id	sid	tid	token	lemma	pos
10_1101-2020_12_31_424971	1	1	Insights	insight	NNS
10_1101-2020_12_31_424971	1	2	into	into	IN
10_1101-2020_12_31_424971	1	3	Genome	Genome	NNP
10_1101-2020_12_31_424971	1	4	Recoding	recode	VBG
10_1101-2020_12_31_424971	1	5	from	from	IN
10_1101-2020_12_31_424971	1	6	the	the	DT
10_1101-2020_12_31_424971	1	7	Mechanism	Mechanism	NNP
10_1101-2020_12_31_424971	1	8	of	of	IN
10_1101-2020_12_31_424971	1	9	a	a	DT
10_1101-2020_12_31_424971	1	10	Classic	Classic	NNP
10_1101-2020_12_31_424971	1	11	+1-Frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	1	12	tRNA	trna	NN
10_1101-2020_12_31_424971	1	13	1	1	CD
10_1101-2020_12_31_424971	1	14	Insights	insight	NNS
10_1101-2020_12_31_424971	1	15	into	into	IN
10_1101-2020_12_31_424971	1	16	Genome	Genome	NNP
10_1101-2020_12_31_424971	1	17	Recoding	recode	VBG
10_1101-2020_12_31_424971	1	18	1	1	CD
10_1101-2020_12_31_424971	1	19	from	from	IN
10_1101-2020_12_31_424971	1	20	the	the	DT
10_1101-2020_12_31_424971	1	21	Mechanism	Mechanism	NNP
10_1101-2020_12_31_424971	1	22	of	of	IN
10_1101-2020_12_31_424971	1	23	a	a	DT
10_1101-2020_12_31_424971	1	24	Classic	Classic	NNP
10_1101-2020_12_31_424971	1	25	+1-Frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	1	26	tRNA	trna	CD
10_1101-2020_12_31_424971	1	27	2	2	CD
10_1101-2020_12_31_424971	1	28	3	3	CD
10_1101-2020_12_31_424971	1	29	4	4	CD
10_1101-2020_12_31_424971	1	30	Howard	Howard	NNP
10_1101-2020_12_31_424971	1	31	Gamper1,5	gamper1,5	CD
10_1101-2020_12_31_424971	1	32	,	,	,
10_1101-2020_12_31_424971	1	33	Haixing	haixe	VBG
10_1101-2020_12_31_424971	1	34	Li2,5	li2,5	NN
10_1101-2020_12_31_424971	1	35	,	,	,
10_1101-2020_12_31_424971	1	36	Isao	Isao	NNP
10_1101-2020_12_31_424971	1	37	Masuda1	Masuda1	NNP
10_1101-2020_12_31_424971	1	38	,	,	,
10_1101-2020_12_31_424971	1	39	D.	D.	NNP
10_1101-2020_12_31_424971	1	40	Miklos	Miklos	NNP
10_1101-2020_12_31_424971	1	41	Robkis3	Robkis3	NNP
10_1101-2020_12_31_424971	1	42	,	,	,
10_1101-2020_12_31_424971	1	43	Thomas	Thomas	NNP
10_1101-2020_12_31_424971	1	44	Christian1	Christian1	NNP
10_1101-2020_12_31_424971	1	45	,	,	,
10_1101-2020_12_31_424971	1	46	5	5	CD
10_1101-2020_12_31_424971	1	47	Adam	Adam	NNP
10_1101-2020_12_31_424971	1	48	B.	B.	NNP
10_1101-2020_12_31_424971	1	49	Conn4	Conn4	NNS
10_1101-2020_12_31_424971	1	50	,	,	,
10_1101-2020_12_31_424971	1	51	Gregor	Gregor	NNP
10_1101-2020_12_31_424971	1	52	Blaha4	Blaha4	NNP
10_1101-2020_12_31_424971	1	53	,	,	,
10_1101-2020_12_31_424971	1	54	E.	E.	NNP
10_1101-2020_12_31_424971	1	55	James	James	NNP
10_1101-2020_12_31_424971	1	56	Petersson3	Petersson3	NNP
10_1101-2020_12_31_424971	1	57	,	,	,
10_1101-2020_12_31_424971	1	58	Ruben	Ruben	NNP
10_1101-2020_12_31_424971	1	59	L.	L.	NNP
10_1101-2020_12_31_424971	1	60	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	1	61	,	,	,
10_1101-2020_12_31_424971	1	62	Jr2	Jr2	NNP
10_1101-2020_12_31_424971	1	63	,	,	,
10_1101-2020_12_31_424971	1	64	#	#	$
10_1101-2020_12_31_424971	1	65	,	,	,
10_1101-2020_12_31_424971	1	66	6	6	CD
10_1101-2020_12_31_424971	1	67	and	and	CC
10_1101-2020_12_31_424971	1	68	Ya	Ya	NNP
10_1101-2020_12_31_424971	1	69	-	-	HYPH
10_1101-2020_12_31_424971	1	70	Ming	Ming	NNP
10_1101-2020_12_31_424971	1	71	Hou1	Hou1	NNP
10_1101-2020_12_31_424971	1	72	,	,	,
10_1101-2020_12_31_424971	1	73	#	#	$
10_1101-2020_12_31_424971	1	74	,	,	,
10_1101-2020_12_31_424971	1	75	*	*	NFP
10_1101-2020_12_31_424971	1	76	7	7	CD
10_1101-2020_12_31_424971	1	77	8	8	CD
10_1101-2020_12_31_424971	1	78	9	9	CD
10_1101-2020_12_31_424971	1	79	1Department	1department	CD
10_1101-2020_12_31_424971	1	80	of	of	IN
10_1101-2020_12_31_424971	1	81	Biochemistry	Biochemistry	NNP
10_1101-2020_12_31_424971	1	82	and	and	CC
10_1101-2020_12_31_424971	1	83	Molecular	Molecular	NNP
10_1101-2020_12_31_424971	1	84	Biology	Biology	NNP
10_1101-2020_12_31_424971	1	85	,	,	,
10_1101-2020_12_31_424971	1	86	Thomas	Thomas	NNP
10_1101-2020_12_31_424971	1	87	Jefferson	Jefferson	NNP
10_1101-2020_12_31_424971	1	88	University	University	NNP
10_1101-2020_12_31_424971	1	89	,	,	,
10_1101-2020_12_31_424971	1	90	10	10	CD
10_1101-2020_12_31_424971	1	91	Philadelphia	Philadelphia	NNP
10_1101-2020_12_31_424971	1	92	,	,	,
10_1101-2020_12_31_424971	1	93	PA	pa	NN
10_1101-2020_12_31_424971	1	94	19107	19107	CD
10_1101-2020_12_31_424971	1	95	,	,	,
10_1101-2020_12_31_424971	1	96	USA	USA	NNP
10_1101-2020_12_31_424971	1	97	11	11	CD
10_1101-2020_12_31_424971	1	98	2Department	2department	CD
10_1101-2020_12_31_424971	1	99	of	of	IN
10_1101-2020_12_31_424971	1	100	Chemistry	Chemistry	NNP
10_1101-2020_12_31_424971	1	101	,	,	,
10_1101-2020_12_31_424971	1	102	Columbia	Columbia	NNP
10_1101-2020_12_31_424971	1	103	University	University	NNP
10_1101-2020_12_31_424971	1	104	,	,	,
10_1101-2020_12_31_424971	1	105	New	New	NNP
10_1101-2020_12_31_424971	1	106	York	York	NNP
10_1101-2020_12_31_424971	1	107	,	,	,
10_1101-2020_12_31_424971	1	108	NY	NY	NNP
10_1101-2020_12_31_424971	1	109	10027	10027	CD
10_1101-2020_12_31_424971	1	110	,	,	,
10_1101-2020_12_31_424971	1	111	USA	USA	NNP
10_1101-2020_12_31_424971	1	112	12	12	CD
10_1101-2020_12_31_424971	1	113	3Department	3Department	NNP
10_1101-2020_12_31_424971	1	114	of	of	IN
10_1101-2020_12_31_424971	1	115	Chemistry	Chemistry	NNP
10_1101-2020_12_31_424971	1	116	,	,	,
10_1101-2020_12_31_424971	1	117	University	University	NNP
10_1101-2020_12_31_424971	1	118	of	of	IN
10_1101-2020_12_31_424971	1	119	Pennsylvania	Pennsylvania	NNP
10_1101-2020_12_31_424971	1	120	,	,	,
10_1101-2020_12_31_424971	1	121	Philadelphia	Philadelphia	NNP
10_1101-2020_12_31_424971	1	122	,	,	,
10_1101-2020_12_31_424971	1	123	PA	PA	NNP
10_1101-2020_12_31_424971	1	124	19104	19104	CD
10_1101-2020_12_31_424971	1	125	,	,	,
10_1101-2020_12_31_424971	1	126	USA	USA	NNP
10_1101-2020_12_31_424971	1	127	13	13	CD
10_1101-2020_12_31_424971	1	128	4Department	4department	NN
10_1101-2020_12_31_424971	1	129	of	of	IN
10_1101-2020_12_31_424971	1	130	Biochemistry	Biochemistry	NNP
10_1101-2020_12_31_424971	1	131	,	,	,
10_1101-2020_12_31_424971	1	132	University	University	NNP
10_1101-2020_12_31_424971	1	133	of	of	IN
10_1101-2020_12_31_424971	1	134	California	California	NNP
10_1101-2020_12_31_424971	1	135	,	,	,
10_1101-2020_12_31_424971	1	136	Riverside	Riverside	NNP
10_1101-2020_12_31_424971	1	137	,	,	,
10_1101-2020_12_31_424971	1	138	CA	CA	NNP
10_1101-2020_12_31_424971	1	139	92521	92521	CD
10_1101-2020_12_31_424971	1	140	,	,	,
10_1101-2020_12_31_424971	1	141	USA	USA	NNP
10_1101-2020_12_31_424971	1	142	14	14	CD
10_1101-2020_12_31_424971	1	143	5These	5these	JJ
10_1101-2020_12_31_424971	1	144	authors	author	NNS
10_1101-2020_12_31_424971	1	145	contributed	contribute	VBD
10_1101-2020_12_31_424971	1	146	equally	equally	RB
10_1101-2020_12_31_424971	1	147	to	to	IN
10_1101-2020_12_31_424971	1	148	this	this	DT
10_1101-2020_12_31_424971	1	149	work	work	NN
10_1101-2020_12_31_424971	1	150	.	.	.
10_1101-2020_12_31_424971	2	1	15	15	CD
10_1101-2020_12_31_424971	2	2	#	#	$
10_1101-2020_12_31_424971	2	3	Corresponding	Corresponding	NNP
10_1101-2020_12_31_424971	2	4	authors	author	NNS
10_1101-2020_12_31_424971	2	5	:	:	:
10_1101-2020_12_31_424971	2	6	16	16	CD
10_1101-2020_12_31_424971	2	7	rlg2118@columbia.edu	rlg2118@columbia.edu	NNS
10_1101-2020_12_31_424971	2	8	(	(	-LRB-
10_1101-2020_12_31_424971	2	9	T	t	NN
10_1101-2020_12_31_424971	2	10	)	)	-RRB-
10_1101-2020_12_31_424971	2	11	212	212	CD
10_1101-2020_12_31_424971	2	12	-	-	HYPH
10_1101-2020_12_31_424971	2	13	854	854	CD
10_1101-2020_12_31_424971	2	14	-	-	HYPH
10_1101-2020_12_31_424971	2	15	1096	1096	CD
10_1101-2020_12_31_424971	2	16	;	;	:
10_1101-2020_12_31_424971	2	17	(	(	-LRB-
10_1101-2020_12_31_424971	2	18	F	f	NN
10_1101-2020_12_31_424971	2	19	)	)	-RRB-
10_1101-2020_12_31_424971	2	20	212	212	CD
10_1101-2020_12_31_424971	2	21	-	-	HYPH
10_1101-2020_12_31_424971	2	22	932	932	CD
10_1101-2020_12_31_424971	2	23	-	-	HYPH
10_1101-2020_12_31_424971	2	24	1289	1289	CD
10_1101-2020_12_31_424971	2	25	;	;	:
10_1101-2020_12_31_424971	2	26	ORCID	ORCID	NNP
10_1101-2020_12_31_424971	2	27	:	:	:
10_1101-2020_12_31_424971	2	28	0000	0000	CD
10_1101-2020_12_31_424971	2	29	-	-	HYPH
10_1101-2020_12_31_424971	2	30	0002	0002	CD
10_1101-2020_12_31_424971	2	31	-	-	HYPH
10_1101-2020_12_31_424971	2	32	1344	1344	CD
10_1101-2020_12_31_424971	2	33	-	-	SYM
10_1101-2020_12_31_424971	2	34	5581	5581	CD
10_1101-2020_12_31_424971	2	35	17	17	CD
10_1101-2020_12_31_424971	2	36	ya-ming.hou@jefferson.edu	ya-ming.hou@jefferson.edu	NN
10_1101-2020_12_31_424971	2	37	(	(	-LRB-
10_1101-2020_12_31_424971	2	38	T	t	NN
10_1101-2020_12_31_424971	2	39	)	)	-RRB-
10_1101-2020_12_31_424971	2	40	215	215	CD
10_1101-2020_12_31_424971	2	41	-	-	HYPH
10_1101-2020_12_31_424971	2	42	503	503	CD
10_1101-2020_12_31_424971	2	43	-	-	HYPH
10_1101-2020_12_31_424971	2	44	4480	4480	CD
10_1101-2020_12_31_424971	2	45	;	;	:
10_1101-2020_12_31_424971	2	46	(	(	-LRB-
10_1101-2020_12_31_424971	2	47	F	f	NN
10_1101-2020_12_31_424971	2	48	)	)	-RRB-
10_1101-2020_12_31_424971	2	49	215	215	CD
10_1101-2020_12_31_424971	2	50	-	-	HYPH
10_1101-2020_12_31_424971	2	51	503	503	CD
10_1101-2020_12_31_424971	2	52	-	-	HYPH
10_1101-2020_12_31_424971	2	53	4954	4954	CD
10_1101-2020_12_31_424971	2	54	;	;	:
10_1101-2020_12_31_424971	2	55	18	18	CD
10_1101-2020_12_31_424971	2	56	ORCID	orcid	NN
10_1101-2020_12_31_424971	2	57	:	:	:
10_1101-2020_12_31_424971	2	58	0000	0000	CD
10_1101-2020_12_31_424971	2	59	-	-	HYPH
10_1101-2020_12_31_424971	2	60	0001	0001	CD
10_1101-2020_12_31_424971	2	61	-	-	HYPH
10_1101-2020_12_31_424971	2	62	6546	6546	CD
10_1101-2020_12_31_424971	2	63	-	-	HYPH
10_1101-2020_12_31_424971	2	64	2597	2597	CD
10_1101-2020_12_31_424971	2	65	19	19	CD
10_1101-2020_12_31_424971	2	66	20	20	CD
10_1101-2020_12_31_424971	2	67	*	*	NFP
10_1101-2020_12_31_424971	2	68	Lead	lead	JJ
10_1101-2020_12_31_424971	2	69	contact	contact	NN
10_1101-2020_12_31_424971	2	70	:	:	:
10_1101-2020_12_31_424971	2	71	Ya	Ya	NNP
10_1101-2020_12_31_424971	2	72	-	-	HYPH
10_1101-2020_12_31_424971	2	73	Ming	Ming	NNP
10_1101-2020_12_31_424971	2	74	Hou	Hou	NNP
10_1101-2020_12_31_424971	2	75	(	(	-LRB-
10_1101-2020_12_31_424971	2	76	ya-ming.hou@jefferson.edu	ya-ming.hou@jefferson.edu	NNP
10_1101-2020_12_31_424971	2	77	)	)	-RRB-
10_1101-2020_12_31_424971	2	78	21	21	CD
10_1101-2020_12_31_424971	2	79	22	22	CD
10_1101-2020_12_31_424971	2	80	Running	Running	NNP
10_1101-2020_12_31_424971	2	81	Title	title	NN
10_1101-2020_12_31_424971	2	82	:	:	:
10_1101-2020_12_31_424971	2	83	Mechanism	mechanism	NN
10_1101-2020_12_31_424971	2	84	of	of	IN
10_1101-2020_12_31_424971	2	85	SufB2-induced	SufB2-induced	NNP
10_1101-2020_12_31_424971	2	86	+1	+1	NNS
10_1101-2020_12_31_424971	2	87	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	2	88	23	23	CD
10_1101-2020_12_31_424971	2	89	24	24	CD
10_1101-2020_12_31_424971	2	90	25	25	CD
10_1101-2020_12_31_424971	2	91	.CC	.CC	:
10_1101-2020_12_31_424971	2	92	-	-	HYPH
10_1101-2020_12_31_424971	2	93	BY	by	IN
10_1101-2020_12_31_424971	2	94	-	-	HYPH
10_1101-2020_12_31_424971	2	95	NC	NC	NNP
10_1101-2020_12_31_424971	2	96	-	-	HYPH
10_1101-2020_12_31_424971	2	97	ND	ND	NNP
10_1101-2020_12_31_424971	2	98	4.0	4.0	CD
10_1101-2020_12_31_424971	2	99	International	International	NNP
10_1101-2020_12_31_424971	2	100	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	2	101	under	under	IN
10_1101-2020_12_31_424971	2	102	a	a	DT
10_1101-2020_12_31_424971	2	103	(	(	-LRB-
10_1101-2020_12_31_424971	2	104	which	which	WDT
10_1101-2020_12_31_424971	2	105	was	be	VBD
10_1101-2020_12_31_424971	2	106	not	not	RB
10_1101-2020_12_31_424971	2	107	certified	certify	VBN
10_1101-2020_12_31_424971	2	108	by	by	IN
10_1101-2020_12_31_424971	2	109	peer	peer	NN
10_1101-2020_12_31_424971	2	110	review	review	NN
10_1101-2020_12_31_424971	2	111	)	)	-RRB-
10_1101-2020_12_31_424971	2	112	is	be	VBZ
10_1101-2020_12_31_424971	2	113	the	the	DT
10_1101-2020_12_31_424971	2	114	author	author	NN
10_1101-2020_12_31_424971	2	115	/	/	SYM
10_1101-2020_12_31_424971	2	116	funder	funder	NN
10_1101-2020_12_31_424971	2	117	,	,	,
10_1101-2020_12_31_424971	2	118	who	who	WP
10_1101-2020_12_31_424971	2	119	has	have	VBZ
10_1101-2020_12_31_424971	2	120	granted	grant	VBN
10_1101-2020_12_31_424971	2	121	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	2	122	a	a	DT
10_1101-2020_12_31_424971	2	123	license	license	NN
10_1101-2020_12_31_424971	2	124	to	to	TO
10_1101-2020_12_31_424971	2	125	display	display	VB
10_1101-2020_12_31_424971	2	126	the	the	DT
10_1101-2020_12_31_424971	2	127	preprint	preprint	NN
10_1101-2020_12_31_424971	2	128	in	in	IN
10_1101-2020_12_31_424971	2	129	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	2	130	.	.	.
10_1101-2020_12_31_424971	3	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	3	2	is	be	VBZ
10_1101-2020_12_31_424971	3	3	made	make	VBN
10_1101-2020_12_31_424971	3	4	The	the	DT
10_1101-2020_12_31_424971	3	5	copyright	copyright	NN
10_1101-2020_12_31_424971	3	6	holder	holder	NN
10_1101-2020_12_31_424971	3	7	for	for	IN
10_1101-2020_12_31_424971	3	8	this	this	DT
10_1101-2020_12_31_424971	3	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	3	10	version	version	NN
10_1101-2020_12_31_424971	3	11	posted	post	VBD
10_1101-2020_12_31_424971	3	12	January	January	NNP
10_1101-2020_12_31_424971	3	13	2	2	CD
10_1101-2020_12_31_424971	3	14	,	,	,
10_1101-2020_12_31_424971	3	15	2021	2021	CD
10_1101-2020_12_31_424971	3	16	.	.	.
10_1101-2020_12_31_424971	3	17	;	;	:
10_1101-2020_12_31_424971	3	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	3	19	:	:	:
10_1101-2020_12_31_424971	3	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	3	21	preprint	preprint	NN
10_1101-2020_12_31_424971	3	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	3	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	3	24	2	2	CD
10_1101-2020_12_31_424971	3	25	ABSTRACT	ABSTRACT	NNP
10_1101-2020_12_31_424971	3	26	26	26	CD
10_1101-2020_12_31_424971	3	27	While	while	IN
10_1101-2020_12_31_424971	3	28	genome	genome	JJ
10_1101-2020_12_31_424971	3	29	recoding	recode	VBG
10_1101-2020_12_31_424971	3	30	using	use	VBG
10_1101-2020_12_31_424971	3	31	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	3	32	codons	codon	NNS
10_1101-2020_12_31_424971	3	33	to	to	TO
10_1101-2020_12_31_424971	3	34	incorporate	incorporate	VB
10_1101-2020_12_31_424971	3	35	non	non	JJ
10_1101-2020_12_31_424971	3	36	-	-	JJ
10_1101-2020_12_31_424971	3	37	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	3	38	amino	amino	NN
10_1101-2020_12_31_424971	3	39	27	27	CD
10_1101-2020_12_31_424971	3	40	acids	acid	NNS
10_1101-2020_12_31_424971	3	41	is	be	VBZ
10_1101-2020_12_31_424971	3	42	attractive	attractive	JJ
10_1101-2020_12_31_424971	3	43	for	for	IN
10_1101-2020_12_31_424971	3	44	biotechnology	biotechnology	NN
10_1101-2020_12_31_424971	3	45	and	and	CC
10_1101-2020_12_31_424971	3	46	bioengineering	bioengineering	NN
10_1101-2020_12_31_424971	3	47	purposes	purpose	NNS
10_1101-2020_12_31_424971	3	48	,	,	,
10_1101-2020_12_31_424971	3	49	the	the	DT
10_1101-2020_12_31_424971	3	50	mechanism	mechanism	NN
10_1101-2020_12_31_424971	3	51	through	through	IN
10_1101-2020_12_31_424971	3	52	which	which	WDT
10_1101-2020_12_31_424971	3	53	28	28	CD
10_1101-2020_12_31_424971	3	54	such	such	JJ
10_1101-2020_12_31_424971	3	55	codons	codon	NNS
10_1101-2020_12_31_424971	3	56	are	be	VBP
10_1101-2020_12_31_424971	3	57	translated	translate	VBN
10_1101-2020_12_31_424971	3	58	is	be	VBZ
10_1101-2020_12_31_424971	3	59	poorly	poorly	RB
10_1101-2020_12_31_424971	3	60	understood	understand	VBN
10_1101-2020_12_31_424971	3	61	.	.	.
10_1101-2020_12_31_424971	4	1	Here	here	RB
10_1101-2020_12_31_424971	4	2	we	-PRON-	PRP
10_1101-2020_12_31_424971	4	3	investigate	investigate	VBP
10_1101-2020_12_31_424971	4	4	translation	translation	NN
10_1101-2020_12_31_424971	4	5	of	of	IN
10_1101-2020_12_31_424971	4	6	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	4	7	29	29	CD
10_1101-2020_12_31_424971	4	8	codons	codon	NNS
10_1101-2020_12_31_424971	4	9	by	by	IN
10_1101-2020_12_31_424971	4	10	a	a	DT
10_1101-2020_12_31_424971	4	11	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	4	12	tRNA	trna	NN
10_1101-2020_12_31_424971	4	13	,	,	,
10_1101-2020_12_31_424971	4	14	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	4	15	,	,	,
10_1101-2020_12_31_424971	4	16	that	that	WDT
10_1101-2020_12_31_424971	4	17	contains	contain	VBZ
10_1101-2020_12_31_424971	4	18	an	an	DT
10_1101-2020_12_31_424971	4	19	extra	extra	JJ
10_1101-2020_12_31_424971	4	20	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	4	21	in	in	IN
10_1101-2020_12_31_424971	4	22	its	-PRON-	PRP$
10_1101-2020_12_31_424971	4	23	anticodon	anticodon	NN
10_1101-2020_12_31_424971	4	24	loop	loop	NN
10_1101-2020_12_31_424971	4	25	.	.	.
10_1101-2020_12_31_424971	5	1	30	30	CD
10_1101-2020_12_31_424971	5	2	Natural	natural	JJ
10_1101-2020_12_31_424971	5	3	post	post	JJ
10_1101-2020_12_31_424971	5	4	-	-	JJ
10_1101-2020_12_31_424971	5	5	transcriptional	transcriptional	JJ
10_1101-2020_12_31_424971	5	6	modification	modification	NN
10_1101-2020_12_31_424971	5	7	of	of	IN
10_1101-2020_12_31_424971	5	8	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	5	9	in	in	IN
10_1101-2020_12_31_424971	5	10	cells	cell	NNS
10_1101-2020_12_31_424971	5	11	prevents	prevent	VBZ
10_1101-2020_12_31_424971	5	12	it	-PRON-	PRP
10_1101-2020_12_31_424971	5	13	from	from	IN
10_1101-2020_12_31_424971	5	14	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	5	15	using	use	VBG
10_1101-2020_12_31_424971	5	16	a	a	DT
10_1101-2020_12_31_424971	5	17	31	31	CD
10_1101-2020_12_31_424971	5	18	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	5	19	-	-	HYPH
10_1101-2020_12_31_424971	5	20	pairing	pair	VBG
10_1101-2020_12_31_424971	5	21	mechanism	mechanism	NN
10_1101-2020_12_31_424971	5	22	such	such	JJ
10_1101-2020_12_31_424971	5	23	that	that	IN
10_1101-2020_12_31_424971	5	24	it	-PRON-	PRP
10_1101-2020_12_31_424971	5	25	preferentially	preferentially	RB
10_1101-2020_12_31_424971	5	26	employs	employ	VBZ
10_1101-2020_12_31_424971	5	27	a	a	DT
10_1101-2020_12_31_424971	5	28	triplet	triplet	NN
10_1101-2020_12_31_424971	5	29	-	-	HYPH
10_1101-2020_12_31_424971	5	30	slippage	slippage	NN
10_1101-2020_12_31_424971	5	31	mechanism	mechanism	NN
10_1101-2020_12_31_424971	5	32	.	.	.
10_1101-2020_12_31_424971	6	1	32	32	CD
10_1101-2020_12_31_424971	6	2	We	-PRON-	PRP
10_1101-2020_12_31_424971	6	3	show	show	VBP
10_1101-2020_12_31_424971	6	4	that	that	IN
10_1101-2020_12_31_424971	6	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	6	6	uses	use	VBZ
10_1101-2020_12_31_424971	6	7	triplet	triplet	NN
10_1101-2020_12_31_424971	6	8	anticodon	anticodon	NN
10_1101-2020_12_31_424971	6	9	-	-	HYPH
10_1101-2020_12_31_424971	6	10	codon	codon	NNP
10_1101-2020_12_31_424971	6	11	pairing	pair	VBG
10_1101-2020_12_31_424971	6	12	in	in	IN
10_1101-2020_12_31_424971	6	13	the	the	DT
10_1101-2020_12_31_424971	6	14	0-frame	0-frame	CD
10_1101-2020_12_31_424971	6	15	to	to	TO
10_1101-2020_12_31_424971	6	16	initially	initially	RB
10_1101-2020_12_31_424971	6	17	decode	decode	VB
10_1101-2020_12_31_424971	6	18	the	the	DT
10_1101-2020_12_31_424971	6	19	33	33	CD
10_1101-2020_12_31_424971	6	20	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	6	21	codon	codon	NN
10_1101-2020_12_31_424971	6	22	,	,	,
10_1101-2020_12_31_424971	6	23	but	but	CC
10_1101-2020_12_31_424971	6	24	subsequently	subsequently	RB
10_1101-2020_12_31_424971	6	25	shifts	shift	VBZ
10_1101-2020_12_31_424971	6	26	to	to	IN
10_1101-2020_12_31_424971	6	27	the	the	DT
10_1101-2020_12_31_424971	6	28	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	6	29	during	during	IN
10_1101-2020_12_31_424971	6	30	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	6	31	-	-	HYPH
10_1101-2020_12_31_424971	6	32	mRNA	mrna	NN
10_1101-2020_12_31_424971	6	33	translocation	translocation	NN
10_1101-2020_12_31_424971	6	34	.	.	.
10_1101-2020_12_31_424971	7	1	34	34	CD
10_1101-2020_12_31_424971	7	2	SufB2	sufb2	NN
10_1101-2020_12_31_424971	7	3	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	7	4	involves	involve	VBZ
10_1101-2020_12_31_424971	7	5	perturbation	perturbation	NN
10_1101-2020_12_31_424971	7	6	of	of	IN
10_1101-2020_12_31_424971	7	7	an	an	DT
10_1101-2020_12_31_424971	7	8	essential	essential	JJ
10_1101-2020_12_31_424971	7	9	ribosome	ribosome	JJ
10_1101-2020_12_31_424971	7	10	conformational	conformational	JJ
10_1101-2020_12_31_424971	7	11	change	change	NN
10_1101-2020_12_31_424971	7	12	that	that	IN
10_1101-2020_12_31_424971	7	13	35	35	CD
10_1101-2020_12_31_424971	7	14	facilitates	facilitate	NNS
10_1101-2020_12_31_424971	7	15	tRNA	trna	NN
10_1101-2020_12_31_424971	7	16	-	-	HYPH
10_1101-2020_12_31_424971	7	17	mRNA	mRNA	NNS
10_1101-2020_12_31_424971	7	18	movements	movement	NNS
10_1101-2020_12_31_424971	7	19	at	at	IN
10_1101-2020_12_31_424971	7	20	a	a	DT
10_1101-2020_12_31_424971	7	21	late	late	JJ
10_1101-2020_12_31_424971	7	22	stage	stage	NN
10_1101-2020_12_31_424971	7	23	of	of	IN
10_1101-2020_12_31_424971	7	24	the	the	DT
10_1101-2020_12_31_424971	7	25	translocation	translocation	NN
10_1101-2020_12_31_424971	7	26	reaction	reaction	NN
10_1101-2020_12_31_424971	7	27	.	.	.
10_1101-2020_12_31_424971	8	1	Our	-PRON-	PRP$
10_1101-2020_12_31_424971	8	2	results	result	NNS
10_1101-2020_12_31_424971	8	3	36	36	CD
10_1101-2020_12_31_424971	8	4	provide	provide	VBP
10_1101-2020_12_31_424971	8	5	a	a	DT
10_1101-2020_12_31_424971	8	6	molecular	molecular	JJ
10_1101-2020_12_31_424971	8	7	mechanism	mechanism	NN
10_1101-2020_12_31_424971	8	8	for	for	IN
10_1101-2020_12_31_424971	8	9	SufB2-induced	SufB2-induced	NNP
10_1101-2020_12_31_424971	8	10	+1	+1	NNS
10_1101-2020_12_31_424971	8	11	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	8	12	and	and	CC
10_1101-2020_12_31_424971	8	13	suggest	suggest	VBP
10_1101-2020_12_31_424971	8	14	that	that	IN
10_1101-2020_12_31_424971	8	15	engineering	engineer	VBG
10_1101-2020_12_31_424971	8	16	37	37	CD
10_1101-2020_12_31_424971	8	17	of	of	IN
10_1101-2020_12_31_424971	8	18	a	a	DT
10_1101-2020_12_31_424971	8	19	specific	specific	JJ
10_1101-2020_12_31_424971	8	20	ribosome	ribosome	JJ
10_1101-2020_12_31_424971	8	21	conformational	conformational	JJ
10_1101-2020_12_31_424971	8	22	change	change	NN
10_1101-2020_12_31_424971	8	23	can	can	MD
10_1101-2020_12_31_424971	8	24	improve	improve	VB
10_1101-2020_12_31_424971	8	25	the	the	DT
10_1101-2020_12_31_424971	8	26	efficiency	efficiency	NN
10_1101-2020_12_31_424971	8	27	of	of	IN
10_1101-2020_12_31_424971	8	28	genome	genome	JJ
10_1101-2020_12_31_424971	8	29	recoding	recoding	NN
10_1101-2020_12_31_424971	8	30	.	.	.
10_1101-2020_12_31_424971	9	1	38	38	CD
10_1101-2020_12_31_424971	9	2	39	39	CD
10_1101-2020_12_31_424971	9	3	Key	key	JJ
10_1101-2020_12_31_424971	9	4	words	word	NNS
10_1101-2020_12_31_424971	9	5	:	:	:
10_1101-2020_12_31_424971	9	6	SufB2	sufb2	JJ
10_1101-2020_12_31_424971	9	7	frameshift	frameshift	NN
10_1101-2020_12_31_424971	9	8	suppressor	suppressor	NN
10_1101-2020_12_31_424971	9	9	tRNA	trna	NN
10_1101-2020_12_31_424971	9	10	,	,	,
10_1101-2020_12_31_424971	9	11	+1	+1	:
10_1101-2020_12_31_424971	9	12	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	9	13	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	9	14	,	,	,
10_1101-2020_12_31_424971	9	15	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	9	16	codon	codon	NNP
10_1101-2020_12_31_424971	9	17	,	,	,
10_1101-2020_12_31_424971	9	18	40	40	CD
10_1101-2020_12_31_424971	9	19	genome	genome	JJ
10_1101-2020_12_31_424971	9	20	expansion	expansion	NN
10_1101-2020_12_31_424971	9	21	,	,	,
10_1101-2020_12_31_424971	9	22	m1G37	m1G37	NNP
10_1101-2020_12_31_424971	9	23	methylation	methylation	CD
10_1101-2020_12_31_424971	9	24	41	41	CD
10_1101-2020_12_31_424971	9	25	42	42	CD
10_1101-2020_12_31_424971	9	26	43	43	CD
10_1101-2020_12_31_424971	9	27	44	44	CD
10_1101-2020_12_31_424971	9	28	45	45	CD
10_1101-2020_12_31_424971	9	29	46	46	CD
10_1101-2020_12_31_424971	9	30	47	47	CD
10_1101-2020_12_31_424971	9	31	48	48	CD
10_1101-2020_12_31_424971	9	32	.CC	.cc	CD
10_1101-2020_12_31_424971	9	33	-	-	HYPH
10_1101-2020_12_31_424971	9	34	BY	by	IN
10_1101-2020_12_31_424971	9	35	-	-	HYPH
10_1101-2020_12_31_424971	9	36	NC	NC	NNP
10_1101-2020_12_31_424971	9	37	-	-	HYPH
10_1101-2020_12_31_424971	9	38	ND	ND	NNP
10_1101-2020_12_31_424971	9	39	4.0	4.0	CD
10_1101-2020_12_31_424971	9	40	International	International	NNP
10_1101-2020_12_31_424971	9	41	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	9	42	under	under	IN
10_1101-2020_12_31_424971	9	43	a	a	DT
10_1101-2020_12_31_424971	9	44	(	(	-LRB-
10_1101-2020_12_31_424971	9	45	which	which	WDT
10_1101-2020_12_31_424971	9	46	was	be	VBD
10_1101-2020_12_31_424971	9	47	not	not	RB
10_1101-2020_12_31_424971	9	48	certified	certify	VBN
10_1101-2020_12_31_424971	9	49	by	by	IN
10_1101-2020_12_31_424971	9	50	peer	peer	NN
10_1101-2020_12_31_424971	9	51	review	review	NN
10_1101-2020_12_31_424971	9	52	)	)	-RRB-
10_1101-2020_12_31_424971	9	53	is	be	VBZ
10_1101-2020_12_31_424971	9	54	the	the	DT
10_1101-2020_12_31_424971	9	55	author	author	NN
10_1101-2020_12_31_424971	9	56	/	/	SYM
10_1101-2020_12_31_424971	9	57	funder	funder	NN
10_1101-2020_12_31_424971	9	58	,	,	,
10_1101-2020_12_31_424971	9	59	who	who	WP
10_1101-2020_12_31_424971	9	60	has	have	VBZ
10_1101-2020_12_31_424971	9	61	granted	grant	VBN
10_1101-2020_12_31_424971	9	62	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	9	63	a	a	DT
10_1101-2020_12_31_424971	9	64	license	license	NN
10_1101-2020_12_31_424971	9	65	to	to	TO
10_1101-2020_12_31_424971	9	66	display	display	VB
10_1101-2020_12_31_424971	9	67	the	the	DT
10_1101-2020_12_31_424971	9	68	preprint	preprint	NN
10_1101-2020_12_31_424971	9	69	in	in	IN
10_1101-2020_12_31_424971	9	70	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	9	71	.	.	.
10_1101-2020_12_31_424971	10	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	10	2	is	be	VBZ
10_1101-2020_12_31_424971	10	3	made	make	VBN
10_1101-2020_12_31_424971	10	4	The	the	DT
10_1101-2020_12_31_424971	10	5	copyright	copyright	NN
10_1101-2020_12_31_424971	10	6	holder	holder	NN
10_1101-2020_12_31_424971	10	7	for	for	IN
10_1101-2020_12_31_424971	10	8	this	this	DT
10_1101-2020_12_31_424971	10	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	10	10	version	version	NN
10_1101-2020_12_31_424971	10	11	posted	post	VBD
10_1101-2020_12_31_424971	10	12	January	January	NNP
10_1101-2020_12_31_424971	10	13	2	2	CD
10_1101-2020_12_31_424971	10	14	,	,	,
10_1101-2020_12_31_424971	10	15	2021	2021	CD
10_1101-2020_12_31_424971	10	16	.	.	.
10_1101-2020_12_31_424971	10	17	;	;	:
10_1101-2020_12_31_424971	10	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	10	19	:	:	:
10_1101-2020_12_31_424971	10	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	10	21	preprint	preprint	NN
10_1101-2020_12_31_424971	10	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	10	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	10	24	3	3	CD
10_1101-2020_12_31_424971	10	25	INTRODUCTION	introduction	NN
10_1101-2020_12_31_424971	10	26	49	49	CD
10_1101-2020_12_31_424971	10	27	The	the	DT
10_1101-2020_12_31_424971	10	28	ability	ability	NN
10_1101-2020_12_31_424971	10	29	to	to	TO
10_1101-2020_12_31_424971	10	30	recode	recode	VB
10_1101-2020_12_31_424971	10	31	the	the	DT
10_1101-2020_12_31_424971	10	32	genome	genome	NN
10_1101-2020_12_31_424971	10	33	and	and	CC
10_1101-2020_12_31_424971	10	34	expand	expand	VB
10_1101-2020_12_31_424971	10	35	the	the	DT
10_1101-2020_12_31_424971	10	36	chemical	chemical	NN
10_1101-2020_12_31_424971	10	37	repertoire	repertoire	NN
10_1101-2020_12_31_424971	10	38	of	of	IN
10_1101-2020_12_31_424971	10	39	proteins	protein	NNS
10_1101-2020_12_31_424971	10	40	to	to	TO
10_1101-2020_12_31_424971	10	41	include	include	VB
10_1101-2020_12_31_424971	10	42	50	50	CD
10_1101-2020_12_31_424971	10	43	non	non	JJ
10_1101-2020_12_31_424971	10	44	-	-	JJ
10_1101-2020_12_31_424971	10	45	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	10	46	amino	amino	JJ
10_1101-2020_12_31_424971	10	47	acids	acid	NNS
10_1101-2020_12_31_424971	10	48	promises	promise	VBZ
10_1101-2020_12_31_424971	10	49	novel	novel	JJ
10_1101-2020_12_31_424971	10	50	tools	tool	NNS
10_1101-2020_12_31_424971	10	51	for	for	IN
10_1101-2020_12_31_424971	10	52	probing	probe	VBG
10_1101-2020_12_31_424971	10	53	protein	protein	NN
10_1101-2020_12_31_424971	10	54	structure	structure	NN
10_1101-2020_12_31_424971	10	55	and	and	CC
10_1101-2020_12_31_424971	10	56	function	function	NN
10_1101-2020_12_31_424971	10	57	.	.	.
10_1101-2020_12_31_424971	11	1	51	51	CD
10_1101-2020_12_31_424971	11	2	While	while	IN
10_1101-2020_12_31_424971	11	3	most	most	JJS
10_1101-2020_12_31_424971	11	4	recoding	recoding	JJ
10_1101-2020_12_31_424971	11	5	employs	employ	NNS
10_1101-2020_12_31_424971	11	6	stop	stop	VBP
10_1101-2020_12_31_424971	11	7	codons	codon	NNS
10_1101-2020_12_31_424971	11	8	as	as	IN
10_1101-2020_12_31_424971	11	9	sites	site	NNS
10_1101-2020_12_31_424971	11	10	for	for	IN
10_1101-2020_12_31_424971	11	11	incorporating	incorporate	VBG
10_1101-2020_12_31_424971	11	12	non	non	JJ
10_1101-2020_12_31_424971	11	13	-	-	JJ
10_1101-2020_12_31_424971	11	14	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	11	15	amino	amino	NN
10_1101-2020_12_31_424971	11	16	52	52	CD
10_1101-2020_12_31_424971	11	17	acids	acid	NNS
10_1101-2020_12_31_424971	11	18	,	,	,
10_1101-2020_12_31_424971	11	19	only	only	RB
10_1101-2020_12_31_424971	11	20	two	two	CD
10_1101-2020_12_31_424971	11	21	stop	stop	NN
10_1101-2020_12_31_424971	11	22	codons	codon	NNS
10_1101-2020_12_31_424971	11	23	can	can	MD
10_1101-2020_12_31_424971	11	24	be	be	VB
10_1101-2020_12_31_424971	11	25	simultaneously	simultaneously	RB
10_1101-2020_12_31_424971	11	26	recoded	recode	VBN
10_1101-2020_12_31_424971	11	27	due	due	IN
10_1101-2020_12_31_424971	11	28	to	to	IN
10_1101-2020_12_31_424971	11	29	the	the	DT
10_1101-2020_12_31_424971	11	30	cellular	cellular	JJ
10_1101-2020_12_31_424971	11	31	need	need	NN
10_1101-2020_12_31_424971	11	32	to	to	TO
10_1101-2020_12_31_424971	11	33	reserve	reserve	VB
10_1101-2020_12_31_424971	11	34	53	53	CD
10_1101-2020_12_31_424971	11	35	the	the	DT
10_1101-2020_12_31_424971	11	36	third	third	JJ
10_1101-2020_12_31_424971	11	37	stop	stop	NN
10_1101-2020_12_31_424971	11	38	codon	codon	NNP
10_1101-2020_12_31_424971	11	39	for	for	IN
10_1101-2020_12_31_424971	11	40	termination	termination	NN
10_1101-2020_12_31_424971	11	41	of	of	IN
10_1101-2020_12_31_424971	11	42	protein	protein	NN
10_1101-2020_12_31_424971	11	43	synthesis	synthesis	NN
10_1101-2020_12_31_424971	11	44	.	.	.
10_1101-2020_12_31_424971	12	1	The	the	DT
10_1101-2020_12_31_424971	12	2	use	use	NN
10_1101-2020_12_31_424971	12	3	of	of	IN
10_1101-2020_12_31_424971	12	4	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	12	5	codons	codon	NNS
10_1101-2020_12_31_424971	12	6	as	as	IN
10_1101-2020_12_31_424971	12	7	54	54	CD
10_1101-2020_12_31_424971	12	8	additional	additional	JJ
10_1101-2020_12_31_424971	12	9	sites	site	NNS
10_1101-2020_12_31_424971	12	10	for	for	IN
10_1101-2020_12_31_424971	12	11	incorporating	incorporate	VBG
10_1101-2020_12_31_424971	12	12	non	non	JJ
10_1101-2020_12_31_424971	12	13	-	-	JJ
10_1101-2020_12_31_424971	12	14	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	12	15	amino	amino	JJ
10_1101-2020_12_31_424971	12	16	acids	acid	NNS
10_1101-2020_12_31_424971	12	17	has	have	VBZ
10_1101-2020_12_31_424971	12	18	thus	thus	RB
10_1101-2020_12_31_424971	12	19	emerged	emerge	VBN
10_1101-2020_12_31_424971	12	20	as	as	IN
10_1101-2020_12_31_424971	12	21	an	an	DT
10_1101-2020_12_31_424971	12	22	attractive	attractive	JJ
10_1101-2020_12_31_424971	12	23	55	55	CD
10_1101-2020_12_31_424971	12	24	alternative1,2	alternative1,2	CD
10_1101-2020_12_31_424971	12	25	.	.	.
10_1101-2020_12_31_424971	13	1	Recoding	recode	VBG
10_1101-2020_12_31_424971	13	2	at	at	IN
10_1101-2020_12_31_424971	13	3	a	a	DT
10_1101-2020_12_31_424971	13	4	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	13	5	codon	codon	NN
10_1101-2020_12_31_424971	13	6	requires	require	VBZ
10_1101-2020_12_31_424971	13	7	a	a	DT
10_1101-2020_12_31_424971	13	8	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	13	9	tRNA	trna	NN
10_1101-2020_12_31_424971	13	10	that	that	WDT
10_1101-2020_12_31_424971	13	11	is	be	VBZ
10_1101-2020_12_31_424971	13	12	56	56	CD
10_1101-2020_12_31_424971	13	13	aminoacylated	aminoacylate	VBN
10_1101-2020_12_31_424971	13	14	with	with	IN
10_1101-2020_12_31_424971	13	15	the	the	DT
10_1101-2020_12_31_424971	13	16	non	non	JJ
10_1101-2020_12_31_424971	13	17	-	-	JJ
10_1101-2020_12_31_424971	13	18	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	13	19	amino	amino	NN
10_1101-2020_12_31_424971	13	20	acid	acid	NN
10_1101-2020_12_31_424971	13	21	of	of	IN
10_1101-2020_12_31_424971	13	22	interest	interest	NN
10_1101-2020_12_31_424971	13	23	.	.	.
10_1101-2020_12_31_424971	14	1	The	the	DT
10_1101-2020_12_31_424971	14	2	primary	primary	JJ
10_1101-2020_12_31_424971	14	3	challenge	challenge	NN
10_1101-2020_12_31_424971	14	4	faced	face	VBN
10_1101-2020_12_31_424971	14	5	by	by	IN
10_1101-2020_12_31_424971	14	6	57	57	CD
10_1101-2020_12_31_424971	14	7	this	this	DT
10_1101-2020_12_31_424971	14	8	technology	technology	NN
10_1101-2020_12_31_424971	14	9	has	have	VBZ
10_1101-2020_12_31_424971	14	10	been	be	VBN
10_1101-2020_12_31_424971	14	11	the	the	DT
10_1101-2020_12_31_424971	14	12	low	low	JJ
10_1101-2020_12_31_424971	14	13	efficiency	efficiency	NN
10_1101-2020_12_31_424971	14	14	with	with	IN
10_1101-2020_12_31_424971	14	15	which	which	WDT
10_1101-2020_12_31_424971	14	16	the	the	DT
10_1101-2020_12_31_424971	14	17	full	full	JJ
10_1101-2020_12_31_424971	14	18	-	-	HYPH
10_1101-2020_12_31_424971	14	19	length	length	NN
10_1101-2020_12_31_424971	14	20	protein	protein	NN
10_1101-2020_12_31_424971	14	21	carrying	carry	VBG
10_1101-2020_12_31_424971	14	22	the	the	DT
10_1101-2020_12_31_424971	14	23	non-58	non-58	JJ
10_1101-2020_12_31_424971	14	24	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	14	25	amino	amino	NN
10_1101-2020_12_31_424971	14	26	acid	acid	NN
10_1101-2020_12_31_424971	14	27	can	can	MD
10_1101-2020_12_31_424971	14	28	be	be	VB
10_1101-2020_12_31_424971	14	29	synthesized	synthesize	VBN
10_1101-2020_12_31_424971	14	30	.	.	.
10_1101-2020_12_31_424971	15	1	One	one	CD
10_1101-2020_12_31_424971	15	2	reason	reason	NN
10_1101-2020_12_31_424971	15	3	for	for	IN
10_1101-2020_12_31_424971	15	4	this	this	DT
10_1101-2020_12_31_424971	15	5	is	be	VBZ
10_1101-2020_12_31_424971	15	6	the	the	DT
10_1101-2020_12_31_424971	15	7	poor	poor	JJ
10_1101-2020_12_31_424971	15	8	recoding	recode	VBG
10_1101-2020_12_31_424971	15	9	efficiency	efficiency	NN
10_1101-2020_12_31_424971	15	10	59	59	CD
10_1101-2020_12_31_424971	15	11	of	of	IN
10_1101-2020_12_31_424971	15	12	the	the	DT
10_1101-2020_12_31_424971	15	13	+1-frameshifting	+1-frameshifting	NNP
10_1101-2020_12_31_424971	15	14	aminoacyl	aminoacyl	NN
10_1101-2020_12_31_424971	15	15	(	(	-LRB-
10_1101-2020_12_31_424971	15	16	aa)-tRNA	aa)-tRNA	NNP
10_1101-2020_12_31_424971	15	17	,	,	,
10_1101-2020_12_31_424971	15	18	and	and	CC
10_1101-2020_12_31_424971	15	19	the	the	DT
10_1101-2020_12_31_424971	15	20	second	second	JJ
10_1101-2020_12_31_424971	15	21	is	be	VBZ
10_1101-2020_12_31_424971	15	22	the	the	DT
10_1101-2020_12_31_424971	15	23	failure	failure	NN
10_1101-2020_12_31_424971	15	24	of	of	IN
10_1101-2020_12_31_424971	15	25	the	the	DT
10_1101-2020_12_31_424971	15	26	+1-frameshifting	+1-frameshifting	NNP
10_1101-2020_12_31_424971	15	27	60	60	CD
10_1101-2020_12_31_424971	15	28	aa	aa	NNP
10_1101-2020_12_31_424971	15	29	-	-	HYPH
10_1101-2020_12_31_424971	15	30	tRNA	trna	NN
10_1101-2020_12_31_424971	15	31	to	to	TO
10_1101-2020_12_31_424971	15	32	compete	compete	VB
10_1101-2020_12_31_424971	15	33	with	with	IN
10_1101-2020_12_31_424971	15	34	canonical	canonical	JJ
10_1101-2020_12_31_424971	15	35	aa	aa	NNP
10_1101-2020_12_31_424971	15	36	-	-	HYPH
10_1101-2020_12_31_424971	15	37	tRNAs	tRNAs	NNP
10_1101-2020_12_31_424971	15	38	that	that	WDT
10_1101-2020_12_31_424971	15	39	read	read	VBP
10_1101-2020_12_31_424971	15	40	the	the	DT
10_1101-2020_12_31_424971	15	41	first	first	JJ
10_1101-2020_12_31_424971	15	42	three	three	CD
10_1101-2020_12_31_424971	15	43	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	15	44	of	of	IN
10_1101-2020_12_31_424971	15	45	the	the	DT
10_1101-2020_12_31_424971	15	46	61	61	CD
10_1101-2020_12_31_424971	15	47	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	15	48	codon	codon	NNP
10_1101-2020_12_31_424971	15	49	at	at	IN
10_1101-2020_12_31_424971	15	50	the	the	DT
10_1101-2020_12_31_424971	15	51	ribosomal	ribosomal	NNP
10_1101-2020_12_31_424971	15	52	aa	aa	NNP
10_1101-2020_12_31_424971	15	53	-	-	HYPH
10_1101-2020_12_31_424971	15	54	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	15	55	binding	binding	NN
10_1101-2020_12_31_424971	15	56	(	(	-LRB-
10_1101-2020_12_31_424971	15	57	A	a	NN
10_1101-2020_12_31_424971	15	58	)	)	-RRB-
10_1101-2020_12_31_424971	15	59	site	site	NN
10_1101-2020_12_31_424971	15	60	during	during	IN
10_1101-2020_12_31_424971	15	61	the	the	DT
10_1101-2020_12_31_424971	15	62	aa	aa	NNP
10_1101-2020_12_31_424971	15	63	-	-	HYPH
10_1101-2020_12_31_424971	15	64	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	15	65	selection	selection	NN
10_1101-2020_12_31_424971	15	66	step	step	NN
10_1101-2020_12_31_424971	15	67	of	of	IN
10_1101-2020_12_31_424971	15	68	62	62	CD
10_1101-2020_12_31_424971	15	69	the	the	DT
10_1101-2020_12_31_424971	15	70	translation	translation	NN
10_1101-2020_12_31_424971	15	71	elongation	elongation	NN
10_1101-2020_12_31_424971	15	72	cycle	cycle	NN
10_1101-2020_12_31_424971	15	73	.	.	.
10_1101-2020_12_31_424971	16	1	While	while	IN
10_1101-2020_12_31_424971	16	2	directed	direct	VBN
10_1101-2020_12_31_424971	16	3	evolution	evolution	NN
10_1101-2020_12_31_424971	16	4	by	by	IN
10_1101-2020_12_31_424971	16	5	synthetic	synthetic	JJ
10_1101-2020_12_31_424971	16	6	biologists	biologist	NNS
10_1101-2020_12_31_424971	16	7	has	have	VBZ
10_1101-2020_12_31_424971	16	8	yielded	yield	VBN
10_1101-2020_12_31_424971	16	9	+1	+1	NNPS
10_1101-2020_12_31_424971	16	10	-	-	:
10_1101-2020_12_31_424971	16	11	63	63	CD
10_1101-2020_12_31_424971	16	12	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	16	13	tRNAs	trnas	CD
10_1101-2020_12_31_424971	16	14	,	,	,
10_1101-2020_12_31_424971	16	15	efficient	efficient	JJ
10_1101-2020_12_31_424971	16	16	recoding	recoding	NN
10_1101-2020_12_31_424971	16	17	requires	require	VBZ
10_1101-2020_12_31_424971	16	18	cell	cell	NN
10_1101-2020_12_31_424971	16	19	lines	line	NNS
10_1101-2020_12_31_424971	16	20	that	that	WDT
10_1101-2020_12_31_424971	16	21	have	have	VBP
10_1101-2020_12_31_424971	16	22	been	be	VBN
10_1101-2020_12_31_424971	16	23	engineered	engineer	VBN
10_1101-2020_12_31_424971	16	24	to	to	TO
10_1101-2020_12_31_424971	16	25	deplete	deplete	VB
10_1101-2020_12_31_424971	16	26	64	64	CD
10_1101-2020_12_31_424971	16	27	potential	potential	JJ
10_1101-2020_12_31_424971	16	28	competitor	competitor	NN
10_1101-2020_12_31_424971	16	29	tRNAs3	tRNAs3	''
10_1101-2020_12_31_424971	16	30	-	-	SYM
10_1101-2020_12_31_424971	16	31	8	8	CD
10_1101-2020_12_31_424971	16	32	.	.	.
10_1101-2020_12_31_424971	17	1	These	these	DT
10_1101-2020_12_31_424971	17	2	problems	problem	NNS
10_1101-2020_12_31_424971	17	3	emphasize	emphasize	VBP
10_1101-2020_12_31_424971	17	4	the	the	DT
10_1101-2020_12_31_424971	17	5	need	need	NN
10_1101-2020_12_31_424971	17	6	to	to	TO
10_1101-2020_12_31_424971	17	7	better	well	RBR
10_1101-2020_12_31_424971	17	8	understand	understand	VB
10_1101-2020_12_31_424971	17	9	the	the	DT
10_1101-2020_12_31_424971	17	10	65	65	CD
10_1101-2020_12_31_424971	17	11	mechanism	mechanism	NN
10_1101-2020_12_31_424971	17	12	through	through	IN
10_1101-2020_12_31_424971	17	13	which	which	WDT
10_1101-2020_12_31_424971	17	14	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	17	15	codons	codon	NNS
10_1101-2020_12_31_424971	17	16	are	be	VBP
10_1101-2020_12_31_424971	17	17	translated	translate	VBN
10_1101-2020_12_31_424971	17	18	by	by	IN
10_1101-2020_12_31_424971	17	19	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	17	20	tRNAs	trnas	CD
10_1101-2020_12_31_424971	17	21	.	.	.
10_1101-2020_12_31_424971	18	1	66	66	CD
10_1101-2020_12_31_424971	18	2	In	in	IN
10_1101-2020_12_31_424971	18	3	bacteria	bacteria	NNS
10_1101-2020_12_31_424971	18	4	,	,	,
10_1101-2020_12_31_424971	18	5	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	18	6	tRNAs	trnas	CD
10_1101-2020_12_31_424971	18	7	that	that	WDT
10_1101-2020_12_31_424971	18	8	suppress	suppress	VBP
10_1101-2020_12_31_424971	18	9	single	single	JJ
10_1101-2020_12_31_424971	18	10	-	-	HYPH
10_1101-2020_12_31_424971	18	11	nucleotide	nucleotide	JJ
10_1101-2020_12_31_424971	18	12	insertion	insertion	NN
10_1101-2020_12_31_424971	18	13	mutations	mutation	NNS
10_1101-2020_12_31_424971	18	14	that	that	IN
10_1101-2020_12_31_424971	18	15	67	67	CD
10_1101-2020_12_31_424971	18	16	shift	shift	NN
10_1101-2020_12_31_424971	18	17	the	the	DT
10_1101-2020_12_31_424971	18	18	translational	translational	JJ
10_1101-2020_12_31_424971	18	19	reading	reading	NN
10_1101-2020_12_31_424971	18	20	frame	frame	NN
10_1101-2020_12_31_424971	18	21	to	to	IN
10_1101-2020_12_31_424971	18	22	the	the	DT
10_1101-2020_12_31_424971	18	23	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	18	24	have	have	VBP
10_1101-2020_12_31_424971	18	25	been	be	VBN
10_1101-2020_12_31_424971	18	26	isolated	isolate	VBN
10_1101-2020_12_31_424971	18	27	from	from	IN
10_1101-2020_12_31_424971	18	28	genetic	genetic	JJ
10_1101-2020_12_31_424971	18	29	studies9,10	studies9,10	NNP
10_1101-2020_12_31_424971	18	30	.	.	.
10_1101-2020_12_31_424971	19	1	68	68	CD
10_1101-2020_12_31_424971	19	2	These	these	DT
10_1101-2020_12_31_424971	19	3	+1-frameshifting	+1-frameshifting	NN
10_1101-2020_12_31_424971	19	4	tRNAs	trnas	CD
10_1101-2020_12_31_424971	19	5	typically	typically	RB
10_1101-2020_12_31_424971	19	6	contain	contain	VBP
10_1101-2020_12_31_424971	19	7	an	an	DT
10_1101-2020_12_31_424971	19	8	extra	extra	JJ
10_1101-2020_12_31_424971	19	9	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	19	10	in	in	IN
10_1101-2020_12_31_424971	19	11	the	the	DT
10_1101-2020_12_31_424971	19	12	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	19	13	loop	loop	NN
10_1101-2020_12_31_424971	19	14	–	–	:
10_1101-2020_12_31_424971	19	15	a	a	DT
10_1101-2020_12_31_424971	19	16	69	69	CD
10_1101-2020_12_31_424971	19	17	property	property	NN
10_1101-2020_12_31_424971	19	18	that	that	WDT
10_1101-2020_12_31_424971	19	19	has	have	VBZ
10_1101-2020_12_31_424971	19	20	led	lead	VBN
10_1101-2020_12_31_424971	19	21	to	to	IN
10_1101-2020_12_31_424971	19	22	the	the	DT
10_1101-2020_12_31_424971	19	23	proposal	proposal	NN
10_1101-2020_12_31_424971	19	24	of	of	IN
10_1101-2020_12_31_424971	19	25	two	two	CD
10_1101-2020_12_31_424971	19	26	competing	compete	VBG
10_1101-2020_12_31_424971	19	27	models	model	NNS
10_1101-2020_12_31_424971	19	28	for	for	IN
10_1101-2020_12_31_424971	19	29	their	-PRON-	PRP$
10_1101-2020_12_31_424971	19	30	mechanism	mechanism	NN
10_1101-2020_12_31_424971	19	31	of	of	IN
10_1101-2020_12_31_424971	19	32	action	action	NN
10_1101-2020_12_31_424971	19	33	.	.	.
10_1101-2020_12_31_424971	20	1	In	in	IN
10_1101-2020_12_31_424971	20	2	70	70	CD
10_1101-2020_12_31_424971	20	3	the	the	DT
10_1101-2020_12_31_424971	20	4	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	20	5	-	-	HYPH
10_1101-2020_12_31_424971	20	6	pairing	pair	VBG
10_1101-2020_12_31_424971	20	7	model	model	NN
10_1101-2020_12_31_424971	20	8	,	,	,
10_1101-2020_12_31_424971	20	9	the	the	DT
10_1101-2020_12_31_424971	20	10	inserted	insert	VBN
10_1101-2020_12_31_424971	20	11	nucleotide	nucleotide	NNP
10_1101-2020_12_31_424971	20	12	joins	join	VBZ
10_1101-2020_12_31_424971	20	13	the	the	DT
10_1101-2020_12_31_424971	20	14	triplet	triplet	NN
10_1101-2020_12_31_424971	20	15	anticodon	anticodon	NN
10_1101-2020_12_31_424971	20	16	in	in	IN
10_1101-2020_12_31_424971	20	17	pairing	pair	VBG
10_1101-2020_12_31_424971	20	18	with	with	IN
10_1101-2020_12_31_424971	20	19	the	the	DT
10_1101-2020_12_31_424971	20	20	71	71	CD
10_1101-2020_12_31_424971	20	21	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	20	22	codon	codon	NN
10_1101-2020_12_31_424971	20	23	in	in	IN
10_1101-2020_12_31_424971	20	24	the	the	DT
10_1101-2020_12_31_424971	20	25	A	A	NNP
10_1101-2020_12_31_424971	20	26	site	site	NN
10_1101-2020_12_31_424971	20	27	and	and	CC
10_1101-2020_12_31_424971	20	28	this	this	DT
10_1101-2020_12_31_424971	20	29	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	20	30	anticodon	anticodon	NN
10_1101-2020_12_31_424971	20	31	-	-	HYPH
10_1101-2020_12_31_424971	20	32	codon	codon	NNP
10_1101-2020_12_31_424971	20	33	pair	pair	NN
10_1101-2020_12_31_424971	20	34	is	be	VBZ
10_1101-2020_12_31_424971	20	35	translocated	translocate	VBN
10_1101-2020_12_31_424971	20	36	to	to	IN
10_1101-2020_12_31_424971	20	37	the	the	DT
10_1101-2020_12_31_424971	20	38	72	72	CD
10_1101-2020_12_31_424971	20	39	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	20	40	peptidyl	peptidyl	NN
10_1101-2020_12_31_424971	20	41	-	-	HYPH
10_1101-2020_12_31_424971	20	42	tRNA	trna	NN
10_1101-2020_12_31_424971	20	43	binding	binding	NN
10_1101-2020_12_31_424971	20	44	(	(	-LRB-
10_1101-2020_12_31_424971	20	45	P	p	NN
10_1101-2020_12_31_424971	20	46	)	)	-RRB-
10_1101-2020_12_31_424971	20	47	site11	site11	FW
10_1101-2020_12_31_424971	20	48	.	.	.
10_1101-2020_12_31_424971	21	1	In	in	IN
10_1101-2020_12_31_424971	21	2	the	the	DT
10_1101-2020_12_31_424971	21	3	triplet	triplet	NN
10_1101-2020_12_31_424971	21	4	-	-	HYPH
10_1101-2020_12_31_424971	21	5	slippage	slippage	NN
10_1101-2020_12_31_424971	21	6	model	model	NN
10_1101-2020_12_31_424971	21	7	,	,	,
10_1101-2020_12_31_424971	21	8	the	the	DT
10_1101-2020_12_31_424971	21	9	expanded	expand	VBN
10_1101-2020_12_31_424971	21	10	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	21	11	73	73	CD
10_1101-2020_12_31_424971	21	12	loop	loop	NN
10_1101-2020_12_31_424971	21	13	forms	form	VBZ
10_1101-2020_12_31_424971	21	14	an	an	DT
10_1101-2020_12_31_424971	21	15	in	in	IN
10_1101-2020_12_31_424971	21	16	-	-	HYPH
10_1101-2020_12_31_424971	21	17	frame	frame	NN
10_1101-2020_12_31_424971	21	18	(	(	-LRB-
10_1101-2020_12_31_424971	21	19	0-frame	0-frame	CD
10_1101-2020_12_31_424971	21	20	)	)	-RRB-
10_1101-2020_12_31_424971	21	21	triplet	triplet	NN
10_1101-2020_12_31_424971	21	22	anticodon	anticodon	NN
10_1101-2020_12_31_424971	21	23	-	-	HYPH
10_1101-2020_12_31_424971	21	24	codon	codon	NNP
10_1101-2020_12_31_424971	21	25	pair	pair	NN
10_1101-2020_12_31_424971	21	26	in	in	IN
10_1101-2020_12_31_424971	21	27	the	the	DT
10_1101-2020_12_31_424971	21	28	A	A	NNP
10_1101-2020_12_31_424971	21	29	site	site	NN
10_1101-2020_12_31_424971	21	30	and	and	CC
10_1101-2020_12_31_424971	21	31	subsequently	subsequently	RB
10_1101-2020_12_31_424971	21	32	shifts	shift	VBZ
10_1101-2020_12_31_424971	21	33	74	74	CD
10_1101-2020_12_31_424971	21	34	.CC	.CC	,
10_1101-2020_12_31_424971	21	35	-	-	HYPH
10_1101-2020_12_31_424971	21	36	BY	by	IN
10_1101-2020_12_31_424971	21	37	-	-	HYPH
10_1101-2020_12_31_424971	21	38	NC	NC	NNP
10_1101-2020_12_31_424971	21	39	-	-	HYPH
10_1101-2020_12_31_424971	21	40	ND	ND	NNP
10_1101-2020_12_31_424971	21	41	4.0	4.0	CD
10_1101-2020_12_31_424971	21	42	International	International	NNP
10_1101-2020_12_31_424971	21	43	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	21	44	under	under	IN
10_1101-2020_12_31_424971	21	45	a	a	DT
10_1101-2020_12_31_424971	21	46	(	(	-LRB-
10_1101-2020_12_31_424971	21	47	which	which	WDT
10_1101-2020_12_31_424971	21	48	was	be	VBD
10_1101-2020_12_31_424971	21	49	not	not	RB
10_1101-2020_12_31_424971	21	50	certified	certify	VBN
10_1101-2020_12_31_424971	21	51	by	by	IN
10_1101-2020_12_31_424971	21	52	peer	peer	NN
10_1101-2020_12_31_424971	21	53	review	review	NN
10_1101-2020_12_31_424971	21	54	)	)	-RRB-
10_1101-2020_12_31_424971	21	55	is	be	VBZ
10_1101-2020_12_31_424971	21	56	the	the	DT
10_1101-2020_12_31_424971	21	57	author	author	NN
10_1101-2020_12_31_424971	21	58	/	/	SYM
10_1101-2020_12_31_424971	21	59	funder	funder	NN
10_1101-2020_12_31_424971	21	60	,	,	,
10_1101-2020_12_31_424971	21	61	who	who	WP
10_1101-2020_12_31_424971	21	62	has	have	VBZ
10_1101-2020_12_31_424971	21	63	granted	grant	VBN
10_1101-2020_12_31_424971	21	64	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	21	65	a	a	DT
10_1101-2020_12_31_424971	21	66	license	license	NN
10_1101-2020_12_31_424971	21	67	to	to	TO
10_1101-2020_12_31_424971	21	68	display	display	VB
10_1101-2020_12_31_424971	21	69	the	the	DT
10_1101-2020_12_31_424971	21	70	preprint	preprint	NN
10_1101-2020_12_31_424971	21	71	in	in	IN
10_1101-2020_12_31_424971	21	72	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	21	73	.	.	.
10_1101-2020_12_31_424971	22	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	22	2	is	be	VBZ
10_1101-2020_12_31_424971	22	3	made	make	VBN
10_1101-2020_12_31_424971	22	4	The	the	DT
10_1101-2020_12_31_424971	22	5	copyright	copyright	NN
10_1101-2020_12_31_424971	22	6	holder	holder	NN
10_1101-2020_12_31_424971	22	7	for	for	IN
10_1101-2020_12_31_424971	22	8	this	this	DT
10_1101-2020_12_31_424971	22	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	22	10	version	version	NN
10_1101-2020_12_31_424971	22	11	posted	post	VBD
10_1101-2020_12_31_424971	22	12	January	January	NNP
10_1101-2020_12_31_424971	22	13	2	2	CD
10_1101-2020_12_31_424971	22	14	,	,	,
10_1101-2020_12_31_424971	22	15	2021	2021	CD
10_1101-2020_12_31_424971	22	16	.	.	.
10_1101-2020_12_31_424971	22	17	;	;	:
10_1101-2020_12_31_424971	22	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	22	19	:	:	:
10_1101-2020_12_31_424971	22	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	22	21	preprint	preprint	NN
10_1101-2020_12_31_424971	22	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	22	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	22	24	4	4	CD
10_1101-2020_12_31_424971	22	25	to	to	IN
10_1101-2020_12_31_424971	22	26	the	the	DT
10_1101-2020_12_31_424971	22	27	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	22	28	at	at	IN
10_1101-2020_12_31_424971	22	29	some	some	DT
10_1101-2020_12_31_424971	22	30	point	point	NN
10_1101-2020_12_31_424971	22	31	later	later	RB
10_1101-2020_12_31_424971	22	32	in	in	IN
10_1101-2020_12_31_424971	22	33	the	the	DT
10_1101-2020_12_31_424971	22	34	elongation	elongation	NN
10_1101-2020_12_31_424971	22	35	cycle12,13	cycle12,13	NNP
10_1101-2020_12_31_424971	22	36	,	,	,
10_1101-2020_12_31_424971	22	37	possibly	possibly	RB
10_1101-2020_12_31_424971	22	38	during	during	IN
10_1101-2020_12_31_424971	22	39	translocation	translocation	NN
10_1101-2020_12_31_424971	22	40	of	of	IN
10_1101-2020_12_31_424971	22	41	the	the	DT
10_1101-2020_12_31_424971	22	42	75	75	CD
10_1101-2020_12_31_424971	22	43	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	22	44	tRNA	trna	NN
10_1101-2020_12_31_424971	22	45	from	from	IN
10_1101-2020_12_31_424971	22	46	the	the	DT
10_1101-2020_12_31_424971	22	47	A	a	NN
10_1101-2020_12_31_424971	22	48	to	to	IN
10_1101-2020_12_31_424971	22	49	P	p	NN
10_1101-2020_12_31_424971	22	50	sites14	sites14	NNS
10_1101-2020_12_31_424971	22	51	or	or	CC
10_1101-2020_12_31_424971	22	52	within	within	IN
10_1101-2020_12_31_424971	22	53	the	the	DT
10_1101-2020_12_31_424971	22	54	P	p	NN
10_1101-2020_12_31_424971	22	55	site15	site15	NN
10_1101-2020_12_31_424971	22	56	.	.	.
10_1101-2020_12_31_424971	23	1	The	the	DT
10_1101-2020_12_31_424971	23	2	triplet	triplet	NN
10_1101-2020_12_31_424971	23	3	-	-	HYPH
10_1101-2020_12_31_424971	23	4	slippage	slippage	NN
10_1101-2020_12_31_424971	23	5	model	model	NN
10_1101-2020_12_31_424971	23	6	is	be	VBZ
10_1101-2020_12_31_424971	23	7	76	76	CD
10_1101-2020_12_31_424971	23	8	supported	support	VBN
10_1101-2020_12_31_424971	23	9	by	by	IN
10_1101-2020_12_31_424971	23	10	structural	structural	JJ
10_1101-2020_12_31_424971	23	11	studies	study	NNS
10_1101-2020_12_31_424971	23	12	of	of	IN
10_1101-2020_12_31_424971	23	13	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	23	14	complexes	complex	NNS
10_1101-2020_12_31_424971	23	15	in	in	IN
10_1101-2020_12_31_424971	23	16	which	which	WDT
10_1101-2020_12_31_424971	23	17	the	the	DT
10_1101-2020_12_31_424971	23	18	expanded	expand	VBN
10_1101-2020_12_31_424971	23	19	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	23	20	-	-	HYPH
10_1101-2020_12_31_424971	23	21	stem-77	stem-77	NN
10_1101-2020_12_31_424971	23	22	loops	loop	NNS
10_1101-2020_12_31_424971	23	23	(	(	-LRB-
10_1101-2020_12_31_424971	23	24	ASLs	ASLs	NNP
10_1101-2020_12_31_424971	23	25	)	)	-RRB-
10_1101-2020_12_31_424971	23	26	of	of	IN
10_1101-2020_12_31_424971	23	27	+1-frameshifting	+1-frameshifting	NN
10_1101-2020_12_31_424971	23	28	tRNAs	trnas	CD
10_1101-2020_12_31_424971	23	29	have	have	VBP
10_1101-2020_12_31_424971	23	30	been	be	VBN
10_1101-2020_12_31_424971	23	31	found	find	VBN
10_1101-2020_12_31_424971	23	32	to	to	TO
10_1101-2020_12_31_424971	23	33	use	use	VB
10_1101-2020_12_31_424971	23	34	triplet	triplet	NN
10_1101-2020_12_31_424971	23	35	anticodon	anticodon	NN
10_1101-2020_12_31_424971	23	36	-	-	HYPH
10_1101-2020_12_31_424971	23	37	codon	codon	NNP
10_1101-2020_12_31_424971	23	38	pairing	pair	VBG
10_1101-2020_12_31_424971	23	39	78	78	CD
10_1101-2020_12_31_424971	23	40	in	in	IN
10_1101-2020_12_31_424971	23	41	the	the	DT
10_1101-2020_12_31_424971	23	42	0-frame	0-frame	CD
10_1101-2020_12_31_424971	23	43	at	at	IN
10_1101-2020_12_31_424971	23	44	the	the	DT
10_1101-2020_12_31_424971	23	45	A	A	NNP
10_1101-2020_12_31_424971	23	46	site16	site16	NNP
10_1101-2020_12_31_424971	23	47	-	-	HYPH
10_1101-2020_12_31_424971	23	48	18	18	CD
10_1101-2020_12_31_424971	23	49	and	and	CC
10_1101-2020_12_31_424971	23	50	in	in	IN
10_1101-2020_12_31_424971	23	51	the	the	DT
10_1101-2020_12_31_424971	23	52	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	23	53	at	at	IN
10_1101-2020_12_31_424971	23	54	the	the	DT
10_1101-2020_12_31_424971	23	55	P	p	NN
10_1101-2020_12_31_424971	23	56	site19	site19	NN
10_1101-2020_12_31_424971	23	57	.	.	.
10_1101-2020_12_31_424971	24	1	Nonetheless	nonetheless	RB
10_1101-2020_12_31_424971	24	2	,	,	,
10_1101-2020_12_31_424971	24	3	these	these	DT
10_1101-2020_12_31_424971	24	4	structures	structure	NNS
10_1101-2020_12_31_424971	24	5	79	79	CD
10_1101-2020_12_31_424971	24	6	do	do	VBP
10_1101-2020_12_31_424971	24	7	not	not	RB
10_1101-2020_12_31_424971	24	8	eliminate	eliminate	VB
10_1101-2020_12_31_424971	24	9	the	the	DT
10_1101-2020_12_31_424971	24	10	possibility	possibility	NN
10_1101-2020_12_31_424971	24	11	that	that	IN
10_1101-2020_12_31_424971	24	12	two	two	CD
10_1101-2020_12_31_424971	24	13	competing	compete	VBG
10_1101-2020_12_31_424971	24	14	triplet	triplet	NN
10_1101-2020_12_31_424971	24	15	pairing	pairing	NN
10_1101-2020_12_31_424971	24	16	schemes	scheme	NNS
10_1101-2020_12_31_424971	24	17	(	(	-LRB-
10_1101-2020_12_31_424971	24	18	0-frame	0-frame	CD
10_1101-2020_12_31_424971	24	19	and	and	CC
10_1101-2020_12_31_424971	24	20	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	24	21	)	)	-RRB-
10_1101-2020_12_31_424971	24	22	80	80	CD
10_1101-2020_12_31_424971	24	23	can	can	MD
10_1101-2020_12_31_424971	24	24	co	co	VB
10_1101-2020_12_31_424971	24	25	-	-	VB
10_1101-2020_12_31_424971	24	26	exist	exist	VB
10_1101-2020_12_31_424971	24	27	when	when	WRB
10_1101-2020_12_31_424971	24	28	a	a	DT
10_1101-2020_12_31_424971	24	29	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	24	30	codon	codon	NN
10_1101-2020_12_31_424971	24	31	motif	motif	NN
10_1101-2020_12_31_424971	24	32	occupies	occupy	VBZ
10_1101-2020_12_31_424971	24	33	the	the	DT
10_1101-2020_12_31_424971	24	34	A	a	NN
10_1101-2020_12_31_424971	24	35	site15	site15	NN
10_1101-2020_12_31_424971	24	36	,	,	,
10_1101-2020_12_31_424971	24	37	that	that	IN
10_1101-2020_12_31_424971	24	38	some	some	DT
10_1101-2020_12_31_424971	24	39	amount	amount	NN
10_1101-2020_12_31_424971	24	40	of	of	IN
10_1101-2020_12_31_424971	24	41	+1	+1	NNS
10_1101-2020_12_31_424971	24	42	81	81	CD
10_1101-2020_12_31_424971	24	43	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	24	44	can	can	MD
10_1101-2020_12_31_424971	24	45	occur	occur	VB
10_1101-2020_12_31_424971	24	46	via	via	IN
10_1101-2020_12_31_424971	24	47	the	the	DT
10_1101-2020_12_31_424971	24	48	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	24	49	-	-	HYPH
10_1101-2020_12_31_424971	24	50	pairing	pair	VBG
10_1101-2020_12_31_424971	24	51	model	model	NN
10_1101-2020_12_31_424971	24	52	,	,	,
10_1101-2020_12_31_424971	24	53	and	and	CC
10_1101-2020_12_31_424971	24	54	that	that	IN
10_1101-2020_12_31_424971	24	55	the	the	DT
10_1101-2020_12_31_424971	24	56	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	24	57	-	-	HYPH
10_1101-2020_12_31_424971	24	58	pairing	pair	VBG
10_1101-2020_12_31_424971	24	59	model	model	NN
10_1101-2020_12_31_424971	24	60	82	82	CD
10_1101-2020_12_31_424971	24	61	may	may	MD
10_1101-2020_12_31_424971	24	62	even	even	RB
10_1101-2020_12_31_424971	24	63	dominate	dominate	VB
10_1101-2020_12_31_424971	24	64	for	for	IN
10_1101-2020_12_31_424971	24	65	particular	particular	JJ
10_1101-2020_12_31_424971	24	66	+1-frameshifting	+1-frameshifting	NN
10_1101-2020_12_31_424971	24	67	tRNAs	trna	NNS
10_1101-2020_12_31_424971	24	68	,	,	,
10_1101-2020_12_31_424971	24	69	codon	codon	NNP
10_1101-2020_12_31_424971	24	70	sequences	sequences	NNP
10_1101-2020_12_31_424971	24	71	,	,	,
10_1101-2020_12_31_424971	24	72	and/or	and/or	CC
10_1101-2020_12_31_424971	24	73	reaction	reaction	NN
10_1101-2020_12_31_424971	24	74	83	83	CD
10_1101-2020_12_31_424971	24	75	conditions10	conditions10	NN
10_1101-2020_12_31_424971	24	76	.	.	.
10_1101-2020_12_31_424971	25	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	25	2	also	also	RB
10_1101-2020_12_31_424971	25	3	do	do	VBP
10_1101-2020_12_31_424971	25	4	not	not	RB
10_1101-2020_12_31_424971	25	5	know	know	VB
10_1101-2020_12_31_424971	25	6	how	how	WRB
10_1101-2020_12_31_424971	25	7	each	each	DT
10_1101-2020_12_31_424971	25	8	model	model	NN
10_1101-2020_12_31_424971	25	9	determines	determine	VBZ
10_1101-2020_12_31_424971	25	10	the	the	DT
10_1101-2020_12_31_424971	25	11	efficiency	efficiency	NN
10_1101-2020_12_31_424971	25	12	of	of	IN
10_1101-2020_12_31_424971	25	13	+1	+1	NNS
10_1101-2020_12_31_424971	25	14	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	25	15	84	84	CD
10_1101-2020_12_31_424971	25	16	or	or	CC
10_1101-2020_12_31_424971	25	17	whether	whether	IN
10_1101-2020_12_31_424971	25	18	any	any	DT
10_1101-2020_12_31_424971	25	19	competition	competition	NN
10_1101-2020_12_31_424971	25	20	between	between	IN
10_1101-2020_12_31_424971	25	21	the	the	DT
10_1101-2020_12_31_424971	25	22	two	two	CD
10_1101-2020_12_31_424971	25	23	models	model	NNS
10_1101-2020_12_31_424971	25	24	is	be	VBZ
10_1101-2020_12_31_424971	25	25	driven	drive	VBN
10_1101-2020_12_31_424971	25	26	by	by	IN
10_1101-2020_12_31_424971	25	27	the	the	DT
10_1101-2020_12_31_424971	25	28	kinetics	kinetic	NNS
10_1101-2020_12_31_424971	25	29	of	of	IN
10_1101-2020_12_31_424971	25	30	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	25	31	or	or	CC
10_1101-2020_12_31_424971	25	32	85	85	CD
10_1101-2020_12_31_424971	25	33	the	the	DT
10_1101-2020_12_31_424971	25	34	thermodynamics	thermodynamic	NNS
10_1101-2020_12_31_424971	25	35	of	of	IN
10_1101-2020_12_31_424971	25	36	base	base	NN
10_1101-2020_12_31_424971	25	37	pairing	pairing	NN
10_1101-2020_12_31_424971	25	38	.	.	.
10_1101-2020_12_31_424971	26	1	In	in	IN
10_1101-2020_12_31_424971	26	2	addition	addition	NN
10_1101-2020_12_31_424971	26	3	,	,	,
10_1101-2020_12_31_424971	26	4	virtually	virtually	RB
10_1101-2020_12_31_424971	26	5	all	all	DT
10_1101-2020_12_31_424971	26	6	natural	natural	JJ
10_1101-2020_12_31_424971	26	7	tRNAs	trnas	CD
10_1101-2020_12_31_424971	26	8	contain	contain	VB
10_1101-2020_12_31_424971	26	9	a	a	DT
10_1101-2020_12_31_424971	26	10	purine	purine	NN
10_1101-2020_12_31_424971	26	11	at	at	IN
10_1101-2020_12_31_424971	26	12	86	86	CD
10_1101-2020_12_31_424971	26	13	nucleotide	nucleotide	JJ
10_1101-2020_12_31_424971	26	14	position	position	NN
10_1101-2020_12_31_424971	26	15	37	37	CD
10_1101-2020_12_31_424971	26	16	on	on	IN
10_1101-2020_12_31_424971	26	17	the	the	DT
10_1101-2020_12_31_424971	26	18	3'-side	3'-side	NNP
10_1101-2020_12_31_424971	26	19	of	of	IN
10_1101-2020_12_31_424971	26	20	the	the	DT
10_1101-2020_12_31_424971	26	21	anticodon	anticodon	NN
10_1101-2020_12_31_424971	26	22	(	(	-LRB-
10_1101-2020_12_31_424971	26	23	http://trna.bioinf.uni-leipzig.de/	http://trna.bioinf.uni-leipzig.de/	NNP
10_1101-2020_12_31_424971	26	24	)	)	-RRB-
10_1101-2020_12_31_424971	26	25	,	,	,
10_1101-2020_12_31_424971	26	26	which	which	WDT
10_1101-2020_12_31_424971	26	27	is	be	VBZ
10_1101-2020_12_31_424971	26	28	87	87	CD
10_1101-2020_12_31_424971	26	29	invariably	invariably	RB
10_1101-2020_12_31_424971	26	30	post	post	JJ
10_1101-2020_12_31_424971	26	31	-	-	JJ
10_1101-2020_12_31_424971	26	32	transcriptionally	transcriptionally	RB
10_1101-2020_12_31_424971	26	33	modified	modify	VBN
10_1101-2020_12_31_424971	26	34	and	and	CC
10_1101-2020_12_31_424971	26	35	is	be	VBZ
10_1101-2020_12_31_424971	26	36	important	important	JJ
10_1101-2020_12_31_424971	26	37	for	for	IN
10_1101-2020_12_31_424971	26	38	maintaining	maintain	VBG
10_1101-2020_12_31_424971	26	39	the	the	DT
10_1101-2020_12_31_424971	26	40	translational	translational	JJ
10_1101-2020_12_31_424971	26	41	reading	reading	NN
10_1101-2020_12_31_424971	26	42	88	88	CD
10_1101-2020_12_31_424971	26	43	frame	frame	NN
10_1101-2020_12_31_424971	26	44	in	in	IN
10_1101-2020_12_31_424971	26	45	the	the	DT
10_1101-2020_12_31_424971	26	46	P	p	NN
10_1101-2020_12_31_424971	26	47	site15	site15	NN
10_1101-2020_12_31_424971	26	48	.	.	.
10_1101-2020_12_31_424971	27	1	While	while	IN
10_1101-2020_12_31_424971	27	2	most	most	JJS
10_1101-2020_12_31_424971	27	3	+1-frameshifting	+1-frameshifting	JJ
10_1101-2020_12_31_424971	27	4	tRNAs	trnas	CD
10_1101-2020_12_31_424971	27	5	sequenced	sequence	VBN
10_1101-2020_12_31_424971	27	6	to	to	IN
10_1101-2020_12_31_424971	27	7	date	date	NN
10_1101-2020_12_31_424971	27	8	also	also	RB
10_1101-2020_12_31_424971	27	9	contain	contain	VBP
10_1101-2020_12_31_424971	27	10	a	a	DT
10_1101-2020_12_31_424971	27	11	purine	purine	NN
10_1101-2020_12_31_424971	27	12	89	89	CD
10_1101-2020_12_31_424971	27	13	nucleotide	nucleotide	RB
10_1101-2020_12_31_424971	27	14	at	at	IN
10_1101-2020_12_31_424971	27	15	position	position	NN
10_1101-2020_12_31_424971	27	16	378	378	CD
10_1101-2020_12_31_424971	27	17	,	,	,
10_1101-2020_12_31_424971	27	18	we	-PRON-	PRP
10_1101-2020_12_31_424971	27	19	do	do	VBP
10_1101-2020_12_31_424971	27	20	not	not	RB
10_1101-2020_12_31_424971	27	21	know	know	VB
10_1101-2020_12_31_424971	27	22	whether	whether	IN
10_1101-2020_12_31_424971	27	23	it	-PRON-	PRP
10_1101-2020_12_31_424971	27	24	is	be	VBZ
10_1101-2020_12_31_424971	27	25	post	post	JJ
10_1101-2020_12_31_424971	27	26	-	-	JJ
10_1101-2020_12_31_424971	27	27	transcriptionally	transcriptionally	RB
10_1101-2020_12_31_424971	27	28	modified	modify	VBN
10_1101-2020_12_31_424971	27	29	or	or	CC
10_1101-2020_12_31_424971	27	30	how	how	WRB
10_1101-2020_12_31_424971	27	31	the	the	DT
10_1101-2020_12_31_424971	27	32	90	90	CD
10_1101-2020_12_31_424971	27	33	modification	modification	NN
10_1101-2020_12_31_424971	27	34	affects	affect	VBZ
10_1101-2020_12_31_424971	27	35	+1	+1	:
10_1101-2020_12_31_424971	27	36	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	27	37	.	.	.
10_1101-2020_12_31_424971	28	1	Perhaps	perhaps	RB
10_1101-2020_12_31_424971	28	2	most	most	RBS
10_1101-2020_12_31_424971	28	3	importantly	importantly	RB
10_1101-2020_12_31_424971	28	4	,	,	,
10_1101-2020_12_31_424971	28	5	while	while	IN
10_1101-2020_12_31_424971	28	6	the	the	DT
10_1101-2020_12_31_424971	28	7	structural	structural	JJ
10_1101-2020_12_31_424971	28	8	studies	study	NNS
10_1101-2020_12_31_424971	28	9	91	91	CD
10_1101-2020_12_31_424971	28	10	described	describe	VBN
10_1101-2020_12_31_424971	28	11	above	above	IN
10_1101-2020_12_31_424971	28	12	provide	provide	VB
10_1101-2020_12_31_424971	28	13	snapshots	snapshot	NNS
10_1101-2020_12_31_424971	28	14	of	of	IN
10_1101-2020_12_31_424971	28	15	the	the	DT
10_1101-2020_12_31_424971	28	16	initial	initial	JJ
10_1101-2020_12_31_424971	28	17	and	and	CC
10_1101-2020_12_31_424971	28	18	final	final	JJ
10_1101-2020_12_31_424971	28	19	states	state	NNS
10_1101-2020_12_31_424971	28	20	of	of	IN
10_1101-2020_12_31_424971	28	21	+1	+1	NNS
10_1101-2020_12_31_424971	28	22	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	28	23	,	,	,
10_1101-2020_12_31_424971	28	24	they	-PRON-	PRP
10_1101-2020_12_31_424971	28	25	do	do	VBP
10_1101-2020_12_31_424971	28	26	not	not	RB
10_1101-2020_12_31_424971	28	27	92	92	CD
10_1101-2020_12_31_424971	28	28	reveal	reveal	VB
10_1101-2020_12_31_424971	28	29	where	where	WRB
10_1101-2020_12_31_424971	28	30	,	,	,
10_1101-2020_12_31_424971	28	31	when	when	WRB
10_1101-2020_12_31_424971	28	32	,	,	,
10_1101-2020_12_31_424971	28	33	or	or	CC
10_1101-2020_12_31_424971	28	34	how	how	WRB
10_1101-2020_12_31_424971	28	35	the	the	DT
10_1101-2020_12_31_424971	28	36	shift	shift	NN
10_1101-2020_12_31_424971	28	37	occurs	occur	VBZ
10_1101-2020_12_31_424971	28	38	,	,	,
10_1101-2020_12_31_424971	28	39	thereby	thereby	RB
10_1101-2020_12_31_424971	28	40	precluding	preclude	VBG
10_1101-2020_12_31_424971	28	41	an	an	DT
10_1101-2020_12_31_424971	28	42	understanding	understanding	NN
10_1101-2020_12_31_424971	28	43	of	of	IN
10_1101-2020_12_31_424971	28	44	the	the	DT
10_1101-2020_12_31_424971	28	45	structural	structural	JJ
10_1101-2020_12_31_424971	28	46	93	93	CD
10_1101-2020_12_31_424971	28	47	basis	basis	NN
10_1101-2020_12_31_424971	28	48	and	and	CC
10_1101-2020_12_31_424971	28	49	mechanism	mechanism	NN
10_1101-2020_12_31_424971	28	50	of	of	IN
10_1101-2020_12_31_424971	28	51	+1	+1	NNS
10_1101-2020_12_31_424971	28	52	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	28	53	.	.	.
10_1101-2020_12_31_424971	29	1	These	these	DT
10_1101-2020_12_31_424971	29	2	open	open	JJ
10_1101-2020_12_31_424971	29	3	questions	question	NNS
10_1101-2020_12_31_424971	29	4	have	have	VBP
10_1101-2020_12_31_424971	29	5	limited	limit	VBN
10_1101-2020_12_31_424971	29	6	our	-PRON-	PRP$
10_1101-2020_12_31_424971	29	7	ability	ability	NN
10_1101-2020_12_31_424971	29	8	to	to	IN
10_1101-2020_12_31_424971	29	9	94	94	CD
10_1101-2020_12_31_424971	29	10	increase	increase	VB
10_1101-2020_12_31_424971	29	11	the	the	DT
10_1101-2020_12_31_424971	29	12	efficiency	efficiency	NN
10_1101-2020_12_31_424971	29	13	of	of	IN
10_1101-2020_12_31_424971	29	14	genome	genome	JJ
10_1101-2020_12_31_424971	29	15	recoding	recode	VBG
10_1101-2020_12_31_424971	29	16	at	at	IN
10_1101-2020_12_31_424971	29	17	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	29	18	codons	codon	NNS
10_1101-2020_12_31_424971	29	19	.	.	.
10_1101-2020_12_31_424971	30	1	95	95	CD
10_1101-2020_12_31_424971	30	2	To	to	TO
10_1101-2020_12_31_424971	30	3	address	address	VB
10_1101-2020_12_31_424971	30	4	these	these	DT
10_1101-2020_12_31_424971	30	5	questions	question	NNS
10_1101-2020_12_31_424971	30	6	,	,	,
10_1101-2020_12_31_424971	30	7	we	-PRON-	PRP
10_1101-2020_12_31_424971	30	8	have	have	VBP
10_1101-2020_12_31_424971	30	9	investigated	investigate	VBN
10_1101-2020_12_31_424971	30	10	the	the	DT
10_1101-2020_12_31_424971	30	11	mechanism	mechanism	NN
10_1101-2020_12_31_424971	30	12	of	of	IN
10_1101-2020_12_31_424971	30	13	+1	+1	NNS
10_1101-2020_12_31_424971	30	14	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	30	15	by	by	IN
10_1101-2020_12_31_424971	30	16	96	96	CD
10_1101-2020_12_31_424971	30	17	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	30	18	(	(	-LRB-
10_1101-2020_12_31_424971	30	19	Figure	Figure	NNP
10_1101-2020_12_31_424971	30	20	1a	1a	NNP
10_1101-2020_12_31_424971	30	21	)	)	-RRB-
10_1101-2020_12_31_424971	30	22	,	,	,
10_1101-2020_12_31_424971	30	23	a	a	DT
10_1101-2020_12_31_424971	30	24	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	30	25	tRNA	trna	NN
10_1101-2020_12_31_424971	30	26	that	that	WDT
10_1101-2020_12_31_424971	30	27	was	be	VBD
10_1101-2020_12_31_424971	30	28	isolated	isolate	VBN
10_1101-2020_12_31_424971	30	29	from	from	IN
10_1101-2020_12_31_424971	30	30	Salmonella	Salmonella	NNP
10_1101-2020_12_31_424971	30	31	typhimurium	typhimurium	NN
10_1101-2020_12_31_424971	30	32	as	as	IN
10_1101-2020_12_31_424971	30	33	a	a	DT
10_1101-2020_12_31_424971	30	34	97	97	CD
10_1101-2020_12_31_424971	30	35	suppressor	suppressor	NN
10_1101-2020_12_31_424971	30	36	of	of	IN
10_1101-2020_12_31_424971	30	37	a	a	DT
10_1101-2020_12_31_424971	30	38	single	single	JJ
10_1101-2020_12_31_424971	30	39	C	C	NNP
10_1101-2020_12_31_424971	30	40	insertion	insertion	NN
10_1101-2020_12_31_424971	30	41	into	into	IN
10_1101-2020_12_31_424971	30	42	a	a	DT
10_1101-2020_12_31_424971	30	43	proline	proline	NN
10_1101-2020_12_31_424971	30	44	(	(	-LRB-
10_1101-2020_12_31_424971	30	45	Pro	Pro	NNP
10_1101-2020_12_31_424971	30	46	)	)	-RRB-
10_1101-2020_12_31_424971	30	47	CCC	CCC	NNP
10_1101-2020_12_31_424971	30	48	codon20	codon20	NNP
10_1101-2020_12_31_424971	30	49	.	.	.
10_1101-2020_12_31_424971	31	1	The	the	DT
10_1101-2020_12_31_424971	31	2	observed	observed	JJ
10_1101-2020_12_31_424971	31	3	high	high	JJ
10_1101-2020_12_31_424971	31	4	+1	+1	NNS
10_1101-2020_12_31_424971	31	5	-	-	SYM
10_1101-2020_12_31_424971	31	6	98	98	CD
10_1101-2020_12_31_424971	31	7	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	31	8	efficiency	efficiency	NN
10_1101-2020_12_31_424971	31	9	of	of	IN
10_1101-2020_12_31_424971	31	10	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	31	11	at	at	IN
10_1101-2020_12_31_424971	31	12	the	the	DT
10_1101-2020_12_31_424971	31	13	CCC	CCC	NNP
10_1101-2020_12_31_424971	31	14	-	-	HYPH
10_1101-2020_12_31_424971	31	15	C	C	NNP
10_1101-2020_12_31_424971	31	16	motif	motif	NN
10_1101-2020_12_31_424971	31	17	,	,	,
10_1101-2020_12_31_424971	31	18	nearly	nearly	RB
10_1101-2020_12_31_424971	31	19	80-fold	80-fold	CD
10_1101-2020_12_31_424971	31	20	above	above	IN
10_1101-2020_12_31_424971	31	21	background20	background20	NNP
10_1101-2020_12_31_424971	31	22	,	,	,
10_1101-2020_12_31_424971	31	23	99	99	CD
10_1101-2020_12_31_424971	31	24	demonstrates	demonstrate	VBZ
10_1101-2020_12_31_424971	31	25	its	-PRON-	PRP$
10_1101-2020_12_31_424971	31	26	ability	ability	NN
10_1101-2020_12_31_424971	31	27	to	to	TO
10_1101-2020_12_31_424971	31	28	successfully	successfully	RB
10_1101-2020_12_31_424971	31	29	compete	compete	VB
10_1101-2020_12_31_424971	31	30	with	with	IN
10_1101-2020_12_31_424971	31	31	the	the	DT
10_1101-2020_12_31_424971	31	32	naturally	naturally	RB
10_1101-2020_12_31_424971	31	33	occurring	occur	VBG
10_1101-2020_12_31_424971	31	34	ProL	ProL	NNP
10_1101-2020_12_31_424971	31	35	and	and	CC
10_1101-2020_12_31_424971	31	36	ProM	ProM	NNP
10_1101-2020_12_31_424971	31	37	100	100	CD
10_1101-2020_12_31_424971	31	38	.CC	.CC	:
10_1101-2020_12_31_424971	31	39	-	-	HYPH
10_1101-2020_12_31_424971	31	40	BY	by	IN
10_1101-2020_12_31_424971	31	41	-	-	HYPH
10_1101-2020_12_31_424971	31	42	NC	NC	NNP
10_1101-2020_12_31_424971	31	43	-	-	HYPH
10_1101-2020_12_31_424971	31	44	ND	ND	NNP
10_1101-2020_12_31_424971	31	45	4.0	4.0	CD
10_1101-2020_12_31_424971	31	46	International	International	NNP
10_1101-2020_12_31_424971	31	47	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	31	48	under	under	IN
10_1101-2020_12_31_424971	31	49	a	a	DT
10_1101-2020_12_31_424971	31	50	(	(	-LRB-
10_1101-2020_12_31_424971	31	51	which	which	WDT
10_1101-2020_12_31_424971	31	52	was	be	VBD
10_1101-2020_12_31_424971	31	53	not	not	RB
10_1101-2020_12_31_424971	31	54	certified	certify	VBN
10_1101-2020_12_31_424971	31	55	by	by	IN
10_1101-2020_12_31_424971	31	56	peer	peer	NN
10_1101-2020_12_31_424971	31	57	review	review	NN
10_1101-2020_12_31_424971	31	58	)	)	-RRB-
10_1101-2020_12_31_424971	31	59	is	be	VBZ
10_1101-2020_12_31_424971	31	60	the	the	DT
10_1101-2020_12_31_424971	31	61	author	author	NN
10_1101-2020_12_31_424971	31	62	/	/	SYM
10_1101-2020_12_31_424971	31	63	funder	funder	NN
10_1101-2020_12_31_424971	31	64	,	,	,
10_1101-2020_12_31_424971	31	65	who	who	WP
10_1101-2020_12_31_424971	31	66	has	have	VBZ
10_1101-2020_12_31_424971	31	67	granted	grant	VBN
10_1101-2020_12_31_424971	31	68	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	31	69	a	a	DT
10_1101-2020_12_31_424971	31	70	license	license	NN
10_1101-2020_12_31_424971	31	71	to	to	TO
10_1101-2020_12_31_424971	31	72	display	display	VB
10_1101-2020_12_31_424971	31	73	the	the	DT
10_1101-2020_12_31_424971	31	74	preprint	preprint	NN
10_1101-2020_12_31_424971	31	75	in	in	IN
10_1101-2020_12_31_424971	31	76	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	31	77	.	.	.
10_1101-2020_12_31_424971	32	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	32	2	is	be	VBZ
10_1101-2020_12_31_424971	32	3	made	make	VBN
10_1101-2020_12_31_424971	32	4	The	the	DT
10_1101-2020_12_31_424971	32	5	copyright	copyright	NN
10_1101-2020_12_31_424971	32	6	holder	holder	NN
10_1101-2020_12_31_424971	32	7	for	for	IN
10_1101-2020_12_31_424971	32	8	this	this	DT
10_1101-2020_12_31_424971	32	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	32	10	version	version	NN
10_1101-2020_12_31_424971	32	11	posted	post	VBD
10_1101-2020_12_31_424971	32	12	January	January	NNP
10_1101-2020_12_31_424971	32	13	2	2	CD
10_1101-2020_12_31_424971	32	14	,	,	,
10_1101-2020_12_31_424971	32	15	2021	2021	CD
10_1101-2020_12_31_424971	32	16	.	.	.
10_1101-2020_12_31_424971	32	17	;	;	:
10_1101-2020_12_31_424971	32	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	32	19	:	:	:
10_1101-2020_12_31_424971	32	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	32	21	preprint	preprint	NN
10_1101-2020_12_31_424971	32	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NN
10_1101-2020_12_31_424971	32	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	32	24	5	5	CD
10_1101-2020_12_31_424971	32	25	isoacceptor	isoacceptor	NN
10_1101-2020_12_31_424971	32	26	tRNAs	trnas	CD
10_1101-2020_12_31_424971	32	27	that	that	WDT
10_1101-2020_12_31_424971	32	28	read	read	VBP
10_1101-2020_12_31_424971	32	29	the	the	DT
10_1101-2020_12_31_424971	32	30	CCC	CCC	NNP
10_1101-2020_12_31_424971	32	31	codon	codon	NN
10_1101-2020_12_31_424971	32	32	.	.	.
10_1101-2020_12_31_424971	33	1	Using	use	VBG
10_1101-2020_12_31_424971	33	2	the	the	DT
10_1101-2020_12_31_424971	33	3	ensemble	ensemble	JJ
10_1101-2020_12_31_424971	33	4	‘	'	``
10_1101-2020_12_31_424971	33	5	codon	codon	NN
10_1101-2020_12_31_424971	33	6	-	-	HYPH
10_1101-2020_12_31_424971	33	7	walk	walk	NN
10_1101-2020_12_31_424971	33	8	’	'	''
10_1101-2020_12_31_424971	33	9	methodology21	methodology21	CD
10_1101-2020_12_31_424971	33	10	101	101	CD
10_1101-2020_12_31_424971	33	11	and	and	CC
10_1101-2020_12_31_424971	33	12	single	single	JJ
10_1101-2020_12_31_424971	33	13	-	-	HYPH
10_1101-2020_12_31_424971	33	14	molecule	molecule	NN
10_1101-2020_12_31_424971	33	15	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	33	16	resonance	resonance	NN
10_1101-2020_12_31_424971	33	17	energy	energy	NN
10_1101-2020_12_31_424971	33	18	transfer	transfer	NN
10_1101-2020_12_31_424971	33	19	(	(	-LRB-
10_1101-2020_12_31_424971	33	20	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	33	21	)	)	-RRB-
10_1101-2020_12_31_424971	33	22	,	,	,
10_1101-2020_12_31_424971	33	23	we	-PRON-	PRP
10_1101-2020_12_31_424971	33	24	have	have	VBP
10_1101-2020_12_31_424971	33	25	compared	compare	VBN
10_1101-2020_12_31_424971	33	26	the	the	DT
10_1101-2020_12_31_424971	33	27	102	102	CD
10_1101-2020_12_31_424971	33	28	+1	+1	NNS
10_1101-2020_12_31_424971	33	29	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	33	30	activity	activity	NN
10_1101-2020_12_31_424971	33	31	of	of	IN
10_1101-2020_12_31_424971	33	32	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	33	33	relative	relative	JJ
10_1101-2020_12_31_424971	33	34	to	to	IN
10_1101-2020_12_31_424971	33	35	its	-PRON-	PRP$
10_1101-2020_12_31_424971	33	36	closest	close	JJS
10_1101-2020_12_31_424971	33	37	counterpart	counterpart	NN
10_1101-2020_12_31_424971	33	38	,	,	,
10_1101-2020_12_31_424971	33	39	ProL	ProL	NNP
10_1101-2020_12_31_424971	33	40	,	,	,
10_1101-2020_12_31_424971	33	41	at	at	IN
10_1101-2020_12_31_424971	33	42	a	a	DT
10_1101-2020_12_31_424971	33	43	CCC	CCC	NNP
10_1101-2020_12_31_424971	33	44	-	-	HYPH
10_1101-2020_12_31_424971	33	45	C	C	NNP
10_1101-2020_12_31_424971	33	46	motif	motif	NN
10_1101-2020_12_31_424971	33	47	,	,	,
10_1101-2020_12_31_424971	33	48	and	and	CC
10_1101-2020_12_31_424971	33	49	103	103	CD
10_1101-2020_12_31_424971	33	50	determined	determine	VBD
10_1101-2020_12_31_424971	33	51	the	the	DT
10_1101-2020_12_31_424971	33	52	position	position	NN
10_1101-2020_12_31_424971	33	53	and	and	CC
10_1101-2020_12_31_424971	33	54	timing	timing	NN
10_1101-2020_12_31_424971	33	55	of	of	IN
10_1101-2020_12_31_424971	33	56	the	the	DT
10_1101-2020_12_31_424971	33	57	shift	shift	NN
10_1101-2020_12_31_424971	33	58	.	.	.
10_1101-2020_12_31_424971	34	1	Our	-PRON-	PRP$
10_1101-2020_12_31_424971	34	2	results	result	NNS
10_1101-2020_12_31_424971	34	3	show	show	VBP
10_1101-2020_12_31_424971	34	4	that	that	IN
10_1101-2020_12_31_424971	34	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	34	6	is	be	VBZ
10_1101-2020_12_31_424971	34	7	naturally	naturally	RB
10_1101-2020_12_31_424971	34	8	N1	N1	NNP
10_1101-2020_12_31_424971	34	9	-	-	HYPH
10_1101-2020_12_31_424971	34	10	104	104	NNP
10_1101-2020_12_31_424971	34	11	methylated	methylate	VBD
10_1101-2020_12_31_424971	34	12	at	at	IN
10_1101-2020_12_31_424971	34	13	G37	G37	NNP
10_1101-2020_12_31_424971	34	14	in	in	IN
10_1101-2020_12_31_424971	34	15	cells	cell	NNS
10_1101-2020_12_31_424971	34	16	,	,	,
10_1101-2020_12_31_424971	34	17	generating	generate	VBG
10_1101-2020_12_31_424971	34	18	an	an	DT
10_1101-2020_12_31_424971	34	19	m1G37	m1g37	NN
10_1101-2020_12_31_424971	34	20	that	that	WDT
10_1101-2020_12_31_424971	34	21	blocks	blocks	NNP
10_1101-2020_12_31_424971	34	22	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	34	23	pairing	pairing	NN
10_1101-2020_12_31_424971	34	24	and	and	CC
10_1101-2020_12_31_424971	34	25	forces	force	VBZ
10_1101-2020_12_31_424971	34	26	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	34	27	105	105	CD
10_1101-2020_12_31_424971	34	28	to	to	TO
10_1101-2020_12_31_424971	34	29	use	use	VB
10_1101-2020_12_31_424971	34	30	0-frame	0-frame	CD
10_1101-2020_12_31_424971	34	31	triplet	triplet	NN
10_1101-2020_12_31_424971	34	32	anticodon	anticodon	NN
10_1101-2020_12_31_424971	34	33	-	-	HYPH
10_1101-2020_12_31_424971	34	34	codon	codon	NNP
10_1101-2020_12_31_424971	34	35	pairing	pair	VBG
10_1101-2020_12_31_424971	34	36	to	to	TO
10_1101-2020_12_31_424971	34	37	decode	decode	VB
10_1101-2020_12_31_424971	34	38	the	the	DT
10_1101-2020_12_31_424971	34	39	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	34	40	codon	codon	NNP
10_1101-2020_12_31_424971	34	41	at	at	IN
10_1101-2020_12_31_424971	34	42	the	the	DT
10_1101-2020_12_31_424971	34	43	A	A	NNP
10_1101-2020_12_31_424971	34	44	site	site	NN
10_1101-2020_12_31_424971	34	45	.	.	.
10_1101-2020_12_31_424971	35	1	106	106	CD
10_1101-2020_12_31_424971	35	2	Additionally	additionally	RB
10_1101-2020_12_31_424971	35	3	,	,	,
10_1101-2020_12_31_424971	35	4	we	-PRON-	PRP
10_1101-2020_12_31_424971	35	5	find	find	VBP
10_1101-2020_12_31_424971	35	6	that	that	IN
10_1101-2020_12_31_424971	35	7	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	35	8	,	,	,
10_1101-2020_12_31_424971	35	9	and	and	CC
10_1101-2020_12_31_424971	35	10	likely	likely	RB
10_1101-2020_12_31_424971	35	11	all	all	DT
10_1101-2020_12_31_424971	35	12	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	35	13	tRNAs	trnas	CD
10_1101-2020_12_31_424971	35	14	,	,	,
10_1101-2020_12_31_424971	35	15	shifts	shift	NNS
10_1101-2020_12_31_424971	35	16	to	to	IN
10_1101-2020_12_31_424971	35	17	the	the	DT
10_1101-2020_12_31_424971	35	18	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	35	19	during	during	IN
10_1101-2020_12_31_424971	35	20	107	107	CD
10_1101-2020_12_31_424971	35	21	the	the	DT
10_1101-2020_12_31_424971	35	22	subsequent	subsequent	JJ
10_1101-2020_12_31_424971	35	23	translocation	translocation	NN
10_1101-2020_12_31_424971	35	24	reaction	reaction	NN
10_1101-2020_12_31_424971	35	25	in	in	IN
10_1101-2020_12_31_424971	35	26	which	which	WDT
10_1101-2020_12_31_424971	35	27	the	the	DT
10_1101-2020_12_31_424971	35	28	translational	translational	JJ
10_1101-2020_12_31_424971	35	29	GTPase	GTPase	NNP
10_1101-2020_12_31_424971	35	30	elongation	elongation	NN
10_1101-2020_12_31_424971	35	31	factor	factor	NN
10_1101-2020_12_31_424971	35	32	(	(	-LRB-
10_1101-2020_12_31_424971	35	33	EF)-G	EF)-G	NNP
10_1101-2020_12_31_424971	35	34	108	108	CD
10_1101-2020_12_31_424971	35	35	catalyzes	catalyze	VBZ
10_1101-2020_12_31_424971	35	36	the	the	DT
10_1101-2020_12_31_424971	35	37	movement	movement	NN
10_1101-2020_12_31_424971	35	38	of	of	IN
10_1101-2020_12_31_424971	35	39	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	35	40	from	from	IN
10_1101-2020_12_31_424971	35	41	the	the	DT
10_1101-2020_12_31_424971	35	42	A	a	NN
10_1101-2020_12_31_424971	35	43	to	to	IN
10_1101-2020_12_31_424971	35	44	P	p	NN
10_1101-2020_12_31_424971	35	45	sites	site	NNS
10_1101-2020_12_31_424971	35	46	(	(	-LRB-
10_1101-2020_12_31_424971	35	47	i.e.	i.e.	FW
10_1101-2020_12_31_424971	35	48	,	,	,
10_1101-2020_12_31_424971	35	49	a	a	DT
10_1101-2020_12_31_424971	35	50	triplet	triplet	NN
10_1101-2020_12_31_424971	35	51	-	-	HYPH
10_1101-2020_12_31_424971	35	52	slippage	slippage	NN
10_1101-2020_12_31_424971	35	53	mechanism	mechanism	NN
10_1101-2020_12_31_424971	35	54	)	)	-RRB-
10_1101-2020_12_31_424971	35	55	.	.	.
10_1101-2020_12_31_424971	36	1	More	More	JJR
10_1101-2020_12_31_424971	36	2	109	109	CD
10_1101-2020_12_31_424971	36	3	specifically	specifically	RB
10_1101-2020_12_31_424971	36	4	,	,	,
10_1101-2020_12_31_424971	36	5	we	-PRON-	PRP
10_1101-2020_12_31_424971	36	6	show	show	VBP
10_1101-2020_12_31_424971	36	7	that	that	IN
10_1101-2020_12_31_424971	36	8	this	this	DT
10_1101-2020_12_31_424971	36	9	frameshift	frameshift	NN
10_1101-2020_12_31_424971	36	10	occurs	occur	VBZ
10_1101-2020_12_31_424971	36	11	in	in	IN
10_1101-2020_12_31_424971	36	12	the	the	DT
10_1101-2020_12_31_424971	36	13	later	later	JJ
10_1101-2020_12_31_424971	36	14	steps	step	NNS
10_1101-2020_12_31_424971	36	15	of	of	IN
10_1101-2020_12_31_424971	36	16	translocation	translocation	NN
10_1101-2020_12_31_424971	36	17	,	,	,
10_1101-2020_12_31_424971	36	18	during	during	IN
10_1101-2020_12_31_424971	36	19	which	which	WDT
10_1101-2020_12_31_424971	36	20	110	110	CD
10_1101-2020_12_31_424971	36	21	EF	EF	NNP
10_1101-2020_12_31_424971	36	22	-	-	HYPH
10_1101-2020_12_31_424971	36	23	G	G	NNP
10_1101-2020_12_31_424971	36	24	catalyzes	catalyze	VBZ
10_1101-2020_12_31_424971	36	25	a	a	DT
10_1101-2020_12_31_424971	36	26	series	series	NN
10_1101-2020_12_31_424971	36	27	of	of	IN
10_1101-2020_12_31_424971	36	28	conformational	conformational	JJ
10_1101-2020_12_31_424971	36	29	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	36	30	of	of	IN
10_1101-2020_12_31_424971	36	31	the	the	DT
10_1101-2020_12_31_424971	36	32	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	36	33	pre	pre	JJ
10_1101-2020_12_31_424971	36	34	-	-	JJ
10_1101-2020_12_31_424971	36	35	translocation	translocation	JJ
10_1101-2020_12_31_424971	36	36	111	111	CD
10_1101-2020_12_31_424971	36	37	(	(	-LRB-
10_1101-2020_12_31_424971	36	38	PRE	PRE	NNP
10_1101-2020_12_31_424971	36	39	)	)	-RRB-
10_1101-2020_12_31_424971	36	40	complex	complex	NN
10_1101-2020_12_31_424971	36	41	that	that	WDT
10_1101-2020_12_31_424971	36	42	enable	enable	VBP
10_1101-2020_12_31_424971	36	43	the	the	DT
10_1101-2020_12_31_424971	36	44	tRNA	trna	NN
10_1101-2020_12_31_424971	36	45	ASLs	asl	NNS
10_1101-2020_12_31_424971	36	46	and	and	CC
10_1101-2020_12_31_424971	36	47	their	-PRON-	PRP$
10_1101-2020_12_31_424971	36	48	associated	associated	JJ
10_1101-2020_12_31_424971	36	49	codons	codon	NNS
10_1101-2020_12_31_424971	36	50	to	to	TO
10_1101-2020_12_31_424971	36	51	move	move	VB
10_1101-2020_12_31_424971	36	52	to	to	IN
10_1101-2020_12_31_424971	36	53	their	-PRON-	PRP$
10_1101-2020_12_31_424971	36	54	112	112	CD
10_1101-2020_12_31_424971	36	55	respective	respective	JJ
10_1101-2020_12_31_424971	36	56	post	post	JJ
10_1101-2020_12_31_424971	36	57	-	-	JJ
10_1101-2020_12_31_424971	36	58	translocation	translocation	JJ
10_1101-2020_12_31_424971	36	59	positions	position	NNS
10_1101-2020_12_31_424971	36	60	within	within	IN
10_1101-2020_12_31_424971	36	61	the	the	DT
10_1101-2020_12_31_424971	36	62	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	36	63	small	small	NN
10_1101-2020_12_31_424971	36	64	(	(	-LRB-
10_1101-2020_12_31_424971	36	65	30S	30s	CD
10_1101-2020_12_31_424971	36	66	in	in	IN
10_1101-2020_12_31_424971	36	67	bacteria	bacteria	NNS
10_1101-2020_12_31_424971	36	68	)	)	-RRB-
10_1101-2020_12_31_424971	36	69	subunit22	subunit22	NN
10_1101-2020_12_31_424971	36	70	-	-	SYM
10_1101-2020_12_31_424971	36	71	28	28	CD
10_1101-2020_12_31_424971	36	72	.	.	.
10_1101-2020_12_31_424971	37	1	113	113	CD
10_1101-2020_12_31_424971	37	2	Thus	thus	RB
10_1101-2020_12_31_424971	37	3	,	,	,
10_1101-2020_12_31_424971	37	4	efforts	effort	NNS
10_1101-2020_12_31_424971	37	5	to	to	TO
10_1101-2020_12_31_424971	37	6	increase	increase	VB
10_1101-2020_12_31_424971	37	7	the	the	DT
10_1101-2020_12_31_424971	37	8	recoding	recode	VBG
10_1101-2020_12_31_424971	37	9	efficiency	efficiency	NN
10_1101-2020_12_31_424971	37	10	of	of	IN
10_1101-2020_12_31_424971	37	11	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	37	12	tRNAs	trnas	CD
10_1101-2020_12_31_424971	37	13	should	should	MD
10_1101-2020_12_31_424971	37	14	focus	focus	VB
10_1101-2020_12_31_424971	37	15	on	on	IN
10_1101-2020_12_31_424971	37	16	114	114	CD
10_1101-2020_12_31_424971	37	17	enforcing	enforce	VBG
10_1101-2020_12_31_424971	37	18	a	a	DT
10_1101-2020_12_31_424971	37	19	triplet	triplet	NN
10_1101-2020_12_31_424971	37	20	anticodon	anticodon	NN
10_1101-2020_12_31_424971	37	21	-	-	HYPH
10_1101-2020_12_31_424971	37	22	codon	codon	NNP
10_1101-2020_12_31_424971	37	23	pairing	pair	VBG
10_1101-2020_12_31_424971	37	24	in	in	IN
10_1101-2020_12_31_424971	37	25	the	the	DT
10_1101-2020_12_31_424971	37	26	0-frame	0-frame	CD
10_1101-2020_12_31_424971	37	27	at	at	IN
10_1101-2020_12_31_424971	37	28	the	the	DT
10_1101-2020_12_31_424971	37	29	A	A	NNP
10_1101-2020_12_31_424971	37	30	site	site	NN
10_1101-2020_12_31_424971	37	31	and	and	CC
10_1101-2020_12_31_424971	37	32	directed	direct	VBN
10_1101-2020_12_31_424971	37	33	evolution	evolution	NN
10_1101-2020_12_31_424971	37	34	to	to	IN
10_1101-2020_12_31_424971	37	35	115	115	CD
10_1101-2020_12_31_424971	37	36	optimize	optimize	NN
10_1101-2020_12_31_424971	37	37	conformational	conformational	JJ
10_1101-2020_12_31_424971	37	38	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	37	39	of	of	IN
10_1101-2020_12_31_424971	37	40	the	the	DT
10_1101-2020_12_31_424971	37	41	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	37	42	PRE	PRE	NNP
10_1101-2020_12_31_424971	37	43	complex	complex	NN
10_1101-2020_12_31_424971	37	44	during	during	IN
10_1101-2020_12_31_424971	37	45	the	the	DT
10_1101-2020_12_31_424971	37	46	late	late	JJ
10_1101-2020_12_31_424971	37	47	stages	stage	NNS
10_1101-2020_12_31_424971	37	48	of	of	IN
10_1101-2020_12_31_424971	37	49	116	116	CD
10_1101-2020_12_31_424971	37	50	translocation	translocation	NN
10_1101-2020_12_31_424971	37	51	.	.	.
10_1101-2020_12_31_424971	38	1	117	117	CD
10_1101-2020_12_31_424971	38	2	118	118	CD
10_1101-2020_12_31_424971	38	3	RESULTS	results	NN
10_1101-2020_12_31_424971	38	4	119	119	CD
10_1101-2020_12_31_424971	38	5	Native	native	JJ
10_1101-2020_12_31_424971	38	6	-	-	HYPH
10_1101-2020_12_31_424971	38	7	state	state	NN
10_1101-2020_12_31_424971	38	8	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	38	9	is	be	VBZ
10_1101-2020_12_31_424971	38	10	N1-methylated	n1-methylate	VBN
10_1101-2020_12_31_424971	38	11	at	at	IN
10_1101-2020_12_31_424971	38	12	G37	G37	NNP
10_1101-2020_12_31_424971	38	13	and	and	CC
10_1101-2020_12_31_424971	38	14	is	be	VBZ
10_1101-2020_12_31_424971	38	15	readily	readily	RB
10_1101-2020_12_31_424971	38	16	aminoacylated	aminoacylate	VBN
10_1101-2020_12_31_424971	38	17	with	with	IN
10_1101-2020_12_31_424971	38	18	Pro	Pro	NNP
10_1101-2020_12_31_424971	38	19	120	120	CD
10_1101-2020_12_31_424971	38	20	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	38	21	contains	contain	VBZ
10_1101-2020_12_31_424971	38	22	an	an	DT
10_1101-2020_12_31_424971	38	23	extra	extra	JJ
10_1101-2020_12_31_424971	38	24	G37a	g37a	NN
10_1101-2020_12_31_424971	38	25	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	38	26	inserted	insert	VBN
10_1101-2020_12_31_424971	38	27	between	between	IN
10_1101-2020_12_31_424971	38	28	G37	G37	NNP
10_1101-2020_12_31_424971	38	29	and	and	CC
10_1101-2020_12_31_424971	38	30	U38	U38	NNP
10_1101-2020_12_31_424971	38	31	of	of	IN
10_1101-2020_12_31_424971	38	32	ProL20	ProL20	NNP
10_1101-2020_12_31_424971	38	33	(	(	-LRB-
10_1101-2020_12_31_424971	38	34	Figure	Figure	NNP
10_1101-2020_12_31_424971	38	35	121	121	CD
10_1101-2020_12_31_424971	38	36	1a	1a	CD
10_1101-2020_12_31_424971	38	37	)	)	-RRB-
10_1101-2020_12_31_424971	38	38	.	.	.
10_1101-2020_12_31_424971	39	1	Whether	whether	IN
10_1101-2020_12_31_424971	39	2	the	the	DT
10_1101-2020_12_31_424971	39	3	extra	extra	JJ
10_1101-2020_12_31_424971	39	4	G37a	g37a	NN
10_1101-2020_12_31_424971	39	5	is	be	VBZ
10_1101-2020_12_31_424971	39	6	methylated	methylate	VBN
10_1101-2020_12_31_424971	39	7	and	and	CC
10_1101-2020_12_31_424971	39	8	how	how	WRB
10_1101-2020_12_31_424971	39	9	it	-PRON-	PRP
10_1101-2020_12_31_424971	39	10	affects	affect	VBZ
10_1101-2020_12_31_424971	39	11	methylation	methylation	NN
10_1101-2020_12_31_424971	39	12	of	of	IN
10_1101-2020_12_31_424971	39	13	G37	G37	NNP
10_1101-2020_12_31_424971	39	14	is	be	VBZ
10_1101-2020_12_31_424971	39	15	unknown	unknown	JJ
10_1101-2020_12_31_424971	39	16	.	.	.
10_1101-2020_12_31_424971	40	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	40	2	122	122	CD
10_1101-2020_12_31_424971	40	3	thus	thus	RB
10_1101-2020_12_31_424971	40	4	determined	determine	VBD
10_1101-2020_12_31_424971	40	5	the	the	DT
10_1101-2020_12_31_424971	40	6	methylation	methylation	NN
10_1101-2020_12_31_424971	40	7	status	status	NN
10_1101-2020_12_31_424971	40	8	of	of	IN
10_1101-2020_12_31_424971	40	9	the	the	DT
10_1101-2020_12_31_424971	40	10	G37-G37a	G37-G37a	NNP
10_1101-2020_12_31_424971	40	11	motif	motif	NN
10_1101-2020_12_31_424971	40	12	using	use	VBG
10_1101-2020_12_31_424971	40	13	RNase	RNase	NNP
10_1101-2020_12_31_424971	40	14	T1	T1	NNP
10_1101-2020_12_31_424971	40	15	cleavage	cleavage	NN
10_1101-2020_12_31_424971	40	16	inhibition	inhibition	NN
10_1101-2020_12_31_424971	40	17	123	123	CD
10_1101-2020_12_31_424971	40	18	assays	assay	NNS
10_1101-2020_12_31_424971	40	19	and	and	CC
10_1101-2020_12_31_424971	40	20	primer	primer	JJ
10_1101-2020_12_31_424971	40	21	extension	extension	NN
10_1101-2020_12_31_424971	40	22	inhibition	inhibition	NN
10_1101-2020_12_31_424971	40	23	assays	assays	RB
10_1101-2020_12_31_424971	40	24	.	.	.
10_1101-2020_12_31_424971	41	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	41	2	first	first	RB
10_1101-2020_12_31_424971	41	3	generated	generate	VBD
10_1101-2020_12_31_424971	41	4	a	a	DT
10_1101-2020_12_31_424971	41	5	plasmid	plasmid	NN
10_1101-2020_12_31_424971	41	6	-	-	HYPH
10_1101-2020_12_31_424971	41	7	encoded	encode	VBN
10_1101-2020_12_31_424971	41	8	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	41	9	by	by	IN
10_1101-2020_12_31_424971	41	10	124	124	CD
10_1101-2020_12_31_424971	41	11	inserting	inserting	NN
10_1101-2020_12_31_424971	41	12	G37a	g37a	NN
10_1101-2020_12_31_424971	41	13	into	into	IN
10_1101-2020_12_31_424971	41	14	an	an	DT
10_1101-2020_12_31_424971	41	15	existing	exist	VBG
10_1101-2020_12_31_424971	41	16	Tac	Tac	NNP
10_1101-2020_12_31_424971	41	17	-	-	HYPH
10_1101-2020_12_31_424971	41	18	inducible	inducible	JJ
10_1101-2020_12_31_424971	41	19	plasmid	plasmid	NN
10_1101-2020_12_31_424971	41	20	encoding	encode	VBG
10_1101-2020_12_31_424971	41	21	Escherichia	Escherichia	NNP
10_1101-2020_12_31_424971	41	22	coli	coli	NNS
10_1101-2020_12_31_424971	41	23	ProL29	ProL29	NNP
10_1101-2020_12_31_424971	41	24	,	,	,
10_1101-2020_12_31_424971	41	25	which	which	WDT
10_1101-2020_12_31_424971	41	26	has	have	VBZ
10_1101-2020_12_31_424971	41	27	125	125	CD
10_1101-2020_12_31_424971	41	28	an	an	DT
10_1101-2020_12_31_424971	41	29	identical	identical	JJ
10_1101-2020_12_31_424971	41	30	sequence	sequence	NN
10_1101-2020_12_31_424971	41	31	to	to	IN
10_1101-2020_12_31_424971	41	32	S.	S.	NNP
10_1101-2020_12_31_424971	41	33	typhimurium	typhimurium	NN
10_1101-2020_12_31_424971	41	34	ProL.	ProL.	.
10_1101-2020_12_31_424971	42	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	42	2	then	then	RB
10_1101-2020_12_31_424971	42	3	expressed	express	VBD
10_1101-2020_12_31_424971	42	4	and	and	CC
10_1101-2020_12_31_424971	42	5	purified	purify	VBD
10_1101-2020_12_31_424971	42	6	the	the	DT
10_1101-2020_12_31_424971	42	7	plasmid-126	plasmid-126	NN
10_1101-2020_12_31_424971	42	8	.CC	.CC	NFP
10_1101-2020_12_31_424971	42	9	-	-	:
10_1101-2020_12_31_424971	42	10	BY	by	IN
10_1101-2020_12_31_424971	42	11	-	-	HYPH
10_1101-2020_12_31_424971	42	12	NC	NC	NNP
10_1101-2020_12_31_424971	42	13	-	-	HYPH
10_1101-2020_12_31_424971	42	14	ND	ND	NNP
10_1101-2020_12_31_424971	42	15	4.0	4.0	CD
10_1101-2020_12_31_424971	42	16	International	International	NNP
10_1101-2020_12_31_424971	42	17	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	42	18	under	under	IN
10_1101-2020_12_31_424971	42	19	a	a	DT
10_1101-2020_12_31_424971	42	20	(	(	-LRB-
10_1101-2020_12_31_424971	42	21	which	which	WDT
10_1101-2020_12_31_424971	42	22	was	be	VBD
10_1101-2020_12_31_424971	42	23	not	not	RB
10_1101-2020_12_31_424971	42	24	certified	certify	VBN
10_1101-2020_12_31_424971	42	25	by	by	IN
10_1101-2020_12_31_424971	42	26	peer	peer	NN
10_1101-2020_12_31_424971	42	27	review	review	NN
10_1101-2020_12_31_424971	42	28	)	)	-RRB-
10_1101-2020_12_31_424971	42	29	is	be	VBZ
10_1101-2020_12_31_424971	42	30	the	the	DT
10_1101-2020_12_31_424971	42	31	author	author	NN
10_1101-2020_12_31_424971	42	32	/	/	SYM
10_1101-2020_12_31_424971	42	33	funder	funder	NN
10_1101-2020_12_31_424971	42	34	,	,	,
10_1101-2020_12_31_424971	42	35	who	who	WP
10_1101-2020_12_31_424971	42	36	has	have	VBZ
10_1101-2020_12_31_424971	42	37	granted	grant	VBN
10_1101-2020_12_31_424971	42	38	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	42	39	a	a	DT
10_1101-2020_12_31_424971	42	40	license	license	NN
10_1101-2020_12_31_424971	42	41	to	to	TO
10_1101-2020_12_31_424971	42	42	display	display	VB
10_1101-2020_12_31_424971	42	43	the	the	DT
10_1101-2020_12_31_424971	42	44	preprint	preprint	NN
10_1101-2020_12_31_424971	42	45	in	in	IN
10_1101-2020_12_31_424971	42	46	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	42	47	.	.	.
10_1101-2020_12_31_424971	43	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	43	2	is	be	VBZ
10_1101-2020_12_31_424971	43	3	made	make	VBN
10_1101-2020_12_31_424971	43	4	The	the	DT
10_1101-2020_12_31_424971	43	5	copyright	copyright	NN
10_1101-2020_12_31_424971	43	6	holder	holder	NN
10_1101-2020_12_31_424971	43	7	for	for	IN
10_1101-2020_12_31_424971	43	8	this	this	DT
10_1101-2020_12_31_424971	43	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	43	10	version	version	NN
10_1101-2020_12_31_424971	43	11	posted	post	VBD
10_1101-2020_12_31_424971	43	12	January	January	NNP
10_1101-2020_12_31_424971	43	13	2	2	CD
10_1101-2020_12_31_424971	43	14	,	,	,
10_1101-2020_12_31_424971	43	15	2021	2021	CD
10_1101-2020_12_31_424971	43	16	.	.	.
10_1101-2020_12_31_424971	43	17	;	;	:
10_1101-2020_12_31_424971	43	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	43	19	:	:	:
10_1101-2020_12_31_424971	43	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	43	21	preprint	preprint	NN
10_1101-2020_12_31_424971	43	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	43	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	43	24	6	6	CD
10_1101-2020_12_31_424971	43	25	encoded	encode	VBN
10_1101-2020_12_31_424971	43	26	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	43	27	and	and	CC
10_1101-2020_12_31_424971	43	28	ProL	ProL	NNP
10_1101-2020_12_31_424971	43	29	from	from	IN
10_1101-2020_12_31_424971	43	30	an	an	DT
10_1101-2020_12_31_424971	43	31	E.	E.	NNP
10_1101-2020_12_31_424971	43	32	coli	coli	VBZ
10_1101-2020_12_31_424971	43	33	ProL	ProL	NNP
10_1101-2020_12_31_424971	43	34	knock	knock	NN
10_1101-2020_12_31_424971	43	35	-	-	HYPH
10_1101-2020_12_31_424971	43	36	out	out	NN
10_1101-2020_12_31_424971	43	37	(	(	-LRB-
10_1101-2020_12_31_424971	43	38	ProL	ProL	NNP
10_1101-2020_12_31_424971	43	39	-	-	HYPH
10_1101-2020_12_31_424971	43	40	KO	KO	NNP
10_1101-2020_12_31_424971	43	41	)	)	-RRB-
10_1101-2020_12_31_424971	43	42	strain30	strain30	VB
10_1101-2020_12_31_424971	43	43	containing	contain	VBG
10_1101-2020_12_31_424971	43	44	all	all	PDT
10_1101-2020_12_31_424971	43	45	the	the	DT
10_1101-2020_12_31_424971	43	46	127	127	CD
10_1101-2020_12_31_424971	43	47	endogenous	endogenous	JJ
10_1101-2020_12_31_424971	43	48	enzymes	enzyme	NNS
10_1101-2020_12_31_424971	43	49	necessary	necessary	JJ
10_1101-2020_12_31_424971	43	50	for	for	IN
10_1101-2020_12_31_424971	43	51	processing	process	VBG
10_1101-2020_12_31_424971	43	52	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	43	53	and	and	CC
10_1101-2020_12_31_424971	43	54	ProL	ProL	NNP
10_1101-2020_12_31_424971	43	55	to	to	IN
10_1101-2020_12_31_424971	43	56	their	-PRON-	PRP$
10_1101-2020_12_31_424971	43	57	S.	S.	NNP
10_1101-2020_12_31_424971	43	58	typhimurium	typhimurium	NN
10_1101-2020_12_31_424971	43	59	native	native	JJ
10_1101-2020_12_31_424971	43	60	128	128	CD
10_1101-2020_12_31_424971	43	61	states	state	NNS
10_1101-2020_12_31_424971	43	62	such	such	JJ
10_1101-2020_12_31_424971	43	63	that	that	IN
10_1101-2020_12_31_424971	43	64	they	-PRON-	PRP
10_1101-2020_12_31_424971	43	65	possess	possess	VBP
10_1101-2020_12_31_424971	43	66	the	the	DT
10_1101-2020_12_31_424971	43	67	full	full	JJ
10_1101-2020_12_31_424971	43	68	complement	complement	NN
10_1101-2020_12_31_424971	43	69	of	of	IN
10_1101-2020_12_31_424971	43	70	naturally	naturally	RB
10_1101-2020_12_31_424971	43	71	occurring	occur	VBG
10_1101-2020_12_31_424971	43	72	post	post	JJ
10_1101-2020_12_31_424971	43	73	-	-	JJ
10_1101-2020_12_31_424971	43	74	transcriptional	transcriptional	JJ
10_1101-2020_12_31_424971	43	75	129	129	CD
10_1101-2020_12_31_424971	43	76	modifications	modification	NNS
10_1101-2020_12_31_424971	43	77	(	(	-LRB-
10_1101-2020_12_31_424971	43	78	termed	term	VBN
10_1101-2020_12_31_424971	43	79	the	the	DT
10_1101-2020_12_31_424971	43	80	native	native	JJ
10_1101-2020_12_31_424971	43	81	-	-	HYPH
10_1101-2020_12_31_424971	43	82	state	state	NN
10_1101-2020_12_31_424971	43	83	tRNAs	trna	NNS
10_1101-2020_12_31_424971	43	84	)	)	-RRB-
10_1101-2020_12_31_424971	43	85	.	.	.
10_1101-2020_12_31_424971	44	1	In	in	IN
10_1101-2020_12_31_424971	44	2	addition	addition	NN
10_1101-2020_12_31_424971	44	3	,	,	,
10_1101-2020_12_31_424971	44	4	we	-PRON-	PRP
10_1101-2020_12_31_424971	44	5	prepared	prepare	VBD
10_1101-2020_12_31_424971	44	6	in	in	IN
10_1101-2020_12_31_424971	44	7	vitro	vitro	FW
10_1101-2020_12_31_424971	44	8	transcripts	transcript	NNS
10_1101-2020_12_31_424971	44	9	of	of	IN
10_1101-2020_12_31_424971	44	10	130	130	CD
10_1101-2020_12_31_424971	44	11	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	44	12	and	and	CC
10_1101-2020_12_31_424971	44	13	ProL	ProL	NNP
10_1101-2020_12_31_424971	44	14	lacking	lack	VBG
10_1101-2020_12_31_424971	44	15	all	all	DT
10_1101-2020_12_31_424971	44	16	post	post	JJ
10_1101-2020_12_31_424971	44	17	-	-	JJ
10_1101-2020_12_31_424971	44	18	transcriptional	transcriptional	JJ
10_1101-2020_12_31_424971	44	19	modifications	modification	NNS
10_1101-2020_12_31_424971	44	20	(	(	-LRB-
10_1101-2020_12_31_424971	44	21	termed	term	VBN
10_1101-2020_12_31_424971	44	22	the	the	DT
10_1101-2020_12_31_424971	44	23	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	44	24	tRNAs	trnas	CD
10_1101-2020_12_31_424971	44	25	)	)	-RRB-
10_1101-2020_12_31_424971	44	26	,	,	,
10_1101-2020_12_31_424971	44	27	or	or	CC
10_1101-2020_12_31_424971	44	28	131	131	CD
10_1101-2020_12_31_424971	44	29	enzymatically	enzymatically	RB
10_1101-2020_12_31_424971	44	30	methylated	methylate	VBN
10_1101-2020_12_31_424971	44	31	with	with	IN
10_1101-2020_12_31_424971	44	32	purified	purify	VBN
10_1101-2020_12_31_424971	44	33	E.	E.	NNP
10_1101-2020_12_31_424971	44	34	coli	coli	NNS
10_1101-2020_12_31_424971	44	35	TrmD30,31	trmd30,31	CD
10_1101-2020_12_31_424971	44	36	such	such	JJ
10_1101-2020_12_31_424971	44	37	that	that	IN
10_1101-2020_12_31_424971	44	38	they	-PRON-	PRP
10_1101-2020_12_31_424971	44	39	possess	possess	VBP
10_1101-2020_12_31_424971	44	40	only	only	RB
10_1101-2020_12_31_424971	44	41	the	the	DT
10_1101-2020_12_31_424971	44	42	N1	N1	NNP
10_1101-2020_12_31_424971	44	43	-	-	HYPH
10_1101-2020_12_31_424971	44	44	132	132	CD
10_1101-2020_12_31_424971	44	45	methylation	methylation	NN
10_1101-2020_12_31_424971	44	46	at	at	IN
10_1101-2020_12_31_424971	44	47	G37	G37	NNP
10_1101-2020_12_31_424971	44	48	and	and	CC
10_1101-2020_12_31_424971	44	49	no	no	DT
10_1101-2020_12_31_424971	44	50	other	other	JJ
10_1101-2020_12_31_424971	44	51	post	post	JJ
10_1101-2020_12_31_424971	44	52	-	-	JJ
10_1101-2020_12_31_424971	44	53	transcriptional	transcriptional	JJ
10_1101-2020_12_31_424971	44	54	modifications	modification	NNS
10_1101-2020_12_31_424971	44	55	(	(	-LRB-
10_1101-2020_12_31_424971	44	56	termed	term	VBN
10_1101-2020_12_31_424971	44	57	the	the	DT
10_1101-2020_12_31_424971	44	58	m1G37-state	m1G37-state	NNP
10_1101-2020_12_31_424971	44	59	133	133	CD
10_1101-2020_12_31_424971	44	60	tRNAs	trnas	CD
10_1101-2020_12_31_424971	44	61	)	)	-RRB-
10_1101-2020_12_31_424971	44	62	.	.	.
10_1101-2020_12_31_424971	45	1	In	in	IN
10_1101-2020_12_31_424971	45	2	the	the	DT
10_1101-2020_12_31_424971	45	3	case	case	NN
10_1101-2020_12_31_424971	45	4	of	of	IN
10_1101-2020_12_31_424971	45	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	45	6	,	,	,
10_1101-2020_12_31_424971	45	7	RNase	RNase	NNP
10_1101-2020_12_31_424971	45	8	T1	T1	NNP
10_1101-2020_12_31_424971	45	9	cleavage	cleavage	NN
10_1101-2020_12_31_424971	45	10	inhibition	inhibition	NN
10_1101-2020_12_31_424971	45	11	assays	assays	RB
10_1101-2020_12_31_424971	45	12	demonstrated	demonstrate	VBD
10_1101-2020_12_31_424971	45	13	cleavage	cleavage	NN
10_1101-2020_12_31_424971	45	14	at	at	IN
10_1101-2020_12_31_424971	45	15	134	134	CD
10_1101-2020_12_31_424971	45	16	G37	G37	NNP
10_1101-2020_12_31_424971	45	17	and	and	CC
10_1101-2020_12_31_424971	45	18	G37a	g37a	NN
10_1101-2020_12_31_424971	45	19	of	of	IN
10_1101-2020_12_31_424971	45	20	the	the	DT
10_1101-2020_12_31_424971	45	21	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	45	22	tRNA	trna	NN
10_1101-2020_12_31_424971	45	23	,	,	,
10_1101-2020_12_31_424971	45	24	but	but	CC
10_1101-2020_12_31_424971	45	25	inhibition	inhibition	NN
10_1101-2020_12_31_424971	45	26	of	of	IN
10_1101-2020_12_31_424971	45	27	cleavage	cleavage	NN
10_1101-2020_12_31_424971	45	28	at	at	IN
10_1101-2020_12_31_424971	45	29	either	either	DT
10_1101-2020_12_31_424971	45	30	position	position	NN
10_1101-2020_12_31_424971	45	31	upon	upon	IN
10_1101-2020_12_31_424971	45	32	treatment	treatment	NN
10_1101-2020_12_31_424971	45	33	135	135	CD
10_1101-2020_12_31_424971	45	34	with	with	IN
10_1101-2020_12_31_424971	45	35	TrmD	TrmD	NNP
10_1101-2020_12_31_424971	45	36	(	(	-LRB-
10_1101-2020_12_31_424971	45	37	Figure	Figure	NNP
10_1101-2020_12_31_424971	45	38	1b	1b	NNP
10_1101-2020_12_31_424971	45	39	)	)	-RRB-
10_1101-2020_12_31_424971	45	40	,	,	,
10_1101-2020_12_31_424971	45	41	indicating	indicate	VBG
10_1101-2020_12_31_424971	45	42	that	that	IN
10_1101-2020_12_31_424971	45	43	both	both	DT
10_1101-2020_12_31_424971	45	44	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	45	45	are	be	VBP
10_1101-2020_12_31_424971	45	46	N1-methylated	n1-methylate	VBN
10_1101-2020_12_31_424971	45	47	in	in	IN
10_1101-2020_12_31_424971	45	48	the	the	DT
10_1101-2020_12_31_424971	45	49	m1G37-state	m1G37-state	NNP
10_1101-2020_12_31_424971	45	50	136	136	CD
10_1101-2020_12_31_424971	45	51	tRNA	trna	NN
10_1101-2020_12_31_424971	45	52	.	.	.
10_1101-2020_12_31_424971	46	1	137	137	CD
10_1101-2020_12_31_424971	46	2	Primer	Primer	NNP
10_1101-2020_12_31_424971	46	3	extension	extension	NN
10_1101-2020_12_31_424971	46	4	inhibition	inhibition	NN
10_1101-2020_12_31_424971	46	5	assays	assays	RB
10_1101-2020_12_31_424971	46	6	,	,	,
10_1101-2020_12_31_424971	46	7	which	which	WDT
10_1101-2020_12_31_424971	46	8	were	be	VBD
10_1101-2020_12_31_424971	46	9	previously	previously	RB
10_1101-2020_12_31_424971	46	10	validated	validate	VBN
10_1101-2020_12_31_424971	46	11	by	by	IN
10_1101-2020_12_31_424971	46	12	mass	mass	NNP
10_1101-2020_12_31_424971	46	13	spectrometry	spectrometry	NNP
10_1101-2020_12_31_424971	46	14	138	138	CD
10_1101-2020_12_31_424971	46	15	analysis30	analysis30	NNS
10_1101-2020_12_31_424971	46	16	,	,	,
10_1101-2020_12_31_424971	46	17	showed	show	VBD
10_1101-2020_12_31_424971	46	18	inhibition	inhibition	NN
10_1101-2020_12_31_424971	46	19	of	of	IN
10_1101-2020_12_31_424971	46	20	extension	extension	NN
10_1101-2020_12_31_424971	46	21	at	at	IN
10_1101-2020_12_31_424971	46	22	G37	G37	NNP
10_1101-2020_12_31_424971	46	23	and	and	CC
10_1101-2020_12_31_424971	46	24	G37a	G37a	NNS
10_1101-2020_12_31_424971	46	25	in	in	IN
10_1101-2020_12_31_424971	46	26	m1G37-	m1g37-	CD
10_1101-2020_12_31_424971	46	27	and	and	CC
10_1101-2020_12_31_424971	46	28	native	native	JJ
10_1101-2020_12_31_424971	46	29	-	-	HYPH
10_1101-2020_12_31_424971	46	30	state	state	NN
10_1101-2020_12_31_424971	46	31	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	46	32	139	139	CD
10_1101-2020_12_31_424971	46	33	(	(	-LRB-
10_1101-2020_12_31_424971	46	34	Figure	Figure	NNP
10_1101-2020_12_31_424971	46	35	1c	1c	NNP
10_1101-2020_12_31_424971	46	36	)	)	-RRB-
10_1101-2020_12_31_424971	46	37	,	,	,
10_1101-2020_12_31_424971	46	38	confirming	confirm	VBG
10_1101-2020_12_31_424971	46	39	that	that	IN
10_1101-2020_12_31_424971	46	40	both	both	DT
10_1101-2020_12_31_424971	46	41	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	46	42	are	be	VBP
10_1101-2020_12_31_424971	46	43	N1-methylated	n1-methylate	VBN
10_1101-2020_12_31_424971	46	44	in	in	IN
10_1101-2020_12_31_424971	46	45	these	these	DT
10_1101-2020_12_31_424971	46	46	species	specie	NNS
10_1101-2020_12_31_424971	46	47	.	.	.
10_1101-2020_12_31_424971	47	1	Notably	notably	RB
10_1101-2020_12_31_424971	47	2	,	,	,
10_1101-2020_12_31_424971	47	3	N1	N1	NNP
10_1101-2020_12_31_424971	47	4	140	140	CD
10_1101-2020_12_31_424971	47	5	methylation	methylation	NN
10_1101-2020_12_31_424971	47	6	shifted	shift	VBD
10_1101-2020_12_31_424971	47	7	almost	almost	RB
10_1101-2020_12_31_424971	47	8	entirely	entirely	RB
10_1101-2020_12_31_424971	47	9	to	to	IN
10_1101-2020_12_31_424971	47	10	G37	G37	NNP
10_1101-2020_12_31_424971	47	11	in	in	IN
10_1101-2020_12_31_424971	47	12	native	native	JJ
10_1101-2020_12_31_424971	47	13	-	-	HYPH
10_1101-2020_12_31_424971	47	14	state	state	NN
10_1101-2020_12_31_424971	47	15	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	47	16	,	,	,
10_1101-2020_12_31_424971	47	17	indicating	indicate	VBG
10_1101-2020_12_31_424971	47	18	that	that	IN
10_1101-2020_12_31_424971	47	19	m1G37	m1g37	NN
10_1101-2020_12_31_424971	47	20	is	be	VBZ
10_1101-2020_12_31_424971	47	21	the	the	DT
10_1101-2020_12_31_424971	47	22	141	141	CD
10_1101-2020_12_31_424971	47	23	dominant	dominant	JJ
10_1101-2020_12_31_424971	47	24	methylation	methylation	NN
10_1101-2020_12_31_424971	47	25	product	product	NN
10_1101-2020_12_31_424971	47	26	in	in	IN
10_1101-2020_12_31_424971	47	27	cells	cell	NNS
10_1101-2020_12_31_424971	47	28	.	.	.
10_1101-2020_12_31_424971	48	1	As	as	IN
10_1101-2020_12_31_424971	48	2	a	a	DT
10_1101-2020_12_31_424971	48	3	control	control	NN
10_1101-2020_12_31_424971	48	4	,	,	,
10_1101-2020_12_31_424971	48	5	no	no	DT
10_1101-2020_12_31_424971	48	6	inhibition	inhibition	NN
10_1101-2020_12_31_424971	48	7	of	of	IN
10_1101-2020_12_31_424971	48	8	extension	extension	NN
10_1101-2020_12_31_424971	48	9	at	at	IN
10_1101-2020_12_31_424971	48	10	G37	G37	NNP
10_1101-2020_12_31_424971	48	11	or	or	CC
10_1101-2020_12_31_424971	48	12	G37a	g37a	NN
10_1101-2020_12_31_424971	48	13	was	be	VBD
10_1101-2020_12_31_424971	48	14	142	142	CD
10_1101-2020_12_31_424971	48	15	observed	observe	VBN
10_1101-2020_12_31_424971	48	16	for	for	IN
10_1101-2020_12_31_424971	48	17	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	48	18	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	48	19	.	.	.
10_1101-2020_12_31_424971	49	1	Complementary	complementary	JJ
10_1101-2020_12_31_424971	49	2	kinetics	kinetics	NN
10_1101-2020_12_31_424971	49	3	experiments	experiment	NNS
10_1101-2020_12_31_424971	49	4	showed	show	VBD
10_1101-2020_12_31_424971	49	5	that	that	IN
10_1101-2020_12_31_424971	49	6	the	the	DT
10_1101-2020_12_31_424971	49	7	yield	yield	NN
10_1101-2020_12_31_424971	49	8	and	and	CC
10_1101-2020_12_31_424971	49	9	143	143	CD
10_1101-2020_12_31_424971	49	10	rate	rate	NN
10_1101-2020_12_31_424971	49	11	of	of	IN
10_1101-2020_12_31_424971	49	12	N1-methylation	n1-methylation	DT
10_1101-2020_12_31_424971	49	13	of	of	IN
10_1101-2020_12_31_424971	49	14	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	49	15	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	49	16	were	be	VBD
10_1101-2020_12_31_424971	49	17	similar	similar	JJ
10_1101-2020_12_31_424971	49	18	to	to	IN
10_1101-2020_12_31_424971	49	19	those	those	DT
10_1101-2020_12_31_424971	49	20	of	of	IN
10_1101-2020_12_31_424971	49	21	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	49	22	ProL	ProL	NNP
10_1101-2020_12_31_424971	49	23	(	(	-LRB-
10_1101-2020_12_31_424971	49	24	Figure	Figure	NNP
10_1101-2020_12_31_424971	49	25	1d	1d	CD
10_1101-2020_12_31_424971	49	26	)	)	-RRB-
10_1101-2020_12_31_424971	49	27	.	.	.
10_1101-2020_12_31_424971	50	1	144	144	CD
10_1101-2020_12_31_424971	50	2	Likewise	likewise	RB
10_1101-2020_12_31_424971	50	3	,	,	,
10_1101-2020_12_31_424971	50	4	kinetics	kinetic	NNS
10_1101-2020_12_31_424971	50	5	experiments	experiment	NNS
10_1101-2020_12_31_424971	50	6	revealed	reveal	VBD
10_1101-2020_12_31_424971	50	7	that	that	IN
10_1101-2020_12_31_424971	50	8	the	the	DT
10_1101-2020_12_31_424971	50	9	yield	yield	NN
10_1101-2020_12_31_424971	50	10	and	and	CC
10_1101-2020_12_31_424971	50	11	rate	rate	NN
10_1101-2020_12_31_424971	50	12	of	of	IN
10_1101-2020_12_31_424971	50	13	aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	50	14	of	of	IN
10_1101-2020_12_31_424971	50	15	native	native	JJ
10_1101-2020_12_31_424971	50	16	-	-	HYPH
10_1101-2020_12_31_424971	50	17	state	state	NN
10_1101-2020_12_31_424971	50	18	145	145	CD
10_1101-2020_12_31_424971	50	19	SufB2	sufb2	NN
10_1101-2020_12_31_424971	50	20	with	with	IN
10_1101-2020_12_31_424971	50	21	Pro	Pro	NNP
10_1101-2020_12_31_424971	50	22	were	be	VBD
10_1101-2020_12_31_424971	50	23	similar	similar	JJ
10_1101-2020_12_31_424971	50	24	to	to	IN
10_1101-2020_12_31_424971	50	25	those	those	DT
10_1101-2020_12_31_424971	50	26	of	of	IN
10_1101-2020_12_31_424971	50	27	native	native	JJ
10_1101-2020_12_31_424971	50	28	-	-	HYPH
10_1101-2020_12_31_424971	50	29	state	state	NN
10_1101-2020_12_31_424971	50	30	ProL	ProL	NNP
10_1101-2020_12_31_424971	50	31	(	(	-LRB-
10_1101-2020_12_31_424971	50	32	Figure	Figure	NNP
10_1101-2020_12_31_424971	50	33	1e	1e	NNP
10_1101-2020_12_31_424971	50	34	)	)	-RRB-
10_1101-2020_12_31_424971	50	35	.	.	.
10_1101-2020_12_31_424971	51	1	In	in	IN
10_1101-2020_12_31_424971	51	2	contrast	contrast	NN
10_1101-2020_12_31_424971	51	3	,	,	,
10_1101-2020_12_31_424971	51	4	aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	51	5	146	146	CD
10_1101-2020_12_31_424971	51	6	of	of	IN
10_1101-2020_12_31_424971	51	7	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	51	8	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	51	9	was	be	VBD
10_1101-2020_12_31_424971	51	10	inhibited	inhibit	VBN
10_1101-2020_12_31_424971	51	11	(	(	-LRB-
10_1101-2020_12_31_424971	51	12	Figure	Figure	NNP
10_1101-2020_12_31_424971	51	13	1f	1f	NNP
10_1101-2020_12_31_424971	51	14	)	)	-RRB-
10_1101-2020_12_31_424971	51	15	.	.	.
10_1101-2020_12_31_424971	52	1	These	these	DT
10_1101-2020_12_31_424971	52	2	results	result	NNS
10_1101-2020_12_31_424971	52	3	demonstrate	demonstrate	VBP
10_1101-2020_12_31_424971	52	4	that	that	IN
10_1101-2020_12_31_424971	52	5	the	the	DT
10_1101-2020_12_31_424971	52	6	native	native	JJ
10_1101-2020_12_31_424971	52	7	-	-	HYPH
10_1101-2020_12_31_424971	52	8	state	state	NN
10_1101-2020_12_31_424971	52	9	147	147	CD
10_1101-2020_12_31_424971	52	10	SufB2	sufb2	NN
10_1101-2020_12_31_424971	52	11	synthesized	synthesize	VBN
10_1101-2020_12_31_424971	52	12	in	in	IN
10_1101-2020_12_31_424971	52	13	cells	cell	NNS
10_1101-2020_12_31_424971	52	14	is	be	VBZ
10_1101-2020_12_31_424971	52	15	quantitatively	quantitatively	RB
10_1101-2020_12_31_424971	52	16	N1-methylated	n1-methylate	VBN
10_1101-2020_12_31_424971	52	17	to	to	TO
10_1101-2020_12_31_424971	52	18	generate	generate	VB
10_1101-2020_12_31_424971	52	19	m1G37	m1G37	NNP
10_1101-2020_12_31_424971	52	20	and	and	CC
10_1101-2020_12_31_424971	52	21	is	be	VBZ
10_1101-2020_12_31_424971	52	22	readily	readily	RB
10_1101-2020_12_31_424971	52	23	148	148	CD
10_1101-2020_12_31_424971	52	24	aminoacylated	aminoacylate	VBN
10_1101-2020_12_31_424971	52	25	with	with	IN
10_1101-2020_12_31_424971	52	26	Pro	Pro	NNP
10_1101-2020_12_31_424971	52	27	.	.	.
10_1101-2020_12_31_424971	53	1	149	149	CD
10_1101-2020_12_31_424971	53	2	150	150	CD
10_1101-2020_12_31_424971	53	3	SufB2	sufb2	NN
10_1101-2020_12_31_424971	53	4	promotes	promote	NNS
10_1101-2020_12_31_424971	53	5	+1	+1	NNS
10_1101-2020_12_31_424971	53	6	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	53	7	using	use	VBG
10_1101-2020_12_31_424971	53	8	triplet	triplet	NN
10_1101-2020_12_31_424971	53	9	-	-	HYPH
10_1101-2020_12_31_424971	53	10	slippage	slippage	NN
10_1101-2020_12_31_424971	53	11	and	and	CC
10_1101-2020_12_31_424971	53	12	possibly	possibly	RB
10_1101-2020_12_31_424971	53	13	other	other	JJ
10_1101-2020_12_31_424971	53	14	mechanisms	mechanism	NNS
10_1101-2020_12_31_424971	53	15	151	151	CD
10_1101-2020_12_31_424971	53	16	.CC	.CC	,
10_1101-2020_12_31_424971	53	17	-	-	:
10_1101-2020_12_31_424971	53	18	BY	by	IN
10_1101-2020_12_31_424971	53	19	-	-	HYPH
10_1101-2020_12_31_424971	53	20	NC	NC	NNP
10_1101-2020_12_31_424971	53	21	-	-	HYPH
10_1101-2020_12_31_424971	53	22	ND	ND	NNP
10_1101-2020_12_31_424971	53	23	4.0	4.0	CD
10_1101-2020_12_31_424971	53	24	International	International	NNP
10_1101-2020_12_31_424971	53	25	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	53	26	under	under	IN
10_1101-2020_12_31_424971	53	27	a	a	DT
10_1101-2020_12_31_424971	53	28	(	(	-LRB-
10_1101-2020_12_31_424971	53	29	which	which	WDT
10_1101-2020_12_31_424971	53	30	was	be	VBD
10_1101-2020_12_31_424971	53	31	not	not	RB
10_1101-2020_12_31_424971	53	32	certified	certify	VBN
10_1101-2020_12_31_424971	53	33	by	by	IN
10_1101-2020_12_31_424971	53	34	peer	peer	NN
10_1101-2020_12_31_424971	53	35	review	review	NN
10_1101-2020_12_31_424971	53	36	)	)	-RRB-
10_1101-2020_12_31_424971	53	37	is	be	VBZ
10_1101-2020_12_31_424971	53	38	the	the	DT
10_1101-2020_12_31_424971	53	39	author	author	NN
10_1101-2020_12_31_424971	53	40	/	/	SYM
10_1101-2020_12_31_424971	53	41	funder	funder	NN
10_1101-2020_12_31_424971	53	42	,	,	,
10_1101-2020_12_31_424971	53	43	who	who	WP
10_1101-2020_12_31_424971	53	44	has	have	VBZ
10_1101-2020_12_31_424971	53	45	granted	grant	VBN
10_1101-2020_12_31_424971	53	46	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	53	47	a	a	DT
10_1101-2020_12_31_424971	53	48	license	license	NN
10_1101-2020_12_31_424971	53	49	to	to	TO
10_1101-2020_12_31_424971	53	50	display	display	VB
10_1101-2020_12_31_424971	53	51	the	the	DT
10_1101-2020_12_31_424971	53	52	preprint	preprint	NN
10_1101-2020_12_31_424971	53	53	in	in	IN
10_1101-2020_12_31_424971	53	54	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	53	55	.	.	.
10_1101-2020_12_31_424971	54	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	54	2	is	be	VBZ
10_1101-2020_12_31_424971	54	3	made	make	VBN
10_1101-2020_12_31_424971	54	4	The	the	DT
10_1101-2020_12_31_424971	54	5	copyright	copyright	NN
10_1101-2020_12_31_424971	54	6	holder	holder	NN
10_1101-2020_12_31_424971	54	7	for	for	IN
10_1101-2020_12_31_424971	54	8	this	this	DT
10_1101-2020_12_31_424971	54	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	54	10	version	version	NN
10_1101-2020_12_31_424971	54	11	posted	post	VBD
10_1101-2020_12_31_424971	54	12	January	January	NNP
10_1101-2020_12_31_424971	54	13	2	2	CD
10_1101-2020_12_31_424971	54	14	,	,	,
10_1101-2020_12_31_424971	54	15	2021	2021	CD
10_1101-2020_12_31_424971	54	16	.	.	.
10_1101-2020_12_31_424971	54	17	;	;	:
10_1101-2020_12_31_424971	54	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	54	19	:	:	:
10_1101-2020_12_31_424971	54	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	54	21	preprint	preprint	NN
10_1101-2020_12_31_424971	54	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	54	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	54	24	7	7	CD
10_1101-2020_12_31_424971	54	25	We	-PRON-	PRP
10_1101-2020_12_31_424971	54	26	next	next	RB
10_1101-2020_12_31_424971	54	27	determined	determine	VBD
10_1101-2020_12_31_424971	54	28	the	the	DT
10_1101-2020_12_31_424971	54	29	mechanism(s	mechanism(s	NNP
10_1101-2020_12_31_424971	54	30	)	)	-RRB-
10_1101-2020_12_31_424971	54	31	through	through	IN
10_1101-2020_12_31_424971	54	32	which	which	WDT
10_1101-2020_12_31_424971	54	33	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	54	34	promotes	promote	VBZ
10_1101-2020_12_31_424971	54	35	+1	+1	NNS
10_1101-2020_12_31_424971	54	36	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	54	37	in	in	IN
10_1101-2020_12_31_424971	54	38	a	a	DT
10_1101-2020_12_31_424971	54	39	152	152	CD
10_1101-2020_12_31_424971	54	40	cellular	cellular	JJ
10_1101-2020_12_31_424971	54	41	context	context	NN
10_1101-2020_12_31_424971	54	42	.	.	.
10_1101-2020_12_31_424971	55	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	55	2	created	create	VBD
10_1101-2020_12_31_424971	55	3	a	a	DT
10_1101-2020_12_31_424971	55	4	pair	pair	NN
10_1101-2020_12_31_424971	55	5	of	of	IN
10_1101-2020_12_31_424971	55	6	isogenic	isogenic	JJ
10_1101-2020_12_31_424971	55	7	E.	E.	NNP
10_1101-2020_12_31_424971	55	8	coli	coli	NNS
10_1101-2020_12_31_424971	55	9	strains	strain	NNS
10_1101-2020_12_31_424971	55	10	expressing	express	VBG
10_1101-2020_12_31_424971	55	11	SufB2	sufb2	NN
10_1101-2020_12_31_424971	55	12	or	or	CC
10_1101-2020_12_31_424971	55	13	ProL	ProL	NNP
10_1101-2020_12_31_424971	55	14	from	from	IN
10_1101-2020_12_31_424971	55	15	the	the	DT
10_1101-2020_12_31_424971	55	16	153	153	CD
10_1101-2020_12_31_424971	55	17	chromosome	chromosome	NN
10_1101-2020_12_31_424971	55	18	in	in	IN
10_1101-2020_12_31_424971	55	19	a	a	DT
10_1101-2020_12_31_424971	55	20	trmD	trmd	CD
10_1101-2020_12_31_424971	55	21	-	-	HYPH
10_1101-2020_12_31_424971	55	22	knockdown	knockdown	VBN
10_1101-2020_12_31_424971	55	23	(	(	-LRB-
10_1101-2020_12_31_424971	55	24	trmD	trmD	NNP
10_1101-2020_12_31_424971	55	25	-	-	HYPH
10_1101-2020_12_31_424971	55	26	KD	KD	NNP
10_1101-2020_12_31_424971	55	27	)	)	-RRB-
10_1101-2020_12_31_424971	55	28	background30	background30	VBZ
10_1101-2020_12_31_424971	55	29	.	.	.
10_1101-2020_12_31_424971	56	1	This	this	DT
10_1101-2020_12_31_424971	56	2	background	background	NN
10_1101-2020_12_31_424971	56	3	strain	strain	NN
10_1101-2020_12_31_424971	56	4	was	be	VBD
10_1101-2020_12_31_424971	56	5	154	154	CD
10_1101-2020_12_31_424971	56	6	designed	design	VBN
10_1101-2020_12_31_424971	56	7	to	to	TO
10_1101-2020_12_31_424971	56	8	evaluate	evaluate	VB
10_1101-2020_12_31_424971	56	9	the	the	DT
10_1101-2020_12_31_424971	56	10	effect	effect	NN
10_1101-2020_12_31_424971	56	11	of	of	IN
10_1101-2020_12_31_424971	56	12	m1G37	m1g37	NN
10_1101-2020_12_31_424971	56	13	on	on	IN
10_1101-2020_12_31_424971	56	14	+1	+1	NNS
10_1101-2020_12_31_424971	56	15	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	56	16	and	and	CC
10_1101-2020_12_31_424971	56	17	it	-PRON-	PRP
10_1101-2020_12_31_424971	56	18	was	be	VBD
10_1101-2020_12_31_424971	56	19	generated	generate	VBN
10_1101-2020_12_31_424971	56	20	by	by	IN
10_1101-2020_12_31_424971	56	21	deleting	delete	VBG
10_1101-2020_12_31_424971	56	22	155	155	CD
10_1101-2020_12_31_424971	56	23	chromosomal	chromosomal	JJ
10_1101-2020_12_31_424971	56	24	trmD	trmD	NNS
10_1101-2020_12_31_424971	56	25	and	and	CC
10_1101-2020_12_31_424971	56	26	controlling	control	VBG
10_1101-2020_12_31_424971	56	27	cellular	cellular	JJ
10_1101-2020_12_31_424971	56	28	levels	level	NNS
10_1101-2020_12_31_424971	56	29	of	of	IN
10_1101-2020_12_31_424971	56	30	m1G37	m1g37	NN
10_1101-2020_12_31_424971	56	31	using	use	VBG
10_1101-2020_12_31_424971	56	32	arabinose	arabinose	RB
10_1101-2020_12_31_424971	56	33	-	-	HYPH
10_1101-2020_12_31_424971	56	34	induced	induce	VBN
10_1101-2020_12_31_424971	56	35	expression	expression	NN
10_1101-2020_12_31_424971	56	36	156	156	CD
10_1101-2020_12_31_424971	56	37	of	of	IN
10_1101-2020_12_31_424971	56	38	the	the	DT
10_1101-2020_12_31_424971	56	39	human	human	JJ
10_1101-2020_12_31_424971	56	40	counterpart	counterpart	NN
10_1101-2020_12_31_424971	56	41	trm5	trm5	NN
10_1101-2020_12_31_424971	56	42	,	,	,
10_1101-2020_12_31_424971	56	43	which	which	WDT
10_1101-2020_12_31_424971	56	44	is	be	VBZ
10_1101-2020_12_31_424971	56	45	competent	competent	JJ
10_1101-2020_12_31_424971	56	46	to	to	TO
10_1101-2020_12_31_424971	56	47	stoichiometrically	stoichiometrically	RB
10_1101-2020_12_31_424971	56	48	N1-methylate	n1-methylate	VB
10_1101-2020_12_31_424971	56	49	intracellular	intracellular	JJ
10_1101-2020_12_31_424971	56	50	157	157	CD
10_1101-2020_12_31_424971	56	51	tRNA	trna	NN
10_1101-2020_12_31_424971	56	52	substrates30	substrates30	NNS
10_1101-2020_12_31_424971	56	53	.	.	.
10_1101-2020_12_31_424971	57	1	The	the	DT
10_1101-2020_12_31_424971	57	2	isogenic	isogenic	JJ
10_1101-2020_12_31_424971	57	3	pair	pair	NN
10_1101-2020_12_31_424971	57	4	of	of	IN
10_1101-2020_12_31_424971	57	5	the	the	DT
10_1101-2020_12_31_424971	57	6	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	57	7	and	and	CC
10_1101-2020_12_31_424971	57	8	ProL	ProL	NNP
10_1101-2020_12_31_424971	57	9	strains	strain	NNS
10_1101-2020_12_31_424971	57	10	were	be	VBD
10_1101-2020_12_31_424971	57	11	measured	measure	VBN
10_1101-2020_12_31_424971	57	12	for	for	IN
10_1101-2020_12_31_424971	57	13	+1	+1	NNS
10_1101-2020_12_31_424971	57	14	158	158	CD
10_1101-2020_12_31_424971	57	15	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	57	16	in	in	IN
10_1101-2020_12_31_424971	57	17	a	a	DT
10_1101-2020_12_31_424971	57	18	cell	cell	NN
10_1101-2020_12_31_424971	57	19	-	-	HYPH
10_1101-2020_12_31_424971	57	20	based	base	VBN
10_1101-2020_12_31_424971	57	21	lacZ	lacz	JJ
10_1101-2020_12_31_424971	57	22	reporter	reporter	NN
10_1101-2020_12_31_424971	57	23	assay	assay	NN
10_1101-2020_12_31_424971	57	24	in	in	IN
10_1101-2020_12_31_424971	57	25	which	which	WDT
10_1101-2020_12_31_424971	57	26	a	a	DT
10_1101-2020_12_31_424971	57	27	CCC	CCC	NNP
10_1101-2020_12_31_424971	57	28	-	-	HYPH
10_1101-2020_12_31_424971	57	29	C	C	NNP
10_1101-2020_12_31_424971	57	30	motif	motif	NN
10_1101-2020_12_31_424971	57	31	was	be	VBD
10_1101-2020_12_31_424971	57	32	inserted	insert	VBN
10_1101-2020_12_31_424971	57	33	into	into	IN
10_1101-2020_12_31_424971	57	34	the	the	DT
10_1101-2020_12_31_424971	57	35	2nd	2nd	JJ
10_1101-2020_12_31_424971	57	36	159	159	CD
10_1101-2020_12_31_424971	57	37	codon	codon	NN
10_1101-2020_12_31_424971	57	38	position	position	NN
10_1101-2020_12_31_424971	57	39	of	of	IN
10_1101-2020_12_31_424971	57	40	lacZ	lacZ	,
10_1101-2020_12_31_424971	57	41	such	such	JJ
10_1101-2020_12_31_424971	57	42	that	that	IN
10_1101-2020_12_31_424971	57	43	a	a	DT
10_1101-2020_12_31_424971	57	44	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	57	45	event	event	NN
10_1101-2020_12_31_424971	57	46	at	at	IN
10_1101-2020_12_31_424971	57	47	the	the	DT
10_1101-2020_12_31_424971	57	48	motif	motif	NN
10_1101-2020_12_31_424971	57	49	was	be	VBD
10_1101-2020_12_31_424971	57	50	necessary	necessary	JJ
10_1101-2020_12_31_424971	57	51	to	to	TO
10_1101-2020_12_31_424971	57	52	synthesize	synthesize	VB
10_1101-2020_12_31_424971	57	53	160	160	CD
10_1101-2020_12_31_424971	57	54	full	full	JJ
10_1101-2020_12_31_424971	57	55	-	-	HYPH
10_1101-2020_12_31_424971	57	56	length	length	NN
10_1101-2020_12_31_424971	57	57	b	b	NN
10_1101-2020_12_31_424971	57	58	-	-	HYPH
10_1101-2020_12_31_424971	57	59	galactosidase	galactosidase	NN
10_1101-2020_12_31_424971	57	60	(	(	-LRB-
10_1101-2020_12_31_424971	57	61	b	b	NNP
10_1101-2020_12_31_424971	57	62	-	-	HYPH
10_1101-2020_12_31_424971	57	63	Gal)29	Gal)29	NNP
10_1101-2020_12_31_424971	57	64	.	.	.
10_1101-2020_12_31_424971	58	1	The	the	DT
10_1101-2020_12_31_424971	58	2	efficiency	efficiency	NN
10_1101-2020_12_31_424971	58	3	of	of	IN
10_1101-2020_12_31_424971	58	4	+1	+1	NNS
10_1101-2020_12_31_424971	58	5	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	58	6	was	be	VBD
10_1101-2020_12_31_424971	58	7	calculated	calculate	VBN
10_1101-2020_12_31_424971	58	8	as	as	IN
10_1101-2020_12_31_424971	58	9	the	the	DT
10_1101-2020_12_31_424971	58	10	ratio	ratio	NN
10_1101-2020_12_31_424971	58	11	161	161	CD
10_1101-2020_12_31_424971	58	12	of	of	IN
10_1101-2020_12_31_424971	58	13	b	b	NN
10_1101-2020_12_31_424971	58	14	-	-	:
10_1101-2020_12_31_424971	58	15	Gal	Gal	NNP
10_1101-2020_12_31_424971	58	16	expressed	express	VBD
10_1101-2020_12_31_424971	58	17	in	in	IN
10_1101-2020_12_31_424971	58	18	cells	cell	NNS
10_1101-2020_12_31_424971	58	19	containing	contain	VBG
10_1101-2020_12_31_424971	58	20	the	the	DT
10_1101-2020_12_31_424971	58	21	CCC	CCC	NNP
10_1101-2020_12_31_424971	58	22	-	-	HYPH
10_1101-2020_12_31_424971	58	23	C	C	NNP
10_1101-2020_12_31_424971	58	24	insertion	insertion	NN
10_1101-2020_12_31_424971	58	25	relative	relative	JJ
10_1101-2020_12_31_424971	58	26	to	to	IN
10_1101-2020_12_31_424971	58	27	cells	cell	NNS
10_1101-2020_12_31_424971	58	28	containing	contain	VBG
10_1101-2020_12_31_424971	58	29	an	an	DT
10_1101-2020_12_31_424971	58	30	in	in	IN
10_1101-2020_12_31_424971	58	31	-	-	HYPH
10_1101-2020_12_31_424971	58	32	frame	frame	NN
10_1101-2020_12_31_424971	58	33	162	162	CD
10_1101-2020_12_31_424971	58	34	CCC	CCC	NNP
10_1101-2020_12_31_424971	58	35	insertion	insertion	NN
10_1101-2020_12_31_424971	58	36	.	.	.
10_1101-2020_12_31_424971	59	1	163	163	CD
10_1101-2020_12_31_424971	59	2	In	in	IN
10_1101-2020_12_31_424971	59	3	the	the	DT
10_1101-2020_12_31_424971	59	4	m1G37-abundant	m1G37-abundant	''
10_1101-2020_12_31_424971	59	5	(	(	-LRB-
10_1101-2020_12_31_424971	59	6	m1G37	m1G37	NNP
10_1101-2020_12_31_424971	59	7	+	+	SYM
10_1101-2020_12_31_424971	59	8	)	)	-RRB-
10_1101-2020_12_31_424971	59	9	condition	condition	NN
10_1101-2020_12_31_424971	59	10	,	,	,
10_1101-2020_12_31_424971	59	11	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	59	12	displayed	display	VBD
10_1101-2020_12_31_424971	59	13	a	a	DT
10_1101-2020_12_31_424971	59	14	high	high	JJ
10_1101-2020_12_31_424971	59	15	+1-frameshifting	+1-frameshifting	PRP$
10_1101-2020_12_31_424971	59	16	164	164	CD
10_1101-2020_12_31_424971	59	17	efficiency	efficiency	NN
10_1101-2020_12_31_424971	59	18	(	(	-LRB-
10_1101-2020_12_31_424971	59	19	8.2	8.2	CD
10_1101-2020_12_31_424971	59	20	%	%	NN
10_1101-2020_12_31_424971	59	21	,	,	,
10_1101-2020_12_31_424971	59	22	Figure	Figure	NNP
10_1101-2020_12_31_424971	59	23	2a	2a	CD
10_1101-2020_12_31_424971	59	24	)	)	-RRB-
10_1101-2020_12_31_424971	59	25	relative	relative	JJ
10_1101-2020_12_31_424971	59	26	to	to	IN
10_1101-2020_12_31_424971	59	27	ProL	ProL	NNP
10_1101-2020_12_31_424971	59	28	(	(	-LRB-
10_1101-2020_12_31_424971	59	29	1.4	1.4	CD
10_1101-2020_12_31_424971	59	30	%	%	NN
10_1101-2020_12_31_424971	59	31	)	)	-RRB-
10_1101-2020_12_31_424971	59	32	.	.	.
10_1101-2020_12_31_424971	60	1	In	in	IN
10_1101-2020_12_31_424971	60	2	the	the	DT
10_1101-2020_12_31_424971	60	3	m1G37-deficient	m1G37-deficient	,
10_1101-2020_12_31_424971	60	4	(	(	-LRB-
10_1101-2020_12_31_424971	60	5	m1G37	m1G37	NNP
10_1101-2020_12_31_424971	60	6	–	–	:
10_1101-2020_12_31_424971	60	7	)	)	-RRB-
10_1101-2020_12_31_424971	60	8	condition	condition	NN
10_1101-2020_12_31_424971	60	9	,	,	,
10_1101-2020_12_31_424971	60	10	165	165	CD
10_1101-2020_12_31_424971	60	11	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	60	12	exhibited	exhibit	VBD
10_1101-2020_12_31_424971	60	13	an	an	DT
10_1101-2020_12_31_424971	60	14	even	even	RB
10_1101-2020_12_31_424971	60	15	higher	high	JJR
10_1101-2020_12_31_424971	60	16	efficiency	efficiency	NN
10_1101-2020_12_31_424971	60	17	(	(	-LRB-
10_1101-2020_12_31_424971	60	18	20.8	20.8	CD
10_1101-2020_12_31_424971	60	19	%	%	NN
10_1101-2020_12_31_424971	60	20	)	)	-RRB-
10_1101-2020_12_31_424971	60	21	and	and	CC
10_1101-2020_12_31_424971	60	22	,	,	,
10_1101-2020_12_31_424971	60	23	consistent	consistent	JJ
10_1101-2020_12_31_424971	60	24	with	with	IN
10_1101-2020_12_31_424971	60	25	our	-PRON-	PRP$
10_1101-2020_12_31_424971	60	26	previous	previous	JJ
10_1101-2020_12_31_424971	60	27	work29	work29	NNS
10_1101-2020_12_31_424971	60	28	,	,	,
10_1101-2020_12_31_424971	60	29	ProL	ProL	NNP
10_1101-2020_12_31_424971	60	30	166	166	CD
10_1101-2020_12_31_424971	60	31	also	also	RB
10_1101-2020_12_31_424971	60	32	displayed	display	VBD
10_1101-2020_12_31_424971	60	33	an	an	DT
10_1101-2020_12_31_424971	60	34	increased	increase	VBN
10_1101-2020_12_31_424971	60	35	efficiency	efficiency	NN
10_1101-2020_12_31_424971	60	36	(	(	-LRB-
10_1101-2020_12_31_424971	60	37	7.0	7.0	CD
10_1101-2020_12_31_424971	60	38	%	%	NN
10_1101-2020_12_31_424971	60	39	)	)	-RRB-
10_1101-2020_12_31_424971	60	40	relative	relative	JJ
10_1101-2020_12_31_424971	60	41	to	to	IN
10_1101-2020_12_31_424971	60	42	background	background	NN
10_1101-2020_12_31_424971	60	43	(	(	-LRB-
10_1101-2020_12_31_424971	60	44	1.4	1.4	CD
10_1101-2020_12_31_424971	60	45	%	%	NN
10_1101-2020_12_31_424971	60	46	)	)	-RRB-
10_1101-2020_12_31_424971	60	47	.	.	.
10_1101-2020_12_31_424971	61	1	Because	because	IN
10_1101-2020_12_31_424971	61	2	N1	N1	NNP
10_1101-2020_12_31_424971	61	3	-	-	HYPH
10_1101-2020_12_31_424971	61	4	167	167	CD
10_1101-2020_12_31_424971	61	5	methylation	methylation	NN
10_1101-2020_12_31_424971	61	6	in	in	IN
10_1101-2020_12_31_424971	61	7	the	the	DT
10_1101-2020_12_31_424971	61	8	m1G37	m1g37	NN
10_1101-2020_12_31_424971	61	9	+	+	SYM
10_1101-2020_12_31_424971	61	10	condition	condition	NN
10_1101-2020_12_31_424971	61	11	was	be	VBD
10_1101-2020_12_31_424971	61	12	stoichiometric	stoichiometric	JJ
10_1101-2020_12_31_424971	61	13	(	(	-LRB-
10_1101-2020_12_31_424971	61	14	Figure	Figure	NNP
10_1101-2020_12_31_424971	61	15	1c	1c	NNP
10_1101-2020_12_31_424971	61	16	)	)	-RRB-
10_1101-2020_12_31_424971	61	17	,	,	,
10_1101-2020_12_31_424971	61	18	thereby	thereby	RB
10_1101-2020_12_31_424971	61	19	preventing	prevent	VBG
10_1101-2020_12_31_424971	61	20	168	168	CD
10_1101-2020_12_31_424971	61	21	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	61	22	-	-	HYPH
10_1101-2020_12_31_424971	61	23	pairing	pair	VBG
10_1101-2020_12_31_424971	61	24	,	,	,
10_1101-2020_12_31_424971	61	25	we	-PRON-	PRP
10_1101-2020_12_31_424971	61	26	attribute	attribute	VBP
10_1101-2020_12_31_424971	61	27	the	the	DT
10_1101-2020_12_31_424971	61	28	8.2	8.2	CD
10_1101-2020_12_31_424971	61	29	%	%	NN
10_1101-2020_12_31_424971	61	30	efficiency	efficiency	NN
10_1101-2020_12_31_424971	61	31	of	of	IN
10_1101-2020_12_31_424971	61	32	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	61	33	in	in	IN
10_1101-2020_12_31_424971	61	34	this	this	DT
10_1101-2020_12_31_424971	61	35	condition	condition	NN
10_1101-2020_12_31_424971	61	36	as	as	IN
10_1101-2020_12_31_424971	61	37	arising	arise	VBG
10_1101-2020_12_31_424971	61	38	exclusively	exclusively	RB
10_1101-2020_12_31_424971	61	39	169	169	CD
10_1101-2020_12_31_424971	61	40	from	from	IN
10_1101-2020_12_31_424971	61	41	triplet	triplet	NN
10_1101-2020_12_31_424971	61	42	-	-	HYPH
10_1101-2020_12_31_424971	61	43	slippage	slippage	NN
10_1101-2020_12_31_424971	61	44	.	.	.
10_1101-2020_12_31_424971	62	1	In	in	IN
10_1101-2020_12_31_424971	62	2	the	the	DT
10_1101-2020_12_31_424971	62	3	m1G37	m1g37	NN
10_1101-2020_12_31_424971	62	4	–	–	:
10_1101-2020_12_31_424971	62	5	condition	condition	NN
10_1101-2020_12_31_424971	62	6	,	,	,
10_1101-2020_12_31_424971	62	7	we	-PRON-	PRP
10_1101-2020_12_31_424971	62	8	observed	observe	VBD
10_1101-2020_12_31_424971	62	9	an	an	DT
10_1101-2020_12_31_424971	62	10	increase	increase	NN
10_1101-2020_12_31_424971	62	11	in	in	IN
10_1101-2020_12_31_424971	62	12	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	62	13	170	170	CD
10_1101-2020_12_31_424971	62	14	efficiency	efficiency	NN
10_1101-2020_12_31_424971	62	15	of	of	IN
10_1101-2020_12_31_424971	62	16	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	62	17	to	to	IN
10_1101-2020_12_31_424971	62	18	20.8	20.8	CD
10_1101-2020_12_31_424971	62	19	%	%	NN
10_1101-2020_12_31_424971	62	20	.	.	.
10_1101-2020_12_31_424971	63	1	While	while	IN
10_1101-2020_12_31_424971	63	2	multiple	multiple	JJ
10_1101-2020_12_31_424971	63	3	mechanisms	mechanism	NNS
10_1101-2020_12_31_424971	63	4	may	may	MD
10_1101-2020_12_31_424971	63	5	exist	exist	VB
10_1101-2020_12_31_424971	63	6	for	for	IN
10_1101-2020_12_31_424971	63	7	the	the	DT
10_1101-2020_12_31_424971	63	8	increased	increase	VBN
10_1101-2020_12_31_424971	63	9	+1	+1	NNP
10_1101-2020_12_31_424971	63	10	171	171	CD
10_1101-2020_12_31_424971	63	11	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	63	12	,	,	,
10_1101-2020_12_31_424971	63	13	the	the	DT
10_1101-2020_12_31_424971	63	14	exploration	exploration	NN
10_1101-2020_12_31_424971	63	15	of	of	IN
10_1101-2020_12_31_424971	63	16	both	both	CC
10_1101-2020_12_31_424971	63	17	triplet	triplet	NN
10_1101-2020_12_31_424971	63	18	-	-	HYPH
10_1101-2020_12_31_424971	63	19	slippage	slippage	NN
10_1101-2020_12_31_424971	63	20	and	and	CC
10_1101-2020_12_31_424971	63	21	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	63	22	-	-	HYPH
10_1101-2020_12_31_424971	63	23	pairing	pairing	NN
10_1101-2020_12_31_424971	63	24	is	be	VBZ
10_1101-2020_12_31_424971	63	25	one	one	CD
10_1101-2020_12_31_424971	63	26	possibility	possibility	NN
10_1101-2020_12_31_424971	63	27	.	.	.
10_1101-2020_12_31_424971	64	1	172	172	CD
10_1101-2020_12_31_424971	64	2	To	to	TO
10_1101-2020_12_31_424971	64	3	confirm	confirm	VB
10_1101-2020_12_31_424971	64	4	our	-PRON-	PRP$
10_1101-2020_12_31_424971	64	5	results	result	NNS
10_1101-2020_12_31_424971	64	6	,	,	,
10_1101-2020_12_31_424971	64	7	we	-PRON-	PRP
10_1101-2020_12_31_424971	64	8	performed	perform	VBD
10_1101-2020_12_31_424971	64	9	similar	similar	JJ
10_1101-2020_12_31_424971	64	10	studies	study	NNS
10_1101-2020_12_31_424971	64	11	with	with	IN
10_1101-2020_12_31_424971	64	12	the	the	DT
10_1101-2020_12_31_424971	64	13	isogenic	isogenic	JJ
10_1101-2020_12_31_424971	64	14	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	64	15	and	and	CC
10_1101-2020_12_31_424971	64	16	ProL	ProL	NNP
10_1101-2020_12_31_424971	64	17	strains	strain	VBZ
10_1101-2020_12_31_424971	64	18	173	173	CD
10_1101-2020_12_31_424971	64	19	on	on	IN
10_1101-2020_12_31_424971	64	20	the	the	DT
10_1101-2020_12_31_424971	64	21	endogenous	endogenous	JJ
10_1101-2020_12_31_424971	64	22	E.	E.	NNP
10_1101-2020_12_31_424971	64	23	coli	coli	NNS
10_1101-2020_12_31_424971	64	24	lolB	lolb	NN
10_1101-2020_12_31_424971	64	25	gene	gene	NN
10_1101-2020_12_31_424971	64	26	,	,	,
10_1101-2020_12_31_424971	64	27	encoding	encode	VBG
10_1101-2020_12_31_424971	64	28	the	the	DT
10_1101-2020_12_31_424971	64	29	outer	outer	JJ
10_1101-2020_12_31_424971	64	30	membrane	membrane	NN
10_1101-2020_12_31_424971	64	31	lipoprotein	lipoprotein	NN
10_1101-2020_12_31_424971	64	32	.	.	.
10_1101-2020_12_31_424971	65	1	The	the	DT
10_1101-2020_12_31_424971	65	2	lolB	lolB	NNP
10_1101-2020_12_31_424971	65	3	gene	gene	NN
10_1101-2020_12_31_424971	65	4	174	174	CD
10_1101-2020_12_31_424971	65	5	naturally	naturally	RB
10_1101-2020_12_31_424971	65	6	contains	contain	VBZ
10_1101-2020_12_31_424971	65	7	a	a	DT
10_1101-2020_12_31_424971	65	8	CCC	CCC	NNP
10_1101-2020_12_31_424971	65	9	-	-	HYPH
10_1101-2020_12_31_424971	65	10	C	C	NNP
10_1101-2020_12_31_424971	65	11	motif	motif	NN
10_1101-2020_12_31_424971	65	12	at	at	IN
10_1101-2020_12_31_424971	65	13	the	the	DT
10_1101-2020_12_31_424971	65	14	2nd	2nd	JJ
10_1101-2020_12_31_424971	65	15	codon	codon	NN
10_1101-2020_12_31_424971	65	16	position	position	NN
10_1101-2020_12_31_424971	65	17	such	such	JJ
10_1101-2020_12_31_424971	65	18	that	that	IN
10_1101-2020_12_31_424971	65	19	+1	+1	NNS
10_1101-2020_12_31_424971	65	20	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	65	21	at	at	IN
10_1101-2020_12_31_424971	65	22	this	this	DT
10_1101-2020_12_31_424971	65	23	motif	motif	NN
10_1101-2020_12_31_424971	65	24	175	175	CD
10_1101-2020_12_31_424971	65	25	would	would	MD
10_1101-2020_12_31_424971	65	26	decrease	decrease	VB
10_1101-2020_12_31_424971	65	27	protein	protein	NN
10_1101-2020_12_31_424971	65	28	synthesis	synthesis	NN
10_1101-2020_12_31_424971	65	29	due	due	JJ
10_1101-2020_12_31_424971	65	30	to	to	IN
10_1101-2020_12_31_424971	65	31	premature	premature	JJ
10_1101-2020_12_31_424971	65	32	termination	termination	NN
10_1101-2020_12_31_424971	65	33	.	.	.
10_1101-2020_12_31_424971	66	1	As	as	IN
10_1101-2020_12_31_424971	66	2	a	a	DT
10_1101-2020_12_31_424971	66	3	reference	reference	NN
10_1101-2020_12_31_424971	66	4	,	,	,
10_1101-2020_12_31_424971	66	5	we	-PRON-	PRP
10_1101-2020_12_31_424971	66	6	used	use	VBD
10_1101-2020_12_31_424971	66	7	E.	E.	NNP
10_1101-2020_12_31_424971	66	8	coli	coli	VBZ
10_1101-2020_12_31_424971	66	9	176	176	CD
10_1101-2020_12_31_424971	66	10	.CC	.CC	:
10_1101-2020_12_31_424971	66	11	-	-	HYPH
10_1101-2020_12_31_424971	66	12	BY	by	IN
10_1101-2020_12_31_424971	66	13	-	-	HYPH
10_1101-2020_12_31_424971	66	14	NC	NC	NNP
10_1101-2020_12_31_424971	66	15	-	-	HYPH
10_1101-2020_12_31_424971	66	16	ND	ND	NNP
10_1101-2020_12_31_424971	66	17	4.0	4.0	CD
10_1101-2020_12_31_424971	66	18	International	International	NNP
10_1101-2020_12_31_424971	66	19	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	66	20	under	under	IN
10_1101-2020_12_31_424971	66	21	a	a	DT
10_1101-2020_12_31_424971	66	22	(	(	-LRB-
10_1101-2020_12_31_424971	66	23	which	which	WDT
10_1101-2020_12_31_424971	66	24	was	be	VBD
10_1101-2020_12_31_424971	66	25	not	not	RB
10_1101-2020_12_31_424971	66	26	certified	certify	VBN
10_1101-2020_12_31_424971	66	27	by	by	IN
10_1101-2020_12_31_424971	66	28	peer	peer	NN
10_1101-2020_12_31_424971	66	29	review	review	NN
10_1101-2020_12_31_424971	66	30	)	)	-RRB-
10_1101-2020_12_31_424971	66	31	is	be	VBZ
10_1101-2020_12_31_424971	66	32	the	the	DT
10_1101-2020_12_31_424971	66	33	author	author	NN
10_1101-2020_12_31_424971	66	34	/	/	SYM
10_1101-2020_12_31_424971	66	35	funder	funder	NN
10_1101-2020_12_31_424971	66	36	,	,	,
10_1101-2020_12_31_424971	66	37	who	who	WP
10_1101-2020_12_31_424971	66	38	has	have	VBZ
10_1101-2020_12_31_424971	66	39	granted	grant	VBN
10_1101-2020_12_31_424971	66	40	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	66	41	a	a	DT
10_1101-2020_12_31_424971	66	42	license	license	NN
10_1101-2020_12_31_424971	66	43	to	to	TO
10_1101-2020_12_31_424971	66	44	display	display	VB
10_1101-2020_12_31_424971	66	45	the	the	DT
10_1101-2020_12_31_424971	66	46	preprint	preprint	NN
10_1101-2020_12_31_424971	66	47	in	in	IN
10_1101-2020_12_31_424971	66	48	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	66	49	.	.	.
10_1101-2020_12_31_424971	67	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	67	2	is	be	VBZ
10_1101-2020_12_31_424971	67	3	made	make	VBN
10_1101-2020_12_31_424971	67	4	The	the	DT
10_1101-2020_12_31_424971	67	5	copyright	copyright	NN
10_1101-2020_12_31_424971	67	6	holder	holder	NN
10_1101-2020_12_31_424971	67	7	for	for	IN
10_1101-2020_12_31_424971	67	8	this	this	DT
10_1101-2020_12_31_424971	67	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	67	10	version	version	NN
10_1101-2020_12_31_424971	67	11	posted	post	VBD
10_1101-2020_12_31_424971	67	12	January	January	NNP
10_1101-2020_12_31_424971	67	13	2	2	CD
10_1101-2020_12_31_424971	67	14	,	,	,
10_1101-2020_12_31_424971	67	15	2021	2021	CD
10_1101-2020_12_31_424971	67	16	.	.	.
10_1101-2020_12_31_424971	67	17	;	;	:
10_1101-2020_12_31_424971	67	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	67	19	:	:	:
10_1101-2020_12_31_424971	67	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	67	21	preprint	preprint	NN
10_1101-2020_12_31_424971	67	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	67	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	67	24	8	8	CD
10_1101-2020_12_31_424971	67	25	cysS	cys	NNS
10_1101-2020_12_31_424971	67	26	,	,	,
10_1101-2020_12_31_424971	67	27	encoding	encode	VBG
10_1101-2020_12_31_424971	67	28	cysteinyl	cysteinyl	NN
10_1101-2020_12_31_424971	67	29	-	-	HYPH
10_1101-2020_12_31_424971	67	30	tRNA	trna	NN
10_1101-2020_12_31_424971	67	31	synthetase	synthetase	NN
10_1101-2020_12_31_424971	67	32	(	(	-LRB-
10_1101-2020_12_31_424971	67	33	CysRS)30	CysRS)30	NNS
10_1101-2020_12_31_424971	67	34	,	,	,
10_1101-2020_12_31_424971	67	35	which	which	WDT
10_1101-2020_12_31_424971	67	36	has	have	VBZ
10_1101-2020_12_31_424971	67	37	no	no	DT
10_1101-2020_12_31_424971	67	38	CCC	CCC	NNP
10_1101-2020_12_31_424971	67	39	-	-	HYPH
10_1101-2020_12_31_424971	67	40	C	C	NNP
10_1101-2020_12_31_424971	67	41	motif	motif	NN
10_1101-2020_12_31_424971	67	42	in	in	IN
10_1101-2020_12_31_424971	67	43	the	the	DT
10_1101-2020_12_31_424971	67	44	first	first	JJ
10_1101-2020_12_31_424971	67	45	16	16	CD
10_1101-2020_12_31_424971	67	46	177	177	CD
10_1101-2020_12_31_424971	67	47	codons	codon	NNS
10_1101-2020_12_31_424971	67	48	and	and	CC
10_1101-2020_12_31_424971	67	49	would	would	MD
10_1101-2020_12_31_424971	67	50	be	be	VB
10_1101-2020_12_31_424971	67	51	less	less	RBR
10_1101-2020_12_31_424971	67	52	sensitive	sensitive	JJ
10_1101-2020_12_31_424971	67	53	to	to	IN
10_1101-2020_12_31_424971	67	54	+1	+1	NNS
10_1101-2020_12_31_424971	67	55	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	67	56	at	at	IN
10_1101-2020_12_31_424971	67	57	CCC	CCC	NNP
10_1101-2020_12_31_424971	67	58	-	-	HYPH
10_1101-2020_12_31_424971	67	59	C	C	NNP
10_1101-2020_12_31_424971	67	60	motifs	motif	NNS
10_1101-2020_12_31_424971	67	61	during	during	IN
10_1101-2020_12_31_424971	67	62	protein	protein	NN
10_1101-2020_12_31_424971	67	63	synthesis	synthesis	NN
10_1101-2020_12_31_424971	67	64	.	.	.
10_1101-2020_12_31_424971	68	1	178	178	CD
10_1101-2020_12_31_424971	68	2	The	the	DT
10_1101-2020_12_31_424971	68	3	ratio	ratio	NN
10_1101-2020_12_31_424971	68	4	of	of	IN
10_1101-2020_12_31_424971	68	5	protein	protein	NN
10_1101-2020_12_31_424971	68	6	synthesis	synthesis	NN
10_1101-2020_12_31_424971	68	7	of	of	IN
10_1101-2020_12_31_424971	68	8	lolB	lolB	NNP
10_1101-2020_12_31_424971	68	9	to	to	IN
10_1101-2020_12_31_424971	68	10	cysS	cys	NNS
10_1101-2020_12_31_424971	68	11	for	for	IN
10_1101-2020_12_31_424971	68	12	the	the	DT
10_1101-2020_12_31_424971	68	13	control	control	NN
10_1101-2020_12_31_424971	68	14	sample	sample	NN
10_1101-2020_12_31_424971	68	15	ProL	ProL	NNP
10_1101-2020_12_31_424971	68	16	in	in	IN
10_1101-2020_12_31_424971	68	17	the	the	DT
10_1101-2020_12_31_424971	68	18	m1G37	m1g37	JJ
10_1101-2020_12_31_424971	68	19	condition	condition	NN
10_1101-2020_12_31_424971	68	20	,	,	,
10_1101-2020_12_31_424971	68	21	179	179	CD
10_1101-2020_12_31_424971	68	22	measured	measure	VBN
10_1101-2020_12_31_424971	68	23	from	from	IN
10_1101-2020_12_31_424971	68	24	Western	western	JJ
10_1101-2020_12_31_424971	68	25	blots	blot	NNS
10_1101-2020_12_31_424971	68	26	(	(	-LRB-
10_1101-2020_12_31_424971	68	27	Methods	Methods	NNP
10_1101-2020_12_31_424971	68	28	)	)	-RRB-
10_1101-2020_12_31_424971	68	29	,	,	,
10_1101-2020_12_31_424971	68	30	was	be	VBD
10_1101-2020_12_31_424971	68	31	normalized	normalize	VBN
10_1101-2020_12_31_424971	68	32	to	to	IN
10_1101-2020_12_31_424971	68	33	1.00	1.00	CD
10_1101-2020_12_31_424971	68	34	,	,	,
10_1101-2020_12_31_424971	68	35	denoting	denote	VBG
10_1101-2020_12_31_424971	68	36	that	that	IN
10_1101-2020_12_31_424971	68	37	lolB	lolb	NN
10_1101-2020_12_31_424971	68	38	and	and	CC
10_1101-2020_12_31_424971	68	39	cysS	cyss	IN
10_1101-2020_12_31_424971	68	40	180	180	CD
10_1101-2020_12_31_424971	68	41	were	be	VBD
10_1101-2020_12_31_424971	68	42	maximally	maximally	RB
10_1101-2020_12_31_424971	68	43	translated	translate	VBN
10_1101-2020_12_31_424971	68	44	in	in	IN
10_1101-2020_12_31_424971	68	45	the	the	DT
10_1101-2020_12_31_424971	68	46	0-frame	0-frame	CD
10_1101-2020_12_31_424971	68	47	without	without	IN
10_1101-2020_12_31_424971	68	48	+1	+1	NNS
10_1101-2020_12_31_424971	68	49	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	68	50	(	(	-LRB-
10_1101-2020_12_31_424971	68	51	i.e.	i.e.	FW
10_1101-2020_12_31_424971	68	52	,	,	,
10_1101-2020_12_31_424971	68	53	a	a	DT
10_1101-2020_12_31_424971	68	54	relative	relative	JJ
10_1101-2020_12_31_424971	68	55	+1	+1	NNS
10_1101-2020_12_31_424971	68	56	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	68	57	181	181	CD
10_1101-2020_12_31_424971	68	58	efficiency	efficiency	NN
10_1101-2020_12_31_424971	68	59	of	of	IN
10_1101-2020_12_31_424971	68	60	0.00	0.00	CD
10_1101-2020_12_31_424971	68	61	)	)	-RRB-
10_1101-2020_12_31_424971	68	62	(	(	-LRB-
10_1101-2020_12_31_424971	68	63	Figures	figure	NNS
10_1101-2020_12_31_424971	68	64	2b	2b	NNP
10_1101-2020_12_31_424971	68	65	,	,	,
10_1101-2020_12_31_424971	68	66	2c	2c	NN
10_1101-2020_12_31_424971	68	67	)	)	-RRB-
10_1101-2020_12_31_424971	68	68	.	.	.
10_1101-2020_12_31_424971	69	1	In	in	IN
10_1101-2020_12_31_424971	69	2	the	the	DT
10_1101-2020_12_31_424971	69	3	m1G37	m1g37	NN
10_1101-2020_12_31_424971	69	4	+	+	CD
10_1101-2020_12_31_424971	69	5	condition	condition	NN
10_1101-2020_12_31_424971	69	6	,	,	,
10_1101-2020_12_31_424971	69	7	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	69	8	displayed	display	VBD
10_1101-2020_12_31_424971	69	9	a	a	DT
10_1101-2020_12_31_424971	69	10	ratio	ratio	NN
10_1101-2020_12_31_424971	69	11	of	of	IN
10_1101-2020_12_31_424971	69	12	LolB	LolB	NNP
10_1101-2020_12_31_424971	69	13	to	to	IN
10_1101-2020_12_31_424971	69	14	182	182	CD
10_1101-2020_12_31_424971	69	15	CysRS	CysRS	NNP
10_1101-2020_12_31_424971	69	16	of	of	IN
10_1101-2020_12_31_424971	69	17	0.62	0.62	CD
10_1101-2020_12_31_424971	69	18	,	,	,
10_1101-2020_12_31_424971	69	19	indicating	indicate	VBG
10_1101-2020_12_31_424971	69	20	an	an	DT
10_1101-2020_12_31_424971	69	21	increase	increase	NN
10_1101-2020_12_31_424971	69	22	in	in	IN
10_1101-2020_12_31_424971	69	23	the	the	DT
10_1101-2020_12_31_424971	69	24	relative	relative	JJ
10_1101-2020_12_31_424971	69	25	+1	+1	:
10_1101-2020_12_31_424971	69	26	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	69	27	efficiency	efficiency	NN
10_1101-2020_12_31_424971	69	28	to	to	IN
10_1101-2020_12_31_424971	69	29	0.38	0.38	CD
10_1101-2020_12_31_424971	69	30	,	,	,
10_1101-2020_12_31_424971	69	31	and	and	CC
10_1101-2020_12_31_424971	69	32	in	in	IN
10_1101-2020_12_31_424971	69	33	the	the	DT
10_1101-2020_12_31_424971	69	34	183	183	CD
10_1101-2020_12_31_424971	69	35	m1G37	m1g37	NN
10_1101-2020_12_31_424971	69	36	–	–	:
10_1101-2020_12_31_424971	69	37	condition	condition	NN
10_1101-2020_12_31_424971	69	38	,	,	,
10_1101-2020_12_31_424971	69	39	it	-PRON-	PRP
10_1101-2020_12_31_424971	69	40	displayed	display	VBD
10_1101-2020_12_31_424971	69	41	a	a	DT
10_1101-2020_12_31_424971	69	42	ratio	ratio	NN
10_1101-2020_12_31_424971	69	43	of	of	IN
10_1101-2020_12_31_424971	69	44	0.17	0.17	CD
10_1101-2020_12_31_424971	69	45	,	,	,
10_1101-2020_12_31_424971	69	46	indicating	indicate	VBG
10_1101-2020_12_31_424971	69	47	an	an	DT
10_1101-2020_12_31_424971	69	48	increase	increase	NN
10_1101-2020_12_31_424971	69	49	in	in	IN
10_1101-2020_12_31_424971	69	50	the	the	DT
10_1101-2020_12_31_424971	69	51	relative	relative	JJ
10_1101-2020_12_31_424971	69	52	+1	+1	:
10_1101-2020_12_31_424971	69	53	184	184	CD
10_1101-2020_12_31_424971	69	54	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	69	55	efficiency	efficiency	NN
10_1101-2020_12_31_424971	69	56	to	to	IN
10_1101-2020_12_31_424971	69	57	0.83	0.83	CD
10_1101-2020_12_31_424971	69	58	(	(	-LRB-
10_1101-2020_12_31_424971	69	59	Figures	figure	NNS
10_1101-2020_12_31_424971	69	60	2b	2b	NNP
10_1101-2020_12_31_424971	69	61	,	,	,
10_1101-2020_12_31_424971	69	62	2c	2c	NN
10_1101-2020_12_31_424971	69	63	)	)	-RRB-
10_1101-2020_12_31_424971	69	64	.	.	.
10_1101-2020_12_31_424971	70	1	Similarly	similarly	RB
10_1101-2020_12_31_424971	70	2	,	,	,
10_1101-2020_12_31_424971	70	3	ProL	ProL	NNP
10_1101-2020_12_31_424971	70	4	in	in	IN
10_1101-2020_12_31_424971	70	5	the	the	DT
10_1101-2020_12_31_424971	70	6	m1G37	m1g37	NN
10_1101-2020_12_31_424971	70	7	–	–	:
10_1101-2020_12_31_424971	70	8	condition	condition	NN
10_1101-2020_12_31_424971	70	9	displayed	display	VBD
10_1101-2020_12_31_424971	70	10	185	185	CD
10_1101-2020_12_31_424971	70	11	a	a	DT
10_1101-2020_12_31_424971	70	12	ratio	ratio	NN
10_1101-2020_12_31_424971	70	13	of	of	IN
10_1101-2020_12_31_424971	70	14	LolB	LolB	NNP
10_1101-2020_12_31_424971	70	15	to	to	IN
10_1101-2020_12_31_424971	70	16	CysRS	CysRS	NNP
10_1101-2020_12_31_424971	70	17	of	of	IN
10_1101-2020_12_31_424971	70	18	0.47	0.47	CD
10_1101-2020_12_31_424971	70	19	,	,	,
10_1101-2020_12_31_424971	70	20	indicating	indicate	VBG
10_1101-2020_12_31_424971	70	21	an	an	DT
10_1101-2020_12_31_424971	70	22	increase	increase	NN
10_1101-2020_12_31_424971	70	23	in	in	IN
10_1101-2020_12_31_424971	70	24	the	the	DT
10_1101-2020_12_31_424971	70	25	+1-frameshifting	+1-frameshifting	JJ
10_1101-2020_12_31_424971	70	26	efficiency	efficiency	NN
10_1101-2020_12_31_424971	70	27	to	to	TO
10_1101-2020_12_31_424971	70	28	0.53	0.53	CD
10_1101-2020_12_31_424971	70	29	.	.	.
10_1101-2020_12_31_424971	71	1	186	186	CD
10_1101-2020_12_31_424971	71	2	187	187	CD
10_1101-2020_12_31_424971	71	3	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	71	4	can	can	MD
10_1101-2020_12_31_424971	71	5	insert	insert	VB
10_1101-2020_12_31_424971	71	6	non	non	JJ
10_1101-2020_12_31_424971	71	7	-	-	JJ
10_1101-2020_12_31_424971	71	8	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	71	9	amino	amino	JJ
10_1101-2020_12_31_424971	71	10	acids	acid	NNS
10_1101-2020_12_31_424971	71	11	at	at	IN
10_1101-2020_12_31_424971	71	12	CCC	CCC	NNP
10_1101-2020_12_31_424971	71	13	-	-	HYPH
10_1101-2020_12_31_424971	71	14	C	C	NNP
10_1101-2020_12_31_424971	71	15	motifs	motif	VBZ
10_1101-2020_12_31_424971	71	16	188	188	CD
10_1101-2020_12_31_424971	71	17	We	-PRON-	PRP
10_1101-2020_12_31_424971	71	18	next	next	RB
10_1101-2020_12_31_424971	71	19	asked	ask	VBD
10_1101-2020_12_31_424971	71	20	whether	whether	IN
10_1101-2020_12_31_424971	71	21	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	71	22	can	can	MD
10_1101-2020_12_31_424971	71	23	deliver	deliver	VB
10_1101-2020_12_31_424971	71	24	non	non	JJ
10_1101-2020_12_31_424971	71	25	-	-	JJ
10_1101-2020_12_31_424971	71	26	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	71	27	amino	amino	JJ
10_1101-2020_12_31_424971	71	28	acids	acid	NNS
10_1101-2020_12_31_424971	71	29	to	to	IN
10_1101-2020_12_31_424971	71	30	the	the	DT
10_1101-2020_12_31_424971	71	31	ribosome	ribosome	NN
10_1101-2020_12_31_424971	71	32	by	by	IN
10_1101-2020_12_31_424971	71	33	189	189	CD
10_1101-2020_12_31_424971	71	34	inducing	induce	VBG
10_1101-2020_12_31_424971	71	35	+1	+1	NNS
10_1101-2020_12_31_424971	71	36	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	71	37	at	at	IN
10_1101-2020_12_31_424971	71	38	a	a	DT
10_1101-2020_12_31_424971	71	39	CCC	CCC	NNP
10_1101-2020_12_31_424971	71	40	-	-	HYPH
10_1101-2020_12_31_424971	71	41	C	C	NNP
10_1101-2020_12_31_424971	71	42	motif	motif	NN
10_1101-2020_12_31_424971	71	43	(	(	-LRB-
10_1101-2020_12_31_424971	71	44	Figure	Figure	NNP
10_1101-2020_12_31_424971	71	45	2d	2d	NNP
10_1101-2020_12_31_424971	71	46	)	)	-RRB-
10_1101-2020_12_31_424971	71	47	.	.	.
10_1101-2020_12_31_424971	72	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	72	2	inserted	insert	VBD
10_1101-2020_12_31_424971	72	3	a	a	DT
10_1101-2020_12_31_424971	72	4	CCC	CCC	NNP
10_1101-2020_12_31_424971	72	5	-	-	HYPH
10_1101-2020_12_31_424971	72	6	C	C	NNP
10_1101-2020_12_31_424971	72	7	motif	motif	NN
10_1101-2020_12_31_424971	72	8	at	at	IN
10_1101-2020_12_31_424971	72	9	the	the	DT
10_1101-2020_12_31_424971	72	10	5th	5th	JJ
10_1101-2020_12_31_424971	72	11	190	190	CD
10_1101-2020_12_31_424971	72	12	codon	codon	NN
10_1101-2020_12_31_424971	72	13	position	position	NN
10_1101-2020_12_31_424971	72	14	of	of	IN
10_1101-2020_12_31_424971	72	15	the	the	DT
10_1101-2020_12_31_424971	72	16	E.	E.	NNP
10_1101-2020_12_31_424971	72	17	coli	coli	NNS
10_1101-2020_12_31_424971	72	18	folA	fola	JJ
10_1101-2020_12_31_424971	72	19	gene	gene	NN
10_1101-2020_12_31_424971	72	20	,	,	,
10_1101-2020_12_31_424971	72	21	encoding	encode	VBG
10_1101-2020_12_31_424971	72	22	dihydrofolate	dihydrofolate	JJ
10_1101-2020_12_31_424971	72	23	reductase	reductase	NN
10_1101-2020_12_31_424971	72	24	(	(	-LRB-
10_1101-2020_12_31_424971	72	25	DHFR	DHFR	NNP
10_1101-2020_12_31_424971	72	26	)	)	-RRB-
10_1101-2020_12_31_424971	72	27	.	.	.
10_1101-2020_12_31_424971	73	1	A	a	DT
10_1101-2020_12_31_424971	73	2	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	73	3	-	-	SYM
10_1101-2020_12_31_424971	73	4	191	191	CD
10_1101-2020_12_31_424971	73	5	induced	induce	VBN
10_1101-2020_12_31_424971	73	6	+1	+1	NNS
10_1101-2020_12_31_424971	73	7	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	73	8	event	event	NN
10_1101-2020_12_31_424971	73	9	at	at	IN
10_1101-2020_12_31_424971	73	10	the	the	DT
10_1101-2020_12_31_424971	73	11	insertion	insertion	NN
10_1101-2020_12_31_424971	73	12	would	would	MD
10_1101-2020_12_31_424971	73	13	result	result	VB
10_1101-2020_12_31_424971	73	14	in	in	IN
10_1101-2020_12_31_424971	73	15	full	full	JJ
10_1101-2020_12_31_424971	73	16	-	-	HYPH
10_1101-2020_12_31_424971	73	17	length	length	NN
10_1101-2020_12_31_424971	73	18	DHFR	DHFR	NNP
10_1101-2020_12_31_424971	73	19	,	,	,
10_1101-2020_12_31_424971	73	20	whereas	whereas	IN
10_1101-2020_12_31_424971	73	21	the	the	DT
10_1101-2020_12_31_424971	73	22	192	192	CD
10_1101-2020_12_31_424971	73	23	absence	absence	NN
10_1101-2020_12_31_424971	73	24	of	of	IN
10_1101-2020_12_31_424971	73	25	+1	+1	NNS
10_1101-2020_12_31_424971	73	26	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	73	27	would	would	MD
10_1101-2020_12_31_424971	73	28	result	result	VB
10_1101-2020_12_31_424971	73	29	in	in	IN
10_1101-2020_12_31_424971	73	30	a	a	DT
10_1101-2020_12_31_424971	73	31	C	c	NN
10_1101-2020_12_31_424971	73	32	-	-	HYPH
10_1101-2020_12_31_424971	73	33	terminal	terminal	JJ
10_1101-2020_12_31_424971	73	34	truncated	truncate	VBN
10_1101-2020_12_31_424971	73	35	DHFR	DHFR	NNP
10_1101-2020_12_31_424971	73	36	fragment	fragment	NN
10_1101-2020_12_31_424971	73	37	(	(	-LRB-
10_1101-2020_12_31_424971	73	38	DC	DC	NNP
10_1101-2020_12_31_424971	73	39	)	)	-RRB-
10_1101-2020_12_31_424971	73	40	.	.	.
10_1101-2020_12_31_424971	74	1	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	74	2	193	193	CD
10_1101-2020_12_31_424971	74	3	was	be	VBD
10_1101-2020_12_31_424971	74	4	aminoacylated	aminoacylate	VBN
10_1101-2020_12_31_424971	74	5	with	with	IN
10_1101-2020_12_31_424971	74	6	non	non	JJ
10_1101-2020_12_31_424971	74	7	-	-	JJ
10_1101-2020_12_31_424971	74	8	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	74	9	amino	amino	JJ
10_1101-2020_12_31_424971	74	10	acids	acid	NNS
10_1101-2020_12_31_424971	74	11	using	use	VBG
10_1101-2020_12_31_424971	74	12	a	a	DT
10_1101-2020_12_31_424971	74	13	Flexizyme32	Flexizyme32	NNP
10_1101-2020_12_31_424971	74	14	and	and	CC
10_1101-2020_12_31_424971	74	15	subsequently	subsequently	RB
10_1101-2020_12_31_424971	74	16	194	194	CD
10_1101-2020_12_31_424971	74	17	tested	test	VBN
10_1101-2020_12_31_424971	74	18	in	in	IN
10_1101-2020_12_31_424971	74	19	[	[	-LRB-
10_1101-2020_12_31_424971	74	20	35S]-Met	35s]-met	CD
10_1101-2020_12_31_424971	74	21	-	-	HYPH
10_1101-2020_12_31_424971	74	22	dependent	dependent	JJ
10_1101-2020_12_31_424971	74	23	in	in	FW
10_1101-2020_12_31_424971	74	24	vitro	vitro	FW
10_1101-2020_12_31_424971	74	25	translation	translation	NN
10_1101-2020_12_31_424971	74	26	reactions	reaction	NNS
10_1101-2020_12_31_424971	74	27	using	use	VBG
10_1101-2020_12_31_424971	74	28	the	the	DT
10_1101-2020_12_31_424971	74	29	E.	E.	NNP
10_1101-2020_12_31_424971	74	30	coli	coli	NNS
10_1101-2020_12_31_424971	74	31	PURExpress	purexpress	NN
10_1101-2020_12_31_424971	74	32	system	system	NN
10_1101-2020_12_31_424971	74	33	.	.	.
10_1101-2020_12_31_424971	75	1	195	195	CD
10_1101-2020_12_31_424971	75	2	The	the	DT
10_1101-2020_12_31_424971	75	3	resulting	result	VBG
10_1101-2020_12_31_424971	75	4	protein	protein	NN
10_1101-2020_12_31_424971	75	5	products	product	NNS
10_1101-2020_12_31_424971	75	6	were	be	VBD
10_1101-2020_12_31_424971	75	7	separated	separate	VBN
10_1101-2020_12_31_424971	75	8	by	by	IN
10_1101-2020_12_31_424971	75	9	sodium	sodium	VBG
10_1101-2020_12_31_424971	75	10	dodecyl	dodecyl	JJ
10_1101-2020_12_31_424971	75	11	sulfate	sulfate	NN
10_1101-2020_12_31_424971	75	12	(	(	-LRB-
10_1101-2020_12_31_424971	75	13	SDS)-polyacrylamide	sds)-polyacrylamide	NN
10_1101-2020_12_31_424971	75	14	196	196	CD
10_1101-2020_12_31_424971	75	15	gel	gel	NN
10_1101-2020_12_31_424971	75	16	electrophoresis	electrophoresis	NN
10_1101-2020_12_31_424971	75	17	and	and	CC
10_1101-2020_12_31_424971	75	18	quantified	quantify	VBN
10_1101-2020_12_31_424971	75	19	by	by	IN
10_1101-2020_12_31_424971	75	20	phosphorimaging	phosphorimage	VBG
10_1101-2020_12_31_424971	75	21	.	.	.
10_1101-2020_12_31_424971	76	1	Control	control	NN
10_1101-2020_12_31_424971	76	2	experiments	experiment	NNS
10_1101-2020_12_31_424971	76	3	with	with	IN
10_1101-2020_12_31_424971	76	4	no	no	DT
10_1101-2020_12_31_424971	76	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	76	6	or	or	CC
10_1101-2020_12_31_424971	76	7	197	197	CD
10_1101-2020_12_31_424971	76	8	with	with	IN
10_1101-2020_12_31_424971	76	9	a	a	DT
10_1101-2020_12_31_424971	76	10	non	non	JJ
10_1101-2020_12_31_424971	76	11	-	-	HYPH
10_1101-2020_12_31_424971	76	12	acylated	acylated	JJ
10_1101-2020_12_31_424971	76	13	SufB2	sufb2	NN
10_1101-2020_12_31_424971	76	14	showed	show	VBD
10_1101-2020_12_31_424971	76	15	no	no	DT
10_1101-2020_12_31_424971	76	16	full	full	JJ
10_1101-2020_12_31_424971	76	17	-	-	HYPH
10_1101-2020_12_31_424971	76	18	length	length	NN
10_1101-2020_12_31_424971	76	19	DHFR	DHFR	NNP
10_1101-2020_12_31_424971	76	20	,	,	,
10_1101-2020_12_31_424971	76	21	demonstrating	demonstrate	VBG
10_1101-2020_12_31_424971	76	22	that	that	IN
10_1101-2020_12_31_424971	76	23	synthesis	synthesis	NN
10_1101-2020_12_31_424971	76	24	of	of	IN
10_1101-2020_12_31_424971	76	25	full-198	full-198	NN
10_1101-2020_12_31_424971	76	26	length	length	NN
10_1101-2020_12_31_424971	76	27	DHFR	DHFR	NNP
10_1101-2020_12_31_424971	76	28	depended	depend	VBD
10_1101-2020_12_31_424971	76	29	upon	upon	IN
10_1101-2020_12_31_424971	76	30	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	76	31	delivery	delivery	NN
10_1101-2020_12_31_424971	76	32	of	of	IN
10_1101-2020_12_31_424971	76	33	an	an	DT
10_1101-2020_12_31_424971	76	34	amino	amino	JJ
10_1101-2020_12_31_424971	76	35	acid	acid	NN
10_1101-2020_12_31_424971	76	36	as	as	IN
10_1101-2020_12_31_424971	76	37	a	a	DT
10_1101-2020_12_31_424971	76	38	result	result	NN
10_1101-2020_12_31_424971	76	39	of	of	IN
10_1101-2020_12_31_424971	76	40	+1	+1	NNS
10_1101-2020_12_31_424971	76	41	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	76	42	at	at	IN
10_1101-2020_12_31_424971	76	43	199	199	CD
10_1101-2020_12_31_424971	76	44	the	the	DT
10_1101-2020_12_31_424971	76	45	CCC	CCC	NNP
10_1101-2020_12_31_424971	76	46	-	-	HYPH
10_1101-2020_12_31_424971	76	47	C	C	NNP
10_1101-2020_12_31_424971	76	48	motif	motif	NN
10_1101-2020_12_31_424971	76	49	.	.	.
10_1101-2020_12_31_424971	77	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	77	2	showed	show	VBD
10_1101-2020_12_31_424971	77	3	that	that	IN
10_1101-2020_12_31_424971	77	4	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	77	5	was	be	VBD
10_1101-2020_12_31_424971	77	6	able	able	JJ
10_1101-2020_12_31_424971	77	7	to	to	TO
10_1101-2020_12_31_424971	77	8	deliver	deliver	VB
10_1101-2020_12_31_424971	77	9	Pro	Pro	NNP
10_1101-2020_12_31_424971	77	10	,	,	,
10_1101-2020_12_31_424971	77	11	Arg	Arg	NNP
10_1101-2020_12_31_424971	77	12	,	,	,
10_1101-2020_12_31_424971	77	13	Val	Val	NNP
10_1101-2020_12_31_424971	77	14	,	,	,
10_1101-2020_12_31_424971	77	15	and	and	CC
10_1101-2020_12_31_424971	77	16	the	the	DT
10_1101-2020_12_31_424971	77	17	Pro	Pro	NNP
10_1101-2020_12_31_424971	77	18	analogs	analog	VBZ
10_1101-2020_12_31_424971	77	19	200	200	CD
10_1101-2020_12_31_424971	77	20	cis	cis	NN
10_1101-2020_12_31_424971	77	21	-	-	HYPH
10_1101-2020_12_31_424971	77	22	hydroxypro	hydroxypro	JJ
10_1101-2020_12_31_424971	77	23	,	,	,
10_1101-2020_12_31_424971	77	24	trans	trans	NNP
10_1101-2020_12_31_424971	77	25	-	-	NNP
10_1101-2020_12_31_424971	77	26	hydroxypro	hydroxypro	JJ
10_1101-2020_12_31_424971	77	27	,	,	,
10_1101-2020_12_31_424971	77	28	azetidine	azetidine	NN
10_1101-2020_12_31_424971	77	29	,	,	,
10_1101-2020_12_31_424971	77	30	and	and	CC
10_1101-2020_12_31_424971	77	31	thiapro	thiapro	NN
10_1101-2020_12_31_424971	77	32	(	(	-LRB-
10_1101-2020_12_31_424971	77	33	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	77	34	Figure	Figure	NNP
10_1101-2020_12_31_424971	77	35	1	1	CD
10_1101-2020_12_31_424971	77	36	)	)	-RRB-
10_1101-2020_12_31_424971	77	37	to	to	IN
10_1101-2020_12_31_424971	77	38	the	the	DT
10_1101-2020_12_31_424971	77	39	201	201	CD
10_1101-2020_12_31_424971	77	40	ribosome	ribosome	NN
10_1101-2020_12_31_424971	77	41	in	in	IN
10_1101-2020_12_31_424971	77	42	response	response	NN
10_1101-2020_12_31_424971	77	43	to	to	IN
10_1101-2020_12_31_424971	77	44	the	the	DT
10_1101-2020_12_31_424971	77	45	CCC	CCC	NNP
10_1101-2020_12_31_424971	77	46	-	-	HYPH
10_1101-2020_12_31_424971	77	47	C	C	NNP
10_1101-2020_12_31_424971	77	48	motif	motif	NN
10_1101-2020_12_31_424971	77	49	,	,	,
10_1101-2020_12_31_424971	77	50	and	and	CC
10_1101-2020_12_31_424971	77	51	that	that	IN
10_1101-2020_12_31_424971	77	52	the	the	DT
10_1101-2020_12_31_424971	77	53	efficiency	efficiency	NN
10_1101-2020_12_31_424971	77	54	of	of	IN
10_1101-2020_12_31_424971	77	55	delivery	delivery	NN
10_1101-2020_12_31_424971	77	56	by	by	IN
10_1101-2020_12_31_424971	77	57	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	77	58	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	77	59	202	202	CD
10_1101-2020_12_31_424971	77	60	.CC	.CC	:
10_1101-2020_12_31_424971	77	61	-	-	HYPH
10_1101-2020_12_31_424971	77	62	BY	by	IN
10_1101-2020_12_31_424971	77	63	-	-	HYPH
10_1101-2020_12_31_424971	77	64	NC	NC	NNP
10_1101-2020_12_31_424971	77	65	-	-	HYPH
10_1101-2020_12_31_424971	77	66	ND	ND	NNP
10_1101-2020_12_31_424971	77	67	4.0	4.0	CD
10_1101-2020_12_31_424971	77	68	International	International	NNP
10_1101-2020_12_31_424971	77	69	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	77	70	under	under	IN
10_1101-2020_12_31_424971	77	71	a	a	DT
10_1101-2020_12_31_424971	77	72	(	(	-LRB-
10_1101-2020_12_31_424971	77	73	which	which	WDT
10_1101-2020_12_31_424971	77	74	was	be	VBD
10_1101-2020_12_31_424971	77	75	not	not	RB
10_1101-2020_12_31_424971	77	76	certified	certify	VBN
10_1101-2020_12_31_424971	77	77	by	by	IN
10_1101-2020_12_31_424971	77	78	peer	peer	NN
10_1101-2020_12_31_424971	77	79	review	review	NN
10_1101-2020_12_31_424971	77	80	)	)	-RRB-
10_1101-2020_12_31_424971	77	81	is	be	VBZ
10_1101-2020_12_31_424971	77	82	the	the	DT
10_1101-2020_12_31_424971	77	83	author	author	NN
10_1101-2020_12_31_424971	77	84	/	/	SYM
10_1101-2020_12_31_424971	77	85	funder	funder	NN
10_1101-2020_12_31_424971	77	86	,	,	,
10_1101-2020_12_31_424971	77	87	who	who	WP
10_1101-2020_12_31_424971	77	88	has	have	VBZ
10_1101-2020_12_31_424971	77	89	granted	grant	VBN
10_1101-2020_12_31_424971	77	90	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	77	91	a	a	DT
10_1101-2020_12_31_424971	77	92	license	license	NN
10_1101-2020_12_31_424971	77	93	to	to	TO
10_1101-2020_12_31_424971	77	94	display	display	VB
10_1101-2020_12_31_424971	77	95	the	the	DT
10_1101-2020_12_31_424971	77	96	preprint	preprint	NN
10_1101-2020_12_31_424971	77	97	in	in	IN
10_1101-2020_12_31_424971	77	98	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	77	99	.	.	.
