id	sid	tid	token	lemma	pos
10_1101-2020_11_24_390039	1	1	O'Keefe	O'Keefe	NNP
10_1101-2020_11_24_390039	1	2	et	et	NNP
10_1101-2020_11_24_390039	1	3	al	al	NNP
10_1101-2020_11_24_390039	1	4	.	.	.
10_1101-2020_11_24_390039	2	1	JOCES	JOCES	NNP
10_1101-2020_11_24_390039	2	2	2020	2020	CD
10_1101-2020_11_24_390039	2	3	257758	257758	CD
10_1101-2020_11_24_390039	2	4	resubmission	resubmission	NN
10_1101-2020_11_24_390039	2	5	Ipomoeassin	Ipomoeassin	NNP
10_1101-2020_11_24_390039	2	6	-	-	HYPH
10_1101-2020_11_24_390039	2	7	F	F	NNP
10_1101-2020_11_24_390039	2	8	inhibits	inhibit	VBZ
10_1101-2020_11_24_390039	2	9	the	the	DT
10_1101-2020_11_24_390039	2	10	in	in	FW
10_1101-2020_11_24_390039	2	11	vitro	vitro	FW
10_1101-2020_11_24_390039	2	12	biogenesis	biogenesis	NN
10_1101-2020_11_24_390039	2	13	of	of	IN
10_1101-2020_11_24_390039	2	14	the	the	DT
10_1101-2020_11_24_390039	2	15	SARS-	SARS-	NNP
10_1101-2020_11_24_390039	2	16	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	2	17	spike	spike	JJ
10_1101-2020_11_24_390039	2	18	protein	protein	NN
10_1101-2020_11_24_390039	2	19	and	and	CC
10_1101-2020_11_24_390039	2	20	its	-PRON-	PRP$
10_1101-2020_11_24_390039	2	21	host	host	NN
10_1101-2020_11_24_390039	2	22	cell	cell	NN
10_1101-2020_11_24_390039	2	23	membrane	membrane	NN
10_1101-2020_11_24_390039	2	24	receptor	receptor	NN
10_1101-2020_11_24_390039	2	25	Sarah	Sarah	NNP
10_1101-2020_11_24_390039	2	26	O’Keefe1,4	O’Keefe1,4	NFP
10_1101-2020_11_24_390039	2	27	,	,	,
10_1101-2020_11_24_390039	2	28	Peristera	Peristera	NNP
10_1101-2020_11_24_390039	2	29	Roboti1	Roboti1	NNP
10_1101-2020_11_24_390039	2	30	,	,	,
10_1101-2020_11_24_390039	2	31	Kwabena	Kwabena	NNP
10_1101-2020_11_24_390039	2	32	B.	B.	NNP
10_1101-2020_11_24_390039	2	33	Duah2	Duah2	VBZ
10_1101-2020_11_24_390039	2	34	,	,	,
10_1101-2020_11_24_390039	2	35	Guanghui	Guanghui	NNP
10_1101-2020_11_24_390039	2	36	Zong3	zong3	NN
10_1101-2020_11_24_390039	2	37	,	,	,
10_1101-2020_11_24_390039	2	38	Hayden	Hayden	NNP
10_1101-2020_11_24_390039	2	39	Schneider2	Schneider2	NNP
10_1101-2020_11_24_390039	2	40	,	,	,
10_1101-2020_11_24_390039	2	41	Wei	Wei	NNP
10_1101-2020_11_24_390039	2	42	Q.	Q.	NNP
10_1101-2020_11_24_390039	2	43	Shi2	Shi2	NNP
10_1101-2020_11_24_390039	2	44	and	and	CC
10_1101-2020_11_24_390039	2	45	Stephen	Stephen	NNP
10_1101-2020_11_24_390039	2	46	High1,4	High1,4	NNP
10_1101-2020_11_24_390039	2	47	1School	1school	CD
10_1101-2020_11_24_390039	2	48	of	of	IN
10_1101-2020_11_24_390039	2	49	Biological	Biological	NNP
10_1101-2020_11_24_390039	2	50	Sciences	Sciences	NNPS
10_1101-2020_11_24_390039	2	51	,	,	,
10_1101-2020_11_24_390039	2	52	Faculty	Faculty	NNP
10_1101-2020_11_24_390039	2	53	of	of	IN
10_1101-2020_11_24_390039	2	54	Biology	Biology	NNP
10_1101-2020_11_24_390039	2	55	,	,	,
10_1101-2020_11_24_390039	2	56	Medicine	Medicine	NNP
10_1101-2020_11_24_390039	2	57	and	and	CC
10_1101-2020_11_24_390039	2	58	Health	Health	NNP
10_1101-2020_11_24_390039	2	59	,	,	,
10_1101-2020_11_24_390039	2	60	University	University	NNP
10_1101-2020_11_24_390039	2	61	of	of	IN
10_1101-2020_11_24_390039	2	62	Manchester	Manchester	NNP
10_1101-2020_11_24_390039	2	63	,	,	,
10_1101-2020_11_24_390039	2	64	Manchester	Manchester	NNP
10_1101-2020_11_24_390039	2	65	,	,	,
10_1101-2020_11_24_390039	2	66	M13	M13	NNP
10_1101-2020_11_24_390039	2	67	9PT	9PT	NNP
10_1101-2020_11_24_390039	2	68	,	,	,
10_1101-2020_11_24_390039	2	69	United	United	NNP
10_1101-2020_11_24_390039	2	70	Kingdom	Kingdom	NNP
10_1101-2020_11_24_390039	2	71	2Department	2department	CD
10_1101-2020_11_24_390039	2	72	of	of	IN
10_1101-2020_11_24_390039	2	73	Chemistry	Chemistry	NNP
10_1101-2020_11_24_390039	2	74	,	,	,
10_1101-2020_11_24_390039	2	75	Ball	Ball	NNP
10_1101-2020_11_24_390039	2	76	State	State	NNP
10_1101-2020_11_24_390039	2	77	University	University	NNP
10_1101-2020_11_24_390039	2	78	,	,	,
10_1101-2020_11_24_390039	2	79	Muncie	Muncie	NNP
10_1101-2020_11_24_390039	2	80	,	,	,
10_1101-2020_11_24_390039	2	81	Indiana	Indiana	NNP
10_1101-2020_11_24_390039	2	82	47306	47306	CD
10_1101-2020_11_24_390039	2	83	,	,	,
10_1101-2020_11_24_390039	2	84	USA	USA	NNP
10_1101-2020_11_24_390039	2	85	3Department	3Department	NNP
10_1101-2020_11_24_390039	2	86	of	of	IN
10_1101-2020_11_24_390039	2	87	Chemistry	Chemistry	NNP
10_1101-2020_11_24_390039	2	88	and	and	CC
10_1101-2020_11_24_390039	2	89	Biochemistry	Biochemistry	NNP
10_1101-2020_11_24_390039	2	90	,	,	,
10_1101-2020_11_24_390039	2	91	University	University	NNP
10_1101-2020_11_24_390039	2	92	of	of	IN
10_1101-2020_11_24_390039	2	93	Maryland	Maryland	NNP
10_1101-2020_11_24_390039	2	94	,	,	,
10_1101-2020_11_24_390039	2	95	College	College	NNP
10_1101-2020_11_24_390039	2	96	Park	Park	NNP
10_1101-2020_11_24_390039	2	97	,	,	,
10_1101-2020_11_24_390039	2	98	Maryland	Maryland	NNP
10_1101-2020_11_24_390039	2	99	20742	20742	CD
10_1101-2020_11_24_390039	2	100	,	,	,
10_1101-2020_11_24_390039	2	101	USA	USA	NNP
10_1101-2020_11_24_390039	2	102	4Lead	4lead	CD
10_1101-2020_11_24_390039	2	103	Contacts	Contacts	NNPS
10_1101-2020_11_24_390039	2	104	for	for	IN
10_1101-2020_11_24_390039	2	105	correspondence	correspondence	NN
10_1101-2020_11_24_390039	2	106	:	:	:
10_1101-2020_11_24_390039	2	107	sarah.okeefe@manchester.ac.uk	sarah.okeefe@manchester.ac.uk	NNS
10_1101-2020_11_24_390039	2	108	;	;	:
10_1101-2020_11_24_390039	2	109	stephen.high@manchester.ac.uk	stephen.high@manchester.ac.uk	NNS
10_1101-2020_11_24_390039	2	110	Running	Running	NNP
10_1101-2020_11_24_390039	2	111	Title	Title	NNP
10_1101-2020_11_24_390039	2	112	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	2	113	-	-	HYPH
10_1101-2020_11_24_390039	2	114	F	F	NNP
10_1101-2020_11_24_390039	2	115	as	as	IN
10_1101-2020_11_24_390039	2	116	a	a	DT
10_1101-2020_11_24_390039	2	117	potential	potential	JJ
10_1101-2020_11_24_390039	2	118	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	2	119	agent	agent	NN
10_1101-2020_11_24_390039	2	120	Keywords	Keywords	NNPS
10_1101-2020_11_24_390039	2	121	Cell	Cell	NNP
10_1101-2020_11_24_390039	2	122	-	-	HYPH
10_1101-2020_11_24_390039	2	123	free	free	JJ
10_1101-2020_11_24_390039	2	124	translation	translation	NN
10_1101-2020_11_24_390039	2	125	,	,	,
10_1101-2020_11_24_390039	2	126	Endoplasmic	endoplasmic	JJ
10_1101-2020_11_24_390039	2	127	reticulum	reticulum	NN
10_1101-2020_11_24_390039	2	128	(	(	-LRB-
10_1101-2020_11_24_390039	2	129	ER	ER	NNP
10_1101-2020_11_24_390039	2	130	)	)	-RRB-
10_1101-2020_11_24_390039	2	131	,	,	,
10_1101-2020_11_24_390039	2	132	ER	ER	NNP
10_1101-2020_11_24_390039	2	133	membrane	membrane	NN
10_1101-2020_11_24_390039	2	134	complex	complex	NN
10_1101-2020_11_24_390039	2	135	(	(	-LRB-
10_1101-2020_11_24_390039	2	136	EMC	EMC	NNP
10_1101-2020_11_24_390039	2	137	)	)	-RRB-
10_1101-2020_11_24_390039	2	138	,	,	,
10_1101-2020_11_24_390039	2	139	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	2	140	translocon	translocon	NN
10_1101-2020_11_24_390039	2	141	,	,	,
10_1101-2020_11_24_390039	2	142	viral	viral	JJ
10_1101-2020_11_24_390039	2	143	protein	protein	NN
10_1101-2020_11_24_390039	2	144	biogenesis	biogenesis	NN
10_1101-2020_11_24_390039	2	145	.	.	.
10_1101-2020_11_24_390039	3	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	3	2	-	-	:
10_1101-2020_11_24_390039	3	3	BY	by	IN
10_1101-2020_11_24_390039	3	4	-	-	HYPH
10_1101-2020_11_24_390039	3	5	ND	ND	NNP
10_1101-2020_11_24_390039	3	6	4.0	4.0	CD
10_1101-2020_11_24_390039	3	7	International	international	JJ
10_1101-2020_11_24_390039	3	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	3	9	available	available	JJ
10_1101-2020_11_24_390039	3	10	under	under	IN
10_1101-2020_11_24_390039	3	11	a	a	DT
10_1101-2020_11_24_390039	3	12	(	(	-LRB-
10_1101-2020_11_24_390039	3	13	which	which	WDT
10_1101-2020_11_24_390039	3	14	was	be	VBD
10_1101-2020_11_24_390039	3	15	not	not	RB
10_1101-2020_11_24_390039	3	16	certified	certify	VBN
10_1101-2020_11_24_390039	3	17	by	by	IN
10_1101-2020_11_24_390039	3	18	peer	peer	NN
10_1101-2020_11_24_390039	3	19	review	review	NN
10_1101-2020_11_24_390039	3	20	)	)	-RRB-
10_1101-2020_11_24_390039	3	21	is	be	VBZ
10_1101-2020_11_24_390039	3	22	the	the	DT
10_1101-2020_11_24_390039	3	23	author	author	NN
10_1101-2020_11_24_390039	3	24	/	/	SYM
10_1101-2020_11_24_390039	3	25	funder	funder	NN
10_1101-2020_11_24_390039	3	26	,	,	,
10_1101-2020_11_24_390039	3	27	who	who	WP
10_1101-2020_11_24_390039	3	28	has	have	VBZ
10_1101-2020_11_24_390039	3	29	granted	grant	VBN
10_1101-2020_11_24_390039	3	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	3	31	a	a	DT
10_1101-2020_11_24_390039	3	32	license	license	NN
10_1101-2020_11_24_390039	3	33	to	to	TO
10_1101-2020_11_24_390039	3	34	display	display	VB
10_1101-2020_11_24_390039	3	35	the	the	DT
10_1101-2020_11_24_390039	3	36	preprint	preprint	NN
10_1101-2020_11_24_390039	3	37	in	in	IN
10_1101-2020_11_24_390039	3	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	3	39	.	.	.
10_1101-2020_11_24_390039	4	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	4	2	is	be	VBZ
10_1101-2020_11_24_390039	4	3	The	the	DT
10_1101-2020_11_24_390039	4	4	copyright	copyright	NN
10_1101-2020_11_24_390039	4	5	holder	holder	NN
10_1101-2020_11_24_390039	4	6	for	for	IN
10_1101-2020_11_24_390039	4	7	this	this	DT
10_1101-2020_11_24_390039	4	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	4	9	version	version	NN
10_1101-2020_11_24_390039	4	10	posted	post	VBD
10_1101-2020_11_24_390039	4	11	January	January	NNP
10_1101-2020_11_24_390039	4	12	5	5	CD
10_1101-2020_11_24_390039	4	13	,	,	,
10_1101-2020_11_24_390039	4	14	2021	2021	CD
10_1101-2020_11_24_390039	4	15	.	.	.
10_1101-2020_11_24_390039	4	16	;	;	:
10_1101-2020_11_24_390039	4	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	4	18	:	:	:
10_1101-2020_11_24_390039	4	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	4	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	4	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	4	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	4	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	4	24	-	-	HYPH
10_1101-2020_11_24_390039	4	25	F	F	NNP
10_1101-2020_11_24_390039	4	26	as	as	IN
10_1101-2020_11_24_390039	4	27	a	a	DT
10_1101-2020_11_24_390039	4	28	potential	potential	JJ
10_1101-2020_11_24_390039	4	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	4	30	agent	agent	NN
10_1101-2020_11_24_390039	4	31	Page	Page	NNP
10_1101-2020_11_24_390039	4	32	2	2	CD
10_1101-2020_11_24_390039	4	33	of	of	IN
10_1101-2020_11_24_390039	4	34	21	21	CD
10_1101-2020_11_24_390039	4	35	Abstract	Abstract	NNP
10_1101-2020_11_24_390039	4	36	In	in	IN
10_1101-2020_11_24_390039	4	37	order	order	NN
10_1101-2020_11_24_390039	4	38	to	to	TO
10_1101-2020_11_24_390039	4	39	produce	produce	VB
10_1101-2020_11_24_390039	4	40	proteins	protein	NNS
10_1101-2020_11_24_390039	4	41	essential	essential	JJ
10_1101-2020_11_24_390039	4	42	for	for	IN
10_1101-2020_11_24_390039	4	43	their	-PRON-	PRP$
10_1101-2020_11_24_390039	4	44	propagation	propagation	NN
10_1101-2020_11_24_390039	4	45	,	,	,
10_1101-2020_11_24_390039	4	46	many	many	JJ
10_1101-2020_11_24_390039	4	47	pathogenic	pathogenic	JJ
10_1101-2020_11_24_390039	4	48	human	human	JJ
10_1101-2020_11_24_390039	4	49	viruses	virus	NNS
10_1101-2020_11_24_390039	4	50	,	,	,
10_1101-2020_11_24_390039	4	51	including	include	VBG
10_1101-2020_11_24_390039	4	52	SARS	SARS	NNP
10_1101-2020_11_24_390039	4	53	-	-	HYPH
10_1101-2020_11_24_390039	4	54	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	4	55	the	the	DT
10_1101-2020_11_24_390039	4	56	causative	causative	JJ
10_1101-2020_11_24_390039	4	57	agent	agent	NN
10_1101-2020_11_24_390039	4	58	of	of	IN
10_1101-2020_11_24_390039	4	59	COVID-19	covid-19	JJ
10_1101-2020_11_24_390039	4	60	respiratory	respiratory	JJ
10_1101-2020_11_24_390039	4	61	disease	disease	NN
10_1101-2020_11_24_390039	4	62	,	,	,
10_1101-2020_11_24_390039	4	63	commandeer	commandeer	NNP
10_1101-2020_11_24_390039	4	64	host	host	NN
10_1101-2020_11_24_390039	4	65	biosynthetic	biosynthetic	JJ
10_1101-2020_11_24_390039	4	66	machineries	machinery	NNS
10_1101-2020_11_24_390039	4	67	and	and	CC
10_1101-2020_11_24_390039	4	68	mechanisms	mechanism	NNS
10_1101-2020_11_24_390039	4	69	.	.	.
10_1101-2020_11_24_390039	5	1	Three	three	CD
10_1101-2020_11_24_390039	5	2	major	major	JJ
10_1101-2020_11_24_390039	5	3	structural	structural	JJ
10_1101-2020_11_24_390039	5	4	proteins	protein	NNS
10_1101-2020_11_24_390039	5	5	,	,	,
10_1101-2020_11_24_390039	5	6	the	the	DT
10_1101-2020_11_24_390039	5	7	spike	spike	NN
10_1101-2020_11_24_390039	5	8	,	,	,
10_1101-2020_11_24_390039	5	9	envelope	envelope	NN
10_1101-2020_11_24_390039	5	10	and	and	CC
10_1101-2020_11_24_390039	5	11	membrane	membrane	NN
10_1101-2020_11_24_390039	5	12	proteins	protein	NNS
10_1101-2020_11_24_390039	5	13	,	,	,
10_1101-2020_11_24_390039	5	14	are	be	VBP
10_1101-2020_11_24_390039	5	15	amongst	amongst	IN
10_1101-2020_11_24_390039	5	16	several	several	JJ
10_1101-2020_11_24_390039	5	17	SARS	SARS	NNP
10_1101-2020_11_24_390039	5	18	-	-	HYPH
10_1101-2020_11_24_390039	5	19	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	5	20	components	component	NNS
10_1101-2020_11_24_390039	5	21	synthesised	synthesise	VBD
10_1101-2020_11_24_390039	5	22	at	at	IN
10_1101-2020_11_24_390039	5	23	the	the	DT
10_1101-2020_11_24_390039	5	24	endoplasmic	endoplasmic	JJ
10_1101-2020_11_24_390039	5	25	reticulum	reticulum	NN
10_1101-2020_11_24_390039	5	26	(	(	-LRB-
10_1101-2020_11_24_390039	5	27	ER	ER	NNP
10_1101-2020_11_24_390039	5	28	)	)	-RRB-
10_1101-2020_11_24_390039	5	29	of	of	IN
10_1101-2020_11_24_390039	5	30	infected	infect	VBN
10_1101-2020_11_24_390039	5	31	human	human	JJ
10_1101-2020_11_24_390039	5	32	cells	cell	NNS
10_1101-2020_11_24_390039	5	33	prior	prior	RB
10_1101-2020_11_24_390039	5	34	to	to	IN
10_1101-2020_11_24_390039	5	35	the	the	DT
10_1101-2020_11_24_390039	5	36	assembly	assembly	NN
10_1101-2020_11_24_390039	5	37	of	of	IN
10_1101-2020_11_24_390039	5	38	new	new	JJ
10_1101-2020_11_24_390039	5	39	viral	viral	JJ
10_1101-2020_11_24_390039	5	40	particles	particle	NNS
10_1101-2020_11_24_390039	5	41	.	.	.
10_1101-2020_11_24_390039	6	1	Hence	hence	RB
10_1101-2020_11_24_390039	6	2	,	,	,
10_1101-2020_11_24_390039	6	3	the	the	DT
10_1101-2020_11_24_390039	6	4	inhibition	inhibition	NN
10_1101-2020_11_24_390039	6	5	of	of	IN
10_1101-2020_11_24_390039	6	6	membrane	membrane	NN
10_1101-2020_11_24_390039	6	7	protein	protein	NN
10_1101-2020_11_24_390039	6	8	synthesis	synthesis	NN
10_1101-2020_11_24_390039	6	9	at	at	IN
10_1101-2020_11_24_390039	6	10	the	the	DT
10_1101-2020_11_24_390039	6	11	ER	ER	NNP
10_1101-2020_11_24_390039	6	12	is	be	VBZ
10_1101-2020_11_24_390039	6	13	an	an	DT
10_1101-2020_11_24_390039	6	14	attractive	attractive	JJ
10_1101-2020_11_24_390039	6	15	strategy	strategy	NN
10_1101-2020_11_24_390039	6	16	for	for	IN
10_1101-2020_11_24_390039	6	17	reducing	reduce	VBG
10_1101-2020_11_24_390039	6	18	the	the	DT
10_1101-2020_11_24_390039	6	19	pathogenicity	pathogenicity	NN
10_1101-2020_11_24_390039	6	20	of	of	IN
10_1101-2020_11_24_390039	6	21	SARS	SARS	NNP
10_1101-2020_11_24_390039	6	22	-	-	HYPH
10_1101-2020_11_24_390039	6	23	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	6	24	and	and	CC
10_1101-2020_11_24_390039	6	25	other	other	JJ
10_1101-2020_11_24_390039	6	26	obligate	obligate	NN
10_1101-2020_11_24_390039	6	27	viral	viral	JJ
10_1101-2020_11_24_390039	6	28	pathogens	pathogen	NNS
10_1101-2020_11_24_390039	6	29	.	.	.
10_1101-2020_11_24_390039	7	1	Using	use	VBG
10_1101-2020_11_24_390039	7	2	an	an	DT
10_1101-2020_11_24_390039	7	3	in	in	FW
10_1101-2020_11_24_390039	7	4	vitro	vitro	FW
10_1101-2020_11_24_390039	7	5	system	system	NN
10_1101-2020_11_24_390039	7	6	,	,	,
10_1101-2020_11_24_390039	7	7	we	-PRON-	PRP
10_1101-2020_11_24_390039	7	8	demonstrate	demonstrate	VBP
10_1101-2020_11_24_390039	7	9	that	that	IN
10_1101-2020_11_24_390039	7	10	the	the	DT
10_1101-2020_11_24_390039	7	11	small	small	JJ
10_1101-2020_11_24_390039	7	12	molecule	molecule	NN
10_1101-2020_11_24_390039	7	13	inhibitor	inhibitor	NN
10_1101-2020_11_24_390039	7	14	ipomoeassin	ipomoeassin	NNP
10_1101-2020_11_24_390039	7	15	F	F	NNP
10_1101-2020_11_24_390039	7	16	(	(	-LRB-
10_1101-2020_11_24_390039	7	17	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	7	18	-	-	HYPH
10_1101-2020_11_24_390039	7	19	F	F	NNP
10_1101-2020_11_24_390039	7	20	)	)	-RRB-
10_1101-2020_11_24_390039	7	21	potently	potently	RB
10_1101-2020_11_24_390039	7	22	blocks	block	VBZ
10_1101-2020_11_24_390039	7	23	the	the	DT
10_1101-2020_11_24_390039	7	24	Sec61-mediated	sec61-mediated	JJ
10_1101-2020_11_24_390039	7	25	ER	ER	NNP
10_1101-2020_11_24_390039	7	26	membrane	membrane	NN
10_1101-2020_11_24_390039	7	27	translocation	translocation	NN
10_1101-2020_11_24_390039	7	28	/	/	SYM
10_1101-2020_11_24_390039	7	29	insertion	insertion	NN
10_1101-2020_11_24_390039	7	30	of	of	IN
10_1101-2020_11_24_390039	7	31	three	three	CD
10_1101-2020_11_24_390039	7	32	therapeutic	therapeutic	JJ
10_1101-2020_11_24_390039	7	33	protein	protein	NN
10_1101-2020_11_24_390039	7	34	targets	target	NNS
10_1101-2020_11_24_390039	7	35	for	for	IN
10_1101-2020_11_24_390039	7	36	SARS	SARS	NNP
10_1101-2020_11_24_390039	7	37	-	-	HYPH
10_1101-2020_11_24_390039	7	38	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	7	39	infection	infection	NN
10_1101-2020_11_24_390039	7	40	;	;	:
10_1101-2020_11_24_390039	7	41	the	the	DT
10_1101-2020_11_24_390039	7	42	viral	viral	JJ
10_1101-2020_11_24_390039	7	43	spike	spike	NN
10_1101-2020_11_24_390039	7	44	and	and	CC
10_1101-2020_11_24_390039	7	45	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	7	46	proteins	protein	VBZ
10_1101-2020_11_24_390039	7	47	together	together	RB
10_1101-2020_11_24_390039	7	48	with	with	IN
10_1101-2020_11_24_390039	7	49	angiotensin	angiotensin	NN
10_1101-2020_11_24_390039	7	50	-	-	HYPH
10_1101-2020_11_24_390039	7	51	converting	convert	VBG
10_1101-2020_11_24_390039	7	52	enzyme	enzyme	NNS
10_1101-2020_11_24_390039	7	53	2	2	CD
10_1101-2020_11_24_390039	7	54	,	,	,
10_1101-2020_11_24_390039	7	55	the	the	DT
10_1101-2020_11_24_390039	7	56	host	host	NN
10_1101-2020_11_24_390039	7	57	cell	cell	NN
10_1101-2020_11_24_390039	7	58	plasma	plasma	NNP
10_1101-2020_11_24_390039	7	59	membrane	membrane	NN
10_1101-2020_11_24_390039	7	60	receptor	receptor	NN
10_1101-2020_11_24_390039	7	61	.	.	.
10_1101-2020_11_24_390039	8	1	Our	-PRON-	PRP$
10_1101-2020_11_24_390039	8	2	findings	finding	NNS
10_1101-2020_11_24_390039	8	3	highlight	highlight	VBP
10_1101-2020_11_24_390039	8	4	the	the	DT
10_1101-2020_11_24_390039	8	5	potential	potential	NN
10_1101-2020_11_24_390039	8	6	for	for	IN
10_1101-2020_11_24_390039	8	7	using	use	VBG
10_1101-2020_11_24_390039	8	8	ER	ER	NNP
10_1101-2020_11_24_390039	8	9	protein	protein	NN
10_1101-2020_11_24_390039	8	10	translocation	translocation	NN
10_1101-2020_11_24_390039	8	11	inhibitors	inhibitor	NNS
10_1101-2020_11_24_390039	8	12	such	such	JJ
10_1101-2020_11_24_390039	8	13	as	as	IN
10_1101-2020_11_24_390039	8	14	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	8	15	-	-	HYPH
10_1101-2020_11_24_390039	8	16	F	F	NNP
10_1101-2020_11_24_390039	8	17	as	as	IN
10_1101-2020_11_24_390039	8	18	host	host	NN
10_1101-2020_11_24_390039	8	19	-	-	HYPH
10_1101-2020_11_24_390039	8	20	targeting	targeting	JJ
10_1101-2020_11_24_390039	8	21	,	,	,
10_1101-2020_11_24_390039	8	22	broad	broad	JJ
10_1101-2020_11_24_390039	8	23	-	-	HYPH
10_1101-2020_11_24_390039	8	24	spectrum	spectrum	NN
10_1101-2020_11_24_390039	8	25	,	,	,
10_1101-2020_11_24_390039	8	26	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	8	27	agents	agent	NNS
10_1101-2020_11_24_390039	8	28	.	.	.
10_1101-2020_11_24_390039	9	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	9	2	-	-	:
10_1101-2020_11_24_390039	9	3	BY	by	IN
10_1101-2020_11_24_390039	9	4	-	-	HYPH
10_1101-2020_11_24_390039	9	5	ND	ND	NNP
10_1101-2020_11_24_390039	9	6	4.0	4.0	CD
10_1101-2020_11_24_390039	9	7	International	international	JJ
10_1101-2020_11_24_390039	9	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	9	9	available	available	JJ
10_1101-2020_11_24_390039	9	10	under	under	IN
10_1101-2020_11_24_390039	9	11	a	a	DT
10_1101-2020_11_24_390039	9	12	(	(	-LRB-
10_1101-2020_11_24_390039	9	13	which	which	WDT
10_1101-2020_11_24_390039	9	14	was	be	VBD
10_1101-2020_11_24_390039	9	15	not	not	RB
10_1101-2020_11_24_390039	9	16	certified	certify	VBN
10_1101-2020_11_24_390039	9	17	by	by	IN
10_1101-2020_11_24_390039	9	18	peer	peer	NN
10_1101-2020_11_24_390039	9	19	review	review	NN
10_1101-2020_11_24_390039	9	20	)	)	-RRB-
10_1101-2020_11_24_390039	9	21	is	be	VBZ
10_1101-2020_11_24_390039	9	22	the	the	DT
10_1101-2020_11_24_390039	9	23	author	author	NN
10_1101-2020_11_24_390039	9	24	/	/	SYM
10_1101-2020_11_24_390039	9	25	funder	funder	NN
10_1101-2020_11_24_390039	9	26	,	,	,
10_1101-2020_11_24_390039	9	27	who	who	WP
10_1101-2020_11_24_390039	9	28	has	have	VBZ
10_1101-2020_11_24_390039	9	29	granted	grant	VBN
10_1101-2020_11_24_390039	9	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	9	31	a	a	DT
10_1101-2020_11_24_390039	9	32	license	license	NN
10_1101-2020_11_24_390039	9	33	to	to	TO
10_1101-2020_11_24_390039	9	34	display	display	VB
10_1101-2020_11_24_390039	9	35	the	the	DT
10_1101-2020_11_24_390039	9	36	preprint	preprint	NN
10_1101-2020_11_24_390039	9	37	in	in	IN
10_1101-2020_11_24_390039	9	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	9	39	.	.	.
10_1101-2020_11_24_390039	10	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	10	2	is	be	VBZ
10_1101-2020_11_24_390039	10	3	The	the	DT
10_1101-2020_11_24_390039	10	4	copyright	copyright	NN
10_1101-2020_11_24_390039	10	5	holder	holder	NN
10_1101-2020_11_24_390039	10	6	for	for	IN
10_1101-2020_11_24_390039	10	7	this	this	DT
10_1101-2020_11_24_390039	10	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	10	9	version	version	NN
10_1101-2020_11_24_390039	10	10	posted	post	VBD
10_1101-2020_11_24_390039	10	11	January	January	NNP
10_1101-2020_11_24_390039	10	12	5	5	CD
10_1101-2020_11_24_390039	10	13	,	,	,
10_1101-2020_11_24_390039	10	14	2021	2021	CD
10_1101-2020_11_24_390039	10	15	.	.	.
10_1101-2020_11_24_390039	10	16	;	;	:
10_1101-2020_11_24_390039	10	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	10	18	:	:	:
10_1101-2020_11_24_390039	10	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	10	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	10	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	10	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	10	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	10	24	-	-	HYPH
10_1101-2020_11_24_390039	10	25	F	F	NNP
10_1101-2020_11_24_390039	10	26	as	as	IN
10_1101-2020_11_24_390039	10	27	a	a	DT
10_1101-2020_11_24_390039	10	28	potential	potential	JJ
10_1101-2020_11_24_390039	10	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	10	30	agent	agent	NN
10_1101-2020_11_24_390039	10	31	Page	Page	NNP
10_1101-2020_11_24_390039	10	32	3	3	CD
10_1101-2020_11_24_390039	10	33	of	of	IN
10_1101-2020_11_24_390039	10	34	21	21	CD
10_1101-2020_11_24_390039	10	35	Introduction	introduction	NN
10_1101-2020_11_24_390039	10	36	Many	many	JJ
10_1101-2020_11_24_390039	10	37	viruses	virus	NNS
10_1101-2020_11_24_390039	10	38	,	,	,
10_1101-2020_11_24_390039	10	39	including	include	VBG
10_1101-2020_11_24_390039	10	40	SARS	SARS	NNP
10_1101-2020_11_24_390039	10	41	-	-	HYPH
10_1101-2020_11_24_390039	10	42	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	10	43	(	(	-LRB-
10_1101-2020_11_24_390039	10	44	Zhou	Zhou	NNP
10_1101-2020_11_24_390039	10	45	et	et	FW
10_1101-2020_11_24_390039	10	46	al	al	NNP
10_1101-2020_11_24_390039	10	47	.	.	NNP
10_1101-2020_11_24_390039	10	48	,	,	,
10_1101-2020_11_24_390039	10	49	2020	2020	CD
10_1101-2020_11_24_390039	10	50	;	;	:
10_1101-2020_11_24_390039	10	51	Zhu	Zhu	NNP
10_1101-2020_11_24_390039	10	52	et	et	FW
10_1101-2020_11_24_390039	10	53	al	al	NNP
10_1101-2020_11_24_390039	10	54	.	.	NNP
10_1101-2020_11_24_390039	10	55	,	,	,
10_1101-2020_11_24_390039	10	56	2020	2020	CD
10_1101-2020_11_24_390039	10	57	)	)	-RRB-
10_1101-2020_11_24_390039	10	58	(	(	-LRB-
10_1101-2020_11_24_390039	10	59	Fig	fig	NN
10_1101-2020_11_24_390039	10	60	.	.	.
10_1101-2020_11_24_390039	11	1	1A	1a	LS
10_1101-2020_11_24_390039	11	2	)	)	-RRB-
10_1101-2020_11_24_390039	11	3	,	,	,
10_1101-2020_11_24_390039	11	4	hijack	hijack	VB
10_1101-2020_11_24_390039	11	5	the	the	DT
10_1101-2020_11_24_390039	11	6	host	host	NN
10_1101-2020_11_24_390039	11	7	cell	cell	NN
10_1101-2020_11_24_390039	11	8	secretory	secretory	NN
10_1101-2020_11_24_390039	11	9	pathway	pathway	NN
10_1101-2020_11_24_390039	11	10	to	to	TO
10_1101-2020_11_24_390039	11	11	correctly	correctly	RB
10_1101-2020_11_24_390039	11	12	synthesise	synthesise	VB
10_1101-2020_11_24_390039	11	13	,	,	,
10_1101-2020_11_24_390039	11	14	fold	fold	VB
10_1101-2020_11_24_390039	11	15	and	and	CC
10_1101-2020_11_24_390039	11	16	assemble	assemble	VB
10_1101-2020_11_24_390039	11	17	important	important	JJ
10_1101-2020_11_24_390039	11	18	viral	viral	JJ
10_1101-2020_11_24_390039	11	19	proteins	protein	NNS
10_1101-2020_11_24_390039	11	20	(	(	-LRB-
10_1101-2020_11_24_390039	11	21	Bojkova	Bojkova	NNP
10_1101-2020_11_24_390039	11	22	et	et	NNP
10_1101-2020_11_24_390039	11	23	al	al	NNP
10_1101-2020_11_24_390039	11	24	.	.	NNP
10_1101-2020_11_24_390039	11	25	,	,	,
10_1101-2020_11_24_390039	11	26	2020	2020	CD
10_1101-2020_11_24_390039	11	27	;	;	:
10_1101-2020_11_24_390039	11	28	Gordon	Gordon	NNP
10_1101-2020_11_24_390039	11	29	et	et	FW
10_1101-2020_11_24_390039	11	30	al	al	NNP
10_1101-2020_11_24_390039	11	31	.	.	NNP
10_1101-2020_11_24_390039	11	32	,	,	,
10_1101-2020_11_24_390039	11	33	2020	2020	CD
10_1101-2020_11_24_390039	11	34	;	;	:
10_1101-2020_11_24_390039	11	35	Sicari	Sicari	NNP
10_1101-2020_11_24_390039	11	36	et	et	FW
10_1101-2020_11_24_390039	11	37	al	al	NNP
10_1101-2020_11_24_390039	11	38	.	.	NNP
10_1101-2020_11_24_390039	11	39	,	,	,
10_1101-2020_11_24_390039	11	40	2020	2020	CD
10_1101-2020_11_24_390039	11	41	)	)	-RRB-
10_1101-2020_11_24_390039	11	42	.	.	.
10_1101-2020_11_24_390039	12	1	Hence	hence	RB
10_1101-2020_11_24_390039	12	2	,	,	,
10_1101-2020_11_24_390039	12	3	small	small	JJ
10_1101-2020_11_24_390039	12	4	molecule	molecule	NN
10_1101-2020_11_24_390039	12	5	inhibitors	inhibitor	NNS
10_1101-2020_11_24_390039	12	6	of	of	IN
10_1101-2020_11_24_390039	12	7	Sec61-mediated	sec61-mediate	VBN
10_1101-2020_11_24_390039	12	8	co	co	JJ
10_1101-2020_11_24_390039	12	9	-	-	JJ
10_1101-2020_11_24_390039	12	10	translational	translational	JJ
10_1101-2020_11_24_390039	12	11	protein	protein	NN
10_1101-2020_11_24_390039	12	12	entry	entry	NN
10_1101-2020_11_24_390039	12	13	into	into	IN
10_1101-2020_11_24_390039	12	14	the	the	DT
10_1101-2020_11_24_390039	12	15	endoplasmic	endoplasmic	JJ
10_1101-2020_11_24_390039	12	16	reticulum	reticulum	NN
10_1101-2020_11_24_390039	12	17	(	(	-LRB-
10_1101-2020_11_24_390039	12	18	ER	ER	NNP
10_1101-2020_11_24_390039	12	19	)	)	-RRB-
10_1101-2020_11_24_390039	12	20	(	(	-LRB-
10_1101-2020_11_24_390039	12	21	Luesch	Luesch	NNP
10_1101-2020_11_24_390039	12	22	and	and	CC
10_1101-2020_11_24_390039	12	23	Paavilainen	Paavilainen	NNP
10_1101-2020_11_24_390039	12	24	,	,	,
10_1101-2020_11_24_390039	12	25	2020	2020	CD
10_1101-2020_11_24_390039	12	26	)	)	-RRB-
10_1101-2020_11_24_390039	12	27	have	have	VBP
10_1101-2020_11_24_390039	12	28	potential	potential	JJ
10_1101-2020_11_24_390039	12	29	as	as	IN
10_1101-2020_11_24_390039	12	30	broad	broad	JJ
10_1101-2020_11_24_390039	12	31	-	-	HYPH
10_1101-2020_11_24_390039	12	32	spectrum	spectrum	NN
10_1101-2020_11_24_390039	12	33	antivirals	antiviral	NNS
10_1101-2020_11_24_390039	12	34	(	(	-LRB-
10_1101-2020_11_24_390039	12	35	Heaton	Heaton	NNP
10_1101-2020_11_24_390039	12	36	et	et	FW
10_1101-2020_11_24_390039	12	37	al	al	NNP
10_1101-2020_11_24_390039	12	38	.	.	NNP
10_1101-2020_11_24_390039	12	39	,	,	,
10_1101-2020_11_24_390039	12	40	2016	2016	CD
10_1101-2020_11_24_390039	12	41	;	;	:
10_1101-2020_11_24_390039	12	42	Shah	Shah	NNP
10_1101-2020_11_24_390039	12	43	et	et	NNP
10_1101-2020_11_24_390039	12	44	al	al	NNP
10_1101-2020_11_24_390039	12	45	.	.	NNP
10_1101-2020_11_24_390039	12	46	,	,	,
10_1101-2020_11_24_390039	12	47	2018	2018	CD
10_1101-2020_11_24_390039	12	48	)	)	-RRB-
10_1101-2020_11_24_390039	12	49	.	.	.
10_1101-2020_11_24_390039	13	1	Such	such	JJ
10_1101-2020_11_24_390039	13	2	inhibitors	inhibitor	NNS
10_1101-2020_11_24_390039	13	3	offer	offer	VBP
10_1101-2020_11_24_390039	13	4	a	a	DT
10_1101-2020_11_24_390039	13	5	dual	dual	JJ
10_1101-2020_11_24_390039	13	6	approach	approach	NN
10_1101-2020_11_24_390039	13	7	;	;	:
10_1101-2020_11_24_390039	13	8	first	first	RB
10_1101-2020_11_24_390039	13	9	,	,	,
10_1101-2020_11_24_390039	13	10	by	by	IN
10_1101-2020_11_24_390039	13	11	directly	directly	RB
10_1101-2020_11_24_390039	13	12	inhibiting	inhibit	VBG
10_1101-2020_11_24_390039	13	13	production	production	NN
10_1101-2020_11_24_390039	13	14	of	of	IN
10_1101-2020_11_24_390039	13	15	key	key	JJ
10_1101-2020_11_24_390039	13	16	viral	viral	JJ
10_1101-2020_11_24_390039	13	17	proteins	protein	NNS
10_1101-2020_11_24_390039	13	18	and	and	CC
10_1101-2020_11_24_390039	13	19	,	,	,
10_1101-2020_11_24_390039	13	20	second	second	RB
10_1101-2020_11_24_390039	13	21	,	,	,
10_1101-2020_11_24_390039	13	22	by	by	IN
10_1101-2020_11_24_390039	13	23	reducing	reduce	VBG
10_1101-2020_11_24_390039	13	24	levels	level	NNS
10_1101-2020_11_24_390039	13	25	of	of	IN
10_1101-2020_11_24_390039	13	26	host	host	NN
10_1101-2020_11_24_390039	13	27	proteins	protein	NNS
10_1101-2020_11_24_390039	13	28	co	co	VBD
10_1101-2020_11_24_390039	13	29	-	-	JJ
10_1101-2020_11_24_390039	13	30	opted	opted	JJ
10_1101-2020_11_24_390039	13	31	during	during	IN
10_1101-2020_11_24_390039	13	32	viral	viral	JJ
10_1101-2020_11_24_390039	13	33	infection	infection	NN
10_1101-2020_11_24_390039	13	34	.	.	.
10_1101-2020_11_24_390039	14	1	Hence	hence	RB
10_1101-2020_11_24_390039	14	2	,	,	,
10_1101-2020_11_24_390039	14	3	human	human	JJ
10_1101-2020_11_24_390039	14	4	angiotensin	angiotensin	NN
10_1101-2020_11_24_390039	14	5	-	-	HYPH
10_1101-2020_11_24_390039	14	6	converting	convert	VBG
10_1101-2020_11_24_390039	14	7	enzyme	enzyme	NNS
10_1101-2020_11_24_390039	14	8	2	2	CD
10_1101-2020_11_24_390039	14	9	(	(	-LRB-
10_1101-2020_11_24_390039	14	10	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	14	11	)	)	-RRB-
10_1101-2020_11_24_390039	14	12	is	be	VBZ
10_1101-2020_11_24_390039	14	13	an	an	DT
10_1101-2020_11_24_390039	14	14	important	important	JJ
10_1101-2020_11_24_390039	14	15	host	host	NN
10_1101-2020_11_24_390039	14	16	cell	cell	NN
10_1101-2020_11_24_390039	14	17	receptor	receptor	NN
10_1101-2020_11_24_390039	14	18	for	for	IN
10_1101-2020_11_24_390039	14	19	SARS	SARS	NNP
10_1101-2020_11_24_390039	14	20	-	-	HYPH
10_1101-2020_11_24_390039	14	21	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	14	22	viral	viral	JJ
10_1101-2020_11_24_390039	14	23	entry	entry	NN
10_1101-2020_11_24_390039	14	24	(	(	-LRB-
10_1101-2020_11_24_390039	14	25	Cantuti	Cantuti	NNP
10_1101-2020_11_24_390039	14	26	-	-	HYPH
10_1101-2020_11_24_390039	14	27	Castelvetri	Castelvetri	NNP
10_1101-2020_11_24_390039	14	28	et	et	FW
10_1101-2020_11_24_390039	14	29	al	al	NNP
10_1101-2020_11_24_390039	14	30	.	.	NNP
10_1101-2020_11_24_390039	14	31	,	,	,
10_1101-2020_11_24_390039	14	32	2020	2020	CD
10_1101-2020_11_24_390039	14	33	;	;	:
10_1101-2020_11_24_390039	14	34	Daly	Daly	NNP
10_1101-2020_11_24_390039	14	35	et	et	NNP
10_1101-2020_11_24_390039	14	36	al	al	NNP
10_1101-2020_11_24_390039	14	37	.	.	NNP
10_1101-2020_11_24_390039	14	38	,	,	,
10_1101-2020_11_24_390039	14	39	2020	2020	CD
10_1101-2020_11_24_390039	14	40	;	;	:
10_1101-2020_11_24_390039	14	41	Walls	Walls	NNP
10_1101-2020_11_24_390039	14	42	et	et	FW
10_1101-2020_11_24_390039	14	43	al	al	NNP
10_1101-2020_11_24_390039	14	44	,	,	,
10_1101-2020_11_24_390039	14	45	2020	2020	CD
10_1101-2020_11_24_390039	14	46	)	)	-RRB-
10_1101-2020_11_24_390039	14	47	synthesised	synthesise	VBD
10_1101-2020_11_24_390039	14	48	at	at	IN
10_1101-2020_11_24_390039	14	49	the	the	DT
10_1101-2020_11_24_390039	14	50	ER	ER	NNP
10_1101-2020_11_24_390039	14	51	prior	prior	RB
10_1101-2020_11_24_390039	14	52	to	to	IN
10_1101-2020_11_24_390039	14	53	its	-PRON-	PRP$
10_1101-2020_11_24_390039	14	54	trafficking	trafficking	NN
10_1101-2020_11_24_390039	14	55	to	to	IN
10_1101-2020_11_24_390039	14	56	the	the	DT
10_1101-2020_11_24_390039	14	57	plasma	plasma	NN
10_1101-2020_11_24_390039	14	58	membrane	membrane	NN
10_1101-2020_11_24_390039	14	59	(	(	-LRB-
10_1101-2020_11_24_390039	14	60	Warner	Warner	NNP
10_1101-2020_11_24_390039	14	61	et	et	NNP
10_1101-2020_11_24_390039	14	62	al	al	NNP
10_1101-2020_11_24_390039	14	63	.	.	NNP
10_1101-2020_11_24_390039	14	64	,	,	,
10_1101-2020_11_24_390039	14	65	2005	2005	CD
10_1101-2020_11_24_390039	14	66	)	)	-RRB-
10_1101-2020_11_24_390039	14	67	.	.	.
10_1101-2020_11_24_390039	15	1	Our	-PRON-	PRP$
10_1101-2020_11_24_390039	15	2	recent	recent	JJ
10_1101-2020_11_24_390039	15	3	studies	study	NNS
10_1101-2020_11_24_390039	15	4	show	show	VBP
10_1101-2020_11_24_390039	15	5	that	that	IN
10_1101-2020_11_24_390039	15	6	ipomoeassin	ipomoeassin	NNP
10_1101-2020_11_24_390039	15	7	-	-	HYPH
10_1101-2020_11_24_390039	15	8	F	F	NNP
10_1101-2020_11_24_390039	15	9	(	(	-LRB-
10_1101-2020_11_24_390039	15	10	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	15	11	-	-	HYPH
10_1101-2020_11_24_390039	15	12	F	F	NNP
10_1101-2020_11_24_390039	15	13	)	)	-RRB-
10_1101-2020_11_24_390039	15	14	(	(	-LRB-
10_1101-2020_11_24_390039	15	15	Fig	fig	NN
10_1101-2020_11_24_390039	15	16	.	.	.
10_1101-2020_11_24_390039	16	1	1B	1B	NNP
10_1101-2020_11_24_390039	16	2	)	)	-RRB-
10_1101-2020_11_24_390039	16	3	is	be	VBZ
10_1101-2020_11_24_390039	16	4	a	a	DT
10_1101-2020_11_24_390039	16	5	potent	potent	JJ
10_1101-2020_11_24_390039	16	6	and	and	CC
10_1101-2020_11_24_390039	16	7	selective	selective	JJ
10_1101-2020_11_24_390039	16	8	inhibitor	inhibitor	NN
10_1101-2020_11_24_390039	16	9	of	of	IN
10_1101-2020_11_24_390039	16	10	Sec61-mediated	sec61-mediate	VBN
10_1101-2020_11_24_390039	16	11	protein	protein	NN
10_1101-2020_11_24_390039	16	12	translocation	translocation	NN
10_1101-2020_11_24_390039	16	13	at	at	IN
10_1101-2020_11_24_390039	16	14	the	the	DT
10_1101-2020_11_24_390039	16	15	ER	ER	NNP
10_1101-2020_11_24_390039	16	16	membrane	membrane	NN
10_1101-2020_11_24_390039	16	17	(	(	-LRB-
10_1101-2020_11_24_390039	16	18	Zong	Zong	NNP
10_1101-2020_11_24_390039	16	19	et	et	NNP
10_1101-2020_11_24_390039	16	20	al	al	NNP
10_1101-2020_11_24_390039	16	21	.	.	NNP
10_1101-2020_11_24_390039	16	22	,	,	,
10_1101-2020_11_24_390039	16	23	2019	2019	CD
10_1101-2020_11_24_390039	16	24	;	;	:
10_1101-2020_11_24_390039	16	25	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	16	26	et	et	NNP
10_1101-2020_11_24_390039	16	27	al	al	NNP
10_1101-2020_11_24_390039	16	28	.	.	NNP
10_1101-2020_11_24_390039	16	29	,	,	,
10_1101-2020_11_24_390039	16	30	2020	2020	CD
10_1101-2020_11_24_390039	16	31	submitted	submit	VBN
10_1101-2020_11_24_390039	16	32	)	)	-RRB-
10_1101-2020_11_24_390039	16	33	.	.	.
10_1101-2020_11_24_390039	17	1	Given	give	VBN
10_1101-2020_11_24_390039	17	2	that	that	IN
10_1101-2020_11_24_390039	17	3	SARS	SARS	NNP
10_1101-2020_11_24_390039	17	4	-	-	HYPH
10_1101-2020_11_24_390039	17	5	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	17	6	membrane	membrane	NN
10_1101-2020_11_24_390039	17	7	proteins	protein	VBZ
10_1101-2020_11_24_390039	17	8	likely	likely	RB
10_1101-2020_11_24_390039	17	9	co	co	VBD
10_1101-2020_11_24_390039	17	10	-	-	JJ
10_1101-2020_11_24_390039	17	11	opt	opt	JJ
10_1101-2020_11_24_390039	17	12	host	host	NN
10_1101-2020_11_24_390039	17	13	mechanisms	mechanism	NNS
10_1101-2020_11_24_390039	17	14	of	of	IN
10_1101-2020_11_24_390039	17	15	ER	ER	NNP
10_1101-2020_11_24_390039	17	16	entry	entry	NN
10_1101-2020_11_24_390039	17	17	(	(	-LRB-
10_1101-2020_11_24_390039	17	18	cf	cf	NN
10_1101-2020_11_24_390039	17	19	.	.	.
10_1101-2020_11_24_390039	18	1	Gordon	Gordon	NNP
10_1101-2020_11_24_390039	18	2	et	et	FW
10_1101-2020_11_24_390039	18	3	al	al	NNP
10_1101-2020_11_24_390039	18	4	.	.	NNP
10_1101-2020_11_24_390039	18	5	,	,	,
10_1101-2020_11_24_390039	18	6	2020	2020	CD
10_1101-2020_11_24_390039	18	7	;	;	:
10_1101-2020_11_24_390039	18	8	Sicari	Sicari	NNP
10_1101-2020_11_24_390039	18	9	et	et	FW
10_1101-2020_11_24_390039	18	10	al	al	NNP
10_1101-2020_11_24_390039	18	11	.	.	NNP
10_1101-2020_11_24_390039	18	12	,	,	,
10_1101-2020_11_24_390039	18	13	2020	2020	CD
10_1101-2020_11_24_390039	18	14	)	)	-RRB-
10_1101-2020_11_24_390039	18	15	,	,	,
10_1101-2020_11_24_390039	18	16	we	-PRON-	PRP
10_1101-2020_11_24_390039	18	17	concluded	conclude	VBD
10_1101-2020_11_24_390039	18	18	that	that	IN
10_1101-2020_11_24_390039	18	19	their	-PRON-	PRP$
10_1101-2020_11_24_390039	18	20	sensitivity	sensitivity	NN
10_1101-2020_11_24_390039	18	21	to	to	IN
10_1101-2020_11_24_390039	18	22	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	18	23	-	-	HYPH
10_1101-2020_11_24_390039	18	24	F	F	NNP
10_1101-2020_11_24_390039	18	25	would	would	MD
10_1101-2020_11_24_390039	18	26	likely	likely	RB
10_1101-2020_11_24_390039	18	27	be	be	VB
10_1101-2020_11_24_390039	18	28	comparable	comparable	JJ
10_1101-2020_11_24_390039	18	29	to	to	IN
10_1101-2020_11_24_390039	18	30	that	that	DT
10_1101-2020_11_24_390039	18	31	of	of	IN
10_1101-2020_11_24_390039	18	32	endogenous	endogenous	JJ
10_1101-2020_11_24_390039	18	33	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	18	34	clients	client	NNS
10_1101-2020_11_24_390039	18	35	(	(	-LRB-
10_1101-2020_11_24_390039	18	36	Fig	fig	NN
10_1101-2020_11_24_390039	18	37	.	.	.
10_1101-2020_11_24_390039	19	1	1C	1C	NNP
10_1101-2020_11_24_390039	19	2	;	;	:
10_1101-2020_11_24_390039	19	3	see	see	VB
10_1101-2020_11_24_390039	19	4	also	also	RB
10_1101-2020_11_24_390039	19	5	Zong	Zong	NNP
10_1101-2020_11_24_390039	19	6	et	et	NNP
10_1101-2020_11_24_390039	19	7	al	al	NNP
10_1101-2020_11_24_390039	19	8	.	.	NNP
10_1101-2020_11_24_390039	19	9	,	,	,
10_1101-2020_11_24_390039	19	10	2019	2019	CD
10_1101-2020_11_24_390039	19	11	;	;	:
10_1101-2020_11_24_390039	19	12	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	19	13	et	et	NNP
10_1101-2020_11_24_390039	19	14	al	al	NNP
10_1101-2020_11_24_390039	19	15	.	.	NNP
10_1101-2020_11_24_390039	19	16	,	,	,
10_1101-2020_11_24_390039	19	17	2020	2020	CD
10_1101-2020_11_24_390039	19	18	submitted	submit	VBN
10_1101-2020_11_24_390039	19	19	)	)	-RRB-
10_1101-2020_11_24_390039	19	20	.	.	.
10_1101-2020_11_24_390039	20	1	We	-PRON-	PRP
10_1101-2020_11_24_390039	20	2	,	,	,
10_1101-2020_11_24_390039	20	3	therefore	therefore	RB
10_1101-2020_11_24_390039	20	4	,	,	,
10_1101-2020_11_24_390039	20	5	evaluated	evaluate	VBD
10_1101-2020_11_24_390039	20	6	the	the	DT
10_1101-2020_11_24_390039	20	7	effects	effect	NNS
10_1101-2020_11_24_390039	20	8	of	of	IN
10_1101-2020_11_24_390039	20	9	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	20	10	-	-	HYPH
10_1101-2020_11_24_390039	20	11	F	F	NNP
10_1101-2020_11_24_390039	20	12	on	on	IN
10_1101-2020_11_24_390039	20	13	SARS	SARS	NNP
10_1101-2020_11_24_390039	20	14	-	-	HYPH
10_1101-2020_11_24_390039	20	15	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	20	16	proteins	protein	NNS
10_1101-2020_11_24_390039	20	17	containing	contain	VBG
10_1101-2020_11_24_390039	20	18	hydrophobic	hydrophobic	NN
10_1101-2020_11_24_390039	20	19	ER	ER	NNP
10_1101-2020_11_24_390039	20	20	targeting	targeting	NN
10_1101-2020_11_24_390039	20	21	signals	signal	NNS
10_1101-2020_11_24_390039	20	22	(	(	-LRB-
10_1101-2020_11_24_390039	20	23	Fig	fig	NN
10_1101-2020_11_24_390039	20	24	.	.	.
10_1101-2020_11_24_390039	21	1	1D	1D	NNP
10_1101-2020_11_24_390039	21	2	)	)	-RRB-
10_1101-2020_11_24_390039	21	3	.	.	.
10_1101-2020_11_24_390039	22	1	The	the	DT
10_1101-2020_11_24_390039	22	2	in	in	FW
10_1101-2020_11_24_390039	22	3	vitro	vitro	FW
10_1101-2020_11_24_390039	22	4	membrane	membrane	NN
10_1101-2020_11_24_390039	22	5	insertion	insertion	NN
10_1101-2020_11_24_390039	22	6	of	of	IN
10_1101-2020_11_24_390039	22	7	the	the	DT
10_1101-2020_11_24_390039	22	8	viral	viral	JJ
10_1101-2020_11_24_390039	22	9	spike	spike	NN
10_1101-2020_11_24_390039	22	10	(	(	-LRB-
10_1101-2020_11_24_390039	22	11	S	S	NNP
10_1101-2020_11_24_390039	22	12	)	)	-RRB-
10_1101-2020_11_24_390039	22	13	protein	protein	NN
10_1101-2020_11_24_390039	22	14	and	and	CC
10_1101-2020_11_24_390039	22	15	membrane	membrane	NN
10_1101-2020_11_24_390039	22	16	translocation	translocation	NN
10_1101-2020_11_24_390039	22	17	of	of	IN
10_1101-2020_11_24_390039	22	18	the	the	DT
10_1101-2020_11_24_390039	22	19	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	22	20	protein	protein	NN
10_1101-2020_11_24_390039	22	21	are	be	VBP
10_1101-2020_11_24_390039	22	22	both	both	DT
10_1101-2020_11_24_390039	22	23	strongly	strongly	RB
10_1101-2020_11_24_390039	22	24	inhibited	inhibit	VBN
10_1101-2020_11_24_390039	22	25	by	by	IN
10_1101-2020_11_24_390039	22	26	Ipom-	Ipom-	NNP
10_1101-2020_11_24_390039	22	27	F	F	NNP
10_1101-2020_11_24_390039	22	28	,	,	,
10_1101-2020_11_24_390039	22	29	whilst	whilst	IN
10_1101-2020_11_24_390039	22	30	several	several	JJ
10_1101-2020_11_24_390039	22	31	other	other	JJ
10_1101-2020_11_24_390039	22	32	viral	viral	JJ
10_1101-2020_11_24_390039	22	33	membrane	membrane	NN
10_1101-2020_11_24_390039	22	34	proteins	protein	NNS
10_1101-2020_11_24_390039	22	35	are	be	VBP
10_1101-2020_11_24_390039	22	36	unaffected	unaffected	JJ
10_1101-2020_11_24_390039	22	37	(	(	-LRB-
10_1101-2020_11_24_390039	22	38	Fig	fig	NN
10_1101-2020_11_24_390039	22	39	.	.	.
10_1101-2020_11_24_390039	23	1	2	2	LS
10_1101-2020_11_24_390039	23	2	)	)	-RRB-
10_1101-2020_11_24_390039	23	3	.	.	.
10_1101-2020_11_24_390039	24	1	Likewise	likewise	RB
10_1101-2020_11_24_390039	24	2	,	,	,
10_1101-2020_11_24_390039	24	3	the	the	DT
10_1101-2020_11_24_390039	24	4	ER	ER	NNP
10_1101-2020_11_24_390039	24	5	integration	integration	NN
10_1101-2020_11_24_390039	24	6	of	of	IN
10_1101-2020_11_24_390039	24	7	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	24	8	,	,	,
10_1101-2020_11_24_390039	24	9	an	an	DT
10_1101-2020_11_24_390039	24	10	important	important	JJ
10_1101-2020_11_24_390039	24	11	host	host	NN
10_1101-2020_11_24_390039	24	12	receptor	receptor	NN
10_1101-2020_11_24_390039	24	13	for	for	IN
10_1101-2020_11_24_390039	24	14	SARS	SARS	NNP
10_1101-2020_11_24_390039	24	15	-	-	HYPH
10_1101-2020_11_24_390039	24	16	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	24	17	(	(	-LRB-
10_1101-2020_11_24_390039	24	18	Walls	Walls	NNP
10_1101-2020_11_24_390039	24	19	et	et	FW
10_1101-2020_11_24_390039	24	20	al	al	NNP
10_1101-2020_11_24_390039	24	21	.	.	NNP
10_1101-2020_11_24_390039	24	22	,	,	,
10_1101-2020_11_24_390039	24	23	2020	2020	CD
10_1101-2020_11_24_390039	24	24	)	)	-RRB-
10_1101-2020_11_24_390039	24	25	,	,	,
10_1101-2020_11_24_390039	24	26	is	be	VBZ
10_1101-2020_11_24_390039	24	27	highly	highly	RB
10_1101-2020_11_24_390039	24	28	sensitive	sensitive	JJ
10_1101-2020_11_24_390039	24	29	to	to	IN
10_1101-2020_11_24_390039	24	30	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	24	31	-	-	HYPH
10_1101-2020_11_24_390039	24	32	F	F	NNP
10_1101-2020_11_24_390039	24	33	(	(	-LRB-
10_1101-2020_11_24_390039	24	34	Fig	Fig	NNP
10_1101-2020_11_24_390039	24	35	.	.	.
10_1101-2020_11_24_390039	25	1	2	2	LS
10_1101-2020_11_24_390039	25	2	)	)	-RRB-
10_1101-2020_11_24_390039	25	3	.	.	.
10_1101-2020_11_24_390039	26	1	We	-PRON-	PRP
10_1101-2020_11_24_390039	26	2	show	show	VBP
10_1101-2020_11_24_390039	26	3	that	that	IN
10_1101-2020_11_24_390039	26	4	the	the	DT
10_1101-2020_11_24_390039	26	5	principle	principle	JJ
10_1101-2020_11_24_390039	26	6	molecular	molecular	JJ
10_1101-2020_11_24_390039	26	7	basis	basis	NN
10_1101-2020_11_24_390039	26	8	for	for	IN
10_1101-2020_11_24_390039	26	9	the	the	DT
10_1101-2020_11_24_390039	26	10	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	26	11	-	-	HYPH
10_1101-2020_11_24_390039	26	12	F	F	NNP
10_1101-2020_11_24_390039	26	13	sensitivity	sensitivity	NN
10_1101-2020_11_24_390039	26	14	of	of	IN
10_1101-2020_11_24_390039	26	15	SARS-	SARS-	NNP
10_1101-2020_11_24_390039	26	16	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	26	17	proteins	protein	NNS
10_1101-2020_11_24_390039	26	18	is	be	VBZ
10_1101-2020_11_24_390039	26	19	their	-PRON-	PRP$
10_1101-2020_11_24_390039	26	20	dependence	dependence	NN
10_1101-2020_11_24_390039	26	21	on	on	IN
10_1101-2020_11_24_390039	26	22	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	26	23	,	,	,
10_1101-2020_11_24_390039	26	24	as	as	IN
10_1101-2020_11_24_390039	26	25	dictated	dictate	VBN
10_1101-2020_11_24_390039	26	26	by	by	IN
10_1101-2020_11_24_390039	26	27	their	-PRON-	PRP$
10_1101-2020_11_24_390039	26	28	individual	individual	JJ
10_1101-2020_11_24_390039	26	29	structural	structural	JJ
10_1101-2020_11_24_390039	26	30	features	feature	NNS
10_1101-2020_11_24_390039	26	31	and	and	CC
10_1101-2020_11_24_390039	26	32	membrane	membrane	NN
10_1101-2020_11_24_390039	26	33	topologies	topology	NNS
10_1101-2020_11_24_390039	26	34	(	(	-LRB-
10_1101-2020_11_24_390039	26	35	Fig	fig	NN
10_1101-2020_11_24_390039	26	36	.	.	.
10_1101-2020_11_24_390039	27	1	3	3	LS
10_1101-2020_11_24_390039	27	2	)	)	-RRB-
10_1101-2020_11_24_390039	27	3	.	.	.
10_1101-2020_11_24_390039	28	1	Taken	take	VBN
10_1101-2020_11_24_390039	28	2	together	together	RB
10_1101-2020_11_24_390039	28	3	,	,	,
10_1101-2020_11_24_390039	28	4	our	-PRON-	PRP$
10_1101-2020_11_24_390039	28	5	in	in	FW
10_1101-2020_11_24_390039	28	6	vitro	vitro	FW
10_1101-2020_11_24_390039	28	7	study	study	NN
10_1101-2020_11_24_390039	28	8	of	of	IN
10_1101-2020_11_24_390039	28	9	SARS	SARS	NNP
10_1101-2020_11_24_390039	28	10	-	-	HYPH
10_1101-2020_11_24_390039	28	11	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	28	12	protein	protein	NN
10_1101-2020_11_24_390039	28	13	synthesis	synthesis	NN
10_1101-2020_11_24_390039	28	14	at	at	IN
10_1101-2020_11_24_390039	28	15	the	the	DT
10_1101-2020_11_24_390039	28	16	ER	ER	NNP
10_1101-2020_11_24_390039	28	17	highlights	highlight	VBZ
10_1101-2020_11_24_390039	28	18	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	28	19	-	-	HYPH
10_1101-2020_11_24_390039	28	20	F	F	NNP
10_1101-2020_11_24_390039	28	21	as	as	IN
10_1101-2020_11_24_390039	28	22	a	a	DT
10_1101-2020_11_24_390039	28	23	promising	promise	VBG
10_1101-2020_11_24_390039	28	24	candidate	candidate	NN
10_1101-2020_11_24_390039	28	25	for	for	IN
10_1101-2020_11_24_390039	28	26	the	the	DT
10_1101-2020_11_24_390039	28	27	development	development	NN
10_1101-2020_11_24_390039	28	28	of	of	IN
10_1101-2020_11_24_390039	28	29	a	a	DT
10_1101-2020_11_24_390039	28	30	broad	broad	JJ
10_1101-2020_11_24_390039	28	31	-	-	HYPH
10_1101-2020_11_24_390039	28	32	spectrum	spectrum	NN
10_1101-2020_11_24_390039	28	33	,	,	,
10_1101-2020_11_24_390039	28	34	host	host	NN
10_1101-2020_11_24_390039	28	35	-	-	HYPH
10_1101-2020_11_24_390039	28	36	targeting	targeting	JJ
10_1101-2020_11_24_390039	28	37	,	,	,
10_1101-2020_11_24_390039	28	38	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	28	39	agent	agent	NN
10_1101-2020_11_24_390039	28	40	.	.	.
10_1101-2020_11_24_390039	29	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	29	2	-	-	:
10_1101-2020_11_24_390039	29	3	BY	by	IN
10_1101-2020_11_24_390039	29	4	-	-	HYPH
10_1101-2020_11_24_390039	29	5	ND	ND	NNP
10_1101-2020_11_24_390039	29	6	4.0	4.0	CD
10_1101-2020_11_24_390039	29	7	International	international	JJ
10_1101-2020_11_24_390039	29	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	29	9	available	available	JJ
10_1101-2020_11_24_390039	29	10	under	under	IN
10_1101-2020_11_24_390039	29	11	a	a	DT
10_1101-2020_11_24_390039	29	12	(	(	-LRB-
10_1101-2020_11_24_390039	29	13	which	which	WDT
10_1101-2020_11_24_390039	29	14	was	be	VBD
10_1101-2020_11_24_390039	29	15	not	not	RB
10_1101-2020_11_24_390039	29	16	certified	certify	VBN
10_1101-2020_11_24_390039	29	17	by	by	IN
10_1101-2020_11_24_390039	29	18	peer	peer	NN
10_1101-2020_11_24_390039	29	19	review	review	NN
10_1101-2020_11_24_390039	29	20	)	)	-RRB-
10_1101-2020_11_24_390039	29	21	is	be	VBZ
10_1101-2020_11_24_390039	29	22	the	the	DT
10_1101-2020_11_24_390039	29	23	author	author	NN
10_1101-2020_11_24_390039	29	24	/	/	SYM
10_1101-2020_11_24_390039	29	25	funder	funder	NN
10_1101-2020_11_24_390039	29	26	,	,	,
10_1101-2020_11_24_390039	29	27	who	who	WP
10_1101-2020_11_24_390039	29	28	has	have	VBZ
10_1101-2020_11_24_390039	29	29	granted	grant	VBN
10_1101-2020_11_24_390039	29	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	29	31	a	a	DT
10_1101-2020_11_24_390039	29	32	license	license	NN
10_1101-2020_11_24_390039	29	33	to	to	TO
10_1101-2020_11_24_390039	29	34	display	display	VB
10_1101-2020_11_24_390039	29	35	the	the	DT
10_1101-2020_11_24_390039	29	36	preprint	preprint	NN
10_1101-2020_11_24_390039	29	37	in	in	IN
10_1101-2020_11_24_390039	29	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	29	39	.	.	.
10_1101-2020_11_24_390039	30	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	30	2	is	be	VBZ
10_1101-2020_11_24_390039	30	3	The	the	DT
10_1101-2020_11_24_390039	30	4	copyright	copyright	NN
10_1101-2020_11_24_390039	30	5	holder	holder	NN
10_1101-2020_11_24_390039	30	6	for	for	IN
10_1101-2020_11_24_390039	30	7	this	this	DT
10_1101-2020_11_24_390039	30	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	30	9	version	version	NN
10_1101-2020_11_24_390039	30	10	posted	post	VBD
10_1101-2020_11_24_390039	30	11	January	January	NNP
10_1101-2020_11_24_390039	30	12	5	5	CD
10_1101-2020_11_24_390039	30	13	,	,	,
10_1101-2020_11_24_390039	30	14	2021	2021	CD
10_1101-2020_11_24_390039	30	15	.	.	.
10_1101-2020_11_24_390039	30	16	;	;	:
10_1101-2020_11_24_390039	30	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	30	18	:	:	:
10_1101-2020_11_24_390039	30	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	30	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	30	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	30	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	30	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	30	24	-	-	HYPH
10_1101-2020_11_24_390039	30	25	F	F	NNP
10_1101-2020_11_24_390039	30	26	as	as	IN
10_1101-2020_11_24_390039	30	27	a	a	DT
10_1101-2020_11_24_390039	30	28	potential	potential	JJ
10_1101-2020_11_24_390039	30	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	30	30	agent	agent	NN
10_1101-2020_11_24_390039	30	31	Page	Page	NNP
10_1101-2020_11_24_390039	30	32	4	4	CD
10_1101-2020_11_24_390039	30	33	of	of	IN
10_1101-2020_11_24_390039	30	34	21	21	CD
10_1101-2020_11_24_390039	30	35	Results	Results	NNPS
10_1101-2020_11_24_390039	30	36	and	and	CC
10_1101-2020_11_24_390039	30	37	Discussion	Discussion	NNP
10_1101-2020_11_24_390039	30	38	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	30	39	-	-	HYPH
10_1101-2020_11_24_390039	30	40	F	F	NNP
10_1101-2020_11_24_390039	30	41	selectively	selectively	RB
10_1101-2020_11_24_390039	30	42	inhibits	inhibit	VBZ
10_1101-2020_11_24_390039	30	43	ER	ER	NNP
10_1101-2020_11_24_390039	30	44	translocation	translocation	NN
10_1101-2020_11_24_390039	30	45	of	of	IN
10_1101-2020_11_24_390039	30	46	the	the	DT
10_1101-2020_11_24_390039	30	47	viral	viral	JJ
10_1101-2020_11_24_390039	30	48	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	30	49	and	and	CC
10_1101-2020_11_24_390039	30	50	S	S	NNP
10_1101-2020_11_24_390039	30	51	proteins	protein	NNS
10_1101-2020_11_24_390039	30	52	To	to	TO
10_1101-2020_11_24_390039	30	53	explore	explore	VB
10_1101-2020_11_24_390039	30	54	the	the	DT
10_1101-2020_11_24_390039	30	55	ability	ability	NN
10_1101-2020_11_24_390039	30	56	of	of	IN
10_1101-2020_11_24_390039	30	57	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	30	58	-	-	HYPH
10_1101-2020_11_24_390039	30	59	F	F	NNP
10_1101-2020_11_24_390039	30	60	to	to	TO
10_1101-2020_11_24_390039	30	61	inhibit	inhibit	VB
10_1101-2020_11_24_390039	30	62	the	the	DT
10_1101-2020_11_24_390039	30	63	ER	ER	NNP
10_1101-2020_11_24_390039	30	64	translocation	translocation	NN
10_1101-2020_11_24_390039	30	65	of	of	IN
10_1101-2020_11_24_390039	30	66	a	a	DT
10_1101-2020_11_24_390039	30	67	small	small	JJ
10_1101-2020_11_24_390039	30	68	,	,	,
10_1101-2020_11_24_390039	30	69	yet	yet	CC
10_1101-2020_11_24_390039	30	70	structurally	structurally	RB
10_1101-2020_11_24_390039	30	71	diverse	diverse	JJ
10_1101-2020_11_24_390039	30	72	,	,	,
10_1101-2020_11_24_390039	30	73	panel	panel	NN
10_1101-2020_11_24_390039	30	74	of	of	IN
10_1101-2020_11_24_390039	30	75	SARS	SARS	NNP
10_1101-2020_11_24_390039	30	76	-	-	HYPH
10_1101-2020_11_24_390039	30	77	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	30	78	membrane	membrane	NN
10_1101-2020_11_24_390039	30	79	and	and	CC
10_1101-2020_11_24_390039	30	80	secretory	secretory	JJ
10_1101-2020_11_24_390039	30	81	-	-	HYPH
10_1101-2020_11_24_390039	30	82	like	like	JJ
10_1101-2020_11_24_390039	30	83	proteins	protein	NNS
10_1101-2020_11_24_390039	30	84	,	,	,
10_1101-2020_11_24_390039	30	85	we	-PRON-	PRP
10_1101-2020_11_24_390039	30	86	first	first	RB
10_1101-2020_11_24_390039	30	87	used	use	VBD
10_1101-2020_11_24_390039	30	88	a	a	DT
10_1101-2020_11_24_390039	30	89	well	well	RB
10_1101-2020_11_24_390039	30	90	-	-	HYPH
10_1101-2020_11_24_390039	30	91	established	establish	VBN
10_1101-2020_11_24_390039	30	92	in	in	IN
10_1101-2020_11_24_390039	30	93	vitro	vitro	FW
10_1101-2020_11_24_390039	30	94	translation	translation	NN
10_1101-2020_11_24_390039	30	95	system	system	NN
10_1101-2020_11_24_390039	30	96	supplemented	supplement	VBN
10_1101-2020_11_24_390039	30	97	with	with	IN
10_1101-2020_11_24_390039	30	98	canine	canine	NN
10_1101-2020_11_24_390039	30	99	pancreatic	pancreatic	JJ
10_1101-2020_11_24_390039	30	100	microsomes	microsome	NNS
10_1101-2020_11_24_390039	30	101	(	(	-LRB-
10_1101-2020_11_24_390039	30	102	Fig	fig	NN
10_1101-2020_11_24_390039	30	103	.	.	.
10_1101-2020_11_24_390039	31	1	2A	2a	LS
10_1101-2020_11_24_390039	31	2	)	)	-RRB-
10_1101-2020_11_24_390039	31	3	.	.	.
10_1101-2020_11_24_390039	32	1	To	to	TO
10_1101-2020_11_24_390039	32	2	facilitate	facilitate	VB
10_1101-2020_11_24_390039	32	3	the	the	DT
10_1101-2020_11_24_390039	32	4	detection	detection	NN
10_1101-2020_11_24_390039	32	5	of	of	IN
10_1101-2020_11_24_390039	32	6	ER	ER	NNP
10_1101-2020_11_24_390039	32	7	translocation	translocation	NN
10_1101-2020_11_24_390039	32	8	,	,	,
10_1101-2020_11_24_390039	32	9	we	-PRON-	PRP
10_1101-2020_11_24_390039	32	10	modified	modify	VBD
10_1101-2020_11_24_390039	32	11	the	the	DT
10_1101-2020_11_24_390039	32	12	viral	viral	NN
10_1101-2020_11_24_390039	32	13	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	32	14	,	,	,
10_1101-2020_11_24_390039	32	15	S	S	NNP
10_1101-2020_11_24_390039	32	16	,	,	,
10_1101-2020_11_24_390039	32	17	E	E	NNP
10_1101-2020_11_24_390039	32	18	,	,	,
10_1101-2020_11_24_390039	32	19	M	M	NNP
10_1101-2020_11_24_390039	32	20	and	and	CC
10_1101-2020_11_24_390039	32	21	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	32	22	proteins	protein	VBZ
10_1101-2020_11_24_390039	32	23	by	by	IN
10_1101-2020_11_24_390039	32	24	adding	add	VBG
10_1101-2020_11_24_390039	32	25	an	an	DT
10_1101-2020_11_24_390039	32	26	OPG2-tag	OPG2-tag	NNP
10_1101-2020_11_24_390039	32	27	;	;	:
10_1101-2020_11_24_390039	32	28	an	an	DT
10_1101-2020_11_24_390039	32	29	epitope	epitope	NN
10_1101-2020_11_24_390039	32	30	that	that	WDT
10_1101-2020_11_24_390039	32	31	supports	support	VBZ
10_1101-2020_11_24_390039	32	32	efficient	efficient	JJ
10_1101-2020_11_24_390039	32	33	ER	ER	NNP
10_1101-2020_11_24_390039	32	34	lumenal	lumenal	JJ
10_1101-2020_11_24_390039	32	35	N	n	NN
10_1101-2020_11_24_390039	32	36	-	-	HYPH
10_1101-2020_11_24_390039	32	37	glycosylation	glycosylation	NN
10_1101-2020_11_24_390039	32	38	and	and	CC
10_1101-2020_11_24_390039	32	39	enables	enable	VBZ
10_1101-2020_11_24_390039	32	40	product	product	NN
10_1101-2020_11_24_390039	32	41	recovery	recovery	NN
10_1101-2020_11_24_390039	32	42	via	via	IN
10_1101-2020_11_24_390039	32	43	immunoprecipitation	immunoprecipitation	NN
10_1101-2020_11_24_390039	32	44	,	,	,
10_1101-2020_11_24_390039	32	45	without	without	IN
10_1101-2020_11_24_390039	32	46	affecting	affect	VBG
10_1101-2020_11_24_390039	32	47	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	32	48	-	-	HYPH
10_1101-2020_11_24_390039	32	49	F	F	NNP
10_1101-2020_11_24_390039	32	50	sensitivity	sensitivity	NN
10_1101-2020_11_24_390039	32	51	(	(	-LRB-
10_1101-2020_11_24_390039	32	52	Fig	fig	NN
10_1101-2020_11_24_390039	32	53	.	.	.
10_1101-2020_11_24_390039	33	1	S1A	s1a	LS
10_1101-2020_11_24_390039	33	2	)	)	-RRB-
10_1101-2020_11_24_390039	33	3	(	(	-LRB-
10_1101-2020_11_24_390039	33	4	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	33	5	et	et	NNP
10_1101-2020_11_24_390039	33	6	al	al	NNP
10_1101-2020_11_24_390039	33	7	.	.	NNP
10_1101-2020_11_24_390039	33	8	,	,	,
10_1101-2020_11_24_390039	33	9	2020	2020	CD
10_1101-2020_11_24_390039	33	10	submitted	submit	VBN
10_1101-2020_11_24_390039	33	11	)	)	-RRB-
10_1101-2020_11_24_390039	33	12	.	.	.
10_1101-2020_11_24_390039	34	1	For	for	IN
10_1101-2020_11_24_390039	34	2	viral	viral	JJ
10_1101-2020_11_24_390039	34	3	proteins	protein	NNS
10_1101-2020_11_24_390039	34	4	that	that	WDT
10_1101-2020_11_24_390039	34	5	lack	lack	VBP
10_1101-2020_11_24_390039	34	6	endogenous	endogenous	JJ
10_1101-2020_11_24_390039	34	7	sites	site	NNS
10_1101-2020_11_24_390039	34	8	for	for	IN
10_1101-2020_11_24_390039	34	9	N	n	NN
10_1101-2020_11_24_390039	34	10	-	-	HYPH
10_1101-2020_11_24_390039	34	11	glycosylation	glycosylation	NN
10_1101-2020_11_24_390039	34	12	,	,	,
10_1101-2020_11_24_390039	34	13	such	such	JJ
10_1101-2020_11_24_390039	34	14	as	as	IN
10_1101-2020_11_24_390039	34	15	the	the	DT
10_1101-2020_11_24_390039	34	16	E	e	NN
10_1101-2020_11_24_390039	34	17	protein	protein	NN
10_1101-2020_11_24_390039	34	18	,	,	,
10_1101-2020_11_24_390039	34	19	the	the	DT
10_1101-2020_11_24_390039	34	20	ER	ER	NNP
10_1101-2020_11_24_390039	34	21	lumenal	lumenal	NN
10_1101-2020_11_24_390039	34	22	OPG2-tag	opg2-tag	NN
10_1101-2020_11_24_390039	34	23	acts	act	VBZ
10_1101-2020_11_24_390039	34	24	as	as	IN
10_1101-2020_11_24_390039	34	25	a	a	DT
10_1101-2020_11_24_390039	34	26	reporter	reporter	NN
10_1101-2020_11_24_390039	34	27	for	for	IN
10_1101-2020_11_24_390039	34	28	ER	ER	NNP
10_1101-2020_11_24_390039	34	29	translocation	translocation	NN
10_1101-2020_11_24_390039	34	30	and	and	CC
10_1101-2020_11_24_390039	34	31	enables	enable	VBZ
10_1101-2020_11_24_390039	34	32	their	-PRON-	PRP$
10_1101-2020_11_24_390039	34	33	recovery	recovery	NN
10_1101-2020_11_24_390039	34	34	of	of	IN
10_1101-2020_11_24_390039	34	35	by	by	IN
10_1101-2020_11_24_390039	34	36	immunoprecipitation	immunoprecipitation	NN
10_1101-2020_11_24_390039	34	37	.	.	.
10_1101-2020_11_24_390039	35	1	Where	where	WRB
10_1101-2020_11_24_390039	35	2	viral	viral	JJ
10_1101-2020_11_24_390039	35	3	proteins	protein	NNS
10_1101-2020_11_24_390039	35	4	already	already	RB
10_1101-2020_11_24_390039	35	5	contain	contain	VBP
10_1101-2020_11_24_390039	35	6	suitable	suitable	JJ
10_1101-2020_11_24_390039	35	7	sites	site	NNS
10_1101-2020_11_24_390039	35	8	for	for	IN
10_1101-2020_11_24_390039	35	9	N-	n-	CD
10_1101-2020_11_24_390039	35	10	glycosylation	glycosylation	NN
10_1101-2020_11_24_390039	35	11	(	(	-LRB-
10_1101-2020_11_24_390039	35	12	S	S	NNP
10_1101-2020_11_24_390039	35	13	and	and	CC
10_1101-2020_11_24_390039	35	14	M	M	NNP
10_1101-2020_11_24_390039	35	15	proteins	protein	NNS
10_1101-2020_11_24_390039	35	16	)	)	-RRB-
10_1101-2020_11_24_390039	35	17	,	,	,
10_1101-2020_11_24_390039	35	18	the	the	DT
10_1101-2020_11_24_390039	35	19	cytosolic	cytosolic	NN
10_1101-2020_11_24_390039	35	20	OPG2-tag	OPG2-tag	NNP
10_1101-2020_11_24_390039	35	21	is	be	VBZ
10_1101-2020_11_24_390039	35	22	used	use	VBN
10_1101-2020_11_24_390039	35	23	solely	solely	RB
10_1101-2020_11_24_390039	35	24	for	for	IN
10_1101-2020_11_24_390039	35	25	immunoprecipitation	immunoprecipitation	NN
10_1101-2020_11_24_390039	35	26	.	.	.
10_1101-2020_11_24_390039	36	1	The	the	DT
10_1101-2020_11_24_390039	36	2	identity	identity	NN
10_1101-2020_11_24_390039	36	3	of	of	IN
10_1101-2020_11_24_390039	36	4	the	the	DT
10_1101-2020_11_24_390039	36	5	resulting	result	VBG
10_1101-2020_11_24_390039	36	6	N	n	CD
10_1101-2020_11_24_390039	36	7	-	-	HYPH
10_1101-2020_11_24_390039	36	8	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	36	9	species	specie	NNS
10_1101-2020_11_24_390039	36	10	for	for	IN
10_1101-2020_11_24_390039	36	11	each	each	DT
10_1101-2020_11_24_390039	36	12	of	of	IN
10_1101-2020_11_24_390039	36	13	these	these	DT
10_1101-2020_11_24_390039	36	14	OPG2-tagged	opg2-tagged	JJ
10_1101-2020_11_24_390039	36	15	viral	viral	JJ
10_1101-2020_11_24_390039	36	16	proteins	protein	NNS
10_1101-2020_11_24_390039	36	17	was	be	VBD
10_1101-2020_11_24_390039	36	18	confirmed	confirm	VBN
10_1101-2020_11_24_390039	36	19	by	by	IN
10_1101-2020_11_24_390039	36	20	endoglycosidase	endoglycosidase	NN
10_1101-2020_11_24_390039	36	21	H	h	NN
10_1101-2020_11_24_390039	36	22	(	(	-LRB-
10_1101-2020_11_24_390039	36	23	Endo	Endo	NNP
10_1101-2020_11_24_390039	36	24	H	h	NN
10_1101-2020_11_24_390039	36	25	)	)	-RRB-
10_1101-2020_11_24_390039	36	26	treatment	treatment	NN
10_1101-2020_11_24_390039	36	27	of	of	IN
10_1101-2020_11_24_390039	36	28	the	the	DT
10_1101-2020_11_24_390039	36	29	radiolabelled	radiolabelle	VBN
10_1101-2020_11_24_390039	36	30	products	product	NNS
10_1101-2020_11_24_390039	36	31	associated	associate	VBN
10_1101-2020_11_24_390039	36	32	with	with	IN
10_1101-2020_11_24_390039	36	33	the	the	DT
10_1101-2020_11_24_390039	36	34	membrane	membrane	NN
10_1101-2020_11_24_390039	36	35	fraction	fraction	NN
10_1101-2020_11_24_390039	36	36	prior	prior	RB
10_1101-2020_11_24_390039	36	37	to	to	IN
10_1101-2020_11_24_390039	36	38	SDS	SDS	NNP
10_1101-2020_11_24_390039	36	39	-	-	HYPH
10_1101-2020_11_24_390039	36	40	PAGE	PAGE	NNP
10_1101-2020_11_24_390039	36	41	(	(	-LRB-
10_1101-2020_11_24_390039	36	42	Fig	fig	NN
10_1101-2020_11_24_390039	36	43	.	.	.
10_1101-2020_11_24_390039	37	1	2B	2B	NNP
10_1101-2020_11_24_390039	37	2	,	,	,
10_1101-2020_11_24_390039	37	3	cf	cf	NNP
10_1101-2020_11_24_390039	37	4	.	.	.
10_1101-2020_11_24_390039	38	1	lanes	lanes	NNP
10_1101-2020_11_24_390039	38	2	1	1	CD
10_1101-2020_11_24_390039	38	3	and	and	CC
10_1101-2020_11_24_390039	38	4	2	2	CD
10_1101-2020_11_24_390039	38	5	in	in	IN
10_1101-2020_11_24_390039	38	6	each	each	DT
10_1101-2020_11_24_390039	38	7	panel	panel	NN
10_1101-2020_11_24_390039	38	8	)	)	-RRB-
10_1101-2020_11_24_390039	38	9	.	.	.
10_1101-2020_11_24_390039	39	1	Using	use	VBG
10_1101-2020_11_24_390039	39	2	ER	ER	NNP
10_1101-2020_11_24_390039	39	3	lumenal	lumenal	JJ
10_1101-2020_11_24_390039	39	4	modification	modification	NN
10_1101-2020_11_24_390039	39	5	of	of	IN
10_1101-2020_11_24_390039	39	6	either	either	DT
10_1101-2020_11_24_390039	39	7	endogenous	endogenous	JJ
10_1101-2020_11_24_390039	39	8	N	N	NNP
10_1101-2020_11_24_390039	39	9	-	-	HYPH
10_1101-2020_11_24_390039	39	10	glycosylation	glycosylation	NN
10_1101-2020_11_24_390039	39	11	sites	site	NNS
10_1101-2020_11_24_390039	39	12	(	(	-LRB-
10_1101-2020_11_24_390039	39	13	viral	viral	JJ
10_1101-2020_11_24_390039	39	14	S	S	NNP
10_1101-2020_11_24_390039	39	15	and	and	CC
10_1101-2020_11_24_390039	39	16	M	M	NNP
10_1101-2020_11_24_390039	39	17	proteins	protein	NNS
10_1101-2020_11_24_390039	39	18	)	)	-RRB-
10_1101-2020_11_24_390039	39	19	or	or	CC
10_1101-2020_11_24_390039	39	20	the	the	DT
10_1101-2020_11_24_390039	39	21	appended	append	VBN
10_1101-2020_11_24_390039	39	22	OPG2-tag	opg2-tag	NN
10_1101-2020_11_24_390039	39	23	(	(	-LRB-
10_1101-2020_11_24_390039	39	24	viral	viral	JJ
10_1101-2020_11_24_390039	39	25	E	e	NN
10_1101-2020_11_24_390039	39	26	and	and	CC
10_1101-2020_11_24_390039	39	27	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	39	28	proteins	protein	NNS
10_1101-2020_11_24_390039	39	29	)	)	-RRB-
10_1101-2020_11_24_390039	39	30	as	as	IN
10_1101-2020_11_24_390039	39	31	a	a	DT
10_1101-2020_11_24_390039	39	32	reporter	reporter	NN
10_1101-2020_11_24_390039	39	33	for	for	IN
10_1101-2020_11_24_390039	39	34	ER	ER	NNP
10_1101-2020_11_24_390039	39	35	membrane	membrane	NN
10_1101-2020_11_24_390039	39	36	translocation	translocation	NN
10_1101-2020_11_24_390039	39	37	,	,	,
10_1101-2020_11_24_390039	39	38	we	-PRON-	PRP
10_1101-2020_11_24_390039	39	39	found	find	VBD
10_1101-2020_11_24_390039	39	40	that	that	IN
10_1101-2020_11_24_390039	39	41	1	1	CD
10_1101-2020_11_24_390039	39	42	µM	µM	NNP
10_1101-2020_11_24_390039	39	43	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	39	44	-	-	HYPH
10_1101-2020_11_24_390039	39	45	F	F	NNP
10_1101-2020_11_24_390039	39	46	strongly	strongly	RB
10_1101-2020_11_24_390039	39	47	inhibited	inhibit	VBD
10_1101-2020_11_24_390039	39	48	both	both	CC
10_1101-2020_11_24_390039	39	49	the	the	DT
10_1101-2020_11_24_390039	39	50	translocation	translocation	NN
10_1101-2020_11_24_390039	39	51	of	of	IN
10_1101-2020_11_24_390039	39	52	the	the	DT
10_1101-2020_11_24_390039	39	53	soluble	soluble	JJ
10_1101-2020_11_24_390039	39	54	,	,	,
10_1101-2020_11_24_390039	39	55	secretory	secretory	JJ
10_1101-2020_11_24_390039	39	56	-	-	HYPH
10_1101-2020_11_24_390039	39	57	like	like	JJ
10_1101-2020_11_24_390039	39	58	protein	protein	NN
10_1101-2020_11_24_390039	39	59	ORF8-OPG2	ORF8-OPG2	NNP
10_1101-2020_11_24_390039	39	60	and	and	CC
10_1101-2020_11_24_390039	39	61	the	the	DT
10_1101-2020_11_24_390039	39	62	integration	integration	NN
10_1101-2020_11_24_390039	39	63	of	of	IN
10_1101-2020_11_24_390039	39	64	the	the	DT
10_1101-2020_11_24_390039	39	65	type	type	NN
10_1101-2020_11_24_390039	39	66	I	-PRON-	PRP
10_1101-2020_11_24_390039	39	67	transmembrane	transmembrane	VBP
10_1101-2020_11_24_390039	39	68	proteins	protein	NNS
10_1101-2020_11_24_390039	39	69	(	(	-LRB-
10_1101-2020_11_24_390039	39	70	TMP	TMP	NNP
10_1101-2020_11_24_390039	39	71	)	)	-RRB-
10_1101-2020_11_24_390039	39	72	S	S	NNP
10_1101-2020_11_24_390039	39	73	-	-	HYPH
10_1101-2020_11_24_390039	39	74	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	39	75	,	,	,
10_1101-2020_11_24_390039	39	76	and	and	CC
10_1101-2020_11_24_390039	39	77	truncated	truncate	VBN
10_1101-2020_11_24_390039	39	78	derivatives	derivative	NNS
10_1101-2020_11_24_390039	39	79	thereof	thereof	RB
10_1101-2020_11_24_390039	39	80	(	(	-LRB-
10_1101-2020_11_24_390039	39	81	Fig	fig	NN
10_1101-2020_11_24_390039	39	82	.	.	.
