id	sid	tid	token	lemma	pos
work_lg7uwni46nhjxg5pc3yrqf32wy	1	1	Remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	1	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	1	3	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	1	4	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	1	5	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	1	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	1	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	1	8	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	1	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	1	10	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	1	11	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	1	12	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	1	13	et	et	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	1	14	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	1	15	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	2	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	2	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	2	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	2	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	3	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	3	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	3	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	3	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	7	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	3	8	24	24	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	3	9	November	November	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	10	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	3	11	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	3	12	RESEARCH	research	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	3	13	Open	Open	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	14	Access	access	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	15	Remobilization	Remobilization	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	17	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	3	18	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	19	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	3	20	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	3	22	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	23	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	24	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	25	tropicalis	tropicalis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	26	Donald	Donald	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	27	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	28	Yergeau1	Yergeau1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	29	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	3	30	Clair	Clair	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	31	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	32	Kelley1	Kelley1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	3	34	Emin	Emin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	35	Kuliyev1	Kuliyev1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	3	37	Haiqing	Haiqing	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	38	Zhu1	Zhu1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	39	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	3	40	Michelle	Michelle	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	41	R	R	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	42	Johnson	Johnson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	43	Hamlet1	Hamlet1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	44	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	3	45	Amy	Amy	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	46	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	47	Sater2	Sater2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	48	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	3	49	Dan	Dan	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	50	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	51	Wells2	Wells2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	52	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	3	53	Paul	Paul	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	54	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	55	Mead1	mead1	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	56	*	*	NFP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	57	Abstract	Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	58	Background	Background	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	59	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	3	60	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	3	61	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	62	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	63	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	3	64	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	65	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	3	66	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	67	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	68	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	3	69	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	70	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	71	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	72	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	73	transgenesis	transgenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	74	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	75	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	3	76	diploid	diploid	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	3	77	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	3	78	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	3	79	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	80	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	3	81	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	4	1	Injecting	inject	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	4	2	one	one	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	4	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	4	4	cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	5	embryos	embryo	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	4	6	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	7	plasmid	plasmid	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	4	8	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	4	9	harboring	harbor	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	4	10	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	4	11	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	4	12	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	13	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	14	together	together	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	4	15	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	16	mRNA	mRNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	4	17	encoding	encode	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	4	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	4	19	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	4	20	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	21	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	4	22	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	4	23	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	24	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	4	25	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	4	26	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	4	27	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	28	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	29	small	small	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	4	30	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	4	31	order	order	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	32	concatemers	concatemer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	4	33	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	4	34	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	4	35	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	4	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	5	1	Here	here	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	5	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	5	3	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	5	4	demonstrate	demonstrate	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	5	5	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	5	6	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	5	7	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	5	8	stably	stably	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	5	9	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	5	10	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	5	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	5	12	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	5	13	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	5	14	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	5	15	effective	effective	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	5	16	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	5	17	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	5	18	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	5	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	6	1	Results	result	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	6	2	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	6	3	Transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	6	4	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	6	5	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	6	6	express	express	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	6	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	6	8	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	6	9	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	6	10	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	6	11	bred	breed	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	6	12	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	6	13	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	6	14	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	6	15	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	6	16	harboring	harbor	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	6	17	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	6	18	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	6	19	yield	yield	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	6	20	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	6	21	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	6	22	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	6	23	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	6	24	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	6	25	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	6	26	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	6	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	7	1	Remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	2	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	7	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	7	4	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	5	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	7	7	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	8	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	7	10	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	11	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	7	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	7	13	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	7	14	verified	verify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	15	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	16	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	7	17	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	18	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	7	20	cloning	clone	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	7	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	7	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	7	23	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	7	24	integrations	integration	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	7	25	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	7	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	8	1	Unlike	unlike	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	8	3	co	co	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	4	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	5	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	6	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	7	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	8	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	8	9	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	8	10	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	11	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	8	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	8	13	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	8	14	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	15	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	8	16	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	17	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	8	18	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	8	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	8	21	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	8	22	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	8	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	9	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	9	2	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	3	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	9	4	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	9	5	frequently	frequently	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	9	6	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	7	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	9	9	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	9	12	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	13	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	14	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	9	15	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	9	16	80	80	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	9	17	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	18	re	re	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	9	19	-	-	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	20	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	21	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	22	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	9	23	Mb	Mb	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	9	24	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	25	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	9	26	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	27	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	28	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	9	29	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	9	30	phenomenon	phenomenon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	31	known	know	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	32	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	33	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	9	34	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	9	35	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	9	36	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	9	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	10	1	Conclusions	conclusion	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	10	2	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	10	3	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	4	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	10	5	study	study	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	10	7	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	10	8	demonstrate	demonstrate	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	10	9	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	10	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	10	11	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	10	12	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	13	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	10	15	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	10	16	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	10	17	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	10	18	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	10	19	effective	effective	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	10	20	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	10	21	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	22	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	23	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	10	24	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	25	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	26	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	10	28	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	10	29	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	10	31	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	32	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	10	33	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	10	34	transmitted	transmit	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	35	through	through	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	10	37	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	10	38	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	11	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	11	2	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	11	3	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	11	4	important	important	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	11	5	step	step	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	11	8	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	10	large	large	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	11	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	11	12	scale	scale	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	13	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	11	14	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	11	15	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	16	gene-	gene-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	17	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	11	18	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	19	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	11	20	trap	trap	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	21	strategies	strategy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	11	22	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	23	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	11	24	highly	highly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	11	25	tractable	tractable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	11	26	developmental	developmental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	11	27	model	model	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	28	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	11	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	12	1	Background	Background	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	12	2	Amphibian	amphibian	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	12	3	model	model	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	12	4	systems	system	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	12	5	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	12	6	provided	provide	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	12	7	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	12	8	wealth	wealth	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	12	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	12	10	information	information	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	12	11	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	12	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	12	13	molecular	molecular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	12	14	mechanisms	mechanism	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	12	15	controlling	control	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	12	16	early	early	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	12	17	vertebrate	vertebrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	12	18	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	12	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	13	1	Frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	13	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	13	4	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	13	5	genus	genus	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	13	6	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	13	7	particularly	particularly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	13	8	well	well	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	13	9	suited	suited	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	13	10	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	11	embryological	embryological	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	13	12	study	study	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	13	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	14	these	these	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	13	15	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	13	16	adapt	adapt	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	13	17	well	well	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	13	18	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	19	captivity	captivity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	20	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	13	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	13	22	females	female	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	13	23	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	13	24	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	13	25	induced	induce	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	26	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	13	27	lay	lay	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	13	28	large	large	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	13	29	numbers	number	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	13	30	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	31	eggs	egg	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	13	32	throughout	throughout	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	33	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	13	34	year	year	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	13	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	14	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	14	2	most	most	RBS
work_lg7uwni46nhjxg5pc3yrqf32wy	14	3	commonly	commonly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	14	4	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	14	5	amphi-	amphi-	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	14	6	bian	bian	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	14	7	model	model	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	14	8	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	14	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	14	10	South	south	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	14	11	African	african	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	14	12	clawed	claw	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	14	13	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	14	14	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	14	15	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	14	16	laevis	laevi	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	14	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	15	1	Genetic	genetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	15	2	manipulation	manipulation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	4	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	15	5	species	species	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	6	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	15	7	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	15	8	practical	practical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	15	9	due	due	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	10	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	15	12	long	long	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	15	13	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	14	time	time	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	15	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	15	16	>	>	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	15	17	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	15	18	year	year	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	19	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	15	20	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	15	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	15	22	pseudo-	pseudo-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	15	23	tetraploid	tetraploid	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	24	nature	nature	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	25	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	15	27	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	15	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	16	1	Another	another	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	16	2	species	species	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	16	5	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	16	6	genus	genus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	7	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	16	8	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	16	9	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	16	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	16	11	shares	share	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	16	13	embryological	embryological	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	14	advantages	advantage	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	16	15	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	16	its	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	16	17	South	south	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	18	African	african	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	19	cousin	cousin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	20	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	16	21	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	22	better	well	RBR
work_lg7uwni46nhjxg5pc3yrqf32wy	16	23	sui-	sui-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	24	ted	te	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	25	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	26	genetic	genetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	27	studies	study	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	16	28	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	29	it	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	16	30	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	31	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	16	32	true	true	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	33	diploid	diploid	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	34	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	16	35	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	36	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	16	37	relatively	relatively	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	16	38	short	short	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	16	39	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	40	time	time	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	16	41	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	16	42	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	16	43	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	16	44	months	month	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	16	45	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	16	46	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	17	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	17	2	potential	potential	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	4	applying	apply	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	17	5	modern	modern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	17	6	genetics	genetic	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	17	7	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	8	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	17	9	classical	classical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	17	10	embryological	embryological	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	17	11	model	model	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	12	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	13	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	17	14	resulted	result	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	17	17	rapid	rapid	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	17	18	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	20	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	17	21	tools	tool	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	17	22	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	23	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	17	24	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	17	25	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	26	recent	recent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	17	27	years	year	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	17	28	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	17	29	reviewed	review	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	30	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	31	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	17	32	1,2	1,2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	17	33	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	17	34	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	17	35	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	17	36	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	17	37	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	17	38	publication	publication	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	39	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	40	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	17	41	genome	genome	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	17	42	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	17	43	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	17	44	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	17	45	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	17	46	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	18	1	Our	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	18	2	studies	study	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	18	3	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	18	4	focused	focus	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	5	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	6	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	18	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	18	8	class	class	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	9	II	II	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	18	10	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	18	11	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	18	12	cut	cut	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	13	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	18	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	18	15	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	18	16	paste	paste	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	17	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	18	18	transposable	transposable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	18	19	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	18	20	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	18	21	modify	modify	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	18	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	18	23	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	24	genome	genome	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	18	25	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	26	gene-	gene-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	27	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	18	28	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	29	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	18	30	trapping	trapping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	31	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	18	32	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	33	inser-	inser-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	18	34	tional	tional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	18	35	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	18	36	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	18	37	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	18	38	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	18	39	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	18	40	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	18	41	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	19	1	Transposable	transposable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	19	2	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	19	3	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	19	4	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	19	5	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	19	6	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	19	7	many	many	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	19	8	years	year	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	19	9	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	19	10	experimentally	experimentally	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	19	11	modify	modify	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	19	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	19	13	genomes	genome	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	19	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	19	15	plants	plant	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	19	16	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	19	17	invertebrates	invertebrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	19	18	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	19	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	19	20	more	more	RBR
work_lg7uwni46nhjxg5pc3yrqf32wy	19	21	recently	recently	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	19	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	19	23	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	19	24	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	19	25	applied	apply	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	19	26	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	19	27	vertebrate	vertebrate	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	19	28	model	model	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	19	29	systems	system	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	19	30	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	19	31	10,11	10,11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	19	32	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	19	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	20	1	Transgenesis	transgenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	20	2	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	20	3	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	20	4	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	20	5	autonomous	autonomous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	20	6	transposable	transposable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	20	7	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	20	8	offers	offer	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	20	9	advantages	advantage	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	20	10	over	over	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	20	11	other	other	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	20	12	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	20	13	methodologies	methodology	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	20	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	21	1	First	first	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	21	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	21	3	transposable	transposable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	21	4	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	21	5	efficiently	efficiently	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	21	6	integrate	integrate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	21	7	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	21	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	21	9	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	21	10	genomes	genome	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	21	11	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	22	1	Second	second	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	22	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	22	3	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	22	5	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	22	6	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	22	7	excised	excise	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	8	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	22	10	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	11	plasmid	plasmid	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	12	prior	prior	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	22	13	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	14	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	22	16	plasmid	plasmid	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	22	17	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	22	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	22	19	which	which	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	22	20	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	22	21	cause	cause	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	22	22	epigenetic	epigenetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	22	23	silencing	silencing	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	24	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	22	25	12,13	12,13	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	22	26	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	22	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	22	28	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	22	29	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	22	30	inte-	inte-	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	22	31	grated	grate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	32	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	33	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	22	34	targeted	target	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	35	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	22	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	23	1	Third	third	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	23	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	23	3	once	once	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	23	4	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	5	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	23	7	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	8	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	23	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	23	10	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	11	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	12	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	23	13	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	23	14	effective	effective	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	23	15	*	*	NFP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	16	Correspondence	correspondence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	17	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	23	18	paul.mead@stjude.org	paul.mead@stjude.org	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	19	1Department	1department	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	23	20	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	21	Pathology	Pathology	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	23	23	St	St	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	24	Jude	Jude	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	25	Children	Children	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	26	’s	’s	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	23	27	Research	Research	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	28	Hospital	Hospital	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	29	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	23	30	262	262	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	23	31	Danny	Danny	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	32	Thomas	Thomas	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	33	Place	Place	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	34	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	23	35	Memphis	Memphis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	23	37	TN	TN	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	38	38105	38105	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	23	39	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	23	40	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	41	Full	Full	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	42	list	list	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	43	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	44	author	author	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	45	information	information	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	46	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	23	47	available	available	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	23	48	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	49	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	23	50	end	end	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	51	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	52	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	23	53	article	article	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	23	54	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	55	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	23	56	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	23	57	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	24	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	24	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	24	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	24	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	24	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	24	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	24	7	©	©	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	24	8	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	24	9	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	24	10	et	et	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	24	11	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	24	12	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	24	13	licensee	licensee	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	24	14	BioMed	BioMed	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	24	15	Central	Central	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	24	16	Ltd.	Ltd.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	25	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	25	2	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	25	3	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	25	4	Open	open	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	25	5	Access	access	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	6	article	article	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	7	distributed	distribute	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	8	under	under	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	25	10	terms	term	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	25	11	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	25	13	Creative	Creative	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	25	14	Commons	Commons	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	25	15	Attribution	Attribution	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	25	16	License	License	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	25	17	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	25	18	http://creativecommons.org/licenses/by/2.0	http://creativecommons.org/licenses/by/2.0	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	25	19	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	25	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	25	21	which	which	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	25	22	permits	permit	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	25	23	unrestricted	unrestricted	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	25	24	use	use	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	25	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	25	26	distribution	distribution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	25	28	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	25	29	reproduction	reproduction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	30	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	31	any	any	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	25	32	medium	medium	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	25	34	provided	provide	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	25	35	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	25	36	original	original	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	25	37	work	work	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	38	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	25	39	properly	properly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	25	40	cited	cite	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	25	41	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	26	1	mailto:paul.mead@stjude.org	mailto:paul.mead@stjude.org	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	2	http://creativecommons.org/licenses/by/2.0	http://creativecommons.org/licenses/by/2.0	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	26	3	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	4	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	5	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	6	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	26	7	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	8	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	9	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	10	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	26	11	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	12	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	26	13	following	follow	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	26	14	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	15	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	16	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	17	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	26	19	cognate	cognate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	20	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	26	21	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	26	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	27	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	27	2	ability	ability	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	3	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	27	4	remobilize	remobilize	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	27	5	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	27	6	resident	resident	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	27	9	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	10	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	27	11	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	27	12	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	13	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	14	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	27	15	variety	variety	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	17	applications	application	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	27	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	27	19	including	include	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	27	20	large	large	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	27	21	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	27	22	scale	scale	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	23	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	27	24	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	27	25	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	26	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	27	27	screens	screen	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	27	28	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	27	29	gene-	gene-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	30	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	27	31	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	32	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	27	33	trap	trap	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	27	34	constructs	construct	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	27	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	28	1	Remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	28	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	28	3	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	28	4	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	28	5	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	28	6	autonomous	autonomous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	28	7	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	28	8	trans-	trans-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	28	9	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	28	10	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	28	11	achieved	achieve	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	28	12	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	28	13	expressing	express	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	28	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	28	15	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	28	16	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	28	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	28	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	28	19	same	same	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	28	20	cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	28	21	harboring	harbor	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	28	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	28	23	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	28	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	29	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	29	2	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	29	3	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	29	4	achieved	achieve	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	29	5	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	29	6	simply	simply	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	29	7	injecting	inject	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	29	8	fertilized	fertilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	29	9	one	one	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	29	10	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	29	11	cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	29	12	embryos	embryo	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	29	13	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	29	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	29	15	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	29	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	29	17	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	29	18	transgenic	transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	29	19	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	29	20	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	29	21	mRNA	mRNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	29	22	encoding	encode	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	29	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	29	24	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	29	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	30	1	As	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	2	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	3	pro-	pro-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	4	ceeds	ceed	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	30	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	30	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	30	7	injected	inject	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	8	mRNA	mrna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	9	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	30	10	translated	translate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	11	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	30	13	host	host	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	14	cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	30	16	catalyzes	catalyze	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	30	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	30	18	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	30	20	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	21	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	22	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	30	23	reactions	reaction	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	30	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	31	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	31	2	approach	approach	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	31	3	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	31	4	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	31	5	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	31	6	successfully	successfully	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	31	7	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	31	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	31	9	Tol2	Tol2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	31	10	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	31	11	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	31	12	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	31	13	fish	fish	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	31	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	31	15	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	31	16	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	31	17	7,14	7,14	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	31	18	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	31	19	16	16	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	31	20	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	31	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	32	1	Another	another	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	32	2	approach	approach	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	3	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	32	4	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	32	5	develop	develop	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	32	6	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	32	7	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	32	8	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	32	9	express	express	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	32	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	32	11	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	12	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	32	13	under	under	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	32	15	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	17	tissue	tissue	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	18	speci-	speci-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	32	19	fic	fic	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	20	promoters	promoter	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	32	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	32	22	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	32	23	cross	cross	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	32	24	these	these	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	32	25	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	32	26	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	27	those	those	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	32	28	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	32	29	harbor	harbor	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	32	30	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	32	31	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	32	32	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	33	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	32	34	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	32	35	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	32	36	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	32	37	trans-	trans-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	38	genic	genic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	32	39	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	32	40	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	33	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	33	2	approach	approach	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	33	3	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	33	4	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	33	5	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	33	6	very	very	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	33	7	suc-	suc-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	33	8	cessfully	cessfully	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	33	9	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	33	10	somatic	somatic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	33	11	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	33	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	33	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	33	14	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	33	15	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	33	16	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	33	17	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	33	18	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	33	19	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	33	20	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	33	21	identify	identify	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	33	22	cancer	cancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	33	23	genes	gene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	33	24	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	33	25	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	33	26	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	33	27	17,18	17,18	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	33	28	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	33	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	34	1	Outcross	Outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	34	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	34	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	34	4	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	34	5	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	34	6	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	34	7	transpo-	transpo-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	34	8	son	son	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	34	9	substrate	substrate	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	34	10	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	34	11	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	34	12	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	34	13	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	34	14	result	result	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	34	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	34	16	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	34	17	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	34	18	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	34	19	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	34	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	34	21	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	34	22	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	34	23	19	19	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	34	24	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	34	25	23	23	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	34	26	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	34	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	35	1	We	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	35	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	35	3	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	35	4	others	other	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	35	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	35	6	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	35	7	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	8	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	35	9	co	co	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	10	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	11	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	12	strategy	strategy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	13	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	35	15	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	35	16	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	35	17	24	24	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	35	18	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	35	19	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	35	20	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	21	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	35	22	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	35	23	transgenic	transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	35	24	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	35	25	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	35	26	express	express	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	35	27	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	28	proteins	protein	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	35	29	under	under	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	35	31	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	32	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	33	ubiquitous	ubiquitous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	35	34	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	35	35	tissue	tissue	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	35	36	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	35	37	specific	specific	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	35	38	promoters	promoter	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	35	39	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	35	40	4,6,25	4,6,25	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	35	41	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	35	42	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	36	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	36	2	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	3	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	36	4	generated	generate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	5	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	6	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	36	7	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	8	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	36	10	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	11	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	36	12	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	36	13	caused	cause	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	14	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	36	16	simple	simple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	36	17	trans-	trans-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	36	18	position	position	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	36	21	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	36	22	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	36	24	plasmid	plasmid	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	25	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	36	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	36	27	frog	frog	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	36	28	genomic	genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	36	29	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	36	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	37	1	Analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	37	4	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	5	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	37	6	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	37	7	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	8	several	several	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	37	9	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	37	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	37	12	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	37	13	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	37	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	37	15	parts	part	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	37	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	37	18	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	37	19	plasmid	plasmid	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	20	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	37	22	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	37	23	introduced	introduce	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	24	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	25	discrete	discrete	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	37	26	loci	loci	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	27	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	28	small	small	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	37	29	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	37	30	order	order	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	37	31	concatemers	concatemer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	37	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	38	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	38	2	unex-	unex-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	38	3	pected	pecte	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	38	4	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	38	5	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	38	6	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	38	7	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	38	8	mechanism	mechanism	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	38	9	makes	make	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	38	10	cloning	clone	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	38	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	38	12	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	38	13	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	38	14	complicated	complicate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	38	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	38	16	time	time	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	38	17	con-	con-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	38	18	suming	sum	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	38	19	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	38	20	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	38	21	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	38	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	39	1	Although	although	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	39	3	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	4	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	39	5	generated	generate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	6	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	39	8	co	co	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	9	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	10	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	11	strategy	strategy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	12	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	39	13	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	14	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	39	15	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	39	16	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	39	17	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	39	19	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	39	20	next	next	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	39	21	investigated	investigate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	39	22	whether	whether	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	23	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	39	24	transpo-	transpo-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	25	sons	son	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	39	26	stably	stably	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	39	27	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	28	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	39	30	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	39	31	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	39	32	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	39	33	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	39	34	effective	effective	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	39	35	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	39	36	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	37	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	39	38	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	40	1	Using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	40	2	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	40	3	double-	double-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	4	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	40	5	strategy	strategy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	40	7	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	40	8	show	show	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	40	9	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	10	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	40	11	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	40	12	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	40	14	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	15	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	16	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	40	17	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	40	18	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	19	following	follow	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	40	20	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	21	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	22	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	23	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	40	25	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	40	26	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	27	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	40	28	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	40	30	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	31	integra-	integra-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	32	tion	tion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	33	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	40	34	occur	occur	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	40	35	via	via	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	36	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	40	37	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	40	38	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	41	1	Results	result	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	41	2	Generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	3	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	41	4	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	6	transgenic	transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	41	7	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	41	8	tropicalis	tropicali	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	41	9	expressing	express	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	41	10	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	41	11	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	12	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	41	13	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	41	14	X.	x.	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	15	tropicalis	tropicalis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	16	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	17	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	41	18	engineered	engineer	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	19	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	41	20	express	express	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	41	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	41	22	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	41	23	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	24	under	under	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	25	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	41	26	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	27	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	28	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	41	29	synthetic	synthetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	41	30	regulatory	regulatory	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	41	31	element	element	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	32	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	41	33	chicken	chicken	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	41	34	b	b	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	41	35	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	41	36	actin	actin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	37	promoter	promoter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	38	coupled	couple	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	39	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	40	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	41	41	cytomegalovirus	cytomegalovirus	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	41	42	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	41	43	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	41	44	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	41	45	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	41	46	26	26	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	41	47	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	41	48	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	41	49	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	41	50	27	27	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	41	51	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	41	52	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	42	1	To	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	42	2	track	track	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	42	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	42	4	inheritance	inheritance	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	42	7	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	8	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	42	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	42	11	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	12	laevis	laevis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	13	g1	g1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	14	crystallin	crystallin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	15	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	42	16	red	red	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	42	17	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	18	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	19	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	42	20	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	21	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	42	22	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	42	23	28	28	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	42	24	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	42	25	reporter	reporter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	26	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	42	27	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	28	downstream	downstream	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	29	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	42	31	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	32	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	42	33	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	34	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	35	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	36	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	42	37	head	head	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	38	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	42	39	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	40	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	42	41	head	head	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	42	orientation	orientation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	42	43	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	42	44	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	45	1a	1a	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	42	46	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	42	47	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	43	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	43	2	presence	presence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	43	5	linked	link	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	6	g1	g1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	43	7	crystallin	crystallin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	43	8	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	43	9	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	43	10	reporter	reporter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	11	allows	allow	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	43	12	screening	screen	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	43	13	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	43	15	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	43	16	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	43	17	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	43	18	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	19	based	base	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	20	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	43	22	presence	presence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	23	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	24	red	red	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	43	25	eyes	eye	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	43	26	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	43	27	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	28	1b	1b	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	43	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	43	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	44	1	We	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	44	2	used	use	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	44	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	44	4	simple	simple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	44	5	linear	linear	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	44	6	plas-	plas-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	44	7	mid	mid	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	44	8	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	44	9	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	44	10	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	44	11	described	describe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	44	12	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	44	13	Etkin	Etkin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	44	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	44	15	Pearman	Pearman	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	44	16	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	44	17	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	44	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	44	19	transgenic	transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	44	20	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	44	21	transposase-	transposase-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	44	22	expressing	express	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	44	23	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	44	24	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	44	25	29	29	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	44	26	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	44	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	45	1	Injected	inject	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	2	embryos	embryo	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	45	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	45	4	scored	score	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	5	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	45	7	presence	presence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	8	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	9	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	45	10	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	45	13	lens	lens	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	14	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	45	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	45	16	RFP-	rfp-	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	45	17	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	45	18	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	45	19	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	45	20	27	27	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	45	21	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	45	22	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	45	23	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	45	24	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	25	570	570	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	45	26	injected	inject	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	45	28	4.7	4.7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	45	29	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	30	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	45	31	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	45	32	raised	raise	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	33	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	34	adulthood	adulthood	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	45	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	46	1	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	46	2	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	46	3	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	46	4	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	46	5	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	46	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	46	7	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	46	8	2	2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	46	9	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	46	10	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	46	11	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	46	12	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	46	13	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	46	14	total	total	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	46	15	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	46	16	five	five	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	46	17	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	46	18	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	46	19	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	46	20	date	date	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	46	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	46	22	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	46	23	identified	identify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	46	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	47	1	Outcross	Outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	47	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	3	male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	47	4	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	5	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	47	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	47	7	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	47	8	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	47	9	M	m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	10	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	11	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	47	12	wild	wild	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	47	13	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	47	14	type	type	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	15	female	female	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	16	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	47	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	18	779	779	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	47	19	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	47	20	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	47	21	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	47	22	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	47	23	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	24	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	47	25	total	total	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	27	3,333	3,333	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	47	28	offspring	offspring	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	29	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	47	30	23.4	23.4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	47	31	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	47	32	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	47	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	48	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	48	2	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	48	3	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	48	4	Mendelian	mendelian	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	48	5	inheritance	inheritance	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	48	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	48	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	48	8	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	48	9	indicates	indicate	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	48	10	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	48	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	48	12	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	48	13	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	48	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	48	15	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	48	16	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	48	17	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	48	18	2	2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	48	19	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	48	20	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	48	21	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	48	22	mosaic	mosaic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	48	23	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	48	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	48	25	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	48	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	49	1	Subsequent	subsequent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	49	2	outcross	outcross	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	4	F1	F1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	49	5	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	49	6	derived	derive	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	7	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	8	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	49	9	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	49	10	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	49	11	2	2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	49	12	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	49	13	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	49	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	49	16	expected	expect	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	17	50	50	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	49	18	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	49	21	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	22	expressing	express	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	49	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	49	24	dominant	dominant	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	49	25	lens	lens	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	26	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	49	27	specific	specific	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	49	28	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	49	29	reporter	reporter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	30	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	49	31	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	32	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	49	33	representative	representative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	49	34	F1	F1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	49	35	out-	out-	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	36	cross	cross	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	37	there	there	EX
work_lg7uwni46nhjxg5pc3yrqf32wy	49	38	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	49	39	239	239	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	49	40	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	49	41	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	49	42	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	49	43	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	49	44	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	45	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	49	46	total	total	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	47	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	48	479	479	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	49	49	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	49	50	49.9	49.9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	49	51	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	49	52	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	49	53	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	50	1	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	50	2	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	3	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	5	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	50	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	50	7	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	50	8	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	50	9	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	50	10	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	11	several	several	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	50	12	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	50	13	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	50	15	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	16	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	50	17	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	18	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	19	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	50	20	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	50	21	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	22	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	50	24	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	50	25	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	50	26	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	50	27	1c	1c	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	50	28	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	50	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	51	1	Reverse	reverse	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	51	2	transcriptase	transcriptase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	51	3	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	51	4	RT)-PCR	RT)-PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	51	5	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	51	6	Western	western	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	51	7	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	51	8	analyses	analysis	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	51	9	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	51	10	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	51	11	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	51	12	verify	verify	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	51	13	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	51	14	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	51	15	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	51	16	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	51	17	expressed	express	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	51	18	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	51	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	51	20	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	51	21	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	51	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	52	1	RT	RT	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	52	2	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	52	3	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	52	4	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	52	5	showed	show	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	52	6	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	52	7	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	52	8	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	52	9	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	52	10	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	52	11	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	52	12	stage	stage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	52	13	40	40	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	52	14	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	52	15	30	30	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	52	16	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	52	17	express	express	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	52	18	mRNA	mRNA	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	52	19	encoding	encode	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	52	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	52	21	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	52	22	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	52	23	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	52	24	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	52	25	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	52	26	1d	1d	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	52	27	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	52	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	53	1	As	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	53	2	expected	expect	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	53	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	53	4	sibling	sible	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	53	5	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	53	6	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	53	7	did	do	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	53	8	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	53	9	express	express	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	53	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	53	11	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	53	12	reporter	reporter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	53	13	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	53	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	53	15	lens	lens	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	53	16	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	53	17	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	53	18	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	53	19	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	53	20	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	53	21	mRNA	mrna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	53	22	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	53	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	54	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	2	adults	adult	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	54	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	54	4	robust	robust	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	54	5	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	7	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	54	8	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	9	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	54	10	detected	detect	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	12	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	13	lysates	lysate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	54	14	pre-	pre-	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	54	15	pared	pare	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	16	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	17	testes	testis	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	54	18	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	19	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	20	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	54	21	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	54	22	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	54	23	male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	54	24	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	54	25	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	54	26	but	but	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	54	27	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	54	28	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	29	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	54	30	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	54	31	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	54	32	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	54	33	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	54	34	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	35	1e	1e	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	54	36	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	54	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	55	1	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	55	2	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	55	3	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	55	4	expressed	express	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	55	5	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	55	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	55	7	liver	liver	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	55	8	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	55	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	55	10	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	55	11	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	55	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	55	13	but	but	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	55	14	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	55	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	55	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	55	17	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	55	18	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	55	19	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	55	20	littermates	littermate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	55	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	56	1	Generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	3	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	56	4	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	56	5	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	56	6	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	56	7	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	8	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	56	9	frogs	frog	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	56	10	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	56	11	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	12	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	56	13	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	14	2	2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	15	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	16	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	17	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	56	18	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	19	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	20	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	21	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	22	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	56	23	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	56	24	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	56	25	express	express	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	26	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	27	under	under	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	28	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	56	29	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	30	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	56	32	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	33	promoter	promoter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	56	34	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	56	35	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	56	36	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	56	37	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	56	38	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	56	39	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	56	40	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	57	1	Double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	57	2	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	57	3	transgenic	transgenic	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	4	F2	f2	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	5	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	57	6	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	7	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	57	8	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	57	9	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	57	10	ubiquitous	ubiquitous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	57	11	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	57	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	57	13	lens	lens	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	14	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	57	15	specific	specific	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	57	16	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	57	17	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	57	18	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	57	19	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	20	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	21	wild-	wild-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	22	type	type	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	23	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	57	24	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	57	25	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	57	26	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	27	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	57	28	F3	f3	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	57	30	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	57	31	either	either	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	57	32	analyzed	analyze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	33	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	34	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	35	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	57	36	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	57	37	raised	raise	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	38	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	57	39	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	40	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	57	41	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	57	42	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	57	43	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	57	44	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	58	1	Five	five	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	58	2	independent	independent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	58	3	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	58	4	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	58	5	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	58	6	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	58	7	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	58	8	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	58	9	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	58	10	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	58	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	58	12	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	58	13	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	58	14	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	58	15	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	58	16	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	58	17	study	study	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	58	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	59	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	59	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	59	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	59	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	60	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	60	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	60	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	60	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	60	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	60	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	60	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	60	8	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	60	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	60	11	As	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	60	13	methodology	methodology	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	14	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	60	16	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	17	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	60	18	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	60	21	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	22	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	60	23	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	60	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	60	25	same	same	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	60	26	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	27	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	60	28	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	29	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	60	31	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	60	32	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	33	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	60	34	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	60	35	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	60	36	8	8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	60	37	F	f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	38	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	60	39	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	60	40	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	60	41	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	60	42	will	will	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	60	43	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	60	44	described	describe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	45	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	46	detail	detail	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	60	47	below	below	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	60	48	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	61	1	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	2	hoppers	hopper	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	61	3	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	61	4	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	61	5	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	6	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	7	harbors	harbor	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	61	8	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	61	9	independently-	independently-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	61	10	segregating	segregating	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	11	alleles	allele	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	61	12	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	61	13	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	61	14	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	15	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	16	three	three	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	61	17	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	61	18	transpo-	transpo-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	19	sons	son	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	61	20	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	21	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	22	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	61	23	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	61	24	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	25	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	26	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	61	27	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	61	28	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	61	29	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	30	base	base	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	61	31	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	32	2456981	2456981	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	61	33	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	61	34	57:2456981	57:2456981	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	61	35	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	61	36	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	37	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	61	38	JGI	JGI	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	61	39	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	61	40	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	61	41	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	61	42	sequence	sequence	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	61	43	v4.1	v4.1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	61	44	assembly	assembly	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	61	45	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	61	46	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	61	47	another	another	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	61	48	allele	allele	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	49	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	50	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	61	51	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	61	52	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	61	53	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	54	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	61	55	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	61	56	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	61	57	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	61	58	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	61	59	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	62	1	Thus	thus	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	62	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	62	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	62	4	F2	F2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	62	5	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	62	6	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	62	7	inherited	inherit	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	62	8	either	either	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	62	9	one	one	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	62	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	62	11	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	62	12	both	both	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	62	13	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	62	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	62	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	62	16	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	62	17	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	62	18	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	62	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	63	1	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	63	2	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	3	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	5	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	6	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	7	8Fhopper	8Fhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	63	8	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	63	9	35	35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	63	10	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	63	11	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	12	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	63	13	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	63	14	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	63	15	transgenic	transgenic	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	16	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	17	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	63	18	inherited	inherit	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	63	20	trimeric	trimeric	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	63	21	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	22	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	23	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	63	24	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	63	25	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	63	26	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	63	27	alone	alone	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	63	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	64	1	Double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	64	2	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	64	3	transgenic	transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	64	4	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	64	5	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	64	6	+	+	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	64	7	/GFP+	/gfp+	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	8	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	64	9	progeny	progeny	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	64	10	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	64	11	F3	f3	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	12	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	64	13	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	64	15	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	64	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	17	8Fhop-	8Fhop-	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	64	18	per	per	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	19	♂	♂	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	64	20	35	35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	64	21	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	64	22	raised	raise	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	23	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	64	24	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	25	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	64	26	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	64	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	64	28	resulting	result	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	64	29	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	30	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	64	31	F4	F4	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	64	32	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	64	33	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	64	34	analyzed	analyze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	35	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	36	modification	modification	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	37	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	38	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	64	39	par-	par-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	40	ental	ental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	64	41	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	64	42	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	43	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	64	44	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	64	45	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	64	46	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	64	47	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	65	1	Observation	observation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	65	4	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	65	5	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	65	8	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	9	out-	out-	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	10	cross	cross	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	11	populations	population	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	65	12	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	65	13	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	14	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	65	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	16	most	most	JJS