10_1101-2020_12_31_424971	78	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	78	2	is	be	VBZ
10_1101-2020_12_31_424971	78	3	made	make	VBN
10_1101-2020_12_31_424971	78	4	The	the	DT
10_1101-2020_12_31_424971	78	5	copyright	copyright	NN
10_1101-2020_12_31_424971	78	6	holder	holder	NN
10_1101-2020_12_31_424971	78	7	for	for	IN
10_1101-2020_12_31_424971	78	8	this	this	DT
10_1101-2020_12_31_424971	78	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	78	10	version	version	NN
10_1101-2020_12_31_424971	78	11	posted	post	VBD
10_1101-2020_12_31_424971	78	12	January	January	NNP
10_1101-2020_12_31_424971	78	13	2	2	CD
10_1101-2020_12_31_424971	78	14	,	,	,
10_1101-2020_12_31_424971	78	15	2021	2021	CD
10_1101-2020_12_31_424971	78	16	.	.	.
10_1101-2020_12_31_424971	78	17	;	;	:
10_1101-2020_12_31_424971	78	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	78	19	:	:	:
10_1101-2020_12_31_424971	78	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	78	21	preprint	preprint	NN
10_1101-2020_12_31_424971	78	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NN
10_1101-2020_12_31_424971	78	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	78	24	9	9	CD
10_1101-2020_12_31_424971	78	25	was	be	VBD
10_1101-2020_12_31_424971	78	26	generally	generally	RB
10_1101-2020_12_31_424971	78	27	higher	high	JJR
10_1101-2020_12_31_424971	78	28	than	than	IN
10_1101-2020_12_31_424971	78	29	that	that	DT
10_1101-2020_12_31_424971	78	30	by	by	IN
10_1101-2020_12_31_424971	78	31	native	native	JJ
10_1101-2020_12_31_424971	78	32	-	-	HYPH
10_1101-2020_12_31_424971	78	33	state	state	NN
10_1101-2020_12_31_424971	78	34	SufB2	sufb2	NN
10_1101-2020_12_31_424971	78	35	.	.	.
10_1101-2020_12_31_424971	79	1	Notably	notably	RB
10_1101-2020_12_31_424971	79	2	,	,	,
10_1101-2020_12_31_424971	79	3	the	the	DT
10_1101-2020_12_31_424971	79	4	PURExpress	purexpress	NN
10_1101-2020_12_31_424971	79	5	system	system	NN
10_1101-2020_12_31_424971	79	6	contains	contain	VBZ
10_1101-2020_12_31_424971	79	7	203	203	CD
10_1101-2020_12_31_424971	79	8	all	all	DT
10_1101-2020_12_31_424971	79	9	canonical	canonical	JJ
10_1101-2020_12_31_424971	79	10	tRNAs	trnas	NN
10_1101-2020_12_31_424971	79	11	,	,	,
10_1101-2020_12_31_424971	79	12	including	include	VBG
10_1101-2020_12_31_424971	79	13	ProL	ProL	NNP
10_1101-2020_12_31_424971	79	14	and	and	CC
10_1101-2020_12_31_424971	79	15	ProM	ProM	NNP
10_1101-2020_12_31_424971	79	16	,	,	,
10_1101-2020_12_31_424971	79	17	indicating	indicate	VBG
10_1101-2020_12_31_424971	79	18	the	the	DT
10_1101-2020_12_31_424971	79	19	ability	ability	NN
10_1101-2020_12_31_424971	79	20	of	of	IN
10_1101-2020_12_31_424971	79	21	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	79	22	to	to	IN
10_1101-2020_12_31_424971	79	23	successfully	successfully	RB
10_1101-2020_12_31_424971	79	24	204	204	CD
10_1101-2020_12_31_424971	79	25	compete	compete	VB
10_1101-2020_12_31_424971	79	26	with	with	IN
10_1101-2020_12_31_424971	79	27	these	these	DT
10_1101-2020_12_31_424971	79	28	tRNAs	trnas	CD
10_1101-2020_12_31_424971	79	29	.	.	.
10_1101-2020_12_31_424971	80	1	205	205	CD
10_1101-2020_12_31_424971	80	2	206	206	CD
10_1101-2020_12_31_424971	80	3	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	80	4	uses	use	VBZ
10_1101-2020_12_31_424971	80	5	triplet	triplet	NN
10_1101-2020_12_31_424971	80	6	pairing	pair	VBG
10_1101-2020_12_31_424971	80	7	in	in	IN
10_1101-2020_12_31_424971	80	8	the	the	DT
10_1101-2020_12_31_424971	80	9	0-frame	0-frame	CD
10_1101-2020_12_31_424971	80	10	at	at	IN
10_1101-2020_12_31_424971	80	11	the	the	DT
10_1101-2020_12_31_424971	80	12	A	A	NNP
10_1101-2020_12_31_424971	80	13	site	site	NN
10_1101-2020_12_31_424971	80	14	207	207	CD
10_1101-2020_12_31_424971	80	15	To	to	TO
10_1101-2020_12_31_424971	80	16	determine	determine	VB
10_1101-2020_12_31_424971	80	17	at	at	IN
10_1101-2020_12_31_424971	80	18	which	which	WDT
10_1101-2020_12_31_424971	80	19	step	step	NN
10_1101-2020_12_31_424971	80	20	in	in	IN
10_1101-2020_12_31_424971	80	21	the	the	DT
10_1101-2020_12_31_424971	80	22	elongation	elongation	NN
10_1101-2020_12_31_424971	80	23	cycle	cycle	NN
10_1101-2020_12_31_424971	80	24	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	80	25	undergoes	undergoe	NNS
10_1101-2020_12_31_424971	80	26	+1	+1	VBZ
10_1101-2020_12_31_424971	80	27	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	80	28	in	in	IN
10_1101-2020_12_31_424971	80	29	208	208	CD
10_1101-2020_12_31_424971	80	30	response	response	NN
10_1101-2020_12_31_424971	80	31	to	to	IN
10_1101-2020_12_31_424971	80	32	a	a	DT
10_1101-2020_12_31_424971	80	33	CCC	CCC	NNP
10_1101-2020_12_31_424971	80	34	-	-	HYPH
10_1101-2020_12_31_424971	80	35	C	C	NNP
10_1101-2020_12_31_424971	80	36	motif	motif	NN
10_1101-2020_12_31_424971	80	37	,	,	,
10_1101-2020_12_31_424971	80	38	we	-PRON-	PRP
10_1101-2020_12_31_424971	80	39	used	use	VBD
10_1101-2020_12_31_424971	80	40	an	an	DT
10_1101-2020_12_31_424971	80	41	E.	E.	NNP
10_1101-2020_12_31_424971	80	42	coli	coli	NNS
10_1101-2020_12_31_424971	80	43	in	in	IN
10_1101-2020_12_31_424971	80	44	vitro	vitro	FW
10_1101-2020_12_31_424971	80	45	translation	translation	NN
10_1101-2020_12_31_424971	80	46	system	system	NN
10_1101-2020_12_31_424971	80	47	composed	compose	VBN
10_1101-2020_12_31_424971	80	48	of	of	IN
10_1101-2020_12_31_424971	80	49	purified	purify	VBN
10_1101-2020_12_31_424971	80	50	209	209	CD
10_1101-2020_12_31_424971	80	51	components	component	NNS
10_1101-2020_12_31_424971	80	52	and	and	CC
10_1101-2020_12_31_424971	80	53	supplemented	supplement	VBN
10_1101-2020_12_31_424971	80	54	with	with	IN
10_1101-2020_12_31_424971	80	55	requisite	requisite	JJ
10_1101-2020_12_31_424971	80	56	tRNAs	trnas	NN
10_1101-2020_12_31_424971	80	57	and	and	CC
10_1101-2020_12_31_424971	80	58	translation	translation	NN
10_1101-2020_12_31_424971	80	59	factors	factor	NNS
10_1101-2020_12_31_424971	80	60	to	to	TO
10_1101-2020_12_31_424971	80	61	perform	perform	VB
10_1101-2020_12_31_424971	80	62	a	a	DT
10_1101-2020_12_31_424971	80	63	series	series	NN
10_1101-2020_12_31_424971	80	64	210	210	CD
10_1101-2020_12_31_424971	80	65	of	of	IN
10_1101-2020_12_31_424971	80	66	ensemble	ensemble	JJ
10_1101-2020_12_31_424971	80	67	rapid	rapid	JJ
10_1101-2020_12_31_424971	80	68	kinetic	kinetic	NNP
10_1101-2020_12_31_424971	80	69	studies	study	NNS
10_1101-2020_12_31_424971	80	70	.	.	.
10_1101-2020_12_31_424971	81	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	81	2	began	begin	VBD
10_1101-2020_12_31_424971	81	3	with	with	IN
10_1101-2020_12_31_424971	81	4	a	a	DT
10_1101-2020_12_31_424971	81	5	GTPase	GTPase	NNP
10_1101-2020_12_31_424971	81	6	assay	assay	NN
10_1101-2020_12_31_424971	81	7	that	that	IN
10_1101-2020_12_31_424971	81	8	reports	report	VBZ
10_1101-2020_12_31_424971	81	9	on	on	IN
10_1101-2020_12_31_424971	81	10	the	the	DT
10_1101-2020_12_31_424971	81	11	yield	yield	NN
10_1101-2020_12_31_424971	81	12	and	and	CC
10_1101-2020_12_31_424971	81	13	211	211	CD
10_1101-2020_12_31_424971	81	14	rate	rate	NN
10_1101-2020_12_31_424971	81	15	with	with	IN
10_1101-2020_12_31_424971	81	16	which	which	WDT
10_1101-2020_12_31_424971	81	17	the	the	DT
10_1101-2020_12_31_424971	81	18	translational	translational	JJ
10_1101-2020_12_31_424971	81	19	GTPase	GTPase	NNP
10_1101-2020_12_31_424971	81	20	EF	EF	NNP
10_1101-2020_12_31_424971	81	21	-	-	HYPH
10_1101-2020_12_31_424971	81	22	Tu	Tu	NNP
10_1101-2020_12_31_424971	81	23	hydrolyzes	hydrolyze	VBZ
10_1101-2020_12_31_424971	81	24	GTP	GTP	NNP
10_1101-2020_12_31_424971	81	25	upon	upon	IN
10_1101-2020_12_31_424971	81	26	delivery	delivery	NN
10_1101-2020_12_31_424971	81	27	of	of	IN
10_1101-2020_12_31_424971	81	28	a	a	DT
10_1101-2020_12_31_424971	81	29	ternary	ternary	JJ
10_1101-2020_12_31_424971	81	30	212	212	CD
10_1101-2020_12_31_424971	81	31	complex	complex	NN
10_1101-2020_12_31_424971	81	32	(	(	-LRB-
10_1101-2020_12_31_424971	81	33	TC	TC	NNP
10_1101-2020_12_31_424971	81	34	)	)	-RRB-
10_1101-2020_12_31_424971	81	35	,	,	,
10_1101-2020_12_31_424971	81	36	composed	compose	VBN
10_1101-2020_12_31_424971	81	37	of	of	IN
10_1101-2020_12_31_424971	81	38	EF	EF	NNP
10_1101-2020_12_31_424971	81	39	-	-	HYPH
10_1101-2020_12_31_424971	81	40	Tu	Tu	NNP
10_1101-2020_12_31_424971	81	41	,	,	,
10_1101-2020_12_31_424971	81	42	[	[	-LRB-
10_1101-2020_12_31_424971	81	43	g-32P]-GTP	g-32p]-gtp	NN
10_1101-2020_12_31_424971	81	44	,	,	,
10_1101-2020_12_31_424971	81	45	and	and	CC
10_1101-2020_12_31_424971	81	46	prolyl	prolyl	NNP
10_1101-2020_12_31_424971	81	47	-	-	HYPH
10_1101-2020_12_31_424971	81	48	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	81	49	(	(	-LRB-
10_1101-2020_12_31_424971	81	50	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	81	51	)	)	-RRB-
10_1101-2020_12_31_424971	81	52	or	or	CC
10_1101-2020_12_31_424971	81	53	ProL	ProL	NNP
10_1101-2020_12_31_424971	81	54	(	(	-LRB-
10_1101-2020_12_31_424971	81	55	ProL	ProL	NNP
10_1101-2020_12_31_424971	81	56	-	-	HYPH
10_1101-2020_12_31_424971	81	57	TC	TC	NNP
10_1101-2020_12_31_424971	81	58	)	)	-RRB-
10_1101-2020_12_31_424971	81	59	,	,	,
10_1101-2020_12_31_424971	81	60	213	213	CD
10_1101-2020_12_31_424971	81	61	to	to	IN
10_1101-2020_12_31_424971	81	62	the	the	DT
10_1101-2020_12_31_424971	81	63	A	A	NNP
10_1101-2020_12_31_424971	81	64	site	site	NN
10_1101-2020_12_31_424971	81	65	of	of	IN
10_1101-2020_12_31_424971	81	66	a	a	DT
10_1101-2020_12_31_424971	81	67	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	81	68	70S	70S	NNP
10_1101-2020_12_31_424971	81	69	initiation	initiation	NN
10_1101-2020_12_31_424971	81	70	complex	complex	NN
10_1101-2020_12_31_424971	81	71	(	(	-LRB-
10_1101-2020_12_31_424971	81	72	70S	70S	NNP
10_1101-2020_12_31_424971	81	73	IC	IC	NNP
10_1101-2020_12_31_424971	81	74	)	)	-RRB-
10_1101-2020_12_31_424971	81	75	carrying	carry	VBG
10_1101-2020_12_31_424971	81	76	an	an	DT
10_1101-2020_12_31_424971	81	77	initiator	initiator	NN
10_1101-2020_12_31_424971	81	78	fMet	fMet	NNP
10_1101-2020_12_31_424971	81	79	-	-	HYPH
10_1101-2020_12_31_424971	81	80	tRNAfMet	tRNAfMet	NNP
10_1101-2020_12_31_424971	81	81	in	in	IN
10_1101-2020_12_31_424971	81	82	214	214	CD
10_1101-2020_12_31_424971	81	83	the	the	DT
10_1101-2020_12_31_424971	81	84	P	p	NN
10_1101-2020_12_31_424971	81	85	site	site	NN
10_1101-2020_12_31_424971	81	86	and	and	CC
10_1101-2020_12_31_424971	81	87	a	a	DT
10_1101-2020_12_31_424971	81	88	programmed	program	VBN
10_1101-2020_12_31_424971	81	89	CCC	CCC	NNP
10_1101-2020_12_31_424971	81	90	-	-	HYPH
10_1101-2020_12_31_424971	81	91	C	C	NNP
10_1101-2020_12_31_424971	81	92	motif	motif	NN
10_1101-2020_12_31_424971	81	93	at	at	IN
10_1101-2020_12_31_424971	81	94	the	the	DT
10_1101-2020_12_31_424971	81	95	A	A	NNP
10_1101-2020_12_31_424971	81	96	site	site	NN
10_1101-2020_12_31_424971	81	97	.	.	.
10_1101-2020_12_31_424971	82	1	The	the	DT
10_1101-2020_12_31_424971	82	2	results	result	NNS
10_1101-2020_12_31_424971	82	3	of	of	IN
10_1101-2020_12_31_424971	82	4	these	these	DT
10_1101-2020_12_31_424971	82	5	experiments	experiment	NNS
10_1101-2020_12_31_424971	82	6	showed	show	VBD
10_1101-2020_12_31_424971	82	7	215	215	CD
10_1101-2020_12_31_424971	82	8	that	that	IN
10_1101-2020_12_31_424971	82	9	the	the	DT
10_1101-2020_12_31_424971	82	10	yield	yield	NN
10_1101-2020_12_31_424971	82	11	and	and	CC
10_1101-2020_12_31_424971	82	12	rate	rate	NN
10_1101-2020_12_31_424971	82	13	of	of	IN
10_1101-2020_12_31_424971	82	14	GTP	GTP	NNP
10_1101-2020_12_31_424971	82	15	hydrolysis	hydrolysis	NN
10_1101-2020_12_31_424971	82	16	(	(	-LRB-
10_1101-2020_12_31_424971	82	17	kGTP	kGTP	NNP
10_1101-2020_12_31_424971	82	18	,	,	,
10_1101-2020_12_31_424971	82	19	obs	obs	NNP
10_1101-2020_12_31_424971	82	20	)	)	-RRB-
10_1101-2020_12_31_424971	82	21	upon	upon	IN
10_1101-2020_12_31_424971	82	22	delivery	delivery	NN
10_1101-2020_12_31_424971	82	23	of	of	IN
10_1101-2020_12_31_424971	82	24	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	82	25	were	be	VBD
10_1101-2020_12_31_424971	82	26	quantitatively	quantitatively	RB
10_1101-2020_12_31_424971	82	27	216	216	CD
10_1101-2020_12_31_424971	82	28	similar	similar	JJ
10_1101-2020_12_31_424971	82	29	to	to	IN
10_1101-2020_12_31_424971	82	30	those	those	DT
10_1101-2020_12_31_424971	82	31	of	of	IN
10_1101-2020_12_31_424971	82	32	ProL	ProL	NNP
10_1101-2020_12_31_424971	82	33	-	-	HYPH
10_1101-2020_12_31_424971	82	34	TC	TC	NNP
10_1101-2020_12_31_424971	82	35	for	for	IN
10_1101-2020_12_31_424971	82	36	both	both	CC
10_1101-2020_12_31_424971	82	37	the	the	DT
10_1101-2020_12_31_424971	82	38	native-	native-	NN
10_1101-2020_12_31_424971	82	39	and	and	CC
10_1101-2020_12_31_424971	82	40	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	82	41	tRNAs	trnas	CD
10_1101-2020_12_31_424971	82	42	(	(	-LRB-
10_1101-2020_12_31_424971	82	43	Figure	Figure	NNP
10_1101-2020_12_31_424971	82	44	3a	3a	NNP
10_1101-2020_12_31_424971	82	45	)	)	-RRB-
10_1101-2020_12_31_424971	82	46	.	.	.
10_1101-2020_12_31_424971	83	1	217	217	CD
10_1101-2020_12_31_424971	83	2	We	-PRON-	PRP
10_1101-2020_12_31_424971	83	3	next	next	RB
10_1101-2020_12_31_424971	83	4	performed	perform	VBD
10_1101-2020_12_31_424971	83	5	a	a	DT
10_1101-2020_12_31_424971	83	6	dipeptide	dipeptide	NN
10_1101-2020_12_31_424971	83	7	formation	formation	NN
10_1101-2020_12_31_424971	83	8	assay	assay	NN
10_1101-2020_12_31_424971	83	9	that	that	WDT
10_1101-2020_12_31_424971	83	10	reports	report	VBZ
10_1101-2020_12_31_424971	83	11	on	on	IN
10_1101-2020_12_31_424971	83	12	the	the	DT
10_1101-2020_12_31_424971	83	13	synthesis	synthesis	NN
10_1101-2020_12_31_424971	83	14	of	of	IN
10_1101-2020_12_31_424971	83	15	a	a	DT
10_1101-2020_12_31_424971	83	16	peptide	peptide	JJ
10_1101-2020_12_31_424971	83	17	218	218	CD
10_1101-2020_12_31_424971	83	18	bond	bond	NN
10_1101-2020_12_31_424971	83	19	between	between	IN
10_1101-2020_12_31_424971	83	20	the	the	DT
10_1101-2020_12_31_424971	83	21	[	[	-LRB-
10_1101-2020_12_31_424971	83	22	35S]-fMet	35s]-fmet	CD
10_1101-2020_12_31_424971	83	23	moiety	moiety	NN
10_1101-2020_12_31_424971	83	24	of	of	IN
10_1101-2020_12_31_424971	83	25	a	a	DT
10_1101-2020_12_31_424971	83	26	P	p	NN
10_1101-2020_12_31_424971	83	27	-	-	HYPH
10_1101-2020_12_31_424971	83	28	site	site	NN
10_1101-2020_12_31_424971	83	29	[	[	-LRB-
10_1101-2020_12_31_424971	83	30	35S]-fMet	35s]-fmet	CD
10_1101-2020_12_31_424971	83	31	-	-	HYPH
10_1101-2020_12_31_424971	83	32	tRNAfMet	trnafmet	NN
10_1101-2020_12_31_424971	83	33	in	in	IN
10_1101-2020_12_31_424971	83	34	a	a	DT
10_1101-2020_12_31_424971	83	35	70S	70S	NNP
10_1101-2020_12_31_424971	83	36	IC	IC	NNP
10_1101-2020_12_31_424971	83	37	and	and	CC
10_1101-2020_12_31_424971	83	38	the	the	DT
10_1101-2020_12_31_424971	83	39	Pro	pro	JJ
10_1101-2020_12_31_424971	83	40	moiety	moiety	NN
10_1101-2020_12_31_424971	83	41	219	219	CD
10_1101-2020_12_31_424971	83	42	of	of	IN
10_1101-2020_12_31_424971	83	43	a	a	DT
10_1101-2020_12_31_424971	83	44	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	83	45	or	or	CC
10_1101-2020_12_31_424971	83	46	ProL	ProL	NNP
10_1101-2020_12_31_424971	83	47	-	-	HYPH
10_1101-2020_12_31_424971	83	48	TC	TC	NNP
10_1101-2020_12_31_424971	83	49	delivered	deliver	VBD
10_1101-2020_12_31_424971	83	50	to	to	IN
10_1101-2020_12_31_424971	83	51	the	the	DT
10_1101-2020_12_31_424971	83	52	A	A	NNP
10_1101-2020_12_31_424971	83	53	site	site	NN
10_1101-2020_12_31_424971	83	54	.	.	.
10_1101-2020_12_31_424971	84	1	This	this	DT
10_1101-2020_12_31_424971	84	2	assay	assay	NN
10_1101-2020_12_31_424971	84	3	revealed	reveal	VBD
10_1101-2020_12_31_424971	84	4	that	that	IN
10_1101-2020_12_31_424971	84	5	the	the	DT
10_1101-2020_12_31_424971	84	6	rate	rate	NN
10_1101-2020_12_31_424971	84	7	of	of	IN
10_1101-2020_12_31_424971	84	8	[	[	-LRB-
10_1101-2020_12_31_424971	84	9	35S]-fMet	35s]-fmet	CD
10_1101-2020_12_31_424971	84	10	-	-	HYPH
10_1101-2020_12_31_424971	84	11	Pro	pro	NN
10_1101-2020_12_31_424971	84	12	220	220	CD
10_1101-2020_12_31_424971	84	13	(	(	-LRB-
10_1101-2020_12_31_424971	84	14	fMP	fmp	NN
10_1101-2020_12_31_424971	84	15	)	)	-RRB-
10_1101-2020_12_31_424971	84	16	formation	formation	NN
10_1101-2020_12_31_424971	84	17	(	(	-LRB-
10_1101-2020_12_31_424971	84	18	kfMP	kfMP	NNP
10_1101-2020_12_31_424971	84	19	,	,	,
10_1101-2020_12_31_424971	84	20	obs	obs	NN
10_1101-2020_12_31_424971	84	21	)	)	-RRB-
10_1101-2020_12_31_424971	84	22	for	for	IN
10_1101-2020_12_31_424971	84	23	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	84	24	was	be	VBD
10_1101-2020_12_31_424971	84	25	within	within	IN
10_1101-2020_12_31_424971	84	26	2-fold	2-fold	CD
10_1101-2020_12_31_424971	84	27	of	of	IN
10_1101-2020_12_31_424971	84	28	that	that	DT
10_1101-2020_12_31_424971	84	29	for	for	IN
10_1101-2020_12_31_424971	84	30	ProL	ProL	NNP
10_1101-2020_12_31_424971	84	31	-	-	HYPH
10_1101-2020_12_31_424971	84	32	TC	TC	NNP
10_1101-2020_12_31_424971	84	33	for	for	IN
10_1101-2020_12_31_424971	84	34	both	both	CC
10_1101-2020_12_31_424971	84	35	the	the	DT
10_1101-2020_12_31_424971	84	36	native-	native-	NN
10_1101-2020_12_31_424971	84	37	221	221	CD
10_1101-2020_12_31_424971	84	38	and	and	CC
10_1101-2020_12_31_424971	84	39	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	84	40	tRNAs	trnas	CD
10_1101-2020_12_31_424971	84	41	(	(	-LRB-
10_1101-2020_12_31_424971	84	42	Figure	figure	NN
10_1101-2020_12_31_424971	84	43	3b	3b	NNP
10_1101-2020_12_31_424971	84	44	,	,	,
10_1101-2020_12_31_424971	84	45	Table	Table	NNP
10_1101-2020_12_31_424971	84	46	S2	S2	NNP
10_1101-2020_12_31_424971	84	47	)	)	-RRB-
10_1101-2020_12_31_424971	84	48	.	.	.
10_1101-2020_12_31_424971	85	1	222	222	CD
10_1101-2020_12_31_424971	85	2	To	to	TO
10_1101-2020_12_31_424971	85	3	test	test	VB
10_1101-2020_12_31_424971	85	4	whether	whether	IN
10_1101-2020_12_31_424971	85	5	native	native	JJ
10_1101-2020_12_31_424971	85	6	-	-	HYPH
10_1101-2020_12_31_424971	85	7	state	state	NN
10_1101-2020_12_31_424971	85	8	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	85	9	can	can	MD
10_1101-2020_12_31_424971	85	10	effectively	effectively	RB
10_1101-2020_12_31_424971	85	11	compete	compete	VB
10_1101-2020_12_31_424971	85	12	with	with	IN
10_1101-2020_12_31_424971	85	13	ProL	ProL	NNP
10_1101-2020_12_31_424971	85	14	-	-	HYPH
10_1101-2020_12_31_424971	85	15	TC	TC	NNP
10_1101-2020_12_31_424971	85	16	for	for	IN
10_1101-2020_12_31_424971	85	17	delivery	delivery	NN
10_1101-2020_12_31_424971	85	18	to	to	IN
10_1101-2020_12_31_424971	85	19	223	223	CD
10_1101-2020_12_31_424971	85	20	the	the	DT
10_1101-2020_12_31_424971	85	21	A	A	NNP
10_1101-2020_12_31_424971	85	22	site	site	NN
10_1101-2020_12_31_424971	85	23	and	and	CC
10_1101-2020_12_31_424971	85	24	peptide	peptide	NN
10_1101-2020_12_31_424971	85	25	-	-	HYPH
10_1101-2020_12_31_424971	85	26	bond	bond	NN
10_1101-2020_12_31_424971	85	27	formation	formation	NN
10_1101-2020_12_31_424971	85	28	,	,	,
10_1101-2020_12_31_424971	85	29	we	-PRON-	PRP
10_1101-2020_12_31_424971	85	30	varied	vary	VBD
10_1101-2020_12_31_424971	85	31	the	the	DT
10_1101-2020_12_31_424971	85	32	dipeptide	dipeptide	NN
10_1101-2020_12_31_424971	85	33	formation	formation	NN
10_1101-2020_12_31_424971	85	34	assay	assay	NN
10_1101-2020_12_31_424971	85	35	such	such	JJ
10_1101-2020_12_31_424971	85	36	that	that	IN
10_1101-2020_12_31_424971	85	37	an	an	DT
10_1101-2020_12_31_424971	85	38	224	224	CD
10_1101-2020_12_31_424971	85	39	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	85	40	mixture	mixture	NN
10_1101-2020_12_31_424971	85	41	of	of	IN
10_1101-2020_12_31_424971	85	42	each	each	DT
10_1101-2020_12_31_424971	85	43	TC	TC	NNP
10_1101-2020_12_31_424971	85	44	was	be	VBD
10_1101-2020_12_31_424971	85	45	used	use	VBN
10_1101-2020_12_31_424971	85	46	in	in	IN
10_1101-2020_12_31_424971	85	47	the	the	DT
10_1101-2020_12_31_424971	85	48	reaction	reaction	NN
10_1101-2020_12_31_424971	85	49	(	(	-LRB-
10_1101-2020_12_31_424971	85	50	Figure	figure	NN
10_1101-2020_12_31_424971	85	51	3c	3c	NN
10_1101-2020_12_31_424971	85	52	)	)	-RRB-
10_1101-2020_12_31_424971	85	53	.	.	.
10_1101-2020_12_31_424971	86	1	Since	since	IN
10_1101-2020_12_31_424971	86	2	aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	86	3	of	of	IN
10_1101-2020_12_31_424971	86	4	both	both	CC
10_1101-2020_12_31_424971	86	5	225	225	CD
10_1101-2020_12_31_424971	86	6	tRNAs	trnas	CD
10_1101-2020_12_31_424971	86	7	with	with	IN
10_1101-2020_12_31_424971	86	8	Pro	Pro	NNP
10_1101-2020_12_31_424971	86	9	would	would	MD
10_1101-2020_12_31_424971	86	10	create	create	VB
10_1101-2020_12_31_424971	86	11	dipeptides	dipeptide	NNS
10_1101-2020_12_31_424971	86	12	of	of	IN
10_1101-2020_12_31_424971	86	13	the	the	DT
10_1101-2020_12_31_424971	86	14	same	same	JJ
10_1101-2020_12_31_424971	86	15	identity	identity	NN
10_1101-2020_12_31_424971	86	16	(	(	-LRB-
10_1101-2020_12_31_424971	86	17	i.e.	i.e.	FW
10_1101-2020_12_31_424971	86	18	,	,	,
10_1101-2020_12_31_424971	86	19	fMP	fmp	CD
10_1101-2020_12_31_424971	86	20	)	)	-RRB-
10_1101-2020_12_31_424971	86	21	,	,	,
10_1101-2020_12_31_424971	86	22	we	-PRON-	PRP
10_1101-2020_12_31_424971	86	23	used	use	VBD
10_1101-2020_12_31_424971	86	24	a	a	DT
10_1101-2020_12_31_424971	86	25	Flexizyme	Flexizyme	NNS
10_1101-2020_12_31_424971	86	26	to	to	TO
10_1101-2020_12_31_424971	86	27	226	226	CD
10_1101-2020_12_31_424971	86	28	aminoacylate	aminoacylate	VB
10_1101-2020_12_31_424971	86	29	them	-PRON-	PRP
10_1101-2020_12_31_424971	86	30	with	with	IN
10_1101-2020_12_31_424971	86	31	different	different	JJ
10_1101-2020_12_31_424971	86	32	amino	amino	JJ
10_1101-2020_12_31_424971	86	33	acids	acid	NNS
10_1101-2020_12_31_424971	86	34	and	and	CC
10_1101-2020_12_31_424971	86	35	generate	generate	VB
10_1101-2020_12_31_424971	86	36	distinct	distinct	JJ
10_1101-2020_12_31_424971	86	37	dipeptides	dipeptide	NNS
10_1101-2020_12_31_424971	86	38	.	.	.
10_1101-2020_12_31_424971	87	1	Control	control	NN
10_1101-2020_12_31_424971	87	2	227	227	CD
10_1101-2020_12_31_424971	87	3	experiments	experiment	NNS
10_1101-2020_12_31_424971	87	4	showed	show	VBD
10_1101-2020_12_31_424971	87	5	that	that	IN
10_1101-2020_12_31_424971	87	6	ProL	ProL	NNP
10_1101-2020_12_31_424971	87	7	charged	charge	VBD
10_1101-2020_12_31_424971	87	8	with	with	IN
10_1101-2020_12_31_424971	87	9	Pro	Pro	NNP
10_1101-2020_12_31_424971	87	10	or	or	CC
10_1101-2020_12_31_424971	87	11	Arg	Arg	NNP
10_1101-2020_12_31_424971	87	12	(	(	-LRB-
10_1101-2020_12_31_424971	87	13	Figure	Figure	NNP
10_1101-2020_12_31_424971	87	14	3c	3c	NN
10_1101-2020_12_31_424971	87	15	,	,	,
10_1101-2020_12_31_424971	87	16	Bars	Bars	NNP
10_1101-2020_12_31_424971	87	17	1	1	CD
10_1101-2020_12_31_424971	87	18	and	and	CC
10_1101-2020_12_31_424971	87	19	2	2	CD
10_1101-2020_12_31_424971	87	20	)	)	-RRB-
10_1101-2020_12_31_424971	87	21	and	and	CC
10_1101-2020_12_31_424971	87	22	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	87	23	228	228	CD
10_1101-2020_12_31_424971	87	24	.CC	.CC	:
10_1101-2020_12_31_424971	87	25	-	-	HYPH
10_1101-2020_12_31_424971	87	26	BY	by	IN
10_1101-2020_12_31_424971	87	27	-	-	HYPH
10_1101-2020_12_31_424971	87	28	NC	NC	NNP
10_1101-2020_12_31_424971	87	29	-	-	HYPH
10_1101-2020_12_31_424971	87	30	ND	ND	NNP
10_1101-2020_12_31_424971	87	31	4.0	4.0	CD
10_1101-2020_12_31_424971	87	32	International	International	NNP
10_1101-2020_12_31_424971	87	33	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	87	34	under	under	IN
10_1101-2020_12_31_424971	87	35	a	a	DT
10_1101-2020_12_31_424971	87	36	(	(	-LRB-
10_1101-2020_12_31_424971	87	37	which	which	WDT
10_1101-2020_12_31_424971	87	38	was	be	VBD
10_1101-2020_12_31_424971	87	39	not	not	RB
10_1101-2020_12_31_424971	87	40	certified	certify	VBN
10_1101-2020_12_31_424971	87	41	by	by	IN
10_1101-2020_12_31_424971	87	42	peer	peer	NN
10_1101-2020_12_31_424971	87	43	review	review	NN
10_1101-2020_12_31_424971	87	44	)	)	-RRB-
10_1101-2020_12_31_424971	87	45	is	be	VBZ
10_1101-2020_12_31_424971	87	46	the	the	DT
10_1101-2020_12_31_424971	87	47	author	author	NN
10_1101-2020_12_31_424971	87	48	/	/	SYM
10_1101-2020_12_31_424971	87	49	funder	funder	NN
10_1101-2020_12_31_424971	87	50	,	,	,
10_1101-2020_12_31_424971	87	51	who	who	WP
10_1101-2020_12_31_424971	87	52	has	have	VBZ
10_1101-2020_12_31_424971	87	53	granted	grant	VBN
10_1101-2020_12_31_424971	87	54	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	87	55	a	a	DT
10_1101-2020_12_31_424971	87	56	license	license	NN
10_1101-2020_12_31_424971	87	57	to	to	TO
10_1101-2020_12_31_424971	87	58	display	display	VB
10_1101-2020_12_31_424971	87	59	the	the	DT
10_1101-2020_12_31_424971	87	60	preprint	preprint	NN
10_1101-2020_12_31_424971	87	61	in	in	IN
10_1101-2020_12_31_424971	87	62	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	87	63	.	.	.
10_1101-2020_12_31_424971	88	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	88	2	is	be	VBZ
10_1101-2020_12_31_424971	88	3	made	make	VBN
10_1101-2020_12_31_424971	88	4	The	the	DT
10_1101-2020_12_31_424971	88	5	copyright	copyright	NN
10_1101-2020_12_31_424971	88	6	holder	holder	NN
10_1101-2020_12_31_424971	88	7	for	for	IN
10_1101-2020_12_31_424971	88	8	this	this	DT
10_1101-2020_12_31_424971	88	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	88	10	version	version	NN
10_1101-2020_12_31_424971	88	11	posted	post	VBD
10_1101-2020_12_31_424971	88	12	January	January	NNP
10_1101-2020_12_31_424971	88	13	2	2	CD
10_1101-2020_12_31_424971	88	14	,	,	,
10_1101-2020_12_31_424971	88	15	2021	2021	CD
10_1101-2020_12_31_424971	88	16	.	.	.
10_1101-2020_12_31_424971	88	17	;	;	:
10_1101-2020_12_31_424971	88	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	88	19	:	:	:
10_1101-2020_12_31_424971	88	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	88	21	preprint	preprint	NN
10_1101-2020_12_31_424971	88	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NNP
10_1101-2020_12_31_424971	88	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	88	24	10	10	CD
10_1101-2020_12_31_424971	88	25	charged	charge	VBN
10_1101-2020_12_31_424971	88	26	with	with	IN
10_1101-2020_12_31_424971	88	27	Pro	Pro	NNP
10_1101-2020_12_31_424971	88	28	or	or	CC
10_1101-2020_12_31_424971	88	29	Arg	Arg	NNP
10_1101-2020_12_31_424971	88	30	(	(	-LRB-
10_1101-2020_12_31_424971	88	31	Bars	Bars	NNP
10_1101-2020_12_31_424971	88	32	3	3	CD
10_1101-2020_12_31_424971	88	33	and	and	CC
10_1101-2020_12_31_424971	88	34	4	4	CD
10_1101-2020_12_31_424971	88	35	)	)	-RRB-
10_1101-2020_12_31_424971	88	36	generated	generate	VBD
10_1101-2020_12_31_424971	88	37	the	the	DT
10_1101-2020_12_31_424971	88	38	same	same	JJ
10_1101-2020_12_31_424971	88	39	amount	amount	NN
10_1101-2020_12_31_424971	88	40	of	of	IN
10_1101-2020_12_31_424971	88	41	fMP	fMP	NNS
10_1101-2020_12_31_424971	88	42	and	and	CC
10_1101-2020_12_31_424971	88	43	fMR	fmr	NN
10_1101-2020_12_31_424971	88	44	,	,	,
10_1101-2020_12_31_424971	88	45	indicating	indicate	VBG
10_1101-2020_12_31_424971	88	46	229	229	CD
10_1101-2020_12_31_424971	88	47	that	that	IN
10_1101-2020_12_31_424971	88	48	the	the	DT
10_1101-2020_12_31_424971	88	49	amino	amino	JJ
10_1101-2020_12_31_424971	88	50	-	-	HYPH
10_1101-2020_12_31_424971	88	51	acid	acid	NN
10_1101-2020_12_31_424971	88	52	identity	identity	NN
10_1101-2020_12_31_424971	88	53	did	do	VBD
10_1101-2020_12_31_424971	88	54	not	not	RB
10_1101-2020_12_31_424971	88	55	affect	affect	VB
10_1101-2020_12_31_424971	88	56	the	the	DT
10_1101-2020_12_31_424971	88	57	level	level	NN
10_1101-2020_12_31_424971	88	58	of	of	IN
10_1101-2020_12_31_424971	88	59	dipeptide	dipeptide	NN
10_1101-2020_12_31_424971	88	60	formation	formation	NN
10_1101-2020_12_31_424971	88	61	.	.	.
10_1101-2020_12_31_424971	89	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	89	2	found	find	VBD
10_1101-2020_12_31_424971	89	3	that	that	IN
10_1101-2020_12_31_424971	89	4	the	the	DT
10_1101-2020_12_31_424971	89	5	230	230	CD
10_1101-2020_12_31_424971	89	6	amount	amount	NN
10_1101-2020_12_31_424971	89	7	of	of	IN
10_1101-2020_12_31_424971	89	8	dipeptide	dipeptide	NN
10_1101-2020_12_31_424971	89	9	formed	form	VBN
10_1101-2020_12_31_424971	89	10	by	by	IN
10_1101-2020_12_31_424971	89	11	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	89	12	and	and	CC
10_1101-2020_12_31_424971	89	13	ProL	ProL	NNP
10_1101-2020_12_31_424971	89	14	-	-	HYPH
10_1101-2020_12_31_424971	89	15	TC	TC	NNP
10_1101-2020_12_31_424971	89	16	in	in	IN
10_1101-2020_12_31_424971	89	17	these	these	DT
10_1101-2020_12_31_424971	89	18	competition	competition	NN
10_1101-2020_12_31_424971	89	19	assays	assays	RB
10_1101-2020_12_31_424971	89	20	was	be	VBD
10_1101-2020_12_31_424971	89	21	similar	similar	JJ
10_1101-2020_12_31_424971	89	22	,	,	,
10_1101-2020_12_31_424971	89	23	231	231	CD
10_1101-2020_12_31_424971	89	24	although	although	IN
10_1101-2020_12_31_424971	89	25	the	the	DT
10_1101-2020_12_31_424971	89	26	amount	amount	NN
10_1101-2020_12_31_424971	89	27	formed	form	VBN
10_1101-2020_12_31_424971	89	28	by	by	IN
10_1101-2020_12_31_424971	89	29	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	89	30	was	be	VBD
10_1101-2020_12_31_424971	89	31	slightly	slightly	RB
10_1101-2020_12_31_424971	89	32	less	less	JJR
10_1101-2020_12_31_424971	89	33	(	(	-LRB-
10_1101-2020_12_31_424971	89	34	45	45	CD
10_1101-2020_12_31_424971	89	35	%	%	NN
10_1101-2020_12_31_424971	89	36	vs.	vs.	NN
10_1101-2020_12_31_424971	89	37	55	55	CD
10_1101-2020_12_31_424971	89	38	%	%	NN
10_1101-2020_12_31_424971	89	39	)	)	-RRB-
10_1101-2020_12_31_424971	89	40	,	,	,
10_1101-2020_12_31_424971	89	41	in	in	IN
10_1101-2020_12_31_424971	89	42	both	both	CC
10_1101-2020_12_31_424971	89	43	the	the	DT
10_1101-2020_12_31_424971	89	44	native-	native-	JJ
10_1101-2020_12_31_424971	89	45	232	232	CD
10_1101-2020_12_31_424971	89	46	(	(	-LRB-
10_1101-2020_12_31_424971	89	47	Bars	Bars	NNP
10_1101-2020_12_31_424971	89	48	5	5	CD
10_1101-2020_12_31_424971	89	49	-	-	SYM
10_1101-2020_12_31_424971	89	50	8	8	CD
10_1101-2020_12_31_424971	89	51	)	)	-RRB-
10_1101-2020_12_31_424971	89	52	and	and	CC
10_1101-2020_12_31_424971	89	53	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	89	54	tRNAs	trnas	CD
10_1101-2020_12_31_424971	89	55	(	(	-LRB-
10_1101-2020_12_31_424971	89	56	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	89	57	Figure	Figure	NNP
10_1101-2020_12_31_424971	89	58	2a	2a	NNP
10_1101-2020_12_31_424971	89	59	)	)	-RRB-
10_1101-2020_12_31_424971	89	60	.	.	.
10_1101-2020_12_31_424971	90	1	These	these	DT
10_1101-2020_12_31_424971	90	2	competition	competition	NN
10_1101-2020_12_31_424971	90	3	experiments	experiment	NNS
10_1101-2020_12_31_424971	90	4	233	233	CD
10_1101-2020_12_31_424971	90	5	provide	provide	VB
10_1101-2020_12_31_424971	90	6	direct	direct	JJ
10_1101-2020_12_31_424971	90	7	evidence	evidence	NN
10_1101-2020_12_31_424971	90	8	that	that	IN
10_1101-2020_12_31_424971	90	9	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	90	10	effectively	effectively	RB
10_1101-2020_12_31_424971	90	11	competes	compete	VBZ
10_1101-2020_12_31_424971	90	12	with	with	IN
10_1101-2020_12_31_424971	90	13	ProL	ProL	NNP
10_1101-2020_12_31_424971	90	14	-	-	HYPH
10_1101-2020_12_31_424971	90	15	TC	TC	NNP
10_1101-2020_12_31_424971	90	16	for	for	IN
10_1101-2020_12_31_424971	90	17	delivery	delivery	NN
10_1101-2020_12_31_424971	90	18	to	to	IN
10_1101-2020_12_31_424971	90	19	the	the	DT
10_1101-2020_12_31_424971	90	20	A	a	NN
10_1101-2020_12_31_424971	90	21	site	site	NN
10_1101-2020_12_31_424971	90	22	234	234	CD
10_1101-2020_12_31_424971	90	23	and	and	CC
10_1101-2020_12_31_424971	90	24	peptide	peptide	NN
10_1101-2020_12_31_424971	90	25	-	-	HYPH
10_1101-2020_12_31_424971	90	26	bond	bond	NN
10_1101-2020_12_31_424971	90	27	formation	formation	NN
10_1101-2020_12_31_424971	90	28	.	.	.
10_1101-2020_12_31_424971	91	1	235	235	CD
10_1101-2020_12_31_424971	91	2	Collectively	collectively	RB
10_1101-2020_12_31_424971	91	3	,	,	,
10_1101-2020_12_31_424971	91	4	the	the	DT
10_1101-2020_12_31_424971	91	5	results	result	NNS
10_1101-2020_12_31_424971	91	6	of	of	IN
10_1101-2020_12_31_424971	91	7	our	-PRON-	PRP$
10_1101-2020_12_31_424971	91	8	GTPase-	gtpase-	JJ
10_1101-2020_12_31_424971	91	9	,	,	,
10_1101-2020_12_31_424971	91	10	dipeptide	dipeptide	NN
10_1101-2020_12_31_424971	91	11	formation-	formation-	NN
10_1101-2020_12_31_424971	91	12	,	,	,
10_1101-2020_12_31_424971	91	13	and	and	CC
10_1101-2020_12_31_424971	91	14	competition	competition	NN
10_1101-2020_12_31_424971	91	15	assays	assays	RB
10_1101-2020_12_31_424971	91	16	indicate	indicate	VBP
10_1101-2020_12_31_424971	91	17	236	236	CD
10_1101-2020_12_31_424971	91	18	that	that	WDT
10_1101-2020_12_31_424971	91	19	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	91	20	is	be	VBZ
10_1101-2020_12_31_424971	91	21	delivered	deliver	VBN
10_1101-2020_12_31_424971	91	22	to	to	IN
10_1101-2020_12_31_424971	91	23	the	the	DT
10_1101-2020_12_31_424971	91	24	A	A	NNP
10_1101-2020_12_31_424971	91	25	site	site	NN
10_1101-2020_12_31_424971	91	26	and	and	CC
10_1101-2020_12_31_424971	91	27	participates	participate	VBZ
10_1101-2020_12_31_424971	91	28	in	in	IN
10_1101-2020_12_31_424971	91	29	peptide	peptide	NN
10_1101-2020_12_31_424971	91	30	-	-	HYPH
10_1101-2020_12_31_424971	91	31	bond	bond	NN
10_1101-2020_12_31_424971	91	32	formation	formation	NN
10_1101-2020_12_31_424971	91	33	in	in	IN
10_1101-2020_12_31_424971	91	34	the	the	DT
10_1101-2020_12_31_424971	91	35	same	same	JJ
10_1101-2020_12_31_424971	91	36	237	237	CD
10_1101-2020_12_31_424971	91	37	way	way	NN
10_1101-2020_12_31_424971	91	38	as	as	IN
10_1101-2020_12_31_424971	91	39	ProL	ProL	NNP
10_1101-2020_12_31_424971	91	40	-	-	HYPH
10_1101-2020_12_31_424971	91	41	TC	TC	NNP
10_1101-2020_12_31_424971	91	42	,	,	,
10_1101-2020_12_31_424971	91	43	suggesting	suggest	VBG
10_1101-2020_12_31_424971	91	44	that	that	IN
10_1101-2020_12_31_424971	91	45	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	91	46	uses	use	VBZ
10_1101-2020_12_31_424971	91	47	triplet	triplet	NN
10_1101-2020_12_31_424971	91	48	pairing	pair	VBG
10_1101-2020_12_31_424971	91	49	in	in	IN
10_1101-2020_12_31_424971	91	50	the	the	DT
10_1101-2020_12_31_424971	91	51	0-frame	0-frame	CD
10_1101-2020_12_31_424971	91	52	at	at	IN
10_1101-2020_12_31_424971	91	53	the	the	DT
10_1101-2020_12_31_424971	91	54	A	A	NNP
10_1101-2020_12_31_424971	91	55	site	site	NN
10_1101-2020_12_31_424971	91	56	that	that	IN
10_1101-2020_12_31_424971	91	57	238	238	CD
10_1101-2020_12_31_424971	91	58	successfully	successfully	RB
10_1101-2020_12_31_424971	91	59	competes	compete	VBZ
10_1101-2020_12_31_424971	91	60	with	with	IN
10_1101-2020_12_31_424971	91	61	triplet	triplet	NN
10_1101-2020_12_31_424971	91	62	pairing	pair	VBG
10_1101-2020_12_31_424971	91	63	by	by	IN
10_1101-2020_12_31_424971	91	64	ProL.	ProL.	NNP
10_1101-2020_12_31_424971	92	1	To	to	TO
10_1101-2020_12_31_424971	92	2	support	support	VB
10_1101-2020_12_31_424971	92	3	this	this	DT
10_1101-2020_12_31_424971	92	4	interpretation	interpretation	NN
10_1101-2020_12_31_424971	92	5	,	,	,
10_1101-2020_12_31_424971	92	6	we	-PRON-	PRP
10_1101-2020_12_31_424971	92	7	measured	measure	VBD
10_1101-2020_12_31_424971	92	8	239	239	CD
10_1101-2020_12_31_424971	92	9	kfMP	kfMP	NNP
10_1101-2020_12_31_424971	92	10	,	,	,
10_1101-2020_12_31_424971	92	11	obs	obs	NN
10_1101-2020_12_31_424971	92	12	in	in	IN
10_1101-2020_12_31_424971	92	13	our	-PRON-	PRP$
10_1101-2020_12_31_424971	92	14	dipeptide	dipeptide	NN
10_1101-2020_12_31_424971	92	15	formation	formation	NN
10_1101-2020_12_31_424971	92	16	assay	assay	NN
10_1101-2020_12_31_424971	92	17	,	,	,
10_1101-2020_12_31_424971	92	18	using	use	VBG
10_1101-2020_12_31_424971	92	19	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	92	20	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	92	21	and	and	CC
10_1101-2020_12_31_424971	92	22	a	a	DT
10_1101-2020_12_31_424971	92	23	series	series	NN
10_1101-2020_12_31_424971	92	24	of	of	IN
10_1101-2020_12_31_424971	92	25	mRNA	mRNA	NNP
10_1101-2020_12_31_424971	92	26	variants	variant	NNS
10_1101-2020_12_31_424971	92	27	240	240	CD
10_1101-2020_12_31_424971	92	28	in	in	IN
10_1101-2020_12_31_424971	92	29	which	which	WDT
10_1101-2020_12_31_424971	92	30	single	single	JJ
10_1101-2020_12_31_424971	92	31	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	92	32	in	in	IN
10_1101-2020_12_31_424971	92	33	the	the	DT
10_1101-2020_12_31_424971	92	34	CCC	CCC	NNP
10_1101-2020_12_31_424971	92	35	-	-	HYPH
10_1101-2020_12_31_424971	92	36	C	C	NNP
10_1101-2020_12_31_424971	92	37	motif	motif	NN
10_1101-2020_12_31_424971	92	38	were	be	VBD
10_1101-2020_12_31_424971	92	39	substituted	substitute	VBN
10_1101-2020_12_31_424971	92	40	.	.	.
10_1101-2020_12_31_424971	93	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	93	2	showed	show	VBD
10_1101-2020_12_31_424971	93	3	that	that	IN
10_1101-2020_12_31_424971	93	4	kfMP	kfMP	NNP
10_1101-2020_12_31_424971	93	5	,	,	,
10_1101-2020_12_31_424971	93	6	obs	obs	NNP
10_1101-2020_12_31_424971	93	7	did	do	VBD
10_1101-2020_12_31_424971	93	8	not	not	RB
10_1101-2020_12_31_424971	93	9	241	241	CD
10_1101-2020_12_31_424971	93	10	decrease	decrease	NN
10_1101-2020_12_31_424971	93	11	upon	upon	IN
10_1101-2020_12_31_424971	93	12	substitution	substitution	NN
10_1101-2020_12_31_424971	93	13	of	of	IN
10_1101-2020_12_31_424971	93	14	the	the	DT
10_1101-2020_12_31_424971	93	15	4th	4th	JJ
10_1101-2020_12_31_424971	93	16	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	93	17	of	of	IN
10_1101-2020_12_31_424971	93	18	the	the	DT
10_1101-2020_12_31_424971	93	19	CCC	CCC	NNP
10_1101-2020_12_31_424971	93	20	-	-	HYPH
10_1101-2020_12_31_424971	93	21	C	C	NNP
10_1101-2020_12_31_424971	93	22	motif	motif	NN
10_1101-2020_12_31_424971	93	23	,	,	,
10_1101-2020_12_31_424971	93	24	but	but	CC
10_1101-2020_12_31_424971	93	25	that	that	IN
10_1101-2020_12_31_424971	93	26	it	-PRON-	PRP
10_1101-2020_12_31_424971	93	27	decreased	decrease	VBD
10_1101-2020_12_31_424971	93	28	242	242	CD
10_1101-2020_12_31_424971	93	29	substantially	substantially	RB
10_1101-2020_12_31_424971	93	30	upon	upon	IN
10_1101-2020_12_31_424971	93	31	substitution	substitution	NN
10_1101-2020_12_31_424971	93	32	of	of	IN
10_1101-2020_12_31_424971	93	33	any	any	DT
10_1101-2020_12_31_424971	93	34	of	of	IN
10_1101-2020_12_31_424971	93	35	the	the	DT
10_1101-2020_12_31_424971	93	36	first	first	JJ
10_1101-2020_12_31_424971	93	37	three	three	CD
10_1101-2020_12_31_424971	93	38	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	93	39	of	of	IN
10_1101-2020_12_31_424971	93	40	the	the	DT
10_1101-2020_12_31_424971	93	41	motif	motif	NN
10_1101-2020_12_31_424971	93	42	(	(	-LRB-
10_1101-2020_12_31_424971	93	43	Figure	Figure	NNP
10_1101-2020_12_31_424971	93	44	3d	3d	NN
10_1101-2020_12_31_424971	93	45	,	,	,
10_1101-2020_12_31_424971	93	46	243	243	CD
10_1101-2020_12_31_424971	93	47	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	93	48	Figure	Figure	NNP
10_1101-2020_12_31_424971	93	49	2b	2b	NNP
10_1101-2020_12_31_424971	93	50	)	)	-RRB-
10_1101-2020_12_31_424971	93	51	.	.	.
10_1101-2020_12_31_424971	94	1	Thus	thus	RB
10_1101-2020_12_31_424971	94	2	,	,	,
10_1101-2020_12_31_424971	94	3	triplet	triplet	NN
10_1101-2020_12_31_424971	94	4	pairing	pairing	NN
10_1101-2020_12_31_424971	94	5	of	of	IN
10_1101-2020_12_31_424971	94	6	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	94	7	to	to	IN
10_1101-2020_12_31_424971	94	8	the	the	DT
10_1101-2020_12_31_424971	94	9	first	first	JJ
10_1101-2020_12_31_424971	94	10	three	three	CD
10_1101-2020_12_31_424971	94	11	Cs	Cs	NNP
10_1101-2020_12_31_424971	94	12	of	of	IN
10_1101-2020_12_31_424971	94	13	the	the	DT
10_1101-2020_12_31_424971	94	14	CCC	CCC	NNP
10_1101-2020_12_31_424971	94	15	-	-	HYPH
10_1101-2020_12_31_424971	94	16	C	C	NNP
10_1101-2020_12_31_424971	94	17	motif	motif	NN
10_1101-2020_12_31_424971	94	18	244	244	CD
10_1101-2020_12_31_424971	94	19	is	be	VBZ
10_1101-2020_12_31_424971	94	20	necessary	necessary	JJ
10_1101-2020_12_31_424971	94	21	and	and	CC
10_1101-2020_12_31_424971	94	22	sufficient	sufficient	JJ
10_1101-2020_12_31_424971	94	23	for	for	IN
10_1101-2020_12_31_424971	94	24	rapid	rapid	JJ
10_1101-2020_12_31_424971	94	25	delivery	delivery	NN
10_1101-2020_12_31_424971	94	26	of	of	IN
10_1101-2020_12_31_424971	94	27	the	the	DT
10_1101-2020_12_31_424971	94	28	tRNA	trna	NN
10_1101-2020_12_31_424971	94	29	to	to	IN
10_1101-2020_12_31_424971	94	30	the	the	DT
10_1101-2020_12_31_424971	94	31	A	A	NNP
10_1101-2020_12_31_424971	94	32	site	site	NN
10_1101-2020_12_31_424971	94	33	and	and	CC
10_1101-2020_12_31_424971	94	34	its	-PRON-	PRP$
10_1101-2020_12_31_424971	94	35	participation	participation	NN
10_1101-2020_12_31_424971	94	36	in	in	IN
10_1101-2020_12_31_424971	94	37	245	245	CD
10_1101-2020_12_31_424971	94	38	peptide	peptide	NN
10_1101-2020_12_31_424971	94	39	-	-	HYPH
10_1101-2020_12_31_424971	94	40	bond	bond	NN
10_1101-2020_12_31_424971	94	41	formation	formation	NN
10_1101-2020_12_31_424971	94	42	.	.	.
10_1101-2020_12_31_424971	95	1	246	246	CD
10_1101-2020_12_31_424971	95	2	247	247	CD
10_1101-2020_12_31_424971	95	3	The	the	DT
10_1101-2020_12_31_424971	95	4	A	A	NNP
10_1101-2020_12_31_424971	95	5	-	-	HYPH
10_1101-2020_12_31_424971	95	6	site	site	NN
10_1101-2020_12_31_424971	95	7	activity	activity	NN
10_1101-2020_12_31_424971	95	8	of	of	IN
10_1101-2020_12_31_424971	95	9	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	95	10	depends	depend	VBZ
10_1101-2020_12_31_424971	95	11	on	on	IN
10_1101-2020_12_31_424971	95	12	the	the	DT
10_1101-2020_12_31_424971	95	13	sequence	sequence	NN
10_1101-2020_12_31_424971	95	14	of	of	IN
10_1101-2020_12_31_424971	95	15	the	the	DT
10_1101-2020_12_31_424971	95	16	anticodon	anticodon	NN
10_1101-2020_12_31_424971	95	17	loop	loop	NN
10_1101-2020_12_31_424971	95	18	248	248	CD
10_1101-2020_12_31_424971	95	19	We	-PRON-	PRP
10_1101-2020_12_31_424971	95	20	next	next	RB
10_1101-2020_12_31_424971	95	21	asked	ask	VBD
10_1101-2020_12_31_424971	95	22	how	how	WRB
10_1101-2020_12_31_424971	95	23	delivery	delivery	NN
10_1101-2020_12_31_424971	95	24	of	of	IN
10_1101-2020_12_31_424971	95	25	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	95	26	to	to	IN
10_1101-2020_12_31_424971	95	27	the	the	DT
10_1101-2020_12_31_424971	95	28	A	a	NN
10_1101-2020_12_31_424971	95	29	site	site	NN
10_1101-2020_12_31_424971	95	30	and	and	CC
10_1101-2020_12_31_424971	95	31	peptide	peptide	NN
10_1101-2020_12_31_424971	95	32	-	-	HYPH
10_1101-2020_12_31_424971	95	33	bond	bond	NN
10_1101-2020_12_31_424971	95	34	formation	formation	NN
10_1101-2020_12_31_424971	95	35	depend	depend	VBP
10_1101-2020_12_31_424971	95	36	on	on	IN
10_1101-2020_12_31_424971	95	37	249	249	CD
10_1101-2020_12_31_424971	95	38	the	the	DT
10_1101-2020_12_31_424971	95	39	sequence	sequence	NN
10_1101-2020_12_31_424971	95	40	of	of	IN
10_1101-2020_12_31_424971	95	41	the	the	DT
10_1101-2020_12_31_424971	95	42	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	95	43	anticodon	anticodon	NN
10_1101-2020_12_31_424971	95	44	loop	loop	NN
10_1101-2020_12_31_424971	95	45	.	.	.
10_1101-2020_12_31_424971	96	1	Starting	start	VBG
10_1101-2020_12_31_424971	96	2	from	from	IN
10_1101-2020_12_31_424971	96	3	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	96	4	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	96	5	,	,	,
10_1101-2020_12_31_424971	96	6	we	-PRON-	PRP
10_1101-2020_12_31_424971	96	7	created	create	VBD
10_1101-2020_12_31_424971	96	8	two	two	CD
10_1101-2020_12_31_424971	96	9	250	250	CD
10_1101-2020_12_31_424971	96	10	variants	variant	NNS
10_1101-2020_12_31_424971	96	11	containing	contain	VBG
10_1101-2020_12_31_424971	96	12	a	a	DT
10_1101-2020_12_31_424971	96	13	G	g	NN
10_1101-2020_12_31_424971	96	14	-	-	HYPH
10_1101-2020_12_31_424971	96	15	to	to	IN
10_1101-2020_12_31_424971	96	16	-	-	HYPH
10_1101-2020_12_31_424971	96	17	C	c	NN
10_1101-2020_12_31_424971	96	18	substitution	substitution	NN
10_1101-2020_12_31_424971	96	19	in	in	IN
10_1101-2020_12_31_424971	96	20	nucleotide	nucleotide	JJ
10_1101-2020_12_31_424971	96	21	37	37	CD
10_1101-2020_12_31_424971	96	22	(	(	-LRB-
10_1101-2020_12_31_424971	96	23	G37C	G37C	NNP
10_1101-2020_12_31_424971	96	24	)	)	-RRB-
10_1101-2020_12_31_424971	96	25	or	or	CC
10_1101-2020_12_31_424971	96	26	34	34	CD
10_1101-2020_12_31_424971	96	27	(	(	-LRB-
10_1101-2020_12_31_424971	96	28	G34C	g34c	NN
10_1101-2020_12_31_424971	96	29	)	)	-RRB-
10_1101-2020_12_31_424971	96	30	within	within	IN
10_1101-2020_12_31_424971	96	31	the	the	DT
10_1101-2020_12_31_424971	96	32	251	251	CD
10_1101-2020_12_31_424971	96	33	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	96	34	loop	loop	NN
10_1101-2020_12_31_424971	96	35	and	and	CC
10_1101-2020_12_31_424971	96	36	adapted	adapt	VBD
10_1101-2020_12_31_424971	96	37	our	-PRON-	PRP$
10_1101-2020_12_31_424971	96	38	dipeptide	dipeptide	NN
10_1101-2020_12_31_424971	96	39	formation	formation	NN
10_1101-2020_12_31_424971	96	40	assay	assay	NN
10_1101-2020_12_31_424971	96	41	to	to	TO
10_1101-2020_12_31_424971	96	42	measure	measure	VB
10_1101-2020_12_31_424971	96	43	the	the	DT
10_1101-2020_12_31_424971	96	44	fMP	fMP	NNS
10_1101-2020_12_31_424971	96	45	yield	yield	NN
10_1101-2020_12_31_424971	96	46	and	and	CC
10_1101-2020_12_31_424971	96	47	kfMP	kfMP	NNP
10_1101-2020_12_31_424971	96	48	,	,	,
10_1101-2020_12_31_424971	96	49	obs	obs	NNP
10_1101-2020_12_31_424971	96	50	252	252	CD
10_1101-2020_12_31_424971	96	51	generated	generate	VBN
10_1101-2020_12_31_424971	96	52	by	by	IN
10_1101-2020_12_31_424971	96	53	each	each	DT
10_1101-2020_12_31_424971	96	54	variant	variant	NN
10_1101-2020_12_31_424971	96	55	at	at	IN
10_1101-2020_12_31_424971	96	56	the	the	DT
10_1101-2020_12_31_424971	96	57	CCC	CCC	NNP
10_1101-2020_12_31_424971	96	58	-	-	HYPH
10_1101-2020_12_31_424971	96	59	C	C	NNP
10_1101-2020_12_31_424971	96	60	motif	motif	NN
10_1101-2020_12_31_424971	96	61	at	at	IN
10_1101-2020_12_31_424971	96	62	the	the	DT
10_1101-2020_12_31_424971	96	63	A	A	NNP
10_1101-2020_12_31_424971	96	64	site	site	NN
10_1101-2020_12_31_424971	96	65	.	.	.
10_1101-2020_12_31_424971	97	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	97	2	showed	show	VBD
10_1101-2020_12_31_424971	97	3	that	that	IN
10_1101-2020_12_31_424971	97	4	the	the	DT
10_1101-2020_12_31_424971	97	5	G37C	G37C	NNP
10_1101-2020_12_31_424971	97	6	variant	variant	NN
10_1101-2020_12_31_424971	97	7	253	253	CD
10_1101-2020_12_31_424971	97	8	resulted	result	VBD
10_1101-2020_12_31_424971	97	9	in	in	IN
10_1101-2020_12_31_424971	97	10	a	a	DT
10_1101-2020_12_31_424971	97	11	fMP	fmp	CD
10_1101-2020_12_31_424971	97	12	yield	yield	NN
10_1101-2020_12_31_424971	97	13	of	of	IN
10_1101-2020_12_31_424971	97	14	32	32	CD
10_1101-2020_12_31_424971	97	15	%	%	NN
10_1101-2020_12_31_424971	97	16	and	and	CC
10_1101-2020_12_31_424971	97	17	a	a	DT
10_1101-2020_12_31_424971	97	18	kfMP	kfMP	NNP
10_1101-2020_12_31_424971	97	19	,	,	,
10_1101-2020_12_31_424971	97	20	obs	obs	NN
10_1101-2020_12_31_424971	97	21	of	of	IN
10_1101-2020_12_31_424971	97	22	0.14	0.14	CD
10_1101-2020_12_31_424971	97	23	±	±	CD
10_1101-2020_12_31_424971	97	24	0.01	0.01	CD
10_1101-2020_12_31_424971	97	25	s–1	s–1	NNS
10_1101-2020_12_31_424971	97	26	,	,	,
10_1101-2020_12_31_424971	97	27	most	most	RBS
10_1101-2020_12_31_424971	97	28	likely	likely	JJ
10_1101-2020_12_31_424971	97	29	by	by	IN
10_1101-2020_12_31_424971	97	30	triplet	triplet	NN
10_1101-2020_12_31_424971	97	31	pairing	pairing	NN
10_1101-2020_12_31_424971	97	32	of	of	IN
10_1101-2020_12_31_424971	97	33	254	254	CD
10_1101-2020_12_31_424971	97	34	.CC	.CC	,
10_1101-2020_12_31_424971	97	35	-	-	HYPH
10_1101-2020_12_31_424971	97	36	BY	by	IN
10_1101-2020_12_31_424971	97	37	-	-	HYPH
10_1101-2020_12_31_424971	97	38	NC	NC	NNP
10_1101-2020_12_31_424971	97	39	-	-	HYPH
10_1101-2020_12_31_424971	97	40	ND	ND	NNP
10_1101-2020_12_31_424971	97	41	4.0	4.0	CD
10_1101-2020_12_31_424971	97	42	International	International	NNP
10_1101-2020_12_31_424971	97	43	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	97	44	under	under	IN
10_1101-2020_12_31_424971	97	45	a	a	DT
10_1101-2020_12_31_424971	97	46	(	(	-LRB-
10_1101-2020_12_31_424971	97	47	which	which	WDT
10_1101-2020_12_31_424971	97	48	was	be	VBD
10_1101-2020_12_31_424971	97	49	not	not	RB
10_1101-2020_12_31_424971	97	50	certified	certify	VBN
10_1101-2020_12_31_424971	97	51	by	by	IN
10_1101-2020_12_31_424971	97	52	peer	peer	NN
10_1101-2020_12_31_424971	97	53	review	review	NN
10_1101-2020_12_31_424971	97	54	)	)	-RRB-
10_1101-2020_12_31_424971	97	55	is	be	VBZ
10_1101-2020_12_31_424971	97	56	the	the	DT
10_1101-2020_12_31_424971	97	57	author	author	NN
10_1101-2020_12_31_424971	97	58	/	/	SYM
10_1101-2020_12_31_424971	97	59	funder	funder	NN
10_1101-2020_12_31_424971	97	60	,	,	,
10_1101-2020_12_31_424971	97	61	who	who	WP
10_1101-2020_12_31_424971	97	62	has	have	VBZ
10_1101-2020_12_31_424971	97	63	granted	grant	VBN
10_1101-2020_12_31_424971	97	64	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	97	65	a	a	DT
10_1101-2020_12_31_424971	97	66	license	license	NN
10_1101-2020_12_31_424971	97	67	to	to	TO
10_1101-2020_12_31_424971	97	68	display	display	VB
10_1101-2020_12_31_424971	97	69	the	the	DT
10_1101-2020_12_31_424971	97	70	preprint	preprint	NN
10_1101-2020_12_31_424971	97	71	in	in	IN
10_1101-2020_12_31_424971	97	72	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	97	73	.	.	.
10_1101-2020_12_31_424971	98	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	98	2	is	be	VBZ
10_1101-2020_12_31_424971	98	3	made	make	VBN
10_1101-2020_12_31_424971	98	4	The	the	DT
10_1101-2020_12_31_424971	98	5	copyright	copyright	NN
10_1101-2020_12_31_424971	98	6	holder	holder	NN
10_1101-2020_12_31_424971	98	7	for	for	IN
10_1101-2020_12_31_424971	98	8	this	this	DT
10_1101-2020_12_31_424971	98	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	98	10	version	version	NN
10_1101-2020_12_31_424971	98	11	posted	post	VBD
10_1101-2020_12_31_424971	98	12	January	January	NNP
10_1101-2020_12_31_424971	98	13	2	2	CD
10_1101-2020_12_31_424971	98	14	,	,	,
10_1101-2020_12_31_424971	98	15	2021	2021	CD
10_1101-2020_12_31_424971	98	16	.	.	.
10_1101-2020_12_31_424971	98	17	;	;	:
10_1101-2020_12_31_424971	98	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	98	19	:	:	:
10_1101-2020_12_31_424971	98	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	98	21	preprint	preprint	NN
10_1101-2020_12_31_424971	98	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	98	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	98	24	11	11	CD
10_1101-2020_12_31_424971	98	25	nucleotides	nucleotide	VBZ
10_1101-2020_12_31_424971	98	26	34	34	CD
10_1101-2020_12_31_424971	98	27	-	-	SYM
10_1101-2020_12_31_424971	98	28	36	36	CD
10_1101-2020_12_31_424971	98	29	of	of	IN
10_1101-2020_12_31_424971	98	30	the	the	DT
10_1101-2020_12_31_424971	98	31	anticodon	anticodon	NN
10_1101-2020_12_31_424971	98	32	loop	loop	NN
10_1101-2020_12_31_424971	98	33	with	with	IN
10_1101-2020_12_31_424971	98	34	the	the	DT
10_1101-2020_12_31_424971	98	35	0-frame	0-frame	CD
10_1101-2020_12_31_424971	98	36	of	of	IN
10_1101-2020_12_31_424971	98	37	the	the	DT
10_1101-2020_12_31_424971	98	38	CCC	CCC	NNP
10_1101-2020_12_31_424971	98	39	-	-	HYPH
10_1101-2020_12_31_424971	98	40	C	C	NNP
10_1101-2020_12_31_424971	98	41	motif	motif	NN
10_1101-2020_12_31_424971	98	42	(	(	-LRB-
10_1101-2020_12_31_424971	98	43	Figure	Figure	NNP
10_1101-2020_12_31_424971	98	44	4a	4a	CD
10_1101-2020_12_31_424971	98	45	)	)	-RRB-
10_1101-2020_12_31_424971	98	46	.	.	.
10_1101-2020_12_31_424971	99	1	In	in	IN
10_1101-2020_12_31_424971	99	2	255	255	CD
10_1101-2020_12_31_424971	99	3	contrast	contrast	NN
10_1101-2020_12_31_424971	99	4	,	,	,
10_1101-2020_12_31_424971	99	5	the	the	DT
10_1101-2020_12_31_424971	99	6	G34C	G34C	NNP
10_1101-2020_12_31_424971	99	7	variant	variant	NN
10_1101-2020_12_31_424971	99	8	resulted	result	VBD
10_1101-2020_12_31_424971	99	9	in	in	IN
10_1101-2020_12_31_424971	99	10	a	a	DT
10_1101-2020_12_31_424971	99	11	fMP	fmp	CD
10_1101-2020_12_31_424971	99	12	yield	yield	NN
10_1101-2020_12_31_424971	99	13	of	of	IN
10_1101-2020_12_31_424971	99	14	30	30	CD
10_1101-2020_12_31_424971	99	15	%	%	NN
10_1101-2020_12_31_424971	99	16	and	and	CC
10_1101-2020_12_31_424971	99	17	a	a	DT
10_1101-2020_12_31_424971	99	18	kfMP	kfMP	NNP
10_1101-2020_12_31_424971	99	19	,	,	,
10_1101-2020_12_31_424971	99	20	obs	obs	NN
10_1101-2020_12_31_424971	99	21	of	of	IN
10_1101-2020_12_31_424971	99	22	0.28	0.28	CD
10_1101-2020_12_31_424971	99	23	±	±	CD
10_1101-2020_12_31_424971	99	24	0.04	0.04	CD
10_1101-2020_12_31_424971	99	25	s–1	s–1	NNS
10_1101-2020_12_31_424971	99	26	,	,	,
10_1101-2020_12_31_424971	99	27	most	most	JJS
10_1101-2020_12_31_424971	99	28	256	256	CD
10_1101-2020_12_31_424971	99	29	likely	likely	JJ
10_1101-2020_12_31_424971	99	30	by	by	IN
10_1101-2020_12_31_424971	99	31	triplet	triplet	NN
10_1101-2020_12_31_424971	99	32	pairing	pairing	NN
10_1101-2020_12_31_424971	99	33	of	of	IN
10_1101-2020_12_31_424971	99	34	nucleotides	nucleotide	VBZ
10_1101-2020_12_31_424971	99	35	35	35	CD
10_1101-2020_12_31_424971	99	36	-	-	SYM
10_1101-2020_12_31_424971	99	37	37	37	CD
10_1101-2020_12_31_424971	99	38	of	of	IN
10_1101-2020_12_31_424971	99	39	the	the	DT
10_1101-2020_12_31_424971	99	40	anticodon	anticodon	NN
10_1101-2020_12_31_424971	99	41	loop	loop	NN
10_1101-2020_12_31_424971	99	42	with	with	IN
10_1101-2020_12_31_424971	99	43	the	the	DT
10_1101-2020_12_31_424971	99	44	0-frame	0-frame	CD
10_1101-2020_12_31_424971	99	45	of	of	IN
10_1101-2020_12_31_424971	99	46	the	the	DT
10_1101-2020_12_31_424971	99	47	CCC	CCC	NNP
10_1101-2020_12_31_424971	99	48	-	-	HYPH
10_1101-2020_12_31_424971	99	49	C	C	NNP
10_1101-2020_12_31_424971	99	50	257	257	CD
10_1101-2020_12_31_424971	99	51	motif	motif	NN
10_1101-2020_12_31_424971	99	52	(	(	-LRB-
10_1101-2020_12_31_424971	99	53	Figure	Figure	NNP
10_1101-2020_12_31_424971	99	54	4b	4b	NNP
10_1101-2020_12_31_424971	99	55	)	)	-RRB-
10_1101-2020_12_31_424971	99	56	.	.	.
10_1101-2020_12_31_424971	100	1	Our	-PRON-	PRP$
10_1101-2020_12_31_424971	100	2	interpretation	interpretation	NN
10_1101-2020_12_31_424971	100	3	that	that	WDT
10_1101-2020_12_31_424971	100	4	nucleotides	nucleotide	VBZ
10_1101-2020_12_31_424971	100	5	35	35	CD
10_1101-2020_12_31_424971	100	6	-	-	SYM
10_1101-2020_12_31_424971	100	7	37	37	CD
10_1101-2020_12_31_424971	100	8	of	of	IN
10_1101-2020_12_31_424971	100	9	the	the	DT
10_1101-2020_12_31_424971	100	10	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	100	11	loop	loop	NN
10_1101-2020_12_31_424971	100	12	of	of	IN
10_1101-2020_12_31_424971	100	13	the	the	DT
10_1101-2020_12_31_424971	100	14	G34C	G34C	NNP
10_1101-2020_12_31_424971	100	15	258	258	CD
10_1101-2020_12_31_424971	100	16	variant	variant	JJ
10_1101-2020_12_31_424971	100	17	most	most	RBS
10_1101-2020_12_31_424971	100	18	likely	likely	JJ
10_1101-2020_12_31_424971	100	19	triplet	triplet	NN
10_1101-2020_12_31_424971	100	20	pair	pair	NN
10_1101-2020_12_31_424971	100	21	with	with	IN
10_1101-2020_12_31_424971	100	22	the	the	DT
10_1101-2020_12_31_424971	100	23	0-frame	0-frame	CD
10_1101-2020_12_31_424971	100	24	of	of	IN
10_1101-2020_12_31_424971	100	25	the	the	DT
10_1101-2020_12_31_424971	100	26	CCC	CCC	NNP
10_1101-2020_12_31_424971	100	27	-	-	HYPH
10_1101-2020_12_31_424971	100	28	C	C	NNP
10_1101-2020_12_31_424971	100	29	motif	motif	NN
10_1101-2020_12_31_424971	100	30	is	be	VBZ
10_1101-2020_12_31_424971	100	31	consistent	consistent	JJ
10_1101-2020_12_31_424971	100	32	with	with	IN
10_1101-2020_12_31_424971	100	33	the	the	DT
10_1101-2020_12_31_424971	100	34	259	259	CD
10_1101-2020_12_31_424971	100	35	observations	observation	NNS
10_1101-2020_12_31_424971	100	36	that	that	WDT
10_1101-2020_12_31_424971	100	37	the	the	DT
10_1101-2020_12_31_424971	100	38	fMP	fMP	NNS
10_1101-2020_12_31_424971	100	39	yield	yield	NN
10_1101-2020_12_31_424971	100	40	and	and	CC
10_1101-2020_12_31_424971	100	41	kfMP	kfMP	NNP
10_1101-2020_12_31_424971	100	42	,	,	,
10_1101-2020_12_31_424971	100	43	obs	obs	NN
10_1101-2020_12_31_424971	100	44	of	of	IN
10_1101-2020_12_31_424971	100	45	the	the	DT
10_1101-2020_12_31_424971	100	46	G34C	G34C	NNP
10_1101-2020_12_31_424971	100	47	variant	variant	NN
10_1101-2020_12_31_424971	100	48	are	be	VBP
10_1101-2020_12_31_424971	100	49	similar	similar	JJ
10_1101-2020_12_31_424971	100	50	and	and	CC
10_1101-2020_12_31_424971	100	51	2-fold	2-fold	CD
10_1101-2020_12_31_424971	100	52	higher	high	JJR
10_1101-2020_12_31_424971	100	53	,	,	,
10_1101-2020_12_31_424971	100	54	260	260	CD
10_1101-2020_12_31_424971	100	55	respectively	respectively	RB
10_1101-2020_12_31_424971	100	56	,	,	,
10_1101-2020_12_31_424971	100	57	than	than	IN
10_1101-2020_12_31_424971	100	58	those	those	DT
10_1101-2020_12_31_424971	100	59	of	of	IN
10_1101-2020_12_31_424971	100	60	the	the	DT
10_1101-2020_12_31_424971	100	61	G37C	G37C	NNP
10_1101-2020_12_31_424971	100	62	variant	variant	NN
10_1101-2020_12_31_424971	100	63	.	.	.
10_1101-2020_12_31_424971	101	1	If	if	IN
10_1101-2020_12_31_424971	101	2	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	101	3	34	34	CD
10_1101-2020_12_31_424971	101	4	-	-	SYM
10_1101-2020_12_31_424971	101	5	36	36	CD
10_1101-2020_12_31_424971	101	6	of	of	IN
10_1101-2020_12_31_424971	101	7	the	the	DT
10_1101-2020_12_31_424971	101	8	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	101	9	loop	loop	NN
10_1101-2020_12_31_424971	101	10	of	of	IN
10_1101-2020_12_31_424971	101	11	the	the	DT
10_1101-2020_12_31_424971	101	12	261	261	CD
10_1101-2020_12_31_424971	101	13	G34C	G34C	NNP
10_1101-2020_12_31_424971	101	14	variant	variant	NN
10_1101-2020_12_31_424971	101	15	were	be	VBD
10_1101-2020_12_31_424971	101	16	to	to	TO
10_1101-2020_12_31_424971	101	17	form	form	VB
10_1101-2020_12_31_424971	101	18	a	a	DT
10_1101-2020_12_31_424971	101	19	triplet	triplet	NN
10_1101-2020_12_31_424971	101	20	pair	pair	NN
10_1101-2020_12_31_424971	101	21	with	with	IN
10_1101-2020_12_31_424971	101	22	the	the	DT
10_1101-2020_12_31_424971	101	23	CCC	CCC	NNP
10_1101-2020_12_31_424971	101	24	-	-	HYPH
10_1101-2020_12_31_424971	101	25	C	C	NNP
10_1101-2020_12_31_424971	101	26	motif	motif	NN
10_1101-2020_12_31_424971	101	27	,	,	,
10_1101-2020_12_31_424971	101	28	we	-PRON-	PRP
10_1101-2020_12_31_424971	101	29	would	would	MD
10_1101-2020_12_31_424971	101	30	have	have	VB
10_1101-2020_12_31_424971	101	31	expected	expect	VBN
10_1101-2020_12_31_424971	101	32	it	-PRON-	PRP
10_1101-2020_12_31_424971	101	33	to	to	TO
10_1101-2020_12_31_424971	101	34	pair	pair	VB
10_1101-2020_12_31_424971	101	35	262	262	CD
10_1101-2020_12_31_424971	101	36	in	in	IN
10_1101-2020_12_31_424971	101	37	the	the	DT
10_1101-2020_12_31_424971	101	38	+2-frame	+2-frame	NN
10_1101-2020_12_31_424971	101	39	,	,	,
10_1101-2020_12_31_424971	101	40	which	which	WDT
10_1101-2020_12_31_424971	101	41	would	would	MD
10_1101-2020_12_31_424971	101	42	have	have	VB
10_1101-2020_12_31_424971	101	43	most	most	RBS
10_1101-2020_12_31_424971	101	44	likely	likely	RB
10_1101-2020_12_31_424971	101	45	reduced	reduce	VBN
10_1101-2020_12_31_424971	101	46	the	the	DT
10_1101-2020_12_31_424971	101	47	fMP	fmp	CD
10_1101-2020_12_31_424971	101	48	yield	yield	NN
10_1101-2020_12_31_424971	101	49	and	and	CC
10_1101-2020_12_31_424971	101	50	kfMP	kfMP	NNP
10_1101-2020_12_31_424971	101	51	,	,	,
10_1101-2020_12_31_424971	101	52	obs	obs	NN
10_1101-2020_12_31_424971	101	53	of	of	IN
10_1101-2020_12_31_424971	101	54	the	the	DT
10_1101-2020_12_31_424971	101	55	G34C	G34C	NNP
10_1101-2020_12_31_424971	101	56	263	263	CD
10_1101-2020_12_31_424971	101	57	variant	variant	JJ
10_1101-2020_12_31_424971	101	58	relative	relative	NN
10_1101-2020_12_31_424971	101	59	to	to	IN
10_1101-2020_12_31_424971	101	60	the	the	DT
10_1101-2020_12_31_424971	101	61	G37C	G37C	NNP
10_1101-2020_12_31_424971	101	62	variant	variant	NN
10_1101-2020_12_31_424971	101	63	.	.	.
10_1101-2020_12_31_424971	102	1	These	these	DT
10_1101-2020_12_31_424971	102	2	results	result	NNS
10_1101-2020_12_31_424971	102	3	suggest	suggest	VBP
10_1101-2020_12_31_424971	102	4	that	that	IN
10_1101-2020_12_31_424971	102	5	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	102	6	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	102	7	exhibits	exhibit	VBZ
10_1101-2020_12_31_424971	102	8	some	some	DT
10_1101-2020_12_31_424971	102	9	264	264	CD
10_1101-2020_12_31_424971	102	10	plasticity	plasticity	NN
10_1101-2020_12_31_424971	102	11	as	as	IN
10_1101-2020_12_31_424971	102	12	to	to	IN
10_1101-2020_12_31_424971	102	13	whether	whether	IN
10_1101-2020_12_31_424971	102	14	it	-PRON-	PRP
10_1101-2020_12_31_424971	102	15	can	can	MD
10_1101-2020_12_31_424971	102	16	undergo	undergo	VB
10_1101-2020_12_31_424971	102	17	triplet	triplet	NN
10_1101-2020_12_31_424971	102	18	pairing	pair	VBG
10_1101-2020_12_31_424971	102	19	with	with	IN
10_1101-2020_12_31_424971	102	20	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	102	21	loop	loop	NNP
10_1101-2020_12_31_424971	102	22	nucleotides	nucleotide	VBZ
10_1101-2020_12_31_424971	102	23	34	34	CD
10_1101-2020_12_31_424971	102	24	-	-	SYM
10_1101-2020_12_31_424971	102	25	36	36	CD
10_1101-2020_12_31_424971	102	26	or	or	CC
10_1101-2020_12_31_424971	102	27	35	35	CD
10_1101-2020_12_31_424971	102	28	-	-	SYM
10_1101-2020_12_31_424971	102	29	265	265	CD
10_1101-2020_12_31_424971	102	30	37	37	CD
10_1101-2020_12_31_424971	102	31	,	,	,
10_1101-2020_12_31_424971	102	32	consistent	consistent	JJ
10_1101-2020_12_31_424971	102	33	with	with	IN
10_1101-2020_12_31_424971	102	34	a	a	DT
10_1101-2020_12_31_424971	102	35	previous	previous	JJ
10_1101-2020_12_31_424971	102	36	study33	study33	NN
10_1101-2020_12_31_424971	102	37	.	.	.
10_1101-2020_12_31_424971	103	1	266	266	CD
10_1101-2020_12_31_424971	103	2	267	267	CD
10_1101-2020_12_31_424971	103	3	SufB2	sufb2	CD
10_1101-2020_12_31_424971	103	4	shifts	shift	NNS
10_1101-2020_12_31_424971	103	5	to	to	IN
10_1101-2020_12_31_424971	103	6	the	the	DT
10_1101-2020_12_31_424971	103	7	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	103	8	during	during	IN
10_1101-2020_12_31_424971	103	9	translocation	translocation	NN
10_1101-2020_12_31_424971	103	10	268	268	CD
10_1101-2020_12_31_424971	103	11	Although	although	IN
10_1101-2020_12_31_424971	103	12	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	103	13	uses	use	VBZ
10_1101-2020_12_31_424971	103	14	triplet	triplet	NN
10_1101-2020_12_31_424971	103	15	pairing	pair	VBG
10_1101-2020_12_31_424971	103	16	in	in	IN
10_1101-2020_12_31_424971	103	17	the	the	DT
10_1101-2020_12_31_424971	103	18	0-frame	0-frame	CD
10_1101-2020_12_31_424971	103	19	when	when	WRB
10_1101-2020_12_31_424971	103	20	it	-PRON-	PRP
10_1101-2020_12_31_424971	103	21	is	be	VBZ
10_1101-2020_12_31_424971	103	22	delivered	deliver	VBN
10_1101-2020_12_31_424971	103	23	to	to	IN
10_1101-2020_12_31_424971	103	24	the	the	DT
10_1101-2020_12_31_424971	103	25	A	A	NNP
10_1101-2020_12_31_424971	103	26	site	site	NN
10_1101-2020_12_31_424971	103	27	,	,	,
10_1101-2020_12_31_424971	103	28	it	-PRON-	PRP
10_1101-2020_12_31_424971	103	29	is	be	VBZ
10_1101-2020_12_31_424971	103	30	a	a	DT
10_1101-2020_12_31_424971	103	31	269	269	CD
10_1101-2020_12_31_424971	103	32	highly	highly	RB
10_1101-2020_12_31_424971	103	33	efficient	efficient	JJ
10_1101-2020_12_31_424971	103	34	+1-frameshifting	+1-frameshifting	NN
10_1101-2020_12_31_424971	103	35	tRNA	trna	NN
10_1101-2020_12_31_424971	103	36	(	(	-LRB-
10_1101-2020_12_31_424971	103	37	Figure	figure	NN
10_1101-2020_12_31_424971	103	38	2	2	CD
10_1101-2020_12_31_424971	103	39	)	)	-RRB-
10_1101-2020_12_31_424971	103	40	.	.	.
10_1101-2020_12_31_424971	104	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	104	2	therefore	therefore	RB
10_1101-2020_12_31_424971	104	3	asked	ask	VBD
10_1101-2020_12_31_424971	104	4	whether	whether	IN
10_1101-2020_12_31_424971	104	5	+1	+1	NNS
10_1101-2020_12_31_424971	104	6	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	104	7	270	270	CD
10_1101-2020_12_31_424971	104	8	occurs	occur	NNS
10_1101-2020_12_31_424971	104	9	during	during	IN
10_1101-2020_12_31_424971	104	10	or	or	CC
10_1101-2020_12_31_424971	104	11	after	after	IN
10_1101-2020_12_31_424971	104	12	translocation	translocation	NN
10_1101-2020_12_31_424971	104	13	of	of	IN
10_1101-2020_12_31_424971	104	14	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	104	15	into	into	IN
10_1101-2020_12_31_424971	104	16	the	the	DT
10_1101-2020_12_31_424971	104	17	P	p	NN
10_1101-2020_12_31_424971	104	18	site	site	NN
10_1101-2020_12_31_424971	104	19	.	.	.
10_1101-2020_12_31_424971	105	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	105	2	addressed	address	VBD
10_1101-2020_12_31_424971	105	3	this	this	DT
10_1101-2020_12_31_424971	105	4	question	question	NN
10_1101-2020_12_31_424971	105	5	by	by	IN
10_1101-2020_12_31_424971	105	6	271	271	CD
10_1101-2020_12_31_424971	105	7	adapting	adapt	VBG
10_1101-2020_12_31_424971	105	8	our	-PRON-	PRP$
10_1101-2020_12_31_424971	105	9	previously	previously	RB
10_1101-2020_12_31_424971	105	10	developed	develop	VBN
10_1101-2020_12_31_424971	105	11	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	105	12	formation	formation	NN
10_1101-2020_12_31_424971	105	13	assays29	assays29	NN
10_1101-2020_12_31_424971	105	14	.	.	.
10_1101-2020_12_31_424971	106	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	106	2	rapidly	rapidly	RB
10_1101-2020_12_31_424971	106	3	delivered	deliver	VBD
10_1101-2020_12_31_424971	106	4	EF	EF	NNP
10_1101-2020_12_31_424971	106	5	-	-	HYPH
10_1101-2020_12_31_424971	106	6	G	G	NNP
10_1101-2020_12_31_424971	106	7	and	and	CC
10_1101-2020_12_31_424971	106	8	272	272	CD
10_1101-2020_12_31_424971	106	9	an	an	DT
10_1101-2020_12_31_424971	106	10	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	106	11	mixture	mixture	NN
10_1101-2020_12_31_424971	106	12	of	of	IN
10_1101-2020_12_31_424971	106	13	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	106	14	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	106	15	,	,	,
10_1101-2020_12_31_424971	106	16	tRNAVal-	tRNAVal-	NNP
10_1101-2020_12_31_424971	106	17	,	,	,
10_1101-2020_12_31_424971	106	18	and	and	CC
10_1101-2020_12_31_424971	106	19	tRNAArg	tRNAArg	NNP
10_1101-2020_12_31_424971	106	20	-	-	HYPH
10_1101-2020_12_31_424971	106	21	TCs	TCs	NNP
10_1101-2020_12_31_424971	106	22	to	to	IN
10_1101-2020_12_31_424971	106	23	70S	70S	NNP
10_1101-2020_12_31_424971	106	24	ICs	ic	NNS
10_1101-2020_12_31_424971	106	25	assembled	assemble	VBD
10_1101-2020_12_31_424971	106	26	on	on	IN
10_1101-2020_12_31_424971	106	27	273	273	CD
10_1101-2020_12_31_424971	106	28	an	an	DT
10_1101-2020_12_31_424971	106	29	mRNA	mrna	NN
10_1101-2020_12_31_424971	106	30	in	in	IN
10_1101-2020_12_31_424971	106	31	which	which	WDT
10_1101-2020_12_31_424971	106	32	the	the	DT
10_1101-2020_12_31_424971	106	33	2nd	2nd	JJ
10_1101-2020_12_31_424971	106	34	codon	codon	NN
10_1101-2020_12_31_424971	106	35	was	be	VBD
10_1101-2020_12_31_424971	106	36	a	a	DT
10_1101-2020_12_31_424971	106	37	CCC	CCC	NNP
10_1101-2020_12_31_424971	106	38	-	-	HYPH
10_1101-2020_12_31_424971	106	39	C	C	NNP
10_1101-2020_12_31_424971	106	40	motif	motif	NN
10_1101-2020_12_31_424971	106	41	and	and	CC
10_1101-2020_12_31_424971	106	42	the	the	DT
10_1101-2020_12_31_424971	106	43	3rd	3rd	JJ
10_1101-2020_12_31_424971	106	44	codon	codon	NN
10_1101-2020_12_31_424971	106	45	was	be	VBD
10_1101-2020_12_31_424971	106	46	either	either	CC
10_1101-2020_12_31_424971	106	47	a	a	DT
10_1101-2020_12_31_424971	106	48	GUU	GUU	NNP
10_1101-2020_12_31_424971	106	49	codon	codon	NN
10_1101-2020_12_31_424971	106	50	274	274	CD
10_1101-2020_12_31_424971	106	51	encoding	encode	VBG
10_1101-2020_12_31_424971	106	52	Val	Val	NNP
10_1101-2020_12_31_424971	106	53	in	in	IN
10_1101-2020_12_31_424971	106	54	the	the	DT
10_1101-2020_12_31_424971	106	55	+1	+1	NNS
10_1101-2020_12_31_424971	106	56	frame	frame	NN
10_1101-2020_12_31_424971	106	57	or	or	CC
10_1101-2020_12_31_424971	106	58	a	a	DT
10_1101-2020_12_31_424971	106	59	CGU	cgu	NN
10_1101-2020_12_31_424971	106	60	codon	codon	NN
10_1101-2020_12_31_424971	106	61	encoding	encode	VBG
10_1101-2020_12_31_424971	106	62	Arg	arg	NN
10_1101-2020_12_31_424971	106	63	in	in	IN
10_1101-2020_12_31_424971	106	64	the	the	DT
10_1101-2020_12_31_424971	106	65	0-frame	0-frame	CD
10_1101-2020_12_31_424971	106	66	.	.	.
10_1101-2020_12_31_424971	107	1	As	as	RB
10_1101-2020_12_31_424971	107	2	soon	soon	RB
10_1101-2020_12_31_424971	107	3	as	as	IN
10_1101-2020_12_31_424971	107	4	275	275	CD
10_1101-2020_12_31_424971	107	5	translocation	translocation	NN
10_1101-2020_12_31_424971	107	6	of	of	IN
10_1101-2020_12_31_424971	107	7	the	the	DT
10_1101-2020_12_31_424971	107	8	PRE	PRE	NNP
10_1101-2020_12_31_424971	107	9	complex	complex	NN
10_1101-2020_12_31_424971	107	10	and	and	CC
10_1101-2020_12_31_424971	107	11	the	the	DT
10_1101-2020_12_31_424971	107	12	associated	associated	JJ
10_1101-2020_12_31_424971	107	13	movement	movement	NN
10_1101-2020_12_31_424971	107	14	of	of	IN
10_1101-2020_12_31_424971	107	15	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	107	16	from	from	IN
10_1101-2020_12_31_424971	107	17	the	the	DT
10_1101-2020_12_31_424971	107	18	P	p	NN
10_1101-2020_12_31_424971	107	19	to	to	IN
10_1101-2020_12_31_424971	107	20	A	a	DT
10_1101-2020_12_31_424971	107	21	sites	site	NNS
10_1101-2020_12_31_424971	107	22	276	276	CD
10_1101-2020_12_31_424971	107	23	formed	form	VBD
10_1101-2020_12_31_424971	107	24	a	a	DT
10_1101-2020_12_31_424971	107	25	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	107	26	post	post	NN
10_1101-2020_12_31_424971	107	27	-	-	JJ
10_1101-2020_12_31_424971	107	28	translocation	translocation	JJ
10_1101-2020_12_31_424971	107	29	(	(	-LRB-
10_1101-2020_12_31_424971	107	30	POST	POST	NNP
10_1101-2020_12_31_424971	107	31	)	)	-RRB-
10_1101-2020_12_31_424971	107	32	complex	complex	NN
10_1101-2020_12_31_424971	107	33	with	with	IN
10_1101-2020_12_31_424971	107	34	an	an	DT
10_1101-2020_12_31_424971	107	35	empty	empty	JJ
10_1101-2020_12_31_424971	107	36	A	a	DT
10_1101-2020_12_31_424971	107	37	site	site	NN
10_1101-2020_12_31_424971	107	38	in	in	IN
10_1101-2020_12_31_424971	107	39	these	these	DT
10_1101-2020_12_31_424971	107	40	experiments	experiment	NNS
10_1101-2020_12_31_424971	107	41	,	,	,
10_1101-2020_12_31_424971	107	42	277	277	CD
10_1101-2020_12_31_424971	107	43	tRNAVal-	tRNAVal-	NNP
10_1101-2020_12_31_424971	107	44	and	and	CC
10_1101-2020_12_31_424971	107	45	tRNAArg	tRNAArg	NNP
10_1101-2020_12_31_424971	107	46	-	-	HYPH
10_1101-2020_12_31_424971	107	47	TC	TC	NNP
10_1101-2020_12_31_424971	107	48	would	would	MD
10_1101-2020_12_31_424971	107	49	compete	compete	VB
10_1101-2020_12_31_424971	107	50	for	for	IN
10_1101-2020_12_31_424971	107	51	the	the	DT
10_1101-2020_12_31_424971	107	52	codon	codon	NN
10_1101-2020_12_31_424971	107	53	at	at	IN
10_1101-2020_12_31_424971	107	54	the	the	DT
10_1101-2020_12_31_424971	107	55	A	A	NNP
10_1101-2020_12_31_424971	107	56	site	site	NN
10_1101-2020_12_31_424971	107	57	to	to	TO
10_1101-2020_12_31_424971	107	58	promote	promote	VB
10_1101-2020_12_31_424971	107	59	formation	formation	NN
10_1101-2020_12_31_424971	107	60	of	of	IN
10_1101-2020_12_31_424971	107	61	an	an	DT
10_1101-2020_12_31_424971	107	62	278	278	CD
10_1101-2020_12_31_424971	107	63	fMPV	fmpv	NN
10_1101-2020_12_31_424971	107	64	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	107	65	or	or	CC
10_1101-2020_12_31_424971	107	66	an	an	DT
10_1101-2020_12_31_424971	107	67	fMPR	fmpr	JJ
10_1101-2020_12_31_424971	107	68	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	107	69	.	.	.
10_1101-2020_12_31_424971	108	1	Thus	thus	RB
10_1101-2020_12_31_424971	108	2	,	,	,
10_1101-2020_12_31_424971	108	3	the	the	DT
10_1101-2020_12_31_424971	108	4	fMPV	fmpv	JJ
10_1101-2020_12_31_424971	108	5	yield	yield	NN
10_1101-2020_12_31_424971	108	6	and	and	CC
10_1101-2020_12_31_424971	108	7	kfMPV	kfmpv	NN
10_1101-2020_12_31_424971	108	8	,	,	,
10_1101-2020_12_31_424971	108	9	obs	obs	NN
10_1101-2020_12_31_424971	108	10	report	report	NN
10_1101-2020_12_31_424971	108	11	on	on	IN
10_1101-2020_12_31_424971	108	12	the	the	DT
10_1101-2020_12_31_424971	108	13	sub-279	sub-279	NNP
10_1101-2020_12_31_424971	108	14	population	population	NN
10_1101-2020_12_31_424971	108	15	of	of	IN
10_1101-2020_12_31_424971	108	16	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	108	17	that	that	WDT
10_1101-2020_12_31_424971	108	18	shifted	shift	VBD
10_1101-2020_12_31_424971	108	19	to	to	IN
10_1101-2020_12_31_424971	108	20	the	the	DT
10_1101-2020_12_31_424971	108	21	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	108	22	,	,	,
10_1101-2020_12_31_424971	108	23	whereas	whereas	IN
10_1101-2020_12_31_424971	108	24	the	the	DT
10_1101-2020_12_31_424971	108	25	fMPR	fmpr	JJ
10_1101-2020_12_31_424971	108	26	yield	yield	NN
10_1101-2020_12_31_424971	108	27	and	and	CC
10_1101-2020_12_31_424971	108	28	kfMPR	kfmpr	NN
10_1101-2020_12_31_424971	108	29	,	,	,
10_1101-2020_12_31_424971	108	30	obs	obs	NN
10_1101-2020_12_31_424971	108	31	report	report	NN
10_1101-2020_12_31_424971	108	32	on	on	IN
10_1101-2020_12_31_424971	108	33	280	280	CD
10_1101-2020_12_31_424971	108	34	.CC	.CC	NFP
10_1101-2020_12_31_424971	108	35	-	-	HYPH
10_1101-2020_12_31_424971	108	36	BY	by	IN
10_1101-2020_12_31_424971	108	37	-	-	HYPH
10_1101-2020_12_31_424971	108	38	NC	NC	NNP
10_1101-2020_12_31_424971	108	39	-	-	HYPH
10_1101-2020_12_31_424971	108	40	ND	ND	NNP
10_1101-2020_12_31_424971	108	41	4.0	4.0	CD
10_1101-2020_12_31_424971	108	42	International	International	NNP
10_1101-2020_12_31_424971	108	43	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	108	44	under	under	IN
10_1101-2020_12_31_424971	108	45	a	a	DT
10_1101-2020_12_31_424971	108	46	(	(	-LRB-
10_1101-2020_12_31_424971	108	47	which	which	WDT
10_1101-2020_12_31_424971	108	48	was	be	VBD
10_1101-2020_12_31_424971	108	49	not	not	RB
10_1101-2020_12_31_424971	108	50	certified	certify	VBN
10_1101-2020_12_31_424971	108	51	by	by	IN
10_1101-2020_12_31_424971	108	52	peer	peer	NN
10_1101-2020_12_31_424971	108	53	review	review	NN
10_1101-2020_12_31_424971	108	54	)	)	-RRB-
10_1101-2020_12_31_424971	108	55	is	be	VBZ
10_1101-2020_12_31_424971	108	56	the	the	DT
10_1101-2020_12_31_424971	108	57	author	author	NN
10_1101-2020_12_31_424971	108	58	/	/	SYM
10_1101-2020_12_31_424971	108	59	funder	funder	NN
10_1101-2020_12_31_424971	108	60	,	,	,
10_1101-2020_12_31_424971	108	61	who	who	WP
10_1101-2020_12_31_424971	108	62	has	have	VBZ
10_1101-2020_12_31_424971	108	63	granted	grant	VBN
10_1101-2020_12_31_424971	108	64	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	108	65	a	a	DT
10_1101-2020_12_31_424971	108	66	license	license	NN
10_1101-2020_12_31_424971	108	67	to	to	TO
10_1101-2020_12_31_424971	108	68	display	display	VB
10_1101-2020_12_31_424971	108	69	the	the	DT
10_1101-2020_12_31_424971	108	70	preprint	preprint	NN
10_1101-2020_12_31_424971	108	71	in	in	IN
10_1101-2020_12_31_424971	108	72	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	108	73	.	.	.
10_1101-2020_12_31_424971	109	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	109	2	is	be	VBZ
10_1101-2020_12_31_424971	109	3	made	make	VBN
10_1101-2020_12_31_424971	109	4	The	the	DT
10_1101-2020_12_31_424971	109	5	copyright	copyright	NN
10_1101-2020_12_31_424971	109	6	holder	holder	NN
10_1101-2020_12_31_424971	109	7	for	for	IN
10_1101-2020_12_31_424971	109	8	this	this	DT
10_1101-2020_12_31_424971	109	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	109	10	version	version	NN
10_1101-2020_12_31_424971	109	11	posted	post	VBD
10_1101-2020_12_31_424971	109	12	January	January	NNP
10_1101-2020_12_31_424971	109	13	2	2	CD
10_1101-2020_12_31_424971	109	14	,	,	,
10_1101-2020_12_31_424971	109	15	2021	2021	CD
10_1101-2020_12_31_424971	109	16	.	.	.
10_1101-2020_12_31_424971	109	17	;	;	:
10_1101-2020_12_31_424971	109	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	109	19	:	:	:
10_1101-2020_12_31_424971	109	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	109	21	preprint	preprint	NN
10_1101-2020_12_31_424971	109	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NNP
10_1101-2020_12_31_424971	109	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	109	24	12	12	CD
10_1101-2020_12_31_424971	109	25	the	the	DT
10_1101-2020_12_31_424971	109	26	sub	sub	NN
10_1101-2020_12_31_424971	109	27	-	-	NN
10_1101-2020_12_31_424971	109	28	population	population	NN
10_1101-2020_12_31_424971	109	29	that	that	WDT
10_1101-2020_12_31_424971	109	30	remained	remain	VBD
10_1101-2020_12_31_424971	109	31	in	in	IN
10_1101-2020_12_31_424971	109	32	the	the	DT
10_1101-2020_12_31_424971	109	33	0-frame29,34	0-frame29,34	CD
10_1101-2020_12_31_424971	109	34	.	.	.
10_1101-2020_12_31_424971	110	1	The	the	DT
10_1101-2020_12_31_424971	110	2	results	result	NNS
10_1101-2020_12_31_424971	110	3	showed	show	VBD
10_1101-2020_12_31_424971	110	4	that	that	IN
10_1101-2020_12_31_424971	110	5	the	the	DT
10_1101-2020_12_31_424971	110	6	yield	yield	NN
10_1101-2020_12_31_424971	110	7	of	of	IN
10_1101-2020_12_31_424971	110	8	fMPV	fMPV	NNP
10_1101-2020_12_31_424971	110	9	281	281	CD
10_1101-2020_12_31_424971	110	10	was	be	VBD
10_1101-2020_12_31_424971	110	11	much	much	RB
10_1101-2020_12_31_424971	110	12	higher	high	JJR
10_1101-2020_12_31_424971	110	13	than	than	IN
10_1101-2020_12_31_424971	110	14	that	that	DT
10_1101-2020_12_31_424971	110	15	of	of	IN
10_1101-2020_12_31_424971	110	16	fMPR	fmpr	JJ
10_1101-2020_12_31_424971	110	17	(	(	-LRB-
10_1101-2020_12_31_424971	110	18	90	90	CD
10_1101-2020_12_31_424971	110	19	%	%	NN
10_1101-2020_12_31_424971	110	20	vs.	vs.	NN
10_1101-2020_12_31_424971	110	21	10	10	CD
10_1101-2020_12_31_424971	110	22	%	%	NN
10_1101-2020_12_31_424971	110	23	,	,	,
10_1101-2020_12_31_424971	110	24	Figure	Figure	NNP
10_1101-2020_12_31_424971	110	25	5a	5a	NNP
10_1101-2020_12_31_424971	110	26	)	)	-RRB-
10_1101-2020_12_31_424971	110	27	,	,	,
10_1101-2020_12_31_424971	110	28	demonstrating	demonstrate	VBG
10_1101-2020_12_31_424971	110	29	the	the	DT
10_1101-2020_12_31_424971	110	30	high	high	JJ
10_1101-2020_12_31_424971	110	31	efficiency	efficiency	NN
10_1101-2020_12_31_424971	110	32	282	282	CD
10_1101-2020_12_31_424971	110	33	with	with	IN
10_1101-2020_12_31_424971	110	34	which	which	WDT
10_1101-2020_12_31_424971	110	35	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	110	36	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	110	37	induces	induce	VBZ
10_1101-2020_12_31_424971	110	38	+1	+1	:
10_1101-2020_12_31_424971	110	39	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	110	40	.	.	.
10_1101-2020_12_31_424971	111	1	Notably	notably	RB
10_1101-2020_12_31_424971	111	2	,	,	,
10_1101-2020_12_31_424971	111	3	relative	relative	JJ
10_1101-2020_12_31_424971	111	4	to	to	IN
10_1101-2020_12_31_424971	111	5	the	the	DT
10_1101-2020_12_31_424971	111	6	+1	+1	NNS
10_1101-2020_12_31_424971	111	7	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	111	8	of	of	IN
10_1101-2020_12_31_424971	111	9	283	283	CD
10_1101-2020_12_31_424971	111	10	ProL	ProL	NNP
10_1101-2020_12_31_424971	111	11	we	-PRON-	PRP
10_1101-2020_12_31_424971	111	12	have	have	VBP
10_1101-2020_12_31_424971	111	13	previously	previously	RB
10_1101-2020_12_31_424971	111	14	reported29	reported29	NNP
10_1101-2020_12_31_424971	111	15	,	,	,
10_1101-2020_12_31_424971	111	16	kfMPV	kfmpv	NN
10_1101-2020_12_31_424971	111	17	,	,	,
10_1101-2020_12_31_424971	111	18	obs	obs	NN
10_1101-2020_12_31_424971	111	19	of	of	IN
10_1101-2020_12_31_424971	111	20	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	111	21	(	(	-LRB-
10_1101-2020_12_31_424971	111	22	0.09	0.09	CD
10_1101-2020_12_31_424971	111	23	s–1	s–1	NNS
10_1101-2020_12_31_424971	111	24	)	)	-RRB-
10_1101-2020_12_31_424971	111	25	was	be	VBD
10_1101-2020_12_31_424971	111	26	comparable	comparable	JJ
10_1101-2020_12_31_424971	111	27	to	to	IN
10_1101-2020_12_31_424971	111	28	the	the	DT
10_1101-2020_12_31_424971	111	29	rate	rate	NN
10_1101-2020_12_31_424971	111	30	of	of	IN
10_1101-2020_12_31_424971	111	31	+1	+1	NNS
10_1101-2020_12_31_424971	111	32	284	284	CD
10_1101-2020_12_31_424971	111	33	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	111	34	of	of	IN
10_1101-2020_12_31_424971	111	35	ProL	prol	NN
10_1101-2020_12_31_424971	111	36	during	during	IN
10_1101-2020_12_31_424971	111	37	translocation	translocation	NN
10_1101-2020_12_31_424971	111	38	(	(	-LRB-
10_1101-2020_12_31_424971	111	39	0.1	0.1	CD
10_1101-2020_12_31_424971	111	40	s–1	s–1	NNS
10_1101-2020_12_31_424971	111	41	)	)	-RRB-
10_1101-2020_12_31_424971	111	42	rather	rather	RB
10_1101-2020_12_31_424971	111	43	than	than	IN
10_1101-2020_12_31_424971	111	44	that	that	DT
10_1101-2020_12_31_424971	111	45	of	of	IN
10_1101-2020_12_31_424971	111	46	+1	+1	NNS
10_1101-2020_12_31_424971	111	47	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	111	48	after	after	IN
10_1101-2020_12_31_424971	111	49	285	285	CD
10_1101-2020_12_31_424971	111	50	translocation	translocation	NN
10_1101-2020_12_31_424971	111	51	into	into	IN
10_1101-2020_12_31_424971	111	52	the	the	DT
10_1101-2020_12_31_424971	111	53	P	p	NN
10_1101-2020_12_31_424971	111	54	site	site	NN
10_1101-2020_12_31_424971	111	55	(	(	-LRB-
10_1101-2020_12_31_424971	111	56	~10–3	~10–3	NFP
10_1101-2020_12_31_424971	111	57	s–1)29	s–1)29	NN
10_1101-2020_12_31_424971	111	58	,	,	,
10_1101-2020_12_31_424971	111	59	indicating	indicate	VBG
10_1101-2020_12_31_424971	111	60	that	that	IN
10_1101-2020_12_31_424971	111	61	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	111	62	underwent	undergo	VBD
10_1101-2020_12_31_424971	111	63	+1	+1	NNS
10_1101-2020_12_31_424971	111	64	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	111	65	during	during	IN
10_1101-2020_12_31_424971	111	66	286	286	CD
10_1101-2020_12_31_424971	111	67	translocation	translocation	NN
10_1101-2020_12_31_424971	111	68	.	.	.
10_1101-2020_12_31_424971	112	1	Our	-PRON-	PRP$
10_1101-2020_12_31_424971	112	2	observation	observation	NN
10_1101-2020_12_31_424971	112	3	that	that	IN
10_1101-2020_12_31_424971	112	4	the	the	DT
10_1101-2020_12_31_424971	112	5	fMPV	fMPV	NNP
10_1101-2020_12_31_424971	112	6	yield	yield	NN
10_1101-2020_12_31_424971	112	7	plateaus	plateaus	NN
10_1101-2020_12_31_424971	112	8	at	at	IN
10_1101-2020_12_31_424971	112	9	90	90	CD
10_1101-2020_12_31_424971	112	10	%	%	NN
10_1101-2020_12_31_424971	112	11	at	at	IN
10_1101-2020_12_31_424971	112	12	long	long	JJ
10_1101-2020_12_31_424971	112	13	reaction	reaction	NN
10_1101-2020_12_31_424971	112	14	times	times	NNP
10_1101-2020_12_31_424971	112	15	287	287	CD
10_1101-2020_12_31_424971	112	16	suggests	suggest	VBZ
10_1101-2020_12_31_424971	112	17	that	that	IN
10_1101-2020_12_31_424971	112	18	the	the	DT
10_1101-2020_12_31_424971	112	19	sub	sub	NN
10_1101-2020_12_31_424971	112	20	-	-	NNS
10_1101-2020_12_31_424971	112	21	populations	population	NNS
10_1101-2020_12_31_424971	112	22	of	of	IN
10_1101-2020_12_31_424971	112	23	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	112	24	that	that	WDT
10_1101-2020_12_31_424971	112	25	will	will	MD
10_1101-2020_12_31_424971	112	26	shift	shift	VB
10_1101-2020_12_31_424971	112	27	to	to	IN
10_1101-2020_12_31_424971	112	28	the	the	DT
10_1101-2020_12_31_424971	112	29	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	112	30	and	and	CC
10_1101-2020_12_31_424971	112	31	remain	remain	VBP
10_1101-2020_12_31_424971	112	32	in	in	IN
10_1101-2020_12_31_424971	112	33	the	the	DT
10_1101-2020_12_31_424971	112	34	0	0	CD
10_1101-2020_12_31_424971	112	35	-	-	SYM
10_1101-2020_12_31_424971	112	36	288	288	CD
10_1101-2020_12_31_424971	112	37	frame	frame	NN
10_1101-2020_12_31_424971	112	38	are	be	VBP
10_1101-2020_12_31_424971	112	39	likely	likely	RB
10_1101-2020_12_31_424971	112	40	established	establish	VBN
10_1101-2020_12_31_424971	112	41	in	in	IN
10_1101-2020_12_31_424971	112	42	the	the	DT
10_1101-2020_12_31_424971	112	43	A	A	NNP
10_1101-2020_12_31_424971	112	44	site	site	NN
10_1101-2020_12_31_424971	112	45	,	,	,
10_1101-2020_12_31_424971	112	46	even	even	RB
10_1101-2020_12_31_424971	112	47	before	before	IN
10_1101-2020_12_31_424971	112	48	EF	EF	NNP
10_1101-2020_12_31_424971	112	49	-	-	HYPH
10_1101-2020_12_31_424971	112	50	G	G	NNP
10_1101-2020_12_31_424971	112	51	binds	bind	NNS
10_1101-2020_12_31_424971	112	52	to	to	IN
10_1101-2020_12_31_424971	112	53	the	the	DT
10_1101-2020_12_31_424971	112	54	PRE	PRE	NNP
10_1101-2020_12_31_424971	112	55	complex	complex	NN
10_1101-2020_12_31_424971	112	56	.	.	.
10_1101-2020_12_31_424971	113	1	Given	give	VBN
10_1101-2020_12_31_424971	113	2	that	that	IN
10_1101-2020_12_31_424971	113	3	289	289	CD
10_1101-2020_12_31_424971	113	4	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	113	5	exhibits	exhibit	NNS
10_1101-2020_12_31_424971	113	6	triplet	triplet	NN
10_1101-2020_12_31_424971	113	7	pairing	pair	VBG
10_1101-2020_12_31_424971	113	8	in	in	IN
10_1101-2020_12_31_424971	113	9	the	the	DT
10_1101-2020_12_31_424971	113	10	0-frame	0-frame	CD
10_1101-2020_12_31_424971	113	11	at	at	IN
10_1101-2020_12_31_424971	113	12	the	the	DT
10_1101-2020_12_31_424971	113	13	A	a	NN
10_1101-2020_12_31_424971	113	14	site	site	NN
10_1101-2020_12_31_424971	113	15	(	(	-LRB-
10_1101-2020_12_31_424971	113	16	Figures	Figures	NNP
10_1101-2020_12_31_424971	113	17	3a	3a	NNP
10_1101-2020_12_31_424971	113	18	-	-	HYPH
10_1101-2020_12_31_424971	113	19	c	c	NNP
10_1101-2020_12_31_424971	113	20	,	,	,
10_1101-2020_12_31_424971	113	21	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	113	22	Table	Table	NNP
10_1101-2020_12_31_424971	113	23	2	2	CD
10_1101-2020_12_31_424971	113	24	,	,	,
10_1101-2020_12_31_424971	113	25	290	290	CD
10_1101-2020_12_31_424971	113	26	and	and	CC
10_1101-2020_12_31_424971	113	27	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	113	28	Figure	Figure	NNP
10_1101-2020_12_31_424971	113	29	2a	2a	NNP
10_1101-2020_12_31_424971	113	30	)	)	-RRB-
10_1101-2020_12_31_424971	113	31	and	and	CC
10_1101-2020_12_31_424971	113	32	shifts	shift	NNS
10_1101-2020_12_31_424971	113	33	into	into	IN
10_1101-2020_12_31_424971	113	34	the	the	DT
10_1101-2020_12_31_424971	113	35	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	113	36	during	during	IN
10_1101-2020_12_31_424971	113	37	translocation	translocation	NN
10_1101-2020_12_31_424971	113	38	(	(	-LRB-
10_1101-2020_12_31_424971	113	39	Figure	Figure	NNP
10_1101-2020_12_31_424971	113	40	5a	5a	NNP
10_1101-2020_12_31_424971	113	41	)	)	-RRB-
10_1101-2020_12_31_424971	113	42	,	,	,
10_1101-2020_12_31_424971	113	43	the	the	DT
10_1101-2020_12_31_424971	113	44	291	291	CD
10_1101-2020_12_31_424971	113	45	two	two	CD
10_1101-2020_12_31_424971	113	46	sub	sub	NN
10_1101-2020_12_31_424971	113	47	-	-	NNS
10_1101-2020_12_31_424971	113	48	populations	population	NNS
10_1101-2020_12_31_424971	113	49	of	of	IN
10_1101-2020_12_31_424971	113	50	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	113	51	in	in	IN
10_1101-2020_12_31_424971	113	52	the	the	DT
10_1101-2020_12_31_424971	113	53	A	A	NNP
10_1101-2020_12_31_424971	113	54	site	site	NN
10_1101-2020_12_31_424971	113	55	seem	seem	VBP
10_1101-2020_12_31_424971	113	56	to	to	TO
10_1101-2020_12_31_424971	113	57	differ	differ	VB
10_1101-2020_12_31_424971	113	58	primarily	primarily	RB
10_1101-2020_12_31_424971	113	59	in	in	IN
10_1101-2020_12_31_424971	113	60	their	-PRON-	PRP$
10_1101-2020_12_31_424971	113	61	propensity	propensity	NN
10_1101-2020_12_31_424971	113	62	to	to	TO
10_1101-2020_12_31_424971	113	63	undergo	undergo	VB
10_1101-2020_12_31_424971	113	64	292	292	CD
10_1101-2020_12_31_424971	113	65	+1	+1	NNS
10_1101-2020_12_31_424971	113	66	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	113	67	during	during	IN
10_1101-2020_12_31_424971	113	68	translocation	translocation	NN
10_1101-2020_12_31_424971	113	69	.	.	.
10_1101-2020_12_31_424971	114	1	The	the	DT
10_1101-2020_12_31_424971	114	2	sub	sub	JJ
10_1101-2020_12_31_424971	114	3	-	-	NN
10_1101-2020_12_31_424971	114	4	population	population	NN
10_1101-2020_12_31_424971	114	5	that	that	WDT
10_1101-2020_12_31_424971	114	6	encompasses	encompass	VBZ
10_1101-2020_12_31_424971	114	7	90	90	CD
10_1101-2020_12_31_424971	114	8	%	%	NN
10_1101-2020_12_31_424971	114	9	of	of	IN
10_1101-2020_12_31_424971	114	10	the	the	DT
10_1101-2020_12_31_424971	114	11	total	total	JJ
10_1101-2020_12_31_424971	114	12	293	293	CD
10_1101-2020_12_31_424971	114	13	would	would	MD
10_1101-2020_12_31_424971	114	14	exhibit	exhibit	VB
10_1101-2020_12_31_424971	114	15	a	a	DT
10_1101-2020_12_31_424971	114	16	high	high	JJ
10_1101-2020_12_31_424971	114	17	propensity	propensity	NN
10_1101-2020_12_31_424971	114	18	of	of	IN
10_1101-2020_12_31_424971	114	19	undergoing	undergoing	JJ
10_1101-2020_12_31_424971	114	20	+1	+1	NNS
10_1101-2020_12_31_424971	114	21	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	114	22	during	during	IN
10_1101-2020_12_31_424971	114	23	translocation	translocation	NN
10_1101-2020_12_31_424971	114	24	,	,	,
10_1101-2020_12_31_424971	114	25	whereas	whereas	IN
10_1101-2020_12_31_424971	114	26	the	the	DT
10_1101-2020_12_31_424971	114	27	294	294	CD
10_1101-2020_12_31_424971	114	28	sub	sub	NN
10_1101-2020_12_31_424971	114	29	-	-	NN
10_1101-2020_12_31_424971	114	30	population	population	NN
10_1101-2020_12_31_424971	114	31	that	that	WDT
10_1101-2020_12_31_424971	114	32	encompasses	encompass	VBZ
10_1101-2020_12_31_424971	114	33	10	10	CD
10_1101-2020_12_31_424971	114	34	%	%	NN
10_1101-2020_12_31_424971	114	35	of	of	IN
10_1101-2020_12_31_424971	114	36	the	the	DT
10_1101-2020_12_31_424971	114	37	total	total	NN
10_1101-2020_12_31_424971	114	38	would	would	MD
10_1101-2020_12_31_424971	114	39	exhibit	exhibit	VB
10_1101-2020_12_31_424971	114	40	a	a	DT
10_1101-2020_12_31_424971	114	41	low	low	JJ
10_1101-2020_12_31_424971	114	42	propensity	propensity	NN
10_1101-2020_12_31_424971	114	43	of	of	IN
10_1101-2020_12_31_424971	114	44	undergoing	undergo	VBG
10_1101-2020_12_31_424971	114	45	295	295	CD
10_1101-2020_12_31_424971	114	46	+1	+1	NNS
10_1101-2020_12_31_424971	114	47	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	114	48	during	during	IN
10_1101-2020_12_31_424971	114	49	translocation	translocation	NN
10_1101-2020_12_31_424971	114	50	,	,	,
10_1101-2020_12_31_424971	114	51	preferring	prefer	VBG
10_1101-2020_12_31_424971	114	52	instead	instead	RB
10_1101-2020_12_31_424971	114	53	to	to	TO
10_1101-2020_12_31_424971	114	54	remain	remain	VB
10_1101-2020_12_31_424971	114	55	in	in	IN
10_1101-2020_12_31_424971	114	56	the	the	DT
10_1101-2020_12_31_424971	114	57	0-frame	0-frame	CD
10_1101-2020_12_31_424971	114	58	.	.	.
10_1101-2020_12_31_424971	115	1	296	296	CD
10_1101-2020_12_31_424971	115	2	We	-PRON-	PRP
10_1101-2020_12_31_424971	115	3	next	next	RB
10_1101-2020_12_31_424971	115	4	determined	determine	VBD
10_1101-2020_12_31_424971	115	5	whether	whether	IN
10_1101-2020_12_31_424971	115	6	the	the	DT
10_1101-2020_12_31_424971	115	7	10	10	CD
10_1101-2020_12_31_424971	115	8	%	%	NN
10_1101-2020_12_31_424971	115	9	sub	sub	NN
10_1101-2020_12_31_424971	115	10	-	-	NN
10_1101-2020_12_31_424971	115	11	population	population	NN
10_1101-2020_12_31_424971	115	12	of	of	IN
10_1101-2020_12_31_424971	115	13	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	115	14	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	115	15	that	that	WDT
10_1101-2020_12_31_424971	115	16	remained	remain	VBD
10_1101-2020_12_31_424971	115	17	in	in	IN
10_1101-2020_12_31_424971	115	18	the	the	DT
10_1101-2020_12_31_424971	115	19	297	297	CD
10_1101-2020_12_31_424971	115	20	0-frame	0-frame	CD
10_1101-2020_12_31_424971	115	21	during	during	IN
10_1101-2020_12_31_424971	115	22	translocation	translocation	NN
10_1101-2020_12_31_424971	115	23	could	could	MD
10_1101-2020_12_31_424971	115	24	undergo	undergo	VB
10_1101-2020_12_31_424971	115	25	+1	+1	NNS
10_1101-2020_12_31_424971	115	26	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	115	27	after	after	IN
10_1101-2020_12_31_424971	115	28	arrival	arrival	NN
10_1101-2020_12_31_424971	115	29	at	at	IN
10_1101-2020_12_31_424971	115	30	the	the	DT
10_1101-2020_12_31_424971	115	31	P	p	NN
10_1101-2020_12_31_424971	115	32	site	site	NN
10_1101-2020_12_31_424971	115	33	.	.	.
10_1101-2020_12_31_424971	116	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	116	2	varied	vary	VBD
10_1101-2020_12_31_424971	116	3	298	298	CD
10_1101-2020_12_31_424971	116	4	our	-PRON-	PRP$
10_1101-2020_12_31_424971	116	5	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	116	6	formation	formation	NN
10_1101-2020_12_31_424971	116	7	assay	assay	NN
10_1101-2020_12_31_424971	116	8	so	so	IN
10_1101-2020_12_31_424971	116	9	as	as	IN
10_1101-2020_12_31_424971	116	10	to	to	TO
10_1101-2020_12_31_424971	116	11	deliver	deliver	VB
10_1101-2020_12_31_424971	116	12	the	the	DT
10_1101-2020_12_31_424971	116	13	TCs	tc	NNS
10_1101-2020_12_31_424971	116	14	in	in	IN
10_1101-2020_12_31_424971	116	15	two	two	CD
10_1101-2020_12_31_424971	116	16	steps	step	NNS
10_1101-2020_12_31_424971	116	17	separated	separate	VBN
10_1101-2020_12_31_424971	116	18	by	by	IN
10_1101-2020_12_31_424971	116	19	a	a	DT
10_1101-2020_12_31_424971	116	20	defined	define	VBN
10_1101-2020_12_31_424971	116	21	time	time	NN
10_1101-2020_12_31_424971	116	22	299	299	CD
10_1101-2020_12_31_424971	116	23	interval	interval	NN
10_1101-2020_12_31_424971	116	24	(	(	-LRB-
10_1101-2020_12_31_424971	116	25	Figure	Figure	NNP
10_1101-2020_12_31_424971	116	26	5b	5b	NN
10_1101-2020_12_31_424971	116	27	)	)	-RRB-
10_1101-2020_12_31_424971	116	28	.	.	.
10_1101-2020_12_31_424971	117	1	In	in	IN
10_1101-2020_12_31_424971	117	2	the	the	DT
10_1101-2020_12_31_424971	117	3	first	first	JJ
10_1101-2020_12_31_424971	117	4	step	step	NN
10_1101-2020_12_31_424971	117	5	,	,	,
10_1101-2020_12_31_424971	117	6	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	117	7	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	117	8	and	and	CC
10_1101-2020_12_31_424971	117	9	EF	EF	NNP
10_1101-2020_12_31_424971	117	10	-	-	HYPH
10_1101-2020_12_31_424971	117	11	G	G	NNP
10_1101-2020_12_31_424971	117	12	were	be	VBD
10_1101-2020_12_31_424971	117	13	delivered	deliver	VBN
10_1101-2020_12_31_424971	117	14	to	to	IN
10_1101-2020_12_31_424971	117	15	the	the	DT
10_1101-2020_12_31_424971	117	16	70S	70S	NNP
10_1101-2020_12_31_424971	117	17	IC	IC	NNP
10_1101-2020_12_31_424971	117	18	300	300	CD
10_1101-2020_12_31_424971	117	19	to	to	TO
10_1101-2020_12_31_424971	117	20	form	form	VB
10_1101-2020_12_31_424971	117	21	a	a	DT
10_1101-2020_12_31_424971	117	22	POST	POST	NNP
10_1101-2020_12_31_424971	117	23	complex	complex	NN
10_1101-2020_12_31_424971	117	24	,	,	,
10_1101-2020_12_31_424971	117	25	which	which	WDT
10_1101-2020_12_31_424971	117	26	was	be	VBD
10_1101-2020_12_31_424971	117	27	then	then	RB
10_1101-2020_12_31_424971	117	28	allowed	allow	VBN
10_1101-2020_12_31_424971	117	29	the	the	DT
10_1101-2020_12_31_424971	117	30	opportunity	opportunity	NN
10_1101-2020_12_31_424971	117	31	to	to	TO
10_1101-2020_12_31_424971	117	32	shift	shift	VB
10_1101-2020_12_31_424971	117	33	to	to	IN
10_1101-2020_12_31_424971	117	34	the	the	DT
10_1101-2020_12_31_424971	117	35	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	117	36	over	over	IN
10_1101-2020_12_31_424971	117	37	a	a	DT
10_1101-2020_12_31_424971	117	38	301	301	CD
10_1101-2020_12_31_424971	117	39	systematically	systematically	RB
10_1101-2020_12_31_424971	117	40	increasing	increasing	JJ
10_1101-2020_12_31_424971	117	41	time	time	NN
10_1101-2020_12_31_424971	117	42	interval	interval	NN
10_1101-2020_12_31_424971	117	43	.	.	.
10_1101-2020_12_31_424971	118	1	In	in	IN
10_1101-2020_12_31_424971	118	2	the	the	DT
10_1101-2020_12_31_424971	118	3	second	second	JJ
10_1101-2020_12_31_424971	118	4	step	step	NN
10_1101-2020_12_31_424971	118	5	,	,	,
10_1101-2020_12_31_424971	118	6	an	an	DT
10_1101-2020_12_31_424971	118	7	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	118	8	mixture	mixture	NN
10_1101-2020_12_31_424971	118	9	of	of	IN
10_1101-2020_12_31_424971	118	10	tRNAArg-	trnaarg-	NN
10_1101-2020_12_31_424971	118	11	and	and	CC
10_1101-2020_12_31_424971	118	12	302	302	CD
10_1101-2020_12_31_424971	118	13	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	118	14	-	-	HYPH
10_1101-2020_12_31_424971	118	15	TCs	TCs	NNP
10_1101-2020_12_31_424971	118	16	was	be	VBD
10_1101-2020_12_31_424971	118	17	delivered	deliver	VBN
10_1101-2020_12_31_424971	118	18	to	to	IN
10_1101-2020_12_31_424971	118	19	the	the	DT
10_1101-2020_12_31_424971	118	20	POST	POST	NNP
10_1101-2020_12_31_424971	118	21	complex	complex	NN
10_1101-2020_12_31_424971	118	22	.	.	.
10_1101-2020_12_31_424971	119	1	The	the	DT
10_1101-2020_12_31_424971	119	2	results	result	NNS
10_1101-2020_12_31_424971	119	3	showed	show	VBD
10_1101-2020_12_31_424971	119	4	that	that	IN
10_1101-2020_12_31_424971	119	5	fMPV	fmpv	NN
10_1101-2020_12_31_424971	119	6	was	be	VBD
10_1101-2020_12_31_424971	119	7	rapidly	rapidly	RB
10_1101-2020_12_31_424971	119	8	303	303	CD
10_1101-2020_12_31_424971	119	9	formed	form	VBN
10_1101-2020_12_31_424971	119	10	at	at	IN
10_1101-2020_12_31_424971	119	11	a	a	DT
10_1101-2020_12_31_424971	119	12	high	high	JJ
10_1101-2020_12_31_424971	119	13	yield	yield	NN
10_1101-2020_12_31_424971	119	14	and	and	CC
10_1101-2020_12_31_424971	119	15	exhibited	exhibit	VBD
10_1101-2020_12_31_424971	119	16	a	a	DT
10_1101-2020_12_31_424971	119	17	kfMP+V	kfMP+V	NNP
10_1101-2020_12_31_424971	119	18	,	,	,
10_1101-2020_12_31_424971	119	19	obs	obs	NNP
10_1101-2020_12_31_424971	119	20	(	(	-LRB-
10_1101-2020_12_31_424971	119	21	where	where	WRB
10_1101-2020_12_31_424971	119	22	the	the	DT
10_1101-2020_12_31_424971	119	23	“	"	``
10_1101-2020_12_31_424971	119	24	+	+	NNS
10_1101-2020_12_31_424971	119	25	”	"	''
10_1101-2020_12_31_424971	119	26	denotes	denote	VBZ
10_1101-2020_12_31_424971	119	27	the	the	DT
10_1101-2020_12_31_424971	119	28	time	time	NN
10_1101-2020_12_31_424971	119	29	interval	interval	NN
10_1101-2020_12_31_424971	119	30	between	between	IN
10_1101-2020_12_31_424971	119	31	304	304	CD
10_1101-2020_12_31_424971	119	32	the	the	DT
10_1101-2020_12_31_424971	119	33	delivery	delivery	NN
10_1101-2020_12_31_424971	119	34	of	of	IN
10_1101-2020_12_31_424971	119	35	translation	translation	NN
10_1101-2020_12_31_424971	119	36	components	component	NNS
10_1101-2020_12_31_424971	119	37	)	)	-RRB-
10_1101-2020_12_31_424971	119	38	that	that	WDT
10_1101-2020_12_31_424971	119	39	did	do	VBD
10_1101-2020_12_31_424971	119	40	not	not	RB
10_1101-2020_12_31_424971	119	41	increase	increase	VB
10_1101-2020_12_31_424971	119	42	as	as	IN
10_1101-2020_12_31_424971	119	43	a	a	DT
10_1101-2020_12_31_424971	119	44	function	function	NN
10_1101-2020_12_31_424971	119	45	of	of	IN
10_1101-2020_12_31_424971	119	46	time	time	NN
10_1101-2020_12_31_424971	119	47	.	.	.
10_1101-2020_12_31_424971	120	1	In	in	IN
10_1101-2020_12_31_424971	120	2	contrast	contrast	NN
10_1101-2020_12_31_424971	120	3	,	,	,
10_1101-2020_12_31_424971	120	4	305	305	CD
10_1101-2020_12_31_424971	120	5	fMPR	fmpr	NN
10_1101-2020_12_31_424971	120	6	was	be	VBD
10_1101-2020_12_31_424971	120	7	formed	form	VBN
10_1101-2020_12_31_424971	120	8	at	at	IN
10_1101-2020_12_31_424971	120	9	a	a	DT
10_1101-2020_12_31_424971	120	10	low	low	JJ
10_1101-2020_12_31_424971	120	11	yield	yield	NN
10_1101-2020_12_31_424971	120	12	and	and	CC
10_1101-2020_12_31_424971	120	13	exhibited	exhibit	VBD
10_1101-2020_12_31_424971	120	14	a	a	DT
10_1101-2020_12_31_424971	120	15	kfMP+R	kfmp+r	NN
10_1101-2020_12_31_424971	120	16	,	,	,
10_1101-2020_12_31_424971	120	17	obs	obs	NN
10_1101-2020_12_31_424971	120	18	that	that	WDT
10_1101-2020_12_31_424971	120	19	did	do	VBD
10_1101-2020_12_31_424971	120	20	not	not	RB
10_1101-2020_12_31_424971	120	21	decrease	decrease	VB
10_1101-2020_12_31_424971	120	22	as	as	IN
10_1101-2020_12_31_424971	120	23	a	a	DT
10_1101-2020_12_31_424971	120	24	function	function	NN
10_1101-2020_12_31_424971	120	25	of	of	IN
10_1101-2020_12_31_424971	120	26	306	306	CD
10_1101-2020_12_31_424971	120	27	.CC	.CC	,
10_1101-2020_12_31_424971	120	28	-	-	HYPH
10_1101-2020_12_31_424971	120	29	BY	by	IN
10_1101-2020_12_31_424971	120	30	-	-	HYPH
10_1101-2020_12_31_424971	120	31	NC	NC	NNP
10_1101-2020_12_31_424971	120	32	-	-	HYPH
10_1101-2020_12_31_424971	120	33	ND	ND	NNP
10_1101-2020_12_31_424971	120	34	4.0	4.0	CD
10_1101-2020_12_31_424971	120	35	International	International	NNP
10_1101-2020_12_31_424971	120	36	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	120	37	under	under	IN
10_1101-2020_12_31_424971	120	38	a	a	DT
10_1101-2020_12_31_424971	120	39	(	(	-LRB-
10_1101-2020_12_31_424971	120	40	which	which	WDT
10_1101-2020_12_31_424971	120	41	was	be	VBD
10_1101-2020_12_31_424971	120	42	not	not	RB
10_1101-2020_12_31_424971	120	43	certified	certify	VBN
10_1101-2020_12_31_424971	120	44	by	by	IN
10_1101-2020_12_31_424971	120	45	peer	peer	NN
10_1101-2020_12_31_424971	120	46	review	review	NN
10_1101-2020_12_31_424971	120	47	)	)	-RRB-
10_1101-2020_12_31_424971	120	48	is	be	VBZ
10_1101-2020_12_31_424971	120	49	the	the	DT
10_1101-2020_12_31_424971	120	50	author	author	NN
10_1101-2020_12_31_424971	120	51	/	/	SYM
10_1101-2020_12_31_424971	120	52	funder	funder	NN
10_1101-2020_12_31_424971	120	53	,	,	,
10_1101-2020_12_31_424971	120	54	who	who	WP
10_1101-2020_12_31_424971	120	55	has	have	VBZ
10_1101-2020_12_31_424971	120	56	granted	grant	VBN
10_1101-2020_12_31_424971	120	57	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	120	58	a	a	DT
10_1101-2020_12_31_424971	120	59	license	license	NN
10_1101-2020_12_31_424971	120	60	to	to	TO
10_1101-2020_12_31_424971	120	61	display	display	VB
10_1101-2020_12_31_424971	120	62	the	the	DT
10_1101-2020_12_31_424971	120	63	preprint	preprint	NN
10_1101-2020_12_31_424971	120	64	in	in	IN
10_1101-2020_12_31_424971	120	65	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	120	66	.	.	.
10_1101-2020_12_31_424971	121	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	121	2	is	be	VBZ
10_1101-2020_12_31_424971	121	3	made	make	VBN
10_1101-2020_12_31_424971	121	4	The	the	DT
10_1101-2020_12_31_424971	121	5	copyright	copyright	NN
10_1101-2020_12_31_424971	121	6	holder	holder	NN
10_1101-2020_12_31_424971	121	7	for	for	IN
10_1101-2020_12_31_424971	121	8	this	this	DT
10_1101-2020_12_31_424971	121	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	121	10	version	version	NN
10_1101-2020_12_31_424971	121	11	posted	post	VBD
10_1101-2020_12_31_424971	121	12	January	January	NNP
10_1101-2020_12_31_424971	121	13	2	2	CD
10_1101-2020_12_31_424971	121	14	,	,	,
10_1101-2020_12_31_424971	121	15	2021	2021	CD
10_1101-2020_12_31_424971	121	16	.	.	.
10_1101-2020_12_31_424971	121	17	;	;	:
10_1101-2020_12_31_424971	121	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	121	19	:	:	:
10_1101-2020_12_31_424971	121	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	121	21	preprint	preprint	NN
10_1101-2020_12_31_424971	121	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NN
10_1101-2020_12_31_424971	121	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	121	24	13	13	CD
10_1101-2020_12_31_424971	121	25	time	time	NN
10_1101-2020_12_31_424971	121	26	.	.	.
10_1101-2020_12_31_424971	122	1	Together	together	RB
10_1101-2020_12_31_424971	122	2	,	,	,
10_1101-2020_12_31_424971	122	3	these	these	DT
10_1101-2020_12_31_424971	122	4	results	result	NNS
10_1101-2020_12_31_424971	122	5	indicate	indicate	VBP
10_1101-2020_12_31_424971	122	6	that	that	IN
10_1101-2020_12_31_424971	122	7	the	the	DT
10_1101-2020_12_31_424971	122	8	sub	sub	NN
10_1101-2020_12_31_424971	122	9	-	-	NN
10_1101-2020_12_31_424971	122	10	population	population	NN
10_1101-2020_12_31_424971	122	11	of	of	IN
10_1101-2020_12_31_424971	122	12	P	p	NN
10_1101-2020_12_31_424971	122	13	site	site	NN
10_1101-2020_12_31_424971	122	14	-	-	HYPH
10_1101-2020_12_31_424971	122	15	bound	bind	VBN
10_1101-2020_12_31_424971	122	16	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	122	17	in	in	IN
10_1101-2020_12_31_424971	122	18	the	the	DT
10_1101-2020_12_31_424971	122	19	0-frame	0-frame	CD
10_1101-2020_12_31_424971	122	20	307	307	CD
10_1101-2020_12_31_424971	122	21	does	do	VBZ
10_1101-2020_12_31_424971	122	22	not	not	RB
10_1101-2020_12_31_424971	122	23	undergo	undergo	VB
10_1101-2020_12_31_424971	122	24	+1	+1	NNS
10_1101-2020_12_31_424971	122	25	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	122	26	.	.	.
10_1101-2020_12_31_424971	123	1	This	this	DT
10_1101-2020_12_31_424971	123	2	interpretation	interpretation	NN
10_1101-2020_12_31_424971	123	3	is	be	VBZ
10_1101-2020_12_31_424971	123	4	supported	support	VBN
10_1101-2020_12_31_424971	123	5	by	by	IN
10_1101-2020_12_31_424971	123	6	the	the	DT
10_1101-2020_12_31_424971	123	7	observation	observation	NN
10_1101-2020_12_31_424971	123	8	that	that	IN
10_1101-2020_12_31_424971	123	9	EF	EF	NNP
10_1101-2020_12_31_424971	123	10	-	-	HYPH
10_1101-2020_12_31_424971	123	11	P	P	NNP
10_1101-2020_12_31_424971	123	12	,	,	,
10_1101-2020_12_31_424971	123	13	308	308	CD
10_1101-2020_12_31_424971	123	14	an	an	DT
10_1101-2020_12_31_424971	123	15	elongation	elongation	NN
10_1101-2020_12_31_424971	123	16	factor	factor	NN
10_1101-2020_12_31_424971	123	17	which	which	WDT
10_1101-2020_12_31_424971	123	18	we	-PRON-	PRP
10_1101-2020_12_31_424971	123	19	showed	show	VBD
10_1101-2020_12_31_424971	123	20	suppresses	suppresse	NNS
10_1101-2020_12_31_424971	123	21	+1	+1	:
10_1101-2020_12_31_424971	123	22	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	123	23	within	within	IN
10_1101-2020_12_31_424971	123	24	the	the	DT
10_1101-2020_12_31_424971	123	25	P	p	NN
10_1101-2020_12_31_424971	123	26	site29	site29	NN
10_1101-2020_12_31_424971	123	27	,	,	,
10_1101-2020_12_31_424971	123	28	had	have	VBD
10_1101-2020_12_31_424971	123	29	no	no	DT
10_1101-2020_12_31_424971	123	30	309	309	CD
10_1101-2020_12_31_424971	123	31	effect	effect	NN
10_1101-2020_12_31_424971	123	32	on	on	IN
10_1101-2020_12_31_424971	123	33	the	the	DT
10_1101-2020_12_31_424971	123	34	yield	yield	NN
10_1101-2020_12_31_424971	123	35	of	of	IN
10_1101-2020_12_31_424971	123	36	fMPV	fmpv	JJ
10_1101-2020_12_31_424971	123	37	yield	yield	NN
10_1101-2020_12_31_424971	123	38	(	(	-LRB-
10_1101-2020_12_31_424971	123	39	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	123	40	Figure	Figure	NNP
10_1101-2020_12_31_424971	123	41	2c	2c	NN
10_1101-2020_12_31_424971	123	42	and	and	CC
10_1101-2020_12_31_424971	123	43	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	123	44	Table	Table	NNP
10_1101-2020_12_31_424971	123	45	3	3	CD
10_1101-2020_12_31_424971	123	46	)	)	-RRB-
10_1101-2020_12_31_424971	123	47	.	.	.
10_1101-2020_12_31_424971	124	1	310	310	CD
10_1101-2020_12_31_424971	124	2	Having	have	VBG
10_1101-2020_12_31_424971	124	3	shown	show	VBN
10_1101-2020_12_31_424971	124	4	that	that	IN
10_1101-2020_12_31_424971	124	5	+1	+1	NNS
10_1101-2020_12_31_424971	124	6	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	124	7	of	of	IN
10_1101-2020_12_31_424971	124	8	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	124	9	occurs	occur	VBZ
10_1101-2020_12_31_424971	124	10	only	only	RB
10_1101-2020_12_31_424971	124	11	during	during	IN
10_1101-2020_12_31_424971	124	12	translocation	translocation	NN
10_1101-2020_12_31_424971	124	13	,	,	,
10_1101-2020_12_31_424971	124	14	we	-PRON-	PRP
10_1101-2020_12_31_424971	124	15	evaluated	evaluate	VBD
10_1101-2020_12_31_424971	124	16	311	311	CD
10_1101-2020_12_31_424971	124	17	the	the	DT
10_1101-2020_12_31_424971	124	18	effect	effect	NN
10_1101-2020_12_31_424971	124	19	of	of	IN
10_1101-2020_12_31_424971	124	20	m1G37	m1g37	NN
10_1101-2020_12_31_424971	124	21	on	on	IN
10_1101-2020_12_31_424971	124	22	the	the	DT
10_1101-2020_12_31_424971	124	23	frequency	frequency	NN
10_1101-2020_12_31_424971	124	24	of	of	IN
10_1101-2020_12_31_424971	124	25	this	this	DT
10_1101-2020_12_31_424971	124	26	event	event	NN
10_1101-2020_12_31_424971	124	27	.	.	.
10_1101-2020_12_31_424971	125	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	125	2	began	begin	VBD
10_1101-2020_12_31_424971	125	3	by	by	IN
10_1101-2020_12_31_424971	125	4	delivering	deliver	VBG
10_1101-2020_12_31_424971	125	5	G37-	G37-	NNP
10_1101-2020_12_31_424971	125	6	,	,	,
10_1101-2020_12_31_424971	125	7	m1G37-	m1g37-	CD
10_1101-2020_12_31_424971	125	8	,	,	,
10_1101-2020_12_31_424971	125	9	or	or	CC
10_1101-2020_12_31_424971	125	10	312	312	CD
10_1101-2020_12_31_424971	125	11	native	native	JJ
10_1101-2020_12_31_424971	125	12	-	-	HYPH
10_1101-2020_12_31_424971	125	13	state	state	NN
10_1101-2020_12_31_424971	125	14	SufB2-TCs	sufb2-tc	NNS
10_1101-2020_12_31_424971	125	15	together	together	RB
10_1101-2020_12_31_424971	125	16	with	with	IN
10_1101-2020_12_31_424971	125	17	EF	EF	NNP
10_1101-2020_12_31_424971	125	18	-	-	HYPH
10_1101-2020_12_31_424971	125	19	G	G	NNP
10_1101-2020_12_31_424971	125	20	to	to	IN
10_1101-2020_12_31_424971	125	21	70S	70S	NNP
10_1101-2020_12_31_424971	125	22	ICs	ic	NNS
10_1101-2020_12_31_424971	125	23	to	to	TO
10_1101-2020_12_31_424971	125	24	form	form	VB
10_1101-2020_12_31_424971	125	25	the	the	DT
10_1101-2020_12_31_424971	125	26	corresponding	corresponding	JJ
10_1101-2020_12_31_424971	125	27	POST	POST	NNP
10_1101-2020_12_31_424971	125	28	313	313	CD
10_1101-2020_12_31_424971	125	29	complexes	complex	NNS
10_1101-2020_12_31_424971	125	30	and	and	CC
10_1101-2020_12_31_424971	125	31	then	then	RB
10_1101-2020_12_31_424971	125	32	delivered	deliver	VBD
10_1101-2020_12_31_424971	125	33	an	an	DT
10_1101-2020_12_31_424971	125	34	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	125	35	mixture	mixture	NN
10_1101-2020_12_31_424971	125	36	of	of	IN
10_1101-2020_12_31_424971	125	37	tRNAArg-	tRNAArg-	NNP
10_1101-2020_12_31_424971	125	38	and	and	CC
10_1101-2020_12_31_424971	125	39	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	125	40	-	-	HYPH
10_1101-2020_12_31_424971	125	41	TCs	TCs	NNP
10_1101-2020_12_31_424971	125	42	to	to	IN
10_1101-2020_12_31_424971	125	43	each	each	DT
10_1101-2020_12_31_424971	125	44	POST	POST	NNP
10_1101-2020_12_31_424971	125	45	314	314	CD
10_1101-2020_12_31_424971	125	46	complex	complex	NN
10_1101-2020_12_31_424971	125	47	to	to	TO
10_1101-2020_12_31_424971	125	48	determine	determine	VB
10_1101-2020_12_31_424971	125	49	the	the	DT
10_1101-2020_12_31_424971	125	50	relative	relative	JJ
10_1101-2020_12_31_424971	125	51	formation	formation	NN
10_1101-2020_12_31_424971	125	52	of	of	IN
10_1101-2020_12_31_424971	125	53	fMPV	fmpv	NN
10_1101-2020_12_31_424971	125	54	and	and	CC
10_1101-2020_12_31_424971	125	55	fMPR	fmpr	NN
10_1101-2020_12_31_424971	125	56	.	.	.
10_1101-2020_12_31_424971	126	1	The	the	DT
10_1101-2020_12_31_424971	126	2	results	result	NNS
10_1101-2020_12_31_424971	126	3	showed	show	VBD
10_1101-2020_12_31_424971	126	4	that	that	IN
10_1101-2020_12_31_424971	126	5	m1G37-	m1g37-	CD
10_1101-2020_12_31_424971	126	6	315	315	CD
10_1101-2020_12_31_424971	126	7	and	and	CC
10_1101-2020_12_31_424971	126	8	native	native	JJ
10_1101-2020_12_31_424971	126	9	-	-	HYPH
10_1101-2020_12_31_424971	126	10	state	state	NN
10_1101-2020_12_31_424971	126	11	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	126	12	displayed	display	VBD
10_1101-2020_12_31_424971	126	13	a	a	DT
10_1101-2020_12_31_424971	126	14	reduced	reduce	VBN
10_1101-2020_12_31_424971	126	15	fMPV	fmpv	NN
10_1101-2020_12_31_424971	126	16	yield	yield	NN
10_1101-2020_12_31_424971	126	17	and	and	CC
10_1101-2020_12_31_424971	126	18	a	a	DT
10_1101-2020_12_31_424971	126	19	concomitantly	concomitantly	RB
10_1101-2020_12_31_424971	126	20	increased	increase	VBN
10_1101-2020_12_31_424971	126	21	fMPR	fmpr	CD
10_1101-2020_12_31_424971	126	22	yield	yield	NN
10_1101-2020_12_31_424971	126	23	316	316	CD
10_1101-2020_12_31_424971	126	24	relative	relative	JJ
10_1101-2020_12_31_424971	126	25	to	to	IN
10_1101-2020_12_31_424971	126	26	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	126	27	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	126	28	(	(	-LRB-
10_1101-2020_12_31_424971	126	29	Figures	figure	NNS
10_1101-2020_12_31_424971	126	30	5c	5c	CD
10_1101-2020_12_31_424971	126	31	,	,	,
10_1101-2020_12_31_424971	126	32	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	126	33	Figures	Figures	NNP
10_1101-2020_12_31_424971	126	34	2d	2d	NNP
10_1101-2020_12_31_424971	126	35	-	-	HYPH
10_1101-2020_12_31_424971	126	36	f	f	NN
10_1101-2020_12_31_424971	126	37	)	)	-RRB-
10_1101-2020_12_31_424971	126	38	,	,	,
10_1101-2020_12_31_424971	126	39	consistent	consistent	JJ
10_1101-2020_12_31_424971	126	40	with	with	IN
10_1101-2020_12_31_424971	126	41	the	the	DT
10_1101-2020_12_31_424971	126	42	notion	notion	NN
10_1101-2020_12_31_424971	126	43	317	317	CD
10_1101-2020_12_31_424971	126	44	that	that	IN
10_1101-2020_12_31_424971	126	45	the	the	DT
10_1101-2020_12_31_424971	126	46	presence	presence	NN
10_1101-2020_12_31_424971	126	47	of	of	IN
10_1101-2020_12_31_424971	126	48	m1G37	m1g37	JJ
10_1101-2020_12_31_424971	126	49	compromises	compromise	NNS
10_1101-2020_12_31_424971	126	50	+1	+1	NNS
10_1101-2020_12_31_424971	126	51	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	126	52	.	.	.
10_1101-2020_12_31_424971	127	1	318	318	CD
10_1101-2020_12_31_424971	127	2	We	-PRON-	PRP
10_1101-2020_12_31_424971	127	3	then	then	RB
10_1101-2020_12_31_424971	127	4	used	use	VBD
10_1101-2020_12_31_424971	127	5	the	the	DT
10_1101-2020_12_31_424971	127	6	same	same	JJ
10_1101-2020_12_31_424971	127	7	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	127	8	formation	formation	NN
10_1101-2020_12_31_424971	127	9	assay	assay	NN
10_1101-2020_12_31_424971	127	10	to	to	TO
10_1101-2020_12_31_424971	127	11	determine	determine	VB
10_1101-2020_12_31_424971	127	12	how	how	WRB
10_1101-2020_12_31_424971	127	13	+1	+1	NNS
10_1101-2020_12_31_424971	127	14	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	127	15	during	during	IN
10_1101-2020_12_31_424971	127	16	319	319	CD
10_1101-2020_12_31_424971	127	17	translocation	translocation	NN
10_1101-2020_12_31_424971	127	18	of	of	IN
10_1101-2020_12_31_424971	127	19	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	127	20	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	127	21	depends	depend	VBZ
10_1101-2020_12_31_424971	127	22	on	on	IN
10_1101-2020_12_31_424971	127	23	the	the	DT
10_1101-2020_12_31_424971	127	24	identity	identity	NN
10_1101-2020_12_31_424971	127	25	of	of	IN
10_1101-2020_12_31_424971	127	26	the	the	DT
10_1101-2020_12_31_424971	127	27	4th	4th	JJ
10_1101-2020_12_31_424971	127	28	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	127	29	of	of	IN
10_1101-2020_12_31_424971	127	30	the	the	DT
10_1101-2020_12_31_424971	127	31	CCC	CCC	NNP
10_1101-2020_12_31_424971	127	32	-	-	HYPH
10_1101-2020_12_31_424971	127	33	C	C	NNP
10_1101-2020_12_31_424971	127	34	motif	motif	NN
10_1101-2020_12_31_424971	127	35	.	.	.
10_1101-2020_12_31_424971	128	1	320	320	CD
10_1101-2020_12_31_424971	128	2	A	a	DT
10_1101-2020_12_31_424971	128	3	series	series	NN
10_1101-2020_12_31_424971	128	4	of	of	IN
10_1101-2020_12_31_424971	128	5	POST	POST	NNP
10_1101-2020_12_31_424971	128	6	complexes	complex	NNS
10_1101-2020_12_31_424971	128	7	were	be	VBD
10_1101-2020_12_31_424971	128	8	generated	generate	VBN
10_1101-2020_12_31_424971	128	9	by	by	IN
10_1101-2020_12_31_424971	128	10	delivering	deliver	VBG
10_1101-2020_12_31_424971	128	11	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	128	12	SufB2-TCs	SufB2-TCs	NNP
10_1101-2020_12_31_424971	128	13	and	and	CC
10_1101-2020_12_31_424971	128	14	EF	EF	NNP
10_1101-2020_12_31_424971	128	15	-	-	HYPH
10_1101-2020_12_31_424971	128	16	G	G	NNP
10_1101-2020_12_31_424971	128	17	to	to	IN
10_1101-2020_12_31_424971	128	18	321	321	CD
10_1101-2020_12_31_424971	128	19	70S	70S	NNP
10_1101-2020_12_31_424971	128	20	ICs	ic	NNS
10_1101-2020_12_31_424971	128	21	programmed	program	VBD
10_1101-2020_12_31_424971	128	22	with	with	IN
10_1101-2020_12_31_424971	128	23	a	a	DT
10_1101-2020_12_31_424971	128	24	CCC	CCC	NNP
10_1101-2020_12_31_424971	128	25	-	-	HYPH
10_1101-2020_12_31_424971	128	26	N	n	NN
10_1101-2020_12_31_424971	128	27	motif	motif	NN
10_1101-2020_12_31_424971	128	28	at	at	IN
10_1101-2020_12_31_424971	128	29	the	the	DT
10_1101-2020_12_31_424971	128	30	2nd	2nd	JJ
10_1101-2020_12_31_424971	128	31	codon	codon	NNP
10_1101-2020_12_31_424971	128	32	position	position	NN
10_1101-2020_12_31_424971	128	33	.	.	.
10_1101-2020_12_31_424971	129	1	Each	each	DT
10_1101-2020_12_31_424971	129	2	POST	POST	NNP
10_1101-2020_12_31_424971	129	3	complex	complex	NN
10_1101-2020_12_31_424971	129	4	was	be	VBD
10_1101-2020_12_31_424971	129	5	322	322	CD
10_1101-2020_12_31_424971	129	6	then	then	RB
10_1101-2020_12_31_424971	129	7	rapidly	rapidly	RB
10_1101-2020_12_31_424971	129	8	mixed	mixed	JJ
10_1101-2020_12_31_424971	129	9	with	with	IN
10_1101-2020_12_31_424971	129	10	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	129	11	-	-	HYPH
10_1101-2020_12_31_424971	129	12	TC	TC	NNP
10_1101-2020_12_31_424971	129	13	to	to	TO
10_1101-2020_12_31_424971	129	14	monitor	monitor	VB
10_1101-2020_12_31_424971	129	15	the	the	DT
10_1101-2020_12_31_424971	129	16	yield	yield	NN
10_1101-2020_12_31_424971	129	17	of	of	IN
10_1101-2020_12_31_424971	129	18	fMPV	fMPV	NNP
10_1101-2020_12_31_424971	129	19	and	and	CC
10_1101-2020_12_31_424971	129	20	kfMP+V	kfMP+V	NNP
10_1101-2020_12_31_424971	129	21	,	,	,
10_1101-2020_12_31_424971	129	22	obs	obs	NNP
10_1101-2020_12_31_424971	129	23	(	(	-LRB-
10_1101-2020_12_31_424971	129	24	Figure	Figure	NNP
10_1101-2020_12_31_424971	129	25	5d	5d	NNP
10_1101-2020_12_31_424971	129	26	)	)	-RRB-
10_1101-2020_12_31_424971	129	27	.	.	.
10_1101-2020_12_31_424971	130	1	The	the	DT
10_1101-2020_12_31_424971	130	2	323	323	CD
10_1101-2020_12_31_424971	130	3	results	result	NNS
10_1101-2020_12_31_424971	130	4	showed	show	VBD
10_1101-2020_12_31_424971	130	5	a	a	DT
10_1101-2020_12_31_424971	130	6	high	high	JJ
10_1101-2020_12_31_424971	130	7	fMPV	fmpv	NN
10_1101-2020_12_31_424971	130	8	yield	yield	NN
10_1101-2020_12_31_424971	130	9	and	and	CC
10_1101-2020_12_31_424971	130	10	high	high	JJ
10_1101-2020_12_31_424971	130	11	kfMP+V	kfMP+V	NNP
10_1101-2020_12_31_424971	130	12	,	,	,
10_1101-2020_12_31_424971	130	13	obs	obs	NNP
10_1101-2020_12_31_424971	130	14	at	at	IN
10_1101-2020_12_31_424971	130	15	the	the	DT
10_1101-2020_12_31_424971	130	16	CCC-[C	CCC-[C	NNP
10_1101-2020_12_31_424971	130	17	/	/	SYM
10_1101-2020_12_31_424971	130	18	U	U	NNP
10_1101-2020_12_31_424971	130	19	]	]	-RRB-
10_1101-2020_12_31_424971	130	20	motifs	motif	NNS
10_1101-2020_12_31_424971	130	21	,	,	,
10_1101-2020_12_31_424971	130	22	but	but	CC
10_1101-2020_12_31_424971	130	23	a	a	DT
10_1101-2020_12_31_424971	130	24	low	low	JJ
10_1101-2020_12_31_424971	130	25	yield	yield	NN
10_1101-2020_12_31_424971	130	26	and	and	CC
10_1101-2020_12_31_424971	130	27	324	324	CD
10_1101-2020_12_31_424971	130	28	low	low	JJ
10_1101-2020_12_31_424971	130	29	kfMP+V	kfMP+V	NNP
10_1101-2020_12_31_424971	130	30	,	,	,
10_1101-2020_12_31_424971	130	31	obs	obs	NNP
10_1101-2020_12_31_424971	130	32	at	at	IN
10_1101-2020_12_31_424971	130	33	the	the	DT
10_1101-2020_12_31_424971	130	34	CCC-[A	CCC-[A	NNP
10_1101-2020_12_31_424971	130	35	/	/	SYM
10_1101-2020_12_31_424971	130	36	G	G	NNP
10_1101-2020_12_31_424971	130	37	]	]	-RRB-
10_1101-2020_12_31_424971	130	38	motifs	motif	NNS
10_1101-2020_12_31_424971	130	39	.	.	.
10_1101-2020_12_31_424971	131	1	This	this	DT
10_1101-2020_12_31_424971	131	2	indicates	indicate	VBZ
10_1101-2020_12_31_424971	131	3	that	that	IN
10_1101-2020_12_31_424971	131	4	high	high	JJ
10_1101-2020_12_31_424971	131	5	-	-	HYPH
10_1101-2020_12_31_424971	131	6	efficiency	efficiency	NN
10_1101-2020_12_31_424971	131	7	of	of	IN
10_1101-2020_12_31_424971	131	8	SufB2-induced	SufB2-induced	NNP
10_1101-2020_12_31_424971	131	9	+1	+1	NNS
10_1101-2020_12_31_424971	131	10	325	325	CD
10_1101-2020_12_31_424971	131	11	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	131	12	during	during	IN
10_1101-2020_12_31_424971	131	13	translocation	translocation	NN
10_1101-2020_12_31_424971	131	14	requires	require	VBZ
10_1101-2020_12_31_424971	131	15	the	the	DT
10_1101-2020_12_31_424971	131	16	presence	presence	NN
10_1101-2020_12_31_424971	131	17	of	of	IN
10_1101-2020_12_31_424971	131	18	a	a	DT
10_1101-2020_12_31_424971	131	19	[	[	-LRB-
10_1101-2020_12_31_424971	131	20	C	C	NNP
10_1101-2020_12_31_424971	131	21	/	/	SYM
10_1101-2020_12_31_424971	131	22	U	u	NN
10_1101-2020_12_31_424971	131	23	]	]	-RRB-
10_1101-2020_12_31_424971	131	24	at	at	IN
10_1101-2020_12_31_424971	131	25	the	the	DT
10_1101-2020_12_31_424971	131	26	4th	4th	JJ
10_1101-2020_12_31_424971	131	27	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	131	28	of	of	IN
10_1101-2020_12_31_424971	131	29	the	the	DT
10_1101-2020_12_31_424971	131	30	326	326	CD
10_1101-2020_12_31_424971	131	31	CCC	CCC	NNP
10_1101-2020_12_31_424971	131	32	-	-	HYPH
10_1101-2020_12_31_424971	131	33	C	C	NNP
10_1101-2020_12_31_424971	131	34	motif	motif	NN
10_1101-2020_12_31_424971	131	35	.	.	.
10_1101-2020_12_31_424971	132	1	Because	because	IN
10_1101-2020_12_31_424971	132	2	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	132	3	in	in	IN
10_1101-2020_12_31_424971	132	4	these	these	DT
10_1101-2020_12_31_424971	132	5	experiments	experiment	NNS
10_1101-2020_12_31_424971	132	6	was	be	VBD
10_1101-2020_12_31_424971	132	7	in	in	IN
10_1101-2020_12_31_424971	132	8	the	the	DT
10_1101-2020_12_31_424971	132	9	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	132	10	,	,	,
10_1101-2020_12_31_424971	132	11	it	-PRON-	PRP
10_1101-2020_12_31_424971	132	12	is	be	VBZ
10_1101-2020_12_31_424971	132	13	possible	possible	JJ
10_1101-2020_12_31_424971	132	14	that	that	IN
10_1101-2020_12_31_424971	132	15	a	a	DT
10_1101-2020_12_31_424971	132	16	sub-327	sub-327	NNP
10_1101-2020_12_31_424971	132	17	population	population	NN
10_1101-2020_12_31_424971	132	18	underwent	undergo	VBD
10_1101-2020_12_31_424971	132	19	+1	+1	NNS
10_1101-2020_12_31_424971	132	20	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	132	21	via	via	IN
10_1101-2020_12_31_424971	132	22	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	132	23	-	-	HYPH
10_1101-2020_12_31_424971	132	24	pairing	pair	VBG
10_1101-2020_12_31_424971	132	25	with	with	IN
10_1101-2020_12_31_424971	132	26	the	the	DT
10_1101-2020_12_31_424971	132	27	[	[	-LRB-
10_1101-2020_12_31_424971	132	28	C	C	NNP
10_1101-2020_12_31_424971	132	29	/	/	SYM
10_1101-2020_12_31_424971	132	30	U	u	NN
10_1101-2020_12_31_424971	132	31	]	]	-RRB-
10_1101-2020_12_31_424971	132	32	at	at	IN
10_1101-2020_12_31_424971	132	33	the	the	DT
10_1101-2020_12_31_424971	132	34	4th	4th	NNP
10_1101-2020_12_31_424971	132	35	nucleotide	nucleotide	NNP
10_1101-2020_12_31_424971	132	36	328	328	CD
10_1101-2020_12_31_424971	132	37	of	of	IN
10_1101-2020_12_31_424971	132	38	the	the	DT
10_1101-2020_12_31_424971	132	39	CCC-[C	CCC-[C	NNP
10_1101-2020_12_31_424971	132	40	/	/	SYM
10_1101-2020_12_31_424971	132	41	U	U	NNP
10_1101-2020_12_31_424971	132	42	]	]	-RRB-
10_1101-2020_12_31_424971	132	43	motif	motif	NN
10_1101-2020_12_31_424971	132	44	during	during	IN
10_1101-2020_12_31_424971	132	45	translocation	translocation	NN
10_1101-2020_12_31_424971	132	46	.	.	.
10_1101-2020_12_31_424971	133	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	133	2	is	be	VBZ
10_1101-2020_12_31_424971	133	3	also	also	RB
10_1101-2020_12_31_424971	133	4	possible	possible	JJ
10_1101-2020_12_31_424971	133	5	that	that	IN
10_1101-2020_12_31_424971	133	6	a	a	DT
10_1101-2020_12_31_424971	133	7	sub	sub	JJ
10_1101-2020_12_31_424971	133	8	-	-	NN
10_1101-2020_12_31_424971	133	9	population	population	NN
10_1101-2020_12_31_424971	133	10	underwent	undergo	VBD
10_1101-2020_12_31_424971	133	11	329	329	CD
10_1101-2020_12_31_424971	133	12	+1	+1	NNS
10_1101-2020_12_31_424971	133	13	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	133	14	via	via	IN
10_1101-2020_12_31_424971	133	15	triplet	triplet	NN
10_1101-2020_12_31_424971	133	16	-	-	HYPH
10_1101-2020_12_31_424971	133	17	slippage	slippage	NN
10_1101-2020_12_31_424971	133	18	,	,	,
10_1101-2020_12_31_424971	133	19	which	which	WDT
10_1101-2020_12_31_424971	133	20	could	could	MD
10_1101-2020_12_31_424971	133	21	potentially	potentially	RB
10_1101-2020_12_31_424971	133	22	be	be	VB
10_1101-2020_12_31_424971	133	23	inhibited	inhibit	VBN
10_1101-2020_12_31_424971	133	24	by	by	IN
10_1101-2020_12_31_424971	133	25	the	the	DT
10_1101-2020_12_31_424971	133	26	presence	presence	NN
10_1101-2020_12_31_424971	133	27	of	of	IN
10_1101-2020_12_31_424971	133	28	[	[	-LRB-
10_1101-2020_12_31_424971	133	29	G	G	NNP
10_1101-2020_12_31_424971	133	30	/	/	,
10_1101-2020_12_31_424971	133	31	A	a	NN
10_1101-2020_12_31_424971	133	32	]	]	-RRB-
10_1101-2020_12_31_424971	133	33	330	330	CD
10_1101-2020_12_31_424971	133	34	at	at	IN
10_1101-2020_12_31_424971	133	35	the	the	DT
10_1101-2020_12_31_424971	133	36	4th	4th	JJ
10_1101-2020_12_31_424971	133	37	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	133	38	of	of	IN
10_1101-2020_12_31_424971	133	39	the	the	DT
10_1101-2020_12_31_424971	133	40	motif	motif	NN
10_1101-2020_12_31_424971	133	41	.	.	.
10_1101-2020_12_31_424971	134	1	To	to	TO
10_1101-2020_12_31_424971	134	2	verify	verify	VB
10_1101-2020_12_31_424971	134	3	that	that	IN
10_1101-2020_12_31_424971	134	4	the	the	DT
10_1101-2020_12_31_424971	134	5	POST	POST	NNP
10_1101-2020_12_31_424971	134	6	complex	complex	NN
10_1101-2020_12_31_424971	134	7	formed	form	VBN
10_1101-2020_12_31_424971	134	8	with	with	IN
10_1101-2020_12_31_424971	134	9	the	the	DT
10_1101-2020_12_31_424971	134	10	CCC	CCC	NNP
10_1101-2020_12_31_424971	134	11	-	-	HYPH
10_1101-2020_12_31_424971	134	12	A	a	DT
10_1101-2020_12_31_424971	134	13	331	331	CD
10_1101-2020_12_31_424971	134	14	sequence	sequence	NN
10_1101-2020_12_31_424971	134	15	was	be	VBD
10_1101-2020_12_31_424971	134	16	largely	largely	RB
10_1101-2020_12_31_424971	134	17	in	in	IN
10_1101-2020_12_31_424971	134	18	the	the	DT
10_1101-2020_12_31_424971	134	19	0-frame	0-frame	CD
10_1101-2020_12_31_424971	134	20	,	,	,
10_1101-2020_12_31_424971	134	21	we	-PRON-	PRP
10_1101-2020_12_31_424971	134	22	rapidly	rapidly	RB
10_1101-2020_12_31_424971	134	23	mixed	mix	VBD
10_1101-2020_12_31_424971	134	24	the	the	DT
10_1101-2020_12_31_424971	134	25	complex	complex	NN
10_1101-2020_12_31_424971	134	26	with	with	IN
10_1101-2020_12_31_424971	134	27	an	an	DT
10_1101-2020_12_31_424971	134	28	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	134	29	mixture	mixture	NN
10_1101-2020_12_31_424971	134	30	of	of	IN
10_1101-2020_12_31_424971	134	31	332	332	CD
10_1101-2020_12_31_424971	134	32	.CC	.CC	:
10_1101-2020_12_31_424971	134	33	-	-	HYPH
10_1101-2020_12_31_424971	134	34	BY	by	IN
10_1101-2020_12_31_424971	134	35	-	-	HYPH
10_1101-2020_12_31_424971	134	36	NC	NC	NNP
10_1101-2020_12_31_424971	134	37	-	-	HYPH
10_1101-2020_12_31_424971	134	38	ND	ND	NNP
10_1101-2020_12_31_424971	134	39	4.0	4.0	CD
10_1101-2020_12_31_424971	134	40	International	International	NNP
10_1101-2020_12_31_424971	134	41	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	134	42	under	under	IN
10_1101-2020_12_31_424971	134	43	a	a	DT
10_1101-2020_12_31_424971	134	44	(	(	-LRB-
10_1101-2020_12_31_424971	134	45	which	which	WDT
10_1101-2020_12_31_424971	134	46	was	be	VBD
10_1101-2020_12_31_424971	134	47	not	not	RB
10_1101-2020_12_31_424971	134	48	certified	certify	VBN
10_1101-2020_12_31_424971	134	49	by	by	IN
10_1101-2020_12_31_424971	134	50	peer	peer	NN
10_1101-2020_12_31_424971	134	51	review	review	NN
10_1101-2020_12_31_424971	134	52	)	)	-RRB-
10_1101-2020_12_31_424971	134	53	is	be	VBZ
10_1101-2020_12_31_424971	134	54	the	the	DT
10_1101-2020_12_31_424971	134	55	author	author	NN
10_1101-2020_12_31_424971	134	56	/	/	SYM
10_1101-2020_12_31_424971	134	57	funder	funder	NN
10_1101-2020_12_31_424971	134	58	,	,	,
10_1101-2020_12_31_424971	134	59	who	who	WP
10_1101-2020_12_31_424971	134	60	has	have	VBZ
10_1101-2020_12_31_424971	134	61	granted	grant	VBN
10_1101-2020_12_31_424971	134	62	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	134	63	a	a	DT
10_1101-2020_12_31_424971	134	64	license	license	NN
10_1101-2020_12_31_424971	134	65	to	to	TO
10_1101-2020_12_31_424971	134	66	display	display	VB
10_1101-2020_12_31_424971	134	67	the	the	DT
10_1101-2020_12_31_424971	134	68	preprint	preprint	NN
10_1101-2020_12_31_424971	134	69	in	in	IN
10_1101-2020_12_31_424971	134	70	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	134	71	.	.	.
10_1101-2020_12_31_424971	135	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	135	2	is	be	VBZ
10_1101-2020_12_31_424971	135	3	made	make	VBN
10_1101-2020_12_31_424971	135	4	The	the	DT
10_1101-2020_12_31_424971	135	5	copyright	copyright	NN
10_1101-2020_12_31_424971	135	6	holder	holder	NN
10_1101-2020_12_31_424971	135	7	for	for	IN
10_1101-2020_12_31_424971	135	8	this	this	DT
10_1101-2020_12_31_424971	135	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	135	10	version	version	NN
10_1101-2020_12_31_424971	135	11	posted	post	VBD
10_1101-2020_12_31_424971	135	12	January	January	NNP
10_1101-2020_12_31_424971	135	13	2	2	CD
10_1101-2020_12_31_424971	135	14	,	,	,
10_1101-2020_12_31_424971	135	15	2021	2021	CD
10_1101-2020_12_31_424971	135	16	.	.	.
10_1101-2020_12_31_424971	135	17	;	;	:
10_1101-2020_12_31_424971	135	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	135	19	:	:	:
10_1101-2020_12_31_424971	135	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	135	21	preprint	preprint	NN
10_1101-2020_12_31_424971	135	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	135	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	135	24	14	14	CD
10_1101-2020_12_31_424971	135	25	tRNASer	tRNASer	NNP
10_1101-2020_12_31_424971	135	26	-	-	HYPH
10_1101-2020_12_31_424971	135	27	TC	TC	NNP
10_1101-2020_12_31_424971	135	28	,	,	,
10_1101-2020_12_31_424971	135	29	cognate	cognate	VB
10_1101-2020_12_31_424971	135	30	to	to	IN
10_1101-2020_12_31_424971	135	31	the	the	DT
10_1101-2020_12_31_424971	135	32	next	next	JJ
10_1101-2020_12_31_424971	135	33	A	A	NNP
10_1101-2020_12_31_424971	135	34	-	-	HYPH
10_1101-2020_12_31_424971	135	35	site	site	NN
10_1101-2020_12_31_424971	135	36	codon	codon	NN
10_1101-2020_12_31_424971	135	37	in	in	IN
10_1101-2020_12_31_424971	135	38	the	the	DT
10_1101-2020_12_31_424971	135	39	0-frame	0-frame	CD
10_1101-2020_12_31_424971	135	40	(	(	-LRB-
10_1101-2020_12_31_424971	135	41	AGU	AGU	NNP
10_1101-2020_12_31_424971	135	42	)	)	-RRB-
10_1101-2020_12_31_424971	135	43	,	,	,
10_1101-2020_12_31_424971	135	44	and	and	CC
10_1101-2020_12_31_424971	135	45	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	135	46	-	-	HYPH
10_1101-2020_12_31_424971	135	47	TC	TC	NNP
10_1101-2020_12_31_424971	135	48	,	,	,
10_1101-2020_12_31_424971	135	49	cognate	cognate	VBP
10_1101-2020_12_31_424971	135	50	to	to	IN
10_1101-2020_12_31_424971	135	51	333	333	CD
10_1101-2020_12_31_424971	135	52	the	the	DT
10_1101-2020_12_31_424971	135	53	next	next	JJ
10_1101-2020_12_31_424971	135	54	A	a	NN
10_1101-2020_12_31_424971	135	55	-	-	HYPH
10_1101-2020_12_31_424971	135	56	site	site	NN
10_1101-2020_12_31_424971	135	57	codon	codon	NN
10_1101-2020_12_31_424971	135	58	in	in	IN
10_1101-2020_12_31_424971	135	59	the	the	DT
10_1101-2020_12_31_424971	135	60	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	135	61	(	(	-LRB-
10_1101-2020_12_31_424971	135	62	GUU	GUU	NNP
10_1101-2020_12_31_424971	135	63	)	)	-RRB-
10_1101-2020_12_31_424971	135	64	(	(	-LRB-
10_1101-2020_12_31_424971	135	65	Figure	figure	NN
10_1101-2020_12_31_424971	135	66	5e	5e	NN
10_1101-2020_12_31_424971	135	67	)	)	-RRB-
10_1101-2020_12_31_424971	135	68	.	.	.
10_1101-2020_12_31_424971	136	1	The	the	DT
10_1101-2020_12_31_424971	136	2	results	result	NNS
10_1101-2020_12_31_424971	136	3	showed	show	VBD
10_1101-2020_12_31_424971	136	4	a	a	DT
10_1101-2020_12_31_424971	136	5	high	high	JJ
10_1101-2020_12_31_424971	136	6	yield	yield	NN
10_1101-2020_12_31_424971	136	7	and	and	CC
10_1101-2020_12_31_424971	136	8	334	334	CD
10_1101-2020_12_31_424971	136	9	high	high	JJ
10_1101-2020_12_31_424971	136	10	kfMP+S	kfmp+s	NN
10_1101-2020_12_31_424971	136	11	,	,	,
10_1101-2020_12_31_424971	136	12	obs	obs	NN
10_1101-2020_12_31_424971	136	13	,	,	,
10_1101-2020_12_31_424971	136	14	supporting	support	VBG
10_1101-2020_12_31_424971	136	15	the	the	DT
10_1101-2020_12_31_424971	136	16	notion	notion	NN
10_1101-2020_12_31_424971	136	17	that	that	IN
10_1101-2020_12_31_424971	136	18	the	the	DT
10_1101-2020_12_31_424971	136	19	POST	POST	NNP
10_1101-2020_12_31_424971	136	20	complex	complex	NN
10_1101-2020_12_31_424971	136	21	formed	form	VBN
10_1101-2020_12_31_424971	136	22	with	with	IN
10_1101-2020_12_31_424971	136	23	the	the	DT
10_1101-2020_12_31_424971	136	24	CCC	CCC	NNP
10_1101-2020_12_31_424971	136	25	-	-	HYPH
10_1101-2020_12_31_424971	136	26	A	a	DT
10_1101-2020_12_31_424971	136	27	motif	motif	NN
10_1101-2020_12_31_424971	136	28	was	be	VBD
10_1101-2020_12_31_424971	136	29	335	335	CD
10_1101-2020_12_31_424971	136	30	largely	largely	RB
10_1101-2020_12_31_424971	136	31	in	in	IN
10_1101-2020_12_31_424971	136	32	the	the	DT
10_1101-2020_12_31_424971	136	33	0-frame	0-frame	CD
10_1101-2020_12_31_424971	136	34	.	.	.
10_1101-2020_12_31_424971	137	1	Thus	thus	RB
10_1101-2020_12_31_424971	137	2	,	,	,
10_1101-2020_12_31_424971	137	3	the	the	DT
10_1101-2020_12_31_424971	137	4	4th	4th	JJ
10_1101-2020_12_31_424971	137	5	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	137	6	of	of	IN
10_1101-2020_12_31_424971	137	7	the	the	DT
10_1101-2020_12_31_424971	137	8	CCC	CCC	NNP
10_1101-2020_12_31_424971	137	9	-	-	HYPH
10_1101-2020_12_31_424971	137	10	C	C	NNP
10_1101-2020_12_31_424971	137	11	motif	motif	NN
10_1101-2020_12_31_424971	137	12	plays	play	VBZ
10_1101-2020_12_31_424971	137	13	a	a	DT
10_1101-2020_12_31_424971	137	14	role	role	NN
10_1101-2020_12_31_424971	137	15	in	in	IN
10_1101-2020_12_31_424971	137	16	determining	determine	VBG
10_1101-2020_12_31_424971	137	17	+1	+1	NNS
10_1101-2020_12_31_424971	137	18	336	336	CD
10_1101-2020_12_31_424971	137	19	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	137	20	during	during	IN
10_1101-2020_12_31_424971	137	21	translocation	translocation	NN
10_1101-2020_12_31_424971	137	22	of	of	IN
10_1101-2020_12_31_424971	137	23	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	137	24	from	from	IN
10_1101-2020_12_31_424971	137	25	the	the	DT
10_1101-2020_12_31_424971	137	26	A	A	NNP
10_1101-2020_12_31_424971	137	27	site	site	NN
10_1101-2020_12_31_424971	137	28	to	to	IN
10_1101-2020_12_31_424971	137	29	the	the	DT
10_1101-2020_12_31_424971	137	30	P	p	NN
10_1101-2020_12_31_424971	137	31	site	site	NN
10_1101-2020_12_31_424971	137	32	.	.	.
10_1101-2020_12_31_424971	138	1	337	337	CD
10_1101-2020_12_31_424971	138	2	338	338	CD
10_1101-2020_12_31_424971	138	3	The	the	DT
10_1101-2020_12_31_424971	138	4	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	138	5	efficiency	efficiency	NN
10_1101-2020_12_31_424971	138	6	of	of	IN
10_1101-2020_12_31_424971	138	7	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	138	8	depends	depend	VBZ
10_1101-2020_12_31_424971	138	9	on	on	IN
10_1101-2020_12_31_424971	138	10	sequences	sequence	NNS
10_1101-2020_12_31_424971	138	11	of	of	IN
10_1101-2020_12_31_424971	138	12	the	the	DT
10_1101-2020_12_31_424971	138	13	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	138	14	loop	loop	NN
10_1101-2020_12_31_424971	138	15	and	and	CC
10_1101-2020_12_31_424971	138	16	339	339	CD
10_1101-2020_12_31_424971	138	17	the	the	DT
10_1101-2020_12_31_424971	138	18	CCC	CCC	NNP
10_1101-2020_12_31_424971	138	19	-	-	HYPH
10_1101-2020_12_31_424971	138	20	C	C	NNP
10_1101-2020_12_31_424971	138	21	motif	motif	NN
10_1101-2020_12_31_424971	138	22	340	340	CD
10_1101-2020_12_31_424971	138	23	To	to	TO
10_1101-2020_12_31_424971	138	24	determine	determine	VB
10_1101-2020_12_31_424971	138	25	whether	whether	IN
10_1101-2020_12_31_424971	138	26	the	the	DT
10_1101-2020_12_31_424971	138	27	+1-frameshifting	+1-frameshifting	JJ
10_1101-2020_12_31_424971	138	28	efficiency	efficiency	NN
10_1101-2020_12_31_424971	138	29	of	of	IN
10_1101-2020_12_31_424971	138	30	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	138	31	during	during	IN
10_1101-2020_12_31_424971	138	32	translocation	translocation	NN
10_1101-2020_12_31_424971	138	33	is	be	VBZ
10_1101-2020_12_31_424971	138	34	influenced	influence	VBN
10_1101-2020_12_31_424971	138	35	341	341	CD
10_1101-2020_12_31_424971	138	36	by	by	IN
10_1101-2020_12_31_424971	138	37	sequences	sequence	NNS
10_1101-2020_12_31_424971	138	38	of	of	IN
10_1101-2020_12_31_424971	138	39	the	the	DT
10_1101-2020_12_31_424971	138	40	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	138	41	loop	loop	NN
10_1101-2020_12_31_424971	138	42	and	and	CC
10_1101-2020_12_31_424971	138	43	the	the	DT
10_1101-2020_12_31_424971	138	44	CCC	CCC	NNP
10_1101-2020_12_31_424971	138	45	-	-	HYPH
10_1101-2020_12_31_424971	138	46	C	C	NNP
10_1101-2020_12_31_424971	138	47	motif	motif	NN
10_1101-2020_12_31_424971	138	48	,	,	,
10_1101-2020_12_31_424971	138	49	we	-PRON-	PRP
10_1101-2020_12_31_424971	138	50	performed	perform	VBD
10_1101-2020_12_31_424971	138	51	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	138	52	formation	formation	NN
10_1101-2020_12_31_424971	138	53	342	342	CD
10_1101-2020_12_31_424971	138	54	assays	assay	NNS
10_1101-2020_12_31_424971	138	55	and	and	CC
10_1101-2020_12_31_424971	138	56	monitored	monitor	VBD
10_1101-2020_12_31_424971	138	57	the	the	DT
10_1101-2020_12_31_424971	138	58	yield	yield	NN
10_1101-2020_12_31_424971	138	59	of	of	IN
10_1101-2020_12_31_424971	138	60	fMPV	fmpv	NN
10_1101-2020_12_31_424971	138	61	.	.	.
10_1101-2020_12_31_424971	139	1	In	in	IN
10_1101-2020_12_31_424971	139	2	these	these	DT
10_1101-2020_12_31_424971	139	3	experiments	experiment	NNS
10_1101-2020_12_31_424971	139	4	,	,	,
10_1101-2020_12_31_424971	139	5	we	-PRON-	PRP
10_1101-2020_12_31_424971	139	6	varied	vary	VBD
10_1101-2020_12_31_424971	139	7	the	the	DT
10_1101-2020_12_31_424971	139	8	sequence	sequence	NN
10_1101-2020_12_31_424971	139	9	of	of	IN
10_1101-2020_12_31_424971	139	10	the	the	DT
10_1101-2020_12_31_424971	139	11	343	343	CD
10_1101-2020_12_31_424971	139	12	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	139	13	anticodon	anticodon	NN
10_1101-2020_12_31_424971	139	14	loop	loop	NN
10_1101-2020_12_31_424971	139	15	and/or	and/or	CC
10_1101-2020_12_31_424971	139	16	the	the	DT
10_1101-2020_12_31_424971	139	17	CCC	CCC	NNP
10_1101-2020_12_31_424971	139	18	-	-	HYPH
10_1101-2020_12_31_424971	139	19	C	C	NNP
10_1101-2020_12_31_424971	139	20	motif	motif	NN
10_1101-2020_12_31_424971	139	21	at	at	IN
10_1101-2020_12_31_424971	139	22	the	the	DT
10_1101-2020_12_31_424971	139	23	2nd	2nd	JJ
10_1101-2020_12_31_424971	139	24	codon	codon	NNP
10_1101-2020_12_31_424971	139	25	position	position	NN
10_1101-2020_12_31_424971	139	26	of	of	IN
10_1101-2020_12_31_424971	139	27	the	the	DT
10_1101-2020_12_31_424971	139	28	mRNA	mrna	NN
10_1101-2020_12_31_424971	139	29	.	.	.
10_1101-2020_12_31_424971	140	1	To	to	TO
10_1101-2020_12_31_424971	140	2	explore	explore	VB
10_1101-2020_12_31_424971	140	3	344	344	CD
10_1101-2020_12_31_424971	140	4	the	the	DT
10_1101-2020_12_31_424971	140	5	possibilities	possibility	NNS
10_1101-2020_12_31_424971	140	6	of	of	IN
10_1101-2020_12_31_424971	140	7	both	both	CC
10_1101-2020_12_31_424971	140	8	triplet	triplet	NN
10_1101-2020_12_31_424971	140	9	-	-	HYPH
10_1101-2020_12_31_424971	140	10	slippage	slippage	NN
10_1101-2020_12_31_424971	140	11	and	and	CC
10_1101-2020_12_31_424971	140	12	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	140	13	-	-	HYPH
10_1101-2020_12_31_424971	140	14	pairing	pair	VBG
10_1101-2020_12_31_424971	140	15	,	,	,
10_1101-2020_12_31_424971	140	16	we	-PRON-	PRP
10_1101-2020_12_31_424971	140	17	used	use	VBD
10_1101-2020_12_31_424971	140	18	variants	variant	NNS
10_1101-2020_12_31_424971	140	19	of	of	IN
10_1101-2020_12_31_424971	140	20	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	140	21	345	345	CD
10_1101-2020_12_31_424971	140	22	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	140	23	.	.	.
10_1101-2020_12_31_424971	141	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	141	2	showed	show	VBD
10_1101-2020_12_31_424971	141	3	that	that	IN
10_1101-2020_12_31_424971	141	4	variants	variant	NNS
10_1101-2020_12_31_424971	141	5	with	with	IN
10_1101-2020_12_31_424971	141	6	the	the	DT
10_1101-2020_12_31_424971	141	7	potential	potential	NN
10_1101-2020_12_31_424971	141	8	to	to	TO
10_1101-2020_12_31_424971	141	9	undergo	undergo	VB
10_1101-2020_12_31_424971	141	10	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	141	11	-	-	HYPH
10_1101-2020_12_31_424971	141	12	pairing	pair	VBG
10_1101-2020_12_31_424971	141	13	with	with	IN
10_1101-2020_12_31_424971	141	14	the	the	DT
10_1101-2020_12_31_424971	141	15	CCC	CCC	NNP
10_1101-2020_12_31_424971	141	16	-	-	HYPH
10_1101-2020_12_31_424971	141	17	C	C	NNP
10_1101-2020_12_31_424971	141	18	346	346	CD
10_1101-2020_12_31_424971	141	19	motif	motif	NN
10_1101-2020_12_31_424971	141	20	resulted	result	VBD
10_1101-2020_12_31_424971	141	21	in	in	IN
10_1101-2020_12_31_424971	141	22	fMPV	fmpv	JJ
10_1101-2020_12_31_424971	141	23	yields	yield	NNS
10_1101-2020_12_31_424971	141	24	of	of	IN
10_1101-2020_12_31_424971	141	25	87	87	CD
10_1101-2020_12_31_424971	141	26	%	%	NN
10_1101-2020_12_31_424971	141	27	and	and	CC
10_1101-2020_12_31_424971	141	28	62	62	CD
10_1101-2020_12_31_424971	141	29	%	%	NN
10_1101-2020_12_31_424971	141	30	(	(	-LRB-
10_1101-2020_12_31_424971	141	31	Figures	Figures	NNP
10_1101-2020_12_31_424971	141	32	4c	4c	NNP
10_1101-2020_12_31_424971	141	33	,	,	,
10_1101-2020_12_31_424971	141	34	d	d	NN
10_1101-2020_12_31_424971	141	35	)	)	-RRB-
10_1101-2020_12_31_424971	141	36	.	.	.
10_1101-2020_12_31_424971	142	1	The	the	DT
10_1101-2020_12_31_424971	142	2	different	different	JJ
10_1101-2020_12_31_424971	142	3	yields	yield	NNS
10_1101-2020_12_31_424971	142	4	suggest	suggest	VBP
10_1101-2020_12_31_424971	142	5	that	that	IN
10_1101-2020_12_31_424971	142	6	347	347	CD
10_1101-2020_12_31_424971	142	7	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	142	8	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	142	9	variants	variant	NNS
10_1101-2020_12_31_424971	142	10	can	can	MD
10_1101-2020_12_31_424971	142	11	induce	induce	VB
10_1101-2020_12_31_424971	142	12	triplet	triplet	NN
10_1101-2020_12_31_424971	142	13	-	-	HYPH
10_1101-2020_12_31_424971	142	14	slippage	slippage	NN
10_1101-2020_12_31_424971	142	15	and/or	and/or	CC
10_1101-2020_12_31_424971	142	16	engage	engage	VB
10_1101-2020_12_31_424971	142	17	in	in	IN
10_1101-2020_12_31_424971	142	18	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	142	19	-	-	HYPH
10_1101-2020_12_31_424971	142	20	pairing	pair	VBG
10_1101-2020_12_31_424971	142	21	with	with	IN
10_1101-2020_12_31_424971	142	22	348	348	CD
10_1101-2020_12_31_424971	142	23	different	different	JJ
10_1101-2020_12_31_424971	142	24	efficiencies	efficiency	NNS
10_1101-2020_12_31_424971	142	25	during	during	IN
10_1101-2020_12_31_424971	142	26	translocation	translocation	NN
10_1101-2020_12_31_424971	142	27	.	.	.
10_1101-2020_12_31_424971	143	1	Analogous	analogous	JJ
10_1101-2020_12_31_424971	143	2	experiments	experiment	NNS
10_1101-2020_12_31_424971	143	3	showed	show	VBD
10_1101-2020_12_31_424971	143	4	that	that	IN
10_1101-2020_12_31_424971	143	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	143	6	variants	variant	NNS
10_1101-2020_12_31_424971	143	7	349	349	CD
10_1101-2020_12_31_424971	143	8	that	that	WDT
10_1101-2020_12_31_424971	143	9	were	be	VBD
10_1101-2020_12_31_424971	143	10	restricted	restrict	VBN
10_1101-2020_12_31_424971	143	11	to	to	IN
10_1101-2020_12_31_424971	143	12	triplet	triplet	NN
10_1101-2020_12_31_424971	143	13	-	-	HYPH
10_1101-2020_12_31_424971	143	14	pairing	pairing	NN
10_1101-2020_12_31_424971	143	15	resulted	result	VBD
10_1101-2020_12_31_424971	143	16	in	in	IN
10_1101-2020_12_31_424971	143	17	reduced	reduce	VBN
10_1101-2020_12_31_424971	143	18	fMPV	fmpv	NN
10_1101-2020_12_31_424971	143	19	yields	yield	NNS
10_1101-2020_12_31_424971	143	20	(	(	-LRB-
10_1101-2020_12_31_424971	143	21	26	26	CD
10_1101-2020_12_31_424971	143	22	%	%	NN
10_1101-2020_12_31_424971	143	23	and	and	CC
10_1101-2020_12_31_424971	143	24	20	20	CD
10_1101-2020_12_31_424971	143	25	%	%	NN
10_1101-2020_12_31_424971	143	26	,	,	,
10_1101-2020_12_31_424971	143	27	respectively	respectively	RB
10_1101-2020_12_31_424971	143	28	)	)	-RRB-
10_1101-2020_12_31_424971	143	29	350	350	CD
10_1101-2020_12_31_424971	143	30	upon	upon	IN
10_1101-2020_12_31_424971	143	31	pairing	pair	VBG
10_1101-2020_12_31_424971	143	32	with	with	IN
10_1101-2020_12_31_424971	143	33	a	a	DT
10_1101-2020_12_31_424971	143	34	CCC	CCC	NNP
10_1101-2020_12_31_424971	143	35	-	-	HYPH
10_1101-2020_12_31_424971	143	36	C	C	NNP
10_1101-2020_12_31_424971	143	37	motif	motif	NN
10_1101-2020_12_31_424971	143	38	(	(	-LRB-
10_1101-2020_12_31_424971	143	39	Figures	Figures	NNPS
10_1101-2020_12_31_424971	143	40	4e	4e	NNP
10_1101-2020_12_31_424971	143	41	,	,	,
10_1101-2020_12_31_424971	143	42	f	f	NN
10_1101-2020_12_31_424971	143	43	)	)	-RRB-
10_1101-2020_12_31_424971	143	44	.	.	.
10_1101-2020_12_31_424971	144	1	Collectively	collectively	RB
10_1101-2020_12_31_424971	144	2	,	,	,
10_1101-2020_12_31_424971	144	3	these	these	DT
10_1101-2020_12_31_424971	144	4	results	result	NNS
10_1101-2020_12_31_424971	144	5	suggest	suggest	VBP
10_1101-2020_12_31_424971	144	6	that	that	IN
10_1101-2020_12_31_424971	144	7	there	there	EX
10_1101-2020_12_31_424971	144	8	is	be	VBZ
10_1101-2020_12_31_424971	144	9	351	351	CD
10_1101-2020_12_31_424971	144	10	considerable	considerable	JJ
10_1101-2020_12_31_424971	144	11	plasticity	plasticity	NN
10_1101-2020_12_31_424971	144	12	in	in	IN
10_1101-2020_12_31_424971	144	13	the	the	DT
10_1101-2020_12_31_424971	144	14	mechanisms	mechanism	NNS
10_1101-2020_12_31_424971	144	15	that	that	WDT
10_1101-2020_12_31_424971	144	16	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	144	17	uses	use	VBZ
10_1101-2020_12_31_424971	144	18	to	to	TO
10_1101-2020_12_31_424971	144	19	induce	induce	VB
10_1101-2020_12_31_424971	144	20	+1	+1	NNS
10_1101-2020_12_31_424971	144	21	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	144	22	during	during	IN
10_1101-2020_12_31_424971	144	23	352	352	CD
10_1101-2020_12_31_424971	144	24	translocation	translocation	NN
10_1101-2020_12_31_424971	144	25	and	and	CC
10_1101-2020_12_31_424971	144	26	in	in	IN
10_1101-2020_12_31_424971	144	27	the	the	DT
10_1101-2020_12_31_424971	144	28	efficiencies	efficiency	NNS
10_1101-2020_12_31_424971	144	29	of	of	IN
10_1101-2020_12_31_424971	144	30	these	these	DT
10_1101-2020_12_31_424971	144	31	mechanisms	mechanism	NNS
10_1101-2020_12_31_424971	144	32	.	.	.
10_1101-2020_12_31_424971	145	1	353	353	CD
10_1101-2020_12_31_424971	145	2	354	354	CD
10_1101-2020_12_31_424971	145	3	An	an	DT
10_1101-2020_12_31_424971	145	4	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	145	5	signal	signal	NN
10_1101-2020_12_31_424971	145	6	that	that	WDT
10_1101-2020_12_31_424971	145	7	reports	report	VBZ
10_1101-2020_12_31_424971	145	8	on	on	IN
10_1101-2020_12_31_424971	145	9	ribosome	ribosome	JJ
10_1101-2020_12_31_424971	145	10	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	145	11	during	during	IN
10_1101-2020_12_31_424971	145	12	individual	individual	JJ
10_1101-2020_12_31_424971	145	13	elongation	elongation	NN
10_1101-2020_12_31_424971	145	14	cycles	cycle	NNS
10_1101-2020_12_31_424971	145	15	355	355	CD
10_1101-2020_12_31_424971	145	16	To	to	TO
10_1101-2020_12_31_424971	145	17	address	address	VB
10_1101-2020_12_31_424971	145	18	the	the	DT
10_1101-2020_12_31_424971	145	19	mechanism	mechanism	NN
10_1101-2020_12_31_424971	145	20	of	of	IN
10_1101-2020_12_31_424971	145	21	SufB2-induced	SufB2-induced	NNP
10_1101-2020_12_31_424971	145	22	+1	+1	NNS
10_1101-2020_12_31_424971	145	23	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	145	24	during	during	IN
10_1101-2020_12_31_424971	145	25	translocation	translocation	NN
10_1101-2020_12_31_424971	145	26	,	,	,
10_1101-2020_12_31_424971	145	27	we	-PRON-	PRP
10_1101-2020_12_31_424971	145	28	used	use	VBD
10_1101-2020_12_31_424971	145	29	356	356	CD
10_1101-2020_12_31_424971	145	30	a	a	DT
10_1101-2020_12_31_424971	145	31	previously	previously	RB
10_1101-2020_12_31_424971	145	32	developed	develop	VBN
10_1101-2020_12_31_424971	145	33	smFRET	smfret	NN
10_1101-2020_12_31_424971	145	34	signal	signal	NN
10_1101-2020_12_31_424971	145	35	to	to	TO
10_1101-2020_12_31_424971	145	36	determine	determine	VB
10_1101-2020_12_31_424971	145	37	whether	whether	IN
10_1101-2020_12_31_424971	145	38	and	and	CC
10_1101-2020_12_31_424971	145	39	how	how	WRB
10_1101-2020_12_31_424971	145	40	SufB2	sufb2	JJ
10_1101-2020_12_31_424971	145	41	alters	alter	VBZ
10_1101-2020_12_31_424971	145	42	the	the	DT
10_1101-2020_12_31_424971	145	43	rates	rate	NNS
10_1101-2020_12_31_424971	145	44	with	with	IN
10_1101-2020_12_31_424971	145	45	357	357	CD
10_1101-2020_12_31_424971	145	46	which	which	WDT
10_1101-2020_12_31_424971	145	47	the	the	DT
10_1101-2020_12_31_424971	145	48	ribosome	ribosome	NN
10_1101-2020_12_31_424971	145	49	undergoes	undergo	VBZ
10_1101-2020_12_31_424971	145	50	a	a	DT
10_1101-2020_12_31_424971	145	51	series	series	NN
10_1101-2020_12_31_424971	145	52	of	of	IN
10_1101-2020_12_31_424971	145	53	conformational	conformational	JJ
10_1101-2020_12_31_424971	145	54	changes	change	NNS
10_1101-2020_12_31_424971	145	55	that	that	WDT
10_1101-2020_12_31_424971	145	56	drive	drive	VBP
10_1101-2020_12_31_424971	145	57	and	and	CC
10_1101-2020_12_31_424971	145	58	regulate	regulate	VB
10_1101-2020_12_31_424971	145	59	the	the	DT
10_1101-2020_12_31_424971	145	60	358	358	CD
10_1101-2020_12_31_424971	145	61	.CC	.CC	NFP
10_1101-2020_12_31_424971	145	62	-	-	HYPH
10_1101-2020_12_31_424971	145	63	BY	by	IN
10_1101-2020_12_31_424971	145	64	-	-	HYPH
10_1101-2020_12_31_424971	145	65	NC	NC	NNP
10_1101-2020_12_31_424971	145	66	-	-	HYPH
10_1101-2020_12_31_424971	145	67	ND	ND	NNP
10_1101-2020_12_31_424971	145	68	4.0	4.0	CD
10_1101-2020_12_31_424971	145	69	International	International	NNP
10_1101-2020_12_31_424971	145	70	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	145	71	under	under	IN
10_1101-2020_12_31_424971	145	72	a	a	DT
10_1101-2020_12_31_424971	145	73	(	(	-LRB-
10_1101-2020_12_31_424971	145	74	which	which	WDT
10_1101-2020_12_31_424971	145	75	was	be	VBD
10_1101-2020_12_31_424971	145	76	not	not	RB
10_1101-2020_12_31_424971	145	77	certified	certify	VBN
10_1101-2020_12_31_424971	145	78	by	by	IN
10_1101-2020_12_31_424971	145	79	peer	peer	NN
10_1101-2020_12_31_424971	145	80	review	review	NN
10_1101-2020_12_31_424971	145	81	)	)	-RRB-
10_1101-2020_12_31_424971	145	82	is	be	VBZ
10_1101-2020_12_31_424971	145	83	the	the	DT
10_1101-2020_12_31_424971	145	84	author	author	NN
10_1101-2020_12_31_424971	145	85	/	/	SYM
10_1101-2020_12_31_424971	145	86	funder	funder	NN
10_1101-2020_12_31_424971	145	87	,	,	,
10_1101-2020_12_31_424971	145	88	who	who	WP
10_1101-2020_12_31_424971	145	89	has	have	VBZ
10_1101-2020_12_31_424971	145	90	granted	grant	VBN
10_1101-2020_12_31_424971	145	91	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	145	92	a	a	DT
10_1101-2020_12_31_424971	145	93	license	license	NN
10_1101-2020_12_31_424971	145	94	to	to	TO
10_1101-2020_12_31_424971	145	95	display	display	VB
10_1101-2020_12_31_424971	145	96	the	the	DT
10_1101-2020_12_31_424971	145	97	preprint	preprint	NN
10_1101-2020_12_31_424971	145	98	in	in	IN
10_1101-2020_12_31_424971	145	99	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	145	100	.	.	.
10_1101-2020_12_31_424971	146	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	146	2	is	be	VBZ
10_1101-2020_12_31_424971	146	3	made	make	VBN
10_1101-2020_12_31_424971	146	4	The	the	DT
10_1101-2020_12_31_424971	146	5	copyright	copyright	NN
10_1101-2020_12_31_424971	146	6	holder	holder	NN
10_1101-2020_12_31_424971	146	7	for	for	IN
10_1101-2020_12_31_424971	146	8	this	this	DT
10_1101-2020_12_31_424971	146	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	146	10	version	version	NN
10_1101-2020_12_31_424971	146	11	posted	post	VBD
10_1101-2020_12_31_424971	146	12	January	January	NNP
10_1101-2020_12_31_424971	146	13	2	2	CD
10_1101-2020_12_31_424971	146	14	,	,	,
10_1101-2020_12_31_424971	146	15	2021	2021	CD
10_1101-2020_12_31_424971	146	16	.	.	.
10_1101-2020_12_31_424971	146	17	;	;	:
10_1101-2020_12_31_424971	146	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	146	19	:	:	:
10_1101-2020_12_31_424971	146	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	146	21	preprint	preprint	NN
10_1101-2020_12_31_424971	146	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	146	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	146	24	15	15	CD
10_1101-2020_12_31_424971	146	25	elongation	elongation	NN
10_1101-2020_12_31_424971	146	26	cycle35	cycle35	VBZ
10_1101-2020_12_31_424971	146	27	(	(	-LRB-
10_1101-2020_12_31_424971	146	28	Figures	Figures	NNP
10_1101-2020_12_31_424971	146	29	6a	6a	NNP
10_1101-2020_12_31_424971	146	30	-	-	HYPH
10_1101-2020_12_31_424971	146	31	c	c	NNP
10_1101-2020_12_31_424971	146	32	)	)	-RRB-
10_1101-2020_12_31_424971	146	33	.	.	.
10_1101-2020_12_31_424971	147	1	This	this	DT
10_1101-2020_12_31_424971	147	2	signal	signal	NN
10_1101-2020_12_31_424971	147	3	is	be	VBZ
10_1101-2020_12_31_424971	147	4	generated	generate	VBN
10_1101-2020_12_31_424971	147	5	using	use	VBG
10_1101-2020_12_31_424971	147	6	a	a	DT
10_1101-2020_12_31_424971	147	7	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	147	8	large	large	JJ
10_1101-2020_12_31_424971	147	9	,	,	,
10_1101-2020_12_31_424971	147	10	or	or	CC
10_1101-2020_12_31_424971	147	11	50S	50S	NNP
10_1101-2020_12_31_424971	147	12	,	,	,
10_1101-2020_12_31_424971	147	13	subunit	subunit	NN
10_1101-2020_12_31_424971	147	14	359	359	CD
10_1101-2020_12_31_424971	147	15	that	that	WDT
10_1101-2020_12_31_424971	147	16	has	have	VBZ
10_1101-2020_12_31_424971	147	17	been	be	VBN
10_1101-2020_12_31_424971	147	18	Cy3-	cy3-	CD
10_1101-2020_12_31_424971	147	19	and	and	CC
10_1101-2020_12_31_424971	147	20	Cy5-labeled	cy5-labele	VBN
10_1101-2020_12_31_424971	147	21	at	at	IN
10_1101-2020_12_31_424971	147	22	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	147	23	proteins	protein	NNS
10_1101-2020_12_31_424971	147	24	bL9	bL9	NNP
10_1101-2020_12_31_424971	147	25	and	and	CC
10_1101-2020_12_31_424971	147	26	uL1	uL1	NNP
10_1101-2020_12_31_424971	147	27	,	,	,
10_1101-2020_12_31_424971	147	28	respectively	respectively	RB
10_1101-2020_12_31_424971	147	29	,	,	,
10_1101-2020_12_31_424971	147	30	to	to	TO
10_1101-2020_12_31_424971	147	31	report	report	VB
10_1101-2020_12_31_424971	147	32	on	on	IN
10_1101-2020_12_31_424971	147	33	360	360	CD
10_1101-2020_12_31_424971	147	34	‘	'	``
10_1101-2020_12_31_424971	147	35	opening	opening	NN
10_1101-2020_12_31_424971	147	36	’	'	''
10_1101-2020_12_31_424971	147	37	and	and	CC
10_1101-2020_12_31_424971	147	38	‘	'	``
10_1101-2020_12_31_424971	147	39	closing	close	VBG
10_1101-2020_12_31_424971	147	40	’	'	''
10_1101-2020_12_31_424971	147	41	of	of	IN
10_1101-2020_12_31_424971	147	42	the	the	DT
10_1101-2020_12_31_424971	147	43	L1	L1	NNP
10_1101-2020_12_31_424971	147	44	stalk	stalk	NN
10_1101-2020_12_31_424971	147	45	of	of	IN
10_1101-2020_12_31_424971	147	46	the	the	DT
10_1101-2020_12_31_424971	147	47	50S	50S	NNP
10_1101-2020_12_31_424971	147	48	subunit	subunit	NN
10_1101-2020_12_31_424971	147	49	.	.	.
10_1101-2020_12_31_424971	148	1	Accordingly	accordingly	RB
10_1101-2020_12_31_424971	148	2	,	,	,
10_1101-2020_12_31_424971	148	3	individual	individual	JJ
10_1101-2020_12_31_424971	148	4	FRET	FRET	NNP
10_1101-2020_12_31_424971	148	5	efficiency	efficiency	NN
10_1101-2020_12_31_424971	148	6	361	361	CD
10_1101-2020_12_31_424971	148	7	(	(	-LRB-
10_1101-2020_12_31_424971	148	8	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	148	9	)	)	-RRB-
10_1101-2020_12_31_424971	148	10	vs.	vs.	FW
10_1101-2020_12_31_424971	148	11	time	time	NN
10_1101-2020_12_31_424971	148	12	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	148	13	recorded	record	VBN
10_1101-2020_12_31_424971	148	14	using	use	VBG
10_1101-2020_12_31_424971	148	15	this	this	DT
10_1101-2020_12_31_424971	148	16	signal	signal	NN
10_1101-2020_12_31_424971	148	17	exhibit	exhibit	NN
10_1101-2020_12_31_424971	148	18	transitions	transition	NNS
10_1101-2020_12_31_424971	148	19	between	between	IN
10_1101-2020_12_31_424971	148	20	two	two	CD
10_1101-2020_12_31_424971	148	21	FRET	FRET	NNP
10_1101-2020_12_31_424971	148	22	states	state	NNS
10_1101-2020_12_31_424971	148	23	362	362	CD
10_1101-2020_12_31_424971	148	24	corresponding	correspond	VBG
10_1101-2020_12_31_424971	148	25	to	to	IN
10_1101-2020_12_31_424971	148	26	the	the	DT
10_1101-2020_12_31_424971	148	27	‘	'	``
10_1101-2020_12_31_424971	148	28	open	open	JJ
10_1101-2020_12_31_424971	148	29	’	'	''
10_1101-2020_12_31_424971	148	30	(	(	-LRB-
10_1101-2020_12_31_424971	148	31	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	148	32	=	=	SYM
10_1101-2020_12_31_424971	148	33	~0.55	~0.55	NFP
10_1101-2020_12_31_424971	148	34	)	)	-RRB-
10_1101-2020_12_31_424971	148	35	and	and	CC
10_1101-2020_12_31_424971	148	36	‘	'	``
10_1101-2020_12_31_424971	148	37	closed	close	VBN
10_1101-2020_12_31_424971	148	38	’	'	''
10_1101-2020_12_31_424971	148	39	(	(	-LRB-
10_1101-2020_12_31_424971	148	40	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	148	41	=	=	NFP
10_1101-2020_12_31_424971	148	42	~0.31	~0.31	NFP
10_1101-2020_12_31_424971	148	43	)	)	-RRB-
10_1101-2020_12_31_424971	148	44	conformations	conformation	NNS
10_1101-2020_12_31_424971	148	45	of	of	IN
10_1101-2020_12_31_424971	148	46	the	the	DT
10_1101-2020_12_31_424971	148	47	L1	L1	NNP
10_1101-2020_12_31_424971	148	48	363	363	CD
10_1101-2020_12_31_424971	148	49	stalk	stalk	NN
10_1101-2020_12_31_424971	148	50	(	(	-LRB-
10_1101-2020_12_31_424971	148	51	Figure	Figure	NNP
10_1101-2020_12_31_424971	148	52	6d	6d	NNP
10_1101-2020_12_31_424971	148	53	)	)	-RRB-
10_1101-2020_12_31_424971	148	54	.	.	.
10_1101-2020_12_31_424971	149	1	364	364	CD
10_1101-2020_12_31_424971	149	2	Previously	previously	RB
10_1101-2020_12_31_424971	149	3	,	,	,
10_1101-2020_12_31_424971	149	4	we	-PRON-	PRP
10_1101-2020_12_31_424971	149	5	have	have	VBP
10_1101-2020_12_31_424971	149	6	shown	show	VBN
10_1101-2020_12_31_424971	149	7	that	that	IN
10_1101-2020_12_31_424971	149	8	open→closed	open→closed	JJ
10_1101-2020_12_31_424971	149	9	and	and	CC
10_1101-2020_12_31_424971	149	10	closed→open	closed→open	NNP
10_1101-2020_12_31_424971	149	11	L1	L1	NNP
10_1101-2020_12_31_424971	149	12	stalk	stalk	NN
10_1101-2020_12_31_424971	149	13	transitions	transition	NNS
10_1101-2020_12_31_424971	149	14	correlate	correlate	VBP
10_1101-2020_12_31_424971	149	15	365	365	CD
10_1101-2020_12_31_424971	149	16	with	with	IN
10_1101-2020_12_31_424971	149	17	a	a	DT
10_1101-2020_12_31_424971	149	18	complex	complex	JJ
10_1101-2020_12_31_424971	149	19	series	series	NN
10_1101-2020_12_31_424971	149	20	of	of	IN
10_1101-2020_12_31_424971	149	21	conformational	conformational	JJ
10_1101-2020_12_31_424971	149	22	changes	change	NNS
10_1101-2020_12_31_424971	149	23	that	that	WDT
10_1101-2020_12_31_424971	149	24	take	take	VBP
10_1101-2020_12_31_424971	149	25	place	place	NN
10_1101-2020_12_31_424971	149	26	during	during	IN
10_1101-2020_12_31_424971	149	27	an	an	DT
10_1101-2020_12_31_424971	149	28	elongation	elongation	NN
10_1101-2020_12_31_424971	149	29	cycle35	cycle35	NNP
10_1101-2020_12_31_424971	149	30	-	-	SYM
10_1101-2020_12_31_424971	149	31	37	37	CD
10_1101-2020_12_31_424971	149	32	.	.	.
10_1101-2020_12_31_424971	150	1	366	366	CD
10_1101-2020_12_31_424971	150	2	The	the	DT
10_1101-2020_12_31_424971	150	3	L1	L1	NNP
10_1101-2020_12_31_424971	150	4	stalk	stalk	NN
10_1101-2020_12_31_424971	150	5	initially	initially	RB
10_1101-2020_12_31_424971	150	6	occupies	occupy	VBZ
10_1101-2020_12_31_424971	150	7	the	the	DT
10_1101-2020_12_31_424971	150	8	open	open	JJ
10_1101-2020_12_31_424971	150	9	conformation	conformation	NN
10_1101-2020_12_31_424971	150	10	as	as	IN
10_1101-2020_12_31_424971	150	11	an	an	DT
10_1101-2020_12_31_424971	150	12	aa	aa	NNP
10_1101-2020_12_31_424971	150	13	-	-	HYPH
10_1101-2020_12_31_424971	150	14	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	150	15	is	be	VBZ
10_1101-2020_12_31_424971	150	16	delivered	deliver	VBN
10_1101-2020_12_31_424971	150	17	to	to	IN
10_1101-2020_12_31_424971	150	18	the	the	DT
10_1101-2020_12_31_424971	150	19	A	A	NNP
10_1101-2020_12_31_424971	150	20	site	site	NN
10_1101-2020_12_31_424971	150	21	of	of	IN
10_1101-2020_12_31_424971	150	22	367	367	CD
10_1101-2020_12_31_424971	150	23	a	a	DT
10_1101-2020_12_31_424971	150	24	70S	70S	NNP
10_1101-2020_12_31_424971	150	25	IC	IC	NNP
10_1101-2020_12_31_424971	150	26	or	or	CC
10_1101-2020_12_31_424971	150	27	POST	POST	NNP
10_1101-2020_12_31_424971	150	28	complex	complex	JJ
10_1101-2020_12_31_424971	150	29	and	and	CC
10_1101-2020_12_31_424971	150	30	peptide	peptide	NN
10_1101-2020_12_31_424971	150	31	-	-	HYPH
10_1101-2020_12_31_424971	150	32	bond	bond	NN
10_1101-2020_12_31_424971	150	33	formation	formation	NN
10_1101-2020_12_31_424971	150	34	generates	generate	VBZ
10_1101-2020_12_31_424971	150	35	a	a	DT
10_1101-2020_12_31_424971	150	36	PRE	PRE	NNP
10_1101-2020_12_31_424971	150	37	complex	complex	NN
10_1101-2020_12_31_424971	150	38	that	that	WDT
10_1101-2020_12_31_424971	150	39	is	be	VBZ
10_1101-2020_12_31_424971	150	40	in	in	IN
10_1101-2020_12_31_424971	150	41	a	a	DT
10_1101-2020_12_31_424971	150	42	368	368	CD
10_1101-2020_12_31_424971	150	43	global	global	JJ
10_1101-2020_12_31_424971	150	44	conformation	conformation	NN
10_1101-2020_12_31_424971	150	45	we	-PRON-	PRP
10_1101-2020_12_31_424971	150	46	refer	refer	VBP
10_1101-2020_12_31_424971	150	47	to	to	IN
10_1101-2020_12_31_424971	150	48	as	as	IN
10_1101-2020_12_31_424971	150	49	global	global	JJ
10_1101-2020_12_31_424971	150	50	state	state	NN
10_1101-2020_12_31_424971	150	51	(	(	-LRB-
10_1101-2020_12_31_424971	150	52	GS	GS	NNP
10_1101-2020_12_31_424971	150	53	)	)	-RRB-
10_1101-2020_12_31_424971	150	54	1	1	CD
10_1101-2020_12_31_424971	150	55	.	.	.
10_1101-2020_12_31_424971	151	1	The	the	DT
10_1101-2020_12_31_424971	151	2	PRE	PRE	NNP
10_1101-2020_12_31_424971	151	3	complex	complex	NN
10_1101-2020_12_31_424971	151	4	then	then	RB
10_1101-2020_12_31_424971	151	5	undergoes	undergo	VBZ
10_1101-2020_12_31_424971	151	6	a	a	DT
10_1101-2020_12_31_424971	151	7	large-369	large-369	NNP
10_1101-2020_12_31_424971	151	8	scale	scale	NN
10_1101-2020_12_31_424971	151	9	structural	structural	JJ
10_1101-2020_12_31_424971	151	10	rearrangement	rearrangement	NN
10_1101-2020_12_31_424971	151	11	that	that	WDT
10_1101-2020_12_31_424971	151	12	includes	include	VBZ
10_1101-2020_12_31_424971	151	13	an	an	DT
10_1101-2020_12_31_424971	151	14	open→closed	open→closed	JJ
10_1101-2020_12_31_424971	151	15	transition	transition	NN
10_1101-2020_12_31_424971	151	16	of	of	IN
10_1101-2020_12_31_424971	151	17	the	the	DT
10_1101-2020_12_31_424971	151	18	L1	L1	NNP
10_1101-2020_12_31_424971	151	19	stalk	stalk	NN
10_1101-2020_12_31_424971	151	20	so	so	IN
10_1101-2020_12_31_424971	151	21	as	as	IN
10_1101-2020_12_31_424971	151	22	to	to	TO
10_1101-2020_12_31_424971	151	23	370	370	CD
10_1101-2020_12_31_424971	151	24	occupy	occupy	VB
10_1101-2020_12_31_424971	151	25	a	a	DT
10_1101-2020_12_31_424971	151	26	second	second	JJ
10_1101-2020_12_31_424971	151	27	global	global	JJ
10_1101-2020_12_31_424971	151	28	conformation	conformation	NN
10_1101-2020_12_31_424971	151	29	we	-PRON-	PRP
10_1101-2020_12_31_424971	151	30	refer	refer	VBP
10_1101-2020_12_31_424971	151	31	to	to	IN
10_1101-2020_12_31_424971	151	32	as	as	IN
10_1101-2020_12_31_424971	151	33	GS2	GS2	NNP
10_1101-2020_12_31_424971	151	34	(	(	-LRB-
10_1101-2020_12_31_424971	151	35	i.e.	i.e.	FW
10_1101-2020_12_31_424971	151	36	,	,	,
10_1101-2020_12_31_424971	151	37	the	the	DT
10_1101-2020_12_31_424971	151	38	0.55→0.31	0.55→0.31	CD
10_1101-2020_12_31_424971	151	39	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	151	40	transition	transition	NN
10_1101-2020_12_31_424971	151	41	371	371	CD
10_1101-2020_12_31_424971	151	42	denoted	denote	VBN
10_1101-2020_12_31_424971	151	43	by	by	IN
10_1101-2020_12_31_424971	151	44	the	the	DT
10_1101-2020_12_31_424971	151	45	rate	rate	NN
10_1101-2020_12_31_424971	151	46	k70S	k70s	ADD
10_1101-2020_12_31_424971	151	47	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	151	48	in	in	IN
10_1101-2020_12_31_424971	151	49	Figures	Figures	NNP
10_1101-2020_12_31_424971	151	50	6d	6d	NNP
10_1101-2020_12_31_424971	151	51	and	and	CC
10_1101-2020_12_31_424971	151	52	e	e	NNP
10_1101-2020_12_31_424971	151	53	,	,	,
10_1101-2020_12_31_424971	151	54	corresponding	correspond	VBG
10_1101-2020_12_31_424971	151	55	to	to	IN
10_1101-2020_12_31_424971	151	56	the	the	DT
10_1101-2020_12_31_424971	151	57	multi	multi	JJ
10_1101-2020_12_31_424971	151	58	-	-	JJ
10_1101-2020_12_31_424971	151	59	step	step	NN
10_1101-2020_12_31_424971	151	60	70S	70S	NNP
10_1101-2020_12_31_424971	151	61	IC→GS2	ic→gs2	NN
10_1101-2020_12_31_424971	151	62	372	372	CD
10_1101-2020_12_31_424971	151	63	transition	transition	NN
10_1101-2020_12_31_424971	151	64	in	in	IN
10_1101-2020_12_31_424971	151	65	Figure	Figure	NNP
10_1101-2020_12_31_424971	151	66	6a	6a	NNP
10_1101-2020_12_31_424971	151	67	)	)	-RRB-
10_1101-2020_12_31_424971	151	68	.	.	.