10_1101-2020_11_24_390039	40	1	2B	2B	NNP
10_1101-2020_11_24_390039	40	2	,	,	,
10_1101-2020_11_24_390039	40	3	Fig	Fig	NNP
10_1101-2020_11_24_390039	40	4	.	.	.
10_1101-2020_11_24_390039	41	1	2C	2c	LS
10_1101-2020_11_24_390039	41	2	,	,	,
10_1101-2020_11_24_390039	41	3	Fig	Fig	NNP
10_1101-2020_11_24_390039	41	4	.	.	.
10_1101-2020_11_24_390039	42	1	S1C	s1c	LS
10_1101-2020_11_24_390039	42	2	)	)	-RRB-
10_1101-2020_11_24_390039	42	3	.	.	.
10_1101-2020_11_24_390039	43	1	Furthermore	furthermore	RB
10_1101-2020_11_24_390039	43	2	,	,	,
10_1101-2020_11_24_390039	43	3	membrane	membrane	NN
10_1101-2020_11_24_390039	43	4	insertion	insertion	NN
10_1101-2020_11_24_390039	43	5	of	of	IN
10_1101-2020_11_24_390039	43	6	the	the	DT
10_1101-2020_11_24_390039	43	7	human	human	JJ
10_1101-2020_11_24_390039	43	8	type	type	NN
10_1101-2020_11_24_390039	43	9	I	-PRON-	PRP
10_1101-2020_11_24_390039	43	10	TMP	TMP	NNP
10_1101-2020_11_24_390039	43	11	,	,	,
10_1101-2020_11_24_390039	43	12	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	43	13	,	,	,
10_1101-2020_11_24_390039	43	14	was	be	VBD
10_1101-2020_11_24_390039	43	15	inhibited	inhibit	VBN
10_1101-2020_11_24_390039	43	16	to	to	IN
10_1101-2020_11_24_390039	43	17	a	a	DT
10_1101-2020_11_24_390039	43	18	similar	similar	JJ
10_1101-2020_11_24_390039	43	19	extent	extent	NN
10_1101-2020_11_24_390039	43	20	(	(	-LRB-
10_1101-2020_11_24_390039	43	21	Fig	fig	NN
10_1101-2020_11_24_390039	43	22	.	.	.
10_1101-2020_11_24_390039	44	1	2B	2B	NNP
10_1101-2020_11_24_390039	44	2	,	,	,
10_1101-2020_11_24_390039	44	3	Fig	Fig	NNP
10_1101-2020_11_24_390039	44	4	.	.	.
10_1101-2020_11_24_390039	45	1	2C	2C	NNP
10_1101-2020_11_24_390039	45	2	,	,	,
10_1101-2020_11_24_390039	45	3	~70	~70	:
10_1101-2020_11_24_390039	45	4	to	to	IN
10_1101-2020_11_24_390039	45	5	~90	~90	$
10_1101-2020_11_24_390039	45	6	%	%	NN
10_1101-2020_11_24_390039	45	7	inhibition	inhibition	NN
10_1101-2020_11_24_390039	45	8	for	for	IN
10_1101-2020_11_24_390039	45	9	these	these	DT
10_1101-2020_11_24_390039	45	10	three	three	CD
10_1101-2020_11_24_390039	45	11	proteins	protein	NNS
10_1101-2020_11_24_390039	45	12	)	)	-RRB-
10_1101-2020_11_24_390039	45	13	.	.	.
10_1101-2020_11_24_390039	46	1	These	these	DT
10_1101-2020_11_24_390039	46	2	results	result	NNS
10_1101-2020_11_24_390039	46	3	mirror	mirror	VBP
10_1101-2020_11_24_390039	46	4	previous	previous	JJ
10_1101-2020_11_24_390039	46	5	findings	finding	NNS
10_1101-2020_11_24_390039	46	6	showing	show	VBG
10_1101-2020_11_24_390039	46	7	that	that	IN
10_1101-2020_11_24_390039	46	8	precursor	precursor	NN
10_1101-2020_11_24_390039	46	9	proteins	protein	NNS
10_1101-2020_11_24_390039	46	10	bearing	bearing	NN
10_1101-2020_11_24_390039	46	11	N-	n-	CD
10_1101-2020_11_24_390039	46	12	terminal	terminal	JJ
10_1101-2020_11_24_390039	46	13	signal	signal	NN
10_1101-2020_11_24_390039	46	14	peptides	peptide	NNS
10_1101-2020_11_24_390039	46	15	,	,	,
10_1101-2020_11_24_390039	46	16	and	and	CC
10_1101-2020_11_24_390039	46	17	which	which	WDT
10_1101-2020_11_24_390039	46	18	are	be	VBP
10_1101-2020_11_24_390039	46	19	therefore	therefore	RB
10_1101-2020_11_24_390039	46	20	obligate	obligate	NN
10_1101-2020_11_24_390039	46	21	clients	client	NNS
10_1101-2020_11_24_390039	46	22	for	for	IN
10_1101-2020_11_24_390039	46	23	the	the	DT
10_1101-2020_11_24_390039	46	24	Sec61-	sec61-	XX
10_1101-2020_11_24_390039	46	25	translocon	translocon	NNP
10_1101-2020_11_24_390039	46	26	,	,	,
10_1101-2020_11_24_390039	46	27	are	be	VBP
10_1101-2020_11_24_390039	46	28	typically	typically	RB
10_1101-2020_11_24_390039	46	29	very	very	RB
10_1101-2020_11_24_390039	46	30	sensitive	sensitive	JJ
10_1101-2020_11_24_390039	46	31	to	to	IN
10_1101-2020_11_24_390039	46	32	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	46	33	-	-	HYPH
10_1101-2020_11_24_390039	46	34	F	F	NNP
10_1101-2020_11_24_390039	46	35	-	-	HYPH
10_1101-2020_11_24_390039	46	36	mediated	mediate	VBN
10_1101-2020_11_24_390039	46	37	inhibition	inhibition	NN
10_1101-2020_11_24_390039	46	38	(	(	-LRB-
10_1101-2020_11_24_390039	46	39	Zong	Zong	NNP
10_1101-2020_11_24_390039	46	40	et	et	NNP
10_1101-2020_11_24_390039	46	41	al	al	NNP
10_1101-2020_11_24_390039	46	42	.	.	NNP
10_1101-2020_11_24_390039	46	43	,	,	,
10_1101-2020_11_24_390039	46	44	2019	2019	CD
10_1101-2020_11_24_390039	46	45	;	;	:
10_1101-2020_11_24_390039	46	46	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	46	47	et	et	NNP
10_1101-2020_11_24_390039	46	48	al	al	NNP
10_1101-2020_11_24_390039	46	49	.	.	NNP
10_1101-2020_11_24_390039	46	50	,	,	,
10_1101-2020_11_24_390039	46	51	2020	2020	CD
10_1101-2020_11_24_390039	46	52	submitted	submit	VBN
10_1101-2020_11_24_390039	46	53	)	)	-RRB-
10_1101-2020_11_24_390039	46	54	.	.	.
10_1101-2020_11_24_390039	47	1	In	in	IN
10_1101-2020_11_24_390039	47	2	the	the	DT
10_1101-2020_11_24_390039	47	3	context	context	NN
10_1101-2020_11_24_390039	47	4	of	of	IN
10_1101-2020_11_24_390039	47	5	SARS	SARS	NNP
10_1101-2020_11_24_390039	47	6	-	-	HYPH
10_1101-2020_11_24_390039	47	7	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	47	8	infection	infection	NN
10_1101-2020_11_24_390039	47	9	,	,	,
10_1101-2020_11_24_390039	47	10	wherein	wherein	WRB
10_1101-2020_11_24_390039	47	11	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	47	12	acts	act	VBZ
10_1101-2020_11_24_390039	47	13	as	as	IN
10_1101-2020_11_24_390039	47	14	an	an	DT
10_1101-2020_11_24_390039	47	15	important	important	JJ
10_1101-2020_11_24_390039	47	16	host	host	NN
10_1101-2020_11_24_390039	47	17	cell	cell	NN
10_1101-2020_11_24_390039	47	18	receptor	receptor	NN
10_1101-2020_11_24_390039	47	19	for	for	IN
10_1101-2020_11_24_390039	47	20	the	the	DT
10_1101-2020_11_24_390039	47	21	SARS	SARS	NNP
10_1101-2020_11_24_390039	47	22	-	-	HYPH
10_1101-2020_11_24_390039	47	23	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	47	24	virus	virus	NN
10_1101-2020_11_24_390039	47	25	.CC	.CC	,
10_1101-2020_11_24_390039	47	26	-	-	:
10_1101-2020_11_24_390039	47	27	BY	by	IN
10_1101-2020_11_24_390039	47	28	-	-	HYPH
10_1101-2020_11_24_390039	47	29	ND	ND	NNP
10_1101-2020_11_24_390039	47	30	4.0	4.0	CD
10_1101-2020_11_24_390039	47	31	International	international	JJ
10_1101-2020_11_24_390039	47	32	licensemade	licensemade	NN
10_1101-2020_11_24_390039	47	33	available	available	JJ
10_1101-2020_11_24_390039	47	34	under	under	IN
10_1101-2020_11_24_390039	47	35	a	a	DT
10_1101-2020_11_24_390039	47	36	(	(	-LRB-
10_1101-2020_11_24_390039	47	37	which	which	WDT
10_1101-2020_11_24_390039	47	38	was	be	VBD
10_1101-2020_11_24_390039	47	39	not	not	RB
10_1101-2020_11_24_390039	47	40	certified	certify	VBN
10_1101-2020_11_24_390039	47	41	by	by	IN
10_1101-2020_11_24_390039	47	42	peer	peer	NN
10_1101-2020_11_24_390039	47	43	review	review	NN
10_1101-2020_11_24_390039	47	44	)	)	-RRB-
10_1101-2020_11_24_390039	47	45	is	be	VBZ
10_1101-2020_11_24_390039	47	46	the	the	DT
10_1101-2020_11_24_390039	47	47	author	author	NN
10_1101-2020_11_24_390039	47	48	/	/	SYM
10_1101-2020_11_24_390039	47	49	funder	funder	NN
10_1101-2020_11_24_390039	47	50	,	,	,
10_1101-2020_11_24_390039	47	51	who	who	WP
10_1101-2020_11_24_390039	47	52	has	have	VBZ
10_1101-2020_11_24_390039	47	53	granted	grant	VBN
10_1101-2020_11_24_390039	47	54	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	47	55	a	a	DT
10_1101-2020_11_24_390039	47	56	license	license	NN
10_1101-2020_11_24_390039	47	57	to	to	TO
10_1101-2020_11_24_390039	47	58	display	display	VB
10_1101-2020_11_24_390039	47	59	the	the	DT
10_1101-2020_11_24_390039	47	60	preprint	preprint	NN
10_1101-2020_11_24_390039	47	61	in	in	IN
10_1101-2020_11_24_390039	47	62	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	47	63	.	.	.
10_1101-2020_11_24_390039	48	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	48	2	is	be	VBZ
10_1101-2020_11_24_390039	48	3	The	the	DT
10_1101-2020_11_24_390039	48	4	copyright	copyright	NN
10_1101-2020_11_24_390039	48	5	holder	holder	NN
10_1101-2020_11_24_390039	48	6	for	for	IN
10_1101-2020_11_24_390039	48	7	this	this	DT
10_1101-2020_11_24_390039	48	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	48	9	version	version	NN
10_1101-2020_11_24_390039	48	10	posted	post	VBD
10_1101-2020_11_24_390039	48	11	January	January	NNP
10_1101-2020_11_24_390039	48	12	5	5	CD
10_1101-2020_11_24_390039	48	13	,	,	,
10_1101-2020_11_24_390039	48	14	2021	2021	CD
10_1101-2020_11_24_390039	48	15	.	.	.
10_1101-2020_11_24_390039	48	16	;	;	:
10_1101-2020_11_24_390039	48	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	48	18	:	:	:
10_1101-2020_11_24_390039	48	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	48	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	48	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	48	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	48	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	48	24	-	-	HYPH
10_1101-2020_11_24_390039	48	25	F	F	NNP
10_1101-2020_11_24_390039	48	26	as	as	IN
10_1101-2020_11_24_390039	48	27	a	a	DT
10_1101-2020_11_24_390039	48	28	potential	potential	JJ
10_1101-2020_11_24_390039	48	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	48	30	agent	agent	NN
10_1101-2020_11_24_390039	48	31	Page	Page	NNP
10_1101-2020_11_24_390039	48	32	5	5	CD
10_1101-2020_11_24_390039	48	33	of	of	IN
10_1101-2020_11_24_390039	48	34	21	21	CD
10_1101-2020_11_24_390039	48	35	via	via	IN
10_1101-2020_11_24_390039	48	36	its	-PRON-	PRP$
10_1101-2020_11_24_390039	48	37	interaction	interaction	NN
10_1101-2020_11_24_390039	48	38	with	with	IN
10_1101-2020_11_24_390039	48	39	the	the	DT
10_1101-2020_11_24_390039	48	40	viral	viral	JJ
10_1101-2020_11_24_390039	48	41	S	s	JJ
10_1101-2020_11_24_390039	48	42	protein	protein	NN
10_1101-2020_11_24_390039	48	43	(	(	-LRB-
10_1101-2020_11_24_390039	48	44	Walls	Walls	NNP
10_1101-2020_11_24_390039	48	45	et	et	FW
10_1101-2020_11_24_390039	48	46	al	al	NNP
10_1101-2020_11_24_390039	48	47	.	.	NNP
10_1101-2020_11_24_390039	48	48	,	,	,
10_1101-2020_11_24_390039	48	49	2020	2020	CD
10_1101-2020_11_24_390039	48	50	)	)	-RRB-
10_1101-2020_11_24_390039	48	51	,	,	,
10_1101-2020_11_24_390039	48	52	these	these	DT
10_1101-2020_11_24_390039	48	53	data	datum	NNS
10_1101-2020_11_24_390039	48	54	suggest	suggest	VBP
10_1101-2020_11_24_390039	48	55	that	that	IN
10_1101-2020_11_24_390039	48	56	an	an	DT
10_1101-2020_11_24_390039	48	57	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	48	58	-	-	HYPH
10_1101-2020_11_24_390039	48	59	F	F	NNP
10_1101-2020_11_24_390039	48	60	-	-	HYPH
10_1101-2020_11_24_390039	48	61	induced	induce	VBN
10_1101-2020_11_24_390039	48	62	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	48	63	effect	effect	NN
10_1101-2020_11_24_390039	48	64	might	may	MD
10_1101-2020_11_24_390039	48	65	be	be	VB
10_1101-2020_11_24_390039	48	66	achieved	achieve	VBN
10_1101-2020_11_24_390039	48	67	via	via	IN
10_1101-2020_11_24_390039	48	68	selective	selective	JJ
10_1101-2020_11_24_390039	48	69	reductions	reduction	NNS
10_1101-2020_11_24_390039	48	70	in	in	IN
10_1101-2020_11_24_390039	48	71	the	the	DT
10_1101-2020_11_24_390039	48	72	biogenesis	biogenesis	NN
10_1101-2020_11_24_390039	48	73	of	of	IN
10_1101-2020_11_24_390039	48	74	both	both	DT
10_1101-2020_11_24_390039	48	75	host	host	NN
10_1101-2020_11_24_390039	48	76	and	and	CC
10_1101-2020_11_24_390039	48	77	viral	viral	JJ
10_1101-2020_11_24_390039	48	78	proteins	protein	NNS
10_1101-2020_11_24_390039	48	79	(	(	-LRB-
10_1101-2020_11_24_390039	48	80	cf	cf	NN
10_1101-2020_11_24_390039	48	81	.	.	.
10_1101-2020_11_24_390039	49	1	Fig	fig	NN
10_1101-2020_11_24_390039	49	2	.	.	.
10_1101-2020_11_24_390039	50	1	1A	1a	LS
10_1101-2020_11_24_390039	50	2	)	)	-RRB-
10_1101-2020_11_24_390039	50	3	.	.	.
10_1101-2020_11_24_390039	51	1	In	in	IN
10_1101-2020_11_24_390039	51	2	contrast	contrast	NN
10_1101-2020_11_24_390039	51	3	to	to	IN
10_1101-2020_11_24_390039	51	4	the	the	DT
10_1101-2020_11_24_390039	51	5	viral	viral	JJ
10_1101-2020_11_24_390039	51	6	S	S	NNP
10_1101-2020_11_24_390039	51	7	and	and	CC
10_1101-2020_11_24_390039	51	8	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	51	9	proteins	protein	NNS
10_1101-2020_11_24_390039	51	10	,	,	,
10_1101-2020_11_24_390039	51	11	insertion	insertion	NN
10_1101-2020_11_24_390039	51	12	of	of	IN
10_1101-2020_11_24_390039	51	13	the	the	DT
10_1101-2020_11_24_390039	51	14	viral	viral	JJ
10_1101-2020_11_24_390039	51	15	E	e	NN
10_1101-2020_11_24_390039	51	16	protein	protein	NN
10_1101-2020_11_24_390039	51	17	was	be	VBD
10_1101-2020_11_24_390039	51	18	unaffected	unaffected	JJ
10_1101-2020_11_24_390039	51	19	by	by	IN
10_1101-2020_11_24_390039	51	20	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	51	21	-	-	HYPH
10_1101-2020_11_24_390039	51	22	F	F	NNP
10_1101-2020_11_24_390039	51	23	(	(	-LRB-
10_1101-2020_11_24_390039	51	24	Fig	Fig	NNP
10_1101-2020_11_24_390039	51	25	.	.	.
10_1101-2020_11_24_390039	52	1	2B	2B	NNP
10_1101-2020_11_24_390039	52	2	-	-	HYPH
10_1101-2020_11_24_390039	52	3	C	C	NNP
10_1101-2020_11_24_390039	52	4	)	)	-RRB-
10_1101-2020_11_24_390039	52	5	,	,	,
10_1101-2020_11_24_390039	52	6	consistent	consistent	JJ
10_1101-2020_11_24_390039	52	7	with	with	IN
10_1101-2020_11_24_390039	52	8	its	-PRON-	PRP$
10_1101-2020_11_24_390039	52	9	recent	recent	JJ
10_1101-2020_11_24_390039	52	10	classification	classification	NN
10_1101-2020_11_24_390039	52	11	as	as	IN
10_1101-2020_11_24_390039	52	12	a	a	DT
10_1101-2020_11_24_390039	52	13	type	type	NN
10_1101-2020_11_24_390039	52	14	III	iii	CD
10_1101-2020_11_24_390039	52	15	TMP	TMP	NNP
10_1101-2020_11_24_390039	52	16	(	(	-LRB-
10_1101-2020_11_24_390039	52	17	Duart	Duart	NNP
10_1101-2020_11_24_390039	52	18	et	et	NNP
10_1101-2020_11_24_390039	52	19	al	al	NNP
10_1101-2020_11_24_390039	52	20	.	.	NNP
10_1101-2020_11_24_390039	52	21	,	,	,
10_1101-2020_11_24_390039	52	22	2020	2020	CD
10_1101-2020_11_24_390039	52	23	)	)	-RRB-
10_1101-2020_11_24_390039	52	24	.	.	.
10_1101-2020_11_24_390039	53	1	Type	type	NN
10_1101-2020_11_24_390039	53	2	III	III	NNP
10_1101-2020_11_24_390039	53	3	TMP	tmp	NN
10_1101-2020_11_24_390039	53	4	integration	integration	NN
10_1101-2020_11_24_390039	53	5	is	be	VBZ
10_1101-2020_11_24_390039	53	6	highly	highly	RB
10_1101-2020_11_24_390039	53	7	resistant	resistant	JJ
10_1101-2020_11_24_390039	53	8	to	to	IN
10_1101-2020_11_24_390039	53	9	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	53	10	-	-	HYPH
10_1101-2020_11_24_390039	53	11	F	F	NNP
10_1101-2020_11_24_390039	53	12	(	(	-LRB-
10_1101-2020_11_24_390039	53	13	Zong	Zong	NNP
10_1101-2020_11_24_390039	53	14	et	et	NNP
10_1101-2020_11_24_390039	53	15	al	al	NNP
10_1101-2020_11_24_390039	53	16	.	.	NNP
10_1101-2020_11_24_390039	53	17	,	,	,
10_1101-2020_11_24_390039	53	18	2019	2019	CD
10_1101-2020_11_24_390039	53	19	)	)	-RRB-
10_1101-2020_11_24_390039	53	20	,	,	,
10_1101-2020_11_24_390039	53	21	most	most	RBS
10_1101-2020_11_24_390039	53	22	likely	likely	RB
10_1101-2020_11_24_390039	53	23	because	because	IN
10_1101-2020_11_24_390039	53	24	they	-PRON-	PRP
10_1101-2020_11_24_390039	53	25	exploit	exploit	VBP
10_1101-2020_11_24_390039	53	26	a	a	DT
10_1101-2020_11_24_390039	53	27	novel	novel	JJ
10_1101-2020_11_24_390039	53	28	pathway	pathway	NN
10_1101-2020_11_24_390039	53	29	for	for	IN
10_1101-2020_11_24_390039	53	30	ER	ER	NNP
10_1101-2020_11_24_390039	53	31	insertion	insertion	NN
10_1101-2020_11_24_390039	53	32	(	(	-LRB-
10_1101-2020_11_24_390039	53	33	cf	cf	NN
10_1101-2020_11_24_390039	53	34	.	.	.
10_1101-2020_11_24_390039	54	1	Fig	fig	NN
10_1101-2020_11_24_390039	54	2	.	.	.
10_1101-2020_11_24_390039	55	1	3	3	LS
10_1101-2020_11_24_390039	55	2	;	;	:
10_1101-2020_11_24_390039	55	3	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	55	4	et	et	NNP
10_1101-2020_11_24_390039	55	5	al	al	NNP
10_1101-2020_11_24_390039	55	6	.	.	NNP
10_1101-2020_11_24_390039	55	7	,	,	,
10_1101-2020_11_24_390039	55	8	2020	2020	CD
10_1101-2020_11_24_390039	55	9	submitted	submit	VBN
10_1101-2020_11_24_390039	55	10	)	)	-RRB-
10_1101-2020_11_24_390039	55	11	.	.	.
10_1101-2020_11_24_390039	56	1	We	-PRON-	PRP
10_1101-2020_11_24_390039	56	2	therefore	therefore	RB
10_1101-2020_11_24_390039	56	3	conclude	conclude	VBP
10_1101-2020_11_24_390039	56	4	that	that	IN
10_1101-2020_11_24_390039	56	5	the	the	DT
10_1101-2020_11_24_390039	56	6	known	know	VBN
10_1101-2020_11_24_390039	56	7	substrate	substrate	NN
10_1101-2020_11_24_390039	56	8	-	-	HYPH
10_1101-2020_11_24_390039	56	9	selective	selective	JJ
10_1101-2020_11_24_390039	56	10	inhibitory	inhibitory	JJ
10_1101-2020_11_24_390039	56	11	action	action	NN
10_1101-2020_11_24_390039	56	12	of	of	IN
10_1101-2020_11_24_390039	56	13	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	56	14	-	-	HYPH
10_1101-2020_11_24_390039	56	15	F	F	NNP
10_1101-2020_11_24_390039	56	16	at	at	IN
10_1101-2020_11_24_390039	56	17	the	the	DT
10_1101-2020_11_24_390039	56	18	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	56	19	translocon	translocon	NN
10_1101-2020_11_24_390039	56	20	is	be	VBZ
10_1101-2020_11_24_390039	56	21	directly	directly	RB
10_1101-2020_11_24_390039	56	22	applicable	applicable	JJ
10_1101-2020_11_24_390039	56	23	to	to	IN
10_1101-2020_11_24_390039	56	24	viral	viral	JJ
10_1101-2020_11_24_390039	56	25	membrane	membrane	NN
10_1101-2020_11_24_390039	56	26	proteins	protein	NNS
10_1101-2020_11_24_390039	56	27	;	;	,
10_1101-2020_11_24_390039	56	28	whereby	whereby	WRB
10_1101-2020_11_24_390039	56	29	the	the	DT
10_1101-2020_11_24_390039	56	30	ER	ER	NNP
10_1101-2020_11_24_390039	56	31	translocation	translocation	NN
10_1101-2020_11_24_390039	56	32	of	of	IN
10_1101-2020_11_24_390039	56	33	secretory	secretory	JJ
10_1101-2020_11_24_390039	56	34	proteins	protein	NNS
10_1101-2020_11_24_390039	56	35	and	and	CC
10_1101-2020_11_24_390039	56	36	type	type	NN
10_1101-2020_11_24_390039	56	37	I	-PRON-	PRP
10_1101-2020_11_24_390039	56	38	TMPs	tmp	NNS
10_1101-2020_11_24_390039	56	39	,	,	,
10_1101-2020_11_24_390039	56	40	but	but	CC
10_1101-2020_11_24_390039	56	41	not	not	RB
10_1101-2020_11_24_390039	56	42	type	type	VB
10_1101-2020_11_24_390039	56	43	III	iii	CD
10_1101-2020_11_24_390039	56	44	TMPs	tmp	NNS
10_1101-2020_11_24_390039	56	45	,	,	,
10_1101-2020_11_24_390039	56	46	is	be	VBZ
10_1101-2020_11_24_390039	56	47	efficiently	efficiently	RB
10_1101-2020_11_24_390039	56	48	blocked	block	VBN
10_1101-2020_11_24_390039	56	49	by	by	IN
10_1101-2020_11_24_390039	56	50	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	56	51	-	-	HYPH
10_1101-2020_11_24_390039	56	52	F.	F.	NNP
10_1101-2020_11_24_390039	57	1	The	the	DT
10_1101-2020_11_24_390039	57	2	viral	viral	JJ
10_1101-2020_11_24_390039	57	3	M	M	NNP
10_1101-2020_11_24_390039	57	4	protein	protein	NN
10_1101-2020_11_24_390039	57	5	is	be	VBZ
10_1101-2020_11_24_390039	57	6	a	a	DT
10_1101-2020_11_24_390039	57	7	multi	multi	JJ
10_1101-2020_11_24_390039	57	8	-	-	JJ
10_1101-2020_11_24_390039	57	9	pass	pass	JJ
10_1101-2020_11_24_390039	57	10	TMP	tmp	NN
10_1101-2020_11_24_390039	57	11	with	with	IN
10_1101-2020_11_24_390039	57	12	its	-PRON-	PRP$
10_1101-2020_11_24_390039	57	13	first	first	JJ
10_1101-2020_11_24_390039	57	14	TMD	TMD	NNP
10_1101-2020_11_24_390039	57	15	oriented	orient	VBN
10_1101-2020_11_24_390039	57	16	so	so	IN
10_1101-2020_11_24_390039	57	17	the	the	DT
10_1101-2020_11_24_390039	57	18	N-	n-	CD
10_1101-2020_11_24_390039	57	19	terminus	terminus	NN
10_1101-2020_11_24_390039	57	20	is	be	VBZ
10_1101-2020_11_24_390039	57	21	exoplasmic	exoplasmic	JJ
10_1101-2020_11_24_390039	57	22	(	(	-LRB-
10_1101-2020_11_24_390039	57	23	Nexo	Nexo	NNP
10_1101-2020_11_24_390039	57	24	)	)	-RRB-
10_1101-2020_11_24_390039	57	25	and	and	CC
10_1101-2020_11_24_390039	57	26	hence	hence	RB
10_1101-2020_11_24_390039	57	27	can	can	MD
10_1101-2020_11_24_390039	57	28	be	be	VB
10_1101-2020_11_24_390039	57	29	considered	consider	VBN
10_1101-2020_11_24_390039	57	30	“	"	``
10_1101-2020_11_24_390039	57	31	type	type	NN
10_1101-2020_11_24_390039	57	32	III	III	NNP
10_1101-2020_11_24_390039	57	33	-	-	HYPH
10_1101-2020_11_24_390039	57	34	like	like	JJ
10_1101-2020_11_24_390039	57	35	”	"	''
10_1101-2020_11_24_390039	57	36	.	.	.
10_1101-2020_11_24_390039	58	1	Although	although	IN
10_1101-2020_11_24_390039	58	2	human	human	JJ
10_1101-2020_11_24_390039	58	3	multi	multi	JJ
10_1101-2020_11_24_390039	58	4	-	-	JJ
10_1101-2020_11_24_390039	58	5	pass	pass	JJ
10_1101-2020_11_24_390039	58	6	TMPs	tmp	NNS
10_1101-2020_11_24_390039	58	7	of	of	IN
10_1101-2020_11_24_390039	58	8	this	this	DT
10_1101-2020_11_24_390039	58	9	type	type	NN
10_1101-2020_11_24_390039	58	10	typically	typically	RB
10_1101-2020_11_24_390039	58	11	require	require	VBP
10_1101-2020_11_24_390039	58	12	both	both	CC
10_1101-2020_11_24_390039	58	13	the	the	DT
10_1101-2020_11_24_390039	58	14	ER	ER	NNP
10_1101-2020_11_24_390039	58	15	membrane	membrane	NN
10_1101-2020_11_24_390039	58	16	complex	complex	NN
10_1101-2020_11_24_390039	58	17	(	(	-LRB-
10_1101-2020_11_24_390039	58	18	EMC	EMC	NNP
10_1101-2020_11_24_390039	58	19	)	)	-RRB-
10_1101-2020_11_24_390039	58	20	and	and	CC
10_1101-2020_11_24_390039	58	21	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	58	22	translocon	translocon	NN
10_1101-2020_11_24_390039	58	23	for	for	IN
10_1101-2020_11_24_390039	58	24	their	-PRON-	PRP$
10_1101-2020_11_24_390039	58	25	authentic	authentic	JJ
10_1101-2020_11_24_390039	58	26	ER	ER	NNP
10_1101-2020_11_24_390039	58	27	insertion	insertion	NN
10_1101-2020_11_24_390039	58	28	(	(	-LRB-
10_1101-2020_11_24_390039	58	29	Chitwood	Chitwood	NNP
10_1101-2020_11_24_390039	58	30	et	et	NNP
10_1101-2020_11_24_390039	58	31	al	al	NNP
10_1101-2020_11_24_390039	58	32	.	.	NNP
10_1101-2020_11_24_390039	58	33	,	,	,
10_1101-2020_11_24_390039	58	34	2018	2018	CD
10_1101-2020_11_24_390039	58	35	)	)	-RRB-
10_1101-2020_11_24_390039	58	36	,	,	,
10_1101-2020_11_24_390039	58	37	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	58	38	-	-	HYPH
10_1101-2020_11_24_390039	58	39	F	F	NNP
10_1101-2020_11_24_390039	58	40	had	have	VBD
10_1101-2020_11_24_390039	58	41	no	no	DT
10_1101-2020_11_24_390039	58	42	significant	significant	JJ
10_1101-2020_11_24_390039	58	43	effect	effect	NN
10_1101-2020_11_24_390039	58	44	on	on	IN
10_1101-2020_11_24_390039	58	45	the	the	DT
10_1101-2020_11_24_390039	58	46	ER	ER	NNP
10_1101-2020_11_24_390039	58	47	translocation	translocation	NN
10_1101-2020_11_24_390039	58	48	/	/	SYM
10_1101-2020_11_24_390039	58	49	insertion	insertion	NN
10_1101-2020_11_24_390039	58	50	of	of	IN
10_1101-2020_11_24_390039	58	51	the	the	DT
10_1101-2020_11_24_390039	58	52	M	M	NNP
10_1101-2020_11_24_390039	58	53	protein	protein	NN
10_1101-2020_11_24_390039	58	54	in	in	IN
10_1101-2020_11_24_390039	58	55	vitro	vitro	FW
10_1101-2020_11_24_390039	58	56	,	,	,
10_1101-2020_11_24_390039	58	57	as	as	IN
10_1101-2020_11_24_390039	58	58	judged	judge	VBN
10_1101-2020_11_24_390039	58	59	by	by	IN
10_1101-2020_11_24_390039	58	60	the	the	DT
10_1101-2020_11_24_390039	58	61	efficiency	efficiency	NN
10_1101-2020_11_24_390039	58	62	of	of	IN
10_1101-2020_11_24_390039	58	63	N-	n-	CD
10_1101-2020_11_24_390039	58	64	glycosylation	glycosylation	NN
10_1101-2020_11_24_390039	58	65	of	of	IN
10_1101-2020_11_24_390039	58	66	its	-PRON-	PRP$
10_1101-2020_11_24_390039	58	67	N	n	CD
10_1101-2020_11_24_390039	58	68	-	-	HYPH
10_1101-2020_11_24_390039	58	69	terminal	terminal	NN
10_1101-2020_11_24_390039	58	70	domain	domain	NN
10_1101-2020_11_24_390039	58	71	(	(	-LRB-
10_1101-2020_11_24_390039	58	72	Fig	fig	NN
10_1101-2020_11_24_390039	58	73	.	.	.
10_1101-2020_11_24_390039	59	1	2C	2C	NNP
10_1101-2020_11_24_390039	59	2	)	)	-RRB-
10_1101-2020_11_24_390039	59	3	.	.	.
10_1101-2020_11_24_390039	60	1	We	-PRON-	PRP
10_1101-2020_11_24_390039	60	2	conclude	conclude	VBP
10_1101-2020_11_24_390039	60	3	that	that	IN
10_1101-2020_11_24_390039	60	4	the	the	DT
10_1101-2020_11_24_390039	60	5	integration	integration	NN
10_1101-2020_11_24_390039	60	6	of	of	IN
10_1101-2020_11_24_390039	60	7	its	-PRON-	PRP$
10_1101-2020_11_24_390039	60	8	first	first	JJ
10_1101-2020_11_24_390039	60	9	TMD	TMD	NNP
10_1101-2020_11_24_390039	60	10	is	be	VBZ
10_1101-2020_11_24_390039	60	11	unaffected	unaffected	JJ
10_1101-2020_11_24_390039	60	12	by	by	IN
10_1101-2020_11_24_390039	60	13	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	60	14	-	-	HYPH
10_1101-2020_11_24_390039	60	15	F	F	NNP
10_1101-2020_11_24_390039	60	16	,	,	,
10_1101-2020_11_24_390039	60	17	consistent	consistent	JJ
10_1101-2020_11_24_390039	60	18	with	with	IN
10_1101-2020_11_24_390039	60	19	its	-PRON-	PRP$
10_1101-2020_11_24_390039	60	20	use	use	NN
10_1101-2020_11_24_390039	60	21	of	of	IN
10_1101-2020_11_24_390039	60	22	the	the	DT
10_1101-2020_11_24_390039	60	23	EMC	EMC	NNP
10_1101-2020_11_24_390039	60	24	(	(	-LRB-
10_1101-2020_11_24_390039	60	25	Chitwood	Chitwood	NNP
10_1101-2020_11_24_390039	60	26	et	et	NNP
10_1101-2020_11_24_390039	60	27	al	al	NNP
10_1101-2020_11_24_390039	60	28	.	.	NNP
10_1101-2020_11_24_390039	60	29	,	,	,
10_1101-2020_11_24_390039	60	30	2018	2018	CD
10_1101-2020_11_24_390039	60	31	;	;	:
10_1101-2020_11_24_390039	60	32	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	60	33	et	et	NNP
10_1101-2020_11_24_390039	60	34	al	al	NNP
10_1101-2020_11_24_390039	60	35	.	.	NNP
10_1101-2020_11_24_390039	60	36	,	,	,
10_1101-2020_11_24_390039	60	37	2020	2020	CD
10_1101-2020_11_24_390039	60	38	submitted	submit	VBN
10_1101-2020_11_24_390039	60	39	)	)	-RRB-
10_1101-2020_11_24_390039	60	40	.	.	.
10_1101-2020_11_24_390039	61	1	There	there	EX
10_1101-2020_11_24_390039	61	2	is	be	VBZ
10_1101-2020_11_24_390039	61	3	however	however	RB
10_1101-2020_11_24_390039	61	4	a	a	DT
10_1101-2020_11_24_390039	61	5	qualitative	qualitative	JJ
10_1101-2020_11_24_390039	61	6	reduction	reduction	NN
10_1101-2020_11_24_390039	61	7	in	in	IN
10_1101-2020_11_24_390039	61	8	the	the	DT
10_1101-2020_11_24_390039	61	9	intensity	intensity	NN
10_1101-2020_11_24_390039	61	10	of	of	IN
10_1101-2020_11_24_390039	61	11	both	both	CC
10_1101-2020_11_24_390039	61	12	the	the	DT
10_1101-2020_11_24_390039	61	13	non-	non-	NN
10_1101-2020_11_24_390039	61	14	and	and	CC
10_1101-2020_11_24_390039	61	15	N	N	NNP
10_1101-2020_11_24_390039	61	16	-	-	HYPH
10_1101-2020_11_24_390039	61	17	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	61	18	forms	form	NNS
10_1101-2020_11_24_390039	61	19	of	of	IN
10_1101-2020_11_24_390039	61	20	the	the	DT
10_1101-2020_11_24_390039	61	21	M	M	NNP
10_1101-2020_11_24_390039	61	22	protein	protein	NN
10_1101-2020_11_24_390039	61	23	when	when	WRB
10_1101-2020_11_24_390039	61	24	compared	compare	VBN
10_1101-2020_11_24_390039	61	25	to	to	IN
10_1101-2020_11_24_390039	61	26	the	the	DT
10_1101-2020_11_24_390039	61	27	control	control	NN
10_1101-2020_11_24_390039	61	28	(	(	-LRB-
10_1101-2020_11_24_390039	61	29	see	see	VB
10_1101-2020_11_24_390039	61	30	Fig	Fig	NNP
10_1101-2020_11_24_390039	61	31	.	.	.
10_1101-2020_11_24_390039	62	1	2B	2B	NNP
10_1101-2020_11_24_390039	62	2	and	and	CC
10_1101-2020_11_24_390039	62	3	Fig	Fig	NNP
10_1101-2020_11_24_390039	62	4	.	.	.
10_1101-2020_11_24_390039	63	1	S1A	s1a	LS
10_1101-2020_11_24_390039	63	2	)	)	-RRB-
10_1101-2020_11_24_390039	63	3	.	.	.
10_1101-2020_11_24_390039	64	1	We	-PRON-	PRP
10_1101-2020_11_24_390039	64	2	speculate	speculate	VBP
10_1101-2020_11_24_390039	64	3	that	that	IN
10_1101-2020_11_24_390039	64	4	this	this	DT
10_1101-2020_11_24_390039	64	5	decrease	decrease	NN
10_1101-2020_11_24_390039	64	6	may	may	MD
10_1101-2020_11_24_390039	64	7	reflect	reflect	VB
10_1101-2020_11_24_390039	64	8	an	an	DT
10_1101-2020_11_24_390039	64	9	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	64	10	-	-	HYPH
10_1101-2020_11_24_390039	64	11	F	F	NNP
10_1101-2020_11_24_390039	64	12	-	-	HYPH
10_1101-2020_11_24_390039	64	13	induced	induce	VBN
10_1101-2020_11_24_390039	64	14	effect	effect	NN
10_1101-2020_11_24_390039	64	15	on	on	IN
10_1101-2020_11_24_390039	64	16	the	the	DT
10_1101-2020_11_24_390039	64	17	Sec61-	sec61-	XX
10_1101-2020_11_24_390039	64	18	dependent	dependent	JJ
10_1101-2020_11_24_390039	64	19	integration	integration	NN
10_1101-2020_11_24_390039	64	20	of	of	IN
10_1101-2020_11_24_390039	64	21	the	the	DT
10_1101-2020_11_24_390039	64	22	second	second	JJ
10_1101-2020_11_24_390039	64	23	and/or	and/or	CC
10_1101-2020_11_24_390039	64	24	third	third	JJ
10_1101-2020_11_24_390039	64	25	TM	TM	NNP
10_1101-2020_11_24_390039	64	26	-	-	HYPH
10_1101-2020_11_24_390039	64	27	spans	span	NNS
10_1101-2020_11_24_390039	64	28	of	of	IN
10_1101-2020_11_24_390039	64	29	the	the	DT
10_1101-2020_11_24_390039	64	30	M	M	NNP
10_1101-2020_11_24_390039	64	31	protein	protein	NN
10_1101-2020_11_24_390039	64	32	(	(	-LRB-
10_1101-2020_11_24_390039	64	33	cf	cf	NN
10_1101-2020_11_24_390039	64	34	.	.	.
10_1101-2020_11_24_390039	65	1	Chitwood	Chitwood	NNP
10_1101-2020_11_24_390039	65	2	et	et	NNP
10_1101-2020_11_24_390039	65	3	al	al	NNP
10_1101-2020_11_24_390039	65	4	.	.	NNP
10_1101-2020_11_24_390039	65	5	,	,	,
10_1101-2020_11_24_390039	65	6	2018	2018	CD
10_1101-2020_11_24_390039	65	7	)	)	-RRB-
10_1101-2020_11_24_390039	65	8	and	and	CC
10_1101-2020_11_24_390039	65	9	our	-PRON-	PRP$
10_1101-2020_11_24_390039	65	10	future	future	JJ
10_1101-2020_11_24_390039	65	11	studies	study	NNS
10_1101-2020_11_24_390039	65	12	will	will	MD
10_1101-2020_11_24_390039	65	13	aim	aim	VB
10_1101-2020_11_24_390039	65	14	to	to	TO
10_1101-2020_11_24_390039	65	15	resolve	resolve	VB
10_1101-2020_11_24_390039	65	16	this	this	DT
10_1101-2020_11_24_390039	65	17	question	question	NN
10_1101-2020_11_24_390039	65	18	.	.	.
10_1101-2020_11_24_390039	66	1	Nevertheless	nevertheless	RB
10_1101-2020_11_24_390039	66	2	,	,	,
10_1101-2020_11_24_390039	66	3	like	like	IN
10_1101-2020_11_24_390039	66	4	similar	similar	JJ
10_1101-2020_11_24_390039	66	5	host	host	NN
10_1101-2020_11_24_390039	66	6	cell	cell	NN
10_1101-2020_11_24_390039	66	7	multi	multi	JJ
10_1101-2020_11_24_390039	66	8	-	-	JJ
10_1101-2020_11_24_390039	66	9	pass	pass	JJ
10_1101-2020_11_24_390039	66	10	TMPs	tmp	NNS
10_1101-2020_11_24_390039	66	11	that	that	WDT
10_1101-2020_11_24_390039	66	12	are	be	VBP
10_1101-2020_11_24_390039	66	13	resistant	resistant	JJ
10_1101-2020_11_24_390039	66	14	to	to	IN
10_1101-2020_11_24_390039	66	15	a	a	DT
10_1101-2020_11_24_390039	66	16	similar	similar	JJ
10_1101-2020_11_24_390039	66	17	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	66	18	inhibitor	inhibitor	NN
10_1101-2020_11_24_390039	66	19	mycolactone	mycolactone	NN
10_1101-2020_11_24_390039	66	20	(	(	-LRB-
10_1101-2020_11_24_390039	66	21	Morel	Morel	NNP
10_1101-2020_11_24_390039	66	22	et	et	NNP
10_1101-2020_11_24_390039	66	23	al	al	NNP
10_1101-2020_11_24_390039	66	24	.	.	NNP
10_1101-2020_11_24_390039	66	25	,	,	,
10_1101-2020_11_24_390039	66	26	2018	2018	CD
10_1101-2020_11_24_390039	66	27	)	)	-RRB-
10_1101-2020_11_24_390039	66	28	,	,	,
10_1101-2020_11_24_390039	66	29	the	the	DT
10_1101-2020_11_24_390039	66	30	M	M	NNP
10_1101-2020_11_24_390039	66	31	protein	protein	NN
10_1101-2020_11_24_390039	66	32	appears	appear	VBZ
10_1101-2020_11_24_390039	66	33	more	more	RBR
10_1101-2020_11_24_390039	66	34	resistant	resistant	JJ
10_1101-2020_11_24_390039	66	35	to	to	IN
10_1101-2020_11_24_390039	66	36	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	66	37	-	-	HYPH
10_1101-2020_11_24_390039	66	38	F	F	NNP
10_1101-2020_11_24_390039	66	39	than	than	IN
10_1101-2020_11_24_390039	66	40	either	either	CC
10_1101-2020_11_24_390039	66	41	the	the	DT
10_1101-2020_11_24_390039	66	42	S	S	NNP
10_1101-2020_11_24_390039	66	43	or	or	CC
10_1101-2020_11_24_390039	66	44	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	66	45	proteins	protein	NNS
10_1101-2020_11_24_390039	66	46	(	(	-LRB-
10_1101-2020_11_24_390039	66	47	Fig	fig	NN
10_1101-2020_11_24_390039	66	48	2	2	CD
10_1101-2020_11_24_390039	66	49	,	,	,
10_1101-2020_11_24_390039	66	50	Fig	Fig	NNP
10_1101-2020_11_24_390039	66	51	.	.	.
10_1101-2020_11_24_390039	67	1	S1A	s1a	LS
10_1101-2020_11_24_390039	67	2	)	)	-RRB-
10_1101-2020_11_24_390039	67	3	.	.	.
10_1101-2020_11_24_390039	68	1	In	in	IN
10_1101-2020_11_24_390039	68	2	practice	practice	NN
10_1101-2020_11_24_390039	68	3	,	,	,
10_1101-2020_11_24_390039	68	4	the	the	DT
10_1101-2020_11_24_390039	68	5	potential	potential	JJ
10_1101-2020_11_24_390039	68	6	resistance	resistance	NN
10_1101-2020_11_24_390039	68	7	of	of	IN
10_1101-2020_11_24_390039	68	8	this	this	DT
10_1101-2020_11_24_390039	68	9	highly	highly	RB
10_1101-2020_11_24_390039	68	10	abundant	abundant	JJ
10_1101-2020_11_24_390039	68	11	and	and	CC
10_1101-2020_11_24_390039	68	12	functionally	functionally	RB
10_1101-2020_11_24_390039	68	13	diverse	diverse	JJ
10_1101-2020_11_24_390039	68	14	class	class	NN
10_1101-2020_11_24_390039	68	15	of	of	IN
10_1101-2020_11_24_390039	68	16	endogenous	endogenous	JJ
10_1101-2020_11_24_390039	68	17	multi	multi	JJ
10_1101-2020_11_24_390039	68	18	-	-	JJ
10_1101-2020_11_24_390039	68	19	spanning	span	VBG
10_1101-2020_11_24_390039	68	20	membrane	membrane	NN
10_1101-2020_11_24_390039	68	21	proteins	protein	NNS
10_1101-2020_11_24_390039	68	22	(	(	-LRB-
10_1101-2020_11_24_390039	68	23	von	von	NNP
10_1101-2020_11_24_390039	68	24	Heijne	Heijne	NNP
10_1101-2020_11_24_390039	68	25	,	,	,
10_1101-2020_11_24_390039	68	26	2007	2007	CD
10_1101-2020_11_24_390039	68	27	)	)	-RRB-
10_1101-2020_11_24_390039	68	28	may	may	MD
10_1101-2020_11_24_390039	68	29	limit	limit	VB
10_1101-2020_11_24_390039	68	30	any	any	DT
10_1101-2020_11_24_390039	68	31	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	68	32	-	-	HYPH
10_1101-2020_11_24_390039	68	33	F	F	NNP
10_1101-2020_11_24_390039	68	34	-	-	HYPH
10_1101-2020_11_24_390039	68	35	induced	induce	VBN
10_1101-2020_11_24_390039	68	36	cytotoxicity	cytotoxicity	NN
10_1101-2020_11_24_390039	68	37	towards	towards	IN
10_1101-2020_11_24_390039	68	38	host	host	NN
10_1101-2020_11_24_390039	68	39	cells	cell	NNS
10_1101-2020_11_24_390039	68	40	.	.	.
10_1101-2020_11_24_390039	69	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	69	2	-	-	:
10_1101-2020_11_24_390039	69	3	BY	by	IN
10_1101-2020_11_24_390039	69	4	-	-	HYPH
10_1101-2020_11_24_390039	69	5	ND	ND	NNP
10_1101-2020_11_24_390039	69	6	4.0	4.0	CD
10_1101-2020_11_24_390039	69	7	International	international	JJ
10_1101-2020_11_24_390039	69	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	69	9	available	available	JJ
10_1101-2020_11_24_390039	69	10	under	under	IN
10_1101-2020_11_24_390039	69	11	a	a	DT
10_1101-2020_11_24_390039	69	12	(	(	-LRB-
10_1101-2020_11_24_390039	69	13	which	which	WDT
10_1101-2020_11_24_390039	69	14	was	be	VBD
10_1101-2020_11_24_390039	69	15	not	not	RB
10_1101-2020_11_24_390039	69	16	certified	certify	VBN
10_1101-2020_11_24_390039	69	17	by	by	IN
10_1101-2020_11_24_390039	69	18	peer	peer	NN
10_1101-2020_11_24_390039	69	19	review	review	NN
10_1101-2020_11_24_390039	69	20	)	)	-RRB-
10_1101-2020_11_24_390039	69	21	is	be	VBZ
10_1101-2020_11_24_390039	69	22	the	the	DT
10_1101-2020_11_24_390039	69	23	author	author	NN
10_1101-2020_11_24_390039	69	24	/	/	SYM
10_1101-2020_11_24_390039	69	25	funder	funder	NN
10_1101-2020_11_24_390039	69	26	,	,	,
10_1101-2020_11_24_390039	69	27	who	who	WP
10_1101-2020_11_24_390039	69	28	has	have	VBZ
10_1101-2020_11_24_390039	69	29	granted	grant	VBN
10_1101-2020_11_24_390039	69	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	69	31	a	a	DT
10_1101-2020_11_24_390039	69	32	license	license	NN
10_1101-2020_11_24_390039	69	33	to	to	TO
10_1101-2020_11_24_390039	69	34	display	display	VB
10_1101-2020_11_24_390039	69	35	the	the	DT
10_1101-2020_11_24_390039	69	36	preprint	preprint	NN
10_1101-2020_11_24_390039	69	37	in	in	IN
10_1101-2020_11_24_390039	69	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	69	39	.	.	.
10_1101-2020_11_24_390039	70	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	70	2	is	be	VBZ
10_1101-2020_11_24_390039	70	3	The	the	DT
10_1101-2020_11_24_390039	70	4	copyright	copyright	NN
10_1101-2020_11_24_390039	70	5	holder	holder	NN
10_1101-2020_11_24_390039	70	6	for	for	IN
10_1101-2020_11_24_390039	70	7	this	this	DT
10_1101-2020_11_24_390039	70	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	70	9	version	version	NN
10_1101-2020_11_24_390039	70	10	posted	post	VBD
10_1101-2020_11_24_390039	70	11	January	January	NNP
10_1101-2020_11_24_390039	70	12	5	5	CD
10_1101-2020_11_24_390039	70	13	,	,	,
10_1101-2020_11_24_390039	70	14	2021	2021	CD
10_1101-2020_11_24_390039	70	15	.	.	.
10_1101-2020_11_24_390039	70	16	;	;	:
10_1101-2020_11_24_390039	70	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	70	18	:	:	:
10_1101-2020_11_24_390039	70	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	70	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	70	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	70	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	70	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	70	24	-	-	HYPH
10_1101-2020_11_24_390039	70	25	F	F	NNP
10_1101-2020_11_24_390039	70	26	as	as	IN
10_1101-2020_11_24_390039	70	27	a	a	DT
10_1101-2020_11_24_390039	70	28	potential	potential	JJ
10_1101-2020_11_24_390039	70	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	70	30	agent	agent	NN
10_1101-2020_11_24_390039	70	31	Page	Page	NNP
10_1101-2020_11_24_390039	70	32	6	6	CD
10_1101-2020_11_24_390039	70	33	of	of	IN
10_1101-2020_11_24_390039	70	34	21	21	CD
10_1101-2020_11_24_390039	70	35	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	70	36	assumes	assume	VBZ
10_1101-2020_11_24_390039	70	37	a	a	DT
10_1101-2020_11_24_390039	70	38	lumenal	lumenal	NN
10_1101-2020_11_24_390039	70	39	-	-	HYPH
10_1101-2020_11_24_390039	70	40	facing	face	VBG
10_1101-2020_11_24_390039	70	41	hairpin	hairpin	NN
10_1101-2020_11_24_390039	70	42	topology	topology	NN
10_1101-2020_11_24_390039	70	43	in	in	IN
10_1101-2020_11_24_390039	70	44	ER	ER	NNP
10_1101-2020_11_24_390039	70	45	-	-	HYPH
10_1101-2020_11_24_390039	70	46	derived	derive	VBN
10_1101-2020_11_24_390039	70	47	microsomes	microsome	NNS
10_1101-2020_11_24_390039	70	48	Cell	cell	NN
10_1101-2020_11_24_390039	70	49	-	-	HYPH
10_1101-2020_11_24_390039	70	50	based	base	VBN
10_1101-2020_11_24_390039	70	51	studies	study	NNS
10_1101-2020_11_24_390039	70	52	of	of	IN
10_1101-2020_11_24_390039	70	53	the	the	DT
10_1101-2020_11_24_390039	70	54	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	70	55	protein	protein	NN
10_1101-2020_11_24_390039	70	56	from	from	IN
10_1101-2020_11_24_390039	70	57	SARS	SARS	NNP
10_1101-2020_11_24_390039	70	58	-	-	HYPH
10_1101-2020_11_24_390039	70	59	CoV-1	CoV-1	NNP
10_1101-2020_11_24_390039	70	60	suggest	suggest	VBP
10_1101-2020_11_24_390039	70	61	it	-PRON-	PRP
10_1101-2020_11_24_390039	70	62	has	have	VBZ
10_1101-2020_11_24_390039	70	63	an	an	DT
10_1101-2020_11_24_390039	70	64	unusual	unusual	JJ
10_1101-2020_11_24_390039	70	65	hairpin	hairpin	NN
10_1101-2020_11_24_390039	70	66	topology	topology	NN
10_1101-2020_11_24_390039	70	67	with	with	IN
10_1101-2020_11_24_390039	70	68	both	both	CC
10_1101-2020_11_24_390039	70	69	its	-PRON-	PRP$
10_1101-2020_11_24_390039	70	70	N-	N-	NNP
10_1101-2020_11_24_390039	70	71	and	and	CC
10_1101-2020_11_24_390039	70	72	C	C	NNP
10_1101-2020_11_24_390039	70	73	-	-	HYPH
10_1101-2020_11_24_390039	70	74	termini	termini	NNP
10_1101-2020_11_24_390039	70	75	located	locate	VBN
10_1101-2020_11_24_390039	70	76	on	on	IN
10_1101-2020_11_24_390039	70	77	the	the	DT
10_1101-2020_11_24_390039	70	78	exoplasmic	exoplasmic	JJ
10_1101-2020_11_24_390039	70	79	side	side	NN
10_1101-2020_11_24_390039	70	80	of	of	IN
10_1101-2020_11_24_390039	70	81	the	the	DT
10_1101-2020_11_24_390039	70	82	host	host	NN
10_1101-2020_11_24_390039	70	83	cell	cell	NN
10_1101-2020_11_24_390039	70	84	membrane	membrane	NN
10_1101-2020_11_24_390039	70	85	,	,	,
10_1101-2020_11_24_390039	70	86	to	to	TO
10_1101-2020_11_24_390039	70	87	which	which	WDT
10_1101-2020_11_24_390039	70	88	it	-PRON-	PRP
10_1101-2020_11_24_390039	70	89	binds	bind	VBZ
10_1101-2020_11_24_390039	70	90	via	via	IN
10_1101-2020_11_24_390039	70	91	an	an	DT
10_1101-2020_11_24_390039	70	92	N	N	NNP
10_1101-2020_11_24_390039	70	93	-	-	HYPH
10_1101-2020_11_24_390039	70	94	terminal	terminal	NN
10_1101-2020_11_24_390039	70	95	amphipathic	amphipathic	JJ
10_1101-2020_11_24_390039	70	96	helix	helix	NN
10_1101-2020_11_24_390039	70	97	(	(	-LRB-
10_1101-2020_11_24_390039	70	98	Netland	Netland	NNP
10_1101-2020_11_24_390039	70	99	et	et	NNP
10_1101-2020_11_24_390039	70	100	al	al	NNP
10_1101-2020_11_24_390039	70	101	.	.	NNP
10_1101-2020_11_24_390039	70	102	,	,	,
10_1101-2020_11_24_390039	70	103	2007	2007	CD
10_1101-2020_11_24_390039	70	104	)	)	-RRB-
10_1101-2020_11_24_390039	70	105	.	.	.
10_1101-2020_11_24_390039	71	1	To	to	TO
10_1101-2020_11_24_390039	71	2	independently	independently	RB
10_1101-2020_11_24_390039	71	3	determine	determine	VB
10_1101-2020_11_24_390039	71	4	the	the	DT
10_1101-2020_11_24_390039	71	5	membrane	membrane	NN
10_1101-2020_11_24_390039	71	6	topology	topology	NN
10_1101-2020_11_24_390039	71	7	of	of	IN
10_1101-2020_11_24_390039	71	8	SARS	SARS	NNP
10_1101-2020_11_24_390039	71	9	-	-	HYPH
10_1101-2020_11_24_390039	71	10	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	71	11	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	71	12	,	,	,
10_1101-2020_11_24_390039	71	13	we	-PRON-	PRP
10_1101-2020_11_24_390039	71	14	prepared	prepare	VBD
10_1101-2020_11_24_390039	71	15	versions	version	NNS
10_1101-2020_11_24_390039	71	16	with	with	IN
10_1101-2020_11_24_390039	71	17	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	71	18	tags	tag	NNS
10_1101-2020_11_24_390039	71	19	at	at	IN
10_1101-2020_11_24_390039	71	20	both	both	CC
10_1101-2020_11_24_390039	71	21	its	-PRON-	PRP$
10_1101-2020_11_24_390039	71	22	N-	N-	NNP
10_1101-2020_11_24_390039	71	23	and	and	CC
10_1101-2020_11_24_390039	71	24	C	C	NNP
10_1101-2020_11_24_390039	71	25	-	-	HYPH
10_1101-2020_11_24_390039	71	26	termini	termini	NNP
10_1101-2020_11_24_390039	71	27	,	,	,
10_1101-2020_11_24_390039	71	28	or	or	CC
10_1101-2020_11_24_390039	71	29	single	single	JJ
10_1101-2020_11_24_390039	71	30	tagged	tag	VBN
10_1101-2020_11_24_390039	71	31	equivalents	equivalent	NNS
10_1101-2020_11_24_390039	71	32	(	(	-LRB-
10_1101-2020_11_24_390039	71	33	see	see	VB
10_1101-2020_11_24_390039	71	34	Fig	Fig	NNP
10_1101-2020_11_24_390039	71	35	.	.	.
10_1101-2020_11_24_390039	72	1	2B	2B	NNP
10_1101-2020_11_24_390039	72	2	,	,	,
10_1101-2020_11_24_390039	72	3	schematics	schematic	NNS
10_1101-2020_11_24_390039	72	4	,	,	,
10_1101-2020_11_24_390039	72	5	OPG2-ORF6-	OPG2-ORF6-	NNP
10_1101-2020_11_24_390039	72	6	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	72	7	,	,	,
10_1101-2020_11_24_390039	72	8	OPG2-ORF6	OPG2-ORF6	NNP
10_1101-2020_11_24_390039	72	9	and	and	CC
10_1101-2020_11_24_390039	72	10	ORF6-OPG2	ORF6-OPG2	NNP
10_1101-2020_11_24_390039	72	11	)	)	-RRB-
10_1101-2020_11_24_390039	72	12	.	.	.
10_1101-2020_11_24_390039	73	1	Following	follow	VBG
10_1101-2020_11_24_390039	73	2	membrane	membrane	NN
10_1101-2020_11_24_390039	73	3	insertion	insertion	NN
10_1101-2020_11_24_390039	73	4	,	,	,
10_1101-2020_11_24_390039	73	5	doubly	doubly	RB
10_1101-2020_11_24_390039	73	6	tagged	tag	VBD
10_1101-2020_11_24_390039	73	7	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	73	8	shows	show	VBZ
10_1101-2020_11_24_390039	73	9	significant	significant	JJ
10_1101-2020_11_24_390039	73	10	amounts	amount	NNS
10_1101-2020_11_24_390039	73	11	of	of	IN
10_1101-2020_11_24_390039	73	12	species	specie	NNS
10_1101-2020_11_24_390039	73	13	with	with	IN
10_1101-2020_11_24_390039	73	14	3-	3-	NNPS
10_1101-2020_11_24_390039	73	15	and	and	CC
10_1101-2020_11_24_390039	73	16	4-	4-	NNP
10_1101-2020_11_24_390039	73	17	N	N	NNP
10_1101-2020_11_24_390039	73	18	-	-	HYPH
10_1101-2020_11_24_390039	73	19	linked	link	VBN
10_1101-2020_11_24_390039	73	20	glycans	glycan	NNS
10_1101-2020_11_24_390039	73	21	(	(	-LRB-
10_1101-2020_11_24_390039	73	22	Fig	fig	NN
10_1101-2020_11_24_390039	73	23	.	.	.
10_1101-2020_11_24_390039	74	1	2B	2B	NNP
10_1101-2020_11_24_390039	74	2	)	)	-RRB-
10_1101-2020_11_24_390039	74	3	.	.	.
10_1101-2020_11_24_390039	75	1	This	this	DT
10_1101-2020_11_24_390039	75	2	pattern	pattern	NN
10_1101-2020_11_24_390039	75	3	confirms	confirm	VBZ
10_1101-2020_11_24_390039	75	4	that	that	IN
10_1101-2020_11_24_390039	75	5	the	the	DT
10_1101-2020_11_24_390039	75	6	SARS	SARS	NNP
10_1101-2020_11_24_390039	75	7	-	-	HYPH
10_1101-2020_11_24_390039	75	8	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	75	9	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	75	10	protein	protein	NN
10_1101-2020_11_24_390039	75	11	assumes	assume	VBZ
10_1101-2020_11_24_390039	75	12	a	a	DT
10_1101-2020_11_24_390039	75	13	‘	'	``
10_1101-2020_11_24_390039	75	14	hairpin	hairpin	NN
10_1101-2020_11_24_390039	75	15	’	'	''
10_1101-2020_11_24_390039	75	16	conformation	conformation	NN
10_1101-2020_11_24_390039	75	17	in	in	IN
10_1101-2020_11_24_390039	75	18	the	the	DT
10_1101-2020_11_24_390039	75	19	ER	ER	NNP
10_1101-2020_11_24_390039	75	20	membrane	membrane	NN
10_1101-2020_11_24_390039	75	21	with	with	IN
10_1101-2020_11_24_390039	75	22	both	both	CC
10_1101-2020_11_24_390039	75	23	its	-PRON-	PRP$
10_1101-2020_11_24_390039	75	24	N-	N-	NNP
10_1101-2020_11_24_390039	75	25	and	and	CC
10_1101-2020_11_24_390039	75	26	C	C	NNP
10_1101-2020_11_24_390039	75	27	-	-	HYPH
10_1101-2020_11_24_390039	75	28	termini	termini	NNP
10_1101-2020_11_24_390039	75	29	in	in	IN
10_1101-2020_11_24_390039	75	30	the	the	DT
10_1101-2020_11_24_390039	75	31	lumen	luman	NNS
10_1101-2020_11_24_390039	75	32	(	(	-LRB-
10_1101-2020_11_24_390039	75	33	Fig	fig	NN
10_1101-2020_11_24_390039	75	34	.	.	.
10_1101-2020_11_24_390039	76	1	2B	2B	NNP
10_1101-2020_11_24_390039	76	2	,	,	,
10_1101-2020_11_24_390039	76	3	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	76	4	)	)	-RRB-
10_1101-2020_11_24_390039	76	5	.	.	.
10_1101-2020_11_24_390039	77	1	These	these	DT
10_1101-2020_11_24_390039	77	2	3-	3-	NNS
10_1101-2020_11_24_390039	77	3	and	and	CC
10_1101-2020_11_24_390039	77	4	4-N-	4-n-	CD
10_1101-2020_11_24_390039	77	5	glycan	glycan	JJ
10_1101-2020_11_24_390039	77	6	bearing	bear	VBG
10_1101-2020_11_24_390039	77	7	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	77	8	species	specie	NNS
10_1101-2020_11_24_390039	77	9	are	be	VBP
10_1101-2020_11_24_390039	77	10	also	also	RB
10_1101-2020_11_24_390039	77	11	resistant	resistant	JJ
10_1101-2020_11_24_390039	77	12	to	to	TO
10_1101-2020_11_24_390039	77	13	extraction	extraction	VB
10_1101-2020_11_24_390039	77	14	with	with	IN
10_1101-2020_11_24_390039	77	15	alkaline	alkaline	NN
10_1101-2020_11_24_390039	77	16	sodium	sodium	NN
10_1101-2020_11_24_390039	77	17	carbonate	carbonate	NN
10_1101-2020_11_24_390039	77	18	buffer	buffer	NN
10_1101-2020_11_24_390039	77	19	(	(	-LRB-
10_1101-2020_11_24_390039	77	20	Fig	fig	NN
10_1101-2020_11_24_390039	77	21	.	.	.
10_1101-2020_11_24_390039	78	1	S1D	s1d	LS
10_1101-2020_11_24_390039	78	2	)	)	-RRB-
10_1101-2020_11_24_390039	78	3	and	and	CC
10_1101-2020_11_24_390039	78	4	protected	protect	VBN
10_1101-2020_11_24_390039	78	5	from	from	IN
10_1101-2020_11_24_390039	78	6	added	add	VBN
10_1101-2020_11_24_390039	78	7	protease	protease	NN
10_1101-2020_11_24_390039	78	8	(	(	-LRB-
10_1101-2020_11_24_390039	78	9	Fig	fig	NN
10_1101-2020_11_24_390039	78	10	.	.	.
10_1101-2020_11_24_390039	79	1	S1E	s1e	LS
10_1101-2020_11_24_390039	79	2	)	)	-RRB-
10_1101-2020_11_24_390039	79	3	,	,	,
10_1101-2020_11_24_390039	79	4	further	further	RB
10_1101-2020_11_24_390039	79	5	indicating	indicate	VBG
10_1101-2020_11_24_390039	79	6	that	that	IN
10_1101-2020_11_24_390039	79	7	the	the	DT
10_1101-2020_11_24_390039	79	8	majority	majority	NN
10_1101-2020_11_24_390039	79	9	of	of	IN
10_1101-2020_11_24_390039	79	10	the	the	DT
10_1101-2020_11_24_390039	79	11	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	79	12	protein	protein	NN
10_1101-2020_11_24_390039	79	13	is	be	VBZ
10_1101-2020_11_24_390039	79	14	stably	stably	RB
10_1101-2020_11_24_390039	79	15	associated	associate	VBN
10_1101-2020_11_24_390039	79	16	with	with	IN
10_1101-2020_11_24_390039	79	17	the	the	DT
10_1101-2020_11_24_390039	79	18	ER	ER	NNP
10_1101-2020_11_24_390039	79	19	membrane	membrane	NN
10_1101-2020_11_24_390039	79	20	in	in	IN
10_1101-2020_11_24_390039	79	21	a	a	DT
10_1101-2020_11_24_390039	79	22	‘	'	``
10_1101-2020_11_24_390039	79	23	hairpin	hairpin	NN
10_1101-2020_11_24_390039	79	24	’	'	''
10_1101-2020_11_24_390039	79	25	(	(	-LRB-
10_1101-2020_11_24_390039	79	26	Nexo	Nexo	NNP
10_1101-2020_11_24_390039	79	27	/	/	SYM
10_1101-2020_11_24_390039	79	28	Cexo	Cexo	NNP
10_1101-2020_11_24_390039	79	29	)	)	-RRB-
10_1101-2020_11_24_390039	79	30	topology	topology	NN
10_1101-2020_11_24_390039	79	31	.	.	.
10_1101-2020_11_24_390039	80	1	Consistent	consistent	JJ
10_1101-2020_11_24_390039	80	2	with	with	IN
10_1101-2020_11_24_390039	80	3	this	this	DT
10_1101-2020_11_24_390039	80	4	unusual	unusual	JJ
10_1101-2020_11_24_390039	80	5	membrane	membrane	NN
10_1101-2020_11_24_390039	80	6	topology	topology	NN
10_1101-2020_11_24_390039	80	7	,	,	,
10_1101-2020_11_24_390039	80	8	we	-PRON-	PRP
10_1101-2020_11_24_390039	80	9	find	find	VBP
10_1101-2020_11_24_390039	80	10	no	no	DT
10_1101-2020_11_24_390039	80	11	indication	indication	NN
10_1101-2020_11_24_390039	80	12	that	that	IN
10_1101-2020_11_24_390039	80	13	the	the	DT
10_1101-2020_11_24_390039	80	14	membrane	membrane	NN
10_1101-2020_11_24_390039	80	15	insertion	insertion	NN
10_1101-2020_11_24_390039	80	16	of	of	IN
10_1101-2020_11_24_390039	80	17	any	any	DT
10_1101-2020_11_24_390039	80	18	of	of	IN
10_1101-2020_11_24_390039	80	19	our	-PRON-	PRP$
10_1101-2020_11_24_390039	80	20	OPG2-tagged	OPG2-tagged	NNP
10_1101-2020_11_24_390039	80	21	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	80	22	variants	variant	NNS
10_1101-2020_11_24_390039	80	23	is	be	VBZ
10_1101-2020_11_24_390039	80	24	reduced	reduce	VBN
10_1101-2020_11_24_390039	80	25	by	by	IN
10_1101-2020_11_24_390039	80	26	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	80	27	-	-	HYPH
10_1101-2020_11_24_390039	80	28	F	F	NNP
10_1101-2020_11_24_390039	80	29	,	,	,
10_1101-2020_11_24_390039	80	30	strongly	strongly	RB
10_1101-2020_11_24_390039	80	31	suggesting	suggest	VBG
10_1101-2020_11_24_390039	80	32	that	that	IN
10_1101-2020_11_24_390039	80	33	its	-PRON-	PRP$
10_1101-2020_11_24_390039	80	34	association	association	NN
10_1101-2020_11_24_390039	80	35	with	with	IN
10_1101-2020_11_24_390039	80	36	the	the	DT
10_1101-2020_11_24_390039	80	37	inner	inner	JJ
10_1101-2020_11_24_390039	80	38	leaflet	leaflet	NN
10_1101-2020_11_24_390039	80	39	of	of	IN
10_1101-2020_11_24_390039	80	40	the	the	DT
10_1101-2020_11_24_390039	80	41	ER	ER	NNP
10_1101-2020_11_24_390039	80	42	membrane	membrane	NN
10_1101-2020_11_24_390039	80	43	does	do	VBZ
10_1101-2020_11_24_390039	80	44	not	not	RB
10_1101-2020_11_24_390039	80	45	require	require	VB
10_1101-2020_11_24_390039	80	46	protein	protein	NN
10_1101-2020_11_24_390039	80	47	translocation	translocation	NN
10_1101-2020_11_24_390039	80	48	via	via	IN
10_1101-2020_11_24_390039	80	49	the	the	DT
10_1101-2020_11_24_390039	80	50	central	central	JJ
10_1101-2020_11_24_390039	80	51	channel	channel	NN
10_1101-2020_11_24_390039	80	52	of	of	IN
10_1101-2020_11_24_390039	80	53	the	the	DT
10_1101-2020_11_24_390039	80	54	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	80	55	translocon	translocon	NN
10_1101-2020_11_24_390039	80	56	(	(	-LRB-
10_1101-2020_11_24_390039	80	57	Gérard	Gérard	NNP
10_1101-2020_11_24_390039	80	58	et	et	NNP
10_1101-2020_11_24_390039	80	59	al	al	NNP
10_1101-2020_11_24_390039	80	60	.	.	NNP
10_1101-2020_11_24_390039	80	61	,	,	,
10_1101-2020_11_24_390039	80	62	2020	2020	CD
10_1101-2020_11_24_390039	80	63	;	;	:
10_1101-2020_11_24_390039	80	64	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	80	65	et	et	NNP
10_1101-2020_11_24_390039	80	66	al	al	NNP
10_1101-2020_11_24_390039	80	67	.	.	NNP
10_1101-2020_11_24_390039	80	68	,	,	,
10_1101-2020_11_24_390039	80	69	2020	2020	CD
10_1101-2020_11_24_390039	80	70	submitted	submit	VBN
10_1101-2020_11_24_390039	80	71	)	)	-RRB-
10_1101-2020_11_24_390039	80	72	.	.	.
10_1101-2020_11_24_390039	81	1	We	-PRON-	PRP
10_1101-2020_11_24_390039	81	2	noted	note	VBD
10_1101-2020_11_24_390039	81	3	a	a	DT
10_1101-2020_11_24_390039	81	4	sub	sub	NN
10_1101-2020_11_24_390039	81	5	-	-	HYPH
10_1101-2020_11_24_390039	81	6	set	set	NN
10_1101-2020_11_24_390039	81	7	of	of	IN
10_1101-2020_11_24_390039	81	8	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	81	9	species	specie	NNS
10_1101-2020_11_24_390039	81	10	bearing	bear	VBG
10_1101-2020_11_24_390039	81	11	only	only	RB
10_1101-2020_11_24_390039	81	12	a	a	DT
10_1101-2020_11_24_390039	81	13	single	single	JJ
10_1101-2020_11_24_390039	81	14	N	N	NNP
10_1101-2020_11_24_390039	81	15	-	-	HYPH
10_1101-2020_11_24_390039	81	16	glycan	glycan	NNP
10_1101-2020_11_24_390039	81	17	was	be	VBD
10_1101-2020_11_24_390039	81	18	also	also	RB
10_1101-2020_11_24_390039	81	19	clearly	clearly	RB
10_1101-2020_11_24_390039	81	20	present	present	JJ
10_1101-2020_11_24_390039	81	21	in	in	IN
10_1101-2020_11_24_390039	81	22	the	the	DT
10_1101-2020_11_24_390039	81	23	membrane	membrane	NN
10_1101-2020_11_24_390039	81	24	-	-	HYPH
10_1101-2020_11_24_390039	81	25	associated	associate	VBN
10_1101-2020_11_24_390039	81	26	fraction	fraction	NN
10_1101-2020_11_24_390039	81	27	with	with	IN
10_1101-2020_11_24_390039	81	28	or	or	CC
10_1101-2020_11_24_390039	81	29	without	without	IN
10_1101-2020_11_24_390039	81	30	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	81	31	-	-	HYPH
10_1101-2020_11_24_390039	81	32	F	F	NNP
10_1101-2020_11_24_390039	81	33	treatment	treatment	NN
10_1101-2020_11_24_390039	81	34	(	(	-LRB-
10_1101-2020_11_24_390039	81	35	Fig	fig	NN
10_1101-2020_11_24_390039	81	36	.	.	.
10_1101-2020_11_24_390039	82	1	2B	2B	NNP
10_1101-2020_11_24_390039	82	2	,	,	,
10_1101-2020_11_24_390039	82	3	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	82	4	,	,	,
10_1101-2020_11_24_390039	82	5	see	see	VB
10_1101-2020_11_24_390039	82	6	1Gly	1gly	CD
10_1101-2020_11_24_390039	82	7	)	)	-RRB-
10_1101-2020_11_24_390039	82	8	.	.	.
10_1101-2020_11_24_390039	83	1	Based	base	VBN
10_1101-2020_11_24_390039	83	2	on	on	IN
10_1101-2020_11_24_390039	83	3	comparison	comparison	NN
10_1101-2020_11_24_390039	83	4	to	to	TO
10_1101-2020_11_24_390039	83	5	singly	singly	RB
10_1101-2020_11_24_390039	83	6	OPG2-tagged	opg2-tagged	JJ
10_1101-2020_11_24_390039	83	7	variants	variant	NNS
10_1101-2020_11_24_390039	83	8	(	(	-LRB-
10_1101-2020_11_24_390039	83	9	Fig	fig	NN
10_1101-2020_11_24_390039	83	10	.	.	.
10_1101-2020_11_24_390039	84	1	2B	2B	NNP
10_1101-2020_11_24_390039	84	2	)	)	-RRB-
10_1101-2020_11_24_390039	84	3	,	,	,
10_1101-2020_11_24_390039	84	4	we	-PRON-	PRP
10_1101-2020_11_24_390039	84	5	conclude	conclude	VBP
10_1101-2020_11_24_390039	84	6	that	that	IN
10_1101-2020_11_24_390039	84	7	OPG2-ORF6-OPG2-	OPG2-ORF6-OPG2-	NNP
10_1101-2020_11_24_390039	84	8	1Gly	1gly	CD
10_1101-2020_11_24_390039	84	9	has	have	VBZ
10_1101-2020_11_24_390039	84	10	its	-PRON-	PRP$
10_1101-2020_11_24_390039	84	11	N	n	NN
10_1101-2020_11_24_390039	84	12	-	-	HYPH
10_1101-2020_11_24_390039	84	13	terminus	terminus	NN
10_1101-2020_11_24_390039	84	14	in	in	IN
10_1101-2020_11_24_390039	84	15	the	the	DT
10_1101-2020_11_24_390039	84	16	ER	ER	NNP
10_1101-2020_11_24_390039	84	17	lumen	luman	NNS
10_1101-2020_11_24_390039	84	18	,	,	,
10_1101-2020_11_24_390039	84	19	where	where	WRB
10_1101-2020_11_24_390039	84	20	only	only	RB
10_1101-2020_11_24_390039	84	21	one	one	CD
10_1101-2020_11_24_390039	84	22	of	of	IN
10_1101-2020_11_24_390039	84	23	its	-PRON-	PRP$
10_1101-2020_11_24_390039	84	24	two	two	CD
10_1101-2020_11_24_390039	84	25	consensus	consensus	NN
10_1101-2020_11_24_390039	84	26	sites	site	NNS
10_1101-2020_11_24_390039	84	27	is	be	VBZ
10_1101-2020_11_24_390039	84	28	efficiently	efficiently	RB
10_1101-2020_11_24_390039	84	29	N	n	NN
10_1101-2020_11_24_390039	84	30	-	-	HYPH
10_1101-2020_11_24_390039	84	31	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	84	32	(	(	-LRB-
10_1101-2020_11_24_390039	84	33	cf	cf	NN
10_1101-2020_11_24_390039	84	34	.	.	.
10_1101-2020_11_24_390039	85	1	Nilsson	Nilsson	NNP
10_1101-2020_11_24_390039	85	2	and	and	CC
10_1101-2020_11_24_390039	85	3	von	von	NNP
10_1101-2020_11_24_390039	85	4	Heijne	Heijne	NNP
10_1101-2020_11_24_390039	85	5	,	,	,
10_1101-2020_11_24_390039	85	6	1993	1993	CD
10_1101-2020_11_24_390039	85	7	)	)	-RRB-
10_1101-2020_11_24_390039	85	8	,	,	,
10_1101-2020_11_24_390039	85	9	whilst	whilst	IN
10_1101-2020_11_24_390039	85	10	its	-PRON-	PRP$
10_1101-2020_11_24_390039	85	11	C-	C-	NNP
10_1101-2020_11_24_390039	85	12	terminus	terminus	NN
10_1101-2020_11_24_390039	85	13	is	be	VBZ
10_1101-2020_11_24_390039	85	14	either	either	CC
10_1101-2020_11_24_390039	85	15	ER	ER	NNP
10_1101-2020_11_24_390039	85	16	luminal	luminal	JJ
10_1101-2020_11_24_390039	85	17	but	but	CC
10_1101-2020_11_24_390039	85	18	non	non	JJ
10_1101-2020_11_24_390039	85	19	-	-	JJ
10_1101-2020_11_24_390039	85	20	glycosylated	glycosylated	JJ
10_1101-2020_11_24_390039	85	21	or	or	CC
10_1101-2020_11_24_390039	85	22	remains	remain	VBZ
10_1101-2020_11_24_390039	85	23	on	on	IN
10_1101-2020_11_24_390039	85	24	the	the	DT
10_1101-2020_11_24_390039	85	25	cytosolic	cytosolic	JJ
10_1101-2020_11_24_390039	85	26	side	side	NN
10_1101-2020_11_24_390039	85	27	of	of	IN
10_1101-2020_11_24_390039	85	28	the	the	DT
10_1101-2020_11_24_390039	85	29	membrane	membrane	NN
10_1101-2020_11_24_390039	85	30	.	.	.
10_1101-2020_11_24_390039	86	1	In	in	IN
10_1101-2020_11_24_390039	86	2	the	the	DT
10_1101-2020_11_24_390039	86	3	latter	latter	JJ
10_1101-2020_11_24_390039	86	4	case	case	NN
10_1101-2020_11_24_390039	86	5	,	,	,
10_1101-2020_11_24_390039	86	6	it	-PRON-	PRP
10_1101-2020_11_24_390039	86	7	may	may	MD
10_1101-2020_11_24_390039	86	8	be	be	VB
10_1101-2020_11_24_390039	86	9	that	that	IN
10_1101-2020_11_24_390039	86	10	,	,	,
10_1101-2020_11_24_390039	86	11	in	in	IN
10_1101-2020_11_24_390039	86	12	addition	addition	NN
10_1101-2020_11_24_390039	86	13	to	to	IN
10_1101-2020_11_24_390039	86	14	its	-PRON-	PRP$
10_1101-2020_11_24_390039	86	15	hairpin	hairpin	NN
10_1101-2020_11_24_390039	86	16	topology	topology	NN
10_1101-2020_11_24_390039	86	17	,	,	,
10_1101-2020_11_24_390039	86	18	some	some	DT
10_1101-2020_11_24_390039	86	19	fraction	fraction	NN
10_1101-2020_11_24_390039	86	20	of	of	IN
10_1101-2020_11_24_390039	86	21	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	86	22	may	may	MD
10_1101-2020_11_24_390039	86	23	be	be	VB
10_1101-2020_11_24_390039	86	24	integrated	integrate	VBN
10_1101-2020_11_24_390039	86	25	into	into	IN
10_1101-2020_11_24_390039	86	26	ER	ER	NNP
10_1101-2020_11_24_390039	86	27	-	-	HYPH
10_1101-2020_11_24_390039	86	28	derived	derive	VBN
10_1101-2020_11_24_390039	86	29	microsomes	microsome	NNS
10_1101-2020_11_24_390039	86	30	as	as	IN
10_1101-2020_11_24_390039	86	31	a	a	DT
10_1101-2020_11_24_390039	86	32	type	type	NN
10_1101-2020_11_24_390039	86	33	III	iii	CD
10_1101-2020_11_24_390039	86	34	TMP	TMP	NNP
10_1101-2020_11_24_390039	86	35	(	(	-LRB-
10_1101-2020_11_24_390039	86	36	cf	cf	NN
10_1101-2020_11_24_390039	86	37	.	.	.
10_1101-2020_11_24_390039	87	1	Fig	fig	NN
10_1101-2020_11_24_390039	87	2	.	.	.
10_1101-2020_11_24_390039	88	1	S2E	s2e	LS
10_1101-2020_11_24_390039	88	2	;	;	:
10_1101-2020_11_24_390039	88	3	see	see	VB
10_1101-2020_11_24_390039	88	4	also	also	RB
10_1101-2020_11_24_390039	88	5	Netland	Netland	NNP
10_1101-2020_11_24_390039	88	6	et	et	FW
10_1101-2020_11_24_390039	88	7	al	al	NNP
10_1101-2020_11_24_390039	88	8	.	.	NNP
10_1101-2020_11_24_390039	88	9	,	,	,
10_1101-2020_11_24_390039	88	10	2007	2007	CD
10_1101-2020_11_24_390039	88	11	)	)	-RRB-
10_1101-2020_11_24_390039	88	12	that	that	WDT
10_1101-2020_11_24_390039	88	13	is	be	VBZ
10_1101-2020_11_24_390039	88	14	resistant	resistant	JJ
10_1101-2020_11_24_390039	88	15	to	to	IN
10_1101-2020_11_24_390039	88	16	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	88	17	-	-	HYPH
10_1101-2020_11_24_390039	88	18	F	F	NNP
10_1101-2020_11_24_390039	88	19	inhibition	inhibition	NN
10_1101-2020_11_24_390039	88	20	(	(	-LRB-
10_1101-2020_11_24_390039	88	21	this	this	DT
10_1101-2020_11_24_390039	88	22	study	study	NN
10_1101-2020_11_24_390039	88	23	;	;	:
10_1101-2020_11_24_390039	88	24	Zong	Zong	NNP
10_1101-2020_11_24_390039	88	25	et	et	NNP
10_1101-2020_11_24_390039	88	26	al	al	NNP
10_1101-2020_11_24_390039	88	27	.	.	NNP
10_1101-2020_11_24_390039	88	28	,	,	,
10_1101-2020_11_24_390039	88	29	2019	2019	CD
10_1101-2020_11_24_390039	88	30	;	;	:
10_1101-2020_11_24_390039	88	31	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	88	32	et	et	NNP
10_1101-2020_11_24_390039	88	33	al	al	NNP
10_1101-2020_11_24_390039	88	34	.	.	NNP
10_1101-2020_11_24_390039	88	35	,	,	,
10_1101-2020_11_24_390039	88	36	2020	2020	CD
10_1101-2020_11_24_390039	88	37	submitted	submit	VBN
10_1101-2020_11_24_390039	88	38	)	)	-RRB-
10_1101-2020_11_24_390039	88	39	.	.	.
10_1101-2020_11_24_390039	89	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	89	2	-	-	:
10_1101-2020_11_24_390039	89	3	BY	by	IN
10_1101-2020_11_24_390039	89	4	-	-	HYPH
10_1101-2020_11_24_390039	89	5	ND	ND	NNP
10_1101-2020_11_24_390039	89	6	4.0	4.0	CD
10_1101-2020_11_24_390039	89	7	International	international	JJ
10_1101-2020_11_24_390039	89	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	89	9	available	available	JJ
10_1101-2020_11_24_390039	89	10	under	under	IN
10_1101-2020_11_24_390039	89	11	a	a	DT
10_1101-2020_11_24_390039	89	12	(	(	-LRB-
10_1101-2020_11_24_390039	89	13	which	which	WDT
10_1101-2020_11_24_390039	89	14	was	be	VBD
10_1101-2020_11_24_390039	89	15	not	not	RB
10_1101-2020_11_24_390039	89	16	certified	certify	VBN
10_1101-2020_11_24_390039	89	17	by	by	IN
10_1101-2020_11_24_390039	89	18	peer	peer	NN
10_1101-2020_11_24_390039	89	19	review	review	NN
10_1101-2020_11_24_390039	89	20	)	)	-RRB-
10_1101-2020_11_24_390039	89	21	is	be	VBZ
10_1101-2020_11_24_390039	89	22	the	the	DT
10_1101-2020_11_24_390039	89	23	author	author	NN
10_1101-2020_11_24_390039	89	24	/	/	SYM
10_1101-2020_11_24_390039	89	25	funder	funder	NN
10_1101-2020_11_24_390039	89	26	,	,	,
10_1101-2020_11_24_390039	89	27	who	who	WP
10_1101-2020_11_24_390039	89	28	has	have	VBZ
10_1101-2020_11_24_390039	89	29	granted	grant	VBN
10_1101-2020_11_24_390039	89	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	89	31	a	a	DT
10_1101-2020_11_24_390039	89	32	license	license	NN
10_1101-2020_11_24_390039	89	33	to	to	TO
10_1101-2020_11_24_390039	89	34	display	display	VB
10_1101-2020_11_24_390039	89	35	the	the	DT
10_1101-2020_11_24_390039	89	36	preprint	preprint	NN
10_1101-2020_11_24_390039	89	37	in	in	IN
10_1101-2020_11_24_390039	89	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	89	39	.	.	.
10_1101-2020_11_24_390039	90	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	90	2	is	be	VBZ
10_1101-2020_11_24_390039	90	3	The	the	DT
10_1101-2020_11_24_390039	90	4	copyright	copyright	NN
10_1101-2020_11_24_390039	90	5	holder	holder	NN
10_1101-2020_11_24_390039	90	6	for	for	IN
10_1101-2020_11_24_390039	90	7	this	this	DT
10_1101-2020_11_24_390039	90	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	90	9	version	version	NN
10_1101-2020_11_24_390039	90	10	posted	post	VBD
10_1101-2020_11_24_390039	90	11	January	January	NNP
10_1101-2020_11_24_390039	90	12	5	5	CD
10_1101-2020_11_24_390039	90	13	,	,	,
10_1101-2020_11_24_390039	90	14	2021	2021	CD
10_1101-2020_11_24_390039	90	15	.	.	.
10_1101-2020_11_24_390039	90	16	;	;	:
10_1101-2020_11_24_390039	90	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	90	18	:	:	:
10_1101-2020_11_24_390039	90	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	90	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	90	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	90	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	90	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	90	24	-	-	HYPH
10_1101-2020_11_24_390039	90	25	F	F	NNP
10_1101-2020_11_24_390039	90	26	as	as	IN
10_1101-2020_11_24_390039	90	27	a	a	DT
10_1101-2020_11_24_390039	90	28	potential	potential	JJ
10_1101-2020_11_24_390039	90	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	90	30	agent	agent	NN
10_1101-2020_11_24_390039	90	31	Page	Page	NNP
10_1101-2020_11_24_390039	90	32	7	7	CD
10_1101-2020_11_24_390039	90	33	of	of	IN
10_1101-2020_11_24_390039	90	34	21	21	CD
10_1101-2020_11_24_390039	90	35	The	the	DT
10_1101-2020_11_24_390039	90	36	molecular	molecular	JJ
10_1101-2020_11_24_390039	90	37	basis	basis	NN
10_1101-2020_11_24_390039	90	38	for	for	IN
10_1101-2020_11_24_390039	90	39	SARS	SARS	NNP
10_1101-2020_11_24_390039	90	40	-	-	HYPH
10_1101-2020_11_24_390039	90	41	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	90	42	protein	protein	NN
10_1101-2020_11_24_390039	90	43	sensitivity	sensitivity	NN
10_1101-2020_11_24_390039	90	44	to	to	IN
10_1101-2020_11_24_390039	90	45	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	90	46	-	-	HYPH
10_1101-2020_11_24_390039	90	47	F	F	NNP
10_1101-2020_11_24_390039	90	48	Having	have	VBG
10_1101-2020_11_24_390039	90	49	ascertained	ascertain	VBN
10_1101-2020_11_24_390039	90	50	that	that	IN
10_1101-2020_11_24_390039	90	51	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	90	52	-	-	HYPH
10_1101-2020_11_24_390039	90	53	F	F	NNP
10_1101-2020_11_24_390039	90	54	inhibits	inhibit	VBZ
10_1101-2020_11_24_390039	90	55	the	the	DT
10_1101-2020_11_24_390039	90	56	ER	ER	NNP
10_1101-2020_11_24_390039	90	57	membrane	membrane	NN
10_1101-2020_11_24_390039	90	58	translocation	translocation	NN
10_1101-2020_11_24_390039	90	59	/	/	SYM
10_1101-2020_11_24_390039	90	60	insertion	insertion	NN
10_1101-2020_11_24_390039	90	61	of	of	IN
10_1101-2020_11_24_390039	90	62	the	the	DT
10_1101-2020_11_24_390039	90	63	viral	viral	JJ
10_1101-2020_11_24_390039	90	64	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	90	65	and	and	CC
10_1101-2020_11_24_390039	90	66	S	S	NNP
10_1101-2020_11_24_390039	90	67	proteins	protein	NNS
10_1101-2020_11_24_390039	90	68	,	,	,
10_1101-2020_11_24_390039	90	69	but	but	CC
10_1101-2020_11_24_390039	90	70	not	not	RB
10_1101-2020_11_24_390039	90	71	of	of	IN
10_1101-2020_11_24_390039	90	72	the	the	DT
10_1101-2020_11_24_390039	90	73	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	90	74	,	,	,
10_1101-2020_11_24_390039	90	75	E	E	NNP
10_1101-2020_11_24_390039	90	76	or	or	CC
10_1101-2020_11_24_390039	90	77	M	M	NNP
10_1101-2020_11_24_390039	90	78	proteins	protein	NNS
10_1101-2020_11_24_390039	90	79	(	(	-LRB-
10_1101-2020_11_24_390039	90	80	Fig	fig	NN
10_1101-2020_11_24_390039	90	81	.	.	.
