Am. J. Hum. Genet. 67:814–821, 2000

814

A Novel Nemaline Myopathy in the Amish Caused by a Mutation in
Troponin T1
Jennifer J. Johnston,1 Richard I. Kelley,5,7 Thomas O. Crawford,6 D. Holmes Morton,7
Richa Agarwala,3 Thorsten Koch,8 Alejandro A. Schäffer,4 Clair A. Francomano,1 and
Leslie G. Biesecker2

1Medical Genetics Branch and 2Genetic Disease Research Branch, National Human Genome Research Institute, 3Information Engineering
Branch, and 4Computational Biology Branch, National Center for Biotechnology Information, National Institutes of Health, Bethesda;
5Kennedy Krieger Institute and Department of Pediatrics and 6Department of Neurology and Pediatrics, Johns Hopkins University, Baltimore;
7The Clinic for Special Children, Strasburg, PA; and 8Konrad-Zuse-Zentrum für Informationstechnik, Berlin

The nemaline myopathies are characterized by weakness and eosinophilic, rodlike (nemaline) inclusions in muscle
fibers. Amish nemaline myopathy is a form of nemaline myopathy common among the Old Order Amish. In the
first months of life, affected infants have tremors with hypotonia and mild contractures of the shoulders and hips.
Progressive worsening of the proximal contractures, weakness, and a pectus carinatum deformity develop before
the children die of respiratory insufficiency, usually in the second year. The disorder has an incidence of ∼1 in 500
among the Amish, and it is inherited in an autosomal recessive pattern. Using a genealogy database, automated
pedigree software, and linkage analysis of DNA samples from four sibships, we identified an ∼2-cM interval on
chromosome 19q13.4 that was homozygous in all affected individuals. The gene for the sarcomeric thin-filament
protein, slow skeletal muscle troponin T (TNNT1), maps to this interval and was sequenced. We identified a stop
codon in exon 11, predicted to truncate the protein at amino acid 179, which segregates with the disease. We
conclude that Amish nemaline myopathy is a distinct, heritable, myopathic disorder caused by a mutation in TNNT1.

Introduction

The nemaline myopathies (NM [MIM 256030, 161800])
are neuromuscular disorders characterized by muscle
weakness and rod-shaped “nemaline” inclusions in skel-
etal muscle fibers (North et al. 1997). NM has been di-
vided into three clinical subtypes—severe neonatal, mild
congenital, and adult-onset—varying in their age at onset,
rate of progression, and other associated features. Child-
hood forms of nemaline myopathy segregate in either an
autosomal recessive or an autosomal dominant pattern.
Mutations in genes encoding three sarcomeric proteins,
including nebulin (NEB [MIM 161650]) (Pelin et al.
1999), a-tropomyosin (TPM3 [MIM 191030]) (Laing et
al. 1995; Tan et al. 1999), and a-actin (ACTA1 [MIM
102610]) (Nowak et al. 1999), have been shown to cause
different forms of hereditary NM. Since 1988, we have
treated or obtained clinical information on 71 infants and
young children from 33 nuclear families with an appar-
ently unique form of NM, which we call Amish nemaline
myopathy (ANM), among the Old Order Amish of Lan-
caster County, Pennsylvania. The purpose of this study

Received June 5, 2000; accepted for publication August 2, 2000;
electronically published August 21, 2000.

Address for correspondence and reprints: Dr. Jennifer J. Johnston,
Rm. 3D-45, Bldg. 10, 10 Center Drive, National Institutes of Health,
Bethesda, MD 20892-1267. E-mail: jjohnsto@nhgri.nih.gov

q 2000 by The American Society of Human Genetics. All rights reserved.
0002-9297/2000/6704-0006$02.00

was to characterize the genetics of the ANM phenotype
and to determine the molecular cause of the disorder.

Subjects and Methods

Subjects

We collected information on the mode of presentation,
clinical manifestations, affection status of first-degree
relatives, age at death, and the genetic relationships of
33 nuclear families having a child affected by ANM in
the Old Order Amish genealogy. Four nuclear families
with ANM, chosen on the basis of accessibility, under-
went phlebotomy and were included in the genotyping
for the whole-genome scan. All participants in the latter
four families were evaluated clinically by one or more
of the authors of the present article, and affection status
was ascertained before the study was initiated. Clinical
data on children from other families were obtained from
clinic reports, through home visits, or by history from
the families ascertained by community outreach at the
Clinic for Special Children. The study was reviewed and
approved by institutional review boards of the National
Institutes of Health and Johns Hopkins University.