10_1101-2020_12_31_424971	152	1	Subsequently	subsequently	RB
10_1101-2020_12_31_424971	152	2	,	,	,
10_1101-2020_12_31_424971	152	3	in	in	IN
10_1101-2020_12_31_424971	152	4	the	the	DT
10_1101-2020_12_31_424971	152	5	absence	absence	NN
10_1101-2020_12_31_424971	152	6	of	of	IN
10_1101-2020_12_31_424971	152	7	EF	EF	NNP
10_1101-2020_12_31_424971	152	8	-	-	HYPH
10_1101-2020_12_31_424971	152	9	G	G	NNP
10_1101-2020_12_31_424971	152	10	,	,	,
10_1101-2020_12_31_424971	152	11	the	the	DT
10_1101-2020_12_31_424971	152	12	L1	L1	NNP
10_1101-2020_12_31_424971	152	13	stalk	stalk	NN
10_1101-2020_12_31_424971	152	14	goes	go	VBZ
10_1101-2020_12_31_424971	152	15	through	through	IN
10_1101-2020_12_31_424971	152	16	373	373	CD
10_1101-2020_12_31_424971	152	17	successive	successive	JJ
10_1101-2020_12_31_424971	152	18	closed→open	closed→open	NN
10_1101-2020_12_31_424971	152	19	and	and	CC
10_1101-2020_12_31_424971	152	20	open→closed	open→closed	JJ
10_1101-2020_12_31_424971	152	21	transitions	transition	NNS
10_1101-2020_12_31_424971	152	22	as	as	IN
10_1101-2020_12_31_424971	152	23	the	the	DT
10_1101-2020_12_31_424971	152	24	PRE	PRE	NNP
10_1101-2020_12_31_424971	152	25	complex	complex	JJ
10_1101-2020_12_31_424971	152	26	undergoes	undergoe	NNS
10_1101-2020_12_31_424971	152	27	multiple	multiple	NN
10_1101-2020_12_31_424971	152	28	374	374	CD
10_1101-2020_12_31_424971	152	29	GS2→GS1	GS2→GS1	NNP
10_1101-2020_12_31_424971	152	30	and	and	CC
10_1101-2020_12_31_424971	152	31	GS1→GS2	GS1→GS2	NNP
10_1101-2020_12_31_424971	152	32	transitions	transition	NNS
10_1101-2020_12_31_424971	152	33	that	that	WDT
10_1101-2020_12_31_424971	152	34	establish	establish	VBP
10_1101-2020_12_31_424971	152	35	a	a	DT
10_1101-2020_12_31_424971	152	36	GS1	GS1	NNP
10_1101-2020_12_31_424971	152	37	⇄	⇄	NNP
10_1101-2020_12_31_424971	152	38	GS2	GS2	NNP
10_1101-2020_12_31_424971	152	39	equilibrium	equilibrium	NN
10_1101-2020_12_31_424971	152	40	(	(	-LRB-
10_1101-2020_12_31_424971	152	41	i.e.	i.e.	FW
10_1101-2020_12_31_424971	152	42	,	,	,
10_1101-2020_12_31_424971	152	43	the	the	DT
10_1101-2020_12_31_424971	152	44	0.55	0.55	CD
10_1101-2020_12_31_424971	152	45	⇄	⇄	NNP
10_1101-2020_12_31_424971	152	46	0.31	0.31	CD
10_1101-2020_12_31_424971	152	47	375	375	CD
10_1101-2020_12_31_424971	152	48	EFRET	efret	NN
10_1101-2020_12_31_424971	152	49	transitions	transition	NNS
10_1101-2020_12_31_424971	152	50	denoted	denote	VBN
10_1101-2020_12_31_424971	152	51	by	by	IN
10_1101-2020_12_31_424971	152	52	the	the	DT
10_1101-2020_12_31_424971	152	53	rates	rate	NNS
10_1101-2020_12_31_424971	152	54	kGS1→GS2	kGS1→GS2	NNP
10_1101-2020_12_31_424971	152	55	and	and	CC
10_1101-2020_12_31_424971	152	56	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	152	57	and	and	CC
10_1101-2020_12_31_424971	152	58	the	the	DT
10_1101-2020_12_31_424971	152	59	equilibrium	equilibrium	NN
10_1101-2020_12_31_424971	152	60	constant	constant	JJ
10_1101-2020_12_31_424971	152	61	Keq	Keq	NNP
10_1101-2020_12_31_424971	152	62	=	=	SYM
10_1101-2020_12_31_424971	152	63	376	376	CD
10_1101-2020_12_31_424971	152	64	(	(	-LRB-
10_1101-2020_12_31_424971	152	65	kGS1→GS2)/(kGS2→GS1	kGS1→GS2)/(kGS2→GS1	NNP
10_1101-2020_12_31_424971	152	66	)	)	-RRB-
10_1101-2020_12_31_424971	152	67	in	in	IN
10_1101-2020_12_31_424971	152	68	Figure	Figure	NNP
10_1101-2020_12_31_424971	152	69	6d	6d	NNP
10_1101-2020_12_31_424971	152	70	,	,	,
10_1101-2020_12_31_424971	152	71	corresponding	correspond	VBG
10_1101-2020_12_31_424971	152	72	to	to	IN
10_1101-2020_12_31_424971	152	73	the	the	DT
10_1101-2020_12_31_424971	152	74	GS1	GS1	NNP
10_1101-2020_12_31_424971	152	75	⇄	⇄	NNP
10_1101-2020_12_31_424971	152	76	GS2	GS2	NNP
10_1101-2020_12_31_424971	152	77	transitions	transition	NNS
10_1101-2020_12_31_424971	152	78	in	in	IN
10_1101-2020_12_31_424971	152	79	Figure	Figure	NNP
10_1101-2020_12_31_424971	152	80	6a	6a	NNP
10_1101-2020_12_31_424971	152	81	)	)	-RRB-
10_1101-2020_12_31_424971	152	82	.	.	.
10_1101-2020_12_31_424971	153	1	In	in	IN
10_1101-2020_12_31_424971	153	2	the	the	DT
10_1101-2020_12_31_424971	153	3	377	377	CD
10_1101-2020_12_31_424971	153	4	presence	presence	NN
10_1101-2020_12_31_424971	153	5	of	of	IN
10_1101-2020_12_31_424971	153	6	EF	EF	NNP
10_1101-2020_12_31_424971	153	7	-	-	HYPH
10_1101-2020_12_31_424971	153	8	G	G	NNP
10_1101-2020_12_31_424971	153	9	,	,	,
10_1101-2020_12_31_424971	153	10	however	however	RB
10_1101-2020_12_31_424971	153	11	,	,	,
10_1101-2020_12_31_424971	153	12	a	a	DT
10_1101-2020_12_31_424971	153	13	single	single	JJ
10_1101-2020_12_31_424971	153	14	closed→open	closed→open	NNP
10_1101-2020_12_31_424971	153	15	L1	L1	NNP
10_1101-2020_12_31_424971	153	16	stalk	stalk	NN
10_1101-2020_12_31_424971	153	17	transition	transition	NN
10_1101-2020_12_31_424971	153	18	reports	report	VBZ
10_1101-2020_12_31_424971	153	19	on	on	IN
10_1101-2020_12_31_424971	153	20	conformational	conformational	JJ
10_1101-2020_12_31_424971	153	21	378	378	CD
10_1101-2020_12_31_424971	153	22	changes	change	NNS
10_1101-2020_12_31_424971	153	23	of	of	IN
10_1101-2020_12_31_424971	153	24	the	the	DT
10_1101-2020_12_31_424971	153	25	PRE	PRE	NNP
10_1101-2020_12_31_424971	153	26	complex	complex	NN
10_1101-2020_12_31_424971	153	27	as	as	IN
10_1101-2020_12_31_424971	153	28	it	-PRON-	PRP
10_1101-2020_12_31_424971	153	29	undergoes	undergo	VBZ
10_1101-2020_12_31_424971	153	30	EF	EF	NNP
10_1101-2020_12_31_424971	153	31	-	-	HYPH
10_1101-2020_12_31_424971	153	32	G	g	NN
10_1101-2020_12_31_424971	153	33	binding	binding	NN
10_1101-2020_12_31_424971	153	34	and	and	CC
10_1101-2020_12_31_424971	153	35	completes	complete	VBZ
10_1101-2020_12_31_424971	153	36	translocation	translocation	NN
10_1101-2020_12_31_424971	153	37	(	(	-LRB-
10_1101-2020_12_31_424971	153	38	i.e.	i.e.	FW
10_1101-2020_12_31_424971	153	39	,	,	,
10_1101-2020_12_31_424971	153	40	the	the	DT
10_1101-2020_12_31_424971	153	41	379	379	CD
10_1101-2020_12_31_424971	153	42	0.31→0.55	0.31→0.55	NNS
10_1101-2020_12_31_424971	153	43	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	153	44	transition	transition	NN
10_1101-2020_12_31_424971	153	45	denoted	denote	VBN
10_1101-2020_12_31_424971	153	46	by	by	IN
10_1101-2020_12_31_424971	153	47	the	the	DT
10_1101-2020_12_31_424971	153	48	rate	rate	NN
10_1101-2020_12_31_424971	153	49	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	153	50	in	in	IN
10_1101-2020_12_31_424971	153	51	Figures	Figures	NNP
10_1101-2020_12_31_424971	153	52	6d	6d	NNP
10_1101-2020_12_31_424971	153	53	and	and	CC
10_1101-2020_12_31_424971	153	54	e	e	NNP
10_1101-2020_12_31_424971	153	55	,	,	,
10_1101-2020_12_31_424971	153	56	corresponding	correspond	VBG
10_1101-2020_12_31_424971	153	57	to	to	IN
10_1101-2020_12_31_424971	153	58	380	380	CD
10_1101-2020_12_31_424971	153	59	the	the	DT
10_1101-2020_12_31_424971	153	60	multi	multi	JJ
10_1101-2020_12_31_424971	153	61	-	-	JJ
10_1101-2020_12_31_424971	153	62	step	step	JJ
10_1101-2020_12_31_424971	153	63	GS2→POST	gs2→post	NN
10_1101-2020_12_31_424971	153	64	transition	transition	NN
10_1101-2020_12_31_424971	153	65	that	that	WDT
10_1101-2020_12_31_424971	153	66	takes	take	VBZ
10_1101-2020_12_31_424971	153	67	place	place	NN
10_1101-2020_12_31_424971	153	68	in	in	IN
10_1101-2020_12_31_424971	153	69	the	the	DT
10_1101-2020_12_31_424971	153	70	presence	presence	NN
10_1101-2020_12_31_424971	153	71	of	of	IN
10_1101-2020_12_31_424971	153	72	EF	EF	NNP
10_1101-2020_12_31_424971	153	73	-	-	HYPH
10_1101-2020_12_31_424971	153	74	G	G	NNP
10_1101-2020_12_31_424971	153	75	and	and	CC
10_1101-2020_12_31_424971	153	76	bridges	bridge	NNS
10_1101-2020_12_31_424971	153	77	across	across	IN
10_1101-2020_12_31_424971	153	78	381	381	CD
10_1101-2020_12_31_424971	153	79	Figures	Figures	NNPS
10_1101-2020_12_31_424971	153	80	6a	6a	CD
10_1101-2020_12_31_424971	153	81	and	and	CC
10_1101-2020_12_31_424971	153	82	b	b	NNP
10_1101-2020_12_31_424971	153	83	)	)	-RRB-
10_1101-2020_12_31_424971	153	84	.	.	.
10_1101-2020_12_31_424971	154	1	Using	use	VBG
10_1101-2020_12_31_424971	154	2	this	this	DT
10_1101-2020_12_31_424971	154	3	approach	approach	NN
10_1101-2020_12_31_424971	154	4	,	,	,
10_1101-2020_12_31_424971	154	5	we	-PRON-	PRP
10_1101-2020_12_31_424971	154	6	have	have	VBP
10_1101-2020_12_31_424971	154	7	successfully	successfully	RB
10_1101-2020_12_31_424971	154	8	monitored	monitor	VBN
10_1101-2020_12_31_424971	154	9	the	the	DT
10_1101-2020_12_31_424971	154	10	conformational	conformational	JJ
10_1101-2020_12_31_424971	154	11	382	382	CD
10_1101-2020_12_31_424971	154	12	.CC	.CC	,
10_1101-2020_12_31_424971	154	13	-	-	HYPH
10_1101-2020_12_31_424971	154	14	BY	by	IN
10_1101-2020_12_31_424971	154	15	-	-	HYPH
10_1101-2020_12_31_424971	154	16	NC	NC	NNP
10_1101-2020_12_31_424971	154	17	-	-	HYPH
10_1101-2020_12_31_424971	154	18	ND	ND	NNP
10_1101-2020_12_31_424971	154	19	4.0	4.0	CD
10_1101-2020_12_31_424971	154	20	International	International	NNP
10_1101-2020_12_31_424971	154	21	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	154	22	under	under	IN
10_1101-2020_12_31_424971	154	23	a	a	DT
10_1101-2020_12_31_424971	154	24	(	(	-LRB-
10_1101-2020_12_31_424971	154	25	which	which	WDT
10_1101-2020_12_31_424971	154	26	was	be	VBD
10_1101-2020_12_31_424971	154	27	not	not	RB
10_1101-2020_12_31_424971	154	28	certified	certify	VBN
10_1101-2020_12_31_424971	154	29	by	by	IN
10_1101-2020_12_31_424971	154	30	peer	peer	NN
10_1101-2020_12_31_424971	154	31	review	review	NN
10_1101-2020_12_31_424971	154	32	)	)	-RRB-
10_1101-2020_12_31_424971	154	33	is	be	VBZ
10_1101-2020_12_31_424971	154	34	the	the	DT
10_1101-2020_12_31_424971	154	35	author	author	NN
10_1101-2020_12_31_424971	154	36	/	/	SYM
10_1101-2020_12_31_424971	154	37	funder	funder	NN
10_1101-2020_12_31_424971	154	38	,	,	,
10_1101-2020_12_31_424971	154	39	who	who	WP
10_1101-2020_12_31_424971	154	40	has	have	VBZ
10_1101-2020_12_31_424971	154	41	granted	grant	VBN
10_1101-2020_12_31_424971	154	42	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	154	43	a	a	DT
10_1101-2020_12_31_424971	154	44	license	license	NN
10_1101-2020_12_31_424971	154	45	to	to	TO
10_1101-2020_12_31_424971	154	46	display	display	VB
10_1101-2020_12_31_424971	154	47	the	the	DT
10_1101-2020_12_31_424971	154	48	preprint	preprint	NN
10_1101-2020_12_31_424971	154	49	in	in	IN
10_1101-2020_12_31_424971	154	50	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	154	51	.	.	.
10_1101-2020_12_31_424971	155	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	155	2	is	be	VBZ
10_1101-2020_12_31_424971	155	3	made	make	VBN
10_1101-2020_12_31_424971	155	4	The	the	DT
10_1101-2020_12_31_424971	155	5	copyright	copyright	NN
10_1101-2020_12_31_424971	155	6	holder	holder	NN
10_1101-2020_12_31_424971	155	7	for	for	IN
10_1101-2020_12_31_424971	155	8	this	this	DT
10_1101-2020_12_31_424971	155	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	155	10	version	version	NN
10_1101-2020_12_31_424971	155	11	posted	post	VBD
10_1101-2020_12_31_424971	155	12	January	January	NNP
10_1101-2020_12_31_424971	155	13	2	2	CD
10_1101-2020_12_31_424971	155	14	,	,	,
10_1101-2020_12_31_424971	155	15	2021	2021	CD
10_1101-2020_12_31_424971	155	16	.	.	.
10_1101-2020_12_31_424971	155	17	;	;	:
10_1101-2020_12_31_424971	155	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	155	19	:	:	:
10_1101-2020_12_31_424971	155	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	155	21	preprint	preprint	NN
10_1101-2020_12_31_424971	155	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NN
10_1101-2020_12_31_424971	155	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	155	24	16	16	CD
10_1101-2020_12_31_424971	155	25	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	155	26	of	of	IN
10_1101-2020_12_31_424971	155	27	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	155	28	complexes	complex	NNS
10_1101-2020_12_31_424971	155	29	during	during	IN
10_1101-2020_12_31_424971	155	30	individual	individual	JJ
10_1101-2020_12_31_424971	155	31	elongation	elongation	NN
10_1101-2020_12_31_424971	155	32	cycles36,38	cycles36,38	NNP
10_1101-2020_12_31_424971	155	33	-	-	HYPH
10_1101-2020_12_31_424971	155	34	41	41	CD
10_1101-2020_12_31_424971	155	35	,	,	,
10_1101-2020_12_31_424971	155	36	including	include	VBG
10_1101-2020_12_31_424971	155	37	in	in	IN
10_1101-2020_12_31_424971	155	38	a	a	DT
10_1101-2020_12_31_424971	155	39	study	study	NN
10_1101-2020_12_31_424971	155	40	383	383	CD
10_1101-2020_12_31_424971	155	41	of	of	IN
10_1101-2020_12_31_424971	155	42	–	–	:
10_1101-2020_12_31_424971	155	43	1	1	CD
10_1101-2020_12_31_424971	155	44	frameshifting41	frameshifting41	CD
10_1101-2020_12_31_424971	155	45	.	.	.
10_1101-2020_12_31_424971	156	1	384	384	CD
10_1101-2020_12_31_424971	156	2	385	385	CD
10_1101-2020_12_31_424971	156	3	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	156	4	interferes	interfere	VBZ
10_1101-2020_12_31_424971	156	5	with	with	IN
10_1101-2020_12_31_424971	156	6	elongation	elongation	NN
10_1101-2020_12_31_424971	156	7	complex	complex	JJ
10_1101-2020_12_31_424971	156	8	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	156	9	during	during	IN
10_1101-2020_12_31_424971	156	10	late	late	JJ
10_1101-2020_12_31_424971	156	11	steps	step	NNS
10_1101-2020_12_31_424971	156	12	in	in	IN
10_1101-2020_12_31_424971	156	13	translocation	translocation	NN
10_1101-2020_12_31_424971	156	14	386	386	CD
10_1101-2020_12_31_424971	156	15	We	-PRON-	PRP
10_1101-2020_12_31_424971	156	16	began	begin	VBD
10_1101-2020_12_31_424971	156	17	by	by	IN
10_1101-2020_12_31_424971	156	18	asking	ask	VBG
10_1101-2020_12_31_424971	156	19	whether	whether	IN
10_1101-2020_12_31_424971	156	20	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	156	21	alters	alter	VBZ
10_1101-2020_12_31_424971	156	22	the	the	DT
10_1101-2020_12_31_424971	156	23	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	156	24	of	of	IN
10_1101-2020_12_31_424971	156	25	elongation	elongation	NN
10_1101-2020_12_31_424971	156	26	complexes	complex	NNS
10_1101-2020_12_31_424971	156	27	during	during	IN
10_1101-2020_12_31_424971	156	28	the	the	DT
10_1101-2020_12_31_424971	156	29	387	387	CD
10_1101-2020_12_31_424971	156	30	earlier	early	JJR
10_1101-2020_12_31_424971	156	31	steps	step	NNS
10_1101-2020_12_31_424971	156	32	of	of	IN
10_1101-2020_12_31_424971	156	33	the	the	DT
10_1101-2020_12_31_424971	156	34	elongation	elongation	NN
10_1101-2020_12_31_424971	156	35	cycle	cycle	NN
10_1101-2020_12_31_424971	156	36	.	.	.
10_1101-2020_12_31_424971	157	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	157	2	stopped	stop	VBD
10_1101-2020_12_31_424971	157	3	-	-	HYPH
10_1101-2020_12_31_424971	157	4	flow	flow	NN
10_1101-2020_12_31_424971	157	5	delivered	deliver	VBN
10_1101-2020_12_31_424971	157	6	SufB2-	SufB2-	NNP
10_1101-2020_12_31_424971	157	7	or	or	CC
10_1101-2020_12_31_424971	157	8	ProL	ProL	NNP
10_1101-2020_12_31_424971	157	9	-	-	HYPH
10_1101-2020_12_31_424971	157	10	TC	TC	NNP
10_1101-2020_12_31_424971	157	11	to	to	IN
10_1101-2020_12_31_424971	157	12	70S	70S	NNP
10_1101-2020_12_31_424971	157	13	ICs	ICs	NNP
10_1101-2020_12_31_424971	157	14	388	388	CD
10_1101-2020_12_31_424971	157	15	and	and	CC
10_1101-2020_12_31_424971	157	16	recorded	record	VBD
10_1101-2020_12_31_424971	157	17	pre	pre	JJ
10_1101-2020_12_31_424971	157	18	-	-	JJ
10_1101-2020_12_31_424971	157	19	steady	steady	JJ
10_1101-2020_12_31_424971	157	20	-	-	HYPH
10_1101-2020_12_31_424971	157	21	state	state	NN
10_1101-2020_12_31_424971	157	22	movies	movie	NNS
10_1101-2020_12_31_424971	157	23	during	during	IN
10_1101-2020_12_31_424971	157	24	delivery	delivery	NN
10_1101-2020_12_31_424971	157	25	,	,	,
10_1101-2020_12_31_424971	157	26	and	and	CC
10_1101-2020_12_31_424971	157	27	steady	steady	JJ
10_1101-2020_12_31_424971	157	28	-	-	HYPH
10_1101-2020_12_31_424971	157	29	state	state	NN
10_1101-2020_12_31_424971	157	30	movies	movie	NNS
10_1101-2020_12_31_424971	157	31	1	1	CD
10_1101-2020_12_31_424971	157	32	min	min	NN
10_1101-2020_12_31_424971	157	33	post-389	post-389	NNP
10_1101-2020_12_31_424971	157	34	delivery	delivery	NN
10_1101-2020_12_31_424971	157	35	(	(	-LRB-
10_1101-2020_12_31_424971	157	36	Figures	Figures	NNP
10_1101-2020_12_31_424971	157	37	6a	6a	NNP
10_1101-2020_12_31_424971	157	38	,	,	,
10_1101-2020_12_31_424971	157	39	d	d	NN
10_1101-2020_12_31_424971	157	40	,	,	,
10_1101-2020_12_31_424971	157	41	and	and	CC
10_1101-2020_12_31_424971	157	42	f	f	NNP
10_1101-2020_12_31_424971	157	43	,	,	,
10_1101-2020_12_31_424971	157	44	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	157	45	Figures	Figures	NNP
10_1101-2020_12_31_424971	157	46	3	3	CD
10_1101-2020_12_31_424971	157	47	,	,	,
10_1101-2020_12_31_424971	157	48	4a	4a	CD
10_1101-2020_12_31_424971	157	49	,	,	,
10_1101-2020_12_31_424971	157	50	and	and	CC
10_1101-2020_12_31_424971	157	51	4b	4b	NNP
10_1101-2020_12_31_424971	157	52	)	)	-RRB-
10_1101-2020_12_31_424971	157	53	.	.	.
10_1101-2020_12_31_424971	158	1	The	the	DT
10_1101-2020_12_31_424971	158	2	results	result	NNS
10_1101-2020_12_31_424971	158	3	showed	show	VBD
10_1101-2020_12_31_424971	158	4	that	that	IN
10_1101-2020_12_31_424971	158	5	k70S	k70s	RB
10_1101-2020_12_31_424971	158	6	390	390	CD
10_1101-2020_12_31_424971	158	7	IC→GS2	ic→gs2	NN
10_1101-2020_12_31_424971	158	8	,	,	,
10_1101-2020_12_31_424971	158	9	as	as	RB
10_1101-2020_12_31_424971	158	10	well	well	RB
10_1101-2020_12_31_424971	158	11	as	as	IN
10_1101-2020_12_31_424971	158	12	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	158	13	,	,	,
10_1101-2020_12_31_424971	158	14	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	158	15	,	,	,
10_1101-2020_12_31_424971	158	16	and	and	CC
10_1101-2020_12_31_424971	158	17	Keq	Keq	NNP
10_1101-2020_12_31_424971	158	18	at	at	IN
10_1101-2020_12_31_424971	158	19	1	1	CD
10_1101-2020_12_31_424971	158	20	min	min	NN
10_1101-2020_12_31_424971	158	21	post	post	JJ
10_1101-2020_12_31_424971	158	22	-	-	JJ
10_1101-2020_12_31_424971	158	23	delivery	delivery	NN
10_1101-2020_12_31_424971	158	24	,	,	,
10_1101-2020_12_31_424971	158	25	for	for	IN
10_1101-2020_12_31_424971	158	26	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	158	27	were	be	VBD
10_1101-2020_12_31_424971	158	28	each	each	DT
10_1101-2020_12_31_424971	158	29	less	less	JJR
10_1101-2020_12_31_424971	158	30	391	391	CD
10_1101-2020_12_31_424971	158	31	than	than	IN
10_1101-2020_12_31_424971	158	32	2-fold	2-fold	CD
10_1101-2020_12_31_424971	158	33	different	different	JJ
10_1101-2020_12_31_424971	158	34	than	than	IN
10_1101-2020_12_31_424971	158	35	the	the	DT
10_1101-2020_12_31_424971	158	36	corresponding	corresponding	JJ
10_1101-2020_12_31_424971	158	37	value	value	NN
10_1101-2020_12_31_424971	158	38	for	for	IN
10_1101-2020_12_31_424971	158	39	ProL	ProL	NNP
10_1101-2020_12_31_424971	158	40	-	-	HYPH
10_1101-2020_12_31_424971	158	41	TC	TC	NNP
10_1101-2020_12_31_424971	158	42	(	(	-LRB-
10_1101-2020_12_31_424971	158	43	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	158	44	Table	Table	NNP
10_1101-2020_12_31_424971	158	45	4	4	CD
10_1101-2020_12_31_424971	158	46	)	)	-RRB-
10_1101-2020_12_31_424971	158	47	.	.	.
10_1101-2020_12_31_424971	159	1	The	the	DT
10_1101-2020_12_31_424971	159	2	392	392	CD
10_1101-2020_12_31_424971	159	3	close	close	JJ
10_1101-2020_12_31_424971	159	4	correspondence	correspondence	NN
10_1101-2020_12_31_424971	159	5	of	of	IN
10_1101-2020_12_31_424971	159	6	these	these	DT
10_1101-2020_12_31_424971	159	7	rates	rate	NNS
10_1101-2020_12_31_424971	159	8	indicates	indicate	VBZ
10_1101-2020_12_31_424971	159	9	that	that	IN
10_1101-2020_12_31_424971	159	10	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	159	11	is	be	VBZ
10_1101-2020_12_31_424971	159	12	delivered	deliver	VBN
10_1101-2020_12_31_424971	159	13	to	to	IN
10_1101-2020_12_31_424971	159	14	the	the	DT
10_1101-2020_12_31_424971	159	15	A	A	NNP
10_1101-2020_12_31_424971	159	16	site	site	NN
10_1101-2020_12_31_424971	159	17	,	,	,
10_1101-2020_12_31_424971	159	18	393	393	CD
10_1101-2020_12_31_424971	159	19	participates	participate	NNS
10_1101-2020_12_31_424971	159	20	in	in	IN
10_1101-2020_12_31_424971	159	21	peptide	peptide	NN
10_1101-2020_12_31_424971	159	22	-	-	HYPH
10_1101-2020_12_31_424971	159	23	bond	bond	NN
10_1101-2020_12_31_424971	159	24	formation	formation	NN
10_1101-2020_12_31_424971	159	25	,	,	,
10_1101-2020_12_31_424971	159	26	undergoes	undergo	VBZ
10_1101-2020_12_31_424971	159	27	GS2	gs2	NN
10_1101-2020_12_31_424971	159	28	formation	formation	NN
10_1101-2020_12_31_424971	159	29	,	,	,
10_1101-2020_12_31_424971	159	30	and	and	CC
10_1101-2020_12_31_424971	159	31	exhibits	exhibit	VBZ
10_1101-2020_12_31_424971	159	32	GS1→GS2	GS1→GS2	NNP
10_1101-2020_12_31_424971	159	33	and	and	CC
10_1101-2020_12_31_424971	159	34	394	394	CD
10_1101-2020_12_31_424971	159	35	GS2→GS1	gs2→gs1	NN
10_1101-2020_12_31_424971	159	36	transitions	transition	NNS
10_1101-2020_12_31_424971	159	37	within	within	IN
10_1101-2020_12_31_424971	159	38	the	the	DT
10_1101-2020_12_31_424971	159	39	GS1	GS1	NNP
10_1101-2020_12_31_424971	159	40	⇄	⇄	NNP
10_1101-2020_12_31_424971	159	41	GS2	GS2	NNP
10_1101-2020_12_31_424971	159	42	equilibrium	equilibrium	NN
10_1101-2020_12_31_424971	159	43	in	in	IN
10_1101-2020_12_31_424971	159	44	a	a	DT
10_1101-2020_12_31_424971	159	45	manner	manner	NN
10_1101-2020_12_31_424971	159	46	that	that	WDT
10_1101-2020_12_31_424971	159	47	is	be	VBZ
10_1101-2020_12_31_424971	159	48	similar	similar	JJ
10_1101-2020_12_31_424971	159	49	to	to	IN
10_1101-2020_12_31_424971	159	50	ProL	ProL	NNP
10_1101-2020_12_31_424971	159	51	-	-	HYPH
10_1101-2020_12_31_424971	159	52	TC	TC	NNP
10_1101-2020_12_31_424971	159	53	,	,	,
10_1101-2020_12_31_424971	159	54	395	395	CD
10_1101-2020_12_31_424971	159	55	consistent	consistent	JJ
10_1101-2020_12_31_424971	159	56	with	with	IN
10_1101-2020_12_31_424971	159	57	the	the	DT
10_1101-2020_12_31_424971	159	58	results	result	NNS
10_1101-2020_12_31_424971	159	59	of	of	IN
10_1101-2020_12_31_424971	159	60	ensemble	ensemble	JJ
10_1101-2020_12_31_424971	159	61	kinetic	kinetic	NN
10_1101-2020_12_31_424971	159	62	assays	assay	NNS
10_1101-2020_12_31_424971	159	63	(	(	-LRB-
10_1101-2020_12_31_424971	159	64	Figures	Figures	NNP
10_1101-2020_12_31_424971	159	65	3a	3a	NNP
10_1101-2020_12_31_424971	159	66	-	-	HYPH
10_1101-2020_12_31_424971	159	67	c	c	NNP
10_1101-2020_12_31_424971	159	68	,	,	,
10_1101-2020_12_31_424971	159	69	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	159	70	Table	Table	NNP
10_1101-2020_12_31_424971	159	71	2	2	CD
10_1101-2020_12_31_424971	159	72	,	,	,
10_1101-2020_12_31_424971	159	73	and	and	CC
10_1101-2020_12_31_424971	159	74	396	396	CD
10_1101-2020_12_31_424971	159	75	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	159	76	Figure	Figure	NNP
10_1101-2020_12_31_424971	159	77	2a	2a	NNP
10_1101-2020_12_31_424971	159	78	)	)	-RRB-
10_1101-2020_12_31_424971	159	79	and	and	CC
10_1101-2020_12_31_424971	159	80	thereby	thereby	RB
10_1101-2020_12_31_424971	159	81	strengthening	strengthen	VBG
10_1101-2020_12_31_424971	159	82	our	-PRON-	PRP$
10_1101-2020_12_31_424971	159	83	interpretation	interpretation	NN
10_1101-2020_12_31_424971	159	84	that	that	IN
10_1101-2020_12_31_424971	159	85	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	159	86	uses	use	VBZ
10_1101-2020_12_31_424971	159	87	triplet	triplet	NN
10_1101-2020_12_31_424971	159	88	397	397	CD
10_1101-2020_12_31_424971	159	89	pairing	pair	VBG
10_1101-2020_12_31_424971	159	90	in	in	IN
10_1101-2020_12_31_424971	159	91	the	the	DT
10_1101-2020_12_31_424971	159	92	0-frame	0-frame	CD
10_1101-2020_12_31_424971	159	93	at	at	IN
10_1101-2020_12_31_424971	159	94	the	the	DT
10_1101-2020_12_31_424971	159	95	A	A	NNP
10_1101-2020_12_31_424971	159	96	site	site	NN
10_1101-2020_12_31_424971	159	97	during	during	IN
10_1101-2020_12_31_424971	159	98	the	the	DT
10_1101-2020_12_31_424971	159	99	early	early	JJ
10_1101-2020_12_31_424971	159	100	stages	stage	NNS
10_1101-2020_12_31_424971	159	101	of	of	IN
10_1101-2020_12_31_424971	159	102	the	the	DT
10_1101-2020_12_31_424971	159	103	elongation	elongation	NN
10_1101-2020_12_31_424971	159	104	cycle	cycle	NN
10_1101-2020_12_31_424971	159	105	that	that	WDT
10_1101-2020_12_31_424971	159	106	precede	precede	VBP
10_1101-2020_12_31_424971	159	107	398	398	CD
10_1101-2020_12_31_424971	159	108	EF	EF	NNP
10_1101-2020_12_31_424971	159	109	-	-	HYPH
10_1101-2020_12_31_424971	159	110	G	g	NN
10_1101-2020_12_31_424971	159	111	binding	binding	NN
10_1101-2020_12_31_424971	159	112	and	and	CC
10_1101-2020_12_31_424971	159	113	EF	EF	NNP
10_1101-2020_12_31_424971	159	114	-	-	HYPH
10_1101-2020_12_31_424971	159	115	G	G	NNP
10_1101-2020_12_31_424971	159	116	-	-	HYPH
10_1101-2020_12_31_424971	159	117	catalyzed	catalyze	VBN
10_1101-2020_12_31_424971	159	118	translocation	translocation	NN
10_1101-2020_12_31_424971	159	119	.	.	.
10_1101-2020_12_31_424971	160	1	Although	although	IN
10_1101-2020_12_31_424971	160	2	we	-PRON-	PRP
10_1101-2020_12_31_424971	160	3	could	could	MD
10_1101-2020_12_31_424971	160	4	not	not	RB
10_1101-2020_12_31_424971	160	5	confidently	confidently	RB
10_1101-2020_12_31_424971	160	6	detect	detect	VB
10_1101-2020_12_31_424971	160	7	the	the	DT
10_1101-2020_12_31_424971	160	8	399	399	CD
10_1101-2020_12_31_424971	160	9	presence	presence	NN
10_1101-2020_12_31_424971	160	10	of	of	IN
10_1101-2020_12_31_424971	160	11	two	two	CD
10_1101-2020_12_31_424971	160	12	sub	sub	NN
10_1101-2020_12_31_424971	160	13	-	-	NNS
10_1101-2020_12_31_424971	160	14	populations	population	NNS
10_1101-2020_12_31_424971	160	15	of	of	IN
10_1101-2020_12_31_424971	160	16	A	a	DT
10_1101-2020_12_31_424971	160	17	site	site	NN
10_1101-2020_12_31_424971	160	18	-	-	HYPH
10_1101-2020_12_31_424971	160	19	bound	bind	VBN
10_1101-2020_12_31_424971	160	20	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	160	21	in	in	IN
10_1101-2020_12_31_424971	160	22	the	the	DT
10_1101-2020_12_31_424971	160	23	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	160	24	data	datum	NNS
10_1101-2020_12_31_424971	160	25	that	that	WDT
10_1101-2020_12_31_424971	160	26	might	may	MD
10_1101-2020_12_31_424971	160	27	differ	differ	VB
10_1101-2020_12_31_424971	160	28	in	in	IN
10_1101-2020_12_31_424971	160	29	400	400	CD
10_1101-2020_12_31_424971	160	30	their	-PRON-	PRP$
10_1101-2020_12_31_424971	160	31	propensity	propensity	NN
10_1101-2020_12_31_424971	160	32	of	of	IN
10_1101-2020_12_31_424971	160	33	undergoing	undergoing	JJ
10_1101-2020_12_31_424971	160	34	+1	+1	NNS
10_1101-2020_12_31_424971	160	35	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	160	36	,	,	,
10_1101-2020_12_31_424971	160	37	as	as	IN
10_1101-2020_12_31_424971	160	38	suggested	suggest	VBN
10_1101-2020_12_31_424971	160	39	by	by	IN
10_1101-2020_12_31_424971	160	40	the	the	DT
10_1101-2020_12_31_424971	160	41	results	result	NNS
10_1101-2020_12_31_424971	160	42	presented	present	VBN
10_1101-2020_12_31_424971	160	43	in	in	IN
10_1101-2020_12_31_424971	160	44	Figure	Figure	NNP
10_1101-2020_12_31_424971	160	45	401	401	CD
10_1101-2020_12_31_424971	160	46	5a	5a	CD
10_1101-2020_12_31_424971	160	47	,	,	,
10_1101-2020_12_31_424971	160	48	it	-PRON-	PRP
10_1101-2020_12_31_424971	160	49	is	be	VBZ
10_1101-2020_12_31_424971	160	50	possible	possible	JJ
10_1101-2020_12_31_424971	160	51	that	that	IN
10_1101-2020_12_31_424971	160	52	the	the	DT
10_1101-2020_12_31_424971	160	53	distance	distance	NN
10_1101-2020_12_31_424971	160	54	between	between	IN
10_1101-2020_12_31_424971	160	55	our	-PRON-	PRP$
10_1101-2020_12_31_424971	160	56	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	160	57	probes	probe	NNS
10_1101-2020_12_31_424971	160	58	and/or	and/or	CC
10_1101-2020_12_31_424971	160	59	the	the	DT
10_1101-2020_12_31_424971	160	60	time	time	NN
10_1101-2020_12_31_424971	160	61	spent	spend	VBN
10_1101-2020_12_31_424971	160	62	in	in	IN
10_1101-2020_12_31_424971	160	63	one	one	CD
10_1101-2020_12_31_424971	160	64	of	of	IN
10_1101-2020_12_31_424971	160	65	402	402	CD
10_1101-2020_12_31_424971	160	66	the	the	DT
10_1101-2020_12_31_424971	160	67	observed	observed	JJ
10_1101-2020_12_31_424971	160	68	FRET	FRET	NNP
10_1101-2020_12_31_424971	160	69	states	state	NNS
10_1101-2020_12_31_424971	160	70	are	be	VBP
10_1101-2020_12_31_424971	160	71	not	not	RB
10_1101-2020_12_31_424971	160	72	sensitive	sensitive	JJ
10_1101-2020_12_31_424971	160	73	enough	enough	RB
10_1101-2020_12_31_424971	160	74	to	to	TO
10_1101-2020_12_31_424971	160	75	detect	detect	VB
10_1101-2020_12_31_424971	160	76	the	the	DT
10_1101-2020_12_31_424971	160	77	structural	structural	JJ
10_1101-2020_12_31_424971	160	78	and/or	and/or	CC
10_1101-2020_12_31_424971	160	79	energetic	energetic	JJ
10_1101-2020_12_31_424971	160	80	403	403	CD
10_1101-2020_12_31_424971	160	81	differences	difference	NNS
10_1101-2020_12_31_424971	160	82	between	between	IN
10_1101-2020_12_31_424971	160	83	these	these	DT
10_1101-2020_12_31_424971	160	84	sub	sub	NN
10_1101-2020_12_31_424971	160	85	-	-	NNS
10_1101-2020_12_31_424971	160	86	populations	population	NNS
10_1101-2020_12_31_424971	160	87	of	of	IN
10_1101-2020_12_31_424971	160	88	A	a	DT
10_1101-2020_12_31_424971	160	89	site	site	NN
10_1101-2020_12_31_424971	160	90	-	-	HYPH
10_1101-2020_12_31_424971	160	91	bound	bind	VBN
10_1101-2020_12_31_424971	160	92	SufB2	sufb2	NN
10_1101-2020_12_31_424971	160	93	.	.	.
10_1101-2020_12_31_424971	161	1	The	the	DT
10_1101-2020_12_31_424971	161	2	development	development	NN
10_1101-2020_12_31_424971	161	3	of	of	IN
10_1101-2020_12_31_424971	161	4	different	different	JJ
10_1101-2020_12_31_424971	161	5	404	404	CD
10_1101-2020_12_31_424971	161	6	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	161	7	signals	signal	NNS
10_1101-2020_12_31_424971	161	8	and/or	and/or	CC
10_1101-2020_12_31_424971	161	9	the	the	DT
10_1101-2020_12_31_424971	161	10	use	use	NN
10_1101-2020_12_31_424971	161	11	of	of	IN
10_1101-2020_12_31_424971	161	12	variants	variant	NNS
10_1101-2020_12_31_424971	161	13	of	of	IN
10_1101-2020_12_31_424971	161	14	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	161	15	and/or	and/or	CC
10_1101-2020_12_31_424971	161	16	the	the	DT
10_1101-2020_12_31_424971	161	17	CCC	CCC	NNP
10_1101-2020_12_31_424971	161	18	-	-	HYPH
10_1101-2020_12_31_424971	161	19	C	C	NNP
10_1101-2020_12_31_424971	161	20	motif	motif	NN
10_1101-2020_12_31_424971	161	21	with	with	IN
10_1101-2020_12_31_424971	161	22	different	different	JJ
10_1101-2020_12_31_424971	161	23	405	405	CD
10_1101-2020_12_31_424971	161	24	propensities	propensity	NNS
10_1101-2020_12_31_424971	161	25	of	of	IN
10_1101-2020_12_31_424971	161	26	undergoing	undergo	VBG
10_1101-2020_12_31_424971	161	27	+1	+1	NNS
10_1101-2020_12_31_424971	161	28	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	161	29	may	may	MD
10_1101-2020_12_31_424971	161	30	allow	allow	VB
10_1101-2020_12_31_424971	161	31	future	future	JJ
10_1101-2020_12_31_424971	161	32	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	161	33	investigations	investigation	NNS
10_1101-2020_12_31_424971	161	34	to	to	TO
10_1101-2020_12_31_424971	161	35	identify	identify	VB
10_1101-2020_12_31_424971	161	36	406	406	CD
10_1101-2020_12_31_424971	161	37	and	and	CC
10_1101-2020_12_31_424971	161	38	characterize	characterize	VB
10_1101-2020_12_31_424971	161	39	such	such	JJ
10_1101-2020_12_31_424971	161	40	sub	sub	NN
10_1101-2020_12_31_424971	161	41	-	-	NNS
10_1101-2020_12_31_424971	161	42	populations	population	NNS
10_1101-2020_12_31_424971	161	43	.	.	.
10_1101-2020_12_31_424971	162	1	407	407	CD
10_1101-2020_12_31_424971	162	2	.CC	.CC	:
10_1101-2020_12_31_424971	162	3	-	-	HYPH
10_1101-2020_12_31_424971	162	4	BY	by	IN
10_1101-2020_12_31_424971	162	5	-	-	HYPH
10_1101-2020_12_31_424971	162	6	NC	NC	NNP
10_1101-2020_12_31_424971	162	7	-	-	HYPH
10_1101-2020_12_31_424971	162	8	ND	ND	NNP
10_1101-2020_12_31_424971	162	9	4.0	4.0	CD
10_1101-2020_12_31_424971	162	10	International	International	NNP
10_1101-2020_12_31_424971	162	11	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	162	12	under	under	IN
10_1101-2020_12_31_424971	162	13	a	a	DT
10_1101-2020_12_31_424971	162	14	(	(	-LRB-
10_1101-2020_12_31_424971	162	15	which	which	WDT
10_1101-2020_12_31_424971	162	16	was	be	VBD
10_1101-2020_12_31_424971	162	17	not	not	RB
10_1101-2020_12_31_424971	162	18	certified	certify	VBN
10_1101-2020_12_31_424971	162	19	by	by	IN
10_1101-2020_12_31_424971	162	20	peer	peer	NN
10_1101-2020_12_31_424971	162	21	review	review	NN
10_1101-2020_12_31_424971	162	22	)	)	-RRB-
10_1101-2020_12_31_424971	162	23	is	be	VBZ
10_1101-2020_12_31_424971	162	24	the	the	DT
10_1101-2020_12_31_424971	162	25	author	author	NN
10_1101-2020_12_31_424971	162	26	/	/	SYM
10_1101-2020_12_31_424971	162	27	funder	funder	NN
10_1101-2020_12_31_424971	162	28	,	,	,
10_1101-2020_12_31_424971	162	29	who	who	WP
10_1101-2020_12_31_424971	162	30	has	have	VBZ
10_1101-2020_12_31_424971	162	31	granted	grant	VBN
10_1101-2020_12_31_424971	162	32	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	162	33	a	a	DT
10_1101-2020_12_31_424971	162	34	license	license	NN
10_1101-2020_12_31_424971	162	35	to	to	TO
10_1101-2020_12_31_424971	162	36	display	display	VB
10_1101-2020_12_31_424971	162	37	the	the	DT
10_1101-2020_12_31_424971	162	38	preprint	preprint	NN
10_1101-2020_12_31_424971	162	39	in	in	IN
10_1101-2020_12_31_424971	162	40	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	162	41	.	.	.
10_1101-2020_12_31_424971	163	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	163	2	is	be	VBZ
10_1101-2020_12_31_424971	163	3	made	make	VBN
10_1101-2020_12_31_424971	163	4	The	the	DT
10_1101-2020_12_31_424971	163	5	copyright	copyright	NN
10_1101-2020_12_31_424971	163	6	holder	holder	NN
10_1101-2020_12_31_424971	163	7	for	for	IN
10_1101-2020_12_31_424971	163	8	this	this	DT
10_1101-2020_12_31_424971	163	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	163	10	version	version	NN
10_1101-2020_12_31_424971	163	11	posted	post	VBD
10_1101-2020_12_31_424971	163	12	January	January	NNP
10_1101-2020_12_31_424971	163	13	2	2	CD
10_1101-2020_12_31_424971	163	14	,	,	,
10_1101-2020_12_31_424971	163	15	2021	2021	CD
10_1101-2020_12_31_424971	163	16	.	.	.
10_1101-2020_12_31_424971	163	17	;	;	:
10_1101-2020_12_31_424971	163	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	163	19	:	:	:
10_1101-2020_12_31_424971	163	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	163	21	preprint	preprint	NN
10_1101-2020_12_31_424971	163	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	163	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	163	24	17	17	CD
10_1101-2020_12_31_424971	163	25	We	-PRON-	PRP
10_1101-2020_12_31_424971	163	26	then	then	RB
10_1101-2020_12_31_424971	163	27	investigated	investigate	VBD
10_1101-2020_12_31_424971	163	28	whether	whether	IN
10_1101-2020_12_31_424971	163	29	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	163	30	alters	alter	VBZ
10_1101-2020_12_31_424971	163	31	the	the	DT
10_1101-2020_12_31_424971	163	32	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	163	33	of	of	IN
10_1101-2020_12_31_424971	163	34	elongation	elongation	NN
10_1101-2020_12_31_424971	163	35	complexes	complex	NNS
10_1101-2020_12_31_424971	163	36	during	during	IN
10_1101-2020_12_31_424971	163	37	the	the	DT
10_1101-2020_12_31_424971	163	38	408	408	CD
10_1101-2020_12_31_424971	163	39	later	later	JJ
10_1101-2020_12_31_424971	163	40	steps	step	NNS
10_1101-2020_12_31_424971	163	41	of	of	IN
10_1101-2020_12_31_424971	163	42	the	the	DT
10_1101-2020_12_31_424971	163	43	elongation	elongation	NN
10_1101-2020_12_31_424971	163	44	cycle	cycle	NN
10_1101-2020_12_31_424971	163	45	.	.	.
10_1101-2020_12_31_424971	164	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	164	2	stopped	stop	VBD
10_1101-2020_12_31_424971	164	3	-	-	HYPH
10_1101-2020_12_31_424971	164	4	flow	flow	NN
10_1101-2020_12_31_424971	164	5	delivered	deliver	VBN
10_1101-2020_12_31_424971	164	6	SufB2-	SufB2-	NNP
10_1101-2020_12_31_424971	164	7	or	or	CC
10_1101-2020_12_31_424971	164	8	ProL	ProL	NNP
10_1101-2020_12_31_424971	164	9	-	-	HYPH
10_1101-2020_12_31_424971	164	10	TC	TC	NNP
10_1101-2020_12_31_424971	164	11	and	and	CC
10_1101-2020_12_31_424971	164	12	EF	EF	NNP
10_1101-2020_12_31_424971	164	13	-	-	HYPH
10_1101-2020_12_31_424971	164	14	G	G	NNP
10_1101-2020_12_31_424971	164	15	to	to	IN
10_1101-2020_12_31_424971	164	16	409	409	CD
10_1101-2020_12_31_424971	164	17	70S	70S	NNP
10_1101-2020_12_31_424971	164	18	ICs	ic	NNS
10_1101-2020_12_31_424971	164	19	and	and	CC
10_1101-2020_12_31_424971	164	20	recorded	record	VBD
10_1101-2020_12_31_424971	164	21	pre	pre	JJ
10_1101-2020_12_31_424971	164	22	-	-	JJ
10_1101-2020_12_31_424971	164	23	steady	steady	JJ
10_1101-2020_12_31_424971	164	24	-	-	HYPH
10_1101-2020_12_31_424971	164	25	state	state	NN
10_1101-2020_12_31_424971	164	26	movies	movie	NNS
10_1101-2020_12_31_424971	164	27	during	during	IN
10_1101-2020_12_31_424971	164	28	delivery	delivery	NN
10_1101-2020_12_31_424971	164	29	,	,	,
10_1101-2020_12_31_424971	164	30	and	and	CC
10_1101-2020_12_31_424971	164	31	steady	steady	JJ
10_1101-2020_12_31_424971	164	32	-	-	HYPH
10_1101-2020_12_31_424971	164	33	state	state	NN
10_1101-2020_12_31_424971	164	34	movies	movie	NNS
10_1101-2020_12_31_424971	164	35	1	1	CD
10_1101-2020_12_31_424971	164	36	,	,	,
10_1101-2020_12_31_424971	164	37	3	3	CD
10_1101-2020_12_31_424971	164	38	,	,	,
10_1101-2020_12_31_424971	164	39	10	10	CD
10_1101-2020_12_31_424971	164	40	,	,	,
10_1101-2020_12_31_424971	164	41	410	410	CD
10_1101-2020_12_31_424971	164	42	and	and	CC
10_1101-2020_12_31_424971	164	43	20	20	CD
10_1101-2020_12_31_424971	164	44	min	min	NN
10_1101-2020_12_31_424971	164	45	post	post	JJ
10_1101-2020_12_31_424971	164	46	-	-	JJ
10_1101-2020_12_31_424971	164	47	delivery	delivery	JJ
10_1101-2020_12_31_424971	164	48	(	(	-LRB-
10_1101-2020_12_31_424971	164	49	Figures	Figures	NNPS
10_1101-2020_12_31_424971	164	50	6b	6b	NNP
10_1101-2020_12_31_424971	164	51	,	,	,
10_1101-2020_12_31_424971	164	52	e	e	NN
10_1101-2020_12_31_424971	164	53	,	,	,
10_1101-2020_12_31_424971	164	54	and	and	CC
10_1101-2020_12_31_424971	164	55	g	g	NN
10_1101-2020_12_31_424971	164	56	,	,	,
10_1101-2020_12_31_424971	164	57	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	164	58	Figures	Figures	NNP
10_1101-2020_12_31_424971	164	59	4c	4c	NNP
10_1101-2020_12_31_424971	164	60	,	,	,
10_1101-2020_12_31_424971	164	61	4d	4d	CD
10_1101-2020_12_31_424971	164	62	,	,	,
10_1101-2020_12_31_424971	164	63	and	and	CC
10_1101-2020_12_31_424971	164	64	5	5	CD
10_1101-2020_12_31_424971	164	65	)	)	-RRB-
10_1101-2020_12_31_424971	164	66	.	.	.
10_1101-2020_12_31_424971	165	1	The	the	DT
10_1101-2020_12_31_424971	165	2	results	result	NNS
10_1101-2020_12_31_424971	165	3	411	411	CD
10_1101-2020_12_31_424971	165	4	showed	show	VBD
10_1101-2020_12_31_424971	165	5	that	that	IN
10_1101-2020_12_31_424971	165	6	k70S	k70S	NNP
10_1101-2020_12_31_424971	165	7	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	165	8	for	for	IN
10_1101-2020_12_31_424971	165	9	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	165	10	and	and	CC
10_1101-2020_12_31_424971	165	11	ProL	ProL	NNP
10_1101-2020_12_31_424971	165	12	-	-	HYPH
10_1101-2020_12_31_424971	165	13	TC	TC	NNP
10_1101-2020_12_31_424971	165	14	were	be	VBD
10_1101-2020_12_31_424971	165	15	within	within	IN
10_1101-2020_12_31_424971	165	16	error	error	NN
10_1101-2020_12_31_424971	165	17	of	of	IN
10_1101-2020_12_31_424971	165	18	each	each	DT
10_1101-2020_12_31_424971	165	19	other	other	JJ
10_1101-2020_12_31_424971	165	20	(	(	-LRB-
10_1101-2020_12_31_424971	165	21	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	165	22	412	412	CD
10_1101-2020_12_31_424971	165	23	Table	table	NN
10_1101-2020_12_31_424971	165	24	5	5	CD
10_1101-2020_12_31_424971	165	25	)	)	-RRB-
10_1101-2020_12_31_424971	165	26	,	,	,
10_1101-2020_12_31_424971	165	27	again	again	RB
10_1101-2020_12_31_424971	165	28	suggesting	suggest	VBG
10_1101-2020_12_31_424971	165	29	that	that	IN
10_1101-2020_12_31_424971	165	30	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	165	31	is	be	VBZ
10_1101-2020_12_31_424971	165	32	delivered	deliver	VBN
10_1101-2020_12_31_424971	165	33	to	to	IN
10_1101-2020_12_31_424971	165	34	the	the	DT
10_1101-2020_12_31_424971	165	35	A	A	NNP
10_1101-2020_12_31_424971	165	36	site	site	NN
10_1101-2020_12_31_424971	165	37	,	,	,
10_1101-2020_12_31_424971	165	38	participates	participate	VBZ
10_1101-2020_12_31_424971	165	39	in	in	IN
10_1101-2020_12_31_424971	165	40	peptide	peptide	NN
10_1101-2020_12_31_424971	165	41	-	-	HYPH
10_1101-2020_12_31_424971	165	42	bond	bond	NN
10_1101-2020_12_31_424971	165	43	413	413	CD
10_1101-2020_12_31_424971	165	44	formation	formation	NN
10_1101-2020_12_31_424971	165	45	,	,	,
10_1101-2020_12_31_424971	165	46	and	and	CC
10_1101-2020_12_31_424971	165	47	undergoes	undergo	VBZ
10_1101-2020_12_31_424971	165	48	GS2	gs2	NN
10_1101-2020_12_31_424971	165	49	formation	formation	NN
10_1101-2020_12_31_424971	165	50	in	in	IN
10_1101-2020_12_31_424971	165	51	a	a	DT
10_1101-2020_12_31_424971	165	52	manner	manner	NN
10_1101-2020_12_31_424971	165	53	that	that	WDT
10_1101-2020_12_31_424971	165	54	is	be	VBZ
10_1101-2020_12_31_424971	165	55	similar	similar	JJ
10_1101-2020_12_31_424971	165	56	to	to	IN
10_1101-2020_12_31_424971	165	57	ProL	ProL	NNP
10_1101-2020_12_31_424971	165	58	-	-	HYPH
10_1101-2020_12_31_424971	165	59	TC	TC	NNP
10_1101-2020_12_31_424971	165	60	.	.	.
10_1101-2020_12_31_424971	166	1	Notably	notably	RB
10_1101-2020_12_31_424971	166	2	,	,	,
10_1101-2020_12_31_424971	166	3	the	the	DT
10_1101-2020_12_31_424971	166	4	k70S	k70S	NNP
10_1101-2020_12_31_424971	166	5	414	414	CD
10_1101-2020_12_31_424971	166	6	IC→GS2s	ic→gs2s	CD
10_1101-2020_12_31_424971	166	7	obtained	obtain	VBN
10_1101-2020_12_31_424971	166	8	in	in	IN
10_1101-2020_12_31_424971	166	9	the	the	DT
10_1101-2020_12_31_424971	166	10	presence	presence	NN
10_1101-2020_12_31_424971	166	11	of	of	IN
10_1101-2020_12_31_424971	166	12	EF	EF	NNP
10_1101-2020_12_31_424971	166	13	-	-	HYPH
10_1101-2020_12_31_424971	166	14	G	G	NNP
10_1101-2020_12_31_424971	166	15	were	be	VBD
10_1101-2020_12_31_424971	166	16	within	within	IN
10_1101-2020_12_31_424971	166	17	error	error	NN
10_1101-2020_12_31_424971	166	18	of	of	IN
10_1101-2020_12_31_424971	166	19	the	the	DT
10_1101-2020_12_31_424971	166	20	ones	one	NNS
10_1101-2020_12_31_424971	166	21	obtained	obtain	VBN
10_1101-2020_12_31_424971	166	22	in	in	IN
10_1101-2020_12_31_424971	166	23	the	the	DT
10_1101-2020_12_31_424971	166	24	absence	absence	NN
10_1101-2020_12_31_424971	166	25	of	of	IN
10_1101-2020_12_31_424971	166	26	415	415	CD
10_1101-2020_12_31_424971	166	27	EF	EF	NNP
10_1101-2020_12_31_424971	166	28	-	-	HYPH
10_1101-2020_12_31_424971	166	29	G	G	NNP
10_1101-2020_12_31_424971	166	30	,	,	,
10_1101-2020_12_31_424971	166	31	consistent	consistent	JJ
10_1101-2020_12_31_424971	166	32	with	with	IN
10_1101-2020_12_31_424971	166	33	reports	report	NNS
10_1101-2020_12_31_424971	166	34	that	that	IN
10_1101-2020_12_31_424971	166	35	EF	EF	NNP
10_1101-2020_12_31_424971	166	36	-	-	HYPH
10_1101-2020_12_31_424971	166	37	G	G	NNP
10_1101-2020_12_31_424971	166	38	has	have	VBZ
10_1101-2020_12_31_424971	166	39	little	little	JJ
10_1101-2020_12_31_424971	166	40	to	to	IN
10_1101-2020_12_31_424971	166	41	no	no	DT
10_1101-2020_12_31_424971	166	42	effect	effect	NN
10_1101-2020_12_31_424971	166	43	on	on	IN
10_1101-2020_12_31_424971	166	44	the	the	DT
10_1101-2020_12_31_424971	166	45	rate	rate	NN
10_1101-2020_12_31_424971	166	46	with	with	IN
10_1101-2020_12_31_424971	166	47	which	which	WDT
10_1101-2020_12_31_424971	166	48	PRE	PRE	NNP
10_1101-2020_12_31_424971	166	49	416	416	CD
10_1101-2020_12_31_424971	166	50	complexes	complex	NNS
10_1101-2020_12_31_424971	166	51	undergo	undergo	VBP
10_1101-2020_12_31_424971	166	52	GS1→GS2	GS1→GS2	NNP
10_1101-2020_12_31_424971	166	53	transitions37,42	transitions37,42	NNP
10_1101-2020_12_31_424971	166	54	.	.	.
10_1101-2020_12_31_424971	167	1	417	417	CD
10_1101-2020_12_31_424971	167	2	Once	once	IN
10_1101-2020_12_31_424971	167	3	it	-PRON-	PRP
10_1101-2020_12_31_424971	167	4	transitions	transition	VBZ
10_1101-2020_12_31_424971	167	5	into	into	IN
10_1101-2020_12_31_424971	167	6	GS2	GS2	NNP
10_1101-2020_12_31_424971	167	7	,	,	,
10_1101-2020_12_31_424971	167	8	however	however	RB
10_1101-2020_12_31_424971	167	9	,	,	,
10_1101-2020_12_31_424971	167	10	the	the	DT
10_1101-2020_12_31_424971	167	11	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	167	12	PRE	PRE	NNP
10_1101-2020_12_31_424971	167	13	complex	complex	NN
10_1101-2020_12_31_424971	167	14	can	can	MD
10_1101-2020_12_31_424971	167	15	bind	bind	VB
10_1101-2020_12_31_424971	167	16	EF	EF	NNP
10_1101-2020_12_31_424971	167	17	-	-	HYPH
10_1101-2020_12_31_424971	167	18	G37,42	G37,42	NNP
10_1101-2020_12_31_424971	167	19	and	and	CC
10_1101-2020_12_31_424971	167	20	we	-PRON-	PRP
10_1101-2020_12_31_424971	167	21	find	find	VBP
10_1101-2020_12_31_424971	167	22	418	418	CD
10_1101-2020_12_31_424971	167	23	that	that	IN
10_1101-2020_12_31_424971	167	24	it	-PRON-	PRP
10_1101-2020_12_31_424971	167	25	becomes	become	VBZ
10_1101-2020_12_31_424971	167	26	arrested	arrest	VBN
10_1101-2020_12_31_424971	167	27	in	in	IN
10_1101-2020_12_31_424971	167	28	an	an	DT
10_1101-2020_12_31_424971	167	29	EF	EF	NNP
10_1101-2020_12_31_424971	167	30	-	-	HYPH
10_1101-2020_12_31_424971	167	31	G	G	NNP
10_1101-2020_12_31_424971	167	32	-	-	HYPH
10_1101-2020_12_31_424971	167	33	bound	bind	VBN
10_1101-2020_12_31_424971	167	34	GS2-like	GS2-like	NNP
10_1101-2020_12_31_424971	167	35	conformation	conformation	NN
10_1101-2020_12_31_424971	167	36	for	for	IN
10_1101-2020_12_31_424971	167	37	up	up	IN
10_1101-2020_12_31_424971	167	38	to	to	IN
10_1101-2020_12_31_424971	167	39	several	several	JJ
10_1101-2020_12_31_424971	167	40	minutes	minute	NNS
10_1101-2020_12_31_424971	167	41	,	,	,
10_1101-2020_12_31_424971	167	42	419	419	CD
10_1101-2020_12_31_424971	167	43	during	during	IN
10_1101-2020_12_31_424971	167	44	which	which	WDT
10_1101-2020_12_31_424971	167	45	it	-PRON-	PRP
10_1101-2020_12_31_424971	167	46	slowly	slowly	RB
10_1101-2020_12_31_424971	167	47	undergoes	undergo	VBZ
10_1101-2020_12_31_424971	167	48	a	a	DT
10_1101-2020_12_31_424971	167	49	GS2→POST	gs2→post	JJ
10_1101-2020_12_31_424971	167	50	transition	transition	NN
10_1101-2020_12_31_424971	167	51	(	(	-LRB-
10_1101-2020_12_31_424971	167	52	Figure	figure	NN
10_1101-2020_12_31_424971	167	53	6	6	CD
10_1101-2020_12_31_424971	167	54	g	g	NN
10_1101-2020_12_31_424971	167	55	,	,	,
10_1101-2020_12_31_424971	167	56	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	167	57	Figure	Figure	NNP
10_1101-2020_12_31_424971	167	58	5	5	CD
10_1101-2020_12_31_424971	167	59	)	)	-RRB-
10_1101-2020_12_31_424971	167	60	.	.	.
10_1101-2020_12_31_424971	168	1	420	420	CD
10_1101-2020_12_31_424971	168	2	While	while	IN
10_1101-2020_12_31_424971	168	3	the	the	DT
10_1101-2020_12_31_424971	168	4	limited	limited	JJ
10_1101-2020_12_31_424971	168	5	number	number	NN
10_1101-2020_12_31_424971	168	6	of	of	IN
10_1101-2020_12_31_424971	168	7	time	time	NN
10_1101-2020_12_31_424971	168	8	points	point	NNS
10_1101-2020_12_31_424971	168	9	did	do	VBD
10_1101-2020_12_31_424971	168	10	not	not	RB
10_1101-2020_12_31_424971	168	11	allow	allow	VB
10_1101-2020_12_31_424971	168	12	rigorous	rigorous	JJ
10_1101-2020_12_31_424971	168	13	determination	determination	NN
10_1101-2020_12_31_424971	168	14	of	of	IN
10_1101-2020_12_31_424971	168	15	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	168	16	for	for	IN
10_1101-2020_12_31_424971	168	17	the	the	DT
10_1101-2020_12_31_424971	168	18	421	421	CD
10_1101-2020_12_31_424971	168	19	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	168	20	PRE	PRE	NNP
10_1101-2020_12_31_424971	168	21	complex	complex	JJ
10_1101-2020_12_31_424971	168	22	,	,	,
10_1101-2020_12_31_424971	168	23	visual	visual	JJ
10_1101-2020_12_31_424971	168	24	inspection	inspection	NN
10_1101-2020_12_31_424971	168	25	(	(	-LRB-
10_1101-2020_12_31_424971	168	26	Figure	figure	NN
10_1101-2020_12_31_424971	168	27	6	6	CD
10_1101-2020_12_31_424971	168	28	g	g	NN
10_1101-2020_12_31_424971	168	29	)	)	-RRB-
10_1101-2020_12_31_424971	168	30	and	and	CC
10_1101-2020_12_31_424971	168	31	quantitative	quantitative	JJ
10_1101-2020_12_31_424971	168	32	analysis	analysis	NN
10_1101-2020_12_31_424971	168	33	(	(	-LRB-
10_1101-2020_12_31_424971	168	34	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	168	35	422	422	CD
10_1101-2020_12_31_424971	168	36	Tables	Tables	NNPS
10_1101-2020_12_31_424971	168	37	5	5	CD
10_1101-2020_12_31_424971	168	38	and	and	CC
10_1101-2020_12_31_424971	168	39	6	6	CD
10_1101-2020_12_31_424971	168	40	)	)	-RRB-
10_1101-2020_12_31_424971	168	41	showed	show	VBD
10_1101-2020_12_31_424971	168	42	that	that	IN
10_1101-2020_12_31_424971	168	43	the	the	DT
10_1101-2020_12_31_424971	168	44	GS2→POST	gs2→post	JJ
10_1101-2020_12_31_424971	168	45	reaction	reaction	NN
10_1101-2020_12_31_424971	168	46	was	be	VBD
10_1101-2020_12_31_424971	168	47	complete	complete	JJ
10_1101-2020_12_31_424971	168	48	between	between	IN
10_1101-2020_12_31_424971	168	49	3	3	CD
10_1101-2020_12_31_424971	168	50	and	and	CC
10_1101-2020_12_31_424971	168	51	10	10	CD
10_1101-2020_12_31_424971	168	52	min	min	NN
10_1101-2020_12_31_424971	168	53	post-423	post-423	NNP
10_1101-2020_12_31_424971	168	54	delivery	delivery	NN
10_1101-2020_12_31_424971	168	55	(	(	-LRB-
10_1101-2020_12_31_424971	168	56	i.e.	i.e.	FW
10_1101-2020_12_31_424971	168	57	,	,	,
10_1101-2020_12_31_424971	168	58	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	168	59	=	=	SYM
10_1101-2020_12_31_424971	168	60	~0.0017–0.0060	~0.0017–0.0060	NFP
10_1101-2020_12_31_424971	168	61	s–1	s–1	NNP
10_1101-2020_12_31_424971	168	62	)	)	-RRB-
10_1101-2020_12_31_424971	168	63	.	.	.
10_1101-2020_12_31_424971	169	1	Remarkably	remarkably	RB
10_1101-2020_12_31_424971	169	2	,	,	,
10_1101-2020_12_31_424971	169	3	this	this	DT
10_1101-2020_12_31_424971	169	4	range	range	NN
10_1101-2020_12_31_424971	169	5	of	of	IN
10_1101-2020_12_31_424971	169	6	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	169	7	is	be	VBZ
10_1101-2020_12_31_424971	169	8	up	up	IN
10_1101-2020_12_31_424971	169	9	to	to	TO
10_1101-2020_12_31_424971	169	10	2	2	CD
10_1101-2020_12_31_424971	169	11	-	-	SYM
10_1101-2020_12_31_424971	169	12	3	3	CD
10_1101-2020_12_31_424971	169	13	424	424	CD
10_1101-2020_12_31_424971	169	14	orders	order	NNS
10_1101-2020_12_31_424971	169	15	of	of	IN
10_1101-2020_12_31_424971	169	16	magnitude	magnitude	NN
10_1101-2020_12_31_424971	169	17	lower	low	JJR
10_1101-2020_12_31_424971	169	18	than	than	IN
10_1101-2020_12_31_424971	169	19	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	169	20	measured	measure	VBN
10_1101-2020_12_31_424971	169	21	for	for	IN
10_1101-2020_12_31_424971	169	22	the	the	DT
10_1101-2020_12_31_424971	169	23	ProL	ProL	NNP
10_1101-2020_12_31_424971	169	24	PRE	PRE	NNP
10_1101-2020_12_31_424971	169	25	complex	complex	NN
10_1101-2020_12_31_424971	169	26	(	(	-LRB-
10_1101-2020_12_31_424971	169	27	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	169	28	425	425	CD
10_1101-2020_12_31_424971	169	29	Table	table	NN
10_1101-2020_12_31_424971	169	30	5	5	CD
10_1101-2020_12_31_424971	169	31	)	)	-RRB-
10_1101-2020_12_31_424971	169	32	.	.	.
10_1101-2020_12_31_424971	170	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	170	2	is	be	VBZ
10_1101-2020_12_31_424971	170	3	also	also	RB
10_1101-2020_12_31_424971	170	4	up	up	IN
10_1101-2020_12_31_424971	170	5	to	to	TO
10_1101-2020_12_31_424971	170	6	2	2	CD
10_1101-2020_12_31_424971	170	7	-	-	SYM
10_1101-2020_12_31_424971	170	8	3	3	CD
10_1101-2020_12_31_424971	170	9	orders	order	NNS
10_1101-2020_12_31_424971	170	10	of	of	IN
10_1101-2020_12_31_424971	170	11	magnitude	magnitude	NN
10_1101-2020_12_31_424971	170	12	lower	low	JJR
10_1101-2020_12_31_424971	170	13	than	than	IN
10_1101-2020_12_31_424971	170	14	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	170	15	for	for	IN
10_1101-2020_12_31_424971	170	16	a	a	DT
10_1101-2020_12_31_424971	170	17	different	different	JJ
10_1101-2020_12_31_424971	170	18	PRE	PRE	NNP
10_1101-2020_12_31_424971	170	19	complex	complex	JJ
10_1101-2020_12_31_424971	170	20	426	426	CD
10_1101-2020_12_31_424971	170	21	measured	measure	VBN
10_1101-2020_12_31_424971	170	22	using	use	VBG
10_1101-2020_12_31_424971	170	23	a	a	DT
10_1101-2020_12_31_424971	170	24	different	different	JJ
10_1101-2020_12_31_424971	170	25	smFRET	smfret	NN
10_1101-2020_12_31_424971	170	26	signal	signal	NN
10_1101-2020_12_31_424971	170	27	under	under	IN
10_1101-2020_12_31_424971	170	28	the	the	DT
10_1101-2020_12_31_424971	170	29	same	same	JJ
10_1101-2020_12_31_424971	170	30	conditions43	conditions43	NN
10_1101-2020_12_31_424971	170	31	and	and	CC
10_1101-2020_12_31_424971	170	32	the	the	DT
10_1101-2020_12_31_424971	170	33	rate	rate	NN
10_1101-2020_12_31_424971	170	34	of	of	IN
10_1101-2020_12_31_424971	170	35	427	427	CD
10_1101-2020_12_31_424971	170	36	translocation	translocation	NN
10_1101-2020_12_31_424971	170	37	measured	measure	VBN
10_1101-2020_12_31_424971	170	38	using	use	VBG
10_1101-2020_12_31_424971	170	39	ensemble	ensemble	JJ
10_1101-2020_12_31_424971	170	40	rapid	rapid	JJ
10_1101-2020_12_31_424971	170	41	kinetic	kinetic	JJ
10_1101-2020_12_31_424971	170	42	approaches	approach	NNS
10_1101-2020_12_31_424971	170	43	under	under	IN
10_1101-2020_12_31_424971	170	44	similar	similar	JJ
10_1101-2020_12_31_424971	170	45	conditions44,45	conditions44,45	NNP
10_1101-2020_12_31_424971	170	46	.	.	.
10_1101-2020_12_31_424971	171	1	428	428	CD
10_1101-2020_12_31_424971	171	2	This	this	DT
10_1101-2020_12_31_424971	171	3	observation	observation	NN
10_1101-2020_12_31_424971	171	4	suggests	suggest	VBZ
10_1101-2020_12_31_424971	171	5	that	that	IN
10_1101-2020_12_31_424971	171	6	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	171	7	adopts	adopt	VBZ
10_1101-2020_12_31_424971	171	8	a	a	DT
10_1101-2020_12_31_424971	171	9	conformation	conformation	NN
10_1101-2020_12_31_424971	171	10	within	within	IN
10_1101-2020_12_31_424971	171	11	the	the	DT
10_1101-2020_12_31_424971	171	12	EF	EF	NNP
10_1101-2020_12_31_424971	171	13	-	-	HYPH
10_1101-2020_12_31_424971	171	14	G	G	NNP
10_1101-2020_12_31_424971	171	15	-	-	HYPH
10_1101-2020_12_31_424971	171	16	bound	bind	VBN
10_1101-2020_12_31_424971	171	17	PRE	PRE	NNP
10_1101-2020_12_31_424971	171	18	complex	complex	NN
10_1101-2020_12_31_424971	171	19	429	429	CD
10_1101-2020_12_31_424971	171	20	that	that	WDT
10_1101-2020_12_31_424971	171	21	significantly	significantly	RB
10_1101-2020_12_31_424971	171	22	impedes	impede	VBZ
10_1101-2020_12_31_424971	171	23	conformational	conformational	JJ
10_1101-2020_12_31_424971	171	24	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	171	25	of	of	IN
10_1101-2020_12_31_424971	171	26	the	the	DT
10_1101-2020_12_31_424971	171	27	complex	complex	NN
10_1101-2020_12_31_424971	171	28	that	that	WDT
10_1101-2020_12_31_424971	171	29	are	be	VBP
10_1101-2020_12_31_424971	171	30	known	know	VBN
10_1101-2020_12_31_424971	171	31	to	to	TO
10_1101-2020_12_31_424971	171	32	take	take	VB
10_1101-2020_12_31_424971	171	33	430	430	CD
10_1101-2020_12_31_424971	171	34	place	place	NN
10_1101-2020_12_31_424971	171	35	during	during	IN
10_1101-2020_12_31_424971	171	36	late	late	JJ
10_1101-2020_12_31_424971	171	37	steps	step	NNS
10_1101-2020_12_31_424971	171	38	in	in	IN
10_1101-2020_12_31_424971	171	39	translocation	translocation	NN
10_1101-2020_12_31_424971	171	40	.	.	.
10_1101-2020_12_31_424971	172	1	These	these	DT
10_1101-2020_12_31_424971	172	2	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	172	3	include	include	VBP
10_1101-2020_12_31_424971	172	4	the	the	DT
10_1101-2020_12_31_424971	172	5	severing	severing	NN
10_1101-2020_12_31_424971	172	6	of	of	IN
10_1101-2020_12_31_424971	172	7	interactions	interaction	NNS
10_1101-2020_12_31_424971	172	8	431	431	CD
10_1101-2020_12_31_424971	172	9	.CC	.CC	:
10_1101-2020_12_31_424971	172	10	-	-	:
10_1101-2020_12_31_424971	172	11	BY	by	IN
10_1101-2020_12_31_424971	172	12	-	-	HYPH
10_1101-2020_12_31_424971	172	13	NC	NC	NNP
10_1101-2020_12_31_424971	172	14	-	-	HYPH
10_1101-2020_12_31_424971	172	15	ND	ND	NNP
10_1101-2020_12_31_424971	172	16	4.0	4.0	CD
10_1101-2020_12_31_424971	172	17	International	International	NNP
10_1101-2020_12_31_424971	172	18	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	172	19	under	under	IN
10_1101-2020_12_31_424971	172	20	a	a	DT
10_1101-2020_12_31_424971	172	21	(	(	-LRB-
10_1101-2020_12_31_424971	172	22	which	which	WDT
10_1101-2020_12_31_424971	172	23	was	be	VBD
10_1101-2020_12_31_424971	172	24	not	not	RB
10_1101-2020_12_31_424971	172	25	certified	certify	VBN
10_1101-2020_12_31_424971	172	26	by	by	IN
10_1101-2020_12_31_424971	172	27	peer	peer	NN
10_1101-2020_12_31_424971	172	28	review	review	NN
10_1101-2020_12_31_424971	172	29	)	)	-RRB-
10_1101-2020_12_31_424971	172	30	is	be	VBZ
10_1101-2020_12_31_424971	172	31	the	the	DT
10_1101-2020_12_31_424971	172	32	author	author	NN
10_1101-2020_12_31_424971	172	33	/	/	SYM
10_1101-2020_12_31_424971	172	34	funder	funder	NN
10_1101-2020_12_31_424971	172	35	,	,	,
10_1101-2020_12_31_424971	172	36	who	who	WP
10_1101-2020_12_31_424971	172	37	has	have	VBZ
10_1101-2020_12_31_424971	172	38	granted	grant	VBN
10_1101-2020_12_31_424971	172	39	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	172	40	a	a	DT
10_1101-2020_12_31_424971	172	41	license	license	NN
10_1101-2020_12_31_424971	172	42	to	to	TO
10_1101-2020_12_31_424971	172	43	display	display	VB
10_1101-2020_12_31_424971	172	44	the	the	DT
10_1101-2020_12_31_424971	172	45	preprint	preprint	NN
10_1101-2020_12_31_424971	172	46	in	in	IN
10_1101-2020_12_31_424971	172	47	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	172	48	.	.	.
10_1101-2020_12_31_424971	173	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	173	2	is	be	VBZ
10_1101-2020_12_31_424971	173	3	made	make	VBN
10_1101-2020_12_31_424971	173	4	The	the	DT
10_1101-2020_12_31_424971	173	5	copyright	copyright	NN
10_1101-2020_12_31_424971	173	6	holder	holder	NN
10_1101-2020_12_31_424971	173	7	for	for	IN
10_1101-2020_12_31_424971	173	8	this	this	DT
10_1101-2020_12_31_424971	173	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	173	10	version	version	NN
10_1101-2020_12_31_424971	173	11	posted	post	VBD
10_1101-2020_12_31_424971	173	12	January	January	NNP
10_1101-2020_12_31_424971	173	13	2	2	CD
10_1101-2020_12_31_424971	173	14	,	,	,
10_1101-2020_12_31_424971	173	15	2021	2021	CD
10_1101-2020_12_31_424971	173	16	.	.	.
10_1101-2020_12_31_424971	173	17	;	;	:
10_1101-2020_12_31_424971	173	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	173	19	:	:	:
10_1101-2020_12_31_424971	173	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	173	21	preprint	preprint	NN
10_1101-2020_12_31_424971	173	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	173	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	173	24	18	18	CD
10_1101-2020_12_31_424971	173	25	between	between	IN
10_1101-2020_12_31_424971	173	26	the	the	DT
10_1101-2020_12_31_424971	173	27	decoding	decode	VBG
10_1101-2020_12_31_424971	173	28	center	center	NN
10_1101-2020_12_31_424971	173	29	of	of	IN
10_1101-2020_12_31_424971	173	30	the	the	DT
10_1101-2020_12_31_424971	173	31	30S	30s	CD
10_1101-2020_12_31_424971	173	32	subunit	subunit	NN
10_1101-2020_12_31_424971	173	33	and	and	CC
10_1101-2020_12_31_424971	173	34	the	the	DT
10_1101-2020_12_31_424971	173	35	anticodon	anticodon	NN
10_1101-2020_12_31_424971	173	36	-	-	HYPH
10_1101-2020_12_31_424971	173	37	codon	codon	NNP
10_1101-2020_12_31_424971	173	38	duplex	duplex	NN
10_1101-2020_12_31_424971	173	39	in	in	IN
10_1101-2020_12_31_424971	173	40	the	the	DT
10_1101-2020_12_31_424971	173	41	A	A	NNP
10_1101-2020_12_31_424971	173	42	site22	site22	NNP
10_1101-2020_12_31_424971	173	43	-	-	SYM
10_1101-2020_12_31_424971	173	44	432	432	CD
10_1101-2020_12_31_424971	173	45	25	25	CD
10_1101-2020_12_31_424971	173	46	;	;	:
10_1101-2020_12_31_424971	173	47	forward	forward	RB
10_1101-2020_12_31_424971	173	48	and	and	CC
10_1101-2020_12_31_424971	173	49	reverse	reverse	VB
10_1101-2020_12_31_424971	173	50	swiveling	swiveling	NN
10_1101-2020_12_31_424971	173	51	of	of	IN
10_1101-2020_12_31_424971	173	52	the	the	DT
10_1101-2020_12_31_424971	173	53	‘	'	``
10_1101-2020_12_31_424971	173	54	head	head	NN
10_1101-2020_12_31_424971	173	55	’	'	''
10_1101-2020_12_31_424971	173	56	domain	domain	NN
10_1101-2020_12_31_424971	173	57	of	of	IN
10_1101-2020_12_31_424971	173	58	the	the	DT
10_1101-2020_12_31_424971	173	59	30S	30S	NNP
10_1101-2020_12_31_424971	173	60	subunit27,28	subunit27,28	NNP
10_1101-2020_12_31_424971	173	61	associated	associate	VBD
10_1101-2020_12_31_424971	173	62	with	with	IN
10_1101-2020_12_31_424971	173	63	433	433	CD
10_1101-2020_12_31_424971	173	64	opening	opening	NN
10_1101-2020_12_31_424971	173	65	and	and	CC
10_1101-2020_12_31_424971	173	66	closing	closing	NN
10_1101-2020_12_31_424971	173	67	,	,	,
10_1101-2020_12_31_424971	173	68	respectively	respectively	RB
10_1101-2020_12_31_424971	173	69	,	,	,
10_1101-2020_12_31_424971	173	70	of	of	IN
10_1101-2020_12_31_424971	173	71	the	the	DT
10_1101-2020_12_31_424971	173	72	‘	'	``
10_1101-2020_12_31_424971	173	73	E	e	NN
10_1101-2020_12_31_424971	173	74	-	-	NN
10_1101-2020_12_31_424971	173	75	site	site	NN
10_1101-2020_12_31_424971	173	76	gate	gate	NN
10_1101-2020_12_31_424971	173	77	’	'	''
10_1101-2020_12_31_424971	173	78	of	of	IN
10_1101-2020_12_31_424971	173	79	the	the	DT
10_1101-2020_12_31_424971	173	80	30S	30s	CD
10_1101-2020_12_31_424971	173	81	subunit26	subunit26	VBZ
10_1101-2020_12_31_424971	173	82	;	;	:
10_1101-2020_12_31_424971	173	83	reverse	reverse	JJ
10_1101-2020_12_31_424971	173	84	relative	relative	JJ
10_1101-2020_12_31_424971	173	85	rotation	rotation	NN
10_1101-2020_12_31_424971	173	86	434	434	CD
10_1101-2020_12_31_424971	173	87	of	of	IN
10_1101-2020_12_31_424971	173	88	the	the	DT
10_1101-2020_12_31_424971	173	89	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	173	90	subunits46,47	subunits46,47	NNP
10_1101-2020_12_31_424971	173	91	;	;	:
10_1101-2020_12_31_424971	173	92	and	and	CC
10_1101-2020_12_31_424971	173	93	opening	opening	NN
10_1101-2020_12_31_424971	173	94	of	of	IN
10_1101-2020_12_31_424971	173	95	the	the	DT
10_1101-2020_12_31_424971	173	96	L1	L1	NNP
10_1101-2020_12_31_424971	173	97	stalk35,37,48	stalk35,37,48	NNP
10_1101-2020_12_31_424971	173	98	.	.	.
10_1101-2020_12_31_424971	174	1	Collectively	collectively	RB
10_1101-2020_12_31_424971	174	2	,	,	,
10_1101-2020_12_31_424971	174	3	these	these	DT
10_1101-2020_12_31_424971	174	4	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	174	5	435	435	CD
10_1101-2020_12_31_424971	174	6	facilitate	facilitate	JJ
10_1101-2020_12_31_424971	174	7	movement	movement	NN
10_1101-2020_12_31_424971	174	8	of	of	IN
10_1101-2020_12_31_424971	174	9	the	the	DT
10_1101-2020_12_31_424971	174	10	tRNA	trna	NN
10_1101-2020_12_31_424971	174	11	ASLs	asl	NNS
10_1101-2020_12_31_424971	174	12	and	and	CC
10_1101-2020_12_31_424971	174	13	their	-PRON-	PRP$
10_1101-2020_12_31_424971	174	14	associated	associated	JJ
10_1101-2020_12_31_424971	174	15	codons	codon	NNS
10_1101-2020_12_31_424971	174	16	from	from	IN
10_1101-2020_12_31_424971	174	17	the	the	DT
10_1101-2020_12_31_424971	174	18	P	p	NN
10_1101-2020_12_31_424971	174	19	and	and	CC
10_1101-2020_12_31_424971	174	20	A	a	DT
10_1101-2020_12_31_424971	174	21	sites	site	NNS
10_1101-2020_12_31_424971	174	22	to	to	IN
10_1101-2020_12_31_424971	174	23	the	the	DT
10_1101-2020_12_31_424971	174	24	436	436	CD
10_1101-2020_12_31_424971	174	25	E	E	NNS
10_1101-2020_12_31_424971	174	26	and	and	CC
10_1101-2020_12_31_424971	174	27	P	p	NN
10_1101-2020_12_31_424971	174	28	sites	site	NNS
10_1101-2020_12_31_424971	174	29	of	of	IN
10_1101-2020_12_31_424971	174	30	the	the	DT
10_1101-2020_12_31_424971	174	31	30S	30s	CD
10_1101-2020_12_31_424971	174	32	subunit	subunit	NN
10_1101-2020_12_31_424971	174	33	.	.	.
10_1101-2020_12_31_424971	175	1	437	437	CD
10_1101-2020_12_31_424971	175	2	We	-PRON-	PRP
10_1101-2020_12_31_424971	175	3	next	next	RB
10_1101-2020_12_31_424971	175	4	explored	explore	VBD
10_1101-2020_12_31_424971	175	5	whether	whether	IN
10_1101-2020_12_31_424971	175	6	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	175	7	alters	alter	VBZ
10_1101-2020_12_31_424971	175	8	the	the	DT
10_1101-2020_12_31_424971	175	9	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	175	10	of	of	IN
10_1101-2020_12_31_424971	175	11	elongation	elongation	NN
10_1101-2020_12_31_424971	175	12	complexes	complex	NNS
10_1101-2020_12_31_424971	175	13	after	after	IN
10_1101-2020_12_31_424971	175	14	it	-PRON-	PRP
10_1101-2020_12_31_424971	175	15	is	be	VBZ
10_1101-2020_12_31_424971	175	16	438	438	CD
10_1101-2020_12_31_424971	175	17	translocated	translocate	VBN
10_1101-2020_12_31_424971	175	18	into	into	IN
10_1101-2020_12_31_424971	175	19	the	the	DT
10_1101-2020_12_31_424971	175	20	P	p	NN
10_1101-2020_12_31_424971	175	21	site	site	NN
10_1101-2020_12_31_424971	175	22	.	.	.
10_1101-2020_12_31_424971	176	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	176	2	prepared	prepare	VBD
10_1101-2020_12_31_424971	176	3	PRE	PRE	NNP
10_1101-2020_12_31_424971	176	4	-	-	HYPH
10_1101-2020_12_31_424971	176	5	like	like	JJ
10_1101-2020_12_31_424971	176	6	complexes	complex	NNS
10_1101-2020_12_31_424971	176	7	carrying	carry	VBG
10_1101-2020_12_31_424971	176	8	deacylated	deacylate	VBN
10_1101-2020_12_31_424971	176	9	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	176	10	or	or	CC
10_1101-2020_12_31_424971	176	11	ProL	ProL	NNP
10_1101-2020_12_31_424971	176	12	439	439	CD
10_1101-2020_12_31_424971	176	13	in	in	IN
10_1101-2020_12_31_424971	176	14	the	the	DT
10_1101-2020_12_31_424971	176	15	P	p	NN
10_1101-2020_12_31_424971	176	16	site	site	NN
10_1101-2020_12_31_424971	176	17	and	and	CC
10_1101-2020_12_31_424971	176	18	a	a	DT
10_1101-2020_12_31_424971	176	19	vacant	vacant	JJ
10_1101-2020_12_31_424971	176	20	A	a	NN
10_1101-2020_12_31_424971	176	21	site	site	NN
10_1101-2020_12_31_424971	176	22	(	(	-LRB-
10_1101-2020_12_31_424971	176	23	denoted	denote	VBN
10_1101-2020_12_31_424971	176	24	PRE	PRE	NNP
10_1101-2020_12_31_424971	176	25	–	–	:
10_1101-2020_12_31_424971	176	26	A	a	DT
10_1101-2020_12_31_424971	176	27	complexes	complex	NNS
10_1101-2020_12_31_424971	176	28	)	)	-RRB-
10_1101-2020_12_31_424971	176	29	and	and	CC
10_1101-2020_12_31_424971	176	30	recorded	record	VBD
10_1101-2020_12_31_424971	176	31	steady	steady	JJ
10_1101-2020_12_31_424971	176	32	-	-	HYPH
10_1101-2020_12_31_424971	176	33	state	state	NN
10_1101-2020_12_31_424971	176	34	movies	movie	NNS
10_1101-2020_12_31_424971	176	35	440	440	CD
10_1101-2020_12_31_424971	176	36	for	for	IN
10_1101-2020_12_31_424971	176	37	the	the	DT
10_1101-2020_12_31_424971	176	38	resulting	result	VBG
10_1101-2020_12_31_424971	176	39	GS1	GS1	NNP
10_1101-2020_12_31_424971	176	40	⇄	⇄	NNP
10_1101-2020_12_31_424971	176	41	GS2	GS2	NNP
10_1101-2020_12_31_424971	176	42	equilibria	equilibrium	NNS
10_1101-2020_12_31_424971	176	43	(	(	-LRB-
10_1101-2020_12_31_424971	176	44	Figures	figure	NNS
10_1101-2020_12_31_424971	176	45	6c	6c	NNPS
10_1101-2020_12_31_424971	176	46	and	and	CC
10_1101-2020_12_31_424971	176	47	h	h	NN
10_1101-2020_12_31_424971	176	48	,	,	,
10_1101-2020_12_31_424971	176	49	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	176	50	Figure	Figure	NNP
10_1101-2020_12_31_424971	176	51	6	6	CD
10_1101-2020_12_31_424971	176	52	)	)	-RRB-
10_1101-2020_12_31_424971	176	53	.	.	.
10_1101-2020_12_31_424971	177	1	The	the	DT
10_1101-2020_12_31_424971	177	2	results	result	NNS
10_1101-2020_12_31_424971	177	3	441	441	CD
10_1101-2020_12_31_424971	177	4	showed	show	VBD
10_1101-2020_12_31_424971	177	5	that	that	IN
10_1101-2020_12_31_424971	177	6	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	177	7	and	and	CC
10_1101-2020_12_31_424971	177	8	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	177	9	for	for	IN
10_1101-2020_12_31_424971	177	10	the	the	DT
10_1101-2020_12_31_424971	177	11	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	177	12	PRE	PRE	NNP
10_1101-2020_12_31_424971	177	13	–	–	:
10_1101-2020_12_31_424971	177	14	A	a	DT
10_1101-2020_12_31_424971	177	15	complex	complex	NN
10_1101-2020_12_31_424971	177	16	were	be	VBD
10_1101-2020_12_31_424971	177	17	45	45	CD
10_1101-2020_12_31_424971	177	18	%	%	NN
10_1101-2020_12_31_424971	177	19	lower	low	JJR
10_1101-2020_12_31_424971	177	20	and	and	CC
10_1101-2020_12_31_424971	177	21	36	36	CD
10_1101-2020_12_31_424971	177	22	%	%	NN
10_1101-2020_12_31_424971	177	23	higher	high	JJR
10_1101-2020_12_31_424971	177	24	,	,	,
10_1101-2020_12_31_424971	177	25	442	442	CD
10_1101-2020_12_31_424971	177	26	respectively	respectively	RB
10_1101-2020_12_31_424971	177	27	,	,	,
10_1101-2020_12_31_424971	177	28	than	than	IN
10_1101-2020_12_31_424971	177	29	for	for	IN
10_1101-2020_12_31_424971	177	30	the	the	DT
10_1101-2020_12_31_424971	177	31	ProL	ProL	NNP
10_1101-2020_12_31_424971	177	32	PRE	PRE	NNP
10_1101-2020_12_31_424971	177	33	–	–	:
10_1101-2020_12_31_424971	177	34	A	a	DT
10_1101-2020_12_31_424971	177	35	complex	complex	NN
10_1101-2020_12_31_424971	177	36	,	,	,
10_1101-2020_12_31_424971	177	37	driving	drive	VBG
10_1101-2020_12_31_424971	177	38	a	a	DT
10_1101-2020_12_31_424971	177	39	2.5-fold	2.5-fold	CD
10_1101-2020_12_31_424971	177	40	shift	shift	NN
10_1101-2020_12_31_424971	177	41	towards	towards	IN
10_1101-2020_12_31_424971	177	42	GS1	GS1	NNP
10_1101-2020_12_31_424971	177	43	in	in	IN
10_1101-2020_12_31_424971	177	44	the	the	DT
10_1101-2020_12_31_424971	177	45	443	443	CD
10_1101-2020_12_31_424971	177	46	GS1	GS1	NNP
10_1101-2020_12_31_424971	177	47	⇄	⇄	NNP
10_1101-2020_12_31_424971	177	48	GS2	GS2	NNP
10_1101-2020_12_31_424971	177	49	equilibrium	equilibrium	NN
10_1101-2020_12_31_424971	177	50	(	(	-LRB-
10_1101-2020_12_31_424971	177	51	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	177	52	Table	Table	NNP
10_1101-2020_12_31_424971	177	53	7	7	CD
10_1101-2020_12_31_424971	177	54	)	)	-RRB-
10_1101-2020_12_31_424971	177	55	,	,	,
10_1101-2020_12_31_424971	177	56	suggesting	suggest	VBG
10_1101-2020_12_31_424971	177	57	that	that	IN
10_1101-2020_12_31_424971	177	58	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	177	59	adopts	adopt	VBZ
10_1101-2020_12_31_424971	177	60	a	a	DT
10_1101-2020_12_31_424971	177	61	conformation	conformation	NN
10_1101-2020_12_31_424971	177	62	at	at	IN
10_1101-2020_12_31_424971	177	63	444	444	CD
10_1101-2020_12_31_424971	177	64	the	the	DT
10_1101-2020_12_31_424971	177	65	P	p	NN
10_1101-2020_12_31_424971	177	66	site	site	NN
10_1101-2020_12_31_424971	177	67	that	that	WDT
10_1101-2020_12_31_424971	177	68	is	be	VBZ
10_1101-2020_12_31_424971	177	69	different	different	JJ
10_1101-2020_12_31_424971	177	70	from	from	IN
10_1101-2020_12_31_424971	177	71	that	that	DT
10_1101-2020_12_31_424971	177	72	of	of	IN
10_1101-2020_12_31_424971	177	73	ProL.	prol.	NN
10_1101-2020_12_31_424971	178	1	Consistent	consistent	JJ
10_1101-2020_12_31_424971	178	2	with	with	IN
10_1101-2020_12_31_424971	178	3	this	this	DT
10_1101-2020_12_31_424971	178	4	interpretation	interpretation	NN
10_1101-2020_12_31_424971	178	5	,	,	,
10_1101-2020_12_31_424971	178	6	a	a	DT
10_1101-2020_12_31_424971	178	7	recent	recent	JJ
10_1101-2020_12_31_424971	178	8	structural	structural	JJ
10_1101-2020_12_31_424971	178	9	445	445	CD
10_1101-2020_12_31_424971	178	10	study	study	NN
10_1101-2020_12_31_424971	178	11	has	have	VBZ
10_1101-2020_12_31_424971	178	12	shown	show	VBN
10_1101-2020_12_31_424971	178	13	that	that	IN
10_1101-2020_12_31_424971	178	14	the	the	DT
10_1101-2020_12_31_424971	178	15	conformation	conformation	NN
10_1101-2020_12_31_424971	178	16	of	of	IN
10_1101-2020_12_31_424971	178	17	P	p	NN
10_1101-2020_12_31_424971	178	18	site	site	NN
10_1101-2020_12_31_424971	178	19	-	-	HYPH
10_1101-2020_12_31_424971	178	20	bound	bind	VBN
10_1101-2020_12_31_424971	178	21	SufA6	SufA6	NNP
10_1101-2020_12_31_424971	178	22	,	,	,
10_1101-2020_12_31_424971	178	23	a	a	DT
10_1101-2020_12_31_424971	178	24	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	178	25	tRNA	trna	NN
10_1101-2020_12_31_424971	178	26	with	with	IN
10_1101-2020_12_31_424971	178	27	an	an	DT
10_1101-2020_12_31_424971	178	28	446	446	CD
10_1101-2020_12_31_424971	178	29	extra	extra	JJ
10_1101-2020_12_31_424971	178	30	nucleotide	nucleotide	RB
10_1101-2020_12_31_424971	178	31	in	in	IN
10_1101-2020_12_31_424971	178	32	the	the	DT
10_1101-2020_12_31_424971	178	33	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	178	34	loop	loop	NN
10_1101-2020_12_31_424971	178	35	,	,	,
10_1101-2020_12_31_424971	178	36	is	be	VBZ
10_1101-2020_12_31_424971	178	37	significantly	significantly	RB
10_1101-2020_12_31_424971	178	38	distorted	distort	VBN
10_1101-2020_12_31_424971	178	39	relative	relative	JJ
10_1101-2020_12_31_424971	178	40	to	to	IN
10_1101-2020_12_31_424971	178	41	a	a	DT
10_1101-2020_12_31_424971	178	42	canonical	canonical	JJ
10_1101-2020_12_31_424971	178	43	tRNA49	trna49	NN
10_1101-2020_12_31_424971	178	44	.	.	.
10_1101-2020_12_31_424971	179	1	447	447	CD
10_1101-2020_12_31_424971	179	2	448	448	CD
10_1101-2020_12_31_424971	179	3	DISCUSSION	discussion	NN
10_1101-2020_12_31_424971	179	4	449	449	CD
10_1101-2020_12_31_424971	179	5	Here	here	RB
10_1101-2020_12_31_424971	179	6	we	-PRON-	PRP
10_1101-2020_12_31_424971	179	7	leverage	leverage	VBP
10_1101-2020_12_31_424971	179	8	the	the	DT
10_1101-2020_12_31_424971	179	9	high	high	JJ
10_1101-2020_12_31_424971	179	10	efficiency	efficiency	NN
10_1101-2020_12_31_424971	179	11	of	of	IN
10_1101-2020_12_31_424971	179	12	recoding	recode	VBG
10_1101-2020_12_31_424971	179	13	by	by	IN
10_1101-2020_12_31_424971	179	14	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	179	15	to	to	TO
10_1101-2020_12_31_424971	179	16	identify	identify	VB
10_1101-2020_12_31_424971	179	17	the	the	DT
10_1101-2020_12_31_424971	179	18	steps	step	NNS
10_1101-2020_12_31_424971	179	19	of	of	IN
10_1101-2020_12_31_424971	179	20	the	the	DT
10_1101-2020_12_31_424971	179	21	450	450	CD
10_1101-2020_12_31_424971	179	22	elongation	elongation	NN
10_1101-2020_12_31_424971	179	23	cycle	cycle	NN
10_1101-2020_12_31_424971	179	24	during	during	IN
10_1101-2020_12_31_424971	179	25	which	which	WDT
10_1101-2020_12_31_424971	179	26	it	-PRON-	PRP
10_1101-2020_12_31_424971	179	27	induces	induce	VBZ
10_1101-2020_12_31_424971	179	28	+1	+1	:
10_1101-2020_12_31_424971	179	29	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	179	30	at	at	IN
10_1101-2020_12_31_424971	179	31	a	a	DT
10_1101-2020_12_31_424971	179	32	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	179	33	codon	codon	NN
10_1101-2020_12_31_424971	179	34	,	,	,
10_1101-2020_12_31_424971	179	35	thus	thus	RB
10_1101-2020_12_31_424971	179	36	answering	answer	VBG
10_1101-2020_12_31_424971	179	37	451	451	CD
10_1101-2020_12_31_424971	179	38	the	the	DT
10_1101-2020_12_31_424971	179	39	key	key	JJ
10_1101-2020_12_31_424971	179	40	questions	question	NNS
10_1101-2020_12_31_424971	179	41	of	of	IN
10_1101-2020_12_31_424971	179	42	where	where	WRB
10_1101-2020_12_31_424971	179	43	,	,	,
10_1101-2020_12_31_424971	179	44	when	when	WRB
10_1101-2020_12_31_424971	179	45	,	,	,
10_1101-2020_12_31_424971	179	46	and	and	CC
10_1101-2020_12_31_424971	179	47	how	how	WRB
10_1101-2020_12_31_424971	179	48	+1	+1	NNS
10_1101-2020_12_31_424971	179	49	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	179	50	occurs	occur	NNS
10_1101-2020_12_31_424971	179	51	.	.	.
10_1101-2020_12_31_424971	180	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	180	2	are	be	VBP
10_1101-2020_12_31_424971	180	3	not	not	RB
10_1101-2020_12_31_424971	180	4	aware	aware	JJ
10_1101-2020_12_31_424971	180	5	of	of	IN
10_1101-2020_12_31_424971	180	6	any	any	DT
10_1101-2020_12_31_424971	180	7	452	452	CD
10_1101-2020_12_31_424971	180	8	other	other	JJ
10_1101-2020_12_31_424971	180	9	studies	study	NNS
10_1101-2020_12_31_424971	180	10	of	of	IN
10_1101-2020_12_31_424971	180	11	+1	+1	NNS
10_1101-2020_12_31_424971	180	12	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	180	13	that	that	WDT
10_1101-2020_12_31_424971	180	14	have	have	VBP
10_1101-2020_12_31_424971	180	15	addressed	address	VBN
10_1101-2020_12_31_424971	180	16	these	these	DT
10_1101-2020_12_31_424971	180	17	questions	question	NNS
10_1101-2020_12_31_424971	180	18	as	as	RB
10_1101-2020_12_31_424971	180	19	precisely	precisely	RB
10_1101-2020_12_31_424971	180	20	.	.	.
10_1101-2020_12_31_424971	181	1	In	in	IN
10_1101-2020_12_31_424971	181	2	addition	addition	NN
10_1101-2020_12_31_424971	181	3	to	to	IN
10_1101-2020_12_31_424971	181	4	453	453	CD
10_1101-2020_12_31_424971	181	5	elucidating	elucidate	VBG
10_1101-2020_12_31_424971	181	6	the	the	DT
10_1101-2020_12_31_424971	181	7	determinants	determinant	NNS
10_1101-2020_12_31_424971	181	8	of	of	IN
10_1101-2020_12_31_424971	181	9	reading	reading	NN
10_1101-2020_12_31_424971	181	10	-	-	HYPH
10_1101-2020_12_31_424971	181	11	frame	frame	NN
10_1101-2020_12_31_424971	181	12	maintenance	maintenance	NN
10_1101-2020_12_31_424971	181	13	and	and	CC
10_1101-2020_12_31_424971	181	14	the	the	DT
10_1101-2020_12_31_424971	181	15	mechanisms	mechanism	NNS
10_1101-2020_12_31_424971	181	16	of	of	IN
10_1101-2020_12_31_424971	181	17	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	181	18	-	-	SYM
10_1101-2020_12_31_424971	181	19	454	454	CD
10_1101-2020_12_31_424971	181	20	induced	induced	JJ
10_1101-2020_12_31_424971	181	21	+1	+1	NNS
10_1101-2020_12_31_424971	181	22	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	181	23	,	,	,
10_1101-2020_12_31_424971	181	24	our	-PRON-	PRP$
10_1101-2020_12_31_424971	181	25	findings	finding	NNS
10_1101-2020_12_31_424971	181	26	reveal	reveal	VBP
10_1101-2020_12_31_424971	181	27	new	new	JJ
10_1101-2020_12_31_424971	181	28	principles	principle	NNS
10_1101-2020_12_31_424971	181	29	that	that	WDT
10_1101-2020_12_31_424971	181	30	can	can	MD
10_1101-2020_12_31_424971	181	31	be	be	VB
10_1101-2020_12_31_424971	181	32	used	use	VBN
10_1101-2020_12_31_424971	181	33	to	to	TO
10_1101-2020_12_31_424971	181	34	engineer	engineer	VB
10_1101-2020_12_31_424971	181	35	genome	genome	NNP
10_1101-2020_12_31_424971	181	36	455	455	CD
10_1101-2020_12_31_424971	181	37	recoding	recode	VBG
10_1101-2020_12_31_424971	181	38	with	with	IN
10_1101-2020_12_31_424971	181	39	higher	high	JJR
10_1101-2020_12_31_424971	181	40	efficiencies	efficiency	NNS
10_1101-2020_12_31_424971	181	41	.	.	.
10_1101-2020_12_31_424971	182	1	456	456	CD
10_1101-2020_12_31_424971	182	2	.CC	.CC	NFP
10_1101-2020_12_31_424971	182	3	-	-	HYPH
10_1101-2020_12_31_424971	182	4	BY	by	IN
10_1101-2020_12_31_424971	182	5	-	-	HYPH
10_1101-2020_12_31_424971	182	6	NC	NC	NNP
10_1101-2020_12_31_424971	182	7	-	-	HYPH
10_1101-2020_12_31_424971	182	8	ND	ND	NNP
10_1101-2020_12_31_424971	182	9	4.0	4.0	CD
10_1101-2020_12_31_424971	182	10	International	International	NNP
10_1101-2020_12_31_424971	182	11	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	182	12	under	under	IN
10_1101-2020_12_31_424971	182	13	a	a	DT
10_1101-2020_12_31_424971	182	14	(	(	-LRB-
10_1101-2020_12_31_424971	182	15	which	which	WDT
10_1101-2020_12_31_424971	182	16	was	be	VBD
10_1101-2020_12_31_424971	182	17	not	not	RB
10_1101-2020_12_31_424971	182	18	certified	certify	VBN
10_1101-2020_12_31_424971	182	19	by	by	IN
10_1101-2020_12_31_424971	182	20	peer	peer	NN
10_1101-2020_12_31_424971	182	21	review	review	NN
10_1101-2020_12_31_424971	182	22	)	)	-RRB-
10_1101-2020_12_31_424971	182	23	is	be	VBZ
10_1101-2020_12_31_424971	182	24	the	the	DT
10_1101-2020_12_31_424971	182	25	author	author	NN
10_1101-2020_12_31_424971	182	26	/	/	SYM
10_1101-2020_12_31_424971	182	27	funder	funder	NN
10_1101-2020_12_31_424971	182	28	,	,	,
10_1101-2020_12_31_424971	182	29	who	who	WP
10_1101-2020_12_31_424971	182	30	has	have	VBZ
10_1101-2020_12_31_424971	182	31	granted	grant	VBN
10_1101-2020_12_31_424971	182	32	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	182	33	a	a	DT
10_1101-2020_12_31_424971	182	34	license	license	NN
10_1101-2020_12_31_424971	182	35	to	to	TO
10_1101-2020_12_31_424971	182	36	display	display	VB
10_1101-2020_12_31_424971	182	37	the	the	DT
10_1101-2020_12_31_424971	182	38	preprint	preprint	NN
10_1101-2020_12_31_424971	182	39	in	in	IN
10_1101-2020_12_31_424971	182	40	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	182	41	.	.	.
10_1101-2020_12_31_424971	183	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	183	2	is	be	VBZ
10_1101-2020_12_31_424971	183	3	made	make	VBN
10_1101-2020_12_31_424971	183	4	The	the	DT
10_1101-2020_12_31_424971	183	5	copyright	copyright	NN
10_1101-2020_12_31_424971	183	6	holder	holder	NN
10_1101-2020_12_31_424971	183	7	for	for	IN
10_1101-2020_12_31_424971	183	8	this	this	DT
10_1101-2020_12_31_424971	183	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	183	10	version	version	NN
10_1101-2020_12_31_424971	183	11	posted	post	VBD
10_1101-2020_12_31_424971	183	12	January	January	NNP
10_1101-2020_12_31_424971	183	13	2	2	CD
10_1101-2020_12_31_424971	183	14	,	,	,
10_1101-2020_12_31_424971	183	15	2021	2021	CD
10_1101-2020_12_31_424971	183	16	.	.	.
10_1101-2020_12_31_424971	183	17	;	;	:
10_1101-2020_12_31_424971	183	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	183	19	:	:	:
10_1101-2020_12_31_424971	183	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	183	21	preprint	preprint	NN
10_1101-2020_12_31_424971	183	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NN
10_1101-2020_12_31_424971	183	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	183	24	19	19	CD
10_1101-2020_12_31_424971	183	25	Integrating	integrate	VBG
10_1101-2020_12_31_424971	183	26	our	-PRON-	PRP$
10_1101-2020_12_31_424971	183	27	results	result	NNS
10_1101-2020_12_31_424971	183	28	with	with	IN
10_1101-2020_12_31_424971	183	29	the	the	DT
10_1101-2020_12_31_424971	183	30	available	available	JJ
10_1101-2020_12_31_424971	183	31	structural	structural	JJ
10_1101-2020_12_31_424971	183	32	,	,	,
10_1101-2020_12_31_424971	183	33	biophysical	biophysical	JJ
10_1101-2020_12_31_424971	183	34	,	,	,
10_1101-2020_12_31_424971	183	35	and	and	CC
10_1101-2020_12_31_424971	183	36	biochemical	biochemical	JJ
10_1101-2020_12_31_424971	183	37	data	datum	NNS
10_1101-2020_12_31_424971	183	38	on	on	IN
10_1101-2020_12_31_424971	183	39	the	the	DT
10_1101-2020_12_31_424971	183	40	457	457	CD
10_1101-2020_12_31_424971	183	41	mechanism	mechanism	NN
10_1101-2020_12_31_424971	183	42	of	of	IN
10_1101-2020_12_31_424971	183	43	translation	translation	NN
10_1101-2020_12_31_424971	183	44	elongation	elongation	NN
10_1101-2020_12_31_424971	183	45	results	result	NNS
10_1101-2020_12_31_424971	183	46	in	in	IN
10_1101-2020_12_31_424971	183	47	the	the	DT
10_1101-2020_12_31_424971	183	48	structure	structure	NN
10_1101-2020_12_31_424971	183	49	-	-	HYPH
10_1101-2020_12_31_424971	183	50	based	base	VBN
10_1101-2020_12_31_424971	183	51	model	model	NN
10_1101-2020_12_31_424971	183	52	for	for	IN
10_1101-2020_12_31_424971	183	53	SufB2-induced	SufB2-induced	NNP
10_1101-2020_12_31_424971	183	54	+1	+1	NNP
10_1101-2020_12_31_424971	183	55	458	458	CD
10_1101-2020_12_31_424971	183	56	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	183	57	that	that	WDT
10_1101-2020_12_31_424971	183	58	we	-PRON-	PRP
10_1101-2020_12_31_424971	183	59	present	present	VBP
10_1101-2020_12_31_424971	183	60	in	in	IN
10_1101-2020_12_31_424971	183	61	Figure	Figure	NNP
10_1101-2020_12_31_424971	183	62	7	7	CD
10_1101-2020_12_31_424971	183	63	.	.	.
10_1101-2020_12_31_424971	184	1	In	in	IN
10_1101-2020_12_31_424971	184	2	this	this	DT
10_1101-2020_12_31_424971	184	3	model	model	NN
10_1101-2020_12_31_424971	184	4	,	,	,
10_1101-2020_12_31_424971	184	5	POST	POST	NNP
10_1101-2020_12_31_424971	184	6	complexes	complex	NNS
10_1101-2020_12_31_424971	184	7	to	to	TO
10_1101-2020_12_31_424971	184	8	which	which	WDT
10_1101-2020_12_31_424971	184	9	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	184	10	or	or	CC
10_1101-2020_12_31_424971	184	11	ProL	ProL	NNP
10_1101-2020_12_31_424971	184	12	459	459	CD
10_1101-2020_12_31_424971	184	13	are	be	VBP
10_1101-2020_12_31_424971	184	14	delivered	deliver	VBN
10_1101-2020_12_31_424971	184	15	exhibit	exhibit	NN
10_1101-2020_12_31_424971	184	16	virtually	virtually	RB
10_1101-2020_12_31_424971	184	17	indistinguishable	indistinguishable	JJ
10_1101-2020_12_31_424971	184	18	conformational	conformational	JJ
10_1101-2020_12_31_424971	184	19	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	184	20	in	in	IN
10_1101-2020_12_31_424971	184	21	the	the	DT
10_1101-2020_12_31_424971	184	22	early	early	JJ
10_1101-2020_12_31_424971	184	23	steps	step	NNS
10_1101-2020_12_31_424971	184	24	of	of	IN
10_1101-2020_12_31_424971	184	25	the	the	DT
10_1101-2020_12_31_424971	184	26	460	460	CD
10_1101-2020_12_31_424971	184	27	elongation	elongation	NN
10_1101-2020_12_31_424971	184	28	cycle	cycle	NN
10_1101-2020_12_31_424971	184	29	,	,	,
10_1101-2020_12_31_424971	184	30	up	up	IN
10_1101-2020_12_31_424971	184	31	to	to	IN
10_1101-2020_12_31_424971	184	32	and	and	CC
10_1101-2020_12_31_424971	184	33	including	include	VBG
10_1101-2020_12_31_424971	184	34	the	the	DT
10_1101-2020_12_31_424971	184	35	initial	initial	JJ
10_1101-2020_12_31_424971	184	36	GS1→GS2	GS1→GS2	NNP
10_1101-2020_12_31_424971	184	37	transition	transition	NN
10_1101-2020_12_31_424971	184	38	.	.	.
10_1101-2020_12_31_424971	185	1	However	however	RB
10_1101-2020_12_31_424971	185	2	,	,	,
10_1101-2020_12_31_424971	185	3	POST	POST	NNP
10_1101-2020_12_31_424971	185	4	complexes	complex	NNS
10_1101-2020_12_31_424971	185	5	461	461	CD
10_1101-2020_12_31_424971	185	6	to	to	TO
10_1101-2020_12_31_424971	185	7	which	which	WDT
10_1101-2020_12_31_424971	185	8	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	185	9	is	be	VBZ
10_1101-2020_12_31_424971	185	10	delivered	deliver	VBN
10_1101-2020_12_31_424971	185	11	exhibit	exhibit	NN
10_1101-2020_12_31_424971	185	12	a	a	DT
10_1101-2020_12_31_424971	185	13	kGS2→POST	kgs2→post	NN
10_1101-2020_12_31_424971	185	14	that	that	WDT
10_1101-2020_12_31_424971	185	15	is	be	VBZ
10_1101-2020_12_31_424971	185	16	more	more	JJR
10_1101-2020_12_31_424971	185	17	than	than	IN
10_1101-2020_12_31_424971	185	18	an	an	DT
10_1101-2020_12_31_424971	185	19	order	order	NN
10_1101-2020_12_31_424971	185	20	-	-	HYPH
10_1101-2020_12_31_424971	185	21	of	of	IN
10_1101-2020_12_31_424971	185	22	-	-	HYPH
10_1101-2020_12_31_424971	185	23	magnitude	magnitude	NN
10_1101-2020_12_31_424971	185	24	slower	slow	JJR
10_1101-2020_12_31_424971	185	25	462	462	CD
10_1101-2020_12_31_424971	185	26	than	than	IN
10_1101-2020_12_31_424971	185	27	those	those	DT
10_1101-2020_12_31_424971	185	28	to	to	TO
10_1101-2020_12_31_424971	185	29	which	which	WDT
10_1101-2020_12_31_424971	185	30	ProL	ProL	NNP
10_1101-2020_12_31_424971	185	31	is	be	VBZ
10_1101-2020_12_31_424971	185	32	delivered	deliver	VBN
10_1101-2020_12_31_424971	185	33	.	.	.
10_1101-2020_12_31_424971	186	1	Notably	notably	RB
10_1101-2020_12_31_424971	186	2	,	,	,
10_1101-2020_12_31_424971	186	3	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	186	4	comprises	comprise	VBZ
10_1101-2020_12_31_424971	186	5	a	a	DT
10_1101-2020_12_31_424971	186	6	series	series	NN
10_1101-2020_12_31_424971	186	7	of	of	IN
10_1101-2020_12_31_424971	186	8	conformational	conformational	JJ
10_1101-2020_12_31_424971	186	9	463	463	CD
10_1101-2020_12_31_424971	186	10	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	186	11	of	of	IN
10_1101-2020_12_31_424971	186	12	the	the	DT
10_1101-2020_12_31_424971	186	13	EF	EF	NNP
10_1101-2020_12_31_424971	186	14	-	-	HYPH
10_1101-2020_12_31_424971	186	15	G	G	NNP
10_1101-2020_12_31_424971	186	16	-	-	HYPH
10_1101-2020_12_31_424971	186	17	bound	bind	VBN
10_1101-2020_12_31_424971	186	18	PRE	PRE	NNP
10_1101-2020_12_31_424971	186	19	complex	complex	NN
10_1101-2020_12_31_424971	186	20	that	that	WDT
10_1101-2020_12_31_424971	186	21	facilitate	facilitate	VBP
10_1101-2020_12_31_424971	186	22	translocation	translocation	NN
10_1101-2020_12_31_424971	186	23	of	of	IN
10_1101-2020_12_31_424971	186	24	the	the	DT
10_1101-2020_12_31_424971	186	25	tRNA	trna	NN
10_1101-2020_12_31_424971	186	26	ASLs	ASLs	NNP
10_1101-2020_12_31_424971	186	27	464	464	CD
10_1101-2020_12_31_424971	186	28	and	and	CC
10_1101-2020_12_31_424971	186	29	associated	associated	JJ
10_1101-2020_12_31_424971	186	30	codons	codon	NNS
10_1101-2020_12_31_424971	186	31	within	within	IN
10_1101-2020_12_31_424971	186	32	the	the	DT
10_1101-2020_12_31_424971	186	33	30S	30s	CD
10_1101-2020_12_31_424971	186	34	subunit	subunit	NN
10_1101-2020_12_31_424971	186	35	.	.	.
10_1101-2020_12_31_424971	187	1	These	these	DT
10_1101-2020_12_31_424971	187	2	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	187	3	encompass	encompass	VBP
10_1101-2020_12_31_424971	187	4	the	the	DT
10_1101-2020_12_31_424971	187	5	severing	sever	VBG
10_1101-2020_12_31_424971	187	6	465	465	CD
10_1101-2020_12_31_424971	187	7	of	of	IN
10_1101-2020_12_31_424971	187	8	decoding	decode	VBG
10_1101-2020_12_31_424971	187	9	center	center	NN
10_1101-2020_12_31_424971	187	10	interactions	interaction	NNS
10_1101-2020_12_31_424971	187	11	with	with	IN
10_1101-2020_12_31_424971	187	12	the	the	DT
10_1101-2020_12_31_424971	187	13	anticodon	anticodon	NN
10_1101-2020_12_31_424971	187	14	-	-	HYPH
10_1101-2020_12_31_424971	187	15	codon	codon	NNP
10_1101-2020_12_31_424971	187	16	duplex	duplex	NN
10_1101-2020_12_31_424971	187	17	in	in	IN
10_1101-2020_12_31_424971	187	18	the	the	DT
10_1101-2020_12_31_424971	187	19	A	A	NNP
10_1101-2020_12_31_424971	187	20	site22	site22	NNP
10_1101-2020_12_31_424971	187	21	-	-	SYM
10_1101-2020_12_31_424971	187	22	25	25	CD
10_1101-2020_12_31_424971	187	23	;	;	:
10_1101-2020_12_31_424971	187	24	forward	forward	RB
10_1101-2020_12_31_424971	187	25	and	and	CC
10_1101-2020_12_31_424971	187	26	466	466	CD
10_1101-2020_12_31_424971	187	27	reverse	reverse	JJ
10_1101-2020_12_31_424971	187	28	head	head	NN
10_1101-2020_12_31_424971	187	29	swiveling27,28,50	swiveling27,28,50	RB
10_1101-2020_12_31_424971	187	30	and	and	CC
10_1101-2020_12_31_424971	187	31	associated	associate	VBD
10_1101-2020_12_31_424971	187	32	opening	opening	NN
10_1101-2020_12_31_424971	187	33	and	and	CC
10_1101-2020_12_31_424971	187	34	closing	closing	NN
10_1101-2020_12_31_424971	187	35	,	,	,
10_1101-2020_12_31_424971	187	36	respectively	respectively	RB
10_1101-2020_12_31_424971	187	37	,	,	,
10_1101-2020_12_31_424971	187	38	of	of	IN
10_1101-2020_12_31_424971	187	39	the	the	DT
10_1101-2020_12_31_424971	187	40	E	e	NN
10_1101-2020_12_31_424971	187	41	-	-	NN
10_1101-2020_12_31_424971	187	42	site	site	NN
10_1101-2020_12_31_424971	187	43	467	467	CD
10_1101-2020_12_31_424971	187	44	gate26	gate26	NN
10_1101-2020_12_31_424971	187	45	;	;	:
10_1101-2020_12_31_424971	187	46	reverse	reverse	JJ
10_1101-2020_12_31_424971	187	47	relative	relative	JJ
10_1101-2020_12_31_424971	187	48	rotation	rotation	NN
10_1101-2020_12_31_424971	187	49	of	of	IN
10_1101-2020_12_31_424971	187	50	the	the	DT
10_1101-2020_12_31_424971	187	51	subunits46,47	subunits46,47	NNP
10_1101-2020_12_31_424971	187	52	;	;	:
10_1101-2020_12_31_424971	187	53	and	and	CC
10_1101-2020_12_31_424971	187	54	opening	opening	NN
10_1101-2020_12_31_424971	187	55	of	of	IN
10_1101-2020_12_31_424971	187	56	the	the	DT
10_1101-2020_12_31_424971	187	57	L1	L1	NNP
10_1101-2020_12_31_424971	187	58	stalk35,37,48	stalk35,37,48	NN
10_1101-2020_12_31_424971	187	59	(	(	-LRB-
10_1101-2020_12_31_424971	187	60	steps	step	NNS
10_1101-2020_12_31_424971	187	61	PRE-468	pre-468	UH
10_1101-2020_12_31_424971	187	62	G2	g2	NN
10_1101-2020_12_31_424971	187	63	to	to	IN
10_1101-2020_12_31_424971	187	64	PRE	PRE	NNP
10_1101-2020_12_31_424971	187	65	-	-	HYPH
10_1101-2020_12_31_424971	187	66	G4	G4	NNP
10_1101-2020_12_31_424971	187	67	,	,	,
10_1101-2020_12_31_424971	187	68	denoted	denote	VBN
10_1101-2020_12_31_424971	187	69	with	with	IN
10_1101-2020_12_31_424971	187	70	red	red	JJ
10_1101-2020_12_31_424971	187	71	arrows	arrow	NNS
10_1101-2020_12_31_424971	187	72	,	,	,
10_1101-2020_12_31_424971	187	73	in	in	IN
10_1101-2020_12_31_424971	187	74	Figure	Figure	NNP
10_1101-2020_12_31_424971	187	75	7	7	CD
10_1101-2020_12_31_424971	187	76	)	)	-RRB-
10_1101-2020_12_31_424971	187	77	.	.	.
10_1101-2020_12_31_424971	188	1	Given	give	VBN
10_1101-2020_12_31_424971	188	2	the	the	DT
10_1101-2020_12_31_424971	188	3	importance	importance	NN
10_1101-2020_12_31_424971	188	4	of	of	IN
10_1101-2020_12_31_424971	188	5	these	these	DT
10_1101-2020_12_31_424971	188	6	469	469	CD
10_1101-2020_12_31_424971	188	7	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	188	8	in	in	IN
10_1101-2020_12_31_424971	188	9	translocation	translocation	NN
10_1101-2020_12_31_424971	188	10	of	of	IN
10_1101-2020_12_31_424971	188	11	the	the	DT
10_1101-2020_12_31_424971	188	12	tRNA	trna	NN
10_1101-2020_12_31_424971	188	13	ASLs	asl	NNS
10_1101-2020_12_31_424971	188	14	and	and	CC
10_1101-2020_12_31_424971	188	15	their	-PRON-	PRP$
10_1101-2020_12_31_424971	188	16	associated	associated	JJ
10_1101-2020_12_31_424971	188	17	codons	codon	NNS
10_1101-2020_12_31_424971	188	18	within	within	IN
10_1101-2020_12_31_424971	188	19	the	the	DT
10_1101-2020_12_31_424971	188	20	30S	30S	NNP
10_1101-2020_12_31_424971	188	21	470	470	CD
10_1101-2020_12_31_424971	188	22	subunit	subunit	NN
10_1101-2020_12_31_424971	188	23	,	,	,
10_1101-2020_12_31_424971	188	24	we	-PRON-	PRP
10_1101-2020_12_31_424971	188	25	propose	propose	VBP
10_1101-2020_12_31_424971	188	26	that	that	IN
10_1101-2020_12_31_424971	188	27	SufB2-mediated	sufb2-mediated	JJ
10_1101-2020_12_31_424971	188	28	perturbation	perturbation	NN
10_1101-2020_12_31_424971	188	29	of	of	IN
10_1101-2020_12_31_424971	188	30	these	these	DT
10_1101-2020_12_31_424971	188	31	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	188	32	underlies	underlie	NNS
10_1101-2020_12_31_424971	188	33	+1	+1	:
10_1101-2020_12_31_424971	188	34	471	471	CD
10_1101-2020_12_31_424971	188	35	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	188	36	.	.	.
10_1101-2020_12_31_424971	189	1	More	more	RBR
10_1101-2020_12_31_424971	189	2	specifically	specifically	RB
10_1101-2020_12_31_424971	189	3	,	,	,
10_1101-2020_12_31_424971	189	4	because	because	IN
10_1101-2020_12_31_424971	189	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	189	6	does	do	VBZ
10_1101-2020_12_31_424971	189	7	not	not	RB
10_1101-2020_12_31_424971	189	8	seem	seem	VB
10_1101-2020_12_31_424971	189	9	to	to	TO
10_1101-2020_12_31_424971	189	10	impede	impede	VB
10_1101-2020_12_31_424971	189	11	the	the	DT
10_1101-2020_12_31_424971	189	12	reverse	reverse	JJ
10_1101-2020_12_31_424971	189	13	relative	relative	JJ
10_1101-2020_12_31_424971	189	14	472	472	CD
10_1101-2020_12_31_424971	189	15	rotation	rotation	NN
10_1101-2020_12_31_424971	189	16	of	of	IN
10_1101-2020_12_31_424971	189	17	the	the	DT
10_1101-2020_12_31_424971	189	18	subunits	subunit	NNS
10_1101-2020_12_31_424971	189	19	or	or	CC
10_1101-2020_12_31_424971	189	20	opening	opening	NN
10_1101-2020_12_31_424971	189	21	of	of	IN
10_1101-2020_12_31_424971	189	22	the	the	DT
10_1101-2020_12_31_424971	189	23	L1	L1	NNP
10_1101-2020_12_31_424971	189	24	stalk	stalk	NN
10_1101-2020_12_31_424971	189	25	during	during	IN
10_1101-2020_12_31_424971	189	26	the	the	DT
10_1101-2020_12_31_424971	189	27	GS2→GS1	GS2→GS1	NNP
10_1101-2020_12_31_424971	189	28	transitions	transition	NNS
10_1101-2020_12_31_424971	189	29	within	within	IN
10_1101-2020_12_31_424971	189	30	the	the	DT
10_1101-2020_12_31_424971	189	31	473	473	CD
10_1101-2020_12_31_424971	189	32	GS1	GS1	NNP
10_1101-2020_12_31_424971	189	33	⇄	⇄	NNP
10_1101-2020_12_31_424971	189	34	GS2	GS2	NNP
10_1101-2020_12_31_424971	189	35	equilibrium	equilibrium	NN
10_1101-2020_12_31_424971	189	36	in	in	IN
10_1101-2020_12_31_424971	189	37	the	the	DT
10_1101-2020_12_31_424971	189	38	absence	absence	NN
10_1101-2020_12_31_424971	189	39	of	of	IN
10_1101-2020_12_31_424971	189	40	EF	EF	NNP
10_1101-2020_12_31_424971	189	41	-	-	HYPH
10_1101-2020_12_31_424971	189	42	G	G	NNP
10_1101-2020_12_31_424971	189	43	(	(	-LRB-
10_1101-2020_12_31_424971	189	44	compare	compare	VB
10_1101-2020_12_31_424971	189	45	kGS2→GS1	kGS2→GS1	NNP
10_1101-2020_12_31_424971	189	46	for	for	IN
10_1101-2020_12_31_424971	189	47	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	189	48	vs.	vs.	IN
10_1101-2020_12_31_424971	189	49	ProL	ProL	NNP
10_1101-2020_12_31_424971	189	50	-	-	HYPH
10_1101-2020_12_31_424971	189	51	TC	TC	NNP
10_1101-2020_12_31_424971	189	52	in	in	IN
10_1101-2020_12_31_424971	189	53	474	474	CD
10_1101-2020_12_31_424971	189	54	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	189	55	Table	Table	NNP
10_1101-2020_12_31_424971	189	56	4	4	CD
10_1101-2020_12_31_424971	189	57	)	)	-RRB-
10_1101-2020_12_31_424971	189	58	,	,	,
10_1101-2020_12_31_424971	189	59	it	-PRON-	PRP
10_1101-2020_12_31_424971	189	60	most	most	RBS
10_1101-2020_12_31_424971	189	61	likely	likely	RB
10_1101-2020_12_31_424971	189	62	interferes	interfere	VBZ
10_1101-2020_12_31_424971	189	63	with	with	IN
10_1101-2020_12_31_424971	189	64	the	the	DT
10_1101-2020_12_31_424971	189	65	severing	severing	NN
10_1101-2020_12_31_424971	189	66	of	of	IN
10_1101-2020_12_31_424971	189	67	decoding	decode	VBG
10_1101-2020_12_31_424971	189	68	center	center	NN
10_1101-2020_12_31_424971	189	69	interactions	interaction	NNS
10_1101-2020_12_31_424971	189	70	475	475	CD
10_1101-2020_12_31_424971	189	71	with	with	IN
10_1101-2020_12_31_424971	189	72	the	the	DT
10_1101-2020_12_31_424971	189	73	anticodon	anticodon	NN
10_1101-2020_12_31_424971	189	74	-	-	HYPH
10_1101-2020_12_31_424971	189	75	codon	codon	NNP
10_1101-2020_12_31_424971	189	76	duplex	duplex	NN
10_1101-2020_12_31_424971	189	77	in	in	IN
10_1101-2020_12_31_424971	189	78	the	the	DT
10_1101-2020_12_31_424971	189	79	A	A	NNP
10_1101-2020_12_31_424971	189	80	site	site	NN
10_1101-2020_12_31_424971	189	81	and/or	and/or	CC
10_1101-2020_12_31_424971	189	82	forward	forward	RB
10_1101-2020_12_31_424971	189	83	and/or	and/or	CC
10_1101-2020_12_31_424971	189	84	reverse	reverse	VB
10_1101-2020_12_31_424971	189	85	head	head	NN
10_1101-2020_12_31_424971	189	86	swiveling	swivel	VBG
10_1101-2020_12_31_424971	189	87	and	and	CC
10_1101-2020_12_31_424971	189	88	476	476	CD
10_1101-2020_12_31_424971	189	89	associated	associate	VBN
10_1101-2020_12_31_424971	189	90	opening	open	VBG
10_1101-2020_12_31_424971	189	91	and/or	and/or	CC
10_1101-2020_12_31_424971	189	92	closing	closing	NN
10_1101-2020_12_31_424971	189	93	,	,	,
10_1101-2020_12_31_424971	189	94	respectively	respectively	RB
10_1101-2020_12_31_424971	189	95	,	,	,
10_1101-2020_12_31_424971	189	96	of	of	IN
10_1101-2020_12_31_424971	189	97	the	the	DT
10_1101-2020_12_31_424971	189	98	E	e	NN
10_1101-2020_12_31_424971	189	99	-	-	NN
10_1101-2020_12_31_424971	189	100	site	site	NN
10_1101-2020_12_31_424971	189	101	gate	gate	NN
10_1101-2020_12_31_424971	189	102	.	.	.
10_1101-2020_12_31_424971	190	1	The	the	DT
10_1101-2020_12_31_424971	190	2	latter	latter	JJ
10_1101-2020_12_31_424971	190	3	rearrangement	rearrangement	NN
10_1101-2020_12_31_424971	190	4	is	be	VBZ
10_1101-2020_12_31_424971	190	5	477	477	CD
10_1101-2020_12_31_424971	190	6	particularly	particularly	RB
10_1101-2020_12_31_424971	190	7	important	important	JJ
10_1101-2020_12_31_424971	190	8	for	for	IN
10_1101-2020_12_31_424971	190	9	movement	movement	NN
10_1101-2020_12_31_424971	190	10	of	of	IN
10_1101-2020_12_31_424971	190	11	the	the	DT
10_1101-2020_12_31_424971	190	12	tRNA	trna	NN
10_1101-2020_12_31_424971	190	13	ASLs	asl	NNS
10_1101-2020_12_31_424971	190	14	and	and	CC
10_1101-2020_12_31_424971	190	15	their	-PRON-	PRP$
10_1101-2020_12_31_424971	190	16	associated	associated	JJ
10_1101-2020_12_31_424971	190	17	codons	codon	NNS
10_1101-2020_12_31_424971	190	18	within	within	IN
10_1101-2020_12_31_424971	190	19	the	the	DT
10_1101-2020_12_31_424971	190	20	30S	30S	NNP
10_1101-2020_12_31_424971	190	21	478	478	CD
10_1101-2020_12_31_424971	190	22	subunit26	subunit26	NNP
10_1101-2020_12_31_424971	190	23	-	-	SYM
10_1101-2020_12_31_424971	190	24	28,50	28,50	CD
10_1101-2020_12_31_424971	190	25	,	,	,
10_1101-2020_12_31_424971	190	26	suggesting	suggest	VBG
10_1101-2020_12_31_424971	190	27	that	that	IN
10_1101-2020_12_31_424971	190	28	SufB2-mediated	sufb2-mediated	JJ
10_1101-2020_12_31_424971	190	29	perturbation	perturbation	NN
10_1101-2020_12_31_424971	190	30	of	of	IN
10_1101-2020_12_31_424971	190	31	head	head	NN
10_1101-2020_12_31_424971	190	32	swiveling	swiveling	NN
10_1101-2020_12_31_424971	190	33	may	may	MD
10_1101-2020_12_31_424971	190	34	make	make	VB
10_1101-2020_12_31_424971	190	35	the	the	DT
10_1101-2020_12_31_424971	190	36	most	most	JJS
10_1101-2020_12_31_424971	190	37	479	479	CD
10_1101-2020_12_31_424971	190	38	important	important	JJ
10_1101-2020_12_31_424971	190	39	contribution	contribution	NN
10_1101-2020_12_31_424971	190	40	to	to	IN
10_1101-2020_12_31_424971	190	41	+1	+1	NNS
10_1101-2020_12_31_424971	190	42	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	190	43	.	.	.
10_1101-2020_12_31_424971	191	1	Consistent	consistent	JJ
10_1101-2020_12_31_424971	191	2	with	with	IN
10_1101-2020_12_31_424971	191	3	this	this	DT
10_1101-2020_12_31_424971	191	4	,	,	,
10_1101-2020_12_31_424971	191	5	a	a	DT
10_1101-2020_12_31_424971	191	6	recent	recent	JJ
10_1101-2020_12_31_424971	191	7	structural	structural	JJ
10_1101-2020_12_31_424971	191	8	study	study	NN
10_1101-2020_12_31_424971	191	9	showed	show	VBD
10_1101-2020_12_31_424971	191	10	480	480	CD
10_1101-2020_12_31_424971	191	11	that	that	IN
10_1101-2020_12_31_424971	191	12	upon	upon	IN
10_1101-2020_12_31_424971	191	13	forward	forward	JJ
10_1101-2020_12_31_424971	191	14	head	head	NN
10_1101-2020_12_31_424971	191	15	swiveling	swivel	VBG
10_1101-2020_12_31_424971	191	16	,	,	,
10_1101-2020_12_31_424971	191	17	the	the	DT
10_1101-2020_12_31_424971	191	18	ASLs	asl	NNS
10_1101-2020_12_31_424971	191	19	of	of	IN
10_1101-2020_12_31_424971	191	20	the	the	DT
10_1101-2020_12_31_424971	191	21	P-	P-	NNP
10_1101-2020_12_31_424971	191	22	and	and	CC
10_1101-2020_12_31_424971	191	23	A	A	NNP
10_1101-2020_12_31_424971	191	24	-	-	HYPH
10_1101-2020_12_31_424971	191	25	site	site	NN
10_1101-2020_12_31_424971	191	26	tRNAs	tRNAs	''
10_1101-2020_12_31_424971	191	27	can	can	MD
10_1101-2020_12_31_424971	191	28	disengage	disengage	VB
10_1101-2020_12_31_424971	191	29	from	from	IN
10_1101-2020_12_31_424971	191	30	their	-PRON-	PRP$
10_1101-2020_12_31_424971	191	31	481	481	CD
10_1101-2020_12_31_424971	191	32	.CC	.CC	NFP
10_1101-2020_12_31_424971	191	33	-	-	HYPH
10_1101-2020_12_31_424971	191	34	BY	by	IN
10_1101-2020_12_31_424971	191	35	-	-	HYPH
10_1101-2020_12_31_424971	191	36	NC	NC	NNP
10_1101-2020_12_31_424971	191	37	-	-	HYPH
10_1101-2020_12_31_424971	191	38	ND	ND	NNP
10_1101-2020_12_31_424971	191	39	4.0	4.0	CD
10_1101-2020_12_31_424971	191	40	International	International	NNP
10_1101-2020_12_31_424971	191	41	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	191	42	under	under	IN
10_1101-2020_12_31_424971	191	43	a	a	DT
10_1101-2020_12_31_424971	191	44	(	(	-LRB-
10_1101-2020_12_31_424971	191	45	which	which	WDT
10_1101-2020_12_31_424971	191	46	was	be	VBD
10_1101-2020_12_31_424971	191	47	not	not	RB
10_1101-2020_12_31_424971	191	48	certified	certify	VBN
10_1101-2020_12_31_424971	191	49	by	by	IN
10_1101-2020_12_31_424971	191	50	peer	peer	NN
10_1101-2020_12_31_424971	191	51	review	review	NN
10_1101-2020_12_31_424971	191	52	)	)	-RRB-
10_1101-2020_12_31_424971	191	53	is	be	VBZ
10_1101-2020_12_31_424971	191	54	the	the	DT
10_1101-2020_12_31_424971	191	55	author	author	NN
10_1101-2020_12_31_424971	191	56	/	/	SYM
10_1101-2020_12_31_424971	191	57	funder	funder	NN
10_1101-2020_12_31_424971	191	58	,	,	,
10_1101-2020_12_31_424971	191	59	who	who	WP
10_1101-2020_12_31_424971	191	60	has	have	VBZ
10_1101-2020_12_31_424971	191	61	granted	grant	VBN
10_1101-2020_12_31_424971	191	62	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	191	63	a	a	DT
10_1101-2020_12_31_424971	191	64	license	license	NN
10_1101-2020_12_31_424971	191	65	to	to	TO
10_1101-2020_12_31_424971	191	66	display	display	VB
10_1101-2020_12_31_424971	191	67	the	the	DT
10_1101-2020_12_31_424971	191	68	preprint	preprint	NN
10_1101-2020_12_31_424971	191	69	in	in	IN
10_1101-2020_12_31_424971	191	70	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	191	71	.	.	.
10_1101-2020_12_31_424971	192	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	192	2	is	be	VBZ
10_1101-2020_12_31_424971	192	3	made	make	VBN
10_1101-2020_12_31_424971	192	4	The	the	DT
10_1101-2020_12_31_424971	192	5	copyright	copyright	NN
10_1101-2020_12_31_424971	192	6	holder	holder	NN
10_1101-2020_12_31_424971	192	7	for	for	IN
10_1101-2020_12_31_424971	192	8	this	this	DT
10_1101-2020_12_31_424971	192	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	192	10	version	version	NN
10_1101-2020_12_31_424971	192	11	posted	post	VBD
10_1101-2020_12_31_424971	192	12	January	January	NNP
10_1101-2020_12_31_424971	192	13	2	2	CD
10_1101-2020_12_31_424971	192	14	,	,	,
10_1101-2020_12_31_424971	192	15	2021	2021	CD
10_1101-2020_12_31_424971	192	16	.	.	.
10_1101-2020_12_31_424971	192	17	;	;	:
10_1101-2020_12_31_424971	192	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	192	19	:	:	:
10_1101-2020_12_31_424971	192	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	192	21	preprint	preprint	NN
10_1101-2020_12_31_424971	192	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	192	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	192	24	20	20	CD
10_1101-2020_12_31_424971	192	25	associated	associate	VBN
10_1101-2020_12_31_424971	192	26	codons	codon	NNS
10_1101-2020_12_31_424971	192	27	and	and	CC
10_1101-2020_12_31_424971	192	28	occupy	occupy	NN
10_1101-2020_12_31_424971	192	29	positions	position	NNS
10_1101-2020_12_31_424971	192	30	similar	similar	JJ
10_1101-2020_12_31_424971	192	31	to	to	IN
10_1101-2020_12_31_424971	192	32	a	a	DT
10_1101-2020_12_31_424971	192	33	partial	partial	JJ
10_1101-2020_12_31_424971	192	34	+1	+1	NNS
10_1101-2020_12_31_424971	192	35	frameshift	frameshift	NN
10_1101-2020_12_31_424971	192	36	,	,	,
10_1101-2020_12_31_424971	192	37	even	even	RB
10_1101-2020_12_31_424971	192	38	in	in	IN
10_1101-2020_12_31_424971	192	39	the	the	DT
10_1101-2020_12_31_424971	192	40	presence	presence	NN
10_1101-2020_12_31_424971	192	41	482	482	CD
10_1101-2020_12_31_424971	192	42	of	of	IN
10_1101-2020_12_31_424971	192	43	a	a	DT
10_1101-2020_12_31_424971	192	44	non	non	JJ
10_1101-2020_12_31_424971	192	45	-	-	JJ
10_1101-2020_12_31_424971	192	46	frameshift	frameshift	JJ
10_1101-2020_12_31_424971	192	47	suppressor	suppressor	NN
10_1101-2020_12_31_424971	192	48	tRNA	trna	NN
10_1101-2020_12_31_424971	192	49	in	in	IN
10_1101-2020_12_31_424971	192	50	the	the	DT
10_1101-2020_12_31_424971	192	51	A	A	NNP
10_1101-2020_12_31_424971	192	52	site	site	NN
10_1101-2020_12_31_424971	192	53	and	and	CC
10_1101-2020_12_31_424971	192	54	the	the	DT
10_1101-2020_12_31_424971	192	55	absence	absence	NN
10_1101-2020_12_31_424971	192	56	of	of	IN
10_1101-2020_12_31_424971	192	57	EF	EF	NNP
10_1101-2020_12_31_424971	192	58	-	-	HYPH
10_1101-2020_12_31_424971	192	59	G51	G51	NNP
10_1101-2020_12_31_424971	192	60	.	.	.
10_1101-2020_12_31_424971	193	1	483	483	CD
10_1101-2020_12_31_424971	193	2	While	while	IN
10_1101-2020_12_31_424971	193	3	previous	previous	JJ
10_1101-2020_12_31_424971	193	4	structural	structural	JJ
10_1101-2020_12_31_424971	193	5	studies	study	NNS
10_1101-2020_12_31_424971	193	6	have	have	VBP
10_1101-2020_12_31_424971	193	7	demonstrated	demonstrate	VBN
10_1101-2020_12_31_424971	193	8	that	that	IN
10_1101-2020_12_31_424971	193	9	+1	+1	NNS
10_1101-2020_12_31_424971	193	10	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	193	11	tRNAs	tRNAs	''
10_1101-2020_12_31_424971	193	12	bind	bind	NN
10_1101-2020_12_31_424971	193	13	to	to	IN
10_1101-2020_12_31_424971	193	14	the	the	DT
10_1101-2020_12_31_424971	193	15	484	484	CD
10_1101-2020_12_31_424971	193	16	A	a	DT
10_1101-2020_12_31_424971	193	17	site	site	NN
10_1101-2020_12_31_424971	193	18	in	in	IN
10_1101-2020_12_31_424971	193	19	the	the	DT
10_1101-2020_12_31_424971	193	20	0-frame16,17,49	0-frame16,17,49	NN
10_1101-2020_12_31_424971	193	21	and	and	CC
10_1101-2020_12_31_424971	193	22	to	to	IN
10_1101-2020_12_31_424971	193	23	the	the	DT
10_1101-2020_12_31_424971	193	24	P	p	NN
10_1101-2020_12_31_424971	193	25	site	site	NN
10_1101-2020_12_31_424971	193	26	in	in	IN
10_1101-2020_12_31_424971	193	27	the	the	DT
10_1101-2020_12_31_424971	193	28	+1-frame19	+1-frame19	NN
10_1101-2020_12_31_424971	193	29	,	,	,
10_1101-2020_12_31_424971	193	30	these	these	DT
10_1101-2020_12_31_424971	193	31	studies	study	NNS
10_1101-2020_12_31_424971	193	32	lacked	lack	VBD
10_1101-2020_12_31_424971	193	33	EF	EF	NNP
10_1101-2020_12_31_424971	193	34	-	-	HYPH
10_1101-2020_12_31_424971	193	35	G	G	NNP
10_1101-2020_12_31_424971	193	36	and	and	CC
10_1101-2020_12_31_424971	193	37	the	the	DT
10_1101-2020_12_31_424971	193	38	485	485	CD
10_1101-2020_12_31_424971	193	39	observed	observe	VBN
10_1101-2020_12_31_424971	193	40	structures	structure	NNS
10_1101-2020_12_31_424971	193	41	were	be	VBD
10_1101-2020_12_31_424971	193	42	obtained	obtain	VBN
10_1101-2020_12_31_424971	193	43	by	by	IN
10_1101-2020_12_31_424971	193	44	directly	directly	RB
10_1101-2020_12_31_424971	193	45	binding	bind	VBG
10_1101-2020_12_31_424971	193	46	a	a	DT
10_1101-2020_12_31_424971	193	47	deacylated	deacylated	JJ
10_1101-2020_12_31_424971	193	48	+1	+1	NNS
10_1101-2020_12_31_424971	193	49	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	193	50	tRNA	trna	NN
10_1101-2020_12_31_424971	193	51	to	to	IN
10_1101-2020_12_31_424971	193	52	the	the	DT
10_1101-2020_12_31_424971	193	53	486	486	CD
10_1101-2020_12_31_424971	193	54	P	p	NN
10_1101-2020_12_31_424971	193	55	site	site	NN
10_1101-2020_12_31_424971	193	56	.	.	.
10_1101-2020_12_31_424971	194	1	Specifically	specifically	RB
10_1101-2020_12_31_424971	194	2	,	,	,
10_1101-2020_12_31_424971	194	3	a	a	DT
10_1101-2020_12_31_424971	194	4	+1	+1	NNS
10_1101-2020_12_31_424971	194	5	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	194	6	peptidyl	peptidyl	NN
10_1101-2020_12_31_424971	194	7	-	-	HYPH
10_1101-2020_12_31_424971	194	8	tRNA	trna	NN
10_1101-2020_12_31_424971	194	9	was	be	VBD
10_1101-2020_12_31_424971	194	10	not	not	RB
10_1101-2020_12_31_424971	194	11	translocated	translocate	VBN
10_1101-2020_12_31_424971	194	12	from	from	IN
10_1101-2020_12_31_424971	194	13	the	the	DT
10_1101-2020_12_31_424971	194	14	A	a	NN
10_1101-2020_12_31_424971	194	15	to	to	IN
10_1101-2020_12_31_424971	194	16	P	p	NN
10_1101-2020_12_31_424971	194	17	sites	site	NNS
10_1101-2020_12_31_424971	194	18	,	,	,
10_1101-2020_12_31_424971	194	19	487	487	CD
10_1101-2020_12_31_424971	194	20	as	as	IN
10_1101-2020_12_31_424971	194	21	would	would	MD
10_1101-2020_12_31_424971	194	22	be	be	VB
10_1101-2020_12_31_424971	194	23	the	the	DT
10_1101-2020_12_31_424971	194	24	case	case	NN
10_1101-2020_12_31_424971	194	25	during	during	IN
10_1101-2020_12_31_424971	194	26	an	an	DT
10_1101-2020_12_31_424971	194	27	authentic	authentic	JJ
10_1101-2020_12_31_424971	194	28	translocation	translocation	NN
10_1101-2020_12_31_424971	194	29	event	event	NN
10_1101-2020_12_31_424971	194	30	.	.	.
10_1101-2020_12_31_424971	195	1	In	in	IN
10_1101-2020_12_31_424971	195	2	contrast	contrast	NN
10_1101-2020_12_31_424971	195	3	,	,	,
10_1101-2020_12_31_424971	195	4	our	-PRON-	PRP$
10_1101-2020_12_31_424971	195	5	elucidation	elucidation	NN
10_1101-2020_12_31_424971	195	6	of	of	IN
10_1101-2020_12_31_424971	195	7	the	the	DT
10_1101-2020_12_31_424971	195	8	488	488	CD
10_1101-2020_12_31_424971	195	9	+1-frameshifting	+1-frameshifting	NN
10_1101-2020_12_31_424971	195	10	mechanism	mechanism	NN
10_1101-2020_12_31_424971	195	11	was	be	VBD
10_1101-2020_12_31_424971	195	12	executed	execute	VBN
10_1101-2020_12_31_424971	195	13	in	in	IN
10_1101-2020_12_31_424971	195	14	the	the	DT
10_1101-2020_12_31_424971	195	15	presence	presence	NN
10_1101-2020_12_31_424971	195	16	of	of	IN
10_1101-2020_12_31_424971	195	17	EF	EF	NNP
10_1101-2020_12_31_424971	195	18	-	-	HYPH
10_1101-2020_12_31_424971	195	19	G	G	NNP
10_1101-2020_12_31_424971	195	20	and	and	CC
10_1101-2020_12_31_424971	195	21	is	be	VBZ
10_1101-2020_12_31_424971	195	22	based	base	VBN
10_1101-2020_12_31_424971	195	23	on	on	IN
10_1101-2020_12_31_424971	195	24	extensive	extensive	JJ
10_1101-2020_12_31_424971	195	25	489	489	CD
10_1101-2020_12_31_424971	195	26	comparison	comparison	NN
10_1101-2020_12_31_424971	195	27	of	of	IN
10_1101-2020_12_31_424971	195	28	the	the	DT
10_1101-2020_12_31_424971	195	29	kinetics	kinetic	NNS
10_1101-2020_12_31_424971	195	30	with	with	IN
10_1101-2020_12_31_424971	195	31	which	which	WDT
10_1101-2020_12_31_424971	195	32	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	195	33	and	and	CC
10_1101-2020_12_31_424971	195	34	ProL	ProL	NNP
10_1101-2020_12_31_424971	195	35	undergo	undergo	VBP
10_1101-2020_12_31_424971	195	36	individual	individual	JJ
10_1101-2020_12_31_424971	195	37	reactions	reaction	NNS
10_1101-2020_12_31_424971	195	38	of	of	IN
10_1101-2020_12_31_424971	195	39	the	the	DT
10_1101-2020_12_31_424971	195	40	490	490	CD
10_1101-2020_12_31_424971	195	41	elongation	elongation	NN
10_1101-2020_12_31_424971	195	42	cycle	cycle	NN
10_1101-2020_12_31_424971	195	43	(	(	-LRB-
10_1101-2020_12_31_424971	195	44	i.e.	i.e.	FW
10_1101-2020_12_31_424971	195	45	,	,	,
10_1101-2020_12_31_424971	195	46	aa	aa	NNP
10_1101-2020_12_31_424971	195	47	-	-	HYPH
10_1101-2020_12_31_424971	195	48	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	195	49	selection	selection	NN
10_1101-2020_12_31_424971	195	50	,	,	,
10_1101-2020_12_31_424971	195	51	peptide	peptide	NN
10_1101-2020_12_31_424971	195	52	-	-	HYPH
10_1101-2020_12_31_424971	195	53	bond	bond	NN
10_1101-2020_12_31_424971	195	54	formation	formation	NN
10_1101-2020_12_31_424971	195	55	,	,	,
10_1101-2020_12_31_424971	195	56	and	and	CC
10_1101-2020_12_31_424971	195	57	translocation	translocation	NN
10_1101-2020_12_31_424971	195	58	)	)	-RRB-
10_1101-2020_12_31_424971	195	59	and	and	CC
10_1101-2020_12_31_424971	195	60	the	the	DT
10_1101-2020_12_31_424971	195	61	491	491	CD
10_1101-2020_12_31_424971	195	62	associated	associate	VBN
10_1101-2020_12_31_424971	195	63	conformational	conformational	JJ
10_1101-2020_12_31_424971	195	64	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	195	65	of	of	IN
10_1101-2020_12_31_424971	195	66	the	the	DT
10_1101-2020_12_31_424971	195	67	elongation	elongation	NN
10_1101-2020_12_31_424971	195	68	complex	complex	NN
10_1101-2020_12_31_424971	195	69	.	.	.
10_1101-2020_12_31_424971	196	1	Additionally	additionally	RB
10_1101-2020_12_31_424971	196	2	,	,	,
10_1101-2020_12_31_424971	196	3	all	all	DT
10_1101-2020_12_31_424971	196	4	of	of	IN
10_1101-2020_12_31_424971	196	5	our	-PRON-	PRP$
10_1101-2020_12_31_424971	196	6	in	in	IN
10_1101-2020_12_31_424971	196	7	492	492	CD
10_1101-2020_12_31_424971	196	8	vitro	vitro	FW
10_1101-2020_12_31_424971	196	9	biochemical	biochemical	NNP
10_1101-2020_12_31_424971	196	10	assays	assay	NNS
10_1101-2020_12_31_424971	196	11	,	,	,
10_1101-2020_12_31_424971	196	12	and	and	CC
10_1101-2020_12_31_424971	196	13	most	most	JJS
10_1101-2020_12_31_424971	196	14	of	of	IN
10_1101-2020_12_31_424971	196	15	our	-PRON-	PRP$
10_1101-2020_12_31_424971	196	16	ensemble	ensemble	JJ
10_1101-2020_12_31_424971	196	17	rapid	rapid	JJ
10_1101-2020_12_31_424971	196	18	kinetics	kinetic	NNS
10_1101-2020_12_31_424971	196	19	assays	assays	RB
10_1101-2020_12_31_424971	196	20	were	be	VBD
10_1101-2020_12_31_424971	196	21	performed	perform	VBN
10_1101-2020_12_31_424971	196	22	under	under	IN
10_1101-2020_12_31_424971	196	23	493	493	CD
10_1101-2020_12_31_424971	196	24	the	the	DT
10_1101-2020_12_31_424971	196	25	conditions	condition	NNS
10_1101-2020_12_31_424971	196	26	in	in	IN
10_1101-2020_12_31_424971	196	27	which	which	WDT
10_1101-2020_12_31_424971	196	28	the	the	DT
10_1101-2020_12_31_424971	196	29	A	A	NNP
10_1101-2020_12_31_424971	196	30	site	site	NN
10_1101-2020_12_31_424971	196	31	is	be	VBZ
10_1101-2020_12_31_424971	196	32	always	always	RB
10_1101-2020_12_31_424971	196	33	occupied	occupy	VBN
10_1101-2020_12_31_424971	196	34	by	by	IN
10_1101-2020_12_31_424971	196	35	an	an	DT
10_1101-2020_12_31_424971	196	36	aa-	aa-	NN
10_1101-2020_12_31_424971	196	37	or	or	CC
10_1101-2020_12_31_424971	196	38	peptidyl	peptidyl	NN
10_1101-2020_12_31_424971	196	39	-	-	HYPH
10_1101-2020_12_31_424971	196	40	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	196	41	,	,	,
10_1101-2020_12_31_424971	196	42	leaving	leave	VBG
10_1101-2020_12_31_424971	196	43	no	no	DT
10_1101-2020_12_31_424971	196	44	494	494	CD
10_1101-2020_12_31_424971	196	45	chance	chance	NN
10_1101-2020_12_31_424971	196	46	of	of	IN
10_1101-2020_12_31_424971	196	47	a	a	DT
10_1101-2020_12_31_424971	196	48	vacant	vacant	JJ
10_1101-2020_12_31_424971	196	49	A	a	NN
10_1101-2020_12_31_424971	196	50	site	site	NN
10_1101-2020_12_31_424971	196	51	.	.	.
10_1101-2020_12_31_424971	197	1	Therefore	therefore	RB
10_1101-2020_12_31_424971	197	2	,	,	,
10_1101-2020_12_31_424971	197	3	the	the	DT
10_1101-2020_12_31_424971	197	4	+1	+1	NNS
10_1101-2020_12_31_424971	197	5	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	197	6	mechanism	mechanism	NN
10_1101-2020_12_31_424971	197	7	we	-PRON-	PRP
10_1101-2020_12_31_424971	197	8	present	present	VBP
10_1101-2020_12_31_424971	197	9	here	here	RB
10_1101-2020_12_31_424971	197	10	is	be	VBZ
10_1101-2020_12_31_424971	197	11	distinct	distinct	JJ
10_1101-2020_12_31_424971	197	12	495	495	CD
10_1101-2020_12_31_424971	197	13	from	from	IN
10_1101-2020_12_31_424971	197	14	that	that	DT
10_1101-2020_12_31_424971	197	15	presented	present	VBN
10_1101-2020_12_31_424971	197	16	by	by	IN
10_1101-2020_12_31_424971	197	17	Farabaugh	Farabaugh	NNP
10_1101-2020_12_31_424971	197	18	and	and	CC
10_1101-2020_12_31_424971	197	19	co	co	NNP
10_1101-2020_12_31_424971	197	20	-	-	NN
10_1101-2020_12_31_424971	197	21	workers13	workers13	NNP
10_1101-2020_12_31_424971	197	22	,	,	,
10_1101-2020_12_31_424971	197	23	in	in	IN
10_1101-2020_12_31_424971	197	24	which	which	WDT
10_1101-2020_12_31_424971	197	25	the	the	DT
10_1101-2020_12_31_424971	197	26	ribosome	ribosome	NN
10_1101-2020_12_31_424971	197	27	is	be	VBZ
10_1101-2020_12_31_424971	197	28	stalled	stall	VBN
10_1101-2020_12_31_424971	197	29	due	due	JJ
10_1101-2020_12_31_424971	197	30	to	to	IN
10_1101-2020_12_31_424971	197	31	a	a	DT
10_1101-2020_12_31_424971	197	32	496	496	CD
10_1101-2020_12_31_424971	197	33	vacant	vacant	JJ
10_1101-2020_12_31_424971	197	34	A	a	DT
10_1101-2020_12_31_424971	197	35	site	site	NN
10_1101-2020_12_31_424971	197	36	,	,	,
10_1101-2020_12_31_424971	197	37	thus	thus	RB
10_1101-2020_12_31_424971	197	38	giving	give	VBG
10_1101-2020_12_31_424971	197	39	the	the	DT
10_1101-2020_12_31_424971	197	40	+1-frameshifting	+1-frameshifting	NN
10_1101-2020_12_31_424971	197	41	-	-	HYPH
10_1101-2020_12_31_424971	197	42	inducing	induce	VBG
10_1101-2020_12_31_424971	197	43	tRNA	trna	NN
10_1101-2020_12_31_424971	197	44	at	at	IN
10_1101-2020_12_31_424971	197	45	the	the	DT
10_1101-2020_12_31_424971	197	46	P	p	NN
10_1101-2020_12_31_424971	197	47	site	site	NN
10_1101-2020_12_31_424971	197	48	an	an	DT
10_1101-2020_12_31_424971	197	49	opportunity	opportunity	NN
10_1101-2020_12_31_424971	197	50	to	to	TO
10_1101-2020_12_31_424971	197	51	497	497	CD
10_1101-2020_12_31_424971	197	52	rearrange	rearrange	NN
10_1101-2020_12_31_424971	197	53	into	into	IN
10_1101-2020_12_31_424971	197	54	the	the	DT
10_1101-2020_12_31_424971	197	55	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	197	56	.	.	.
10_1101-2020_12_31_424971	198	1	The	the	DT
10_1101-2020_12_31_424971	198	2	fact	fact	NN
10_1101-2020_12_31_424971	198	3	that	that	IN
10_1101-2020_12_31_424971	198	4	all	all	DT
10_1101-2020_12_31_424971	198	5	well	well	RB
10_1101-2020_12_31_424971	198	6	-	-	HYPH
10_1101-2020_12_31_424971	198	7	characterized	characterize	VBN
10_1101-2020_12_31_424971	198	8	+1-frameshifting	+1-frameshifting	PRP$
10_1101-2020_12_31_424971	198	9	tRNAs	trnas	CD
10_1101-2020_12_31_424971	198	10	contain	contain	NN
10_1101-2020_12_31_424971	198	11	498	498	CD
10_1101-2020_12_31_424971	198	12	an	an	DT
10_1101-2020_12_31_424971	198	13	extra	extra	JJ
10_1101-2020_12_31_424971	198	14	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	198	15	in	in	IN
10_1101-2020_12_31_424971	198	16	the	the	DT
10_1101-2020_12_31_424971	198	17	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	198	18	loop	loop	NN
10_1101-2020_12_31_424971	198	19	,	,	,
10_1101-2020_12_31_424971	198	20	despite	despite	IN
10_1101-2020_12_31_424971	198	21	differences	difference	NNS
10_1101-2020_12_31_424971	198	22	in	in	IN
10_1101-2020_12_31_424971	198	23	their	-PRON-	PRP$
10_1101-2020_12_31_424971	198	24	primary	primary	JJ
10_1101-2020_12_31_424971	198	25	sequences	sequence	NNS
10_1101-2020_12_31_424971	198	26	,	,	,
10_1101-2020_12_31_424971	198	27	the	the	DT
10_1101-2020_12_31_424971	198	28	499	499	CD
10_1101-2020_12_31_424971	198	29	amino	amino	JJ
10_1101-2020_12_31_424971	198	30	acids	acid	NNS
10_1101-2020_12_31_424971	198	31	they	-PRON-	PRP
10_1101-2020_12_31_424971	198	32	carry	carry	VBP
10_1101-2020_12_31_424971	198	33	,	,	,
10_1101-2020_12_31_424971	198	34	and	and	CC
10_1101-2020_12_31_424971	198	35	whether	whether	IN
10_1101-2020_12_31_424971	198	36	the	the	DT
10_1101-2020_12_31_424971	198	37	extra	extra	JJ
10_1101-2020_12_31_424971	198	38	nucleotide	nucleotide	NN
10_1101-2020_12_31_424971	198	39	is	be	VBZ
10_1101-2020_12_31_424971	198	40	inserted	insert	VBN
10_1101-2020_12_31_424971	198	41	at	at	IN
10_1101-2020_12_31_424971	198	42	the	the	DT
10_1101-2020_12_31_424971	198	43	3'-	3'-	NNP
10_1101-2020_12_31_424971	198	44	or	or	CC
10_1101-2020_12_31_424971	198	45	5'-sides	5'-sides	NNPS
10_1101-2020_12_31_424971	198	46	of	of	IN
10_1101-2020_12_31_424971	198	47	the	the	DT
10_1101-2020_12_31_424971	198	48	500	500	CD
10_1101-2020_12_31_424971	198	49	anticodon	anticodon	NN
10_1101-2020_12_31_424971	198	50	,	,	,
10_1101-2020_12_31_424971	198	51	suggests	suggest	VBZ
10_1101-2020_12_31_424971	198	52	that	that	IN
10_1101-2020_12_31_424971	198	53	the	the	DT
10_1101-2020_12_31_424971	198	54	results	result	NNS
10_1101-2020_12_31_424971	198	55	we	-PRON-	PRP
10_1101-2020_12_31_424971	198	56	report	report	VBP
10_1101-2020_12_31_424971	198	57	here	here	RB
10_1101-2020_12_31_424971	198	58	for	for	IN
10_1101-2020_12_31_424971	198	59	SufB2	sufb2	NN
10_1101-2020_12_31_424971	198	60	are	be	VBP
10_1101-2020_12_31_424971	198	61	likely	likely	RB
10_1101-2020_12_31_424971	198	62	applicable	applicable	JJ
10_1101-2020_12_31_424971	198	63	to	to	IN
10_1101-2020_12_31_424971	198	64	other	other	JJ
10_1101-2020_12_31_424971	198	65	+1	+1	:
10_1101-2020_12_31_424971	198	66	-	-	:
10_1101-2020_12_31_424971	198	67	501	501	CD
10_1101-2020_12_31_424971	198	68	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	198	69	tRNAs	trnas	CD
10_1101-2020_12_31_424971	198	70	with	with	IN
10_1101-2020_12_31_424971	198	71	an	an	DT
10_1101-2020_12_31_424971	198	72	expanded	expand	VBN
10_1101-2020_12_31_424971	198	73	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	198	74	loop	loop	NN
10_1101-2020_12_31_424971	198	75	.	.	.
10_1101-2020_12_31_424971	199	1	502	502	CD
10_1101-2020_12_31_424971	199	2	While	while	IN
10_1101-2020_12_31_424971	199	3	an	an	DT
10_1101-2020_12_31_424971	199	4	expanded	expand	VBN
10_1101-2020_12_31_424971	199	5	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	199	6	loop	loop	NN
10_1101-2020_12_31_424971	199	7	is	be	VBZ
10_1101-2020_12_31_424971	199	8	a	a	DT
10_1101-2020_12_31_424971	199	9	strong	strong	JJ
10_1101-2020_12_31_424971	199	10	feature	feature	NN
10_1101-2020_12_31_424971	199	11	associated	associate	VBN
10_1101-2020_12_31_424971	199	12	with	with	IN
10_1101-2020_12_31_424971	199	13	+1	+1	NNS
10_1101-2020_12_31_424971	199	14	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	199	15	,	,	,
10_1101-2020_12_31_424971	199	16	it	-PRON-	PRP
10_1101-2020_12_31_424971	199	17	is	be	VBZ
10_1101-2020_12_31_424971	199	18	503	503	CD
10_1101-2020_12_31_424971	199	19	not	not	RB
10_1101-2020_12_31_424971	199	20	associated	associate	VBN
10_1101-2020_12_31_424971	199	21	with	with	IN
10_1101-2020_12_31_424971	199	22	–	–	:
10_1101-2020_12_31_424971	199	23	1	1	CD
10_1101-2020_12_31_424971	199	24	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	199	25	,	,	,
10_1101-2020_12_31_424971	199	26	which	which	WDT
10_1101-2020_12_31_424971	199	27	instead	instead	RB
10_1101-2020_12_31_424971	199	28	is	be	VBZ
10_1101-2020_12_31_424971	199	29	typically	typically	RB
10_1101-2020_12_31_424971	199	30	induced	induce	VBN
10_1101-2020_12_31_424971	199	31	by	by	IN
10_1101-2020_12_31_424971	199	32	structural	structural	JJ
10_1101-2020_12_31_424971	199	33	barriers	barrier	NNS
10_1101-2020_12_31_424971	199	34	in	in	IN
10_1101-2020_12_31_424971	199	35	504	504	CD
10_1101-2020_12_31_424971	199	36	the	the	DT
10_1101-2020_12_31_424971	199	37	mRNA	mrna	NN
10_1101-2020_12_31_424971	199	38	that	that	WDT
10_1101-2020_12_31_424971	199	39	stall	stall	VBP
10_1101-2020_12_31_424971	199	40	a	a	DT
10_1101-2020_12_31_424971	199	41	translating	translating	NN
10_1101-2020_12_31_424971	199	42	ribosome	ribosome	NN
10_1101-2020_12_31_424971	199	43	from	from	IN
10_1101-2020_12_31_424971	199	44	moving	move	VBG
10_1101-2020_12_31_424971	199	45	forward	forward	RB
10_1101-2020_12_31_424971	199	46	,	,	,
10_1101-2020_12_31_424971	199	47	thus	thus	RB
10_1101-2020_12_31_424971	199	48	providing	provide	VBG
10_1101-2020_12_31_424971	199	49	the	the	DT
10_1101-2020_12_31_424971	199	50	ribosome	ribosome	NN
10_1101-2020_12_31_424971	199	51	with	with	IN
10_1101-2020_12_31_424971	199	52	505	505	CD
10_1101-2020_12_31_424971	199	53	an	an	DT
10_1101-2020_12_31_424971	199	54	opportunity	opportunity	NN
10_1101-2020_12_31_424971	199	55	to	to	TO
10_1101-2020_12_31_424971	199	56	shift	shift	VB
10_1101-2020_12_31_424971	199	57	backwards	backwards	RB
10_1101-2020_12_31_424971	199	58	in	in	IN
10_1101-2020_12_31_424971	199	59	the	the	DT
10_1101-2020_12_31_424971	199	60	–	–	:
10_1101-2020_12_31_424971	199	61	1	1	CD
10_1101-2020_12_31_424971	199	62	direction10,52	direction10,52	RB
10_1101-2020_12_31_424971	199	63	.	.	.
10_1101-2020_12_31_424971	200	1	Given	give	VBN
10_1101-2020_12_31_424971	200	2	the	the	DT
10_1101-2020_12_31_424971	200	3	unique	unique	JJ
10_1101-2020_12_31_424971	200	4	role	role	NN
10_1101-2020_12_31_424971	200	5	of	of	IN
10_1101-2020_12_31_424971	200	6	the	the	DT
10_1101-2020_12_31_424971	200	7	expanded	expand	VBN
10_1101-2020_12_31_424971	200	8	506	506	CD
10_1101-2020_12_31_424971	200	9	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	200	10	loop	loop	NN
10_1101-2020_12_31_424971	200	11	in	in	IN
10_1101-2020_12_31_424971	200	12	+1	+1	NNS
10_1101-2020_12_31_424971	200	13	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	200	14	,	,	,
10_1101-2020_12_31_424971	200	15	here	here	RB
10_1101-2020_12_31_424971	200	16	we	-PRON-	PRP
10_1101-2020_12_31_424971	200	17	have	have	VBP
10_1101-2020_12_31_424971	200	18	identified	identify	VBN
10_1101-2020_12_31_424971	200	19	the	the	DT
10_1101-2020_12_31_424971	200	20	determinants	determinant	NNS
10_1101-2020_12_31_424971	200	21	that	that	WDT
10_1101-2020_12_31_424971	200	22	drive	drive	VBP
10_1101-2020_12_31_424971	200	23	the	the	DT
10_1101-2020_12_31_424971	200	24	507	507	CD
10_1101-2020_12_31_424971	200	25	.CC	.CC	NFP
10_1101-2020_12_31_424971	200	26	-	-	:
10_1101-2020_12_31_424971	200	27	BY	by	IN
10_1101-2020_12_31_424971	200	28	-	-	HYPH
10_1101-2020_12_31_424971	200	29	NC	NC	NNP
10_1101-2020_12_31_424971	200	30	-	-	HYPH
10_1101-2020_12_31_424971	200	31	ND	ND	NNP
10_1101-2020_12_31_424971	200	32	4.0	4.0	CD
10_1101-2020_12_31_424971	200	33	International	International	NNP
10_1101-2020_12_31_424971	200	34	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	200	35	under	under	IN
10_1101-2020_12_31_424971	200	36	a	a	DT
10_1101-2020_12_31_424971	200	37	(	(	-LRB-
10_1101-2020_12_31_424971	200	38	which	which	WDT
10_1101-2020_12_31_424971	200	39	was	be	VBD
10_1101-2020_12_31_424971	200	40	not	not	RB
10_1101-2020_12_31_424971	200	41	certified	certify	VBN
10_1101-2020_12_31_424971	200	42	by	by	IN
10_1101-2020_12_31_424971	200	43	peer	peer	NN
10_1101-2020_12_31_424971	200	44	review	review	NN
10_1101-2020_12_31_424971	200	45	)	)	-RRB-
10_1101-2020_12_31_424971	200	46	is	be	VBZ
10_1101-2020_12_31_424971	200	47	the	the	DT
10_1101-2020_12_31_424971	200	48	author	author	NN
10_1101-2020_12_31_424971	200	49	/	/	SYM
10_1101-2020_12_31_424971	200	50	funder	funder	NN
10_1101-2020_12_31_424971	200	51	,	,	,
10_1101-2020_12_31_424971	200	52	who	who	WP
10_1101-2020_12_31_424971	200	53	has	have	VBZ
10_1101-2020_12_31_424971	200	54	granted	grant	VBN
10_1101-2020_12_31_424971	200	55	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	200	56	a	a	DT
10_1101-2020_12_31_424971	200	57	license	license	NN
10_1101-2020_12_31_424971	200	58	to	to	TO
10_1101-2020_12_31_424971	200	59	display	display	VB
10_1101-2020_12_31_424971	200	60	the	the	DT
10_1101-2020_12_31_424971	200	61	preprint	preprint	NN
10_1101-2020_12_31_424971	200	62	in	in	IN
10_1101-2020_12_31_424971	200	63	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	200	64	.	.	.
10_1101-2020_12_31_424971	201	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	201	2	is	be	VBZ
10_1101-2020_12_31_424971	201	3	made	make	VBN
10_1101-2020_12_31_424971	201	4	The	the	DT
10_1101-2020_12_31_424971	201	5	copyright	copyright	NN
10_1101-2020_12_31_424971	201	6	holder	holder	NN
10_1101-2020_12_31_424971	201	7	for	for	IN
10_1101-2020_12_31_424971	201	8	this	this	DT
10_1101-2020_12_31_424971	201	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	201	10	version	version	NN
10_1101-2020_12_31_424971	201	11	posted	post	VBD
10_1101-2020_12_31_424971	201	12	January	January	NNP
10_1101-2020_12_31_424971	201	13	2	2	CD
10_1101-2020_12_31_424971	201	14	,	,	,
10_1101-2020_12_31_424971	201	15	2021	2021	CD
10_1101-2020_12_31_424971	201	16	.	.	.
10_1101-2020_12_31_424971	201	17	;	;	:
10_1101-2020_12_31_424971	201	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	201	19	:	:	:
10_1101-2020_12_31_424971	201	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	201	21	preprint	preprint	NN
10_1101-2020_12_31_424971	201	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	201	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	201	24	21	21	CD
10_1101-2020_12_31_424971	201	25	ribosome	ribosome	NN
10_1101-2020_12_31_424971	201	26	to	to	TO
10_1101-2020_12_31_424971	201	27	shift	shift	VB
10_1101-2020_12_31_424971	201	28	in	in	IN
10_1101-2020_12_31_424971	201	29	the	the	DT
10_1101-2020_12_31_424971	201	30	+1	+1	NNS
10_1101-2020_12_31_424971	201	31	direction	direction	NN
10_1101-2020_12_31_424971	201	32	.	.	.
10_1101-2020_12_31_424971	202	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	202	2	show	show	VBP
10_1101-2020_12_31_424971	202	3	that	that	IN
10_1101-2020_12_31_424971	202	4	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	202	5	exclusively	exclusively	RB
10_1101-2020_12_31_424971	202	6	uses	use	VBZ
10_1101-2020_12_31_424971	202	7	the	the	DT
10_1101-2020_12_31_424971	202	8	triplet	triplet	NN
10_1101-2020_12_31_424971	202	9	-	-	HYPH
10_1101-2020_12_31_424971	202	10	slippage	slippage	NN
10_1101-2020_12_31_424971	202	11	508	508	CD
10_1101-2020_12_31_424971	202	12	mechanism	mechanism	NN
10_1101-2020_12_31_424971	202	13	of	of	IN
10_1101-2020_12_31_424971	202	14	+1	+1	NNS
10_1101-2020_12_31_424971	202	15	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	202	16	in	in	IN
10_1101-2020_12_31_424971	202	17	the	the	DT
10_1101-2020_12_31_424971	202	18	m1G37	m1g37	NN
10_1101-2020_12_31_424971	202	19	+	+	CC
10_1101-2020_12_31_424971	202	20	condition	condition	NN
10_1101-2020_12_31_424971	202	21	,	,	,
10_1101-2020_12_31_424971	202	22	but	but	CC
10_1101-2020_12_31_424971	202	23	that	that	IN
10_1101-2020_12_31_424971	202	24	it	-PRON-	PRP
10_1101-2020_12_31_424971	202	25	explores	explore	VBZ
10_1101-2020_12_31_424971	202	26	other	other	JJ
10_1101-2020_12_31_424971	202	27	mechanisms	mechanism	NNS
10_1101-2020_12_31_424971	202	28	509	509	CD
10_1101-2020_12_31_424971	202	29	(	(	-LRB-
10_1101-2020_12_31_424971	202	30	e.g.	e.g.	RB
10_1101-2020_12_31_424971	202	31	,	,	,
10_1101-2020_12_31_424971	202	32	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	202	33	-	-	HYPH
10_1101-2020_12_31_424971	202	34	pairing	pairing	NN
10_1101-2020_12_31_424971	202	35	)	)	-RRB-
10_1101-2020_12_31_424971	202	36	in	in	IN
10_1101-2020_12_31_424971	202	37	the	the	DT
10_1101-2020_12_31_424971	202	38	m1G37	m1g37	NN
10_1101-2020_12_31_424971	202	39	–	–	:
10_1101-2020_12_31_424971	202	40	condition	condition	NN
10_1101-2020_12_31_424971	202	41	during	during	IN
10_1101-2020_12_31_424971	202	42	translocation	translocation	NN
10_1101-2020_12_31_424971	202	43	from	from	IN
10_1101-2020_12_31_424971	202	44	the	the	DT
10_1101-2020_12_31_424971	202	45	A	A	NNP
10_1101-2020_12_31_424971	202	46	site	site	NN
10_1101-2020_12_31_424971	202	47	to	to	IN
10_1101-2020_12_31_424971	202	48	the	the	DT
10_1101-2020_12_31_424971	202	49	P	p	NN
10_1101-2020_12_31_424971	202	50	510	510	CD
10_1101-2020_12_31_424971	202	51	site	site	NN
10_1101-2020_12_31_424971	202	52	.	.	.
10_1101-2020_12_31_424971	203	1	Under	under	IN
10_1101-2020_12_31_424971	203	2	conditions	condition	NNS
10_1101-2020_12_31_424971	203	3	that	that	WDT
10_1101-2020_12_31_424971	203	4	only	only	RB
10_1101-2020_12_31_424971	203	5	permit	permit	VBP
10_1101-2020_12_31_424971	203	6	the	the	DT
10_1101-2020_12_31_424971	203	7	triplet	triplet	NN
10_1101-2020_12_31_424971	203	8	-	-	HYPH
10_1101-2020_12_31_424971	203	9	slippage	slippage	NN
10_1101-2020_12_31_424971	203	10	mechanism	mechanism	NN
10_1101-2020_12_31_424971	203	11	(	(	-LRB-
10_1101-2020_12_31_424971	203	12	e.g.	e.g.	RB
10_1101-2020_12_31_424971	203	13	,	,	,
10_1101-2020_12_31_424971	203	14	in	in	IN
10_1101-2020_12_31_424971	203	15	the	the	DT
10_1101-2020_12_31_424971	203	16	presence	presence	NN
10_1101-2020_12_31_424971	203	17	of	of	IN
10_1101-2020_12_31_424971	203	18	511	511	CD
10_1101-2020_12_31_424971	203	19	m1G37	m1g37	NN
10_1101-2020_12_31_424971	203	20	)	)	-RRB-
10_1101-2020_12_31_424971	203	21	,	,	,
10_1101-2020_12_31_424971	203	22	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	203	23	exhibits	exhibit	VBZ
10_1101-2020_12_31_424971	203	24	a	a	DT
10_1101-2020_12_31_424971	203	25	relatively	relatively	RB
10_1101-2020_12_31_424971	203	26	low	low	JJ
10_1101-2020_12_31_424971	203	27	+1-frameshifting	+1-frameshifting	JJ
10_1101-2020_12_31_424971	203	28	efficiency	efficiency	NN
10_1101-2020_12_31_424971	203	29	of	of	IN
10_1101-2020_12_31_424971	203	30	~30	~30	$
10_1101-2020_12_31_424971	203	31	%	%	NN
10_1101-2020_12_31_424971	203	32	,	,	,
10_1101-2020_12_31_424971	203	33	whereas	whereas	IN
10_1101-2020_12_31_424971	203	34	under	under	IN
10_1101-2020_12_31_424971	203	35	512	512	CD
10_1101-2020_12_31_424971	203	36	conditions	condition	NNS
10_1101-2020_12_31_424971	203	37	that	that	WDT
10_1101-2020_12_31_424971	203	38	permit	permit	VBP
10_1101-2020_12_31_424971	203	39	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	203	40	-	-	HYPH
10_1101-2020_12_31_424971	203	41	pairing	pair	VBG
10_1101-2020_12_31_424971	203	42	during	during	IN
10_1101-2020_12_31_424971	203	43	translocation	translocation	NN
10_1101-2020_12_31_424971	203	44	(	(	-LRB-
10_1101-2020_12_31_424971	203	45	e.g.	e.g.	RB
10_1101-2020_12_31_424971	203	46	,	,	,
10_1101-2020_12_31_424971	203	47	in	in	IN
10_1101-2020_12_31_424971	203	48	the	the	DT
10_1101-2020_12_31_424971	203	49	absence	absence	NN
10_1101-2020_12_31_424971	203	50	of	of	IN
10_1101-2020_12_31_424971	203	51	m1G37	m1g37	NN
10_1101-2020_12_31_424971	203	52	)	)	-RRB-
10_1101-2020_12_31_424971	203	53	,	,	,
10_1101-2020_12_31_424971	203	54	it	-PRON-	PRP
10_1101-2020_12_31_424971	203	55	513	513	CD
10_1101-2020_12_31_424971	203	56	exhibits	exhibit	VBZ
10_1101-2020_12_31_424971	203	57	a	a	DT
10_1101-2020_12_31_424971	203	58	relatively	relatively	RB
10_1101-2020_12_31_424971	203	59	high	high	JJ
10_1101-2020_12_31_424971	203	60	+1-frameshifting	+1-frameshifting	JJ
10_1101-2020_12_31_424971	203	61	efficiency	efficiency	NN
10_1101-2020_12_31_424971	203	62	of	of	IN
10_1101-2020_12_31_424971	203	63	~90	~90	NFP
10_1101-2020_12_31_424971	203	64	%	%	NN
10_1101-2020_12_31_424971	203	65	(	(	-LRB-
10_1101-2020_12_31_424971	203	66	Figures	Figures	NNP
10_1101-2020_12_31_424971	203	67	4c	4c	NNP
10_1101-2020_12_31_424971	203	68	-	-	HYPH
10_1101-2020_12_31_424971	203	69	f	f	NN
10_1101-2020_12_31_424971	203	70	,	,	,
10_1101-2020_12_31_424971	203	71	5a	5a	NNP
10_1101-2020_12_31_424971	203	72	)	)	-RRB-
10_1101-2020_12_31_424971	203	73	.	.	.
10_1101-2020_12_31_424971	204	1	This	this	DT
10_1101-2020_12_31_424971	204	2	feature	feature	NN
10_1101-2020_12_31_424971	204	3	is	be	VBZ
10_1101-2020_12_31_424971	204	4	514	514	CD
10_1101-2020_12_31_424971	204	5	observed	observe	VBN
10_1101-2020_12_31_424971	204	6	in	in	IN
10_1101-2020_12_31_424971	204	7	various	various	JJ
10_1101-2020_12_31_424971	204	8	sequence	sequence	NN
10_1101-2020_12_31_424971	204	9	contexts	contexts	NN
10_1101-2020_12_31_424971	204	10	.	.	.
10_1101-2020_12_31_424971	205	1	One	one	CD
10_1101-2020_12_31_424971	205	2	advantage	advantage	NN
10_1101-2020_12_31_424971	205	3	of	of	IN
10_1101-2020_12_31_424971	205	4	a	a	DT
10_1101-2020_12_31_424971	205	5	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	205	6	-	-	HYPH
10_1101-2020_12_31_424971	205	7	pairing	pair	VBG
10_1101-2020_12_31_424971	205	8	mechanism	mechanism	NN
10_1101-2020_12_31_424971	205	9	515	515	CD
10_1101-2020_12_31_424971	205	10	during	during	IN
10_1101-2020_12_31_424971	205	11	translocation	translocation	NN
10_1101-2020_12_31_424971	205	12	is	be	VBZ
10_1101-2020_12_31_424971	205	13	that	that	IN
10_1101-2020_12_31_424971	205	14	it	-PRON-	PRP
10_1101-2020_12_31_424971	205	15	would	would	MD
10_1101-2020_12_31_424971	205	16	enhance	enhance	VB
10_1101-2020_12_31_424971	205	17	the	the	DT
10_1101-2020_12_31_424971	205	18	thermodynamic	thermodynamic	JJ
10_1101-2020_12_31_424971	205	19	stability	stability	NN
10_1101-2020_12_31_424971	205	20	of	of	IN
10_1101-2020_12_31_424971	205	21	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	205	22	-	-	HYPH
10_1101-2020_12_31_424971	205	23	codon	codon	NNP
10_1101-2020_12_31_424971	205	24	516	516	CD
10_1101-2020_12_31_424971	205	25	pairing	pairing	NN
10_1101-2020_12_31_424971	205	26	during	during	IN
10_1101-2020_12_31_424971	205	27	the	the	DT
10_1101-2020_12_31_424971	205	28	large	large	JJ
10_1101-2020_12_31_424971	205	29	EF	EF	NNP
10_1101-2020_12_31_424971	205	30	-	-	HYPH
10_1101-2020_12_31_424971	205	31	G	G	NNP
10_1101-2020_12_31_424971	205	32	-	-	HYPH
10_1101-2020_12_31_424971	205	33	catalyzed	catalyzed	JJ
10_1101-2020_12_31_424971	205	34	conformational	conformational	JJ
10_1101-2020_12_31_424971	205	35	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	205	36	that	that	IN
10_1101-2020_12_31_424971	205	37	PRE	PRE	NNP
10_1101-2020_12_31_424971	205	38	complexes	complex	NNS
10_1101-2020_12_31_424971	205	39	517	517	CD
10_1101-2020_12_31_424971	205	40	undergo	undergo	VBP
10_1101-2020_12_31_424971	205	41	during	during	IN
10_1101-2020_12_31_424971	205	42	translocation	translocation	NN
10_1101-2020_12_31_424971	205	43	to	to	TO
10_1101-2020_12_31_424971	205	44	form	form	VB
10_1101-2020_12_31_424971	205	45	POST	POST	NNP
10_1101-2020_12_31_424971	205	46	complexes	complex	NNS
10_1101-2020_12_31_424971	205	47	.	.	.
10_1101-2020_12_31_424971	206	1	Nonetheless	nonetheless	RB
10_1101-2020_12_31_424971	206	2	,	,	,
10_1101-2020_12_31_424971	206	3	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	206	4	is	be	VBZ
10_1101-2020_12_31_424971	206	5	naturally	naturally	RB
10_1101-2020_12_31_424971	206	6	518	518	CD
10_1101-2020_12_31_424971	206	7	methylated	methylate	VBN
10_1101-2020_12_31_424971	206	8	with	with	IN
10_1101-2020_12_31_424971	206	9	m1G37	m1g37	NN
10_1101-2020_12_31_424971	206	10	(	(	-LRB-
10_1101-2020_12_31_424971	206	11	Figure	Figure	NNP
10_1101-2020_12_31_424971	206	12	1c	1c	NN
10_1101-2020_12_31_424971	206	13	)	)	-RRB-
10_1101-2020_12_31_424971	206	14	,	,	,
10_1101-2020_12_31_424971	206	15	indicating	indicate	VBG
10_1101-2020_12_31_424971	206	16	that	that	IN
10_1101-2020_12_31_424971	206	17	it	-PRON-	PRP
10_1101-2020_12_31_424971	206	18	makes	make	VBZ
10_1101-2020_12_31_424971	206	19	exclusive	exclusive	JJ
10_1101-2020_12_31_424971	206	20	use	use	NN
10_1101-2020_12_31_424971	206	21	of	of	IN
10_1101-2020_12_31_424971	206	22	the	the	DT
10_1101-2020_12_31_424971	206	23	triplet	triplet	NN
10_1101-2020_12_31_424971	206	24	-	-	HYPH
10_1101-2020_12_31_424971	206	25	slippage	slippage	NN
10_1101-2020_12_31_424971	206	26	519	519	CD
10_1101-2020_12_31_424971	206	27	mechanism	mechanism	NN
10_1101-2020_12_31_424971	206	28	in	in	IN
10_1101-2020_12_31_424971	206	29	vivo	vivo	NNP
10_1101-2020_12_31_424971	206	30	.	.	.
10_1101-2020_12_31_424971	207	1	This	this	DT
10_1101-2020_12_31_424971	207	2	mechanism	mechanism	NN
10_1101-2020_12_31_424971	207	3	is	be	VBZ
10_1101-2020_12_31_424971	207	4	likely	likely	JJ
10_1101-2020_12_31_424971	207	5	also	also	RB
10_1101-2020_12_31_424971	207	6	exclusively	exclusively	RB
10_1101-2020_12_31_424971	207	7	used	use	VBN
10_1101-2020_12_31_424971	207	8	in	in	IN
10_1101-2020_12_31_424971	207	9	vivo	vivo	NNP
10_1101-2020_12_31_424971	207	10	by	by	IN
10_1101-2020_12_31_424971	207	11	all	all	DT
10_1101-2020_12_31_424971	207	12	other	other	JJ
10_1101-2020_12_31_424971	207	13	+1	+1	:
10_1101-2020_12_31_424971	207	14	-	-	:
10_1101-2020_12_31_424971	207	15	520	520	CD
10_1101-2020_12_31_424971	207	16	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	207	17	tRNAs	trnas	CD
10_1101-2020_12_31_424971	207	18	that	that	WDT
10_1101-2020_12_31_424971	207	19	have	have	VBP
10_1101-2020_12_31_424971	207	20	evolved	evolve	VBN
10_1101-2020_12_31_424971	207	21	from	from	IN
10_1101-2020_12_31_424971	207	22	canonical	canonical	JJ
10_1101-2020_12_31_424971	207	23	tRNAs	trnas	CD
10_1101-2020_12_31_424971	207	24	to	to	TO
10_1101-2020_12_31_424971	207	25	retain	retain	VB
10_1101-2020_12_31_424971	207	26	a	a	DT
10_1101-2020_12_31_424971	207	27	purine	purine	NN
10_1101-2020_12_31_424971	207	28	at	at	IN
10_1101-2020_12_31_424971	207	29	position	position	NN
10_1101-2020_12_31_424971	207	30	37	37	CD
10_1101-2020_12_31_424971	207	31	,	,	,
10_1101-2020_12_31_424971	207	32	521	521	CD
10_1101-2020_12_31_424971	207	33	which	which	WDT
10_1101-2020_12_31_424971	207	34	is	be	VBZ
10_1101-2020_12_31_424971	207	35	almost	almost	RB
10_1101-2020_12_31_424971	207	36	universally	universally	RB
10_1101-2020_12_31_424971	207	37	post	post	JJ
10_1101-2020_12_31_424971	207	38	-	-	JJ
10_1101-2020_12_31_424971	207	39	transcriptionally	transcriptionally	RB
10_1101-2020_12_31_424971	207	40	modified	modify	VBN
10_1101-2020_12_31_424971	207	41	to	to	TO
10_1101-2020_12_31_424971	207	42	block	block	VB
10_1101-2020_12_31_424971	207	43	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	207	44	-	-	HYPH
10_1101-2020_12_31_424971	207	45	pairing	pair	VBG
10_1101-2020_12_31_424971	207	46	522	522	CD
10_1101-2020_12_31_424971	207	47	mechanisms	mechanism	NNS
10_1101-2020_12_31_424971	207	48	.	.	.
10_1101-2020_12_31_424971	208	1	523	523	CD
10_1101-2020_12_31_424971	208	2	The	the	DT
10_1101-2020_12_31_424971	208	3	key	key	JJ
10_1101-2020_12_31_424971	208	4	insight	insight	NN
10_1101-2020_12_31_424971	208	5	from	from	IN
10_1101-2020_12_31_424971	208	6	this	this	DT
10_1101-2020_12_31_424971	208	7	work	work	NN
10_1101-2020_12_31_424971	208	8	suggests	suggest	VBZ
10_1101-2020_12_31_424971	208	9	an	an	DT
10_1101-2020_12_31_424971	208	10	entirely	entirely	RB
10_1101-2020_12_31_424971	208	11	novel	novel	JJ
10_1101-2020_12_31_424971	208	12	pathway	pathway	NN
10_1101-2020_12_31_424971	208	13	to	to	TO
10_1101-2020_12_31_424971	208	14	increase	increase	VB
10_1101-2020_12_31_424971	208	15	the	the	DT
10_1101-2020_12_31_424971	208	16	efficiency	efficiency	NN
10_1101-2020_12_31_424971	208	17	524	524	CD
10_1101-2020_12_31_424971	208	18	of	of	IN
10_1101-2020_12_31_424971	208	19	genome	genome	NN
10_1101-2020_12_31_424971	208	20	recoding	recode	VBG
10_1101-2020_12_31_424971	208	21	at	at	IN
10_1101-2020_12_31_424971	208	22	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	208	23	codons	codon	NNS
10_1101-2020_12_31_424971	208	24	.	.	.
10_1101-2020_12_31_424971	209	1	While	while	IN
10_1101-2020_12_31_424971	209	2	initial	initial	JJ
10_1101-2020_12_31_424971	209	3	success	success	NN
10_1101-2020_12_31_424971	209	4	in	in	IN
10_1101-2020_12_31_424971	209	5	genome	genome	JJ
10_1101-2020_12_31_424971	209	6	recoding	recoding	NN
10_1101-2020_12_31_424971	209	7	has	have	VBZ
10_1101-2020_12_31_424971	209	8	been	be	VBN
10_1101-2020_12_31_424971	209	9	525	525	CD
10_1101-2020_12_31_424971	209	10	achieved	achieve	VBN
10_1101-2020_12_31_424971	209	11	by	by	IN
10_1101-2020_12_31_424971	209	12	engineering	engineer	VBG
10_1101-2020_12_31_424971	209	13	the	the	DT
10_1101-2020_12_31_424971	209	14	anticodon	anticodon	NN
10_1101-2020_12_31_424971	209	15	-	-	HYPH
10_1101-2020_12_31_424971	209	16	codon	codon	NN
10_1101-2020_12_31_424971	209	17	interactions	interaction	NNS
10_1101-2020_12_31_424971	209	18	of	of	IN
10_1101-2020_12_31_424971	209	19	a	a	DT
10_1101-2020_12_31_424971	209	20	+1-frameshifting	+1-frameshifting	NN
10_1101-2020_12_31_424971	209	21	-	-	HYPH
10_1101-2020_12_31_424971	209	22	inducing	induce	VBG
10_1101-2020_12_31_424971	209	23	tRNA	trna	NN
10_1101-2020_12_31_424971	209	24	at	at	IN
10_1101-2020_12_31_424971	209	25	526	526	CD
10_1101-2020_12_31_424971	209	26	the	the	DT
10_1101-2020_12_31_424971	209	27	A	A	NNP
10_1101-2020_12_31_424971	209	28	site6,53	site6,53	NNP
10_1101-2020_12_31_424971	209	29	,	,	,
10_1101-2020_12_31_424971	209	30	or	or	CC
10_1101-2020_12_31_424971	209	31	by	by	IN
10_1101-2020_12_31_424971	209	32	engineering	engineer	VBG
10_1101-2020_12_31_424971	209	33	a	a	DT
10_1101-2020_12_31_424971	209	34	new	new	JJ
10_1101-2020_12_31_424971	209	35	bacterial	bacterial	JJ
10_1101-2020_12_31_424971	209	36	genome	genome	NN
10_1101-2020_12_31_424971	209	37	with	with	IN
10_1101-2020_12_31_424971	209	38	a	a	DT
10_1101-2020_12_31_424971	209	39	minimal	minimal	JJ
10_1101-2020_12_31_424971	209	40	set	set	NN
10_1101-2020_12_31_424971	209	41	of	of	IN
10_1101-2020_12_31_424971	209	42	codons	codon	NNS
10_1101-2020_12_31_424971	209	43	for	for	IN
10_1101-2020_12_31_424971	209	44	all	all	DT
10_1101-2020_12_31_424971	209	45	amino	amino	NN
10_1101-2020_12_31_424971	209	46	527	527	CD
10_1101-2020_12_31_424971	209	47	acids54	acids54	NNPS
10_1101-2020_12_31_424971	209	48	,	,	,
10_1101-2020_12_31_424971	209	49	we	-PRON-	PRP
10_1101-2020_12_31_424971	209	50	suggest	suggest	VBP
10_1101-2020_12_31_424971	209	51	that	that	IN
10_1101-2020_12_31_424971	209	52	efforts	effort	NNS
10_1101-2020_12_31_424971	209	53	to	to	TO
10_1101-2020_12_31_424971	209	54	engineer	engineer	VB
10_1101-2020_12_31_424971	209	55	the	the	DT
10_1101-2020_12_31_424971	209	56	‘	'	``
10_1101-2020_12_31_424971	209	57	neck	neck	NN
10_1101-2020_12_31_424971	209	58	’	'	''
10_1101-2020_12_31_424971	209	59	structural	structural	JJ
10_1101-2020_12_31_424971	209	60	element	element	NN
10_1101-2020_12_31_424971	209	61	of	of	IN
10_1101-2020_12_31_424971	209	62	the	the	DT
10_1101-2020_12_31_424971	209	63	30S	30s	CD
10_1101-2020_12_31_424971	209	64	subunit	subunit	NN
10_1101-2020_12_31_424971	209	65	that	that	IN
10_1101-2020_12_31_424971	209	66	528	528	CD
10_1101-2020_12_31_424971	209	67	regulates	regulate	NNS
10_1101-2020_12_31_424971	209	68	head	head	NN
10_1101-2020_12_31_424971	209	69	swiveling	swiveling	NN
10_1101-2020_12_31_424971	209	70	would	would	MD
10_1101-2020_12_31_424971	209	71	be	be	VB
10_1101-2020_12_31_424971	209	72	as	as	RB
10_1101-2020_12_31_424971	209	73	,	,	,
10_1101-2020_12_31_424971	209	74	or	or	CC
10_1101-2020_12_31_424971	209	75	even	even	RB
10_1101-2020_12_31_424971	209	76	more	more	JJR
10_1101-2020_12_31_424971	209	77	,	,	,
10_1101-2020_12_31_424971	209	78	effective	effective	JJ
10_1101-2020_12_31_424971	209	79	.	.	.
10_1101-2020_12_31_424971	210	1	This	this	DT
10_1101-2020_12_31_424971	210	2	can	can	MD
10_1101-2020_12_31_424971	210	3	be	be	VB
10_1101-2020_12_31_424971	210	4	achieved	achieve	VBN
10_1101-2020_12_31_424971	210	5	by	by	IN
10_1101-2020_12_31_424971	210	6	screening	screen	VBG
10_1101-2020_12_31_424971	210	7	529	529	CD
10_1101-2020_12_31_424971	210	8	for	for	IN
10_1101-2020_12_31_424971	210	9	30S	30s	CD
10_1101-2020_12_31_424971	210	10	subunit	subunit	NN
10_1101-2020_12_31_424971	210	11	variants	variant	NNS
10_1101-2020_12_31_424971	210	12	that	that	WDT
10_1101-2020_12_31_424971	210	13	exhibit	exhibit	VBP
10_1101-2020_12_31_424971	210	14	high	high	JJ
10_1101-2020_12_31_424971	210	15	+1-frameshifting	+1-frameshifting	JJ
10_1101-2020_12_31_424971	210	16	efficiencies	efficiency	NNS
10_1101-2020_12_31_424971	210	17	mediated	mediate	VBN
10_1101-2020_12_31_424971	210	18	by	by	IN
10_1101-2020_12_31_424971	210	19	+1	+1	NNPS
10_1101-2020_12_31_424971	210	20	-	-	:
10_1101-2020_12_31_424971	210	21	530	530	CD
10_1101-2020_12_31_424971	210	22	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	210	23	tRNAs	trnas	CD
10_1101-2020_12_31_424971	210	24	at	at	IN
10_1101-2020_12_31_424971	210	25	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	210	26	codons	codon	NNS
10_1101-2020_12_31_424971	210	27	while	while	IN
10_1101-2020_12_31_424971	210	28	preserving	preserve	VBG
10_1101-2020_12_31_424971	210	29	0-frame	0-frame	CD
10_1101-2020_12_31_424971	210	30	translation	translation	NN
10_1101-2020_12_31_424971	210	31	by	by	IN
10_1101-2020_12_31_424971	210	32	canonical	canonical	JJ
10_1101-2020_12_31_424971	210	33	531	531	CD
10_1101-2020_12_31_424971	210	34	tRNAs	trnas	CD
10_1101-2020_12_31_424971	210	35	at	at	IN
10_1101-2020_12_31_424971	210	36	triplet	triplet	NN
10_1101-2020_12_31_424971	210	37	codons	codon	NNS
10_1101-2020_12_31_424971	210	38	.	.	.
10_1101-2020_12_31_424971	211	1	Specifically	specifically	RB
10_1101-2020_12_31_424971	211	2	,	,	,
10_1101-2020_12_31_424971	211	3	head	head	NN
10_1101-2020_12_31_424971	211	4	swiveling	swiveling	NN
10_1101-2020_12_31_424971	211	5	is	be	VBZ
10_1101-2020_12_31_424971	211	6	driven	drive	VBN
10_1101-2020_12_31_424971	211	7	by	by	IN
10_1101-2020_12_31_424971	211	8	the	the	DT
10_1101-2020_12_31_424971	211	9	synergistic	synergistic	JJ
10_1101-2020_12_31_424971	211	10	action	action	NN
10_1101-2020_12_31_424971	211	11	of	of	IN
10_1101-2020_12_31_424971	211	12	two	two	CD
10_1101-2020_12_31_424971	211	13	532	532	CD
10_1101-2020_12_31_424971	211	14	hinges	hinge	NNS
10_1101-2020_12_31_424971	211	15	within	within	IN
10_1101-2020_12_31_424971	211	16	the	the	DT
10_1101-2020_12_31_424971	211	17	16S	16s	CD
10_1101-2020_12_31_424971	211	18	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	211	19	RNA	RNA	NNP
10_1101-2020_12_31_424971	211	20	elements	element	NNS
10_1101-2020_12_31_424971	211	21	that	that	WDT
10_1101-2020_12_31_424971	211	22	comprise	comprise	VBP
10_1101-2020_12_31_424971	211	23	the	the	DT
10_1101-2020_12_31_424971	211	24	30S	30s	CD
10_1101-2020_12_31_424971	211	25	subunit	subunit	NN
10_1101-2020_12_31_424971	211	26	neck55	neck55	NN
10_1101-2020_12_31_424971	211	27	.	.	.
10_1101-2020_12_31_424971	212	1	Hinge	hinge	NN
10_1101-2020_12_31_424971	212	2	1	1	CD
10_1101-2020_12_31_424971	212	3	is	be	VBZ
10_1101-2020_12_31_424971	212	4	533	533	CD
10_1101-2020_12_31_424971	212	5	.CC	.CC	:
10_1101-2020_12_31_424971	212	6	-	-	HYPH
10_1101-2020_12_31_424971	212	7	BY	by	IN
10_1101-2020_12_31_424971	212	8	-	-	HYPH
10_1101-2020_12_31_424971	212	9	NC	NC	NNP
10_1101-2020_12_31_424971	212	10	-	-	HYPH
10_1101-2020_12_31_424971	212	11	ND	ND	NNP
10_1101-2020_12_31_424971	212	12	4.0	4.0	CD
10_1101-2020_12_31_424971	212	13	International	International	NNP
10_1101-2020_12_31_424971	212	14	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	212	15	under	under	IN
10_1101-2020_12_31_424971	212	16	a	a	DT
10_1101-2020_12_31_424971	212	17	(	(	-LRB-
10_1101-2020_12_31_424971	212	18	which	which	WDT
10_1101-2020_12_31_424971	212	19	was	be	VBD
10_1101-2020_12_31_424971	212	20	not	not	RB
10_1101-2020_12_31_424971	212	21	certified	certify	VBN
10_1101-2020_12_31_424971	212	22	by	by	IN
10_1101-2020_12_31_424971	212	23	peer	peer	NN
10_1101-2020_12_31_424971	212	24	review	review	NN
10_1101-2020_12_31_424971	212	25	)	)	-RRB-
10_1101-2020_12_31_424971	212	26	is	be	VBZ
10_1101-2020_12_31_424971	212	27	the	the	DT
10_1101-2020_12_31_424971	212	28	author	author	NN
10_1101-2020_12_31_424971	212	29	/	/	SYM
10_1101-2020_12_31_424971	212	30	funder	funder	NN
10_1101-2020_12_31_424971	212	31	,	,	,
10_1101-2020_12_31_424971	212	32	who	who	WP
10_1101-2020_12_31_424971	212	33	has	have	VBZ
10_1101-2020_12_31_424971	212	34	granted	grant	VBN
10_1101-2020_12_31_424971	212	35	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	212	36	a	a	DT
10_1101-2020_12_31_424971	212	37	license	license	NN
10_1101-2020_12_31_424971	212	38	to	to	TO
10_1101-2020_12_31_424971	212	39	display	display	VB
10_1101-2020_12_31_424971	212	40	the	the	DT
10_1101-2020_12_31_424971	212	41	preprint	preprint	NN
10_1101-2020_12_31_424971	212	42	in	in	IN
10_1101-2020_12_31_424971	212	43	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	212	44	.	.	.
10_1101-2020_12_31_424971	213	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	213	2	is	be	VBZ
10_1101-2020_12_31_424971	213	3	made	make	VBN
10_1101-2020_12_31_424971	213	4	The	the	DT
10_1101-2020_12_31_424971	213	5	copyright	copyright	NN
10_1101-2020_12_31_424971	213	6	holder	holder	NN
10_1101-2020_12_31_424971	213	7	for	for	IN
10_1101-2020_12_31_424971	213	8	this	this	DT
10_1101-2020_12_31_424971	213	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	213	10	version	version	NN
10_1101-2020_12_31_424971	213	11	posted	post	VBD
10_1101-2020_12_31_424971	213	12	January	January	NNP
10_1101-2020_12_31_424971	213	13	2	2	CD
10_1101-2020_12_31_424971	213	14	,	,	,
10_1101-2020_12_31_424971	213	15	2021	2021	CD
10_1101-2020_12_31_424971	213	16	.	.	.
10_1101-2020_12_31_424971	213	17	;	;	:
10_1101-2020_12_31_424971	213	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	213	19	:	:	:
10_1101-2020_12_31_424971	213	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	213	21	preprint	preprint	NN
10_1101-2020_12_31_424971	213	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	213	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	213	24	22	22	CD
10_1101-2020_12_31_424971	213	25	composed	compose	VBN
10_1101-2020_12_31_424971	213	26	of	of	IN
10_1101-2020_12_31_424971	213	27	two	two	CD
10_1101-2020_12_31_424971	213	28	G	G	NNP
10_1101-2020_12_31_424971	213	29	-	-	HYPH
10_1101-2020_12_31_424971	213	30	U	u	NN
10_1101-2020_12_31_424971	213	31	wobble	wobble	JJ
10_1101-2020_12_31_424971	213	32	base	base	NN
10_1101-2020_12_31_424971	213	33	pairs	pair	NNS
10_1101-2020_12_31_424971	213	34	that	that	WDT
10_1101-2020_12_31_424971	213	35	are	be	VBP
10_1101-2020_12_31_424971	213	36	separated	separate	VBN
10_1101-2020_12_31_424971	213	37	by	by	IN
10_1101-2020_12_31_424971	213	38	a	a	DT
10_1101-2020_12_31_424971	213	39	bulged	bulge	VBN
10_1101-2020_12_31_424971	213	40	G	g	NN
10_1101-2020_12_31_424971	213	41	within	within	IN
10_1101-2020_12_31_424971	213	42	helix	helix	NN
10_1101-2020_12_31_424971	213	43	28	28	CD
10_1101-2020_12_31_424971	213	44	(	(	-LRB-
10_1101-2020_12_31_424971	213	45	h28	h28	NN
10_1101-2020_12_31_424971	213	46	)	)	-RRB-
10_1101-2020_12_31_424971	213	47	,	,	,
10_1101-2020_12_31_424971	213	48	534	534	CD
10_1101-2020_12_31_424971	213	49	while	while	IN
10_1101-2020_12_31_424971	213	50	hinge	hinge	NN
10_1101-2020_12_31_424971	213	51	2	2	CD
10_1101-2020_12_31_424971	213	52	is	be	VBZ
10_1101-2020_12_31_424971	213	53	composed	compose	VBN
10_1101-2020_12_31_424971	213	54	of	of	IN
10_1101-2020_12_31_424971	213	55	a	a	DT
10_1101-2020_12_31_424971	213	56	GACU	GACU	NNP
10_1101-2020_12_31_424971	213	57	linker	linker	NN
10_1101-2020_12_31_424971	213	58	between	between	IN
10_1101-2020_12_31_424971	213	59	h34	h34	NN
10_1101-2020_12_31_424971	213	60	and	and	CC
10_1101-2020_12_31_424971	213	61	h35/36	h35/36	ADD
10_1101-2020_12_31_424971	213	62	within	within	IN
10_1101-2020_12_31_424971	213	63	a	a	DT
10_1101-2020_12_31_424971	213	64	three	three	CD
10_1101-2020_12_31_424971	213	65	-	-	HYPH
10_1101-2020_12_31_424971	213	66	helical	helical	JJ
10_1101-2020_12_31_424971	213	67	535	535	CD
10_1101-2020_12_31_424971	213	68	junction	junction	NN
10_1101-2020_12_31_424971	213	69	with	with	IN
10_1101-2020_12_31_424971	213	70	h38	h38	NN
10_1101-2020_12_31_424971	213	71	.	.	.
10_1101-2020_12_31_424971	214	1	Co	Co	NNS
10_1101-2020_12_31_424971	214	2	-	-	VB
10_1101-2020_12_31_424971	214	3	engineering	engineer	VBG
10_1101-2020_12_31_424971	214	4	these	these	DT
10_1101-2020_12_31_424971	214	5	two	two	CD
10_1101-2020_12_31_424971	214	6	hinges	hinge	NNS
10_1101-2020_12_31_424971	214	7	by	by	IN
10_1101-2020_12_31_424971	214	8	directed	direct	VBN
10_1101-2020_12_31_424971	214	9	evolution	evolution	NN
10_1101-2020_12_31_424971	214	10	should	should	MD
10_1101-2020_12_31_424971	214	11	identify	identify	VB
10_1101-2020_12_31_424971	214	12	such	such	JJ
10_1101-2020_12_31_424971	214	13	30S	30S	NNP
10_1101-2020_12_31_424971	214	14	536	536	CD
10_1101-2020_12_31_424971	214	15	subunit	subunit	NN
10_1101-2020_12_31_424971	214	16	variants	variant	NNS
10_1101-2020_12_31_424971	214	17	.	.	.
10_1101-2020_12_31_424971	215	1	To	to	TO
10_1101-2020_12_31_424971	215	2	complement	complement	VB
10_1101-2020_12_31_424971	215	3	the	the	DT
10_1101-2020_12_31_424971	215	4	directed	direct	VBN
10_1101-2020_12_31_424971	215	5	evolution	evolution	NN
10_1101-2020_12_31_424971	215	6	approach	approach	NN
10_1101-2020_12_31_424971	215	7	,	,	,
10_1101-2020_12_31_424971	215	8	we	-PRON-	PRP
10_1101-2020_12_31_424971	215	9	suggest	suggest	VBP
10_1101-2020_12_31_424971	215	10	that	that	IN
10_1101-2020_12_31_424971	215	11	our	-PRON-	PRP$
10_1101-2020_12_31_424971	215	12	recently	recently	RB
10_1101-2020_12_31_424971	215	13	537	537	CD
10_1101-2020_12_31_424971	215	14	developed	develop	VBN
10_1101-2020_12_31_424971	215	15	time	time	NN
10_1101-2020_12_31_424971	215	16	-	-	HYPH
10_1101-2020_12_31_424971	215	17	resolved	resolve	VBN
10_1101-2020_12_31_424971	215	18	cryogenic	cryogenic	JJ
10_1101-2020_12_31_424971	215	19	electron	electron	NN
10_1101-2020_12_31_424971	215	20	microscopy	microscopy	NN
10_1101-2020_12_31_424971	215	21	(	(	-LRB-
10_1101-2020_12_31_424971	215	22	TR	TR	NNP
10_1101-2020_12_31_424971	215	23	cryo	cryo	JJ
10_1101-2020_12_31_424971	215	24	-	-	HYPH
10_1101-2020_12_31_424971	215	25	EM	em	NN
10_1101-2020_12_31_424971	215	26	)	)	-RRB-
10_1101-2020_12_31_424971	215	27	method56,57	method56,57	NN
10_1101-2020_12_31_424971	215	28	can	can	MD
10_1101-2020_12_31_424971	215	29	be	be	VB
10_1101-2020_12_31_424971	215	30	used	use	VBN
10_1101-2020_12_31_424971	215	31	538	538	CD
10_1101-2020_12_31_424971	215	32	to	to	TO
10_1101-2020_12_31_424971	215	33	obtain	obtain	VB
10_1101-2020_12_31_424971	215	34	structures	structure	NNS
10_1101-2020_12_31_424971	215	35	of	of	IN
10_1101-2020_12_31_424971	215	36	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	215	37	and	and	CC
10_1101-2020_12_31_424971	215	38	ProL	ProL	NNP
10_1101-2020_12_31_424971	215	39	in	in	IN
10_1101-2020_12_31_424971	215	40	EF	EF	NNP
10_1101-2020_12_31_424971	215	41	-	-	HYPH
10_1101-2020_12_31_424971	215	42	G	G	NNP
10_1101-2020_12_31_424971	215	43	-	-	HYPH
10_1101-2020_12_31_424971	215	44	bound	bind	VBN
10_1101-2020_12_31_424971	215	45	PRE	PRE	NNP
10_1101-2020_12_31_424971	215	46	complexes	complex	NNS
10_1101-2020_12_31_424971	215	47	captured	capture	VBN
10_1101-2020_12_31_424971	215	48	in	in	IN
10_1101-2020_12_31_424971	215	49	intermediate	intermediate	JJ
10_1101-2020_12_31_424971	215	50	539	539	CD
10_1101-2020_12_31_424971	215	51	states	state	NNS
10_1101-2020_12_31_424971	215	52	of	of	IN
10_1101-2020_12_31_424971	215	53	translocation	translocation	NN
10_1101-2020_12_31_424971	215	54	.	.	.
10_1101-2020_12_31_424971	216	1	Such	such	JJ
10_1101-2020_12_31_424971	216	2	cryo	cryo	JJ
10_1101-2020_12_31_424971	216	3	-	-	HYPH
10_1101-2020_12_31_424971	216	4	EM	em	NN
10_1101-2020_12_31_424971	216	5	structures	structure	NNS
10_1101-2020_12_31_424971	216	6	would	would	MD
10_1101-2020_12_31_424971	216	7	help	help	VB
10_1101-2020_12_31_424971	216	8	further	far	RBR
10_1101-2020_12_31_424971	216	9	define	define	VB
10_1101-2020_12_31_424971	216	10	how	how	WRB
10_1101-2020_12_31_424971	216	11	the	the	DT
10_1101-2020_12_31_424971	216	12	two	two	CD
10_1101-2020_12_31_424971	216	13	hinges	hinge	NNS
10_1101-2020_12_31_424971	216	14	540	540	CD
10_1101-2020_12_31_424971	216	15	that	that	DT
10_1101-2020_12_31_424971	216	16	control	control	NN
10_1101-2020_12_31_424971	216	17	head	head	NN
10_1101-2020_12_31_424971	216	18	swiveling	swivel	VBG
10_1101-2020_12_31_424971	216	19	are	be	VBP
10_1101-2020_12_31_424971	216	20	differentially	differentially	RB
10_1101-2020_12_31_424971	216	21	modulated	modulate	VBN
10_1101-2020_12_31_424971	216	22	during	during	IN
10_1101-2020_12_31_424971	216	23	translocation	translocation	NN
10_1101-2020_12_31_424971	216	24	of	of	IN
10_1101-2020_12_31_424971	216	25	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	216	26	vs.	vs.	IN
10_1101-2020_12_31_424971	216	27	ProL	ProL	NNP
10_1101-2020_12_31_424971	216	28	to	to	IN
10_1101-2020_12_31_424971	216	29	541	541	CD
10_1101-2020_12_31_424971	216	30	provide	provide	VB
10_1101-2020_12_31_424971	216	31	a	a	DT
10_1101-2020_12_31_424971	216	32	structure	structure	NN
10_1101-2020_12_31_424971	216	33	-	-	HYPH
10_1101-2020_12_31_424971	216	34	based	base	VBN
10_1101-2020_12_31_424971	216	35	roadmap	roadmap	NNP
10_1101-2020_12_31_424971	216	36	for	for	IN
10_1101-2020_12_31_424971	216	37	engineering	engineer	VBG
10_1101-2020_12_31_424971	216	38	them	-PRON-	PRP
10_1101-2020_12_31_424971	216	39	.	.	.
10_1101-2020_12_31_424971	217	1	In	in	IN
10_1101-2020_12_31_424971	217	2	addition	addition	NN
10_1101-2020_12_31_424971	217	3	,	,	,
10_1101-2020_12_31_424971	217	4	detailed	detailed	JJ
10_1101-2020_12_31_424971	217	5	comparison	comparison	NN
10_1101-2020_12_31_424971	217	6	of	of	IN
10_1101-2020_12_31_424971	217	7	such	such	JJ
10_1101-2020_12_31_424971	217	8	542	542	CD
10_1101-2020_12_31_424971	217	9	structures	structure	NNS
10_1101-2020_12_31_424971	217	10	would	would	MD
10_1101-2020_12_31_424971	217	11	offer	offer	VB
10_1101-2020_12_31_424971	217	12	the	the	DT
10_1101-2020_12_31_424971	217	13	opportunity	opportunity	NN
10_1101-2020_12_31_424971	217	14	to	to	TO
10_1101-2020_12_31_424971	217	15	identify	identify	VB
10_1101-2020_12_31_424971	217	16	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	217	17	structural	structural	JJ
10_1101-2020_12_31_424971	217	18	elements	element	NNS
10_1101-2020_12_31_424971	217	19	beyond	beyond	IN
10_1101-2020_12_31_424971	217	20	the	the	DT
10_1101-2020_12_31_424971	217	21	two	two	CD
10_1101-2020_12_31_424971	217	22	543	543	CD
10_1101-2020_12_31_424971	217	23	hinges	hinge	NNS
10_1101-2020_12_31_424971	217	24	that	that	WDT
10_1101-2020_12_31_424971	217	25	play	play	VBP
10_1101-2020_12_31_424971	217	26	a	a	DT
10_1101-2020_12_31_424971	217	27	role	role	NN
10_1101-2020_12_31_424971	217	28	in	in	IN
10_1101-2020_12_31_424971	217	29	+1	+1	NNS
10_1101-2020_12_31_424971	217	30	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	217	31	and	and	CC
10_1101-2020_12_31_424971	217	32	can	can	MD
10_1101-2020_12_31_424971	217	33	thus	thus	RB
10_1101-2020_12_31_424971	217	34	serve	serve	VB
10_1101-2020_12_31_424971	217	35	as	as	IN
10_1101-2020_12_31_424971	217	36	additional	additional	JJ
10_1101-2020_12_31_424971	217	37	targets	target	NNS
10_1101-2020_12_31_424971	217	38	for	for	IN
10_1101-2020_12_31_424971	217	39	engineering	engineering	NN
10_1101-2020_12_31_424971	217	40	.	.	.
10_1101-2020_12_31_424971	218	1	544	544	CD
10_1101-2020_12_31_424971	218	2	Furthermore	furthermore	RB
10_1101-2020_12_31_424971	218	3	,	,	,
10_1101-2020_12_31_424971	218	4	antibiotics	antibiotic	NNS
10_1101-2020_12_31_424971	218	5	that	that	WDT
10_1101-2020_12_31_424971	218	6	bind	bind	VBP
10_1101-2020_12_31_424971	218	7	to	to	IN
10_1101-2020_12_31_424971	218	8	the	the	DT
10_1101-2020_12_31_424971	218	9	30S	30s	CD
10_1101-2020_12_31_424971	218	10	subunit	subunit	NN
10_1101-2020_12_31_424971	218	11	and	and	CC
10_1101-2020_12_31_424971	218	12	act	act	VB
10_1101-2020_12_31_424971	218	13	as	as	IN
10_1101-2020_12_31_424971	218	14	translocation	translocation	NN
10_1101-2020_12_31_424971	218	15	modulators	modulator	NNS
10_1101-2020_12_31_424971	218	16	can	can	MD
10_1101-2020_12_31_424971	218	17	be	be	VB
10_1101-2020_12_31_424971	218	18	545	545	CD
10_1101-2020_12_31_424971	218	19	exploited	exploit	VBN
10_1101-2020_12_31_424971	218	20	to	to	TO
10_1101-2020_12_31_424971	218	21	further	further	RB
10_1101-2020_12_31_424971	218	22	increase	increase	VB
10_1101-2020_12_31_424971	218	23	the	the	DT
10_1101-2020_12_31_424971	218	24	+1-frameshifting	+1-frameshifting	JJ
10_1101-2020_12_31_424971	218	25	efficiency	efficiency	NN
10_1101-2020_12_31_424971	218	26	at	at	IN
10_1101-2020_12_31_424971	218	27	a	a	DT
10_1101-2020_12_31_424971	218	28	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	218	29	codon	codon	NN
10_1101-2020_12_31_424971	218	30	with	with	IN
10_1101-2020_12_31_424971	218	31	either	either	DT
10_1101-2020_12_31_424971	218	32	546	546	CD
10_1101-2020_12_31_424971	218	33	wildtype	wildtype	NN
10_1101-2020_12_31_424971	218	34	or	or	CC
10_1101-2020_12_31_424971	218	35	highly	highly	RB
10_1101-2020_12_31_424971	218	36	efficient	efficient	JJ
10_1101-2020_12_31_424971	218	37	30S	30s	CD
10_1101-2020_12_31_424971	218	38	subunit	subunit	NN
10_1101-2020_12_31_424971	218	39	variants	variant	NNS
10_1101-2020_12_31_424971	218	40	.	.	.