10_1101-2020_11_24_390039	91	1	2C	2C	NNP
10_1101-2020_11_24_390039	91	2	)	)	-RRB-
10_1101-2020_11_24_390039	91	3	,	,	,
10_1101-2020_11_24_390039	91	4	we	-PRON-	PRP
10_1101-2020_11_24_390039	91	5	next	next	RB
10_1101-2020_11_24_390039	91	6	investigated	investigate	VBD
10_1101-2020_11_24_390039	91	7	the	the	DT
10_1101-2020_11_24_390039	91	8	molecular	molecular	JJ
10_1101-2020_11_24_390039	91	9	basis	basis	NN
10_1101-2020_11_24_390039	91	10	for	for	IN
10_1101-2020_11_24_390039	91	11	this	this	DT
10_1101-2020_11_24_390039	91	12	selectivity	selectivity	NN
10_1101-2020_11_24_390039	91	13	.	.	.
10_1101-2020_11_24_390039	92	1	For	for	IN
10_1101-2020_11_24_390039	92	2	these	these	DT
10_1101-2020_11_24_390039	92	3	studies	study	NNS
10_1101-2020_11_24_390039	92	4	we	-PRON-	PRP
10_1101-2020_11_24_390039	92	5	employed	employ	VBD
10_1101-2020_11_24_390039	92	6	semi	semi	RB
10_1101-2020_11_24_390039	92	7	-	-	JJ
10_1101-2020_11_24_390039	92	8	permeabilised	permeabilised	JJ
10_1101-2020_11_24_390039	92	9	(	(	-LRB-
10_1101-2020_11_24_390039	92	10	SP	SP	NNP
10_1101-2020_11_24_390039	92	11	)	)	-RRB-
10_1101-2020_11_24_390039	92	12	mammalian	mammalian	JJ
10_1101-2020_11_24_390039	92	13	cells	cell	NNS
10_1101-2020_11_24_390039	92	14	,	,	,
10_1101-2020_11_24_390039	92	15	depleted	deplete	VBN
10_1101-2020_11_24_390039	92	16	of	of	IN
10_1101-2020_11_24_390039	92	17	specific	specific	JJ
10_1101-2020_11_24_390039	92	18	membrane	membrane	NN
10_1101-2020_11_24_390039	92	19	components	component	NNS
10_1101-2020_11_24_390039	92	20	via	via	IN
10_1101-2020_11_24_390039	92	21	siRNA	sirna	NN
10_1101-2020_11_24_390039	92	22	-	-	HYPH
10_1101-2020_11_24_390039	92	23	mediated	mediate	VBN
10_1101-2020_11_24_390039	92	24	knockdown	knockdown	VBN
10_1101-2020_11_24_390039	92	25	,	,	,
10_1101-2020_11_24_390039	92	26	as	as	IN
10_1101-2020_11_24_390039	92	27	our	-PRON-	PRP$
10_1101-2020_11_24_390039	92	28	source	source	NN
10_1101-2020_11_24_390039	92	29	of	of	IN
10_1101-2020_11_24_390039	92	30	ER	ER	NNP
10_1101-2020_11_24_390039	92	31	membrane	membrane	NN
10_1101-2020_11_24_390039	92	32	(	(	-LRB-
10_1101-2020_11_24_390039	92	33	Fig	fig	NN
10_1101-2020_11_24_390039	92	34	.	.	.
10_1101-2020_11_24_390039	93	1	3A	3A	NNP
10_1101-2020_11_24_390039	93	2	;	;	:
10_1101-2020_11_24_390039	93	3	Wilson	Wilson	NNP
10_1101-2020_11_24_390039	93	4	et	et	NNP
10_1101-2020_11_24_390039	93	5	al	al	NNP
10_1101-2020_11_24_390039	93	6	.	.	NNP
10_1101-2020_11_24_390039	93	7	,	,	,
10_1101-2020_11_24_390039	93	8	2007	2007	CD
10_1101-2020_11_24_390039	93	9	)	)	-RRB-
10_1101-2020_11_24_390039	93	10	.	.	.
10_1101-2020_11_24_390039	94	1	Consistent	consistent	JJ
10_1101-2020_11_24_390039	94	2	with	with	IN
10_1101-2020_11_24_390039	94	3	our	-PRON-	PRP$
10_1101-2020_11_24_390039	94	4	recent	recent	JJ
10_1101-2020_11_24_390039	94	5	work	work	NN
10_1101-2020_11_24_390039	94	6	(	(	-LRB-
10_1101-2020_11_24_390039	94	7	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	94	8	et	et	NNP
10_1101-2020_11_24_390039	94	9	al	al	NNP
10_1101-2020_11_24_390039	94	10	.	.	NNP
10_1101-2020_11_24_390039	94	11	,	,	,
10_1101-2020_11_24_390039	94	12	2020	2020	CD
10_1101-2020_11_24_390039	94	13	submitted	submit	VBN
10_1101-2020_11_24_390039	94	14	)	)	-RRB-
10_1101-2020_11_24_390039	94	15	,	,	,
10_1101-2020_11_24_390039	94	16	and	and	CC
10_1101-2020_11_24_390039	94	17	based	base	VBN
10_1101-2020_11_24_390039	94	18	on	on	IN
10_1101-2020_11_24_390039	94	19	the	the	DT
10_1101-2020_11_24_390039	94	20	quantitative	quantitative	JJ
10_1101-2020_11_24_390039	94	21	immunoblotting	immunoblotting	NN
10_1101-2020_11_24_390039	94	22	of	of	IN
10_1101-2020_11_24_390039	94	23	target	target	NN
10_1101-2020_11_24_390039	94	24	and	and	CC
10_1101-2020_11_24_390039	94	25	control	control	NN
10_1101-2020_11_24_390039	94	26	gene	gene	NN
10_1101-2020_11_24_390039	94	27	products	product	NNS
10_1101-2020_11_24_390039	94	28	(	(	-LRB-
10_1101-2020_11_24_390039	94	29	Fig	fig	NN
10_1101-2020_11_24_390039	94	30	.	.	.
10_1101-2020_11_24_390039	95	1	S2A	S2A	NNP
10_1101-2020_11_24_390039	95	2	-	-	HYPH
10_1101-2020_11_24_390039	95	3	C	C	NNP
10_1101-2020_11_24_390039	95	4	)	)	-RRB-
10_1101-2020_11_24_390039	95	5	,	,	,
10_1101-2020_11_24_390039	95	6	we	-PRON-	PRP
10_1101-2020_11_24_390039	95	7	selectively	selectively	RB
10_1101-2020_11_24_390039	95	8	depleted	deplete	VBD
10_1101-2020_11_24_390039	95	9	HeLa	HeLa	NNP
10_1101-2020_11_24_390039	95	10	cells	cell	NNS
10_1101-2020_11_24_390039	95	11	for	for	IN
10_1101-2020_11_24_390039	95	12	core	core	JJ
10_1101-2020_11_24_390039	95	13	components	component	NNS
10_1101-2020_11_24_390039	95	14	of	of	IN
10_1101-2020_11_24_390039	95	15	the	the	DT
10_1101-2020_11_24_390039	95	16	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	95	17	translocon	translocon	NN
10_1101-2020_11_24_390039	95	18	(	(	-LRB-
10_1101-2020_11_24_390039	95	19	Sec61α	Sec61α	NNP
10_1101-2020_11_24_390039	95	20	-	-	HYPH
10_1101-2020_11_24_390039	95	21	kd	kd	NNP
10_1101-2020_11_24_390039	95	22	,	,	,
10_1101-2020_11_24_390039	95	23	~65	~65	NFP
10_1101-2020_11_24_390039	95	24	%	%	NN
10_1101-2020_11_24_390039	95	25	reduction	reduction	NN
10_1101-2020_11_24_390039	95	26	)	)	-RRB-
10_1101-2020_11_24_390039	95	27	,	,	,
10_1101-2020_11_24_390039	95	28	the	the	DT
10_1101-2020_11_24_390039	95	29	EMC	EMC	NNP
10_1101-2020_11_24_390039	95	30	(	(	-LRB-
10_1101-2020_11_24_390039	95	31	EMC5-kd	EMC5-kd	NNP
10_1101-2020_11_24_390039	95	32	,	,	,
10_1101-2020_11_24_390039	95	33	~73	~73	.
10_1101-2020_11_24_390039	95	34	%	%	NN
10_1101-2020_11_24_390039	95	35	reduction	reduction	NN
10_1101-2020_11_24_390039	95	36	)	)	-RRB-
10_1101-2020_11_24_390039	95	37	and	and	CC
10_1101-2020_11_24_390039	95	38	both	both	CC
10_1101-2020_11_24_390039	95	39	together	together	RB
10_1101-2020_11_24_390039	95	40	(	(	-LRB-
10_1101-2020_11_24_390039	95	41	Sec61α+EMC5-kd	Sec61α+EMC5-kd	NNS
10_1101-2020_11_24_390039	95	42	,	,	,
10_1101-2020_11_24_390039	95	43	~68	~68	.
10_1101-2020_11_24_390039	95	44	%	%	NN
10_1101-2020_11_24_390039	95	45	and	and	CC
10_1101-2020_11_24_390039	95	46	~78	~78	NFP
10_1101-2020_11_24_390039	95	47	%	%	NN
10_1101-2020_11_24_390039	95	48	reduction	reduction	NNP
10_1101-2020_11_24_390039	95	49	)	)	-RRB-
10_1101-2020_11_24_390039	95	50	prior	prior	RB
10_1101-2020_11_24_390039	95	51	to	to	IN
10_1101-2020_11_24_390039	95	52	semi	semi	JJ
10_1101-2020_11_24_390039	95	53	-	-	NN
10_1101-2020_11_24_390039	95	54	permeabilisation	permeabilisation	NN
10_1101-2020_11_24_390039	95	55	with	with	IN
10_1101-2020_11_24_390039	95	56	digitonin	digitonin	NN
10_1101-2020_11_24_390039	95	57	and	and	CC
10_1101-2020_11_24_390039	95	58	use	use	NN
10_1101-2020_11_24_390039	95	59	for	for	IN
10_1101-2020_11_24_390039	95	60	in	in	FW
10_1101-2020_11_24_390039	95	61	vitro	vitro	FW
10_1101-2020_11_24_390039	95	62	ER	ER	NNP
10_1101-2020_11_24_390039	95	63	translocation	translocation	NN
10_1101-2020_11_24_390039	95	64	assays	assays	RB
10_1101-2020_11_24_390039	95	65	.	.	.
10_1101-2020_11_24_390039	96	1	Following	follow	VBG
10_1101-2020_11_24_390039	96	2	the	the	DT
10_1101-2020_11_24_390039	96	3	analysis	analysis	NN
10_1101-2020_11_24_390039	96	4	of	of	IN
10_1101-2020_11_24_390039	96	5	total	total	JJ
10_1101-2020_11_24_390039	96	6	OPG2-tagged	opg2-tagged	JJ
10_1101-2020_11_24_390039	96	7	translation	translation	NN
10_1101-2020_11_24_390039	96	8	products	product	NNS
10_1101-2020_11_24_390039	96	9	recovered	recover	VBN
10_1101-2020_11_24_390039	96	10	by	by	IN
10_1101-2020_11_24_390039	96	11	immunoprecipitation	immunoprecipitation	NN
10_1101-2020_11_24_390039	96	12	,	,	,
10_1101-2020_11_24_390039	96	13	we	-PRON-	PRP
10_1101-2020_11_24_390039	96	14	found	find	VBD
10_1101-2020_11_24_390039	96	15	that	that	DT
10_1101-2020_11_24_390039	96	16	:	:	:
10_1101-2020_11_24_390039	96	17	i	i	PRP
10_1101-2020_11_24_390039	96	18	)	)	-RRB-
10_1101-2020_11_24_390039	96	19	the	the	DT
10_1101-2020_11_24_390039	96	20	S	S	NNP
10_1101-2020_11_24_390039	96	21	protein	protein	NN
10_1101-2020_11_24_390039	96	22	and	and	CC
10_1101-2020_11_24_390039	96	23	a	a	DT
10_1101-2020_11_24_390039	96	24	truncated	truncate	VBN
10_1101-2020_11_24_390039	96	25	derivative	derivative	NN
10_1101-2020_11_24_390039	96	26	were	be	VBD
10_1101-2020_11_24_390039	96	27	both	both	DT
10_1101-2020_11_24_390039	96	28	more	more	RBR
10_1101-2020_11_24_390039	96	29	strongly	strongly	RB
10_1101-2020_11_24_390039	96	30	affected	affect	VBN
10_1101-2020_11_24_390039	96	31	by	by	IN
10_1101-2020_11_24_390039	96	32	the	the	DT
10_1101-2020_11_24_390039	96	33	depletion	depletion	NN
10_1101-2020_11_24_390039	96	34	of	of	IN
10_1101-2020_11_24_390039	96	35	Sec61α	Sec61α	NNP
10_1101-2020_11_24_390039	96	36	than	than	IN
10_1101-2020_11_24_390039	96	37	of	of	IN
10_1101-2020_11_24_390039	96	38	EMC5	EMC5	NNP
10_1101-2020_11_24_390039	96	39	(	(	-LRB-
10_1101-2020_11_24_390039	96	40	Fig	Fig	NNP
10_1101-2020_11_24_390039	96	41	.	.	.
10_1101-2020_11_24_390039	97	1	3B	3B	NNP
10_1101-2020_11_24_390039	97	2	,	,	,
10_1101-2020_11_24_390039	97	3	Fig	Fig	NNP
10_1101-2020_11_24_390039	97	4	.	.	.
10_1101-2020_11_24_390039	98	1	S2D	s2d	LS
10_1101-2020_11_24_390039	98	2	)	)	-RRB-
10_1101-2020_11_24_390039	98	3	;	;	:
10_1101-2020_11_24_390039	98	4	ii	ii	LS
10_1101-2020_11_24_390039	98	5	)	)	-RRB-
10_1101-2020_11_24_390039	98	6	the	the	DT
10_1101-2020_11_24_390039	98	7	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	98	8	protein	protein	NN
10_1101-2020_11_24_390039	98	9	was	be	VBD
10_1101-2020_11_24_390039	98	10	likewise	likewise	RB
10_1101-2020_11_24_390039	98	11	strongly	strongly	RB
10_1101-2020_11_24_390039	98	12	affected	affect	VBN
10_1101-2020_11_24_390039	98	13	by	by	IN
10_1101-2020_11_24_390039	98	14	Sec61α	sec61α	CD
10_1101-2020_11_24_390039	98	15	depletion	depletion	NN
10_1101-2020_11_24_390039	98	16	but	but	CC
10_1101-2020_11_24_390039	98	17	also	also	RB
10_1101-2020_11_24_390039	98	18	sensitive	sensitive	JJ
10_1101-2020_11_24_390039	98	19	to	to	IN
10_1101-2020_11_24_390039	98	20	EMC5	EMC5	NNP
10_1101-2020_11_24_390039	98	21	depletion	depletion	NN
10_1101-2020_11_24_390039	98	22	(	(	-LRB-
10_1101-2020_11_24_390039	98	23	Fig	fig	NN
10_1101-2020_11_24_390039	98	24	.	.	.
10_1101-2020_11_24_390039	99	1	3C	3c	NN
10_1101-2020_11_24_390039	99	2	)	)	-RRB-
10_1101-2020_11_24_390039	99	3	;	;	:
10_1101-2020_11_24_390039	99	4	iii	iii	LS
10_1101-2020_11_24_390039	99	5	)	)	-RRB-
10_1101-2020_11_24_390039	99	6	the	the	DT
10_1101-2020_11_24_390039	99	7	E	E	NNP
10_1101-2020_11_24_390039	99	8	protein	protein	NN
10_1101-2020_11_24_390039	99	9	showed	show	VBD
10_1101-2020_11_24_390039	99	10	diminished	diminished	JJ
10_1101-2020_11_24_390039	99	11	insertion	insertion	NN
10_1101-2020_11_24_390039	99	12	efficiency	efficiency	NN
10_1101-2020_11_24_390039	99	13	after	after	IN
10_1101-2020_11_24_390039	99	14	knock	knock	NN
10_1101-2020_11_24_390039	99	15	-	-	HYPH
10_1101-2020_11_24_390039	99	16	down	down	NN
10_1101-2020_11_24_390039	99	17	of	of	IN
10_1101-2020_11_24_390039	99	18	Sec61α	Sec61α	NNP
10_1101-2020_11_24_390039	99	19	and	and	CC
10_1101-2020_11_24_390039	99	20	EMC5	EMC5	NNP
10_1101-2020_11_24_390039	99	21	,	,	,
10_1101-2020_11_24_390039	99	22	although	although	IN
10_1101-2020_11_24_390039	99	23	the	the	DT
10_1101-2020_11_24_390039	99	24	latter	latter	NN
10_1101-2020_11_24_390039	99	25	had	have	VBD
10_1101-2020_11_24_390039	99	26	a	a	DT
10_1101-2020_11_24_390039	99	27	more	more	RBR
10_1101-2020_11_24_390039	99	28	pronounced	pronounced	JJ
10_1101-2020_11_24_390039	99	29	effect	effect	NN
10_1101-2020_11_24_390039	99	30	(	(	-LRB-
10_1101-2020_11_24_390039	99	31	Fig	fig	NN
10_1101-2020_11_24_390039	99	32	.	.	.
10_1101-2020_11_24_390039	100	1	3D	3d	NN
10_1101-2020_11_24_390039	100	2	)	)	-RRB-
10_1101-2020_11_24_390039	100	3	.	.	.
10_1101-2020_11_24_390039	101	1	In	in	IN
10_1101-2020_11_24_390039	101	2	each	each	DT
10_1101-2020_11_24_390039	101	3	case	case	NN
10_1101-2020_11_24_390039	101	4	,	,	,
10_1101-2020_11_24_390039	101	5	the	the	DT
10_1101-2020_11_24_390039	101	6	combined	combine	VBN
10_1101-2020_11_24_390039	101	7	knockdown	knockdown	NNP
10_1101-2020_11_24_390039	101	8	of	of	IN
10_1101-2020_11_24_390039	101	9	Sec61α	Sec61α	NNP
10_1101-2020_11_24_390039	101	10	and	and	CC
10_1101-2020_11_24_390039	101	11	EMC5	EMC5	NNP
10_1101-2020_11_24_390039	101	12	resulted	result	VBD
10_1101-2020_11_24_390039	101	13	in	in	IN
10_1101-2020_11_24_390039	101	14	a	a	DT
10_1101-2020_11_24_390039	101	15	reduction	reduction	NN
10_1101-2020_11_24_390039	101	16	of	of	IN
10_1101-2020_11_24_390039	101	17	membrane	membrane	NN
10_1101-2020_11_24_390039	101	18	insertion	insertion	NN
10_1101-2020_11_24_390039	101	19	that	that	WDT
10_1101-2020_11_24_390039	101	20	was	be	VBD
10_1101-2020_11_24_390039	101	21	either	either	CC
10_1101-2020_11_24_390039	101	22	comparable	comparable	JJ
10_1101-2020_11_24_390039	101	23	to	to	IN
10_1101-2020_11_24_390039	101	24	,	,	,
10_1101-2020_11_24_390039	101	25	or	or	CC
10_1101-2020_11_24_390039	101	26	greater	great	JJR
10_1101-2020_11_24_390039	101	27	than	than	IN
10_1101-2020_11_24_390039	101	28	,	,	,
10_1101-2020_11_24_390039	101	29	that	that	DT
10_1101-2020_11_24_390039	101	30	achieved	achieve	VBD
10_1101-2020_11_24_390039	101	31	following	follow	VBG
10_1101-2020_11_24_390039	101	32	the	the	DT
10_1101-2020_11_24_390039	101	33	knock-	knock-	NN
10_1101-2020_11_24_390039	101	34	down	down	IN
10_1101-2020_11_24_390039	101	35	of	of	IN
10_1101-2020_11_24_390039	101	36	Sec61α	Sec61α	NNP
10_1101-2020_11_24_390039	101	37	alone	alone	RB
10_1101-2020_11_24_390039	101	38	(	(	-LRB-
10_1101-2020_11_24_390039	101	39	Figs	fig	NNS
10_1101-2020_11_24_390039	101	40	.	.	.
10_1101-2020_11_24_390039	102	1	3B	3b	JJ
10_1101-2020_11_24_390039	102	2	to	to	IN
10_1101-2020_11_24_390039	102	3	3D	3d	NN
10_1101-2020_11_24_390039	102	4	)	)	-RRB-
10_1101-2020_11_24_390039	102	5	.	.	.
10_1101-2020_11_24_390039	103	1	For	for	IN
10_1101-2020_11_24_390039	103	2	the	the	DT
10_1101-2020_11_24_390039	103	3	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	103	4	protein	protein	NN
10_1101-2020_11_24_390039	103	5	,	,	,
10_1101-2020_11_24_390039	103	6	the	the	DT
10_1101-2020_11_24_390039	103	7	total	total	JJ
10_1101-2020_11_24_390039	103	8	level	level	NN
10_1101-2020_11_24_390039	103	9	of	of	IN
10_1101-2020_11_24_390039	103	10	N	n	NN
10_1101-2020_11_24_390039	103	11	-	-	HYPH
10_1101-2020_11_24_390039	103	12	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	103	13	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	103	14	species	specie	NNS
10_1101-2020_11_24_390039	103	15	was	be	VBD
10_1101-2020_11_24_390039	103	16	unaffected	unaffected	JJ
10_1101-2020_11_24_390039	103	17	by	by	IN
10_1101-2020_11_24_390039	103	18	any	any	DT
10_1101-2020_11_24_390039	103	19	knockdown	knockdown	VBN
10_1101-2020_11_24_390039	103	20	condition	condition	NN
10_1101-2020_11_24_390039	103	21	tested	test	VBN
10_1101-2020_11_24_390039	103	22	(	(	-LRB-
10_1101-2020_11_24_390039	103	23	Fig	fig	NN
10_1101-2020_11_24_390039	103	24	.	.	.
10_1101-2020_11_24_390039	104	1	3E	3E	NNP
10_1101-2020_11_24_390039	104	2	)	)	-RRB-
10_1101-2020_11_24_390039	104	3	.	.	.
10_1101-2020_11_24_390039	105	1	However	however	RB
10_1101-2020_11_24_390039	105	2	,	,	,
10_1101-2020_11_24_390039	105	3	we	-PRON-	PRP
10_1101-2020_11_24_390039	105	4	note	note	VBP
10_1101-2020_11_24_390039	105	5	a	a	DT
10_1101-2020_11_24_390039	105	6	marked	marked	JJ
10_1101-2020_11_24_390039	105	7	increase	increase	NN
10_1101-2020_11_24_390039	105	8	in	in	IN
10_1101-2020_11_24_390039	105	9	the	the	DT
10_1101-2020_11_24_390039	105	10	proportion	proportion	NN
10_1101-2020_11_24_390039	105	11	of	of	IN
10_1101-2020_11_24_390039	105	12	potentially	potentially	RB
10_1101-2020_11_24_390039	105	13	mis	mis	NN
10_1101-2020_11_24_390039	105	14	-	-	HYPH
10_1101-2020_11_24_390039	105	15	inserted	insert	VBN
10_1101-2020_11_24_390039	105	16	OPG2-ORF6-OPG2	opg2-orf6-opg2	CD
10_1101-2020_11_24_390039	105	17	-	-	HYPH
10_1101-2020_11_24_390039	105	18	1Gly	1Gly	NNS
10_1101-2020_11_24_390039	105	19	species	specie	NNS
10_1101-2020_11_24_390039	105	20	,	,	,
10_1101-2020_11_24_390039	105	21	particularly	particularly	RB
10_1101-2020_11_24_390039	105	22	after	after	IN
10_1101-2020_11_24_390039	105	23	co	co	NN
10_1101-2020_11_24_390039	105	24	-	-	NN
10_1101-2020_11_24_390039	105	25	depletion	depletion	NN
10_1101-2020_11_24_390039	105	26	of	of	IN
10_1101-2020_11_24_390039	105	27	EMC5	EMC5	NNP
10_1101-2020_11_24_390039	105	28	and	and	CC
10_1101-2020_11_24_390039	105	29	Sec61α	Sec61α	NNP
10_1101-2020_11_24_390039	105	30	(	(	-LRB-
10_1101-2020_11_24_390039	105	31	see	see	VB
10_1101-2020_11_24_390039	105	32	Fig	Fig	NNP
10_1101-2020_11_24_390039	105	33	.	.	.
10_1101-2020_11_24_390039	106	1	3E	3e	NN
10_1101-2020_11_24_390039	106	2	;	;	:
10_1101-2020_11_24_390039	106	3	Fig	Fig	NNP
10_1101-2020_11_24_390039	106	4	.	.	.
10_1101-2020_11_24_390039	107	1	S2E	s2e	LS
10_1101-2020_11_24_390039	107	2	)	)	-RRB-
10_1101-2020_11_24_390039	107	3	.	.	.
10_1101-2020_11_24_390039	108	1	We	-PRON-	PRP
10_1101-2020_11_24_390039	108	2	speculate	speculate	VBP
10_1101-2020_11_24_390039	108	3	that	that	IN
10_1101-2020_11_24_390039	108	4	the	the	DT
10_1101-2020_11_24_390039	108	5	unusual	unusual	JJ
10_1101-2020_11_24_390039	108	6	hairpin	hairpin	NN
10_1101-2020_11_24_390039	108	7	topology	topology	NN
10_1101-2020_11_24_390039	108	8	of	of	IN
10_1101-2020_11_24_390039	108	9	the	the	DT
10_1101-2020_11_24_390039	108	10	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	108	11	protein	protein	NN
10_1101-2020_11_24_390039	108	12	may	may	MD
10_1101-2020_11_24_390039	108	13	be	be	VB
10_1101-2020_11_24_390039	108	14	attributed	attribute	VBN
10_1101-2020_11_24_390039	108	15	to	to	IN
10_1101-2020_11_24_390039	108	16	the	the	DT
10_1101-2020_11_24_390039	108	17	EMC	EMC	NNP
10_1101-2020_11_24_390039	108	18	and	and	CC
10_1101-2020_11_24_390039	108	19	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	108	20	complex	complex	JJ
10_1101-2020_11_24_390039	108	21	acting	acting	NN
10_1101-2020_11_24_390039	108	22	in	in	IN
10_1101-2020_11_24_390039	108	23	concert	concert	NN
10_1101-2020_11_24_390039	108	24	to	to	TO
10_1101-2020_11_24_390039	108	25	provide	provide	VB
10_1101-2020_11_24_390039	108	26	an	an	DT
10_1101-2020_11_24_390039	108	27	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	108	28	-	-	HYPH
10_1101-2020_11_24_390039	108	29	F	F	NNP
10_1101-2020_11_24_390039	108	30	insensitive	insensitive	JJ
10_1101-2020_11_24_390039	108	31	pathway	pathway	NN
10_1101-2020_11_24_390039	108	32	for	for	IN
10_1101-2020_11_24_390039	108	33	protein	protein	NN
10_1101-2020_11_24_390039	108	34	translocation	translocation	NN
10_1101-2020_11_24_390039	108	35	across	across	IN
10_1101-2020_11_24_390039	108	36	the	the	DT
10_1101-2020_11_24_390039	108	37	ER	ER	NNP
10_1101-2020_11_24_390039	108	38	membrane	membrane	NN
10_1101-2020_11_24_390039	108	39	(	(	-LRB-
10_1101-2020_11_24_390039	108	40	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	108	41	et	et	NNP
10_1101-2020_11_24_390039	108	42	al	al	NNP
10_1101-2020_11_24_390039	108	43	.	.	NNP
10_1101-2020_11_24_390039	108	44	,	,	,
10_1101-2020_11_24_390039	108	45	2020	2020	CD
10_1101-2020_11_24_390039	108	46	,	,	,
10_1101-2020_11_24_390039	108	47	submitted	submit	VBN
10_1101-2020_11_24_390039	108	48	)	)	-RRB-
10_1101-2020_11_24_390039	108	49	.	.	.
10_1101-2020_11_24_390039	109	1	Perturbation	perturbation	NN
10_1101-2020_11_24_390039	109	2	of	of	IN
10_1101-2020_11_24_390039	109	3	this	this	DT
10_1101-2020_11_24_390039	109	4	pathway	pathway	NN
10_1101-2020_11_24_390039	109	5	seemingly	seemingly	RB
10_1101-2020_11_24_390039	109	6	increases	increase	VBZ
10_1101-2020_11_24_390039	109	7	the	the	DT
10_1101-2020_11_24_390039	109	8	potential	potential	NN
10_1101-2020_11_24_390039	109	9	for	for	IN
10_1101-2020_11_24_390039	109	10	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	109	11	to	to	IN
10_1101-2020_11_24_390039	109	12	mis-	mis-	NN
10_1101-2020_11_24_390039	109	13	.CC	.CC	:
10_1101-2020_11_24_390039	109	14	-	-	:
10_1101-2020_11_24_390039	109	15	BY	by	IN
10_1101-2020_11_24_390039	109	16	-	-	HYPH
10_1101-2020_11_24_390039	109	17	ND	ND	NNP
10_1101-2020_11_24_390039	109	18	4.0	4.0	CD
10_1101-2020_11_24_390039	109	19	International	international	JJ
10_1101-2020_11_24_390039	109	20	licensemade	licensemade	NN
10_1101-2020_11_24_390039	109	21	available	available	JJ
10_1101-2020_11_24_390039	109	22	under	under	IN
10_1101-2020_11_24_390039	109	23	a	a	DT
10_1101-2020_11_24_390039	109	24	(	(	-LRB-
10_1101-2020_11_24_390039	109	25	which	which	WDT
10_1101-2020_11_24_390039	109	26	was	be	VBD
10_1101-2020_11_24_390039	109	27	not	not	RB
10_1101-2020_11_24_390039	109	28	certified	certify	VBN
10_1101-2020_11_24_390039	109	29	by	by	IN
10_1101-2020_11_24_390039	109	30	peer	peer	NN
10_1101-2020_11_24_390039	109	31	review	review	NN
10_1101-2020_11_24_390039	109	32	)	)	-RRB-
10_1101-2020_11_24_390039	109	33	is	be	VBZ
10_1101-2020_11_24_390039	109	34	the	the	DT
10_1101-2020_11_24_390039	109	35	author	author	NN
10_1101-2020_11_24_390039	109	36	/	/	SYM
10_1101-2020_11_24_390039	109	37	funder	funder	NN
10_1101-2020_11_24_390039	109	38	,	,	,
10_1101-2020_11_24_390039	109	39	who	who	WP
10_1101-2020_11_24_390039	109	40	has	have	VBZ
10_1101-2020_11_24_390039	109	41	granted	grant	VBN
10_1101-2020_11_24_390039	109	42	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	109	43	a	a	DT
10_1101-2020_11_24_390039	109	44	license	license	NN
10_1101-2020_11_24_390039	109	45	to	to	TO
10_1101-2020_11_24_390039	109	46	display	display	VB
10_1101-2020_11_24_390039	109	47	the	the	DT
10_1101-2020_11_24_390039	109	48	preprint	preprint	NN
10_1101-2020_11_24_390039	109	49	in	in	IN
10_1101-2020_11_24_390039	109	50	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	109	51	.	.	.
10_1101-2020_11_24_390039	110	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	110	2	is	be	VBZ
10_1101-2020_11_24_390039	110	3	The	the	DT
10_1101-2020_11_24_390039	110	4	copyright	copyright	NN
10_1101-2020_11_24_390039	110	5	holder	holder	NN
10_1101-2020_11_24_390039	110	6	for	for	IN
10_1101-2020_11_24_390039	110	7	this	this	DT
10_1101-2020_11_24_390039	110	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	110	9	version	version	NN
10_1101-2020_11_24_390039	110	10	posted	post	VBD
10_1101-2020_11_24_390039	110	11	January	January	NNP
10_1101-2020_11_24_390039	110	12	5	5	CD
10_1101-2020_11_24_390039	110	13	,	,	,
10_1101-2020_11_24_390039	110	14	2021	2021	CD
10_1101-2020_11_24_390039	110	15	.	.	.
10_1101-2020_11_24_390039	110	16	;	;	:
10_1101-2020_11_24_390039	110	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	110	18	:	:	:
10_1101-2020_11_24_390039	110	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	110	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	110	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	110	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	110	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	110	24	-	-	HYPH
10_1101-2020_11_24_390039	110	25	F	F	NNP
10_1101-2020_11_24_390039	110	26	as	as	IN
10_1101-2020_11_24_390039	110	27	a	a	DT
10_1101-2020_11_24_390039	110	28	potential	potential	JJ
10_1101-2020_11_24_390039	110	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	110	30	agent	agent	NN
10_1101-2020_11_24_390039	110	31	Page	Page	NNP
10_1101-2020_11_24_390039	110	32	8	8	CD
10_1101-2020_11_24_390039	110	33	of	of	IN
10_1101-2020_11_24_390039	110	34	21	21	CD
10_1101-2020_11_24_390039	110	35	insert	insert	NN
10_1101-2020_11_24_390039	110	36	(	(	-LRB-
10_1101-2020_11_24_390039	110	37	cf	cf	NN
10_1101-2020_11_24_390039	110	38	.	.	.
10_1101-2020_11_24_390039	111	1	Chitwood	Chitwood	NNP
10_1101-2020_11_24_390039	111	2	et	et	NNP
10_1101-2020_11_24_390039	111	3	al	al	NNP
10_1101-2020_11_24_390039	111	4	.	.	NNP
10_1101-2020_11_24_390039	111	5	,	,	,
10_1101-2020_11_24_390039	111	6	2018	2018	CD
10_1101-2020_11_24_390039	111	7	)	)	-RRB-
10_1101-2020_11_24_390039	111	8	,	,	,
10_1101-2020_11_24_390039	111	9	perhaps	perhaps	RB
10_1101-2020_11_24_390039	111	10	as	as	IN
10_1101-2020_11_24_390039	111	11	a	a	DT
10_1101-2020_11_24_390039	111	12	consequence	consequence	NN
10_1101-2020_11_24_390039	111	13	of	of	IN
10_1101-2020_11_24_390039	111	14	disruption	disruption	NN
10_1101-2020_11_24_390039	111	15	to	to	IN
10_1101-2020_11_24_390039	111	16	the	the	DT
10_1101-2020_11_24_390039	111	17	translocation	translocation	NN
10_1101-2020_11_24_390039	111	18	of	of	IN
10_1101-2020_11_24_390039	111	19	its	-PRON-	PRP$
10_1101-2020_11_24_390039	111	20	C	c	NN
10_1101-2020_11_24_390039	111	21	-	-	HYPH
10_1101-2020_11_24_390039	111	22	terminus	terminus	NN
10_1101-2020_11_24_390039	111	23	(	(	-LRB-
10_1101-2020_11_24_390039	111	24	Fig	fig	NN
10_1101-2020_11_24_390039	111	25	.	.	.
10_1101-2020_11_24_390039	112	1	S2E	s2e	LS
10_1101-2020_11_24_390039	112	2	)	)	-RRB-
10_1101-2020_11_24_390039	112	3	.	.	.
10_1101-2020_11_24_390039	113	1	Taken	take	VBN
10_1101-2020_11_24_390039	113	2	together	together	RB
10_1101-2020_11_24_390039	113	3	,	,	,
10_1101-2020_11_24_390039	113	4	our	-PRON-	PRP$
10_1101-2020_11_24_390039	113	5	data	datum	NNS
10_1101-2020_11_24_390039	113	6	establish	establish	VBP
10_1101-2020_11_24_390039	113	7	that	that	IN
10_1101-2020_11_24_390039	113	8	,	,	,
10_1101-2020_11_24_390039	113	9	analogous	analogous	JJ
10_1101-2020_11_24_390039	113	10	to	to	IN
10_1101-2020_11_24_390039	113	11	human	human	JJ
10_1101-2020_11_24_390039	113	12	membrane	membrane	NN
10_1101-2020_11_24_390039	113	13	and	and	CC
10_1101-2020_11_24_390039	113	14	secretory	secretory	NN
10_1101-2020_11_24_390039	113	15	proteins	protein	NNS
10_1101-2020_11_24_390039	113	16	,	,	,
10_1101-2020_11_24_390039	113	17	the	the	DT
10_1101-2020_11_24_390039	113	18	principal	principal	JJ
10_1101-2020_11_24_390039	113	19	molecular	molecular	JJ
10_1101-2020_11_24_390039	113	20	basis	basis	NN
10_1101-2020_11_24_390039	113	21	for	for	IN
10_1101-2020_11_24_390039	113	22	the	the	DT
10_1101-2020_11_24_390039	113	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	113	24	-	-	HYPH
10_1101-2020_11_24_390039	113	25	F	F	NNP
10_1101-2020_11_24_390039	113	26	-	-	HYPH
10_1101-2020_11_24_390039	113	27	sensitivity	sensitivity	NN
10_1101-2020_11_24_390039	113	28	of	of	IN
10_1101-2020_11_24_390039	113	29	the	the	DT
10_1101-2020_11_24_390039	113	30	SARS	SARS	NNP
10_1101-2020_11_24_390039	113	31	-	-	HYPH
10_1101-2020_11_24_390039	113	32	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	113	33	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	113	34	and	and	CC
10_1101-2020_11_24_390039	113	35	S	S	NNP
10_1101-2020_11_24_390039	113	36	proteins	protein	NNS
10_1101-2020_11_24_390039	113	37	is	be	VBZ
10_1101-2020_11_24_390039	113	38	their	-PRON-	PRP$
10_1101-2020_11_24_390039	113	39	dependence	dependence	NN
10_1101-2020_11_24_390039	113	40	on	on	IN
10_1101-2020_11_24_390039	113	41	Sec61-mediated	sec61-mediated	JJ
10_1101-2020_11_24_390039	113	42	protein	protein	NN
10_1101-2020_11_24_390039	113	43	translocation	translocation	NN
10_1101-2020_11_24_390039	113	44	into	into	IN
10_1101-2020_11_24_390039	113	45	and	and	CC
10_1101-2020_11_24_390039	113	46	across	across	IN
10_1101-2020_11_24_390039	113	47	the	the	DT
10_1101-2020_11_24_390039	113	48	ER	ER	NNP
10_1101-2020_11_24_390039	113	49	membrane	membrane	NN
10_1101-2020_11_24_390039	113	50	.	.	.
10_1101-2020_11_24_390039	114	1	In	in	IN
10_1101-2020_11_24_390039	114	2	contrast	contrast	NN
10_1101-2020_11_24_390039	114	3	,	,	,
10_1101-2020_11_24_390039	114	4	the	the	DT
10_1101-2020_11_24_390039	114	5	E	e	NN
10_1101-2020_11_24_390039	114	6	,	,	,
10_1101-2020_11_24_390039	114	7	M	M	NNP
10_1101-2020_11_24_390039	114	8	,	,	,
10_1101-2020_11_24_390039	114	9	and	and	CC
10_1101-2020_11_24_390039	114	10	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	114	11	proteins	protein	NNS
10_1101-2020_11_24_390039	114	12	appear	appear	VBP
10_1101-2020_11_24_390039	114	13	capable	capable	JJ
10_1101-2020_11_24_390039	114	14	of	of	IN
10_1101-2020_11_24_390039	114	15	exploiting	exploit	VBG
10_1101-2020_11_24_390039	114	16	one	one	CD
10_1101-2020_11_24_390039	114	17	or	or	CC
10_1101-2020_11_24_390039	114	18	more	more	JJR
10_1101-2020_11_24_390039	114	19	alternative	alternative	JJ
10_1101-2020_11_24_390039	114	20	membrane	membrane	NN
10_1101-2020_11_24_390039	114	21	insertion	insertion	NN
10_1101-2020_11_24_390039	114	22	/	/	SYM
10_1101-2020_11_24_390039	114	23	translocation	translocation	NN
10_1101-2020_11_24_390039	114	24	pathways	pathway	NNS
10_1101-2020_11_24_390039	114	25	that	that	WDT
10_1101-2020_11_24_390039	114	26	can	can	MD
10_1101-2020_11_24_390039	114	27	bypass	bypass	VB
10_1101-2020_11_24_390039	114	28	the	the	DT
10_1101-2020_11_24_390039	114	29	translocase	translocase	NN
10_1101-2020_11_24_390039	114	30	activity	activity	NN
10_1101-2020_11_24_390039	114	31	of	of	IN
10_1101-2020_11_24_390039	114	32	the	the	DT
10_1101-2020_11_24_390039	114	33	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	114	34	complex	complex	NN
10_1101-2020_11_24_390039	114	35	.	.	.
10_1101-2020_11_24_390039	115	1	These	these	DT
10_1101-2020_11_24_390039	115	2	alternatives	alternative	NNS
10_1101-2020_11_24_390039	115	3	most	most	RBS
10_1101-2020_11_24_390039	115	4	likely	likely	RB
10_1101-2020_11_24_390039	115	5	include	include	VBP
10_1101-2020_11_24_390039	115	6	a	a	DT
10_1101-2020_11_24_390039	115	7	recently	recently	RB
10_1101-2020_11_24_390039	115	8	described	describe	VBN
10_1101-2020_11_24_390039	115	9	route	route	NN
10_1101-2020_11_24_390039	115	10	for	for	IN
10_1101-2020_11_24_390039	115	11	type	type	NN
10_1101-2020_11_24_390039	115	12	III	III	NNP
10_1101-2020_11_24_390039	115	13	TMP	TMP	NNP
10_1101-2020_11_24_390039	115	14	insertion	insertion	NN
10_1101-2020_11_24_390039	115	15	that	that	WDT
10_1101-2020_11_24_390039	115	16	requires	require	VBZ
10_1101-2020_11_24_390039	115	17	the	the	DT
10_1101-2020_11_24_390039	115	18	insertase	insertase	NN
10_1101-2020_11_24_390039	115	19	function	function	NN
10_1101-2020_11_24_390039	115	20	of	of	IN
10_1101-2020_11_24_390039	115	21	the	the	DT
10_1101-2020_11_24_390039	115	22	EMC	EMC	NNP
10_1101-2020_11_24_390039	115	23	(	(	-LRB-
10_1101-2020_11_24_390039	115	24	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	115	25	et	et	NNP
10_1101-2020_11_24_390039	115	26	al	al	NNP
10_1101-2020_11_24_390039	115	27	.	.	NNP
10_1101-2020_11_24_390039	115	28	,	,	,
10_1101-2020_11_24_390039	115	29	2020	2020	CD
10_1101-2020_11_24_390039	115	30	submitted	submit	VBN
10_1101-2020_11_24_390039	115	31	)	)	-RRB-
10_1101-2020_11_24_390039	115	32	,	,	,
10_1101-2020_11_24_390039	115	33	which	which	WDT
10_1101-2020_11_24_390039	115	34	our	-PRON-	PRP$
10_1101-2020_11_24_390039	115	35	data	datum	NNS
10_1101-2020_11_24_390039	115	36	suggest	suggest	VBP
10_1101-2020_11_24_390039	115	37	is	be	VBZ
10_1101-2020_11_24_390039	115	38	also	also	RB
10_1101-2020_11_24_390039	115	39	sufficient	sufficient	JJ
10_1101-2020_11_24_390039	115	40	to	to	TO
10_1101-2020_11_24_390039	115	41	confer	confer	VB
10_1101-2020_11_24_390039	115	42	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	115	43	-	-	HYPH
10_1101-2020_11_24_390039	115	44	F	F	NNP
10_1101-2020_11_24_390039	115	45	-	-	HYPH
10_1101-2020_11_24_390039	115	46	resistance	resistance	NN
10_1101-2020_11_24_390039	115	47	to	to	IN
10_1101-2020_11_24_390039	115	48	the	the	DT
10_1101-2020_11_24_390039	115	49	viral	viral	JJ
10_1101-2020_11_24_390039	115	50	E	e	NN
10_1101-2020_11_24_390039	115	51	protein	protein	NN
10_1101-2020_11_24_390039	115	52	and	and	CC
10_1101-2020_11_24_390039	115	53	at	at	IN
10_1101-2020_11_24_390039	115	54	least	least	JJS
10_1101-2020_11_24_390039	115	55	the	the	DT
10_1101-2020_11_24_390039	115	56	first	first	JJ
10_1101-2020_11_24_390039	115	57	TM	TM	NNP
10_1101-2020_11_24_390039	115	58	-	-	HYPH
10_1101-2020_11_24_390039	115	59	span	span	NN
10_1101-2020_11_24_390039	115	60	of	of	IN
10_1101-2020_11_24_390039	115	61	the	the	DT
10_1101-2020_11_24_390039	115	62	viral	viral	JJ
10_1101-2020_11_24_390039	115	63	M	M	NNP
10_1101-2020_11_24_390039	115	64	protein	protein	NN
10_1101-2020_11_24_390039	115	65	.	.	.
10_1101-2020_11_24_390039	116	1	Concluding	conclude	VBG
10_1101-2020_11_24_390039	116	2	Remarks	Remarks	NNPS
10_1101-2020_11_24_390039	116	3	We	-PRON-	PRP
10_1101-2020_11_24_390039	116	4	conclude	conclude	VBP
10_1101-2020_11_24_390039	116	5	,	,	,
10_1101-2020_11_24_390039	116	6	that	that	DT
10_1101-2020_11_24_390039	116	7	Sec61-selective	sec61-selective	JJ
10_1101-2020_11_24_390039	116	8	protein	protein	NN
10_1101-2020_11_24_390039	116	9	translocation	translocation	NN
10_1101-2020_11_24_390039	116	10	inhibitors	inhibitor	NNS
10_1101-2020_11_24_390039	116	11	like	like	IN
10_1101-2020_11_24_390039	116	12	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	116	13	-	-	HYPH
10_1101-2020_11_24_390039	116	14	F	F	NNP
10_1101-2020_11_24_390039	116	15	hold	hold	NN
10_1101-2020_11_24_390039	116	16	promise	promise	NN
10_1101-2020_11_24_390039	116	17	as	as	IN
10_1101-2020_11_24_390039	116	18	broad	broad	JJ
10_1101-2020_11_24_390039	116	19	-	-	HYPH
10_1101-2020_11_24_390039	116	20	spectrum	spectrum	NN
10_1101-2020_11_24_390039	116	21	antivirals	antiviral	NNS
10_1101-2020_11_24_390039	116	22	that	that	WDT
10_1101-2020_11_24_390039	116	23	may	may	MD
10_1101-2020_11_24_390039	116	24	exert	exert	VB
10_1101-2020_11_24_390039	116	25	a	a	DT
10_1101-2020_11_24_390039	116	26	therapeutic	therapeutic	JJ
10_1101-2020_11_24_390039	116	27	effect	effect	NN
10_1101-2020_11_24_390039	116	28	by	by	IN
10_1101-2020_11_24_390039	116	29	selectively	selectively	RB
10_1101-2020_11_24_390039	116	30	inhibiting	inhibit	VBG
10_1101-2020_11_24_390039	116	31	the	the	DT
10_1101-2020_11_24_390039	116	32	ER	ER	NNP
10_1101-2020_11_24_390039	116	33	translocation	translocation	NN
10_1101-2020_11_24_390039	116	34	of	of	IN
10_1101-2020_11_24_390039	116	35	viral	viral	JJ
10_1101-2020_11_24_390039	116	36	and/or	and/or	CC
10_1101-2020_11_24_390039	116	37	host	host	NN
10_1101-2020_11_24_390039	116	38	proteins	protein	NNS
10_1101-2020_11_24_390039	116	39	which	which	WDT
10_1101-2020_11_24_390039	116	40	are	be	VBP
10_1101-2020_11_24_390039	116	41	crucial	crucial	JJ
10_1101-2020_11_24_390039	116	42	to	to	IN
10_1101-2020_11_24_390039	116	43	viral	viral	JJ
10_1101-2020_11_24_390039	116	44	infection	infection	NN
10_1101-2020_11_24_390039	116	45	and	and	CC
10_1101-2020_11_24_390039	116	46	propagation	propagation	NN
10_1101-2020_11_24_390039	116	47	(	(	-LRB-
10_1101-2020_11_24_390039	116	48	Mast	Mast	NNP
10_1101-2020_11_24_390039	116	49	et	et	NNP
10_1101-2020_11_24_390039	116	50	al	al	NNP
10_1101-2020_11_24_390039	116	51	.	.	NNP
10_1101-2020_11_24_390039	116	52	,	,	,
10_1101-2020_11_24_390039	116	53	2020	2020	CD
10_1101-2020_11_24_390039	116	54	)	)	-RRB-
10_1101-2020_11_24_390039	116	55	.	.	.
10_1101-2020_11_24_390039	117	1	In	in	IN
10_1101-2020_11_24_390039	117	2	the	the	DT
10_1101-2020_11_24_390039	117	3	context	context	NN
10_1101-2020_11_24_390039	117	4	of	of	IN
10_1101-2020_11_24_390039	117	5	SARS	SARS	NNP
10_1101-2020_11_24_390039	117	6	-	-	HYPH
10_1101-2020_11_24_390039	117	7	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	117	8	,	,	,
10_1101-2020_11_24_390039	117	9	integration	integration	NN
10_1101-2020_11_24_390039	117	10	of	of	IN
10_1101-2020_11_24_390039	117	11	the	the	DT
10_1101-2020_11_24_390039	117	12	viral	viral	JJ
10_1101-2020_11_24_390039	117	13	S	S	NNP
10_1101-2020_11_24_390039	117	14	protein	protein	NN
10_1101-2020_11_24_390039	117	15	and	and	CC
10_1101-2020_11_24_390039	117	16	its	-PRON-	PRP$
10_1101-2020_11_24_390039	117	17	host	host	NN
10_1101-2020_11_24_390039	117	18	cell	cell	NN
10_1101-2020_11_24_390039	117	19	receptor	receptor	NN
10_1101-2020_11_24_390039	117	20	,	,	,
10_1101-2020_11_24_390039	117	21	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	117	22	,	,	,
10_1101-2020_11_24_390039	117	23	into	into	IN
10_1101-2020_11_24_390039	117	24	the	the	DT
10_1101-2020_11_24_390039	117	25	ER	ER	NNP
10_1101-2020_11_24_390039	117	26	membrane	membrane	NN
10_1101-2020_11_24_390039	117	27	is	be	VBZ
10_1101-2020_11_24_390039	117	28	significantly	significantly	RB
10_1101-2020_11_24_390039	117	29	reduced	reduce	VBN
10_1101-2020_11_24_390039	117	30	by	by	IN
10_1101-2020_11_24_390039	117	31	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	117	32	-	-	HYPH
10_1101-2020_11_24_390039	117	33	F	F	NNP
10_1101-2020_11_24_390039	117	34	(	(	-LRB-
10_1101-2020_11_24_390039	117	35	Fig	Fig	NNP
10_1101-2020_11_24_390039	117	36	.	.	.
10_1101-2020_11_24_390039	118	1	2C	2C	NNP
10_1101-2020_11_24_390039	118	2	,	,	,
10_1101-2020_11_24_390039	118	3	3B	3B	NNP
10_1101-2020_11_24_390039	118	4	)	)	-RRB-
10_1101-2020_11_24_390039	118	5	.	.	.
10_1101-2020_11_24_390039	119	1	Likewise	likewise	RB
10_1101-2020_11_24_390039	119	2	,	,	,
10_1101-2020_11_24_390039	119	3	translocation	translocation	NN
10_1101-2020_11_24_390039	119	4	of	of	IN
10_1101-2020_11_24_390039	119	5	the	the	DT
10_1101-2020_11_24_390039	119	6	viral	viral	JJ
10_1101-2020_11_24_390039	119	7	ORF8	orf8	JJ
10_1101-2020_11_24_390039	119	8	protein	protein	NN
10_1101-2020_11_24_390039	119	9	across	across	IN
10_1101-2020_11_24_390039	119	10	the	the	DT
10_1101-2020_11_24_390039	119	11	ER	ER	NNP
10_1101-2020_11_24_390039	119	12	membrane	membrane	NN
10_1101-2020_11_24_390039	119	13	and	and	CC
10_1101-2020_11_24_390039	119	14	into	into	IN
10_1101-2020_11_24_390039	119	15	its	-PRON-	PRP$
10_1101-2020_11_24_390039	119	16	lumen	luman	NNS
10_1101-2020_11_24_390039	119	17	is	be	VBZ
10_1101-2020_11_24_390039	119	18	substantially	substantially	RB
10_1101-2020_11_24_390039	119	19	diminished	diminish	VBN
10_1101-2020_11_24_390039	119	20	(	(	-LRB-
10_1101-2020_11_24_390039	119	21	Fig	fig	NN
10_1101-2020_11_24_390039	119	22	.	.	.
10_1101-2020_11_24_390039	120	1	2C	2C	NNP
10_1101-2020_11_24_390039	120	2	,	,	,
10_1101-2020_11_24_390039	120	3	3C	3c	NN
10_1101-2020_11_24_390039	120	4	)	)	-RRB-
10_1101-2020_11_24_390039	120	5	.	.	.
10_1101-2020_11_24_390039	121	1	The	the	DT
10_1101-2020_11_24_390039	121	2	binding	binding	NN
10_1101-2020_11_24_390039	121	3	of	of	IN
10_1101-2020_11_24_390039	121	4	the	the	DT
10_1101-2020_11_24_390039	121	5	viral	viral	JJ
10_1101-2020_11_24_390039	121	6	S	S	NNP
10_1101-2020_11_24_390039	121	7	protein	protein	NN
10_1101-2020_11_24_390039	121	8	to	to	IN
10_1101-2020_11_24_390039	121	9	cell	cell	NN
10_1101-2020_11_24_390039	121	10	surface	surface	NN
10_1101-2020_11_24_390039	121	11	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	121	12	is	be	VBZ
10_1101-2020_11_24_390039	121	13	a	a	DT
10_1101-2020_11_24_390039	121	14	key	key	JJ
10_1101-2020_11_24_390039	121	15	step	step	NN
10_1101-2020_11_24_390039	121	16	in	in	IN
10_1101-2020_11_24_390039	121	17	host	host	NN
10_1101-2020_11_24_390039	121	18	cell	cell	NN
10_1101-2020_11_24_390039	121	19	infection	infection	NN
10_1101-2020_11_24_390039	121	20	(	(	-LRB-
10_1101-2020_11_24_390039	121	21	Drew	Drew	NNP
10_1101-2020_11_24_390039	121	22	and	and	CC
10_1101-2020_11_24_390039	121	23	Janes	Janes	NNP
10_1101-2020_11_24_390039	121	24	,	,	,
10_1101-2020_11_24_390039	121	25	2020	2020	CD
10_1101-2020_11_24_390039	121	26	)	)	-RRB-
10_1101-2020_11_24_390039	121	27	,	,	,
10_1101-2020_11_24_390039	121	28	whilst	whilst	IN
10_1101-2020_11_24_390039	121	29	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	121	30	may	may	MD
10_1101-2020_11_24_390039	121	31	protect	protect	VB
10_1101-2020_11_24_390039	121	32	SARS	SARS	NNP
10_1101-2020_11_24_390039	121	33	-	-	HYPH
10_1101-2020_11_24_390039	121	34	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	121	35	infected	infected	JJ
10_1101-2020_11_24_390039	121	36	cells	cell	NNS
10_1101-2020_11_24_390039	121	37	against	against	IN
10_1101-2020_11_24_390039	121	38	host	host	NN
10_1101-2020_11_24_390039	121	39	cytotoxic	cytotoxic	NNP
10_1101-2020_11_24_390039	121	40	T	T	NNP
10_1101-2020_11_24_390039	121	41	lymphocytes	lymphocyte	NNS
10_1101-2020_11_24_390039	121	42	(	(	-LRB-
10_1101-2020_11_24_390039	121	43	Zhang	Zhang	NNP
10_1101-2020_11_24_390039	121	44	et	et	NNP
10_1101-2020_11_24_390039	121	45	al	al	NNP
10_1101-2020_11_24_390039	121	46	.	.	NNP
10_1101-2020_11_24_390039	121	47	,	,	,
10_1101-2020_11_24_390039	121	48	2020	2020	CD
10_1101-2020_11_24_390039	121	49	)	)	-RRB-
10_1101-2020_11_24_390039	121	50	,	,	,
10_1101-2020_11_24_390039	121	51	making	make	VBG
10_1101-2020_11_24_390039	121	52	all	all	DT
10_1101-2020_11_24_390039	121	53	three	three	CD
10_1101-2020_11_24_390039	121	54	of	of	IN
10_1101-2020_11_24_390039	121	55	these	these	DT
10_1101-2020_11_24_390039	121	56	proteins	protein	NNS
10_1101-2020_11_24_390039	121	57	viable	viable	JJ
10_1101-2020_11_24_390039	121	58	therapeutic	therapeutic	JJ
10_1101-2020_11_24_390039	121	59	targets	target	NNS
10_1101-2020_11_24_390039	121	60	(	(	-LRB-
10_1101-2020_11_24_390039	121	61	Drew	Drew	NNP
10_1101-2020_11_24_390039	121	62	and	and	CC
10_1101-2020_11_24_390039	121	63	Janes	Janes	NNP
10_1101-2020_11_24_390039	121	64	,	,	,
10_1101-2020_11_24_390039	121	65	2020	2020	CD
10_1101-2020_11_24_390039	121	66	;	;	:
10_1101-2020_11_24_390039	121	67	Li	Li	NNP
10_1101-2020_11_24_390039	121	68	et	et	NNP
10_1101-2020_11_24_390039	121	69	al	al	NNP
10_1101-2020_11_24_390039	121	70	.	.	NNP
10_1101-2020_11_24_390039	121	71	,	,	,
10_1101-2020_11_24_390039	121	72	2020	2020	CD
10_1101-2020_11_24_390039	121	73	;	;	:
10_1101-2020_11_24_390039	121	74	Young	Young	NNP
10_1101-2020_11_24_390039	121	75	et	et	NNP
10_1101-2020_11_24_390039	121	76	al	al	NNP
10_1101-2020_11_24_390039	121	77	.	.	NNP
10_1101-2020_11_24_390039	121	78	,	,	,
10_1101-2020_11_24_390039	121	79	2020	2020	CD
10_1101-2020_11_24_390039	121	80	)	)	-RRB-
10_1101-2020_11_24_390039	121	81	.	.	.
10_1101-2020_11_24_390039	122	1	Like	like	IN
10_1101-2020_11_24_390039	122	2	other	other	JJ
10_1101-2020_11_24_390039	122	3	small	small	JJ
10_1101-2020_11_24_390039	122	4	molecule	molecule	NN
10_1101-2020_11_24_390039	122	5	inhibitors	inhibitor	NNS
10_1101-2020_11_24_390039	122	6	that	that	WDT
10_1101-2020_11_24_390039	122	7	target	target	VBP
10_1101-2020_11_24_390039	122	8	fundamental	fundamental	JJ
10_1101-2020_11_24_390039	122	9	cellular	cellular	JJ
10_1101-2020_11_24_390039	122	10	pathways	pathway	NNS
10_1101-2020_11_24_390039	122	11	(	(	-LRB-
10_1101-2020_11_24_390039	122	12	Bojkova	Bojkova	NNP
10_1101-2020_11_24_390039	122	13	et	et	NNP
10_1101-2020_11_24_390039	122	14	al	al	NNP
10_1101-2020_11_24_390039	122	15	.	.	.
10_1101-2020_11_24_390039	123	1	2020	2020	CD
10_1101-2020_11_24_390039	123	2	)	)	-RRB-
10_1101-2020_11_24_390039	123	3	,	,	,
10_1101-2020_11_24_390039	123	4	the	the	DT
10_1101-2020_11_24_390039	123	5	broad	broad	RB
10_1101-2020_11_24_390039	123	6	-	-	HYPH
10_1101-2020_11_24_390039	123	7	ranging	range	VBG
10_1101-2020_11_24_390039	123	8	effects	effect	NNS
10_1101-2020_11_24_390039	123	9	of	of	IN
10_1101-2020_11_24_390039	123	10	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	123	11	inhibitors	inhibitor	NNS
10_1101-2020_11_24_390039	123	12	on	on	IN
10_1101-2020_11_24_390039	123	13	host	host	NN
10_1101-2020_11_24_390039	123	14	cell	cell	NN
10_1101-2020_11_24_390039	123	15	membrane	membrane	NN
10_1101-2020_11_24_390039	123	16	and	and	CC
10_1101-2020_11_24_390039	123	17	secretory	secretory	JJ
10_1101-2020_11_24_390039	123	18	protein	protein	NN
10_1101-2020_11_24_390039	123	19	synthesis	synthesis	NN
10_1101-2020_11_24_390039	123	20	(	(	-LRB-
10_1101-2020_11_24_390039	123	21	Morel	Morel	NNP
10_1101-2020_11_24_390039	123	22	et	et	NNP
10_1101-2020_11_24_390039	123	23	al	al	NNP
10_1101-2020_11_24_390039	123	24	.	.	NNP
10_1101-2020_11_24_390039	123	25	,	,	,
10_1101-2020_11_24_390039	123	26	2018	2018	CD
10_1101-2020_11_24_390039	123	27	;	;	:
10_1101-2020_11_24_390039	123	28	Zong	Zong	NNP
10_1101-2020_11_24_390039	123	29	et	et	NNP
10_1101-2020_11_24_390039	123	30	al	al	NNP
10_1101-2020_11_24_390039	123	31	.	.	.
10_1101-2020_11_24_390039	124	1	2019	2019	CD
10_1101-2020_11_24_390039	124	2	)	)	-RRB-
10_1101-2020_11_24_390039	124	3	,	,	,
10_1101-2020_11_24_390039	124	4	including	include	VBG
10_1101-2020_11_24_390039	124	5	the	the	DT
10_1101-2020_11_24_390039	124	6	strong	strong	JJ
10_1101-2020_11_24_390039	124	7	in	in	IN
10_1101-2020_11_24_390039	124	8	vitro	vitro	FW
10_1101-2020_11_24_390039	124	9	effect	effect	NN
10_1101-2020_11_24_390039	124	10	of	of	IN
10_1101-2020_11_24_390039	124	11	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	124	12	-	-	HYPH
10_1101-2020_11_24_390039	124	13	F	F	NNP
10_1101-2020_11_24_390039	124	14	on	on	IN
10_1101-2020_11_24_390039	124	15	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	124	16	biogenesis	biogenesis	NN
10_1101-2020_11_24_390039	124	17	(	(	-LRB-
10_1101-2020_11_24_390039	124	18	cf	cf	NN
10_1101-2020_11_24_390039	124	19	.	.	.
10_1101-2020_11_24_390039	125	1	Grob	Grob	NNP
10_1101-2020_11_24_390039	125	2	et	et	NNP
10_1101-2020_11_24_390039	125	3	al	al	NNP
10_1101-2020_11_24_390039	125	4	.	.	.
10_1101-2020_11_24_390039	126	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	126	2	-	-	:
10_1101-2020_11_24_390039	126	3	BY	by	IN
10_1101-2020_11_24_390039	126	4	-	-	HYPH
10_1101-2020_11_24_390039	126	5	ND	ND	NNP
10_1101-2020_11_24_390039	126	6	4.0	4.0	CD
10_1101-2020_11_24_390039	126	7	International	international	JJ
10_1101-2020_11_24_390039	126	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	126	9	available	available	JJ
10_1101-2020_11_24_390039	126	10	under	under	IN
10_1101-2020_11_24_390039	126	11	a	a	DT
10_1101-2020_11_24_390039	126	12	(	(	-LRB-
10_1101-2020_11_24_390039	126	13	which	which	WDT
10_1101-2020_11_24_390039	126	14	was	be	VBD
10_1101-2020_11_24_390039	126	15	not	not	RB
10_1101-2020_11_24_390039	126	16	certified	certify	VBN
10_1101-2020_11_24_390039	126	17	by	by	IN
10_1101-2020_11_24_390039	126	18	peer	peer	NN
10_1101-2020_11_24_390039	126	19	review	review	NN
10_1101-2020_11_24_390039	126	20	)	)	-RRB-
10_1101-2020_11_24_390039	126	21	is	be	VBZ
10_1101-2020_11_24_390039	126	22	the	the	DT
10_1101-2020_11_24_390039	126	23	author	author	NN
10_1101-2020_11_24_390039	126	24	/	/	SYM
10_1101-2020_11_24_390039	126	25	funder	funder	NN
10_1101-2020_11_24_390039	126	26	,	,	,
10_1101-2020_11_24_390039	126	27	who	who	WP
10_1101-2020_11_24_390039	126	28	has	have	VBZ
10_1101-2020_11_24_390039	126	29	granted	grant	VBN
10_1101-2020_11_24_390039	126	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	126	31	a	a	DT
10_1101-2020_11_24_390039	126	32	license	license	NN
10_1101-2020_11_24_390039	126	33	to	to	TO
10_1101-2020_11_24_390039	126	34	display	display	VB
10_1101-2020_11_24_390039	126	35	the	the	DT
10_1101-2020_11_24_390039	126	36	preprint	preprint	NN
10_1101-2020_11_24_390039	126	37	in	in	IN
10_1101-2020_11_24_390039	126	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	126	39	.	.	.
10_1101-2020_11_24_390039	127	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	127	2	is	be	VBZ
10_1101-2020_11_24_390039	127	3	The	the	DT
10_1101-2020_11_24_390039	127	4	copyright	copyright	NN
10_1101-2020_11_24_390039	127	5	holder	holder	NN
10_1101-2020_11_24_390039	127	6	for	for	IN
10_1101-2020_11_24_390039	127	7	this	this	DT
10_1101-2020_11_24_390039	127	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	127	9	version	version	NN
10_1101-2020_11_24_390039	127	10	posted	post	VBD
10_1101-2020_11_24_390039	127	11	January	January	NNP
10_1101-2020_11_24_390039	127	12	5	5	CD
10_1101-2020_11_24_390039	127	13	,	,	,
10_1101-2020_11_24_390039	127	14	2021	2021	CD
10_1101-2020_11_24_390039	127	15	.	.	.
10_1101-2020_11_24_390039	127	16	;	;	:
10_1101-2020_11_24_390039	127	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	127	18	:	:	:
10_1101-2020_11_24_390039	127	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	127	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	127	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	127	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	127	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	127	24	-	-	HYPH
10_1101-2020_11_24_390039	127	25	F	F	NNP
10_1101-2020_11_24_390039	127	26	as	as	IN
10_1101-2020_11_24_390039	127	27	a	a	DT
10_1101-2020_11_24_390039	127	28	potential	potential	JJ
10_1101-2020_11_24_390039	127	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	127	30	agent	agent	NN
10_1101-2020_11_24_390039	127	31	Page	Page	NNP
10_1101-2020_11_24_390039	127	32	9	9	CD
10_1101-2020_11_24_390039	127	33	of	of	IN
10_1101-2020_11_24_390039	127	34	21	21	CD
10_1101-2020_11_24_390039	127	35	2020	2020	CD
10_1101-2020_11_24_390039	127	36	)	)	-RRB-
10_1101-2020_11_24_390039	127	37	,	,	,
10_1101-2020_11_24_390039	127	38	present	present	VB
10_1101-2020_11_24_390039	127	39	an	an	DT
10_1101-2020_11_24_390039	127	40	obvious	obvious	JJ
10_1101-2020_11_24_390039	127	41	hurdle	hurdle	NN
10_1101-2020_11_24_390039	127	42	to	to	IN
10_1101-2020_11_24_390039	127	43	their	-PRON-	PRP$
10_1101-2020_11_24_390039	127	44	future	future	JJ
10_1101-2020_11_24_390039	127	45	use	use	NN
10_1101-2020_11_24_390039	127	46	.	.	.
10_1101-2020_11_24_390039	128	1	Nevertheless	nevertheless	RB
10_1101-2020_11_24_390039	128	2	,	,	,
10_1101-2020_11_24_390039	128	3	given	give	VBN
10_1101-2020_11_24_390039	128	4	that	that	IN
10_1101-2020_11_24_390039	128	5	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	128	6	-	-	HYPH
10_1101-2020_11_24_390039	128	7	F	F	NNP
10_1101-2020_11_24_390039	128	8	is	be	VBZ
10_1101-2020_11_24_390039	128	9	a	a	DT
10_1101-2020_11_24_390039	128	10	potent	potent	JJ
10_1101-2020_11_24_390039	128	11	inhibitor	inhibitor	NN
10_1101-2020_11_24_390039	128	12	of	of	IN
10_1101-2020_11_24_390039	128	13	Sec61-mediated	sec61-mediate	VBN
10_1101-2020_11_24_390039	128	14	protein	protein	NN
10_1101-2020_11_24_390039	128	15	translocation	translocation	NN
10_1101-2020_11_24_390039	128	16	in	in	IN
10_1101-2020_11_24_390039	128	17	cell	cell	NN
10_1101-2020_11_24_390039	128	18	culture	culture	NN
10_1101-2020_11_24_390039	128	19	models	model	NNS
10_1101-2020_11_24_390039	128	20	(	(	-LRB-
10_1101-2020_11_24_390039	128	21	Zong	Zong	NNP
10_1101-2020_11_24_390039	128	22	et	et	NNP
10_1101-2020_11_24_390039	128	23	al	al	NNP
10_1101-2020_11_24_390039	128	24	.	.	NNP
10_1101-2020_11_24_390039	128	25	,	,	,
10_1101-2020_11_24_390039	128	26	2019	2019	CD
10_1101-2020_11_24_390039	128	27	)	)	-RRB-
10_1101-2020_11_24_390039	128	28	,	,	,
10_1101-2020_11_24_390039	128	29	and	and	CC
10_1101-2020_11_24_390039	128	30	appears	appear	VBZ
10_1101-2020_11_24_390039	128	31	well	well	RB
10_1101-2020_11_24_390039	128	32	tolerated	tolerate	VBN
10_1101-2020_11_24_390039	128	33	in	in	IN
10_1101-2020_11_24_390039	128	34	mice	mouse	NNS
10_1101-2020_11_24_390039	128	35	(	(	-LRB-
10_1101-2020_11_24_390039	128	36	Zong	Zong	NNP
10_1101-2020_11_24_390039	128	37	et	et	NNP
10_1101-2020_11_24_390039	128	38	al	al	NNP
10_1101-2020_11_24_390039	128	39	.	.	NNP
10_1101-2020_11_24_390039	128	40	,	,	,
10_1101-2020_11_24_390039	128	41	2020	2020	CD
10_1101-2020_11_24_390039	128	42	)	)	-RRB-
10_1101-2020_11_24_390039	128	43	,	,	,
10_1101-2020_11_24_390039	128	44	we	-PRON-	PRP
10_1101-2020_11_24_390039	128	45	propose	propose	VBP
10_1101-2020_11_24_390039	128	46	that	that	IN
10_1101-2020_11_24_390039	128	47	future	future	JJ
10_1101-2020_11_24_390039	128	48	studies	study	NNS
10_1101-2020_11_24_390039	128	49	investigating	investigate	VBG
10_1101-2020_11_24_390039	128	50	its	-PRON-	PRP$
10_1101-2020_11_24_390039	128	51	effect	effect	NN
10_1101-2020_11_24_390039	128	52	on	on	IN
10_1101-2020_11_24_390039	128	53	SARS	SARS	NNP
10_1101-2020_11_24_390039	128	54	-	-	HYPH
10_1101-2020_11_24_390039	128	55	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	128	56	infection	infection	NN
10_1101-2020_11_24_390039	128	57	and	and	CC
10_1101-2020_11_24_390039	128	58	propagation	propagation	NN
10_1101-2020_11_24_390039	128	59	in	in	IN
10_1101-2020_11_24_390039	128	60	cellular	cellular	JJ
10_1101-2020_11_24_390039	128	61	models	model	NNS
10_1101-2020_11_24_390039	128	62	are	be	VBP
10_1101-2020_11_24_390039	128	63	clearly	clearly	RB
10_1101-2020_11_24_390039	128	64	warranted	warrant	VBN
10_1101-2020_11_24_390039	128	65	(	(	-LRB-
10_1101-2020_11_24_390039	128	66	cf	cf	NN
10_1101-2020_11_24_390039	128	67	.	.	.
10_1101-2020_11_24_390039	129	1	Bojkova	Bojkova	NNP
10_1101-2020_11_24_390039	129	2	et	et	NNP
10_1101-2020_11_24_390039	129	3	al	al	NNP
10_1101-2020_11_24_390039	129	4	.	.	.
10_1101-2020_11_24_390039	130	1	2020	2020	CD
10_1101-2020_11_24_390039	130	2	)	)	-RRB-
10_1101-2020_11_24_390039	130	3	.	.	.
10_1101-2020_11_24_390039	131	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	131	2	-	-	:
10_1101-2020_11_24_390039	131	3	BY	by	IN
10_1101-2020_11_24_390039	131	4	-	-	HYPH
10_1101-2020_11_24_390039	131	5	ND	ND	NNP
10_1101-2020_11_24_390039	131	6	4.0	4.0	CD
10_1101-2020_11_24_390039	131	7	International	international	JJ
10_1101-2020_11_24_390039	131	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	131	9	available	available	JJ
10_1101-2020_11_24_390039	131	10	under	under	IN
10_1101-2020_11_24_390039	131	11	a	a	DT
10_1101-2020_11_24_390039	131	12	(	(	-LRB-
10_1101-2020_11_24_390039	131	13	which	which	WDT
10_1101-2020_11_24_390039	131	14	was	be	VBD
10_1101-2020_11_24_390039	131	15	not	not	RB
10_1101-2020_11_24_390039	131	16	certified	certify	VBN
10_1101-2020_11_24_390039	131	17	by	by	IN
10_1101-2020_11_24_390039	131	18	peer	peer	NN
10_1101-2020_11_24_390039	131	19	review	review	NN
10_1101-2020_11_24_390039	131	20	)	)	-RRB-
10_1101-2020_11_24_390039	131	21	is	be	VBZ
10_1101-2020_11_24_390039	131	22	the	the	DT
10_1101-2020_11_24_390039	131	23	author	author	NN
10_1101-2020_11_24_390039	131	24	/	/	SYM
10_1101-2020_11_24_390039	131	25	funder	funder	NN
10_1101-2020_11_24_390039	131	26	,	,	,
10_1101-2020_11_24_390039	131	27	who	who	WP
10_1101-2020_11_24_390039	131	28	has	have	VBZ
10_1101-2020_11_24_390039	131	29	granted	grant	VBN
10_1101-2020_11_24_390039	131	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	131	31	a	a	DT
10_1101-2020_11_24_390039	131	32	license	license	NN
10_1101-2020_11_24_390039	131	33	to	to	TO
10_1101-2020_11_24_390039	131	34	display	display	VB
10_1101-2020_11_24_390039	131	35	the	the	DT
10_1101-2020_11_24_390039	131	36	preprint	preprint	NN
10_1101-2020_11_24_390039	131	37	in	in	IN
10_1101-2020_11_24_390039	131	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	131	39	.	.	.
10_1101-2020_11_24_390039	132	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	132	2	is	be	VBZ
10_1101-2020_11_24_390039	132	3	The	the	DT
10_1101-2020_11_24_390039	132	4	copyright	copyright	NN
10_1101-2020_11_24_390039	132	5	holder	holder	NN
10_1101-2020_11_24_390039	132	6	for	for	IN
10_1101-2020_11_24_390039	132	7	this	this	DT
10_1101-2020_11_24_390039	132	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	132	9	version	version	NN
10_1101-2020_11_24_390039	132	10	posted	post	VBD
10_1101-2020_11_24_390039	132	11	January	January	NNP
10_1101-2020_11_24_390039	132	12	5	5	CD
10_1101-2020_11_24_390039	132	13	,	,	,
10_1101-2020_11_24_390039	132	14	2021	2021	CD
10_1101-2020_11_24_390039	132	15	.	.	.
10_1101-2020_11_24_390039	132	16	;	;	:
10_1101-2020_11_24_390039	132	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	132	18	:	:	:
10_1101-2020_11_24_390039	132	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	132	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	132	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	132	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	132	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	132	24	-	-	HYPH
10_1101-2020_11_24_390039	132	25	F	F	NNP
10_1101-2020_11_24_390039	132	26	as	as	IN
10_1101-2020_11_24_390039	132	27	a	a	DT
10_1101-2020_11_24_390039	132	28	potential	potential	JJ
10_1101-2020_11_24_390039	132	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	132	30	agent	agent	NN
10_1101-2020_11_24_390039	132	31	Page	Page	NNP
10_1101-2020_11_24_390039	132	32	10	10	CD
10_1101-2020_11_24_390039	132	33	of	of	IN
10_1101-2020_11_24_390039	132	34	21	21	CD
10_1101-2020_11_24_390039	132	35	Materials	Materials	NNPS
10_1101-2020_11_24_390039	132	36	and	and	CC
10_1101-2020_11_24_390039	132	37	Methods	Methods	NNP
10_1101-2020_11_24_390039	132	38	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	132	39	-	-	HYPH
10_1101-2020_11_24_390039	132	40	F	F	NNP
10_1101-2020_11_24_390039	132	41	and	and	CC
10_1101-2020_11_24_390039	132	42	Antibodies	Antibodies	NNPS
10_1101-2020_11_24_390039	132	43	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	132	44	-	-	HYPH
10_1101-2020_11_24_390039	132	45	F	F	NNP
10_1101-2020_11_24_390039	132	46	was	be	VBD
10_1101-2020_11_24_390039	132	47	synthesised	synthesise	VBN
10_1101-2020_11_24_390039	132	48	as	as	IN
10_1101-2020_11_24_390039	132	49	previously	previously	RB
10_1101-2020_11_24_390039	132	50	described	describe	VBN
10_1101-2020_11_24_390039	132	51	(	(	-LRB-
10_1101-2020_11_24_390039	132	52	Zong	Zong	NNP
10_1101-2020_11_24_390039	132	53	et	et	NNP
10_1101-2020_11_24_390039	132	54	al	al	NNP
10_1101-2020_11_24_390039	132	55	.	.	NNP
10_1101-2020_11_24_390039	132	56	,	,	,
10_1101-2020_11_24_390039	132	57	in	in	IN
10_1101-2020_11_24_390039	132	58	press	press	NN
10_1101-2020_11_24_390039	132	59	)	)	-RRB-
10_1101-2020_11_24_390039	132	60	.	.	.
10_1101-2020_11_24_390039	133	1	Antibodies	antibody	NNS
10_1101-2020_11_24_390039	133	2	used	use	VBD
10_1101-2020_11_24_390039	133	3	to	to	TO
10_1101-2020_11_24_390039	133	4	validate	validate	VB
10_1101-2020_11_24_390039	133	5	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	133	6	and/or	and/or	CC
10_1101-2020_11_24_390039	133	7	EMC	EMC	NNP
10_1101-2020_11_24_390039	133	8	subunit	subunit	NN
10_1101-2020_11_24_390039	133	9	depletions	depletion	NNS
10_1101-2020_11_24_390039	133	10	in	in	IN
10_1101-2020_11_24_390039	133	11	SP	SP	NNP
10_1101-2020_11_24_390039	133	12	cells	cell	NNS
10_1101-2020_11_24_390039	133	13	(	(	-LRB-
10_1101-2020_11_24_390039	133	14	Fig	fig	NN
10_1101-2020_11_24_390039	133	15	.	.	.
10_1101-2020_11_24_390039	134	1	S2	s2	NN
10_1101-2020_11_24_390039	134	2	)	)	-RRB-
10_1101-2020_11_24_390039	134	3	were	be	VBD
10_1101-2020_11_24_390039	134	4	purchased	purchase	VBN
10_1101-2020_11_24_390039	134	5	from	from	IN
10_1101-2020_11_24_390039	134	6	Santa	Santa	NNP
10_1101-2020_11_24_390039	134	7	Cruz	Cruz	NNP
10_1101-2020_11_24_390039	134	8	Biotechnology	Biotechnology	NNP
10_1101-2020_11_24_390039	134	9	(	(	-LRB-
10_1101-2020_11_24_390039	134	10	goat	goat	NNP
10_1101-2020_11_24_390039	134	11	polyclonal	polyclonal	JJ
10_1101-2020_11_24_390039	134	12	anti-	anti-	NNP
10_1101-2020_11_24_390039	134	13	LMNB1	LMNB1	''
10_1101-2020_11_24_390039	134	14	(	(	-LRB-
10_1101-2020_11_24_390039	134	15	clone	clone	NN
10_1101-2020_11_24_390039	134	16	M-20	m-20	CD
10_1101-2020_11_24_390039	134	17	,	,	,
10_1101-2020_11_24_390039	134	18	sc-6217	sc-6217	NNP
10_1101-2020_11_24_390039	134	19	)	)	-RRB-
10_1101-2020_11_24_390039	134	20	,	,	,
10_1101-2020_11_24_390039	134	21	Bethyl	Bethyl	NNP
10_1101-2020_11_24_390039	134	22	Laboratories	Laboratories	NNP
10_1101-2020_11_24_390039	134	23	(	(	-LRB-
10_1101-2020_11_24_390039	134	24	rabbit	rabbit	NN
10_1101-2020_11_24_390039	134	25	polyclonal	polyclonal	JJ
10_1101-2020_11_24_390039	134	26	anti	anti	JJ
10_1101-2020_11_24_390039	134	27	-	-	JJ
10_1101-2020_11_24_390039	134	28	EMC5	emc5	JJ
10_1101-2020_11_24_390039	134	29	(	(	-LRB-
10_1101-2020_11_24_390039	134	30	A305	A305	NNP
10_1101-2020_11_24_390039	134	31	-	-	HYPH
10_1101-2020_11_24_390039	134	32	832-A	832-A	NNP
10_1101-2020_11_24_390039	134	33	)	)	-RRB-
10_1101-2020_11_24_390039	134	34	)	)	-RRB-
10_1101-2020_11_24_390039	134	35	,	,	,
10_1101-2020_11_24_390039	134	36	Abcam	Abcam	NNP
10_1101-2020_11_24_390039	134	37	(	(	-LRB-
10_1101-2020_11_24_390039	134	38	rabbit	rabbit	NN
10_1101-2020_11_24_390039	134	39	polyclonal	polyclonal	JJ
10_1101-2020_11_24_390039	134	40	anti	anti	JJ
10_1101-2020_11_24_390039	134	41	-	-	NNP
10_1101-2020_11_24_390039	134	42	EMC6	EMC6	NNP
10_1101-2020_11_24_390039	134	43	,	,	,
10_1101-2020_11_24_390039	134	44	(	(	-LRB-
10_1101-2020_11_24_390039	134	45	ab84902	ab84902	FW
10_1101-2020_11_24_390039	134	46	)	)	-RRB-
10_1101-2020_11_24_390039	134	47	)	)	-RRB-
10_1101-2020_11_24_390039	134	48	,	,	,
10_1101-2020_11_24_390039	134	49	gifted	gift	VBN
10_1101-2020_11_24_390039	134	50	by	by	IN
10_1101-2020_11_24_390039	134	51	Sven	Sven	NNP
10_1101-2020_11_24_390039	134	52	Lang	Lang	NNP
10_1101-2020_11_24_390039	134	53	and	and	CC
10_1101-2020_11_24_390039	134	54	Richard	Richard	NNP
10_1101-2020_11_24_390039	134	55	Zimmermann	Zimmermann	NNP
10_1101-2020_11_24_390039	134	56	(	(	-LRB-
10_1101-2020_11_24_390039	134	57	University	University	NNP
10_1101-2020_11_24_390039	134	58	of	of	IN
10_1101-2020_11_24_390039	134	59	Saarland	Saarland	NNP
10_1101-2020_11_24_390039	134	60	,	,	,
10_1101-2020_11_24_390039	134	61	Homburg	Homburg	NNP
10_1101-2020_11_24_390039	134	62	,	,	,
10_1101-2020_11_24_390039	134	63	Germany	Germany	NNP
10_1101-2020_11_24_390039	134	64	,	,	,
10_1101-2020_11_24_390039	134	65	rabbit	rabbit	NN
10_1101-2020_11_24_390039	134	66	anti	anti	JJ
10_1101-2020_11_24_390039	134	67	-	-	JJ
10_1101-2020_11_24_390039	134	68	Sec61α	sec61α	JJ
10_1101-2020_11_24_390039	134	69	)	)	-RRB-
10_1101-2020_11_24_390039	134	70	or	or	CC
10_1101-2020_11_24_390039	134	71	as	as	RB
10_1101-2020_11_24_390039	134	72	previously	previously	RB
10_1101-2020_11_24_390039	134	73	described	describe	VBN
10_1101-2020_11_24_390039	134	74	(	(	-LRB-
10_1101-2020_11_24_390039	134	75	mouse	mouse	NN
10_1101-2020_11_24_390039	134	76	monoclonal	monoclonal	JJ
10_1101-2020_11_24_390039	134	77	anti	anti	NNP
10_1101-2020_11_24_390039	134	78	-	-	JJ
10_1101-2020_11_24_390039	134	79	OPG2	opg2	JJ
10_1101-2020_11_24_390039	134	80	tag	tag	NN
10_1101-2020_11_24_390039	134	81	(	(	-LRB-
10_1101-2020_11_24_390039	134	82	McKenna	McKenna	NNP
10_1101-2020_11_24_390039	134	83	et	et	NNP
10_1101-2020_11_24_390039	134	84	al	al	NNP
10_1101-2020_11_24_390039	134	85	.	.	NNP
10_1101-2020_11_24_390039	134	86	,	,	,
10_1101-2020_11_24_390039	134	87	2016	2016	CD
10_1101-2020_11_24_390039	134	88	)	)	-RRB-
10_1101-2020_11_24_390039	134	89	and	and	CC
10_1101-2020_11_24_390039	134	90	rabbit	rabbit	NN
10_1101-2020_11_24_390039	134	91	polyclonal	polyclonal	JJ
10_1101-2020_11_24_390039	134	92	anti	anti	JJ
10_1101-2020_11_24_390039	134	93	-	-	JJ
10_1101-2020_11_24_390039	134	94	OST48	ost48	JJ
10_1101-2020_11_24_390039	134	95	(	(	-LRB-
10_1101-2020_11_24_390039	134	96	Wilson	Wilson	NNP
10_1101-2020_11_24_390039	134	97	et	et	NNP
10_1101-2020_11_24_390039	134	98	al	al	NNP
10_1101-2020_11_24_390039	134	99	.	.	NNP
10_1101-2020_11_24_390039	134	100	,	,	,
10_1101-2020_11_24_390039	134	101	2007	2007	CD
10_1101-2020_11_24_390039	134	102	)	)	-RRB-
10_1101-2020_11_24_390039	134	103	.	.	.
10_1101-2020_11_24_390039	135	1	DNA	DNA	NNP
10_1101-2020_11_24_390039	135	2	constructs	construct	VBZ
10_1101-2020_11_24_390039	135	3	The	the	DT
10_1101-2020_11_24_390039	135	4	cDNA	cdna	NN
10_1101-2020_11_24_390039	135	5	for	for	IN
10_1101-2020_11_24_390039	135	6	human	human	JJ
10_1101-2020_11_24_390039	135	7	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	135	8	(	(	-LRB-
10_1101-2020_11_24_390039	135	9	Uniprot	Uniprot	NNP
10_1101-2020_11_24_390039	135	10	:	:	:
10_1101-2020_11_24_390039	135	11	Q9BYF1	Q9BYF1	NNP
10_1101-2020_11_24_390039	135	12	)	)	-RRB-
10_1101-2020_11_24_390039	135	13	was	be	VBD
10_1101-2020_11_24_390039	135	14	purchased	purchase	VBN
10_1101-2020_11_24_390039	135	15	from	from	IN
10_1101-2020_11_24_390039	135	16	Sino	Sino	NNP
10_1101-2020_11_24_390039	135	17	Biological	Biological	NNP
10_1101-2020_11_24_390039	135	18	(	(	-LRB-
10_1101-2020_11_24_390039	135	19	HG10108-M	HG10108-M	NNP
10_1101-2020_11_24_390039	135	20	)	)	-RRB-
10_1101-2020_11_24_390039	135	21	.	.	.
10_1101-2020_11_24_390039	136	1	cDNAs	cDNAs	NNP
10_1101-2020_11_24_390039	136	2	encoding	encode	VBG
10_1101-2020_11_24_390039	136	3	the	the	DT
10_1101-2020_11_24_390039	136	4	SARS	SARS	NNP
10_1101-2020_11_24_390039	136	5	-	-	HYPH
10_1101-2020_11_24_390039	136	6	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	136	7	genes	gene	NNS
10_1101-2020_11_24_390039	136	8	for	for	IN
10_1101-2020_11_24_390039	136	9	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	136	10	,	,	,
10_1101-2020_11_24_390039	136	11	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	136	12	and	and	CC
10_1101-2020_11_24_390039	136	13	the	the	DT
10_1101-2020_11_24_390039	136	14	E	E	NNP
10_1101-2020_11_24_390039	136	15	M	M	NNP
10_1101-2020_11_24_390039	136	16	and	and	CC
10_1101-2020_11_24_390039	136	17	S	S	NNP
10_1101-2020_11_24_390039	136	18	proteins	protein	NNS
10_1101-2020_11_24_390039	136	19	(	(	-LRB-
10_1101-2020_11_24_390039	136	20	Uniprot	Uniprot	NNP
10_1101-2020_11_24_390039	136	21	:	:	:
10_1101-2020_11_24_390039	136	22	P0DTC6	p0dtc6	NN
10_1101-2020_11_24_390039	136	23	,	,	,
10_1101-2020_11_24_390039	136	24	P0DTC8	P0DTC8	NNP
10_1101-2020_11_24_390039	136	25	,	,	,
10_1101-2020_11_24_390039	136	26	P0DTC4	P0DTC4	NNP
10_1101-2020_11_24_390039	136	27	,	,	,
10_1101-2020_11_24_390039	136	28	P0DTC5	P0DTC5	NNP
10_1101-2020_11_24_390039	136	29	,	,	,
10_1101-2020_11_24_390039	136	30	P0DTC2	P0DTC2	NNP
10_1101-2020_11_24_390039	136	31	respectively	respectively	RB
10_1101-2020_11_24_390039	136	32	)	)	-RRB-
10_1101-2020_11_24_390039	136	33	were	be	VBD
10_1101-2020_11_24_390039	136	34	kindly	kindly	RB
10_1101-2020_11_24_390039	136	35	provided	provide	VBN
10_1101-2020_11_24_390039	136	36	by	by	IN
10_1101-2020_11_24_390039	136	37	Nevan	Nevan	NNP
10_1101-2020_11_24_390039	136	38	Krogan	Krogan	NNP
10_1101-2020_11_24_390039	136	39	(	(	-LRB-
10_1101-2020_11_24_390039	136	40	UCSF	UCSF	NNP
10_1101-2020_11_24_390039	136	41	,	,	,
10_1101-2020_11_24_390039	136	42	US	US	NNP
10_1101-2020_11_24_390039	136	43	)	)	-RRB-
10_1101-2020_11_24_390039	136	44	(	(	-LRB-
10_1101-2020_11_24_390039	136	45	Gordon	Gordon	NNP
10_1101-2020_11_24_390039	136	46	et	et	FW
10_1101-2020_11_24_390039	136	47	al	al	NNP
10_1101-2020_11_24_390039	136	48	.	.	.