Pedigree Analysis

Because manual genealogy analysis and pedigree
drawing are error prone, we used the Amish Genealogy
Database version 2.0 (Agarwala et al. 1999) and the



Johnston et al.: TNNT1 Gene Mutation in Nemaline Myopathy 815

associated software, PedHunter (Agarwala et al. 1998),
to connect the 33 nuclear families with an affected child
into “all-shortest-paths” pedigrees. All 33 known fam-
ilies were used for the pedigree analysis, to increase the
likelihood of finding the true inheritance path of the
mutant allele. We found four all-shortest-paths pedigrees
with different founder couples at the top. Each all-short-
est-paths pedigree connects the same 65 of 66 obligate
carrier parents back to a founder couple, one of whom
may have been a carrier. We then formulated a Steiner
tree problem to extract a minimal pedigree (also called
a “Steiner” pedigree) that has the smallest number of
meioses needed to provide one path of inheritance from
the founder couple down to each carrier parent (Agar-
wala et al. 1998). We used the sophisticated branch-and-
cut–based Steiner tree software of Koch and Martin
(1998) to solve to optimality all four instances corre-
sponding to the different all-shortest-paths pedigrees.
From the four possible solutions, we chose the one with
the smallest number of individuals. For genetic linkage
analyses, the subpedigree of the chosen Steiner pedigree
was pruned, removing 29 families and leaving the four
sampled nuclear families, their ancestors, and any par-
ent-child links among their ancestors used in the full
Steiner pedigree.

Genotyping

Human genomic DNA was isolated from Epstein-Barr
virus–immortalized lymphoblastoid lines or fibroblast
cell lines, using Puregene DNA isolation kits (Gentra-
Systems). Polymorphic microsatellite markers from the
ABI PRISM linkage mapping set, version 2, were used
for genotyping. Additional markers were identified from
genetic maps and were used in fine mapping. These ad-
ditional markers were ordered as labeled map pairs (Re-
search Genetics) or as custom-labeled oligonucleotides
(Life Technologies). For initial homozygosity mapping,
three pools of genomic DNA were created, representing
parents, unaffected siblings, and affected siblings. All
genotyping reactions were performed using the standard
protocol from PE Biosystems, with individual reaction
components and a reduced reaction volume of 10 ml.
PCR products were pooled according to supplied pro-
tocols and were loaded on an ABI 377 automated se-
quencer (filter set D: 5% LongRanger acrylamide gel
[FMC Bioproducts]), and the data were analyzed using
ABI GeneScan 3.1 and ABI Genotyper 2.1 software (PE
Biosystems).

Linkage Analysis

The genetic linkage analyses were performed using the
FASTLINK software package, version 4.1P (Lathrop et
al. 1984; Cottingham et al. 1993; Schäffer et al. 1994).
Loops were broken using the method of Becker et al.
(1998). Some multipoint runs were done in parallel

(Gupta et al. 1995), using a shared-memory computer
and the p4 parallel programming system (Butler and
Lusk 1994). In the initial genome scan, we used only
four of the five loops (three of the four families) and did
two-point analyses on each marker, using equal allele
frequencies. For the linkage results shown on chromo-
some 19, we used all five loops (four families). We used
equal allele frequencies in the calculations, because the
sample size is sufficiently small and biased toward af-
fected individuals and their parents to preclude reason-
able estimates of allele frequencies. In all analyses, we
assumed that ANM is a fully penetrant phenotype in-
herited in an autosomal recessive pattern, with a disease
allele frequency of .03. This allele frequency was used
to increase the effectiveness of homozygosity mapping,
reducing the probability that another allele would be
introduced into the pedigree. For comparison purposes,
the multipoint linkage was also calculated using an allele
frequency of .045 (square root of disease frequency). The
Genethon map of the chromosome 19 markers that ul-
timately proved to be the correct region (numbers in
parentheses are the genetic map position [in cM]) is
D19S571 (87.7)–D19S572 (93.4)–D19S924 (∼94)–
D19S927 (94.7)–D19S418 (97.5)–[D19S926, D19S880
(99.6)]–D19S877 (100.1)–D19S210 (105). Analysis with
BLAST searches (Altschul et al. 1997) of the sequence-
tagged-site content of bacterial artificial chromosomes
(BACs), with GenBank accession numbers AC019238
and AC0011476, showed that they both contain
D19S418 and D19S926 but not D19S880, supporting the
order of markers shown.

Sequence Analysis

The coding exons of TNNT1, including the flanking
intron sequence, were amplified from genomic DNA
from an affected individual, an obligate carrier, and
a control. Genomic DNA (50 ng) was amplified in a
50-ml PCR reaction containing 50 pmol each of for-
ward and reverse primer, 1.25 units AmpliTaq DNA
polymerase (Perkin-Elmer), and 0.2 mM dNTP mix
(Pharmacia Biotech). The PCR reaction buffers and
annealing temperatures were oligonucleotide-pair spe-
cific. Reactions for primer pair 5F/6R contained 10
mM Tris-HCl pH 8.3, 50 mM KCl, and 1.5 mM
MgCl2, with an annealing temperature of 677C. Re-
actions for 1F/5R, 6F/7R, 7F/9R2, and 11F/14R con-
tained 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM
MgSO4, and 1# PCR enhancer (Life Technologies),
with an annealing temperature of 607C; reactions for
9F/11R were run under identical conditions to 1F/5R,
except for the addition of 2X PCR enhancer. Initial
denaturation for all sets was 3 min at 947C, followed
by 34 cycles of 15 s at 947C, 15 s at the appropriate
annealing temperature, 2 min at 727C, and a final
extension for 7 min at 727C. Using oligonucleotides



816 Am. J. Hum. Genet. 67:814–821, 2000

Figure 1 Pedigree used for the whole-genome–scan linkage analysis. The pedigree consisted of four nuclear families, which included six
affected patients. These four families are connected in a single subpedigree with five loops. The full pedigree was generated computationally
from an Old Order Amish genealogy database and represents a portion of the simplest pedigree that connects 33 affected nuclear families to
a putative founder couple who were born in the first half of the 18th century.

Figure 2 Haplotype analysis of affected persons. To determine
the locus boundaries using an analysis of recombinants of affected
individuals only, marker D19S927 provides the centromeric boundary
and marker D19S880 provides the telomeric boundary. The pedigree
designations refer to the generation number in Roman numerals from
the pedigree; the individual number is Arabic, numbered from left to
right. The allele numbers are the standard CEPH alleles, and “m”
signifies the mutant TNNT1 allele.

10F/11R, exon 11 was amplified from genomic DNA
in 136 control individuals and 13 additional family
members with ANM. Reactions were run under iden-
tical conditions to 1F/5R, except for the absence of
PCR enhancer. PCR products were purified and se-
quenced as described elsewhere (Johnston et al. 1997).
Primer sequences named for the TNNT1 introns from
which they are derived are listed in the Appendix.

Results

Phenotype Analysis

All neonates with ANM have tremors that are evident
at birth or within a few days of birth and that involve
most skeletal muscle groups, especially the muscles of the
jaw and lower limbs. These tremors subside over the first
2–3 mo of life. Mild proximal contractures present at
birth gradually worsen with age, such that hip abduction
is often limited to <107 by age 12 mo. Progressive muscle
atrophy and weakness develop simultaneously with the
contractures. Gross motor development is limited to roll-
ing side to side, but forearm and hand function is normal,
as is apparent intelligence. A characteristic, severe pectus
carinatum deformity, with rigidity of the chest wall, de-
velops along with the proximal contractures. The neu-
romuscular examinations of parents and normally devel-
oping siblings are unremarkable. However, several
siblings with normal outcomes have had abnormal trem-

ors both in utero and for several weeks after birth. The
neurological examinations and, in one case, tests for hy-
poglycemia and hypocalcemia, were otherwise normal in
these siblings. These findings suggest the presence of a
subtle carrier effect, but persons with this effect have been
considered unaffected, and we have not included samples
from any of these individuals in our study.

All routine laboratory chemistries and metabolic stud-
ies have been normal in affected patients. Although there
often are terminal signs of right-side congestive heart
failure, there is no evidence of primary cardiac involve-
ment, and one patient who was studied at age 21 mo



Johnston et al.: TNNT1 Gene Mutation in Nemaline Myopathy 817

Table 1

Two-Point LOD Scores for NM Phenotype and Markers on
Chromosome 19

MARKER

LOD SCOREa AT v p

.0 .01 .03 .05 .07 .1

D19S572 2` 2.17 .20 .32 .36 .36
D19S924 1.35 1.31 1.21 1.12 1.03 .90
D19S927 2` 21.82 2.94 2.57 2.35 2.15
D19S418 2.11 1.98 1.74 1.53 1.33 1.08
D19S926 2.08 1.96 1.72 1.50 1.30 1.05
D19S880 1.96 1.87 1.69 1.53 1.37 1.16
D19S605 .56 .56 .54 .51 .47 .40
D19S877 2.05 1.96 1.77 1.60 1.43 1.21
D19S210 2` 2.46 2.06 .10 .17 .23

a The five-loop version of the pedigree was used for these cal-
culations. Recombination fractions are shown only up to .1, be-
cause the markers are very close to each other and we expect the
disease gene to be close to these markers.

Figure 3 Three-point linkage analysis using two chromosome
19 genetic markers. Calculations were done using disease allele fre-
quencies of .03 and .045.

had a normal electrocardiogram and echocardiogram.
Four children in their first year had quadriceps muscle
biopsies with both light and electron microscopic ex-
aminations. Light microscopy showed prominent type I
fiber disproportion, Z-band streaming, and abundant
centrally placed refractile rods, as well as areas of my-
ofibrillar disruption and myofiber degeneration (data not
shown).

Pedigree and Linkage Analysis

The affected families included 33 nuclear families with
one or more children affected with ANM. These families
included 33 probands, with a total of 71 affected chil-
dren and 143 unaffected siblings. The Steiner pedigree
used for genetic linkage analysis is shown in figure 1.
Prior to performing the full genomewide scan, we used
linkage analysis to exclude the gene for NEB as a can-
didate for this disorder (Johnston et al. 1999). In ad-
dition, we performed a homozygosity screen using mark-
ers from the ABI linkage set surrounding candidate genes
for a-tropomyosin and troponin T1, among others. The
region on chromosome 19 surrounding the gene for tro-
ponin T1 was followed up with additional markers, but
the data were not sufficiently convincing (see below). In
our analyses of the genome scan data, six regions merited
higher resolution genotyping because they had either a
marker with a two-point LOD score 11.5 or two ad-
jacent markers with scores 11.0. Of these six regions,
only the chromosome 19 region, containing TNNT1,
had a marker with a two-point LOD score 12.0 and a
multipoint LOD score 13.0. We found the two highest-
scoring adjacent markers—D19S418 and D19S926—to
be the only markers in the study that are homozygous
for the same allele in all six genotyped affected individ-
uals. However, both markers are also homozygous for
the disease-associated allele in two of the eight obligate

carrier parents. Haplotypes of affected individuals are
shown in figure 2. Two-point LOD scores are shown in
table 1. A three-point LOD score curve using markers
D19S418, D19S926, and disease is shown in figure 3;
the peak LOD score using a disease allele frequency of
.03 is 5.41, and the peak LOD score using a disease
allele frequency of .045 is 4.38. These values are con-
sistent (to the third significant digit) throughout the in-
terval D19S418–D19S926. This region of homozygosity
was considered inconclusive on the original candidate
linkage analysis. In retrospect, that assessment can be
attributed to the small region of homozygosity (∼2 cM),
a double crossover in one nuclear family, and dearth of
informative markers in the region. These data strongly
support the hypothesis that ANM is inherited in an au-
tosomal recessive pattern and is linked to the chromo-
some 19 region containing the gene TNNT1, suggested
by others to be a candidate for NM (Laing 1995).

Mutation Analysis of TNNT1

Because troponin T (TnT) is a sarcomeric protein, we
considered TNNT1 to be a candidate for the ANM dis-
ease gene and sequenced the coding region, including
the intron/exon borders, in one affected individual, an
obligate carrier, and a control. A homozygous nonsense
mutation was present in the DNA from the affected in-
dividual in exon 11, G579T (Genbank entry S69208),
resulting in a stop codon E180X (fig. 4). Although
TNNT1 transcripts undergo alternative splicing of exons
5 and 12, producing up to four isoforms (Samson et al.
1994), exon 11 is present in all known splice products.
The change was present in a heterozygous state in the



818 Am. J. Hum. Genet. 67:814–821, 2000

Figure 4 Sequence traces of exon 11 of the TNNT1 gene in an unaffected control, a carrier parent, and an affected patient. The carrier
is heterozygous for the G579T substitution, and the affected individual is homozygous for this change. The nucleotide and predicted amino
acid sequence is shown above the traces, with the stop codon labeled by an asterisk (*).

obligate carrier and absent from the control sample. All
15 available samples from the full pedigree were ana-
lyzed by sequencing, and the mutation was found to
segregate with the disease state. The mutation was not
found in 200 non-Amish control chromosomes nor in
72 chromosomes from Amish individuals drawn from
nuclear families unaffected by ANM. Because genetic
control samples must be acquired from unrelated indi-
viduals, it is impossible to gather true Amish controls,
since all Amish persons are related.

Discussion

ANM is a distinct form of NM that segregates in an
autosomal recessive pattern. With the identification of
a mutation in TNNT1 (gene encoding slow skeletal
muscle TnT), it becomes the fourth form of NM to be
associated with an abnormality of a protein component
of the thin filament of the sarcomere. Nemaline bodies,
the hallmark of NM, are histochemically and ultra-
structurally similar to the Z disk of the sarcomere and
are often found in physical continuity with the Z disk
in NM. It is notable, therefore, that all four of the genes
associated with NM code for protein components in-
tegral to the thin filament rather than protein com-
ponents found solely in the Z disk. However, one of
the gene products responsible for NM—nebulin—is
thought to be an important regulator of the assembly
and organization of the Z disk (Pelin et al. 1999). The
other three gene products associated with NM—a-actin
(Nowak et al. 1999), a-tropomyosin (Laing et al. 1995;
Tan et al. 1999) and, with this article, slow skeletal
TnT—interact with one another and ultimately regu-
late the development of muscle contraction. Like the
more heterogeneous adult forms of NM, the prolifer-
ation of nemaline bodies in each of these latter three
disorders may be a secondary consequence of abnormal

regulation of force within the sarcomere (North et al.
1997; Michele et al. 1999).

The mapping of this phenotype was facilitated by the
structure of the Amish population. The Old Order
Amish are a genetic isolate with a high rate of consan-
guinity and multiple disorders with proved or apparent
founder effects. The Old Order Amish trace their an-
cestry to 50–100 European immigrants of the mid to
late 1700s. In the Amish Genealogy Database, version
2.0, the average inbreeding coefficient is .0187 (Agar-
wala et al. 1999). The genetic origins of this population
and their strict endogamy predispose them to manifest
rare disorders that are inherited in an autosomal reces-
sive pattern. These same genetic and demographic fea-
tures of the Old Order Amish advance the identification
of rare disease-causing genes that are found within this
group. The technique of whole-genome linkage analysis
via identification of regions of homozygosity among af-
fected individuals is particularly suited to this popula-
tion (McKusick 2000) and was a productive approach
in this instance to map, clone, and identify a nonsense
mutation in TNNT1, coding for slow skeletal TnT as
the cause of AMN.

The identified mutation of TNNT1 predicts a trun-
cation of the TnT protein at amino acid 180, removing
the C-terminal 83 amino acids that include the principal
site of interaction with the other two components of
the troponin complex, troponin I (TnI) and troponin C
(TnC). In addition, a second site of interaction with
tropomyosin, which is dependent on Ca11 concentra-
tion, is also in the deleted part of the protein. The re-
maining N-terminal portion of TnT forms the whole of
the troponin tail region, which anchors the complex to
tropomyosin. A schematic diagram of these interactions
is shown in figure 5 (Cohen 1975; Flicker et al. 1982).
There are at least three potential consequences of this
mutation: the mutant message may be subject to accel-



Johnston et al.: TNNT1 Gene Mutation in Nemaline Myopathy 819

Figure 5 Thin filament structure showing troponin complex,
tropomyosin, and actin. TnC, TnI, and the C-terminal portion of TnT
bind near Cys190 of tropomyosin. The N-terminal portion of TnT
extends along the C-terminal half of tropomyosin. The predicted trun-
cation in ANM would delete a part of the C-terminal end of the TnT
molecule that interacts with TnI, TnC, and tropomyosin.

erated nonsense-mediated decay (Maquat 1995), the
protein may be unstable or improperly localized, or the
truncated protein may be translated in normal abun-
dance and appropriately bound to tropomyosin in the
thin filament but deficient in the ability to interact prop-
erly with TnI and TnC. We speculate that the recessive
inheritance pattern in ANM may be indicative of ac-
celerated nonsense-mediated decay or protein instabil-
ity, compared with the dominant inheritance pattern
seen in the family with NM segregating a missense mu-
tation in TPM3 (Laing et al. 1995) and the families
segregating missense mutations for ACTA1 (Nowak et
al. 1999). Production of aberrant sarcomeric proteins
may be less well tolerated than haploinsufficiency of
these same proteins.

In any of these cases, this abnormality of TnT is likely
to disturb the coupling of excitation to contraction
within muscle fibers. At rest, and with low concentra-
tions of Ca11, TnI interacts with a-actin and a-tropo-
myosin to block the ATPase of actomyosin and thus
inhibit contraction. With muscle fiber depolarization,
Ca11 released from the sarcoplasmic reticulum is bound
to TnC, and in the presence of TnT, a conformational
change of the complex releases the inhibitory effect of
TnI upon actomyosin.

Hypertrophic cardiomyopathy (HCM), like NM,
has been associated with mutations of protein com-
ponents of the thin filament of the sarcomere, in-
cluding cardiac TnT (Laing 1995). A variety of de-
letion, splice site, and missense mutations in the gene
for cardiac TnT (TNNT2) cause familial HCM (Perry
1998). A splice-site mutation in intron 16 of TNNT2,
seen in one individual with familial HCM, is pre-
dicted to lead to production of a truncated protein.
Transfection of this mutation into a quail myotube

expression system resulted in disorganized myofibrils
and a greatly diminished Ca11-activated force of con-
traction (Watkins et al. 1996; Perry 1998), indicating
that expression of a truncated cardiac TnT may have
a dominant negative effect on muscle. We hypothesize
that mutations in TNNT1 manifest in an autosomal
recessive pattern, whereas TNNT2 mutations segre-
gate in an autosomal dominant pattern, because skel-
etal and cardiac muscle may have different pheno-
typic thresholds.

It is interesting to note that mutations in the Cae-
norhabditis elegans TnT (mup-2) gene lead to myocyte
dysfunction suggestive of the phenotype seen in ANM.
The recessive inheritance pattern of human TNNT1 mu-
tations is consistent with that seen in the C. elegans
mutants (both truncation and null mutants). Worms ho-
mozygous for either a null allele or an amino terminal
truncation mutation of mup-2 show a phenotype with
apparent hypercontraction and ultimate detachment of
body wall muscles (Myers et al. 1996). Prior to de-
tachment, the embryos show uncoordinated, slow
twitching, rather than the vigorous rolling typical of
wild-type embryos. Mutations affecting voltage-depen-
dent muscle Ca11 release, TnC, or sarcomere assembly
are epistatic to mup-2, which suggests that the mup-2
phenotype is not due to sustained Ca11-independent
contraction but is caused by aberrant regulation of con-
traction (McArdle et al. 1998).

In vitro studies of human fast skeletal TnT show that
truncated TnT protein does not bind TnI/TnC as effi-
ciently as wild-type TnT (Jha et al. 1996). The authors
propose that, in the absence of TnT tethering TnI/TnC
to tropomyosin, inhibition of contraction is not estab-
lished normally after contraction, leading to the phe-
notypic twitching and ultimate muscle detachment.
Although we have treated ANM patients with myo-
tonia-limiting drugs, such as carbamazepine and mex-
ilitene, in an attempt to limit the progression of the chest
deformity and associated respiratory insufficiency, such
treatments have had minimal benefit. Further under-
standing of the cellular pathogenesis of ANM and study
of the identified mutation in potential animal models
should stimulate research into effective treatments for
this relentlessly progressive disorder.

Acknowledgments

We wish to thank Ralph Kuncl for identification of nemaline
myopathy in biopsy specimens. We would also like to thank
Joie Davis for her contribution to the fieldwork.



820 Am. J. Hum. Genet. 67:814–821, 2000

Appendix

Primer Sequences
1F TCCCTAAGACCCAGGAATCCG
4F CGGTCCTCTAACAGCCTCTCACG
5R2 GGCTTAAAGGACCGGGCCTGG
5F TGACCCTCTTCCTCCTTTACAGC
6R TCTGCCTTTCTCACACCTTGTCTC
6F CTACCTCACTGGACGGCACATC
7R GCCTCGTGTTTGACACTAATCAGC
7F GCTGATTAGTGTCAAACACGAGGC
9R2 GGCATCCGGCTGAAGAAGTAAC
9F TGCGTTTCTGCTGGTTCTGATG
10R CTCAGCCCCTCCTCCGTTAGG
10F CTGTGGTCCCAACATGGAAATGG
11R CCTTTATCCCCCTGTCTCACACC
11F TGAACAAAATGGTGCCGACAAC
13R ACCCAGGATTCCGAGAGCAGAG
13F TGCTTCCTTTGGGCAGGGAG
14R ACATCCAGGAGGGGAACTGC

Electronic-Database Information

Accession numbers and URLs for data in this article are as
follows:

GenBank, http://www.ncbi.nlm.nih.gov/Genbank/index.html
(for BAC clones AC019238 and AC0011476 and for
TNNT1 sequence S69208)

Généthon, ftp://ftp.genethon.fr/pub/Gmap/Nature-1995/data/
data_chrom19 (for microsatellite markers from the chro-
mosome 19 region)

Online Mendelian Inheritance in Man (OMIM), http://www
.ncbi.nlm.nih.gov/Omim/ (for NM [MIM 256030, 161800],
NEB [MIM 161650], TPM3 [MIM 191030], and ACTA1
[MIM 102610])

References

Agarwala R, Biesecker LG, Hopkins KA, Francomano CA,
Schäffer AA (1998) Software for constructing and verifying
pedigrees within large genealogies and an application to the
Old Order Amish of Lancaster County. Genome Res 8:211–
221

Agarwala R, Biesecker LG, Tomlin JF, Schäffer AA (1999)
Towards a complete North American Anabaptist genealogy:
a systematic approach to merging partially overlapping ge-
nealogy resources. Am J Med Genet 86:156–161

Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z,
Miller W, Lipman DJ (1997) Gapped BLAST and PSI-
BLAST: a new generation of protein database search pro-
grams. Nucleic Acids Res 25:3389–3402

Becker A, Geiger D, Schäffer AA (1998) Automatic selection
of loop breakers for genetic linkage analysis. Hum Hered
48:49–60

Butler R, Lusk E (1994) The p4 parallel programming system.
Parallel Computing 20:547–564

Cohen C (1975) The protein switch of muscle contraction. Sci
Am 233:36–45

Cottingham RW Jr, Idury RM, Schäffer AA (1993) Faster se-
quential genetic linkage computations. Am J Hum Genet 53:
252–263

Flicker PF, Phillips GN Jr, Cohen C (1982) Troponin and its
interactions with tropomyosin: an electron microscope
study. J Mol Biol 162:495–501

Gupta SK, Schäffer AA, Cox AL, Dwarkadas S, Zwaenepoel
W (1995) Integrating parallelization strategies for linkage
analysis. Comput Biomed Res 28:116–139

Jha PK, Leavis PC, Sarkar S (1996) Interaction of deletion
mutants of troponins I and T: COOH-terminal truncation
of troponin T abolishes troponin I binding and reduces
Ca21 sensitivity of the reconstituted regulatory system. Bio-
chemistry 35:16573–16580

Johnston J, Kelley RI, Feigenbaum A, Cox GF, Iyer GS, Fun-
anage VL, Proujansky R (1997) Mutation characterization
and genotype-phenotype correlation in Barth syndrome. Am
J Hum Genet 61:1053–1058

Johnston JJ, Kelley RI, Morton DH, Crawford TO, Biesecker
LG, Francomano CA (1999) Haplotype analysis of markers
on chromosome 2q21.2-q22 in nemaline myopathy in the
Amish: Evidence for genetic heterogeneity. Am J Hum Genet
65:A256

Koch T, Martin A (1998) Solving Steiner tree problems in
graphs to optimality. Networks 32:207–232

Laing NG (1995) Inherited disorders of contractile proteins in
skeletal and cardiac muscle. Curr Opin Neurol 8:391–396

Laing NG, Wilton SD, Akkari PA, Dorosz S, Boundy K, Knee-
bone C, Blumbergs P, White S, Watkins H, Love DR, et al
(1995) A mutation in the a-tropomyosin gene TPM3 asso-
ciated with autosomal dominant nemaline myopathy. Nat
Genet 9:75–79

Lathrop GM, Lalouel J-M, Julier C, Ott J (1984) Strategies
for multilocus linkage analysis in humans. Proc Natl Acad
Sci USA 81:3443–3446

Maquat L (1995) When cells stop making sense: effects of
nonsense codons on RNA metabolism in vertebrate cells.
RNA 1:453–465

McArdle K, Allen TS, Bucher EA (1998) Ca21-dependent
muscle dysfunction caused by mutation of the Caenorhab-
ditis elegans troponin T-1 gene. J Cell Biol 143:1201–1213

McKusick VA (2000) Ellis-van Creveld syndrome and the
Amish. Nat Genet 24:203–204

Michele DE, Albayya FP, Metzger JM (1999) A nemaline my-
opathy mutation in alpha-tropomyosin causes defective reg-
ulation of striated muscle force production. J Clin Invest
104:1575–1581

Myers CD, Goh PY, Allen TS, Bucher EA, Bogaert T (1996)
Developmental genetic analysis of troponin T mutations in
striated and nonstriated muscle cells of Caenorhabditis ele-
gans. J Cell Biol 132:1061–1077

North KN, Laing NG, Wallgren-Pettersson C, The ENMC In-
ternational Consortium on Nemaline Myopathy (1997)
Nemaline myopathy: current concepts. J Med Genet 34:
705–713

Nowak KJ, Wattanasirichaigoon D, Goebel HH, Wilce M,
Pelin K, Donner K, Jacob RL, Hubner C, Oexle K, Anderson
JR, Verity CM, North KN, Iannaccone ST, Muller CR,



Johnston et al.: TNNT1 Gene Mutation in Nemaline Myopathy 821

Nurnberg P, Muntoni F, Sewry C, Hughes I, Sutphen R,
Lacson AG, Swoboda KJ, Vigneron J, Wallgren-Pettersson
C, Beggs AH, Laing NG (1999) Mutations in the skeletal
muscle alpha-actin gene in patients with actin myopathy and
nemaline myopathy. Nat Genet 23:208–212

Pelin K, Hilpelä P, Donner K, Sewry C, Akkari PA, Wilton SD,
Wattanasirichaigoon D, Bang ML, Centner T, Hanefeld F,
Odent S, Fardeau M, Urtizberea JA, Muntoni F, Dubowitz
V, Beggs AH, Laing NG, Labeit S, de la Chapelle A, Wall-
gren-Pettersson C (1999) Mutations in the nebulin gene as-
sociated with autosomal recessive nemaline myopathy. Proc
Natl Acad Sci USA 96:2305–2310

Perry SV (1998) Troponin T: genetics, properties and function.
J Muscle Res Cell Motil 19:575–602

Samson F, Mesnard L, Mihovilovic M, Potter TG, Mercadier
JJ, Roses AD, Gilbert JR (1994) A new human slow skeletal

troponin T (TnTs) mRNA isoform derived from alternative
splicing of a single gene. Biochem Biophys Res Commun
199:841–847

Schäffer AA, Gupta SK, Shriram K, Cottingham RW Jr (1994)
Avoiding recomputation in linkage analysis. Hum Hered 44:
225–237

Tan P, Briner J, Boltshauser E, Davis MR, Wilton SD, North
K, Wallgren-Pettersson C, Laing NG (1999) Homozygosity
for a nonsense mutation in the a-tropomyosin slow gene
TPM3 in a patient with severe infantile nemaline myopathy.
Neuromuscul Disord 9:573–579

Watkins H, Seidman CE, Seidman JG, Feng HS, Sweeney HL
(1996) Expression and functional assessment of a truncated
cardiac troponin T that causes hypertrophic cardiomyo-
pathy: evidence for a dominant negative action. J Clin Invest
98:2456–2461