10_1101-2020_12_31_424971	219	1	Implemented	implement	VBN
10_1101-2020_12_31_424971	219	2	in	in	IN
10_1101-2020_12_31_424971	219	3	combination	combination	NN
10_1101-2020_12_31_424971	219	4	and	and	CC
10_1101-2020_12_31_424971	219	5	integrated	integrate	VBN
10_1101-2020_12_31_424971	219	6	into	into	IN
10_1101-2020_12_31_424971	219	7	547	547	CD
10_1101-2020_12_31_424971	219	8	a	a	DT
10_1101-2020_12_31_424971	219	9	recently	recently	RB
10_1101-2020_12_31_424971	219	10	described	describe	VBN
10_1101-2020_12_31_424971	219	11	in	in	IN
10_1101-2020_12_31_424971	219	12	vivo	vivo	NNP
10_1101-2020_12_31_424971	219	13	‘	'	``
10_1101-2020_12_31_424971	219	14	designer	designer	NN
10_1101-2020_12_31_424971	219	15	organelle	organelle	NNP
10_1101-2020_12_31_424971	219	16	’	'	''
10_1101-2020_12_31_424971	219	17	strategy58	strategy58	NNP
10_1101-2020_12_31_424971	219	18	,	,	,
10_1101-2020_12_31_424971	219	19	these	these	DT
10_1101-2020_12_31_424971	219	20	approaches	approach	NNS
10_1101-2020_12_31_424971	219	21	should	should	MD
10_1101-2020_12_31_424971	219	22	provide	provide	VB
10_1101-2020_12_31_424971	219	23	a	a	DT
10_1101-2020_12_31_424971	219	24	548	548	CD
10_1101-2020_12_31_424971	219	25	novel	novel	NN
10_1101-2020_12_31_424971	219	26	and	and	CC
10_1101-2020_12_31_424971	219	27	powerful	powerful	JJ
10_1101-2020_12_31_424971	219	28	platform	platform	NN
10_1101-2020_12_31_424971	219	29	for	for	IN
10_1101-2020_12_31_424971	219	30	increasing	increase	VBG
10_1101-2020_12_31_424971	219	31	the	the	DT
10_1101-2020_12_31_424971	219	32	efficiency	efficiency	NN
10_1101-2020_12_31_424971	219	33	of	of	IN
10_1101-2020_12_31_424971	219	34	genome	genome	JJ
10_1101-2020_12_31_424971	219	35	recoding	recode	VBG
10_1101-2020_12_31_424971	219	36	at	at	IN
10_1101-2020_12_31_424971	219	37	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	219	38	codons	codon	NNS
10_1101-2020_12_31_424971	219	39	549	549	CD
10_1101-2020_12_31_424971	219	40	with	with	IN
10_1101-2020_12_31_424971	219	41	minimal	minimal	JJ
10_1101-2020_12_31_424971	219	42	off	off	JJ
10_1101-2020_12_31_424971	219	43	-	-	HYPH
10_1101-2020_12_31_424971	219	44	target	target	NN
10_1101-2020_12_31_424971	219	45	effects	effect	NNS
10_1101-2020_12_31_424971	219	46	.	.	.
10_1101-2020_12_31_424971	220	1	550	550	CD
10_1101-2020_12_31_424971	220	2	.CC	.CC	:
10_1101-2020_12_31_424971	220	3	-	-	HYPH
10_1101-2020_12_31_424971	220	4	BY	by	IN
10_1101-2020_12_31_424971	220	5	-	-	HYPH
10_1101-2020_12_31_424971	220	6	NC	NC	NNP
10_1101-2020_12_31_424971	220	7	-	-	HYPH
10_1101-2020_12_31_424971	220	8	ND	ND	NNP
10_1101-2020_12_31_424971	220	9	4.0	4.0	CD
10_1101-2020_12_31_424971	220	10	International	International	NNP
10_1101-2020_12_31_424971	220	11	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	220	12	under	under	IN
10_1101-2020_12_31_424971	220	13	a	a	DT
10_1101-2020_12_31_424971	220	14	(	(	-LRB-
10_1101-2020_12_31_424971	220	15	which	which	WDT
10_1101-2020_12_31_424971	220	16	was	be	VBD
10_1101-2020_12_31_424971	220	17	not	not	RB
10_1101-2020_12_31_424971	220	18	certified	certify	VBN
10_1101-2020_12_31_424971	220	19	by	by	IN
10_1101-2020_12_31_424971	220	20	peer	peer	NN
10_1101-2020_12_31_424971	220	21	review	review	NN
10_1101-2020_12_31_424971	220	22	)	)	-RRB-
10_1101-2020_12_31_424971	220	23	is	be	VBZ
10_1101-2020_12_31_424971	220	24	the	the	DT
10_1101-2020_12_31_424971	220	25	author	author	NN
10_1101-2020_12_31_424971	220	26	/	/	SYM
10_1101-2020_12_31_424971	220	27	funder	funder	NN
10_1101-2020_12_31_424971	220	28	,	,	,
10_1101-2020_12_31_424971	220	29	who	who	WP
10_1101-2020_12_31_424971	220	30	has	have	VBZ
10_1101-2020_12_31_424971	220	31	granted	grant	VBN
10_1101-2020_12_31_424971	220	32	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	220	33	a	a	DT
10_1101-2020_12_31_424971	220	34	license	license	NN
10_1101-2020_12_31_424971	220	35	to	to	TO
10_1101-2020_12_31_424971	220	36	display	display	VB
10_1101-2020_12_31_424971	220	37	the	the	DT
10_1101-2020_12_31_424971	220	38	preprint	preprint	NN
10_1101-2020_12_31_424971	220	39	in	in	IN
10_1101-2020_12_31_424971	220	40	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	220	41	.	.	.
10_1101-2020_12_31_424971	221	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	221	2	is	be	VBZ
10_1101-2020_12_31_424971	221	3	made	make	VBN
10_1101-2020_12_31_424971	221	4	The	the	DT
10_1101-2020_12_31_424971	221	5	copyright	copyright	NN
10_1101-2020_12_31_424971	221	6	holder	holder	NN
10_1101-2020_12_31_424971	221	7	for	for	IN
10_1101-2020_12_31_424971	221	8	this	this	DT
10_1101-2020_12_31_424971	221	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	221	10	version	version	NN
10_1101-2020_12_31_424971	221	11	posted	post	VBD
10_1101-2020_12_31_424971	221	12	January	January	NNP
10_1101-2020_12_31_424971	221	13	2	2	CD
10_1101-2020_12_31_424971	221	14	,	,	,
10_1101-2020_12_31_424971	221	15	2021	2021	CD
10_1101-2020_12_31_424971	221	16	.	.	.
10_1101-2020_12_31_424971	221	17	;	;	:
10_1101-2020_12_31_424971	221	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	221	19	:	:	:
10_1101-2020_12_31_424971	221	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	221	21	preprint	preprint	NN
10_1101-2020_12_31_424971	221	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	221	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	221	24	23	23	CD
10_1101-2020_12_31_424971	221	25	METHODS	METHODS	NNP
10_1101-2020_12_31_424971	221	26	551	551	CD
10_1101-2020_12_31_424971	221	27	Construction	construction	NN
10_1101-2020_12_31_424971	221	28	of	of	IN
10_1101-2020_12_31_424971	221	29	E.	E.	NNP
10_1101-2020_12_31_424971	221	30	coli	coli	NNS
10_1101-2020_12_31_424971	221	31	strains	strain	NNS
10_1101-2020_12_31_424971	221	32	.	.	.
10_1101-2020_12_31_424971	222	1	E.	E.	NNP
10_1101-2020_12_31_424971	222	2	coli	coli	NNS
10_1101-2020_12_31_424971	222	3	strains	strain	NNS
10_1101-2020_12_31_424971	222	4	that	that	WDT
10_1101-2020_12_31_424971	222	5	expressed	express	VBD
10_1101-2020_12_31_424971	222	6	a	a	DT
10_1101-2020_12_31_424971	222	7	plasmid	plasmid	NN
10_1101-2020_12_31_424971	222	8	-	-	HYPH
10_1101-2020_12_31_424971	222	9	borne	bear	VBN
10_1101-2020_12_31_424971	222	10	ProL	ProL	NNP
10_1101-2020_12_31_424971	222	11	or	or	CC
10_1101-2020_12_31_424971	222	12	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	222	13	for	for	IN
10_1101-2020_12_31_424971	222	14	552	552	CD
10_1101-2020_12_31_424971	222	15	isolation	isolation	NN
10_1101-2020_12_31_424971	222	16	of	of	IN
10_1101-2020_12_31_424971	222	17	native	native	JJ
10_1101-2020_12_31_424971	222	18	-	-	HYPH
10_1101-2020_12_31_424971	222	19	state	state	NN
10_1101-2020_12_31_424971	222	20	tRNAs	trna	NNS
10_1101-2020_12_31_424971	222	21	were	be	VBD
10_1101-2020_12_31_424971	222	22	made	make	VBN
10_1101-2020_12_31_424971	222	23	in	in	IN
10_1101-2020_12_31_424971	222	24	a	a	DT
10_1101-2020_12_31_424971	222	25	ProL	ProL	NNP
10_1101-2020_12_31_424971	222	26	-	-	HYPH
10_1101-2020_12_31_424971	222	27	KO	KO	NNP
10_1101-2020_12_31_424971	222	28	strain	strain	NN
10_1101-2020_12_31_424971	222	29	,	,	,
10_1101-2020_12_31_424971	222	30	which	which	WDT
10_1101-2020_12_31_424971	222	31	was	be	VBD
10_1101-2020_12_31_424971	222	32	constructed	construct	VBN
10_1101-2020_12_31_424971	222	33	by	by	IN
10_1101-2020_12_31_424971	222	34	inserting	insert	VBG
10_1101-2020_12_31_424971	222	35	553	553	CD
10_1101-2020_12_31_424971	222	36	the	the	DT
10_1101-2020_12_31_424971	222	37	Kan	Kan	NNP
10_1101-2020_12_31_424971	222	38	-	-	HYPH
10_1101-2020_12_31_424971	222	39	resistance	resistance	NNP
10_1101-2020_12_31_424971	222	40	(	(	-LRB-
10_1101-2020_12_31_424971	222	41	Kan	Kan	NNP
10_1101-2020_12_31_424971	222	42	-	-	HYPH
10_1101-2020_12_31_424971	222	43	R	R	NNP
10_1101-2020_12_31_424971	222	44	)	)	-RRB-
10_1101-2020_12_31_424971	222	45	gene	gene	NN
10_1101-2020_12_31_424971	222	46	,	,	,
10_1101-2020_12_31_424971	222	47	amplified	amplify	VBN
10_1101-2020_12_31_424971	222	48	by	by	IN
10_1101-2020_12_31_424971	222	49	PCR	PCR	NNP
10_1101-2020_12_31_424971	222	50	primers	primer	NNS
10_1101-2020_12_31_424971	222	51	from	from	IN
10_1101-2020_12_31_424971	222	52	pKD4	pKD4	NNS
10_1101-2020_12_31_424971	222	53	,	,	,
10_1101-2020_12_31_424971	222	54	into	into	IN
10_1101-2020_12_31_424971	222	55	the	the	DT
10_1101-2020_12_31_424971	222	56	ProL	ProL	NNP
10_1101-2020_12_31_424971	222	57	locus	locus	NN
10_1101-2020_12_31_424971	222	58	of	of	IN
10_1101-2020_12_31_424971	222	59	E.	E.	NNP
10_1101-2020_12_31_424971	222	60	554	554	CD
10_1101-2020_12_31_424971	222	61	coli	coli	NNS
10_1101-2020_12_31_424971	222	62	BL21(DE3	BL21(DE3	''
10_1101-2020_12_31_424971	222	63	)	)	-RRB-
10_1101-2020_12_31_424971	222	64	using	use	VBG
10_1101-2020_12_31_424971	222	65	the	the	DT
10_1101-2020_12_31_424971	222	66	l	l	NNP
10_1101-2020_12_31_424971	222	67	-	-	HYPH
10_1101-2020_12_31_424971	222	68	Red	Red	NNP
10_1101-2020_12_31_424971	222	69	recombination	recombination	NN
10_1101-2020_12_31_424971	222	70	method59	method59	NN
10_1101-2020_12_31_424971	222	71	,	,	,
10_1101-2020_12_31_424971	222	72	followed	follow	VBN
10_1101-2020_12_31_424971	222	73	by	by	IN
10_1101-2020_12_31_424971	222	74	removal	removal	NN
10_1101-2020_12_31_424971	222	75	of	of	IN
10_1101-2020_12_31_424971	222	76	the	the	DT
10_1101-2020_12_31_424971	222	77	Kan	Kan	NNP
10_1101-2020_12_31_424971	222	78	-	-	HYPH
10_1101-2020_12_31_424971	222	79	R	R	NNP
10_1101-2020_12_31_424971	222	80	gene	gene	NN
10_1101-2020_12_31_424971	222	81	555	555	CD
10_1101-2020_12_31_424971	222	82	using	use	VBG
10_1101-2020_12_31_424971	222	83	FLP	FLP	NNP
10_1101-2020_12_31_424971	222	84	recombination30	recombination30	NNP
10_1101-2020_12_31_424971	222	85	.	.	.
10_1101-2020_12_31_424971	223	1	The	the	DT
10_1101-2020_12_31_424971	223	2	pKK223-SufB2	pKK223-SufB2	NNP
10_1101-2020_12_31_424971	223	3	plasmid	plasmid	NN
10_1101-2020_12_31_424971	223	4	was	be	VBD
10_1101-2020_12_31_424971	223	5	made	make	VBN
10_1101-2020_12_31_424971	223	6	by	by	IN
10_1101-2020_12_31_424971	223	7	site	site	NN
10_1101-2020_12_31_424971	223	8	-	-	HYPH
10_1101-2020_12_31_424971	223	9	directed	direct	VBN
10_1101-2020_12_31_424971	223	10	mutagenesis	mutagenesis	NN
10_1101-2020_12_31_424971	223	11	556	556	CD
10_1101-2020_12_31_424971	223	12	to	to	TO
10_1101-2020_12_31_424971	223	13	introduce	introduce	VB
10_1101-2020_12_31_424971	223	14	G37a	g37a	NN
10_1101-2020_12_31_424971	223	15	into	into	IN
10_1101-2020_12_31_424971	223	16	the	the	DT
10_1101-2020_12_31_424971	223	17	pKK223-ProL	pKK223-ProL	NNP
10_1101-2020_12_31_424971	223	18	plasmid29	plasmid29	NN
10_1101-2020_12_31_424971	223	19	.	.	.
10_1101-2020_12_31_424971	224	1	E.	E.	NNP
10_1101-2020_12_31_424971	224	2	coli	coli	NNS
10_1101-2020_12_31_424971	224	3	strains	strain	VBZ
10_1101-2020_12_31_424971	224	4	that	that	WDT
10_1101-2020_12_31_424971	224	5	expressed	express	VBD
10_1101-2020_12_31_424971	224	6	ProL	ProL	NNP
10_1101-2020_12_31_424971	224	7	or	or	CC
10_1101-2020_12_31_424971	224	8	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	224	9	557	557	CD
10_1101-2020_12_31_424971	224	10	from	from	IN
10_1101-2020_12_31_424971	224	11	the	the	DT
10_1101-2020_12_31_424971	224	12	chromosome	chromosome	NN
10_1101-2020_12_31_424971	224	13	as	as	IN
10_1101-2020_12_31_424971	224	14	an	an	DT
10_1101-2020_12_31_424971	224	15	isogenic	isogenic	JJ
10_1101-2020_12_31_424971	224	16	pair	pair	NN
10_1101-2020_12_31_424971	224	17	for	for	IN
10_1101-2020_12_31_424971	224	18	reporter	reporter	NN
10_1101-2020_12_31_424971	224	19	assays	assay	NNS
10_1101-2020_12_31_424971	224	20	were	be	VBD
10_1101-2020_12_31_424971	224	21	made	make	VBN
10_1101-2020_12_31_424971	224	22	using	use	VBG
10_1101-2020_12_31_424971	224	23	the	the	DT
10_1101-2020_12_31_424971	224	24	l	l	NNP
10_1101-2020_12_31_424971	224	25	-	-	HYPH
10_1101-2020_12_31_424971	224	26	Red	Red	NNP
10_1101-2020_12_31_424971	224	27	558	558	CD
10_1101-2020_12_31_424971	224	28	technique30	technique30	NNS
10_1101-2020_12_31_424971	224	29	.	.	.
10_1101-2020_12_31_424971	225	1	To	to	TO
10_1101-2020_12_31_424971	225	2	construct	construct	VB
10_1101-2020_12_31_424971	225	3	the	the	DT
10_1101-2020_12_31_424971	225	4	E.	E.	NNP
10_1101-2020_12_31_424971	225	5	coli	coli	VB
10_1101-2020_12_31_424971	225	6	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	225	7	strain	strain	NN
10_1101-2020_12_31_424971	225	8	,	,	,
10_1101-2020_12_31_424971	225	9	the	the	DT
10_1101-2020_12_31_424971	225	10	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	225	11	gene	gene	NN
10_1101-2020_12_31_424971	225	12	was	be	VBD
10_1101-2020_12_31_424971	225	13	PCR	PCR	NNP
10_1101-2020_12_31_424971	225	14	-	-	HYPH
10_1101-2020_12_31_424971	225	15	amplified	amplify	VBN
10_1101-2020_12_31_424971	225	16	from	from	IN
10_1101-2020_12_31_424971	225	17	559	559	CD
10_1101-2020_12_31_424971	225	18	pKK223-SufB2	pKK223-SufB2	NNS
10_1101-2020_12_31_424971	225	19	,	,	,
10_1101-2020_12_31_424971	225	20	and	and	CC
10_1101-2020_12_31_424971	225	21	the	the	DT
10_1101-2020_12_31_424971	225	22	5	5	CD
10_1101-2020_12_31_424971	225	23	'	'	''
10_1101-2020_12_31_424971	225	24	end	end	NN
10_1101-2020_12_31_424971	225	25	of	of	IN
10_1101-2020_12_31_424971	225	26	the	the	DT
10_1101-2020_12_31_424971	225	27	amplified	amplified	JJ
10_1101-2020_12_31_424971	225	28	gene	gene	NN
10_1101-2020_12_31_424971	225	29	was	be	VBD
10_1101-2020_12_31_424971	225	30	joined	join	VBN
10_1101-2020_12_31_424971	225	31	with	with	IN
10_1101-2020_12_31_424971	225	32	Kan	Kan	NNP
10_1101-2020_12_31_424971	225	33	-	-	HYPH
10_1101-2020_12_31_424971	225	34	R	R	NNP
10_1101-2020_12_31_424971	225	35	(	(	-LRB-
10_1101-2020_12_31_424971	225	36	from	from	IN
10_1101-2020_12_31_424971	225	37	pKD4	pKD4	NNS
10_1101-2020_12_31_424971	225	38	)	)	-RRB-
10_1101-2020_12_31_424971	225	39	by	by	IN
10_1101-2020_12_31_424971	225	40	PCR	PCR	NNP
10_1101-2020_12_31_424971	225	41	560	560	CD
10_1101-2020_12_31_424971	225	42	using	use	VBG
10_1101-2020_12_31_424971	225	43	reverse-2	reverse-2	NNP
10_1101-2020_12_31_424971	225	44	primer	primer	NN
10_1101-2020_12_31_424971	225	45	,	,	,
10_1101-2020_12_31_424971	225	46	while	while	IN
10_1101-2020_12_31_424971	225	47	the	the	DT
10_1101-2020_12_31_424971	225	48	3	3	CD
10_1101-2020_12_31_424971	225	49	'	'	POS
10_1101-2020_12_31_424971	225	50	end	end	NN
10_1101-2020_12_31_424971	225	51	was	be	VBD
10_1101-2020_12_31_424971	225	52	homologous	homologous	JJ
10_1101-2020_12_31_424971	225	53	to	to	IN
10_1101-2020_12_31_424971	225	54	the	the	DT
10_1101-2020_12_31_424971	225	55	ProL	prol	NN
10_1101-2020_12_31_424971	225	56	3	3	CD
10_1101-2020_12_31_424971	225	57	'	'	POS
10_1101-2020_12_31_424971	225	58	flanking	flanking	NN
10_1101-2020_12_31_424971	225	59	region	region	NN
10_1101-2020_12_31_424971	225	60	.	.	.
10_1101-2020_12_31_424971	226	1	The	the	DT
10_1101-2020_12_31_424971	226	2	PCR-561	pcr-561	NN
10_1101-2020_12_31_424971	226	3	amplified	amplify	VBD
10_1101-2020_12_31_424971	226	4	SufB2-Kan	sufb2-kan	ADD
10_1101-2020_12_31_424971	226	5	product	product	NN
10_1101-2020_12_31_424971	226	6	was	be	VBD
10_1101-2020_12_31_424971	226	7	used	use	VBN
10_1101-2020_12_31_424971	226	8	to	to	TO
10_1101-2020_12_31_424971	226	9	replace	replace	VB
10_1101-2020_12_31_424971	226	10	ProL	ProL	NNP
10_1101-2020_12_31_424971	226	11	in	in	IN
10_1101-2020_12_31_424971	226	12	l	l	NNP
10_1101-2020_12_31_424971	226	13	-	-	HYPH
10_1101-2020_12_31_424971	226	14	Red	red	NN
10_1101-2020_12_31_424971	226	15	expressing	express	VBG
10_1101-2020_12_31_424971	226	16	cells	cell	NNS
10_1101-2020_12_31_424971	226	17	.	.	.
10_1101-2020_12_31_424971	227	1	An	an	DT
10_1101-2020_12_31_424971	227	2	isogenic	isogenic	JJ
10_1101-2020_12_31_424971	227	3	562	562	CD
10_1101-2020_12_31_424971	227	4	counterpart	counterpart	NN
10_1101-2020_12_31_424971	227	5	strain	strain	NN
10_1101-2020_12_31_424971	227	6	expressing	express	VBG
10_1101-2020_12_31_424971	227	7	ProL	ProL	NNP
10_1101-2020_12_31_424971	227	8	-	-	HYPH
10_1101-2020_12_31_424971	227	9	Kan	Kan	NNP
10_1101-2020_12_31_424971	227	10	was	be	VBD
10_1101-2020_12_31_424971	227	11	also	also	RB
10_1101-2020_12_31_424971	227	12	made	make	VBN
10_1101-2020_12_31_424971	227	13	.	.	.
10_1101-2020_12_31_424971	228	1	These	these	DT
10_1101-2020_12_31_424971	228	2	ProL	ProL	NNP
10_1101-2020_12_31_424971	228	3	-	-	HYPH
10_1101-2020_12_31_424971	228	4	Kan	Kan	NNP
10_1101-2020_12_31_424971	228	5	and	and	CC
10_1101-2020_12_31_424971	228	6	SufB2-Kan	sufb2-kan	ADD
10_1101-2020_12_31_424971	228	7	loci	loci	NN
10_1101-2020_12_31_424971	228	8	563	563	CD
10_1101-2020_12_31_424971	228	9	were	be	VBD
10_1101-2020_12_31_424971	228	10	independently	independently	RB
10_1101-2020_12_31_424971	228	11	transferred	transfer	VBN
10_1101-2020_12_31_424971	228	12	to	to	IN
10_1101-2020_12_31_424971	228	13	the	the	DT
10_1101-2020_12_31_424971	228	14	trmD	trmd	CD
10_1101-2020_12_31_424971	228	15	-	-	HYPH
10_1101-2020_12_31_424971	228	16	KO	KO	NNP
10_1101-2020_12_31_424971	228	17	strain29	strain29	NN
10_1101-2020_12_31_424971	228	18	by	by	IN
10_1101-2020_12_31_424971	228	19	P1	P1	NNP
10_1101-2020_12_31_424971	228	20	transduction	transduction	NN
10_1101-2020_12_31_424971	228	21	,	,	,
10_1101-2020_12_31_424971	228	22	followed	follow	VBN
10_1101-2020_12_31_424971	228	23	by	by	IN
10_1101-2020_12_31_424971	228	24	pCP20	pcp20	JJ
10_1101-2020_12_31_424971	228	25	-	-	:
10_1101-2020_12_31_424971	228	26	564	564	CD
10_1101-2020_12_31_424971	228	27	dependent	dependent	JJ
10_1101-2020_12_31_424971	228	28	FLP	FLP	NNP
10_1101-2020_12_31_424971	228	29	recombination	recombination	NN
10_1101-2020_12_31_424971	228	30	,	,	,
10_1101-2020_12_31_424971	228	31	generating	generate	VBG
10_1101-2020_12_31_424971	228	32	the	the	DT
10_1101-2020_12_31_424971	228	33	isogenic	isogenic	JJ
10_1101-2020_12_31_424971	228	34	pair	pair	NN
10_1101-2020_12_31_424971	228	35	of	of	IN
10_1101-2020_12_31_424971	228	36	ProL	ProL	NNP
10_1101-2020_12_31_424971	228	37	and	and	CC
10_1101-2020_12_31_424971	228	38	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	228	39	strains	strain	NNS
10_1101-2020_12_31_424971	228	40	in	in	IN
10_1101-2020_12_31_424971	228	41	the	the	DT
10_1101-2020_12_31_424971	228	42	trmD-565	trmD-565	NNP
10_1101-2020_12_31_424971	228	43	KO	KO	NNP
10_1101-2020_12_31_424971	228	44	background	background	NN
10_1101-2020_12_31_424971	228	45	.	.	.
10_1101-2020_12_31_424971	229	1	These	these	DT
10_1101-2020_12_31_424971	229	2	strains	strain	NNS
10_1101-2020_12_31_424971	229	3	were	be	VBD
10_1101-2020_12_31_424971	229	4	transformed	transform	VBN
10_1101-2020_12_31_424971	229	5	with	with	IN
10_1101-2020_12_31_424971	229	6	pKK223	pKK223	NNP
10_1101-2020_12_31_424971	229	7	-	-	HYPH
10_1101-2020_12_31_424971	229	8	3-lacZ	3-lacz	CD
10_1101-2020_12_31_424971	229	9	reporter	reporter	NN
10_1101-2020_12_31_424971	229	10	plasmid	plasmid	NN
10_1101-2020_12_31_424971	229	11	that	that	WDT
10_1101-2020_12_31_424971	229	12	has	have	VBZ
10_1101-2020_12_31_424971	229	13	566	566	CD
10_1101-2020_12_31_424971	229	14	the	the	DT
10_1101-2020_12_31_424971	229	15	CCC	CCC	NNP
10_1101-2020_12_31_424971	229	16	-	-	HYPH
10_1101-2020_12_31_424971	229	17	C	C	NNP
10_1101-2020_12_31_424971	229	18	motif	motif	NN
10_1101-2020_12_31_424971	229	19	at	at	IN
10_1101-2020_12_31_424971	229	20	the	the	DT
10_1101-2020_12_31_424971	229	21	2nd	2nd	JJ
10_1101-2020_12_31_424971	229	22	codon	codon	NNP
10_1101-2020_12_31_424971	229	23	position	position	NN
10_1101-2020_12_31_424971	229	24	of	of	IN
10_1101-2020_12_31_424971	229	25	the	the	DT
10_1101-2020_12_31_424971	229	26	lacZ	lacz	CD
10_1101-2020_12_31_424971	229	27	gene	gene	NN
10_1101-2020_12_31_424971	229	28	,	,	,
10_1101-2020_12_31_424971	229	29	and	and	CC
10_1101-2020_12_31_424971	229	30	the	the	DT
10_1101-2020_12_31_424971	229	31	b	b	NNP
10_1101-2020_12_31_424971	229	32	-	-	HYPH
10_1101-2020_12_31_424971	229	33	Gal	Gal	NNP
10_1101-2020_12_31_424971	229	34	activity	activity	NN
10_1101-2020_12_31_424971	229	35	was	be	VBD
10_1101-2020_12_31_424971	229	36	measured29	measured29	VBN
10_1101-2020_12_31_424971	229	37	.	.	.
10_1101-2020_12_31_424971	230	1	567	567	CD
10_1101-2020_12_31_424971	230	2	All	all	DT
10_1101-2020_12_31_424971	230	3	primer	primer	JJ
10_1101-2020_12_31_424971	230	4	sequences	sequence	NNS
10_1101-2020_12_31_424971	230	5	used	use	VBN
10_1101-2020_12_31_424971	230	6	in	in	IN
10_1101-2020_12_31_424971	230	7	this	this	DT
10_1101-2020_12_31_424971	230	8	work	work	NN
10_1101-2020_12_31_424971	230	9	are	be	VBP
10_1101-2020_12_31_424971	230	10	shown	show	VBN
10_1101-2020_12_31_424971	230	11	in	in	IN
10_1101-2020_12_31_424971	230	12	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	230	13	Table	Table	NNP
10_1101-2020_12_31_424971	230	14	1	1	CD
10_1101-2020_12_31_424971	230	15	.	.	.
10_1101-2020_12_31_424971	231	1	568	568	CD
10_1101-2020_12_31_424971	231	2	569	569	CD
10_1101-2020_12_31_424971	231	3	Preparation	Preparation	NNP
10_1101-2020_12_31_424971	231	4	of	of	IN
10_1101-2020_12_31_424971	231	5	translation	translation	NN
10_1101-2020_12_31_424971	231	6	components	component	NNS
10_1101-2020_12_31_424971	231	7	for	for	IN
10_1101-2020_12_31_424971	231	8	ensemble	ensemble	JJ
10_1101-2020_12_31_424971	231	9	biochemical	biochemical	JJ
10_1101-2020_12_31_424971	231	10	experiments	experiment	NNS
10_1101-2020_12_31_424971	231	11	.	.	.
10_1101-2020_12_31_424971	232	1	The	the	DT
10_1101-2020_12_31_424971	232	2	mRNA	mrna	CD
10_1101-2020_12_31_424971	232	3	570	570	CD
10_1101-2020_12_31_424971	232	4	used	use	VBN
10_1101-2020_12_31_424971	232	5	for	for	IN
10_1101-2020_12_31_424971	232	6	most	most	JJS
10_1101-2020_12_31_424971	232	7	in	in	FW
10_1101-2020_12_31_424971	232	8	vitro	vitro	FW
10_1101-2020_12_31_424971	232	9	translation	translation	NN
10_1101-2020_12_31_424971	232	10	reactions	reaction	NNS
10_1101-2020_12_31_424971	232	11	is	be	VBZ
10_1101-2020_12_31_424971	232	12	shown	show	VBN
10_1101-2020_12_31_424971	232	13	below	below	IN
10_1101-2020_12_31_424971	232	14	,	,	,
10_1101-2020_12_31_424971	232	15	including	include	VBG
10_1101-2020_12_31_424971	232	16	the	the	DT
10_1101-2020_12_31_424971	232	17	Shine	Shine	NNP
10_1101-2020_12_31_424971	232	18	-	-	HYPH
10_1101-2020_12_31_424971	232	19	Dalgarno	Dalgarno	NNP
10_1101-2020_12_31_424971	232	20	571	571	CD
10_1101-2020_12_31_424971	232	21	sequence	sequence	NN
10_1101-2020_12_31_424971	232	22	,	,	,
10_1101-2020_12_31_424971	232	23	the	the	DT
10_1101-2020_12_31_424971	232	24	AUG	AUG	NNP
10_1101-2020_12_31_424971	232	25	start	start	VBP
10_1101-2020_12_31_424971	232	26	codon	codon	NNP
10_1101-2020_12_31_424971	232	27	,	,	,
10_1101-2020_12_31_424971	232	28	and	and	CC
10_1101-2020_12_31_424971	232	29	the	the	DT
10_1101-2020_12_31_424971	232	30	CCC	CCC	NNP
10_1101-2020_12_31_424971	232	31	-	-	HYPH
10_1101-2020_12_31_424971	232	32	C	C	NNP
10_1101-2020_12_31_424971	232	33	motif	motif	NN
10_1101-2020_12_31_424971	232	34	:	:	:
10_1101-2020_12_31_424971	232	35	572	572	CD
10_1101-2020_12_31_424971	232	36	5'-GGGAAGGAGGUAAAAAUGCCCCGUUCUAAG(CAC)7	5'-GGGAAGGAGGUAAAAAUGCCCCGUUCUAAG(CAC)7	NNS
10_1101-2020_12_31_424971	232	37	.	.	.
10_1101-2020_12_31_424971	233	1	573	573	CD
10_1101-2020_12_31_424971	233	2	Variants	variant	NNS
10_1101-2020_12_31_424971	233	3	of	of	IN
10_1101-2020_12_31_424971	233	4	this	this	DT
10_1101-2020_12_31_424971	233	5	mRNA	mrna	NN
10_1101-2020_12_31_424971	233	6	had	have	VBD
10_1101-2020_12_31_424971	233	7	a	a	DT
10_1101-2020_12_31_424971	233	8	base	base	JJ
10_1101-2020_12_31_424971	233	9	substitution	substitution	NN
10_1101-2020_12_31_424971	233	10	in	in	IN
10_1101-2020_12_31_424971	233	11	the	the	DT
10_1101-2020_12_31_424971	233	12	CCC	CCC	NNP
10_1101-2020_12_31_424971	233	13	-	-	HYPH
10_1101-2020_12_31_424971	233	14	C	C	NNP
10_1101-2020_12_31_424971	233	15	motif	motif	NN
10_1101-2020_12_31_424971	233	16	.	.	.
10_1101-2020_12_31_424971	234	1	All	all	DT
10_1101-2020_12_31_424971	234	2	mRNAs	mRNAs	''
10_1101-2020_12_31_424971	234	3	were	be	VBD
10_1101-2020_12_31_424971	234	4	transcribed	transcribed	NNP
10_1101-2020_12_31_424971	234	5	574	574	CD
10_1101-2020_12_31_424971	234	6	from	from	IN
10_1101-2020_12_31_424971	234	7	double	double	JJ
10_1101-2020_12_31_424971	234	8	-	-	HYPH
10_1101-2020_12_31_424971	234	9	stranded	strand	VBN
10_1101-2020_12_31_424971	234	10	DNA	dna	NN
10_1101-2020_12_31_424971	234	11	templates	template	NNS
10_1101-2020_12_31_424971	234	12	with	with	IN
10_1101-2020_12_31_424971	234	13	T7	T7	NNP
10_1101-2020_12_31_424971	234	14	RNA	RNA	NNP
10_1101-2020_12_31_424971	234	15	polymerase	polymerase	NN
10_1101-2020_12_31_424971	234	16	and	and	CC
10_1101-2020_12_31_424971	234	17	purified	purify	VBN
10_1101-2020_12_31_424971	234	18	by	by	IN
10_1101-2020_12_31_424971	234	19	gel	gel	NN
10_1101-2020_12_31_424971	234	20	575	575	CD
10_1101-2020_12_31_424971	234	21	.CC	.CC	:
10_1101-2020_12_31_424971	234	22	-	-	:
10_1101-2020_12_31_424971	234	23	BY	by	IN
10_1101-2020_12_31_424971	234	24	-	-	HYPH
10_1101-2020_12_31_424971	234	25	NC	NC	NNP
10_1101-2020_12_31_424971	234	26	-	-	HYPH
10_1101-2020_12_31_424971	234	27	ND	ND	NNP
10_1101-2020_12_31_424971	234	28	4.0	4.0	CD
10_1101-2020_12_31_424971	234	29	International	International	NNP
10_1101-2020_12_31_424971	234	30	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	234	31	under	under	IN
10_1101-2020_12_31_424971	234	32	a	a	DT
10_1101-2020_12_31_424971	234	33	(	(	-LRB-
10_1101-2020_12_31_424971	234	34	which	which	WDT
10_1101-2020_12_31_424971	234	35	was	be	VBD
10_1101-2020_12_31_424971	234	36	not	not	RB
10_1101-2020_12_31_424971	234	37	certified	certify	VBN
10_1101-2020_12_31_424971	234	38	by	by	IN
10_1101-2020_12_31_424971	234	39	peer	peer	NN
10_1101-2020_12_31_424971	234	40	review	review	NN
10_1101-2020_12_31_424971	234	41	)	)	-RRB-
10_1101-2020_12_31_424971	234	42	is	be	VBZ
10_1101-2020_12_31_424971	234	43	the	the	DT
10_1101-2020_12_31_424971	234	44	author	author	NN
10_1101-2020_12_31_424971	234	45	/	/	SYM
10_1101-2020_12_31_424971	234	46	funder	funder	NN
10_1101-2020_12_31_424971	234	47	,	,	,
10_1101-2020_12_31_424971	234	48	who	who	WP
10_1101-2020_12_31_424971	234	49	has	have	VBZ
10_1101-2020_12_31_424971	234	50	granted	grant	VBN
10_1101-2020_12_31_424971	234	51	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	234	52	a	a	DT
10_1101-2020_12_31_424971	234	53	license	license	NN
10_1101-2020_12_31_424971	234	54	to	to	TO
10_1101-2020_12_31_424971	234	55	display	display	VB
10_1101-2020_12_31_424971	234	56	the	the	DT
10_1101-2020_12_31_424971	234	57	preprint	preprint	NN
10_1101-2020_12_31_424971	234	58	in	in	IN
10_1101-2020_12_31_424971	234	59	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	234	60	.	.	.
10_1101-2020_12_31_424971	235	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	235	2	is	be	VBZ
10_1101-2020_12_31_424971	235	3	made	make	VBN
10_1101-2020_12_31_424971	235	4	The	the	DT
10_1101-2020_12_31_424971	235	5	copyright	copyright	NN
10_1101-2020_12_31_424971	235	6	holder	holder	NN
10_1101-2020_12_31_424971	235	7	for	for	IN
10_1101-2020_12_31_424971	235	8	this	this	DT
10_1101-2020_12_31_424971	235	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	235	10	version	version	NN
10_1101-2020_12_31_424971	235	11	posted	post	VBD
10_1101-2020_12_31_424971	235	12	January	January	NNP
10_1101-2020_12_31_424971	235	13	2	2	CD
10_1101-2020_12_31_424971	235	14	,	,	,
10_1101-2020_12_31_424971	235	15	2021	2021	CD
10_1101-2020_12_31_424971	235	16	.	.	.
10_1101-2020_12_31_424971	235	17	;	;	:
10_1101-2020_12_31_424971	235	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	235	19	:	:	:
10_1101-2020_12_31_424971	235	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	235	21	preprint	preprint	NN
10_1101-2020_12_31_424971	235	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	235	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	235	24	24	24	CD
10_1101-2020_12_31_424971	235	25	electrophoresis	electrophoresis	NN
10_1101-2020_12_31_424971	235	26	.	.	.
10_1101-2020_12_31_424971	236	1	E.	E.	NNP
10_1101-2020_12_31_424971	236	2	coli	coli	NNS
10_1101-2020_12_31_424971	236	3	strains	strain	VBZ
10_1101-2020_12_31_424971	236	4	over	over	RB
10_1101-2020_12_31_424971	236	5	-	-	HYPH
10_1101-2020_12_31_424971	236	6	expressing	express	VBG
10_1101-2020_12_31_424971	236	7	native	native	JJ
10_1101-2020_12_31_424971	236	8	-	-	HYPH
10_1101-2020_12_31_424971	236	9	state	state	NN
10_1101-2020_12_31_424971	236	10	tRNAfMet	tRNAfMet	NNP
10_1101-2020_12_31_424971	236	11	,	,	,
10_1101-2020_12_31_424971	236	12	tRNAArg	tRNAArg	NNP
10_1101-2020_12_31_424971	236	13	(	(	-LRB-
10_1101-2020_12_31_424971	236	14	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	236	15	ICG	ICG	NNP
10_1101-2020_12_31_424971	236	16	,	,	,
10_1101-2020_12_31_424971	236	17	576	576	CD
10_1101-2020_12_31_424971	236	18	where	where	WRB
10_1101-2020_12_31_424971	236	19	I	-PRON-	PRP
10_1101-2020_12_31_424971	236	20	=	=	SYM
10_1101-2020_12_31_424971	236	21	inosine	inosine	NNP
10_1101-2020_12_31_424971	236	22	)	)	-RRB-
10_1101-2020_12_31_424971	236	23	,	,	,
10_1101-2020_12_31_424971	236	24	and	and	CC
10_1101-2020_12_31_424971	236	25	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	236	26	(	(	-LRB-
10_1101-2020_12_31_424971	236	27	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	236	28	U*AC	U*AC	NNP
10_1101-2020_12_31_424971	236	29	,	,	,
10_1101-2020_12_31_424971	236	30	where	where	WRB
10_1101-2020_12_31_424971	236	31	U	u	NN
10_1101-2020_12_31_424971	236	32	*	*	NFP
10_1101-2020_12_31_424971	236	33	=	=	SYM
10_1101-2020_12_31_424971	236	34	cmo5U	cmo5u	NN
10_1101-2020_12_31_424971	236	35	)	)	-RRB-
10_1101-2020_12_31_424971	236	36	were	be	VBD
10_1101-2020_12_31_424971	236	37	grown	grow	VBN
10_1101-2020_12_31_424971	236	38	to	to	IN
10_1101-2020_12_31_424971	236	39	saturation	saturation	NN
10_1101-2020_12_31_424971	236	40	577	577	CD
10_1101-2020_12_31_424971	236	41	and	and	CC
10_1101-2020_12_31_424971	236	42	were	be	VBD
10_1101-2020_12_31_424971	236	43	used	use	VBN
10_1101-2020_12_31_424971	236	44	to	to	TO
10_1101-2020_12_31_424971	236	45	isolate	isolate	VB
10_1101-2020_12_31_424971	236	46	total	total	JJ
10_1101-2020_12_31_424971	236	47	tRNA	trna	NN
10_1101-2020_12_31_424971	236	48	.	.	.
10_1101-2020_12_31_424971	237	1	The	the	DT
10_1101-2020_12_31_424971	237	2	over	over	RB
10_1101-2020_12_31_424971	237	3	-	-	HYPH
10_1101-2020_12_31_424971	237	4	expressed	express	VBN
10_1101-2020_12_31_424971	237	5	tRNA	trna	NN
10_1101-2020_12_31_424971	237	6	species	specie	NNS
10_1101-2020_12_31_424971	237	7	in	in	IN
10_1101-2020_12_31_424971	237	8	each	each	DT
10_1101-2020_12_31_424971	237	9	total	total	JJ
10_1101-2020_12_31_424971	237	10	tRNA	trna	NN
10_1101-2020_12_31_424971	237	11	sample	sample	NN
10_1101-2020_12_31_424971	237	12	578	578	CD
10_1101-2020_12_31_424971	237	13	was	be	VBD
10_1101-2020_12_31_424971	237	14	aminoacylated	aminoacylate	VBN
10_1101-2020_12_31_424971	237	15	by	by	IN
10_1101-2020_12_31_424971	237	16	the	the	DT
10_1101-2020_12_31_424971	237	17	cognate	cognate	NN
10_1101-2020_12_31_424971	237	18	aminoacyl	aminoacyl	NNP
10_1101-2020_12_31_424971	237	19	-	-	HYPH
10_1101-2020_12_31_424971	237	20	tRNA	trna	NN
10_1101-2020_12_31_424971	237	21	synthetase	synthetase	NN
10_1101-2020_12_31_424971	237	22	and	and	CC
10_1101-2020_12_31_424971	237	23	used	use	VBD
10_1101-2020_12_31_424971	237	24	directly	directly	RB
10_1101-2020_12_31_424971	237	25	in	in	IN
10_1101-2020_12_31_424971	237	26	the	the	DT
10_1101-2020_12_31_424971	237	27	TC	TC	NNP
10_1101-2020_12_31_424971	237	28	579	579	CD
10_1101-2020_12_31_424971	237	29	formation	formation	NN
10_1101-2020_12_31_424971	237	30	reaction	reaction	NN
10_1101-2020_12_31_424971	237	31	and	and	CC
10_1101-2020_12_31_424971	237	32	subsequent	subsequent	JJ
10_1101-2020_12_31_424971	237	33	TC	TC	NNP
10_1101-2020_12_31_424971	237	34	delivery	delivery	NN
10_1101-2020_12_31_424971	237	35	to	to	IN
10_1101-2020_12_31_424971	237	36	70S	70S	NNP
10_1101-2020_12_31_424971	237	37	ICs	ic	NNS
10_1101-2020_12_31_424971	237	38	or	or	CC
10_1101-2020_12_31_424971	237	39	POST	POST	NNP
10_1101-2020_12_31_424971	237	40	complexes	complex	NNS
10_1101-2020_12_31_424971	237	41	.	.	.
10_1101-2020_12_31_424971	238	1	E.	E.	NNP
10_1101-2020_12_31_424971	238	2	coli	coli	VBZ
10_1101-2020_12_31_424971	238	3	tRNASer	tRNASer	NNP
10_1101-2020_12_31_424971	238	4	580	580	CD
10_1101-2020_12_31_424971	238	5	(	(	-LRB-
10_1101-2020_12_31_424971	238	6	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	238	7	ACU	ACU	NNP
10_1101-2020_12_31_424971	238	8	)	)	-RRB-
10_1101-2020_12_31_424971	238	9	was	be	VBD
10_1101-2020_12_31_424971	238	10	prepared	prepare	VBN
10_1101-2020_12_31_424971	238	11	by	by	IN
10_1101-2020_12_31_424971	238	12	in	in	IN
10_1101-2020_12_31_424971	238	13	vitro	vitro	FW
10_1101-2020_12_31_424971	238	14	transcription	transcription	NN
10_1101-2020_12_31_424971	238	15	.	.	.
10_1101-2020_12_31_424971	239	1	Aminoacyl	Aminoacyl	NNP
10_1101-2020_12_31_424971	239	2	-	-	HYPH
10_1101-2020_12_31_424971	239	3	tRNAs	trnas	CD
10_1101-2020_12_31_424971	239	4	with	with	IN
10_1101-2020_12_31_424971	239	5	the	the	DT
10_1101-2020_12_31_424971	239	6	cognate	cognate	NN
10_1101-2020_12_31_424971	239	7	581	581	CD
10_1101-2020_12_31_424971	239	8	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	239	9	amino	amino	NN
10_1101-2020_12_31_424971	239	10	acid	acid	NN
10_1101-2020_12_31_424971	239	11	were	be	VBD
10_1101-2020_12_31_424971	239	12	prepared	prepare	VBN
10_1101-2020_12_31_424971	239	13	using	use	VBG
10_1101-2020_12_31_424971	239	14	the	the	DT
10_1101-2020_12_31_424971	239	15	respective	respective	JJ
10_1101-2020_12_31_424971	239	16	aminoacyl	aminoacyl	NN
10_1101-2020_12_31_424971	239	17	-	-	HYPH
10_1101-2020_12_31_424971	239	18	tRNA	trna	NN
10_1101-2020_12_31_424971	239	19	synthetase	synthetase	NN
10_1101-2020_12_31_424971	239	20	and	and	CC
10_1101-2020_12_31_424971	239	21	582	582	CD
10_1101-2020_12_31_424971	239	22	those	those	DT
10_1101-2020_12_31_424971	239	23	with	with	IN
10_1101-2020_12_31_424971	239	24	a	a	DT
10_1101-2020_12_31_424971	239	25	non	non	JJ
10_1101-2020_12_31_424971	239	26	-	-	JJ
10_1101-2020_12_31_424971	239	27	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	239	28	amino	amino	NN
10_1101-2020_12_31_424971	239	29	acid	acid	NN
10_1101-2020_12_31_424971	239	30	were	be	VBD
10_1101-2020_12_31_424971	239	31	prepared	prepare	VBN
10_1101-2020_12_31_424971	239	32	using	use	VBG
10_1101-2020_12_31_424971	239	33	the	the	DT
10_1101-2020_12_31_424971	239	34	dFx	dFx	``
10_1101-2020_12_31_424971	239	35	Flexizyme	Flexizyme	NNPS
10_1101-2020_12_31_424971	239	36	and	and	CC
10_1101-2020_12_31_424971	239	37	the	the	DT
10_1101-2020_12_31_424971	239	38	3,5	3,5	CD
10_1101-2020_12_31_424971	239	39	-	-	SYM
10_1101-2020_12_31_424971	239	40	583	583	CD
10_1101-2020_12_31_424971	239	41	dinitobenzyl	dinitobenzyl	NN
10_1101-2020_12_31_424971	239	42	ester	ester	NN
10_1101-2020_12_31_424971	239	43	(	(	-LRB-
10_1101-2020_12_31_424971	239	44	DBE	DBE	NNP
10_1101-2020_12_31_424971	239	45	)	)	-RRB-
10_1101-2020_12_31_424971	239	46	of	of	IN
10_1101-2020_12_31_424971	239	47	the	the	DT
10_1101-2020_12_31_424971	239	48	respective	respective	JJ
10_1101-2020_12_31_424971	239	49	amino	amino	NN
10_1101-2020_12_31_424971	239	50	acid	acid	NN
10_1101-2020_12_31_424971	239	51	(	(	-LRB-
10_1101-2020_12_31_424971	239	52	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	239	53	Figure	Figure	NNP
10_1101-2020_12_31_424971	239	54	1	1	CD
10_1101-2020_12_31_424971	239	55	)	)	-RRB-
10_1101-2020_12_31_424971	239	56	.	.	.
10_1101-2020_12_31_424971	240	1	Aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	240	2	584	584	CD
10_1101-2020_12_31_424971	240	3	and	and	CC
10_1101-2020_12_31_424971	240	4	formylation	formylation	NN
10_1101-2020_12_31_424971	240	5	of	of	IN
10_1101-2020_12_31_424971	240	6	tRNAfMet	tRNAfMet	NNP
10_1101-2020_12_31_424971	240	7	were	be	VBD
10_1101-2020_12_31_424971	240	8	performed	perform	VBN
10_1101-2020_12_31_424971	240	9	in	in	IN
10_1101-2020_12_31_424971	240	10	a	a	DT
10_1101-2020_12_31_424971	240	11	one	one	CD
10_1101-2020_12_31_424971	240	12	-	-	HYPH
10_1101-2020_12_31_424971	240	13	step	step	NN
10_1101-2020_12_31_424971	240	14	reaction	reaction	NN
10_1101-2020_12_31_424971	240	15	in	in	IN
10_1101-2020_12_31_424971	240	16	which	which	WDT
10_1101-2020_12_31_424971	240	17	formyl	formyl	NN
10_1101-2020_12_31_424971	240	18	transferase	transferase	NN
10_1101-2020_12_31_424971	240	19	and	and	CC
10_1101-2020_12_31_424971	240	20	585	585	CD
10_1101-2020_12_31_424971	240	21	the	the	DT
10_1101-2020_12_31_424971	240	22	methyl	methyl	NN
10_1101-2020_12_31_424971	240	23	donor	donor	NN
10_1101-2020_12_31_424971	240	24	10-formyltetrahydrofolate	10-formyltetrahydrofolate	CD
10_1101-2020_12_31_424971	240	25	were	be	VBD
10_1101-2020_12_31_424971	240	26	added	add	VBN
10_1101-2020_12_31_424971	240	27	to	to	IN
10_1101-2020_12_31_424971	240	28	the	the	DT
10_1101-2020_12_31_424971	240	29	aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	240	30	reaction29	reaction29	JJ
10_1101-2020_12_31_424971	240	31	.	.	.
10_1101-2020_12_31_424971	241	1	586	586	CD
10_1101-2020_12_31_424971	241	2	Aminoacyl	Aminoacyl	NNP
10_1101-2020_12_31_424971	241	3	-	-	HYPH
10_1101-2020_12_31_424971	241	4	tRNAs	tRNAs	NNP
10_1101-2020_12_31_424971	241	5	were	be	VBD
10_1101-2020_12_31_424971	241	6	stored	store	VBN
10_1101-2020_12_31_424971	241	7	in	in	IN
10_1101-2020_12_31_424971	241	8	25	25	CD
10_1101-2020_12_31_424971	241	9	mM	mm	NN
10_1101-2020_12_31_424971	241	10	sodium	sodium	NN
10_1101-2020_12_31_424971	241	11	acetate	acetate	NN
10_1101-2020_12_31_424971	241	12	(	(	-LRB-
10_1101-2020_12_31_424971	241	13	NaOAc	NaOAc	NNPS
10_1101-2020_12_31_424971	241	14	)	)	-RRB-
10_1101-2020_12_31_424971	241	15	(	(	-LRB-
10_1101-2020_12_31_424971	241	16	pH	pH	NNP
10_1101-2020_12_31_424971	241	17	5	5	CD
10_1101-2020_12_31_424971	241	18	)	)	-RRB-
10_1101-2020_12_31_424971	241	19	at	at	IN
10_1101-2020_12_31_424971	241	20	–	–	:
10_1101-2020_12_31_424971	241	21	70	70	CD
10_1101-2020_12_31_424971	241	22	°	°	,
10_1101-2020_12_31_424971	241	23	C	C	NNP
10_1101-2020_12_31_424971	241	24	,	,	,
10_1101-2020_12_31_424971	241	25	as	as	IN
10_1101-2020_12_31_424971	241	26	were	be	VBD
10_1101-2020_12_31_424971	241	27	six-587	six-587	NNP
10_1101-2020_12_31_424971	241	28	His	-PRON-	PRP$
10_1101-2020_12_31_424971	241	29	-	-	HYPH
10_1101-2020_12_31_424971	241	30	tagged	tag	VBN
10_1101-2020_12_31_424971	241	31	E.	E.	NNP
10_1101-2020_12_31_424971	241	32	coli	coli	NNS
10_1101-2020_12_31_424971	241	33	initiation	initiation	NN
10_1101-2020_12_31_424971	241	34	and	and	CC
10_1101-2020_12_31_424971	241	35	elongation	elongation	NN
10_1101-2020_12_31_424971	241	36	factors	factor	NNS
10_1101-2020_12_31_424971	241	37	and	and	CC
10_1101-2020_12_31_424971	241	38	tight	tight	RB
10_1101-2020_12_31_424971	241	39	-	-	HYPH
10_1101-2020_12_31_424971	241	40	coupled	couple	VBN
10_1101-2020_12_31_424971	241	41	70S	70S	NNP
10_1101-2020_12_31_424971	241	42	ribosomes	ribosome	NNS
10_1101-2020_12_31_424971	241	43	isolated	isolate	VBN
10_1101-2020_12_31_424971	241	44	from	from	IN
10_1101-2020_12_31_424971	241	45	588	588	CD
10_1101-2020_12_31_424971	241	46	E.	E.	NNP
10_1101-2020_12_31_424971	241	47	coli	coli	NNS
10_1101-2020_12_31_424971	241	48	MRE600	MRE600	NNP
10_1101-2020_12_31_424971	241	49	cells	cell	NNS
10_1101-2020_12_31_424971	241	50	.	.	.
10_1101-2020_12_31_424971	242	1	Recombinant	recombinant	VB
10_1101-2020_12_31_424971	242	2	His	-PRON-	PRP$
10_1101-2020_12_31_424971	242	3	-	-	HYPH
10_1101-2020_12_31_424971	242	4	tagged	tag	VBN
10_1101-2020_12_31_424971	242	5	E.	E.	NNP
10_1101-2020_12_31_424971	242	6	coli	coli	NNS
10_1101-2020_12_31_424971	242	7	EF	EF	NNP
10_1101-2020_12_31_424971	242	8	-	-	HYPH
10_1101-2020_12_31_424971	242	9	P	p	NN
10_1101-2020_12_31_424971	242	10	bearing	bear	VBG
10_1101-2020_12_31_424971	242	11	a	a	DT
10_1101-2020_12_31_424971	242	12	b	b	NN
10_1101-2020_12_31_424971	242	13	-	-	HYPH
10_1101-2020_12_31_424971	242	14	lysyl	lysyl	JJ
10_1101-2020_12_31_424971	242	15	-	-	HYPH
10_1101-2020_12_31_424971	242	16	K34	K34	NNP
10_1101-2020_12_31_424971	242	17	was	be	VBD
10_1101-2020_12_31_424971	242	18	expressed	express	VBN
10_1101-2020_12_31_424971	242	19	589	589	CD
10_1101-2020_12_31_424971	242	20	and	and	CC
10_1101-2020_12_31_424971	242	21	purified	purify	VBN
10_1101-2020_12_31_424971	242	22	from	from	IN
10_1101-2020_12_31_424971	242	23	cells	cell	NNS
10_1101-2020_12_31_424971	242	24	co	co	JJ
10_1101-2020_12_31_424971	242	25	-	-	JJ
10_1101-2020_12_31_424971	242	26	expressing	expressing	JJ
10_1101-2020_12_31_424971	242	27	efp	efp	NN
10_1101-2020_12_31_424971	242	28	,	,	,
10_1101-2020_12_31_424971	242	29	yjeA	yjea	CD
10_1101-2020_12_31_424971	242	30	,	,	,
10_1101-2020_12_31_424971	242	31	and	and	CC
10_1101-2020_12_31_424971	242	32	yjeK	yjeK	,
10_1101-2020_12_31_424971	242	33	and	and	CC
10_1101-2020_12_31_424971	242	34	stored	store	VBD
10_1101-2020_12_31_424971	242	35	at	at	IN
10_1101-2020_12_31_424971	242	36	–	–	:
10_1101-2020_12_31_424971	242	37	20	20	CD
10_1101-2020_12_31_424971	242	38	°	°	NNS
10_1101-2020_12_31_424971	242	39	C29	C29	NNP
10_1101-2020_12_31_424971	242	40	.	.	.
10_1101-2020_12_31_424971	243	1	590	590	CD
10_1101-2020_12_31_424971	243	2	591	591	CD
10_1101-2020_12_31_424971	243	3	Preparation	preparation	NN
10_1101-2020_12_31_424971	243	4	of	of	IN
10_1101-2020_12_31_424971	243	5	translation	translation	NN
10_1101-2020_12_31_424971	243	6	components	component	NNS
10_1101-2020_12_31_424971	243	7	for	for	IN
10_1101-2020_12_31_424971	243	8	smFRET	smfret	NN
10_1101-2020_12_31_424971	243	9	experiments	experiment	NNS
10_1101-2020_12_31_424971	243	10	.	.	.
10_1101-2020_12_31_424971	244	1	30S	30s	CD
10_1101-2020_12_31_424971	244	2	subunits	subunit	NNS
10_1101-2020_12_31_424971	244	3	and	and	CC
10_1101-2020_12_31_424971	244	4	50S	50s	CD
10_1101-2020_12_31_424971	244	5	592	592	CD
10_1101-2020_12_31_424971	244	6	subunits	subunit	NNS
10_1101-2020_12_31_424971	244	7	lacking	lack	VBG
10_1101-2020_12_31_424971	244	8	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	244	9	proteins	protein	NNS
10_1101-2020_12_31_424971	244	10	bL9	bL9	NNP
10_1101-2020_12_31_424971	244	11	and	and	CC
10_1101-2020_12_31_424971	244	12	uL1	uL1	NNP
10_1101-2020_12_31_424971	244	13	were	be	VBD
10_1101-2020_12_31_424971	244	14	purified	purify	VBN
10_1101-2020_12_31_424971	244	15	from	from	IN
10_1101-2020_12_31_424971	244	16	a	a	DT
10_1101-2020_12_31_424971	244	17	previously	previously	RB
10_1101-2020_12_31_424971	244	18	described	describe	VBN
10_1101-2020_12_31_424971	244	19	bL9	bL9	NNP
10_1101-2020_12_31_424971	244	20	-	-	:
10_1101-2020_12_31_424971	244	21	593	593	NNP
10_1101-2020_12_31_424971	244	22	uL1	ul1	RB
10_1101-2020_12_31_424971	244	23	double	double	JJ
10_1101-2020_12_31_424971	244	24	deletion	deletion	NN
10_1101-2020_12_31_424971	244	25	E.	E.	NNP
10_1101-2020_12_31_424971	244	26	coli	coli	NNS
10_1101-2020_12_31_424971	244	27	strain35,60	strain35,60	NNP
10_1101-2020_12_31_424971	244	28	using	use	VBG
10_1101-2020_12_31_424971	244	29	previously	previously	RB
10_1101-2020_12_31_424971	244	30	described	describe	VBN
10_1101-2020_12_31_424971	244	31	protocols35,37,60	protocols35,37,60	NNP
10_1101-2020_12_31_424971	244	32	.	.	.
10_1101-2020_12_31_424971	245	1	A	a	DT
10_1101-2020_12_31_424971	245	2	previously	previously	RB
10_1101-2020_12_31_424971	245	3	594	594	CD
10_1101-2020_12_31_424971	245	4	described	describe	VBN
10_1101-2020_12_31_424971	245	5	single	single	JJ
10_1101-2020_12_31_424971	245	6	-	-	HYPH
10_1101-2020_12_31_424971	245	7	cysteine	cysteine	NN
10_1101-2020_12_31_424971	245	8	variant	variant	NN
10_1101-2020_12_31_424971	245	9	of	of	IN
10_1101-2020_12_31_424971	245	10	bL9	bl9	NN
10_1101-2020_12_31_424971	245	11	carrying	carry	VBG
10_1101-2020_12_31_424971	245	12	a	a	DT
10_1101-2020_12_31_424971	245	13	Gln	Gln	NNP
10_1101-2020_12_31_424971	245	14	-	-	HYPH
10_1101-2020_12_31_424971	245	15	to	to	IN
10_1101-2020_12_31_424971	245	16	-	-	HYPH
10_1101-2020_12_31_424971	245	17	Cys	cys	NN
10_1101-2020_12_31_424971	245	18	substitution	substitution	NN
10_1101-2020_12_31_424971	245	19	mutation	mutation	NN
10_1101-2020_12_31_424971	245	20	at	at	IN
10_1101-2020_12_31_424971	245	21	residue	residue	NN
10_1101-2020_12_31_424971	245	22	595	595	CD
10_1101-2020_12_31_424971	245	23	position	position	NN
10_1101-2020_12_31_424971	245	24	18	18	CD
10_1101-2020_12_31_424971	245	25	(	(	-LRB-
10_1101-2020_12_31_424971	245	26	bL9(Q18C))35	bL9(Q18C))35	NNP
10_1101-2020_12_31_424971	245	27	and	and	CC
10_1101-2020_12_31_424971	245	28	a	a	DT
10_1101-2020_12_31_424971	245	29	previously	previously	RB
10_1101-2020_12_31_424971	245	30	described	describe	VBN
10_1101-2020_12_31_424971	245	31	single	single	JJ
10_1101-2020_12_31_424971	245	32	-	-	HYPH
10_1101-2020_12_31_424971	245	33	cysteine	cysteine	NN
10_1101-2020_12_31_424971	245	34	variant	variant	NN
10_1101-2020_12_31_424971	245	35	of	of	IN
10_1101-2020_12_31_424971	245	36	uL1	uL1	NNS
10_1101-2020_12_31_424971	245	37	carrying	carry	VBG
10_1101-2020_12_31_424971	245	38	a	a	DT
10_1101-2020_12_31_424971	245	39	596	596	CD
10_1101-2020_12_31_424971	245	40	Thr	Thr	NNP
10_1101-2020_12_31_424971	245	41	-	-	HYPH
10_1101-2020_12_31_424971	245	42	to	to	IN
10_1101-2020_12_31_424971	245	43	-	-	HYPH
10_1101-2020_12_31_424971	245	44	Cys	cys	NN
10_1101-2020_12_31_424971	245	45	substitution	substitution	NN
10_1101-2020_12_31_424971	245	46	mutation	mutation	NN
10_1101-2020_12_31_424971	245	47	at	at	IN
10_1101-2020_12_31_424971	245	48	residue	residue	JJ
10_1101-2020_12_31_424971	245	49	position	position	NN
10_1101-2020_12_31_424971	245	50	202	202	CD
10_1101-2020_12_31_424971	245	51	(	(	-LRB-
10_1101-2020_12_31_424971	245	52	uL1(T202C))35,37	uL1(T202C))35,37	NNP
10_1101-2020_12_31_424971	245	53	were	be	VBD
10_1101-2020_12_31_424971	245	54	purified	purify	VBN
10_1101-2020_12_31_424971	245	55	,	,	,
10_1101-2020_12_31_424971	245	56	labeled	label	VBD
10_1101-2020_12_31_424971	245	57	597	597	CD
10_1101-2020_12_31_424971	245	58	with	with	IN
10_1101-2020_12_31_424971	245	59	Cy3-	cy3-	CD
10_1101-2020_12_31_424971	245	60	and	and	CC
10_1101-2020_12_31_424971	245	61	Cy5-maleimide	Cy5-maleimide	NNP
10_1101-2020_12_31_424971	245	62	,	,	,
10_1101-2020_12_31_424971	245	63	respectively	respectively	RB
10_1101-2020_12_31_424971	245	64	,	,	,
10_1101-2020_12_31_424971	245	65	to	to	TO
10_1101-2020_12_31_424971	245	66	generate	generate	VB
10_1101-2020_12_31_424971	245	67	bL9(Cy3	bl9(cy3	NN
10_1101-2020_12_31_424971	245	68	)	)	-RRB-
10_1101-2020_12_31_424971	245	69	and	and	CC
10_1101-2020_12_31_424971	245	70	uL1(Cy5	ul1(cy5	NN
10_1101-2020_12_31_424971	245	71	)	)	-RRB-
10_1101-2020_12_31_424971	245	72	,	,	,
10_1101-2020_12_31_424971	245	73	and	and	CC
10_1101-2020_12_31_424971	245	74	598	598	CD
10_1101-2020_12_31_424971	245	75	reconstituted	reconstitute	VBN
10_1101-2020_12_31_424971	245	76	into	into	IN
10_1101-2020_12_31_424971	245	77	the	the	DT
10_1101-2020_12_31_424971	245	78	50S	50S	NNP
10_1101-2020_12_31_424971	245	79	subunits	subunit	NNS
10_1101-2020_12_31_424971	245	80	lacking	lack	VBG
10_1101-2020_12_31_424971	245	81	bL9	bl9	NN
10_1101-2020_12_31_424971	245	82	and	and	CC
10_1101-2020_12_31_424971	245	83	uL1	ul1	RB
10_1101-2020_12_31_424971	245	84	following	follow	VBG
10_1101-2020_12_31_424971	245	85	previously	previously	RB
10_1101-2020_12_31_424971	245	86	described	describe	VBN
10_1101-2020_12_31_424971	245	87	599	599	CD
10_1101-2020_12_31_424971	245	88	protocols35	protocols35	NNS
10_1101-2020_12_31_424971	245	89	.	.	.
10_1101-2020_12_31_424971	246	1	The	the	DT
10_1101-2020_12_31_424971	246	2	reconstituted	reconstituted	JJ
10_1101-2020_12_31_424971	246	3	bL9(Cy3)-	bl9(cy3)-	NN
10_1101-2020_12_31_424971	246	4	and	and	CC
10_1101-2020_12_31_424971	246	5	uL1(Cy5)-labeled	ul1(cy5)-labeled	CD
10_1101-2020_12_31_424971	246	6	50S	50s	CD
10_1101-2020_12_31_424971	246	7	subunits	subunit	NNS
10_1101-2020_12_31_424971	246	8	were	be	VBD
10_1101-2020_12_31_424971	246	9	then	then	RB
10_1101-2020_12_31_424971	246	10	re	re	NN
10_1101-2020_12_31_424971	246	11	-	-	VBN
10_1101-2020_12_31_424971	246	12	purified	purify	VBD
10_1101-2020_12_31_424971	246	13	600	600	CD
10_1101-2020_12_31_424971	246	14	.CC	.CC	,
10_1101-2020_12_31_424971	246	15	-	-	HYPH
10_1101-2020_12_31_424971	246	16	BY	by	IN
10_1101-2020_12_31_424971	246	17	-	-	HYPH
10_1101-2020_12_31_424971	246	18	NC	NC	NNP
10_1101-2020_12_31_424971	246	19	-	-	HYPH
10_1101-2020_12_31_424971	246	20	ND	ND	NNP
10_1101-2020_12_31_424971	246	21	4.0	4.0	CD
10_1101-2020_12_31_424971	246	22	International	International	NNP
10_1101-2020_12_31_424971	246	23	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	246	24	under	under	IN
10_1101-2020_12_31_424971	246	25	a	a	DT
10_1101-2020_12_31_424971	246	26	(	(	-LRB-
10_1101-2020_12_31_424971	246	27	which	which	WDT
10_1101-2020_12_31_424971	246	28	was	be	VBD
10_1101-2020_12_31_424971	246	29	not	not	RB
10_1101-2020_12_31_424971	246	30	certified	certify	VBN
10_1101-2020_12_31_424971	246	31	by	by	IN
10_1101-2020_12_31_424971	246	32	peer	peer	NN
10_1101-2020_12_31_424971	246	33	review	review	NN
10_1101-2020_12_31_424971	246	34	)	)	-RRB-
10_1101-2020_12_31_424971	246	35	is	be	VBZ
10_1101-2020_12_31_424971	246	36	the	the	DT
10_1101-2020_12_31_424971	246	37	author	author	NN
10_1101-2020_12_31_424971	246	38	/	/	SYM
10_1101-2020_12_31_424971	246	39	funder	funder	NN
10_1101-2020_12_31_424971	246	40	,	,	,
10_1101-2020_12_31_424971	246	41	who	who	WP
10_1101-2020_12_31_424971	246	42	has	have	VBZ
10_1101-2020_12_31_424971	246	43	granted	grant	VBN
10_1101-2020_12_31_424971	246	44	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	246	45	a	a	DT
10_1101-2020_12_31_424971	246	46	license	license	NN
10_1101-2020_12_31_424971	246	47	to	to	TO
10_1101-2020_12_31_424971	246	48	display	display	VB
10_1101-2020_12_31_424971	246	49	the	the	DT
10_1101-2020_12_31_424971	246	50	preprint	preprint	NN
10_1101-2020_12_31_424971	246	51	in	in	IN
10_1101-2020_12_31_424971	246	52	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	246	53	.	.	.
10_1101-2020_12_31_424971	247	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	247	2	is	be	VBZ
10_1101-2020_12_31_424971	247	3	made	make	VBN
10_1101-2020_12_31_424971	247	4	The	the	DT
10_1101-2020_12_31_424971	247	5	copyright	copyright	NN
10_1101-2020_12_31_424971	247	6	holder	holder	NN
10_1101-2020_12_31_424971	247	7	for	for	IN
10_1101-2020_12_31_424971	247	8	this	this	DT
10_1101-2020_12_31_424971	247	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	247	10	version	version	NN
10_1101-2020_12_31_424971	247	11	posted	post	VBD
10_1101-2020_12_31_424971	247	12	January	January	NNP
10_1101-2020_12_31_424971	247	13	2	2	CD
10_1101-2020_12_31_424971	247	14	,	,	,
10_1101-2020_12_31_424971	247	15	2021	2021	CD
10_1101-2020_12_31_424971	247	16	.	.	.
10_1101-2020_12_31_424971	247	17	;	;	:
10_1101-2020_12_31_424971	247	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	247	19	:	:	:
10_1101-2020_12_31_424971	247	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	247	21	preprint	preprint	NN
10_1101-2020_12_31_424971	247	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	247	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	247	24	25	25	CD
10_1101-2020_12_31_424971	247	25	using	use	VBG
10_1101-2020_12_31_424971	247	26	sucrose	sucrose	JJ
10_1101-2020_12_31_424971	247	27	density	density	NN
10_1101-2020_12_31_424971	247	28	gradient	gradient	NN
10_1101-2020_12_31_424971	247	29	ultracentrifugation35,43	ultracentrifugation35,43	NNP
10_1101-2020_12_31_424971	247	30	.	.	.
10_1101-2020_12_31_424971	248	1	50S	50s	CD
10_1101-2020_12_31_424971	248	2	subunits	subunit	NNS
10_1101-2020_12_31_424971	248	3	lacking	lack	VBG
10_1101-2020_12_31_424971	248	4	bL9(Cy3	bl9(cy3	NN
10_1101-2020_12_31_424971	248	5	)	)	-RRB-
10_1101-2020_12_31_424971	248	6	and/or	and/or	CC
10_1101-2020_12_31_424971	248	7	601	601	CD
10_1101-2020_12_31_424971	248	8	uL1(Cy5	ul1(cy5	CD
10_1101-2020_12_31_424971	248	9	)	)	-RRB-
10_1101-2020_12_31_424971	248	10	or	or	CC
10_1101-2020_12_31_424971	248	11	harboring	harbor	VBG
10_1101-2020_12_31_424971	248	12	unlabeled	unlabeled	JJ
10_1101-2020_12_31_424971	248	13	bL9	bl9	NN
10_1101-2020_12_31_424971	248	14	and/or	and/or	CC
10_1101-2020_12_31_424971	248	15	uL1	ul1	NN
10_1101-2020_12_31_424971	248	16	do	do	VBP
10_1101-2020_12_31_424971	248	17	not	not	RB
10_1101-2020_12_31_424971	248	18	generate	generate	VB
10_1101-2020_12_31_424971	248	19	bL9(Cy3)-uL1(Cy5	bl9(cy3)-ul1(cy5	NN
10_1101-2020_12_31_424971	248	20	)	)	-RRB-
10_1101-2020_12_31_424971	248	21	smFRET	smfret	NN
10_1101-2020_12_31_424971	248	22	602	602	CD
10_1101-2020_12_31_424971	248	23	signals	signal	NNS
10_1101-2020_12_31_424971	248	24	and	and	CC
10_1101-2020_12_31_424971	248	25	therefore	therefore	RB
10_1101-2020_12_31_424971	248	26	do	do	VBP
10_1101-2020_12_31_424971	248	27	not	not	RB
10_1101-2020_12_31_424971	248	28	affect	affect	VB
10_1101-2020_12_31_424971	248	29	data	datum	NNS
10_1101-2020_12_31_424971	248	30	collection	collection	NN
10_1101-2020_12_31_424971	248	31	or	or	CC
10_1101-2020_12_31_424971	248	32	analysis	analysis	NN
10_1101-2020_12_31_424971	248	33	.	.	.
10_1101-2020_12_31_424971	249	1	Previously	previously	RB
10_1101-2020_12_31_424971	249	2	,	,	,
10_1101-2020_12_31_424971	249	3	we	-PRON-	PRP
10_1101-2020_12_31_424971	249	4	have	have	VBP
10_1101-2020_12_31_424971	249	5	shown	show	VBN
10_1101-2020_12_31_424971	249	6	that	that	IN
10_1101-2020_12_31_424971	249	7	603	603	CD
10_1101-2020_12_31_424971	249	8	70S	70S	NNP
10_1101-2020_12_31_424971	249	9	ICs	ic	NNS
10_1101-2020_12_31_424971	249	10	formed	form	VBD
10_1101-2020_12_31_424971	249	11	with	with	IN
10_1101-2020_12_31_424971	249	12	these	these	DT
10_1101-2020_12_31_424971	249	13	bL9(Cy3)-	bL9(Cy3)-	NNS
10_1101-2020_12_31_424971	249	14	and	and	CC
10_1101-2020_12_31_424971	249	15	uL1(Cy5)-containing	ul1(cy5)-containing	CD
10_1101-2020_12_31_424971	249	16	50S	50s	CD
10_1101-2020_12_31_424971	249	17	subunits	subunit	NNS
10_1101-2020_12_31_424971	249	18	can	can	MD
10_1101-2020_12_31_424971	249	19	undergo	undergo	VB
10_1101-2020_12_31_424971	249	20	604	604	CD
10_1101-2020_12_31_424971	249	21	peptide	peptide	NN
10_1101-2020_12_31_424971	249	22	-	-	HYPH
10_1101-2020_12_31_424971	249	23	bond	bond	NN
10_1101-2020_12_31_424971	249	24	formation	formation	NN
10_1101-2020_12_31_424971	249	25	and	and	CC
10_1101-2020_12_31_424971	249	26	two	two	CD
10_1101-2020_12_31_424971	249	27	rounds	round	NNS
10_1101-2020_12_31_424971	249	28	of	of	IN
10_1101-2020_12_31_424971	249	29	translocation	translocation	NN
10_1101-2020_12_31_424971	249	30	elongation	elongation	NN
10_1101-2020_12_31_424971	249	31	with	with	IN
10_1101-2020_12_31_424971	249	32	similar	similar	JJ
10_1101-2020_12_31_424971	249	33	efficiency	efficiency	NN
10_1101-2020_12_31_424971	249	34	as	as	IN
10_1101-2020_12_31_424971	249	35	70S	70S	NNP
10_1101-2020_12_31_424971	249	36	605	605	CD
10_1101-2020_12_31_424971	249	37	ICs	ic	NNS
10_1101-2020_12_31_424971	249	38	formed	form	VBN
10_1101-2020_12_31_424971	249	39	with	with	IN
10_1101-2020_12_31_424971	249	40	wild	wild	JJ
10_1101-2020_12_31_424971	249	41	-	-	HYPH
10_1101-2020_12_31_424971	249	42	type	type	NN
10_1101-2020_12_31_424971	249	43	50S	50S	NNP
10_1101-2020_12_31_424971	249	44	subunits35	subunits35	NNP
10_1101-2020_12_31_424971	249	45	.	.	.
10_1101-2020_12_31_424971	250	1	606	606	CD
10_1101-2020_12_31_424971	250	2	The	the	DT
10_1101-2020_12_31_424971	250	3	sequence	sequence	NN
10_1101-2020_12_31_424971	250	4	of	of	IN
10_1101-2020_12_31_424971	250	5	the	the	DT
10_1101-2020_12_31_424971	250	6	mRNA	mrna	NN
10_1101-2020_12_31_424971	250	7	used	use	VBN
10_1101-2020_12_31_424971	250	8	for	for	IN
10_1101-2020_12_31_424971	250	9	assembling	assemble	VBG
10_1101-2020_12_31_424971	250	10	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	250	11	complexes	complex	NNS
10_1101-2020_12_31_424971	250	12	for	for	IN
10_1101-2020_12_31_424971	250	13	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	250	14	studies	study	NNS
10_1101-2020_12_31_424971	250	15	607	607	CD
10_1101-2020_12_31_424971	250	16	is	be	VBZ
10_1101-2020_12_31_424971	250	17	shown	show	VBN
10_1101-2020_12_31_424971	250	18	below	below	IN
10_1101-2020_12_31_424971	250	19	,	,	,
10_1101-2020_12_31_424971	250	20	including	include	VBG
10_1101-2020_12_31_424971	250	21	the	the	DT
10_1101-2020_12_31_424971	250	22	Shine	Shine	NNP
10_1101-2020_12_31_424971	250	23	-	-	HYPH
10_1101-2020_12_31_424971	250	24	Dalgarno	Dalgarno	NNP
10_1101-2020_12_31_424971	250	25	sequence	sequence	NN
10_1101-2020_12_31_424971	250	26	,	,	,
10_1101-2020_12_31_424971	250	27	the	the	DT
10_1101-2020_12_31_424971	250	28	AUG	AUG	NNP
10_1101-2020_12_31_424971	250	29	start	start	VBP
10_1101-2020_12_31_424971	250	30	codon	codon	NNP
10_1101-2020_12_31_424971	250	31	,	,	,
10_1101-2020_12_31_424971	250	32	and	and	CC
10_1101-2020_12_31_424971	250	33	the	the	DT
10_1101-2020_12_31_424971	250	34	CCC	CCC	NNP
10_1101-2020_12_31_424971	250	35	-	-	HYPH
10_1101-2020_12_31_424971	250	36	C	C	NNP
10_1101-2020_12_31_424971	250	37	608	608	CD
10_1101-2020_12_31_424971	250	38	motif	motif	NN
10_1101-2020_12_31_424971	250	39	:	:	:
10_1101-2020_12_31_424971	250	40	609	609	CD
10_1101-2020_12_31_424971	250	41	5'-GCAACCUAAAACUCACACAGGGCCCUAAGGACAUAAAAAUGCCCCGUU	5'-gcaaccuaaaacucacacagggcccuaaggacauaaaaaugccccguu	CD
10_1101-2020_12_31_424971	250	42	610	610	CD
10_1101-2020_12_31_424971	250	43	AUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA	AUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA	NNP
10_1101-2020_12_31_424971	250	44	.	.	.
10_1101-2020_12_31_424971	251	1	611	611	CD
10_1101-2020_12_31_424971	251	2	The	the	DT
10_1101-2020_12_31_424971	251	3	mRNA	mrna	NN
10_1101-2020_12_31_424971	251	4	was	be	VBD
10_1101-2020_12_31_424971	251	5	synthesized	synthesize	VBN
10_1101-2020_12_31_424971	251	6	by	by	IN
10_1101-2020_12_31_424971	251	7	in	in	IN
10_1101-2020_12_31_424971	251	8	vitro	vitro	FW
10_1101-2020_12_31_424971	251	9	transcription	transcription	NN
10_1101-2020_12_31_424971	251	10	using	use	VBG
10_1101-2020_12_31_424971	251	11	T7	T7	NNP
10_1101-2020_12_31_424971	251	12	RNA	RNA	NNP
10_1101-2020_12_31_424971	251	13	polymerase	polymerase	NN
10_1101-2020_12_31_424971	251	14	,	,	,
10_1101-2020_12_31_424971	251	15	and	and	CC
10_1101-2020_12_31_424971	251	16	then	then	RB
10_1101-2020_12_31_424971	251	17	612	612	CD
10_1101-2020_12_31_424971	251	18	hybridized	hybridize	VBD
10_1101-2020_12_31_424971	251	19	to	to	IN
10_1101-2020_12_31_424971	251	20	a	a	DT
10_1101-2020_12_31_424971	251	21	previously	previously	RB
10_1101-2020_12_31_424971	251	22	described	describe	VBN
10_1101-2020_12_31_424971	251	23	3’-biotinylated	3’-biotinylated	CD
10_1101-2020_12_31_424971	251	24	DNA	dna	NN
10_1101-2020_12_31_424971	251	25	oligonucleotide	oligonucleotide	RB
10_1101-2020_12_31_424971	251	26	(	(	-LRB-
10_1101-2020_12_31_424971	251	27	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	251	28	Table	Table	NNP
10_1101-2020_12_31_424971	251	29	613	613	CD
10_1101-2020_12_31_424971	251	30	1	1	CD
10_1101-2020_12_31_424971	251	31	)	)	-RRB-
10_1101-2020_12_31_424971	251	32	that	that	WDT
10_1101-2020_12_31_424971	251	33	was	be	VBD
10_1101-2020_12_31_424971	251	34	complementary	complementary	JJ
10_1101-2020_12_31_424971	251	35	to	to	IN
10_1101-2020_12_31_424971	251	36	the	the	DT
10_1101-2020_12_31_424971	251	37	5	5	CD
10_1101-2020_12_31_424971	251	38	'	'	''
10_1101-2020_12_31_424971	251	39	end	end	NN
10_1101-2020_12_31_424971	251	40	of	of	IN
10_1101-2020_12_31_424971	251	41	the	the	DT
10_1101-2020_12_31_424971	251	42	mRNA	mrna	NN
10_1101-2020_12_31_424971	251	43	and	and	CC
10_1101-2020_12_31_424971	251	44	was	be	VBD
10_1101-2020_12_31_424971	251	45	chemically	chemically	RB
10_1101-2020_12_31_424971	251	46	synthesized	synthesize	VBN
10_1101-2020_12_31_424971	251	47	by	by	IN
10_1101-2020_12_31_424971	251	48	614	614	CD
10_1101-2020_12_31_424971	251	49	Integrated	Integrated	NNP
10_1101-2020_12_31_424971	251	50	DNA	DNA	NNP
10_1101-2020_12_31_424971	251	51	Technologies60	Technologies60	NNP
10_1101-2020_12_31_424971	251	52	.	.	.
10_1101-2020_12_31_424971	252	1	Hybridized	hybridize	VBN
10_1101-2020_12_31_424971	252	2	mRNA	mrna	RB
10_1101-2020_12_31_424971	252	3	:	:	:
10_1101-2020_12_31_424971	252	4	DNA	dna	NN
10_1101-2020_12_31_424971	252	5	-	-	HYPH
10_1101-2020_12_31_424971	252	6	biotin	biotin	JJ
10_1101-2020_12_31_424971	252	7	complexes	complex	NNS
10_1101-2020_12_31_424971	252	8	were	be	VBD
10_1101-2020_12_31_424971	252	9	stored	store	VBN
10_1101-2020_12_31_424971	252	10	in	in	IN
10_1101-2020_12_31_424971	252	11	10	10	CD
10_1101-2020_12_31_424971	252	12	mM	mM	NNP
10_1101-2020_12_31_424971	252	13	615	615	CD
10_1101-2020_12_31_424971	252	14	Tris	Tris	NNP
10_1101-2020_12_31_424971	252	15	-	-	HYPH
10_1101-2020_12_31_424971	252	16	OAc	OAc	NNS
10_1101-2020_12_31_424971	252	17	(	(	-LRB-
10_1101-2020_12_31_424971	252	18	pH	pH	NNP
10_1101-2020_12_31_424971	252	19	=	=	SYM
10_1101-2020_12_31_424971	252	20	7.5	7.5	CD
10_1101-2020_12_31_424971	252	21	at	at	IN
10_1101-2020_12_31_424971	252	22	37	37	CD
10_1101-2020_12_31_424971	252	23	ºC	ºC	NNP
10_1101-2020_12_31_424971	252	24	)	)	-RRB-
10_1101-2020_12_31_424971	252	25	,	,	,
10_1101-2020_12_31_424971	252	26	1	1	CD
10_1101-2020_12_31_424971	252	27	mM	mm	NN
10_1101-2020_12_31_424971	252	28	EDTA	edta	NN
10_1101-2020_12_31_424971	252	29	,	,	,
10_1101-2020_12_31_424971	252	30	and	and	CC
10_1101-2020_12_31_424971	252	31	10	10	CD
10_1101-2020_12_31_424971	252	32	mM	mm	NN
10_1101-2020_12_31_424971	252	33	KCl	KCl	NNS
10_1101-2020_12_31_424971	252	34	at	at	IN
10_1101-2020_12_31_424971	252	35	–	–	:
10_1101-2020_12_31_424971	252	36	80	80	CD
10_1101-2020_12_31_424971	252	37	ºC	ºC	NNP
10_1101-2020_12_31_424971	252	38	until	until	IN
10_1101-2020_12_31_424971	252	39	they	-PRON-	PRP
10_1101-2020_12_31_424971	252	40	were	be	VBD
10_1101-2020_12_31_424971	252	41	used	use	VBN
10_1101-2020_12_31_424971	252	42	in	in	IN
10_1101-2020_12_31_424971	252	43	616	616	CD
10_1101-2020_12_31_424971	252	44	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	252	45	complex	complex	JJ
10_1101-2020_12_31_424971	252	46	assembly	assembly	NN
10_1101-2020_12_31_424971	252	47	.	.	.
10_1101-2020_12_31_424971	253	1	Aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	253	2	and	and	CC
10_1101-2020_12_31_424971	253	3	formylation	formylation	NN
10_1101-2020_12_31_424971	253	4	of	of	IN
10_1101-2020_12_31_424971	253	5	tRNAfMet	tRNAfMet	NNP
10_1101-2020_12_31_424971	253	6	(	(	-LRB-
10_1101-2020_12_31_424971	253	7	purchased	purchase	VBN
10_1101-2020_12_31_424971	253	8	from	from	IN
10_1101-2020_12_31_424971	253	9	MP	MP	NNP
10_1101-2020_12_31_424971	253	10	617	617	CD
10_1101-2020_12_31_424971	253	11	Biomedicals	Biomedicals	NNPS
10_1101-2020_12_31_424971	253	12	)	)	-RRB-
10_1101-2020_12_31_424971	253	13	was	be	VBD
10_1101-2020_12_31_424971	253	14	achieved	achieve	VBN
10_1101-2020_12_31_424971	253	15	simultaneously	simultaneously	RB
10_1101-2020_12_31_424971	253	16	using	use	VBG
10_1101-2020_12_31_424971	253	17	E.	E.	NNP
10_1101-2020_12_31_424971	253	18	coli	coli	NNS
10_1101-2020_12_31_424971	253	19	methionyl	methionyl	NN
10_1101-2020_12_31_424971	253	20	-	-	HYPH
10_1101-2020_12_31_424971	253	21	tRNA	trna	JJ
10_1101-2020_12_31_424971	253	22	synthetase	synthetase	NN
10_1101-2020_12_31_424971	253	23	and	and	CC
10_1101-2020_12_31_424971	253	24	E.	E.	NNP
10_1101-2020_12_31_424971	253	25	coli	coli	VBZ
10_1101-2020_12_31_424971	253	26	618	618	CD
10_1101-2020_12_31_424971	253	27	formylmethionyl	formylmethionyl	NN
10_1101-2020_12_31_424971	253	28	-	-	HYPH
10_1101-2020_12_31_424971	253	29	tRNA	trna	JJ
10_1101-2020_12_31_424971	253	30	formyltransferase60	formyltransferase60	NN
10_1101-2020_12_31_424971	253	31	.	.	.
10_1101-2020_12_31_424971	254	1	Expression	expression	NN
10_1101-2020_12_31_424971	254	2	and	and	CC
10_1101-2020_12_31_424971	254	3	purification	purification	NN
10_1101-2020_12_31_424971	254	4	of	of	IN
10_1101-2020_12_31_424971	254	5	IF1	IF1	NNP
10_1101-2020_12_31_424971	254	6	,	,	,
10_1101-2020_12_31_424971	254	7	IF2	IF2	NNP
10_1101-2020_12_31_424971	254	8	,	,	,
10_1101-2020_12_31_424971	254	9	IF3	IF3	NNP
10_1101-2020_12_31_424971	254	10	,	,	,
10_1101-2020_12_31_424971	254	11	EF	EF	NNP
10_1101-2020_12_31_424971	254	12	-	-	HYPH
10_1101-2020_12_31_424971	254	13	Tu	Tu	NNP
10_1101-2020_12_31_424971	254	14	,	,	,
10_1101-2020_12_31_424971	254	15	619	619	CD
10_1101-2020_12_31_424971	254	16	EF	EF	NNP
10_1101-2020_12_31_424971	254	17	-	-	HYPH
10_1101-2020_12_31_424971	254	18	Ts	Ts	NNP
10_1101-2020_12_31_424971	254	19	,	,	,
10_1101-2020_12_31_424971	254	20	and	and	CC
10_1101-2020_12_31_424971	254	21	EF	EF	NNP
10_1101-2020_12_31_424971	254	22	-	-	HYPH
10_1101-2020_12_31_424971	254	23	G	G	NNP
10_1101-2020_12_31_424971	254	24	were	be	VBD
10_1101-2020_12_31_424971	254	25	following	follow	VBG
10_1101-2020_12_31_424971	254	26	previously	previously	RB
10_1101-2020_12_31_424971	254	27	published	publish	VBN
10_1101-2020_12_31_424971	254	28	procedures60	procedures60	NNS
10_1101-2020_12_31_424971	254	29	.	.	.
10_1101-2020_12_31_424971	255	1	620	620	CD
10_1101-2020_12_31_424971	255	2	621	621	CD
10_1101-2020_12_31_424971	255	3	Preparation	preparation	NN
10_1101-2020_12_31_424971	255	4	and	and	CC
10_1101-2020_12_31_424971	255	5	purification	purification	NN
10_1101-2020_12_31_424971	255	6	of	of	IN
10_1101-2020_12_31_424971	255	7	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	255	8	and	and	CC
10_1101-2020_12_31_424971	255	9	ProL.	ProL.	.
10_1101-2020_12_31_424971	256	1	Native	native	JJ
10_1101-2020_12_31_424971	256	2	-	-	HYPH
10_1101-2020_12_31_424971	256	3	state	state	NN
10_1101-2020_12_31_424971	256	4	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	256	5	was	be	VBD
10_1101-2020_12_31_424971	256	6	isolated	isolate	VBN
10_1101-2020_12_31_424971	256	7	from	from	IN
10_1101-2020_12_31_424971	256	8	a	a	DT
10_1101-2020_12_31_424971	256	9	622	622	CD
10_1101-2020_12_31_424971	256	10	derivative	derivative	NN
10_1101-2020_12_31_424971	256	11	of	of	IN
10_1101-2020_12_31_424971	256	12	E.	E.	NNP
10_1101-2020_12_31_424971	256	13	coli	coli	NNS
10_1101-2020_12_31_424971	256	14	JM109	JM109	NNP
10_1101-2020_12_31_424971	256	15	lacking	lack	VBG
10_1101-2020_12_31_424971	256	16	the	the	DT
10_1101-2020_12_31_424971	256	17	endogenous	endogenous	JJ
10_1101-2020_12_31_424971	256	18	ProL	prol	NN
10_1101-2020_12_31_424971	256	19	,	,	,
10_1101-2020_12_31_424971	256	20	but	but	CC
10_1101-2020_12_31_424971	256	21	expressing	express	VBG
10_1101-2020_12_31_424971	256	22	SufB2	sufb2	NN
10_1101-2020_12_31_424971	256	23	from	from	IN
10_1101-2020_12_31_424971	256	24	the	the	DT
10_1101-2020_12_31_424971	256	25	pKK223	pKK223	NNP
10_1101-2020_12_31_424971	256	26	-	-	HYPH
10_1101-2020_12_31_424971	256	27	623	623	CD
10_1101-2020_12_31_424971	256	28	3	3	CD
10_1101-2020_12_31_424971	256	29	plasmid	plasmid	NN
10_1101-2020_12_31_424971	256	30	(	(	-LRB-
10_1101-2020_12_31_424971	256	31	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	256	32	Table	Table	NNP
10_1101-2020_12_31_424971	256	33	1	1	CD
10_1101-2020_12_31_424971	256	34	)	)	-RRB-
10_1101-2020_12_31_424971	256	35	,	,	,
10_1101-2020_12_31_424971	256	36	while	while	IN
10_1101-2020_12_31_424971	256	37	native	native	JJ
10_1101-2020_12_31_424971	256	38	-	-	HYPH
10_1101-2020_12_31_424971	256	39	state	state	NN
10_1101-2020_12_31_424971	256	40	ProL	ProL	NNP
10_1101-2020_12_31_424971	256	41	was	be	VBD
10_1101-2020_12_31_424971	256	42	purified	purify	VBN
10_1101-2020_12_31_424971	256	43	from	from	IN
10_1101-2020_12_31_424971	256	44	total	total	JJ
10_1101-2020_12_31_424971	256	45	tRNA	trna	NN
10_1101-2020_12_31_424971	256	46	isolated	isolate	VBD
10_1101-2020_12_31_424971	256	47	624	624	CD
10_1101-2020_12_31_424971	256	48	from	from	IN
10_1101-2020_12_31_424971	256	49	E.	E.	NNP
10_1101-2020_12_31_424971	256	50	coli	coli	NNS
10_1101-2020_12_31_424971	256	51	JM109	JM109	NNP
10_1101-2020_12_31_424971	256	52	cells	cell	NNS
10_1101-2020_12_31_424971	256	53	over	over	IN
10_1101-2020_12_31_424971	256	54	-	-	HYPH
10_1101-2020_12_31_424971	256	55	expressing	express	VBG
10_1101-2020_12_31_424971	256	56	ProL	prol	NN
10_1101-2020_12_31_424971	256	57	from	from	IN
10_1101-2020_12_31_424971	256	58	the	the	DT
10_1101-2020_12_31_424971	256	59	pKK223	pKK223	NNP
10_1101-2020_12_31_424971	256	60	-	-	HYPH
10_1101-2020_12_31_424971	256	61	3	3	CD
10_1101-2020_12_31_424971	256	62	plasmid	plasmid	NN
10_1101-2020_12_31_424971	256	63	.	.	.
10_1101-2020_12_31_424971	257	1	The	the	DT
10_1101-2020_12_31_424971	257	2	ProL	ProL	NNP
10_1101-2020_12_31_424971	257	3	-	-	HYPH
10_1101-2020_12_31_424971	257	4	KO	KO	NNP
10_1101-2020_12_31_424971	257	5	strain	strain	VBP
10_1101-2020_12_31_424971	257	6	625	625	CD
10_1101-2020_12_31_424971	257	7	lacking	lack	VBG
10_1101-2020_12_31_424971	257	8	the	the	DT
10_1101-2020_12_31_424971	257	9	endogenous	endogenous	JJ
10_1101-2020_12_31_424971	257	10	ProL	ProL	NNP
10_1101-2020_12_31_424971	257	11	was	be	VBD
10_1101-2020_12_31_424971	257	12	described	describe	VBN
10_1101-2020_12_31_424971	257	13	previously30	previously30	NNP
10_1101-2020_12_31_424971	257	14	.	.	.
10_1101-2020_12_31_424971	258	1	Each	each	DT
10_1101-2020_12_31_424971	258	2	native	native	JJ
10_1101-2020_12_31_424971	258	3	-	-	HYPH
10_1101-2020_12_31_424971	258	4	state	state	NN
10_1101-2020_12_31_424971	258	5	tRNA	trna	NN
10_1101-2020_12_31_424971	258	6	was	be	VBD
10_1101-2020_12_31_424971	258	7	isolated	isolate	VBN
10_1101-2020_12_31_424971	258	8	626	626	CD
10_1101-2020_12_31_424971	258	9	.CC	.CC	,
10_1101-2020_12_31_424971	258	10	-	-	HYPH
10_1101-2020_12_31_424971	258	11	BY	by	IN
10_1101-2020_12_31_424971	258	12	-	-	HYPH
10_1101-2020_12_31_424971	258	13	NC	NC	NNP
10_1101-2020_12_31_424971	258	14	-	-	HYPH
10_1101-2020_12_31_424971	258	15	ND	ND	NNP
10_1101-2020_12_31_424971	258	16	4.0	4.0	CD
10_1101-2020_12_31_424971	258	17	International	International	NNP
10_1101-2020_12_31_424971	258	18	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	258	19	under	under	IN
10_1101-2020_12_31_424971	258	20	a	a	DT
10_1101-2020_12_31_424971	258	21	(	(	-LRB-
10_1101-2020_12_31_424971	258	22	which	which	WDT
10_1101-2020_12_31_424971	258	23	was	be	VBD
10_1101-2020_12_31_424971	258	24	not	not	RB
10_1101-2020_12_31_424971	258	25	certified	certify	VBN
10_1101-2020_12_31_424971	258	26	by	by	IN
10_1101-2020_12_31_424971	258	27	peer	peer	NN
10_1101-2020_12_31_424971	258	28	review	review	NN
10_1101-2020_12_31_424971	258	29	)	)	-RRB-
10_1101-2020_12_31_424971	258	30	is	be	VBZ
10_1101-2020_12_31_424971	258	31	the	the	DT
10_1101-2020_12_31_424971	258	32	author	author	NN
10_1101-2020_12_31_424971	258	33	/	/	SYM
10_1101-2020_12_31_424971	258	34	funder	funder	NN
10_1101-2020_12_31_424971	258	35	,	,	,
10_1101-2020_12_31_424971	258	36	who	who	WP
10_1101-2020_12_31_424971	258	37	has	have	VBZ
10_1101-2020_12_31_424971	258	38	granted	grant	VBN
10_1101-2020_12_31_424971	258	39	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	258	40	a	a	DT
10_1101-2020_12_31_424971	258	41	license	license	NN
10_1101-2020_12_31_424971	258	42	to	to	TO
10_1101-2020_12_31_424971	258	43	display	display	VB
10_1101-2020_12_31_424971	258	44	the	the	DT
10_1101-2020_12_31_424971	258	45	preprint	preprint	NN
10_1101-2020_12_31_424971	258	46	in	in	IN
10_1101-2020_12_31_424971	258	47	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	258	48	.	.	.
10_1101-2020_12_31_424971	259	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	259	2	is	be	VBZ
10_1101-2020_12_31_424971	259	3	made	make	VBN
10_1101-2020_12_31_424971	259	4	The	the	DT
10_1101-2020_12_31_424971	259	5	copyright	copyright	NN
10_1101-2020_12_31_424971	259	6	holder	holder	NN
10_1101-2020_12_31_424971	259	7	for	for	IN
10_1101-2020_12_31_424971	259	8	this	this	DT
10_1101-2020_12_31_424971	259	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	259	10	version	version	NN
10_1101-2020_12_31_424971	259	11	posted	post	VBD
10_1101-2020_12_31_424971	259	12	January	January	NNP
10_1101-2020_12_31_424971	259	13	2	2	CD
10_1101-2020_12_31_424971	259	14	,	,	,
10_1101-2020_12_31_424971	259	15	2021	2021	CD
10_1101-2020_12_31_424971	259	16	.	.	.
10_1101-2020_12_31_424971	259	17	;	;	:
10_1101-2020_12_31_424971	259	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	259	19	:	:	:
10_1101-2020_12_31_424971	259	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	259	21	preprint	preprint	NN
10_1101-2020_12_31_424971	259	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	259	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	259	24	26	26	CD
10_1101-2020_12_31_424971	259	25	by	by	IN
10_1101-2020_12_31_424971	259	26	a	a	DT
10_1101-2020_12_31_424971	259	27	biotinylated	biotinylated	JJ
10_1101-2020_12_31_424971	259	28	capture	capture	NN
10_1101-2020_12_31_424971	259	29	probe	probe	NN
10_1101-2020_12_31_424971	259	30	attached	attach	VBN
10_1101-2020_12_31_424971	259	31	to	to	IN
10_1101-2020_12_31_424971	259	32	streptavidin	streptavidin	NNP
10_1101-2020_12_31_424971	259	33	-	-	HYPH
10_1101-2020_12_31_424971	259	34	derivatized	derivatize	VBN
10_1101-2020_12_31_424971	259	35	Sepharose	Sepharose	NNP
10_1101-2020_12_31_424971	259	36	beads29	beads29	NNP
10_1101-2020_12_31_424971	259	37	.	.	.
10_1101-2020_12_31_424971	260	1	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	260	2	627	627	CD
10_1101-2020_12_31_424971	260	3	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	260	4	and	and	CC
10_1101-2020_12_31_424971	260	5	ProL	ProL	NNP
10_1101-2020_12_31_424971	260	6	were	be	VBD
10_1101-2020_12_31_424971	260	7	also	also	RB
10_1101-2020_12_31_424971	260	8	prepared	prepare	VBN
10_1101-2020_12_31_424971	260	9	by	by	IN
10_1101-2020_12_31_424971	260	10	in	in	IN
10_1101-2020_12_31_424971	260	11	vitro	vitro	FW
10_1101-2020_12_31_424971	260	12	transcription	transcription	NN
10_1101-2020_12_31_424971	260	13	.	.	.
10_1101-2020_12_31_424971	261	1	Each	each	DT
10_1101-2020_12_31_424971	261	2	primary	primary	JJ
10_1101-2020_12_31_424971	261	3	transcript	transcript	NN
10_1101-2020_12_31_424971	261	4	contained	contain	VBD
10_1101-2020_12_31_424971	261	5	a	a	DT
10_1101-2020_12_31_424971	261	6	628	628	CD
10_1101-2020_12_31_424971	261	7	ribozyme	ribozyme	NNS
10_1101-2020_12_31_424971	261	8	domain	domain	NN
10_1101-2020_12_31_424971	261	9	on	on	IN
10_1101-2020_12_31_424971	261	10	the	the	DT
10_1101-2020_12_31_424971	261	11	5'-side	5'-side	NN
10_1101-2020_12_31_424971	261	12	of	of	IN
10_1101-2020_12_31_424971	261	13	the	the	DT
10_1101-2020_12_31_424971	261	14	tRNA	trna	NN
10_1101-2020_12_31_424971	261	15	sequence	sequence	NN
10_1101-2020_12_31_424971	261	16	,	,	,
10_1101-2020_12_31_424971	261	17	which	which	WDT
10_1101-2020_12_31_424971	261	18	self	self	NN
10_1101-2020_12_31_424971	261	19	-	-	HYPH
10_1101-2020_12_31_424971	261	20	cleaved	cleave	VBN
10_1101-2020_12_31_424971	261	21	to	to	TO
10_1101-2020_12_31_424971	261	22	release	release	VB
10_1101-2020_12_31_424971	261	23	the	the	DT
10_1101-2020_12_31_424971	261	24	tRNA	trna	NN
10_1101-2020_12_31_424971	261	25	.	.	.
10_1101-2020_12_31_424971	262	1	629	629	CD
10_1101-2020_12_31_424971	262	2	m1G37-state	m1G37-state	NNP
10_1101-2020_12_31_424971	262	3	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	262	4	and	and	CC
10_1101-2020_12_31_424971	262	5	ProL	ProL	NNP
10_1101-2020_12_31_424971	262	6	were	be	VBD
10_1101-2020_12_31_424971	262	7	prepared	prepare	VBN
10_1101-2020_12_31_424971	262	8	by	by	IN
10_1101-2020_12_31_424971	262	9	TrmD	TrmD	NNP
10_1101-2020_12_31_424971	262	10	-	-	HYPH
10_1101-2020_12_31_424971	262	11	catalyzed	catalyze	VBN
10_1101-2020_12_31_424971	262	12	and	and	CC
10_1101-2020_12_31_424971	262	13	S	S	NNP
10_1101-2020_12_31_424971	262	14	-	-	HYPH
10_1101-2020_12_31_424971	262	15	adenosyl	adenosyl	NNP
10_1101-2020_12_31_424971	262	16	methionine	methionine	NNP
10_1101-2020_12_31_424971	262	17	630	630	CD
10_1101-2020_12_31_424971	262	18	(	(	-LRB-
10_1101-2020_12_31_424971	262	19	AdoMet)-dependent	adomet)-dependent	IN
10_1101-2020_12_31_424971	262	20	methylation	methylation	NN
10_1101-2020_12_31_424971	262	21	of	of	IN
10_1101-2020_12_31_424971	262	22	each	each	DT
10_1101-2020_12_31_424971	262	23	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	262	24	tRNA	trna	NN
10_1101-2020_12_31_424971	262	25	.	.	.
10_1101-2020_12_31_424971	263	1	Due	due	IN
10_1101-2020_12_31_424971	263	2	to	to	IN
10_1101-2020_12_31_424971	263	3	the	the	DT
10_1101-2020_12_31_424971	263	4	lability	lability	NN
10_1101-2020_12_31_424971	263	5	of	of	IN
10_1101-2020_12_31_424971	263	6	the	the	DT
10_1101-2020_12_31_424971	263	7	aminoacyl	aminoacyl	JJ
10_1101-2020_12_31_424971	263	8	631	631	CD
10_1101-2020_12_31_424971	263	9	linkage	linkage	NN
10_1101-2020_12_31_424971	263	10	to	to	IN
10_1101-2020_12_31_424971	263	11	Pro	Pro	NNP
10_1101-2020_12_31_424971	263	12	,	,	,
10_1101-2020_12_31_424971	263	13	stocks	stock	NNS
10_1101-2020_12_31_424971	263	14	of	of	IN
10_1101-2020_12_31_424971	263	15	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	263	16	and	and	CC
10_1101-2020_12_31_424971	263	17	ProL	ProL	NNP
10_1101-2020_12_31_424971	263	18	aminoacylated	aminoacylate	VBD
10_1101-2020_12_31_424971	263	19	with	with	IN
10_1101-2020_12_31_424971	263	20	Pro	Pro	NNP
10_1101-2020_12_31_424971	263	21	were	be	VBD
10_1101-2020_12_31_424971	263	22	either	either	CC
10_1101-2020_12_31_424971	263	23	used	use	VBN
10_1101-2020_12_31_424971	263	24	immediately	immediately	RB
10_1101-2020_12_31_424971	263	25	632	632	CD
10_1101-2020_12_31_424971	263	26	or	or	CC
10_1101-2020_12_31_424971	263	27	stored	store	VBN
10_1101-2020_12_31_424971	263	28	no	no	RB
10_1101-2020_12_31_424971	263	29	longer	long	RBR
10_1101-2020_12_31_424971	263	30	than	than	IN
10_1101-2020_12_31_424971	263	31	2	2	CD
10_1101-2020_12_31_424971	263	32	-	-	SYM
10_1101-2020_12_31_424971	263	33	3	3	CD
10_1101-2020_12_31_424971	263	34	weeks	week	NNS
10_1101-2020_12_31_424971	263	35	at	at	IN
10_1101-2020_12_31_424971	263	36	–	–	:
10_1101-2020_12_31_424971	263	37	70	70	CD
10_1101-2020_12_31_424971	263	38	°	°	,
10_1101-2020_12_31_424971	263	39	C	C	NNP
10_1101-2020_12_31_424971	263	40	in	in	IN
10_1101-2020_12_31_424971	263	41	25	25	CD
10_1101-2020_12_31_424971	263	42	mM	mM	NNP
10_1101-2020_12_31_424971	263	43	NaOAc	NaOAc	NNS
10_1101-2020_12_31_424971	263	44	(	(	-LRB-
10_1101-2020_12_31_424971	263	45	pH	pH	NNP
10_1101-2020_12_31_424971	263	46	5.0	5.0	CD
10_1101-2020_12_31_424971	263	47	)	)	-RRB-
10_1101-2020_12_31_424971	263	48	.	.	.
10_1101-2020_12_31_424971	264	1	633	633	CD
10_1101-2020_12_31_424971	264	2	634	634	CD
10_1101-2020_12_31_424971	264	3	Primer	Primer	NNP
10_1101-2020_12_31_424971	264	4	extension	extension	NN
10_1101-2020_12_31_424971	264	5	inhibition	inhibition	NN
10_1101-2020_12_31_424971	264	6	assays	assays	RB
10_1101-2020_12_31_424971	264	7	.	.	.
10_1101-2020_12_31_424971	265	1	Primer	primer	JJ
10_1101-2020_12_31_424971	265	2	extension	extension	NN
10_1101-2020_12_31_424971	265	3	inhibition	inhibition	NN
10_1101-2020_12_31_424971	265	4	analyses	analysis	NNS
10_1101-2020_12_31_424971	265	5	of	of	IN
10_1101-2020_12_31_424971	265	6	native-	native-	NN
10_1101-2020_12_31_424971	265	7	,	,	,
10_1101-2020_12_31_424971	265	8	G37-	G37-	NNP
10_1101-2020_12_31_424971	265	9	,	,	,
10_1101-2020_12_31_424971	265	10	and	and	CC
10_1101-2020_12_31_424971	265	11	635	635	CD
10_1101-2020_12_31_424971	265	12	m1G37-state	m1G37-state	NNP
10_1101-2020_12_31_424971	265	13	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	265	14	and	and	CC
10_1101-2020_12_31_424971	265	15	ProL	ProL	NNP
10_1101-2020_12_31_424971	265	16	were	be	VBD
10_1101-2020_12_31_424971	265	17	performed	perform	VBN
10_1101-2020_12_31_424971	265	18	as	as	IN
10_1101-2020_12_31_424971	265	19	described30	described30	JJ
10_1101-2020_12_31_424971	265	20	.	.	.
10_1101-2020_12_31_424971	266	1	A	a	DT
10_1101-2020_12_31_424971	266	2	DNA	dna	NN
10_1101-2020_12_31_424971	266	3	primer	primer	NN
10_1101-2020_12_31_424971	266	4	complementary	complementary	JJ
10_1101-2020_12_31_424971	266	5	to	to	IN
10_1101-2020_12_31_424971	266	6	636	636	CD
10_1101-2020_12_31_424971	266	7	the	the	DT
10_1101-2020_12_31_424971	266	8	sequence	sequence	NN
10_1101-2020_12_31_424971	266	9	of	of	IN
10_1101-2020_12_31_424971	266	10	C41	C41	NNP
10_1101-2020_12_31_424971	266	11	to	to	IN
10_1101-2020_12_31_424971	266	12	A57	A57	NNP
10_1101-2020_12_31_424971	266	13	of	of	IN
10_1101-2020_12_31_424971	266	14	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	266	15	and	and	CC
10_1101-2020_12_31_424971	266	16	ProL	ProL	NNP
10_1101-2020_12_31_424971	266	17	was	be	VBD
10_1101-2020_12_31_424971	266	18	chemically	chemically	RB
10_1101-2020_12_31_424971	266	19	synthesized	synthesize	VBN
10_1101-2020_12_31_424971	266	20	,	,	,
10_1101-2020_12_31_424971	266	21	32P	32P	NNP
10_1101-2020_12_31_424971	266	22	-	-	HYPH
10_1101-2020_12_31_424971	266	23	labeled	label	VBN
10_1101-2020_12_31_424971	266	24	at	at	IN
10_1101-2020_12_31_424971	266	25	the	the	DT
10_1101-2020_12_31_424971	266	26	637	637	CD
10_1101-2020_12_31_424971	266	27	5'-end	5'-end	CD
10_1101-2020_12_31_424971	266	28	by	by	IN
10_1101-2020_12_31_424971	266	29	T4	T4	NNP
10_1101-2020_12_31_424971	266	30	polynucleotide	polynucleotide	NN
10_1101-2020_12_31_424971	266	31	kinase	kinase	NNP
10_1101-2020_12_31_424971	266	32	,	,	,
10_1101-2020_12_31_424971	266	33	annealed	anneal	VBD
10_1101-2020_12_31_424971	266	34	to	to	IN
10_1101-2020_12_31_424971	266	35	each	each	DT
10_1101-2020_12_31_424971	266	36	tRNA	trna	NN
10_1101-2020_12_31_424971	266	37	,	,	,
10_1101-2020_12_31_424971	266	38	and	and	CC
10_1101-2020_12_31_424971	266	39	was	be	VBD
10_1101-2020_12_31_424971	266	40	extended	extend	VBN
10_1101-2020_12_31_424971	266	41	by	by	IN
10_1101-2020_12_31_424971	266	42	Superscript	Superscript	NNP
10_1101-2020_12_31_424971	266	43	III	III	NNP
10_1101-2020_12_31_424971	266	44	638	638	CD
10_1101-2020_12_31_424971	266	45	reverse	reverse	JJ
10_1101-2020_12_31_424971	266	46	transcriptase	transcriptase	NN
10_1101-2020_12_31_424971	266	47	(	(	-LRB-
10_1101-2020_12_31_424971	266	48	Invitrogen	Invitrogen	NNP
10_1101-2020_12_31_424971	266	49	)	)	-RRB-
10_1101-2020_12_31_424971	266	50	at	at	IN
10_1101-2020_12_31_424971	266	51	200	200	CD
10_1101-2020_12_31_424971	266	52	units/µL	units/µL	NNS
10_1101-2020_12_31_424971	266	53	with	with	IN
10_1101-2020_12_31_424971	266	54	6	6	CD
10_1101-2020_12_31_424971	266	55	µM	µM	NNP
10_1101-2020_12_31_424971	266	56	each	each	DT
10_1101-2020_12_31_424971	266	57	dNTP	dntp	NN
10_1101-2020_12_31_424971	266	58	in	in	IN
10_1101-2020_12_31_424971	266	59	50	50	CD
10_1101-2020_12_31_424971	266	60	mM	mM	NNP
10_1101-2020_12_31_424971	266	61	Tris	Tris	NNP
10_1101-2020_12_31_424971	266	62	-	-	HYPH
10_1101-2020_12_31_424971	266	63	HCl	HCl	NNP
10_1101-2020_12_31_424971	266	64	(	(	-LRB-
10_1101-2020_12_31_424971	266	65	pH	pH	NNP
10_1101-2020_12_31_424971	266	66	639	639	CD
10_1101-2020_12_31_424971	266	67	8.3	8.3	CD
10_1101-2020_12_31_424971	266	68	)	)	-RRB-
10_1101-2020_12_31_424971	266	69	,	,	,
10_1101-2020_12_31_424971	266	70	3	3	CD
10_1101-2020_12_31_424971	266	71	mM	mM	NNP
10_1101-2020_12_31_424971	266	72	MgCl2	mgcl2	NN
10_1101-2020_12_31_424971	266	73	,	,	,
10_1101-2020_12_31_424971	266	74	75	75	CD
10_1101-2020_12_31_424971	266	75	mM	mM	NNP
10_1101-2020_12_31_424971	266	76	KCl	KCl	NNS
10_1101-2020_12_31_424971	266	77	,	,	,
10_1101-2020_12_31_424971	266	78	and	and	CC
10_1101-2020_12_31_424971	266	79	1	1	CD
10_1101-2020_12_31_424971	266	80	mM	mM	NNP
10_1101-2020_12_31_424971	266	81	DTT	DTT	NNP
10_1101-2020_12_31_424971	266	82	at	at	IN
10_1101-2020_12_31_424971	266	83	55	55	CD
10_1101-2020_12_31_424971	266	84	°	°	NNS
10_1101-2020_12_31_424971	266	85	C	C	NNP
10_1101-2020_12_31_424971	266	86	for	for	IN
10_1101-2020_12_31_424971	266	87	30	30	CD
10_1101-2020_12_31_424971	266	88	min	min	NN
10_1101-2020_12_31_424971	266	89	,	,	,
10_1101-2020_12_31_424971	266	90	and	and	CC
10_1101-2020_12_31_424971	266	91	terminated	terminate	VBN
10_1101-2020_12_31_424971	266	92	by	by	IN
10_1101-2020_12_31_424971	266	93	heating	heat	VBG
10_1101-2020_12_31_424971	266	94	at	at	IN
10_1101-2020_12_31_424971	266	95	640	640	CD
10_1101-2020_12_31_424971	266	96	70	70	CD
10_1101-2020_12_31_424971	266	97	°	°	,
10_1101-2020_12_31_424971	266	98	C	C	NNP
10_1101-2020_12_31_424971	266	99	for	for	IN
10_1101-2020_12_31_424971	266	100	15	15	CD
10_1101-2020_12_31_424971	266	101	min	min	NN
10_1101-2020_12_31_424971	266	102	.	.	.
10_1101-2020_12_31_424971	267	1	Extension	extension	NN
10_1101-2020_12_31_424971	267	2	was	be	VBD
10_1101-2020_12_31_424971	267	3	quenched	quench	VBN
10_1101-2020_12_31_424971	267	4	with	with	IN
10_1101-2020_12_31_424971	267	5	10	10	CD
10_1101-2020_12_31_424971	267	6	mM	mm	NN
10_1101-2020_12_31_424971	267	7	EDTA	EDTA	NNS
10_1101-2020_12_31_424971	267	8	and	and	CC
10_1101-2020_12_31_424971	267	9	products	product	NNS
10_1101-2020_12_31_424971	267	10	of	of	IN
10_1101-2020_12_31_424971	267	11	extension	extension	NN
10_1101-2020_12_31_424971	267	12	were	be	VBD
10_1101-2020_12_31_424971	267	13	641	641	CD
10_1101-2020_12_31_424971	267	14	separated	separate	VBN
10_1101-2020_12_31_424971	267	15	by	by	IN
10_1101-2020_12_31_424971	267	16	12	12	CD
10_1101-2020_12_31_424971	267	17	%	%	NN
10_1101-2020_12_31_424971	267	18	denaturing	denature	VBG
10_1101-2020_12_31_424971	267	19	polyacrylamide	polyacrylamide	NN
10_1101-2020_12_31_424971	267	20	gel	gel	NN
10_1101-2020_12_31_424971	267	21	electrophoresis	electrophoresis	NN
10_1101-2020_12_31_424971	267	22	(	(	-LRB-
10_1101-2020_12_31_424971	267	23	PAGE/7	PAGE/7	NNP
10_1101-2020_12_31_424971	267	24	M	M	NNP
10_1101-2020_12_31_424971	267	25	urea	urea	NN
10_1101-2020_12_31_424971	267	26	)	)	-RRB-
10_1101-2020_12_31_424971	267	27	and	and	CC
10_1101-2020_12_31_424971	267	28	analyzed	analyze	VBD
10_1101-2020_12_31_424971	267	29	642	642	CD
10_1101-2020_12_31_424971	267	30	by	by	IN
10_1101-2020_12_31_424971	267	31	phosphorimaging	phosphorimage	VBG
10_1101-2020_12_31_424971	267	32	.	.	.
10_1101-2020_12_31_424971	268	1	In	in	IN
10_1101-2020_12_31_424971	268	2	these	these	DT
10_1101-2020_12_31_424971	268	3	assays	assay	NNS
10_1101-2020_12_31_424971	268	4	,	,	,
10_1101-2020_12_31_424971	268	5	the	the	DT
10_1101-2020_12_31_424971	268	6	length	length	NN
10_1101-2020_12_31_424971	268	7	of	of	IN
10_1101-2020_12_31_424971	268	8	the	the	DT
10_1101-2020_12_31_424971	268	9	read	read	VB
10_1101-2020_12_31_424971	268	10	-	-	HYPH
10_1101-2020_12_31_424971	268	11	through	through	RP
10_1101-2020_12_31_424971	268	12	cDNA	cdna	NN
10_1101-2020_12_31_424971	268	13	is	be	VBZ
10_1101-2020_12_31_424971	268	14	54	54	CD
10_1101-2020_12_31_424971	268	15	-	-	SYM
10_1101-2020_12_31_424971	268	16	55	55	CD
10_1101-2020_12_31_424971	268	17	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	268	18	,	,	,
10_1101-2020_12_31_424971	268	19	643	643	CD
10_1101-2020_12_31_424971	268	20	as	as	IN
10_1101-2020_12_31_424971	268	21	in	in	IN
10_1101-2020_12_31_424971	268	22	the	the	DT
10_1101-2020_12_31_424971	268	23	case	case	NN
10_1101-2020_12_31_424971	268	24	of	of	IN
10_1101-2020_12_31_424971	268	25	the	the	DT
10_1101-2020_12_31_424971	268	26	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	268	27	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	268	28	and	and	CC
10_1101-2020_12_31_424971	268	29	ProL	ProL	NNP
10_1101-2020_12_31_424971	268	30	,	,	,
10_1101-2020_12_31_424971	268	31	whereas	whereas	IN
10_1101-2020_12_31_424971	268	32	the	the	DT
10_1101-2020_12_31_424971	268	33	length	length	NN
10_1101-2020_12_31_424971	268	34	of	of	IN
10_1101-2020_12_31_424971	268	35	the	the	DT
10_1101-2020_12_31_424971	268	36	primer	primer	NN
10_1101-2020_12_31_424971	268	37	-	-	HYPH
10_1101-2020_12_31_424971	268	38	extension	extension	NN
10_1101-2020_12_31_424971	268	39	644	644	CD
10_1101-2020_12_31_424971	268	40	inhibited	inhibit	VBN
10_1101-2020_12_31_424971	268	41	cDNA	cdna	NN
10_1101-2020_12_31_424971	268	42	products	product	NNS
10_1101-2020_12_31_424971	268	43	is	be	VBZ
10_1101-2020_12_31_424971	268	44	21	21	CD
10_1101-2020_12_31_424971	268	45	-	-	SYM
10_1101-2020_12_31_424971	268	46	22	22	CD
10_1101-2020_12_31_424971	268	47	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	268	48	,	,	,
10_1101-2020_12_31_424971	268	49	as	as	IN
10_1101-2020_12_31_424971	268	50	in	in	IN
10_1101-2020_12_31_424971	268	51	the	the	DT
10_1101-2020_12_31_424971	268	52	case	case	NN
10_1101-2020_12_31_424971	268	53	of	of	IN
10_1101-2020_12_31_424971	268	54	the	the	DT
10_1101-2020_12_31_424971	268	55	m1G37-state	m1G37-state	NNP
10_1101-2020_12_31_424971	268	56	and	and	CC
10_1101-2020_12_31_424971	268	57	native	native	JJ
10_1101-2020_12_31_424971	268	58	-	-	HYPH
10_1101-2020_12_31_424971	268	59	state	state	NN
10_1101-2020_12_31_424971	268	60	.	.	.
10_1101-2020_12_31_424971	269	1	645	645	CD
10_1101-2020_12_31_424971	269	2	646	646	CD
10_1101-2020_12_31_424971	269	3	RNase	RNase	NNP
10_1101-2020_12_31_424971	269	4	T1	t1	NN
10_1101-2020_12_31_424971	269	5	cleavage	cleavage	NN
10_1101-2020_12_31_424971	269	6	inhibition	inhibition	NN
10_1101-2020_12_31_424971	269	7	assays	assays	RB
10_1101-2020_12_31_424971	269	8	.	.	.
10_1101-2020_12_31_424971	270	1	RNase	rnase	UH
10_1101-2020_12_31_424971	270	2	T1	T1	NNP
10_1101-2020_12_31_424971	270	3	cleaves	cleave	NNS
10_1101-2020_12_31_424971	270	4	on	on	IN
10_1101-2020_12_31_424971	270	5	the	the	DT
10_1101-2020_12_31_424971	270	6	3'-side	3'-side	NNP
10_1101-2020_12_31_424971	270	7	of	of	IN
10_1101-2020_12_31_424971	270	8	G	G	NNP
10_1101-2020_12_31_424971	270	9	,	,	,
10_1101-2020_12_31_424971	270	10	but	but	CC
10_1101-2020_12_31_424971	270	11	not	not	RB
10_1101-2020_12_31_424971	270	12	m1G.	m1g.	VB
10_1101-2020_12_31_424971	271	1	647	647	CD
10_1101-2020_12_31_424971	271	2	Cleavage	cleavage	NN
10_1101-2020_12_31_424971	271	3	of	of	IN
10_1101-2020_12_31_424971	271	4	tRNAs	trnas	CD
10_1101-2020_12_31_424971	271	5	was	be	VBD
10_1101-2020_12_31_424971	271	6	performed	perform	VBN
10_1101-2020_12_31_424971	271	7	as	as	IN
10_1101-2020_12_31_424971	271	8	previously	previously	RB
10_1101-2020_12_31_424971	271	9	described29	described29	NNP
10_1101-2020_12_31_424971	271	10	.	.	.
10_1101-2020_12_31_424971	272	1	Each	each	DT
10_1101-2020_12_31_424971	272	2	tRNA	trna	NN
10_1101-2020_12_31_424971	272	3	(	(	-LRB-
10_1101-2020_12_31_424971	272	4	1	1	CD
10_1101-2020_12_31_424971	272	5	µg	µg	IN
10_1101-2020_12_31_424971	272	6	)	)	-RRB-
10_1101-2020_12_31_424971	272	7	was	be	VBD
10_1101-2020_12_31_424971	272	8	3'-end	3'-end	CD
10_1101-2020_12_31_424971	272	9	648	648	CD
10_1101-2020_12_31_424971	272	10	labeled	label	VBN
10_1101-2020_12_31_424971	272	11	using	use	VBG
10_1101-2020_12_31_424971	272	12	Bacillus	Bacillus	NNP
10_1101-2020_12_31_424971	272	13	stearothermophilus	stearothermophilus	NN
10_1101-2020_12_31_424971	272	14	CCA	CCA	NNP
10_1101-2020_12_31_424971	272	15	-	-	HYPH
10_1101-2020_12_31_424971	272	16	adding	add	VBG
10_1101-2020_12_31_424971	272	17	enzyme	enzyme	NNS
10_1101-2020_12_31_424971	272	18	(	(	-LRB-
10_1101-2020_12_31_424971	272	19	10	10	CD
10_1101-2020_12_31_424971	272	20	nM	nM	NNP
10_1101-2020_12_31_424971	272	21	)	)	-RRB-
10_1101-2020_12_31_424971	272	22	with	with	IN
10_1101-2020_12_31_424971	272	23	[	[	-LRB-
10_1101-2020_12_31_424971	272	24	α-32P]ATP	α-32p]atp	NN
10_1101-2020_12_31_424971	272	25	at	at	IN
10_1101-2020_12_31_424971	272	26	60	60	CD
10_1101-2020_12_31_424971	272	27	°	°	NNS
10_1101-2020_12_31_424971	272	28	C	C	NNP
10_1101-2020_12_31_424971	272	29	649	649	CD
10_1101-2020_12_31_424971	272	30	in	in	IN
10_1101-2020_12_31_424971	272	31	100	100	CD
10_1101-2020_12_31_424971	272	32	mM	mm	NN
10_1101-2020_12_31_424971	272	33	glycine	glycine	NN
10_1101-2020_12_31_424971	272	34	(	(	-LRB-
10_1101-2020_12_31_424971	272	35	pH	pH	NNP
10_1101-2020_12_31_424971	272	36	9.0	9.0	CD
10_1101-2020_12_31_424971	272	37	)	)	-RRB-
10_1101-2020_12_31_424971	272	38	and	and	CC
10_1101-2020_12_31_424971	272	39	10	10	CD
10_1101-2020_12_31_424971	272	40	mM	mM	NNP
10_1101-2020_12_31_424971	272	41	MgCl2	mgcl2	NN
10_1101-2020_12_31_424971	272	42	.	.	.
10_1101-2020_12_31_424971	273	1	The	the	DT
10_1101-2020_12_31_424971	273	2	labeled	label	VBN
10_1101-2020_12_31_424971	273	3	tRNA	trna	NN
10_1101-2020_12_31_424971	273	4	was	be	VBD
10_1101-2020_12_31_424971	273	5	digested	digest	VBN
10_1101-2020_12_31_424971	273	6	by	by	IN
10_1101-2020_12_31_424971	273	7	RNase	RNase	NNP
10_1101-2020_12_31_424971	273	8	T1	T1	NNP
10_1101-2020_12_31_424971	273	9	650	650	CD
10_1101-2020_12_31_424971	273	10	(	(	-LRB-
10_1101-2020_12_31_424971	273	11	Roche	Roche	NNP
10_1101-2020_12_31_424971	273	12	,	,	,
10_1101-2020_12_31_424971	273	13	cat	cat	NN
10_1101-2020_12_31_424971	273	14	#	#	$
10_1101-2020_12_31_424971	273	15	109193	109193	CD
10_1101-2020_12_31_424971	273	16	)	)	-RRB-
10_1101-2020_12_31_424971	273	17	at	at	IN
10_1101-2020_12_31_424971	273	18	a	a	DT
10_1101-2020_12_31_424971	273	19	final	final	JJ
10_1101-2020_12_31_424971	273	20	concentration	concentration	NN
10_1101-2020_12_31_424971	273	21	of	of	IN
10_1101-2020_12_31_424971	273	22	0.02	0.02	CD
10_1101-2020_12_31_424971	273	23	units/µL	units/µL	NNS
10_1101-2020_12_31_424971	273	24	for	for	IN
10_1101-2020_12_31_424971	273	25	20	20	CD
10_1101-2020_12_31_424971	273	26	min	min	NN
10_1101-2020_12_31_424971	273	27	at	at	IN
10_1101-2020_12_31_424971	273	28	50	50	CD
10_1101-2020_12_31_424971	273	29	°	°	NNS
10_1101-2020_12_31_424971	273	30	C	C	NNP
10_1101-2020_12_31_424971	273	31	in	in	IN
10_1101-2020_12_31_424971	273	32	20	20	CD
10_1101-2020_12_31_424971	273	33	mM	mm	NN
10_1101-2020_12_31_424971	273	34	651	651	CD
10_1101-2020_12_31_424971	273	35	.CC	.CC	,
10_1101-2020_12_31_424971	273	36	-	-	HYPH
10_1101-2020_12_31_424971	273	37	BY	by	IN
10_1101-2020_12_31_424971	273	38	-	-	HYPH
10_1101-2020_12_31_424971	273	39	NC	NC	NNP
10_1101-2020_12_31_424971	273	40	-	-	HYPH
10_1101-2020_12_31_424971	273	41	ND	ND	NNP
10_1101-2020_12_31_424971	273	42	4.0	4.0	CD
10_1101-2020_12_31_424971	273	43	International	International	NNP
10_1101-2020_12_31_424971	273	44	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	273	45	under	under	IN
10_1101-2020_12_31_424971	273	46	a	a	DT
10_1101-2020_12_31_424971	273	47	(	(	-LRB-
10_1101-2020_12_31_424971	273	48	which	which	WDT
10_1101-2020_12_31_424971	273	49	was	be	VBD
10_1101-2020_12_31_424971	273	50	not	not	RB
10_1101-2020_12_31_424971	273	51	certified	certify	VBN
10_1101-2020_12_31_424971	273	52	by	by	IN
10_1101-2020_12_31_424971	273	53	peer	peer	NN
10_1101-2020_12_31_424971	273	54	review	review	NN
10_1101-2020_12_31_424971	273	55	)	)	-RRB-
10_1101-2020_12_31_424971	273	56	is	be	VBZ
10_1101-2020_12_31_424971	273	57	the	the	DT
10_1101-2020_12_31_424971	273	58	author	author	NN
10_1101-2020_12_31_424971	273	59	/	/	SYM
10_1101-2020_12_31_424971	273	60	funder	funder	NN
10_1101-2020_12_31_424971	273	61	,	,	,
10_1101-2020_12_31_424971	273	62	who	who	WP
10_1101-2020_12_31_424971	273	63	has	have	VBZ
10_1101-2020_12_31_424971	273	64	granted	grant	VBN
10_1101-2020_12_31_424971	273	65	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	273	66	a	a	DT
10_1101-2020_12_31_424971	273	67	license	license	NN
10_1101-2020_12_31_424971	273	68	to	to	TO
10_1101-2020_12_31_424971	273	69	display	display	VB
10_1101-2020_12_31_424971	273	70	the	the	DT
10_1101-2020_12_31_424971	273	71	preprint	preprint	NN
10_1101-2020_12_31_424971	273	72	in	in	IN
10_1101-2020_12_31_424971	273	73	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	273	74	.	.	.
10_1101-2020_12_31_424971	274	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	274	2	is	be	VBZ
10_1101-2020_12_31_424971	274	3	made	make	VBN
10_1101-2020_12_31_424971	274	4	The	the	DT
10_1101-2020_12_31_424971	274	5	copyright	copyright	NN
10_1101-2020_12_31_424971	274	6	holder	holder	NN
10_1101-2020_12_31_424971	274	7	for	for	IN
10_1101-2020_12_31_424971	274	8	this	this	DT
10_1101-2020_12_31_424971	274	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	274	10	version	version	NN
10_1101-2020_12_31_424971	274	11	posted	post	VBD
10_1101-2020_12_31_424971	274	12	January	January	NNP
10_1101-2020_12_31_424971	274	13	2	2	CD
10_1101-2020_12_31_424971	274	14	,	,	,
10_1101-2020_12_31_424971	274	15	2021	2021	CD
10_1101-2020_12_31_424971	274	16	.	.	.
10_1101-2020_12_31_424971	274	17	;	;	:
10_1101-2020_12_31_424971	274	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	274	19	:	:	:
10_1101-2020_12_31_424971	274	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	274	21	preprint	preprint	NN
10_1101-2020_12_31_424971	274	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	274	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	274	24	27	27	CD
10_1101-2020_12_31_424971	274	25	sodium	sodium	NN
10_1101-2020_12_31_424971	274	26	citrate	citrate	NN
10_1101-2020_12_31_424971	274	27	(	(	-LRB-
10_1101-2020_12_31_424971	274	28	pH	pH	NNP
10_1101-2020_12_31_424971	274	29	5.5	5.5	CD
10_1101-2020_12_31_424971	274	30	)	)	-RRB-
10_1101-2020_12_31_424971	274	31	and	and	CC
10_1101-2020_12_31_424971	274	32	1	1	CD
10_1101-2020_12_31_424971	274	33	mM	mM	NNP
10_1101-2020_12_31_424971	274	34	ethylene	ethylene	NN
10_1101-2020_12_31_424971	274	35	diamine	diamine	NN
10_1101-2020_12_31_424971	274	36	tetraacetic	tetraacetic	JJ
10_1101-2020_12_31_424971	274	37	acid	acid	NN
10_1101-2020_12_31_424971	274	38	(	(	-LRB-
10_1101-2020_12_31_424971	274	39	EDTA	EDTA	NNP
10_1101-2020_12_31_424971	274	40	)	)	-RRB-
10_1101-2020_12_31_424971	274	41	.	.	.
10_1101-2020_12_31_424971	275	1	The	the	DT
10_1101-2020_12_31_424971	275	2	RNA	RNA	NNP
10_1101-2020_12_31_424971	275	3	fragments	fragment	VBZ
10_1101-2020_12_31_424971	275	4	652	652	CD
10_1101-2020_12_31_424971	275	5	generated	generate	VBN
10_1101-2020_12_31_424971	275	6	from	from	IN
10_1101-2020_12_31_424971	275	7	cleavage	cleavage	NN
10_1101-2020_12_31_424971	275	8	were	be	VBD
10_1101-2020_12_31_424971	275	9	separated	separate	VBN
10_1101-2020_12_31_424971	275	10	by	by	IN
10_1101-2020_12_31_424971	275	11	12	12	CD
10_1101-2020_12_31_424971	275	12	%	%	NN
10_1101-2020_12_31_424971	275	13	PAGE/7	PAGE/7	NNP
10_1101-2020_12_31_424971	275	14	M	M	NNP
10_1101-2020_12_31_424971	275	15	urea	urea	NN
10_1101-2020_12_31_424971	275	16	along	along	IN
10_1101-2020_12_31_424971	275	17	with	with	IN
10_1101-2020_12_31_424971	275	18	an	an	DT
10_1101-2020_12_31_424971	275	19	RNA	RNA	NNP
10_1101-2020_12_31_424971	275	20	ladder	ladder	NN
10_1101-2020_12_31_424971	275	21	653	653	CD
10_1101-2020_12_31_424971	275	22	generated	generate	VBN
10_1101-2020_12_31_424971	275	23	by	by	IN
10_1101-2020_12_31_424971	275	24	alkali	alkali	JJ
10_1101-2020_12_31_424971	275	25	hydrolysis	hydrolysis	NN
10_1101-2020_12_31_424971	275	26	of	of	IN
10_1101-2020_12_31_424971	275	27	the	the	DT
10_1101-2020_12_31_424971	275	28	tRNA	trna	NN
10_1101-2020_12_31_424971	275	29	of	of	IN
10_1101-2020_12_31_424971	275	30	interest	interest	NN
10_1101-2020_12_31_424971	275	31	.	.	.
10_1101-2020_12_31_424971	276	1	Cleavage	cleavage	NN
10_1101-2020_12_31_424971	276	2	was	be	VBD
10_1101-2020_12_31_424971	276	3	analyzed	analyze	VBN
10_1101-2020_12_31_424971	276	4	by	by	IN
10_1101-2020_12_31_424971	276	5	654	654	CD
10_1101-2020_12_31_424971	276	6	phosphorimaging	phosphorimaging	NN
10_1101-2020_12_31_424971	276	7	.	.	.
10_1101-2020_12_31_424971	277	1	655	655	CD
10_1101-2020_12_31_424971	277	2	656	656	CD
10_1101-2020_12_31_424971	277	3	Methylation	methylation	NN
10_1101-2020_12_31_424971	277	4	assays	assay	NNS
10_1101-2020_12_31_424971	277	5	.	.	.
10_1101-2020_12_31_424971	278	1	Pre	pre	JJ
10_1101-2020_12_31_424971	278	2	-	-	JJ
10_1101-2020_12_31_424971	278	3	steady	steady	JJ
10_1101-2020_12_31_424971	278	4	-	-	HYPH
10_1101-2020_12_31_424971	278	5	state	state	NN
10_1101-2020_12_31_424971	278	6	assays	assay	NNS
10_1101-2020_12_31_424971	278	7	under	under	IN
10_1101-2020_12_31_424971	278	8	single	single	JJ
10_1101-2020_12_31_424971	278	9	-	-	HYPH
10_1101-2020_12_31_424971	278	10	turnover	turnover	NN
10_1101-2020_12_31_424971	278	11	conditions61	conditions61	NN
10_1101-2020_12_31_424971	278	12	were	be	VBD
10_1101-2020_12_31_424971	278	13	performed	perform	VBN
10_1101-2020_12_31_424971	278	14	657	657	CD
10_1101-2020_12_31_424971	278	15	on	on	IN
10_1101-2020_12_31_424971	278	16	a	a	DT
10_1101-2020_12_31_424971	278	17	rapid	rapid	JJ
10_1101-2020_12_31_424971	278	18	quench	quench	NN
10_1101-2020_12_31_424971	278	19	-	-	HYPH
10_1101-2020_12_31_424971	278	20	flow	flow	NN
10_1101-2020_12_31_424971	278	21	apparatus	apparatus	NN
10_1101-2020_12_31_424971	278	22	(	(	-LRB-
10_1101-2020_12_31_424971	278	23	Kintek	Kintek	NNP
10_1101-2020_12_31_424971	278	24	RQF-3	RQF-3	NNP
10_1101-2020_12_31_424971	278	25	)	)	-RRB-
10_1101-2020_12_31_424971	278	26	.	.	.
10_1101-2020_12_31_424971	279	1	The	the	DT
10_1101-2020_12_31_424971	279	2	tRNA	trna	NN
10_1101-2020_12_31_424971	279	3	substrate	substrate	NN
10_1101-2020_12_31_424971	279	4	was	be	VBD
10_1101-2020_12_31_424971	279	5	heated	heat	VBN
10_1101-2020_12_31_424971	279	6	to	to	IN
10_1101-2020_12_31_424971	279	7	85	85	CD
10_1101-2020_12_31_424971	279	8	°	°	,
10_1101-2020_12_31_424971	279	9	C	C	NNP
10_1101-2020_12_31_424971	279	10	for	for	IN
10_1101-2020_12_31_424971	279	11	658	658	CD
10_1101-2020_12_31_424971	279	12	2.5	2.5	CD
10_1101-2020_12_31_424971	279	13	min	min	NN
10_1101-2020_12_31_424971	279	14	followed	follow	VBN
10_1101-2020_12_31_424971	279	15	by	by	IN
10_1101-2020_12_31_424971	279	16	addition	addition	NN
10_1101-2020_12_31_424971	279	17	of	of	IN
10_1101-2020_12_31_424971	279	18	10	10	CD
10_1101-2020_12_31_424971	279	19	mM	mM	NNP
10_1101-2020_12_31_424971	279	20	MgCl2	mgcl2	NN
10_1101-2020_12_31_424971	279	21	,	,	,
10_1101-2020_12_31_424971	279	22	and	and	CC
10_1101-2020_12_31_424971	279	23	slowly	slowly	RB
10_1101-2020_12_31_424971	279	24	cooled	cool	VBD
10_1101-2020_12_31_424971	279	25	to	to	IN
10_1101-2020_12_31_424971	279	26	37	37	CD
10_1101-2020_12_31_424971	279	27	°	°	,
10_1101-2020_12_31_424971	279	28	C	C	NNP
10_1101-2020_12_31_424971	279	29	in	in	IN
10_1101-2020_12_31_424971	279	30	15	15	CD
10_1101-2020_12_31_424971	279	31	min	min	NN
10_1101-2020_12_31_424971	279	32	.	.	.
10_1101-2020_12_31_424971	280	1	N1-methylation	n1-methylation	DT
10_1101-2020_12_31_424971	280	2	659	659	CD
10_1101-2020_12_31_424971	280	3	of	of	IN
10_1101-2020_12_31_424971	280	4	G37	G37	NNP
10_1101-2020_12_31_424971	280	5	in	in	IN
10_1101-2020_12_31_424971	280	6	the	the	DT
10_1101-2020_12_31_424971	280	7	pre	pre	NN
10_1101-2020_12_31_424971	280	8	-	-	JJ
10_1101-2020_12_31_424971	280	9	annealed	anneal	VBN
10_1101-2020_12_31_424971	280	10	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	280	11	(	(	-LRB-
10_1101-2020_12_31_424971	280	12	final	final	JJ
10_1101-2020_12_31_424971	280	13	concentration	concentration	NNP
10_1101-2020_12_31_424971	280	14	1	1	CD
10_1101-2020_12_31_424971	280	15	µM	µM	NNP
10_1101-2020_12_31_424971	280	16	)	)	-RRB-
10_1101-2020_12_31_424971	280	17	was	be	VBD
10_1101-2020_12_31_424971	280	18	initiated	initiate	VBN
10_1101-2020_12_31_424971	280	19	with	with	IN
10_1101-2020_12_31_424971	280	20	the	the	DT
10_1101-2020_12_31_424971	280	21	addition	addition	NN
10_1101-2020_12_31_424971	280	22	of	of	IN
10_1101-2020_12_31_424971	280	23	E.	E.	NNP
10_1101-2020_12_31_424971	280	24	660	660	CD
10_1101-2020_12_31_424971	280	25	coli	coli	NNS
10_1101-2020_12_31_424971	280	26	TrmD	TrmD	NNP
10_1101-2020_12_31_424971	280	27	(	(	-LRB-
10_1101-2020_12_31_424971	280	28	10	10	CD
10_1101-2020_12_31_424971	280	29	µM	µM	NNP
10_1101-2020_12_31_424971	280	30	)	)	-RRB-
10_1101-2020_12_31_424971	280	31	and	and	CC
10_1101-2020_12_31_424971	280	32	[	[	-LRB-
10_1101-2020_12_31_424971	280	33	3H]-AdoMet	3h]-adomet	CD
10_1101-2020_12_31_424971	280	34	(	(	-LRB-
10_1101-2020_12_31_424971	280	35	Perkin	Perkin	NNP
10_1101-2020_12_31_424971	280	36	Elmer	Elmer	NNP
10_1101-2020_12_31_424971	280	37	,	,	,
10_1101-2020_12_31_424971	280	38	4200	4200	CD
10_1101-2020_12_31_424971	280	39	DPM	DPM	NNP
10_1101-2020_12_31_424971	280	40	/	/	SYM
10_1101-2020_12_31_424971	280	41	pmol	pmol	NN
10_1101-2020_12_31_424971	280	42	)	)	-RRB-
10_1101-2020_12_31_424971	280	43	at	at	IN
10_1101-2020_12_31_424971	280	44	a	a	DT
10_1101-2020_12_31_424971	280	45	final	final	JJ
10_1101-2020_12_31_424971	280	46	concentration	concentration	NN
10_1101-2020_12_31_424971	280	47	of	of	IN
10_1101-2020_12_31_424971	280	48	15	15	CD
10_1101-2020_12_31_424971	280	49	661	661	CD
10_1101-2020_12_31_424971	280	50	µM	µM	NNP
10_1101-2020_12_31_424971	280	51	in	in	IN
10_1101-2020_12_31_424971	280	52	a	a	DT
10_1101-2020_12_31_424971	280	53	buffer	buffer	NN
10_1101-2020_12_31_424971	280	54	containing	contain	VBG
10_1101-2020_12_31_424971	280	55	100	100	CD
10_1101-2020_12_31_424971	280	56	mM	mM	NNP
10_1101-2020_12_31_424971	280	57	Tris	Tris	NNP
10_1101-2020_12_31_424971	280	58	-	-	HYPH
10_1101-2020_12_31_424971	280	59	HCl	HCl	NNP
10_1101-2020_12_31_424971	280	60	(	(	-LRB-
10_1101-2020_12_31_424971	280	61	pH	pH	NNP
10_1101-2020_12_31_424971	280	62	8.0	8.0	CD
10_1101-2020_12_31_424971	280	63	)	)	-RRB-
10_1101-2020_12_31_424971	280	64	,	,	,
10_1101-2020_12_31_424971	280	65	24	24	CD
10_1101-2020_12_31_424971	280	66	mM	mm	NN
10_1101-2020_12_31_424971	280	67	NH4Cl	nh4cl	CD
10_1101-2020_12_31_424971	280	68	,	,	,
10_1101-2020_12_31_424971	280	69	6	6	CD
10_1101-2020_12_31_424971	280	70	mM	mM	NNP
10_1101-2020_12_31_424971	280	71	MgCl2	mgcl2	NN
10_1101-2020_12_31_424971	280	72	,	,	,
10_1101-2020_12_31_424971	280	73	4	4	CD
10_1101-2020_12_31_424971	280	74	mM	mM	NNP
10_1101-2020_12_31_424971	280	75	DTT	DTT	NNP
10_1101-2020_12_31_424971	280	76	,	,	,
10_1101-2020_12_31_424971	280	77	0.1	0.1	CD
10_1101-2020_12_31_424971	280	78	662	662	CD
10_1101-2020_12_31_424971	280	79	mM	mm	NN
10_1101-2020_12_31_424971	280	80	EDTA	edta	NN
10_1101-2020_12_31_424971	280	81	,	,	,
10_1101-2020_12_31_424971	280	82	and	and	CC
10_1101-2020_12_31_424971	280	83	0.024	0.024	CD
10_1101-2020_12_31_424971	280	84	mg	mg	NNP
10_1101-2020_12_31_424971	280	85	/	/	SYM
10_1101-2020_12_31_424971	280	86	mL	mL	NNP
10_1101-2020_12_31_424971	280	87	BSA	BSA	NNP
10_1101-2020_12_31_424971	280	88	in	in	IN
10_1101-2020_12_31_424971	280	89	a	a	DT
10_1101-2020_12_31_424971	280	90	reaction	reaction	NN
10_1101-2020_12_31_424971	280	91	of	of	IN
10_1101-2020_12_31_424971	280	92	30	30	CD
10_1101-2020_12_31_424971	280	93	µL.	µl.	NN
10_1101-2020_12_31_424971	281	1	The	the	DT
10_1101-2020_12_31_424971	281	2	buffer	buffer	NN
10_1101-2020_12_31_424971	281	3	used	use	VBN
10_1101-2020_12_31_424971	281	4	was	be	VBD
10_1101-2020_12_31_424971	281	5	optimized	optimize	VBN
10_1101-2020_12_31_424971	281	6	for	for	IN
10_1101-2020_12_31_424971	281	7	TrmD	TrmD	NNP
10_1101-2020_12_31_424971	281	8	663	663	CD
10_1101-2020_12_31_424971	281	9	in	in	IN
10_1101-2020_12_31_424971	281	10	order	order	NN
10_1101-2020_12_31_424971	281	11	to	to	TO
10_1101-2020_12_31_424971	281	12	evaluate	evaluate	VB
10_1101-2020_12_31_424971	281	13	its	-PRON-	PRP$
10_1101-2020_12_31_424971	281	14	in	in	FW
10_1101-2020_12_31_424971	281	15	vitro	vitro	FW
10_1101-2020_12_31_424971	281	16	activity61	activity61	NNP
10_1101-2020_12_31_424971	281	17	.	.	.
10_1101-2020_12_31_424971	282	1	Reaction	reaction	NN
10_1101-2020_12_31_424971	282	2	aliquots	aliquot	NNS
10_1101-2020_12_31_424971	282	3	of	of	IN
10_1101-2020_12_31_424971	282	4	5	5	CD
10_1101-2020_12_31_424971	282	5	µL	µl	CD
10_1101-2020_12_31_424971	282	6	were	be	VBD
10_1101-2020_12_31_424971	282	7	removed	remove	VBN
10_1101-2020_12_31_424971	282	8	at	at	IN
10_1101-2020_12_31_424971	282	9	various	various	JJ
10_1101-2020_12_31_424971	282	10	time	time	NN
10_1101-2020_12_31_424971	282	11	664	664	CD
10_1101-2020_12_31_424971	282	12	points	point	NNS
10_1101-2020_12_31_424971	282	13	and	and	CC
10_1101-2020_12_31_424971	282	14	precipitated	precipitate	VBD
10_1101-2020_12_31_424971	282	15	in	in	IN
10_1101-2020_12_31_424971	282	16	5	5	CD
10_1101-2020_12_31_424971	282	17	%	%	NN
10_1101-2020_12_31_424971	282	18	(	(	-LRB-
10_1101-2020_12_31_424971	282	19	w	w	NNP
10_1101-2020_12_31_424971	282	20	/	/	SYM
10_1101-2020_12_31_424971	282	21	v	v	NNP
10_1101-2020_12_31_424971	282	22	)	)	-RRB-
10_1101-2020_12_31_424971	282	23	trichloroacetic	trichloroacetic	JJ
10_1101-2020_12_31_424971	282	24	acid	acid	NN
10_1101-2020_12_31_424971	282	25	(	(	-LRB-
10_1101-2020_12_31_424971	282	26	TCA	TCA	NNP
10_1101-2020_12_31_424971	282	27	)	)	-RRB-
10_1101-2020_12_31_424971	282	28	on	on	IN
10_1101-2020_12_31_424971	282	29	filter	filter	NN
10_1101-2020_12_31_424971	282	30	pads	pad	NNS
10_1101-2020_12_31_424971	282	31	for	for	IN
10_1101-2020_12_31_424971	282	32	10	10	CD
10_1101-2020_12_31_424971	282	33	min	min	NN
10_1101-2020_12_31_424971	282	34	twice	twice	RB
10_1101-2020_12_31_424971	282	35	.	.	.
10_1101-2020_12_31_424971	283	1	Filter	Filter	NNP
10_1101-2020_12_31_424971	283	2	665	665	CD
10_1101-2020_12_31_424971	283	3	pads	pad	NNS
10_1101-2020_12_31_424971	283	4	were	be	VBD
10_1101-2020_12_31_424971	283	5	washed	wash	VBN
10_1101-2020_12_31_424971	283	6	with	with	IN
10_1101-2020_12_31_424971	283	7	95	95	CD
10_1101-2020_12_31_424971	283	8	%	%	NN
10_1101-2020_12_31_424971	283	9	ethanol	ethanol	NN
10_1101-2020_12_31_424971	283	10	twice	twice	RB
10_1101-2020_12_31_424971	283	11	,	,	,
10_1101-2020_12_31_424971	283	12	with	with	IN
10_1101-2020_12_31_424971	283	13	ether	ether	NN
10_1101-2020_12_31_424971	283	14	once	once	RB
10_1101-2020_12_31_424971	283	15	,	,	,
10_1101-2020_12_31_424971	283	16	air	air	NN
10_1101-2020_12_31_424971	283	17	dried	dry	VBN
10_1101-2020_12_31_424971	283	18	,	,	,
10_1101-2020_12_31_424971	283	19	and	and	CC
10_1101-2020_12_31_424971	283	20	measured	measure	VBN
10_1101-2020_12_31_424971	283	21	for	for	IN
10_1101-2020_12_31_424971	283	22	666	666	CD
10_1101-2020_12_31_424971	283	23	radioactivity	radioactivity	NN
10_1101-2020_12_31_424971	283	24	in	in	IN
10_1101-2020_12_31_424971	283	25	an	an	DT
10_1101-2020_12_31_424971	283	26	LS6000	LS6000	NNP
10_1101-2020_12_31_424971	283	27	scintillation	scintillation	NN
10_1101-2020_12_31_424971	283	28	counter	counter	NN
10_1101-2020_12_31_424971	283	29	(	(	-LRB-
10_1101-2020_12_31_424971	283	30	Beckman	Beckman	NNP
10_1101-2020_12_31_424971	283	31	)	)	-RRB-
10_1101-2020_12_31_424971	283	32	.	.	.
10_1101-2020_12_31_424971	284	1	Counts	count	NNS
10_1101-2020_12_31_424971	284	2	were	be	VBD
10_1101-2020_12_31_424971	284	3	converted	convert	VBN
10_1101-2020_12_31_424971	284	4	to	to	IN
10_1101-2020_12_31_424971	284	5	pmoles	pmole	NNS
10_1101-2020_12_31_424971	284	6	667	667	CD
10_1101-2020_12_31_424971	284	7	using	use	VBG
10_1101-2020_12_31_424971	284	8	the	the	DT
10_1101-2020_12_31_424971	284	9	specific	specific	JJ
10_1101-2020_12_31_424971	284	10	activity	activity	NN
10_1101-2020_12_31_424971	284	11	of	of	IN
10_1101-2020_12_31_424971	284	12	the	the	DT
10_1101-2020_12_31_424971	284	13	[	[	-LRB-
10_1101-2020_12_31_424971	284	14	3H]-AdoMet	3h]-adomet	CD
10_1101-2020_12_31_424971	284	15	after	after	IN
10_1101-2020_12_31_424971	284	16	correcting	correct	VBG
10_1101-2020_12_31_424971	284	17	for	for	IN
10_1101-2020_12_31_424971	284	18	the	the	DT
10_1101-2020_12_31_424971	284	19	signal	signal	NN
10_1101-2020_12_31_424971	284	20	quenching	quenching	NN
10_1101-2020_12_31_424971	284	21	by	by	IN
10_1101-2020_12_31_424971	284	22	filter	filter	NN
10_1101-2020_12_31_424971	284	23	668	668	CD
10_1101-2020_12_31_424971	284	24	pads	pad	NNS
10_1101-2020_12_31_424971	284	25	.	.	.
10_1101-2020_12_31_424971	285	1	In	in	IN
10_1101-2020_12_31_424971	285	2	these	these	DT
10_1101-2020_12_31_424971	285	3	assays	assay	NNS
10_1101-2020_12_31_424971	285	4	,	,	,
10_1101-2020_12_31_424971	285	5	a	a	DT
10_1101-2020_12_31_424971	285	6	negative	negative	JJ
10_1101-2020_12_31_424971	285	7	control	control	NN
10_1101-2020_12_31_424971	285	8	was	be	VBD
10_1101-2020_12_31_424971	285	9	always	always	RB
10_1101-2020_12_31_424971	285	10	included	include	VBN
10_1101-2020_12_31_424971	285	11	,	,	,
10_1101-2020_12_31_424971	285	12	in	in	IN
10_1101-2020_12_31_424971	285	13	which	which	WDT
10_1101-2020_12_31_424971	285	14	no	no	DT
10_1101-2020_12_31_424971	285	15	enzyme	enzyme	NNS
10_1101-2020_12_31_424971	285	16	was	be	VBD
10_1101-2020_12_31_424971	285	17	added	add	VBN
10_1101-2020_12_31_424971	285	18	669	669	CD
10_1101-2020_12_31_424971	285	19	to	to	IN
10_1101-2020_12_31_424971	285	20	the	the	DT
10_1101-2020_12_31_424971	285	21	reaction61	reaction61	NN
10_1101-2020_12_31_424971	285	22	,	,	,
10_1101-2020_12_31_424971	285	23	and	and	CC
10_1101-2020_12_31_424971	285	24	signal	signal	NN
10_1101-2020_12_31_424971	285	25	from	from	IN
10_1101-2020_12_31_424971	285	26	the	the	DT
10_1101-2020_12_31_424971	285	27	negative	negative	JJ
10_1101-2020_12_31_424971	285	28	control	control	NN
10_1101-2020_12_31_424971	285	29	was	be	VBD
10_1101-2020_12_31_424971	285	30	subtracted	subtract	VBN
10_1101-2020_12_31_424971	285	31	from	from	IN
10_1101-2020_12_31_424971	285	32	signal	signal	NN
10_1101-2020_12_31_424971	285	33	of	of	IN
10_1101-2020_12_31_424971	285	34	each	each	DT
10_1101-2020_12_31_424971	285	35	sample	sample	NN
10_1101-2020_12_31_424971	285	36	670	670	CD
10_1101-2020_12_31_424971	285	37	for	for	IN
10_1101-2020_12_31_424971	285	38	determining	determine	VBG
10_1101-2020_12_31_424971	285	39	the	the	DT
10_1101-2020_12_31_424971	285	40	level	level	NN
10_1101-2020_12_31_424971	285	41	of	of	IN
10_1101-2020_12_31_424971	285	42	methylation	methylation	NN
10_1101-2020_12_31_424971	285	43	.	.	.
10_1101-2020_12_31_424971	286	1	671	671	CD
10_1101-2020_12_31_424971	286	2	672	672	CD
10_1101-2020_12_31_424971	286	3	Aminoacylation	Aminoacylation	NNP
10_1101-2020_12_31_424971	286	4	assays	assay	NNS
10_1101-2020_12_31_424971	286	5	.	.	.
10_1101-2020_12_31_424971	287	1	Each	each	DT
10_1101-2020_12_31_424971	287	2	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	287	3	or	or	CC
10_1101-2020_12_31_424971	287	4	ProL	ProL	NNP
10_1101-2020_12_31_424971	287	5	tRNA	trna	NN
10_1101-2020_12_31_424971	287	6	was	be	VBD
10_1101-2020_12_31_424971	287	7	aminoacylated	aminoacylate	VBN
10_1101-2020_12_31_424971	287	8	with	with	IN
10_1101-2020_12_31_424971	287	9	Pro	Pro	NNP
10_1101-2020_12_31_424971	287	10	by	by	IN
10_1101-2020_12_31_424971	287	11	a	a	DT
10_1101-2020_12_31_424971	287	12	673	673	CD
10_1101-2020_12_31_424971	287	13	recombinant	recombinant	JJ
10_1101-2020_12_31_424971	287	14	E.	E.	NNP
10_1101-2020_12_31_424971	287	15	coli	coli	NNS
10_1101-2020_12_31_424971	287	16	ProRS	ProRS	NNP
10_1101-2020_12_31_424971	287	17	expressed	express	VBD
10_1101-2020_12_31_424971	287	18	from	from	IN
10_1101-2020_12_31_424971	287	19	the	the	DT
10_1101-2020_12_31_424971	287	20	plasmid	plasmid	NN
10_1101-2020_12_31_424971	287	21	pET22	pET22	NNS
10_1101-2020_12_31_424971	287	22	and	and	CC
10_1101-2020_12_31_424971	287	23	purified	purify	VBN
10_1101-2020_12_31_424971	287	24	from	from	IN
10_1101-2020_12_31_424971	287	25	E.	E.	NNP
10_1101-2020_12_31_424971	287	26	coli	coli	NNS
10_1101-2020_12_31_424971	287	27	BL21	BL21	NNP
10_1101-2020_12_31_424971	287	28	674	674	CD
10_1101-2020_12_31_424971	287	29	(	(	-LRB-
10_1101-2020_12_31_424971	287	30	DE3)62	DE3)62	NNP
10_1101-2020_12_31_424971	287	31	.	.	.
10_1101-2020_12_31_424971	288	1	Each	each	DT
10_1101-2020_12_31_424971	288	2	tRNA	trna	NN
10_1101-2020_12_31_424971	288	3	was	be	VBD
10_1101-2020_12_31_424971	288	4	heat	heat	NN
10_1101-2020_12_31_424971	288	5	-	-	HYPH
10_1101-2020_12_31_424971	288	6	denatured	denature	VBN
10_1101-2020_12_31_424971	288	7	at	at	IN
10_1101-2020_12_31_424971	288	8	80	80	CD
10_1101-2020_12_31_424971	288	9	ºC	ºC	NNP
10_1101-2020_12_31_424971	288	10	for	for	IN
10_1101-2020_12_31_424971	288	11	3	3	CD
10_1101-2020_12_31_424971	288	12	min	min	NN
10_1101-2020_12_31_424971	288	13	,	,	,
10_1101-2020_12_31_424971	288	14	and	and	CC
10_1101-2020_12_31_424971	288	15	re	re	NNS
10_1101-2020_12_31_424971	288	16	-	-	VBN
10_1101-2020_12_31_424971	288	17	annealed	anneal	VBD
10_1101-2020_12_31_424971	288	18	at	at	IN
10_1101-2020_12_31_424971	288	19	37	37	CD
10_1101-2020_12_31_424971	288	20	ºC	ºC	NNP
10_1101-2020_12_31_424971	288	21	for	for	IN
10_1101-2020_12_31_424971	288	22	15	15	CD
10_1101-2020_12_31_424971	288	23	min	min	NN
10_1101-2020_12_31_424971	288	24	.	.	.
10_1101-2020_12_31_424971	289	1	675	675	CD
10_1101-2020_12_31_424971	289	2	Aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	289	3	under	under	IN
10_1101-2020_12_31_424971	289	4	pre	pre	JJ
10_1101-2020_12_31_424971	289	5	-	-	JJ
10_1101-2020_12_31_424971	289	6	steady	steady	JJ
10_1101-2020_12_31_424971	289	7	state	state	NN
10_1101-2020_12_31_424971	289	8	conditions	condition	NNS
10_1101-2020_12_31_424971	289	9	was	be	VBD
10_1101-2020_12_31_424971	289	10	performed	perform	VBN
10_1101-2020_12_31_424971	289	11	at	at	IN
10_1101-2020_12_31_424971	289	12	37	37	CD
10_1101-2020_12_31_424971	289	13	ºC	ºC	NNP
10_1101-2020_12_31_424971	289	14	with	with	IN
10_1101-2020_12_31_424971	289	15	10	10	CD
10_1101-2020_12_31_424971	289	16	µM	µM	NNP
10_1101-2020_12_31_424971	289	17	tRNA	trna	NN
10_1101-2020_12_31_424971	289	18	,	,	,
10_1101-2020_12_31_424971	289	19	1	1	CD
10_1101-2020_12_31_424971	289	20	676	676	CD
10_1101-2020_12_31_424971	289	21	.CC	.CC	:
10_1101-2020_12_31_424971	289	22	-	-	HYPH
10_1101-2020_12_31_424971	289	23	BY	by	IN
10_1101-2020_12_31_424971	289	24	-	-	HYPH
10_1101-2020_12_31_424971	289	25	NC	NC	NNP
10_1101-2020_12_31_424971	289	26	-	-	HYPH
10_1101-2020_12_31_424971	289	27	ND	ND	NNP
10_1101-2020_12_31_424971	289	28	4.0	4.0	CD
10_1101-2020_12_31_424971	289	29	International	International	NNP
10_1101-2020_12_31_424971	289	30	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	289	31	under	under	IN
10_1101-2020_12_31_424971	289	32	a	a	DT
10_1101-2020_12_31_424971	289	33	(	(	-LRB-
10_1101-2020_12_31_424971	289	34	which	which	WDT
10_1101-2020_12_31_424971	289	35	was	be	VBD
10_1101-2020_12_31_424971	289	36	not	not	RB
10_1101-2020_12_31_424971	289	37	certified	certify	VBN
10_1101-2020_12_31_424971	289	38	by	by	IN
10_1101-2020_12_31_424971	289	39	peer	peer	NN
10_1101-2020_12_31_424971	289	40	review	review	NN
10_1101-2020_12_31_424971	289	41	)	)	-RRB-
10_1101-2020_12_31_424971	289	42	is	be	VBZ
10_1101-2020_12_31_424971	289	43	the	the	DT
10_1101-2020_12_31_424971	289	44	author	author	NN
10_1101-2020_12_31_424971	289	45	/	/	SYM
10_1101-2020_12_31_424971	289	46	funder	funder	NN
10_1101-2020_12_31_424971	289	47	,	,	,
10_1101-2020_12_31_424971	289	48	who	who	WP
10_1101-2020_12_31_424971	289	49	has	have	VBZ
10_1101-2020_12_31_424971	289	50	granted	grant	VBN
10_1101-2020_12_31_424971	289	51	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	289	52	a	a	DT
10_1101-2020_12_31_424971	289	53	license	license	NN
10_1101-2020_12_31_424971	289	54	to	to	TO
10_1101-2020_12_31_424971	289	55	display	display	VB
10_1101-2020_12_31_424971	289	56	the	the	DT
10_1101-2020_12_31_424971	289	57	preprint	preprint	NN
10_1101-2020_12_31_424971	289	58	in	in	IN
10_1101-2020_12_31_424971	289	59	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	289	60	.	.	.
10_1101-2020_12_31_424971	290	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	290	2	is	be	VBZ
10_1101-2020_12_31_424971	290	3	made	make	VBN
10_1101-2020_12_31_424971	290	4	The	the	DT
10_1101-2020_12_31_424971	290	5	copyright	copyright	NN
10_1101-2020_12_31_424971	290	6	holder	holder	NN
10_1101-2020_12_31_424971	290	7	for	for	IN
10_1101-2020_12_31_424971	290	8	this	this	DT
10_1101-2020_12_31_424971	290	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	290	10	version	version	NN
10_1101-2020_12_31_424971	290	11	posted	post	VBD
10_1101-2020_12_31_424971	290	12	January	January	NNP
10_1101-2020_12_31_424971	290	13	2	2	CD
10_1101-2020_12_31_424971	290	14	,	,	,
10_1101-2020_12_31_424971	290	15	2021	2021	CD
10_1101-2020_12_31_424971	290	16	.	.	.
10_1101-2020_12_31_424971	290	17	;	;	:
10_1101-2020_12_31_424971	290	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	290	19	:	:	:
10_1101-2020_12_31_424971	290	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	290	21	preprint	preprint	NN
10_1101-2020_12_31_424971	290	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	290	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	290	24	28	28	CD
10_1101-2020_12_31_424971	290	25	µM	µM	NNP
10_1101-2020_12_31_424971	290	26	ProRS	ProRS	NNP
10_1101-2020_12_31_424971	290	27	,	,	,
10_1101-2020_12_31_424971	290	28	and	and	CC
10_1101-2020_12_31_424971	290	29	15	15	CD
10_1101-2020_12_31_424971	290	30	µM	µM	NNP
10_1101-2020_12_31_424971	290	31	[	[	-LRB-
10_1101-2020_12_31_424971	290	32	3H]-Pro	3H]-Pro	NNP
10_1101-2020_12_31_424971	290	33	(	(	-LRB-
10_1101-2020_12_31_424971	290	34	Perkin	Perkin	NNP
10_1101-2020_12_31_424971	290	35	Elmer	Elmer	NNP
10_1101-2020_12_31_424971	290	36	,	,	,
10_1101-2020_12_31_424971	290	37	7.5	7.5	CD
10_1101-2020_12_31_424971	290	38	Ci	Ci	NNP
10_1101-2020_12_31_424971	290	39	/	/	SYM
10_1101-2020_12_31_424971	290	40	mmol	mmol	NN
10_1101-2020_12_31_424971	290	41	)	)	-RRB-
10_1101-2020_12_31_424971	290	42	in	in	IN
10_1101-2020_12_31_424971	290	43	a	a	DT
10_1101-2020_12_31_424971	290	44	buffer	buffer	NN
10_1101-2020_12_31_424971	290	45	containing	contain	VBG
10_1101-2020_12_31_424971	290	46	20	20	CD
10_1101-2020_12_31_424971	290	47	mM	mm	NN
10_1101-2020_12_31_424971	290	48	KCl	KCl	NNS
10_1101-2020_12_31_424971	290	49	,	,	,
10_1101-2020_12_31_424971	290	50	10	10	CD
10_1101-2020_12_31_424971	290	51	677	677	CD
10_1101-2020_12_31_424971	290	52	mM	mM	NNP
10_1101-2020_12_31_424971	290	53	MgCl2	mgcl2	NN
10_1101-2020_12_31_424971	290	54	,	,	,
10_1101-2020_12_31_424971	290	55	4	4	CD
10_1101-2020_12_31_424971	290	56	mM	mM	NNP
10_1101-2020_12_31_424971	290	57	dithiothreitol	dithiothreitol	NN
10_1101-2020_12_31_424971	290	58	(	(	-LRB-
10_1101-2020_12_31_424971	290	59	DTT	DTT	NNP
10_1101-2020_12_31_424971	290	60	)	)	-RRB-
10_1101-2020_12_31_424971	290	61	,	,	,
10_1101-2020_12_31_424971	290	62	0.2	0.2	CD
10_1101-2020_12_31_424971	290	63	mg	mg	NNP
10_1101-2020_12_31_424971	290	64	/	/	SYM
10_1101-2020_12_31_424971	290	65	mL	mL	NNP
10_1101-2020_12_31_424971	290	66	bovine	bovine	NN
10_1101-2020_12_31_424971	290	67	serum	serum	NN
10_1101-2020_12_31_424971	290	68	albumin	albumin	NN
10_1101-2020_12_31_424971	290	69	(	(	-LRB-
10_1101-2020_12_31_424971	290	70	BSA	BSA	NNP
10_1101-2020_12_31_424971	290	71	)	)	-RRB-
10_1101-2020_12_31_424971	290	72	,	,	,
10_1101-2020_12_31_424971	290	73	2	2	CD
10_1101-2020_12_31_424971	290	74	mM	mm	NN
10_1101-2020_12_31_424971	290	75	ATP	atp	NN
10_1101-2020_12_31_424971	290	76	(	(	-LRB-
10_1101-2020_12_31_424971	290	77	pH	pH	NNP
10_1101-2020_12_31_424971	290	78	678	678	CD
10_1101-2020_12_31_424971	290	79	8.0	8.0	CD
10_1101-2020_12_31_424971	290	80	)	)	-RRB-
10_1101-2020_12_31_424971	290	81	,	,	,
10_1101-2020_12_31_424971	290	82	and	and	CC
10_1101-2020_12_31_424971	290	83	50	50	CD
10_1101-2020_12_31_424971	290	84	mM	mM	NNP
10_1101-2020_12_31_424971	290	85	Tris	Tris	NNP
10_1101-2020_12_31_424971	290	86	-	-	HYPH
10_1101-2020_12_31_424971	290	87	HCl	HCl	NNP
10_1101-2020_12_31_424971	290	88	(	(	-LRB-
10_1101-2020_12_31_424971	290	89	pH	pH	NNP
10_1101-2020_12_31_424971	290	90	7.5	7.5	CD
10_1101-2020_12_31_424971	290	91	)	)	-RRB-
10_1101-2020_12_31_424971	290	92	in	in	IN
10_1101-2020_12_31_424971	290	93	a	a	DT
10_1101-2020_12_31_424971	290	94	reaction	reaction	NN
10_1101-2020_12_31_424971	290	95	of	of	IN
10_1101-2020_12_31_424971	290	96	30	30	CD
10_1101-2020_12_31_424971	290	97	µL.	µl.	NN
10_1101-2020_12_31_424971	291	1	Reaction	reaction	NN
10_1101-2020_12_31_424971	291	2	aliquots	aliquot	NNS
10_1101-2020_12_31_424971	291	3	of	of	IN
10_1101-2020_12_31_424971	291	4	5	5	CD
10_1101-2020_12_31_424971	291	5	µL	µl	CD
10_1101-2020_12_31_424971	291	6	were	be	VBD
10_1101-2020_12_31_424971	291	7	removed	remove	VBN
10_1101-2020_12_31_424971	291	8	679	679	CD
10_1101-2020_12_31_424971	291	9	at	at	IN
10_1101-2020_12_31_424971	291	10	different	different	JJ
10_1101-2020_12_31_424971	291	11	time	time	NN
10_1101-2020_12_31_424971	291	12	intervals	interval	NNS
10_1101-2020_12_31_424971	291	13	and	and	CC
10_1101-2020_12_31_424971	291	14	precipitated	precipitate	VBD
10_1101-2020_12_31_424971	291	15	with	with	IN
10_1101-2020_12_31_424971	291	16	5	5	CD
10_1101-2020_12_31_424971	291	17	%	%	NN
10_1101-2020_12_31_424971	291	18	(	(	-LRB-
10_1101-2020_12_31_424971	291	19	w	w	NNP
10_1101-2020_12_31_424971	291	20	/	/	SYM
10_1101-2020_12_31_424971	291	21	v	v	LS
10_1101-2020_12_31_424971	291	22	)	)	-RRB-
10_1101-2020_12_31_424971	291	23	TCA	TCA	NNP
10_1101-2020_12_31_424971	291	24	on	on	IN
10_1101-2020_12_31_424971	291	25	filter	filter	NN
10_1101-2020_12_31_424971	291	26	pads	pad	NNS
10_1101-2020_12_31_424971	291	27	for	for	IN
10_1101-2020_12_31_424971	291	28	10	10	CD
10_1101-2020_12_31_424971	291	29	min	min	NN
10_1101-2020_12_31_424971	291	30	twice	twice	RB
10_1101-2020_12_31_424971	291	31	.	.	.
10_1101-2020_12_31_424971	292	1	Filter	Filter	NNP
10_1101-2020_12_31_424971	292	2	680	680	CD
10_1101-2020_12_31_424971	292	3	pads	pad	NNS
10_1101-2020_12_31_424971	292	4	were	be	VBD
10_1101-2020_12_31_424971	292	5	washed	wash	VBN
10_1101-2020_12_31_424971	292	6	with	with	IN
10_1101-2020_12_31_424971	292	7	95	95	CD
10_1101-2020_12_31_424971	292	8	%	%	NN
10_1101-2020_12_31_424971	292	9	ethanol	ethanol	NN
10_1101-2020_12_31_424971	292	10	twice	twice	RB
10_1101-2020_12_31_424971	292	11	,	,	,
10_1101-2020_12_31_424971	292	12	with	with	IN
10_1101-2020_12_31_424971	292	13	ether	ether	NN
10_1101-2020_12_31_424971	292	14	once	once	RB
10_1101-2020_12_31_424971	292	15	,	,	,
10_1101-2020_12_31_424971	292	16	air	air	NN
10_1101-2020_12_31_424971	292	17	dried	dry	VBN
10_1101-2020_12_31_424971	292	18	,	,	,
10_1101-2020_12_31_424971	292	19	and	and	CC
10_1101-2020_12_31_424971	292	20	measured	measure	VBN
10_1101-2020_12_31_424971	292	21	for	for	IN
10_1101-2020_12_31_424971	292	22	681	681	CD
10_1101-2020_12_31_424971	292	23	radioactivity	radioactivity	NN
10_1101-2020_12_31_424971	292	24	in	in	IN
10_1101-2020_12_31_424971	292	25	an	an	DT
10_1101-2020_12_31_424971	292	26	LS6000	LS6000	NNP
10_1101-2020_12_31_424971	292	27	scintillation	scintillation	NN
10_1101-2020_12_31_424971	292	28	counter	counter	NN
10_1101-2020_12_31_424971	292	29	(	(	-LRB-
10_1101-2020_12_31_424971	292	30	Beckman	Beckman	NNP
10_1101-2020_12_31_424971	292	31	)	)	-RRB-
10_1101-2020_12_31_424971	292	32	.	.	.
10_1101-2020_12_31_424971	293	1	Counts	count	NNS
10_1101-2020_12_31_424971	293	2	were	be	VBD
10_1101-2020_12_31_424971	293	3	converted	convert	VBN
10_1101-2020_12_31_424971	293	4	to	to	IN
10_1101-2020_12_31_424971	293	5	pmoles	pmole	NNS
10_1101-2020_12_31_424971	293	6	682	682	CD
10_1101-2020_12_31_424971	293	7	using	use	VBG
10_1101-2020_12_31_424971	293	8	the	the	DT
10_1101-2020_12_31_424971	293	9	specific	specific	JJ
10_1101-2020_12_31_424971	293	10	activity	activity	NN
10_1101-2020_12_31_424971	293	11	of	of	IN
10_1101-2020_12_31_424971	293	12	the	the	DT
10_1101-2020_12_31_424971	293	13	[	[	-LRB-
10_1101-2020_12_31_424971	293	14	3H]-Pro	3h]-pro	NN
10_1101-2020_12_31_424971	293	15	after	after	IN
10_1101-2020_12_31_424971	293	16	correcting	correct	VBG
10_1101-2020_12_31_424971	293	17	for	for	IN
10_1101-2020_12_31_424971	293	18	signal	signal	NN
10_1101-2020_12_31_424971	293	19	quenching	quenching	NN
10_1101-2020_12_31_424971	293	20	by	by	IN
10_1101-2020_12_31_424971	293	21	filter	filter	NN
10_1101-2020_12_31_424971	293	22	pads	pad	NNS
10_1101-2020_12_31_424971	293	23	.	.	.
10_1101-2020_12_31_424971	294	1	683	683	CD
10_1101-2020_12_31_424971	294	2	684	684	CD
10_1101-2020_12_31_424971	294	3	Cell	Cell	NNP
10_1101-2020_12_31_424971	294	4	-	-	HYPH
10_1101-2020_12_31_424971	294	5	based	base	VBN
10_1101-2020_12_31_424971	294	6	+1-frameshifting	+1-frameshifting	NNP
10_1101-2020_12_31_424971	294	7	reporter	reporter	NN
10_1101-2020_12_31_424971	294	8	assays	assays	RB
10_1101-2020_12_31_424971	294	9	.	.	.
10_1101-2020_12_31_424971	295	1	Isogenic	Isogenic	NNP
10_1101-2020_12_31_424971	295	2	E.	E.	NNP
10_1101-2020_12_31_424971	295	3	coli	coli	VBZ
10_1101-2020_12_31_424971	295	4	strains	strain	NNS
10_1101-2020_12_31_424971	295	5	expressing	express	VBG
10_1101-2020_12_31_424971	295	6	chromosomal	chromosomal	JJ
10_1101-2020_12_31_424971	295	7	685	685	CD
10_1101-2020_12_31_424971	295	8	copies	copy	NNS
10_1101-2020_12_31_424971	295	9	of	of	IN
10_1101-2020_12_31_424971	295	10	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	295	11	or	or	CC
10_1101-2020_12_31_424971	295	12	ProL	ProL	NNP
10_1101-2020_12_31_424971	295	13	were	be	VBD
10_1101-2020_12_31_424971	295	14	created	create	VBN
10_1101-2020_12_31_424971	295	15	in	in	IN
10_1101-2020_12_31_424971	295	16	a	a	DT
10_1101-2020_12_31_424971	295	17	previously	previously	RB
10_1101-2020_12_31_424971	295	18	developed	develop	VBN
10_1101-2020_12_31_424971	295	19	trmD	trmd	NN
10_1101-2020_12_31_424971	295	20	-	-	HYPH
10_1101-2020_12_31_424971	295	21	knockdown	knockdown	VBN
10_1101-2020_12_31_424971	295	22	(	(	-LRB-
10_1101-2020_12_31_424971	295	23	trmD	trmD	NNP
10_1101-2020_12_31_424971	295	24	-	-	HYPH
10_1101-2020_12_31_424971	295	25	KD	KD	NNP
10_1101-2020_12_31_424971	295	26	)	)	-RRB-
10_1101-2020_12_31_424971	295	27	686	686	CD
10_1101-2020_12_31_424971	295	28	background	background	NN
10_1101-2020_12_31_424971	295	29	,	,	,
10_1101-2020_12_31_424971	295	30	in	in	IN
10_1101-2020_12_31_424971	295	31	which	which	WDT
10_1101-2020_12_31_424971	295	32	the	the	DT
10_1101-2020_12_31_424971	295	33	chromosomal	chromosomal	NN
10_1101-2020_12_31_424971	295	34	trmD	trmd	CD
10_1101-2020_12_31_424971	295	35	is	be	VBZ
10_1101-2020_12_31_424971	295	36	deleted	delete	VBN
10_1101-2020_12_31_424971	295	37	but	but	CC
10_1101-2020_12_31_424971	295	38	cell	cell	NN
10_1101-2020_12_31_424971	295	39	viability	viability	NN
10_1101-2020_12_31_424971	295	40	is	be	VBZ
10_1101-2020_12_31_424971	295	41	maintained	maintain	VBN
10_1101-2020_12_31_424971	295	42	through	through	IN
10_1101-2020_12_31_424971	295	43	the	the	DT
10_1101-2020_12_31_424971	295	44	687	687	CD
10_1101-2020_12_31_424971	295	45	arabinose	arabinose	RB
10_1101-2020_12_31_424971	295	46	-	-	HYPH
10_1101-2020_12_31_424971	295	47	induced	induce	VBN
10_1101-2020_12_31_424971	295	48	expression	expression	NN
10_1101-2020_12_31_424971	295	49	of	of	IN
10_1101-2020_12_31_424971	295	50	a	a	DT
10_1101-2020_12_31_424971	295	51	plasmid	plasmid	NN
10_1101-2020_12_31_424971	295	52	-	-	HYPH
10_1101-2020_12_31_424971	295	53	borne	bear	VBN
10_1101-2020_12_31_424971	295	54	trm5	trm5	NN
10_1101-2020_12_31_424971	295	55	,	,	,
10_1101-2020_12_31_424971	295	56	the	the	DT
10_1101-2020_12_31_424971	295	57	human	human	JJ
10_1101-2020_12_31_424971	295	58	counterpart	counterpart	NN
10_1101-2020_12_31_424971	295	59	of	of	IN
10_1101-2020_12_31_424971	295	60	trmD29,30	trmD29,30	NNP
10_1101-2020_12_31_424971	295	61	that	that	DT
10_1101-2020_12_31_424971	295	62	is	be	VBZ
10_1101-2020_12_31_424971	295	63	688	688	CD
10_1101-2020_12_31_424971	295	64	competent	competent	JJ
10_1101-2020_12_31_424971	295	65	for	for	IN
10_1101-2020_12_31_424971	295	66	m1G37	m1g37	JJ
10_1101-2020_12_31_424971	295	67	synthesis	synthesis	NN
10_1101-2020_12_31_424971	295	68	to	to	TO
10_1101-2020_12_31_424971	295	69	support	support	VB
10_1101-2020_12_31_424971	295	70	bacterial	bacterial	JJ
10_1101-2020_12_31_424971	295	71	growth	growth	NN
10_1101-2020_12_31_424971	295	72	(	(	-LRB-
10_1101-2020_12_31_424971	295	73	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	295	74	Table	Table	NNP
10_1101-2020_12_31_424971	295	75	1	1	CD
10_1101-2020_12_31_424971	295	76	)	)	-RRB-
10_1101-2020_12_31_424971	295	77	.	.	.
10_1101-2020_12_31_424971	296	1	Due	due	IN
10_1101-2020_12_31_424971	296	2	to	to	IN
10_1101-2020_12_31_424971	296	3	the	the	DT
10_1101-2020_12_31_424971	296	4	689	689	CD
10_1101-2020_12_31_424971	296	5	essentiality	essentiality	NN
10_1101-2020_12_31_424971	296	6	of	of	IN
10_1101-2020_12_31_424971	296	7	trmD	trmd	CD
10_1101-2020_12_31_424971	296	8	for	for	IN
10_1101-2020_12_31_424971	296	9	cell	cell	NN
10_1101-2020_12_31_424971	296	10	growth	growth	NN
10_1101-2020_12_31_424971	296	11	,	,	,
10_1101-2020_12_31_424971	296	12	a	a	DT
10_1101-2020_12_31_424971	296	13	simple	simple	JJ
10_1101-2020_12_31_424971	296	14	knock	knock	NN
10_1101-2020_12_31_424971	296	15	-	-	HYPH
10_1101-2020_12_31_424971	296	16	out	out	NN
10_1101-2020_12_31_424971	296	17	can	can	MD
10_1101-2020_12_31_424971	296	18	not	not	RB
10_1101-2020_12_31_424971	296	19	be	be	VB
10_1101-2020_12_31_424971	296	20	made	make	VBN
10_1101-2020_12_31_424971	296	21	.	.	.
10_1101-2020_12_31_424971	297	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	297	2	chose	choose	VBD
10_1101-2020_12_31_424971	297	3	human	human	JJ
10_1101-2020_12_31_424971	297	4	Trm5	Trm5	NNP
10_1101-2020_12_31_424971	297	5	690	690	CD
10_1101-2020_12_31_424971	297	6	as	as	IN
10_1101-2020_12_31_424971	297	7	the	the	DT
10_1101-2020_12_31_424971	297	8	maintenance	maintenance	NN
10_1101-2020_12_31_424971	297	9	protein	protein	NN
10_1101-2020_12_31_424971	297	10	in	in	IN
10_1101-2020_12_31_424971	297	11	the	the	DT
10_1101-2020_12_31_424971	297	12	trmD	trmd	CD
10_1101-2020_12_31_424971	297	13	-	-	HYPH
10_1101-2020_12_31_424971	297	14	KD	KD	NNP
10_1101-2020_12_31_424971	297	15	background	background	NN
10_1101-2020_12_31_424971	297	16	,	,	,
10_1101-2020_12_31_424971	297	17	because	because	IN
10_1101-2020_12_31_424971	297	18	this	this	DT
10_1101-2020_12_31_424971	297	19	enzyme	enzyme	NNS
10_1101-2020_12_31_424971	297	20	is	be	VBZ
10_1101-2020_12_31_424971	297	21	rapidly	rapidly	RB
10_1101-2020_12_31_424971	297	22	degraded	degrade	VBN
10_1101-2020_12_31_424971	297	23	691	691	CD
10_1101-2020_12_31_424971	297	24	in	in	IN
10_1101-2020_12_31_424971	297	25	E.	E.	NNP
10_1101-2020_12_31_424971	297	26	coli	coli	NNS
10_1101-2020_12_31_424971	297	27	once	once	IN
10_1101-2020_12_31_424971	297	28	its	-PRON-	PRP$
10_1101-2020_12_31_424971	297	29	expression	expression	NN
10_1101-2020_12_31_424971	297	30	is	be	VBZ
10_1101-2020_12_31_424971	297	31	turned	turn	VBN
10_1101-2020_12_31_424971	297	32	off	off	RP
10_1101-2020_12_31_424971	297	33	to	to	TO
10_1101-2020_12_31_424971	297	34	allow	allow	VB
10_1101-2020_12_31_424971	297	35	immediate	immediate	JJ
10_1101-2020_12_31_424971	297	36	arrest	arrest	NN
10_1101-2020_12_31_424971	297	37	of	of	IN
10_1101-2020_12_31_424971	297	38	m1G37	m1g37	JJ
10_1101-2020_12_31_424971	297	39	synthesis	synthesis	NN
10_1101-2020_12_31_424971	297	40	.	.	.
10_1101-2020_12_31_424971	298	1	In	in	IN
10_1101-2020_12_31_424971	298	2	the	the	DT
10_1101-2020_12_31_424971	298	3	692	692	CD
10_1101-2020_12_31_424971	298	4	isogenic	isogenic	JJ
10_1101-2020_12_31_424971	298	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	298	6	and	and	CC
10_1101-2020_12_31_424971	298	7	ProL	ProL	NNP
10_1101-2020_12_31_424971	298	8	strains	strain	NNS
10_1101-2020_12_31_424971	298	9	,	,	,
10_1101-2020_12_31_424971	298	10	the	the	DT
10_1101-2020_12_31_424971	298	11	level	level	NN
10_1101-2020_12_31_424971	298	12	of	of	IN
10_1101-2020_12_31_424971	298	13	m1G37	m1g37	NN
10_1101-2020_12_31_424971	298	14	is	be	VBZ
10_1101-2020_12_31_424971	298	15	determined	determine	VBN
10_1101-2020_12_31_424971	298	16	by	by	IN
10_1101-2020_12_31_424971	298	17	the	the	DT
10_1101-2020_12_31_424971	298	18	concentration	concentration	NN
10_1101-2020_12_31_424971	298	19	of	of	IN
10_1101-2020_12_31_424971	298	20	the	the	DT
10_1101-2020_12_31_424971	298	21	693	693	CD
10_1101-2020_12_31_424971	298	22	added	add	VBN
10_1101-2020_12_31_424971	298	23	arabinose	arabinose	RB
10_1101-2020_12_31_424971	298	24	in	in	IN
10_1101-2020_12_31_424971	298	25	a	a	DT
10_1101-2020_12_31_424971	298	26	cellular	cellular	JJ
10_1101-2020_12_31_424971	298	27	context	context	NN
10_1101-2020_12_31_424971	298	28	that	that	WDT
10_1101-2020_12_31_424971	298	29	expresses	express	VBZ
10_1101-2020_12_31_424971	298	30	ProM	ProM	NNP
10_1101-2020_12_31_424971	298	31	as	as	IN
10_1101-2020_12_31_424971	298	32	the	the	DT
10_1101-2020_12_31_424971	298	33	only	only	JJ
10_1101-2020_12_31_424971	298	34	competing	compete	VBG
10_1101-2020_12_31_424971	298	35	tRNAPro	tRNAPro	NNP
10_1101-2020_12_31_424971	298	36	species	species	NN
10_1101-2020_12_31_424971	298	37	.	.	.
10_1101-2020_12_31_424971	299	1	694	694	CD
10_1101-2020_12_31_424971	299	2	In	in	IN
10_1101-2020_12_31_424971	299	3	the	the	DT
10_1101-2020_12_31_424971	299	4	m1G37	m1g37	NN
10_1101-2020_12_31_424971	299	5	+	+	CC
10_1101-2020_12_31_424971	299	6	condition	condition	NN
10_1101-2020_12_31_424971	299	7	,	,	,
10_1101-2020_12_31_424971	299	8	where	where	WRB
10_1101-2020_12_31_424971	299	9	arabinose	arabinose	DT
10_1101-2020_12_31_424971	299	10	was	be	VBD
10_1101-2020_12_31_424971	299	11	added	add	VBN
10_1101-2020_12_31_424971	299	12	to	to	IN
10_1101-2020_12_31_424971	299	13	0.2	0.2	CD
10_1101-2020_12_31_424971	299	14	%	%	NN
10_1101-2020_12_31_424971	299	15	in	in	IN
10_1101-2020_12_31_424971	299	16	the	the	DT
10_1101-2020_12_31_424971	299	17	medium	medium	NN
10_1101-2020_12_31_424971	299	18	,	,	,
10_1101-2020_12_31_424971	299	19	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	299	20	substrates	substrate	VBZ
10_1101-2020_12_31_424971	299	21	695	695	CD
10_1101-2020_12_31_424971	299	22	of	of	IN
10_1101-2020_12_31_424971	299	23	N1-methylation	N1-methylation	NNP
10_1101-2020_12_31_424971	299	24	were	be	VBD
10_1101-2020_12_31_424971	299	25	confirmed	confirm	VBN
10_1101-2020_12_31_424971	299	26	to	to	TO
10_1101-2020_12_31_424971	299	27	be	be	VB
10_1101-2020_12_31_424971	299	28	100	100	CD
10_1101-2020_12_31_424971	299	29	%	%	NN
10_1101-2020_12_31_424971	299	30	methylated	methylate	VBN
10_1101-2020_12_31_424971	299	31	by	by	IN
10_1101-2020_12_31_424971	299	32	mass	mass	NNP
10_1101-2020_12_31_424971	299	33	spectrometry	spectrometry	NNP
10_1101-2020_12_31_424971	299	34	,	,	,
10_1101-2020_12_31_424971	299	35	whereas	whereas	IN
10_1101-2020_12_31_424971	299	36	in	in	IN
10_1101-2020_12_31_424971	299	37	the	the	DT
10_1101-2020_12_31_424971	299	38	696	696	CD
10_1101-2020_12_31_424971	299	39	m1G37	m1g37	NN
10_1101-2020_12_31_424971	299	40	–	–	:
10_1101-2020_12_31_424971	299	41	condition	condition	NN
10_1101-2020_12_31_424971	299	42	,	,	,
10_1101-2020_12_31_424971	299	43	where	where	WRB
10_1101-2020_12_31_424971	299	44	arabinose	arabinose	DT
10_1101-2020_12_31_424971	299	45	was	be	VBD
10_1101-2020_12_31_424971	299	46	not	not	RB
10_1101-2020_12_31_424971	299	47	added	add	VBN
10_1101-2020_12_31_424971	299	48	to	to	IN
10_1101-2020_12_31_424971	299	49	the	the	DT
10_1101-2020_12_31_424971	299	50	medium	medium	NN
10_1101-2020_12_31_424971	299	51	,	,	,
10_1101-2020_12_31_424971	299	52	tRNA	trna	JJ
10_1101-2020_12_31_424971	299	53	substrates	substrate	NNS
10_1101-2020_12_31_424971	299	54	of	of	IN
10_1101-2020_12_31_424971	299	55	N1	n1	NN
10_1101-2020_12_31_424971	299	56	-	-	HYPH
10_1101-2020_12_31_424971	299	57	697	697	CD
10_1101-2020_12_31_424971	299	58	methylation	methylation	NN
10_1101-2020_12_31_424971	299	59	were	be	VBD
10_1101-2020_12_31_424971	299	60	confirmed	confirm	VBN
10_1101-2020_12_31_424971	299	61	to	to	TO
10_1101-2020_12_31_424971	299	62	be	be	VB
10_1101-2020_12_31_424971	299	63	20	20	CD
10_1101-2020_12_31_424971	299	64	%	%	NN
10_1101-2020_12_31_424971	299	65	methylated	methylate	VBN
10_1101-2020_12_31_424971	299	66	by	by	IN
10_1101-2020_12_31_424971	299	67	mass	mass	NNP
10_1101-2020_12_31_424971	299	68	spectrometry30	spectrometry30	NNP
10_1101-2020_12_31_424971	299	69	.	.	.
10_1101-2020_12_31_424971	300	1	Each	each	DT
10_1101-2020_12_31_424971	300	2	strain	strain	NN
10_1101-2020_12_31_424971	300	3	was	be	VBD
10_1101-2020_12_31_424971	300	4	698	698	CD
10_1101-2020_12_31_424971	300	5	transformed	transform	VBN
10_1101-2020_12_31_424971	300	6	with	with	IN
10_1101-2020_12_31_424971	300	7	the	the	DT
10_1101-2020_12_31_424971	300	8	pKK223	pKK223	NNP
10_1101-2020_12_31_424971	300	9	-	-	HYPH
10_1101-2020_12_31_424971	300	10	3	3	CD
10_1101-2020_12_31_424971	300	11	plasmid	plasmid	NN
10_1101-2020_12_31_424971	300	12	expressing	express	VBG
10_1101-2020_12_31_424971	300	13	an	an	DT
10_1101-2020_12_31_424971	300	14	mRNA	mrna	NN
10_1101-2020_12_31_424971	300	15	with	with	IN
10_1101-2020_12_31_424971	300	16	a	a	DT
10_1101-2020_12_31_424971	300	17	CCC	CCC	NNP
10_1101-2020_12_31_424971	300	18	-	-	HYPH
10_1101-2020_12_31_424971	300	19	C	C	NNP
10_1101-2020_12_31_424971	300	20	motif	motif	NN
10_1101-2020_12_31_424971	300	21	at	at	IN
10_1101-2020_12_31_424971	300	22	the	the	DT
10_1101-2020_12_31_424971	300	23	2nd	2nd	JJ
10_1101-2020_12_31_424971	300	24	codon	codon	NNP
10_1101-2020_12_31_424971	300	25	699	699	CD
10_1101-2020_12_31_424971	300	26	position	position	NN
10_1101-2020_12_31_424971	300	27	of	of	IN
10_1101-2020_12_31_424971	300	28	the	the	DT
10_1101-2020_12_31_424971	300	29	reporter	reporter	NN
10_1101-2020_12_31_424971	300	30	lacZ	lacz	CD
10_1101-2020_12_31_424971	300	31	gene	gene	NN
10_1101-2020_12_31_424971	300	32	.	.	.
10_1101-2020_12_31_424971	301	1	To	to	TO
10_1101-2020_12_31_424971	301	2	simplify	simplify	VB
10_1101-2020_12_31_424971	301	3	the	the	DT
10_1101-2020_12_31_424971	301	4	interpretation	interpretation	NN
10_1101-2020_12_31_424971	301	5	,	,	,
10_1101-2020_12_31_424971	301	6	the	the	DT
10_1101-2020_12_31_424971	301	7	natural	natural	JJ
10_1101-2020_12_31_424971	301	8	AUG	AUG	NNP
10_1101-2020_12_31_424971	301	9	codon	codon	NN
10_1101-2020_12_31_424971	301	10	at	at	IN
10_1101-2020_12_31_424971	301	11	the	the	DT
10_1101-2020_12_31_424971	301	12	5th	5th	JJ
10_1101-2020_12_31_424971	301	13	700	700	CD
10_1101-2020_12_31_424971	301	14	position	position	NN
10_1101-2020_12_31_424971	301	15	of	of	IN
10_1101-2020_12_31_424971	301	16	lacZ	lacz	CD
10_1101-2020_12_31_424971	301	17	was	be	VBD
10_1101-2020_12_31_424971	301	18	removed	remove	VBN
10_1101-2020_12_31_424971	301	19	.	.	.
10_1101-2020_12_31_424971	302	1	A	a	DT
10_1101-2020_12_31_424971	302	2	+1	+1	:
10_1101-2020_12_31_424971	302	3	frameshift	frameshift	NN
10_1101-2020_12_31_424971	302	4	at	at	IN
10_1101-2020_12_31_424971	302	5	the	the	DT
10_1101-2020_12_31_424971	302	6	CCC	CCC	NNP
10_1101-2020_12_31_424971	302	7	-	-	HYPH
10_1101-2020_12_31_424971	302	8	C	C	NNP
10_1101-2020_12_31_424971	302	9	motif	motif	NN
10_1101-2020_12_31_424971	302	10	would	would	MD
10_1101-2020_12_31_424971	302	11	enable	enable	VB
10_1101-2020_12_31_424971	302	12	expression	expression	NN
10_1101-2020_12_31_424971	302	13	of	of	IN
10_1101-2020_12_31_424971	302	14	701	701	CD
10_1101-2020_12_31_424971	302	15	.CC	.CC	,
10_1101-2020_12_31_424971	302	16	-	-	HYPH
10_1101-2020_12_31_424971	302	17	BY	by	IN
10_1101-2020_12_31_424971	302	18	-	-	HYPH
10_1101-2020_12_31_424971	302	19	NC	NC	NNP
10_1101-2020_12_31_424971	302	20	-	-	HYPH
10_1101-2020_12_31_424971	302	21	ND	ND	NNP
10_1101-2020_12_31_424971	302	22	4.0	4.0	CD
10_1101-2020_12_31_424971	302	23	International	International	NNP
10_1101-2020_12_31_424971	302	24	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	302	25	under	under	IN
10_1101-2020_12_31_424971	302	26	a	a	DT
10_1101-2020_12_31_424971	302	27	(	(	-LRB-
10_1101-2020_12_31_424971	302	28	which	which	WDT
10_1101-2020_12_31_424971	302	29	was	be	VBD
10_1101-2020_12_31_424971	302	30	not	not	RB
10_1101-2020_12_31_424971	302	31	certified	certify	VBN
10_1101-2020_12_31_424971	302	32	by	by	IN
10_1101-2020_12_31_424971	302	33	peer	peer	NN
10_1101-2020_12_31_424971	302	34	review	review	NN
10_1101-2020_12_31_424971	302	35	)	)	-RRB-
10_1101-2020_12_31_424971	302	36	is	be	VBZ
10_1101-2020_12_31_424971	302	37	the	the	DT
10_1101-2020_12_31_424971	302	38	author	author	NN
10_1101-2020_12_31_424971	302	39	/	/	SYM
10_1101-2020_12_31_424971	302	40	funder	funder	NN
10_1101-2020_12_31_424971	302	41	,	,	,
10_1101-2020_12_31_424971	302	42	who	who	WP
10_1101-2020_12_31_424971	302	43	has	have	VBZ
10_1101-2020_12_31_424971	302	44	granted	grant	VBN
10_1101-2020_12_31_424971	302	45	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	302	46	a	a	DT
10_1101-2020_12_31_424971	302	47	license	license	NN
10_1101-2020_12_31_424971	302	48	to	to	TO
10_1101-2020_12_31_424971	302	49	display	display	VB
10_1101-2020_12_31_424971	302	50	the	the	DT
10_1101-2020_12_31_424971	302	51	preprint	preprint	NN
10_1101-2020_12_31_424971	302	52	in	in	IN
10_1101-2020_12_31_424971	302	53	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	302	54	.	.	.
10_1101-2020_12_31_424971	303	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	303	2	is	be	VBZ
10_1101-2020_12_31_424971	303	3	made	make	VBN
10_1101-2020_12_31_424971	303	4	The	the	DT
10_1101-2020_12_31_424971	303	5	copyright	copyright	NN
10_1101-2020_12_31_424971	303	6	holder	holder	NN
10_1101-2020_12_31_424971	303	7	for	for	IN
10_1101-2020_12_31_424971	303	8	this	this	DT
10_1101-2020_12_31_424971	303	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	303	10	version	version	NN
10_1101-2020_12_31_424971	303	11	posted	post	VBD
10_1101-2020_12_31_424971	303	12	January	January	NNP
10_1101-2020_12_31_424971	303	13	2	2	CD
10_1101-2020_12_31_424971	303	14	,	,	,
10_1101-2020_12_31_424971	303	15	2021	2021	CD
10_1101-2020_12_31_424971	303	16	.	.	.
10_1101-2020_12_31_424971	303	17	;	;	:
10_1101-2020_12_31_424971	303	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	303	19	:	:	:
10_1101-2020_12_31_424971	303	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	303	21	preprint	preprint	NN
10_1101-2020_12_31_424971	303	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	303	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	303	24	29	29	CD
10_1101-2020_12_31_424971	303	25	lacZ.	lacz.	NN
10_1101-2020_12_31_424971	304	1	The	the	DT
10_1101-2020_12_31_424971	304	2	activity	activity	NN
10_1101-2020_12_31_424971	304	3	of	of	IN
10_1101-2020_12_31_424971	304	4	b	b	NN
10_1101-2020_12_31_424971	304	5	-	-	:
10_1101-2020_12_31_424971	304	6	Gal	Gal	NNP
10_1101-2020_12_31_424971	304	7	was	be	VBD
10_1101-2020_12_31_424971	304	8	directly	directly	RB
10_1101-2020_12_31_424971	304	9	measured	measure	VBN
10_1101-2020_12_31_424971	304	10	from	from	IN
10_1101-2020_12_31_424971	304	11	lysates	lysate	NNS
10_1101-2020_12_31_424971	304	12	of	of	IN
10_1101-2020_12_31_424971	304	13	cells	cell	NNS
10_1101-2020_12_31_424971	304	14	grown	grow	VBN
10_1101-2020_12_31_424971	304	15	in	in	IN
10_1101-2020_12_31_424971	304	16	the	the	DT
10_1101-2020_12_31_424971	304	17	presence	presence	NN
10_1101-2020_12_31_424971	304	18	or	or	CC
10_1101-2020_12_31_424971	304	19	702	702	CD
10_1101-2020_12_31_424971	304	20	absence	absence	NN
10_1101-2020_12_31_424971	304	21	of	of	IN
10_1101-2020_12_31_424971	304	22	0.2	0.2	CD
10_1101-2020_12_31_424971	304	23	%	%	NN
10_1101-2020_12_31_424971	304	24	arabinose	arabinose	RB
10_1101-2020_12_31_424971	304	25	to	to	TO
10_1101-2020_12_31_424971	304	26	induce	induce	VB
10_1101-2020_12_31_424971	304	27	or	or	CC
10_1101-2020_12_31_424971	304	28	not	not	RB
10_1101-2020_12_31_424971	304	29	induce	induce	VB
10_1101-2020_12_31_424971	304	30	,	,	,
10_1101-2020_12_31_424971	304	31	respectively	respectively	RB
10_1101-2020_12_31_424971	304	32	,	,	,
10_1101-2020_12_31_424971	304	33	the	the	DT
10_1101-2020_12_31_424971	304	34	plasmid	plasmid	NNP
10_1101-2020_12_31_424971	304	35	-	-	HYPH
10_1101-2020_12_31_424971	304	36	borne	bear	VBN
10_1101-2020_12_31_424971	304	37	human	human	JJ
10_1101-2020_12_31_424971	304	38	trm5	trm5	NN
10_1101-2020_12_31_424971	304	39	.	.	.
10_1101-2020_12_31_424971	305	1	703	703	CD
10_1101-2020_12_31_424971	305	2	In	in	IN
10_1101-2020_12_31_424971	305	3	these	these	DT
10_1101-2020_12_31_424971	305	4	assays	assay	NNS
10_1101-2020_12_31_424971	305	5	,	,	,
10_1101-2020_12_31_424971	305	6	decoding	decode	VBG
10_1101-2020_12_31_424971	305	7	of	of	IN
10_1101-2020_12_31_424971	305	8	the	the	DT
10_1101-2020_12_31_424971	305	9	CCC	CCC	NNP
10_1101-2020_12_31_424971	305	10	-	-	HYPH
10_1101-2020_12_31_424971	305	11	C	C	NNP
10_1101-2020_12_31_424971	305	12	codon	codon	NN
10_1101-2020_12_31_424971	305	13	motif	motif	NN
10_1101-2020_12_31_424971	305	14	would	would	MD
10_1101-2020_12_31_424971	305	15	be	be	VB
10_1101-2020_12_31_424971	305	16	mediated	mediate	VBN
10_1101-2020_12_31_424971	305	17	by	by	IN
10_1101-2020_12_31_424971	305	18	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	305	19	and	and	CC
10_1101-2020_12_31_424971	305	20	ProM	ProM	NNP
10_1101-2020_12_31_424971	305	21	in	in	IN
10_1101-2020_12_31_424971	305	22	704	704	CD
10_1101-2020_12_31_424971	305	23	the	the	DT
10_1101-2020_12_31_424971	305	24	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	305	25	strain	strain	NN
10_1101-2020_12_31_424971	305	26	,	,	,
10_1101-2020_12_31_424971	305	27	and	and	CC
10_1101-2020_12_31_424971	305	28	would	would	MD
10_1101-2020_12_31_424971	305	29	be	be	VB
10_1101-2020_12_31_424971	305	30	mediated	mediate	VBN
10_1101-2020_12_31_424971	305	31	by	by	IN
10_1101-2020_12_31_424971	305	32	ProL	ProL	NNP
10_1101-2020_12_31_424971	305	33	and	and	CC
10_1101-2020_12_31_424971	305	34	ProM	ProM	NNP
10_1101-2020_12_31_424971	305	35	in	in	IN
10_1101-2020_12_31_424971	305	36	the	the	DT
10_1101-2020_12_31_424971	305	37	ProL	ProL	NNP
10_1101-2020_12_31_424971	305	38	strain	strain	NN
10_1101-2020_12_31_424971	305	39	.	.	.
10_1101-2020_12_31_424971	306	1	Due	due	IN
10_1101-2020_12_31_424971	306	2	to	to	IN
10_1101-2020_12_31_424971	306	3	the	the	DT
10_1101-2020_12_31_424971	306	4	presence	presence	NN
10_1101-2020_12_31_424971	306	5	705	705	CD
10_1101-2020_12_31_424971	306	6	of	of	IN
10_1101-2020_12_31_424971	306	7	ProM	ProM	NNP
10_1101-2020_12_31_424971	306	8	in	in	IN
10_1101-2020_12_31_424971	306	9	both	both	DT
10_1101-2020_12_31_424971	306	10	strains	strain	NNS
10_1101-2020_12_31_424971	306	11	,	,	,
10_1101-2020_12_31_424971	306	12	there	there	EX
10_1101-2020_12_31_424971	306	13	would	would	MD
10_1101-2020_12_31_424971	306	14	be	be	VB
10_1101-2020_12_31_424971	306	15	no	no	DT
10_1101-2020_12_31_424971	306	16	vacancy	vacancy	NN
10_1101-2020_12_31_424971	306	17	at	at	IN
10_1101-2020_12_31_424971	306	18	the	the	DT
10_1101-2020_12_31_424971	306	19	CCC	CCC	NNP
10_1101-2020_12_31_424971	306	20	-	-	HYPH
10_1101-2020_12_31_424971	306	21	C	C	NNP
10_1101-2020_12_31_424971	306	22	codon	codon	NN
10_1101-2020_12_31_424971	306	23	motif	motif	NN
10_1101-2020_12_31_424971	306	24	.	.	.
10_1101-2020_12_31_424971	307	1	706	706	CD
10_1101-2020_12_31_424971	307	2	707	707	CD
10_1101-2020_12_31_424971	307	3	Cell	cell	NN
10_1101-2020_12_31_424971	307	4	-	-	HYPH
10_1101-2020_12_31_424971	307	5	based	base	VBN
10_1101-2020_12_31_424971	307	6	+1	+1	NNS
10_1101-2020_12_31_424971	307	7	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	307	8	lolB	lolB	NNS
10_1101-2020_12_31_424971	307	9	assays	assays	RB
10_1101-2020_12_31_424971	307	10	.	.	.
10_1101-2020_12_31_424971	308	1	To	to	TO
10_1101-2020_12_31_424971	308	2	quantify	quantify	VB
10_1101-2020_12_31_424971	308	3	the	the	DT
10_1101-2020_12_31_424971	308	4	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	308	5	efficiency	efficiency	NN
10_1101-2020_12_31_424971	308	6	at	at	IN
10_1101-2020_12_31_424971	308	7	the	the	DT
10_1101-2020_12_31_424971	308	8	708	708	CD
10_1101-2020_12_31_424971	308	9	CCC	CCC	NNP
10_1101-2020_12_31_424971	308	10	-	-	HYPH
10_1101-2020_12_31_424971	308	11	C	C	NNP
10_1101-2020_12_31_424971	308	12	motif	motif	NN
10_1101-2020_12_31_424971	308	13	at	at	IN
10_1101-2020_12_31_424971	308	14	the	the	DT
10_1101-2020_12_31_424971	308	15	2nd	2nd	JJ
10_1101-2020_12_31_424971	308	16	codon	codon	NNP
10_1101-2020_12_31_424971	308	17	position	position	NN
10_1101-2020_12_31_424971	308	18	of	of	IN
10_1101-2020_12_31_424971	308	19	the	the	DT
10_1101-2020_12_31_424971	308	20	natural	natural	JJ
10_1101-2020_12_31_424971	308	21	lolB	lolB	NNP
10_1101-2020_12_31_424971	308	22	gene	gene	NN
10_1101-2020_12_31_424971	308	23	,	,	,
10_1101-2020_12_31_424971	308	24	the	the	DT
10_1101-2020_12_31_424971	308	25	ratio	ratio	NN
10_1101-2020_12_31_424971	308	26	of	of	IN
10_1101-2020_12_31_424971	308	27	protein	protein	NN
10_1101-2020_12_31_424971	308	28	synthesis	synthesis	NN
10_1101-2020_12_31_424971	308	29	of	of	IN
10_1101-2020_12_31_424971	308	30	709	709	CD
10_1101-2020_12_31_424971	308	31	lolB	lolB	NNS
10_1101-2020_12_31_424971	308	32	to	to	IN
10_1101-2020_12_31_424971	308	33	cysS	cysS	NNP
10_1101-2020_12_31_424971	308	34	was	be	VBD
10_1101-2020_12_31_424971	308	35	measured	measure	VBN
10_1101-2020_12_31_424971	308	36	by	by	IN
10_1101-2020_12_31_424971	308	37	Western	western	JJ
10_1101-2020_12_31_424971	308	38	blots	blot	NNS
10_1101-2020_12_31_424971	308	39	.	.	.
10_1101-2020_12_31_424971	309	1	Overnight	overnight	JJ
10_1101-2020_12_31_424971	309	2	cultures	culture	NNS
10_1101-2020_12_31_424971	309	3	of	of	IN
10_1101-2020_12_31_424971	309	4	the	the	DT
10_1101-2020_12_31_424971	309	5	isogenic	isogenic	JJ
10_1101-2020_12_31_424971	309	6	strains	strain	NNS
10_1101-2020_12_31_424971	309	7	expressing	express	VBG
10_1101-2020_12_31_424971	309	8	710	710	CD
10_1101-2020_12_31_424971	309	9	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	309	10	or	or	CC
10_1101-2020_12_31_424971	309	11	ProL	ProL	NNP
10_1101-2020_12_31_424971	309	12	were	be	VBD
10_1101-2020_12_31_424971	309	13	separately	separately	RB
10_1101-2020_12_31_424971	309	14	inoculated	inoculate	VBN
10_1101-2020_12_31_424971	309	15	into	into	IN
10_1101-2020_12_31_424971	309	16	fresh	fresh	JJ
10_1101-2020_12_31_424971	309	17	LB	LB	NNP
10_1101-2020_12_31_424971	309	18	media	medium	NNS
10_1101-2020_12_31_424971	309	19	in	in	IN
10_1101-2020_12_31_424971	309	20	the	the	DT
10_1101-2020_12_31_424971	309	21	presence	presence	NN
10_1101-2020_12_31_424971	309	22	or	or	CC
10_1101-2020_12_31_424971	309	23	absence	absence	NN
10_1101-2020_12_31_424971	309	24	of	of	IN
10_1101-2020_12_31_424971	309	25	0.2	0.2	CD
10_1101-2020_12_31_424971	309	26	%	%	NN
10_1101-2020_12_31_424971	309	27	711	711	CD
10_1101-2020_12_31_424971	309	28	arabinose	arabinose	RB
10_1101-2020_12_31_424971	309	29	and	and	CC
10_1101-2020_12_31_424971	309	30	were	be	VBD
10_1101-2020_12_31_424971	309	31	grown	grow	VBN
10_1101-2020_12_31_424971	309	32	for	for	IN
10_1101-2020_12_31_424971	309	33	4	4	CD
10_1101-2020_12_31_424971	309	34	h	h	NN
10_1101-2020_12_31_424971	309	35	to	to	TO
10_1101-2020_12_31_424971	309	36	produce	produce	VB
10_1101-2020_12_31_424971	309	37	the	the	DT
10_1101-2020_12_31_424971	309	38	m1G37	m1g37	NN
10_1101-2020_12_31_424971	309	39	+	+	SYM
10_1101-2020_12_31_424971	309	40	and	and	CC
10_1101-2020_12_31_424971	309	41	m1G37	m1g37	NN
10_1101-2020_12_31_424971	309	42	–	–	:
10_1101-2020_12_31_424971	309	43	conditions	condition	NNS
10_1101-2020_12_31_424971	309	44	,	,	,
10_1101-2020_12_31_424971	309	45	respectively	respectively	RB
10_1101-2020_12_31_424971	309	46	.	.	.
10_1101-2020_12_31_424971	310	1	712	712	CD
10_1101-2020_12_31_424971	310	2	Cultures	culture	NNS
10_1101-2020_12_31_424971	310	3	were	be	VBD
10_1101-2020_12_31_424971	310	4	diluted	dilute	VBN
10_1101-2020_12_31_424971	310	5	10-	10-	CD
10_1101-2020_12_31_424971	310	6	to	to	IN
10_1101-2020_12_31_424971	310	7	16-fold	16-fold	CD
10_1101-2020_12_31_424971	310	8	into	into	IN
10_1101-2020_12_31_424971	310	9	fresh	fresh	JJ
10_1101-2020_12_31_424971	310	10	media	medium	NNS
10_1101-2020_12_31_424971	310	11	to	to	IN
10_1101-2020_12_31_424971	310	12	an	an	DT
10_1101-2020_12_31_424971	310	13	optical	optical	JJ
10_1101-2020_12_31_424971	310	14	density	density	NN
10_1101-2020_12_31_424971	310	15	(	(	-LRB-
10_1101-2020_12_31_424971	310	16	OD	OD	NNP
10_1101-2020_12_31_424971	310	17	)	)	-RRB-
10_1101-2020_12_31_424971	310	18	of	of	IN
10_1101-2020_12_31_424971	310	19	~0.1	~0.1	CD
10_1101-2020_12_31_424971	310	20	and	and	CC
10_1101-2020_12_31_424971	310	21	grown	grow	VBD
10_1101-2020_12_31_424971	310	22	713	713	CD
10_1101-2020_12_31_424971	310	23	for	for	IN
10_1101-2020_12_31_424971	310	24	another	another	DT
10_1101-2020_12_31_424971	310	25	3	3	CD
10_1101-2020_12_31_424971	310	26	h.	h.	NN
10_1101-2020_12_31_424971	310	27	Cells	cell	NNS
10_1101-2020_12_31_424971	310	28	were	be	VBD
10_1101-2020_12_31_424971	310	29	harvested	harvest	VBN
10_1101-2020_12_31_424971	310	30	and	and	CC
10_1101-2020_12_31_424971	310	31	15	15	CD
10_1101-2020_12_31_424971	310	32	µg	µg	NN
10_1101-2020_12_31_424971	310	33	of	of	IN
10_1101-2020_12_31_424971	310	34	total	total	JJ
10_1101-2020_12_31_424971	310	35	protein	protein	NN
10_1101-2020_12_31_424971	310	36	from	from	IN
10_1101-2020_12_31_424971	310	37	cell	cell	NN
10_1101-2020_12_31_424971	310	38	lysates	lysate	NNS
10_1101-2020_12_31_424971	310	39	was	be	VBD
10_1101-2020_12_31_424971	310	40	separated	separate	VBN
10_1101-2020_12_31_424971	310	41	714	714	CD
10_1101-2020_12_31_424971	310	42	on	on	IN
10_1101-2020_12_31_424971	310	43	12	12	CD
10_1101-2020_12_31_424971	310	44	%	%	NN
10_1101-2020_12_31_424971	310	45	SDS	SDS	NNP
10_1101-2020_12_31_424971	310	46	-	-	HYPH
10_1101-2020_12_31_424971	310	47	PAGE	PAGE	NNP
10_1101-2020_12_31_424971	310	48	and	and	CC
10_1101-2020_12_31_424971	310	49	probed	probe	VBN
10_1101-2020_12_31_424971	310	50	with	with	IN
10_1101-2020_12_31_424971	310	51	rabbit	rabbit	NN
10_1101-2020_12_31_424971	310	52	polyclonal	polyclonal	JJ
10_1101-2020_12_31_424971	310	53	primary	primary	JJ
10_1101-2020_12_31_424971	310	54	antibodies	antibody	NNS
10_1101-2020_12_31_424971	310	55	against	against	IN
10_1101-2020_12_31_424971	310	56	LolB	LolB	NNP
10_1101-2020_12_31_424971	310	57	(	(	-LRB-
10_1101-2020_12_31_424971	310	58	at	at	IN
10_1101-2020_12_31_424971	310	59	a	a	DT
10_1101-2020_12_31_424971	310	60	715	715	CD
10_1101-2020_12_31_424971	310	61	10,000	10,000	CD
10_1101-2020_12_31_424971	310	62	dilution	dilution	NN
10_1101-2020_12_31_424971	310	63	)	)	-RRB-
10_1101-2020_12_31_424971	310	64	and	and	CC
10_1101-2020_12_31_424971	310	65	against	against	IN
10_1101-2020_12_31_424971	310	66	CysRS	CysRS	NNP
10_1101-2020_12_31_424971	310	67	(	(	-LRB-
10_1101-2020_12_31_424971	310	68	at	at	IN
10_1101-2020_12_31_424971	310	69	a	a	DT
10_1101-2020_12_31_424971	310	70	20,000	20,000	CD
10_1101-2020_12_31_424971	310	71	dilution	dilution	NN
10_1101-2020_12_31_424971	310	72	)	)	-RRB-
10_1101-2020_12_31_424971	310	73	,	,	,
10_1101-2020_12_31_424971	310	74	followed	follow	VBN
10_1101-2020_12_31_424971	310	75	by	by	IN
10_1101-2020_12_31_424971	310	76	goat	goat	NN
10_1101-2020_12_31_424971	310	77	polyclonal	polyclonal	JJ
10_1101-2020_12_31_424971	310	78	anti	anti	JJ
10_1101-2020_12_31_424971	310	79	-	-	JJ
10_1101-2020_12_31_424971	310	80	rabbit	rabbit	JJ
10_1101-2020_12_31_424971	310	81	716	716	CD
10_1101-2020_12_31_424971	310	82	IgG	IgG	NNP
10_1101-2020_12_31_424971	310	83	secondary	secondary	JJ
10_1101-2020_12_31_424971	310	84	antibody	antibody	NN
10_1101-2020_12_31_424971	310	85	(	(	-LRB-
10_1101-2020_12_31_424971	310	86	Sigma	Sigma	NNP
10_1101-2020_12_31_424971	310	87	-	-	HYPH
10_1101-2020_12_31_424971	310	88	Aldrich	Aldrich	NNP
10_1101-2020_12_31_424971	310	89	,	,	,
10_1101-2020_12_31_424971	310	90	#	#	NNP
10_1101-2020_12_31_424971	310	91	A0545	A0545	NNP
10_1101-2020_12_31_424971	310	92	)	)	-RRB-
10_1101-2020_12_31_424971	310	93	.	.	.