10_1101-2020_11_24_390039	137	1	2020	2020	CD
10_1101-2020_11_24_390039	137	2	)	)	-RRB-
10_1101-2020_11_24_390039	137	3	,	,	,
10_1101-2020_11_24_390039	137	4	amplified	amplify	VBN
10_1101-2020_11_24_390039	137	5	by	by	IN
10_1101-2020_11_24_390039	137	6	PCR	PCR	NNP
10_1101-2020_11_24_390039	137	7	,	,	,
10_1101-2020_11_24_390039	137	8	subcloned	subclone	VBN
10_1101-2020_11_24_390039	137	9	into	into	IN
10_1101-2020_11_24_390039	137	10	the	the	DT
10_1101-2020_11_24_390039	137	11	pcDNA5	pcDNA5	NNP
10_1101-2020_11_24_390039	137	12	vector	vector	NN
10_1101-2020_11_24_390039	137	13	and	and	CC
10_1101-2020_11_24_390039	137	14	constructs	construct	NNS
10_1101-2020_11_24_390039	137	15	validated	validate	VBN
10_1101-2020_11_24_390039	137	16	by	by	IN
10_1101-2020_11_24_390039	137	17	DNA	DNA	NNP
10_1101-2020_11_24_390039	137	18	sequencing	sequencing	NN
10_1101-2020_11_24_390039	137	19	(	(	-LRB-
10_1101-2020_11_24_390039	137	20	GATC	GATC	NNP
10_1101-2020_11_24_390039	137	21	,	,	,
10_1101-2020_11_24_390039	137	22	Eurofins	Eurofins	NNP
10_1101-2020_11_24_390039	137	23	Genomics	Genomics	NNP
10_1101-2020_11_24_390039	137	24	)	)	-RRB-
10_1101-2020_11_24_390039	137	25	.	.	.
10_1101-2020_11_24_390039	138	1	ORF6-OPG2	ORF6-OPG2	NNP
10_1101-2020_11_24_390039	138	2	,	,	,
10_1101-2020_11_24_390039	138	3	ORF8-OPG2	ORF8-OPG2	NNP
10_1101-2020_11_24_390039	138	4	,	,	,
10_1101-2020_11_24_390039	138	5	M	M	NNP
10_1101-2020_11_24_390039	138	6	-	-	HYPH
10_1101-2020_11_24_390039	138	7	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	138	8	and	and	CC
10_1101-2020_11_24_390039	138	9	S	S	NNP
10_1101-2020_11_24_390039	138	10	-	-	HYPH
10_1101-2020_11_24_390039	138	11	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	138	12	were	be	VBD
10_1101-2020_11_24_390039	138	13	generated	generate	VBN
10_1101-2020_11_24_390039	138	14	by	by	IN
10_1101-2020_11_24_390039	138	15	inserting	insert	VBG
10_1101-2020_11_24_390039	138	16	the	the	DT
10_1101-2020_11_24_390039	138	17	respective	respective	JJ
10_1101-2020_11_24_390039	138	18	cDNAs	cdnas	NN
10_1101-2020_11_24_390039	138	19	in	in	IN
10_1101-2020_11_24_390039	138	20	frame	frame	NN
10_1101-2020_11_24_390039	138	21	between	between	IN
10_1101-2020_11_24_390039	138	22	NheI	NheI	NNP
10_1101-2020_11_24_390039	138	23	and	and	CC
10_1101-2020_11_24_390039	138	24	AflII	AflII	NNP
10_1101-2020_11_24_390039	138	25	sites	site	NNS
10_1101-2020_11_24_390039	138	26	of	of	IN
10_1101-2020_11_24_390039	138	27	a	a	DT
10_1101-2020_11_24_390039	138	28	pcDNA5	pcDNA5	NNP
10_1101-2020_11_24_390039	138	29	/	/	SYM
10_1101-2020_11_24_390039	138	30	FRT	frt	NN
10_1101-2020_11_24_390039	138	31	/	/	SYM
10_1101-2020_11_24_390039	138	32	V5-	V5-	NNP
10_1101-2020_11_24_390039	138	33	His	-PRON-	PRP$
10_1101-2020_11_24_390039	138	34	vector	vector	NN
10_1101-2020_11_24_390039	138	35	(	(	-LRB-
10_1101-2020_11_24_390039	138	36	Invitrogen	Invitrogen	NNP
10_1101-2020_11_24_390039	138	37	)	)	-RRB-
10_1101-2020_11_24_390039	138	38	containing	contain	VBG
10_1101-2020_11_24_390039	138	39	a	a	DT
10_1101-2020_11_24_390039	138	40	C	C	NNP
10_1101-2020_11_24_390039	138	41	-	-	HYPH
10_1101-2020_11_24_390039	138	42	terminal	terminal	JJ
10_1101-2020_11_24_390039	138	43	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	138	44	tag	tag	NN
10_1101-2020_11_24_390039	138	45	(	(	-LRB-
10_1101-2020_11_24_390039	138	46	MNGTEGPNFYVPFSNKTG	MNGTEGPNFYVPFSNKTG	NNP
10_1101-2020_11_24_390039	138	47	)	)	-RRB-
10_1101-2020_11_24_390039	138	48	.	.	.
10_1101-2020_11_24_390039	139	1	OPG2-E	OPG2-E	NNP
10_1101-2020_11_24_390039	139	2	was	be	VBD
10_1101-2020_11_24_390039	139	3	generated	generate	VBN
10_1101-2020_11_24_390039	139	4	by	by	IN
10_1101-2020_11_24_390039	139	5	cloning	clone	VBG
10_1101-2020_11_24_390039	139	6	the	the	DT
10_1101-2020_11_24_390039	139	7	cDNA	cdna	NN
10_1101-2020_11_24_390039	139	8	encoding	encode	VBG
10_1101-2020_11_24_390039	139	9	the	the	DT
10_1101-2020_11_24_390039	139	10	E	e	NN
10_1101-2020_11_24_390039	139	11	-	-	NN
10_1101-2020_11_24_390039	139	12	protein	protein	NN
10_1101-2020_11_24_390039	139	13	into	into	IN
10_1101-2020_11_24_390039	139	14	the	the	DT
10_1101-2020_11_24_390039	139	15	same	same	JJ
10_1101-2020_11_24_390039	139	16	pcDNA5-OPG2	pcDNA5-OPG2	NNP
10_1101-2020_11_24_390039	139	17	vector	vector	NN
10_1101-2020_11_24_390039	139	18	using	use	VBG
10_1101-2020_11_24_390039	139	19	the	the	DT
10_1101-2020_11_24_390039	139	20	KpnI	KpnI	NNP
10_1101-2020_11_24_390039	139	21	and	and	CC
10_1101-2020_11_24_390039	139	22	BamHI	BamHI	NNP
10_1101-2020_11_24_390039	139	23	sites	site	NNS
10_1101-2020_11_24_390039	139	24	and	and	CC
10_1101-2020_11_24_390039	139	25	deleting	delete	VBG
10_1101-2020_11_24_390039	139	26	the	the	DT
10_1101-2020_11_24_390039	139	27	stop	stop	NN
10_1101-2020_11_24_390039	139	28	codon	codon	NN
10_1101-2020_11_24_390039	139	29	after	after	IN
10_1101-2020_11_24_390039	139	30	the	the	DT
10_1101-2020_11_24_390039	139	31	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	139	32	tag	tag	NN
10_1101-2020_11_24_390039	139	33	by	by	IN
10_1101-2020_11_24_390039	139	34	site	site	NN
10_1101-2020_11_24_390039	139	35	-	-	HYPH
10_1101-2020_11_24_390039	139	36	directed	direct	VBN
10_1101-2020_11_24_390039	139	37	mutagenesis	mutagenesis	NN
10_1101-2020_11_24_390039	139	38	(	(	-LRB-
10_1101-2020_11_24_390039	139	39	Stratagene	Stratagene	NNP
10_1101-2020_11_24_390039	139	40	QuikChange	QuikChange	NNP
10_1101-2020_11_24_390039	139	41	,	,	,
10_1101-2020_11_24_390039	139	42	Agilent	Agilent	NNP
10_1101-2020_11_24_390039	139	43	Technologies	Technologies	NNP
10_1101-2020_11_24_390039	139	44	)	)	-RRB-
10_1101-2020_11_24_390039	139	45	.	.	.
10_1101-2020_11_24_390039	140	1	The	the	DT
10_1101-2020_11_24_390039	140	2	N	n	CD
10_1101-2020_11_24_390039	140	3	-	-	HYPH
10_1101-2020_11_24_390039	140	4	terminal	terminal	NN
10_1101-2020_11_24_390039	140	5	OPG2-tag	OPG2-tag	NNP
10_1101-2020_11_24_390039	140	6	of	of	IN
10_1101-2020_11_24_390039	140	7	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	140	8	was	be	VBD
10_1101-2020_11_24_390039	140	9	inserted	insert	VBN
10_1101-2020_11_24_390039	140	10	by	by	IN
10_1101-2020_11_24_390039	140	11	site	site	NN
10_1101-2020_11_24_390039	140	12	-	-	HYPH
10_1101-2020_11_24_390039	140	13	directed	direct	VBN
10_1101-2020_11_24_390039	140	14	mutagenesis	mutagenesis	NN
10_1101-2020_11_24_390039	140	15	of	of	IN
10_1101-2020_11_24_390039	140	16	ORF6-OPG2	ORF6-OPG2	NNP
10_1101-2020_11_24_390039	140	17	using	use	VBG
10_1101-2020_11_24_390039	140	18	the	the	DT
10_1101-2020_11_24_390039	140	19	relevant	relevant	JJ
10_1101-2020_11_24_390039	140	20	forward	forward	NN
10_1101-2020_11_24_390039	140	21	and	and	CC
10_1101-2020_11_24_390039	140	22	reverse	reverse	VB
10_1101-2020_11_24_390039	140	23	primers	primer	NNS
10_1101-2020_11_24_390039	140	24	(	(	-LRB-
10_1101-2020_11_24_390039	140	25	Integrated	Integrated	NNP
10_1101-2020_11_24_390039	140	26	DNA	DNA	NNP
10_1101-2020_11_24_390039	140	27	Technologies	Technologies	NNP
10_1101-2020_11_24_390039	140	28	)	)	-RRB-
10_1101-2020_11_24_390039	140	29	.	.	.
10_1101-2020_11_24_390039	141	1	Linear	linear	JJ
10_1101-2020_11_24_390039	141	2	DNA	dna	NN
10_1101-2020_11_24_390039	141	3	templates	template	NNS
10_1101-2020_11_24_390039	141	4	were	be	VBD
10_1101-2020_11_24_390039	141	5	generated	generate	VBN
10_1101-2020_11_24_390039	141	6	by	by	IN
10_1101-2020_11_24_390039	141	7	PCR	PCR	NNP
10_1101-2020_11_24_390039	141	8	and	and	CC
10_1101-2020_11_24_390039	141	9	mRNA	mRNA	NNP
10_1101-2020_11_24_390039	141	10	transcribed	transcribed	NNP
10_1101-2020_11_24_390039	141	11	using	use	VBG
10_1101-2020_11_24_390039	141	12	T7	T7	NNP
10_1101-2020_11_24_390039	141	13	polymerase	polymerase	NN
10_1101-2020_11_24_390039	141	14	.	.	.
10_1101-2020_11_24_390039	142	1	siRNA	siRNA	NNP
10_1101-2020_11_24_390039	142	2	-	-	HYPH
10_1101-2020_11_24_390039	142	3	mediated	mediate	VBN
10_1101-2020_11_24_390039	142	4	knockdown	knockdown	NN
10_1101-2020_11_24_390039	142	5	and	and	CC
10_1101-2020_11_24_390039	142	6	SP	SP	NNP
10_1101-2020_11_24_390039	142	7	cell	cell	NN
10_1101-2020_11_24_390039	142	8	preparation	preparation	NN
10_1101-2020_11_24_390039	142	9	HeLa	HeLa	NNP
10_1101-2020_11_24_390039	142	10	cells	cell	NNS
10_1101-2020_11_24_390039	142	11	(	(	-LRB-
10_1101-2020_11_24_390039	142	12	human	human	JJ
10_1101-2020_11_24_390039	142	13	epithelial	epithelial	JJ
10_1101-2020_11_24_390039	142	14	cervix	cervix	NN
10_1101-2020_11_24_390039	142	15	carcinoma	carcinoma	NN
10_1101-2020_11_24_390039	142	16	cells	cell	NNS
10_1101-2020_11_24_390039	142	17	)	)	-RRB-
10_1101-2020_11_24_390039	142	18	were	be	VBD
10_1101-2020_11_24_390039	142	19	cultured	culture	VBN
10_1101-2020_11_24_390039	142	20	in	in	IN
10_1101-2020_11_24_390039	142	21	DMEM	DMEM	NNP
10_1101-2020_11_24_390039	142	22	supplemented	supplement	VBN
10_1101-2020_11_24_390039	142	23	with	with	IN
10_1101-2020_11_24_390039	142	24	10	10	CD
10_1101-2020_11_24_390039	142	25	%	%	NN
10_1101-2020_11_24_390039	142	26	(	(	-LRB-
10_1101-2020_11_24_390039	142	27	v	v	NN
10_1101-2020_11_24_390039	142	28	/	/	SYM
10_1101-2020_11_24_390039	142	29	v	v	NN
10_1101-2020_11_24_390039	142	30	)	)	-RRB-
10_1101-2020_11_24_390039	142	31	FBS	FBS	NNP
10_1101-2020_11_24_390039	142	32	and	and	CC
10_1101-2020_11_24_390039	142	33	maintained	maintain	VBD
10_1101-2020_11_24_390039	142	34	in	in	IN
10_1101-2020_11_24_390039	142	35	a	a	DT
10_1101-2020_11_24_390039	142	36	5	5	CD
10_1101-2020_11_24_390039	142	37	%	%	NN
10_1101-2020_11_24_390039	142	38	CO2	CO2	NNP
10_1101-2020_11_24_390039	142	39	humidified	humidify	VBD
10_1101-2020_11_24_390039	142	40	incubator	incubator	NN
10_1101-2020_11_24_390039	142	41	at	at	IN
10_1101-2020_11_24_390039	142	42	37	37	CD
10_1101-2020_11_24_390039	142	43	°	°	NNS
10_1101-2020_11_24_390039	142	44	C	C	NNP
10_1101-2020_11_24_390039	142	45	.	.	.
10_1101-2020_11_24_390039	143	1	Knockdown	Knockdown	VBN
10_1101-2020_11_24_390039	143	2	of	of	IN
10_1101-2020_11_24_390039	143	3	target	target	NN
10_1101-2020_11_24_390039	143	4	genes	gene	NNS
10_1101-2020_11_24_390039	143	5	were	be	VBD
10_1101-2020_11_24_390039	143	6	performed	perform	VBN
10_1101-2020_11_24_390039	143	7	as	as	IN
10_1101-2020_11_24_390039	143	8	previously	previously	RB
10_1101-2020_11_24_390039	143	9	.CC	.CC	:
10_1101-2020_11_24_390039	143	10	-	-	:
10_1101-2020_11_24_390039	143	11	BY	by	IN
10_1101-2020_11_24_390039	143	12	-	-	HYPH
10_1101-2020_11_24_390039	143	13	ND	ND	NNP
10_1101-2020_11_24_390039	143	14	4.0	4.0	CD
10_1101-2020_11_24_390039	143	15	International	international	JJ
10_1101-2020_11_24_390039	143	16	licensemade	licensemade	NN
10_1101-2020_11_24_390039	143	17	available	available	JJ
10_1101-2020_11_24_390039	143	18	under	under	IN
10_1101-2020_11_24_390039	143	19	a	a	DT
10_1101-2020_11_24_390039	143	20	(	(	-LRB-
10_1101-2020_11_24_390039	143	21	which	which	WDT
10_1101-2020_11_24_390039	143	22	was	be	VBD
10_1101-2020_11_24_390039	143	23	not	not	RB
10_1101-2020_11_24_390039	143	24	certified	certify	VBN
10_1101-2020_11_24_390039	143	25	by	by	IN
10_1101-2020_11_24_390039	143	26	peer	peer	NN
10_1101-2020_11_24_390039	143	27	review	review	NN
10_1101-2020_11_24_390039	143	28	)	)	-RRB-
10_1101-2020_11_24_390039	143	29	is	be	VBZ
10_1101-2020_11_24_390039	143	30	the	the	DT
10_1101-2020_11_24_390039	143	31	author	author	NN
10_1101-2020_11_24_390039	143	32	/	/	SYM
10_1101-2020_11_24_390039	143	33	funder	funder	NN
10_1101-2020_11_24_390039	143	34	,	,	,
10_1101-2020_11_24_390039	143	35	who	who	WP
10_1101-2020_11_24_390039	143	36	has	have	VBZ
10_1101-2020_11_24_390039	143	37	granted	grant	VBN
10_1101-2020_11_24_390039	143	38	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	143	39	a	a	DT
10_1101-2020_11_24_390039	143	40	license	license	NN
10_1101-2020_11_24_390039	143	41	to	to	TO
10_1101-2020_11_24_390039	143	42	display	display	VB
10_1101-2020_11_24_390039	143	43	the	the	DT
10_1101-2020_11_24_390039	143	44	preprint	preprint	NN
10_1101-2020_11_24_390039	143	45	in	in	IN
10_1101-2020_11_24_390039	143	46	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	143	47	.	.	.
10_1101-2020_11_24_390039	144	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	144	2	is	be	VBZ
10_1101-2020_11_24_390039	144	3	The	the	DT
10_1101-2020_11_24_390039	144	4	copyright	copyright	NN
10_1101-2020_11_24_390039	144	5	holder	holder	NN
10_1101-2020_11_24_390039	144	6	for	for	IN
10_1101-2020_11_24_390039	144	7	this	this	DT
10_1101-2020_11_24_390039	144	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	144	9	version	version	NN
10_1101-2020_11_24_390039	144	10	posted	post	VBD
10_1101-2020_11_24_390039	144	11	January	January	NNP
10_1101-2020_11_24_390039	144	12	5	5	CD
10_1101-2020_11_24_390039	144	13	,	,	,
10_1101-2020_11_24_390039	144	14	2021	2021	CD
10_1101-2020_11_24_390039	144	15	.	.	.
10_1101-2020_11_24_390039	144	16	;	;	:
10_1101-2020_11_24_390039	144	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	144	18	:	:	:
10_1101-2020_11_24_390039	144	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	144	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	144	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	144	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	144	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	144	24	-	-	HYPH
10_1101-2020_11_24_390039	144	25	F	F	NNP
10_1101-2020_11_24_390039	144	26	as	as	IN
10_1101-2020_11_24_390039	144	27	a	a	DT
10_1101-2020_11_24_390039	144	28	potential	potential	JJ
10_1101-2020_11_24_390039	144	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	144	30	agent	agent	NN
10_1101-2020_11_24_390039	144	31	Page	Page	NNP
10_1101-2020_11_24_390039	144	32	11	11	CD
10_1101-2020_11_24_390039	144	33	of	of	IN
10_1101-2020_11_24_390039	144	34	21	21	CD
10_1101-2020_11_24_390039	144	35	described	describe	VBN
10_1101-2020_11_24_390039	144	36	(	(	-LRB-
10_1101-2020_11_24_390039	144	37	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	144	38	et	et	NNP
10_1101-2020_11_24_390039	144	39	al	al	NNP
10_1101-2020_11_24_390039	144	40	.	.	NNP
10_1101-2020_11_24_390039	144	41	,	,	,
10_1101-2020_11_24_390039	144	42	2020	2020	CD
10_1101-2020_11_24_390039	144	43	submitted	submit	VBN
10_1101-2020_11_24_390039	144	44	)	)	-RRB-
10_1101-2020_11_24_390039	144	45	using	use	VBG
10_1101-2020_11_24_390039	144	46	20	20	CD
10_1101-2020_11_24_390039	144	47	nM	nM	NNP
10_1101-2020_11_24_390039	144	48	(	(	-LRB-
10_1101-2020_11_24_390039	144	49	final	final	JJ
10_1101-2020_11_24_390039	144	50	concentration	concentration	NN
10_1101-2020_11_24_390039	144	51	)	)	-RRB-
10_1101-2020_11_24_390039	144	52	of	of	IN
10_1101-2020_11_24_390039	144	53	either	either	DT
10_1101-2020_11_24_390039	144	54	control	control	NN
10_1101-2020_11_24_390039	144	55	siRNA	siRNA	.
10_1101-2020_11_24_390039	144	56	(	(	-LRB-
10_1101-2020_11_24_390039	144	57	ON	ON	NNP
10_1101-2020_11_24_390039	144	58	-	-	HYPH
10_1101-2020_11_24_390039	144	59	TARGETplus	TARGETplus	NNP
10_1101-2020_11_24_390039	144	60	Non	non	JJ
10_1101-2020_11_24_390039	144	61	-	-	JJ
10_1101-2020_11_24_390039	144	62	targeting	targeting	JJ
10_1101-2020_11_24_390039	144	63	control	control	NN
10_1101-2020_11_24_390039	144	64	pool	pool	NN
10_1101-2020_11_24_390039	144	65	;	;	:
10_1101-2020_11_24_390039	144	66	Dharmacon	Dharmacon	NNP
10_1101-2020_11_24_390039	144	67	)	)	-RRB-
10_1101-2020_11_24_390039	144	68	,	,	,
10_1101-2020_11_24_390039	144	69	SEC61A1	sec61a1	NN
10_1101-2020_11_24_390039	144	70	siRNA	siRNA	.
10_1101-2020_11_24_390039	144	71	(	(	-LRB-
10_1101-2020_11_24_390039	144	72	Sec61α	Sec61α	NNP
10_1101-2020_11_24_390039	144	73	-	-	HYPH
10_1101-2020_11_24_390039	144	74	kd	kd	NNP
10_1101-2020_11_24_390039	144	75	,	,	,
10_1101-2020_11_24_390039	144	76	GE	GE	NNP
10_1101-2020_11_24_390039	144	77	Healthcare	Healthcare	NNP
10_1101-2020_11_24_390039	144	78	,	,	,
10_1101-2020_11_24_390039	144	79	sequence	sequence	NN
10_1101-2020_11_24_390039	144	80	AACACUGAAAUGUCUACGUUUUU	AACACUGAAAUGUCUACGUUUUU	NNP
10_1101-2020_11_24_390039	144	81	)	)	-RRB-
10_1101-2020_11_24_390039	144	82	,	,	,
10_1101-2020_11_24_390039	144	83	MMGT1	MMGT1	''
10_1101-2020_11_24_390039	144	84	siRNA	siRNA	NNP
10_1101-2020_11_24_390039	144	85	(	(	-LRB-
10_1101-2020_11_24_390039	144	86	EMC5-kd	EMC5-kd	NNP
10_1101-2020_11_24_390039	144	87	,	,	,
10_1101-2020_11_24_390039	144	88	ThermoFisher	ThermoFisher	NNP
10_1101-2020_11_24_390039	144	89	Scientific	Scientific	NNP
10_1101-2020_11_24_390039	144	90	,	,	,
10_1101-2020_11_24_390039	144	91	s41129	s41129	JJ
10_1101-2020_11_24_390039	144	92	)	)	-RRB-
10_1101-2020_11_24_390039	144	93	and	and	CC
10_1101-2020_11_24_390039	144	94	INTERFERin	INTERFERin	NNP
10_1101-2020_11_24_390039	144	95	(	(	-LRB-
10_1101-2020_11_24_390039	144	96	Polyplus	Polyplus	NNP
10_1101-2020_11_24_390039	144	97	,	,	,
10_1101-2020_11_24_390039	144	98	409	409	CD
10_1101-2020_11_24_390039	144	99	-	-	SYM
10_1101-2020_11_24_390039	144	100	10	10	CD
10_1101-2020_11_24_390039	144	101	)	)	-RRB-
10_1101-2020_11_24_390039	144	102	as	as	IN
10_1101-2020_11_24_390039	144	103	described	describe	VBN
10_1101-2020_11_24_390039	144	104	by	by	IN
10_1101-2020_11_24_390039	144	105	the	the	DT
10_1101-2020_11_24_390039	144	106	manufacturer	manufacturer	NN
10_1101-2020_11_24_390039	144	107	.	.	.
10_1101-2020_11_24_390039	145	1	96	96	CD
10_1101-2020_11_24_390039	145	2	h	h	NN
10_1101-2020_11_24_390039	145	3	post	post	JJ
10_1101-2020_11_24_390039	145	4	-	-	JJ
10_1101-2020_11_24_390039	145	5	initial	initial	JJ
10_1101-2020_11_24_390039	145	6	transfection	transfection	NN
10_1101-2020_11_24_390039	145	7	,	,	,
10_1101-2020_11_24_390039	145	8	cells	cell	NNS
10_1101-2020_11_24_390039	145	9	were	be	VBD
10_1101-2020_11_24_390039	145	10	semi	semi	RB
10_1101-2020_11_24_390039	145	11	-	-	JJ
10_1101-2020_11_24_390039	145	12	permeabilsed	permeabilsed	JJ
10_1101-2020_11_24_390039	145	13	using	use	VBG
10_1101-2020_11_24_390039	145	14	80	80	CD
10_1101-2020_11_24_390039	145	15	μg	μg	CD
10_1101-2020_11_24_390039	145	16	/	/	SYM
10_1101-2020_11_24_390039	145	17	mL	mL	NNP
10_1101-2020_11_24_390039	145	18	high	high	JJ
10_1101-2020_11_24_390039	145	19	purity	purity	NN
10_1101-2020_11_24_390039	145	20	digitonin	digitonin	NN
10_1101-2020_11_24_390039	145	21	(	(	-LRB-
10_1101-2020_11_24_390039	145	22	Calbiochem	Calbiochem	NNP
10_1101-2020_11_24_390039	145	23	)	)	-RRB-
10_1101-2020_11_24_390039	145	24	and	and	CC
10_1101-2020_11_24_390039	145	25	treated	treat	VBN
10_1101-2020_11_24_390039	145	26	with	with	IN
10_1101-2020_11_24_390039	145	27	0.2	0.2	CD
10_1101-2020_11_24_390039	145	28	U	U	NNP
10_1101-2020_11_24_390039	145	29	Nuclease	Nuclease	NNP
10_1101-2020_11_24_390039	145	30	S7	S7	NNP
10_1101-2020_11_24_390039	145	31	Micrococcal	Micrococcal	NNP
10_1101-2020_11_24_390039	145	32	nuclease	nuclease	NN
10_1101-2020_11_24_390039	145	33	from	from	IN
10_1101-2020_11_24_390039	145	34	Staphylococcus	Staphylococcus	NNP
10_1101-2020_11_24_390039	145	35	aureus	aureus	NNP
10_1101-2020_11_24_390039	145	36	(	(	-LRB-
10_1101-2020_11_24_390039	145	37	Sigma	Sigma	NNP
10_1101-2020_11_24_390039	145	38	-	-	HYPH
10_1101-2020_11_24_390039	145	39	Aldrich	Aldrich	NNP
10_1101-2020_11_24_390039	145	40	,	,	,
10_1101-2020_11_24_390039	145	41	10107921001	10107921001	CD
10_1101-2020_11_24_390039	145	42	)	)	-RRB-
10_1101-2020_11_24_390039	145	43	as	as	IN
10_1101-2020_11_24_390039	145	44	previously	previously	RB
10_1101-2020_11_24_390039	145	45	described	describe	VBN
10_1101-2020_11_24_390039	145	46	(	(	-LRB-
10_1101-2020_11_24_390039	145	47	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	145	48	et	et	NNP
10_1101-2020_11_24_390039	145	49	al	al	NNP
10_1101-2020_11_24_390039	145	50	.	.	NNP
10_1101-2020_11_24_390039	145	51	,	,	,
10_1101-2020_11_24_390039	145	52	2020	2020	CD
10_1101-2020_11_24_390039	145	53	submitted	submit	VBD
10_1101-2020_11_24_390039	145	54	;	;	:
10_1101-2020_11_24_390039	145	55	Wilson	Wilson	NNP
10_1101-2020_11_24_390039	145	56	et	et	NNP
10_1101-2020_11_24_390039	145	57	al	al	NNP
10_1101-2020_11_24_390039	145	58	.	.	NNP
10_1101-2020_11_24_390039	145	59	,	,	,
10_1101-2020_11_24_390039	145	60	2007	2007	CD
10_1101-2020_11_24_390039	145	61	)	)	-RRB-
10_1101-2020_11_24_390039	145	62	.	.	.
10_1101-2020_11_24_390039	146	1	SP	SP	NNP
10_1101-2020_11_24_390039	146	2	cells	cell	NNS
10_1101-2020_11_24_390039	146	3	lacking	lack	VBG
10_1101-2020_11_24_390039	146	4	endogenous	endogenous	JJ
10_1101-2020_11_24_390039	146	5	mRNA	mRNA	NNS
10_1101-2020_11_24_390039	146	6	were	be	VBD
10_1101-2020_11_24_390039	146	7	resuspended	resuspend	VBN
10_1101-2020_11_24_390039	146	8	(	(	-LRB-
10_1101-2020_11_24_390039	146	9	3x106	3x106	CD
10_1101-2020_11_24_390039	146	10	SP	SP	NNP
10_1101-2020_11_24_390039	146	11	cells	cell	NNS
10_1101-2020_11_24_390039	146	12	/	/	SYM
10_1101-2020_11_24_390039	146	13	mL	mL	NNP
10_1101-2020_11_24_390039	146	14	as	as	IN
10_1101-2020_11_24_390039	146	15	determined	determine	VBN
10_1101-2020_11_24_390039	146	16	by	by	IN
10_1101-2020_11_24_390039	146	17	trypan	trypan	NN
10_1101-2020_11_24_390039	146	18	blue	blue	NNP
10_1101-2020_11_24_390039	146	19	(	(	-LRB-
10_1101-2020_11_24_390039	146	20	Sigma	Sigma	NNP
10_1101-2020_11_24_390039	146	21	-	-	HYPH
10_1101-2020_11_24_390039	146	22	Aldrich	Aldrich	NNP
10_1101-2020_11_24_390039	146	23	,	,	,
10_1101-2020_11_24_390039	146	24	T8154	T8154	NNP
10_1101-2020_11_24_390039	146	25	)	)	-RRB-
10_1101-2020_11_24_390039	146	26	staining	stain	VBG
10_1101-2020_11_24_390039	146	27	)	)	-RRB-
10_1101-2020_11_24_390039	146	28	in	in	IN
10_1101-2020_11_24_390039	146	29	KHM	KHM	NNP
10_1101-2020_11_24_390039	146	30	buffer	buffer	NN
10_1101-2020_11_24_390039	146	31	(	(	-LRB-
10_1101-2020_11_24_390039	146	32	110	110	CD
10_1101-2020_11_24_390039	146	33	mM	mm	NN
10_1101-2020_11_24_390039	146	34	KOAc	KOAc	NNS
10_1101-2020_11_24_390039	146	35	,	,	,
10_1101-2020_11_24_390039	146	36	2	2	CD
10_1101-2020_11_24_390039	146	37	mM	mm	NN
10_1101-2020_11_24_390039	146	38	Mg(OAc)2	mg(oac)2	NN
10_1101-2020_11_24_390039	146	39	,	,	,
10_1101-2020_11_24_390039	146	40	20	20	CD
10_1101-2020_11_24_390039	146	41	mM	mM	NNP
10_1101-2020_11_24_390039	146	42	HEPES	HEPES	NNP
10_1101-2020_11_24_390039	146	43	-	-	HYPH
10_1101-2020_11_24_390039	146	44	KOH	KOH	NNP
10_1101-2020_11_24_390039	146	45	pH	pH	NNP
10_1101-2020_11_24_390039	146	46	7.2	7.2	CD
10_1101-2020_11_24_390039	146	47	)	)	-RRB-
10_1101-2020_11_24_390039	146	48	prior	prior	RB
10_1101-2020_11_24_390039	146	49	to	to	IN
10_1101-2020_11_24_390039	146	50	analysis	analysis	NN
10_1101-2020_11_24_390039	146	51	by	by	IN
10_1101-2020_11_24_390039	146	52	western	western	JJ
10_1101-2020_11_24_390039	146	53	blot	blot	NN
10_1101-2020_11_24_390039	146	54	,	,	,
10_1101-2020_11_24_390039	146	55	or	or	CC
10_1101-2020_11_24_390039	146	56	inclusion	inclusion	NN
10_1101-2020_11_24_390039	146	57	in	in	IN
10_1101-2020_11_24_390039	146	58	translation	translation	NN
10_1101-2020_11_24_390039	146	59	master	master	NN
10_1101-2020_11_24_390039	146	60	mixes	mix	NNS
10_1101-2020_11_24_390039	146	61	such	such	JJ
10_1101-2020_11_24_390039	146	62	that	that	IN
10_1101-2020_11_24_390039	146	63	each	each	DT
10_1101-2020_11_24_390039	146	64	translation	translation	NN
10_1101-2020_11_24_390039	146	65	reaction	reaction	NN
10_1101-2020_11_24_390039	146	66	contained	contain	VBD
10_1101-2020_11_24_390039	146	67	2x105	2x105	CD
10_1101-2020_11_24_390039	146	68	cells	cell	NNS
10_1101-2020_11_24_390039	146	69	/	/	SYM
10_1101-2020_11_24_390039	146	70	mL.	ml.	NN
10_1101-2020_11_24_390039	147	1	In	in	IN
10_1101-2020_11_24_390039	147	2	vitro	vitro	FW
10_1101-2020_11_24_390039	147	3	ER	ER	NNP
10_1101-2020_11_24_390039	147	4	import	import	NN
10_1101-2020_11_24_390039	147	5	assays	assays	RB
10_1101-2020_11_24_390039	147	6	Standard	standard	JJ
10_1101-2020_11_24_390039	147	7	translation	translation	NN
10_1101-2020_11_24_390039	147	8	and	and	CC
10_1101-2020_11_24_390039	147	9	membrane	membrane	NN
10_1101-2020_11_24_390039	147	10	translocation	translocation	NN
10_1101-2020_11_24_390039	147	11	/	/	SYM
10_1101-2020_11_24_390039	147	12	insertion	insertion	NN
10_1101-2020_11_24_390039	147	13	assays	assays	RB
10_1101-2020_11_24_390039	147	14	,	,	,
10_1101-2020_11_24_390039	147	15	supplemented	supplement	VBN
10_1101-2020_11_24_390039	147	16	with	with	IN
10_1101-2020_11_24_390039	147	17	nuclease	nuclease	NN
10_1101-2020_11_24_390039	147	18	-	-	HYPH
10_1101-2020_11_24_390039	147	19	treated	treat	VBN
10_1101-2020_11_24_390039	147	20	canine	canine	NN
10_1101-2020_11_24_390039	147	21	pancreatic	pancreatic	JJ
10_1101-2020_11_24_390039	147	22	microsomes	microsome	NNS
10_1101-2020_11_24_390039	147	23	(	(	-LRB-
10_1101-2020_11_24_390039	147	24	from	from	IN
10_1101-2020_11_24_390039	147	25	stock	stock	NN
10_1101-2020_11_24_390039	147	26	with	with	IN
10_1101-2020_11_24_390039	147	27	OD280	OD280	NNP
10_1101-2020_11_24_390039	147	28	=	=	SYM
10_1101-2020_11_24_390039	147	29	44	44	CD
10_1101-2020_11_24_390039	147	30	/	/	SYM
10_1101-2020_11_24_390039	147	31	mL	ml	NN
10_1101-2020_11_24_390039	147	32	)	)	-RRB-
10_1101-2020_11_24_390039	147	33	or	or	CC
10_1101-2020_11_24_390039	147	34	siRNA	sirna	RB
10_1101-2020_11_24_390039	147	35	-	-	HYPH
10_1101-2020_11_24_390039	147	36	treated	treat	VBN
10_1101-2020_11_24_390039	147	37	SP	SP	NNP
10_1101-2020_11_24_390039	147	38	HeLa	HeLa	NNP
10_1101-2020_11_24_390039	147	39	cells	cell	NNS
10_1101-2020_11_24_390039	147	40	,	,	,
10_1101-2020_11_24_390039	147	41	were	be	VBD
10_1101-2020_11_24_390039	147	42	performed	perform	VBN
10_1101-2020_11_24_390039	147	43	in	in	IN
10_1101-2020_11_24_390039	147	44	nuclease	nuclease	NN
10_1101-2020_11_24_390039	147	45	-	-	HYPH
10_1101-2020_11_24_390039	147	46	treated	treat	VBN
10_1101-2020_11_24_390039	147	47	rabbit	rabbit	NN
10_1101-2020_11_24_390039	147	48	reticulocyte	reticulocyte	NN
10_1101-2020_11_24_390039	147	49	lysate	lysate	NN
10_1101-2020_11_24_390039	147	50	(	(	-LRB-
10_1101-2020_11_24_390039	147	51	Promega	Promega	NNP
10_1101-2020_11_24_390039	147	52	)	)	-RRB-
10_1101-2020_11_24_390039	147	53	as	as	IN
10_1101-2020_11_24_390039	147	54	previously	previously	RB
10_1101-2020_11_24_390039	147	55	described	describe	VBN
10_1101-2020_11_24_390039	147	56	(	(	-LRB-
10_1101-2020_11_24_390039	147	57	Zong	Zong	NNP
10_1101-2020_11_24_390039	147	58	et	et	NNP
10_1101-2020_11_24_390039	147	59	al	al	NNP
10_1101-2020_11_24_390039	147	60	.	.	NNP
10_1101-2020_11_24_390039	147	61	,	,	,
10_1101-2020_11_24_390039	147	62	2019	2019	CD
10_1101-2020_11_24_390039	147	63	;	;	:
10_1101-2020_11_24_390039	147	64	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	147	65	et	et	NNP
10_1101-2020_11_24_390039	147	66	al	al	NNP
10_1101-2020_11_24_390039	147	67	.	.	NNP
10_1101-2020_11_24_390039	147	68	,	,	,
10_1101-2020_11_24_390039	147	69	2020	2020	CD
10_1101-2020_11_24_390039	147	70	submitted	submit	VBN
10_1101-2020_11_24_390039	147	71	)	)	-RRB-
10_1101-2020_11_24_390039	147	72	:	:	:
10_1101-2020_11_24_390039	147	73	namely	namely	RB
10_1101-2020_11_24_390039	147	74	in	in	IN
10_1101-2020_11_24_390039	147	75	the	the	DT
10_1101-2020_11_24_390039	147	76	presence	presence	NN
10_1101-2020_11_24_390039	147	77	of	of	IN
10_1101-2020_11_24_390039	147	78	EasyTag	EasyTag	NNP
10_1101-2020_11_24_390039	147	79	EXPRESS	EXPRESS	NNP
10_1101-2020_11_24_390039	147	80	35S	35S	NNP
10_1101-2020_11_24_390039	147	81	Protein	protein	NN
10_1101-2020_11_24_390039	147	82	Labelling	Labelling	NNP
10_1101-2020_11_24_390039	147	83	Mix	Mix	NNP
10_1101-2020_11_24_390039	147	84	containing	contain	VBG
10_1101-2020_11_24_390039	147	85	[	[	-LRB-
10_1101-2020_11_24_390039	147	86	35S	35S	NNP
10_1101-2020_11_24_390039	147	87	]	]	-RRB-
10_1101-2020_11_24_390039	147	88	methionine	methionine	NNP
10_1101-2020_11_24_390039	147	89	(	(	-LRB-
10_1101-2020_11_24_390039	147	90	Perkin	Perkin	NNP
10_1101-2020_11_24_390039	147	91	Elmer	Elmer	NNP
10_1101-2020_11_24_390039	147	92	)	)	-RRB-
10_1101-2020_11_24_390039	147	93	(	(	-LRB-
10_1101-2020_11_24_390039	147	94	0.533	0.533	CD
10_1101-2020_11_24_390039	147	95	MBq	MBq	NNS
10_1101-2020_11_24_390039	147	96	;	;	:
10_1101-2020_11_24_390039	147	97	30.15	30.15	CD
10_1101-2020_11_24_390039	147	98	TBq	TBq	NNP
10_1101-2020_11_24_390039	147	99	/	/	SYM
10_1101-2020_11_24_390039	147	100	mmol	mmol	NN
10_1101-2020_11_24_390039	147	101	)	)	-RRB-
10_1101-2020_11_24_390039	147	102	,	,	,
10_1101-2020_11_24_390039	147	103	25	25	CD
10_1101-2020_11_24_390039	147	104	μM	μM	NNP
10_1101-2020_11_24_390039	147	105	amino	amino	NNP
10_1101-2020_11_24_390039	147	106	acids	acid	NNS
10_1101-2020_11_24_390039	147	107	minus	minus	CC
10_1101-2020_11_24_390039	147	108	methionine	methionine	NNP
10_1101-2020_11_24_390039	147	109	(	(	-LRB-
10_1101-2020_11_24_390039	147	110	Promega	Promega	NNP
10_1101-2020_11_24_390039	147	111	)	)	-RRB-
10_1101-2020_11_24_390039	147	112	,	,	,
10_1101-2020_11_24_390039	147	113	1	1	CD
10_1101-2020_11_24_390039	147	114	µM	µM	NNP
10_1101-2020_11_24_390039	147	115	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	147	116	-	-	HYPH
10_1101-2020_11_24_390039	147	117	F	F	NNP
10_1101-2020_11_24_390039	147	118	,	,	,
10_1101-2020_11_24_390039	147	119	or	or	CC
10_1101-2020_11_24_390039	147	120	an	an	DT
10_1101-2020_11_24_390039	147	121	equivalent	equivalent	JJ
10_1101-2020_11_24_390039	147	122	volume	volume	NN
10_1101-2020_11_24_390039	147	123	of	of	IN
10_1101-2020_11_24_390039	147	124	DMSO	DMSO	NNP
10_1101-2020_11_24_390039	147	125	,	,	,
10_1101-2020_11_24_390039	147	126	6.5	6.5	CD
10_1101-2020_11_24_390039	147	127	%	%	NN
10_1101-2020_11_24_390039	147	128	(	(	-LRB-
10_1101-2020_11_24_390039	147	129	v	v	NN
10_1101-2020_11_24_390039	147	130	/	/	SYM
10_1101-2020_11_24_390039	147	131	v	v	NN
10_1101-2020_11_24_390039	147	132	)	)	-RRB-
10_1101-2020_11_24_390039	147	133	ER-	ER-	NNP
10_1101-2020_11_24_390039	147	134	derived	derive	VBD
10_1101-2020_11_24_390039	147	135	microsomes	microsome	NNS
10_1101-2020_11_24_390039	147	136	or	or	CC
10_1101-2020_11_24_390039	147	137	SP	SP	NNP
10_1101-2020_11_24_390039	147	138	cells	cell	NNS
10_1101-2020_11_24_390039	147	139	and	and	CC
10_1101-2020_11_24_390039	147	140	~10	~10	.
10_1101-2020_11_24_390039	147	141	%	%	NN
10_1101-2020_11_24_390039	147	142	(	(	-LRB-
10_1101-2020_11_24_390039	147	143	v	v	NN
10_1101-2020_11_24_390039	147	144	/	/	SYM
10_1101-2020_11_24_390039	147	145	v	v	NN
10_1101-2020_11_24_390039	147	146	)	)	-RRB-
10_1101-2020_11_24_390039	147	147	of	of	XX
10_1101-2020_11_24_390039	147	148	in	in	FW
10_1101-2020_11_24_390039	147	149	vitro	vitro	FW
10_1101-2020_11_24_390039	147	150	transcribed	transcribed	NNP
10_1101-2020_11_24_390039	147	151	mRNA	mRNA	.
10_1101-2020_11_24_390039	147	152	(	(	-LRB-
10_1101-2020_11_24_390039	147	153	~500	~500	NNP
10_1101-2020_11_24_390039	147	154	ng	ng	NNP
10_1101-2020_11_24_390039	147	155	/	/	SYM
10_1101-2020_11_24_390039	147	156	μL	μL	NNP
10_1101-2020_11_24_390039	147	157	)	)	-RRB-
10_1101-2020_11_24_390039	147	158	encoding	encode	VBG
10_1101-2020_11_24_390039	147	159	the	the	DT
10_1101-2020_11_24_390039	147	160	relevant	relevant	JJ
10_1101-2020_11_24_390039	147	161	precursor	precursor	NN
10_1101-2020_11_24_390039	147	162	protein	protein	NN
10_1101-2020_11_24_390039	147	163	.	.	.
10_1101-2020_11_24_390039	148	1	Microsomal	microsomal	JJ
10_1101-2020_11_24_390039	148	2	translation	translation	NN
10_1101-2020_11_24_390039	148	3	reactions	reaction	NNS
10_1101-2020_11_24_390039	148	4	(	(	-LRB-
10_1101-2020_11_24_390039	148	5	20	20	CD
10_1101-2020_11_24_390039	148	6	μL	μL	NNP
10_1101-2020_11_24_390039	148	7	)	)	-RRB-
10_1101-2020_11_24_390039	148	8	were	be	VBD
10_1101-2020_11_24_390039	148	9	performed	perform	VBN
10_1101-2020_11_24_390039	148	10	for	for	IN
10_1101-2020_11_24_390039	148	11	30	30	CD
10_1101-2020_11_24_390039	148	12	min	min	NN
10_1101-2020_11_24_390039	148	13	at	at	IN
10_1101-2020_11_24_390039	148	14	30	30	CD
10_1101-2020_11_24_390039	148	15	°	°	,
10_1101-2020_11_24_390039	148	16	C	C	NNP
10_1101-2020_11_24_390039	148	17	whereas	whereas	IN
10_1101-2020_11_24_390039	148	18	those	those	DT
10_1101-2020_11_24_390039	148	19	using	use	VBG
10_1101-2020_11_24_390039	148	20	SP	SP	NNP
10_1101-2020_11_24_390039	148	21	HeLa	HeLa	NNP
10_1101-2020_11_24_390039	148	22	cells	cell	NNS
10_1101-2020_11_24_390039	148	23	were	be	VBD
10_1101-2020_11_24_390039	148	24	performed	perform	VBN
10_1101-2020_11_24_390039	148	25	on	on	IN
10_1101-2020_11_24_390039	148	26	a	a	DT
10_1101-2020_11_24_390039	148	27	1.5X	1.5x	JJ
10_1101-2020_11_24_390039	148	28	scale	scale	NN
10_1101-2020_11_24_390039	148	29	(	(	-LRB-
10_1101-2020_11_24_390039	148	30	30	30	CD
10_1101-2020_11_24_390039	148	31	μL	μL	NNP
10_1101-2020_11_24_390039	148	32	translation	translation	NN
10_1101-2020_11_24_390039	148	33	reactions	reaction	NNS
10_1101-2020_11_24_390039	148	34	)	)	-RRB-
10_1101-2020_11_24_390039	148	35	for	for	IN
10_1101-2020_11_24_390039	148	36	1	1	CD
10_1101-2020_11_24_390039	148	37	h	h	NN
10_1101-2020_11_24_390039	148	38	at	at	IN
10_1101-2020_11_24_390039	148	39	30	30	CD
10_1101-2020_11_24_390039	148	40	°	°	,
10_1101-2020_11_24_390039	148	41	C	C	NNP
10_1101-2020_11_24_390039	148	42	.	.	.
10_1101-2020_11_24_390039	149	1	As	as	IN
10_1101-2020_11_24_390039	149	2	the	the	DT
10_1101-2020_11_24_390039	149	3	S	S	NNP
10_1101-2020_11_24_390039	149	4	protein	protein	NN
10_1101-2020_11_24_390039	149	5	was	be	VBD
10_1101-2020_11_24_390039	149	6	most	most	RBS
10_1101-2020_11_24_390039	149	7	efficiently	efficiently	RB
10_1101-2020_11_24_390039	149	8	synthesised	synthesise	VBN
10_1101-2020_11_24_390039	149	9	using	use	VBG
10_1101-2020_11_24_390039	149	10	the	the	DT
10_1101-2020_11_24_390039	149	11	TNT	TNT	NNP
10_1101-2020_11_24_390039	149	12	®	®	NNPS
10_1101-2020_11_24_390039	149	13	Coupled	couple	VBN
10_1101-2020_11_24_390039	149	14	system	system	NN
10_1101-2020_11_24_390039	149	15	(	(	-LRB-
10_1101-2020_11_24_390039	149	16	Fig	fig	NN
10_1101-2020_11_24_390039	149	17	.	.	.
10_1101-2020_11_24_390039	150	1	S1B	S1B	NNP
10_1101-2020_11_24_390039	150	2	)	)	-RRB-
10_1101-2020_11_24_390039	150	3	,	,	,
10_1101-2020_11_24_390039	150	4	import	import	NN
10_1101-2020_11_24_390039	150	5	assays	assays	RB
10_1101-2020_11_24_390039	150	6	of	of	IN
10_1101-2020_11_24_390039	150	7	the	the	DT
10_1101-2020_11_24_390039	150	8	comparatively	comparatively	RB
10_1101-2020_11_24_390039	150	9	higher	high	JJR
10_1101-2020_11_24_390039	150	10	molecular	molecular	JJ
10_1101-2020_11_24_390039	150	11	weight	weight	NN
10_1101-2020_11_24_390039	150	12	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	150	13	and	and	CC
10_1101-2020_11_24_390039	150	14	S	S	NNP
10_1101-2020_11_24_390039	150	15	proteins	protein	NNS
10_1101-2020_11_24_390039	150	16	(	(	-LRB-
10_1101-2020_11_24_390039	150	17	50	50	CD
10_1101-2020_11_24_390039	150	18	μL	μL	NNP
10_1101-2020_11_24_390039	150	19	reactions	reaction	NNS
10_1101-2020_11_24_390039	150	20	)	)	-RRB-
10_1101-2020_11_24_390039	150	21	were	be	VBD
10_1101-2020_11_24_390039	150	22	both	both	DT
10_1101-2020_11_24_390039	150	23	performed	perform	VBN
10_1101-2020_11_24_390039	150	24	using	use	VBG
10_1101-2020_11_24_390039	150	25	the	the	DT
10_1101-2020_11_24_390039	150	26	TNT	TNT	NNP
10_1101-2020_11_24_390039	150	27	®	®	NNPS
10_1101-2020_11_24_390039	150	28	Coupled	couple	VBN
10_1101-2020_11_24_390039	150	29	Transcription/	transcription/	NN
10_1101-2020_11_24_390039	150	30	Translation	translation	NN
10_1101-2020_11_24_390039	150	31	system	system	NN
10_1101-2020_11_24_390039	150	32	(	(	-LRB-
10_1101-2020_11_24_390039	150	33	Promega	Promega	NNP
10_1101-2020_11_24_390039	150	34	)	)	-RRB-
10_1101-2020_11_24_390039	150	35	for	for	IN
10_1101-2020_11_24_390039	150	36	90	90	CD
10_1101-2020_11_24_390039	150	37	min	min	NN
10_1101-2020_11_24_390039	150	38	at	at	IN
10_1101-2020_11_24_390039	150	39	30	30	CD
10_1101-2020_11_24_390039	150	40	°	°	,
10_1101-2020_11_24_390039	150	41	C	C	NNP
10_1101-2020_11_24_390039	150	42	as	as	IN
10_1101-2020_11_24_390039	150	43	described	describe	VBN
10_1101-2020_11_24_390039	150	44	by	by	IN
10_1101-2020_11_24_390039	150	45	the	the	DT
10_1101-2020_11_24_390039	150	46	manufacturer	manufacturer	NN
10_1101-2020_11_24_390039	150	47	(	(	-LRB-
10_1101-2020_11_24_390039	150	48	~50	~50	NFP
10_1101-2020_11_24_390039	150	49	ng	ng	NN
10_1101-2020_11_24_390039	150	50	/	/	SYM
10_1101-2020_11_24_390039	150	51	μL	μL	NNP
10_1101-2020_11_24_390039	150	52	cDNA,1	cdna,1	XX
10_1101-2020_11_24_390039	150	53	µM	µM	NNP
10_1101-2020_11_24_390039	150	54	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	150	55	-	-	HYPH
10_1101-2020_11_24_390039	150	56	F	F	NNP
10_1101-2020_11_24_390039	150	57	or	or	CC
10_1101-2020_11_24_390039	150	58	an	an	DT
10_1101-2020_11_24_390039	150	59	equivalent	equivalent	JJ
10_1101-2020_11_24_390039	150	60	.CC	.CC	NFP
10_1101-2020_11_24_390039	150	61	-	-	HYPH
10_1101-2020_11_24_390039	150	62	BY	by	IN
10_1101-2020_11_24_390039	150	63	-	-	HYPH
10_1101-2020_11_24_390039	150	64	ND	ND	NNP
10_1101-2020_11_24_390039	150	65	4.0	4.0	CD
10_1101-2020_11_24_390039	150	66	International	international	JJ
10_1101-2020_11_24_390039	150	67	licensemade	licensemade	NN
10_1101-2020_11_24_390039	150	68	available	available	JJ
10_1101-2020_11_24_390039	150	69	under	under	IN
10_1101-2020_11_24_390039	150	70	a	a	DT
10_1101-2020_11_24_390039	150	71	(	(	-LRB-
10_1101-2020_11_24_390039	150	72	which	which	WDT
10_1101-2020_11_24_390039	150	73	was	be	VBD
10_1101-2020_11_24_390039	150	74	not	not	RB
10_1101-2020_11_24_390039	150	75	certified	certify	VBN
10_1101-2020_11_24_390039	150	76	by	by	IN
10_1101-2020_11_24_390039	150	77	peer	peer	NN
10_1101-2020_11_24_390039	150	78	review	review	NN
10_1101-2020_11_24_390039	150	79	)	)	-RRB-
10_1101-2020_11_24_390039	150	80	is	be	VBZ
10_1101-2020_11_24_390039	150	81	the	the	DT
10_1101-2020_11_24_390039	150	82	author	author	NN
10_1101-2020_11_24_390039	150	83	/	/	SYM
10_1101-2020_11_24_390039	150	84	funder	funder	NN
10_1101-2020_11_24_390039	150	85	,	,	,
10_1101-2020_11_24_390039	150	86	who	who	WP
10_1101-2020_11_24_390039	150	87	has	have	VBZ
10_1101-2020_11_24_390039	150	88	granted	grant	VBN
10_1101-2020_11_24_390039	150	89	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	150	90	a	a	DT
10_1101-2020_11_24_390039	150	91	license	license	NN
10_1101-2020_11_24_390039	150	92	to	to	TO
10_1101-2020_11_24_390039	150	93	display	display	VB
10_1101-2020_11_24_390039	150	94	the	the	DT
10_1101-2020_11_24_390039	150	95	preprint	preprint	NN
10_1101-2020_11_24_390039	150	96	in	in	IN
10_1101-2020_11_24_390039	150	97	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	150	98	.	.	.
10_1101-2020_11_24_390039	151	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	151	2	is	be	VBZ
10_1101-2020_11_24_390039	151	3	The	the	DT
10_1101-2020_11_24_390039	151	4	copyright	copyright	NN
10_1101-2020_11_24_390039	151	5	holder	holder	NN
10_1101-2020_11_24_390039	151	6	for	for	IN
10_1101-2020_11_24_390039	151	7	this	this	DT
10_1101-2020_11_24_390039	151	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	151	9	version	version	NN
10_1101-2020_11_24_390039	151	10	posted	post	VBD
10_1101-2020_11_24_390039	151	11	January	January	NNP
10_1101-2020_11_24_390039	151	12	5	5	CD
10_1101-2020_11_24_390039	151	13	,	,	,
10_1101-2020_11_24_390039	151	14	2021	2021	CD
10_1101-2020_11_24_390039	151	15	.	.	.
10_1101-2020_11_24_390039	151	16	;	;	:
10_1101-2020_11_24_390039	151	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	151	18	:	:	:
10_1101-2020_11_24_390039	151	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	151	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	151	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	151	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	151	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	151	24	-	-	HYPH
10_1101-2020_11_24_390039	151	25	F	F	NNP
10_1101-2020_11_24_390039	151	26	as	as	IN
10_1101-2020_11_24_390039	151	27	a	a	DT
10_1101-2020_11_24_390039	151	28	potential	potential	JJ
10_1101-2020_11_24_390039	151	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	151	30	agent	agent	NN
10_1101-2020_11_24_390039	151	31	Page	Page	NNP
10_1101-2020_11_24_390039	151	32	12	12	CD
10_1101-2020_11_24_390039	151	33	of	of	IN
10_1101-2020_11_24_390039	151	34	21	21	CD
10_1101-2020_11_24_390039	151	35	volume	volume	NN
10_1101-2020_11_24_390039	151	36	of	of	IN
10_1101-2020_11_24_390039	151	37	DMSO	DMSO	NNP
10_1101-2020_11_24_390039	151	38	,	,	,
10_1101-2020_11_24_390039	151	39	12	12	CD
10_1101-2020_11_24_390039	151	40	%	%	NN
10_1101-2020_11_24_390039	151	41	(	(	-LRB-
10_1101-2020_11_24_390039	151	42	v	v	NN
10_1101-2020_11_24_390039	151	43	/	/	SYM
10_1101-2020_11_24_390039	151	44	v	v	NN
10_1101-2020_11_24_390039	151	45	)	)	-RRB-
10_1101-2020_11_24_390039	151	46	ER	ER	NNP
10_1101-2020_11_24_390039	151	47	-	-	HYPH
10_1101-2020_11_24_390039	151	48	derived	derive	VBN
10_1101-2020_11_24_390039	151	49	microsomes	microsome	NNS
10_1101-2020_11_24_390039	151	50	or	or	CC
10_1101-2020_11_24_390039	151	51	SP	SP	NNP
10_1101-2020_11_24_390039	151	52	cells	cell	NNS
10_1101-2020_11_24_390039	151	53	)	)	-RRB-
10_1101-2020_11_24_390039	151	54	.	.	.
10_1101-2020_11_24_390039	152	1	All	all	DT
10_1101-2020_11_24_390039	152	2	translation	translation	NN
10_1101-2020_11_24_390039	152	3	reactions	reaction	NNS
10_1101-2020_11_24_390039	152	4	were	be	VBD
10_1101-2020_11_24_390039	152	5	finished	finish	VBN
10_1101-2020_11_24_390039	152	6	by	by	IN
10_1101-2020_11_24_390039	152	7	incubating	incubate	VBG
10_1101-2020_11_24_390039	152	8	with	with	IN
10_1101-2020_11_24_390039	152	9	0.1	0.1	CD
10_1101-2020_11_24_390039	152	10	mM	mm	NN
10_1101-2020_11_24_390039	152	11	puromycin	puromycin	JJ
10_1101-2020_11_24_390039	152	12	for	for	IN
10_1101-2020_11_24_390039	152	13	10	10	CD
10_1101-2020_11_24_390039	152	14	min	min	NN
10_1101-2020_11_24_390039	152	15	at	at	IN
10_1101-2020_11_24_390039	152	16	30	30	CD
10_1101-2020_11_24_390039	152	17	°	°	,
10_1101-2020_11_24_390039	152	18	C	C	NNP
10_1101-2020_11_24_390039	152	19	to	to	TO
10_1101-2020_11_24_390039	152	20	ensure	ensure	VB
10_1101-2020_11_24_390039	152	21	translation	translation	NN
10_1101-2020_11_24_390039	152	22	termination	termination	NN
10_1101-2020_11_24_390039	152	23	and	and	CC
10_1101-2020_11_24_390039	152	24	ribosome	ribosome	NN
10_1101-2020_11_24_390039	152	25	release	release	NN
10_1101-2020_11_24_390039	152	26	of	of	IN
10_1101-2020_11_24_390039	152	27	newly	newly	RB
10_1101-2020_11_24_390039	152	28	synthesised	synthesise	VBN
10_1101-2020_11_24_390039	152	29	proteins	protein	NNS
10_1101-2020_11_24_390039	152	30	prior	prior	RB
10_1101-2020_11_24_390039	152	31	to	to	IN
10_1101-2020_11_24_390039	152	32	analysis	analysis	NN
10_1101-2020_11_24_390039	152	33	.	.	.
10_1101-2020_11_24_390039	153	1	Recovery	recovery	NN
10_1101-2020_11_24_390039	153	2	and	and	CC
10_1101-2020_11_24_390039	153	3	analysis	analysis	NN
10_1101-2020_11_24_390039	153	4	of	of	IN
10_1101-2020_11_24_390039	153	5	radiolabelled	radiolabelle	VBN
10_1101-2020_11_24_390039	153	6	products	product	NNS
10_1101-2020_11_24_390039	153	7	Following	follow	VBG
10_1101-2020_11_24_390039	153	8	puromycin	puromycin	JJ
10_1101-2020_11_24_390039	153	9	treatment	treatment	NN
10_1101-2020_11_24_390039	153	10	,	,	,
10_1101-2020_11_24_390039	153	11	microsomal	microsomal	JJ
10_1101-2020_11_24_390039	153	12	membrane	membrane	NN
10_1101-2020_11_24_390039	153	13	-	-	HYPH
10_1101-2020_11_24_390039	153	14	associated	associate	VBN
10_1101-2020_11_24_390039	153	15	fractions	fraction	NNS
10_1101-2020_11_24_390039	153	16	were	be	VBD
10_1101-2020_11_24_390039	153	17	recovered	recover	VBN
10_1101-2020_11_24_390039	153	18	by	by	IN
10_1101-2020_11_24_390039	153	19	centrifugation	centrifugation	NN
10_1101-2020_11_24_390039	153	20	through	through	IN
10_1101-2020_11_24_390039	153	21	an	an	DT
10_1101-2020_11_24_390039	153	22	80	80	CD
10_1101-2020_11_24_390039	153	23	μL	μl	NN
10_1101-2020_11_24_390039	153	24	high	high	JJ
10_1101-2020_11_24_390039	153	25	-	-	HYPH
10_1101-2020_11_24_390039	153	26	salt	salt	NN
10_1101-2020_11_24_390039	153	27	cushion	cushion	NN
10_1101-2020_11_24_390039	153	28	(	(	-LRB-
10_1101-2020_11_24_390039	153	29	0.75	0.75	CD
10_1101-2020_11_24_390039	153	30	M	m	NN
10_1101-2020_11_24_390039	153	31	sucrose	sucrose	NN
10_1101-2020_11_24_390039	153	32	,	,	,
10_1101-2020_11_24_390039	153	33	0.5	0.5	CD
10_1101-2020_11_24_390039	153	34	M	M	NNP
10_1101-2020_11_24_390039	153	35	KOAc	KOAc	NNS
10_1101-2020_11_24_390039	153	36	,	,	,
10_1101-2020_11_24_390039	153	37	5	5	CD
10_1101-2020_11_24_390039	153	38	mM	mm	NN
10_1101-2020_11_24_390039	153	39	Mg(OAc)2	mg(oac)2	NN
10_1101-2020_11_24_390039	153	40	,	,	,
10_1101-2020_11_24_390039	153	41	50	50	CD
10_1101-2020_11_24_390039	153	42	mM	mM	NNP
10_1101-2020_11_24_390039	153	43	Hepes	Hepes	NNP
10_1101-2020_11_24_390039	153	44	-	-	HYPH
10_1101-2020_11_24_390039	153	45	KOH	KOH	NNP
10_1101-2020_11_24_390039	153	46	,	,	,
10_1101-2020_11_24_390039	153	47	pH	pH	NNP
10_1101-2020_11_24_390039	153	48	7.9	7.9	CD
10_1101-2020_11_24_390039	153	49	)	)	-RRB-
10_1101-2020_11_24_390039	153	50	at	at	IN
10_1101-2020_11_24_390039	153	51	100,000	100,000	CD
10_1101-2020_11_24_390039	153	52	g	g	NN
10_1101-2020_11_24_390039	153	53	for	for	IN
10_1101-2020_11_24_390039	153	54	10	10	CD
10_1101-2020_11_24_390039	153	55	min	min	NN
10_1101-2020_11_24_390039	153	56	at	at	IN
10_1101-2020_11_24_390039	153	57	4	4	CD
10_1101-2020_11_24_390039	153	58	°	°	NNS
10_1101-2020_11_24_390039	153	59	C	C	NNP
10_1101-2020_11_24_390039	153	60	and	and	CC
10_1101-2020_11_24_390039	153	61	the	the	DT
10_1101-2020_11_24_390039	153	62	pellet	pellet	NN
10_1101-2020_11_24_390039	153	63	suspended	suspend	VBN
10_1101-2020_11_24_390039	153	64	directly	directly	RB
10_1101-2020_11_24_390039	153	65	in	in	IN
10_1101-2020_11_24_390039	153	66	SDS	SDS	NNP
10_1101-2020_11_24_390039	153	67	sample	sample	NN
10_1101-2020_11_24_390039	153	68	buffer	buffer	NN
10_1101-2020_11_24_390039	153	69	.	.	.
10_1101-2020_11_24_390039	154	1	To	to	TO
10_1101-2020_11_24_390039	154	2	confirm	confirm	VB
10_1101-2020_11_24_390039	154	3	the	the	DT
10_1101-2020_11_24_390039	154	4	topology	topology	NN
10_1101-2020_11_24_390039	154	5	of	of	IN
10_1101-2020_11_24_390039	154	6	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	154	7	(	(	-LRB-
10_1101-2020_11_24_390039	154	8	Fig	Fig	NNP
10_1101-2020_11_24_390039	154	9	.	.	.
10_1101-2020_11_24_390039	155	1	S2	s2	NN
10_1101-2020_11_24_390039	155	2	)	)	-RRB-
10_1101-2020_11_24_390039	155	3	,	,	,
10_1101-2020_11_24_390039	155	4	the	the	DT
10_1101-2020_11_24_390039	155	5	membrane	membrane	NN
10_1101-2020_11_24_390039	155	6	-	-	HYPH
10_1101-2020_11_24_390039	155	7	associated	associate	VBN
10_1101-2020_11_24_390039	155	8	fraction	fraction	NN
10_1101-2020_11_24_390039	155	9	of	of	IN
10_1101-2020_11_24_390039	155	10	the	the	DT
10_1101-2020_11_24_390039	155	11	doubly	doubly	RB
10_1101-2020_11_24_390039	155	12	-	-	HYPH
10_1101-2020_11_24_390039	155	13	OPG2-tagged	opg2-tagged	JJ
10_1101-2020_11_24_390039	155	14	form	form	NN
10_1101-2020_11_24_390039	155	15	(	(	-LRB-
10_1101-2020_11_24_390039	155	16	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	155	17	)	)	-RRB-
10_1101-2020_11_24_390039	155	18	was	be	VBD
10_1101-2020_11_24_390039	155	19	resuspended	resuspend	VBN
10_1101-2020_11_24_390039	155	20	in	in	IN
10_1101-2020_11_24_390039	155	21	KHM	KHM	NNP
10_1101-2020_11_24_390039	155	22	buffer	buffer	NN
10_1101-2020_11_24_390039	155	23	(	(	-LRB-
10_1101-2020_11_24_390039	155	24	20	20	CD
10_1101-2020_11_24_390039	155	25	μL	μL	NNP
10_1101-2020_11_24_390039	155	26	)	)	-RRB-
10_1101-2020_11_24_390039	155	27	and	and	CC
10_1101-2020_11_24_390039	155	28	subjected	subject	VBN
10_1101-2020_11_24_390039	155	29	to	to	IN
10_1101-2020_11_24_390039	155	30	either	either	CC
10_1101-2020_11_24_390039	155	31	carbonate	carbonate	NN
10_1101-2020_11_24_390039	155	32	extraction	extraction	NN
10_1101-2020_11_24_390039	155	33	(	(	-LRB-
10_1101-2020_11_24_390039	155	34	0.1	0.1	CD
10_1101-2020_11_24_390039	155	35	M	M	NNP
10_1101-2020_11_24_390039	155	36	Na2CO3	Na2CO3	NNP
10_1101-2020_11_24_390039	155	37	,	,	,
10_1101-2020_11_24_390039	155	38	pH	pH	NNP
10_1101-2020_11_24_390039	155	39	11.3	11.3	CD
10_1101-2020_11_24_390039	155	40	)	)	-RRB-
10_1101-2020_11_24_390039	155	41	(	(	-LRB-
10_1101-2020_11_24_390039	155	42	McKenna	McKenna	NNP
10_1101-2020_11_24_390039	155	43	et	et	NNP
10_1101-2020_11_24_390039	155	44	al	al	NNP
10_1101-2020_11_24_390039	155	45	.	.	NNP
10_1101-2020_11_24_390039	155	46	,	,	,
10_1101-2020_11_24_390039	155	47	2016	2016	CD
10_1101-2020_11_24_390039	155	48	)	)	-RRB-
10_1101-2020_11_24_390039	155	49	or	or	CC
10_1101-2020_11_24_390039	155	50	a	a	DT
10_1101-2020_11_24_390039	155	51	protease	protease	NN
10_1101-2020_11_24_390039	155	52	protection	protection	NN
10_1101-2020_11_24_390039	155	53	assay	assay	NN
10_1101-2020_11_24_390039	155	54	using	use	VBG
10_1101-2020_11_24_390039	155	55	trypsin	trypsin	NNP
10_1101-2020_11_24_390039	155	56	(	(	-LRB-
10_1101-2020_11_24_390039	155	57	1	1	CD
10_1101-2020_11_24_390039	155	58	μg	μg	NNP
10_1101-2020_11_24_390039	155	59	/	/	SYM
10_1101-2020_11_24_390039	155	60	mL	ml	NN
10_1101-2020_11_24_390039	155	61	)	)	-RRB-
10_1101-2020_11_24_390039	155	62	with	with	IN
10_1101-2020_11_24_390039	155	63	or	or	CC
10_1101-2020_11_24_390039	155	64	without	without	IN
10_1101-2020_11_24_390039	155	65	0.1	0.1	CD
10_1101-2020_11_24_390039	155	66	%	%	NN
10_1101-2020_11_24_390039	155	67	Triton	Triton	NNP
10_1101-2020_11_24_390039	155	68	X-100	X-100	NNP
10_1101-2020_11_24_390039	155	69	(	(	-LRB-
10_1101-2020_11_24_390039	155	70	Ray	Ray	NNP
10_1101-2020_11_24_390039	155	71	-	-	HYPH
10_1101-2020_11_24_390039	155	72	Sinha	Sinha	NNP
10_1101-2020_11_24_390039	155	73	et	et	NNP
10_1101-2020_11_24_390039	155	74	al	al	NNP
10_1101-2020_11_24_390039	155	75	.	.	NNP
10_1101-2020_11_24_390039	155	76	,	,	,
10_1101-2020_11_24_390039	155	77	2009	2009	CD
10_1101-2020_11_24_390039	155	78	)	)	-RRB-
10_1101-2020_11_24_390039	155	79	prior	prior	RB
10_1101-2020_11_24_390039	155	80	to	to	IN
10_1101-2020_11_24_390039	155	81	suspension	suspension	NN
10_1101-2020_11_24_390039	155	82	in	in	IN
10_1101-2020_11_24_390039	155	83	SDS	SDS	NNP
10_1101-2020_11_24_390039	155	84	sample	sample	NN
10_1101-2020_11_24_390039	155	85	buffer	buffer	NN
10_1101-2020_11_24_390039	155	86	.	.	.
10_1101-2020_11_24_390039	156	1	For	for	IN
10_1101-2020_11_24_390039	156	2	translation	translation	NN
10_1101-2020_11_24_390039	156	3	reactions	reaction	NNS
10_1101-2020_11_24_390039	156	4	using	use	VBG
10_1101-2020_11_24_390039	156	5	SP	SP	NNP
10_1101-2020_11_24_390039	156	6	cells	cell	NNS
10_1101-2020_11_24_390039	156	7	,	,	,
10_1101-2020_11_24_390039	156	8	the	the	DT
10_1101-2020_11_24_390039	156	9	total	total	JJ
10_1101-2020_11_24_390039	156	10	reaction	reaction	NN
10_1101-2020_11_24_390039	156	11	material	material	NN
10_1101-2020_11_24_390039	156	12	was	be	VBD
10_1101-2020_11_24_390039	156	13	diluted	dilute	VBN
10_1101-2020_11_24_390039	156	14	with	with	IN
10_1101-2020_11_24_390039	156	15	nine	nine	CD
10_1101-2020_11_24_390039	156	16	volumes	volume	NNS
10_1101-2020_11_24_390039	156	17	of	of	IN
10_1101-2020_11_24_390039	156	18	Triton	Triton	NNP
10_1101-2020_11_24_390039	156	19	immunoprecipitation	immunoprecipitation	NN
10_1101-2020_11_24_390039	156	20	buffer	buffer	NN
10_1101-2020_11_24_390039	156	21	(	(	-LRB-
10_1101-2020_11_24_390039	156	22	10	10	CD
10_1101-2020_11_24_390039	156	23	mM	mM	NNP
10_1101-2020_11_24_390039	156	24	Tris	Tris	NNP
10_1101-2020_11_24_390039	156	25	-	-	HYPH
10_1101-2020_11_24_390039	156	26	HCl	HCl	NNP
10_1101-2020_11_24_390039	156	27	,	,	,
10_1101-2020_11_24_390039	156	28	140	140	CD
10_1101-2020_11_24_390039	156	29	mM	mM	NNP
10_1101-2020_11_24_390039	156	30	NaCl	NaCl	NNP
10_1101-2020_11_24_390039	156	31	,	,	,
10_1101-2020_11_24_390039	156	32	1	1	CD
10_1101-2020_11_24_390039	156	33	mM	mm	NN
10_1101-2020_11_24_390039	156	34	EDTA	EDTA	NNP
10_1101-2020_11_24_390039	156	35	,	,	,
10_1101-2020_11_24_390039	156	36	1	1	CD
10_1101-2020_11_24_390039	156	37	%	%	NN
10_1101-2020_11_24_390039	156	38	Triton	Triton	NNP
10_1101-2020_11_24_390039	156	39	X-100	X-100	NNP
10_1101-2020_11_24_390039	156	40	,	,	,
10_1101-2020_11_24_390039	156	41	5	5	CD
10_1101-2020_11_24_390039	156	42	mM	mm	NN
10_1101-2020_11_24_390039	156	43	PMSF	pmsf	NN
10_1101-2020_11_24_390039	156	44	,	,	,
10_1101-2020_11_24_390039	156	45	1	1	CD
10_1101-2020_11_24_390039	156	46	mM	mm	NN
10_1101-2020_11_24_390039	156	47	methionine	methionine	NN
10_1101-2020_11_24_390039	156	48	(	(	-LRB-
10_1101-2020_11_24_390039	156	49	to	to	TO
10_1101-2020_11_24_390039	156	50	prevent	prevent	VB
10_1101-2020_11_24_390039	156	51	background	background	NN
10_1101-2020_11_24_390039	156	52	from	from	IN
10_1101-2020_11_24_390039	156	53	the	the	DT
10_1101-2020_11_24_390039	156	54	radiolabelled	radiolabelle	VBN
10_1101-2020_11_24_390039	156	55	methionine	methionine	NN
10_1101-2020_11_24_390039	156	56	)	)	-RRB-
10_1101-2020_11_24_390039	156	57	,	,	,
10_1101-2020_11_24_390039	156	58	pH	pH	NNP
10_1101-2020_11_24_390039	156	59	7.5	7.5	CD
10_1101-2020_11_24_390039	156	60	)	)	-RRB-
10_1101-2020_11_24_390039	156	61	.	.	.
10_1101-2020_11_24_390039	157	1	Samples	sample	NNS
10_1101-2020_11_24_390039	157	2	were	be	VBD
10_1101-2020_11_24_390039	157	3	incubated	incubate	VBN
10_1101-2020_11_24_390039	157	4	under	under	IN
10_1101-2020_11_24_390039	157	5	constant	constant	JJ
10_1101-2020_11_24_390039	157	6	agitation	agitation	NN
10_1101-2020_11_24_390039	157	7	with	with	IN
10_1101-2020_11_24_390039	157	8	an	an	DT
10_1101-2020_11_24_390039	157	9	antibody	antibody	NN
10_1101-2020_11_24_390039	157	10	recognising	recognise	VBG
10_1101-2020_11_24_390039	157	11	the	the	DT
10_1101-2020_11_24_390039	157	12	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	157	13	epitope	epitope	NN
10_1101-2020_11_24_390039	157	14	(	(	-LRB-
10_1101-2020_11_24_390039	157	15	1:200	1:200	CD
10_1101-2020_11_24_390039	157	16	dilution	dilution	NN
10_1101-2020_11_24_390039	157	17	)	)	-RRB-
10_1101-2020_11_24_390039	157	18	for	for	IN
10_1101-2020_11_24_390039	157	19	16	16	CD
10_1101-2020_11_24_390039	157	20	h	h	NN
10_1101-2020_11_24_390039	157	21	at	at	IN
10_1101-2020_11_24_390039	157	22	4	4	CD
10_1101-2020_11_24_390039	157	23	°	°	,
10_1101-2020_11_24_390039	157	24	C	C	NNP
10_1101-2020_11_24_390039	157	25	to	to	TO
10_1101-2020_11_24_390039	157	26	recover	recover	VB
10_1101-2020_11_24_390039	157	27	both	both	DT
10_1101-2020_11_24_390039	157	28	the	the	DT
10_1101-2020_11_24_390039	157	29	membrane	membrane	NN
10_1101-2020_11_24_390039	157	30	-	-	HYPH
10_1101-2020_11_24_390039	157	31	associated	associate	VBN
10_1101-2020_11_24_390039	157	32	and	and	CC
10_1101-2020_11_24_390039	157	33	non	non	JJ
10_1101-2020_11_24_390039	157	34	-	-	JJ
10_1101-2020_11_24_390039	157	35	targeted	target	VBN
10_1101-2020_11_24_390039	157	36	nascent	nascent	JJ
10_1101-2020_11_24_390039	157	37	chains	chain	NNS
10_1101-2020_11_24_390039	157	38	.	.	.
10_1101-2020_11_24_390039	158	1	Samples	sample	NNS
10_1101-2020_11_24_390039	158	2	were	be	VBD
10_1101-2020_11_24_390039	158	3	next	next	RB
10_1101-2020_11_24_390039	158	4	incubated	incubate	VBN
10_1101-2020_11_24_390039	158	5	under	under	IN
10_1101-2020_11_24_390039	158	6	constant	constant	JJ
10_1101-2020_11_24_390039	158	7	agitation	agitation	NN
10_1101-2020_11_24_390039	158	8	with	with	IN
10_1101-2020_11_24_390039	158	9	10	10	CD
10_1101-2020_11_24_390039	158	10	%	%	NN
10_1101-2020_11_24_390039	158	11	(	(	-LRB-
10_1101-2020_11_24_390039	158	12	v	v	NN
10_1101-2020_11_24_390039	158	13	/	/	SYM
10_1101-2020_11_24_390039	158	14	v	v	NN
10_1101-2020_11_24_390039	158	15	)	)	-RRB-
10_1101-2020_11_24_390039	158	16	Protein	Protein	NNP
10_1101-2020_11_24_390039	158	17	-	-	HYPH
10_1101-2020_11_24_390039	158	18	A	a	NN
10_1101-2020_11_24_390039	158	19	-	-	HYPH
10_1101-2020_11_24_390039	158	20	Sepharose	sepharose	NN
10_1101-2020_11_24_390039	158	21	beads	bead	NNS
10_1101-2020_11_24_390039	158	22	(	(	-LRB-
10_1101-2020_11_24_390039	158	23	Genscript	genscript	NN
10_1101-2020_11_24_390039	158	24	)	)	-RRB-
10_1101-2020_11_24_390039	158	25	for	for	IN
10_1101-2020_11_24_390039	158	26	a	a	DT
10_1101-2020_11_24_390039	158	27	further	further	JJ
10_1101-2020_11_24_390039	158	28	2	2	CD
10_1101-2020_11_24_390039	158	29	h	h	NN
10_1101-2020_11_24_390039	158	30	at	at	IN
10_1101-2020_11_24_390039	158	31	4	4	CD
10_1101-2020_11_24_390039	158	32	°	°	NNS
10_1101-2020_11_24_390039	158	33	C	C	NNP
10_1101-2020_11_24_390039	158	34	before	before	IN
10_1101-2020_11_24_390039	158	35	recovery	recovery	NN
10_1101-2020_11_24_390039	158	36	by	by	IN
10_1101-2020_11_24_390039	158	37	centrifugation	centrifugation	NN
10_1101-2020_11_24_390039	158	38	at	at	IN
10_1101-2020_11_24_390039	158	39	13,000	13,000	CD
10_1101-2020_11_24_390039	158	40	g	g	NN
10_1101-2020_11_24_390039	158	41	for	for	IN
10_1101-2020_11_24_390039	158	42	1	1	CD
10_1101-2020_11_24_390039	158	43	min	min	NN
10_1101-2020_11_24_390039	158	44	.	.	.
10_1101-2020_11_24_390039	159	1	Protein	protein	NN
10_1101-2020_11_24_390039	159	2	-	-	HYPH
10_1101-2020_11_24_390039	159	3	A	a	NN
10_1101-2020_11_24_390039	159	4	-	-	HYPH
10_1101-2020_11_24_390039	159	5	Sepharose	sepharose	NN
10_1101-2020_11_24_390039	159	6	beads	bead	NNS
10_1101-2020_11_24_390039	159	7	were	be	VBD
10_1101-2020_11_24_390039	159	8	washed	wash	VBN
10_1101-2020_11_24_390039	159	9	twice	twice	RB
10_1101-2020_11_24_390039	159	10	with	with	IN
10_1101-2020_11_24_390039	159	11	Triton	Triton	NNP
10_1101-2020_11_24_390039	159	12	immunoprecipitation	immunoprecipitation	NN
10_1101-2020_11_24_390039	159	13	buffer	buffer	NN
10_1101-2020_11_24_390039	159	14	prior	prior	RB
10_1101-2020_11_24_390039	159	15	to	to	IN
10_1101-2020_11_24_390039	159	16	suspension	suspension	NN
10_1101-2020_11_24_390039	159	17	in	in	IN
10_1101-2020_11_24_390039	159	18	SDS	SDS	NNP
10_1101-2020_11_24_390039	159	19	sample	sample	NN
10_1101-2020_11_24_390039	159	20	buffer	buffer	NN
10_1101-2020_11_24_390039	159	21	.	.	.
10_1101-2020_11_24_390039	160	1	Where	where	WRB
10_1101-2020_11_24_390039	160	2	indicated	indicate	VBN
10_1101-2020_11_24_390039	160	3	,	,	,
10_1101-2020_11_24_390039	160	4	samples	sample	NNS
10_1101-2020_11_24_390039	160	5	were	be	VBD
10_1101-2020_11_24_390039	160	6	treated	treat	VBN
10_1101-2020_11_24_390039	160	7	with	with	IN
10_1101-2020_11_24_390039	160	8	1000	1000	CD
10_1101-2020_11_24_390039	160	9	U	u	NN
10_1101-2020_11_24_390039	160	10	of	of	IN
10_1101-2020_11_24_390039	160	11	a	a	DT
10_1101-2020_11_24_390039	160	12	form	form	NN
10_1101-2020_11_24_390039	160	13	of	of	IN
10_1101-2020_11_24_390039	160	14	Endoglycosidase	Endoglycosidase	NNP
10_1101-2020_11_24_390039	160	15	H	H	NNP
10_1101-2020_11_24_390039	160	16	that	that	WDT
10_1101-2020_11_24_390039	160	17	does	do	VBZ
10_1101-2020_11_24_390039	160	18	not	not	RB
10_1101-2020_11_24_390039	160	19	co	co	VB
10_1101-2020_11_24_390039	160	20	-	-	VB
10_1101-2020_11_24_390039	160	21	migrate	migrate	VB
10_1101-2020_11_24_390039	160	22	with	with	IN
10_1101-2020_11_24_390039	160	23	and	and	CC
10_1101-2020_11_24_390039	160	24	hence	hence	RB
10_1101-2020_11_24_390039	160	25	potentially	potentially	RB
10_1101-2020_11_24_390039	160	26	distort	distort	VBP
10_1101-2020_11_24_390039	160	27	the	the	DT
10_1101-2020_11_24_390039	160	28	radiolabelled	radiolabelle	VBN
10_1101-2020_11_24_390039	160	29	products	product	NNS
10_1101-2020_11_24_390039	160	30	when	when	WRB
10_1101-2020_11_24_390039	160	31	resolved	resolve	VBN
10_1101-2020_11_24_390039	160	32	:	:	:
10_1101-2020_11_24_390039	160	33	Endoglycosidase	Endoglycosidase	NNP
10_1101-2020_11_24_390039	160	34	Hf	Hf	NNP
10_1101-2020_11_24_390039	160	35	(	(	-LRB-
10_1101-2020_11_24_390039	160	36	translation	translation	NN
10_1101-2020_11_24_390039	160	37	products	product	NNS
10_1101-2020_11_24_390039	160	38	of	of	IN
10_1101-2020_11_24_390039	160	39	~10	~10	NFP
10_1101-2020_11_24_390039	160	40	-	-	:
10_1101-2020_11_24_390039	160	41	50	50	CD
10_1101-2020_11_24_390039	160	42	kDa	kDa	NNS
10_1101-2020_11_24_390039	160	43	;	;	:
10_1101-2020_11_24_390039	160	44	New	New	NNP
10_1101-2020_11_24_390039	160	45	England	England	NNP
10_1101-2020_11_24_390039	160	46	Biolabs	Biolabs	NNP
10_1101-2020_11_24_390039	160	47	,	,	,
10_1101-2020_11_24_390039	160	48	P0703S	P0703S	NNPS
10_1101-2020_11_24_390039	160	49	)	)	-RRB-
10_1101-2020_11_24_390039	160	50	or	or	CC
10_1101-2020_11_24_390039	160	51	Endoglycosidase	Endoglycosidase	NNP
10_1101-2020_11_24_390039	160	52	H	H	NNP
10_1101-2020_11_24_390039	160	53	(	(	-LRB-
10_1101-2020_11_24_390039	160	54	translation	translation	NN
10_1101-2020_11_24_390039	160	55	products	product	NNS
10_1101-2020_11_24_390039	160	56	of	of	IN
10_1101-2020_11_24_390039	160	57	~50	~50	NFP
10_1101-2020_11_24_390039	160	58	-	-	HYPH
10_1101-2020_11_24_390039	160	59	150	150	CD
10_1101-2020_11_24_390039	160	60	kDa	kda	NN
10_1101-2020_11_24_390039	160	61	protein	protein	NN
10_1101-2020_11_24_390039	160	62	substrates	substrate	NNS
10_1101-2020_11_24_390039	160	63	;	;	:
10_1101-2020_11_24_390039	160	64	New	New	NNP
10_1101-2020_11_24_390039	160	65	England	England	NNP
10_1101-2020_11_24_390039	160	66	Biolabs	Biolabs	NNP
10_1101-2020_11_24_390039	160	67	,	,	,
10_1101-2020_11_24_390039	160	68	P0702S	P0702S	NNP
10_1101-2020_11_24_390039	160	69	)	)	-RRB-
10_1101-2020_11_24_390039	160	70	.	.	.
10_1101-2020_11_24_390039	161	1	All	all	DT
10_1101-2020_11_24_390039	161	2	samples	sample	NNS
10_1101-2020_11_24_390039	161	3	were	be	VBD
10_1101-2020_11_24_390039	161	4	solubilised	solubilise	VBN
10_1101-2020_11_24_390039	161	5	for	for	IN
10_1101-2020_11_24_390039	161	6	12	12	CD
10_1101-2020_11_24_390039	161	7	h	h	NN
10_1101-2020_11_24_390039	161	8	at	at	IN
10_1101-2020_11_24_390039	161	9	37	37	CD
10_1101-2020_11_24_390039	161	10	°	°	NNS
10_1101-2020_11_24_390039	161	11	C	C	NNP
10_1101-2020_11_24_390039	161	12	and	and	CC
10_1101-2020_11_24_390039	161	13	then	then	RB
10_1101-2020_11_24_390039	161	14	sonicated	sonicate	VBD
10_1101-2020_11_24_390039	161	15	prior	prior	RB
10_1101-2020_11_24_390039	161	16	to	to	IN
10_1101-2020_11_24_390039	161	17	resolution	resolution	NN
10_1101-2020_11_24_390039	161	18	by	by	IN
10_1101-2020_11_24_390039	161	19	SDS	SDS	NNP
10_1101-2020_11_24_390039	161	20	-	-	HYPH
10_1101-2020_11_24_390039	161	21	PAGE	PAGE	NNP
10_1101-2020_11_24_390039	161	22	(	(	-LRB-
10_1101-2020_11_24_390039	161	23	10	10	CD
10_1101-2020_11_24_390039	161	24	%	%	NN
10_1101-2020_11_24_390039	161	25	or	or	CC
10_1101-2020_11_24_390039	161	26	16	16	CD
10_1101-2020_11_24_390039	161	27	%	%	NN
10_1101-2020_11_24_390039	161	28	PAGE	PAGE	NNP
10_1101-2020_11_24_390039	161	29	,	,	,
10_1101-2020_11_24_390039	161	30	120V	120v	CD
10_1101-2020_11_24_390039	161	31	,	,	,
10_1101-2020_11_24_390039	161	32	120	120	CD
10_1101-2020_11_24_390039	161	33	-	-	SYM
10_1101-2020_11_24_390039	161	34	180	180	CD
10_1101-2020_11_24_390039	161	35	min	min	NN
10_1101-2020_11_24_390039	161	36	)	)	-RRB-
10_1101-2020_11_24_390039	161	37	.	.	.
10_1101-2020_11_24_390039	162	1	Gels	gel	NNS
10_1101-2020_11_24_390039	162	2	were	be	VBD
10_1101-2020_11_24_390039	162	3	.CC	.CC	:
10_1101-2020_11_24_390039	162	4	-	-	HYPH
10_1101-2020_11_24_390039	162	5	BY	by	IN
10_1101-2020_11_24_390039	162	6	-	-	HYPH
10_1101-2020_11_24_390039	162	7	ND	ND	NNP
10_1101-2020_11_24_390039	162	8	4.0	4.0	CD
10_1101-2020_11_24_390039	162	9	International	international	JJ
10_1101-2020_11_24_390039	162	10	licensemade	licensemade	NN
10_1101-2020_11_24_390039	162	11	available	available	JJ
10_1101-2020_11_24_390039	162	12	under	under	IN
10_1101-2020_11_24_390039	162	13	a	a	DT
10_1101-2020_11_24_390039	162	14	(	(	-LRB-
10_1101-2020_11_24_390039	162	15	which	which	WDT
10_1101-2020_11_24_390039	162	16	was	be	VBD
10_1101-2020_11_24_390039	162	17	not	not	RB
10_1101-2020_11_24_390039	162	18	certified	certify	VBN
10_1101-2020_11_24_390039	162	19	by	by	IN
10_1101-2020_11_24_390039	162	20	peer	peer	NN
10_1101-2020_11_24_390039	162	21	review	review	NN
10_1101-2020_11_24_390039	162	22	)	)	-RRB-
10_1101-2020_11_24_390039	162	23	is	be	VBZ
10_1101-2020_11_24_390039	162	24	the	the	DT
10_1101-2020_11_24_390039	162	25	author	author	NN
10_1101-2020_11_24_390039	162	26	/	/	SYM
10_1101-2020_11_24_390039	162	27	funder	funder	NN
10_1101-2020_11_24_390039	162	28	,	,	,
10_1101-2020_11_24_390039	162	29	who	who	WP
10_1101-2020_11_24_390039	162	30	has	have	VBZ
10_1101-2020_11_24_390039	162	31	granted	grant	VBN
10_1101-2020_11_24_390039	162	32	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	162	33	a	a	DT
10_1101-2020_11_24_390039	162	34	license	license	NN
10_1101-2020_11_24_390039	162	35	to	to	TO
10_1101-2020_11_24_390039	162	36	display	display	VB
10_1101-2020_11_24_390039	162	37	the	the	DT
10_1101-2020_11_24_390039	162	38	preprint	preprint	NN
10_1101-2020_11_24_390039	162	39	in	in	IN
10_1101-2020_11_24_390039	162	40	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	162	41	.	.	.
10_1101-2020_11_24_390039	163	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	163	2	is	be	VBZ
10_1101-2020_11_24_390039	163	3	The	the	DT
10_1101-2020_11_24_390039	163	4	copyright	copyright	NN
10_1101-2020_11_24_390039	163	5	holder	holder	NN
10_1101-2020_11_24_390039	163	6	for	for	IN
10_1101-2020_11_24_390039	163	7	this	this	DT
10_1101-2020_11_24_390039	163	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	163	9	version	version	NN
10_1101-2020_11_24_390039	163	10	posted	post	VBD
10_1101-2020_11_24_390039	163	11	January	January	NNP
10_1101-2020_11_24_390039	163	12	5	5	CD
10_1101-2020_11_24_390039	163	13	,	,	,
10_1101-2020_11_24_390039	163	14	2021	2021	CD
10_1101-2020_11_24_390039	163	15	.	.	.
10_1101-2020_11_24_390039	163	16	;	;	:
10_1101-2020_11_24_390039	163	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	163	18	:	:	:
10_1101-2020_11_24_390039	163	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	163	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	163	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	163	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	163	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	163	24	-	-	HYPH
10_1101-2020_11_24_390039	163	25	F	F	NNP
10_1101-2020_11_24_390039	163	26	as	as	IN
10_1101-2020_11_24_390039	163	27	a	a	DT
10_1101-2020_11_24_390039	163	28	potential	potential	JJ
10_1101-2020_11_24_390039	163	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	163	30	agent	agent	NN
10_1101-2020_11_24_390039	163	31	Page	Page	NNP
10_1101-2020_11_24_390039	163	32	13	13	CD
10_1101-2020_11_24_390039	163	33	of	of	IN
10_1101-2020_11_24_390039	163	34	21	21	CD
10_1101-2020_11_24_390039	163	35	fixed	fix	VBN
10_1101-2020_11_24_390039	163	36	for	for	IN
10_1101-2020_11_24_390039	163	37	5	5	CD
10_1101-2020_11_24_390039	163	38	min	min	NN
10_1101-2020_11_24_390039	163	39	(	(	-LRB-
10_1101-2020_11_24_390039	163	40	20	20	CD
10_1101-2020_11_24_390039	163	41	%	%	NN
10_1101-2020_11_24_390039	163	42	MeOH	MeOH	NNP
10_1101-2020_11_24_390039	163	43	,	,	,
10_1101-2020_11_24_390039	163	44	10	10	CD
10_1101-2020_11_24_390039	163	45	%	%	NN
10_1101-2020_11_24_390039	163	46	AcOH	AcOH	NNP
10_1101-2020_11_24_390039	163	47	)	)	-RRB-
10_1101-2020_11_24_390039	163	48	,	,	,
10_1101-2020_11_24_390039	163	49	dried	dry	VBN
10_1101-2020_11_24_390039	163	50	for	for	IN
10_1101-2020_11_24_390039	163	51	2	2	CD
10_1101-2020_11_24_390039	163	52	h	h	NN
10_1101-2020_11_24_390039	163	53	at	at	IN
10_1101-2020_11_24_390039	163	54	65	65	CD
10_1101-2020_11_24_390039	163	55	°	°	NNS
10_1101-2020_11_24_390039	163	56	C	C	NNP
10_1101-2020_11_24_390039	163	57	and	and	CC
10_1101-2020_11_24_390039	163	58	radiolabelled	radiolabelle	VBD
10_1101-2020_11_24_390039	163	59	products	product	NNS
10_1101-2020_11_24_390039	163	60	visualised	visualise	VBN
10_1101-2020_11_24_390039	163	61	using	use	VBG
10_1101-2020_11_24_390039	163	62	a	a	DT
10_1101-2020_11_24_390039	163	63	Typhoon	Typhoon	NNP
10_1101-2020_11_24_390039	163	64	FLA-700	fla-700	FW
10_1101-2020_11_24_390039	163	65	(	(	-LRB-
10_1101-2020_11_24_390039	163	66	GE	GE	NNP
10_1101-2020_11_24_390039	163	67	Healthcare	Healthcare	NNP
10_1101-2020_11_24_390039	163	68	)	)	-RRB-
10_1101-2020_11_24_390039	163	69	following	follow	VBG
10_1101-2020_11_24_390039	163	70	exposure	exposure	NN
10_1101-2020_11_24_390039	163	71	to	to	IN
10_1101-2020_11_24_390039	163	72	a	a	DT
10_1101-2020_11_24_390039	163	73	phosphorimaging	phosphorimage	VBG
10_1101-2020_11_24_390039	163	74	plate	plate	NN
10_1101-2020_11_24_390039	163	75	for	for	IN
10_1101-2020_11_24_390039	163	76	24	24	CD
10_1101-2020_11_24_390039	163	77	-	-	SYM
10_1101-2020_11_24_390039	163	78	72	72	CD
10_1101-2020_11_24_390039	163	79	h.	h.	NN
10_1101-2020_11_24_390039	163	80	Western	Western	NNP
10_1101-2020_11_24_390039	163	81	Blotting	Blotting	NNP
10_1101-2020_11_24_390039	163	82	Following	follow	VBG
10_1101-2020_11_24_390039	163	83	semi	semi	JJ
10_1101-2020_11_24_390039	163	84	-	-	NN
10_1101-2020_11_24_390039	163	85	permeabilisation	permeabilisation	NN
10_1101-2020_11_24_390039	163	86	,	,	,
10_1101-2020_11_24_390039	163	87	aliquots	aliquot	NNS
10_1101-2020_11_24_390039	163	88	of	of	IN
10_1101-2020_11_24_390039	163	89	siRNA	sirna	NN
10_1101-2020_11_24_390039	163	90	-	-	HYPH
10_1101-2020_11_24_390039	163	91	treated	treat	VBN
10_1101-2020_11_24_390039	163	92	HeLa	HeLa	NNP
10_1101-2020_11_24_390039	163	93	cells	cell	NNS
10_1101-2020_11_24_390039	163	94	were	be	VBD
10_1101-2020_11_24_390039	163	95	suspended	suspend	VBN
10_1101-2020_11_24_390039	163	96	in	in	IN
10_1101-2020_11_24_390039	163	97	SDS	SDS	NNP
10_1101-2020_11_24_390039	163	98	sample	sample	NN
10_1101-2020_11_24_390039	163	99	buffer	buffer	NN
10_1101-2020_11_24_390039	163	100	,	,	,
10_1101-2020_11_24_390039	163	101	denatured	denature	VBD
10_1101-2020_11_24_390039	163	102	for	for	IN
10_1101-2020_11_24_390039	163	103	12	12	CD
10_1101-2020_11_24_390039	163	104	h	h	NN
10_1101-2020_11_24_390039	163	105	at	at	IN
10_1101-2020_11_24_390039	163	106	37	37	CD
10_1101-2020_11_24_390039	163	107	°	°	NNS
10_1101-2020_11_24_390039	163	108	C	C	NNP
10_1101-2020_11_24_390039	163	109	and	and	CC
10_1101-2020_11_24_390039	163	110	sonicated	sonicate	VBN
10_1101-2020_11_24_390039	163	111	prior	prior	RB
10_1101-2020_11_24_390039	163	112	to	to	IN
10_1101-2020_11_24_390039	163	113	resolution	resolution	NN
10_1101-2020_11_24_390039	163	114	by	by	IN
10_1101-2020_11_24_390039	163	115	SDS	SDS	NNP
10_1101-2020_11_24_390039	163	116	-	-	HYPH
10_1101-2020_11_24_390039	163	117	PAGE	PAGE	NNP
10_1101-2020_11_24_390039	163	118	(	(	-LRB-
10_1101-2020_11_24_390039	163	119	16	16	CD
10_1101-2020_11_24_390039	163	120	%	%	NN
10_1101-2020_11_24_390039	163	121	or	or	CC
10_1101-2020_11_24_390039	163	122	10	10	CD
10_1101-2020_11_24_390039	163	123	%	%	NN
10_1101-2020_11_24_390039	163	124	PAGE	PAGE	NNP
10_1101-2020_11_24_390039	163	125	,	,	,
10_1101-2020_11_24_390039	163	126	120V	120v	CD
10_1101-2020_11_24_390039	163	127	,	,	,
10_1101-2020_11_24_390039	163	128	120	120	CD
10_1101-2020_11_24_390039	163	129	-	-	SYM
10_1101-2020_11_24_390039	163	130	150	150	CD
10_1101-2020_11_24_390039	163	131	min	min	NN
10_1101-2020_11_24_390039	163	132	)	)	-RRB-
10_1101-2020_11_24_390039	163	133	.	.	.
10_1101-2020_11_24_390039	164	1	Following	follow	VBG
10_1101-2020_11_24_390039	164	2	transfer	transfer	NN
10_1101-2020_11_24_390039	164	3	to	to	IN
10_1101-2020_11_24_390039	164	4	a	a	DT
10_1101-2020_11_24_390039	164	5	PVDF	PVDF	NNP
10_1101-2020_11_24_390039	164	6	membrane	membrane	NN
10_1101-2020_11_24_390039	164	7	in	in	IN
10_1101-2020_11_24_390039	164	8	transfer	transfer	NN
10_1101-2020_11_24_390039	164	9	buffer	buffer	NN
10_1101-2020_11_24_390039	164	10	(	(	-LRB-
10_1101-2020_11_24_390039	164	11	0.06	0.06	CD
10_1101-2020_11_24_390039	164	12	M	M	NNP
10_1101-2020_11_24_390039	164	13	Tris	Tris	NNP
10_1101-2020_11_24_390039	164	14	,	,	,
10_1101-2020_11_24_390039	164	15	0.60	0.60	CD
10_1101-2020_11_24_390039	164	16	M	M	NNP
10_1101-2020_11_24_390039	164	17	glycine	glycine	NN
10_1101-2020_11_24_390039	164	18	,	,	,
10_1101-2020_11_24_390039	164	19	20	20	CD
10_1101-2020_11_24_390039	164	20	%	%	NN
10_1101-2020_11_24_390039	164	21	MeOH	MeOH	NNP
10_1101-2020_11_24_390039	164	22	)	)	-RRB-
10_1101-2020_11_24_390039	164	23	at	at	IN
10_1101-2020_11_24_390039	164	24	300	300	CD
10_1101-2020_11_24_390039	164	25	mA	mA	NNP
10_1101-2020_11_24_390039	164	26	for	for	IN
10_1101-2020_11_24_390039	164	27	2.5	2.5	CD
10_1101-2020_11_24_390039	164	28	h	h	NN
10_1101-2020_11_24_390039	164	29	,	,	,
10_1101-2020_11_24_390039	164	30	PVDF	PVDF	NNP
10_1101-2020_11_24_390039	164	31	membranes	membrane	NNS
10_1101-2020_11_24_390039	164	32	were	be	VBD
10_1101-2020_11_24_390039	164	33	incubated	incubate	VBN
10_1101-2020_11_24_390039	164	34	in	in	IN
10_1101-2020_11_24_390039	164	35	1X	1x	JJ
10_1101-2020_11_24_390039	164	36	Casein	Casein	NNP
10_1101-2020_11_24_390039	164	37	blocking	block	VBG
10_1101-2020_11_24_390039	164	38	buffer	buffer	NN
10_1101-2020_11_24_390039	164	39	(	(	-LRB-
10_1101-2020_11_24_390039	164	40	10X	10x	CD
10_1101-2020_11_24_390039	164	41	stock	stock	NN
10_1101-2020_11_24_390039	164	42	from	from	IN
10_1101-2020_11_24_390039	164	43	Sigma	Sigma	NNP
10_1101-2020_11_24_390039	164	44	-	-	HYPH
10_1101-2020_11_24_390039	164	45	Aldrich	Aldrich	NNP
10_1101-2020_11_24_390039	164	46	,	,	,
10_1101-2020_11_24_390039	164	47	B6429	B6429	NNP
10_1101-2020_11_24_390039	164	48	)	)	-RRB-
10_1101-2020_11_24_390039	164	49	made	make	VBD
10_1101-2020_11_24_390039	164	50	up	up	RP
10_1101-2020_11_24_390039	164	51	in	in	IN
10_1101-2020_11_24_390039	164	52	TBS	TBS	NNP
10_1101-2020_11_24_390039	164	53	,	,	,
10_1101-2020_11_24_390039	164	54	incubated	incubate	VBN
10_1101-2020_11_24_390039	164	55	with	with	IN
10_1101-2020_11_24_390039	164	56	appropriate	appropriate	JJ
10_1101-2020_11_24_390039	164	57	primary	primary	JJ
10_1101-2020_11_24_390039	164	58	antibodies	antibody	NNS
10_1101-2020_11_24_390039	164	59	(	(	-LRB-
10_1101-2020_11_24_390039	164	60	1:500	1:500	CD
10_1101-2020_11_24_390039	164	61	or	or	CC
10_1101-2020_11_24_390039	164	62	1:1000	1:1000	CD
10_1101-2020_11_24_390039	164	63	dilution	dilution	NN
10_1101-2020_11_24_390039	164	64	)	)	-RRB-
10_1101-2020_11_24_390039	164	65	and	and	CC
10_1101-2020_11_24_390039	164	66	processed	process	VBN
10_1101-2020_11_24_390039	164	67	for	for	IN
10_1101-2020_11_24_390039	164	68	fluorescence	fluorescence	NN
10_1101-2020_11_24_390039	164	69	-	-	HYPH
10_1101-2020_11_24_390039	164	70	based	base	VBN
10_1101-2020_11_24_390039	164	71	detection	detection	NN
10_1101-2020_11_24_390039	164	72	as	as	IN
10_1101-2020_11_24_390039	164	73	described	describe	VBN
10_1101-2020_11_24_390039	164	74	by	by	IN
10_1101-2020_11_24_390039	164	75	LI	LI	NNP
10_1101-2020_11_24_390039	164	76	-	-	HYPH
10_1101-2020_11_24_390039	164	77	COR	COR	NNP
10_1101-2020_11_24_390039	164	78	Biosciences	Biosciences	NNPS
10_1101-2020_11_24_390039	164	79	using	use	VBG
10_1101-2020_11_24_390039	164	80	appropriate	appropriate	JJ
10_1101-2020_11_24_390039	164	81	secondary	secondary	JJ
10_1101-2020_11_24_390039	164	82	antibodies	antibody	NNS
10_1101-2020_11_24_390039	164	83	(	(	-LRB-
10_1101-2020_11_24_390039	164	84	IRDye	IRDye	NNP
10_1101-2020_11_24_390039	164	85	680RD	680RD	NNP
10_1101-2020_11_24_390039	164	86	Donkey	Donkey	NNP
10_1101-2020_11_24_390039	164	87	anti	anti	NNP
10_1101-2020_11_24_390039	164	88	-	-	NNP
10_1101-2020_11_24_390039	164	89	Goat	Goat	NNP
10_1101-2020_11_24_390039	164	90	,	,	,
10_1101-2020_11_24_390039	164	91	IRDye	IRDye	NNP
10_1101-2020_11_24_390039	164	92	680RD	680RD	NNP
10_1101-2020_11_24_390039	164	93	Donkey	Donkey	NNP
10_1101-2020_11_24_390039	164	94	anti	anti	JJ
10_1101-2020_11_24_390039	164	95	-	-	NNP
10_1101-2020_11_24_390039	164	96	Rabbit	rabbit	JJ
10_1101-2020_11_24_390039	164	97	,	,	,
10_1101-2020_11_24_390039	164	98	IRDye	IRDye	NNP
10_1101-2020_11_24_390039	164	99	800CW	800CW	NNP
10_1101-2020_11_24_390039	164	100	Donkey	Donkey	NNP
10_1101-2020_11_24_390039	164	101	anti	anti	NNP
10_1101-2020_11_24_390039	164	102	-	-	NNP
10_1101-2020_11_24_390039	164	103	Mouse	Mouse	NNP
10_1101-2020_11_24_390039	164	104	)	)	-RRB-
10_1101-2020_11_24_390039	164	105	at	at	IN
10_1101-2020_11_24_390039	164	106	1:10,000	1:10,000	CD
10_1101-2020_11_24_390039	164	107	dilution	dilution	NN
10_1101-2020_11_24_390039	164	108	.	.	.
10_1101-2020_11_24_390039	165	1	Signals	signal	NNS
10_1101-2020_11_24_390039	165	2	were	be	VBD
10_1101-2020_11_24_390039	165	3	visualised	visualise	VBN
10_1101-2020_11_24_390039	165	4	using	use	VBG
10_1101-2020_11_24_390039	165	5	an	an	DT
10_1101-2020_11_24_390039	165	6	Odyssey	Odyssey	NNP
10_1101-2020_11_24_390039	165	7	CLx	CLx	NNP
10_1101-2020_11_24_390039	165	8	Imaging	Imaging	NNP
10_1101-2020_11_24_390039	165	9	System	System	NNP
10_1101-2020_11_24_390039	165	10	(	(	-LRB-
10_1101-2020_11_24_390039	165	11	LI	LI	NNP
10_1101-2020_11_24_390039	165	12	-	-	HYPH
10_1101-2020_11_24_390039	165	13	COR	COR	NNP
10_1101-2020_11_24_390039	165	14	Biosciences	Biosciences	NNPS
10_1101-2020_11_24_390039	165	15	)	)	-RRB-
10_1101-2020_11_24_390039	165	16	.	.	.
10_1101-2020_11_24_390039	166	1	Quantitation	quantitation	NN
10_1101-2020_11_24_390039	166	2	and	and	CC
10_1101-2020_11_24_390039	166	3	Statistical	Statistical	NNP
10_1101-2020_11_24_390039	166	4	Analysis	Analysis	NNP
10_1101-2020_11_24_390039	166	5	Bar	Bar	NNP
10_1101-2020_11_24_390039	166	6	graphs	graphs	NN
10_1101-2020_11_24_390039	166	7	depict	depict	VBP
10_1101-2020_11_24_390039	166	8	either	either	CC
10_1101-2020_11_24_390039	166	9	the	the	DT
10_1101-2020_11_24_390039	166	10	efficiency	efficiency	NN
10_1101-2020_11_24_390039	166	11	of	of	IN
10_1101-2020_11_24_390039	166	12	membrane	membrane	NN
10_1101-2020_11_24_390039	166	13	translocation	translocation	NN
10_1101-2020_11_24_390039	166	14	/	/	SYM
10_1101-2020_11_24_390039	166	15	insertion	insertion	NN
10_1101-2020_11_24_390039	166	16	calculated	calculate	VBN
10_1101-2020_11_24_390039	166	17	as	as	IN
10_1101-2020_11_24_390039	166	18	the	the	DT
10_1101-2020_11_24_390039	166	19	ratio	ratio	NN
10_1101-2020_11_24_390039	166	20	of	of	IN
10_1101-2020_11_24_390039	166	21	N	n	NN
10_1101-2020_11_24_390039	166	22	-	-	HYPH
10_1101-2020_11_24_390039	166	23	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	166	24	protein	protein	NN
10_1101-2020_11_24_390039	166	25	relative	relative	JJ
10_1101-2020_11_24_390039	166	26	to	to	IN
10_1101-2020_11_24_390039	166	27	the	the	DT
10_1101-2020_11_24_390039	166	28	amount	amount	NN
10_1101-2020_11_24_390039	166	29	of	of	IN
10_1101-2020_11_24_390039	166	30	non	non	JJ
10_1101-2020_11_24_390039	166	31	-	-	JJ
10_1101-2020_11_24_390039	166	32	N-	n-	JJ
10_1101-2020_11_24_390039	166	33	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	166	34	protein	protein	NN
10_1101-2020_11_24_390039	166	35	(	(	-LRB-
10_1101-2020_11_24_390039	166	36	Fig	fig	NN
10_1101-2020_11_24_390039	166	37	.	.	.
10_1101-2020_11_24_390039	167	1	2	2	CD
10_1101-2020_11_24_390039	167	2	-	-	SYM
10_1101-2020_11_24_390039	167	3	3	3	CD
10_1101-2020_11_24_390039	167	4	)	)	-RRB-
10_1101-2020_11_24_390039	167	5	,	,	,
10_1101-2020_11_24_390039	167	6	or	or	CC
10_1101-2020_11_24_390039	167	7	the	the	DT
10_1101-2020_11_24_390039	167	8	efficiencies	efficiency	NNS
10_1101-2020_11_24_390039	167	9	of	of	IN
10_1101-2020_11_24_390039	167	10	siRNA	sirna	NN
10_1101-2020_11_24_390039	167	11	-	-	HYPH
10_1101-2020_11_24_390039	167	12	mediated	mediate	VBN
10_1101-2020_11_24_390039	167	13	knockdown	knockdown	VBN
10_1101-2020_11_24_390039	167	14	in	in	IN
10_1101-2020_11_24_390039	167	15	SP	SP	NNP
10_1101-2020_11_24_390039	167	16	cells	cell	NNS
10_1101-2020_11_24_390039	167	17	calculated	calculate	VBN
10_1101-2020_11_24_390039	167	18	as	as	IN
10_1101-2020_11_24_390039	167	19	a	a	DT
10_1101-2020_11_24_390039	167	20	proportion	proportion	NN
10_1101-2020_11_24_390039	167	21	of	of	IN
10_1101-2020_11_24_390039	167	22	the	the	DT
10_1101-2020_11_24_390039	167	23	protein	protein	NN
10_1101-2020_11_24_390039	167	24	content	content	NN
10_1101-2020_11_24_390039	167	25	when	when	WRB
10_1101-2020_11_24_390039	167	26	compared	compare	VBN
10_1101-2020_11_24_390039	167	27	to	to	IN
10_1101-2020_11_24_390039	167	28	the	the	DT
10_1101-2020_11_24_390039	167	29	NT	NT	NNP
10_1101-2020_11_24_390039	167	30	control	control	NN
10_1101-2020_11_24_390039	167	31	(	(	-LRB-
10_1101-2020_11_24_390039	167	32	Fig	fig	NN
10_1101-2020_11_24_390039	167	33	.	.	.
10_1101-2020_11_24_390039	168	1	S2	s2	NN
10_1101-2020_11_24_390039	168	2	)	)	-RRB-
10_1101-2020_11_24_390039	168	3	,	,	,
10_1101-2020_11_24_390039	168	4	with	with	IN
10_1101-2020_11_24_390039	168	5	all	all	DT
10_1101-2020_11_24_390039	168	6	control	control	NN
10_1101-2020_11_24_390039	168	7	samples	sample	NNS
10_1101-2020_11_24_390039	168	8	set	set	VBN
10_1101-2020_11_24_390039	168	9	to	to	IN
10_1101-2020_11_24_390039	168	10	100	100	CD
10_1101-2020_11_24_390039	168	11	%	%	NN
10_1101-2020_11_24_390039	168	12	.	.	.
10_1101-2020_11_24_390039	169	1	Normalised	normalised	JJ
10_1101-2020_11_24_390039	169	2	values	value	NNS
10_1101-2020_11_24_390039	169	3	were	be	VBD
10_1101-2020_11_24_390039	169	4	used	use	VBN
10_1101-2020_11_24_390039	169	5	for	for	IN
10_1101-2020_11_24_390039	169	6	statistical	statistical	JJ
10_1101-2020_11_24_390039	169	7	comparison	comparison	NN
10_1101-2020_11_24_390039	169	8	(	(	-LRB-
10_1101-2020_11_24_390039	169	9	one	one	CD
10_1101-2020_11_24_390039	169	10	-	-	HYPH
10_1101-2020_11_24_390039	169	11	way	way	NN
10_1101-2020_11_24_390039	169	12	or	or	CC
10_1101-2020_11_24_390039	169	13	two	two	CD
10_1101-2020_11_24_390039	169	14	-	-	HYPH
10_1101-2020_11_24_390039	169	15	way	way	NN
10_1101-2020_11_24_390039	169	16	ANOVA	ANOVA	NNP
10_1101-2020_11_24_390039	169	17	;	;	:
10_1101-2020_11_24_390039	169	18	DF	DF	NNP
10_1101-2020_11_24_390039	169	19	and	and	CC
10_1101-2020_11_24_390039	169	20	F	F	NNP
10_1101-2020_11_24_390039	169	21	values	value	NNS
10_1101-2020_11_24_390039	169	22	are	be	VBP
10_1101-2020_11_24_390039	169	23	shown	show	VBN
10_1101-2020_11_24_390039	169	24	in	in	IN
10_1101-2020_11_24_390039	169	25	each	each	DT
10_1101-2020_11_24_390039	169	26	figure	figure	NN
10_1101-2020_11_24_390039	169	27	as	as	IN
10_1101-2020_11_24_390039	169	28	appropriate	appropriate	JJ
10_1101-2020_11_24_390039	169	29	and	and	CC
10_1101-2020_11_24_390039	169	30	the	the	DT
10_1101-2020_11_24_390039	169	31	multiple	multiple	JJ
10_1101-2020_11_24_390039	169	32	comparisons	comparison	NNS
10_1101-2020_11_24_390039	169	33	test	test	NN
10_1101-2020_11_24_390039	169	34	used	use	VBN
10_1101-2020_11_24_390039	169	35	are	be	VBP
10_1101-2020_11_24_390039	169	36	indicated	indicate	VBN
10_1101-2020_11_24_390039	169	37	in	in	IN
10_1101-2020_11_24_390039	169	38	the	the	DT
10_1101-2020_11_24_390039	169	39	appropriate	appropriate	JJ
10_1101-2020_11_24_390039	169	40	figure	figure	NN
10_1101-2020_11_24_390039	169	41	legend	legend	NN
10_1101-2020_11_24_390039	169	42	)	)	-RRB-
10_1101-2020_11_24_390039	169	43	.	.	.
10_1101-2020_11_24_390039	170	1	Statistical	statistical	JJ
10_1101-2020_11_24_390039	170	2	significance	significance	NN
10_1101-2020_11_24_390039	170	3	is	be	VBZ
10_1101-2020_11_24_390039	170	4	given	give	VBN
10_1101-2020_11_24_390039	170	5	as	as	IN
10_1101-2020_11_24_390039	170	6	n.s	n.s	NNP
10_1101-2020_11_24_390039	170	7	.	.	NNP
10_1101-2020_11_24_390039	170	8	,	,	,
10_1101-2020_11_24_390039	170	9	non	non	JJ
10_1101-2020_11_24_390039	170	10	-	-	JJ
10_1101-2020_11_24_390039	170	11	significant	significant	JJ
10_1101-2020_11_24_390039	170	12	>	>	NN
10_1101-2020_11_24_390039	170	13	0.1	0.1	CD
10_1101-2020_11_24_390039	170	14	;	;	:
10_1101-2020_11_24_390039	170	15	*	*	NFP
10_1101-2020_11_24_390039	170	16	,	,	,
10_1101-2020_11_24_390039	170	17	P	p	NN
10_1101-2020_11_24_390039	170	18	<	<	XX
10_1101-2020_11_24_390039	170	19	0.05	0.05	XX
10_1101-2020_11_24_390039	170	20	;	;	:
10_1101-2020_11_24_390039	170	21	*	*	NFP
10_1101-2020_11_24_390039	170	22	*	*	NFP
10_1101-2020_11_24_390039	170	23	,	,	,
10_1101-2020_11_24_390039	170	24	P	p	NN
10_1101-2020_11_24_390039	170	25	<	<	XX
10_1101-2020_11_24_390039	170	26	0.01	0.01	XX
10_1101-2020_11_24_390039	170	27	;	;	:
10_1101-2020_11_24_390039	170	28	*	*	NFP
10_1101-2020_11_24_390039	170	29	*	*	NFP
10_1101-2020_11_24_390039	170	30	*	*	NFP
10_1101-2020_11_24_390039	170	31	,	,	,
10_1101-2020_11_24_390039	170	32	P	p	NN
10_1101-2020_11_24_390039	170	33	<	<	XX
10_1101-2020_11_24_390039	170	34	0.001	0.001	CD
10_1101-2020_11_24_390039	170	35	;	;	:
10_1101-2020_11_24_390039	170	36	*	*	NFP
10_1101-2020_11_24_390039	170	37	*	*	NFP
10_1101-2020_11_24_390039	170	38	*	*	NFP
10_1101-2020_11_24_390039	170	39	*	*	NFP
10_1101-2020_11_24_390039	170	40	,	,	,
10_1101-2020_11_24_390039	170	41	P	p	NN
10_1101-2020_11_24_390039	170	42	<	<	XX
10_1101-2020_11_24_390039	170	43	0.0001	0.0001	CD
10_1101-2020_11_24_390039	170	44	.	.	.
10_1101-2020_11_24_390039	171	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	171	2	-	-	:
10_1101-2020_11_24_390039	171	3	BY	by	IN
10_1101-2020_11_24_390039	171	4	-	-	HYPH
10_1101-2020_11_24_390039	171	5	ND	ND	NNP
10_1101-2020_11_24_390039	171	6	4.0	4.0	CD
10_1101-2020_11_24_390039	171	7	International	international	JJ
10_1101-2020_11_24_390039	171	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	171	9	available	available	JJ
10_1101-2020_11_24_390039	171	10	under	under	IN
10_1101-2020_11_24_390039	171	11	a	a	DT
10_1101-2020_11_24_390039	171	12	(	(	-LRB-
10_1101-2020_11_24_390039	171	13	which	which	WDT
10_1101-2020_11_24_390039	171	14	was	be	VBD
10_1101-2020_11_24_390039	171	15	not	not	RB
10_1101-2020_11_24_390039	171	16	certified	certify	VBN
10_1101-2020_11_24_390039	171	17	by	by	IN
10_1101-2020_11_24_390039	171	18	peer	peer	NN
10_1101-2020_11_24_390039	171	19	review	review	NN
10_1101-2020_11_24_390039	171	20	)	)	-RRB-
10_1101-2020_11_24_390039	171	21	is	be	VBZ
10_1101-2020_11_24_390039	171	22	the	the	DT
10_1101-2020_11_24_390039	171	23	author	author	NN
10_1101-2020_11_24_390039	171	24	/	/	SYM
10_1101-2020_11_24_390039	171	25	funder	funder	NN
10_1101-2020_11_24_390039	171	26	,	,	,
10_1101-2020_11_24_390039	171	27	who	who	WP
10_1101-2020_11_24_390039	171	28	has	have	VBZ
10_1101-2020_11_24_390039	171	29	granted	grant	VBN
10_1101-2020_11_24_390039	171	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	171	31	a	a	DT
10_1101-2020_11_24_390039	171	32	license	license	NN
10_1101-2020_11_24_390039	171	33	to	to	TO
10_1101-2020_11_24_390039	171	34	display	display	VB
10_1101-2020_11_24_390039	171	35	the	the	DT
10_1101-2020_11_24_390039	171	36	preprint	preprint	NN
10_1101-2020_11_24_390039	171	37	in	in	IN
10_1101-2020_11_24_390039	171	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	171	39	.	.	.
10_1101-2020_11_24_390039	172	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	172	2	is	be	VBZ
10_1101-2020_11_24_390039	172	3	The	the	DT
10_1101-2020_11_24_390039	172	4	copyright	copyright	NN
10_1101-2020_11_24_390039	172	5	holder	holder	NN
10_1101-2020_11_24_390039	172	6	for	for	IN
10_1101-2020_11_24_390039	172	7	this	this	DT
10_1101-2020_11_24_390039	172	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	172	9	version	version	NN
10_1101-2020_11_24_390039	172	10	posted	post	VBD
10_1101-2020_11_24_390039	172	11	January	January	NNP
10_1101-2020_11_24_390039	172	12	5	5	CD
10_1101-2020_11_24_390039	172	13	,	,	,
10_1101-2020_11_24_390039	172	14	2021	2021	CD
10_1101-2020_11_24_390039	172	15	.	.	.
10_1101-2020_11_24_390039	172	16	;	;	:
10_1101-2020_11_24_390039	172	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	172	18	:	:	:
10_1101-2020_11_24_390039	172	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	172	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	172	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	172	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	172	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	172	24	-	-	HYPH
10_1101-2020_11_24_390039	172	25	F	F	NNP
10_1101-2020_11_24_390039	172	26	as	as	IN
10_1101-2020_11_24_390039	172	27	a	a	DT
10_1101-2020_11_24_390039	172	28	potential	potential	JJ
10_1101-2020_11_24_390039	172	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	172	30	agent	agent	NN
10_1101-2020_11_24_390039	172	31	Page	Page	NNP
10_1101-2020_11_24_390039	172	32	14	14	CD
10_1101-2020_11_24_390039	172	33	of	of	IN
10_1101-2020_11_24_390039	172	34	21	21	CD
10_1101-2020_11_24_390039	172	35	Acknowledgements	Acknowledgements	NNPS
10_1101-2020_11_24_390039	172	36	We	-PRON-	PRP
10_1101-2020_11_24_390039	172	37	thank	thank	VBP
10_1101-2020_11_24_390039	172	38	Quentin	Quentin	NNP
10_1101-2020_11_24_390039	172	39	Roebuck	Roebuck	NNP
10_1101-2020_11_24_390039	172	40	for	for	IN
10_1101-2020_11_24_390039	172	41	technical	technical	JJ
10_1101-2020_11_24_390039	172	42	assistance	assistance	NN
10_1101-2020_11_24_390039	172	43	,	,	,
10_1101-2020_11_24_390039	172	44	Nevan	Nevan	NNP
10_1101-2020_11_24_390039	172	45	Krogan	Krogan	NNP
10_1101-2020_11_24_390039	172	46	(	(	-LRB-
10_1101-2020_11_24_390039	172	47	UCSF	UCSF	NNP
10_1101-2020_11_24_390039	172	48	)	)	-RRB-
10_1101-2020_11_24_390039	172	49	for	for	IN
10_1101-2020_11_24_390039	172	50	SARS	SARS	NNP
10_1101-2020_11_24_390039	172	51	-	-	HYPH
10_1101-2020_11_24_390039	172	52	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	172	53	plasmids	plasmid	NNS
10_1101-2020_11_24_390039	172	54	,	,	,
10_1101-2020_11_24_390039	172	55	Sven	Sven	NNP
10_1101-2020_11_24_390039	172	56	Lang	Lang	NNP
10_1101-2020_11_24_390039	172	57	(	(	-LRB-
10_1101-2020_11_24_390039	172	58	University	University	NNP
10_1101-2020_11_24_390039	172	59	of	of	IN
10_1101-2020_11_24_390039	172	60	Saarland	Saarland	NNP
10_1101-2020_11_24_390039	172	61	)	)	-RRB-
10_1101-2020_11_24_390039	172	62	for	for	IN
10_1101-2020_11_24_390039	172	63	Sec61α	Sec61α	NNP
10_1101-2020_11_24_390039	172	64	antisera	antisera	NNP
10_1101-2020_11_24_390039	172	65	,	,	,
10_1101-2020_11_24_390039	172	66	Belinda	Belinda	NNP
10_1101-2020_11_24_390039	172	67	Hall	Hall	NNP
10_1101-2020_11_24_390039	172	68	and	and	CC
10_1101-2020_11_24_390039	172	69	Rachel	Rachel	NNP
10_1101-2020_11_24_390039	172	70	Simmonds	Simmonds	NNP
10_1101-2020_11_24_390039	172	71	(	(	-LRB-
10_1101-2020_11_24_390039	172	72	University	University	NNP
10_1101-2020_11_24_390039	172	73	of	of	IN
10_1101-2020_11_24_390039	172	74	Surrey	Surrey	NNP
10_1101-2020_11_24_390039	172	75	)	)	-RRB-
10_1101-2020_11_24_390039	172	76	for	for	IN
10_1101-2020_11_24_390039	172	77	useful	useful	JJ
10_1101-2020_11_24_390039	172	78	discussions	discussion	NNS
10_1101-2020_11_24_390039	172	79	.	.	.
10_1101-2020_11_24_390039	173	1	We	-PRON-	PRP
10_1101-2020_11_24_390039	173	2	are	be	VBP
10_1101-2020_11_24_390039	173	3	indebted	indebted	JJ
10_1101-2020_11_24_390039	173	4	to	to	IN
10_1101-2020_11_24_390039	173	5	Richard	Richard	NNP
10_1101-2020_11_24_390039	173	6	Zimmermann	Zimmermann	NNP
10_1101-2020_11_24_390039	173	7	(	(	-LRB-
10_1101-2020_11_24_390039	173	8	University	University	NNP
10_1101-2020_11_24_390039	173	9	of	of	IN
10_1101-2020_11_24_390039	173	10	Saarland	Saarland	NNP
10_1101-2020_11_24_390039	173	11	)	)	-RRB-
10_1101-2020_11_24_390039	173	12	for	for	IN
10_1101-2020_11_24_390039	173	13	catalyzing	catalyze	VBG
10_1101-2020_11_24_390039	173	14	SARS	SARS	NNP
10_1101-2020_11_24_390039	173	15	-	-	HYPH
10_1101-2020_11_24_390039	173	16	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	173	17	related	related	JJ
10_1101-2020_11_24_390039	173	18	discussions	discussion	NNS
10_1101-2020_11_24_390039	173	19	amongst	amongst	IN
10_1101-2020_11_24_390039	173	20	the	the	DT
10_1101-2020_11_24_390039	173	21	ER	ER	NNP
10_1101-2020_11_24_390039	173	22	research	research	NN
10_1101-2020_11_24_390039	173	23	community	community	NN
10_1101-2020_11_24_390039	173	24	.	.	.
10_1101-2020_11_24_390039	174	1	Competing	compete	VBG
10_1101-2020_11_24_390039	174	2	interests	interest	NNS
10_1101-2020_11_24_390039	174	3	The	the	DT
10_1101-2020_11_24_390039	174	4	authors	author	NNS
10_1101-2020_11_24_390039	174	5	declare	declare	VBP
10_1101-2020_11_24_390039	174	6	no	no	DT
10_1101-2020_11_24_390039	174	7	competing	compete	VBG
10_1101-2020_11_24_390039	174	8	interests	interest	NNS
10_1101-2020_11_24_390039	174	9	.	.	.
10_1101-2020_11_24_390039	175	1	Author	author	NN
10_1101-2020_11_24_390039	175	2	Contributions	Contributions	NNP
10_1101-2020_11_24_390039	175	3	K.B.D.	K.B.D.	NNP
10_1101-2020_11_24_390039	175	4	,	,	,
10_1101-2020_11_24_390039	175	5	G.Z.	G.Z.	NNP
10_1101-2020_11_24_390039	176	1	and	and	CC
10_1101-2020_11_24_390039	176	2	H.S.	H.S.	NNP
10_1101-2020_11_24_390039	177	1	participated	participate	VBN
10_1101-2020_11_24_390039	177	2	in	in	IN
10_1101-2020_11_24_390039	177	3	synthesis	synthesis	NN
10_1101-2020_11_24_390039	177	4	of	of	IN
10_1101-2020_11_24_390039	177	5	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	177	6	-	-	HYPH
10_1101-2020_11_24_390039	177	7	F	F	NNP
10_1101-2020_11_24_390039	177	8	and	and	CC
10_1101-2020_11_24_390039	177	9	W.Q.S	W.Q.S	NNP
10_1101-2020_11_24_390039	177	10	supervised	supervise	VBD
10_1101-2020_11_24_390039	177	11	the	the	DT
10_1101-2020_11_24_390039	177	12	synthesis	synthesis	NN
10_1101-2020_11_24_390039	177	13	;	;	:
10_1101-2020_11_24_390039	177	14	P.R.	P.R.	NNP
10_1101-2020_11_24_390039	178	1	generated	generate	VBN
10_1101-2020_11_24_390039	178	2	SARS	SARS	NNP
10_1101-2020_11_24_390039	178	3	-	-	HYPH
10_1101-2020_11_24_390039	178	4	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	178	5	plasmids	plasmid	NNS
10_1101-2020_11_24_390039	178	6	;	;	:
10_1101-2020_11_24_390039	178	7	S.O’K.	s.o’k.	ADD
10_1101-2020_11_24_390039	179	1	performed	perform	VBN
10_1101-2020_11_24_390039	179	2	site-	site-	NNP
10_1101-2020_11_24_390039	179	3	directed	direct	VBD
10_1101-2020_11_24_390039	179	4	mutagenesis	mutagenesis	NN
10_1101-2020_11_24_390039	179	5	and	and	CC
10_1101-2020_11_24_390039	179	6	experiments	experiment	NNS
10_1101-2020_11_24_390039	179	7	;	;	:
10_1101-2020_11_24_390039	179	8	S.O’K.	s.o’k.	ADD
10_1101-2020_11_24_390039	180	1	and	and	CC
10_1101-2020_11_24_390039	180	2	S.H.	S.H.	NNP
10_1101-2020_11_24_390039	181	1	designed	design	VBN
10_1101-2020_11_24_390039	181	2	the	the	DT
10_1101-2020_11_24_390039	181	3	study	study	NN
10_1101-2020_11_24_390039	181	4	,	,	,
10_1101-2020_11_24_390039	181	5	analysed	analyse	VBD
10_1101-2020_11_24_390039	181	6	the	the	DT
10_1101-2020_11_24_390039	181	7	data	datum	NNS
10_1101-2020_11_24_390039	181	8	and	and	CC
10_1101-2020_11_24_390039	181	9	wrote	write	VBD
10_1101-2020_11_24_390039	181	10	the	the	DT
10_1101-2020_11_24_390039	181	11	manuscript	manuscript	NN
10_1101-2020_11_24_390039	181	12	.	.	.
10_1101-2020_11_24_390039	182	1	Funding	fund	VBG
10_1101-2020_11_24_390039	182	2	This	this	DT
10_1101-2020_11_24_390039	182	3	work	work	NN
10_1101-2020_11_24_390039	182	4	was	be	VBD
10_1101-2020_11_24_390039	182	5	supported	support	VBN
10_1101-2020_11_24_390039	182	6	by	by	IN
10_1101-2020_11_24_390039	182	7	a	a	DT
10_1101-2020_11_24_390039	182	8	Wellcome	Wellcome	NNP
10_1101-2020_11_24_390039	182	9	Trust	Trust	NNP
10_1101-2020_11_24_390039	182	10	Investigator	Investigator	NNP
10_1101-2020_11_24_390039	182	11	Award	Award	NNP
10_1101-2020_11_24_390039	182	12	in	in	IN
10_1101-2020_11_24_390039	182	13	Science	Science	NNP
10_1101-2020_11_24_390039	182	14	204957	204957	CD
10_1101-2020_11_24_390039	182	15	/	/	SYM
10_1101-2020_11_24_390039	182	16	Z/16	Z/16	NNP
10_1101-2020_11_24_390039	182	17	/	/	SYM
10_1101-2020_11_24_390039	182	18	Z	Z	NNP
10_1101-2020_11_24_390039	182	19	(	(	-LRB-
10_1101-2020_11_24_390039	182	20	S.H.	S.H.	NNP
10_1101-2020_11_24_390039	183	1	)	)	-RRB-
10_1101-2020_11_24_390039	183	2	,	,	,
10_1101-2020_11_24_390039	183	3	an	an	DT
10_1101-2020_11_24_390039	183	4	AREA	area	NN
10_1101-2020_11_24_390039	183	5	grant	grant	NN
10_1101-2020_11_24_390039	183	6	2R15GM116032	2r15gm116032	CD
10_1101-2020_11_24_390039	183	7	-	-	:
10_1101-2020_11_24_390039	183	8	02A1	02a1	CD
10_1101-2020_11_24_390039	183	9	from	from	IN
10_1101-2020_11_24_390039	183	10	the	the	DT
10_1101-2020_11_24_390039	183	11	National	National	NNP
10_1101-2020_11_24_390039	183	12	Institute	Institute	NNP
10_1101-2020_11_24_390039	183	13	of	of	IN
10_1101-2020_11_24_390039	183	14	General	General	NNP
10_1101-2020_11_24_390039	183	15	Medical	Medical	NNP
10_1101-2020_11_24_390039	183	16	Sciences	Sciences	NNPS
10_1101-2020_11_24_390039	183	17	of	of	IN
10_1101-2020_11_24_390039	183	18	the	the	DT
10_1101-2020_11_24_390039	183	19	National	National	NNP
10_1101-2020_11_24_390039	183	20	Institutes	Institutes	NNPS
10_1101-2020_11_24_390039	183	21	of	of	IN
10_1101-2020_11_24_390039	183	22	Health	Health	NNP
10_1101-2020_11_24_390039	183	23	(	(	-LRB-
10_1101-2020_11_24_390039	183	24	NIH	NIH	NNP
10_1101-2020_11_24_390039	183	25	)	)	-RRB-
10_1101-2020_11_24_390039	183	26	and	and	CC
10_1101-2020_11_24_390039	183	27	a	a	DT
10_1101-2020_11_24_390039	183	28	Ball	Ball	NNP
10_1101-2020_11_24_390039	183	29	State	State	NNP
10_1101-2020_11_24_390039	183	30	University	University	NNP
10_1101-2020_11_24_390039	183	31	(	(	-LRB-
10_1101-2020_11_24_390039	183	32	BSU	BSU	NNP
10_1101-2020_11_24_390039	183	33	)	)	-RRB-
10_1101-2020_11_24_390039	183	34	Provost	Provost	NNP
10_1101-2020_11_24_390039	183	35	Startup	Startup	NNP
10_1101-2020_11_24_390039	183	36	Award	Award	NNP
10_1101-2020_11_24_390039	183	37	(	(	-LRB-
10_1101-2020_11_24_390039	183	38	W.Q.S.	W.Q.S.	NNP
10_1101-2020_11_24_390039	183	39	)	)	-RRB-
10_1101-2020_11_24_390039	183	40	.	.	.
10_1101-2020_11_24_390039	184	1	Supplementary	supplementary	JJ
10_1101-2020_11_24_390039	184	2	Information	Information	NNP
10_1101-2020_11_24_390039	184	3	Supplementary	Supplementary	NNP
10_1101-2020_11_24_390039	184	4	information	information	NN
10_1101-2020_11_24_390039	184	5	Fig	Fig	NNP
10_1101-2020_11_24_390039	184	6	.	.	.
10_1101-2020_11_24_390039	185	1	S1	S1	NNP
10_1101-2020_11_24_390039	185	2	and	and	CC
10_1101-2020_11_24_390039	185	3	Fig	Fig	NNP
10_1101-2020_11_24_390039	185	4	.	.	.
10_1101-2020_11_24_390039	186	1	S2	s2	NN
10_1101-2020_11_24_390039	186	2	accompanies	accompany	VBZ
10_1101-2020_11_24_390039	186	3	this	this	DT
10_1101-2020_11_24_390039	186	4	report	report	NN
10_1101-2020_11_24_390039	186	5	.	.	.
10_1101-2020_11_24_390039	187	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	187	2	-	-	:
10_1101-2020_11_24_390039	187	3	BY	by	IN
10_1101-2020_11_24_390039	187	4	-	-	HYPH
10_1101-2020_11_24_390039	187	5	ND	ND	NNP
10_1101-2020_11_24_390039	187	6	4.0	4.0	CD
10_1101-2020_11_24_390039	187	7	International	international	JJ
10_1101-2020_11_24_390039	187	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	187	9	available	available	JJ
10_1101-2020_11_24_390039	187	10	under	under	IN
10_1101-2020_11_24_390039	187	11	a	a	DT
10_1101-2020_11_24_390039	187	12	(	(	-LRB-
10_1101-2020_11_24_390039	187	13	which	which	WDT
10_1101-2020_11_24_390039	187	14	was	be	VBD
10_1101-2020_11_24_390039	187	15	not	not	RB
10_1101-2020_11_24_390039	187	16	certified	certify	VBN
10_1101-2020_11_24_390039	187	17	by	by	IN
10_1101-2020_11_24_390039	187	18	peer	peer	NN
10_1101-2020_11_24_390039	187	19	review	review	NN
10_1101-2020_11_24_390039	187	20	)	)	-RRB-
10_1101-2020_11_24_390039	187	21	is	be	VBZ
10_1101-2020_11_24_390039	187	22	the	the	DT
10_1101-2020_11_24_390039	187	23	author	author	NN
10_1101-2020_11_24_390039	187	24	/	/	SYM
10_1101-2020_11_24_390039	187	25	funder	funder	NN
10_1101-2020_11_24_390039	187	26	,	,	,
10_1101-2020_11_24_390039	187	27	who	who	WP
10_1101-2020_11_24_390039	187	28	has	have	VBZ
10_1101-2020_11_24_390039	187	29	granted	grant	VBN
10_1101-2020_11_24_390039	187	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	187	31	a	a	DT
10_1101-2020_11_24_390039	187	32	license	license	NN
10_1101-2020_11_24_390039	187	33	to	to	TO
10_1101-2020_11_24_390039	187	34	display	display	VB
10_1101-2020_11_24_390039	187	35	the	the	DT
10_1101-2020_11_24_390039	187	36	preprint	preprint	NN
10_1101-2020_11_24_390039	187	37	in	in	IN
10_1101-2020_11_24_390039	187	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	187	39	.	.	.
10_1101-2020_11_24_390039	188	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	188	2	is	be	VBZ
10_1101-2020_11_24_390039	188	3	The	the	DT
10_1101-2020_11_24_390039	188	4	copyright	copyright	NN
10_1101-2020_11_24_390039	188	5	holder	holder	NN
10_1101-2020_11_24_390039	188	6	for	for	IN
10_1101-2020_11_24_390039	188	7	this	this	DT
10_1101-2020_11_24_390039	188	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	188	9	version	version	NN
10_1101-2020_11_24_390039	188	10	posted	post	VBD
10_1101-2020_11_24_390039	188	11	January	January	NNP
10_1101-2020_11_24_390039	188	12	5	5	CD
10_1101-2020_11_24_390039	188	13	,	,	,
10_1101-2020_11_24_390039	188	14	2021	2021	CD
10_1101-2020_11_24_390039	188	15	.	.	.
10_1101-2020_11_24_390039	188	16	;	;	:
10_1101-2020_11_24_390039	188	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	188	18	:	:	:
10_1101-2020_11_24_390039	188	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	188	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	188	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	188	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	188	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	188	24	-	-	HYPH
10_1101-2020_11_24_390039	188	25	F	F	NNP
10_1101-2020_11_24_390039	188	26	as	as	IN
10_1101-2020_11_24_390039	188	27	a	a	DT
10_1101-2020_11_24_390039	188	28	potential	potential	JJ
10_1101-2020_11_24_390039	188	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	188	30	agent	agent	NN
10_1101-2020_11_24_390039	188	31	Page	Page	NNP
10_1101-2020_11_24_390039	188	32	15	15	CD
10_1101-2020_11_24_390039	188	33	of	of	IN
10_1101-2020_11_24_390039	188	34	21	21	CD
10_1101-2020_11_24_390039	188	35	References	References	NNPS
10_1101-2020_11_24_390039	188	36	Adalja	Adalja	NNP
10_1101-2020_11_24_390039	188	37	,	,	,
10_1101-2020_11_24_390039	188	38	A.	a.	NN
10_1101-2020_11_24_390039	188	39	,	,	,
10_1101-2020_11_24_390039	188	40	and	and	CC
10_1101-2020_11_24_390039	188	41	Inglesby	Inglesby	NNP
10_1101-2020_11_24_390039	188	42	,	,	,
10_1101-2020_11_24_390039	188	43	T.	t.	NN
10_1101-2020_11_24_390039	188	44	(	(	-LRB-
10_1101-2020_11_24_390039	188	45	2019	2019	CD
10_1101-2020_11_24_390039	188	46	)	)	-RRB-
10_1101-2020_11_24_390039	188	47	.	.	.
10_1101-2020_11_24_390039	189	1	Broad	broad	JJ
10_1101-2020_11_24_390039	189	2	-	-	HYPH
10_1101-2020_11_24_390039	189	3	spectrum	spectrum	NN
10_1101-2020_11_24_390039	189	4	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	189	5	agents	agent	NNS
10_1101-2020_11_24_390039	189	6	:	:	:
10_1101-2020_11_24_390039	189	7	A	a	DT
10_1101-2020_11_24_390039	189	8	crucial	crucial	JJ
10_1101-2020_11_24_390039	189	9	pandemic	pandemic	JJ
10_1101-2020_11_24_390039	189	10	tool	tool	NN
10_1101-2020_11_24_390039	189	11	.	.	.
10_1101-2020_11_24_390039	190	1	Exp	Exp	NNP
10_1101-2020_11_24_390039	190	2	.	.	.
10_1101-2020_11_24_390039	191	1	Rev.	Rev.	NNP
10_1101-2020_11_24_390039	192	1	Anti	Anti	NNP
10_1101-2020_11_24_390039	192	2	-	-	NNP
10_1101-2020_11_24_390039	192	3	Infect	Infect	NNP
10_1101-2020_11_24_390039	192	4	.	.	.
10_1101-2020_11_24_390039	193	1	Ther	ther	RB
10_1101-2020_11_24_390039	193	2	.	.	.
10_1101-2020_11_24_390039	194	1	17	17	CD
10_1101-2020_11_24_390039	194	2	,	,	,
10_1101-2020_11_24_390039	194	3	467	467	CD
10_1101-2020_11_24_390039	194	4	-	-	SYM
10_1101-2020_11_24_390039	194	5	470	470	CD
10_1101-2020_11_24_390039	194	6	.	.	.
10_1101-2020_11_24_390039	195	1	Bojkova	Bojkova	NNP
10_1101-2020_11_24_390039	195	2	,	,	,
10_1101-2020_11_24_390039	195	3	D.	D.	NNP
10_1101-2020_11_24_390039	195	4	,	,	,
10_1101-2020_11_24_390039	195	5	Klann	Klann	NNP
10_1101-2020_11_24_390039	195	6	,	,	,
10_1101-2020_11_24_390039	195	7	K.	K.	NNP
10_1101-2020_11_24_390039	195	8	,	,	,
10_1101-2020_11_24_390039	195	9	Koch	Koch	NNP
10_1101-2020_11_24_390039	195	10	,	,	,
10_1101-2020_11_24_390039	195	11	B.	B.	NNP
10_1101-2020_11_24_390039	195	12	,	,	,
10_1101-2020_11_24_390039	195	13	Widera	Widera	NNP
10_1101-2020_11_24_390039	195	14	,	,	,
10_1101-2020_11_24_390039	195	15	M.	M.	NNP
10_1101-2020_11_24_390039	195	16	,	,	,
10_1101-2020_11_24_390039	195	17	Krause	Krause	NNP
10_1101-2020_11_24_390039	195	18	,	,	,
10_1101-2020_11_24_390039	195	19	D.	D.	NNP
10_1101-2020_11_24_390039	195	20	,	,	,
10_1101-2020_11_24_390039	195	21	Ciesek	Ciesek	NNP
10_1101-2020_11_24_390039	195	22	,	,	,
10_1101-2020_11_24_390039	195	23	S.	S.	NNP
10_1101-2020_11_24_390039	195	24	,	,	,
10_1101-2020_11_24_390039	195	25	Cinatl	Cinatl	NNP
10_1101-2020_11_24_390039	195	26	,	,	,
10_1101-2020_11_24_390039	195	27	J.	J.	NNP
10_1101-2020_11_24_390039	195	28	,	,	,
10_1101-2020_11_24_390039	195	29	and	and	CC
10_1101-2020_11_24_390039	195	30	Münch	Münch	NNP
10_1101-2020_11_24_390039	195	31	,	,	,
10_1101-2020_11_24_390039	195	32	C.	C.	NNP
10_1101-2020_11_24_390039	195	33	(	(	-LRB-
10_1101-2020_11_24_390039	195	34	2020	2020	CD
10_1101-2020_11_24_390039	195	35	)	)	-RRB-
10_1101-2020_11_24_390039	195	36	.	.	.
10_1101-2020_11_24_390039	196	1	Proteomics	Proteomics	NNP
10_1101-2020_11_24_390039	196	2	of	of	IN
10_1101-2020_11_24_390039	196	3	SARS	SARS	NNP
10_1101-2020_11_24_390039	196	4	-	-	HYPH
10_1101-2020_11_24_390039	196	5	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	196	6	infected	infected	JJ
10_1101-2020_11_24_390039	196	7	host	host	NN
10_1101-2020_11_24_390039	196	8	cells	cell	NNS
10_1101-2020_11_24_390039	196	9	reveals	reveal	VBZ
10_1101-2020_11_24_390039	196	10	therapy	therapy	NN
10_1101-2020_11_24_390039	196	11	targets	target	NNS
10_1101-2020_11_24_390039	196	12	.	.	.
10_1101-2020_11_24_390039	197	1	Nature	nature	NN
10_1101-2020_11_24_390039	197	2	.	.	.
10_1101-2020_11_24_390039	198	1	583	583	CD
10_1101-2020_11_24_390039	198	2	,	,	,
10_1101-2020_11_24_390039	198	3	469	469	CD
10_1101-2020_11_24_390039	198	4	-	-	SYM
10_1101-2020_11_24_390039	198	5	472	472	CD
10_1101-2020_11_24_390039	198	6	.	.	.
10_1101-2020_11_24_390039	199	1	Cantuti	Cantuti	NNP
10_1101-2020_11_24_390039	199	2	-	-	HYPH
10_1101-2020_11_24_390039	199	3	Castelvetri	Castelvetri	NNP
10_1101-2020_11_24_390039	199	4	,	,	,
10_1101-2020_11_24_390039	199	5	L.	L.	NNP
10_1101-2020_11_24_390039	199	6	,	,	,
10_1101-2020_11_24_390039	199	7	Ojha	Ojha	NNP
10_1101-2020_11_24_390039	199	8	,	,	,
10_1101-2020_11_24_390039	199	9	R.	R.	NNP
10_1101-2020_11_24_390039	199	10	,	,	,
10_1101-2020_11_24_390039	199	11	Pedro	Pedro	NNP
10_1101-2020_11_24_390039	199	12	,	,	,
10_1101-2020_11_24_390039	199	13	L.	L.	NNP
10_1101-2020_11_24_390039	199	14	D.	D.	NNP
10_1101-2020_11_24_390039	199	15	,	,	,
10_1101-2020_11_24_390039	199	16	Djannatian	Djannatian	NNP
10_1101-2020_11_24_390039	199	17	,	,	,
10_1101-2020_11_24_390039	199	18	M.	M.	NNP
10_1101-2020_11_24_390039	199	19	,	,	,
10_1101-2020_11_24_390039	199	20	Franz	Franz	NNP
10_1101-2020_11_24_390039	199	21	,	,	,
10_1101-2020_11_24_390039	199	22	J.	J.	NNP
10_1101-2020_11_24_390039	199	23	,	,	,
10_1101-2020_11_24_390039	199	24	Kuivanen	Kuivanen	NNP
10_1101-2020_11_24_390039	199	25	,	,	,
10_1101-2020_11_24_390039	199	26	S.	S.	NNP
10_1101-2020_11_24_390039	199	27	,	,	,
10_1101-2020_11_24_390039	199	28	van	van	NNP
10_1101-2020_11_24_390039	199	29	der	der	NNP
10_1101-2020_11_24_390039	199	30	Meer	Meer	NNP
10_1101-2020_11_24_390039	199	31	,	,	,
10_1101-2020_11_24_390039	199	32	F.	F.	NNP
10_1101-2020_11_24_390039	199	33	,	,	,
10_1101-2020_11_24_390039	199	34	Kallio	Kallio	NNP
10_1101-2020_11_24_390039	199	35	,	,	,
10_1101-2020_11_24_390039	199	36	K.	K.	NNP
10_1101-2020_11_24_390039	199	37	,	,	,
10_1101-2020_11_24_390039	199	38	Kaya	Kaya	NNP
10_1101-2020_11_24_390039	199	39	,	,	,
10_1101-2020_11_24_390039	199	40	T.	T.	NNP
10_1101-2020_11_24_390039	199	41	,	,	,
10_1101-2020_11_24_390039	199	42	Anastasina	Anastasina	NNP
10_1101-2020_11_24_390039	199	43	,	,	,
10_1101-2020_11_24_390039	199	44	M.	M.	NNP
10_1101-2020_11_24_390039	199	45	,	,	,
10_1101-2020_11_24_390039	199	46	et	et	NNP
10_1101-2020_11_24_390039	199	47	al	al	NNP
10_1101-2020_11_24_390039	199	48	.	.	.
10_1101-2020_11_24_390039	200	1	(	(	-LRB-
10_1101-2020_11_24_390039	200	2	2020	2020	CD
10_1101-2020_11_24_390039	200	3	)	)	-RRB-
10_1101-2020_11_24_390039	200	4	.	.	.
10_1101-2020_11_24_390039	201	1	Neuropilin-1	Neuropilin-1	NNP
10_1101-2020_11_24_390039	201	2	facilitates	facilitate	VBZ
10_1101-2020_11_24_390039	201	3	SARS	SARS	NNP
10_1101-2020_11_24_390039	201	4	-	-	HYPH
10_1101-2020_11_24_390039	201	5	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	201	6	cell	cell	NN
10_1101-2020_11_24_390039	201	7	entry	entry	NN
10_1101-2020_11_24_390039	201	8	and	and	CC
10_1101-2020_11_24_390039	201	9	infectivity	infectivity	NN
10_1101-2020_11_24_390039	201	10	.	.	.
10_1101-2020_11_24_390039	202	1	Science	science	NN
10_1101-2020_11_24_390039	202	2	.	.	.
10_1101-2020_11_24_390039	203	1	370	370	CD
10_1101-2020_11_24_390039	203	2	,	,	,
10_1101-2020_11_24_390039	203	3	856	856	CD
10_1101-2020_11_24_390039	203	4	-	-	SYM
10_1101-2020_11_24_390039	203	5	860	860	CD
10_1101-2020_11_24_390039	203	6	.	.	.
10_1101-2020_11_24_390039	204	1	Chitwood	Chitwood	NNP
10_1101-2020_11_24_390039	204	2	,	,	,
10_1101-2020_11_24_390039	204	3	P.	P.	NNP
10_1101-2020_11_24_390039	204	4	J.	J.	NNP
10_1101-2020_11_24_390039	204	5	,	,	,
10_1101-2020_11_24_390039	204	6	Juszkiewicz	Juszkiewicz	NNP
10_1101-2020_11_24_390039	204	7	,	,	,
10_1101-2020_11_24_390039	204	8	S.	S.	NNP
10_1101-2020_11_24_390039	204	9	,	,	,
10_1101-2020_11_24_390039	204	10	Guna	Guna	NNP
10_1101-2020_11_24_390039	204	11	,	,	,
10_1101-2020_11_24_390039	204	12	A.	a.	NN
10_1101-2020_11_24_390039	204	13	,	,	,
10_1101-2020_11_24_390039	204	14	Shao	Shao	NNP
10_1101-2020_11_24_390039	204	15	,	,	,
10_1101-2020_11_24_390039	204	16	S.	S.	NNP
10_1101-2020_11_24_390039	204	17	,	,	,
10_1101-2020_11_24_390039	204	18	and	and	CC
10_1101-2020_11_24_390039	204	19	Hegde	Hegde	NNP
10_1101-2020_11_24_390039	204	20	,	,	,
10_1101-2020_11_24_390039	204	21	R.	R.	NNP
10_1101-2020_11_24_390039	204	22	S.	S.	NNP
10_1101-2020_11_24_390039	204	23	(	(	-LRB-
10_1101-2020_11_24_390039	204	24	2018	2018	CD
10_1101-2020_11_24_390039	204	25	)	)	-RRB-
10_1101-2020_11_24_390039	204	26	.	.	.
10_1101-2020_11_24_390039	205	1	EMC	EMC	NNP
10_1101-2020_11_24_390039	205	2	is	be	VBZ
10_1101-2020_11_24_390039	205	3	required	require	VBN
10_1101-2020_11_24_390039	205	4	to	to	TO
10_1101-2020_11_24_390039	205	5	initiate	initiate	VB
10_1101-2020_11_24_390039	205	6	accurate	accurate	JJ
10_1101-2020_11_24_390039	205	7	membrane	membrane	NN
10_1101-2020_11_24_390039	205	8	protein	protein	NN
10_1101-2020_11_24_390039	205	9	topogenesis	topogenesis	NN
10_1101-2020_11_24_390039	205	10	.	.	.
10_1101-2020_11_24_390039	206	1	Cell	cell	NN
10_1101-2020_11_24_390039	206	2	.	.	.
10_1101-2020_11_24_390039	207	1	175	175	CD
10_1101-2020_11_24_390039	207	2	,	,	,
10_1101-2020_11_24_390039	207	3	1-	1-	CD
10_1101-2020_11_24_390039	207	4	13	13	CD
10_1101-2020_11_24_390039	207	5	.	.	.
10_1101-2020_11_24_390039	208	1	Daly	Daly	NNP
10_1101-2020_11_24_390039	208	2	,	,	,
10_1101-2020_11_24_390039	208	3	J.	J.	NNP
10_1101-2020_11_24_390039	208	4	L.	L.	NNP
10_1101-2020_11_24_390039	208	5	,	,	,
10_1101-2020_11_24_390039	208	6	Simonetti	Simonetti	NNP
10_1101-2020_11_24_390039	208	7	,	,	,
10_1101-2020_11_24_390039	208	8	B.	B.	NNP
10_1101-2020_11_24_390039	208	9	,	,	,
10_1101-2020_11_24_390039	208	10	Klein	Klein	NNP
10_1101-2020_11_24_390039	208	11	,	,	,
10_1101-2020_11_24_390039	208	12	K.	K.	NNP
10_1101-2020_11_24_390039	208	13	,	,	,
10_1101-2020_11_24_390039	208	14	Chen	Chen	NNP
10_1101-2020_11_24_390039	208	15	,	,	,
10_1101-2020_11_24_390039	208	16	K.-E.	K.-E.	NNP
10_1101-2020_11_24_390039	208	17	,	,	,
10_1101-2020_11_24_390039	208	18	Kavanagh	Kavanagh	NNP
10_1101-2020_11_24_390039	208	19	Williamson	Williamson	NNP
10_1101-2020_11_24_390039	208	20	,	,	,
10_1101-2020_11_24_390039	208	21	M.	M.	NNP
10_1101-2020_11_24_390039	208	22	,	,	,
10_1101-2020_11_24_390039	208	23	Antón	Antón	NNP
10_1101-2020_11_24_390039	208	24	-	-	HYPH
10_1101-2020_11_24_390039	208	25	Plágaro	Plágaro	NNP
10_1101-2020_11_24_390039	208	26	,	,	,
10_1101-2020_11_24_390039	208	27	C.	C.	NNP
10_1101-2020_11_24_390039	208	28	,	,	,
10_1101-2020_11_24_390039	208	29	Shoemark	Shoemark	NNP
10_1101-2020_11_24_390039	208	30	,	,	,
10_1101-2020_11_24_390039	208	31	D.	D.	NNP
10_1101-2020_11_24_390039	208	32	K.	K.	NNP
10_1101-2020_11_24_390039	208	33	,	,	,
10_1101-2020_11_24_390039	208	34	Simón	Simón	NNP
10_1101-2020_11_24_390039	208	35	-	-	HYPH
10_1101-2020_11_24_390039	208	36	Gracia	Gracia	NNP
10_1101-2020_11_24_390039	208	37	,	,	,
10_1101-2020_11_24_390039	208	38	L.	L.	NNP
10_1101-2020_11_24_390039	208	39	,	,	,
10_1101-2020_11_24_390039	208	40	Bauer	Bauer	NNP
10_1101-2020_11_24_390039	208	41	,	,	,
10_1101-2020_11_24_390039	208	42	M.	M.	NNP
10_1101-2020_11_24_390039	208	43	et	et	NNP
10_1101-2020_11_24_390039	208	44	al	al	NNP
10_1101-2020_11_24_390039	208	45	.	.	.
10_1101-2020_11_24_390039	209	1	(	(	-LRB-
10_1101-2020_11_24_390039	209	2	2020	2020	CD
10_1101-2020_11_24_390039	209	3	)	)	-RRB-
10_1101-2020_11_24_390039	209	4	.	.	.
10_1101-2020_11_24_390039	210	1	Neuropilin-1	Neuropilin-1	NNP
10_1101-2020_11_24_390039	210	2	is	be	VBZ
10_1101-2020_11_24_390039	210	3	a	a	DT
10_1101-2020_11_24_390039	210	4	host	host	NN
10_1101-2020_11_24_390039	210	5	factor	factor	NN
10_1101-2020_11_24_390039	210	6	for	for	IN
10_1101-2020_11_24_390039	210	7	SARS	SARS	NNP
10_1101-2020_11_24_390039	210	8	-	-	HYPH
10_1101-2020_11_24_390039	210	9	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	210	10	infection	infection	NN
10_1101-2020_11_24_390039	210	11	.	.	.
10_1101-2020_11_24_390039	211	1	Science	science	NN
10_1101-2020_11_24_390039	211	2	.	.	.
10_1101-2020_11_24_390039	212	1	370	370	CD
10_1101-2020_11_24_390039	212	2	,	,	,
10_1101-2020_11_24_390039	212	3	861-	861-	CD
10_1101-2020_11_24_390039	212	4	865	865	CD
10_1101-2020_11_24_390039	212	5	.	.	.
10_1101-2020_11_24_390039	213	1	Drew	Drew	NNP
10_1101-2020_11_24_390039	213	2	,	,	,
10_1101-2020_11_24_390039	213	3	E.	E.	NNP
10_1101-2020_11_24_390039	213	4	D.	D.	NNP
10_1101-2020_11_24_390039	213	5	,	,	,
10_1101-2020_11_24_390039	213	6	and	and	CC
10_1101-2020_11_24_390039	213	7	Janes	Janes	NNP
10_1101-2020_11_24_390039	213	8	,	,	,
10_1101-2020_11_24_390039	213	9	R.	R.	NNP
10_1101-2020_11_24_390039	213	10	W.	W.	NNP
10_1101-2020_11_24_390039	213	11	(	(	-LRB-
10_1101-2020_11_24_390039	213	12	2020	2020	CD
10_1101-2020_11_24_390039	213	13	)	)	-RRB-
10_1101-2020_11_24_390039	213	14	.	.	.
10_1101-2020_11_24_390039	214	1	Identification	identification	NN
10_1101-2020_11_24_390039	214	2	of	of	IN
10_1101-2020_11_24_390039	214	3	a	a	DT
10_1101-2020_11_24_390039	214	4	druggable	druggable	JJ
10_1101-2020_11_24_390039	214	5	binding	bind	VBG
10_1101-2020_11_24_390039	214	6	pocket	pocket	NN
10_1101-2020_11_24_390039	214	7	in	in	IN
10_1101-2020_11_24_390039	214	8	the	the	DT
10_1101-2020_11_24_390039	214	9	spike	spike	JJ
10_1101-2020_11_24_390039	214	10	protein	protein	NN
10_1101-2020_11_24_390039	214	11	reveals	reveal	VBZ
10_1101-2020_11_24_390039	214	12	a	a	DT
10_1101-2020_11_24_390039	214	13	key	key	JJ
10_1101-2020_11_24_390039	214	14	site	site	NN
10_1101-2020_11_24_390039	214	15	for	for	IN
10_1101-2020_11_24_390039	214	16	existing	exist	VBG
10_1101-2020_11_24_390039	214	17	drugs	drug	NNS
10_1101-2020_11_24_390039	214	18	potentially	potentially	RB
10_1101-2020_11_24_390039	214	19	capable	capable	JJ
10_1101-2020_11_24_390039	214	20	of	of	IN
10_1101-2020_11_24_390039	214	21	combating	combat	VBG
10_1101-2020_11_24_390039	214	22	Covid-19	Covid-19	NNP
10_1101-2020_11_24_390039	214	23	infectivity	infectivity	NN
10_1101-2020_11_24_390039	214	24	.	.	.
10_1101-2020_11_24_390039	215	1	BMC	BMC	NNP
10_1101-2020_11_24_390039	215	2	Mol	Mol	NNP
10_1101-2020_11_24_390039	215	3	.	.	.
10_1101-2020_11_24_390039	216	1	Cell	Cell	NNP
10_1101-2020_11_24_390039	216	2	Biol	Biol	NNP
10_1101-2020_11_24_390039	216	3	.	.	.
10_1101-2020_11_24_390039	217	1	21	21	CD
10_1101-2020_11_24_390039	217	2	,	,	,
10_1101-2020_11_24_390039	217	3	49	49	CD
10_1101-2020_11_24_390039	217	4	.	.	.
10_1101-2020_11_24_390039	218	1	Duart	Duart	NNP
10_1101-2020_11_24_390039	218	2	,	,	,
10_1101-2020_11_24_390039	218	3	G.	G.	NNP
10_1101-2020_11_24_390039	218	4	,	,	,
10_1101-2020_11_24_390039	218	5	García	García	NNP
10_1101-2020_11_24_390039	218	6	-	-	HYPH
10_1101-2020_11_24_390039	218	7	Murria	Murria	NNP
10_1101-2020_11_24_390039	218	8	,	,	,
10_1101-2020_11_24_390039	218	9	M.	M.	NNP
10_1101-2020_11_24_390039	218	10	J.	J.	NNP
10_1101-2020_11_24_390039	218	11	,	,	,
10_1101-2020_11_24_390039	218	12	Grau	Grau	NNP
10_1101-2020_11_24_390039	218	13	,	,	,
10_1101-2020_11_24_390039	218	14	B.	B.	NNP
10_1101-2020_11_24_390039	218	15	,	,	,
10_1101-2020_11_24_390039	218	16	Acosta	Acosta	NNP
10_1101-2020_11_24_390039	218	17	-	-	HYPH
10_1101-2020_11_24_390039	218	18	Cáceres	Cáceres	NNP
10_1101-2020_11_24_390039	218	19	,	,	,
10_1101-2020_11_24_390039	218	20	J.	J.	NNP
10_1101-2020_11_24_390039	218	21	M.	M.	NNP
10_1101-2020_11_24_390039	218	22	,	,	,
10_1101-2020_11_24_390039	218	23	Martínez-	Martínez-	NNP
10_1101-2020_11_24_390039	218	24	Gil	Gil	NNP
10_1101-2020_11_24_390039	218	25	,	,	,
10_1101-2020_11_24_390039	218	26	L.	L.	NNP
10_1101-2020_11_24_390039	218	27	,	,	,
10_1101-2020_11_24_390039	218	28	and	and	CC
10_1101-2020_11_24_390039	218	29	Mingarro	Mingarro	NNP
10_1101-2020_11_24_390039	218	30	I.	I.	NNP
10_1101-2020_11_24_390039	219	1	(	(	-LRB-
10_1101-2020_11_24_390039	219	2	2020	2020	CD
10_1101-2020_11_24_390039	219	3	)	)	-RRB-
10_1101-2020_11_24_390039	219	4	SARS	SARS	NNP
10_1101-2020_11_24_390039	219	5	-	-	HYPH
10_1101-2020_11_24_390039	219	6	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	219	7	envelope	envelope	NNP
10_1101-2020_11_24_390039	219	8	protein	protein	NN
10_1101-2020_11_24_390039	219	9	topology	topology	NN
10_1101-2020_11_24_390039	219	10	in	in	IN
10_1101-2020_11_24_390039	219	11	eukaryotic	eukaryotic	JJ
10_1101-2020_11_24_390039	219	12	membranes	membrane	NNS
10_1101-2020_11_24_390039	219	13	.	.	.
10_1101-2020_11_24_390039	220	1	Open	open	JJ
10_1101-2020_11_24_390039	220	2	Biol	Biol	NNP
10_1101-2020_11_24_390039	220	3	.	.	.
10_1101-2020_11_24_390039	221	1	10	10	CD
10_1101-2020_11_24_390039	221	2	,	,	,
10_1101-2020_11_24_390039	221	3	200209	200209	CD
10_1101-2020_11_24_390039	221	4	.	.	.
10_1101-2020_11_24_390039	222	1	Firth	firth	NN
10_1101-2020_11_24_390039	222	2	,	,	,
10_1101-2020_11_24_390039	222	3	A.	a.	NN
10_1101-2020_11_24_390039	222	4	E.	E.	NNP
10_1101-2020_11_24_390039	222	5	(	(	-LRB-
10_1101-2020_11_24_390039	222	6	2020	2020	CD
10_1101-2020_11_24_390039	222	7	)	)	-RRB-
10_1101-2020_11_24_390039	222	8	.	.	.
10_1101-2020_11_24_390039	223	1	A	a	DT
10_1101-2020_11_24_390039	223	2	putative	putative	JJ
10_1101-2020_11_24_390039	223	3	new	new	JJ
10_1101-2020_11_24_390039	223	4	SARS	SARS	NNP
10_1101-2020_11_24_390039	223	5	-	-	HYPH
10_1101-2020_11_24_390039	223	6	CoV	CoV	NNP
10_1101-2020_11_24_390039	223	7	protein	protein	NN
10_1101-2020_11_24_390039	223	8	,	,	,
10_1101-2020_11_24_390039	223	9	3c	3c	CD
10_1101-2020_11_24_390039	223	10	,	,	,
10_1101-2020_11_24_390039	223	11	encoded	encode	VBD
10_1101-2020_11_24_390039	223	12	in	in	IN
10_1101-2020_11_24_390039	223	13	an	an	DT
10_1101-2020_11_24_390039	223	14	ORF	ORF	NNP
10_1101-2020_11_24_390039	223	15	overlapping	overlap	VBG
10_1101-2020_11_24_390039	223	16	ORF3a	orf3a	NN
10_1101-2020_11_24_390039	223	17	.	.	.
10_1101-2020_11_24_390039	224	1	J.	J.	NNP
10_1101-2020_11_24_390039	224	2	Gen.	Gen.	NNP
10_1101-2020_11_24_390039	224	3	Virol	Virol	NNP
10_1101-2020_11_24_390039	224	4	.	.	.
10_1101-2020_11_24_390039	225	1	101	101	CD
10_1101-2020_11_24_390039	225	2	,	,	,
10_1101-2020_11_24_390039	225	3	1085	1085	CD
10_1101-2020_11_24_390039	225	4	-	-	SYM
10_1101-2020_11_24_390039	225	5	1089	1089	CD
10_1101-2020_11_24_390039	225	6	.	.	.
10_1101-2020_11_24_390039	226	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	226	2	-	-	:
10_1101-2020_11_24_390039	226	3	BY	by	IN
10_1101-2020_11_24_390039	226	4	-	-	HYPH
10_1101-2020_11_24_390039	226	5	ND	ND	NNP
10_1101-2020_11_24_390039	226	6	4.0	4.0	CD
10_1101-2020_11_24_390039	226	7	International	international	JJ
10_1101-2020_11_24_390039	226	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	226	9	available	available	JJ
10_1101-2020_11_24_390039	226	10	under	under	IN
10_1101-2020_11_24_390039	226	11	a	a	DT
10_1101-2020_11_24_390039	226	12	(	(	-LRB-
10_1101-2020_11_24_390039	226	13	which	which	WDT
10_1101-2020_11_24_390039	226	14	was	be	VBD
10_1101-2020_11_24_390039	226	15	not	not	RB
10_1101-2020_11_24_390039	226	16	certified	certify	VBN
10_1101-2020_11_24_390039	226	17	by	by	IN
10_1101-2020_11_24_390039	226	18	peer	peer	NN
10_1101-2020_11_24_390039	226	19	review	review	NN
10_1101-2020_11_24_390039	226	20	)	)	-RRB-
10_1101-2020_11_24_390039	226	21	is	be	VBZ
10_1101-2020_11_24_390039	226	22	the	the	DT
10_1101-2020_11_24_390039	226	23	author	author	NN
10_1101-2020_11_24_390039	226	24	/	/	SYM
10_1101-2020_11_24_390039	226	25	funder	funder	NN
10_1101-2020_11_24_390039	226	26	,	,	,
10_1101-2020_11_24_390039	226	27	who	who	WP
10_1101-2020_11_24_390039	226	28	has	have	VBZ
10_1101-2020_11_24_390039	226	29	granted	grant	VBN
10_1101-2020_11_24_390039	226	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	226	31	a	a	DT
10_1101-2020_11_24_390039	226	32	license	license	NN
10_1101-2020_11_24_390039	226	33	to	to	TO
10_1101-2020_11_24_390039	226	34	display	display	VB
10_1101-2020_11_24_390039	226	35	the	the	DT
10_1101-2020_11_24_390039	226	36	preprint	preprint	NN
10_1101-2020_11_24_390039	226	37	in	in	IN
10_1101-2020_11_24_390039	226	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	226	39	.	.	.
10_1101-2020_11_24_390039	227	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	227	2	is	be	VBZ
10_1101-2020_11_24_390039	227	3	The	the	DT
10_1101-2020_11_24_390039	227	4	copyright	copyright	NN
10_1101-2020_11_24_390039	227	5	holder	holder	NN
10_1101-2020_11_24_390039	227	6	for	for	IN
10_1101-2020_11_24_390039	227	7	this	this	DT
10_1101-2020_11_24_390039	227	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	227	9	version	version	NN
10_1101-2020_11_24_390039	227	10	posted	post	VBD
10_1101-2020_11_24_390039	227	11	January	January	NNP
10_1101-2020_11_24_390039	227	12	5	5	CD
10_1101-2020_11_24_390039	227	13	,	,	,
10_1101-2020_11_24_390039	227	14	2021	2021	CD
10_1101-2020_11_24_390039	227	15	.	.	.
10_1101-2020_11_24_390039	227	16	;	;	:
10_1101-2020_11_24_390039	227	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	227	18	:	:	:
10_1101-2020_11_24_390039	227	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	227	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	227	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	227	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	227	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	227	24	-	-	HYPH
10_1101-2020_11_24_390039	227	25	F	F	NNP
10_1101-2020_11_24_390039	227	26	as	as	IN
10_1101-2020_11_24_390039	227	27	a	a	DT
10_1101-2020_11_24_390039	227	28	potential	potential	JJ
10_1101-2020_11_24_390039	227	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	227	30	agent	agent	NN
10_1101-2020_11_24_390039	227	31	Page	Page	NNP
10_1101-2020_11_24_390039	227	32	16	16	CD
10_1101-2020_11_24_390039	227	33	of	of	IN
10_1101-2020_11_24_390039	227	34	21	21	CD
10_1101-2020_11_24_390039	227	35	Gérard	Gérard	NNP
10_1101-2020_11_24_390039	227	36	,	,	,
10_1101-2020_11_24_390039	227	37	S.	S.	NNP
10_1101-2020_11_24_390039	227	38	F.	F.	NNP
10_1101-2020_11_24_390039	227	39	,	,	,
10_1101-2020_11_24_390039	227	40	Hall	Hall	NNP
10_1101-2020_11_24_390039	227	41	,	,	,
10_1101-2020_11_24_390039	227	42	B.	B.	NNP
10_1101-2020_11_24_390039	227	43	S.	S.	NNP
10_1101-2020_11_24_390039	227	44	,	,	,
10_1101-2020_11_24_390039	227	45	Zaki	Zaki	NNP
10_1101-2020_11_24_390039	227	46	,	,	,
10_1101-2020_11_24_390039	227	47	A.	a.	NN
10_1101-2020_11_24_390039	227	48	M.	M.	NNP
10_1101-2020_11_24_390039	227	49	,	,	,
10_1101-2020_11_24_390039	227	50	Corfield	Corfield	NNP
10_1101-2020_11_24_390039	227	51	,	,	,
10_1101-2020_11_24_390039	227	52	K.	K.	NNP
10_1101-2020_11_24_390039	227	53	A.	A.	NNP
10_1101-2020_11_24_390039	227	54	,	,	,
10_1101-2020_11_24_390039	227	55	Mayerhofer	Mayerhofer	NNP
10_1101-2020_11_24_390039	227	56	,	,	,
10_1101-2020_11_24_390039	227	57	P.	P.	NNP
10_1101-2020_11_24_390039	227	58	U.	U.	NNP
10_1101-2020_11_24_390039	227	59	,	,	,
10_1101-2020_11_24_390039	227	60	Costa	Costa	NNP
10_1101-2020_11_24_390039	227	61	,	,	,
10_1101-2020_11_24_390039	227	62	C.	C.	NNP
10_1101-2020_11_24_390039	227	63	,	,	,
10_1101-2020_11_24_390039	227	64	Whelligan	Whelligan	NNP
10_1101-2020_11_24_390039	227	65	,	,	,
10_1101-2020_11_24_390039	227	66	D.	D.	NNP
10_1101-2020_11_24_390039	227	67	K.	K.	NNP
10_1101-2020_11_24_390039	227	68	,	,	,
10_1101-2020_11_24_390039	227	69	Biggin	Biggin	NNP
10_1101-2020_11_24_390039	227	70	P.	P.	NNP
10_1101-2020_11_24_390039	227	71	C.	C.	NNP
10_1101-2020_11_24_390039	227	72	,	,	,
10_1101-2020_11_24_390039	227	73	Simmonds	Simmonds	NNP
10_1101-2020_11_24_390039	227	74	,	,	,
10_1101-2020_11_24_390039	227	75	R.	R.	NNP
10_1101-2020_11_24_390039	227	76	E.	E.	NNP
10_1101-2020_11_24_390039	227	77	,	,	,
10_1101-2020_11_24_390039	227	78	and	and	CC
10_1101-2020_11_24_390039	227	79	Higgins	Higgins	NNP
10_1101-2020_11_24_390039	227	80	,	,	,
10_1101-2020_11_24_390039	227	81	M.	M.	NNP
10_1101-2020_11_24_390039	227	82	K.	K.	NNP
10_1101-2020_11_24_390039	227	83	(	(	-LRB-
10_1101-2020_11_24_390039	227	84	2020	2020	CD
10_1101-2020_11_24_390039	227	85	)	)	-RRB-
10_1101-2020_11_24_390039	227	86	.	.	.
10_1101-2020_11_24_390039	228	1	Structure	structure	NN
10_1101-2020_11_24_390039	228	2	of	of	IN
10_1101-2020_11_24_390039	228	3	the	the	DT
10_1101-2020_11_24_390039	228	4	inhibited	inhibited	JJ
10_1101-2020_11_24_390039	228	5	state	state	NN
10_1101-2020_11_24_390039	228	6	of	of	IN
10_1101-2020_11_24_390039	228	7	the	the	DT
10_1101-2020_11_24_390039	228	8	Sec	Sec	NNP
10_1101-2020_11_24_390039	228	9	translocon	translocon	NN
10_1101-2020_11_24_390039	228	10	.	.	.
10_1101-2020_11_24_390039	229	1	Mol	Mol	NNP
10_1101-2020_11_24_390039	229	2	.	.	.
10_1101-2020_11_24_390039	230	1	Cell	cell	NN
10_1101-2020_11_24_390039	230	2	.	.	.
10_1101-2020_11_24_390039	231	1	79	79	CD
10_1101-2020_11_24_390039	231	2	,	,	,
10_1101-2020_11_24_390039	231	3	406-	406-	CD
10_1101-2020_11_24_390039	231	4	415.e7	415.e7	CD
10_1101-2020_11_24_390039	231	5	.	.	.
10_1101-2020_11_24_390039	232	1	Gordon	Gordon	NNP
10_1101-2020_11_24_390039	232	2	,	,	,
10_1101-2020_11_24_390039	232	3	D.	D.	NNP
10_1101-2020_11_24_390039	232	4	E.	E.	NNP
10_1101-2020_11_24_390039	232	5	,	,	,
10_1101-2020_11_24_390039	232	6	Jang	Jang	NNP
10_1101-2020_11_24_390039	232	7	,	,	,
10_1101-2020_11_24_390039	232	8	G.	G.	NNP
10_1101-2020_11_24_390039	232	9	M.	M.	NNP
10_1101-2020_11_24_390039	232	10	,	,	,
10_1101-2020_11_24_390039	232	11	Bouhaddou	Bouhaddou	NNP
10_1101-2020_11_24_390039	232	12	,	,	,
10_1101-2020_11_24_390039	232	13	M.	M.	NNP
10_1101-2020_11_24_390039	232	14	,	,	,
10_1101-2020_11_24_390039	232	15	Xu	Xu	NNP
10_1101-2020_11_24_390039	232	16	,	,	,
10_1101-2020_11_24_390039	232	17	J.	J.	NNP
10_1101-2020_11_24_390039	232	18	,	,	,
10_1101-2020_11_24_390039	232	19	Obernier	Obernier	NNP
10_1101-2020_11_24_390039	232	20	,	,	,
10_1101-2020_11_24_390039	232	21	K.	K.	NNP
10_1101-2020_11_24_390039	232	22	,	,	,
10_1101-2020_11_24_390039	232	23	White	White	NNP
10_1101-2020_11_24_390039	232	24	,	,	,
10_1101-2020_11_24_390039	232	25	K.	K.	NNP
10_1101-2020_11_24_390039	232	26	M.	M.	NNP
10_1101-2020_11_24_390039	232	27	,	,	,
10_1101-2020_11_24_390039	232	28	O’Meara	O’Meara	NNP
10_1101-2020_11_24_390039	232	29	,	,	,
10_1101-2020_11_24_390039	232	30	M.	M.	NNP
10_1101-2020_11_24_390039	232	31	J.	J.	NNP
10_1101-2020_11_24_390039	232	32	,	,	,
10_1101-2020_11_24_390039	232	33	Rezelj	Rezelj	NNP
10_1101-2020_11_24_390039	232	34	,	,	,
10_1101-2020_11_24_390039	232	35	V.	V.	NNP
10_1101-2020_11_24_390039	232	36	V.	V.	NNP
10_1101-2020_11_24_390039	232	37	,	,	,
10_1101-2020_11_24_390039	232	38	Guo	Guo	NNP
10_1101-2020_11_24_390039	232	39	,	,	,
10_1101-2020_11_24_390039	232	40	J.	J.	NNP
10_1101-2020_11_24_390039	233	1	Z.	Z.	NNP
10_1101-2020_11_24_390039	233	2	,	,	,
10_1101-2020_11_24_390039	233	3	Swaney	Swaney	NNP
10_1101-2020_11_24_390039	233	4	,	,	,
10_1101-2020_11_24_390039	233	5	D.	D.	NNP
10_1101-2020_11_24_390039	233	6	L.	L.	NNP
10_1101-2020_11_24_390039	233	7	,	,	,
10_1101-2020_11_24_390039	233	8	Tummino	Tummino	NNP
10_1101-2020_11_24_390039	233	9	,	,	,
10_1101-2020_11_24_390039	233	10	T.	T.	NNP
10_1101-2020_11_24_390039	233	11	A.	A.	NNP
10_1101-2020_11_24_390039	233	12	et	et	FW
10_1101-2020_11_24_390039	233	13	al	al	NNP
10_1101-2020_11_24_390039	233	14	.	.	.
10_1101-2020_11_24_390039	234	1	(	(	-LRB-
10_1101-2020_11_24_390039	234	2	2020	2020	CD
10_1101-2020_11_24_390039	234	3	)	)	-RRB-
10_1101-2020_11_24_390039	234	4	A	a	DT
10_1101-2020_11_24_390039	234	5	SARS	SARS	NNP
10_1101-2020_11_24_390039	234	6	-	-	HYPH
10_1101-2020_11_24_390039	234	7	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	234	8	protein	protein	NNP
10_1101-2020_11_24_390039	234	9	interaction	interaction	NNP
10_1101-2020_11_24_390039	234	10	map	map	NNP
10_1101-2020_11_24_390039	234	11	reveals	reveal	VBZ
10_1101-2020_11_24_390039	234	12	targets	target	NNS
10_1101-2020_11_24_390039	234	13	for	for	IN
10_1101-2020_11_24_390039	234	14	drug	drug	NN
10_1101-2020_11_24_390039	234	15	repurposing	repurposing	NN
10_1101-2020_11_24_390039	234	16	.	.	.
10_1101-2020_11_24_390039	235	1	Nature	nature	NN
10_1101-2020_11_24_390039	235	2	.	.	.
10_1101-2020_11_24_390039	236	1	583	583	CD
10_1101-2020_11_24_390039	236	2	,	,	,
10_1101-2020_11_24_390039	236	3	459	459	CD
10_1101-2020_11_24_390039	236	4	-	-	SYM
10_1101-2020_11_24_390039	236	5	468	468	CD
10_1101-2020_11_24_390039	236	6	.	.	.
10_1101-2020_11_24_390039	237	1	Grob	Grob	NNP
10_1101-2020_11_24_390039	237	2	,	,	,
10_1101-2020_11_24_390039	237	3	S.	S.	NNP
10_1101-2020_11_24_390039	237	4	,	,	,
10_1101-2020_11_24_390039	237	5	Jahn	Jahn	NNP
10_1101-2020_11_24_390039	237	6	,	,	,
10_1101-2020_11_24_390039	237	7	C.	C.	NNP
10_1101-2020_11_24_390039	237	8	,	,	,
10_1101-2020_11_24_390039	237	9	Cushman	Cushman	NNP
10_1101-2020_11_24_390039	237	10	,	,	,
10_1101-2020_11_24_390039	237	11	S.	S.	NNP
10_1101-2020_11_24_390039	237	12	,	,	,
10_1101-2020_11_24_390039	237	13	Bär	Bär	NNP
10_1101-2020_11_24_390039	237	14	,	,	,
10_1101-2020_11_24_390039	237	15	C.	C.	NNP
10_1101-2020_11_24_390039	237	16	,	,	,
10_1101-2020_11_24_390039	237	17	and	and	CC
10_1101-2020_11_24_390039	237	18	Thum	Thum	NNP
10_1101-2020_11_24_390039	237	19	,	,	,
10_1101-2020_11_24_390039	237	20	T.	T.	NNP
10_1101-2020_11_24_390039	237	21	(	(	-LRB-
10_1101-2020_11_24_390039	237	22	2020	2020	CD
10_1101-2020_11_24_390039	237	23	)	)	-RRB-
10_1101-2020_11_24_390039	237	24	.	.	.
10_1101-2020_11_24_390039	238	1	SARS	SARS	NNP
10_1101-2020_11_24_390039	238	2	-	-	HYPH
10_1101-2020_11_24_390039	238	3	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	238	4	receptor	receptor	NN
10_1101-2020_11_24_390039	238	5	ACE2-dependent	ACE2-dependent	NNP
10_1101-2020_11_24_390039	238	6	implications	implication	NNS
10_1101-2020_11_24_390039	238	7	on	on	IN
10_1101-2020_11_24_390039	238	8	the	the	DT
10_1101-2020_11_24_390039	238	9	cardiovascular	cardiovascular	JJ
10_1101-2020_11_24_390039	238	10	system	system	NN
10_1101-2020_11_24_390039	238	11	:	:	:
10_1101-2020_11_24_390039	238	12	from	from	IN
10_1101-2020_11_24_390039	238	13	basic	basic	JJ
10_1101-2020_11_24_390039	238	14	science	science	NN
10_1101-2020_11_24_390039	238	15	to	to	IN
10_1101-2020_11_24_390039	238	16	clinical	clinical	JJ
10_1101-2020_11_24_390039	238	17	implications	implication	NNS
10_1101-2020_11_24_390039	238	18	.	.	.
10_1101-2020_11_24_390039	239	1	J.	J.	NNP
10_1101-2020_11_24_390039	239	2	Mol	Mol	NNP
10_1101-2020_11_24_390039	239	3	.	.	.
10_1101-2020_11_24_390039	240	1	Cell	cell	NN
10_1101-2020_11_24_390039	240	2	.	.	.
10_1101-2020_11_24_390039	241	1	Cardiol	Cardiol	NNP
10_1101-2020_11_24_390039	241	2	.	.	.
10_1101-2020_11_24_390039	242	1	144	144	CD
10_1101-2020_11_24_390039	242	2	,	,	,
10_1101-2020_11_24_390039	242	3	47	47	CD
10_1101-2020_11_24_390039	242	4	-	-	SYM
10_1101-2020_11_24_390039	242	5	53	53	CD
10_1101-2020_11_24_390039	242	6	.	.	.
10_1101-2020_11_24_390039	243	1	Heaton	Heaton	NNP
10_1101-2020_11_24_390039	243	2	,	,	,
10_1101-2020_11_24_390039	243	3	N.	N.	NNP
10_1101-2020_11_24_390039	243	4	S.	S.	NNP
10_1101-2020_11_24_390039	243	5	,	,	,
10_1101-2020_11_24_390039	243	6	Moshkina	Moshkina	NNP
10_1101-2020_11_24_390039	243	7	,	,	,
10_1101-2020_11_24_390039	243	8	N.	N.	NNP
10_1101-2020_11_24_390039	243	9	,	,	,
10_1101-2020_11_24_390039	243	10	Fenouil	Fenouil	NNP
10_1101-2020_11_24_390039	243	11	,	,	,
10_1101-2020_11_24_390039	243	12	R.	R.	NNP
10_1101-2020_11_24_390039	243	13	,	,	,
10_1101-2020_11_24_390039	243	14	Gardner	Gardner	NNP
10_1101-2020_11_24_390039	243	15	,	,	,
10_1101-2020_11_24_390039	243	16	T.	T.	NNP
10_1101-2020_11_24_390039	243	17	J.	J.	NNP
10_1101-2020_11_24_390039	243	18	,	,	,
10_1101-2020_11_24_390039	243	19	Aguirre	Aguirre	NNP
10_1101-2020_11_24_390039	243	20	,	,	,
10_1101-2020_11_24_390039	243	21	S.	S.	NNP
10_1101-2020_11_24_390039	243	22	,	,	,
10_1101-2020_11_24_390039	243	23	Shah	Shah	NNP
10_1101-2020_11_24_390039	243	24	,	,	,
10_1101-2020_11_24_390039	243	25	P.	P.	NNP
10_1101-2020_11_24_390039	243	26	S.	S.	NNP
10_1101-2020_11_24_390039	243	27	,	,	,
10_1101-2020_11_24_390039	243	28	Zhao	Zhao	NNP
10_1101-2020_11_24_390039	243	29	,	,	,
10_1101-2020_11_24_390039	243	30	N.	N.	NNP
10_1101-2020_11_24_390039	243	31	,	,	,
10_1101-2020_11_24_390039	243	32	Manganaro	Manganaro	NNP
10_1101-2020_11_24_390039	243	33	,	,	,
10_1101-2020_11_24_390039	243	34	L.	L.	NNP
10_1101-2020_11_24_390039	243	35	,	,	,
10_1101-2020_11_24_390039	243	36	Hultquist	Hultquist	NNP
10_1101-2020_11_24_390039	243	37	,	,	,
10_1101-2020_11_24_390039	243	38	J.	J.	NNP
10_1101-2020_11_24_390039	243	39	F.	F.	NNP
10_1101-2020_11_24_390039	243	40	,	,	,
10_1101-2020_11_24_390039	243	41	Noel	Noel	NNP
10_1101-2020_11_24_390039	243	42	,	,	,
10_1101-2020_11_24_390039	243	43	J.	J.	NNP
10_1101-2020_11_24_390039	243	44	et	et	NNP
10_1101-2020_11_24_390039	243	45	al	al	NNP
10_1101-2020_11_24_390039	243	46	.	.	.
10_1101-2020_11_24_390039	244	1	(	(	-LRB-
10_1101-2020_11_24_390039	244	2	2016	2016	CD
10_1101-2020_11_24_390039	244	3	)	)	-RRB-
10_1101-2020_11_24_390039	244	4	.	.	.
10_1101-2020_11_24_390039	245	1	Targeting	target	VBG
10_1101-2020_11_24_390039	245	2	viral	viral	JJ
10_1101-2020_11_24_390039	245	3	proteostasis	proteostasis	NN
10_1101-2020_11_24_390039	245	4	limits	limit	NNS
10_1101-2020_11_24_390039	245	5	influenza	influenza	NNP
10_1101-2020_11_24_390039	245	6	virus	virus	NN
10_1101-2020_11_24_390039	245	7	,	,	,
10_1101-2020_11_24_390039	245	8	HIV	HIV	NNP
10_1101-2020_11_24_390039	245	9	,	,	,
10_1101-2020_11_24_390039	245	10	and	and	CC
10_1101-2020_11_24_390039	245	11	Dengue	Dengue	NNP
10_1101-2020_11_24_390039	245	12	virus	virus	NN
10_1101-2020_11_24_390039	245	13	infection	infection	NN
10_1101-2020_11_24_390039	245	14	.	.	.
10_1101-2020_11_24_390039	246	1	Immunity	immunity	NN
10_1101-2020_11_24_390039	246	2	.	.	.
10_1101-2020_11_24_390039	247	1	44	44	CD
10_1101-2020_11_24_390039	247	2	,	,	,
10_1101-2020_11_24_390039	247	3	46	46	CD
10_1101-2020_11_24_390039	247	4	-	-	SYM
10_1101-2020_11_24_390039	247	5	58	58	CD
10_1101-2020_11_24_390039	247	6	.	.	.
10_1101-2020_11_24_390039	248	1	Li	Li	NNP
10_1101-2020_11_24_390039	248	2	,	,	,
10_1101-2020_11_24_390039	248	3	J.-Y.	J.-Y.	NNP
10_1101-2020_11_24_390039	248	4	,	,	,
10_1101-2020_11_24_390039	248	5	Liao	Liao	NNP
10_1101-2020_11_24_390039	248	6	,	,	,
10_1101-2020_11_24_390039	248	7	C.-H.	C.-H.	NNP
10_1101-2020_11_24_390039	248	8	,	,	,
10_1101-2020_11_24_390039	248	9	Wang	Wang	NNP
10_1101-2020_11_24_390039	248	10	,	,	,
10_1101-2020_11_24_390039	248	11	Q.	Q.	NNP
10_1101-2020_11_24_390039	248	12	,	,	,
10_1101-2020_11_24_390039	248	13	Tan	Tan	NNP
10_1101-2020_11_24_390039	248	14	,	,	,
10_1101-2020_11_24_390039	248	15	Y.-	Y.-	NNP
10_1101-2020_11_24_390039	248	16	.	.	NNP
10_1101-2020_11_24_390039	248	17	,	,	,
10_1101-2020_11_24_390039	248	18	Luo	Luo	NNP
10_1101-2020_11_24_390039	248	19	,	,	,
10_1101-2020_11_24_390039	248	20	R.	R.	NNP
10_1101-2020_11_24_390039	248	21	,	,	,
10_1101-2020_11_24_390039	248	22	Qiu	Qiu	NNP
10_1101-2020_11_24_390039	248	23	,	,	,
10_1101-2020_11_24_390039	248	24	Y.	Y.	NNP
10_1101-2020_11_24_390039	248	25	,	,	,
10_1101-2020_11_24_390039	248	26	and	and	CC
10_1101-2020_11_24_390039	248	27	Ge	Ge	NNP
10_1101-2020_11_24_390039	248	28	,	,	,
10_1101-2020_11_24_390039	248	29	X.-Y.	X.-Y.	NNP
10_1101-2020_11_24_390039	249	1	(	(	-LRB-
10_1101-2020_11_24_390039	249	2	2020	2020	CD
10_1101-2020_11_24_390039	249	3	)	)	-RRB-
10_1101-2020_11_24_390039	249	4	.	.	.
10_1101-2020_11_24_390039	250	1	The	the	DT
10_1101-2020_11_24_390039	250	2	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	250	3	,	,	,
10_1101-2020_11_24_390039	250	4	ORF8	ORF8	NNS
10_1101-2020_11_24_390039	250	5	and	and	CC
10_1101-2020_11_24_390039	250	6	nucleocapsid	nucleocapsid	JJ
10_1101-2020_11_24_390039	250	7	proteins	protein	NNS
10_1101-2020_11_24_390039	250	8	of	of	IN
10_1101-2020_11_24_390039	250	9	SARS	SARS	NNP
10_1101-2020_11_24_390039	250	10	-	-	HYPH
10_1101-2020_11_24_390039	250	11	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	250	12	inhibit	inhibit	NN
10_1101-2020_11_24_390039	250	13	type	type	NN
10_1101-2020_11_24_390039	250	14	I	-PRON-	PRP
10_1101-2020_11_24_390039	250	15	interferon	interferon	VBP
10_1101-2020_11_24_390039	250	16	signalling	signal	VBG
10_1101-2020_11_24_390039	250	17	pathway	pathway	NN
10_1101-2020_11_24_390039	250	18	.	.	.
10_1101-2020_11_24_390039	251	1	Virus	Virus	NNP
10_1101-2020_11_24_390039	251	2	Res	Res	NNP
10_1101-2020_11_24_390039	251	3	.	.	.
10_1101-2020_11_24_390039	252	1	286	286	CD
10_1101-2020_11_24_390039	252	2	,	,	,
10_1101-2020_11_24_390039	252	3	198074	198074	CD
10_1101-2020_11_24_390039	252	4	.	.	.
10_1101-2020_11_24_390039	253	1	Luesch	Luesch	NNP
10_1101-2020_11_24_390039	253	2	,	,	,
10_1101-2020_11_24_390039	253	3	H.	H.	NNP
10_1101-2020_11_24_390039	253	4	,	,	,
10_1101-2020_11_24_390039	253	5	and	and	CC
10_1101-2020_11_24_390039	253	6	Paavilainen	Paavilainen	NNP
10_1101-2020_11_24_390039	253	7	,	,	,
10_1101-2020_11_24_390039	253	8	V.	V.	NNP
10_1101-2020_11_24_390039	253	9	O.	O.	NNP
10_1101-2020_11_24_390039	254	1	(	(	-LRB-
10_1101-2020_11_24_390039	254	2	2020	2020	CD
10_1101-2020_11_24_390039	254	3	)	)	-RRB-
10_1101-2020_11_24_390039	254	4	.	.	.
10_1101-2020_11_24_390039	255	1	Natural	natural	JJ
10_1101-2020_11_24_390039	255	2	products	product	NNS
10_1101-2020_11_24_390039	255	3	as	as	IN
10_1101-2020_11_24_390039	255	4	modulators	modulator	NNS
10_1101-2020_11_24_390039	255	5	of	of	IN
10_1101-2020_11_24_390039	255	6	eukaryotic	eukaryotic	JJ
10_1101-2020_11_24_390039	255	7	protein	protein	NN
10_1101-2020_11_24_390039	255	8	secretion	secretion	NN
10_1101-2020_11_24_390039	255	9	.	.	.
10_1101-2020_11_24_390039	256	1	Nat	Nat	NNP
10_1101-2020_11_24_390039	256	2	.	.	.
10_1101-2020_11_24_390039	257	1	Prod	Prod	NNP
10_1101-2020_11_24_390039	257	2	.	.	.
10_1101-2020_11_24_390039	258	1	Rep.	Rep.	NNP
10_1101-2020_11_24_390039	258	2	37	37	CD
10_1101-2020_11_24_390039	258	3	,	,	,
10_1101-2020_11_24_390039	258	4	717	717	CD
10_1101-2020_11_24_390039	258	5	-	-	SYM
10_1101-2020_11_24_390039	258	6	736	736	CD
10_1101-2020_11_24_390039	258	7	.	.	.
10_1101-2020_11_24_390039	259	1	Mast	Mast	NNP
10_1101-2020_11_24_390039	259	2	,	,	,
10_1101-2020_11_24_390039	259	3	F.	F.	NNP
10_1101-2020_11_24_390039	259	4	D.	D.	NNP
10_1101-2020_11_24_390039	259	5	,	,	,
10_1101-2020_11_24_390039	259	6	Navare	Navare	NNP
10_1101-2020_11_24_390039	259	7	,	,	,
10_1101-2020_11_24_390039	259	8	A.	a.	NN
10_1101-2020_11_24_390039	259	9	T.	T.	NNP
10_1101-2020_11_24_390039	259	10	,	,	,
10_1101-2020_11_24_390039	259	11	van	van	NNP
10_1101-2020_11_24_390039	259	12	der	der	IN
10_1101-2020_11_24_390039	259	13	Sloot	Sloot	NNP
10_1101-2020_11_24_390039	259	14	,	,	,
10_1101-2020_11_24_390039	259	15	A.	a.	NN
10_1101-2020_11_24_390039	259	16	M.	M.	NNP
10_1101-2020_11_24_390039	259	17	,	,	,
10_1101-2020_11_24_390039	259	18	Coulombe	Coulombe	NNP
10_1101-2020_11_24_390039	259	19	-	-	HYPH
10_1101-2020_11_24_390039	259	20	Huntington	Huntington	NNP
10_1101-2020_11_24_390039	259	21	,	,	,
10_1101-2020_11_24_390039	259	22	J.	J.	NNP
10_1101-2020_11_24_390039	259	23	Rout	Rout	NNP
10_1101-2020_11_24_390039	259	24	,	,	,
10_1101-2020_11_24_390039	259	25	M.	M.	NNP
10_1101-2020_11_24_390039	259	26	P.	P.	NNP
10_1101-2020_11_24_390039	259	27	,	,	,
10_1101-2020_11_24_390039	259	28	Baliga	Baliga	NNP
10_1101-2020_11_24_390039	259	29	,	,	,
10_1101-2020_11_24_390039	259	30	N.	N.	NNP
10_1101-2020_11_24_390039	259	31	S.	S.	NNP
10_1101-2020_11_24_390039	259	32	,	,	,
10_1101-2020_11_24_390039	259	33	Kaushansky	Kaushansky	NNP
10_1101-2020_11_24_390039	259	34	,	,	,
10_1101-2020_11_24_390039	259	35	A.	A.	NNP
10_1101-2020_11_24_390039	259	36	,	,	,
10_1101-2020_11_24_390039	259	37	Chait	Chait	NNP
10_1101-2020_11_24_390039	259	38	,	,	,
10_1101-2020_11_24_390039	259	39	B.	B.	NNP
10_1101-2020_11_24_390039	259	40	T.	T.	NNP
10_1101-2020_11_24_390039	259	41	,	,	,
10_1101-2020_11_24_390039	259	42	Aderem	Aderem	NNP
10_1101-2020_11_24_390039	259	43	,	,	,
10_1101-2020_11_24_390039	259	44	A.	A.	NNP
10_1101-2020_11_24_390039	259	45	,	,	,
10_1101-2020_11_24_390039	259	46	Rice	Rice	NNP
10_1101-2020_11_24_390039	259	47	,	,	,
10_1101-2020_11_24_390039	259	48	C.	C.	NNP
10_1101-2020_11_24_390039	259	49	M.	M.	NNP
10_1101-2020_11_24_390039	259	50	et	et	NNP
10_1101-2020_11_24_390039	259	51	al	al	NNP
10_1101-2020_11_24_390039	259	52	.	.	.
10_1101-2020_11_24_390039	260	1	(	(	-LRB-
10_1101-2020_11_24_390039	260	2	2020	2020	CD
10_1101-2020_11_24_390039	260	3	)	)	-RRB-
10_1101-2020_11_24_390039	260	4	.	.	.
10_1101-2020_11_24_390039	261	1	Crippling	crippling	JJ
10_1101-2020_11_24_390039	261	2	life	life	NN
10_1101-2020_11_24_390039	261	3	support	support	NN
10_1101-2020_11_24_390039	261	4	for	for	IN
10_1101-2020_11_24_390039	261	5	SARS	SARS	NNP
10_1101-2020_11_24_390039	261	6	-	-	HYPH
10_1101-2020_11_24_390039	261	7	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	261	8	and	and	CC
10_1101-2020_11_24_390039	261	9	other	other	JJ
10_1101-2020_11_24_390039	261	10	viruses	virus	NNS
10_1101-2020_11_24_390039	261	11	through	through	IN
10_1101-2020_11_24_390039	261	12	synthetic	synthetic	JJ
10_1101-2020_11_24_390039	261	13	lethality	lethality	NN
10_1101-2020_11_24_390039	261	14	.	.	.
10_1101-2020_11_24_390039	262	1	J.	J.	NNP
10_1101-2020_11_24_390039	263	1	Cell	cell	NN
10_1101-2020_11_24_390039	263	2	.	.	.
10_1101-2020_11_24_390039	264	1	Biol	Biol	NNP
10_1101-2020_11_24_390039	264	2	.	.	.
10_1101-2020_11_24_390039	265	1	219	219	CD
10_1101-2020_11_24_390039	265	2	,	,	,
10_1101-2020_11_24_390039	265	3	e202006159	e202006159	NN
10_1101-2020_11_24_390039	265	4	.	.	.
10_1101-2020_11_24_390039	266	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	266	2	-	-	:
10_1101-2020_11_24_390039	266	3	BY	by	IN
10_1101-2020_11_24_390039	266	4	-	-	HYPH
10_1101-2020_11_24_390039	266	5	ND	ND	NNP
10_1101-2020_11_24_390039	266	6	4.0	4.0	CD
10_1101-2020_11_24_390039	266	7	International	international	JJ
10_1101-2020_11_24_390039	266	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	266	9	available	available	JJ
10_1101-2020_11_24_390039	266	10	under	under	IN
10_1101-2020_11_24_390039	266	11	a	a	DT
10_1101-2020_11_24_390039	266	12	(	(	-LRB-
10_1101-2020_11_24_390039	266	13	which	which	WDT
10_1101-2020_11_24_390039	266	14	was	be	VBD
10_1101-2020_11_24_390039	266	15	not	not	RB
10_1101-2020_11_24_390039	266	16	certified	certify	VBN
10_1101-2020_11_24_390039	266	17	by	by	IN
10_1101-2020_11_24_390039	266	18	peer	peer	NN
10_1101-2020_11_24_390039	266	19	review	review	NN
10_1101-2020_11_24_390039	266	20	)	)	-RRB-
10_1101-2020_11_24_390039	266	21	is	be	VBZ
10_1101-2020_11_24_390039	266	22	the	the	DT
10_1101-2020_11_24_390039	266	23	author	author	NN
10_1101-2020_11_24_390039	266	24	/	/	SYM
10_1101-2020_11_24_390039	266	25	funder	funder	NN
10_1101-2020_11_24_390039	266	26	,	,	,
10_1101-2020_11_24_390039	266	27	who	who	WP
10_1101-2020_11_24_390039	266	28	has	have	VBZ
10_1101-2020_11_24_390039	266	29	granted	grant	VBN
10_1101-2020_11_24_390039	266	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	266	31	a	a	DT
10_1101-2020_11_24_390039	266	32	license	license	NN
10_1101-2020_11_24_390039	266	33	to	to	TO
10_1101-2020_11_24_390039	266	34	display	display	VB
10_1101-2020_11_24_390039	266	35	the	the	DT
10_1101-2020_11_24_390039	266	36	preprint	preprint	NN
10_1101-2020_11_24_390039	266	37	in	in	IN
10_1101-2020_11_24_390039	266	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	266	39	.	.	.
10_1101-2020_11_24_390039	267	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	267	2	is	be	VBZ
10_1101-2020_11_24_390039	267	3	The	the	DT
10_1101-2020_11_24_390039	267	4	copyright	copyright	NN
10_1101-2020_11_24_390039	267	5	holder	holder	NN
10_1101-2020_11_24_390039	267	6	for	for	IN
10_1101-2020_11_24_390039	267	7	this	this	DT
10_1101-2020_11_24_390039	267	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	267	9	version	version	NN
10_1101-2020_11_24_390039	267	10	posted	post	VBD
10_1101-2020_11_24_390039	267	11	January	January	NNP
10_1101-2020_11_24_390039	267	12	5	5	CD
10_1101-2020_11_24_390039	267	13	,	,	,
10_1101-2020_11_24_390039	267	14	2021	2021	CD
10_1101-2020_11_24_390039	267	15	.	.	.
10_1101-2020_11_24_390039	267	16	;	;	:
10_1101-2020_11_24_390039	267	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	267	18	:	:	:
10_1101-2020_11_24_390039	267	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	267	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	267	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	267	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	267	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	267	24	-	-	HYPH
10_1101-2020_11_24_390039	267	25	F	F	NNP
10_1101-2020_11_24_390039	267	26	as	as	IN
10_1101-2020_11_24_390039	267	27	a	a	DT
10_1101-2020_11_24_390039	267	28	potential	potential	JJ
10_1101-2020_11_24_390039	267	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	267	30	agent	agent	NN
10_1101-2020_11_24_390039	267	31	Page	Page	NNP
10_1101-2020_11_24_390039	267	32	17	17	CD
10_1101-2020_11_24_390039	267	33	of	of	IN
10_1101-2020_11_24_390039	267	34	21	21	CD
10_1101-2020_11_24_390039	267	35	McKenna	McKenna	NNP
10_1101-2020_11_24_390039	267	36	,	,	,
10_1101-2020_11_24_390039	267	37	M.	M.	NNP
10_1101-2020_11_24_390039	267	38	,	,	,
10_1101-2020_11_24_390039	267	39	Simmonds	Simmonds	NNP
10_1101-2020_11_24_390039	267	40	,	,	,
10_1101-2020_11_24_390039	267	41	R.E.	R.E.	NNP
10_1101-2020_11_24_390039	267	42	,	,	,
10_1101-2020_11_24_390039	267	43	and	and	CC
10_1101-2020_11_24_390039	267	44	High	High	NNP
10_1101-2020_11_24_390039	267	45	,	,	,
10_1101-2020_11_24_390039	267	46	S.	S.	NNP
10_1101-2020_11_24_390039	267	47	(	(	-LRB-
10_1101-2020_11_24_390039	267	48	2016	2016	CD
10_1101-2020_11_24_390039	267	49	)	)	-RRB-
10_1101-2020_11_24_390039	267	50	.	.	.
10_1101-2020_11_24_390039	268	1	Mechanistic	mechanistic	JJ
10_1101-2020_11_24_390039	268	2	insights	insight	NNS
10_1101-2020_11_24_390039	268	3	into	into	IN
10_1101-2020_11_24_390039	268	4	the	the	DT
10_1101-2020_11_24_390039	268	5	inhibition	inhibition	NN
10_1101-2020_11_24_390039	268	6	of	of	IN
10_1101-2020_11_24_390039	268	7	Sec61-dependent	sec61-dependent	NN
10_1101-2020_11_24_390039	268	8	co-	co-	JJ
10_1101-2020_11_24_390039	268	9	and	and	CC
10_1101-2020_11_24_390039	268	10	post	post	JJ
10_1101-2020_11_24_390039	268	11	-	-	JJ
10_1101-2020_11_24_390039	268	12	translational	translational	JJ
10_1101-2020_11_24_390039	268	13	translocation	translocation	NN
10_1101-2020_11_24_390039	268	14	by	by	IN
10_1101-2020_11_24_390039	268	15	mycolactone	mycolactone	NN
10_1101-2020_11_24_390039	268	16	.	.	.
10_1101-2020_11_24_390039	269	1	J.	J.	NNP
10_1101-2020_11_24_390039	270	1	Cell	Cell	NNP
10_1101-2020_11_24_390039	270	2	Sci	Sci	NNP
10_1101-2020_11_24_390039	270	3	.	.	.
10_1101-2020_11_24_390039	271	1	129	129	CD
10_1101-2020_11_24_390039	271	2	,	,	,
10_1101-2020_11_24_390039	271	3	1404	1404	CD
10_1101-2020_11_24_390039	271	4	-	-	SYM
10_1101-2020_11_24_390039	271	5	1415	1415	CD
10_1101-2020_11_24_390039	271	6	.	.	.
10_1101-2020_11_24_390039	272	1	Morel	Morel	NNP
10_1101-2020_11_24_390039	272	2	,	,	,
10_1101-2020_11_24_390039	272	3	J.	J.	NNP
10_1101-2020_11_24_390039	272	4	D.	D.	NNP
10_1101-2020_11_24_390039	272	5	,	,	,
10_1101-2020_11_24_390039	272	6	Paatero	Paatero	NNP
10_1101-2020_11_24_390039	272	7	,	,	,
10_1101-2020_11_24_390039	272	8	A.	a.	NN
10_1101-2020_11_24_390039	272	9	O.	O.	NNP
10_1101-2020_11_24_390039	272	10	,	,	,
10_1101-2020_11_24_390039	272	11	Wei	Wei	NNP
10_1101-2020_11_24_390039	272	12	,	,	,
10_1101-2020_11_24_390039	272	13	J.	J.	NNP
10_1101-2020_11_24_390039	272	14	,	,	,
10_1101-2020_11_24_390039	272	15	Yewdell	Yewdell	NNP
10_1101-2020_11_24_390039	272	16	,	,	,
10_1101-2020_11_24_390039	272	17	J.	J.	NNP
10_1101-2020_11_24_390039	272	18	W.	W.	NNP
10_1101-2020_11_24_390039	272	19	,	,	,
10_1101-2020_11_24_390039	272	20	Guenin	Guenin	NNP
10_1101-2020_11_24_390039	272	21	-	-	HYPH
10_1101-2020_11_24_390039	272	22	Macé	Macé	NNP
10_1101-2020_11_24_390039	272	23	,	,	,
10_1101-2020_11_24_390039	272	24	L.	L.	NNP
10_1101-2020_11_24_390039	272	25	,	,	,
10_1101-2020_11_24_390039	272	26	Van	Van	NNP
10_1101-2020_11_24_390039	272	27	Haver	Haver	NNP
10_1101-2020_11_24_390039	272	28	,	,	,
10_1101-2020_11_24_390039	272	29	D.	D.	NNP
10_1101-2020_11_24_390039	272	30	,	,	,
10_1101-2020_11_24_390039	272	31	Impens	Impens	NNP
10_1101-2020_11_24_390039	272	32	,	,	,
10_1101-2020_11_24_390039	272	33	F.	F.	NNP
10_1101-2020_11_24_390039	272	34	,	,	,
10_1101-2020_11_24_390039	272	35	Pietrosemoli	Pietrosemoli	NNP
10_1101-2020_11_24_390039	272	36	,	,	,
10_1101-2020_11_24_390039	272	37	N.	N.	NNP
10_1101-2020_11_24_390039	272	38	,	,	,
10_1101-2020_11_24_390039	272	39	Paavilainen	Paavilainen	NNP
10_1101-2020_11_24_390039	272	40	,	,	,
10_1101-2020_11_24_390039	272	41	V.	V.	NNP
10_1101-2020_11_24_390039	272	42	O.	O.	NNP
10_1101-2020_11_24_390039	272	43	,	,	,
10_1101-2020_11_24_390039	272	44	and	and	CC
10_1101-2020_11_24_390039	272	45	Demangel	Demangel	NNP
10_1101-2020_11_24_390039	272	46	,	,	,
10_1101-2020_11_24_390039	272	47	C.	C.	NNP
10_1101-2020_11_24_390039	272	48	(	(	-LRB-
10_1101-2020_11_24_390039	272	49	2018	2018	CD
10_1101-2020_11_24_390039	272	50	)	)	-RRB-
10_1101-2020_11_24_390039	272	51	.	.	.
10_1101-2020_11_24_390039	273	1	Proteomics	proteomic	NNS
10_1101-2020_11_24_390039	273	2	reveals	reveal	VBZ
10_1101-2020_11_24_390039	273	3	scope	scope	NN
10_1101-2020_11_24_390039	273	4	of	of	IN
10_1101-2020_11_24_390039	273	5	mycolactone	mycolactone	NN
10_1101-2020_11_24_390039	273	6	-	-	HYPH
10_1101-2020_11_24_390039	273	7	mediated	mediate	VBN
10_1101-2020_11_24_390039	273	8	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	273	9	blockade	blockade	NN
10_1101-2020_11_24_390039	273	10	and	and	CC
10_1101-2020_11_24_390039	273	11	distinctive	distinctive	JJ
10_1101-2020_11_24_390039	273	12	stress	stress	NN
10_1101-2020_11_24_390039	273	13	signature	signature	NN
10_1101-2020_11_24_390039	273	14	.	.	.
10_1101-2020_11_24_390039	274	1	Mol	Mol	NNP
10_1101-2020_11_24_390039	274	2	.	.	.
10_1101-2020_11_24_390039	275	1	Cell	Cell	NNP
10_1101-2020_11_24_390039	275	2	Prot	Prot	NNP
10_1101-2020_11_24_390039	275	3	.	.	.
10_1101-2020_11_24_390039	276	1	17	17	CD
10_1101-2020_11_24_390039	276	2	,	,	,
10_1101-2020_11_24_390039	276	3	1750	1750	CD
10_1101-2020_11_24_390039	276	4	-	-	SYM
10_1101-2020_11_24_390039	276	5	1765	1765	CD
10_1101-2020_11_24_390039	276	6	.	.	.
10_1101-2020_11_24_390039	277	1	Naqvi	Naqvi	NNP
10_1101-2020_11_24_390039	277	2	,	,	,
10_1101-2020_11_24_390039	277	3	A.	a.	NN
10_1101-2020_11_24_390039	278	1	A.	A.	NNP
10_1101-2020_11_24_390039	278	2	T.	T.	NNP
10_1101-2020_11_24_390039	278	3	,	,	,
10_1101-2020_11_24_390039	278	4	Fatima	Fatima	NNP
10_1101-2020_11_24_390039	278	5	,	,	,
10_1101-2020_11_24_390039	278	6	K.	K.	NNP
10_1101-2020_11_24_390039	278	7	,	,	,
10_1101-2020_11_24_390039	278	8	Mohammad	Mohammad	NNP
10_1101-2020_11_24_390039	278	9	,	,	,
10_1101-2020_11_24_390039	278	10	T.	T.	NNP
10_1101-2020_11_24_390039	278	11	,	,	,
10_1101-2020_11_24_390039	278	12	Fatima	Fatima	NNP
10_1101-2020_11_24_390039	278	13	,	,	,
10_1101-2020_11_24_390039	278	14	U.	U.	NNP
10_1101-2020_11_24_390039	278	15	,	,	,
10_1101-2020_11_24_390039	278	16	Singh	Singh	NNP
10_1101-2020_11_24_390039	278	17	,	,	,
10_1101-2020_11_24_390039	278	18	I.	I.	NNP
10_1101-2020_11_24_390039	278	19	K.	K.	NNP
10_1101-2020_11_24_390039	278	20	,	,	,
10_1101-2020_11_24_390039	278	21	Singh	Singh	NNP
10_1101-2020_11_24_390039	278	22	,	,	,
10_1101-2020_11_24_390039	278	23	A.	a.	NN
10_1101-2020_11_24_390039	278	24	,	,	,
10_1101-2020_11_24_390039	278	25	Atif	Atif	NNP
10_1101-2020_11_24_390039	278	26	,	,	,
10_1101-2020_11_24_390039	278	27	A.	a.	NN
10_1101-2020_11_24_390039	278	28	M.	M.	NNP
10_1101-2020_11_24_390039	278	29	,	,	,
10_1101-2020_11_24_390039	278	30	Hariprasad	Hariprasad	NNP
10_1101-2020_11_24_390039	278	31	,	,	,
10_1101-2020_11_24_390039	278	32	G.	G.	NNP
10_1101-2020_11_24_390039	278	33	,	,	,
10_1101-2020_11_24_390039	278	34	Hasan	Hasan	NNP
10_1101-2020_11_24_390039	278	35	,	,	,
10_1101-2020_11_24_390039	278	36	G.	G.	NNP
10_1101-2020_11_24_390039	278	37	M.	M.	NNP
10_1101-2020_11_24_390039	278	38	,	,	,
10_1101-2020_11_24_390039	278	39	and	and	CC
10_1101-2020_11_24_390039	278	40	Hassan	Hassan	NNP
10_1101-2020_11_24_390039	278	41	,	,	,
10_1101-2020_11_24_390039	278	42	M.	M.	NNP
10_1101-2020_11_24_390039	278	43	I.	I.	NNP
10_1101-2020_11_24_390039	279	1	(	(	-LRB-
10_1101-2020_11_24_390039	279	2	2020	2020	CD
10_1101-2020_11_24_390039	279	3	)	)	-RRB-
10_1101-2020_11_24_390039	279	4	Insights	insight	NNS
10_1101-2020_11_24_390039	279	5	into	into	IN
10_1101-2020_11_24_390039	279	6	SARS	SARS	NNP
10_1101-2020_11_24_390039	279	7	-	-	HYPH
10_1101-2020_11_24_390039	279	8	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	279	9	genome	genome	NN
10_1101-2020_11_24_390039	279	10	,	,	,
10_1101-2020_11_24_390039	279	11	structure	structure	NN
10_1101-2020_11_24_390039	279	12	,	,	,
10_1101-2020_11_24_390039	279	13	evolution	evolution	NN
10_1101-2020_11_24_390039	279	14	,	,	,
10_1101-2020_11_24_390039	279	15	pathogenesis	pathogenesis	NN
10_1101-2020_11_24_390039	279	16	and	and	CC
10_1101-2020_11_24_390039	279	17	therapies	therapy	NNS
10_1101-2020_11_24_390039	279	18	:	:	:
10_1101-2020_11_24_390039	279	19	structural	structural	JJ
10_1101-2020_11_24_390039	279	20	genomics	genomic	NNS
10_1101-2020_11_24_390039	279	21	approach	approach	NN
10_1101-2020_11_24_390039	279	22	.	.	.
10_1101-2020_11_24_390039	280	1	Biochim	Biochim	NNP
10_1101-2020_11_24_390039	280	2	.	.	.
10_1101-2020_11_24_390039	281	1	Biophys	Biophys	NNP
10_1101-2020_11_24_390039	281	2	.	.	.
10_1101-2020_11_24_390039	282	1	Acta	Acta	NNP
10_1101-2020_11_24_390039	282	2	.	.	.
10_1101-2020_11_24_390039	283	1	Mol	Mol	NNP
10_1101-2020_11_24_390039	283	2	.	.	.
10_1101-2020_11_24_390039	284	1	Basis	Basis	NNP
10_1101-2020_11_24_390039	284	2	Dis	Dis	NNP
10_1101-2020_11_24_390039	284	3	.	.	.
10_1101-2020_11_24_390039	285	1	1866	1866	CD
10_1101-2020_11_24_390039	285	2	,	,	,
10_1101-2020_11_24_390039	285	3	165878	165878	CD
10_1101-2020_11_24_390039	285	4	.	.	.
10_1101-2020_11_24_390039	286	1	Netland	Netland	NNP
10_1101-2020_11_24_390039	286	2	,	,	,
10_1101-2020_11_24_390039	286	3	J.	J.	NNP
10_1101-2020_11_24_390039	286	4	,	,	,
10_1101-2020_11_24_390039	286	5	Ferraro	Ferraro	NNP
10_1101-2020_11_24_390039	286	6	,	,	,
10_1101-2020_11_24_390039	286	7	D.	D.	NNP
10_1101-2020_11_24_390039	286	8	,	,	,
10_1101-2020_11_24_390039	286	9	Pewe	Pewe	NNP
10_1101-2020_11_24_390039	286	10	,	,	,
10_1101-2020_11_24_390039	286	11	L.	L.	NNP
10_1101-2020_11_24_390039	286	12	,	,	,
10_1101-2020_11_24_390039	286	13	Olivares	Olivares	NNP
10_1101-2020_11_24_390039	286	14	,	,	,
10_1101-2020_11_24_390039	286	15	H.	H.	NNP
10_1101-2020_11_24_390039	286	16	,	,	,
10_1101-2020_11_24_390039	286	17	Gallagher	Gallagher	NNP
10_1101-2020_11_24_390039	286	18	,	,	,
10_1101-2020_11_24_390039	286	19	T.	t.	NN
10_1101-2020_11_24_390039	286	20	,	,	,
10_1101-2020_11_24_390039	286	21	and	and	CC
10_1101-2020_11_24_390039	286	22	Perlman	Perlman	NNP
10_1101-2020_11_24_390039	286	23	,	,	,
10_1101-2020_11_24_390039	286	24	S.	S.	NNP
10_1101-2020_11_24_390039	286	25	(	(	-LRB-
10_1101-2020_11_24_390039	286	26	2007	2007	CD
10_1101-2020_11_24_390039	286	27	)	)	-RRB-
10_1101-2020_11_24_390039	286	28	.	.	.
10_1101-2020_11_24_390039	287	1	Enhancement	enhancement	NN
10_1101-2020_11_24_390039	287	2	of	of	IN
10_1101-2020_11_24_390039	287	3	murine	murine	NNP
10_1101-2020_11_24_390039	287	4	coronavirus	coronavirus	NNP
10_1101-2020_11_24_390039	287	5	replication	replication	NNP
10_1101-2020_11_24_390039	287	6	by	by	IN
10_1101-2020_11_24_390039	287	7	severe	severe	JJ
10_1101-2020_11_24_390039	287	8	acute	acute	JJ
10_1101-2020_11_24_390039	287	9	respiratory	respiratory	JJ
10_1101-2020_11_24_390039	287	10	syndrome	syndrome	NN
10_1101-2020_11_24_390039	287	11	coronavirus	coronavirus	NNP
10_1101-2020_11_24_390039	287	12	protein	protein	NN
10_1101-2020_11_24_390039	287	13	6	6	CD
10_1101-2020_11_24_390039	287	14	requires	require	VBZ
10_1101-2020_11_24_390039	287	15	the	the	DT
10_1101-2020_11_24_390039	287	16	N	n	JJ
10_1101-2020_11_24_390039	287	17	-	-	HYPH
10_1101-2020_11_24_390039	287	18	terminal	terminal	JJ
10_1101-2020_11_24_390039	287	19	hydrophobic	hydrophobic	NN
10_1101-2020_11_24_390039	287	20	region	region	NN
10_1101-2020_11_24_390039	287	21	but	but	CC
10_1101-2020_11_24_390039	287	22	not	not	RB
10_1101-2020_11_24_390039	287	23	C	c	NN
10_1101-2020_11_24_390039	287	24	-	-	HYPH
10_1101-2020_11_24_390039	287	25	terminal	terminal	JJ
10_1101-2020_11_24_390039	287	26	sorting	sort	VBG
10_1101-2020_11_24_390039	287	27	motifs	motif	NNS
10_1101-2020_11_24_390039	287	28	.	.	.
10_1101-2020_11_24_390039	288	1	J.	J.	NNP
10_1101-2020_11_24_390039	288	2	Virol	Virol	NNP
10_1101-2020_11_24_390039	288	3	.	.	.
10_1101-2020_11_24_390039	289	1	81	81	CD
10_1101-2020_11_24_390039	289	2	,	,	,
10_1101-2020_11_24_390039	289	3	11520	11520	CD
10_1101-2020_11_24_390039	289	4	-	-	SYM
10_1101-2020_11_24_390039	289	5	11525	11525	CD
10_1101-2020_11_24_390039	289	6	.	.	.
10_1101-2020_11_24_390039	290	1	Nilsson	Nilsson	NNP
10_1101-2020_11_24_390039	290	2	,	,	,
10_1101-2020_11_24_390039	290	3	I.	I.	NNP
10_1101-2020_11_24_390039	290	4	M.	M.	NNP
10_1101-2020_11_24_390039	290	5	,	,	,
10_1101-2020_11_24_390039	290	6	and	and	CC
10_1101-2020_11_24_390039	290	7	von	von	NNP
10_1101-2020_11_24_390039	290	8	Heijne	Heijne	NNP
10_1101-2020_11_24_390039	290	9	,	,	,
10_1101-2020_11_24_390039	290	10	G.	G.	NNP
10_1101-2020_11_24_390039	290	11	(	(	-LRB-
10_1101-2020_11_24_390039	290	12	1993	1993	CD
10_1101-2020_11_24_390039	290	13	)	)	-RRB-
10_1101-2020_11_24_390039	290	14	.	.	.
10_1101-2020_11_24_390039	291	1	Determination	determination	NN
10_1101-2020_11_24_390039	291	2	of	of	IN
10_1101-2020_11_24_390039	291	3	the	the	DT
10_1101-2020_11_24_390039	291	4	distance	distance	NN
10_1101-2020_11_24_390039	291	5	between	between	IN
10_1101-2020_11_24_390039	291	6	the	the	DT
10_1101-2020_11_24_390039	291	7	oligosaccharyltransferase	oligosaccharyltransferase	JJ
10_1101-2020_11_24_390039	291	8	active	active	JJ
10_1101-2020_11_24_390039	291	9	site	site	NN
10_1101-2020_11_24_390039	291	10	and	and	CC
10_1101-2020_11_24_390039	291	11	the	the	DT
10_1101-2020_11_24_390039	291	12	endoplasmic	endoplasmic	JJ
10_1101-2020_11_24_390039	291	13	reticulum	reticulum	NN
10_1101-2020_11_24_390039	291	14	membrane	membrane	NN
10_1101-2020_11_24_390039	291	15	.	.	.
10_1101-2020_11_24_390039	292	1	J.	J.	NNP
10_1101-2020_11_24_390039	292	2	Biol	Biol	NNP
10_1101-2020_11_24_390039	292	3	.	.	.
10_1101-2020_11_24_390039	293	1	Chem	Chem	NNP
10_1101-2020_11_24_390039	293	2	.	.	.
10_1101-2020_11_24_390039	294	1	268	268	CD
10_1101-2020_11_24_390039	294	2	,	,	,
10_1101-2020_11_24_390039	294	3	5798	5798	CD
10_1101-2020_11_24_390039	294	4	-	-	SYM
10_1101-2020_11_24_390039	294	5	5801	5801	CD
10_1101-2020_11_24_390039	294	6	.	.	.
10_1101-2020_11_24_390039	295	1	Ray	Ray	NNP
10_1101-2020_11_24_390039	295	2	-	-	HYPH
10_1101-2020_11_24_390039	295	3	Sinha	Sinha	NNP
10_1101-2020_11_24_390039	295	4	,	,	,
10_1101-2020_11_24_390039	295	5	A.	A.	NNP
10_1101-2020_11_24_390039	295	6	,	,	,
10_1101-2020_11_24_390039	295	7	Cross	Cross	NNP
10_1101-2020_11_24_390039	295	8	,	,	,
10_1101-2020_11_24_390039	295	9	B.	B.	NNP
10_1101-2020_11_24_390039	295	10	C.	C.	NNP
10_1101-2020_11_24_390039	295	11	S.	S.	NNP
10_1101-2020_11_24_390039	295	12	,	,	,
10_1101-2020_11_24_390039	295	13	Mironov	Mironov	NNP
10_1101-2020_11_24_390039	295	14	,	,	,
10_1101-2020_11_24_390039	295	15	A.	A.	NNP
10_1101-2020_11_24_390039	295	16	,	,	,
10_1101-2020_11_24_390039	295	17	Wiertz	Wiertz	NNP
10_1101-2020_11_24_390039	295	18	,	,	,
10_1101-2020_11_24_390039	295	19	E.	E.	NNP
10_1101-2020_11_24_390039	295	20	,	,	,
10_1101-2020_11_24_390039	295	21	and	and	CC
10_1101-2020_11_24_390039	295	22	High	High	NNP
10_1101-2020_11_24_390039	295	23	,	,	,
10_1101-2020_11_24_390039	295	24	S.	S.	NNP
10_1101-2020_11_24_390039	295	25	(	(	-LRB-
10_1101-2020_11_24_390039	295	26	2009	2009	CD
10_1101-2020_11_24_390039	295	27	)	)	-RRB-
10_1101-2020_11_24_390039	295	28	.	.	.
10_1101-2020_11_24_390039	296	1	Endoplasmic	endoplasmic	JJ
10_1101-2020_11_24_390039	296	2	reticulum	reticulum	NN
10_1101-2020_11_24_390039	296	3	-	-	HYPH
10_1101-2020_11_24_390039	296	4	associated	associate	VBN
10_1101-2020_11_24_390039	296	5	degradation	degradation	NN
10_1101-2020_11_24_390039	296	6	of	of	IN
10_1101-2020_11_24_390039	296	7	a	a	DT
10_1101-2020_11_24_390039	296	8	degron	degron	NN
10_1101-2020_11_24_390039	296	9	-	-	HYPH
10_1101-2020_11_24_390039	296	10	containing	contain	VBG
10_1101-2020_11_24_390039	296	11	polytopic	polytopic	JJ
10_1101-2020_11_24_390039	296	12	membrane	membrane	NN
10_1101-2020_11_24_390039	296	13	protein	protein	NN
10_1101-2020_11_24_390039	296	14	.	.	.
10_1101-2020_11_24_390039	297	1	Mol	Mol	NNP
10_1101-2020_11_24_390039	297	2	.	.	.
10_1101-2020_11_24_390039	298	1	Membr	Membr	NNP
10_1101-2020_11_24_390039	298	2	.	.	.
10_1101-2020_11_24_390039	299	1	Biol	Biol	NNP
10_1101-2020_11_24_390039	299	2	.	.	.
10_1101-2020_11_24_390039	300	1	26	26	CD
10_1101-2020_11_24_390039	300	2	,	,	,
10_1101-2020_11_24_390039	300	3	448	448	CD
10_1101-2020_11_24_390039	300	4	-	-	SYM
10_1101-2020_11_24_390039	300	5	464	464	CD
10_1101-2020_11_24_390039	300	6	.	.	.
10_1101-2020_11_24_390039	301	1	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	301	2	,	,	,
10_1101-2020_11_24_390039	301	3	S.	S.	NNP
10_1101-2020_11_24_390039	301	4	,	,	,
10_1101-2020_11_24_390039	301	5	Zong	Zong	NNP
10_1101-2020_11_24_390039	301	6	,	,	,
10_1101-2020_11_24_390039	301	7	G.	G.	NNP
10_1101-2020_11_24_390039	301	8	,	,	,
10_1101-2020_11_24_390039	301	9	Duah	Duah	NNP
10_1101-2020_11_24_390039	301	10	,	,	,
10_1101-2020_11_24_390039	301	11	K.	K.	NNP
10_1101-2020_11_24_390039	301	12	B.	B.	NNP
10_1101-2020_11_24_390039	301	13	,	,	,
10_1101-2020_11_24_390039	301	14	Andrews	Andrews	NNP
10_1101-2020_11_24_390039	301	15	,	,	,
10_1101-2020_11_24_390039	301	16	L.	L.	NNP
10_1101-2020_11_24_390039	301	17	E.	E.	NNP
10_1101-2020_11_24_390039	301	18	,	,	,
10_1101-2020_11_24_390039	301	19	Shi	Shi	NNP
10_1101-2020_11_24_390039	301	20	,	,	,
10_1101-2020_11_24_390039	301	21	W.	W.	NNP
10_1101-2020_11_24_390039	301	22	Q.	Q.	NNP
10_1101-2020_11_24_390039	301	23	,	,	,
10_1101-2020_11_24_390039	301	24	and	and	CC
10_1101-2020_11_24_390039	301	25	High	High	NNP
10_1101-2020_11_24_390039	301	26	,	,	,
10_1101-2020_11_24_390039	301	27	S.	S.	NNP
10_1101-2020_11_24_390039	301	28	(	(	-LRB-
10_1101-2020_11_24_390039	301	29	2020	2020	CD
10_1101-2020_11_24_390039	301	30	)	)	-RRB-
10_1101-2020_11_24_390039	301	31	.	.	.
10_1101-2020_11_24_390039	302	1	Type	type	NN
10_1101-2020_11_24_390039	302	2	III	III	NNP
10_1101-2020_11_24_390039	302	3	transmembrane	transmembrane	JJ
10_1101-2020_11_24_390039	302	4	protein	protein	NN
10_1101-2020_11_24_390039	302	5	integration	integration	NN
10_1101-2020_11_24_390039	302	6	requires	require	VBZ
10_1101-2020_11_24_390039	302	7	both	both	CC
10_1101-2020_11_24_390039	302	8	the	the	DT
10_1101-2020_11_24_390039	302	9	EMC	EMC	NNP
10_1101-2020_11_24_390039	302	10	and	and	CC
10_1101-2020_11_24_390039	302	11	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	302	12	complex	complex	JJ
10_1101-2020_11_24_390039	302	13	.	.	.
10_1101-2020_11_24_390039	303	1	Submitted	submit	VBN
10_1101-2020_11_24_390039	303	2	.	.	.
10_1101-2020_11_24_390039	304	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	304	2	-	-	:
10_1101-2020_11_24_390039	304	3	BY	by	IN
10_1101-2020_11_24_390039	304	4	-	-	HYPH
10_1101-2020_11_24_390039	304	5	ND	ND	NNP
10_1101-2020_11_24_390039	304	6	4.0	4.0	CD
10_1101-2020_11_24_390039	304	7	International	international	JJ
10_1101-2020_11_24_390039	304	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	304	9	available	available	JJ
10_1101-2020_11_24_390039	304	10	under	under	IN
10_1101-2020_11_24_390039	304	11	a	a	DT
10_1101-2020_11_24_390039	304	12	(	(	-LRB-
10_1101-2020_11_24_390039	304	13	which	which	WDT
10_1101-2020_11_24_390039	304	14	was	be	VBD
10_1101-2020_11_24_390039	304	15	not	not	RB
10_1101-2020_11_24_390039	304	16	certified	certify	VBN
10_1101-2020_11_24_390039	304	17	by	by	IN
10_1101-2020_11_24_390039	304	18	peer	peer	NN
10_1101-2020_11_24_390039	304	19	review	review	NN
10_1101-2020_11_24_390039	304	20	)	)	-RRB-
10_1101-2020_11_24_390039	304	21	is	be	VBZ
10_1101-2020_11_24_390039	304	22	the	the	DT
10_1101-2020_11_24_390039	304	23	author	author	NN
10_1101-2020_11_24_390039	304	24	/	/	SYM
10_1101-2020_11_24_390039	304	25	funder	funder	NN
10_1101-2020_11_24_390039	304	26	,	,	,
10_1101-2020_11_24_390039	304	27	who	who	WP
10_1101-2020_11_24_390039	304	28	has	have	VBZ
10_1101-2020_11_24_390039	304	29	granted	grant	VBN
10_1101-2020_11_24_390039	304	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	304	31	a	a	DT
10_1101-2020_11_24_390039	304	32	license	license	NN
10_1101-2020_11_24_390039	304	33	to	to	TO
10_1101-2020_11_24_390039	304	34	display	display	VB
10_1101-2020_11_24_390039	304	35	the	the	DT
10_1101-2020_11_24_390039	304	36	preprint	preprint	NN
10_1101-2020_11_24_390039	304	37	in	in	IN
10_1101-2020_11_24_390039	304	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	304	39	.	.	.
10_1101-2020_11_24_390039	305	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	305	2	is	be	VBZ
10_1101-2020_11_24_390039	305	3	The	the	DT
10_1101-2020_11_24_390039	305	4	copyright	copyright	NN
10_1101-2020_11_24_390039	305	5	holder	holder	NN
10_1101-2020_11_24_390039	305	6	for	for	IN
10_1101-2020_11_24_390039	305	7	this	this	DT
10_1101-2020_11_24_390039	305	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	305	9	version	version	NN
10_1101-2020_11_24_390039	305	10	posted	post	VBD
10_1101-2020_11_24_390039	305	11	January	January	NNP
10_1101-2020_11_24_390039	305	12	5	5	CD
10_1101-2020_11_24_390039	305	13	,	,	,
10_1101-2020_11_24_390039	305	14	2021	2021	CD
10_1101-2020_11_24_390039	305	15	.	.	.
10_1101-2020_11_24_390039	305	16	;	;	:
10_1101-2020_11_24_390039	305	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	305	18	:	:	:
10_1101-2020_11_24_390039	305	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	305	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	305	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	305	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	305	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	305	24	-	-	HYPH
10_1101-2020_11_24_390039	305	25	F	F	NNP
10_1101-2020_11_24_390039	305	26	as	as	IN
10_1101-2020_11_24_390039	305	27	a	a	DT
10_1101-2020_11_24_390039	305	28	potential	potential	JJ
10_1101-2020_11_24_390039	305	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	305	30	agent	agent	NN
10_1101-2020_11_24_390039	305	31	Page	Page	NNP
10_1101-2020_11_24_390039	305	32	18	18	CD
10_1101-2020_11_24_390039	305	33	of	of	IN
10_1101-2020_11_24_390039	305	34	21	21	CD
10_1101-2020_11_24_390039	305	35	Sicari	Sicari	NNP
10_1101-2020_11_24_390039	305	36	,	,	,
10_1101-2020_11_24_390039	305	37	D.	D.	NNP
10_1101-2020_11_24_390039	305	38	,	,	,
10_1101-2020_11_24_390039	305	39	Chatziioannou	Chatziioannou	NNP
10_1101-2020_11_24_390039	305	40	,	,	,
10_1101-2020_11_24_390039	305	41	A.	a.	NN
10_1101-2020_11_24_390039	305	42	,	,	,
10_1101-2020_11_24_390039	305	43	Koutsandreas	Koutsandreas	NNP
10_1101-2020_11_24_390039	305	44	,	,	,
10_1101-2020_11_24_390039	305	45	T.	T.	NNP
10_1101-2020_11_24_390039	305	46	,	,	,
10_1101-2020_11_24_390039	305	47	Sitia	Sitia	NNP
10_1101-2020_11_24_390039	305	48	,	,	,
10_1101-2020_11_24_390039	305	49	R.	R.	NNP
10_1101-2020_11_24_390039	305	50	,	,	,
10_1101-2020_11_24_390039	305	51	and	and	CC
10_1101-2020_11_24_390039	305	52	Chevet	Chevet	NNP
10_1101-2020_11_24_390039	305	53	,	,	,
10_1101-2020_11_24_390039	305	54	E.	E.	NNP
10_1101-2020_11_24_390039	305	55	(	(	-LRB-
10_1101-2020_11_24_390039	305	56	2020	2020	CD
10_1101-2020_11_24_390039	305	57	)	)	-RRB-
10_1101-2020_11_24_390039	305	58	.	.	.
10_1101-2020_11_24_390039	306	1	Role	role	NN
10_1101-2020_11_24_390039	306	2	of	of	IN
10_1101-2020_11_24_390039	306	3	the	the	DT
10_1101-2020_11_24_390039	306	4	early	early	JJ
10_1101-2020_11_24_390039	306	5	secretory	secretory	JJ
10_1101-2020_11_24_390039	306	6	pathway	pathway	NN
10_1101-2020_11_24_390039	306	7	in	in	IN
10_1101-2020_11_24_390039	306	8	SARS	SARS	NNP
10_1101-2020_11_24_390039	306	9	-	-	HYPH
10_1101-2020_11_24_390039	306	10	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	306	11	infection	infection	NN
10_1101-2020_11_24_390039	306	12	.	.	.
10_1101-2020_11_24_390039	307	1	J.	J.	NNP
10_1101-2020_11_24_390039	308	1	Cell	cell	NN
10_1101-2020_11_24_390039	308	2	.	.	.
10_1101-2020_11_24_390039	309	1	Biol	Biol	NNP
10_1101-2020_11_24_390039	309	2	.	.	.
10_1101-2020_11_24_390039	310	1	219	219	CD
10_1101-2020_11_24_390039	310	2	,	,	,
10_1101-2020_11_24_390039	310	3	e202006005	e202006005	NNP
10_1101-2020_11_24_390039	310	4	.	.	.
10_1101-2020_11_24_390039	311	1	Shah	Shah	NNP
10_1101-2020_11_24_390039	311	2	,	,	,
10_1101-2020_11_24_390039	311	3	P.	P.	NNP
10_1101-2020_11_24_390039	311	4	S.	S.	NNP
10_1101-2020_11_24_390039	311	5	,	,	,
10_1101-2020_11_24_390039	311	6	Link	Link	NNP
10_1101-2020_11_24_390039	311	7	,	,	,
10_1101-2020_11_24_390039	311	8	N.	N.	NNP
10_1101-2020_11_24_390039	311	9	,	,	,
10_1101-2020_11_24_390039	311	10	Jang	Jang	NNP
10_1101-2020_11_24_390039	311	11	,	,	,
10_1101-2020_11_24_390039	311	12	G.	G.	NNP
10_1101-2020_11_24_390039	311	13	M.	M.	NNP
10_1101-2020_11_24_390039	311	14	,	,	,
10_1101-2020_11_24_390039	311	15	Sharp	Sharp	NNP
10_1101-2020_11_24_390039	311	16	,	,	,
10_1101-2020_11_24_390039	311	17	P.	P.	NNP
10_1101-2020_11_24_390039	311	18	P.	P.	NNP
10_1101-2020_11_24_390039	311	19	,	,	,
10_1101-2020_11_24_390039	311	20	Zhu	Zhu	NNP
10_1101-2020_11_24_390039	311	21	,	,	,
10_1101-2020_11_24_390039	311	22	T.	T.	NNP
10_1101-2020_11_24_390039	311	23	,	,	,
10_1101-2020_11_24_390039	311	24	Swaney	Swaney	NNP
10_1101-2020_11_24_390039	311	25	,	,	,
10_1101-2020_11_24_390039	311	26	D.	D.	NNP
10_1101-2020_11_24_390039	311	27	L.	L.	NNP
10_1101-2020_11_24_390039	311	28	,	,	,
10_1101-2020_11_24_390039	311	29	Johnson	Johnson	NNP
10_1101-2020_11_24_390039	311	30	,	,	,
10_1101-2020_11_24_390039	311	31	J.	J.	NNP
10_1101-2020_11_24_390039	311	32	R.	R.	NNP
10_1101-2020_11_24_390039	311	33	,	,	,
10_1101-2020_11_24_390039	311	34	Von	Von	NNP
10_1101-2020_11_24_390039	311	35	Dollen	Dollen	NNP
10_1101-2020_11_24_390039	311	36	,	,	,
10_1101-2020_11_24_390039	311	37	J.	J.	NNP
10_1101-2020_11_24_390039	311	38	,	,	,
10_1101-2020_11_24_390039	311	39	Ramage	Ramage	NNP
10_1101-2020_11_24_390039	311	40	,	,	,
10_1101-2020_11_24_390039	311	41	H.	H.	NNP
10_1101-2020_11_24_390039	311	42	R.	R.	NNP
10_1101-2020_11_24_390039	311	43	,	,	,
10_1101-2020_11_24_390039	311	44	Satkamp	Satkamp	NNP
10_1101-2020_11_24_390039	311	45	,	,	,
10_1101-2020_11_24_390039	311	46	L.	L.	NNP
10_1101-2020_11_24_390039	311	47	et	et	NNP
10_1101-2020_11_24_390039	311	48	al	al	NNP
10_1101-2020_11_24_390039	311	49	.	.	.
10_1101-2020_11_24_390039	312	1	(	(	-LRB-
10_1101-2020_11_24_390039	312	2	2018	2018	CD
10_1101-2020_11_24_390039	312	3	)	)	-RRB-
10_1101-2020_11_24_390039	312	4	.	.	.
10_1101-2020_11_24_390039	313	1	Comparative	comparative	JJ
10_1101-2020_11_24_390039	313	2	flavivirus	flavivirus	JJ
10_1101-2020_11_24_390039	313	3	-	-	HYPH
10_1101-2020_11_24_390039	313	4	host	host	NN
10_1101-2020_11_24_390039	313	5	protein	protein	NN
10_1101-2020_11_24_390039	313	6	interaction	interaction	NN
10_1101-2020_11_24_390039	313	7	mapping	mapping	NN
10_1101-2020_11_24_390039	313	8	reveals	reveal	VBZ
10_1101-2020_11_24_390039	313	9	mechanisms	mechanism	NNS
10_1101-2020_11_24_390039	313	10	of	of	IN
10_1101-2020_11_24_390039	313	11	Dengue	Dengue	NNP
10_1101-2020_11_24_390039	313	12	and	and	CC
10_1101-2020_11_24_390039	313	13	Zika	Zika	NNP
10_1101-2020_11_24_390039	313	14	virus	virus	NN
10_1101-2020_11_24_390039	313	15	pathogenesis	pathogenesis	NN
10_1101-2020_11_24_390039	313	16	.	.	.
10_1101-2020_11_24_390039	314	1	Cell	cell	NN
10_1101-2020_11_24_390039	314	2	.	.	.
10_1101-2020_11_24_390039	315	1	175	175	CD
10_1101-2020_11_24_390039	315	2	,	,	,
10_1101-2020_11_24_390039	315	3	1931	1931	CD
10_1101-2020_11_24_390039	315	4	-	-	SYM
10_1101-2020_11_24_390039	315	5	1945.e18	1945.e18	CD
10_1101-2020_11_24_390039	315	6	.	.	.
10_1101-2020_11_24_390039	316	1	Von	Von	NNP
10_1101-2020_11_24_390039	316	2	Heijne	Heijne	NNP
10_1101-2020_11_24_390039	316	3	,	,	,
10_1101-2020_11_24_390039	316	4	G.	G.	NNP
10_1101-2020_11_24_390039	316	5	(	(	-LRB-
10_1101-2020_11_24_390039	316	6	2007	2007	CD
10_1101-2020_11_24_390039	316	7	)	)	-RRB-
10_1101-2020_11_24_390039	316	8	.	.	.
10_1101-2020_11_24_390039	317	1	The	the	DT
10_1101-2020_11_24_390039	317	2	membrane	membrane	NN
10_1101-2020_11_24_390039	317	3	protein	protein	NN
10_1101-2020_11_24_390039	317	4	universe	universe	NN
10_1101-2020_11_24_390039	317	5	:	:	:
10_1101-2020_11_24_390039	317	6	what	what	WP
10_1101-2020_11_24_390039	317	7	’s	’	VBZ
10_1101-2020_11_24_390039	317	8	out	out	RB
10_1101-2020_11_24_390039	317	9	there	there	RB
10_1101-2020_11_24_390039	317	10	and	and	CC
10_1101-2020_11_24_390039	317	11	why	why	WRB
10_1101-2020_11_24_390039	317	12	bother	bother	VB
10_1101-2020_11_24_390039	317	13	?	?	.
10_1101-2020_11_24_390039	318	1	J.	J.	NNP
10_1101-2020_11_24_390039	318	2	Intern	Intern	NNP
10_1101-2020_11_24_390039	318	3	.	.	.
10_1101-2020_11_24_390039	319	1	Med	Med	NNP
10_1101-2020_11_24_390039	319	2	.	.	.
10_1101-2020_11_24_390039	320	1	261	261	CD
10_1101-2020_11_24_390039	320	2	,	,	,
10_1101-2020_11_24_390039	320	3	543	543	CD
10_1101-2020_11_24_390039	320	4	-	-	SYM
10_1101-2020_11_24_390039	320	5	547	547	CD
10_1101-2020_11_24_390039	320	6	.	.	.
10_1101-2020_11_24_390039	321	1	Walls	wall	NNS
10_1101-2020_11_24_390039	321	2	,	,	,
10_1101-2020_11_24_390039	321	3	A.	a.	NN
10_1101-2020_11_24_390039	321	4	C.	C.	NNP
10_1101-2020_11_24_390039	321	5	,	,	,
10_1101-2020_11_24_390039	321	6	Park	Park	NNP
10_1101-2020_11_24_390039	321	7	,	,	,
10_1101-2020_11_24_390039	321	8	Y.-J.	Y.-J.	NNP
10_1101-2020_11_24_390039	321	9	,	,	,
10_1101-2020_11_24_390039	321	10	Tortorici	Tortorici	NNP
10_1101-2020_11_24_390039	321	11	,	,	,
10_1101-2020_11_24_390039	321	12	M.	M.	NNP
10_1101-2020_11_24_390039	321	13	A.	A.	NNP
10_1101-2020_11_24_390039	321	14	,	,	,
10_1101-2020_11_24_390039	321	15	Wall	Wall	NNP
10_1101-2020_11_24_390039	321	16	,	,	,
10_1101-2020_11_24_390039	321	17	A.	A.	NNP
10_1101-2020_11_24_390039	321	18	,	,	,
10_1101-2020_11_24_390039	321	19	McGuire	McGuire	NNP
10_1101-2020_11_24_390039	321	20	,	,	,
10_1101-2020_11_24_390039	321	21	A.	a.	NN
10_1101-2020_11_24_390039	321	22	T.	t.	NN
10_1101-2020_11_24_390039	321	23	,	,	,
10_1101-2020_11_24_390039	321	24	and	and	CC
10_1101-2020_11_24_390039	321	25	Veesler	Veesler	NNP
10_1101-2020_11_24_390039	321	26	,	,	,
10_1101-2020_11_24_390039	321	27	D.	D.	NNP
10_1101-2020_11_24_390039	321	28	(	(	-LRB-
10_1101-2020_11_24_390039	321	29	2020	2020	CD
10_1101-2020_11_24_390039	321	30	)	)	-RRB-
10_1101-2020_11_24_390039	321	31	.	.	.
10_1101-2020_11_24_390039	322	1	Structure	structure	NN
10_1101-2020_11_24_390039	322	2	,	,	,
10_1101-2020_11_24_390039	322	3	function	function	NN
10_1101-2020_11_24_390039	322	4	and	and	CC
10_1101-2020_11_24_390039	322	5	antigenicity	antigenicity	NN
10_1101-2020_11_24_390039	322	6	of	of	IN
10_1101-2020_11_24_390039	322	7	the	the	DT
10_1101-2020_11_24_390039	322	8	SARS	SARS	NNP
10_1101-2020_11_24_390039	322	9	-	-	HYPH
10_1101-2020_11_24_390039	322	10	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	322	11	spike	spike	NNP
10_1101-2020_11_24_390039	322	12	glycoprotein	glycoprotein	NNP
10_1101-2020_11_24_390039	322	13	.	.	.
10_1101-2020_11_24_390039	323	1	Cell	cell	NN
10_1101-2020_11_24_390039	323	2	.	.	.
10_1101-2020_11_24_390039	324	1	181	181	CD
10_1101-2020_11_24_390039	324	2	,	,	,
10_1101-2020_11_24_390039	324	3	P281	P281	NNP
10_1101-2020_11_24_390039	324	4	-	-	HYPH
10_1101-2020_11_24_390039	324	5	292.E6	292.E6	NNP
10_1101-2020_11_24_390039	324	6	.	.	.
10_1101-2020_11_24_390039	325	1	Warner	Warner	NNP
10_1101-2020_11_24_390039	325	2	,	,	,
10_1101-2020_11_24_390039	325	3	F.	F.	NNP
10_1101-2020_11_24_390039	325	4	J.	J.	NNP
10_1101-2020_11_24_390039	325	5	,	,	,
10_1101-2020_11_24_390039	325	6	Lew	Lew	NNP
10_1101-2020_11_24_390039	325	7	,	,	,
10_1101-2020_11_24_390039	325	8	R.	R.	NNP
10_1101-2020_11_24_390039	325	9	A.	A.	NNP
10_1101-2020_11_24_390039	325	10	,	,	,
10_1101-2020_11_24_390039	325	11	Smith	Smith	NNP
10_1101-2020_11_24_390039	325	12	,	,	,
10_1101-2020_11_24_390039	325	13	A.	a.	NN
10_1101-2020_11_24_390039	325	14	I.	I.	NNP
10_1101-2020_11_24_390039	325	15	,	,	,
10_1101-2020_11_24_390039	325	16	Lambert	Lambert	NNP
10_1101-2020_11_24_390039	325	17	,	,	,
10_1101-2020_11_24_390039	325	18	D.	D.	NNP
10_1101-2020_11_24_390039	325	19	W.	W.	NNP
10_1101-2020_11_24_390039	325	20	,	,	,
10_1101-2020_11_24_390039	325	21	Hooper	Hooper	NNP
10_1101-2020_11_24_390039	325	22	,	,	,
10_1101-2020_11_24_390039	325	23	N.	N.	NNP
10_1101-2020_11_24_390039	325	24	M.	M.	NNP
10_1101-2020_11_24_390039	325	25	,	,	,
10_1101-2020_11_24_390039	325	26	and	and	CC
10_1101-2020_11_24_390039	325	27	Turner	Turner	NNP
10_1101-2020_11_24_390039	325	28	,	,	,
10_1101-2020_11_24_390039	325	29	A.	a.	NN
10_1101-2020_11_24_390039	325	30	T.	t.	NN
10_1101-2020_11_24_390039	325	31	(	(	-LRB-
10_1101-2020_11_24_390039	325	32	2005	2005	CD
10_1101-2020_11_24_390039	325	33	)	)	-RRB-
10_1101-2020_11_24_390039	325	34	.	.	.
10_1101-2020_11_24_390039	326	1	Angiotensin	Angiotensin	NNP
10_1101-2020_11_24_390039	326	2	-	-	HYPH
10_1101-2020_11_24_390039	326	3	converting	convert	VBG
10_1101-2020_11_24_390039	326	4	enzyme	enzyme	NNS
10_1101-2020_11_24_390039	326	5	2	2	CD
10_1101-2020_11_24_390039	326	6	(	(	-LRB-
10_1101-2020_11_24_390039	326	7	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	326	8	)	)	-RRB-
10_1101-2020_11_24_390039	326	9	,	,	,
10_1101-2020_11_24_390039	326	10	but	but	CC
10_1101-2020_11_24_390039	326	11	not	not	RB
10_1101-2020_11_24_390039	326	12	ACE	ACE	NNP
10_1101-2020_11_24_390039	326	13	,	,	,
10_1101-2020_11_24_390039	326	14	is	be	VBZ
10_1101-2020_11_24_390039	326	15	preferentially	preferentially	RB
10_1101-2020_11_24_390039	326	16	localised	localise	VBN
10_1101-2020_11_24_390039	326	17	to	to	IN
10_1101-2020_11_24_390039	326	18	the	the	DT
10_1101-2020_11_24_390039	326	19	apical	apical	JJ
10_1101-2020_11_24_390039	326	20	surface	surface	NN
10_1101-2020_11_24_390039	326	21	of	of	IN
10_1101-2020_11_24_390039	326	22	polarised	polarise	VBN
10_1101-2020_11_24_390039	326	23	kidney	kidney	NN
10_1101-2020_11_24_390039	326	24	cells	cell	NNS
10_1101-2020_11_24_390039	326	25	.	.	.
10_1101-2020_11_24_390039	327	1	J.	J.	NNP
10_1101-2020_11_24_390039	327	2	Biol	Biol	NNP
10_1101-2020_11_24_390039	327	3	.	.	.
10_1101-2020_11_24_390039	328	1	Chem	Chem	NNP
10_1101-2020_11_24_390039	328	2	.	.	.
10_1101-2020_11_24_390039	329	1	280	280	CD
10_1101-2020_11_24_390039	329	2	,	,	,
10_1101-2020_11_24_390039	329	3	39353	39353	CD
10_1101-2020_11_24_390039	329	4	-	-	SYM
10_1101-2020_11_24_390039	329	5	39362	39362	CD
10_1101-2020_11_24_390039	329	6	.	.	.
10_1101-2020_11_24_390039	330	1	Wilson	Wilson	NNP
10_1101-2020_11_24_390039	330	2	,	,	,
10_1101-2020_11_24_390039	330	3	C.	C.	NNP
10_1101-2020_11_24_390039	330	4	M.	M.	NNP
10_1101-2020_11_24_390039	330	5	,	,	,
10_1101-2020_11_24_390039	330	6	and	and	CC
10_1101-2020_11_24_390039	330	7	High	High	NNP
10_1101-2020_11_24_390039	330	8	,	,	,
10_1101-2020_11_24_390039	330	9	S.	S.	NNP
10_1101-2020_11_24_390039	330	10	(	(	-LRB-
10_1101-2020_11_24_390039	330	11	2007	2007	CD
10_1101-2020_11_24_390039	330	12	)	)	-RRB-
10_1101-2020_11_24_390039	330	13	.	.	.
10_1101-2020_11_24_390039	331	1	Ribophorin	Ribophorin	NNP
10_1101-2020_11_24_390039	331	2	I	-PRON-	PRP
10_1101-2020_11_24_390039	331	3	acts	act	VBZ
10_1101-2020_11_24_390039	331	4	as	as	IN
10_1101-2020_11_24_390039	331	5	a	a	DT
10_1101-2020_11_24_390039	331	6	substrate	substrate	NN
10_1101-2020_11_24_390039	331	7	-	-	HYPH
10_1101-2020_11_24_390039	331	8	specific	specific	JJ
10_1101-2020_11_24_390039	331	9	facilitator	facilitator	NN
10_1101-2020_11_24_390039	331	10	of	of	IN
10_1101-2020_11_24_390039	331	11	N	n	NN
10_1101-2020_11_24_390039	331	12	-	-	HYPH
10_1101-2020_11_24_390039	331	13	glycosylation	glycosylation	NN
10_1101-2020_11_24_390039	331	14	.	.	.
10_1101-2020_11_24_390039	332	1	J.	J.	NNP
10_1101-2020_11_24_390039	333	1	Cell	cell	NN
10_1101-2020_11_24_390039	333	2	.	.	.
10_1101-2020_11_24_390039	334	1	Sci	Sci	NNP
10_1101-2020_11_24_390039	334	2	.	.	.
10_1101-2020_11_24_390039	335	1	120	120	CD
10_1101-2020_11_24_390039	335	2	,	,	,
10_1101-2020_11_24_390039	335	3	648	648	CD
10_1101-2020_11_24_390039	335	4	-	-	SYM
10_1101-2020_11_24_390039	335	5	657	657	CD
10_1101-2020_11_24_390039	335	6	.	.	.
10_1101-2020_11_24_390039	336	1	Young	Young	NNP
10_1101-2020_11_24_390039	336	2	,	,	,
10_1101-2020_11_24_390039	336	3	B.	B.	NNP
10_1101-2020_11_24_390039	336	4	E.	E.	NNP
10_1101-2020_11_24_390039	336	5	,	,	,
10_1101-2020_11_24_390039	336	6	Fong	Fong	NNP
10_1101-2020_11_24_390039	336	7	,	,	,
10_1101-2020_11_24_390039	336	8	S.-W.	S.-W.	NNP
10_1101-2020_11_24_390039	336	9	,	,	,
10_1101-2020_11_24_390039	336	10	Chan	Chan	NNP
10_1101-2020_11_24_390039	336	11	,	,	,
10_1101-2020_11_24_390039	336	12	Y.	Y.	NNP
10_1101-2020_11_24_390039	336	13	H.	H.	NNP
10_1101-2020_11_24_390039	336	14	,	,	,
10_1101-2020_11_24_390039	336	15	Mak	Mak	NNP
10_1101-2020_11_24_390039	336	16	,	,	,
10_1101-2020_11_24_390039	336	17	T.-M.	T.-M.	NNP
10_1101-2020_11_24_390039	336	18	,	,	,
10_1101-2020_11_24_390039	336	19	Ang	Ang	NNP
10_1101-2020_11_24_390039	336	20	,	,	,
10_1101-2020_11_24_390039	336	21	L.	L.	NNP
10_1101-2020_11_24_390039	336	22	W.	W.	NNP
10_1101-2020_11_24_390039	336	23	,	,	,
10_1101-2020_11_24_390039	336	24	Anderson	Anderson	NNP
10_1101-2020_11_24_390039	336	25	,	,	,
10_1101-2020_11_24_390039	336	26	D.	D.	NNP
10_1101-2020_11_24_390039	336	27	E.	E.	NNP
10_1101-2020_11_24_390039	336	28	,	,	,
10_1101-2020_11_24_390039	336	29	Yi	Yi	NNP
10_1101-2020_11_24_390039	336	30	-	-	HYPH
10_1101-2020_11_24_390039	336	31	Pin	Pin	NNP
10_1101-2020_11_24_390039	336	32	Lee	Lee	NNP
10_1101-2020_11_24_390039	336	33	,	,	,
10_1101-2020_11_24_390039	336	34	C.	C.	NNP
10_1101-2020_11_24_390039	336	35	,	,	,
10_1101-2020_11_24_390039	336	36	Naqiah	Naqiah	NNP
10_1101-2020_11_24_390039	336	37	Amrun	Amrun	NNP
10_1101-2020_11_24_390039	336	38	,	,	,
10_1101-2020_11_24_390039	336	39	S.	S.	NNP
10_1101-2020_11_24_390039	336	40	,	,	,
10_1101-2020_11_24_390039	336	41	Lee	Lee	NNP
10_1101-2020_11_24_390039	336	42	,	,	,
10_1101-2020_11_24_390039	336	43	B.	B.	NNP
10_1101-2020_11_24_390039	336	44	,	,	,
10_1101-2020_11_24_390039	336	45	Shan	Shan	NNP
10_1101-2020_11_24_390039	336	46	Goh	Goh	NNP
10_1101-2020_11_24_390039	336	47	,	,	,
10_1101-2020_11_24_390039	336	48	Y.	Y.	NNP
10_1101-2020_11_24_390039	336	49	et	et	NNP
10_1101-2020_11_24_390039	336	50	al	al	NNP
10_1101-2020_11_24_390039	336	51	.	.	.
10_1101-2020_11_24_390039	337	1	(	(	-LRB-
10_1101-2020_11_24_390039	337	2	2020	2020	CD
10_1101-2020_11_24_390039	337	3	)	)	-RRB-
10_1101-2020_11_24_390039	337	4	.	.	.
10_1101-2020_11_24_390039	338	1	Effects	effect	NNS
10_1101-2020_11_24_390039	338	2	of	of	IN
10_1101-2020_11_24_390039	338	3	a	a	DT
10_1101-2020_11_24_390039	338	4	major	major	JJ
10_1101-2020_11_24_390039	338	5	deletion	deletion	NN
10_1101-2020_11_24_390039	338	6	in	in	IN
10_1101-2020_11_24_390039	338	7	the	the	DT
10_1101-2020_11_24_390039	338	8	SARS	SARS	NNP
10_1101-2020_11_24_390039	338	9	-	-	HYPH
10_1101-2020_11_24_390039	338	10	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	338	11	genome	genome	NN
10_1101-2020_11_24_390039	338	12	on	on	IN
10_1101-2020_11_24_390039	338	13	the	the	DT
10_1101-2020_11_24_390039	338	14	severity	severity	NN
10_1101-2020_11_24_390039	338	15	of	of	IN
10_1101-2020_11_24_390039	338	16	infection	infection	NN
10_1101-2020_11_24_390039	338	17	and	and	CC
10_1101-2020_11_24_390039	338	18	inflammatory	inflammatory	JJ
10_1101-2020_11_24_390039	338	19	response	response	NN
10_1101-2020_11_24_390039	338	20	:	:	:
10_1101-2020_11_24_390039	338	21	an	an	DT
10_1101-2020_11_24_390039	338	22	observational	observational	JJ
10_1101-2020_11_24_390039	338	23	cohort	cohort	NN
10_1101-2020_11_24_390039	338	24	study	study	NN
10_1101-2020_11_24_390039	338	25	.	.	.
10_1101-2020_11_24_390039	339	1	Lancet	Lancet	NNP
10_1101-2020_11_24_390039	339	2	.	.	.
10_1101-2020_11_24_390039	340	1	396	396	CD
10_1101-2020_11_24_390039	340	2	,	,	,
10_1101-2020_11_24_390039	340	3	603	603	CD
10_1101-2020_11_24_390039	340	4	-	-	SYM
10_1101-2020_11_24_390039	340	5	611	611	CD
10_1101-2020_11_24_390039	340	6	.	.	.
10_1101-2020_11_24_390039	341	1	Zhang	Zhang	NNP
10_1101-2020_11_24_390039	341	2	,	,	,
10_1101-2020_11_24_390039	341	3	Y.	Y.	NNP
10_1101-2020_11_24_390039	341	4	,	,	,
10_1101-2020_11_24_390039	341	5	Zhang	Zhang	NNP
10_1101-2020_11_24_390039	341	6	,	,	,
10_1101-2020_11_24_390039	341	7	J.	J.	NNP
10_1101-2020_11_24_390039	341	8	,	,	,
10_1101-2020_11_24_390039	341	9	Chen	Chen	NNP
10_1101-2020_11_24_390039	341	10	.	.	.
10_1101-2020_11_24_390039	342	1	Y.	Y.	NNP
10_1101-2020_11_24_390039	342	2	,	,	,
10_1101-2020_11_24_390039	342	3	Luo	Luo	NNP
10_1101-2020_11_24_390039	342	4	,	,	,
10_1101-2020_11_24_390039	342	5	B.	B.	NNP
10_1101-2020_11_24_390039	342	6	,	,	,
10_1101-2020_11_24_390039	342	7	Yuan	Yuan	NNP
10_1101-2020_11_24_390039	342	8	,	,	,
10_1101-2020_11_24_390039	342	9	Y.	Y.	NNP
10_1101-2020_11_24_390039	342	10	,	,	,
10_1101-2020_11_24_390039	342	11	Huang	Huang	NNP
10_1101-2020_11_24_390039	342	12	,	,	,
10_1101-2020_11_24_390039	342	13	F.	F.	NNP
10_1101-2020_11_24_390039	342	14	,	,	,
10_1101-2020_11_24_390039	342	15	Yang	Yang	NNP
10_1101-2020_11_24_390039	342	16	,	,	,
10_1101-2020_11_24_390039	342	17	T.	T.	NNP
10_1101-2020_11_24_390039	342	18	,	,	,
10_1101-2020_11_24_390039	342	19	Yu	Yu	NNP
10_1101-2020_11_24_390039	342	20	,	,	,
10_1101-2020_11_24_390039	342	21	F.	F.	NNP
10_1101-2020_11_24_390039	342	22	,	,	,
10_1101-2020_11_24_390039	342	23	Liu	Liu	NNP
10_1101-2020_11_24_390039	342	24	,	,	,
10_1101-2020_11_24_390039	342	25	J.	J.	NNP
10_1101-2020_11_24_390039	342	26	,	,	,
10_1101-2020_11_24_390039	342	27	Song	Song	NNP
10_1101-2020_11_24_390039	342	28	,	,	,
10_1101-2020_11_24_390039	342	29	Z.	Z.	NNP
10_1101-2020_11_24_390039	342	30	et	et	FW
10_1101-2020_11_24_390039	342	31	al	al	NNP
10_1101-2020_11_24_390039	342	32	.	.	.
10_1101-2020_11_24_390039	343	1	(	(	-LRB-
10_1101-2020_11_24_390039	343	2	2020	2020	CD
10_1101-2020_11_24_390039	343	3	)	)	-RRB-
10_1101-2020_11_24_390039	343	4	.	.	.
10_1101-2020_11_24_390039	344	1	The	the	DT
10_1101-2020_11_24_390039	344	2	ORF8	orf8	JJ
10_1101-2020_11_24_390039	344	3	protein	protein	NN
10_1101-2020_11_24_390039	344	4	of	of	IN
10_1101-2020_11_24_390039	344	5	SARS	SARS	NNP
10_1101-2020_11_24_390039	344	6	-	-	HYPH
10_1101-2020_11_24_390039	344	7	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	344	8	mediates	mediate	VBZ
10_1101-2020_11_24_390039	344	9	immune	immune	JJ
10_1101-2020_11_24_390039	344	10	evasion	evasion	NN
10_1101-2020_11_24_390039	344	11	through	through	IN
10_1101-2020_11_24_390039	344	12	potently	potently	RB
10_1101-2020_11_24_390039	344	13	downregulating	downregulate	VBG
10_1101-2020_11_24_390039	344	14	MHC-1	MHC-1	NNP
10_1101-2020_11_24_390039	344	15	.	.	.
10_1101-2020_11_24_390039	345	1	bioRxiv	biorxiv	NN
10_1101-2020_11_24_390039	345	2	.	.	.
10_1101-2020_11_24_390039	346	1	doi	doi	NNP
10_1101-2020_11_24_390039	346	2	:	:	:
10_1101-2020_11_24_390039	346	3	10.1101/2020.05.24.111823	10.1101/2020.05.24.111823	CD
10_1101-2020_11_24_390039	346	4	.CC	.CC	:
10_1101-2020_11_24_390039	346	5	-	-	:
10_1101-2020_11_24_390039	346	6	BY	by	IN
10_1101-2020_11_24_390039	346	7	-	-	HYPH
10_1101-2020_11_24_390039	346	8	ND	ND	NNP
10_1101-2020_11_24_390039	346	9	4.0	4.0	CD
10_1101-2020_11_24_390039	346	10	International	international	JJ
10_1101-2020_11_24_390039	346	11	licensemade	licensemade	NN
10_1101-2020_11_24_390039	346	12	available	available	JJ
10_1101-2020_11_24_390039	346	13	under	under	IN
10_1101-2020_11_24_390039	346	14	a	a	DT
10_1101-2020_11_24_390039	346	15	(	(	-LRB-
10_1101-2020_11_24_390039	346	16	which	which	WDT
10_1101-2020_11_24_390039	346	17	was	be	VBD
10_1101-2020_11_24_390039	346	18	not	not	RB
10_1101-2020_11_24_390039	346	19	certified	certify	VBN
10_1101-2020_11_24_390039	346	20	by	by	IN
10_1101-2020_11_24_390039	346	21	peer	peer	NN
10_1101-2020_11_24_390039	346	22	review	review	NN
10_1101-2020_11_24_390039	346	23	)	)	-RRB-
10_1101-2020_11_24_390039	346	24	is	be	VBZ
10_1101-2020_11_24_390039	346	25	the	the	DT
10_1101-2020_11_24_390039	346	26	author	author	NN
10_1101-2020_11_24_390039	346	27	/	/	SYM
10_1101-2020_11_24_390039	346	28	funder	funder	NN
10_1101-2020_11_24_390039	346	29	,	,	,
10_1101-2020_11_24_390039	346	30	who	who	WP
10_1101-2020_11_24_390039	346	31	has	have	VBZ
10_1101-2020_11_24_390039	346	32	granted	grant	VBN
10_1101-2020_11_24_390039	346	33	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	346	34	a	a	DT
10_1101-2020_11_24_390039	346	35	license	license	NN
10_1101-2020_11_24_390039	346	36	to	to	TO
10_1101-2020_11_24_390039	346	37	display	display	VB
10_1101-2020_11_24_390039	346	38	the	the	DT
10_1101-2020_11_24_390039	346	39	preprint	preprint	NN
10_1101-2020_11_24_390039	346	40	in	in	IN
10_1101-2020_11_24_390039	346	41	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	346	42	.	.	.
10_1101-2020_11_24_390039	347	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	347	2	is	be	VBZ
10_1101-2020_11_24_390039	347	3	The	the	DT
10_1101-2020_11_24_390039	347	4	copyright	copyright	NN
10_1101-2020_11_24_390039	347	5	holder	holder	NN
10_1101-2020_11_24_390039	347	6	for	for	IN
10_1101-2020_11_24_390039	347	7	this	this	DT
10_1101-2020_11_24_390039	347	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	347	9	version	version	NN
10_1101-2020_11_24_390039	347	10	posted	post	VBD
10_1101-2020_11_24_390039	347	11	January	January	NNP
10_1101-2020_11_24_390039	347	12	5	5	CD
10_1101-2020_11_24_390039	347	13	,	,	,
10_1101-2020_11_24_390039	347	14	2021	2021	CD
10_1101-2020_11_24_390039	347	15	.	.	.
10_1101-2020_11_24_390039	347	16	;	;	:
10_1101-2020_11_24_390039	347	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	347	18	:	:	:
10_1101-2020_11_24_390039	347	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	347	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	347	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	347	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	347	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	347	24	-	-	HYPH
10_1101-2020_11_24_390039	347	25	F	F	NNP
10_1101-2020_11_24_390039	347	26	as	as	IN
10_1101-2020_11_24_390039	347	27	a	a	DT
10_1101-2020_11_24_390039	347	28	potential	potential	JJ
10_1101-2020_11_24_390039	347	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	347	30	agent	agent	NN
10_1101-2020_11_24_390039	347	31	Page	Page	NNP
10_1101-2020_11_24_390039	347	32	19	19	CD
10_1101-2020_11_24_390039	347	33	of	of	IN
10_1101-2020_11_24_390039	347	34	21	21	CD
10_1101-2020_11_24_390039	347	35	Zhou	Zhou	NNP
10_1101-2020_11_24_390039	347	36	,	,	,
10_1101-2020_11_24_390039	347	37	P.	P.	NNP
10_1101-2020_11_24_390039	347	38	,	,	,
10_1101-2020_11_24_390039	347	39	Yang	Yang	NNP
10_1101-2020_11_24_390039	347	40	,	,	,
10_1101-2020_11_24_390039	347	41	X.-L.	X.-L.	NNP
10_1101-2020_11_24_390039	347	42	,	,	,
10_1101-2020_11_24_390039	347	43	Wang	Wang	NNP
10_1101-2020_11_24_390039	347	44	,	,	,
10_1101-2020_11_24_390039	347	45	X.-G.	X.-G.	NNP
10_1101-2020_11_24_390039	347	46	,	,	,
10_1101-2020_11_24_390039	347	47	Hu	Hu	NNP
10_1101-2020_11_24_390039	347	48	,	,	,
10_1101-2020_11_24_390039	347	49	B.	B.	NNP
10_1101-2020_11_24_390039	347	50	,	,	,
10_1101-2020_11_24_390039	347	51	Zhang	Zhang	NNP
10_1101-2020_11_24_390039	347	52	,	,	,
10_1101-2020_11_24_390039	347	53	L.	L.	NNP
10_1101-2020_11_24_390039	347	54	,	,	,
10_1101-2020_11_24_390039	347	55	Zhang	Zhang	NNP
10_1101-2020_11_24_390039	347	56	,	,	,
10_1101-2020_11_24_390039	347	57	W.	W.	NNP
10_1101-2020_11_24_390039	347	58	,	,	,
10_1101-2020_11_24_390039	347	59	Si	Si	NNP
10_1101-2020_11_24_390039	347	60	,	,	,
10_1101-2020_11_24_390039	347	61	H.-R.	H.-R.	NNP
10_1101-2020_11_24_390039	347	62	,	,	,
10_1101-2020_11_24_390039	347	63	Zhu	Zhu	NNP
10_1101-2020_11_24_390039	347	64	,	,	,
10_1101-2020_11_24_390039	347	65	Y.	Y.	NNP
10_1101-2020_11_24_390039	347	66	,	,	,
10_1101-2020_11_24_390039	347	67	Li	Li	NNP
10_1101-2020_11_24_390039	347	68	,	,	,
10_1101-2020_11_24_390039	347	69	B.	B.	NNP
10_1101-2020_11_24_390039	347	70	,	,	,
10_1101-2020_11_24_390039	347	71	Huang	Huang	NNP
10_1101-2020_11_24_390039	347	72	,	,	,
10_1101-2020_11_24_390039	347	73	C.-L.	C.-L.	NNP
10_1101-2020_11_24_390039	347	74	et	et	FW
10_1101-2020_11_24_390039	347	75	al	al	NNP
10_1101-2020_11_24_390039	347	76	.	.	.
10_1101-2020_11_24_390039	348	1	(	(	-LRB-
10_1101-2020_11_24_390039	348	2	2020	2020	CD
10_1101-2020_11_24_390039	348	3	)	)	-RRB-
10_1101-2020_11_24_390039	348	4	.	.	.
10_1101-2020_11_24_390039	349	1	A	a	DT
10_1101-2020_11_24_390039	349	2	pneumonia	pneumonia	NN
10_1101-2020_11_24_390039	349	3	outbreak	outbreak	NN
10_1101-2020_11_24_390039	349	4	associated	associate	VBN
10_1101-2020_11_24_390039	349	5	with	with	IN
10_1101-2020_11_24_390039	349	6	a	a	DT
10_1101-2020_11_24_390039	349	7	new	new	JJ
10_1101-2020_11_24_390039	349	8	coronavirus	coronavirus	NN
10_1101-2020_11_24_390039	349	9	of	of	IN
10_1101-2020_11_24_390039	349	10	probable	probable	JJ
10_1101-2020_11_24_390039	349	11	bat	bat	NN
10_1101-2020_11_24_390039	349	12	origin	origin	NN
10_1101-2020_11_24_390039	349	13	.	.	.
10_1101-2020_11_24_390039	350	1	Nature	nature	NN
10_1101-2020_11_24_390039	350	2	.	.	.
10_1101-2020_11_24_390039	351	1	579	579	CD
10_1101-2020_11_24_390039	351	2	,	,	,
10_1101-2020_11_24_390039	351	3	270	270	CD
10_1101-2020_11_24_390039	351	4	-	-	SYM
10_1101-2020_11_24_390039	351	5	273	273	CD
10_1101-2020_11_24_390039	351	6	.	.	.
10_1101-2020_11_24_390039	352	1	Zhu	Zhu	NNP
10_1101-2020_11_24_390039	352	2	,	,	,
10_1101-2020_11_24_390039	352	3	N.	N.	NNP
10_1101-2020_11_24_390039	352	4	,	,	,
10_1101-2020_11_24_390039	352	5	Zhang	Zhang	NNP
10_1101-2020_11_24_390039	352	6	,	,	,
10_1101-2020_11_24_390039	352	7	D.	D.	NNP
10_1101-2020_11_24_390039	352	8	,	,	,
10_1101-2020_11_24_390039	352	9	Wang	Wang	NNP
10_1101-2020_11_24_390039	352	10	,	,	,
10_1101-2020_11_24_390039	352	11	W.	W.	NNP
10_1101-2020_11_24_390039	352	12	,	,	,
10_1101-2020_11_24_390039	352	13	Li	Li	NNP
10_1101-2020_11_24_390039	352	14	,	,	,
10_1101-2020_11_24_390039	352	15	X.	X.	NNP
10_1101-2020_11_24_390039	352	16	,	,	,
10_1101-2020_11_24_390039	352	17	Yang	Yang	NNP
10_1101-2020_11_24_390039	352	18	,	,	,
10_1101-2020_11_24_390039	352	19	B.	B.	NNP
10_1101-2020_11_24_390039	352	20	,	,	,
10_1101-2020_11_24_390039	352	21	Song	Song	NNP
10_1101-2020_11_24_390039	352	22	,	,	,
10_1101-2020_11_24_390039	352	23	J.	J.	NNP
10_1101-2020_11_24_390039	352	24	,	,	,
10_1101-2020_11_24_390039	352	25	Zhao	Zhao	NNP
10_1101-2020_11_24_390039	352	26	,	,	,
10_1101-2020_11_24_390039	352	27	X.	X.	NNP
10_1101-2020_11_24_390039	352	28	,	,	,
10_1101-2020_11_24_390039	352	29	Huang	Huang	NNP
10_1101-2020_11_24_390039	352	30	,	,	,
10_1101-2020_11_24_390039	352	31	B.	B.	NNP
10_1101-2020_11_24_390039	352	32	,	,	,
10_1101-2020_11_24_390039	352	33	Shi	Shi	NNP
10_1101-2020_11_24_390039	352	34	,	,	,
10_1101-2020_11_24_390039	352	35	W.	W.	NNP
10_1101-2020_11_24_390039	352	36	,	,	,
10_1101-2020_11_24_390039	352	37	Lu	Lu	NNP
10_1101-2020_11_24_390039	352	38	,	,	,
10_1101-2020_11_24_390039	352	39	R.	R.	NNP
10_1101-2020_11_24_390039	352	40	,	,	,
10_1101-2020_11_24_390039	352	41	et	et	NNP
10_1101-2020_11_24_390039	352	42	al	al	NNP
10_1101-2020_11_24_390039	352	43	.	.	.
10_1101-2020_11_24_390039	353	1	(	(	-LRB-
10_1101-2020_11_24_390039	353	2	2020	2020	CD
10_1101-2020_11_24_390039	353	3	)	)	-RRB-
10_1101-2020_11_24_390039	353	4	.	.	.
10_1101-2020_11_24_390039	354	1	A	a	DT
10_1101-2020_11_24_390039	354	2	novel	novel	JJ
10_1101-2020_11_24_390039	354	3	coronavirus	coronavirus	NN
10_1101-2020_11_24_390039	354	4	from	from	IN
10_1101-2020_11_24_390039	354	5	patients	patient	NNS
10_1101-2020_11_24_390039	354	6	with	with	IN
10_1101-2020_11_24_390039	354	7	pneumonia	pneumonia	NN
10_1101-2020_11_24_390039	354	8	in	in	IN
10_1101-2020_11_24_390039	354	9	China	China	NNP
10_1101-2020_11_24_390039	354	10	,	,	,
10_1101-2020_11_24_390039	354	11	2019	2019	CD
10_1101-2020_11_24_390039	354	12	.	.	.
10_1101-2020_11_24_390039	355	1	N.	N.	NNP
10_1101-2020_11_24_390039	355	2	Eng	Eng	NNP
10_1101-2020_11_24_390039	355	3	.	.	.
10_1101-2020_11_24_390039	356	1	J.	J.	NNP
10_1101-2020_11_24_390039	356	2	Med	Med	NNP
10_1101-2020_11_24_390039	356	3	.	.	.
10_1101-2020_11_24_390039	357	1	382	382	CD
10_1101-2020_11_24_390039	357	2	,	,	,
10_1101-2020_11_24_390039	357	3	727	727	CD
10_1101-2020_11_24_390039	357	4	-	-	SYM
10_1101-2020_11_24_390039	357	5	733	733	CD
10_1101-2020_11_24_390039	357	6	.	.	.
10_1101-2020_11_24_390039	358	1	Zong	Zong	NNP
10_1101-2020_11_24_390039	358	2	,	,	,
10_1101-2020_11_24_390039	358	3	G.	G.	NNP
10_1101-2020_11_24_390039	358	4	,	,	,
10_1101-2020_11_24_390039	358	5	Hu	Hu	NNP
10_1101-2020_11_24_390039	358	6	,	,	,
10_1101-2020_11_24_390039	358	7	Z.	Z.	NNP
10_1101-2020_11_24_390039	358	8	,	,	,
10_1101-2020_11_24_390039	358	9	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	358	10	,	,	,
10_1101-2020_11_24_390039	358	11	S.	S.	NNP
10_1101-2020_11_24_390039	358	12	,	,	,
10_1101-2020_11_24_390039	358	13	Tranter	Tranter	NNP
10_1101-2020_11_24_390039	358	14	,	,	,
10_1101-2020_11_24_390039	358	15	D.	D.	NNP
10_1101-2020_11_24_390039	358	16	,	,	,
10_1101-2020_11_24_390039	358	17	Iannotti	Iannotti	NNP
10_1101-2020_11_24_390039	358	18	,	,	,
10_1101-2020_11_24_390039	358	19	M.	M.	NNP
10_1101-2020_11_24_390039	358	20	J.	J.	NNP
10_1101-2020_11_24_390039	358	21	,	,	,
10_1101-2020_11_24_390039	358	22	Baron	Baron	NNP
10_1101-2020_11_24_390039	358	23	,	,	,
10_1101-2020_11_24_390039	358	24	L.	L.	NNP
10_1101-2020_11_24_390039	358	25	,	,	,
10_1101-2020_11_24_390039	358	26	Hall	Hall	NNP
10_1101-2020_11_24_390039	358	27	,	,	,
10_1101-2020_11_24_390039	358	28	B.	B.	NNP
10_1101-2020_11_24_390039	358	29	,	,	,
10_1101-2020_11_24_390039	358	30	Corfield	Corfield	NNP
10_1101-2020_11_24_390039	358	31	,	,	,
10_1101-2020_11_24_390039	358	32	K.	K.	NNP
10_1101-2020_11_24_390039	358	33	,	,	,
10_1101-2020_11_24_390039	358	34	Paatero	Paatero	NNP
10_1101-2020_11_24_390039	358	35	,	,	,
10_1101-2020_11_24_390039	358	36	A.	a.	NN
10_1101-2020_11_24_390039	358	37	,	,	,
10_1101-2020_11_24_390039	358	38	Henderson	Henderson	NNP
10_1101-2020_11_24_390039	358	39	M.	M.	NNP
10_1101-2020_11_24_390039	358	40	et	et	NNP
10_1101-2020_11_24_390039	358	41	al	al	NNP
10_1101-2020_11_24_390039	358	42	.	.	.
10_1101-2020_11_24_390039	359	1	(	(	-LRB-
10_1101-2020_11_24_390039	359	2	2019	2019	CD
10_1101-2020_11_24_390039	359	3	)	)	-RRB-
10_1101-2020_11_24_390039	359	4	.	.	.
10_1101-2020_11_24_390039	360	1	Ipomoeassin	Ipomoeassin	NNP
10_1101-2020_11_24_390039	360	2	F	F	NNP
10_1101-2020_11_24_390039	360	3	binds	bind	NNS
10_1101-2020_11_24_390039	360	4	Sec61α	Sec61α	NNP
10_1101-2020_11_24_390039	360	5	to	to	TO
10_1101-2020_11_24_390039	360	6	inhibit	inhibit	VB
10_1101-2020_11_24_390039	360	7	protein	protein	NN
10_1101-2020_11_24_390039	360	8	translocation	translocation	NN
10_1101-2020_11_24_390039	360	9	.	.	.
10_1101-2020_11_24_390039	361	1	J.	J.	NNP
10_1101-2020_11_24_390039	362	1	Am	Am	NNP
10_1101-2020_11_24_390039	362	2	.	.	.
10_1101-2020_11_24_390039	363	1	Chem	Chem	NNP
10_1101-2020_11_24_390039	363	2	.	.	.
10_1101-2020_11_24_390039	364	1	Soc	Soc	NNP
10_1101-2020_11_24_390039	364	2	.	.	.
10_1101-2020_11_24_390039	365	1	141	141	CD
10_1101-2020_11_24_390039	365	2	,	,	,
10_1101-2020_11_24_390039	365	3	8450	8450	CD
10_1101-2020_11_24_390039	365	4	-	-	SYM
10_1101-2020_11_24_390039	365	5	8461	8461	CD
10_1101-2020_11_24_390039	365	6	.	.	.
10_1101-2020_11_24_390039	366	1	Zong	Zong	NNP
10_1101-2020_11_24_390039	366	2	,	,	,
10_1101-2020_11_24_390039	366	3	G.	G.	NNP
10_1101-2020_11_24_390039	366	4	,	,	,
10_1101-2020_11_24_390039	366	5	Hu	Hu	NNP
10_1101-2020_11_24_390039	366	6	,	,	,
10_1101-2020_11_24_390039	366	7	Z.	Z.	NNP
10_1101-2020_11_24_390039	366	8	,	,	,
10_1101-2020_11_24_390039	366	9	Duah	Duah	NNP
10_1101-2020_11_24_390039	366	10	,	,	,
10_1101-2020_11_24_390039	366	11	K.	K.	NNP
10_1101-2020_11_24_390039	366	12	,	,	,
10_1101-2020_11_24_390039	366	13	B.	B.	NNP
10_1101-2020_11_24_390039	366	14	,	,	,
10_1101-2020_11_24_390039	366	15	Andrews	Andrews	NNP
10_1101-2020_11_24_390039	366	16	,	,	,
10_1101-2020_11_24_390039	366	17	L.	L.	NNP
10_1101-2020_11_24_390039	366	18	E.	E.	NNP
10_1101-2020_11_24_390039	366	19	,	,	,
10_1101-2020_11_24_390039	366	20	Zhou	Zhou	NNP
10_1101-2020_11_24_390039	366	21	,	,	,
10_1101-2020_11_24_390039	366	22	J.	J.	NNP
10_1101-2020_11_24_390039	366	23	,	,	,
10_1101-2020_11_24_390039	366	24	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	366	25	,	,	,
10_1101-2020_11_24_390039	366	26	S.	S.	NNP
10_1101-2020_11_24_390039	366	27	,	,	,
10_1101-2020_11_24_390039	366	28	Whisenhunt	Whisenhunt	NNP
10_1101-2020_11_24_390039	366	29	,	,	,
10_1101-2020_11_24_390039	366	30	L.	L.	NNP
10_1101-2020_11_24_390039	366	31	,	,	,
10_1101-2020_11_24_390039	366	32	Shim	Shim	NNP
10_1101-2020_11_24_390039	366	33	,	,	,
10_1101-2020_11_24_390039	366	34	J.	J.	NNP
10_1101-2020_11_24_390039	366	35	S.	S.	NNP
10_1101-2020_11_24_390039	366	36	,	,	,
10_1101-2020_11_24_390039	366	37	Du	Du	NNP
10_1101-2020_11_24_390039	366	38	,	,	,
10_1101-2020_11_24_390039	366	39	Y.	Y.	NNP
10_1101-2020_11_24_390039	366	40	,	,	,
10_1101-2020_11_24_390039	366	41	High	High	NNP
10_1101-2020_11_24_390039	366	42	,	,	,
10_1101-2020_11_24_390039	366	43	S.	S.	NNP
10_1101-2020_11_24_390039	366	44	,	,	,
10_1101-2020_11_24_390039	366	45	et	et	NNP
10_1101-2020_11_24_390039	366	46	al	al	NNP
10_1101-2020_11_24_390039	366	47	.	.	.
10_1101-2020_11_24_390039	367	1	(	(	-LRB-
10_1101-2020_11_24_390039	367	2	2020	2020	CD
10_1101-2020_11_24_390039	367	3	)	)	-RRB-
10_1101-2020_11_24_390039	367	4	Ring	ring	NN
10_1101-2020_11_24_390039	367	5	-	-	HYPH
10_1101-2020_11_24_390039	367	6	expansion	expansion	NN
10_1101-2020_11_24_390039	367	7	leads	lead	VBZ
10_1101-2020_11_24_390039	367	8	to	to	IN
10_1101-2020_11_24_390039	367	9	a	a	DT
10_1101-2020_11_24_390039	367	10	more	more	RBR
10_1101-2020_11_24_390039	367	11	potent	potent	JJ
10_1101-2020_11_24_390039	367	12	analogue	analogue	NN
10_1101-2020_11_24_390039	367	13	of	of	IN
10_1101-2020_11_24_390039	367	14	ipomoeassin	ipomoeassin	NNP
10_1101-2020_11_24_390039	367	15	F.	F.	NNP
10_1101-2020_11_24_390039	367	16	J.	J.	NNP
10_1101-2020_11_24_390039	367	17	Org	Org	NNP
10_1101-2020_11_24_390039	367	18	.	.	.
10_1101-2020_11_24_390039	368	1	Chem	Chem	NNP
10_1101-2020_11_24_390039	368	2	.	.	.
10_1101-2020_11_24_390039	369	1	doi	doi	XX
10_1101-2020_11_24_390039	369	2	:	:	:
10_1101-2020_11_24_390039	369	3	10.1021	10.1021	CD
10_1101-2020_11_24_390039	369	4	/	/	SYM
10_1101-2020_11_24_390039	369	5	acs.joc.0c01659	acs.joc.0c01659	NNP
10_1101-2020_11_24_390039	369	6	.CC	.CC	:
10_1101-2020_11_24_390039	369	7	-	-	:
10_1101-2020_11_24_390039	369	8	BY	by	IN
10_1101-2020_11_24_390039	369	9	-	-	HYPH
10_1101-2020_11_24_390039	369	10	ND	ND	NNP
10_1101-2020_11_24_390039	369	11	4.0	4.0	CD
10_1101-2020_11_24_390039	369	12	International	international	JJ
10_1101-2020_11_24_390039	369	13	licensemade	licensemade	NN
10_1101-2020_11_24_390039	369	14	available	available	JJ
10_1101-2020_11_24_390039	369	15	under	under	IN
10_1101-2020_11_24_390039	369	16	a	a	DT
10_1101-2020_11_24_390039	369	17	(	(	-LRB-
10_1101-2020_11_24_390039	369	18	which	which	WDT
10_1101-2020_11_24_390039	369	19	was	be	VBD
10_1101-2020_11_24_390039	369	20	not	not	RB
10_1101-2020_11_24_390039	369	21	certified	certify	VBN
10_1101-2020_11_24_390039	369	22	by	by	IN
10_1101-2020_11_24_390039	369	23	peer	peer	NN
10_1101-2020_11_24_390039	369	24	review	review	NN
10_1101-2020_11_24_390039	369	25	)	)	-RRB-
10_1101-2020_11_24_390039	369	26	is	be	VBZ
10_1101-2020_11_24_390039	369	27	the	the	DT
10_1101-2020_11_24_390039	369	28	author	author	NN
10_1101-2020_11_24_390039	369	29	/	/	SYM
10_1101-2020_11_24_390039	369	30	funder	funder	NN
10_1101-2020_11_24_390039	369	31	,	,	,
10_1101-2020_11_24_390039	369	32	who	who	WP
10_1101-2020_11_24_390039	369	33	has	have	VBZ
10_1101-2020_11_24_390039	369	34	granted	grant	VBN
10_1101-2020_11_24_390039	369	35	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	369	36	a	a	DT
10_1101-2020_11_24_390039	369	37	license	license	NN
10_1101-2020_11_24_390039	369	38	to	to	TO
10_1101-2020_11_24_390039	369	39	display	display	VB
10_1101-2020_11_24_390039	369	40	the	the	DT
10_1101-2020_11_24_390039	369	41	preprint	preprint	NN
10_1101-2020_11_24_390039	369	42	in	in	IN
10_1101-2020_11_24_390039	369	43	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	369	44	.	.	.
10_1101-2020_11_24_390039	370	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	370	2	is	be	VBZ
10_1101-2020_11_24_390039	370	3	The	the	DT
10_1101-2020_11_24_390039	370	4	copyright	copyright	NN
10_1101-2020_11_24_390039	370	5	holder	holder	NN
10_1101-2020_11_24_390039	370	6	for	for	IN
10_1101-2020_11_24_390039	370	7	this	this	DT
10_1101-2020_11_24_390039	370	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	370	9	version	version	NN
10_1101-2020_11_24_390039	370	10	posted	post	VBD
10_1101-2020_11_24_390039	370	11	January	January	NNP
10_1101-2020_11_24_390039	370	12	5	5	CD
10_1101-2020_11_24_390039	370	13	,	,	,
10_1101-2020_11_24_390039	370	14	2021	2021	CD
10_1101-2020_11_24_390039	370	15	.	.	.
10_1101-2020_11_24_390039	370	16	;	;	:
10_1101-2020_11_24_390039	370	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	370	18	:	:	:
10_1101-2020_11_24_390039	370	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	370	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	370	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	370	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	370	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	370	24	-	-	HYPH
10_1101-2020_11_24_390039	370	25	F	F	NNP
10_1101-2020_11_24_390039	370	26	as	as	IN
10_1101-2020_11_24_390039	370	27	a	a	DT
10_1101-2020_11_24_390039	370	28	potential	potential	JJ
10_1101-2020_11_24_390039	370	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	370	30	agent	agent	NN
10_1101-2020_11_24_390039	370	31	Page	Page	NNP
10_1101-2020_11_24_390039	370	32	20	20	CD
10_1101-2020_11_24_390039	370	33	of	of	IN
10_1101-2020_11_24_390039	370	34	21	21	CD
10_1101-2020_11_24_390039	370	35	Figure	Figure	NNP
10_1101-2020_11_24_390039	370	36	Legends	Legends	NNPS
10_1101-2020_11_24_390039	370	37	Fig	Fig	NNP
10_1101-2020_11_24_390039	370	38	.	.	.
10_1101-2020_11_24_390039	371	1	1	1	LS
10_1101-2020_11_24_390039	371	2	.	.	.
10_1101-2020_11_24_390039	372	1	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	372	2	-	-	HYPH
10_1101-2020_11_24_390039	372	3	F	F	NNP
10_1101-2020_11_24_390039	372	4	as	as	IN
10_1101-2020_11_24_390039	372	5	a	a	DT
10_1101-2020_11_24_390039	372	6	potential	potential	JJ
10_1101-2020_11_24_390039	372	7	inhibitor	inhibitor	NN
10_1101-2020_11_24_390039	372	8	of	of	IN
10_1101-2020_11_24_390039	372	9	SARS	SARS	NNP
10_1101-2020_11_24_390039	372	10	-	-	HYPH
10_1101-2020_11_24_390039	372	11	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	372	12	viral	viral	JJ
10_1101-2020_11_24_390039	372	13	protein	protein	NN
10_1101-2020_11_24_390039	372	14	synthesis	synthesis	NN
10_1101-2020_11_24_390039	372	15	.	.	.
10_1101-2020_11_24_390039	373	1	(	(	-LRB-
10_1101-2020_11_24_390039	373	2	A	a	DT
10_1101-2020_11_24_390039	373	3	)	)	-RRB-
10_1101-2020_11_24_390039	373	4	Schematic	schematic	JJ
10_1101-2020_11_24_390039	373	5	of	of	IN
10_1101-2020_11_24_390039	373	6	(	(	-LRB-
10_1101-2020_11_24_390039	373	7	+	+	SYM
10_1101-2020_11_24_390039	373	8	)	)	-RRB-
10_1101-2020_11_24_390039	373	9	ssRNA	ssRNA	NFP
10_1101-2020_11_24_390039	373	10	genome	genome	JJ
10_1101-2020_11_24_390039	373	11	architecture	architecture	NN
10_1101-2020_11_24_390039	373	12	of	of	IN
10_1101-2020_11_24_390039	373	13	SARS	SARS	NNP
10_1101-2020_11_24_390039	373	14	-	-	HYPH
10_1101-2020_11_24_390039	373	15	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	373	16	(	(	-LRB-
10_1101-2020_11_24_390039	373	17	29903	29903	CD
10_1101-2020_11_24_390039	373	18	nt	nt	RB
10_1101-2020_11_24_390039	373	19	)	)	-RRB-
10_1101-2020_11_24_390039	373	20	containing	contain	VBG
10_1101-2020_11_24_390039	373	21	5	5	CD
10_1101-2020_11_24_390039	373	22	’	'	''
10_1101-2020_11_24_390039	373	23	capped	capped	JJ
10_1101-2020_11_24_390039	373	24	mRNA	mrna	NN
10_1101-2020_11_24_390039	373	25	with	with	IN
10_1101-2020_11_24_390039	373	26	a	a	DT
10_1101-2020_11_24_390039	373	27	leader	leader	NN
10_1101-2020_11_24_390039	373	28	sequence	sequence	NN
10_1101-2020_11_24_390039	373	29	(	(	-LRB-
10_1101-2020_11_24_390039	373	30	LS	LS	NNP
10_1101-2020_11_24_390039	373	31	)	)	-RRB-
10_1101-2020_11_24_390039	373	32	,	,	,
10_1101-2020_11_24_390039	373	33	3	3	CD
10_1101-2020_11_24_390039	373	34	’	'	''
10_1101-2020_11_24_390039	373	35	end	end	NN
10_1101-2020_11_24_390039	373	36	poly	poly	NN
10_1101-2020_11_24_390039	373	37	-	-	,
10_1101-2020_11_24_390039	373	38	A	a	NN
10_1101-2020_11_24_390039	373	39	tail	tail	NN
10_1101-2020_11_24_390039	373	40	,	,	,
10_1101-2020_11_24_390039	373	41	5	5	CD
10_1101-2020_11_24_390039	373	42	’	'	''
10_1101-2020_11_24_390039	373	43	and	and	CC
10_1101-2020_11_24_390039	373	44	3	3	CD
10_1101-2020_11_24_390039	373	45	’	'	''
10_1101-2020_11_24_390039	373	46	UTRs	utr	NNS
10_1101-2020_11_24_390039	373	47	and	and	CC
10_1101-2020_11_24_390039	373	48	open	open	JJ
10_1101-2020_11_24_390039	373	49	reading	reading	NN
10_1101-2020_11_24_390039	373	50	frames	frame	NNS
10_1101-2020_11_24_390039	373	51	(	(	-LRB-
10_1101-2020_11_24_390039	373	52	ORFs	ORFs	NNP
10_1101-2020_11_24_390039	373	53	)	)	-RRB-
10_1101-2020_11_24_390039	373	54	:	:	:
10_1101-2020_11_24_390039	373	55	ORF1a	ORF1a	NNP
10_1101-2020_11_24_390039	373	56	,	,	,
10_1101-2020_11_24_390039	373	57	ORF1b	ORF1b	NNP
10_1101-2020_11_24_390039	373	58	,	,	,
10_1101-2020_11_24_390039	373	59	spike	spike	NNP
10_1101-2020_11_24_390039	373	60	(	(	-LRB-
10_1101-2020_11_24_390039	373	61	S	S	NNP
10_1101-2020_11_24_390039	373	62	)	)	-RRB-
10_1101-2020_11_24_390039	373	63	,	,	,
10_1101-2020_11_24_390039	373	64	ORF3a	ORF3a	NNP
10_1101-2020_11_24_390039	373	65	,	,	,
10_1101-2020_11_24_390039	373	66	envelope	envelope	NNP
10_1101-2020_11_24_390039	373	67	(	(	-LRB-
10_1101-2020_11_24_390039	373	68	E	E	NNP
10_1101-2020_11_24_390039	373	69	)	)	-RRB-
10_1101-2020_11_24_390039	373	70	,	,	,
10_1101-2020_11_24_390039	373	71	membrane	membrane	NN
10_1101-2020_11_24_390039	373	72	(	(	-LRB-
10_1101-2020_11_24_390039	373	73	M	M	NNP
10_1101-2020_11_24_390039	373	74	)	)	-RRB-
10_1101-2020_11_24_390039	373	75	,	,	,
10_1101-2020_11_24_390039	373	76	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	373	77	,	,	,
10_1101-2020_11_24_390039	373	78	ORF7	ORF7	NNP
10_1101-2020_11_24_390039	373	79	,	,	,
10_1101-2020_11_24_390039	373	80	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	373	81	,	,	,
10_1101-2020_11_24_390039	373	82	nucleoprotein	nucleoprotein	NNP
10_1101-2020_11_24_390039	373	83	(	(	-LRB-
10_1101-2020_11_24_390039	373	84	N	n	NN
10_1101-2020_11_24_390039	373	85	)	)	-RRB-
10_1101-2020_11_24_390039	373	86	and	and	CC
10_1101-2020_11_24_390039	373	87	ORF10	orf10	NN
10_1101-2020_11_24_390039	373	88	(	(	-LRB-
10_1101-2020_11_24_390039	373	89	Firth	firth	NN
10_1101-2020_11_24_390039	373	90	,	,	,
10_1101-2020_11_24_390039	373	91	2020	2020	CD
10_1101-2020_11_24_390039	373	92	;	;	:
10_1101-2020_11_24_390039	373	93	Naqvi	Naqvi	NNP
10_1101-2020_11_24_390039	373	94	et	et	NNP
10_1101-2020_11_24_390039	373	95	al	al	NNP
10_1101-2020_11_24_390039	373	96	.	.	NNP
10_1101-2020_11_24_390039	373	97	,	,	,
10_1101-2020_11_24_390039	373	98	2020	2020	CD
10_1101-2020_11_24_390039	373	99	)	)	-RRB-
10_1101-2020_11_24_390039	373	100	.	.	.
10_1101-2020_11_24_390039	374	1	An	an	DT
10_1101-2020_11_24_390039	374	2	important	important	JJ
10_1101-2020_11_24_390039	374	3	mode	mode	NN
10_1101-2020_11_24_390039	374	4	of	of	IN
10_1101-2020_11_24_390039	374	5	SARS	SARS	NNP
10_1101-2020_11_24_390039	374	6	-	-	HYPH
10_1101-2020_11_24_390039	374	7	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	374	8	host	host	NN
10_1101-2020_11_24_390039	374	9	entry	entry	NN
10_1101-2020_11_24_390039	374	10	proceeds	proceed	VBZ
10_1101-2020_11_24_390039	374	11	via	via	IN
10_1101-2020_11_24_390039	374	12	interaction	interaction	NN
10_1101-2020_11_24_390039	374	13	of	of	IN
10_1101-2020_11_24_390039	374	14	the	the	DT
10_1101-2020_11_24_390039	374	15	viral	viral	JJ
10_1101-2020_11_24_390039	374	16	S	S	NNP
10_1101-2020_11_24_390039	374	17	protein	protein	NN
10_1101-2020_11_24_390039	374	18	with	with	IN
10_1101-2020_11_24_390039	374	19	human	human	NN
10_1101-2020_11_24_390039	374	20	angiotensin-	angiotensin-	JJ
10_1101-2020_11_24_390039	374	21	converting	convert	VBG
10_1101-2020_11_24_390039	374	22	enzyme	enzyme	NNS
10_1101-2020_11_24_390039	374	23	2	2	CD
10_1101-2020_11_24_390039	374	24	(	(	-LRB-
10_1101-2020_11_24_390039	374	25	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	374	26	)	)	-RRB-
10_1101-2020_11_24_390039	374	27	(	(	-LRB-
10_1101-2020_11_24_390039	374	28	Walls	Walls	NNP
10_1101-2020_11_24_390039	374	29	et	et	FW
10_1101-2020_11_24_390039	374	30	al	al	NNP
10_1101-2020_11_24_390039	374	31	.	.	NNP
10_1101-2020_11_24_390039	374	32	,	,	,
10_1101-2020_11_24_390039	374	33	2020	2020	CD
10_1101-2020_11_24_390039	374	34	)	)	-RRB-
10_1101-2020_11_24_390039	374	35	.	.	.
10_1101-2020_11_24_390039	375	1	(	(	-LRB-
10_1101-2020_11_24_390039	375	2	B	b	NN
10_1101-2020_11_24_390039	375	3	)	)	-RRB-
10_1101-2020_11_24_390039	375	4	Structure	structure	NN
10_1101-2020_11_24_390039	375	5	of	of	IN
10_1101-2020_11_24_390039	375	6	Ipomoeassin-	Ipomoeassin-	NNP
10_1101-2020_11_24_390039	375	7	F	F	NNP
10_1101-2020_11_24_390039	375	8	(	(	-LRB-
10_1101-2020_11_24_390039	375	9	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	375	10	-	-	HYPH
10_1101-2020_11_24_390039	375	11	F	F	NNP
10_1101-2020_11_24_390039	375	12	)	)	-RRB-
10_1101-2020_11_24_390039	375	13	,	,	,
10_1101-2020_11_24_390039	375	14	a	a	DT
10_1101-2020_11_24_390039	375	15	small	small	JJ
10_1101-2020_11_24_390039	375	16	molecule	molecule	JJ
10_1101-2020_11_24_390039	375	17	inhibitor	inhibitor	NN
10_1101-2020_11_24_390039	375	18	of	of	IN
10_1101-2020_11_24_390039	375	19	Sec61-mediated	sec61-mediate	VBN
10_1101-2020_11_24_390039	375	20	protein	protein	NN
10_1101-2020_11_24_390039	375	21	translocation	translocation	NN
10_1101-2020_11_24_390039	375	22	.	.	.
10_1101-2020_11_24_390039	376	1	(	(	-LRB-
10_1101-2020_11_24_390039	376	2	C	c	NN
10_1101-2020_11_24_390039	376	3	)	)	-RRB-
10_1101-2020_11_24_390039	376	4	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	376	5	-	-	HYPH
10_1101-2020_11_24_390039	376	6	F	F	NNP
10_1101-2020_11_24_390039	376	7	efficiently	efficiently	RB
10_1101-2020_11_24_390039	376	8	blocks	block	VBZ
10_1101-2020_11_24_390039	376	9	membrane	membrane	NN
10_1101-2020_11_24_390039	376	10	translocation	translocation	NN
10_1101-2020_11_24_390039	376	11	of	of	IN
10_1101-2020_11_24_390039	376	12	secretory	secretory	JJ
10_1101-2020_11_24_390039	376	13	proteins	protein	NNS
10_1101-2020_11_24_390039	376	14	and	and	CC
10_1101-2020_11_24_390039	376	15	insertion	insertion	NN
10_1101-2020_11_24_390039	376	16	of	of	IN
10_1101-2020_11_24_390039	376	17	single	single	JJ
10_1101-2020_11_24_390039	376	18	-	-	HYPH
10_1101-2020_11_24_390039	376	19	pass	pass	NN
10_1101-2020_11_24_390039	376	20	type	type	NN
10_1101-2020_11_24_390039	376	21	I	-PRON-	PRP
10_1101-2020_11_24_390039	376	22	and	and	CC
10_1101-2020_11_24_390039	376	23	type	type	VB
10_1101-2020_11_24_390039	376	24	II	II	NNP
10_1101-2020_11_24_390039	376	25	TMPs	tmp	NNS
10_1101-2020_11_24_390039	376	26	,	,	,
10_1101-2020_11_24_390039	376	27	but	but	CC
10_1101-2020_11_24_390039	376	28	not	not	RB
10_1101-2020_11_24_390039	376	29	insertion	insertion	NN
10_1101-2020_11_24_390039	376	30	of	of	IN
10_1101-2020_11_24_390039	376	31	type	type	NN
10_1101-2020_11_24_390039	376	32	III	iii	CD
10_1101-2020_11_24_390039	376	33	TMPs	tmp	NNS
10_1101-2020_11_24_390039	376	34	or	or	CC
10_1101-2020_11_24_390039	376	35	tail	tail	NN
10_1101-2020_11_24_390039	376	36	-	-	HYPH
10_1101-2020_11_24_390039	376	37	anchored	anchor	VBN
10_1101-2020_11_24_390039	376	38	(	(	-LRB-
10_1101-2020_11_24_390039	376	39	TA	TA	NNP
10_1101-2020_11_24_390039	376	40	)	)	-RRB-
10_1101-2020_11_24_390039	376	41	proteins	protein	NNS
10_1101-2020_11_24_390039	376	42	.	.	.
10_1101-2020_11_24_390039	377	1	SA	SA	NNP
10_1101-2020_11_24_390039	377	2	denotes	denote	VBZ
10_1101-2020_11_24_390039	377	3	a	a	DT
10_1101-2020_11_24_390039	377	4	signal	signal	NN
10_1101-2020_11_24_390039	377	5	anchor	anchor	NN
10_1101-2020_11_24_390039	377	6	.	.	.
10_1101-2020_11_24_390039	378	1	(	(	-LRB-
10_1101-2020_11_24_390039	378	2	D	d	NN
10_1101-2020_11_24_390039	378	3	)	)	-RRB-
10_1101-2020_11_24_390039	378	4	Based	base	VBN
10_1101-2020_11_24_390039	378	5	on	on	IN
10_1101-2020_11_24_390039	378	6	known	know	VBN
10_1101-2020_11_24_390039	378	7	/	/	SYM
10_1101-2020_11_24_390039	378	8	predicted	predict	VBN
10_1101-2020_11_24_390039	378	9	membrane	membrane	NN
10_1101-2020_11_24_390039	378	10	topology	topology	NN
10_1101-2020_11_24_390039	378	11	of	of	IN
10_1101-2020_11_24_390039	378	12	SARS	SARS	NNP
10_1101-2020_11_24_390039	378	13	-	-	HYPH
10_1101-2020_11_24_390039	378	14	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	378	15	proteins	protein	NNS
10_1101-2020_11_24_390039	378	16	,	,	,
10_1101-2020_11_24_390039	378	17	and	and	CC
10_1101-2020_11_24_390039	378	18	sensitivity	sensitivity	NN
10_1101-2020_11_24_390039	378	19	of	of	IN
10_1101-2020_11_24_390039	378	20	comparable	comparable	JJ
10_1101-2020_11_24_390039	378	21	host	host	NN
10_1101-2020_11_24_390039	378	22	cell	cell	NN
10_1101-2020_11_24_390039	378	23	proteins	protein	NNS
10_1101-2020_11_24_390039	378	24	(	(	-LRB-
10_1101-2020_11_24_390039	378	25	Zong	Zong	NNP
10_1101-2020_11_24_390039	378	26	et	et	NNP
10_1101-2020_11_24_390039	378	27	al	al	NNP
10_1101-2020_11_24_390039	378	28	.	.	NNP
10_1101-2020_11_24_390039	378	29	,	,	,
10_1101-2020_11_24_390039	378	30	2019	2019	CD
10_1101-2020_11_24_390039	378	31	;	;	:
10_1101-2020_11_24_390039	378	32	O’Keefe	O’Keefe	NNP
10_1101-2020_11_24_390039	378	33	et	et	NNP
10_1101-2020_11_24_390039	378	34	al	al	NNP
10_1101-2020_11_24_390039	378	35	.	.	NNP
10_1101-2020_11_24_390039	378	36	,	,	,
10_1101-2020_11_24_390039	378	37	2020	2020	CD
10_1101-2020_11_24_390039	378	38	submitted	submit	VBN
10_1101-2020_11_24_390039	378	39	)	)	-RRB-
10_1101-2020_11_24_390039	378	40	,	,	,
10_1101-2020_11_24_390039	378	41	likely	likely	JJ
10_1101-2020_11_24_390039	378	42	sensitivity	sensitivity	NN
10_1101-2020_11_24_390039	378	43	to	to	IN
10_1101-2020_11_24_390039	378	44	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	378	45	-	-	HYPH
10_1101-2020_11_24_390039	378	46	F	F	NNP
10_1101-2020_11_24_390039	378	47	was	be	VBD
10_1101-2020_11_24_390039	378	48	anticipated	anticipate	VBN
10_1101-2020_11_24_390039	378	49	.	.	.
10_1101-2020_11_24_390039	379	1	Fig	fig	NN
10_1101-2020_11_24_390039	379	2	.	.	.
10_1101-2020_11_24_390039	380	1	2	2	LS
10_1101-2020_11_24_390039	380	2	.	.	.
10_1101-2020_11_24_390039	381	1	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	381	2	-	-	HYPH
10_1101-2020_11_24_390039	381	3	F	F	NNP
10_1101-2020_11_24_390039	381	4	selectively	selectively	RB
10_1101-2020_11_24_390039	381	5	inhibits	inhibit	VBZ
10_1101-2020_11_24_390039	381	6	the	the	DT
10_1101-2020_11_24_390039	381	7	ER	ER	NNP
10_1101-2020_11_24_390039	381	8	membrane	membrane	NN
10_1101-2020_11_24_390039	381	9	translocation	translocation	NN
10_1101-2020_11_24_390039	381	10	of	of	IN
10_1101-2020_11_24_390039	381	11	SARS-	SARS-	NNP
10_1101-2020_11_24_390039	381	12	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	381	13	proteins	protein	NNS
10_1101-2020_11_24_390039	381	14	.	.	.
10_1101-2020_11_24_390039	382	1	(	(	-LRB-
10_1101-2020_11_24_390039	382	2	A	a	DT
10_1101-2020_11_24_390039	382	3	)	)	-RRB-
10_1101-2020_11_24_390039	382	4	Schematic	schematic	JJ
10_1101-2020_11_24_390039	382	5	of	of	IN
10_1101-2020_11_24_390039	382	6	in	in	FW
10_1101-2020_11_24_390039	382	7	vitro	vitro	FW
10_1101-2020_11_24_390039	382	8	ER	ER	NNP
10_1101-2020_11_24_390039	382	9	import	import	NN
10_1101-2020_11_24_390039	382	10	assay	assay	NN
10_1101-2020_11_24_390039	382	11	using	use	VBG
10_1101-2020_11_24_390039	382	12	pancreatic	pancreatic	JJ
10_1101-2020_11_24_390039	382	13	microsomes	microsome	NNS
10_1101-2020_11_24_390039	382	14	.	.	.
10_1101-2020_11_24_390039	383	1	Following	follow	VBG
10_1101-2020_11_24_390039	383	2	translation	translation	NN
10_1101-2020_11_24_390039	383	3	,	,	,
10_1101-2020_11_24_390039	383	4	fully	fully	RB
10_1101-2020_11_24_390039	383	5	translocated	translocate	VBN
10_1101-2020_11_24_390039	383	6	/	/	SYM
10_1101-2020_11_24_390039	383	7	membrane	membrane	NN
10_1101-2020_11_24_390039	383	8	inserted	insert	VBD
10_1101-2020_11_24_390039	383	9	radiolabelled	radiolabelle	VBN
10_1101-2020_11_24_390039	383	10	precursor	precursor	NN
10_1101-2020_11_24_390039	383	11	proteins	protein	NNS
10_1101-2020_11_24_390039	383	12	are	be	VBP
10_1101-2020_11_24_390039	383	13	recovered	recover	VBN
10_1101-2020_11_24_390039	383	14	and	and	CC
10_1101-2020_11_24_390039	383	15	analysed	analyse	VBN
10_1101-2020_11_24_390039	383	16	by	by	IN
10_1101-2020_11_24_390039	383	17	SDS	SDS	NNP
10_1101-2020_11_24_390039	383	18	-	-	HYPH
10_1101-2020_11_24_390039	383	19	PAGE	page	NN
10_1101-2020_11_24_390039	383	20	and	and	CC
10_1101-2020_11_24_390039	383	21	phosphorimaging	phosphorimaging	NN
10_1101-2020_11_24_390039	383	22	.	.	.
10_1101-2020_11_24_390039	384	1	N	n	LS
10_1101-2020_11_24_390039	384	2	-	-	HYPH
10_1101-2020_11_24_390039	384	3	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	384	4	species	specie	NNS
10_1101-2020_11_24_390039	384	5	were	be	VBD
10_1101-2020_11_24_390039	384	6	confirmed	confirm	VBN
10_1101-2020_11_24_390039	384	7	by	by	IN
10_1101-2020_11_24_390039	384	8	treatment	treatment	NN
10_1101-2020_11_24_390039	384	9	with	with	IN
10_1101-2020_11_24_390039	384	10	endoglycosidase	endoglycosidase	NN
10_1101-2020_11_24_390039	384	11	H	h	NN
10_1101-2020_11_24_390039	384	12	(	(	-LRB-
10_1101-2020_11_24_390039	384	13	Endo	Endo	NNP
10_1101-2020_11_24_390039	384	14	H	H	NNP
10_1101-2020_11_24_390039	384	15	)	)	-RRB-
10_1101-2020_11_24_390039	384	16	.	.	.
10_1101-2020_11_24_390039	385	1	(	(	-LRB-
10_1101-2020_11_24_390039	385	2	B	b	NN
10_1101-2020_11_24_390039	385	3	)	)	-RRB-
10_1101-2020_11_24_390039	385	4	Protein	protein	NN
10_1101-2020_11_24_390039	385	5	precursors	precursor	NNS
10_1101-2020_11_24_390039	385	6	of	of	IN
10_1101-2020_11_24_390039	385	7	the	the	DT
10_1101-2020_11_24_390039	385	8	human	human	NN
10_1101-2020_11_24_390039	385	9	angiotensin-	angiotensin-	JJ
10_1101-2020_11_24_390039	385	10	converting	convert	VBG
10_1101-2020_11_24_390039	385	11	enzyme	enzyme	NNS
10_1101-2020_11_24_390039	385	12	2	2	CD
10_1101-2020_11_24_390039	385	13	(	(	-LRB-
10_1101-2020_11_24_390039	385	14	ACE2	ACE2	NNP
10_1101-2020_11_24_390039	385	15	)	)	-RRB-
10_1101-2020_11_24_390039	385	16	and	and	CC
10_1101-2020_11_24_390039	385	17	OPG2-tagged	opg2-tagged	JJ
10_1101-2020_11_24_390039	385	18	versions	version	NNS
10_1101-2020_11_24_390039	385	19	of	of	IN
10_1101-2020_11_24_390039	385	20	the	the	DT
10_1101-2020_11_24_390039	385	21	SARS	SARS	NNP
10_1101-2020_11_24_390039	385	22	-	-	HYPH
10_1101-2020_11_24_390039	385	23	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	385	24	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	385	25	(	(	-LRB-
10_1101-2020_11_24_390039	385	26	ORF8-OPG2	ORF8-OPG2	NNP
10_1101-2020_11_24_390039	385	27	)	)	-RRB-
10_1101-2020_11_24_390039	385	28	,	,	,
10_1101-2020_11_24_390039	385	29	spike	spike	NNP
10_1101-2020_11_24_390039	385	30	(	(	-LRB-
10_1101-2020_11_24_390039	385	31	S	S	NNP
10_1101-2020_11_24_390039	385	32	-	-	HYPH
10_1101-2020_11_24_390039	385	33	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	385	34	)	)	-RRB-
10_1101-2020_11_24_390039	385	35	,	,	,
10_1101-2020_11_24_390039	385	36	envelope	envelope	NNP
10_1101-2020_11_24_390039	385	37	(	(	-LRB-
10_1101-2020_11_24_390039	385	38	OPG2-E	OPG2-E	NNP
10_1101-2020_11_24_390039	385	39	)	)	-RRB-
10_1101-2020_11_24_390039	385	40	,	,	,
10_1101-2020_11_24_390039	385	41	membrane	membrane	NN
10_1101-2020_11_24_390039	385	42	(	(	-LRB-
10_1101-2020_11_24_390039	385	43	M-	M-	NNP
10_1101-2020_11_24_390039	385	44	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	385	45	)	)	-RRB-
10_1101-2020_11_24_390039	385	46	and	and	CC
10_1101-2020_11_24_390039	385	47	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	385	48	(	(	-LRB-
10_1101-2020_11_24_390039	385	49	a	a	DT
10_1101-2020_11_24_390039	385	50	doubly	doubly	RB
10_1101-2020_11_24_390039	385	51	-	-	HYPH
10_1101-2020_11_24_390039	385	52	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	385	53	tagged	tag	VBN
10_1101-2020_11_24_390039	385	54	version	version	NN
10_1101-2020_11_24_390039	385	55	,	,	,
10_1101-2020_11_24_390039	385	56	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	385	57	,	,	,
10_1101-2020_11_24_390039	385	58	and	and	CC
10_1101-2020_11_24_390039	385	59	two	two	CD
10_1101-2020_11_24_390039	385	60	singly	singly	RB
10_1101-2020_11_24_390039	385	61	-	-	HYPH
10_1101-2020_11_24_390039	385	62	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	385	63	tagged	tag	VBN
10_1101-2020_11_24_390039	385	64	forms	form	NNS
10_1101-2020_11_24_390039	385	65	,	,	,
10_1101-2020_11_24_390039	385	66	OPG2-ORF6	OPG2-ORF6	NNP
10_1101-2020_11_24_390039	385	67	and	and	CC
10_1101-2020_11_24_390039	385	68	ORF6-OPG2	ORF6-OPG2	NNP
10_1101-2020_11_24_390039	385	69	,	,	,
10_1101-2020_11_24_390039	385	70	with	with	IN
10_1101-2020_11_24_390039	385	71	predominant	predominant	NNP
10_1101-2020_11_24_390039	385	72	N-	n-	CD
10_1101-2020_11_24_390039	385	73	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	385	74	species	specie	NNS
10_1101-2020_11_24_390039	385	75	in	in	IN
10_1101-2020_11_24_390039	385	76	bold	bold	NNP
10_1101-2020_11_24_390039	385	77	)	)	-RRB-
10_1101-2020_11_24_390039	385	78	were	be	VBD
10_1101-2020_11_24_390039	385	79	synthesised	synthesise	VBN
10_1101-2020_11_24_390039	385	80	in	in	IN
10_1101-2020_11_24_390039	385	81	rabbit	rabbit	NN
10_1101-2020_11_24_390039	385	82	reticulocyte	reticulocyte	NNP
10_1101-2020_11_24_390039	385	83	lysate	lysate	NN
10_1101-2020_11_24_390039	385	84	supplemented	supplement	VBN
10_1101-2020_11_24_390039	385	85	with	with	IN
10_1101-2020_11_24_390039	385	86	ER	ER	NNP
10_1101-2020_11_24_390039	385	87	microsomes	microsome	NNS
10_1101-2020_11_24_390039	385	88	without	without	IN
10_1101-2020_11_24_390039	385	89	or	or	CC
10_1101-2020_11_24_390039	385	90	with	with	IN
10_1101-2020_11_24_390039	385	91	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	385	92	-	-	HYPH
10_1101-2020_11_24_390039	385	93	F	F	NNP
10_1101-2020_11_24_390039	385	94	(	(	-LRB-
10_1101-2020_11_24_390039	385	95	lanes	lanes	NNP
10_1101-2020_11_24_390039	385	96	1	1	CD
10_1101-2020_11_24_390039	385	97	and	and	CC
10_1101-2020_11_24_390039	385	98	3	3	CD
10_1101-2020_11_24_390039	385	99	)	)	-RRB-
10_1101-2020_11_24_390039	385	100	.	.	.
10_1101-2020_11_24_390039	386	1	Phosphorimages	phosphorimage	NNS
10_1101-2020_11_24_390039	386	2	of	of	IN
10_1101-2020_11_24_390039	386	3	membrane	membrane	NN
10_1101-2020_11_24_390039	386	4	-	-	HYPH
10_1101-2020_11_24_390039	386	5	associated	associate	VBN
10_1101-2020_11_24_390039	386	6	products	product	NNS
10_1101-2020_11_24_390039	386	7	resolved	resolve	VBN
10_1101-2020_11_24_390039	386	8	by	by	IN
10_1101-2020_11_24_390039	386	9	SDS	SDS	NNP
10_1101-2020_11_24_390039	386	10	-	-	HYPH
10_1101-2020_11_24_390039	386	11	PAGE	PAGE	NNP
10_1101-2020_11_24_390039	386	12	with	with	IN
10_1101-2020_11_24_390039	386	13	representative	representative	JJ
10_1101-2020_11_24_390039	386	14	substrate	substrate	NN
10_1101-2020_11_24_390039	386	15	outlines	outline	NNS
10_1101-2020_11_24_390039	386	16	are	be	VBP
10_1101-2020_11_24_390039	386	17	shown	show	VBN
10_1101-2020_11_24_390039	386	18	.	.	.
10_1101-2020_11_24_390039	387	1	N	n	NN
10_1101-2020_11_24_390039	387	2	-	-	HYPH
10_1101-2020_11_24_390039	387	3	glycosylation	glycosylation	NN
10_1101-2020_11_24_390039	387	4	was	be	VBD
10_1101-2020_11_24_390039	387	5	used	use	VBN
10_1101-2020_11_24_390039	387	6	to	to	TO
10_1101-2020_11_24_390039	387	7	measure	measure	VB
10_1101-2020_11_24_390039	387	8	the	the	DT
10_1101-2020_11_24_390039	387	9	efficiency	efficiency	NN
10_1101-2020_11_24_390039	387	10	of	of	IN
10_1101-2020_11_24_390039	387	11	membrane	membrane	NN
10_1101-2020_11_24_390039	387	12	translocation	translocation	NN
10_1101-2020_11_24_390039	387	13	/	/	SYM
10_1101-2020_11_24_390039	387	14	insertion	insertion	NN
10_1101-2020_11_24_390039	387	15	and	and	CC
10_1101-2020_11_24_390039	387	16	N	N	NNP
10_1101-2020_11_24_390039	387	17	-	-	HYPH
10_1101-2020_11_24_390039	387	18	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	387	19	(	(	-LRB-
10_1101-2020_11_24_390039	387	20	X	X	NNP
10_1101-2020_11_24_390039	387	21	-	-	NNP
10_1101-2020_11_24_390039	387	22	Gly	gly	NN
10_1101-2020_11_24_390039	387	23	)	)	-RRB-
10_1101-2020_11_24_390039	387	24	versus	versus	IN
10_1101-2020_11_24_390039	387	25	non	non	JJ
10_1101-2020_11_24_390039	387	26	-	-	JJ
10_1101-2020_11_24_390039	387	27	N	n	JJ
10_1101-2020_11_24_390039	387	28	-	-	HYPH
10_1101-2020_11_24_390039	387	29	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	387	30	(	(	-LRB-
10_1101-2020_11_24_390039	387	31	0Gly	0gly	NN
10_1101-2020_11_24_390039	387	32	)	)	-RRB-
10_1101-2020_11_24_390039	387	33	species	specie	NNS
10_1101-2020_11_24_390039	387	34	identified	identify	VBN
10_1101-2020_11_24_390039	387	35	using	use	VBG
10_1101-2020_11_24_390039	387	36	Endo	Endo	NNP
10_1101-2020_11_24_390039	387	37	H	H	NNP
10_1101-2020_11_24_390039	387	38	(	(	-LRB-
10_1101-2020_11_24_390039	387	39	see	see	VB
10_1101-2020_11_24_390039	387	40	lane	lane	NNP
10_1101-2020_11_24_390039	387	41	2	2	CD
10_1101-2020_11_24_390039	387	42	)	)	-RRB-
10_1101-2020_11_24_390039	387	43	.	.	.
10_1101-2020_11_24_390039	388	1	(	(	-LRB-
10_1101-2020_11_24_390039	388	2	C	C	NNP
10_1101-2020_11_24_390039	388	3	)	)	-RRB-
10_1101-2020_11_24_390039	388	4	The	the	DT
10_1101-2020_11_24_390039	388	5	relative	relative	JJ
10_1101-2020_11_24_390039	388	6	efficiency	efficiency	NN
10_1101-2020_11_24_390039	388	7	of	of	IN
10_1101-2020_11_24_390039	388	8	membrane	membrane	NN
10_1101-2020_11_24_390039	388	9	translocation	translocation	NN
10_1101-2020_11_24_390039	388	10	/	/	SYM
10_1101-2020_11_24_390039	388	11	insertion	insertion	NN
10_1101-2020_11_24_390039	388	12	in	in	IN
10_1101-2020_11_24_390039	388	13	the	the	DT
10_1101-2020_11_24_390039	388	14	.CC	.CC	:
10_1101-2020_11_24_390039	388	15	-	-	HYPH
10_1101-2020_11_24_390039	388	16	BY	by	IN
10_1101-2020_11_24_390039	388	17	-	-	HYPH
10_1101-2020_11_24_390039	388	18	ND	ND	NNP
10_1101-2020_11_24_390039	388	19	4.0	4.0	CD
10_1101-2020_11_24_390039	388	20	International	international	JJ
10_1101-2020_11_24_390039	388	21	licensemade	licensemade	NN
10_1101-2020_11_24_390039	388	22	available	available	JJ
10_1101-2020_11_24_390039	388	23	under	under	IN
10_1101-2020_11_24_390039	388	24	a	a	DT
10_1101-2020_11_24_390039	388	25	(	(	-LRB-
10_1101-2020_11_24_390039	388	26	which	which	WDT
10_1101-2020_11_24_390039	388	27	was	be	VBD
10_1101-2020_11_24_390039	388	28	not	not	RB
10_1101-2020_11_24_390039	388	29	certified	certify	VBN
10_1101-2020_11_24_390039	388	30	by	by	IN
10_1101-2020_11_24_390039	388	31	peer	peer	NN
10_1101-2020_11_24_390039	388	32	review	review	NN
10_1101-2020_11_24_390039	388	33	)	)	-RRB-
10_1101-2020_11_24_390039	388	34	is	be	VBZ
10_1101-2020_11_24_390039	388	35	the	the	DT
10_1101-2020_11_24_390039	388	36	author	author	NN
10_1101-2020_11_24_390039	388	37	/	/	SYM
10_1101-2020_11_24_390039	388	38	funder	funder	NN
10_1101-2020_11_24_390039	388	39	,	,	,
10_1101-2020_11_24_390039	388	40	who	who	WP
10_1101-2020_11_24_390039	388	41	has	have	VBZ
10_1101-2020_11_24_390039	388	42	granted	grant	VBN
10_1101-2020_11_24_390039	388	43	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	388	44	a	a	DT
10_1101-2020_11_24_390039	388	45	license	license	NN
10_1101-2020_11_24_390039	388	46	to	to	TO
10_1101-2020_11_24_390039	388	47	display	display	VB
10_1101-2020_11_24_390039	388	48	the	the	DT
10_1101-2020_11_24_390039	388	49	preprint	preprint	NN
10_1101-2020_11_24_390039	388	50	in	in	IN
10_1101-2020_11_24_390039	388	51	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	388	52	.	.	.
10_1101-2020_11_24_390039	389	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	389	2	is	be	VBZ
10_1101-2020_11_24_390039	389	3	The	the	DT
10_1101-2020_11_24_390039	389	4	copyright	copyright	NN
10_1101-2020_11_24_390039	389	5	holder	holder	NN
10_1101-2020_11_24_390039	389	6	for	for	IN
10_1101-2020_11_24_390039	389	7	this	this	DT
10_1101-2020_11_24_390039	389	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	389	9	version	version	NN
10_1101-2020_11_24_390039	389	10	posted	post	VBD
10_1101-2020_11_24_390039	389	11	January	January	NNP
10_1101-2020_11_24_390039	389	12	5	5	CD
10_1101-2020_11_24_390039	389	13	,	,	,
10_1101-2020_11_24_390039	389	14	2021	2021	CD
10_1101-2020_11_24_390039	389	15	.	.	.
10_1101-2020_11_24_390039	389	16	;	;	:
10_1101-2020_11_24_390039	389	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	389	18	:	:	:
10_1101-2020_11_24_390039	389	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	389	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	389	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	389	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	389	23	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	389	24	-	-	HYPH
10_1101-2020_11_24_390039	389	25	F	F	NNP
10_1101-2020_11_24_390039	389	26	as	as	IN
10_1101-2020_11_24_390039	389	27	a	a	DT
10_1101-2020_11_24_390039	389	28	potential	potential	JJ
10_1101-2020_11_24_390039	389	29	antiviral	antiviral	JJ
10_1101-2020_11_24_390039	389	30	agent	agent	NN
10_1101-2020_11_24_390039	389	31	Page	Page	NNP
10_1101-2020_11_24_390039	389	32	21	21	CD
10_1101-2020_11_24_390039	389	33	of	of	IN
10_1101-2020_11_24_390039	389	34	21	21	CD
10_1101-2020_11_24_390039	389	35	presence	presence	NN
10_1101-2020_11_24_390039	389	36	of	of	IN
10_1101-2020_11_24_390039	389	37	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	389	38	-	-	HYPH
10_1101-2020_11_24_390039	389	39	F	F	NNP
10_1101-2020_11_24_390039	389	40	was	be	VBD
10_1101-2020_11_24_390039	389	41	calculated	calculate	VBN
10_1101-2020_11_24_390039	389	42	using	use	VBG
10_1101-2020_11_24_390039	389	43	the	the	DT
10_1101-2020_11_24_390039	389	44	ratio	ratio	NN
10_1101-2020_11_24_390039	389	45	of	of	IN
10_1101-2020_11_24_390039	389	46	N	n	NN
10_1101-2020_11_24_390039	389	47	-	-	HYPH
10_1101-2020_11_24_390039	389	48	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	389	49	protein	protein	NN
10_1101-2020_11_24_390039	389	50	to	to	IN
10_1101-2020_11_24_390039	389	51	non	non	JJ
10_1101-2020_11_24_390039	389	52	-	-	JJ
10_1101-2020_11_24_390039	389	53	glycosylated	glycosylated	JJ
10_1101-2020_11_24_390039	389	54	protein	protein	NN
10_1101-2020_11_24_390039	389	55	,	,	,
10_1101-2020_11_24_390039	389	56	relative	relative	JJ
10_1101-2020_11_24_390039	389	57	to	to	IN
10_1101-2020_11_24_390039	389	58	the	the	DT
10_1101-2020_11_24_390039	389	59	DMSO	DMSO	NNP
10_1101-2020_11_24_390039	389	60	treated	treat	VBN
10_1101-2020_11_24_390039	389	61	control	control	NN
10_1101-2020_11_24_390039	389	62	(	(	-LRB-
10_1101-2020_11_24_390039	389	63	set	set	VBN
10_1101-2020_11_24_390039	389	64	to	to	IN
10_1101-2020_11_24_390039	389	65	100	100	CD
10_1101-2020_11_24_390039	389	66	%	%	NN
10_1101-2020_11_24_390039	389	67	efficiency	efficiency	NN
10_1101-2020_11_24_390039	389	68	)	)	-RRB-
10_1101-2020_11_24_390039	389	69	.	.	.
10_1101-2020_11_24_390039	390	1	Quantitations	quantitation	NNS
10_1101-2020_11_24_390039	390	2	are	be	VBP
10_1101-2020_11_24_390039	390	3	given	give	VBN
10_1101-2020_11_24_390039	390	4	as	as	IN
10_1101-2020_11_24_390039	390	5	mean±s.e.m	mean±s.e.m	NN
10_1101-2020_11_24_390039	390	6	for	for	IN
10_1101-2020_11_24_390039	390	7	independent	independent	JJ
10_1101-2020_11_24_390039	390	8	translation	translation	NN
10_1101-2020_11_24_390039	390	9	reactions	reaction	NNS
10_1101-2020_11_24_390039	390	10	performed	perform	VBN
10_1101-2020_11_24_390039	390	11	in	in	IN
10_1101-2020_11_24_390039	390	12	triplicate	triplicate	NN
10_1101-2020_11_24_390039	390	13	(	(	-LRB-
10_1101-2020_11_24_390039	390	14	n=3	n=3	NNP
10_1101-2020_11_24_390039	390	15	)	)	-RRB-
10_1101-2020_11_24_390039	390	16	and	and	CC
10_1101-2020_11_24_390039	390	17	statistical	statistical	JJ
10_1101-2020_11_24_390039	390	18	significance	significance	NN
10_1101-2020_11_24_390039	390	19	(	(	-LRB-
10_1101-2020_11_24_390039	390	20	one	one	CD
10_1101-2020_11_24_390039	390	21	-	-	HYPH
10_1101-2020_11_24_390039	390	22	way	way	NN
10_1101-2020_11_24_390039	390	23	ANOVA	ANOVA	NNP
10_1101-2020_11_24_390039	390	24	,	,	,
10_1101-2020_11_24_390039	390	25	DF	DF	NNP
10_1101-2020_11_24_390039	390	26	and	and	CC
10_1101-2020_11_24_390039	390	27	F	F	NNP
10_1101-2020_11_24_390039	390	28	values	value	NNS
10_1101-2020_11_24_390039	390	29	shown	show	VBN
10_1101-2020_11_24_390039	390	30	in	in	IN
10_1101-2020_11_24_390039	390	31	the	the	DT
10_1101-2020_11_24_390039	390	32	figure	figure	NN
10_1101-2020_11_24_390039	390	33	)	)	-RRB-
10_1101-2020_11_24_390039	390	34	was	be	VBD
10_1101-2020_11_24_390039	390	35	determined	determine	VBN
10_1101-2020_11_24_390039	390	36	using	use	VBG
10_1101-2020_11_24_390039	390	37	Dunnett	Dunnett	NNP
10_1101-2020_11_24_390039	390	38	’s	’s	POS
10_1101-2020_11_24_390039	390	39	multiple	multiple	JJ
10_1101-2020_11_24_390039	390	40	comparisons	comparison	NNS
10_1101-2020_11_24_390039	390	41	test	test	NN
10_1101-2020_11_24_390039	390	42	.	.	.
10_1101-2020_11_24_390039	391	1	Statistical	statistical	JJ
10_1101-2020_11_24_390039	391	2	significance	significance	NN
10_1101-2020_11_24_390039	391	3	:	:	:
10_1101-2020_11_24_390039	391	4	n.s	n.s	NNP
10_1101-2020_11_24_390039	391	5	.	.	NNP
10_1101-2020_11_24_390039	391	6	,	,	,
10_1101-2020_11_24_390039	391	7	non	non	JJ
10_1101-2020_11_24_390039	391	8	-	-	JJ
10_1101-2020_11_24_390039	391	9	significant	significant	JJ
10_1101-2020_11_24_390039	391	10	>	>	NN
10_1101-2020_11_24_390039	391	11	0.1	0.1	CD
10_1101-2020_11_24_390039	391	12	;	;	:
10_1101-2020_11_24_390039	391	13	*	*	NFP
10_1101-2020_11_24_390039	391	14	*	*	NFP
10_1101-2020_11_24_390039	391	15	*	*	NFP
10_1101-2020_11_24_390039	391	16	*	*	NFP
10_1101-2020_11_24_390039	391	17	,	,	,
10_1101-2020_11_24_390039	391	18	P	p	NN
10_1101-2020_11_24_390039	391	19	<	<	XX
10_1101-2020_11_24_390039	391	20	0.0001	0.0001	CD
10_1101-2020_11_24_390039	391	21	.	.	.
10_1101-2020_11_24_390039	392	1	Fig	fig	NN
10_1101-2020_11_24_390039	392	2	.	.	.
10_1101-2020_11_24_390039	393	1	3	3	LS
10_1101-2020_11_24_390039	393	2	.	.	.
10_1101-2020_11_24_390039	394	1	SARS	SARS	NNP
10_1101-2020_11_24_390039	394	2	-	-	HYPH
10_1101-2020_11_24_390039	394	3	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	394	4	proteins	protein	NNS
10_1101-2020_11_24_390039	394	5	are	be	VBP
10_1101-2020_11_24_390039	394	6	variably	variably	RB
10_1101-2020_11_24_390039	394	7	dependent	dependent	JJ
10_1101-2020_11_24_390039	394	8	on	on	IN
10_1101-2020_11_24_390039	394	9	the	the	DT
10_1101-2020_11_24_390039	394	10	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	394	11	complex	complex	NN
10_1101-2020_11_24_390039	394	12	and/or	and/or	CC
10_1101-2020_11_24_390039	394	13	the	the	DT
10_1101-2020_11_24_390039	394	14	EMC	emc	NN
10_1101-2020_11_24_390039	394	15	for	for	IN
10_1101-2020_11_24_390039	394	16	ER	ER	NNP
10_1101-2020_11_24_390039	394	17	membrane	membrane	NN
10_1101-2020_11_24_390039	394	18	translocation	translocation	NN
10_1101-2020_11_24_390039	394	19	/	/	SYM
10_1101-2020_11_24_390039	394	20	insertion	insertion	NN
10_1101-2020_11_24_390039	394	21	.	.	.
10_1101-2020_11_24_390039	395	1	(	(	-LRB-
10_1101-2020_11_24_390039	395	2	A	a	DT
10_1101-2020_11_24_390039	395	3	)	)	-RRB-
10_1101-2020_11_24_390039	395	4	Schematic	schematic	JJ
10_1101-2020_11_24_390039	395	5	of	of	IN
10_1101-2020_11_24_390039	395	6	in	in	FW
10_1101-2020_11_24_390039	395	7	vitro	vitro	FW
10_1101-2020_11_24_390039	395	8	ER	ER	NNP
10_1101-2020_11_24_390039	395	9	import	import	NN
10_1101-2020_11_24_390039	395	10	assay	assay	NN
10_1101-2020_11_24_390039	395	11	using	use	VBG
10_1101-2020_11_24_390039	395	12	control	control	NN
10_1101-2020_11_24_390039	395	13	SP	SP	NNP
10_1101-2020_11_24_390039	395	14	cells	cell	NNS
10_1101-2020_11_24_390039	395	15	,	,	,
10_1101-2020_11_24_390039	395	16	or	or	CC
10_1101-2020_11_24_390039	395	17	those	those	DT
10_1101-2020_11_24_390039	395	18	depleted	deplete	VBN
10_1101-2020_11_24_390039	395	19	of	of	IN
10_1101-2020_11_24_390039	395	20	a	a	DT
10_1101-2020_11_24_390039	395	21	subunit	subunit	NN
10_1101-2020_11_24_390039	395	22	of	of	IN
10_1101-2020_11_24_390039	395	23	the	the	DT
10_1101-2020_11_24_390039	395	24	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	395	25	complex	complex	NN
10_1101-2020_11_24_390039	395	26	and/or	and/or	CC
10_1101-2020_11_24_390039	395	27	the	the	DT
10_1101-2020_11_24_390039	395	28	EMC	EMC	NNP
10_1101-2020_11_24_390039	395	29	via	via	IN
10_1101-2020_11_24_390039	395	30	siRNA	siRNA	NNP
10_1101-2020_11_24_390039	395	31	.	.	.
10_1101-2020_11_24_390039	396	1	Following	follow	VBG
10_1101-2020_11_24_390039	396	2	translation	translation	NN
10_1101-2020_11_24_390039	396	3	,	,	,
10_1101-2020_11_24_390039	396	4	OPG2-	OPG2-	VBD
10_1101-2020_11_24_390039	396	5	tagged	tag	VBN
10_1101-2020_11_24_390039	396	6	translation	translation	NN
10_1101-2020_11_24_390039	396	7	products	product	NNS
10_1101-2020_11_24_390039	396	8	(	(	-LRB-
10_1101-2020_11_24_390039	396	9	i.e.	i.e.	FW
10_1101-2020_11_24_390039	397	1	membrane	membrane	NN
10_1101-2020_11_24_390039	397	2	-	-	HYPH
10_1101-2020_11_24_390039	397	3	associated	associate	VBN
10_1101-2020_11_24_390039	397	4	and	and	CC
10_1101-2020_11_24_390039	397	5	non	non	JJ
10_1101-2020_11_24_390039	397	6	-	-	JJ
10_1101-2020_11_24_390039	397	7	targeted	target	VBN
10_1101-2020_11_24_390039	397	8	nascent	nascent	JJ
10_1101-2020_11_24_390039	397	9	chains	chain	NNS
10_1101-2020_11_24_390039	397	10	)	)	-RRB-
10_1101-2020_11_24_390039	397	11	were	be	VBD
10_1101-2020_11_24_390039	397	12	immunoprecipitated	immunoprecipitate	VBN
10_1101-2020_11_24_390039	397	13	,	,	,
10_1101-2020_11_24_390039	397	14	resolved	resolve	VBN
10_1101-2020_11_24_390039	397	15	by	by	IN
10_1101-2020_11_24_390039	397	16	SDS	SDS	NNP
10_1101-2020_11_24_390039	397	17	-	-	HYPH
10_1101-2020_11_24_390039	397	18	PAGE	PAGE	NNP
10_1101-2020_11_24_390039	397	19	and	and	CC
10_1101-2020_11_24_390039	397	20	analysed	analyse	VBN
10_1101-2020_11_24_390039	397	21	by	by	IN
10_1101-2020_11_24_390039	397	22	phosphorimaging	phosphorimage	VBG
10_1101-2020_11_24_390039	397	23	.	.	.
10_1101-2020_11_24_390039	398	1	OPG2-tagged	opg2-tagged	JJ
10_1101-2020_11_24_390039	398	2	variants	variant	NNS
10_1101-2020_11_24_390039	398	3	of	of	IN
10_1101-2020_11_24_390039	398	4	the	the	DT
10_1101-2020_11_24_390039	398	5	SARS	SARS	NNP
10_1101-2020_11_24_390039	398	6	-	-	HYPH
10_1101-2020_11_24_390039	398	7	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	398	8	(	(	-LRB-
10_1101-2020_11_24_390039	398	9	B	b	NN
10_1101-2020_11_24_390039	398	10	)	)	-RRB-
10_1101-2020_11_24_390039	398	11	spike	spike	NNP
10_1101-2020_11_24_390039	398	12	(	(	-LRB-
10_1101-2020_11_24_390039	398	13	S-	s-	XX
10_1101-2020_11_24_390039	398	14	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	398	15	)	)	-RRB-
10_1101-2020_11_24_390039	398	16	,	,	,
10_1101-2020_11_24_390039	398	17	(	(	-LRB-
10_1101-2020_11_24_390039	398	18	C	c	NN
10_1101-2020_11_24_390039	398	19	)	)	-RRB-
10_1101-2020_11_24_390039	398	20	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	398	21	(	(	-LRB-
10_1101-2020_11_24_390039	398	22	ORF8-OPG2	ORF8-OPG2	NNP
10_1101-2020_11_24_390039	398	23	)	)	-RRB-
10_1101-2020_11_24_390039	398	24	,	,	,
10_1101-2020_11_24_390039	398	25	(	(	-LRB-
10_1101-2020_11_24_390039	398	26	D	d	NN
10_1101-2020_11_24_390039	398	27	)	)	-RRB-
10_1101-2020_11_24_390039	398	28	envelope	envelope	NNP
10_1101-2020_11_24_390039	398	29	(	(	-LRB-
10_1101-2020_11_24_390039	398	30	OPG2-E	OPG2-E	NNP
10_1101-2020_11_24_390039	398	31	)	)	-RRB-
10_1101-2020_11_24_390039	398	32	and	and	CC
10_1101-2020_11_24_390039	398	33	(	(	-LRB-
10_1101-2020_11_24_390039	398	34	E	e	NN
10_1101-2020_11_24_390039	398	35	)	)	-RRB-
10_1101-2020_11_24_390039	398	36	ORF6	orf6	ADD
10_1101-2020_11_24_390039	398	37	(	(	-LRB-
10_1101-2020_11_24_390039	398	38	OPG2-	OPG2-	NNP
10_1101-2020_11_24_390039	398	39	ORF6-OPG2	ORF6-OPG2	NNP
10_1101-2020_11_24_390039	398	40	species	specie	NNS
10_1101-2020_11_24_390039	398	41	(	(	-LRB-
10_1101-2020_11_24_390039	398	42	labelled	label	VBN
10_1101-2020_11_24_390039	398	43	as	as	IN
10_1101-2020_11_24_390039	398	44	for	for	IN
10_1101-2020_11_24_390039	398	45	Fig	Fig	NNP
10_1101-2020_11_24_390039	398	46	.	.	.
10_1101-2020_11_24_390039	399	1	2	2	LS
10_1101-2020_11_24_390039	399	2	)	)	-RRB-
10_1101-2020_11_24_390039	399	3	were	be	VBD
10_1101-2020_11_24_390039	399	4	synthesised	synthesise	VBN
10_1101-2020_11_24_390039	399	5	in	in	IN
10_1101-2020_11_24_390039	399	6	rabbit	rabbit	NN
10_1101-2020_11_24_390039	399	7	reticulocyte	reticulocyte	NNP
10_1101-2020_11_24_390039	399	8	lysate	lysate	NN
10_1101-2020_11_24_390039	399	9	supplemented	supplement	VBN
10_1101-2020_11_24_390039	399	10	with	with	IN
10_1101-2020_11_24_390039	399	11	control	control	NN
10_1101-2020_11_24_390039	399	12	SP	SP	NNP
10_1101-2020_11_24_390039	399	13	cells	cell	NNS
10_1101-2020_11_24_390039	399	14	(	(	-LRB-
10_1101-2020_11_24_390039	399	15	lanes	lanes	NNP
10_1101-2020_11_24_390039	399	16	1	1	CD
10_1101-2020_11_24_390039	399	17	-	-	SYM
10_1101-2020_11_24_390039	399	18	2	2	CD
10_1101-2020_11_24_390039	399	19	)	)	-RRB-
10_1101-2020_11_24_390039	399	20	or	or	CC
10_1101-2020_11_24_390039	399	21	those	those	DT
10_1101-2020_11_24_390039	399	22	with	with	IN
10_1101-2020_11_24_390039	399	23	impaired	impaired	JJ
10_1101-2020_11_24_390039	399	24	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	399	25	and/or	and/or	CC
10_1101-2020_11_24_390039	399	26	EMC	EMC	NNP
10_1101-2020_11_24_390039	399	27	function	function	NN
10_1101-2020_11_24_390039	399	28	(	(	-LRB-
10_1101-2020_11_24_390039	399	29	lanes	lanes	NNP
10_1101-2020_11_24_390039	399	30	3	3	CD
10_1101-2020_11_24_390039	399	31	-	-	SYM
10_1101-2020_11_24_390039	399	32	6	6	CD
10_1101-2020_11_24_390039	399	33	)	)	-RRB-
10_1101-2020_11_24_390039	399	34	.	.	.
10_1101-2020_11_24_390039	400	1	Radiolabelled	radiolabelle	VBN
10_1101-2020_11_24_390039	400	2	products	product	NNS
10_1101-2020_11_24_390039	400	3	were	be	VBD
10_1101-2020_11_24_390039	400	4	recovered	recover	VBN
10_1101-2020_11_24_390039	400	5	and	and	CC
10_1101-2020_11_24_390039	400	6	analysed	analyse	VBN
10_1101-2020_11_24_390039	400	7	as	as	IN
10_1101-2020_11_24_390039	400	8	in	in	IN
10_1101-2020_11_24_390039	400	9	(	(	-LRB-
10_1101-2020_11_24_390039	400	10	A	a	NN
10_1101-2020_11_24_390039	400	11	)	)	-RRB-
10_1101-2020_11_24_390039	400	12	.	.	.
10_1101-2020_11_24_390039	401	1	Membrane	membrane	NN
10_1101-2020_11_24_390039	401	2	translocation	translocation	NN
10_1101-2020_11_24_390039	401	3	/	/	SYM
10_1101-2020_11_24_390039	401	4	insertion	insertion	NN
10_1101-2020_11_24_390039	401	5	efficiency	efficiency	NN
10_1101-2020_11_24_390039	401	6	was	be	VBD
10_1101-2020_11_24_390039	401	7	determined	determine	VBN
10_1101-2020_11_24_390039	401	8	using	use	VBG
10_1101-2020_11_24_390039	401	9	the	the	DT
10_1101-2020_11_24_390039	401	10	ratio	ratio	NN
10_1101-2020_11_24_390039	401	11	of	of	IN
10_1101-2020_11_24_390039	401	12	the	the	DT
10_1101-2020_11_24_390039	401	13	N	n	NN
10_1101-2020_11_24_390039	401	14	-	-	HYPH
10_1101-2020_11_24_390039	401	15	glycosylation	glycosylation	NN
10_1101-2020_11_24_390039	401	16	of	of	IN
10_1101-2020_11_24_390039	401	17	lumenal	lumenal	JJ
10_1101-2020_11_24_390039	401	18	domains	domain	NNS
10_1101-2020_11_24_390039	401	19	,	,	,
10_1101-2020_11_24_390039	401	20	identified	identify	VBN
10_1101-2020_11_24_390039	401	21	using	use	VBG
10_1101-2020_11_24_390039	401	22	Endo	Endo	NNP
10_1101-2020_11_24_390039	401	23	H	H	NNP
10_1101-2020_11_24_390039	401	24	(	(	-LRB-
10_1101-2020_11_24_390039	401	25	EH	EH	NNP
10_1101-2020_11_24_390039	401	26	,	,	,
10_1101-2020_11_24_390039	401	27	lane	lane	NNP
10_1101-2020_11_24_390039	401	28	1	1	CD
10_1101-2020_11_24_390039	401	29	)	)	-RRB-
10_1101-2020_11_24_390039	401	30	,	,	,
10_1101-2020_11_24_390039	401	31	relative	relative	JJ
10_1101-2020_11_24_390039	401	32	to	to	IN
10_1101-2020_11_24_390039	401	33	the	the	DT
10_1101-2020_11_24_390039	401	34	NT	NT	NNP
10_1101-2020_11_24_390039	401	35	control	control	NN
10_1101-2020_11_24_390039	401	36	(	(	-LRB-
10_1101-2020_11_24_390039	401	37	set	set	VBN
10_1101-2020_11_24_390039	401	38	to	to	IN
10_1101-2020_11_24_390039	401	39	100	100	CD
10_1101-2020_11_24_390039	401	40	%	%	NN
10_1101-2020_11_24_390039	401	41	translocation	translocation	NN
10_1101-2020_11_24_390039	401	42	/	/	SYM
10_1101-2020_11_24_390039	401	43	insertion	insertion	NN
10_1101-2020_11_24_390039	401	44	efficiency	efficiency	NN
10_1101-2020_11_24_390039	401	45	)	)	-RRB-
10_1101-2020_11_24_390039	401	46	.	.	.
10_1101-2020_11_24_390039	402	1	Quantitations	quantitation	NNS
10_1101-2020_11_24_390039	402	2	(	(	-LRB-
10_1101-2020_11_24_390039	402	3	n=3	n=3	NNP
10_1101-2020_11_24_390039	402	4	)	)	-RRB-
10_1101-2020_11_24_390039	402	5	and	and	CC
10_1101-2020_11_24_390039	402	6	statistical	statistical	JJ
10_1101-2020_11_24_390039	402	7	significance	significance	NN
10_1101-2020_11_24_390039	402	8	(	(	-LRB-
10_1101-2020_11_24_390039	402	9	two	two	CD
10_1101-2020_11_24_390039	402	10	-	-	HYPH
10_1101-2020_11_24_390039	402	11	way	way	NN
10_1101-2020_11_24_390039	402	12	ANOVA	ANOVA	NNP
10_1101-2020_11_24_390039	402	13	,	,	,
10_1101-2020_11_24_390039	402	14	DF	DF	NNP
10_1101-2020_11_24_390039	402	15	and	and	CC
10_1101-2020_11_24_390039	402	16	F	F	NNP
10_1101-2020_11_24_390039	402	17	values	value	NNS
10_1101-2020_11_24_390039	402	18	shown	show	VBN
10_1101-2020_11_24_390039	402	19	in	in	IN
10_1101-2020_11_24_390039	402	20	the	the	DT
10_1101-2020_11_24_390039	402	21	figure	figure	NN
10_1101-2020_11_24_390039	402	22	)	)	-RRB-
10_1101-2020_11_24_390039	402	23	determined	determine	VBD
10_1101-2020_11_24_390039	402	24	as	as	IN
10_1101-2020_11_24_390039	402	25	for	for	IN
10_1101-2020_11_24_390039	402	26	Figure	figure	NN
10_1101-2020_11_24_390039	402	27	2	2	CD
10_1101-2020_11_24_390039	402	28	.	.	.
10_1101-2020_11_24_390039	403	1	Statistical	statistical	JJ
10_1101-2020_11_24_390039	403	2	significance	significance	NN
10_1101-2020_11_24_390039	403	3	:	:	:
10_1101-2020_11_24_390039	403	4	n.s	n.s	NNP
10_1101-2020_11_24_390039	403	5	.	.	NNP
10_1101-2020_11_24_390039	403	6	,	,	,
10_1101-2020_11_24_390039	403	7	non	non	JJ
10_1101-2020_11_24_390039	403	8	-	-	JJ
10_1101-2020_11_24_390039	403	9	significant	significant	JJ
10_1101-2020_11_24_390039	403	10	>	>	NN
10_1101-2020_11_24_390039	403	11	0.1	0.1	CD
10_1101-2020_11_24_390039	403	12	;	;	:
10_1101-2020_11_24_390039	403	13	*	*	NFP
10_1101-2020_11_24_390039	403	14	,	,	,
10_1101-2020_11_24_390039	403	15	P	p	NN
10_1101-2020_11_24_390039	403	16	<	<	XX
10_1101-2020_11_24_390039	403	17	0.05	0.05	XX
10_1101-2020_11_24_390039	403	18	;	;	:
10_1101-2020_11_24_390039	403	19	*	*	NFP
10_1101-2020_11_24_390039	403	20	*	*	NFP
10_1101-2020_11_24_390039	403	21	,	,	,
10_1101-2020_11_24_390039	403	22	P	p	NN
10_1101-2020_11_24_390039	403	23	<	<	XX
10_1101-2020_11_24_390039	403	24	0.01	0.01	XX
10_1101-2020_11_24_390039	403	25	;	;	:
10_1101-2020_11_24_390039	403	26	*	*	NFP
10_1101-2020_11_24_390039	403	27	*	*	NFP
10_1101-2020_11_24_390039	403	28	*	*	NFP
10_1101-2020_11_24_390039	403	29	,	,	,
10_1101-2020_11_24_390039	403	30	P	p	NN
10_1101-2020_11_24_390039	403	31	<	<	XX
10_1101-2020_11_24_390039	403	32	0.001	0.001	CD
10_1101-2020_11_24_390039	403	33	;	;	:
10_1101-2020_11_24_390039	403	34	*	*	NFP
10_1101-2020_11_24_390039	403	35	*	*	NFP
10_1101-2020_11_24_390039	403	36	*	*	NFP
10_1101-2020_11_24_390039	403	37	*	*	NFP
10_1101-2020_11_24_390039	403	38	,	,	,
10_1101-2020_11_24_390039	403	39	P	p	NN
10_1101-2020_11_24_390039	403	40	<	<	XX
10_1101-2020_11_24_390039	403	41	0.0001	0.0001	CD
10_1101-2020_11_24_390039	403	42	.	.	.
10_1101-2020_11_24_390039	404	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	404	2	-	-	:
10_1101-2020_11_24_390039	404	3	BY	by	IN
10_1101-2020_11_24_390039	404	4	-	-	HYPH
10_1101-2020_11_24_390039	404	5	ND	ND	NNP
10_1101-2020_11_24_390039	404	6	4.0	4.0	CD
10_1101-2020_11_24_390039	404	7	International	international	JJ
10_1101-2020_11_24_390039	404	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	404	9	available	available	JJ
10_1101-2020_11_24_390039	404	10	under	under	IN
10_1101-2020_11_24_390039	404	11	a	a	DT
10_1101-2020_11_24_390039	404	12	(	(	-LRB-
10_1101-2020_11_24_390039	404	13	which	which	WDT
10_1101-2020_11_24_390039	404	14	was	be	VBD
10_1101-2020_11_24_390039	404	15	not	not	RB
10_1101-2020_11_24_390039	404	16	certified	certify	VBN
10_1101-2020_11_24_390039	404	17	by	by	IN
10_1101-2020_11_24_390039	404	18	peer	peer	NN
10_1101-2020_11_24_390039	404	19	review	review	NN
10_1101-2020_11_24_390039	404	20	)	)	-RRB-
10_1101-2020_11_24_390039	404	21	is	be	VBZ
10_1101-2020_11_24_390039	404	22	the	the	DT
10_1101-2020_11_24_390039	404	23	author	author	NN
10_1101-2020_11_24_390039	404	24	/	/	SYM
10_1101-2020_11_24_390039	404	25	funder	funder	NN
10_1101-2020_11_24_390039	404	26	,	,	,
10_1101-2020_11_24_390039	404	27	who	who	WP
10_1101-2020_11_24_390039	404	28	has	have	VBZ
10_1101-2020_11_24_390039	404	29	granted	grant	VBN
10_1101-2020_11_24_390039	404	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	404	31	a	a	DT
10_1101-2020_11_24_390039	404	32	license	license	NN
10_1101-2020_11_24_390039	404	33	to	to	TO
10_1101-2020_11_24_390039	404	34	display	display	VB
10_1101-2020_11_24_390039	404	35	the	the	DT
10_1101-2020_11_24_390039	404	36	preprint	preprint	NN
10_1101-2020_11_24_390039	404	37	in	in	IN
10_1101-2020_11_24_390039	404	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	404	39	.	.	.
10_1101-2020_11_24_390039	405	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	405	2	is	be	VBZ
10_1101-2020_11_24_390039	405	3	The	the	DT
10_1101-2020_11_24_390039	405	4	copyright	copyright	NN
10_1101-2020_11_24_390039	405	5	holder	holder	NN
10_1101-2020_11_24_390039	405	6	for	for	IN
10_1101-2020_11_24_390039	405	7	this	this	DT
10_1101-2020_11_24_390039	405	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	405	9	version	version	NN
10_1101-2020_11_24_390039	405	10	posted	post	VBD
10_1101-2020_11_24_390039	405	11	January	January	NNP
10_1101-2020_11_24_390039	405	12	5	5	CD
10_1101-2020_11_24_390039	405	13	,	,	,
10_1101-2020_11_24_390039	405	14	2021	2021	CD
10_1101-2020_11_24_390039	405	15	.	.	.