work_lg7uwni46nhjxg5pc3yrqf32wy	65	17	cases	case	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	65	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	65	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	65	20	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	65	21	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	22	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	65	24	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	25	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	65	26	identical	identical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	65	27	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	28	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	65	29	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	65	31	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	32	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	65	34	suggesting	suggest	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	65	35	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	65	37	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	65	38	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	65	39	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	65	40	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	65	41	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	65	42	intact	intact	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	65	43	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	66	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	2	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	66	3	small	small	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	66	4	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	66	7	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	66	8	pro-	pro-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	9	geny	geny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	66	11	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	66	12	observed	observe	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	66	13	markedly	markedly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	66	14	different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	66	15	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	66	16	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	18	either	either	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	66	19	small	small	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	66	20	populations	population	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	66	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	22	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	66	23	within	within	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	66	25	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	26	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	66	27	Fig-	Fig-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	66	28	ure	ure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	66	29	3a	3a	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	66	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	66	31	b	b	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	66	32	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	66	33	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	66	34	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	35	whole	whole	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	66	36	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	66	37	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	66	38	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	39	4a	4a	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	66	40	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	66	41	b	b	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	42	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	66	43	40	40	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	66	44	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	66	45	20,015	20,015	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	66	46	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	66	47	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	66	48	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	66	49	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	66	50	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	66	51	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	67	1	We	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	67	2	reasoned	reason	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	67	3	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	67	5	change	change	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	7	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	67	8	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	9	might	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	67	10	result	result	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	67	11	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	67	13	modifi-	modifi-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	67	14	cation	cation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	15	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	67	17	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	67	18	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	67	19	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	20	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	67	22	remobilized	remobilized	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	67	23	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	67	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	68	1	Embryos	embryo	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	68	2	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	3	small	small	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	68	4	subsets	subset	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	68	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	6	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	68	7	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	8	increased	increase	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	9	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	68	10	intensity	intensity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	11	likely	likely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	68	12	represent	represent	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	68	13	stochastic	stochastic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	68	14	trans-	trans-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	15	posase	posase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	16	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	18	somatic	somatic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	68	19	tissues	tissue	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	68	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	68	21	somatic	somatic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	68	22	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	68	23	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	68	24	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	68	25	3a	3a	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	68	26	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	68	27	b	b	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	68	28	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	68	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	68	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	69	1	An	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	69	2	organism	organism	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	69	4	wide	wide	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	69	5	change	change	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	7	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	69	8	inten-	inten-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	9	sity	sity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	10	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	69	11	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	12	4a	4a	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	69	13	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	69	14	likely	likely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	69	15	represents	represent	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	69	16	modification	modification	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	17	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	69	19	par-	par-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	69	20	ental	ental	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	69	21	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	69	22	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	23	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	24	during	during	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	25	gametogenesis	gametogenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	26	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	69	27	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	69	28	passed	pass	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	29	on	on	RP
work_lg7uwni46nhjxg5pc3yrqf32wy	69	30	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	69	32	resulting	result	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	69	33	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	69	34	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	70	1	Remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	3	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	70	4	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	5	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	70	7	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	8	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	9	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	70	11	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	70	12	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	13	will	will	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	70	14	likely	likely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	70	15	alter	alter	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	70	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	70	17	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	70	18	epigenetic	epigenetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	70	19	environment	environment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	20	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	70	22	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	23	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	70	24	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	70	25	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	70	26	subject	subject	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	70	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	70	28	re	re	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	70	29	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	70	30	integrated	integrated	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	70	31	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	70	32	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	33	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	70	34	influence	influence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	35	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	36	nearby	nearby	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	70	37	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	38	regulatory	regulatory	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	70	39	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	70	40	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	70	41	differ	differ	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	70	42	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	43	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	70	44	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	70	45	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	70	46	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	71	1	Genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	71	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	71	3	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	71	4	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	71	5	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	71	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	71	7	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	71	8	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	71	9	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	71	10	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	71	11	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	71	12	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	71	13	pT2bGFP8F	pT2bGFP8F	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	71	14	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	71	15	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	71	16	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	71	17	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	71	18	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	71	19	gcRFP	gcrfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	71	20	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	71	21	8F	8F	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	71	22	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	71	23	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	71	24	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	71	25	analyzed	analyze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	71	26	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	71	27	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	71	28	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	71	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	72	1	Digestion	digestion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	3	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	72	4	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	5	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	6	pT2bGFP	pt2bgfp	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	72	7	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	8	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	72	9	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	10	BglII	BglII	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	72	11	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	72	12	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	13	three	three	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	72	14	bands	band	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	72	15	when	when	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	72	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	72	17	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	18	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	72	19	hybridized	hybridize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	20	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	21	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	72	22	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	72	23	probe	probe	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	24	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	72	25	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	72	26	4c	4c	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	72	27	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	72	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	73	1	Changes	change	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	73	2	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	73	4	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	73	5	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	6	hybridization	hybridization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	7	pattern	pattern	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	8	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	73	9	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	10	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	73	11	deter-	deter-	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	73	12	mine	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	73	13	whether	whether	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	73	15	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	73	16	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	17	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	73	18	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	19	altered	alter	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	20	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	21	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	22	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	73	24	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	73	25	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	73	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	74	1	Analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	74	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	74	3	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	74	4	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	74	5	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	74	6	Generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	74	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	74	8	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	74	9	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	74	10	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	74	11	tropicalis	tropicali	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	74	12	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	74	13	expresses	express	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	74	14	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	74	15	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	74	16	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	75	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	75	2	a	a	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	75	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	75	4	Schematic	schematic	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	75	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	75	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	75	7	pCAGGS	pcaggs	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	75	8	-	-	:
work_lg7uwni46nhjxg5pc3yrqf32wy	75	9	SB10	sb10	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	75	10	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	75	11	gcRFP	gcrfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	75	12	construct	construct	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	75	13	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	75	14	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	75	15	develop	develop	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	75	16	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	75	17	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	75	18	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	75	19	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	75	20	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	75	21	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	75	22	expressing	express	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	75	23	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	75	24	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	75	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	76	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	76	2	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	76	3	transgenes	transgene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	76	4	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	76	5	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	76	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	76	7	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	76	8	tail	tail	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	76	9	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	76	10	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	76	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	76	12	tail	tail	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	76	13	orientation	orientation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	76	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	77	1	Not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	77	2	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	77	3	scale	scale	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	77	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	78	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	78	2	b	b	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	78	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	78	4	Red	red	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	78	5	lens	lens	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	78	8	right	right	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	78	9	eye	eye	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	11	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	78	12	adult	adult	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	13	F1	F1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	78	14	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	78	15	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	16	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	17	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	78	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	19	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	20	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	78	21	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	78	22	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	78	23	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	78	24	M.	m.	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	25	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	78	26	border	border	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	27	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	28	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	78	29	eye	eye	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	30	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	78	31	indicated	indicate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	32	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	33	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	78	34	dashed	dash	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	35	white	white	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	78	36	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	78	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	79	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	79	2	c	c	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	79	4	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	79	5	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	6	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	8	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	79	9	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	79	10	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	11	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	12	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	79	13	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	79	14	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	79	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	79	16	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	17	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	79	18	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	79	19	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	20	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	21	multiple	multiple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	79	22	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	79	23	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	79	25	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	79	26	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	79	27	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	79	28	linear	linear	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	79	29	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	79	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	80	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	80	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	80	3	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	80	4	digested	digest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	80	5	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	80	6	BamHI	BamHI	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	80	7	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	80	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	80	9	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	80	10	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	80	11	probed	probe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	80	12	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	80	13	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	80	14	radiolabelled	radiolabelle	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	80	15	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	80	16	cDNA	cdna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	80	17	probe	probe	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	80	18	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	80	19	see	see	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	80	20	schematic	schematic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	80	21	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	80	22	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	80	23	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	80	24	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	80	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	81	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	81	2	d	d	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	81	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	81	4	RT	RT	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	81	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	81	6	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	81	7	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	81	8	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	81	9	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	81	10	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	81	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	81	12	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	81	13	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	82	1	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	82	2	RNA	RNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	82	3	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	82	4	detected	detect	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	82	5	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	82	6	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	82	7	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	82	8	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	82	9	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	82	10	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	82	11	+	+	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	82	12	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	82	13	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	82	14	but	but	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	82	15	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	82	16	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	82	17	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	82	18	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	82	19	negative	negative	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	82	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	82	21	-RFP	-RFP	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	82	22	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	82	23	progeny	progeny	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	82	24	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	82	25	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	82	26	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	82	27	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	82	28	2M.	2M.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	83	1	RNA	rna	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	83	2	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	83	3	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	83	4	wild	wild	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	83	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	83	6	type	type	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	83	7	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	83	8	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	83	9	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	83	10	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	83	11	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	83	12	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	83	13	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	83	14	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	83	15	St.	St.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	83	16	15	15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	83	17	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	83	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	84	1	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	84	2	mock	mock	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	84	3	reverse	reverse	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	84	4	transcription	transcription	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	5	reaction	reaction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	84	7	without	without	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	8	added	add	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	9	RT	RT	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	84	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	84	11	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	12	RNA	RNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	84	13	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	14	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	15	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	84	16	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	84	17	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	84	18	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	84	19	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	84	21	+	+	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	84	22	RFP(-RT	RFP(-RT	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	84	23	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	84	24	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	84	25	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	84	26	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	27	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	28	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	84	29	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	84	30	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	84	31	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	85	1	Primers	primer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	85	2	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	85	3	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	85	4	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	85	5	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	85	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	85	7	actin	actin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	85	8	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	85	9	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	85	10	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	85	11	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	85	12	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	85	13	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	85	14	RNA	RNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	85	15	recovery	recovery	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	85	16	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	86	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	86	2	e	e	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	86	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	86	4	Western	western	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	86	5	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	86	6	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	86	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	86	8	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	86	9	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	86	10	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	86	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	86	12	tissues	tissue	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	86	13	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	86	14	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	86	15	adult	adult	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	86	16	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	86	17	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	86	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	87	1	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	87	2	monoclonal	monoclonal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	87	3	antibody	antibody	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	4	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	5	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	87	6	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	87	7	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	8	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	87	9	demonstrate	demonstrate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	87	10	abundant	abundant	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	87	11	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	12	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	13	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	87	15	testis	testis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	16	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	87	17	liver	liver	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	19	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	87	20	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	87	21	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	87	22	adults	adult	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	87	23	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	87	24	but	but	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	87	25	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	87	26	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	87	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	87	28	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	87	29	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	87	30	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	87	31	siblings	sibling	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	87	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	88	1	Protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	2	lysates	lysate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	88	3	prepared	prepare	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	88	4	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	5	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	88	6	injected	inject	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	7	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	8	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	88	9	mRNA	mrna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	10	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	88	12	one	one	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	88	13	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	88	14	cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	15	stage	stage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	16	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	88	17	prepared	prepare	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	18	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	19	stage	stage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	20	15	15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	88	21	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	88	22	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	88	23	lane	lane	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	88	24	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	88	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	89	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	89	2	blots	blot	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	89	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	89	4	stripped	strip	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	89	5	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	89	6	re-	re-	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	89	7	probed	probe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	89	8	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	89	9	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	89	10	monoclonal	monoclonal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	89	11	antibody	antibody	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	89	12	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	89	13	recognizes	recognize	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	89	14	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	89	15	a-	a-	XX
work_lg7uwni46nhjxg5pc3yrqf32wy	89	16	actin	actin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	89	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	90	1	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	90	2	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	90	3	polymerase	polymerase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	90	4	chain	chain	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	90	5	reaction	reaction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	90	6	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	90	7	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	90	8	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	90	9	red	red	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	90	10	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	90	11	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	90	12	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	90	13	RT	RT	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	90	14	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	90	15	reverse	reverse	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	90	16	transcriptase	transcriptase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	90	17	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	90	18	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	90	19	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	90	20	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	90	21	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	90	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	91	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	91	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	91	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	91	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	92	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	92	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	92	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	92	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	92	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	92	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	92	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	92	8	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	92	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	92	11	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	92	13	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	92	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	15	F3	F3	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	92	16	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	92	17	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	92	18	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	19	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	92	20	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	21	wild	wild	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	92	22	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	92	23	type	type	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	24	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	92	25	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	92	26	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	27	most	most	JJS
work_lg7uwni46nhjxg5pc3yrqf32wy	92	28	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	92	30	pro-	pro-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	31	geny	geny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	32	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	92	33	inherited	inherit	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	34	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	92	35	unaltered	unaltered	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	92	36	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	92	37	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	38	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	92	39	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	92	40	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	92	41	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	92	42	4c	4c	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	92	43	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	92	44	lanes	lane	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	92	45	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	92	46	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	92	47	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	92	48	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	92	49	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	92	50	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	92	51	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	93	1	Examples	example	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	93	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	3	germline	germline	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	93	4	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	93	7	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	93	8	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	93	9	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	10	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	93	11	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	93	12	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	93	13	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	93	14	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	93	15	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	93	16	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	93	17	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	18	4a	4a	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	93	19	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	93	20	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	93	21	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	93	22	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	93	23	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	93	24	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	93	25	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	26	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	93	28	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	93	29	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	30	8Fhopper	8Fhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	93	31	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	93	32	58	58	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	93	33	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	93	34	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	35	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	36	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	93	37	4c	4c	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	93	38	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	93	39	lanes	lane	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	93	40	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	93	41	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	93	42	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	93	43	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	93	44	dashed	dash	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	93	45	arrows	arrow	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	93	46	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	93	47	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	94	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	94	2	data	data	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	3	indicates	indicate	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	94	4	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	94	6	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	7	predicted	predict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	8	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	94	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	94	10	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	94	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	94	12	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	94	13	individuals	individual	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	94	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	94	16	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	94	17	population	population	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	94	20	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	21	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	94	22	represent	represent	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	94	23	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	94	24	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	94	25	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	94	26	modified	modify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	94	28	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	94	29	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	94	30	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	31	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	94	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	95	1	Thus	thus	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	95	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	95	3	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	95	4	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	95	5	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	95	6	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	95	7	identified	identify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	95	8	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	95	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	95	10	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	95	11	population	population	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	95	12	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	95	13	simply	simply	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	95	14	observing	observe	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	95	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	95	16	tad-	tad-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	95	17	poles	pole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	95	18	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	95	19	changes	change	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	95	20	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	95	21	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	95	22	intensity	intensity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	95	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	96	1	Outcross	Outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	96	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	96	3	eleven	eleven	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	96	4	8F	8F	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	96	5	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	96	6	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	96	7	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	96	8	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	96	9	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	96	10	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	96	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	96	12	fre-	fre-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	96	13	quency	quency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	96	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	96	15	remobilized	remobilized	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	96	16	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	96	17	varied	vary	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	96	18	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	96	19	0.07	0.07	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	96	20	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	96	21	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	96	22	0.71	0.71	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	96	23	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	96	24	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	96	25	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	96	26	4b	4b	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	96	27	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	96	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	97	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	97	2	variation	variation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	3	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	97	5	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	6	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	7	between	between	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	8	individual	individual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	97	9	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	10	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	97	11	likely	likely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	97	12	reflects	reflect	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	97	13	subtle	subtle	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	97	14	differences	difference	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	97	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	16	epigenetic	epigenetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	97	17	modification	modification	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	97	20	sub-	sub-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	97	21	strate	strate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	22	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	97	23	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	97	24	transgenes	transgene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	97	25	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	26	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	97	27	animal	animal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	28	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	97	29	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	97	30	alter	alter	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	97	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	97	32	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	33	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	34	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	97	35	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	36	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	97	37	reintegration	reintegration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	97	38	reactions	reaction	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	97	39	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	98	1	Analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	98	4	cloned	cloned	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	98	5	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	98	6	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	98	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	98	9	par-	par-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	98	10	ental	ental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	98	11	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	12	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	98	13	57:2456981	57:2456981	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	98	14	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	98	15	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	98	17	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	18	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	98	19	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	98	20	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	98	21	4c	4c	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	98	22	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	98	23	lane	lane	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	24	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	98	25	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	98	26	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	98	27	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	98	28	showed	show	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	98	29	no	no	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	98	30	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	31	change	change	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	32	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	98	33	indicating	indicate	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	98	34	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	35	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	98	36	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	37	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	98	38	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	98	39	excised	excise	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	40	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	41	within	within	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	42	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	98	43	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	44	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	45	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	98	46	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	98	47	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	98	48	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	98	49	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	98	50	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	99	1	Extension	extension	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	2	primer	primer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	3	tag	tag	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	4	selection	selection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	5	linker	linker	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	6	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	7	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	99	8	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	99	9	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	99	10	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	99	11	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	99	12	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	99	13	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	99	14	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	99	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	99	16	standard	standard	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	99	17	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	99	18	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	99	19	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	99	20	6,8	6,8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	99	21	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	99	22	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	99	23	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	24	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	99	25	clone	clone	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	99	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	99	27	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	28	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	99	29	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	99	31	novel	novel	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	99	32	bands	band	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	99	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	100	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	100	2	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	3	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	4	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	5	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	6	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	7	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	8	8Fhopper	8Fhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	100	9	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	100	10	58	58	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	100	11	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	100	12	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	100	13	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	100	14	occurred	occur	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	15	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	100	17	same	same	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	100	18	scaffold	scaffold	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	19	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	100	21	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	100	22	inte-	inte-	XX
work_lg7uwni46nhjxg5pc3yrqf32wy	100	23	gration	gration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	24	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	25	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	100	26	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	100	27	thus	thus	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	100	28	represented	represent	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	100	29	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	100	30	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	100	31	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	100	32	hop	hop	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	33	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	100	34	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	100	35	Table	table	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	36	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	100	37	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	100	38	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	100	39	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	100	40	;	;	,
work_lg7uwni46nhjxg5pc3yrqf32wy	100	41	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	100	42	8Fhopper	8Fhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	100	43	♂	♂	ADD
work_lg7uwni46nhjxg5pc3yrqf32wy	100	44	58	58	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	100	45	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	100	46	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	100	47	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	100	48	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	101	1	Genomic	Genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	101	2	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	101	3	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	101	4	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	101	5	Breeding	breeding	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	101	6	strategy	strategy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	101	7	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	101	8	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	101	9	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	101	10	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	101	11	transgenic	transgenic	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	101	12	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	101	13	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	101	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	102	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	102	2	F2	f2	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	102	3	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	102	4	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	102	5	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	102	6	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	102	7	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	102	8	wild	wild	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	102	9	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	102	10	type	type	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	102	11	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	102	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	102	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	102	14	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	102	15	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	102	16	scored	score	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	102	17	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	102	18	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	102	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	102	20	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	102	21	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	102	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	103	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	103	2	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	103	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	103	4	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	103	5	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	103	6	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	103	7	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	103	8	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	103	9	F3	F3	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	103	10	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	103	11	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	103	12	either	either	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	103	13	raised	raise	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	103	14	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	103	15	adulthood	adulthood	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	103	16	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	103	17	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	103	18	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	103	19	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	103	20	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	103	21	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	103	22	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	103	23	after	after	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	103	24	stage	stage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	103	25	45	45	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	103	26	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	103	27	molecular	molecular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	103	28	analyses	analysis	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	103	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	104	1	GFP	gfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	104	2	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	104	3	green	green	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	104	4	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	104	5	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	104	6	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	104	7	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	104	8	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	104	9	red	red	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	104	10	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	104	11	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	104	12	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	105	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	105	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	105	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	105	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	106	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	106	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	106	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	106	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	106	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	106	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	106	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	106	8	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	106	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	106	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	106	11	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	106	12	sequencing	sequencing	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	106	13	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	106	14	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	106	15	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	106	16	verify	verify	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	106	17	both	both	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	106	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	106	19	5’-	5’-	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	106	20	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	106	21	3’-	3’-	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	106	22	ends	end	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	106	23	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	106	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	106	25	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	106	26	insertion	insertion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	106	27	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	106	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	107	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	107	2	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	3	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	107	6	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	7	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	107	8	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	107	9	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	107	10	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	11	57:2491386	57:2491386	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	107	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	107	13	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	107	14	34,405	34,405	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	107	15	bp	bp	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	107	16	away	away	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	107	17	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	107	19	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	107	20	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	21	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	22	chro-	chro-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	23	mosome	mosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	24	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	107	25	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	107	26	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	107	27	5b	5b	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	107	28	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	107	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	108	1	Sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	2	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	108	5	integra-	integra-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	108	6	tion	tion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	7	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	8	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	108	9	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	108	11	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	12	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	13	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	108	14	catalyzed	catalyze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	15	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	16	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	108	17	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	108	18	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	19	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	108	20	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	109	1	That	that	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	109	2	is	is	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	109	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	109	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	109	5	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	109	6	inserted	insert	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	109	7	precisely	precisely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	109	8	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	109	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	109	10	predicted	predict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	109	11	boundary	boundary	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	109	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	109	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	109	14	indirect	indirect	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	109	15	repeat	repeat	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	109	16	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	109	17	direct	direct	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	109	18	repeats	repeat	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	109	19	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	109	20	IR	IR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	109	21	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	109	22	DRs	DRs	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	109	23	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	109	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	110	1	Further-	Further-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	110	2	more	more	RBR
work_lg7uwni46nhjxg5pc3yrqf32wy	110	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	110	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	110	5	integrated	integrated	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	110	6	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	110	7	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	110	8	flanked	flank	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	9	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	110	11	expected	expect	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	12	TA	TA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	110	13	dinucleotide	dinucleotide	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	14	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	15	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	16	duplication	duplication	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	17	cata-	cata-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	18	lyzed	lyze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	19	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	110	20	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	110	21	transposase	transposase	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	110	22	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	110	23	31	31	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	110	24	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	110	25	33	33	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	110	26	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	110	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	111	1	Thus	thus	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	111	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	111	3	unlike	unlike	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	111	5	co-	co-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	111	6	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	7	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	8	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	9	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	111	10	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	111	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	111	12	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	111	13	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	14	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	111	15	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	111	16	results	result	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	111	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	18	unexpected	unexpected	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	111	19	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	20	formation	formation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	21	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	111	22	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	23	5a	5a	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	111	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	111	25	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	111	26	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	111	27	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	111	28	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	111	29	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	111	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	111	31	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	32	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	111	33	catalyzed	catalyze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	34	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	35	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	36	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	37	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	38	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	39	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	111	40	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	41	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	111	42	via	via	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	43	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	111	44	trans-	trans-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	45	position	position	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	46	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	111	47	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	111	48	5b	5b	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	111	49	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	111	50	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	112	1	To	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	2	date	date	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	112	4	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	112	5	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	112	6	identified	identify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	7	40	40	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	112	8	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	9	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	112	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	112	11	based	base	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	12	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	13	differences	difference	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	112	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	15	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	112	16	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	17	intensity	intensity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	112	19	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	20	20,015	20,015	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	112	21	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	112	22	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	112	23	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	112	24	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	112	25	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	112	27	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	112	28	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	29	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	112	30	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	112	31	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	112	32	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	112	33	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	112	34	4b	4b	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	112	35	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	112	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	113	1	South-	South-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	113	2	ern	ern	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	113	3	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	4	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	113	5	confirmed	confirm	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	6	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	7	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	113	8	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	9	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	10	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	11	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	12	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	113	13	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	113	14	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	113	15	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	113	17	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	113	18	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	113	20	yields	yield	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	113	21	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	113	22	apparent	apparent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	113	23	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	24	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	25	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	26	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	113	27	0.2	0.2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	113	28	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	113	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	114	1	Pre	pre	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	114	2	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	114	3	sorting	sorting	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	114	4	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	114	5	based	base	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	6	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	7	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	114	8	intensity	intensity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	9	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	114	10	underestimate	underestimate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	114	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	114	12	total	total	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	114	13	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	14	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	15	if	if	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	114	17	re-	re-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	114	18	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	19	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	20	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	114	21	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	22	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	114	23	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	24	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	114	25	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	114	26	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	114	27	markedly	markedly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	114	28	different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	114	29	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	114	31	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	114	32	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	114	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	115	1	To	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	115	2	test	test	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	115	3	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	115	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	115	5	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	115	6	outcrossed	outcrosse	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	115	7	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	115	8	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	115	9	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	115	10	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	115	11	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	115	12	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	115	13	8Fhopper	8Fhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	115	14	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	115	15	51	51	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	115	16	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	115	17	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	115	18	analyzed	analyze	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	115	19	all	all	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	115	20	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	115	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	115	22	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	115	23	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	115	24	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	115	25	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	115	26	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	115	27	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	115	28	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	115	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	116	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	116	2	8Fhopper	8Fhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	116	3	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	116	4	51	51	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	116	5	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	116	6	inher-	inher-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	116	7	ited	ite	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	116	8	both	both	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	116	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	116	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	116	11	pT2bGFP	pt2bgfp	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	116	12	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	116	13	alleles	allele	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	116	14	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	116	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	116	16	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	116	17	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	116	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	117	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	117	2	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	117	3	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	117	4	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	117	5	8Fhopper	8Fhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	117	6	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	117	7	51	51	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	117	8	out-	out-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	117	9	cross	cross	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	117	10	displayed	display	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	117	11	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	117	12	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	117	13	patterns	pattern	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	117	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	117	15	intensities	intensity	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	117	16	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	117	17	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	117	18	indistinguishable	indistinguishable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	117	19	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	117	20	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	117	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	117	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	117	23	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	117	24	alleles	allele	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	117	25	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	117	26	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	117	27	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	117	28	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	117	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	117	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	118	1	From	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	118	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	118	3	677	677	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	118	4	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	118	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	118	6	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	118	7	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	118	8	analyzed	analyze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	118	9	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	118	10	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	118	11	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	118	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	118	13	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	118	14	identified	identify	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	118	15	four	four	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	118	16	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	118	17	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	118	18	only	only	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	118	19	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	118	20	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	118	21	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	118	22	remobilizations	remobilization	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	118	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	119	1	Samples	sample	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	119	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	3	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	119	4	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	5	where	where	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	119	6	changes	change	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	119	7	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	119	8	evident	evident	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	119	9	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	10	South-	South-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	119	11	ern	ern	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	119	12	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	13	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	14	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	119	15	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	16	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	17	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	119	18	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	119	19	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	119	20	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	119	21	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	119	22	clone	clone	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	119	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	119	24	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	25	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	119	28	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	119	29	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	119	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	120	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	120	2	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	120	3	experiment	experiment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	120	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	120	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	120	6	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	120	7	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	120	8	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	120	9	0.3	0.3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	120	10	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	120	11	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	120	12	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	120	13	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	120	14	events	event	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	120	15	out	out	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	120	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	120	17	677	677	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	120	18	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	120	19	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	120	20	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	120	21	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	120	22	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	120	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	121	1	These	these	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	121	2	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	121	3	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	121	4	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	121	6	actual	actual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	121	7	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	8	fre-	fre-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	9	quency	quency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	10	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	121	11	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	121	12	somewhat	somewhat	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	121	13	higher	high	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	121	14	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	15	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	121	16	estimated	estimate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	17	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	18	simple	simple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	121	19	visual	visual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	121	20	inspection	inspection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	121	23	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	121	24	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	121	25	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	121	26	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	121	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	122	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	122	2	observed	observed	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	122	3	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	122	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	122	5	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	122	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	122	7	only	only	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	122	8	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	122	9	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	122	10	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	122	11	out-	out-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	122	12	cross	cross	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	122	13	population	population	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	122	14	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	122	15	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	122	16	out	out	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	122	17	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	122	18	677	677	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	122	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	122	20	that	that	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	122	21	is	is	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	122	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	122	23	0.6	0.6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	122	24	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	122	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	123	1	Scoring	score	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	123	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	123	3	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	123	4	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	6	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	7	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	123	8	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	9	changes	change	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	123	10	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	11	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	123	12	intensity	intensity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	13	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	123	14	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	123	15	overestimate	overestimate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	123	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	123	17	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	18	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	123	20	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	21	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	123	22	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	23	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	123	24	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	123	25	distin-	distin-	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	123	26	guish	guish	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	123	27	between	between	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	28	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	29	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	123	30	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	123	31	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	123	32	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	123	33	only	only	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	123	34	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	123	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	124	1	We	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	124	2	analyzed	analyze	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	124	3	25	25	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	124	4	GFP	gfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	124	6	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	124	7	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	124	8	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	124	10	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	124	11	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	12	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	124	13	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	124	14	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	124	15	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	124	16	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	124	17	see	see	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	124	18	below	below	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	124	19	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	124	20	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	21	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	124	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	124	23	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	24	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	124	25	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	26	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	27	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	124	28	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	29	cloning	clone	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	124	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	124	31	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	124	32	inser-	inser-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	33	tion	tion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	34	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	124	35	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	124	36	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	124	37	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	124	38	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	124	39	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	124	40	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	125	1	Only	only	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	125	2	one	one	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	125	3	GFP	gfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	4	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	125	5	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	6	tad-	tad-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	7	pole	pole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	8	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	125	9	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	125	10	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	125	12	only	only	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	125	13	modification	modification	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	125	16	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	17	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	125	18	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	19	locus	locus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	125	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	125	21	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	125	22	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	23	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	125	24	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	125	25	24	24	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	125	26	GFP	gfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	27	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	125	28	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	29	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	125	30	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	125	31	96	96	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	125	32	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	33	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	125	34	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	125	35	re	re	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	36	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	37	integration	integration	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	38	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	125	39	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	125	40	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	125	41	evident	evident	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	42	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	43	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	44	bands	band	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	125	45	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	46	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	125	47	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	48	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	49	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	125	50	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	51	cloning	clone	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	125	52	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	125	53	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	125	54	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	125	55	Somatic	somatic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	56	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	57	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	58	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	125	59	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	125	60	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	61	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	125	62	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	125	63	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	126	1	Outcross	Outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	126	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	126	3	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	126	4	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	126	5	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	126	6	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	126	7	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	126	8	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	126	9	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	126	10	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	126	11	inherited	inherit	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	126	12	both	both	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	126	13	transgenes	transgene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	126	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	127	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	127	2	rare	rare	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	127	3	instances	instance	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	127	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	127	5	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	127	6	identified	identify	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	127	7	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	127	8	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	127	9	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	127	10	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	127	11	express	express	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	127	12	intense	intense	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	127	13	levels	level	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	127	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	127	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	127	16	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	127	17	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	127	18	reporter	reporter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	127	19	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	127	20	individual	individual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	127	21	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	127	22	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	127	23	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	127	24	small	small	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	127	25	groups	group	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	127	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	127	27	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	127	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	128	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	128	2	change	change	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	3	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	4	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	128	5	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	6	seen	see	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	8	these	these	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	128	9	somatic	somatic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	128	10	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	128	11	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	128	12	likely	likely	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	128	13	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	128	14	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	128	15	due	due	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	16	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	17	sporadic	sporadic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	128	18	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	128	21	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	128	22	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	128	23	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	128	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	128	25	change	change	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	26	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	27	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	128	28	intensity	intensity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	29	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	128	30	likely	likely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	128	31	due	due	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	32	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	33	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	128	34	influence	influence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	35	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	128	37	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	128	38	chromatin	chromatin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	128	39	environment	environment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	40	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	41	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	128	42	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	128	43	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	44	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	128	45	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	129	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	129	2	region	region	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	129	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	129	4	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	129	5	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	129	6	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	129	7	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	129	8	dashed	dash	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	129	9	box	box	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	129	10	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	129	11	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	129	12	indicated	indicate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	129	13	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	129	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	129	15	cartoon	cartoon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	129	16	inset	inset	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	129	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	130	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	130	2	a	a	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	130	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	130	4	Tail	tail	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	130	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	130	6	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	130	7	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	130	8	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	130	9	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	130	10	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	130	11	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	130	12	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	130	13	muscle	muscle	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	130	14	cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	130	15	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	130	16	intense	intense	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	130	17	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	130	18	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	130	19	arrow	arrow	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	130	20	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	130	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	131	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	131	2	b	b	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	131	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	131	4	Double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	131	5	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	131	6	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	131	7	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	131	8	high	high	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	131	9	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	131	10	level	level	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	131	11	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	131	12	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	131	13	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	131	14	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	131	15	subset	subset	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	131	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	131	17	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	131	18	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	131	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	131	20	brachial	brachial	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	131	21	cartilage	cartilage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	131	22	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	131	23	arrow	arrow	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	131	24	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	131	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	132	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	132	2	immobilized	immobilized	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	132	3	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	4	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	132	5	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	132	6	photographed	photograph	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	7	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	132	8	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	132	9	dsRED	dsred	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	10	filter	filter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	11	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	132	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	132	13	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	132	14	images	image	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	132	15	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	132	16	overlaid	overlay	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	17	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	132	18	demonstrate	demonstrate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	132	19	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	20	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	132	21	animal	animal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	22	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	132	23	inherited	inherit	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	132	25	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	132	26	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	132	27	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	132	28	transgene	transgene	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	132	29	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	132	30	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	132	31	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	32	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	33	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	132	34	lens	lens	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	35	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	132	36	indicated	indicate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	37	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	132	38	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	132	39	white	white	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	132	40	arrowhead	arrowhead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	132	41	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	132	42	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	133	1	GFP	gfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	133	2	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	133	3	green	green	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	133	4	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	133	5	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	133	6	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	133	7	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	133	8	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	133	9	red	red	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	133	10	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	133	11	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	133	12	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	134	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	134	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	134	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	134	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	135	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	135	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	135	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	135	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	135	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	135	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	135	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	135	8	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	135	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	135	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	135	11	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	135	12	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	135	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	135	14	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	135	15	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	135	16	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	135	17	transposition	transposition	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	135	18	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	135	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	136	1	Thus	thus	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	136	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	136	3	while	while	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	4	it	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	136	5	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	136	6	possible	possible	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	136	7	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	136	8	identify	identify	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	136	9	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	10	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	136	11	only	only	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	136	12	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	136	13	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	14	changes	change	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	136	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	16	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	136	17	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	136	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	136	20	vast	vast	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	136	21	majority	majority	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	22	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	23	GFP-	GFP-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	136	24	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	136	25	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	26	represent	represent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	27	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	28	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	136	29	integration	integration	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	136	30	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	136	31	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	137	1	Remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	137	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	137	3	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	137	4	resident	resident	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	137	5	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	137	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	137	7	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	137	8	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	137	9	result	result	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	137	10	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	137	11	chromosomal	chromosomal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	137	12	rearrangements	rearrangement	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	137	13	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	137	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	137	15	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	137	16	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	137	17	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	137	18	34	34	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	137	19	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	137	20	41	41	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	137	21	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	137	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	138	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	2	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	138	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	138	4	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	5	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	7	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	138	8	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	138	9	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	138	11	high	high	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	138	12	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	138	13	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	14	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	15	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	138	16	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	138	17	30	30	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	138	18	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	138	19	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	138	20	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	21	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	138	22	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	23	fre-	fre-	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	138	24	quent	quent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	138	25	alteration	alteration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	138	28	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	138	29	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	138	30	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	138	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	138	32	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	138	33	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	34	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	35	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	138	36	nine	nine	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	138	37	out	out	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	38	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	39	nine	nine	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	138	40	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	41	pedigrees	pedigree	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	138	42	examined	examine	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	43	displayed	display	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	138	44	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	138	45	alterations	alteration	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	138	46	span-	span-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	138	47	ning	ne	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	138	48	105	105	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	138	49	bp	bp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	50	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	51	107	107	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	138	52	bp	bp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	53	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	138	54	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	138	55	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	56	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	138	57	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	138	58	41	41	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	138	59	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	138	60	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	139	1	To	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	139	2	determine	determine	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	139	3	whether	whether	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	4	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	139	5	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	139	8	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	9	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	139	10	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	11	similar	similar	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	139	12	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	139	13	alterations	alteration	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	139	14	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	139	16	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	17	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	139	19	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	139	20	examined	examine	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	139	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	139	22	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	139	23	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	139	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	139	25	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	139	26	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	27	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	28	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	139	29	Excision	Excision	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	139	30	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	139	31	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	32	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	33	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	34	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	35	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	139	36	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	139	37	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	38	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	139	39	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	40	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	41	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	139	42	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	139	43	transgenic	transgenic	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	44	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	139	45	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	139	46	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	140	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	140	2	a	a	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	140	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	140	4	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	140	5	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	140	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	140	7	sibling	sible	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	140	8	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	140	9	derived	derive	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	140	10	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	140	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	140	12	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	140	13	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	140	14	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	140	15	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	140	16	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	140	17	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	140	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	141	1	Tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	141	2	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	141	3	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	141	4	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	141	5	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	141	6	significantly	significantly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	141	7	brighter	bright	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	141	8	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	141	9	their	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	141	10	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	141	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	141	12	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	141	13	siblings	sibling	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	141	14	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	141	15	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	141	16	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	141	17	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	141	18	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	141	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	141	20	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	141	21	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	141	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	142	1	Tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	142	2	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	142	3	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	142	4	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	142	5	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	142	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	142	7	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	142	8	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	142	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	143	1	Dorsal	dorsal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	143	2	view	view	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	143	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	143	4	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	143	5	anterior	anterior	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	143	6	facing	face	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	143	7	towards	towards	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	143	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	143	9	right	right	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	143	10	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	144	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	144	2	b	b	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	144	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	144	4	Representative	representative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	144	5	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	144	6	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	144	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	144	8	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	144	9	population	population	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	144	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	144	11	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	144	12	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	144	13	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	144	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	145	1	Table	table	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	145	2	includes	include	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	145	3	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	145	4	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	145	5	breeding	breed	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	145	6	four	four	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	145	7	F2	f2	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	145	8	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	145	9	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	145	10	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	145	11	54	54	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	145	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	145	13	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	145	14	♂	♂	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	145	15	55	55	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	145	16	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	145	17	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	145	18	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	145	19	56	56	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	145	20	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	145	21	8F	8F	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	145	22	♀	♀	$