10_1101-2020_12_31_424971	311	1	The	the	DT
10_1101-2020_12_31_424971	311	2	ratio	ratio	NN
10_1101-2020_12_31_424971	311	3	of	of	IN
10_1101-2020_12_31_424971	311	4	protein	protein	NN
10_1101-2020_12_31_424971	311	5	synthesis	synthesis	NN
10_1101-2020_12_31_424971	311	6	of	of	IN
10_1101-2020_12_31_424971	311	7	lolB	lolB	NNP
10_1101-2020_12_31_424971	311	8	to	to	IN
10_1101-2020_12_31_424971	311	9	cysS	cysS	NNP
10_1101-2020_12_31_424971	311	10	717	717	CD
10_1101-2020_12_31_424971	311	11	was	be	VBD
10_1101-2020_12_31_424971	311	12	quantified	quantify	VBN
10_1101-2020_12_31_424971	311	13	using	use	VBG
10_1101-2020_12_31_424971	311	14	Super	Super	NNP
10_1101-2020_12_31_424971	311	15	Signal	Signal	NNP
10_1101-2020_12_31_424971	311	16	West	West	NNP
10_1101-2020_12_31_424971	311	17	Pico	Pico	NNP
10_1101-2020_12_31_424971	311	18	Chemiluminescent	Chemiluminescent	NNP
10_1101-2020_12_31_424971	311	19	substrate	substrate	NN
10_1101-2020_12_31_424971	311	20	(	(	-LRB-
10_1101-2020_12_31_424971	311	21	Thermo	Thermo	NNP
10_1101-2020_12_31_424971	311	22	Fischer	Fischer	NNP
10_1101-2020_12_31_424971	311	23	)	)	-RRB-
10_1101-2020_12_31_424971	311	24	in	in	IN
10_1101-2020_12_31_424971	311	25	a	a	DT
10_1101-2020_12_31_424971	311	26	718	718	CD
10_1101-2020_12_31_424971	311	27	Chemi	Chemi	NNP
10_1101-2020_12_31_424971	311	28	-	-	HYPH
10_1101-2020_12_31_424971	311	29	Doc	Doc	NNP
10_1101-2020_12_31_424971	311	30	XR	XR	NNP
10_1101-2020_12_31_424971	311	31	imager	imager	NN
10_1101-2020_12_31_424971	311	32	(	(	-LRB-
10_1101-2020_12_31_424971	311	33	Bio	Bio	NNP
10_1101-2020_12_31_424971	311	34	-	-	HYPH
10_1101-2020_12_31_424971	311	35	Rad	Rad	NNP
10_1101-2020_12_31_424971	311	36	)	)	-RRB-
10_1101-2020_12_31_424971	311	37	and	and	CC
10_1101-2020_12_31_424971	311	38	analyzed	analyze	VBN
10_1101-2020_12_31_424971	311	39	by	by	IN
10_1101-2020_12_31_424971	311	40	Image	Image	NNP
10_1101-2020_12_31_424971	311	41	Lab	Lab	NNP
10_1101-2020_12_31_424971	311	42	software	software	NN
10_1101-2020_12_31_424971	311	43	(	(	-LRB-
10_1101-2020_12_31_424971	311	44	Bio	Bio	NNP
10_1101-2020_12_31_424971	311	45	-	-	HYPH
10_1101-2020_12_31_424971	311	46	Rad	Rad	NNP
10_1101-2020_12_31_424971	311	47	,	,	,
10_1101-2020_12_31_424971	311	48	SOFT	soft	JJ
10_1101-2020_12_31_424971	311	49	-	-	HYPH
10_1101-2020_12_31_424971	311	50	LIT-170	lit-170	PRP
10_1101-2020_12_31_424971	311	51	-	-	HYPH
10_1101-2020_12_31_424971	311	52	719	719	CD
10_1101-2020_12_31_424971	311	53	9690-ILSPC	9690-ilspc	CD
10_1101-2020_12_31_424971	311	54	-	-	HYPH
10_1101-2020_12_31_424971	311	55	V-6	V-6	NNP
10_1101-2020_12_31_424971	311	56	-	-	HYPH
10_1101-2020_12_31_424971	311	57	1	1	NNP
10_1101-2020_12_31_424971	311	58	)	)	-RRB-
10_1101-2020_12_31_424971	311	59	.	.	.
10_1101-2020_12_31_424971	312	1	To	to	TO
10_1101-2020_12_31_424971	312	2	measure	measure	VB
10_1101-2020_12_31_424971	312	3	the	the	DT
10_1101-2020_12_31_424971	312	4	+1-frameshifting	+1-frameshifting	JJ
10_1101-2020_12_31_424971	312	5	efficiency	efficiency	NN
10_1101-2020_12_31_424971	312	6	,	,	,
10_1101-2020_12_31_424971	312	7	we	-PRON-	PRP
10_1101-2020_12_31_424971	312	8	measured	measure	VBD
10_1101-2020_12_31_424971	312	9	the	the	DT
10_1101-2020_12_31_424971	312	10	ratio	ratio	NN
10_1101-2020_12_31_424971	312	11	of	of	IN
10_1101-2020_12_31_424971	312	12	protein	protein	NN
10_1101-2020_12_31_424971	312	13	720	720	CD
10_1101-2020_12_31_424971	312	14	synthesis	synthesis	NN
10_1101-2020_12_31_424971	312	15	of	of	IN
10_1101-2020_12_31_424971	312	16	lolB	lolB	NNS
10_1101-2020_12_31_424971	312	17	to	to	IN
10_1101-2020_12_31_424971	312	18	cysS	cys	NNS
10_1101-2020_12_31_424971	312	19	for	for	IN
10_1101-2020_12_31_424971	312	20	each	each	DT
10_1101-2020_12_31_424971	312	21	tRNA	trna	NN
10_1101-2020_12_31_424971	312	22	in	in	IN
10_1101-2020_12_31_424971	312	23	each	each	DT
10_1101-2020_12_31_424971	312	24	condition	condition	NN
10_1101-2020_12_31_424971	312	25	,	,	,
10_1101-2020_12_31_424971	312	26	and	and	CC
10_1101-2020_12_31_424971	312	27	we	-PRON-	PRP
10_1101-2020_12_31_424971	312	28	normalized	normalize	VBD
10_1101-2020_12_31_424971	312	29	the	the	DT
10_1101-2020_12_31_424971	312	30	observed	observed	JJ
10_1101-2020_12_31_424971	312	31	ratio	ratio	NN
10_1101-2020_12_31_424971	312	32	721	721	CD
10_1101-2020_12_31_424971	312	33	in	in	IN
10_1101-2020_12_31_424971	312	34	the	the	DT
10_1101-2020_12_31_424971	312	35	control	control	NN
10_1101-2020_12_31_424971	312	36	sample	sample	NN
10_1101-2020_12_31_424971	312	37	(	(	-LRB-
10_1101-2020_12_31_424971	312	38	i.e.	i.e.	FW
10_1101-2020_12_31_424971	312	39	,	,	,
10_1101-2020_12_31_424971	312	40	ProL	ProL	NNP
10_1101-2020_12_31_424971	312	41	in	in	IN
10_1101-2020_12_31_424971	312	42	the	the	DT
10_1101-2020_12_31_424971	312	43	m1G37	m1g37	NN
10_1101-2020_12_31_424971	312	44	+	+	SYM
10_1101-2020_12_31_424971	312	45	condition	condition	NN
10_1101-2020_12_31_424971	312	46	)	)	-RRB-
10_1101-2020_12_31_424971	312	47	to	to	IN
10_1101-2020_12_31_424971	312	48	1.0	1.0	CD
10_1101-2020_12_31_424971	312	49	,	,	,
10_1101-2020_12_31_424971	312	50	indicating	indicate	VBG
10_1101-2020_12_31_424971	312	51	that	that	IN
10_1101-2020_12_31_424971	312	52	protein	protein	NN
10_1101-2020_12_31_424971	312	53	synthesis	synthesis	NN
10_1101-2020_12_31_424971	312	54	722	722	CD
10_1101-2020_12_31_424971	312	55	of	of	IN
10_1101-2020_12_31_424971	312	56	these	these	DT
10_1101-2020_12_31_424971	312	57	two	two	CD
10_1101-2020_12_31_424971	312	58	genes	gene	NNS
10_1101-2020_12_31_424971	312	59	was	be	VBD
10_1101-2020_12_31_424971	312	60	in	in	IN
10_1101-2020_12_31_424971	312	61	the	the	DT
10_1101-2020_12_31_424971	312	62	0-frame	0-frame	CD
10_1101-2020_12_31_424971	312	63	and	and	CC
10_1101-2020_12_31_424971	312	64	no	no	DT
10_1101-2020_12_31_424971	312	65	+1	+1	NNS
10_1101-2020_12_31_424971	312	66	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	312	67	.	.	.
10_1101-2020_12_31_424971	313	1	A	a	DT
10_1101-2020_12_31_424971	313	2	decrease	decrease	NN
10_1101-2020_12_31_424971	313	3	of	of	IN
10_1101-2020_12_31_424971	313	4	this	this	DT
10_1101-2020_12_31_424971	313	5	ratio	ratio	NN
10_1101-2020_12_31_424971	313	6	was	be	VBD
10_1101-2020_12_31_424971	313	7	723	723	CD
10_1101-2020_12_31_424971	313	8	interpreted	interpret	VBN
10_1101-2020_12_31_424971	313	9	as	as	IN
10_1101-2020_12_31_424971	313	10	a	a	DT
10_1101-2020_12_31_424971	313	11	proxy	proxy	NN
10_1101-2020_12_31_424971	313	12	of	of	IN
10_1101-2020_12_31_424971	313	13	+1	+1	NNS
10_1101-2020_12_31_424971	313	14	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	313	15	at	at	IN
10_1101-2020_12_31_424971	313	16	the	the	DT
10_1101-2020_12_31_424971	313	17	CCC	CCC	NNP
10_1101-2020_12_31_424971	313	18	-	-	HYPH
10_1101-2020_12_31_424971	313	19	C	C	NNP
10_1101-2020_12_31_424971	313	20	motif	motif	NN
10_1101-2020_12_31_424971	313	21	at	at	IN
10_1101-2020_12_31_424971	313	22	the	the	DT
10_1101-2020_12_31_424971	313	23	2nd	2nd	JJ
10_1101-2020_12_31_424971	313	24	codon	codon	NN
10_1101-2020_12_31_424971	313	25	position	position	NN
10_1101-2020_12_31_424971	313	26	of	of	IN
10_1101-2020_12_31_424971	313	27	lolB.	lolb.	NN
10_1101-2020_12_31_424971	314	1	724	724	CD
10_1101-2020_12_31_424971	314	2	From	from	IN
10_1101-2020_12_31_424971	314	3	the	the	DT
10_1101-2020_12_31_424971	314	4	observed	observed	JJ
10_1101-2020_12_31_424971	314	5	ratio	ratio	NN
10_1101-2020_12_31_424971	314	6	of	of	IN
10_1101-2020_12_31_424971	314	7	each	each	DT
10_1101-2020_12_31_424971	314	8	sample	sample	NN
10_1101-2020_12_31_424971	314	9	in	in	IN
10_1101-2020_12_31_424971	314	10	each	each	DT
10_1101-2020_12_31_424971	314	11	condition	condition	NN
10_1101-2020_12_31_424971	314	12	,	,	,
10_1101-2020_12_31_424971	314	13	we	-PRON-	PRP
10_1101-2020_12_31_424971	314	14	calculated	calculate	VBD
10_1101-2020_12_31_424971	314	15	the	the	DT
10_1101-2020_12_31_424971	314	16	+1	+1	NNS
10_1101-2020_12_31_424971	314	17	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	314	18	725	725	CD
10_1101-2020_12_31_424971	314	19	efficiency	efficiency	NN
10_1101-2020_12_31_424971	314	20	relative	relative	JJ
10_1101-2020_12_31_424971	314	21	to	to	IN
10_1101-2020_12_31_424971	314	22	the	the	DT
10_1101-2020_12_31_424971	314	23	control	control	NN
10_1101-2020_12_31_424971	314	24	sample	sample	NN
10_1101-2020_12_31_424971	314	25	.	.	.
10_1101-2020_12_31_424971	315	1	726	726	CD
10_1101-2020_12_31_424971	315	2	727	727	CD
10_1101-2020_12_31_424971	315	3	.CC	.CC	:
10_1101-2020_12_31_424971	315	4	-	-	HYPH
10_1101-2020_12_31_424971	315	5	BY	by	IN
10_1101-2020_12_31_424971	315	6	-	-	HYPH
10_1101-2020_12_31_424971	315	7	NC	NC	NNP
10_1101-2020_12_31_424971	315	8	-	-	HYPH
10_1101-2020_12_31_424971	315	9	ND	ND	NNP
10_1101-2020_12_31_424971	315	10	4.0	4.0	CD
10_1101-2020_12_31_424971	315	11	International	International	NNP
10_1101-2020_12_31_424971	315	12	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	315	13	under	under	IN
10_1101-2020_12_31_424971	315	14	a	a	DT
10_1101-2020_12_31_424971	315	15	(	(	-LRB-
10_1101-2020_12_31_424971	315	16	which	which	WDT
10_1101-2020_12_31_424971	315	17	was	be	VBD
10_1101-2020_12_31_424971	315	18	not	not	RB
10_1101-2020_12_31_424971	315	19	certified	certify	VBN
10_1101-2020_12_31_424971	315	20	by	by	IN
10_1101-2020_12_31_424971	315	21	peer	peer	NN
10_1101-2020_12_31_424971	315	22	review	review	NN
10_1101-2020_12_31_424971	315	23	)	)	-RRB-
10_1101-2020_12_31_424971	315	24	is	be	VBZ
10_1101-2020_12_31_424971	315	25	the	the	DT
10_1101-2020_12_31_424971	315	26	author	author	NN
10_1101-2020_12_31_424971	315	27	/	/	SYM
10_1101-2020_12_31_424971	315	28	funder	funder	NN
10_1101-2020_12_31_424971	315	29	,	,	,
10_1101-2020_12_31_424971	315	30	who	who	WP
10_1101-2020_12_31_424971	315	31	has	have	VBZ
10_1101-2020_12_31_424971	315	32	granted	grant	VBN
10_1101-2020_12_31_424971	315	33	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	315	34	a	a	DT
10_1101-2020_12_31_424971	315	35	license	license	NN
10_1101-2020_12_31_424971	315	36	to	to	TO
10_1101-2020_12_31_424971	315	37	display	display	VB
10_1101-2020_12_31_424971	315	38	the	the	DT
10_1101-2020_12_31_424971	315	39	preprint	preprint	NN
10_1101-2020_12_31_424971	315	40	in	in	IN
10_1101-2020_12_31_424971	315	41	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	315	42	.	.	.
10_1101-2020_12_31_424971	316	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	316	2	is	be	VBZ
10_1101-2020_12_31_424971	316	3	made	make	VBN
10_1101-2020_12_31_424971	316	4	The	the	DT
10_1101-2020_12_31_424971	316	5	copyright	copyright	NN
10_1101-2020_12_31_424971	316	6	holder	holder	NN
10_1101-2020_12_31_424971	316	7	for	for	IN
10_1101-2020_12_31_424971	316	8	this	this	DT
10_1101-2020_12_31_424971	316	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	316	10	version	version	NN
10_1101-2020_12_31_424971	316	11	posted	post	VBD
10_1101-2020_12_31_424971	316	12	January	January	NNP
10_1101-2020_12_31_424971	316	13	2	2	CD
10_1101-2020_12_31_424971	316	14	,	,	,
10_1101-2020_12_31_424971	316	15	2021	2021	CD
10_1101-2020_12_31_424971	316	16	.	.	.
10_1101-2020_12_31_424971	316	17	;	;	:
10_1101-2020_12_31_424971	316	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	316	19	:	:	:
10_1101-2020_12_31_424971	316	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	316	21	preprint	preprint	NN
10_1101-2020_12_31_424971	316	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	316	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	316	24	30	30	CD
10_1101-2020_12_31_424971	316	25	Cell	cell	NN
10_1101-2020_12_31_424971	316	26	-	-	HYPH
10_1101-2020_12_31_424971	316	27	free	free	JJ
10_1101-2020_12_31_424971	316	28	PURExpress	purexpress	NN
10_1101-2020_12_31_424971	316	29	in	in	IN
10_1101-2020_12_31_424971	316	30	vitro	vitro	FW
10_1101-2020_12_31_424971	316	31	translation	translation	NN
10_1101-2020_12_31_424971	316	32	assays	assays	RB
10_1101-2020_12_31_424971	316	33	.	.	.
10_1101-2020_12_31_424971	317	1	The	the	DT
10_1101-2020_12_31_424971	317	2	folA	fola	JJ
10_1101-2020_12_31_424971	317	3	gene	gene	NN
10_1101-2020_12_31_424971	317	4	,	,	,
10_1101-2020_12_31_424971	317	5	provided	provide	VBN
10_1101-2020_12_31_424971	317	6	as	as	IN
10_1101-2020_12_31_424971	317	7	part	part	NN
10_1101-2020_12_31_424971	317	8	of	of	IN
10_1101-2020_12_31_424971	317	9	the	the	DT
10_1101-2020_12_31_424971	317	10	E.	E.	NNP
10_1101-2020_12_31_424971	317	11	728	728	CD
10_1101-2020_12_31_424971	317	12	coli	coli	NNS
10_1101-2020_12_31_424971	317	13	PURExpress	purexpress	NN
10_1101-2020_12_31_424971	317	14	(	(	-LRB-
10_1101-2020_12_31_424971	317	15	New	New	NNP
10_1101-2020_12_31_424971	317	16	England	England	NNP
10_1101-2020_12_31_424971	317	17	BioLabs	BioLabs	NNP
10_1101-2020_12_31_424971	317	18	)	)	-RRB-
10_1101-2020_12_31_424971	317	19	in	in	IN
10_1101-2020_12_31_424971	317	20	vitro	vitro	FW
10_1101-2020_12_31_424971	317	21	translation	translation	NN
10_1101-2020_12_31_424971	317	22	system	system	NN
10_1101-2020_12_31_424971	317	23	,	,	,
10_1101-2020_12_31_424971	317	24	was	be	VBD
10_1101-2020_12_31_424971	317	25	modified	modify	VBN
10_1101-2020_12_31_424971	317	26	by	by	IN
10_1101-2020_12_31_424971	317	27	site	site	NN
10_1101-2020_12_31_424971	317	28	-	-	HYPH
10_1101-2020_12_31_424971	317	29	directed	direct	VBN
10_1101-2020_12_31_424971	317	30	729	729	CD
10_1101-2020_12_31_424971	317	31	mutagenesis	mutagenesis	NN
10_1101-2020_12_31_424971	317	32	to	to	TO
10_1101-2020_12_31_424971	317	33	introduce	introduce	VB
10_1101-2020_12_31_424971	317	34	a	a	DT
10_1101-2020_12_31_424971	317	35	CCC	CCC	NNP
10_1101-2020_12_31_424971	317	36	-	-	HYPH
10_1101-2020_12_31_424971	317	37	C	C	NNP
10_1101-2020_12_31_424971	317	38	motif	motif	NN
10_1101-2020_12_31_424971	317	39	into	into	IN
10_1101-2020_12_31_424971	317	40	the	the	DT
10_1101-2020_12_31_424971	317	41	5th	5th	JJ
10_1101-2020_12_31_424971	317	42	codon	codon	NN
10_1101-2020_12_31_424971	317	43	position	position	NN
10_1101-2020_12_31_424971	317	44	.	.	.
10_1101-2020_12_31_424971	318	1	If	if	IN
10_1101-2020_12_31_424971	318	2	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	318	3	induced	induce	VBN
10_1101-2020_12_31_424971	318	4	+1	+1	NNS
10_1101-2020_12_31_424971	318	5	730	730	CD
10_1101-2020_12_31_424971	318	6	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	318	7	at	at	IN
10_1101-2020_12_31_424971	318	8	this	this	DT
10_1101-2020_12_31_424971	318	9	motif	motif	NN
10_1101-2020_12_31_424971	318	10	,	,	,
10_1101-2020_12_31_424971	318	11	a	a	DT
10_1101-2020_12_31_424971	318	12	full	full	JJ
10_1101-2020_12_31_424971	318	13	-	-	HYPH
10_1101-2020_12_31_424971	318	14	length	length	NN
10_1101-2020_12_31_424971	318	15	DHFR	DHFR	NNP
10_1101-2020_12_31_424971	318	16	would	would	MD
10_1101-2020_12_31_424971	318	17	be	be	VB
10_1101-2020_12_31_424971	318	18	made	make	VBN
10_1101-2020_12_31_424971	318	19	,	,	,
10_1101-2020_12_31_424971	318	20	whereas	whereas	IN
10_1101-2020_12_31_424971	318	21	if	if	IN
10_1101-2020_12_31_424971	318	22	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	318	23	failed	fail	VBD
10_1101-2020_12_31_424971	318	24	to	to	TO
10_1101-2020_12_31_424971	318	25	do	do	VB
10_1101-2020_12_31_424971	318	26	so	so	RB
10_1101-2020_12_31_424971	318	27	,	,	,
10_1101-2020_12_31_424971	318	28	a	a	DT
10_1101-2020_12_31_424971	318	29	731	731	CD
10_1101-2020_12_31_424971	318	30	C	c	NN
10_1101-2020_12_31_424971	318	31	-	-	HYPH
10_1101-2020_12_31_424971	318	32	terminal	terminal	JJ
10_1101-2020_12_31_424971	318	33	truncated	truncate	VBN
10_1101-2020_12_31_424971	318	34	fragment	fragment	NN
10_1101-2020_12_31_424971	318	35	(	(	-LRB-
10_1101-2020_12_31_424971	318	36	DC	DC	NNP
10_1101-2020_12_31_424971	318	37	)	)	-RRB-
10_1101-2020_12_31_424971	318	38	would	would	MD
10_1101-2020_12_31_424971	318	39	be	be	VB
10_1101-2020_12_31_424971	318	40	made	make	VBN
10_1101-2020_12_31_424971	318	41	due	due	JJ
10_1101-2020_12_31_424971	318	42	to	to	IN
10_1101-2020_12_31_424971	318	43	premature	premature	JJ
10_1101-2020_12_31_424971	318	44	termination	termination	NN
10_1101-2020_12_31_424971	318	45	of	of	IN
10_1101-2020_12_31_424971	318	46	protein	protein	NN
10_1101-2020_12_31_424971	318	47	732	732	CD
10_1101-2020_12_31_424971	318	48	synthesis	synthesis	NN
10_1101-2020_12_31_424971	318	49	.	.	.
10_1101-2020_12_31_424971	319	1	Because	because	IN
10_1101-2020_12_31_424971	319	2	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	319	3	has	have	VBZ
10_1101-2020_12_31_424971	319	4	no	no	DT
10_1101-2020_12_31_424971	319	5	orthogonal	orthogonal	JJ
10_1101-2020_12_31_424971	319	6	tRNA	trna	NN
10_1101-2020_12_31_424971	319	7	synthetase	synthetase	NN
10_1101-2020_12_31_424971	319	8	for	for	IN
10_1101-2020_12_31_424971	319	9	aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	319	10	with	with	IN
10_1101-2020_12_31_424971	319	11	a	a	DT
10_1101-2020_12_31_424971	319	12	non-733	non-733	NNP
10_1101-2020_12_31_424971	319	13	proteinogenic	proteinogenic	NN
10_1101-2020_12_31_424971	319	14	amino	amino	NN
10_1101-2020_12_31_424971	319	15	acid	acid	NN
10_1101-2020_12_31_424971	319	16	,	,	,
10_1101-2020_12_31_424971	319	17	we	-PRON-	PRP
10_1101-2020_12_31_424971	319	18	used	use	VBD
10_1101-2020_12_31_424971	319	19	the	the	DT
10_1101-2020_12_31_424971	319	20	Flexizyme	Flexizyme	NNP
10_1101-2020_12_31_424971	319	21	ribozyme	ribozyme	NNS
10_1101-2020_12_31_424971	319	22	technology32	technology32	VB
10_1101-2020_12_31_424971	319	23	for	for	IN
10_1101-2020_12_31_424971	319	24	this	this	DT
10_1101-2020_12_31_424971	319	25	purpose	purpose	NN
10_1101-2020_12_31_424971	319	26	.	.	.
10_1101-2020_12_31_424971	320	1	734	734	CD
10_1101-2020_12_31_424971	320	2	Coupled	couple	VBN
10_1101-2020_12_31_424971	320	3	in	in	IN
10_1101-2020_12_31_424971	320	4	vitro	vitro	FW
10_1101-2020_12_31_424971	320	5	transcription	transcription	NN
10_1101-2020_12_31_424971	320	6	-	-	HYPH
10_1101-2020_12_31_424971	320	7	translation	translation	NN
10_1101-2020_12_31_424971	320	8	of	of	IN
10_1101-2020_12_31_424971	320	9	the	the	DT
10_1101-2020_12_31_424971	320	10	modified	modify	VBN
10_1101-2020_12_31_424971	320	11	E.	E.	NNP
10_1101-2020_12_31_424971	320	12	coli	coli	NNS
10_1101-2020_12_31_424971	320	13	folA	fola	JJ
10_1101-2020_12_31_424971	320	14	gene	gene	NN
10_1101-2020_12_31_424971	320	15	containing	contain	VBG
10_1101-2020_12_31_424971	320	16	the	the	DT
10_1101-2020_12_31_424971	320	17	CCC	CCC	NNP
10_1101-2020_12_31_424971	320	18	-	-	HYPH
10_1101-2020_12_31_424971	320	19	C	C	NNP
10_1101-2020_12_31_424971	320	20	735	735	CD
10_1101-2020_12_31_424971	320	21	motif	motif	NN
10_1101-2020_12_31_424971	320	22	at	at	IN
10_1101-2020_12_31_424971	320	23	the	the	DT
10_1101-2020_12_31_424971	320	24	5th	5th	JJ
10_1101-2020_12_31_424971	320	25	codon	codon	NN
10_1101-2020_12_31_424971	320	26	position	position	NN
10_1101-2020_12_31_424971	320	27	was	be	VBD
10_1101-2020_12_31_424971	320	28	conducted	conduct	VBN
10_1101-2020_12_31_424971	320	29	in	in	IN
10_1101-2020_12_31_424971	320	30	the	the	DT
10_1101-2020_12_31_424971	320	31	presence	presence	NN
10_1101-2020_12_31_424971	320	32	of	of	IN
10_1101-2020_12_31_424971	320	33	[	[	-LRB-
10_1101-2020_12_31_424971	320	34	35S]-Met	35s]-met	CD
10_1101-2020_12_31_424971	320	35	using	use	VBG
10_1101-2020_12_31_424971	320	36	the	the	DT
10_1101-2020_12_31_424971	320	37	PURExpress	purexpress	NN
10_1101-2020_12_31_424971	320	38	736	736	CD
10_1101-2020_12_31_424971	320	39	system	system	NN
10_1101-2020_12_31_424971	320	40	.	.	.
10_1101-2020_12_31_424971	321	1	SDS	SDS	NNP
10_1101-2020_12_31_424971	321	2	-	-	HYPH
10_1101-2020_12_31_424971	321	3	PAGE	PAGE	NNP
10_1101-2020_12_31_424971	321	4	analysis	analysis	NN
10_1101-2020_12_31_424971	321	5	was	be	VBD
10_1101-2020_12_31_424971	321	6	used	use	VBN
10_1101-2020_12_31_424971	321	7	to	to	TO
10_1101-2020_12_31_424971	321	8	detect	detect	VB
10_1101-2020_12_31_424971	321	9	[	[	-LRB-
10_1101-2020_12_31_424971	321	10	35S]-Met	35s]-met	CD
10_1101-2020_12_31_424971	321	11	-	-	HYPH
10_1101-2020_12_31_424971	321	12	labeled	label	VBN
10_1101-2020_12_31_424971	321	13	polypeptides	polypeptide	NNS
10_1101-2020_12_31_424971	321	14	,	,	,
10_1101-2020_12_31_424971	321	15	which	which	WDT
10_1101-2020_12_31_424971	321	16	included	include	VBD
10_1101-2020_12_31_424971	321	17	737	737	CD
10_1101-2020_12_31_424971	321	18	the	the	DT
10_1101-2020_12_31_424971	321	19	full	full	JJ
10_1101-2020_12_31_424971	321	20	-	-	HYPH
10_1101-2020_12_31_424971	321	21	length	length	NN
10_1101-2020_12_31_424971	321	22	DHFR	DHFR	NNP
10_1101-2020_12_31_424971	321	23	,	,	,
10_1101-2020_12_31_424971	321	24	the	the	DT
10_1101-2020_12_31_424971	321	25	DC	DC	NNP
10_1101-2020_12_31_424971	321	26	fragment	fragment	NN
10_1101-2020_12_31_424971	321	27	,	,	,
10_1101-2020_12_31_424971	321	28	and	and	CC
10_1101-2020_12_31_424971	321	29	a	a	DT
10_1101-2020_12_31_424971	321	30	DN	DN	NNP
10_1101-2020_12_31_424971	321	31	fragment	fragment	NN
10_1101-2020_12_31_424971	321	32	that	that	WDT
10_1101-2020_12_31_424971	321	33	likely	likely	RB
10_1101-2020_12_31_424971	321	34	resulted	result	VBD
10_1101-2020_12_31_424971	321	35	from	from	IN
10_1101-2020_12_31_424971	321	36	initiation	initiation	NN
10_1101-2020_12_31_424971	321	37	of	of	IN
10_1101-2020_12_31_424971	321	38	738	738	CD
10_1101-2020_12_31_424971	321	39	translation	translation	NN
10_1101-2020_12_31_424971	321	40	at	at	IN
10_1101-2020_12_31_424971	321	41	a	a	DT
10_1101-2020_12_31_424971	321	42	cryptic	cryptic	JJ
10_1101-2020_12_31_424971	321	43	site	site	NN
10_1101-2020_12_31_424971	321	44	downstream	downstream	JJ
10_1101-2020_12_31_424971	321	45	from	from	IN
10_1101-2020_12_31_424971	321	46	the	the	DT
10_1101-2020_12_31_424971	321	47	CCC	CCC	NNP
10_1101-2020_12_31_424971	321	48	-	-	HYPH
10_1101-2020_12_31_424971	321	49	C	C	NNP
10_1101-2020_12_31_424971	321	50	motif	motif	NN
10_1101-2020_12_31_424971	321	51	(	(	-LRB-
10_1101-2020_12_31_424971	321	52	Figure	Figure	NNP
10_1101-2020_12_31_424971	321	53	2d	2d	NNP
10_1101-2020_12_31_424971	321	54	)	)	-RRB-
10_1101-2020_12_31_424971	321	55	.	.	.
10_1101-2020_12_31_424971	322	1	The	the	DT
10_1101-2020_12_31_424971	322	2	fraction	fraction	NN
10_1101-2020_12_31_424971	322	3	of	of	IN
10_1101-2020_12_31_424971	322	4	the	the	DT
10_1101-2020_12_31_424971	322	5	full-739	full-739	NNP
10_1101-2020_12_31_424971	322	6	length	length	NN
10_1101-2020_12_31_424971	322	7	folA	fola	JJ
10_1101-2020_12_31_424971	322	8	gene	gene	NN
10_1101-2020_12_31_424971	322	9	product	product	NN
10_1101-2020_12_31_424971	322	10	,	,	,
10_1101-2020_12_31_424971	322	11	the	the	DT
10_1101-2020_12_31_424971	322	12	DC	DC	NNP
10_1101-2020_12_31_424971	322	13	fragment	fragment	NN
10_1101-2020_12_31_424971	322	14	,	,	,
10_1101-2020_12_31_424971	322	15	and	and	CC
10_1101-2020_12_31_424971	322	16	the	the	DT
10_1101-2020_12_31_424971	322	17	DN	DN	NNP
10_1101-2020_12_31_424971	322	18	fragment	fragment	NN
10_1101-2020_12_31_424971	322	19	was	be	VBD
10_1101-2020_12_31_424971	322	20	calculated	calculate	VBN
10_1101-2020_12_31_424971	322	21	from	from	IN
10_1101-2020_12_31_424971	322	22	the	the	DT
10_1101-2020_12_31_424971	322	23	amount	amount	NN
10_1101-2020_12_31_424971	322	24	740	740	CD
10_1101-2020_12_31_424971	322	25	of	of	IN
10_1101-2020_12_31_424971	322	26	each	each	DT
10_1101-2020_12_31_424971	322	27	in	in	IN
10_1101-2020_12_31_424971	322	28	the	the	DT
10_1101-2020_12_31_424971	322	29	sum	sum	NN
10_1101-2020_12_31_424971	322	30	of	of	IN
10_1101-2020_12_31_424971	322	31	all	all	DT
10_1101-2020_12_31_424971	322	32	three	three	CD
10_1101-2020_12_31_424971	322	33	products	product	NNS
10_1101-2020_12_31_424971	322	34	.	.	.
10_1101-2020_12_31_424971	323	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	323	2	attribute	attribute	VBP
10_1101-2020_12_31_424971	323	3	the	the	DT
10_1101-2020_12_31_424971	323	4	overall	overall	JJ
10_1101-2020_12_31_424971	323	5	low	low	JJ
10_1101-2020_12_31_424971	323	6	recoding	recode	VBG
10_1101-2020_12_31_424971	323	7	efficiency	efficiency	NN
10_1101-2020_12_31_424971	323	8	(	(	-LRB-
10_1101-2020_12_31_424971	323	9	0.5	0.5	CD
10_1101-2020_12_31_424971	323	10	–	–	:
10_1101-2020_12_31_424971	323	11	741	741	CD
10_1101-2020_12_31_424971	323	12	5.0	5.0	CD
10_1101-2020_12_31_424971	323	13	%	%	NN
10_1101-2020_12_31_424971	323	14	)	)	-RRB-
10_1101-2020_12_31_424971	323	15	as	as	IN
10_1101-2020_12_31_424971	323	16	arising	arise	VBG
10_1101-2020_12_31_424971	323	17	from	from	IN
10_1101-2020_12_31_424971	323	18	a	a	DT
10_1101-2020_12_31_424971	323	19	combination	combination	NN
10_1101-2020_12_31_424971	323	20	of	of	IN
10_1101-2020_12_31_424971	323	21	the	the	DT
10_1101-2020_12_31_424971	323	22	rapid	rapid	JJ
10_1101-2020_12_31_424971	323	23	hydrolysis	hydrolysis	NN
10_1101-2020_12_31_424971	323	24	of	of	IN
10_1101-2020_12_31_424971	323	25	the	the	DT
10_1101-2020_12_31_424971	323	26	prolyl	prolyl	NNP
10_1101-2020_12_31_424971	323	27	linkage	linkage	NN
10_1101-2020_12_31_424971	323	28	,	,	,
10_1101-2020_12_31_424971	323	29	which	which	WDT
10_1101-2020_12_31_424971	323	30	is	be	VBZ
10_1101-2020_12_31_424971	323	31	the	the	DT
10_1101-2020_12_31_424971	323	32	least	least	JJS
10_1101-2020_12_31_424971	323	33	742	742	CD
10_1101-2020_12_31_424971	323	34	stable	stable	JJ
10_1101-2020_12_31_424971	323	35	among	among	IN
10_1101-2020_12_31_424971	323	36	aminoacyl	aminoacyl	NNP
10_1101-2020_12_31_424971	323	37	linkages63	linkages63	NNP
10_1101-2020_12_31_424971	323	38	,	,	,
10_1101-2020_12_31_424971	323	39	and	and	CC
10_1101-2020_12_31_424971	323	40	the	the	DT
10_1101-2020_12_31_424971	323	41	lack	lack	NN
10_1101-2020_12_31_424971	323	42	of	of	IN
10_1101-2020_12_31_424971	323	43	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	323	44	re	re	NN
10_1101-2020_12_31_424971	323	45	-	-	NN
10_1101-2020_12_31_424971	323	46	acylation	acylation	NN
10_1101-2020_12_31_424971	323	47	in	in	IN
10_1101-2020_12_31_424971	323	48	the	the	DT
10_1101-2020_12_31_424971	323	49	PURExpress	purexpress	NN
10_1101-2020_12_31_424971	323	50	system	system	NN
10_1101-2020_12_31_424971	323	51	.	.	.
10_1101-2020_12_31_424971	324	1	743	743	CD
10_1101-2020_12_31_424971	324	2	In	in	IN
10_1101-2020_12_31_424971	324	3	these	these	DT
10_1101-2020_12_31_424971	324	4	assays	assay	NNS
10_1101-2020_12_31_424971	324	5	,	,	,
10_1101-2020_12_31_424971	324	6	each	each	DT
10_1101-2020_12_31_424971	324	7	tRNA	trna	NN
10_1101-2020_12_31_424971	324	8	was	be	VBD
10_1101-2020_12_31_424971	324	9	tested	test	VBN
10_1101-2020_12_31_424971	324	10	in	in	IN
10_1101-2020_12_31_424971	324	11	the	the	DT
10_1101-2020_12_31_424971	324	12	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	324	13	and	and	CC
10_1101-2020_12_31_424971	324	14	each	each	DT
10_1101-2020_12_31_424971	324	15	was	be	VBD
10_1101-2020_12_31_424971	324	16	normalized	normalize	VBN
10_1101-2020_12_31_424971	324	17	by	by	IN
10_1101-2020_12_31_424971	324	18	the	the	DT
10_1101-2020_12_31_424971	324	19	744	744	CD
10_1101-2020_12_31_424971	324	20	flexizyme	flexizyme	NNS
10_1101-2020_12_31_424971	324	21	aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	324	22	efficiency	efficiency	NN
10_1101-2020_12_31_424971	324	23	,	,	,
10_1101-2020_12_31_424971	324	24	which	which	WDT
10_1101-2020_12_31_424971	324	25	was	be	VBD
10_1101-2020_12_31_424971	324	26	~30	~30	.
10_1101-2020_12_31_424971	324	27	%	%	NN
10_1101-2020_12_31_424971	324	28	for	for	IN
10_1101-2020_12_31_424971	324	29	Pro	pro	JJ
10_1101-2020_12_31_424971	324	30	and	and	CC
10_1101-2020_12_31_424971	324	31	Pro	pro	JJ
10_1101-2020_12_31_424971	324	32	analogues	analogue	NNS
10_1101-2020_12_31_424971	324	33	.	.	.
10_1101-2020_12_31_424971	325	1	The	the	DT
10_1101-2020_12_31_424971	325	2	745	745	CD
10_1101-2020_12_31_424971	325	3	PURExpress	purexpress	NN
10_1101-2020_12_31_424971	325	4	contained	contain	VBD
10_1101-2020_12_31_424971	325	5	all	all	DT
10_1101-2020_12_31_424971	325	6	natural	natural	JJ
10_1101-2020_12_31_424971	325	7	E.	E.	NNP
10_1101-2020_12_31_424971	325	8	coli	coli	NNS
10_1101-2020_12_31_424971	325	9	tRNAs	tRNAs	NNP
10_1101-2020_12_31_424971	325	10	,	,	,
10_1101-2020_12_31_424971	325	11	such	such	JJ
10_1101-2020_12_31_424971	325	12	that	that	IN
10_1101-2020_12_31_424971	325	13	the	the	DT
10_1101-2020_12_31_424971	325	14	CCC	CCC	NNP
10_1101-2020_12_31_424971	325	15	-	-	HYPH
10_1101-2020_12_31_424971	325	16	C	C	NNP
10_1101-2020_12_31_424971	325	17	codon	codon	NN
10_1101-2020_12_31_424971	325	18	motif	motif	NN
10_1101-2020_12_31_424971	325	19	would	would	MD
10_1101-2020_12_31_424971	325	20	not	not	RB
10_1101-2020_12_31_424971	325	21	have	have	VB
10_1101-2020_12_31_424971	325	22	746	746	CD
10_1101-2020_12_31_424971	325	23	a	a	DT
10_1101-2020_12_31_424971	325	24	chance	chance	NN
10_1101-2020_12_31_424971	325	25	of	of	IN
10_1101-2020_12_31_424971	325	26	vacancy	vacancy	NN
10_1101-2020_12_31_424971	325	27	even	even	RB
10_1101-2020_12_31_424971	325	28	when	when	WRB
10_1101-2020_12_31_424971	325	29	a	a	DT
10_1101-2020_12_31_424971	325	30	specific	specific	JJ
10_1101-2020_12_31_424971	325	31	CCC	ccc	NN
10_1101-2020_12_31_424971	325	32	-	-	HYPH
10_1101-2020_12_31_424971	325	33	reading	read	VBG
10_1101-2020_12_31_424971	325	34	tRNA	trna	NN
10_1101-2020_12_31_424971	325	35	was	be	VBD
10_1101-2020_12_31_424971	325	36	absent	absent	JJ
10_1101-2020_12_31_424971	325	37	.	.	.
10_1101-2020_12_31_424971	326	1	747	747	CD
10_1101-2020_12_31_424971	326	2	748	748	CD
10_1101-2020_12_31_424971	326	3	Rapid	Rapid	NNP
10_1101-2020_12_31_424971	326	4	kinetic	kinetic	NN
10_1101-2020_12_31_424971	326	5	GTPase	GTPase	NNP
10_1101-2020_12_31_424971	326	6	assays	assay	NNS
10_1101-2020_12_31_424971	326	7	.	.	.
10_1101-2020_12_31_424971	327	1	Ensemble	ensemble	JJ
10_1101-2020_12_31_424971	327	2	GTPase	GTPase	NNP
10_1101-2020_12_31_424971	327	3	assays	assay	NNS
10_1101-2020_12_31_424971	327	4	were	be	VBD
10_1101-2020_12_31_424971	327	5	performed	perform	VBN
10_1101-2020_12_31_424971	327	6	using	use	VBG
10_1101-2020_12_31_424971	327	7	the	the	DT
10_1101-2020_12_31_424971	327	8	codon	codon	NN
10_1101-2020_12_31_424971	327	9	-	-	HYPH
10_1101-2020_12_31_424971	327	10	walk	walk	VB
10_1101-2020_12_31_424971	327	11	749	749	CD
10_1101-2020_12_31_424971	327	12	approach	approach	NN
10_1101-2020_12_31_424971	327	13	,	,	,
10_1101-2020_12_31_424971	327	14	in	in	IN
10_1101-2020_12_31_424971	327	15	which	which	WDT
10_1101-2020_12_31_424971	327	16	an	an	DT
10_1101-2020_12_31_424971	327	17	E.	E.	NNP
10_1101-2020_12_31_424971	327	18	coli	coli	NNS
10_1101-2020_12_31_424971	327	19	in	in	IN
10_1101-2020_12_31_424971	327	20	vitro	vitro	FW
10_1101-2020_12_31_424971	327	21	translation	translation	NN
10_1101-2020_12_31_424971	327	22	system	system	NN
10_1101-2020_12_31_424971	327	23	composed	compose	VBN
10_1101-2020_12_31_424971	327	24	of	of	IN
10_1101-2020_12_31_424971	327	25	purified	purify	VBN
10_1101-2020_12_31_424971	327	26	components	component	NNS
10_1101-2020_12_31_424971	327	27	is	be	VBZ
10_1101-2020_12_31_424971	327	28	750	750	CD
10_1101-2020_12_31_424971	327	29	supplemented	supplement	VBN
10_1101-2020_12_31_424971	327	30	with	with	IN
10_1101-2020_12_31_424971	327	31	the	the	DT
10_1101-2020_12_31_424971	327	32	requisite	requisite	JJ
10_1101-2020_12_31_424971	327	33	tRNAs	trnas	NN
10_1101-2020_12_31_424971	327	34	and	and	CC
10_1101-2020_12_31_424971	327	35	translation	translation	NN
10_1101-2020_12_31_424971	327	36	factors	factor	NNS
10_1101-2020_12_31_424971	327	37	to	to	TO
10_1101-2020_12_31_424971	327	38	interrogate	interrogate	VB
10_1101-2020_12_31_424971	327	39	individual	individual	JJ
10_1101-2020_12_31_424971	327	40	steps	step	NNS
10_1101-2020_12_31_424971	327	41	of	of	IN
10_1101-2020_12_31_424971	327	42	751	751	CD
10_1101-2020_12_31_424971	327	43	the	the	DT
10_1101-2020_12_31_424971	327	44	elongation	elongation	NN
10_1101-2020_12_31_424971	327	45	cycle	cycle	NN
10_1101-2020_12_31_424971	327	46	.	.	.
10_1101-2020_12_31_424971	328	1	Programmed	program	VBN
10_1101-2020_12_31_424971	328	2	with	with	IN
10_1101-2020_12_31_424971	328	3	a	a	DT
10_1101-2020_12_31_424971	328	4	previously	previously	RB
10_1101-2020_12_31_424971	328	5	validated	validate	VBN
10_1101-2020_12_31_424971	328	6	synthetic	synthetic	JJ
10_1101-2020_12_31_424971	328	7	AUG	AUG	NNP
10_1101-2020_12_31_424971	328	8	-	-	HYPH
10_1101-2020_12_31_424971	328	9	CCC	CCC	NNP
10_1101-2020_12_31_424971	328	10	-	-	HYPH
10_1101-2020_12_31_424971	328	11	CGU	CGU	NNP
10_1101-2020_12_31_424971	328	12	-	-	HYPH
10_1101-2020_12_31_424971	328	13	U	u	NN
10_1101-2020_12_31_424971	328	14	mRNA	mrna	NN
10_1101-2020_12_31_424971	328	15	752	752	CD
10_1101-2020_12_31_424971	328	16	.CC	.CC	NFP
10_1101-2020_12_31_424971	328	17	-	-	HYPH
10_1101-2020_12_31_424971	328	18	BY	by	IN
10_1101-2020_12_31_424971	328	19	-	-	HYPH
10_1101-2020_12_31_424971	328	20	NC	NC	NNP
10_1101-2020_12_31_424971	328	21	-	-	HYPH
10_1101-2020_12_31_424971	328	22	ND	ND	NNP
10_1101-2020_12_31_424971	328	23	4.0	4.0	CD
10_1101-2020_12_31_424971	328	24	International	International	NNP
10_1101-2020_12_31_424971	328	25	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	328	26	under	under	IN
10_1101-2020_12_31_424971	328	27	a	a	DT
10_1101-2020_12_31_424971	328	28	(	(	-LRB-
10_1101-2020_12_31_424971	328	29	which	which	WDT
10_1101-2020_12_31_424971	328	30	was	be	VBD
10_1101-2020_12_31_424971	328	31	not	not	RB
10_1101-2020_12_31_424971	328	32	certified	certify	VBN
10_1101-2020_12_31_424971	328	33	by	by	IN
10_1101-2020_12_31_424971	328	34	peer	peer	NN
10_1101-2020_12_31_424971	328	35	review	review	NN
10_1101-2020_12_31_424971	328	36	)	)	-RRB-
10_1101-2020_12_31_424971	328	37	is	be	VBZ
10_1101-2020_12_31_424971	328	38	the	the	DT
10_1101-2020_12_31_424971	328	39	author	author	NN
10_1101-2020_12_31_424971	328	40	/	/	SYM
10_1101-2020_12_31_424971	328	41	funder	funder	NN
10_1101-2020_12_31_424971	328	42	,	,	,
10_1101-2020_12_31_424971	328	43	who	who	WP
10_1101-2020_12_31_424971	328	44	has	have	VBZ
10_1101-2020_12_31_424971	328	45	granted	grant	VBN
10_1101-2020_12_31_424971	328	46	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	328	47	a	a	DT
10_1101-2020_12_31_424971	328	48	license	license	NN
10_1101-2020_12_31_424971	328	49	to	to	TO
10_1101-2020_12_31_424971	328	50	display	display	VB
10_1101-2020_12_31_424971	328	51	the	the	DT
10_1101-2020_12_31_424971	328	52	preprint	preprint	NN
10_1101-2020_12_31_424971	328	53	in	in	IN
10_1101-2020_12_31_424971	328	54	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	328	55	.	.	.
10_1101-2020_12_31_424971	329	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	329	2	is	be	VBZ
10_1101-2020_12_31_424971	329	3	made	make	VBN
10_1101-2020_12_31_424971	329	4	The	the	DT
10_1101-2020_12_31_424971	329	5	copyright	copyright	NN
10_1101-2020_12_31_424971	329	6	holder	holder	NN
10_1101-2020_12_31_424971	329	7	for	for	IN
10_1101-2020_12_31_424971	329	8	this	this	DT
10_1101-2020_12_31_424971	329	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	329	10	version	version	NN
10_1101-2020_12_31_424971	329	11	posted	post	VBD
10_1101-2020_12_31_424971	329	12	January	January	NNP
10_1101-2020_12_31_424971	329	13	2	2	CD
10_1101-2020_12_31_424971	329	14	,	,	,
10_1101-2020_12_31_424971	329	15	2021	2021	CD
10_1101-2020_12_31_424971	329	16	.	.	.
10_1101-2020_12_31_424971	329	17	;	;	:
10_1101-2020_12_31_424971	329	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	329	19	:	:	:
10_1101-2020_12_31_424971	329	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	329	21	preprint	preprint	NN
10_1101-2020_12_31_424971	329	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	329	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	329	24	31	31	CD
10_1101-2020_12_31_424971	329	25	template29,34	template29,34	NNP
10_1101-2020_12_31_424971	329	26	,	,	,
10_1101-2020_12_31_424971	329	27	a	a	DT
10_1101-2020_12_31_424971	329	28	70S	70S	NNP
10_1101-2020_12_31_424971	329	29	IC	IC	NNP
10_1101-2020_12_31_424971	329	30	was	be	VBD
10_1101-2020_12_31_424971	329	31	assembled	assemble	VBN
10_1101-2020_12_31_424971	329	32	that	that	IN
10_1101-2020_12_31_424971	329	33	positioned	position	VBD
10_1101-2020_12_31_424971	329	34	the	the	DT
10_1101-2020_12_31_424971	329	35	AUG	AUG	NNP
10_1101-2020_12_31_424971	329	36	start	start	VBP
10_1101-2020_12_31_424971	329	37	codon	codon	NNP
10_1101-2020_12_31_424971	329	38	and	and	CC
10_1101-2020_12_31_424971	329	39	an	an	DT
10_1101-2020_12_31_424971	329	40	initiator	initiator	NN
10_1101-2020_12_31_424971	329	41	fMet-753	fMet-753	,
10_1101-2020_12_31_424971	329	42	tRNAfMet	trnafmet	ADD
10_1101-2020_12_31_424971	329	43	at	at	IN
10_1101-2020_12_31_424971	329	44	the	the	DT
10_1101-2020_12_31_424971	329	45	P	p	NN
10_1101-2020_12_31_424971	329	46	site	site	NN
10_1101-2020_12_31_424971	329	47	and	and	CC
10_1101-2020_12_31_424971	329	48	the	the	DT
10_1101-2020_12_31_424971	329	49	CCC	CCC	NNP
10_1101-2020_12_31_424971	329	50	-	-	HYPH
10_1101-2020_12_31_424971	329	51	C	C	NNP
10_1101-2020_12_31_424971	329	52	motif	motif	NN
10_1101-2020_12_31_424971	329	53	at	at	IN
10_1101-2020_12_31_424971	329	54	the	the	DT
10_1101-2020_12_31_424971	329	55	A	A	NNP
10_1101-2020_12_31_424971	329	56	site	site	NN
10_1101-2020_12_31_424971	329	57	.	.	.
10_1101-2020_12_31_424971	330	1	Reactions	reaction	NNS
10_1101-2020_12_31_424971	330	2	to	to	TO
10_1101-2020_12_31_424971	330	3	monitor	monitor	VB
10_1101-2020_12_31_424971	330	4	the	the	DT
10_1101-2020_12_31_424971	330	5	EF	EF	NNP
10_1101-2020_12_31_424971	330	6	-	-	HYPH
10_1101-2020_12_31_424971	330	7	Tu-754	tu-754	CD
10_1101-2020_12_31_424971	330	8	dependent	dependent	JJ
10_1101-2020_12_31_424971	330	9	hydrolysis	hydrolysis	NN
10_1101-2020_12_31_424971	330	10	of	of	IN
10_1101-2020_12_31_424971	330	11	GTP	GTP	NNP
10_1101-2020_12_31_424971	330	12	during	during	IN
10_1101-2020_12_31_424971	330	13	delivery	delivery	NN
10_1101-2020_12_31_424971	330	14	and	and	CC
10_1101-2020_12_31_424971	330	15	accommodation	accommodation	NN
10_1101-2020_12_31_424971	330	16	of	of	IN
10_1101-2020_12_31_424971	330	17	a	a	DT
10_1101-2020_12_31_424971	330	18	TC	tc	NN
10_1101-2020_12_31_424971	330	19	to	to	IN
10_1101-2020_12_31_424971	330	20	the	the	DT
10_1101-2020_12_31_424971	330	21	A	A	NNP
10_1101-2020_12_31_424971	330	22	site	site	NN
10_1101-2020_12_31_424971	330	23	were	be	VBD
10_1101-2020_12_31_424971	330	24	755	755	CD
10_1101-2020_12_31_424971	330	25	conducted	conduct	VBN
10_1101-2020_12_31_424971	330	26	at	at	IN
10_1101-2020_12_31_424971	330	27	20	20	CD
10_1101-2020_12_31_424971	330	28	°	°	NNS
10_1101-2020_12_31_424971	330	29	C	C	NNP
10_1101-2020_12_31_424971	330	30	in	in	IN
10_1101-2020_12_31_424971	330	31	a	a	DT
10_1101-2020_12_31_424971	330	32	buffer	buffer	NN
10_1101-2020_12_31_424971	330	33	containing	contain	VBG
10_1101-2020_12_31_424971	330	34	50	50	CD
10_1101-2020_12_31_424971	330	35	mM	mM	NNP
10_1101-2020_12_31_424971	330	36	Tris	Tris	NNP
10_1101-2020_12_31_424971	330	37	-	-	HYPH
10_1101-2020_12_31_424971	330	38	HCl	HCl	NNP
10_1101-2020_12_31_424971	330	39	(	(	-LRB-
10_1101-2020_12_31_424971	330	40	pH	pH	NNP
10_1101-2020_12_31_424971	330	41	7.5	7.5	CD
10_1101-2020_12_31_424971	330	42	)	)	-RRB-
10_1101-2020_12_31_424971	330	43	,	,	,
10_1101-2020_12_31_424971	330	44	70	70	CD
10_1101-2020_12_31_424971	330	45	mM	mm	NN
10_1101-2020_12_31_424971	330	46	NH4Cl	nh4cl	CD
10_1101-2020_12_31_424971	330	47	,	,	,
10_1101-2020_12_31_424971	330	48	30	30	CD
10_1101-2020_12_31_424971	330	49	mM	mm	NN
10_1101-2020_12_31_424971	330	50	KCl	KCl	NNS
10_1101-2020_12_31_424971	330	51	,	,	,
10_1101-2020_12_31_424971	330	52	7	7	CD
10_1101-2020_12_31_424971	330	53	756	756	CD
10_1101-2020_12_31_424971	330	54	mM	mM	NNP
10_1101-2020_12_31_424971	330	55	MgCl2	mgcl2	NN
10_1101-2020_12_31_424971	330	56	,	,	,
10_1101-2020_12_31_424971	330	57	1	1	CD
10_1101-2020_12_31_424971	330	58	mM	mM	NNP
10_1101-2020_12_31_424971	330	59	DTT	DTT	NNP
10_1101-2020_12_31_424971	330	60	,	,	,
10_1101-2020_12_31_424971	330	61	and	and	CC
10_1101-2020_12_31_424971	330	62	0.5	0.5	CD
10_1101-2020_12_31_424971	330	63	mM	mm	NN
10_1101-2020_12_31_424971	330	64	spermidine29	spermidine29	CD
10_1101-2020_12_31_424971	330	65	.	.	.
10_1101-2020_12_31_424971	331	1	Each	each	DT
10_1101-2020_12_31_424971	331	2	TC	TC	NNP
10_1101-2020_12_31_424971	331	3	was	be	VBD
10_1101-2020_12_31_424971	331	4	formed	form	VBN
10_1101-2020_12_31_424971	331	5	by	by	IN
10_1101-2020_12_31_424971	331	6	incubating	incubate	VBG
10_1101-2020_12_31_424971	331	7	EF	EF	NNP
10_1101-2020_12_31_424971	331	8	-	-	HYPH
10_1101-2020_12_31_424971	331	9	Tu	Tu	NNP
10_1101-2020_12_31_424971	331	10	with	with	IN
10_1101-2020_12_31_424971	331	11	757	757	CD
10_1101-2020_12_31_424971	331	12	8	8	CD
10_1101-2020_12_31_424971	331	13	nM	nM	NNP
10_1101-2020_12_31_424971	331	14	[	[	-LRB-
10_1101-2020_12_31_424971	331	15	g-32P]-GTP	g-32p]-gtp	NN
10_1101-2020_12_31_424971	331	16	(	(	-LRB-
10_1101-2020_12_31_424971	331	17	6000	6000	CD
10_1101-2020_12_31_424971	331	18	Ci	Ci	NNP
10_1101-2020_12_31_424971	331	19	/	/	SYM
10_1101-2020_12_31_424971	331	20	mmole	mmole	NN
10_1101-2020_12_31_424971	331	21	)	)	-RRB-
10_1101-2020_12_31_424971	331	22	for	for	IN
10_1101-2020_12_31_424971	331	23	15	15	CD
10_1101-2020_12_31_424971	331	24	min	min	NN
10_1101-2020_12_31_424971	331	25	at	at	IN
10_1101-2020_12_31_424971	331	26	37	37	CD
10_1101-2020_12_31_424971	331	27	ºC	ºC	NNP
10_1101-2020_12_31_424971	331	28	,	,	,
10_1101-2020_12_31_424971	331	29	after	after	IN
10_1101-2020_12_31_424971	331	30	which	which	WDT
10_1101-2020_12_31_424971	331	31	aminoacylated	aminoacylate	VBD
10_1101-2020_12_31_424971	331	32	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	331	33	or	or	CC
10_1101-2020_12_31_424971	331	34	ProL	ProL	NNP
10_1101-2020_12_31_424971	331	35	758	758	CD
10_1101-2020_12_31_424971	331	36	was	be	VBD
10_1101-2020_12_31_424971	331	37	added	add	VBN
10_1101-2020_12_31_424971	331	38	and	and	CC
10_1101-2020_12_31_424971	331	39	the	the	DT
10_1101-2020_12_31_424971	331	40	incubation	incubation	NN
10_1101-2020_12_31_424971	331	41	continued	continue	VBD
10_1101-2020_12_31_424971	331	42	for	for	IN
10_1101-2020_12_31_424971	331	43	15	15	CD
10_1101-2020_12_31_424971	331	44	min	min	NN
10_1101-2020_12_31_424971	331	45	at	at	IN
10_1101-2020_12_31_424971	331	46	4	4	CD
10_1101-2020_12_31_424971	331	47	ºC.	ºC.	NNS
10_1101-2020_12_31_424971	332	1	Unbound	Unbound	NNP
10_1101-2020_12_31_424971	332	2	[	[	-LRB-
10_1101-2020_12_31_424971	332	3	g-32P]-GTP	g-32P]-GTP	NNP
10_1101-2020_12_31_424971	332	4	was	be	VBD
10_1101-2020_12_31_424971	332	5	removed	remove	VBN
10_1101-2020_12_31_424971	332	6	759	759	CD
10_1101-2020_12_31_424971	332	7	from	from	IN
10_1101-2020_12_31_424971	332	8	the	the	DT
10_1101-2020_12_31_424971	332	9	TC	TC	NNP
10_1101-2020_12_31_424971	332	10	solution	solution	NN
10_1101-2020_12_31_424971	332	11	by	by	IN
10_1101-2020_12_31_424971	332	12	gel	gel	NN
10_1101-2020_12_31_424971	332	13	filtration	filtration	NN
10_1101-2020_12_31_424971	332	14	through	through	IN
10_1101-2020_12_31_424971	332	15	a	a	DT
10_1101-2020_12_31_424971	332	16	spin	spin	NN
10_1101-2020_12_31_424971	332	17	cartridge	cartridge	NN
10_1101-2020_12_31_424971	332	18	(	(	-LRB-
10_1101-2020_12_31_424971	332	19	CentriSpin-20	CentriSpin-20	NNP
10_1101-2020_12_31_424971	332	20	;	;	:
10_1101-2020_12_31_424971	332	21	Princeton	Princeton	NNP
10_1101-2020_12_31_424971	332	22	760	760	CD
10_1101-2020_12_31_424971	332	23	Separations	Separations	NNPS
10_1101-2020_12_31_424971	332	24	)	)	-RRB-
10_1101-2020_12_31_424971	332	25	.	.	.
10_1101-2020_12_31_424971	333	1	Equal	equal	JJ
10_1101-2020_12_31_424971	333	2	volumes	volume	NNS
10_1101-2020_12_31_424971	333	3	of	of	IN
10_1101-2020_12_31_424971	333	4	each	each	DT
10_1101-2020_12_31_424971	333	5	purified	purify	VBN
10_1101-2020_12_31_424971	333	6	TC	TC	NNP
10_1101-2020_12_31_424971	333	7	and	and	CC
10_1101-2020_12_31_424971	333	8	a	a	DT
10_1101-2020_12_31_424971	333	9	solution	solution	NN
10_1101-2020_12_31_424971	333	10	of	of	IN
10_1101-2020_12_31_424971	333	11	70S	70S	NNP
10_1101-2020_12_31_424971	333	12	ICs	ic	NNS
10_1101-2020_12_31_424971	333	13	were	be	VBD
10_1101-2020_12_31_424971	333	14	rapidly	rapidly	RB
10_1101-2020_12_31_424971	333	15	mixed	mix	VBN
10_1101-2020_12_31_424971	333	16	in	in	IN
10_1101-2020_12_31_424971	333	17	761	761	CD
10_1101-2020_12_31_424971	333	18	the	the	DT
10_1101-2020_12_31_424971	333	19	RQF-3	RQF-3	NNP
10_1101-2020_12_31_424971	333	20	Kintek	Kintek	NNPS
10_1101-2020_12_31_424971	333	21	chemical	chemical	NN
10_1101-2020_12_31_424971	333	22	quench	quench	NN
10_1101-2020_12_31_424971	333	23	apparatus29	apparatus29	NNP
10_1101-2020_12_31_424971	333	24	.	.	.
10_1101-2020_12_31_424971	334	1	Final	final	JJ
10_1101-2020_12_31_424971	334	2	concentrations	concentration	NNS
10_1101-2020_12_31_424971	334	3	in	in	IN
10_1101-2020_12_31_424971	334	4	these	these	DT
10_1101-2020_12_31_424971	334	5	reactions	reaction	NNS
10_1101-2020_12_31_424971	334	6	were	be	VBD
10_1101-2020_12_31_424971	334	7	0.5	0.5	CD
10_1101-2020_12_31_424971	334	8	762	762	CD
10_1101-2020_12_31_424971	334	9	µM	µm	NN
10_1101-2020_12_31_424971	334	10	for	for	IN
10_1101-2020_12_31_424971	334	11	the	the	DT
10_1101-2020_12_31_424971	334	12	70S	70S	NNP
10_1101-2020_12_31_424971	334	13	IC	IC	NNP
10_1101-2020_12_31_424971	334	14	;	;	:
10_1101-2020_12_31_424971	334	15	0.8	0.8	CD
10_1101-2020_12_31_424971	334	16	µM	µm	NN
10_1101-2020_12_31_424971	334	17	for	for	IN
10_1101-2020_12_31_424971	334	18	mRNA	mRNA	NNP
10_1101-2020_12_31_424971	334	19	;	;	:
10_1101-2020_12_31_424971	334	20	0.65	0.65	CD
10_1101-2020_12_31_424971	334	21	µM	µM	NNP
10_1101-2020_12_31_424971	334	22	each	each	DT
10_1101-2020_12_31_424971	334	23	for	for	IN
10_1101-2020_12_31_424971	334	24	IFs	IFs	NNP
10_1101-2020_12_31_424971	334	25	1	1	CD
10_1101-2020_12_31_424971	334	26	,	,	,
10_1101-2020_12_31_424971	334	27	2	2	CD
10_1101-2020_12_31_424971	334	28	,	,	,
10_1101-2020_12_31_424971	334	29	and	and	CC
10_1101-2020_12_31_424971	334	30	3	3	CD
10_1101-2020_12_31_424971	334	31	;	;	:
10_1101-2020_12_31_424971	334	32	0.65	0.65	CD
10_1101-2020_12_31_424971	334	33	µM	µM	NNP
10_1101-2020_12_31_424971	334	34	for	for	IN
10_1101-2020_12_31_424971	334	35	fMet	fMet	NNP
10_1101-2020_12_31_424971	334	36	-	-	HYPH
10_1101-2020_12_31_424971	334	37	tRNAMet	tRNAMet	NNP
10_1101-2020_12_31_424971	334	38	;	;	:
10_1101-2020_12_31_424971	334	39	763	763	CD
10_1101-2020_12_31_424971	334	40	1.8	1.8	CD
10_1101-2020_12_31_424971	334	41	µM	µm	NN
10_1101-2020_12_31_424971	334	42	for	for	IN
10_1101-2020_12_31_424971	334	43	EF	EF	NNP
10_1101-2020_12_31_424971	334	44	-	-	HYPH
10_1101-2020_12_31_424971	334	45	Tu	Tu	NNP
10_1101-2020_12_31_424971	334	46	;	;	:
10_1101-2020_12_31_424971	334	47	0.4	0.4	CD
10_1101-2020_12_31_424971	334	48	µM	µM	NNP
10_1101-2020_12_31_424971	334	49	for	for	IN
10_1101-2020_12_31_424971	334	50	aminoacylated	aminoacylate	VBN
10_1101-2020_12_31_424971	334	51	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	334	52	or	or	CC
10_1101-2020_12_31_424971	334	53	ProL	ProL	NNP
10_1101-2020_12_31_424971	334	54	;	;	:
10_1101-2020_12_31_424971	334	55	and	and	CC
10_1101-2020_12_31_424971	334	56	0.5	0.5	CD
10_1101-2020_12_31_424971	334	57	mM	mm	NN
10_1101-2020_12_31_424971	334	58	for	for	IN
10_1101-2020_12_31_424971	334	59	cold	cold	JJ
10_1101-2020_12_31_424971	334	60	GTP	GTP	NNP
10_1101-2020_12_31_424971	334	61	.	.	.
10_1101-2020_12_31_424971	335	1	The	the	DT
10_1101-2020_12_31_424971	335	2	yield	yield	NN
10_1101-2020_12_31_424971	335	3	764	764	CD
10_1101-2020_12_31_424971	335	4	of	of	IN
10_1101-2020_12_31_424971	335	5	GTP	GTP	NNP
10_1101-2020_12_31_424971	335	6	hydrolysis	hydrolysis	NN
10_1101-2020_12_31_424971	335	7	and	and	CC
10_1101-2020_12_31_424971	335	8	kGTP	kgtp	NN
10_1101-2020_12_31_424971	335	9	,	,	,
10_1101-2020_12_31_424971	335	10	obs	obs	NN
10_1101-2020_12_31_424971	335	11	upon	upon	IN
10_1101-2020_12_31_424971	335	12	rapid	rapid	JJ
10_1101-2020_12_31_424971	335	13	mixing	mixing	NN
10_1101-2020_12_31_424971	335	14	of	of	IN
10_1101-2020_12_31_424971	335	15	each	each	DT
10_1101-2020_12_31_424971	335	16	TC	TC	NNP
10_1101-2020_12_31_424971	335	17	with	with	IN
10_1101-2020_12_31_424971	335	18	excess	excess	JJ
10_1101-2020_12_31_424971	335	19	70S	70S	NNP
10_1101-2020_12_31_424971	335	20	ICs	ic	NNS
10_1101-2020_12_31_424971	335	21	were	be	VBD
10_1101-2020_12_31_424971	335	22	measured	measure	VBN
10_1101-2020_12_31_424971	335	23	765	765	CD
10_1101-2020_12_31_424971	335	24	by	by	IN
10_1101-2020_12_31_424971	335	25	removing	remove	VBG
10_1101-2020_12_31_424971	335	26	aliquots	aliquot	NNS
10_1101-2020_12_31_424971	335	27	of	of	IN
10_1101-2020_12_31_424971	335	28	the	the	DT
10_1101-2020_12_31_424971	335	29	reaction	reaction	NN
10_1101-2020_12_31_424971	335	30	at	at	IN
10_1101-2020_12_31_424971	335	31	defined	define	VBN
10_1101-2020_12_31_424971	335	32	time	time	NN
10_1101-2020_12_31_424971	335	33	points	point	NNS
10_1101-2020_12_31_424971	335	34	,	,	,
10_1101-2020_12_31_424971	335	35	quenching	quench	VBG
10_1101-2020_12_31_424971	335	36	the	the	DT
10_1101-2020_12_31_424971	335	37	aliquots	aliquot	NNS
10_1101-2020_12_31_424971	335	38	with	with	IN
10_1101-2020_12_31_424971	335	39	40	40	CD
10_1101-2020_12_31_424971	335	40	%	%	NN
10_1101-2020_12_31_424971	335	41	formic	formic	JJ
10_1101-2020_12_31_424971	335	42	766	766	CD
10_1101-2020_12_31_424971	335	43	acid	acid	NN
10_1101-2020_12_31_424971	335	44	,	,	,
10_1101-2020_12_31_424971	335	45	separating	separate	VBG
10_1101-2020_12_31_424971	335	46	[	[	-LRB-
10_1101-2020_12_31_424971	335	47	g-32P	g-32p	NN
10_1101-2020_12_31_424971	335	48	]	]	-RRB-
10_1101-2020_12_31_424971	335	49	from	from	IN
10_1101-2020_12_31_424971	335	50	[	[	-LRB-
10_1101-2020_12_31_424971	335	51	g-32P]-GTP	g-32p]-gtp	NN
10_1101-2020_12_31_424971	335	52	using	use	VBG
10_1101-2020_12_31_424971	335	53	thin	thin	JJ
10_1101-2020_12_31_424971	335	54	layer	layer	NN
10_1101-2020_12_31_424971	335	55	chromatography	chromatography	NN
10_1101-2020_12_31_424971	335	56	(	(	-LRB-
10_1101-2020_12_31_424971	335	57	TLC	TLC	NNP
10_1101-2020_12_31_424971	335	58	)	)	-RRB-
10_1101-2020_12_31_424971	335	59	,	,	,
10_1101-2020_12_31_424971	335	60	and	and	CC
10_1101-2020_12_31_424971	335	61	quantifying	quantify	VBG
10_1101-2020_12_31_424971	335	62	767	767	CD
10_1101-2020_12_31_424971	335	63	the	the	DT
10_1101-2020_12_31_424971	335	64	amount	amount	NN
10_1101-2020_12_31_424971	335	65	of	of	IN
10_1101-2020_12_31_424971	335	66	each	each	DT
10_1101-2020_12_31_424971	335	67	as	as	IN
10_1101-2020_12_31_424971	335	68	a	a	DT
10_1101-2020_12_31_424971	335	69	function	function	NN
10_1101-2020_12_31_424971	335	70	of	of	IN
10_1101-2020_12_31_424971	335	71	time	time	NN
10_1101-2020_12_31_424971	335	72	using	use	VBG
10_1101-2020_12_31_424971	335	73	phosphorimaging29	phosphorimaging29	NNP
10_1101-2020_12_31_424971	335	74	.	.	.
10_1101-2020_12_31_424971	336	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	336	2	adjusted	adjust	VBD
10_1101-2020_12_31_424971	336	3	reaction	reaction	NN
10_1101-2020_12_31_424971	336	4	768	768	CD
10_1101-2020_12_31_424971	336	5	conditions	condition	NNS
10_1101-2020_12_31_424971	336	6	such	such	JJ
10_1101-2020_12_31_424971	336	7	that	that	IN
10_1101-2020_12_31_424971	336	8	the	the	DT
10_1101-2020_12_31_424971	336	9	kGTP	kgtp	NN
10_1101-2020_12_31_424971	336	10	,	,	,
10_1101-2020_12_31_424971	336	11	obs	obs	NNP
10_1101-2020_12_31_424971	336	12	increased	increase	VBD
10_1101-2020_12_31_424971	336	13	linearly	linearly	RB
10_1101-2020_12_31_424971	336	14	as	as	IN
10_1101-2020_12_31_424971	336	15	a	a	DT
10_1101-2020_12_31_424971	336	16	function	function	NN
10_1101-2020_12_31_424971	336	17	of	of	IN
10_1101-2020_12_31_424971	336	18	70S	70S	NNP
10_1101-2020_12_31_424971	336	19	IC	IC	NNP
10_1101-2020_12_31_424971	336	20	concentration	concentration	NN
10_1101-2020_12_31_424971	336	21	.	.	.
10_1101-2020_12_31_424971	337	1	769	769	CD
10_1101-2020_12_31_424971	337	2	770	770	CD
10_1101-2020_12_31_424971	337	3	Rapid	Rapid	NNP
10_1101-2020_12_31_424971	337	4	kinetic	kinetic	NN
10_1101-2020_12_31_424971	337	5	di-	di-	XX
10_1101-2020_12_31_424971	337	6	and	and	CC
10_1101-2020_12_31_424971	337	7	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	337	8	formation	formation	NN
10_1101-2020_12_31_424971	337	9	assays	assays	RB
10_1101-2020_12_31_424971	337	10	.	.	.
10_1101-2020_12_31_424971	338	1	Di-	di-	RB
10_1101-2020_12_31_424971	338	2	and	and	CC
10_1101-2020_12_31_424971	338	3	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	338	4	formation	formation	NN
10_1101-2020_12_31_424971	338	5	assays	assays	RB
10_1101-2020_12_31_424971	338	6	were	be	VBD
10_1101-2020_12_31_424971	338	7	771	771	CD
10_1101-2020_12_31_424971	338	8	performed	perform	VBN
10_1101-2020_12_31_424971	338	9	using	use	VBG
10_1101-2020_12_31_424971	338	10	the	the	DT
10_1101-2020_12_31_424971	338	11	codon	codon	NN
10_1101-2020_12_31_424971	338	12	-	-	HYPH
10_1101-2020_12_31_424971	338	13	walk	walk	NN
10_1101-2020_12_31_424971	338	14	approach	approach	NN
10_1101-2020_12_31_424971	338	15	described	describe	VBN
10_1101-2020_12_31_424971	338	16	above	above	RB
10_1101-2020_12_31_424971	338	17	in	in	IN
10_1101-2020_12_31_424971	338	18	50	50	CD
10_1101-2020_12_31_424971	338	19	mM	mM	NNP
10_1101-2020_12_31_424971	338	20	Tris	Tris	NNP
10_1101-2020_12_31_424971	338	21	-	-	HYPH
10_1101-2020_12_31_424971	338	22	HCl	HCl	NNP
10_1101-2020_12_31_424971	338	23	(	(	-LRB-
10_1101-2020_12_31_424971	338	24	pH	pH	NNP
10_1101-2020_12_31_424971	338	25	7.5	7.5	CD
10_1101-2020_12_31_424971	338	26	)	)	-RRB-
10_1101-2020_12_31_424971	338	27	,	,	,
10_1101-2020_12_31_424971	338	28	70	70	CD
10_1101-2020_12_31_424971	338	29	mM	mM	NNP
10_1101-2020_12_31_424971	338	30	772	772	CD
10_1101-2020_12_31_424971	338	31	NH4Cl	nh4cl	CD
10_1101-2020_12_31_424971	338	32	,	,	,
10_1101-2020_12_31_424971	338	33	30	30	CD
10_1101-2020_12_31_424971	338	34	mM	mm	NN
10_1101-2020_12_31_424971	338	35	KCl	KCl	NNS
10_1101-2020_12_31_424971	338	36	,	,	,
10_1101-2020_12_31_424971	338	37	3.5	3.5	CD
10_1101-2020_12_31_424971	338	38	mM	mM	NNP
10_1101-2020_12_31_424971	338	39	MgCl2	mgcl2	NN
10_1101-2020_12_31_424971	338	40	,	,	,
10_1101-2020_12_31_424971	338	41	1	1	CD
10_1101-2020_12_31_424971	338	42	mM	mM	NNP
10_1101-2020_12_31_424971	338	43	DTT	DTT	NNP
10_1101-2020_12_31_424971	338	44	,	,	,
10_1101-2020_12_31_424971	338	45	0.5	0.5	CD
10_1101-2020_12_31_424971	338	46	mM	mm	NN
10_1101-2020_12_31_424971	338	47	spermidine	spermidine	NN
10_1101-2020_12_31_424971	338	48	,	,	,
10_1101-2020_12_31_424971	338	49	at	at	IN
10_1101-2020_12_31_424971	338	50	20	20	CD
10_1101-2020_12_31_424971	338	51	°	°	NNS
10_1101-2020_12_31_424971	338	52	C	C	NNP
10_1101-2020_12_31_424971	338	53	unless	unless	IN
10_1101-2020_12_31_424971	338	54	otherwise	otherwise	RB
10_1101-2020_12_31_424971	338	55	773	773	CD
10_1101-2020_12_31_424971	338	56	indicated29	indicated29	NNPS
10_1101-2020_12_31_424971	338	57	.	.	.
10_1101-2020_12_31_424971	339	1	70S	70s	CD
10_1101-2020_12_31_424971	339	2	ICs	ic	NNS
10_1101-2020_12_31_424971	339	3	were	be	VBD
10_1101-2020_12_31_424971	339	4	formed	form	VBN
10_1101-2020_12_31_424971	339	5	by	by	IN
10_1101-2020_12_31_424971	339	6	incubating	incubate	VBG
10_1101-2020_12_31_424971	339	7	70S	70S	NNP
10_1101-2020_12_31_424971	339	8	ribosomes	ribosome	NNS
10_1101-2020_12_31_424971	339	9	,	,	,
10_1101-2020_12_31_424971	339	10	mRNA	mRNA	NNS
10_1101-2020_12_31_424971	339	11	,	,	,
10_1101-2020_12_31_424971	339	12	[	[	-LRB-
10_1101-2020_12_31_424971	339	13	35S]-fMet	35s]-fmet	CD
10_1101-2020_12_31_424971	339	14	-	-	HYPH
10_1101-2020_12_31_424971	339	15	tRNAfMet	tRNAfMet	NNP
10_1101-2020_12_31_424971	339	16	,	,	,
10_1101-2020_12_31_424971	339	17	and	and	CC
10_1101-2020_12_31_424971	339	18	774	774	CD
10_1101-2020_12_31_424971	339	19	IFs	if	NNS
10_1101-2020_12_31_424971	339	20	1	1	CD
10_1101-2020_12_31_424971	339	21	,	,	,
10_1101-2020_12_31_424971	339	22	2	2	CD
10_1101-2020_12_31_424971	339	23	,	,	,
10_1101-2020_12_31_424971	339	24	and	and	CC
10_1101-2020_12_31_424971	339	25	3	3	CD
10_1101-2020_12_31_424971	339	26	,	,	,
10_1101-2020_12_31_424971	339	27	and	and	CC
10_1101-2020_12_31_424971	339	28	GTP	GTP	NNP
10_1101-2020_12_31_424971	339	29	,	,	,
10_1101-2020_12_31_424971	339	30	for	for	IN
10_1101-2020_12_31_424971	339	31	25	25	CD
10_1101-2020_12_31_424971	339	32	min	min	NN
10_1101-2020_12_31_424971	339	33	at	at	IN
10_1101-2020_12_31_424971	339	34	37	37	CD
10_1101-2020_12_31_424971	339	35	°	°	NNS
10_1101-2020_12_31_424971	339	36	C	C	NNP
10_1101-2020_12_31_424971	339	37	in	in	IN
10_1101-2020_12_31_424971	339	38	the	the	DT
10_1101-2020_12_31_424971	339	39	reaction	reaction	NN
10_1101-2020_12_31_424971	339	40	buffer	buffer	NN
10_1101-2020_12_31_424971	339	41	.	.	.
10_1101-2020_12_31_424971	340	1	Separately	separately	RB
10_1101-2020_12_31_424971	340	2	,	,	,
10_1101-2020_12_31_424971	340	3	TCs	tc	NNS
10_1101-2020_12_31_424971	340	4	were	be	VBD
10_1101-2020_12_31_424971	340	5	formed	form	VBN
10_1101-2020_12_31_424971	340	6	775	775	CD
10_1101-2020_12_31_424971	340	7	in	in	IN
10_1101-2020_12_31_424971	340	8	the	the	DT
10_1101-2020_12_31_424971	340	9	reaction	reaction	NN
10_1101-2020_12_31_424971	340	10	buffer	buffer	NN
10_1101-2020_12_31_424971	340	11	by	by	IN
10_1101-2020_12_31_424971	340	12	incubating	incubate	VBG
10_1101-2020_12_31_424971	340	13	EF	EF	NNP
10_1101-2020_12_31_424971	340	14	-	-	HYPH
10_1101-2020_12_31_424971	340	15	Tu	Tu	NNP
10_1101-2020_12_31_424971	340	16	and	and	CC
10_1101-2020_12_31_424971	340	17	GTP	GTP	NNP
10_1101-2020_12_31_424971	340	18	for	for	IN
10_1101-2020_12_31_424971	340	19	15	15	CD
10_1101-2020_12_31_424971	340	20	min	min	NN
10_1101-2020_12_31_424971	340	21	at	at	IN
10_1101-2020_12_31_424971	340	22	37	37	CD
10_1101-2020_12_31_424971	340	23	°	°	NNS
10_1101-2020_12_31_424971	340	24	C	C	NNP
10_1101-2020_12_31_424971	340	25	followed	follow	VBN
10_1101-2020_12_31_424971	340	26	by	by	IN
10_1101-2020_12_31_424971	340	27	adding	add	VBG
10_1101-2020_12_31_424971	340	28	the	the	DT
10_1101-2020_12_31_424971	340	29	776	776	CD
10_1101-2020_12_31_424971	340	30	requisite	requisite	JJ
10_1101-2020_12_31_424971	340	31	aa	aa	NNP
10_1101-2020_12_31_424971	340	32	-	-	HYPH
10_1101-2020_12_31_424971	340	33	tRNAs	tRNAs	NNP
10_1101-2020_12_31_424971	340	34	and	and	CC
10_1101-2020_12_31_424971	340	35	incubating	incubate	VBG
10_1101-2020_12_31_424971	340	36	in	in	IN
10_1101-2020_12_31_424971	340	37	an	an	DT
10_1101-2020_12_31_424971	340	38	ice	ice	NN
10_1101-2020_12_31_424971	340	39	bath	bath	NN
10_1101-2020_12_31_424971	340	40	for	for	IN
10_1101-2020_12_31_424971	340	41	15	15	CD
10_1101-2020_12_31_424971	340	42	min	min	NN
10_1101-2020_12_31_424971	340	43	.	.	.
10_1101-2020_12_31_424971	341	1	In	in	IN
10_1101-2020_12_31_424971	341	2	dipeptide	dipeptide	NN
10_1101-2020_12_31_424971	341	3	formation	formation	NN
10_1101-2020_12_31_424971	341	4	assays	assays	RB
10_1101-2020_12_31_424971	341	5	,	,	,
10_1101-2020_12_31_424971	341	6	70S	70S	NNP
10_1101-2020_12_31_424971	341	7	777	777	CD
10_1101-2020_12_31_424971	341	8	.CC	.CC	:
10_1101-2020_12_31_424971	341	9	-	-	HYPH
10_1101-2020_12_31_424971	341	10	BY	by	IN
10_1101-2020_12_31_424971	341	11	-	-	HYPH
10_1101-2020_12_31_424971	341	12	NC	NC	NNP
10_1101-2020_12_31_424971	341	13	-	-	HYPH
10_1101-2020_12_31_424971	341	14	ND	ND	NNP
10_1101-2020_12_31_424971	341	15	4.0	4.0	CD
10_1101-2020_12_31_424971	341	16	International	International	NNP
10_1101-2020_12_31_424971	341	17	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	341	18	under	under	IN
10_1101-2020_12_31_424971	341	19	a	a	DT
10_1101-2020_12_31_424971	341	20	(	(	-LRB-
10_1101-2020_12_31_424971	341	21	which	which	WDT
10_1101-2020_12_31_424971	341	22	was	be	VBD
10_1101-2020_12_31_424971	341	23	not	not	RB
10_1101-2020_12_31_424971	341	24	certified	certify	VBN
10_1101-2020_12_31_424971	341	25	by	by	IN
10_1101-2020_12_31_424971	341	26	peer	peer	NN
10_1101-2020_12_31_424971	341	27	review	review	NN
10_1101-2020_12_31_424971	341	28	)	)	-RRB-
10_1101-2020_12_31_424971	341	29	is	be	VBZ
10_1101-2020_12_31_424971	341	30	the	the	DT
10_1101-2020_12_31_424971	341	31	author	author	NN
10_1101-2020_12_31_424971	341	32	/	/	SYM
10_1101-2020_12_31_424971	341	33	funder	funder	NN
10_1101-2020_12_31_424971	341	34	,	,	,
10_1101-2020_12_31_424971	341	35	who	who	WP
10_1101-2020_12_31_424971	341	36	has	have	VBZ
10_1101-2020_12_31_424971	341	37	granted	grant	VBN
10_1101-2020_12_31_424971	341	38	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	341	39	a	a	DT
10_1101-2020_12_31_424971	341	40	license	license	NN
10_1101-2020_12_31_424971	341	41	to	to	TO
10_1101-2020_12_31_424971	341	42	display	display	VB
10_1101-2020_12_31_424971	341	43	the	the	DT
10_1101-2020_12_31_424971	341	44	preprint	preprint	NN
10_1101-2020_12_31_424971	341	45	in	in	IN
10_1101-2020_12_31_424971	341	46	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	341	47	.	.	.
10_1101-2020_12_31_424971	342	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	342	2	is	be	VBZ
10_1101-2020_12_31_424971	342	3	made	make	VBN
10_1101-2020_12_31_424971	342	4	The	the	DT
10_1101-2020_12_31_424971	342	5	copyright	copyright	NN
10_1101-2020_12_31_424971	342	6	holder	holder	NN
10_1101-2020_12_31_424971	342	7	for	for	IN
10_1101-2020_12_31_424971	342	8	this	this	DT
10_1101-2020_12_31_424971	342	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	342	10	version	version	NN
10_1101-2020_12_31_424971	342	11	posted	post	VBD
10_1101-2020_12_31_424971	342	12	January	January	NNP
10_1101-2020_12_31_424971	342	13	2	2	CD
10_1101-2020_12_31_424971	342	14	,	,	,
10_1101-2020_12_31_424971	342	15	2021	2021	CD
10_1101-2020_12_31_424971	342	16	.	.	.
10_1101-2020_12_31_424971	342	17	;	;	:
10_1101-2020_12_31_424971	342	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	342	19	:	:	:
10_1101-2020_12_31_424971	342	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	342	21	preprint	preprint	NN
10_1101-2020_12_31_424971	342	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NN
10_1101-2020_12_31_424971	342	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	342	24	32	32	CD
10_1101-2020_12_31_424971	342	25	ICs	ic	NNS
10_1101-2020_12_31_424971	342	26	templated	template	VBN
10_1101-2020_12_31_424971	342	27	with	with	IN
10_1101-2020_12_31_424971	342	28	the	the	DT
10_1101-2020_12_31_424971	342	29	specified	specify	VBN
10_1101-2020_12_31_424971	342	30	variants	variant	NNS
10_1101-2020_12_31_424971	342	31	of	of	IN
10_1101-2020_12_31_424971	342	32	an	an	DT
10_1101-2020_12_31_424971	342	33	AUG	AUG	NNP
10_1101-2020_12_31_424971	342	34	-	-	HYPH
10_1101-2020_12_31_424971	342	35	NNN	NNN	NNP
10_1101-2020_12_31_424971	342	36	-	-	HYPH
10_1101-2020_12_31_424971	342	37	NGU	NGU	NNP
10_1101-2020_12_31_424971	342	38	-	-	HYPH
10_1101-2020_12_31_424971	342	39	U	U	NNP
10_1101-2020_12_31_424971	342	40	mRNA	mrna	NN
10_1101-2020_12_31_424971	342	41	were	be	VBD
10_1101-2020_12_31_424971	342	42	mixed	mixed	JJ
10_1101-2020_12_31_424971	342	43	with	with	IN
10_1101-2020_12_31_424971	342	44	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	342	45	-	-	HYPH
10_1101-2020_12_31_424971	342	46	778	778	CD
10_1101-2020_12_31_424971	342	47	TC	TC	NNP
10_1101-2020_12_31_424971	342	48	or	or	CC
10_1101-2020_12_31_424971	342	49	ProL	ProL	NNP
10_1101-2020_12_31_424971	342	50	-	-	HYPH
10_1101-2020_12_31_424971	342	51	TC	TC	NNP
10_1101-2020_12_31_424971	342	52	.	.	.
10_1101-2020_12_31_424971	343	1	fMP	fMP	NNP
10_1101-2020_12_31_424971	343	2	formation	formation	NN
10_1101-2020_12_31_424971	343	3	was	be	VBD
10_1101-2020_12_31_424971	343	4	monitored	monitor	VBN
10_1101-2020_12_31_424971	343	5	in	in	IN
10_1101-2020_12_31_424971	343	6	an	an	DT
10_1101-2020_12_31_424971	343	7	RQF-3	RQF-3	NNP
10_1101-2020_12_31_424971	343	8	Kintek	Kintek	NNPS
10_1101-2020_12_31_424971	343	9	chemical	chemical	NN
10_1101-2020_12_31_424971	343	10	quench	quench	NN
10_1101-2020_12_31_424971	343	11	apparatus	apparatus	NN
10_1101-2020_12_31_424971	343	12	.	.	.
10_1101-2020_12_31_424971	344	1	In	in	IN
10_1101-2020_12_31_424971	344	2	779	779	CD
10_1101-2020_12_31_424971	344	3	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	344	4	formation	formation	NN
10_1101-2020_12_31_424971	344	5	assays	assays	RB
10_1101-2020_12_31_424971	344	6	,	,	,
10_1101-2020_12_31_424971	344	7	70S	70S	NNP
10_1101-2020_12_31_424971	344	8	ICs	ic	NNS
10_1101-2020_12_31_424971	344	9	templated	template	VBD
10_1101-2020_12_31_424971	344	10	with	with	IN
10_1101-2020_12_31_424971	344	11	the	the	DT
10_1101-2020_12_31_424971	344	12	specified	specify	VBN
10_1101-2020_12_31_424971	344	13	variants	variant	NNS
10_1101-2020_12_31_424971	344	14	of	of	IN
10_1101-2020_12_31_424971	344	15	the	the	DT
10_1101-2020_12_31_424971	344	16	AUG	AUG	NNP
10_1101-2020_12_31_424971	344	17	-	-	HYPH
10_1101-2020_12_31_424971	344	18	NCC	NCC	NNP
10_1101-2020_12_31_424971	344	19	-	-	HYPH
10_1101-2020_12_31_424971	344	20	NGU-780	NGU-780	NNP
10_1101-2020_12_31_424971	344	21	U	U	NNP
10_1101-2020_12_31_424971	344	22	mRNA	mRNA	NNS
10_1101-2020_12_31_424971	344	23	were	be	VBD
10_1101-2020_12_31_424971	344	24	mixed	mixed	JJ
10_1101-2020_12_31_424971	344	25	,	,	,
10_1101-2020_12_31_424971	344	26	either	either	CC
10_1101-2020_12_31_424971	344	27	in	in	IN
10_1101-2020_12_31_424971	344	28	one	one	CD
10_1101-2020_12_31_424971	344	29	step	step	NN
10_1101-2020_12_31_424971	344	30	or	or	CC
10_1101-2020_12_31_424971	344	31	in	in	IN
10_1101-2020_12_31_424971	344	32	two	two	CD
10_1101-2020_12_31_424971	344	33	steps	step	NNS
10_1101-2020_12_31_424971	344	34	,	,	,
10_1101-2020_12_31_424971	344	35	with	with	IN
10_1101-2020_12_31_424971	344	36	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	344	37	mixtures	mixture	NNS
10_1101-2020_12_31_424971	344	38	of	of	IN
10_1101-2020_12_31_424971	344	39	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	344	40	,	,	,
10_1101-2020_12_31_424971	344	41	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	344	42	781	781	CD
10_1101-2020_12_31_424971	344	43	(	(	-LRB-
10_1101-2020_12_31_424971	344	44	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	344	45	U*AC	U*AC	NNP
10_1101-2020_12_31_424971	344	46	,	,	,
10_1101-2020_12_31_424971	344	47	where	where	WRB
10_1101-2020_12_31_424971	344	48	U	u	NN
10_1101-2020_12_31_424971	344	49	*	*	NFP
10_1101-2020_12_31_424971	344	50	=	=	SYM
10_1101-2020_12_31_424971	344	51	cmo5U)-	cmo5U)-	NNS
10_1101-2020_12_31_424971	344	52	,	,	,
10_1101-2020_12_31_424971	344	53	and	and	CC
10_1101-2020_12_31_424971	344	54	tRNAArg	tRNAArg	NNP
10_1101-2020_12_31_424971	344	55	(	(	-LRB-
10_1101-2020_12_31_424971	344	56	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	344	57	ICG	ICG	NNP
10_1101-2020_12_31_424971	344	58	,	,	,
10_1101-2020_12_31_424971	344	59	where	where	WRB
10_1101-2020_12_31_424971	344	60	I	-PRON-	PRP
10_1101-2020_12_31_424971	344	61	=	=	SYM
10_1101-2020_12_31_424971	344	62	inosine)-TCs	inosine)-TCs	NNP
10_1101-2020_12_31_424971	344	63	and	and	CC
10_1101-2020_12_31_424971	344	64	782	782	CD
10_1101-2020_12_31_424971	344	65	EF	EF	NNP
10_1101-2020_12_31_424971	344	66	-	-	HYPH
10_1101-2020_12_31_424971	344	67	G.	G.	NNP
10_1101-2020_12_31_424971	345	1	Formation	formation	NN
10_1101-2020_12_31_424971	345	2	of	of	IN
10_1101-2020_12_31_424971	345	3	fMPV	fmpv	NN
10_1101-2020_12_31_424971	345	4	and	and	CC
10_1101-2020_12_31_424971	345	5	fMPR	fmpr	NN
10_1101-2020_12_31_424971	345	6	were	be	VBD
10_1101-2020_12_31_424971	345	7	monitored	monitor	VBN
10_1101-2020_12_31_424971	345	8	in	in	IN
10_1101-2020_12_31_424971	345	9	an	an	DT
10_1101-2020_12_31_424971	345	10	RQF-3	RQF-3	NNP
10_1101-2020_12_31_424971	345	11	Kintek	Kintek	NNPS
10_1101-2020_12_31_424971	345	12	chemical	chemical	NN
10_1101-2020_12_31_424971	345	13	quench	quench	NN
10_1101-2020_12_31_424971	345	14	783	783	CD
10_1101-2020_12_31_424971	345	15	apparatus	apparatus	NN
10_1101-2020_12_31_424971	345	16	.	.	.
10_1101-2020_12_31_424971	346	1	Tripeptide	tripeptide	JJ
10_1101-2020_12_31_424971	346	2	formation	formation	NN
10_1101-2020_12_31_424971	346	3	assays	assay	VBZ
10_1101-2020_12_31_424971	346	4	with	with	IN
10_1101-2020_12_31_424971	346	5	one	one	CD
10_1101-2020_12_31_424971	346	6	-	-	HYPH
10_1101-2020_12_31_424971	346	7	step	step	NN
10_1101-2020_12_31_424971	346	8	delivery	delivery	NN
10_1101-2020_12_31_424971	346	9	of	of	IN
10_1101-2020_12_31_424971	346	10	TCs	tc	NNS
10_1101-2020_12_31_424971	346	11	were	be	VBD
10_1101-2020_12_31_424971	346	12	initiated	initiate	VBN
10_1101-2020_12_31_424971	346	13	by	by	IN
10_1101-2020_12_31_424971	346	14	rapidly	rapidly	RB
10_1101-2020_12_31_424971	346	15	784	784	CD
10_1101-2020_12_31_424971	346	16	mixing	mix	VBG
10_1101-2020_12_31_424971	346	17	the	the	DT
10_1101-2020_12_31_424971	346	18	70S	70S	NNP
10_1101-2020_12_31_424971	346	19	IC	IC	NNP
10_1101-2020_12_31_424971	346	20	with	with	IN
10_1101-2020_12_31_424971	346	21	two	two	CD
10_1101-2020_12_31_424971	346	22	or	or	CC
10_1101-2020_12_31_424971	346	23	more	more	JJR
10_1101-2020_12_31_424971	346	24	of	of	IN
10_1101-2020_12_31_424971	346	25	the	the	DT
10_1101-2020_12_31_424971	346	26	TCs	tc	NNS
10_1101-2020_12_31_424971	346	27	in	in	IN
10_1101-2020_12_31_424971	346	28	the	the	DT
10_1101-2020_12_31_424971	346	29	RQF-3	RQF-3	NNP
10_1101-2020_12_31_424971	346	30	Kintek	Kintek	NNPS
10_1101-2020_12_31_424971	346	31	chemical	chemical	NN
10_1101-2020_12_31_424971	346	32	quench	quench	NN
10_1101-2020_12_31_424971	346	33	apparatus	apparatus	NN
10_1101-2020_12_31_424971	346	34	.	.	.
10_1101-2020_12_31_424971	347	1	785	785	CD
10_1101-2020_12_31_424971	347	2	Final	final	JJ
10_1101-2020_12_31_424971	347	3	concentrations	concentration	NNS
10_1101-2020_12_31_424971	347	4	in	in	IN
10_1101-2020_12_31_424971	347	5	these	these	DT
10_1101-2020_12_31_424971	347	6	reactions	reaction	NNS
10_1101-2020_12_31_424971	347	7	were	be	VBD
10_1101-2020_12_31_424971	347	8	0.37	0.37	CD
10_1101-2020_12_31_424971	347	9	µM	µm	NN
10_1101-2020_12_31_424971	347	10	for	for	IN
10_1101-2020_12_31_424971	347	11	the	the	DT
10_1101-2020_12_31_424971	347	12	70S	70S	NNP
10_1101-2020_12_31_424971	347	13	IC	IC	NNP
10_1101-2020_12_31_424971	347	14	;	;	:
10_1101-2020_12_31_424971	347	15	0.5	0.5	CD
10_1101-2020_12_31_424971	347	16	µM	µm	NN
10_1101-2020_12_31_424971	347	17	for	for	IN
10_1101-2020_12_31_424971	347	18	mRNA	mRNA	NNP
10_1101-2020_12_31_424971	347	19	;	;	:
10_1101-2020_12_31_424971	347	20	0.5	0.5	CD
10_1101-2020_12_31_424971	347	21	µM	µM	NNP
10_1101-2020_12_31_424971	347	22	786	786	CD
10_1101-2020_12_31_424971	347	23	each	each	DT
10_1101-2020_12_31_424971	347	24	for	for	IN
10_1101-2020_12_31_424971	347	25	IFs	if	NNS
10_1101-2020_12_31_424971	347	26	1	1	CD
10_1101-2020_12_31_424971	347	27	,	,	,
10_1101-2020_12_31_424971	347	28	2	2	CD
10_1101-2020_12_31_424971	347	29	,	,	,
10_1101-2020_12_31_424971	347	30	and	and	CC
10_1101-2020_12_31_424971	347	31	3	3	CD
10_1101-2020_12_31_424971	347	32	;	;	:
10_1101-2020_12_31_424971	347	33	0.25	0.25	CD
10_1101-2020_12_31_424971	347	34	µM	µm	NN
10_1101-2020_12_31_424971	347	35	for	for	IN
10_1101-2020_12_31_424971	347	36	[	[	-LRB-
10_1101-2020_12_31_424971	347	37	35S]-fMet	35s]-fmet	CD
10_1101-2020_12_31_424971	347	38	-	-	HYPH
10_1101-2020_12_31_424971	347	39	tRNAfMet	trnafmet	CD
10_1101-2020_12_31_424971	347	40	;	;	:
10_1101-2020_12_31_424971	347	41	2.0	2.0	CD
10_1101-2020_12_31_424971	347	42	µM	µm	NN
10_1101-2020_12_31_424971	347	43	for	for	IN
10_1101-2020_12_31_424971	347	44	EF	EF	NNP
10_1101-2020_12_31_424971	347	45	-	-	HYPH
10_1101-2020_12_31_424971	347	46	G	G	NNP
10_1101-2020_12_31_424971	347	47	;	;	:
10_1101-2020_12_31_424971	347	48	0.75	0.75	CD
10_1101-2020_12_31_424971	347	49	µM	µm	NN
10_1101-2020_12_31_424971	347	50	for	for	IN
10_1101-2020_12_31_424971	347	51	EF	EF	NNP
10_1101-2020_12_31_424971	347	52	-	-	HYPH
10_1101-2020_12_31_424971	347	53	Tu	Tu	NNP
10_1101-2020_12_31_424971	347	54	for	for	IN
10_1101-2020_12_31_424971	347	55	787	787	CD
10_1101-2020_12_31_424971	347	56	each	each	DT
10_1101-2020_12_31_424971	347	57	aa	aa	NNP
10_1101-2020_12_31_424971	347	58	-	-	HYPH
10_1101-2020_12_31_424971	347	59	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	347	60	;	;	:
10_1101-2020_12_31_424971	347	61	0.5	0.5	CD
10_1101-2020_12_31_424971	347	62	µM	µm	NN
10_1101-2020_12_31_424971	347	63	each	each	DT
10_1101-2020_12_31_424971	347	64	for	for	IN
10_1101-2020_12_31_424971	347	65	the	the	DT
10_1101-2020_12_31_424971	347	66	aa	aa	NNP
10_1101-2020_12_31_424971	347	67	-	-	HYPH
10_1101-2020_12_31_424971	347	68	tRNAs	tRNAs	NNP
10_1101-2020_12_31_424971	347	69	;	;	:
10_1101-2020_12_31_424971	347	70	and	and	CC
10_1101-2020_12_31_424971	347	71	1	1	CD
10_1101-2020_12_31_424971	347	72	mM	mM	NNP
10_1101-2020_12_31_424971	347	73	for	for	IN
10_1101-2020_12_31_424971	347	74	GTP	GTP	NNP
10_1101-2020_12_31_424971	347	75	.	.	.
10_1101-2020_12_31_424971	348	1	For	for	IN
10_1101-2020_12_31_424971	348	2	tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	348	3	formation	formation	NN
10_1101-2020_12_31_424971	348	4	assays	assays	RB
10_1101-2020_12_31_424971	348	5	788	788	CD
10_1101-2020_12_31_424971	348	6	with	with	IN
10_1101-2020_12_31_424971	348	7	one	one	CD
10_1101-2020_12_31_424971	348	8	-	-	HYPH
10_1101-2020_12_31_424971	348	9	step	step	NN
10_1101-2020_12_31_424971	348	10	delivery	delivery	NN
10_1101-2020_12_31_424971	348	11	of	of	IN
10_1101-2020_12_31_424971	348	12	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	348	13	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	348	14	,	,	,
10_1101-2020_12_31_424971	348	15	tRNAVal-	tRNAVal-	NNP
10_1101-2020_12_31_424971	348	16	,	,	,
10_1101-2020_12_31_424971	348	17	and	and	CC
10_1101-2020_12_31_424971	348	18	tRNAArg	tRNAArg	NNP
10_1101-2020_12_31_424971	348	19	-	-	HYPH
10_1101-2020_12_31_424971	348	20	TCs	TCs	NNP
10_1101-2020_12_31_424971	348	21	to	to	IN
10_1101-2020_12_31_424971	348	22	the	the	DT
10_1101-2020_12_31_424971	348	23	70S	70S	NNP
10_1101-2020_12_31_424971	348	24	ICs	ic	NNS
10_1101-2020_12_31_424971	348	25	,	,	,
10_1101-2020_12_31_424971	348	26	the	the	DT
10_1101-2020_12_31_424971	348	27	yield	yield	NN
10_1101-2020_12_31_424971	348	28	789	789	CD
10_1101-2020_12_31_424971	348	29	of	of	IN
10_1101-2020_12_31_424971	348	30	fMPV	fMPV	NNP
10_1101-2020_12_31_424971	348	31	and	and	CC
10_1101-2020_12_31_424971	348	32	kfMPV	kfMPV	NNP
10_1101-2020_12_31_424971	348	33	,	,	,
10_1101-2020_12_31_424971	348	34	obs	obs	NN
10_1101-2020_12_31_424971	348	35	report	report	NN
10_1101-2020_12_31_424971	348	36	on	on	IN
10_1101-2020_12_31_424971	348	37	the	the	DT
10_1101-2020_12_31_424971	348	38	activity	activity	NN
10_1101-2020_12_31_424971	348	39	of	of	IN
10_1101-2020_12_31_424971	348	40	ribosomes	ribosome	NNS
10_1101-2020_12_31_424971	348	41	that	that	WDT
10_1101-2020_12_31_424971	348	42	shifted	shift	VBD
10_1101-2020_12_31_424971	348	43	to	to	IN
10_1101-2020_12_31_424971	348	44	the	the	DT
10_1101-2020_12_31_424971	348	45	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	348	46	,	,	,
10_1101-2020_12_31_424971	348	47	whereas	whereas	IN
10_1101-2020_12_31_424971	348	48	the	the	DT
10_1101-2020_12_31_424971	348	49	790	790	CD
10_1101-2020_12_31_424971	348	50	yield	yield	NN
10_1101-2020_12_31_424971	348	51	of	of	IN
10_1101-2020_12_31_424971	348	52	fMPR	fmpr	NN
10_1101-2020_12_31_424971	348	53	and	and	CC
10_1101-2020_12_31_424971	348	54	kfMPR	kfMPR	NNP
10_1101-2020_12_31_424971	348	55	,	,	,
10_1101-2020_12_31_424971	348	56	obs	obs	NN
10_1101-2020_12_31_424971	348	57	report	report	NN
10_1101-2020_12_31_424971	348	58	on	on	IN
10_1101-2020_12_31_424971	348	59	the	the	DT
10_1101-2020_12_31_424971	348	60	activity	activity	NN
10_1101-2020_12_31_424971	348	61	of	of	IN
10_1101-2020_12_31_424971	348	62	ribosomes	ribosome	NNS
10_1101-2020_12_31_424971	348	63	that	that	WDT
10_1101-2020_12_31_424971	348	64	remained	remain	VBD
10_1101-2020_12_31_424971	348	65	in	in	IN
10_1101-2020_12_31_424971	348	66	the	the	DT
10_1101-2020_12_31_424971	348	67	0-frame29,34	0-frame29,34	CD
10_1101-2020_12_31_424971	348	68	.	.	.
10_1101-2020_12_31_424971	349	1	791	791	CD
10_1101-2020_12_31_424971	349	2	We	-PRON-	PRP
10_1101-2020_12_31_424971	349	3	chose	choose	VBD
10_1101-2020_12_31_424971	349	4	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	349	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	349	6	to	to	TO
10_1101-2020_12_31_424971	349	7	maximize	maximize	VB
10_1101-2020_12_31_424971	349	8	its	-PRON-	PRP$
10_1101-2020_12_31_424971	349	9	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	349	10	efficiency	efficiency	NN
10_1101-2020_12_31_424971	349	11	but	but	CC
10_1101-2020_12_31_424971	349	12	native	native	JJ
10_1101-2020_12_31_424971	349	13	-	-	HYPH
10_1101-2020_12_31_424971	349	14	state	state	NN
10_1101-2020_12_31_424971	349	15	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	349	16	792	792	CD
10_1101-2020_12_31_424971	349	17	and	and	CC
10_1101-2020_12_31_424971	349	18	tRNAArg	tRNAArg	NNP
10_1101-2020_12_31_424971	349	19	to	to	TO
10_1101-2020_12_31_424971	349	20	prevent	prevent	VB
10_1101-2020_12_31_424971	349	21	them	-PRON-	PRP
10_1101-2020_12_31_424971	349	22	from	from	IN
10_1101-2020_12_31_424971	349	23	undergoing	undergo	VBG
10_1101-2020_12_31_424971	349	24	unwanted	unwanted	JJ
10_1101-2020_12_31_424971	349	25	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	349	26	(	(	-LRB-
10_1101-2020_12_31_424971	349	27	note	note	VB
10_1101-2020_12_31_424971	349	28	that	that	IN
10_1101-2020_12_31_424971	349	29	,	,	,
10_1101-2020_12_31_424971	349	30	for	for	IN
10_1101-2020_12_31_424971	349	31	simplicity	simplicity	NN
10_1101-2020_12_31_424971	349	32	,	,	,
10_1101-2020_12_31_424971	349	33	793	793	CD
10_1101-2020_12_31_424971	349	34	we	-PRON-	PRP
10_1101-2020_12_31_424971	349	35	have	have	VBP
10_1101-2020_12_31_424971	349	36	not	not	RB
10_1101-2020_12_31_424971	349	37	denoted	denote	VBN
10_1101-2020_12_31_424971	349	38	the	the	DT
10_1101-2020_12_31_424971	349	39	aminoacyl	aminoacyl	JJ
10_1101-2020_12_31_424971	349	40	or	or	CC
10_1101-2020_12_31_424971	349	41	dipeptidyl	dipeptidyl	JJ
10_1101-2020_12_31_424971	349	42	moieties	moiety	NNS
10_1101-2020_12_31_424971	349	43	of	of	IN
10_1101-2020_12_31_424971	349	44	the	the	DT
10_1101-2020_12_31_424971	349	45	tRNAs	trnas	CD
10_1101-2020_12_31_424971	349	46	)	)	-RRB-
10_1101-2020_12_31_424971	349	47	.	.	.
10_1101-2020_12_31_424971	350	1	Tripeptide	tripeptide	NN
10_1101-2020_12_31_424971	350	2	formation	formation	NN
10_1101-2020_12_31_424971	350	3	794	794	CD
10_1101-2020_12_31_424971	350	4	assays	assay	NNS
10_1101-2020_12_31_424971	350	5	with	with	IN
10_1101-2020_12_31_424971	350	6	two	two	CD
10_1101-2020_12_31_424971	350	7	-	-	HYPH
10_1101-2020_12_31_424971	350	8	step	step	NN
10_1101-2020_12_31_424971	350	9	delivery	delivery	NN
10_1101-2020_12_31_424971	350	10	of	of	IN
10_1101-2020_12_31_424971	350	11	TCs29	TCs29	NNS
10_1101-2020_12_31_424971	350	12	were	be	VBD
10_1101-2020_12_31_424971	350	13	performed	perform	VBN
10_1101-2020_12_31_424971	350	14	in	in	IN
10_1101-2020_12_31_424971	350	15	a	a	DT
10_1101-2020_12_31_424971	350	16	manner	manner	NN
10_1101-2020_12_31_424971	350	17	similar	similar	JJ
10_1101-2020_12_31_424971	350	18	to	to	IN
10_1101-2020_12_31_424971	350	19	those	those	DT
10_1101-2020_12_31_424971	350	20	with	with	IN
10_1101-2020_12_31_424971	350	21	one	one	CD
10_1101-2020_12_31_424971	350	22	-	-	HYPH
10_1101-2020_12_31_424971	350	23	step	step	NN
10_1101-2020_12_31_424971	350	24	795	795	CD
10_1101-2020_12_31_424971	350	25	delivery	delivery	NN
10_1101-2020_12_31_424971	350	26	of	of	IN
10_1101-2020_12_31_424971	350	27	TCs	tc	NNS
10_1101-2020_12_31_424971	350	28	,	,	,
10_1101-2020_12_31_424971	350	29	except	except	IN
10_1101-2020_12_31_424971	350	30	that	that	IN
10_1101-2020_12_31_424971	350	31	the	the	DT
10_1101-2020_12_31_424971	350	32	70S	70S	NNP
10_1101-2020_12_31_424971	350	33	ICs	ic	NNS
10_1101-2020_12_31_424971	350	34	were	be	VBD
10_1101-2020_12_31_424971	350	35	incubated	incubate	VBN
10_1101-2020_12_31_424971	350	36	with	with	IN
10_1101-2020_12_31_424971	350	37	a	a	DT
10_1101-2020_12_31_424971	350	38	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	350	39	or	or	CC
10_1101-2020_12_31_424971	350	40	ProL	ProL	NNP
10_1101-2020_12_31_424971	350	41	-	-	HYPH
10_1101-2020_12_31_424971	350	42	TC	TC	NNP
10_1101-2020_12_31_424971	350	43	and	and	CC
10_1101-2020_12_31_424971	350	44	2.0	2.0	CD
10_1101-2020_12_31_424971	350	45	µM	µM	NNP
10_1101-2020_12_31_424971	350	46	796	796	CD
10_1101-2020_12_31_424971	350	47	EF	EF	NNP
10_1101-2020_12_31_424971	350	48	-	-	HYPH
10_1101-2020_12_31_424971	350	49	G	G	NNP
10_1101-2020_12_31_424971	350	50	for	for	IN
10_1101-2020_12_31_424971	350	51	0.5	0.5	CD
10_1101-2020_12_31_424971	350	52	-	-	SYM
10_1101-2020_12_31_424971	350	53	10	10	CD
10_1101-2020_12_31_424971	350	54	min	min	NN
10_1101-2020_12_31_424971	350	55	,	,	,
10_1101-2020_12_31_424971	350	56	as	as	IN
10_1101-2020_12_31_424971	350	57	specified	specify	VBN
10_1101-2020_12_31_424971	350	58	,	,	,
10_1101-2020_12_31_424971	350	59	followed	follow	VBN
10_1101-2020_12_31_424971	350	60	by	by	IN
10_1101-2020_12_31_424971	350	61	manual	manual	JJ
10_1101-2020_12_31_424971	350	62	addition	addition	NN
10_1101-2020_12_31_424971	350	63	of	of	IN
10_1101-2020_12_31_424971	350	64	an	an	DT
10_1101-2020_12_31_424971	350	65	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	350	66	mixture	mixture	NN
10_1101-2020_12_31_424971	350	67	of	of	IN
10_1101-2020_12_31_424971	350	68	tRNAArg-	trnaarg-	NN
10_1101-2020_12_31_424971	350	69	797	797	CD
10_1101-2020_12_31_424971	350	70	and	and	CC
10_1101-2020_12_31_424971	350	71	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	350	72	-	-	HYPH
10_1101-2020_12_31_424971	350	73	TCs	TCs	NNP
10_1101-2020_12_31_424971	350	74	.	.	.
10_1101-2020_12_31_424971	351	1	Reactions	reaction	NNS
10_1101-2020_12_31_424971	351	2	were	be	VBD
10_1101-2020_12_31_424971	351	3	conducted	conduct	VBN
10_1101-2020_12_31_424971	351	4	at	at	IN
10_1101-2020_12_31_424971	351	5	20	20	CD
10_1101-2020_12_31_424971	351	6	°	°	NNS
10_1101-2020_12_31_424971	351	7	C	C	NNP
10_1101-2020_12_31_424971	351	8	unless	unless	IN
10_1101-2020_12_31_424971	351	9	otherwise	otherwise	RB
10_1101-2020_12_31_424971	351	10	specified	specify	VBN
10_1101-2020_12_31_424971	351	11	,	,	,
10_1101-2020_12_31_424971	351	12	and	and	CC
10_1101-2020_12_31_424971	351	13	were	be	VBD
10_1101-2020_12_31_424971	351	14	798	798	CD
10_1101-2020_12_31_424971	351	15	quenched	quench	VBN
10_1101-2020_12_31_424971	351	16	by	by	IN
10_1101-2020_12_31_424971	351	17	adding	add	VBG
10_1101-2020_12_31_424971	351	18	concentrated	concentrate	VBD
10_1101-2020_12_31_424971	351	19	KOH	KOH	NNP
10_1101-2020_12_31_424971	351	20	to	to	IN
10_1101-2020_12_31_424971	351	21	0.5	0.5	CD
10_1101-2020_12_31_424971	351	22	M.	M.	NNP
10_1101-2020_12_31_424971	351	23	After	after	IN
10_1101-2020_12_31_424971	351	24	a	a	DT
10_1101-2020_12_31_424971	351	25	brief	brief	JJ
10_1101-2020_12_31_424971	351	26	incubation	incubation	NN
10_1101-2020_12_31_424971	351	27	at	at	IN
10_1101-2020_12_31_424971	351	28	37	37	CD
10_1101-2020_12_31_424971	351	29	°	°	NNS
10_1101-2020_12_31_424971	351	30	C	C	NNP
10_1101-2020_12_31_424971	351	31	,	,	,
10_1101-2020_12_31_424971	351	32	aliquots	aliquot	NNS
10_1101-2020_12_31_424971	351	33	of	of	IN
10_1101-2020_12_31_424971	351	34	0.65	0.65	CD
10_1101-2020_12_31_424971	351	35	799	799	CD
10_1101-2020_12_31_424971	351	36	µL	µl	CD
10_1101-2020_12_31_424971	351	37	were	be	VBD
10_1101-2020_12_31_424971	351	38	spotted	spot	VBN
10_1101-2020_12_31_424971	351	39	onto	onto	IN
10_1101-2020_12_31_424971	351	40	a	a	DT
10_1101-2020_12_31_424971	351	41	cellulose	cellulose	NN
10_1101-2020_12_31_424971	351	42	-	-	HYPH
10_1101-2020_12_31_424971	351	43	backed	back	VBN
10_1101-2020_12_31_424971	351	44	plastic	plastic	NN
10_1101-2020_12_31_424971	351	45	TLC	tlc	NN
10_1101-2020_12_31_424971	351	46	sheet	sheet	NN
10_1101-2020_12_31_424971	351	47	and	and	CC
10_1101-2020_12_31_424971	351	48	electrophoresed	electrophorese	VBD
10_1101-2020_12_31_424971	351	49	at	at	IN
10_1101-2020_12_31_424971	351	50	1000	1000	CD
10_1101-2020_12_31_424971	351	51	V	v	NN
10_1101-2020_12_31_424971	351	52	in	in	IN
10_1101-2020_12_31_424971	351	53	800	800	CD
10_1101-2020_12_31_424971	351	54	PYRAC	pyrac	NN
10_1101-2020_12_31_424971	351	55	buffer	buffer	NN
10_1101-2020_12_31_424971	351	56	(	(	-LRB-
10_1101-2020_12_31_424971	351	57	62	62	CD
10_1101-2020_12_31_424971	351	58	mM	mM	NNP
10_1101-2020_12_31_424971	351	59	pyridine	pyridine	JJ
10_1101-2020_12_31_424971	351	60	,	,	,
10_1101-2020_12_31_424971	351	61	3.48	3.48	CD
10_1101-2020_12_31_424971	351	62	M	M	NNP
10_1101-2020_12_31_424971	351	63	acetic	acetic	JJ
10_1101-2020_12_31_424971	351	64	acid	acid	NN
10_1101-2020_12_31_424971	351	65	,	,	,
10_1101-2020_12_31_424971	351	66	pH	pH	NNP
10_1101-2020_12_31_424971	351	67	2.7	2.7	CD
10_1101-2020_12_31_424971	351	68	)	)	-RRB-
10_1101-2020_12_31_424971	351	69	until	until	IN
10_1101-2020_12_31_424971	351	70	the	the	DT
10_1101-2020_12_31_424971	351	71	marker	marker	NN
10_1101-2020_12_31_424971	351	72	dye	dye	NN
10_1101-2020_12_31_424971	351	73	bromophenol	bromophenol	NN
10_1101-2020_12_31_424971	351	74	801	801	CD
10_1101-2020_12_31_424971	351	75	blue	blue	JJ
10_1101-2020_12_31_424971	351	76	reached	reach	VBD
10_1101-2020_12_31_424971	351	77	the	the	DT
10_1101-2020_12_31_424971	351	78	water	water	NN
10_1101-2020_12_31_424971	351	79	-	-	HYPH
10_1101-2020_12_31_424971	351	80	oil	oil	NN
10_1101-2020_12_31_424971	351	81	interface	interface	NN
10_1101-2020_12_31_424971	351	82	at	at	IN
10_1101-2020_12_31_424971	351	83	the	the	DT
10_1101-2020_12_31_424971	351	84	anode29	anode29	NNS
10_1101-2020_12_31_424971	351	85	.	.	.
10_1101-2020_12_31_424971	352	1	The	the	DT
10_1101-2020_12_31_424971	352	2	position	position	NN
10_1101-2020_12_31_424971	352	3	of	of	IN
10_1101-2020_12_31_424971	352	4	the	the	DT
10_1101-2020_12_31_424971	352	5	origin	origin	NN
10_1101-2020_12_31_424971	352	6	was	be	VBD
10_1101-2020_12_31_424971	352	7	adjusted	adjust	VBN
10_1101-2020_12_31_424971	352	8	to	to	IN
10_1101-2020_12_31_424971	352	9	802	802	CD
10_1101-2020_12_31_424971	352	10	maximize	maximize	NN
10_1101-2020_12_31_424971	352	11	separation	separation	NN
10_1101-2020_12_31_424971	352	12	of	of	IN
10_1101-2020_12_31_424971	352	13	the	the	DT
10_1101-2020_12_31_424971	352	14	expected	expect	VBN
10_1101-2020_12_31_424971	352	15	oligopeptide	oligopeptide	IN
10_1101-2020_12_31_424971	352	16	products	product	NNS
10_1101-2020_12_31_424971	352	17	.	.	.
10_1101-2020_12_31_424971	353	1	The	the	DT
10_1101-2020_12_31_424971	353	2	separation	separation	NN
10_1101-2020_12_31_424971	353	3	of	of	IN
10_1101-2020_12_31_424971	353	4	unreacted	unreacted	JJ
10_1101-2020_12_31_424971	353	5	[	[	-LRB-
10_1101-2020_12_31_424971	353	6	35S]-803	35s]-803	CD
10_1101-2020_12_31_424971	353	7	.CC	.CC	NFP
10_1101-2020_12_31_424971	353	8	-	-	HYPH
10_1101-2020_12_31_424971	353	9	BY	by	IN
10_1101-2020_12_31_424971	353	10	-	-	HYPH
10_1101-2020_12_31_424971	353	11	NC	NC	NNP
10_1101-2020_12_31_424971	353	12	-	-	HYPH
10_1101-2020_12_31_424971	353	13	ND	ND	NNP
10_1101-2020_12_31_424971	353	14	4.0	4.0	CD
10_1101-2020_12_31_424971	353	15	International	International	NNP
10_1101-2020_12_31_424971	353	16	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	353	17	under	under	IN
10_1101-2020_12_31_424971	353	18	a	a	DT
10_1101-2020_12_31_424971	353	19	(	(	-LRB-
10_1101-2020_12_31_424971	353	20	which	which	WDT
10_1101-2020_12_31_424971	353	21	was	be	VBD
10_1101-2020_12_31_424971	353	22	not	not	RB
10_1101-2020_12_31_424971	353	23	certified	certify	VBN
10_1101-2020_12_31_424971	353	24	by	by	IN
10_1101-2020_12_31_424971	353	25	peer	peer	NN
10_1101-2020_12_31_424971	353	26	review	review	NN
10_1101-2020_12_31_424971	353	27	)	)	-RRB-
10_1101-2020_12_31_424971	353	28	is	be	VBZ
10_1101-2020_12_31_424971	353	29	the	the	DT
10_1101-2020_12_31_424971	353	30	author	author	NN
10_1101-2020_12_31_424971	353	31	/	/	SYM
10_1101-2020_12_31_424971	353	32	funder	funder	NN
10_1101-2020_12_31_424971	353	33	,	,	,
10_1101-2020_12_31_424971	353	34	who	who	WP
10_1101-2020_12_31_424971	353	35	has	have	VBZ
10_1101-2020_12_31_424971	353	36	granted	grant	VBN
10_1101-2020_12_31_424971	353	37	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	353	38	a	a	DT
10_1101-2020_12_31_424971	353	39	license	license	NN
10_1101-2020_12_31_424971	353	40	to	to	TO
10_1101-2020_12_31_424971	353	41	display	display	VB
10_1101-2020_12_31_424971	353	42	the	the	DT
10_1101-2020_12_31_424971	353	43	preprint	preprint	NN
10_1101-2020_12_31_424971	353	44	in	in	IN
10_1101-2020_12_31_424971	353	45	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	353	46	.	.	.
10_1101-2020_12_31_424971	354	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	354	2	is	be	VBZ
10_1101-2020_12_31_424971	354	3	made	make	VBN
10_1101-2020_12_31_424971	354	4	The	the	DT
10_1101-2020_12_31_424971	354	5	copyright	copyright	NN
10_1101-2020_12_31_424971	354	6	holder	holder	NN
10_1101-2020_12_31_424971	354	7	for	for	IN
10_1101-2020_12_31_424971	354	8	this	this	DT
10_1101-2020_12_31_424971	354	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	354	10	version	version	NN
10_1101-2020_12_31_424971	354	11	posted	post	VBD
10_1101-2020_12_31_424971	354	12	January	January	NNP
10_1101-2020_12_31_424971	354	13	2	2	CD
10_1101-2020_12_31_424971	354	14	,	,	,
10_1101-2020_12_31_424971	354	15	2021	2021	CD
10_1101-2020_12_31_424971	354	16	.	.	.
10_1101-2020_12_31_424971	354	17	;	;	:
10_1101-2020_12_31_424971	354	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	354	19	:	:	:
10_1101-2020_12_31_424971	354	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	354	21	preprint	preprint	NN
10_1101-2020_12_31_424971	354	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	354	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	354	24	33	33	CD
10_1101-2020_12_31_424971	354	25	fMet	fMet	NNP
10_1101-2020_12_31_424971	354	26	and	and	CC
10_1101-2020_12_31_424971	354	27	each	each	DT
10_1101-2020_12_31_424971	354	28	of	of	IN
10_1101-2020_12_31_424971	354	29	the	the	DT
10_1101-2020_12_31_424971	354	30	[	[	-LRB-
10_1101-2020_12_31_424971	354	31	35S]-fMet	35s]-fmet	CD
10_1101-2020_12_31_424971	354	32	-	-	HYPH
10_1101-2020_12_31_424971	354	33	peptide	peptide	NN
10_1101-2020_12_31_424971	354	34	products	product	NNS
10_1101-2020_12_31_424971	354	35	was	be	VBD
10_1101-2020_12_31_424971	354	36	visualized	visualize	VBN
10_1101-2020_12_31_424971	354	37	by	by	IN
10_1101-2020_12_31_424971	354	38	phosphorimaging	phosphorimage	VBG
10_1101-2020_12_31_424971	354	39	and	and	CC
10_1101-2020_12_31_424971	354	40	804	804	CD
10_1101-2020_12_31_424971	354	41	quantified	quantify	VBN
10_1101-2020_12_31_424971	354	42	using	use	VBG
10_1101-2020_12_31_424971	354	43	ImageQuant	ImageQuant	NNP
10_1101-2020_12_31_424971	354	44	(	(	-LRB-
10_1101-2020_12_31_424971	354	45	GE	GE	NNP
10_1101-2020_12_31_424971	354	46	Healthcare	Healthcare	NNP
10_1101-2020_12_31_424971	354	47	)	)	-RRB-
10_1101-2020_12_31_424971	354	48	and	and	CC
10_1101-2020_12_31_424971	354	49	kinetic	kinetic	JJ
10_1101-2020_12_31_424971	354	50	plots	plot	NNS
10_1101-2020_12_31_424971	354	51	were	be	VBD
10_1101-2020_12_31_424971	354	52	fitted	fit	VBN
10_1101-2020_12_31_424971	354	53	using	use	VBG
10_1101-2020_12_31_424971	354	54	Kaleidagraph	Kaleidagraph	NNP
10_1101-2020_12_31_424971	354	55	805	805	CD
10_1101-2020_12_31_424971	354	56	(	(	-LRB-
10_1101-2020_12_31_424971	354	57	Synergy	Synergy	NNP
10_1101-2020_12_31_424971	354	58	software	software	NN
10_1101-2020_12_31_424971	354	59	)	)	-RRB-
10_1101-2020_12_31_424971	354	60	.	.	.
10_1101-2020_12_31_424971	355	1	806	806	CD
10_1101-2020_12_31_424971	355	2	807	807	CD
10_1101-2020_12_31_424971	355	3	Assembly	Assembly	NNP
10_1101-2020_12_31_424971	355	4	and	and	CC
10_1101-2020_12_31_424971	355	5	purification	purification	NN
10_1101-2020_12_31_424971	355	6	of	of	IN
10_1101-2020_12_31_424971	355	7	70S	70S	NNP
10_1101-2020_12_31_424971	355	8	ICs	ic	NNS
10_1101-2020_12_31_424971	355	9	,	,	,
10_1101-2020_12_31_424971	355	10	TCs	tc	NNS
10_1101-2020_12_31_424971	355	11	,	,	,
10_1101-2020_12_31_424971	355	12	POST	POST	NNP
10_1101-2020_12_31_424971	355	13	,	,	,
10_1101-2020_12_31_424971	355	14	and	and	CC
10_1101-2020_12_31_424971	355	15	PRE	PRE	NNP
10_1101-2020_12_31_424971	355	16	–	–	:
10_1101-2020_12_31_424971	355	17	A	a	DT
10_1101-2020_12_31_424971	355	18	complexes	complex	NNS
10_1101-2020_12_31_424971	355	19	for	for	IN
10_1101-2020_12_31_424971	355	20	use	use	NN
10_1101-2020_12_31_424971	355	21	in	in	IN
10_1101-2020_12_31_424971	355	22	smFRET	smfret	$
10_1101-2020_12_31_424971	355	23	808	808	CD
10_1101-2020_12_31_424971	355	24	experiments	experiment	NNS
10_1101-2020_12_31_424971	355	25	.	.	.
10_1101-2020_12_31_424971	356	1	70S	70s	CD
10_1101-2020_12_31_424971	356	2	ICs	ic	NNS
10_1101-2020_12_31_424971	356	3	were	be	VBD
10_1101-2020_12_31_424971	356	4	assembled	assemble	VBN
10_1101-2020_12_31_424971	356	5	in	in	IN
10_1101-2020_12_31_424971	356	6	a	a	DT
10_1101-2020_12_31_424971	356	7	manner	manner	NN
10_1101-2020_12_31_424971	356	8	analogous	analogous	JJ
10_1101-2020_12_31_424971	356	9	to	to	IN
10_1101-2020_12_31_424971	356	10	those	those	DT
10_1101-2020_12_31_424971	356	11	for	for	IN
10_1101-2020_12_31_424971	356	12	the	the	DT
10_1101-2020_12_31_424971	356	13	ensemble	ensemble	JJ
10_1101-2020_12_31_424971	356	14	rapid	rapid	JJ
10_1101-2020_12_31_424971	356	15	809	809	CD
10_1101-2020_12_31_424971	356	16	kinetic	kinetic	JJ
10_1101-2020_12_31_424971	356	17	studies	study	NNS
10_1101-2020_12_31_424971	356	18	described	describe	VBN
10_1101-2020_12_31_424971	356	19	above	above	RB
10_1101-2020_12_31_424971	356	20	,	,	,
10_1101-2020_12_31_424971	356	21	except	except	IN
10_1101-2020_12_31_424971	356	22	that	that	IN
10_1101-2020_12_31_424971	356	23	the	the	DT
10_1101-2020_12_31_424971	356	24	mRNA	mrna	NN
10_1101-2020_12_31_424971	356	25	containing	contain	VBG
10_1101-2020_12_31_424971	356	26	an	an	DT
10_1101-2020_12_31_424971	356	27	AUG	AUG	NNP
10_1101-2020_12_31_424971	356	28	-	-	HYPH
10_1101-2020_12_31_424971	356	29	CCC	CCC	NNP
10_1101-2020_12_31_424971	356	30	-	-	HYPH
10_1101-2020_12_31_424971	356	31	CGU	CGU	NNP
10_1101-2020_12_31_424971	356	32	-	-	HYPH
10_1101-2020_12_31_424971	356	33	U	u	NN
10_1101-2020_12_31_424971	356	34	coding	code	VBG
10_1101-2020_12_31_424971	356	35	810	810	CD
10_1101-2020_12_31_424971	356	36	sequence	sequence	NN
10_1101-2020_12_31_424971	356	37	was	be	VBD
10_1101-2020_12_31_424971	356	38	5'-biotinylated	5'-biotinylate	VBN
10_1101-2020_12_31_424971	356	39	and	and	CC
10_1101-2020_12_31_424971	356	40	the	the	DT
10_1101-2020_12_31_424971	356	41	50S	50S	NNP
10_1101-2020_12_31_424971	356	42	subunits	subunit	NNS
10_1101-2020_12_31_424971	356	43	were	be	VBD
10_1101-2020_12_31_424971	356	44	labeled	label	VBN
10_1101-2020_12_31_424971	356	45	with	with	IN
10_1101-2020_12_31_424971	356	46	bL9(Cy3	bl9(cy3	NN
10_1101-2020_12_31_424971	356	47	)	)	-RRB-
10_1101-2020_12_31_424971	356	48	and	and	CC
10_1101-2020_12_31_424971	356	49	uL1(Cy5	ul1(cy5	NN
10_1101-2020_12_31_424971	356	50	)	)	-RRB-
10_1101-2020_12_31_424971	356	51	.	.	.
10_1101-2020_12_31_424971	357	1	811	811	CD
10_1101-2020_12_31_424971	357	2	More	more	RBR
10_1101-2020_12_31_424971	357	3	specifically	specifically	RB
10_1101-2020_12_31_424971	357	4	,	,	,
10_1101-2020_12_31_424971	357	5	70S	70S	NNP
10_1101-2020_12_31_424971	357	6	ICs	ic	NNS
10_1101-2020_12_31_424971	357	7	were	be	VBD
10_1101-2020_12_31_424971	357	8	assembled	assemble	VBN
10_1101-2020_12_31_424971	357	9	in	in	IN
10_1101-2020_12_31_424971	357	10	three	three	CD
10_1101-2020_12_31_424971	357	11	steps	step	NNS
10_1101-2020_12_31_424971	357	12	.	.	.
10_1101-2020_12_31_424971	358	1	First	first	RB
10_1101-2020_12_31_424971	358	2	,	,	,
10_1101-2020_12_31_424971	358	3	15	15	CD
10_1101-2020_12_31_424971	358	4	pmol	pmol	NN
10_1101-2020_12_31_424971	358	5	of	of	IN
10_1101-2020_12_31_424971	358	6	30S	30s	CD
10_1101-2020_12_31_424971	358	7	subunits	subunit	NNS
10_1101-2020_12_31_424971	358	8	,	,	,
10_1101-2020_12_31_424971	358	9	27	27	CD
10_1101-2020_12_31_424971	358	10	pmol	pmol	NN
10_1101-2020_12_31_424971	358	11	812	812	CD
10_1101-2020_12_31_424971	358	12	of	of	IN
10_1101-2020_12_31_424971	358	13	IF1	IF1	NNP
10_1101-2020_12_31_424971	358	14	,	,	,
10_1101-2020_12_31_424971	358	15	27	27	CD
10_1101-2020_12_31_424971	358	16	pmol	pmol	NN
10_1101-2020_12_31_424971	358	17	of	of	IN
10_1101-2020_12_31_424971	358	18	IF2	IF2	NNP
10_1101-2020_12_31_424971	358	19	,	,	,
10_1101-2020_12_31_424971	358	20	27	27	CD
10_1101-2020_12_31_424971	358	21	pmol	pmol	NN
10_1101-2020_12_31_424971	358	22	of	of	IN
10_1101-2020_12_31_424971	358	23	IF3	IF3	NNP
10_1101-2020_12_31_424971	358	24	,	,	,
10_1101-2020_12_31_424971	358	25	18	18	CD
10_1101-2020_12_31_424971	358	26	nmol	nmol	NN
10_1101-2020_12_31_424971	358	27	of	of	IN
10_1101-2020_12_31_424971	358	28	GTP	GTP	NNP
10_1101-2020_12_31_424971	358	29	,	,	,
10_1101-2020_12_31_424971	358	30	and	and	CC
10_1101-2020_12_31_424971	358	31	25	25	CD
10_1101-2020_12_31_424971	358	32	pmol	pmol	NN
10_1101-2020_12_31_424971	358	33	of	of	IN
10_1101-2020_12_31_424971	358	34	biotin	biotin	NN
10_1101-2020_12_31_424971	358	35	-	-	HYPH
10_1101-2020_12_31_424971	358	36	mRNA	mrna	NN
10_1101-2020_12_31_424971	358	37	in	in	IN
10_1101-2020_12_31_424971	358	38	7	7	CD
10_1101-2020_12_31_424971	358	39	µL	µL	NNP
10_1101-2020_12_31_424971	358	40	of	of	IN
10_1101-2020_12_31_424971	358	41	813	813	CD
10_1101-2020_12_31_424971	358	42	Tris	Tris	NNP
10_1101-2020_12_31_424971	358	43	-	-	HYPH
10_1101-2020_12_31_424971	358	44	Polymix	Polymix	NNP
10_1101-2020_12_31_424971	358	45	Buffer	Buffer	NNP
10_1101-2020_12_31_424971	358	46	(	(	-LRB-
10_1101-2020_12_31_424971	358	47	50	50	CD
10_1101-2020_12_31_424971	358	48	mM	mm	NN
10_1101-2020_12_31_424971	358	49	Tris-(hydroxymethyl)-aminomethane	tris-(hydroxymethyl)-aminomethane	NN
10_1101-2020_12_31_424971	358	50	acetate	acetate	NN
10_1101-2020_12_31_424971	358	51	(	(	-LRB-
10_1101-2020_12_31_424971	358	52	Tris	Tris	NNP
10_1101-2020_12_31_424971	358	53	-	-	HYPH
10_1101-2020_12_31_424971	358	54	OAc	OAc	NNP
10_1101-2020_12_31_424971	358	55	)	)	-RRB-
10_1101-2020_12_31_424971	358	56	(	(	-LRB-
10_1101-2020_12_31_424971	358	57	pH25	pH25	JJR
10_1101-2020_12_31_424971	358	58	°	°	NNP
10_1101-2020_12_31_424971	358	59	C	C	NNP
10_1101-2020_12_31_424971	358	60	=	=	SYM
10_1101-2020_12_31_424971	358	61	814	814	CD
10_1101-2020_12_31_424971	358	62	7.0	7.0	CD
10_1101-2020_12_31_424971	358	63	)	)	-RRB-
10_1101-2020_12_31_424971	358	64	,	,	,
10_1101-2020_12_31_424971	358	65	100	100	CD
10_1101-2020_12_31_424971	358	66	mM	mM	NNP
10_1101-2020_12_31_424971	358	67	KCl	KCl	NNS
10_1101-2020_12_31_424971	358	68	,	,	,
10_1101-2020_12_31_424971	358	69	5	5	CD
10_1101-2020_12_31_424971	358	70	mM	mm	NN
10_1101-2020_12_31_424971	358	71	NH4OAc	NH4OAc	NNS
10_1101-2020_12_31_424971	358	72	,	,	,
10_1101-2020_12_31_424971	358	73	0.5	0.5	CD
10_1101-2020_12_31_424971	358	74	mM	mm	NN
10_1101-2020_12_31_424971	358	75	Ca(OAc)2	ca(oac)2	NN
10_1101-2020_12_31_424971	358	76	,	,	,
10_1101-2020_12_31_424971	358	77	0.1	0.1	CD
10_1101-2020_12_31_424971	358	78	mM	mm	NN
10_1101-2020_12_31_424971	358	79	EDTA	edta	NN
10_1101-2020_12_31_424971	358	80	,	,	,
10_1101-2020_12_31_424971	358	81	10	10	CD
10_1101-2020_12_31_424971	358	82	mM	mm	NN
10_1101-2020_12_31_424971	358	83	2-mercaptoethanol	2-mercaptoethanol	CD
10_1101-2020_12_31_424971	358	84	815	815	CD
10_1101-2020_12_31_424971	358	85	(	(	-LRB-
10_1101-2020_12_31_424971	358	86	BME	BME	NNP
10_1101-2020_12_31_424971	358	87	)	)	-RRB-
10_1101-2020_12_31_424971	358	88	,	,	,
10_1101-2020_12_31_424971	358	89	5	5	CD
10_1101-2020_12_31_424971	358	90	mM	mM	NNP
10_1101-2020_12_31_424971	358	91	putrescine	putrescine	NN
10_1101-2020_12_31_424971	358	92	dihydrochloride	dihydrochloride	NN
10_1101-2020_12_31_424971	358	93	,	,	,
10_1101-2020_12_31_424971	358	94	and	and	CC
10_1101-2020_12_31_424971	358	95	1	1	CD
10_1101-2020_12_31_424971	358	96	mM	mM	NNP
10_1101-2020_12_31_424971	358	97	spermidine	spermidine	NN
10_1101-2020_12_31_424971	358	98	(	(	-LRB-
10_1101-2020_12_31_424971	358	99	free	free	JJ
10_1101-2020_12_31_424971	358	100	base	base	NN
10_1101-2020_12_31_424971	358	101	)	)	-RRB-
10_1101-2020_12_31_424971	358	102	)	)	-RRB-
10_1101-2020_12_31_424971	358	103	at	at	IN
10_1101-2020_12_31_424971	358	104	5	5	CD
10_1101-2020_12_31_424971	358	105	mM	mm	NN
10_1101-2020_12_31_424971	358	106	Mg(OAc)2	mg(oac)2	NN
10_1101-2020_12_31_424971	358	107	816	816	CD
10_1101-2020_12_31_424971	358	108	were	be	VBD
10_1101-2020_12_31_424971	358	109	incubated	incubate	VBN
10_1101-2020_12_31_424971	358	110	for	for	IN
10_1101-2020_12_31_424971	358	111	10	10	CD
10_1101-2020_12_31_424971	358	112	min	min	NN
10_1101-2020_12_31_424971	358	113	at	at	IN
10_1101-2020_12_31_424971	358	114	37	37	CD
10_1101-2020_12_31_424971	358	115	ºC.	ºC.	NNS
10_1101-2020_12_31_424971	359	1	Then	then	RB
10_1101-2020_12_31_424971	359	2	20	20	CD
10_1101-2020_12_31_424971	359	3	pmol	pmol	NN
10_1101-2020_12_31_424971	359	4	of	of	IN
10_1101-2020_12_31_424971	359	5	fMet	fMet	NNP
10_1101-2020_12_31_424971	359	6	-	-	HYPH
10_1101-2020_12_31_424971	359	7	tRNAfMet	tRNAfMet	NNP
10_1101-2020_12_31_424971	359	8	in	in	IN
10_1101-2020_12_31_424971	359	9	2	2	CD
10_1101-2020_12_31_424971	359	10	µL	µl	CD
10_1101-2020_12_31_424971	359	11	of	of	IN
10_1101-2020_12_31_424971	359	12	10	10	CD
10_1101-2020_12_31_424971	359	13	mM	mM	NNP
10_1101-2020_12_31_424971	359	14	KOAc	KOAc	NNS
10_1101-2020_12_31_424971	359	15	(	(	-LRB-
10_1101-2020_12_31_424971	359	16	pH	ph	NN
10_1101-2020_12_31_424971	359	17	=	=	SYM
10_1101-2020_12_31_424971	359	18	817	817	CD
10_1101-2020_12_31_424971	359	19	5	5	CD
10_1101-2020_12_31_424971	359	20	)	)	-RRB-
10_1101-2020_12_31_424971	359	21	was	be	VBD
10_1101-2020_12_31_424971	359	22	added	add	VBN
10_1101-2020_12_31_424971	359	23	to	to	IN
10_1101-2020_12_31_424971	359	24	the	the	DT
10_1101-2020_12_31_424971	359	25	reaction	reaction	NN
10_1101-2020_12_31_424971	359	26	,	,	,
10_1101-2020_12_31_424971	359	27	followed	follow	VBN
10_1101-2020_12_31_424971	359	28	by	by	IN
10_1101-2020_12_31_424971	359	29	an	an	DT
10_1101-2020_12_31_424971	359	30	additional	additional	JJ
10_1101-2020_12_31_424971	359	31	incubation	incubation	NN
10_1101-2020_12_31_424971	359	32	of	of	IN
10_1101-2020_12_31_424971	359	33	10	10	CD
10_1101-2020_12_31_424971	359	34	min	min	NN
10_1101-2020_12_31_424971	359	35	at	at	IN
10_1101-2020_12_31_424971	359	36	37	37	CD
10_1101-2020_12_31_424971	359	37	ºC.	ºC.	NNS
10_1101-2020_12_31_424971	360	1	Finally	finally	RB
10_1101-2020_12_31_424971	360	2	,	,	,
10_1101-2020_12_31_424971	360	3	10	10	CD
10_1101-2020_12_31_424971	360	4	818	818	CD
10_1101-2020_12_31_424971	360	5	pmol	pmol	NN
10_1101-2020_12_31_424971	360	6	of	of	IN
10_1101-2020_12_31_424971	360	7	bL9(Cy3)-	bL9(Cy3)-	NNS
10_1101-2020_12_31_424971	360	8	and	and	CC
10_1101-2020_12_31_424971	360	9	uL1(Cy5)-labeled	ul1(cy5)-labeled	CD
10_1101-2020_12_31_424971	360	10	50S	50s	CD
10_1101-2020_12_31_424971	360	11	subunits	subunit	NNS
10_1101-2020_12_31_424971	360	12	in	in	IN
10_1101-2020_12_31_424971	360	13	1	1	CD
10_1101-2020_12_31_424971	360	14	µL	µl	CD
10_1101-2020_12_31_424971	360	15	of	of	IN
10_1101-2020_12_31_424971	360	16	Reconstitution	Reconstitution	NNP
10_1101-2020_12_31_424971	360	17	Buffer	Buffer	NNP
10_1101-2020_12_31_424971	360	18	(	(	-LRB-
10_1101-2020_12_31_424971	360	19	20	20	CD
10_1101-2020_12_31_424971	360	20	mM	mm	NN
10_1101-2020_12_31_424971	360	21	819	819	CD
10_1101-2020_12_31_424971	360	22	Tris	Tris	NNP
10_1101-2020_12_31_424971	360	23	-	-	HYPH
10_1101-2020_12_31_424971	360	24	HCl	HCl	NNP
10_1101-2020_12_31_424971	360	25	(	(	-LRB-
10_1101-2020_12_31_424971	360	26	pH25	pH25	JJR
10_1101-2020_12_31_424971	360	27	°	°	NNP
10_1101-2020_12_31_424971	360	28	C	C	NNP
10_1101-2020_12_31_424971	360	29	=	=	SYM
10_1101-2020_12_31_424971	360	30	7.8	7.8	CD
10_1101-2020_12_31_424971	360	31	)	)	-RRB-
10_1101-2020_12_31_424971	360	32	,	,	,
10_1101-2020_12_31_424971	360	33	8	8	CD
10_1101-2020_12_31_424971	360	34	mM	mm	NN
10_1101-2020_12_31_424971	360	35	Mg(OAc)2	mg(oac)2	NN
10_1101-2020_12_31_424971	360	36	,	,	,
10_1101-2020_12_31_424971	360	37	150	150	CD
10_1101-2020_12_31_424971	360	38	mM	mm	NN
10_1101-2020_12_31_424971	360	39	NH4Cl	nh4cl	CD
10_1101-2020_12_31_424971	360	40	,	,	,
10_1101-2020_12_31_424971	360	41	0.2	0.2	CD
10_1101-2020_12_31_424971	360	42	mM	mm	NN
10_1101-2020_12_31_424971	360	43	EDTA	edta	NN
10_1101-2020_12_31_424971	360	44	,	,	,
10_1101-2020_12_31_424971	360	45	and	and	CC
10_1101-2020_12_31_424971	360	46	5	5	CD
10_1101-2020_12_31_424971	360	47	mM	mm	NN
10_1101-2020_12_31_424971	360	48	BME	BME	NNP
10_1101-2020_12_31_424971	360	49	)	)	-RRB-
10_1101-2020_12_31_424971	360	50	was	be	VBD
10_1101-2020_12_31_424971	360	51	820	820	CD
10_1101-2020_12_31_424971	360	52	added	add	VBN
10_1101-2020_12_31_424971	360	53	to	to	IN
10_1101-2020_12_31_424971	360	54	the	the	DT
10_1101-2020_12_31_424971	360	55	reaction	reaction	NN
10_1101-2020_12_31_424971	360	56	to	to	TO
10_1101-2020_12_31_424971	360	57	give	give	VB
10_1101-2020_12_31_424971	360	58	a	a	DT
10_1101-2020_12_31_424971	360	59	final	final	JJ
10_1101-2020_12_31_424971	360	60	volume	volume	NN
10_1101-2020_12_31_424971	360	61	of	of	IN
10_1101-2020_12_31_424971	360	62	10	10	CD
10_1101-2020_12_31_424971	360	63	µL	µl	CD
10_1101-2020_12_31_424971	360	64	,	,	,
10_1101-2020_12_31_424971	360	65	followed	follow	VBN
10_1101-2020_12_31_424971	360	66	by	by	IN
10_1101-2020_12_31_424971	360	67	a	a	DT
10_1101-2020_12_31_424971	360	68	final	final	JJ
10_1101-2020_12_31_424971	360	69	incubation	incubation	NN
10_1101-2020_12_31_424971	360	70	of	of	IN
10_1101-2020_12_31_424971	360	71	10	10	CD
10_1101-2020_12_31_424971	360	72	min	min	NN
10_1101-2020_12_31_424971	360	73	at	at	IN
10_1101-2020_12_31_424971	360	74	821	821	CD
10_1101-2020_12_31_424971	360	75	37	37	CD
10_1101-2020_12_31_424971	360	76	ºC.	ºC.	NNS
10_1101-2020_12_31_424971	361	1	The	the	DT
10_1101-2020_12_31_424971	361	2	reaction	reaction	NN
10_1101-2020_12_31_424971	361	3	was	be	VBD
10_1101-2020_12_31_424971	361	4	then	then	RB
10_1101-2020_12_31_424971	361	5	adjusted	adjust	VBN
10_1101-2020_12_31_424971	361	6	to	to	IN
10_1101-2020_12_31_424971	361	7	100	100	CD
10_1101-2020_12_31_424971	361	8	µL	µL	NNP
10_1101-2020_12_31_424971	361	9	with	with	IN
10_1101-2020_12_31_424971	361	10	Tris	Tris	NNP
10_1101-2020_12_31_424971	361	11	-	-	HYPH
10_1101-2020_12_31_424971	361	12	Polymix	Polymix	NNP
10_1101-2020_12_31_424971	361	13	Buffer	Buffer	NNP
10_1101-2020_12_31_424971	361	14	at	at	IN
10_1101-2020_12_31_424971	361	15	20	20	CD
10_1101-2020_12_31_424971	361	16	mM	mm	NN
10_1101-2020_12_31_424971	361	17	Mg(OAc)2	mg(oac)2	NN
10_1101-2020_12_31_424971	361	18	,	,	,
10_1101-2020_12_31_424971	361	19	822	822	CD
10_1101-2020_12_31_424971	361	20	loaded	load	VBN
10_1101-2020_12_31_424971	361	21	onto	onto	IN
10_1101-2020_12_31_424971	361	22	a	a	DT
10_1101-2020_12_31_424971	361	23	10	10	CD
10_1101-2020_12_31_424971	361	24	-	-	SYM
10_1101-2020_12_31_424971	361	25	40	40	CD
10_1101-2020_12_31_424971	361	26	%	%	NN
10_1101-2020_12_31_424971	361	27	(	(	-LRB-
10_1101-2020_12_31_424971	361	28	w	w	NNP
10_1101-2020_12_31_424971	361	29	/	/	SYM
10_1101-2020_12_31_424971	361	30	v	v	NNP
10_1101-2020_12_31_424971	361	31	)	)	-RRB-
10_1101-2020_12_31_424971	361	32	sucrose	sucrose	JJ
10_1101-2020_12_31_424971	361	33	gradient	gradient	NN
10_1101-2020_12_31_424971	361	34	prepared	prepare	VBD
10_1101-2020_12_31_424971	361	35	in	in	IN
10_1101-2020_12_31_424971	361	36	Tris	Tris	NNP
10_1101-2020_12_31_424971	361	37	-	-	HYPH
10_1101-2020_12_31_424971	361	38	Polymix	Polymix	NNP
10_1101-2020_12_31_424971	361	39	Buffer	Buffer	NNP
10_1101-2020_12_31_424971	361	40	at	at	IN
10_1101-2020_12_31_424971	361	41	20	20	CD
10_1101-2020_12_31_424971	361	42	mM	mm	NN
10_1101-2020_12_31_424971	361	43	Mg(OAc)2	Mg(OAc)2	NNS
10_1101-2020_12_31_424971	361	44	,	,	,
10_1101-2020_12_31_424971	361	45	823	823	CD
10_1101-2020_12_31_424971	361	46	and	and	CC
10_1101-2020_12_31_424971	361	47	purified	purify	VBN
10_1101-2020_12_31_424971	361	48	by	by	IN
10_1101-2020_12_31_424971	361	49	sucrose	sucrose	JJ
10_1101-2020_12_31_424971	361	50	density	density	NN
10_1101-2020_12_31_424971	361	51	gradient	gradient	NNP
10_1101-2020_12_31_424971	361	52	ultracentrifugation	ultracentrifugation	NN
10_1101-2020_12_31_424971	361	53	to	to	TO
10_1101-2020_12_31_424971	361	54	remove	remove	VB
10_1101-2020_12_31_424971	361	55	any	any	DT
10_1101-2020_12_31_424971	361	56	free	free	JJ
10_1101-2020_12_31_424971	361	57	mRNA	mRNA	NNS
10_1101-2020_12_31_424971	361	58	,	,	,
10_1101-2020_12_31_424971	361	59	IFs	if	NNS
10_1101-2020_12_31_424971	361	60	,	,	,
10_1101-2020_12_31_424971	361	61	and	and	CC
10_1101-2020_12_31_424971	361	62	824	824	CD
10_1101-2020_12_31_424971	361	63	fMet	fMet	NNP
10_1101-2020_12_31_424971	361	64	-	-	HYPH
10_1101-2020_12_31_424971	361	65	tRNAfMet	tRNAfMet	NNP
10_1101-2020_12_31_424971	361	66	.	.	.
10_1101-2020_12_31_424971	362	1	Purified	Purified	NNP
10_1101-2020_12_31_424971	362	2	70S	70S	NNP
10_1101-2020_12_31_424971	362	3	ICs	ic	NNS
10_1101-2020_12_31_424971	362	4	were	be	VBD
10_1101-2020_12_31_424971	362	5	aliquoted	aliquote	VBN
10_1101-2020_12_31_424971	362	6	,	,	,
10_1101-2020_12_31_424971	362	7	flash	flash	NNP
10_1101-2020_12_31_424971	362	8	frozen	frozen	JJ
10_1101-2020_12_31_424971	362	9	in	in	IN
10_1101-2020_12_31_424971	362	10	liquid	liquid	JJ
10_1101-2020_12_31_424971	362	11	nitrogen	nitrogen	NN
10_1101-2020_12_31_424971	362	12	,	,	,
10_1101-2020_12_31_424971	362	13	and	and	CC
10_1101-2020_12_31_424971	362	14	stored	store	VBD
10_1101-2020_12_31_424971	362	15	at	at	IN
10_1101-2020_12_31_424971	362	16	–	–	:
10_1101-2020_12_31_424971	362	17	80	80	CD
10_1101-2020_12_31_424971	362	18	825	825	CD
10_1101-2020_12_31_424971	362	19	ºC	ºC	NNP
10_1101-2020_12_31_424971	362	20	until	until	IN
10_1101-2020_12_31_424971	362	21	use	use	NN
10_1101-2020_12_31_424971	362	22	in	in	IN
10_1101-2020_12_31_424971	362	23	smFRET	smfret	NN
10_1101-2020_12_31_424971	362	24	experiments	experiment	NNS
10_1101-2020_12_31_424971	362	25	.	.	.
10_1101-2020_12_31_424971	363	1	826	826	CD
10_1101-2020_12_31_424971	363	2	TCs	tc	NNS
10_1101-2020_12_31_424971	363	3	were	be	VBD
10_1101-2020_12_31_424971	363	4	prepared	prepare	VBN
10_1101-2020_12_31_424971	363	5	in	in	IN
10_1101-2020_12_31_424971	363	6	two	two	CD
10_1101-2020_12_31_424971	363	7	steps	step	NNS
10_1101-2020_12_31_424971	363	8	.	.	.
10_1101-2020_12_31_424971	364	1	First	first	RB
10_1101-2020_12_31_424971	364	2	,	,	,
10_1101-2020_12_31_424971	364	3	300	300	CD
10_1101-2020_12_31_424971	364	4	pmol	pmol	NN
10_1101-2020_12_31_424971	364	5	of	of	IN
10_1101-2020_12_31_424971	364	6	EF	EF	NNP
10_1101-2020_12_31_424971	364	7	-	-	HYPH
10_1101-2020_12_31_424971	364	8	Tu	Tu	NNP
10_1101-2020_12_31_424971	364	9	and	and	CC
10_1101-2020_12_31_424971	364	10	200	200	CD
10_1101-2020_12_31_424971	364	11	pmol	pmol	NN
10_1101-2020_12_31_424971	364	12	of	of	IN
10_1101-2020_12_31_424971	364	13	EF	EF	NNP
10_1101-2020_12_31_424971	364	14	-	-	HYPH
10_1101-2020_12_31_424971	364	15	Ts	Ts	NNP
10_1101-2020_12_31_424971	364	16	in	in	IN
10_1101-2020_12_31_424971	364	17	8	8	CD
10_1101-2020_12_31_424971	364	18	µL	µl	CD
10_1101-2020_12_31_424971	364	19	of	of	IN
10_1101-2020_12_31_424971	364	20	827	827	CD
10_1101-2020_12_31_424971	364	21	Tris	Tris	NNP
10_1101-2020_12_31_424971	364	22	-	-	HYPH
10_1101-2020_12_31_424971	364	23	Polymix	Polymix	NNP
10_1101-2020_12_31_424971	364	24	Buffer	Buffer	NNP
10_1101-2020_12_31_424971	364	25	at	at	IN
10_1101-2020_12_31_424971	364	26	5	5	CD
10_1101-2020_12_31_424971	364	27	mM	mm	NN
10_1101-2020_12_31_424971	364	28	Mg(OAc)2	mg(oac)2	NN
10_1101-2020_12_31_424971	364	29	supplemented	supplement	VBN
10_1101-2020_12_31_424971	364	30	with	with	IN
10_1101-2020_12_31_424971	364	31	GTP	GTP	NNP
10_1101-2020_12_31_424971	364	32	Charging	Charging	NNP
10_1101-2020_12_31_424971	364	33	Components	Components	NNPS
10_1101-2020_12_31_424971	364	34	(	(	-LRB-
10_1101-2020_12_31_424971	364	35	1	1	CD
10_1101-2020_12_31_424971	364	36	mM	mM	NNP
10_1101-2020_12_31_424971	364	37	828	828	CD
10_1101-2020_12_31_424971	364	38	GTP	GTP	NNP
10_1101-2020_12_31_424971	364	39	,	,	,
10_1101-2020_12_31_424971	364	40	3	3	CD
10_1101-2020_12_31_424971	364	41	mM	mM	NNP
10_1101-2020_12_31_424971	364	42	phosphoenolpyruvate	phosphoenolpyruvate	NN
10_1101-2020_12_31_424971	364	43	,	,	,
10_1101-2020_12_31_424971	364	44	and	and	CC
10_1101-2020_12_31_424971	364	45	2	2	CD
10_1101-2020_12_31_424971	364	46	units	unit	NNS
10_1101-2020_12_31_424971	364	47	/	/	SYM
10_1101-2020_12_31_424971	364	48	mL	mL	NNP
10_1101-2020_12_31_424971	364	49	pyruvate	pyruvate	NNP
10_1101-2020_12_31_424971	364	50	kinase	kinase	NN
10_1101-2020_12_31_424971	364	51	)	)	-RRB-
10_1101-2020_12_31_424971	364	52	were	be	VBD
10_1101-2020_12_31_424971	364	53	incubated	incubate	VBN
10_1101-2020_12_31_424971	364	54	for	for	IN
10_1101-2020_12_31_424971	364	55	1	1	CD
10_1101-2020_12_31_424971	364	56	min	min	NN
10_1101-2020_12_31_424971	364	57	at	at	IN
10_1101-2020_12_31_424971	364	58	829	829	CD
10_1101-2020_12_31_424971	364	59	.CC	.CC	,
10_1101-2020_12_31_424971	364	60	-	-	HYPH
10_1101-2020_12_31_424971	364	61	BY	by	IN
10_1101-2020_12_31_424971	364	62	-	-	HYPH
10_1101-2020_12_31_424971	364	63	NC	NC	NNP
10_1101-2020_12_31_424971	364	64	-	-	HYPH
10_1101-2020_12_31_424971	364	65	ND	ND	NNP
10_1101-2020_12_31_424971	364	66	4.0	4.0	CD
10_1101-2020_12_31_424971	364	67	International	International	NNP
10_1101-2020_12_31_424971	364	68	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	364	69	under	under	IN
10_1101-2020_12_31_424971	364	70	a	a	DT
10_1101-2020_12_31_424971	364	71	(	(	-LRB-
10_1101-2020_12_31_424971	364	72	which	which	WDT
10_1101-2020_12_31_424971	364	73	was	be	VBD
10_1101-2020_12_31_424971	364	74	not	not	RB
10_1101-2020_12_31_424971	364	75	certified	certify	VBN
10_1101-2020_12_31_424971	364	76	by	by	IN
10_1101-2020_12_31_424971	364	77	peer	peer	NN
10_1101-2020_12_31_424971	364	78	review	review	NN
10_1101-2020_12_31_424971	364	79	)	)	-RRB-
10_1101-2020_12_31_424971	364	80	is	be	VBZ
10_1101-2020_12_31_424971	364	81	the	the	DT
10_1101-2020_12_31_424971	364	82	author	author	NN
10_1101-2020_12_31_424971	364	83	/	/	SYM
10_1101-2020_12_31_424971	364	84	funder	funder	NN
10_1101-2020_12_31_424971	364	85	,	,	,
10_1101-2020_12_31_424971	364	86	who	who	WP
10_1101-2020_12_31_424971	364	87	has	have	VBZ
10_1101-2020_12_31_424971	364	88	granted	grant	VBN
10_1101-2020_12_31_424971	364	89	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	364	90	a	a	DT
10_1101-2020_12_31_424971	364	91	license	license	NN
10_1101-2020_12_31_424971	364	92	to	to	TO
10_1101-2020_12_31_424971	364	93	display	display	VB
10_1101-2020_12_31_424971	364	94	the	the	DT
10_1101-2020_12_31_424971	364	95	preprint	preprint	NN
10_1101-2020_12_31_424971	364	96	in	in	IN
10_1101-2020_12_31_424971	364	97	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	364	98	.	.	.
10_1101-2020_12_31_424971	365	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	365	2	is	be	VBZ
10_1101-2020_12_31_424971	365	3	made	make	VBN
10_1101-2020_12_31_424971	365	4	The	the	DT
10_1101-2020_12_31_424971	365	5	copyright	copyright	NN
10_1101-2020_12_31_424971	365	6	holder	holder	NN
10_1101-2020_12_31_424971	365	7	for	for	IN
10_1101-2020_12_31_424971	365	8	this	this	DT
10_1101-2020_12_31_424971	365	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	365	10	version	version	NN
10_1101-2020_12_31_424971	365	11	posted	post	VBD
10_1101-2020_12_31_424971	365	12	January	January	NNP
10_1101-2020_12_31_424971	365	13	2	2	CD
10_1101-2020_12_31_424971	365	14	,	,	,
10_1101-2020_12_31_424971	365	15	2021	2021	CD
10_1101-2020_12_31_424971	365	16	.	.	.
10_1101-2020_12_31_424971	365	17	;	;	:
10_1101-2020_12_31_424971	365	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	365	19	:	:	:
10_1101-2020_12_31_424971	365	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	365	21	preprint	preprint	NN
10_1101-2020_12_31_424971	365	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	365	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	365	24	34	34	CD
10_1101-2020_12_31_424971	365	25	37	37	CD
10_1101-2020_12_31_424971	365	26	ºC.	ºC.	NNS
10_1101-2020_12_31_424971	366	1	Then	then	RB
10_1101-2020_12_31_424971	366	2	,	,	,
10_1101-2020_12_31_424971	366	3	30	30	CD
10_1101-2020_12_31_424971	366	4	pmol	pmol	NN
10_1101-2020_12_31_424971	366	5	of	of	IN
10_1101-2020_12_31_424971	366	6	aa	aa	NNP
10_1101-2020_12_31_424971	366	7	-	-	HYPH
10_1101-2020_12_31_424971	366	8	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	366	9	in	in	IN
10_1101-2020_12_31_424971	366	10	2	2	CD
10_1101-2020_12_31_424971	366	11	µL	µl	CD
10_1101-2020_12_31_424971	366	12	of	of	IN
10_1101-2020_12_31_424971	366	13	25	25	CD
10_1101-2020_12_31_424971	366	14	mM	mM	NNP
10_1101-2020_12_31_424971	366	15	NaOAc	NaOAc	NNS
10_1101-2020_12_31_424971	366	16	(	(	-LRB-
10_1101-2020_12_31_424971	366	17	pH	pH	NNP
10_1101-2020_12_31_424971	366	18	=	=	SYM
10_1101-2020_12_31_424971	366	19	5	5	CD
10_1101-2020_12_31_424971	366	20	)	)	-RRB-
10_1101-2020_12_31_424971	366	21	was	be	VBD
10_1101-2020_12_31_424971	366	22	added	add	VBN
10_1101-2020_12_31_424971	366	23	to	to	IN
10_1101-2020_12_31_424971	366	24	the	the	DT
10_1101-2020_12_31_424971	366	25	reaction	reaction	NN
10_1101-2020_12_31_424971	366	26	,	,	,
10_1101-2020_12_31_424971	366	27	830	830	CD
10_1101-2020_12_31_424971	366	28	followed	follow	VBN
10_1101-2020_12_31_424971	366	29	by	by	IN
10_1101-2020_12_31_424971	366	30	an	an	DT
10_1101-2020_12_31_424971	366	31	additional	additional	JJ
10_1101-2020_12_31_424971	366	32	incubation	incubation	NN
10_1101-2020_12_31_424971	366	33	of	of	IN
10_1101-2020_12_31_424971	366	34	1	1	CD
10_1101-2020_12_31_424971	366	35	min	min	NN
10_1101-2020_12_31_424971	366	36	at	at	IN
10_1101-2020_12_31_424971	366	37	37	37	CD
10_1101-2020_12_31_424971	366	38	ºC.	ºC.	NNS
10_1101-2020_12_31_424971	367	1	This	this	DT
10_1101-2020_12_31_424971	367	2	results	result	VBZ
10_1101-2020_12_31_424971	367	3	in	in	IN
10_1101-2020_12_31_424971	367	4	a	a	DT
10_1101-2020_12_31_424971	367	5	TC	TC	NNP
10_1101-2020_12_31_424971	367	6	solution	solution	NN
10_1101-2020_12_31_424971	367	7	with	with	IN
10_1101-2020_12_31_424971	367	8	a	a	DT
10_1101-2020_12_31_424971	367	9	final	final	JJ
10_1101-2020_12_31_424971	367	10	831	831	CD
10_1101-2020_12_31_424971	367	11	volume	volume	NN
10_1101-2020_12_31_424971	367	12	of	of	IN
10_1101-2020_12_31_424971	367	13	10	10	CD
10_1101-2020_12_31_424971	367	14	µL	µL	.
10_1101-2020_12_31_424971	367	15	that	that	WDT
10_1101-2020_12_31_424971	367	16	was	be	VBD
10_1101-2020_12_31_424971	367	17	then	then	RB
10_1101-2020_12_31_424971	367	18	stored	store	VBN
10_1101-2020_12_31_424971	367	19	on	on	IN
10_1101-2020_12_31_424971	367	20	ice	ice	NN
10_1101-2020_12_31_424971	367	21	until	until	IN
10_1101-2020_12_31_424971	367	22	used	use	VBN
10_1101-2020_12_31_424971	367	23	for	for	IN
10_1101-2020_12_31_424971	367	24	smFRET	smfret	NN
10_1101-2020_12_31_424971	367	25	experiments	experiment	NNS
10_1101-2020_12_31_424971	367	26	.	.	.
10_1101-2020_12_31_424971	368	1	832	832	CD
10_1101-2020_12_31_424971	368	2	To	to	TO
10_1101-2020_12_31_424971	368	3	prepare	prepare	VB
10_1101-2020_12_31_424971	368	4	PRE	PRE	NNP
10_1101-2020_12_31_424971	368	5	–	–	:
10_1101-2020_12_31_424971	368	6	A	a	DT
10_1101-2020_12_31_424971	368	7	complexes	complex	NNS
10_1101-2020_12_31_424971	368	8	,	,	,
10_1101-2020_12_31_424971	368	9	we	-PRON-	PRP
10_1101-2020_12_31_424971	368	10	first	first	RB
10_1101-2020_12_31_424971	368	11	needed	need	VBD
10_1101-2020_12_31_424971	368	12	to	to	TO
10_1101-2020_12_31_424971	368	13	assemble	assemble	VB
10_1101-2020_12_31_424971	368	14	POST	POST	NNP
10_1101-2020_12_31_424971	368	15	complexes	complex	NNS
10_1101-2020_12_31_424971	368	16	.	.	.
10_1101-2020_12_31_424971	369	1	POST	POST	NNP
10_1101-2020_12_31_424971	369	2	833	833	CD
10_1101-2020_12_31_424971	369	3	complexes	complex	NNS
10_1101-2020_12_31_424971	369	4	were	be	VBD
10_1101-2020_12_31_424971	369	5	assembled	assemble	VBN
10_1101-2020_12_31_424971	369	6	by	by	IN
10_1101-2020_12_31_424971	369	7	first	first	RB
10_1101-2020_12_31_424971	369	8	preparing	prepare	VBG
10_1101-2020_12_31_424971	369	9	a	a	DT
10_1101-2020_12_31_424971	369	10	10-µL	10-µL	NNS
10_1101-2020_12_31_424971	369	11	solution	solution	NN
10_1101-2020_12_31_424971	369	12	of	of	IN
10_1101-2020_12_31_424971	369	13	70S	70S	NNP
10_1101-2020_12_31_424971	369	14	IC	IC	NNP
10_1101-2020_12_31_424971	369	15	and	and	CC
10_1101-2020_12_31_424971	369	16	a	a	DT
10_1101-2020_12_31_424971	369	17	10-µL	10-µl	JJ
10_1101-2020_12_31_424971	369	18	solution	solution	NN
10_1101-2020_12_31_424971	369	19	of	of	IN
10_1101-2020_12_31_424971	369	20	834	834	CD
10_1101-2020_12_31_424971	369	21	TC	TC	NNP
10_1101-2020_12_31_424971	369	22	as	as	IN
10_1101-2020_12_31_424971	369	23	described	describe	VBN
10_1101-2020_12_31_424971	369	24	above	above	RB
10_1101-2020_12_31_424971	369	25	.	.	.
10_1101-2020_12_31_424971	370	1	Separately	separately	RB
10_1101-2020_12_31_424971	370	2	,	,	,
10_1101-2020_12_31_424971	370	3	a	a	DT
10_1101-2020_12_31_424971	370	4	solution	solution	NN
10_1101-2020_12_31_424971	370	5	of	of	IN
10_1101-2020_12_31_424971	370	6	GTP	GTP	NNP
10_1101-2020_12_31_424971	370	7	-	-	HYPH
10_1101-2020_12_31_424971	370	8	bound	bind	VBN
10_1101-2020_12_31_424971	370	9	EF	EF	NNP
10_1101-2020_12_31_424971	370	10	-	-	HYPH
10_1101-2020_12_31_424971	370	11	G	G	NNP
10_1101-2020_12_31_424971	370	12	was	be	VBD
10_1101-2020_12_31_424971	370	13	prepared	prepare	VBN
10_1101-2020_12_31_424971	370	14	by	by	IN
10_1101-2020_12_31_424971	370	15	incubating	incubate	VBG
10_1101-2020_12_31_424971	370	16	835	835	CD
10_1101-2020_12_31_424971	370	17	120	120	CD
10_1101-2020_12_31_424971	370	18	pmol	pmol	NN
10_1101-2020_12_31_424971	370	19	EF	EF	NNP
10_1101-2020_12_31_424971	370	20	-	-	HYPH
10_1101-2020_12_31_424971	370	21	G	G	NNP
10_1101-2020_12_31_424971	370	22	in	in	IN
10_1101-2020_12_31_424971	370	23	5	5	CD
10_1101-2020_12_31_424971	370	24	µL	µl	CD
10_1101-2020_12_31_424971	370	25	of	of	IN
10_1101-2020_12_31_424971	370	26	Tris	Tris	NNP
10_1101-2020_12_31_424971	370	27	-	-	HYPH
10_1101-2020_12_31_424971	370	28	Polymix	Polymix	NNP
10_1101-2020_12_31_424971	370	29	Buffer	Buffer	NNP
10_1101-2020_12_31_424971	370	30	at	at	IN
10_1101-2020_12_31_424971	370	31	5	5	CD
10_1101-2020_12_31_424971	370	32	mM	mm	NN
10_1101-2020_12_31_424971	370	33	Mg(OAc)2	mg(oac)2	NN
10_1101-2020_12_31_424971	370	34	supplemented	supplement	VBN
10_1101-2020_12_31_424971	370	35	with	with	IN
10_1101-2020_12_31_424971	370	36	GTP	GTP	NNP
10_1101-2020_12_31_424971	370	37	836	836	CD
10_1101-2020_12_31_424971	370	38	Charging	charge	VBG
10_1101-2020_12_31_424971	370	39	Components	Components	NNPS
10_1101-2020_12_31_424971	370	40	for	for	IN
10_1101-2020_12_31_424971	370	41	2	2	CD
10_1101-2020_12_31_424971	370	42	min	min	NN
10_1101-2020_12_31_424971	370	43	at	at	IN
10_1101-2020_12_31_424971	370	44	room	room	NN
10_1101-2020_12_31_424971	370	45	temperature	temperature	NN
10_1101-2020_12_31_424971	370	46	.	.	.
10_1101-2020_12_31_424971	371	1	Then	then	RB
10_1101-2020_12_31_424971	371	2	10	10	CD
10_1101-2020_12_31_424971	371	3	µL	µl	CD
10_1101-2020_12_31_424971	371	4	of	of	IN
10_1101-2020_12_31_424971	371	5	the	the	DT
10_1101-2020_12_31_424971	371	6	70S	70S	NNP
10_1101-2020_12_31_424971	371	7	IC	IC	NNP
10_1101-2020_12_31_424971	371	8	,	,	,
10_1101-2020_12_31_424971	371	9	10	10	CD
10_1101-2020_12_31_424971	371	10	µL	µl	CD
10_1101-2020_12_31_424971	371	11	of	of	IN
10_1101-2020_12_31_424971	371	12	the	the	DT
10_1101-2020_12_31_424971	371	13	TC	TC	NNP
10_1101-2020_12_31_424971	371	14	,	,	,
10_1101-2020_12_31_424971	371	15	837	837	CD
10_1101-2020_12_31_424971	371	16	and	and	CC
10_1101-2020_12_31_424971	371	17	2.5	2.5	CD
10_1101-2020_12_31_424971	371	18	µL	µL	NNP
10_1101-2020_12_31_424971	371	19	the	the	DT
10_1101-2020_12_31_424971	371	20	GTP	GTP	NNP
10_1101-2020_12_31_424971	371	21	-	-	HYPH
10_1101-2020_12_31_424971	371	22	bound	bind	VBN
10_1101-2020_12_31_424971	371	23	EF	EF	NNP
10_1101-2020_12_31_424971	371	24	-	-	HYPH
10_1101-2020_12_31_424971	371	25	G	G	NNP
10_1101-2020_12_31_424971	371	26	solution	solution	NN
10_1101-2020_12_31_424971	371	27	were	be	VBD
10_1101-2020_12_31_424971	371	28	mixed	mixed	JJ
10_1101-2020_12_31_424971	371	29	,	,	,
10_1101-2020_12_31_424971	371	30	and	and	CC
10_1101-2020_12_31_424971	371	31	incubated	incubate	VBD
10_1101-2020_12_31_424971	371	32	for	for	IN
10_1101-2020_12_31_424971	371	33	5	5	CD
10_1101-2020_12_31_424971	371	34	min	min	NN
10_1101-2020_12_31_424971	371	35	at	at	IN
10_1101-2020_12_31_424971	371	36	room	room	NN
10_1101-2020_12_31_424971	371	37	838	838	CD
10_1101-2020_12_31_424971	371	38	temperature	temperature	NN
10_1101-2020_12_31_424971	371	39	and	and	CC
10_1101-2020_12_31_424971	371	40	for	for	IN
10_1101-2020_12_31_424971	371	41	additional	additional	JJ
10_1101-2020_12_31_424971	371	42	5	5	CD
10_1101-2020_12_31_424971	371	43	min	min	NN
10_1101-2020_12_31_424971	371	44	on	on	IN
10_1101-2020_12_31_424971	371	45	ice	ice	NN
10_1101-2020_12_31_424971	371	46	.	.	.
10_1101-2020_12_31_424971	372	1	The	the	DT
10_1101-2020_12_31_424971	372	2	resulting	result	VBG
10_1101-2020_12_31_424971	372	3	POST	POST	NNP
10_1101-2020_12_31_424971	372	4	complex	complex	NN
10_1101-2020_12_31_424971	372	5	was	be	VBD
10_1101-2020_12_31_424971	372	6	diluted	dilute	VBN
10_1101-2020_12_31_424971	372	7	by	by	IN
10_1101-2020_12_31_424971	372	8	adjusting	adjust	VBG
10_1101-2020_12_31_424971	372	9	839	839	CD
10_1101-2020_12_31_424971	372	10	the	the	DT
10_1101-2020_12_31_424971	372	11	reaction	reaction	NN
10_1101-2020_12_31_424971	372	12	volume	volume	NN
10_1101-2020_12_31_424971	372	13	to	to	IN
10_1101-2020_12_31_424971	372	14	100	100	CD
10_1101-2020_12_31_424971	372	15	µL	µL	NNP
10_1101-2020_12_31_424971	372	16	with	with	IN
10_1101-2020_12_31_424971	372	17	Tris	Tris	NNP
10_1101-2020_12_31_424971	372	18	-	-	HYPH
10_1101-2020_12_31_424971	372	19	Polymix	Polymix	NNP
10_1101-2020_12_31_424971	372	20	Buffer	Buffer	NNP
10_1101-2020_12_31_424971	372	21	at	at	IN
10_1101-2020_12_31_424971	372	22	20	20	CD
10_1101-2020_12_31_424971	372	23	mM	mm	NN
10_1101-2020_12_31_424971	372	24	Mg(OAc)2	Mg(OAc)2	NNS
10_1101-2020_12_31_424971	372	25	and	and	CC
10_1101-2020_12_31_424971	372	26	purified	purify	VBD
10_1101-2020_12_31_424971	372	27	via	via	IN
10_1101-2020_12_31_424971	372	28	840	840	CD
10_1101-2020_12_31_424971	372	29	sucrose	sucrose	JJ
10_1101-2020_12_31_424971	372	30	density	density	NN
10_1101-2020_12_31_424971	372	31	gradient	gradient	NN
10_1101-2020_12_31_424971	372	32	ultracentrifugation	ultracentrifugation	NN
10_1101-2020_12_31_424971	372	33	as	as	IN
10_1101-2020_12_31_424971	372	34	described	describe	VBN
10_1101-2020_12_31_424971	372	35	above	above	RB
10_1101-2020_12_31_424971	372	36	for	for	IN
10_1101-2020_12_31_424971	372	37	the	the	DT
10_1101-2020_12_31_424971	372	38	70S	70S	NNP
10_1101-2020_12_31_424971	372	39	ICs	ic	NNS
10_1101-2020_12_31_424971	372	40	.	.	.
10_1101-2020_12_31_424971	373	1	Purified	Purified	NNP
10_1101-2020_12_31_424971	373	2	POST	POST	NNP
10_1101-2020_12_31_424971	373	3	841	841	CD
10_1101-2020_12_31_424971	373	4	complexes	complex	NNS
10_1101-2020_12_31_424971	373	5	were	be	VBD
10_1101-2020_12_31_424971	373	6	aliquoted	aliquote	VBN
10_1101-2020_12_31_424971	373	7	,	,	,
10_1101-2020_12_31_424971	373	8	flash	flash	NNP
10_1101-2020_12_31_424971	373	9	frozen	frozen	JJ
10_1101-2020_12_31_424971	373	10	in	in	IN
10_1101-2020_12_31_424971	373	11	liquid	liquid	JJ
10_1101-2020_12_31_424971	373	12	nitrogen	nitrogen	NN
10_1101-2020_12_31_424971	373	13	,	,	,
10_1101-2020_12_31_424971	373	14	and	and	CC
10_1101-2020_12_31_424971	373	15	stored	store	VBD
10_1101-2020_12_31_424971	373	16	at	at	IN
10_1101-2020_12_31_424971	373	17	–	–	:
10_1101-2020_12_31_424971	373	18	80	80	CD
10_1101-2020_12_31_424971	373	19	ºC	ºC	NNP
10_1101-2020_12_31_424971	373	20	until	until	IN
10_1101-2020_12_31_424971	373	21	use	use	NN
10_1101-2020_12_31_424971	373	22	in	in	IN
10_1101-2020_12_31_424971	373	23	842	842	CD
10_1101-2020_12_31_424971	373	24	smFRET	smfret	NN
10_1101-2020_12_31_424971	373	25	experiments	experiment	NNS
10_1101-2020_12_31_424971	373	26	.	.	.
10_1101-2020_12_31_424971	374	1	PRE	PRE	NNP
10_1101-2020_12_31_424971	374	2	–	–	:
10_1101-2020_12_31_424971	374	3	A	a	DT
10_1101-2020_12_31_424971	374	4	complexes	complex	NNS
10_1101-2020_12_31_424971	374	5	were	be	VBD
10_1101-2020_12_31_424971	374	6	then	then	RB
10_1101-2020_12_31_424971	374	7	generated	generate	VBN
10_1101-2020_12_31_424971	374	8	by	by	IN
10_1101-2020_12_31_424971	374	9	mixing	mix	VBG
10_1101-2020_12_31_424971	374	10	3	3	CD
10_1101-2020_12_31_424971	374	11	µL	µL	NNP
10_1101-2020_12_31_424971	374	12	of	of	IN
10_1101-2020_12_31_424971	374	13	POST	POST	NNP
10_1101-2020_12_31_424971	374	14	complex	complex	NN
10_1101-2020_12_31_424971	374	15	,	,	,
10_1101-2020_12_31_424971	374	16	843	843	CD
10_1101-2020_12_31_424971	374	17	2	2	CD
10_1101-2020_12_31_424971	374	18	µL	µl	CD
10_1101-2020_12_31_424971	374	19	of	of	IN
10_1101-2020_12_31_424971	374	20	a	a	DT
10_1101-2020_12_31_424971	374	21	10	10	CD
10_1101-2020_12_31_424971	374	22	mM	mm	NN
10_1101-2020_12_31_424971	374	23	puromycin	puromycin	JJ
10_1101-2020_12_31_424971	374	24	solution	solution	NN
10_1101-2020_12_31_424971	374	25	(	(	-LRB-
10_1101-2020_12_31_424971	374	26	prepared	prepare	VBN
10_1101-2020_12_31_424971	374	27	in	in	IN
10_1101-2020_12_31_424971	374	28	Nanopure	Nanopure	NNP
10_1101-2020_12_31_424971	374	29	water	water	NN
10_1101-2020_12_31_424971	374	30	and	and	CC
10_1101-2020_12_31_424971	374	31	filtered	filter	VBD
10_1101-2020_12_31_424971	374	32	using	use	VBG
10_1101-2020_12_31_424971	374	33	a	a	DT
10_1101-2020_12_31_424971	374	34	0.22	0.22	CD
10_1101-2020_12_31_424971	374	35	µm	µm	NNP
10_1101-2020_12_31_424971	374	36	844	844	CD
10_1101-2020_12_31_424971	374	37	filter	filter	NN
10_1101-2020_12_31_424971	374	38	)	)	-RRB-
10_1101-2020_12_31_424971	374	39	,	,	,
10_1101-2020_12_31_424971	374	40	and	and	CC
10_1101-2020_12_31_424971	374	41	15	15	CD
10_1101-2020_12_31_424971	374	42	µL	µl	CD
10_1101-2020_12_31_424971	374	43	of	of	IN
10_1101-2020_12_31_424971	374	44	Tris	Tris	NNP
10_1101-2020_12_31_424971	374	45	-	-	HYPH
10_1101-2020_12_31_424971	374	46	Polymix	Polymix	NNP
10_1101-2020_12_31_424971	374	47	Buffer	Buffer	NNP
10_1101-2020_12_31_424971	374	48	at	at	IN
10_1101-2020_12_31_424971	374	49	15	15	CD
10_1101-2020_12_31_424971	374	50	mM	mm	NN
10_1101-2020_12_31_424971	374	51	Mg(OAc)2	Mg(OAc)2	NNS
10_1101-2020_12_31_424971	374	52	and	and	CC
10_1101-2020_12_31_424971	374	53	incubating	incubate	VBG
10_1101-2020_12_31_424971	374	54	the	the	DT
10_1101-2020_12_31_424971	374	55	mixture	mixture	NN
10_1101-2020_12_31_424971	374	56	for	for	IN
10_1101-2020_12_31_424971	374	57	10	10	CD
10_1101-2020_12_31_424971	374	58	min	min	NN
10_1101-2020_12_31_424971	374	59	845	845	CD
10_1101-2020_12_31_424971	374	60	at	at	IN
10_1101-2020_12_31_424971	374	61	room	room	NN
10_1101-2020_12_31_424971	374	62	temperature	temperature	NN
10_1101-2020_12_31_424971	374	63	.	.	.
10_1101-2020_12_31_424971	375	1	PRE	PRE	NNP
10_1101-2020_12_31_424971	375	2	–	–	:
10_1101-2020_12_31_424971	375	3	A	a	DT
10_1101-2020_12_31_424971	375	4	complexes	complex	NNS
10_1101-2020_12_31_424971	375	5	were	be	VBD
10_1101-2020_12_31_424971	375	6	used	use	VBN
10_1101-2020_12_31_424971	375	7	for	for	IN
10_1101-2020_12_31_424971	375	8	smFRET	smfret	NN
10_1101-2020_12_31_424971	375	9	experiments	experiment	NNS
10_1101-2020_12_31_424971	375	10	immediately	immediately	RB
10_1101-2020_12_31_424971	375	11	upon	upon	IN
10_1101-2020_12_31_424971	375	12	846	846	CD
10_1101-2020_12_31_424971	375	13	preparation	preparation	NN
10_1101-2020_12_31_424971	375	14	.	.	.
10_1101-2020_12_31_424971	376	1	847	847	CD
10_1101-2020_12_31_424971	376	2	848	848	CD
10_1101-2020_12_31_424971	376	3	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	376	4	imaging	imaging	NN
10_1101-2020_12_31_424971	376	5	using	use	VBG
10_1101-2020_12_31_424971	376	6	total	total	JJ
10_1101-2020_12_31_424971	376	7	internal	internal	JJ
10_1101-2020_12_31_424971	376	8	reflection	reflection	NN
10_1101-2020_12_31_424971	376	9	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	376	10	(	(	-LRB-
10_1101-2020_12_31_424971	376	11	TIRF	TIRF	NNP
10_1101-2020_12_31_424971	376	12	)	)	-RRB-
10_1101-2020_12_31_424971	376	13	microscopy	microscopy	JJ
10_1101-2020_12_31_424971	376	14	.	.	.
10_1101-2020_12_31_424971	377	1	70S	70s	CD
10_1101-2020_12_31_424971	377	2	ICs	ic	NNS
10_1101-2020_12_31_424971	377	3	or	or	CC
10_1101-2020_12_31_424971	377	4	849	849	CD
10_1101-2020_12_31_424971	377	5	PRE	PRE	NNP
10_1101-2020_12_31_424971	377	6	–	–	:
10_1101-2020_12_31_424971	377	7	A	a	DT
10_1101-2020_12_31_424971	377	8	complexes	complex	NNS
10_1101-2020_12_31_424971	377	9	were	be	VBD
10_1101-2020_12_31_424971	377	10	tethered	tether	VBN
10_1101-2020_12_31_424971	377	11	to	to	IN
10_1101-2020_12_31_424971	377	12	the	the	DT
10_1101-2020_12_31_424971	377	13	PEG	peg	NN
10_1101-2020_12_31_424971	377	14	/	/	SYM
10_1101-2020_12_31_424971	377	15	biotin	biotin	NN
10_1101-2020_12_31_424971	377	16	-	-	HYPH
10_1101-2020_12_31_424971	377	17	PEG	peg	NN
10_1101-2020_12_31_424971	377	18	-	-	HYPH
10_1101-2020_12_31_424971	377	19	passivated	passivate	VBN
10_1101-2020_12_31_424971	377	20	and	and	CC
10_1101-2020_12_31_424971	377	21	streptavidin	streptavidin	NNP
10_1101-2020_12_31_424971	377	22	-	-	HYPH
10_1101-2020_12_31_424971	377	23	derivatized	derivatize	VBN
10_1101-2020_12_31_424971	377	24	850	850	CD
10_1101-2020_12_31_424971	377	25	surface	surface	NN
10_1101-2020_12_31_424971	377	26	of	of	IN
10_1101-2020_12_31_424971	377	27	a	a	DT
10_1101-2020_12_31_424971	377	28	quartz	quartz	NN
10_1101-2020_12_31_424971	377	29	microfluidic	microfluidic	NN
10_1101-2020_12_31_424971	377	30	flowcell	flowcell	NN
10_1101-2020_12_31_424971	377	31	via	via	IN
10_1101-2020_12_31_424971	377	32	a	a	DT
10_1101-2020_12_31_424971	377	33	biotin	biotin	NN
10_1101-2020_12_31_424971	377	34	-	-	HYPH
10_1101-2020_12_31_424971	377	35	streptavidin	streptavidin	NN
10_1101-2020_12_31_424971	377	36	-	-	HYPH
10_1101-2020_12_31_424971	377	37	biotin	biotin	JJ
10_1101-2020_12_31_424971	377	38	bridge	bridge	NN
10_1101-2020_12_31_424971	377	39	between	between	IN
10_1101-2020_12_31_424971	377	40	the	the	DT
10_1101-2020_12_31_424971	377	41	biotin-851	biotin-851	NN
10_1101-2020_12_31_424971	377	42	mRNA	mRNA	NNS
10_1101-2020_12_31_424971	377	43	and	and	CC
10_1101-2020_12_31_424971	377	44	the	the	DT
10_1101-2020_12_31_424971	377	45	biotin	biotin	NNP
10_1101-2020_12_31_424971	377	46	-	-	HYPH
10_1101-2020_12_31_424971	377	47	PEG37,43	PEG37,43	NNS
10_1101-2020_12_31_424971	377	48	.	.	.
10_1101-2020_12_31_424971	378	1	Untethered	Untethered	NNP
10_1101-2020_12_31_424971	378	2	70S	70S	NNP
10_1101-2020_12_31_424971	378	3	ICs	ic	NNS
10_1101-2020_12_31_424971	378	4	or	or	CC
10_1101-2020_12_31_424971	378	5	PRE	PRE	NNP
10_1101-2020_12_31_424971	378	6	–	–	:
10_1101-2020_12_31_424971	378	7	A	a	DT
10_1101-2020_12_31_424971	378	8	complexes	complex	NNS
10_1101-2020_12_31_424971	378	9	were	be	VBD
10_1101-2020_12_31_424971	378	10	removed	remove	VBN
10_1101-2020_12_31_424971	378	11	from	from	IN
10_1101-2020_12_31_424971	378	12	the	the	DT
10_1101-2020_12_31_424971	378	13	852	852	CD
10_1101-2020_12_31_424971	378	14	flowcell	flowcell	NN
10_1101-2020_12_31_424971	378	15	,	,	,
10_1101-2020_12_31_424971	378	16	and	and	CC
10_1101-2020_12_31_424971	378	17	the	the	DT
10_1101-2020_12_31_424971	378	18	flowcell	flowcell	NN
10_1101-2020_12_31_424971	378	19	was	be	VBD
10_1101-2020_12_31_424971	378	20	prepared	prepare	VBN
10_1101-2020_12_31_424971	378	21	for	for	IN
10_1101-2020_12_31_424971	378	22	smFRET	smfret	NN
10_1101-2020_12_31_424971	378	23	imaging	image	VBG
10_1101-2020_12_31_424971	378	24	experiments	experiment	NNS
10_1101-2020_12_31_424971	378	25	,	,	,
10_1101-2020_12_31_424971	378	26	by	by	IN
10_1101-2020_12_31_424971	378	27	flushing	flush	VBG
10_1101-2020_12_31_424971	378	28	it	-PRON-	PRP
10_1101-2020_12_31_424971	378	29	with	with	IN
10_1101-2020_12_31_424971	378	30	Tris-853	tris-853	CD
10_1101-2020_12_31_424971	378	31	Polymix	Polymix	NNP
10_1101-2020_12_31_424971	378	32	Buffer	Buffer	NNP
10_1101-2020_12_31_424971	378	33	at	at	IN
10_1101-2020_12_31_424971	378	34	15	15	CD
10_1101-2020_12_31_424971	378	35	mM	mm	NN
10_1101-2020_12_31_424971	378	36	Mg(OAc)2	mg(oac)2	NN
10_1101-2020_12_31_424971	378	37	supplemented	supplement	VBN
10_1101-2020_12_31_424971	378	38	with	with	IN
10_1101-2020_12_31_424971	378	39	an	an	DT
10_1101-2020_12_31_424971	378	40	Oxygen	oxygen	NN
10_1101-2020_12_31_424971	378	41	-	-	HYPH
10_1101-2020_12_31_424971	378	42	Scavenging	scavenge	VBG
10_1101-2020_12_31_424971	378	43	System	system	NN
10_1101-2020_12_31_424971	378	44	(	(	-LRB-
10_1101-2020_12_31_424971	378	45	2.5	2.5	CD
10_1101-2020_12_31_424971	378	46	mM	mM	NNP
10_1101-2020_12_31_424971	378	47	854	854	CD
10_1101-2020_12_31_424971	378	48	protocatechuic	protocatechuic	NNS
10_1101-2020_12_31_424971	378	49	acid	acid	NN
10_1101-2020_12_31_424971	378	50	(	(	-LRB-
10_1101-2020_12_31_424971	378	51	pH	pH	NNP
10_1101-2020_12_31_424971	378	52	=	=	SYM
10_1101-2020_12_31_424971	378	53	9	9	CD
10_1101-2020_12_31_424971	378	54	)	)	-RRB-
10_1101-2020_12_31_424971	378	55	(	(	-LRB-
10_1101-2020_12_31_424971	378	56	Sigma	Sigma	NNP
10_1101-2020_12_31_424971	378	57	Aldrich	Aldrich	NNP
10_1101-2020_12_31_424971	378	58	)	)	-RRB-
10_1101-2020_12_31_424971	378	59	and	and	CC
10_1101-2020_12_31_424971	378	60	250	250	CD
10_1101-2020_12_31_424971	378	61	nM	nM	NNP
10_1101-2020_12_31_424971	378	62	protocatechuate-3,4-dioxygenase	protocatechuate-3,4-dioxygenase	NNP
10_1101-2020_12_31_424971	378	63	(	(	-LRB-
10_1101-2020_12_31_424971	378	64	pH	pH	NNP
10_1101-2020_12_31_424971	378	65	855	855	CD
10_1101-2020_12_31_424971	378	66	.CC	.cc	SYM
10_1101-2020_12_31_424971	378	67	-	-	HYPH
10_1101-2020_12_31_424971	378	68	BY	by	IN
10_1101-2020_12_31_424971	378	69	-	-	HYPH
10_1101-2020_12_31_424971	378	70	NC	NC	NNP
10_1101-2020_12_31_424971	378	71	-	-	HYPH
10_1101-2020_12_31_424971	378	72	ND	ND	NNP
10_1101-2020_12_31_424971	378	73	4.0	4.0	CD
10_1101-2020_12_31_424971	378	74	International	International	NNP
10_1101-2020_12_31_424971	378	75	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	378	76	under	under	IN
10_1101-2020_12_31_424971	378	77	a	a	DT
10_1101-2020_12_31_424971	378	78	(	(	-LRB-
10_1101-2020_12_31_424971	378	79	which	which	WDT
10_1101-2020_12_31_424971	378	80	was	be	VBD
10_1101-2020_12_31_424971	378	81	not	not	RB
10_1101-2020_12_31_424971	378	82	certified	certify	VBN
10_1101-2020_12_31_424971	378	83	by	by	IN
10_1101-2020_12_31_424971	378	84	peer	peer	NN
10_1101-2020_12_31_424971	378	85	review	review	NN
10_1101-2020_12_31_424971	378	86	)	)	-RRB-
10_1101-2020_12_31_424971	378	87	is	be	VBZ
10_1101-2020_12_31_424971	378	88	the	the	DT
10_1101-2020_12_31_424971	378	89	author	author	NN
10_1101-2020_12_31_424971	378	90	/	/	SYM
10_1101-2020_12_31_424971	378	91	funder	funder	NN
10_1101-2020_12_31_424971	378	92	,	,	,
10_1101-2020_12_31_424971	378	93	who	who	WP
10_1101-2020_12_31_424971	378	94	has	have	VBZ
10_1101-2020_12_31_424971	378	95	granted	grant	VBN
10_1101-2020_12_31_424971	378	96	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	378	97	a	a	DT
10_1101-2020_12_31_424971	378	98	license	license	NN
10_1101-2020_12_31_424971	378	99	to	to	TO
10_1101-2020_12_31_424971	378	100	display	display	VB
10_1101-2020_12_31_424971	378	101	the	the	DT
10_1101-2020_12_31_424971	378	102	preprint	preprint	NN
10_1101-2020_12_31_424971	378	103	in	in	IN
10_1101-2020_12_31_424971	378	104	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	378	105	.	.	.
10_1101-2020_12_31_424971	379	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	379	2	is	be	VBZ
10_1101-2020_12_31_424971	379	3	made	make	VBN
10_1101-2020_12_31_424971	379	4	The	the	DT
10_1101-2020_12_31_424971	379	5	copyright	copyright	NN
10_1101-2020_12_31_424971	379	6	holder	holder	NN
10_1101-2020_12_31_424971	379	7	for	for	IN
10_1101-2020_12_31_424971	379	8	this	this	DT
10_1101-2020_12_31_424971	379	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	379	10	version	version	NN
10_1101-2020_12_31_424971	379	11	posted	post	VBD
10_1101-2020_12_31_424971	379	12	January	January	NNP
10_1101-2020_12_31_424971	379	13	2	2	CD
10_1101-2020_12_31_424971	379	14	,	,	,
10_1101-2020_12_31_424971	379	15	2021	2021	CD
10_1101-2020_12_31_424971	379	16	.	.	.
10_1101-2020_12_31_424971	379	17	;	;	:
10_1101-2020_12_31_424971	379	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	379	19	:	:	:
10_1101-2020_12_31_424971	379	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	379	21	preprint	preprint	NN
10_1101-2020_12_31_424971	379	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	379	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	379	24	35	35	CD
10_1101-2020_12_31_424971	379	25	=	=	SYM
10_1101-2020_12_31_424971	379	26	7.8	7.8	CD
10_1101-2020_12_31_424971	379	27	)	)	-RRB-
10_1101-2020_12_31_424971	379	28	(	(	-LRB-
10_1101-2020_12_31_424971	379	29	Sigma	Sigma	NNP
10_1101-2020_12_31_424971	379	30	Aldrich))64	Aldrich))64	NNP
10_1101-2020_12_31_424971	379	31	and	and	CC
10_1101-2020_12_31_424971	379	32	a	a	DT
10_1101-2020_12_31_424971	379	33	Triplet	Triplet	NNP
10_1101-2020_12_31_424971	379	34	-	-	HYPH
10_1101-2020_12_31_424971	379	35	State	State	NNP
10_1101-2020_12_31_424971	379	36	-	-	HYPH
10_1101-2020_12_31_424971	379	37	Quencher	Quencher	NNP
10_1101-2020_12_31_424971	379	38	Cocktail	Cocktail	NNP
10_1101-2020_12_31_424971	379	39	(	(	-LRB-
10_1101-2020_12_31_424971	379	40	1	1	CD
10_1101-2020_12_31_424971	379	41	mM	mM	NNP
10_1101-2020_12_31_424971	379	42	1,3,5,7-cyclooctatetraene	1,3,5,7-cyclooctatetraene	CD
10_1101-2020_12_31_424971	379	43	856	856	CD
10_1101-2020_12_31_424971	379	44	(	(	-LRB-
10_1101-2020_12_31_424971	379	45	Aldrich	Aldrich	NNP
10_1101-2020_12_31_424971	379	46	)	)	-RRB-
10_1101-2020_12_31_424971	379	47	and	and	CC
10_1101-2020_12_31_424971	379	48	1	1	CD
10_1101-2020_12_31_424971	379	49	mM	mm	NN
10_1101-2020_12_31_424971	379	50	3-nitrobenzyl	3-nitrobenzyl	CD
10_1101-2020_12_31_424971	379	51	alcohol	alcohol	NN
10_1101-2020_12_31_424971	379	52	(	(	-LRB-
10_1101-2020_12_31_424971	379	53	Fluka))65	Fluka))65	NNP
10_1101-2020_12_31_424971	379	54	.	.	.
10_1101-2020_12_31_424971	380	1	857	857	CD
10_1101-2020_12_31_424971	380	2	Tethered	Tethered	NNP
10_1101-2020_12_31_424971	380	3	70S	70S	NNP
10_1101-2020_12_31_424971	380	4	ICs	ic	NNS
10_1101-2020_12_31_424971	380	5	or	or	CC
10_1101-2020_12_31_424971	380	6	PRE	PRE	NNP
10_1101-2020_12_31_424971	380	7	–	–	:
10_1101-2020_12_31_424971	380	8	A	a	DT
10_1101-2020_12_31_424971	380	9	complexes	complex	NNS
10_1101-2020_12_31_424971	380	10	were	be	VBD
10_1101-2020_12_31_424971	380	11	imaged	image	VBN
10_1101-2020_12_31_424971	380	12	at	at	IN
10_1101-2020_12_31_424971	380	13	single	single	JJ
10_1101-2020_12_31_424971	380	14	-	-	HYPH
10_1101-2020_12_31_424971	380	15	molecule	molecule	NN
10_1101-2020_12_31_424971	380	16	resolution	resolution	NN
10_1101-2020_12_31_424971	380	17	using	use	VBG
10_1101-2020_12_31_424971	380	18	a	a	DT
10_1101-2020_12_31_424971	380	19	858	858	CD
10_1101-2020_12_31_424971	380	20	laboratory	laboratory	NN
10_1101-2020_12_31_424971	380	21	-	-	HYPH
10_1101-2020_12_31_424971	380	22	built	build	VBN
10_1101-2020_12_31_424971	380	23	,	,	,
10_1101-2020_12_31_424971	380	24	wide	wide	JJ
10_1101-2020_12_31_424971	380	25	-	-	HYPH
10_1101-2020_12_31_424971	380	26	field	field	NN
10_1101-2020_12_31_424971	380	27	,	,	,
10_1101-2020_12_31_424971	380	28	prism	prism	NN
10_1101-2020_12_31_424971	380	29	-	-	HYPH
10_1101-2020_12_31_424971	380	30	based	base	VBN
10_1101-2020_12_31_424971	380	31	total	total	JJ
10_1101-2020_12_31_424971	380	32	internal	internal	JJ
10_1101-2020_12_31_424971	380	33	reflection	reflection	NN
10_1101-2020_12_31_424971	380	34	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	380	35	(	(	-LRB-
10_1101-2020_12_31_424971	380	36	TIRF	TIRF	NNP
10_1101-2020_12_31_424971	380	37	)	)	-RRB-
10_1101-2020_12_31_424971	380	38	microscope	microscope	NN
10_1101-2020_12_31_424971	380	39	859	859	CD
10_1101-2020_12_31_424971	380	40	with	with	IN
10_1101-2020_12_31_424971	380	41	a	a	DT
10_1101-2020_12_31_424971	380	42	532-nm	532-nm	CD
10_1101-2020_12_31_424971	380	43	,	,	,
10_1101-2020_12_31_424971	380	44	diode	diode	NN
10_1101-2020_12_31_424971	380	45	-	-	HYPH
10_1101-2020_12_31_424971	380	46	pumped	pump	VBN
10_1101-2020_12_31_424971	380	47	,	,	,
10_1101-2020_12_31_424971	380	48	solid	solid	JJ
10_1101-2020_12_31_424971	380	49	-	-	HYPH
10_1101-2020_12_31_424971	380	50	state	state	NN
10_1101-2020_12_31_424971	380	51	laser	laser	NN
10_1101-2020_12_31_424971	380	52	(	(	-LRB-
10_1101-2020_12_31_424971	380	53	Laser	Laser	NNP
10_1101-2020_12_31_424971	380	54	Quantum	Quantum	NNP
10_1101-2020_12_31_424971	380	55	)	)	-RRB-
10_1101-2020_12_31_424971	380	56	excitation	excitation	NN
10_1101-2020_12_31_424971	380	57	source	source	NN
10_1101-2020_12_31_424971	380	58	delivering	deliver	VBG
10_1101-2020_12_31_424971	380	59	a	a	DT
10_1101-2020_12_31_424971	380	60	860	860	CD
10_1101-2020_12_31_424971	380	61	power	power	NN
10_1101-2020_12_31_424971	380	62	of	of	IN
10_1101-2020_12_31_424971	380	63	16	16	CD
10_1101-2020_12_31_424971	380	64	-	-	SYM
10_1101-2020_12_31_424971	380	65	25	25	CD
10_1101-2020_12_31_424971	380	66	mW	mW	NNP
10_1101-2020_12_31_424971	380	67	as	as	IN
10_1101-2020_12_31_424971	380	68	measured	measure	VBN
10_1101-2020_12_31_424971	380	69	at	at	IN
10_1101-2020_12_31_424971	380	70	the	the	DT
10_1101-2020_12_31_424971	380	71	prism	prism	NN
10_1101-2020_12_31_424971	380	72	to	to	TO
10_1101-2020_12_31_424971	380	73	ensure	ensure	VB
10_1101-2020_12_31_424971	380	74	the	the	DT
10_1101-2020_12_31_424971	380	75	same	same	JJ
10_1101-2020_12_31_424971	380	76	power	power	NN
10_1101-2020_12_31_424971	380	77	density	density	NN
10_1101-2020_12_31_424971	380	78	on	on	IN
10_1101-2020_12_31_424971	380	79	the	the	DT
10_1101-2020_12_31_424971	380	80	imaging	imaging	JJ
10_1101-2020_12_31_424971	380	81	861	861	CD
10_1101-2020_12_31_424971	380	82	plane	plane	NN
10_1101-2020_12_31_424971	380	83	.	.	.
10_1101-2020_12_31_424971	381	1	The	the	DT
10_1101-2020_12_31_424971	381	2	Cy3	cy3	NN
10_1101-2020_12_31_424971	381	3	and	and	CC
10_1101-2020_12_31_424971	381	4	Cy5	Cy5	NNP
10_1101-2020_12_31_424971	381	5	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	381	6	emissions	emission	NNS
10_1101-2020_12_31_424971	381	7	were	be	VBD
10_1101-2020_12_31_424971	381	8	simultaneously	simultaneously	RB
10_1101-2020_12_31_424971	381	9	collected	collect	VBN
10_1101-2020_12_31_424971	381	10	by	by	IN
10_1101-2020_12_31_424971	381	11	a	a	DT
10_1101-2020_12_31_424971	381	12	1.2	1.2	CD
10_1101-2020_12_31_424971	381	13	862	862	CD
10_1101-2020_12_31_424971	381	14	numerical	numerical	JJ
10_1101-2020_12_31_424971	381	15	aperture	aperture	NN
10_1101-2020_12_31_424971	381	16	,	,	,
10_1101-2020_12_31_424971	381	17	60	60	CD
10_1101-2020_12_31_424971	381	18	´	´	CD
10_1101-2020_12_31_424971	381	19	,	,	,
10_1101-2020_12_31_424971	381	20	water	water	NN
10_1101-2020_12_31_424971	381	21	-	-	HYPH
10_1101-2020_12_31_424971	381	22	immersion	immersion	NN
10_1101-2020_12_31_424971	381	23	objective	objective	NN
10_1101-2020_12_31_424971	381	24	(	(	-LRB-
10_1101-2020_12_31_424971	381	25	Nikon	Nikon	NNP
10_1101-2020_12_31_424971	381	26	)	)	-RRB-
10_1101-2020_12_31_424971	381	27	and	and	CC
10_1101-2020_12_31_424971	381	28	separated	separate	VBD
10_1101-2020_12_31_424971	381	29	based	base	VBN
10_1101-2020_12_31_424971	381	30	on	on	IN
10_1101-2020_12_31_424971	381	31	wavelength	wavelength	NN
10_1101-2020_12_31_424971	381	32	863	863	CD
10_1101-2020_12_31_424971	381	33	using	use	VBG
10_1101-2020_12_31_424971	381	34	a	a	DT
10_1101-2020_12_31_424971	381	35	two	two	CD
10_1101-2020_12_31_424971	381	36	-	-	HYPH
10_1101-2020_12_31_424971	381	37	channel	channel	NN
10_1101-2020_12_31_424971	381	38	,	,	,
10_1101-2020_12_31_424971	381	39	simultaneous	simultaneous	JJ
10_1101-2020_12_31_424971	381	40	-	-	HYPH
10_1101-2020_12_31_424971	381	41	imaging	image	VBG
10_1101-2020_12_31_424971	381	42	system	system	NN
10_1101-2020_12_31_424971	381	43	(	(	-LRB-
10_1101-2020_12_31_424971	381	44	Dual	Dual	NNP
10_1101-2020_12_31_424971	381	45	ViewTM	ViewTM	NNP
10_1101-2020_12_31_424971	381	46	,	,	,
10_1101-2020_12_31_424971	381	47	Optical	Optical	NNP
10_1101-2020_12_31_424971	381	48	Insights	Insights	NNPS
10_1101-2020_12_31_424971	381	49	LLC	LLC	NNP
10_1101-2020_12_31_424971	381	50	)	)	-RRB-
10_1101-2020_12_31_424971	381	51	.	.	.
10_1101-2020_12_31_424971	382	1	The	the	DT
10_1101-2020_12_31_424971	382	2	Cy3	cy3	CD
10_1101-2020_12_31_424971	382	3	864	864	CD
10_1101-2020_12_31_424971	382	4	and	and	CC
10_1101-2020_12_31_424971	382	5	Cy5	Cy5	NNP
10_1101-2020_12_31_424971	382	6	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	382	7	intensities	intensity	NNS
10_1101-2020_12_31_424971	382	8	were	be	VBD
10_1101-2020_12_31_424971	382	9	recorded	record	VBN
10_1101-2020_12_31_424971	382	10	using	use	VBG
10_1101-2020_12_31_424971	382	11	a	a	DT
10_1101-2020_12_31_424971	382	12	1024	1024	CD
10_1101-2020_12_31_424971	382	13	´	´	CD
10_1101-2020_12_31_424971	382	14	1024	1024	CD
10_1101-2020_12_31_424971	382	15	pixel	pixel	NN
10_1101-2020_12_31_424971	382	16	,	,	,
10_1101-2020_12_31_424971	382	17	back	back	RB
10_1101-2020_12_31_424971	382	18	-	-	HYPH
10_1101-2020_12_31_424971	382	19	illuminated	illuminate	VBN
10_1101-2020_12_31_424971	382	20	865	865	CD
10_1101-2020_12_31_424971	382	21	electron	electron	NN
10_1101-2020_12_31_424971	382	22	-	-	HYPH
10_1101-2020_12_31_424971	382	23	multiplying	multiply	VBG
10_1101-2020_12_31_424971	382	24	charge	charge	NN
10_1101-2020_12_31_424971	382	25	-	-	HYPH
10_1101-2020_12_31_424971	382	26	coupled	couple	VBN
10_1101-2020_12_31_424971	382	27	-	-	HYPH
10_1101-2020_12_31_424971	382	28	device	device	NN
10_1101-2020_12_31_424971	382	29	(	(	-LRB-
10_1101-2020_12_31_424971	382	30	EMCCD	EMCCD	NNP
10_1101-2020_12_31_424971	382	31	)	)	-RRB-
10_1101-2020_12_31_424971	382	32	camera	camera	NN
10_1101-2020_12_31_424971	382	33	(	(	-LRB-
10_1101-2020_12_31_424971	382	34	Andor	Andor	NNP
10_1101-2020_12_31_424971	382	35	iXon	iXon	NNP
10_1101-2020_12_31_424971	382	36	Ultra	Ultra	NNP
10_1101-2020_12_31_424971	382	37	888	888	CD
10_1101-2020_12_31_424971	382	38	)	)	-RRB-
10_1101-2020_12_31_424971	382	39	operating	operate	VBG
10_1101-2020_12_31_424971	382	40	866	866	CD
10_1101-2020_12_31_424971	382	41	with	with	IN
10_1101-2020_12_31_424971	382	42	2	2	CD
10_1101-2020_12_31_424971	382	43	´	´	CD
10_1101-2020_12_31_424971	382	44	2	2	CD
10_1101-2020_12_31_424971	382	45	pixel	pixel	NN
10_1101-2020_12_31_424971	382	46	binning	bin	VBG
10_1101-2020_12_31_424971	382	47	at	at	IN
10_1101-2020_12_31_424971	382	48	an	an	DT
10_1101-2020_12_31_424971	382	49	acquisition	acquisition	NN
10_1101-2020_12_31_424971	382	50	time	time	NN
10_1101-2020_12_31_424971	382	51	of	of	IN
10_1101-2020_12_31_424971	382	52	0.1	0.1	CD
10_1101-2020_12_31_424971	382	53	seconds	second	NNS
10_1101-2020_12_31_424971	382	54	per	per	IN
10_1101-2020_12_31_424971	382	55	frame	frame	NN
10_1101-2020_12_31_424971	382	56	controlled	control	VBN
10_1101-2020_12_31_424971	382	57	by	by	IN
10_1101-2020_12_31_424971	382	58	software	software	NN
10_1101-2020_12_31_424971	382	59	867	867	CD
10_1101-2020_12_31_424971	382	60	μManager	μManager	NNP
10_1101-2020_12_31_424971	382	61	1.4	1.4	CD
10_1101-2020_12_31_424971	382	62	.	.	.
10_1101-2020_12_31_424971	383	1	This	this	DT
10_1101-2020_12_31_424971	383	2	microscope	microscope	NN
10_1101-2020_12_31_424971	383	3	allows	allow	VBZ
10_1101-2020_12_31_424971	383	4	direct	direct	JJ
10_1101-2020_12_31_424971	383	5	visualization	visualization	NN
10_1101-2020_12_31_424971	383	6	of	of	IN
10_1101-2020_12_31_424971	383	7	thousands	thousand	NNS
10_1101-2020_12_31_424971	383	8	of	of	IN
10_1101-2020_12_31_424971	383	9	individual	individual	JJ
10_1101-2020_12_31_424971	383	10	70S	70S	NNP
10_1101-2020_12_31_424971	383	11	ICs	ic	NNS
10_1101-2020_12_31_424971	383	12	or	or	CC
10_1101-2020_12_31_424971	383	13	868	868	CD
10_1101-2020_12_31_424971	383	14	PRE	PRE	NNP
10_1101-2020_12_31_424971	383	15	-	-	HYPH
10_1101-2020_12_31_424971	383	16	A	a	DT
10_1101-2020_12_31_424971	383	17	complexes	complex	NNS
10_1101-2020_12_31_424971	383	18	in	in	IN
10_1101-2020_12_31_424971	383	19	a	a	DT
10_1101-2020_12_31_424971	383	20	field	field	NN
10_1101-2020_12_31_424971	383	21	-	-	HYPH
10_1101-2020_12_31_424971	383	22	of	of	IN
10_1101-2020_12_31_424971	383	23	-	-	HYPH
10_1101-2020_12_31_424971	383	24	view	view	NN
10_1101-2020_12_31_424971	383	25	of	of	IN
10_1101-2020_12_31_424971	383	26	115	115	CD
10_1101-2020_12_31_424971	383	27	×	×	CD
10_1101-2020_12_31_424971	383	28	230	230	CD
10_1101-2020_12_31_424971	383	29	µm2	µm2	RB
10_1101-2020_12_31_424971	383	30	.	.	.
10_1101-2020_12_31_424971	384	1	Each	each	DT
10_1101-2020_12_31_424971	384	2	movie	movie	NN
10_1101-2020_12_31_424971	384	3	was	be	VBD
10_1101-2020_12_31_424971	384	4	composed	compose	VBN
10_1101-2020_12_31_424971	384	5	of	of	IN
10_1101-2020_12_31_424971	384	6	600	600	CD
10_1101-2020_12_31_424971	384	7	frames	frame	NNS
10_1101-2020_12_31_424971	384	8	869	869	CD
10_1101-2020_12_31_424971	384	9	in	in	IN
10_1101-2020_12_31_424971	384	10	order	order	NN
10_1101-2020_12_31_424971	384	11	to	to	TO
10_1101-2020_12_31_424971	384	12	ensure	ensure	VB
10_1101-2020_12_31_424971	384	13	that	that	IN
10_1101-2020_12_31_424971	384	14	the	the	DT
10_1101-2020_12_31_424971	384	15	majority	majority	NN
10_1101-2020_12_31_424971	384	16	of	of	IN
10_1101-2020_12_31_424971	384	17	the	the	DT
10_1101-2020_12_31_424971	384	18	fluorophores	fluorophore	NNS
10_1101-2020_12_31_424971	384	19	in	in	IN
10_1101-2020_12_31_424971	384	20	the	the	DT
10_1101-2020_12_31_424971	384	21	field	field	NN
10_1101-2020_12_31_424971	384	22	-	-	HYPH
10_1101-2020_12_31_424971	384	23	of	of	IN
10_1101-2020_12_31_424971	384	24	-	-	HYPH
10_1101-2020_12_31_424971	384	25	view	view	NN
10_1101-2020_12_31_424971	384	26	were	be	VBD
10_1101-2020_12_31_424971	384	27	photobleached	photobleache	VBN
10_1101-2020_12_31_424971	384	28	870	870	CD
10_1101-2020_12_31_424971	384	29	within	within	IN
10_1101-2020_12_31_424971	384	30	the	the	DT
10_1101-2020_12_31_424971	384	31	observation	observation	NN
10_1101-2020_12_31_424971	384	32	period	period	NN
10_1101-2020_12_31_424971	384	33	.	.	.
10_1101-2020_12_31_424971	385	1	For	for	IN
10_1101-2020_12_31_424971	385	2	stopped	stop	VBN
10_1101-2020_12_31_424971	385	3	-	-	HYPH
10_1101-2020_12_31_424971	385	4	flow	flow	NN
10_1101-2020_12_31_424971	385	5	experiments	experiment	NNS
10_1101-2020_12_31_424971	385	6	using	use	VBG
10_1101-2020_12_31_424971	385	7	tethered	tethered	JJ
10_1101-2020_12_31_424971	385	8	70S	70S	NNP
10_1101-2020_12_31_424971	385	9	ICs	ic	NNS
10_1101-2020_12_31_424971	385	10	,	,	,
10_1101-2020_12_31_424971	385	11	we	-PRON-	PRP
10_1101-2020_12_31_424971	385	12	delivered	deliver	VBD
10_1101-2020_12_31_424971	385	13	871	871	CD
10_1101-2020_12_31_424971	385	14	0.25	0.25	CD
10_1101-2020_12_31_424971	385	15	µM	µM	NNP
10_1101-2020_12_31_424971	385	16	of	of	IN
10_1101-2020_12_31_424971	385	17	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	385	18	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	385	19	or	or	CC
10_1101-2020_12_31_424971	385	20	ProL	ProL	NNP
10_1101-2020_12_31_424971	385	21	-	-	HYPH
10_1101-2020_12_31_424971	385	22	TC	TC	NNP
10_1101-2020_12_31_424971	385	23	in	in	IN
10_1101-2020_12_31_424971	385	24	the	the	DT
10_1101-2020_12_31_424971	385	25	absence	absence	NN
10_1101-2020_12_31_424971	385	26	of	of	IN
10_1101-2020_12_31_424971	385	27	EF	EF	NNP
10_1101-2020_12_31_424971	385	28	-	-	HYPH
10_1101-2020_12_31_424971	385	29	G	G	NNP
10_1101-2020_12_31_424971	385	30	or	or	CC
10_1101-2020_12_31_424971	385	31	,	,	,
10_1101-2020_12_31_424971	385	32	when	when	WRB
10_1101-2020_12_31_424971	385	33	specified	specify	VBN
10_1101-2020_12_31_424971	385	34	,	,	,
10_1101-2020_12_31_424971	385	35	in	in	IN
10_1101-2020_12_31_424971	385	36	the	the	DT
10_1101-2020_12_31_424971	385	37	872	872	CD
10_1101-2020_12_31_424971	385	38	presence	presence	NN
10_1101-2020_12_31_424971	385	39	of	of	IN
10_1101-2020_12_31_424971	385	40	a	a	DT
10_1101-2020_12_31_424971	385	41	2	2	CD
10_1101-2020_12_31_424971	385	42	µM	µM	NNP
10_1101-2020_12_31_424971	385	43	saturating	saturating	NN
10_1101-2020_12_31_424971	385	44	concentration	concentration	NN
10_1101-2020_12_31_424971	385	45	of	of	IN
10_1101-2020_12_31_424971	385	46	EF	EF	NNP
10_1101-2020_12_31_424971	385	47	-	-	HYPH
10_1101-2020_12_31_424971	385	48	G.	G.	NNP
10_1101-2020_12_31_424971	385	49	Stopped	Stopped	NNP
10_1101-2020_12_31_424971	385	50	-	-	HYPH
10_1101-2020_12_31_424971	385	51	flow	flow	NN
10_1101-2020_12_31_424971	385	52	experiments	experiment	NNS
10_1101-2020_12_31_424971	385	53	proceeded	proceed	VBN
10_1101-2020_12_31_424971	385	54	by	by	IN
10_1101-2020_12_31_424971	385	55	873	873	CD
10_1101-2020_12_31_424971	385	56	recording	record	VBG
10_1101-2020_12_31_424971	385	57	an	an	DT
10_1101-2020_12_31_424971	385	58	initial	initial	JJ
10_1101-2020_12_31_424971	385	59	pre	pre	JJ
10_1101-2020_12_31_424971	385	60	-	-	JJ
10_1101-2020_12_31_424971	385	61	steady	steady	JJ
10_1101-2020_12_31_424971	385	62	-	-	HYPH
10_1101-2020_12_31_424971	385	63	state	state	NN
10_1101-2020_12_31_424971	385	64	movie	movie	NN
10_1101-2020_12_31_424971	385	65	of	of	IN
10_1101-2020_12_31_424971	385	66	a	a	DT
10_1101-2020_12_31_424971	385	67	field	field	NN
10_1101-2020_12_31_424971	385	68	-	-	HYPH
10_1101-2020_12_31_424971	385	69	of	of	IN
10_1101-2020_12_31_424971	385	70	-	-	HYPH
10_1101-2020_12_31_424971	385	71	view	view	NN
10_1101-2020_12_31_424971	385	72	that	that	IN
10_1101-2020_12_31_424971	385	73	captured	capture	VBD
10_1101-2020_12_31_424971	385	74	conformational	conformational	JJ
10_1101-2020_12_31_424971	385	75	changes	change	NNS
10_1101-2020_12_31_424971	385	76	874	874	CD
10_1101-2020_12_31_424971	385	77	taking	take	VBG
10_1101-2020_12_31_424971	385	78	place	place	NN
10_1101-2020_12_31_424971	385	79	during	during	IN
10_1101-2020_12_31_424971	385	80	delivery	delivery	NN
10_1101-2020_12_31_424971	385	81	followed	follow	VBN
10_1101-2020_12_31_424971	385	82	by	by	IN
10_1101-2020_12_31_424971	385	83	recording	record	VBG
10_1101-2020_12_31_424971	385	84	of	of	IN
10_1101-2020_12_31_424971	385	85	one	one	CD
10_1101-2020_12_31_424971	385	86	or	or	CC
10_1101-2020_12_31_424971	385	87	more	more	RBR
10_1101-2020_12_31_424971	385	88	steady	steady	JJ
10_1101-2020_12_31_424971	385	89	-	-	HYPH
10_1101-2020_12_31_424971	385	90	state	state	NN
10_1101-2020_12_31_424971	385	91	movies	movie	NNS
10_1101-2020_12_31_424971	385	92	of	of	IN
10_1101-2020_12_31_424971	385	93	different	different	JJ
10_1101-2020_12_31_424971	385	94	875	875	CD
10_1101-2020_12_31_424971	385	95	fields	field	NNS
10_1101-2020_12_31_424971	385	96	-	-	HYPH
10_1101-2020_12_31_424971	385	97	of	of	IN
10_1101-2020_12_31_424971	385	98	-	-	HYPH
10_1101-2020_12_31_424971	385	99	view	view	NN
10_1101-2020_12_31_424971	385	100	that	that	IN
10_1101-2020_12_31_424971	385	101	captured	capture	VBD
10_1101-2020_12_31_424971	385	102	conformational	conformational	JJ
10_1101-2020_12_31_424971	385	103	changes	change	NNS
10_1101-2020_12_31_424971	385	104	taking	take	VBG
10_1101-2020_12_31_424971	385	105	place	place	NN
10_1101-2020_12_31_424971	385	106	the	the	DT
10_1101-2020_12_31_424971	385	107	specified	specified	JJ
10_1101-2020_12_31_424971	385	108	number	number	NN
10_1101-2020_12_31_424971	385	109	of	of	IN
10_1101-2020_12_31_424971	385	110	minutes	minute	NNS
10_1101-2020_12_31_424971	385	111	876	876	CD
10_1101-2020_12_31_424971	385	112	post	post	NN
10_1101-2020_12_31_424971	385	113	-	-	NN
10_1101-2020_12_31_424971	385	114	delivery	delivery	NN
10_1101-2020_12_31_424971	385	115	.	.	.