10_1101-2020_11_24_390039	405	16	;	;	:
10_1101-2020_11_24_390039	405	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	405	18	:	:	:
10_1101-2020_11_24_390039	405	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	405	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	405	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NNP
10_1101-2020_11_24_390039	405	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NN
10_1101-2020_11_24_390039	405	23	.CC	.CC	NFP
10_1101-2020_11_24_390039	405	24	-	-	:
10_1101-2020_11_24_390039	405	25	BY	by	IN
10_1101-2020_11_24_390039	405	26	-	-	HYPH
10_1101-2020_11_24_390039	405	27	ND	ND	NNP
10_1101-2020_11_24_390039	405	28	4.0	4.0	CD
10_1101-2020_11_24_390039	405	29	International	international	JJ
10_1101-2020_11_24_390039	405	30	licensemade	licensemade	NN
10_1101-2020_11_24_390039	405	31	available	available	JJ
10_1101-2020_11_24_390039	405	32	under	under	IN
10_1101-2020_11_24_390039	405	33	a	a	DT
10_1101-2020_11_24_390039	405	34	(	(	-LRB-
10_1101-2020_11_24_390039	405	35	which	which	WDT
10_1101-2020_11_24_390039	405	36	was	be	VBD
10_1101-2020_11_24_390039	405	37	not	not	RB
10_1101-2020_11_24_390039	405	38	certified	certify	VBN
10_1101-2020_11_24_390039	405	39	by	by	IN
10_1101-2020_11_24_390039	405	40	peer	peer	NN
10_1101-2020_11_24_390039	405	41	review	review	NN
10_1101-2020_11_24_390039	405	42	)	)	-RRB-
10_1101-2020_11_24_390039	405	43	is	be	VBZ
10_1101-2020_11_24_390039	405	44	the	the	DT
10_1101-2020_11_24_390039	405	45	author	author	NN
10_1101-2020_11_24_390039	405	46	/	/	SYM
10_1101-2020_11_24_390039	405	47	funder	funder	NN
10_1101-2020_11_24_390039	405	48	,	,	,
10_1101-2020_11_24_390039	405	49	who	who	WP
10_1101-2020_11_24_390039	405	50	has	have	VBZ
10_1101-2020_11_24_390039	405	51	granted	grant	VBN
10_1101-2020_11_24_390039	405	52	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	405	53	a	a	DT
10_1101-2020_11_24_390039	405	54	license	license	NN
10_1101-2020_11_24_390039	405	55	to	to	TO
10_1101-2020_11_24_390039	405	56	display	display	VB
10_1101-2020_11_24_390039	405	57	the	the	DT
10_1101-2020_11_24_390039	405	58	preprint	preprint	NN
10_1101-2020_11_24_390039	405	59	in	in	IN
10_1101-2020_11_24_390039	405	60	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	405	61	.	.	.
10_1101-2020_11_24_390039	406	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	406	2	is	be	VBZ
10_1101-2020_11_24_390039	406	3	The	the	DT
10_1101-2020_11_24_390039	406	4	copyright	copyright	NN
10_1101-2020_11_24_390039	406	5	holder	holder	NN
10_1101-2020_11_24_390039	406	6	for	for	IN
10_1101-2020_11_24_390039	406	7	this	this	DT
10_1101-2020_11_24_390039	406	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	406	9	version	version	NN
10_1101-2020_11_24_390039	406	10	posted	post	VBD
10_1101-2020_11_24_390039	406	11	January	January	NNP
10_1101-2020_11_24_390039	406	12	5	5	CD
10_1101-2020_11_24_390039	406	13	,	,	,
10_1101-2020_11_24_390039	406	14	2021	2021	CD
10_1101-2020_11_24_390039	406	15	.	.	.
10_1101-2020_11_24_390039	406	16	;	;	:
10_1101-2020_11_24_390039	406	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	406	18	:	:	:
10_1101-2020_11_24_390039	406	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	406	20	preprint	preprint	NN
10_1101-2020_11_24_390039	406	21	mqbssysh	mqbssysh	NNS
10_1101-2020_11_24_390039	406	22	Typewritten	Typewritten	NNP
10_1101-2020_11_24_390039	406	23	Text	Text	NNP
10_1101-2020_11_24_390039	406	24	Figure	Figure	NNP
10_1101-2020_11_24_390039	406	25	1	1	CD
10_1101-2020_11_24_390039	406	26	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	406	27	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NN
10_1101-2020_11_24_390039	406	28	.CC	.CC	NFP
10_1101-2020_11_24_390039	406	29	-	-	:
10_1101-2020_11_24_390039	406	30	BY	by	IN
10_1101-2020_11_24_390039	406	31	-	-	HYPH
10_1101-2020_11_24_390039	406	32	ND	ND	NNP
10_1101-2020_11_24_390039	406	33	4.0	4.0	CD
10_1101-2020_11_24_390039	406	34	International	international	JJ
10_1101-2020_11_24_390039	406	35	licensemade	licensemade	NN
10_1101-2020_11_24_390039	406	36	available	available	JJ
10_1101-2020_11_24_390039	406	37	under	under	IN
10_1101-2020_11_24_390039	406	38	a	a	DT
10_1101-2020_11_24_390039	406	39	(	(	-LRB-
10_1101-2020_11_24_390039	406	40	which	which	WDT
10_1101-2020_11_24_390039	406	41	was	be	VBD
10_1101-2020_11_24_390039	406	42	not	not	RB
10_1101-2020_11_24_390039	406	43	certified	certify	VBN
10_1101-2020_11_24_390039	406	44	by	by	IN
10_1101-2020_11_24_390039	406	45	peer	peer	NN
10_1101-2020_11_24_390039	406	46	review	review	NN
10_1101-2020_11_24_390039	406	47	)	)	-RRB-
10_1101-2020_11_24_390039	406	48	is	be	VBZ
10_1101-2020_11_24_390039	406	49	the	the	DT
10_1101-2020_11_24_390039	406	50	author	author	NN
10_1101-2020_11_24_390039	406	51	/	/	SYM
10_1101-2020_11_24_390039	406	52	funder	funder	NN
10_1101-2020_11_24_390039	406	53	,	,	,
10_1101-2020_11_24_390039	406	54	who	who	WP
10_1101-2020_11_24_390039	406	55	has	have	VBZ
10_1101-2020_11_24_390039	406	56	granted	grant	VBN
10_1101-2020_11_24_390039	406	57	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	406	58	a	a	DT
10_1101-2020_11_24_390039	406	59	license	license	NN
10_1101-2020_11_24_390039	406	60	to	to	TO
10_1101-2020_11_24_390039	406	61	display	display	VB
10_1101-2020_11_24_390039	406	62	the	the	DT
10_1101-2020_11_24_390039	406	63	preprint	preprint	NN
10_1101-2020_11_24_390039	406	64	in	in	IN
10_1101-2020_11_24_390039	406	65	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	406	66	.	.	.
10_1101-2020_11_24_390039	407	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	407	2	is	be	VBZ
10_1101-2020_11_24_390039	407	3	The	the	DT
10_1101-2020_11_24_390039	407	4	copyright	copyright	NN
10_1101-2020_11_24_390039	407	5	holder	holder	NN
10_1101-2020_11_24_390039	407	6	for	for	IN
10_1101-2020_11_24_390039	407	7	this	this	DT
10_1101-2020_11_24_390039	407	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	407	9	version	version	NN
10_1101-2020_11_24_390039	407	10	posted	post	VBD
10_1101-2020_11_24_390039	407	11	January	January	NNP
10_1101-2020_11_24_390039	407	12	5	5	CD
10_1101-2020_11_24_390039	407	13	,	,	,
10_1101-2020_11_24_390039	407	14	2021	2021	CD
10_1101-2020_11_24_390039	407	15	.	.	.
10_1101-2020_11_24_390039	407	16	;	;	:
10_1101-2020_11_24_390039	407	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	407	18	:	:	:
10_1101-2020_11_24_390039	407	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	407	20	preprint	preprint	NN
10_1101-2020_11_24_390039	407	21	mqbssysh	mqbssysh	NNS
10_1101-2020_11_24_390039	407	22	Typewritten	Typewritten	NNP
10_1101-2020_11_24_390039	407	23	Text	Text	NNP
10_1101-2020_11_24_390039	407	24	Figure	Figure	NNP
10_1101-2020_11_24_390039	407	25	2	2	CD
10_1101-2020_11_24_390039	407	26	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	407	27	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NN
10_1101-2020_11_24_390039	407	28	.CC	.CC	NFP
10_1101-2020_11_24_390039	407	29	-	-	:
10_1101-2020_11_24_390039	407	30	BY	by	IN
10_1101-2020_11_24_390039	407	31	-	-	HYPH
10_1101-2020_11_24_390039	407	32	ND	ND	NNP
10_1101-2020_11_24_390039	407	33	4.0	4.0	CD
10_1101-2020_11_24_390039	407	34	International	international	JJ
10_1101-2020_11_24_390039	407	35	licensemade	licensemade	NN
10_1101-2020_11_24_390039	407	36	available	available	JJ
10_1101-2020_11_24_390039	407	37	under	under	IN
10_1101-2020_11_24_390039	407	38	a	a	DT
10_1101-2020_11_24_390039	407	39	(	(	-LRB-
10_1101-2020_11_24_390039	407	40	which	which	WDT
10_1101-2020_11_24_390039	407	41	was	be	VBD
10_1101-2020_11_24_390039	407	42	not	not	RB
10_1101-2020_11_24_390039	407	43	certified	certify	VBN
10_1101-2020_11_24_390039	407	44	by	by	IN
10_1101-2020_11_24_390039	407	45	peer	peer	NN
10_1101-2020_11_24_390039	407	46	review	review	NN
10_1101-2020_11_24_390039	407	47	)	)	-RRB-
10_1101-2020_11_24_390039	407	48	is	be	VBZ
10_1101-2020_11_24_390039	407	49	the	the	DT
10_1101-2020_11_24_390039	407	50	author	author	NN
10_1101-2020_11_24_390039	407	51	/	/	SYM
10_1101-2020_11_24_390039	407	52	funder	funder	NN
10_1101-2020_11_24_390039	407	53	,	,	,
10_1101-2020_11_24_390039	407	54	who	who	WP
10_1101-2020_11_24_390039	407	55	has	have	VBZ
10_1101-2020_11_24_390039	407	56	granted	grant	VBN
10_1101-2020_11_24_390039	407	57	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	407	58	a	a	DT
10_1101-2020_11_24_390039	407	59	license	license	NN
10_1101-2020_11_24_390039	407	60	to	to	TO
10_1101-2020_11_24_390039	407	61	display	display	VB
10_1101-2020_11_24_390039	407	62	the	the	DT
10_1101-2020_11_24_390039	407	63	preprint	preprint	NN
10_1101-2020_11_24_390039	407	64	in	in	IN
10_1101-2020_11_24_390039	407	65	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	407	66	.	.	.
10_1101-2020_11_24_390039	408	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	408	2	is	be	VBZ
10_1101-2020_11_24_390039	408	3	The	the	DT
10_1101-2020_11_24_390039	408	4	copyright	copyright	NN
10_1101-2020_11_24_390039	408	5	holder	holder	NN
10_1101-2020_11_24_390039	408	6	for	for	IN
10_1101-2020_11_24_390039	408	7	this	this	DT
10_1101-2020_11_24_390039	408	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	408	9	version	version	NN
10_1101-2020_11_24_390039	408	10	posted	post	VBD
10_1101-2020_11_24_390039	408	11	January	January	NNP
10_1101-2020_11_24_390039	408	12	5	5	CD
10_1101-2020_11_24_390039	408	13	,	,	,
10_1101-2020_11_24_390039	408	14	2021	2021	CD
10_1101-2020_11_24_390039	408	15	.	.	.
10_1101-2020_11_24_390039	408	16	;	;	:
10_1101-2020_11_24_390039	408	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	408	18	:	:	:
10_1101-2020_11_24_390039	408	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	408	20	preprint	preprint	NN
10_1101-2020_11_24_390039	408	21	mqbssysh	mqbssysh	NNS
10_1101-2020_11_24_390039	408	22	Typewritten	Typewritten	NNP
10_1101-2020_11_24_390039	408	23	Text	Text	NNP
10_1101-2020_11_24_390039	408	24	Figure	Figure	NNP
10_1101-2020_11_24_390039	408	25	3	3	CD
10_1101-2020_11_24_390039	408	26	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	408	27	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NN
10_1101-2020_11_24_390039	408	28	Supplementary	supplementary	JJ
10_1101-2020_11_24_390039	408	29	information	information	NN
10_1101-2020_11_24_390039	408	30	for	for	IN
10_1101-2020_11_24_390039	408	31	Ipomoeassin	Ipomoeassin	NNP
10_1101-2020_11_24_390039	408	32	-	-	HYPH
10_1101-2020_11_24_390039	408	33	F	F	NNP
10_1101-2020_11_24_390039	408	34	inhibits	inhibit	VBZ
10_1101-2020_11_24_390039	408	35	the	the	DT
10_1101-2020_11_24_390039	408	36	in	in	FW
10_1101-2020_11_24_390039	408	37	vitro	vitro	FW
10_1101-2020_11_24_390039	408	38	biogenesis	biogenesis	NN
10_1101-2020_11_24_390039	408	39	of	of	IN
10_1101-2020_11_24_390039	408	40	the	the	DT
10_1101-2020_11_24_390039	408	41	SARS	SARS	NNP
10_1101-2020_11_24_390039	408	42	-	-	HYPH
10_1101-2020_11_24_390039	408	43	CoV-2	CoV-2	NNP
10_1101-2020_11_24_390039	408	44	spike	spike	JJ
10_1101-2020_11_24_390039	408	45	protein	protein	NN
10_1101-2020_11_24_390039	408	46	and	and	CC
10_1101-2020_11_24_390039	408	47	its	-PRON-	PRP$
10_1101-2020_11_24_390039	408	48	host	host	NN
10_1101-2020_11_24_390039	408	49	cell	cell	NN
10_1101-2020_11_24_390039	408	50	membrane	membrane	NN
10_1101-2020_11_24_390039	408	51	receptor	receptor	NN
10_1101-2020_11_24_390039	408	52	Sa	Sa	NNP
10_1101-2020_11_24_390039	408	53	a	a	DT
10_1101-2020_11_24_390039	408	54	O	o	NN
10_1101-2020_11_24_390039	408	55	Kee	Kee	NNP
10_1101-2020_11_24_390039	408	56	e	e	NN
10_1101-2020_11_24_390039	408	57	,	,	,
10_1101-2020_11_24_390039	408	58	Pe	Pe	NNP
10_1101-2020_11_24_390039	408	59	e	e	VBZ
10_1101-2020_11_24_390039	408	60	a	a	DT
10_1101-2020_11_24_390039	408	61	Roboti	Roboti	NNP
10_1101-2020_11_24_390039	408	62	,	,	,
10_1101-2020_11_24_390039	408	63	Kwabena	Kwabena	NNP
10_1101-2020_11_24_390039	408	64	B.	B.	NNP
10_1101-2020_11_24_390039	408	65	Duah	Duah	NNP
10_1101-2020_11_24_390039	408	66	,	,	,
10_1101-2020_11_24_390039	408	67	Guanghui	Guanghui	NNP
10_1101-2020_11_24_390039	408	68	Zong	Zong	NNP
10_1101-2020_11_24_390039	408	69	,	,	,
10_1101-2020_11_24_390039	408	70	Hayden	Hayden	NNP
10_1101-2020_11_24_390039	408	71	Scheider	Scheider	NNP
10_1101-2020_11_24_390039	408	72	,	,	,
10_1101-2020_11_24_390039	408	73	Wei	Wei	NNP
10_1101-2020_11_24_390039	408	74	Q.	Q.	NNP
10_1101-2020_11_24_390039	408	75	Shi	Shi	NNP
10_1101-2020_11_24_390039	408	76	and	and	CC
10_1101-2020_11_24_390039	408	77	Stephen	Stephen	NNP
10_1101-2020_11_24_390039	408	78	High	High	NNP
10_1101-2020_11_24_390039	408	79	.CC	.CC	:
10_1101-2020_11_24_390039	408	80	-	-	HYPH
10_1101-2020_11_24_390039	408	81	BY	by	IN
10_1101-2020_11_24_390039	408	82	-	-	HYPH
10_1101-2020_11_24_390039	408	83	ND	ND	NNP
10_1101-2020_11_24_390039	408	84	4.0	4.0	CD
10_1101-2020_11_24_390039	408	85	International	international	JJ
10_1101-2020_11_24_390039	408	86	licensemade	licensemade	NN
10_1101-2020_11_24_390039	408	87	available	available	JJ
10_1101-2020_11_24_390039	408	88	under	under	IN
10_1101-2020_11_24_390039	408	89	a	a	DT
10_1101-2020_11_24_390039	408	90	(	(	-LRB-
10_1101-2020_11_24_390039	408	91	which	which	WDT
10_1101-2020_11_24_390039	408	92	was	be	VBD
10_1101-2020_11_24_390039	408	93	not	not	RB
10_1101-2020_11_24_390039	408	94	certified	certify	VBN
10_1101-2020_11_24_390039	408	95	by	by	IN
10_1101-2020_11_24_390039	408	96	peer	peer	NN
10_1101-2020_11_24_390039	408	97	review	review	NN
10_1101-2020_11_24_390039	408	98	)	)	-RRB-
10_1101-2020_11_24_390039	408	99	is	be	VBZ
10_1101-2020_11_24_390039	408	100	the	the	DT
10_1101-2020_11_24_390039	408	101	author	author	NN
10_1101-2020_11_24_390039	408	102	/	/	SYM
10_1101-2020_11_24_390039	408	103	funder	funder	NN
10_1101-2020_11_24_390039	408	104	,	,	,
10_1101-2020_11_24_390039	408	105	who	who	WP
10_1101-2020_11_24_390039	408	106	has	have	VBZ
10_1101-2020_11_24_390039	408	107	granted	grant	VBN
10_1101-2020_11_24_390039	408	108	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	408	109	a	a	DT
10_1101-2020_11_24_390039	408	110	license	license	NN
10_1101-2020_11_24_390039	408	111	to	to	TO
10_1101-2020_11_24_390039	408	112	display	display	VB
10_1101-2020_11_24_390039	408	113	the	the	DT
10_1101-2020_11_24_390039	408	114	preprint	preprint	NN
10_1101-2020_11_24_390039	408	115	in	in	IN
10_1101-2020_11_24_390039	408	116	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	408	117	.	.	.
10_1101-2020_11_24_390039	409	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	409	2	is	be	VBZ
10_1101-2020_11_24_390039	409	3	The	the	DT
10_1101-2020_11_24_390039	409	4	copyright	copyright	NN
10_1101-2020_11_24_390039	409	5	holder	holder	NN
10_1101-2020_11_24_390039	409	6	for	for	IN
10_1101-2020_11_24_390039	409	7	this	this	DT
10_1101-2020_11_24_390039	409	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	409	9	version	version	NN
10_1101-2020_11_24_390039	409	10	posted	post	VBD
10_1101-2020_11_24_390039	409	11	January	January	NNP
10_1101-2020_11_24_390039	409	12	5	5	CD
10_1101-2020_11_24_390039	409	13	,	,	,
10_1101-2020_11_24_390039	409	14	2021	2021	CD
10_1101-2020_11_24_390039	409	15	.	.	.
10_1101-2020_11_24_390039	409	16	;	;	:
10_1101-2020_11_24_390039	409	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	409	18	:	:	:
10_1101-2020_11_24_390039	409	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	409	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	409	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	409	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NN
10_1101-2020_11_24_390039	409	23	Page	page	NN
10_1101-2020_11_24_390039	409	24	2	2	CD
10_1101-2020_11_24_390039	409	25	of	of	IN
10_1101-2020_11_24_390039	409	26	5	5	CD
10_1101-2020_11_24_390039	409	27	Fig	Fig	NNP
10_1101-2020_11_24_390039	409	28	.	.	.
10_1101-2020_11_24_390039	410	1	S1	S1	NNS
10_1101-2020_11_24_390039	410	2	.	.	.
10_1101-2020_11_24_390039	411	1	Additional	additional	JJ
10_1101-2020_11_24_390039	411	2	studies	study	NNS
10_1101-2020_11_24_390039	411	3	using	use	VBG
10_1101-2020_11_24_390039	411	4	ER	ER	NNP
10_1101-2020_11_24_390039	411	5	microsomes	microsome	NNS
10_1101-2020_11_24_390039	411	6	,	,	,
10_1101-2020_11_24_390039	411	7	Related	related	JJ
10_1101-2020_11_24_390039	411	8	to	to	IN
10_1101-2020_11_24_390039	411	9	Figures	Figures	NNP
10_1101-2020_11_24_390039	411	10	2	2	CD
10_1101-2020_11_24_390039	411	11	and	and	CC
10_1101-2020_11_24_390039	411	12	3	3	CD
10_1101-2020_11_24_390039	411	13	.	.	.
10_1101-2020_11_24_390039	412	1	(	(	-LRB-
10_1101-2020_11_24_390039	412	2	A	a	DT
10_1101-2020_11_24_390039	412	3	)	)	-RRB-
10_1101-2020_11_24_390039	412	4	Non	non	JJ
10_1101-2020_11_24_390039	412	5	-	-	JJ
10_1101-2020_11_24_390039	412	6	tagged	tagged	JJ
10_1101-2020_11_24_390039	412	7	(	(	-LRB-
10_1101-2020_11_24_390039	412	8	lanes	lanes	NNP
10_1101-2020_11_24_390039	412	9	1	1	CD
10_1101-2020_11_24_390039	412	10	-	-	SYM
10_1101-2020_11_24_390039	412	11	3	3	CD
10_1101-2020_11_24_390039	412	12	)	)	-RRB-
10_1101-2020_11_24_390039	412	13	and	and	CC
10_1101-2020_11_24_390039	412	14	OPG2-tagged	OPG2-tagged	NNP
10_1101-2020_11_24_390039	412	15	(	(	-LRB-
10_1101-2020_11_24_390039	412	16	lanes	lanes	NNP
10_1101-2020_11_24_390039	412	17	4	4	CD
10_1101-2020_11_24_390039	412	18	-	-	SYM
10_1101-2020_11_24_390039	412	19	6	6	CD
10_1101-2020_11_24_390039	412	20	)	)	-RRB-
10_1101-2020_11_24_390039	412	21	versions	version	NNS
10_1101-2020_11_24_390039	412	22	of	of	IN
10_1101-2020_11_24_390039	412	23	the	the	DT
10_1101-2020_11_24_390039	412	24	SARS	SARS	NNP
10_1101-2020_11_24_390039	412	25	-	-	HYPH
10_1101-2020_11_24_390039	412	26	CoV-	CoV-	NNP
10_1101-2020_11_24_390039	412	27	2	2	CD
10_1101-2020_11_24_390039	412	28	spike	spike	JJ
10_1101-2020_11_24_390039	412	29	protein	protein	NN
10_1101-2020_11_24_390039	412	30	(	(	-LRB-
10_1101-2020_11_24_390039	412	31	S	S	NNP
10_1101-2020_11_24_390039	412	32	,	,	,
10_1101-2020_11_24_390039	412	33	S	S	NNP
10_1101-2020_11_24_390039	412	34	-	-	HYPH
10_1101-2020_11_24_390039	412	35	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	412	36	)	)	-RRB-
10_1101-2020_11_24_390039	412	37	,	,	,
10_1101-2020_11_24_390039	412	38	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	412	39	(	(	-LRB-
10_1101-2020_11_24_390039	412	40	ORF8	ORF8	NNP
10_1101-2020_11_24_390039	412	41	,	,	,
10_1101-2020_11_24_390039	412	42	ORF8-OPG2	ORF8-OPG2	NNP
10_1101-2020_11_24_390039	412	43	)	)	-RRB-
10_1101-2020_11_24_390039	412	44	and	and	CC
10_1101-2020_11_24_390039	412	45	membrane	membrane	NN
10_1101-2020_11_24_390039	412	46	protein	protein	NN
10_1101-2020_11_24_390039	412	47	(	(	-LRB-
10_1101-2020_11_24_390039	412	48	M	M	NNP
10_1101-2020_11_24_390039	412	49	,	,	,
10_1101-2020_11_24_390039	412	50	M	M	NNP
10_1101-2020_11_24_390039	412	51	-	-	HYPH
10_1101-2020_11_24_390039	412	52	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	412	53	)	)	-RRB-
10_1101-2020_11_24_390039	412	54	were	be	VBD
10_1101-2020_11_24_390039	412	55	synthesised	synthesise	VBN
10_1101-2020_11_24_390039	412	56	in	in	IN
10_1101-2020_11_24_390039	412	57	rabbit	rabbit	NN
10_1101-2020_11_24_390039	412	58	reticulocyte	reticulocyte	NNP
10_1101-2020_11_24_390039	412	59	lysate	lysate	NN
10_1101-2020_11_24_390039	412	60	supplemented	supplement	VBN
10_1101-2020_11_24_390039	412	61	with	with	IN
10_1101-2020_11_24_390039	412	62	ER-	ER-	NNP
10_1101-2020_11_24_390039	412	63	derived	derive	VBD
10_1101-2020_11_24_390039	412	64	canine	canine	NN
10_1101-2020_11_24_390039	412	65	pancreatic	pancreatic	JJ
10_1101-2020_11_24_390039	412	66	microsomes	microsome	NNS
10_1101-2020_11_24_390039	412	67	in	in	IN
10_1101-2020_11_24_390039	412	68	the	the	DT
10_1101-2020_11_24_390039	412	69	absence	absence	NN
10_1101-2020_11_24_390039	412	70	and	and	CC
10_1101-2020_11_24_390039	412	71	presence	presence	NN
10_1101-2020_11_24_390039	412	72	of	of	IN
10_1101-2020_11_24_390039	412	73	Ipom	Ipom	NNP
10_1101-2020_11_24_390039	412	74	-	-	HYPH
10_1101-2020_11_24_390039	412	75	F	F	NNP
10_1101-2020_11_24_390039	412	76	(	(	-LRB-
10_1101-2020_11_24_390039	412	77	lanes	lanes	NNP
10_1101-2020_11_24_390039	412	78	1	1	CD
10_1101-2020_11_24_390039	412	79	and	and	CC
10_1101-2020_11_24_390039	412	80	3	3	CD
10_1101-2020_11_24_390039	412	81	)	)	-RRB-
10_1101-2020_11_24_390039	412	82	.	.	.
10_1101-2020_11_24_390039	413	1	Phosphorimages	phosphorimage	NNS
10_1101-2020_11_24_390039	413	2	of	of	IN
10_1101-2020_11_24_390039	413	3	membrane	membrane	NN
10_1101-2020_11_24_390039	413	4	-	-	HYPH
10_1101-2020_11_24_390039	413	5	associated	associate	VBN
10_1101-2020_11_24_390039	413	6	products	product	NNS
10_1101-2020_11_24_390039	413	7	resolved	resolve	VBN
10_1101-2020_11_24_390039	413	8	by	by	IN
10_1101-2020_11_24_390039	413	9	SDS	SDS	NNP
10_1101-2020_11_24_390039	413	10	-	-	HYPH
10_1101-2020_11_24_390039	413	11	PAGE	page	NN
10_1101-2020_11_24_390039	413	12	together	together	RB
10_1101-2020_11_24_390039	413	13	with	with	IN
10_1101-2020_11_24_390039	413	14	representative	representative	JJ
10_1101-2020_11_24_390039	413	15	substrate	substrate	NN
10_1101-2020_11_24_390039	413	16	outlines	outline	NNS
10_1101-2020_11_24_390039	413	17	are	be	VBP
10_1101-2020_11_24_390039	413	18	shown	show	VBN
10_1101-2020_11_24_390039	413	19	.	.	.
10_1101-2020_11_24_390039	414	1	N	n	LS
10_1101-2020_11_24_390039	414	2	-	-	HYPH
10_1101-2020_11_24_390039	414	3	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	414	4	(	(	-LRB-
10_1101-2020_11_24_390039	414	5	X	X	NNP
10_1101-2020_11_24_390039	414	6	-	-	NNP
10_1101-2020_11_24_390039	414	7	Gly	gly	NN
10_1101-2020_11_24_390039	414	8	)	)	-RRB-
10_1101-2020_11_24_390039	414	9	versus	versus	IN
10_1101-2020_11_24_390039	414	10	non	non	JJ
10_1101-2020_11_24_390039	414	11	-	-	JJ
10_1101-2020_11_24_390039	414	12	N	n	JJ
10_1101-2020_11_24_390039	414	13	-	-	HYPH
10_1101-2020_11_24_390039	414	14	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	414	15	(	(	-LRB-
10_1101-2020_11_24_390039	414	16	0Gly	0gly	NN
10_1101-2020_11_24_390039	414	17	)	)	-RRB-
10_1101-2020_11_24_390039	414	18	species	specie	NNS
10_1101-2020_11_24_390039	414	19	were	be	VBD
10_1101-2020_11_24_390039	414	20	identified	identify	VBN
10_1101-2020_11_24_390039	414	21	by	by	IN
10_1101-2020_11_24_390039	414	22	treatment	treatment	NN
10_1101-2020_11_24_390039	414	23	with	with	IN
10_1101-2020_11_24_390039	414	24	endoglycosidase	endoglycosidase	NN
10_1101-2020_11_24_390039	414	25	H	h	NN
10_1101-2020_11_24_390039	414	26	(	(	-LRB-
10_1101-2020_11_24_390039	414	27	Endo	Endo	NNP
10_1101-2020_11_24_390039	414	28	H	H	NNP
10_1101-2020_11_24_390039	414	29	,	,	,
10_1101-2020_11_24_390039	414	30	lanes	lane	VBZ
10_1101-2020_11_24_390039	414	31	2	2	CD
10_1101-2020_11_24_390039	414	32	and	and	CC
10_1101-2020_11_24_390039	414	33	5	5	CD
10_1101-2020_11_24_390039	414	34	)	)	-RRB-
10_1101-2020_11_24_390039	414	35	.	.	.
10_1101-2020_11_24_390039	415	1	(	(	-LRB-
10_1101-2020_11_24_390039	415	2	B	b	NN
10_1101-2020_11_24_390039	415	3	)	)	-RRB-
10_1101-2020_11_24_390039	415	4	The	the	DT
10_1101-2020_11_24_390039	415	5	S	S	NNP
10_1101-2020_11_24_390039	415	6	protein	protein	NN
10_1101-2020_11_24_390039	415	7	was	be	VBD
10_1101-2020_11_24_390039	415	8	synthesised	synthesise	VBN
10_1101-2020_11_24_390039	415	9	in	in	IN
10_1101-2020_11_24_390039	415	10	a	a	DT
10_1101-2020_11_24_390039	415	11	Flexi	Flexi	NNP
10_1101-2020_11_24_390039	415	12	®	®	NNPS
10_1101-2020_11_24_390039	415	13	rabbit	rabbit	NN
10_1101-2020_11_24_390039	415	14	reticulocyte	reticulocyte	NN
10_1101-2020_11_24_390039	415	15	system	system	NN
10_1101-2020_11_24_390039	415	16	with	with	IN
10_1101-2020_11_24_390039	415	17	varying	vary	VBG
10_1101-2020_11_24_390039	415	18	concentrations	concentration	NNS
10_1101-2020_11_24_390039	415	19	of	of	IN
10_1101-2020_11_24_390039	415	20	magnesium	magnesium	NN
10_1101-2020_11_24_390039	415	21	acetate	acetate	NN
10_1101-2020_11_24_390039	415	22	(	(	-LRB-
10_1101-2020_11_24_390039	415	23	lanes	lanes	NNP
10_1101-2020_11_24_390039	415	24	1	1	CD
10_1101-2020_11_24_390039	415	25	-	-	SYM
10_1101-2020_11_24_390039	415	26	5	5	CD
10_1101-2020_11_24_390039	415	27	)	)	-RRB-
10_1101-2020_11_24_390039	415	28	and	and	CC
10_1101-2020_11_24_390039	415	29	a	a	DT
10_1101-2020_11_24_390039	415	30	TNT	tnt	NN
10_1101-2020_11_24_390039	415	31	®	®	.
10_1101-2020_11_24_390039	415	32	Coupled	couple	VBN
10_1101-2020_11_24_390039	415	33	system	system	NN
10_1101-2020_11_24_390039	415	34	(	(	-LRB-
10_1101-2020_11_24_390039	415	35	lane	lane	NNP
10_1101-2020_11_24_390039	415	36	6	6	CD
10_1101-2020_11_24_390039	415	37	)	)	-RRB-
10_1101-2020_11_24_390039	415	38	in	in	IN
10_1101-2020_11_24_390039	415	39	the	the	DT
10_1101-2020_11_24_390039	415	40	absence	absence	NN
10_1101-2020_11_24_390039	415	41	of	of	IN
10_1101-2020_11_24_390039	415	42	ER	ER	NNP
10_1101-2020_11_24_390039	415	43	-	-	HYPH
10_1101-2020_11_24_390039	415	44	derived	derive	VBN
10_1101-2020_11_24_390039	415	45	.CC	.CC	:
10_1101-2020_11_24_390039	415	46	-	-	HYPH
10_1101-2020_11_24_390039	415	47	BY	by	IN
10_1101-2020_11_24_390039	415	48	-	-	HYPH
10_1101-2020_11_24_390039	415	49	ND	ND	NNP
10_1101-2020_11_24_390039	415	50	4.0	4.0	CD
10_1101-2020_11_24_390039	415	51	International	international	JJ
10_1101-2020_11_24_390039	415	52	licensemade	licensemade	NN
10_1101-2020_11_24_390039	415	53	available	available	JJ
10_1101-2020_11_24_390039	415	54	under	under	IN
10_1101-2020_11_24_390039	415	55	a	a	DT
10_1101-2020_11_24_390039	415	56	(	(	-LRB-
10_1101-2020_11_24_390039	415	57	which	which	WDT
10_1101-2020_11_24_390039	415	58	was	be	VBD
10_1101-2020_11_24_390039	415	59	not	not	RB
10_1101-2020_11_24_390039	415	60	certified	certify	VBN
10_1101-2020_11_24_390039	415	61	by	by	IN
10_1101-2020_11_24_390039	415	62	peer	peer	NN
10_1101-2020_11_24_390039	415	63	review	review	NN
10_1101-2020_11_24_390039	415	64	)	)	-RRB-
10_1101-2020_11_24_390039	415	65	is	be	VBZ
10_1101-2020_11_24_390039	415	66	the	the	DT
10_1101-2020_11_24_390039	415	67	author	author	NN
10_1101-2020_11_24_390039	415	68	/	/	SYM
10_1101-2020_11_24_390039	415	69	funder	funder	NN
10_1101-2020_11_24_390039	415	70	,	,	,
10_1101-2020_11_24_390039	415	71	who	who	WP
10_1101-2020_11_24_390039	415	72	has	have	VBZ
10_1101-2020_11_24_390039	415	73	granted	grant	VBN
10_1101-2020_11_24_390039	415	74	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	415	75	a	a	DT
10_1101-2020_11_24_390039	415	76	license	license	NN
10_1101-2020_11_24_390039	415	77	to	to	TO
10_1101-2020_11_24_390039	415	78	display	display	VB
10_1101-2020_11_24_390039	415	79	the	the	DT
10_1101-2020_11_24_390039	415	80	preprint	preprint	NN
10_1101-2020_11_24_390039	415	81	in	in	IN
10_1101-2020_11_24_390039	415	82	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	415	83	.	.	.
10_1101-2020_11_24_390039	416	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	416	2	is	be	VBZ
10_1101-2020_11_24_390039	416	3	The	the	DT
10_1101-2020_11_24_390039	416	4	copyright	copyright	NN
10_1101-2020_11_24_390039	416	5	holder	holder	NN
10_1101-2020_11_24_390039	416	6	for	for	IN
10_1101-2020_11_24_390039	416	7	this	this	DT
10_1101-2020_11_24_390039	416	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	416	9	version	version	NN
10_1101-2020_11_24_390039	416	10	posted	post	VBD
10_1101-2020_11_24_390039	416	11	January	January	NNP
10_1101-2020_11_24_390039	416	12	5	5	CD
10_1101-2020_11_24_390039	416	13	,	,	,
10_1101-2020_11_24_390039	416	14	2021	2021	CD
10_1101-2020_11_24_390039	416	15	.	.	.
10_1101-2020_11_24_390039	416	16	;	;	:
10_1101-2020_11_24_390039	416	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	416	18	:	:	:
10_1101-2020_11_24_390039	416	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	416	20	preprint	preprint	NN
10_1101-2020_11_24_390039	416	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	416	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	416	23	microsomes	microsome	NNS
10_1101-2020_11_24_390039	416	24	.	.	.
10_1101-2020_11_24_390039	417	1	5	5	CD
10_1101-2020_11_24_390039	417	2	%	%	NN
10_1101-2020_11_24_390039	417	3	of	of	IN
10_1101-2020_11_24_390039	417	4	the	the	DT
10_1101-2020_11_24_390039	417	5	total	total	JJ
10_1101-2020_11_24_390039	417	6	reaction	reaction	NN
10_1101-2020_11_24_390039	417	7	material	material	NN
10_1101-2020_11_24_390039	417	8	was	be	VBD
10_1101-2020_11_24_390039	417	9	resolved	resolve	VBN
10_1101-2020_11_24_390039	417	10	by	by	IN
10_1101-2020_11_24_390039	417	11	SDS	SDS	NNP
10_1101-2020_11_24_390039	417	12	-	-	HYPH
10_1101-2020_11_24_390039	417	13	PAGE	PAGE	NNP
10_1101-2020_11_24_390039	417	14	and	and	CC
10_1101-2020_11_24_390039	417	15	visualised	visualise	VBN
10_1101-2020_11_24_390039	417	16	by	by	IN
10_1101-2020_11_24_390039	417	17	phosphorimaging	phosphorimage	VBG
10_1101-2020_11_24_390039	417	18	.	.	.
10_1101-2020_11_24_390039	418	1	(	(	-LRB-
10_1101-2020_11_24_390039	418	2	C	C	NNP
10_1101-2020_11_24_390039	418	3	)	)	-RRB-
10_1101-2020_11_24_390039	418	4	The	the	DT
10_1101-2020_11_24_390039	418	5	ER	ER	NNP
10_1101-2020_11_24_390039	418	6	import	import	NN
10_1101-2020_11_24_390039	418	7	of	of	IN
10_1101-2020_11_24_390039	418	8	truncated	truncate	VBN
10_1101-2020_11_24_390039	418	9	variants	variant	NNS
10_1101-2020_11_24_390039	418	10	of	of	IN
10_1101-2020_11_24_390039	418	11	the	the	DT
10_1101-2020_11_24_390039	418	12	S	S	NNP
10_1101-2020_11_24_390039	418	13	protein	protein	NN
10_1101-2020_11_24_390039	418	14	(	(	-LRB-
10_1101-2020_11_24_390039	418	15	S	s	NN
10_1101-2020_11_24_390039	418	16	-	-	HYPH
10_1101-2020_11_24_390039	418	17	short	short	JJ
10_1101-2020_11_24_390039	418	18	,	,	,
10_1101-2020_11_24_390039	418	19	S	S	NNP
10_1101-2020_11_24_390039	418	20	-	-	HYPH
10_1101-2020_11_24_390039	418	21	s.s.-TMD	s.s.-TMD	NNP
10_1101-2020_11_24_390039	418	22	,	,	,
10_1101-2020_11_24_390039	418	23	S	s	JJ
10_1101-2020_11_24_390039	418	24	-	-	HYPH
10_1101-2020_11_24_390039	418	25	half	half	NN
10_1101-2020_11_24_390039	418	26	-	-	HYPH
10_1101-2020_11_24_390039	418	27	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	418	28	)	)	-RRB-
10_1101-2020_11_24_390039	418	29	was	be	VBD
10_1101-2020_11_24_390039	418	30	analysed	analyse	VBN
10_1101-2020_11_24_390039	418	31	as	as	IN
10_1101-2020_11_24_390039	418	32	described	describe	VBN
10_1101-2020_11_24_390039	418	33	for	for	IN
10_1101-2020_11_24_390039	418	34	(	(	-LRB-
10_1101-2020_11_24_390039	418	35	A	a	NN
10_1101-2020_11_24_390039	418	36	)	)	-RRB-
10_1101-2020_11_24_390039	418	37	.	.	.
10_1101-2020_11_24_390039	419	1	(	(	-LRB-
10_1101-2020_11_24_390039	419	2	D	d	NN
10_1101-2020_11_24_390039	419	3	)	)	-RRB-
10_1101-2020_11_24_390039	419	4	The	the	DT
10_1101-2020_11_24_390039	419	5	membrane	membrane	NN
10_1101-2020_11_24_390039	419	6	-	-	HYPH
10_1101-2020_11_24_390039	419	7	associated	associate	VBN
10_1101-2020_11_24_390039	419	8	products	product	NNS
10_1101-2020_11_24_390039	419	9	of	of	IN
10_1101-2020_11_24_390039	419	10	the	the	DT
10_1101-2020_11_24_390039	419	11	doubly	doubly	RB
10_1101-2020_11_24_390039	419	12	tagged	tag	VBN
10_1101-2020_11_24_390039	419	13	form	form	NN
10_1101-2020_11_24_390039	419	14	of	of	IN
10_1101-2020_11_24_390039	419	15	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	419	16	(	(	-LRB-
10_1101-2020_11_24_390039	419	17	OPG2-	OPG2-	NNP
10_1101-2020_11_24_390039	419	18	ORF6-OPG2	ORF6-OPG2	NNP
10_1101-2020_11_24_390039	419	19	)	)	-RRB-
10_1101-2020_11_24_390039	419	20	were	be	VBD
10_1101-2020_11_24_390039	419	21	synthesised	synthesise	VBN
10_1101-2020_11_24_390039	419	22	as	as	IN
10_1101-2020_11_24_390039	419	23	in	in	IN
10_1101-2020_11_24_390039	419	24	(	(	-LRB-
10_1101-2020_11_24_390039	419	25	A	a	NN
10_1101-2020_11_24_390039	419	26	)	)	-RRB-
10_1101-2020_11_24_390039	419	27	and	and	CC
10_1101-2020_11_24_390039	419	28	,	,	,
10_1101-2020_11_24_390039	419	29	following	follow	VBG
10_1101-2020_11_24_390039	419	30	treatment	treatment	NN
10_1101-2020_11_24_390039	419	31	with	with	IN
10_1101-2020_11_24_390039	419	32	sodium	sodium	NN
10_1101-2020_11_24_390039	419	33	carbonate	carbonate	NN
10_1101-2020_11_24_390039	419	34	buffer	buffer	NN
10_1101-2020_11_24_390039	419	35	and	and	CC
10_1101-2020_11_24_390039	419	36	centrifugation	centrifugation	NN
10_1101-2020_11_24_390039	419	37	,	,	,
10_1101-2020_11_24_390039	419	38	the	the	DT
10_1101-2020_11_24_390039	419	39	pellet	pellet	NN
10_1101-2020_11_24_390039	419	40	,	,	,
10_1101-2020_11_24_390039	419	41	enriched	enrich	VBN
10_1101-2020_11_24_390039	419	42	for	for	IN
10_1101-2020_11_24_390039	419	43	membrane	membrane	NN
10_1101-2020_11_24_390039	419	44	-	-	HYPH
10_1101-2020_11_24_390039	419	45	integrated	integrate	VBN
10_1101-2020_11_24_390039	419	46	material	material	NN
10_1101-2020_11_24_390039	419	47	,	,	,
10_1101-2020_11_24_390039	419	48	and	and	CC
10_1101-2020_11_24_390039	419	49	supernatant	supernatant	JJ
10_1101-2020_11_24_390039	419	50	,	,	,
10_1101-2020_11_24_390039	419	51	largely	largely	RB
10_1101-2020_11_24_390039	419	52	containing	contain	VBG
10_1101-2020_11_24_390039	419	53	peripherally	peripherally	RB
10_1101-2020_11_24_390039	419	54	membrane	membrane	NN
10_1101-2020_11_24_390039	419	55	-	-	HYPH
10_1101-2020_11_24_390039	419	56	associated	associate	VBN
10_1101-2020_11_24_390039	419	57	material	material	NN
10_1101-2020_11_24_390039	419	58	,	,	,
10_1101-2020_11_24_390039	419	59	were	be	VBD
10_1101-2020_11_24_390039	419	60	analysed	analyse	VBN
10_1101-2020_11_24_390039	419	61	for	for	IN
10_1101-2020_11_24_390039	419	62	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	419	63	.	.	.
10_1101-2020_11_24_390039	420	1	(	(	-LRB-
10_1101-2020_11_24_390039	420	2	E	e	NN
10_1101-2020_11_24_390039	420	3	)	)	-RRB-
10_1101-2020_11_24_390039	420	4	The	the	DT
10_1101-2020_11_24_390039	420	5	membrane	membrane	NN
10_1101-2020_11_24_390039	420	6	-	-	HYPH
10_1101-2020_11_24_390039	420	7	associated	associate	VBN
10_1101-2020_11_24_390039	420	8	products	product	NNS
10_1101-2020_11_24_390039	420	9	of	of	IN
10_1101-2020_11_24_390039	420	10	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	420	11	were	be	VBD
10_1101-2020_11_24_390039	420	12	treated	treat	VBN
10_1101-2020_11_24_390039	420	13	with	with	IN
10_1101-2020_11_24_390039	420	14	trypsin	trypsin	NNP
10_1101-2020_11_24_390039	420	15	in	in	IN
10_1101-2020_11_24_390039	420	16	the	the	DT
10_1101-2020_11_24_390039	420	17	absence	absence	NN
10_1101-2020_11_24_390039	420	18	or	or	CC
10_1101-2020_11_24_390039	420	19	presence	presence	NN
10_1101-2020_11_24_390039	420	20	of	of	IN
10_1101-2020_11_24_390039	420	21	Triton-100	Triton-100	NNS
10_1101-2020_11_24_390039	420	22	(	(	-LRB-
10_1101-2020_11_24_390039	420	23	TX-100	TX-100	NNP
10_1101-2020_11_24_390039	420	24	,	,	,
10_1101-2020_11_24_390039	420	25	lanes	lane	VBZ
10_1101-2020_11_24_390039	420	26	2	2	CD
10_1101-2020_11_24_390039	420	27	-	-	SYM
10_1101-2020_11_24_390039	420	28	3	3	CD
10_1101-2020_11_24_390039	420	29	)	)	-RRB-
10_1101-2020_11_24_390039	420	30	.	.	.
10_1101-2020_11_24_390039	421	1	1	1	LS
10_1101-2020_11_24_390039	421	2	.CC	.CC	:
10_1101-2020_11_24_390039	421	3	-	-	HYPH
10_1101-2020_11_24_390039	421	4	BY	by	IN
10_1101-2020_11_24_390039	421	5	-	-	HYPH
10_1101-2020_11_24_390039	421	6	ND	ND	NNP
10_1101-2020_11_24_390039	421	7	4.0	4.0	CD
10_1101-2020_11_24_390039	421	8	International	international	JJ
10_1101-2020_11_24_390039	421	9	licensemade	licensemade	NN
10_1101-2020_11_24_390039	421	10	available	available	JJ
10_1101-2020_11_24_390039	421	11	under	under	IN
10_1101-2020_11_24_390039	421	12	a	a	DT
10_1101-2020_11_24_390039	421	13	(	(	-LRB-
10_1101-2020_11_24_390039	421	14	which	which	WDT
10_1101-2020_11_24_390039	421	15	was	be	VBD
10_1101-2020_11_24_390039	421	16	not	not	RB
10_1101-2020_11_24_390039	421	17	certified	certify	VBN
10_1101-2020_11_24_390039	421	18	by	by	IN
10_1101-2020_11_24_390039	421	19	peer	peer	NN
10_1101-2020_11_24_390039	421	20	review	review	NN
10_1101-2020_11_24_390039	421	21	)	)	-RRB-
10_1101-2020_11_24_390039	421	22	is	be	VBZ
10_1101-2020_11_24_390039	421	23	the	the	DT
10_1101-2020_11_24_390039	421	24	author	author	NN
10_1101-2020_11_24_390039	421	25	/	/	SYM
10_1101-2020_11_24_390039	421	26	funder	funder	NN
10_1101-2020_11_24_390039	421	27	,	,	,
10_1101-2020_11_24_390039	421	28	who	who	WP
10_1101-2020_11_24_390039	421	29	has	have	VBZ
10_1101-2020_11_24_390039	421	30	granted	grant	VBN
10_1101-2020_11_24_390039	421	31	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	421	32	a	a	DT
10_1101-2020_11_24_390039	421	33	license	license	NN
10_1101-2020_11_24_390039	421	34	to	to	TO
10_1101-2020_11_24_390039	421	35	display	display	VB
10_1101-2020_11_24_390039	421	36	the	the	DT
10_1101-2020_11_24_390039	421	37	preprint	preprint	NN
10_1101-2020_11_24_390039	421	38	in	in	IN
10_1101-2020_11_24_390039	421	39	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	421	40	.	.	.
10_1101-2020_11_24_390039	422	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	422	2	is	be	VBZ
10_1101-2020_11_24_390039	422	3	The	the	DT
10_1101-2020_11_24_390039	422	4	copyright	copyright	NN
10_1101-2020_11_24_390039	422	5	holder	holder	NN
10_1101-2020_11_24_390039	422	6	for	for	IN
10_1101-2020_11_24_390039	422	7	this	this	DT
10_1101-2020_11_24_390039	422	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	422	9	version	version	NN
10_1101-2020_11_24_390039	422	10	posted	post	VBD
10_1101-2020_11_24_390039	422	11	January	January	NNP
10_1101-2020_11_24_390039	422	12	5	5	CD
10_1101-2020_11_24_390039	422	13	,	,	,
10_1101-2020_11_24_390039	422	14	2021	2021	CD
10_1101-2020_11_24_390039	422	15	.	.	.
10_1101-2020_11_24_390039	422	16	;	;	:
10_1101-2020_11_24_390039	422	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	422	18	:	:	:
10_1101-2020_11_24_390039	422	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	422	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	422	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	422	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	422	23	Page	page	NN
10_1101-2020_11_24_390039	422	24	4	4	CD
10_1101-2020_11_24_390039	422	25	of	of	IN
10_1101-2020_11_24_390039	422	26	5	5	CD
10_1101-2020_11_24_390039	422	27	Fig	Fig	NNP
10_1101-2020_11_24_390039	422	28	.	.	.
10_1101-2020_11_24_390039	423	1	S2	s2	NN
10_1101-2020_11_24_390039	423	2	.	.	.
10_1101-2020_11_24_390039	424	1	Validation	validation	NN
10_1101-2020_11_24_390039	424	2	of	of	IN
10_1101-2020_11_24_390039	424	3	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	424	4	and/or	and/or	CC
10_1101-2020_11_24_390039	424	5	EMC	EMC	NNP
10_1101-2020_11_24_390039	424	6	subunit	subunit	NN
10_1101-2020_11_24_390039	424	7	depletions	depletion	NNS
10_1101-2020_11_24_390039	424	8	in	in	IN
10_1101-2020_11_24_390039	424	9	SP	SP	NNP
10_1101-2020_11_24_390039	424	10	cells	cell	NNS
10_1101-2020_11_24_390039	424	11	,	,	,
10_1101-2020_11_24_390039	424	12	Related	relate	VBN
10_1101-2020_11_24_390039	424	13	to	to	IN
10_1101-2020_11_24_390039	424	14	Figure	figure	NN
10_1101-2020_11_24_390039	424	15	3	3	CD
10_1101-2020_11_24_390039	424	16	.	.	.
10_1101-2020_11_24_390039	425	1	(	(	-LRB-
10_1101-2020_11_24_390039	425	2	A	a	NN
10_1101-2020_11_24_390039	425	3	)	)	-RRB-
10_1101-2020_11_24_390039	425	4	The	the	DT
10_1101-2020_11_24_390039	425	5	effects	effect	NNS
10_1101-2020_11_24_390039	425	6	of	of	IN
10_1101-2020_11_24_390039	425	7	transfecting	transfecte	VBG
10_1101-2020_11_24_390039	425	8	HeLa	HeLa	NNP
10_1101-2020_11_24_390039	425	9	cells	cell	NNS
10_1101-2020_11_24_390039	425	10	with	with	IN
10_1101-2020_11_24_390039	425	11	non	non	JJ
10_1101-2020_11_24_390039	425	12	-	-	JJ
10_1101-2020_11_24_390039	425	13	targeting	targeting	JJ
10_1101-2020_11_24_390039	425	14	(	(	-LRB-
10_1101-2020_11_24_390039	425	15	NT	NT	NNP
10_1101-2020_11_24_390039	425	16	;	;	:
10_1101-2020_11_24_390039	425	17	lane	lane	NNP
10_1101-2020_11_24_390039	425	18	1	1	CD
10_1101-2020_11_24_390039	425	19	)	)	-RRB-
10_1101-2020_11_24_390039	425	20	,	,	,
10_1101-2020_11_24_390039	425	21	Sec61D-	Sec61D-	NNP
10_1101-2020_11_24_390039	425	22	targeting	targeting	NN
10_1101-2020_11_24_390039	425	23	(	(	-LRB-
10_1101-2020_11_24_390039	425	24	lane	lane	NNP
10_1101-2020_11_24_390039	425	25	2	2	CD
10_1101-2020_11_24_390039	425	26	)	)	-RRB-
10_1101-2020_11_24_390039	425	27	,	,	,
10_1101-2020_11_24_390039	425	28	EMC5-targeting	emc5-targete	VBG
10_1101-2020_11_24_390039	425	29	(	(	-LRB-
10_1101-2020_11_24_390039	425	30	lane	lane	NNP
10_1101-2020_11_24_390039	425	31	3	3	CD
10_1101-2020_11_24_390039	425	32	)	)	-RRB-
10_1101-2020_11_24_390039	425	33	and	and	CC
10_1101-2020_11_24_390039	425	34	Sec61D+EMC5-targeting	sec61d+emc5-targete	VBG
10_1101-2020_11_24_390039	425	35	(	(	-LRB-
10_1101-2020_11_24_390039	425	36	lane	lane	NNP
10_1101-2020_11_24_390039	425	37	4	4	CD
10_1101-2020_11_24_390039	425	38	)	)	-RRB-
10_1101-2020_11_24_390039	425	39	siRNAs	sirnas	CD
10_1101-2020_11_24_390039	425	40	were	be	VBD
10_1101-2020_11_24_390039	425	41	determined	determine	VBN
10_1101-2020_11_24_390039	425	42	after	after	IN
10_1101-2020_11_24_390039	425	43	semi	semi	JJ
10_1101-2020_11_24_390039	425	44	-	-	NN
10_1101-2020_11_24_390039	425	45	permeabilisation	permeabilisation	NN
10_1101-2020_11_24_390039	425	46	by	by	IN
10_1101-2020_11_24_390039	425	47	immunoblotting	immunoblotte	VBG
10_1101-2020_11_24_390039	425	48	for	for	IN
10_1101-2020_11_24_390039	425	49	target	target	NN
10_1101-2020_11_24_390039	425	50	genes	gene	NNS
10_1101-2020_11_24_390039	425	51	(	(	-LRB-
10_1101-2020_11_24_390039	425	52	Sec61D	Sec61D	NNP
10_1101-2020_11_24_390039	425	53	,	,	,
10_1101-2020_11_24_390039	425	54	EMC5	EMC5	NNP
10_1101-2020_11_24_390039	425	55	)	)	-RRB-
10_1101-2020_11_24_390039	425	56	.	.	.
10_1101-2020_11_24_390039	426	1	Controls	control	NNS
10_1101-2020_11_24_390039	426	2	to	to	TO
10_1101-2020_11_24_390039	426	3	assess	assess	VB
10_1101-2020_11_24_390039	426	4	destabilisation	destabilisation	NN
10_1101-2020_11_24_390039	426	5	of	of	IN
10_1101-2020_11_24_390039	426	6	the	the	DT
10_1101-2020_11_24_390039	426	7	wider	wide	JJR
10_1101-2020_11_24_390039	426	8	EMC	EMC	NNP
10_1101-2020_11_24_390039	426	9	complex	complex	NN
10_1101-2020_11_24_390039	426	10	(	(	-LRB-
10_1101-2020_11_24_390039	426	11	EMC2	EMC2	NNP
10_1101-2020_11_24_390039	426	12	and	and	CC
10_1101-2020_11_24_390039	426	13	EMC6	EMC6	NNP
10_1101-2020_11_24_390039	426	14	)	)	-RRB-
10_1101-2020_11_24_390039	426	15	,	,	,
10_1101-2020_11_24_390039	426	16	any	any	DT
10_1101-2020_11_24_390039	426	17	effect	effect	NN
10_1101-2020_11_24_390039	426	18	on	on	IN
10_1101-2020_11_24_390039	426	19	the	the	DT
10_1101-2020_11_24_390039	426	20	N	N	NNP
10_1101-2020_11_24_390039	426	21	-	-	HYPH
10_1101-2020_11_24_390039	426	22	glycosylation	glycosylation	NN
10_1101-2020_11_24_390039	426	23	machinery	machinery	NN
10_1101-2020_11_24_390039	426	24	(	(	-LRB-
10_1101-2020_11_24_390039	426	25	the	the	DT
10_1101-2020_11_24_390039	426	26	ER	ER	NNP
10_1101-2020_11_24_390039	426	27	-	-	HYPH
10_1101-2020_11_24_390039	426	28	resident	resident	NN
10_1101-2020_11_24_390039	426	29	48	48	CD
10_1101-2020_11_24_390039	426	30	kDa	kDa	NNS
10_1101-2020_11_24_390039	426	31	subunit	subunit	NN
10_1101-2020_11_24_390039	426	32	of	of	IN
10_1101-2020_11_24_390039	426	33	the	the	DT
10_1101-2020_11_24_390039	426	34	oligosaccharyl	oligosaccharyl	NN
10_1101-2020_11_24_390039	426	35	-	-	HYPH
10_1101-2020_11_24_390039	426	36	transferase	transferase	NN
10_1101-2020_11_24_390039	426	37	complex	complex	NN
10_1101-2020_11_24_390039	426	38	(	(	-LRB-
10_1101-2020_11_24_390039	426	39	OST48	ost48	UH
10_1101-2020_11_24_390039	426	40	)	)	-RRB-
10_1101-2020_11_24_390039	426	41	and	and	CC
10_1101-2020_11_24_390039	426	42	the	the	DT
10_1101-2020_11_24_390039	426	43	quantity	quantity	NN
10_1101-2020_11_24_390039	426	44	of	of	IN
10_1101-2020_11_24_390039	426	45	SP	SP	NNP
10_1101-2020_11_24_390039	426	46	cells	cell	NNS
10_1101-2020_11_24_390039	426	47	used	use	VBN
10_1101-2020_11_24_390039	426	48	in	in	IN
10_1101-2020_11_24_390039	426	49	each	each	DT
10_1101-2020_11_24_390039	426	50	experiment	experiment	NN
10_1101-2020_11_24_390039	426	51	(	(	-LRB-
10_1101-2020_11_24_390039	426	52	the	the	DT
10_1101-2020_11_24_390039	426	53	nuclear	nuclear	JJ
10_1101-2020_11_24_390039	426	54	protein	protein	NN
10_1101-2020_11_24_390039	426	55	Lamin	Lamin	NNP
10_1101-2020_11_24_390039	426	56	-	-	HYPH
10_1101-2020_11_24_390039	426	57	B1	b1	NN
10_1101-2020_11_24_390039	426	58	(	(	-LRB-
10_1101-2020_11_24_390039	426	59	LMNB1	lmnb1	NN
10_1101-2020_11_24_390039	426	60	)	)	-RRB-
10_1101-2020_11_24_390039	426	61	)	)	-RRB-
10_1101-2020_11_24_390039	426	62	,	,	,
10_1101-2020_11_24_390039	426	63	are	be	VBP
10_1101-2020_11_24_390039	426	64	also	also	RB
10_1101-2020_11_24_390039	426	65	shown	show	VBN
10_1101-2020_11_24_390039	426	66	.	.	.
10_1101-2020_11_24_390039	427	1	(	(	-LRB-
10_1101-2020_11_24_390039	427	2	B	b	NN
10_1101-2020_11_24_390039	427	3	)	)	-RRB-
10_1101-2020_11_24_390039	427	4	The	the	DT
10_1101-2020_11_24_390039	427	5	efficiencies	efficiency	NNS
10_1101-2020_11_24_390039	427	6	of	of	IN
10_1101-2020_11_24_390039	427	7	siRNA	sirna	NN
10_1101-2020_11_24_390039	427	8	-	-	HYPH
10_1101-2020_11_24_390039	427	9	mediated	mediate	VBN
10_1101-2020_11_24_390039	427	10	knockdown	knockdown	NNP
10_1101-2020_11_24_390039	427	11	(	(	-LRB-
10_1101-2020_11_24_390039	427	12	bold	bold	JJ
10_1101-2020_11_24_390039	427	13	)	)	-RRB-
10_1101-2020_11_24_390039	427	14	were	be	VBD
10_1101-2020_11_24_390039	427	15	calculated	calculate	VBN
10_1101-2020_11_24_390039	427	16	as	as	IN
10_1101-2020_11_24_390039	427	17	a	a	DT
10_1101-2020_11_24_390039	427	18	proportion	proportion	NN
10_1101-2020_11_24_390039	427	19	of	of	IN
10_1101-2020_11_24_390039	427	20	the	the	DT
10_1101-2020_11_24_390039	427	21	signal	signal	JJ
10_1101-2020_11_24_390039	427	22	intensity	intensity	NN
10_1101-2020_11_24_390039	427	23	obtained	obtain	VBN
10_1101-2020_11_24_390039	427	24	with	with	IN
10_1101-2020_11_24_390039	427	25	the	the	DT
10_1101-2020_11_24_390039	427	26	NT	NT	NNP
10_1101-2020_11_24_390039	427	27	control	control	NN
10_1101-2020_11_24_390039	427	28	(	(	-LRB-
10_1101-2020_11_24_390039	427	29	set	set	VBN
10_1101-2020_11_24_390039	427	30	as	as	IN
10_1101-2020_11_24_390039	427	31	100	100	CD
10_1101-2020_11_24_390039	427	32	%	%	NN
10_1101-2020_11_24_390039	427	33	)	)	-RRB-
10_1101-2020_11_24_390039	427	34	.	.	.
10_1101-2020_11_24_390039	428	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	428	2	-	-	:
10_1101-2020_11_24_390039	428	3	BY	by	IN
10_1101-2020_11_24_390039	428	4	-	-	HYPH
10_1101-2020_11_24_390039	428	5	ND	ND	NNP
10_1101-2020_11_24_390039	428	6	4.0	4.0	CD
10_1101-2020_11_24_390039	428	7	International	international	JJ
10_1101-2020_11_24_390039	428	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	428	9	available	available	JJ
10_1101-2020_11_24_390039	428	10	under	under	IN
10_1101-2020_11_24_390039	428	11	a	a	DT
10_1101-2020_11_24_390039	428	12	(	(	-LRB-
10_1101-2020_11_24_390039	428	13	which	which	WDT
10_1101-2020_11_24_390039	428	14	was	be	VBD
10_1101-2020_11_24_390039	428	15	not	not	RB
10_1101-2020_11_24_390039	428	16	certified	certify	VBN
10_1101-2020_11_24_390039	428	17	by	by	IN
10_1101-2020_11_24_390039	428	18	peer	peer	NN
10_1101-2020_11_24_390039	428	19	review	review	NN
10_1101-2020_11_24_390039	428	20	)	)	-RRB-
10_1101-2020_11_24_390039	428	21	is	be	VBZ
10_1101-2020_11_24_390039	428	22	the	the	DT
10_1101-2020_11_24_390039	428	23	author	author	NN
10_1101-2020_11_24_390039	428	24	/	/	SYM
10_1101-2020_11_24_390039	428	25	funder	funder	NN
10_1101-2020_11_24_390039	428	26	,	,	,
10_1101-2020_11_24_390039	428	27	who	who	WP
10_1101-2020_11_24_390039	428	28	has	have	VBZ
10_1101-2020_11_24_390039	428	29	granted	grant	VBN
10_1101-2020_11_24_390039	428	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	428	31	a	a	DT
10_1101-2020_11_24_390039	428	32	license	license	NN
10_1101-2020_11_24_390039	428	33	to	to	TO
10_1101-2020_11_24_390039	428	34	display	display	VB
10_1101-2020_11_24_390039	428	35	the	the	DT
10_1101-2020_11_24_390039	428	36	preprint	preprint	NN
10_1101-2020_11_24_390039	428	37	in	in	IN
10_1101-2020_11_24_390039	428	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	428	39	.	.	.
10_1101-2020_11_24_390039	429	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	429	2	is	be	VBZ
10_1101-2020_11_24_390039	429	3	The	the	DT
10_1101-2020_11_24_390039	429	4	copyright	copyright	NN
10_1101-2020_11_24_390039	429	5	holder	holder	NN
10_1101-2020_11_24_390039	429	6	for	for	IN
10_1101-2020_11_24_390039	429	7	this	this	DT
10_1101-2020_11_24_390039	429	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	429	9	version	version	NN
10_1101-2020_11_24_390039	429	10	posted	post	VBD
10_1101-2020_11_24_390039	429	11	January	January	NNP
10_1101-2020_11_24_390039	429	12	5	5	CD
10_1101-2020_11_24_390039	429	13	,	,	,
10_1101-2020_11_24_390039	429	14	2021	2021	CD
10_1101-2020_11_24_390039	429	15	.	.	.
10_1101-2020_11_24_390039	429	16	;	;	:
10_1101-2020_11_24_390039	429	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	429	18	:	:	:
10_1101-2020_11_24_390039	429	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	429	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	429	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	429	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NNP
10_1101-2020_11_24_390039	429	23	Quantitations	quantitation	NNS
10_1101-2020_11_24_390039	429	24	are	be	VBP
10_1101-2020_11_24_390039	429	25	given	give	VBN
10_1101-2020_11_24_390039	429	26	as	as	IN
10_1101-2020_11_24_390039	429	27	mean±s.e.m	mean±s.e.m	NN
10_1101-2020_11_24_390039	429	28	for	for	IN
10_1101-2020_11_24_390039	429	29	three	three	CD
10_1101-2020_11_24_390039	429	30	separate	separate	JJ
10_1101-2020_11_24_390039	429	31	siRNA	sirna	NN
10_1101-2020_11_24_390039	429	32	treatments	treatment	NNS
10_1101-2020_11_24_390039	429	33	(	(	-LRB-
10_1101-2020_11_24_390039	429	34	n=3	n=3	NNP
10_1101-2020_11_24_390039	429	35	)	)	-RRB-
10_1101-2020_11_24_390039	429	36	with	with	IN
10_1101-2020_11_24_390039	429	37	statistical	statistical	JJ
10_1101-2020_11_24_390039	429	38	significance	significance	NN
10_1101-2020_11_24_390039	429	39	of	of	IN
10_1101-2020_11_24_390039	429	40	siRNA	siRNA	NNP
10_1101-2020_11_24_390039	429	41	-	-	HYPH
10_1101-2020_11_24_390039	429	42	mediated	mediate	VBN
10_1101-2020_11_24_390039	429	43	knockdowns	knockdown	NNS
10_1101-2020_11_24_390039	429	44	(	(	-LRB-
10_1101-2020_11_24_390039	429	45	two	two	CD
10_1101-2020_11_24_390039	429	46	-	-	HYPH
10_1101-2020_11_24_390039	429	47	way	way	NN
10_1101-2020_11_24_390039	429	48	ANOVA	ANOVA	NNP
10_1101-2020_11_24_390039	429	49	,	,	,
10_1101-2020_11_24_390039	429	50	DF	DF	NNP
10_1101-2020_11_24_390039	429	51	and	and	CC
10_1101-2020_11_24_390039	429	52	F	F	NNP
10_1101-2020_11_24_390039	429	53	a	a	DT
10_1101-2020_11_24_390039	429	54	)	)	-RRB-
10_1101-2020_11_24_390039	429	55	D	d	NN
10_1101-2020_11_24_390039	429	56	c	c	NN
10_1101-2020_11_24_390039	429	57	a	a	NN
10_1101-2020_11_24_390039	429	58	.	.	.
10_1101-2020_11_24_390039	430	1	Statistical	statistical	JJ
10_1101-2020_11_24_390039	430	2	significance	significance	NN
10_1101-2020_11_24_390039	430	3	is	be	VBZ
10_1101-2020_11_24_390039	430	4	given	give	VBN
10_1101-2020_11_24_390039	430	5	as	as	IN
10_1101-2020_11_24_390039	430	6	n.s	n.s	NNP
10_1101-2020_11_24_390039	430	7	.	.	NNP
10_1101-2020_11_24_390039	430	8	,	,	,
10_1101-2020_11_24_390039	430	9	non	non	JJ
10_1101-2020_11_24_390039	430	10	-	-	JJ
10_1101-2020_11_24_390039	430	11	significant	significant	JJ
10_1101-2020_11_24_390039	430	12	>	>	NN
10_1101-2020_11_24_390039	430	13	0.1	0.1	CD
10_1101-2020_11_24_390039	430	14	;	;	:
10_1101-2020_11_24_390039	430	15	*	*	NFP
10_1101-2020_11_24_390039	430	16	,	,	,
10_1101-2020_11_24_390039	430	17	P	p	NN
10_1101-2020_11_24_390039	430	18	<	<	XX
10_1101-2020_11_24_390039	430	19	0.05	0.05	XX
10_1101-2020_11_24_390039	430	20	;	;	:
10_1101-2020_11_24_390039	430	21	*	*	NFP
10_1101-2020_11_24_390039	430	22	*	*	NFP
10_1101-2020_11_24_390039	430	23	*	*	NFP
10_1101-2020_11_24_390039	430	24	*	*	NFP
10_1101-2020_11_24_390039	430	25	,	,	,
10_1101-2020_11_24_390039	430	26	P	p	NN
10_1101-2020_11_24_390039	430	27	<	<	XX
10_1101-2020_11_24_390039	430	28	0.0001	0.0001	CD
10_1101-2020_11_24_390039	430	29	.	.	.
10_1101-2020_11_24_390039	431	1	(	(	-LRB-
10_1101-2020_11_24_390039	431	2	C	c	NN
10_1101-2020_11_24_390039	431	3	)	)	-RRB-
10_1101-2020_11_24_390039	431	4	Knockdown	Knockdown	NNP
10_1101-2020_11_24_390039	431	5	efficiencies	efficiency	NNS
10_1101-2020_11_24_390039	431	6	(	(	-LRB-
10_1101-2020_11_24_390039	431	7	mean±s.e.m	mean±s.e.m	NNP
10_1101-2020_11_24_390039	431	8	)	)	-RRB-
10_1101-2020_11_24_390039	431	9	for	for	IN
10_1101-2020_11_24_390039	431	10	each	each	DT
10_1101-2020_11_24_390039	431	11	of	of	IN
10_1101-2020_11_24_390039	431	12	the	the	DT
10_1101-2020_11_24_390039	431	13	target	target	NN
10_1101-2020_11_24_390039	431	14	genes	gene	NNS
10_1101-2020_11_24_390039	431	15	.	.	.
10_1101-2020_11_24_390039	432	1	(	(	-LRB-
10_1101-2020_11_24_390039	432	2	D	d	NN
10_1101-2020_11_24_390039	432	3	)	)	-RRB-
10_1101-2020_11_24_390039	432	4	A	a	DT
10_1101-2020_11_24_390039	432	5	truncated	truncate	VBN
10_1101-2020_11_24_390039	432	6	variant	variant	NN
10_1101-2020_11_24_390039	432	7	of	of	IN
10_1101-2020_11_24_390039	432	8	the	the	DT
10_1101-2020_11_24_390039	432	9	S	S	NNP
10_1101-2020_11_24_390039	432	10	protein	protein	NN
10_1101-2020_11_24_390039	432	11	(	(	-LRB-
10_1101-2020_11_24_390039	432	12	S	S	NNP
10_1101-2020_11_24_390039	432	13	-	-	HYPH
10_1101-2020_11_24_390039	432	14	half	half	NN
10_1101-2020_11_24_390039	432	15	-	-	HYPH
10_1101-2020_11_24_390039	432	16	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	432	17	)	)	-RRB-
10_1101-2020_11_24_390039	432	18	was	be	VBD
10_1101-2020_11_24_390039	432	19	synthesised	synthesise	VBN
10_1101-2020_11_24_390039	432	20	in	in	IN
10_1101-2020_11_24_390039	432	21	rabbit	rabbit	NN
10_1101-2020_11_24_390039	432	22	reticulocyte	reticulocyte	NNP
10_1101-2020_11_24_390039	432	23	lysate	lysate	NN
10_1101-2020_11_24_390039	432	24	supplemented	supplement	VBN
10_1101-2020_11_24_390039	432	25	with	with	IN
10_1101-2020_11_24_390039	432	26	SP	SP	NNP
10_1101-2020_11_24_390039	432	27	cells	cell	NNS
10_1101-2020_11_24_390039	432	28	with	with	IN
10_1101-2020_11_24_390039	432	29	impaired	impaired	JJ
10_1101-2020_11_24_390039	432	30	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	432	31	complex	complex	NN
10_1101-2020_11_24_390039	432	32	and/or	and/or	CC
10_1101-2020_11_24_390039	432	33	EMC	EMC	NNP
10_1101-2020_11_24_390039	432	34	function	function	NN
10_1101-2020_11_24_390039	432	35	and	and	CC
10_1101-2020_11_24_390039	432	36	recovered	recover	VBN
10_1101-2020_11_24_390039	432	37	by	by	IN
10_1101-2020_11_24_390039	432	38	immunoprecipitation	immunoprecipitation	NN
10_1101-2020_11_24_390039	432	39	via	via	IN
10_1101-2020_11_24_390039	432	40	the	the	DT
10_1101-2020_11_24_390039	432	41	OPG2	OPG2	NNP
10_1101-2020_11_24_390039	432	42	tag	tag	NN
10_1101-2020_11_24_390039	432	43	.	.	.
10_1101-2020_11_24_390039	433	1	Radiolabelled	radiolabelle	VBN
10_1101-2020_11_24_390039	433	2	products	product	NNS
10_1101-2020_11_24_390039	433	3	resolved	resolve	VBN
10_1101-2020_11_24_390039	433	4	by	by	IN
10_1101-2020_11_24_390039	433	5	SDS	SDS	NNP
10_1101-2020_11_24_390039	433	6	-	-	HYPH
10_1101-2020_11_24_390039	433	7	PAGE	PAGE	NNP
10_1101-2020_11_24_390039	433	8	and	and	CC
10_1101-2020_11_24_390039	433	9	analysed	analyse	VBN
10_1101-2020_11_24_390039	433	10	by	by	IN
10_1101-2020_11_24_390039	433	11	phosphorimaging	phosphorimage	VBG
10_1101-2020_11_24_390039	433	12	.	.	.
10_1101-2020_11_24_390039	434	1	N	n	LS
10_1101-2020_11_24_390039	434	2	-	-	HYPH
10_1101-2020_11_24_390039	434	3	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	434	4	(	(	-LRB-
10_1101-2020_11_24_390039	434	5	14-Gly	14-gly	CD
10_1101-2020_11_24_390039	434	6	)	)	-RRB-
10_1101-2020_11_24_390039	434	7	versus	versus	IN
10_1101-2020_11_24_390039	434	8	non	non	JJ
10_1101-2020_11_24_390039	434	9	-	-	JJ
10_1101-2020_11_24_390039	434	10	N	n	JJ
10_1101-2020_11_24_390039	434	11	-	-	HYPH
10_1101-2020_11_24_390039	434	12	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	434	13	(	(	-LRB-
10_1101-2020_11_24_390039	434	14	0Gly	0gly	NN
10_1101-2020_11_24_390039	434	15	)	)	-RRB-
10_1101-2020_11_24_390039	434	16	species	specie	NNS
10_1101-2020_11_24_390039	434	17	were	be	VBD
10_1101-2020_11_24_390039	434	18	identified	identify	VBN
10_1101-2020_11_24_390039	434	19	by	by	IN
10_1101-2020_11_24_390039	434	20	treatment	treatment	NN
10_1101-2020_11_24_390039	434	21	with	with	IN
10_1101-2020_11_24_390039	434	22	endoglycosidase	endoglycosidase	NN
10_1101-2020_11_24_390039	434	23	H	h	NN
10_1101-2020_11_24_390039	434	24	(	(	-LRB-
10_1101-2020_11_24_390039	434	25	Endo	Endo	NNP
10_1101-2020_11_24_390039	434	26	H	H	NNP
10_1101-2020_11_24_390039	434	27	,	,	,
10_1101-2020_11_24_390039	434	28	lane	lane	NN
10_1101-2020_11_24_390039	434	29	1	1	CD
10_1101-2020_11_24_390039	434	30	)	)	-RRB-
10_1101-2020_11_24_390039	434	31	.	.	.
10_1101-2020_11_24_390039	435	1	(	(	-LRB-
10_1101-2020_11_24_390039	435	2	E	e	NN
10_1101-2020_11_24_390039	435	3	)	)	-RRB-
10_1101-2020_11_24_390039	435	4	Further	further	JJ
10_1101-2020_11_24_390039	435	5	analysis	analysis	NN
10_1101-2020_11_24_390039	435	6	of	of	IN
10_1101-2020_11_24_390039	435	7	the	the	DT
10_1101-2020_11_24_390039	435	8	data	datum	NNS
10_1101-2020_11_24_390039	435	9	presented	present	VBN
10_1101-2020_11_24_390039	435	10	in	in	IN
10_1101-2020_11_24_390039	435	11	Fig	Fig	NNP
10_1101-2020_11_24_390039	435	12	.	.	.
10_1101-2020_11_24_390039	436	1	3E	3E	NNP
10_1101-2020_11_24_390039	436	2	of	of	IN
10_1101-2020_11_24_390039	436	3	the	the	DT
10_1101-2020_11_24_390039	436	4	main	main	JJ
10_1101-2020_11_24_390039	436	5	text	text	NN
10_1101-2020_11_24_390039	436	6	.	.	.
10_1101-2020_11_24_390039	437	1	Here	here	RB
10_1101-2020_11_24_390039	437	2	,	,	,
10_1101-2020_11_24_390039	437	3	the	the	DT
10_1101-2020_11_24_390039	437	4	ratio	ratio	NN
10_1101-2020_11_24_390039	437	5	of	of	IN
10_1101-2020_11_24_390039	437	6	3Gly	3gly	CD
10_1101-2020_11_24_390039	437	7	and	and	CC
10_1101-2020_11_24_390039	437	8	4Gly	4gly	CD
10_1101-2020_11_24_390039	437	9	bearing	bear	VBG
10_1101-2020_11_24_390039	437	10	OPG2-ORF6-OPG2	OPG2-ORF6-OPG2	NNP
10_1101-2020_11_24_390039	437	11	N-	n-	CD
10_1101-2020_11_24_390039	437	12	glycosylated	glycosylate	VBN
10_1101-2020_11_24_390039	437	13	species	specie	NNS
10_1101-2020_11_24_390039	437	14	relative	relative	JJ
10_1101-2020_11_24_390039	437	15	to	to	IN
10_1101-2020_11_24_390039	437	16	the	the	DT
10_1101-2020_11_24_390039	437	17	1Gly	1Gly	``
10_1101-2020_11_24_390039	437	18	species	specie	NNS
10_1101-2020_11_24_390039	437	19	present	present	JJ
10_1101-2020_11_24_390039	437	20	in	in	IN
10_1101-2020_11_24_390039	437	21	the	the	DT
10_1101-2020_11_24_390039	437	22	same	same	JJ
10_1101-2020_11_24_390039	437	23	sample	sample	NN
10_1101-2020_11_24_390039	437	24	was	be	VBD
10_1101-2020_11_24_390039	437	25	used	use	VBN
10_1101-2020_11_24_390039	437	26	as	as	IN
10_1101-2020_11_24_390039	437	27	a	a	DT
10_1101-2020_11_24_390039	437	28	proxy	proxy	NN
10_1101-2020_11_24_390039	437	29	to	to	TO
10_1101-2020_11_24_390039	437	30	estimate	estimate	VB
10_1101-2020_11_24_390039	437	31	potential	potential	JJ
10_1101-2020_11_24_390039	437	32	mis	mis	NN
10_1101-2020_11_24_390039	437	33	-	-	HYPH
10_1101-2020_11_24_390039	437	34	insertion	insertion	NN
10_1101-2020_11_24_390039	437	35	of	of	IN
10_1101-2020_11_24_390039	437	36	the	the	DT
10_1101-2020_11_24_390039	437	37	ORF6	ORF6	NNP
10_1101-2020_11_24_390039	437	38	protein	protein	NN
10_1101-2020_11_24_390039	437	39	in	in	IN
10_1101-2020_11_24_390039	437	40	SP	SP	NNP
10_1101-2020_11_24_390039	437	41	cells	cell	NNS
10_1101-2020_11_24_390039	437	42	with	with	IN
10_1101-2020_11_24_390039	437	43	impaired	impaired	JJ
10_1101-2020_11_24_390039	437	44	Sec61	Sec61	NNP
10_1101-2020_11_24_390039	437	45	complex	complex	NN
10_1101-2020_11_24_390039	437	46	and/or	and/or	CC
10_1101-2020_11_24_390039	437	47	EMC	EMC	NNP
10_1101-2020_11_24_390039	437	48	function	function	VBP
10_1101-2020_11_24_390039	437	49	relative	relative	JJ
10_1101-2020_11_24_390039	437	50	to	to	IN
10_1101-2020_11_24_390039	437	51	the	the	DT
10_1101-2020_11_24_390039	437	52	NT	NT	NNP
10_1101-2020_11_24_390039	437	53	control	control	NN
10_1101-2020_11_24_390039	437	54	(	(	-LRB-
10_1101-2020_11_24_390039	437	55	set	set	VBN
10_1101-2020_11_24_390039	437	56	to	to	IN
10_1101-2020_11_24_390039	437	57	100	100	CD
10_1101-2020_11_24_390039	437	58	%	%	NN
10_1101-2020_11_24_390039	437	59	efficiency	efficiency	NN
10_1101-2020_11_24_390039	437	60	)	)	-RRB-
10_1101-2020_11_24_390039	437	61	.	.	.
10_1101-2020_11_24_390039	438	1	Quantitations	quantitation	NNS
10_1101-2020_11_24_390039	438	2	are	be	VBP
10_1101-2020_11_24_390039	438	3	given	give	VBN
10_1101-2020_11_24_390039	438	4	as	as	IN
10_1101-2020_11_24_390039	438	5	mean±s.e.m	mean±s.e.m	NN
10_1101-2020_11_24_390039	438	6	for	for	IN
10_1101-2020_11_24_390039	438	7	independent	independent	JJ
10_1101-2020_11_24_390039	438	8	translation	translation	NN
10_1101-2020_11_24_390039	438	9	reactions	reaction	NNS
10_1101-2020_11_24_390039	438	10	from	from	IN
10_1101-2020_11_24_390039	438	11	separate	separate	JJ
10_1101-2020_11_24_390039	438	12	siRNA	sirna	NN
10_1101-2020_11_24_390039	438	13	treatments	treatment	NNS
10_1101-2020_11_24_390039	438	14	performed	perform	VBN
10_1101-2020_11_24_390039	438	15	in	in	IN
10_1101-2020_11_24_390039	438	16	triplicate	triplicate	NN
10_1101-2020_11_24_390039	438	17	(	(	-LRB-
10_1101-2020_11_24_390039	438	18	n=3	n=3	NNP
10_1101-2020_11_24_390039	438	19	)	)	-RRB-
10_1101-2020_11_24_390039	438	20	and	and	CC
10_1101-2020_11_24_390039	438	21	statistical	statistical	JJ
10_1101-2020_11_24_390039	438	22	significance	significance	NN
10_1101-2020_11_24_390039	438	23	(	(	-LRB-
10_1101-2020_11_24_390039	438	24	two	two	CD
10_1101-2020_11_24_390039	438	25	-	-	HYPH
10_1101-2020_11_24_390039	438	26	way	way	NN
10_1101-2020_11_24_390039	438	27	ANOVA	ANOVA	NNP
10_1101-2020_11_24_390039	438	28	,	,	,
10_1101-2020_11_24_390039	438	29	DF	DF	NNP
10_1101-2020_11_24_390039	438	30	and	and	CC
10_1101-2020_11_24_390039	438	31	F	F	NNP
10_1101-2020_11_24_390039	438	32	values	value	NNS
10_1101-2020_11_24_390039	438	33	shown	show	VBN
10_1101-2020_11_24_390039	438	34	in	in	IN
10_1101-2020_11_24_390039	438	35	the	the	DT
10_1101-2020_11_24_390039	438	36	figure	figure	NN
10_1101-2020_11_24_390039	438	37	)	)	-RRB-
10_1101-2020_11_24_390039	438	38	was	be	VBD
10_1101-2020_11_24_390039	438	39	determined	determine	VBN
10_1101-2020_11_24_390039	438	40	D	d	NN
10_1101-2020_11_24_390039	438	41	c	c	NNP
10_1101-2020_11_24_390039	438	42	a	a	NN
10_1101-2020_11_24_390039	438	43	.	.	.
10_1101-2020_11_24_390039	439	1	S	S	NNP
10_1101-2020_11_24_390039	439	2	a	a	DT
10_1101-2020_11_24_390039	439	3	ca	ca	NN
10_1101-2020_11_24_390039	439	4	ificance	ificance	NN
10_1101-2020_11_24_390039	439	5	is	be	VBZ
10_1101-2020_11_24_390039	439	6	given	give	VBN
10_1101-2020_11_24_390039	439	7	as	as	IN
10_1101-2020_11_24_390039	439	8	n.s	n.s	NNP
10_1101-2020_11_24_390039	439	9	.	.	NNP
10_1101-2020_11_24_390039	439	10	,	,	,
10_1101-2020_11_24_390039	439	11	non-	non-	NNP
10_1101-2020_11_24_390039	439	12	significant	significant	JJ
10_1101-2020_11_24_390039	439	13	>	>	XX
10_1101-2020_11_24_390039	439	14	0.1	0.1	CD
10_1101-2020_11_24_390039	439	15	;	;	:
10_1101-2020_11_24_390039	439	16	*	*	NFP
10_1101-2020_11_24_390039	439	17	,	,	,
10_1101-2020_11_24_390039	439	18	P	p	NN
10_1101-2020_11_24_390039	439	19	<	<	XX
10_1101-2020_11_24_390039	439	20	0.05	0.05	XX
10_1101-2020_11_24_390039	439	21	;	;	:
10_1101-2020_11_24_390039	439	22	*	*	NFP
10_1101-2020_11_24_390039	439	23	*	*	NFP
10_1101-2020_11_24_390039	439	24	*	*	NFP
10_1101-2020_11_24_390039	439	25	,	,	,
10_1101-2020_11_24_390039	439	26	P	p	NN
10_1101-2020_11_24_390039	439	27	<	<	XX
10_1101-2020_11_24_390039	439	28	0.001	0.001	CD
10_1101-2020_11_24_390039	439	29	.	.	.
10_1101-2020_11_24_390039	440	1	.CC	.CC	NFP
10_1101-2020_11_24_390039	440	2	-	-	:
10_1101-2020_11_24_390039	440	3	BY	by	IN
10_1101-2020_11_24_390039	440	4	-	-	HYPH
10_1101-2020_11_24_390039	440	5	ND	ND	NNP
10_1101-2020_11_24_390039	440	6	4.0	4.0	CD
10_1101-2020_11_24_390039	440	7	International	international	JJ
10_1101-2020_11_24_390039	440	8	licensemade	licensemade	NN
10_1101-2020_11_24_390039	440	9	available	available	JJ
10_1101-2020_11_24_390039	440	10	under	under	IN
10_1101-2020_11_24_390039	440	11	a	a	DT
10_1101-2020_11_24_390039	440	12	(	(	-LRB-
10_1101-2020_11_24_390039	440	13	which	which	WDT
10_1101-2020_11_24_390039	440	14	was	be	VBD
10_1101-2020_11_24_390039	440	15	not	not	RB
10_1101-2020_11_24_390039	440	16	certified	certify	VBN
10_1101-2020_11_24_390039	440	17	by	by	IN
10_1101-2020_11_24_390039	440	18	peer	peer	NN
10_1101-2020_11_24_390039	440	19	review	review	NN
10_1101-2020_11_24_390039	440	20	)	)	-RRB-
10_1101-2020_11_24_390039	440	21	is	be	VBZ
10_1101-2020_11_24_390039	440	22	the	the	DT
10_1101-2020_11_24_390039	440	23	author	author	NN
10_1101-2020_11_24_390039	440	24	/	/	SYM
10_1101-2020_11_24_390039	440	25	funder	funder	NN
10_1101-2020_11_24_390039	440	26	,	,	,
10_1101-2020_11_24_390039	440	27	who	who	WP
10_1101-2020_11_24_390039	440	28	has	have	VBZ
10_1101-2020_11_24_390039	440	29	granted	grant	VBN
10_1101-2020_11_24_390039	440	30	bioRxiv	biorxiv	IN
10_1101-2020_11_24_390039	440	31	a	a	DT
10_1101-2020_11_24_390039	440	32	license	license	NN
10_1101-2020_11_24_390039	440	33	to	to	TO
10_1101-2020_11_24_390039	440	34	display	display	VB
10_1101-2020_11_24_390039	440	35	the	the	DT
10_1101-2020_11_24_390039	440	36	preprint	preprint	NN
10_1101-2020_11_24_390039	440	37	in	in	IN
10_1101-2020_11_24_390039	440	38	perpetuity	perpetuity	NN
10_1101-2020_11_24_390039	440	39	.	.	.
10_1101-2020_11_24_390039	441	1	It	-PRON-	PRP
10_1101-2020_11_24_390039	441	2	is	be	VBZ
10_1101-2020_11_24_390039	441	3	The	the	DT
10_1101-2020_11_24_390039	441	4	copyright	copyright	NN
10_1101-2020_11_24_390039	441	5	holder	holder	NN
10_1101-2020_11_24_390039	441	6	for	for	IN
10_1101-2020_11_24_390039	441	7	this	this	DT
10_1101-2020_11_24_390039	441	8	preprintthis	preprintthis	NN
10_1101-2020_11_24_390039	441	9	version	version	NN
10_1101-2020_11_24_390039	441	10	posted	post	VBD
10_1101-2020_11_24_390039	441	11	January	January	NNP
10_1101-2020_11_24_390039	441	12	5	5	CD
10_1101-2020_11_24_390039	441	13	,	,	,
10_1101-2020_11_24_390039	441	14	2021	2021	CD
10_1101-2020_11_24_390039	441	15	.	.	.
10_1101-2020_11_24_390039	441	16	;	;	:
10_1101-2020_11_24_390039	441	17	https://doi.org/10.1101/2020.11.24.390039doi	https://doi.org/10.1101/2020.11.24.390039doi	UH
10_1101-2020_11_24_390039	441	18	:	:	:
10_1101-2020_11_24_390039	441	19	bioRxiv	biorxiv	VB
10_1101-2020_11_24_390039	441	20	preprint	preprint	JJ
10_1101-2020_11_24_390039	441	21	https://doi.org/10.1101/2020.11.24.390039	https://doi.org/10.1101/2020.11.24.390039	NN
10_1101-2020_11_24_390039	441	22	http://creativecommons.org/licenses/by-nd/4.0/	http://creativecommons.org/licenses/by-nd/4.0/	NN