work_lg7uwni46nhjxg5pc3yrqf32wy	145	23	61	61	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	145	24	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	145	25	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	145	26	seven	seven	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	145	27	F3	f3	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	145	28	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	145	29	8F35	8f35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	145	30	♂	♂	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	145	31	A	a	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	145	32	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	145	33	B	b	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	145	34	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	145	35	C	c	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	145	36	etc	etc	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	145	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	145	38	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	146	1	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	146	2	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	146	3	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	146	4	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	146	5	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	146	6	wild	wild	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	146	7	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	146	8	type	type	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	146	9	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	146	10	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	147	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	147	2	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	147	3	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	4	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	147	5	scored	score	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	6	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	7	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	147	8	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	9	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	147	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	147	11	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	147	12	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	147	13	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	147	14	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	15	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	147	16	either	either	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	147	17	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	18	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	19	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	20	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	21	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	22	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	147	23	raised	raise	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	24	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	25	adulthood	adulthood	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	26	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	147	27	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	147	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	148	1	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	148	2	range	range	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	4	apparent	apparent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	148	5	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	6	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	7	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	8	0	0	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	148	9	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	10	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	148	11	0.7	0.7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	148	12	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	13	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	148	14	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	16	individual	individual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	148	17	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	18	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	19	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	148	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	148	21	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	22	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	148	23	average	average	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	148	24	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	25	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	26	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	148	27	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	28	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	148	29	per	per	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	30	thousand	thousand	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	148	31	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	148	32	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	148	33	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	148	34	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	35	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	148	36	0.2	0.2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	148	37	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	148	38	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	148	39	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	149	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	149	2	c	c	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	149	4	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	149	5	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	6	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	8	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	149	9	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	149	10	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	11	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	149	13	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	15	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	149	16	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	149	17	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	18	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	149	19	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	149	20	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	150	1	Genomic	Genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	150	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	150	3	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	150	4	digested	digest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	150	5	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	150	6	BglII	BglII	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	150	7	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	150	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	150	9	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	150	10	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	150	11	probed	probe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	150	12	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	150	13	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	150	14	radiolabelled	radiolabelle	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	150	15	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	150	16	cDNA	cdna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	150	17	probe	probe	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	150	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	151	1	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	151	2	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	151	3	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	151	4	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	151	5	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	151	6	lanes	lanes	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	151	7	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	151	8	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	151	9	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	151	10	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	151	11	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	151	12	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	151	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	151	14	same	same	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	151	15	banding	banding	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	151	16	pattern	pattern	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	151	17	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	151	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	151	19	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	151	20	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	151	21	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	151	22	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	151	23	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	151	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	152	1	Lanes	Lanes	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	152	2	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	152	3	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	152	4	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	152	5	show	show	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	152	6	example	example	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	152	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	152	8	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	152	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	152	10	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	152	11	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	152	12	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	152	13	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	153	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	153	2	dashed	dash	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	153	3	arrow	arrow	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	153	4	indicates	indicate	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	153	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	153	6	change	change	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	153	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	153	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	153	9	mobility	mobility	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	153	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	153	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	153	12	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	153	13	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	153	14	harboring	harbor	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	153	15	BglII	BglII	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	153	16	fragment	fragment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	153	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	154	1	Lane	Lane	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	154	2	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	154	3	contains	contain	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	154	4	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	154	5	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	154	6	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	154	7	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	154	8	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	154	9	siblings	sibling	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	154	10	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	155	1	GFP	gfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	155	2	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	155	3	green	green	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	155	4	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	155	5	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	155	6	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	155	7	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	155	8	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	155	9	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	155	10	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	155	11	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	156	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	156	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	156	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	156	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	157	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	157	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	157	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	157	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	157	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	157	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	157	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	157	8	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	157	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	157	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	157	11	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	157	12	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	157	13	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	157	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	158	1	Genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	158	2	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	158	3	samples	sample	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	158	4	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	158	5	eight	eight	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	158	6	remo-	remo-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	158	7	bilization	bilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	158	8	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	158	9	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	158	10	eight	eight	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	158	11	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	158	12	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	158	13	only	only	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	158	14	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	158	15	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	158	16	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	158	17	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	158	18	amplify	amplify	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	158	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	158	20	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	158	21	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	158	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	158	23	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	158	24	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	158	25	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	158	26	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	158	27	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	158	28	ends	end	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	158	29	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	158	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	158	31	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	158	32	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	158	33	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	158	34	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	158	35	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	158	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	159	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	2	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	159	3	case	case	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	159	5	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	159	6	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	159	7	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	159	8	primers	primer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	159	9	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	159	10	amplify	amplify	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	159	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	159	12	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	159	13	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	159	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	159	15	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	159	16	’	’	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	159	17	junctions	junction	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	159	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	159	20	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	159	21	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	22	generated	generate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	159	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	159	24	appropri-	appropri-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	159	25	ate	ate	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	159	26	sized	sized	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	159	27	products	product	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	159	28	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	159	29	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	159	30	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	159	31	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	32	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	159	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	159	34	indicating	indicate	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	159	35	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	159	37	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	159	38	directly	directly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	159	39	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	159	40	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	159	41	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	42	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	43	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	159	44	intact	intact	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	159	45	following	follow	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	159	46	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	47	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	48	pT2bGFP	pt2bgfp	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	159	49	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	159	50	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	51	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	159	52	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	53	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	159	54	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	160	1	Sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	2	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	160	5	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	6	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	7	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	8	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	9	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	160	10	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	160	11	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	160	12	similar	similar	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	160	13	base	base	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	14	distribution	distribution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	15	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	160	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	160	17	canoni-	canoni-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	18	cal	cal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	19	TA	TA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	160	20	dinucleotide	dinucleotide	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	21	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	22	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	160	23	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	24	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	25	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	160	26	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	27	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	160	28	mammalian	mammalian	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	160	29	genomes	genome	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	160	30	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	160	31	42,43	42,43	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	160	32	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	160	33	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	160	34	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	160	35	5d	5d	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	160	36	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	160	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	161	1	Transpo-	transpo-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	161	2	sons	son	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	161	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	161	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	161	5	Tc1	Tc1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	161	6	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	161	7	mariner	mariner	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	161	8	family	family	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	161	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	161	10	including	include	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	161	11	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	161	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	161	13	integrate	integrate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	161	14	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	161	15	TA	TA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	161	16	dinucleotides	dinucleotide	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	161	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	162	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	162	2	consensus	consensus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	3	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	4	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	5	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	162	6	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	8	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	162	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	162	10	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	12	mammals	mammal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	162	13	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	162	14	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	162	15	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	162	16	palindromic	palindromic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	162	17	ATATATAT	ATATATAT	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	162	18	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	162	20	where	where	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	162	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	162	22	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	162	23	TA	TA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	162	24	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	25	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	162	26	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	27	bold	bold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	162	28	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	162	29	although	although	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	30	none	none	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	31	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	32	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	162	33	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	34	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	35	integration	integration	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	162	36	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	162	37	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	38	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	39	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	162	40	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	41	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	162	42	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	162	43	exact	exact	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	162	44	palindrome	palindrome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	162	45	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	163	1	Cloning	clone	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	163	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	163	3	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	4	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	163	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	163	7	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	163	8	loci	loci	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	9	indi-	indi-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	163	10	cated	cat	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	163	11	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	163	13	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	14	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	163	15	frequently	frequently	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	163	16	inte-	inte-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	163	17	grate	grate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	163	18	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	163	20	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	163	21	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	22	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	163	23	Figures	Figures	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	163	24	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	163	25	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	163	26	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	163	27	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	163	28	12	12	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	163	29	out	out	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	30	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	31	15	15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	163	32	classed	class	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	33	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	34	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	163	35	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	163	37	80	80	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	163	38	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	163	39	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	163	40	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	164	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	164	2	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	164	3	cases	case	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	164	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	164	5	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	164	6	iden-	iden-	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	164	7	tified	tifie	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	164	8	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	164	9	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	164	10	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	164	11	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	164	12	re	re	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	164	13	-	-	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	164	14	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	164	15	within	within	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	164	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	164	17	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	164	18	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	164	19	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	164	20	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	164	21	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	164	22	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	164	23	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	164	24	Table	table	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	164	25	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	164	26	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	164	27	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	164	28	6a	6a	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	164	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	164	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	165	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	165	2	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	165	3	identity	identity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	4	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	165	5	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	6	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	165	7	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	165	8	map	map	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	165	9	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	165	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	165	11	chromosomal	chromosomal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	165	12	location	location	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	13	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	165	14	44	44	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	165	15	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	165	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	165	18	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	165	19	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	20	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	165	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	165	22	showed	show	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	165	23	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	165	25	while	while	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	26	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	165	27	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	28	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	165	29	more	more	RBR
work_lg7uwni46nhjxg5pc3yrqf32wy	165	30	frequent	frequent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	165	31	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	165	32	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	33	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	34	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	35	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	36	other	other	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	165	37	chromo-	chromo-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	38	somes	some	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	165	39	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	165	40	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	165	41	detected	detect	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	42	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	165	43	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	165	44	6b	6b	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	165	45	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	165	46	three	three	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	165	47	out	out	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	48	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	49	fifteen	fifteen	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	165	50	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	165	51	20	20	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	165	52	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	53	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	165	54	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	55	integrations	integration	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	165	56	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	165	57	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	165	58	different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	165	59	chromosomes	chromosome	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	165	60	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	165	61	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	166	1	GFP	gfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	2	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	166	3	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	166	4	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	5	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	166	7	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	166	8	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	9	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	166	10	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	11	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	166	12	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	166	13	raised	raise	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	14	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	166	16	adult	adult	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	17	stage	stage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	166	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	166	20	outcrossed	outcrosse	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	166	21	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	166	22	demonstrate	demonstrate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	166	23	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	166	25	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	26	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	166	27	alleles	allele	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	166	28	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	166	29	stably	stably	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	166	30	transmitted	transmit	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	31	through	through	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	32	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	166	33	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	166	34	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	167	1	Genomic	Genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	167	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	167	3	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	167	4	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	5	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	6	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	167	7	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	167	8	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	167	9	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	167	10	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	167	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	167	12	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	167	13	sib-	sib-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	14	lings	ling	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	167	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	167	16	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	17	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	18	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	167	19	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	20	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	167	22	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	23	cloning	clone	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	167	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	167	25	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	167	26	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	27	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	28	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	167	29	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	167	30	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	167	31	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	167	32	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	167	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	168	1	For	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	2	exam-	exam-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	168	3	ple	ple	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	168	5	remobilized	remobilize	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	168	6	female	female	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	168	7	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	8	62E3	62e3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	168	9	produced	produce	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	168	10	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	168	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	168	12	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	168	13	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	168	15	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	16	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	17	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	18	showed	show	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	168	19	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	168	20	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	168	21	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	22	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	168	24	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	168	25	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	168	26	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	168	27	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	168	28	140	140	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	168	29	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	168	30	140:1237072	140:1237072	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	168	31	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	168	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	169	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	169	2	novel	novel	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	3	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	4	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	5	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	6	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	7	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	169	8	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	169	10	same	same	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	169	11	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	12	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	169	14	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	15	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	16	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	169	17	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	18	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	169	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	169	20	linkage	linkage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	21	group	group	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	22	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	169	23	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	169	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	169	25	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	169	26	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	169	27	cM	cm	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	28	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	169	30	paren-	paren-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	169	31	tal	tal	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	169	32	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	169	33	concatemer	concatemer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	169	34	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	169	35	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	169	36	represents	represent	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	169	37	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	169	38	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	169	39	hop	hop	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	40	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	169	41	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	169	42	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	169	43	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	169	44	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	169	45	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	170	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	170	2	62E3	62e3	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	170	3	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	4	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	5	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	170	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	170	8	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	170	9	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	170	10	UTR	UTR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	170	11	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	12	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	170	13	muscle	muscle	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	14	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	170	15	related	relate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	16	coiled	coiled	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	170	17	coil	coil	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	18	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	19	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	170	20	GenBank	GenBank	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	170	21	acces-	acces-	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	22	sion	sion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	23	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	24	XM_002935280.1	XM_002935280.1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	170	25	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	170	26	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	170	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	171	1	7	7	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	171	2	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	171	3	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	171	4	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	171	5	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	171	6	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	171	7	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	171	8	founder	founder	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	9	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	171	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	171	11	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	13	8	8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	171	14	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	171	15	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	171	16	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	171	17	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	171	18	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	19	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	171	20	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	171	21	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	22	within	within	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	23	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	171	24	repeat	repeat	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	25	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	26	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	171	27	38	38	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	171	28	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	171	29	Linkage	Linkage	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	171	30	Group	Group	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	171	31	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	171	32	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	171	33	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	34	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	171	35	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	171	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	171	37	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	171	38	mapped	map	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	39	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	171	40	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	41	fluorescence	fluorescence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	42	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	43	situ	situ	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	44	hybridization	hybridization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	45	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	171	46	FISH	fish	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	47	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	171	48	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	49	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	171	50	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	51	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	171	52	telomere	telomere	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	53	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	54	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	171	55	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	171	56	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	171	57	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	171	58	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	171	59	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	171	60	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	172	1	Table	table	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	172	2	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	172	3	Integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	172	4	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	172	5	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	172	6	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	172	7	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	172	8	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	172	9	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	172	10	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	172	11	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	172	12	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	173	1	Tadpole	Tadpole	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	2	Right	right	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	3	indirect	indirect	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	4	repeat	repeat	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	5	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	173	6	direct	direct	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	173	7	repeats	repeat	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	173	8	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	173	9	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	10	Integration	Integration	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	11	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	12	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	13	’	’	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	173	14	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	173	15	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	16	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	17	’	’	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	173	18	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	173	19	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	20	Parental	Parental	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	21	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	22	GCAACGCTagtcac	GCAACGCTagtcac	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	23	...	...	:
work_lg7uwni46nhjxg5pc3yrqf32wy	173	24	cagttATTGATTa	cagttattgatta	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	25	57:2456981	57:2456981	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	26	pSST739	pSST739	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	27	C7orf72-like	c7orf72-like	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	28	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	29	♂	♂	$
work_lg7uwni46nhjxg5pc3yrqf32wy	173	30	51	51	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	31	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	173	32	498	498	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	33	GCGCAATACTATTATAcagttgaagtcgg	gcgcaatactattatacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	34	57:2452131	57:2452131	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	35	pSST739	pSST739	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	36	C7orf72-like	c7orf72-like	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	37	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	38	♂	♂	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	173	39	51	51	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	40	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	173	41	55	55	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	42	CGGGCCATGATGTATAcagttgaagtcgg	CGGGCCATGATGTATAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	43	pT2bGFPb	pT2bGFPb	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	44	pSST739	pSST739	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	45	C7orf72-like	c7orf72-like	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	46	8F	8F	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	173	47	♀	♀	$
work_lg7uwni46nhjxg5pc3yrqf32wy	173	48	61	61	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	49	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	173	50	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	51	GTGGAGCTCTGAAATAcagttgaagtcgg	GTGGAGCTCTGAAATAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	52	pT2bGFPb	pT2bGFPb	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	53	pSST739	pSST739	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	54	C7orf72-like	c7orf72-like	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	55	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	56	♂	♂	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	173	57	58	58	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	58	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	173	59	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	60	AAAGGCAACACGCGTAcagttgaagtcgg	AAAGGCAACACGCGTAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	61	57:2470830	57:2470830	''
work_lg7uwni46nhjxg5pc3yrqf32wy	173	62	pSST739	pSST739	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	63	C7orf72-like	c7orf72-like	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	173	64	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	65	♂	♂	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	173	66	58	58	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	67	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	173	68	8	8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	69	GAATCTCTGTGATCTAcagttgaagtcgg	GAATCTCTGTGATCTAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	70	57:2491386	57:2491386	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	71	pSST739	pSST739	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	72	C7orf72-like	C7orf72-like	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	73	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	74	♂	♂	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	173	75	C-43	c-43	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	76	CAGAGCTAGATATATAcagttgaagtcgg	cagagctagatatatacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	77	57:2507804	57:2507804	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	78	C7orf72-like	c7orf72-like	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	79	C7orf72-like	c7orf72-like	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	80	8F35	8f35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	81	♀	♀	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	82	F-1	F-1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	83	TGGAAATGCCTATATAcagttgaagtcgg	TGGAAATGCCTATATAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	84	57:2544323	57:2544323	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	85	C7orf72-like	C7orf72-like	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	86	Ikaros	Ikaros	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	87	8F35	8f35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	88	♂	♂	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	89	C-44	c-44	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	90	AAGAAAGCACTTGGTAcagttgaagtcgg	aagaaagcacttggtacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	91	57:2672369	57:2672369	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	92	Dopa	Dopa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	93	decarboxylase	decarboxylase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	94	Dopa	Dopa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	95	decarboxylase	decarboxylase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	96	8F	8F	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	173	97	♀	♀	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	173	98	60	60	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	99	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	173	100	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	101	CCCCCTTCGGTGATTAcagttgaagtcgg	cccccttcggtgattacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	102	57:2897938	57:2897938	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	103	Grb10	Grb10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	104	Cordon	Cordon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	105	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	106	bleu	bleu	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	107	8F35	8f35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	108	♂	♂	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	173	109	A-207	A-207	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	110	ACAAACGGGCCATGTAcagttgaagtcgg	acaaacgggccatgtacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	111	57:2991209	57:2991209	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	112	Grb10	Grb10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	113	Cordon	Cordon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	114	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	115	bleu	bleu	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	116	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	117	♂	♂	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	173	118	58	58	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	119	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	173	120	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	121	TATCTAAACAAAGTTAcagttgaagtcgg	tatctaaacaaagttacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	122	588:587502	588:587502	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	123	Cam	Cam	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	124	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	125	PDE	PDE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	126	1C	1C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	127	Cam	Cam	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	128	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	129	PDE	PDE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	130	1C	1c	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	131	6265	6265	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	132	TCACTACATATTTCTAcagttgaagtcgg	TCACTACATATTTCTAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	133	294:394261	294:394261	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	173	134	PTPRM	PTPRM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	135	PTPRM	ptprm	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	136	8F	8F	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	173	137	♂	♂	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	173	138	58	58	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	139	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	173	140	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	141	TAAGAATTAATAGTTAcagttgaagtcgg	TAAGAATTAATAGTTAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	142	250:752306	250:752306	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	143	c	c	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	144	-	-	:
work_lg7uwni46nhjxg5pc3yrqf32wy	173	145	Fyn	Fyn	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	146	c	c	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	147	-	-	:
work_lg7uwni46nhjxg5pc3yrqf32wy	173	148	Fyn	Fyn	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	149	8F35	8f35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	150	♂	♂	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	173	151	C-35	c-35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	152	TATAAATAAAGATATAcagttgaagtcgg	TATAAATAAAGATATAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	153	223:803513	223:803513	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	154	Connexin	Connexin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	155	31.1	31.1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	156	C1orf94-like	C1orf94-like	:
work_lg7uwni46nhjxg5pc3yrqf32wy	173	157	8F	8F	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	173	158	♂	♂	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	159	B-203	B-203	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	160	AAGGCAGTCAGTTATAcagttgaagtcgg	aaggcagtcagttatacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	161	15:2263789	15:2263789	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	162	RDC-1	RDC-1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	163	COP9	COP9	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	164	8F35	8f35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	165	♂	♂	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	166	A-205	A-205	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	167	GATAACTCTTAAGTTAcagttgaagtcgg	gataactcttaagttacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	168	484:822241	484:822241	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	169	Amphiphysin	Amphiphysin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	170	Amphiphysin	Amphiphysin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	171	Sequences	Sequences	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	173	172	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	173	173	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	173	174	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	173	175	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	176	insertion	insertion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	177	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	178	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	173	179	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	180	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	173	181	extension	extension	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	182	primer	primer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	183	tag	tag	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	184	selection	selection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	185	linker	linker	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	186	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	173	187	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	173	188	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	173	189	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	174	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	174	2	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	3	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	174	4	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	174	5	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	6	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	7	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	174	8	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	9	reactions	reaction	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	174	10	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	174	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	174	12	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	174	13	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	14	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	174	15	italics	italics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	174	16	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	174	17	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	174	18	flanked	flank	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	19	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	174	21	characteristic	characteristic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	174	22	TA	TA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	174	23	dinucleotide	dinucleotide	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	24	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	25	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	26	duplication	duplication	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	174	27	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	174	28	bold	bold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	174	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	174	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	175	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	175	2	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	175	3	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	4	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	175	5	depicted	depict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	7	capital	capital	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	8	letters	letter	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	175	9	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	175	10	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	175	11	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	12	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	175	13	interrogate	interrogate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	175	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	175	15	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	175	16	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	175	17	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	175	18	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	19	database	database	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	175	21	Joint	Joint	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	175	22	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	175	23	Institute	Institute	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	175	24	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	175	25	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	175	26	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	175	27	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	28	assembly	assembly	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	29	v4.1	v4.1	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	30	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	175	31	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	175	32	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	175	33	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	175	34	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	175	35	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	175	36	assign	assign	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	175	37	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	175	38	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	39	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	175	40	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	41	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	175	42	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	175	43	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	175	44	scaffolds	scaffold	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	175	45	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	176	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	176	2	genes	gene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	176	3	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	176	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	176	5	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	176	6	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	176	7	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	176	8	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	176	9	listed	list	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	176	10	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	177	1	aThe	aThe	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	177	2	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	177	3	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	177	4	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	177	5	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	177	6	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	177	7	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	177	8	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	177	9	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	177	10	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	177	11	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	177	12	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	177	13	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	177	14	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	177	15	mechanism	mechanism	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	177	16	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	178	1	bTwo	bTwo	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	178	2	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	178	3	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	178	4	showed	show	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	178	5	reintegration	reintegration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	178	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	178	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	178	8	excised	excised	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	178	9	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	178	10	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	178	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	178	12	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	178	13	concatamer	concatamer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	178	14	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	178	15	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	178	16	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	178	17	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	178	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	179	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	179	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	179	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	179	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	180	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	180	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	180	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	180	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	8	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	180	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	180	11	http://www.ncbi.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=search&term=XM_002935280.1	http://www.ncbi.nih.gov/entrez/query.fcgi?db=Nucleotide&cmd=search&term=XM_002935280.1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	12	Double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	180	13	transgenic	transgenic	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	14	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	180	15	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	16	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	17	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	180	18	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	180	19	generated	generate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	20	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	21	breeding	breed	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	180	22	heterozygous	heterozygous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	180	23	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	24	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	180	25	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	26	F1	F1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	27	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	180	28	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	29	het-	het-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	180	30	erozygous	erozygous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	180	31	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	32	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	180	33	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	34	2	2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	35	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	36	F1	F1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	37	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	180	38	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	180	39	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	180	40	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	180	41	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	42	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	180	43	sorted	sort	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	44	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	45	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	46	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	180	47	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	180	48	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	180	49	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	180	50	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	180	51	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	180	52	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	180	53	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	181	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	181	2	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	181	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	181	4	heterozygous	heterozygous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	181	5	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	181	6	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	181	7	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	8	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	181	9	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	181	10	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	11	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	12	wild	wild	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	181	13	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	181	14	type	type	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	15	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	181	16	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	181	17	remobiliza-	remobiliza-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	181	18	tion	tion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	19	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	181	20	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	181	21	scored	score	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	22	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	181	24	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	25	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	26	observing	observe	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	181	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	181	28	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	181	29	population	population	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	30	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	31	changes	change	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	181	32	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	33	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	181	34	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	181	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	182	1	To	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	2	date	date	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	182	4	ten	ten	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	182	5	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	182	6	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	182	7	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	182	8	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	182	9	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	10	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	11	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	182	12	112	112	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	182	13	remobilized	remobilize	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	182	14	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	182	15	GFP	gfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	16	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	182	17	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	182	18	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	182	19	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	182	20	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	182	21	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	22	identified	identify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	23	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	24	11,646	11,646	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	182	25	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	182	26	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	182	27	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	182	28	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	29	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	182	30	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	31	7a	7a	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	182	32	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	182	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	183	1	Genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	183	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	183	3	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	4	several	several	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	183	5	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	183	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	183	7	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	183	8	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	183	9	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	183	10	analyzed	analyze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	11	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	12	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	183	13	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	14	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	183	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	183	16	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	183	17	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	183	18	verified	verify	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	183	19	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	183	21	banding	banding	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	22	pattern	pattern	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	23	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	183	24	changed	change	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	25	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	183	27	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	183	28	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	183	29	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	183	30	pattern	pattern	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	31	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	183	32	indi-	indi-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	183	33	cative	cative	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	183	34	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	35	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	183	36	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	183	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	184	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	184	2	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	184	3	integra-	integra-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	184	4	tion	tion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	5	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	184	6	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	184	7	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	8	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	184	9	Table	table	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	10	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	184	11	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	184	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	184	13	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	184	14	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	15	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	16	confirmed	confirm	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	184	17	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	184	19	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	20	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	184	21	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	184	22	re	re	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	23	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	24	inte-	inte-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	184	25	grated	grate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	184	26	via	via	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	27	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	184	28	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	184	29	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	184	30	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	31	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	32	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	184	33	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	184	34	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	184	35	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	184	36	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	184	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	185	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	185	2	average	average	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	185	3	apparent	apparent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	185	4	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	185	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	185	6	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	185	7	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	185	8	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	185	9	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	185	10	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	185	11	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	185	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	185	13	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	185	14	five	five	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	185	15	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	185	16	times	time	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	185	17	higher	high	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	185	18	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	185	19	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	185	20	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	185	21	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	185	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	185	23	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	185	24	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	185	25	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	185	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	186	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	186	2	higher	high	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	186	3	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	5	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	6	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	186	9	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	186	10	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	186	11	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	186	12	compared	compare	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	13	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	186	15	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	16	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	186	17	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	186	18	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	186	19	due	due	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	20	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	186	22	increased	increase	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	23	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	24	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	25	potential	potential	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	186	26	substrate	substrate	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	186	27	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	186	28	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	186	30	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	31	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	32	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	186	33	three	three	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	186	34	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	35	8F	8F	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	186	36	compared	compare	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	37	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	38	8	8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	186	39	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	186	40	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	186	41	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	186	42	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	186	43	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	186	44	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	186	45	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	187	1	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	187	2	range	range	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	187	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	187	4	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	187	5	activities	activity	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	187	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	187	7	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	187	8	0	0	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	187	9	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	187	10	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	187	11	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	187	12	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	187	13	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	187	14	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	187	15	noted	note	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	187	16	between	between	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	187	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	187	18	different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	187	19	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	187	20	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	187	21	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	187	22	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	187	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	188	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	188	2	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	188	3	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	188	4	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	188	5	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	188	6	produced	produce	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	188	7	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	188	8	breeding	breed	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	188	9	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	188	10	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	188	11	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	188	12	heterozygous	heterozygous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	188	13	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	188	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	188	15	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	188	16	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	188	17	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	188	18	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	188	19	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	188	20	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	188	21	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	188	22	het-	het-	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	188	23	erozygous	erozygous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	188	24	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	188	25	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	188	26	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	188	27	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	188	28	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	188	29	allele	allele	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	188	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	189	1	Double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	189	2	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	189	3	heterozy-	heterozy-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	4	gous	gous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	189	5	males	male	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	189	6	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	189	7	7Mhopper	7mhopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	8	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	189	9	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	189	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	189	11	7Mhopper	7mhopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	12	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	189	13	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	189	14	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	189	15	7Mhopper	7mhopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	16	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	189	17	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	189	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	189	19	7Mhopper	7Mhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	189	20	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	189	21	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	189	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	189	23	7Mhopper	7Mhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	189	24	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	189	25	14	14	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	189	26	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	189	27	7Mhopper	7mhopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	28	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	189	29	20	20	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	189	30	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	189	31	produced	produce	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	189	32	offspring	offspring	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	33	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	34	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	189	35	average	average	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	189	36	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	37	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	38	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	39	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	189	40	0.44	0.44	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	189	41	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	189	42	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	190	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	190	2	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	4	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	190	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	190	6	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	190	7	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	8	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	190	10	outcrosses	outcrosse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	190	11	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	12	these	these	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	190	13	males	male	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	190	14	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	190	15	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	190	16	50	50	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	190	17	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	190	19	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	20	expected	expect	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	21	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	190	23	Mendelian	mendelian	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	190	24	inheritance	inheritance	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	25	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	190	26	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	190	27	heterozygous	heterozygous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	190	28	dominant	dominant	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	190	29	allele	allele	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	190	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	191	1	Two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	191	2	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	191	3	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	191	4	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	5	male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	191	6	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	191	7	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	191	8	7Mhopper	7mhopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	9	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	191	10	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	191	11	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	191	12	7Mhopper	7Mhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	191	13	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	191	14	11	11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	191	15	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	191	16	produced	produce	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	191	17	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	191	18	much	much	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	191	19	higher	high	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	191	20	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	22	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	23	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	191	24	GFP-	gfp-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	191	25	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	191	26	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	191	27	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	191	28	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	29	their	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	191	30	siblings	sibling	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	191	31	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	191	32	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	191	33	1.9	1.9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	191	34	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	35	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	36	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	191	37	Integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	38	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	39	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	40	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	41	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	191	42	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	191	43	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	191	44	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	192	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	192	2	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	192	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	192	4	Schematic	schematic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	192	5	representation	representation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	192	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	192	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	192	8	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	192	9	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	192	10	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	192	11	showing	show	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	192	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	192	13	predicted	predict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	192	14	orientation	orientation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	192	15	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	192	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	192	17	trimeric	trimeric	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	192	18	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	192	19	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	192	20	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	192	21	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	192	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	193	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	193	2	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	193	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	193	4	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	193	5	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	193	6	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	193	7	occurred	occur	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	193	8	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	193	9	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	193	10	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	193	11	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	193	12	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	193	13	mechanism	mechanism	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	193	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	194	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	194	2	Not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	194	3	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	194	4	scale	scale	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	194	5	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	194	6	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	195	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	195	2	b	b	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	195	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	195	4	Schematic	schematic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	195	5	representation	representation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	195	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	195	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	195	8	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	195	9	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	195	10	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	195	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	195	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	195	13	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	195	14	tadpole	tadpole	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	195	15	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	195	16	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	195	17	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	195	18	4b	4b	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	195	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	196	1	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	196	2	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	196	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	196	4	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	196	5	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	196	6	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	196	7	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	196	8	clone	clone	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	196	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	196	10	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	196	11	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	196	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	196	13	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	196	14	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	196	15	end	end	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	196	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	196	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	196	18	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	196	19	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	196	20	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	196	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	196	22	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	196	23	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	196	24	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	196	25	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	196	26	’	’	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	196	27	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	196	28	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	196	29	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	196	30	verified	verify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	196	31	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	196	32	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	196	33	primers	primer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	196	34	designed	design	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	196	35	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	196	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	196	37	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	196	38	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	196	39	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	197	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	197	2	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	197	3	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	4	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	5	occurred	occur	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	197	6	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	197	8	same	same	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	197	9	scaffold	scaffold	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	10	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	197	11	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	197	12	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	13	position	position	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	14	2544323	2544323	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	197	15	bp	bp	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	197	16	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	197	17	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	197	19	Joint	Joint	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	197	20	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	197	21	Institute	Institute	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	197	22	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	197	23	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	197	24	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	197	25	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	26	assembly	assembly	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	27	v4.1	v4.1	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	28	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	197	30	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	197	31	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	197	32	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	33	locus	locus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	197	34	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	197	35	57:2456981	57:2456981	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	197	36	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	197	37	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	197	38	represented	represent	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	197	39	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	197	40	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	197	41	hop	hop	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	197	42	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	198	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	198	2	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	198	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	198	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	198	5	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	198	6	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	198	7	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	198	8	genomic	genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	198	9	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	198	10	junctions	junction	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	198	11	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	198	12	arrows	arrow	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	198	13	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	198	14	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	198	15	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	198	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	198	17	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	198	18	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	198	19	occurred	occur	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	198	20	via	via	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	198	21	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	198	22	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	198	23	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	198	24	reaction	reaction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	198	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	199	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	199	2	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	199	3	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	199	4	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	199	5	flanked	flank	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	6	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	199	8	expected	expect	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	9	TA	TA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	199	10	dinucleotide	dinucleotide	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	11	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	12	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	13	duplication	duplication	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	14	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	199	15	TSD	TSD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	199	16	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	199	17	bold	bold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	199	18	underlined	underlined	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	199	19	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	199	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	199	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	199	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	199	23	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	199	24	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	199	25	inserted	insert	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	26	precisely	precisely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	199	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	199	28	without	without	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	29	any	any	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	199	30	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	199	31	plasmid	plasmid	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	199	32	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	33	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	34	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	199	35	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	36	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	199	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	200	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	200	2	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	200	3	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	200	4	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	200	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	200	6	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	200	7	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	200	8	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	200	9	capitalized	capitalize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	200	10	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	200	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	200	12	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	200	13	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	200	14	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	200	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	200	16	lowercase	lowercase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	200	17	italics	italic	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	200	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	201	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	201	2	Not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	201	3	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	201	4	scale	scale	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	201	5	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	201	6	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	202	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	202	2	c	c	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	202	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	202	4	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	202	5	preferred	preferred	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	202	6	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	202	7	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	202	8	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	202	9	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	202	10	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	202	11	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	202	12	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	202	13	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	202	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	202	15	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	202	16	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	202	17	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	202	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	203	1	Weblogo	weblogo	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	203	2	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	203	3	http://weblogo.berkeley.edu	http://weblogo.berkeley.edu	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	203	4	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	203	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	203	6	five	five	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	203	7	base	base	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	203	8	pair	pair	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	203	9	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	203	10	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	203	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	203	12	TA	TA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	203	13	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	203	14	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	203	15	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	204	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	204	2	relative	relative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	204	3	size	size	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	204	6	letters	letter	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	204	7	indicates	indicate	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	204	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	204	9	strength	strength	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	204	12	information	information	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	13	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	204	15	y	y	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	16	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	204	17	axis	axis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	204	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	204	19	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	204	21	maximum	maximum	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	22	indicated	indicate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	23	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	204	24	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	204	25	bits	bit	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	204	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	205	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	205	2	table	table	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	205	3	shows	show	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	205	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	205	5	base	base	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	205	6	distribution	distribution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	205	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	205	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	205	9	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	205	10	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	205	11	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	205	12	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	205	13	integration	integration	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	205	14	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	205	15	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	205	16	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	206	1	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	206	2	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	206	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	206	4	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	206	5	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	206	6	extension	extension	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	7	primer	primer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	8	tag	tag	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	9	selection	selection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	10	linker	linker	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	206	12	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	13	polymerase	polymerase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	14	chain	chain	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	15	reaction	reaction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	16	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	206	17	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	206	18	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	206	19	polymerase	polymerase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	20	chain	chain	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	21	reaction	reaction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	206	22	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	206	23	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	206	24	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	206	25	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	206	26	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	206	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	207	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	207	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	207	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	207	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	208	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	208	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	208	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	208	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	208	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	208	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	208	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	208	8	8	8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	208	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	208	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	208	11	http://weblogo.berkeley.edu	http://weblogo.berkeley.edu	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	208	12	compared	compare	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	208	13	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	208	14	0.44	0.44	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	208	15	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	208	16	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	208	17	male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	208	18	sibling	sibling	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	208	19	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	208	20	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	208	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	209	1	Intrigu-	intrigu-	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	209	2	ingly	ingly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	209	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	209	4	these	these	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	209	5	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	209	6	appear	appear	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	209	7	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	209	8	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	209	9	homozygous	homozygous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	209	10	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	209	11	both	both	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	209	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	209	13	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	209	14	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	209	15	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	209	16	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	209	17	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	209	18	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	209	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	209	20	substrate	substrate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	209	21	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	209	22	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	209	23	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	209	24	transgenes	transgene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	209	25	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	209	26	100	100	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	209	27	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	209	28	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	209	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	209	30	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	209	31	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	209	32	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	209	33	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	209	34	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	209	35	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	209	36	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	209	37	nearly	nearly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	209	38	all	all	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	209	39	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	209	40	>	>	XX
work_lg7uwni46nhjxg5pc3yrqf32wy	209	41	98	98	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	209	42	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	209	43	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	209	44	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	209	45	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	209	46	GFP-	GFP-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	209	47	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	209	48	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	210	1	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	210	2	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	3	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	210	6	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	210	7	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	8	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	210	9	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	10	all	all	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	210	11	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	210	13	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	210	14	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	210	15	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	210	16	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	210	17	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	210	18	n	n	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	210	19	=	=	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	210	20	107	107	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	210	21	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	22	7Mhopper	7mhopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	23	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	210	24	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	210	25	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	210	26	n	n	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	210	27	=	=	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	210	28	114	114	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	210	29	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	30	7Mhopper	7mhopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	31	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	210	32	11	11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	210	33	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	210	34	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	210	35	inherited	inherit	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	210	37	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	210	38	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	210	39	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	40	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	210	41	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	210	42	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	210	43	banding	banding	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	44	pattern	pattern	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	45	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	210	46	identical	identical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	210	47	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	48	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	210	49	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	210	50	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	210	51	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	211	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	211	2	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	211	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	211	4	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	211	5	tad-	tad-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	6	poles	pole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	211	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	211	9	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	211	10	populations	population	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	211	11	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	12	7Mhopper	7Mhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	211	13	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	211	14	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	211	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	211	16	7Mhopper	7Mhopper	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	211	17	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	211	18	11	11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	211	19	showed	show	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	211	20	changes	change	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	211	21	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	22	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	211	23	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	211	24	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	211	25	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	26	indicative	indicative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	211	27	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	28	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	29	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	211	30	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	31	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	32	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	33	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	34	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	211	35	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	36	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	37	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	211	38	substrate	substrate	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	211	39	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	40	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	211	41	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	212	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	212	2	rare	rare	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	212	3	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	212	4	<	<	XX
work_lg7uwni46nhjxg5pc3yrqf32wy	212	5	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	212	6	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	7	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	212	8	GFP-	gfp-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	212	9	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	212	10	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	212	11	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	12	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	212	14	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	212	15	populations	population	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	212	16	did	do	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	212	17	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	212	18	inherit	inherit	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	212	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	212	20	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	212	21	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	22	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	23	determined	determined	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	212	24	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	25	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	212	26	Schematic	schematic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	212	27	representation	representation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	28	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	29	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	30	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	212	31	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	212	32	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	212	33	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	212	34	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	212	35	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	212	36	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	212	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	213	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	213	2	a	a	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	213	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	213	4	Local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	213	5	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	213	6	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	213	7	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	213	8	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	213	9	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	213	10	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	213	11	depicts	depict	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	213	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	213	13	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	213	14	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	213	15	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	213	16	eight	eight	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	213	17	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	213	18	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	213	19	<	<	XX
work_lg7uwni46nhjxg5pc3yrqf32wy	213	20	200	200	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	213	21	kb	kb	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	213	22	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	213	23	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	213	24	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	213	25	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	213	26	hops	hops	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	213	27	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	213	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	214	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	214	2	Not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	214	3	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	214	4	scale	scale	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	214	5	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	214	6	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	215	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	215	2	region	region	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	215	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	215	4	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	215	5	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	215	6	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	215	7	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	215	8	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	215	9	syntenic	syntenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	215	10	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	215	11	human	human	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	215	12	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	215	13	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	215	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	216	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	216	2	Vista	Vista	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	216	3	http://genome.lbl.gov/vista	http://genome.lbl.gov/vista	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	216	4	alignment	alignment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	216	5	shows	show	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	6	regions	region	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	216	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	216	8	homology	homology	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	216	9	between	between	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	216	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	216	11	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	216	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	216	13	human	human	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	14	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	15	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	216	16	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	216	17	pink	pink	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	18	represents	represent	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	19	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	20	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	21	coding	coding	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	22	regions	region	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	216	23	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	216	24	blue	blue	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	25	represents	represent	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	26	conserved	conserved	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	216	27	exons	exon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	216	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	217	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	217	2	position	position	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	217	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	217	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	217	5	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	217	6	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	217	7	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	217	8	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	217	9	indicated	indicate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	217	10	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	217	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	217	12	grey	grey	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	217	13	box	box	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	217	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	218	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	218	2	remobilized	remobilized	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	218	3	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	218	4	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	218	5	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	218	6	depicted	depict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	218	7	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	218	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	218	9	grey	grey	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	218	10	triangles	triangle	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	218	11	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	219	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	219	2	position	position	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	3	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	219	4	orientation	orientation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	6	predicted	predict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	7	genes	gene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	219	8	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	219	10	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	219	11	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	12	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	219	13	depicted	depict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	219	16	lower	low	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	219	17	section	section	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	219	20	panel	panel	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	219	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	220	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	220	2	b	b	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	220	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	220	4	Schematic	schematic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	220	5	representation	representation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	220	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	220	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	220	8	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	220	9	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	220	10	chromosomes	chromosome	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	220	11	indicating	indicate	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	220	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	220	13	distribution	distribution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	220	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	220	15	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	220	16	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	220	17	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	220	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	221	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	221	2	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	221	3	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	221	4	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	221	5	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	221	6	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	221	7	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	221	8	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	221	9	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	221	10	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	221	11	thick	thick	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	221	12	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	221	13	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	221	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	222	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	222	2	predicted	predict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	222	3	loci	loci	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	222	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	222	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	222	6	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	222	7	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	222	8	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	222	9	depicted	depict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	222	10	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	222	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	222	12	thin	thin	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	222	13	black	black	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	222	14	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	222	15	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	223	1	Approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	223	2	80	80	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	223	3	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	223	6	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	7	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	223	8	occur	occur	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	223	9	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	223	11	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	12	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	13	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	223	14	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	223	15	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	16	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	223	17	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	223	18	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	223	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	223	20	remaining	remain	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	223	21	20	20	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	223	22	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	23	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	223	24	distributed	distribute	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	25	randomly	randomly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	223	26	throughout	throughout	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	223	28	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	223	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	224	1	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	224	2	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	224	3	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	224	4	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	224	5	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	225	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	225	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	225	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	225	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	226	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	226	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	226	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	226	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	226	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	226	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	226	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	226	8	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	226	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	226	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	226	11	http://genome.lbl.gov/vista	http://genome.lbl.gov/vista	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	226	12	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	226	13	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	226	14	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	226	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	226	16	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	226	17	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	226	18	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	226	19	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	226	20	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	226	21	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	226	22	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	226	23	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	226	24	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	226	25	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	226	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	227	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	227	2	unexpected	unexpected	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	227	3	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	227	4	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	227	5	Mendelian	mendelian	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	227	6	inheritance	inheritance	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	8	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	227	9	7M	7m	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	227	10	♂	♂	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	227	11	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	227	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	227	13	7M	7m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	14	♂	♂	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	227	15	11	11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	227	16	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	227	17	unex-	unex-	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	227	18	plained	plain	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	19	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	227	20	however	however	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	227	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	227	22	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	227	23	data	data	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	24	suggests	suggest	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	227	25	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	26	increasing	increase	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	227	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	227	28	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	29	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	30	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	227	32	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	227	33	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	227	34	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	35	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	227	36	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	37	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	227	38	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	227	39	increase	increase	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	227	40	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	227	41	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	42	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	43	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	44	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	45	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	227	46	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	227	47	population	population	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	227	48	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	228	1	To	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	228	2	date	date	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	228	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	228	4	four	four	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	228	5	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	228	6	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	228	7	female	female	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	228	8	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	228	9	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	228	10	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	228	11	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	228	12	out-	out-	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	228	13	crossed	crossed	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	228	14	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	228	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	228	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	228	17	mean	mean	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	228	18	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	228	19	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	228	20	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	228	21	these	these	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	228	22	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	228	23	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	228	24	2.54	2.54	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	228	25	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	228	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	229	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	229	2	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	229	3	reflect	reflect	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	229	4	individual	individual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	229	5	differences	difference	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	229	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	7	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	8	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	229	9	reintegration	reintegration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	10	activities	activity	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	229	11	between	between	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	12	different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	229	13	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	14	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	229	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	229	16	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	229	17	it	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	229	18	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	229	19	indicate	indicate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	229	20	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	229	21	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	229	23	driven	drive	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	24	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	25	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	229	26	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	229	27	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	229	28	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	229	29	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	229	31	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	229	32	more	more	RBR
work_lg7uwni46nhjxg5pc3yrqf32wy	229	33	efficient	efficient	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	229	34	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	35	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	229	36	female	female	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	229	37	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	38	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	229	39	mean	mean	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	229	40	2.54	2.54	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	229	41	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	42	;	;	,
work_lg7uwni46nhjxg5pc3yrqf32wy	229	43	n	n	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	229	44	=	=	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	229	45	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	229	46	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	229	47	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	48	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	49	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	229	50	male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	229	51	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	52	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	229	53	mean	mean	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	229	54	0.76	0.76	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	229	55	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	56	;	;	,
work_lg7uwni46nhjxg5pc3yrqf32wy	229	57	n	n	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	229	58	=	=	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	229	59	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	229	60	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	229	61	unpaired	unpaired	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	229	62	Student	Student	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	229	63	’s	’s	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	229	64	t-	t-	XX
work_lg7uwni46nhjxg5pc3yrqf32wy	229	65	test	test	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	66	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	229	67	P	p	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	68	=	=	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	229	69	0.0088	0.0088	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	229	70	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	229	71	degrees	degree	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	229	72	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	73	freedom	freedom	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	229	74	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	229	75	11	11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	229	76	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	229	77	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	230	1	With	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	230	3	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	4	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	230	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	230	6	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	230	7	observed	observe	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	230	8	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	230	9	modest	modest	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	230	10	increase	increase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	230	13	mean	mean	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	230	14	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	15	efficiency	efficiency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	16	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	230	18	female	female	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	230	19	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	230	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	230	21	0.56	0.56	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	230	22	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	23	;	;	,
work_lg7uwni46nhjxg5pc3yrqf32wy	230	24	n	n	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	25	=	=	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	230	26	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	230	27	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	230	28	compared	compare	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	29	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	230	31	male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	230	32	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	230	33	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	230	34	0.25	0.25	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	230	35	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	36	;	;	,
work_lg7uwni46nhjxg5pc3yrqf32wy	230	37	n	n	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	230	38	=	=	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	230	39	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	230	40	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	230	41	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	230	42	however	however	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	230	43	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	230	44	due	due	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	45	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	46	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	230	47	small	small	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	230	48	sample	sample	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	49	size	size	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	50	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	230	51	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	230	52	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	230	53	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	230	54	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	230	55	statistically	statistically	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	230	56	significant	significant	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	230	57	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	230	58	Student	student	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	59	’s	’s	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	230	60	t	t	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	61	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	230	62	test	test	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	63	P	p	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	64	=	=	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	230	65	0.25	0.25	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	230	66	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	230	67	degrees	degree	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	230	68	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	69	freedom	freedom	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	230	70	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	230	71	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	230	72	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	230	73	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	231	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	231	2	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	231	3	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	231	4	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	231	5	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	231	6	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	231	7	located	locate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	231	8	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	231	9	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	231	10	38	38	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	231	11	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	231	12	maps	map	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	231	13	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	231	14	chromosome	chromosome	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	231	15	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	231	16	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	231	17	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	231	18	7b	7b	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	231	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	231	20	7c	7c	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	231	21	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	231	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	232	1	Genomic	Genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	232	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	232	3	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	4	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	5	representative	representative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	232	6	GFP-	GFP-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	232	7	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	232	8	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	232	9	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	232	11	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	232	12	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	232	13	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	14	outcrosses	outcrosse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	232	15	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	232	16	ana-	ana-	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	232	17	lyzed	lyze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	18	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	19	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	232	20	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	232	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	232	23	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	232	24	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	25	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	232	26	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	232	27	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	28	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	232	29	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	232	30	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	232	31	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	232	32	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	232	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	233	1	As	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	2	noted	note	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	3	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	233	5	remo-	remo-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	6	bilized	bilized	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	233	7	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	233	8	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	9	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	10	above	above	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	233	11	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	233	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	233	13	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	233	14	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	15	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	233	16	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	233	18	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	233	19	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	233	20	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	233	21	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	233	22	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	233	23	SB-	SB-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	233	24	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	25	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	233	26	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	233	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	234	1	As	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	2	determined	determine	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	3	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	234	5	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	6	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	234	7	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	234	9	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	10	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	11	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	234	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	234	13	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	234	14	strong	strong	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	234	15	bias	bias	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	16	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	17	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	234	18	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	19	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	20	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	21	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	234	22	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	23	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	234	25	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	234	26	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	234	27	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	234	28	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	234	29	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	30	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	31	integration	integration	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	234	32	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	234	33	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	34	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	234	35	same	same	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	234	36	scaffold	scaffold	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	37	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	234	38	scaffold	scaffold	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	234	39	38	38	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	234	40	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	234	41	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	42	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	234	43	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	234	44	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	45	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	234	46	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	47	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	234	48	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	234	49	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	234	50	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	234	51	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	234	52	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	234	53	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	235	1	Discussion	Discussion	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	235	2	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	235	3	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	235	4	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	235	5	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	235	6	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	8	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	235	9	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	235	10	Here	here	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	235	11	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	235	12	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	235	13	demonstrate	demonstrate	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	235	14	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	15	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	235	16	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	235	17	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	18	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	235	20	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	21	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	22	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	235	23	effective	effective	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	235	24	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	235	25	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	26	remobi-	remobi-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	235	27	lization	lization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	28	following	follow	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	235	29	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	30	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	31	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	32	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	33	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	235	34	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	235	35	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	235	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	236	1	Unlike	unlike	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	236	3	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	4	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	236	5	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	236	8	co	co	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	9	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	10	injec-	injec-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	236	11	tion	tion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	12	strategy	strategy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	13	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	236	14	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	236	15	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	16	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	17	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	236	18	complex	complex	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	236	19	non-	non-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	20	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	236	21	mechanism	mechanism	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	236	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	236	24	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	25	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	236	26	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	236	27	re	re	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	28	-	-	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	29	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	30	via	via	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	31	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	236	32	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	236	33	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	236	34	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	35	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	236	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	237	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	237	2	observed	observed	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	237	3	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	237	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	237	5	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	237	6	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	237	7	subsequent	subsequent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	237	8	re-	re-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	237	9	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	237	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	237	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	237	12	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	237	13	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	237	14	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	237	15	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	237	16	low	low	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	237	17	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	237	18	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	237	19	average	average	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	237	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	237	21	less	less	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	237	22	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	237	23	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	237	24	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	237	25	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	237	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	238	1	Our	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	238	2	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	238	3	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	4	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	238	5	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	238	6	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	238	7	similar	similar	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	238	8	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	9	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	238	10	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	12	other	other	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	238	13	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	14	vitro	vitro	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	238	15	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	238	16	45	45	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	238	17	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	238	18	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	238	19	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	20	vivo	vivo	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	238	21	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	238	22	19,46,47	19,46,47	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	238	23	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	238	24	systems	system	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	238	25	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	238	26	where	where	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	238	27	low	low	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	238	28	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	238	29	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	30	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	31	trans-	trans-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	238	32	poson	poson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	238	33	donor	donor	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	238	34	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	238	35	served	serve	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	238	36	poorly	poorly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	238	37	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	38	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	238	39	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	40	remo-	remo-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	238	41	bilization	bilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	238	42	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	239	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	2	mammals	mammal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	239	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	239	4	increasing	increase	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	239	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	239	6	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	8	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	239	9	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	239	10	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	11	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	239	12	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	13	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	239	14	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	239	15	contain	contain	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	239	16	high	high	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	239	17	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	239	18	order	order	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	19	concatemers	concatemer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	239	20	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	239	21	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	22	increased	increase	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	23	remobili-	remobili-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	24	zation	zation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	25	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	239	26	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	239	27	19,46	19,46	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	239	28	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	239	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	240	1	For	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	2	example	example	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	240	4	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	5	AB1	AB1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	240	6	embryonic	embryonic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	240	7	stem	stem	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	8	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	240	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	240	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	240	11	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	240	12	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	240	13	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	240	14	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	240	15	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	240	16	knocked	knock	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	17	in	in	RP
work_lg7uwni46nhjxg5pc3yrqf32wy	240	18	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	240	19	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	240	21	Hprt	Hprt	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	240	22	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	23	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	240	25	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	26	X	x	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	27	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	28	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	240	29	subse-	subse-	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	240	30	quent	quent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	240	31	transient	transient	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	240	32	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	33	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	34	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	240	35	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	36	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	240	37	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	240	38	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	240	39	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	240	40	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	41	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	240	42	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	43	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	44	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	45	circa	circa	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	46	3.5	3.5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	240	47	×	×	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	240	48	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	240	49	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	240	50	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	240	51	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	240	52	per	per	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	53	cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	54	per	per	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	55	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	240	56	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	240	57	45	45	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	240	58	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	240	59	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	241	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	2	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	241	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	241	4	low	low	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	241	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	241	6	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	7	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	8	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	241	9	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	241	10	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	11	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	241	12	result	result	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	241	13	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	14	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	241	15	low	low	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	241	16	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	17	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	18	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	19	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	241	20	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	241	21	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	241	22	passed	pass	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	23	through	through	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	241	25	germ-	germ-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	26	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	241	27	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	241	28	19,47	19,47	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	241	29	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	241	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	242	1	For	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	2	example	example	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	242	4	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	242	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	242	6	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	7	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	242	8	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	242	9	donors	donor	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	242	10	result	result	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	242	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	12	novel	novel	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	13	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	14	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	15	integration	integration	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	242	16	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	242	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	18	approxi-	approxi-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	242	19	mately	mately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	242	20	one	one	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	242	21	embryo	embryo	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	22	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	23	every	every	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	242	24	one	one	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	242	25	hundred	hundred	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	242	26	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	242	27	around	around	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	242	28	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	242	29	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	30	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	242	31	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	32	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	242	33	outcross	outcross	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	34	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	35	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	242	36	transgenic	transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	242	37	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	242	38	seed	seed	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	242	39	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	242	40	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	242	41	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	242	42	47	47	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	242	43	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	242	44	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	243	1	Increasing	increase	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	243	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	243	3	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	5	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	243	6	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	243	7	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	8	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	243	9	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	10	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	243	11	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	243	12	contain	contain	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	243	13	high	high	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	243	14	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	243	15	order	order	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	16	concatemers	concatemer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	243	17	resulted	result	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	243	18	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	19	increased	increase	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	20	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	21	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	22	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	243	23	however	however	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	243	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	243	25	Geurts	Geurts	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	243	26	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	243	27	colleagues	colleague	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	243	28	noted	note	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	243	29	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	30	there	there	EX
work_lg7uwni46nhjxg5pc3yrqf32wy	243	31	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	243	32	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	243	33	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	243	34	linear	linear	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	243	35	correlation	correlation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	36	between	between	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	37	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	38	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	39	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	40	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	41	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	243	42	remo-	remo-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	243	43	bilization	bilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	44	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	243	45	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	243	46	47	47	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	243	47	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	243	48	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	244	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	244	2	suggests	suggest	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	244	3	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	4	other	other	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	244	5	factors	factor	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	244	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	244	7	such	such	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	244	8	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	244	10	methylation	methylation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	11	status	status	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	244	13	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	244	14	other	other	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	244	15	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	244	16	chroma-	chroma-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	244	17	tin	tin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	18	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	244	19	environment	environment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	20	factors	factor	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	244	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	244	22	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	244	23	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	244	24	influence	influence	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	244	25	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	244	26	ability	ability	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	27	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	28	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	29	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	244	30	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	244	31	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	244	32	serve	serve	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	244	33	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	34	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	244	35	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	36	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	244	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	245	1	Horie	Horie	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	245	2	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	245	3	colleagues	colleague	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	245	4	observed	observe	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	245	5	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	6	low-	low-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	7	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	8	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	9	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	245	10	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	245	11	concatemers	concatemer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	245	12	served	serve	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	245	13	very	very	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	245	14	poorly	poorly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	245	15	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	16	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	245	17	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	18	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	19	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	20	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	245	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	245	22	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	245	23	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	245	25	presence	presence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	27	more	more	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	245	28	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	245	29	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	245	31	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	245	32	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	245	33	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	34	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	245	35	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	36	acted	act	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	245	37	synergistically	synergistically	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	245	38	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	245	39	increase	increase	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	245	40	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	245	41	fre-	fre-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	245	42	quency	quency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	43	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	44	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	45	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	245	46	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	47	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	48	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	245	49	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	246	1	With	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	2	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	246	3	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	4	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	5	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	246	6	contained	contain	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	246	7	around	around	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	246	8	20	20	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	246	9	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	246	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	246	12	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	246	13	sub-	sub-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	246	14	strate	strate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	246	16	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	246	17	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	18	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	20	1.25	1.25	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	246	21	transpositions	transposition	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	246	22	per	per	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	23	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	24	per	per	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	25	animal	animal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	26	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	246	27	125	125	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	246	28	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	246	30	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	246	31	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	246	32	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	246	33	19	19	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	246	34	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	246	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	247	1	Keng	Keng	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	247	2	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	247	3	colleagues	colleague	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	247	4	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	247	5	reported	report	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	247	6	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	247	7	similar	similar	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	247	8	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	9	fre-	fre-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	10	quency	quency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	11	when	when	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	247	12	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	247	13	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	247	14	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	247	15	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	247	16	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	247	17	con-	con-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	18	tained	taine	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	247	19	either	either	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	247	20	20	20	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	247	21	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	247	22	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	247	23	1.16	1.16	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	247	24	transpositions	transposition	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	247	25	per	per	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	26	GFP-	gfp-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	247	27	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	247	28	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	247	30	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	247	31	100	100	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	247	32	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	247	33	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	247	34	1.14	1.14	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	247	35	transpositions	transposition	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	247	36	per	per	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	37	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	247	38	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	247	39	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	247	40	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	41	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	247	42	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	43	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	247	44	substrate	substrate	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	247	45	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	247	46	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	47	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	247	48	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	49	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	247	50	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	247	51	46	46	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	247	52	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	247	53	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	248	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	2	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	248	3	study	study	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	248	5	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	248	6	used	use	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	248	7	low	low	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	248	8	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	248	9	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	10	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	11	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	12	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	248	13	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	14	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	248	15	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	16	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	17	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	248	19	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	20	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	248	21	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	22	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	248	24	plasmid	plasmid	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	248	25	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	248	26	mRNA	mRNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	248	27	co	co	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	28	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	29	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	30	strategy	strategy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	31	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	248	32	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	33	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	34	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	248	35	complex	complex	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	248	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	248	37	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	248	38	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	248	39	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	248	40	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	41	mechanism	mechanism	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	248	42	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	248	43	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	248	44	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	248	45	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	249	1	We	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	249	2	reasoned	reason	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	249	3	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	249	5	if	if	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	6	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	249	7	similar	similar	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	249	8	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	249	9	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	249	10	cano-	cano-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	249	11	nical	nical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	249	12	mechanism	mechanism	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	13	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	249	14	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	249	17	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	18	step	step	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	249	20	starting	start	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	249	21	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	22	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	249	23	simple	simple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	249	24	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	25	would	would	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	249	26	help	help	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	249	27	facilitate	facilitate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	249	28	cloning	clone	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	249	29	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	249	31	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	32	event	event	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	249	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	250	1	Although	although	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	250	3	remo-	remo-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	250	4	bilization	bilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	5	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	6	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	250	9	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	250	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	250	12	dou-	dou-	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	250	13	ble	ble	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	250	14	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	250	15	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	250	16	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	250	17	low	low	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	250	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	250	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	250	20	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	21	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	22	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	23	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	250	24	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	250	25	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	250	26	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	250	27	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	250	28	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	250	29	transpositions	transposition	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	250	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	251	1	There	there	EX
work_lg7uwni46nhjxg5pc3yrqf32wy	251	2	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	251	3	several	several	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	251	4	strategies	strategy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	251	5	available	available	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	251	6	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	251	7	increase	increase	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	251	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	251	9	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	251	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	251	11	remobili-	remobili-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	251	12	zation	zation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	251	13	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	251	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	251	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	251	16	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	251	17	genome	genome	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	251	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	252	1	Increasing	increase	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	252	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	252	3	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	4	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	6	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	252	7	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	252	8	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	252	9	will	will	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	252	10	likely	likely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	252	11	signifi-	signifi-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	12	cantly	cantly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	252	13	increase	increase	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	252	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	252	15	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	17	novel	novel	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	18	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	19	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	20	integration	integration	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	252	21	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	252	22	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	252	24	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	252	25	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	26	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	27	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	252	28	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	252	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	253	1	Transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	253	2	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	253	3	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	253	4	multiple	multiple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	253	5	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	253	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	253	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	253	8	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	253	9	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	253	10	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	253	11	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	253	12	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	254	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	254	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	254	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	254	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	254	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	254	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	254	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	254	8	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	254	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	254	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	254	11	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	254	12	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	254	13	Transposon	Transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	254	14	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	254	15	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	254	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	254	17	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	254	18	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	254	19	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	254	20	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	254	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	255	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	255	2	a	a	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	255	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	255	4	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	255	5	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	255	6	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	255	7	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	255	8	nine	nine	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	255	9	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	255	10	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	255	11	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	255	12	adults	adult	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	255	13	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	255	14	scored	score	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	255	15	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	255	16	changes	change	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	255	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	255	18	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	255	19	intensity	intensity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	255	20	indicative	indicative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	255	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	255	22	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	255	23	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	255	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	256	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	256	2	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	256	3	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	256	4	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	256	5	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	256	6	contains	contain	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	256	7	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	256	8	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	256	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	256	10	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	256	11	eight	eight	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	256	12	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	256	13	ten	ten	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	256	14	pT2bGFP	pt2bgfp	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	256	15	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	256	16	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	256	17	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	256	18	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	256	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	257	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	257	2	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	257	3	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	257	4	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	257	5	expressed	express	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	257	6	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	257	7	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	257	8	percentage	percentage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	257	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	257	10	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	257	11	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	257	12	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	257	13	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	257	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	257	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	257	16	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	257	17	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	257	18	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	257	19	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	257	20	population	population	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	257	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	258	1	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	2	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	3	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	4	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	258	5	7M	7m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	6	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	7	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	8	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	258	9	7M	7m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	10	♂	♂	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	258	11	11	11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	12	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	13	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	258	14	functionally	functionally	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	258	15	homozygous	homozygous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	258	16	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	258	17	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	18	both	both	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	258	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	258	20	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	21	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	22	allele	allele	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	23	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	258	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	258	25	transposase	transposase	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	26	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	258	27	transgene	transgene	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	28	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	258	29	see	see	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	258	30	text	text	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	31	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	32	details	detail	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	258	33	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	258	34	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	258	35	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	258	36	display	display	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	258	37	higher	high	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	258	38	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	39	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	40	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	258	41	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	258	42	1.8	1.8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	43	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	44	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	258	45	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	46	their	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	258	47	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	258	48	heterozygous	heterozygous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	258	49	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	258	50	male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	258	51	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	52	littermates	littermate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	258	53	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	258	54	7M	7m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	55	♂	♂	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	258	56	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	57	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	258	58	7M	7m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	59	♂	♂	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	258	60	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	61	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	258	62	7M	7m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	63	♂	♂	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	258	64	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	65	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	258	66	7M	7M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	67	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	68	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	69	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	258	70	7M	7m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	71	♂	♂	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	258	72	14	14	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	73	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	258	74	7M	7m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	75	♂	♂	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	258	76	20	20	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	77	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	258	78	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	258	79	0.44	0.44	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	258	80	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	258	81	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	258	82	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	259	1	Outcross	Outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	259	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	259	3	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	259	4	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	259	5	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	259	6	7M	7m	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	259	7	♀	♀	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	259	8	25	25	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	259	9	produced	produce	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	259	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	259	11	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	259	12	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	259	13	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	259	14	>	>	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	259	15	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	259	16	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	259	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	260	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	260	2	b	b	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	260	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	260	4	Schematic	schematic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	260	5	representation	representation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	260	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	260	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	260	8	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	260	9	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	260	10	chromosomes	chromosome	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	260	11	indicating	indicate	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	260	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	260	13	distribution	distribution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	260	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	260	15	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	260	16	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	260	17	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	260	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	261	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	261	2	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	261	3	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	261	4	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	261	5	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	261	6	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	261	7	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	261	8	thick	thick	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	261	9	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	261	10	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	261	11	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	261	12	located	locate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	261	13	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	261	14	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	261	15	38	38	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	261	16	which	which	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	261	17	maps	map	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	261	18	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	261	19	chromosome	chromosome	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	261	20	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	261	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	262	1	Remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	262	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	262	3	discrete	discrete	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	262	4	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	262	5	away	away	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	262	6	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	262	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	262	8	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	262	9	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	262	10	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	262	11	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	262	12	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	262	13	represented	represent	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	262	14	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	262	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	262	16	grey	grey	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	262	17	arrows	arrow	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	262	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	263	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	263	2	Not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	263	3	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	263	4	scale	scale	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	263	5	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	263	6	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	264	1	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	264	2	c	c	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	3	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	264	4	Fluorescence	Fluorescence	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	264	5	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	6	situ	situ	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	7	hybridization	hybridization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	8	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	9	metaphase	metaphase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	10	chromosomes	chromosome	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	264	11	verifies	verifie	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	264	12	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	264	14	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	264	15	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	264	16	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	264	17	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	18	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	19	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	264	20	located	locate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	21	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	22	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	264	23	telomere	telomere	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	24	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	25	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	264	26	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	264	27	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	264	28	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	264	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	265	1	GFP	gfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	265	2	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	265	3	green	green	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	265	4	fluorescence	fluorescence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	265	5	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	265	6	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	265	7	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	265	8	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	265	9	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	265	10	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	265	11	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	266	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	266	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	266	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	266	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	267	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	267	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	267	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	267	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	267	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	267	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	267	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	267	8	11	11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	267	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	267	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	267	11	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	267	12	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	267	13	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	267	14	generated	generate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	267	15	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	267	16	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	267	17	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	267	18	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	267	19	♀	♀	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	267	20	622E	622E	,
work_lg7uwni46nhjxg5pc3yrqf32wy	267	21	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	267	22	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	267	23	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	267	24	harbor	harbor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	267	25	more	more	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	267	26	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	267	27	seven	seven	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	267	28	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	267	29	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	267	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	267	31	pT2bGFP	pt2bgfp	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	267	32	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	267	33	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	267	34	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	267	35	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	267	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	268	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	268	2	total	total	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	268	3	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	5	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	268	6	sub-	sub-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	268	7	strates	strate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	268	8	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	9	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	268	10	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	11	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	12	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	268	13	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	268	14	further	further	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	268	15	increased	increase	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	16	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	17	incrossing	incrosse	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	268	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	268	19	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	20	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	268	21	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	22	other	other	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	268	23	pT2bGFP	pt2bgfp	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	268	24	foun-	foun-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	268	25	ders	der	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	268	26	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	268	27	contain	contain	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	268	28	multiple	multiple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	268	29	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	268	30	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	268	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	268	32	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	268	33	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	268	34	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	269	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	2	addition	addition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	3	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	4	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	5	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	6	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	269	7	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	8	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	269	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	269	11	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	269	12	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	13	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	269	14	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	269	15	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	269	16	influence	influence	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	269	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	269	18	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	19	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	20	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	269	22	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	269	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	270	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	270	2	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	270	3	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	270	4	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	270	5	frog	frog	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	270	6	described	describe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	270	7	here	here	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	270	8	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	270	9	generated	generate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	270	10	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	270	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	270	12	first	first	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	270	13	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	270	14	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	270	15	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	270	16	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	270	17	SB10	sb10	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	270	18	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	270	19	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	270	20	24	24	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	270	21	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	270	22	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	270	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	271	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	2	recent	recent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	271	3	years	year	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	271	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	271	5	several	several	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	271	6	hyperactive	hyperactive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	271	7	mutant	mutant	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	271	8	forms	form	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	271	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	271	11	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	271	12	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	271	13	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	271	14	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	15	developed	develop	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	16	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	271	17	including	include	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	271	18	SB11	SB11	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	271	19	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	271	20	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	271	21	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	271	22	three	three	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	271	23	-	-	:
work_lg7uwni46nhjxg5pc3yrqf32wy	271	24	fold	fold	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	271	25	higher	high	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	271	26	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	27	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	271	28	48	48	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	271	29	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	271	30	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	271	31	SB100X	sb100x	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	32	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	271	33	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	271	34	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	271	35	100-fold	100-fold	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	271	36	increase	increase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	37	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	38	enzymatic	enzymatic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	271	39	activ-	activ-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	271	40	ity	ity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	41	when	when	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	271	42	compared	compare	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	43	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	271	44	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	271	45	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	271	46	49	49	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	271	47	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	271	48	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	272	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	2	addition	addition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	3	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	272	5	choice	choice	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	7	modified	modify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	8	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	272	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	272	10	different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	272	11	promoters	promoter	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	272	12	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	13	varying	vary	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	272	14	transcriptional	transcriptional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	272	15	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	16	could	could	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	272	17	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	272	18	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	19	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	272	20	drive	drive	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	272	21	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	22	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	272	24	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	272	25	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	26	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	272	27	enhance	enhance	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	272	28	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	272	29	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	30	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	31	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	32	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	272	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	273	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	273	2	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	273	3	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	273	4	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	273	5	as	as	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	273	6	simple	simple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	273	7	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	8	finding	find	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	273	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	273	10	most	most	RBS
work_lg7uwni46nhjxg5pc3yrqf32wy	273	11	powerful	powerful	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	273	12	promoter	promoter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	13	and/or	and/or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	273	14	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	15	available	available	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	273	16	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	273	17	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	18	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	273	19	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	273	20	sensitive	sensitive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	273	21	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	22	overproduction	overproduction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	23	inhibition	inhibition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	273	25	where	where	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	273	26	increasing	increase	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	273	27	levels	level	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	273	28	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	29	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	273	30	impair	impair	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	273	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	273	32	overall	overall	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	273	33	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	34	efficiency	efficiency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	273	35	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	273	36	48	48	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	273	37	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	273	38	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	274	1	Why	why	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	274	2	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	274	3	different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	274	4	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	274	5	mechanisms	mechanism	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	274	6	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	274	7	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	274	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	274	9	co	co	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	274	10	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	274	11	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	274	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	274	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	274	14	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	274	15	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	274	16	strategies	strategy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	274	17	?	?	.
work_lg7uwni46nhjxg5pc3yrqf32wy	275	1	There	there	EX
work_lg7uwni46nhjxg5pc3yrqf32wy	275	2	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	275	3	several	several	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	275	4	possible	possible	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	275	5	reasons	reason	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	275	6	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	275	8	different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	275	9	inte-	inte-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	275	10	gration	gration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	11	mechanisms	mechanism	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	275	12	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	13	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	275	15	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	275	16	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	275	17	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	275	18	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	19	meth-	meth-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	20	ods	od	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	275	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	275	22	that	that	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	275	23	is	is	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	275	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	275	25	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	26	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	275	27	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	28	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	275	29	breeding	breed	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	275	30	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	275	31	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	32	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	275	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	276	1	First	first	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	276	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	276	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	276	4	concentration	concentration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	276	7	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	8	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	276	9	vastly	vastly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	276	10	higher	high	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	276	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	276	13	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	14	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	15	where	where	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	276	16	approxi-	approxi-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	276	17	mately	mately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	276	18	75	75	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	276	19	pg	pg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	276	21	around	around	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	22	10.8	10.8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	276	23	×	×	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	276	24	106	106	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	276	25	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	276	26	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	276	27	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	28	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	276	29	plasmid	plasmid	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	30	harboring	harbor	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	276	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	276	32	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	276	33	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	276	34	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	35	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	276	36	co	co	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	37	-	-	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	38	injected	inject	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	39	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	40	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	276	41	mRNA	mrna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	276	42	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	277	1	By	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	2	comparison	comparison	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	277	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	277	5	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	277	6	8F	8f	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	7	foun-	foun-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	277	8	der	der	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	9	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	10	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	277	12	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	277	13	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	14	strategy	strategy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	15	con-	con-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	16	tained	taine	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	277	17	three	three	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	277	18	copies	copy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	277	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	277	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	277	21	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	277	22	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	277	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	278	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	278	2	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	278	3	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	278	4	catalyzes	catalyze	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	278	5	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	278	6	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	278	7	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	278	8	dimer	dimer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	278	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	278	10	dimers	dimer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	278	11	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	278	12	tetramer	tetramer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	278	13	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	278	14	bound	bind	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	278	15	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	278	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	278	17	indirect	indirect	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	278	18	IR	IR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	278	19	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	278	20	DR	DR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	278	21	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	278	22	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	278	23	flank	flank	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	278	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	278	25	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	278	26	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	278	27	32	32	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	278	28	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	278	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	279	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	279	2	massive	massive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	3	excess	excess	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	5	sub-	sub-	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	279	6	strate	strate	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	7	present	present	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	8	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	279	10	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	279	12	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	13	strategy	strategy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	14	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	279	15	prohibit	prohibit	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	279	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	279	17	correct	correct	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	18	assembly	assembly	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	20	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	21	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	279	23	sub-	sub-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	24	strate	strate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	25	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	279	26	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	279	27	result	result	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	279	28	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	29	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	30	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	31	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	32	enzymatic	enzymatic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	33	activ-	activ-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	279	34	ity	ity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	279	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	280	1	Also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	280	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	280	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	280	4	integrated	integrated	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	280	5	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	280	6	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	280	7	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	280	8	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	280	9	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	280	10	better	well	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	280	11	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	280	12	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	280	13	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	280	14	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	280	15	due	due	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	280	16	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	280	17	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	280	18	methylation	methylation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	280	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	280	20	heterochromatinization	heterochromatinization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	280	21	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	280	22	50,51	50,51	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	280	23	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	280	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	281	1	Recent	recent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	281	2	studies	study	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	281	3	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	281	4	shown	show	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	5	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	6	CpG	CpG	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	281	7	methylation	methylation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	8	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	281	9	supercoiling	supercoiling	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	11	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	281	12	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	281	13	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	281	14	harboring	harbor	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	281	15	plasmids	plasmid	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	281	16	result	result	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	281	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	18	highly	highly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	281	19	efficient	efficient	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	281	20	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	21	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	281	23	co	co	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	24	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	25	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	26	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	27	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	28	mammals	mammal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	281	29	when	when	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	281	30	compared	compare	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	31	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	32	non	non	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	281	33	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	281	34	methylated	methylated	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	281	35	linear	linear	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	281	36	plasmid	plasmid	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	281	37	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	281	38	donors	donor	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	281	39	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	281	40	52	52	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	281	41	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	281	42	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	282	1	Finally	finally	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	282	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	282	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	282	4	differences	difference	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	282	5	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	282	7	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	8	mechanisms	mechanism	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	282	9	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	10	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	282	12	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	282	13	strategies	strategy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	282	14	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	282	15	reflect	reflect	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	282	16	differences	difference	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	282	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	282	19	availability	availability	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	20	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	21	host	host	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	22	factors	factor	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	282	23	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	24	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	282	25	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	26	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	282	28	developing	develop	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	282	29	gametes	gamete	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	282	30	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	282	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	282	32	early	early	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	282	33	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	282	34	cleavage	cleavage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	35	stage	stage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	282	36	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	282	37	embryos	embryo	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	282	38	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	283	1	Potential	potential	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	283	2	uses	use	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	283	3	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	4	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	283	5	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	7	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	283	8	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	283	9	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	283	10	demonstration	demonstration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	11	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	283	12	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	283	13	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	283	14	stably	stably	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	283	15	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	16	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	283	18	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	19	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	20	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	283	21	effective	effective	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	283	22	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	283	23	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	24	remobi-	remobi-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	283	25	lization	lization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	26	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	283	27	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	283	28	important	important	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	283	29	step	step	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	30	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	31	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	283	32	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	33	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	34	large	large	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	283	35	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	283	36	scale	scale	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	37	insertional	insertional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	283	38	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	39	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	283	40	enhancer-	enhancer-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	41	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	283	42	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	43	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	283	44	trap	trap	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	45	screens	screen	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	283	46	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	47	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	283	48	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	283	49	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	284	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	284	2	breeding	breeding	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	284	4	based	base	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	5	remo-	remo-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	284	6	bilization	bilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	7	strategy	strategy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	8	described	describe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	9	here	here	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	284	10	provides	provide	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	284	11	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	284	12	simple	simple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	284	13	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	284	14	robust	robust	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	284	15	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	16	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	17	generating	generate	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	284	18	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	284	19	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	284	20	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	284	21	without	without	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	284	23	need	need	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	24	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	25	labor-	labor-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	26	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	284	27	skill	skill	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	28	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	284	29	intensive	intensive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	284	30	micro-	micro-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	31	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	284	32	methodologies	methodology	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	284	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	285	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	285	2	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	285	3	provides	provide	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	285	4	several	several	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	285	5	important	important	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	285	6	advantages	advantage	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	285	7	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	285	8	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	285	9	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	285	10	based	base	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	285	11	genetic	genetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	285	12	screens	screen	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	285	13	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	286	1	First	first	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	286	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	286	3	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	286	4	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	286	5	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	286	6	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	286	7	several	several	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	286	8	thou-	thou-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	286	9	sand	sand	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	286	10	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	286	11	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	287	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	287	2	high	high	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	287	3	fecundity	fecundity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	5	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	287	6	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	287	7	indi-	indi-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	287	8	cates	cat	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	287	9	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	287	11	even	even	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	287	12	if	if	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	287	14	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	15	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	16	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	287	17	low	low	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	287	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	287	19	multiple	multiple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	287	20	novel	novel	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	21	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	22	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	23	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	24	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	287	25	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	287	26	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	287	27	identified	identify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	28	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	29	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	287	30	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	287	31	outcross	outcross	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	287	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	288	1	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	288	2	second	second	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	288	3	advantage	advantage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	288	4	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	288	5	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	288	6	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	288	7	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	288	8	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	288	9	long	long	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	288	10	life-	life-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	288	11	span	span	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	288	12	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	288	13	captivity	captivity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	288	14	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	288	15	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	288	16	reach	reach	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	288	17	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	288	18	decades	decade	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	288	19	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	288	20	more	more	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	288	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	288	22	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	288	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	288	24	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	288	25	remain	remain	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	288	26	fertile	fertile	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	288	27	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	288	28	more	more	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	288	29	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	288	30	ten	ten	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	288	31	years	year	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	288	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	289	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	289	2	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	289	3	important	important	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	289	4	implications	implication	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	5	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	6	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	7	stra-	stra-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	8	tegies	tegie	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	289	10	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	11	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	289	12	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	289	13	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	14	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	15	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	16	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	289	17	main-	main-	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	289	18	tained	taine	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	289	20	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	21	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	22	regular	regular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	289	23	intervals	interval	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	24	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	25	many	many	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	289	26	Table	table	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	27	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	28	Integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	29	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	30	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	31	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	32	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	33	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	34	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	35	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	36	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	37	Hoppers	Hoppers	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	38	Tadpole	Tadpole	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	39	Right	Right	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	40	IR	IR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	41	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	289	42	DR	DR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	43	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	289	44	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	45	Integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	46	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	47	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	48	’	’	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	49	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	289	50	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	51	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	52	’	’	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	53	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	289	54	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	55	Parental	Parental	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	56	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	57	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	58	TGTTAGTTATTACTTAcagttgaagtcgg	tgttagttattacttacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	59	38:3796832	38:3796832	''
work_lg7uwni46nhjxg5pc3yrqf32wy	289	60	EDEM2	EDEM2	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	61	PHF20	PHF20	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	62	E208	e208	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	63	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	289	64	91	91	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	65	TCATTATCAGTATATAcagttgaagtcgg	tcattatcagtatatacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	66	38:552620	38:552620	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	67	EMILIN3	emilin3	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	68	EMILIN3	emilin3	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	289	69	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	70	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	289	71	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	72	GCTACTCACACAGTTAcagttgaagtcgg	GCTACTCACACAGTTAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	73	13:899336	13:899336	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	74	SPRY2	SPRY2	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	75	NDFIP2	NDFIP2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	76	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	77	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	289	78	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	79	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	80	TGTTACTGGGCACTTAcagttgaagtcgg	tgttactgggcacttacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	81	3:3883685	3:3883685	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	82	MYNN	MYNN	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	83	MDS1	MDS1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	84	A21A-1	A21A-1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	85	AGTGTGTAGCTATATAcagttgaagtcgg	agtgtgtagctatatacagttgaagtcgg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	86	909:49452	909:49452	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	87	GBP3	GBP3	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	88	GBP3	GBP3	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	89	C2AB-5	c2ab-5	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	90	CGGGCCATGATGTATAcagttgaagtcgg	CGGGCCATGATGTATAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	91	Repeat	Repeat	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	92	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	289	93	-	-	:
work_lg7uwni46nhjxg5pc3yrqf32wy	289	94	E2F3	E2F3	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	95	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	289	96	95	95	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	97	GCACATAATACACATAcagttgaagtcgg	GCACATAATACACATAcagttgaagtcgg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	98	Unknown	unknown	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	289	99	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	289	100	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	289	101	E220	e220	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	102	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	289	103	248	248	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	104	CATGTAcagttgaagtcgg	catgtacagttgaagtcgg	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	289	105	Unknown	unknown	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	289	106	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	289	107	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	289	108	Sequences	Sequences	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	109	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	289	110	seven	seven	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	111	novel	novel	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	112	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	113	insertion	insertion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	114	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	115	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	116	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	117	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	118	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	289	119	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	289	120	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	121	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	289	122	extension	extension	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	123	primer	primer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	124	tag	tag	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	125	selection	selection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	126	linker	linker	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	127	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	289	128	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	289	129	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	289	130	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	290	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	290	2	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	290	3	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	290	4	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	290	5	italics	italics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	290	6	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	290	7	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	290	8	flanked	flank	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	290	9	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	290	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	290	11	characteristic	characteristic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	290	12	TA	TA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	290	13	dinucleotide	dinucleotide	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	290	14	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	290	15	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	290	16	duplication	duplication	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	290	17	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	290	18	bold	bold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	290	19	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	290	20	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	291	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	291	2	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	291	3	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	4	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	291	5	depicted	depict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	7	capital	capital	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	8	letters	letter	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	291	9	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	291	10	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	291	11	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	12	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	291	13	interrogate	interrogate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	291	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	291	15	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	291	16	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	291	17	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	291	18	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	19	database	database	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	291	21	Joint	Joint	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	291	22	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	291	23	Institute	Institute	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	291	24	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	291	25	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	291	26	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	291	27	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	28	assembly	assembly	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	29	v4.1	v4.1	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	30	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	291	31	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	291	32	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	291	33	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	291	34	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	291	35	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	291	36	assign	assign	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	291	37	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	291	38	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	39	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	291	40	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	41	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	291	42	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	291	43	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	291	44	scaffolds	scaffold	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	291	45	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	292	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	292	2	genes	gene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	292	3	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	292	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	292	5	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	292	6	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	292	7	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	292	8	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	292	9	indicated	indicate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	292	10	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	293	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	293	2	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	293	3	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	293	4	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	294	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	294	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	294	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	294	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	294	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	294	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	294	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	294	8	12	12	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	294	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	294	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	294	11	years	year	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	294	12	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	294	13	male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	294	14	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	294	15	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	294	16	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	294	17	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	294	18	every	every	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	294	19	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	294	20	weeks	week	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	294	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	294	22	females	female	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	294	23	every	every	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	294	24	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	294	25	months	month	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	294	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	295	1	Laboratories	laboratory	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	295	2	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	3	limited	limited	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	295	4	animal	animal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	5	holding	holding	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	6	space	space	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	7	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	295	8	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	295	9	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	295	11	small	small	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	295	12	cadre	cadre	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	13	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	14	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	15	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	295	16	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	295	17	perform	perform	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	295	18	large	large	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	295	19	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	295	20	scale	scale	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	21	enhancer-	enhancer-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	22	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	295	23	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	24	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	295	25	trap	trap	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	26	screens	screen	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	295	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	295	28	keeping	keep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	295	29	only	only	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	295	30	those	those	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	295	31	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	295	32	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	33	interesting	interesting	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	295	34	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	295	35	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	295	36	profiles	profile	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	295	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	296	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	296	2	long	long	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	296	3	lifespan	lifespan	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	296	6	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	7	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	296	8	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	296	9	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	296	10	have	have	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	296	11	important	important	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	296	12	implications	implication	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	296	13	if	if	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	14	epigenetic	epigenetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	296	15	silencing	silencing	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	296	18	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	296	19	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	20	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	21	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	296	22	identified	identify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	23	over	over	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	24	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	296	25	series	series	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	296	27	generations	generation	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	296	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	297	1	Stably	stably	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	297	2	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	297	3	transgenes	transgene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	297	4	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	297	5	frequently	frequently	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	297	6	subjected	subject	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	297	7	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	297	8	epigenetic	epigenetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	297	9	silencing	silencing	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	297	10	over	over	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	297	11	suc-	suc-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	297	12	cessive	cessive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	297	13	generations	generation	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	297	14	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	297	15	12,53,54	12,53,54	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	297	16	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	297	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	298	1	Silencing	silence	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	298	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	298	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	298	4	transpo-	transpo-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	298	5	sase	sase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	298	6	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	298	7	would	would	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	298	8	likely	likely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	298	9	result	result	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	298	10	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	298	11	abolishment	abolishment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	298	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	298	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	298	14	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	298	15	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	298	16	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	299	1	As	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	299	2	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	299	3	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	299	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	299	5	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	299	6	lives	live	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	299	7	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	299	8	many	many	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	299	9	years	year	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	299	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	299	11	having	have	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	299	12	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	299	13	regenerate	regenerate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	299	14	new	new	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	299	15	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	299	16	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	299	17	hopping	hop	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	299	18	strategies	strategy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	299	19	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	299	20	not	not	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	299	21	likely	likely	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	299	22	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	299	23	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	299	24	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	299	25	problem	problem	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	299	26	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	299	27	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	299	28	species	specie	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	299	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	300	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	300	2	propensity	propensity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	300	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	300	4	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	300	5	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	300	6	catalyze	catalyze	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	300	7	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	300	8	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	300	9	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	300	10	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	300	11	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	300	12	third	third	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	300	13	advantage	advantage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	300	14	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	300	15	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	300	16	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	300	17	exploited	exploit	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	300	18	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	300	19	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	300	20	insertional	insertional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	300	21	mutants	mutant	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	300	22	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	300	23	genes	gene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	300	24	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	300	25	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	300	26	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	300	27	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	300	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	301	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	2	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	301	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	301	4	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	301	5	75	75	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	301	6	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	7	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	8	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	9	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	301	10	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	301	11	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	12	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	13	integrate	integrate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	301	14	within	within	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	15	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	301	16	Mb	Mb	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	301	17	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	301	19	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	20	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	301	21	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	301	22	19	19	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	301	23	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	301	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	302	1	Our	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	302	2	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	302	3	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	4	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	302	7	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	302	8	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	9	indicates	indicate	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	302	10	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	11	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	302	12	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	13	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	302	14	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	302	15	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	302	16	feature	feature	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	17	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	302	19	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	302	20	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	21	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	302	22	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	302	23	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	302	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	303	1	Transgenic	Transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	303	2	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	303	3	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	303	4	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	303	5	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	303	6	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	303	7	integrations	integration	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	303	8	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	9	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	10	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	303	11	dense	dense	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	303	12	regions	region	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	303	13	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	303	15	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	16	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	303	17	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	303	18	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	19	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	20	donors	donor	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	303	21	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	22	insertional	insertional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	303	23	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	24	strategies	strategy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	303	25	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	303	26	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	27	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	28	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	29	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	30	within	within	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	31	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	303	32	nearby	nearby	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	303	33	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	34	may	may	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	303	35	disrupt	disrupt	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	303	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	303	37	nor-	nor-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	38	mal	mal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	303	39	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	40	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	41	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	303	42	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	303	43	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	304	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	304	3	example	example	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	4	presented	present	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	5	here	here	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	304	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	304	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	304	8	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	304	9	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	304	10	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	11	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	304	12	located	locate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	13	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	14	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	304	15	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	304	16	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	304	17	which	which	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	304	18	maps	map	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	304	19	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	20	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	304	21	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	304	22	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	23	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	304	24	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	304	25	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	304	26	synte-	synte-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	304	27	nic	nic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	304	28	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	29	human	human	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	304	30	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	304	31	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	304	32	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	304	33	Figure	Figure	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	304	34	6a	6a	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	304	35	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	304	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	305	1	It	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	305	2	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	305	3	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	305	4	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	305	5	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	305	6	dense	dense	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	305	7	region	region	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	305	8	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	305	9	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	305	10	50	50	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	305	11	genes	gene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	305	12	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	305	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	305	14	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	305	15	Mb	Mb	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	305	16	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	305	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	305	18	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	305	19	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	305	20	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	306	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	306	2	genome	genome	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	306	3	size	size	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	5	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	306	6	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	306	7	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	306	8	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	306	9	one	one	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	306	10	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	306	11	half	half	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	12	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	306	13	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	306	15	human	human	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	306	16	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	17	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	306	18	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	306	19	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	306	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	306	21	while	while	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	306	23	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	24	content	content	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	25	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	306	27	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	28	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	306	29	similar	similar	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	306	30	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	31	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	306	32	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	33	man	man	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	306	34	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	307	1	Thus	thus	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	307	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	307	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	307	4	overall	overall	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	307	5	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	307	6	density	density	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	307	7	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	307	8	relatively	relatively	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	307	9	high	high	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	307	10	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	307	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	307	12	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	307	13	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	308	1	Different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	308	2	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	308	3	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	308	4	cut	cut	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	308	5	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	308	6	paste	paste	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	308	7	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	308	8	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	308	9	systems	system	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	308	10	offer	offer	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	308	11	unique	unique	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	308	12	advantages	advantage	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	308	13	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	308	14	manipu-	manipu-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	308	15	lating	lating	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	308	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	308	17	vertebrate	vertebrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	308	18	genome	genome	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	308	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	309	1	For	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	2	example	example	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	309	4	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	309	5	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	309	6	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	7	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	8	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	9	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	309	10	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	309	11	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	309	12	exploited	exploit	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	13	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	309	14	saturate	saturate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	309	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	309	16	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	309	17	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	309	18	flanking	flank	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	309	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	309	20	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	309	21	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	22	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	23	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	24	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	309	25	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	26	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	27	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	309	28	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	309	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	310	1	We	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	310	2	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	310	3	recently	recently	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	310	4	demonstrated	demonstrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	310	5	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	310	6	Tol2	tol2	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	310	7	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	310	8	stably	stably	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	310	9	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	310	10	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	310	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	310	12	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	310	13	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	310	14	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	310	15	effective	effective	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	310	16	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	310	17	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	310	18	remobi-	remobi-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	310	19	lization	lization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	310	20	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	310	21	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	310	22	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	310	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	311	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	311	2	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	311	3	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	4	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	6	Tol2	Tol2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	311	7	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	311	8	less	less	RBR
work_lg7uwni46nhjxg5pc3yrqf32wy	311	9	pronounced	pronounced	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	311	10	than	than	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	11	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	311	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	13	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	311	14	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	311	15	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	311	16	20	20	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	311	17	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	19	Tol2	Tol2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	311	20	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	21	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	22	integration	integration	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	311	23	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	311	24	occur	occur	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	311	25	near	near	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	311	27	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	28	locus	locus	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	29	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	311	30	com-	com-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	31	pared	pare	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	311	32	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	33	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	311	34	80	80	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	311	35	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	36	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	311	37	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	311	38	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	312	1	Using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	312	2	nested	nest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	3	trans-	trans-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	312	4	poson	poson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	312	5	substrates	substrate	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	312	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	312	7	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	8	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	312	9	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	10	example	example	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	11	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	312	12	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	312	13	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	312	14	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	312	15	cloned	clone	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	312	16	within	within	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	17	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	312	18	Tol2	tol2	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	312	19	element	element	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	312	21	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	22	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	312	23	wide	wide	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	312	24	remobiliza-	remobiliza-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	312	25	tion	tion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	26	screens	screen	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	312	27	could	could	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	312	28	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	312	29	performed	perform	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	30	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	312	31	Tol2	Tol2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	312	32	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	312	33	randomly	randomly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	312	34	distribute	distribute	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	312	35	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	312	36	dual	dual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	312	37	substrate	substrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	38	throughout	throughout	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	39	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	312	40	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	41	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	312	42	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	43	subsequent	subsequent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	312	44	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	312	45	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	46	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	312	47	locally	locally	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	312	48	saturate	saturate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	312	49	regions	region	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	312	50	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	51	interest	interest	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	52	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	53	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	312	54	insertion	insertion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	312	55	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	312	56	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	313	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	2	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	313	3	study	study	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	4	described	describe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	5	here	here	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	313	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	313	7	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	313	8	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	313	9	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	313	11	simple	simple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	313	12	ubiquitous	ubiquitous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	313	13	promoter	promoter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	14	element	element	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	15	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	313	16	drive	drive	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	313	17	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	313	20	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	313	21	repor-	repor-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	22	ter	ter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	313	23	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	314	1	Substrate	substrate	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	314	2	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	314	3	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	314	4	harbor	harbor	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	314	5	potentially	potentially	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	314	6	more	more	RBR
work_lg7uwni46nhjxg5pc3yrqf32wy	314	7	mutagenic	mutagenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	314	8	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	314	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	314	10	such	such	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	314	11	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	314	12	polyadenylation	polyadenylation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	314	13	trap	trap	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	314	14	ele-	ele-	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	314	15	ments	ment	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	314	16	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	314	17	55	55	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	314	18	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	314	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	314	20	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	314	21	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	314	22	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	314	23	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	314	24	efficiently	efficiently	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	314	25	disrupt	disrupt	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	314	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	314	27	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	314	28	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	314	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	314	30	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	314	31	trapped	trap	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	314	32	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	314	33	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	314	34	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	315	1	Finally	finally	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	315	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	315	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	315	4	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	5	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	315	6	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	315	7	excellent	excellent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	315	8	model	model	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	9	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	10	embryologi-	embryologi-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	315	11	cal	cal	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	315	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	315	13	biochemical	biochemical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	315	14	studies	study	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	315	15	due	due	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	315	16	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	17	its	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	315	18	small	small	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	315	19	size	size	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	315	21	simple	simple	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	315	22	husbandry	husbandry	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	23	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	315	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	315	25	ease	ease	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	27	manipulating	manipulate	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	315	28	embryos	embryo	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	315	29	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	30	all	all	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	315	31	stages	stage	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	315	32	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	33	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	315	34	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	316	1	Furthermore	furthermore	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	316	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	316	3	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	4	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	316	5	tetrapod	tetrapod	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	6	spe-	spe-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	7	cies	cie	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	316	8	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	316	9	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	316	10	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	316	11	shares	share	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	316	12	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	316	13	similar	similar	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	316	14	body	body	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	15	plan	plan	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	16	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	17	mam-	mam-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	316	18	mals	mal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	316	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	316	20	allowing	allow	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	316	21	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	22	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	23	developmental	developmental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	316	24	processes	process	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	316	25	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	316	26	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	316	27	unique	unique	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	316	28	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	29	higher	high	JJR
work_lg7uwni46nhjxg5pc3yrqf32wy	316	30	vertebrates	vertebrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	316	31	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	316	32	such	such	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	316	33	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	34	limb	limb	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	35	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	316	36	digit	digit	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	37	pattern	pattern	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	38	formation	formation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	316	39	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	317	1	Combining	combine	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	317	2	these	these	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	317	3	features	feature	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	317	4	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	317	5	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	317	6	sim-	sim-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	317	7	ple	ple	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	317	8	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	317	9	robust	robust	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	317	10	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	317	11	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	317	12	generating	generate	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	317	13	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	317	14	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	317	15	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	317	16	will	will	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	317	17	provide	provide	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	317	18	valuable	valuable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	317	19	tools	tool	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	317	20	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	317	21	apply	apply	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	317	22	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	317	23	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	317	24	highly	highly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	317	25	tractable	tractable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	317	26	developmental	developmental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	317	27	model	model	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	317	28	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	317	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	318	1	Conclusions	Conclusions	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	318	2	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	3	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	318	4	stably	stably	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	318	5	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	6	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	318	8	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	9	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	10	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	11	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	12	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	318	13	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	14	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	15	Co	Co	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	318	16	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	17	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	19	plasmid	plasmid	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	20	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	21	harboring	harbor	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	318	22	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	318	23	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	24	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	25	together	together	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	318	26	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	27	mRNA	mRNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	28	encoding	encode	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	318	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	318	30	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	31	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	32	results	result	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	318	33	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	34	efficient	efficient	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	318	35	transgenesis	transgenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	36	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	318	37	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	38	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	318	39	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	319	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	319	2	inte-	inte-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	319	3	gration	gration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	319	4	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	319	5	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	319	6	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	319	7	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	319	8	co	co	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	319	9	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	319	10	injection	injection	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	319	11	approach	approach	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	319	12	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	319	13	complex	complex	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	319	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	319	15	frequently	frequently	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	319	16	contain	contain	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	319	17	low	low	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	319	18	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	319	19	order	order	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	319	20	concate-	concate-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	319	21	mers	mer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	319	22	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	319	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	319	24	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	319	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	320	1	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	320	2	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	320	3	study	study	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	320	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	320	5	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	320	6	demonstrate	demonstrate	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	320	7	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	320	8	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	320	9	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	320	10	stably	stably	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	320	11	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	320	12	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	320	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	320	14	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	320	15	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	320	16	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	320	17	effective	effective	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	320	18	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	320	19	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	320	20	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	320	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	321	1	Transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	321	2	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	321	3	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	321	4	express	express	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	321	5	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	321	6	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	321	9	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	10	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	321	11	bred	breed	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	12	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	13	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	321	14	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	321	15	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	321	16	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	321	17	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	321	18	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	321	19	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	321	20	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	21	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	321	22	outcrossed	outcrosse	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	23	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	24	wild	wild	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	321	25	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	321	26	type	type	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	27	ani-	ani-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	321	28	mals	mal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	321	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	322	1	Remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	2	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	322	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	322	4	readily	readily	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	322	5	identified	identify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	6	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	7	increased	increase	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	8	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	322	9	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	10	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	322	12	offspring	offspring	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	13	where	where	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	322	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	322	15	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	322	16	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	322	17	concatemer	concatemer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	322	18	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	322	19	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	20	modified	modify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	21	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	322	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	322	23	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	322	24	enzyme	enzyme	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	322	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	323	1	Integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	2	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	3	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	5	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	323	6	GFP-	GFP-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	323	7	bright	bright	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	323	8	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	9	indicated	indicate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	323	10	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	323	12	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	323	13	re	re	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	14	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	323	15	integra-	integra-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	323	16	tion	tion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	17	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	323	18	had	have	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	323	19	occurred	occur	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	20	via	via	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	21	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	323	22	canonical	canonical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	323	23	cut	cut	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	24	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	323	25	paste	paste	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	323	26	mechanism	mechanism	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	323	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	324	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	324	2	rate	rate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	4	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	5	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	324	8	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	9	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	324	10	similar	similar	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	324	11	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	12	that	that	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	324	13	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	15	other	other	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	324	16	species	specie	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	324	17	when	when	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	324	18	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	324	19	low	low	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	324	20	copy	copy	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	21	number	number	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	22	concatemer	concatemer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	23	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	324	24	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	25	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	324	27	trans-	trans-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	324	28	poson	poson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	324	29	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	324	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	325	1	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	325	2	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	325	3	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	4	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	5	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	325	6	tool	tool	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	7	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	8	genetic	genetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	9	manipulation	manipulation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	11	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	325	12	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	325	13	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	325	14	diploid	diploid	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	325	15	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	16	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	325	17	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	325	18	offers	offer	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	19	several	several	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	20	advantages	advantage	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	325	21	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	22	large	large	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	23	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	325	24	scale	scale	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	25	forward	forward	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	325	26	genetic	genetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	27	screens	screen	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	325	28	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	29	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	325	30	tetrapod	tetrapod	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	31	model	model	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	32	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	325	33	including	include	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	325	34	vast	vast	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	35	numbers	number	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	325	36	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	37	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	38	per	per	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	39	spawn	spawn	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	40	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	325	41	long	long	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	42	lifespan	lifespan	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	43	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	325	44	availability	availability	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	45	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	46	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	47	resources	resource	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	325	48	including	include	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	325	49	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	325	50	genome	genome	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	51	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	52	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	325	53	genetic	genetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	325	54	map	map	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	325	55	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	326	1	Here	here	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	326	2	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	326	3	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	326	4	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	326	5	demonstrated	demonstrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	6	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	7	we	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	326	8	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	326	9	exploit	exploit	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	326	10	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	326	11	cut	cut	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	326	13	paste	paste	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	14	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	15	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	16	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	326	17	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	18	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	326	19	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	326	20	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	326	21	trans-	trans-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	326	22	poson	poson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	326	23	transgenics	transgenic	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	326	24	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	25	simply	simply	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	326	26	breeding	breed	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	326	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	326	28	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	326	29	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	326	30	trans-	trans-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	31	genic	genic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	326	32	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	326	33	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	326	34	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	327	1	Novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	327	2	transposon	transposon	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	327	3	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	327	4	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	327	5	readily	readily	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	327	6	identified	identify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	327	7	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	327	8	changes	change	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	327	9	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	327	10	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	327	11	reporter	reporter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	327	12	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	327	13	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	327	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	327	15	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	327	16	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	327	17	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	327	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	328	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	328	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	328	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	328	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	328	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	328	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	328	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	328	8	13	13	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	328	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	328	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	328	11	remobilized	remobilized	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	328	12	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	328	13	compared	compare	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	328	14	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	328	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	328	16	parental	parental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	328	17	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	328	18	pat-	pat-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	328	19	tern	tern	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	328	20	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	329	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	329	2	local	local	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	329	3	hopping	hopping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	329	4	activity	activity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	329	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	329	6	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	329	7	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	329	8	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	329	9	exploited	exploit	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	329	10	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	329	11	saturate	saturate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	329	12	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	329	13	regions	region	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	329	14	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	329	15	flank	flank	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	329	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	329	17	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	329	18	donor	donor	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	329	19	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	329	20	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	330	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	330	2	ability	ability	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	3	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	330	4	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	330	5	thousands	thousand	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	330	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	7	pro-	pro-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	8	geny	geny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	9	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	10	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	330	11	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	330	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	330	13	combined	combine	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	14	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	330	16	ease	ease	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	17	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	18	identi-	identi-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	330	19	fying	fye	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	330	20	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	330	21	insertion	insertion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	22	events	event	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	330	23	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	330	24	will	will	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	330	25	allow	allow	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	330	26	large	large	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	330	27	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	330	28	scale	scale	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	29	SB-	SB-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	330	30	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	31	screens	screen	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	330	32	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	330	33	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	330	34	performed	perform	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	35	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	330	36	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	330	37	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	330	38	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	331	1	Methods	Methods	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	331	2	Plasmids	Plasmids	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	331	3	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	331	4	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	331	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	331	6	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	331	7	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	331	8	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	331	9	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	331	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	331	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	331	12	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	331	13	construct	construct	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	331	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	331	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	331	16	transgenic	transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	331	17	pT2bGFP	pT2bGFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	331	18	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	331	19	tropicalis	tropicalis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	331	20	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	331	21	8F	8F	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	331	22	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	331	23	been	be	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	331	24	described	describe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	331	25	previously	previously	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	331	26	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	331	27	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	331	28	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	331	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	332	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	332	2	pCAGGS	pcaggs	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	332	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	332	4	SB10	sb10	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	332	5	construct	construct	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	332	6	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	332	7	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	332	8	gift	gift	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	332	9	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	332	10	Dr	Dr	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	332	11	David	David	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	332	12	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	332	13	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	332	14	27	27	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	332	15	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	332	16	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	333	1	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	333	2	3,613	3,613	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	333	3	bp	bp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	4	HincII	HincII	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	333	5	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	333	6	BamHI	BamHI	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	333	7	fragment	fragment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	8	containing	contain	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	333	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	333	10	promoter/	promoter/	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	11	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	333	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	333	14	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	333	15	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	16	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	17	pCAGGS	pcaggs	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	18	-	-	:
work_lg7uwni46nhjxg5pc3yrqf32wy	333	19	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	333	20	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	333	21	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	22	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	23	pBluescript	pBluescript	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	333	24	SK+	SK+	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	333	25	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	333	26	pBS	pBS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	333	27	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	333	28	SK+	sk+	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	333	30	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	333	31	generate	generate	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	333	32	pBS	pBS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	333	33	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	333	34	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	333	35	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	333	36	SB10	sb10	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	333	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	334	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	334	2	2.2	2.2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	334	3	kb	kb	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	334	4	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	5	laevis	laevis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	6	g1	g1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	7	crystallin	crystallin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	8	promoter	promoter	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	9	driving	drive	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	334	10	dsRed	dsRed	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	11	construct	construct	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	334	12	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	334	13	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	334	14	gift	gift	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	334	15	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	334	16	Dr	Dr	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	17	Robert	Robert	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	18	Grainger	Grainger	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	19	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	334	20	2.2	2.2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	334	21	g1	g1	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	334	22	crystallin	crystallin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	23	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	334	24	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	334	25	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	334	26	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	334	27	28	28	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	334	28	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	334	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	334	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	335	1	An	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	335	2	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	335	3	3.5	3.5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	335	4	kb	kb	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	5	g1-crystallin	g1-crystallin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	6	promoter	promoter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	7	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	335	8	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	9	frag-	frag-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	10	ment	ment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	11	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	335	12	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	13	amplified	amplify	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	335	14	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	15	2.2	2.2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	335	16	g1	g1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	17	crystallin	crystallin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	18	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	335	19	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	20	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	335	21	primers	primer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	335	22	DSR1	DSR1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	23	5’-GTAAGCGGCAGGGTCGGA-3	5’-GTAAGCGGCAGGGTCGGA-3	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	24	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	335	25	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	335	26	DSR2	DSR2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	27	5’-GCCTCGAGCGATTTCGGCC-	5’-gcctcgagcgatttcggcc-	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	335	28	TATTGGT-3	tattggt-3	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	29	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	335	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	335	31	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	32	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	33	pGEM	pgem	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	34	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	335	35	Teasy	Teasy	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	36	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	335	37	Promega	Promega	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	38	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	335	39	Madison	Madison	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	40	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	335	41	WI	WI	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	42	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	335	43	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	335	44	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	335	45	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	335	46	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	335	47	fully	fully	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	335	48	sequenced	sequence	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	49	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	335	50	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	335	51	yield	yield	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	335	52	pGEM	pgem	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	53	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	335	54	gcRFP	gcrfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	335	55	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	336	1	An	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	336	2	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	336	3	3.5	3.5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	336	4	kb	kb	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	5	SacI	SacI	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	336	6	restriction	restriction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	7	fragment	fragment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	8	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	9	pGEM	pgem	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	10	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	336	11	gcRFP	gcrfp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	12	encoding	encode	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	336	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	336	14	g1	g1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	336	15	crystallin-	crystallin-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	336	16	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	336	17	reporter	reporter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	18	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	336	19	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	20	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	336	22	unique	unique	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	336	23	SacI	SacI	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	336	24	restriction	restriction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	25	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	27	pBS	pbs	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	28	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	336	29	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	336	30	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	336	31	SB10	sb10	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	336	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	337	1	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	337	2	single	single	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	337	3	clone	clone	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	4	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	337	5	selected	select	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	6	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	337	8	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	337	9	mini	mini	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	337	10	-	-	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	337	11	genes	gene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	337	12	oriented	orient	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	13	tail	tail	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	14	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	337	15	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	16	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	337	17	tail	tail	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	18	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	337	20	pBS-	pBS-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	337	21	SK	SK	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	337	22	plasmid	plasmid	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	23	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	337	24	pCAGGS	pcaggs	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	25	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	337	26	SB10;gcRFP	sb10;gcrfp	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	337	27	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	337	28	Figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	29	1a	1a	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	337	30	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	337	31	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	338	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	338	2	pCAGGS	pcaggs	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	3	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	338	4	SB10;gcRFP	sb10;gcrfp	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	338	5	construct	construct	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	6	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	338	7	linearized	linearize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	8	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	9	ScaI	ScaI	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	338	10	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	338	11	injected	inject	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	12	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	13	vitro	vitro	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	338	14	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	15	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	338	16	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	338	17	fertilized	fertilize	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	338	18	embryos	embryo	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	338	19	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	20	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	338	21	one	one	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	338	22	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	338	23	cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	24	stage	stage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	25	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	338	26	500	500	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	338	27	pg	pg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	28	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	29	linear	linear	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	338	30	plasmid	plasmid	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	31	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	338	32	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	33	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	338	34	nL	nl	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	35	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	36	water	water	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	37	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	338	38	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	39	described	describe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	338	40	previously	previously	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	338	41	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	338	42	6,8	6,8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	338	43	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	338	44	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	339	1	Tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	339	2	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	339	3	scored	score	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	339	4	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	339	5	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	339	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	339	7	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	339	8	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	339	9	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	339	10	lens	lens	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	339	11	after	after	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	339	12	stage	stage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	339	13	40	40	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	339	14	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	339	15	30	30	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	339	16	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	339	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	340	1	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	340	2	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	340	3	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	340	4	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	340	5	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	340	6	27	27	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	340	7	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	340	8	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	9	570	570	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	340	10	injected	inject	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	11	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	340	12	4.7	4.7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	340	13	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	14	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	340	15	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	340	16	selected	select	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	17	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	340	18	raised	raise	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	19	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	20	adulthood	adulthood	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	340	22	outcrossed	outcrosse	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	340	23	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	340	24	determine	determine	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	340	25	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	26	transmission	transmission	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	27	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	28	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	340	29	transgene	transgene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	340	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	341	1	Male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	341	2	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	341	3	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	341	4	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	341	5	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	341	6	2	2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	341	7	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	341	8	pro-	pro-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	341	9	duced	duce	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	341	10	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	341	11	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	341	12	expressed	express	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	341	13	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	341	14	robustly	robustly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	341	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	341	16	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	341	17	lens	lens	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	341	18	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	341	19	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	341	20	selected	select	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	341	21	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	341	22	further	further	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	341	23	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	341	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	342	1	Husbandry	Husbandry	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	342	2	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	342	3	micro	micro	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	342	4	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	342	5	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	342	6	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	342	7	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	342	8	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	342	9	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	342	10	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	342	11	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	342	12	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	342	13	maintained	maintain	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	342	14	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	342	15	28	28	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	342	16	°	°	,
work_lg7uwni46nhjxg5pc3yrqf32wy	342	17	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	342	18	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	342	19	static	static	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	342	20	tanks	tank	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	342	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	342	22	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	342	23	staged	stage	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	342	24	according	accord	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	342	25	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	342	26	Nieuwkoop	Nieuwkoop	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	342	27	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	342	28	Faber	Faber	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	342	29	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	342	30	30	30	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	342	31	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	342	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	343	1	Adult	adult	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	343	2	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	343	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	343	4	housed	house	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	343	5	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	343	6	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	343	7	recirculating	recirculate	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	343	8	aquarium	aquarium	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	343	9	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	343	10	26	26	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	343	11	°	°	,
work_lg7uwni46nhjxg5pc3yrqf32wy	343	12	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	343	13	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	344	1	Transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	344	2	adult	adult	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	3	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	344	4	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	344	5	identified	identify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	6	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	7	implanting	implant	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	344	8	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	344	9	radio	radio	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	10	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	344	11	frequency	frequency	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	12	identification	identification	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	13	microchip	microchip	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	14	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	344	15	microSensys	microsensys	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	344	16	GmbH	GmbH	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	344	17	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	344	18	Erfurt	Erfurt	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	344	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	344	20	Germany	Germany	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	344	21	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	344	22	beneath	beneath	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	344	24	skin	skin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	25	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	344	27	dorsal	dorsal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	28	surface	surface	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	29	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	30	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	344	31	animal	animal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	344	32	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	344	33	56	56	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	344	34	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	344	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	345	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	345	2	unique	unique	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	345	3	16-digit	16-digit	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	345	4	alphanumeric	alphanumeric	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	345	5	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	345	6	encoded	encode	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	345	7	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	345	8	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	345	9	chip	chip	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	345	10	provides	provide	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	345	11	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	345	12	convenient	convenient	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	345	13	method	method	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	345	14	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	345	15	identifying	identify	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	345	16	individual	individual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	345	17	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	345	18	throughout	throughout	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	345	19	their	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	345	20	lifespan	lifespan	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	345	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	346	1	Female	Female	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	346	2	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	346	3	tropicalis	tropicalis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	4	animals	animal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	346	5	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	346	6	pre	pre	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	7	-	-	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	8	primed	prime	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	9	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	346	11	1:5	1:5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	346	12	dilution	dilution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	13	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	14	human	human	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	346	15	chorionic	chorionic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	346	16	gonadotropin	gonadotropin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	17	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	346	18	hCG	hCG	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	346	19	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	346	20	overnight	overnight	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	346	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	346	22	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	346	23	primed	prime	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	346	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	346	25	day	day	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	27	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	28	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	29	200	200	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	346	30	U	u	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	31	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	346	32	hCG	hCG	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	346	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	347	1	Fertilized	fertilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	347	2	eggs	egg	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	347	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	347	4	obtained	obtain	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	347	5	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	347	6	natural	natural	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	347	7	matings	mating	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	347	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	348	1	Injected	inject	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	348	2	eggs	egg	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	348	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	348	4	allowed	allow	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	348	5	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	348	6	heal	heal	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	348	7	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	348	8	28	28	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	348	9	°	°	,
work_lg7uwni46nhjxg5pc3yrqf32wy	348	10	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	348	11	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	348	12	transferred	transfer	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	348	13	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	348	14	tanks	tank	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	348	15	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	348	16	growth	growth	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	348	17	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	348	18	28	28	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	348	19	°	°	,
work_lg7uwni46nhjxg5pc3yrqf32wy	348	20	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	348	21	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	348	22	56	56	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	348	23	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	348	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	349	1	This	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	349	2	project	project	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	349	3	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	349	4	approved	approve	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	349	5	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	349	6	St.	St.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	7	Jude	Jude	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	8	Children	Children	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	9	’s	’s	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	349	10	Research	Research	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	11	Hospital	Hospital	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	12	’s	’s	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	349	13	Institutional	Institutional	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	14	Animal	Animal	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	15	Care	Care	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	16	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	349	17	Use	Use	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	18	Committee	Committee	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	349	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	350	1	RT	RT	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	2	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	350	3	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	4	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	6	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	7	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	8	Total	Total	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	9	cellular	cellular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	350	10	RNA	RNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	11	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	350	12	isolated	isolate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	13	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	350	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	350	15	RNAeasy	RNAeasy	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	16	kit	kit	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	17	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	350	18	Clontech	Clontech	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	350	20	Mountain	Mountain	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	21	View	View	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	350	23	CA	CA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	350	25	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	26	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	350	27	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	28	individual	individual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	350	29	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	30	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	350	31	positive	positive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	350	32	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	350	33	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	34	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	350	35	negative	negative	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	350	36	stage	stage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	37	40	40	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	350	38	embryos	embryo	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	350	39	gener-	gener-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	40	ated	ate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	41	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	42	outcross	outcross	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	43	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	350	44	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	45	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	350	46	SB10;gcRFP	SB10;gcRFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	350	47	2M.	2M.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	351	1	First	first	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	351	2	strand	strand	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	351	3	cDNA	cdna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	351	4	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	351	5	synthesized	synthesize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	351	6	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	351	7	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	351	8	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	351	9	template	template	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	351	10	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	351	11	32P	32P	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	351	12	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	351	13	labelled	label	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	351	14	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	351	15	reactions	reaction	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	351	16	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	351	17	described	describe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	351	18	previously	previously	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	351	19	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	351	20	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	351	21	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	351	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	352	1	Primers	primer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	352	2	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	352	3	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	352	4	amplification	amplification	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	352	5	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	352	6	SB3	SB3	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	352	7	5’-GCCGCTCAG-	5’-gccgctcag-	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	352	8	CAAGGAAGA-3	CAAGGAAGA-3	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	352	9	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	352	10	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	352	11	SB4	sb4	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	352	12	5’-GAAGACCCATTTGC-	5’-gaagacccatttgc-	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	352	13	GACCAAG-3	gaccaag-3	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	352	14	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	352	15	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	352	16	annealed	anneal	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	352	17	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	352	18	56	56	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	352	19	°	°	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	352	20	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	352	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	352	22	produced	produce	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	352	23	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	352	24	383	383	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	352	25	bp	bp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	352	26	fragment	fragment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	352	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	353	1	Primers	primer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	353	2	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	353	3	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	353	4	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	353	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	353	6	actin	actin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	353	7	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	353	8	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	353	9	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	353	10	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	353	11	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	353	12	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	353	13	RNA	RNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	353	14	recovery	recovery	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	353	15	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	354	1	Western	western	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	354	2	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	3	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	5	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	354	6	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	8	tissues	tissue	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	354	9	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	10	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	11	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	354	12	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	354	13	Whole	whole	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	354	14	embryo	embryo	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	15	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	354	16	adult	adult	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	17	tissue	tissue	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	18	samples	sample	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	354	19	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	354	20	snap	snap	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	354	21	frozen	freeze	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	22	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	23	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	354	24	dry	dry	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	354	25	ice	ice	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	26	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	354	27	ethanol	ethanol	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	28	bath	bath	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	29	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	354	30	stored	store	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	354	31	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	354	32	-80	-80	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	354	33	°	°	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	354	34	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	354	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	355	1	100	100	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	2	μl	μl	XX
work_lg7uwni46nhjxg5pc3yrqf32wy	355	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	4	RIPA	RIPA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	5	buffer	buffer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	6	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	7	150	150	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	8	mM	mM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	9	sodium	sodium	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	10	chloride	chloride	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	11	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	12	50	50	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	13	mM	mm	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	14	tris(hydroxymethyl)aminomethane	tris(hydroxymethyl)aminomethane	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	15	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	16	hydrogen	hydrogen	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	17	chlor-	chlor-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	18	ide	ide	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	19	pH	pH	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	20	7.5	7.5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	22	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	23	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	24	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	25	v	v	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	26	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	355	27	v	v	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	28	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	29	nonyl	nonyl	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	30	phenoxypolyethoxylethanol	phenoxypolyethoxylethanol	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	355	31	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	32	IPEGAL	IPEGAL	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	33	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	34	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	35	0.5	0.5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	36	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	37	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	38	w	w	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	39	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	355	40	v	v	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	41	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	42	sodium	sodium	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	43	deoxycholate	deoxycholate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	44	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	45	0.1	0.1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	46	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	47	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	48	w	w	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	49	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	355	50	v	v	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	51	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	52	sodium	sodium	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	53	dodecyl	dodecyl	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	355	54	sulfate	sulfate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	55	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	56	1X	1x	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	57	Complete	Complete	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	58	Protease	Protease	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	59	Inhibitor	Inhibitor	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	60	Cocktail	Cocktail	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	61	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	62	Roche	Roche	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	63	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	64	Indianapolis	Indianapolis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	65	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	66	IN	IN	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	67	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	68	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	69	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	70	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	71	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	72	added	add	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	73	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	74	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	355	75	frozen	frozen	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	355	76	samples	sample	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	355	77	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	78	mixed	mix	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	79	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	80	vortex	vortex	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	81	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	82	extracted	extract	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	83	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	84	Freon	Freon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	85	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	86	200	200	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	87	μL	μl	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	88	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	89	1,1,2-trichlorotrifluroethane	1,1,2-trichlorotrifluroethane	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	90	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	91	Sigma-	Sigma-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	92	Aldrich	Aldrich	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	93	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	94	St.	St.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	95	Louis	Louis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	96	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	97	MO	MO	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	98	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	355	99	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	100	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	101	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	355	102	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	355	103	centrifuged	centrifuge	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	104	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	105	16,100	16,100	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	106	×	×	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	355	107	g	g	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	108	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	109	15	15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	110	minutes	minute	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	355	111	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	355	112	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	355	113	°	°	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	355	114	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	355	115	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	356	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	356	2	upper	upper	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	356	3	phase	phase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	356	4	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	356	5	trans-	trans-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	356	6	ferred	ferre	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	356	7	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	356	8	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	356	9	fresh	fresh	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	356	10	tube	tube	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	356	11	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	356	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	356	13	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	356	14	concentration	concentration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	356	15	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	356	16	measured	measure	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	356	17	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	356	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	356	19	Bradford	Bradford	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	356	20	assay	assay	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	356	21	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	356	22	Bio	Bio	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	356	23	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	356	24	Rad	Rad	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	356	25	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	356	26	Hercules	Hercules	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	356	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	356	28	CA	CA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	356	29	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	356	30	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	356	31	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	356	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	357	1	Aliquots	aliquot	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	357	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	3	each	each	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	357	4	sample	sample	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	5	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	357	6	diluted	dilute	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	7	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	8	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	357	9	equal	equal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	357	10	volume	volume	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	11	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	12	2×	2×	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	357	13	Laemmli	Laemmli	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	357	14	Sample	Sample	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	357	15	Buffer	Buffer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	357	16	containing	contain	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	357	17	b	b	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	18	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	357	19	mercaptoethanol	mercaptoethanol	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	357	21	Bio	Bio	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	357	22	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	357	23	Rad	Rad	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	357	24	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	357	25	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	357	26	denatured	denature	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	27	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	28	heating	heat	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	357	29	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	30	100	100	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	357	31	°	°	,
work_lg7uwni46nhjxg5pc3yrqf32wy	357	32	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	357	33	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	357	34	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	357	35	minutes	minute	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	357	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	358	1	Proteins	protein	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	358	2	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	358	3	separated	separate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	4	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	5	elec-	elec-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	358	6	trophoresis	trophoresis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	358	7	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	8	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	358	9	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	10	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	358	11	15	15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	358	12	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	13	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	358	14	w	w	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	358	15	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	358	16	v	v	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	358	17	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	358	18	Criterion	criterion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	19	precast	precast	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	358	20	polya-	polya-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	358	21	crylamide	crylamide	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	22	gels	gel	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	358	23	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	358	24	Bio	Bio	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	358	25	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	358	26	Rad	Rad	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	358	27	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	358	28	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	358	29	pre	pre	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	358	30	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	358	31	stained	stained	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	358	32	SDS	sds	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	33	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	358	34	PAGE	page	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	35	standards	standard	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	358	36	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	358	37	Bio	Bio	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	358	38	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	358	39	Rad	Rad	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	358	40	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	358	41	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	358	42	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	43	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	44	molecular	molecular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	358	45	weight	weight	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	358	46	mar-	mar-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	358	47	kers	ker	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	358	48	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	359	1	Proteins	protein	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	359	2	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	359	3	transferred	transfer	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	4	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	5	Hybond	Hybond	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	359	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	359	7	P	p	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	8	polyvinyli-	polyvinyli-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	9	dene	dene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	10	difluoride	difluoride	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	11	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	359	12	PDVF	PDVF	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	359	13	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	359	14	GE	GE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	359	15	Healthcare	Healthcare	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	359	16	Life	Life	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	359	17	Sciences	Sciences	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	359	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	359	19	Piscataway	Piscataway	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	359	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	359	21	NJ	NJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	359	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	359	23	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	359	24	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	359	25	membranes	membrane	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	359	26	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	27	50	50	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	359	28	V	v	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	29	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	30	1.5	1.5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	359	31	hours	hour	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	359	32	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	359	33	4	4	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	359	34	°	°	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	359	35	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	359	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	360	1	Protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	2	transfer	transfer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	3	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	360	4	verified	verify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	5	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	6	staining	stain	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	360	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	360	8	membrane	membrane	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	9	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	10	Ponceau	Ponceau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	11	S.	S.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	12	Monoclonal	Monoclonal	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	13	anti	anti	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	360	14	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	360	15	SB	sb	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	360	16	trans-	trans-	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	360	17	posase	posase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	18	antibody	antibody	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	19	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	360	20	MAB2798	MAB2798	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	21	;	;	,
work_lg7uwni46nhjxg5pc3yrqf32wy	360	22	R&D	R&D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	23	Systems	Systems	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	360	25	Minneapolis	Minneapolis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	26	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	360	27	MN	MN	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	28	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	360	29	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	30	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	360	31	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	360	32	resuspended	resuspend	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	33	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	34	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	360	35	final	final	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	360	36	concentration	concentration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	37	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	38	500	500	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	360	39	μg	μg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	40	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	360	41	mL	ml	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	360	42	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	360	43	diluted	dilute	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	360	44	1:500	1:500	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	360	45	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	360	46	probe	probe	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	360	47	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	360	48	membranes	membrane	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	360	49	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	50	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	360	51	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	360	52	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	361	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	361	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	361	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	361	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	8	14	14	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	361	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	361	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	361	11	blocked	block	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	361	12	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	361	13	Superblock	Superblock	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	14	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	361	15	Pierce	Pierce	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	16	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	361	17	Rockford	Rockford	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	361	19	IL	IL	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	361	21	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	22	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	361	23	containing	contain	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	361	24	0.05	0.05	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	361	25	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	361	26	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	361	27	v	v	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	361	28	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	361	29	v	v	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	361	30	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	361	31	Tween	Tween	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	361	32	20	20	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	361	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	362	1	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	362	2	secondary	secondary	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	362	3	goat	goat	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	362	4	anti	anti	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	362	5	-	-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	362	6	mouse	mouse	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	362	7	horseradish	horseradish	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	362	8	peroxidase	peroxidase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	362	9	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	362	10	conjugated	conjugate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	362	11	antibody	antibody	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	362	12	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	362	13	diluted	dilute	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	362	14	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	362	15	1:10,000	1:10,000	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	362	16	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	362	17	developed	develop	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	362	18	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	362	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	362	20	Chemi-	Chemi-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	362	21	luminescent	luminescent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	362	22	Detection	Detection	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	362	23	System	System	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	362	24	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	362	25	Pierce	pierce	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	362	26	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	362	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	363	1	Membranes	Membranes	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	363	2	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	363	3	stripped	strip	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	4	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	5	Restore	Restore	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	363	6	Western	western	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	363	7	Blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	8	Stripping	strip	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	363	9	Solu-	Solu-	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	363	10	tion	tion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	11	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	363	12	Pierce	pierce	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	13	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	363	14	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	363	15	re	re	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	363	16	-	-	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	17	probed	probe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	18	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	19	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	363	20	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	21	monoclonal	monoclonal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	363	22	antibody	antibody	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	23	specific	specific	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	363	24	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	25	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	363	26	b	b	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	363	27	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	363	28	actin	actin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	363	29	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	363	30	ab8224	ab8224	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	363	31	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	363	32	Abcam	Abcam	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	363	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	363	34	Cambridge	Cambridge	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	363	35	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	363	36	MA	MA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	363	37	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	363	38	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	363	39	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	363	40	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	41	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	363	42	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	43	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	44	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	45	recovery	recovery	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	363	46	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	364	1	Fluorescent	fluorescent	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	364	2	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	364	3	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	364	4	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	364	5	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	364	6	Leica	Leica	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	364	7	FLIII	FLIII	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	364	8	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	364	9	dissecting	dissecting	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	364	10	microscope	microscope	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	364	11	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	364	12	used	use	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	364	13	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	364	14	analyze	analyze	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	364	15	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	364	16	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	364	17	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	364	18	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	364	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	365	1	Digital	digital	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	365	2	images	image	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	365	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	365	4	captured	capture	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	365	5	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	365	6	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	365	7	Nikon	Nikon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	8	Ri1	ri1	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	365	9	color	color	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	365	10	digital	digital	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	11	camera	camera	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	365	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	365	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	365	14	Nikon	Nikon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	15	Elements	Elements	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	16	Basic	Basic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	17	Research	Research	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	18	software	software	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	365	19	pack-	pack-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	365	20	age	age	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	365	21	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	365	22	Nikon	Nikon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	23	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	365	24	Melville	Melville	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	25	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	365	26	NY	NY	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	365	28	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	365	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	365	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	366	1	Tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	366	2	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	366	3	immobi-	immobi-	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	366	4	lized	lize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	366	5	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	366	6	photography	photography	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	366	7	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	366	8	brief	brief	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	366	9	anesthesia	anesthesia	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	366	10	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	366	11	0.015	0.015	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	366	12	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	366	13	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	366	14	w/	w/	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	366	15	v	v	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	366	16	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	366	17	tricaine	tricaine	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	366	18	methanesulphonate	methanesulphonate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	366	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	367	1	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	367	2	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	3	hybridization	hybridization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	4	Genomic	Genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	367	5	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	367	6	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	367	7	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	8	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	9	individual	individual	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	367	10	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	367	11	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	12	overnight	overnight	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	367	13	proteinase	proteinase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	14	K	k	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	15	digestion	digestion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	16	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	17	56	56	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	367	18	°	°	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	367	19	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	367	20	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	367	21	phenol/	phenol/	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	367	22	chloroform	chloroform	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	367	23	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	367	24	isoamyl	isoamyl	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	367	25	alcohol	alcohol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	367	26	extraction	extraction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	367	27	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	367	28	standard	standard	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	367	29	protocols	protocol	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	367	30	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	367	31	8	8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	367	32	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	367	33	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	368	1	Genomic	Genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	3	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	368	4	3	3	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	368	5	μg	μg	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	6	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	7	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	368	8	μg	μg	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	368	9	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	368	10	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	368	11	digested	digest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	12	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	13	BglII	BglII	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	14	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	368	15	separated	separate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	368	16	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	17	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	368	18	0.7	0.7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	368	19	%	%	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	368	21	w	w	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	22	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	368	23	v	v	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	24	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	368	25	agarose	agarose	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	368	26	gel	gel	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	27	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	368	28	transferred	transfer	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	29	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	30	Hybond	hybond	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	368	31	N+	N+	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	32	hybridization	hybridization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	33	transfer	transfer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	34	mem-	mem-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	368	35	branes	brane	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	368	36	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	368	37	GE	GE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	38	Healthcare	Healthcare	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	39	Life	Life	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	40	Sciences	Sciences	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	368	41	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	368	42	Piscataway	Piscataway	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	43	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	368	44	NJ	NJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	45	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	368	46	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	368	47	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	368	48	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	369	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	369	2	hybridization	hybridization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	3	membranes	membrane	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	369	4	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	369	5	probed	probe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	6	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	7	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	369	8	32P	32P	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	369	9	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	369	10	radiolabeled	radiolabele	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	11	fragment	fragment	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	369	14	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	369	15	open	open	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	369	16	reading	reading	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	17	frame	frame	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	18	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	369	19	approximately	approximately	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	369	20	700	700	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	369	21	bp	bp	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	22	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	369	23	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	369	24	exposed	expose	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	25	onto	onto	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	26	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	369	27	GE	GE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	369	28	Healthcare	Healthcare	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	369	29	Life	Life	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	369	30	Sciences	Sciences	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	369	31	phosphorimager	phosphorimager	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	369	32	screen	screen	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	33	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	34	detection	detection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	369	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	370	1	Genomic	Genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	2	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	3	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	370	4	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	5	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	6	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	7	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	8	Integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	9	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	10	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	11	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	370	12	performed	perform	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	13	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	14	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	15	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	370	16	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	17	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	370	19	right	right	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	370	20	arm	arm	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	21	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	370	22	IR	IR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	23	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	370	24	DR	DR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	25	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	370	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	370	28	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	29	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	370	30	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	31	described	describe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	370	32	previously	previously	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	370	33	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	370	34	6,8	6,8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	370	35	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	370	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	371	1	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	371	2	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	371	3	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	371	4	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	371	5	verified	verify	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	371	6	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	371	7	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	371	8	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	371	9	strategies	strategy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	371	10	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	371	11	primers	primer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	371	12	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	371	13	bind	bind	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	371	14	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	371	15	scaffold	scaffold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	371	16	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	371	17	beyond	beyond	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	371	18	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	371	19	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	371	20	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	371	21	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	371	22	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	371	23	products	product	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	371	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	372	1	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	372	2	primers	primer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	372	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	372	4	also	also	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	372	5	designed	design	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	372	6	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	372	7	amplify	amplify	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	372	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	372	9	predicted	predict	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	372	10	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	372	11	that	that	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	372	12	flank	flank	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	372	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	372	14	left	leave	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	372	15	IR	IR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	372	16	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	372	17	DR	DR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	372	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	372	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	372	20	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	372	21	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	372	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	373	1	All	all	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	373	2	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	373	3	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	373	4	products	product	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	373	5	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	373	6	cloned	clone	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	373	7	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	373	8	either	either	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	373	9	pGEM	pgem	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	373	10	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	373	11	T	t	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	373	12	Easy	Easy	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	373	13	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	373	14	Promega	Promega	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	373	15	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	373	16	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	373	17	TOPO	TOPO	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	373	18	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	373	19	TA	TA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	373	20	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	373	21	Invitrogen	Invitrogen	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	373	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	373	23	Carlsbad	Carlsbad	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	373	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	373	25	CA	CA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	373	26	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	373	27	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	373	28	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	373	29	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	373	30	sequenced	sequence	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	373	31	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	374	1	Novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	374	2	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	374	3	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	374	4	queried	query	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	5	against	against	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	374	7	Joint	Joint	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	374	8	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	374	9	Insti-	Insti-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	374	10	tute	tute	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	11	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	374	12	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	374	13	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	374	14	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	374	15	version	version	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	16	4.1	4.1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	374	17	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	374	18	http://genome.jgi-	http://genome.jgi-	ADD
work_lg7uwni46nhjxg5pc3yrqf32wy	374	19	psf.org/Xentr4/Xentr4.home.html	psf.org/Xentr4/Xentr4.home.html	AFX
work_lg7uwni46nhjxg5pc3yrqf32wy	374	20	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	374	21	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	374	22	scaffolds	scaffold	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	374	23	were	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	374	24	assigned	assign	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	25	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	26	chromosomes	chromosome	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	374	27	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	374	28	linkage	linkage	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	374	29	groups	group	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	374	30	based	base	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	31	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	32	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	374	33	genetic	genetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	374	34	map	map	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	35	developed	develop	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	36	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	37	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	374	38	University	University	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	374	39	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	374	40	Houston	Houston	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	374	41	[	[	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	374	42	44	44	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	374	43	]	]	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	374	44	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	375	1	List	list	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	3	abbreviations	abbreviation	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	375	4	bp	bp	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	5	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	6	base	base	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	7	pair	pair	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	8	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	9	CAGGS	CAGGS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	10	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	11	chicken	chicken	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	12	β	β	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	13	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	375	14	actin	actin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	15	promoter	promoter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	16	coupled	couple	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	17	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	18	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	375	19	cytomegalovirus	cytomegalovirus	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	375	20	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	21	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	22	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	23	LM	LM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	24	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	375	25	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	26	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	27	extension	extension	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	28	primer	primer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	29	tag	tag	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	30	selection	selection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	31	linker	linker	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	32	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	375	33	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	34	polymerase	polymerase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	35	chain	chain	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	36	reaction	reaction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	37	;	;	,
work_lg7uwni46nhjxg5pc3yrqf32wy	375	38	FISH	fish	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	39	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	40	fluorescence	fluorescence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	41	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	42	situ	situ	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	43	hybridization	hybridization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	44	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	45	GFP	GFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	46	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	47	green	green	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	375	48	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	49	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	50	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	51	hCG	hCG	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	52	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	375	53	human	human	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	375	54	chorionic	chorionic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	375	55	gonadotropin	gonadotropin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	56	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	57	IR	IR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	58	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	375	59	DR	DR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	60	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	61	indirect	indirect	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	375	62	repeat	repeat	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	63	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	375	64	direct	direct	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	375	65	repeats	repeat	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	375	66	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	67	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	68	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	69	polymerase	polymerase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	70	chain	chain	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	71	reaction	reaction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	72	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	73	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	74	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	75	red	red	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	375	76	fluorescent	fluorescent	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	77	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	78	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	79	RT	RT	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	80	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	81	reverse	reverse	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	375	82	transcriptase	transcriptase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	83	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	84	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	85	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	86	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	87	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	88	;	;	,
work_lg7uwni46nhjxg5pc3yrqf32wy	375	89	UTR	UTR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	375	90	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	375	91	untranslated	untranslated	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	375	92	region	region	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	375	93	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	376	1	Acknowledgements	acknowledgement	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	376	2	We	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	3	thank	thank	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	4	Cheryl	Cheryl	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	5	Winter	Winter	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	6	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	376	7	animal	animal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	376	8	husbandry	husbandry	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	376	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	376	10	Drs	Drs	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	11	David	David	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	12	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	13	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	376	14	Robert	Robert	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	15	Grainger	Grainger	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	16	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	376	17	providing	provide	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	376	18	plasmids	plasmid	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	376	19	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	376	20	pCAGGS	pcaggs	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	376	21	-	-	:
work_lg7uwni46nhjxg5pc3yrqf32wy	376	22	SB10	sb10	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	376	23	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	376	24	2.2	2.2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	376	25	g1-crystallin-	g1-crystallin-	.
work_lg7uwni46nhjxg5pc3yrqf32wy	376	26	RFP	RFP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	376	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	376	28	respectively	respectively	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	376	29	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	376	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	377	1	We	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	2	thank	thank	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	377	4	following	follow	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	377	5	St.	St.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	6	Jude	Jude	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	7	Children	Children	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	8	’s	’s	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	377	9	Research	Research	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	10	Hospital	Hospital	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	11	shared	share	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	377	12	resources	resource	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	377	13	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	377	14	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	377	15	Hartwell	Hartwell	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	16	Center	Center	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	17	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	377	18	Bioinformatics	Bioinformatics	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	377	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	377	20	Biotechnology	Biotechnology	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	21	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	377	22	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	377	23	sequencing	sequencing	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	377	24	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	377	25	bioinformatics	bioinformatic	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	377	26	support	support	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	377	27	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	377	28	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	377	29	Cytogenetics	Cytogenetics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	30	Lab	Lab	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	31	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	377	32	FISH	fish	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	377	33	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	377	34	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	377	35	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	377	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	377	37	Animal	Animal	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	38	Resource	Resource	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	39	Center	Center	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	377	40	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	378	1	Support	support	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	378	2	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	378	3	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	378	4	study	study	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	378	5	was	be	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	378	6	provided	provide	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	378	7	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	378	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	378	9	National	National	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	378	10	Institutes	Institutes	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	378	11	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	378	12	Health	Health	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	378	13	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	378	14	HD042994	hd042994	UH
work_lg7uwni46nhjxg5pc3yrqf32wy	378	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	378	16	MH079381	MH079381	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	378	17	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	378	18	PEM	PEM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	378	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	378	20	HD046661	hd046661	ADD
work_lg7uwni46nhjxg5pc3yrqf32wy	378	21	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	378	22	AKS	AKS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	378	23	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	378	24	DEW	DEW	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	378	25	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	378	26	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	378	27	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	378	28	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	378	29	American	american	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	378	30	Lebanese	lebanese	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	378	31	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	378	32	Syrian	Syrian	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	378	33	Associated	Associated	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	378	34	Charities	Charities	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	378	35	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	378	36	PEM	PEM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	378	37	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	378	38	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	379	1	Author	author	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	379	2	details	detail	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	379	3	1Department	1department	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	379	4	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	379	5	Pathology	Pathology	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	379	7	St	St	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	8	Jude	Jude	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	9	Children	Children	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	10	’s	’s	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	379	11	Research	Research	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	12	Hospital	Hospital	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	13	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	379	14	262	262	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	379	15	Danny	Danny	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	16	Thomas	Thomas	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	17	Place	Place	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	379	19	Memphis	Memphis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	379	21	TN	TN	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	22	38105	38105	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	379	23	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	379	24	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	379	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	380	1	2Department	2department	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	380	2	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	380	3	Biology	Biology	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	380	4	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	380	5	Biochemistry	Biochemistry	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	380	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	380	7	University	University	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	380	8	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	380	9	Houston	Houston	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	380	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	380	11	Houston	Houston	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	380	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	380	13	TX	TX	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	380	14	77204	77204	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	380	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	380	16	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	380	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	381	1	Authors	author	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	381	2	’	’	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	381	3	contributions	contribution	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	381	4	DAY	DAY	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	381	5	carried	carry	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	381	6	out	out	RP
work_lg7uwni46nhjxg5pc3yrqf32wy	381	7	embryo	embryo	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	381	8	injections	injection	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	381	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	381	10	scored	score	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	381	11	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	381	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	381	13	performed	perform	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	381	14	molecular	molecular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	381	15	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	381	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	381	17	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	381	18	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	381	19	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	381	20	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	381	21	helped	help	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	381	22	prepare	prepare	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	381	23	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	381	24	manuscript	manuscript	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	381	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	382	1	CMK	CMK	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	382	2	performed	perform	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	382	3	molecular	molecular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	382	4	analyses	analysis	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	382	5	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	382	6	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	382	7	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	382	8	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	382	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	382	10	scored	score	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	382	11	tadpoles	tadpole	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	382	12	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	382	13	helped	help	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	382	14	prepare	prepare	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	382	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	382	16	manuscript	manuscript	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	382	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	383	1	EK	EK	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	383	2	performed	perform	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	383	3	embryo	embryo	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	383	4	injections	injection	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	383	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	383	6	scored	score	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	383	7	progeny	progeny	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	383	8	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	383	9	assisted	assist	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	383	10	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	383	11	molecular	molecular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	383	12	analyses	analysis	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	383	13	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	383	14	helped	help	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	383	15	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	383	16	general	general	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	383	17	husbandry	husbandry	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	383	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	384	1	HZ	HZ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	384	2	performed	perform	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	384	3	embryo	embryo	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	384	4	injections	injection	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	384	5	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	384	6	helped	help	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	384	7	score	score	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	384	8	progeny	progeny	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	384	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	385	1	MRJH	MRJH	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	385	2	generated	generate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	385	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	385	4	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	385	5	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	385	6	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	385	7	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	385	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	386	1	AKS	AKS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	386	2	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	386	3	DEW	dew	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	386	4	provided	provide	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	386	5	mapping	mapping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	386	6	data	datum	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	386	7	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	386	8	assign	assign	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	386	9	sequence	sequence	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	386	10	scaffolds	scaffold	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	386	11	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	386	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	386	13	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	386	14	tropicalis	tropicalis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	386	15	linkage	linkage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	386	16	groups	group	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	386	17	and/or	and/or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	386	18	chromosomes	chromosome	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	386	19	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	387	1	PEM	PEM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	387	2	conceived	conceive	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	387	3	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	387	4	study	study	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	387	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	387	6	directed	direct	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	387	7	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	387	8	project	project	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	387	9	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	387	10	wrote	write	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	387	11	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	387	12	manuscript	manuscript	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	387	13	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	388	1	All	all	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	388	2	authors	author	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	388	3	read	read	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	388	4	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	388	5	approved	approve	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	388	6	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	388	7	final	final	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	388	8	manuscript	manuscript	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	388	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	389	1	Competing	compete	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	389	2	interests	interest	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	389	3	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	389	4	authors	author	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	389	5	declare	declare	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	389	6	that	that	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	389	7	they	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	389	8	have	have	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	389	9	no	no	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	389	10	competing	compete	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	389	11	interests	interest	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	389	12	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	390	1	Received	receive	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	390	2	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	390	3	22	22	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	390	4	July	July	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	390	5	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	390	6	Accepted	accept	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	390	7	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	390	8	24	24	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	390	9	November	November	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	390	10	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	390	11	Published	publish	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	390	12	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	390	13	24	24	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	390	14	November	November	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	390	15	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	390	16	References	reference	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	390	17	1	1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	390	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	391	1	Hirsch	Hirsch	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	391	2	N	N	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	391	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	391	4	Zimmerman	Zimmerman	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	391	5	LB	LB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	391	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	391	7	Grainger	Grainger	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	391	8	RM	RM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	391	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	391	10	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	391	11	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	391	12	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	391	13	next	next	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	391	14	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	391	15	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	391	16	X.	x.	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	391	17	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	391	18	genetics	genetic	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	391	19	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	391	20	genomics	genomic	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	391	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	392	1	Dev	Dev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	392	2	Dyn	Dyn	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	392	3	2002	2002	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	392	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	392	5	225:422	225:422	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	392	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	392	7	433	433	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	392	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	393	1	2	2	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	393	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	394	1	Showell	Showell	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	394	2	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	394	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	394	4	Conlon	Conlon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	394	5	FL	FL	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	394	6	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	394	7	Decoding	decode	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	394	8	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	394	9	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	394	10	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	394	11	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	394	12	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	395	1	Genesis	Genesis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	395	2	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	395	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	395	4	45:418	45:418	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	395	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	395	6	26	26	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	395	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	396	1	3	3	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	396	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	397	1	Hellsten	hellsten	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	397	2	U	U	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	4	Harland	Harland	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	5	RM	RM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	7	Gilchrist	Gilchrist	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	8	MJ	MJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	10	Hendrix	Hendrix	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	11	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	13	Jurka	Jurka	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	14	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	16	Kapitonov	Kapitonov	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	17	V	V	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	19	Ovcharenko	Ovcharenko	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	20	I	I	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	22	Putnam	Putnam	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	23	NH	NH	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	25	Shu	Shu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	26	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	28	Taher	Taher	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	29	L	L	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	31	Blitz	Blitz	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	32	IL	IL	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	34	Blumberg	Blumberg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	35	B	B	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	37	Dichmann	Dichmann	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	38	DS	DS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	39	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	40	Dubchak	Dubchak	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	41	I	I	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	42	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	43	Amaya	Amaya	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	44	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	45	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	46	Detter	Detter	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	47	JC	JC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	48	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	49	Fletcher	Fletcher	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	50	R	R	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	51	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	52	Gerhard	Gerhard	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	53	DS	DS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	54	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	55	Goodstein	Goodstein	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	56	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	57	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	58	Graves	Graves	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	59	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	60	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	61	Grigoriev	Grigoriev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	62	IV	IV	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	63	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	64	Grimwood	Grimwood	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	65	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	66	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	67	Kawashima	Kawashima	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	68	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	69	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	70	Lindquist	Lindquist	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	71	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	72	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	73	Lucas	Lucas	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	74	SM	SM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	75	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	76	Mead	Mead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	77	PE	PE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	78	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	79	Mitros	Mitros	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	80	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	81	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	82	Ogino	Ogino	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	83	H	H	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	84	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	85	Ohta	Ohta	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	86	Y	Y	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	87	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	88	Poliakov	Poliakov	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	89	AV	AV	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	90	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	91	Pollet	Pollet	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	92	N	N	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	93	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	94	Robert	Robert	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	95	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	96	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	97	Salamov	Salamov	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	98	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	99	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	100	Sater	Sater	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	101	AK	AK	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	102	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	103	Schmutz	Schmutz	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	104	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	105	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	106	Terry	Terry	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	107	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	108	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	109	Vize	Vize	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	110	PD	PD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	111	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	112	Warren	Warren	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	113	WC	WC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	114	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	115	Wells	Wells	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	116	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	117	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	118	Wills	Wills	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	119	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	120	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	121	Wilson	Wilson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	122	RK	RK	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	123	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	124	Zimmerman	Zimmerman	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	125	LB	LB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	126	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	127	Zorn	Zorn	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	128	AM	AM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	129	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	130	Grainger	Grainger	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	131	R	R	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	132	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	133	Grammer	Grammer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	134	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	135	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	136	Khokha	Khokha	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	137	MK	MK	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	138	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	139	Richardson	Richardson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	140	PM	PM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	141	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	397	142	Rokhsar	Rokhsar	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	143	DS	DS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	144	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	397	145	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	397	146	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	397	147	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	397	148	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	397	149	Western	western	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	397	150	clawed	claw	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	397	151	frog	frog	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	397	152	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	153	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	397	154	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	398	1	Science	science	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	398	2	2010	2010	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	398	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	398	4	328:633	328:633	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	398	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	398	6	636	636	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	398	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	399	1	4	4	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	399	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	400	1	Doherty	Doherty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	2	JR	JR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	400	4	Johnson	Johnson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	5	Hamlet	Hamlet	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	6	MR	MR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	7	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	400	8	Kuliyev	Kuliyev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	9	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	400	11	Mead	Mead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	12	PE	PE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	13	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	400	14	A	a	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	400	15	flk-1	flk-1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	400	16	promoter/	promoter/	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	400	17	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	400	18	reporter	reporter	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	400	19	transgenic	transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	20	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	21	laevis	laevi	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	400	22	generated	generate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	400	23	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	400	24	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	400	25	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	26	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	27	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	28	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	400	29	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	400	30	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	400	31	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	400	32	vivo	vivo	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	400	33	model	model	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	400	34	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	400	35	vascular	vascular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	400	36	studies	study	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	400	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	401	1	Dev	Dev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	401	2	Dyn	Dyn	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	401	3	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	401	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	401	5	236:2808	236:2808	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	401	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	401	7	2817	2817	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	401	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	402	1	5	5	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	402	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	403	1	Hamlet	Hamlet	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	2	MR	MR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	403	4	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	5	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	403	7	Kuliyev	Kuliyev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	8	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	403	10	Takeda	Takeda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	11	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	403	13	Taira	Taira	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	14	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	403	16	Kawakami	Kawakami	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	17	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	403	19	Mead	Mead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	20	PE	PE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	21	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	403	22	Tol2	Tol2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	23	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	24	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	403	25	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	403	26	transgenesis	transgenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	403	27	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	403	28	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	29	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	403	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	404	1	Genesis	Genesis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	404	2	2006	2006	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	404	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	404	4	44:438	44:438	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	404	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	404	6	445	445	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	404	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	405	1	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	405	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	406	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	2	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	406	4	Johnson	Johnson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	5	Hamlet	Hamlet	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	6	MR	MR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	7	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	406	8	Kuliyev	Kuliyev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	9	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	10	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	406	11	Zhu	Zhu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	12	H	H	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	13	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	406	14	Doherty	Doherty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	15	JR	JR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	16	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	406	17	Archer	Archer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	18	TD	TD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	406	20	Subhawong	Subhawong	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	21	AP	AP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	406	23	Valentine	Valentine	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	24	MB	MB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	25	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	406	26	Kelley	Kelley	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	27	CM	CM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	28	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	406	29	Mead	Mead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	30	PE	PE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	31	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	406	32	Transgenesis	transgenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	406	33	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	406	34	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	35	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	406	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	406	37	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	38	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	406	39	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	406	40	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	406	41	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	407	1	Dev	Dev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	407	2	Dyn	Dyn	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	407	3	2009	2009	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	407	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	407	5	238:1727	238:1727	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	407	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	407	7	1743	1743	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	407	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	408	1	7	7	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	408	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	409	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	2	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	409	4	Kelley	Kelley	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	5	CM	CM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	409	7	Kuliyev	Kuliyev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	8	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	409	10	Zhu	Zhu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	11	H	H	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	409	13	Sater	Sater	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	14	AK	AK	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	409	16	Wells	Wells	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	17	DE	DE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	409	19	Mead	Mead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	20	PE	PE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	21	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	409	22	Remobilization	Remobilization	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	23	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	409	24	Tol2	tol2	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	409	25	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	409	26	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	409	27	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	409	28	tropicalis	tropicali	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	409	29	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	410	1	BMC	BMC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	410	2	Dev	Dev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	410	3	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	410	4	2010	2010	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	410	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	410	6	10:11	10:11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	410	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	411	1	8	8	LS
work_lg7uwni46nhjxg5pc3yrqf32wy	411	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	412	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	2	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	412	4	Kuliyev	Kuliyev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	5	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	412	7	Mead	Mead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	8	PE	PE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	412	10	Injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	412	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	412	12	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	412	13	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	14	transgenesis	transgenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	412	15	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	412	16	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	17	tropicalis	tropicali	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	412	18	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	412	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	412	20	identification	identification	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	412	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	412	22	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	412	23	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	24	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	412	25	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	412	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	413	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	413	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	413	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	413	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	8	15	15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	413	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	413	11	http://genome.jgi-psf.org/Xentr4/Xentr4.home.html	http://genome.jgi-psf.org/xentr4/xentr4.home.html	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	12	http://genome.jgi-psf.org/Xentr4/Xentr4.home.html	http://genome.jgi-psf.org/Xentr4/Xentr4.home.html	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	13	http://www.ncbi.nlm.nih.gov/pubmed/12454920?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12454920?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	14	http://www.ncbi.nlm.nih.gov/pubmed/12454920?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12454920?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	15	http://www.ncbi.nlm.nih.gov/pubmed/17549727?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17549727?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	16	http://www.ncbi.nlm.nih.gov/pubmed/20431018?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/20431018?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	17	http://www.ncbi.nlm.nih.gov/pubmed/20431018?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/20431018?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	18	http://www.ncbi.nlm.nih.gov/pubmed/17879322?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17879322?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	19	http://www.ncbi.nlm.nih.gov/pubmed/17879322?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17879322?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	20	http://www.ncbi.nlm.nih.gov/pubmed/17879322?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17879322?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	21	http://www.ncbi.nlm.nih.gov/pubmed/17879322?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17879322?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	22	http://www.ncbi.nlm.nih.gov/pubmed/16906529?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16906529?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	23	http://www.ncbi.nlm.nih.gov/pubmed/19517568?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/19517568?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	24	http://www.ncbi.nlm.nih.gov/pubmed/19517568?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/19517568?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	25	http://www.ncbi.nlm.nih.gov/pubmed/20096115?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/20096115?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	26	http://www.ncbi.nlm.nih.gov/pubmed/18007633?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18007633?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	27	http://www.ncbi.nlm.nih.gov/pubmed/18007633?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18007633?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	28	sites	site	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	413	29	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	30	modified	modified	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	413	31	extension	extension	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	32	primer	primer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	33	tag	tag	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	34	selection	selection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	35	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	413	36	EPTS	EPTS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	37	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	413	38	linker	linker	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	39	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	413	40	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	413	41	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	413	42	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	414	1	Nat	Nat	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	414	2	Protoc	Protoc	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	414	3	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	414	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	414	5	2:2975	2:2975	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	414	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	414	7	2986	2986	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	414	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	415	1	9	9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	415	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	416	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	416	2	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	416	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	416	4	Mead	Mead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	416	5	PE	PE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	416	6	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	416	7	Manipulating	manipulate	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	416	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	416	9	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	416	10	genome	genome	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	416	11	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	416	12	transposable	transposable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	416	13	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	416	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	417	1	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	417	2	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	417	3	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	417	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	417	5	8(Suppl	8(Suppl	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	417	6	1):S11	1):S11	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	417	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	418	1	10	10	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	418	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	419	1	Kawakami	Kawakami	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	419	2	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	419	3	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	419	4	Tol2	tol2	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	419	5	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	419	6	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	419	7	versatile	versatile	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	419	8	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	419	9	transfer	transfer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	419	10	vector	vector	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	419	11	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	419	12	vertebrates	vertebrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	419	13	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	420	1	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	420	2	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	420	3	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	420	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	420	5	8(Suppl	8(Suppl	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	420	6	1):S7	1):s7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	420	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	421	1	11	11	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	421	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	422	1	Sivasubbu	Sivasubbu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	422	2	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	422	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	422	4	Balciunas	Balciunas	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	422	5	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	422	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	422	7	Amsterdam	Amsterdam	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	422	8	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	422	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	422	10	Ekker	Ekker	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	422	11	SC	SC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	422	12	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	422	13	Insertional	insertional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	422	14	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	422	15	strategies	strategy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	422	16	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	422	17	zebrafish	zebrafish	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	422	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	423	1	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	423	2	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	423	3	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	423	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	423	5	8(Suppl	8(suppl	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	423	6	1):S9	1):s9	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	423	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	424	1	12	12	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	424	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	425	1	Whitelaw	whitelaw	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	425	2	E	e	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	425	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	425	4	Sutherland	Sutherland	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	5	H	H	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	425	7	Kearns	Kearns	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	8	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	425	10	Morgan	Morgan	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	11	H	H	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	425	13	Weaving	Weaving	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	14	L	L	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	425	16	Garrick	Garrick	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	17	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	425	18	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	425	19	Epigenetic	epigenetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	425	20	effects	effect	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	425	21	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	425	22	transgene	transgene	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	425	23	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	425	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	426	1	Methods	Methods	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	426	2	Mol	Mol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	426	3	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	426	4	2001	2001	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	426	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	426	6	158:351	158:351	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	426	7	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	426	8	368	368	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	426	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	427	1	13	13	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	427	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	428	1	Chen	Chen	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	2	ZY	ZY	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	428	4	He	He	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	5	CY	CY	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	428	7	Meuse	Meuse	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	8	L	L	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	428	10	Kay	Kay	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	11	MA	MA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	12	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	428	13	Silencing	silencing	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	428	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	428	15	episomal	episomal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	428	16	transgene	transgene	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	428	17	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	428	18	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	428	19	plasmid	plasmid	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	20	bacterial	bacterial	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	428	21	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	22	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	428	23	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	428	24	vivo	vivo	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	428	25	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	429	1	Gene	Gene	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	429	2	Ther	Ther	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	429	3	2004	2004	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	429	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	429	5	11:856	11:856	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	429	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	429	7	864	864	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	429	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	430	1	14	14	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	430	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	431	1	Kondrychyn	Kondrychyn	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	2	I	I	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	431	4	Garcia	Garcia	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	431	6	Lecea	Lecea	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	7	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	8	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	431	9	Emelyanov	Emelyanov	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	10	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	11	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	431	12	Parinov	Parinov	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	13	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	14	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	431	15	Korzh	Korzh	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	16	V	V	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	17	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	431	18	Genome-	Genome-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	19	wide	wide	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	431	20	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	431	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	431	22	Tol2	Tol2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	23	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	24	reintegration	reintegration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	431	25	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	431	26	zebrafish	zebrafish	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	431	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	432	1	BMC	BMC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	432	2	Genomics	Genomics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	432	3	2009	2009	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	432	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	432	5	10:418	10:418	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	432	6	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	433	1	15	15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	433	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	434	1	Nagayoshi	Nagayoshi	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	2	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	434	4	Hayashi	Hayashi	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	5	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	434	7	Abe	Abe	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	8	G	G	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	434	10	Osato	Osato	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	11	N	N	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	434	13	Asakawa	Asakawa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	14	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	434	16	Urasaki	Urasaki	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	17	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	434	19	Horikawa	Horikawa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	20	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	434	22	Ikeo	Ikeo	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	23	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	434	25	Takeda	Takeda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	26	H	H	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	434	28	Kawakami	Kawakami	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	29	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	30	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	434	31	Insertional	insertional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	434	32	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	434	33	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	434	34	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	434	35	Tol2	Tol2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	36	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	434	37	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	434	38	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	434	39	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	434	40	trap	trap	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	434	41	approach	approach	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	434	42	generated	generate	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	434	43	mutations	mutation	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	434	44	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	434	45	two	two	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	434	46	developmental	developmental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	434	47	genes	gene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	434	48	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	434	49	tcf7	tcf7	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	434	50	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	434	51	synembryn	synembryn	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	434	52	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	434	53	like	like	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	434	54	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	435	1	Development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	435	2	2008	2008	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	435	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	435	4	135:159	135:159	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	435	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	435	6	169	169	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	435	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	436	1	16	16	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	436	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	437	1	Parinov	Parinov	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	2	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	437	4	Kondrichin	Kondrichin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	5	I	I	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	437	7	Korzh	Korzh	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	8	V	V	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	437	10	Emelyanov	Emelyanov	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	11	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	12	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	437	13	Tol2	Tol2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	14	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	15	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	437	16	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	437	17	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	437	18	trap	trap	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	437	19	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	437	20	identify	identify	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	437	21	developmentally	developmentally	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	437	22	regulated	regulate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	437	23	zebrafish	zebrafish	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	24	genes	gene	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	437	25	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	437	26	vivo	vivo	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	437	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	438	1	Dev	Dev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	438	2	Dyn	Dyn	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	438	3	2004	2004	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	438	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	438	5	231:449	231:449	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	438	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	438	7	459	459	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	438	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	439	1	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	439	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	440	1	Collier	Collier	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	2	LS	LS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	440	4	Carlson	Carlson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	5	CM	CM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	440	7	Ravimohan	Ravimohan	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	8	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	440	10	Dupuy	Dupuy	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	11	AJ	AJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	440	13	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	14	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	15	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	440	16	Cancer	cancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	440	17	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	440	18	discovery	discovery	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	440	19	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	440	20	solid	solid	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	440	21	tumours	tumour	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	440	22	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	440	23	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	440	24	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	440	25	based	base	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	440	26	somatic	somatic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	440	27	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	440	28	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	440	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	440	30	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	440	31	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	441	1	Nature	nature	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	441	2	2005	2005	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	441	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	441	4	436:272	436:272	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	441	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	441	6	276	276	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	441	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	442	1	18	18	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	442	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	443	1	Dupuy	Dupuy	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	2	AJ	AJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	443	4	Akagi	Akagi	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	5	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	443	7	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	8	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	443	10	Copeland	Copeland	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	11	NG	NG	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	443	13	Jenkins	Jenkins	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	14	NA	NA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	15	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	443	16	Mammalian	mammalian	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	443	17	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	443	18	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	443	19	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	443	20	highly	highly	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	443	21	mobile	mobile	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	443	22	somatic	somatic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	443	23	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	24	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	443	25	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	443	26	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	443	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	444	1	Nature	nature	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	444	2	2005	2005	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	444	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	444	4	436:221	436:221	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	444	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	444	6	6	6	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	444	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	445	1	19	19	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	445	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	446	1	Horie	Horie	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	2	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	446	4	Kuroiwa	Kuroiwa	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	446	5	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	446	7	Ikawa	Ikawa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	8	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	446	10	Okabe	Okabe	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	11	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	446	13	Kondoh	Kondoh	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	14	G	G	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	446	16	Matsuda	Matsuda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	17	Y	Y	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	446	19	Takeda	Takeda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	20	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	21	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	446	22	Efficient	efficient	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	446	23	chromosomal	chromosomal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	446	24	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	446	25	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	446	26	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	446	27	Tc1	tc1	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	446	28	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	446	29	mariner-	mariner-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	446	30	like	like	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	446	31	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	32	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	446	33	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	446	34	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	446	35	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	446	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	447	1	Proc	Proc	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	447	2	Natl	Natl	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	447	3	Acad	Acad	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	447	4	Sci	Sci	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	447	5	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	447	6	2001	2001	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	447	7	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	447	8	98:9191	98:9191	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	447	9	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	447	10	9196	9196	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	447	11	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	448	1	20	20	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	448	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	449	1	Keng	Keng	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	2	VW	VW	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	449	4	Ryan	Ryan	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	5	BJ	BJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	449	7	Wangensteen	Wangensteen	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	8	KJ	KJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	449	10	Balciunas	Balciunas	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	11	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	449	13	Schmedt	Schmedt	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	14	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	449	16	Ekker	Ekker	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	17	SC	SC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	449	19	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	20	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	21	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	449	22	Efficient	Efficient	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	23	Transposition	Transposition	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	24	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	449	25	Tol2	Tol2	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	449	26	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	449	27	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	449	28	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	449	29	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	449	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	450	1	Genetics	Genetics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	450	2	2009	2009	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	450	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	450	4	183:1565	183:1565	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	450	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	450	6	1573	1573	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	450	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	451	1	21	21	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	451	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	452	1	Kitada	Kitada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	2	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	452	4	Ishishita	Ishishita	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	5	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	452	7	Tosaka	Tosaka	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	8	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	452	10	Takahashi	Takahashi	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	11	R	R	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	452	13	Ueda	Ueda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	14	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	452	16	Keng	Keng	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	17	VW	VW	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	452	19	Horie	Horie	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	20	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	452	22	Takeda	Takeda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	23	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	24	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	452	25	Transposon	Transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	452	26	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	452	27	tagged	tag	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	452	28	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	452	29	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	452	30	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	452	31	rat	rat	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	452	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	453	1	Nat	Nat	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	453	2	Methods	Methods	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	453	3	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	453	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	453	5	4:131	4:131	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	453	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	453	7	133	133	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	453	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	454	1	22	22	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	454	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	455	1	Lu	Lu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	2	B	B	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	455	4	Geurts	Geurts	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	5	AM	AM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	455	7	Poirier	Poirier	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	8	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	455	10	Petit	Petit	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	11	DC	DC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	455	13	Harrison	Harrison	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	14	W	W	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	455	16	Overbeek	Overbeek	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	17	PA	PA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	455	19	Bishop	Bishop	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	20	CE	CE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	21	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	455	22	Generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	455	23	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	455	24	rat	rat	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	455	25	mutants	mutant	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	455	26	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	455	27	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	455	28	coat	coat	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	455	29	color	color	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	455	30	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	455	31	tagged	tag	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	455	32	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	33	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	455	34	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	455	35	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	455	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	456	1	Mamm	mamm	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	456	2	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	456	3	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	456	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	456	5	18:338	18:338	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	456	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	456	7	346	346	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	456	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	457	1	23	23	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	457	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	458	1	Takeda	Takeda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	458	2	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	458	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	458	4	Keng	Keng	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	458	5	VW	VW	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	458	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	458	7	Horie	Horie	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	458	8	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	458	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	458	10	Germline	Germline	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	458	11	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	458	12	mediated	mediate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	458	13	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	458	14	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	458	15	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	458	16	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	458	17	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	458	18	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	458	19	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	458	20	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	459	1	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	459	2	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	459	3	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	459	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	459	5	8(Suppl	8(Suppl	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	459	6	1):S14	1):S14	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	459	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	460	1	24	24	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	460	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	461	1	Ivics	Ivics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	461	2	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	461	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	461	4	Hackett	Hackett	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	461	5	PB	PB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	461	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	461	7	Plasterk	Plasterk	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	461	8	RH	RH	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	461	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	461	10	Izsvák	Izsvák	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	461	11	Z	z	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	461	12	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	461	13	Molecular	molecular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	461	14	reconstruction	reconstruction	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	461	15	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	461	16	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	461	17	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	461	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	461	19	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	461	20	Tc1-like	tc1-like	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	461	21	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	461	22	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	461	23	fish	fish	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	461	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	461	25	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	461	26	its	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	461	27	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	461	28	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	461	29	human	human	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	461	30	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	461	31	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	462	1	Cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	462	2	1997	1997	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	462	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	462	4	91:501	91:501	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	462	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	462	6	510	510	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	462	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	463	1	25	25	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	463	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	464	1	Sinzelle	Sinzelle	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	2	L	L	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	464	4	Vallin	Vallin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	5	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	464	7	Coen	Coen	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	8	L	L	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	464	10	Chesneau	Chesneau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	11	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	464	13	Du	Du	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	14	Pasquier	Pasquier	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	15	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	16	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	464	17	Pollet	Pollet	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	18	N	N	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	19	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	464	20	Demeneix	Demeneix	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	21	B	B	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	22	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	464	23	Mazabraud	Mazabraud	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	24	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	25	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	464	26	Generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	464	27	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	464	28	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	464	29	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	30	laevis	laevi	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	464	31	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	464	32	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	464	33	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	34	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	464	35	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	464	36	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	464	37	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	465	1	Transgenic	Transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	465	2	Res	Res	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	465	3	2006	2006	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	465	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	465	5	15:751	15:751	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	465	6	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	465	7	760	760	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	465	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	466	1	26	26	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	466	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	467	1	Okabe	Okabe	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	2	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	467	4	Ikawa	Ikawa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	5	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	467	7	Kominami	Kominami	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	8	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	467	10	Nakanishi	Nakanishi	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	11	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	467	13	Nishimune	Nishimune	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	14	Y	Y	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	467	15	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	467	16	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	467	17	Green	green	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	467	18	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	467	19	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	467	20	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	467	21	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	467	22	source	source	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	467	23	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	467	24	ubiquitous	ubiquitous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	467	25	green	green	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	467	26	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	467	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	468	1	FEBS	FEBS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	468	2	Lett	Lett	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	468	3	1997	1997	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	468	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	468	5	407:313	407:313	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	468	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	468	7	319	319	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	468	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	469	1	27	27	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	469	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	470	1	Dupuy	Dupuy	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	470	2	AJ	AJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	470	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	470	4	Fritz	Fritz	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	470	5	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	470	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	470	7	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	470	8	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	470	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	470	10	Transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	470	11	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	470	12	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	470	13	disruption	disruption	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	470	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	470	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	470	16	male	male	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	470	17	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	470	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	470	19	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	470	20	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	470	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	471	1	Genesis	Genesis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	471	2	2001	2001	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	471	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	471	4	30:82	30:82	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	471	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	471	6	88	88	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	471	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	472	1	28	28	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	472	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	473	1	Offield	Offield	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	473	2	MF	MF	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	473	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	473	4	Hirsch	Hirsch	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	473	5	N	N	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	473	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	473	7	Grainger	Grainger	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	473	8	RM	RM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	473	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	473	10	The	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	473	11	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	473	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	473	13	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	473	14	tropicalis	tropicalis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	473	15	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	473	16	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	473	17	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	473	18	their	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	473	19	use	use	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	473	20	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	473	21	studying	study	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	473	22	lens	lens	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	473	23	developmental	developmental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	473	24	timing	timing	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	473	25	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	473	26	living	live	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	473	27	embryos	embryo	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	473	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	474	1	Development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	474	2	2000	2000	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	474	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	474	4	127:1789	127:1789	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	474	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	474	6	1797	1797	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	474	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	475	1	29	29	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	475	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	476	1	Etkin	Etkin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	476	2	LD	LD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	476	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	476	4	Pearman	Pearman	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	476	5	B	B	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	476	6	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	476	7	Distribution	distribution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	8	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	476	9	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	10	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	476	11	germ	germ	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	12	line	line	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	13	transmission	transmission	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	15	exogenous	exogenous	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	476	16	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	17	sequences	sequence	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	476	18	following	follow	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	476	19	microinjection	microinjection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	20	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	21	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	476	22	laevis	laevis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	476	23	eggs	egg	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	476	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	477	1	Development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	477	2	1987	1987	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	477	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	477	4	99:15	99:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	477	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	477	6	23	23	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	477	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	478	1	30	30	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	478	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	479	1	Nieuwkoop	Nieuwkoop	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	2	PD	PD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	479	4	Faber	Faber	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	5	F	F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	6	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	479	7	Normal	normal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	479	8	table	table	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	10	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	11	laevis	laevi	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	479	12	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	479	13	Daudin	Daudin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	14	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	479	15	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	479	16	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	479	17	systematical	systematical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	479	18	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	479	19	chronological	chronological	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	479	20	survey	survey	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	22	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	479	23	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	24	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	25	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	479	26	fertilized	fertilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	27	egg	egg	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	28	till	till	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	479	30	end	end	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	31	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	32	metamorphosis	metamorphosis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	479	33	New	New	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	34	York	York	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	35	&	&	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	479	36	London	London	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	37	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	479	38	Garland	Garland	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	39	Publishing	Publishing	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	40	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	479	41	Inc.	Inc.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	479	42	;	;	:
work_lg7uwni46nhjxg5pc3yrqf32wy	479	43	1994	1994	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	479	44	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	480	1	31	31	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	480	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	481	1	Plasterk	Plasterk	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	481	2	RH	RH	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	481	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	481	4	Izsvak	Izsvak	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	481	5	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	481	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	481	7	Ivics	Ivics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	481	8	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	481	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	481	10	Resident	resident	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	481	11	aliens	alien	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	481	12	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	481	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	481	14	Tc1	Tc1	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	481	15	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	481	16	mariner	mariner	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	481	17	superfamily	superfamily	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	481	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	481	19	transposable	transposable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	481	20	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	481	21	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	482	1	Trends	Trends	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	482	2	Genet	Genet	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	482	3	1999	1999	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	482	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	482	5	15:326	15:326	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	482	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	482	7	332	332	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	482	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	483	1	32	32	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	483	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	484	1	Izsvák	Izsvák	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	2	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	484	4	Khare	Khare	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	5	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	484	7	Behlke	Behlke	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	8	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	484	10	Heinemann	Heinemann	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	11	U	U	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	484	13	Plasterk	Plasterk	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	14	RH	RH	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	484	16	Ivics	Ivics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	17	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	18	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	484	19	Involvement	involvement	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	484	20	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	484	21	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	484	22	bifunctional	bifunctional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	484	23	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	484	24	paired	pair	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	484	25	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	484	26	like	like	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	484	27	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	484	28	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	484	29	binding	bind	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	484	30	domain	domain	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	484	31	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	484	32	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	484	33	transpositional	transpositional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	484	34	enhancer	enhancer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	484	35	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	484	36	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	37	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	484	38	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	484	39	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	485	1	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	485	2	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	485	3	Chem	Chem	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	485	4	2002	2002	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	485	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	485	6	277:34581	277:34581	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	485	7	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	485	8	24588	24588	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	485	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	486	1	33	33	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	486	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	487	1	Cui	Cui	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	2	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	487	4	Geurts	Geurts	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	5	AM	am	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	487	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	487	7	Liu	Liu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	8	G	G	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	487	10	Kaufman	Kaufman	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	11	CD	CD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	487	13	Hackett	Hackett	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	14	PB	PB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	15	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	487	16	Structure	structure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	487	17	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	487	18	function	function	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	487	19	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	487	20	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	487	21	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	487	22	inverted	inverted	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	487	23	terminal	terminal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	487	24	repeats	repeat	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	487	25	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	487	26	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	487	27	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	28	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	29	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	487	30	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	488	1	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	488	2	Mol	Mol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	488	3	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	488	4	2002	2002	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	488	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	488	6	318:1221	318:1221	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	488	7	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	488	8	1235	1235	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	488	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	489	1	34	34	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	489	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	490	1	Zhang	Zhang	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	2	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	490	4	Yu	Yu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	5	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	490	7	Pulletikurti	Pulletikurti	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	8	V	V	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	490	10	Lamb	Lamb	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	11	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	490	13	Danilova	Danilova	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	14	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	490	16	Weber	Weber	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	17	DF	DF	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	490	19	Birchler	Birchler	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	20	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	490	22	Peterson	Peterson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	23	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	24	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	490	25	Alternative	Alternative	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	26	Ac	Ac	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	27	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	490	28	Ds	Ds	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	490	29	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	490	30	induces	induce	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	490	31	major	major	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	490	32	chromosomal	chromosomal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	490	33	rearrangements	rearrangement	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	490	34	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	490	35	maize	maize	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	490	36	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	491	1	Genes	Genes	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	491	2	Dev	Dev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	491	3	2009	2009	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	491	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	491	5	23:755	23:755	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	491	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	491	7	765	765	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	491	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	492	1	35	35	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	492	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	493	1	Zhang	Zhang	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	493	2	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	493	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	493	4	Peterson	Peterson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	493	5	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	493	6	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	493	7	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	493	8	segmental	segmental	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	493	9	deletion	deletion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	493	10	series	series	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	493	11	generated	generate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	493	12	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	493	13	sister-	sister-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	493	14	chromatid	chromatid	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	493	15	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	493	16	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	493	17	Ac	Ac	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	493	18	transposable	transposable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	493	19	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	493	20	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	493	21	maize	maize	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	493	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	494	1	Genetics	Genetics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	494	2	2005	2005	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	494	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	494	4	171:333	171:333	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	494	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	494	6	344	344	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	494	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	495	1	36	36	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	495	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	496	1	Zhang	Zhang	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	496	2	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	496	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	496	4	Peterson	Peterson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	496	5	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	496	6	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	496	7	Transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	496	8	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	496	9	reversed	reversed	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	496	10	Ac	Ac	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	496	11	element	element	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	496	12	ends	end	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	496	13	generates	generate	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	496	14	chromosome	chromosome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	496	15	rearrangements	rearrangement	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	496	16	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	496	17	maize	maize	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	496	18	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	497	1	Genetics	Genetics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	497	2	2004	2004	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	497	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	497	4	167:1929	167:1929	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	497	5	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	497	6	1937	1937	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	497	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	498	1	37	37	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	498	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	499	1	Zhang	Zhang	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	499	2	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	499	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	499	4	Peterson	Peterson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	499	5	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	499	6	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	499	7	Genome	Genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	499	8	rearrangements	rearrangement	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	499	9	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	499	10	nonlinear	nonlinear	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	499	11	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	499	12	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	499	13	maize	maize	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	499	14	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	500	1	Genetics	Genetics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	500	2	1999	1999	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	500	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	500	4	153:1403	153:1403	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	500	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	500	6	1410	1410	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	500	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	501	1	38	38	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	501	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	502	1	Lister	Lister	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	2	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	502	4	Jackson	Jackson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	5	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	502	7	Martin	Martin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	8	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	502	10	Transposon	Transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	11	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	502	12	induced	induce	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	13	inversion	inversion	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	15	Antirrhinum	Antirrhinum	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	16	modifies	modifies	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	17	nivea	nivea	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	18	gene	gene	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	19	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	20	to	to	TO
work_lg7uwni46nhjxg5pc3yrqf32wy	502	21	give	give	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	502	22	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	502	23	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	502	24	flower	flower	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	25	color	color	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	26	pattern	pattern	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	27	under	under	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	28	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	502	29	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	30	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	502	31	cycloidearadialis	cycloidearadialis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	502	32	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	503	1	Plant	Plant	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	503	2	Cell	Cell	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	503	3	1993	1993	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	503	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	503	5	5:1541	5:1541	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	503	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	503	7	1553	1553	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	503	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	504	1	39	39	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	504	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	505	1	Martin	Martin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	505	2	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	505	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	505	4	Lister	Lister	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	505	5	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	505	6	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	505	7	Genome	genome	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	505	8	juggling	juggle	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	505	9	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	505	10	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	505	11	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	505	12	Tam3-induced	tam3-induced	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	505	13	rearrangements	rearrangement	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	505	14	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	505	15	Antirrhinum	Antirrhinum	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	505	16	majus	maju	VBD
work_lg7uwni46nhjxg5pc3yrqf32wy	505	17	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	506	1	Dev	Dev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	506	2	Genet	Genet	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	506	3	1989	1989	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	506	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	506	5	10:438	10:438	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	506	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	506	7	451	451	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	506	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	507	1	40	40	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	507	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	508	1	Moerman	Moerman	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	508	2	DG	DG	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	508	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	508	4	Kiff	Kiff	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	508	5	JE	JE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	508	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	508	7	Waterston	Waterston	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	508	8	RH	RH	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	508	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	508	10	Germline	germline	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	508	11	excision	excision	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	508	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	508	13	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	508	14	transposable	transposable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	508	15	element	element	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	508	16	Tc1	tc1	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	508	17	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	508	18	C.	C.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	508	19	elegans	elegan	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	508	20	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	509	1	Nucleic	Nucleic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	509	2	Acids	Acids	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	509	3	Res	res	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	509	4	1991	1991	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	509	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	509	6	19:5669	19:5669	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	509	7	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	509	8	5672	5672	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	509	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	510	1	41	41	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	510	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	511	1	Geurts	geurt	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	511	2	AM	am	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	511	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	4	Collier	Collier	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	5	LS	LS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	7	Geurts	Geurts	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	8	JL	JL	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	10	Oseth	Oseth	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	11	LL	LL	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	13	Bell	Bell	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	14	ML	ML	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	16	Mu	Mu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	17	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	19	Lucito	Lucito	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	20	R	R	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	22	Godbout	Godbout	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	23	SA	SA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	25	Green	Green	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	26	LE	LE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	28	Lowe	Lowe	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	29	SW	SW	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	31	Hirsch	Hirsch	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	32	BA	BA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	34	Leinwand	Leinwand	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	35	LA	LA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	511	37	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	38	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	511	39	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	511	40	Gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	511	41	mutations	mutation	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	511	42	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	511	43	genomic	genomic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	511	44	rearrangements	rearrangement	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	511	45	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	511	46	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	511	47	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	511	48	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	511	49	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	511	50	result	result	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	511	51	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	511	52	transposon	transposon	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	511	53	mobilization	mobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	511	54	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	511	55	chromosomal	chromosomal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	511	56	concatemers	concatemer	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	511	57	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	512	1	PLoS	PLoS	:
work_lg7uwni46nhjxg5pc3yrqf32wy	512	2	Genet	Genet	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	512	3	2006	2006	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	512	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	512	5	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	512	6	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	512	7	e156	e156	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	512	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	513	1	42	42	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	513	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	514	1	Vigdal	Vigdal	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	2	TJ	TJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	514	4	Kaufman	Kaufman	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	5	CD	CD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	514	7	Izsvák	Izsvák	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	8	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	514	10	Voytas	Voytas	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	11	DF	DF	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	514	13	Ivics	Ivics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	14	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	15	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	514	16	Common	common	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	514	17	physical	physical	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	514	18	properties	property	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	514	19	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	514	20	DNA	dna	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	514	21	affecting	affect	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	514	22	target	target	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	514	23	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	514	24	selection	selection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	514	25	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	514	26	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	27	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	514	28	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	514	29	other	other	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	514	30	Tc1	tc1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	514	31	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	514	32	mariner	mariner	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	514	33	transposable	transposable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	514	34	elements	element	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	514	35	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	515	1	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	515	2	Mol	Mol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	515	3	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	515	4	2002	2002	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	515	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	515	6	323:441	323:441	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	515	7	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	515	8	452	452	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	515	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	516	1	43	43	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	516	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	517	1	Yant	yant	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	517	2	SR	SR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	517	4	Wu	Wu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	5	X	X	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	517	7	Huang	Huang	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	8	Y	Y	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	517	10	Garrison	Garrison	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	11	B	B	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	517	13	Burgess	Burgess	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	14	SM	SM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	517	16	Kay	Kay	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	17	MA	MA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	18	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	517	19	High	high	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	517	20	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	517	21	resolution	resolution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	517	22	genome	genome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	517	23	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	517	24	wide	wide	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	517	25	mapping	mapping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	517	26	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	517	27	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	517	28	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	517	29	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	517	30	mammals	mammal	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	517	31	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	518	1	Mol	Mol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	518	2	Cell	Cell	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	518	3	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	518	4	2005	2005	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	518	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	518	6	25:2085	25:2085	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	518	7	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	518	8	2094	2094	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	518	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	519	1	44	44	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	519	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	520	1	Wells	Wells	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	2	DE	DE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	4	Gutierrez	Gutierrez	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	5	L	L	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	7	Xu	Xu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	8	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	10	Krylov	Krylov	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	11	V	V	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	13	Macha	Macha	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	14	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	16	Blankenburg	Blankenburg	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	17	KP	KP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	19	Hitchens	Hitchens	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	20	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	22	Bellot	Bellot	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	23	LJ	LJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	25	Spivey	Spivey	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	26	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	28	Stemple	Stemple	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	29	DL	DL	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	31	Kowis	Kowis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	32	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	34	Ye	Ye	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	35	Y	Y	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	37	Pasternak	Pasternak	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	38	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	39	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	40	Owen	Owen	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	41	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	42	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	43	Tran	Tran	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	44	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	45	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	46	Slavikova	Slavikova	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	47	R	R	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	48	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	49	Tumova	Tumova	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	50	L	L	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	51	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	52	Tlapakova	Tlapakova	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	53	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	54	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	55	Seifertova	Seifertova	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	56	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	57	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	58	Scherer	Scherer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	59	SE	SE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	60	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	520	61	Sater	Sater	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	62	AK	AK	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	63	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	520	64	A	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	520	65	genetic	genetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	520	66	map	map	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	520	67	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	520	68	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	520	69	tropicalis	tropicali	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	520	70	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	521	1	Dev	Dev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	521	2	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	521	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	521	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	521	5	354:1	354:1	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	521	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	521	7	8	8	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	521	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	522	1	45	45	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	522	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	523	1	Luo	Luo	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	523	2	G	G	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	523	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	523	4	Ivics	Ivics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	523	5	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	523	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	523	7	Izsvák	Izsvák	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	523	8	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	523	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	523	10	Bradley	Bradley	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	523	11	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	523	12	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	523	13	Chromosomal	chromosomal	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	523	14	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	523	15	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	523	16	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	523	17	Tc1/	Tc1/	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	523	18	mariner	mariner	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	523	19	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	523	20	like	like	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	523	21	element	element	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	523	22	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	523	23	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	523	24	embryonic	embryonic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	523	25	stem	stem	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	523	26	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	523	27	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	524	1	Proc	Proc	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	524	2	Natl	Natl	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	524	3	Acad	Acad	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	524	4	Sci	Sci	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	524	5	USA	USA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	524	6	1998	1998	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	524	7	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	524	8	95:10769	95:10769	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	524	9	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	524	10	10773	10773	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	524	11	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	525	1	46	46	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	525	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	526	1	Keng	Keng	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	2	VW	VW	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	4	Yae	Yae	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	5	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	7	Hayakawa	Hayakawa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	8	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	10	Mizuno	Mizuno	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	11	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	13	Uno	Uno	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	14	Y	Y	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	16	Yusa	Yusa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	17	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	19	Kokubu	Kokubu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	20	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	22	Kinoshita	Kinoshita	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	23	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	25	Akagi	Akagi	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	26	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	28	Jenkins	Jenkins	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	29	NA	NA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	31	Copeland	Copeland	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	32	NG	NG	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	34	Horie	Horie	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	35	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	526	37	Takeda	Takeda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	38	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	39	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	526	40	Region-	Region-	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	41	specific	specific	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	526	42	saturation	saturation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	526	43	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	526	44	mutagenesis	mutagenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	526	45	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	526	46	mice	mouse	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	526	47	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	526	48	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	526	49	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	50	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	526	51	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	526	52	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	526	53	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	527	1	Nat	Nat	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	527	2	Methods	Methods	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	527	3	2005	2005	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	527	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	527	5	2:763	2:763	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	527	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	527	7	769	769	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	527	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	528	1	47	47	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	528	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	529	1	Geurts	geurt	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	529	2	AM	am	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	529	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	529	4	Wilber	Wilber	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	5	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	529	7	Carlson	Carlson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	8	CM	CM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	529	10	Lobitz	Lobitz	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	11	PD	PD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	529	13	Clark	Clark	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	14	KJ	KJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	529	16	Hackett	Hackett	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	17	PB	PB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	529	19	McIvor	McIvor	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	20	RS	RS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	529	22	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	23	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	24	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	529	25	Conditional	conditional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	529	26	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	529	27	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	529	28	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	529	29	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	529	30	mouse	mouse	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	529	31	using	use	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	529	32	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	529	33	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	529	34	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	35	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	529	36	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	529	37	trap	trap	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	529	38	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	529	39	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	530	1	BMC	BMC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	530	2	Biotechnol	Biotechnol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	530	3	2006	2006	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	530	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	530	5	6:30	6:30	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	530	6	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	531	1	48	48	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	531	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	532	1	Geurts	geurt	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	532	2	AM	am	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	532	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	532	4	Yang	Yang	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	5	Y	Y	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	532	7	Clark	Clark	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	8	KJ	KJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	532	10	Liu	Liu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	11	G	G	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	532	13	Cui	Cui	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	14	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	532	16	Dupuy	Dupuy	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	17	AJ	AJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	532	19	Bell	Bell	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	20	JB	JB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	532	22	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	23	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	532	25	Hackett	Hackett	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	26	PB	PB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	27	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	532	28	Gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	532	29	transfer	transfer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	532	30	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	532	31	genomes	genome	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	532	32	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	532	33	human	human	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	532	34	cells	cell	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	532	35	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	532	36	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	532	37	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	38	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	532	39	transposon	transposon	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	532	40	system	system	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	532	41	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	533	1	Mol	Mol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	533	2	Ther	Ther	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	533	3	2003	2003	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	533	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	533	5	8:108	8:108	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	533	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	533	7	117	117	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	533	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	534	1	49	49	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	534	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	535	1	Mátés	Mátés	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	2	L	L	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	4	Chuah	Chuah	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	5	MK	MK	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	7	Belay	belay	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	535	8	E	E	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	535	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	10	Jerchow	Jerchow	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	11	B	B	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	13	Manoj	Manoj	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	14	N	N	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	16	Acosta	Acosta	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	17	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	535	18	Sanchez	Sanchez	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	19	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	21	Grzela	Grzela	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	22	DP	DP	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	23	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	24	Schmitt	Schmitt	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	25	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	26	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	27	Becker	Becker	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	28	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	29	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	30	Matrai	Matrai	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	31	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	32	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	33	Ma	Ma	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	34	L	L	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	35	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	36	Samara	Samara	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	37	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	535	38	Kuko	Kuko	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	39	E	e	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	535	40	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	41	Gysemans	Gysemans	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	42	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	43	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	44	Pryputniewicz	Pryputniewicz	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	45	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	46	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	47	Miskey	Miskey	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	48	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	49	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	50	Fletcher	Fletcher	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	51	B	B	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	52	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	53	VandenDriessche	VandenDriessche	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	54	T	T	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	55	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	56	Ivics	Ivics	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	57	Z	Z	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	58	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	535	59	Izsvák	Izsvák	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	60	Z	z	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	535	61	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	535	62	Molecular	molecular	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	535	63	evolution	evolution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	535	64	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	535	65	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	535	66	novel	novel	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	535	67	hyperactive	hyperactive	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	535	68	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	535	69	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	535	70	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	535	71	enables	enable	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	535	72	robust	robust	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	535	73	stable	stable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	535	74	gene	gene	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	535	75	transfer	transfer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	535	76	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	535	77	vertebrates	vertebrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	535	78	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	536	1	Nat	Nat	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	536	2	Genet	Genet	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	536	3	2009	2009	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	536	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	536	5	41:753	41:753	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	536	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	536	7	761	761	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	536	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	537	1	50	50	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	537	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	538	1	Yusa	Yusa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	538	2	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	538	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	538	4	Takeda	Takeda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	538	5	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	538	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	538	7	Horie	Horie	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	538	8	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	538	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	538	10	Enhancement	enhancement	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	538	11	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	538	12	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	538	13	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	538	14	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	538	15	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	538	16	CpG	CpG	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	538	17	methylation	methylation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	538	18	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	538	19	possible	possible	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	538	20	role	role	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	538	21	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	538	22	heterochromatin	heterochromatin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	538	23	formation	formation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	538	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	539	1	Mol	Mol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	539	2	Cell	Cell	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	539	3	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	539	4	2004	2004	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	539	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	539	6	24:4004	24:4004	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	539	7	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	539	8	4018	4018	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	539	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	540	1	51	51	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	540	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	541	1	Ikeda	Ikeda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	2	R	R	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	541	4	Kokubu	Kokubu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	5	C	C	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	541	7	Yusa	Yusa	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	8	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	541	10	Keng	Keng	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	11	VW	VW	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	541	13	Horie	Horie	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	14	K	K	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	541	16	Takeda	Takeda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	17	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	18	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	541	19	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	541	20	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	541	21	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	541	22	has	have	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	541	23	an	an	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	541	24	affinity	affinity	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	541	25	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	541	26	heterochromatin	heterochromatin	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	541	27	conformation	conformation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	541	28	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	542	1	Mol	Mol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	542	2	Cell	Cell	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	542	3	Biol	Biol	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	542	4	2007	2007	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	542	5	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	542	6	27:1665	27:1665	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	542	7	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	542	8	1676	1676	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	542	9	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	543	1	52	52	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	543	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	544	1	Carlson	Carlson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	2	DF	DF	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	544	4	Geurts	Geurts	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	5	AM	am	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	544	7	Garbe	Garbe	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	8	JR	JR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	544	10	Park	Park	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	11	CW	CW	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	544	13	Rangel	Rangel	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	14	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	544	15	Filho	Filho	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	16	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	17	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	544	18	O’Grady	O’Grady	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	19	SM	SM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	20	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	544	21	Jacob	Jacob	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	22	HJ	HJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	23	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	544	24	Steer	Steer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	25	CJ	CJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	26	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	544	27	Largaespada	Largaespada	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	28	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	29	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	544	30	Fahrenkrug	Fahrenkrug	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	31	SC	SC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	32	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	544	33	Efficient	efficient	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	544	34	mammalian	mammalian	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	544	35	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	544	36	transgenesis	transgenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	544	37	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	544	38	cis	cis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	544	39	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	544	40	enhanced	enhance	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	544	41	Sleeping	Sleeping	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	42	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	544	43	transposition	transposition	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	544	44	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	545	1	Transgenic	Transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	545	2	Res	Res	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	545	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	545	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	545	5	20:29	20:29	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	545	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	545	7	45	45	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	545	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	546	1	53	53	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	546	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	547	1	Allen	Allen	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	547	2	ND	ND	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	547	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	547	4	Norris	Norris	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	547	5	ML	ML	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	547	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	547	7	Surani	Surani	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	547	8	MA	MA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	547	9	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	547	10	Epigenetic	epigenetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	547	11	control	control	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	547	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	547	13	transgene	transgene	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	547	14	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	547	15	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	547	16	imprinting	imprinting	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	547	17	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	547	18	genotype	genotype	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	547	19	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	547	20	specific	specific	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	547	21	modifiers	modifier	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	547	22	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	548	1	Cell	cell	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	548	2	1990	1990	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	548	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	548	4	61:853	61:853	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	548	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	548	6	861	861	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	548	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	549	1	54	54	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	549	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	550	1	Carver	Carver	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	2	AS	AS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	4	Dalrymple	Dalrymple	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	5	MA	MA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	7	Wright	Wright	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	8	G	G	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	10	Cottom	Cottom	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	11	DS	DS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	13	Reeves	Reeves	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	14	DB	DB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	16	Gibson	Gibson	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	17	YH	YH	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	19	Keenan	Keenan	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	20	JL	JL	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	22	Barrass	Barrass	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	23	JD	JD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	25	Scott	Scott	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	26	AR	AR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	28	Colman	Colman	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	29	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	550	31	Garner	Garner	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	32	I	-PRON-	PRP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	33	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	550	34	Transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	550	35	livestock	livestock	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	550	36	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	550	37	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	38	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	550	39	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	550	40	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	551	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	551	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	551	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	551	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	8	16	16	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	551	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	551	11	http://www.ncbi.nlm.nih.gov/pubmed/18007633?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18007633?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	12	http://www.ncbi.nlm.nih.gov/pubmed/18007633?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18007633?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	13	http://www.ncbi.nlm.nih.gov/pubmed/18047688?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18047688?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	14	http://www.ncbi.nlm.nih.gov/pubmed/18047688?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18047688?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	15	http://www.ncbi.nlm.nih.gov/pubmed/18047699?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18047699?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	16	http://www.ncbi.nlm.nih.gov/pubmed/18047701?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18047701?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	17	http://www.ncbi.nlm.nih.gov/pubmed/18047701?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18047701?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	18	http://www.ncbi.nlm.nih.gov/pubmed/11236667?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/11236667?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	19	http://www.ncbi.nlm.nih.gov/pubmed/15029228?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15029228?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	20	http://www.ncbi.nlm.nih.gov/pubmed/15029228?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15029228?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	21	http://www.ncbi.nlm.nih.gov/pubmed/19737393?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/19737393?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	22	http://www.ncbi.nlm.nih.gov/pubmed/19737393?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/19737393?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	23	http://www.ncbi.nlm.nih.gov/pubmed/18065431?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18065431?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	24	http://www.ncbi.nlm.nih.gov/pubmed/18065431?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18065431?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	25	http://www.ncbi.nlm.nih.gov/pubmed/18065431?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18065431?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	26	http://www.ncbi.nlm.nih.gov/pubmed/15366023?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15366023?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	27	http://www.ncbi.nlm.nih.gov/pubmed/15366023?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15366023?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	28	http://www.ncbi.nlm.nih.gov/pubmed/15366023?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15366023?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	29	http://www.ncbi.nlm.nih.gov/pubmed/16015333?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16015333?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	30	http://www.ncbi.nlm.nih.gov/pubmed/16015333?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16015333?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	31	http://www.ncbi.nlm.nih.gov/pubmed/16015333?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16015333?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	32	http://www.ncbi.nlm.nih.gov/pubmed/16015321?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16015321?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	33	http://www.ncbi.nlm.nih.gov/pubmed/16015321?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16015321?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	34	http://www.ncbi.nlm.nih.gov/pubmed/16015321?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16015321?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	35	http://www.ncbi.nlm.nih.gov/pubmed/11481482?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/11481482?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	36	http://www.ncbi.nlm.nih.gov/pubmed/11481482?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/11481482?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	37	http://www.ncbi.nlm.nih.gov/pubmed/19805821?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/19805821?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	38	http://www.ncbi.nlm.nih.gov/pubmed/17220894?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17220894?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	39	http://www.ncbi.nlm.nih.gov/pubmed/17557177?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17557177?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	40	http://www.ncbi.nlm.nih.gov/pubmed/17557177?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17557177?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	41	http://www.ncbi.nlm.nih.gov/pubmed/18047691?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18047691?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	42	http://www.ncbi.nlm.nih.gov/pubmed/18047691?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/18047691?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	43	http://www.ncbi.nlm.nih.gov/pubmed/9390559?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/9390559?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	44	http://www.ncbi.nlm.nih.gov/pubmed/9390559?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/9390559?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	45	http://www.ncbi.nlm.nih.gov/pubmed/9390559?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/9390559?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	46	http://www.ncbi.nlm.nih.gov/pubmed/16957880?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16957880?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	47	http://www.ncbi.nlm.nih.gov/pubmed/16957880?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16957880?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	48	http://www.ncbi.nlm.nih.gov/pubmed/9175875?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/9175875?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	49	http://www.ncbi.nlm.nih.gov/pubmed/9175875?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/9175875?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	50	http://www.ncbi.nlm.nih.gov/pubmed/11416868?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/11416868?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	51	http://www.ncbi.nlm.nih.gov/pubmed/11416868?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/11416868?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	52	http://www.ncbi.nlm.nih.gov/pubmed/10751168?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/10751168?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	53	http://www.ncbi.nlm.nih.gov/pubmed/10751168?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/10751168?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	54	http://www.ncbi.nlm.nih.gov/pubmed/10751168?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/10751168?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	55	http://www.ncbi.nlm.nih.gov/pubmed/2443337?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/2443337?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	56	http://www.ncbi.nlm.nih.gov/pubmed/2443337?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/2443337?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	57	http://www.ncbi.nlm.nih.gov/pubmed/2443337?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/2443337?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	58	http://www.ncbi.nlm.nih.gov/pubmed/10431195?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/10431195?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	59	http://www.ncbi.nlm.nih.gov/pubmed/10431195?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/10431195?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	60	http://www.ncbi.nlm.nih.gov/pubmed/12082109?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12082109?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	61	http://www.ncbi.nlm.nih.gov/pubmed/12082109?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12082109?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	62	http://www.ncbi.nlm.nih.gov/pubmed/12082109?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12082109?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	63	http://www.ncbi.nlm.nih.gov/pubmed/12083513?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12083513?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	64	http://www.ncbi.nlm.nih.gov/pubmed/12083513?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12083513?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	65	http://www.ncbi.nlm.nih.gov/pubmed/12083513?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12083513?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	66	http://www.ncbi.nlm.nih.gov/pubmed/19299561?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/19299561?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	67	http://www.ncbi.nlm.nih.gov/pubmed/19299561?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/19299561?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	68	http://www.ncbi.nlm.nih.gov/pubmed/15965263?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15965263?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	69	http://www.ncbi.nlm.nih.gov/pubmed/15965263?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15965263?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	70	http://www.ncbi.nlm.nih.gov/pubmed/15342530?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15342530?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	71	http://www.ncbi.nlm.nih.gov/pubmed/15342530?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15342530?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	72	http://www.ncbi.nlm.nih.gov/pubmed/10545468?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/10545468?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	73	http://www.ncbi.nlm.nih.gov/pubmed/10545468?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/10545468?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	74	http://www.ncbi.nlm.nih.gov/pubmed/8312739?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/8312739?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	75	http://www.ncbi.nlm.nih.gov/pubmed/8312739?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/8312739?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	76	http://www.ncbi.nlm.nih.gov/pubmed/8312739?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/8312739?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	77	http://www.ncbi.nlm.nih.gov/pubmed/2557989?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/2557989?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	78	http://www.ncbi.nlm.nih.gov/pubmed/2557989?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/2557989?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	79	http://www.ncbi.nlm.nih.gov/pubmed/1658738?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/1658738?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	80	http://www.ncbi.nlm.nih.gov/pubmed/1658738?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/1658738?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	81	http://www.ncbi.nlm.nih.gov/pubmed/17009875?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17009875?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	82	http://www.ncbi.nlm.nih.gov/pubmed/17009875?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17009875?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	83	http://www.ncbi.nlm.nih.gov/pubmed/12381300?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12381300?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	84	http://www.ncbi.nlm.nih.gov/pubmed/12381300?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12381300?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	85	http://www.ncbi.nlm.nih.gov/pubmed/12381300?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12381300?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	86	http://www.ncbi.nlm.nih.gov/pubmed/15743807?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15743807?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	87	http://www.ncbi.nlm.nih.gov/pubmed/15743807?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15743807?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	88	http://www.ncbi.nlm.nih.gov/pubmed/21458440?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/21458440?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	89	http://www.ncbi.nlm.nih.gov/pubmed/21458440?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/21458440?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	90	http://www.ncbi.nlm.nih.gov/pubmed/9724779?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/9724779?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	91	http://www.ncbi.nlm.nih.gov/pubmed/9724779?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/9724779?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	92	http://www.ncbi.nlm.nih.gov/pubmed/16179923?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16179923?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	93	http://www.ncbi.nlm.nih.gov/pubmed/16179923?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16179923?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	94	http://www.ncbi.nlm.nih.gov/pubmed/16179923?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16179923?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	95	http://www.ncbi.nlm.nih.gov/pubmed/16800892?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16800892?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	96	http://www.ncbi.nlm.nih.gov/pubmed/16800892?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16800892?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	97	http://www.ncbi.nlm.nih.gov/pubmed/12842434?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12842434?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	98	http://www.ncbi.nlm.nih.gov/pubmed/12842434?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/12842434?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	99	http://www.ncbi.nlm.nih.gov/pubmed/19412179?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/19412179?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	100	http://www.ncbi.nlm.nih.gov/pubmed/19412179?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/19412179?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	101	http://www.ncbi.nlm.nih.gov/pubmed/15082793?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15082793?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	102	http://www.ncbi.nlm.nih.gov/pubmed/15082793?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/15082793?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	103	http://www.ncbi.nlm.nih.gov/pubmed/17178833?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17178833?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	104	http://www.ncbi.nlm.nih.gov/pubmed/17178833?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/17178833?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	105	http://www.ncbi.nlm.nih.gov/pubmed/20352328?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/20352328?dopt=abstract	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	106	http://www.ncbi.nlm.nih.gov/pubmed/20352328?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/20352328?dopt=abstract	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	551	107	http://www.ncbi.nlm.nih.gov/pubmed/2111735?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/2111735?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	108	http://www.ncbi.nlm.nih.gov/pubmed/2111735?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/2111735?dopt=abstract	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	109	bioreactors	bioreactor	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	551	110	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	551	111	stable	stable	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	112	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	113	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	114	human	human	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	551	115	alpha-1-antitrypsin	alpha-1-antitrypsin	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	551	116	by	by	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	117	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	551	118	flock	flock	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	119	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	120	sheep	sheep	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	551	121	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	552	1	Biotechnology	biotechnology	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	552	2	(	(	-LRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	552	3	N	N	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	552	4	Y	y	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	552	5	)	)	-RRB-
work_lg7uwni46nhjxg5pc3yrqf32wy	552	6	1993	1993	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	552	7	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	552	8	11:1263	11:1263	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	552	9	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	552	10	1270	1270	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	552	11	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	553	1	55	55	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	553	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	554	1	Clark	Clark	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	2	KJ	KJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	4	Balciunas	Balciunas	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	5	D	D	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	7	Pogoda	Pogoda	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	8	HM	HM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	10	Ding	Ding	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	11	Y	Y	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	13	Westcot	Westcot	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	14	SE	SE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	15	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	16	Bedell	Bedell	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	17	VM	VM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	18	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	19	Greenwood	Greenwood	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	20	TM	TM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	21	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	22	Urban	Urban	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	23	MD	MD	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	24	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	25	Skuster	Skuster	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	26	KJ	KJ	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	27	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	28	Petzold	petzold	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	554	29	AM	am	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	554	30	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	31	Ni	Ni	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	32	J	J	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	33	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	34	Nielsen	Nielsen	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	35	AL	AL	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	36	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	37	Patowary	Patowary	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	38	A	A	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	39	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	40	Scaria	Scaria	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	41	V	V	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	42	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	43	Sivasubbu	Sivasubbu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	44	S	S	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	45	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	46	Xu	Xu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	47	X	X	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	48	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	49	Hammerschmidt	Hammerschmidt	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	50	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	51	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	554	52	Ekker	Ekker	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	53	SC	SC	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	54	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	554	55	In	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	554	56	vivo	vivo	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	554	57	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	554	58	trapping	trapping	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	554	59	produces	produce	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	554	60	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	554	61	functional	functional	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	554	62	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	554	63	codex	codex	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	554	64	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	554	65	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	554	66	vertebrate	vertebrate	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	554	67	proteome	proteome	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	554	68	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	555	1	Nat	Nat	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	555	2	Methods	Methods	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	555	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	555	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	555	5	8:506	8:506	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	555	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	555	7	515	515	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	555	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	556	1	56	56	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	556	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	557	1	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	2	DA	DA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	557	4	Kelley	Kelley	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	5	CM	CM	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	557	7	Zhu	Zhu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	8	H	H	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	557	10	Kuliyev	Kuliyev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	11	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	12	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	557	13	Mead	Mead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	14	PE	PE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	15	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	557	16	Transposon	Transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	17	transgenesis	transgenesis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	557	18	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	557	19	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	557	20	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	558	1	Methods	method	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	558	2	2010	2010	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	558	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	558	4	51:92	51:92	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	558	5	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	558	6	100	100	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	558	7	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	559	1	57	57	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	559	2	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	560	1	Doherty	Doherty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	560	2	JR	JR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	560	3	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	560	4	Zhu	Zhu	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	560	5	H	H	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	560	6	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	560	7	Kuliyev	Kuliyev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	560	8	E	E	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	560	9	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	560	10	Mead	Mead	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	560	11	PE	PE	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	560	12	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	560	13	Determination	determination	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	560	14	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	560	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	560	16	minimal	minimal	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	560	17	domains	domain	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	560	18	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	560	19	Mix.3	mix.3	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	560	20	/	/	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	560	21	Mixer	Mixer	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	560	22	required	require	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	560	23	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	560	24	endoderm	endoderm	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	560	25	development	development	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	560	26	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	561	1	Mech	Mech	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	561	2	Dev	Dev	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	561	3	2006	2006	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	561	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	561	5	123:56	123:56	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	561	6	-	-	SYM
work_lg7uwni46nhjxg5pc3yrqf32wy	561	7	66	66	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	561	8	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	561	9	doi:10.1186/1759	doi:10.1186/1759	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	561	10	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	561	11	8753	8753	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	561	12	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	561	13	2	2	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	561	14	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	561	15	15	15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	561	16	Cite	cite	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	561	17	this	this	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	561	18	article	article	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	561	19	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	561	20	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	561	21	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	561	22	et	et	FW
work_lg7uwni46nhjxg5pc3yrqf32wy	561	23	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	561	24	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	562	1	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	562	2	Remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	562	3	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	562	4	Sleeping	sleep	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	562	5	Beauty	Beauty	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	562	6	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	562	7	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	562	8	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	562	9	germline	germline	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	562	10	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	562	11	Xenopus	Xenopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	562	12	tropicalis	tropicali	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	562	13	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	563	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	563	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	563	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	563	4	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	563	5	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	564	1	Submit	submit	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	564	2	your	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	564	3	next	next	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	564	4	manuscript	manuscript	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	5	to	to	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	6	BioMed	BioMed	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	7	Central	Central	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	8	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	564	9	take	take	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	564	10	full	full	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	564	11	advantage	advantage	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	12	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	13	:	:	:
work_lg7uwni46nhjxg5pc3yrqf32wy	564	14	•	•	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	564	15	Convenient	convenient	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	564	16	online	online	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	564	17	submission	submission	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	18	•	•	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	19	Thorough	thorough	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	564	20	peer	peer	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	21	review	review	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	22	•	•	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	23	No	no	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	564	24	space	space	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	25	constraints	constraint	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	564	26	or	or	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	564	27	color	color	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	28	figure	figure	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	29	charges	charge	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	564	30	•	•	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	31	Immediate	immediate	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	564	32	publication	publication	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	33	on	on	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	34	acceptance	acceptance	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	35	•	•	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	36	Inclusion	Inclusion	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	37	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	38	PubMed	PubMed	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	39	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	564	40	CAS	CAS	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	41	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	564	42	Scopus	Scopus	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	43	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	564	44	Google	Google	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	45	Scholar	Scholar	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	46	•	•	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	47	Research	Research	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	48	which	which	WDT
work_lg7uwni46nhjxg5pc3yrqf32wy	564	49	is	be	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	564	50	freely	freely	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	564	51	available	available	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	564	52	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	53	redistribution	redistribution	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	54	Submit	submit	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	564	55	your	-PRON-	PRP$
work_lg7uwni46nhjxg5pc3yrqf32wy	564	56	manuscript	manuscript	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	57	at	at	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	564	58	www.biomedcentral.com/submit	www.biomedcentral.com/submit	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	59	Yergeau	Yergeau	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	60	et	et	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	61	al	al	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	564	62	.	.	.
work_lg7uwni46nhjxg5pc3yrqf32wy	565	1	Mobile	Mobile	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	2	DNA	DNA	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	3	2011	2011	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	565	4	,	,	,
work_lg7uwni46nhjxg5pc3yrqf32wy	565	5	2:15	2:15	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	565	6	http://www.mobilednajournal.com/content/2/1/15	http://www.mobilednajournal.com/content/2/1/15	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	7	Page	Page	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	8	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	565	9	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	10	17	17	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	565	11	http://www.ncbi.nlm.nih.gov/pubmed/21552255?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/21552255?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	12	http://www.ncbi.nlm.nih.gov/pubmed/21552255?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/21552255?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	13	http://www.ncbi.nlm.nih.gov/pubmed/21552255?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/21552255?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	14	http://www.ncbi.nlm.nih.gov/pubmed/20211730?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/20211730?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	15	http://www.ncbi.nlm.nih.gov/pubmed/20211730?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/20211730?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	16	http://www.ncbi.nlm.nih.gov/pubmed/16330190?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16330190?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	17	http://www.ncbi.nlm.nih.gov/pubmed/16330190?dopt=Abstract	http://www.ncbi.nlm.nih.gov/pubmed/16330190?dopt=Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	18	Abstract	Abstract	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	19	Background	Background	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	20	Results	Results	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	21	Conclusions	Conclusions	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	565	22	Background	Background	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	23	Results	Results	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	24	Generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	25	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	565	26	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	27	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	28	transgenic	transgenic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	29	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	30	tropicalis	tropicali	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	565	31	expressing	express	VBG
work_lg7uwni46nhjxg5pc3yrqf32wy	565	32	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	33	transposase	transposase	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	34	Generation	Generation	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	35	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	36	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	565	37	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	565	38	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	565	39	‘	'	``
work_lg7uwni46nhjxg5pc3yrqf32wy	565	40	hopper	hopper	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	41	’	'	''
work_lg7uwni46nhjxg5pc3yrqf32wy	565	42	frogs	frog	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	565	43	8F	8F	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	44	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	565	45	7	7	CD
work_lg7uwni46nhjxg5pc3yrqf32wy	565	46	M	M	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	47	hoppers	hopper	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	565	48	Discussion	Discussion	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	49	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	50	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	565	51	can	can	MD
work_lg7uwni46nhjxg5pc3yrqf32wy	565	52	be	be	VB
work_lg7uwni46nhjxg5pc3yrqf32wy	565	53	remobilized	remobilize	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	54	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	55	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	56	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	57	Why	why	WRB
work_lg7uwni46nhjxg5pc3yrqf32wy	565	58	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	565	59	different	different	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	565	60	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	61	mechanisms	mechanism	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	565	62	observed	observe	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	63	with	with	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	64	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	565	65	co	co	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	66	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	67	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	565	68	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	565	69	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	565	70	double	double	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	565	71	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	565	72	strategies	strategy	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	565	73	?	?	.
work_lg7uwni46nhjxg5pc3yrqf32wy	566	1	Potential	potential	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	566	2	uses	use	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	566	3	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	4	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	5	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	6	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	7	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	8	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	9	Conclusions	Conclusions	NNPS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	10	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	11	transposons	transposon	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	12	stably	stably	RB
work_lg7uwni46nhjxg5pc3yrqf32wy	566	13	integrated	integrate	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	14	into	into	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	15	the	the	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	566	16	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	17	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	18	genome	genome	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	19	are	be	VBP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	20	substrates	substrate	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	21	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	22	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	23	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	24	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	25	remobilization	remobilization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	26	as	as	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	27	a	a	DT
work_lg7uwni46nhjxg5pc3yrqf32wy	566	28	tool	tool	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	29	for	for	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	30	genetic	genetic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	566	31	manipulation	manipulation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	32	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	33	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	34	tropicalis	tropicalis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	35	Methods	Methods	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	36	Plasmids	Plasmids	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	37	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	566	38	generation	generation	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	39	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	40	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	566	41	lines	line	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	42	Husbandry	Husbandry	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	43	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	566	44	micro	micro	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	45	-	-	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	46	injection	injection	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	47	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	48	X.	X.	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	49	tropicalis	tropicalis	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	50	RT	RT	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	51	-	-	HYPH
work_lg7uwni46nhjxg5pc3yrqf32wy	566	52	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	53	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	54	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	55	SB	SB	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	56	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	57	Western	western	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	566	58	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	59	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	60	of	of	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	61	SB10	SB10	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	62	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	63	in	in	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	64	tissues	tissue	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	65	harvested	harvest	VBN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	66	from	from	IN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	67	transgenic	transgenic	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	566	68	frogs	frog	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	69	Fluorescent	Fluorescent	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	70	protein	protein	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	71	expression	expression	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	72	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	73	Southern	southern	JJ
work_lg7uwni46nhjxg5pc3yrqf32wy	566	74	blot	blot	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	75	hybridization	hybridization	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	76	Genomic	Genomic	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	77	PCR	PCR	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	78	and	and	CC
work_lg7uwni46nhjxg5pc3yrqf32wy	566	79	transposon	transposon	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	80	integration	integration	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	81	site	site	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	82	analysis	analysis	NN
work_lg7uwni46nhjxg5pc3yrqf32wy	566	83	Acknowledgements	Acknowledgements	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	84	Author	Author	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	85	details	detail	VBZ
work_lg7uwni46nhjxg5pc3yrqf32wy	566	86	Authors	author	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	87	'	'	POS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	88	contributions	contribution	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	89	Competing	Competing	NNP
work_lg7uwni46nhjxg5pc3yrqf32wy	566	90	interests	interest	NNS
work_lg7uwni46nhjxg5pc3yrqf32wy	566	91	References	reference	NNS