10_1101-2020_12_31_424971	386	1	877	877	CD
10_1101-2020_12_31_424971	386	2	878	878	CD
10_1101-2020_12_31_424971	386	3	Analysis	analysis	NN
10_1101-2020_12_31_424971	386	4	of	of	IN
10_1101-2020_12_31_424971	386	5	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	386	6	experiments	experiment	NNS
10_1101-2020_12_31_424971	386	7	.	.	.
10_1101-2020_12_31_424971	387	1	For	for	IN
10_1101-2020_12_31_424971	387	2	each	each	DT
10_1101-2020_12_31_424971	387	3	TIRF	TIRF	NNP
10_1101-2020_12_31_424971	387	4	microscopy	microscopy	JJ
10_1101-2020_12_31_424971	387	5	movie	movie	NN
10_1101-2020_12_31_424971	387	6	,	,	,
10_1101-2020_12_31_424971	387	7	we	-PRON-	PRP
10_1101-2020_12_31_424971	387	8	identified	identify	VBD
10_1101-2020_12_31_424971	387	9	879	879	CD
10_1101-2020_12_31_424971	387	10	fluorophores	fluorophore	NNS
10_1101-2020_12_31_424971	387	11	,	,	,
10_1101-2020_12_31_424971	387	12	aligned	align	VBN
10_1101-2020_12_31_424971	387	13	Cy3	cy3	NN
10_1101-2020_12_31_424971	387	14	and	and	CC
10_1101-2020_12_31_424971	387	15	Cy5	cy5	NN
10_1101-2020_12_31_424971	387	16	imaging	imaging	NN
10_1101-2020_12_31_424971	387	17	channels	channel	NNS
10_1101-2020_12_31_424971	387	18	,	,	,
10_1101-2020_12_31_424971	387	19	and	and	CC
10_1101-2020_12_31_424971	387	20	generated	generate	VBN
10_1101-2020_12_31_424971	387	21	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	387	22	intensity	intensity	NN
10_1101-2020_12_31_424971	387	23	vs.	vs.	IN
10_1101-2020_12_31_424971	387	24	880	880	CD
10_1101-2020_12_31_424971	387	25	.CC	.CC	NFP
10_1101-2020_12_31_424971	387	26	-	-	HYPH
10_1101-2020_12_31_424971	387	27	BY	by	IN
10_1101-2020_12_31_424971	387	28	-	-	HYPH
10_1101-2020_12_31_424971	387	29	NC	NC	NNP
10_1101-2020_12_31_424971	387	30	-	-	HYPH
10_1101-2020_12_31_424971	387	31	ND	ND	NNP
10_1101-2020_12_31_424971	387	32	4.0	4.0	CD
10_1101-2020_12_31_424971	387	33	International	International	NNP
10_1101-2020_12_31_424971	387	34	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	387	35	under	under	IN
10_1101-2020_12_31_424971	387	36	a	a	DT
10_1101-2020_12_31_424971	387	37	(	(	-LRB-
10_1101-2020_12_31_424971	387	38	which	which	WDT
10_1101-2020_12_31_424971	387	39	was	be	VBD
10_1101-2020_12_31_424971	387	40	not	not	RB
10_1101-2020_12_31_424971	387	41	certified	certify	VBN
10_1101-2020_12_31_424971	387	42	by	by	IN
10_1101-2020_12_31_424971	387	43	peer	peer	NN
10_1101-2020_12_31_424971	387	44	review	review	NN
10_1101-2020_12_31_424971	387	45	)	)	-RRB-
10_1101-2020_12_31_424971	387	46	is	be	VBZ
10_1101-2020_12_31_424971	387	47	the	the	DT
10_1101-2020_12_31_424971	387	48	author	author	NN
10_1101-2020_12_31_424971	387	49	/	/	SYM
10_1101-2020_12_31_424971	387	50	funder	funder	NN
10_1101-2020_12_31_424971	387	51	,	,	,
10_1101-2020_12_31_424971	387	52	who	who	WP
10_1101-2020_12_31_424971	387	53	has	have	VBZ
10_1101-2020_12_31_424971	387	54	granted	grant	VBN
10_1101-2020_12_31_424971	387	55	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	387	56	a	a	DT
10_1101-2020_12_31_424971	387	57	license	license	NN
10_1101-2020_12_31_424971	387	58	to	to	TO
10_1101-2020_12_31_424971	387	59	display	display	VB
10_1101-2020_12_31_424971	387	60	the	the	DT
10_1101-2020_12_31_424971	387	61	preprint	preprint	NN
10_1101-2020_12_31_424971	387	62	in	in	IN
10_1101-2020_12_31_424971	387	63	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	387	64	.	.	.
10_1101-2020_12_31_424971	388	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	388	2	is	be	VBZ
10_1101-2020_12_31_424971	388	3	made	make	VBN
10_1101-2020_12_31_424971	388	4	The	the	DT
10_1101-2020_12_31_424971	388	5	copyright	copyright	NN
10_1101-2020_12_31_424971	388	6	holder	holder	NN
10_1101-2020_12_31_424971	388	7	for	for	IN
10_1101-2020_12_31_424971	388	8	this	this	DT
10_1101-2020_12_31_424971	388	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	388	10	version	version	NN
10_1101-2020_12_31_424971	388	11	posted	post	VBD
10_1101-2020_12_31_424971	388	12	January	January	NNP
10_1101-2020_12_31_424971	388	13	2	2	CD
10_1101-2020_12_31_424971	388	14	,	,	,
10_1101-2020_12_31_424971	388	15	2021	2021	CD
10_1101-2020_12_31_424971	388	16	.	.	.
10_1101-2020_12_31_424971	388	17	;	;	:
10_1101-2020_12_31_424971	388	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	388	19	:	:	:
10_1101-2020_12_31_424971	388	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	388	21	preprint	preprint	NN
10_1101-2020_12_31_424971	388	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	388	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	388	24	36	36	CD
10_1101-2020_12_31_424971	388	25	time	time	NN
10_1101-2020_12_31_424971	388	26	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	388	27	for	for	IN
10_1101-2020_12_31_424971	388	28	each	each	DT
10_1101-2020_12_31_424971	388	29	pair	pair	NN
10_1101-2020_12_31_424971	388	30	of	of	IN
10_1101-2020_12_31_424971	388	31	Cy3	cy3	NN
10_1101-2020_12_31_424971	388	32	and	and	CC
10_1101-2020_12_31_424971	388	33	Cy5	cy5	NN
10_1101-2020_12_31_424971	388	34	fluorophores	fluorophore	NNS
10_1101-2020_12_31_424971	388	35	using	use	VBG
10_1101-2020_12_31_424971	388	36	custom	custom	RB
10_1101-2020_12_31_424971	388	37	-	-	HYPH
10_1101-2020_12_31_424971	388	38	written	write	VBN
10_1101-2020_12_31_424971	388	39	software	software	NN
10_1101-2020_12_31_424971	388	40	881	881	CD
10_1101-2020_12_31_424971	388	41	(	(	-LRB-
10_1101-2020_12_31_424971	388	42	manuscript	manuscript	NN
10_1101-2020_12_31_424971	388	43	in	in	IN
10_1101-2020_12_31_424971	388	44	preparation	preparation	NN
10_1101-2020_12_31_424971	388	45	;	;	:
10_1101-2020_12_31_424971	388	46	Jason	Jason	NNP
10_1101-2020_12_31_424971	388	47	Hon	Hon	NNP
10_1101-2020_12_31_424971	388	48	,	,	,
10_1101-2020_12_31_424971	388	49	Colin	Colin	NNP
10_1101-2020_12_31_424971	388	50	Kinz	Kinz	NNP
10_1101-2020_12_31_424971	388	51	-	-	HYPH
10_1101-2020_12_31_424971	388	52	Thompson	Thompson	NNP
10_1101-2020_12_31_424971	388	53	,	,	,
10_1101-2020_12_31_424971	388	54	Ruben	Ruben	NNP
10_1101-2020_12_31_424971	388	55	L.	L.	NNP
10_1101-2020_12_31_424971	388	56	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	388	57	)	)	-RRB-
10_1101-2020_12_31_424971	388	58	as	as	IN
10_1101-2020_12_31_424971	388	59	described	describe	VBD
10_1101-2020_12_31_424971	388	60	882	882	CD
10_1101-2020_12_31_424971	388	61	previously66	previously66	NN
10_1101-2020_12_31_424971	388	62	.	.	.
10_1101-2020_12_31_424971	389	1	For	for	IN
10_1101-2020_12_31_424971	389	2	each	each	DT
10_1101-2020_12_31_424971	389	3	time	time	NN
10_1101-2020_12_31_424971	389	4	point	point	NN
10_1101-2020_12_31_424971	389	5	,	,	,
10_1101-2020_12_31_424971	389	6	Cy5	cy5	NN
10_1101-2020_12_31_424971	389	7	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	389	8	intensity	intensity	NN
10_1101-2020_12_31_424971	389	9	values	value	NNS
10_1101-2020_12_31_424971	389	10	were	be	VBD
10_1101-2020_12_31_424971	389	11	corrected	correct	VBN
10_1101-2020_12_31_424971	389	12	for	for	IN
10_1101-2020_12_31_424971	389	13	Cy3	cy3	CD
10_1101-2020_12_31_424971	389	14	883	883	CD
10_1101-2020_12_31_424971	389	15	bleedthrough	bleedthrough	NN
10_1101-2020_12_31_424971	389	16	by	by	IN
10_1101-2020_12_31_424971	389	17	subtracting	subtract	VBG
10_1101-2020_12_31_424971	389	18	5	5	CD
10_1101-2020_12_31_424971	389	19	%	%	NN
10_1101-2020_12_31_424971	389	20	of	of	IN
10_1101-2020_12_31_424971	389	21	the	the	DT
10_1101-2020_12_31_424971	389	22	Cy3	Cy3	NNP
10_1101-2020_12_31_424971	389	23	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	389	24	intensity	intensity	NN
10_1101-2020_12_31_424971	389	25	value	value	NN
10_1101-2020_12_31_424971	389	26	in	in	IN
10_1101-2020_12_31_424971	389	27	the	the	DT
10_1101-2020_12_31_424971	389	28	corresponding	corresponding	JJ
10_1101-2020_12_31_424971	389	29	Cy3	cy3	CD
10_1101-2020_12_31_424971	389	30	884	884	CD
10_1101-2020_12_31_424971	389	31	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	389	32	intensity	intensity	NN
10_1101-2020_12_31_424971	389	33	vs.	vs.	IN
10_1101-2020_12_31_424971	389	34	time	time	NN
10_1101-2020_12_31_424971	389	35	trajectory	trajectory	CD
10_1101-2020_12_31_424971	389	36	.	.	.
10_1101-2020_12_31_424971	390	1	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	390	2	vs.	vs.	IN
10_1101-2020_12_31_424971	390	3	time	time	NN
10_1101-2020_12_31_424971	390	4	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	390	5	were	be	VBD
10_1101-2020_12_31_424971	390	6	generated	generate	VBN
10_1101-2020_12_31_424971	390	7	by	by	IN
10_1101-2020_12_31_424971	390	8	using	use	VBG
10_1101-2020_12_31_424971	390	9	the	the	DT
10_1101-2020_12_31_424971	390	10	885	885	CD
10_1101-2020_12_31_424971	390	11	Cy3	cy3	CD
10_1101-2020_12_31_424971	390	12	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	390	13	intensity	intensity	NN
10_1101-2020_12_31_424971	390	14	(	(	-LRB-
10_1101-2020_12_31_424971	390	15	ICy3	ICy3	NNP
10_1101-2020_12_31_424971	390	16	)	)	-RRB-
10_1101-2020_12_31_424971	390	17	and	and	CC
10_1101-2020_12_31_424971	390	18	the	the	DT
10_1101-2020_12_31_424971	390	19	bleedthrough	bleedthrough	RB
10_1101-2020_12_31_424971	390	20	-	-	HYPH
10_1101-2020_12_31_424971	390	21	corrected	correct	VBN
10_1101-2020_12_31_424971	390	22	Cy5	cy5	NN
10_1101-2020_12_31_424971	390	23	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	390	24	intensity	intensity	NN
10_1101-2020_12_31_424971	390	25	(	(	-LRB-
10_1101-2020_12_31_424971	390	26	ICy5	ICy5	NNP
10_1101-2020_12_31_424971	390	27	)	)	-RRB-
10_1101-2020_12_31_424971	390	28	886	886	CD
10_1101-2020_12_31_424971	390	29	from	from	IN
10_1101-2020_12_31_424971	390	30	each	each	DT
10_1101-2020_12_31_424971	390	31	aligned	align	VBN
10_1101-2020_12_31_424971	390	32	pair	pair	NN
10_1101-2020_12_31_424971	390	33	of	of	IN
10_1101-2020_12_31_424971	390	34	Cy3	cy3	NN
10_1101-2020_12_31_424971	390	35	and	and	CC
10_1101-2020_12_31_424971	390	36	Cy5	cy5	NN
10_1101-2020_12_31_424971	390	37	fluorophores	fluorophore	NNS
10_1101-2020_12_31_424971	390	38	to	to	TO
10_1101-2020_12_31_424971	390	39	calculate	calculate	VB
10_1101-2020_12_31_424971	390	40	the	the	DT
10_1101-2020_12_31_424971	390	41	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	390	42	value	value	NN
10_1101-2020_12_31_424971	390	43	at	at	IN
10_1101-2020_12_31_424971	390	44	each	each	DT
10_1101-2020_12_31_424971	390	45	time	time	NN
10_1101-2020_12_31_424971	390	46	point	point	NN
10_1101-2020_12_31_424971	390	47	887	887	CD
10_1101-2020_12_31_424971	390	48	using	use	VBG
10_1101-2020_12_31_424971	390	49	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	390	50	=	=	NFP
10_1101-2020_12_31_424971	390	51	(	(	-LRB-
10_1101-2020_12_31_424971	390	52	ICy5	ICy5	NNP
10_1101-2020_12_31_424971	390	53	/	/	,
10_1101-2020_12_31_424971	390	54	(	(	-LRB-
10_1101-2020_12_31_424971	390	55	ICy5	ICy5	NNP
10_1101-2020_12_31_424971	390	56	+	+	SYM
10_1101-2020_12_31_424971	390	57	ICy3	ICy3	NNP
10_1101-2020_12_31_424971	390	58	)	)	-RRB-
10_1101-2020_12_31_424971	390	59	)	)	-RRB-
10_1101-2020_12_31_424971	390	60	.	.	.
10_1101-2020_12_31_424971	391	1	888	888	CD
10_1101-2020_12_31_424971	391	2	For	for	IN
10_1101-2020_12_31_424971	391	3	both	both	DT
10_1101-2020_12_31_424971	391	4	pre	pre	JJ
10_1101-2020_12_31_424971	391	5	-	-	JJ
10_1101-2020_12_31_424971	391	6	steady	steady	JJ
10_1101-2020_12_31_424971	391	7	-	-	HYPH
10_1101-2020_12_31_424971	391	8	state	state	NN
10_1101-2020_12_31_424971	391	9	and	and	CC
10_1101-2020_12_31_424971	391	10	steady	steady	JJ
10_1101-2020_12_31_424971	391	11	-	-	HYPH
10_1101-2020_12_31_424971	391	12	state	state	NN
10_1101-2020_12_31_424971	391	13	movies	movie	NNS
10_1101-2020_12_31_424971	391	14	(	(	-LRB-
10_1101-2020_12_31_424971	391	15	Figures	figure	NNS
10_1101-2020_12_31_424971	391	16	6d-6h	6d-6h	CD
10_1101-2020_12_31_424971	391	17	and	and	CC
10_1101-2020_12_31_424971	391	18	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	391	19	889	889	CD
10_1101-2020_12_31_424971	391	20	Figures	figure	NNS
10_1101-2020_12_31_424971	391	21	3	3	CD
10_1101-2020_12_31_424971	391	22	,	,	,
10_1101-2020_12_31_424971	391	23	5	5	CD
10_1101-2020_12_31_424971	391	24	,	,	,
10_1101-2020_12_31_424971	391	25	and	and	CC
10_1101-2020_12_31_424971	391	26	6	6	CD
10_1101-2020_12_31_424971	391	27	,	,	,
10_1101-2020_12_31_424971	391	28	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	391	29	Tables	Tables	NNP
10_1101-2020_12_31_424971	391	30	4	4	CD
10_1101-2020_12_31_424971	391	31	-	-	SYM
10_1101-2020_12_31_424971	391	32	7	7	CD
10_1101-2020_12_31_424971	391	33	)	)	-RRB-
10_1101-2020_12_31_424971	391	34	,	,	,
10_1101-2020_12_31_424971	391	35	an	an	DT
10_1101-2020_12_31_424971	391	36	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	391	37	vs.	vs.	NN
10_1101-2020_12_31_424971	391	38	time	time	NN
10_1101-2020_12_31_424971	391	39	trajectory	trajectory	CD
10_1101-2020_12_31_424971	391	40	was	be	VBD
10_1101-2020_12_31_424971	391	41	selected	select	VBN
10_1101-2020_12_31_424971	391	42	for	for	IN
10_1101-2020_12_31_424971	391	43	890	890	CD
10_1101-2020_12_31_424971	391	44	further	further	JJ
10_1101-2020_12_31_424971	391	45	analysis	analysis	NN
10_1101-2020_12_31_424971	391	46	if	if	IN
10_1101-2020_12_31_424971	391	47	all	all	DT
10_1101-2020_12_31_424971	391	48	of	of	IN
10_1101-2020_12_31_424971	391	49	the	the	DT
10_1101-2020_12_31_424971	391	50	transitions	transition	NNS
10_1101-2020_12_31_424971	391	51	in	in	IN
10_1101-2020_12_31_424971	391	52	the	the	DT
10_1101-2020_12_31_424971	391	53	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	391	54	intensity	intensity	NN
10_1101-2020_12_31_424971	391	55	vs.	vs.	IN
10_1101-2020_12_31_424971	391	56	time	time	NN
10_1101-2020_12_31_424971	391	57	trajectory	trajectory	CD
10_1101-2020_12_31_424971	391	58	were	be	VBD
10_1101-2020_12_31_424971	391	59	anti-891	anti-891	NNP
10_1101-2020_12_31_424971	391	60	correlated	correlate	VBN
10_1101-2020_12_31_424971	391	61	for	for	IN
10_1101-2020_12_31_424971	391	62	the	the	DT
10_1101-2020_12_31_424971	391	63	corresponding	corresponding	JJ
10_1101-2020_12_31_424971	391	64	,	,	,
10_1101-2020_12_31_424971	391	65	aligned	align	VBN
10_1101-2020_12_31_424971	391	66	pair	pair	NN
10_1101-2020_12_31_424971	391	67	of	of	IN
10_1101-2020_12_31_424971	391	68	Cy3	cy3	NN
10_1101-2020_12_31_424971	391	69	and	and	CC
10_1101-2020_12_31_424971	391	70	Cy5	cy5	NN
10_1101-2020_12_31_424971	391	71	fluorophores	fluorophore	NNS
10_1101-2020_12_31_424971	391	72	,	,	,
10_1101-2020_12_31_424971	391	73	and	and	CC
10_1101-2020_12_31_424971	391	74	the	the	DT
10_1101-2020_12_31_424971	391	75	Cy3	cy3	CD
10_1101-2020_12_31_424971	391	76	892	892	CD
10_1101-2020_12_31_424971	391	77	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	391	78	intensity	intensity	NN
10_1101-2020_12_31_424971	391	79	vs.	vs.	NN
10_1101-2020_12_31_424971	391	80	time	time	NN
10_1101-2020_12_31_424971	391	81	trajectory	trajectory	CD
10_1101-2020_12_31_424971	391	82	underwent	undergo	VBD
10_1101-2020_12_31_424971	391	83	single	single	JJ
10_1101-2020_12_31_424971	391	84	-	-	HYPH
10_1101-2020_12_31_424971	391	85	step	step	NN
10_1101-2020_12_31_424971	391	86	Cy3	cy3	NN
10_1101-2020_12_31_424971	391	87	photobleaching	photobleaching	NN
10_1101-2020_12_31_424971	391	88	,	,	,
10_1101-2020_12_31_424971	391	89	893	893	CD
10_1101-2020_12_31_424971	391	90	demonstrating	demonstrate	VBG
10_1101-2020_12_31_424971	391	91	it	-PRON-	PRP
10_1101-2020_12_31_424971	391	92	arose	arise	VBD
10_1101-2020_12_31_424971	391	93	from	from	IN
10_1101-2020_12_31_424971	391	94	a	a	DT
10_1101-2020_12_31_424971	391	95	single	single	JJ
10_1101-2020_12_31_424971	391	96	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	391	97	complex	complex	NN
10_1101-2020_12_31_424971	391	98	.	.	.
10_1101-2020_12_31_424971	392	1	In	in	IN
10_1101-2020_12_31_424971	392	2	the	the	DT
10_1101-2020_12_31_424971	392	3	case	case	NN
10_1101-2020_12_31_424971	392	4	of	of	IN
10_1101-2020_12_31_424971	392	5	pre	pre	JJ
10_1101-2020_12_31_424971	392	6	-	-	JJ
10_1101-2020_12_31_424971	392	7	steady	steady	JJ
10_1101-2020_12_31_424971	392	8	-	-	HYPH
10_1101-2020_12_31_424971	392	9	state	state	NN
10_1101-2020_12_31_424971	392	10	movies	movie	NNS
10_1101-2020_12_31_424971	392	11	894	894	CD
10_1101-2020_12_31_424971	392	12	(	(	-LRB-
10_1101-2020_12_31_424971	392	13	Figures	figure	NNS
10_1101-2020_12_31_424971	392	14	6d-6	6d-6	CD
10_1101-2020_12_31_424971	392	15	g	g	NN
10_1101-2020_12_31_424971	392	16	,	,	,
10_1101-2020_12_31_424971	392	17	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	392	18	Figures	Figures	NNPS
10_1101-2020_12_31_424971	392	19	3	3	CD
10_1101-2020_12_31_424971	392	20	and	and	CC
10_1101-2020_12_31_424971	392	21	5	5	CD
10_1101-2020_12_31_424971	392	22	and	and	CC
10_1101-2020_12_31_424971	392	23	Tables	Tables	NNP
10_1101-2020_12_31_424971	392	24	4	4	CD
10_1101-2020_12_31_424971	392	25	-	-	SYM
10_1101-2020_12_31_424971	392	26	6	6	CD
10_1101-2020_12_31_424971	392	27	)	)	-RRB-
10_1101-2020_12_31_424971	392	28	,	,	,
10_1101-2020_12_31_424971	392	29	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	392	30	vs.	vs.	IN
10_1101-2020_12_31_424971	392	31	time	time	NN
10_1101-2020_12_31_424971	392	32	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	392	33	had	have	VBD
10_1101-2020_12_31_424971	392	34	895	895	CD
10_1101-2020_12_31_424971	392	35	to	to	TO
10_1101-2020_12_31_424971	392	36	meet	meet	VB
10_1101-2020_12_31_424971	392	37	two	two	CD
10_1101-2020_12_31_424971	392	38	additional	additional	JJ
10_1101-2020_12_31_424971	392	39	criteria	criterion	NNS
10_1101-2020_12_31_424971	392	40	in	in	IN
10_1101-2020_12_31_424971	392	41	order	order	NN
10_1101-2020_12_31_424971	392	42	to	to	TO
10_1101-2020_12_31_424971	392	43	be	be	VB
10_1101-2020_12_31_424971	392	44	selected	select	VBN
10_1101-2020_12_31_424971	392	45	for	for	IN
10_1101-2020_12_31_424971	392	46	further	further	JJ
10_1101-2020_12_31_424971	392	47	analysis	analysis	NN
10_1101-2020_12_31_424971	392	48	:	:	:
10_1101-2020_12_31_424971	392	49	(	(	-LRB-
10_1101-2020_12_31_424971	392	50	i	i	NN
10_1101-2020_12_31_424971	392	51	)	)	-RRB-
10_1101-2020_12_31_424971	392	52	EFRET	efret	FW
10_1101-2020_12_31_424971	392	53	vs.	vs.	NN
10_1101-2020_12_31_424971	392	54	time	time	NN
10_1101-2020_12_31_424971	392	55	896	896	CD
10_1101-2020_12_31_424971	392	56	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	392	57	had	have	VBD
10_1101-2020_12_31_424971	392	58	to	to	TO
10_1101-2020_12_31_424971	392	59	be	be	VB
10_1101-2020_12_31_424971	392	60	stably	stably	RB
10_1101-2020_12_31_424971	392	61	sampling	sample	VBG
10_1101-2020_12_31_424971	392	62	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	392	63	=	=	NFP
10_1101-2020_12_31_424971	392	64	0.55	0.55	CD
10_1101-2020_12_31_424971	392	65	prior	prior	RB
10_1101-2020_12_31_424971	392	66	to	to	IN
10_1101-2020_12_31_424971	392	67	TC	TC	NNP
10_1101-2020_12_31_424971	392	68	delivery	delivery	NN
10_1101-2020_12_31_424971	392	69	,	,	,
10_1101-2020_12_31_424971	392	70	thereby	thereby	RB
10_1101-2020_12_31_424971	392	71	confirming	confirm	VBG
10_1101-2020_12_31_424971	392	72	that	that	IN
10_1101-2020_12_31_424971	392	73	897	897	CD
10_1101-2020_12_31_424971	392	74	the	the	DT
10_1101-2020_12_31_424971	392	75	corresponding	correspond	VBG
10_1101-2020_12_31_424971	392	76	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	392	77	complex	complex	NN
10_1101-2020_12_31_424971	392	78	was	be	VBD
10_1101-2020_12_31_424971	392	79	a	a	DT
10_1101-2020_12_31_424971	392	80	70S	70S	NNP
10_1101-2020_12_31_424971	392	81	IC	IC	NNP
10_1101-2020_12_31_424971	392	82	carrying	carry	VBG
10_1101-2020_12_31_424971	392	83	an	an	DT
10_1101-2020_12_31_424971	392	84	fMet	fMet	NNP
10_1101-2020_12_31_424971	392	85	-	-	HYPH
10_1101-2020_12_31_424971	392	86	tRNAfMet	tRNAfMet	NNP
10_1101-2020_12_31_424971	392	87	at	at	IN
10_1101-2020_12_31_424971	392	88	the	the	DT
10_1101-2020_12_31_424971	392	89	P	p	NN
10_1101-2020_12_31_424971	392	90	site	site	NN
10_1101-2020_12_31_424971	392	91	and	and	CC
10_1101-2020_12_31_424971	392	92	898	898	CD
10_1101-2020_12_31_424971	392	93	(	(	-LRB-
10_1101-2020_12_31_424971	392	94	ii	ii	NN
10_1101-2020_12_31_424971	392	95	)	)	-RRB-
10_1101-2020_12_31_424971	392	96	EFRET	efret	FW
10_1101-2020_12_31_424971	392	97	vs.	vs.	NN
10_1101-2020_12_31_424971	392	98	time	time	NN
10_1101-2020_12_31_424971	392	99	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	392	100	had	have	VBD
10_1101-2020_12_31_424971	392	101	to	to	TO
10_1101-2020_12_31_424971	392	102	exhibit	exhibit	VB
10_1101-2020_12_31_424971	392	103	at	at	RB
10_1101-2020_12_31_424971	392	104	least	least	RBS
10_1101-2020_12_31_424971	392	105	one	one	CD
10_1101-2020_12_31_424971	392	106	0.55→0.31	0.55→0.31	CD
10_1101-2020_12_31_424971	392	107	transition	transition	NN
10_1101-2020_12_31_424971	392	108	after	after	IN
10_1101-2020_12_31_424971	392	109	delivery	delivery	NN
10_1101-2020_12_31_424971	392	110	of	of	IN
10_1101-2020_12_31_424971	392	111	TCs	tc	NNS
10_1101-2020_12_31_424971	392	112	,	,	,
10_1101-2020_12_31_424971	392	113	899	899	CD
10_1101-2020_12_31_424971	392	114	thereby	thereby	RB
10_1101-2020_12_31_424971	392	115	confirming	confirm	VBG
10_1101-2020_12_31_424971	392	116	that	that	IN
10_1101-2020_12_31_424971	392	117	the	the	DT
10_1101-2020_12_31_424971	392	118	corresponding	correspond	VBG
10_1101-2020_12_31_424971	392	119	70S	70S	NNP
10_1101-2020_12_31_424971	392	120	IC	IC	NNP
10_1101-2020_12_31_424971	392	121	had	have	VBD
10_1101-2020_12_31_424971	392	122	accommodated	accommodate	VBN
10_1101-2020_12_31_424971	392	123	a	a	DT
10_1101-2020_12_31_424971	392	124	Pro	Pro	NNP
10_1101-2020_12_31_424971	392	125	-	-	JJ
10_1101-2020_12_31_424971	392	126	SufB2	sufb2	JJ
10_1101-2020_12_31_424971	392	127	or	or	CC
10_1101-2020_12_31_424971	392	128	Pro	pro	JJ
10_1101-2020_12_31_424971	392	129	-	-	JJ
10_1101-2020_12_31_424971	392	130	ProL	ProL	NNP
10_1101-2020_12_31_424971	392	131	900	900	CD
10_1101-2020_12_31_424971	392	132	into	into	IN
10_1101-2020_12_31_424971	392	133	the	the	DT
10_1101-2020_12_31_424971	392	134	A	A	NNP
10_1101-2020_12_31_424971	392	135	site	site	NN
10_1101-2020_12_31_424971	392	136	,	,	,
10_1101-2020_12_31_424971	392	137	that	that	IN
10_1101-2020_12_31_424971	392	138	the	the	DT
10_1101-2020_12_31_424971	392	139	A	a	DT
10_1101-2020_12_31_424971	392	140	site	site	NN
10_1101-2020_12_31_424971	392	141	-	-	HYPH
10_1101-2020_12_31_424971	392	142	bound	bind	VBN
10_1101-2020_12_31_424971	392	143	Pro	pro	JJ
10_1101-2020_12_31_424971	392	144	-	-	JJ
10_1101-2020_12_31_424971	392	145	SufB2	sufb2	JJ
10_1101-2020_12_31_424971	392	146	or	or	CC
10_1101-2020_12_31_424971	392	147	Pro	pro	JJ
10_1101-2020_12_31_424971	392	148	-	-	JJ
10_1101-2020_12_31_424971	392	149	ProL	ProL	NNP
10_1101-2020_12_31_424971	392	150	had	have	VBD
10_1101-2020_12_31_424971	392	151	participated	participate	VBN
10_1101-2020_12_31_424971	392	152	as	as	IN
10_1101-2020_12_31_424971	392	153	the	the	DT
10_1101-2020_12_31_424971	392	154	acceptor	acceptor	NN
10_1101-2020_12_31_424971	392	155	in	in	IN
10_1101-2020_12_31_424971	392	156	901	901	CD
10_1101-2020_12_31_424971	392	157	peptide	peptide	NN
10_1101-2020_12_31_424971	392	158	-	-	HYPH
10_1101-2020_12_31_424971	392	159	bond	bond	NN
10_1101-2020_12_31_424971	392	160	formation	formation	NN
10_1101-2020_12_31_424971	392	161	,	,	,
10_1101-2020_12_31_424971	392	162	and	and	CC
10_1101-2020_12_31_424971	392	163	that	that	IN
10_1101-2020_12_31_424971	392	164	the	the	DT
10_1101-2020_12_31_424971	392	165	resulting	result	VBG
10_1101-2020_12_31_424971	392	166	PRE	PRE	NNP
10_1101-2020_12_31_424971	392	167	complex	complex	NN
10_1101-2020_12_31_424971	392	168	was	be	VBD
10_1101-2020_12_31_424971	392	169	capable	capable	JJ
10_1101-2020_12_31_424971	392	170	of	of	IN
10_1101-2020_12_31_424971	392	171	undergoing	undergo	VBG
10_1101-2020_12_31_424971	392	172	902	902	CD
10_1101-2020_12_31_424971	392	173	GS1→GS2	GS1→GS2	NNP
10_1101-2020_12_31_424971	392	174	transitions	transition	NNS
10_1101-2020_12_31_424971	392	175	.	.	.
10_1101-2020_12_31_424971	393	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	393	2	note	note	VBP
10_1101-2020_12_31_424971	393	3	that	that	IN
10_1101-2020_12_31_424971	393	4	the	the	DT
10_1101-2020_12_31_424971	393	5	second	second	JJ
10_1101-2020_12_31_424971	393	6	criterion	criterion	NN
10_1101-2020_12_31_424971	393	7	might	may	MD
10_1101-2020_12_31_424971	393	8	result	result	VB
10_1101-2020_12_31_424971	393	9	in	in	IN
10_1101-2020_12_31_424971	393	10	the	the	DT
10_1101-2020_12_31_424971	393	11	exclusion	exclusion	NN
10_1101-2020_12_31_424971	393	12	of	of	IN
10_1101-2020_12_31_424971	393	13	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	393	14	vs.	vs.	NN
10_1101-2020_12_31_424971	393	15	903	903	CD
10_1101-2020_12_31_424971	393	16	time	time	NN
10_1101-2020_12_31_424971	393	17	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	393	18	in	in	IN
10_1101-2020_12_31_424971	393	19	which	which	WDT
10_1101-2020_12_31_424971	393	20	Cy3	cy3	NN
10_1101-2020_12_31_424971	393	21	or	or	CC
10_1101-2020_12_31_424971	393	22	Cy5	cy5	NN
10_1101-2020_12_31_424971	393	23	simply	simply	RB
10_1101-2020_12_31_424971	393	24	photobleached	photobleache	VBN
10_1101-2020_12_31_424971	393	25	prior	prior	RB
10_1101-2020_12_31_424971	393	26	to	to	IN
10_1101-2020_12_31_424971	393	27	undergoing	undergo	VBG
10_1101-2020_12_31_424971	393	28	a	a	DT
10_1101-2020_12_31_424971	393	29	0.55→0.31	0.55→0.31	NNP
10_1101-2020_12_31_424971	393	30	904	904	CD
10_1101-2020_12_31_424971	393	31	transition	transition	NN
10_1101-2020_12_31_424971	393	32	,	,	,
10_1101-2020_12_31_424971	393	33	and	and	CC
10_1101-2020_12_31_424971	393	34	could	could	MD
10_1101-2020_12_31_424971	393	35	therefore	therefore	RB
10_1101-2020_12_31_424971	393	36	result	result	VB
10_1101-2020_12_31_424971	393	37	in	in	IN
10_1101-2020_12_31_424971	393	38	a	a	DT
10_1101-2020_12_31_424971	393	39	slight	slight	JJ
10_1101-2020_12_31_424971	393	40	overestimation	overestimation	NN
10_1101-2020_12_31_424971	393	41	of	of	IN
10_1101-2020_12_31_424971	393	42	k70S	k70s	ADD
10_1101-2020_12_31_424971	393	43	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	393	44	and/or	and/or	CC
10_1101-2020_12_31_424971	393	45	kGS1→GS2	kGS1→GS2	NNP
10_1101-2020_12_31_424971	393	46	(	(	-LRB-
10_1101-2020_12_31_424971	393	47	see	see	VB
10_1101-2020_12_31_424971	393	48	905	905	CD
10_1101-2020_12_31_424971	393	49	below	below	IN
10_1101-2020_12_31_424971	393	50	for	for	IN
10_1101-2020_12_31_424971	393	51	a	a	DT
10_1101-2020_12_31_424971	393	52	detailed	detailed	JJ
10_1101-2020_12_31_424971	393	53	description	description	NN
10_1101-2020_12_31_424971	393	54	of	of	IN
10_1101-2020_12_31_424971	393	55	how	how	WRB
10_1101-2020_12_31_424971	393	56	k70S	k70S	NNP
10_1101-2020_12_31_424971	393	57	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	393	58	,	,	,
10_1101-2020_12_31_424971	393	59	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	393	60	,	,	,
10_1101-2020_12_31_424971	393	61	and	and	CC
10_1101-2020_12_31_424971	393	62	other	other	JJ
10_1101-2020_12_31_424971	393	63	kinetic	kinetic	NN
10_1101-2020_12_31_424971	393	64	and	and	CC
10_1101-2020_12_31_424971	393	65	thermodynamic	thermodynamic	JJ
10_1101-2020_12_31_424971	393	66	906	906	CD
10_1101-2020_12_31_424971	393	67	.CC	.CC	,
10_1101-2020_12_31_424971	393	68	-	-	HYPH
10_1101-2020_12_31_424971	393	69	BY	by	IN
10_1101-2020_12_31_424971	393	70	-	-	HYPH
10_1101-2020_12_31_424971	393	71	NC	NC	NNP
10_1101-2020_12_31_424971	393	72	-	-	HYPH
10_1101-2020_12_31_424971	393	73	ND	ND	NNP
10_1101-2020_12_31_424971	393	74	4.0	4.0	CD
10_1101-2020_12_31_424971	393	75	International	International	NNP
10_1101-2020_12_31_424971	393	76	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	393	77	under	under	IN
10_1101-2020_12_31_424971	393	78	a	a	DT
10_1101-2020_12_31_424971	393	79	(	(	-LRB-
10_1101-2020_12_31_424971	393	80	which	which	WDT
10_1101-2020_12_31_424971	393	81	was	be	VBD
10_1101-2020_12_31_424971	393	82	not	not	RB
10_1101-2020_12_31_424971	393	83	certified	certify	VBN
10_1101-2020_12_31_424971	393	84	by	by	IN
10_1101-2020_12_31_424971	393	85	peer	peer	NN
10_1101-2020_12_31_424971	393	86	review	review	NN
10_1101-2020_12_31_424971	393	87	)	)	-RRB-
10_1101-2020_12_31_424971	393	88	is	be	VBZ
10_1101-2020_12_31_424971	393	89	the	the	DT
10_1101-2020_12_31_424971	393	90	author	author	NN
10_1101-2020_12_31_424971	393	91	/	/	SYM
10_1101-2020_12_31_424971	393	92	funder	funder	NN
10_1101-2020_12_31_424971	393	93	,	,	,
10_1101-2020_12_31_424971	393	94	who	who	WP
10_1101-2020_12_31_424971	393	95	has	have	VBZ
10_1101-2020_12_31_424971	393	96	granted	grant	VBN
10_1101-2020_12_31_424971	393	97	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	393	98	a	a	DT
10_1101-2020_12_31_424971	393	99	license	license	NN
10_1101-2020_12_31_424971	393	100	to	to	TO
10_1101-2020_12_31_424971	393	101	display	display	VB
10_1101-2020_12_31_424971	393	102	the	the	DT
10_1101-2020_12_31_424971	393	103	preprint	preprint	NN
10_1101-2020_12_31_424971	393	104	in	in	IN
10_1101-2020_12_31_424971	393	105	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	393	106	.	.	.
10_1101-2020_12_31_424971	394	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	394	2	is	be	VBZ
10_1101-2020_12_31_424971	394	3	made	make	VBN
10_1101-2020_12_31_424971	394	4	The	the	DT
10_1101-2020_12_31_424971	394	5	copyright	copyright	NN
10_1101-2020_12_31_424971	394	6	holder	holder	NN
10_1101-2020_12_31_424971	394	7	for	for	IN
10_1101-2020_12_31_424971	394	8	this	this	DT
10_1101-2020_12_31_424971	394	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	394	10	version	version	NN
10_1101-2020_12_31_424971	394	11	posted	post	VBD
10_1101-2020_12_31_424971	394	12	January	January	NNP
10_1101-2020_12_31_424971	394	13	2	2	CD
10_1101-2020_12_31_424971	394	14	,	,	,
10_1101-2020_12_31_424971	394	15	2021	2021	CD
10_1101-2020_12_31_424971	394	16	.	.	.
10_1101-2020_12_31_424971	394	17	;	;	:
10_1101-2020_12_31_424971	394	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	394	19	:	:	:
10_1101-2020_12_31_424971	394	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	394	21	preprint	preprint	NN
10_1101-2020_12_31_424971	394	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	394	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	394	24	37	37	CD
10_1101-2020_12_31_424971	394	25	parameters	parameter	NNS
10_1101-2020_12_31_424971	394	26	were	be	VBD
10_1101-2020_12_31_424971	394	27	estimated	estimate	VBN
10_1101-2020_12_31_424971	394	28	)	)	-RRB-
10_1101-2020_12_31_424971	394	29	.	.	.
10_1101-2020_12_31_424971	395	1	Nonetheless	nonetheless	RB
10_1101-2020_12_31_424971	395	2	,	,	,
10_1101-2020_12_31_424971	395	3	the	the	DT
10_1101-2020_12_31_424971	395	4	number	number	NN
10_1101-2020_12_31_424971	395	5	of	of	IN
10_1101-2020_12_31_424971	395	6	such	such	JJ
10_1101-2020_12_31_424971	395	7	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	395	8	vs.	vs.	IN
10_1101-2020_12_31_424971	395	9	time	time	NN
10_1101-2020_12_31_424971	395	10	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	395	11	should	should	MD
10_1101-2020_12_31_424971	395	12	907	907	CD
10_1101-2020_12_31_424971	395	13	be	be	VB
10_1101-2020_12_31_424971	395	14	exceedingly	exceedingly	RB
10_1101-2020_12_31_424971	395	15	small	small	JJ
10_1101-2020_12_31_424971	395	16	.	.	.
10_1101-2020_12_31_424971	396	1	This	this	DT
10_1101-2020_12_31_424971	396	2	is	be	VBZ
10_1101-2020_12_31_424971	396	3	because	because	IN
10_1101-2020_12_31_424971	396	4	the	the	DT
10_1101-2020_12_31_424971	396	5	rates	rate	NNS
10_1101-2020_12_31_424971	396	6	with	with	IN
10_1101-2020_12_31_424971	396	7	which	which	WDT
10_1101-2020_12_31_424971	396	8	the	the	DT
10_1101-2020_12_31_424971	396	9	fluorophore	fluorophore	NN
10_1101-2020_12_31_424971	396	10	that	that	WDT
10_1101-2020_12_31_424971	396	11	photobleached	photobleache	VBD
10_1101-2020_12_31_424971	396	12	908	908	CD
10_1101-2020_12_31_424971	396	13	the	the	DT
10_1101-2020_12_31_424971	396	14	fastest	fast	JJS
10_1101-2020_12_31_424971	396	15	,	,	,
10_1101-2020_12_31_424971	396	16	Cy5	cy5	NN
10_1101-2020_12_31_424971	396	17	,	,	,
10_1101-2020_12_31_424971	396	18	entered	enter	VBD
10_1101-2020_12_31_424971	396	19	into	into	IN
10_1101-2020_12_31_424971	396	20	the	the	DT
10_1101-2020_12_31_424971	396	21	photobleached	photobleache	VBN
10_1101-2020_12_31_424971	396	22	state	state	NN
10_1101-2020_12_31_424971	396	23	(	(	-LRB-
10_1101-2020_12_31_424971	396	24	Æ	æ	NN
10_1101-2020_12_31_424971	396	25	)	)	-RRB-
10_1101-2020_12_31_424971	396	26	from	from	IN
10_1101-2020_12_31_424971	396	27	the	the	DT
10_1101-2020_12_31_424971	396	28	GS1	GS1	NNP
10_1101-2020_12_31_424971	396	29	,	,	,
10_1101-2020_12_31_424971	396	30	GS2	GS2	NNP
10_1101-2020_12_31_424971	396	31	,	,	,
10_1101-2020_12_31_424971	396	32	EF	EF	NNP
10_1101-2020_12_31_424971	396	33	-	-	HYPH
10_1101-2020_12_31_424971	396	34	G	G	NNP
10_1101-2020_12_31_424971	396	35	-	-	HYPH
10_1101-2020_12_31_424971	396	36	bound	bind	VBN
10_1101-2020_12_31_424971	396	37	GS2	GS2	NNP
10_1101-2020_12_31_424971	396	38	-	-	,
10_1101-2020_12_31_424971	396	39	909	909	CD
10_1101-2020_12_31_424971	396	40	like	like	IN
10_1101-2020_12_31_424971	396	41	,	,	,
10_1101-2020_12_31_424971	396	42	and	and	CC
10_1101-2020_12_31_424971	396	43	POST	POST	NNP
10_1101-2020_12_31_424971	396	44	states	state	NNS
10_1101-2020_12_31_424971	396	45	were	be	VBD
10_1101-2020_12_31_424971	396	46	kGS1→Æ	kGS1→Æ	NNP
10_1101-2020_12_31_424971	396	47	=	=	SYM
10_1101-2020_12_31_424971	396	48	0.04	0.04	CD
10_1101-2020_12_31_424971	396	49	±	±	CD
10_1101-2020_12_31_424971	396	50	0.02	0.02	CD
10_1101-2020_12_31_424971	396	51	s–1	s–1	NNS
10_1101-2020_12_31_424971	396	52	,	,	,
10_1101-2020_12_31_424971	396	53	kGS2→Æ	kGS2→Æ	NNP
10_1101-2020_12_31_424971	396	54	=	=	SYM
10_1101-2020_12_31_424971	396	55	0.07	0.07	CD
10_1101-2020_12_31_424971	396	56	±	±	CD
10_1101-2020_12_31_424971	396	57	0.01	0.01	CD
10_1101-2020_12_31_424971	396	58	s–1	s–1	NNS
10_1101-2020_12_31_424971	396	59	,	,	,
10_1101-2020_12_31_424971	396	60	kGS2(G)→Æ	kGS2(G)→Æ	NNP
10_1101-2020_12_31_424971	396	61	=	=	SYM
10_1101-2020_12_31_424971	396	62	0.07	0.07	CD
10_1101-2020_12_31_424971	396	63	±	±	CD
10_1101-2020_12_31_424971	396	64	910	910	CD
10_1101-2020_12_31_424971	396	65	0.01	0.01	CD
10_1101-2020_12_31_424971	396	66	s–1	s–1	NNS
10_1101-2020_12_31_424971	396	67	(	(	-LRB-
10_1101-2020_12_31_424971	396	68	where	where	WRB
10_1101-2020_12_31_424971	396	69	the	the	DT
10_1101-2020_12_31_424971	396	70	subscript	subscript	NN
10_1101-2020_12_31_424971	396	71	“	"	``
10_1101-2020_12_31_424971	396	72	(	(	-LRB-
10_1101-2020_12_31_424971	396	73	G	g	NN
10_1101-2020_12_31_424971	396	74	)	)	-RRB-
10_1101-2020_12_31_424971	396	75	”	"	''
10_1101-2020_12_31_424971	396	76	denotes	denote	VBZ
10_1101-2020_12_31_424971	396	77	experiments	experiment	NNS
10_1101-2020_12_31_424971	396	78	performed	perform	VBN
10_1101-2020_12_31_424971	396	79	in	in	IN
10_1101-2020_12_31_424971	396	80	the	the	DT
10_1101-2020_12_31_424971	396	81	presence	presence	NN
10_1101-2020_12_31_424971	396	82	of	of	IN
10_1101-2020_12_31_424971	396	83	EF	EF	NNP
10_1101-2020_12_31_424971	396	84	-	-	HYPH
10_1101-2020_12_31_424971	396	85	G	G	NNP
10_1101-2020_12_31_424971	396	86	)	)	-RRB-
10_1101-2020_12_31_424971	396	87	,	,	,
10_1101-2020_12_31_424971	396	88	and	and	CC
10_1101-2020_12_31_424971	396	89	911	911	CD
10_1101-2020_12_31_424971	396	90	kPOST→Æ	kpost→æ	CD
10_1101-2020_12_31_424971	396	91	0.05	0.05	CD
10_1101-2020_12_31_424971	396	92	±	±	CD
10_1101-2020_12_31_424971	396	93	0.02	0.02	CD
10_1101-2020_12_31_424971	396	94	s–1	s–1	NNS
10_1101-2020_12_31_424971	396	95	,	,	,
10_1101-2020_12_31_424971	396	96	respectively	respectively	RB
10_1101-2020_12_31_424971	396	97	(	(	-LRB-
10_1101-2020_12_31_424971	396	98	see	see	VB
10_1101-2020_12_31_424971	396	99	below	below	RP
10_1101-2020_12_31_424971	396	100	for	for	IN
10_1101-2020_12_31_424971	396	101	a	a	DT
10_1101-2020_12_31_424971	396	102	detailed	detailed	JJ
10_1101-2020_12_31_424971	396	103	description	description	NN
10_1101-2020_12_31_424971	396	104	of	of	IN
10_1101-2020_12_31_424971	396	105	how	how	WRB
10_1101-2020_12_31_424971	396	106	kGS1→Æ	kGS1→Æ	NNP
10_1101-2020_12_31_424971	396	107	,	,	,
10_1101-2020_12_31_424971	396	108	kGS2→Æ	kGS2→Æ	NNP
10_1101-2020_12_31_424971	396	109	,	,	,
10_1101-2020_12_31_424971	396	110	912	912	CD
10_1101-2020_12_31_424971	396	111	kGS2(G)→Æ	kGS2(G)→Æ	NNS
10_1101-2020_12_31_424971	396	112	,	,	,
10_1101-2020_12_31_424971	396	113	and	and	CC
10_1101-2020_12_31_424971	396	114	kPOST→Æ	kpost→æ	NN
10_1101-2020_12_31_424971	396	115	were	be	VBD
10_1101-2020_12_31_424971	396	116	estimated	estimate	VBN
10_1101-2020_12_31_424971	396	117	)	)	-RRB-
10_1101-2020_12_31_424971	396	118	.	.	.
10_1101-2020_12_31_424971	397	1	These	these	DT
10_1101-2020_12_31_424971	397	2	rates	rate	NNS
10_1101-2020_12_31_424971	397	3	are	be	VBP
10_1101-2020_12_31_424971	397	4	,	,	,
10_1101-2020_12_31_424971	397	5	on	on	IN
10_1101-2020_12_31_424971	397	6	average	average	JJ
10_1101-2020_12_31_424971	397	7	,	,	,
10_1101-2020_12_31_424971	397	8	about	about	RB
10_1101-2020_12_31_424971	397	9	11-fold	11-fold	CD
10_1101-2020_12_31_424971	397	10	lower	low	JJR
10_1101-2020_12_31_424971	397	11	than	than	IN
10_1101-2020_12_31_424971	397	12	913	913	CD
10_1101-2020_12_31_424971	397	13	those	those	DT
10_1101-2020_12_31_424971	397	14	of	of	IN
10_1101-2020_12_31_424971	397	15	k70S	k70s	NN
10_1101-2020_12_31_424971	397	16	IC	IC	NNP
10_1101-2020_12_31_424971	397	17	→	→	SYM
10_1101-2020_12_31_424971	397	18	GS2	GS2	NNP
10_1101-2020_12_31_424971	397	19	and	and	CC
10_1101-2020_12_31_424971	397	20	kGS1	kGS1	NNP
10_1101-2020_12_31_424971	397	21	→	→	SYM
10_1101-2020_12_31_424971	397	22	GS2	GS2	NNP
10_1101-2020_12_31_424971	397	23	(	(	-LRB-
10_1101-2020_12_31_424971	397	24	0.3–0.6	0.3–0.6	CD
10_1101-2020_12_31_424971	397	25	s–1	s–1	NNS
10_1101-2020_12_31_424971	397	26	and	and	CC
10_1101-2020_12_31_424971	397	27	0.58–0.82	0.58–0.82	NN
10_1101-2020_12_31_424971	397	28	s–1	s–1	NNP
10_1101-2020_12_31_424971	397	29	(	(	-LRB-
10_1101-2020_12_31_424971	397	30	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	397	31	Table	Table	NNP
10_1101-2020_12_31_424971	397	32	4	4	CD
10_1101-2020_12_31_424971	397	33	)	)	-RRB-
10_1101-2020_12_31_424971	397	34	)	)	-RRB-
10_1101-2020_12_31_424971	397	35	.	.	.
10_1101-2020_12_31_424971	398	1	914	914	CD
10_1101-2020_12_31_424971	398	2	Consequently	consequently	RB
10_1101-2020_12_31_424971	398	3	,	,	,
10_1101-2020_12_31_424971	398	4	we	-PRON-	PRP
10_1101-2020_12_31_424971	398	5	do	do	VBP
10_1101-2020_12_31_424971	398	6	not	not	RB
10_1101-2020_12_31_424971	398	7	expect	expect	VB
10_1101-2020_12_31_424971	398	8	the	the	DT
10_1101-2020_12_31_424971	398	9	measurements	measurement	NNS
10_1101-2020_12_31_424971	398	10	of	of	IN
10_1101-2020_12_31_424971	398	11	k70S	k70S	NNP
10_1101-2020_12_31_424971	398	12	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	398	13	and	and	CC
10_1101-2020_12_31_424971	398	14	kGS1→GS2	kGS1→GS2	NNP
10_1101-2020_12_31_424971	398	15	to	to	TO
10_1101-2020_12_31_424971	398	16	be	be	VB
10_1101-2020_12_31_424971	398	17	limited	limit	VBN
10_1101-2020_12_31_424971	398	18	by	by	IN
10_1101-2020_12_31_424971	398	19	915	915	CD
10_1101-2020_12_31_424971	398	20	Cy3	cy3	CD
10_1101-2020_12_31_424971	398	21	or	or	CC
10_1101-2020_12_31_424971	398	22	Cy5	cy5	NN
10_1101-2020_12_31_424971	398	23	photobleaching	photobleaching	NN
10_1101-2020_12_31_424971	398	24	.	.	.
10_1101-2020_12_31_424971	399	1	Additionally	additionally	RB
10_1101-2020_12_31_424971	399	2	,	,	,
10_1101-2020_12_31_424971	399	3	even	even	RB
10_1101-2020_12_31_424971	399	4	if	if	IN
10_1101-2020_12_31_424971	399	5	k70S	k70S	NNP
10_1101-2020_12_31_424971	399	6	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	399	7	and	and	CC
10_1101-2020_12_31_424971	399	8	kGS1→GS2	kGS1→GS2	NNP
10_1101-2020_12_31_424971	399	9	were	be	VBD
10_1101-2020_12_31_424971	399	10	slightly	slightly	RB
10_1101-2020_12_31_424971	399	11	916	916	CD
10_1101-2020_12_31_424971	399	12	overestimated	overestimate	VBN
10_1101-2020_12_31_424971	399	13	,	,	,
10_1101-2020_12_31_424971	399	14	they	-PRON-	PRP
10_1101-2020_12_31_424971	399	15	would	would	MD
10_1101-2020_12_31_424971	399	16	be	be	VB
10_1101-2020_12_31_424971	399	17	expected	expect	VBN
10_1101-2020_12_31_424971	399	18	to	to	TO
10_1101-2020_12_31_424971	399	19	be	be	VB
10_1101-2020_12_31_424971	399	20	equally	equally	RB
10_1101-2020_12_31_424971	399	21	overestimated	overestimate	VBN
10_1101-2020_12_31_424971	399	22	for	for	IN
10_1101-2020_12_31_424971	399	23	SufB2-	SufB2-	NNP
10_1101-2020_12_31_424971	399	24	and	and	CC
10_1101-2020_12_31_424971	399	25	ProL	ProL	NNP
10_1101-2020_12_31_424971	399	26	917	917	CD
10_1101-2020_12_31_424971	399	27	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	399	28	complexes	complex	NNS
10_1101-2020_12_31_424971	399	29	given	give	VBN
10_1101-2020_12_31_424971	399	30	that	that	IN
10_1101-2020_12_31_424971	399	31	the	the	DT
10_1101-2020_12_31_424971	399	32	rate	rate	NN
10_1101-2020_12_31_424971	399	33	of	of	IN
10_1101-2020_12_31_424971	399	34	photobleaching	photobleaching	NN
10_1101-2020_12_31_424971	399	35	would	would	MD
10_1101-2020_12_31_424971	399	36	be	be	VB
10_1101-2020_12_31_424971	399	37	expected	expect	VBN
10_1101-2020_12_31_424971	399	38	to	to	TO
10_1101-2020_12_31_424971	399	39	be	be	VB
10_1101-2020_12_31_424971	399	40	very	very	RB
10_1101-2020_12_31_424971	399	41	similar	similar	JJ
10_1101-2020_12_31_424971	399	42	918	918	CD
10_1101-2020_12_31_424971	399	43	for	for	IN
10_1101-2020_12_31_424971	399	44	SufB2-	SufB2-	NNP
10_1101-2020_12_31_424971	399	45	and	and	CC
10_1101-2020_12_31_424971	399	46	ProL	ProL	NNP
10_1101-2020_12_31_424971	399	47	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	399	48	complexes	complex	NNS
10_1101-2020_12_31_424971	399	49	.	.	.
10_1101-2020_12_31_424971	400	1	Furthermore	furthermore	RB
10_1101-2020_12_31_424971	400	2	,	,	,
10_1101-2020_12_31_424971	400	3	because	because	IN
10_1101-2020_12_31_424971	400	4	we	-PRON-	PRP
10_1101-2020_12_31_424971	400	5	are	be	VBP
10_1101-2020_12_31_424971	400	6	primarily	primarily	RB
10_1101-2020_12_31_424971	400	7	concerned	concerned	JJ
10_1101-2020_12_31_424971	400	8	with	with	IN
10_1101-2020_12_31_424971	400	9	919	919	CD
10_1101-2020_12_31_424971	400	10	the	the	DT
10_1101-2020_12_31_424971	400	11	relative	relative	JJ
10_1101-2020_12_31_424971	400	12	values	value	NNS
10_1101-2020_12_31_424971	400	13	of	of	IN
10_1101-2020_12_31_424971	400	14	k70S	k70S	NNP
10_1101-2020_12_31_424971	400	15	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	400	16	and	and	CC
10_1101-2020_12_31_424971	400	17	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	400	18	for	for	IN
10_1101-2020_12_31_424971	400	19	SufB2-	SufB2-	NNP
10_1101-2020_12_31_424971	400	20	vs.	vs.	IN
10_1101-2020_12_31_424971	400	21	ProL	ProL	NNP
10_1101-2020_12_31_424971	400	22	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	400	23	complexes	complex	NNS
10_1101-2020_12_31_424971	400	24	,	,	,
10_1101-2020_12_31_424971	400	25	rather	rather	RB
10_1101-2020_12_31_424971	400	26	920	920	CD
10_1101-2020_12_31_424971	400	27	than	than	IN
10_1101-2020_12_31_424971	400	28	with	with	IN
10_1101-2020_12_31_424971	400	29	the	the	DT
10_1101-2020_12_31_424971	400	30	absolute	absolute	JJ
10_1101-2020_12_31_424971	400	31	values	value	NNS
10_1101-2020_12_31_424971	400	32	of	of	IN
10_1101-2020_12_31_424971	400	33	k70S	k70S	NNP
10_1101-2020_12_31_424971	400	34	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	400	35	and	and	CC
10_1101-2020_12_31_424971	400	36	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	400	37	for	for	IN
10_1101-2020_12_31_424971	400	38	the	the	DT
10_1101-2020_12_31_424971	400	39	SufB2-	SufB2-	NNP
10_1101-2020_12_31_424971	400	40	and	and	CC
10_1101-2020_12_31_424971	400	41	ProL	ProL	NNP
10_1101-2020_12_31_424971	400	42	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	400	43	921	921	CD
10_1101-2020_12_31_424971	400	44	complexes	complex	NNS
10_1101-2020_12_31_424971	400	45	,	,	,
10_1101-2020_12_31_424971	400	46	such	such	JJ
10_1101-2020_12_31_424971	400	47	slight	slight	JJ
10_1101-2020_12_31_424971	400	48	overestimations	overestimation	NNS
10_1101-2020_12_31_424971	400	49	do	do	VBP
10_1101-2020_12_31_424971	400	50	not	not	RB
10_1101-2020_12_31_424971	400	51	affect	affect	VB
10_1101-2020_12_31_424971	400	52	the	the	DT
10_1101-2020_12_31_424971	400	53	conclusions	conclusion	NNS
10_1101-2020_12_31_424971	400	54	of	of	IN
10_1101-2020_12_31_424971	400	55	the	the	DT
10_1101-2020_12_31_424971	400	56	work	work	NN
10_1101-2020_12_31_424971	400	57	presented	present	VBN
10_1101-2020_12_31_424971	400	58	here	here	RB
10_1101-2020_12_31_424971	400	59	.	.	.
10_1101-2020_12_31_424971	401	1	922	922	CD
10_1101-2020_12_31_424971	401	2	To	to	TO
10_1101-2020_12_31_424971	401	3	calculate	calculate	VB
10_1101-2020_12_31_424971	401	4	k70S	k70s	ADD
10_1101-2020_12_31_424971	401	5	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	401	6	and	and	CC
10_1101-2020_12_31_424971	401	7	the	the	DT
10_1101-2020_12_31_424971	401	8	corresponding	corresponding	JJ
10_1101-2020_12_31_424971	401	9	error	error	NN
10_1101-2020_12_31_424971	401	10	from	from	IN
10_1101-2020_12_31_424971	401	11	the	the	DT
10_1101-2020_12_31_424971	401	12	pre	pre	JJ
10_1101-2020_12_31_424971	401	13	-	-	JJ
10_1101-2020_12_31_424971	401	14	steady	steady	JJ
10_1101-2020_12_31_424971	401	15	-	-	HYPH
10_1101-2020_12_31_424971	401	16	state	state	NN
10_1101-2020_12_31_424971	401	17	experiments	experiment	NNS
10_1101-2020_12_31_424971	401	18	,	,	,
10_1101-2020_12_31_424971	401	19	923	923	CD
10_1101-2020_12_31_424971	401	20	we	-PRON-	PRP
10_1101-2020_12_31_424971	401	21	analyzed	analyze	VBD
10_1101-2020_12_31_424971	401	22	the	the	DT
10_1101-2020_12_31_424971	401	23	70S	70S	NNP
10_1101-2020_12_31_424971	401	24	IC	IC	NNP
10_1101-2020_12_31_424971	401	25	survival	survival	NN
10_1101-2020_12_31_424971	401	26	probabilities	probability	NNS
10_1101-2020_12_31_424971	401	27	(	(	-LRB-
10_1101-2020_12_31_424971	401	28	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	401	29	Figure	Figure	NNP
10_1101-2020_12_31_424971	401	30	4	4	CD
10_1101-2020_12_31_424971	401	31	,	,	,
10_1101-2020_12_31_424971	401	32	Tables	Tables	NNP
10_1101-2020_12_31_424971	401	33	4	4	CD
10_1101-2020_12_31_424971	401	34	and	and	CC
10_1101-2020_12_31_424971	401	35	5)37,67	5)37,67	CD
10_1101-2020_12_31_424971	401	36	.	.	.
10_1101-2020_12_31_424971	402	1	924	924	CD
10_1101-2020_12_31_424971	402	2	Briefly	briefly	RB
10_1101-2020_12_31_424971	402	3	,	,	,
10_1101-2020_12_31_424971	402	4	for	for	IN
10_1101-2020_12_31_424971	402	5	each	each	DT
10_1101-2020_12_31_424971	402	6	trajectory	trajectory	CD
10_1101-2020_12_31_424971	402	7	,	,	,
10_1101-2020_12_31_424971	402	8	we	-PRON-	PRP
10_1101-2020_12_31_424971	402	9	extracted	extract	VBD
10_1101-2020_12_31_424971	402	10	the	the	DT
10_1101-2020_12_31_424971	402	11	time	time	NN
10_1101-2020_12_31_424971	402	12	interval	interval	NN
10_1101-2020_12_31_424971	402	13	during	during	IN
10_1101-2020_12_31_424971	402	14	which	which	WDT
10_1101-2020_12_31_424971	402	15	we	-PRON-	PRP
10_1101-2020_12_31_424971	402	16	were	be	VBD
10_1101-2020_12_31_424971	402	17	waiting	wait	VBG
10_1101-2020_12_31_424971	402	18	for	for	IN
10_1101-2020_12_31_424971	402	19	the	the	DT
10_1101-2020_12_31_424971	402	20	925	925	CD
10_1101-2020_12_31_424971	402	21	70S	70S	NNP
10_1101-2020_12_31_424971	402	22	IC	IC	NNP
10_1101-2020_12_31_424971	402	23	to	to	TO
10_1101-2020_12_31_424971	402	24	undergo	undergo	VB
10_1101-2020_12_31_424971	402	25	a	a	DT
10_1101-2020_12_31_424971	402	26	transition	transition	NN
10_1101-2020_12_31_424971	402	27	to	to	IN
10_1101-2020_12_31_424971	402	28	GS2	GS2	NNP
10_1101-2020_12_31_424971	402	29	and	and	CC
10_1101-2020_12_31_424971	402	30	used	use	VBD
10_1101-2020_12_31_424971	402	31	these	these	DT
10_1101-2020_12_31_424971	402	32	‘	'	``
10_1101-2020_12_31_424971	402	33	waiting	wait	VBG
10_1101-2020_12_31_424971	402	34	times	time	NNS
10_1101-2020_12_31_424971	402	35	’	'	''
10_1101-2020_12_31_424971	402	36	to	to	TO
10_1101-2020_12_31_424971	402	37	construct	construct	VB
10_1101-2020_12_31_424971	402	38	a	a	DT
10_1101-2020_12_31_424971	402	39	70S	70S	NNP
10_1101-2020_12_31_424971	402	40	IC	IC	NNP
10_1101-2020_12_31_424971	402	41	survival	survival	NN
10_1101-2020_12_31_424971	402	42	926	926	CD
10_1101-2020_12_31_424971	402	43	probability	probability	NN
10_1101-2020_12_31_424971	402	44	distribution	distribution	NN
10_1101-2020_12_31_424971	402	45	,	,	,
10_1101-2020_12_31_424971	402	46	as	as	IN
10_1101-2020_12_31_424971	402	47	shown	show	VBN
10_1101-2020_12_31_424971	402	48	in	in	IN
10_1101-2020_12_31_424971	402	49	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	402	50	Figure	Figure	NNP
10_1101-2020_12_31_424971	402	51	4	4	CD
10_1101-2020_12_31_424971	402	52	.	.	.
10_1101-2020_12_31_424971	403	1	All	all	DT
10_1101-2020_12_31_424971	403	2	70S	70S	NNP
10_1101-2020_12_31_424971	403	3	IC	IC	NNP
10_1101-2020_12_31_424971	403	4	survival	survival	NN
10_1101-2020_12_31_424971	403	5	probability	probability	NN
10_1101-2020_12_31_424971	403	6	927	927	CD
10_1101-2020_12_31_424971	403	7	distributions	distribution	NNS
10_1101-2020_12_31_424971	403	8	were	be	VBD
10_1101-2020_12_31_424971	403	9	best	well	RBS
10_1101-2020_12_31_424971	403	10	described	describe	VBN
10_1101-2020_12_31_424971	403	11	by	by	IN
10_1101-2020_12_31_424971	403	12	a	a	DT
10_1101-2020_12_31_424971	403	13	single	single	JJ
10_1101-2020_12_31_424971	403	14	exponential	exponential	JJ
10_1101-2020_12_31_424971	403	15	decay	decay	NN
10_1101-2020_12_31_424971	403	16	function	function	NN
10_1101-2020_12_31_424971	403	17	of	of	IN
10_1101-2020_12_31_424971	403	18	the	the	DT
10_1101-2020_12_31_424971	403	19	type	type	NN
10_1101-2020_12_31_424971	403	20	928	928	NNP
10_1101-2020_12_31_424971	403	21	𝑌	𝑌	NNP
10_1101-2020_12_31_424971	403	22	=	=	SYM
10_1101-2020_12_31_424971	403	23	𝐴e("#/𝜏	𝐴e("#/𝜏	NNP
10_1101-2020_12_31_424971	403	24	!	!	.
10_1101-2020_12_31_424971	404	1	"	"	``
10_1101-2020_12_31_424971	404	2	#	#	$
10_1101-2020_12_31_424971	404	3	%	%	NN
10_1101-2020_12_31_424971	404	4	&	&	CC
10_1101-2020_12_31_424971	404	5	)	)	-RRB-
10_1101-2020_12_31_424971	404	6	,	,	,
10_1101-2020_12_31_424971	404	7	(	(	-LRB-
10_1101-2020_12_31_424971	404	8	1	1	LS
10_1101-2020_12_31_424971	404	9	)	)	-RRB-
10_1101-2020_12_31_424971	404	10	929	929	CD
10_1101-2020_12_31_424971	404	11	where	where	WRB
10_1101-2020_12_31_424971	404	12	Y	Y	NNP
10_1101-2020_12_31_424971	404	13	is	be	VBZ
10_1101-2020_12_31_424971	404	14	survival	survival	NN
10_1101-2020_12_31_424971	404	15	probability	probability	NN
10_1101-2020_12_31_424971	404	16	,	,	,
10_1101-2020_12_31_424971	404	17	A	A	NNP
10_1101-2020_12_31_424971	404	18	is	be	VBZ
10_1101-2020_12_31_424971	404	19	the	the	DT
10_1101-2020_12_31_424971	404	20	initial	initial	JJ
10_1101-2020_12_31_424971	404	21	population	population	NN
10_1101-2020_12_31_424971	404	22	of	of	IN
10_1101-2020_12_31_424971	404	23	70S	70S	NNP
10_1101-2020_12_31_424971	404	24	IC	IC	NNP
10_1101-2020_12_31_424971	404	25	,	,	,
10_1101-2020_12_31_424971	404	26	t	t	NNP
10_1101-2020_12_31_424971	404	27	is	be	VBZ
10_1101-2020_12_31_424971	404	28	time	time	NN
10_1101-2020_12_31_424971	404	29	,	,	,
10_1101-2020_12_31_424971	404	30	and	and	CC
10_1101-2020_12_31_424971	404	31	τ70S	τ70S	``
10_1101-2020_12_31_424971	404	32	IC	IC	NNP
10_1101-2020_12_31_424971	404	33	is	be	VBZ
10_1101-2020_12_31_424971	404	34	the	the	DT
10_1101-2020_12_31_424971	404	35	930	930	CD
10_1101-2020_12_31_424971	404	36	time	time	NN
10_1101-2020_12_31_424971	404	37	constant	constant	JJ
10_1101-2020_12_31_424971	404	38	with	with	IN
10_1101-2020_12_31_424971	404	39	which	which	WDT
10_1101-2020_12_31_424971	404	40	70S	70S	NNP
10_1101-2020_12_31_424971	404	41	IC	IC	NNP
10_1101-2020_12_31_424971	404	42	transitions	transition	VBZ
10_1101-2020_12_31_424971	404	43	to	to	IN
10_1101-2020_12_31_424971	404	44	a	a	DT
10_1101-2020_12_31_424971	404	45	PRE	PRE	NNP
10_1101-2020_12_31_424971	404	46	complex	complex	NN
10_1101-2020_12_31_424971	404	47	in	in	IN
10_1101-2020_12_31_424971	404	48	the	the	DT
10_1101-2020_12_31_424971	404	49	GS2	GS2	NNP
10_1101-2020_12_31_424971	404	50	state	state	NN
10_1101-2020_12_31_424971	404	51	.	.	.
10_1101-2020_12_31_424971	405	1	k70S	k70S	NNP
10_1101-2020_12_31_424971	405	2	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	405	3	was	be	VBD
10_1101-2020_12_31_424971	405	4	931	931	CD
10_1101-2020_12_31_424971	405	5	.CC	.CC	:
10_1101-2020_12_31_424971	405	6	-	-	HYPH
10_1101-2020_12_31_424971	405	7	BY	by	IN
10_1101-2020_12_31_424971	405	8	-	-	HYPH
10_1101-2020_12_31_424971	405	9	NC	NC	NNP
10_1101-2020_12_31_424971	405	10	-	-	HYPH
10_1101-2020_12_31_424971	405	11	ND	ND	NNP
10_1101-2020_12_31_424971	405	12	4.0	4.0	CD
10_1101-2020_12_31_424971	405	13	International	International	NNP
10_1101-2020_12_31_424971	405	14	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	405	15	under	under	IN
10_1101-2020_12_31_424971	405	16	a	a	DT
10_1101-2020_12_31_424971	405	17	(	(	-LRB-
10_1101-2020_12_31_424971	405	18	which	which	WDT
10_1101-2020_12_31_424971	405	19	was	be	VBD
10_1101-2020_12_31_424971	405	20	not	not	RB
10_1101-2020_12_31_424971	405	21	certified	certify	VBN
10_1101-2020_12_31_424971	405	22	by	by	IN
10_1101-2020_12_31_424971	405	23	peer	peer	NN
10_1101-2020_12_31_424971	405	24	review	review	NN
10_1101-2020_12_31_424971	405	25	)	)	-RRB-
10_1101-2020_12_31_424971	405	26	is	be	VBZ
10_1101-2020_12_31_424971	405	27	the	the	DT
10_1101-2020_12_31_424971	405	28	author	author	NN
10_1101-2020_12_31_424971	405	29	/	/	SYM
10_1101-2020_12_31_424971	405	30	funder	funder	NN
10_1101-2020_12_31_424971	405	31	,	,	,
10_1101-2020_12_31_424971	405	32	who	who	WP
10_1101-2020_12_31_424971	405	33	has	have	VBZ
10_1101-2020_12_31_424971	405	34	granted	grant	VBN
10_1101-2020_12_31_424971	405	35	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	405	36	a	a	DT
10_1101-2020_12_31_424971	405	37	license	license	NN
10_1101-2020_12_31_424971	405	38	to	to	TO
10_1101-2020_12_31_424971	405	39	display	display	VB
10_1101-2020_12_31_424971	405	40	the	the	DT
10_1101-2020_12_31_424971	405	41	preprint	preprint	NN
10_1101-2020_12_31_424971	405	42	in	in	IN
10_1101-2020_12_31_424971	405	43	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	405	44	.	.	.
10_1101-2020_12_31_424971	406	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	406	2	is	be	VBZ
10_1101-2020_12_31_424971	406	3	made	make	VBN
10_1101-2020_12_31_424971	406	4	The	the	DT
10_1101-2020_12_31_424971	406	5	copyright	copyright	NN
10_1101-2020_12_31_424971	406	6	holder	holder	NN
10_1101-2020_12_31_424971	406	7	for	for	IN
10_1101-2020_12_31_424971	406	8	this	this	DT
10_1101-2020_12_31_424971	406	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	406	10	version	version	NN
10_1101-2020_12_31_424971	406	11	posted	post	VBD
10_1101-2020_12_31_424971	406	12	January	January	NNP
10_1101-2020_12_31_424971	406	13	2	2	CD
10_1101-2020_12_31_424971	406	14	,	,	,
10_1101-2020_12_31_424971	406	15	2021	2021	CD
10_1101-2020_12_31_424971	406	16	.	.	.
10_1101-2020_12_31_424971	406	17	;	;	:
10_1101-2020_12_31_424971	406	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	406	19	:	:	:
10_1101-2020_12_31_424971	406	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	406	21	preprint	preprint	NN
10_1101-2020_12_31_424971	406	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NNP
10_1101-2020_12_31_424971	406	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	406	24	38	38	CD
10_1101-2020_12_31_424971	406	25	then	then	RB
10_1101-2020_12_31_424971	406	26	calculated	calculate	VBN
10_1101-2020_12_31_424971	406	27	using	use	VBG
10_1101-2020_12_31_424971	406	28	the	the	DT
10_1101-2020_12_31_424971	406	29	equation	equation	NN
10_1101-2020_12_31_424971	406	30	k70S	k70s	ADD
10_1101-2020_12_31_424971	406	31	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	406	32	=	=	SYM
10_1101-2020_12_31_424971	406	33	1	1	CD
10_1101-2020_12_31_424971	406	34	/	/	SYM
10_1101-2020_12_31_424971	406	35	τ70S	τ70s	NN
10_1101-2020_12_31_424971	406	36	IC	IC	NNP
10_1101-2020_12_31_424971	406	37	.	.	.
10_1101-2020_12_31_424971	407	1	Errors	error	NNS
10_1101-2020_12_31_424971	407	2	were	be	VBD
10_1101-2020_12_31_424971	407	3	calculated	calculate	VBN
10_1101-2020_12_31_424971	407	4	as	as	IN
10_1101-2020_12_31_424971	407	5	the	the	DT
10_1101-2020_12_31_424971	407	6	standard	standard	JJ
10_1101-2020_12_31_424971	407	7	932	932	CD
10_1101-2020_12_31_424971	407	8	deviation	deviation	NN
10_1101-2020_12_31_424971	407	9	of	of	IN
10_1101-2020_12_31_424971	407	10	technical	technical	JJ
10_1101-2020_12_31_424971	407	11	triplicates	triplicate	NNS
10_1101-2020_12_31_424971	407	12	.	.	.
10_1101-2020_12_31_424971	408	1	933	933	CD
10_1101-2020_12_31_424971	408	2	Six	six	CD
10_1101-2020_12_31_424971	408	3	sets	set	NNS
10_1101-2020_12_31_424971	408	4	of	of	IN
10_1101-2020_12_31_424971	408	5	kinetic	kinetic	NN
10_1101-2020_12_31_424971	408	6	and/or	and/or	CC
10_1101-2020_12_31_424971	408	7	thermodynamic	thermodynamic	JJ
10_1101-2020_12_31_424971	408	8	parameters	parameter	NNS
10_1101-2020_12_31_424971	408	9	were	be	VBD
10_1101-2020_12_31_424971	408	10	calculated	calculate	VBN
10_1101-2020_12_31_424971	408	11	from	from	IN
10_1101-2020_12_31_424971	408	12	hidden	hide	VBN
10_1101-2020_12_31_424971	408	13	Markov	Markov	NNP
10_1101-2020_12_31_424971	408	14	934	934	CD
10_1101-2020_12_31_424971	408	15	model	model	NN
10_1101-2020_12_31_424971	408	16	(	(	-LRB-
10_1101-2020_12_31_424971	408	17	HMM	HMM	NNP
10_1101-2020_12_31_424971	408	18	)	)	-RRB-
10_1101-2020_12_31_424971	408	19	analyses	analysis	NNS
10_1101-2020_12_31_424971	408	20	of	of	IN
10_1101-2020_12_31_424971	408	21	the	the	DT
10_1101-2020_12_31_424971	408	22	recorded	record	VBN
10_1101-2020_12_31_424971	408	23	movies	movie	NNS
10_1101-2020_12_31_424971	408	24	.	.	.
10_1101-2020_12_31_424971	409	1	These	these	DT
10_1101-2020_12_31_424971	409	2	parameters	parameter	NNS
10_1101-2020_12_31_424971	409	3	are	be	VBP
10_1101-2020_12_31_424971	409	4	defined	define	VBN
10_1101-2020_12_31_424971	409	5	here	here	RB
10_1101-2020_12_31_424971	409	6	as	as	IN
10_1101-2020_12_31_424971	409	7	:	:	:
10_1101-2020_12_31_424971	409	8	(	(	-LRB-
10_1101-2020_12_31_424971	409	9	i	i	NN
10_1101-2020_12_31_424971	409	10	)	)	-RRB-
10_1101-2020_12_31_424971	409	11	935	935	CD
10_1101-2020_12_31_424971	409	12	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	409	13	,	,	,
10_1101-2020_12_31_424971	409	14	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	409	15	,	,	,
10_1101-2020_12_31_424971	409	16	and	and	CC
10_1101-2020_12_31_424971	409	17	Keq	Keq	NNP
10_1101-2020_12_31_424971	409	18	from	from	IN
10_1101-2020_12_31_424971	409	19	the	the	DT
10_1101-2020_12_31_424971	409	20	pre	pre	JJ
10_1101-2020_12_31_424971	409	21	-	-	JJ
10_1101-2020_12_31_424971	409	22	steady	steady	JJ
10_1101-2020_12_31_424971	409	23	-	-	HYPH
10_1101-2020_12_31_424971	409	24	state	state	NN
10_1101-2020_12_31_424971	409	25	and	and	CC
10_1101-2020_12_31_424971	409	26	steady	steady	JJ
10_1101-2020_12_31_424971	409	27	-	-	HYPH
10_1101-2020_12_31_424971	409	28	state	state	NN
10_1101-2020_12_31_424971	409	29	movies	movie	NNS
10_1101-2020_12_31_424971	409	30	recorded	record	VBN
10_1101-2020_12_31_424971	409	31	for	for	IN
10_1101-2020_12_31_424971	409	32	the	the	DT
10_1101-2020_12_31_424971	409	33	936	936	CD
10_1101-2020_12_31_424971	409	34	delivery	delivery	NN
10_1101-2020_12_31_424971	409	35	of	of	IN
10_1101-2020_12_31_424971	409	36	SufB2-	SufB2-	NNP
10_1101-2020_12_31_424971	409	37	and	and	CC
10_1101-2020_12_31_424971	409	38	ProL	ProL	NNP
10_1101-2020_12_31_424971	409	39	-	-	HYPH
10_1101-2020_12_31_424971	409	40	TCs	tc	NNS
10_1101-2020_12_31_424971	409	41	in	in	IN
10_1101-2020_12_31_424971	409	42	the	the	DT
10_1101-2020_12_31_424971	409	43	absence	absence	NN
10_1101-2020_12_31_424971	409	44	of	of	IN
10_1101-2020_12_31_424971	409	45	EF	EF	NNP
10_1101-2020_12_31_424971	409	46	-	-	HYPH
10_1101-2020_12_31_424971	409	47	G	G	NNP
10_1101-2020_12_31_424971	409	48	(	(	-LRB-
10_1101-2020_12_31_424971	409	49	Figures	Figures	NNP
10_1101-2020_12_31_424971	409	50	6d	6d	NNP
10_1101-2020_12_31_424971	409	51	,	,	,
10_1101-2020_12_31_424971	409	52	6f	6f	RB
10_1101-2020_12_31_424971	409	53	,	,	,
10_1101-2020_12_31_424971	409	54	and	and	CC
10_1101-2020_12_31_424971	409	55	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	409	56	937	937	CD
10_1101-2020_12_31_424971	409	57	Figure	figure	NN
10_1101-2020_12_31_424971	409	58	3	3	CD
10_1101-2020_12_31_424971	409	59	and	and	CC
10_1101-2020_12_31_424971	409	60	Table	table	NN
10_1101-2020_12_31_424971	409	61	4	4	CD
10_1101-2020_12_31_424971	409	62	)	)	-RRB-
10_1101-2020_12_31_424971	409	63	;	;	:
10_1101-2020_12_31_424971	409	64	(	(	-LRB-
10_1101-2020_12_31_424971	409	65	ii	ii	NNP
10_1101-2020_12_31_424971	409	66	)	)	-RRB-
10_1101-2020_12_31_424971	409	67	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	409	68	from	from	IN
10_1101-2020_12_31_424971	409	69	the	the	DT
10_1101-2020_12_31_424971	409	70	pre	pre	JJ
10_1101-2020_12_31_424971	409	71	-	-	JJ
10_1101-2020_12_31_424971	409	72	steady	steady	JJ
10_1101-2020_12_31_424971	409	73	-	-	HYPH
10_1101-2020_12_31_424971	409	74	state	state	NN
10_1101-2020_12_31_424971	409	75	movie	movie	NN
10_1101-2020_12_31_424971	409	76	recorded	record	VBN
10_1101-2020_12_31_424971	409	77	for	for	IN
10_1101-2020_12_31_424971	409	78	the	the	DT
10_1101-2020_12_31_424971	409	79	delivery	delivery	NN
10_1101-2020_12_31_424971	409	80	of	of	IN
10_1101-2020_12_31_424971	409	81	938	938	CD
10_1101-2020_12_31_424971	409	82	ProL	ProL	NNP
10_1101-2020_12_31_424971	409	83	-	-	HYPH
10_1101-2020_12_31_424971	409	84	TC	TC	NNP
10_1101-2020_12_31_424971	409	85	in	in	IN
10_1101-2020_12_31_424971	409	86	the	the	DT
10_1101-2020_12_31_424971	409	87	presence	presence	NN
10_1101-2020_12_31_424971	409	88	of	of	IN
10_1101-2020_12_31_424971	409	89	EF	EF	NNP
10_1101-2020_12_31_424971	409	90	-	-	HYPH
10_1101-2020_12_31_424971	409	91	G	G	NNP
10_1101-2020_12_31_424971	409	92	(	(	-LRB-
10_1101-2020_12_31_424971	409	93	Figures	Figures	NNP
10_1101-2020_12_31_424971	409	94	6e	6e	NNP
10_1101-2020_12_31_424971	409	95	,	,	,
10_1101-2020_12_31_424971	409	96	6	6	CD
10_1101-2020_12_31_424971	409	97	g	g	NN
10_1101-2020_12_31_424971	409	98	,	,	,
10_1101-2020_12_31_424971	409	99	and	and	CC
10_1101-2020_12_31_424971	409	100	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	409	101	Figure	Figure	NNP
10_1101-2020_12_31_424971	409	102	5	5	CD
10_1101-2020_12_31_424971	409	103	and	and	CC
10_1101-2020_12_31_424971	409	104	Table	table	NN
10_1101-2020_12_31_424971	409	105	5	5	CD
10_1101-2020_12_31_424971	409	106	)	)	-RRB-
10_1101-2020_12_31_424971	409	107	;	;	:
10_1101-2020_12_31_424971	409	108	(	(	-LRB-
10_1101-2020_12_31_424971	409	109	iii	iii	NN
10_1101-2020_12_31_424971	409	110	)	)	-RRB-
10_1101-2020_12_31_424971	409	111	939	939	CD
10_1101-2020_12_31_424971	409	112	the	the	DT
10_1101-2020_12_31_424971	409	113	fractional	fractional	JJ
10_1101-2020_12_31_424971	409	114	population	population	NN
10_1101-2020_12_31_424971	409	115	of	of	IN
10_1101-2020_12_31_424971	409	116	the	the	DT
10_1101-2020_12_31_424971	409	117	POST	POST	NNP
10_1101-2020_12_31_424971	409	118	complex	complex	NN
10_1101-2020_12_31_424971	409	119	from	from	IN
10_1101-2020_12_31_424971	409	120	the	the	DT
10_1101-2020_12_31_424971	409	121	pre	pre	JJ
10_1101-2020_12_31_424971	409	122	-	-	JJ
10_1101-2020_12_31_424971	409	123	steady	steady	JJ
10_1101-2020_12_31_424971	409	124	-	-	HYPH
10_1101-2020_12_31_424971	409	125	state	state	NN
10_1101-2020_12_31_424971	409	126	and	and	CC
10_1101-2020_12_31_424971	409	127	steady	steady	JJ
10_1101-2020_12_31_424971	409	128	-	-	HYPH
10_1101-2020_12_31_424971	409	129	state	state	NN
10_1101-2020_12_31_424971	409	130	movies	movie	NNS
10_1101-2020_12_31_424971	409	131	940	940	CD
10_1101-2020_12_31_424971	409	132	recorded	record	VBN
10_1101-2020_12_31_424971	409	133	for	for	IN
10_1101-2020_12_31_424971	409	134	the	the	DT
10_1101-2020_12_31_424971	409	135	delivery	delivery	NN
10_1101-2020_12_31_424971	409	136	of	of	IN
10_1101-2020_12_31_424971	409	137	SufB2-	SufB2-	NNP
10_1101-2020_12_31_424971	409	138	and	and	CC
10_1101-2020_12_31_424971	409	139	ProL	ProL	NNP
10_1101-2020_12_31_424971	409	140	-	-	HYPH
10_1101-2020_12_31_424971	409	141	TCs	tc	NNS
10_1101-2020_12_31_424971	409	142	in	in	IN
10_1101-2020_12_31_424971	409	143	the	the	DT
10_1101-2020_12_31_424971	409	144	presence	presence	NN
10_1101-2020_12_31_424971	409	145	of	of	IN
10_1101-2020_12_31_424971	409	146	EF	EF	NNP
10_1101-2020_12_31_424971	409	147	-	-	HYPH
10_1101-2020_12_31_424971	409	148	G	G	NNP
10_1101-2020_12_31_424971	409	149	(	(	-LRB-
10_1101-2020_12_31_424971	409	150	Figures	Figures	NNP
10_1101-2020_12_31_424971	409	151	6e	6e	NNP
10_1101-2020_12_31_424971	409	152	,	,	,
10_1101-2020_12_31_424971	409	153	6	6	CD
10_1101-2020_12_31_424971	409	154	g	g	NN
10_1101-2020_12_31_424971	409	155	,	,	,
10_1101-2020_12_31_424971	409	156	and	and	CC
10_1101-2020_12_31_424971	409	157	941	941	CD
10_1101-2020_12_31_424971	409	158	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	409	159	Figure	figure	NN
10_1101-2020_12_31_424971	409	160	5	5	CD
10_1101-2020_12_31_424971	409	161	and	and	CC
10_1101-2020_12_31_424971	409	162	Table	table	NN
10_1101-2020_12_31_424971	409	163	5	5	CD
10_1101-2020_12_31_424971	409	164	)	)	-RRB-
10_1101-2020_12_31_424971	409	165	;	;	:
10_1101-2020_12_31_424971	409	166	(	(	-LRB-
10_1101-2020_12_31_424971	409	167	iv	iv	NN
10_1101-2020_12_31_424971	409	168	)	)	-RRB-
10_1101-2020_12_31_424971	409	169	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	409	170	,	,	,
10_1101-2020_12_31_424971	409	171	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	409	172	,	,	,
10_1101-2020_12_31_424971	409	173	and	and	CC
10_1101-2020_12_31_424971	409	174	Keq	Keq	NNP
10_1101-2020_12_31_424971	409	175	from	from	IN
10_1101-2020_12_31_424971	409	176	a	a	DT
10_1101-2020_12_31_424971	409	177	sub	sub	NN
10_1101-2020_12_31_424971	409	178	-	-	NN
10_1101-2020_12_31_424971	409	179	population	population	NN
10_1101-2020_12_31_424971	409	180	of	of	IN
10_1101-2020_12_31_424971	409	181	942	942	CD
10_1101-2020_12_31_424971	409	182	PRE	PRE	NNP
10_1101-2020_12_31_424971	409	183	complexes	complex	NNS
10_1101-2020_12_31_424971	409	184	that	that	WDT
10_1101-2020_12_31_424971	409	185	lacked	lack	VBD
10_1101-2020_12_31_424971	409	186	an	an	DT
10_1101-2020_12_31_424971	409	187	A	A	NNP
10_1101-2020_12_31_424971	409	188	site	site	NN
10_1101-2020_12_31_424971	409	189	-	-	HYPH
10_1101-2020_12_31_424971	409	190	bound	bind	VBN
10_1101-2020_12_31_424971	409	191	,	,	,
10_1101-2020_12_31_424971	409	192	deacylated	deacylate	VBN
10_1101-2020_12_31_424971	409	193	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	409	194	in	in	IN
10_1101-2020_12_31_424971	409	195	the	the	DT
10_1101-2020_12_31_424971	409	196	steady	steady	JJ
10_1101-2020_12_31_424971	409	197	-	-	HYPH
10_1101-2020_12_31_424971	409	198	state	state	NN
10_1101-2020_12_31_424971	409	199	movies	movie	NNS
10_1101-2020_12_31_424971	409	200	943	943	CD
10_1101-2020_12_31_424971	409	201	recorded	record	VBN
10_1101-2020_12_31_424971	409	202	for	for	IN
10_1101-2020_12_31_424971	409	203	the	the	DT
10_1101-2020_12_31_424971	409	204	longer	long	JJR
10_1101-2020_12_31_424971	409	205	time	time	NN
10_1101-2020_12_31_424971	409	206	points	point	NNS
10_1101-2020_12_31_424971	409	207	(	(	-LRB-
10_1101-2020_12_31_424971	409	208	i.e.	i.e.	FW
10_1101-2020_12_31_424971	409	209	,	,	,
10_1101-2020_12_31_424971	409	210	3	3	CD
10_1101-2020_12_31_424971	409	211	,	,	,
10_1101-2020_12_31_424971	409	212	10	10	CD
10_1101-2020_12_31_424971	409	213	,	,	,
10_1101-2020_12_31_424971	409	214	and	and	CC
10_1101-2020_12_31_424971	409	215	20	20	CD
10_1101-2020_12_31_424971	409	216	min	min	NN
10_1101-2020_12_31_424971	409	217	)	)	-RRB-
10_1101-2020_12_31_424971	409	218	after	after	IN
10_1101-2020_12_31_424971	409	219	the	the	DT
10_1101-2020_12_31_424971	409	220	delivery	delivery	NN
10_1101-2020_12_31_424971	409	221	of	of	IN
10_1101-2020_12_31_424971	409	222	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	409	223	in	in	IN
10_1101-2020_12_31_424971	409	224	the	the	DT
10_1101-2020_12_31_424971	409	225	944	944	CD
10_1101-2020_12_31_424971	409	226	presence	presence	NN
10_1101-2020_12_31_424971	409	227	of	of	IN
10_1101-2020_12_31_424971	409	228	EF	EF	NNP
10_1101-2020_12_31_424971	409	229	-	-	HYPH
10_1101-2020_12_31_424971	409	230	G	G	NNP
10_1101-2020_12_31_424971	409	231	(	(	-LRB-
10_1101-2020_12_31_424971	409	232	Figures	figure	NNS
10_1101-2020_12_31_424971	409	233	6	6	CD
10_1101-2020_12_31_424971	409	234	g	g	NN
10_1101-2020_12_31_424971	409	235	,	,	,
10_1101-2020_12_31_424971	409	236	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	409	237	Table	Table	NNP
10_1101-2020_12_31_424971	409	238	6	6	CD
10_1101-2020_12_31_424971	409	239	)	)	-RRB-
10_1101-2020_12_31_424971	409	240	;	;	:
10_1101-2020_12_31_424971	409	241	(	(	-LRB-
10_1101-2020_12_31_424971	409	242	v	v	NN
10_1101-2020_12_31_424971	409	243	)	)	-RRB-
10_1101-2020_12_31_424971	409	244	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	409	245	,	,	,
10_1101-2020_12_31_424971	409	246	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	409	247	,	,	,
10_1101-2020_12_31_424971	409	248	and	and	CC
10_1101-2020_12_31_424971	409	249	Keq	Keq	NNP
10_1101-2020_12_31_424971	409	250	from	from	IN
10_1101-2020_12_31_424971	409	251	the	the	DT
10_1101-2020_12_31_424971	409	252	945	945	CD
10_1101-2020_12_31_424971	409	253	steady	steady	JJ
10_1101-2020_12_31_424971	409	254	-	-	HYPH
10_1101-2020_12_31_424971	409	255	state	state	NN
10_1101-2020_12_31_424971	409	256	movies	movie	NNS
10_1101-2020_12_31_424971	409	257	recorded	record	VBN
10_1101-2020_12_31_424971	409	258	for	for	IN
10_1101-2020_12_31_424971	409	259	the	the	DT
10_1101-2020_12_31_424971	409	260	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	409	261	and	and	CC
10_1101-2020_12_31_424971	409	262	ProL	ProL	NNP
10_1101-2020_12_31_424971	409	263	PRE	PRE	NNP
10_1101-2020_12_31_424971	409	264	–	–	:
10_1101-2020_12_31_424971	409	265	A	a	DT
10_1101-2020_12_31_424971	409	266	complexes	complex	NNS
10_1101-2020_12_31_424971	409	267	(	(	-LRB-
10_1101-2020_12_31_424971	409	268	Figures	figure	NNS
10_1101-2020_12_31_424971	409	269	6h	6h	CD
10_1101-2020_12_31_424971	409	270	and	and	CC
10_1101-2020_12_31_424971	409	271	946	946	CD
10_1101-2020_12_31_424971	409	272	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	409	273	Figure	Figure	NNP
10_1101-2020_12_31_424971	409	274	6	6	CD
10_1101-2020_12_31_424971	409	275	and	and	CC
10_1101-2020_12_31_424971	409	276	Table	table	NN
10_1101-2020_12_31_424971	409	277	7	7	CD
10_1101-2020_12_31_424971	409	278	)	)	-RRB-
10_1101-2020_12_31_424971	409	279	;	;	:
10_1101-2020_12_31_424971	409	280	and	and	CC
10_1101-2020_12_31_424971	409	281	(	(	-LRB-
10_1101-2020_12_31_424971	409	282	vi	vi	NNP
10_1101-2020_12_31_424971	409	283	)	)	-RRB-
10_1101-2020_12_31_424971	409	284	kGS1→Æ	kGS1→Æ	NNP
10_1101-2020_12_31_424971	409	285	,	,	,
10_1101-2020_12_31_424971	409	286	kGS2→Æ	kGS2→Æ	NNP
10_1101-2020_12_31_424971	409	287	,	,	,
10_1101-2020_12_31_424971	409	288	kGS2(G)→Æ	kGS2(G)→Æ	NNP
10_1101-2020_12_31_424971	409	289	,	,	,
10_1101-2020_12_31_424971	409	290	and	and	CC
10_1101-2020_12_31_424971	409	291	kPOST→Æ	kpost→æ	NN
10_1101-2020_12_31_424971	409	292	from	from	IN
10_1101-2020_12_31_424971	409	293	the	the	DT
10_1101-2020_12_31_424971	409	294	947	947	CD
10_1101-2020_12_31_424971	409	295	movies	movie	NNS
10_1101-2020_12_31_424971	409	296	described	describe	VBN
10_1101-2020_12_31_424971	409	297	in	in	IN
10_1101-2020_12_31_424971	409	298	(	(	-LRB-
10_1101-2020_12_31_424971	409	299	i)-(v	i)-(v	NN
10_1101-2020_12_31_424971	409	300	)	)	-RRB-
10_1101-2020_12_31_424971	409	301	(	(	-LRB-
10_1101-2020_12_31_424971	409	302	Figures	figure	NNS
10_1101-2020_12_31_424971	409	303	6d-6h	6d-6h	CD
10_1101-2020_12_31_424971	409	304	,	,	,
10_1101-2020_12_31_424971	409	305	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	409	306	Figures	Figures	NNP
10_1101-2020_12_31_424971	409	307	3	3	CD
10_1101-2020_12_31_424971	409	308	,	,	,
10_1101-2020_12_31_424971	409	309	5	5	CD
10_1101-2020_12_31_424971	409	310	,	,	,
10_1101-2020_12_31_424971	409	311	and	and	CC
10_1101-2020_12_31_424971	409	312	6	6	CD
10_1101-2020_12_31_424971	409	313	,	,	,
10_1101-2020_12_31_424971	409	314	and	and	CC
10_1101-2020_12_31_424971	409	315	reported	report	VBD
10_1101-2020_12_31_424971	409	316	two	two	CD
10_1101-2020_12_31_424971	409	317	948	948	CD
10_1101-2020_12_31_424971	409	318	paragraphs	paragraph	NNS
10_1101-2020_12_31_424971	409	319	above	above	RB
10_1101-2020_12_31_424971	409	320	)	)	-RRB-
10_1101-2020_12_31_424971	409	321	.	.	.
10_1101-2020_12_31_424971	410	1	To	to	TO
10_1101-2020_12_31_424971	410	2	calculate	calculate	VB
10_1101-2020_12_31_424971	410	3	these	these	DT
10_1101-2020_12_31_424971	410	4	parameters	parameter	NNS
10_1101-2020_12_31_424971	410	5	,	,	,
10_1101-2020_12_31_424971	410	6	we	-PRON-	PRP
10_1101-2020_12_31_424971	410	7	extended	extend	VBD
10_1101-2020_12_31_424971	410	8	the	the	DT
10_1101-2020_12_31_424971	410	9	variational	variational	JJ
10_1101-2020_12_31_424971	410	10	Bayes	Bayes	NNP
10_1101-2020_12_31_424971	410	11	approach	approach	VBP
10_1101-2020_12_31_424971	410	12	949	949	CD
10_1101-2020_12_31_424971	410	13	we	-PRON-	PRP
10_1101-2020_12_31_424971	410	14	introduced	introduce	VBD
10_1101-2020_12_31_424971	410	15	in	in	IN
10_1101-2020_12_31_424971	410	16	the	the	DT
10_1101-2020_12_31_424971	410	17	vbFRET	vbFRET	NNP
10_1101-2020_12_31_424971	410	18	algorithm68	algorithm68	NNP
10_1101-2020_12_31_424971	410	19	to	to	TO
10_1101-2020_12_31_424971	410	20	estimate	estimate	VB
10_1101-2020_12_31_424971	410	21	a	a	DT
10_1101-2020_12_31_424971	410	22	‘	'	``
10_1101-2020_12_31_424971	410	23	consensus	consensus	NN
10_1101-2020_12_31_424971	410	24	’	'	''
10_1101-2020_12_31_424971	410	25	(	(	-LRB-
10_1101-2020_12_31_424971	410	26	i.e.	i.e.	FW
10_1101-2020_12_31_424971	410	27	,	,	,
10_1101-2020_12_31_424971	410	28	‘	'	``
10_1101-2020_12_31_424971	410	29	global	global	JJ
10_1101-2020_12_31_424971	410	30	’	'	''
10_1101-2020_12_31_424971	410	31	)	)	-RRB-
10_1101-2020_12_31_424971	410	32	HMM	HMM	NNP
10_1101-2020_12_31_424971	410	33	of	of	IN
10_1101-2020_12_31_424971	410	34	the	the	DT
10_1101-2020_12_31_424971	410	35	950	950	CD
10_1101-2020_12_31_424971	410	36	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	410	37	vs.	vs.	NN
10_1101-2020_12_31_424971	410	38	time	time	NN
10_1101-2020_12_31_424971	410	39	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	410	40	.	.	.
10_1101-2020_12_31_424971	411	1	In	in	IN
10_1101-2020_12_31_424971	411	2	this	this	DT
10_1101-2020_12_31_424971	411	3	approach	approach	NN
10_1101-2020_12_31_424971	411	4	,	,	,
10_1101-2020_12_31_424971	411	5	we	-PRON-	PRP
10_1101-2020_12_31_424971	411	6	use	use	VBP
10_1101-2020_12_31_424971	411	7	Bayesian	bayesian	JJ
10_1101-2020_12_31_424971	411	8	inference	inference	NN
10_1101-2020_12_31_424971	411	9	to	to	TO
10_1101-2020_12_31_424971	411	10	estimate	estimate	VB
10_1101-2020_12_31_424971	411	11	a	a	DT
10_1101-2020_12_31_424971	411	12	single	single	JJ
10_1101-2020_12_31_424971	411	13	,	,	,
10_1101-2020_12_31_424971	411	14	951	951	CD
10_1101-2020_12_31_424971	411	15	consensus	consensus	NN
10_1101-2020_12_31_424971	411	16	HMM	HMM	NNP
10_1101-2020_12_31_424971	411	17	that	that	WDT
10_1101-2020_12_31_424971	411	18	is	be	VBZ
10_1101-2020_12_31_424971	411	19	most	most	RBS
10_1101-2020_12_31_424971	411	20	consistent	consistent	JJ
10_1101-2020_12_31_424971	411	21	with	with	IN
10_1101-2020_12_31_424971	411	22	all	all	PDT
10_1101-2020_12_31_424971	411	23	the	the	DT
10_1101-2020_12_31_424971	411	24	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	411	25	vs.	vs.	NN
10_1101-2020_12_31_424971	411	26	time	time	NN
10_1101-2020_12_31_424971	411	27	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	411	28	in	in	IN
10_1101-2020_12_31_424971	411	29	a	a	DT
10_1101-2020_12_31_424971	411	30	movie	movie	NN
10_1101-2020_12_31_424971	411	31	,	,	,
10_1101-2020_12_31_424971	411	32	rather	rather	RB
10_1101-2020_12_31_424971	411	33	952	952	CD
10_1101-2020_12_31_424971	411	34	than	than	IN
10_1101-2020_12_31_424971	411	35	to	to	TO
10_1101-2020_12_31_424971	411	36	estimate	estimate	VB
10_1101-2020_12_31_424971	411	37	a	a	DT
10_1101-2020_12_31_424971	411	38	separate	separate	JJ
10_1101-2020_12_31_424971	411	39	HMM	HMM	NNP
10_1101-2020_12_31_424971	411	40	for	for	IN
10_1101-2020_12_31_424971	411	41	each	each	DT
10_1101-2020_12_31_424971	411	42	trajectory	trajectory	NN
10_1101-2020_12_31_424971	411	43	in	in	IN
10_1101-2020_12_31_424971	411	44	the	the	DT
10_1101-2020_12_31_424971	411	45	movie	movie	NN
10_1101-2020_12_31_424971	411	46	.	.	.
10_1101-2020_12_31_424971	412	1	To	to	TO
10_1101-2020_12_31_424971	412	2	estimate	estimate	VB
10_1101-2020_12_31_424971	412	3	such	such	PDT
10_1101-2020_12_31_424971	412	4	a	a	DT
10_1101-2020_12_31_424971	412	5	consensus	consensus	NN
10_1101-2020_12_31_424971	412	6	953	953	CD
10_1101-2020_12_31_424971	412	7	HMM	HMM	NNP
10_1101-2020_12_31_424971	412	8	,	,	,
10_1101-2020_12_31_424971	412	9	we	-PRON-	PRP
10_1101-2020_12_31_424971	412	10	assume	assume	VBP
10_1101-2020_12_31_424971	412	11	each	each	DT
10_1101-2020_12_31_424971	412	12	trajectory	trajectory	CD
10_1101-2020_12_31_424971	412	13	is	be	VBZ
10_1101-2020_12_31_424971	412	14	independent	independent	JJ
10_1101-2020_12_31_424971	412	15	and	and	CC
10_1101-2020_12_31_424971	412	16	identically	identically	RB
10_1101-2020_12_31_424971	412	17	distributed	distribute	VBN
10_1101-2020_12_31_424971	412	18	,	,	,
10_1101-2020_12_31_424971	412	19	thereby	thereby	RB
10_1101-2020_12_31_424971	412	20	enabling	enable	VBG
10_1101-2020_12_31_424971	412	21	us	-PRON-	PRP
10_1101-2020_12_31_424971	412	22	954	954	CD
10_1101-2020_12_31_424971	412	23	to	to	TO
10_1101-2020_12_31_424971	412	24	perform	perform	VB
10_1101-2020_12_31_424971	412	25	the	the	DT
10_1101-2020_12_31_424971	412	26	inference	inference	NN
10_1101-2020_12_31_424971	412	27	using	use	VBG
10_1101-2020_12_31_424971	412	28	the	the	DT
10_1101-2020_12_31_424971	412	29	likelihood	likelihood	NN
10_1101-2020_12_31_424971	412	30	function	function	NN
10_1101-2020_12_31_424971	412	31	955	955	CD
10_1101-2020_12_31_424971	412	32	ℒ	ℒ	NNP
10_1101-2020_12_31_424971	412	33	=	=	SYM
10_1101-2020_12_31_424971	412	34	∏	∏	NNP
10_1101-2020_12_31_424971	412	35	ℒ	ℒ	NNP
10_1101-2020_12_31_424971	412	36	&	&	CC
10_1101-2020_12_31_424971	412	37	&	&	CC
10_1101-2020_12_31_424971	412	38	∈	∈	NNP
10_1101-2020_12_31_424971	412	39	)	)	-RRB-
10_1101-2020_12_31_424971	412	40	*	*	NFP
10_1101-2020_12_31_424971	412	41	+	+	SYM
10_1101-2020_12_31_424971	412	42	,	,	,
10_1101-2020_12_31_424971	412	43	-	-	:
10_1101-2020_12_31_424971	412	44	.	.	.
10_1101-2020_12_31_424971	413	1	)	)	-RRB-
10_1101-2020_12_31_424971	413	2	/*0	/*0	NFP
10_1101-2020_12_31_424971	413	3	-	-	SYM
10_1101-2020_12_31_424971	413	4	1	1	CD
10_1101-2020_12_31_424971	413	5	,	,	,
10_1101-2020_12_31_424971	413	6	(	(	-LRB-
10_1101-2020_12_31_424971	413	7	2	2	LS
10_1101-2020_12_31_424971	413	8	)	)	-RRB-
10_1101-2020_12_31_424971	413	9	956	956	CD
10_1101-2020_12_31_424971	413	10	.CC	.CC	:
10_1101-2020_12_31_424971	413	11	-	-	HYPH
10_1101-2020_12_31_424971	413	12	BY	by	IN
10_1101-2020_12_31_424971	413	13	-	-	HYPH
10_1101-2020_12_31_424971	413	14	NC	NC	NNP
10_1101-2020_12_31_424971	413	15	-	-	HYPH
10_1101-2020_12_31_424971	413	16	ND	ND	NNP
10_1101-2020_12_31_424971	413	17	4.0	4.0	CD
10_1101-2020_12_31_424971	413	18	International	International	NNP
10_1101-2020_12_31_424971	413	19	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	413	20	under	under	IN
10_1101-2020_12_31_424971	413	21	a	a	DT
10_1101-2020_12_31_424971	413	22	(	(	-LRB-
10_1101-2020_12_31_424971	413	23	which	which	WDT
10_1101-2020_12_31_424971	413	24	was	be	VBD
10_1101-2020_12_31_424971	413	25	not	not	RB
10_1101-2020_12_31_424971	413	26	certified	certify	VBN
10_1101-2020_12_31_424971	413	27	by	by	IN
10_1101-2020_12_31_424971	413	28	peer	peer	NN
10_1101-2020_12_31_424971	413	29	review	review	NN
10_1101-2020_12_31_424971	413	30	)	)	-RRB-
10_1101-2020_12_31_424971	413	31	is	be	VBZ
10_1101-2020_12_31_424971	413	32	the	the	DT
10_1101-2020_12_31_424971	413	33	author	author	NN
10_1101-2020_12_31_424971	413	34	/	/	SYM
10_1101-2020_12_31_424971	413	35	funder	funder	NN
10_1101-2020_12_31_424971	413	36	,	,	,
10_1101-2020_12_31_424971	413	37	who	who	WP
10_1101-2020_12_31_424971	413	38	has	have	VBZ
10_1101-2020_12_31_424971	413	39	granted	grant	VBN
10_1101-2020_12_31_424971	413	40	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	413	41	a	a	DT
10_1101-2020_12_31_424971	413	42	license	license	NN
10_1101-2020_12_31_424971	413	43	to	to	TO
10_1101-2020_12_31_424971	413	44	display	display	VB
10_1101-2020_12_31_424971	413	45	the	the	DT
10_1101-2020_12_31_424971	413	46	preprint	preprint	NN
10_1101-2020_12_31_424971	413	47	in	in	IN
10_1101-2020_12_31_424971	413	48	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	413	49	.	.	.
10_1101-2020_12_31_424971	414	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	414	2	is	be	VBZ
10_1101-2020_12_31_424971	414	3	made	make	VBN
10_1101-2020_12_31_424971	414	4	The	the	DT
10_1101-2020_12_31_424971	414	5	copyright	copyright	NN
10_1101-2020_12_31_424971	414	6	holder	holder	NN
10_1101-2020_12_31_424971	414	7	for	for	IN
10_1101-2020_12_31_424971	414	8	this	this	DT
10_1101-2020_12_31_424971	414	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	414	10	version	version	NN
10_1101-2020_12_31_424971	414	11	posted	post	VBD
10_1101-2020_12_31_424971	414	12	January	January	NNP
10_1101-2020_12_31_424971	414	13	2	2	CD
10_1101-2020_12_31_424971	414	14	,	,	,
10_1101-2020_12_31_424971	414	15	2021	2021	CD
10_1101-2020_12_31_424971	414	16	.	.	.
10_1101-2020_12_31_424971	414	17	;	;	:
10_1101-2020_12_31_424971	414	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	414	19	:	:	:
10_1101-2020_12_31_424971	414	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	414	21	preprint	preprint	NN
10_1101-2020_12_31_424971	414	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	414	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	414	24	39	39	CD
10_1101-2020_12_31_424971	414	25	where	where	WRB
10_1101-2020_12_31_424971	414	26	ℒ	ℒ	NNP
10_1101-2020_12_31_424971	414	27	&	&	CC
10_1101-2020_12_31_424971	414	28	is	be	VBZ
10_1101-2020_12_31_424971	414	29	the	the	DT
10_1101-2020_12_31_424971	414	30	variational	variational	JJ
10_1101-2020_12_31_424971	414	31	approximation	approximation	NN
10_1101-2020_12_31_424971	414	32	of	of	IN
10_1101-2020_12_31_424971	414	33	the	the	DT
10_1101-2020_12_31_424971	414	34	likelihood	likelihood	NN
10_1101-2020_12_31_424971	414	35	function	function	NN
10_1101-2020_12_31_424971	414	36	for	for	IN
10_1101-2020_12_31_424971	414	37	a	a	DT
10_1101-2020_12_31_424971	414	38	single	single	JJ
10_1101-2020_12_31_424971	414	39	trajectory	trajectory	NN
10_1101-2020_12_31_424971	414	40	.	.	.
10_1101-2020_12_31_424971	415	1	957	957	CD
10_1101-2020_12_31_424971	415	2	Subsequently	subsequently	RB
10_1101-2020_12_31_424971	415	3	,	,	,
10_1101-2020_12_31_424971	415	4	the	the	DT
10_1101-2020_12_31_424971	415	5	single	single	JJ
10_1101-2020_12_31_424971	415	6	,	,	,
10_1101-2020_12_31_424971	415	7	consensus	consensus	NN
10_1101-2020_12_31_424971	415	8	HMM	HMM	NNP
10_1101-2020_12_31_424971	415	9	that	that	WDT
10_1101-2020_12_31_424971	415	10	is	be	VBZ
10_1101-2020_12_31_424971	415	11	most	most	RBS
10_1101-2020_12_31_424971	415	12	consistent	consistent	JJ
10_1101-2020_12_31_424971	415	13	with	with	IN
10_1101-2020_12_31_424971	415	14	all	all	DT
10_1101-2020_12_31_424971	415	15	of	of	IN
10_1101-2020_12_31_424971	415	16	the	the	DT
10_1101-2020_12_31_424971	415	17	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	415	18	is	be	VBZ
10_1101-2020_12_31_424971	415	19	958	958	CD
10_1101-2020_12_31_424971	415	20	estimated	estimate	VBN
10_1101-2020_12_31_424971	415	21	using	use	VBG
10_1101-2020_12_31_424971	415	22	the	the	DT
10_1101-2020_12_31_424971	415	23	expectation	expectation	NN
10_1101-2020_12_31_424971	415	24	-	-	HYPH
10_1101-2020_12_31_424971	415	25	maximization	maximization	NN
10_1101-2020_12_31_424971	415	26	algorithm	algorithm	NN
10_1101-2020_12_31_424971	415	27	that	that	IN
10_1101-2020_12_31_424971	415	28	we	-PRON-	PRP
10_1101-2020_12_31_424971	415	29	have	have	VBP
10_1101-2020_12_31_424971	415	30	previously	previously	RB
10_1101-2020_12_31_424971	415	31	described68	described68	NFP
10_1101-2020_12_31_424971	415	32	.	.	.
10_1101-2020_12_31_424971	416	1	959	959	CD
10_1101-2020_12_31_424971	416	2	Viterbi	Viterbi	NNP
10_1101-2020_12_31_424971	416	3	paths	path	NNS
10_1101-2020_12_31_424971	416	4	(	(	-LRB-
10_1101-2020_12_31_424971	416	5	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	416	6	Figures	Figures	NNPS
10_1101-2020_12_31_424971	416	7	3	3	CD
10_1101-2020_12_31_424971	416	8	,	,	,
10_1101-2020_12_31_424971	416	9	5	5	CD
10_1101-2020_12_31_424971	416	10	,	,	,
10_1101-2020_12_31_424971	416	11	and	and	CC
10_1101-2020_12_31_424971	416	12	6	6	CD
10_1101-2020_12_31_424971	416	13	)	)	-RRB-
10_1101-2020_12_31_424971	416	14	,	,	,
10_1101-2020_12_31_424971	416	15	representing	represent	VBG
10_1101-2020_12_31_424971	416	16	the	the	DT
10_1101-2020_12_31_424971	416	17	most	most	RBS
10_1101-2020_12_31_424971	416	18	probable	probable	JJ
10_1101-2020_12_31_424971	416	19	hidden	hide	VBN
10_1101-2020_12_31_424971	416	20	-	-	HYPH
10_1101-2020_12_31_424971	416	21	state	state	NN
10_1101-2020_12_31_424971	416	22	960	960	CD
10_1101-2020_12_31_424971	416	23	trajectory	trajectory	CD
10_1101-2020_12_31_424971	416	24	,	,	,
10_1101-2020_12_31_424971	416	25	were	be	VBD
10_1101-2020_12_31_424971	416	26	then	then	RB
10_1101-2020_12_31_424971	416	27	calculated	calculate	VBN
10_1101-2020_12_31_424971	416	28	from	from	IN
10_1101-2020_12_31_424971	416	29	the	the	DT
10_1101-2020_12_31_424971	416	30	HMM	HMM	NNP
10_1101-2020_12_31_424971	416	31	using	use	VBG
10_1101-2020_12_31_424971	416	32	the	the	DT
10_1101-2020_12_31_424971	416	33	Viterbi	Viterbi	NNP
10_1101-2020_12_31_424971	416	34	algorithm69	algorithm69	NNP
10_1101-2020_12_31_424971	416	35	.	.	.
10_1101-2020_12_31_424971	417	1	Based	base	VBN
10_1101-2020_12_31_424971	417	2	on	on	IN
10_1101-2020_12_31_424971	417	3	extensive	extensive	JJ
10_1101-2020_12_31_424971	417	4	961	961	CD
10_1101-2020_12_31_424971	417	5	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	417	6	studies	study	NNS
10_1101-2020_12_31_424971	417	7	of	of	IN
10_1101-2020_12_31_424971	417	8	translation	translation	NN
10_1101-2020_12_31_424971	417	9	elongation	elongation	NN
10_1101-2020_12_31_424971	417	10	using	use	VBG
10_1101-2020_12_31_424971	417	11	the	the	DT
10_1101-2020_12_31_424971	417	12	bL9(Cy3)-uL1(Cy5	bl9(cy3)-ul1(cy5	NN
10_1101-2020_12_31_424971	417	13	)	)	-RRB-
10_1101-2020_12_31_424971	417	14	smFRET	smfret	$
10_1101-2020_12_31_424971	417	15	signal35,36,38	signal35,36,38	CD
10_1101-2020_12_31_424971	417	16	,	,	,
10_1101-2020_12_31_424971	417	17	we	-PRON-	PRP
10_1101-2020_12_31_424971	417	18	962	962	CD
10_1101-2020_12_31_424971	417	19	selected	select	VBD
10_1101-2020_12_31_424971	417	20	a	a	DT
10_1101-2020_12_31_424971	417	21	consensus	consensus	NN
10_1101-2020_12_31_424971	417	22	HMM	HMM	NNP
10_1101-2020_12_31_424971	417	23	composed	compose	VBN
10_1101-2020_12_31_424971	417	24	of	of	IN
10_1101-2020_12_31_424971	417	25	three	three	CD
10_1101-2020_12_31_424971	417	26	states	state	NNS
10_1101-2020_12_31_424971	417	27	for	for	IN
10_1101-2020_12_31_424971	417	28	further	further	JJ
10_1101-2020_12_31_424971	417	29	analysis	analysis	NN
10_1101-2020_12_31_424971	417	30	of	of	IN
10_1101-2020_12_31_424971	417	31	the	the	DT
10_1101-2020_12_31_424971	417	32	data	datum	NNS
10_1101-2020_12_31_424971	417	33	.	.	.
10_1101-2020_12_31_424971	418	1	For	for	IN
10_1101-2020_12_31_424971	418	2	963	963	CD
10_1101-2020_12_31_424971	418	3	calculation	calculation	NN
10_1101-2020_12_31_424971	418	4	of	of	IN
10_1101-2020_12_31_424971	418	5	the	the	DT
10_1101-2020_12_31_424971	418	6	kinetic	kinetic	JJ
10_1101-2020_12_31_424971	418	7	and/or	and/or	CC
10_1101-2020_12_31_424971	418	8	thermodynamic	thermodynamic	JJ
10_1101-2020_12_31_424971	418	9	parameters	parameter	NNS
10_1101-2020_12_31_424971	418	10	in	in	IN
10_1101-2020_12_31_424971	418	11	(	(	-LRB-
10_1101-2020_12_31_424971	418	12	i	i	NN
10_1101-2020_12_31_424971	418	13	)	)	-RRB-
10_1101-2020_12_31_424971	418	14	,	,	,
10_1101-2020_12_31_424971	418	15	(	(	-LRB-
10_1101-2020_12_31_424971	418	16	iv	iv	LS
10_1101-2020_12_31_424971	418	17	)	)	-RRB-
10_1101-2020_12_31_424971	418	18	,	,	,
10_1101-2020_12_31_424971	418	19	and	and	CC
10_1101-2020_12_31_424971	418	20	(	(	-LRB-
10_1101-2020_12_31_424971	418	21	v	v	NN
10_1101-2020_12_31_424971	418	22	)	)	-RRB-
10_1101-2020_12_31_424971	418	23	,	,	,
10_1101-2020_12_31_424971	418	24	the	the	DT
10_1101-2020_12_31_424971	418	25	three	three	CD
10_1101-2020_12_31_424971	418	26	states	state	NNS
10_1101-2020_12_31_424971	418	27	964	964	CD
10_1101-2020_12_31_424971	418	28	corresponded	correspond	VBD
10_1101-2020_12_31_424971	418	29	to	to	IN
10_1101-2020_12_31_424971	418	30	GS1	GS1	NNP
10_1101-2020_12_31_424971	418	31	,	,	,
10_1101-2020_12_31_424971	418	32	GS2	GS2	NNP
10_1101-2020_12_31_424971	418	33	,	,	,
10_1101-2020_12_31_424971	418	34	and	and	CC
10_1101-2020_12_31_424971	418	35	Æ	Æ	NNP
10_1101-2020_12_31_424971	418	36	and	and	CC
10_1101-2020_12_31_424971	418	37	for	for	IN
10_1101-2020_12_31_424971	418	38	calculation	calculation	NN
10_1101-2020_12_31_424971	418	39	of	of	IN
10_1101-2020_12_31_424971	418	40	the	the	DT
10_1101-2020_12_31_424971	418	41	kinetic	kinetic	NN
10_1101-2020_12_31_424971	418	42	and/or	and/or	CC
10_1101-2020_12_31_424971	418	43	thermodynamic	thermodynamic	NN
10_1101-2020_12_31_424971	418	44	965	965	CD
10_1101-2020_12_31_424971	418	45	parameters	parameter	NNS
10_1101-2020_12_31_424971	418	46	in	in	IN
10_1101-2020_12_31_424971	418	47	(	(	-LRB-
10_1101-2020_12_31_424971	418	48	ii	ii	NNP
10_1101-2020_12_31_424971	418	49	)	)	-RRB-
10_1101-2020_12_31_424971	418	50	and	and	CC
10_1101-2020_12_31_424971	418	51	(	(	-LRB-
10_1101-2020_12_31_424971	418	52	iii	iii	NNP
10_1101-2020_12_31_424971	418	53	)	)	-RRB-
10_1101-2020_12_31_424971	418	54	,	,	,
10_1101-2020_12_31_424971	418	55	the	the	DT
10_1101-2020_12_31_424971	418	56	three	three	CD
10_1101-2020_12_31_424971	418	57	states	state	NNS
10_1101-2020_12_31_424971	418	58	corresponded	correspond	VBD
10_1101-2020_12_31_424971	418	59	to	to	IN
10_1101-2020_12_31_424971	418	60	EF	EF	NNP
10_1101-2020_12_31_424971	418	61	-	-	HYPH
10_1101-2020_12_31_424971	418	62	G	G	NNP
10_1101-2020_12_31_424971	418	63	-	-	HYPH
10_1101-2020_12_31_424971	418	64	bound	bind	VBN
10_1101-2020_12_31_424971	418	65	GS2-like	GS2-like	NNP
10_1101-2020_12_31_424971	418	66	,	,	,
10_1101-2020_12_31_424971	418	67	POST	POST	NNP
10_1101-2020_12_31_424971	418	68	,	,	,
10_1101-2020_12_31_424971	418	69	and	and	CC
10_1101-2020_12_31_424971	418	70	Æ.	æ.	NN
10_1101-2020_12_31_424971	419	1	966	966	CD
10_1101-2020_12_31_424971	419	2	The	the	DT
10_1101-2020_12_31_424971	419	3	transition	transition	NN
10_1101-2020_12_31_424971	419	4	matrix	matrix	NN
10_1101-2020_12_31_424971	419	5	of	of	IN
10_1101-2020_12_31_424971	419	6	the	the	DT
10_1101-2020_12_31_424971	419	7	consensus	consensus	NN
10_1101-2020_12_31_424971	419	8	HMM	HMM	NNP
10_1101-2020_12_31_424971	419	9	was	be	VBD
10_1101-2020_12_31_424971	419	10	then	then	RB
10_1101-2020_12_31_424971	419	11	used	use	VBN
10_1101-2020_12_31_424971	419	12	to	to	TO
10_1101-2020_12_31_424971	419	13	calculate	calculate	VB
10_1101-2020_12_31_424971	419	14	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	419	15	and	and	CC
10_1101-2020_12_31_424971	419	16	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	419	17	in	in	IN
10_1101-2020_12_31_424971	419	18	967	967	CD
10_1101-2020_12_31_424971	419	19	(	(	-LRB-
10_1101-2020_12_31_424971	419	20	i	i	NN
10_1101-2020_12_31_424971	419	21	)	)	-RRB-
10_1101-2020_12_31_424971	419	22	,	,	,
10_1101-2020_12_31_424971	419	23	(	(	-LRB-
10_1101-2020_12_31_424971	419	24	iv	iv	LS
10_1101-2020_12_31_424971	419	25	)	)	-RRB-
10_1101-2020_12_31_424971	419	26	,	,	,
10_1101-2020_12_31_424971	419	27	and	and	CC
10_1101-2020_12_31_424971	419	28	(	(	-LRB-
10_1101-2020_12_31_424971	419	29	v	v	NN
10_1101-2020_12_31_424971	419	30	)	)	-RRB-
10_1101-2020_12_31_424971	419	31	;	;	:
10_1101-2020_12_31_424971	419	32	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	419	33	in	in	IN
10_1101-2020_12_31_424971	419	34	(	(	-LRB-
10_1101-2020_12_31_424971	419	35	ii	ii	NNP
10_1101-2020_12_31_424971	419	36	)	)	-RRB-
10_1101-2020_12_31_424971	419	37	;	;	:
10_1101-2020_12_31_424971	419	38	kGS1→Æ	kGS1→Æ	NNP
10_1101-2020_12_31_424971	419	39	,	,	,
10_1101-2020_12_31_424971	419	40	kGS2→Æ	kGS2→Æ	NNP
10_1101-2020_12_31_424971	419	41	,	,	,
10_1101-2020_12_31_424971	419	42	kGS2(G)→Æ	kGS2(G)→Æ	NNP
10_1101-2020_12_31_424971	419	43	,	,	,
10_1101-2020_12_31_424971	419	44	and	and	CC
10_1101-2020_12_31_424971	419	45	kPOST→Æ	kpost→æ	NN
10_1101-2020_12_31_424971	419	46	in	in	RP
10_1101-2020_12_31_424971	419	47	(	(	-LRB-
10_1101-2020_12_31_424971	419	48	vi	vi	NNP
10_1101-2020_12_31_424971	419	49	)	)	-RRB-
10_1101-2020_12_31_424971	419	50	;	;	:
10_1101-2020_12_31_424971	419	51	and	and	CC
10_1101-2020_12_31_424971	419	52	the	the	DT
10_1101-2020_12_31_424971	419	53	errors	error	NNS
10_1101-2020_12_31_424971	419	54	968	968	CD
10_1101-2020_12_31_424971	419	55	corresponding	correspond	VBG
10_1101-2020_12_31_424971	419	56	to	to	IN
10_1101-2020_12_31_424971	419	57	each	each	DT
10_1101-2020_12_31_424971	419	58	of	of	IN
10_1101-2020_12_31_424971	419	59	these	these	DT
10_1101-2020_12_31_424971	419	60	parameters	parameter	NNS
10_1101-2020_12_31_424971	419	61	.	.	.
10_1101-2020_12_31_424971	420	1	This	this	DT
10_1101-2020_12_31_424971	420	2	transition	transition	NN
10_1101-2020_12_31_424971	420	3	matrix	matrix	NN
10_1101-2020_12_31_424971	420	4	consists	consist	VBZ
10_1101-2020_12_31_424971	420	5	of	of	IN
10_1101-2020_12_31_424971	420	6	a	a	DT
10_1101-2020_12_31_424971	420	7	3	3	CD
10_1101-2020_12_31_424971	420	8	x	x	SYM
10_1101-2020_12_31_424971	420	9	3	3	CD
10_1101-2020_12_31_424971	420	10	matrix	matrix	NN
10_1101-2020_12_31_424971	420	11	in	in	IN
10_1101-2020_12_31_424971	420	12	969	969	CD
10_1101-2020_12_31_424971	420	13	which	which	WDT
10_1101-2020_12_31_424971	420	14	the	the	DT
10_1101-2020_12_31_424971	420	15	off	off	JJ
10_1101-2020_12_31_424971	420	16	-	-	HYPH
10_1101-2020_12_31_424971	420	17	diagonal	diagonal	JJ
10_1101-2020_12_31_424971	420	18	elements	element	NNS
10_1101-2020_12_31_424971	420	19	correspond	correspond	VBP
10_1101-2020_12_31_424971	420	20	to	to	IN
10_1101-2020_12_31_424971	420	21	the	the	DT
10_1101-2020_12_31_424971	420	22	number	number	NN
10_1101-2020_12_31_424971	420	23	of	of	IN
10_1101-2020_12_31_424971	420	24	times	time	NNS
10_1101-2020_12_31_424971	420	25	a	a	DT
10_1101-2020_12_31_424971	420	26	transition	transition	NN
10_1101-2020_12_31_424971	420	27	takes	take	VBZ
10_1101-2020_12_31_424971	420	28	place	place	NN
10_1101-2020_12_31_424971	420	29	970	970	CD
10_1101-2020_12_31_424971	420	30	between	between	IN
10_1101-2020_12_31_424971	420	31	each	each	DT
10_1101-2020_12_31_424971	420	32	pair	pair	NN
10_1101-2020_12_31_424971	420	33	of	of	IN
10_1101-2020_12_31_424971	420	34	the	the	DT
10_1101-2020_12_31_424971	420	35	GS1	GS1	NNP
10_1101-2020_12_31_424971	420	36	,	,	,
10_1101-2020_12_31_424971	420	37	GS2	GS2	NNP
10_1101-2020_12_31_424971	420	38	,	,	,
10_1101-2020_12_31_424971	420	39	and	and	CC
10_1101-2020_12_31_424971	420	40	Æ	æ	NN
10_1101-2020_12_31_424971	420	41	states	state	NNS
10_1101-2020_12_31_424971	420	42	(	(	-LRB-
10_1101-2020_12_31_424971	420	43	in	in	IN
10_1101-2020_12_31_424971	420	44	(	(	-LRB-
10_1101-2020_12_31_424971	420	45	i	i	NN
10_1101-2020_12_31_424971	420	46	)	)	-RRB-
10_1101-2020_12_31_424971	420	47	,	,	,
10_1101-2020_12_31_424971	420	48	(	(	-LRB-
10_1101-2020_12_31_424971	420	49	iv	iv	NN
10_1101-2020_12_31_424971	420	50	)	)	-RRB-
10_1101-2020_12_31_424971	420	51	,	,	,
10_1101-2020_12_31_424971	420	52	(	(	-LRB-
10_1101-2020_12_31_424971	420	53	v	v	NN
10_1101-2020_12_31_424971	420	54	)	)	-RRB-
10_1101-2020_12_31_424971	420	55	,	,	,
10_1101-2020_12_31_424971	420	56	and	and	CC
10_1101-2020_12_31_424971	420	57	(	(	-LRB-
10_1101-2020_12_31_424971	420	58	vi	vi	NNP
10_1101-2020_12_31_424971	420	59	)	)	-RRB-
10_1101-2020_12_31_424971	420	60	)	)	-RRB-
10_1101-2020_12_31_424971	420	61	or	or	CC
10_1101-2020_12_31_424971	420	62	each	each	DT
10_1101-2020_12_31_424971	420	63	pair	pair	NN
10_1101-2020_12_31_424971	420	64	of	of	IN
10_1101-2020_12_31_424971	420	65	the	the	DT
10_1101-2020_12_31_424971	420	66	EF-971	EF-971	NNP
10_1101-2020_12_31_424971	420	67	G	G	NNP
10_1101-2020_12_31_424971	420	68	-	-	HYPH
10_1101-2020_12_31_424971	420	69	bound	bind	VBN
10_1101-2020_12_31_424971	420	70	GS2-like	GS2-like	NNP
10_1101-2020_12_31_424971	420	71	,	,	,
10_1101-2020_12_31_424971	420	72	POST	POST	NNP
10_1101-2020_12_31_424971	420	73	,	,	,
10_1101-2020_12_31_424971	420	74	and	and	CC
10_1101-2020_12_31_424971	420	75	Æ	Æ	NNP
10_1101-2020_12_31_424971	420	76	states	state	NNS
10_1101-2020_12_31_424971	420	77	(	(	-LRB-
10_1101-2020_12_31_424971	420	78	in	in	IN
10_1101-2020_12_31_424971	420	79	(	(	-LRB-
10_1101-2020_12_31_424971	420	80	ii	ii	NNP
10_1101-2020_12_31_424971	420	81	)	)	-RRB-
10_1101-2020_12_31_424971	420	82	and	and	CC
10_1101-2020_12_31_424971	420	83	(	(	-LRB-
10_1101-2020_12_31_424971	420	84	vi	vi	NNP
10_1101-2020_12_31_424971	420	85	)	)	-RRB-
10_1101-2020_12_31_424971	420	86	)	)	-RRB-
10_1101-2020_12_31_424971	420	87	and	and	CC
10_1101-2020_12_31_424971	420	88	the	the	DT
10_1101-2020_12_31_424971	420	89	on	on	IN
10_1101-2020_12_31_424971	420	90	-	-	HYPH
10_1101-2020_12_31_424971	420	91	diagonal	diagonal	JJ
10_1101-2020_12_31_424971	420	92	elements	element	NNS
10_1101-2020_12_31_424971	420	93	correspond	correspond	VBP
10_1101-2020_12_31_424971	420	94	972	972	CD
10_1101-2020_12_31_424971	420	95	to	to	IN
10_1101-2020_12_31_424971	420	96	the	the	DT
10_1101-2020_12_31_424971	420	97	number	number	NN
10_1101-2020_12_31_424971	420	98	of	of	IN
10_1101-2020_12_31_424971	420	99	times	time	NNS
10_1101-2020_12_31_424971	420	100	a	a	DT
10_1101-2020_12_31_424971	420	101	transition	transition	NN
10_1101-2020_12_31_424971	420	102	does	do	VBZ
10_1101-2020_12_31_424971	420	103	not	not	RB
10_1101-2020_12_31_424971	420	104	take	take	VB
10_1101-2020_12_31_424971	420	105	place	place	NN
10_1101-2020_12_31_424971	420	106	out	out	IN
10_1101-2020_12_31_424971	420	107	of	of	IN
10_1101-2020_12_31_424971	420	108	the	the	DT
10_1101-2020_12_31_424971	420	109	GS1	GS1	NNP
10_1101-2020_12_31_424971	420	110	,	,	,
10_1101-2020_12_31_424971	420	111	GS2	GS2	NNP
10_1101-2020_12_31_424971	420	112	,	,	,
10_1101-2020_12_31_424971	420	113	and	and	CC
10_1101-2020_12_31_424971	420	114	Æ	æ	NN
10_1101-2020_12_31_424971	420	115	states	state	NNS
10_1101-2020_12_31_424971	420	116	(	(	-LRB-
10_1101-2020_12_31_424971	420	117	in	in	IN
10_1101-2020_12_31_424971	420	118	(	(	-LRB-
10_1101-2020_12_31_424971	420	119	i	i	NN
10_1101-2020_12_31_424971	420	120	)	)	-RRB-
10_1101-2020_12_31_424971	420	121	,	,	,
10_1101-2020_12_31_424971	420	122	973	973	CD
10_1101-2020_12_31_424971	420	123	(	(	-LRB-
10_1101-2020_12_31_424971	420	124	iv	iv	NN
10_1101-2020_12_31_424971	420	125	)	)	-RRB-
10_1101-2020_12_31_424971	420	126	,	,	,
10_1101-2020_12_31_424971	420	127	(	(	-LRB-
10_1101-2020_12_31_424971	420	128	v	v	NN
10_1101-2020_12_31_424971	420	129	)	)	-RRB-
10_1101-2020_12_31_424971	420	130	,	,	,
10_1101-2020_12_31_424971	420	131	and	and	CC
10_1101-2020_12_31_424971	420	132	(	(	-LRB-
10_1101-2020_12_31_424971	420	133	vi	vi	NNP
10_1101-2020_12_31_424971	420	134	)	)	-RRB-
10_1101-2020_12_31_424971	420	135	)	)	-RRB-
10_1101-2020_12_31_424971	420	136	or	or	CC
10_1101-2020_12_31_424971	420	137	out	out	IN
10_1101-2020_12_31_424971	420	138	of	of	IN
10_1101-2020_12_31_424971	420	139	the	the	DT
10_1101-2020_12_31_424971	420	140	EF	EF	NNP
10_1101-2020_12_31_424971	420	141	-	-	HYPH
10_1101-2020_12_31_424971	420	142	G	G	NNP
10_1101-2020_12_31_424971	420	143	-	-	HYPH
10_1101-2020_12_31_424971	420	144	bound	bind	VBN
10_1101-2020_12_31_424971	420	145	GS2-like	GS2-like	NNP
10_1101-2020_12_31_424971	420	146	,	,	,
10_1101-2020_12_31_424971	420	147	POST	POST	NNP
10_1101-2020_12_31_424971	420	148	,	,	,
10_1101-2020_12_31_424971	420	149	and	and	CC
10_1101-2020_12_31_424971	420	150	Æ	Æ	NNP
10_1101-2020_12_31_424971	420	151	states	state	NNS
10_1101-2020_12_31_424971	420	152	(	(	-LRB-
10_1101-2020_12_31_424971	420	153	in	in	IN
10_1101-2020_12_31_424971	420	154	(	(	-LRB-
10_1101-2020_12_31_424971	420	155	ii	ii	NNP
10_1101-2020_12_31_424971	420	156	)	)	-RRB-
10_1101-2020_12_31_424971	420	157	and	and	CC
10_1101-2020_12_31_424971	420	158	(	(	-LRB-
10_1101-2020_12_31_424971	420	159	vi	vi	NNP
10_1101-2020_12_31_424971	420	160	)	)	-RRB-
10_1101-2020_12_31_424971	420	161	)	)	-RRB-
10_1101-2020_12_31_424971	420	162	.	.	.
10_1101-2020_12_31_424971	421	1	Each	each	DT
10_1101-2020_12_31_424971	421	2	974	974	CD
10_1101-2020_12_31_424971	421	3	element	element	NN
10_1101-2020_12_31_424971	421	4	of	of	IN
10_1101-2020_12_31_424971	421	5	this	this	DT
10_1101-2020_12_31_424971	421	6	matrix	matrix	NN
10_1101-2020_12_31_424971	421	7	parameterizes	parameterize	VBZ
10_1101-2020_12_31_424971	421	8	a	a	DT
10_1101-2020_12_31_424971	421	9	Dirichlet	Dirichlet	NNP
10_1101-2020_12_31_424971	421	10	distribution	distribution	NN
10_1101-2020_12_31_424971	421	11	,	,	,
10_1101-2020_12_31_424971	421	12	from	from	IN
10_1101-2020_12_31_424971	421	13	which	which	WDT
10_1101-2020_12_31_424971	421	14	we	-PRON-	PRP
10_1101-2020_12_31_424971	421	15	calculated	calculate	VBD
10_1101-2020_12_31_424971	421	16	the	the	DT
10_1101-2020_12_31_424971	421	17	mean	mean	NN
10_1101-2020_12_31_424971	421	18	975	975	CD
10_1101-2020_12_31_424971	421	19	and	and	CC
10_1101-2020_12_31_424971	421	20	the	the	DT
10_1101-2020_12_31_424971	421	21	square	square	JJ
10_1101-2020_12_31_424971	421	22	root	root	NN
10_1101-2020_12_31_424971	421	23	of	of	IN
10_1101-2020_12_31_424971	421	24	the	the	DT
10_1101-2020_12_31_424971	421	25	variance	variance	NN
10_1101-2020_12_31_424971	421	26	for	for	IN
10_1101-2020_12_31_424971	421	27	four	four	CD
10_1101-2020_12_31_424971	421	28	transition	transition	NN
10_1101-2020_12_31_424971	421	29	probabilities	probability	NNS
10_1101-2020_12_31_424971	421	30	pGS1→GS2	pgs1→gs2	CD
10_1101-2020_12_31_424971	421	31	,	,	,
10_1101-2020_12_31_424971	421	32	pGS2→GS1	pGS2→GS1	NNP
10_1101-2020_12_31_424971	421	33	,	,	,
10_1101-2020_12_31_424971	421	34	pGS1→Æ	pGS1→Æ	NNP
10_1101-2020_12_31_424971	421	35	,	,	,
10_1101-2020_12_31_424971	421	36	and	and	CC
10_1101-2020_12_31_424971	421	37	976	976	CD
10_1101-2020_12_31_424971	421	38	pGS2→Æ	pgs2→æ	NN
10_1101-2020_12_31_424971	421	39	(	(	-LRB-
10_1101-2020_12_31_424971	421	40	in	in	FW
10_1101-2020_12_31_424971	421	41	(	(	-LRB-
10_1101-2020_12_31_424971	421	42	i	i	NN
10_1101-2020_12_31_424971	421	43	)	)	-RRB-
10_1101-2020_12_31_424971	421	44	,	,	,
10_1101-2020_12_31_424971	421	45	(	(	-LRB-
10_1101-2020_12_31_424971	421	46	iv	iv	NN
10_1101-2020_12_31_424971	421	47	)	)	-RRB-
10_1101-2020_12_31_424971	421	48	,	,	,
10_1101-2020_12_31_424971	421	49	(	(	-LRB-
10_1101-2020_12_31_424971	421	50	v	v	NN
10_1101-2020_12_31_424971	421	51	)	)	-RRB-
10_1101-2020_12_31_424971	421	52	,	,	,
10_1101-2020_12_31_424971	421	53	and	and	CC
10_1101-2020_12_31_424971	421	54	(	(	-LRB-
10_1101-2020_12_31_424971	421	55	vi	vi	NNP
10_1101-2020_12_31_424971	421	56	)	)	-RRB-
10_1101-2020_12_31_424971	421	57	)	)	-RRB-
10_1101-2020_12_31_424971	421	58	or	or	CC
10_1101-2020_12_31_424971	421	59	for	for	IN
10_1101-2020_12_31_424971	421	60	three	three	CD
10_1101-2020_12_31_424971	421	61	transition	transition	NN
10_1101-2020_12_31_424971	421	62	probabilities	probability	NNS
10_1101-2020_12_31_424971	421	63	pGS2→POST	pGS2→POST	NNS
10_1101-2020_12_31_424971	421	64	,	,	,
10_1101-2020_12_31_424971	421	65	pGS2(G)→Æ	pGS2(G)→Æ	NNS
10_1101-2020_12_31_424971	421	66	,	,	,
10_1101-2020_12_31_424971	421	67	and	and	CC
10_1101-2020_12_31_424971	421	68	pPOST→977	pPOST→977	NNP
10_1101-2020_12_31_424971	421	69	Æ	Æ	NNP
10_1101-2020_12_31_424971	421	70	(	(	-LRB-
10_1101-2020_12_31_424971	421	71	in	in	IN
10_1101-2020_12_31_424971	421	72	(	(	-LRB-
10_1101-2020_12_31_424971	421	73	ii	ii	NNP
10_1101-2020_12_31_424971	421	74	)	)	-RRB-
10_1101-2020_12_31_424971	421	75	and	and	CC
10_1101-2020_12_31_424971	421	76	(	(	-LRB-
10_1101-2020_12_31_424971	421	77	vi	vi	NNP
10_1101-2020_12_31_424971	421	78	)	)	-RRB-
10_1101-2020_12_31_424971	421	79	)	)	-RRB-
10_1101-2020_12_31_424971	421	80	.	.	.
10_1101-2020_12_31_424971	422	1	These	these	DT
10_1101-2020_12_31_424971	422	2	transition	transition	NN
10_1101-2020_12_31_424971	422	3	probabilities	probability	NNS
10_1101-2020_12_31_424971	422	4	were	be	VBD
10_1101-2020_12_31_424971	422	5	then	then	RB
10_1101-2020_12_31_424971	422	6	used	use	VBN
10_1101-2020_12_31_424971	422	7	to	to	TO
10_1101-2020_12_31_424971	422	8	calculate	calculate	VB
10_1101-2020_12_31_424971	422	9	the	the	DT
10_1101-2020_12_31_424971	422	10	corresponding	correspond	VBG
10_1101-2020_12_31_424971	422	11	978	978	CD
10_1101-2020_12_31_424971	422	12	four	four	CD
10_1101-2020_12_31_424971	422	13	rate	rate	NN
10_1101-2020_12_31_424971	422	14	constants	constant	NNS
10_1101-2020_12_31_424971	422	15	,	,	,
10_1101-2020_12_31_424971	422	16	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	422	17	,	,	,
10_1101-2020_12_31_424971	422	18	kGS2→GS1	kGS2→GS1	NNP
10_1101-2020_12_31_424971	422	19	,	,	,
10_1101-2020_12_31_424971	422	20	kGS1→Æ	kGS1→Æ	NNP
10_1101-2020_12_31_424971	422	21	,	,	,
10_1101-2020_12_31_424971	422	22	and	and	CC
10_1101-2020_12_31_424971	422	23	kGS2→Æ	kGS2→Æ	NNP
10_1101-2020_12_31_424971	422	24	(	(	-LRB-
10_1101-2020_12_31_424971	422	25	in	in	IN
10_1101-2020_12_31_424971	422	26	(	(	-LRB-
10_1101-2020_12_31_424971	422	27	i	i	NN
10_1101-2020_12_31_424971	422	28	)	)	-RRB-
10_1101-2020_12_31_424971	422	29	,	,	,
10_1101-2020_12_31_424971	422	30	(	(	-LRB-
10_1101-2020_12_31_424971	422	31	iv	iv	NN
10_1101-2020_12_31_424971	422	32	)	)	-RRB-
10_1101-2020_12_31_424971	422	33	,	,	,
10_1101-2020_12_31_424971	422	34	(	(	-LRB-
10_1101-2020_12_31_424971	422	35	v	v	NN
10_1101-2020_12_31_424971	422	36	)	)	-RRB-
10_1101-2020_12_31_424971	422	37	,	,	,
10_1101-2020_12_31_424971	422	38	and	and	CC
10_1101-2020_12_31_424971	422	39	(	(	-LRB-
10_1101-2020_12_31_424971	422	40	vi	vi	NNP
10_1101-2020_12_31_424971	422	41	)	)	-RRB-
10_1101-2020_12_31_424971	422	42	)	)	-RRB-
10_1101-2020_12_31_424971	422	43	or	or	CC
10_1101-2020_12_31_424971	422	44	three	three	CD
10_1101-2020_12_31_424971	422	45	rate	rate	NN
10_1101-2020_12_31_424971	422	46	979	979	CD
10_1101-2020_12_31_424971	422	47	constants	constant	NNS
10_1101-2020_12_31_424971	422	48	,	,	,
10_1101-2020_12_31_424971	422	49	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	422	50	,	,	,
10_1101-2020_12_31_424971	422	51	kGS2(G)→Æ	kGS2(G)→Æ	NNP
10_1101-2020_12_31_424971	422	52	,	,	,
10_1101-2020_12_31_424971	422	53	and	and	CC
10_1101-2020_12_31_424971	422	54	kPOST→Æ	kPOST→Æ	NNP
10_1101-2020_12_31_424971	422	55	(	(	-LRB-
10_1101-2020_12_31_424971	422	56	in	in	IN
10_1101-2020_12_31_424971	422	57	(	(	-LRB-
10_1101-2020_12_31_424971	422	58	ii	ii	NNP
10_1101-2020_12_31_424971	422	59	)	)	-RRB-
10_1101-2020_12_31_424971	422	60	and	and	CC
10_1101-2020_12_31_424971	422	61	(	(	-LRB-
10_1101-2020_12_31_424971	422	62	vi	vi	NNP
10_1101-2020_12_31_424971	422	63	)	)	-RRB-
10_1101-2020_12_31_424971	422	64	)	)	-RRB-
10_1101-2020_12_31_424971	422	65	using	use	VBG
10_1101-2020_12_31_424971	422	66	the	the	DT
10_1101-2020_12_31_424971	422	67	equation	equation	NN
10_1101-2020_12_31_424971	422	68	980	980	CD
10_1101-2020_12_31_424971	422	69	.CC	.CC	,
10_1101-2020_12_31_424971	422	70	-	-	HYPH
10_1101-2020_12_31_424971	422	71	BY	by	IN
10_1101-2020_12_31_424971	422	72	-	-	HYPH
10_1101-2020_12_31_424971	422	73	NC	NC	NNP
10_1101-2020_12_31_424971	422	74	-	-	HYPH
10_1101-2020_12_31_424971	422	75	ND	ND	NNP
10_1101-2020_12_31_424971	422	76	4.0	4.0	CD
10_1101-2020_12_31_424971	422	77	International	International	NNP
10_1101-2020_12_31_424971	422	78	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	422	79	under	under	IN
10_1101-2020_12_31_424971	422	80	a	a	DT
10_1101-2020_12_31_424971	422	81	(	(	-LRB-
10_1101-2020_12_31_424971	422	82	which	which	WDT
10_1101-2020_12_31_424971	422	83	was	be	VBD
10_1101-2020_12_31_424971	422	84	not	not	RB
10_1101-2020_12_31_424971	422	85	certified	certify	VBN
10_1101-2020_12_31_424971	422	86	by	by	IN
10_1101-2020_12_31_424971	422	87	peer	peer	NN
10_1101-2020_12_31_424971	422	88	review	review	NN
10_1101-2020_12_31_424971	422	89	)	)	-RRB-
10_1101-2020_12_31_424971	422	90	is	be	VBZ
10_1101-2020_12_31_424971	422	91	the	the	DT
10_1101-2020_12_31_424971	422	92	author	author	NN
10_1101-2020_12_31_424971	422	93	/	/	SYM
10_1101-2020_12_31_424971	422	94	funder	funder	NN
10_1101-2020_12_31_424971	422	95	,	,	,
10_1101-2020_12_31_424971	422	96	who	who	WP
10_1101-2020_12_31_424971	422	97	has	have	VBZ
10_1101-2020_12_31_424971	422	98	granted	grant	VBN
10_1101-2020_12_31_424971	422	99	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	422	100	a	a	DT
10_1101-2020_12_31_424971	422	101	license	license	NN
10_1101-2020_12_31_424971	422	102	to	to	TO
10_1101-2020_12_31_424971	422	103	display	display	VB
10_1101-2020_12_31_424971	422	104	the	the	DT
10_1101-2020_12_31_424971	422	105	preprint	preprint	NN
10_1101-2020_12_31_424971	422	106	in	in	IN
10_1101-2020_12_31_424971	422	107	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	422	108	.	.	.
10_1101-2020_12_31_424971	423	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	423	2	is	be	VBZ
10_1101-2020_12_31_424971	423	3	made	make	VBN
10_1101-2020_12_31_424971	423	4	The	the	DT
10_1101-2020_12_31_424971	423	5	copyright	copyright	NN
10_1101-2020_12_31_424971	423	6	holder	holder	NN
10_1101-2020_12_31_424971	423	7	for	for	IN
10_1101-2020_12_31_424971	423	8	this	this	DT
10_1101-2020_12_31_424971	423	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	423	10	version	version	NN
10_1101-2020_12_31_424971	423	11	posted	post	VBD
10_1101-2020_12_31_424971	423	12	January	January	NNP
10_1101-2020_12_31_424971	423	13	2	2	CD
10_1101-2020_12_31_424971	423	14	,	,	,
10_1101-2020_12_31_424971	423	15	2021	2021	CD
10_1101-2020_12_31_424971	423	16	.	.	.
10_1101-2020_12_31_424971	423	17	;	;	:
10_1101-2020_12_31_424971	423	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	423	19	:	:	:
10_1101-2020_12_31_424971	423	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	423	21	preprint	preprint	NN
10_1101-2020_12_31_424971	423	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NNP
10_1101-2020_12_31_424971	423	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	423	24	40	40	CD
10_1101-2020_12_31_424971	423	25	𝑘	𝑘	NNS
10_1101-2020_12_31_424971	423	26	=	=	SYM
10_1101-2020_12_31_424971	423	27	−	−	NNP
10_1101-2020_12_31_424971	423	28	ln(1	ln(1	NN
10_1101-2020_12_31_424971	423	29	−	−	NNP
10_1101-2020_12_31_424971	423	30	𝑝	𝑝	NNP
10_1101-2020_12_31_424971	423	31	)	)	-RRB-
10_1101-2020_12_31_424971	423	32	𝑡	𝑡	NN
10_1101-2020_12_31_424971	423	33	,	,	,
10_1101-2020_12_31_424971	423	34	(	(	-LRB-
10_1101-2020_12_31_424971	423	35	3	3	CD
10_1101-2020_12_31_424971	423	36	)	)	-RRB-
10_1101-2020_12_31_424971	423	37	981	981	CD
10_1101-2020_12_31_424971	423	38	where	where	WRB
10_1101-2020_12_31_424971	423	39	t	t	NN
10_1101-2020_12_31_424971	423	40	is	be	VBZ
10_1101-2020_12_31_424971	423	41	the	the	DT
10_1101-2020_12_31_424971	423	42	time	time	NN
10_1101-2020_12_31_424971	423	43	interval	interval	NN
10_1101-2020_12_31_424971	423	44	between	between	IN
10_1101-2020_12_31_424971	423	45	data	datum	NNS
10_1101-2020_12_31_424971	423	46	points	point	NNS
10_1101-2020_12_31_424971	423	47	(	(	-LRB-
10_1101-2020_12_31_424971	423	48	t	t	NNP
10_1101-2020_12_31_424971	423	49	=	=	SYM
10_1101-2020_12_31_424971	423	50	0.1	0.1	CD
10_1101-2020_12_31_424971	423	51	s	s	NN
10_1101-2020_12_31_424971	423	52	)	)	-RRB-
10_1101-2020_12_31_424971	423	53	.	.	.
10_1101-2020_12_31_424971	424	1	We	-PRON-	PRP
10_1101-2020_12_31_424971	424	2	propagated	propagate	VBD
10_1101-2020_12_31_424971	424	3	the	the	DT
10_1101-2020_12_31_424971	424	4	error	error	NN
10_1101-2020_12_31_424971	424	5	for	for	IN
10_1101-2020_12_31_424971	424	6	the	the	DT
10_1101-2020_12_31_424971	424	7	982	982	CD
10_1101-2020_12_31_424971	424	8	transition	transition	NN
10_1101-2020_12_31_424971	424	9	probabilities	probability	NNS
10_1101-2020_12_31_424971	424	10	into	into	IN
10_1101-2020_12_31_424971	424	11	the	the	DT
10_1101-2020_12_31_424971	424	12	error	error	NN
10_1101-2020_12_31_424971	424	13	for	for	IN
10_1101-2020_12_31_424971	424	14	the	the	DT
10_1101-2020_12_31_424971	424	15	rate	rate	NN
10_1101-2020_12_31_424971	424	16	constants	constant	NNS
10_1101-2020_12_31_424971	424	17	using	use	VBG
10_1101-2020_12_31_424971	424	18	the	the	DT
10_1101-2020_12_31_424971	424	19	equation	equation	NN
10_1101-2020_12_31_424971	424	20	983	983	CD
10_1101-2020_12_31_424971	424	21	𝜎2	𝜎2	NN
10_1101-2020_12_31_424971	424	22	=	=	NFP
10_1101-2020_12_31_424971	424	23	𝜎3	𝜎3	NN
10_1101-2020_12_31_424971	424	24	(	(	-LRB-
10_1101-2020_12_31_424971	424	25	1	1	CD
10_1101-2020_12_31_424971	424	26	−	−	NNP
10_1101-2020_12_31_424971	424	27	𝑝	𝑝	NNP
10_1101-2020_12_31_424971	424	28	)	)	-RRB-
10_1101-2020_12_31_424971	424	29	×	×	NN
10_1101-2020_12_31_424971	424	30	𝑡	𝑡	XX
10_1101-2020_12_31_424971	424	31	,	,	,
10_1101-2020_12_31_424971	424	32	(	(	-LRB-
10_1101-2020_12_31_424971	424	33	4	4	CD
10_1101-2020_12_31_424971	424	34	)	)	-RRB-
10_1101-2020_12_31_424971	424	35	984	984	CD
10_1101-2020_12_31_424971	424	36	where	where	WRB
10_1101-2020_12_31_424971	424	37	𝜎3	𝜎3	NNP
10_1101-2020_12_31_424971	424	38	is	be	VBZ
10_1101-2020_12_31_424971	424	39	the	the	DT
10_1101-2020_12_31_424971	424	40	standard	standard	JJ
10_1101-2020_12_31_424971	424	41	deviation	deviation	NN
10_1101-2020_12_31_424971	424	42	of	of	IN
10_1101-2020_12_31_424971	424	43	the	the	DT
10_1101-2020_12_31_424971	424	44	variance	variance	NN
10_1101-2020_12_31_424971	424	45	of	of	IN
10_1101-2020_12_31_424971	424	46	p	p	NN
10_1101-2020_12_31_424971	424	47	and	and	CC
10_1101-2020_12_31_424971	424	48	𝜎2	𝜎2	NNP
10_1101-2020_12_31_424971	424	49	is	be	VBZ
10_1101-2020_12_31_424971	424	50	the	the	DT
10_1101-2020_12_31_424971	424	51	standard	standard	JJ
10_1101-2020_12_31_424971	424	52	deviation	deviation	NN
10_1101-2020_12_31_424971	424	53	of	of	IN
10_1101-2020_12_31_424971	424	54	the	the	DT
10_1101-2020_12_31_424971	424	55	985	985	CD
10_1101-2020_12_31_424971	424	56	variance	variance	NN
10_1101-2020_12_31_424971	424	57	of	of	IN
10_1101-2020_12_31_424971	424	58	k.	k.	NNP
10_1101-2020_12_31_424971	424	59	Keq	Keq	NNP
10_1101-2020_12_31_424971	424	60	in	in	IN
10_1101-2020_12_31_424971	424	61	(	(	-LRB-
10_1101-2020_12_31_424971	424	62	i	i	NN
10_1101-2020_12_31_424971	424	63	)	)	-RRB-
10_1101-2020_12_31_424971	424	64	,	,	,
10_1101-2020_12_31_424971	424	65	(	(	-LRB-
10_1101-2020_12_31_424971	424	66	iv	iv	LS
10_1101-2020_12_31_424971	424	67	)	)	-RRB-
10_1101-2020_12_31_424971	424	68	,	,	,
10_1101-2020_12_31_424971	424	69	and	and	CC
10_1101-2020_12_31_424971	424	70	(	(	-LRB-
10_1101-2020_12_31_424971	424	71	v	v	NN
10_1101-2020_12_31_424971	424	72	)	)	-RRB-
10_1101-2020_12_31_424971	424	73	was	be	VBD
10_1101-2020_12_31_424971	424	74	determined	determine	VBN
10_1101-2020_12_31_424971	424	75	using	use	VBG
10_1101-2020_12_31_424971	424	76	the	the	DT
10_1101-2020_12_31_424971	424	77	equation	equation	NN
10_1101-2020_12_31_424971	424	78	Keq	Keq	NNP
10_1101-2020_12_31_424971	424	79	=	=	SYM
10_1101-2020_12_31_424971	424	80	kGS1→GS2	kGS1→GS2	NNP
10_1101-2020_12_31_424971	424	81	/	/	SYM
10_1101-2020_12_31_424971	424	82	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	424	83	.	.	.
10_1101-2020_12_31_424971	425	1	986	986	CD
10_1101-2020_12_31_424971	425	2	The	the	DT
10_1101-2020_12_31_424971	425	3	fractional	fractional	JJ
10_1101-2020_12_31_424971	425	4	populations	population	NNS
10_1101-2020_12_31_424971	425	5	of	of	IN
10_1101-2020_12_31_424971	425	6	the	the	DT
10_1101-2020_12_31_424971	425	7	POST	POST	NNP
10_1101-2020_12_31_424971	425	8	complex	complex	NN
10_1101-2020_12_31_424971	425	9	in	in	IN
10_1101-2020_12_31_424971	425	10	(	(	-LRB-
10_1101-2020_12_31_424971	425	11	iii	iii	NN
10_1101-2020_12_31_424971	425	12	)	)	-RRB-
10_1101-2020_12_31_424971	425	13	and	and	CC
10_1101-2020_12_31_424971	425	14	the	the	DT
10_1101-2020_12_31_424971	425	15	corresponding	corresponding	JJ
10_1101-2020_12_31_424971	425	16	errors	error	NNS
10_1101-2020_12_31_424971	425	17	were	be	VBD
10_1101-2020_12_31_424971	425	18	987	987	CD
10_1101-2020_12_31_424971	425	19	calculated	calculate	VBN
10_1101-2020_12_31_424971	425	20	by	by	IN
10_1101-2020_12_31_424971	425	21	marginalizing	marginalize	VBG
10_1101-2020_12_31_424971	425	22	,	,	,
10_1101-2020_12_31_424971	425	23	which	which	WDT
10_1101-2020_12_31_424971	425	24	in	in	IN
10_1101-2020_12_31_424971	425	25	this	this	DT
10_1101-2020_12_31_424971	425	26	case	case	NN
10_1101-2020_12_31_424971	425	27	simply	simply	RB
10_1101-2020_12_31_424971	425	28	amounts	amount	VBZ
10_1101-2020_12_31_424971	425	29	to	to	IN
10_1101-2020_12_31_424971	425	30	calculating	calculate	VBG
10_1101-2020_12_31_424971	425	31	the	the	DT
10_1101-2020_12_31_424971	425	32	mean	mean	NN
10_1101-2020_12_31_424971	425	33	and	and	CC
10_1101-2020_12_31_424971	425	34	the	the	DT
10_1101-2020_12_31_424971	425	35	988	988	CD
10_1101-2020_12_31_424971	425	36	standard	standard	JJ
10_1101-2020_12_31_424971	425	37	error	error	NN
10_1101-2020_12_31_424971	425	38	of	of	IN
10_1101-2020_12_31_424971	425	39	the	the	DT
10_1101-2020_12_31_424971	425	40	mean	mean	NN
10_1101-2020_12_31_424971	425	41	,	,	,
10_1101-2020_12_31_424971	425	42	for	for	IN
10_1101-2020_12_31_424971	425	43	the	the	DT
10_1101-2020_12_31_424971	425	44	conditional	conditional	JJ
10_1101-2020_12_31_424971	425	45	probabilities	probability	NNS
10_1101-2020_12_31_424971	425	46	of	of	IN
10_1101-2020_12_31_424971	425	47	each	each	DT
10_1101-2020_12_31_424971	425	48	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	425	49	data	datum	NNS
10_1101-2020_12_31_424971	425	50	point	point	NN
10_1101-2020_12_31_424971	425	51	given	give	VBN
10_1101-2020_12_31_424971	425	52	each	each	DT
10_1101-2020_12_31_424971	425	53	989	989	CD
10_1101-2020_12_31_424971	425	54	hidden	hide	VBN
10_1101-2020_12_31_424971	425	55	state	state	NN
10_1101-2020_12_31_424971	425	56	.	.	.
10_1101-2020_12_31_424971	426	1	Because	because	IN
10_1101-2020_12_31_424971	426	2	the	the	DT
10_1101-2020_12_31_424971	426	3	data	data	NN
10_1101-2020_12_31_424971	426	4	points	point	NNS
10_1101-2020_12_31_424971	426	5	preceding	precede	VBG
10_1101-2020_12_31_424971	426	6	the	the	DT
10_1101-2020_12_31_424971	426	7	initial	initial	JJ
10_1101-2020_12_31_424971	426	8	70S	70S	NNP
10_1101-2020_12_31_424971	426	9	IC→GS2	ic→gs2	NN
10_1101-2020_12_31_424971	426	10	transition	transition	NN
10_1101-2020_12_31_424971	426	11	in	in	IN
10_1101-2020_12_31_424971	426	12	the	the	DT
10_1101-2020_12_31_424971	426	13	pre-990	pre-990	NNP
10_1101-2020_12_31_424971	426	14	steady	steady	JJ
10_1101-2020_12_31_424971	426	15	-	-	HYPH
10_1101-2020_12_31_424971	426	16	state	state	NN
10_1101-2020_12_31_424971	426	17	movies	movie	NNS
10_1101-2020_12_31_424971	426	18	do	do	VBP
10_1101-2020_12_31_424971	426	19	not	not	RB
10_1101-2020_12_31_424971	426	20	contribute	contribute	VB
10_1101-2020_12_31_424971	426	21	to	to	IN
10_1101-2020_12_31_424971	426	22	the	the	DT
10_1101-2020_12_31_424971	426	23	kinetic	kinetic	JJ
10_1101-2020_12_31_424971	426	24	and/or	and/or	CC
10_1101-2020_12_31_424971	426	25	thermodynamic	thermodynamic	JJ
10_1101-2020_12_31_424971	426	26	parameters	parameter	NNS
10_1101-2020_12_31_424971	426	27	in	in	IN
10_1101-2020_12_31_424971	426	28	(	(	-LRB-
10_1101-2020_12_31_424971	426	29	i)-(vi	i)-(vi	NNP
10_1101-2020_12_31_424971	426	30	)	)	-RRB-
10_1101-2020_12_31_424971	426	31	,	,	,
10_1101-2020_12_31_424971	426	32	991	991	CD
10_1101-2020_12_31_424971	426	33	these	these	DT
10_1101-2020_12_31_424971	426	34	data	datum	NNS
10_1101-2020_12_31_424971	426	35	points	point	NNS
10_1101-2020_12_31_424971	426	36	were	be	VBD
10_1101-2020_12_31_424971	426	37	not	not	RB
10_1101-2020_12_31_424971	426	38	included	include	VBN
10_1101-2020_12_31_424971	426	39	in	in	IN
10_1101-2020_12_31_424971	426	40	the	the	DT
10_1101-2020_12_31_424971	426	41	analyses	analysis	NNS
10_1101-2020_12_31_424971	426	42	that	that	WDT
10_1101-2020_12_31_424971	426	43	were	be	VBD
10_1101-2020_12_31_424971	426	44	used	use	VBN
10_1101-2020_12_31_424971	426	45	to	to	TO
10_1101-2020_12_31_424971	426	46	determine	determine	VB
10_1101-2020_12_31_424971	426	47	these	these	DT
10_1101-2020_12_31_424971	426	48	992	992	CD
10_1101-2020_12_31_424971	426	49	thermodynamic	thermodynamic	JJ
10_1101-2020_12_31_424971	426	50	parameters	parameter	NNS
10_1101-2020_12_31_424971	426	51	.	.	.
10_1101-2020_12_31_424971	427	1	993	993	CD
10_1101-2020_12_31_424971	427	2	994	994	CD
10_1101-2020_12_31_424971	427	3	QUANTIFICATION	QUANTIFICATION	NNS
10_1101-2020_12_31_424971	427	4	AND	and	CC
10_1101-2020_12_31_424971	427	5	STATISTICAL	statistical	NN
10_1101-2020_12_31_424971	427	6	ANALYSES	analyse	VBZ
10_1101-2020_12_31_424971	427	7	995	995	CD
10_1101-2020_12_31_424971	427	8	All	all	DT
10_1101-2020_12_31_424971	427	9	ensemble	ensemble	JJ
10_1101-2020_12_31_424971	427	10	biochemical	biochemical	JJ
10_1101-2020_12_31_424971	427	11	experiments	experiment	NNS
10_1101-2020_12_31_424971	427	12	and	and	CC
10_1101-2020_12_31_424971	427	13	cell	cell	NN
10_1101-2020_12_31_424971	427	14	-	-	HYPH
10_1101-2020_12_31_424971	427	15	based	base	VBN
10_1101-2020_12_31_424971	427	16	reporter	reporter	NN
10_1101-2020_12_31_424971	427	17	assays	assays	RB
10_1101-2020_12_31_424971	427	18	were	be	VBD
10_1101-2020_12_31_424971	427	19	repeated	repeat	VBN
10_1101-2020_12_31_424971	427	20	at	at	IN
10_1101-2020_12_31_424971	427	21	least	least	RBS
10_1101-2020_12_31_424971	427	22	996	996	CD
10_1101-2020_12_31_424971	427	23	three	three	CD
10_1101-2020_12_31_424971	427	24	times	time	NNS
10_1101-2020_12_31_424971	427	25	and	and	CC
10_1101-2020_12_31_424971	427	26	the	the	DT
10_1101-2020_12_31_424971	427	27	mean	mean	JJ
10_1101-2020_12_31_424971	427	28	values	value	NNS
10_1101-2020_12_31_424971	427	29	and	and	CC
10_1101-2020_12_31_424971	427	30	standard	standard	JJ
10_1101-2020_12_31_424971	427	31	deviations	deviation	NNS
10_1101-2020_12_31_424971	427	32	for	for	IN
10_1101-2020_12_31_424971	427	33	each	each	DT
10_1101-2020_12_31_424971	427	34	experiment	experiment	NN
10_1101-2020_12_31_424971	427	35	or	or	CC
10_1101-2020_12_31_424971	427	36	assay	assay	NNP
10_1101-2020_12_31_424971	427	37	are	be	VBP
10_1101-2020_12_31_424971	427	38	997	997	CD
10_1101-2020_12_31_424971	427	39	reported	report	VBN
10_1101-2020_12_31_424971	427	40	.	.	.
10_1101-2020_12_31_424971	428	1	Technical	technical	JJ
10_1101-2020_12_31_424971	428	2	replicates	replicate	NNS
10_1101-2020_12_31_424971	428	3	of	of	IN
10_1101-2020_12_31_424971	428	4	all	all	DT
10_1101-2020_12_31_424971	428	5	smFRET	smfret	NN
10_1101-2020_12_31_424971	428	6	experiments	experiment	NNS
10_1101-2020_12_31_424971	428	7	were	be	VBD
10_1101-2020_12_31_424971	428	8	repeated	repeat	VBN
10_1101-2020_12_31_424971	428	9	at	at	IN
10_1101-2020_12_31_424971	428	10	least	least	RBS
10_1101-2020_12_31_424971	428	11	three	three	CD
10_1101-2020_12_31_424971	428	12	times	time	NNS
10_1101-2020_12_31_424971	428	13	and	and	CC
10_1101-2020_12_31_424971	428	14	998	998	CD
10_1101-2020_12_31_424971	428	15	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	428	16	from	from	IN
10_1101-2020_12_31_424971	428	17	all	all	DT
10_1101-2020_12_31_424971	428	18	of	of	IN
10_1101-2020_12_31_424971	428	19	the	the	DT
10_1101-2020_12_31_424971	428	20	technical	technical	JJ
10_1101-2020_12_31_424971	428	21	replicates	replicate	NNS
10_1101-2020_12_31_424971	428	22	for	for	IN
10_1101-2020_12_31_424971	428	23	each	each	DT
10_1101-2020_12_31_424971	428	24	experiment	experiment	NN
10_1101-2020_12_31_424971	428	25	were	be	VBD
10_1101-2020_12_31_424971	428	26	combined	combine	VBN
10_1101-2020_12_31_424971	428	27	prior	prior	RB
10_1101-2020_12_31_424971	428	28	to	to	IN
10_1101-2020_12_31_424971	428	29	999	999	CD
10_1101-2020_12_31_424971	428	30	generating	generate	VBG
10_1101-2020_12_31_424971	428	31	the	the	DT
10_1101-2020_12_31_424971	428	32	surface	surface	NN
10_1101-2020_12_31_424971	428	33	contour	contour	NN
10_1101-2020_12_31_424971	428	34	plot	plot	NN
10_1101-2020_12_31_424971	428	35	of	of	IN
10_1101-2020_12_31_424971	428	36	the	the	DT
10_1101-2020_12_31_424971	428	37	time	time	NN
10_1101-2020_12_31_424971	428	38	evolution	evolution	NN
10_1101-2020_12_31_424971	428	39	of	of	IN
10_1101-2020_12_31_424971	428	40	population	population	NN
10_1101-2020_12_31_424971	428	41	FRET	FRET	NNS
10_1101-2020_12_31_424971	428	42	and	and	CC
10_1101-2020_12_31_424971	428	43	modeling	model	VBG
10_1101-2020_12_31_424971	428	44	with	with	IN
10_1101-2020_12_31_424971	428	45	1000	1000	CD
10_1101-2020_12_31_424971	428	46	the	the	DT
10_1101-2020_12_31_424971	428	47	HMM	HMM	NNP
10_1101-2020_12_31_424971	428	48	.	.	.
10_1101-2020_12_31_424971	429	1	Mean	mean	JJ
10_1101-2020_12_31_424971	429	2	values	value	NNS
10_1101-2020_12_31_424971	429	3	and	and	CC
10_1101-2020_12_31_424971	429	4	errors	error	NNS
10_1101-2020_12_31_424971	429	5	for	for	IN
10_1101-2020_12_31_424971	429	6	the	the	DT
10_1101-2020_12_31_424971	429	7	transition	transition	NN
10_1101-2020_12_31_424971	429	8	rates	rate	NNS
10_1101-2020_12_31_424971	429	9	and	and	CC
10_1101-2020_12_31_424971	429	10	fractional	fractional	JJ
10_1101-2020_12_31_424971	429	11	populations	population	NNS
10_1101-2020_12_31_424971	429	12	determined	determine	VBD
10_1101-2020_12_31_424971	429	13	1001	1001	CD
10_1101-2020_12_31_424971	429	14	from	from	IN
10_1101-2020_12_31_424971	429	15	modeling	model	VBG
10_1101-2020_12_31_424971	429	16	with	with	IN
10_1101-2020_12_31_424971	429	17	an	an	DT
10_1101-2020_12_31_424971	429	18	HMM	HMM	NNP
10_1101-2020_12_31_424971	429	19	are	be	VBP
10_1101-2020_12_31_424971	429	20	reported	report	VBN
10_1101-2020_12_31_424971	429	21	(	(	-LRB-
10_1101-2020_12_31_424971	429	22	for	for	IN
10_1101-2020_12_31_424971	429	23	details	detail	NNS
10_1101-2020_12_31_424971	429	24	see	see	VBP
10_1101-2020_12_31_424971	429	25	“	"	``
10_1101-2020_12_31_424971	429	26	Analysis	analysis	NN
10_1101-2020_12_31_424971	429	27	of	of	IN
10_1101-2020_12_31_424971	429	28	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	429	29	experiments	experiment	NNS
10_1101-2020_12_31_424971	429	30	”	"	''
10_1101-2020_12_31_424971	429	31	in	in	IN
10_1101-2020_12_31_424971	429	32	1002	1002	CD
10_1101-2020_12_31_424971	429	33	Methods	Methods	NNPS
10_1101-2020_12_31_424971	429	34	)	)	-RRB-
10_1101-2020_12_31_424971	429	35	.	.	.
10_1101-2020_12_31_424971	430	1	Mean	mean	JJ
10_1101-2020_12_31_424971	430	2	values	value	NNS
10_1101-2020_12_31_424971	430	3	and	and	CC
10_1101-2020_12_31_424971	430	4	standard	standard	JJ
10_1101-2020_12_31_424971	430	5	deviations	deviation	NNS
10_1101-2020_12_31_424971	430	6	for	for	IN
10_1101-2020_12_31_424971	430	7	the	the	DT
10_1101-2020_12_31_424971	430	8	k70S	k70s	XX
10_1101-2020_12_31_424971	430	9	IC→GS2s	IC→GS2s	NNP
10_1101-2020_12_31_424971	430	10	were	be	VBD
10_1101-2020_12_31_424971	430	11	determined	determine	VBN
10_1101-2020_12_31_424971	430	12	from	from	IN
10_1101-2020_12_31_424971	430	13	1003	1003	CD
10_1101-2020_12_31_424971	430	14	technical	technical	JJ
10_1101-2020_12_31_424971	430	15	triplicates	triplicate	NNS
10_1101-2020_12_31_424971	430	16	of	of	IN
10_1101-2020_12_31_424971	430	17	the	the	DT
10_1101-2020_12_31_424971	430	18	survival	survival	NN
10_1101-2020_12_31_424971	430	19	plots	plot	NNS
10_1101-2020_12_31_424971	430	20	analysis	analysis	NN
10_1101-2020_12_31_424971	430	21	for	for	IN
10_1101-2020_12_31_424971	430	22	each	each	DT
10_1101-2020_12_31_424971	430	23	experiment	experiment	NN
10_1101-2020_12_31_424971	430	24	and	and	CC
10_1101-2020_12_31_424971	430	25	are	be	VBP
10_1101-2020_12_31_424971	430	26	reported	report	VBN
10_1101-2020_12_31_424971	430	27	.	.	.
10_1101-2020_12_31_424971	431	1	1004	1004	CD
10_1101-2020_12_31_424971	431	2	1005	1005	CD
10_1101-2020_12_31_424971	431	3	.CC	.cc	SYM
10_1101-2020_12_31_424971	431	4	-	-	:
10_1101-2020_12_31_424971	431	5	BY	by	IN
10_1101-2020_12_31_424971	431	6	-	-	HYPH
10_1101-2020_12_31_424971	431	7	NC	NC	NNP
10_1101-2020_12_31_424971	431	8	-	-	HYPH
10_1101-2020_12_31_424971	431	9	ND	ND	NNP
10_1101-2020_12_31_424971	431	10	4.0	4.0	CD
10_1101-2020_12_31_424971	431	11	International	International	NNP
10_1101-2020_12_31_424971	431	12	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	431	13	under	under	IN
10_1101-2020_12_31_424971	431	14	a	a	DT
10_1101-2020_12_31_424971	431	15	(	(	-LRB-
10_1101-2020_12_31_424971	431	16	which	which	WDT
10_1101-2020_12_31_424971	431	17	was	be	VBD
10_1101-2020_12_31_424971	431	18	not	not	RB
10_1101-2020_12_31_424971	431	19	certified	certify	VBN
10_1101-2020_12_31_424971	431	20	by	by	IN
10_1101-2020_12_31_424971	431	21	peer	peer	NN
10_1101-2020_12_31_424971	431	22	review	review	NN
10_1101-2020_12_31_424971	431	23	)	)	-RRB-
10_1101-2020_12_31_424971	431	24	is	be	VBZ
10_1101-2020_12_31_424971	431	25	the	the	DT
10_1101-2020_12_31_424971	431	26	author	author	NN
10_1101-2020_12_31_424971	431	27	/	/	SYM
10_1101-2020_12_31_424971	431	28	funder	funder	NN
10_1101-2020_12_31_424971	431	29	,	,	,
10_1101-2020_12_31_424971	431	30	who	who	WP
10_1101-2020_12_31_424971	431	31	has	have	VBZ
10_1101-2020_12_31_424971	431	32	granted	grant	VBN
10_1101-2020_12_31_424971	431	33	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	431	34	a	a	DT
10_1101-2020_12_31_424971	431	35	license	license	NN
10_1101-2020_12_31_424971	431	36	to	to	TO
10_1101-2020_12_31_424971	431	37	display	display	VB
10_1101-2020_12_31_424971	431	38	the	the	DT
10_1101-2020_12_31_424971	431	39	preprint	preprint	NN
10_1101-2020_12_31_424971	431	40	in	in	IN
10_1101-2020_12_31_424971	431	41	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	431	42	.	.	.
10_1101-2020_12_31_424971	432	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	432	2	is	be	VBZ
10_1101-2020_12_31_424971	432	3	made	make	VBN
10_1101-2020_12_31_424971	432	4	The	the	DT
10_1101-2020_12_31_424971	432	5	copyright	copyright	NN
10_1101-2020_12_31_424971	432	6	holder	holder	NN
10_1101-2020_12_31_424971	432	7	for	for	IN
10_1101-2020_12_31_424971	432	8	this	this	DT
10_1101-2020_12_31_424971	432	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	432	10	version	version	NN
10_1101-2020_12_31_424971	432	11	posted	post	VBD
10_1101-2020_12_31_424971	432	12	January	January	NNP
10_1101-2020_12_31_424971	432	13	2	2	CD
10_1101-2020_12_31_424971	432	14	,	,	,
10_1101-2020_12_31_424971	432	15	2021	2021	CD
10_1101-2020_12_31_424971	432	16	.	.	.
10_1101-2020_12_31_424971	432	17	;	;	:
10_1101-2020_12_31_424971	432	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	432	19	:	:	:
10_1101-2020_12_31_424971	432	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	432	21	preprint	preprint	NN
10_1101-2020_12_31_424971	432	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	432	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	432	24	41	41	CD
10_1101-2020_12_31_424971	432	25	DATA	datum	NNS
10_1101-2020_12_31_424971	432	26	AND	and	CC
10_1101-2020_12_31_424971	432	27	CODE	code	NN
10_1101-2020_12_31_424971	432	28	AVAILABILITY	AVAILABILITY	NNS
10_1101-2020_12_31_424971	432	29	1006	1006	CD
10_1101-2020_12_31_424971	432	30	1007	1007	CD
10_1101-2020_12_31_424971	432	31	Data	Data	NNP
10_1101-2020_12_31_424971	432	32	Availability	Availability	NNP
10_1101-2020_12_31_424971	432	33	1008	1008	CD
10_1101-2020_12_31_424971	432	34	With	with	IN
10_1101-2020_12_31_424971	432	35	the	the	DT
10_1101-2020_12_31_424971	432	36	exception	exception	NN
10_1101-2020_12_31_424971	432	37	of	of	IN
10_1101-2020_12_31_424971	432	38	the	the	DT
10_1101-2020_12_31_424971	432	39	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	432	40	data	datum	NNS
10_1101-2020_12_31_424971	432	41	,	,	,
10_1101-2020_12_31_424971	432	42	all	all	DT
10_1101-2020_12_31_424971	432	43	other	other	JJ
10_1101-2020_12_31_424971	432	44	data	datum	NNS
10_1101-2020_12_31_424971	432	45	supporting	support	VBG
10_1101-2020_12_31_424971	432	46	the	the	DT
10_1101-2020_12_31_424971	432	47	findings	finding	NNS
10_1101-2020_12_31_424971	432	48	of	of	IN
10_1101-2020_12_31_424971	432	49	this	this	DT
10_1101-2020_12_31_424971	432	50	study	study	NN
10_1101-2020_12_31_424971	432	51	are	be	VBP
10_1101-2020_12_31_424971	432	52	1009	1009	CD
10_1101-2020_12_31_424971	432	53	presented	present	VBN
10_1101-2020_12_31_424971	432	54	within	within	IN
10_1101-2020_12_31_424971	432	55	this	this	DT
10_1101-2020_12_31_424971	432	56	article	article	NN
10_1101-2020_12_31_424971	432	57	.	.	.
10_1101-2020_12_31_424971	433	1	Due	due	IN
10_1101-2020_12_31_424971	433	2	to	to	IN
10_1101-2020_12_31_424971	433	3	the	the	DT
10_1101-2020_12_31_424971	433	4	lack	lack	NN
10_1101-2020_12_31_424971	433	5	of	of	IN
10_1101-2020_12_31_424971	433	6	a	a	DT
10_1101-2020_12_31_424971	433	7	public	public	JJ
10_1101-2020_12_31_424971	433	8	repository	repository	NN
10_1101-2020_12_31_424971	433	9	for	for	IN
10_1101-2020_12_31_424971	433	10	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	433	11	data	datum	NNS
10_1101-2020_12_31_424971	433	12	,	,	,
10_1101-2020_12_31_424971	433	13	the	the	DT
10_1101-2020_12_31_424971	433	14	smFRET	smfret	$
10_1101-2020_12_31_424971	433	15	1010	1010	CD
10_1101-2020_12_31_424971	433	16	data	datum	NNS
10_1101-2020_12_31_424971	433	17	supporting	support	VBG
10_1101-2020_12_31_424971	433	18	the	the	DT
10_1101-2020_12_31_424971	433	19	findings	finding	NNS
10_1101-2020_12_31_424971	433	20	of	of	IN
10_1101-2020_12_31_424971	433	21	this	this	DT
10_1101-2020_12_31_424971	433	22	study	study	NN
10_1101-2020_12_31_424971	433	23	are	be	VBP
10_1101-2020_12_31_424971	433	24	available	available	JJ
10_1101-2020_12_31_424971	433	25	from	from	IN
10_1101-2020_12_31_424971	433	26	the	the	DT
10_1101-2020_12_31_424971	433	27	corresponding	correspond	VBG
10_1101-2020_12_31_424971	433	28	authors	author	NNS
10_1101-2020_12_31_424971	433	29	upon	upon	IN
10_1101-2020_12_31_424971	433	30	1011	1011	CD
10_1101-2020_12_31_424971	433	31	request	request	NN
10_1101-2020_12_31_424971	433	32	.	.	.
10_1101-2020_12_31_424971	434	1	Source	source	NN
10_1101-2020_12_31_424971	434	2	data	datum	NNS
10_1101-2020_12_31_424971	434	3	are	be	VBP
10_1101-2020_12_31_424971	434	4	provided	provide	VBN
10_1101-2020_12_31_424971	434	5	with	with	IN
10_1101-2020_12_31_424971	434	6	this	this	DT
10_1101-2020_12_31_424971	434	7	paper	paper	NN
10_1101-2020_12_31_424971	434	8	.	.	.
10_1101-2020_12_31_424971	435	1	1012	1012	CD
10_1101-2020_12_31_424971	435	2	Code	Code	NNP
10_1101-2020_12_31_424971	435	3	Availability	Availability	NNP
10_1101-2020_12_31_424971	435	4	1013	1013	CD
10_1101-2020_12_31_424971	435	5	The	the	DT
10_1101-2020_12_31_424971	435	6	code	code	NN
10_1101-2020_12_31_424971	435	7	used	use	VBD
10_1101-2020_12_31_424971	435	8	to	to	TO
10_1101-2020_12_31_424971	435	9	analyze	analyze	VB
10_1101-2020_12_31_424971	435	10	the	the	DT
10_1101-2020_12_31_424971	435	11	TIRF	tirf	NN
10_1101-2020_12_31_424971	435	12	movies	movie	NNS
10_1101-2020_12_31_424971	435	13	in	in	IN
10_1101-2020_12_31_424971	435	14	this	this	DT
10_1101-2020_12_31_424971	435	15	study	study	NN
10_1101-2020_12_31_424971	435	16	is	be	VBZ
10_1101-2020_12_31_424971	435	17	described	describe	VBN
10_1101-2020_12_31_424971	435	18	in	in	IN
10_1101-2020_12_31_424971	435	19	a	a	DT
10_1101-2020_12_31_424971	435	20	manuscript	manuscript	NN
10_1101-2020_12_31_424971	435	21	in	in	IN
10_1101-2020_12_31_424971	435	22	preparation	preparation	NN
10_1101-2020_12_31_424971	435	23	1014	1014	CD
10_1101-2020_12_31_424971	435	24	(	(	-LRB-
10_1101-2020_12_31_424971	435	25	Jason	Jason	NNP
10_1101-2020_12_31_424971	435	26	Hon	Hon	NNP
10_1101-2020_12_31_424971	435	27	,	,	,
10_1101-2020_12_31_424971	435	28	Colin	Colin	NNP
10_1101-2020_12_31_424971	435	29	Kinz	Kinz	NNP
10_1101-2020_12_31_424971	435	30	-	-	HYPH
10_1101-2020_12_31_424971	435	31	Thompson	Thompson	NNP
10_1101-2020_12_31_424971	435	32	,	,	,
10_1101-2020_12_31_424971	435	33	Ruben	Ruben	NNP
10_1101-2020_12_31_424971	435	34	L.	L.	NNP
10_1101-2020_12_31_424971	435	35	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	435	36	)	)	-RRB-
10_1101-2020_12_31_424971	435	37	,	,	,
10_1101-2020_12_31_424971	435	38	where	where	WRB
10_1101-2020_12_31_424971	435	39	R.L.G.	R.L.G.	NNP
10_1101-2020_12_31_424971	436	1	is	be	VBZ
10_1101-2020_12_31_424971	436	2	the	the	DT
10_1101-2020_12_31_424971	436	3	corresponding	corresponding	JJ
10_1101-2020_12_31_424971	436	4	1015	1015	CD
10_1101-2020_12_31_424971	436	5	author	author	NN
10_1101-2020_12_31_424971	436	6	.	.	.
10_1101-2020_12_31_424971	437	1	Therefore	therefore	RB
10_1101-2020_12_31_424971	437	2	,	,	,
10_1101-2020_12_31_424971	437	3	the	the	DT
10_1101-2020_12_31_424971	437	4	code	code	NN
10_1101-2020_12_31_424971	437	5	is	be	VBZ
10_1101-2020_12_31_424971	437	6	available	available	JJ
10_1101-2020_12_31_424971	437	7	from	from	IN
10_1101-2020_12_31_424971	437	8	R.L.G	R.L.G	NNP
10_1101-2020_12_31_424971	437	9	,	,	,
10_1101-2020_12_31_424971	437	10	upon	upon	IN
10_1101-2020_12_31_424971	437	11	request	request	NN
10_1101-2020_12_31_424971	437	12	.	.	.
10_1101-2020_12_31_424971	438	1	1016	1016	CD
10_1101-2020_12_31_424971	438	2	1017	1017	CD
10_1101-2020_12_31_424971	438	3	1018	1018	CD
10_1101-2020_12_31_424971	438	4	1019	1019	CD
10_1101-2020_12_31_424971	438	5	.CC	.cc	SYM
10_1101-2020_12_31_424971	438	6	-	-	HYPH
10_1101-2020_12_31_424971	438	7	BY	by	IN
10_1101-2020_12_31_424971	438	8	-	-	HYPH
10_1101-2020_12_31_424971	438	9	NC	NC	NNP
10_1101-2020_12_31_424971	438	10	-	-	HYPH
10_1101-2020_12_31_424971	438	11	ND	ND	NNP
10_1101-2020_12_31_424971	438	12	4.0	4.0	CD
10_1101-2020_12_31_424971	438	13	International	International	NNP
10_1101-2020_12_31_424971	438	14	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	438	15	under	under	IN
10_1101-2020_12_31_424971	438	16	a	a	DT
10_1101-2020_12_31_424971	438	17	(	(	-LRB-
10_1101-2020_12_31_424971	438	18	which	which	WDT
10_1101-2020_12_31_424971	438	19	was	be	VBD
10_1101-2020_12_31_424971	438	20	not	not	RB
10_1101-2020_12_31_424971	438	21	certified	certify	VBN
10_1101-2020_12_31_424971	438	22	by	by	IN
10_1101-2020_12_31_424971	438	23	peer	peer	NN
10_1101-2020_12_31_424971	438	24	review	review	NN
10_1101-2020_12_31_424971	438	25	)	)	-RRB-
10_1101-2020_12_31_424971	438	26	is	be	VBZ
10_1101-2020_12_31_424971	438	27	the	the	DT
10_1101-2020_12_31_424971	438	28	author	author	NN
10_1101-2020_12_31_424971	438	29	/	/	SYM
10_1101-2020_12_31_424971	438	30	funder	funder	NN
10_1101-2020_12_31_424971	438	31	,	,	,
10_1101-2020_12_31_424971	438	32	who	who	WP
10_1101-2020_12_31_424971	438	33	has	have	VBZ
10_1101-2020_12_31_424971	438	34	granted	grant	VBN
10_1101-2020_12_31_424971	438	35	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	438	36	a	a	DT
10_1101-2020_12_31_424971	438	37	license	license	NN
10_1101-2020_12_31_424971	438	38	to	to	TO
10_1101-2020_12_31_424971	438	39	display	display	VB
10_1101-2020_12_31_424971	438	40	the	the	DT
10_1101-2020_12_31_424971	438	41	preprint	preprint	NN
10_1101-2020_12_31_424971	438	42	in	in	IN
10_1101-2020_12_31_424971	438	43	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	438	44	.	.	.
10_1101-2020_12_31_424971	439	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	439	2	is	be	VBZ
10_1101-2020_12_31_424971	439	3	made	make	VBN
10_1101-2020_12_31_424971	439	4	The	the	DT
10_1101-2020_12_31_424971	439	5	copyright	copyright	NN
10_1101-2020_12_31_424971	439	6	holder	holder	NN
10_1101-2020_12_31_424971	439	7	for	for	IN
10_1101-2020_12_31_424971	439	8	this	this	DT
10_1101-2020_12_31_424971	439	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	439	10	version	version	NN
10_1101-2020_12_31_424971	439	11	posted	post	VBD
10_1101-2020_12_31_424971	439	12	January	January	NNP
10_1101-2020_12_31_424971	439	13	2	2	CD
10_1101-2020_12_31_424971	439	14	,	,	,
10_1101-2020_12_31_424971	439	15	2021	2021	CD
10_1101-2020_12_31_424971	439	16	.	.	.
10_1101-2020_12_31_424971	439	17	;	;	:
10_1101-2020_12_31_424971	439	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	439	19	:	:	:
10_1101-2020_12_31_424971	439	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	439	21	preprint	preprint	NN
10_1101-2020_12_31_424971	439	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	439	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	439	24	42	42	CD
10_1101-2020_12_31_424971	439	25	REFERENCES	reference	NNS
10_1101-2020_12_31_424971	439	26	1020	1020	CD
10_1101-2020_12_31_424971	439	27	1	1	CD
10_1101-2020_12_31_424971	439	28	.	.	.
10_1101-2020_12_31_424971	440	1	Wang	Wang	NNP
10_1101-2020_12_31_424971	440	2	,	,	,
10_1101-2020_12_31_424971	440	3	K.	K.	NNP
10_1101-2020_12_31_424971	440	4	,	,	,
10_1101-2020_12_31_424971	440	5	Schmied	Schmied	NNP
10_1101-2020_12_31_424971	440	6	,	,	,
10_1101-2020_12_31_424971	440	7	W.H.	W.H.	NNP
10_1101-2020_12_31_424971	441	1	&	&	CC
10_1101-2020_12_31_424971	441	2	Chin	Chin	NNP
10_1101-2020_12_31_424971	441	3	,	,	,
10_1101-2020_12_31_424971	441	4	J.W.	J.W.	NNP
10_1101-2020_12_31_424971	442	1	Reprogramming	reprogramme	VBG
10_1101-2020_12_31_424971	442	2	the	the	DT
10_1101-2020_12_31_424971	442	3	genetic	genetic	JJ
10_1101-2020_12_31_424971	442	4	code	code	NN
10_1101-2020_12_31_424971	442	5	:	:	:
10_1101-2020_12_31_424971	442	6	from	from	IN
10_1101-2020_12_31_424971	442	7	triplet	triplet	NN
10_1101-2020_12_31_424971	442	8	to	to	IN
10_1101-2020_12_31_424971	442	9	1021	1021	CD
10_1101-2020_12_31_424971	442	10	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	442	11	codes	code	NNS
10_1101-2020_12_31_424971	442	12	.	.	.
10_1101-2020_12_31_424971	443	1	Angew	angew	VB
10_1101-2020_12_31_424971	443	2	Chem	Chem	NNP
10_1101-2020_12_31_424971	443	3	Int	Int	NNP
10_1101-2020_12_31_424971	443	4	Ed	Ed	NNP
10_1101-2020_12_31_424971	443	5	Engl	Engl	NNP
10_1101-2020_12_31_424971	443	6	51	51	CD
10_1101-2020_12_31_424971	443	7	,	,	,
10_1101-2020_12_31_424971	443	8	2288	2288	CD
10_1101-2020_12_31_424971	443	9	-	-	SYM
10_1101-2020_12_31_424971	443	10	97	97	CD
10_1101-2020_12_31_424971	443	11	(	(	-LRB-
10_1101-2020_12_31_424971	443	12	2012	2012	CD
10_1101-2020_12_31_424971	443	13	)	)	-RRB-
10_1101-2020_12_31_424971	443	14	.	.	.
10_1101-2020_12_31_424971	444	1	1022	1022	CD
10_1101-2020_12_31_424971	444	2	2	2	CD
10_1101-2020_12_31_424971	444	3	.	.	.
10_1101-2020_12_31_424971	445	1	Chen	Chen	NNP
10_1101-2020_12_31_424971	445	2	,	,	,
10_1101-2020_12_31_424971	445	3	Y.	Y.	NNP
10_1101-2020_12_31_424971	445	4	et	et	NNP
10_1101-2020_12_31_424971	445	5	al	al	NNP
10_1101-2020_12_31_424971	445	6	.	.	.
10_1101-2020_12_31_424971	446	1	Controlling	control	VBG
10_1101-2020_12_31_424971	446	2	the	the	DT
10_1101-2020_12_31_424971	446	3	Replication	Replication	NNP
10_1101-2020_12_31_424971	446	4	of	of	IN
10_1101-2020_12_31_424971	446	5	a	a	DT
10_1101-2020_12_31_424971	446	6	Genomically	genomically	RB
10_1101-2020_12_31_424971	446	7	Recoded	recode	VBN
10_1101-2020_12_31_424971	446	8	HIV-1	HIV-1	NNP
10_1101-2020_12_31_424971	446	9	with	with	IN
10_1101-2020_12_31_424971	446	10	a	a	DT
10_1101-2020_12_31_424971	446	11	1023	1023	CD
10_1101-2020_12_31_424971	446	12	Functional	Functional	NNP
10_1101-2020_12_31_424971	446	13	Quadruplet	Quadruplet	NNP
10_1101-2020_12_31_424971	446	14	Codon	Codon	NNP
10_1101-2020_12_31_424971	446	15	in	in	IN
10_1101-2020_12_31_424971	446	16	Mammalian	Mammalian	NNP
10_1101-2020_12_31_424971	446	17	Cells	Cells	NNPS
10_1101-2020_12_31_424971	446	18	.	.	.
10_1101-2020_12_31_424971	447	1	ACS	ACS	NNP
10_1101-2020_12_31_424971	447	2	Synth	Synth	NNP
10_1101-2020_12_31_424971	447	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	447	4	7	7	CD
10_1101-2020_12_31_424971	447	5	,	,	,
10_1101-2020_12_31_424971	447	6	1612	1612	CD
10_1101-2020_12_31_424971	447	7	-	-	SYM
10_1101-2020_12_31_424971	447	8	1617	1617	CD
10_1101-2020_12_31_424971	447	9	(	(	-LRB-
10_1101-2020_12_31_424971	447	10	2018	2018	CD
10_1101-2020_12_31_424971	447	11	)	)	-RRB-
10_1101-2020_12_31_424971	447	12	.	.	.
10_1101-2020_12_31_424971	448	1	1024	1024	CD
10_1101-2020_12_31_424971	448	2	3	3	CD
10_1101-2020_12_31_424971	448	3	.	.	.
10_1101-2020_12_31_424971	449	1	Lee	Lee	NNP
10_1101-2020_12_31_424971	449	2	,	,	,
10_1101-2020_12_31_424971	449	3	B.S.	B.S.	NNP
10_1101-2020_12_31_424971	449	4	,	,	,
10_1101-2020_12_31_424971	449	5	Kim	Kim	NNP
10_1101-2020_12_31_424971	449	6	,	,	,
10_1101-2020_12_31_424971	449	7	S.	S.	NNP
10_1101-2020_12_31_424971	449	8	,	,	,
10_1101-2020_12_31_424971	449	9	Ko	Ko	NNP
10_1101-2020_12_31_424971	449	10	,	,	,
10_1101-2020_12_31_424971	449	11	B.J.	B.J.	NNP
10_1101-2020_12_31_424971	450	1	&	&	CC
10_1101-2020_12_31_424971	450	2	Yoo	Yoo	NNP
10_1101-2020_12_31_424971	450	3	,	,	,
10_1101-2020_12_31_424971	450	4	T.H.	T.H.	NNP
10_1101-2020_12_31_424971	451	1	An	an	DT
10_1101-2020_12_31_424971	451	2	efficient	efficient	JJ
10_1101-2020_12_31_424971	451	3	system	system	NN
10_1101-2020_12_31_424971	451	4	for	for	IN
10_1101-2020_12_31_424971	451	5	incorporation	incorporation	NN
10_1101-2020_12_31_424971	451	6	of	of	IN
10_1101-2020_12_31_424971	451	7	unnatural	unnatural	JJ
10_1101-2020_12_31_424971	451	8	1025	1025	CD
10_1101-2020_12_31_424971	451	9	amino	amino	JJ
10_1101-2020_12_31_424971	451	10	acids	acid	NNS
10_1101-2020_12_31_424971	451	11	in	in	IN
10_1101-2020_12_31_424971	451	12	response	response	NN
10_1101-2020_12_31_424971	451	13	to	to	IN
10_1101-2020_12_31_424971	451	14	the	the	DT
10_1101-2020_12_31_424971	451	15	four	four	CD
10_1101-2020_12_31_424971	451	16	-	-	HYPH
10_1101-2020_12_31_424971	451	17	base	base	NN
10_1101-2020_12_31_424971	451	18	codon	codon	NN
10_1101-2020_12_31_424971	451	19	AGGA	AGGA	NNP
10_1101-2020_12_31_424971	451	20	in	in	IN
10_1101-2020_12_31_424971	451	21	Escherichia	Escherichia	NNP
10_1101-2020_12_31_424971	451	22	coli	coli	NNS
10_1101-2020_12_31_424971	451	23	.	.	.
10_1101-2020_12_31_424971	452	1	Biochim	Biochim	NNP
10_1101-2020_12_31_424971	452	2	1026	1026	CD
10_1101-2020_12_31_424971	452	3	Biophys	Biophys	NNP
10_1101-2020_12_31_424971	452	4	Acta	Acta	NNP
10_1101-2020_12_31_424971	452	5	1861	1861	CD
10_1101-2020_12_31_424971	452	6	,	,	,
10_1101-2020_12_31_424971	452	7	3016	3016	CD
10_1101-2020_12_31_424971	452	8	-	-	SYM
10_1101-2020_12_31_424971	452	9	3023	3023	CD
10_1101-2020_12_31_424971	452	10	(	(	-LRB-
10_1101-2020_12_31_424971	452	11	2017	2017	CD
10_1101-2020_12_31_424971	452	12	)	)	-RRB-
10_1101-2020_12_31_424971	452	13	.	.	.
10_1101-2020_12_31_424971	453	1	1027	1027	CD
10_1101-2020_12_31_424971	453	2	4	4	CD
10_1101-2020_12_31_424971	453	3	.	.	.
10_1101-2020_12_31_424971	454	1	Chatterjee	Chatterjee	NNP
10_1101-2020_12_31_424971	454	2	,	,	,
10_1101-2020_12_31_424971	454	3	A.	A.	NNP
10_1101-2020_12_31_424971	454	4	,	,	,
10_1101-2020_12_31_424971	454	5	Lajoie	Lajoie	NNP
10_1101-2020_12_31_424971	454	6	,	,	,
10_1101-2020_12_31_424971	454	7	M.J.	M.J.	NNP
10_1101-2020_12_31_424971	454	8	,	,	,
10_1101-2020_12_31_424971	454	9	Xiao	Xiao	NNP
10_1101-2020_12_31_424971	454	10	,	,	,
10_1101-2020_12_31_424971	454	11	H.	H.	NNP
10_1101-2020_12_31_424971	454	12	,	,	,
10_1101-2020_12_31_424971	454	13	Church	Church	NNP
10_1101-2020_12_31_424971	454	14	,	,	,
10_1101-2020_12_31_424971	454	15	G.M.	G.M.	NNP
10_1101-2020_12_31_424971	455	1	&	&	CC
10_1101-2020_12_31_424971	455	2	Schultz	Schultz	NNP
10_1101-2020_12_31_424971	455	3	,	,	,
10_1101-2020_12_31_424971	455	4	P.G.	P.G.	NNP
10_1101-2020_12_31_424971	456	1	A	a	DT
10_1101-2020_12_31_424971	456	2	bacterial	bacterial	JJ
10_1101-2020_12_31_424971	456	3	strain	strain	NN
10_1101-2020_12_31_424971	456	4	with	with	IN
10_1101-2020_12_31_424971	456	5	1028	1028	CD
10_1101-2020_12_31_424971	456	6	a	a	DT
10_1101-2020_12_31_424971	456	7	unique	unique	JJ
10_1101-2020_12_31_424971	456	8	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	456	9	codon	codon	NN
10_1101-2020_12_31_424971	456	10	specifying	specify	VBG
10_1101-2020_12_31_424971	456	11	non	non	JJ
10_1101-2020_12_31_424971	456	12	-	-	JJ
10_1101-2020_12_31_424971	456	13	native	native	JJ
10_1101-2020_12_31_424971	456	14	amino	amino	NN
10_1101-2020_12_31_424971	456	15	acids	acid	NNS
10_1101-2020_12_31_424971	456	16	.	.	.
10_1101-2020_12_31_424971	457	1	Chembiochem	Chembiochem	NNP
10_1101-2020_12_31_424971	457	2	15	15	CD
10_1101-2020_12_31_424971	457	3	,	,	,
10_1101-2020_12_31_424971	457	4	1782	1782	CD
10_1101-2020_12_31_424971	457	5	-	-	SYM
10_1101-2020_12_31_424971	457	6	6	6	CD
10_1101-2020_12_31_424971	457	7	1029	1029	CD
10_1101-2020_12_31_424971	457	8	(	(	-LRB-
10_1101-2020_12_31_424971	457	9	2014	2014	CD
10_1101-2020_12_31_424971	457	10	)	)	-RRB-
10_1101-2020_12_31_424971	457	11	.	.	.
10_1101-2020_12_31_424971	458	1	1030	1030	CD
10_1101-2020_12_31_424971	458	2	5	5	CD
10_1101-2020_12_31_424971	458	3	.	.	.
10_1101-2020_12_31_424971	459	1	Niu	niu	UH
10_1101-2020_12_31_424971	459	2	,	,	,
10_1101-2020_12_31_424971	459	3	W.	W.	NNP
10_1101-2020_12_31_424971	459	4	,	,	,
10_1101-2020_12_31_424971	459	5	Schultz	Schultz	NNP
10_1101-2020_12_31_424971	459	6	,	,	,
10_1101-2020_12_31_424971	459	7	P.G.	P.G.	NNP
10_1101-2020_12_31_424971	460	1	&	&	CC
10_1101-2020_12_31_424971	460	2	Guo	Guo	NNP
10_1101-2020_12_31_424971	460	3	,	,	,
10_1101-2020_12_31_424971	460	4	J.	J.	NNP
10_1101-2020_12_31_424971	461	1	An	an	DT
10_1101-2020_12_31_424971	461	2	expanded	expand	VBN
10_1101-2020_12_31_424971	461	3	genetic	genetic	JJ
10_1101-2020_12_31_424971	461	4	code	code	NN
10_1101-2020_12_31_424971	461	5	in	in	IN
10_1101-2020_12_31_424971	461	6	mammalian	mammalian	JJ
10_1101-2020_12_31_424971	461	7	cells	cell	NNS
10_1101-2020_12_31_424971	461	8	with	with	IN
10_1101-2020_12_31_424971	461	9	a	a	DT
10_1101-2020_12_31_424971	461	10	1031	1031	CD
10_1101-2020_12_31_424971	461	11	functional	functional	JJ
10_1101-2020_12_31_424971	461	12	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	461	13	codon	codon	NNP
10_1101-2020_12_31_424971	461	14	.	.	.
10_1101-2020_12_31_424971	462	1	ACS	ACS	NNP
10_1101-2020_12_31_424971	462	2	Chem	Chem	NNP
10_1101-2020_12_31_424971	462	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	462	4	8	8	CD
10_1101-2020_12_31_424971	462	5	,	,	,
10_1101-2020_12_31_424971	462	6	1640	1640	CD
10_1101-2020_12_31_424971	462	7	-	-	SYM
10_1101-2020_12_31_424971	462	8	5	5	CD
10_1101-2020_12_31_424971	462	9	(	(	-LRB-
10_1101-2020_12_31_424971	462	10	2013	2013	CD
10_1101-2020_12_31_424971	462	11	)	)	-RRB-
10_1101-2020_12_31_424971	462	12	.	.	.
10_1101-2020_12_31_424971	463	1	1032	1032	CD
10_1101-2020_12_31_424971	463	2	6	6	CD
10_1101-2020_12_31_424971	463	3	.	.	.
10_1101-2020_12_31_424971	464	1	Wang	Wang	NNP
10_1101-2020_12_31_424971	464	2	,	,	,
10_1101-2020_12_31_424971	464	3	N.	N.	NNP
10_1101-2020_12_31_424971	464	4	,	,	,
10_1101-2020_12_31_424971	464	5	Shang	Shang	NNP
10_1101-2020_12_31_424971	464	6	,	,	,
10_1101-2020_12_31_424971	464	7	X.	X.	NNP
10_1101-2020_12_31_424971	464	8	,	,	,
10_1101-2020_12_31_424971	464	9	Cerny	Cerny	NNP
10_1101-2020_12_31_424971	464	10	,	,	,
10_1101-2020_12_31_424971	464	11	R.	R.	NNP
10_1101-2020_12_31_424971	464	12	,	,	,
10_1101-2020_12_31_424971	464	13	Niu	Niu	NNP
10_1101-2020_12_31_424971	464	14	,	,	,
10_1101-2020_12_31_424971	464	15	W.	W.	NNP
10_1101-2020_12_31_424971	464	16	&	&	CC
10_1101-2020_12_31_424971	464	17	Guo	Guo	NNP
10_1101-2020_12_31_424971	464	18	,	,	,
10_1101-2020_12_31_424971	464	19	J.	J.	NNP
10_1101-2020_12_31_424971	465	1	Systematic	Systematic	NNP
10_1101-2020_12_31_424971	465	2	Evolution	Evolution	NNP
10_1101-2020_12_31_424971	465	3	and	and	CC
10_1101-2020_12_31_424971	465	4	Study	Study	NNP
10_1101-2020_12_31_424971	465	5	of	of	IN
10_1101-2020_12_31_424971	465	6	1033	1033	CD
10_1101-2020_12_31_424971	465	7	UAGN	UAGN	NNP
10_1101-2020_12_31_424971	465	8	Decoding	Decoding	NNP
10_1101-2020_12_31_424971	465	9	tRNAs	trnas	CD
10_1101-2020_12_31_424971	465	10	in	in	IN
10_1101-2020_12_31_424971	465	11	a	a	DT
10_1101-2020_12_31_424971	465	12	Genomically	genomically	RB
10_1101-2020_12_31_424971	465	13	Recoded	recode	VBN
10_1101-2020_12_31_424971	465	14	Bacteria	Bacteria	NNS
10_1101-2020_12_31_424971	465	15	.	.	.
10_1101-2020_12_31_424971	466	1	Sci	Sci	NNP
10_1101-2020_12_31_424971	466	2	Rep	Rep	NNP
10_1101-2020_12_31_424971	466	3	6	6	CD
10_1101-2020_12_31_424971	466	4	,	,	,
10_1101-2020_12_31_424971	466	5	21898	21898	CD
10_1101-2020_12_31_424971	466	6	(	(	-LRB-
10_1101-2020_12_31_424971	466	7	2016	2016	CD
10_1101-2020_12_31_424971	466	8	)	)	-RRB-
10_1101-2020_12_31_424971	466	9	.	.	.
10_1101-2020_12_31_424971	467	1	1034	1034	CD
10_1101-2020_12_31_424971	467	2	7	7	CD
10_1101-2020_12_31_424971	467	3	.	.	.
10_1101-2020_12_31_424971	468	1	Neumann	Neumann	NNP
10_1101-2020_12_31_424971	468	2	,	,	,
10_1101-2020_12_31_424971	468	3	H.	H.	NNP
10_1101-2020_12_31_424971	468	4	,	,	,
10_1101-2020_12_31_424971	468	5	Wang	Wang	NNP
10_1101-2020_12_31_424971	468	6	,	,	,
10_1101-2020_12_31_424971	468	7	K.	K.	NNP
10_1101-2020_12_31_424971	468	8	,	,	,
10_1101-2020_12_31_424971	468	9	Davis	Davis	NNP
10_1101-2020_12_31_424971	468	10	,	,	,
10_1101-2020_12_31_424971	468	11	L.	L.	NNP
10_1101-2020_12_31_424971	468	12	,	,	,
10_1101-2020_12_31_424971	468	13	Garcia	Garcia	NNP
10_1101-2020_12_31_424971	468	14	-	-	HYPH
10_1101-2020_12_31_424971	468	15	Alai	Alai	NNP
10_1101-2020_12_31_424971	468	16	,	,	,
10_1101-2020_12_31_424971	468	17	M.	M.	NNP
10_1101-2020_12_31_424971	468	18	&	&	CC
10_1101-2020_12_31_424971	468	19	Chin	Chin	NNP
10_1101-2020_12_31_424971	468	20	,	,	,
10_1101-2020_12_31_424971	468	21	J.W.	J.W.	NNP
10_1101-2020_12_31_424971	469	1	Encoding	encode	VBG
10_1101-2020_12_31_424971	469	2	multiple	multiple	JJ
10_1101-2020_12_31_424971	469	3	1035	1035	CD
10_1101-2020_12_31_424971	469	4	unnatural	unnatural	JJ
10_1101-2020_12_31_424971	469	5	amino	amino	NN
10_1101-2020_12_31_424971	469	6	acids	acid	NNS
10_1101-2020_12_31_424971	469	7	via	via	IN
10_1101-2020_12_31_424971	469	8	evolution	evolution	NN
10_1101-2020_12_31_424971	469	9	of	of	IN
10_1101-2020_12_31_424971	469	10	a	a	DT
10_1101-2020_12_31_424971	469	11	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	469	12	-	-	HYPH
10_1101-2020_12_31_424971	469	13	decoding	decode	VBG
10_1101-2020_12_31_424971	469	14	ribosome	ribosome	NN
10_1101-2020_12_31_424971	469	15	.	.	.
10_1101-2020_12_31_424971	470	1	Nature	nature	NN
10_1101-2020_12_31_424971	470	2	464	464	CD
10_1101-2020_12_31_424971	470	3	,	,	,
10_1101-2020_12_31_424971	470	4	1036	1036	CD
10_1101-2020_12_31_424971	470	5	441	441	CD
10_1101-2020_12_31_424971	470	6	-	-	SYM
10_1101-2020_12_31_424971	470	7	4	4	CD
10_1101-2020_12_31_424971	470	8	(	(	-LRB-
10_1101-2020_12_31_424971	470	9	2010	2010	CD
10_1101-2020_12_31_424971	470	10	)	)	-RRB-
10_1101-2020_12_31_424971	470	11	.	.	.
10_1101-2020_12_31_424971	471	1	1037	1037	CD
10_1101-2020_12_31_424971	471	2	8	8	CD
10_1101-2020_12_31_424971	471	3	.	.	.
10_1101-2020_12_31_424971	472	1	Wang	Wang	NNP
10_1101-2020_12_31_424971	472	2	,	,	,
10_1101-2020_12_31_424971	472	3	K.	K.	NNP
10_1101-2020_12_31_424971	472	4	et	et	NNP
10_1101-2020_12_31_424971	472	5	al	al	NNP
10_1101-2020_12_31_424971	472	6	.	.	.
10_1101-2020_12_31_424971	473	1	Optimized	optimized	JJ
10_1101-2020_12_31_424971	473	2	orthogonal	orthogonal	JJ
10_1101-2020_12_31_424971	473	3	translation	translation	NN
10_1101-2020_12_31_424971	473	4	of	of	IN
10_1101-2020_12_31_424971	473	5	unnatural	unnatural	JJ
10_1101-2020_12_31_424971	473	6	amino	amino	NN
10_1101-2020_12_31_424971	473	7	acids	acid	NNS
10_1101-2020_12_31_424971	473	8	enables	enable	VBZ
10_1101-2020_12_31_424971	473	9	1038	1038	CD
10_1101-2020_12_31_424971	473	10	spontaneous	spontaneous	JJ
10_1101-2020_12_31_424971	473	11	protein	protein	NN
10_1101-2020_12_31_424971	473	12	double	double	JJ
10_1101-2020_12_31_424971	473	13	-	-	HYPH
10_1101-2020_12_31_424971	473	14	labelling	labelling	NN
10_1101-2020_12_31_424971	473	15	and	and	CC
10_1101-2020_12_31_424971	473	16	FRET	FRET	NNS
10_1101-2020_12_31_424971	473	17	.	.	.
10_1101-2020_12_31_424971	474	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	474	2	Chem	Chem	NNP
10_1101-2020_12_31_424971	474	3	6	6	CD
10_1101-2020_12_31_424971	474	4	,	,	,
10_1101-2020_12_31_424971	474	5	393	393	CD
10_1101-2020_12_31_424971	474	6	-	-	SYM
10_1101-2020_12_31_424971	474	7	403	403	CD
10_1101-2020_12_31_424971	474	8	(	(	-LRB-
10_1101-2020_12_31_424971	474	9	2014	2014	CD
10_1101-2020_12_31_424971	474	10	)	)	-RRB-
10_1101-2020_12_31_424971	474	11	.	.	.
10_1101-2020_12_31_424971	475	1	1039	1039	CD
10_1101-2020_12_31_424971	475	2	9	9	CD
10_1101-2020_12_31_424971	475	3	.	.	.
10_1101-2020_12_31_424971	476	1	Atkins	Atkins	NNP
10_1101-2020_12_31_424971	476	2	,	,	,
10_1101-2020_12_31_424971	476	3	J.F.	J.F.	NNP
10_1101-2020_12_31_424971	476	4	,	,	,
10_1101-2020_12_31_424971	476	5	Loughran	Loughran	NNP
10_1101-2020_12_31_424971	476	6	,	,	,
10_1101-2020_12_31_424971	476	7	G.	G.	NNP
10_1101-2020_12_31_424971	476	8	,	,	,
10_1101-2020_12_31_424971	476	9	Bhatt	Bhatt	NNP
10_1101-2020_12_31_424971	476	10	,	,	,
10_1101-2020_12_31_424971	476	11	P.R.	P.R.	NNP
10_1101-2020_12_31_424971	476	12	,	,	,
10_1101-2020_12_31_424971	476	13	Firth	Firth	NNP
10_1101-2020_12_31_424971	476	14	,	,	,
10_1101-2020_12_31_424971	476	15	A.E.	A.E.	NNP
10_1101-2020_12_31_424971	477	1	&	&	CC
10_1101-2020_12_31_424971	477	2	Baranov	Baranov	NNP
10_1101-2020_12_31_424971	477	3	,	,	,
10_1101-2020_12_31_424971	477	4	P.V.	P.V.	NNP
10_1101-2020_12_31_424971	478	1	Ribosomal	Ribosomal	NNP
10_1101-2020_12_31_424971	478	2	1040	1040	CD
10_1101-2020_12_31_424971	478	3	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	478	4	and	and	CC
10_1101-2020_12_31_424971	478	5	transcriptional	transcriptional	JJ
10_1101-2020_12_31_424971	478	6	slippage	slippage	NN
10_1101-2020_12_31_424971	478	7	:	:	:
10_1101-2020_12_31_424971	478	8	From	from	IN
10_1101-2020_12_31_424971	478	9	genetic	genetic	JJ
10_1101-2020_12_31_424971	478	10	steganography	steganography	NN
10_1101-2020_12_31_424971	478	11	and	and	CC
10_1101-2020_12_31_424971	478	12	1041	1041	CD
10_1101-2020_12_31_424971	478	13	cryptography	cryptography	NN
10_1101-2020_12_31_424971	478	14	to	to	IN
10_1101-2020_12_31_424971	478	15	adventitious	adventitious	JJ
10_1101-2020_12_31_424971	478	16	use	use	NN
10_1101-2020_12_31_424971	478	17	.	.	.
10_1101-2020_12_31_424971	479	1	Nucleic	Nucleic	NNP
10_1101-2020_12_31_424971	479	2	Acids	Acids	NNPS
10_1101-2020_12_31_424971	479	3	Res	Res	NNP
10_1101-2020_12_31_424971	479	4	44	44	CD
10_1101-2020_12_31_424971	479	5	,	,	,
10_1101-2020_12_31_424971	479	6	7007	7007	CD
10_1101-2020_12_31_424971	479	7	-	-	SYM
10_1101-2020_12_31_424971	479	8	78	78	CD
10_1101-2020_12_31_424971	479	9	(	(	-LRB-
10_1101-2020_12_31_424971	479	10	2016	2016	CD
10_1101-2020_12_31_424971	479	11	)	)	-RRB-
10_1101-2020_12_31_424971	479	12	.	.	.
10_1101-2020_12_31_424971	480	1	1042	1042	CD
10_1101-2020_12_31_424971	480	2	10	10	CD
10_1101-2020_12_31_424971	480	3	.	.	.
10_1101-2020_12_31_424971	481	1	Atkins	Atkins	NNP
10_1101-2020_12_31_424971	481	2	,	,	,
10_1101-2020_12_31_424971	481	3	J.F.	J.F.	NNP
10_1101-2020_12_31_424971	482	1	&	&	CC
10_1101-2020_12_31_424971	482	2	Bjork	Bjork	NNP
10_1101-2020_12_31_424971	482	3	,	,	,
10_1101-2020_12_31_424971	482	4	G.R.	G.R.	NNP
10_1101-2020_12_31_424971	483	1	A	a	DT
10_1101-2020_12_31_424971	483	2	gripping	grip	VBG
10_1101-2020_12_31_424971	483	3	tale	tale	NN
10_1101-2020_12_31_424971	483	4	of	of	IN
10_1101-2020_12_31_424971	483	5	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	483	6	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	483	7	:	:	:
10_1101-2020_12_31_424971	483	8	extragenic	extragenic	NNP
10_1101-2020_12_31_424971	483	9	1043	1043	CD
10_1101-2020_12_31_424971	483	10	suppressors	suppressor	NNS
10_1101-2020_12_31_424971	483	11	of	of	IN
10_1101-2020_12_31_424971	483	12	frameshift	frameshift	NN
10_1101-2020_12_31_424971	483	13	mutations	mutation	NNS
10_1101-2020_12_31_424971	483	14	spotlight	spotlight	NNP
10_1101-2020_12_31_424971	483	15	P	P	NNP
10_1101-2020_12_31_424971	483	16	-	-	HYPH
10_1101-2020_12_31_424971	483	17	site	site	NN
10_1101-2020_12_31_424971	483	18	realignment	realignment	NN
10_1101-2020_12_31_424971	483	19	.	.	.
10_1101-2020_12_31_424971	484	1	Microbiol	Microbiol	NNP
10_1101-2020_12_31_424971	484	2	Mol	Mol	NNP
10_1101-2020_12_31_424971	484	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	484	4	Rev	Rev	NNP
10_1101-2020_12_31_424971	484	5	1044	1044	CD
10_1101-2020_12_31_424971	484	6	73	73	CD
10_1101-2020_12_31_424971	484	7	,	,	,
10_1101-2020_12_31_424971	484	8	178	178	CD
10_1101-2020_12_31_424971	484	9	-	-	HYPH
10_1101-2020_12_31_424971	484	10	210	210	CD
10_1101-2020_12_31_424971	484	11	(	(	-LRB-
10_1101-2020_12_31_424971	484	12	2009	2009	CD
10_1101-2020_12_31_424971	484	13	)	)	-RRB-
10_1101-2020_12_31_424971	484	14	.	.	.
10_1101-2020_12_31_424971	485	1	1045	1045	CD
10_1101-2020_12_31_424971	485	2	11	11	CD
10_1101-2020_12_31_424971	485	3	.	.	.
10_1101-2020_12_31_424971	486	1	Roth	Roth	NNP
10_1101-2020_12_31_424971	486	2	,	,	,
10_1101-2020_12_31_424971	486	3	J.R.	J.R.	NNP
10_1101-2020_12_31_424971	486	4	Frameshift	Frameshift	NNP
10_1101-2020_12_31_424971	486	5	suppression	suppression	NN
10_1101-2020_12_31_424971	486	6	.	.	.
10_1101-2020_12_31_424971	487	1	Cell	Cell	NNP
10_1101-2020_12_31_424971	487	2	24	24	CD
10_1101-2020_12_31_424971	487	3	,	,	,
10_1101-2020_12_31_424971	487	4	601	601	CD
10_1101-2020_12_31_424971	487	5	-	-	HYPH
10_1101-2020_12_31_424971	487	6	2	2	CD
10_1101-2020_12_31_424971	487	7	(	(	-LRB-
10_1101-2020_12_31_424971	487	8	1981	1981	CD
10_1101-2020_12_31_424971	487	9	)	)	-RRB-
10_1101-2020_12_31_424971	487	10	.	.	.
10_1101-2020_12_31_424971	488	1	1046	1046	CD
10_1101-2020_12_31_424971	488	2	12	12	CD
10_1101-2020_12_31_424971	488	3	.	.	.
10_1101-2020_12_31_424971	489	1	Bossi	Bossi	NNP
10_1101-2020_12_31_424971	489	2	,	,	,
10_1101-2020_12_31_424971	489	3	L.	L.	NNP
10_1101-2020_12_31_424971	489	4	&	&	CC
10_1101-2020_12_31_424971	489	5	Roth	Roth	NNP
10_1101-2020_12_31_424971	489	6	,	,	,
10_1101-2020_12_31_424971	489	7	J.R.	J.R.	NNP
10_1101-2020_12_31_424971	489	8	Four	four	CD
10_1101-2020_12_31_424971	489	9	-	-	HYPH
10_1101-2020_12_31_424971	489	10	base	base	NN
10_1101-2020_12_31_424971	489	11	codons	codon	NNS
10_1101-2020_12_31_424971	489	12	ACCA	ACCA	NNP
10_1101-2020_12_31_424971	489	13	,	,	,
10_1101-2020_12_31_424971	489	14	ACCU	ACCU	NNP
10_1101-2020_12_31_424971	489	15	and	and	CC
10_1101-2020_12_31_424971	489	16	ACCC	ACCC	NNP
10_1101-2020_12_31_424971	489	17	are	be	VBP
10_1101-2020_12_31_424971	489	18	recognized	recognize	VBN
10_1101-2020_12_31_424971	489	19	by	by	IN
10_1101-2020_12_31_424971	489	20	1047	1047	CD
10_1101-2020_12_31_424971	489	21	frameshift	frameshift	NN
10_1101-2020_12_31_424971	489	22	suppressor	suppressor	NN
10_1101-2020_12_31_424971	489	23	sufJ.	sufJ.	NNP
10_1101-2020_12_31_424971	490	1	Cell	cell	NN
10_1101-2020_12_31_424971	490	2	25	25	CD
10_1101-2020_12_31_424971	490	3	,	,	,
10_1101-2020_12_31_424971	490	4	489	489	CD
10_1101-2020_12_31_424971	490	5	-	-	SYM
10_1101-2020_12_31_424971	490	6	96	96	CD
10_1101-2020_12_31_424971	490	7	(	(	-LRB-
10_1101-2020_12_31_424971	490	8	1981	1981	CD
10_1101-2020_12_31_424971	490	9	)	)	-RRB-
10_1101-2020_12_31_424971	490	10	.	.	.
10_1101-2020_12_31_424971	491	1	1048	1048	CD
10_1101-2020_12_31_424971	491	2	13	13	CD
10_1101-2020_12_31_424971	491	3	.	.	.
10_1101-2020_12_31_424971	492	1	Qian	Qian	NNP
10_1101-2020_12_31_424971	492	2	,	,	,
10_1101-2020_12_31_424971	492	3	Q.	Q.	NNP
10_1101-2020_12_31_424971	492	4	et	et	NNP
10_1101-2020_12_31_424971	492	5	al	al	NNP
10_1101-2020_12_31_424971	492	6	.	.	.
10_1101-2020_12_31_424971	493	1	A	a	DT
10_1101-2020_12_31_424971	493	2	new	new	JJ
10_1101-2020_12_31_424971	493	3	model	model	NN
10_1101-2020_12_31_424971	493	4	for	for	IN
10_1101-2020_12_31_424971	493	5	phenotypic	phenotypic	JJ
10_1101-2020_12_31_424971	493	6	suppression	suppression	NN
10_1101-2020_12_31_424971	493	7	of	of	IN
10_1101-2020_12_31_424971	493	8	frameshift	frameshift	NN
10_1101-2020_12_31_424971	493	9	mutations	mutation	NNS
10_1101-2020_12_31_424971	493	10	by	by	IN
10_1101-2020_12_31_424971	493	11	1049	1049	CD
10_1101-2020_12_31_424971	493	12	mutant	mutant	JJ
10_1101-2020_12_31_424971	493	13	tRNAs	tRNAs	''
10_1101-2020_12_31_424971	493	14	.	.	.
10_1101-2020_12_31_424971	494	1	Mol	Mol	NNP
10_1101-2020_12_31_424971	494	2	Cell	Cell	NNP
10_1101-2020_12_31_424971	494	3	1	1	CD
10_1101-2020_12_31_424971	494	4	,	,	,
10_1101-2020_12_31_424971	494	5	471	471	CD
10_1101-2020_12_31_424971	494	6	-	-	SYM
10_1101-2020_12_31_424971	494	7	82	82	CD
10_1101-2020_12_31_424971	494	8	(	(	-LRB-
10_1101-2020_12_31_424971	494	9	1998	1998	CD
10_1101-2020_12_31_424971	494	10	)	)	-RRB-
10_1101-2020_12_31_424971	494	11	.	.	.
10_1101-2020_12_31_424971	495	1	1050	1050	CD
10_1101-2020_12_31_424971	495	2	14	14	CD
10_1101-2020_12_31_424971	495	3	.	.	.
10_1101-2020_12_31_424971	496	1	Weiss	Weiss	NNP
10_1101-2020_12_31_424971	496	2	,	,	,
10_1101-2020_12_31_424971	496	3	R.B.	R.B.	NNP
10_1101-2020_12_31_424971	496	4	,	,	,
10_1101-2020_12_31_424971	496	5	Dunn	Dunn	NNP
10_1101-2020_12_31_424971	496	6	,	,	,
10_1101-2020_12_31_424971	496	7	D.M.	D.M.	NNP
10_1101-2020_12_31_424971	496	8	,	,	,
10_1101-2020_12_31_424971	496	9	Shuh	Shuh	NNP
10_1101-2020_12_31_424971	496	10	,	,	,
10_1101-2020_12_31_424971	496	11	M.	M.	NNP
10_1101-2020_12_31_424971	496	12	,	,	,
10_1101-2020_12_31_424971	496	13	Atkins	Atkins	NNP
10_1101-2020_12_31_424971	496	14	,	,	,
10_1101-2020_12_31_424971	496	15	J.F.	J.F.	NNP
10_1101-2020_12_31_424971	497	1	&	&	CC
10_1101-2020_12_31_424971	497	2	Gesteland	Gesteland	NNP
10_1101-2020_12_31_424971	497	3	,	,	,
10_1101-2020_12_31_424971	497	4	R.F.	R.F.	NNP
10_1101-2020_12_31_424971	498	1	E.	E.	NNP
10_1101-2020_12_31_424971	498	2	coli	coli	NNS
10_1101-2020_12_31_424971	498	3	ribosomes	ribosome	VBZ
10_1101-2020_12_31_424971	498	4	re-1051	re-1051	NNPS
10_1101-2020_12_31_424971	498	5	phase	phase	NN
10_1101-2020_12_31_424971	498	6	on	on	IN
10_1101-2020_12_31_424971	498	7	retroviral	retroviral	JJ
10_1101-2020_12_31_424971	498	8	frameshift	frameshift	NN
10_1101-2020_12_31_424971	498	9	signals	signal	NNS
10_1101-2020_12_31_424971	498	10	at	at	IN
10_1101-2020_12_31_424971	498	11	rates	rate	NNS
10_1101-2020_12_31_424971	498	12	ranging	range	VBG
10_1101-2020_12_31_424971	498	13	from	from	IN
10_1101-2020_12_31_424971	498	14	2	2	CD
10_1101-2020_12_31_424971	498	15	to	to	IN
10_1101-2020_12_31_424971	498	16	50	50	CD
10_1101-2020_12_31_424971	498	17	percent	percent	NN
10_1101-2020_12_31_424971	498	18	.	.	.
10_1101-2020_12_31_424971	499	1	New	New	NNP
10_1101-2020_12_31_424971	499	2	Biol	Biol	NNP
10_1101-2020_12_31_424971	499	3	1	1	CD
10_1101-2020_12_31_424971	499	4	,	,	,
10_1101-2020_12_31_424971	499	5	1052	1052	CD
10_1101-2020_12_31_424971	499	6	159	159	CD
10_1101-2020_12_31_424971	499	7	-	-	SYM
10_1101-2020_12_31_424971	499	8	69	69	CD
10_1101-2020_12_31_424971	499	9	(	(	-LRB-
10_1101-2020_12_31_424971	499	10	1989	1989	CD
10_1101-2020_12_31_424971	499	11	)	)	-RRB-
10_1101-2020_12_31_424971	499	12	.	.	.
10_1101-2020_12_31_424971	500	1	1053	1053	CD
10_1101-2020_12_31_424971	500	2	15	15	CD
10_1101-2020_12_31_424971	500	3	.	.	.
10_1101-2020_12_31_424971	501	1	Jager	Jager	NNP
10_1101-2020_12_31_424971	501	2	,	,	,
10_1101-2020_12_31_424971	501	3	G.	G.	NNP
10_1101-2020_12_31_424971	501	4	,	,	,
10_1101-2020_12_31_424971	501	5	Nilsson	Nilsson	NNP
10_1101-2020_12_31_424971	501	6	,	,	,
10_1101-2020_12_31_424971	501	7	K.	K.	NNP
10_1101-2020_12_31_424971	501	8	&	&	CC
10_1101-2020_12_31_424971	501	9	Bjork	Bjork	NNP
10_1101-2020_12_31_424971	501	10	,	,	,
10_1101-2020_12_31_424971	501	11	G.R.	G.R.	NNP
10_1101-2020_12_31_424971	502	1	The	the	DT
10_1101-2020_12_31_424971	502	2	phenotype	phenotype	NN
10_1101-2020_12_31_424971	502	3	of	of	IN
10_1101-2020_12_31_424971	502	4	many	many	JJ
10_1101-2020_12_31_424971	502	5	independently	independently	RB
10_1101-2020_12_31_424971	502	6	isolated	isolate	VBN
10_1101-2020_12_31_424971	502	7	+1	+1	NNS
10_1101-2020_12_31_424971	502	8	1054	1054	CD
10_1101-2020_12_31_424971	502	9	frameshift	frameshift	NN
10_1101-2020_12_31_424971	502	10	suppressor	suppressor	NN
10_1101-2020_12_31_424971	502	11	mutants	mutant	NNS
10_1101-2020_12_31_424971	502	12	supports	support	VBZ
10_1101-2020_12_31_424971	502	13	a	a	DT
10_1101-2020_12_31_424971	502	14	pivotal	pivotal	JJ
10_1101-2020_12_31_424971	502	15	role	role	NN
10_1101-2020_12_31_424971	502	16	of	of	IN
10_1101-2020_12_31_424971	502	17	the	the	DT
10_1101-2020_12_31_424971	502	18	P	p	NN
10_1101-2020_12_31_424971	502	19	-	-	HYPH
10_1101-2020_12_31_424971	502	20	site	site	NN
10_1101-2020_12_31_424971	502	21	in	in	IN
10_1101-2020_12_31_424971	502	22	reading	read	VBG
10_1101-2020_12_31_424971	502	23	frame	frame	NN
10_1101-2020_12_31_424971	502	24	1055	1055	CD
10_1101-2020_12_31_424971	502	25	maintenance	maintenance	NN
10_1101-2020_12_31_424971	502	26	.	.	.
10_1101-2020_12_31_424971	503	1	PLoS	plos	ADD
10_1101-2020_12_31_424971	503	2	One	one	CD
10_1101-2020_12_31_424971	503	3	8	8	CD
10_1101-2020_12_31_424971	503	4	,	,	,
10_1101-2020_12_31_424971	503	5	e60246	e60246	NNP
10_1101-2020_12_31_424971	503	6	(	(	-LRB-
10_1101-2020_12_31_424971	503	7	2013	2013	CD
10_1101-2020_12_31_424971	503	8	)	)	-RRB-
10_1101-2020_12_31_424971	503	9	.	.	.
10_1101-2020_12_31_424971	504	1	1056	1056	CD
10_1101-2020_12_31_424971	504	2	16	16	CD
10_1101-2020_12_31_424971	504	3	.	.	.
10_1101-2020_12_31_424971	505	1	Fagan	Fagan	NNP
10_1101-2020_12_31_424971	505	2	,	,	,
10_1101-2020_12_31_424971	505	3	C.E.	C.E.	NNP
10_1101-2020_12_31_424971	505	4	,	,	,
10_1101-2020_12_31_424971	505	5	Maehigashi	Maehigashi	NNP
10_1101-2020_12_31_424971	505	6	,	,	,
10_1101-2020_12_31_424971	505	7	T.	T.	NNP
10_1101-2020_12_31_424971	505	8	,	,	,
10_1101-2020_12_31_424971	505	9	Dunkle	Dunkle	NNP
10_1101-2020_12_31_424971	505	10	,	,	,
10_1101-2020_12_31_424971	505	11	J.A.	J.A.	NNP
10_1101-2020_12_31_424971	505	12	,	,	,
10_1101-2020_12_31_424971	505	13	Miles	Miles	NNP
10_1101-2020_12_31_424971	505	14	,	,	,
10_1101-2020_12_31_424971	505	15	S.J.	S.J.	NNP
10_1101-2020_12_31_424971	506	1	&	&	CC
10_1101-2020_12_31_424971	506	2	Dunham	Dunham	NNP
10_1101-2020_12_31_424971	506	3	,	,	,
10_1101-2020_12_31_424971	506	4	C.M.	C.M.	NNP
10_1101-2020_12_31_424971	507	1	Structural	structural	JJ
10_1101-2020_12_31_424971	507	2	1057	1057	CD
10_1101-2020_12_31_424971	507	3	insights	insight	NNS
10_1101-2020_12_31_424971	507	4	into	into	IN
10_1101-2020_12_31_424971	507	5	translational	translational	JJ
10_1101-2020_12_31_424971	507	6	recoding	recoding	NN
10_1101-2020_12_31_424971	507	7	by	by	IN
10_1101-2020_12_31_424971	507	8	frameshift	frameshift	NN
10_1101-2020_12_31_424971	507	9	suppressor	suppressor	NN
10_1101-2020_12_31_424971	507	10	tRNASufJ.	trnasufj.	NN
10_1101-2020_12_31_424971	508	1	RNA	RNA	NNP
10_1101-2020_12_31_424971	508	2	20	20	CD
10_1101-2020_12_31_424971	508	3	,	,	,
10_1101-2020_12_31_424971	508	4	1944	1944	CD
10_1101-2020_12_31_424971	508	5	-	-	SYM
10_1101-2020_12_31_424971	508	6	54	54	CD
10_1101-2020_12_31_424971	508	7	1058	1058	CD
10_1101-2020_12_31_424971	508	8	(	(	-LRB-
10_1101-2020_12_31_424971	508	9	2014	2014	CD
10_1101-2020_12_31_424971	508	10	)	)	-RRB-
10_1101-2020_12_31_424971	508	11	.	.	.
10_1101-2020_12_31_424971	509	1	1059	1059	CD
10_1101-2020_12_31_424971	509	2	17	17	CD
10_1101-2020_12_31_424971	509	3	.	.	.
10_1101-2020_12_31_424971	510	1	Maehigashi	Maehigashi	NNP
10_1101-2020_12_31_424971	510	2	,	,	,
10_1101-2020_12_31_424971	510	3	T.	T.	NNP
10_1101-2020_12_31_424971	510	4	,	,	,
10_1101-2020_12_31_424971	510	5	Dunkle	Dunkle	NNP
10_1101-2020_12_31_424971	510	6	,	,	,
10_1101-2020_12_31_424971	510	7	J.A.	J.A.	NNP
10_1101-2020_12_31_424971	510	8	,	,	,
10_1101-2020_12_31_424971	510	9	Miles	Miles	NNP
10_1101-2020_12_31_424971	510	10	,	,	,
10_1101-2020_12_31_424971	510	11	S.J.	S.J.	NNP
10_1101-2020_12_31_424971	511	1	&	&	CC
10_1101-2020_12_31_424971	511	2	Dunham	Dunham	NNP
10_1101-2020_12_31_424971	511	3	,	,	,
10_1101-2020_12_31_424971	511	4	C.M.	C.M.	NNP
10_1101-2020_12_31_424971	512	1	Structural	structural	JJ
10_1101-2020_12_31_424971	512	2	insights	insight	NNS
10_1101-2020_12_31_424971	512	3	into	into	IN
10_1101-2020_12_31_424971	512	4	+1	+1	NNS
10_1101-2020_12_31_424971	512	5	1060	1060	CD
10_1101-2020_12_31_424971	512	6	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	512	7	promoted	promote	VBN
10_1101-2020_12_31_424971	512	8	by	by	IN
10_1101-2020_12_31_424971	512	9	expanded	expanded	JJ
10_1101-2020_12_31_424971	512	10	or	or	CC
10_1101-2020_12_31_424971	512	11	modification	modification	NN
10_1101-2020_12_31_424971	512	12	-	-	HYPH
10_1101-2020_12_31_424971	512	13	deficient	deficient	JJ
10_1101-2020_12_31_424971	512	14	anticodon	anticodon	NN
10_1101-2020_12_31_424971	512	15	stem	stem	NN
10_1101-2020_12_31_424971	512	16	loops	loop	NNS
10_1101-2020_12_31_424971	512	17	.	.	.
10_1101-2020_12_31_424971	513	1	1061	1061	CD
10_1101-2020_12_31_424971	513	2	Proc	Proc	NNP
10_1101-2020_12_31_424971	513	3	Natl	Natl	NNP
10_1101-2020_12_31_424971	513	4	Acad	Acad	NNP
10_1101-2020_12_31_424971	513	5	Sci	Sci	NNP
10_1101-2020_12_31_424971	513	6	U	U	NNP
10_1101-2020_12_31_424971	513	7	S	S	NNP
10_1101-2020_12_31_424971	513	8	A	A	NNP
10_1101-2020_12_31_424971	513	9	111	111	CD
10_1101-2020_12_31_424971	513	10	,	,	,
10_1101-2020_12_31_424971	513	11	12740	12740	CD
10_1101-2020_12_31_424971	513	12	-	-	SYM
10_1101-2020_12_31_424971	513	13	5	5	CD
10_1101-2020_12_31_424971	513	14	(	(	-LRB-
10_1101-2020_12_31_424971	513	15	2014	2014	CD
10_1101-2020_12_31_424971	513	16	)	)	-RRB-
10_1101-2020_12_31_424971	513	17	.	.	.
10_1101-2020_12_31_424971	514	1	1062	1062	CD
10_1101-2020_12_31_424971	514	2	18	18	CD
10_1101-2020_12_31_424971	514	3	.	.	.
10_1101-2020_12_31_424971	515	1	Dunham	Dunham	NNP
10_1101-2020_12_31_424971	515	2	,	,	,
10_1101-2020_12_31_424971	515	3	C.M.	C.M.	NNP
10_1101-2020_12_31_424971	516	1	et	et	NNP
10_1101-2020_12_31_424971	516	2	al	al	NNP
10_1101-2020_12_31_424971	516	3	.	.	.
10_1101-2020_12_31_424971	517	1	Structures	structure	NNS
10_1101-2020_12_31_424971	517	2	of	of	IN
10_1101-2020_12_31_424971	517	3	tRNAs	trnas	CD
10_1101-2020_12_31_424971	517	4	with	with	IN
10_1101-2020_12_31_424971	517	5	an	an	DT
10_1101-2020_12_31_424971	517	6	expanded	expand	VBN
10_1101-2020_12_31_424971	517	7	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	517	8	loop	loop	NN
10_1101-2020_12_31_424971	517	9	in	in	IN
10_1101-2020_12_31_424971	517	10	the	the	DT
10_1101-2020_12_31_424971	517	11	1063	1063	CD
10_1101-2020_12_31_424971	517	12	decoding	decode	VBG
10_1101-2020_12_31_424971	517	13	center	center	NN
10_1101-2020_12_31_424971	517	14	of	of	IN
10_1101-2020_12_31_424971	517	15	the	the	DT
10_1101-2020_12_31_424971	517	16	30S	30s	CD
10_1101-2020_12_31_424971	517	17	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	517	18	subunit	subunit	NN
10_1101-2020_12_31_424971	517	19	.	.	.
10_1101-2020_12_31_424971	518	1	RNA	RNA	NNP
10_1101-2020_12_31_424971	518	2	13	13	CD
10_1101-2020_12_31_424971	518	3	,	,	,
10_1101-2020_12_31_424971	518	4	817	817	CD
10_1101-2020_12_31_424971	518	5	-	-	SYM
10_1101-2020_12_31_424971	518	6	23	23	CD
10_1101-2020_12_31_424971	518	7	(	(	-LRB-
10_1101-2020_12_31_424971	518	8	2007	2007	CD
10_1101-2020_12_31_424971	518	9	)	)	-RRB-
10_1101-2020_12_31_424971	518	10	.	.	.
10_1101-2020_12_31_424971	519	1	1064	1064	CD
10_1101-2020_12_31_424971	519	2	19	19	CD
10_1101-2020_12_31_424971	519	3	.	.	.
10_1101-2020_12_31_424971	520	1	Hong	Hong	NNP
10_1101-2020_12_31_424971	520	2	,	,	,
10_1101-2020_12_31_424971	520	3	S.	S.	NNP
10_1101-2020_12_31_424971	520	4	et	et	NNP
10_1101-2020_12_31_424971	520	5	al	al	NNP
10_1101-2020_12_31_424971	520	6	.	.	.
10_1101-2020_12_31_424971	521	1	Mechanism	mechanism	NN
10_1101-2020_12_31_424971	521	2	of	of	IN
10_1101-2020_12_31_424971	521	3	tRNA	trna	NN
10_1101-2020_12_31_424971	521	4	-	-	HYPH
10_1101-2020_12_31_424971	521	5	mediated	mediate	VBN
10_1101-2020_12_31_424971	521	6	+1	+1	NNS
10_1101-2020_12_31_424971	521	7	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	521	8	frameshifting	frameshifting	NN
10_1101-2020_12_31_424971	521	9	.	.	.
10_1101-2020_12_31_424971	522	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	522	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	522	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	522	4	1065	1065	CD
10_1101-2020_12_31_424971	522	5	Sci	Sci	NNP
10_1101-2020_12_31_424971	522	6	U	U	NNP
10_1101-2020_12_31_424971	522	7	S	S	NNP
10_1101-2020_12_31_424971	522	8	A	A	NNP
10_1101-2020_12_31_424971	522	9	115	115	CD
10_1101-2020_12_31_424971	522	10	,	,	,
10_1101-2020_12_31_424971	522	11	11226	11226	CD
10_1101-2020_12_31_424971	522	12	-	-	SYM
10_1101-2020_12_31_424971	522	13	11231	11231	CD
10_1101-2020_12_31_424971	522	14	(	(	-LRB-
10_1101-2020_12_31_424971	522	15	2018	2018	CD
10_1101-2020_12_31_424971	522	16	)	)	-RRB-
10_1101-2020_12_31_424971	522	17	.	.	.
10_1101-2020_12_31_424971	523	1	1066	1066	CD
10_1101-2020_12_31_424971	523	2	20	20	CD
10_1101-2020_12_31_424971	523	3	.	.	.
10_1101-2020_12_31_424971	524	1	Sroga	Sroga	NNP
10_1101-2020_12_31_424971	524	2	,	,	,
10_1101-2020_12_31_424971	524	3	G.E.	G.E.	NNP
10_1101-2020_12_31_424971	524	4	,	,	,
10_1101-2020_12_31_424971	524	5	Nemoto	Nemoto	NNP
10_1101-2020_12_31_424971	524	6	,	,	,
10_1101-2020_12_31_424971	524	7	F.	F.	NNP
10_1101-2020_12_31_424971	524	8	,	,	,
10_1101-2020_12_31_424971	524	9	Kuchino	Kuchino	NNP
10_1101-2020_12_31_424971	524	10	,	,	,
10_1101-2020_12_31_424971	524	11	Y.	Y.	NNP
10_1101-2020_12_31_424971	525	1	&	&	CC
10_1101-2020_12_31_424971	525	2	Bjork	Bjork	NNP
10_1101-2020_12_31_424971	525	3	,	,	,
10_1101-2020_12_31_424971	525	4	G.R.	G.R.	NNP
10_1101-2020_12_31_424971	526	1	Insertion	insertion	NN
10_1101-2020_12_31_424971	526	2	(	(	-LRB-
10_1101-2020_12_31_424971	526	3	sufB	sufB	NNP
10_1101-2020_12_31_424971	526	4	)	)	-RRB-
10_1101-2020_12_31_424971	526	5	in	in	IN
10_1101-2020_12_31_424971	526	6	the	the	DT
10_1101-2020_12_31_424971	526	7	anticodon	anticodon	NN
10_1101-2020_12_31_424971	526	8	loop	loop	NN
10_1101-2020_12_31_424971	526	9	1067	1067	CD
10_1101-2020_12_31_424971	526	10	or	or	CC
10_1101-2020_12_31_424971	526	11	base	base	NN
10_1101-2020_12_31_424971	526	12	substitution	substitution	NN
10_1101-2020_12_31_424971	526	13	(	(	-LRB-
10_1101-2020_12_31_424971	526	14	sufC	sufC	NFP
10_1101-2020_12_31_424971	526	15	)	)	-RRB-
10_1101-2020_12_31_424971	526	16	in	in	IN
10_1101-2020_12_31_424971	526	17	the	the	DT
10_1101-2020_12_31_424971	526	18	anticodon	anticodon	NN
10_1101-2020_12_31_424971	526	19	stem	stem	NN
10_1101-2020_12_31_424971	526	20	of	of	IN
10_1101-2020_12_31_424971	526	21	tRNA(Pro)2	tRNA(Pro)2	NNP
10_1101-2020_12_31_424971	526	22	from	from	IN
10_1101-2020_12_31_424971	526	23	Salmonella	salmonella	NN
10_1101-2020_12_31_424971	526	24	1068	1068	CD
10_1101-2020_12_31_424971	526	25	.CC	.cc	SYM
10_1101-2020_12_31_424971	526	26	-	-	:
10_1101-2020_12_31_424971	526	27	BY	by	IN
10_1101-2020_12_31_424971	526	28	-	-	HYPH
10_1101-2020_12_31_424971	526	29	NC	NC	NNP
10_1101-2020_12_31_424971	526	30	-	-	HYPH
10_1101-2020_12_31_424971	526	31	ND	ND	NNP
10_1101-2020_12_31_424971	526	32	4.0	4.0	CD
10_1101-2020_12_31_424971	526	33	International	International	NNP
10_1101-2020_12_31_424971	526	34	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	526	35	under	under	IN
10_1101-2020_12_31_424971	526	36	a	a	DT
10_1101-2020_12_31_424971	526	37	(	(	-LRB-
10_1101-2020_12_31_424971	526	38	which	which	WDT
10_1101-2020_12_31_424971	526	39	was	be	VBD
10_1101-2020_12_31_424971	526	40	not	not	RB
10_1101-2020_12_31_424971	526	41	certified	certify	VBN
10_1101-2020_12_31_424971	526	42	by	by	IN
10_1101-2020_12_31_424971	526	43	peer	peer	NN
10_1101-2020_12_31_424971	526	44	review	review	NN
10_1101-2020_12_31_424971	526	45	)	)	-RRB-
10_1101-2020_12_31_424971	526	46	is	be	VBZ
10_1101-2020_12_31_424971	526	47	the	the	DT
10_1101-2020_12_31_424971	526	48	author	author	NN
10_1101-2020_12_31_424971	526	49	/	/	SYM
10_1101-2020_12_31_424971	526	50	funder	funder	NN
10_1101-2020_12_31_424971	526	51	,	,	,
10_1101-2020_12_31_424971	526	52	who	who	WP
10_1101-2020_12_31_424971	526	53	has	have	VBZ
10_1101-2020_12_31_424971	526	54	granted	grant	VBN
10_1101-2020_12_31_424971	526	55	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	526	56	a	a	DT
10_1101-2020_12_31_424971	526	57	license	license	NN
10_1101-2020_12_31_424971	526	58	to	to	TO
10_1101-2020_12_31_424971	526	59	display	display	VB
10_1101-2020_12_31_424971	526	60	the	the	DT
10_1101-2020_12_31_424971	526	61	preprint	preprint	NN
10_1101-2020_12_31_424971	526	62	in	in	IN
10_1101-2020_12_31_424971	526	63	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	526	64	.	.	.
10_1101-2020_12_31_424971	527	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	527	2	is	be	VBZ
10_1101-2020_12_31_424971	527	3	made	make	VBN
10_1101-2020_12_31_424971	527	4	The	the	DT
10_1101-2020_12_31_424971	527	5	copyright	copyright	NN
10_1101-2020_12_31_424971	527	6	holder	holder	NN
10_1101-2020_12_31_424971	527	7	for	for	IN
10_1101-2020_12_31_424971	527	8	this	this	DT
10_1101-2020_12_31_424971	527	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	527	10	version	version	NN
10_1101-2020_12_31_424971	527	11	posted	post	VBD
10_1101-2020_12_31_424971	527	12	January	January	NNP
10_1101-2020_12_31_424971	527	13	2	2	CD
10_1101-2020_12_31_424971	527	14	,	,	,
10_1101-2020_12_31_424971	527	15	2021	2021	CD
10_1101-2020_12_31_424971	527	16	.	.	.
10_1101-2020_12_31_424971	527	17	;	;	:
10_1101-2020_12_31_424971	527	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	527	19	:	:	:
10_1101-2020_12_31_424971	527	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	527	21	preprint	preprint	NN
10_1101-2020_12_31_424971	527	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	527	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	527	24	43	43	CD
10_1101-2020_12_31_424971	527	25	typhimurium	typhimurium	NN
10_1101-2020_12_31_424971	527	26	induces	induce	VBZ
10_1101-2020_12_31_424971	527	27	suppression	suppression	NN
10_1101-2020_12_31_424971	527	28	of	of	IN
10_1101-2020_12_31_424971	527	29	frameshift	frameshift	NN
10_1101-2020_12_31_424971	527	30	mutations	mutation	NNS
10_1101-2020_12_31_424971	527	31	.	.	.
10_1101-2020_12_31_424971	528	1	Nucleic	Nucleic	NNP
10_1101-2020_12_31_424971	528	2	Acids	Acids	NNPS
10_1101-2020_12_31_424971	528	3	Res	Res	NNP
10_1101-2020_12_31_424971	528	4	20	20	CD
10_1101-2020_12_31_424971	528	5	,	,	,
10_1101-2020_12_31_424971	528	6	3463	3463	CD
10_1101-2020_12_31_424971	528	7	-	-	SYM
10_1101-2020_12_31_424971	528	8	9	9	CD
10_1101-2020_12_31_424971	528	9	1069	1069	CD
10_1101-2020_12_31_424971	528	10	(	(	-LRB-
10_1101-2020_12_31_424971	528	11	1992	1992	CD
10_1101-2020_12_31_424971	528	12	)	)	-RRB-
10_1101-2020_12_31_424971	528	13	.	.	.
10_1101-2020_12_31_424971	529	1	1070	1070	CD
10_1101-2020_12_31_424971	529	2	21	21	CD
10_1101-2020_12_31_424971	529	3	.	.	.
10_1101-2020_12_31_424971	530	1	Caliskan	Caliskan	NNP
10_1101-2020_12_31_424971	530	2	,	,	,
10_1101-2020_12_31_424971	530	3	N.	N.	NNP
10_1101-2020_12_31_424971	530	4	,	,	,
10_1101-2020_12_31_424971	530	5	Katunin	Katunin	NNP
10_1101-2020_12_31_424971	530	6	,	,	,
10_1101-2020_12_31_424971	530	7	V.I.	V.I.	NNP
10_1101-2020_12_31_424971	530	8	,	,	,
10_1101-2020_12_31_424971	530	9	Belardinelli	Belardinelli	NNP
10_1101-2020_12_31_424971	530	10	,	,	,
10_1101-2020_12_31_424971	530	11	R.	R.	NNP
10_1101-2020_12_31_424971	530	12	,	,	,
10_1101-2020_12_31_424971	530	13	Peske	Peske	NNP
10_1101-2020_12_31_424971	530	14	,	,	,
10_1101-2020_12_31_424971	530	15	F.	F.	NNP
10_1101-2020_12_31_424971	530	16	&	&	CC
10_1101-2020_12_31_424971	530	17	Rodnina	Rodnina	NNP
10_1101-2020_12_31_424971	530	18	,	,	,
10_1101-2020_12_31_424971	530	19	M.V.	M.V.	NNP
10_1101-2020_12_31_424971	531	1	Programmed	Programmed	NNP
10_1101-2020_12_31_424971	531	2	-1	-1	NNP
10_1101-2020_12_31_424971	531	3	1071	1071	CD
10_1101-2020_12_31_424971	531	4	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	531	5	by	by	IN
10_1101-2020_12_31_424971	531	6	kinetic	kinetic	NN
10_1101-2020_12_31_424971	531	7	partitioning	partitioning	NN
10_1101-2020_12_31_424971	531	8	during	during	IN
10_1101-2020_12_31_424971	531	9	impeded	impeded	JJ
10_1101-2020_12_31_424971	531	10	translocation	translocation	NN
10_1101-2020_12_31_424971	531	11	.	.	.
10_1101-2020_12_31_424971	532	1	Cell	Cell	NNP
10_1101-2020_12_31_424971	532	2	157	157	CD
10_1101-2020_12_31_424971	532	3	,	,	,
10_1101-2020_12_31_424971	532	4	1619	1619	CD
10_1101-2020_12_31_424971	532	5	-	-	SYM
10_1101-2020_12_31_424971	532	6	31	31	CD
10_1101-2020_12_31_424971	532	7	1072	1072	CD
10_1101-2020_12_31_424971	532	8	(	(	-LRB-
10_1101-2020_12_31_424971	532	9	2014	2014	CD
10_1101-2020_12_31_424971	532	10	)	)	-RRB-
10_1101-2020_12_31_424971	532	11	.	.	.
10_1101-2020_12_31_424971	533	1	1073	1073	CD
10_1101-2020_12_31_424971	533	2	22	22	CD
10_1101-2020_12_31_424971	533	3	.	.	.
10_1101-2020_12_31_424971	534	1	Taylor	Taylor	NNP
10_1101-2020_12_31_424971	534	2	,	,	,
10_1101-2020_12_31_424971	534	3	D.J.	D.J.	NNP
10_1101-2020_12_31_424971	535	1	et	et	NNP
10_1101-2020_12_31_424971	535	2	al	al	NNP
10_1101-2020_12_31_424971	535	3	.	.	.
10_1101-2020_12_31_424971	536	1	Structures	structure	NNS
10_1101-2020_12_31_424971	536	2	of	of	IN
10_1101-2020_12_31_424971	536	3	modified	modify	VBN
10_1101-2020_12_31_424971	536	4	eEF2	eEF2	NNP
10_1101-2020_12_31_424971	536	5	80S	80S	NNP
10_1101-2020_12_31_424971	536	6	ribosome	ribosome	VBD
10_1101-2020_12_31_424971	536	7	complexes	complex	NNS
10_1101-2020_12_31_424971	536	8	reveal	reveal	VBP
10_1101-2020_12_31_424971	536	9	the	the	DT
10_1101-2020_12_31_424971	536	10	role	role	NN
10_1101-2020_12_31_424971	536	11	1074	1074	CD
10_1101-2020_12_31_424971	536	12	of	of	IN
10_1101-2020_12_31_424971	536	13	GTP	GTP	NNP
10_1101-2020_12_31_424971	536	14	hydrolysis	hydrolysis	NN
10_1101-2020_12_31_424971	536	15	in	in	IN
10_1101-2020_12_31_424971	536	16	translocation	translocation	NN
10_1101-2020_12_31_424971	536	17	.	.	.
10_1101-2020_12_31_424971	537	1	EMBO	EMBO	NNP
10_1101-2020_12_31_424971	537	2	J	J	NNP
10_1101-2020_12_31_424971	537	3	26	26	CD
10_1101-2020_12_31_424971	537	4	,	,	,
10_1101-2020_12_31_424971	537	5	2421	2421	CD
10_1101-2020_12_31_424971	537	6	-	-	SYM
10_1101-2020_12_31_424971	537	7	31	31	CD
10_1101-2020_12_31_424971	537	8	(	(	-LRB-
10_1101-2020_12_31_424971	537	9	2007	2007	CD
10_1101-2020_12_31_424971	537	10	)	)	-RRB-
10_1101-2020_12_31_424971	537	11	.	.	.
10_1101-2020_12_31_424971	538	1	1075	1075	CD
10_1101-2020_12_31_424971	538	2	23	23	CD
10_1101-2020_12_31_424971	538	3	.	.	.
10_1101-2020_12_31_424971	539	1	Khade	Khade	NNP
10_1101-2020_12_31_424971	539	2	,	,	,
10_1101-2020_12_31_424971	539	3	P.K.	P.K.	NNP
10_1101-2020_12_31_424971	540	1	&	&	CC
10_1101-2020_12_31_424971	540	2	Joseph	Joseph	NNP
10_1101-2020_12_31_424971	540	3	,	,	,
10_1101-2020_12_31_424971	540	4	S.	S.	NNP
10_1101-2020_12_31_424971	540	5	Messenger	Messenger	NNP
10_1101-2020_12_31_424971	540	6	RNA	RNA	NNP
10_1101-2020_12_31_424971	540	7	interactions	interaction	NNS
10_1101-2020_12_31_424971	540	8	in	in	IN
10_1101-2020_12_31_424971	540	9	the	the	DT
10_1101-2020_12_31_424971	540	10	decoding	decode	VBG
10_1101-2020_12_31_424971	540	11	center	center	NN
10_1101-2020_12_31_424971	540	12	control	control	NN
10_1101-2020_12_31_424971	540	13	1076	1076	CD
10_1101-2020_12_31_424971	540	14	the	the	DT
10_1101-2020_12_31_424971	540	15	rate	rate	NN
10_1101-2020_12_31_424971	540	16	of	of	IN
10_1101-2020_12_31_424971	540	17	translocation	translocation	NN
10_1101-2020_12_31_424971	540	18	.	.	.
10_1101-2020_12_31_424971	541	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	541	2	Struct	Struct	NNP
10_1101-2020_12_31_424971	541	3	Mol	Mol	NNP
10_1101-2020_12_31_424971	541	4	Biol	Biol	NNP
10_1101-2020_12_31_424971	541	5	18	18	CD
10_1101-2020_12_31_424971	541	6	,	,	,
10_1101-2020_12_31_424971	541	7	1300	1300	CD
10_1101-2020_12_31_424971	541	8	-	-	SYM
10_1101-2020_12_31_424971	541	9	2	2	CD
10_1101-2020_12_31_424971	541	10	(	(	-LRB-
10_1101-2020_12_31_424971	541	11	2011	2011	CD
10_1101-2020_12_31_424971	541	12	)	)	-RRB-
10_1101-2020_12_31_424971	541	13	.	.	.
10_1101-2020_12_31_424971	542	1	1077	1077	CD
10_1101-2020_12_31_424971	542	2	24	24	CD
10_1101-2020_12_31_424971	542	3	.	.	.
10_1101-2020_12_31_424971	543	1	Liu	Liu	NNP
10_1101-2020_12_31_424971	543	2	,	,	,
10_1101-2020_12_31_424971	543	3	G.	G.	NNP
10_1101-2020_12_31_424971	543	4	et	et	NNP
10_1101-2020_12_31_424971	543	5	al	al	NNP
10_1101-2020_12_31_424971	543	6	.	.	.
10_1101-2020_12_31_424971	544	1	EF	EF	NNP
10_1101-2020_12_31_424971	544	2	-	-	HYPH
10_1101-2020_12_31_424971	544	3	G	G	NNP
10_1101-2020_12_31_424971	544	4	catalyzes	catalyze	VBZ
10_1101-2020_12_31_424971	544	5	tRNA	trna	NN
10_1101-2020_12_31_424971	544	6	translocation	translocation	NN
10_1101-2020_12_31_424971	544	7	by	by	IN
10_1101-2020_12_31_424971	544	8	disrupting	disrupt	VBG
10_1101-2020_12_31_424971	544	9	interactions	interaction	NNS
10_1101-2020_12_31_424971	544	10	between	between	IN
10_1101-2020_12_31_424971	544	11	1078	1078	CD
10_1101-2020_12_31_424971	544	12	decoding	decode	VBG
10_1101-2020_12_31_424971	544	13	center	center	NN
10_1101-2020_12_31_424971	544	14	and	and	CC
10_1101-2020_12_31_424971	544	15	codon	codon	NNP
10_1101-2020_12_31_424971	544	16	-	-	HYPH
10_1101-2020_12_31_424971	544	17	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	544	18	duplex	duplex	NNP
10_1101-2020_12_31_424971	544	19	.	.	.
10_1101-2020_12_31_424971	545	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	545	2	Struct	Struct	NNP
10_1101-2020_12_31_424971	545	3	Mol	Mol	NNP
10_1101-2020_12_31_424971	545	4	Biol	Biol	NNP
10_1101-2020_12_31_424971	545	5	21	21	CD
10_1101-2020_12_31_424971	545	6	,	,	,
10_1101-2020_12_31_424971	545	7	817	817	CD
10_1101-2020_12_31_424971	545	8	-	-	SYM
10_1101-2020_12_31_424971	545	9	24	24	CD
10_1101-2020_12_31_424971	545	10	(	(	-LRB-
10_1101-2020_12_31_424971	545	11	2014	2014	CD
10_1101-2020_12_31_424971	545	12	)	)	-RRB-
10_1101-2020_12_31_424971	545	13	.	.	.
10_1101-2020_12_31_424971	546	1	1079	1079	CD
10_1101-2020_12_31_424971	546	2	25	25	CD
10_1101-2020_12_31_424971	546	3	.	.	.
10_1101-2020_12_31_424971	547	1	Abeyrathne	Abeyrathne	NNP
10_1101-2020_12_31_424971	547	2	,	,	,
10_1101-2020_12_31_424971	547	3	P.D.	P.D.	NNP
10_1101-2020_12_31_424971	547	4	,	,	,
10_1101-2020_12_31_424971	547	5	Koh	Koh	NNP
10_1101-2020_12_31_424971	547	6	,	,	,
10_1101-2020_12_31_424971	547	7	C.S.	C.S.	NNP
10_1101-2020_12_31_424971	547	8	,	,	,
10_1101-2020_12_31_424971	547	9	Grant	Grant	NNP
10_1101-2020_12_31_424971	547	10	,	,	,
10_1101-2020_12_31_424971	547	11	T.	T.	NNP
10_1101-2020_12_31_424971	547	12	,	,	,
10_1101-2020_12_31_424971	547	13	Grigorieff	Grigorieff	NNP
10_1101-2020_12_31_424971	547	14	,	,	,
10_1101-2020_12_31_424971	547	15	N.	N.	NNP
10_1101-2020_12_31_424971	547	16	&	&	CC
10_1101-2020_12_31_424971	547	17	Korostelev	Korostelev	NNP
10_1101-2020_12_31_424971	547	18	,	,	,
10_1101-2020_12_31_424971	547	19	A.A.	A.A.	NNP
10_1101-2020_12_31_424971	547	20	Ensemble	ensemble	JJ
10_1101-2020_12_31_424971	547	21	cryo-1080	cryo-1080	VBP
10_1101-2020_12_31_424971	547	22	EM	em	NN
10_1101-2020_12_31_424971	547	23	uncovers	uncover	NNS
10_1101-2020_12_31_424971	547	24	inchworm	inchworm	NN
10_1101-2020_12_31_424971	547	25	-	-	HYPH
10_1101-2020_12_31_424971	547	26	like	like	JJ
10_1101-2020_12_31_424971	547	27	translocation	translocation	NN
10_1101-2020_12_31_424971	547	28	of	of	IN
10_1101-2020_12_31_424971	547	29	a	a	DT
10_1101-2020_12_31_424971	547	30	viral	viral	JJ
10_1101-2020_12_31_424971	547	31	IRES	ires	NN
10_1101-2020_12_31_424971	547	32	through	through	IN
10_1101-2020_12_31_424971	547	33	the	the	DT
10_1101-2020_12_31_424971	547	34	ribosome	ribosome	NN
10_1101-2020_12_31_424971	547	35	.	.	.
10_1101-2020_12_31_424971	548	1	Elife	elife	NN
10_1101-2020_12_31_424971	548	2	5	5	CD
10_1101-2020_12_31_424971	548	3	,	,	,
10_1101-2020_12_31_424971	548	4	1081	1081	CD
10_1101-2020_12_31_424971	548	5	doi	doi	XX
10_1101-2020_12_31_424971	548	6	:	:	:
10_1101-2020_12_31_424971	548	7	10.7554	10.7554	CD
10_1101-2020_12_31_424971	548	8	/	/	SYM
10_1101-2020_12_31_424971	548	9	eLife.14874	elife.14874	NN
10_1101-2020_12_31_424971	548	10	(	(	-LRB-
10_1101-2020_12_31_424971	548	11	2016	2016	CD
10_1101-2020_12_31_424971	548	12	)	)	-RRB-
10_1101-2020_12_31_424971	548	13	.	.	.
10_1101-2020_12_31_424971	549	1	1082	1082	CD
10_1101-2020_12_31_424971	549	2	26	26	CD
10_1101-2020_12_31_424971	549	3	.	.	.
10_1101-2020_12_31_424971	550	1	Schuwirth	Schuwirth	NNP
10_1101-2020_12_31_424971	550	2	,	,	,
10_1101-2020_12_31_424971	550	3	B.S.	B.S.	NNP
10_1101-2020_12_31_424971	551	1	et	et	NNP
10_1101-2020_12_31_424971	551	2	al	al	NNP
10_1101-2020_12_31_424971	551	3	.	.	.
10_1101-2020_12_31_424971	552	1	Structures	structure	NNS
10_1101-2020_12_31_424971	552	2	of	of	IN
10_1101-2020_12_31_424971	552	3	the	the	DT
10_1101-2020_12_31_424971	552	4	bacterial	bacterial	JJ
10_1101-2020_12_31_424971	552	5	ribosome	ribosome	NN
10_1101-2020_12_31_424971	552	6	at	at	IN
10_1101-2020_12_31_424971	552	7	3.5	3.5	CD
10_1101-2020_12_31_424971	552	8	A	a	DT
10_1101-2020_12_31_424971	552	9	resolution	resolution	NN
10_1101-2020_12_31_424971	552	10	.	.	.
10_1101-2020_12_31_424971	553	1	Science	science	NN
10_1101-2020_12_31_424971	553	2	1083	1083	CD
10_1101-2020_12_31_424971	553	3	310	310	CD
10_1101-2020_12_31_424971	553	4	,	,	,
10_1101-2020_12_31_424971	553	5	827	827	CD
10_1101-2020_12_31_424971	553	6	-	-	SYM
10_1101-2020_12_31_424971	553	7	34	34	CD
10_1101-2020_12_31_424971	553	8	(	(	-LRB-
10_1101-2020_12_31_424971	553	9	2005	2005	CD
10_1101-2020_12_31_424971	553	10	)	)	-RRB-
10_1101-2020_12_31_424971	553	11	.	.	.
10_1101-2020_12_31_424971	554	1	1084	1084	CD
10_1101-2020_12_31_424971	554	2	27	27	CD
10_1101-2020_12_31_424971	554	3	.	.	.
10_1101-2020_12_31_424971	555	1	Pulk	pulk	NN
10_1101-2020_12_31_424971	555	2	,	,	,
10_1101-2020_12_31_424971	555	3	A.	a.	NN
10_1101-2020_12_31_424971	556	1	&	&	CC
10_1101-2020_12_31_424971	556	2	Cate	Cate	NNP
10_1101-2020_12_31_424971	556	3	,	,	,
10_1101-2020_12_31_424971	556	4	J.H.	J.H.	NNP
10_1101-2020_12_31_424971	557	1	Control	control	NN
10_1101-2020_12_31_424971	557	2	of	of	IN
10_1101-2020_12_31_424971	557	3	ribosomal	ribosomal	NNP
10_1101-2020_12_31_424971	557	4	subunit	subunit	NN
10_1101-2020_12_31_424971	557	5	rotation	rotation	NN
10_1101-2020_12_31_424971	557	6	by	by	IN
10_1101-2020_12_31_424971	557	7	elongation	elongation	NN
10_1101-2020_12_31_424971	557	8	factor	factor	NN
10_1101-2020_12_31_424971	557	9	G.	G.	NNP
10_1101-2020_12_31_424971	557	10	1085	1085	CD
10_1101-2020_12_31_424971	557	11	Science	Science	NNP
10_1101-2020_12_31_424971	557	12	340	340	CD
10_1101-2020_12_31_424971	557	13	,	,	,
10_1101-2020_12_31_424971	557	14	1235970	1235970	CD
10_1101-2020_12_31_424971	557	15	(	(	-LRB-
10_1101-2020_12_31_424971	557	16	2013	2013	CD
10_1101-2020_12_31_424971	557	17	)	)	-RRB-
10_1101-2020_12_31_424971	557	18	.	.	.
10_1101-2020_12_31_424971	558	1	1086	1086	CD
10_1101-2020_12_31_424971	558	2	28	28	CD
10_1101-2020_12_31_424971	558	3	.	.	.
10_1101-2020_12_31_424971	559	1	Ratje	Ratje	NNP
10_1101-2020_12_31_424971	559	2	,	,	,
10_1101-2020_12_31_424971	559	3	A.H.	A.H.	NNP
10_1101-2020_12_31_424971	559	4	et	et	NNP
10_1101-2020_12_31_424971	559	5	al	al	NNP
10_1101-2020_12_31_424971	559	6	.	.	.
10_1101-2020_12_31_424971	560	1	Head	Head	NNP
10_1101-2020_12_31_424971	560	2	swivel	swivel	NN
10_1101-2020_12_31_424971	560	3	on	on	IN
10_1101-2020_12_31_424971	560	4	the	the	DT
10_1101-2020_12_31_424971	560	5	ribosome	ribosome	JJ
10_1101-2020_12_31_424971	560	6	facilitates	facilitate	NNS
10_1101-2020_12_31_424971	560	7	translocation	translocation	NN
10_1101-2020_12_31_424971	560	8	by	by	IN
10_1101-2020_12_31_424971	560	9	means	mean	NNS
10_1101-2020_12_31_424971	560	10	of	of	IN
10_1101-2020_12_31_424971	560	11	intra-1087	intra-1087	NNP
10_1101-2020_12_31_424971	560	12	subunit	subunit	NN
10_1101-2020_12_31_424971	560	13	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	560	14	hybrid	hybrid	JJ
10_1101-2020_12_31_424971	560	15	sites	site	NNS
10_1101-2020_12_31_424971	560	16	.	.	.
10_1101-2020_12_31_424971	561	1	Nature	nature	NN
10_1101-2020_12_31_424971	561	2	468	468	CD
10_1101-2020_12_31_424971	561	3	,	,	,
10_1101-2020_12_31_424971	561	4	713	713	CD
10_1101-2020_12_31_424971	561	5	-	-	SYM
10_1101-2020_12_31_424971	561	6	6	6	CD
10_1101-2020_12_31_424971	561	7	(	(	-LRB-
10_1101-2020_12_31_424971	561	8	2010	2010	CD
10_1101-2020_12_31_424971	561	9	)	)	-RRB-
10_1101-2020_12_31_424971	561	10	.	.	.
10_1101-2020_12_31_424971	562	1	1088	1088	CD
10_1101-2020_12_31_424971	562	2	29	29	CD
10_1101-2020_12_31_424971	562	3	.	.	.
10_1101-2020_12_31_424971	563	1	Gamper	Gamper	NNP
10_1101-2020_12_31_424971	563	2	,	,	,
10_1101-2020_12_31_424971	563	3	H.B.	H.B.	NNP
10_1101-2020_12_31_424971	563	4	,	,	,
10_1101-2020_12_31_424971	563	5	Masuda	Masuda	NNP
10_1101-2020_12_31_424971	563	6	,	,	,
10_1101-2020_12_31_424971	563	7	I.	I.	NNP
10_1101-2020_12_31_424971	563	8	,	,	,
10_1101-2020_12_31_424971	563	9	Frenkel	Frenkel	NNP
10_1101-2020_12_31_424971	563	10	-	-	HYPH
10_1101-2020_12_31_424971	563	11	Morgenstern	Morgenstern	NNP
10_1101-2020_12_31_424971	563	12	,	,	,
10_1101-2020_12_31_424971	563	13	M.	M.	NNP
10_1101-2020_12_31_424971	563	14	&	&	CC
10_1101-2020_12_31_424971	563	15	Hou	Hou	NNP
10_1101-2020_12_31_424971	563	16	,	,	,
10_1101-2020_12_31_424971	563	17	Y.M.	Y.M.	NNP
10_1101-2020_12_31_424971	564	1	Maintenance	maintenance	NN
10_1101-2020_12_31_424971	564	2	of	of	IN
10_1101-2020_12_31_424971	564	3	protein	protein	NN
10_1101-2020_12_31_424971	564	4	1089	1089	CD
10_1101-2020_12_31_424971	564	5	synthesis	synthesis	NN
10_1101-2020_12_31_424971	564	6	reading	reading	NN
10_1101-2020_12_31_424971	564	7	frame	frame	NN
10_1101-2020_12_31_424971	564	8	by	by	IN
10_1101-2020_12_31_424971	564	9	EF	EF	NNP
10_1101-2020_12_31_424971	564	10	-	-	HYPH
10_1101-2020_12_31_424971	564	11	P	P	NNP
10_1101-2020_12_31_424971	564	12	and	and	CC
10_1101-2020_12_31_424971	564	13	m(1)G37-tRNA	m(1)G37-tRNA	NNP
10_1101-2020_12_31_424971	564	14	.	.	.
10_1101-2020_12_31_424971	565	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	565	2	Commun	Commun	NNP
10_1101-2020_12_31_424971	565	3	6	6	CD
10_1101-2020_12_31_424971	565	4	,	,	,
10_1101-2020_12_31_424971	565	5	7226	7226	CD
10_1101-2020_12_31_424971	565	6	(	(	-LRB-
10_1101-2020_12_31_424971	565	7	2015	2015	CD
10_1101-2020_12_31_424971	565	8	)	)	-RRB-
10_1101-2020_12_31_424971	565	9	.	.	.
10_1101-2020_12_31_424971	566	1	1090	1090	CD
10_1101-2020_12_31_424971	566	2	30	30	CD
10_1101-2020_12_31_424971	566	3	.	.	.
10_1101-2020_12_31_424971	567	1	Masuda	Masuda	NNP
10_1101-2020_12_31_424971	567	2	,	,	,
10_1101-2020_12_31_424971	567	3	I.	I.	NNP
10_1101-2020_12_31_424971	567	4	et	et	NNP
10_1101-2020_12_31_424971	567	5	al	al	NNP
10_1101-2020_12_31_424971	567	6	.	.	.
10_1101-2020_12_31_424971	568	1	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	568	2	Methylation	methylation	NN
10_1101-2020_12_31_424971	568	3	Is	be	VBZ
10_1101-2020_12_31_424971	568	4	a	a	DT
10_1101-2020_12_31_424971	568	5	Global	Global	NNP
10_1101-2020_12_31_424971	568	6	Determinant	Determinant	NNP
10_1101-2020_12_31_424971	568	7	of	of	IN
10_1101-2020_12_31_424971	568	8	Bacterial	Bacterial	NNP
10_1101-2020_12_31_424971	568	9	Multi	Multi	NNP
10_1101-2020_12_31_424971	568	10	-	-	JJ
10_1101-2020_12_31_424971	568	11	drug	drug	NNP
10_1101-2020_12_31_424971	568	12	1091	1091	CD
10_1101-2020_12_31_424971	568	13	Resistance	Resistance	NNP
10_1101-2020_12_31_424971	568	14	.	.	.
10_1101-2020_12_31_424971	569	1	Cell	Cell	NNP
10_1101-2020_12_31_424971	569	2	Syst	Syst	NNP
10_1101-2020_12_31_424971	569	3	8	8	CD
10_1101-2020_12_31_424971	569	4	,	,	,
10_1101-2020_12_31_424971	569	5	302	302	CD
10_1101-2020_12_31_424971	569	6	-	-	HYPH
10_1101-2020_12_31_424971	569	7	314	314	CD
10_1101-2020_12_31_424971	569	8	e8	e8	NNS
10_1101-2020_12_31_424971	569	9	(	(	-LRB-
10_1101-2020_12_31_424971	569	10	2019	2019	CD
10_1101-2020_12_31_424971	569	11	)	)	-RRB-
10_1101-2020_12_31_424971	569	12	.	.	.
10_1101-2020_12_31_424971	570	1	1092	1092	CD
10_1101-2020_12_31_424971	570	2	31	31	CD
10_1101-2020_12_31_424971	570	3	.	.	.
10_1101-2020_12_31_424971	571	1	Christian	Christian	NNP
10_1101-2020_12_31_424971	571	2	,	,	,
10_1101-2020_12_31_424971	571	3	T.	T.	NNP
10_1101-2020_12_31_424971	571	4	&	&	CC
10_1101-2020_12_31_424971	571	5	Hou	Hou	NNP
10_1101-2020_12_31_424971	571	6	,	,	,
10_1101-2020_12_31_424971	571	7	Y.M.	Y.M.	NNP
10_1101-2020_12_31_424971	572	1	Distinct	distinct	JJ
10_1101-2020_12_31_424971	572	2	determinants	determinant	NNS
10_1101-2020_12_31_424971	572	3	of	of	IN
10_1101-2020_12_31_424971	572	4	tRNA	trna	NN
10_1101-2020_12_31_424971	572	5	recognition	recognition	NN
10_1101-2020_12_31_424971	572	6	by	by	IN
10_1101-2020_12_31_424971	572	7	the	the	DT
10_1101-2020_12_31_424971	572	8	TrmD	TrmD	NNP
10_1101-2020_12_31_424971	572	9	and	and	CC
10_1101-2020_12_31_424971	572	10	1093	1093	CD
10_1101-2020_12_31_424971	572	11	Trm5	Trm5	NNP
10_1101-2020_12_31_424971	572	12	methyl	methyl	NN
10_1101-2020_12_31_424971	572	13	transferases	transferase	VBZ
10_1101-2020_12_31_424971	572	14	.	.	.
10_1101-2020_12_31_424971	573	1	J	J	NNP
10_1101-2020_12_31_424971	573	2	Mol	Mol	NNP
10_1101-2020_12_31_424971	573	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	573	4	373	373	CD
10_1101-2020_12_31_424971	573	5	,	,	,
10_1101-2020_12_31_424971	573	6	623	623	CD
10_1101-2020_12_31_424971	573	7	-	-	SYM
10_1101-2020_12_31_424971	573	8	32	32	CD
10_1101-2020_12_31_424971	573	9	(	(	-LRB-
10_1101-2020_12_31_424971	573	10	2007	2007	CD
10_1101-2020_12_31_424971	573	11	)	)	-RRB-
10_1101-2020_12_31_424971	573	12	.	.	.
10_1101-2020_12_31_424971	574	1	1094	1094	CD
10_1101-2020_12_31_424971	574	2	32	32	CD
10_1101-2020_12_31_424971	574	3	.	.	.
10_1101-2020_12_31_424971	575	1	Murakami	Murakami	NNP
10_1101-2020_12_31_424971	575	2	,	,	,
10_1101-2020_12_31_424971	575	3	H.	H.	NNP
10_1101-2020_12_31_424971	575	4	,	,	,
10_1101-2020_12_31_424971	575	5	Ohta	Ohta	NNP
10_1101-2020_12_31_424971	575	6	,	,	,
10_1101-2020_12_31_424971	575	7	A.	A.	NNP
10_1101-2020_12_31_424971	575	8	,	,	,
10_1101-2020_12_31_424971	575	9	Ashigai	Ashigai	NNP
10_1101-2020_12_31_424971	575	10	,	,	,
10_1101-2020_12_31_424971	575	11	H.	H.	NNP
10_1101-2020_12_31_424971	575	12	&	&	CC
10_1101-2020_12_31_424971	575	13	Suga	Suga	NNP
10_1101-2020_12_31_424971	575	14	,	,	,
10_1101-2020_12_31_424971	575	15	H.	H.	NNP
10_1101-2020_12_31_424971	575	16	A	a	DT
10_1101-2020_12_31_424971	575	17	highly	highly	RB
10_1101-2020_12_31_424971	575	18	flexible	flexible	JJ
10_1101-2020_12_31_424971	575	19	tRNA	trna	NN
10_1101-2020_12_31_424971	575	20	acylation	acylation	NN
10_1101-2020_12_31_424971	575	21	method	method	NN
10_1101-2020_12_31_424971	575	22	1095	1095	CD
10_1101-2020_12_31_424971	575	23	for	for	IN
10_1101-2020_12_31_424971	575	24	non	non	JJ
10_1101-2020_12_31_424971	575	25	-	-	JJ
10_1101-2020_12_31_424971	575	26	natural	natural	JJ
10_1101-2020_12_31_424971	575	27	polypeptide	polypeptide	NN
10_1101-2020_12_31_424971	575	28	synthesis	synthesis	NN
10_1101-2020_12_31_424971	575	29	.	.	.
10_1101-2020_12_31_424971	576	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	576	2	Methods	Methods	NNP
10_1101-2020_12_31_424971	576	3	3	3	CD
10_1101-2020_12_31_424971	576	4	,	,	,
10_1101-2020_12_31_424971	576	5	357	357	CD
10_1101-2020_12_31_424971	576	6	-	-	SYM
10_1101-2020_12_31_424971	576	7	9	9	CD
10_1101-2020_12_31_424971	576	8	(	(	-LRB-
10_1101-2020_12_31_424971	576	9	2006	2006	CD
10_1101-2020_12_31_424971	576	10	)	)	-RRB-
10_1101-2020_12_31_424971	576	11	.	.	.
10_1101-2020_12_31_424971	577	1	1096	1096	CD
10_1101-2020_12_31_424971	577	2	33	33	CD
10_1101-2020_12_31_424971	577	3	.	.	.
10_1101-2020_12_31_424971	578	1	Walker	Walker	NNP
10_1101-2020_12_31_424971	578	2	,	,	,
10_1101-2020_12_31_424971	578	3	S.E.	S.E.	NNP
10_1101-2020_12_31_424971	579	1	&	&	CC
10_1101-2020_12_31_424971	579	2	Fredrick	Fredrick	NNP
10_1101-2020_12_31_424971	579	3	,	,	,
10_1101-2020_12_31_424971	579	4	K.	K.	NNP
10_1101-2020_12_31_424971	579	5	Recognition	Recognition	NNP
10_1101-2020_12_31_424971	579	6	and	and	CC
10_1101-2020_12_31_424971	579	7	positioning	positioning	NN
10_1101-2020_12_31_424971	579	8	of	of	IN
10_1101-2020_12_31_424971	579	9	mRNA	mRNA	NNS
10_1101-2020_12_31_424971	579	10	in	in	IN
10_1101-2020_12_31_424971	579	11	the	the	DT
10_1101-2020_12_31_424971	579	12	ribosome	ribosome	NN
10_1101-2020_12_31_424971	579	13	by	by	IN
10_1101-2020_12_31_424971	579	14	1097	1097	CD
10_1101-2020_12_31_424971	579	15	tRNAs	trnas	CD
10_1101-2020_12_31_424971	579	16	with	with	IN
10_1101-2020_12_31_424971	579	17	expanded	expand	VBN
10_1101-2020_12_31_424971	579	18	anticodons	anticodon	NNS
10_1101-2020_12_31_424971	579	19	.	.	.
10_1101-2020_12_31_424971	580	1	J	J	NNP
10_1101-2020_12_31_424971	580	2	Mol	Mol	NNP
10_1101-2020_12_31_424971	580	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	580	4	360	360	CD
10_1101-2020_12_31_424971	580	5	,	,	,
10_1101-2020_12_31_424971	580	6	599	599	CD
10_1101-2020_12_31_424971	580	7	-	-	SYM
10_1101-2020_12_31_424971	580	8	609	609	CD
10_1101-2020_12_31_424971	580	9	(	(	-LRB-
10_1101-2020_12_31_424971	580	10	2006	2006	CD
10_1101-2020_12_31_424971	580	11	)	)	-RRB-
10_1101-2020_12_31_424971	580	12	.	.	.
10_1101-2020_12_31_424971	581	1	1098	1098	CD
10_1101-2020_12_31_424971	581	2	34	34	CD
10_1101-2020_12_31_424971	581	3	.	.	.
10_1101-2020_12_31_424971	582	1	Gamper	Gamper	NNP
10_1101-2020_12_31_424971	582	2	,	,	,
10_1101-2020_12_31_424971	582	3	H.B.	H.B.	NNP
10_1101-2020_12_31_424971	582	4	,	,	,
10_1101-2020_12_31_424971	582	5	Masuda	Masuda	NNP
10_1101-2020_12_31_424971	582	6	,	,	,
10_1101-2020_12_31_424971	582	7	I.	I.	NNP
10_1101-2020_12_31_424971	582	8	,	,	,
10_1101-2020_12_31_424971	582	9	Frenkel	Frenkel	NNP
10_1101-2020_12_31_424971	582	10	-	-	HYPH
10_1101-2020_12_31_424971	582	11	Morgenstern	Morgenstern	NNP
10_1101-2020_12_31_424971	582	12	,	,	,
10_1101-2020_12_31_424971	582	13	M.	M.	NNP
10_1101-2020_12_31_424971	582	14	&	&	CC
10_1101-2020_12_31_424971	582	15	Hou	Hou	NNP
10_1101-2020_12_31_424971	582	16	,	,	,
10_1101-2020_12_31_424971	582	17	Y.M.	Y.M.	NNP
10_1101-2020_12_31_424971	583	1	The	the	DT
10_1101-2020_12_31_424971	583	2	UGG	UGG	NNP
10_1101-2020_12_31_424971	583	3	Isoacceptor	Isoacceptor	NNP
10_1101-2020_12_31_424971	583	4	1099	1099	CD
10_1101-2020_12_31_424971	583	5	of	of	IN
10_1101-2020_12_31_424971	583	6	tRNAPro	tRNAPro	NNP
10_1101-2020_12_31_424971	583	7	Is	be	VBZ
10_1101-2020_12_31_424971	583	8	Naturally	naturally	RB
10_1101-2020_12_31_424971	583	9	Prone	prone	JJ
10_1101-2020_12_31_424971	583	10	to	to	IN
10_1101-2020_12_31_424971	583	11	Frameshifts	Frameshifts	NNP
10_1101-2020_12_31_424971	583	12	.	.	.
10_1101-2020_12_31_424971	584	1	Int	Int	NNP
10_1101-2020_12_31_424971	584	2	J	J	NNP
10_1101-2020_12_31_424971	584	3	Mol	Mol	NNP
10_1101-2020_12_31_424971	584	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	584	5	16	16	CD
10_1101-2020_12_31_424971	584	6	,	,	,
10_1101-2020_12_31_424971	584	7	14866	14866	CD
10_1101-2020_12_31_424971	584	8	-	-	SYM
10_1101-2020_12_31_424971	584	9	83	83	CD
10_1101-2020_12_31_424971	584	10	(	(	-LRB-
10_1101-2020_12_31_424971	584	11	2015	2015	CD
10_1101-2020_12_31_424971	584	12	)	)	-RRB-
10_1101-2020_12_31_424971	584	13	.	.	.
10_1101-2020_12_31_424971	585	1	1100	1100	CD
10_1101-2020_12_31_424971	585	2	35	35	CD
10_1101-2020_12_31_424971	585	3	.	.	.
10_1101-2020_12_31_424971	586	1	Fei	Fei	NNP
10_1101-2020_12_31_424971	586	2	,	,	,
10_1101-2020_12_31_424971	586	3	J.	J.	NNP
10_1101-2020_12_31_424971	586	4	et	et	NNP
10_1101-2020_12_31_424971	586	5	al	al	NNP
10_1101-2020_12_31_424971	586	6	.	.	.
10_1101-2020_12_31_424971	587	1	Allosteric	allosteric	JJ
10_1101-2020_12_31_424971	587	2	collaboration	collaboration	NN
10_1101-2020_12_31_424971	587	3	between	between	IN
10_1101-2020_12_31_424971	587	4	elongation	elongation	NN
10_1101-2020_12_31_424971	587	5	factor	factor	NN
10_1101-2020_12_31_424971	587	6	G	g	NN
10_1101-2020_12_31_424971	587	7	and	and	CC
10_1101-2020_12_31_424971	587	8	the	the	DT
10_1101-2020_12_31_424971	587	9	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	587	10	L1	L1	NNP
10_1101-2020_12_31_424971	587	11	1101	1101	CD
10_1101-2020_12_31_424971	587	12	stalk	stalk	NN
10_1101-2020_12_31_424971	587	13	directs	direct	VBZ
10_1101-2020_12_31_424971	587	14	tRNA	trna	JJ
10_1101-2020_12_31_424971	587	15	movements	movement	NNS
10_1101-2020_12_31_424971	587	16	during	during	IN
10_1101-2020_12_31_424971	587	17	translation	translation	NN
10_1101-2020_12_31_424971	587	18	.	.	.
10_1101-2020_12_31_424971	588	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	588	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	588	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	588	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	588	5	U	U	NNP
10_1101-2020_12_31_424971	588	6	S	S	NNP
10_1101-2020_12_31_424971	588	7	A	A	NNP
10_1101-2020_12_31_424971	588	8	106	106	CD
10_1101-2020_12_31_424971	588	9	,	,	,
10_1101-2020_12_31_424971	588	10	15702	15702	CD
10_1101-2020_12_31_424971	588	11	-	-	SYM
10_1101-2020_12_31_424971	588	12	1102	1102	CD
10_1101-2020_12_31_424971	588	13	7	7	CD
10_1101-2020_12_31_424971	588	14	(	(	-LRB-
10_1101-2020_12_31_424971	588	15	2009	2009	CD
10_1101-2020_12_31_424971	588	16	)	)	-RRB-
10_1101-2020_12_31_424971	588	17	.	.	.
10_1101-2020_12_31_424971	589	1	1103	1103	CD
10_1101-2020_12_31_424971	589	2	36	36	CD
10_1101-2020_12_31_424971	589	3	.	.	.
10_1101-2020_12_31_424971	590	1	Ning	Ning	NNP
10_1101-2020_12_31_424971	590	2	,	,	,
10_1101-2020_12_31_424971	590	3	W.	W.	NNP
10_1101-2020_12_31_424971	590	4	,	,	,
10_1101-2020_12_31_424971	590	5	Fei	Fei	NNP
10_1101-2020_12_31_424971	590	6	,	,	,
10_1101-2020_12_31_424971	590	7	J.	J.	NNP
10_1101-2020_12_31_424971	591	1	&	&	CC
10_1101-2020_12_31_424971	591	2	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	591	3	,	,	,
10_1101-2020_12_31_424971	591	4	R.L.	R.L.	NNP
10_1101-2020_12_31_424971	591	5	,	,	,
10_1101-2020_12_31_424971	591	6	Jr.	Jr.	NNP
10_1101-2020_12_31_424971	592	1	The	the	DT
10_1101-2020_12_31_424971	592	2	ribosome	ribosome	NN
10_1101-2020_12_31_424971	592	3	uses	use	VBZ
10_1101-2020_12_31_424971	592	4	cooperative	cooperative	JJ
10_1101-2020_12_31_424971	592	5	conformational	conformational	JJ
10_1101-2020_12_31_424971	592	6	1104	1104	CD
10_1101-2020_12_31_424971	592	7	changes	change	NNS
10_1101-2020_12_31_424971	592	8	to	to	TO
10_1101-2020_12_31_424971	592	9	maximize	maximize	VB
10_1101-2020_12_31_424971	592	10	and	and	CC
10_1101-2020_12_31_424971	592	11	regulate	regulate	VB
10_1101-2020_12_31_424971	592	12	the	the	DT
10_1101-2020_12_31_424971	592	13	efficiency	efficiency	NN
10_1101-2020_12_31_424971	592	14	of	of	IN
10_1101-2020_12_31_424971	592	15	translation	translation	NN
10_1101-2020_12_31_424971	592	16	.	.	.
10_1101-2020_12_31_424971	593	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	593	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	593	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	593	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	593	5	U	U	NNP
10_1101-2020_12_31_424971	593	6	S	S	NNP
10_1101-2020_12_31_424971	593	7	A	A	NNP
10_1101-2020_12_31_424971	593	8	1105	1105	CD
10_1101-2020_12_31_424971	593	9	111	111	CD
10_1101-2020_12_31_424971	593	10	,	,	,
10_1101-2020_12_31_424971	593	11	12073	12073	CD
10_1101-2020_12_31_424971	593	12	-	-	SYM
10_1101-2020_12_31_424971	593	13	8	8	CD
10_1101-2020_12_31_424971	593	14	(	(	-LRB-
10_1101-2020_12_31_424971	593	15	2014	2014	CD
10_1101-2020_12_31_424971	593	16	)	)	-RRB-
10_1101-2020_12_31_424971	593	17	.	.	.
10_1101-2020_12_31_424971	594	1	1106	1106	CD
10_1101-2020_12_31_424971	594	2	37	37	CD
10_1101-2020_12_31_424971	594	3	.	.	.
10_1101-2020_12_31_424971	595	1	Fei	Fei	NNP
10_1101-2020_12_31_424971	595	2	,	,	,
10_1101-2020_12_31_424971	595	3	J.	J.	NNP
10_1101-2020_12_31_424971	595	4	,	,	,
10_1101-2020_12_31_424971	595	5	Kosuri	Kosuri	NNP
10_1101-2020_12_31_424971	595	6	,	,	,
10_1101-2020_12_31_424971	595	7	P.	P.	NNP
10_1101-2020_12_31_424971	595	8	,	,	,
10_1101-2020_12_31_424971	595	9	MacDougall	MacDougall	NNP
10_1101-2020_12_31_424971	595	10	,	,	,
10_1101-2020_12_31_424971	595	11	D.D.	D.D.	NNP
10_1101-2020_12_31_424971	596	1	&	&	CC
10_1101-2020_12_31_424971	596	2	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	596	3	,	,	,
10_1101-2020_12_31_424971	596	4	R.L.	R.L.	NNP
10_1101-2020_12_31_424971	596	5	,	,	,
10_1101-2020_12_31_424971	596	6	Jr.	Jr.	NNP
10_1101-2020_12_31_424971	596	7	Coupling	Coupling	NNP
10_1101-2020_12_31_424971	596	8	of	of	IN
10_1101-2020_12_31_424971	596	9	ribosomal	ribosomal	NNP
10_1101-2020_12_31_424971	596	10	L1	L1	NNP
10_1101-2020_12_31_424971	596	11	stalk	stalk	NNP
10_1101-2020_12_31_424971	596	12	1107	1107	CD
10_1101-2020_12_31_424971	596	13	and	and	CC
10_1101-2020_12_31_424971	596	14	tRNA	trna	JJ
10_1101-2020_12_31_424971	596	15	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	596	16	during	during	IN
10_1101-2020_12_31_424971	596	17	translation	translation	NN
10_1101-2020_12_31_424971	596	18	elongation	elongation	NN
10_1101-2020_12_31_424971	596	19	.	.	.
10_1101-2020_12_31_424971	597	1	Mol	Mol	NNP
10_1101-2020_12_31_424971	597	2	Cell	Cell	NNP
10_1101-2020_12_31_424971	597	3	30	30	CD
10_1101-2020_12_31_424971	597	4	,	,	,
10_1101-2020_12_31_424971	597	5	348	348	CD
10_1101-2020_12_31_424971	597	6	-	-	HYPH
10_1101-2020_12_31_424971	597	7	59	59	CD
10_1101-2020_12_31_424971	597	8	(	(	-LRB-
10_1101-2020_12_31_424971	597	9	2008	2008	CD
10_1101-2020_12_31_424971	597	10	)	)	-RRB-
10_1101-2020_12_31_424971	597	11	.	.	.
10_1101-2020_12_31_424971	598	1	1108	1108	CD
10_1101-2020_12_31_424971	598	2	38	38	CD
10_1101-2020_12_31_424971	598	3	.	.	.
10_1101-2020_12_31_424971	599	1	Fei	Fei	NNP
10_1101-2020_12_31_424971	599	2	,	,	,
10_1101-2020_12_31_424971	599	3	J.	J.	NNP
10_1101-2020_12_31_424971	599	4	,	,	,
10_1101-2020_12_31_424971	599	5	Richard	Richard	NNP
10_1101-2020_12_31_424971	599	6	,	,	,
10_1101-2020_12_31_424971	599	7	A.C.	A.C.	NNP
10_1101-2020_12_31_424971	599	8	,	,	,
10_1101-2020_12_31_424971	599	9	Bronson	Bronson	NNP
10_1101-2020_12_31_424971	599	10	,	,	,
10_1101-2020_12_31_424971	599	11	J.E.	J.E.	NNP
10_1101-2020_12_31_424971	600	1	&	&	CC
10_1101-2020_12_31_424971	600	2	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	600	3	,	,	,
10_1101-2020_12_31_424971	600	4	R.L.	R.L.	NNP
10_1101-2020_12_31_424971	600	5	,	,	,
10_1101-2020_12_31_424971	600	6	Jr.	Jr.	NNP
10_1101-2020_12_31_424971	601	1	Transfer	Transfer	NNP
10_1101-2020_12_31_424971	601	2	RNA	RNA	NNP
10_1101-2020_12_31_424971	601	3	-	-	HYPH
10_1101-2020_12_31_424971	601	4	mediated	mediate	VBN
10_1101-2020_12_31_424971	601	5	1109	1109	CD
10_1101-2020_12_31_424971	601	6	regulation	regulation	NN
10_1101-2020_12_31_424971	601	7	of	of	IN
10_1101-2020_12_31_424971	601	8	ribosome	ribosome	JJ
10_1101-2020_12_31_424971	601	9	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	601	10	during	during	IN
10_1101-2020_12_31_424971	601	11	protein	protein	NN
10_1101-2020_12_31_424971	601	12	synthesis	synthesis	NN
10_1101-2020_12_31_424971	601	13	.	.	.
10_1101-2020_12_31_424971	602	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	602	2	Struct	Struct	NNP
10_1101-2020_12_31_424971	602	3	Mol	Mol	NNP
10_1101-2020_12_31_424971	602	4	Biol	Biol	NNP
10_1101-2020_12_31_424971	602	5	18	18	CD
10_1101-2020_12_31_424971	602	6	,	,	,
10_1101-2020_12_31_424971	602	7	1043	1043	CD
10_1101-2020_12_31_424971	602	8	-	-	SYM
10_1101-2020_12_31_424971	602	9	1110	1110	CD
10_1101-2020_12_31_424971	602	10	51	51	CD
10_1101-2020_12_31_424971	602	11	(	(	-LRB-
10_1101-2020_12_31_424971	602	12	2011	2011	CD
10_1101-2020_12_31_424971	602	13	)	)	-RRB-
10_1101-2020_12_31_424971	602	14	.	.	.
10_1101-2020_12_31_424971	603	1	1111	1111	CD
10_1101-2020_12_31_424971	603	2	39	39	CD
10_1101-2020_12_31_424971	603	3	.	.	.
10_1101-2020_12_31_424971	604	1	Boel	Boel	NNP
10_1101-2020_12_31_424971	604	2	,	,	,
10_1101-2020_12_31_424971	604	3	G.	G.	NNP
10_1101-2020_12_31_424971	604	4	et	et	NNP
10_1101-2020_12_31_424971	604	5	al	al	NNP
10_1101-2020_12_31_424971	604	6	.	.	.
10_1101-2020_12_31_424971	605	1	The	the	DT
10_1101-2020_12_31_424971	605	2	ABC	ABC	NNP
10_1101-2020_12_31_424971	605	3	-	-	HYPH
10_1101-2020_12_31_424971	605	4	F	F	NNP
10_1101-2020_12_31_424971	605	5	protein	protein	NN
10_1101-2020_12_31_424971	605	6	EttA	EttA	NNP
10_1101-2020_12_31_424971	605	7	gates	gate	NNS
10_1101-2020_12_31_424971	605	8	ribosome	ribosome	VBD
10_1101-2020_12_31_424971	605	9	entry	entry	NN
10_1101-2020_12_31_424971	605	10	into	into	IN
10_1101-2020_12_31_424971	605	11	the	the	DT
10_1101-2020_12_31_424971	605	12	translation	translation	NN
10_1101-2020_12_31_424971	605	13	1112	1112	CD
10_1101-2020_12_31_424971	605	14	elongation	elongation	NN
10_1101-2020_12_31_424971	605	15	cycle	cycle	NN
10_1101-2020_12_31_424971	605	16	.	.	.
10_1101-2020_12_31_424971	606	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	606	2	Struct	Struct	NNP
10_1101-2020_12_31_424971	606	3	Mol	Mol	NNP
10_1101-2020_12_31_424971	606	4	Biol	Biol	NNP
10_1101-2020_12_31_424971	606	5	21	21	CD
10_1101-2020_12_31_424971	606	6	,	,	,
10_1101-2020_12_31_424971	606	7	143	143	CD
10_1101-2020_12_31_424971	606	8	-	-	SYM
10_1101-2020_12_31_424971	606	9	51	51	CD
10_1101-2020_12_31_424971	606	10	(	(	-LRB-
10_1101-2020_12_31_424971	606	11	2014	2014	CD
10_1101-2020_12_31_424971	606	12	)	)	-RRB-
10_1101-2020_12_31_424971	606	13	.	.	.
10_1101-2020_12_31_424971	607	1	1113	1113	CD
10_1101-2020_12_31_424971	607	2	40	40	CD
10_1101-2020_12_31_424971	607	3	.	.	.
10_1101-2020_12_31_424971	608	1	Chen	Chen	NNP
10_1101-2020_12_31_424971	608	2	,	,	,
10_1101-2020_12_31_424971	608	3	B.	B.	NNP
10_1101-2020_12_31_424971	608	4	et	et	NNP
10_1101-2020_12_31_424971	608	5	al	al	NNP
10_1101-2020_12_31_424971	608	6	.	.	.
10_1101-2020_12_31_424971	609	1	EttA	EttA	NNP
10_1101-2020_12_31_424971	609	2	regulates	regulate	VBZ
10_1101-2020_12_31_424971	609	3	translation	translation	NN
10_1101-2020_12_31_424971	609	4	by	by	IN
10_1101-2020_12_31_424971	609	5	binding	bind	VBG
10_1101-2020_12_31_424971	609	6	the	the	DT
10_1101-2020_12_31_424971	609	7	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	609	8	E	e	NN
10_1101-2020_12_31_424971	609	9	site	site	NN
10_1101-2020_12_31_424971	609	10	and	and	CC
10_1101-2020_12_31_424971	609	11	restricting	restrict	VBG
10_1101-2020_12_31_424971	609	12	1114	1114	CD
10_1101-2020_12_31_424971	609	13	ribosome	ribosome	NN
10_1101-2020_12_31_424971	609	14	-	-	HYPH
10_1101-2020_12_31_424971	609	15	tRNA	trna	NN
10_1101-2020_12_31_424971	609	16	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	609	17	.	.	.
10_1101-2020_12_31_424971	610	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	610	2	Struct	Struct	NNP
10_1101-2020_12_31_424971	610	3	Mol	Mol	NNP
10_1101-2020_12_31_424971	610	4	Biol	Biol	NNP
10_1101-2020_12_31_424971	610	5	21	21	CD
10_1101-2020_12_31_424971	610	6	,	,	,
10_1101-2020_12_31_424971	610	7	152	152	CD
10_1101-2020_12_31_424971	610	8	-	-	SYM
10_1101-2020_12_31_424971	610	9	9	9	CD
10_1101-2020_12_31_424971	610	10	(	(	-LRB-
10_1101-2020_12_31_424971	610	11	2014	2014	CD
10_1101-2020_12_31_424971	610	12	)	)	-RRB-
10_1101-2020_12_31_424971	610	13	.	.	.
10_1101-2020_12_31_424971	611	1	1115	1115	CD
10_1101-2020_12_31_424971	611	2	41	41	CD
10_1101-2020_12_31_424971	611	3	.	.	.
10_1101-2020_12_31_424971	612	1	Kim	Kim	NNP
10_1101-2020_12_31_424971	612	2	,	,	,
10_1101-2020_12_31_424971	612	3	H.K.	H.K.	NNP
10_1101-2020_12_31_424971	613	1	et	et	NNP
10_1101-2020_12_31_424971	613	2	al	al	NNP
10_1101-2020_12_31_424971	613	3	.	.	.
10_1101-2020_12_31_424971	614	1	A	a	DT
10_1101-2020_12_31_424971	614	2	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	614	3	stimulatory	stimulatory	JJ
10_1101-2020_12_31_424971	614	4	stem	stem	NN
10_1101-2020_12_31_424971	614	5	loop	loop	NN
10_1101-2020_12_31_424971	614	6	destabilizes	destabilize	VBZ
10_1101-2020_12_31_424971	614	7	the	the	DT
10_1101-2020_12_31_424971	614	8	hybrid	hybrid	JJ
10_1101-2020_12_31_424971	614	9	state	state	NN
10_1101-2020_12_31_424971	614	10	and	and	CC
10_1101-2020_12_31_424971	614	11	1116	1116	CD
10_1101-2020_12_31_424971	614	12	impedes	impede	NNS
10_1101-2020_12_31_424971	614	13	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	614	14	translocation	translocation	NN
10_1101-2020_12_31_424971	614	15	.	.	.
10_1101-2020_12_31_424971	615	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	615	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	615	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	615	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	615	5	U	U	NNP
10_1101-2020_12_31_424971	615	6	S	S	NNP
10_1101-2020_12_31_424971	615	7	A	A	NNP
10_1101-2020_12_31_424971	615	8	111	111	CD
10_1101-2020_12_31_424971	615	9	,	,	,
10_1101-2020_12_31_424971	615	10	5538	5538	CD
10_1101-2020_12_31_424971	615	11	-	-	SYM
10_1101-2020_12_31_424971	615	12	43	43	CD
10_1101-2020_12_31_424971	615	13	(	(	-LRB-
10_1101-2020_12_31_424971	615	14	2014	2014	CD
10_1101-2020_12_31_424971	615	15	)	)	-RRB-
10_1101-2020_12_31_424971	615	16	.	.	.
10_1101-2020_12_31_424971	616	1	1117	1117	CD
10_1101-2020_12_31_424971	616	2	.CC	.CC	:
10_1101-2020_12_31_424971	616	3	-	-	:
10_1101-2020_12_31_424971	616	4	BY	by	IN
10_1101-2020_12_31_424971	616	5	-	-	HYPH
10_1101-2020_12_31_424971	616	6	NC	NC	NNP
10_1101-2020_12_31_424971	616	7	-	-	HYPH
10_1101-2020_12_31_424971	616	8	ND	ND	NNP
10_1101-2020_12_31_424971	616	9	4.0	4.0	CD
10_1101-2020_12_31_424971	616	10	International	International	NNP
10_1101-2020_12_31_424971	616	11	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	616	12	under	under	IN
10_1101-2020_12_31_424971	616	13	a	a	DT
10_1101-2020_12_31_424971	616	14	(	(	-LRB-
10_1101-2020_12_31_424971	616	15	which	which	WDT
10_1101-2020_12_31_424971	616	16	was	be	VBD
10_1101-2020_12_31_424971	616	17	not	not	RB
10_1101-2020_12_31_424971	616	18	certified	certify	VBN
10_1101-2020_12_31_424971	616	19	by	by	IN
10_1101-2020_12_31_424971	616	20	peer	peer	NN
10_1101-2020_12_31_424971	616	21	review	review	NN
10_1101-2020_12_31_424971	616	22	)	)	-RRB-
10_1101-2020_12_31_424971	616	23	is	be	VBZ
10_1101-2020_12_31_424971	616	24	the	the	DT
10_1101-2020_12_31_424971	616	25	author	author	NN
10_1101-2020_12_31_424971	616	26	/	/	SYM
10_1101-2020_12_31_424971	616	27	funder	funder	NN
10_1101-2020_12_31_424971	616	28	,	,	,
10_1101-2020_12_31_424971	616	29	who	who	WP
10_1101-2020_12_31_424971	616	30	has	have	VBZ
10_1101-2020_12_31_424971	616	31	granted	grant	VBN
10_1101-2020_12_31_424971	616	32	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	616	33	a	a	DT
10_1101-2020_12_31_424971	616	34	license	license	NN
10_1101-2020_12_31_424971	616	35	to	to	TO
10_1101-2020_12_31_424971	616	36	display	display	VB
10_1101-2020_12_31_424971	616	37	the	the	DT
10_1101-2020_12_31_424971	616	38	preprint	preprint	NN
10_1101-2020_12_31_424971	616	39	in	in	IN
10_1101-2020_12_31_424971	616	40	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	616	41	.	.	.
10_1101-2020_12_31_424971	617	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	617	2	is	be	VBZ
10_1101-2020_12_31_424971	617	3	made	make	VBN
10_1101-2020_12_31_424971	617	4	The	the	DT
10_1101-2020_12_31_424971	617	5	copyright	copyright	NN
10_1101-2020_12_31_424971	617	6	holder	holder	NN
10_1101-2020_12_31_424971	617	7	for	for	IN
10_1101-2020_12_31_424971	617	8	this	this	DT
10_1101-2020_12_31_424971	617	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	617	10	version	version	NN
10_1101-2020_12_31_424971	617	11	posted	post	VBD
10_1101-2020_12_31_424971	617	12	January	January	NNP
10_1101-2020_12_31_424971	617	13	2	2	CD
10_1101-2020_12_31_424971	617	14	,	,	,
10_1101-2020_12_31_424971	617	15	2021	2021	CD
10_1101-2020_12_31_424971	617	16	.	.	.
10_1101-2020_12_31_424971	617	17	;	;	:
10_1101-2020_12_31_424971	617	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	617	19	:	:	:
10_1101-2020_12_31_424971	617	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	617	21	preprint	preprint	NN
10_1101-2020_12_31_424971	617	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NNP
10_1101-2020_12_31_424971	617	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	617	24	44	44	CD
10_1101-2020_12_31_424971	617	25	42	42	CD
10_1101-2020_12_31_424971	617	26	.	.	.
10_1101-2020_12_31_424971	618	1	Munro	Munro	NNP
10_1101-2020_12_31_424971	618	2	,	,	,
10_1101-2020_12_31_424971	618	3	J.B.	J.B.	NNP
10_1101-2020_12_31_424971	618	4	,	,	,
10_1101-2020_12_31_424971	618	5	Wasserman	Wasserman	NNP
10_1101-2020_12_31_424971	618	6	,	,	,
10_1101-2020_12_31_424971	618	7	M.R.	M.R.	NNP
10_1101-2020_12_31_424971	618	8	,	,	,
10_1101-2020_12_31_424971	618	9	Altman	Altman	NNP
10_1101-2020_12_31_424971	618	10	,	,	,
10_1101-2020_12_31_424971	618	11	R.B.	R.B.	NNP
10_1101-2020_12_31_424971	618	12	,	,	,
10_1101-2020_12_31_424971	618	13	Wang	Wang	NNP
10_1101-2020_12_31_424971	618	14	,	,	,
10_1101-2020_12_31_424971	618	15	L.	L.	NNP
10_1101-2020_12_31_424971	618	16	&	&	CC
10_1101-2020_12_31_424971	618	17	Blanchard	Blanchard	NNP
10_1101-2020_12_31_424971	618	18	,	,	,
10_1101-2020_12_31_424971	618	19	S.C.	South Carolina	NNP
10_1101-2020_12_31_424971	618	20	Correlated	correlate	VBD
10_1101-2020_12_31_424971	618	21	1118	1118	CD
10_1101-2020_12_31_424971	618	22	conformational	conformational	JJ
10_1101-2020_12_31_424971	618	23	events	event	NNS
10_1101-2020_12_31_424971	618	24	in	in	IN
10_1101-2020_12_31_424971	618	25	EF	EF	NNP
10_1101-2020_12_31_424971	618	26	-	-	HYPH
10_1101-2020_12_31_424971	618	27	G	G	NNP
10_1101-2020_12_31_424971	618	28	and	and	CC
10_1101-2020_12_31_424971	618	29	the	the	DT
10_1101-2020_12_31_424971	618	30	ribosome	ribosome	JJ
10_1101-2020_12_31_424971	618	31	regulate	regulate	NN
10_1101-2020_12_31_424971	618	32	translocation	translocation	NN
10_1101-2020_12_31_424971	618	33	.	.	.
10_1101-2020_12_31_424971	619	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	619	2	Struct	Struct	NNP
10_1101-2020_12_31_424971	619	3	Mol	Mol	NNP
10_1101-2020_12_31_424971	619	4	1119	1119	CD
10_1101-2020_12_31_424971	619	5	Biol	Biol	NNP
10_1101-2020_12_31_424971	619	6	17	17	CD
10_1101-2020_12_31_424971	619	7	,	,	,
10_1101-2020_12_31_424971	619	8	1470	1470	CD
10_1101-2020_12_31_424971	619	9	-	-	SYM
10_1101-2020_12_31_424971	619	10	7	7	CD
10_1101-2020_12_31_424971	619	11	(	(	-LRB-
10_1101-2020_12_31_424971	619	12	2010	2010	CD
10_1101-2020_12_31_424971	619	13	)	)	-RRB-
10_1101-2020_12_31_424971	619	14	.	.	.
10_1101-2020_12_31_424971	620	1	1120	1120	CD
10_1101-2020_12_31_424971	620	2	43	43	CD
10_1101-2020_12_31_424971	620	3	.	.	.
10_1101-2020_12_31_424971	621	1	Blanchard	Blanchard	NNP
10_1101-2020_12_31_424971	621	2	,	,	,
10_1101-2020_12_31_424971	621	3	S.C.	South Carolina	NNP
10_1101-2020_12_31_424971	621	4	,	,	,
10_1101-2020_12_31_424971	621	5	Kim	Kim	NNP
10_1101-2020_12_31_424971	621	6	,	,	,
10_1101-2020_12_31_424971	621	7	H.D.	H.D.	NNP
10_1101-2020_12_31_424971	621	8	,	,	,
10_1101-2020_12_31_424971	621	9	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	621	10	,	,	,
10_1101-2020_12_31_424971	621	11	R.L.	R.L.	NNP
10_1101-2020_12_31_424971	621	12	,	,	,
10_1101-2020_12_31_424971	621	13	Jr.	Jr.	NNP
10_1101-2020_12_31_424971	621	14	,	,	,
10_1101-2020_12_31_424971	621	15	Puglisi	Puglisi	NNP
10_1101-2020_12_31_424971	621	16	,	,	,
10_1101-2020_12_31_424971	621	17	J.D.	J.D.	NNP
10_1101-2020_12_31_424971	622	1	&	&	CC
10_1101-2020_12_31_424971	622	2	Chu	Chu	NNP
10_1101-2020_12_31_424971	622	3	,	,	,
10_1101-2020_12_31_424971	622	4	S.	S.	NNP
10_1101-2020_12_31_424971	622	5	tRNA	trna	NN
10_1101-2020_12_31_424971	622	6	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	622	7	1121	1121	CD
10_1101-2020_12_31_424971	622	8	on	on	IN
10_1101-2020_12_31_424971	622	9	the	the	DT
10_1101-2020_12_31_424971	622	10	ribosome	ribosome	NN
10_1101-2020_12_31_424971	622	11	during	during	IN
10_1101-2020_12_31_424971	622	12	translation	translation	NN
10_1101-2020_12_31_424971	622	13	.	.	.
10_1101-2020_12_31_424971	623	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	623	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	623	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	623	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	623	5	U	U	NNP
10_1101-2020_12_31_424971	623	6	S	S	NNP
10_1101-2020_12_31_424971	623	7	A	A	NNP
10_1101-2020_12_31_424971	623	8	101	101	CD
10_1101-2020_12_31_424971	623	9	,	,	,
10_1101-2020_12_31_424971	623	10	12893	12893	CD
10_1101-2020_12_31_424971	623	11	-	-	SYM
10_1101-2020_12_31_424971	623	12	8	8	CD
10_1101-2020_12_31_424971	623	13	(	(	-LRB-
10_1101-2020_12_31_424971	623	14	2004	2004	CD
10_1101-2020_12_31_424971	623	15	)	)	-RRB-
10_1101-2020_12_31_424971	623	16	.	.	.
10_1101-2020_12_31_424971	624	1	1122	1122	CD
10_1101-2020_12_31_424971	624	2	44	44	CD
10_1101-2020_12_31_424971	624	3	.	.	.
10_1101-2020_12_31_424971	625	1	Studer	Studer	NNP
10_1101-2020_12_31_424971	625	2	,	,	,
10_1101-2020_12_31_424971	625	3	S.M.	S.M.	NNP
10_1101-2020_12_31_424971	625	4	,	,	,
10_1101-2020_12_31_424971	625	5	Feinberg	Feinberg	NNP
10_1101-2020_12_31_424971	625	6	,	,	,
10_1101-2020_12_31_424971	625	7	J.S.	J.S.	NNP
10_1101-2020_12_31_424971	626	1	&	&	CC
10_1101-2020_12_31_424971	626	2	Joseph	Joseph	NNP
10_1101-2020_12_31_424971	626	3	,	,	,
10_1101-2020_12_31_424971	626	4	S.	S.	NNP
10_1101-2020_12_31_424971	626	5	Rapid	Rapid	NNP
10_1101-2020_12_31_424971	626	6	kinetic	kinetic	JJ
10_1101-2020_12_31_424971	626	7	analysis	analysis	NN
10_1101-2020_12_31_424971	626	8	of	of	IN
10_1101-2020_12_31_424971	626	9	EF	EF	NNP
10_1101-2020_12_31_424971	626	10	-	-	HYPH
10_1101-2020_12_31_424971	626	11	G	G	NNP
10_1101-2020_12_31_424971	626	12	-	-	HYPH
10_1101-2020_12_31_424971	626	13	dependent	dependent	JJ
10_1101-2020_12_31_424971	626	14	1123	1123	CD
10_1101-2020_12_31_424971	626	15	mRNA	mrna	NN
10_1101-2020_12_31_424971	626	16	translocation	translocation	NN
10_1101-2020_12_31_424971	626	17	in	in	IN
10_1101-2020_12_31_424971	626	18	the	the	DT
10_1101-2020_12_31_424971	626	19	ribosome	ribosome	NN
10_1101-2020_12_31_424971	626	20	.	.	.
10_1101-2020_12_31_424971	627	1	J	J	NNP
10_1101-2020_12_31_424971	627	2	Mol	Mol	NNP
10_1101-2020_12_31_424971	627	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	627	4	327	327	CD
10_1101-2020_12_31_424971	627	5	,	,	,
10_1101-2020_12_31_424971	627	6	369	369	CD
10_1101-2020_12_31_424971	627	7	-	-	SYM
10_1101-2020_12_31_424971	627	8	81	81	CD
10_1101-2020_12_31_424971	627	9	(	(	-LRB-
10_1101-2020_12_31_424971	627	10	2003	2003	CD
10_1101-2020_12_31_424971	627	11	)	)	-RRB-
10_1101-2020_12_31_424971	627	12	.	.	.
10_1101-2020_12_31_424971	628	1	1124	1124	CD
10_1101-2020_12_31_424971	628	2	45	45	CD
10_1101-2020_12_31_424971	628	3	.	.	.
10_1101-2020_12_31_424971	629	1	Wintermeyer	Wintermeyer	NNP
10_1101-2020_12_31_424971	629	2	,	,	,
10_1101-2020_12_31_424971	629	3	W.	W.	NNP
10_1101-2020_12_31_424971	629	4	&	&	CC
10_1101-2020_12_31_424971	629	5	Rodnina	Rodnina	NNP
10_1101-2020_12_31_424971	629	6	,	,	,
10_1101-2020_12_31_424971	629	7	M.V.	M.V.	NNP
10_1101-2020_12_31_424971	630	1	Translational	translational	JJ
10_1101-2020_12_31_424971	630	2	elongation	elongation	NN
10_1101-2020_12_31_424971	630	3	factor	factor	NN
10_1101-2020_12_31_424971	630	4	G	g	NN
10_1101-2020_12_31_424971	630	5	:	:	:
10_1101-2020_12_31_424971	630	6	a	a	DT
10_1101-2020_12_31_424971	630	7	GTP	gtp	NN
10_1101-2020_12_31_424971	630	8	-	-	HYPH
10_1101-2020_12_31_424971	630	9	driven	drive	VBN
10_1101-2020_12_31_424971	630	10	motor	motor	NN
10_1101-2020_12_31_424971	630	11	1125	1125	CD
10_1101-2020_12_31_424971	630	12	of	of	IN
10_1101-2020_12_31_424971	630	13	the	the	DT
10_1101-2020_12_31_424971	630	14	ribosome	ribosome	NN
10_1101-2020_12_31_424971	630	15	.	.	.
10_1101-2020_12_31_424971	631	1	Essays	Essays	NNPS
10_1101-2020_12_31_424971	631	2	Biochem	Biochem	NNP
10_1101-2020_12_31_424971	631	3	35	35	CD
10_1101-2020_12_31_424971	631	4	,	,	,
10_1101-2020_12_31_424971	631	5	117	117	CD
10_1101-2020_12_31_424971	631	6	-	-	SYM
10_1101-2020_12_31_424971	631	7	29	29	CD
10_1101-2020_12_31_424971	631	8	(	(	-LRB-
10_1101-2020_12_31_424971	631	9	2000	2000	CD
10_1101-2020_12_31_424971	631	10	)	)	-RRB-
10_1101-2020_12_31_424971	631	11	.	.	.
10_1101-2020_12_31_424971	632	1	1126	1126	CD
10_1101-2020_12_31_424971	632	2	46	46	CD
10_1101-2020_12_31_424971	632	3	.	.	.
10_1101-2020_12_31_424971	633	1	Ermolenko	Ermolenko	NNP
10_1101-2020_12_31_424971	633	2	,	,	,
10_1101-2020_12_31_424971	633	3	D.N.	D.N.	NNP
10_1101-2020_12_31_424971	634	1	et	et	NNP
10_1101-2020_12_31_424971	634	2	al	al	NNP
10_1101-2020_12_31_424971	634	3	.	.	.
10_1101-2020_12_31_424971	635	1	Observation	observation	NN
10_1101-2020_12_31_424971	635	2	of	of	IN
10_1101-2020_12_31_424971	635	3	intersubunit	intersubunit	JJ
10_1101-2020_12_31_424971	635	4	movement	movement	NN
10_1101-2020_12_31_424971	635	5	of	of	IN
10_1101-2020_12_31_424971	635	6	the	the	DT
10_1101-2020_12_31_424971	635	7	ribosome	ribosome	NN
10_1101-2020_12_31_424971	635	8	in	in	IN
10_1101-2020_12_31_424971	635	9	solution	solution	NN
10_1101-2020_12_31_424971	635	10	1127	1127	CD
10_1101-2020_12_31_424971	635	11	using	use	VBG
10_1101-2020_12_31_424971	635	12	FRET	FRET	NNP
10_1101-2020_12_31_424971	635	13	.	.	.
10_1101-2020_12_31_424971	636	1	J	J	NNP
10_1101-2020_12_31_424971	636	2	Mol	Mol	NNP
10_1101-2020_12_31_424971	636	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	636	4	370	370	CD
10_1101-2020_12_31_424971	636	5	,	,	,
10_1101-2020_12_31_424971	636	6	530	530	CD
10_1101-2020_12_31_424971	636	7	-	-	SYM
10_1101-2020_12_31_424971	636	8	40	40	CD
10_1101-2020_12_31_424971	636	9	(	(	-LRB-
10_1101-2020_12_31_424971	636	10	2007	2007	CD
10_1101-2020_12_31_424971	636	11	)	)	-RRB-
10_1101-2020_12_31_424971	636	12	.	.	.
10_1101-2020_12_31_424971	637	1	1128	1128	CD
10_1101-2020_12_31_424971	637	2	47	47	CD
10_1101-2020_12_31_424971	637	3	.	.	.
10_1101-2020_12_31_424971	638	1	Ermolenko	Ermolenko	NNP
10_1101-2020_12_31_424971	638	2	,	,	,
10_1101-2020_12_31_424971	638	3	D.N.	D.N.	NNP
10_1101-2020_12_31_424971	639	1	&	&	CC
10_1101-2020_12_31_424971	639	2	Noller	Noller	NNP
10_1101-2020_12_31_424971	639	3	,	,	,
10_1101-2020_12_31_424971	639	4	H.F.	H.F.	NNP
10_1101-2020_12_31_424971	639	5	mRNA	mrna	NN
10_1101-2020_12_31_424971	639	6	translocation	translocation	NN
10_1101-2020_12_31_424971	639	7	occurs	occur	VBZ
10_1101-2020_12_31_424971	639	8	during	during	IN
10_1101-2020_12_31_424971	639	9	the	the	DT
10_1101-2020_12_31_424971	639	10	second	second	JJ
10_1101-2020_12_31_424971	639	11	step	step	NN
10_1101-2020_12_31_424971	639	12	of	of	IN
10_1101-2020_12_31_424971	639	13	1129	1129	CD
10_1101-2020_12_31_424971	639	14	ribosomal	ribosomal	JJ
10_1101-2020_12_31_424971	639	15	intersubunit	intersubunit	JJ
10_1101-2020_12_31_424971	639	16	rotation	rotation	NN
10_1101-2020_12_31_424971	639	17	.	.	.
10_1101-2020_12_31_424971	640	1	Nat	Nat	NNP
10_1101-2020_12_31_424971	640	2	Struct	Struct	NNP
10_1101-2020_12_31_424971	640	3	Mol	Mol	NNP
10_1101-2020_12_31_424971	640	4	Biol	Biol	NNP
10_1101-2020_12_31_424971	640	5	18	18	CD
10_1101-2020_12_31_424971	640	6	,	,	,
10_1101-2020_12_31_424971	640	7	457	457	CD
10_1101-2020_12_31_424971	640	8	-	-	SYM
10_1101-2020_12_31_424971	640	9	62	62	CD
10_1101-2020_12_31_424971	640	10	(	(	-LRB-
10_1101-2020_12_31_424971	640	11	2011	2011	CD
10_1101-2020_12_31_424971	640	12	)	)	-RRB-
10_1101-2020_12_31_424971	640	13	.	.	.
10_1101-2020_12_31_424971	641	1	1130	1130	CD
10_1101-2020_12_31_424971	641	2	48	48	CD
10_1101-2020_12_31_424971	641	3	.	.	.
10_1101-2020_12_31_424971	642	1	Cornish	Cornish	NNP
10_1101-2020_12_31_424971	642	2	,	,	,
10_1101-2020_12_31_424971	642	3	P.V.	P.V.	NNP
10_1101-2020_12_31_424971	643	1	et	et	NNP
10_1101-2020_12_31_424971	643	2	al	al	NNP
10_1101-2020_12_31_424971	643	3	.	.	.
10_1101-2020_12_31_424971	644	1	Following	follow	VBG
10_1101-2020_12_31_424971	644	2	movement	movement	NN
10_1101-2020_12_31_424971	644	3	of	of	IN
10_1101-2020_12_31_424971	644	4	the	the	DT
10_1101-2020_12_31_424971	644	5	L1	L1	NNP
10_1101-2020_12_31_424971	644	6	stalk	stalk	NN
10_1101-2020_12_31_424971	644	7	between	between	IN
10_1101-2020_12_31_424971	644	8	three	three	CD
10_1101-2020_12_31_424971	644	9	functional	functional	JJ
10_1101-2020_12_31_424971	644	10	states	state	NNS
10_1101-2020_12_31_424971	644	11	1131	1131	CD
10_1101-2020_12_31_424971	644	12	in	in	IN
10_1101-2020_12_31_424971	644	13	single	single	JJ
10_1101-2020_12_31_424971	644	14	ribosomes	ribosome	NNS
10_1101-2020_12_31_424971	644	15	.	.	.
10_1101-2020_12_31_424971	645	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	645	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	645	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	645	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	645	5	U	U	NNP
10_1101-2020_12_31_424971	645	6	S	S	NNP
10_1101-2020_12_31_424971	645	7	A	A	NNP
10_1101-2020_12_31_424971	645	8	106	106	CD
10_1101-2020_12_31_424971	645	9	,	,	,
10_1101-2020_12_31_424971	645	10	2571	2571	CD
10_1101-2020_12_31_424971	645	11	-	-	SYM
10_1101-2020_12_31_424971	645	12	6	6	CD
10_1101-2020_12_31_424971	645	13	(	(	-LRB-
10_1101-2020_12_31_424971	645	14	2009	2009	CD
10_1101-2020_12_31_424971	645	15	)	)	-RRB-
10_1101-2020_12_31_424971	645	16	.	.	.
10_1101-2020_12_31_424971	646	1	1132	1132	CD
10_1101-2020_12_31_424971	646	2	49	49	CD
10_1101-2020_12_31_424971	646	3	.	.	.
10_1101-2020_12_31_424971	647	1	Nguyen	Nguyen	NNP
10_1101-2020_12_31_424971	647	2	,	,	,
10_1101-2020_12_31_424971	647	3	H.A.	H.A.	NNP
10_1101-2020_12_31_424971	647	4	,	,	,
10_1101-2020_12_31_424971	647	5	Hoffer	Hoffer	NNP
10_1101-2020_12_31_424971	647	6	,	,	,
10_1101-2020_12_31_424971	647	7	E.D.	E.D.	NNP
10_1101-2020_12_31_424971	648	1	&	&	CC
10_1101-2020_12_31_424971	648	2	Dunham	Dunham	NNP
10_1101-2020_12_31_424971	648	3	,	,	,
10_1101-2020_12_31_424971	648	4	C.M.	C.M.	NNP
10_1101-2020_12_31_424971	649	1	Importance	importance	NN
10_1101-2020_12_31_424971	649	2	of	of	IN
10_1101-2020_12_31_424971	649	3	a	a	DT
10_1101-2020_12_31_424971	649	4	tRNA	trna	NN
10_1101-2020_12_31_424971	649	5	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	649	6	loop	loop	NNP
10_1101-2020_12_31_424971	649	7	1133	1133	CD
10_1101-2020_12_31_424971	649	8	modification	modification	NN
10_1101-2020_12_31_424971	649	9	and	and	CC
10_1101-2020_12_31_424971	649	10	a	a	DT
10_1101-2020_12_31_424971	649	11	conserved	conserve	VBN
10_1101-2020_12_31_424971	649	12	,	,	,
10_1101-2020_12_31_424971	649	13	noncanonical	noncanonical	JJ
10_1101-2020_12_31_424971	649	14	anticodon	anticodon	NN
10_1101-2020_12_31_424971	649	15	stem	stem	NN
10_1101-2020_12_31_424971	649	16	pairing	pair	VBG
10_1101-2020_12_31_424971	649	17	in	in	IN
10_1101-2020_12_31_424971	649	18	tRNACGGProfor	trnacggprofor	CD
10_1101-2020_12_31_424971	649	19	1134	1134	CD
10_1101-2020_12_31_424971	649	20	decoding	decoding	NN
10_1101-2020_12_31_424971	649	21	.	.	.
10_1101-2020_12_31_424971	650	1	J	J	NNP
10_1101-2020_12_31_424971	650	2	Biol	Biol	NNP
10_1101-2020_12_31_424971	650	3	Chem	Chem	NNP
10_1101-2020_12_31_424971	650	4	294	294	CD
10_1101-2020_12_31_424971	650	5	,	,	,
10_1101-2020_12_31_424971	650	6	5281	5281	CD
10_1101-2020_12_31_424971	650	7	-	-	SYM
10_1101-2020_12_31_424971	650	8	5291	5291	CD
10_1101-2020_12_31_424971	650	9	(	(	-LRB-
10_1101-2020_12_31_424971	650	10	2019	2019	CD
10_1101-2020_12_31_424971	650	11	)	)	-RRB-
10_1101-2020_12_31_424971	650	12	.	.	.
10_1101-2020_12_31_424971	651	1	1135	1135	CD
10_1101-2020_12_31_424971	651	2	50	50	CD
10_1101-2020_12_31_424971	651	3	.	.	.
10_1101-2020_12_31_424971	652	1	Guo	Guo	NNP
10_1101-2020_12_31_424971	652	2	,	,	,
10_1101-2020_12_31_424971	652	3	Z.	Z.	NNP
10_1101-2020_12_31_424971	653	1	&	&	CC
10_1101-2020_12_31_424971	653	2	Noller	Noller	NNP
10_1101-2020_12_31_424971	653	3	,	,	,
10_1101-2020_12_31_424971	653	4	H.F.	H.F.	NNP
10_1101-2020_12_31_424971	653	5	Rotation	Rotation	NNP
10_1101-2020_12_31_424971	653	6	of	of	IN
10_1101-2020_12_31_424971	653	7	the	the	DT
10_1101-2020_12_31_424971	653	8	head	head	NN
10_1101-2020_12_31_424971	653	9	of	of	IN
10_1101-2020_12_31_424971	653	10	the	the	DT
10_1101-2020_12_31_424971	653	11	30S	30s	CD
10_1101-2020_12_31_424971	653	12	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	653	13	subunit	subunit	NN
10_1101-2020_12_31_424971	653	14	during	during	IN
10_1101-2020_12_31_424971	653	15	mRNA	mRNA	NNP
10_1101-2020_12_31_424971	653	16	1136	1136	CD
10_1101-2020_12_31_424971	653	17	translocation	translocation	NN
10_1101-2020_12_31_424971	653	18	.	.	.
10_1101-2020_12_31_424971	654	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	654	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	654	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	654	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	654	5	U	U	NNP
10_1101-2020_12_31_424971	654	6	S	S	NNP
10_1101-2020_12_31_424971	654	7	A	A	NNP
10_1101-2020_12_31_424971	654	8	109	109	CD
10_1101-2020_12_31_424971	654	9	,	,	,
10_1101-2020_12_31_424971	654	10	20391	20391	CD
10_1101-2020_12_31_424971	654	11	-	-	SYM
10_1101-2020_12_31_424971	654	12	4	4	CD
10_1101-2020_12_31_424971	654	13	(	(	-LRB-
10_1101-2020_12_31_424971	654	14	2012	2012	CD
10_1101-2020_12_31_424971	654	15	)	)	-RRB-
10_1101-2020_12_31_424971	654	16	.	.	.
10_1101-2020_12_31_424971	655	1	1137	1137	CD
10_1101-2020_12_31_424971	655	2	51	51	CD
10_1101-2020_12_31_424971	655	3	.	.	.
10_1101-2020_12_31_424971	656	1	Zhou	Zhou	NNP
10_1101-2020_12_31_424971	656	2	,	,	,
10_1101-2020_12_31_424971	656	3	J.	J.	NNP
10_1101-2020_12_31_424971	656	4	,	,	,
10_1101-2020_12_31_424971	656	5	Lancaster	Lancaster	NNP
10_1101-2020_12_31_424971	656	6	,	,	,
10_1101-2020_12_31_424971	656	7	L.	L.	NNP
10_1101-2020_12_31_424971	656	8	,	,	,
10_1101-2020_12_31_424971	656	9	Donohue	Donohue	NNP
10_1101-2020_12_31_424971	656	10	,	,	,
10_1101-2020_12_31_424971	656	11	J.P.	J.P.	NNP
10_1101-2020_12_31_424971	656	12	&	&	CC
10_1101-2020_12_31_424971	656	13	Noller	Noller	NNP
10_1101-2020_12_31_424971	656	14	,	,	,
10_1101-2020_12_31_424971	656	15	H.F.	H.F.	NNP
10_1101-2020_12_31_424971	656	16	Spontaneous	spontaneous	JJ
10_1101-2020_12_31_424971	656	17	ribosomal	ribosomal	NN
10_1101-2020_12_31_424971	656	18	1138	1138	CD
10_1101-2020_12_31_424971	656	19	translocation	translocation	NN
10_1101-2020_12_31_424971	656	20	of	of	IN
10_1101-2020_12_31_424971	656	21	mRNA	mRNA	NNS
10_1101-2020_12_31_424971	656	22	and	and	CC
10_1101-2020_12_31_424971	656	23	tRNAs	trnas	CD
10_1101-2020_12_31_424971	656	24	into	into	IN
10_1101-2020_12_31_424971	656	25	a	a	DT
10_1101-2020_12_31_424971	656	26	chimeric	chimeric	JJ
10_1101-2020_12_31_424971	656	27	hybrid	hybrid	JJ
10_1101-2020_12_31_424971	656	28	state	state	NN
10_1101-2020_12_31_424971	656	29	.	.	.
10_1101-2020_12_31_424971	657	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	657	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	657	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	657	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	657	5	U	U	NNP
10_1101-2020_12_31_424971	657	6	S	S	NNP
10_1101-2020_12_31_424971	657	7	A	A	NNP
10_1101-2020_12_31_424971	657	8	1139	1139	CD
10_1101-2020_12_31_424971	657	9	116	116	CD
10_1101-2020_12_31_424971	657	10	,	,	,
10_1101-2020_12_31_424971	657	11	7813	7813	CD
10_1101-2020_12_31_424971	657	12	-	-	SYM
10_1101-2020_12_31_424971	657	13	7818	7818	CD
10_1101-2020_12_31_424971	657	14	(	(	-LRB-
10_1101-2020_12_31_424971	657	15	2019	2019	CD
10_1101-2020_12_31_424971	657	16	)	)	-RRB-
10_1101-2020_12_31_424971	657	17	.	.	.
10_1101-2020_12_31_424971	658	1	1140	1140	CD
10_1101-2020_12_31_424971	658	2	52	52	CD
10_1101-2020_12_31_424971	658	3	.	.	.
10_1101-2020_12_31_424971	659	1	Korniy	Korniy	NNP
10_1101-2020_12_31_424971	659	2	,	,	,
10_1101-2020_12_31_424971	659	3	N.	N.	NNP
10_1101-2020_12_31_424971	659	4	,	,	,
10_1101-2020_12_31_424971	659	5	Samatova	Samatova	NNP
10_1101-2020_12_31_424971	659	6	,	,	,
10_1101-2020_12_31_424971	659	7	E.	E.	NNP
10_1101-2020_12_31_424971	659	8	,	,	,
10_1101-2020_12_31_424971	659	9	Anokhina	Anokhina	NNP
10_1101-2020_12_31_424971	659	10	,	,	,
10_1101-2020_12_31_424971	659	11	M.M.	M.M.	NNP
10_1101-2020_12_31_424971	659	12	,	,	,
10_1101-2020_12_31_424971	659	13	Peske	Peske	NNP
10_1101-2020_12_31_424971	659	14	,	,	,
10_1101-2020_12_31_424971	659	15	F.	F.	NNP
10_1101-2020_12_31_424971	659	16	&	&	CC
10_1101-2020_12_31_424971	659	17	Rodnina	Rodnina	NNP
10_1101-2020_12_31_424971	659	18	,	,	,
10_1101-2020_12_31_424971	659	19	M.V.	M.V.	NNP
10_1101-2020_12_31_424971	660	1	Mechanisms	mechanism	NNS
10_1101-2020_12_31_424971	660	2	and	and	CC
10_1101-2020_12_31_424971	660	3	1141	1141	CD
10_1101-2020_12_31_424971	660	4	biomedical	biomedical	JJ
10_1101-2020_12_31_424971	660	5	implications	implication	NNS
10_1101-2020_12_31_424971	660	6	of	of	IN
10_1101-2020_12_31_424971	660	7	-1	-1	.
10_1101-2020_12_31_424971	660	8	programmed	program	VBN
10_1101-2020_12_31_424971	660	9	ribosome	ribosome	NNP
10_1101-2020_12_31_424971	660	10	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	660	11	on	on	IN
10_1101-2020_12_31_424971	660	12	viral	viral	JJ
10_1101-2020_12_31_424971	660	13	and	and	CC
10_1101-2020_12_31_424971	660	14	bacterial	bacterial	JJ
10_1101-2020_12_31_424971	660	15	1142	1142	CD
10_1101-2020_12_31_424971	660	16	mRNAs	mrnas	ADD
10_1101-2020_12_31_424971	660	17	.	.	.
10_1101-2020_12_31_424971	661	1	FEBS	FEBS	NNP
10_1101-2020_12_31_424971	661	2	Lett	Lett	NNP
10_1101-2020_12_31_424971	661	3	593	593	CD
10_1101-2020_12_31_424971	661	4	,	,	,
10_1101-2020_12_31_424971	661	5	1468	1468	CD
10_1101-2020_12_31_424971	661	6	-	-	SYM
10_1101-2020_12_31_424971	661	7	1482	1482	CD
10_1101-2020_12_31_424971	661	8	(	(	-LRB-
10_1101-2020_12_31_424971	661	9	2019	2019	CD
10_1101-2020_12_31_424971	661	10	)	)	-RRB-
10_1101-2020_12_31_424971	661	11	.	.	.
10_1101-2020_12_31_424971	662	1	1143	1143	CD
10_1101-2020_12_31_424971	662	2	53	53	CD
10_1101-2020_12_31_424971	662	3	.	.	.
10_1101-2020_12_31_424971	663	1	Lajoie	Lajoie	NNP
10_1101-2020_12_31_424971	663	2	,	,	,
10_1101-2020_12_31_424971	663	3	M.J.	M.J.	NNP
10_1101-2020_12_31_424971	663	4	et	et	NNP
10_1101-2020_12_31_424971	663	5	al	al	NNP
10_1101-2020_12_31_424971	663	6	.	.	.
10_1101-2020_12_31_424971	664	1	Genomically	genomically	RB
10_1101-2020_12_31_424971	664	2	recoded	recode	VBD
10_1101-2020_12_31_424971	664	3	organisms	organism	NNS
10_1101-2020_12_31_424971	664	4	expand	expand	VBP
10_1101-2020_12_31_424971	664	5	biological	biological	JJ
10_1101-2020_12_31_424971	664	6	functions	function	NNS
10_1101-2020_12_31_424971	664	7	.	.	.
10_1101-2020_12_31_424971	665	1	Science	science	NN
10_1101-2020_12_31_424971	665	2	1144	1144	CD
10_1101-2020_12_31_424971	665	3	342	342	CD
10_1101-2020_12_31_424971	665	4	,	,	,
10_1101-2020_12_31_424971	665	5	357	357	CD
10_1101-2020_12_31_424971	665	6	-	-	HYPH
10_1101-2020_12_31_424971	665	7	60	60	CD
10_1101-2020_12_31_424971	665	8	(	(	-LRB-
10_1101-2020_12_31_424971	665	9	2013	2013	CD
10_1101-2020_12_31_424971	665	10	)	)	-RRB-
10_1101-2020_12_31_424971	665	11	.	.	.
10_1101-2020_12_31_424971	666	1	1145	1145	CD
10_1101-2020_12_31_424971	666	2	54	54	CD
10_1101-2020_12_31_424971	666	3	.	.	.
10_1101-2020_12_31_424971	667	1	Wang	Wang	NNP
10_1101-2020_12_31_424971	667	2	,	,	,
10_1101-2020_12_31_424971	667	3	K.	K.	NNP
10_1101-2020_12_31_424971	667	4	,	,	,
10_1101-2020_12_31_424971	667	5	de	de	NNP
10_1101-2020_12_31_424971	667	6	la	la	NNP
10_1101-2020_12_31_424971	667	7	Torre	Torre	NNP
10_1101-2020_12_31_424971	667	8	,	,	,
10_1101-2020_12_31_424971	667	9	D.	D.	NNP
10_1101-2020_12_31_424971	667	10	,	,	,
10_1101-2020_12_31_424971	667	11	Robertson	Robertson	NNP
10_1101-2020_12_31_424971	667	12	,	,	,
10_1101-2020_12_31_424971	667	13	W.E.	W.E.	NNP
10_1101-2020_12_31_424971	668	1	&	&	CC
10_1101-2020_12_31_424971	668	2	Chin	Chin	NNP
10_1101-2020_12_31_424971	668	3	,	,	,
10_1101-2020_12_31_424971	668	4	J.W.	J.W.	NNP
10_1101-2020_12_31_424971	669	1	Programmed	program	VBN
10_1101-2020_12_31_424971	669	2	chromosome	chromosome	NN
10_1101-2020_12_31_424971	669	3	1146	1146	CD
10_1101-2020_12_31_424971	669	4	fission	fission	NN
10_1101-2020_12_31_424971	669	5	and	and	CC
10_1101-2020_12_31_424971	669	6	fusion	fusion	NN
10_1101-2020_12_31_424971	669	7	enable	enable	VBP
10_1101-2020_12_31_424971	669	8	precise	precise	JJ
10_1101-2020_12_31_424971	669	9	large	large	JJ
10_1101-2020_12_31_424971	669	10	-	-	HYPH
10_1101-2020_12_31_424971	669	11	scale	scale	NN
10_1101-2020_12_31_424971	669	12	genome	genome	JJ
10_1101-2020_12_31_424971	669	13	rearrangement	rearrangement	NN
10_1101-2020_12_31_424971	669	14	and	and	CC
10_1101-2020_12_31_424971	669	15	assembly	assembly	NN
10_1101-2020_12_31_424971	669	16	.	.	.
10_1101-2020_12_31_424971	670	1	1147	1147	CD
10_1101-2020_12_31_424971	670	2	Science	Science	NNP
10_1101-2020_12_31_424971	670	3	365	365	CD
10_1101-2020_12_31_424971	670	4	,	,	,
10_1101-2020_12_31_424971	670	5	922	922	CD
10_1101-2020_12_31_424971	670	6	-	-	SYM
10_1101-2020_12_31_424971	670	7	926	926	CD
10_1101-2020_12_31_424971	670	8	(	(	-LRB-
10_1101-2020_12_31_424971	670	9	2019	2019	CD
10_1101-2020_12_31_424971	670	10	)	)	-RRB-
10_1101-2020_12_31_424971	670	11	.	.	.
10_1101-2020_12_31_424971	671	1	1148	1148	CD
10_1101-2020_12_31_424971	671	2	55	55	CD
10_1101-2020_12_31_424971	671	3	.	.	.
10_1101-2020_12_31_424971	672	1	Mohan	Mohan	NNP
10_1101-2020_12_31_424971	672	2	,	,	,
10_1101-2020_12_31_424971	672	3	S.	S.	NNP
10_1101-2020_12_31_424971	672	4	,	,	,
10_1101-2020_12_31_424971	672	5	Donohue	Donohue	NNP
10_1101-2020_12_31_424971	672	6	,	,	,
10_1101-2020_12_31_424971	672	7	J.P.	J.P.	NNP
10_1101-2020_12_31_424971	672	8	&	&	CC
10_1101-2020_12_31_424971	672	9	Noller	Noller	NNP
10_1101-2020_12_31_424971	672	10	,	,	,
10_1101-2020_12_31_424971	672	11	H.F.	H.F.	NNP
10_1101-2020_12_31_424971	672	12	Molecular	Molecular	NNP
10_1101-2020_12_31_424971	672	13	mechanics	mechanic	NNS
10_1101-2020_12_31_424971	672	14	of	of	IN
10_1101-2020_12_31_424971	672	15	30S	30s	CD
10_1101-2020_12_31_424971	672	16	subunit	subunit	NN
10_1101-2020_12_31_424971	672	17	head	head	VB
10_1101-2020_12_31_424971	672	18	1149	1149	CD
10_1101-2020_12_31_424971	672	19	rotation	rotation	NN
10_1101-2020_12_31_424971	672	20	.	.	.
10_1101-2020_12_31_424971	673	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	673	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	673	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	673	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	673	5	U	U	NNP
10_1101-2020_12_31_424971	673	6	S	S	NNP
10_1101-2020_12_31_424971	673	7	A	A	NNP
10_1101-2020_12_31_424971	673	8	111	111	CD
10_1101-2020_12_31_424971	673	9	,	,	,
10_1101-2020_12_31_424971	673	10	13325	13325	CD
10_1101-2020_12_31_424971	673	11	-	-	SYM
10_1101-2020_12_31_424971	673	12	30	30	CD
10_1101-2020_12_31_424971	673	13	(	(	-LRB-
10_1101-2020_12_31_424971	673	14	2014	2014	CD
10_1101-2020_12_31_424971	673	15	)	)	-RRB-
10_1101-2020_12_31_424971	673	16	.	.	.
10_1101-2020_12_31_424971	674	1	1150	1150	CD
10_1101-2020_12_31_424971	674	2	56	56	CD
10_1101-2020_12_31_424971	674	3	.	.	.
10_1101-2020_12_31_424971	675	1	Kaledhonkar	Kaledhonkar	NNP
10_1101-2020_12_31_424971	675	2	,	,	,
10_1101-2020_12_31_424971	675	3	S.	S.	NNP
10_1101-2020_12_31_424971	675	4	et	et	NNP
10_1101-2020_12_31_424971	675	5	al	al	NNP
10_1101-2020_12_31_424971	675	6	.	.	.
10_1101-2020_12_31_424971	676	1	Late	late	JJ
10_1101-2020_12_31_424971	676	2	steps	step	NNS
10_1101-2020_12_31_424971	676	3	in	in	IN
10_1101-2020_12_31_424971	676	4	bacterial	bacterial	JJ
10_1101-2020_12_31_424971	676	5	translation	translation	NN
10_1101-2020_12_31_424971	676	6	initiation	initiation	NN
10_1101-2020_12_31_424971	676	7	visualized	visualize	VBN
10_1101-2020_12_31_424971	676	8	using	use	VBG
10_1101-2020_12_31_424971	676	9	time-1151	time-1151	NNP
10_1101-2020_12_31_424971	676	10	resolved	resolve	VBN
10_1101-2020_12_31_424971	676	11	cryo	cryo	JJ
10_1101-2020_12_31_424971	676	12	-	-	HYPH
10_1101-2020_12_31_424971	676	13	EM	EM	NNP
10_1101-2020_12_31_424971	676	14	.	.	.
10_1101-2020_12_31_424971	677	1	Nature	nature	NN
10_1101-2020_12_31_424971	677	2	570	570	CD
10_1101-2020_12_31_424971	677	3	,	,	,
10_1101-2020_12_31_424971	677	4	400	400	CD
10_1101-2020_12_31_424971	677	5	-	-	SYM
10_1101-2020_12_31_424971	677	6	404	404	CD
10_1101-2020_12_31_424971	677	7	(	(	-LRB-
10_1101-2020_12_31_424971	677	8	2019	2019	CD
10_1101-2020_12_31_424971	677	9	)	)	-RRB-
10_1101-2020_12_31_424971	677	10	.	.	.
10_1101-2020_12_31_424971	678	1	1152	1152	CD
10_1101-2020_12_31_424971	678	2	57	57	CD
10_1101-2020_12_31_424971	678	3	.	.	.
10_1101-2020_12_31_424971	679	1	Chen	Chen	NNP
10_1101-2020_12_31_424971	679	2	,	,	,
10_1101-2020_12_31_424971	679	3	B.	B.	NNP
10_1101-2020_12_31_424971	679	4	et	et	NNP
10_1101-2020_12_31_424971	679	5	al	al	NNP
10_1101-2020_12_31_424971	679	6	.	.	.
10_1101-2020_12_31_424971	680	1	Structural	structural	JJ
10_1101-2020_12_31_424971	680	2	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	680	3	of	of	IN
10_1101-2020_12_31_424971	680	4	ribosome	ribosome	NNP
10_1101-2020_12_31_424971	680	5	subunit	subunit	NNP
10_1101-2020_12_31_424971	680	6	association	association	NNP
10_1101-2020_12_31_424971	680	7	studied	study	VBN
10_1101-2020_12_31_424971	680	8	by	by	IN
10_1101-2020_12_31_424971	680	9	mixing-1153	mixing-1153	JJ
10_1101-2020_12_31_424971	680	10	spraying	spray	VBG
10_1101-2020_12_31_424971	680	11	time	time	NN
10_1101-2020_12_31_424971	680	12	-	-	HYPH
10_1101-2020_12_31_424971	680	13	resolved	resolve	VBN
10_1101-2020_12_31_424971	680	14	cryogenic	cryogenic	JJ
10_1101-2020_12_31_424971	680	15	electron	electron	NN
10_1101-2020_12_31_424971	680	16	microscopy	microscopy	NN
10_1101-2020_12_31_424971	680	17	.	.	.
10_1101-2020_12_31_424971	681	1	Structure	structure	NN
10_1101-2020_12_31_424971	681	2	23	23	CD
10_1101-2020_12_31_424971	681	3	,	,	,
10_1101-2020_12_31_424971	681	4	1097	1097	CD
10_1101-2020_12_31_424971	681	5	-	-	SYM
10_1101-2020_12_31_424971	681	6	105	105	CD
10_1101-2020_12_31_424971	681	7	(	(	-LRB-
10_1101-2020_12_31_424971	681	8	2015	2015	CD
10_1101-2020_12_31_424971	681	9	)	)	-RRB-
10_1101-2020_12_31_424971	681	10	.	.	.
10_1101-2020_12_31_424971	682	1	1154	1154	CD
10_1101-2020_12_31_424971	682	2	58	58	CD
10_1101-2020_12_31_424971	682	3	.	.	.
10_1101-2020_12_31_424971	683	1	Reinkemeier	Reinkemeier	NNP
10_1101-2020_12_31_424971	683	2	,	,	,
10_1101-2020_12_31_424971	683	3	C.D.	C.D.	NNP
10_1101-2020_12_31_424971	683	4	,	,	,
10_1101-2020_12_31_424971	683	5	Girona	Girona	NNP
10_1101-2020_12_31_424971	683	6	,	,	,
10_1101-2020_12_31_424971	683	7	G.E.	G.E.	NNP
10_1101-2020_12_31_424971	684	1	&	&	CC
10_1101-2020_12_31_424971	684	2	Lemke	Lemke	NNP
10_1101-2020_12_31_424971	684	3	,	,	,
10_1101-2020_12_31_424971	684	4	E.A.	E.A.	NNP
10_1101-2020_12_31_424971	685	1	Designer	designer	NN
10_1101-2020_12_31_424971	685	2	membraneless	membraneless	NN
10_1101-2020_12_31_424971	685	3	organelles	organelle	NNS
10_1101-2020_12_31_424971	685	4	1155	1155	CD
10_1101-2020_12_31_424971	685	5	enable	enable	VBP
10_1101-2020_12_31_424971	685	6	codon	codon	NNP
10_1101-2020_12_31_424971	685	7	reassignment	reassignment	NN
10_1101-2020_12_31_424971	685	8	of	of	IN
10_1101-2020_12_31_424971	685	9	selected	select	VBN
10_1101-2020_12_31_424971	685	10	mRNAs	mRNAs	''
10_1101-2020_12_31_424971	685	11	in	in	IN
10_1101-2020_12_31_424971	685	12	eukaryotes	eukaryote	NNS
10_1101-2020_12_31_424971	685	13	.	.	.
10_1101-2020_12_31_424971	686	1	Science	science	NN
10_1101-2020_12_31_424971	686	2	363(2019	363(2019	NNP
10_1101-2020_12_31_424971	686	3	)	)	-RRB-
10_1101-2020_12_31_424971	686	4	.	.	.
10_1101-2020_12_31_424971	687	1	1156	1156	CD
10_1101-2020_12_31_424971	687	2	59	59	CD
10_1101-2020_12_31_424971	687	3	.	.	.
10_1101-2020_12_31_424971	688	1	Datsenko	Datsenko	NNP
10_1101-2020_12_31_424971	688	2	,	,	,
10_1101-2020_12_31_424971	688	3	K.A.	K.A.	NNP
10_1101-2020_12_31_424971	689	1	&	&	CC
10_1101-2020_12_31_424971	689	2	Wanner	Wanner	NNP
10_1101-2020_12_31_424971	689	3	,	,	,
10_1101-2020_12_31_424971	689	4	B.L.	B.L.	NNP
10_1101-2020_12_31_424971	690	1	One	one	CD
10_1101-2020_12_31_424971	690	2	-	-	HYPH
10_1101-2020_12_31_424971	690	3	step	step	NN
10_1101-2020_12_31_424971	690	4	inactivation	inactivation	NN
10_1101-2020_12_31_424971	690	5	of	of	IN
10_1101-2020_12_31_424971	690	6	chromosomal	chromosomal	JJ
10_1101-2020_12_31_424971	690	7	genes	gene	NNS
10_1101-2020_12_31_424971	690	8	in	in	IN
10_1101-2020_12_31_424971	690	9	1157	1157	CD
10_1101-2020_12_31_424971	690	10	Escherichia	Escherichia	NNP
10_1101-2020_12_31_424971	690	11	coli	coli	NNS
10_1101-2020_12_31_424971	690	12	K-12	k-12	CD
10_1101-2020_12_31_424971	690	13	using	use	VBG
10_1101-2020_12_31_424971	690	14	PCR	PCR	NNP
10_1101-2020_12_31_424971	690	15	products	product	NNS
10_1101-2020_12_31_424971	690	16	.	.	.
10_1101-2020_12_31_424971	691	1	Proc	Proc	NNP
10_1101-2020_12_31_424971	691	2	Natl	Natl	NNP
10_1101-2020_12_31_424971	691	3	Acad	Acad	NNP
10_1101-2020_12_31_424971	691	4	Sci	Sci	NNP
10_1101-2020_12_31_424971	691	5	U	U	NNP
10_1101-2020_12_31_424971	691	6	S	S	NNP
10_1101-2020_12_31_424971	691	7	A	A	NNP
10_1101-2020_12_31_424971	691	8	97	97	CD
10_1101-2020_12_31_424971	691	9	,	,	,
10_1101-2020_12_31_424971	691	10	6640	6640	CD
10_1101-2020_12_31_424971	691	11	-	-	SYM
10_1101-2020_12_31_424971	691	12	5	5	CD
10_1101-2020_12_31_424971	691	13	(	(	-LRB-
10_1101-2020_12_31_424971	691	14	2000	2000	CD
10_1101-2020_12_31_424971	691	15	)	)	-RRB-
10_1101-2020_12_31_424971	691	16	.	.	.
10_1101-2020_12_31_424971	692	1	1158	1158	CD
10_1101-2020_12_31_424971	692	2	60	60	CD
10_1101-2020_12_31_424971	692	3	.	.	.
10_1101-2020_12_31_424971	693	1	Fei	Fei	NNP
10_1101-2020_12_31_424971	693	2	,	,	,
10_1101-2020_12_31_424971	693	3	J.	J.	NNP
10_1101-2020_12_31_424971	693	4	et	et	NNP
10_1101-2020_12_31_424971	693	5	al	al	NNP
10_1101-2020_12_31_424971	693	6	.	.	.
10_1101-2020_12_31_424971	694	1	A	a	DT
10_1101-2020_12_31_424971	694	2	highly	highly	RB
10_1101-2020_12_31_424971	694	3	purified	purified	JJ
10_1101-2020_12_31_424971	694	4	,	,	,
10_1101-2020_12_31_424971	694	5	fluorescently	fluorescently	RB
10_1101-2020_12_31_424971	694	6	labeled	label	VBN
10_1101-2020_12_31_424971	694	7	in	in	IN
10_1101-2020_12_31_424971	694	8	vitro	vitro	FW
10_1101-2020_12_31_424971	694	9	translation	translation	NN
10_1101-2020_12_31_424971	694	10	system	system	NN
10_1101-2020_12_31_424971	694	11	for	for	IN
10_1101-2020_12_31_424971	694	12	single-1159	single-1159	NN
10_1101-2020_12_31_424971	694	13	molecule	molecule	JJ
10_1101-2020_12_31_424971	694	14	studies	study	NNS
10_1101-2020_12_31_424971	694	15	of	of	IN
10_1101-2020_12_31_424971	694	16	protein	protein	NN
10_1101-2020_12_31_424971	694	17	synthesis	synthesis	NN
10_1101-2020_12_31_424971	694	18	.	.	.
10_1101-2020_12_31_424971	695	1	Methods	Methods	NNP
10_1101-2020_12_31_424971	695	2	Enzymol	enzymol	JJ
10_1101-2020_12_31_424971	695	3	472	472	CD
10_1101-2020_12_31_424971	695	4	,	,	,
10_1101-2020_12_31_424971	695	5	221	221	CD
10_1101-2020_12_31_424971	695	6	-	-	SYM
10_1101-2020_12_31_424971	695	7	59	59	CD
10_1101-2020_12_31_424971	695	8	(	(	-LRB-
10_1101-2020_12_31_424971	695	9	2010	2010	CD
10_1101-2020_12_31_424971	695	10	)	)	-RRB-
10_1101-2020_12_31_424971	695	11	.	.	.
10_1101-2020_12_31_424971	696	1	1160	1160	CD
10_1101-2020_12_31_424971	696	2	61	61	CD
10_1101-2020_12_31_424971	696	3	.	.	.
10_1101-2020_12_31_424971	697	1	Christian	Christian	NNP
10_1101-2020_12_31_424971	697	2	,	,	,
10_1101-2020_12_31_424971	697	3	T.	T.	NNP
10_1101-2020_12_31_424971	697	4	,	,	,
10_1101-2020_12_31_424971	697	5	Lahoud	Lahoud	NNP
10_1101-2020_12_31_424971	697	6	,	,	,
10_1101-2020_12_31_424971	697	7	G.	G.	NNP
10_1101-2020_12_31_424971	697	8	,	,	,
10_1101-2020_12_31_424971	697	9	Liu	Liu	NNP
10_1101-2020_12_31_424971	697	10	,	,	,
10_1101-2020_12_31_424971	697	11	C.	C.	NNP
10_1101-2020_12_31_424971	697	12	&	&	CC
10_1101-2020_12_31_424971	697	13	Hou	Hou	NNP
10_1101-2020_12_31_424971	697	14	,	,	,
10_1101-2020_12_31_424971	697	15	Y.M.	Y.M.	NNP
10_1101-2020_12_31_424971	698	1	Control	control	NN
10_1101-2020_12_31_424971	698	2	of	of	IN
10_1101-2020_12_31_424971	698	3	catalytic	catalytic	JJ
10_1101-2020_12_31_424971	698	4	cycle	cycle	NN
10_1101-2020_12_31_424971	698	5	by	by	IN
10_1101-2020_12_31_424971	698	6	a	a	DT
10_1101-2020_12_31_424971	698	7	pair	pair	NN
10_1101-2020_12_31_424971	698	8	of	of	IN
10_1101-2020_12_31_424971	698	9	1161	1161	CD
10_1101-2020_12_31_424971	698	10	analogous	analogous	JJ
10_1101-2020_12_31_424971	698	11	tRNA	trna	NN
10_1101-2020_12_31_424971	698	12	modification	modification	NN
10_1101-2020_12_31_424971	698	13	enzymes	enzyme	NNS
10_1101-2020_12_31_424971	698	14	.	.	.
10_1101-2020_12_31_424971	699	1	J	J	NNP
10_1101-2020_12_31_424971	699	2	Mol	Mol	NNP
10_1101-2020_12_31_424971	699	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	699	4	400	400	CD
10_1101-2020_12_31_424971	699	5	,	,	,
10_1101-2020_12_31_424971	699	6	204	204	CD
10_1101-2020_12_31_424971	699	7	-	-	SYM
10_1101-2020_12_31_424971	699	8	17	17	CD
10_1101-2020_12_31_424971	699	9	(	(	-LRB-
10_1101-2020_12_31_424971	699	10	2010	2010	CD
10_1101-2020_12_31_424971	699	11	)	)	-RRB-
10_1101-2020_12_31_424971	699	12	.	.	.
10_1101-2020_12_31_424971	700	1	1162	1162	CD
10_1101-2020_12_31_424971	700	2	62	62	CD
10_1101-2020_12_31_424971	700	3	.	.	.
10_1101-2020_12_31_424971	701	1	Zhang	Zhang	NNP
10_1101-2020_12_31_424971	701	2	,	,	,
10_1101-2020_12_31_424971	701	3	C.M.	C.M.	NNP
10_1101-2020_12_31_424971	701	4	,	,	,
10_1101-2020_12_31_424971	701	5	Perona	Perona	NNP
10_1101-2020_12_31_424971	701	6	,	,	,
10_1101-2020_12_31_424971	701	7	J.J.	J.J.	NNP
10_1101-2020_12_31_424971	701	8	,	,	,
10_1101-2020_12_31_424971	701	9	Ryu	Ryu	NNP
10_1101-2020_12_31_424971	701	10	,	,	,
10_1101-2020_12_31_424971	701	11	K.	K.	NNP
10_1101-2020_12_31_424971	701	12	,	,	,
10_1101-2020_12_31_424971	701	13	Francklyn	Francklyn	NNP
10_1101-2020_12_31_424971	701	14	,	,	,
10_1101-2020_12_31_424971	701	15	C.	C.	NNP
10_1101-2020_12_31_424971	701	16	&	&	CC
10_1101-2020_12_31_424971	701	17	Hou	Hou	NNP
10_1101-2020_12_31_424971	701	18	,	,	,
10_1101-2020_12_31_424971	701	19	Y.M.	Y.M.	NNP
10_1101-2020_12_31_424971	702	1	Distinct	distinct	JJ
10_1101-2020_12_31_424971	702	2	kinetic	kinetic	JJ
10_1101-2020_12_31_424971	702	3	1163	1163	CD
10_1101-2020_12_31_424971	702	4	mechanisms	mechanism	NNS
10_1101-2020_12_31_424971	702	5	of	of	IN
10_1101-2020_12_31_424971	702	6	the	the	DT
10_1101-2020_12_31_424971	702	7	two	two	CD
10_1101-2020_12_31_424971	702	8	classes	class	NNS
10_1101-2020_12_31_424971	702	9	of	of	IN
10_1101-2020_12_31_424971	702	10	Aminoacyl	Aminoacyl	NNP
10_1101-2020_12_31_424971	702	11	-	-	HYPH
10_1101-2020_12_31_424971	702	12	tRNA	trna	NN
10_1101-2020_12_31_424971	702	13	synthetases	synthetase	NNS
10_1101-2020_12_31_424971	702	14	.	.	.
10_1101-2020_12_31_424971	703	1	J	J	NNP
10_1101-2020_12_31_424971	703	2	Mol	Mol	NNP
10_1101-2020_12_31_424971	703	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	703	4	361	361	CD
10_1101-2020_12_31_424971	703	5	,	,	,
10_1101-2020_12_31_424971	703	6	300	300	CD
10_1101-2020_12_31_424971	703	7	-	-	SYM
10_1101-2020_12_31_424971	703	8	11	11	CD
10_1101-2020_12_31_424971	703	9	1164	1164	CD
10_1101-2020_12_31_424971	703	10	(	(	-LRB-
10_1101-2020_12_31_424971	703	11	2006	2006	CD
10_1101-2020_12_31_424971	703	12	)	)	-RRB-
10_1101-2020_12_31_424971	703	13	.	.	.
10_1101-2020_12_31_424971	704	1	1165	1165	CD
10_1101-2020_12_31_424971	704	2	63	63	CD
10_1101-2020_12_31_424971	704	3	.	.	.
10_1101-2020_12_31_424971	705	1	Peacock	Peacock	NNP
10_1101-2020_12_31_424971	705	2	,	,	,
10_1101-2020_12_31_424971	705	3	J.R.	J.R.	NNP
10_1101-2020_12_31_424971	705	4	et	et	NNP
10_1101-2020_12_31_424971	705	5	al	al	NNP
10_1101-2020_12_31_424971	705	6	.	.	.
10_1101-2020_12_31_424971	706	1	Amino	amino	JJ
10_1101-2020_12_31_424971	706	2	acid	acid	NN
10_1101-2020_12_31_424971	706	3	-	-	HYPH
10_1101-2020_12_31_424971	706	4	dependent	dependent	JJ
10_1101-2020_12_31_424971	706	5	stability	stability	NN
10_1101-2020_12_31_424971	706	6	of	of	IN
10_1101-2020_12_31_424971	706	7	the	the	DT
10_1101-2020_12_31_424971	706	8	acyl	acyl	NN
10_1101-2020_12_31_424971	706	9	linkage	linkage	NN
10_1101-2020_12_31_424971	706	10	in	in	IN
10_1101-2020_12_31_424971	706	11	aminoacyl-1166	aminoacyl-1166	NNP
10_1101-2020_12_31_424971	706	12	tRNA	trna	NN
10_1101-2020_12_31_424971	706	13	.	.	.
10_1101-2020_12_31_424971	707	1	RNA	RNA	NNP
10_1101-2020_12_31_424971	707	2	20	20	CD
10_1101-2020_12_31_424971	707	3	,	,	,
10_1101-2020_12_31_424971	707	4	758	758	CD
10_1101-2020_12_31_424971	707	5	-	-	SYM
10_1101-2020_12_31_424971	707	6	64	64	CD
10_1101-2020_12_31_424971	707	7	(	(	-LRB-
10_1101-2020_12_31_424971	707	8	2014	2014	CD
10_1101-2020_12_31_424971	707	9	)	)	-RRB-
10_1101-2020_12_31_424971	707	10	.	.	.
10_1101-2020_12_31_424971	708	1	1167	1167	CD
10_1101-2020_12_31_424971	708	2	.CC	.CC	:
10_1101-2020_12_31_424971	708	3	-	-	HYPH
10_1101-2020_12_31_424971	708	4	BY	by	IN
10_1101-2020_12_31_424971	708	5	-	-	HYPH
10_1101-2020_12_31_424971	708	6	NC	NC	NNP
10_1101-2020_12_31_424971	708	7	-	-	HYPH
10_1101-2020_12_31_424971	708	8	ND	ND	NNP
10_1101-2020_12_31_424971	708	9	4.0	4.0	CD
10_1101-2020_12_31_424971	708	10	International	International	NNP
10_1101-2020_12_31_424971	708	11	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	708	12	under	under	IN
10_1101-2020_12_31_424971	708	13	a	a	DT
10_1101-2020_12_31_424971	708	14	(	(	-LRB-
10_1101-2020_12_31_424971	708	15	which	which	WDT
10_1101-2020_12_31_424971	708	16	was	be	VBD
10_1101-2020_12_31_424971	708	17	not	not	RB
10_1101-2020_12_31_424971	708	18	certified	certify	VBN
10_1101-2020_12_31_424971	708	19	by	by	IN
10_1101-2020_12_31_424971	708	20	peer	peer	NN
10_1101-2020_12_31_424971	708	21	review	review	NN
10_1101-2020_12_31_424971	708	22	)	)	-RRB-
10_1101-2020_12_31_424971	708	23	is	be	VBZ
10_1101-2020_12_31_424971	708	24	the	the	DT
10_1101-2020_12_31_424971	708	25	author	author	NN
10_1101-2020_12_31_424971	708	26	/	/	SYM
10_1101-2020_12_31_424971	708	27	funder	funder	NN
10_1101-2020_12_31_424971	708	28	,	,	,
10_1101-2020_12_31_424971	708	29	who	who	WP
10_1101-2020_12_31_424971	708	30	has	have	VBZ
10_1101-2020_12_31_424971	708	31	granted	grant	VBN
10_1101-2020_12_31_424971	708	32	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	708	33	a	a	DT
10_1101-2020_12_31_424971	708	34	license	license	NN
10_1101-2020_12_31_424971	708	35	to	to	TO
10_1101-2020_12_31_424971	708	36	display	display	VB
10_1101-2020_12_31_424971	708	37	the	the	DT
10_1101-2020_12_31_424971	708	38	preprint	preprint	NN
10_1101-2020_12_31_424971	708	39	in	in	IN
10_1101-2020_12_31_424971	708	40	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	708	41	.	.	.
10_1101-2020_12_31_424971	709	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	709	2	is	be	VBZ
10_1101-2020_12_31_424971	709	3	made	make	VBN
10_1101-2020_12_31_424971	709	4	The	the	DT
10_1101-2020_12_31_424971	709	5	copyright	copyright	NN
10_1101-2020_12_31_424971	709	6	holder	holder	NN
10_1101-2020_12_31_424971	709	7	for	for	IN
10_1101-2020_12_31_424971	709	8	this	this	DT
10_1101-2020_12_31_424971	709	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	709	10	version	version	NN
10_1101-2020_12_31_424971	709	11	posted	post	VBD
10_1101-2020_12_31_424971	709	12	January	January	NNP
10_1101-2020_12_31_424971	709	13	2	2	CD
10_1101-2020_12_31_424971	709	14	,	,	,
10_1101-2020_12_31_424971	709	15	2021	2021	CD
10_1101-2020_12_31_424971	709	16	.	.	.
10_1101-2020_12_31_424971	709	17	;	;	:
10_1101-2020_12_31_424971	709	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	709	19	:	:	:
10_1101-2020_12_31_424971	709	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	709	21	preprint	preprint	NN
10_1101-2020_12_31_424971	709	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	709	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	709	24	45	45	CD
10_1101-2020_12_31_424971	709	25	64	64	CD
10_1101-2020_12_31_424971	709	26	.	.	.
10_1101-2020_12_31_424971	710	1	Aitken	Aitken	NNP
10_1101-2020_12_31_424971	710	2	,	,	,
10_1101-2020_12_31_424971	710	3	C.E.	C.E.	NNP
10_1101-2020_12_31_424971	710	4	,	,	,
10_1101-2020_12_31_424971	710	5	Marshall	Marshall	NNP
10_1101-2020_12_31_424971	710	6	,	,	,
10_1101-2020_12_31_424971	710	7	R.A.	R.A.	NNP
10_1101-2020_12_31_424971	710	8	&	&	CC
10_1101-2020_12_31_424971	710	9	Puglisi	Puglisi	NNP
10_1101-2020_12_31_424971	710	10	,	,	,
10_1101-2020_12_31_424971	710	11	J.D.	J.D.	NNP
10_1101-2020_12_31_424971	711	1	An	an	DT
10_1101-2020_12_31_424971	711	2	oxygen	oxygen	NN
10_1101-2020_12_31_424971	711	3	scavenging	scavenge	VBG
10_1101-2020_12_31_424971	711	4	system	system	NN
10_1101-2020_12_31_424971	711	5	for	for	IN
10_1101-2020_12_31_424971	711	6	1168	1168	CD
10_1101-2020_12_31_424971	711	7	improvement	improvement	NN
10_1101-2020_12_31_424971	711	8	of	of	IN
10_1101-2020_12_31_424971	711	9	dye	dye	NN
10_1101-2020_12_31_424971	711	10	stability	stability	NN
10_1101-2020_12_31_424971	711	11	in	in	IN
10_1101-2020_12_31_424971	711	12	single	single	JJ
10_1101-2020_12_31_424971	711	13	-	-	HYPH
10_1101-2020_12_31_424971	711	14	molecule	molecule	NN
10_1101-2020_12_31_424971	711	15	fluorescence	fluorescence	NN
10_1101-2020_12_31_424971	711	16	experiments	experiment	NNS
10_1101-2020_12_31_424971	711	17	.	.	.
10_1101-2020_12_31_424971	712	1	Biophys	Biophys	NNP
10_1101-2020_12_31_424971	712	2	J	J	NNP
10_1101-2020_12_31_424971	712	3	94	94	CD
10_1101-2020_12_31_424971	712	4	,	,	,
10_1101-2020_12_31_424971	712	5	1169	1169	CD
10_1101-2020_12_31_424971	712	6	1826	1826	CD
10_1101-2020_12_31_424971	712	7	-	-	SYM
10_1101-2020_12_31_424971	712	8	35	35	CD
10_1101-2020_12_31_424971	712	9	(	(	-LRB-
10_1101-2020_12_31_424971	712	10	2008	2008	CD
10_1101-2020_12_31_424971	712	11	)	)	-RRB-
10_1101-2020_12_31_424971	712	12	.	.	.
10_1101-2020_12_31_424971	713	1	1170	1170	CD
10_1101-2020_12_31_424971	713	2	65	65	CD
10_1101-2020_12_31_424971	713	3	.	.	.
10_1101-2020_12_31_424971	714	1	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	714	2	,	,	,
10_1101-2020_12_31_424971	714	3	R.L.	R.L.	NNP
10_1101-2020_12_31_424971	714	4	,	,	,
10_1101-2020_12_31_424971	714	5	Jr.	Jr.	NNP
10_1101-2020_12_31_424971	714	6	,	,	,
10_1101-2020_12_31_424971	714	7	Chu	Chu	NNP
10_1101-2020_12_31_424971	714	8	,	,	,
10_1101-2020_12_31_424971	714	9	S.	S.	NNP
10_1101-2020_12_31_424971	714	10	&	&	CC
10_1101-2020_12_31_424971	714	11	Puglisi	Puglisi	NNP
10_1101-2020_12_31_424971	714	12	,	,	,
10_1101-2020_12_31_424971	714	13	J.D.	J.D.	NNP
10_1101-2020_12_31_424971	715	1	Thiostrepton	Thiostrepton	NNP
10_1101-2020_12_31_424971	715	2	inhibition	inhibition	NN
10_1101-2020_12_31_424971	715	3	of	of	IN
10_1101-2020_12_31_424971	715	4	tRNA	trna	NN
10_1101-2020_12_31_424971	715	5	delivery	delivery	NN
10_1101-2020_12_31_424971	715	6	to	to	IN
10_1101-2020_12_31_424971	715	7	the	the	DT
10_1101-2020_12_31_424971	715	8	1171	1171	CD
10_1101-2020_12_31_424971	715	9	ribosome	ribosome	VBD
10_1101-2020_12_31_424971	715	10	.	.	.
10_1101-2020_12_31_424971	716	1	RNA	RNA	NNP
10_1101-2020_12_31_424971	716	2	13	13	CD
10_1101-2020_12_31_424971	716	3	,	,	,
10_1101-2020_12_31_424971	716	4	2091	2091	CD
10_1101-2020_12_31_424971	716	5	-	-	SYM
10_1101-2020_12_31_424971	716	6	7	7	CD
10_1101-2020_12_31_424971	716	7	(	(	-LRB-
10_1101-2020_12_31_424971	716	8	2007	2007	CD
10_1101-2020_12_31_424971	716	9	)	)	-RRB-
10_1101-2020_12_31_424971	716	10	.	.	.
10_1101-2020_12_31_424971	717	1	1172	1172	CD
10_1101-2020_12_31_424971	717	2	66	66	CD
10_1101-2020_12_31_424971	717	3	.	.	.
10_1101-2020_12_31_424971	718	1	Desai	Desai	NNP
10_1101-2020_12_31_424971	718	2	,	,	,
10_1101-2020_12_31_424971	718	3	B.J.	B.J.	NNP
10_1101-2020_12_31_424971	719	1	&	&	CC
10_1101-2020_12_31_424971	719	2	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	719	3	,	,	,
10_1101-2020_12_31_424971	719	4	R.L.	R.L.	NNP
10_1101-2020_12_31_424971	719	5	,	,	,
10_1101-2020_12_31_424971	719	6	Jr.	Jr.	NNP
10_1101-2020_12_31_424971	719	7	Multiplexed	Multiplexed	NNP
10_1101-2020_12_31_424971	719	8	,	,	,
10_1101-2020_12_31_424971	719	9	bioorthogonal	bioorthogonal	JJ
10_1101-2020_12_31_424971	719	10	labeling	labeling	NN
10_1101-2020_12_31_424971	719	11	of	of	IN
10_1101-2020_12_31_424971	719	12	multicomponent	multicomponent	NN
10_1101-2020_12_31_424971	719	13	,	,	,
10_1101-2020_12_31_424971	719	14	1173	1173	CD
10_1101-2020_12_31_424971	719	15	biomolecular	biomolecular	JJ
10_1101-2020_12_31_424971	719	16	complexes	complex	NNS
10_1101-2020_12_31_424971	719	17	using	use	VBG
10_1101-2020_12_31_424971	719	18	genomically	genomically	RB
10_1101-2020_12_31_424971	719	19	encoded	encode	VBN
10_1101-2020_12_31_424971	719	20	,	,	,
10_1101-2020_12_31_424971	719	21	non	non	JJ
10_1101-2020_12_31_424971	719	22	-	-	JJ
10_1101-2020_12_31_424971	719	23	canonical	canonical	JJ
10_1101-2020_12_31_424971	719	24	amino	amino	NN
10_1101-2020_12_31_424971	719	25	acids	acid	NNS
10_1101-2020_12_31_424971	719	26	.	.	.
10_1101-2020_12_31_424971	720	1	1174	1174	CD
10_1101-2020_12_31_424971	720	2	bioRxiv	biorxiv	NN
10_1101-2020_12_31_424971	720	3	doi	doi	NN
10_1101-2020_12_31_424971	720	4	:	:	:
10_1101-2020_12_31_424971	720	5	10.1101/730465(2019	10.1101/730465(2019	LS
10_1101-2020_12_31_424971	720	6	)	)	-RRB-
10_1101-2020_12_31_424971	720	7	.	.	.
10_1101-2020_12_31_424971	721	1	1175	1175	CD
10_1101-2020_12_31_424971	721	2	67	67	CD
10_1101-2020_12_31_424971	721	3	.	.	.
10_1101-2020_12_31_424971	722	1	MacDougall	MacDougall	NNP
10_1101-2020_12_31_424971	722	2	,	,	,
10_1101-2020_12_31_424971	722	3	D.D.	D.D.	NNP
10_1101-2020_12_31_424971	723	1	&	&	CC
10_1101-2020_12_31_424971	723	2	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	723	3	,	,	,
10_1101-2020_12_31_424971	723	4	R.L.	R.L.	NNP
10_1101-2020_12_31_424971	723	5	,	,	,
10_1101-2020_12_31_424971	723	6	Jr.	Jr.	NNP
10_1101-2020_12_31_424971	724	1	Translation	translation	NN
10_1101-2020_12_31_424971	724	2	initiation	initiation	NN
10_1101-2020_12_31_424971	724	3	factor	factor	NN
10_1101-2020_12_31_424971	724	4	3	3	CD
10_1101-2020_12_31_424971	724	5	regulates	regulate	NNS
10_1101-2020_12_31_424971	724	6	switching	switch	VBG
10_1101-2020_12_31_424971	724	7	1176	1176	CD
10_1101-2020_12_31_424971	724	8	between	between	IN
10_1101-2020_12_31_424971	724	9	different	different	JJ
10_1101-2020_12_31_424971	724	10	modes	mode	NNS
10_1101-2020_12_31_424971	724	11	of	of	IN
10_1101-2020_12_31_424971	724	12	ribosomal	ribosomal	NNP
10_1101-2020_12_31_424971	724	13	subunit	subunit	NN
10_1101-2020_12_31_424971	724	14	joining	joining	NN
10_1101-2020_12_31_424971	724	15	.	.	.
10_1101-2020_12_31_424971	725	1	J	J	NNP
10_1101-2020_12_31_424971	725	2	Mol	Mol	NNP
10_1101-2020_12_31_424971	725	3	Biol	Biol	NNP
10_1101-2020_12_31_424971	725	4	427	427	CD
10_1101-2020_12_31_424971	725	5	,	,	,
10_1101-2020_12_31_424971	725	6	1801	1801	CD
10_1101-2020_12_31_424971	725	7	-	-	SYM
10_1101-2020_12_31_424971	725	8	18	18	CD
10_1101-2020_12_31_424971	725	9	(	(	-LRB-
10_1101-2020_12_31_424971	725	10	2015	2015	CD
10_1101-2020_12_31_424971	725	11	)	)	-RRB-
10_1101-2020_12_31_424971	725	12	.	.	.
10_1101-2020_12_31_424971	726	1	1177	1177	CD
10_1101-2020_12_31_424971	726	2	68	68	CD
10_1101-2020_12_31_424971	726	3	.	.	.
10_1101-2020_12_31_424971	727	1	Bronson	Bronson	NNP
10_1101-2020_12_31_424971	727	2	,	,	,
10_1101-2020_12_31_424971	727	3	J.E.	J.E.	NNP
10_1101-2020_12_31_424971	727	4	,	,	,
10_1101-2020_12_31_424971	727	5	Fei	Fei	NNP
10_1101-2020_12_31_424971	727	6	,	,	,
10_1101-2020_12_31_424971	727	7	J.	J.	NNP
10_1101-2020_12_31_424971	727	8	,	,	,
10_1101-2020_12_31_424971	727	9	Hofman	Hofman	NNP
10_1101-2020_12_31_424971	727	10	,	,	,
10_1101-2020_12_31_424971	727	11	J.M.	J.M.	NNP
10_1101-2020_12_31_424971	727	12	,	,	,
10_1101-2020_12_31_424971	727	13	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	727	14	,	,	,
10_1101-2020_12_31_424971	727	15	R.L.	R.L.	NNP
10_1101-2020_12_31_424971	727	16	,	,	,
10_1101-2020_12_31_424971	727	17	Jr.	Jr.	NNP
10_1101-2020_12_31_424971	727	18	&	&	CC
10_1101-2020_12_31_424971	727	19	Wiggins	Wiggins	NNP
10_1101-2020_12_31_424971	727	20	,	,	,
10_1101-2020_12_31_424971	727	21	C.H.	C.H.	NNP
10_1101-2020_12_31_424971	728	1	Learning	learning	NN
10_1101-2020_12_31_424971	728	2	rates	rate	NNS
10_1101-2020_12_31_424971	728	3	1178	1178	CD
10_1101-2020_12_31_424971	728	4	and	and	CC
10_1101-2020_12_31_424971	728	5	states	state	NNS
10_1101-2020_12_31_424971	728	6	from	from	IN
10_1101-2020_12_31_424971	728	7	biophysical	biophysical	JJ
10_1101-2020_12_31_424971	728	8	time	time	NN
10_1101-2020_12_31_424971	728	9	series	series	NNP
10_1101-2020_12_31_424971	728	10	:	:	:
10_1101-2020_12_31_424971	728	11	a	a	DT
10_1101-2020_12_31_424971	728	12	Bayesian	bayesian	JJ
10_1101-2020_12_31_424971	728	13	approach	approach	NN
10_1101-2020_12_31_424971	728	14	to	to	IN
10_1101-2020_12_31_424971	728	15	model	model	NN
10_1101-2020_12_31_424971	728	16	selection	selection	NN
10_1101-2020_12_31_424971	728	17	and	and	CC
10_1101-2020_12_31_424971	728	18	1179	1179	CD
10_1101-2020_12_31_424971	728	19	single	single	JJ
10_1101-2020_12_31_424971	728	20	-	-	HYPH
10_1101-2020_12_31_424971	728	21	molecule	molecule	NN
10_1101-2020_12_31_424971	728	22	FRET	FRET	NNP
10_1101-2020_12_31_424971	728	23	data	datum	NNS
10_1101-2020_12_31_424971	728	24	.	.	.
10_1101-2020_12_31_424971	729	1	Biophys	Biophys	NNP
10_1101-2020_12_31_424971	729	2	J	J	NNP
10_1101-2020_12_31_424971	729	3	97	97	CD
10_1101-2020_12_31_424971	729	4	,	,	,
10_1101-2020_12_31_424971	729	5	3196	3196	CD
10_1101-2020_12_31_424971	729	6	-	-	SYM
10_1101-2020_12_31_424971	729	7	205	205	CD
10_1101-2020_12_31_424971	729	8	(	(	-LRB-
10_1101-2020_12_31_424971	729	9	2009	2009	CD
10_1101-2020_12_31_424971	729	10	)	)	-RRB-
10_1101-2020_12_31_424971	729	11	.	.	.
10_1101-2020_12_31_424971	730	1	1180	1180	CD
10_1101-2020_12_31_424971	730	2	69	69	CD
10_1101-2020_12_31_424971	730	3	.	.	.
10_1101-2020_12_31_424971	731	1	Viterbi	Viterbi	NNP
10_1101-2020_12_31_424971	731	2	,	,	,
10_1101-2020_12_31_424971	731	3	A.J.	A.J.	NNP
10_1101-2020_12_31_424971	732	1	Error	error	NN
10_1101-2020_12_31_424971	732	2	bounds	bound	NNS
10_1101-2020_12_31_424971	732	3	for	for	IN
10_1101-2020_12_31_424971	732	4	convolutional	convolutional	JJ
10_1101-2020_12_31_424971	732	5	codes	code	NNS
10_1101-2020_12_31_424971	732	6	and	and	CC
10_1101-2020_12_31_424971	732	7	an	an	DT
10_1101-2020_12_31_424971	732	8	asymptotically	asymptotically	RB
10_1101-2020_12_31_424971	732	9	optimum	optimum	JJ
10_1101-2020_12_31_424971	732	10	1181	1181	CD
10_1101-2020_12_31_424971	732	11	decoding	decode	VBG
10_1101-2020_12_31_424971	732	12	algorithm	algorithm	NNP
10_1101-2020_12_31_424971	732	13	.	.	.
10_1101-2020_12_31_424971	733	1	IEEE	IEEE	NNP
10_1101-2020_12_31_424971	733	2	Trans	Trans	NNPS
10_1101-2020_12_31_424971	733	3	.	.	.
10_1101-2020_12_31_424971	734	1	Inform	inform	NN
10_1101-2020_12_31_424971	734	2	.	.	.
10_1101-2020_12_31_424971	735	1	Theory	theory	NN
10_1101-2020_12_31_424971	735	2	13	13	CD
10_1101-2020_12_31_424971	735	3	,	,	,
10_1101-2020_12_31_424971	735	4	260	260	CD
10_1101-2020_12_31_424971	735	5	-	-	HYPH
10_1101-2020_12_31_424971	735	6	269	269	CD
10_1101-2020_12_31_424971	735	7	(	(	-LRB-
10_1101-2020_12_31_424971	735	8	1967	1967	CD
10_1101-2020_12_31_424971	735	9	)	)	-RRB-
10_1101-2020_12_31_424971	735	10	.	.	.
10_1101-2020_12_31_424971	736	1	1182	1182	CD
10_1101-2020_12_31_424971	736	2	70	70	CD
10_1101-2020_12_31_424971	736	3	.	.	.
10_1101-2020_12_31_424971	737	1	Agirrezabala	Agirrezabala	NNP
10_1101-2020_12_31_424971	737	2	,	,	,
10_1101-2020_12_31_424971	737	3	X.	X.	NNP
10_1101-2020_12_31_424971	737	4	et	et	NNP
10_1101-2020_12_31_424971	737	5	al	al	NNP
10_1101-2020_12_31_424971	737	6	.	.	.
10_1101-2020_12_31_424971	738	1	Visualization	visualization	NN
10_1101-2020_12_31_424971	738	2	of	of	IN
10_1101-2020_12_31_424971	738	3	the	the	DT
10_1101-2020_12_31_424971	738	4	hybrid	hybrid	JJ
10_1101-2020_12_31_424971	738	5	state	state	NN
10_1101-2020_12_31_424971	738	6	of	of	IN
10_1101-2020_12_31_424971	738	7	tRNA	trna	NN
10_1101-2020_12_31_424971	738	8	binding	bind	VBG
10_1101-2020_12_31_424971	738	9	promoted	promote	VBN
10_1101-2020_12_31_424971	738	10	by	by	IN
10_1101-2020_12_31_424971	738	11	1183	1183	CD
10_1101-2020_12_31_424971	738	12	spontaneous	spontaneous	JJ
10_1101-2020_12_31_424971	738	13	ratcheting	ratcheting	NN
10_1101-2020_12_31_424971	738	14	of	of	IN
10_1101-2020_12_31_424971	738	15	the	the	DT
10_1101-2020_12_31_424971	738	16	ribosome	ribosome	NN
10_1101-2020_12_31_424971	738	17	.	.	.
10_1101-2020_12_31_424971	739	1	Mol	Mol	NNP
10_1101-2020_12_31_424971	739	2	Cell	Cell	NNP
10_1101-2020_12_31_424971	739	3	32	32	CD
10_1101-2020_12_31_424971	739	4	,	,	,
10_1101-2020_12_31_424971	739	5	190	190	CD
10_1101-2020_12_31_424971	739	6	-	-	SYM
10_1101-2020_12_31_424971	739	7	7	7	CD
10_1101-2020_12_31_424971	739	8	(	(	-LRB-
10_1101-2020_12_31_424971	739	9	2008	2008	CD
10_1101-2020_12_31_424971	739	10	)	)	-RRB-
10_1101-2020_12_31_424971	739	11	.	.	.
10_1101-2020_12_31_424971	740	1	1184	1184	CD
10_1101-2020_12_31_424971	740	2	1185	1185	CD
10_1101-2020_12_31_424971	740	3	1186	1186	CD
10_1101-2020_12_31_424971	740	4	.CC	.CC	:
10_1101-2020_12_31_424971	740	5	-	-	HYPH
10_1101-2020_12_31_424971	740	6	BY	by	IN
10_1101-2020_12_31_424971	740	7	-	-	HYPH
10_1101-2020_12_31_424971	740	8	NC	NC	NNP
10_1101-2020_12_31_424971	740	9	-	-	HYPH
10_1101-2020_12_31_424971	740	10	ND	ND	NNP
10_1101-2020_12_31_424971	740	11	4.0	4.0	CD
10_1101-2020_12_31_424971	740	12	International	International	NNP
10_1101-2020_12_31_424971	740	13	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	740	14	under	under	IN
10_1101-2020_12_31_424971	740	15	a	a	DT
10_1101-2020_12_31_424971	740	16	(	(	-LRB-
10_1101-2020_12_31_424971	740	17	which	which	WDT
10_1101-2020_12_31_424971	740	18	was	be	VBD
10_1101-2020_12_31_424971	740	19	not	not	RB
10_1101-2020_12_31_424971	740	20	certified	certify	VBN
10_1101-2020_12_31_424971	740	21	by	by	IN
10_1101-2020_12_31_424971	740	22	peer	peer	NN
10_1101-2020_12_31_424971	740	23	review	review	NN
10_1101-2020_12_31_424971	740	24	)	)	-RRB-
10_1101-2020_12_31_424971	740	25	is	be	VBZ
10_1101-2020_12_31_424971	740	26	the	the	DT
10_1101-2020_12_31_424971	740	27	author	author	NN
10_1101-2020_12_31_424971	740	28	/	/	SYM
10_1101-2020_12_31_424971	740	29	funder	funder	NN
10_1101-2020_12_31_424971	740	30	,	,	,
10_1101-2020_12_31_424971	740	31	who	who	WP
10_1101-2020_12_31_424971	740	32	has	have	VBZ
10_1101-2020_12_31_424971	740	33	granted	grant	VBN
10_1101-2020_12_31_424971	740	34	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	740	35	a	a	DT
10_1101-2020_12_31_424971	740	36	license	license	NN
10_1101-2020_12_31_424971	740	37	to	to	TO
10_1101-2020_12_31_424971	740	38	display	display	VB
10_1101-2020_12_31_424971	740	39	the	the	DT
10_1101-2020_12_31_424971	740	40	preprint	preprint	NN
10_1101-2020_12_31_424971	740	41	in	in	IN
10_1101-2020_12_31_424971	740	42	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	740	43	.	.	.
10_1101-2020_12_31_424971	741	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	741	2	is	be	VBZ
10_1101-2020_12_31_424971	741	3	made	make	VBN
10_1101-2020_12_31_424971	741	4	The	the	DT
10_1101-2020_12_31_424971	741	5	copyright	copyright	NN
10_1101-2020_12_31_424971	741	6	holder	holder	NN
10_1101-2020_12_31_424971	741	7	for	for	IN
10_1101-2020_12_31_424971	741	8	this	this	DT
10_1101-2020_12_31_424971	741	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	741	10	version	version	NN
10_1101-2020_12_31_424971	741	11	posted	post	VBD
10_1101-2020_12_31_424971	741	12	January	January	NNP
10_1101-2020_12_31_424971	741	13	2	2	CD
10_1101-2020_12_31_424971	741	14	,	,	,
10_1101-2020_12_31_424971	741	15	2021	2021	CD
10_1101-2020_12_31_424971	741	16	.	.	.
10_1101-2020_12_31_424971	741	17	;	;	:
10_1101-2020_12_31_424971	741	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	741	19	:	:	:
10_1101-2020_12_31_424971	741	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	741	21	preprint	preprint	NN
10_1101-2020_12_31_424971	741	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	741	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	741	24	46	46	CD
10_1101-2020_12_31_424971	741	25	ACKNOWLEDGEMENTS	acknowledgement	NNS
10_1101-2020_12_31_424971	741	26	1187	1187	CD
10_1101-2020_12_31_424971	741	27	We	-PRON-	PRP
10_1101-2020_12_31_424971	741	28	thank	thank	VBP
10_1101-2020_12_31_424971	741	29	Dr.	Dr.	NNP
10_1101-2020_12_31_424971	741	30	Hajime	Hajime	NNP
10_1101-2020_12_31_424971	741	31	Tokuda	Tokuda	NNP
10_1101-2020_12_31_424971	741	32	for	for	IN
10_1101-2020_12_31_424971	741	33	rabbit	rabbit	NN
10_1101-2020_12_31_424971	741	34	polyclonal	polyclonal	JJ
10_1101-2020_12_31_424971	741	35	anti	anti	JJ
10_1101-2020_12_31_424971	741	36	-	-	JJ
10_1101-2020_12_31_424971	741	37	LolB	lolb	JJ
10_1101-2020_12_31_424971	741	38	antibodies	antibody	NNS
10_1101-2020_12_31_424971	741	39	,	,	,
10_1101-2020_12_31_424971	741	40	Dr.	Dr.	NNP
10_1101-2020_12_31_424971	741	41	Colin	Colin	NNP
10_1101-2020_12_31_424971	741	42	Kinz-1188	Kinz-1188	NNP
10_1101-2020_12_31_424971	741	43	Thompson	Thompson	NNP
10_1101-2020_12_31_424971	741	44	and	and	CC
10_1101-2020_12_31_424971	741	45	Korak	Korak	NNP
10_1101-2020_12_31_424971	741	46	Kumar	Kumar	NNP
10_1101-2020_12_31_424971	741	47	Ray	Ray	NNP
10_1101-2020_12_31_424971	741	48	for	for	IN
10_1101-2020_12_31_424971	741	49	help	help	NN
10_1101-2020_12_31_424971	741	50	with	with	IN
10_1101-2020_12_31_424971	741	51	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	741	52	data	datum	NNS
10_1101-2020_12_31_424971	741	53	analysis	analysis	NN
10_1101-2020_12_31_424971	741	54	.	.	.
10_1101-2020_12_31_424971	742	1	R.L.G.	R.L.G.	NNP
10_1101-2020_12_31_424971	743	1	and	and	CC
10_1101-2020_12_31_424971	743	2	H.L.	H.L.	NNP
10_1101-2020_12_31_424971	744	1	thank	thank	VBP
10_1101-2020_12_31_424971	744	2	the	the	DT
10_1101-2020_12_31_424971	744	3	1189	1189	CD
10_1101-2020_12_31_424971	744	4	Columbia	Columbia	NNP
10_1101-2020_12_31_424971	744	5	University	University	NNP
10_1101-2020_12_31_424971	744	6	Precision	Precision	NNP
10_1101-2020_12_31_424971	744	7	Biomolecular	Biomolecular	NNP
10_1101-2020_12_31_424971	744	8	Characterization	Characterization	NNP
10_1101-2020_12_31_424971	744	9	Facility	Facility	NNP
10_1101-2020_12_31_424971	744	10	for	for	IN
10_1101-2020_12_31_424971	744	11	access	access	NN
10_1101-2020_12_31_424971	744	12	to	to	IN
10_1101-2020_12_31_424971	744	13	and	and	CC
10_1101-2020_12_31_424971	744	14	support	support	NN
10_1101-2020_12_31_424971	744	15	of	of	IN
10_1101-2020_12_31_424971	744	16	1190	1190	CD
10_1101-2020_12_31_424971	744	17	instrumentation	instrumentation	NN
10_1101-2020_12_31_424971	744	18	.	.	.
10_1101-2020_12_31_424971	745	1	This	this	DT
10_1101-2020_12_31_424971	745	2	work	work	NN
10_1101-2020_12_31_424971	745	3	was	be	VBD
10_1101-2020_12_31_424971	745	4	supported	support	VBN
10_1101-2020_12_31_424971	745	5	by	by	IN
10_1101-2020_12_31_424971	745	6	NIH	NIH	NNP
10_1101-2020_12_31_424971	745	7	grants	grant	NNS
10_1101-2020_12_31_424971	745	8	GM134931	gm134931	ADD
10_1101-2020_12_31_424971	745	9	to	to	IN
10_1101-2020_12_31_424971	745	10	Y	Y	NNP
10_1101-2020_12_31_424971	745	11	-	-	HYPH
10_1101-2020_12_31_424971	745	12	M.H.	M.H.	NNP
10_1101-2020_12_31_424971	746	1	and	and	CC
10_1101-2020_12_31_424971	746	2	GM119386	GM119386	NNP
10_1101-2020_12_31_424971	746	3	to	to	IN
10_1101-2020_12_31_424971	746	4	1191	1191	CD
10_1101-2020_12_31_424971	746	5	R.L.G.	R.L.G.	NNP
10_1101-2020_12_31_424971	746	6	,	,	,
10_1101-2020_12_31_424971	746	7	a	a	DT
10_1101-2020_12_31_424971	746	8	Charles	Charles	NNP
10_1101-2020_12_31_424971	746	9	H.	H.	NNP
10_1101-2020_12_31_424971	746	10	Revson	Revson	NNP
10_1101-2020_12_31_424971	746	11	Foundation	Foundation	NNP
10_1101-2020_12_31_424971	746	12	Postdoctoral	Postdoctoral	NNP
10_1101-2020_12_31_424971	746	13	Fellowship	Fellowship	NNP
10_1101-2020_12_31_424971	746	14	in	in	IN
10_1101-2020_12_31_424971	746	15	Biomedical	Biomedical	NNP
10_1101-2020_12_31_424971	746	16	Science	Science	NNP
10_1101-2020_12_31_424971	746	17	19	19	CD
10_1101-2020_12_31_424971	746	18	-	-	SYM
10_1101-2020_12_31_424971	746	19	24	24	CD
10_1101-2020_12_31_424971	746	20	to	to	IN
10_1101-2020_12_31_424971	746	21	1192	1192	CD
10_1101-2020_12_31_424971	746	22	H.L.	H.L.	NNP
10_1101-2020_12_31_424971	746	23	,	,	,
10_1101-2020_12_31_424971	746	24	a	a	DT
10_1101-2020_12_31_424971	746	25	Japanese	japanese	JJ
10_1101-2020_12_31_424971	746	26	JSPS	JSPS	NNP
10_1101-2020_12_31_424971	746	27	overseas	overseas	JJ
10_1101-2020_12_31_424971	746	28	postdoctoral	postdoctoral	JJ
10_1101-2020_12_31_424971	746	29	fellowship	fellowship	NN
10_1101-2020_12_31_424971	746	30	to	to	IN
10_1101-2020_12_31_424971	746	31	I.M.	I.M.	NNP
10_1101-2020_12_31_424971	746	32	,	,	,
10_1101-2020_12_31_424971	746	33	and	and	CC
10_1101-2020_12_31_424971	746	34	NSF	NSF	NNP
10_1101-2020_12_31_424971	746	35	grant	grant	NN
10_1101-2020_12_31_424971	746	36	CHE-1708759	CHE-1708759	NNP
10_1101-2020_12_31_424971	746	37	to	to	IN
10_1101-2020_12_31_424971	746	38	1193	1193	CD
10_1101-2020_12_31_424971	746	39	E.J.P.	E.J.P.	NNP
10_1101-2020_12_31_424971	747	1	1194	1194	CD
10_1101-2020_12_31_424971	747	2	1195	1195	CD
10_1101-2020_12_31_424971	747	3	AUTHOR	AUTHOR	NNP
10_1101-2020_12_31_424971	747	4	CONTRIBUTIONS	CONTRIBUTIONS	NNP
10_1101-2020_12_31_424971	747	5	1196	1196	CD
10_1101-2020_12_31_424971	747	6	H.G.	H.G.	NNP
10_1101-2020_12_31_424971	748	1	conceived	conceive	VBN
10_1101-2020_12_31_424971	748	2	of	of	IN
10_1101-2020_12_31_424971	748	3	and	and	CC
10_1101-2020_12_31_424971	748	4	performed	perform	VBN
10_1101-2020_12_31_424971	748	5	ensemble	ensemble	JJ
10_1101-2020_12_31_424971	748	6	rapid	rapid	JJ
10_1101-2020_12_31_424971	748	7	kinetic	kinetic	NNP
10_1101-2020_12_31_424971	748	8	assays	assay	NNS
10_1101-2020_12_31_424971	748	9	,	,	,
10_1101-2020_12_31_424971	748	10	R.L.G.	R.L.G.	NNP
10_1101-2020_12_31_424971	749	1	and	and	CC
10_1101-2020_12_31_424971	749	2	H.L.	H.L.	NNP
10_1101-2020_12_31_424971	750	1	conceived	conceive	VBD
10_1101-2020_12_31_424971	750	2	1197	1197	CD
10_1101-2020_12_31_424971	750	3	of	of	IN
10_1101-2020_12_31_424971	750	4	and	and	CC
10_1101-2020_12_31_424971	750	5	designed	design	VBD
10_1101-2020_12_31_424971	750	6	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	750	7	assays	assay	NNS
10_1101-2020_12_31_424971	750	8	,	,	,
10_1101-2020_12_31_424971	750	9	H.L.	H.L.	NNP
10_1101-2020_12_31_424971	751	1	performed	perform	VBN
10_1101-2020_12_31_424971	751	2	smFRET	smFRET	NNP
10_1101-2020_12_31_424971	751	3	assays	assay	NNS
10_1101-2020_12_31_424971	751	4	,	,	,
10_1101-2020_12_31_424971	751	5	I.M.	I.M.	NNP
10_1101-2020_12_31_424971	752	1	performed	perform	VBN
10_1101-2020_12_31_424971	752	2	cell	cell	NN
10_1101-2020_12_31_424971	752	3	-	-	HYPH
10_1101-2020_12_31_424971	752	4	based	base	VBN
10_1101-2020_12_31_424971	752	5	1198	1198	CD
10_1101-2020_12_31_424971	752	6	reporter	reporter	NN
10_1101-2020_12_31_424971	752	7	assays	assays	RB
10_1101-2020_12_31_424971	752	8	,	,	,
10_1101-2020_12_31_424971	752	9	D.M.R.	D.M.R.	NNP
10_1101-2020_12_31_424971	753	1	and	and	CC
10_1101-2020_12_31_424971	753	2	E.J.P.	E.J.P.	NNP
10_1101-2020_12_31_424971	754	1	generated	generate	VBN
10_1101-2020_12_31_424971	754	2	aminoacyl	aminoacyl	NNP
10_1101-2020_12_31_424971	754	3	-	-	HYPH
10_1101-2020_12_31_424971	754	4	DBE	DBE	NNP
10_1101-2020_12_31_424971	754	5	derivatives	derivative	NNS
10_1101-2020_12_31_424971	754	6	,	,	,
10_1101-2020_12_31_424971	754	7	T.C.	T.C.	NNP
10_1101-2020_12_31_424971	755	1	performed	perform	VBN
10_1101-2020_12_31_424971	755	2	G37	G37	NNP
10_1101-2020_12_31_424971	755	3	1199	1199	CD
10_1101-2020_12_31_424971	755	4	methylation	methylation	NN
10_1101-2020_12_31_424971	755	5	and	and	CC
10_1101-2020_12_31_424971	755	6	aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	755	7	assays	assays	RB
10_1101-2020_12_31_424971	755	8	,	,	,
10_1101-2020_12_31_424971	755	9	and	and	CC
10_1101-2020_12_31_424971	755	10	A.B.C.	A.B.C.	NNP
10_1101-2020_12_31_424971	756	1	and	and	CC
10_1101-2020_12_31_424971	756	2	G.B.	G.B.	NNP
10_1101-2020_12_31_424971	757	1	provided	provide	VBN
10_1101-2020_12_31_424971	757	2	E.	E.	NNP
10_1101-2020_12_31_424971	757	3	coli	coli	NNS
10_1101-2020_12_31_424971	757	4	70S	70S	NNP
10_1101-2020_12_31_424971	757	5	ribosomes	ribosome	NNS
10_1101-2020_12_31_424971	757	6	.	.	.
10_1101-2020_12_31_424971	758	1	1200	1200	CD
10_1101-2020_12_31_424971	758	2	Y.M.H.	Y.M.H.	NNP
10_1101-2020_12_31_424971	759	1	and	and	CC
10_1101-2020_12_31_424971	759	2	R.L.G.	R.L.G.	NNP
10_1101-2020_12_31_424971	760	1	wrote	write	VBD
10_1101-2020_12_31_424971	760	2	the	the	DT
10_1101-2020_12_31_424971	760	3	manuscript	manuscript	NN
10_1101-2020_12_31_424971	760	4	.	.	.
10_1101-2020_12_31_424971	761	1	1201	1201	CD
10_1101-2020_12_31_424971	761	2	1202	1202	CD
10_1101-2020_12_31_424971	761	3	COMPETING	COMPETING	NNP
10_1101-2020_12_31_424971	761	4	FINANICAL	FINANICAL	NNP
10_1101-2020_12_31_424971	761	5	INTERESTS	INTERESTS	NNP
10_1101-2020_12_31_424971	761	6	1203	1203	CD
10_1101-2020_12_31_424971	761	7	The	the	DT
10_1101-2020_12_31_424971	761	8	authors	author	NNS
10_1101-2020_12_31_424971	761	9	declare	declare	VBP
10_1101-2020_12_31_424971	761	10	no	no	DT
10_1101-2020_12_31_424971	761	11	competing	compete	VBG
10_1101-2020_12_31_424971	761	12	interests	interest	NNS
10_1101-2020_12_31_424971	761	13	.	.	.
10_1101-2020_12_31_424971	762	1	1204	1204	CD
10_1101-2020_12_31_424971	762	2	1205	1205	CD
10_1101-2020_12_31_424971	762	3	CONTACT	contact	NN
10_1101-2020_12_31_424971	762	4	FOR	for	IN
10_1101-2020_12_31_424971	762	5	REAGENT	REAGENT	NNP
10_1101-2020_12_31_424971	762	6	AND	and	CC
10_1101-2020_12_31_424971	762	7	RESOURCE	resource	NN
10_1101-2020_12_31_424971	762	8	SHARING	sharing	NN
10_1101-2020_12_31_424971	762	9	1206	1206	CD
10_1101-2020_12_31_424971	762	10	Further	further	JJ
10_1101-2020_12_31_424971	762	11	information	information	NN
10_1101-2020_12_31_424971	762	12	and	and	CC
10_1101-2020_12_31_424971	762	13	requests	request	NNS
10_1101-2020_12_31_424971	762	14	for	for	IN
10_1101-2020_12_31_424971	762	15	resources	resource	NNS
10_1101-2020_12_31_424971	762	16	and	and	CC
10_1101-2020_12_31_424971	762	17	reagents	reagent	NNS
10_1101-2020_12_31_424971	762	18	should	should	MD
10_1101-2020_12_31_424971	762	19	be	be	VB
10_1101-2020_12_31_424971	762	20	directed	direct	VBN
10_1101-2020_12_31_424971	762	21	to	to	IN
10_1101-2020_12_31_424971	762	22	and	and	CC
10_1101-2020_12_31_424971	762	23	will	will	MD
10_1101-2020_12_31_424971	762	24	be	be	VB
10_1101-2020_12_31_424971	762	25	1207	1207	CD
10_1101-2020_12_31_424971	762	26	fulfilled	fulfil	VBN
10_1101-2020_12_31_424971	762	27	by	by	IN
10_1101-2020_12_31_424971	762	28	the	the	DT
10_1101-2020_12_31_424971	762	29	lead	lead	NN
10_1101-2020_12_31_424971	762	30	contacts	contact	NNS
10_1101-2020_12_31_424971	762	31	Ruben	Ruben	NNP
10_1101-2020_12_31_424971	762	32	L.	L.	NNP
10_1101-2020_12_31_424971	762	33	Gonzalez	Gonzalez	NNP
10_1101-2020_12_31_424971	762	34	,	,	,
10_1101-2020_12_31_424971	762	35	Jr.	Jr.	NNP
10_1101-2020_12_31_424971	762	36	(	(	-LRB-
10_1101-2020_12_31_424971	762	37	rlg2118@columbia.edu	rlg2118@columbia.edu	NNP
10_1101-2020_12_31_424971	762	38	)	)	-RRB-
10_1101-2020_12_31_424971	762	39	and	and	CC
10_1101-2020_12_31_424971	762	40	Ya	Ya	NNP
10_1101-2020_12_31_424971	762	41	-	-	HYPH
10_1101-2020_12_31_424971	762	42	Ming	Ming	NNP
10_1101-2020_12_31_424971	762	43	Hou	Hou	NNP
10_1101-2020_12_31_424971	762	44	1208	1208	CD
10_1101-2020_12_31_424971	762	45	(	(	-LRB-
10_1101-2020_12_31_424971	762	46	ya-ming.hou@jefferson.edu	ya-ming.hou@jefferson.edu	NNP
10_1101-2020_12_31_424971	762	47	)	)	-RRB-
10_1101-2020_12_31_424971	762	48	.	.	.
10_1101-2020_12_31_424971	763	1	1209	1209	CD
10_1101-2020_12_31_424971	763	2	1210	1210	CD
10_1101-2020_12_31_424971	763	3	1211	1211	CD
10_1101-2020_12_31_424971	763	4	1212	1212	CD
10_1101-2020_12_31_424971	763	5	1213	1213	CD
10_1101-2020_12_31_424971	763	6	1214	1214	CD
10_1101-2020_12_31_424971	763	7	.CC	.CC	:
10_1101-2020_12_31_424971	763	8	-	-	:
10_1101-2020_12_31_424971	763	9	BY	by	IN
10_1101-2020_12_31_424971	763	10	-	-	HYPH
10_1101-2020_12_31_424971	763	11	NC	NC	NNP
10_1101-2020_12_31_424971	763	12	-	-	HYPH
10_1101-2020_12_31_424971	763	13	ND	ND	NNP
10_1101-2020_12_31_424971	763	14	4.0	4.0	CD
10_1101-2020_12_31_424971	763	15	International	International	NNP
10_1101-2020_12_31_424971	763	16	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	763	17	under	under	IN
10_1101-2020_12_31_424971	763	18	a	a	DT
10_1101-2020_12_31_424971	763	19	(	(	-LRB-
10_1101-2020_12_31_424971	763	20	which	which	WDT
10_1101-2020_12_31_424971	763	21	was	be	VBD
10_1101-2020_12_31_424971	763	22	not	not	RB
10_1101-2020_12_31_424971	763	23	certified	certify	VBN
10_1101-2020_12_31_424971	763	24	by	by	IN
10_1101-2020_12_31_424971	763	25	peer	peer	NN
10_1101-2020_12_31_424971	763	26	review	review	NN
10_1101-2020_12_31_424971	763	27	)	)	-RRB-
10_1101-2020_12_31_424971	763	28	is	be	VBZ
10_1101-2020_12_31_424971	763	29	the	the	DT
10_1101-2020_12_31_424971	763	30	author	author	NN
10_1101-2020_12_31_424971	763	31	/	/	SYM
10_1101-2020_12_31_424971	763	32	funder	funder	NN
10_1101-2020_12_31_424971	763	33	,	,	,
10_1101-2020_12_31_424971	763	34	who	who	WP
10_1101-2020_12_31_424971	763	35	has	have	VBZ
10_1101-2020_12_31_424971	763	36	granted	grant	VBN
10_1101-2020_12_31_424971	763	37	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	763	38	a	a	DT
10_1101-2020_12_31_424971	763	39	license	license	NN
10_1101-2020_12_31_424971	763	40	to	to	TO
10_1101-2020_12_31_424971	763	41	display	display	VB
10_1101-2020_12_31_424971	763	42	the	the	DT
10_1101-2020_12_31_424971	763	43	preprint	preprint	NN
10_1101-2020_12_31_424971	763	44	in	in	IN
10_1101-2020_12_31_424971	763	45	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	763	46	.	.	.
10_1101-2020_12_31_424971	764	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	764	2	is	be	VBZ
10_1101-2020_12_31_424971	764	3	made	make	VBN
10_1101-2020_12_31_424971	764	4	The	the	DT
10_1101-2020_12_31_424971	764	5	copyright	copyright	NN
10_1101-2020_12_31_424971	764	6	holder	holder	NN
10_1101-2020_12_31_424971	764	7	for	for	IN
10_1101-2020_12_31_424971	764	8	this	this	DT
10_1101-2020_12_31_424971	764	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	764	10	version	version	NN
10_1101-2020_12_31_424971	764	11	posted	post	VBD
10_1101-2020_12_31_424971	764	12	January	January	NNP
10_1101-2020_12_31_424971	764	13	2	2	CD
10_1101-2020_12_31_424971	764	14	,	,	,
10_1101-2020_12_31_424971	764	15	2021	2021	CD
10_1101-2020_12_31_424971	764	16	.	.	.
10_1101-2020_12_31_424971	764	17	;	;	:
10_1101-2020_12_31_424971	764	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	764	19	:	:	:
10_1101-2020_12_31_424971	764	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	764	21	preprint	preprint	NN
10_1101-2020_12_31_424971	764	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	764	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	764	24	47	47	CD
10_1101-2020_12_31_424971	764	25	FIGURE	FIGURE	NNP
10_1101-2020_12_31_424971	764	26	LEGENDS	legend	NNS
10_1101-2020_12_31_424971	764	27	1215	1215	CD
10_1101-2020_12_31_424971	764	28	1216	1216	CD
10_1101-2020_12_31_424971	764	29	Figure	Figure	NNP
10_1101-2020_12_31_424971	764	30	1	1	CD
10_1101-2020_12_31_424971	764	31	.	.	.
10_1101-2020_12_31_424971	765	1	Methylation	methylation	NN
10_1101-2020_12_31_424971	765	2	and	and	CC
10_1101-2020_12_31_424971	765	3	aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	765	4	of	of	IN
10_1101-2020_12_31_424971	765	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	765	6	and	and	CC
10_1101-2020_12_31_424971	765	7	ProL.	ProL.	.
10_1101-2020_12_31_424971	766	1	a	a	DT
10_1101-2020_12_31_424971	766	2	Sequence	Sequence	NNP
10_1101-2020_12_31_424971	766	3	and	and	CC
10_1101-2020_12_31_424971	766	4	secondary	secondary	JJ
10_1101-2020_12_31_424971	766	5	1217	1217	CD
10_1101-2020_12_31_424971	766	6	structure	structure	NN
10_1101-2020_12_31_424971	766	7	of	of	IN
10_1101-2020_12_31_424971	766	8	native	native	JJ
10_1101-2020_12_31_424971	766	9	-	-	HYPH
10_1101-2020_12_31_424971	766	10	state	state	NN
10_1101-2020_12_31_424971	766	11	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	766	12	,	,	,
10_1101-2020_12_31_424971	766	13	showing	show	VBG
10_1101-2020_12_31_424971	766	14	the	the	DT
10_1101-2020_12_31_424971	766	15	N1-methylated	n1-methylate	VBN
10_1101-2020_12_31_424971	766	16	G37	G37	NNP
10_1101-2020_12_31_424971	766	17	in	in	IN
10_1101-2020_12_31_424971	766	18	red	red	NN
10_1101-2020_12_31_424971	766	19	and	and	CC
10_1101-2020_12_31_424971	766	20	the	the	DT
10_1101-2020_12_31_424971	766	21	G37a	g37a	NN
10_1101-2020_12_31_424971	766	22	insertion	insertion	NN
10_1101-2020_12_31_424971	766	23	to	to	IN
10_1101-2020_12_31_424971	766	24	1218	1218	CD
10_1101-2020_12_31_424971	766	25	ProL	ProL	NNP
10_1101-2020_12_31_424971	766	26	in	in	IN
10_1101-2020_12_31_424971	766	27	blue	blue	NNP
10_1101-2020_12_31_424971	766	28	.	.	.
10_1101-2020_12_31_424971	767	1	b	b	LS
10_1101-2020_12_31_424971	767	2	RNase	RNase	NNP
10_1101-2020_12_31_424971	767	3	T1	T1	NNP
10_1101-2020_12_31_424971	767	4	cleavage	cleavage	NN
10_1101-2020_12_31_424971	767	5	inhibition	inhibition	NN
10_1101-2020_12_31_424971	767	6	assays	assays	RB
10_1101-2020_12_31_424971	767	7	of	of	IN
10_1101-2020_12_31_424971	767	8	TrmD	TrmD	NNP
10_1101-2020_12_31_424971	767	9	-	-	HYPH
10_1101-2020_12_31_424971	767	10	methylated	methylate	VBN
10_1101-2020_12_31_424971	767	11	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	767	12	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	767	13	1219	1219	CD
10_1101-2020_12_31_424971	767	14	transcript	transcript	NN
10_1101-2020_12_31_424971	767	15	confirm	confirm	VB
10_1101-2020_12_31_424971	767	16	the	the	DT
10_1101-2020_12_31_424971	767	17	presence	presence	NN
10_1101-2020_12_31_424971	767	18	of	of	IN
10_1101-2020_12_31_424971	767	19	m1G37	m1G37	NNP
10_1101-2020_12_31_424971	767	20	and	and	CC
10_1101-2020_12_31_424971	767	21	m1G37a	m1g37a	ADD
10_1101-2020_12_31_424971	767	22	.	.	.
10_1101-2020_12_31_424971	768	1	Cleavage	cleavage	NN
10_1101-2020_12_31_424971	768	2	products	product	NNS
10_1101-2020_12_31_424971	768	3	are	be	VBP
10_1101-2020_12_31_424971	768	4	marked	mark	VBN
10_1101-2020_12_31_424971	768	5	by	by	IN
10_1101-2020_12_31_424971	768	6	the	the	DT
10_1101-2020_12_31_424971	768	7	1220	1220	CD
10_1101-2020_12_31_424971	768	8	nucleotide	nucleotide	JJ
10_1101-2020_12_31_424971	768	9	positions	position	NNS
10_1101-2020_12_31_424971	768	10	of	of	IN
10_1101-2020_12_31_424971	768	11	Gs	Gs	NNP
10_1101-2020_12_31_424971	768	12	.	.	.
10_1101-2020_12_31_424971	769	1	L	l	NN
10_1101-2020_12_31_424971	769	2	:	:	:
10_1101-2020_12_31_424971	769	3	the	the	DT
10_1101-2020_12_31_424971	769	4	molecular	molecular	JJ
10_1101-2020_12_31_424971	769	5	ladder	ladder	NN
10_1101-2020_12_31_424971	769	6	of	of	IN
10_1101-2020_12_31_424971	769	7	tRNA	trna	NN
10_1101-2020_12_31_424971	769	8	fragments	fragment	NNS
10_1101-2020_12_31_424971	769	9	generated	generate	VBN
10_1101-2020_12_31_424971	769	10	from	from	IN
10_1101-2020_12_31_424971	769	11	alkali	alkali	JJ
10_1101-2020_12_31_424971	769	12	1221	1221	CD
10_1101-2020_12_31_424971	769	13	hydrolysis	hydrolysis	NN
10_1101-2020_12_31_424971	769	14	.	.	.
10_1101-2020_12_31_424971	770	1	c	c	LS
10_1101-2020_12_31_424971	770	2	Primer	Primer	NNP
10_1101-2020_12_31_424971	770	3	extension	extension	NN
10_1101-2020_12_31_424971	770	4	inhibition	inhibition	NN
10_1101-2020_12_31_424971	770	5	assays	assays	RB
10_1101-2020_12_31_424971	770	6	identify	identify	VBP
10_1101-2020_12_31_424971	770	7	m1G37	m1G37	NNP
10_1101-2020_12_31_424971	770	8	in	in	IN
10_1101-2020_12_31_424971	770	9	native	native	JJ
10_1101-2020_12_31_424971	770	10	-	-	HYPH
10_1101-2020_12_31_424971	770	11	state	state	NN
10_1101-2020_12_31_424971	770	12	SufB2	sufb2	NN
10_1101-2020_12_31_424971	770	13	.	.	.
10_1101-2020_12_31_424971	771	1	Red	red	JJ
10_1101-2020_12_31_424971	771	2	and	and	CC
10_1101-2020_12_31_424971	771	3	1222	1222	CD
10_1101-2020_12_31_424971	771	4	blue	blue	JJ
10_1101-2020_12_31_424971	771	5	arrows	arrow	NNS
10_1101-2020_12_31_424971	771	6	indicate	indicate	VBP
10_1101-2020_12_31_424971	771	7	positions	position	NNS
10_1101-2020_12_31_424971	771	8	of	of	IN
10_1101-2020_12_31_424971	771	9	primer	primer	JJ
10_1101-2020_12_31_424971	771	10	extension	extension	NN
10_1101-2020_12_31_424971	771	11	inhibition	inhibition	NN
10_1101-2020_12_31_424971	771	12	products	product	NNS
10_1101-2020_12_31_424971	771	13	at	at	IN
10_1101-2020_12_31_424971	771	14	the	the	DT
10_1101-2020_12_31_424971	771	15	methylated	methylated	JJ
10_1101-2020_12_31_424971	771	16	G37	G37	NNP
10_1101-2020_12_31_424971	771	17	and	and	CC
10_1101-2020_12_31_424971	771	18	1223	1223	CD
10_1101-2020_12_31_424971	771	19	G37a	G37a	NNS
10_1101-2020_12_31_424971	771	20	,	,	,
10_1101-2020_12_31_424971	771	21	respectively	respectively	RB
10_1101-2020_12_31_424971	771	22	,	,	,
10_1101-2020_12_31_424971	771	23	which	which	WDT
10_1101-2020_12_31_424971	771	24	are	be	VBP
10_1101-2020_12_31_424971	771	25	offset	offset	VBN
10_1101-2020_12_31_424971	771	26	by	by	IN
10_1101-2020_12_31_424971	771	27	one	one	CD
10_1101-2020_12_31_424971	771	28	nucleotide	nucleotide	JJ
10_1101-2020_12_31_424971	771	29	relative	relative	NNP
10_1101-2020_12_31_424971	771	30	to	to	IN
10_1101-2020_12_31_424971	771	31	ProL.	ProL.	.
10_1101-2020_12_31_424971	772	1	The	the	DT
10_1101-2020_12_31_424971	772	2	first	first	JJ
10_1101-2020_12_31_424971	772	3	primer	primer	JJ
10_1101-2020_12_31_424971	772	4	extension	extension	NN
10_1101-2020_12_31_424971	772	5	1224	1224	CD
10_1101-2020_12_31_424971	772	6	inhibition	inhibition	NN
10_1101-2020_12_31_424971	772	7	product	product	NN
10_1101-2020_12_31_424971	772	8	for	for	IN
10_1101-2020_12_31_424971	772	9	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	772	10	corresponds	correspond	NNS
10_1101-2020_12_31_424971	772	11	to	to	IN
10_1101-2020_12_31_424971	772	12	m1G37a	m1g37a	ADD
10_1101-2020_12_31_424971	772	13	,	,	,
10_1101-2020_12_31_424971	772	14	the	the	DT
10_1101-2020_12_31_424971	772	15	second	second	JJ
10_1101-2020_12_31_424971	772	16	corresponds	correspond	NNS
10_1101-2020_12_31_424971	772	17	to	to	TO
10_1101-2020_12_31_424971	772	18	m1G37	m1g37	VB
10_1101-2020_12_31_424971	772	19	,	,	,
10_1101-2020_12_31_424971	772	20	while	while	IN
10_1101-2020_12_31_424971	772	21	the	the	DT
10_1101-2020_12_31_424971	772	22	1225	1225	CD
10_1101-2020_12_31_424971	772	23	primer	primer	NNP
10_1101-2020_12_31_424971	772	24	extension	extension	NN
10_1101-2020_12_31_424971	772	25	inhibition	inhibition	NN
10_1101-2020_12_31_424971	772	26	product	product	NN
10_1101-2020_12_31_424971	772	27	for	for	IN
10_1101-2020_12_31_424971	772	28	ProL	ProL	NNP
10_1101-2020_12_31_424971	772	29	corresponds	correspond	NNS
10_1101-2020_12_31_424971	772	30	to	to	IN
10_1101-2020_12_31_424971	772	31	m1G37	m1g37	VB
10_1101-2020_12_31_424971	772	32	.	.	.
10_1101-2020_12_31_424971	773	1	Due	due	IN
10_1101-2020_12_31_424971	773	2	to	to	IN
10_1101-2020_12_31_424971	773	3	the	the	DT
10_1101-2020_12_31_424971	773	4	propensity	propensity	NN
10_1101-2020_12_31_424971	773	5	of	of	IN
10_1101-2020_12_31_424971	773	6	1226	1226	CD
10_1101-2020_12_31_424971	773	7	primer	primer	NN
10_1101-2020_12_31_424971	773	8	extension	extension	NN
10_1101-2020_12_31_424971	773	9	to	to	TO
10_1101-2020_12_31_424971	773	10	make	make	VB
10_1101-2020_12_31_424971	773	11	multiple	multiple	JJ
10_1101-2020_12_31_424971	773	12	stops	stop	NNS
10_1101-2020_12_31_424971	773	13	on	on	IN
10_1101-2020_12_31_424971	773	14	a	a	DT
10_1101-2020_12_31_424971	773	15	long	long	JJ
10_1101-2020_12_31_424971	773	16	transcript	transcript	NN
10_1101-2020_12_31_424971	773	17	of	of	IN
10_1101-2020_12_31_424971	773	18	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	773	19	,	,	,
10_1101-2020_12_31_424971	773	20	the	the	DT
10_1101-2020_12_31_424971	773	21	read	read	VB
10_1101-2020_12_31_424971	773	22	-	-	HYPH
10_1101-2020_12_31_424971	773	23	through	through	RP
10_1101-2020_12_31_424971	773	24	primer	primer	NN
10_1101-2020_12_31_424971	773	25	1227	1227	CD
10_1101-2020_12_31_424971	773	26	extension	extension	NN
10_1101-2020_12_31_424971	773	27	product	product	NN
10_1101-2020_12_31_424971	773	28	(	(	-LRB-
10_1101-2020_12_31_424971	773	29	54	54	CD
10_1101-2020_12_31_424971	773	30	-	-	SYM
10_1101-2020_12_31_424971	773	31	55	55	CD
10_1101-2020_12_31_424971	773	32	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	773	33	)	)	-RRB-
10_1101-2020_12_31_424971	773	34	had	have	VBD
10_1101-2020_12_31_424971	773	35	a	a	DT
10_1101-2020_12_31_424971	773	36	reduced	reduce	VBN
10_1101-2020_12_31_424971	773	37	intensity	intensity	NN
10_1101-2020_12_31_424971	773	38	relative	relative	JJ
10_1101-2020_12_31_424971	773	39	to	to	IN
10_1101-2020_12_31_424971	773	40	the	the	DT
10_1101-2020_12_31_424971	773	41	primer	primer	NNP
10_1101-2020_12_31_424971	773	42	extension	extension	NN
10_1101-2020_12_31_424971	773	43	1228	1228	CD
10_1101-2020_12_31_424971	773	44	inhibition	inhibition	NN
10_1101-2020_12_31_424971	773	45	products	product	NNS
10_1101-2020_12_31_424971	773	46	(	(	-LRB-
10_1101-2020_12_31_424971	773	47	21	21	CD
10_1101-2020_12_31_424971	773	48	-	-	SYM
10_1101-2020_12_31_424971	773	49	22	22	CD
10_1101-2020_12_31_424971	773	50	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	773	51	)	)	-RRB-
10_1101-2020_12_31_424971	773	52	.	.	.
10_1101-2020_12_31_424971	774	1	Molecular	molecular	JJ
10_1101-2020_12_31_424971	774	2	size	size	NN
10_1101-2020_12_31_424971	774	3	markers	marker	NNS
10_1101-2020_12_31_424971	774	4	are	be	VBP
10_1101-2020_12_31_424971	774	5	provided	provide	VBN
10_1101-2020_12_31_424971	774	6	by	by	IN
10_1101-2020_12_31_424971	774	7	the	the	DT
10_1101-2020_12_31_424971	774	8	primer	primer	NN
10_1101-2020_12_31_424971	774	9	alone	alone	RB
10_1101-2020_12_31_424971	774	10	1229	1229	CD
10_1101-2020_12_31_424971	774	11	(	(	-LRB-
10_1101-2020_12_31_424971	774	12	17	17	CD
10_1101-2020_12_31_424971	774	13	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	774	14	)	)	-RRB-
10_1101-2020_12_31_424971	774	15	and	and	CC
10_1101-2020_12_31_424971	774	16	the	the	DT
10_1101-2020_12_31_424971	774	17	run	run	VB
10_1101-2020_12_31_424971	774	18	-	-	HYPH
10_1101-2020_12_31_424971	774	19	off	off	RP
10_1101-2020_12_31_424971	774	20	products	product	NNS
10_1101-2020_12_31_424971	774	21	(	(	-LRB-
10_1101-2020_12_31_424971	774	22	54	54	CD
10_1101-2020_12_31_424971	774	23	-	-	SYM
10_1101-2020_12_31_424971	774	24	55	55	CD
10_1101-2020_12_31_424971	774	25	nucleotides	nucleotide	NNS
10_1101-2020_12_31_424971	774	26	)	)	-RRB-
10_1101-2020_12_31_424971	774	27	.	.	.
10_1101-2020_12_31_424971	775	1	d	d	LS
10_1101-2020_12_31_424971	775	2	TrmD	TrmD	NNP
10_1101-2020_12_31_424971	775	3	-	-	HYPH
10_1101-2020_12_31_424971	775	4	catalyzed	catalyze	VBN
10_1101-2020_12_31_424971	775	5	N1	n1	NN
10_1101-2020_12_31_424971	775	6	methylation	methylation	NN
10_1101-2020_12_31_424971	775	7	1230	1230	CD
10_1101-2020_12_31_424971	775	8	of	of	IN
10_1101-2020_12_31_424971	775	9	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	775	10	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	775	11	and	and	CC
10_1101-2020_12_31_424971	775	12	ProL	ProL	NNP
10_1101-2020_12_31_424971	775	13	as	as	IN
10_1101-2020_12_31_424971	775	14	a	a	DT
10_1101-2020_12_31_424971	775	15	function	function	NN
10_1101-2020_12_31_424971	775	16	of	of	IN
10_1101-2020_12_31_424971	775	17	time	time	NN
10_1101-2020_12_31_424971	775	18	.	.	.
10_1101-2020_12_31_424971	776	1	e	e	NNP
10_1101-2020_12_31_424971	776	2	,	,	,
10_1101-2020_12_31_424971	776	3	f	f	NNP
10_1101-2020_12_31_424971	776	4	ProRS	ProRS	NNP
10_1101-2020_12_31_424971	776	5	-	-	HYPH
10_1101-2020_12_31_424971	776	6	catalyzed	catalyzed	JJ
10_1101-2020_12_31_424971	776	7	aminoacylation	aminoacylation	NN
10_1101-2020_12_31_424971	776	8	.	.	.
10_1101-2020_12_31_424971	777	1	e	e	LS
10_1101-2020_12_31_424971	777	2	1231	1231	CD
10_1101-2020_12_31_424971	777	3	Aminoacylation	Aminoacylation	NNP
10_1101-2020_12_31_424971	777	4	of	of	IN
10_1101-2020_12_31_424971	777	5	native	native	JJ
10_1101-2020_12_31_424971	777	6	-	-	HYPH
10_1101-2020_12_31_424971	777	7	state	state	NN
10_1101-2020_12_31_424971	777	8	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	777	9	and	and	CC
10_1101-2020_12_31_424971	777	10	ProL.	ProL.	.
10_1101-2020_12_31_424971	778	1	f	f	LS
10_1101-2020_12_31_424971	778	2	Aminoacylation	Aminoacylation	NNP
10_1101-2020_12_31_424971	778	3	of	of	IN
10_1101-2020_12_31_424971	778	4	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	778	5	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	778	6	and	and	CC
10_1101-2020_12_31_424971	778	7	ProL	ProL	NNP
10_1101-2020_12_31_424971	778	8	1232	1232	CD
10_1101-2020_12_31_424971	778	9	as	as	IN
10_1101-2020_12_31_424971	778	10	a	a	DT
10_1101-2020_12_31_424971	778	11	function	function	NN
10_1101-2020_12_31_424971	778	12	of	of	IN
10_1101-2020_12_31_424971	778	13	time	time	NN
10_1101-2020_12_31_424971	778	14	.	.	.
10_1101-2020_12_31_424971	779	1	In	in	IN
10_1101-2020_12_31_424971	779	2	panels	panels	NNP
10_1101-2020_12_31_424971	779	3	b	b	NNP
10_1101-2020_12_31_424971	779	4	,	,	,
10_1101-2020_12_31_424971	779	5	c	c	NNP
10_1101-2020_12_31_424971	779	6	,	,	,
10_1101-2020_12_31_424971	779	7	gels	gel	NNS
10_1101-2020_12_31_424971	779	8	were	be	VBD
10_1101-2020_12_31_424971	779	9	performed	perform	VBN
10_1101-2020_12_31_424971	779	10	three	three	CD
10_1101-2020_12_31_424971	779	11	times	time	NNS
10_1101-2020_12_31_424971	779	12	with	with	IN
10_1101-2020_12_31_424971	779	13	similar	similar	JJ
10_1101-2020_12_31_424971	779	14	results	result	NNS
10_1101-2020_12_31_424971	779	15	,	,	,
10_1101-2020_12_31_424971	779	16	while	while	IN
10_1101-2020_12_31_424971	779	17	in	in	IN
10_1101-2020_12_31_424971	779	18	1233	1233	CD
10_1101-2020_12_31_424971	779	19	panels	panel	NNS
10_1101-2020_12_31_424971	779	20	d	d	NNP
10_1101-2020_12_31_424971	779	21	-	-	HYPH
10_1101-2020_12_31_424971	779	22	f	f	NNP
10_1101-2020_12_31_424971	779	23	,	,	,
10_1101-2020_12_31_424971	779	24	the	the	DT
10_1101-2020_12_31_424971	779	25	bars	bar	NNS
10_1101-2020_12_31_424971	779	26	are	be	VBP
10_1101-2020_12_31_424971	779	27	SD	sd	NN
10_1101-2020_12_31_424971	779	28	of	of	IN
10_1101-2020_12_31_424971	779	29	three	three	CD
10_1101-2020_12_31_424971	779	30	independent	independent	NN
10_1101-2020_12_31_424971	779	31	(	(	-LRB-
10_1101-2020_12_31_424971	779	32	n	n	NN
10_1101-2020_12_31_424971	779	33	=	=	SYM
10_1101-2020_12_31_424971	779	34	3	3	LS
10_1101-2020_12_31_424971	779	35	)	)	-RRB-
10_1101-2020_12_31_424971	779	36	experiments	experiment	NNS
10_1101-2020_12_31_424971	779	37	,	,	,
10_1101-2020_12_31_424971	779	38	and	and	CC
10_1101-2020_12_31_424971	779	39	the	the	DT
10_1101-2020_12_31_424971	779	40	data	datum	NNS
10_1101-2020_12_31_424971	779	41	are	be	VBP
10_1101-2020_12_31_424971	779	42	presented	present	VBN
10_1101-2020_12_31_424971	779	43	1234	1234	CD
10_1101-2020_12_31_424971	779	44	as	as	IN
10_1101-2020_12_31_424971	779	45	mean	mean	JJ
10_1101-2020_12_31_424971	779	46	values	value	NNS
10_1101-2020_12_31_424971	779	47	±	±	CD
10_1101-2020_12_31_424971	779	48	SD	sd	NN
10_1101-2020_12_31_424971	779	49	.	.	.
10_1101-2020_12_31_424971	780	1	1235	1235	CD
10_1101-2020_12_31_424971	780	2	1236	1236	CD
10_1101-2020_12_31_424971	780	3	Figure	Figure	NNP
10_1101-2020_12_31_424971	780	4	2	2	CD
10_1101-2020_12_31_424971	780	5	.	.	.
10_1101-2020_12_31_424971	781	1	SufB2-induced	sufb2-induced	XX
10_1101-2020_12_31_424971	781	2	+1	+1	NNS
10_1101-2020_12_31_424971	781	3	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	781	4	and	and	CC
10_1101-2020_12_31_424971	781	5	genome	genome	JJ
10_1101-2020_12_31_424971	781	6	recoding	recoding	NN
10_1101-2020_12_31_424971	781	7	.	.	.
10_1101-2020_12_31_424971	782	1	a	a	DT
10_1101-2020_12_31_424971	782	2	The	The	NNP
10_1101-2020_12_31_424971	782	3	+1-frameshifting	+1-frameshifting	NNP
10_1101-2020_12_31_424971	782	4	1237	1237	CD
10_1101-2020_12_31_424971	782	5	efficiency	efficiency	NN
10_1101-2020_12_31_424971	782	6	in	in	IN
10_1101-2020_12_31_424971	782	7	cell	cell	NN
10_1101-2020_12_31_424971	782	8	-	-	HYPH
10_1101-2020_12_31_424971	782	9	based	base	VBN
10_1101-2020_12_31_424971	782	10	lacZ	lacz	JJ
10_1101-2020_12_31_424971	782	11	assay	assay	NNP
10_1101-2020_12_31_424971	782	12	for	for	IN
10_1101-2020_12_31_424971	782	13	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	782	14	and	and	CC
10_1101-2020_12_31_424971	782	15	ProL	ProL	NNP
10_1101-2020_12_31_424971	782	16	strains	strain	VBZ
10_1101-2020_12_31_424971	782	17	in	in	IN
10_1101-2020_12_31_424971	782	18	m1G37	m1g37	JJ
10_1101-2020_12_31_424971	782	19	+	+	SYM
10_1101-2020_12_31_424971	782	20	and	and	CC
10_1101-2020_12_31_424971	782	21	m1G37	m1g37	NN
10_1101-2020_12_31_424971	782	22	–	–	:
10_1101-2020_12_31_424971	782	23	conditions	condition	NNS
10_1101-2020_12_31_424971	782	24	.	.	.
10_1101-2020_12_31_424971	783	1	1238	1238	CD
10_1101-2020_12_31_424971	783	2	The	the	DT
10_1101-2020_12_31_424971	783	3	bars	bar	NNS
10_1101-2020_12_31_424971	783	4	in	in	IN
10_1101-2020_12_31_424971	783	5	the	the	DT
10_1101-2020_12_31_424971	783	6	graph	graph	NN
10_1101-2020_12_31_424971	783	7	are	be	VBP
10_1101-2020_12_31_424971	783	8	SD	sd	NN
10_1101-2020_12_31_424971	783	9	of	of	IN
10_1101-2020_12_31_424971	783	10	four	four	CD
10_1101-2020_12_31_424971	783	11	,	,	,
10_1101-2020_12_31_424971	783	12	five	five	CD
10_1101-2020_12_31_424971	783	13	,	,	,
10_1101-2020_12_31_424971	783	14	or	or	CC
10_1101-2020_12_31_424971	783	15	six	six	CD
10_1101-2020_12_31_424971	783	16	independent	independent	JJ
10_1101-2020_12_31_424971	783	17	(	(	-LRB-
10_1101-2020_12_31_424971	783	18	n	n	NN
10_1101-2020_12_31_424971	783	19	=	=	SYM
10_1101-2020_12_31_424971	783	20	4	4	CD
10_1101-2020_12_31_424971	783	21	,	,	,
10_1101-2020_12_31_424971	783	22	5	5	CD
10_1101-2020_12_31_424971	783	23	,	,	,
10_1101-2020_12_31_424971	783	24	or	or	CC
10_1101-2020_12_31_424971	783	25	6	6	CD
10_1101-2020_12_31_424971	783	26	)	)	-RRB-
10_1101-2020_12_31_424971	783	27	biological	biological	JJ
10_1101-2020_12_31_424971	783	28	repeats	repeat	NNS
10_1101-2020_12_31_424971	783	29	,	,	,
10_1101-2020_12_31_424971	783	30	1239	1239	CD
10_1101-2020_12_31_424971	783	31	and	and	CC
10_1101-2020_12_31_424971	783	32	the	the	DT
10_1101-2020_12_31_424971	783	33	data	datum	NNS
10_1101-2020_12_31_424971	783	34	are	be	VBP
10_1101-2020_12_31_424971	783	35	mean	mean	JJ
10_1101-2020_12_31_424971	783	36	values	value	NNS
10_1101-2020_12_31_424971	783	37	±	±	CD
10_1101-2020_12_31_424971	783	38	SD	sd	NN
10_1101-2020_12_31_424971	783	39	.	.	.
10_1101-2020_12_31_424971	784	1	b	b	LS
10_1101-2020_12_31_424971	784	2	The	the	DT
10_1101-2020_12_31_424971	784	3	difference	difference	NN
10_1101-2020_12_31_424971	784	4	in	in	IN
10_1101-2020_12_31_424971	784	5	the	the	DT
10_1101-2020_12_31_424971	784	6	ratio	ratio	NN
10_1101-2020_12_31_424971	784	7	of	of	IN
10_1101-2020_12_31_424971	784	8	protein	protein	NN
10_1101-2020_12_31_424971	784	9	synthesis	synthesis	NN
10_1101-2020_12_31_424971	784	10	of	of	IN
10_1101-2020_12_31_424971	784	11	lolB	lolB	NNP
10_1101-2020_12_31_424971	784	12	to	to	IN
10_1101-2020_12_31_424971	784	13	1240	1240	CD
10_1101-2020_12_31_424971	784	14	cysS	cys	NNS
10_1101-2020_12_31_424971	784	15	for	for	IN
10_1101-2020_12_31_424971	784	16	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	784	17	and	and	CC
10_1101-2020_12_31_424971	784	18	ProL	ProL	NNP
10_1101-2020_12_31_424971	784	19	strains	strain	VBZ
10_1101-2020_12_31_424971	784	20	in	in	IN
10_1101-2020_12_31_424971	784	21	m1G37	m1g37	JJ
10_1101-2020_12_31_424971	784	22	+	+	SYM
10_1101-2020_12_31_424971	784	23	and	and	CC
10_1101-2020_12_31_424971	784	24	m1G37	m1g37	NN
10_1101-2020_12_31_424971	784	25	–	–	:
10_1101-2020_12_31_424971	784	26	conditions	condition	NNS
10_1101-2020_12_31_424971	784	27	relative	relative	JJ
10_1101-2020_12_31_424971	784	28	to	to	IN
10_1101-2020_12_31_424971	784	29	ProL	ProL	NNP
10_1101-2020_12_31_424971	784	30	in	in	IN
10_1101-2020_12_31_424971	784	31	the	the	DT
10_1101-2020_12_31_424971	784	32	m1G37	m1g37	NN
10_1101-2020_12_31_424971	784	33	+	+	CD
10_1101-2020_12_31_424971	784	34	1241	1241	CD
10_1101-2020_12_31_424971	784	35	.CC	.cc	SYM
10_1101-2020_12_31_424971	784	36	-	-	HYPH
10_1101-2020_12_31_424971	784	37	BY	by	IN
10_1101-2020_12_31_424971	784	38	-	-	HYPH
10_1101-2020_12_31_424971	784	39	NC	NC	NNP
10_1101-2020_12_31_424971	784	40	-	-	HYPH
10_1101-2020_12_31_424971	784	41	ND	ND	NNP
10_1101-2020_12_31_424971	784	42	4.0	4.0	CD
10_1101-2020_12_31_424971	784	43	International	International	NNP
10_1101-2020_12_31_424971	784	44	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	784	45	under	under	IN
10_1101-2020_12_31_424971	784	46	a	a	DT
10_1101-2020_12_31_424971	784	47	(	(	-LRB-
10_1101-2020_12_31_424971	784	48	which	which	WDT
10_1101-2020_12_31_424971	784	49	was	be	VBD
10_1101-2020_12_31_424971	784	50	not	not	RB
10_1101-2020_12_31_424971	784	51	certified	certify	VBN
10_1101-2020_12_31_424971	784	52	by	by	IN
10_1101-2020_12_31_424971	784	53	peer	peer	NN
10_1101-2020_12_31_424971	784	54	review	review	NN
10_1101-2020_12_31_424971	784	55	)	)	-RRB-
10_1101-2020_12_31_424971	784	56	is	be	VBZ
10_1101-2020_12_31_424971	784	57	the	the	DT
10_1101-2020_12_31_424971	784	58	author	author	NN
10_1101-2020_12_31_424971	784	59	/	/	SYM
10_1101-2020_12_31_424971	784	60	funder	funder	NN
10_1101-2020_12_31_424971	784	61	,	,	,
10_1101-2020_12_31_424971	784	62	who	who	WP
10_1101-2020_12_31_424971	784	63	has	have	VBZ
10_1101-2020_12_31_424971	784	64	granted	grant	VBN
10_1101-2020_12_31_424971	784	65	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	784	66	a	a	DT
10_1101-2020_12_31_424971	784	67	license	license	NN
10_1101-2020_12_31_424971	784	68	to	to	TO
10_1101-2020_12_31_424971	784	69	display	display	VB
10_1101-2020_12_31_424971	784	70	the	the	DT
10_1101-2020_12_31_424971	784	71	preprint	preprint	NN
10_1101-2020_12_31_424971	784	72	in	in	IN
10_1101-2020_12_31_424971	784	73	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	784	74	.	.	.
10_1101-2020_12_31_424971	785	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	785	2	is	be	VBZ
10_1101-2020_12_31_424971	785	3	made	make	VBN
10_1101-2020_12_31_424971	785	4	The	the	DT
10_1101-2020_12_31_424971	785	5	copyright	copyright	NN
10_1101-2020_12_31_424971	785	6	holder	holder	NN
10_1101-2020_12_31_424971	785	7	for	for	IN
10_1101-2020_12_31_424971	785	8	this	this	DT
10_1101-2020_12_31_424971	785	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	785	10	version	version	NN
10_1101-2020_12_31_424971	785	11	posted	post	VBD
10_1101-2020_12_31_424971	785	12	January	January	NNP
10_1101-2020_12_31_424971	785	13	2	2	CD
10_1101-2020_12_31_424971	785	14	,	,	,
10_1101-2020_12_31_424971	785	15	2021	2021	CD
10_1101-2020_12_31_424971	785	16	.	.	.
10_1101-2020_12_31_424971	785	17	;	;	:
10_1101-2020_12_31_424971	785	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	785	19	:	:	:
10_1101-2020_12_31_424971	785	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	785	21	preprint	preprint	NN
10_1101-2020_12_31_424971	785	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NN
10_1101-2020_12_31_424971	785	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	785	24	48	48	CD
10_1101-2020_12_31_424971	785	25	condition	condition	NN
10_1101-2020_12_31_424971	785	26	.	.	.
10_1101-2020_12_31_424971	786	1	c	c	NNP
10_1101-2020_12_31_424971	786	2	Measurements	measurement	NNS
10_1101-2020_12_31_424971	786	3	underlying	underlie	VBG
10_1101-2020_12_31_424971	786	4	the	the	DT
10_1101-2020_12_31_424971	786	5	bar	bar	NN
10_1101-2020_12_31_424971	786	6	plots	plot	NNS
10_1101-2020_12_31_424971	786	7	in	in	IN
10_1101-2020_12_31_424971	786	8	panel	panel	NN
10_1101-2020_12_31_424971	786	9	b.	b.	NNP
10_1101-2020_12_31_424971	787	1	Each	each	DT
10_1101-2020_12_31_424971	787	2	ratio	ratio	NN
10_1101-2020_12_31_424971	787	3	was	be	VBD
10_1101-2020_12_31_424971	787	4	measured	measure	VBN
10_1101-2020_12_31_424971	787	5	directly	directly	RB
10_1101-2020_12_31_424971	787	6	1242	1242	CD
10_1101-2020_12_31_424971	787	7	and	and	CC
10_1101-2020_12_31_424971	787	8	the	the	DT
10_1101-2020_12_31_424971	787	9	ratio	ratio	NN
10_1101-2020_12_31_424971	787	10	of	of	IN
10_1101-2020_12_31_424971	787	11	ProL	ProL	NNP
10_1101-2020_12_31_424971	787	12	in	in	IN
10_1101-2020_12_31_424971	787	13	the	the	DT
10_1101-2020_12_31_424971	787	14	m1G37	m1g37	NN
10_1101-2020_12_31_424971	787	15	+	+	CC
10_1101-2020_12_31_424971	787	16	condition	condition	NN
10_1101-2020_12_31_424971	787	17	was	be	VBD
10_1101-2020_12_31_424971	787	18	normalized	normalize	VBN
10_1101-2020_12_31_424971	787	19	to	to	IN
10_1101-2020_12_31_424971	787	20	1.0	1.0	CD
10_1101-2020_12_31_424971	787	21	.	.	.
10_1101-2020_12_31_424971	788	1	The	the	DT
10_1101-2020_12_31_424971	788	2	difference	difference	NN
10_1101-2020_12_31_424971	788	3	of	of	IN
10_1101-2020_12_31_424971	788	4	each	each	DT
10_1101-2020_12_31_424971	788	5	ratio	ratio	NN
10_1101-2020_12_31_424971	788	6	1243	1243	CD
10_1101-2020_12_31_424971	788	7	relative	relative	JJ
10_1101-2020_12_31_424971	788	8	to	to	IN
10_1101-2020_12_31_424971	788	9	the	the	DT
10_1101-2020_12_31_424971	788	10	normalized	normalized	JJ
10_1101-2020_12_31_424971	788	11	ratio	ratio	NN
10_1101-2020_12_31_424971	788	12	represented	represent	VBD
10_1101-2020_12_31_424971	788	13	the	the	DT
10_1101-2020_12_31_424971	788	14	+1-frameshifting	+1-frameshifte	VBG
10_1101-2020_12_31_424971	788	15	efficiency	efficiency	NN
10_1101-2020_12_31_424971	788	16	at	at	IN
10_1101-2020_12_31_424971	788	17	the	the	DT
10_1101-2020_12_31_424971	788	18	CCC	CCC	NNP
10_1101-2020_12_31_424971	788	19	-	-	HYPH
10_1101-2020_12_31_424971	788	20	C	C	NNP
10_1101-2020_12_31_424971	788	21	motif	motif	NN
10_1101-2020_12_31_424971	788	22	at	at	IN
10_1101-2020_12_31_424971	788	23	1244	1244	CD
10_1101-2020_12_31_424971	788	24	the	the	DT
10_1101-2020_12_31_424971	788	25	2nd	2nd	JJ
10_1101-2020_12_31_424971	788	26	codon	codon	NN
10_1101-2020_12_31_424971	788	27	of	of	IN
10_1101-2020_12_31_424971	788	28	lolB.	lolb.	NN
10_1101-2020_12_31_424971	789	1	The	the	DT
10_1101-2020_12_31_424971	789	2	bars	bar	NNS
10_1101-2020_12_31_424971	789	3	in	in	IN
10_1101-2020_12_31_424971	789	4	the	the	DT
10_1101-2020_12_31_424971	789	5	graph	graph	NN
10_1101-2020_12_31_424971	789	6	are	be	VBP
10_1101-2020_12_31_424971	789	7	SD	sd	NN
10_1101-2020_12_31_424971	789	8	of	of	IN
10_1101-2020_12_31_424971	789	9	three	three	CD
10_1101-2020_12_31_424971	789	10	independent	independent	NN
10_1101-2020_12_31_424971	789	11	(	(	-LRB-
10_1101-2020_12_31_424971	789	12	n	n	NN
10_1101-2020_12_31_424971	789	13	=	=	SYM
10_1101-2020_12_31_424971	789	14	3	3	LS
10_1101-2020_12_31_424971	789	15	)	)	-RRB-
10_1101-2020_12_31_424971	789	16	biological	biological	JJ
10_1101-2020_12_31_424971	789	17	repeats	repeat	NNS
10_1101-2020_12_31_424971	789	18	,	,	,
10_1101-2020_12_31_424971	789	19	1245	1245	CD
10_1101-2020_12_31_424971	789	20	and	and	CC
10_1101-2020_12_31_424971	789	21	the	the	DT
10_1101-2020_12_31_424971	789	22	data	datum	NNS
10_1101-2020_12_31_424971	789	23	are	be	VBP
10_1101-2020_12_31_424971	789	24	mean	mean	JJ
10_1101-2020_12_31_424971	789	25	values	value	NNS
10_1101-2020_12_31_424971	789	26	±	±	CD
10_1101-2020_12_31_424971	789	27	SD	sd	NN
10_1101-2020_12_31_424971	789	28	.	.	.
10_1101-2020_12_31_424971	790	1	In	in	IN
10_1101-2020_12_31_424971	790	2	a	a	DT
10_1101-2020_12_31_424971	790	3	,	,	,
10_1101-2020_12_31_424971	790	4	b	b	NN
10_1101-2020_12_31_424971	790	5	,	,	,
10_1101-2020_12_31_424971	790	6	decoding	decoding	NN
10_1101-2020_12_31_424971	790	7	of	of	IN
10_1101-2020_12_31_424971	790	8	the	the	DT
10_1101-2020_12_31_424971	790	9	CCC	CCC	NNP
10_1101-2020_12_31_424971	790	10	-	-	HYPH
10_1101-2020_12_31_424971	790	11	C	C	NNP
10_1101-2020_12_31_424971	790	12	motif	motif	NN
10_1101-2020_12_31_424971	790	13	was	be	VBD
10_1101-2020_12_31_424971	790	14	mediated	mediate	VBN
10_1101-2020_12_31_424971	790	15	by	by	IN
10_1101-2020_12_31_424971	790	16	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	790	17	1246	1246	CD
10_1101-2020_12_31_424971	790	18	and	and	CC
10_1101-2020_12_31_424971	790	19	ProM	ProM	NNP
10_1101-2020_12_31_424971	790	20	in	in	IN
10_1101-2020_12_31_424971	790	21	the	the	DT
10_1101-2020_12_31_424971	790	22	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	790	23	strain	strain	NN
10_1101-2020_12_31_424971	790	24	,	,	,
10_1101-2020_12_31_424971	790	25	and	and	CC
10_1101-2020_12_31_424971	790	26	by	by	IN
10_1101-2020_12_31_424971	790	27	ProL	ProL	NNP
10_1101-2020_12_31_424971	790	28	and	and	CC
10_1101-2020_12_31_424971	790	29	ProM	ProM	NNP
10_1101-2020_12_31_424971	790	30	in	in	IN
10_1101-2020_12_31_424971	790	31	the	the	DT
10_1101-2020_12_31_424971	790	32	ProL	ProL	NNP
10_1101-2020_12_31_424971	790	33	strain	strain	NN
10_1101-2020_12_31_424971	790	34	,	,	,
10_1101-2020_12_31_424971	790	35	where	where	WRB
10_1101-2020_12_31_424971	790	36	the	the	DT
10_1101-2020_12_31_424971	790	37	presence	presence	NN
10_1101-2020_12_31_424971	790	38	of	of	IN
10_1101-2020_12_31_424971	790	39	1247	1247	CD
10_1101-2020_12_31_424971	790	40	ProM	ProM	NNP
10_1101-2020_12_31_424971	790	41	ensured	ensure	VBD
10_1101-2020_12_31_424971	790	42	no	no	DT
10_1101-2020_12_31_424971	790	43	vacancy	vacancy	NN
10_1101-2020_12_31_424971	790	44	at	at	IN
10_1101-2020_12_31_424971	790	45	the	the	DT
10_1101-2020_12_31_424971	790	46	CCC	CCC	NNP
10_1101-2020_12_31_424971	790	47	-	-	HYPH
10_1101-2020_12_31_424971	790	48	C	C	NNP
10_1101-2020_12_31_424971	790	49	motif	motif	NN
10_1101-2020_12_31_424971	790	50	.	.	.
10_1101-2020_12_31_424971	791	1	The	the	DT
10_1101-2020_12_31_424971	791	2	increased	increased	JJ
10_1101-2020_12_31_424971	791	3	+1	+1	NNS
10_1101-2020_12_31_424971	791	4	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	791	5	in	in	IN
10_1101-2020_12_31_424971	791	6	the	the	DT
10_1101-2020_12_31_424971	791	7	m1G37	m1g37	NN
10_1101-2020_12_31_424971	791	8	–	–	:
10_1101-2020_12_31_424971	791	9	1248	1248	CD
10_1101-2020_12_31_424971	791	10	condition	condition	NN
10_1101-2020_12_31_424971	791	11	vs.	vs.	IN
10_1101-2020_12_31_424971	791	12	the	the	DT
10_1101-2020_12_31_424971	791	13	m1G37	m1g37	NN
10_1101-2020_12_31_424971	791	14	+	+	SYM
10_1101-2020_12_31_424971	791	15	condition	condition	NN
10_1101-2020_12_31_424971	791	16	indicates	indicate	VBZ
10_1101-2020_12_31_424971	791	17	that	that	IN
10_1101-2020_12_31_424971	791	18	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	791	19	and	and	CC
10_1101-2020_12_31_424971	791	20	ProL	ProL	NNP
10_1101-2020_12_31_424971	791	21	are	be	VBP
10_1101-2020_12_31_424971	791	22	each	each	DT
10_1101-2020_12_31_424971	791	23	an	an	DT
10_1101-2020_12_31_424971	791	24	active	active	JJ
10_1101-2020_12_31_424971	791	25	determinant	determinant	NN
10_1101-2020_12_31_424971	791	26	1249	1249	CD
10_1101-2020_12_31_424971	791	27	in	in	IN
10_1101-2020_12_31_424971	791	28	decoding	decode	VBG
10_1101-2020_12_31_424971	791	29	the	the	DT
10_1101-2020_12_31_424971	791	30	CCC	CCC	NNP
10_1101-2020_12_31_424971	791	31	-	-	HYPH
10_1101-2020_12_31_424971	791	32	C	C	NNP
10_1101-2020_12_31_424971	791	33	motif	motif	NN
10_1101-2020_12_31_424971	791	34	.	.	.
10_1101-2020_12_31_424971	792	1	d	d	NNP
10_1101-2020_12_31_424971	792	2	SufB2-mediated	SufB2-mediated	NNP
10_1101-2020_12_31_424971	792	3	insertion	insertion	NN
10_1101-2020_12_31_424971	792	4	of	of	IN
10_1101-2020_12_31_424971	792	5	non	non	JJ
10_1101-2020_12_31_424971	792	6	-	-	JJ
10_1101-2020_12_31_424971	792	7	proteinogenic	proteinogenic	JJ
10_1101-2020_12_31_424971	792	8	amino	amino	JJ
10_1101-2020_12_31_424971	792	9	acids	acid	NNS
10_1101-2020_12_31_424971	792	10	at	at	IN
10_1101-2020_12_31_424971	792	11	1250	1250	CD
10_1101-2020_12_31_424971	792	12	the	the	DT
10_1101-2020_12_31_424971	792	13	CCC	CCC	NNP
10_1101-2020_12_31_424971	792	14	-	-	HYPH
10_1101-2020_12_31_424971	792	15	C	C	NNP
10_1101-2020_12_31_424971	792	16	motif	motif	NN
10_1101-2020_12_31_424971	792	17	in	in	IN
10_1101-2020_12_31_424971	792	18	the	the	DT
10_1101-2020_12_31_424971	792	19	5th	5th	JJ
10_1101-2020_12_31_424971	792	20	codon	codon	NN
10_1101-2020_12_31_424971	792	21	position	position	NN
10_1101-2020_12_31_424971	792	22	of	of	IN
10_1101-2020_12_31_424971	792	23	folA	fola	NN
10_1101-2020_12_31_424971	792	24	using	use	VBG
10_1101-2020_12_31_424971	792	25	[	[	-LRB-
10_1101-2020_12_31_424971	792	26	35S]-Met	35s]-met	CD
10_1101-2020_12_31_424971	792	27	-	-	HYPH
10_1101-2020_12_31_424971	792	28	dependent	dependent	JJ
10_1101-2020_12_31_424971	792	29	in	in	FW
10_1101-2020_12_31_424971	792	30	vitro	vitro	FW
10_1101-2020_12_31_424971	792	31	translation	translation	NN
10_1101-2020_12_31_424971	792	32	.	.	.
10_1101-2020_12_31_424971	793	1	1251	1251	CD
10_1101-2020_12_31_424971	793	2	Reporters	reporter	NNS
10_1101-2020_12_31_424971	793	3	of	of	IN
10_1101-2020_12_31_424971	793	4	folA	folA	,
10_1101-2020_12_31_424971	793	5	are	be	VBP
10_1101-2020_12_31_424971	793	6	denoted	denote	VBN
10_1101-2020_12_31_424971	793	7	by	by	IN
10_1101-2020_12_31_424971	793	8	+	+	NNP
10_1101-2020_12_31_424971	793	9	/	/	SYM
10_1101-2020_12_31_424971	793	10	–	–	:
10_1101-2020_12_31_424971	793	11	CCC	CCC	NNP
10_1101-2020_12_31_424971	793	12	-	-	HYPH
10_1101-2020_12_31_424971	793	13	C	C	NNP
10_1101-2020_12_31_424971	793	14	,	,	,
10_1101-2020_12_31_424971	793	15	where	where	WRB
10_1101-2020_12_31_424971	793	16	“	"	``
10_1101-2020_12_31_424971	793	17	+	+	CC
10_1101-2020_12_31_424971	793	18	”	"	''
10_1101-2020_12_31_424971	793	19	and	and	CC
10_1101-2020_12_31_424971	793	20	“	"	``
10_1101-2020_12_31_424971	793	21	–	–	:
10_1101-2020_12_31_424971	793	22	”	"	''
10_1101-2020_12_31_424971	793	23	indicate	indicate	VBP
10_1101-2020_12_31_424971	793	24	constructs	construct	NNS
10_1101-2020_12_31_424971	793	25	with	with	IN
10_1101-2020_12_31_424971	793	26	and	and	CC
10_1101-2020_12_31_424971	793	27	1252	1252	CD
10_1101-2020_12_31_424971	793	28	without	without	IN
10_1101-2020_12_31_424971	793	29	the	the	DT
10_1101-2020_12_31_424971	793	30	CCC	CCC	NNP
10_1101-2020_12_31_424971	793	31	-	-	HYPH
10_1101-2020_12_31_424971	793	32	C	C	NNP
10_1101-2020_12_31_424971	793	33	motif	motif	NN
10_1101-2020_12_31_424971	793	34	.	.	.
10_1101-2020_12_31_424971	794	1	SDS	SDS	NNP
10_1101-2020_12_31_424971	794	2	-	-	HYPH
10_1101-2020_12_31_424971	794	3	PAGE	PAGE	NNP
10_1101-2020_12_31_424971	794	4	analysis	analysis	NN
10_1101-2020_12_31_424971	794	5	identifies	identify	VBZ
10_1101-2020_12_31_424971	794	6	full	full	JJ
10_1101-2020_12_31_424971	794	7	-	-	HYPH
10_1101-2020_12_31_424971	794	8	length	length	NN
10_1101-2020_12_31_424971	794	9	DHFR	DHFR	NNP
10_1101-2020_12_31_424971	794	10	resulting	result	VBG
10_1101-2020_12_31_424971	794	11	from	from	IN
10_1101-2020_12_31_424971	794	12	a	a	DT
10_1101-2020_12_31_424971	794	13	+1	+1	NN
10_1101-2020_12_31_424971	794	14	-	-	SYM
10_1101-2020_12_31_424971	794	15	1253	1253	CD
10_1101-2020_12_31_424971	794	16	frameshift	frameshift	NN
10_1101-2020_12_31_424971	794	17	event	event	NN
10_1101-2020_12_31_424971	794	18	at	at	IN
10_1101-2020_12_31_424971	794	19	the	the	DT
10_1101-2020_12_31_424971	794	20	CCC	CCC	NNP
10_1101-2020_12_31_424971	794	21	-	-	HYPH
10_1101-2020_12_31_424971	794	22	C	C	NNP
10_1101-2020_12_31_424971	794	23	motif	motif	NN
10_1101-2020_12_31_424971	794	24	by	by	IN
10_1101-2020_12_31_424971	794	25	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	794	26	pre	pre	JJ
10_1101-2020_12_31_424971	794	27	-	-	JJ
10_1101-2020_12_31_424971	794	28	aminoacylated	aminoacylate	VBN
10_1101-2020_12_31_424971	794	29	with	with	IN
10_1101-2020_12_31_424971	794	30	the	the	DT
10_1101-2020_12_31_424971	794	31	amino	amino	JJ
10_1101-2020_12_31_424971	794	32	acid	acid	NN
10_1101-2020_12_31_424971	794	33	shown	show	VBN
10_1101-2020_12_31_424971	794	34	at	at	IN
10_1101-2020_12_31_424971	794	35	1254	1254	CD
10_1101-2020_12_31_424971	794	36	the	the	DT
10_1101-2020_12_31_424971	794	37	top	top	NN
10_1101-2020_12_31_424971	794	38	of	of	IN
10_1101-2020_12_31_424971	794	39	each	each	DT
10_1101-2020_12_31_424971	794	40	lane	lane	NN
10_1101-2020_12_31_424971	794	41	,	,	,
10_1101-2020_12_31_424971	794	42	a	a	DT
10_1101-2020_12_31_424971	794	43	DC	DC	NNP
10_1101-2020_12_31_424971	794	44	fragment	fragment	NN
10_1101-2020_12_31_424971	794	45	resulting	result	VBG
10_1101-2020_12_31_424971	794	46	from	from	IN
10_1101-2020_12_31_424971	794	47	lack	lack	NN
10_1101-2020_12_31_424971	794	48	of	of	IN
10_1101-2020_12_31_424971	794	49	the	the	DT
10_1101-2020_12_31_424971	794	50	+1-frameshift	+1-frameshift	NN
10_1101-2020_12_31_424971	794	51	event	event	NN
10_1101-2020_12_31_424971	794	52	,	,	,
10_1101-2020_12_31_424971	794	53	and	and	CC
10_1101-2020_12_31_424971	794	54	a	a	DT
10_1101-2020_12_31_424971	794	55	DN	DN	NNP
10_1101-2020_12_31_424971	794	56	1255	1255	CD
10_1101-2020_12_31_424971	794	57	fragment	fragment	NN
10_1101-2020_12_31_424971	794	58	resulting	result	VBG
10_1101-2020_12_31_424971	794	59	from	from	IN
10_1101-2020_12_31_424971	794	60	translation	translation	NN
10_1101-2020_12_31_424971	794	61	initiation	initiation	NN
10_1101-2020_12_31_424971	794	62	at	at	IN
10_1101-2020_12_31_424971	794	63	the	the	DT
10_1101-2020_12_31_424971	794	64	AUG	AUG	NNP
10_1101-2020_12_31_424971	794	65	codon	codon	NN
10_1101-2020_12_31_424971	794	66	likely	likely	RB
10_1101-2020_12_31_424971	794	67	at	at	IN
10_1101-2020_12_31_424971	794	68	position	position	NN
10_1101-2020_12_31_424971	794	69	17	17	CD
10_1101-2020_12_31_424971	794	70	or	or	CC
10_1101-2020_12_31_424971	794	71	21	21	CD
10_1101-2020_12_31_424971	794	72	1256	1256	CD
10_1101-2020_12_31_424971	794	73	downstream	downstream	RB
10_1101-2020_12_31_424971	794	74	from	from	IN
10_1101-2020_12_31_424971	794	75	the	the	DT
10_1101-2020_12_31_424971	794	76	CCC	CCC	NNP
10_1101-2020_12_31_424971	794	77	-	-	HYPH
10_1101-2020_12_31_424971	794	78	C	C	NNP
10_1101-2020_12_31_424971	794	79	motif	motif	NN
10_1101-2020_12_31_424971	794	80	.	.	.
10_1101-2020_12_31_424971	795	1	Gel	gel	NN
10_1101-2020_12_31_424971	795	2	samples	sample	NNS
10_1101-2020_12_31_424971	795	3	were	be	VBD
10_1101-2020_12_31_424971	795	4	derived	derive	VBN
10_1101-2020_12_31_424971	795	5	from	from	IN
10_1101-2020_12_31_424971	795	6	the	the	DT
10_1101-2020_12_31_424971	795	7	same	same	JJ
10_1101-2020_12_31_424971	795	8	experiment	experiment	NN
10_1101-2020_12_31_424971	795	9	,	,	,
10_1101-2020_12_31_424971	795	10	which	which	WDT
10_1101-2020_12_31_424971	795	11	1257	1257	CD
10_1101-2020_12_31_424971	795	12	was	be	VBD
10_1101-2020_12_31_424971	795	13	performed	perform	VBN
10_1101-2020_12_31_424971	795	14	five	five	CD
10_1101-2020_12_31_424971	795	15	times	time	NNS
10_1101-2020_12_31_424971	795	16	with	with	IN
10_1101-2020_12_31_424971	795	17	similar	similar	JJ
10_1101-2020_12_31_424971	795	18	results	result	NNS
10_1101-2020_12_31_424971	795	19	.	.	.
10_1101-2020_12_31_424971	796	1	Gels	gel	NNS
10_1101-2020_12_31_424971	796	2	for	for	IN
10_1101-2020_12_31_424971	796	3	each	each	DT
10_1101-2020_12_31_424971	796	4	experiment	experiment	NN
10_1101-2020_12_31_424971	796	5	were	be	VBD
10_1101-2020_12_31_424971	796	6	processed	process	VBN
10_1101-2020_12_31_424971	796	7	in	in	IN
10_1101-2020_12_31_424971	796	8	parallel	parallel	NN
10_1101-2020_12_31_424971	796	9	.	.	.
10_1101-2020_12_31_424971	797	1	1258	1258	CD
10_1101-2020_12_31_424971	797	2	Lane	Lane	NNP
10_1101-2020_12_31_424971	797	3	1	1	CD
10_1101-2020_12_31_424971	797	4	:	:	:
10_1101-2020_12_31_424971	797	5	full	full	JJ
10_1101-2020_12_31_424971	797	6	-	-	HYPH
10_1101-2020_12_31_424971	797	7	length	length	NN
10_1101-2020_12_31_424971	797	8	DHFR	DHFR	NNP
10_1101-2020_12_31_424971	797	9	as	as	IN
10_1101-2020_12_31_424971	797	10	the	the	DT
10_1101-2020_12_31_424971	797	11	molecular	molecular	JJ
10_1101-2020_12_31_424971	797	12	marker	marker	NN
10_1101-2020_12_31_424971	797	13	;	;	:
10_1101-2020_12_31_424971	797	14	deacyl	deacyl	NNP
10_1101-2020_12_31_424971	797	15	:	:	:
10_1101-2020_12_31_424971	797	16	deacylated	deacylate	VBN
10_1101-2020_12_31_424971	797	17	tRNA	tRNA	NNP
10_1101-2020_12_31_424971	797	18	.	.	.
10_1101-2020_12_31_424971	798	1	1259	1259	CD
10_1101-2020_12_31_424971	798	2	1260	1260	CD
10_1101-2020_12_31_424971	798	3	Figure	Figure	NNP
10_1101-2020_12_31_424971	798	4	3	3	CD
10_1101-2020_12_31_424971	798	5	.	.	.
10_1101-2020_12_31_424971	799	1	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	799	2	uses	use	VBZ
10_1101-2020_12_31_424971	799	3	a	a	DT
10_1101-2020_12_31_424971	799	4	triplet	triplet	NN
10_1101-2020_12_31_424971	799	5	anticodon	anticodon	NN
10_1101-2020_12_31_424971	799	6	-	-	HYPH
10_1101-2020_12_31_424971	799	7	codon	codon	NN
10_1101-2020_12_31_424971	799	8	pairing	pairing	NN
10_1101-2020_12_31_424971	799	9	scheme	scheme	NN
10_1101-2020_12_31_424971	799	10	at	at	IN
10_1101-2020_12_31_424971	799	11	the	the	DT
10_1101-2020_12_31_424971	799	12	A	A	NNP
10_1101-2020_12_31_424971	799	13	site	site	NN
10_1101-2020_12_31_424971	799	14	.	.	.
10_1101-2020_12_31_424971	800	1	a	a	DT
10_1101-2020_12_31_424971	800	2	GTP	GTP	NNP
10_1101-2020_12_31_424971	800	3	1261	1261	CD
10_1101-2020_12_31_424971	800	4	hydrolysis	hydrolysis	NN
10_1101-2020_12_31_424971	800	5	by	by	IN
10_1101-2020_12_31_424971	800	6	EF	EF	NNP
10_1101-2020_12_31_424971	800	7	-	-	HYPH
10_1101-2020_12_31_424971	800	8	Tu	Tu	NNP
10_1101-2020_12_31_424971	800	9	as	as	IN
10_1101-2020_12_31_424971	800	10	a	a	DT
10_1101-2020_12_31_424971	800	11	function	function	NN
10_1101-2020_12_31_424971	800	12	of	of	IN
10_1101-2020_12_31_424971	800	13	time	time	NN
10_1101-2020_12_31_424971	800	14	for	for	IN
10_1101-2020_12_31_424971	800	15	delivery	delivery	NN
10_1101-2020_12_31_424971	800	16	of	of	IN
10_1101-2020_12_31_424971	800	17	G37-	G37-	NNP
10_1101-2020_12_31_424971	800	18	or	or	CC
10_1101-2020_12_31_424971	800	19	native	native	JJ
10_1101-2020_12_31_424971	800	20	-	-	HYPH
10_1101-2020_12_31_424971	800	21	state	state	NN
10_1101-2020_12_31_424971	800	22	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	800	23	or	or	CC
10_1101-2020_12_31_424971	800	24	ProL	ProL	NNP
10_1101-2020_12_31_424971	800	25	-	-	HYPH
10_1101-2020_12_31_424971	800	26	TC	TC	NNP
10_1101-2020_12_31_424971	800	27	1262	1262	CD
10_1101-2020_12_31_424971	800	28	to	to	IN
10_1101-2020_12_31_424971	800	29	the	the	DT
10_1101-2020_12_31_424971	800	30	A	A	NNP
10_1101-2020_12_31_424971	800	31	site	site	NN
10_1101-2020_12_31_424971	800	32	of	of	IN
10_1101-2020_12_31_424971	800	33	a	a	DT
10_1101-2020_12_31_424971	800	34	70S	70S	NNP
10_1101-2020_12_31_424971	800	35	IC	IC	NNP
10_1101-2020_12_31_424971	800	36	.	.	.
10_1101-2020_12_31_424971	801	1	Although	although	IN
10_1101-2020_12_31_424971	801	2	the	the	DT
10_1101-2020_12_31_424971	801	3	concentration	concentration	NN
10_1101-2020_12_31_424971	801	4	of	of	IN
10_1101-2020_12_31_424971	801	5	TCs	tc	NNS
10_1101-2020_12_31_424971	801	6	was	be	VBD
10_1101-2020_12_31_424971	801	7	limiting	limit	VBG
10_1101-2020_12_31_424971	801	8	,	,	,
10_1101-2020_12_31_424971	801	9	which	which	WDT
10_1101-2020_12_31_424971	801	10	would	would	MD
10_1101-2020_12_31_424971	801	11	limit	limit	VB
10_1101-2020_12_31_424971	801	12	the	the	DT
10_1101-2020_12_31_424971	801	13	1263	1263	CD
10_1101-2020_12_31_424971	801	14	rate	rate	NN
10_1101-2020_12_31_424971	801	15	of	of	IN
10_1101-2020_12_31_424971	801	16	binding	binding	NN
10_1101-2020_12_31_424971	801	17	of	of	IN
10_1101-2020_12_31_424971	801	18	TCs	tc	NNS
10_1101-2020_12_31_424971	801	19	to	to	IN
10_1101-2020_12_31_424971	801	20	the	the	DT
10_1101-2020_12_31_424971	801	21	70S	70S	NNP
10_1101-2020_12_31_424971	801	22	IC	IC	NNP
10_1101-2020_12_31_424971	801	23	,	,	,
10_1101-2020_12_31_424971	801	24	the	the	DT
10_1101-2020_12_31_424971	801	25	observed	observed	JJ
10_1101-2020_12_31_424971	801	26	differences	difference	NNS
10_1101-2020_12_31_424971	801	27	in	in	IN
10_1101-2020_12_31_424971	801	28	the	the	DT
10_1101-2020_12_31_424971	801	29	yield	yield	NN
10_1101-2020_12_31_424971	801	30	of	of	IN
10_1101-2020_12_31_424971	801	31	GTPase	GTPase	NNP
10_1101-2020_12_31_424971	801	32	activity	activity	NN
10_1101-2020_12_31_424971	801	33	1264	1264	CD
10_1101-2020_12_31_424971	801	34	indicated	indicate	VBD
10_1101-2020_12_31_424971	801	35	that	that	IN
10_1101-2020_12_31_424971	801	36	binding	bind	VBG
10_1101-2020_12_31_424971	801	37	was	be	VBD
10_1101-2020_12_31_424971	801	38	not	not	RB
10_1101-2020_12_31_424971	801	39	the	the	DT
10_1101-2020_12_31_424971	801	40	sole	sole	JJ
10_1101-2020_12_31_424971	801	41	determinant	determinant	NN
10_1101-2020_12_31_424971	801	42	,	,	,
10_1101-2020_12_31_424971	801	43	but	but	CC
10_1101-2020_12_31_424971	801	44	that	that	IN
10_1101-2020_12_31_424971	801	45	other	other	JJ
10_1101-2020_12_31_424971	801	46	factors	factor	NNS
10_1101-2020_12_31_424971	801	47	,	,	,
10_1101-2020_12_31_424971	801	48	such	such	JJ
10_1101-2020_12_31_424971	801	49	as	as	IN
10_1101-2020_12_31_424971	801	50	the	the	DT
10_1101-2020_12_31_424971	801	51	identity	identity	NN
10_1101-2020_12_31_424971	801	52	1265	1265	CD
10_1101-2020_12_31_424971	801	53	and	and	CC
10_1101-2020_12_31_424971	801	54	the	the	DT
10_1101-2020_12_31_424971	801	55	methylation	methylation	NN
10_1101-2020_12_31_424971	801	56	state	state	NN
10_1101-2020_12_31_424971	801	57	of	of	IN
10_1101-2020_12_31_424971	801	58	the	the	DT
10_1101-2020_12_31_424971	801	59	tRNA	trna	NN
10_1101-2020_12_31_424971	801	60	,	,	,
10_1101-2020_12_31_424971	801	61	affected	affect	VBD
10_1101-2020_12_31_424971	801	62	the	the	DT
10_1101-2020_12_31_424971	801	63	GTPase	GTPase	NNP
10_1101-2020_12_31_424971	801	64	activity	activity	NN
10_1101-2020_12_31_424971	801	65	.	.	.
10_1101-2020_12_31_424971	802	1	b	b	LS
10_1101-2020_12_31_424971	802	2	Dipeptide	Dipeptide	NNP
10_1101-2020_12_31_424971	802	3	fMP	fmp	CD
10_1101-2020_12_31_424971	802	4	formation	formation	NN
10_1101-2020_12_31_424971	802	5	1266	1266	CD
10_1101-2020_12_31_424971	802	6	as	as	IN
10_1101-2020_12_31_424971	802	7	a	a	DT
10_1101-2020_12_31_424971	802	8	function	function	NN
10_1101-2020_12_31_424971	802	9	of	of	IN
10_1101-2020_12_31_424971	802	10	time	time	NN
10_1101-2020_12_31_424971	802	11	for	for	IN
10_1101-2020_12_31_424971	802	12	delivery	delivery	NN
10_1101-2020_12_31_424971	802	13	of	of	IN
10_1101-2020_12_31_424971	802	14	G37-	G37-	NNP
10_1101-2020_12_31_424971	802	15	or	or	CC
10_1101-2020_12_31_424971	802	16	native	native	JJ
10_1101-2020_12_31_424971	802	17	-	-	HYPH
10_1101-2020_12_31_424971	802	18	state	state	NN
10_1101-2020_12_31_424971	802	19	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	802	20	or	or	CC
10_1101-2020_12_31_424971	802	21	ProL	ProL	NNP
10_1101-2020_12_31_424971	802	22	-	-	HYPH
10_1101-2020_12_31_424971	802	23	TC	TC	NNP
10_1101-2020_12_31_424971	802	24	to	to	IN
10_1101-2020_12_31_424971	802	25	the	the	DT
10_1101-2020_12_31_424971	802	26	A	A	NNP
10_1101-2020_12_31_424971	802	27	site	site	NN
10_1101-2020_12_31_424971	802	28	of	of	IN
10_1101-2020_12_31_424971	802	29	a	a	DT
10_1101-2020_12_31_424971	802	30	70S	70S	NNP
10_1101-2020_12_31_424971	802	31	1267	1267	CD
10_1101-2020_12_31_424971	802	32	.CC	.cc	SYM
10_1101-2020_12_31_424971	802	33	-	-	HYPH
10_1101-2020_12_31_424971	802	34	BY	by	IN
10_1101-2020_12_31_424971	802	35	-	-	HYPH
10_1101-2020_12_31_424971	802	36	NC	NC	NNP
10_1101-2020_12_31_424971	802	37	-	-	HYPH
10_1101-2020_12_31_424971	802	38	ND	ND	NNP
10_1101-2020_12_31_424971	802	39	4.0	4.0	CD
10_1101-2020_12_31_424971	802	40	International	International	NNP
10_1101-2020_12_31_424971	802	41	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	802	42	under	under	IN
10_1101-2020_12_31_424971	802	43	a	a	DT
10_1101-2020_12_31_424971	802	44	(	(	-LRB-
10_1101-2020_12_31_424971	802	45	which	which	WDT
10_1101-2020_12_31_424971	802	46	was	be	VBD
10_1101-2020_12_31_424971	802	47	not	not	RB
10_1101-2020_12_31_424971	802	48	certified	certify	VBN
10_1101-2020_12_31_424971	802	49	by	by	IN
10_1101-2020_12_31_424971	802	50	peer	peer	NN
10_1101-2020_12_31_424971	802	51	review	review	NN
10_1101-2020_12_31_424971	802	52	)	)	-RRB-
10_1101-2020_12_31_424971	802	53	is	be	VBZ
10_1101-2020_12_31_424971	802	54	the	the	DT
10_1101-2020_12_31_424971	802	55	author	author	NN
10_1101-2020_12_31_424971	802	56	/	/	SYM
10_1101-2020_12_31_424971	802	57	funder	funder	NN
10_1101-2020_12_31_424971	802	58	,	,	,
10_1101-2020_12_31_424971	802	59	who	who	WP
10_1101-2020_12_31_424971	802	60	has	have	VBZ
10_1101-2020_12_31_424971	802	61	granted	grant	VBN
10_1101-2020_12_31_424971	802	62	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	802	63	a	a	DT
10_1101-2020_12_31_424971	802	64	license	license	NN
10_1101-2020_12_31_424971	802	65	to	to	TO
10_1101-2020_12_31_424971	802	66	display	display	VB
10_1101-2020_12_31_424971	802	67	the	the	DT
10_1101-2020_12_31_424971	802	68	preprint	preprint	NN
10_1101-2020_12_31_424971	802	69	in	in	IN
10_1101-2020_12_31_424971	802	70	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	802	71	.	.	.
10_1101-2020_12_31_424971	803	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	803	2	is	be	VBZ
10_1101-2020_12_31_424971	803	3	made	make	VBN
10_1101-2020_12_31_424971	803	4	The	the	DT
10_1101-2020_12_31_424971	803	5	copyright	copyright	NN
10_1101-2020_12_31_424971	803	6	holder	holder	NN
10_1101-2020_12_31_424971	803	7	for	for	IN
10_1101-2020_12_31_424971	803	8	this	this	DT
10_1101-2020_12_31_424971	803	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	803	10	version	version	NN
10_1101-2020_12_31_424971	803	11	posted	post	VBD
10_1101-2020_12_31_424971	803	12	January	January	NNP
10_1101-2020_12_31_424971	803	13	2	2	CD
10_1101-2020_12_31_424971	803	14	,	,	,
10_1101-2020_12_31_424971	803	15	2021	2021	CD
10_1101-2020_12_31_424971	803	16	.	.	.
10_1101-2020_12_31_424971	803	17	;	;	:
10_1101-2020_12_31_424971	803	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	803	19	:	:	:
10_1101-2020_12_31_424971	803	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	803	21	preprint	preprint	NN
10_1101-2020_12_31_424971	803	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NNP
10_1101-2020_12_31_424971	803	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	803	24	49	49	CD
10_1101-2020_12_31_424971	803	25	IC	IC	NNP
10_1101-2020_12_31_424971	803	26	.	.	.
10_1101-2020_12_31_424971	804	1	Due	due	IN
10_1101-2020_12_31_424971	804	2	to	to	IN
10_1101-2020_12_31_424971	804	3	the	the	DT
10_1101-2020_12_31_424971	804	4	limiting	limit	VBG
10_1101-2020_12_31_424971	804	5	concentration	concentration	NN
10_1101-2020_12_31_424971	804	6	of	of	IN
10_1101-2020_12_31_424971	804	7	the	the	DT
10_1101-2020_12_31_424971	804	8	70S	70S	NNP
10_1101-2020_12_31_424971	804	9	IC	IC	NNP
10_1101-2020_12_31_424971	804	10	,	,	,
10_1101-2020_12_31_424971	804	11	which	which	WDT
10_1101-2020_12_31_424971	804	12	did	do	VBD
10_1101-2020_12_31_424971	804	13	not	not	RB
10_1101-2020_12_31_424971	804	14	include	include	VB
10_1101-2020_12_31_424971	804	15	the	the	DT
10_1101-2020_12_31_424971	804	16	tRNA	trna	NN
10_1101-2020_12_31_424971	804	17	substrate	substrate	NN
10_1101-2020_12_31_424971	804	18	,	,	,
10_1101-2020_12_31_424971	804	19	the	the	DT
10_1101-2020_12_31_424971	804	20	1268	1268	CD
10_1101-2020_12_31_424971	804	21	yield	yield	NN
10_1101-2020_12_31_424971	804	22	of	of	IN
10_1101-2020_12_31_424971	804	23	di-	di-	JJ
10_1101-2020_12_31_424971	804	24	or	or	CC
10_1101-2020_12_31_424971	804	25	tri	tri	JJ
10_1101-2020_12_31_424971	804	26	-	-	HYPH
10_1101-2020_12_31_424971	804	27	peptide	peptide	JJ
10_1101-2020_12_31_424971	804	28	formation	formation	NN
10_1101-2020_12_31_424971	804	29	assays	assays	RB
10_1101-2020_12_31_424971	804	30	was	be	VBD
10_1101-2020_12_31_424971	804	31	constant	constant	JJ
10_1101-2020_12_31_424971	804	32	even	even	RB
10_1101-2020_12_31_424971	804	33	with	with	IN
10_1101-2020_12_31_424971	804	34	different	different	JJ
10_1101-2020_12_31_424971	804	35	tRNAs	trna	NNS
10_1101-2020_12_31_424971	804	36	in	in	IN
10_1101-2020_12_31_424971	804	37	TCs	tc	NNS
10_1101-2020_12_31_424971	804	38	.	.	.
10_1101-2020_12_31_424971	805	1	c	c	LS
10_1101-2020_12_31_424971	805	2	The	the	DT
10_1101-2020_12_31_424971	805	3	1269	1269	CD
10_1101-2020_12_31_424971	805	4	yield	yield	NN
10_1101-2020_12_31_424971	805	5	of	of	IN
10_1101-2020_12_31_424971	805	6	fMP	fMP	NNS
10_1101-2020_12_31_424971	805	7	and	and	CC
10_1101-2020_12_31_424971	805	8	fMR	fMR	NNS
10_1101-2020_12_31_424971	805	9	in	in	IN
10_1101-2020_12_31_424971	805	10	dipeptide	dipeptide	NN
10_1101-2020_12_31_424971	805	11	formation	formation	NN
10_1101-2020_12_31_424971	805	12	assays	assays	RB
10_1101-2020_12_31_424971	805	13	in	in	IN
10_1101-2020_12_31_424971	805	14	which	which	WDT
10_1101-2020_12_31_424971	805	15	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	805	16	mixtures	mixture	NNS
10_1101-2020_12_31_424971	805	17	of	of	IN
10_1101-2020_12_31_424971	805	18	native	native	JJ
10_1101-2020_12_31_424971	805	19	-	-	HYPH
10_1101-2020_12_31_424971	805	20	state	state	NN
10_1101-2020_12_31_424971	805	21	1270	1270	CD
10_1101-2020_12_31_424971	805	22	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	805	23	,	,	,
10_1101-2020_12_31_424971	805	24	carrying	carry	VBG
10_1101-2020_12_31_424971	805	25	Pro	Pro	NNP
10_1101-2020_12_31_424971	805	26	and/or	and/or	CC
10_1101-2020_12_31_424971	805	27	Arg	Arg	NNP
10_1101-2020_12_31_424971	805	28	,	,	,
10_1101-2020_12_31_424971	805	29	and/or	and/or	CC
10_1101-2020_12_31_424971	805	30	native	native	JJ
10_1101-2020_12_31_424971	805	31	-	-	HYPH
10_1101-2020_12_31_424971	805	32	state	state	NN
10_1101-2020_12_31_424971	805	33	ProL	ProL	NNP
10_1101-2020_12_31_424971	805	34	-	-	HYPH
10_1101-2020_12_31_424971	805	35	TC	TC	NNP
10_1101-2020_12_31_424971	805	36	,	,	,
10_1101-2020_12_31_424971	805	37	carrying	carry	VBG
10_1101-2020_12_31_424971	805	38	Pro	Pro	NNP
10_1101-2020_12_31_424971	805	39	and/or	and/or	CC
10_1101-2020_12_31_424971	805	40	Arg	Arg	NNP
10_1101-2020_12_31_424971	805	41	,	,	,
10_1101-2020_12_31_424971	805	42	are	be	VBP
10_1101-2020_12_31_424971	805	43	1271	1271	CD
10_1101-2020_12_31_424971	805	44	delivered	deliver	VBN
10_1101-2020_12_31_424971	805	45	to	to	IN
10_1101-2020_12_31_424971	805	46	70S	70S	NNP
10_1101-2020_12_31_424971	805	47	ICs	ic	NNS
10_1101-2020_12_31_424971	805	48	.	.	.
10_1101-2020_12_31_424971	806	1	The	the	DT
10_1101-2020_12_31_424971	806	2	mRNA	mrna	NN
10_1101-2020_12_31_424971	806	3	in	in	IN
10_1101-2020_12_31_424971	806	4	70S	70S	NNP
10_1101-2020_12_31_424971	806	5	ICs	ic	NNS
10_1101-2020_12_31_424971	806	6	in	in	IN
10_1101-2020_12_31_424971	806	7	(	(	-LRB-
10_1101-2020_12_31_424971	806	8	A	A	NNP
10_1101-2020_12_31_424971	806	9	-	-	HYPH
10_1101-2020_12_31_424971	806	10	C	C	NNP
10_1101-2020_12_31_424971	806	11	)	)	-RRB-
10_1101-2020_12_31_424971	806	12	is	be	VBZ
10_1101-2020_12_31_424971	806	13	AUG	AUG	NNP
10_1101-2020_12_31_424971	806	14	-	-	HYPH
10_1101-2020_12_31_424971	806	15	CCC	CCC	NNP
10_1101-2020_12_31_424971	806	16	-	-	HYPH
10_1101-2020_12_31_424971	806	17	CGU	CGU	NNP
10_1101-2020_12_31_424971	806	18	-	-	HYPH
10_1101-2020_12_31_424971	806	19	U.	U.	NNP
10_1101-2020_12_31_424971	807	1	d	d	LS
10_1101-2020_12_31_424971	807	2	Dipeptide	Dipeptide	NNP
10_1101-2020_12_31_424971	807	3	formation	formation	NN
10_1101-2020_12_31_424971	807	4	1272	1272	CD
10_1101-2020_12_31_424971	807	5	rate	rate	NN
10_1101-2020_12_31_424971	807	6	kfMP	kfMP	NNP
10_1101-2020_12_31_424971	807	7	,	,	,
10_1101-2020_12_31_424971	807	8	obs	obs	NN
10_1101-2020_12_31_424971	807	9	for	for	IN
10_1101-2020_12_31_424971	807	10	delivery	delivery	NN
10_1101-2020_12_31_424971	807	11	of	of	IN
10_1101-2020_12_31_424971	807	12	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	807	13	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	807	14	to	to	IN
10_1101-2020_12_31_424971	807	15	70S	70S	NNP
10_1101-2020_12_31_424971	807	16	ICs	ic	NNS
10_1101-2020_12_31_424971	807	17	containing	contain	VBG
10_1101-2020_12_31_424971	807	18	sequence	sequence	NN
10_1101-2020_12_31_424971	807	19	variants	variant	NNS
10_1101-2020_12_31_424971	807	20	of	of	IN
10_1101-2020_12_31_424971	807	21	the	the	DT
10_1101-2020_12_31_424971	807	22	1273	1273	CD
10_1101-2020_12_31_424971	807	23	CCC	CCC	NNP
10_1101-2020_12_31_424971	807	24	-	-	HYPH
10_1101-2020_12_31_424971	807	25	C	C	NNP
10_1101-2020_12_31_424971	807	26	motif	motif	NN
10_1101-2020_12_31_424971	807	27	in	in	IN
10_1101-2020_12_31_424971	807	28	the	the	DT
10_1101-2020_12_31_424971	807	29	A	A	NNP
10_1101-2020_12_31_424971	807	30	site	site	NN
10_1101-2020_12_31_424971	807	31	.	.	.
10_1101-2020_12_31_424971	808	1	In	in	IN
10_1101-2020_12_31_424971	808	2	panels	panel	NNS
10_1101-2020_12_31_424971	808	3	a	a	XX
10_1101-2020_12_31_424971	808	4	,	,	,
10_1101-2020_12_31_424971	808	5	b	b	NN
10_1101-2020_12_31_424971	808	6	,	,	,
10_1101-2020_12_31_424971	808	7	the	the	DT
10_1101-2020_12_31_424971	808	8	bars	bar	NNS
10_1101-2020_12_31_424971	808	9	in	in	IN
10_1101-2020_12_31_424971	808	10	the	the	DT
10_1101-2020_12_31_424971	808	11	graphs	graph	NNS
10_1101-2020_12_31_424971	808	12	are	be	VBP
10_1101-2020_12_31_424971	808	13	SD	sd	NN
10_1101-2020_12_31_424971	808	14	of	of	IN
10_1101-2020_12_31_424971	808	15	three	three	CD
10_1101-2020_12_31_424971	808	16	independent	independent	NN
10_1101-2020_12_31_424971	808	17	(	(	-LRB-
10_1101-2020_12_31_424971	808	18	n	n	IN
10_1101-2020_12_31_424971	808	19	1274	1274	CD
10_1101-2020_12_31_424971	808	20	=	=	SYM
10_1101-2020_12_31_424971	808	21	3	3	LS
10_1101-2020_12_31_424971	808	22	)	)	-RRB-
10_1101-2020_12_31_424971	808	23	experiments	experiment	NNS
10_1101-2020_12_31_424971	808	24	,	,	,
10_1101-2020_12_31_424971	808	25	in	in	IN
10_1101-2020_12_31_424971	808	26	panel	panel	NN
10_1101-2020_12_31_424971	808	27	c	c	NNP
10_1101-2020_12_31_424971	808	28	,	,	,
10_1101-2020_12_31_424971	808	29	the	the	DT
10_1101-2020_12_31_424971	808	30	bars	bar	NNS
10_1101-2020_12_31_424971	808	31	in	in	IN
10_1101-2020_12_31_424971	808	32	the	the	DT
10_1101-2020_12_31_424971	808	33	graphs	graph	NNS
10_1101-2020_12_31_424971	808	34	are	be	VBP
10_1101-2020_12_31_424971	808	35	SD	sd	NN
10_1101-2020_12_31_424971	808	36	of	of	IN
10_1101-2020_12_31_424971	808	37	four	four	CD
10_1101-2020_12_31_424971	808	38	independent	independent	NN
10_1101-2020_12_31_424971	808	39	(	(	-LRB-
10_1101-2020_12_31_424971	808	40	n	n	JJ
10_1101-2020_12_31_424971	808	41	=	=	SYM
10_1101-2020_12_31_424971	808	42	4	4	LS
10_1101-2020_12_31_424971	808	43	)	)	-RRB-
10_1101-2020_12_31_424971	808	44	experiments	experiment	NNS
10_1101-2020_12_31_424971	808	45	,	,	,
10_1101-2020_12_31_424971	808	46	1275	1275	CD
10_1101-2020_12_31_424971	808	47	and	and	CC
10_1101-2020_12_31_424971	808	48	in	in	IN
10_1101-2020_12_31_424971	808	49	panel	panel	NN
10_1101-2020_12_31_424971	808	50	d	d	NN
10_1101-2020_12_31_424971	808	51	,	,	,
10_1101-2020_12_31_424971	808	52	the	the	DT
10_1101-2020_12_31_424971	808	53	bars	bar	NNS
10_1101-2020_12_31_424971	808	54	in	in	IN
10_1101-2020_12_31_424971	808	55	the	the	DT
10_1101-2020_12_31_424971	808	56	graphs	graph	NNS
10_1101-2020_12_31_424971	808	57	are	be	VBP
10_1101-2020_12_31_424971	808	58	SD	sd	NN
10_1101-2020_12_31_424971	808	59	of	of	IN
10_1101-2020_12_31_424971	808	60	three	three	CD
10_1101-2020_12_31_424971	808	61	or	or	CC
10_1101-2020_12_31_424971	808	62	four	four	CD
10_1101-2020_12_31_424971	808	63	independent	independent	NN
10_1101-2020_12_31_424971	808	64	(	(	-LRB-
10_1101-2020_12_31_424971	808	65	n	n	NN
10_1101-2020_12_31_424971	808	66	=	=	SYM
10_1101-2020_12_31_424971	808	67	3	3	CD
10_1101-2020_12_31_424971	808	68	or	or	CC
10_1101-2020_12_31_424971	808	69	4	4	CD
10_1101-2020_12_31_424971	808	70	)	)	-RRB-
10_1101-2020_12_31_424971	808	71	experiments	experiment	NNS
10_1101-2020_12_31_424971	808	72	.	.	.
10_1101-2020_12_31_424971	809	1	1276	1276	CD
10_1101-2020_12_31_424971	809	2	All	all	DT
10_1101-2020_12_31_424971	809	3	data	datum	NNS
10_1101-2020_12_31_424971	809	4	are	be	VBP
10_1101-2020_12_31_424971	809	5	presented	present	VBN
10_1101-2020_12_31_424971	809	6	as	as	IN
10_1101-2020_12_31_424971	809	7	mean	mean	JJ
10_1101-2020_12_31_424971	809	8	values	value	NNS
10_1101-2020_12_31_424971	809	9	±	±	CD
10_1101-2020_12_31_424971	809	10	SD	sd	NN
10_1101-2020_12_31_424971	809	11	.	.	.
10_1101-2020_12_31_424971	810	1	∆t	∆t	LS
10_1101-2020_12_31_424971	810	2	:	:	:
10_1101-2020_12_31_424971	810	3	a	a	DT
10_1101-2020_12_31_424971	810	4	time	time	NN
10_1101-2020_12_31_424971	810	5	interval	interval	NN
10_1101-2020_12_31_424971	810	6	,	,	,
10_1101-2020_12_31_424971	810	7	ND	ND	NNP
10_1101-2020_12_31_424971	810	8	:	:	:
10_1101-2020_12_31_424971	810	9	not	not	RB
10_1101-2020_12_31_424971	810	10	detected	detect	VBN
10_1101-2020_12_31_424971	810	11	.	.	.
10_1101-2020_12_31_424971	811	1	1277	1277	CD
10_1101-2020_12_31_424971	811	2	1278	1278	CD
10_1101-2020_12_31_424971	811	3	Figure	Figure	NNP
10_1101-2020_12_31_424971	811	4	4	4	CD
10_1101-2020_12_31_424971	811	5	.	.	.
10_1101-2020_12_31_424971	812	1	Plasticity	plasticity	NN
10_1101-2020_12_31_424971	812	2	of	of	IN
10_1101-2020_12_31_424971	812	3	SufB2-induced	SufB2-induced	NNP
10_1101-2020_12_31_424971	812	4	+1	+1	NNS
10_1101-2020_12_31_424971	812	5	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	812	6	.	.	.
10_1101-2020_12_31_424971	813	1	a	a	DT
10_1101-2020_12_31_424971	813	2	fMP	fMP	NNP
10_1101-2020_12_31_424971	813	3	formation	formation	NN
10_1101-2020_12_31_424971	813	4	as	as	IN
10_1101-2020_12_31_424971	813	5	a	a	DT
10_1101-2020_12_31_424971	813	6	function	function	NN
10_1101-2020_12_31_424971	813	7	of	of	IN
10_1101-2020_12_31_424971	813	8	time	time	NN
10_1101-2020_12_31_424971	813	9	1279	1279	CD
10_1101-2020_12_31_424971	813	10	upon	upon	IN
10_1101-2020_12_31_424971	813	11	delivery	delivery	NN
10_1101-2020_12_31_424971	813	12	of	of	IN
10_1101-2020_12_31_424971	813	13	the	the	DT
10_1101-2020_12_31_424971	813	14	G37C	G37C	NNP
10_1101-2020_12_31_424971	813	15	variant	variant	NN
10_1101-2020_12_31_424971	813	16	of	of	IN
10_1101-2020_12_31_424971	813	17	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	813	18	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	813	19	to	to	IN
10_1101-2020_12_31_424971	813	20	the	the	DT
10_1101-2020_12_31_424971	813	21	A	A	NNP
10_1101-2020_12_31_424971	813	22	site	site	NN
10_1101-2020_12_31_424971	813	23	of	of	IN
10_1101-2020_12_31_424971	813	24	a	a	DT
10_1101-2020_12_31_424971	813	25	70S	70S	NNP
10_1101-2020_12_31_424971	813	26	IC	IC	NNP
10_1101-2020_12_31_424971	813	27	,	,	,
10_1101-2020_12_31_424971	813	28	allowing	allow	VBG
10_1101-2020_12_31_424971	813	29	1280	1280	CD
10_1101-2020_12_31_424971	813	30	nucleotides	nucleotide	VBZ
10_1101-2020_12_31_424971	813	31	34	34	CD
10_1101-2020_12_31_424971	813	32	-	-	SYM
10_1101-2020_12_31_424971	813	33	36	36	CD
10_1101-2020_12_31_424971	813	34	to	to	TO
10_1101-2020_12_31_424971	813	35	pair	pair	VB
10_1101-2020_12_31_424971	813	36	with	with	IN
10_1101-2020_12_31_424971	813	37	a	a	DT
10_1101-2020_12_31_424971	813	38	CCC	CCC	NNP
10_1101-2020_12_31_424971	813	39	-	-	HYPH
10_1101-2020_12_31_424971	813	40	C	C	NNP
10_1101-2020_12_31_424971	813	41	motif	motif	NN
10_1101-2020_12_31_424971	813	42	at	at	IN
10_1101-2020_12_31_424971	813	43	the	the	DT
10_1101-2020_12_31_424971	813	44	A	A	NNP
10_1101-2020_12_31_424971	813	45	site	site	NN
10_1101-2020_12_31_424971	813	46	.	.	.
10_1101-2020_12_31_424971	814	1	b	b	NN
10_1101-2020_12_31_424971	814	2	fMP	fMP	NNP
10_1101-2020_12_31_424971	814	3	formation	formation	NN
10_1101-2020_12_31_424971	814	4	as	as	IN
10_1101-2020_12_31_424971	814	5	a	a	DT
10_1101-2020_12_31_424971	814	6	function	function	NN
10_1101-2020_12_31_424971	814	7	of	of	IN
10_1101-2020_12_31_424971	814	8	time	time	NN
10_1101-2020_12_31_424971	814	9	1281	1281	CD
10_1101-2020_12_31_424971	814	10	upon	upon	IN
10_1101-2020_12_31_424971	814	11	delivery	delivery	NN
10_1101-2020_12_31_424971	814	12	of	of	IN
10_1101-2020_12_31_424971	814	13	the	the	DT
10_1101-2020_12_31_424971	814	14	G34C	G34C	NNP
10_1101-2020_12_31_424971	814	15	variant	variant	NN
10_1101-2020_12_31_424971	814	16	of	of	IN
10_1101-2020_12_31_424971	814	17	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	814	18	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	814	19	to	to	IN
10_1101-2020_12_31_424971	814	20	the	the	DT
10_1101-2020_12_31_424971	814	21	A	A	NNP
10_1101-2020_12_31_424971	814	22	site	site	NN
10_1101-2020_12_31_424971	814	23	of	of	IN
10_1101-2020_12_31_424971	814	24	a	a	DT
10_1101-2020_12_31_424971	814	25	70S	70S	NNP
10_1101-2020_12_31_424971	814	26	IC	IC	NNP
10_1101-2020_12_31_424971	814	27	,	,	,
10_1101-2020_12_31_424971	814	28	allowing	allow	VBG
10_1101-2020_12_31_424971	814	29	1282	1282	CD
10_1101-2020_12_31_424971	814	30	nucleotides	nucleotide	VBZ
10_1101-2020_12_31_424971	814	31	35	35	CD
10_1101-2020_12_31_424971	814	32	-	-	SYM
10_1101-2020_12_31_424971	814	33	37	37	CD
10_1101-2020_12_31_424971	814	34	to	to	TO
10_1101-2020_12_31_424971	814	35	pair	pair	VB
10_1101-2020_12_31_424971	814	36	with	with	IN
10_1101-2020_12_31_424971	814	37	a	a	DT
10_1101-2020_12_31_424971	814	38	CCC	CCC	NNP
10_1101-2020_12_31_424971	814	39	-	-	HYPH
10_1101-2020_12_31_424971	814	40	C	C	NNP
10_1101-2020_12_31_424971	814	41	motif	motif	NN
10_1101-2020_12_31_424971	814	42	.	.	.
10_1101-2020_12_31_424971	815	1	c	c	LS
10_1101-2020_12_31_424971	815	2	-	-	HYPH
10_1101-2020_12_31_424971	815	3	f	f	NNP
10_1101-2020_12_31_424971	815	4	Results	Results	NNP
10_1101-2020_12_31_424971	815	5	of	of	IN
10_1101-2020_12_31_424971	815	6	fMPV	fmpv	NN
10_1101-2020_12_31_424971	815	7	formation	formation	NN
10_1101-2020_12_31_424971	815	8	assays	assays	RB
10_1101-2020_12_31_424971	815	9	in	in	IN
10_1101-2020_12_31_424971	815	10	which	which	WDT
10_1101-2020_12_31_424971	815	11	1283	1283	CD
10_1101-2020_12_31_424971	815	12	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	815	13	is	be	VBZ
10_1101-2020_12_31_424971	815	14	delivered	deliver	VBN
10_1101-2020_12_31_424971	815	15	to	to	IN
10_1101-2020_12_31_424971	815	16	an	an	DT
10_1101-2020_12_31_424971	815	17	A	A	NNP
10_1101-2020_12_31_424971	815	18	site	site	NN
10_1101-2020_12_31_424971	815	19	programmed	program	VBN
10_1101-2020_12_31_424971	815	20	with	with	IN
10_1101-2020_12_31_424971	815	21	a	a	DT
10_1101-2020_12_31_424971	815	22	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	815	23	codon	codon	NN
10_1101-2020_12_31_424971	815	24	at	at	IN
10_1101-2020_12_31_424971	815	25	the	the	DT
10_1101-2020_12_31_424971	815	26	2nd	2nd	JJ
10_1101-2020_12_31_424971	815	27	position	position	NN
10_1101-2020_12_31_424971	815	28	and	and	CC
10_1101-2020_12_31_424971	815	29	1284	1284	CD
10_1101-2020_12_31_424971	815	30	sequences	sequence	NNS
10_1101-2020_12_31_424971	815	31	of	of	IN
10_1101-2020_12_31_424971	815	32	the	the	DT
10_1101-2020_12_31_424971	815	33	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	815	34	anticodon	anticodon	NN
10_1101-2020_12_31_424971	815	35	loop	loop	NN
10_1101-2020_12_31_424971	815	36	and/or	and/or	CC
10_1101-2020_12_31_424971	815	37	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	815	38	codon	codon	NNP
10_1101-2020_12_31_424971	815	39	are	be	VBP
10_1101-2020_12_31_424971	815	40	varied	varied	JJ
10_1101-2020_12_31_424971	815	41	.	.	.
10_1101-2020_12_31_424971	816	1	Yields	yield	NNS
10_1101-2020_12_31_424971	816	2	of	of	IN
10_1101-2020_12_31_424971	816	3	fMPV	fMPV	NNP
10_1101-2020_12_31_424971	816	4	1285	1285	CD
10_1101-2020_12_31_424971	816	5	formation	formation	NN
10_1101-2020_12_31_424971	816	6	represent	represent	NN
10_1101-2020_12_31_424971	816	7	+1	+1	:
10_1101-2020_12_31_424971	816	8	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	816	9	during	during	IN
10_1101-2020_12_31_424971	816	10	translocation	translocation	NN
10_1101-2020_12_31_424971	816	11	of	of	IN
10_1101-2020_12_31_424971	816	12	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	816	13	from	from	IN
10_1101-2020_12_31_424971	816	14	the	the	DT
10_1101-2020_12_31_424971	816	15	A	A	NNP
10_1101-2020_12_31_424971	816	16	site	site	NN
10_1101-2020_12_31_424971	816	17	to	to	IN
10_1101-2020_12_31_424971	816	18	the	the	DT
10_1101-2020_12_31_424971	816	19	P	p	NN
10_1101-2020_12_31_424971	816	20	site	site	NN
10_1101-2020_12_31_424971	816	21	.	.	.
10_1101-2020_12_31_424971	817	1	1286	1286	CD
10_1101-2020_12_31_424971	817	2	Possible	possible	JJ
10_1101-2020_12_31_424971	817	3	+1-frame	+1-frame	VBZ
10_1101-2020_12_31_424971	817	4	anticodon	anticodon	NN
10_1101-2020_12_31_424971	817	5	-	-	HYPH
10_1101-2020_12_31_424971	817	6	codon	codon	NN
10_1101-2020_12_31_424971	817	7	pairing	pair	VBG
10_1101-2020_12_31_424971	817	8	schemes	scheme	NNS
10_1101-2020_12_31_424971	817	9	of	of	IN
10_1101-2020_12_31_424971	817	10	SufB2	sufb2	NN
10_1101-2020_12_31_424971	817	11	during	during	IN
10_1101-2020_12_31_424971	817	12	translocation	translocation	NN
10_1101-2020_12_31_424971	817	13	:	:	:
10_1101-2020_12_31_424971	817	14	c	c	NN
10_1101-2020_12_31_424971	817	15	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	817	16	1287	1287	CD
10_1101-2020_12_31_424971	817	17	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	817	18	capable	capable	JJ
10_1101-2020_12_31_424971	817	19	of	of	IN
10_1101-2020_12_31_424971	817	20	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	817	21	at	at	IN
10_1101-2020_12_31_424971	817	22	a	a	DT
10_1101-2020_12_31_424971	817	23	CCC	CCC	NNP
10_1101-2020_12_31_424971	817	24	-	-	HYPH
10_1101-2020_12_31_424971	817	25	C	C	NNP
10_1101-2020_12_31_424971	817	26	motif	motif	NN
10_1101-2020_12_31_424971	817	27	via	via	IN
10_1101-2020_12_31_424971	817	28	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	817	29	pairing	pairing	NN
10_1101-2020_12_31_424971	817	30	and/or	and/or	CC
10_1101-2020_12_31_424971	817	31	triplet	triplet	NN
10_1101-2020_12_31_424971	817	32	slippage	slippage	NN
10_1101-2020_12_31_424971	817	33	,	,	,
10_1101-2020_12_31_424971	817	34	d	d	NNP
10_1101-2020_12_31_424971	817	35	1288	1288	CD
10_1101-2020_12_31_424971	817	36	G37C	G37C	NNP
10_1101-2020_12_31_424971	817	37	variant	variant	NN
10_1101-2020_12_31_424971	817	38	of	of	IN
10_1101-2020_12_31_424971	817	39	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	817	40	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	817	41	capable	capable	JJ
10_1101-2020_12_31_424971	817	42	of	of	IN
10_1101-2020_12_31_424971	817	43	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	817	44	at	at	IN
10_1101-2020_12_31_424971	817	45	a	a	DT
10_1101-2020_12_31_424971	817	46	GCC	GCC	NNP
10_1101-2020_12_31_424971	817	47	-	-	HYPH
10_1101-2020_12_31_424971	817	48	C	c	NN
10_1101-2020_12_31_424971	817	49	motif	motif	NN
10_1101-2020_12_31_424971	817	50	via	via	IN
10_1101-2020_12_31_424971	817	51	quadruplet	quadruplet	NN
10_1101-2020_12_31_424971	817	52	pairing	pair	VBG
10_1101-2020_12_31_424971	817	53	1289	1289	CD
10_1101-2020_12_31_424971	817	54	and/or	and/or	CC
10_1101-2020_12_31_424971	817	55	triplet	triplet	NN
10_1101-2020_12_31_424971	817	56	slippage	slippage	NN
10_1101-2020_12_31_424971	817	57	,	,	,
10_1101-2020_12_31_424971	817	58	e	e	LS
10_1101-2020_12_31_424971	817	59	m1G37-state	m1G37-state	NNP
10_1101-2020_12_31_424971	817	60	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	817	61	capable	capable	JJ
10_1101-2020_12_31_424971	817	62	of	of	IN
10_1101-2020_12_31_424971	817	63	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	817	64	at	at	IN
10_1101-2020_12_31_424971	817	65	a	a	DT
10_1101-2020_12_31_424971	817	66	CCC	CCC	NNP
10_1101-2020_12_31_424971	817	67	-	-	HYPH
10_1101-2020_12_31_424971	817	68	C	C	NNP
10_1101-2020_12_31_424971	817	69	motif	motif	NN
10_1101-2020_12_31_424971	817	70	via	via	IN
10_1101-2020_12_31_424971	817	71	only	only	RB
10_1101-2020_12_31_424971	817	72	1290	1290	CD
10_1101-2020_12_31_424971	817	73	triplet	triplet	NN
10_1101-2020_12_31_424971	817	74	slippage	slippage	NN
10_1101-2020_12_31_424971	817	75	,	,	,
10_1101-2020_12_31_424971	817	76	and	and	CC
10_1101-2020_12_31_424971	817	77	f	f	NNP
10_1101-2020_12_31_424971	817	78	G37C	G37C	NNP
10_1101-2020_12_31_424971	817	79	variant	variant	NN
10_1101-2020_12_31_424971	817	80	of	of	IN
10_1101-2020_12_31_424971	817	81	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	817	82	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	817	83	capable	capable	JJ
10_1101-2020_12_31_424971	817	84	of	of	IN
10_1101-2020_12_31_424971	817	85	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	817	86	at	at	IN
10_1101-2020_12_31_424971	817	87	a	a	DT
10_1101-2020_12_31_424971	817	88	CCC	CCC	NNP
10_1101-2020_12_31_424971	817	89	-	-	HYPH
10_1101-2020_12_31_424971	817	90	C	C	NNP
10_1101-2020_12_31_424971	817	91	motif	motif	NN
10_1101-2020_12_31_424971	817	92	1291	1291	CD
10_1101-2020_12_31_424971	817	93	via	via	IN
10_1101-2020_12_31_424971	817	94	only	only	JJ
10_1101-2020_12_31_424971	817	95	triplet	triplet	NN
10_1101-2020_12_31_424971	817	96	slippage	slippage	NN
10_1101-2020_12_31_424971	817	97	.	.	.
10_1101-2020_12_31_424971	818	1	In	in	IN
10_1101-2020_12_31_424971	818	2	panels	panel	NNS
10_1101-2020_12_31_424971	818	3	a	a	XX
10_1101-2020_12_31_424971	818	4	,	,	,
10_1101-2020_12_31_424971	818	5	b	b	NN
10_1101-2020_12_31_424971	818	6	,	,	,
10_1101-2020_12_31_424971	818	7	the	the	DT
10_1101-2020_12_31_424971	818	8	bars	bar	NNS
10_1101-2020_12_31_424971	818	9	in	in	IN
10_1101-2020_12_31_424971	818	10	the	the	DT
10_1101-2020_12_31_424971	818	11	graphs	graph	NNS
10_1101-2020_12_31_424971	818	12	are	be	VBP
10_1101-2020_12_31_424971	818	13	SD	sd	NN
10_1101-2020_12_31_424971	818	14	of	of	IN
10_1101-2020_12_31_424971	818	15	three	three	CD
10_1101-2020_12_31_424971	818	16	(	(	-LRB-
10_1101-2020_12_31_424971	818	17	n	n	NN
10_1101-2020_12_31_424971	818	18	=	=	SYM
10_1101-2020_12_31_424971	818	19	3	3	LS
10_1101-2020_12_31_424971	818	20	)	)	-RRB-
10_1101-2020_12_31_424971	818	21	independent	independent	JJ
10_1101-2020_12_31_424971	818	22	1292	1292	CD
10_1101-2020_12_31_424971	818	23	experiments	experiment	NNS
10_1101-2020_12_31_424971	818	24	,	,	,
10_1101-2020_12_31_424971	818	25	and	and	CC
10_1101-2020_12_31_424971	818	26	the	the	DT
10_1101-2020_12_31_424971	818	27	data	datum	NNS
10_1101-2020_12_31_424971	818	28	are	be	VBP
10_1101-2020_12_31_424971	818	29	presented	present	VBN
10_1101-2020_12_31_424971	818	30	as	as	IN
10_1101-2020_12_31_424971	818	31	mean	mean	JJ
10_1101-2020_12_31_424971	818	32	values	value	NNS
10_1101-2020_12_31_424971	818	33	±	±	CD
10_1101-2020_12_31_424971	818	34	SD	sd	NN
10_1101-2020_12_31_424971	818	35	.	.	.
10_1101-2020_12_31_424971	819	1	∆t	∆t	LS
10_1101-2020_12_31_424971	819	2	:	:	:
10_1101-2020_12_31_424971	819	3	a	a	DT
10_1101-2020_12_31_424971	819	4	time	time	NN
10_1101-2020_12_31_424971	819	5	interval	interval	NN
10_1101-2020_12_31_424971	819	6	.	.	.
10_1101-2020_12_31_424971	820	1	1293	1293	CD
10_1101-2020_12_31_424971	820	2	.CC	.CC	:
10_1101-2020_12_31_424971	820	3	-	-	:
10_1101-2020_12_31_424971	820	4	BY	by	IN
10_1101-2020_12_31_424971	820	5	-	-	HYPH
10_1101-2020_12_31_424971	820	6	NC	NC	NNP
10_1101-2020_12_31_424971	820	7	-	-	HYPH
10_1101-2020_12_31_424971	820	8	ND	ND	NNP
10_1101-2020_12_31_424971	820	9	4.0	4.0	CD
10_1101-2020_12_31_424971	820	10	International	International	NNP
10_1101-2020_12_31_424971	820	11	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	820	12	under	under	IN
10_1101-2020_12_31_424971	820	13	a	a	DT
10_1101-2020_12_31_424971	820	14	(	(	-LRB-
10_1101-2020_12_31_424971	820	15	which	which	WDT
10_1101-2020_12_31_424971	820	16	was	be	VBD
10_1101-2020_12_31_424971	820	17	not	not	RB
10_1101-2020_12_31_424971	820	18	certified	certify	VBN
10_1101-2020_12_31_424971	820	19	by	by	IN
10_1101-2020_12_31_424971	820	20	peer	peer	NN
10_1101-2020_12_31_424971	820	21	review	review	NN
10_1101-2020_12_31_424971	820	22	)	)	-RRB-
10_1101-2020_12_31_424971	820	23	is	be	VBZ
10_1101-2020_12_31_424971	820	24	the	the	DT
10_1101-2020_12_31_424971	820	25	author	author	NN
10_1101-2020_12_31_424971	820	26	/	/	SYM
10_1101-2020_12_31_424971	820	27	funder	funder	NN
10_1101-2020_12_31_424971	820	28	,	,	,
10_1101-2020_12_31_424971	820	29	who	who	WP
10_1101-2020_12_31_424971	820	30	has	have	VBZ
10_1101-2020_12_31_424971	820	31	granted	grant	VBN
10_1101-2020_12_31_424971	820	32	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	820	33	a	a	DT
10_1101-2020_12_31_424971	820	34	license	license	NN
10_1101-2020_12_31_424971	820	35	to	to	TO
10_1101-2020_12_31_424971	820	36	display	display	VB
10_1101-2020_12_31_424971	820	37	the	the	DT
10_1101-2020_12_31_424971	820	38	preprint	preprint	NN
10_1101-2020_12_31_424971	820	39	in	in	IN
10_1101-2020_12_31_424971	820	40	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	820	41	.	.	.
10_1101-2020_12_31_424971	821	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	821	2	is	be	VBZ
10_1101-2020_12_31_424971	821	3	made	make	VBN
10_1101-2020_12_31_424971	821	4	The	the	DT
10_1101-2020_12_31_424971	821	5	copyright	copyright	NN
10_1101-2020_12_31_424971	821	6	holder	holder	NN
10_1101-2020_12_31_424971	821	7	for	for	IN
10_1101-2020_12_31_424971	821	8	this	this	DT
10_1101-2020_12_31_424971	821	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	821	10	version	version	NN
10_1101-2020_12_31_424971	821	11	posted	post	VBD
10_1101-2020_12_31_424971	821	12	January	January	NNP
10_1101-2020_12_31_424971	821	13	2	2	CD
10_1101-2020_12_31_424971	821	14	,	,	,
10_1101-2020_12_31_424971	821	15	2021	2021	CD
10_1101-2020_12_31_424971	821	16	.	.	.
10_1101-2020_12_31_424971	821	17	;	;	:
10_1101-2020_12_31_424971	821	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	821	19	:	:	:
10_1101-2020_12_31_424971	821	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	821	21	preprint	preprint	NN
10_1101-2020_12_31_424971	821	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	821	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	821	24	50	50	CD
10_1101-2020_12_31_424971	821	25	1294	1294	CD
10_1101-2020_12_31_424971	821	26	Figure	Figure	NNP
10_1101-2020_12_31_424971	821	27	5	5	CD
10_1101-2020_12_31_424971	821	28	.	.	.
10_1101-2020_12_31_424971	822	1	SufB2	sufb2	NN
10_1101-2020_12_31_424971	822	2	shifts	shift	NNS
10_1101-2020_12_31_424971	822	3	to	to	IN
10_1101-2020_12_31_424971	822	4	the	the	DT
10_1101-2020_12_31_424971	822	5	+1-frame	+1-frame	NNS
10_1101-2020_12_31_424971	822	6	during	during	IN
10_1101-2020_12_31_424971	822	7	translocation	translocation	NN
10_1101-2020_12_31_424971	822	8	.	.	.
10_1101-2020_12_31_424971	823	1	a	a	DT
10_1101-2020_12_31_424971	823	2	Relative	relative	JJ
10_1101-2020_12_31_424971	823	3	fMPV	fmpv	NN
10_1101-2020_12_31_424971	823	4	and	and	CC
10_1101-2020_12_31_424971	823	5	fMPR	fmpr	JJ
10_1101-2020_12_31_424971	823	6	1295	1295	CD
10_1101-2020_12_31_424971	823	7	formation	formation	NN
10_1101-2020_12_31_424971	823	8	as	as	IN
10_1101-2020_12_31_424971	823	9	a	a	DT
10_1101-2020_12_31_424971	823	10	function	function	NN
10_1101-2020_12_31_424971	823	11	of	of	IN
10_1101-2020_12_31_424971	823	12	time	time	NN
10_1101-2020_12_31_424971	823	13	upon	upon	IN
10_1101-2020_12_31_424971	823	14	rapid	rapid	JJ
10_1101-2020_12_31_424971	823	15	delivery	delivery	NN
10_1101-2020_12_31_424971	823	16	of	of	IN
10_1101-2020_12_31_424971	823	17	EF	EF	NNP
10_1101-2020_12_31_424971	823	18	-	-	HYPH
10_1101-2020_12_31_424971	823	19	G	G	NNP
10_1101-2020_12_31_424971	823	20	and	and	CC
10_1101-2020_12_31_424971	823	21	an	an	DT
10_1101-2020_12_31_424971	823	22	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	823	23	mixture	mixture	NN
10_1101-2020_12_31_424971	823	24	of	of	IN
10_1101-2020_12_31_424971	823	25	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	823	26	1296	1296	CD
10_1101-2020_12_31_424971	823	27	SufB2-	sufb2-	CD
10_1101-2020_12_31_424971	823	28	,	,	,
10_1101-2020_12_31_424971	823	29	tRNAVal-	tRNAVal-	NNP
10_1101-2020_12_31_424971	823	30	,	,	,
10_1101-2020_12_31_424971	823	31	and	and	CC
10_1101-2020_12_31_424971	823	32	tRNAArg	tRNAArg	NNP
10_1101-2020_12_31_424971	823	33	-	-	HYPH
10_1101-2020_12_31_424971	823	34	TCs	TCs	NNP
10_1101-2020_12_31_424971	823	35	to	to	IN
10_1101-2020_12_31_424971	823	36	70S	70S	NNP
10_1101-2020_12_31_424971	823	37	ICs	ic	NNS
10_1101-2020_12_31_424971	823	38	carrying	carry	VBG
10_1101-2020_12_31_424971	823	39	a	a	DT
10_1101-2020_12_31_424971	823	40	CCC	CCC	NNP
10_1101-2020_12_31_424971	823	41	-	-	HYPH
10_1101-2020_12_31_424971	823	42	C	C	NNP
10_1101-2020_12_31_424971	823	43	motif	motif	NN
10_1101-2020_12_31_424971	823	44	in	in	IN
10_1101-2020_12_31_424971	823	45	the	the	DT
10_1101-2020_12_31_424971	823	46	A	A	NNP
10_1101-2020_12_31_424971	823	47	site	site	NN
10_1101-2020_12_31_424971	823	48	.	.	.
10_1101-2020_12_31_424971	824	1	b	b	LS
10_1101-2020_12_31_424971	824	2	Relative	Relative	NNP
10_1101-2020_12_31_424971	824	3	1297	1297	CD
10_1101-2020_12_31_424971	824	4	fMPV	fmpv	NN
10_1101-2020_12_31_424971	824	5	and	and	CC
10_1101-2020_12_31_424971	824	6	fMPR	fmpr	JJ
10_1101-2020_12_31_424971	824	7	formation	formation	NN
10_1101-2020_12_31_424971	824	8	as	as	IN
10_1101-2020_12_31_424971	824	9	a	a	DT
10_1101-2020_12_31_424971	824	10	function	function	NN
10_1101-2020_12_31_424971	824	11	of	of	IN
10_1101-2020_12_31_424971	824	12	time	time	NN
10_1101-2020_12_31_424971	824	13	when	when	WRB
10_1101-2020_12_31_424971	824	14	a	a	DT
10_1101-2020_12_31_424971	824	15	defined	define	VBN
10_1101-2020_12_31_424971	824	16	time	time	NN
10_1101-2020_12_31_424971	824	17	interval	interval	NN
10_1101-2020_12_31_424971	824	18	is	be	VBZ
10_1101-2020_12_31_424971	824	19	introduced	introduce	VBN
10_1101-2020_12_31_424971	824	20	between	between	IN
10_1101-2020_12_31_424971	824	21	1298	1298	CD
10_1101-2020_12_31_424971	824	22	delivery	delivery	NN
10_1101-2020_12_31_424971	824	23	of	of	IN
10_1101-2020_12_31_424971	824	24	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	824	25	SufB2-TC	SufB2-TC	NNP
10_1101-2020_12_31_424971	824	26	and	and	CC
10_1101-2020_12_31_424971	824	27	EF	EF	NNP
10_1101-2020_12_31_424971	824	28	-	-	HYPH
10_1101-2020_12_31_424971	824	29	G	G	NNP
10_1101-2020_12_31_424971	824	30	and	and	CC
10_1101-2020_12_31_424971	824	31	delivery	delivery	NN
10_1101-2020_12_31_424971	824	32	of	of	IN
10_1101-2020_12_31_424971	824	33	an	an	DT
10_1101-2020_12_31_424971	824	34	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	824	35	mixture	mixture	NN
10_1101-2020_12_31_424971	824	36	of	of	IN
10_1101-2020_12_31_424971	824	37	tRNAArg-	trnaarg-	NN
10_1101-2020_12_31_424971	824	38	and	and	CC
10_1101-2020_12_31_424971	824	39	1299	1299	CD
10_1101-2020_12_31_424971	824	40	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	824	41	-	-	HYPH
10_1101-2020_12_31_424971	824	42	TCs	TCs	NNP
10_1101-2020_12_31_424971	824	43	.	.	.
10_1101-2020_12_31_424971	825	1	c	c	LS
10_1101-2020_12_31_424971	825	2	Relative	relative	JJ
10_1101-2020_12_31_424971	825	3	fMPV	fmpv	NN
10_1101-2020_12_31_424971	825	4	and	and	CC
10_1101-2020_12_31_424971	825	5	fMPR	fmpr	JJ
10_1101-2020_12_31_424971	825	6	formation	formation	NN
10_1101-2020_12_31_424971	825	7	after	after	IN
10_1101-2020_12_31_424971	825	8	reacting	react	VBG
10_1101-2020_12_31_424971	825	9	fMP	fmp	XX
10_1101-2020_12_31_424971	825	10	-	-	HYPH
10_1101-2020_12_31_424971	825	11	POST	POST	AFX
10_1101-2020_12_31_424971	825	12	complexes	complex	NNS
10_1101-2020_12_31_424971	825	13	with	with	IN
10_1101-2020_12_31_424971	825	14	a	a	DT
10_1101-2020_12_31_424971	825	15	1300	1300	CD
10_1101-2020_12_31_424971	825	16	mixture	mixture	NN
10_1101-2020_12_31_424971	825	17	of	of	IN
10_1101-2020_12_31_424971	825	18	tRNAVal-	tRNAVal-	NNP
10_1101-2020_12_31_424971	825	19	and	and	CC
10_1101-2020_12_31_424971	825	20	tRNAArg	tRNAArg	NNP
10_1101-2020_12_31_424971	825	21	-	-	HYPH
10_1101-2020_12_31_424971	825	22	TCs	TCs	NNP
10_1101-2020_12_31_424971	825	23	based	base	VBN
10_1101-2020_12_31_424971	825	24	on	on	IN
10_1101-2020_12_31_424971	825	25	the	the	DT
10_1101-2020_12_31_424971	825	26	time	time	NN
10_1101-2020_12_31_424971	825	27	courses	course	NNS
10_1101-2020_12_31_424971	825	28	in	in	IN
10_1101-2020_12_31_424971	825	29	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	825	30	Figures	Figures	NNP
10_1101-2020_12_31_424971	825	31	2d	2d	NNP
10_1101-2020_12_31_424971	825	32	-	-	HYPH
10_1101-2020_12_31_424971	825	33	f	f	NN
10_1101-2020_12_31_424971	825	34	.	.	.
10_1101-2020_12_31_424971	825	35	1301	1301	CD
10_1101-2020_12_31_424971	825	36	d	d	NNP
10_1101-2020_12_31_424971	825	37	fMPV	fMPV	NNP
10_1101-2020_12_31_424971	825	38	formation	formation	NN
10_1101-2020_12_31_424971	825	39	as	as	IN
10_1101-2020_12_31_424971	825	40	a	a	DT
10_1101-2020_12_31_424971	825	41	function	function	NN
10_1101-2020_12_31_424971	825	42	of	of	IN
10_1101-2020_12_31_424971	825	43	time	time	NN
10_1101-2020_12_31_424971	825	44	upon	upon	IN
10_1101-2020_12_31_424971	825	45	rapid	rapid	JJ
10_1101-2020_12_31_424971	825	46	delivery	delivery	NN
10_1101-2020_12_31_424971	825	47	of	of	IN
10_1101-2020_12_31_424971	825	48	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	825	49	-	-	HYPH
10_1101-2020_12_31_424971	825	50	TC	TC	NNP
10_1101-2020_12_31_424971	825	51	to	to	IN
10_1101-2020_12_31_424971	825	52	an	an	DT
10_1101-2020_12_31_424971	825	53	fMP	fmp	CD
10_1101-2020_12_31_424971	825	54	-	-	HYPH
10_1101-2020_12_31_424971	825	55	POST	POST	NNP
10_1101-2020_12_31_424971	825	56	1302	1302	CD
10_1101-2020_12_31_424971	825	57	complex	complex	NN
10_1101-2020_12_31_424971	825	58	carrying	carry	VBG
10_1101-2020_12_31_424971	825	59	a	a	DT
10_1101-2020_12_31_424971	825	60	CCC	CCC	NNP
10_1101-2020_12_31_424971	825	61	-	-	HYPH
10_1101-2020_12_31_424971	825	62	N	n	CD
10_1101-2020_12_31_424971	825	63	motif	motif	NN
10_1101-2020_12_31_424971	825	64	in	in	IN
10_1101-2020_12_31_424971	825	65	the	the	DT
10_1101-2020_12_31_424971	825	66	A	A	NNP
10_1101-2020_12_31_424971	825	67	site	site	NN
10_1101-2020_12_31_424971	825	68	.	.	.
10_1101-2020_12_31_424971	826	1	e	e	LS
10_1101-2020_12_31_424971	826	2	Relative	relative	JJ
10_1101-2020_12_31_424971	826	3	fMPV	fmpv	NN
10_1101-2020_12_31_424971	826	4	and	and	CC
10_1101-2020_12_31_424971	826	5	fMPS	fmps	NN
10_1101-2020_12_31_424971	826	6	formation	formation	NN
10_1101-2020_12_31_424971	826	7	as	as	IN
10_1101-2020_12_31_424971	826	8	a	a	DT
10_1101-2020_12_31_424971	826	9	function	function	NN
10_1101-2020_12_31_424971	826	10	1303	1303	CD
10_1101-2020_12_31_424971	826	11	of	of	IN
10_1101-2020_12_31_424971	826	12	time	time	NN
10_1101-2020_12_31_424971	826	13	upon	upon	IN
10_1101-2020_12_31_424971	826	14	rapid	rapid	JJ
10_1101-2020_12_31_424971	826	15	delivery	delivery	NN
10_1101-2020_12_31_424971	826	16	of	of	IN
10_1101-2020_12_31_424971	826	17	an	an	DT
10_1101-2020_12_31_424971	826	18	equimolar	equimolar	JJ
10_1101-2020_12_31_424971	826	19	mixture	mixture	NN
10_1101-2020_12_31_424971	826	20	of	of	IN
10_1101-2020_12_31_424971	826	21	tRNAVal-	tRNAVal-	NNP
10_1101-2020_12_31_424971	826	22	and	and	CC
10_1101-2020_12_31_424971	826	23	tRNASer	tRNASer	NNP
10_1101-2020_12_31_424971	826	24	-	-	HYPH
10_1101-2020_12_31_424971	826	25	TCs	tc	NNS
10_1101-2020_12_31_424971	826	26	to	to	IN
10_1101-2020_12_31_424971	826	27	an	an	DT
10_1101-2020_12_31_424971	826	28	fMP	fMP	NNP
10_1101-2020_12_31_424971	826	29	-	-	HYPH
10_1101-2020_12_31_424971	826	30	POST	POST	NNP
10_1101-2020_12_31_424971	826	31	1304	1304	CD
10_1101-2020_12_31_424971	826	32	complex	complex	NN
10_1101-2020_12_31_424971	826	33	carrying	carry	VBG
10_1101-2020_12_31_424971	826	34	a	a	DT
10_1101-2020_12_31_424971	826	35	CCC	CCC	NNP
10_1101-2020_12_31_424971	826	36	-	-	HYPH
10_1101-2020_12_31_424971	826	37	A	a	DT
10_1101-2020_12_31_424971	826	38	motif	motif	NN
10_1101-2020_12_31_424971	826	39	in	in	IN
10_1101-2020_12_31_424971	826	40	the	the	DT
10_1101-2020_12_31_424971	826	41	A	A	NNP
10_1101-2020_12_31_424971	826	42	site	site	NN
10_1101-2020_12_31_424971	826	43	.	.	.
10_1101-2020_12_31_424971	827	1	In	in	IN
10_1101-2020_12_31_424971	827	2	panels	panel	NNS
10_1101-2020_12_31_424971	827	3	a	a	DT
10_1101-2020_12_31_424971	827	4	-	-	HYPH
10_1101-2020_12_31_424971	827	5	e	e	NN
10_1101-2020_12_31_424971	827	6	,	,	,
10_1101-2020_12_31_424971	827	7	the	the	DT
10_1101-2020_12_31_424971	827	8	bars	bar	NNS
10_1101-2020_12_31_424971	827	9	are	be	VBP
10_1101-2020_12_31_424971	827	10	SD	sd	NN
10_1101-2020_12_31_424971	827	11	of	of	IN
10_1101-2020_12_31_424971	827	12	three	three	CD
10_1101-2020_12_31_424971	827	13	(	(	-LRB-
10_1101-2020_12_31_424971	827	14	n	n	NN
10_1101-2020_12_31_424971	827	15	=	=	SYM
10_1101-2020_12_31_424971	827	16	3	3	CD
10_1101-2020_12_31_424971	827	17	)	)	-RRB-
10_1101-2020_12_31_424971	827	18	1305	1305	CD
10_1101-2020_12_31_424971	827	19	independent	independent	JJ
10_1101-2020_12_31_424971	827	20	experiments	experiment	NNS
10_1101-2020_12_31_424971	827	21	and	and	CC
10_1101-2020_12_31_424971	827	22	the	the	DT
10_1101-2020_12_31_424971	827	23	data	datum	NNS
10_1101-2020_12_31_424971	827	24	are	be	VBP
10_1101-2020_12_31_424971	827	25	presented	present	VBN
10_1101-2020_12_31_424971	827	26	as	as	IN
10_1101-2020_12_31_424971	827	27	mean	mean	JJ
10_1101-2020_12_31_424971	827	28	values	value	NNS
10_1101-2020_12_31_424971	827	29	±	±	CD
10_1101-2020_12_31_424971	827	30	SD	sd	NN
10_1101-2020_12_31_424971	827	31	.	.	.
10_1101-2020_12_31_424971	828	1	Arg	arg	NN
10_1101-2020_12_31_424971	828	2	:	:	:
10_1101-2020_12_31_424971	828	3	arginyl	arginyl	NN
10_1101-2020_12_31_424971	828	4	-	-	:
10_1101-2020_12_31_424971	828	5	tRNAArg	tRNAArg	NNP
10_1101-2020_12_31_424971	828	6	;	;	:
10_1101-2020_12_31_424971	828	7	1306	1306	CD
10_1101-2020_12_31_424971	828	8	Val	Val	NNP
10_1101-2020_12_31_424971	828	9	:	:	:
10_1101-2020_12_31_424971	828	10	valyl	valyl	NN
10_1101-2020_12_31_424971	828	11	-	-	HYPH
10_1101-2020_12_31_424971	828	12	tRNAVal	tRNAVal	NNP
10_1101-2020_12_31_424971	828	13	.	.	.
10_1101-2020_12_31_424971	829	1	1307	1307	CD
10_1101-2020_12_31_424971	829	2	1308	1308	CD
10_1101-2020_12_31_424971	829	3	Figure	Figure	NNP
10_1101-2020_12_31_424971	829	4	6	6	CD
10_1101-2020_12_31_424971	829	5	.	.	.
10_1101-2020_12_31_424971	830	1	SufB2	sufb2	NN
10_1101-2020_12_31_424971	830	2	interferes	interfere	VBZ
10_1101-2020_12_31_424971	830	3	with	with	IN
10_1101-2020_12_31_424971	830	4	elongation	elongation	NN
10_1101-2020_12_31_424971	830	5	complex	complex	JJ
10_1101-2020_12_31_424971	830	6	dynamics	dynamic	NNS
10_1101-2020_12_31_424971	830	7	during	during	IN
10_1101-2020_12_31_424971	830	8	late	late	JJ
10_1101-2020_12_31_424971	830	9	steps	step	NNS
10_1101-2020_12_31_424971	830	10	of	of	IN
10_1101-2020_12_31_424971	830	11	1309	1309	CD
10_1101-2020_12_31_424971	830	12	translocation	translocation	NN
10_1101-2020_12_31_424971	830	13	.	.	.
10_1101-2020_12_31_424971	831	1	a	a	LS
10_1101-2020_12_31_424971	831	2	-	-	HYPH
10_1101-2020_12_31_424971	831	3	c	c	NNP
10_1101-2020_12_31_424971	831	4	Cartoon	Cartoon	NNP
10_1101-2020_12_31_424971	831	5	representation	representation	NN
10_1101-2020_12_31_424971	831	6	of	of	IN
10_1101-2020_12_31_424971	831	7	elongation	elongation	NN
10_1101-2020_12_31_424971	831	8	as	as	IN
10_1101-2020_12_31_424971	831	9	a	a	DT
10_1101-2020_12_31_424971	831	10	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	831	11	SufB2-	sufb2-	NN
10_1101-2020_12_31_424971	831	12	or	or	CC
10_1101-2020_12_31_424971	831	13	ProL	ProL	NNP
10_1101-2020_12_31_424971	831	14	-	-	HYPH
10_1101-2020_12_31_424971	831	15	TC	TC	NNP
10_1101-2020_12_31_424971	831	16	is	be	VBZ
10_1101-2020_12_31_424971	831	17	1310	1310	CD
10_1101-2020_12_31_424971	831	18	delivered	deliver	VBN
10_1101-2020_12_31_424971	831	19	to	to	IN
10_1101-2020_12_31_424971	831	20	the	the	DT
10_1101-2020_12_31_424971	831	21	A	A	NNP
10_1101-2020_12_31_424971	831	22	site	site	NN
10_1101-2020_12_31_424971	831	23	of	of	IN
10_1101-2020_12_31_424971	831	24	a	a	DT
10_1101-2020_12_31_424971	831	25	bL9(Cy3)-	bl9(cy3)-	NN
10_1101-2020_12_31_424971	831	26	and	and	CC
10_1101-2020_12_31_424971	831	27	uL1(Cy5)-labeled	ul1(cy5)-labeled	CD
10_1101-2020_12_31_424971	831	28	70S	70S	NNP
10_1101-2020_12_31_424971	831	29	IC	IC	NNP
10_1101-2020_12_31_424971	831	30	;	;	:
10_1101-2020_12_31_424971	831	31	a	a	NN
10_1101-2020_12_31_424971	831	32	in	in	IN
10_1101-2020_12_31_424971	831	33	the	the	DT
10_1101-2020_12_31_424971	831	34	absence	absence	NN
10_1101-2020_12_31_424971	831	35	,	,	,
10_1101-2020_12_31_424971	831	36	or	or	CC
10_1101-2020_12_31_424971	831	37	b	b	NN
10_1101-2020_12_31_424971	831	38	in	in	IN
10_1101-2020_12_31_424971	831	39	the	the	DT
10_1101-2020_12_31_424971	831	40	1311	1311	CD
10_1101-2020_12_31_424971	831	41	presence	presence	NN
10_1101-2020_12_31_424971	831	42	of	of	IN
10_1101-2020_12_31_424971	831	43	EF	EF	NNP
10_1101-2020_12_31_424971	831	44	-	-	HYPH
10_1101-2020_12_31_424971	831	45	G	G	NNP
10_1101-2020_12_31_424971	831	46	,	,	,
10_1101-2020_12_31_424971	831	47	or	or	CC
10_1101-2020_12_31_424971	831	48	c	c	NN
10_1101-2020_12_31_424971	831	49	upon	upon	IN
10_1101-2020_12_31_424971	831	50	using	use	VBG
10_1101-2020_12_31_424971	831	51	puromycin	puromycin	NNS
10_1101-2020_12_31_424971	831	52	(	(	-LRB-
10_1101-2020_12_31_424971	831	53	Pmn	pmn	NN
10_1101-2020_12_31_424971	831	54	)	)	-RRB-
10_1101-2020_12_31_424971	831	55	to	to	TO
10_1101-2020_12_31_424971	831	56	deacylate	deacylate	VB
10_1101-2020_12_31_424971	831	57	the	the	DT
10_1101-2020_12_31_424971	831	58	P	p	NN
10_1101-2020_12_31_424971	831	59	site	site	NN
10_1101-2020_12_31_424971	831	60	-	-	HYPH
10_1101-2020_12_31_424971	831	61	bound	bind	VBN
10_1101-2020_12_31_424971	831	62	G37-state	G37-state	NNP
10_1101-2020_12_31_424971	831	63	1312	1312	CD
10_1101-2020_12_31_424971	831	64	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	831	65	or	or	CC
10_1101-2020_12_31_424971	831	66	ProL	ProL	NNP
10_1101-2020_12_31_424971	831	67	and	and	CC
10_1101-2020_12_31_424971	831	68	generate	generate	VB
10_1101-2020_12_31_424971	831	69	the	the	DT
10_1101-2020_12_31_424971	831	70	corresponding	correspond	VBG
10_1101-2020_12_31_424971	831	71	PRE	PRE	NNP
10_1101-2020_12_31_424971	831	72	–	–	:
10_1101-2020_12_31_424971	831	73	A	a	DT
10_1101-2020_12_31_424971	831	74	complex	complex	NN
10_1101-2020_12_31_424971	831	75	.	.	.
10_1101-2020_12_31_424971	832	1	The	the	DT
10_1101-2020_12_31_424971	832	2	30S	30S	NNP
10_1101-2020_12_31_424971	832	3	and	and	CC
10_1101-2020_12_31_424971	832	4	50S	50S	NNP
10_1101-2020_12_31_424971	832	5	subunits	subunit	NNS
10_1101-2020_12_31_424971	832	6	are	be	VBP
10_1101-2020_12_31_424971	832	7	1313	1313	CD
10_1101-2020_12_31_424971	832	8	tan	tan	NN
10_1101-2020_12_31_424971	832	9	and	and	CC
10_1101-2020_12_31_424971	832	10	light	light	NN
10_1101-2020_12_31_424971	832	11	blue	blue	NN
10_1101-2020_12_31_424971	832	12	,	,	,
10_1101-2020_12_31_424971	832	13	respectively	respectively	RB
10_1101-2020_12_31_424971	832	14	;	;	:
10_1101-2020_12_31_424971	832	15	the	the	DT
10_1101-2020_12_31_424971	832	16	L1	L1	NNP
10_1101-2020_12_31_424971	832	17	stalk	stalk	NN
10_1101-2020_12_31_424971	832	18	is	be	VBZ
10_1101-2020_12_31_424971	832	19	dark	dark	JJ
10_1101-2020_12_31_424971	832	20	blue	blue	JJ
10_1101-2020_12_31_424971	832	21	;	;	:
10_1101-2020_12_31_424971	832	22	Cy3	cy3	NN
10_1101-2020_12_31_424971	832	23	and	and	CC
10_1101-2020_12_31_424971	832	24	Cy5	cy5	NN
10_1101-2020_12_31_424971	832	25	are	be	VBP
10_1101-2020_12_31_424971	832	26	bright	bright	JJ
10_1101-2020_12_31_424971	832	27	green	green	JJ
10_1101-2020_12_31_424971	832	28	and	and	CC
10_1101-2020_12_31_424971	832	29	red	red	JJ
10_1101-2020_12_31_424971	832	30	1314	1314	CD
10_1101-2020_12_31_424971	832	31	spheres	sphere	NNS
10_1101-2020_12_31_424971	832	32	,	,	,
10_1101-2020_12_31_424971	832	33	respectively	respectively	RB
10_1101-2020_12_31_424971	832	34	;	;	:
10_1101-2020_12_31_424971	832	35	EF	EF	NNP
10_1101-2020_12_31_424971	832	36	-	-	HYPH
10_1101-2020_12_31_424971	832	37	Tu	Tu	NNP
10_1101-2020_12_31_424971	832	38	is	be	VBZ
10_1101-2020_12_31_424971	832	39	pink	pink	JJ
10_1101-2020_12_31_424971	832	40	;	;	:
10_1101-2020_12_31_424971	832	41	EF	EF	NNP
10_1101-2020_12_31_424971	832	42	-	-	HYPH
10_1101-2020_12_31_424971	832	43	G	G	NNP
10_1101-2020_12_31_424971	832	44	is	be	VBZ
10_1101-2020_12_31_424971	832	45	purple	purple	JJ
10_1101-2020_12_31_424971	832	46	;	;	:
10_1101-2020_12_31_424971	832	47	fMet	fMet	NNP
10_1101-2020_12_31_424971	832	48	-	-	HYPH
10_1101-2020_12_31_424971	832	49	tRNAfMet	tRNAfMet	NNP
10_1101-2020_12_31_424971	832	50	is	be	VBZ
10_1101-2020_12_31_424971	832	51	dark	dark	JJ
10_1101-2020_12_31_424971	832	52	green	green	NN
10_1101-2020_12_31_424971	832	53	;	;	:
10_1101-2020_12_31_424971	832	54	and	and	CC
10_1101-2020_12_31_424971	832	55	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	832	56	or	or	CC
10_1101-2020_12_31_424971	832	57	1315	1315	CD
10_1101-2020_12_31_424971	832	58	ProL	ProL	NNP
10_1101-2020_12_31_424971	832	59	is	be	VBZ
10_1101-2020_12_31_424971	832	60	dark	dark	JJ
10_1101-2020_12_31_424971	832	61	red	red	NN
10_1101-2020_12_31_424971	832	62	.	.	.
10_1101-2020_12_31_424971	833	1	d	d	NNP
10_1101-2020_12_31_424971	833	2	,	,	,
10_1101-2020_12_31_424971	833	3	e	e	NNP
10_1101-2020_12_31_424971	833	4	Hypothetical	Hypothetical	NNP
10_1101-2020_12_31_424971	833	5	(	(	-LRB-
10_1101-2020_12_31_424971	833	6	top	top	NNP
10_1101-2020_12_31_424971	833	7	)	)	-RRB-
10_1101-2020_12_31_424971	833	8	and	and	CC
10_1101-2020_12_31_424971	833	9	representative	representative	NN
10_1101-2020_12_31_424971	833	10	experimentally	experimentally	RB
10_1101-2020_12_31_424971	833	11	observed	observe	VBN
10_1101-2020_12_31_424971	833	12	(	(	-LRB-
10_1101-2020_12_31_424971	833	13	bottom	bottom	NN
10_1101-2020_12_31_424971	833	14	)	)	-RRB-
10_1101-2020_12_31_424971	833	15	1316	1316	CD
10_1101-2020_12_31_424971	833	16	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	833	17	vs.	vs.	IN
10_1101-2020_12_31_424971	833	18	time	time	NN
10_1101-2020_12_31_424971	833	19	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	833	20	recorded	record	VBN
10_1101-2020_12_31_424971	833	21	as	as	IN
10_1101-2020_12_31_424971	833	22	ProL	ProL	NNP
10_1101-2020_12_31_424971	833	23	-	-	HYPH
10_1101-2020_12_31_424971	833	24	TC	TC	NNP
10_1101-2020_12_31_424971	833	25	is	be	VBZ
10_1101-2020_12_31_424971	833	26	delivered	deliver	VBN
10_1101-2020_12_31_424971	833	27	to	to	IN
10_1101-2020_12_31_424971	833	28	a	a	DT
10_1101-2020_12_31_424971	833	29	70S	70S	NNP
10_1101-2020_12_31_424971	833	30	IC	IC	NNP
10_1101-2020_12_31_424971	833	31	,	,	,
10_1101-2020_12_31_424971	833	32	d	d	NN
10_1101-2020_12_31_424971	833	33	in	in	IN
10_1101-2020_12_31_424971	833	34	the	the	DT
10_1101-2020_12_31_424971	833	35	absence	absence	NN
10_1101-2020_12_31_424971	833	36	and	and	CC
10_1101-2020_12_31_424971	833	37	e	e	NNP
10_1101-2020_12_31_424971	833	38	1317	1317	CD
10_1101-2020_12_31_424971	833	39	in	in	IN
10_1101-2020_12_31_424971	833	40	the	the	DT
10_1101-2020_12_31_424971	833	41	presence	presence	NN
10_1101-2020_12_31_424971	833	42	of	of	IN
10_1101-2020_12_31_424971	833	43	EF	EF	NNP
10_1101-2020_12_31_424971	833	44	-	-	HYPH
10_1101-2020_12_31_424971	833	45	G	G	NNP
10_1101-2020_12_31_424971	833	46	as	as	IN
10_1101-2020_12_31_424971	833	47	depicted	depict	VBN
10_1101-2020_12_31_424971	833	48	in	in	IN
10_1101-2020_12_31_424971	833	49	a	a	DT
10_1101-2020_12_31_424971	833	50	,	,	,
10_1101-2020_12_31_424971	833	51	b.	b.	NN
10_1101-2020_12_31_424971	834	1	The	the	DT
10_1101-2020_12_31_424971	834	2	waiting	wait	VBG
10_1101-2020_12_31_424971	834	3	times	time	NNS
10_1101-2020_12_31_424971	834	4	associated	associate	VBN
10_1101-2020_12_31_424971	834	5	with	with	IN
10_1101-2020_12_31_424971	834	6	k70S	k70S	NNP
10_1101-2020_12_31_424971	834	7	IC→GS2	IC→GS2	NNP
10_1101-2020_12_31_424971	834	8	,	,	,
10_1101-2020_12_31_424971	834	9	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	834	10	,	,	,
10_1101-2020_12_31_424971	834	11	1318	1318	CD
10_1101-2020_12_31_424971	834	12	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	834	13	,	,	,
10_1101-2020_12_31_424971	834	14	and	and	CC
10_1101-2020_12_31_424971	834	15	kGS2→POST	kGS2→POST	NNP
10_1101-2020_12_31_424971	834	16	are	be	VBP
10_1101-2020_12_31_424971	834	17	indicated	indicate	VBN
10_1101-2020_12_31_424971	834	18	in	in	IN
10_1101-2020_12_31_424971	834	19	each	each	DT
10_1101-2020_12_31_424971	834	20	hypothetical	hypothetical	JJ
10_1101-2020_12_31_424971	834	21	trajectory	trajectory	NN
10_1101-2020_12_31_424971	834	22	.	.	.
10_1101-2020_12_31_424971	835	1	f	f	NNP
10_1101-2020_12_31_424971	835	2	,	,	,
10_1101-2020_12_31_424971	835	3	g	g	NNP
10_1101-2020_12_31_424971	835	4	,	,	,
10_1101-2020_12_31_424971	835	5	and	and	CC
10_1101-2020_12_31_424971	835	6	h	h	NNP
10_1101-2020_12_31_424971	835	7	Surface	Surface	NNP
10_1101-2020_12_31_424971	835	8	contour	contour	NN
10_1101-2020_12_31_424971	835	9	1319	1319	CD
10_1101-2020_12_31_424971	835	10	.CC	.CC	,
10_1101-2020_12_31_424971	835	11	-	-	:
10_1101-2020_12_31_424971	835	12	BY	by	IN
10_1101-2020_12_31_424971	835	13	-	-	HYPH
10_1101-2020_12_31_424971	835	14	NC	NC	NNP
10_1101-2020_12_31_424971	835	15	-	-	HYPH
10_1101-2020_12_31_424971	835	16	ND	ND	NNP
10_1101-2020_12_31_424971	835	17	4.0	4.0	CD
10_1101-2020_12_31_424971	835	18	International	International	NNP
10_1101-2020_12_31_424971	835	19	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	835	20	under	under	IN
10_1101-2020_12_31_424971	835	21	a	a	DT
10_1101-2020_12_31_424971	835	22	(	(	-LRB-
10_1101-2020_12_31_424971	835	23	which	which	WDT
10_1101-2020_12_31_424971	835	24	was	be	VBD
10_1101-2020_12_31_424971	835	25	not	not	RB
10_1101-2020_12_31_424971	835	26	certified	certify	VBN
10_1101-2020_12_31_424971	835	27	by	by	IN
10_1101-2020_12_31_424971	835	28	peer	peer	NN
10_1101-2020_12_31_424971	835	29	review	review	NN
10_1101-2020_12_31_424971	835	30	)	)	-RRB-
10_1101-2020_12_31_424971	835	31	is	be	VBZ
10_1101-2020_12_31_424971	835	32	the	the	DT
10_1101-2020_12_31_424971	835	33	author	author	NN
10_1101-2020_12_31_424971	835	34	/	/	SYM
10_1101-2020_12_31_424971	835	35	funder	funder	NN
10_1101-2020_12_31_424971	835	36	,	,	,
10_1101-2020_12_31_424971	835	37	who	who	WP
10_1101-2020_12_31_424971	835	38	has	have	VBZ
10_1101-2020_12_31_424971	835	39	granted	grant	VBN
10_1101-2020_12_31_424971	835	40	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	835	41	a	a	DT
10_1101-2020_12_31_424971	835	42	license	license	NN
10_1101-2020_12_31_424971	835	43	to	to	TO
10_1101-2020_12_31_424971	835	44	display	display	VB
10_1101-2020_12_31_424971	835	45	the	the	DT
10_1101-2020_12_31_424971	835	46	preprint	preprint	NN
10_1101-2020_12_31_424971	835	47	in	in	IN
10_1101-2020_12_31_424971	835	48	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	835	49	.	.	.
10_1101-2020_12_31_424971	836	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	836	2	is	be	VBZ
10_1101-2020_12_31_424971	836	3	made	make	VBN
10_1101-2020_12_31_424971	836	4	The	the	DT
10_1101-2020_12_31_424971	836	5	copyright	copyright	NN
10_1101-2020_12_31_424971	836	6	holder	holder	NN
10_1101-2020_12_31_424971	836	7	for	for	IN
10_1101-2020_12_31_424971	836	8	this	this	DT
10_1101-2020_12_31_424971	836	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	836	10	version	version	NN
10_1101-2020_12_31_424971	836	11	posted	post	VBD
10_1101-2020_12_31_424971	836	12	January	January	NNP
10_1101-2020_12_31_424971	836	13	2	2	CD
10_1101-2020_12_31_424971	836	14	,	,	,
10_1101-2020_12_31_424971	836	15	2021	2021	CD
10_1101-2020_12_31_424971	836	16	.	.	.
10_1101-2020_12_31_424971	836	17	;	;	:
10_1101-2020_12_31_424971	836	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	836	19	:	:	:
10_1101-2020_12_31_424971	836	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	836	21	preprint	preprint	NN
10_1101-2020_12_31_424971	836	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NN
10_1101-2020_12_31_424971	836	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	836	24	51	51	CD
10_1101-2020_12_31_424971	836	25	plots	plot	NNS
10_1101-2020_12_31_424971	836	26	of	of	IN
10_1101-2020_12_31_424971	836	27	the	the	DT
10_1101-2020_12_31_424971	836	28	time	time	NN
10_1101-2020_12_31_424971	836	29	evolution	evolution	NN
10_1101-2020_12_31_424971	836	30	of	of	IN
10_1101-2020_12_31_424971	836	31	population	population	NN
10_1101-2020_12_31_424971	836	32	FRET	FRET	NNS
10_1101-2020_12_31_424971	836	33	obtained	obtain	VBN
10_1101-2020_12_31_424971	836	34	by	by	IN
10_1101-2020_12_31_424971	836	35	superimposing	superimpose	VBG
10_1101-2020_12_31_424971	836	36	individual	individual	JJ
10_1101-2020_12_31_424971	836	37	EFRET	EFRET	NNP
10_1101-2020_12_31_424971	836	38	vs.	vs.	IN
10_1101-2020_12_31_424971	836	39	time	time	NN
10_1101-2020_12_31_424971	836	40	1320	1320	CD
10_1101-2020_12_31_424971	836	41	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	836	42	in	in	IN
10_1101-2020_12_31_424971	836	43	the	the	DT
10_1101-2020_12_31_424971	836	44	experiments	experiment	NNS
10_1101-2020_12_31_424971	836	45	in	in	IN
10_1101-2020_12_31_424971	836	46	a	a	DT
10_1101-2020_12_31_424971	836	47	,	,	,
10_1101-2020_12_31_424971	836	48	b	b	NN
10_1101-2020_12_31_424971	836	49	,	,	,
10_1101-2020_12_31_424971	836	50	and	and	CC
10_1101-2020_12_31_424971	836	51	c	c	NN
10_1101-2020_12_31_424971	836	52	,	,	,
10_1101-2020_12_31_424971	836	53	respectively	respectively	RB
10_1101-2020_12_31_424971	836	54	,	,	,
10_1101-2020_12_31_424971	836	55	for	for	IN
10_1101-2020_12_31_424971	836	56	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	836	57	(	(	-LRB-
10_1101-2020_12_31_424971	836	58	top	top	NN
10_1101-2020_12_31_424971	836	59	)	)	-RRB-
10_1101-2020_12_31_424971	836	60	and	and	CC
10_1101-2020_12_31_424971	836	61	ProL	ProL	NNP
10_1101-2020_12_31_424971	836	62	(	(	-LRB-
10_1101-2020_12_31_424971	836	63	bottom	bottom	NN
10_1101-2020_12_31_424971	836	64	)	)	-RRB-
10_1101-2020_12_31_424971	836	65	.	.	.
10_1101-2020_12_31_424971	837	1	N	n	CD
10_1101-2020_12_31_424971	837	2	:	:	:
10_1101-2020_12_31_424971	837	3	1321	1321	CD
10_1101-2020_12_31_424971	837	4	the	the	DT
10_1101-2020_12_31_424971	837	5	number	number	NN
10_1101-2020_12_31_424971	837	6	of	of	IN
10_1101-2020_12_31_424971	837	7	trajectories	trajectory	NNS
10_1101-2020_12_31_424971	837	8	used	use	VBN
10_1101-2020_12_31_424971	837	9	to	to	TO
10_1101-2020_12_31_424971	837	10	construct	construct	VB
10_1101-2020_12_31_424971	837	11	each	each	DT
10_1101-2020_12_31_424971	837	12	contour	contour	NN
10_1101-2020_12_31_424971	837	13	plot	plot	NN
10_1101-2020_12_31_424971	837	14	.	.	.
10_1101-2020_12_31_424971	838	1	Surface	surface	NN
10_1101-2020_12_31_424971	838	2	contours	contour	NNS
10_1101-2020_12_31_424971	838	3	are	be	VBP
10_1101-2020_12_31_424971	838	4	colored	color	VBN
10_1101-2020_12_31_424971	838	5	as	as	IN
10_1101-2020_12_31_424971	838	6	1322	1322	CD
10_1101-2020_12_31_424971	838	7	denoted	denote	VBN
10_1101-2020_12_31_424971	838	8	in	in	IN
10_1101-2020_12_31_424971	838	9	the	the	DT
10_1101-2020_12_31_424971	838	10	population	population	NN
10_1101-2020_12_31_424971	838	11	color	color	NN
10_1101-2020_12_31_424971	838	12	bars	bar	NNS
10_1101-2020_12_31_424971	838	13	.	.	.
10_1101-2020_12_31_424971	839	1	For	for	IN
10_1101-2020_12_31_424971	839	2	pre	pre	JJ
10_1101-2020_12_31_424971	839	3	-	-	JJ
10_1101-2020_12_31_424971	839	4	steady	steady	JJ
10_1101-2020_12_31_424971	839	5	-	-	HYPH
10_1101-2020_12_31_424971	839	6	state	state	NN
10_1101-2020_12_31_424971	839	7	experiments	experiment	NNS
10_1101-2020_12_31_424971	839	8	,	,	,
10_1101-2020_12_31_424971	839	9	the	the	DT
10_1101-2020_12_31_424971	839	10	black	black	JJ
10_1101-2020_12_31_424971	839	11	dashed	dash	VBN
10_1101-2020_12_31_424971	839	12	lines	line	NNS
10_1101-2020_12_31_424971	839	13	1323	1323	CD
10_1101-2020_12_31_424971	839	14	indicate	indicate	VBP
10_1101-2020_12_31_424971	839	15	the	the	DT
10_1101-2020_12_31_424971	839	16	time	time	NN
10_1101-2020_12_31_424971	839	17	at	at	IN
10_1101-2020_12_31_424971	839	18	which	which	WDT
10_1101-2020_12_31_424971	839	19	the	the	DT
10_1101-2020_12_31_424971	839	20	TC	TC	NNP
10_1101-2020_12_31_424971	839	21	was	be	VBD
10_1101-2020_12_31_424971	839	22	delivered	deliver	VBN
10_1101-2020_12_31_424971	839	23	and	and	CC
10_1101-2020_12_31_424971	839	24	the	the	DT
10_1101-2020_12_31_424971	839	25	gray	gray	JJ
10_1101-2020_12_31_424971	839	26	shaded	shaded	JJ
10_1101-2020_12_31_424971	839	27	areas	area	NNS
10_1101-2020_12_31_424971	839	28	denote	denote	VBP
10_1101-2020_12_31_424971	839	29	the	the	DT
10_1101-2020_12_31_424971	839	30	time	time	NN
10_1101-2020_12_31_424971	839	31	1324	1324	CD
10_1101-2020_12_31_424971	839	32	required	require	VBN
10_1101-2020_12_31_424971	839	33	for	for	IN
10_1101-2020_12_31_424971	839	34	the	the	DT
10_1101-2020_12_31_424971	839	35	majority	majority	NN
10_1101-2020_12_31_424971	839	36	(	(	-LRB-
10_1101-2020_12_31_424971	839	37	54	54	CD
10_1101-2020_12_31_424971	839	38	-	-	SYM
10_1101-2020_12_31_424971	839	39	68	68	CD
10_1101-2020_12_31_424971	839	40	%	%	NN
10_1101-2020_12_31_424971	839	41	)	)	-RRB-
10_1101-2020_12_31_424971	839	42	of	of	IN
10_1101-2020_12_31_424971	839	43	the	the	DT
10_1101-2020_12_31_424971	839	44	70S	70S	NNP
10_1101-2020_12_31_424971	839	45	ICs	ic	NNS
10_1101-2020_12_31_424971	839	46	to	to	TO
10_1101-2020_12_31_424971	839	47	transition	transition	NN
10_1101-2020_12_31_424971	839	48	to	to	IN
10_1101-2020_12_31_424971	839	49	GS2	GS2	NNP
10_1101-2020_12_31_424971	839	50	.	.	.
10_1101-2020_12_31_424971	840	1	Note	note	VB
10_1101-2020_12_31_424971	840	2	that	that	IN
10_1101-2020_12_31_424971	840	3	the	the	DT
10_1101-2020_12_31_424971	840	4	rate	rate	NN
10_1101-2020_12_31_424971	840	5	of	of	IN
10_1101-2020_12_31_424971	840	6	1325	1325	CD
10_1101-2020_12_31_424971	840	7	deacylated	deacylated	JJ
10_1101-2020_12_31_424971	840	8	SufB2	sufb2	JJ
10_1101-2020_12_31_424971	840	9	dissociation	dissociation	NN
10_1101-2020_12_31_424971	840	10	from	from	IN
10_1101-2020_12_31_424971	840	11	the	the	DT
10_1101-2020_12_31_424971	840	12	A	A	NNP
10_1101-2020_12_31_424971	840	13	site	site	NN
10_1101-2020_12_31_424971	840	14	under	under	IN
10_1101-2020_12_31_424971	840	15	our	-PRON-	PRP$
10_1101-2020_12_31_424971	840	16	conditions	condition	NNS
10_1101-2020_12_31_424971	840	17	is	be	VBZ
10_1101-2020_12_31_424971	840	18	similar	similar	JJ
10_1101-2020_12_31_424971	840	19	to	to	IN
10_1101-2020_12_31_424971	840	20	that	that	DT
10_1101-2020_12_31_424971	840	21	of	of	IN
10_1101-2020_12_31_424971	840	22	EF	EF	NNP
10_1101-2020_12_31_424971	840	23	-	-	HYPH
10_1101-2020_12_31_424971	840	24	G-1326	G-1326	NNP
10_1101-2020_12_31_424971	840	25	catalyzed	catalyzed	JJ
10_1101-2020_12_31_424971	840	26	translocation	translocation	NN
10_1101-2020_12_31_424971	840	27	,	,	,
10_1101-2020_12_31_424971	840	28	thereby	thereby	RB
10_1101-2020_12_31_424971	840	29	resulting	result	VBG
10_1101-2020_12_31_424971	840	30	in	in	IN
10_1101-2020_12_31_424971	840	31	the	the	DT
10_1101-2020_12_31_424971	840	32	buildup	buildup	NN
10_1101-2020_12_31_424971	840	33	of	of	IN
10_1101-2020_12_31_424971	840	34	a	a	DT
10_1101-2020_12_31_424971	840	35	PRE	PRE	NNP
10_1101-2020_12_31_424971	840	36	complex	complex	JJ
10_1101-2020_12_31_424971	840	37	sub	sub	NN
10_1101-2020_12_31_424971	840	38	-	-	NN
10_1101-2020_12_31_424971	840	39	population	population	NN
10_1101-2020_12_31_424971	840	40	over	over	IN
10_1101-2020_12_31_424971	840	41	3	3	CD
10_1101-2020_12_31_424971	840	42	-	-	SYM
10_1101-2020_12_31_424971	840	43	1327	1327	CD
10_1101-2020_12_31_424971	840	44	20	20	CD
10_1101-2020_12_31_424971	840	45	min	min	NN
10_1101-2020_12_31_424971	840	46	post	post	JJ
10_1101-2020_12_31_424971	840	47	-	-	JJ
10_1101-2020_12_31_424971	840	48	delivery	delivery	NN
10_1101-2020_12_31_424971	840	49	that	that	WDT
10_1101-2020_12_31_424971	840	50	lacks	lack	VBZ
10_1101-2020_12_31_424971	840	51	an	an	DT
10_1101-2020_12_31_424971	840	52	A	a	NN
10_1101-2020_12_31_424971	840	53	site	site	NN
10_1101-2020_12_31_424971	840	54	tRNA	trna	NN
10_1101-2020_12_31_424971	840	55	and	and	CC
10_1101-2020_12_31_424971	840	56	is	be	VBZ
10_1101-2020_12_31_424971	840	57	incapable	incapable	JJ
10_1101-2020_12_31_424971	840	58	of	of	IN
10_1101-2020_12_31_424971	840	59	translocation	translocation	NN
10_1101-2020_12_31_424971	840	60	.	.	.
10_1101-2020_12_31_424971	841	1	This	this	DT
10_1101-2020_12_31_424971	841	2	sub-1328	sub-1328	JJ
10_1101-2020_12_31_424971	841	3	population	population	NN
10_1101-2020_12_31_424971	841	4	exhibits	exhibit	VBZ
10_1101-2020_12_31_424971	841	5	kGS1→GS2	kgs1→gs2	CD
10_1101-2020_12_31_424971	841	6	,	,	,
10_1101-2020_12_31_424971	841	7	kGS2→GS1	kgs2→gs1	CD
10_1101-2020_12_31_424971	841	8	,	,	,
10_1101-2020_12_31_424971	841	9	and	and	CC
10_1101-2020_12_31_424971	841	10	Keq	Keq	NNP
10_1101-2020_12_31_424971	841	11	values	value	NNS
10_1101-2020_12_31_424971	841	12	similar	similar	JJ
10_1101-2020_12_31_424971	841	13	to	to	IN
10_1101-2020_12_31_424971	841	14	those	those	DT
10_1101-2020_12_31_424971	841	15	observed	observe	VBN
10_1101-2020_12_31_424971	841	16	in	in	IN
10_1101-2020_12_31_424971	841	17	experiments	experiment	NNS
10_1101-2020_12_31_424971	841	18	1329	1329	CD
10_1101-2020_12_31_424971	841	19	recorded	record	VBN
10_1101-2020_12_31_424971	841	20	in	in	IN
10_1101-2020_12_31_424971	841	21	the	the	DT
10_1101-2020_12_31_424971	841	22	absence	absence	NN
10_1101-2020_12_31_424971	841	23	of	of	IN
10_1101-2020_12_31_424971	841	24	EF	EF	NNP
10_1101-2020_12_31_424971	841	25	-	-	HYPH
10_1101-2020_12_31_424971	841	26	G	G	NNP
10_1101-2020_12_31_424971	841	27	(	(	-LRB-
10_1101-2020_12_31_424971	841	28	Supplementary	Supplementary	NNP
10_1101-2020_12_31_424971	841	29	Table	Table	NNP
10_1101-2020_12_31_424971	841	30	6	6	CD
10_1101-2020_12_31_424971	841	31	)	)	-RRB-
10_1101-2020_12_31_424971	841	32	.	.	.
10_1101-2020_12_31_424971	842	1	1330	1330	CD
10_1101-2020_12_31_424971	842	2	1331	1331	CD
10_1101-2020_12_31_424971	842	3	Figure	Figure	NNP
10_1101-2020_12_31_424971	842	4	7	7	CD
10_1101-2020_12_31_424971	842	5	.	.	.
10_1101-2020_12_31_424971	843	1	Structure	structure	NN
10_1101-2020_12_31_424971	843	2	-	-	HYPH
10_1101-2020_12_31_424971	843	3	based	base	VBN
10_1101-2020_12_31_424971	843	4	mechanistic	mechanistic	JJ
10_1101-2020_12_31_424971	843	5	model	model	NN
10_1101-2020_12_31_424971	843	6	for	for	IN
10_1101-2020_12_31_424971	843	7	SufB2-induced	SufB2-induced	NNP
10_1101-2020_12_31_424971	843	8	+1	+1	NNS
10_1101-2020_12_31_424971	843	9	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	843	10	.	.	.
10_1101-2020_12_31_424971	844	1	A	a	DT
10_1101-2020_12_31_424971	844	2	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	844	3	-	-	HYPH
10_1101-2020_12_31_424971	844	4	1332	1332	CD
10_1101-2020_12_31_424971	844	5	TC	TC	NNP
10_1101-2020_12_31_424971	844	6	uses	use	VBZ
10_1101-2020_12_31_424971	844	7	triplet	triplet	NN
10_1101-2020_12_31_424971	844	8	anticodon	anticodon	NN
10_1101-2020_12_31_424971	844	9	-	-	HYPH
10_1101-2020_12_31_424971	844	10	codon	codon	NNP
10_1101-2020_12_31_424971	844	11	pairing	pair	VBG
10_1101-2020_12_31_424971	844	12	in	in	IN
10_1101-2020_12_31_424971	844	13	the	the	DT
10_1101-2020_12_31_424971	844	14	0-frame	0-frame	CD
10_1101-2020_12_31_424971	844	15	at	at	IN
10_1101-2020_12_31_424971	844	16	a	a	DT
10_1101-2020_12_31_424971	844	17	CCC	CCC	NNP
10_1101-2020_12_31_424971	844	18	-	-	HYPH
10_1101-2020_12_31_424971	844	19	C	C	NNP
10_1101-2020_12_31_424971	844	20	motif	motif	NN
10_1101-2020_12_31_424971	844	21	,	,	,
10_1101-2020_12_31_424971	844	22	undergoes	undergo	VBZ
10_1101-2020_12_31_424971	844	23	peptide	peptide	NN
10_1101-2020_12_31_424971	844	24	-	-	HYPH
10_1101-2020_12_31_424971	844	25	bond	bond	NN
10_1101-2020_12_31_424971	844	26	1333	1333	CD
10_1101-2020_12_31_424971	844	27	formation	formation	NN
10_1101-2020_12_31_424971	844	28	,	,	,
10_1101-2020_12_31_424971	844	29	and	and	CC
10_1101-2020_12_31_424971	844	30	enables	enable	VBZ
10_1101-2020_12_31_424971	844	31	the	the	DT
10_1101-2020_12_31_424971	844	32	resulting	result	VBG
10_1101-2020_12_31_424971	844	33	PRE	PRE	NNP
10_1101-2020_12_31_424971	844	34	complex	complex	JJ
10_1101-2020_12_31_424971	844	35	to	to	TO
10_1101-2020_12_31_424971	844	36	undergo	undergo	VB
10_1101-2020_12_31_424971	844	37	a	a	DT
10_1101-2020_12_31_424971	844	38	GS1→GS2	GS1→GS2	NNP
10_1101-2020_12_31_424971	844	39	transition	transition	NN
10_1101-2020_12_31_424971	844	40	,	,	,
10_1101-2020_12_31_424971	844	41	all	all	DT
10_1101-2020_12_31_424971	844	42	with	with	IN
10_1101-2020_12_31_424971	844	43	1334	1334	CD
10_1101-2020_12_31_424971	844	44	rates	rate	NNS
10_1101-2020_12_31_424971	844	45	similar	similar	JJ
10_1101-2020_12_31_424971	844	46	to	to	IN
10_1101-2020_12_31_424971	844	47	those	those	DT
10_1101-2020_12_31_424971	844	48	of	of	IN
10_1101-2020_12_31_424971	844	49	ProL	ProL	NNP
10_1101-2020_12_31_424971	844	50	-	-	HYPH
10_1101-2020_12_31_424971	844	51	TC	TC	NNP
10_1101-2020_12_31_424971	844	52	.	.	.
10_1101-2020_12_31_424971	845	1	During	during	IN
10_1101-2020_12_31_424971	845	2	the	the	DT
10_1101-2020_12_31_424971	845	3	GS1→GS2	GS1→GS2	NNP
10_1101-2020_12_31_424971	845	4	transition	transition	NN
10_1101-2020_12_31_424971	845	5	,	,	,
10_1101-2020_12_31_424971	845	6	the	the	DT
10_1101-2020_12_31_424971	845	7	30S	30s	CD
10_1101-2020_12_31_424971	845	8	subunit	subunit	NN
10_1101-2020_12_31_424971	845	9	rotates	rotate	VBZ
10_1101-2020_12_31_424971	845	10	1335	1335	CD
10_1101-2020_12_31_424971	845	11	relative	relative	JJ
10_1101-2020_12_31_424971	845	12	to	to	IN
10_1101-2020_12_31_424971	845	13	the	the	DT
10_1101-2020_12_31_424971	845	14	50S	50S	NNP
10_1101-2020_12_31_424971	845	15	subunit	subunit	NN
10_1101-2020_12_31_424971	845	16	by	by	IN
10_1101-2020_12_31_424971	845	17	8º	8º	NNS
10_1101-2020_12_31_424971	845	18	in	in	IN
10_1101-2020_12_31_424971	845	19	the	the	DT
10_1101-2020_12_31_424971	845	20	counter	counter	NN
10_1101-2020_12_31_424971	845	21	-	-	NN
10_1101-2020_12_31_424971	845	22	clockwise	clockwise	NN
10_1101-2020_12_31_424971	845	23	(	(	-LRB-
10_1101-2020_12_31_424971	845	24	+	+	SYM
10_1101-2020_12_31_424971	845	25	)	)	-RRB-
10_1101-2020_12_31_424971	845	26	direction	direction	NN
10_1101-2020_12_31_424971	845	27	along	along	IN
10_1101-2020_12_31_424971	845	28	the	the	DT
10_1101-2020_12_31_424971	845	29	black	black	JJ
10_1101-2020_12_31_424971	845	30	curved	curved	JJ
10_1101-2020_12_31_424971	845	31	1336	1336	CD
10_1101-2020_12_31_424971	845	32	arrow	arrow	NN
10_1101-2020_12_31_424971	845	33	;	;	:
10_1101-2020_12_31_424971	845	34	the	the	DT
10_1101-2020_12_31_424971	845	35	30S	30s	CD
10_1101-2020_12_31_424971	845	36	subunit	subunit	NN
10_1101-2020_12_31_424971	845	37	head	head	NN
10_1101-2020_12_31_424971	845	38	swivels	swivel	VBZ
10_1101-2020_12_31_424971	845	39	relative	relative	JJ
10_1101-2020_12_31_424971	845	40	to	to	IN
10_1101-2020_12_31_424971	845	41	the	the	DT
10_1101-2020_12_31_424971	845	42	30S	30s	CD
10_1101-2020_12_31_424971	845	43	subunit	subunit	NN
10_1101-2020_12_31_424971	845	44	body	body	NN
10_1101-2020_12_31_424971	845	45	by	by	IN
10_1101-2020_12_31_424971	845	46	5º	5º	CD
10_1101-2020_12_31_424971	845	47	in	in	IN
10_1101-2020_12_31_424971	845	48	the	the	DT
10_1101-2020_12_31_424971	845	49	clockwise	clockwise	NN
10_1101-2020_12_31_424971	845	50	(	(	-LRB-
10_1101-2020_12_31_424971	845	51	–	–	:
10_1101-2020_12_31_424971	845	52	)	)	-RRB-
10_1101-2020_12_31_424971	845	53	1337	1337	CD
10_1101-2020_12_31_424971	845	54	direction	direction	NN
10_1101-2020_12_31_424971	845	55	against	against	IN
10_1101-2020_12_31_424971	845	56	the	the	DT
10_1101-2020_12_31_424971	845	57	black	black	JJ
10_1101-2020_12_31_424971	845	58	curved	curved	NNP
10_1101-2020_12_31_424971	845	59	arrow	arrow	NN
10_1101-2020_12_31_424971	845	60	;	;	:
10_1101-2020_12_31_424971	845	61	the	the	DT
10_1101-2020_12_31_424971	845	62	L1	L1	NNP
10_1101-2020_12_31_424971	845	63	stalk	stalk	NN
10_1101-2020_12_31_424971	845	64	closes	close	VBZ
10_1101-2020_12_31_424971	845	65	by	by	IN
10_1101-2020_12_31_424971	845	66	~60	~60	NFP
10_1101-2020_12_31_424971	845	67	Å	å	NN
10_1101-2020_12_31_424971	845	68	;	;	:
10_1101-2020_12_31_424971	845	69	and	and	CC
10_1101-2020_12_31_424971	845	70	the	the	DT
10_1101-2020_12_31_424971	845	71	tRNAs	trnas	CD
10_1101-2020_12_31_424971	845	72	are	be	VBP
10_1101-2020_12_31_424971	845	73	1338	1338	CD
10_1101-2020_12_31_424971	845	74	reconfigured	reconfigure	VBN
10_1101-2020_12_31_424971	845	75	from	from	IN
10_1101-2020_12_31_424971	845	76	their	-PRON-	PRP$
10_1101-2020_12_31_424971	845	77	P	p	NN
10_1101-2020_12_31_424971	845	78	/	/	SYM
10_1101-2020_12_31_424971	845	79	P	p	NN
10_1101-2020_12_31_424971	845	80	and	and	CC
10_1101-2020_12_31_424971	845	81	A	a	NN
10_1101-2020_12_31_424971	845	82	/	/	,
10_1101-2020_12_31_424971	845	83	A	a	NN
10_1101-2020_12_31_424971	845	84	to	to	IN
10_1101-2020_12_31_424971	845	85	their	-PRON-	PRP$
10_1101-2020_12_31_424971	845	86	P	p	NN
10_1101-2020_12_31_424971	845	87	/	/	SYM
10_1101-2020_12_31_424971	845	88	E	e	NN
10_1101-2020_12_31_424971	845	89	and	and	CC
10_1101-2020_12_31_424971	845	90	A	a	NN
10_1101-2020_12_31_424971	845	91	/	/	SYM
10_1101-2020_12_31_424971	845	92	P	p	NN
10_1101-2020_12_31_424971	845	93	configurations	configuration	NNS
10_1101-2020_12_31_424971	845	94	.	.	.
10_1101-2020_12_31_424971	846	1	EF	EF	NNP
10_1101-2020_12_31_424971	846	2	-	-	HYPH
10_1101-2020_12_31_424971	846	3	G	G	NNP
10_1101-2020_12_31_424971	846	4	then	then	RB
10_1101-2020_12_31_424971	846	5	binds	bind	VBZ
10_1101-2020_12_31_424971	846	6	to	to	IN
10_1101-2020_12_31_424971	846	7	the	the	DT
10_1101-2020_12_31_424971	846	8	1339	1339	CD
10_1101-2020_12_31_424971	846	9	PRE	PRE	NNP
10_1101-2020_12_31_424971	846	10	complex	complex	JJ
10_1101-2020_12_31_424971	846	11	to	to	TO
10_1101-2020_12_31_424971	846	12	form	form	VB
10_1101-2020_12_31_424971	846	13	PRE	PRE	NNP
10_1101-2020_12_31_424971	846	14	-	-	HYPH
10_1101-2020_12_31_424971	846	15	G1	G1	NNP
10_1101-2020_12_31_424971	846	16	and	and	CC
10_1101-2020_12_31_424971	846	17	subsequently	subsequently	RB
10_1101-2020_12_31_424971	846	18	catalyzes	catalyze	VBZ
10_1101-2020_12_31_424971	846	19	a	a	DT
10_1101-2020_12_31_424971	846	20	series	series	NN
10_1101-2020_12_31_424971	846	21	of	of	IN
10_1101-2020_12_31_424971	846	22	conformational	conformational	JJ
10_1101-2020_12_31_424971	846	23	1340	1340	CD
10_1101-2020_12_31_424971	846	24	rearrangements	rearrangement	NNS
10_1101-2020_12_31_424971	846	25	of	of	IN
10_1101-2020_12_31_424971	846	26	the	the	DT
10_1101-2020_12_31_424971	846	27	complex	complex	NN
10_1101-2020_12_31_424971	846	28	(	(	-LRB-
10_1101-2020_12_31_424971	846	29	PRE	PRE	NNP
10_1101-2020_12_31_424971	846	30	-	-	HYPH
10_1101-2020_12_31_424971	846	31	G1	G1	NNP
10_1101-2020_12_31_424971	846	32	to	to	IN
10_1101-2020_12_31_424971	846	33	PRE	PRE	NNP
10_1101-2020_12_31_424971	846	34	-	-	HYPH
10_1101-2020_12_31_424971	846	35	G4	G4	NNP
10_1101-2020_12_31_424971	846	36	)	)	-RRB-
10_1101-2020_12_31_424971	846	37	that	that	WDT
10_1101-2020_12_31_424971	846	38	encompass	encompass	VBP
10_1101-2020_12_31_424971	846	39	further	further	JJ
10_1101-2020_12_31_424971	846	40	counter	counter	NN
10_1101-2020_12_31_424971	846	41	-	-	NN
10_1101-2020_12_31_424971	846	42	clockwise	clockwise	JJ
10_1101-2020_12_31_424971	846	43	1341	1341	CD
10_1101-2020_12_31_424971	846	44	and	and	CC
10_1101-2020_12_31_424971	846	45	clockwise	clockwise	NN
10_1101-2020_12_31_424971	846	46	rotations	rotation	NNS
10_1101-2020_12_31_424971	846	47	of	of	IN
10_1101-2020_12_31_424971	846	48	the	the	DT
10_1101-2020_12_31_424971	846	49	subunits	subunit	NNS
10_1101-2020_12_31_424971	846	50	;	;	,
10_1101-2020_12_31_424971	846	51	severing	sever	VBG
10_1101-2020_12_31_424971	846	52	of	of	IN
10_1101-2020_12_31_424971	846	53	decoding	decode	VBG
10_1101-2020_12_31_424971	846	54	center	center	NN
10_1101-2020_12_31_424971	846	55	interactions	interaction	NNS
10_1101-2020_12_31_424971	846	56	with	with	IN
10_1101-2020_12_31_424971	846	57	the	the	DT
10_1101-2020_12_31_424971	846	58	1342	1342	CD
10_1101-2020_12_31_424971	846	59	anticodon	anticodon	NNP
10_1101-2020_12_31_424971	846	60	-	-	HYPH
10_1101-2020_12_31_424971	846	61	codon	codon	NNP
10_1101-2020_12_31_424971	846	62	duplex	duplex	NN
10_1101-2020_12_31_424971	846	63	in	in	IN
10_1101-2020_12_31_424971	846	64	the	the	DT
10_1101-2020_12_31_424971	846	65	A	A	NNP
10_1101-2020_12_31_424971	846	66	site	site	NN
10_1101-2020_12_31_424971	846	67	;	;	:
10_1101-2020_12_31_424971	846	68	counter	counter	NN
10_1101-2020_12_31_424971	846	69	-	-	NN
10_1101-2020_12_31_424971	846	70	clockwise	clockwise	NN
10_1101-2020_12_31_424971	846	71	and	and	CC
10_1101-2020_12_31_424971	846	72	clockwise	clockwise	NN
10_1101-2020_12_31_424971	846	73	swiveling	swiveling	NN
10_1101-2020_12_31_424971	846	74	of	of	IN
10_1101-2020_12_31_424971	846	75	the	the	DT
10_1101-2020_12_31_424971	846	76	head	head	NN
10_1101-2020_12_31_424971	846	77	and	and	CC
10_1101-2020_12_31_424971	846	78	1343	1343	CD
10_1101-2020_12_31_424971	846	79	the	the	DT
10_1101-2020_12_31_424971	846	80	associated	associate	VBN
10_1101-2020_12_31_424971	846	81	opening	opening	NN
10_1101-2020_12_31_424971	846	82	and	and	CC
10_1101-2020_12_31_424971	846	83	closing	closing	NN
10_1101-2020_12_31_424971	846	84	of	of	IN
10_1101-2020_12_31_424971	846	85	the	the	DT
10_1101-2020_12_31_424971	846	86	E	e	NN
10_1101-2020_12_31_424971	846	87	-	-	NN
10_1101-2020_12_31_424971	846	88	site	site	NN
10_1101-2020_12_31_424971	846	89	gate	gate	NN
10_1101-2020_12_31_424971	846	90	;	;	,
10_1101-2020_12_31_424971	846	91	opening	opening	NN
10_1101-2020_12_31_424971	846	92	of	of	IN
10_1101-2020_12_31_424971	846	93	the	the	DT
10_1101-2020_12_31_424971	846	94	L1	L1	NNP
10_1101-2020_12_31_424971	846	95	stalk	stalk	NN
10_1101-2020_12_31_424971	846	96	;	;	:
10_1101-2020_12_31_424971	846	97	and	and	CC
10_1101-2020_12_31_424971	846	98	1344	1344	CD
10_1101-2020_12_31_424971	846	99	.CC	.CC	NFP
10_1101-2020_12_31_424971	846	100	-	-	HYPH
10_1101-2020_12_31_424971	846	101	BY	by	IN
10_1101-2020_12_31_424971	846	102	-	-	HYPH
10_1101-2020_12_31_424971	846	103	NC	NC	NNP
10_1101-2020_12_31_424971	846	104	-	-	HYPH
10_1101-2020_12_31_424971	846	105	ND	ND	NNP
10_1101-2020_12_31_424971	846	106	4.0	4.0	CD
10_1101-2020_12_31_424971	846	107	International	International	NNP
10_1101-2020_12_31_424971	846	108	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	846	109	under	under	IN
10_1101-2020_12_31_424971	846	110	a	a	DT
10_1101-2020_12_31_424971	846	111	(	(	-LRB-
10_1101-2020_12_31_424971	846	112	which	which	WDT
10_1101-2020_12_31_424971	846	113	was	be	VBD
10_1101-2020_12_31_424971	846	114	not	not	RB
10_1101-2020_12_31_424971	846	115	certified	certify	VBN
10_1101-2020_12_31_424971	846	116	by	by	IN
10_1101-2020_12_31_424971	846	117	peer	peer	NN
10_1101-2020_12_31_424971	846	118	review	review	NN
10_1101-2020_12_31_424971	846	119	)	)	-RRB-
10_1101-2020_12_31_424971	846	120	is	be	VBZ
10_1101-2020_12_31_424971	846	121	the	the	DT
10_1101-2020_12_31_424971	846	122	author	author	NN
10_1101-2020_12_31_424971	846	123	/	/	SYM
10_1101-2020_12_31_424971	846	124	funder	funder	NN
10_1101-2020_12_31_424971	846	125	,	,	,
10_1101-2020_12_31_424971	846	126	who	who	WP
10_1101-2020_12_31_424971	846	127	has	have	VBZ
10_1101-2020_12_31_424971	846	128	granted	grant	VBN
10_1101-2020_12_31_424971	846	129	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	846	130	a	a	DT
10_1101-2020_12_31_424971	846	131	license	license	NN
10_1101-2020_12_31_424971	846	132	to	to	TO
10_1101-2020_12_31_424971	846	133	display	display	VB
10_1101-2020_12_31_424971	846	134	the	the	DT
10_1101-2020_12_31_424971	846	135	preprint	preprint	NN
10_1101-2020_12_31_424971	846	136	in	in	IN
10_1101-2020_12_31_424971	846	137	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	846	138	.	.	.
10_1101-2020_12_31_424971	847	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	847	2	is	be	VBZ
10_1101-2020_12_31_424971	847	3	made	make	VBN
10_1101-2020_12_31_424971	847	4	The	the	DT
10_1101-2020_12_31_424971	847	5	copyright	copyright	NN
10_1101-2020_12_31_424971	847	6	holder	holder	NN
10_1101-2020_12_31_424971	847	7	for	for	IN
10_1101-2020_12_31_424971	847	8	this	this	DT
10_1101-2020_12_31_424971	847	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	847	10	version	version	NN
10_1101-2020_12_31_424971	847	11	posted	post	VBD
10_1101-2020_12_31_424971	847	12	January	January	NNP
10_1101-2020_12_31_424971	847	13	2	2	CD
10_1101-2020_12_31_424971	847	14	,	,	,
10_1101-2020_12_31_424971	847	15	2021	2021	CD
10_1101-2020_12_31_424971	847	16	.	.	.
10_1101-2020_12_31_424971	847	17	;	;	:
10_1101-2020_12_31_424971	847	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	847	19	:	:	:
10_1101-2020_12_31_424971	847	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	847	21	preprint	preprint	NN
10_1101-2020_12_31_424971	847	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	NN
10_1101-2020_12_31_424971	847	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	847	24	52	52	CD
10_1101-2020_12_31_424971	847	25	reconfigurations	reconfiguration	NNS
10_1101-2020_12_31_424971	847	26	of	of	IN
10_1101-2020_12_31_424971	847	27	the	the	DT
10_1101-2020_12_31_424971	847	28	tRNAs	trnas	CD
10_1101-2020_12_31_424971	847	29	as	as	IN
10_1101-2020_12_31_424971	847	30	they	-PRON-	PRP
10_1101-2020_12_31_424971	847	31	move	move	VBP
10_1101-2020_12_31_424971	847	32	from	from	IN
10_1101-2020_12_31_424971	847	33	the	the	DT
10_1101-2020_12_31_424971	847	34	P	p	NN
10_1101-2020_12_31_424971	847	35	and	and	CC
10_1101-2020_12_31_424971	847	36	A	a	DT
10_1101-2020_12_31_424971	847	37	sites	site	NNS
10_1101-2020_12_31_424971	847	38	to	to	IN
10_1101-2020_12_31_424971	847	39	the	the	DT
10_1101-2020_12_31_424971	847	40	E	e	NN
10_1101-2020_12_31_424971	847	41	and	and	CC
10_1101-2020_12_31_424971	847	42	P	p	NN
10_1101-2020_12_31_424971	847	43	sites	site	NNS
10_1101-2020_12_31_424971	847	44	.	.	.
10_1101-2020_12_31_424971	848	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	848	2	is	be	VBZ
10_1101-2020_12_31_424971	848	3	during	during	IN
10_1101-2020_12_31_424971	848	4	1345	1345	CD
10_1101-2020_12_31_424971	848	5	these	these	DT
10_1101-2020_12_31_424971	848	6	steps	step	NNS
10_1101-2020_12_31_424971	848	7	,	,	,
10_1101-2020_12_31_424971	848	8	shown	show	VBN
10_1101-2020_12_31_424971	848	9	in	in	IN
10_1101-2020_12_31_424971	848	10	red	red	JJ
10_1101-2020_12_31_424971	848	11	arrows	arrow	NNS
10_1101-2020_12_31_424971	848	12	within	within	IN
10_1101-2020_12_31_424971	848	13	the	the	DT
10_1101-2020_12_31_424971	848	14	gray	gray	JJ
10_1101-2020_12_31_424971	848	15	shaded	shaded	JJ
10_1101-2020_12_31_424971	848	16	box	box	NN
10_1101-2020_12_31_424971	848	17	,	,	,
10_1101-2020_12_31_424971	848	18	that	that	IN
10_1101-2020_12_31_424971	848	19	SufB2	SufB2	NNP
10_1101-2020_12_31_424971	848	20	impedes	impede	NNS
10_1101-2020_12_31_424971	848	21	forward	forward	RB
10_1101-2020_12_31_424971	848	22	and/or	and/or	CC
10_1101-2020_12_31_424971	848	23	1346	1346	CD
10_1101-2020_12_31_424971	848	24	reverse	reverse	JJ
10_1101-2020_12_31_424971	848	25	swiveling	swiveling	NN
10_1101-2020_12_31_424971	848	26	of	of	IN
10_1101-2020_12_31_424971	848	27	the	the	DT
10_1101-2020_12_31_424971	848	28	head	head	NN
10_1101-2020_12_31_424971	848	29	and	and	CC
10_1101-2020_12_31_424971	848	30	the	the	DT
10_1101-2020_12_31_424971	848	31	associated	associate	VBN
10_1101-2020_12_31_424971	848	32	opening	open	VBG
10_1101-2020_12_31_424971	848	33	and/or	and/or	CC
10_1101-2020_12_31_424971	848	34	closing	closing	NN
10_1101-2020_12_31_424971	848	35	of	of	IN
10_1101-2020_12_31_424971	848	36	the	the	DT
10_1101-2020_12_31_424971	848	37	E	e	NN
10_1101-2020_12_31_424971	848	38	-	-	NN
10_1101-2020_12_31_424971	848	39	site	site	NN
10_1101-2020_12_31_424971	848	40	gate	gate	NN
10_1101-2020_12_31_424971	848	41	,	,	,
10_1101-2020_12_31_424971	848	42	1347	1347	CD
10_1101-2020_12_31_424971	848	43	facilitating	facilitate	VBG
10_1101-2020_12_31_424971	848	44	+1	+1	NNS
10_1101-2020_12_31_424971	848	45	frameshifting	frameshifte	VBG
10_1101-2020_12_31_424971	848	46	.	.	.
10_1101-2020_12_31_424971	849	1	Next	next	RB
10_1101-2020_12_31_424971	849	2	,	,	,
10_1101-2020_12_31_424971	849	3	EF	EF	NNP
10_1101-2020_12_31_424971	849	4	-	-	HYPH
10_1101-2020_12_31_424971	849	5	G	G	NNP
10_1101-2020_12_31_424971	849	6	and	and	CC
10_1101-2020_12_31_424971	849	7	the	the	DT
10_1101-2020_12_31_424971	849	8	deacylated	deacylated	JJ
10_1101-2020_12_31_424971	849	9	tRNA	trna	NN
10_1101-2020_12_31_424971	849	10	dissociate	dissociate	NN
10_1101-2020_12_31_424971	849	11	from	from	IN
10_1101-2020_12_31_424971	849	12	PRE	PRE	NNP
10_1101-2020_12_31_424971	849	13	-	-	HYPH
10_1101-2020_12_31_424971	849	14	G4	G4	NNP
10_1101-2020_12_31_424971	849	15	,	,	,
10_1101-2020_12_31_424971	849	16	1348	1348	CD
10_1101-2020_12_31_424971	849	17	leaving	leave	VBG
10_1101-2020_12_31_424971	849	18	a	a	DT
10_1101-2020_12_31_424971	849	19	POST	POST	NNP
10_1101-2020_12_31_424971	849	20	complex	complex	NN
10_1101-2020_12_31_424971	849	21	ready	ready	JJ
10_1101-2020_12_31_424971	849	22	to	to	TO
10_1101-2020_12_31_424971	849	23	enter	enter	VB
10_1101-2020_12_31_424971	849	24	the	the	DT
10_1101-2020_12_31_424971	849	25	next	next	JJ
10_1101-2020_12_31_424971	849	26	elongation	elongation	NN
10_1101-2020_12_31_424971	849	27	cycle	cycle	NN
10_1101-2020_12_31_424971	849	28	.	.	.
10_1101-2020_12_31_424971	850	1	The	the	DT
10_1101-2020_12_31_424971	850	2	cartoons	cartoon	NNS
10_1101-2020_12_31_424971	850	3	depicting	depict	VBG
10_1101-2020_12_31_424971	850	4	PRE-1349	PRE-1349	NNP
10_1101-2020_12_31_424971	850	5	G1(GS1	G1(GS1	NNP
10_1101-2020_12_31_424971	850	6	)	)	-RRB-
10_1101-2020_12_31_424971	850	7	and	and	CC
10_1101-2020_12_31_424971	850	8	PRE	PRE	NNP
10_1101-2020_12_31_424971	850	9	-	-	HYPH
10_1101-2020_12_31_424971	850	10	G1(GS2	G1(GS2	NNP
10_1101-2020_12_31_424971	850	11	)	)	-RRB-
10_1101-2020_12_31_424971	850	12	were	be	VBD
10_1101-2020_12_31_424971	850	13	generated	generate	VBN
10_1101-2020_12_31_424971	850	14	using	use	VBG
10_1101-2020_12_31_424971	850	15	Biological	Biological	NNP
10_1101-2020_12_31_424971	850	16	Assemblies	Assemblies	NNPS
10_1101-2020_12_31_424971	850	17	2	2	CD
10_1101-2020_12_31_424971	850	18	and	and	CC
10_1101-2020_12_31_424971	850	19	1	1	CD
10_1101-2020_12_31_424971	850	20	,	,	,
10_1101-2020_12_31_424971	850	21	respectively	respectively	RB
10_1101-2020_12_31_424971	850	22	,	,	,
10_1101-2020_12_31_424971	850	23	1350	1350	CD
10_1101-2020_12_31_424971	850	24	of	of	IN
10_1101-2020_12_31_424971	850	25	PDB	PDB	NNP
10_1101-2020_12_31_424971	850	26	entry	entry	NN
10_1101-2020_12_31_424971	850	27	4V9D.	4v9d.	CD
10_1101-2020_12_31_424971	851	1	Due	due	IN
10_1101-2020_12_31_424971	851	2	to	to	IN
10_1101-2020_12_31_424971	851	3	the	the	DT
10_1101-2020_12_31_424971	851	4	lack	lack	NN
10_1101-2020_12_31_424971	851	5	of	of	IN
10_1101-2020_12_31_424971	851	6	an	an	DT
10_1101-2020_12_31_424971	851	7	A	A	NNP
10_1101-2020_12_31_424971	851	8	-	-	HYPH
10_1101-2020_12_31_424971	851	9	site	site	NN
10_1101-2020_12_31_424971	851	10	tRNA	trna	NN
10_1101-2020_12_31_424971	851	11	or	or	CC
10_1101-2020_12_31_424971	851	12	EF	EF	NNP
10_1101-2020_12_31_424971	851	13	-	-	HYPH
10_1101-2020_12_31_424971	851	14	G	G	NNP
10_1101-2020_12_31_424971	851	15	in	in	IN
10_1101-2020_12_31_424971	851	16	4V9D	4v9d	CD
10_1101-2020_12_31_424971	851	17	,	,	,
10_1101-2020_12_31_424971	851	18	cartoons	cartoon	NNS
10_1101-2020_12_31_424971	851	19	of	of	IN
10_1101-2020_12_31_424971	851	20	the	the	DT
10_1101-2020_12_31_424971	851	21	A-	a-	XX
10_1101-2020_12_31_424971	851	22	and	and	CC
10_1101-2020_12_31_424971	851	23	1351	1351	CD
10_1101-2020_12_31_424971	851	24	P	p	NN
10_1101-2020_12_31_424971	851	25	-	-	HYPH
10_1101-2020_12_31_424971	851	26	site	site	NN
10_1101-2020_12_31_424971	851	27	tRNAs	trnas	CD
10_1101-2020_12_31_424971	851	28	from	from	IN
10_1101-2020_12_31_424971	851	29	previous	previous	JJ
10_1101-2020_12_31_424971	851	30	structures1	structures1	NN
10_1101-2020_12_31_424971	851	31	were	be	VBD
10_1101-2020_12_31_424971	851	32	positioned	position	VBN
10_1101-2020_12_31_424971	851	33	into	into	IN
10_1101-2020_12_31_424971	851	34	the	the	DT
10_1101-2020_12_31_424971	851	35	two	two	CD
10_1101-2020_12_31_424971	851	36	assemblies	assembly	NNS
10_1101-2020_12_31_424971	851	37	using	use	VBG
10_1101-2020_12_31_424971	851	38	the	the	DT
10_1101-2020_12_31_424971	851	39	P	p	NN
10_1101-2020_12_31_424971	851	40	-	-	HYPH
10_1101-2020_12_31_424971	851	41	site	site	NN
10_1101-2020_12_31_424971	851	42	1352	1352	CD
10_1101-2020_12_31_424971	851	43	tRNAs	trnas	CD
10_1101-2020_12_31_424971	851	44	in	in	IN
10_1101-2020_12_31_424971	851	45	4V9D	4v9d	CD
10_1101-2020_12_31_424971	851	46	as	as	IN
10_1101-2020_12_31_424971	851	47	guides	guide	NNS
10_1101-2020_12_31_424971	851	48	and	and	CC
10_1101-2020_12_31_424971	851	49	a	a	DT
10_1101-2020_12_31_424971	851	50	cartoon	cartoon	NN
10_1101-2020_12_31_424971	851	51	of	of	IN
10_1101-2020_12_31_424971	851	52	EF	EF	NNP
10_1101-2020_12_31_424971	851	53	-	-	HYPH
10_1101-2020_12_31_424971	851	54	G	G	NNP
10_1101-2020_12_31_424971	851	55	generated	generate	VBD
10_1101-2020_12_31_424971	851	56	from	from	IN
10_1101-2020_12_31_424971	851	57	4V7D	4v7d	CD
10_1101-2020_12_31_424971	851	58	was	be	VBD
10_1101-2020_12_31_424971	851	59	manually	manually	RB
10_1101-2020_12_31_424971	851	60	positioned	position	VBN
10_1101-2020_12_31_424971	851	61	1353	1353	CD
10_1101-2020_12_31_424971	851	62	near	near	IN
10_1101-2020_12_31_424971	851	63	the	the	DT
10_1101-2020_12_31_424971	851	64	factor	factor	NN
10_1101-2020_12_31_424971	851	65	binding	bind	VBG
10_1101-2020_12_31_424971	851	66	site	site	NN
10_1101-2020_12_31_424971	851	67	of	of	IN
10_1101-2020_12_31_424971	851	68	the	the	DT
10_1101-2020_12_31_424971	851	69	ribosomes	ribosome	NNS
10_1101-2020_12_31_424971	851	70	.	.	.
10_1101-2020_12_31_424971	852	1	The	the	DT
10_1101-2020_12_31_424971	852	2	cartoons	cartoon	NNS
10_1101-2020_12_31_424971	852	3	depicting	depict	VBG
10_1101-2020_12_31_424971	852	4	PRE	PRE	NNP
10_1101-2020_12_31_424971	852	5	-	-	HYPH
10_1101-2020_12_31_424971	852	6	G2	G2	NNP
10_1101-2020_12_31_424971	852	7	,	,	,
10_1101-2020_12_31_424971	852	8	PRE	PRE	NNP
10_1101-2020_12_31_424971	852	9	-	-	HYPH
10_1101-2020_12_31_424971	852	10	G3	G3	NNP
10_1101-2020_12_31_424971	852	11	,	,	,
10_1101-2020_12_31_424971	852	12	and	and	CC
10_1101-2020_12_31_424971	852	13	PRE-1354	PRE-1354	NNP
10_1101-2020_12_31_424971	852	14	G4	G4	NNP
10_1101-2020_12_31_424971	852	15	were	be	VBD
10_1101-2020_12_31_424971	852	16	generated	generate	VBN
10_1101-2020_12_31_424971	852	17	from	from	IN
10_1101-2020_12_31_424971	852	18	4V7D	4v7d	CD
10_1101-2020_12_31_424971	852	19	,	,	,
10_1101-2020_12_31_424971	852	20	4W29	4w29	CD
10_1101-2020_12_31_424971	852	21	,	,	,
10_1101-2020_12_31_424971	852	22	and	and	CC
10_1101-2020_12_31_424971	852	23	4V5F	4v5f	CD
10_1101-2020_12_31_424971	852	24	,	,	,
10_1101-2020_12_31_424971	852	25	respectively	respectively	RB
10_1101-2020_12_31_424971	852	26	,	,	,
10_1101-2020_12_31_424971	852	27	and	and	CC
10_1101-2020_12_31_424971	852	28	colored	color	VBD
10_1101-2020_12_31_424971	852	29	as	as	IN
10_1101-2020_12_31_424971	852	30	in	in	IN
10_1101-2020_12_31_424971	852	31	Figure	Figure	NNP
10_1101-2020_12_31_424971	852	32	6	6	CD
10_1101-2020_12_31_424971	852	33	,	,	,
10_1101-2020_12_31_424971	852	34	with	with	IN
10_1101-2020_12_31_424971	852	35	1355	1355	CD
10_1101-2020_12_31_424971	852	36	the	the	DT
10_1101-2020_12_31_424971	852	37	head	head	NN
10_1101-2020_12_31_424971	852	38	domain	domain	NN
10_1101-2020_12_31_424971	852	39	shown	show	VBN
10_1101-2020_12_31_424971	852	40	in	in	IN
10_1101-2020_12_31_424971	852	41	orange	orange	NN
10_1101-2020_12_31_424971	852	42	.	.	.
10_1101-2020_12_31_424971	853	1	1356	1356	CD
10_1101-2020_12_31_424971	853	2	1357	1357	CD
10_1101-2020_12_31_424971	853	3	1358	1358	CD
10_1101-2020_12_31_424971	853	4	1359	1359	CD
10_1101-2020_12_31_424971	853	5	.CC	.cc	SYM
10_1101-2020_12_31_424971	853	6	-	-	HYPH
10_1101-2020_12_31_424971	853	7	BY	by	IN
10_1101-2020_12_31_424971	853	8	-	-	HYPH
10_1101-2020_12_31_424971	853	9	NC	NC	NNP
10_1101-2020_12_31_424971	853	10	-	-	HYPH
10_1101-2020_12_31_424971	853	11	ND	ND	NNP
10_1101-2020_12_31_424971	853	12	4.0	4.0	CD
10_1101-2020_12_31_424971	853	13	International	International	NNP
10_1101-2020_12_31_424971	853	14	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	853	15	under	under	IN
10_1101-2020_12_31_424971	853	16	a	a	DT
10_1101-2020_12_31_424971	853	17	(	(	-LRB-
10_1101-2020_12_31_424971	853	18	which	which	WDT
10_1101-2020_12_31_424971	853	19	was	be	VBD
10_1101-2020_12_31_424971	853	20	not	not	RB
10_1101-2020_12_31_424971	853	21	certified	certify	VBN
10_1101-2020_12_31_424971	853	22	by	by	IN
10_1101-2020_12_31_424971	853	23	peer	peer	NN
10_1101-2020_12_31_424971	853	24	review	review	NN
10_1101-2020_12_31_424971	853	25	)	)	-RRB-
10_1101-2020_12_31_424971	853	26	is	be	VBZ
10_1101-2020_12_31_424971	853	27	the	the	DT
10_1101-2020_12_31_424971	853	28	author	author	NN
10_1101-2020_12_31_424971	853	29	/	/	SYM
10_1101-2020_12_31_424971	853	30	funder	funder	NN
10_1101-2020_12_31_424971	853	31	,	,	,
10_1101-2020_12_31_424971	853	32	who	who	WP
10_1101-2020_12_31_424971	853	33	has	have	VBZ
10_1101-2020_12_31_424971	853	34	granted	grant	VBN
10_1101-2020_12_31_424971	853	35	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	853	36	a	a	DT
10_1101-2020_12_31_424971	853	37	license	license	NN
10_1101-2020_12_31_424971	853	38	to	to	TO
10_1101-2020_12_31_424971	853	39	display	display	VB
10_1101-2020_12_31_424971	853	40	the	the	DT
10_1101-2020_12_31_424971	853	41	preprint	preprint	NN
10_1101-2020_12_31_424971	853	42	in	in	IN
10_1101-2020_12_31_424971	853	43	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	853	44	.	.	.
10_1101-2020_12_31_424971	854	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	854	2	is	be	VBZ
10_1101-2020_12_31_424971	854	3	made	make	VBN
10_1101-2020_12_31_424971	854	4	The	the	DT
10_1101-2020_12_31_424971	854	5	copyright	copyright	NN
10_1101-2020_12_31_424971	854	6	holder	holder	NN
10_1101-2020_12_31_424971	854	7	for	for	IN
10_1101-2020_12_31_424971	854	8	this	this	DT
10_1101-2020_12_31_424971	854	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	854	10	version	version	NN
10_1101-2020_12_31_424971	854	11	posted	post	VBD
10_1101-2020_12_31_424971	854	12	January	January	NNP
10_1101-2020_12_31_424971	854	13	2	2	CD
10_1101-2020_12_31_424971	854	14	,	,	,
10_1101-2020_12_31_424971	854	15	2021	2021	CD
10_1101-2020_12_31_424971	854	16	.	.	.
10_1101-2020_12_31_424971	854	17	;	;	:
10_1101-2020_12_31_424971	854	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	854	19	:	:	:
10_1101-2020_12_31_424971	854	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	854	21	preprint	preprint	NN
10_1101-2020_12_31_424971	854	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	854	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	854	24	53	53	CD
10_1101-2020_12_31_424971	854	25	Figure	figure	NN
10_1101-2020_12_31_424971	854	26	1	1	CD
10_1101-2020_12_31_424971	854	27	1360	1360	CD
10_1101-2020_12_31_424971	854	28	1361	1361	CD
10_1101-2020_12_31_424971	854	29	1362	1362	CD
10_1101-2020_12_31_424971	854	30	.CC	.cc	SYM
10_1101-2020_12_31_424971	854	31	-	-	:
10_1101-2020_12_31_424971	854	32	BY	by	IN
10_1101-2020_12_31_424971	854	33	-	-	HYPH
10_1101-2020_12_31_424971	854	34	NC	NC	NNP
10_1101-2020_12_31_424971	854	35	-	-	HYPH
10_1101-2020_12_31_424971	854	36	ND	ND	NNP
10_1101-2020_12_31_424971	854	37	4.0	4.0	CD
10_1101-2020_12_31_424971	854	38	International	International	NNP
10_1101-2020_12_31_424971	854	39	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	854	40	under	under	IN
10_1101-2020_12_31_424971	854	41	a	a	DT
10_1101-2020_12_31_424971	854	42	(	(	-LRB-
10_1101-2020_12_31_424971	854	43	which	which	WDT
10_1101-2020_12_31_424971	854	44	was	be	VBD
10_1101-2020_12_31_424971	854	45	not	not	RB
10_1101-2020_12_31_424971	854	46	certified	certify	VBN
10_1101-2020_12_31_424971	854	47	by	by	IN
10_1101-2020_12_31_424971	854	48	peer	peer	NN
10_1101-2020_12_31_424971	854	49	review	review	NN
10_1101-2020_12_31_424971	854	50	)	)	-RRB-
10_1101-2020_12_31_424971	854	51	is	be	VBZ
10_1101-2020_12_31_424971	854	52	the	the	DT
10_1101-2020_12_31_424971	854	53	author	author	NN
10_1101-2020_12_31_424971	854	54	/	/	SYM
10_1101-2020_12_31_424971	854	55	funder	funder	NN
10_1101-2020_12_31_424971	854	56	,	,	,
10_1101-2020_12_31_424971	854	57	who	who	WP
10_1101-2020_12_31_424971	854	58	has	have	VBZ
10_1101-2020_12_31_424971	854	59	granted	grant	VBN
10_1101-2020_12_31_424971	854	60	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	854	61	a	a	DT
10_1101-2020_12_31_424971	854	62	license	license	NN
10_1101-2020_12_31_424971	854	63	to	to	TO
10_1101-2020_12_31_424971	854	64	display	display	VB
10_1101-2020_12_31_424971	854	65	the	the	DT
10_1101-2020_12_31_424971	854	66	preprint	preprint	NN
10_1101-2020_12_31_424971	854	67	in	in	IN
10_1101-2020_12_31_424971	854	68	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	854	69	.	.	.
10_1101-2020_12_31_424971	855	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	855	2	is	be	VBZ
10_1101-2020_12_31_424971	855	3	made	make	VBN
10_1101-2020_12_31_424971	855	4	The	the	DT
10_1101-2020_12_31_424971	855	5	copyright	copyright	NN
10_1101-2020_12_31_424971	855	6	holder	holder	NN
10_1101-2020_12_31_424971	855	7	for	for	IN
10_1101-2020_12_31_424971	855	8	this	this	DT
10_1101-2020_12_31_424971	855	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	855	10	version	version	NN
10_1101-2020_12_31_424971	855	11	posted	post	VBD
10_1101-2020_12_31_424971	855	12	January	January	NNP
10_1101-2020_12_31_424971	855	13	2	2	CD
10_1101-2020_12_31_424971	855	14	,	,	,
10_1101-2020_12_31_424971	855	15	2021	2021	CD
10_1101-2020_12_31_424971	855	16	.	.	.
10_1101-2020_12_31_424971	855	17	;	;	:
10_1101-2020_12_31_424971	855	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	855	19	:	:	:
10_1101-2020_12_31_424971	855	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	855	21	preprint	preprint	NN
10_1101-2020_12_31_424971	855	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	855	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	855	24	54	54	CD
10_1101-2020_12_31_424971	855	25	Figure	figure	NN
10_1101-2020_12_31_424971	855	26	2	2	CD
10_1101-2020_12_31_424971	855	27	1363	1363	CD
10_1101-2020_12_31_424971	855	28	1364	1364	CD
10_1101-2020_12_31_424971	855	29	1365	1365	CD
10_1101-2020_12_31_424971	855	30	1366	1366	CD
10_1101-2020_12_31_424971	855	31	.CC	.cc	SYM
10_1101-2020_12_31_424971	855	32	-	-	HYPH
10_1101-2020_12_31_424971	855	33	BY	by	IN
10_1101-2020_12_31_424971	855	34	-	-	HYPH
10_1101-2020_12_31_424971	855	35	NC	NC	NNP
10_1101-2020_12_31_424971	855	36	-	-	HYPH
10_1101-2020_12_31_424971	855	37	ND	ND	NNP
10_1101-2020_12_31_424971	855	38	4.0	4.0	CD
10_1101-2020_12_31_424971	855	39	International	International	NNP
10_1101-2020_12_31_424971	855	40	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	855	41	under	under	IN
10_1101-2020_12_31_424971	855	42	a	a	DT
10_1101-2020_12_31_424971	855	43	(	(	-LRB-
10_1101-2020_12_31_424971	855	44	which	which	WDT
10_1101-2020_12_31_424971	855	45	was	be	VBD
10_1101-2020_12_31_424971	855	46	not	not	RB
10_1101-2020_12_31_424971	855	47	certified	certify	VBN
10_1101-2020_12_31_424971	855	48	by	by	IN
10_1101-2020_12_31_424971	855	49	peer	peer	NN
10_1101-2020_12_31_424971	855	50	review	review	NN
10_1101-2020_12_31_424971	855	51	)	)	-RRB-
10_1101-2020_12_31_424971	855	52	is	be	VBZ
10_1101-2020_12_31_424971	855	53	the	the	DT
10_1101-2020_12_31_424971	855	54	author	author	NN
10_1101-2020_12_31_424971	855	55	/	/	SYM
10_1101-2020_12_31_424971	855	56	funder	funder	NN
10_1101-2020_12_31_424971	855	57	,	,	,
10_1101-2020_12_31_424971	855	58	who	who	WP
10_1101-2020_12_31_424971	855	59	has	have	VBZ
10_1101-2020_12_31_424971	855	60	granted	grant	VBN
10_1101-2020_12_31_424971	855	61	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	855	62	a	a	DT
10_1101-2020_12_31_424971	855	63	license	license	NN
10_1101-2020_12_31_424971	855	64	to	to	TO
10_1101-2020_12_31_424971	855	65	display	display	VB
10_1101-2020_12_31_424971	855	66	the	the	DT
10_1101-2020_12_31_424971	855	67	preprint	preprint	NN
10_1101-2020_12_31_424971	855	68	in	in	IN
10_1101-2020_12_31_424971	855	69	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	855	70	.	.	.
10_1101-2020_12_31_424971	856	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	856	2	is	be	VBZ
10_1101-2020_12_31_424971	856	3	made	make	VBN
10_1101-2020_12_31_424971	856	4	The	the	DT
10_1101-2020_12_31_424971	856	5	copyright	copyright	NN
10_1101-2020_12_31_424971	856	6	holder	holder	NN
10_1101-2020_12_31_424971	856	7	for	for	IN
10_1101-2020_12_31_424971	856	8	this	this	DT
10_1101-2020_12_31_424971	856	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	856	10	version	version	NN
10_1101-2020_12_31_424971	856	11	posted	post	VBD
10_1101-2020_12_31_424971	856	12	January	January	NNP
10_1101-2020_12_31_424971	856	13	2	2	CD
10_1101-2020_12_31_424971	856	14	,	,	,
10_1101-2020_12_31_424971	856	15	2021	2021	CD
10_1101-2020_12_31_424971	856	16	.	.	.
10_1101-2020_12_31_424971	856	17	;	;	:
10_1101-2020_12_31_424971	856	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	856	19	:	:	:
10_1101-2020_12_31_424971	856	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	856	21	preprint	preprint	NN
10_1101-2020_12_31_424971	856	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	856	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	856	24	55	55	CD
10_1101-2020_12_31_424971	856	25	Figure	figure	NN
10_1101-2020_12_31_424971	856	26	3	3	CD
10_1101-2020_12_31_424971	856	27	1367	1367	CD
10_1101-2020_12_31_424971	856	28	1368	1368	CD
10_1101-2020_12_31_424971	856	29	1369	1369	CD
10_1101-2020_12_31_424971	856	30	.CC	.cc	SYM
10_1101-2020_12_31_424971	856	31	-	-	:
10_1101-2020_12_31_424971	856	32	BY	by	IN
10_1101-2020_12_31_424971	856	33	-	-	HYPH
10_1101-2020_12_31_424971	856	34	NC	NC	NNP
10_1101-2020_12_31_424971	856	35	-	-	HYPH
10_1101-2020_12_31_424971	856	36	ND	ND	NNP
10_1101-2020_12_31_424971	856	37	4.0	4.0	CD
10_1101-2020_12_31_424971	856	38	International	International	NNP
10_1101-2020_12_31_424971	856	39	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	856	40	under	under	IN
10_1101-2020_12_31_424971	856	41	a	a	DT
10_1101-2020_12_31_424971	856	42	(	(	-LRB-
10_1101-2020_12_31_424971	856	43	which	which	WDT
10_1101-2020_12_31_424971	856	44	was	be	VBD
10_1101-2020_12_31_424971	856	45	not	not	RB
10_1101-2020_12_31_424971	856	46	certified	certify	VBN
10_1101-2020_12_31_424971	856	47	by	by	IN
10_1101-2020_12_31_424971	856	48	peer	peer	NN
10_1101-2020_12_31_424971	856	49	review	review	NN
10_1101-2020_12_31_424971	856	50	)	)	-RRB-
10_1101-2020_12_31_424971	856	51	is	be	VBZ
10_1101-2020_12_31_424971	856	52	the	the	DT
10_1101-2020_12_31_424971	856	53	author	author	NN
10_1101-2020_12_31_424971	856	54	/	/	SYM
10_1101-2020_12_31_424971	856	55	funder	funder	NN
10_1101-2020_12_31_424971	856	56	,	,	,
10_1101-2020_12_31_424971	856	57	who	who	WP
10_1101-2020_12_31_424971	856	58	has	have	VBZ
10_1101-2020_12_31_424971	856	59	granted	grant	VBN
10_1101-2020_12_31_424971	856	60	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	856	61	a	a	DT
10_1101-2020_12_31_424971	856	62	license	license	NN
10_1101-2020_12_31_424971	856	63	to	to	TO
10_1101-2020_12_31_424971	856	64	display	display	VB
10_1101-2020_12_31_424971	856	65	the	the	DT
10_1101-2020_12_31_424971	856	66	preprint	preprint	NN
10_1101-2020_12_31_424971	856	67	in	in	IN
10_1101-2020_12_31_424971	856	68	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	856	69	.	.	.
10_1101-2020_12_31_424971	857	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	857	2	is	be	VBZ
10_1101-2020_12_31_424971	857	3	made	make	VBN
10_1101-2020_12_31_424971	857	4	The	the	DT
10_1101-2020_12_31_424971	857	5	copyright	copyright	NN
10_1101-2020_12_31_424971	857	6	holder	holder	NN
10_1101-2020_12_31_424971	857	7	for	for	IN
10_1101-2020_12_31_424971	857	8	this	this	DT
10_1101-2020_12_31_424971	857	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	857	10	version	version	NN
10_1101-2020_12_31_424971	857	11	posted	post	VBD
10_1101-2020_12_31_424971	857	12	January	January	NNP
10_1101-2020_12_31_424971	857	13	2	2	CD
10_1101-2020_12_31_424971	857	14	,	,	,
10_1101-2020_12_31_424971	857	15	2021	2021	CD
10_1101-2020_12_31_424971	857	16	.	.	.
10_1101-2020_12_31_424971	857	17	;	;	:
10_1101-2020_12_31_424971	857	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	857	19	:	:	:
10_1101-2020_12_31_424971	857	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	857	21	preprint	preprint	NN
10_1101-2020_12_31_424971	857	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	857	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	857	24	56	56	CD
10_1101-2020_12_31_424971	857	25	Figure	figure	NN
10_1101-2020_12_31_424971	857	26	4	4	CD
10_1101-2020_12_31_424971	857	27	1370	1370	CD
10_1101-2020_12_31_424971	857	28	1371	1371	CD
10_1101-2020_12_31_424971	857	29	.CC	.cc	SYM
10_1101-2020_12_31_424971	857	30	-	-	HYPH
10_1101-2020_12_31_424971	857	31	BY	by	IN
10_1101-2020_12_31_424971	857	32	-	-	HYPH
10_1101-2020_12_31_424971	857	33	NC	NC	NNP
10_1101-2020_12_31_424971	857	34	-	-	HYPH
10_1101-2020_12_31_424971	857	35	ND	ND	NNP
10_1101-2020_12_31_424971	857	36	4.0	4.0	CD
10_1101-2020_12_31_424971	857	37	International	International	NNP
10_1101-2020_12_31_424971	857	38	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	857	39	under	under	IN
10_1101-2020_12_31_424971	857	40	a	a	DT
10_1101-2020_12_31_424971	857	41	(	(	-LRB-
10_1101-2020_12_31_424971	857	42	which	which	WDT
10_1101-2020_12_31_424971	857	43	was	be	VBD
10_1101-2020_12_31_424971	857	44	not	not	RB
10_1101-2020_12_31_424971	857	45	certified	certify	VBN
10_1101-2020_12_31_424971	857	46	by	by	IN
10_1101-2020_12_31_424971	857	47	peer	peer	NN
10_1101-2020_12_31_424971	857	48	review	review	NN
10_1101-2020_12_31_424971	857	49	)	)	-RRB-
10_1101-2020_12_31_424971	857	50	is	be	VBZ
10_1101-2020_12_31_424971	857	51	the	the	DT
10_1101-2020_12_31_424971	857	52	author	author	NN
10_1101-2020_12_31_424971	857	53	/	/	SYM
10_1101-2020_12_31_424971	857	54	funder	funder	NN
10_1101-2020_12_31_424971	857	55	,	,	,
10_1101-2020_12_31_424971	857	56	who	who	WP
10_1101-2020_12_31_424971	857	57	has	have	VBZ
10_1101-2020_12_31_424971	857	58	granted	grant	VBN
10_1101-2020_12_31_424971	857	59	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	857	60	a	a	DT
10_1101-2020_12_31_424971	857	61	license	license	NN
10_1101-2020_12_31_424971	857	62	to	to	TO
10_1101-2020_12_31_424971	857	63	display	display	VB
10_1101-2020_12_31_424971	857	64	the	the	DT
10_1101-2020_12_31_424971	857	65	preprint	preprint	NN
10_1101-2020_12_31_424971	857	66	in	in	IN
10_1101-2020_12_31_424971	857	67	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	857	68	.	.	.
10_1101-2020_12_31_424971	858	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	858	2	is	be	VBZ
10_1101-2020_12_31_424971	858	3	made	make	VBN
10_1101-2020_12_31_424971	858	4	The	the	DT
10_1101-2020_12_31_424971	858	5	copyright	copyright	NN
10_1101-2020_12_31_424971	858	6	holder	holder	NN
10_1101-2020_12_31_424971	858	7	for	for	IN
10_1101-2020_12_31_424971	858	8	this	this	DT
10_1101-2020_12_31_424971	858	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	858	10	version	version	NN
10_1101-2020_12_31_424971	858	11	posted	post	VBD
10_1101-2020_12_31_424971	858	12	January	January	NNP
10_1101-2020_12_31_424971	858	13	2	2	CD
10_1101-2020_12_31_424971	858	14	,	,	,
10_1101-2020_12_31_424971	858	15	2021	2021	CD
10_1101-2020_12_31_424971	858	16	.	.	.
10_1101-2020_12_31_424971	858	17	;	;	:
10_1101-2020_12_31_424971	858	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	858	19	:	:	:
10_1101-2020_12_31_424971	858	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	858	21	preprint	preprint	NN
10_1101-2020_12_31_424971	858	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	858	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	858	24	57	57	CD
10_1101-2020_12_31_424971	858	25	Figure	figure	NN
10_1101-2020_12_31_424971	858	26	5	5	CD
10_1101-2020_12_31_424971	858	27	1372	1372	CD
10_1101-2020_12_31_424971	858	28	1373	1373	CD
10_1101-2020_12_31_424971	858	29	1374	1374	CD
10_1101-2020_12_31_424971	858	30	.CC	.CC	NFP
10_1101-2020_12_31_424971	858	31	-	-	:
10_1101-2020_12_31_424971	858	32	BY	by	IN
10_1101-2020_12_31_424971	858	33	-	-	HYPH
10_1101-2020_12_31_424971	858	34	NC	NC	NNP
10_1101-2020_12_31_424971	858	35	-	-	HYPH
10_1101-2020_12_31_424971	858	36	ND	ND	NNP
10_1101-2020_12_31_424971	858	37	4.0	4.0	CD
10_1101-2020_12_31_424971	858	38	International	International	NNP
10_1101-2020_12_31_424971	858	39	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	858	40	under	under	IN
10_1101-2020_12_31_424971	858	41	a	a	DT
10_1101-2020_12_31_424971	858	42	(	(	-LRB-
10_1101-2020_12_31_424971	858	43	which	which	WDT
10_1101-2020_12_31_424971	858	44	was	be	VBD
10_1101-2020_12_31_424971	858	45	not	not	RB
10_1101-2020_12_31_424971	858	46	certified	certify	VBN
10_1101-2020_12_31_424971	858	47	by	by	IN
10_1101-2020_12_31_424971	858	48	peer	peer	NN
10_1101-2020_12_31_424971	858	49	review	review	NN
10_1101-2020_12_31_424971	858	50	)	)	-RRB-
10_1101-2020_12_31_424971	858	51	is	be	VBZ
10_1101-2020_12_31_424971	858	52	the	the	DT
10_1101-2020_12_31_424971	858	53	author	author	NN
10_1101-2020_12_31_424971	858	54	/	/	SYM
10_1101-2020_12_31_424971	858	55	funder	funder	NN
10_1101-2020_12_31_424971	858	56	,	,	,
10_1101-2020_12_31_424971	858	57	who	who	WP
10_1101-2020_12_31_424971	858	58	has	have	VBZ
10_1101-2020_12_31_424971	858	59	granted	grant	VBN
10_1101-2020_12_31_424971	858	60	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	858	61	a	a	DT
10_1101-2020_12_31_424971	858	62	license	license	NN
10_1101-2020_12_31_424971	858	63	to	to	TO
10_1101-2020_12_31_424971	858	64	display	display	VB
10_1101-2020_12_31_424971	858	65	the	the	DT
10_1101-2020_12_31_424971	858	66	preprint	preprint	NN
10_1101-2020_12_31_424971	858	67	in	in	IN
10_1101-2020_12_31_424971	858	68	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	858	69	.	.	.
10_1101-2020_12_31_424971	859	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	859	2	is	be	VBZ
10_1101-2020_12_31_424971	859	3	made	make	VBN
10_1101-2020_12_31_424971	859	4	The	the	DT
10_1101-2020_12_31_424971	859	5	copyright	copyright	NN
10_1101-2020_12_31_424971	859	6	holder	holder	NN
10_1101-2020_12_31_424971	859	7	for	for	IN
10_1101-2020_12_31_424971	859	8	this	this	DT
10_1101-2020_12_31_424971	859	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	859	10	version	version	NN
10_1101-2020_12_31_424971	859	11	posted	post	VBD
10_1101-2020_12_31_424971	859	12	January	January	NNP
10_1101-2020_12_31_424971	859	13	2	2	CD
10_1101-2020_12_31_424971	859	14	,	,	,
10_1101-2020_12_31_424971	859	15	2021	2021	CD
10_1101-2020_12_31_424971	859	16	.	.	.
10_1101-2020_12_31_424971	859	17	;	;	:
10_1101-2020_12_31_424971	859	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	859	19	:	:	:
10_1101-2020_12_31_424971	859	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	859	21	preprint	preprint	NN
10_1101-2020_12_31_424971	859	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	859	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2020_12_31_424971	859	24	58	58	CD
10_1101-2020_12_31_424971	859	25	Figure	figure	NN
10_1101-2020_12_31_424971	859	26	6	6	CD
10_1101-2020_12_31_424971	859	27	1375	1375	CD
10_1101-2020_12_31_424971	859	28	1376	1376	CD
10_1101-2020_12_31_424971	859	29	1377	1377	CD
10_1101-2020_12_31_424971	859	30	P	p	NN
10_1101-2020_12_31_424971	859	31	A	a	DT
10_1101-2020_12_31_424971	859	32	1.00	1.00	CD
10_1101-2020_12_31_424971	859	33	0.50	0.50	CD
10_1101-2020_12_31_424971	859	34	0.00	0.00	CD
10_1101-2020_12_31_424971	859	35	E	e	NN
10_1101-2020_12_31_424971	859	36	F	f	NN
10_1101-2020_12_31_424971	859	37	R	r	NN
10_1101-2020_12_31_424971	859	38	E	e	NN
10_1101-2020_12_31_424971	859	39	T	t	NN
10_1101-2020_12_31_424971	859	40	0	0	CD
10_1101-2020_12_31_424971	859	41	10	10	CD
10_1101-2020_12_31_424971	859	42	20	20	CD
10_1101-2020_12_31_424971	859	43	30	30	CD
10_1101-2020_12_31_424971	859	44	0	0	CD
10_1101-2020_12_31_424971	859	45	10	10	CD
10_1101-2020_12_31_424971	859	46	1	1	CD
10_1101-2020_12_31_424971	859	47	Time	Time	NNP
10_1101-2020_12_31_424971	859	48	(	(	-LRB-
10_1101-2020_12_31_424971	859	49	s	s	NNP
10_1101-2020_12_31_424971	859	50	)	)	-RRB-
10_1101-2020_12_31_424971	859	51	Time	Time	NNP
10_1101-2020_12_31_424971	859	52	(	(	-LRB-
10_1101-2020_12_31_424971	859	53	s	s	NNP
10_1101-2020_12_31_424971	859	54	)	)	-RRB-
10_1101-2020_12_31_424971	859	55	ProL	ProL	NNP
10_1101-2020_12_31_424971	859	56	-	-	HYPH
10_1101-2020_12_31_424971	859	57	TC	TC	NNP
10_1101-2020_12_31_424971	859	58	ProL	ProL	NNP
10_1101-2020_12_31_424971	859	59	-	-	HYPH
10_1101-2020_12_31_424971	859	60	TC	TC	NNP
10_1101-2020_12_31_424971	859	61	+	+	CC
10_1101-2020_12_31_424971	859	62	EF	EF	NNP
10_1101-2020_12_31_424971	859	63	-	-	HYPH
10_1101-2020_12_31_424971	859	64	G	G	NNP
10_1101-2020_12_31_424971	859	65	Deliver	Deliver	NNP
10_1101-2020_12_31_424971	859	66	TCsat	TCsat	NNP
10_1101-2020_12_31_424971	859	67	5	5	CD
10_1101-2020_12_31_424971	859	68	s	s	NN
10_1101-2020_12_31_424971	859	69	Deliver	deliver	VB
10_1101-2020_12_31_424971	859	70	TCs+EF	tcs+ef	NN
10_1101-2020_12_31_424971	859	71	-	-	HYPH
10_1101-2020_12_31_424971	859	72	Gat	Gat	NNP
10_1101-2020_12_31_424971	859	73	5	5	CD
10_1101-2020_12_31_424971	859	74	s	s	NNP
10_1101-2020_12_31_424971	859	75	N=	N=	NNP
10_1101-2020_12_31_424971	859	76	k70S	k70S	NNP
10_1101-2020_12_31_424971	859	77	IC→GS	IC→GS	NNP
10_1101-2020_12_31_424971	859	78	kGS1→GS	kGS1→GS	NNP
10_1101-2020_12_31_424971	859	79	a	a	DT
10_1101-2020_12_31_424971	859	80	kGS	kg	NNS
10_1101-2020_12_31_424971	859	81	→GS1	→gs1	CD
10_1101-2020_12_31_424971	859	82	A	a	NN
10_1101-2020_12_31_424971	859	83	P.	p.	NN
10_1101-2020_12_31_424971	859	84	.	.	.
10_1101-2020_12_31_424971	860	1	Time	Time	NNP
10_1101-2020_12_31_424971	860	2	e	e	NNP
10_1101-2020_12_31_424971	860	3	Time	time	NN
10_1101-2020_12_31_424971	860	4	0.55	0.55	CD
10_1101-2020_12_31_424971	860	5	(	(	-LRB-
10_1101-2020_12_31_424971	860	6	1	1	CD
10_1101-2020_12_31_424971	860	7	e	e	NN
10_1101-2020_12_31_424971	860	8	)	)	-RRB-
10_1101-2020_12_31_424971	860	9	0	0	NFP
10_1101-2020_12_31_424971	860	10	.	.	.
10_1101-2020_12_31_424971	861	1	1	1	CD
10_1101-2020_12_31_424971	861	2	(	(	-LRB-
10_1101-2020_12_31_424971	861	3	1	1	CD
10_1101-2020_12_31_424971	861	4	l	l	NN
10_1101-2020_12_31_424971	861	5	se	se	NN
10_1101-2020_12_31_424971	861	6	)	)	-RRB-
10_1101-2020_12_31_424971	861	7	0	0	NFP
10_1101-2020_12_31_424971	861	8	.	.	.
10_1101-2020_12_31_424971	862	1	0.7	0.7	CD
10_1101-2020_12_31_424971	862	2	15	15	CD
10_1101-2020_12_31_424971	862	3	15	15	CD
10_1101-2020_12_31_424971	862	4	10	10	CD
10_1101-2020_12_31_424971	862	5	10	10	CD
10_1101-2020_12_31_424971	862	6	N=	n=	NN
10_1101-2020_12_31_424971	862	7	5	5	CD
10_1101-2020_12_31_424971	862	8	1	1	CD
10_1101-2020_12_31_424971	862	9	ProL	ProL	NNP
10_1101-2020_12_31_424971	862	10	GS	GS	NNP
10_1101-2020_12_31_424971	862	11	P	P	NNP
10_1101-2020_12_31_424971	862	12	E1	e1	NN
10_1101-2020_12_31_424971	862	13	Stal	Stal	NNP
10_1101-2020_12_31_424971	862	14	P	P	NNP
10_1101-2020_12_31_424971	862	15	ST	ST	NNP
10_1101-2020_12_31_424971	862	16	GS1	GS1	NNP
10_1101-2020_12_31_424971	862	17	(	(	-LRB-
10_1101-2020_12_31_424971	862	18	EF	EF	NNP
10_1101-2020_12_31_424971	862	19	-	-	HYPH
10_1101-2020_12_31_424971	862	20	G	G	NNP
10_1101-2020_12_31_424971	862	21	)	)	-RRB-
10_1101-2020_12_31_424971	862	22	GS	GS	NNP
10_1101-2020_12_31_424971	862	23	(	(	-LRB-
10_1101-2020_12_31_424971	862	24	EF	EF	NNP
10_1101-2020_12_31_424971	862	25	-	-	HYPH
10_1101-2020_12_31_424971	862	26	G	G	NNP
10_1101-2020_12_31_424971	862	27	)	)	-RRB-
10_1101-2020_12_31_424971	862	28	E	E	NNP
10_1101-2020_12_31_424971	862	29	GS	GS	NNP
10_1101-2020_12_31_424971	862	30	GS1	GS1	NNP
10_1101-2020_12_31_424971	862	31	E	E	NNP
10_1101-2020_12_31_424971	862	32	F	f	NN
10_1101-2020_12_31_424971	862	33	R	r	NN
10_1101-2020_12_31_424971	862	34	E	e	NN
10_1101-2020_12_31_424971	862	35	T	t	NN
10_1101-2020_12_31_424971	862	36	k70S	k70	NNS
10_1101-2020_12_31_424971	862	37	IC→GS	ic→gs	CC
10_1101-2020_12_31_424971	862	38	kGS	kg	NNS
10_1101-2020_12_31_424971	862	39	→P	→P	-LRB-
10_1101-2020_12_31_424971	862	40	ST	ST	NNP
10_1101-2020_12_31_424971	862	41	0	0	NNP
10_1101-2020_12_31_424971	862	42	5	5	CD
10_1101-2020_12_31_424971	862	43	Time	Time	NNP
10_1101-2020_12_31_424971	862	44	(	(	-LRB-
10_1101-2020_12_31_424971	862	45	s	s	NN
10_1101-2020_12_31_424971	862	46	)	)	-RRB-
10_1101-2020_12_31_424971	862	47	7.5.5	7.5.5	CD
10_1101-2020_12_31_424971	862	48	E	e	NN
10_1101-2020_12_31_424971	862	49	F	f	NN
10_1101-2020_12_31_424971	862	50	R	r	NN
10_1101-2020_12_31_424971	862	51	E	e	NN
10_1101-2020_12_31_424971	862	52	T	t	NN
10_1101-2020_12_31_424971	862	53	N	n	NN
10_1101-2020_12_31_424971	862	54	=	=	SYM
10_1101-2020_12_31_424971	862	55	N=	N=	NNP
10_1101-2020_12_31_424971	862	56	N=	N=	NNP
10_1101-2020_12_31_424971	862	57	N=	N=	NNP
10_1101-2020_12_31_424971	862	58	5	5	CD
10_1101-2020_12_31_424971	862	59	Suf	Suf	NNP
10_1101-2020_12_31_424971	862	60	N=1	N=1	NNP
10_1101-2020_12_31_424971	862	61	N=	N=	NNP
10_1101-2020_12_31_424971	862	62	7	7	CD
10_1101-2020_12_31_424971	862	63	N=	n=	NN
10_1101-2020_12_31_424971	862	64	1	1	CD
10_1101-2020_12_31_424971	862	65	ProL	ProL	NNP
10_1101-2020_12_31_424971	862	66	0	0	CD
10_1101-2020_12_31_424971	862	67	.	.	.
10_1101-2020_12_31_424971	863	1	0.0	0.0	CD
10_1101-2020_12_31_424971	863	2	0	0	CD
10_1101-2020_12_31_424971	863	3	.	.	.
10_1101-2020_12_31_424971	864	1	0	0	NFP
10_1101-2020_12_31_424971	864	2	.	.	.
10_1101-2020_12_31_424971	865	1	0	0	NFP
10_1101-2020_12_31_424971	865	2	.	.	.
10_1101-2020_12_31_424971	866	1	0	0	NFP
10_1101-2020_12_31_424971	866	2	.	.	.
10_1101-2020_12_31_424971	867	1	1.0	1.0	CD
10_1101-2020_12_31_424971	867	2	1	1	CD
10_1101-2020_12_31_424971	867	3	.	.	.
10_1101-2020_12_31_424971	868	1	E	E	NNP
10_1101-2020_12_31_424971	868	2	F	F	NNP
10_1101-2020_12_31_424971	868	3	R	r	NN
10_1101-2020_12_31_424971	868	4	E	e	NN
10_1101-2020_12_31_424971	868	5	T	t	NN
10_1101-2020_12_31_424971	868	6	Suf	suf	NN
10_1101-2020_12_31_424971	868	7	0	0	CD
10_1101-2020_12_31_424971	868	8	.	.	.
10_1101-2020_12_31_424971	869	1	0.0	0.0	CD
10_1101-2020_12_31_424971	869	2	0	0	CD
10_1101-2020_12_31_424971	869	3	.	.	.
10_1101-2020_12_31_424971	870	1	0	0	NFP
10_1101-2020_12_31_424971	870	2	.	.	.
10_1101-2020_12_31_424971	871	1	0	0	NFP
10_1101-2020_12_31_424971	871	2	.	.	.
10_1101-2020_12_31_424971	872	1	0	0	NFP
10_1101-2020_12_31_424971	872	2	.	.	.
10_1101-2020_12_31_424971	873	1	1.0	1.0	CD
10_1101-2020_12_31_424971	873	2	1	1	CD
10_1101-2020_12_31_424971	873	3	.	.	.
10_1101-2020_12_31_424971	874	1	N=1	N=1	NNP
10_1101-2020_12_31_424971	874	2	ProL	ProL	NNP
10_1101-2020_12_31_424971	874	3	70S	70S	NNP
10_1101-2020_12_31_424971	874	4	IC	IC	NNP
10_1101-2020_12_31_424971	874	5	TC	TC	NNP
10_1101-2020_12_31_424971	874	6	EF	EF	NNP
10_1101-2020_12_31_424971	874	7	-	-	HYPH
10_1101-2020_12_31_424971	874	8	G	G	NNP
10_1101-2020_12_31_424971	874	9	Pm	Pm	NNP
10_1101-2020_12_31_424971	874	10	N=1	N=1	NNP
10_1101-2020_12_31_424971	874	11	Time	Time	NNP
10_1101-2020_12_31_424971	874	12	(	(	-LRB-
10_1101-2020_12_31_424971	874	13	mi	mi	NNP
10_1101-2020_12_31_424971	874	14	)	)	-RRB-
10_1101-2020_12_31_424971	874	15	Time	Time	NNP
10_1101-2020_12_31_424971	874	16	(	(	-LRB-
10_1101-2020_12_31_424971	874	17	mi	mi	NNP
10_1101-2020_12_31_424971	874	18	)	)	-RRB-
10_1101-2020_12_31_424971	874	19	.5	.5	.
10_1101-2020_12_31_424971	874	20	GS1	GS1	NNP
10_1101-2020_12_31_424971	874	21	0	0	CD
10_1101-2020_12_31_424971	874	22	.	.	.
10_1101-2020_12_31_424971	875	1	5	5	CD
10_1101-2020_12_31_424971	875	2	0	0	CD
10_1101-2020_12_31_424971	875	3	.	.	.
10_1101-2020_12_31_424971	876	1	0	0	CD
10_1101-2020_12_31_424971	876	2	5	5	CD
10_1101-2020_12_31_424971	876	3	107.5	107.5	CD
10_1101-2020_12_31_424971	876	4	.5	.5	NN
10_1101-2020_12_31_424971	876	5	0	0	CD
10_1101-2020_12_31_424971	876	6	5	5	CD
10_1101-2020_12_31_424971	876	7	Time	Time	NNP
10_1101-2020_12_31_424971	876	8	(	(	-LRB-
10_1101-2020_12_31_424971	876	9	s	s	NN
10_1101-2020_12_31_424971	876	10	)	)	-RRB-
10_1101-2020_12_31_424971	876	11	10	10	CD
10_1101-2020_12_31_424971	876	12	Time	Time	NNP
10_1101-2020_12_31_424971	876	13	(	(	-LRB-
10_1101-2020_12_31_424971	876	14	s	s	NNP
10_1101-2020_12_31_424971	876	15	)	)	-RRB-
10_1101-2020_12_31_424971	876	16	.5	.5	.
10_1101-2020_12_31_424971	876	17	0	0	NFP
10_1101-2020_12_31_424971	876	18	5	5	CD
10_1101-2020_12_31_424971	876	19	Time	Time	NNP
10_1101-2020_12_31_424971	876	20	(	(	-LRB-
10_1101-2020_12_31_424971	876	21	s	s	NN
10_1101-2020_12_31_424971	876	22	)	)	-RRB-
10_1101-2020_12_31_424971	876	23	7.5	7.5	CD
10_1101-2020_12_31_424971	876	24	a	a	DT
10_1101-2020_12_31_424971	876	25	0	0	CD
10_1101-2020_12_31_424971	876	26	1	1	CD
10_1101-2020_12_31_424971	876	27	0	0	CD
10_1101-2020_12_31_424971	876	28	1	1	CD
10_1101-2020_12_31_424971	876	29	10	10	CD
10_1101-2020_12_31_424971	876	30	N=17	n=17	NN
10_1101-2020_12_31_424971	876	31	0	0	CD
10_1101-2020_12_31_424971	876	32	0	0	CD
10_1101-2020_12_31_424971	876	33	N=55	N=55	NNP
10_1101-2020_12_31_424971	876	34	Suf	Suf	NNP
10_1101-2020_12_31_424971	876	35	0	0	CD
10_1101-2020_12_31_424971	876	36	.	.	.
10_1101-2020_12_31_424971	877	1	0	0	NFP
10_1101-2020_12_31_424971	877	2	.	.	.
10_1101-2020_12_31_424971	878	1	0	0	NFP
10_1101-2020_12_31_424971	878	2	5	5	CD
10_1101-2020_12_31_424971	878	3	Time	Time	NNP
10_1101-2020_12_31_424971	878	4	(	(	-LRB-
10_1101-2020_12_31_424971	878	5	s	s	NN
10_1101-2020_12_31_424971	878	6	)	)	-RRB-
10_1101-2020_12_31_424971	878	7	10	10	CD
10_1101-2020_12_31_424971	878	8	0	0	CD
10_1101-2020_12_31_424971	878	9	5	5	CD
10_1101-2020_12_31_424971	878	10	Time	Time	NNP
10_1101-2020_12_31_424971	878	11	(	(	-LRB-
10_1101-2020_12_31_424971	878	12	s	s	NN
10_1101-2020_12_31_424971	878	13	)	)	-RRB-
10_1101-2020_12_31_424971	878	14	7.5.5	7.5.5	CD
10_1101-2020_12_31_424971	878	15	0	0	CD
10_1101-2020_12_31_424971	878	16	5	5	CD
10_1101-2020_12_31_424971	878	17	Time	Time	NNP
10_1101-2020_12_31_424971	878	18	(	(	-LRB-
10_1101-2020_12_31_424971	878	19	s	s	NN
10_1101-2020_12_31_424971	878	20	)	)	-RRB-
10_1101-2020_12_31_424971	878	21	7.5.5	7.5.5	CD
10_1101-2020_12_31_424971	878	22	0	0	CD
10_1101-2020_12_31_424971	878	23	5	5	CD
10_1101-2020_12_31_424971	878	24	Time	Time	NNP
10_1101-2020_12_31_424971	878	25	(	(	-LRB-
10_1101-2020_12_31_424971	878	26	s	s	NN
10_1101-2020_12_31_424971	878	27	)	)	-RRB-
10_1101-2020_12_31_424971	878	28	7.5	7.5	CD
10_1101-2020_12_31_424971	878	29	.CC	.CC	NFP
10_1101-2020_12_31_424971	878	30	-	-	HYPH
10_1101-2020_12_31_424971	878	31	BY	by	IN
10_1101-2020_12_31_424971	878	32	-	-	HYPH
10_1101-2020_12_31_424971	878	33	NC	NC	NNP
10_1101-2020_12_31_424971	878	34	-	-	HYPH
10_1101-2020_12_31_424971	878	35	ND	ND	NNP
10_1101-2020_12_31_424971	878	36	4.0	4.0	CD
10_1101-2020_12_31_424971	878	37	International	International	NNP
10_1101-2020_12_31_424971	878	38	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	878	39	under	under	IN
10_1101-2020_12_31_424971	878	40	a	a	DT
10_1101-2020_12_31_424971	878	41	(	(	-LRB-
10_1101-2020_12_31_424971	878	42	which	which	WDT
10_1101-2020_12_31_424971	878	43	was	be	VBD
10_1101-2020_12_31_424971	878	44	not	not	RB
10_1101-2020_12_31_424971	878	45	certified	certify	VBN
10_1101-2020_12_31_424971	878	46	by	by	IN
10_1101-2020_12_31_424971	878	47	peer	peer	NN
10_1101-2020_12_31_424971	878	48	review	review	NN
10_1101-2020_12_31_424971	878	49	)	)	-RRB-
10_1101-2020_12_31_424971	878	50	is	be	VBZ
10_1101-2020_12_31_424971	878	51	the	the	DT
10_1101-2020_12_31_424971	878	52	author	author	NN
10_1101-2020_12_31_424971	878	53	/	/	SYM
10_1101-2020_12_31_424971	878	54	funder	funder	NN
10_1101-2020_12_31_424971	878	55	,	,	,
10_1101-2020_12_31_424971	878	56	who	who	WP
10_1101-2020_12_31_424971	878	57	has	have	VBZ
10_1101-2020_12_31_424971	878	58	granted	grant	VBN
10_1101-2020_12_31_424971	878	59	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	878	60	a	a	DT
10_1101-2020_12_31_424971	878	61	license	license	NN
10_1101-2020_12_31_424971	878	62	to	to	TO
10_1101-2020_12_31_424971	878	63	display	display	VB
10_1101-2020_12_31_424971	878	64	the	the	DT
10_1101-2020_12_31_424971	878	65	preprint	preprint	NN
10_1101-2020_12_31_424971	878	66	in	in	IN
10_1101-2020_12_31_424971	878	67	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	878	68	.	.	.
10_1101-2020_12_31_424971	879	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	879	2	is	be	VBZ
10_1101-2020_12_31_424971	879	3	made	make	VBN
10_1101-2020_12_31_424971	879	4	The	the	DT
10_1101-2020_12_31_424971	879	5	copyright	copyright	NN
10_1101-2020_12_31_424971	879	6	holder	holder	NN
10_1101-2020_12_31_424971	879	7	for	for	IN
10_1101-2020_12_31_424971	879	8	this	this	DT
10_1101-2020_12_31_424971	879	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	879	10	version	version	NN
10_1101-2020_12_31_424971	879	11	posted	post	VBD
10_1101-2020_12_31_424971	879	12	January	January	NNP
10_1101-2020_12_31_424971	879	13	2	2	CD
10_1101-2020_12_31_424971	879	14	,	,	,
10_1101-2020_12_31_424971	879	15	2021	2021	CD
10_1101-2020_12_31_424971	879	16	.	.	.
10_1101-2020_12_31_424971	879	17	;	;	:
10_1101-2020_12_31_424971	879	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	879	19	:	:	:
10_1101-2020_12_31_424971	879	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	879	21	preprint	preprint	NN
10_1101-2020_12_31_424971	879	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	879	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2020_12_31_424971	879	24	59	59	CD
10_1101-2020_12_31_424971	879	25	Figure	figure	NN
10_1101-2020_12_31_424971	879	26	7	7	CD
10_1101-2020_12_31_424971	879	27	1378	1378	CD
10_1101-2020_12_31_424971	879	28	1379	1379	CD
10_1101-2020_12_31_424971	879	29	1380	1380	CD
10_1101-2020_12_31_424971	879	30	1381	1381	CD
10_1101-2020_12_31_424971	879	31	60	60	CD
10_1101-2020_12_31_424971	879	32	Å	Å	NNP
10_1101-2020_12_31_424971	879	33	POST	POST	NNP
10_1101-2020_12_31_424971	879	34	PRE	PRE	NNP
10_1101-2020_12_31_424971	879	35	PRE	PRE	NNP
10_1101-2020_12_31_424971	879	36	-	-	HYPH
10_1101-2020_12_31_424971	879	37	G1	G1	NNP
10_1101-2020_12_31_424971	879	38	PRE	PRE	NNP
10_1101-2020_12_31_424971	879	39	-	-	HYPH
10_1101-2020_12_31_424971	879	40	G2	G2	NNP
10_1101-2020_12_31_424971	879	41	PRE	PRE	NNP
10_1101-2020_12_31_424971	879	42	-	-	HYPH
10_1101-2020_12_31_424971	879	43	G3	G3	NNP
10_1101-2020_12_31_424971	879	44	PRE	PRE	NNP
10_1101-2020_12_31_424971	879	45	-	-	HYPH
10_1101-2020_12_31_424971	879	46	G4	G4	NNP
10_1101-2020_12_31_424971	879	47	POST	POST	NNP
10_1101-2020_12_31_424971	879	48	GS1	GS1	NNP
10_1101-2020_12_31_424971	879	49	GS1	GS1	NNP
10_1101-2020_12_31_424971	879	50	GS2	GS2	NNP
10_1101-2020_12_31_424971	879	51	GS2	GS2	NNP
10_1101-2020_12_31_424971	879	52	60	60	CD
10_1101-2020_12_31_424971	879	53	Å	Å	NNP
10_1101-2020_12_31_424971	879	54	Intersubunit	intersubunit	JJ
10_1101-2020_12_31_424971	879	55	rotation	rotation	NN
10_1101-2020_12_31_424971	879	56	8	8	CD
10_1101-2020_12_31_424971	879	57	°	°	,
10_1101-2020_12_31_424971	879	58	8	8	CD
10_1101-2020_12_31_424971	879	59	°	°	,
10_1101-2020_12_31_424971	879	60	12	12	CD
10_1101-2020_12_31_424971	879	61	°	°	,
10_1101-2020_12_31_424971	879	62	2	2	CD
10_1101-2020_12_31_424971	879	63	°	°	,
10_1101-2020_12_31_424971	879	64	0	0	CD
10_1101-2020_12_31_424971	879	65	°	°	,
10_1101-2020_12_31_424971	879	66	Head	Head	NNP
10_1101-2020_12_31_424971	879	67	swive	swive	JJ
10_1101-2020_12_31_424971	879	68	in	in	IN
10_1101-2020_12_31_424971	879	69	-	-	HYPH
10_1101-2020_12_31_424971	879	70	°	°	NN
10_1101-2020_12_31_424971	879	71	-	-	HYPH
10_1101-2020_12_31_424971	879	72	°	°	NNP
10_1101-2020_12_31_424971	879	73	3	3	CD
10_1101-2020_12_31_424971	879	74	°	°	,
10_1101-2020_12_31_424971	879	75	21	21	CD
10_1101-2020_12_31_424971	879	76	°	°	NNS
10_1101-2020_12_31_424971	879	77	0	0	CD
10_1101-2020_12_31_424971	879	78	°	°	NNS
10_1101-2020_12_31_424971	879	79	.CC	.CC	NFP
10_1101-2020_12_31_424971	879	80	-	-	HYPH
10_1101-2020_12_31_424971	879	81	BY	by	IN
10_1101-2020_12_31_424971	879	82	-	-	HYPH
10_1101-2020_12_31_424971	879	83	NC	NC	NNP
10_1101-2020_12_31_424971	879	84	-	-	HYPH
10_1101-2020_12_31_424971	879	85	ND	ND	NNP
10_1101-2020_12_31_424971	879	86	4.0	4.0	CD
10_1101-2020_12_31_424971	879	87	International	International	NNP
10_1101-2020_12_31_424971	879	88	licenseavailable	licenseavailable	NN
10_1101-2020_12_31_424971	879	89	under	under	IN
10_1101-2020_12_31_424971	879	90	a	a	DT
10_1101-2020_12_31_424971	879	91	(	(	-LRB-
10_1101-2020_12_31_424971	879	92	which	which	WDT
10_1101-2020_12_31_424971	879	93	was	be	VBD
10_1101-2020_12_31_424971	879	94	not	not	RB
10_1101-2020_12_31_424971	879	95	certified	certify	VBN
10_1101-2020_12_31_424971	879	96	by	by	IN
10_1101-2020_12_31_424971	879	97	peer	peer	NN
10_1101-2020_12_31_424971	879	98	review	review	NN
10_1101-2020_12_31_424971	879	99	)	)	-RRB-
10_1101-2020_12_31_424971	879	100	is	be	VBZ
10_1101-2020_12_31_424971	879	101	the	the	DT
10_1101-2020_12_31_424971	879	102	author	author	NN
10_1101-2020_12_31_424971	879	103	/	/	SYM
10_1101-2020_12_31_424971	879	104	funder	funder	NN
10_1101-2020_12_31_424971	879	105	,	,	,
10_1101-2020_12_31_424971	879	106	who	who	WP
10_1101-2020_12_31_424971	879	107	has	have	VBZ
10_1101-2020_12_31_424971	879	108	granted	grant	VBN
10_1101-2020_12_31_424971	879	109	bioRxiv	biorxiv	IN
10_1101-2020_12_31_424971	879	110	a	a	DT
10_1101-2020_12_31_424971	879	111	license	license	NN
10_1101-2020_12_31_424971	879	112	to	to	TO
10_1101-2020_12_31_424971	879	113	display	display	VB
10_1101-2020_12_31_424971	879	114	the	the	DT
10_1101-2020_12_31_424971	879	115	preprint	preprint	NN
10_1101-2020_12_31_424971	879	116	in	in	IN
10_1101-2020_12_31_424971	879	117	perpetuity	perpetuity	NN
10_1101-2020_12_31_424971	879	118	.	.	.
10_1101-2020_12_31_424971	880	1	It	-PRON-	PRP
10_1101-2020_12_31_424971	880	2	is	be	VBZ
10_1101-2020_12_31_424971	880	3	made	make	VBN
10_1101-2020_12_31_424971	880	4	The	the	DT
10_1101-2020_12_31_424971	880	5	copyright	copyright	NN
10_1101-2020_12_31_424971	880	6	holder	holder	NN
10_1101-2020_12_31_424971	880	7	for	for	IN
10_1101-2020_12_31_424971	880	8	this	this	DT
10_1101-2020_12_31_424971	880	9	preprintthis	preprintthis	NN
10_1101-2020_12_31_424971	880	10	version	version	NN
10_1101-2020_12_31_424971	880	11	posted	post	VBD
10_1101-2020_12_31_424971	880	12	January	January	NNP
10_1101-2020_12_31_424971	880	13	2	2	CD
10_1101-2020_12_31_424971	880	14	,	,	,
10_1101-2020_12_31_424971	880	15	2021	2021	CD
10_1101-2020_12_31_424971	880	16	.	.	.
10_1101-2020_12_31_424971	880	17	;	;	:
10_1101-2020_12_31_424971	880	18	https://doi.org/10.1101/2020.12.31.424971doi	https://doi.org/10.1101/2020.12.31.424971doi	NFP
10_1101-2020_12_31_424971	880	19	:	:	:
10_1101-2020_12_31_424971	880	20	bioRxiv	biorxiv	VB
10_1101-2020_12_31_424971	880	21	preprint	preprint	NN
10_1101-2020_12_31_424971	880	22	https://doi.org/10.1101/2020.12.31.424971	https://doi.org/10.1101/2020.12.31.424971	UH
10_1101-2020_12_31_424971	880	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN