id	sid	tid	token	lemma	pos
10_1101-2021_01_06_425657	1	1	The	the	DT
10_1101-2021_01_06_425657	1	2	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	1	3	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	1	4	ligase	ligase	NN
10_1101-2021_01_06_425657	1	5	senses	sense	VBZ
10_1101-2021_01_06_425657	1	6	cellular	cellular	JJ
10_1101-2021_01_06_425657	1	7	redox	redox	JJ
10_1101-2021_01_06_425657	1	8	state	state	NN
10_1101-2021_01_06_425657	1	9	to	to	TO
10_1101-2021_01_06_425657	1	10	regulate	regulate	VB
10_1101-2021_01_06_425657	1	11	the	the	DT
10_1101-2021_01_06_425657	1	12	transcription	transcription	NN
10_1101-2021_01_06_425657	1	13	of	of	IN
10_1101-2021_01_06_425657	1	14	sulfur	sulfur	NN
10_1101-2021_01_06_425657	1	15	metabolism	metabolism	NN
10_1101-2021_01_06_425657	1	16	gene	gene	NN
10_1101-2021_01_06_425657	1	17	The	the	DT
10_1101-2021_01_06_425657	1	18	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	1	19	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	1	20	ligase	ligase	NN
10_1101-2021_01_06_425657	1	21	senses	sense	VBZ
10_1101-2021_01_06_425657	1	22	cellular	cellular	JJ
10_1101-2021_01_06_425657	1	23	redox	redox	JJ
10_1101-2021_01_06_425657	1	24	state	state	NN
10_1101-2021_01_06_425657	1	25	to	to	TO
10_1101-2021_01_06_425657	1	26	regulate	regulate	VB
10_1101-2021_01_06_425657	1	27	the	the	DT
10_1101-2021_01_06_425657	1	28	1	1	CD
10_1101-2021_01_06_425657	1	29	transcription	transcription	NN
10_1101-2021_01_06_425657	1	30	of	of	IN
10_1101-2021_01_06_425657	1	31	sulfur	sulfur	NN
10_1101-2021_01_06_425657	1	32	metabolism	metabolism	NN
10_1101-2021_01_06_425657	1	33	genes	gene	NNS
10_1101-2021_01_06_425657	1	34	2	2	CD
10_1101-2021_01_06_425657	1	35	3	3	CD
10_1101-2021_01_06_425657	1	36	Zane	Zane	NNP
10_1101-2021_01_06_425657	1	37	Johnson1	Johnson1	NNP
10_1101-2021_01_06_425657	1	38	,	,	,
10_1101-2021_01_06_425657	1	39	Yun	Yun	NNP
10_1101-2021_01_06_425657	1	40	Wang1	wang1	NN
10_1101-2021_01_06_425657	1	41	,	,	,
10_1101-2021_01_06_425657	1	42	Benjamin	Benjamin	NNP
10_1101-2021_01_06_425657	1	43	M.	M.	NNP
10_1101-2021_01_06_425657	1	44	Sutter1	Sutter1	NNP
10_1101-2021_01_06_425657	1	45	,	,	,
10_1101-2021_01_06_425657	1	46	Benjamin	Benjamin	NNP
10_1101-2021_01_06_425657	1	47	P.	P.	NNP
10_1101-2021_01_06_425657	1	48	Tu1	Tu1	NNP
10_1101-2021_01_06_425657	1	49	*	*	NFP
10_1101-2021_01_06_425657	1	50	4	4	CD
10_1101-2021_01_06_425657	1	51	5	5	CD
10_1101-2021_01_06_425657	1	52	1	1	CD
10_1101-2021_01_06_425657	1	53	Department	Department	NNP
10_1101-2021_01_06_425657	1	54	of	of	IN
10_1101-2021_01_06_425657	1	55	Biochemistry	Biochemistry	NNP
10_1101-2021_01_06_425657	1	56	,	,	,
10_1101-2021_01_06_425657	1	57	University	University	NNP
10_1101-2021_01_06_425657	1	58	of	of	IN
10_1101-2021_01_06_425657	1	59	Texas	Texas	NNP
10_1101-2021_01_06_425657	1	60	Southwestern	Southwestern	NNP
10_1101-2021_01_06_425657	1	61	Medical	Medical	NNP
10_1101-2021_01_06_425657	1	62	Center	Center	NNP
10_1101-2021_01_06_425657	1	63	,	,	,
10_1101-2021_01_06_425657	1	64	6	6	CD
10_1101-2021_01_06_425657	1	65	Dallas	Dallas	NNP
10_1101-2021_01_06_425657	1	66	,	,	,
10_1101-2021_01_06_425657	1	67	TX	TX	NNP
10_1101-2021_01_06_425657	1	68	75390	75390	CD
10_1101-2021_01_06_425657	1	69	-	-	SYM
10_1101-2021_01_06_425657	1	70	9038	9038	CD
10_1101-2021_01_06_425657	1	71	7	7	CD
10_1101-2021_01_06_425657	1	72	8	8	CD
10_1101-2021_01_06_425657	1	73	*	*	NFP
10_1101-2021_01_06_425657	1	74	Correspondence	Correspondence	NNP
10_1101-2021_01_06_425657	1	75	and	and	CC
10_1101-2021_01_06_425657	1	76	Lead	Lead	NNP
10_1101-2021_01_06_425657	1	77	Contact	contact	NN
10_1101-2021_01_06_425657	1	78	:	:	:
10_1101-2021_01_06_425657	1	79	benjamin.tu@utsouthwestern.edu	benjamin.tu@utsouthwestern.edu	NNP
10_1101-2021_01_06_425657	1	80	9	9	CD
10_1101-2021_01_06_425657	1	81	10	10	CD
10_1101-2021_01_06_425657	1	82	11	11	CD
10_1101-2021_01_06_425657	1	83	12	12	CD
10_1101-2021_01_06_425657	1	84	.CC	.cc	CD
10_1101-2021_01_06_425657	1	85	-	-	:
10_1101-2021_01_06_425657	1	86	BY	by	IN
10_1101-2021_01_06_425657	1	87	4.0	4.0	CD
10_1101-2021_01_06_425657	1	88	International	International	NNP
10_1101-2021_01_06_425657	1	89	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	1	90	under	under	IN
10_1101-2021_01_06_425657	1	91	a	a	DT
10_1101-2021_01_06_425657	1	92	(	(	-LRB-
10_1101-2021_01_06_425657	1	93	which	which	WDT
10_1101-2021_01_06_425657	1	94	was	be	VBD
10_1101-2021_01_06_425657	1	95	not	not	RB
10_1101-2021_01_06_425657	1	96	certified	certify	VBN
10_1101-2021_01_06_425657	1	97	by	by	IN
10_1101-2021_01_06_425657	1	98	peer	peer	NN
10_1101-2021_01_06_425657	1	99	review	review	NN
10_1101-2021_01_06_425657	1	100	)	)	-RRB-
10_1101-2021_01_06_425657	1	101	is	be	VBZ
10_1101-2021_01_06_425657	1	102	the	the	DT
10_1101-2021_01_06_425657	1	103	author	author	NN
10_1101-2021_01_06_425657	1	104	/	/	SYM
10_1101-2021_01_06_425657	1	105	funder	funder	NN
10_1101-2021_01_06_425657	1	106	,	,	,
10_1101-2021_01_06_425657	1	107	who	who	WP
10_1101-2021_01_06_425657	1	108	has	have	VBZ
10_1101-2021_01_06_425657	1	109	granted	grant	VBN
10_1101-2021_01_06_425657	1	110	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	1	111	a	a	DT
10_1101-2021_01_06_425657	1	112	license	license	NN
10_1101-2021_01_06_425657	1	113	to	to	TO
10_1101-2021_01_06_425657	1	114	display	display	VB
10_1101-2021_01_06_425657	1	115	the	the	DT
10_1101-2021_01_06_425657	1	116	preprint	preprint	NN
10_1101-2021_01_06_425657	1	117	in	in	IN
10_1101-2021_01_06_425657	1	118	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	1	119	.	.	.
10_1101-2021_01_06_425657	2	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	2	2	is	be	VBZ
10_1101-2021_01_06_425657	2	3	made	make	VBN
10_1101-2021_01_06_425657	2	4	The	the	DT
10_1101-2021_01_06_425657	2	5	copyright	copyright	NN
10_1101-2021_01_06_425657	2	6	holder	holder	NN
10_1101-2021_01_06_425657	2	7	for	for	IN
10_1101-2021_01_06_425657	2	8	this	this	DT
10_1101-2021_01_06_425657	2	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	2	10	version	version	NN
10_1101-2021_01_06_425657	2	11	posted	post	VBD
10_1101-2021_01_06_425657	2	12	January	January	NNP
10_1101-2021_01_06_425657	2	13	7	7	CD
10_1101-2021_01_06_425657	2	14	,	,	,
10_1101-2021_01_06_425657	2	15	2021	2021	CD
10_1101-2021_01_06_425657	2	16	.	.	.
10_1101-2021_01_06_425657	2	17	;	;	:
10_1101-2021_01_06_425657	2	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	2	19	:	:	:
10_1101-2021_01_06_425657	2	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	2	21	preprint	preprint	NN
10_1101-2021_01_06_425657	2	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	2	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	2	24	2	2	CD
10_1101-2021_01_06_425657	2	25	SUMMARY	summary	NN
10_1101-2021_01_06_425657	2	26	13	13	CD
10_1101-2021_01_06_425657	2	27	14	14	CD
10_1101-2021_01_06_425657	2	28	In	in	IN
10_1101-2021_01_06_425657	2	29	yeast	yeast	NN
10_1101-2021_01_06_425657	2	30	,	,	,
10_1101-2021_01_06_425657	2	31	control	control	NN
10_1101-2021_01_06_425657	2	32	of	of	IN
10_1101-2021_01_06_425657	2	33	sulfur	sulfur	NN
10_1101-2021_01_06_425657	2	34	amino	amino	NN
10_1101-2021_01_06_425657	2	35	acid	acid	NN
10_1101-2021_01_06_425657	2	36	metabolism	metabolism	NN
10_1101-2021_01_06_425657	2	37	relies	rely	VBZ
10_1101-2021_01_06_425657	2	38	upon	upon	IN
10_1101-2021_01_06_425657	2	39	Met4	Met4	NNP
10_1101-2021_01_06_425657	2	40	,	,	,
10_1101-2021_01_06_425657	2	41	a	a	DT
10_1101-2021_01_06_425657	2	42	transcription	transcription	NN
10_1101-2021_01_06_425657	2	43	factor	factor	NN
10_1101-2021_01_06_425657	2	44	which	which	WDT
10_1101-2021_01_06_425657	2	45	15	15	CD
10_1101-2021_01_06_425657	2	46	activates	activate	VBZ
10_1101-2021_01_06_425657	2	47	the	the	DT
10_1101-2021_01_06_425657	2	48	expression	expression	NN
10_1101-2021_01_06_425657	2	49	of	of	IN
10_1101-2021_01_06_425657	2	50	a	a	DT
10_1101-2021_01_06_425657	2	51	network	network	NN
10_1101-2021_01_06_425657	2	52	of	of	IN
10_1101-2021_01_06_425657	2	53	enzymes	enzyme	NNS
10_1101-2021_01_06_425657	2	54	responsible	responsible	JJ
10_1101-2021_01_06_425657	2	55	for	for	IN
10_1101-2021_01_06_425657	2	56	the	the	DT
10_1101-2021_01_06_425657	2	57	biosynthesis	biosynthesis	NN
10_1101-2021_01_06_425657	2	58	of	of	IN
10_1101-2021_01_06_425657	2	59	cysteine	cysteine	NNP
10_1101-2021_01_06_425657	2	60	and	and	CC
10_1101-2021_01_06_425657	2	61	16	16	CD
10_1101-2021_01_06_425657	2	62	methionine	methionine	NN
10_1101-2021_01_06_425657	2	63	.	.	.
10_1101-2021_01_06_425657	3	1	In	in	IN
10_1101-2021_01_06_425657	3	2	times	time	NNS
10_1101-2021_01_06_425657	3	3	of	of	IN
10_1101-2021_01_06_425657	3	4	sulfur	sulfur	NN
10_1101-2021_01_06_425657	3	5	abundance	abundance	NN
10_1101-2021_01_06_425657	3	6	,	,	,
10_1101-2021_01_06_425657	3	7	the	the	DT
10_1101-2021_01_06_425657	3	8	activity	activity	NN
10_1101-2021_01_06_425657	3	9	of	of	IN
10_1101-2021_01_06_425657	3	10	Met4	Met4	NNP
10_1101-2021_01_06_425657	3	11	is	be	VBZ
10_1101-2021_01_06_425657	3	12	repressed	repress	VBN
10_1101-2021_01_06_425657	3	13	via	via	IN
10_1101-2021_01_06_425657	3	14	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	3	15	by	by	IN
10_1101-2021_01_06_425657	3	16	17	17	CD
10_1101-2021_01_06_425657	3	17	the	the	DT
10_1101-2021_01_06_425657	3	18	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	3	19	E3	E3	NNP
10_1101-2021_01_06_425657	3	20	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	3	21	ligase	ligase	NN
10_1101-2021_01_06_425657	3	22	,	,	,
10_1101-2021_01_06_425657	3	23	but	but	CC
10_1101-2021_01_06_425657	3	24	the	the	DT
10_1101-2021_01_06_425657	3	25	mechanism	mechanism	NN
10_1101-2021_01_06_425657	3	26	by	by	IN
10_1101-2021_01_06_425657	3	27	which	which	WDT
10_1101-2021_01_06_425657	3	28	the	the	DT
10_1101-2021_01_06_425657	3	29	F	F	NNP
10_1101-2021_01_06_425657	3	30	-	-	HYPH
10_1101-2021_01_06_425657	3	31	box	box	NN
10_1101-2021_01_06_425657	3	32	protein	protein	NN
10_1101-2021_01_06_425657	3	33	Met30	Met30	NNP
10_1101-2021_01_06_425657	3	34	senses	sense	VBZ
10_1101-2021_01_06_425657	3	35	18	18	CD
10_1101-2021_01_06_425657	3	36	sulfur	sulfur	NN
10_1101-2021_01_06_425657	3	37	status	status	NN
10_1101-2021_01_06_425657	3	38	to	to	TO
10_1101-2021_01_06_425657	3	39	tune	tune	VB
10_1101-2021_01_06_425657	3	40	its	-PRON-	PRP$
10_1101-2021_01_06_425657	3	41	E3	E3	JJS
10_1101-2021_01_06_425657	3	42	ligase	ligase	NN
10_1101-2021_01_06_425657	3	43	activity	activity	NN
10_1101-2021_01_06_425657	3	44	remains	remain	VBZ
10_1101-2021_01_06_425657	3	45	unresolved	unresolved	JJ
10_1101-2021_01_06_425657	3	46	.	.	.
10_1101-2021_01_06_425657	4	1	Here	here	RB
10_1101-2021_01_06_425657	4	2	,	,	,
10_1101-2021_01_06_425657	4	3	using	use	VBG
10_1101-2021_01_06_425657	4	4	a	a	DT
10_1101-2021_01_06_425657	4	5	combination	combination	NN
10_1101-2021_01_06_425657	4	6	of	of	IN
10_1101-2021_01_06_425657	4	7	19	19	CD
10_1101-2021_01_06_425657	4	8	genetics	genetic	NNS
10_1101-2021_01_06_425657	4	9	and	and	CC
10_1101-2021_01_06_425657	4	10	biochemistry	biochemistry	NN
10_1101-2021_01_06_425657	4	11	,	,	,
10_1101-2021_01_06_425657	4	12	we	-PRON-	PRP
10_1101-2021_01_06_425657	4	13	show	show	VBP
10_1101-2021_01_06_425657	4	14	that	that	IN
10_1101-2021_01_06_425657	4	15	Met30	Met30	NNP
10_1101-2021_01_06_425657	4	16	utilizes	utilize	VBZ
10_1101-2021_01_06_425657	4	17	exquisitely	exquisitely	RB
10_1101-2021_01_06_425657	4	18	redox	redox	JJ
10_1101-2021_01_06_425657	4	19	-	-	HYPH
10_1101-2021_01_06_425657	4	20	sensitive	sensitive	JJ
10_1101-2021_01_06_425657	4	21	cysteine	cysteine	NN
10_1101-2021_01_06_425657	4	22	20	20	CD
10_1101-2021_01_06_425657	4	23	residues	residue	NNS
10_1101-2021_01_06_425657	4	24	in	in	IN
10_1101-2021_01_06_425657	4	25	its	-PRON-	PRP$
10_1101-2021_01_06_425657	4	26	WD-40	WD-40	NNP
10_1101-2021_01_06_425657	4	27	repeat	repeat	NN
10_1101-2021_01_06_425657	4	28	region	region	NN
10_1101-2021_01_06_425657	4	29	to	to	TO
10_1101-2021_01_06_425657	4	30	sense	sense	VB
10_1101-2021_01_06_425657	4	31	the	the	DT
10_1101-2021_01_06_425657	4	32	availability	availability	NN
10_1101-2021_01_06_425657	4	33	of	of	IN
10_1101-2021_01_06_425657	4	34	sulfur	sulfur	NN
10_1101-2021_01_06_425657	4	35	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	4	36	in	in	IN
10_1101-2021_01_06_425657	4	37	the	the	DT
10_1101-2021_01_06_425657	4	38	cell	cell	NN
10_1101-2021_01_06_425657	4	39	.	.	.
10_1101-2021_01_06_425657	5	1	21	21	CD
10_1101-2021_01_06_425657	5	2	Oxidation	oxidation	NN
10_1101-2021_01_06_425657	5	3	of	of	IN
10_1101-2021_01_06_425657	5	4	these	these	DT
10_1101-2021_01_06_425657	5	5	cysteine	cysteine	JJ
10_1101-2021_01_06_425657	5	6	residues	residue	NNS
10_1101-2021_01_06_425657	5	7	in	in	IN
10_1101-2021_01_06_425657	5	8	response	response	NN
10_1101-2021_01_06_425657	5	9	to	to	IN
10_1101-2021_01_06_425657	5	10	sulfur	sulfur	NN
10_1101-2021_01_06_425657	5	11	starvation	starvation	NN
10_1101-2021_01_06_425657	5	12	inhibits	inhibit	NNS
10_1101-2021_01_06_425657	5	13	binding	bind	VBG
10_1101-2021_01_06_425657	5	14	and	and	CC
10_1101-2021_01_06_425657	5	15	22	22	CD
10_1101-2021_01_06_425657	5	16	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	5	17	of	of	IN
10_1101-2021_01_06_425657	5	18	Met4	Met4	NNP
10_1101-2021_01_06_425657	5	19	,	,	,
10_1101-2021_01_06_425657	5	20	leading	lead	VBG
10_1101-2021_01_06_425657	5	21	to	to	IN
10_1101-2021_01_06_425657	5	22	induction	induction	NN
10_1101-2021_01_06_425657	5	23	of	of	IN
10_1101-2021_01_06_425657	5	24	sulfur	sulfur	NN
10_1101-2021_01_06_425657	5	25	metabolism	metabolism	NN
10_1101-2021_01_06_425657	5	26	genes	gene	NNS
10_1101-2021_01_06_425657	5	27	.	.	.
10_1101-2021_01_06_425657	6	1	Our	-PRON-	PRP$
10_1101-2021_01_06_425657	6	2	findings	finding	NNS
10_1101-2021_01_06_425657	6	3	reveal	reveal	VBP
10_1101-2021_01_06_425657	6	4	how	how	WRB
10_1101-2021_01_06_425657	6	5	23	23	CD
10_1101-2021_01_06_425657	6	6	SCFMet30	scfmet30	VBP
10_1101-2021_01_06_425657	6	7	dynamically	dynamically	RB
10_1101-2021_01_06_425657	6	8	senses	sense	VBZ
10_1101-2021_01_06_425657	6	9	redox	redox	JJ
10_1101-2021_01_06_425657	6	10	cues	cue	NNS
10_1101-2021_01_06_425657	6	11	to	to	TO
10_1101-2021_01_06_425657	6	12	regulate	regulate	VB
10_1101-2021_01_06_425657	6	13	synthesis	synthesis	NN
10_1101-2021_01_06_425657	6	14	of	of	IN
10_1101-2021_01_06_425657	6	15	these	these	DT
10_1101-2021_01_06_425657	6	16	special	special	JJ
10_1101-2021_01_06_425657	6	17	amino	amino	NN
10_1101-2021_01_06_425657	6	18	acids	acid	NNS
10_1101-2021_01_06_425657	6	19	,	,	,
10_1101-2021_01_06_425657	6	20	and	and	CC
10_1101-2021_01_06_425657	6	21	24	24	CD
10_1101-2021_01_06_425657	6	22	further	further	RB
10_1101-2021_01_06_425657	6	23	highlight	highlight	NN
10_1101-2021_01_06_425657	6	24	the	the	DT
10_1101-2021_01_06_425657	6	25	mechanistic	mechanistic	JJ
10_1101-2021_01_06_425657	6	26	diversity	diversity	NN
10_1101-2021_01_06_425657	6	27	in	in	IN
10_1101-2021_01_06_425657	6	28	E3	E3	NNP
10_1101-2021_01_06_425657	6	29	ligase	ligase	JJ
10_1101-2021_01_06_425657	6	30	-	-	HYPH
10_1101-2021_01_06_425657	6	31	substrate	substrate	NN
10_1101-2021_01_06_425657	6	32	relationships	relationship	NNS
10_1101-2021_01_06_425657	6	33	.	.	.
10_1101-2021_01_06_425657	7	1	25	25	CD
10_1101-2021_01_06_425657	7	2	26	26	CD
10_1101-2021_01_06_425657	7	3	INTRODUCTION	introduction	NN
10_1101-2021_01_06_425657	7	4	27	27	CD
10_1101-2021_01_06_425657	7	5	28	28	CD
10_1101-2021_01_06_425657	7	6	The	the	DT
10_1101-2021_01_06_425657	7	7	biosynthesis	biosynthesis	NN
10_1101-2021_01_06_425657	7	8	of	of	IN
10_1101-2021_01_06_425657	7	9	sulfur	sulfur	NN
10_1101-2021_01_06_425657	7	10	-	-	HYPH
10_1101-2021_01_06_425657	7	11	containing	contain	VBG
10_1101-2021_01_06_425657	7	12	amino	amino	JJ
10_1101-2021_01_06_425657	7	13	acids	acid	NNS
10_1101-2021_01_06_425657	7	14	supplies	supply	VBZ
10_1101-2021_01_06_425657	7	15	cells	cell	NNS
10_1101-2021_01_06_425657	7	16	with	with	IN
10_1101-2021_01_06_425657	7	17	increased	increase	VBN
10_1101-2021_01_06_425657	7	18	levels	level	NNS
10_1101-2021_01_06_425657	7	19	of	of	IN
10_1101-2021_01_06_425657	7	20	cysteine	cysteine	NN
10_1101-2021_01_06_425657	7	21	29	29	CD
10_1101-2021_01_06_425657	7	22	and	and	CC
10_1101-2021_01_06_425657	7	23	methionine	methionine	NNP
10_1101-2021_01_06_425657	7	24	,	,	,
10_1101-2021_01_06_425657	7	25	as	as	RB
10_1101-2021_01_06_425657	7	26	well	well	RB
10_1101-2021_01_06_425657	7	27	as	as	IN
10_1101-2021_01_06_425657	7	28	their	-PRON-	PRP$
10_1101-2021_01_06_425657	7	29	downstream	downstream	JJ
10_1101-2021_01_06_425657	7	30	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	7	31	glutathione	glutathione	NN
10_1101-2021_01_06_425657	7	32	and	and	CC
10_1101-2021_01_06_425657	7	33	S	S	NNP
10_1101-2021_01_06_425657	7	34	-	-	HYPH
10_1101-2021_01_06_425657	7	35	adenosylmethionine	adenosylmethionine	NNP
10_1101-2021_01_06_425657	7	36	30	30	CD
10_1101-2021_01_06_425657	7	37	(	(	-LRB-
10_1101-2021_01_06_425657	7	38	SAM	SAM	NNP
10_1101-2021_01_06_425657	7	39	)	)	-RRB-
10_1101-2021_01_06_425657	7	40	.	.	.
10_1101-2021_01_06_425657	8	1	Glutathione	glutathione	NN
10_1101-2021_01_06_425657	8	2	serves	serve	VBZ
10_1101-2021_01_06_425657	8	3	as	as	IN
10_1101-2021_01_06_425657	8	4	a	a	DT
10_1101-2021_01_06_425657	8	5	redox	redox	JJ
10_1101-2021_01_06_425657	8	6	buffer	buffer	NN
10_1101-2021_01_06_425657	8	7	to	to	TO
10_1101-2021_01_06_425657	8	8	maintain	maintain	VB
10_1101-2021_01_06_425657	8	9	the	the	DT
10_1101-2021_01_06_425657	8	10	reducing	reduce	VBG
10_1101-2021_01_06_425657	8	11	environment	environment	NN
10_1101-2021_01_06_425657	8	12	of	of	IN
10_1101-2021_01_06_425657	8	13	the	the	DT
10_1101-2021_01_06_425657	8	14	cell	cell	NN
10_1101-2021_01_06_425657	8	15	and	and	CC
10_1101-2021_01_06_425657	8	16	31	31	CD
10_1101-2021_01_06_425657	8	17	provide	provide	VBP
10_1101-2021_01_06_425657	8	18	protection	protection	NN
10_1101-2021_01_06_425657	8	19	against	against	IN
10_1101-2021_01_06_425657	8	20	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	8	21	stress	stress	NN
10_1101-2021_01_06_425657	8	22	,	,	,
10_1101-2021_01_06_425657	8	23	while	while	IN
10_1101-2021_01_06_425657	8	24	SAM	SAM	NNP
10_1101-2021_01_06_425657	8	25	serves	serve	VBZ
10_1101-2021_01_06_425657	8	26	as	as	IN
10_1101-2021_01_06_425657	8	27	the	the	DT
10_1101-2021_01_06_425657	8	28	methyl	methyl	NN
10_1101-2021_01_06_425657	8	29	donor	donor	NN
10_1101-2021_01_06_425657	8	30	for	for	IN
10_1101-2021_01_06_425657	8	31	nearly	nearly	RB
10_1101-2021_01_06_425657	8	32	all	all	DT
10_1101-2021_01_06_425657	8	33	32	32	CD
10_1101-2021_01_06_425657	8	34	methyltransferase	methyltransferase	NN
10_1101-2021_01_06_425657	8	35	enzymes	enzyme	NNS
10_1101-2021_01_06_425657	8	36	(	(	-LRB-
10_1101-2021_01_06_425657	8	37	Ljungdahl	Ljungdahl	NNP
10_1101-2021_01_06_425657	8	38	and	and	CC
10_1101-2021_01_06_425657	8	39	Daignan	Daignan	NNP
10_1101-2021_01_06_425657	8	40	-	-	HYPH
10_1101-2021_01_06_425657	8	41	Fornier	Fornier	NNP
10_1101-2021_01_06_425657	8	42	,	,	,
10_1101-2021_01_06_425657	8	43	2012	2012	CD
10_1101-2021_01_06_425657	8	44	,	,	,
10_1101-2021_01_06_425657	8	45	Cantoni	Cantoni	NNP
10_1101-2021_01_06_425657	8	46	,	,	,
10_1101-2021_01_06_425657	8	47	1975	1975	CD
10_1101-2021_01_06_425657	8	48	)	)	-RRB-
10_1101-2021_01_06_425657	8	49	.	.	.
10_1101-2021_01_06_425657	9	1	In	in	IN
10_1101-2021_01_06_425657	9	2	the	the	DT
10_1101-2021_01_06_425657	9	3	yeast	yeast	NN
10_1101-2021_01_06_425657	9	4	33	33	CD
10_1101-2021_01_06_425657	9	5	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_06_425657	9	6	cerevisiae	cerevisiae	NNS
10_1101-2021_01_06_425657	9	7	,	,	,
10_1101-2021_01_06_425657	9	8	biosynthesis	biosynthesis	NN
10_1101-2021_01_06_425657	9	9	of	of	IN
10_1101-2021_01_06_425657	9	10	all	all	DT
10_1101-2021_01_06_425657	9	11	sulfur	sulfur	NN
10_1101-2021_01_06_425657	9	12	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	9	13	can	can	MD
10_1101-2021_01_06_425657	9	14	be	be	VB
10_1101-2021_01_06_425657	9	15	performed	perform	VBN
10_1101-2021_01_06_425657	9	16	de	de	IN
10_1101-2021_01_06_425657	9	17	novo	novo	NNP
10_1101-2021_01_06_425657	9	18	via	via	IN
10_1101-2021_01_06_425657	9	19	34	34	CD
10_1101-2021_01_06_425657	9	20	enzymes	enzyme	NNS
10_1101-2021_01_06_425657	9	21	encoded	encode	VBN
10_1101-2021_01_06_425657	9	22	in	in	IN
10_1101-2021_01_06_425657	9	23	the	the	DT
10_1101-2021_01_06_425657	9	24	gene	gene	NN
10_1101-2021_01_06_425657	9	25	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	9	26	network	network	NN
10_1101-2021_01_06_425657	9	27	known	know	VBN
10_1101-2021_01_06_425657	9	28	as	as	IN
10_1101-2021_01_06_425657	9	29	the	the	DT
10_1101-2021_01_06_425657	9	30	MET	MET	NNP
10_1101-2021_01_06_425657	9	31	regulon	regulon	NN
10_1101-2021_01_06_425657	9	32	.	.	.
10_1101-2021_01_06_425657	10	1	Activation	activation	NN
10_1101-2021_01_06_425657	10	2	of	of	IN
10_1101-2021_01_06_425657	10	3	35	35	CD
10_1101-2021_01_06_425657	10	4	the	the	DT
10_1101-2021_01_06_425657	10	5	MET	MET	NNP
10_1101-2021_01_06_425657	10	6	gene	gene	NN
10_1101-2021_01_06_425657	10	7	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	10	8	program	program	NN
10_1101-2021_01_06_425657	10	9	under	under	IN
10_1101-2021_01_06_425657	10	10	conditions	condition	NNS
10_1101-2021_01_06_425657	10	11	of	of	IN
10_1101-2021_01_06_425657	10	12	sulfur	sulfur	NN
10_1101-2021_01_06_425657	10	13	starvation	starvation	NN
10_1101-2021_01_06_425657	10	14	relies	rely	VBZ
10_1101-2021_01_06_425657	10	15	on	on	IN
10_1101-2021_01_06_425657	10	16	the	the	DT
10_1101-2021_01_06_425657	10	17	36	36	CD
10_1101-2021_01_06_425657	10	18	transcription	transcription	NN
10_1101-2021_01_06_425657	10	19	factor	factor	NN
10_1101-2021_01_06_425657	10	20	Met4	Met4	NNP
10_1101-2021_01_06_425657	10	21	and	and	CC
10_1101-2021_01_06_425657	10	22	additional	additional	JJ
10_1101-2021_01_06_425657	10	23	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	10	24	co	co	NNS
10_1101-2021_01_06_425657	10	25	-	-	NNS
10_1101-2021_01_06_425657	10	26	activators	activator	NNS
10_1101-2021_01_06_425657	10	27	that	that	WDT
10_1101-2021_01_06_425657	10	28	allow	allow	VBP
10_1101-2021_01_06_425657	10	29	Met4	Met4	NNP
10_1101-2021_01_06_425657	10	30	to	to	TO
10_1101-2021_01_06_425657	10	31	be	be	VB
10_1101-2021_01_06_425657	10	32	37	37	CD
10_1101-2021_01_06_425657	10	33	recruited	recruit	VBN
10_1101-2021_01_06_425657	10	34	to	to	IN
10_1101-2021_01_06_425657	10	35	the	the	DT
10_1101-2021_01_06_425657	10	36	MET	MET	NNP
10_1101-2021_01_06_425657	10	37	genes	gene	NNS
10_1101-2021_01_06_425657	10	38	(	(	-LRB-
10_1101-2021_01_06_425657	10	39	Kuras	Kuras	NNP
10_1101-2021_01_06_425657	10	40	et	et	NNP
10_1101-2021_01_06_425657	10	41	al	al	NNP
10_1101-2021_01_06_425657	10	42	.	.	NNP
10_1101-2021_01_06_425657	10	43	,	,	,
10_1101-2021_01_06_425657	10	44	1996	1996	CD
10_1101-2021_01_06_425657	10	45	,	,	,
10_1101-2021_01_06_425657	10	46	Blaiseau	Blaiseau	NNP
10_1101-2021_01_06_425657	10	47	and	and	CC
10_1101-2021_01_06_425657	10	48	Thomas	Thomas	NNP
10_1101-2021_01_06_425657	10	49	,	,	,
10_1101-2021_01_06_425657	10	50	1998	1998	CD
10_1101-2021_01_06_425657	10	51	)	)	-RRB-
10_1101-2021_01_06_425657	10	52	.	.	.
10_1101-2021_01_06_425657	11	1	38	38	CD
10_1101-2021_01_06_425657	11	2	39	39	CD
10_1101-2021_01_06_425657	11	3	When	when	WRB
10_1101-2021_01_06_425657	11	4	yeast	yeast	NN
10_1101-2021_01_06_425657	11	5	cells	cell	NNS
10_1101-2021_01_06_425657	11	6	sense	sense	VBP
10_1101-2021_01_06_425657	11	7	sufficiently	sufficiently	RB
10_1101-2021_01_06_425657	11	8	high	high	JJ
10_1101-2021_01_06_425657	11	9	levels	level	NNS
10_1101-2021_01_06_425657	11	10	of	of	IN
10_1101-2021_01_06_425657	11	11	sulfur	sulfur	NN
10_1101-2021_01_06_425657	11	12	in	in	IN
10_1101-2021_01_06_425657	11	13	the	the	DT
10_1101-2021_01_06_425657	11	14	environment	environment	NN
10_1101-2021_01_06_425657	11	15	,	,	,
10_1101-2021_01_06_425657	11	16	the	the	DT
10_1101-2021_01_06_425657	11	17	MET	MET	NNP
10_1101-2021_01_06_425657	11	18	gene	gene	NN
10_1101-2021_01_06_425657	11	19	40	40	CD
10_1101-2021_01_06_425657	11	20	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	11	21	program	program	NN
10_1101-2021_01_06_425657	11	22	is	be	VBZ
10_1101-2021_01_06_425657	11	23	negatively	negatively	RB
10_1101-2021_01_06_425657	11	24	regulated	regulate	VBN
10_1101-2021_01_06_425657	11	25	by	by	IN
10_1101-2021_01_06_425657	11	26	the	the	DT
10_1101-2021_01_06_425657	11	27	activity	activity	NN
10_1101-2021_01_06_425657	11	28	of	of	IN
10_1101-2021_01_06_425657	11	29	the	the	DT
10_1101-2021_01_06_425657	11	30	SCF	scf	NN
10_1101-2021_01_06_425657	11	31	E3	e3	NN
10_1101-2021_01_06_425657	11	32	ligase	ligase	NN
10_1101-2021_01_06_425657	11	33	Met30	Met30	NNP
10_1101-2021_01_06_425657	11	34	41	41	CD
10_1101-2021_01_06_425657	11	35	(	(	-LRB-
10_1101-2021_01_06_425657	11	36	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	11	37	)	)	-RRB-
10_1101-2021_01_06_425657	11	38	through	through	IN
10_1101-2021_01_06_425657	11	39	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	11	40	of	of	IN
10_1101-2021_01_06_425657	11	41	the	the	DT
10_1101-2021_01_06_425657	11	42	master	master	NN
10_1101-2021_01_06_425657	11	43	transcription	transcription	NN
10_1101-2021_01_06_425657	11	44	factor	factor	NN
10_1101-2021_01_06_425657	11	45	Met4	Met4	NNP
10_1101-2021_01_06_425657	11	46	(	(	-LRB-
10_1101-2021_01_06_425657	11	47	Kaiser	Kaiser	NNP
10_1101-2021_01_06_425657	11	48	et	et	FW
10_1101-2021_01_06_425657	11	49	al	al	NNP
10_1101-2021_01_06_425657	11	50	.	.	NNP
10_1101-2021_01_06_425657	11	51	,	,	,
10_1101-2021_01_06_425657	11	52	2000	2000	CD
10_1101-2021_01_06_425657	11	53	)	)	-RRB-
10_1101-2021_01_06_425657	11	54	.	.	.
10_1101-2021_01_06_425657	12	1	42	42	CD
10_1101-2021_01_06_425657	12	2	Met4	met4	JJ
10_1101-2021_01_06_425657	12	3	is	be	VBZ
10_1101-2021_01_06_425657	12	4	unique	unique	JJ
10_1101-2021_01_06_425657	12	5	as	as	IN
10_1101-2021_01_06_425657	12	6	an	an	DT
10_1101-2021_01_06_425657	12	7	E3	E3	NNP
10_1101-2021_01_06_425657	12	8	ligase	ligase	NN
10_1101-2021_01_06_425657	12	9	substrate	substrate	VB
10_1101-2021_01_06_425657	12	10	as	as	IN
10_1101-2021_01_06_425657	12	11	it	-PRON-	PRP
10_1101-2021_01_06_425657	12	12	contains	contain	VBZ
10_1101-2021_01_06_425657	12	13	an	an	DT
10_1101-2021_01_06_425657	12	14	internal	internal	JJ
10_1101-2021_01_06_425657	12	15	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	12	16	interacting	interact	VBG
10_1101-2021_01_06_425657	12	17	motif	motif	NN
10_1101-2021_01_06_425657	12	18	(	(	-LRB-
10_1101-2021_01_06_425657	12	19	UIM	UIM	NNP
10_1101-2021_01_06_425657	12	20	)	)	-RRB-
10_1101-2021_01_06_425657	12	21	43	43	CD
10_1101-2021_01_06_425657	12	22	which	which	WDT
10_1101-2021_01_06_425657	12	23	folds	fold	VBZ
10_1101-2021_01_06_425657	12	24	in	in	IN
10_1101-2021_01_06_425657	12	25	and	and	CC
10_1101-2021_01_06_425657	12	26	caps	cap	VBZ
10_1101-2021_01_06_425657	12	27	the	the	DT
10_1101-2021_01_06_425657	12	28	growing	grow	VBG
10_1101-2021_01_06_425657	12	29	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	12	30	chain	chain	NN
10_1101-2021_01_06_425657	12	31	generated	generate	VBN
10_1101-2021_01_06_425657	12	32	by	by	IN
10_1101-2021_01_06_425657	12	33	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	12	34	,	,	,
10_1101-2021_01_06_425657	12	35	resulting	result	VBG
10_1101-2021_01_06_425657	12	36	in	in	IN
10_1101-2021_01_06_425657	12	37	a	a	DT
10_1101-2021_01_06_425657	12	38	44	44	CD
10_1101-2021_01_06_425657	12	39	proteolytically	proteolytically	RB
10_1101-2021_01_06_425657	12	40	stable	stable	JJ
10_1101-2021_01_06_425657	12	41	but	but	CC
10_1101-2021_01_06_425657	12	42	transcriptionally	transcriptionally	RB
10_1101-2021_01_06_425657	12	43	inactive	inactive	JJ
10_1101-2021_01_06_425657	12	44	oligo	oligo	NNP
10_1101-2021_01_06_425657	12	45	-	-	HYPH
10_1101-2021_01_06_425657	12	46	ubiquitinated	ubiquitinated	JJ
10_1101-2021_01_06_425657	12	47	state	state	NN
10_1101-2021_01_06_425657	12	48	(	(	-LRB-
10_1101-2021_01_06_425657	12	49	Flick	Flick	NNP
10_1101-2021_01_06_425657	12	50	et	et	NNP
10_1101-2021_01_06_425657	12	51	al	al	NNP
10_1101-2021_01_06_425657	12	52	.	.	NNP
10_1101-2021_01_06_425657	12	53	,	,	,
10_1101-2021_01_06_425657	12	54	2006	2006	CD
10_1101-2021_01_06_425657	12	55	)	)	-RRB-
10_1101-2021_01_06_425657	12	56	.	.	.
10_1101-2021_01_06_425657	13	1	45	45	CD
10_1101-2021_01_06_425657	13	2	Upon	upon	IN
10_1101-2021_01_06_425657	13	3	sulfur	sulfur	NN
10_1101-2021_01_06_425657	13	4	starvation	starvation	NN
10_1101-2021_01_06_425657	13	5	,	,	,
10_1101-2021_01_06_425657	13	6	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	13	7	ceases	cease	VBZ
10_1101-2021_01_06_425657	13	8	to	to	TO
10_1101-2021_01_06_425657	13	9	ubiquitinate	ubiquitinate	VB
10_1101-2021_01_06_425657	13	10	Met4	Met4	NNP
10_1101-2021_01_06_425657	13	11	,	,	,
10_1101-2021_01_06_425657	13	12	allowing	allow	VBG
10_1101-2021_01_06_425657	13	13	Met4	Met4	NNP
10_1101-2021_01_06_425657	13	14	to	to	TO
10_1101-2021_01_06_425657	13	15	become	become	VB
10_1101-2021_01_06_425657	13	16	46	46	CD
10_1101-2021_01_06_425657	13	17	deubiquitinated	deubiquitinate	VBD
10_1101-2021_01_06_425657	13	18	and	and	CC
10_1101-2021_01_06_425657	13	19	transcriptionally	transcriptionally	RB
10_1101-2021_01_06_425657	13	20	active	active	JJ
10_1101-2021_01_06_425657	13	21	.	.	.
10_1101-2021_01_06_425657	14	1	47	47	CD
10_1101-2021_01_06_425657	14	2	48	48	CD
10_1101-2021_01_06_425657	14	3	Since	since	IN
10_1101-2021_01_06_425657	14	4	its	-PRON-	PRP$
10_1101-2021_01_06_425657	14	5	discovery	discovery	NN
10_1101-2021_01_06_425657	14	6	,	,	,
10_1101-2021_01_06_425657	14	7	much	much	JJ
10_1101-2021_01_06_425657	14	8	effort	effort	NN
10_1101-2021_01_06_425657	14	9	has	have	VBZ
10_1101-2021_01_06_425657	14	10	gone	go	VBN
10_1101-2021_01_06_425657	14	11	into	into	IN
10_1101-2021_01_06_425657	14	12	understanding	understand	VBG
10_1101-2021_01_06_425657	14	13	how	how	WRB
10_1101-2021_01_06_425657	14	14	Met30	Met30	NNP
10_1101-2021_01_06_425657	14	15	senses	sense	VBZ
10_1101-2021_01_06_425657	14	16	the	the	DT
10_1101-2021_01_06_425657	14	17	sulfur	sulfur	NN
10_1101-2021_01_06_425657	14	18	status	status	NN
10_1101-2021_01_06_425657	14	19	49	49	CD
10_1101-2021_01_06_425657	14	20	of	of	IN
10_1101-2021_01_06_425657	14	21	the	the	DT
10_1101-2021_01_06_425657	14	22	cell	cell	NN
10_1101-2021_01_06_425657	14	23	.	.	.
10_1101-2021_01_06_425657	15	1	Several	several	JJ
10_1101-2021_01_06_425657	15	2	mechanisms	mechanism	NNS
10_1101-2021_01_06_425657	15	3	have	have	VBP
10_1101-2021_01_06_425657	15	4	been	be	VBN
10_1101-2021_01_06_425657	15	5	attributed	attribute	VBN
10_1101-2021_01_06_425657	15	6	to	to	IN
10_1101-2021_01_06_425657	15	7	Met30	Met30	NNP
10_1101-2021_01_06_425657	15	8	to	to	TO
10_1101-2021_01_06_425657	15	9	describe	describe	VB
10_1101-2021_01_06_425657	15	10	how	how	WRB
10_1101-2021_01_06_425657	15	11	Met4	met4	JJ
10_1101-2021_01_06_425657	15	12	and	and	CC
10_1101-2021_01_06_425657	15	13	itself	-PRON-	PRP
10_1101-2021_01_06_425657	15	14	50	50	CD
10_1101-2021_01_06_425657	15	15	work	work	NN
10_1101-2021_01_06_425657	15	16	together	together	RB
10_1101-2021_01_06_425657	15	17	to	to	TO
10_1101-2021_01_06_425657	15	18	regulate	regulate	VB
10_1101-2021_01_06_425657	15	19	levels	level	NNS
10_1101-2021_01_06_425657	15	20	of	of	IN
10_1101-2021_01_06_425657	15	21	MET	MET	NNP
10_1101-2021_01_06_425657	15	22	gene	gene	NN
10_1101-2021_01_06_425657	15	23	transcripts	transcript	NNS
10_1101-2021_01_06_425657	15	24	in	in	IN
10_1101-2021_01_06_425657	15	25	response	response	NN
10_1101-2021_01_06_425657	15	26	to	to	IN
10_1101-2021_01_06_425657	15	27	the	the	DT
10_1101-2021_01_06_425657	15	28	availability	availability	NN
10_1101-2021_01_06_425657	15	29	of	of	IN
10_1101-2021_01_06_425657	15	30	sulfur	sulfur	NN
10_1101-2021_01_06_425657	15	31	or	or	CC
10_1101-2021_01_06_425657	15	32	51	51	CD
10_1101-2021_01_06_425657	15	33	the	the	DT
10_1101-2021_01_06_425657	15	34	presence	presence	NN
10_1101-2021_01_06_425657	15	35	of	of	IN
10_1101-2021_01_06_425657	15	36	toxic	toxic	JJ
10_1101-2021_01_06_425657	15	37	heavy	heavy	JJ
10_1101-2021_01_06_425657	15	38	metals	metal	NNS
10_1101-2021_01_06_425657	15	39	(	(	-LRB-
10_1101-2021_01_06_425657	15	40	Thomas	Thomas	NNP
10_1101-2021_01_06_425657	15	41	et	et	FW
10_1101-2021_01_06_425657	15	42	al	al	NNP
10_1101-2021_01_06_425657	15	43	.	.	NNP
10_1101-2021_01_06_425657	15	44	,	,	,
10_1101-2021_01_06_425657	15	45	1995	1995	CD
10_1101-2021_01_06_425657	15	46	)	)	-RRB-
10_1101-2021_01_06_425657	15	47	.	.	.
10_1101-2021_01_06_425657	16	1	After	after	IN
10_1101-2021_01_06_425657	16	2	the	the	DT
10_1101-2021_01_06_425657	16	3	discovery	discovery	NN
10_1101-2021_01_06_425657	16	4	that	that	IN
10_1101-2021_01_06_425657	16	5	Met30	Met30	NNP
10_1101-2021_01_06_425657	16	6	is	be	VBZ
10_1101-2021_01_06_425657	16	7	an	an	DT
10_1101-2021_01_06_425657	16	8	E3	e3	$
10_1101-2021_01_06_425657	16	9	52	52	CD
10_1101-2021_01_06_425657	16	10	.CC	.cc	CD
10_1101-2021_01_06_425657	16	11	-	-	:
10_1101-2021_01_06_425657	16	12	BY	by	IN
10_1101-2021_01_06_425657	16	13	4.0	4.0	CD
10_1101-2021_01_06_425657	16	14	International	International	NNP
10_1101-2021_01_06_425657	16	15	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	16	16	under	under	IN
10_1101-2021_01_06_425657	16	17	a	a	DT
10_1101-2021_01_06_425657	16	18	(	(	-LRB-
10_1101-2021_01_06_425657	16	19	which	which	WDT
10_1101-2021_01_06_425657	16	20	was	be	VBD
10_1101-2021_01_06_425657	16	21	not	not	RB
10_1101-2021_01_06_425657	16	22	certified	certify	VBN
10_1101-2021_01_06_425657	16	23	by	by	IN
10_1101-2021_01_06_425657	16	24	peer	peer	NN
10_1101-2021_01_06_425657	16	25	review	review	NN
10_1101-2021_01_06_425657	16	26	)	)	-RRB-
10_1101-2021_01_06_425657	16	27	is	be	VBZ
10_1101-2021_01_06_425657	16	28	the	the	DT
10_1101-2021_01_06_425657	16	29	author	author	NN
10_1101-2021_01_06_425657	16	30	/	/	SYM
10_1101-2021_01_06_425657	16	31	funder	funder	NN
10_1101-2021_01_06_425657	16	32	,	,	,
10_1101-2021_01_06_425657	16	33	who	who	WP
10_1101-2021_01_06_425657	16	34	has	have	VBZ
10_1101-2021_01_06_425657	16	35	granted	grant	VBN
10_1101-2021_01_06_425657	16	36	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	16	37	a	a	DT
10_1101-2021_01_06_425657	16	38	license	license	NN
10_1101-2021_01_06_425657	16	39	to	to	TO
10_1101-2021_01_06_425657	16	40	display	display	VB
10_1101-2021_01_06_425657	16	41	the	the	DT
10_1101-2021_01_06_425657	16	42	preprint	preprint	NN
10_1101-2021_01_06_425657	16	43	in	in	IN
10_1101-2021_01_06_425657	16	44	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	16	45	.	.	.
10_1101-2021_01_06_425657	17	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	17	2	is	be	VBZ
10_1101-2021_01_06_425657	17	3	made	make	VBN
10_1101-2021_01_06_425657	17	4	The	the	DT
10_1101-2021_01_06_425657	17	5	copyright	copyright	NN
10_1101-2021_01_06_425657	17	6	holder	holder	NN
10_1101-2021_01_06_425657	17	7	for	for	IN
10_1101-2021_01_06_425657	17	8	this	this	DT
10_1101-2021_01_06_425657	17	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	17	10	version	version	NN
10_1101-2021_01_06_425657	17	11	posted	post	VBD
10_1101-2021_01_06_425657	17	12	January	January	NNP
10_1101-2021_01_06_425657	17	13	7	7	CD
10_1101-2021_01_06_425657	17	14	,	,	,
10_1101-2021_01_06_425657	17	15	2021	2021	CD
10_1101-2021_01_06_425657	17	16	.	.	.
10_1101-2021_01_06_425657	17	17	;	;	:
10_1101-2021_01_06_425657	17	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	17	19	:	:	:
10_1101-2021_01_06_425657	17	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	17	21	preprint	preprint	NN
10_1101-2021_01_06_425657	17	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	17	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	17	24	3	3	CD
10_1101-2021_01_06_425657	17	25	ligase	ligase	NN
10_1101-2021_01_06_425657	17	26	that	that	WDT
10_1101-2021_01_06_425657	17	27	negatively	negatively	RB
10_1101-2021_01_06_425657	17	28	regulates	regulate	VBZ
10_1101-2021_01_06_425657	17	29	Met4	Met4	NNP
10_1101-2021_01_06_425657	17	30	through	through	IN
10_1101-2021_01_06_425657	17	31	ubiquitin	ubiquitin	NN
10_1101-2021_01_06_425657	17	32	-	-	HYPH
10_1101-2021_01_06_425657	17	33	dependent	dependent	JJ
10_1101-2021_01_06_425657	17	34	and	and	CC
10_1101-2021_01_06_425657	17	35	both	both	CC
10_1101-2021_01_06_425657	17	36	proteolysis	proteolysis	NN
10_1101-2021_01_06_425657	17	37	-	-	HYPH
10_1101-2021_01_06_425657	17	38	dependent	dependent	JJ
10_1101-2021_01_06_425657	17	39	53	53	CD
10_1101-2021_01_06_425657	17	40	and	and	CC
10_1101-2021_01_06_425657	17	41	independent	independent	JJ
10_1101-2021_01_06_425657	17	42	mechanisms	mechanism	NNS
10_1101-2021_01_06_425657	17	43	(	(	-LRB-
10_1101-2021_01_06_425657	17	44	Rouillon	Rouillon	NNP
10_1101-2021_01_06_425657	17	45	et	et	NNP
10_1101-2021_01_06_425657	17	46	al	al	NNP
10_1101-2021_01_06_425657	17	47	.	.	NNP
10_1101-2021_01_06_425657	17	48	,	,	,
10_1101-2021_01_06_425657	17	49	2000	2000	CD
10_1101-2021_01_06_425657	17	50	,	,	,
10_1101-2021_01_06_425657	17	51	Flick	Flick	NNP
10_1101-2021_01_06_425657	17	52	et	et	NNP
10_1101-2021_01_06_425657	17	53	al	al	NNP
10_1101-2021_01_06_425657	17	54	.	.	NNP
10_1101-2021_01_06_425657	17	55	,	,	,
10_1101-2021_01_06_425657	17	56	2004	2004	CD
10_1101-2021_01_06_425657	17	57	,	,	,
10_1101-2021_01_06_425657	17	58	Kuras	Kuras	NNP
10_1101-2021_01_06_425657	17	59	et	et	NNP
10_1101-2021_01_06_425657	17	60	al	al	NNP
10_1101-2021_01_06_425657	17	61	.	.	NNP
10_1101-2021_01_06_425657	17	62	,	,	,
10_1101-2021_01_06_425657	17	63	2002	2002	CD
10_1101-2021_01_06_425657	17	64	)	)	-RRB-
10_1101-2021_01_06_425657	17	65	,	,	,
10_1101-2021_01_06_425657	17	66	it	-PRON-	PRP
10_1101-2021_01_06_425657	17	67	was	be	VBD
10_1101-2021_01_06_425657	17	68	54	54	CD
10_1101-2021_01_06_425657	17	69	found	find	VBD
10_1101-2021_01_06_425657	17	70	that	that	IN
10_1101-2021_01_06_425657	17	71	Met30	Met30	NNP
10_1101-2021_01_06_425657	17	72	dissociates	dissociate	NNS
10_1101-2021_01_06_425657	17	73	from	from	IN
10_1101-2021_01_06_425657	17	74	SCF	scf	NN
10_1101-2021_01_06_425657	17	75	complexes	complex	NNS
10_1101-2021_01_06_425657	17	76	upon	upon	IN
10_1101-2021_01_06_425657	17	77	cadmium	cadmium	NN
10_1101-2021_01_06_425657	17	78	addition	addition	NN
10_1101-2021_01_06_425657	17	79	,	,	,
10_1101-2021_01_06_425657	17	80	resulting	result	VBG
10_1101-2021_01_06_425657	17	81	in	in	IN
10_1101-2021_01_06_425657	17	82	the	the	DT
10_1101-2021_01_06_425657	17	83	55	55	CD
10_1101-2021_01_06_425657	17	84	disruption	disruption	NN
10_1101-2021_01_06_425657	17	85	of	of	IN
10_1101-2021_01_06_425657	17	86	the	the	DT
10_1101-2021_01_06_425657	17	87	aforementioned	aforementioned	JJ
10_1101-2021_01_06_425657	17	88	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	17	89	-	-	HYPH
10_1101-2021_01_06_425657	17	90	dependent	dependent	JJ
10_1101-2021_01_06_425657	17	91	regulatory	regulatory	JJ
10_1101-2021_01_06_425657	17	92	mechanisms	mechanism	NNS
10_1101-2021_01_06_425657	17	93	(	(	-LRB-
10_1101-2021_01_06_425657	17	94	Barbey	Barbey	NNP
10_1101-2021_01_06_425657	17	95	et	et	NNP
10_1101-2021_01_06_425657	17	96	al	al	NNP
10_1101-2021_01_06_425657	17	97	.	.	NNP
10_1101-2021_01_06_425657	17	98	,	,	,
10_1101-2021_01_06_425657	17	99	56	56	CD
10_1101-2021_01_06_425657	17	100	2005	2005	CD
10_1101-2021_01_06_425657	17	101	)	)	-RRB-
10_1101-2021_01_06_425657	17	102	.	.	.
10_1101-2021_01_06_425657	18	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	18	2	was	be	VBD
10_1101-2021_01_06_425657	18	3	later	later	RB
10_1101-2021_01_06_425657	18	4	reported	report	VBN
10_1101-2021_01_06_425657	18	5	that	that	IN
10_1101-2021_01_06_425657	18	6	this	this	DT
10_1101-2021_01_06_425657	18	7	cadmium	cadmium	NN
10_1101-2021_01_06_425657	18	8	-	-	HYPH
10_1101-2021_01_06_425657	18	9	specific	specific	JJ
10_1101-2021_01_06_425657	18	10	dissociation	dissociation	NN
10_1101-2021_01_06_425657	18	11	of	of	IN
10_1101-2021_01_06_425657	18	12	Met30	Met30	NNP
10_1101-2021_01_06_425657	18	13	from	from	IN
10_1101-2021_01_06_425657	18	14	SCF	scf	NN
10_1101-2021_01_06_425657	18	15	complexes	complex	NNS
10_1101-2021_01_06_425657	18	16	57	57	CD
10_1101-2021_01_06_425657	18	17	is	be	VBZ
10_1101-2021_01_06_425657	18	18	mediated	mediate	VBN
10_1101-2021_01_06_425657	18	19	by	by	IN
10_1101-2021_01_06_425657	18	20	the	the	DT
10_1101-2021_01_06_425657	18	21	Cdc48	Cdc48	NNP
10_1101-2021_01_06_425657	18	22	/	/	SYM
10_1101-2021_01_06_425657	18	23	p97	p97	NN
10_1101-2021_01_06_425657	18	24	AAA+	AAA+	NNP
10_1101-2021_01_06_425657	18	25	ATPase	ATPase	NNP
10_1101-2021_01_06_425657	18	26	complex	complex	NN
10_1101-2021_01_06_425657	18	27	,	,	,
10_1101-2021_01_06_425657	18	28	and	and	CC
10_1101-2021_01_06_425657	18	29	that	that	IN
10_1101-2021_01_06_425657	18	30	Met30	Met30	NNP
10_1101-2021_01_06_425657	18	31	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	18	32	is	be	VBZ
10_1101-2021_01_06_425657	18	33	required	require	VBN
10_1101-2021_01_06_425657	18	34	58	58	CD
10_1101-2021_01_06_425657	18	35	for	for	IN
10_1101-2021_01_06_425657	18	36	Cdc48	Cdc48	NNP
10_1101-2021_01_06_425657	18	37	to	to	TO
10_1101-2021_01_06_425657	18	38	strip	strip	VB
10_1101-2021_01_06_425657	18	39	Met30	Met30	NNP
10_1101-2021_01_06_425657	18	40	from	from	IN
10_1101-2021_01_06_425657	18	41	these	these	DT
10_1101-2021_01_06_425657	18	42	complexes	complex	NNS
10_1101-2021_01_06_425657	18	43	(	(	-LRB-
10_1101-2021_01_06_425657	18	44	Yen	Yen	NNP
10_1101-2021_01_06_425657	18	45	et	et	FW
10_1101-2021_01_06_425657	18	46	al	al	NNP
10_1101-2021_01_06_425657	18	47	.	.	NNP
10_1101-2021_01_06_425657	18	48	,	,	,
10_1101-2021_01_06_425657	18	49	2012	2012	CD
10_1101-2021_01_06_425657	18	50	)	)	-RRB-
10_1101-2021_01_06_425657	18	51	.	.	.
10_1101-2021_01_06_425657	19	1	In	in	IN
10_1101-2021_01_06_425657	19	2	parallel	parallel	NN
10_1101-2021_01_06_425657	19	3	,	,	,
10_1101-2021_01_06_425657	19	4	attempts	attempt	VBZ
10_1101-2021_01_06_425657	19	5	to	to	TO
10_1101-2021_01_06_425657	19	6	identify	identify	VB
10_1101-2021_01_06_425657	19	7	59	59	CD
10_1101-2021_01_06_425657	19	8	the	the	DT
10_1101-2021_01_06_425657	19	9	sulfur	sulfur	NN
10_1101-2021_01_06_425657	19	10	metabolic	metabolic	JJ
10_1101-2021_01_06_425657	19	11	cue	cue	NN
10_1101-2021_01_06_425657	19	12	sensed	sense	VBN
10_1101-2021_01_06_425657	19	13	by	by	IN
10_1101-2021_01_06_425657	19	14	Met30	Met30	NNP
10_1101-2021_01_06_425657	19	15	suggested	suggest	VBD
10_1101-2021_01_06_425657	19	16	that	that	DT
10_1101-2021_01_06_425657	19	17	cysteine	cysteine	NN
10_1101-2021_01_06_425657	19	18	,	,	,
10_1101-2021_01_06_425657	19	19	or	or	CC
10_1101-2021_01_06_425657	19	20	possibly	possibly	RB
10_1101-2021_01_06_425657	19	21	some	some	DT
10_1101-2021_01_06_425657	19	22	downstream	downstream	JJ
10_1101-2021_01_06_425657	19	23	60	60	CD
10_1101-2021_01_06_425657	19	24	metabolite	metabolite	NN
10_1101-2021_01_06_425657	19	25	,	,	,
10_1101-2021_01_06_425657	19	26	was	be	VBD
10_1101-2021_01_06_425657	19	27	required	require	VBN
10_1101-2021_01_06_425657	19	28	for	for	IN
10_1101-2021_01_06_425657	19	29	the	the	DT
10_1101-2021_01_06_425657	19	30	degradation	degradation	NN
10_1101-2021_01_06_425657	19	31	of	of	IN
10_1101-2021_01_06_425657	19	32	Met4	Met4	NNP
10_1101-2021_01_06_425657	19	33	by	by	IN
10_1101-2021_01_06_425657	19	34	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	19	35	,	,	,
10_1101-2021_01_06_425657	19	36	although	although	IN
10_1101-2021_01_06_425657	19	37	glutathione	glutathione	NN
10_1101-2021_01_06_425657	19	38	was	be	VBD
10_1101-2021_01_06_425657	19	39	61	61	CD
10_1101-2021_01_06_425657	19	40	reportedly	reportedly	RB
10_1101-2021_01_06_425657	19	41	not	not	RB
10_1101-2021_01_06_425657	19	42	involved	involve	VBN
10_1101-2021_01_06_425657	19	43	in	in	IN
10_1101-2021_01_06_425657	19	44	this	this	DT
10_1101-2021_01_06_425657	19	45	mechanism	mechanism	NN
10_1101-2021_01_06_425657	19	46	(	(	-LRB-
10_1101-2021_01_06_425657	19	47	Hansen	Hansen	NNP
10_1101-2021_01_06_425657	19	48	and	and	CC
10_1101-2021_01_06_425657	19	49	Johannesen	Johannesen	NNP
10_1101-2021_01_06_425657	19	50	,	,	,
10_1101-2021_01_06_425657	19	51	2000	2000	CD
10_1101-2021_01_06_425657	19	52	,	,	,
10_1101-2021_01_06_425657	19	53	Menant	Menant	NNP
10_1101-2021_01_06_425657	19	54	et	et	NNP
10_1101-2021_01_06_425657	19	55	al	al	NNP
10_1101-2021_01_06_425657	19	56	.	.	NNP
10_1101-2021_01_06_425657	19	57	,	,	,
10_1101-2021_01_06_425657	19	58	2006	2006	CD
10_1101-2021_01_06_425657	19	59	)	)	-RRB-
10_1101-2021_01_06_425657	19	60	.	.	.
10_1101-2021_01_06_425657	20	1	62	62	CD
10_1101-2021_01_06_425657	20	2	A	a	DT
10_1101-2021_01_06_425657	20	3	genetic	genetic	JJ
10_1101-2021_01_06_425657	20	4	screen	screen	NN
10_1101-2021_01_06_425657	20	5	for	for	IN
10_1101-2021_01_06_425657	20	6	mutants	mutant	NNS
10_1101-2021_01_06_425657	20	7	that	that	WDT
10_1101-2021_01_06_425657	20	8	fail	fail	VBP
10_1101-2021_01_06_425657	20	9	to	to	TO
10_1101-2021_01_06_425657	20	10	repress	repress	VB
10_1101-2021_01_06_425657	20	11	MET	MET	NNP
10_1101-2021_01_06_425657	20	12	gene	gene	NN
10_1101-2021_01_06_425657	20	13	expression	expression	NN
10_1101-2021_01_06_425657	20	14	found	find	VBD
10_1101-2021_01_06_425657	20	15	that	that	IN
10_1101-2021_01_06_425657	20	16	cho2D	cho2D	NNP
10_1101-2021_01_06_425657	20	17	cells	cell	NNS
10_1101-2021_01_06_425657	20	18	,	,	,
10_1101-2021_01_06_425657	20	19	63	63	CD
10_1101-2021_01_06_425657	20	20	which	which	WDT
10_1101-2021_01_06_425657	20	21	are	be	VBP
10_1101-2021_01_06_425657	20	22	defective	defective	JJ
10_1101-2021_01_06_425657	20	23	in	in	IN
10_1101-2021_01_06_425657	20	24	the	the	DT
10_1101-2021_01_06_425657	20	25	synthesis	synthesis	NN
10_1101-2021_01_06_425657	20	26	of	of	IN
10_1101-2021_01_06_425657	20	27	phosphatidylcholine	phosphatidylcholine	NN
10_1101-2021_01_06_425657	20	28	(	(	-LRB-
10_1101-2021_01_06_425657	20	29	PC	PC	NNP
10_1101-2021_01_06_425657	20	30	)	)	-RRB-
10_1101-2021_01_06_425657	20	31	from	from	IN
10_1101-2021_01_06_425657	20	32	phosphatidylethanolamine	phosphatidylethanolamine	NN
10_1101-2021_01_06_425657	20	33	64	64	CD
10_1101-2021_01_06_425657	20	34	(	(	-LRB-
10_1101-2021_01_06_425657	20	35	PE	PE	NNP
10_1101-2021_01_06_425657	20	36	)	)	-RRB-
10_1101-2021_01_06_425657	20	37	,	,	,
10_1101-2021_01_06_425657	20	38	results	result	NNS
10_1101-2021_01_06_425657	20	39	in	in	IN
10_1101-2021_01_06_425657	20	40	elevated	elevated	JJ
10_1101-2021_01_06_425657	20	41	SAM	SAM	NNP
10_1101-2021_01_06_425657	20	42	levels	level	NNS
10_1101-2021_01_06_425657	20	43	and	and	CC
10_1101-2021_01_06_425657	20	44	deficiency	deficiency	NN
10_1101-2021_01_06_425657	20	45	in	in	IN
10_1101-2021_01_06_425657	20	46	cysteine	cysteine	NN
10_1101-2021_01_06_425657	20	47	levels	level	NNS
10_1101-2021_01_06_425657	20	48	(	(	-LRB-
10_1101-2021_01_06_425657	20	49	Sadhu	Sadhu	NNP
10_1101-2021_01_06_425657	20	50	et	et	NNP
10_1101-2021_01_06_425657	20	51	al	al	NNP
10_1101-2021_01_06_425657	20	52	.	.	NNP
10_1101-2021_01_06_425657	20	53	,	,	,
10_1101-2021_01_06_425657	20	54	2014	2014	CD
10_1101-2021_01_06_425657	20	55	)	)	-RRB-
10_1101-2021_01_06_425657	20	56	.	.	.
10_1101-2021_01_06_425657	21	1	65	65	CD
10_1101-2021_01_06_425657	21	2	However	however	RB
10_1101-2021_01_06_425657	21	3	,	,	,
10_1101-2021_01_06_425657	21	4	while	while	IN
10_1101-2021_01_06_425657	21	5	Met30	Met30	NNP
10_1101-2021_01_06_425657	21	6	and	and	CC
10_1101-2021_01_06_425657	21	7	Met4	Met4	NNP
10_1101-2021_01_06_425657	21	8	have	have	VBP
10_1101-2021_01_06_425657	21	9	been	be	VBN
10_1101-2021_01_06_425657	21	10	studied	study	VBN
10_1101-2021_01_06_425657	21	11	extensively	extensively	RB
10_1101-2021_01_06_425657	21	12	for	for	IN
10_1101-2021_01_06_425657	21	13	over	over	IN
10_1101-2021_01_06_425657	21	14	two	two	CD
10_1101-2021_01_06_425657	21	15	decades	decade	NNS
10_1101-2021_01_06_425657	21	16	,	,	,
10_1101-2021_01_06_425657	21	17	the	the	DT
10_1101-2021_01_06_425657	21	18	66	66	CD
10_1101-2021_01_06_425657	21	19	biochemical	biochemical	JJ
10_1101-2021_01_06_425657	21	20	mechanisms	mechanism	NNS
10_1101-2021_01_06_425657	21	21	by	by	IN
10_1101-2021_01_06_425657	21	22	which	which	WDT
10_1101-2021_01_06_425657	21	23	Met30	Met30	NNP
10_1101-2021_01_06_425657	21	24	senses	sense	VBZ
10_1101-2021_01_06_425657	21	25	and	and	CC
10_1101-2021_01_06_425657	21	26	responds	respond	VBZ
10_1101-2021_01_06_425657	21	27	to	to	IN
10_1101-2021_01_06_425657	21	28	the	the	DT
10_1101-2021_01_06_425657	21	29	presence	presence	NN
10_1101-2021_01_06_425657	21	30	or	or	CC
10_1101-2021_01_06_425657	21	31	absence	absence	NN
10_1101-2021_01_06_425657	21	32	of	of	IN
10_1101-2021_01_06_425657	21	33	sulfur	sulfur	NN
10_1101-2021_01_06_425657	21	34	67	67	CD
10_1101-2021_01_06_425657	21	35	remains	remain	VBZ
10_1101-2021_01_06_425657	21	36	incomplete	incomplete	JJ
10_1101-2021_01_06_425657	21	37	(	(	-LRB-
10_1101-2021_01_06_425657	21	38	Sadhu	Sadhu	NNP
10_1101-2021_01_06_425657	21	39	et	et	NNP
10_1101-2021_01_06_425657	21	40	al	al	NNP
10_1101-2021_01_06_425657	21	41	.	.	NNP
10_1101-2021_01_06_425657	21	42	,	,	,
10_1101-2021_01_06_425657	21	43	2014	2014	CD
10_1101-2021_01_06_425657	21	44	)	)	-RRB-
10_1101-2021_01_06_425657	21	45	.	.	.
10_1101-2021_01_06_425657	22	1	68	68	CD
10_1101-2021_01_06_425657	22	2	69	69	CD
10_1101-2021_01_06_425657	22	3	Herein	Herein	NNP
10_1101-2021_01_06_425657	22	4	,	,	,
10_1101-2021_01_06_425657	22	5	we	-PRON-	PRP
10_1101-2021_01_06_425657	22	6	utilize	utilize	VBP
10_1101-2021_01_06_425657	22	7	prototrophic	prototrophic	JJ
10_1101-2021_01_06_425657	22	8	yeast	yeast	NN
10_1101-2021_01_06_425657	22	9	strains	strain	NNS
10_1101-2021_01_06_425657	22	10	grown	grow	VBN
10_1101-2021_01_06_425657	22	11	in	in	IN
10_1101-2021_01_06_425657	22	12	sulfur	sulfur	NN
10_1101-2021_01_06_425657	22	13	-	-	HYPH
10_1101-2021_01_06_425657	22	14	rich	rich	JJ
10_1101-2021_01_06_425657	22	15	and	and	CC
10_1101-2021_01_06_425657	22	16	sulfur	sulfur	NN
10_1101-2021_01_06_425657	22	17	-	-	HYPH
10_1101-2021_01_06_425657	22	18	free	free	JJ
10_1101-2021_01_06_425657	22	19	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	22	20	70	70	CD
10_1101-2021_01_06_425657	22	21	conditions	condition	NNS
10_1101-2021_01_06_425657	22	22	to	to	TO
10_1101-2021_01_06_425657	22	23	elucidate	elucidate	VB
10_1101-2021_01_06_425657	22	24	the	the	DT
10_1101-2021_01_06_425657	22	25	mechanism	mechanism	NN
10_1101-2021_01_06_425657	22	26	by	by	IN
10_1101-2021_01_06_425657	22	27	which	which	WDT
10_1101-2021_01_06_425657	22	28	Met30	Met30	NNP
10_1101-2021_01_06_425657	22	29	senses	sense	VBZ
10_1101-2021_01_06_425657	22	30	sulfur	sulfur	NN
10_1101-2021_01_06_425657	22	31	.	.	.
10_1101-2021_01_06_425657	23	1	Using	use	VBG
10_1101-2021_01_06_425657	23	2	a	a	DT
10_1101-2021_01_06_425657	23	3	combination	combination	NN
10_1101-2021_01_06_425657	23	4	of	of	IN
10_1101-2021_01_06_425657	23	5	in	in	IN
10_1101-2021_01_06_425657	23	6	71	71	CD
10_1101-2021_01_06_425657	23	7	vivo	vivo	NN
10_1101-2021_01_06_425657	23	8	and	and	CC
10_1101-2021_01_06_425657	23	9	in	in	FW
10_1101-2021_01_06_425657	23	10	vitro	vitro	FW
10_1101-2021_01_06_425657	23	11	experiments	experiment	NNS
10_1101-2021_01_06_425657	23	12	,	,	,
10_1101-2021_01_06_425657	23	13	we	-PRON-	PRP
10_1101-2021_01_06_425657	23	14	find	find	VBP
10_1101-2021_01_06_425657	23	15	that	that	IN
10_1101-2021_01_06_425657	23	16	instead	instead	RB
10_1101-2021_01_06_425657	23	17	of	of	IN
10_1101-2021_01_06_425657	23	18	sensing	sense	VBG
10_1101-2021_01_06_425657	23	19	any	any	DT
10_1101-2021_01_06_425657	23	20	single	single	JJ
10_1101-2021_01_06_425657	23	21	sulfur	sulfur	NN
10_1101-2021_01_06_425657	23	22	-	-	HYPH
10_1101-2021_01_06_425657	23	23	containing	contain	VBG
10_1101-2021_01_06_425657	23	24	72	72	CD
10_1101-2021_01_06_425657	23	25	metabolite	metabolite	NN
10_1101-2021_01_06_425657	23	26	,	,	,
10_1101-2021_01_06_425657	23	27	Met30	Met30	NNP
10_1101-2021_01_06_425657	23	28	indirectly	indirectly	RB
10_1101-2021_01_06_425657	23	29	senses	sense	VBZ
10_1101-2021_01_06_425657	23	30	the	the	DT
10_1101-2021_01_06_425657	23	31	levels	level	NNS
10_1101-2021_01_06_425657	23	32	of	of	IN
10_1101-2021_01_06_425657	23	33	sulfur	sulfur	NN
10_1101-2021_01_06_425657	23	34	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	23	35	in	in	IN
10_1101-2021_01_06_425657	23	36	the	the	DT
10_1101-2021_01_06_425657	23	37	cell	cell	NN
10_1101-2021_01_06_425657	23	38	by	by	IN
10_1101-2021_01_06_425657	23	39	acting	act	VBG
10_1101-2021_01_06_425657	23	40	as	as	IN
10_1101-2021_01_06_425657	23	41	a	a	DT
10_1101-2021_01_06_425657	23	42	sensor	sensor	NN
10_1101-2021_01_06_425657	23	43	73	73	CD
10_1101-2021_01_06_425657	23	44	of	of	IN
10_1101-2021_01_06_425657	23	45	redox	redox	NN
10_1101-2021_01_06_425657	23	46	state	state	NN
10_1101-2021_01_06_425657	23	47	.	.	.
10_1101-2021_01_06_425657	24	1	We	-PRON-	PRP
10_1101-2021_01_06_425657	24	2	describe	describe	VBP
10_1101-2021_01_06_425657	24	3	a	a	DT
10_1101-2021_01_06_425657	24	4	novel	novel	JJ
10_1101-2021_01_06_425657	24	5	mechanism	mechanism	NN
10_1101-2021_01_06_425657	24	6	by	by	IN
10_1101-2021_01_06_425657	24	7	which	which	WDT
10_1101-2021_01_06_425657	24	8	an	an	DT
10_1101-2021_01_06_425657	24	9	F	F	NNP
10_1101-2021_01_06_425657	24	10	-	-	HYPH
10_1101-2021_01_06_425657	24	11	box	box	NN
10_1101-2021_01_06_425657	24	12	protein	protein	NN
10_1101-2021_01_06_425657	24	13	can	can	MD
10_1101-2021_01_06_425657	24	14	be	be	VB
10_1101-2021_01_06_425657	24	15	regulated	regulate	VBN
10_1101-2021_01_06_425657	24	16	through	through	IN
10_1101-2021_01_06_425657	24	17	74	74	CD
10_1101-2021_01_06_425657	24	18	the	the	DT
10_1101-2021_01_06_425657	24	19	use	use	NN
10_1101-2021_01_06_425657	24	20	of	of	IN
10_1101-2021_01_06_425657	24	21	multiple	multiple	JJ
10_1101-2021_01_06_425657	24	22	cysteine	cysteine	NN
10_1101-2021_01_06_425657	24	23	residues	residue	NNS
10_1101-2021_01_06_425657	24	24	as	as	IN
10_1101-2021_01_06_425657	24	25	redox	redox	NN
10_1101-2021_01_06_425657	24	26	sensors	sensor	NNS
10_1101-2021_01_06_425657	24	27	that	that	WDT
10_1101-2021_01_06_425657	24	28	,	,	,
10_1101-2021_01_06_425657	24	29	upon	upon	IN
10_1101-2021_01_06_425657	24	30	oxidation	oxidation	NN
10_1101-2021_01_06_425657	24	31	,	,	,
10_1101-2021_01_06_425657	24	32	disrupt	disrupt	RB
10_1101-2021_01_06_425657	24	33	binding	binding	NN
10_1101-2021_01_06_425657	24	34	of	of	IN
10_1101-2021_01_06_425657	24	35	the	the	DT
10_1101-2021_01_06_425657	24	36	75	75	CD
10_1101-2021_01_06_425657	24	37	E3	e3	NN
10_1101-2021_01_06_425657	24	38	ligase	ligase	NN
10_1101-2021_01_06_425657	24	39	to	to	IN
10_1101-2021_01_06_425657	24	40	its	-PRON-	PRP$
10_1101-2021_01_06_425657	24	41	target	target	NN
10_1101-2021_01_06_425657	24	42	to	to	TO
10_1101-2021_01_06_425657	24	43	enable	enable	VB
10_1101-2021_01_06_425657	24	44	the	the	DT
10_1101-2021_01_06_425657	24	45	activation	activation	NN
10_1101-2021_01_06_425657	24	46	of	of	IN
10_1101-2021_01_06_425657	24	47	a	a	DT
10_1101-2021_01_06_425657	24	48	coordinated	coordinated	JJ
10_1101-2021_01_06_425657	24	49	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	24	50	response	response	NN
10_1101-2021_01_06_425657	24	51	.	.	.
10_1101-2021_01_06_425657	25	1	76	76	CD
10_1101-2021_01_06_425657	25	2	77	77	CD
10_1101-2021_01_06_425657	25	3	RESULTS	RESULTS	NNP
10_1101-2021_01_06_425657	25	4	78	78	CD
10_1101-2021_01_06_425657	25	5	79	79	CD
10_1101-2021_01_06_425657	25	6	SYNTHESIS	synthesi	NNS
10_1101-2021_01_06_425657	25	7	OF	of	IN
10_1101-2021_01_06_425657	25	8	CYSTEINE	CYSTEINE	NNP
10_1101-2021_01_06_425657	25	9	IS	be	VBZ
10_1101-2021_01_06_425657	25	10	MORE	more	RBR
10_1101-2021_01_06_425657	25	11	IMPORTANT	important	JJ
10_1101-2021_01_06_425657	25	12	THAN	than	IN
10_1101-2021_01_06_425657	25	13	METHIONINE	METHIONINE	NNP
10_1101-2021_01_06_425657	25	14	FOR	for	IN
10_1101-2021_01_06_425657	25	15	MET4	MET4	NNP
10_1101-2021_01_06_425657	25	16	80	80	CD
10_1101-2021_01_06_425657	25	17	UBIQUITINATION	UBIQUITINATION	NNP
10_1101-2021_01_06_425657	25	18	81	81	CD
10_1101-2021_01_06_425657	25	19	82	82	CD
10_1101-2021_01_06_425657	25	20	Previous	previous	JJ
10_1101-2021_01_06_425657	25	21	work	work	NN
10_1101-2021_01_06_425657	25	22	in	in	IN
10_1101-2021_01_06_425657	25	23	our	-PRON-	PRP$
10_1101-2021_01_06_425657	25	24	lab	lab	NN
10_1101-2021_01_06_425657	25	25	has	have	VBZ
10_1101-2021_01_06_425657	25	26	characterized	characterize	VBN
10_1101-2021_01_06_425657	25	27	the	the	DT
10_1101-2021_01_06_425657	25	28	metabolic	metabolic	JJ
10_1101-2021_01_06_425657	25	29	and	and	CC
10_1101-2021_01_06_425657	25	30	cellular	cellular	JJ
10_1101-2021_01_06_425657	25	31	response	response	NN
10_1101-2021_01_06_425657	25	32	of	of	IN
10_1101-2021_01_06_425657	25	33	yeast	yeast	NN
10_1101-2021_01_06_425657	25	34	cells	cell	NNS
10_1101-2021_01_06_425657	25	35	83	83	CD
10_1101-2021_01_06_425657	25	36	following	follow	VBG
10_1101-2021_01_06_425657	25	37	switch	switch	NN
10_1101-2021_01_06_425657	25	38	from	from	IN
10_1101-2021_01_06_425657	25	39	rich	rich	JJ
10_1101-2021_01_06_425657	25	40	lactate	lactate	JJ
10_1101-2021_01_06_425657	25	41	media	medium	NNS
10_1101-2021_01_06_425657	25	42	(	(	-LRB-
10_1101-2021_01_06_425657	25	43	YPL	YPL	NNP
10_1101-2021_01_06_425657	25	44	)	)	-RRB-
10_1101-2021_01_06_425657	25	45	to	to	IN
10_1101-2021_01_06_425657	25	46	minimal	minimal	JJ
10_1101-2021_01_06_425657	25	47	lactate	lactate	JJ
10_1101-2021_01_06_425657	25	48	media	medium	NNS
10_1101-2021_01_06_425657	25	49	(	(	-LRB-
10_1101-2021_01_06_425657	25	50	SL	sl	NN
10_1101-2021_01_06_425657	25	51	)	)	-RRB-
10_1101-2021_01_06_425657	25	52	(	(	-LRB-
10_1101-2021_01_06_425657	25	53	Wu	Wu	NNP
10_1101-2021_01_06_425657	25	54	and	and	CC
10_1101-2021_01_06_425657	25	55	Tu	Tu	NNP
10_1101-2021_01_06_425657	25	56	,	,	,
10_1101-2021_01_06_425657	25	57	2011	2011	CD
10_1101-2021_01_06_425657	25	58	,	,	,
10_1101-2021_01_06_425657	25	59	84	84	CD
10_1101-2021_01_06_425657	25	60	Sutter	Sutter	NNP
10_1101-2021_01_06_425657	25	61	et	et	FW
10_1101-2021_01_06_425657	25	62	al	al	NNP
10_1101-2021_01_06_425657	25	63	.	.	NNP
10_1101-2021_01_06_425657	25	64	,	,	,
10_1101-2021_01_06_425657	25	65	2013	2013	CD
10_1101-2021_01_06_425657	25	66	,	,	,
10_1101-2021_01_06_425657	25	67	Laxman	Laxman	NNP
10_1101-2021_01_06_425657	25	68	et	et	FW
10_1101-2021_01_06_425657	25	69	al	al	NNP
10_1101-2021_01_06_425657	25	70	.	.	NNP
10_1101-2021_01_06_425657	25	71	,	,	,
10_1101-2021_01_06_425657	25	72	2013	2013	CD
10_1101-2021_01_06_425657	25	73	,	,	,
10_1101-2021_01_06_425657	25	74	Kato	Kato	NNP
10_1101-2021_01_06_425657	25	75	et	et	FW
10_1101-2021_01_06_425657	25	76	al	al	NNP
10_1101-2021_01_06_425657	25	77	.	.	NNP
10_1101-2021_01_06_425657	25	78	,	,	,
10_1101-2021_01_06_425657	25	79	2019	2019	CD
10_1101-2021_01_06_425657	25	80	,	,	,
10_1101-2021_01_06_425657	25	81	Yang	Yang	NNP
10_1101-2021_01_06_425657	25	82	et	et	FW
10_1101-2021_01_06_425657	25	83	al	al	NNP
10_1101-2021_01_06_425657	25	84	.	.	NNP
10_1101-2021_01_06_425657	25	85	,	,	,
10_1101-2021_01_06_425657	25	86	2019	2019	CD
10_1101-2021_01_06_425657	25	87	,	,	,
10_1101-2021_01_06_425657	25	88	Ye	Ye	NNP
10_1101-2021_01_06_425657	25	89	et	et	FW
10_1101-2021_01_06_425657	25	90	al	al	NNP
10_1101-2021_01_06_425657	25	91	.	.	NNP
10_1101-2021_01_06_425657	25	92	,	,	,
10_1101-2021_01_06_425657	25	93	2017	2017	CD
10_1101-2021_01_06_425657	25	94	,	,	,
10_1101-2021_01_06_425657	25	95	Ye	Ye	NNP
10_1101-2021_01_06_425657	25	96	et	et	NNP
10_1101-2021_01_06_425657	25	97	85	85	CD
10_1101-2021_01_06_425657	25	98	al	al	NNP
10_1101-2021_01_06_425657	25	99	.	.	NNP
10_1101-2021_01_06_425657	25	100	,	,	,
10_1101-2021_01_06_425657	25	101	2019	2019	CD
10_1101-2021_01_06_425657	25	102	)	)	-RRB-
10_1101-2021_01_06_425657	25	103	.	.	.
10_1101-2021_01_06_425657	26	1	Under	under	IN
10_1101-2021_01_06_425657	26	2	such	such	JJ
10_1101-2021_01_06_425657	26	3	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	26	4	conditions	condition	NNS
10_1101-2021_01_06_425657	26	5	,	,	,
10_1101-2021_01_06_425657	26	6	yeast	yeast	NN
10_1101-2021_01_06_425657	26	7	cells	cell	NNS
10_1101-2021_01_06_425657	26	8	engage	engage	VBP
10_1101-2021_01_06_425657	26	9	regulatory	regulatory	JJ
10_1101-2021_01_06_425657	26	10	mechanisms	mechanism	NNS
10_1101-2021_01_06_425657	26	11	that	that	WDT
10_1101-2021_01_06_425657	26	12	might	may	MD
10_1101-2021_01_06_425657	26	13	86	86	CD
10_1101-2021_01_06_425657	26	14	otherwise	otherwise	RB
10_1101-2021_01_06_425657	26	15	be	be	VB
10_1101-2021_01_06_425657	26	16	subject	subject	JJ
10_1101-2021_01_06_425657	26	17	to	to	IN
10_1101-2021_01_06_425657	26	18	glucose	glucose	VB
10_1101-2021_01_06_425657	26	19	repression	repression	NN
10_1101-2021_01_06_425657	26	20	.	.	.
10_1101-2021_01_06_425657	27	1	Among	among	IN
10_1101-2021_01_06_425657	27	2	other	other	JJ
10_1101-2021_01_06_425657	27	3	phenotypes	phenotype	NNS
10_1101-2021_01_06_425657	27	4	,	,	,
10_1101-2021_01_06_425657	27	5	this	this	DT
10_1101-2021_01_06_425657	27	6	switch	switch	NN
10_1101-2021_01_06_425657	27	7	results	result	NNS
10_1101-2021_01_06_425657	27	8	in	in	IN
10_1101-2021_01_06_425657	27	9	the	the	DT
10_1101-2021_01_06_425657	27	10	87	87	CD
10_1101-2021_01_06_425657	27	11	acute	acute	JJ
10_1101-2021_01_06_425657	27	12	depletion	depletion	NN
10_1101-2021_01_06_425657	27	13	of	of	IN
10_1101-2021_01_06_425657	27	14	sulfur	sulfur	NN
10_1101-2021_01_06_425657	27	15	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	27	16	and	and	CC
10_1101-2021_01_06_425657	27	17	the	the	DT
10_1101-2021_01_06_425657	27	18	activation	activation	NN
10_1101-2021_01_06_425657	27	19	of	of	IN
10_1101-2021_01_06_425657	27	20	the	the	DT
10_1101-2021_01_06_425657	27	21	MET	MET	NNP
10_1101-2021_01_06_425657	27	22	gene	gene	NN
10_1101-2021_01_06_425657	27	23	regulon	regulon	NN
10_1101-2021_01_06_425657	27	24	(	(	-LRB-
10_1101-2021_01_06_425657	27	25	Sutter	Sutter	NNP
10_1101-2021_01_06_425657	27	26	et	et	FW
10_1101-2021_01_06_425657	27	27	al	al	NNP
10_1101-2021_01_06_425657	27	28	.	.	NNP
10_1101-2021_01_06_425657	27	29	,	,	,
10_1101-2021_01_06_425657	27	30	88	88	CD
10_1101-2021_01_06_425657	27	31	2013	2013	CD
10_1101-2021_01_06_425657	27	32	,	,	,
10_1101-2021_01_06_425657	27	33	Ye	Ye	NNP
10_1101-2021_01_06_425657	27	34	et	et	FW
10_1101-2021_01_06_425657	27	35	al	al	NNP
10_1101-2021_01_06_425657	27	36	.	.	NNP
10_1101-2021_01_06_425657	27	37	,	,	,
10_1101-2021_01_06_425657	27	38	2019	2019	CD
10_1101-2021_01_06_425657	27	39	)	)	-RRB-
10_1101-2021_01_06_425657	27	40	.	.	.
10_1101-2021_01_06_425657	28	1	To	to	TO
10_1101-2021_01_06_425657	28	2	better	well	RBR
10_1101-2021_01_06_425657	28	3	study	study	VB
10_1101-2021_01_06_425657	28	4	the	the	DT
10_1101-2021_01_06_425657	28	5	response	response	NN
10_1101-2021_01_06_425657	28	6	of	of	IN
10_1101-2021_01_06_425657	28	7	yeast	yeast	NN
10_1101-2021_01_06_425657	28	8	cells	cell	NNS
10_1101-2021_01_06_425657	28	9	to	to	IN
10_1101-2021_01_06_425657	28	10	sulfur	sulfur	NN
10_1101-2021_01_06_425657	28	11	starvation	starvation	NN
10_1101-2021_01_06_425657	28	12	,	,	,
10_1101-2021_01_06_425657	28	13	we	-PRON-	PRP
10_1101-2021_01_06_425657	28	14	89	89	CD
10_1101-2021_01_06_425657	28	15	reformulated	reformulate	VBD
10_1101-2021_01_06_425657	28	16	our	-PRON-	PRP$
10_1101-2021_01_06_425657	28	17	minimal	minimal	JJ
10_1101-2021_01_06_425657	28	18	lactate	lactate	JJ
10_1101-2021_01_06_425657	28	19	media	medium	NNS
10_1101-2021_01_06_425657	28	20	to	to	TO
10_1101-2021_01_06_425657	28	21	contain	contain	VB
10_1101-2021_01_06_425657	28	22	no	no	DT
10_1101-2021_01_06_425657	28	23	sulfate	sulfate	NN
10_1101-2021_01_06_425657	28	24	,	,	,
10_1101-2021_01_06_425657	28	25	as	as	IN
10_1101-2021_01_06_425657	28	26	prototrophic	prototrophic	JJ
10_1101-2021_01_06_425657	28	27	yeast	yeast	NN
10_1101-2021_01_06_425657	28	28	can	can	MD
10_1101-2021_01_06_425657	28	29	assimilate	assimilate	VB
10_1101-2021_01_06_425657	28	30	90	90	CD
10_1101-2021_01_06_425657	28	31	sulfur	sulfur	NN
10_1101-2021_01_06_425657	28	32	in	in	IN
10_1101-2021_01_06_425657	28	33	the	the	DT
10_1101-2021_01_06_425657	28	34	form	form	NN
10_1101-2021_01_06_425657	28	35	of	of	IN
10_1101-2021_01_06_425657	28	36	inorganic	inorganic	JJ
10_1101-2021_01_06_425657	28	37	sulfate	sulfate	NN
10_1101-2021_01_06_425657	28	38	into	into	IN
10_1101-2021_01_06_425657	28	39	reduced	reduce	VBN
10_1101-2021_01_06_425657	28	40	sulfur	sulfur	NN
10_1101-2021_01_06_425657	28	41	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	28	42	.	.	.
10_1101-2021_01_06_425657	29	1	After	after	IN
10_1101-2021_01_06_425657	29	2	switching	switch	VBG
10_1101-2021_01_06_425657	29	3	cells	cell	NNS
10_1101-2021_01_06_425657	29	4	from	from	IN
10_1101-2021_01_06_425657	29	5	91	91	CD
10_1101-2021_01_06_425657	29	6	YP	YP	NNP
10_1101-2021_01_06_425657	29	7	lactate	lactate	JJ
10_1101-2021_01_06_425657	29	8	media	medium	NNS
10_1101-2021_01_06_425657	29	9	(	(	-LRB-
10_1101-2021_01_06_425657	29	10	Rich	Rich	NNP
10_1101-2021_01_06_425657	29	11	)	)	-RRB-
10_1101-2021_01_06_425657	29	12	to	to	IN
10_1101-2021_01_06_425657	29	13	the	the	DT
10_1101-2021_01_06_425657	29	14	new	new	JJ
10_1101-2021_01_06_425657	29	15	minimal	minimal	JJ
10_1101-2021_01_06_425657	29	16	sulfur	sulfur	NN
10_1101-2021_01_06_425657	29	17	-	-	HYPH
10_1101-2021_01_06_425657	29	18	free	free	JJ
10_1101-2021_01_06_425657	29	19	lactate	lactate	JJ
10_1101-2021_01_06_425657	29	20	media	medium	NNS
10_1101-2021_01_06_425657	29	21	(	(	-LRB-
10_1101-2021_01_06_425657	29	22	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	29	23	)	)	-RRB-
10_1101-2021_01_06_425657	29	24	,	,	,
10_1101-2021_01_06_425657	29	25	we	-PRON-	PRP
10_1101-2021_01_06_425657	29	26	found	find	VBD
10_1101-2021_01_06_425657	29	27	that	that	IN
10_1101-2021_01_06_425657	29	28	92	92	CD
10_1101-2021_01_06_425657	29	29	.CC	.CC	,
10_1101-2021_01_06_425657	29	30	-	-	:
10_1101-2021_01_06_425657	29	31	BY	by	IN
10_1101-2021_01_06_425657	29	32	4.0	4.0	CD
10_1101-2021_01_06_425657	29	33	International	International	NNP
10_1101-2021_01_06_425657	29	34	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	29	35	under	under	IN
10_1101-2021_01_06_425657	29	36	a	a	DT
10_1101-2021_01_06_425657	29	37	(	(	-LRB-
10_1101-2021_01_06_425657	29	38	which	which	WDT
10_1101-2021_01_06_425657	29	39	was	be	VBD
10_1101-2021_01_06_425657	29	40	not	not	RB
10_1101-2021_01_06_425657	29	41	certified	certify	VBN
10_1101-2021_01_06_425657	29	42	by	by	IN
10_1101-2021_01_06_425657	29	43	peer	peer	NN
10_1101-2021_01_06_425657	29	44	review	review	NN
10_1101-2021_01_06_425657	29	45	)	)	-RRB-
10_1101-2021_01_06_425657	29	46	is	be	VBZ
10_1101-2021_01_06_425657	29	47	the	the	DT
10_1101-2021_01_06_425657	29	48	author	author	NN
10_1101-2021_01_06_425657	29	49	/	/	SYM
10_1101-2021_01_06_425657	29	50	funder	funder	NN
10_1101-2021_01_06_425657	29	51	,	,	,
10_1101-2021_01_06_425657	29	52	who	who	WP
10_1101-2021_01_06_425657	29	53	has	have	VBZ
10_1101-2021_01_06_425657	29	54	granted	grant	VBN
10_1101-2021_01_06_425657	29	55	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	29	56	a	a	DT
10_1101-2021_01_06_425657	29	57	license	license	NN
10_1101-2021_01_06_425657	29	58	to	to	TO
10_1101-2021_01_06_425657	29	59	display	display	VB
10_1101-2021_01_06_425657	29	60	the	the	DT
10_1101-2021_01_06_425657	29	61	preprint	preprint	NN
10_1101-2021_01_06_425657	29	62	in	in	IN
10_1101-2021_01_06_425657	29	63	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	29	64	.	.	.
10_1101-2021_01_06_425657	30	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	30	2	is	be	VBZ
10_1101-2021_01_06_425657	30	3	made	make	VBN
10_1101-2021_01_06_425657	30	4	The	the	DT
10_1101-2021_01_06_425657	30	5	copyright	copyright	NN
10_1101-2021_01_06_425657	30	6	holder	holder	NN
10_1101-2021_01_06_425657	30	7	for	for	IN
10_1101-2021_01_06_425657	30	8	this	this	DT
10_1101-2021_01_06_425657	30	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	30	10	version	version	NN
10_1101-2021_01_06_425657	30	11	posted	post	VBD
10_1101-2021_01_06_425657	30	12	January	January	NNP
10_1101-2021_01_06_425657	30	13	7	7	CD
10_1101-2021_01_06_425657	30	14	,	,	,
10_1101-2021_01_06_425657	30	15	2021	2021	CD
10_1101-2021_01_06_425657	30	16	.	.	.
10_1101-2021_01_06_425657	30	17	;	;	:
10_1101-2021_01_06_425657	30	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	30	19	:	:	:
10_1101-2021_01_06_425657	30	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	30	21	preprint	preprint	NN
10_1101-2021_01_06_425657	30	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NN
10_1101-2021_01_06_425657	30	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	30	24	4	4	CD
10_1101-2021_01_06_425657	30	25	Met30	Met30	NNP
10_1101-2021_01_06_425657	30	26	and	and	CC
10_1101-2021_01_06_425657	30	27	Met4	Met4	NNP
10_1101-2021_01_06_425657	30	28	quickly	quickly	RB
10_1101-2021_01_06_425657	30	29	respond	respond	VB
10_1101-2021_01_06_425657	30	30	to	to	IN
10_1101-2021_01_06_425657	30	31	sulfur	sulfur	NN
10_1101-2021_01_06_425657	30	32	starvation	starvation	NN
10_1101-2021_01_06_425657	30	33	through	through	IN
10_1101-2021_01_06_425657	30	34	the	the	DT
10_1101-2021_01_06_425657	30	35	extensively	extensively	RB
10_1101-2021_01_06_425657	30	36	studied	study	VBN
10_1101-2021_01_06_425657	30	37	ubiquitin-93	ubiquitin-93	NN
10_1101-2021_01_06_425657	30	38	dependent	dependent	JJ
10_1101-2021_01_06_425657	30	39	mechanisms	mechanism	NNS
10_1101-2021_01_06_425657	30	40	regulating	regulate	VBG
10_1101-2021_01_06_425657	30	41	Met4	met4	JJ
10_1101-2021_01_06_425657	30	42	activity	activity	NN
10_1101-2021_01_06_425657	30	43	(	(	-LRB-
10_1101-2021_01_06_425657	30	44	Figure	figure	NN
10_1101-2021_01_06_425657	30	45	1A	1a	NN
10_1101-2021_01_06_425657	30	46	)	)	-RRB-
10_1101-2021_01_06_425657	30	47	(	(	-LRB-
10_1101-2021_01_06_425657	30	48	Yen	Yen	NNP
10_1101-2021_01_06_425657	30	49	et	et	FW
10_1101-2021_01_06_425657	30	50	al	al	NNP
10_1101-2021_01_06_425657	30	51	.	.	NNP
10_1101-2021_01_06_425657	30	52	,	,	,
10_1101-2021_01_06_425657	30	53	2005	2005	CD
10_1101-2021_01_06_425657	30	54	,	,	,
10_1101-2021_01_06_425657	30	55	Flick	Flick	NNP
10_1101-2021_01_06_425657	30	56	et	et	NNP
10_1101-2021_01_06_425657	30	57	al	al	NNP
10_1101-2021_01_06_425657	30	58	.	.	NNP
10_1101-2021_01_06_425657	30	59	,	,	,
10_1101-2021_01_06_425657	30	60	2006	2006	CD
10_1101-2021_01_06_425657	30	61	,	,	,
10_1101-2021_01_06_425657	30	62	94	94	CD
10_1101-2021_01_06_425657	30	63	Barbey	Barbey	NNP
10_1101-2021_01_06_425657	30	64	et	et	NNP
10_1101-2021_01_06_425657	30	65	al	al	NNP
10_1101-2021_01_06_425657	30	66	.	.	NNP
10_1101-2021_01_06_425657	30	67	,	,	,
10_1101-2021_01_06_425657	30	68	2005	2005	CD
10_1101-2021_01_06_425657	30	69	,	,	,
10_1101-2021_01_06_425657	30	70	Kaiser	Kaiser	NNP
10_1101-2021_01_06_425657	30	71	et	et	FW
10_1101-2021_01_06_425657	30	72	al	al	NNP
10_1101-2021_01_06_425657	30	73	.	.	NNP
10_1101-2021_01_06_425657	30	74	,	,	,
10_1101-2021_01_06_425657	30	75	2000	2000	CD
10_1101-2021_01_06_425657	30	76	,	,	,
10_1101-2021_01_06_425657	30	77	Flick	Flick	NNP
10_1101-2021_01_06_425657	30	78	et	et	NNP
10_1101-2021_01_06_425657	30	79	al	al	NNP
10_1101-2021_01_06_425657	30	80	.	.	NNP
10_1101-2021_01_06_425657	30	81	,	,	,
10_1101-2021_01_06_425657	30	82	2004	2004	CD
10_1101-2021_01_06_425657	30	83	)	)	-RRB-
10_1101-2021_01_06_425657	30	84	.	.	.
10_1101-2021_01_06_425657	31	1	As	as	IN
10_1101-2021_01_06_425657	31	2	previously	previously	RB
10_1101-2021_01_06_425657	31	3	observed	observe	VBN
10_1101-2021_01_06_425657	31	4	,	,	,
10_1101-2021_01_06_425657	31	5	the	the	DT
10_1101-2021_01_06_425657	31	6	95	95	CD
10_1101-2021_01_06_425657	31	7	deubiquitination	deubiquitination	NN
10_1101-2021_01_06_425657	31	8	of	of	IN
10_1101-2021_01_06_425657	31	9	Met4	Met4	NNP
10_1101-2021_01_06_425657	31	10	resulted	result	VBN
10_1101-2021_01_06_425657	31	11	in	in	IN
10_1101-2021_01_06_425657	31	12	the	the	DT
10_1101-2021_01_06_425657	31	13	activation	activation	NN
10_1101-2021_01_06_425657	31	14	of	of	IN
10_1101-2021_01_06_425657	31	15	the	the	DT
10_1101-2021_01_06_425657	31	16	MET	MET	NNP
10_1101-2021_01_06_425657	31	17	genes	gene	NNS
10_1101-2021_01_06_425657	31	18	(	(	-LRB-
10_1101-2021_01_06_425657	31	19	Figure	figure	NN
10_1101-2021_01_06_425657	31	20	1B	1b	NN
10_1101-2021_01_06_425657	31	21	)	)	-RRB-
10_1101-2021_01_06_425657	31	22	and	and	CC
10_1101-2021_01_06_425657	31	23	corresponded	correspond	VBD
10_1101-2021_01_06_425657	31	24	96	96	CD
10_1101-2021_01_06_425657	31	25	well	well	RB
10_1101-2021_01_06_425657	31	26	with	with	IN
10_1101-2021_01_06_425657	31	27	changes	change	NNS
10_1101-2021_01_06_425657	31	28	in	in	IN
10_1101-2021_01_06_425657	31	29	observed	observed	JJ
10_1101-2021_01_06_425657	31	30	sulfur	sulfur	NN
10_1101-2021_01_06_425657	31	31	metabolite	metabolite	JJ
10_1101-2021_01_06_425657	31	32	levels	level	NNS
10_1101-2021_01_06_425657	31	33	(	(	-LRB-
10_1101-2021_01_06_425657	31	34	Figure	figure	NN
10_1101-2021_01_06_425657	31	35	1C	1c	NN
10_1101-2021_01_06_425657	31	36	)	)	-RRB-
10_1101-2021_01_06_425657	31	37	.	.	.
10_1101-2021_01_06_425657	32	1	Addition	addition	NN
10_1101-2021_01_06_425657	32	2	of	of	IN
10_1101-2021_01_06_425657	32	3	sulfur	sulfur	NN
10_1101-2021_01_06_425657	32	4	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	32	5	97	97	CD
10_1101-2021_01_06_425657	32	6	quickly	quickly	RB
10_1101-2021_01_06_425657	32	7	rescued	rescue	VBN
10_1101-2021_01_06_425657	32	8	Met30	Met30	NNP
10_1101-2021_01_06_425657	32	9	activity	activity	NN
10_1101-2021_01_06_425657	32	10	and	and	CC
10_1101-2021_01_06_425657	32	11	resulted	result	VBD
10_1101-2021_01_06_425657	32	12	in	in	IN
10_1101-2021_01_06_425657	32	13	the	the	DT
10_1101-2021_01_06_425657	32	14	re	re	NN
10_1101-2021_01_06_425657	32	15	-	-	NN
10_1101-2021_01_06_425657	32	16	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	32	17	of	of	IN
10_1101-2021_01_06_425657	32	18	Met4	Met4	NNP
10_1101-2021_01_06_425657	32	19	and	and	CC
10_1101-2021_01_06_425657	32	20	the	the	DT
10_1101-2021_01_06_425657	32	21	repression	repression	NN
10_1101-2021_01_06_425657	32	22	of	of	IN
10_1101-2021_01_06_425657	32	23	98	98	CD
10_1101-2021_01_06_425657	32	24	the	the	DT
10_1101-2021_01_06_425657	32	25	MET	MET	NNP
10_1101-2021_01_06_425657	32	26	genes	gene	NNS
10_1101-2021_01_06_425657	32	27	.	.	.
10_1101-2021_01_06_425657	33	1	99	99	CD
10_1101-2021_01_06_425657	33	2	100	100	CD
10_1101-2021_01_06_425657	33	3	As	as	IN
10_1101-2021_01_06_425657	33	4	previously	previously	RB
10_1101-2021_01_06_425657	33	5	noted	note	VBN
10_1101-2021_01_06_425657	33	6	,	,	,
10_1101-2021_01_06_425657	33	7	Met4	met4	JJ
10_1101-2021_01_06_425657	33	8	activation	activation	NN
10_1101-2021_01_06_425657	33	9	in	in	IN
10_1101-2021_01_06_425657	33	10	response	response	NN
10_1101-2021_01_06_425657	33	11	to	to	IN
10_1101-2021_01_06_425657	33	12	sulfur	sulfur	NN
10_1101-2021_01_06_425657	33	13	starvation	starvation	NN
10_1101-2021_01_06_425657	33	14	results	result	NNS
10_1101-2021_01_06_425657	33	15	in	in	IN
10_1101-2021_01_06_425657	33	16	the	the	DT
10_1101-2021_01_06_425657	33	17	emergence	emergence	NN
10_1101-2021_01_06_425657	33	18	of	of	IN
10_1101-2021_01_06_425657	33	19	a	a	DT
10_1101-2021_01_06_425657	33	20	101	101	CD
10_1101-2021_01_06_425657	33	21	second	second	NN
10_1101-2021_01_06_425657	33	22	,	,	,
10_1101-2021_01_06_425657	33	23	faster	fast	RBR
10_1101-2021_01_06_425657	33	24	-	-	HYPH
10_1101-2021_01_06_425657	33	25	migrating	migrate	VBG
10_1101-2021_01_06_425657	33	26	proteoform	proteoform	NN
10_1101-2021_01_06_425657	33	27	of	of	IN
10_1101-2021_01_06_425657	33	28	Met30	Met30	NNP
10_1101-2021_01_06_425657	33	29	,	,	,
10_1101-2021_01_06_425657	33	30	which	which	WDT
10_1101-2021_01_06_425657	33	31	disappears	disappear	VBZ
10_1101-2021_01_06_425657	33	32	after	after	IN
10_1101-2021_01_06_425657	33	33	rescuing	rescue	VBG
10_1101-2021_01_06_425657	33	34	yeast	yeast	NN
10_1101-2021_01_06_425657	33	35	cells	cell	NNS
10_1101-2021_01_06_425657	33	36	with	with	IN
10_1101-2021_01_06_425657	33	37	102	102	CD
10_1101-2021_01_06_425657	33	38	sulfur	sulfur	NN
10_1101-2021_01_06_425657	33	39	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	33	40	(	(	-LRB-
10_1101-2021_01_06_425657	33	41	Sadhu	Sadhu	NNP
10_1101-2021_01_06_425657	33	42	et	et	NNP
10_1101-2021_01_06_425657	33	43	al	al	NNP
10_1101-2021_01_06_425657	33	44	.	.	NNP
10_1101-2021_01_06_425657	33	45	,	,	,
10_1101-2021_01_06_425657	33	46	2014	2014	CD
10_1101-2021_01_06_425657	33	47	)	)	-RRB-
10_1101-2021_01_06_425657	33	48	.	.	.
10_1101-2021_01_06_425657	34	1	We	-PRON-	PRP
10_1101-2021_01_06_425657	34	2	found	find	VBD
10_1101-2021_01_06_425657	34	3	that	that	IN
10_1101-2021_01_06_425657	34	4	the	the	DT
10_1101-2021_01_06_425657	34	5	appearance	appearance	NN
10_1101-2021_01_06_425657	34	6	of	of	IN
10_1101-2021_01_06_425657	34	7	this	this	DT
10_1101-2021_01_06_425657	34	8	proteoform	proteoform	NN
10_1101-2021_01_06_425657	34	9	is	be	VBZ
10_1101-2021_01_06_425657	34	10	103	103	CD
10_1101-2021_01_06_425657	34	11	dependent	dependent	JJ
10_1101-2021_01_06_425657	34	12	on	on	IN
10_1101-2021_01_06_425657	34	13	both	both	CC
10_1101-2021_01_06_425657	34	14	MET4	MET4	NNP
10_1101-2021_01_06_425657	34	15	and	and	CC
10_1101-2021_01_06_425657	34	16	new	new	JJ
10_1101-2021_01_06_425657	34	17	translation	translation	NN
10_1101-2021_01_06_425657	34	18	,	,	,
10_1101-2021_01_06_425657	34	19	as	as	IN
10_1101-2021_01_06_425657	34	20	it	-PRON-	PRP
10_1101-2021_01_06_425657	34	21	was	be	VBD
10_1101-2021_01_06_425657	34	22	not	not	RB
10_1101-2021_01_06_425657	34	23	observed	observe	VBN
10_1101-2021_01_06_425657	34	24	in	in	IN
10_1101-2021_01_06_425657	34	25	either	either	DT
10_1101-2021_01_06_425657	34	26	met4D	met4D	NNP
10_1101-2021_01_06_425657	34	27	cells	cell	NNS
10_1101-2021_01_06_425657	34	28	or	or	CC
10_1101-2021_01_06_425657	34	29	cells	cell	NNS
10_1101-2021_01_06_425657	34	30	104	104	CD
10_1101-2021_01_06_425657	34	31	treated	treat	VBN
10_1101-2021_01_06_425657	34	32	with	with	IN
10_1101-2021_01_06_425657	34	33	cycloheximide	cycloheximide	NN
10_1101-2021_01_06_425657	34	34	during	during	IN
10_1101-2021_01_06_425657	34	35	sulfur	sulfur	NN
10_1101-2021_01_06_425657	34	36	starvation	starvation	NN
10_1101-2021_01_06_425657	34	37	(	(	-LRB-
10_1101-2021_01_06_425657	34	38	Figure	figure	VB
10_1101-2021_01_06_425657	34	39	S1A	s1a	NN
10_1101-2021_01_06_425657	34	40	and	and	CC
10_1101-2021_01_06_425657	34	41	C	C	NNP
10_1101-2021_01_06_425657	34	42	)	)	-RRB-
10_1101-2021_01_06_425657	34	43	.	.	.
10_1101-2021_01_06_425657	35	1	Additionally	additionally	RB
10_1101-2021_01_06_425657	35	2	,	,	,
10_1101-2021_01_06_425657	35	3	this	this	DT
10_1101-2021_01_06_425657	35	4	105	105	CD
10_1101-2021_01_06_425657	35	5	proteoform	proteoform	NN
10_1101-2021_01_06_425657	35	6	persists	persist	VBZ
10_1101-2021_01_06_425657	35	7	after	after	IN
10_1101-2021_01_06_425657	35	8	rescue	rescue	NN
10_1101-2021_01_06_425657	35	9	with	with	IN
10_1101-2021_01_06_425657	35	10	a	a	DT
10_1101-2021_01_06_425657	35	11	sulfur	sulfur	NN
10_1101-2021_01_06_425657	35	12	source	source	NN
10_1101-2021_01_06_425657	35	13	in	in	IN
10_1101-2021_01_06_425657	35	14	the	the	DT
10_1101-2021_01_06_425657	35	15	presence	presence	NN
10_1101-2021_01_06_425657	35	16	of	of	IN
10_1101-2021_01_06_425657	35	17	a	a	DT
10_1101-2021_01_06_425657	35	18	proteasome	proteasome	JJ
10_1101-2021_01_06_425657	35	19	inhibitor	inhibitor	NN
10_1101-2021_01_06_425657	35	20	106	106	CD
10_1101-2021_01_06_425657	35	21	(	(	-LRB-
10_1101-2021_01_06_425657	35	22	Figure	Figure	NNP
10_1101-2021_01_06_425657	35	23	S1B	s1b	NN
10_1101-2021_01_06_425657	35	24	)	)	-RRB-
10_1101-2021_01_06_425657	35	25	.	.	.
10_1101-2021_01_06_425657	36	1	107	107	CD
10_1101-2021_01_06_425657	36	2	108	108	CD
10_1101-2021_01_06_425657	36	3	We	-PRON-	PRP
10_1101-2021_01_06_425657	36	4	hypothesized	hypothesize	VBD
10_1101-2021_01_06_425657	36	5	that	that	IN
10_1101-2021_01_06_425657	36	6	this	this	DT
10_1101-2021_01_06_425657	36	7	faster	fast	RBR
10_1101-2021_01_06_425657	36	8	-	-	HYPH
10_1101-2021_01_06_425657	36	9	migrating	migrate	VBG
10_1101-2021_01_06_425657	36	10	proteoform	proteoform	NN
10_1101-2021_01_06_425657	36	11	of	of	IN
10_1101-2021_01_06_425657	36	12	Met30	Met30	NNP
10_1101-2021_01_06_425657	36	13	might	may	MD
10_1101-2021_01_06_425657	36	14	be	be	VB
10_1101-2021_01_06_425657	36	15	the	the	DT
10_1101-2021_01_06_425657	36	16	result	result	NN
10_1101-2021_01_06_425657	36	17	of	of	IN
10_1101-2021_01_06_425657	36	18	translation	translation	NN
10_1101-2021_01_06_425657	36	19	109	109	CD
10_1101-2021_01_06_425657	36	20	initiation	initiation	NN
10_1101-2021_01_06_425657	36	21	at	at	IN
10_1101-2021_01_06_425657	36	22	an	an	DT
10_1101-2021_01_06_425657	36	23	internal	internal	JJ
10_1101-2021_01_06_425657	36	24	methionine	methionine	NN
10_1101-2021_01_06_425657	36	25	residue	residue	NN
10_1101-2021_01_06_425657	36	26	.	.	.
10_1101-2021_01_06_425657	37	1	In	in	IN
10_1101-2021_01_06_425657	37	2	support	support	NN
10_1101-2021_01_06_425657	37	3	of	of	IN
10_1101-2021_01_06_425657	37	4	this	this	DT
10_1101-2021_01_06_425657	37	5	possibility	possibility	NN
10_1101-2021_01_06_425657	37	6	,	,	,
10_1101-2021_01_06_425657	37	7	mutation	mutation	NN
10_1101-2021_01_06_425657	37	8	of	of	IN
10_1101-2021_01_06_425657	37	9	methionine	methionine	NNP
10_1101-2021_01_06_425657	37	10	110	110	CD
10_1101-2021_01_06_425657	37	11	residues	residue	NNS
10_1101-2021_01_06_425657	37	12	30	30	CD
10_1101-2021_01_06_425657	37	13	,	,	,
10_1101-2021_01_06_425657	37	14	35	35	CD
10_1101-2021_01_06_425657	37	15	,	,	,
10_1101-2021_01_06_425657	37	16	and	and	CC
10_1101-2021_01_06_425657	37	17	36	36	CD
10_1101-2021_01_06_425657	37	18	to	to	TO
10_1101-2021_01_06_425657	37	19	alanine	alanine	NN
10_1101-2021_01_06_425657	37	20	blocked	block	VBD
10_1101-2021_01_06_425657	37	21	the	the	DT
10_1101-2021_01_06_425657	37	22	appearance	appearance	NN
10_1101-2021_01_06_425657	37	23	of	of	IN
10_1101-2021_01_06_425657	37	24	a	a	DT
10_1101-2021_01_06_425657	37	25	lower	low	JJR
10_1101-2021_01_06_425657	37	26	form	form	NN
10_1101-2021_01_06_425657	37	27	during	during	IN
10_1101-2021_01_06_425657	37	28	sulfur	sulfur	NN
10_1101-2021_01_06_425657	37	29	starvation	starvation	NN
10_1101-2021_01_06_425657	37	30	111	111	CD
10_1101-2021_01_06_425657	37	31	(	(	-LRB-
10_1101-2021_01_06_425657	37	32	Figure	figure	NN
10_1101-2021_01_06_425657	37	33	S1D	s1d	NN
10_1101-2021_01_06_425657	37	34	)	)	-RRB-
10_1101-2021_01_06_425657	37	35	.	.	.
10_1101-2021_01_06_425657	38	1	Conversely	conversely	RB
10_1101-2021_01_06_425657	38	2	,	,	,
10_1101-2021_01_06_425657	38	3	deletion	deletion	NN
10_1101-2021_01_06_425657	38	4	of	of	IN
10_1101-2021_01_06_425657	38	5	the	the	DT
10_1101-2021_01_06_425657	38	6	first	first	JJ
10_1101-2021_01_06_425657	38	7	20	20	CD
10_1101-2021_01_06_425657	38	8	amino	amino	JJ
10_1101-2021_01_06_425657	38	9	acids	acid	NNS
10_1101-2021_01_06_425657	38	10	containing	contain	VBG
10_1101-2021_01_06_425657	38	11	the	the	DT
10_1101-2021_01_06_425657	38	12	first	first	JJ
10_1101-2021_01_06_425657	38	13	three	three	CD
10_1101-2021_01_06_425657	38	14	methionine	methionine	NN
10_1101-2021_01_06_425657	38	15	112	112	CD
10_1101-2021_01_06_425657	38	16	residues	residue	NNS
10_1101-2021_01_06_425657	38	17	of	of	IN
10_1101-2021_01_06_425657	38	18	Met30	Met30	NNP
10_1101-2021_01_06_425657	38	19	resulted	result	VBD
10_1101-2021_01_06_425657	38	20	in	in	IN
10_1101-2021_01_06_425657	38	21	expression	expression	NN
10_1101-2021_01_06_425657	38	22	of	of	IN
10_1101-2021_01_06_425657	38	23	a	a	DT
10_1101-2021_01_06_425657	38	24	Met30	Met30	NNP
10_1101-2021_01_06_425657	38	25	proteoform	proteoform	NN
10_1101-2021_01_06_425657	38	26	that	that	WDT
10_1101-2021_01_06_425657	38	27	migrated	migrate	VBN
10_1101-2021_01_06_425657	38	28	at	at	IN
10_1101-2021_01_06_425657	38	29	the	the	DT
10_1101-2021_01_06_425657	38	30	apparent	apparent	JJ
10_1101-2021_01_06_425657	38	31	113	113	CD
10_1101-2021_01_06_425657	38	32	molecular	molecular	JJ
10_1101-2021_01_06_425657	38	33	weight	weight	NN
10_1101-2021_01_06_425657	38	34	of	of	IN
10_1101-2021_01_06_425657	38	35	the	the	DT
10_1101-2021_01_06_425657	38	36	wild	wild	JJ
10_1101-2021_01_06_425657	38	37	type	type	NN
10_1101-2021_01_06_425657	38	38	short	short	JJ
10_1101-2021_01_06_425657	38	39	form	form	NN
10_1101-2021_01_06_425657	38	40	and	and	CC
10_1101-2021_01_06_425657	38	41	did	do	VBD
10_1101-2021_01_06_425657	38	42	not	not	RB
10_1101-2021_01_06_425657	38	43	generate	generate	VB
10_1101-2021_01_06_425657	38	44	a	a	DT
10_1101-2021_01_06_425657	38	45	new	new	JJ
10_1101-2021_01_06_425657	38	46	,	,	,
10_1101-2021_01_06_425657	38	47	even	even	RB
10_1101-2021_01_06_425657	38	48	-	-	HYPH
10_1101-2021_01_06_425657	38	49	faster	fast	JJR
10_1101-2021_01_06_425657	38	50	migrating	migrate	VBG
10_1101-2021_01_06_425657	38	51	114	114	CD
10_1101-2021_01_06_425657	38	52	proteoform	proteoform	NN
10_1101-2021_01_06_425657	38	53	under	under	IN
10_1101-2021_01_06_425657	38	54	sulfur	sulfur	NN
10_1101-2021_01_06_425657	38	55	starvation	starvation	NN
10_1101-2021_01_06_425657	38	56	(	(	-LRB-
10_1101-2021_01_06_425657	38	57	Figure	figure	NN
10_1101-2021_01_06_425657	38	58	S1D	s1d	NN
10_1101-2021_01_06_425657	38	59	)	)	-RRB-
10_1101-2021_01_06_425657	38	60	.	.	.
10_1101-2021_01_06_425657	39	1	Moreover	moreover	RB
10_1101-2021_01_06_425657	39	2	,	,	,
10_1101-2021_01_06_425657	39	3	the	the	DT
10_1101-2021_01_06_425657	39	4	Met30M30/35/36A	Met30M30/35/36A	NNP
10_1101-2021_01_06_425657	39	5	and	and	CC
10_1101-2021_01_06_425657	39	6	Met30D1	Met30D1	NNP
10_1101-2021_01_06_425657	39	7	-	-	:
10_1101-2021_01_06_425657	39	8	20	20	CD
10_1101-2021_01_06_425657	39	9	115	115	CD
10_1101-2021_01_06_425657	39	10	strains	strain	NNS
10_1101-2021_01_06_425657	39	11	expressing	express	VBG
10_1101-2021_01_06_425657	39	12	either	either	CC
10_1101-2021_01_06_425657	39	13	solely	solely	RB
10_1101-2021_01_06_425657	39	14	the	the	DT
10_1101-2021_01_06_425657	39	15	long	long	JJ
10_1101-2021_01_06_425657	39	16	or	or	CC
10_1101-2021_01_06_425657	39	17	short	short	JJ
10_1101-2021_01_06_425657	39	18	form	form	NN
10_1101-2021_01_06_425657	39	19	of	of	IN
10_1101-2021_01_06_425657	39	20	the	the	DT
10_1101-2021_01_06_425657	39	21	Met30	Met30	NNP
10_1101-2021_01_06_425657	39	22	protein	protein	NN
10_1101-2021_01_06_425657	39	23	had	have	VBD
10_1101-2021_01_06_425657	39	24	no	no	DT
10_1101-2021_01_06_425657	39	25	obvious	obvious	JJ
10_1101-2021_01_06_425657	39	26	116	116	CD
10_1101-2021_01_06_425657	39	27	phenotype	phenotype	NN
10_1101-2021_01_06_425657	39	28	with	with	IN
10_1101-2021_01_06_425657	39	29	respect	respect	NN
10_1101-2021_01_06_425657	39	30	to	to	IN
10_1101-2021_01_06_425657	39	31	Met4	met4	JJ
10_1101-2021_01_06_425657	39	32	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	39	33	or	or	CC
10_1101-2021_01_06_425657	39	34	growth	growth	NN
10_1101-2021_01_06_425657	39	35	in	in	IN
10_1101-2021_01_06_425657	39	36	high	high	JJ
10_1101-2021_01_06_425657	39	37	or	or	CC
10_1101-2021_01_06_425657	39	38	low	low	JJ
10_1101-2021_01_06_425657	39	39	sulfur	sulfur	NN
10_1101-2021_01_06_425657	39	40	media	medium	NNS
10_1101-2021_01_06_425657	39	41	(	(	-LRB-
10_1101-2021_01_06_425657	39	42	Figure	figure	NN
10_1101-2021_01_06_425657	39	43	S1E	s1e	NN
10_1101-2021_01_06_425657	39	44	)	)	-RRB-
10_1101-2021_01_06_425657	39	45	.	.	.
10_1101-2021_01_06_425657	40	1	117	117	CD
10_1101-2021_01_06_425657	40	2	We	-PRON-	PRP
10_1101-2021_01_06_425657	40	3	conclude	conclude	VBP
10_1101-2021_01_06_425657	40	4	that	that	IN
10_1101-2021_01_06_425657	40	5	the	the	DT
10_1101-2021_01_06_425657	40	6	faster	fast	RBR
10_1101-2021_01_06_425657	40	7	-	-	HYPH
10_1101-2021_01_06_425657	40	8	migrating	migrate	VBG
10_1101-2021_01_06_425657	40	9	proteoform	proteoform	NN
10_1101-2021_01_06_425657	40	10	of	of	IN
10_1101-2021_01_06_425657	40	11	Met30	Met30	NNP
10_1101-2021_01_06_425657	40	12	that	that	WDT
10_1101-2021_01_06_425657	40	13	is	be	VBZ
10_1101-2021_01_06_425657	40	14	produced	produce	VBN
10_1101-2021_01_06_425657	40	15	during	during	IN
10_1101-2021_01_06_425657	40	16	sulfur	sulfur	NN
10_1101-2021_01_06_425657	40	17	118	118	CD
10_1101-2021_01_06_425657	40	18	starvation	starvation	NN
10_1101-2021_01_06_425657	40	19	has	have	VBZ
10_1101-2021_01_06_425657	40	20	no	no	DT
10_1101-2021_01_06_425657	40	21	discernible	discernible	JJ
10_1101-2021_01_06_425657	40	22	effect	effect	NN
10_1101-2021_01_06_425657	40	23	on	on	IN
10_1101-2021_01_06_425657	40	24	sulfur	sulfur	NN
10_1101-2021_01_06_425657	40	25	metabolic	metabolic	JJ
10_1101-2021_01_06_425657	40	26	regulation	regulation	NN
10_1101-2021_01_06_425657	40	27	under	under	IN
10_1101-2021_01_06_425657	40	28	these	these	DT
10_1101-2021_01_06_425657	40	29	conditions	condition	NNS
10_1101-2021_01_06_425657	40	30	.	.	.
10_1101-2021_01_06_425657	41	1	119	119	CD
10_1101-2021_01_06_425657	41	2	120	120	CD
10_1101-2021_01_06_425657	41	3	The	the	DT
10_1101-2021_01_06_425657	41	4	sulfur	sulfur	NN
10_1101-2021_01_06_425657	41	5	amino	amino	NN
10_1101-2021_01_06_425657	41	6	acid	acid	NNP
10_1101-2021_01_06_425657	41	7	biosynthetic	biosynthetic	NNP
10_1101-2021_01_06_425657	41	8	pathway	pathway	NN
10_1101-2021_01_06_425657	41	9	is	be	VBZ
10_1101-2021_01_06_425657	41	10	bifurcated	bifurcate	VBN
10_1101-2021_01_06_425657	41	11	into	into	IN
10_1101-2021_01_06_425657	41	12	two	two	CD
10_1101-2021_01_06_425657	41	13	branches	branch	NNS
10_1101-2021_01_06_425657	41	14	at	at	IN
10_1101-2021_01_06_425657	41	15	the	the	DT
10_1101-2021_01_06_425657	41	16	central	central	JJ
10_1101-2021_01_06_425657	41	17	121	121	CD
10_1101-2021_01_06_425657	41	18	metabolite	metabolite	JJ
10_1101-2021_01_06_425657	41	19	homocysteine	homocysteine	NN
10_1101-2021_01_06_425657	41	20	,	,	,
10_1101-2021_01_06_425657	41	21	where	where	WRB
10_1101-2021_01_06_425657	41	22	this	this	DT
10_1101-2021_01_06_425657	41	23	precursor	precursor	NN
10_1101-2021_01_06_425657	41	24	metabolite	metabolite	NN
10_1101-2021_01_06_425657	41	25	commits	commit	VBZ
10_1101-2021_01_06_425657	41	26	either	either	CC
10_1101-2021_01_06_425657	41	27	to	to	IN
10_1101-2021_01_06_425657	41	28	the	the	DT
10_1101-2021_01_06_425657	41	29	production	production	NN
10_1101-2021_01_06_425657	41	30	of	of	IN
10_1101-2021_01_06_425657	41	31	122	122	CD
10_1101-2021_01_06_425657	41	32	cysteine	cysteine	NN
10_1101-2021_01_06_425657	41	33	or	or	CC
10_1101-2021_01_06_425657	41	34	methionine	methionine	NN
10_1101-2021_01_06_425657	41	35	(	(	-LRB-
10_1101-2021_01_06_425657	41	36	Figure	figure	NN
10_1101-2021_01_06_425657	41	37	1E	1e	NN
10_1101-2021_01_06_425657	41	38	)	)	-RRB-
10_1101-2021_01_06_425657	41	39	.	.	.
10_1101-2021_01_06_425657	42	1	After	after	IN
10_1101-2021_01_06_425657	42	2	confirming	confirm	VBG
10_1101-2021_01_06_425657	42	3	Met30	Met30	NNP
10_1101-2021_01_06_425657	42	4	and	and	CC
10_1101-2021_01_06_425657	42	5	Met4	Met4	NNP
10_1101-2021_01_06_425657	42	6	were	be	VBD
10_1101-2021_01_06_425657	42	7	responding	respond	VBG
10_1101-2021_01_06_425657	42	8	to	to	IN
10_1101-2021_01_06_425657	42	9	sulfur	sulfur	NN
10_1101-2021_01_06_425657	42	10	123	123	CD
10_1101-2021_01_06_425657	42	11	starvation	starvation	NN
10_1101-2021_01_06_425657	42	12	as	as	IN
10_1101-2021_01_06_425657	42	13	expected	expect	VBN
10_1101-2021_01_06_425657	42	14	,	,	,
10_1101-2021_01_06_425657	42	15	we	-PRON-	PRP
10_1101-2021_01_06_425657	42	16	sought	seek	VBD
10_1101-2021_01_06_425657	42	17	to	to	TO
10_1101-2021_01_06_425657	42	18	determine	determine	VB
10_1101-2021_01_06_425657	42	19	whether	whether	IN
10_1101-2021_01_06_425657	42	20	the	the	DT
10_1101-2021_01_06_425657	42	21	cysteine	cysteine	NN
10_1101-2021_01_06_425657	42	22	or	or	CC
10_1101-2021_01_06_425657	42	23	methionine	methionine	JJ
10_1101-2021_01_06_425657	42	24	branch	branch	NN
10_1101-2021_01_06_425657	42	25	of	of	IN
10_1101-2021_01_06_425657	42	26	the	the	DT
10_1101-2021_01_06_425657	42	27	124	124	CD
10_1101-2021_01_06_425657	42	28	sulfur	sulfur	NN
10_1101-2021_01_06_425657	42	29	metabolic	metabolic	JJ
10_1101-2021_01_06_425657	42	30	pathway	pathway	NN
10_1101-2021_01_06_425657	42	31	was	be	VBD
10_1101-2021_01_06_425657	42	32	sufficient	sufficient	JJ
10_1101-2021_01_06_425657	42	33	to	to	TO
10_1101-2021_01_06_425657	42	34	rescue	rescue	VB
10_1101-2021_01_06_425657	42	35	Met30	Met30	NNP
10_1101-2021_01_06_425657	42	36	E3	e3	CC
10_1101-2021_01_06_425657	42	37	ligase	ligase	NN
10_1101-2021_01_06_425657	42	38	activity	activity	NN
10_1101-2021_01_06_425657	42	39	and	and	CC
10_1101-2021_01_06_425657	42	40	re	re	NN
10_1101-2021_01_06_425657	42	41	-	-	NN
10_1101-2021_01_06_425657	42	42	ubiquitinate	ubiquitinate	JJ
10_1101-2021_01_06_425657	42	43	125	125	CD
10_1101-2021_01_06_425657	42	44	Met4	Met4	NNP
10_1101-2021_01_06_425657	42	45	after	after	IN
10_1101-2021_01_06_425657	42	46	sulfur	sulfur	NN
10_1101-2021_01_06_425657	42	47	starvation	starvation	NN
10_1101-2021_01_06_425657	42	48	.	.	.
10_1101-2021_01_06_425657	43	1	To	to	TO
10_1101-2021_01_06_425657	43	2	determine	determine	VB
10_1101-2021_01_06_425657	43	3	whether	whether	IN
10_1101-2021_01_06_425657	43	4	the	the	DT
10_1101-2021_01_06_425657	43	5	synthesis	synthesis	NN
10_1101-2021_01_06_425657	43	6	of	of	IN
10_1101-2021_01_06_425657	43	7	methionine	methionine	NNP
10_1101-2021_01_06_425657	43	8	is	be	VBZ
10_1101-2021_01_06_425657	43	9	necessary	necessary	JJ
10_1101-2021_01_06_425657	43	10	to	to	IN
10_1101-2021_01_06_425657	43	11	126	126	CD
10_1101-2021_01_06_425657	43	12	rescue	rescue	NN
10_1101-2021_01_06_425657	43	13	Met30	Met30	NNP
10_1101-2021_01_06_425657	43	14	activity	activity	NN
10_1101-2021_01_06_425657	43	15	,	,	,
10_1101-2021_01_06_425657	43	16	cells	cell	NNS
10_1101-2021_01_06_425657	43	17	lacking	lack	VBG
10_1101-2021_01_06_425657	43	18	methionine	methionine	NNP
10_1101-2021_01_06_425657	43	19	synthase	synthase	NNP
10_1101-2021_01_06_425657	43	20	(	(	-LRB-
10_1101-2021_01_06_425657	43	21	met6D	met6D	NNP
10_1101-2021_01_06_425657	43	22	)	)	-RRB-
10_1101-2021_01_06_425657	43	23	were	be	VBD
10_1101-2021_01_06_425657	43	24	fed	feed	VBN
10_1101-2021_01_06_425657	43	25	either	either	CC
10_1101-2021_01_06_425657	43	26	homocysteine	homocysteine	JJ
10_1101-2021_01_06_425657	43	27	or	or	CC
10_1101-2021_01_06_425657	43	28	127	127	CD
10_1101-2021_01_06_425657	43	29	methionine	methionine	NN
10_1101-2021_01_06_425657	43	30	after	after	IN
10_1101-2021_01_06_425657	43	31	switching	switch	VBG
10_1101-2021_01_06_425657	43	32	to	to	IN
10_1101-2021_01_06_425657	43	33	sulfur	sulfur	NN
10_1101-2021_01_06_425657	43	34	-	-	HYPH
10_1101-2021_01_06_425657	43	35	free	free	JJ
10_1101-2021_01_06_425657	43	36	lactate	lactate	NN
10_1101-2021_01_06_425657	43	37	(	(	-LRB-
10_1101-2021_01_06_425657	43	38	−Sulfur	−sulfur	NN
10_1101-2021_01_06_425657	43	39	)	)	-RRB-
10_1101-2021_01_06_425657	43	40	media	medium	NNS
10_1101-2021_01_06_425657	43	41	.	.	.
10_1101-2021_01_06_425657	44	1	Interestingly	interestingly	RB
10_1101-2021_01_06_425657	44	2	,	,	,
10_1101-2021_01_06_425657	44	3	cells	cell	NNS
10_1101-2021_01_06_425657	44	4	fed	feed	VBD
10_1101-2021_01_06_425657	44	5	128	128	CD
10_1101-2021_01_06_425657	44	6	homocysteine	homocysteine	NN
10_1101-2021_01_06_425657	44	7	were	be	VBD
10_1101-2021_01_06_425657	44	8	still	still	RB
10_1101-2021_01_06_425657	44	9	able	able	JJ
10_1101-2021_01_06_425657	44	10	to	to	TO
10_1101-2021_01_06_425657	44	11	ubiquitinate	ubiquitinate	VB
10_1101-2021_01_06_425657	44	12	and	and	CC
10_1101-2021_01_06_425657	44	13	degrade	degrade	VB
10_1101-2021_01_06_425657	44	14	Met4	Met4	NNP
10_1101-2021_01_06_425657	44	15	,	,	,
10_1101-2021_01_06_425657	44	16	while	while	IN
10_1101-2021_01_06_425657	44	17	methionine	methionine	JJ
10_1101-2021_01_06_425657	44	18	-	-	HYPH
10_1101-2021_01_06_425657	44	19	fed	fed	NNP
10_1101-2021_01_06_425657	44	20	cells	cell	NNS
10_1101-2021_01_06_425657	44	21	129	129	CD
10_1101-2021_01_06_425657	44	22	appeared	appear	VBD
10_1101-2021_01_06_425657	44	23	to	to	IN
10_1101-2021_01_06_425657	44	24	oligo	oligo	NNP
10_1101-2021_01_06_425657	44	25	-	-	HYPH
10_1101-2021_01_06_425657	44	26	ubiquitinate	ubiquitinate	VB
10_1101-2021_01_06_425657	44	27	and	and	CC
10_1101-2021_01_06_425657	44	28	stabilize	stabilize	VB
10_1101-2021_01_06_425657	44	29	Met4	Met4	NNP
10_1101-2021_01_06_425657	44	30	(	(	-LRB-
10_1101-2021_01_06_425657	44	31	Figure	Figure	NNP
10_1101-2021_01_06_425657	44	32	1D	1D	NNP
10_1101-2021_01_06_425657	44	33	)	)	-RRB-
10_1101-2021_01_06_425657	44	34	.	.	.
10_1101-2021_01_06_425657	45	1	These	these	DT
10_1101-2021_01_06_425657	45	2	observations	observation	NNS
10_1101-2021_01_06_425657	45	3	are	be	VBP
10_1101-2021_01_06_425657	45	4	consistent	consistent	JJ
10_1101-2021_01_06_425657	45	5	130	130	CD
10_1101-2021_01_06_425657	45	6	with	with	IN
10_1101-2021_01_06_425657	45	7	previous	previous	JJ
10_1101-2021_01_06_425657	45	8	reports	report	NNS
10_1101-2021_01_06_425657	45	9	and	and	CC
10_1101-2021_01_06_425657	45	10	suggest	suggest	VBP
10_1101-2021_01_06_425657	45	11	Met30	Met30	NNP
10_1101-2021_01_06_425657	45	12	and	and	CC
10_1101-2021_01_06_425657	45	13	Met4	met4	JJ
10_1101-2021_01_06_425657	45	14	interpret	interpret	NN
10_1101-2021_01_06_425657	45	15	sulfur	sulfur	NN
10_1101-2021_01_06_425657	45	16	sufficiency	sufficiency	NN
10_1101-2021_01_06_425657	45	17	through	through	IN
10_1101-2021_01_06_425657	45	18	both	both	DT
10_1101-2021_01_06_425657	45	19	131	131	CD
10_1101-2021_01_06_425657	45	20	branches	branch	NNS
10_1101-2021_01_06_425657	45	21	of	of	IN
10_1101-2021_01_06_425657	45	22	sulfur	sulfur	NN
10_1101-2021_01_06_425657	45	23	metabolism	metabolism	NN
10_1101-2021_01_06_425657	45	24	to	to	IN
10_1101-2021_01_06_425657	45	25	a	a	DT
10_1101-2021_01_06_425657	45	26	degree	degree	NN
10_1101-2021_01_06_425657	45	27	(	(	-LRB-
10_1101-2021_01_06_425657	45	28	Hansen	Hansen	NNP
10_1101-2021_01_06_425657	45	29	and	and	CC
10_1101-2021_01_06_425657	45	30	Johannesen	Johannesen	NNP
10_1101-2021_01_06_425657	45	31	,	,	,
10_1101-2021_01_06_425657	45	32	2000	2000	CD
10_1101-2021_01_06_425657	45	33	,	,	,
10_1101-2021_01_06_425657	45	34	Kaiser	Kaiser	NNP
10_1101-2021_01_06_425657	45	35	et	et	FW
10_1101-2021_01_06_425657	45	36	al	al	NNP
10_1101-2021_01_06_425657	45	37	.	.	NNP
10_1101-2021_01_06_425657	45	38	,	,	,
10_1101-2021_01_06_425657	45	39	2000	2000	CD
10_1101-2021_01_06_425657	45	40	,	,	,
10_1101-2021_01_06_425657	45	41	132	132	CD
10_1101-2021_01_06_425657	45	42	.CC	.CC	NFP
10_1101-2021_01_06_425657	45	43	-	-	:
10_1101-2021_01_06_425657	45	44	BY	by	IN
10_1101-2021_01_06_425657	45	45	4.0	4.0	CD
10_1101-2021_01_06_425657	45	46	International	International	NNP
10_1101-2021_01_06_425657	45	47	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	45	48	under	under	IN
10_1101-2021_01_06_425657	45	49	a	a	DT
10_1101-2021_01_06_425657	45	50	(	(	-LRB-
10_1101-2021_01_06_425657	45	51	which	which	WDT
10_1101-2021_01_06_425657	45	52	was	be	VBD
10_1101-2021_01_06_425657	45	53	not	not	RB
10_1101-2021_01_06_425657	45	54	certified	certify	VBN
10_1101-2021_01_06_425657	45	55	by	by	IN
10_1101-2021_01_06_425657	45	56	peer	peer	NN
10_1101-2021_01_06_425657	45	57	review	review	NN
10_1101-2021_01_06_425657	45	58	)	)	-RRB-
10_1101-2021_01_06_425657	45	59	is	be	VBZ
10_1101-2021_01_06_425657	45	60	the	the	DT
10_1101-2021_01_06_425657	45	61	author	author	NN
10_1101-2021_01_06_425657	45	62	/	/	SYM
10_1101-2021_01_06_425657	45	63	funder	funder	NN
10_1101-2021_01_06_425657	45	64	,	,	,
10_1101-2021_01_06_425657	45	65	who	who	WP
10_1101-2021_01_06_425657	45	66	has	have	VBZ
10_1101-2021_01_06_425657	45	67	granted	grant	VBN
10_1101-2021_01_06_425657	45	68	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	45	69	a	a	DT
10_1101-2021_01_06_425657	45	70	license	license	NN
10_1101-2021_01_06_425657	45	71	to	to	TO
10_1101-2021_01_06_425657	45	72	display	display	VB
10_1101-2021_01_06_425657	45	73	the	the	DT
10_1101-2021_01_06_425657	45	74	preprint	preprint	NN
10_1101-2021_01_06_425657	45	75	in	in	IN
10_1101-2021_01_06_425657	45	76	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	45	77	.	.	.
10_1101-2021_01_06_425657	46	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	46	2	is	be	VBZ
10_1101-2021_01_06_425657	46	3	made	make	VBN
10_1101-2021_01_06_425657	46	4	The	the	DT
10_1101-2021_01_06_425657	46	5	copyright	copyright	NN
10_1101-2021_01_06_425657	46	6	holder	holder	NN
10_1101-2021_01_06_425657	46	7	for	for	IN
10_1101-2021_01_06_425657	46	8	this	this	DT
10_1101-2021_01_06_425657	46	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	46	10	version	version	NN
10_1101-2021_01_06_425657	46	11	posted	post	VBD
10_1101-2021_01_06_425657	46	12	January	January	NNP
10_1101-2021_01_06_425657	46	13	7	7	CD
10_1101-2021_01_06_425657	46	14	,	,	,
10_1101-2021_01_06_425657	46	15	2021	2021	CD
10_1101-2021_01_06_425657	46	16	.	.	.
10_1101-2021_01_06_425657	46	17	;	;	:
10_1101-2021_01_06_425657	46	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	46	19	:	:	:
10_1101-2021_01_06_425657	46	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	46	21	preprint	preprint	NN
10_1101-2021_01_06_425657	46	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	46	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	46	24	5	5	CD
10_1101-2021_01_06_425657	46	25	Kuras	Kuras	NNP
10_1101-2021_01_06_425657	46	26	et	et	NNP
10_1101-2021_01_06_425657	46	27	al	al	NNP
10_1101-2021_01_06_425657	46	28	.	.	NNP
10_1101-2021_01_06_425657	46	29	,	,	,
10_1101-2021_01_06_425657	46	30	2002	2002	CD
10_1101-2021_01_06_425657	46	31	,	,	,
10_1101-2021_01_06_425657	46	32	Flick	Flick	NNP
10_1101-2021_01_06_425657	46	33	et	et	NNP
10_1101-2021_01_06_425657	46	34	al	al	NNP
10_1101-2021_01_06_425657	46	35	.	.	NNP
10_1101-2021_01_06_425657	46	36	,	,	,
10_1101-2021_01_06_425657	46	37	2004	2004	CD
10_1101-2021_01_06_425657	46	38	,	,	,
10_1101-2021_01_06_425657	46	39	Menant	Menant	NNP
10_1101-2021_01_06_425657	46	40	et	et	NNP
10_1101-2021_01_06_425657	46	41	al	al	NNP
10_1101-2021_01_06_425657	46	42	.	.	NNP
10_1101-2021_01_06_425657	46	43	,	,	,
10_1101-2021_01_06_425657	46	44	2006	2006	CD
10_1101-2021_01_06_425657	46	45	,	,	,
10_1101-2021_01_06_425657	46	46	Sadhu	Sadhu	NNP
10_1101-2021_01_06_425657	46	47	et	et	NNP
10_1101-2021_01_06_425657	46	48	al	al	NNP
10_1101-2021_01_06_425657	46	49	.	.	NNP
10_1101-2021_01_06_425657	46	50	,	,	,
10_1101-2021_01_06_425657	46	51	2014	2014	CD
10_1101-2021_01_06_425657	46	52	)	)	-RRB-
10_1101-2021_01_06_425657	46	53	,	,	,
10_1101-2021_01_06_425657	46	54	with	with	IN
10_1101-2021_01_06_425657	46	55	the	the	DT
10_1101-2021_01_06_425657	46	56	stability	stability	NN
10_1101-2021_01_06_425657	46	57	of	of	IN
10_1101-2021_01_06_425657	46	58	133	133	CD
10_1101-2021_01_06_425657	46	59	Met4	Met4	NNP
10_1101-2021_01_06_425657	46	60	,	,	,
10_1101-2021_01_06_425657	46	61	but	but	CC
10_1101-2021_01_06_425657	46	62	not	not	RB
10_1101-2021_01_06_425657	46	63	the	the	DT
10_1101-2021_01_06_425657	46	64	E3	e3	JJ
10_1101-2021_01_06_425657	46	65	ligase	ligase	NN
10_1101-2021_01_06_425657	46	66	activity	activity	NN
10_1101-2021_01_06_425657	46	67	of	of	IN
10_1101-2021_01_06_425657	46	68	Met30	Met30	NNP
10_1101-2021_01_06_425657	46	69	,	,	,
10_1101-2021_01_06_425657	46	70	apparently	apparently	RB
10_1101-2021_01_06_425657	46	71	dependent	dependent	JJ
10_1101-2021_01_06_425657	46	72	on	on	IN
10_1101-2021_01_06_425657	46	73	the	the	DT
10_1101-2021_01_06_425657	46	74	methionine	methionine	NN
10_1101-2021_01_06_425657	46	75	branch	branch	NN
10_1101-2021_01_06_425657	46	76	.	.	.
10_1101-2021_01_06_425657	47	1	134	134	CD
10_1101-2021_01_06_425657	47	2	135	135	CD
10_1101-2021_01_06_425657	47	3	To	to	TO
10_1101-2021_01_06_425657	47	4	determine	determine	VB
10_1101-2021_01_06_425657	47	5	whether	whether	IN
10_1101-2021_01_06_425657	47	6	Met30	Met30	NNP
10_1101-2021_01_06_425657	47	7	specifically	specifically	RB
10_1101-2021_01_06_425657	47	8	responds	respond	VBZ
10_1101-2021_01_06_425657	47	9	to	to	TO
10_1101-2021_01_06_425657	47	10	cysteine	cysteine	VB
10_1101-2021_01_06_425657	47	11	,	,	,
10_1101-2021_01_06_425657	47	12	cells	cell	NNS
10_1101-2021_01_06_425657	47	13	lacking	lack	VBG
10_1101-2021_01_06_425657	47	14	cystathionine	cystathionine	NN
10_1101-2021_01_06_425657	47	15	beta-136	beta-136	NNP
10_1101-2021_01_06_425657	47	16	lyase	lyase	NN
10_1101-2021_01_06_425657	47	17	(	(	-LRB-
10_1101-2021_01_06_425657	47	18	str3D	str3D	NNP
10_1101-2021_01_06_425657	47	19	)	)	-RRB-
10_1101-2021_01_06_425657	47	20	,	,	,
10_1101-2021_01_06_425657	47	21	the	the	DT
10_1101-2021_01_06_425657	47	22	enzyme	enzyme	NNS
10_1101-2021_01_06_425657	47	23	responsible	responsible	JJ
10_1101-2021_01_06_425657	47	24	for	for	IN
10_1101-2021_01_06_425657	47	25	the	the	DT
10_1101-2021_01_06_425657	47	26	conversion	conversion	NN
10_1101-2021_01_06_425657	47	27	of	of	IN
10_1101-2021_01_06_425657	47	28	cystathionine	cystathionine	NN
10_1101-2021_01_06_425657	47	29	to	to	IN
10_1101-2021_01_06_425657	47	30	homocysteine	homocysteine	NN
10_1101-2021_01_06_425657	47	31	,	,	,
10_1101-2021_01_06_425657	47	32	were	be	VBD
10_1101-2021_01_06_425657	47	33	137	137	CD
10_1101-2021_01_06_425657	47	34	starved	starve	VBN
10_1101-2021_01_06_425657	47	35	of	of	IN
10_1101-2021_01_06_425657	47	36	sulfur	sulfur	NN
10_1101-2021_01_06_425657	47	37	and	and	CC
10_1101-2021_01_06_425657	47	38	fed	fed	NNP
10_1101-2021_01_06_425657	47	39	either	either	CC
10_1101-2021_01_06_425657	47	40	cysteine	cysteine	NN
10_1101-2021_01_06_425657	47	41	or	or	CC
10_1101-2021_01_06_425657	47	42	methionine	methionine	NN
10_1101-2021_01_06_425657	47	43	.	.	.
10_1101-2021_01_06_425657	48	1	This	this	DT
10_1101-2021_01_06_425657	48	2	mutant	mutant	NN
10_1101-2021_01_06_425657	48	3	is	be	VBZ
10_1101-2021_01_06_425657	48	4	incapable	incapable	JJ
10_1101-2021_01_06_425657	48	5	of	of	IN
10_1101-2021_01_06_425657	48	6	synthesizing	synthesize	VBG
10_1101-2021_01_06_425657	48	7	138	138	CD
10_1101-2021_01_06_425657	48	8	methionine	methionine	NN
10_1101-2021_01_06_425657	48	9	from	from	IN
10_1101-2021_01_06_425657	48	10	cysteine	cysteine	NN
10_1101-2021_01_06_425657	48	11	via	via	IN
10_1101-2021_01_06_425657	48	12	the	the	DT
10_1101-2021_01_06_425657	48	13	two	two	CD
10_1101-2021_01_06_425657	48	14	-	-	HYPH
10_1101-2021_01_06_425657	48	15	step	step	NN
10_1101-2021_01_06_425657	48	16	conversion	conversion	NN
10_1101-2021_01_06_425657	48	17	of	of	IN
10_1101-2021_01_06_425657	48	18	cysteine	cysteine	NN
10_1101-2021_01_06_425657	48	19	into	into	IN
10_1101-2021_01_06_425657	48	20	the	the	DT
10_1101-2021_01_06_425657	48	21	common	common	JJ
10_1101-2021_01_06_425657	48	22	precursor	precursor	NN
10_1101-2021_01_06_425657	48	23	139	139	CD
10_1101-2021_01_06_425657	48	24	metabolite	metabolite	NNP
10_1101-2021_01_06_425657	48	25	homocysteine	homocysteine	NN
10_1101-2021_01_06_425657	48	26	.	.	.
10_1101-2021_01_06_425657	49	1	Our	-PRON-	PRP$
10_1101-2021_01_06_425657	49	2	results	result	NNS
10_1101-2021_01_06_425657	49	3	show	show	NN
10_1101-2021_01_06_425657	49	4	cysteine	cysteine	NN
10_1101-2021_01_06_425657	49	5	was	be	VBD
10_1101-2021_01_06_425657	49	6	able	able	JJ
10_1101-2021_01_06_425657	49	7	to	to	TO
10_1101-2021_01_06_425657	49	8	rescue	rescue	VB
10_1101-2021_01_06_425657	49	9	Met30	met30	JJ
10_1101-2021_01_06_425657	49	10	activity	activity	NN
10_1101-2021_01_06_425657	49	11	even	even	RB
10_1101-2021_01_06_425657	49	12	in	in	IN
10_1101-2021_01_06_425657	49	13	a	a	DT
10_1101-2021_01_06_425657	49	14	140	140	CD
10_1101-2021_01_06_425657	49	15	str3D	str3D	NNP
10_1101-2021_01_06_425657	49	16	mutant	mutant	NN
10_1101-2021_01_06_425657	49	17	,	,	,
10_1101-2021_01_06_425657	49	18	further	further	RB
10_1101-2021_01_06_425657	49	19	suggesting	suggest	VBG
10_1101-2021_01_06_425657	49	20	cysteine	cysteine	NN
10_1101-2021_01_06_425657	49	21	or	or	CC
10_1101-2021_01_06_425657	49	22	a	a	DT
10_1101-2021_01_06_425657	49	23	downstream	downstream	JJ
10_1101-2021_01_06_425657	49	24	metabolite	metabolite	NN
10_1101-2021_01_06_425657	49	25	,	,	,
10_1101-2021_01_06_425657	49	26	and	and	CC
10_1101-2021_01_06_425657	49	27	not	not	RB
10_1101-2021_01_06_425657	49	28	methionine	methionine	VB
10_1101-2021_01_06_425657	49	29	,	,	,
10_1101-2021_01_06_425657	49	30	as	as	IN
10_1101-2021_01_06_425657	49	31	the	the	DT
10_1101-2021_01_06_425657	49	32	141	141	CD
10_1101-2021_01_06_425657	49	33	signal	signal	NN
10_1101-2021_01_06_425657	49	34	of	of	IN
10_1101-2021_01_06_425657	49	35	sulfur	sulfur	NN
10_1101-2021_01_06_425657	49	36	sufficiency	sufficiency	NN
10_1101-2021_01_06_425657	49	37	for	for	IN
10_1101-2021_01_06_425657	49	38	Met30	Met30	NNP
10_1101-2021_01_06_425657	49	39	(	(	-LRB-
10_1101-2021_01_06_425657	49	40	Figure	Figure	NNP
10_1101-2021_01_06_425657	49	41	1D	1d	NN
10_1101-2021_01_06_425657	49	42	)	)	-RRB-
10_1101-2021_01_06_425657	49	43	.	.	.
10_1101-2021_01_06_425657	50	1	142	142	CD
10_1101-2021_01_06_425657	50	2	143	143	CD
10_1101-2021_01_06_425657	50	3	CYSTEINE	cysteine	NN
10_1101-2021_01_06_425657	50	4	RESIDUES	residues	NN
10_1101-2021_01_06_425657	50	5	IN	in	IN
10_1101-2021_01_06_425657	50	6	MET30	met30	NN
10_1101-2021_01_06_425657	50	7	ARE	are	VBP
10_1101-2021_01_06_425657	50	8	OXIDIZED	oxidize	VBN
10_1101-2021_01_06_425657	50	9	DURING	during	IN
10_1101-2021_01_06_425657	50	10	SULFUR	SULFUR	NNP
10_1101-2021_01_06_425657	50	11	STARVATION	STARVATION	VBN
10_1101-2021_01_06_425657	50	12	144	144	CD
10_1101-2021_01_06_425657	50	13	145	145	CD
10_1101-2021_01_06_425657	50	14	The	the	DT
10_1101-2021_01_06_425657	50	15	synthesis	synthesis	NN
10_1101-2021_01_06_425657	50	16	of	of	IN
10_1101-2021_01_06_425657	50	17	cysteine	cysteine	NN
10_1101-2021_01_06_425657	50	18	from	from	IN
10_1101-2021_01_06_425657	50	19	homocysteine	homocysteine	JJ
10_1101-2021_01_06_425657	50	20	contributes	contribute	NNS
10_1101-2021_01_06_425657	50	21	to	to	IN
10_1101-2021_01_06_425657	50	22	the	the	DT
10_1101-2021_01_06_425657	50	23	production	production	NN
10_1101-2021_01_06_425657	50	24	of	of	IN
10_1101-2021_01_06_425657	50	25	the	the	DT
10_1101-2021_01_06_425657	50	26	downstream	downstream	JJ
10_1101-2021_01_06_425657	50	27	146	146	CD
10_1101-2021_01_06_425657	50	28	tripeptide	tripeptide	NN
10_1101-2021_01_06_425657	50	29	metabolite	metabolite	JJ
10_1101-2021_01_06_425657	50	30	glutathione	glutathione	NN
10_1101-2021_01_06_425657	50	31	(	(	-LRB-
10_1101-2021_01_06_425657	50	32	GSH	GSH	NNP
10_1101-2021_01_06_425657	50	33	)	)	-RRB-
10_1101-2021_01_06_425657	50	34	,	,	,
10_1101-2021_01_06_425657	50	35	which	which	WDT
10_1101-2021_01_06_425657	50	36	exists	exist	VBZ
10_1101-2021_01_06_425657	50	37	at	at	IN
10_1101-2021_01_06_425657	50	38	millimolar	millimolar	JJ
10_1101-2021_01_06_425657	50	39	concentrations	concentration	NNS
10_1101-2021_01_06_425657	50	40	in	in	IN
10_1101-2021_01_06_425657	50	41	cells	cell	NNS
10_1101-2021_01_06_425657	50	42	and	and	CC
10_1101-2021_01_06_425657	50	43	is	be	VBZ
10_1101-2021_01_06_425657	50	44	147	147	CD
10_1101-2021_01_06_425657	50	45	the	the	DT
10_1101-2021_01_06_425657	50	46	major	major	JJ
10_1101-2021_01_06_425657	50	47	cellular	cellular	JJ
10_1101-2021_01_06_425657	50	48	reductant	reductant	NN
10_1101-2021_01_06_425657	50	49	for	for	IN
10_1101-2021_01_06_425657	50	50	buffering	buffer	VBG
10_1101-2021_01_06_425657	50	51	against	against	IN
10_1101-2021_01_06_425657	50	52	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	50	53	stress	stress	NN
10_1101-2021_01_06_425657	50	54	(	(	-LRB-
10_1101-2021_01_06_425657	50	55	Cuozzo	Cuozzo	NNP
10_1101-2021_01_06_425657	50	56	and	and	CC
10_1101-2021_01_06_425657	50	57	Kaiser	Kaiser	NNP
10_1101-2021_01_06_425657	50	58	,	,	,
10_1101-2021_01_06_425657	50	59	1999	1999	CD
10_1101-2021_01_06_425657	50	60	,	,	,
10_1101-2021_01_06_425657	50	61	Wu	Wu	NNP
10_1101-2021_01_06_425657	50	62	148	148	CD
10_1101-2021_01_06_425657	50	63	et	et	NNP
10_1101-2021_01_06_425657	50	64	al	al	NNP
10_1101-2021_01_06_425657	50	65	.	.	NNP
10_1101-2021_01_06_425657	50	66	,	,	,
10_1101-2021_01_06_425657	50	67	2004	2004	CD
10_1101-2021_01_06_425657	50	68	)	)	-RRB-
10_1101-2021_01_06_425657	50	69	.	.	.
10_1101-2021_01_06_425657	51	1	Specifically	specifically	RB
10_1101-2021_01_06_425657	51	2	,	,	,
10_1101-2021_01_06_425657	51	3	glutathione	glutathione	NN
10_1101-2021_01_06_425657	51	4	serves	serve	VBZ
10_1101-2021_01_06_425657	51	5	to	to	TO
10_1101-2021_01_06_425657	51	6	neutralize	neutralize	VB
10_1101-2021_01_06_425657	51	7	reactive	reactive	JJ
10_1101-2021_01_06_425657	51	8	oxygen	oxygen	NN
10_1101-2021_01_06_425657	51	9	species	specie	NNS
10_1101-2021_01_06_425657	51	10	such	such	JJ
10_1101-2021_01_06_425657	51	11	as	as	IN
10_1101-2021_01_06_425657	51	12	149	149	CD
10_1101-2021_01_06_425657	51	13	peroxides	peroxide	NNS
10_1101-2021_01_06_425657	51	14	and	and	CC
10_1101-2021_01_06_425657	51	15	free	free	JJ
10_1101-2021_01_06_425657	51	16	radicals	radical	NNS
10_1101-2021_01_06_425657	51	17	,	,	,
10_1101-2021_01_06_425657	51	18	detoxify	detoxify	VB
10_1101-2021_01_06_425657	51	19	heavy	heavy	JJ
10_1101-2021_01_06_425657	51	20	metals	metal	NNS
10_1101-2021_01_06_425657	51	21	,	,	,
10_1101-2021_01_06_425657	51	22	and	and	CC
10_1101-2021_01_06_425657	51	23	preserve	preserve	VB
10_1101-2021_01_06_425657	51	24	the	the	DT
10_1101-2021_01_06_425657	51	25	reduced	reduced	JJ
10_1101-2021_01_06_425657	51	26	state	state	NN
10_1101-2021_01_06_425657	51	27	of	of	IN
10_1101-2021_01_06_425657	51	28	protein	protein	NN
10_1101-2021_01_06_425657	51	29	thiols	thiol	VBD
10_1101-2021_01_06_425657	51	30	150	150	CD
10_1101-2021_01_06_425657	51	31	(	(	-LRB-
10_1101-2021_01_06_425657	51	32	Pompella	Pompella	NNP
10_1101-2021_01_06_425657	51	33	et	et	NNP
10_1101-2021_01_06_425657	51	34	al	al	NNP
10_1101-2021_01_06_425657	51	35	.	.	NNP
10_1101-2021_01_06_425657	51	36	,	,	,
10_1101-2021_01_06_425657	51	37	2003	2003	CD
10_1101-2021_01_06_425657	51	38	,	,	,
10_1101-2021_01_06_425657	51	39	Penninckx	Penninckx	NNP
10_1101-2021_01_06_425657	51	40	,	,	,
10_1101-2021_01_06_425657	51	41	2000	2000	CD
10_1101-2021_01_06_425657	51	42	)	)	-RRB-
10_1101-2021_01_06_425657	51	43	.	.	.
10_1101-2021_01_06_425657	52	1	Considering	consider	VBG
10_1101-2021_01_06_425657	52	2	the	the	DT
10_1101-2021_01_06_425657	52	3	relatively	relatively	RB
10_1101-2021_01_06_425657	52	4	high	high	JJ
10_1101-2021_01_06_425657	52	5	number	number	NN
10_1101-2021_01_06_425657	52	6	of	of	IN
10_1101-2021_01_06_425657	52	7	cysteine	cysteine	NN
10_1101-2021_01_06_425657	52	8	151	151	CD
10_1101-2021_01_06_425657	52	9	residues	residue	NNS
10_1101-2021_01_06_425657	52	10	in	in	IN
10_1101-2021_01_06_425657	52	11	Met30	Met30	NNP
10_1101-2021_01_06_425657	52	12	(	(	-LRB-
10_1101-2021_01_06_425657	52	13	Figure	Figure	NNP
10_1101-2021_01_06_425657	52	14	2A	2a	NN
10_1101-2021_01_06_425657	52	15	)	)	-RRB-
10_1101-2021_01_06_425657	52	16	,	,	,
10_1101-2021_01_06_425657	52	17	we	-PRON-	PRP
10_1101-2021_01_06_425657	52	18	sought	seek	VBD
10_1101-2021_01_06_425657	52	19	to	to	TO
10_1101-2021_01_06_425657	52	20	determine	determine	VB
10_1101-2021_01_06_425657	52	21	if	if	IN
10_1101-2021_01_06_425657	52	22	these	these	DT
10_1101-2021_01_06_425657	52	23	residues	residue	NNS
10_1101-2021_01_06_425657	52	24	might	may	MD
10_1101-2021_01_06_425657	52	25	become	become	VB
10_1101-2021_01_06_425657	52	26	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	52	27	152	152	CD
10_1101-2021_01_06_425657	52	28	during	during	IN
10_1101-2021_01_06_425657	52	29	acute	acute	JJ
10_1101-2021_01_06_425657	52	30	sulfur	sulfur	NN
10_1101-2021_01_06_425657	52	31	starvation	starvation	NN
10_1101-2021_01_06_425657	52	32	.	.	.
10_1101-2021_01_06_425657	53	1	Utilizing	utilize	VBG
10_1101-2021_01_06_425657	53	2	the	the	DT
10_1101-2021_01_06_425657	53	3	thiol	thiol	NN
10_1101-2021_01_06_425657	53	4	-	-	HYPH
10_1101-2021_01_06_425657	53	5	modifying	modify	VBG
10_1101-2021_01_06_425657	53	6	agent	agent	NN
10_1101-2021_01_06_425657	53	7	methoxy	methoxy	NNP
10_1101-2021_01_06_425657	53	8	-	-	HYPH
10_1101-2021_01_06_425657	53	9	PEG	peg	NN
10_1101-2021_01_06_425657	53	10	-	-	HYPH
10_1101-2021_01_06_425657	53	11	maleimide	maleimide	NN
10_1101-2021_01_06_425657	53	12	153	153	CD
10_1101-2021_01_06_425657	53	13	(	(	-LRB-
10_1101-2021_01_06_425657	53	14	mPEG2K	mPEG2K	NNP
10_1101-2021_01_06_425657	53	15	-	-	HYPH
10_1101-2021_01_06_425657	53	16	mal	mal	NNP
10_1101-2021_01_06_425657	53	17	)	)	-RRB-
10_1101-2021_01_06_425657	53	18	,	,	,
10_1101-2021_01_06_425657	53	19	which	which	WDT
10_1101-2021_01_06_425657	53	20	adds	add	VBZ
10_1101-2021_01_06_425657	53	21	~2	~2	NFP
10_1101-2021_01_06_425657	53	22	kDa	kDa	NNS
10_1101-2021_01_06_425657	53	23	per	per	IN
10_1101-2021_01_06_425657	53	24	reduced	reduce	VBN
10_1101-2021_01_06_425657	53	25	cysteine	cysteine	NN
10_1101-2021_01_06_425657	53	26	residue	residue	NN
10_1101-2021_01_06_425657	53	27	,	,	,
10_1101-2021_01_06_425657	53	28	we	-PRON-	PRP
10_1101-2021_01_06_425657	53	29	assessed	assess	VBD
10_1101-2021_01_06_425657	53	30	Met30	Met30	NNP
10_1101-2021_01_06_425657	53	31	cysteine	cysteine	VBP
10_1101-2021_01_06_425657	53	32	154	154	CD
10_1101-2021_01_06_425657	53	33	oxidation	oxidation	NN
10_1101-2021_01_06_425657	53	34	in	in	IN
10_1101-2021_01_06_425657	53	35	vivo	vivo	NNP
10_1101-2021_01_06_425657	53	36	by	by	IN
10_1101-2021_01_06_425657	53	37	Western	western	JJ
10_1101-2021_01_06_425657	53	38	blot	blot	NN
10_1101-2021_01_06_425657	53	39	.	.	.
10_1101-2021_01_06_425657	54	1	Theoretically	theoretically	RB
10_1101-2021_01_06_425657	54	2	,	,	,
10_1101-2021_01_06_425657	54	3	full	full	JJ
10_1101-2021_01_06_425657	54	4	modification	modification	NN
10_1101-2021_01_06_425657	54	5	of	of	IN
10_1101-2021_01_06_425657	54	6	the	the	DT
10_1101-2021_01_06_425657	54	7	23	23	CD
10_1101-2021_01_06_425657	54	8	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	54	9	in	in	IN
10_1101-2021_01_06_425657	54	10	Met30	Met30	NNP
10_1101-2021_01_06_425657	54	11	by	by	IN
10_1101-2021_01_06_425657	54	12	155	155	CD
10_1101-2021_01_06_425657	54	13	mPEG2K	mpeg2k	CD
10_1101-2021_01_06_425657	54	14	-	-	HYPH
10_1101-2021_01_06_425657	54	15	mal	mal	NNP
10_1101-2021_01_06_425657	54	16	should	should	MD
10_1101-2021_01_06_425657	54	17	significantly	significantly	RB
10_1101-2021_01_06_425657	54	18	shift	shift	VB
10_1101-2021_01_06_425657	54	19	the	the	DT
10_1101-2021_01_06_425657	54	20	apparent	apparent	JJ
10_1101-2021_01_06_425657	54	21	molecular	molecular	JJ
10_1101-2021_01_06_425657	54	22	weight	weight	NN
10_1101-2021_01_06_425657	54	23	of	of	IN
10_1101-2021_01_06_425657	54	24	Met30	Met30	NNP
10_1101-2021_01_06_425657	54	25	by	by	IN
10_1101-2021_01_06_425657	54	26	~45	~45	:
10_1101-2021_01_06_425657	54	27	-	-	HYPH
10_1101-2021_01_06_425657	54	28	50	50	CD
10_1101-2021_01_06_425657	54	29	kDa	kDa	NNS
10_1101-2021_01_06_425657	54	30	.	.	.
10_1101-2021_01_06_425657	55	1	156	156	CD
10_1101-2021_01_06_425657	55	2	As	as	IN
10_1101-2021_01_06_425657	55	3	expected	expect	VBN
10_1101-2021_01_06_425657	55	4	,	,	,
10_1101-2021_01_06_425657	55	5	Met30	Met30	NNP
10_1101-2021_01_06_425657	55	6	in	in	IN
10_1101-2021_01_06_425657	55	7	sulfur	sulfur	NN
10_1101-2021_01_06_425657	55	8	-	-	HYPH
10_1101-2021_01_06_425657	55	9	replete	replete	JJ
10_1101-2021_01_06_425657	55	10	rich	rich	JJ
10_1101-2021_01_06_425657	55	11	media	medium	NNS
10_1101-2021_01_06_425657	55	12	migrates	migrate	NNS
10_1101-2021_01_06_425657	55	13	at	at	IN
10_1101-2021_01_06_425657	55	14	~140	~140	NN
10_1101-2021_01_06_425657	55	15	kDa	kDa	NNS
10_1101-2021_01_06_425657	55	16	(	(	-LRB-
10_1101-2021_01_06_425657	55	17	Figure	figure	NN
10_1101-2021_01_06_425657	55	18	2B	2b	NN
10_1101-2021_01_06_425657	55	19	,	,	,
10_1101-2021_01_06_425657	55	20	first	first	JJ
10_1101-2021_01_06_425657	55	21	lane	lane	NN
10_1101-2021_01_06_425657	55	22	)	)	-RRB-
10_1101-2021_01_06_425657	55	23	,	,	,
10_1101-2021_01_06_425657	55	24	157	157	CD
10_1101-2021_01_06_425657	55	25	nicely	nicely	RB
10_1101-2021_01_06_425657	55	26	corresponding	correspond	VBG
10_1101-2021_01_06_425657	55	27	to	to	IN
10_1101-2021_01_06_425657	55	28	the	the	DT
10_1101-2021_01_06_425657	55	29	modification	modification	NN
10_1101-2021_01_06_425657	55	30	of	of	IN
10_1101-2021_01_06_425657	55	31	most	most	JJS
10_1101-2021_01_06_425657	55	32	if	if	IN
10_1101-2021_01_06_425657	55	33	not	not	RB
10_1101-2021_01_06_425657	55	34	all	all	DT
10_1101-2021_01_06_425657	55	35	of	of	IN
10_1101-2021_01_06_425657	55	36	its	-PRON-	PRP$
10_1101-2021_01_06_425657	55	37	23	23	CD
10_1101-2021_01_06_425657	55	38	cysteine	cysteine	NN
10_1101-2021_01_06_425657	55	39	residues	residue	NNS
10_1101-2021_01_06_425657	55	40	,	,	,
10_1101-2021_01_06_425657	55	41	suggesting	suggest	VBG
10_1101-2021_01_06_425657	55	42	158	158	CD
10_1101-2021_01_06_425657	55	43	they	-PRON-	PRP
10_1101-2021_01_06_425657	55	44	are	be	VBP
10_1101-2021_01_06_425657	55	45	all	all	RB
10_1101-2021_01_06_425657	55	46	in	in	IN
10_1101-2021_01_06_425657	55	47	the	the	DT
10_1101-2021_01_06_425657	55	48	reduced	reduced	JJ
10_1101-2021_01_06_425657	55	49	state	state	NN
10_1101-2021_01_06_425657	55	50	while	while	IN
10_1101-2021_01_06_425657	55	51	sulfur	sulfur	NN
10_1101-2021_01_06_425657	55	52	levels	level	NNS
10_1101-2021_01_06_425657	55	53	are	be	VBP
10_1101-2021_01_06_425657	55	54	high	high	JJ
10_1101-2021_01_06_425657	55	55	and	and	CC
10_1101-2021_01_06_425657	55	56	Met4	met4	JJ
10_1101-2021_01_06_425657	55	57	is	be	VBZ
10_1101-2021_01_06_425657	55	58	being	be	VBG
10_1101-2021_01_06_425657	55	59	negatively	negatively	RB
10_1101-2021_01_06_425657	55	60	regulated	regulate	VBN
10_1101-2021_01_06_425657	55	61	.	.	.
10_1101-2021_01_06_425657	56	1	159	159	CD
10_1101-2021_01_06_425657	56	2	However	however	RB
10_1101-2021_01_06_425657	56	3	,	,	,
10_1101-2021_01_06_425657	56	4	after	after	IN
10_1101-2021_01_06_425657	56	5	shifting	shift	VBG
10_1101-2021_01_06_425657	56	6	into	into	IN
10_1101-2021_01_06_425657	56	7	sulfur	sulfur	NN
10_1101-2021_01_06_425657	56	8	-	-	HYPH
10_1101-2021_01_06_425657	56	9	free	free	JJ
10_1101-2021_01_06_425657	56	10	minimal	minimal	JJ
10_1101-2021_01_06_425657	56	11	lactate	lactate	JJ
10_1101-2021_01_06_425657	56	12	media	medium	NNS
10_1101-2021_01_06_425657	56	13	,	,	,
10_1101-2021_01_06_425657	56	14	Met30	Met30	NNP
10_1101-2021_01_06_425657	56	15	migrates	migrate	NNS
10_1101-2021_01_06_425657	56	16	at	at	IN
10_1101-2021_01_06_425657	56	17	~80	~80	NFP
10_1101-2021_01_06_425657	56	18	kDa	kDa	NNS
10_1101-2021_01_06_425657	56	19	—	—	:
10_1101-2021_01_06_425657	56	20	160	160	CD
10_1101-2021_01_06_425657	56	21	suggesting	suggest	VBG
10_1101-2021_01_06_425657	56	22	the	the	DT
10_1101-2021_01_06_425657	56	23	majority	majority	NN
10_1101-2021_01_06_425657	56	24	of	of	IN
10_1101-2021_01_06_425657	56	25	its	-PRON-	PRP$
10_1101-2021_01_06_425657	56	26	cysteine	cysteine	JJ
10_1101-2021_01_06_425657	56	27	residues	residue	NNS
10_1101-2021_01_06_425657	56	28	are	be	VBP
10_1101-2021_01_06_425657	56	29	rapidly	rapidly	RB
10_1101-2021_01_06_425657	56	30	becoming	become	VBG
10_1101-2021_01_06_425657	56	31	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	56	32	in	in	IN
10_1101-2021_01_06_425657	56	33	vivo	vivo	NNP
10_1101-2021_01_06_425657	56	34	following	follow	VBG
10_1101-2021_01_06_425657	56	35	161	161	CD
10_1101-2021_01_06_425657	56	36	acute	acute	JJ
10_1101-2021_01_06_425657	56	37	sulfur	sulfur	NN
10_1101-2021_01_06_425657	56	38	starvation	starvation	NN
10_1101-2021_01_06_425657	56	39	(	(	-LRB-
10_1101-2021_01_06_425657	56	40	Figure	figure	NN
10_1101-2021_01_06_425657	56	41	2B	2b	NN
10_1101-2021_01_06_425657	56	42	,	,	,
10_1101-2021_01_06_425657	56	43	second	second	JJ
10_1101-2021_01_06_425657	56	44	and	and	CC
10_1101-2021_01_06_425657	56	45	third	third	JJ
10_1101-2021_01_06_425657	56	46	lane	lane	NN
10_1101-2021_01_06_425657	56	47	)	)	-RRB-
10_1101-2021_01_06_425657	56	48	.	.	.
10_1101-2021_01_06_425657	57	1	In	in	IN
10_1101-2021_01_06_425657	57	2	contrast	contrast	NN
10_1101-2021_01_06_425657	57	3	,	,	,
10_1101-2021_01_06_425657	57	4	the	the	DT
10_1101-2021_01_06_425657	57	5	loading	loading	NN
10_1101-2021_01_06_425657	57	6	control	control	NN
10_1101-2021_01_06_425657	57	7	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	57	8	162	162	CD
10_1101-2021_01_06_425657	57	9	contains	contain	VBZ
10_1101-2021_01_06_425657	57	10	a	a	DT
10_1101-2021_01_06_425657	57	11	single	single	JJ
10_1101-2021_01_06_425657	57	12	cysteine	cysteine	NN
10_1101-2021_01_06_425657	57	13	residue	residue	NN
10_1101-2021_01_06_425657	57	14	,	,	,
10_1101-2021_01_06_425657	57	15	and	and	CC
10_1101-2021_01_06_425657	57	16	did	do	VBD
10_1101-2021_01_06_425657	57	17	not	not	RB
10_1101-2021_01_06_425657	57	18	exhibit	exhibit	VB
10_1101-2021_01_06_425657	57	19	significant	significant	JJ
10_1101-2021_01_06_425657	57	20	oxidation	oxidation	NN
10_1101-2021_01_06_425657	57	21	within	within	IN
10_1101-2021_01_06_425657	57	22	the	the	DT
10_1101-2021_01_06_425657	57	23	same	same	JJ
10_1101-2021_01_06_425657	57	24	time	time	NN
10_1101-2021_01_06_425657	57	25	163	163	CD
10_1101-2021_01_06_425657	57	26	period	period	NN
10_1101-2021_01_06_425657	57	27	of	of	IN
10_1101-2021_01_06_425657	57	28	sulfur	sulfur	NN
10_1101-2021_01_06_425657	57	29	starvation	starvation	NN
10_1101-2021_01_06_425657	57	30	.	.	.
10_1101-2021_01_06_425657	58	1	As	as	IN
10_1101-2021_01_06_425657	58	2	expected	expect	VBN
10_1101-2021_01_06_425657	58	3	,	,	,
10_1101-2021_01_06_425657	58	4	repletion	repletion	NN
10_1101-2021_01_06_425657	58	5	of	of	IN
10_1101-2021_01_06_425657	58	6	sulfur	sulfur	NN
10_1101-2021_01_06_425657	58	7	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	58	8	led	lead	VBD
10_1101-2021_01_06_425657	58	9	to	to	IN
10_1101-2021_01_06_425657	58	10	the	the	DT
10_1101-2021_01_06_425657	58	11	reduction	reduction	NN
10_1101-2021_01_06_425657	58	12	and	and	CC
10_1101-2021_01_06_425657	58	13	164	164	CD
10_1101-2021_01_06_425657	58	14	modification	modification	NN
10_1101-2021_01_06_425657	58	15	of	of	IN
10_1101-2021_01_06_425657	58	16	Met30	Met30	NNP
10_1101-2021_01_06_425657	58	17	’s	’s	POS
10_1101-2021_01_06_425657	58	18	cysteine	cysteine	NN
10_1101-2021_01_06_425657	58	19	residues	residue	NNS
10_1101-2021_01_06_425657	58	20	by	by	IN
10_1101-2021_01_06_425657	58	21	mPEG2K	mPEG2K	NNP
10_1101-2021_01_06_425657	58	22	-	-	HYPH
10_1101-2021_01_06_425657	58	23	mal	mal	NNP
10_1101-2021_01_06_425657	58	24	to	to	IN
10_1101-2021_01_06_425657	58	25	the	the	DT
10_1101-2021_01_06_425657	58	26	extent	extent	NN
10_1101-2021_01_06_425657	58	27	seen	see	VBN
10_1101-2021_01_06_425657	58	28	in	in	IN
10_1101-2021_01_06_425657	58	29	the	the	DT
10_1101-2021_01_06_425657	58	30	rich	rich	JJ
10_1101-2021_01_06_425657	58	31	media	medium	NNS
10_1101-2021_01_06_425657	58	32	165	165	CD
10_1101-2021_01_06_425657	58	33	condition	condition	NN
10_1101-2021_01_06_425657	58	34	.	.	.
10_1101-2021_01_06_425657	59	1	Such	such	JJ
10_1101-2021_01_06_425657	59	2	oxidation	oxidation	NN
10_1101-2021_01_06_425657	59	3	and	and	CC
10_1101-2021_01_06_425657	59	4	re	re	NN
10_1101-2021_01_06_425657	59	5	-	-	NN
10_1101-2021_01_06_425657	59	6	reduction	reduction	NN
10_1101-2021_01_06_425657	59	7	of	of	IN
10_1101-2021_01_06_425657	59	8	Met30	Met30	NNP
10_1101-2021_01_06_425657	59	9	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	59	10	corresponds	correspond	VBZ
10_1101-2021_01_06_425657	59	11	well	well	RB
10_1101-2021_01_06_425657	59	12	with	with	IN
10_1101-2021_01_06_425657	59	13	Met4	Met4	NNP
10_1101-2021_01_06_425657	59	14	166	166	CD
10_1101-2021_01_06_425657	59	15	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	59	16	status	status	NN
10_1101-2021_01_06_425657	59	17	(	(	-LRB-
10_1101-2021_01_06_425657	59	18	Figure	figure	NN
10_1101-2021_01_06_425657	59	19	2B	2B	NNS
10_1101-2021_01_06_425657	59	20	)	)	-RRB-
10_1101-2021_01_06_425657	59	21	.	.	.
10_1101-2021_01_06_425657	60	1	Additionally	additionally	RB
10_1101-2021_01_06_425657	60	2	,	,	,
10_1101-2021_01_06_425657	60	3	when	when	WRB
10_1101-2021_01_06_425657	60	4	cells	cell	NNS
10_1101-2021_01_06_425657	60	5	were	be	VBD
10_1101-2021_01_06_425657	60	6	grown	grow	VBN
10_1101-2021_01_06_425657	60	7	in	in	IN
10_1101-2021_01_06_425657	60	8	sulfur	sulfur	NN
10_1101-2021_01_06_425657	60	9	-	-	HYPH
10_1101-2021_01_06_425657	60	10	free	free	JJ
10_1101-2021_01_06_425657	60	11	media	medium	NNS
10_1101-2021_01_06_425657	60	12	167	167	CD
10_1101-2021_01_06_425657	60	13	containing	contain	VBG
10_1101-2021_01_06_425657	60	14	glucose	glucose	NN
10_1101-2021_01_06_425657	60	15	(	(	-LRB-
10_1101-2021_01_06_425657	60	16	SFD	SFD	NNP
10_1101-2021_01_06_425657	60	17	)	)	-RRB-
10_1101-2021_01_06_425657	60	18	as	as	IN
10_1101-2021_01_06_425657	60	19	the	the	DT
10_1101-2021_01_06_425657	60	20	carbon	carbon	NN
10_1101-2021_01_06_425657	60	21	source	source	NN
10_1101-2021_01_06_425657	60	22	,	,	,
10_1101-2021_01_06_425657	60	23	Met30	Met30	NNP
10_1101-2021_01_06_425657	60	24	also	also	RB
10_1101-2021_01_06_425657	60	25	becomes	become	VBZ
10_1101-2021_01_06_425657	60	26	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	60	27	,	,	,
10_1101-2021_01_06_425657	60	28	although	although	IN
10_1101-2021_01_06_425657	60	29	on	on	IN
10_1101-2021_01_06_425657	60	30	a	a	DT
10_1101-2021_01_06_425657	60	31	168	168	CD
10_1101-2021_01_06_425657	60	32	slower	slow	JJR
10_1101-2021_01_06_425657	60	33	timescale	timescale	NN
10_1101-2021_01_06_425657	60	34	—	—	:
10_1101-2021_01_06_425657	60	35	suggesting	suggest	VBG
10_1101-2021_01_06_425657	60	36	this	this	DT
10_1101-2021_01_06_425657	60	37	mechanism	mechanism	NN
10_1101-2021_01_06_425657	60	38	is	be	VBZ
10_1101-2021_01_06_425657	60	39	not	not	RB
10_1101-2021_01_06_425657	60	40	specific	specific	JJ
10_1101-2021_01_06_425657	60	41	to	to	TO
10_1101-2021_01_06_425657	60	42	yeast	yeast	NN
10_1101-2021_01_06_425657	60	43	grown	grow	VBN
10_1101-2021_01_06_425657	60	44	under	under	IN
10_1101-2021_01_06_425657	60	45	non-169	non-169	NN
10_1101-2021_01_06_425657	60	46	fermentable	fermentable	JJ
10_1101-2021_01_06_425657	60	47	conditions	condition	NNS
10_1101-2021_01_06_425657	60	48	(	(	-LRB-
10_1101-2021_01_06_425657	60	49	Figure	figure	NN
10_1101-2021_01_06_425657	60	50	2C	2c	NN
10_1101-2021_01_06_425657	60	51	)	)	-RRB-
10_1101-2021_01_06_425657	60	52	.	.	.
10_1101-2021_01_06_425657	61	1	170	170	CD
10_1101-2021_01_06_425657	61	2	171	171	CD
10_1101-2021_01_06_425657	61	3	.CC	.CC	:
10_1101-2021_01_06_425657	61	4	-	-	:
10_1101-2021_01_06_425657	61	5	BY	by	IN
10_1101-2021_01_06_425657	61	6	4.0	4.0	CD
10_1101-2021_01_06_425657	61	7	International	International	NNP
10_1101-2021_01_06_425657	61	8	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	61	9	under	under	IN
10_1101-2021_01_06_425657	61	10	a	a	DT
10_1101-2021_01_06_425657	61	11	(	(	-LRB-
10_1101-2021_01_06_425657	61	12	which	which	WDT
10_1101-2021_01_06_425657	61	13	was	be	VBD
10_1101-2021_01_06_425657	61	14	not	not	RB
10_1101-2021_01_06_425657	61	15	certified	certify	VBN
10_1101-2021_01_06_425657	61	16	by	by	IN
10_1101-2021_01_06_425657	61	17	peer	peer	NN
10_1101-2021_01_06_425657	61	18	review	review	NN
10_1101-2021_01_06_425657	61	19	)	)	-RRB-
10_1101-2021_01_06_425657	61	20	is	be	VBZ
10_1101-2021_01_06_425657	61	21	the	the	DT
10_1101-2021_01_06_425657	61	22	author	author	NN
10_1101-2021_01_06_425657	61	23	/	/	SYM
10_1101-2021_01_06_425657	61	24	funder	funder	NN
10_1101-2021_01_06_425657	61	25	,	,	,
10_1101-2021_01_06_425657	61	26	who	who	WP
10_1101-2021_01_06_425657	61	27	has	have	VBZ
10_1101-2021_01_06_425657	61	28	granted	grant	VBN
10_1101-2021_01_06_425657	61	29	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	61	30	a	a	DT
10_1101-2021_01_06_425657	61	31	license	license	NN
10_1101-2021_01_06_425657	61	32	to	to	TO
10_1101-2021_01_06_425657	61	33	display	display	VB
10_1101-2021_01_06_425657	61	34	the	the	DT
10_1101-2021_01_06_425657	61	35	preprint	preprint	NN
10_1101-2021_01_06_425657	61	36	in	in	IN
10_1101-2021_01_06_425657	61	37	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	61	38	.	.	.
10_1101-2021_01_06_425657	62	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	62	2	is	be	VBZ
10_1101-2021_01_06_425657	62	3	made	make	VBN
10_1101-2021_01_06_425657	62	4	The	the	DT
10_1101-2021_01_06_425657	62	5	copyright	copyright	NN
10_1101-2021_01_06_425657	62	6	holder	holder	NN
10_1101-2021_01_06_425657	62	7	for	for	IN
10_1101-2021_01_06_425657	62	8	this	this	DT
10_1101-2021_01_06_425657	62	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	62	10	version	version	NN
10_1101-2021_01_06_425657	62	11	posted	post	VBD
10_1101-2021_01_06_425657	62	12	January	January	NNP
10_1101-2021_01_06_425657	62	13	7	7	CD
10_1101-2021_01_06_425657	62	14	,	,	,
10_1101-2021_01_06_425657	62	15	2021	2021	CD
10_1101-2021_01_06_425657	62	16	.	.	.
10_1101-2021_01_06_425657	62	17	;	;	:
10_1101-2021_01_06_425657	62	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	62	19	:	:	:
10_1101-2021_01_06_425657	62	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	62	21	preprint	preprint	NN
10_1101-2021_01_06_425657	62	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	62	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	62	24	6	6	CD
10_1101-2021_01_06_425657	62	25	Considering	consider	VBG
10_1101-2021_01_06_425657	62	26	the	the	DT
10_1101-2021_01_06_425657	62	27	link	link	NN
10_1101-2021_01_06_425657	62	28	between	between	IN
10_1101-2021_01_06_425657	62	29	sulfur	sulfur	NN
10_1101-2021_01_06_425657	62	30	starvation	starvation	NN
10_1101-2021_01_06_425657	62	31	and	and	CC
10_1101-2021_01_06_425657	62	32	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	62	33	stress	stress	NN
10_1101-2021_01_06_425657	62	34	,	,	,
10_1101-2021_01_06_425657	62	35	we	-PRON-	PRP
10_1101-2021_01_06_425657	62	36	next	next	RB
10_1101-2021_01_06_425657	62	37	assessed	assess	VBD
10_1101-2021_01_06_425657	62	38	whether	whether	IN
10_1101-2021_01_06_425657	62	39	172	172	CD
10_1101-2021_01_06_425657	62	40	simply	simply	RB
10_1101-2021_01_06_425657	62	41	changing	change	VBG
10_1101-2021_01_06_425657	62	42	the	the	DT
10_1101-2021_01_06_425657	62	43	redox	redox	JJ
10_1101-2021_01_06_425657	62	44	state	state	NN
10_1101-2021_01_06_425657	62	45	of	of	IN
10_1101-2021_01_06_425657	62	46	sulfur	sulfur	NN
10_1101-2021_01_06_425657	62	47	-	-	HYPH
10_1101-2021_01_06_425657	62	48	starved	starve	VBN
10_1101-2021_01_06_425657	62	49	cells	cell	NNS
10_1101-2021_01_06_425657	62	50	could	could	MD
10_1101-2021_01_06_425657	62	51	mimic	mimic	VB
10_1101-2021_01_06_425657	62	52	sulfur	sulfur	NN
10_1101-2021_01_06_425657	62	53	repletion	repletion	NN
10_1101-2021_01_06_425657	62	54	with	with	IN
10_1101-2021_01_06_425657	62	55	respect	respect	NN
10_1101-2021_01_06_425657	62	56	173	173	CD
10_1101-2021_01_06_425657	62	57	to	to	IN
10_1101-2021_01_06_425657	62	58	Met30	Met30	NNP
10_1101-2021_01_06_425657	62	59	E3	e3	CC
10_1101-2021_01_06_425657	62	60	ligase	ligase	NN
10_1101-2021_01_06_425657	62	61	activity	activity	NN
10_1101-2021_01_06_425657	62	62	.	.	.
10_1101-2021_01_06_425657	63	1	Addition	addition	NN
10_1101-2021_01_06_425657	63	2	of	of	IN
10_1101-2021_01_06_425657	63	3	the	the	DT
10_1101-2021_01_06_425657	63	4	potent	potent	JJ
10_1101-2021_01_06_425657	63	5	,	,	,
10_1101-2021_01_06_425657	63	6	membrane	membrane	NN
10_1101-2021_01_06_425657	63	7	-	-	HYPH
10_1101-2021_01_06_425657	63	8	permeable	permeable	JJ
10_1101-2021_01_06_425657	63	9	reducing	reduce	VBG
10_1101-2021_01_06_425657	63	10	agent	agent	NN
10_1101-2021_01_06_425657	63	11	DTT	DTT	NNP
10_1101-2021_01_06_425657	63	12	to	to	IN
10_1101-2021_01_06_425657	63	13	174	174	CD
10_1101-2021_01_06_425657	63	14	yeast	yeast	NN
10_1101-2021_01_06_425657	63	15	cells	cell	NNS
10_1101-2021_01_06_425657	63	16	starved	starve	VBN
10_1101-2021_01_06_425657	63	17	of	of	IN
10_1101-2021_01_06_425657	63	18	sulfur	sulfur	NN
10_1101-2021_01_06_425657	63	19	readily	readily	RB
10_1101-2021_01_06_425657	63	20	reversed	reverse	VBN
10_1101-2021_01_06_425657	63	21	Met30	Met30	NNP
10_1101-2021_01_06_425657	63	22	cysteine	cysteine	NN
10_1101-2021_01_06_425657	63	23	oxidation	oxidation	NN
10_1101-2021_01_06_425657	63	24	.	.	.
10_1101-2021_01_06_425657	64	1	DTT	DTT	NNP
10_1101-2021_01_06_425657	64	2	also	also	RB
10_1101-2021_01_06_425657	64	3	resulted	result	VBD
10_1101-2021_01_06_425657	64	4	in	in	IN
10_1101-2021_01_06_425657	64	5	the	the	DT
10_1101-2021_01_06_425657	64	6	175	175	CD
10_1101-2021_01_06_425657	64	7	partial	partial	JJ
10_1101-2021_01_06_425657	64	8	re	re	NN
10_1101-2021_01_06_425657	64	9	-	-	NN
10_1101-2021_01_06_425657	64	10	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	64	11	of	of	IN
10_1101-2021_01_06_425657	64	12	Met4	Met4	NNP
10_1101-2021_01_06_425657	64	13	,	,	,
10_1101-2021_01_06_425657	64	14	suggesting	suggest	VBG
10_1101-2021_01_06_425657	64	15	that	that	IN
10_1101-2021_01_06_425657	64	16	Met30	Met30	NNP
10_1101-2021_01_06_425657	64	17	cysteine	cysteine	VBP
10_1101-2021_01_06_425657	64	18	redox	redox	NN
10_1101-2021_01_06_425657	64	19	status	status	NN
10_1101-2021_01_06_425657	64	20	influences	influence	VBZ
10_1101-2021_01_06_425657	64	21	its	-PRON-	PRP$
10_1101-2021_01_06_425657	64	22	176	176	CD
10_1101-2021_01_06_425657	64	23	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	64	24	activity	activity	NN
10_1101-2021_01_06_425657	64	25	against	against	IN
10_1101-2021_01_06_425657	64	26	Met4	Met4	NNP
10_1101-2021_01_06_425657	64	27	(	(	-LRB-
10_1101-2021_01_06_425657	64	28	Figure	Figure	NNP
10_1101-2021_01_06_425657	64	29	2D	2d	NN
10_1101-2021_01_06_425657	64	30	)	)	-RRB-
10_1101-2021_01_06_425657	64	31	.	.	.
10_1101-2021_01_06_425657	65	1	Taken	take	VBN
10_1101-2021_01_06_425657	65	2	together	together	RB
10_1101-2021_01_06_425657	65	3	,	,	,
10_1101-2021_01_06_425657	65	4	these	these	DT
10_1101-2021_01_06_425657	65	5	data	datum	NNS
10_1101-2021_01_06_425657	65	6	strongly	strongly	RB
10_1101-2021_01_06_425657	65	7	suggest	suggest	VBP
10_1101-2021_01_06_425657	65	8	177	177	CD
10_1101-2021_01_06_425657	65	9	cysteine	cysteine	JJ
10_1101-2021_01_06_425657	65	10	residues	residue	NNS
10_1101-2021_01_06_425657	65	11	within	within	IN
10_1101-2021_01_06_425657	65	12	Met30	Met30	NNP
10_1101-2021_01_06_425657	65	13	are	be	VBP
10_1101-2021_01_06_425657	65	14	poised	poise	VBN
10_1101-2021_01_06_425657	65	15	to	to	TO
10_1101-2021_01_06_425657	65	16	become	become	VB
10_1101-2021_01_06_425657	65	17	rapidly	rapidly	RB
10_1101-2021_01_06_425657	65	18	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	65	19	in	in	IN
10_1101-2021_01_06_425657	65	20	response	response	NN
10_1101-2021_01_06_425657	65	21	to	to	IN
10_1101-2021_01_06_425657	65	22	sulfur	sulfur	NN
10_1101-2021_01_06_425657	65	23	178	178	CD
10_1101-2021_01_06_425657	65	24	starvation	starvation	NN
10_1101-2021_01_06_425657	65	25	,	,	,
10_1101-2021_01_06_425657	65	26	which	which	WDT
10_1101-2021_01_06_425657	65	27	is	be	VBZ
10_1101-2021_01_06_425657	65	28	correlated	correlate	VBN
10_1101-2021_01_06_425657	65	29	with	with	IN
10_1101-2021_01_06_425657	65	30	the	the	DT
10_1101-2021_01_06_425657	65	31	deubiquitination	deubiquitination	NN
10_1101-2021_01_06_425657	65	32	of	of	IN
10_1101-2021_01_06_425657	65	33	its	-PRON-	PRP$
10_1101-2021_01_06_425657	65	34	substrate	substrate	NN
10_1101-2021_01_06_425657	65	35	Met4	Met4	NNP
10_1101-2021_01_06_425657	65	36	.	.	.
10_1101-2021_01_06_425657	66	1	179	179	CD
10_1101-2021_01_06_425657	66	2	180	180	CD
10_1101-2021_01_06_425657	66	3	MET30	met30	NN
10_1101-2021_01_06_425657	66	4	CYSTEINE	CYSTEINE	NNS
10_1101-2021_01_06_425657	66	5	POINT	POINT	VBN
10_1101-2021_01_06_425657	66	6	MUTANTS	mutant	NNS
10_1101-2021_01_06_425657	66	7	EXHIBIT	EXHIBIT	NNP
10_1101-2021_01_06_425657	66	8	DYSREGULATED	dysregulate	VBN
10_1101-2021_01_06_425657	66	9	SULFUR	SULFUR	NNP
10_1101-2021_01_06_425657	66	10	SENSING	sense	VBG
10_1101-2021_01_06_425657	66	11	181	181	CD
10_1101-2021_01_06_425657	66	12	IN	IN	NNP
10_1101-2021_01_06_425657	66	13	VIVO	VIVO	NNP
10_1101-2021_01_06_425657	66	14	182	182	CD
10_1101-2021_01_06_425657	66	15	183	183	CD
10_1101-2021_01_06_425657	66	16	After	after	IN
10_1101-2021_01_06_425657	66	17	establishing	establish	VBG
10_1101-2021_01_06_425657	66	18	Met30	Met30	NNP
10_1101-2021_01_06_425657	66	19	cysteine	cysteine	NN
10_1101-2021_01_06_425657	66	20	redox	redox	NN
10_1101-2021_01_06_425657	66	21	status	status	NN
10_1101-2021_01_06_425657	66	22	as	as	IN
10_1101-2021_01_06_425657	66	23	an	an	DT
10_1101-2021_01_06_425657	66	24	important	important	JJ
10_1101-2021_01_06_425657	66	25	factor	factor	NN
10_1101-2021_01_06_425657	66	26	in	in	IN
10_1101-2021_01_06_425657	66	27	sensing	sense	VBG
10_1101-2021_01_06_425657	66	28	sulfur	sulfur	NN
10_1101-2021_01_06_425657	66	29	starvation	starvation	NN
10_1101-2021_01_06_425657	66	30	,	,	,
10_1101-2021_01_06_425657	66	31	184	184	CD
10_1101-2021_01_06_425657	66	32	we	-PRON-	PRP
10_1101-2021_01_06_425657	66	33	sought	seek	VBD
10_1101-2021_01_06_425657	66	34	to	to	TO
10_1101-2021_01_06_425657	66	35	determine	determine	VB
10_1101-2021_01_06_425657	66	36	whether	whether	IN
10_1101-2021_01_06_425657	66	37	specific	specific	JJ
10_1101-2021_01_06_425657	66	38	residues	residue	NNS
10_1101-2021_01_06_425657	66	39	played	play	VBD
10_1101-2021_01_06_425657	66	40	key	key	JJ
10_1101-2021_01_06_425657	66	41	roles	role	NNS
10_1101-2021_01_06_425657	66	42	in	in	IN
10_1101-2021_01_06_425657	66	43	the	the	DT
10_1101-2021_01_06_425657	66	44	sensing	sensing	NN
10_1101-2021_01_06_425657	66	45	mechanism	mechanism	NN
10_1101-2021_01_06_425657	66	46	.	.	.
10_1101-2021_01_06_425657	67	1	185	185	CD
10_1101-2021_01_06_425657	67	2	Through	through	IN
10_1101-2021_01_06_425657	67	3	site	site	NN
10_1101-2021_01_06_425657	67	4	-	-	HYPH
10_1101-2021_01_06_425657	67	5	directed	direct	VBN
10_1101-2021_01_06_425657	67	6	mutagenesis	mutagenesis	NN
10_1101-2021_01_06_425657	67	7	of	of	IN
10_1101-2021_01_06_425657	67	8	Met30	Met30	NNP
10_1101-2021_01_06_425657	67	9	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	67	10	individually	individually	RB
10_1101-2021_01_06_425657	67	11	and	and	CC
10_1101-2021_01_06_425657	67	12	in	in	IN
10_1101-2021_01_06_425657	67	13	clusters	cluster	NNS
10_1101-2021_01_06_425657	67	14	(	(	-LRB-
10_1101-2021_01_06_425657	67	15	Figure	figure	VB
10_1101-2021_01_06_425657	67	16	S2A	S2A	NNP
10_1101-2021_01_06_425657	67	17	186	186	CD
10_1101-2021_01_06_425657	67	18	and	and	CC
10_1101-2021_01_06_425657	67	19	B	B	NNP
10_1101-2021_01_06_425657	67	20	)	)	-RRB-
10_1101-2021_01_06_425657	67	21	,	,	,
10_1101-2021_01_06_425657	67	22	we	-PRON-	PRP
10_1101-2021_01_06_425657	67	23	observed	observe	VBD
10_1101-2021_01_06_425657	67	24	that	that	IN
10_1101-2021_01_06_425657	67	25	mutation	mutation	NN
10_1101-2021_01_06_425657	67	26	of	of	IN
10_1101-2021_01_06_425657	67	27	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	67	28	in	in	IN
10_1101-2021_01_06_425657	67	29	the	the	DT
10_1101-2021_01_06_425657	67	30	WD-40	WD-40	NNP
10_1101-2021_01_06_425657	67	31	repeat	repeat	NN
10_1101-2021_01_06_425657	67	32	regions	region	NNS
10_1101-2021_01_06_425657	67	33	of	of	IN
10_1101-2021_01_06_425657	67	34	Met30	Met30	NNP
10_1101-2021_01_06_425657	67	35	with	with	IN
10_1101-2021_01_06_425657	67	36	the	the	DT
10_1101-2021_01_06_425657	67	37	187	187	CD
10_1101-2021_01_06_425657	67	38	highest	high	JJS
10_1101-2021_01_06_425657	67	39	concentration	concentration	NN
10_1101-2021_01_06_425657	67	40	of	of	IN
10_1101-2021_01_06_425657	67	41	cysteine	cysteine	NN
10_1101-2021_01_06_425657	67	42	residues	residue	NNS
10_1101-2021_01_06_425657	67	43	(	(	-LRB-
10_1101-2021_01_06_425657	67	44	WD-40	WD-40	NNP
10_1101-2021_01_06_425657	67	45	repeat	repeat	NN
10_1101-2021_01_06_425657	67	46	regions	region	NNS
10_1101-2021_01_06_425657	67	47	4	4	CD
10_1101-2021_01_06_425657	67	48	and	and	CC
10_1101-2021_01_06_425657	67	49	8)	8)	CD
10_1101-2021_01_06_425657	67	50	resulted	result	VBD
10_1101-2021_01_06_425657	67	51	in	in	IN
10_1101-2021_01_06_425657	67	52	dysregulated	dysregulate	VBN
10_1101-2021_01_06_425657	67	53	188	188	CD
10_1101-2021_01_06_425657	67	54	Met4	met4	JJ
10_1101-2021_01_06_425657	67	55	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	67	56	status	status	NN
10_1101-2021_01_06_425657	67	57	(	(	-LRB-
10_1101-2021_01_06_425657	67	58	Figure	Figure	NNP
10_1101-2021_01_06_425657	67	59	3A	3a	NN
10_1101-2021_01_06_425657	67	60	)	)	-RRB-
10_1101-2021_01_06_425657	67	61	and	and	CC
10_1101-2021_01_06_425657	67	62	MET	MET	NNP
10_1101-2021_01_06_425657	67	63	gene	gene	NN
10_1101-2021_01_06_425657	67	64	expression	expression	NN
10_1101-2021_01_06_425657	67	65	(	(	-LRB-
10_1101-2021_01_06_425657	67	66	Figure	Figure	NNP
10_1101-2021_01_06_425657	67	67	3B	3b	NN
10_1101-2021_01_06_425657	67	68	)	)	-RRB-
10_1101-2021_01_06_425657	67	69	.	.	.
10_1101-2021_01_06_425657	68	1	Specifically	specifically	RB
10_1101-2021_01_06_425657	68	2	,	,	,
10_1101-2021_01_06_425657	68	3	189	189	CD
10_1101-2021_01_06_425657	68	4	conservatively	conservatively	RB
10_1101-2021_01_06_425657	68	5	mutating	mutate	VBG
10_1101-2021_01_06_425657	68	6	these	these	DT
10_1101-2021_01_06_425657	68	7	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	68	8	to	to	TO
10_1101-2021_01_06_425657	68	9	serine	serine	VB
10_1101-2021_01_06_425657	68	10	residues	residues	NNP
10_1101-2021_01_06_425657	68	11	mimics	mimic	NNS
10_1101-2021_01_06_425657	68	12	the	the	DT
10_1101-2021_01_06_425657	68	13	reduced	reduced	JJ
10_1101-2021_01_06_425657	68	14	state	state	NN
10_1101-2021_01_06_425657	68	15	of	of	IN
10_1101-2021_01_06_425657	68	16	the	the	DT
10_1101-2021_01_06_425657	68	17	Met30	Met30	NNP
10_1101-2021_01_06_425657	68	18	190	190	CD
10_1101-2021_01_06_425657	68	19	protein	protein	NN
10_1101-2021_01_06_425657	68	20	,	,	,
10_1101-2021_01_06_425657	68	21	resulting	result	VBG
10_1101-2021_01_06_425657	68	22	in	in	IN
10_1101-2021_01_06_425657	68	23	constitutive	constitutive	JJ
10_1101-2021_01_06_425657	68	24	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	68	25	of	of	IN
10_1101-2021_01_06_425657	68	26	Met4	Met4	NNP
10_1101-2021_01_06_425657	68	27	by	by	IN
10_1101-2021_01_06_425657	68	28	Met30	Met30	NNP
10_1101-2021_01_06_425657	68	29	even	even	RB
10_1101-2021_01_06_425657	68	30	when	when	WRB
10_1101-2021_01_06_425657	68	31	cells	cell	NNS
10_1101-2021_01_06_425657	68	32	are	be	VBP
10_1101-2021_01_06_425657	68	33	starved	starve	VBN
10_1101-2021_01_06_425657	68	34	of	of	IN
10_1101-2021_01_06_425657	68	35	191	191	CD
10_1101-2021_01_06_425657	68	36	sulfur	sulfur	NN
10_1101-2021_01_06_425657	68	37	.	.	.
10_1101-2021_01_06_425657	69	1	The	the	DT
10_1101-2021_01_06_425657	69	2	mixed	mixed	JJ
10_1101-2021_01_06_425657	69	3	population	population	NN
10_1101-2021_01_06_425657	69	4	of	of	IN
10_1101-2021_01_06_425657	69	5	ubiquitinated	ubiquitinated	JJ
10_1101-2021_01_06_425657	69	6	and	and	CC
10_1101-2021_01_06_425657	69	7	deubiquitinated	deubiquitinate	VBD
10_1101-2021_01_06_425657	69	8	Met4	Met4	NNP
10_1101-2021_01_06_425657	69	9	in	in	IN
10_1101-2021_01_06_425657	69	10	the	the	DT
10_1101-2021_01_06_425657	69	11	mutant	mutant	NN
10_1101-2021_01_06_425657	69	12	strains	strain	VBZ
10_1101-2021_01_06_425657	69	13	192	192	CD
10_1101-2021_01_06_425657	69	14	resulted	result	VBD
10_1101-2021_01_06_425657	69	15	in	in	IN
10_1101-2021_01_06_425657	69	16	reduced	reduce	VBN
10_1101-2021_01_06_425657	69	17	induction	induction	NN
10_1101-2021_01_06_425657	69	18	of	of	IN
10_1101-2021_01_06_425657	69	19	SAM1	SAM1	NNP
10_1101-2021_01_06_425657	69	20	and	and	CC
10_1101-2021_01_06_425657	69	21	GSH1	GSH1	NNP
10_1101-2021_01_06_425657	69	22	,	,	,
10_1101-2021_01_06_425657	69	23	while	while	IN
10_1101-2021_01_06_425657	69	24	MET17	MET17	NNP
10_1101-2021_01_06_425657	69	25	appears	appear	VBZ
10_1101-2021_01_06_425657	69	26	to	to	TO
10_1101-2021_01_06_425657	69	27	be	be	VB
10_1101-2021_01_06_425657	69	28	upregulated	upregulate	VBN
10_1101-2021_01_06_425657	69	29	in	in	IN
10_1101-2021_01_06_425657	69	30	the	the	DT
10_1101-2021_01_06_425657	69	31	193	193	CD
10_1101-2021_01_06_425657	69	32	mutants	mutant	NNS
10_1101-2021_01_06_425657	69	33	but	but	CC
10_1101-2021_01_06_425657	69	34	is	be	VBZ
10_1101-2021_01_06_425657	69	35	largely	largely	RB
10_1101-2021_01_06_425657	69	36	insensitive	insensitive	JJ
10_1101-2021_01_06_425657	69	37	to	to	IN
10_1101-2021_01_06_425657	69	38	the	the	DT
10_1101-2021_01_06_425657	69	39	changes	change	NNS
10_1101-2021_01_06_425657	69	40	in	in	IN
10_1101-2021_01_06_425657	69	41	the	the	DT
10_1101-2021_01_06_425657	69	42	sulfur	sulfur	NN
10_1101-2021_01_06_425657	69	43	status	status	NN
10_1101-2021_01_06_425657	69	44	of	of	IN
10_1101-2021_01_06_425657	69	45	the	the	DT
10_1101-2021_01_06_425657	69	46	cell	cell	NN
10_1101-2021_01_06_425657	69	47	.	.	.
10_1101-2021_01_06_425657	70	1	Interestingly	interestingly	RB
10_1101-2021_01_06_425657	70	2	,	,	,
10_1101-2021_01_06_425657	70	3	a	a	DT
10_1101-2021_01_06_425657	70	4	194	194	CD
10_1101-2021_01_06_425657	70	5	single	single	JJ
10_1101-2021_01_06_425657	70	6	cysteine	cysteine	NN
10_1101-2021_01_06_425657	70	7	to	to	IN
10_1101-2021_01_06_425657	70	8	serine	serine	NNP
10_1101-2021_01_06_425657	70	9	mutant	mutant	NNP
10_1101-2021_01_06_425657	70	10	,	,	,
10_1101-2021_01_06_425657	70	11	C414S	C414S	NNP
10_1101-2021_01_06_425657	70	12	,	,	,
10_1101-2021_01_06_425657	70	13	phenocopies	phenocopie	VBZ
10_1101-2021_01_06_425657	70	14	the	the	DT
10_1101-2021_01_06_425657	70	15	grouped	group	VBN
10_1101-2021_01_06_425657	70	16	cysteine	cysteine	NN
10_1101-2021_01_06_425657	70	17	to	to	IN
10_1101-2021_01_06_425657	70	18	serine	serine	NNP
10_1101-2021_01_06_425657	70	19	mutants	mutant	NNS
10_1101-2021_01_06_425657	70	20	195	195	CD
10_1101-2021_01_06_425657	70	21	C414/426/436/439S	c414/426/436/439s	NN
10_1101-2021_01_06_425657	70	22	(	(	-LRB-
10_1101-2021_01_06_425657	70	23	data	datum	NNS
10_1101-2021_01_06_425657	70	24	not	not	RB
10_1101-2021_01_06_425657	70	25	shown	show	VBN
10_1101-2021_01_06_425657	70	26	)	)	-RRB-
10_1101-2021_01_06_425657	70	27	and	and	CC
10_1101-2021_01_06_425657	70	28	C614/616/622/630S.	C614/616/622/630S.	NNP
10_1101-2021_01_06_425657	71	1	These	these	DT
10_1101-2021_01_06_425657	71	2	mutants	mutant	NNS
10_1101-2021_01_06_425657	71	3	also	also	RB
10_1101-2021_01_06_425657	71	4	exhibit	exhibit	VBP
10_1101-2021_01_06_425657	71	5	slight	slight	JJ
10_1101-2021_01_06_425657	71	6	196	196	CD
10_1101-2021_01_06_425657	71	7	growth	growth	NN
10_1101-2021_01_06_425657	71	8	phenotypes	phenotype	NNS
10_1101-2021_01_06_425657	71	9	when	when	WRB
10_1101-2021_01_06_425657	71	10	cultured	culture	VBN
10_1101-2021_01_06_425657	71	11	in	in	IN
10_1101-2021_01_06_425657	71	12	both	both	CC
10_1101-2021_01_06_425657	71	13	rich	rich	JJ
10_1101-2021_01_06_425657	71	14	and	and	CC
10_1101-2021_01_06_425657	71	15	−sulfur	−sulfur	JJ
10_1101-2021_01_06_425657	71	16	lactate	lactate	JJ
10_1101-2021_01_06_425657	71	17	media	medium	NNS
10_1101-2021_01_06_425657	71	18	supplemented	supplement	VBN
10_1101-2021_01_06_425657	71	19	with	with	IN
10_1101-2021_01_06_425657	71	20	197	197	CD
10_1101-2021_01_06_425657	71	21	homocysteine	homocysteine	JJ
10_1101-2021_01_06_425657	71	22	(	(	-LRB-
10_1101-2021_01_06_425657	71	23	Figure	figure	NN
10_1101-2021_01_06_425657	71	24	3C	3c	NN
10_1101-2021_01_06_425657	71	25	)	)	-RRB-
10_1101-2021_01_06_425657	71	26	.	.	.
10_1101-2021_01_06_425657	72	1	Furthermore	furthermore	RB
10_1101-2021_01_06_425657	72	2	,	,	,
10_1101-2021_01_06_425657	72	3	these	these	DT
10_1101-2021_01_06_425657	72	4	point	point	NN
10_1101-2021_01_06_425657	72	5	mutants	mutant	NNS
10_1101-2021_01_06_425657	72	6	only	only	RB
10_1101-2021_01_06_425657	72	7	effect	effect	VBP
10_1101-2021_01_06_425657	72	8	Met4	met4	JJ
10_1101-2021_01_06_425657	72	9	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	72	10	in	in	IN
10_1101-2021_01_06_425657	72	11	198	198	CD
10_1101-2021_01_06_425657	72	12	the	the	DT
10_1101-2021_01_06_425657	72	13	context	context	NN
10_1101-2021_01_06_425657	72	14	of	of	IN
10_1101-2021_01_06_425657	72	15	sulfur	sulfur	NN
10_1101-2021_01_06_425657	72	16	starvation	starvation	NN
10_1101-2021_01_06_425657	72	17	,	,	,
10_1101-2021_01_06_425657	72	18	as	as	IN
10_1101-2021_01_06_425657	72	19	strains	strain	NNS
10_1101-2021_01_06_425657	72	20	expressing	express	VBG
10_1101-2021_01_06_425657	72	21	these	these	DT
10_1101-2021_01_06_425657	72	22	mutants	mutant	NNS
10_1101-2021_01_06_425657	72	23	exhibited	exhibit	VBD
10_1101-2021_01_06_425657	72	24	a	a	DT
10_1101-2021_01_06_425657	72	25	normal	normal	JJ
10_1101-2021_01_06_425657	72	26	response	response	NN
10_1101-2021_01_06_425657	72	27	to	to	IN
10_1101-2021_01_06_425657	72	28	199	199	CD
10_1101-2021_01_06_425657	72	29	cadmium	cadmium	NN
10_1101-2021_01_06_425657	72	30	as	as	IN
10_1101-2021_01_06_425657	72	31	evidenced	evidence	VBN
10_1101-2021_01_06_425657	72	32	by	by	IN
10_1101-2021_01_06_425657	72	33	rapid	rapid	JJ
10_1101-2021_01_06_425657	72	34	deubiquitination	deubiquitination	NN
10_1101-2021_01_06_425657	72	35	of	of	IN
10_1101-2021_01_06_425657	72	36	Met4	Met4	NNP
10_1101-2021_01_06_425657	72	37	(	(	-LRB-
10_1101-2021_01_06_425657	72	38	Figure	Figure	NNP
10_1101-2021_01_06_425657	72	39	S2C	s2c	NN
10_1101-2021_01_06_425657	72	40	)	)	-RRB-
10_1101-2021_01_06_425657	72	41	.	.	.
10_1101-2021_01_06_425657	73	1	200	200	CD
10_1101-2021_01_06_425657	73	2	201	201	CD
10_1101-2021_01_06_425657	73	3	MET30	met30	NN
10_1101-2021_01_06_425657	73	4	CYSTEINE	CYSTEINE	NNS
10_1101-2021_01_06_425657	73	5	OXIDATION	oxidation	NN
10_1101-2021_01_06_425657	73	6	DISRUPTS	disrupt	NNS
10_1101-2021_01_06_425657	73	7	UBIQUITINATION	ubiquitination	NN
10_1101-2021_01_06_425657	73	8	AND	and	CC
10_1101-2021_01_06_425657	73	9	BINDING	binding	NN
10_1101-2021_01_06_425657	73	10	OF	of	IN
10_1101-2021_01_06_425657	73	11	202	202	CD
10_1101-2021_01_06_425657	73	12	MET4	MET4	NNP
10_1101-2021_01_06_425657	73	13	IN	in	IN
10_1101-2021_01_06_425657	73	14	VITRO	VITRO	NNP
10_1101-2021_01_06_425657	73	15	203	203	CD
10_1101-2021_01_06_425657	73	16	204	204	CD
10_1101-2021_01_06_425657	73	17	Having	have	VBG
10_1101-2021_01_06_425657	73	18	observed	observe	VBN
10_1101-2021_01_06_425657	73	19	that	that	IN
10_1101-2021_01_06_425657	73	20	Met30	Met30	NNP
10_1101-2021_01_06_425657	73	21	cysteine	cysteine	JJ
10_1101-2021_01_06_425657	73	22	redox	redox	NN
10_1101-2021_01_06_425657	73	23	status	status	NN
10_1101-2021_01_06_425657	73	24	is	be	VBZ
10_1101-2021_01_06_425657	73	25	correlated	correlate	VBN
10_1101-2021_01_06_425657	73	26	with	with	IN
10_1101-2021_01_06_425657	73	27	Met4	met4	JJ
10_1101-2021_01_06_425657	73	28	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	73	29	status	status	NN
10_1101-2021_01_06_425657	73	30	in	in	IN
10_1101-2021_01_06_425657	73	31	205	205	CD
10_1101-2021_01_06_425657	73	32	vivo	vivo	NN
10_1101-2021_01_06_425657	73	33	,	,	,
10_1101-2021_01_06_425657	73	34	we	-PRON-	PRP
10_1101-2021_01_06_425657	73	35	next	next	RB
10_1101-2021_01_06_425657	73	36	sought	seek	VBD
10_1101-2021_01_06_425657	73	37	to	to	TO
10_1101-2021_01_06_425657	73	38	determine	determine	VB
10_1101-2021_01_06_425657	73	39	whether	whether	IN
10_1101-2021_01_06_425657	73	40	the	the	DT
10_1101-2021_01_06_425657	73	41	sulfur	sulfur	NN
10_1101-2021_01_06_425657	73	42	/	/	SYM
10_1101-2021_01_06_425657	73	43	redox	redox	NN
10_1101-2021_01_06_425657	73	44	-	-	HYPH
10_1101-2021_01_06_425657	73	45	sensing	sense	VBG
10_1101-2021_01_06_425657	73	46	ability	ability	NN
10_1101-2021_01_06_425657	73	47	of	of	IN
10_1101-2021_01_06_425657	73	48	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	73	49	E3	E3	NNP
10_1101-2021_01_06_425657	73	50	ligase	ligase	NN
10_1101-2021_01_06_425657	73	51	206	206	CD
10_1101-2021_01_06_425657	73	52	activity	activity	NN
10_1101-2021_01_06_425657	73	53	could	could	MD
10_1101-2021_01_06_425657	73	54	be	be	VB
10_1101-2021_01_06_425657	73	55	reconstituted	reconstitute	VBN
10_1101-2021_01_06_425657	73	56	in	in	IN
10_1101-2021_01_06_425657	73	57	vitro	vitro	FW
10_1101-2021_01_06_425657	73	58	.	.	.
10_1101-2021_01_06_425657	74	1	To	to	IN
10_1101-2021_01_06_425657	74	2	this	this	DT
10_1101-2021_01_06_425657	74	3	end	end	NN
10_1101-2021_01_06_425657	74	4	,	,	,
10_1101-2021_01_06_425657	74	5	we	-PRON-	PRP
10_1101-2021_01_06_425657	74	6	performed	perform	VBD
10_1101-2021_01_06_425657	74	7	large	large	JJ
10_1101-2021_01_06_425657	74	8	scale	scale	NN
10_1101-2021_01_06_425657	74	9	immuno	immuno	NN
10_1101-2021_01_06_425657	74	10	-	-	HYPH
10_1101-2021_01_06_425657	74	11	purifications	purification	NNS
10_1101-2021_01_06_425657	74	12	207	207	CD
10_1101-2021_01_06_425657	74	13	of	of	IN
10_1101-2021_01_06_425657	74	14	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	74	15	to	to	TO
10_1101-2021_01_06_425657	74	16	pull	pull	VB
10_1101-2021_01_06_425657	74	17	down	down	RP
10_1101-2021_01_06_425657	74	18	Met30	Met30	NNP
10_1101-2021_01_06_425657	74	19	and	and	CC
10_1101-2021_01_06_425657	74	20	its	-PRON-	PRP$
10_1101-2021_01_06_425657	74	21	interacting	interact	VBG
10_1101-2021_01_06_425657	74	22	partners	partner	NNS
10_1101-2021_01_06_425657	74	23	in	in	IN
10_1101-2021_01_06_425657	74	24	both	both	CC
10_1101-2021_01_06_425657	74	25	high	high	JJ
10_1101-2021_01_06_425657	74	26	and	and	CC
10_1101-2021_01_06_425657	74	27	low	low	JJ
10_1101-2021_01_06_425657	74	28	sulfur	sulfur	NN
10_1101-2021_01_06_425657	74	29	208	208	CD
10_1101-2021_01_06_425657	74	30	conditions	condition	NNS
10_1101-2021_01_06_425657	74	31	for	for	IN
10_1101-2021_01_06_425657	74	32	in	in	IN
10_1101-2021_01_06_425657	74	33	vitro	vitro	FW
10_1101-2021_01_06_425657	74	34	ubiquitination	ubiquitination	NNP
10_1101-2021_01_06_425657	74	35	assays	assays	RB
10_1101-2021_01_06_425657	74	36	with	with	IN
10_1101-2021_01_06_425657	74	37	recombinantly	recombinantly	RB
10_1101-2021_01_06_425657	74	38	purified	purify	VBN
10_1101-2021_01_06_425657	74	39	E1	e1	NN
10_1101-2021_01_06_425657	74	40	,	,	,
10_1101-2021_01_06_425657	74	41	E2	e2	NN
10_1101-2021_01_06_425657	74	42	,	,	,
10_1101-2021_01_06_425657	74	43	and	and	CC
10_1101-2021_01_06_425657	74	44	Met4	Met4	NNP
10_1101-2021_01_06_425657	74	45	(	(	-LRB-
10_1101-2021_01_06_425657	74	46	Figure	Figure	NNP
10_1101-2021_01_06_425657	74	47	209	209	CD
10_1101-2021_01_06_425657	74	48	4A	4A	NNS
10_1101-2021_01_06_425657	74	49	)	)	-RRB-
10_1101-2021_01_06_425657	74	50	.	.	.
10_1101-2021_01_06_425657	75	1	Initial	initial	JJ
10_1101-2021_01_06_425657	75	2	in	in	FW
10_1101-2021_01_06_425657	75	3	vitro	vitro	FW
10_1101-2021_01_06_425657	75	4	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	75	5	experiments	experiment	NNS
10_1101-2021_01_06_425657	75	6	showed	show	VBD
10_1101-2021_01_06_425657	75	7	little	little	JJ
10_1101-2021_01_06_425657	75	8	difference	difference	NN
10_1101-2021_01_06_425657	75	9	in	in	IN
10_1101-2021_01_06_425657	75	10	activity	activity	NN
10_1101-2021_01_06_425657	75	11	between	between	IN
10_1101-2021_01_06_425657	75	12	the	the	DT
10_1101-2021_01_06_425657	75	13	two	two	CD
10_1101-2021_01_06_425657	75	14	210	210	CD
10_1101-2021_01_06_425657	75	15	.CC	.CC	NFP
10_1101-2021_01_06_425657	75	16	-	-	:
10_1101-2021_01_06_425657	75	17	BY	by	IN
10_1101-2021_01_06_425657	75	18	4.0	4.0	CD
10_1101-2021_01_06_425657	75	19	International	International	NNP
10_1101-2021_01_06_425657	75	20	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	75	21	under	under	IN
10_1101-2021_01_06_425657	75	22	a	a	DT
10_1101-2021_01_06_425657	75	23	(	(	-LRB-
10_1101-2021_01_06_425657	75	24	which	which	WDT
10_1101-2021_01_06_425657	75	25	was	be	VBD
10_1101-2021_01_06_425657	75	26	not	not	RB
10_1101-2021_01_06_425657	75	27	certified	certify	VBN
10_1101-2021_01_06_425657	75	28	by	by	IN
10_1101-2021_01_06_425657	75	29	peer	peer	NN
10_1101-2021_01_06_425657	75	30	review	review	NN
10_1101-2021_01_06_425657	75	31	)	)	-RRB-
10_1101-2021_01_06_425657	75	32	is	be	VBZ
10_1101-2021_01_06_425657	75	33	the	the	DT
10_1101-2021_01_06_425657	75	34	author	author	NN
10_1101-2021_01_06_425657	75	35	/	/	SYM
10_1101-2021_01_06_425657	75	36	funder	funder	NN
10_1101-2021_01_06_425657	75	37	,	,	,
10_1101-2021_01_06_425657	75	38	who	who	WP
10_1101-2021_01_06_425657	75	39	has	have	VBZ
10_1101-2021_01_06_425657	75	40	granted	grant	VBN
10_1101-2021_01_06_425657	75	41	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	75	42	a	a	DT
10_1101-2021_01_06_425657	75	43	license	license	NN
10_1101-2021_01_06_425657	75	44	to	to	TO
10_1101-2021_01_06_425657	75	45	display	display	VB
10_1101-2021_01_06_425657	75	46	the	the	DT
10_1101-2021_01_06_425657	75	47	preprint	preprint	NN
10_1101-2021_01_06_425657	75	48	in	in	IN
10_1101-2021_01_06_425657	75	49	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	75	50	.	.	.
10_1101-2021_01_06_425657	76	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	76	2	is	be	VBZ
10_1101-2021_01_06_425657	76	3	made	make	VBN
10_1101-2021_01_06_425657	76	4	The	the	DT
10_1101-2021_01_06_425657	76	5	copyright	copyright	NN
10_1101-2021_01_06_425657	76	6	holder	holder	NN
10_1101-2021_01_06_425657	76	7	for	for	IN
10_1101-2021_01_06_425657	76	8	this	this	DT
10_1101-2021_01_06_425657	76	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	76	10	version	version	NN
10_1101-2021_01_06_425657	76	11	posted	post	VBD
10_1101-2021_01_06_425657	76	12	January	January	NNP
10_1101-2021_01_06_425657	76	13	7	7	CD
10_1101-2021_01_06_425657	76	14	,	,	,
10_1101-2021_01_06_425657	76	15	2021	2021	CD
10_1101-2021_01_06_425657	76	16	.	.	.
10_1101-2021_01_06_425657	76	17	;	;	:
10_1101-2021_01_06_425657	76	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	76	19	:	:	:
10_1101-2021_01_06_425657	76	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	76	21	preprint	preprint	NN
10_1101-2021_01_06_425657	76	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	76	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	76	24	7	7	CD
10_1101-2021_01_06_425657	76	25	conditions	condition	NNS
10_1101-2021_01_06_425657	76	26	,	,	,
10_1101-2021_01_06_425657	76	27	mirroring	mirror	VBG
10_1101-2021_01_06_425657	76	28	prior	prior	JJ
10_1101-2021_01_06_425657	76	29	efforts	effort	NNS
10_1101-2021_01_06_425657	76	30	to	to	TO
10_1101-2021_01_06_425657	76	31	demonstrate	demonstrate	VB
10_1101-2021_01_06_425657	76	32	differential	differential	JJ
10_1101-2021_01_06_425657	76	33	activity	activity	NN
10_1101-2021_01_06_425657	76	34	of	of	IN
10_1101-2021_01_06_425657	76	35	the	the	DT
10_1101-2021_01_06_425657	76	36	Met30	Met30	NNP
10_1101-2021_01_06_425657	76	37	E3	e3	NN
10_1101-2021_01_06_425657	76	38	ligase	ligase	NN
10_1101-2021_01_06_425657	76	39	in	in	IN
10_1101-2021_01_06_425657	76	40	211	211	CD
10_1101-2021_01_06_425657	76	41	response	response	NN
10_1101-2021_01_06_425657	76	42	to	to	IN
10_1101-2021_01_06_425657	76	43	stimuli	stimulus	NNS
10_1101-2021_01_06_425657	76	44	that	that	WDT
10_1101-2021_01_06_425657	76	45	effect	effect	VBP
10_1101-2021_01_06_425657	76	46	its	-PRON-	PRP$
10_1101-2021_01_06_425657	76	47	activity	activity	NN
10_1101-2021_01_06_425657	76	48	in	in	IN
10_1101-2021_01_06_425657	76	49	vivo	vivo	NNP
10_1101-2021_01_06_425657	76	50	(	(	-LRB-
10_1101-2021_01_06_425657	76	51	Figure	Figure	NNP
10_1101-2021_01_06_425657	76	52	S3A	s3a	NN
10_1101-2021_01_06_425657	76	53	)	)	-RRB-
10_1101-2021_01_06_425657	76	54	(	(	-LRB-
10_1101-2021_01_06_425657	76	55	Barbey	Barbey	NNP
10_1101-2021_01_06_425657	76	56	et	et	NNP
10_1101-2021_01_06_425657	76	57	al	al	NNP
10_1101-2021_01_06_425657	76	58	.	.	NNP
10_1101-2021_01_06_425657	76	59	,	,	,
10_1101-2021_01_06_425657	76	60	2005	2005	CD
10_1101-2021_01_06_425657	76	61	)	)	-RRB-
10_1101-2021_01_06_425657	76	62	.	.	.
10_1101-2021_01_06_425657	77	1	212	212	CD
10_1101-2021_01_06_425657	77	2	213	213	CD
10_1101-2021_01_06_425657	77	3	Since	since	IN
10_1101-2021_01_06_425657	77	4	the	the	DT
10_1101-2021_01_06_425657	77	5	cysteine	cysteine	NN
10_1101-2021_01_06_425657	77	6	residues	residue	NNS
10_1101-2021_01_06_425657	77	7	within	within	IN
10_1101-2021_01_06_425657	77	8	Met30	Met30	NNP
10_1101-2021_01_06_425657	77	9	became	become	VBD
10_1101-2021_01_06_425657	77	10	rapidly	rapidly	RB
10_1101-2021_01_06_425657	77	11	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	77	12	in	in	IN
10_1101-2021_01_06_425657	77	13	sulfur	sulfur	NN
10_1101-2021_01_06_425657	77	14	-	-	HYPH
10_1101-2021_01_06_425657	77	15	free	free	JJ
10_1101-2021_01_06_425657	77	16	conditions	condition	NNS
10_1101-2021_01_06_425657	77	17	,	,	,
10_1101-2021_01_06_425657	77	18	the	the	DT
10_1101-2021_01_06_425657	77	19	214	214	CD
10_1101-2021_01_06_425657	77	20	addition	addition	NN
10_1101-2021_01_06_425657	77	21	of	of	IN
10_1101-2021_01_06_425657	77	22	DTT	DTT	NNP
10_1101-2021_01_06_425657	77	23	as	as	IN
10_1101-2021_01_06_425657	77	24	a	a	DT
10_1101-2021_01_06_425657	77	25	standard	standard	JJ
10_1101-2021_01_06_425657	77	26	component	component	NN
10_1101-2021_01_06_425657	77	27	in	in	IN
10_1101-2021_01_06_425657	77	28	our	-PRON-	PRP$
10_1101-2021_01_06_425657	77	29	IP	IP	NNP
10_1101-2021_01_06_425657	77	30	buffer	buffer	NN
10_1101-2021_01_06_425657	77	31	and	and	CC
10_1101-2021_01_06_425657	77	32	in	in	RB
10_1101-2021_01_06_425657	77	33	in	in	FW
10_1101-2021_01_06_425657	77	34	vitro	vitro	FW
10_1101-2021_01_06_425657	77	35	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	77	36	reactions	reaction	NNS
10_1101-2021_01_06_425657	77	37	215	215	CD
10_1101-2021_01_06_425657	77	38	could	could	MD
10_1101-2021_01_06_425657	77	39	potentially	potentially	RB
10_1101-2021_01_06_425657	77	40	reduce	reduce	VB
10_1101-2021_01_06_425657	77	41	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	77	42	Met30	Met30	NNP
10_1101-2021_01_06_425657	77	43	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	77	44	and	and	CC
10_1101-2021_01_06_425657	77	45	alter	alter	VB
10_1101-2021_01_06_425657	77	46	its	-PRON-	PRP$
10_1101-2021_01_06_425657	77	47	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	77	48	activity	activity	NN
10_1101-2021_01_06_425657	77	49	towards	towards	IN
10_1101-2021_01_06_425657	77	50	216	216	CD
10_1101-2021_01_06_425657	77	51	Met4	met4	NN
10_1101-2021_01_06_425657	77	52	.	.	.
10_1101-2021_01_06_425657	78	1	To	to	TO
10_1101-2021_01_06_425657	78	2	test	test	VB
10_1101-2021_01_06_425657	78	3	this	this	DT
10_1101-2021_01_06_425657	78	4	possibility	possibility	NN
10_1101-2021_01_06_425657	78	5	,	,	,
10_1101-2021_01_06_425657	78	6	we	-PRON-	PRP
10_1101-2021_01_06_425657	78	7	next	next	RB
10_1101-2021_01_06_425657	78	8	performed	perform	VBD
10_1101-2021_01_06_425657	78	9	the	the	DT
10_1101-2021_01_06_425657	78	10	Met30	Met30	NNP
10_1101-2021_01_06_425657	78	11	IP	IP	NNP
10_1101-2021_01_06_425657	78	12	and	and	CC
10_1101-2021_01_06_425657	78	13	in	in	IN
10_1101-2021_01_06_425657	78	14	vitro	vitro	FW
10_1101-2021_01_06_425657	78	15	assay	assay	NNP
10_1101-2021_01_06_425657	78	16	in	in	IN
10_1101-2021_01_06_425657	78	17	the	the	DT
10_1101-2021_01_06_425657	78	18	complete	complete	JJ
10_1101-2021_01_06_425657	78	19	217	217	CD
10_1101-2021_01_06_425657	78	20	absence	absence	NN
10_1101-2021_01_06_425657	78	21	of	of	IN
10_1101-2021_01_06_425657	78	22	reducing	reduce	VBG
10_1101-2021_01_06_425657	78	23	agent	agent	NN
10_1101-2021_01_06_425657	78	24	.	.	.
10_1101-2021_01_06_425657	79	1	Strikingly	strikingly	RB
10_1101-2021_01_06_425657	79	2	,	,	,
10_1101-2021_01_06_425657	79	3	we	-PRON-	PRP
10_1101-2021_01_06_425657	79	4	observed	observe	VBD
10_1101-2021_01_06_425657	79	5	little	little	JJ
10_1101-2021_01_06_425657	79	6	to	to	IN
10_1101-2021_01_06_425657	79	7	no	no	DT
10_1101-2021_01_06_425657	79	8	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	79	9	activity	activity	NN
10_1101-2021_01_06_425657	79	10	in	in	IN
10_1101-2021_01_06_425657	79	11	these	these	DT
10_1101-2021_01_06_425657	79	12	218	218	CD
10_1101-2021_01_06_425657	79	13	conditions	condition	NNS
10_1101-2021_01_06_425657	79	14	(	(	-LRB-
10_1101-2021_01_06_425657	79	15	Fig	fig	NN
10_1101-2021_01_06_425657	79	16	.	.	.
10_1101-2021_01_06_425657	80	1	S3B	S3B	NNP
10_1101-2021_01_06_425657	80	2	)	)	-RRB-
10_1101-2021_01_06_425657	80	3	,	,	,
10_1101-2021_01_06_425657	80	4	suggesting	suggest	VBG
10_1101-2021_01_06_425657	80	5	that	that	IN
10_1101-2021_01_06_425657	80	6	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	80	7	Met30	Met30	NNP
10_1101-2021_01_06_425657	80	8	exhibits	exhibit	NNS
10_1101-2021_01_06_425657	80	9	significantly	significantly	RB
10_1101-2021_01_06_425657	80	10	reduced	reduce	VBD
10_1101-2021_01_06_425657	80	11	219	219	CD
10_1101-2021_01_06_425657	80	12	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	80	13	activity	activity	NN
10_1101-2021_01_06_425657	80	14	.	.	.
10_1101-2021_01_06_425657	81	1	220	220	CD
10_1101-2021_01_06_425657	81	2	221	221	CD
10_1101-2021_01_06_425657	81	3	To	to	TO
10_1101-2021_01_06_425657	81	4	more	more	RBR
10_1101-2021_01_06_425657	81	5	rigorously	rigorously	RB
10_1101-2021_01_06_425657	81	6	test	test	VB
10_1101-2021_01_06_425657	81	7	the	the	DT
10_1101-2021_01_06_425657	81	8	effect	effect	NN
10_1101-2021_01_06_425657	81	9	of	of	IN
10_1101-2021_01_06_425657	81	10	reducing	reduce	VBG
10_1101-2021_01_06_425657	81	11	agents	agent	NNS
10_1101-2021_01_06_425657	81	12	on	on	IN
10_1101-2021_01_06_425657	81	13	the	the	DT
10_1101-2021_01_06_425657	81	14	activity	activity	NN
10_1101-2021_01_06_425657	81	15	of	of	IN
10_1101-2021_01_06_425657	81	16	immunopurified	immunopurifie	VBN
10_1101-2021_01_06_425657	81	17	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	81	18	,	,	,
10_1101-2021_01_06_425657	81	19	222	222	CD
10_1101-2021_01_06_425657	81	20	we	-PRON-	PRP
10_1101-2021_01_06_425657	81	21	performed	perform	VBD
10_1101-2021_01_06_425657	81	22	in	in	IN
10_1101-2021_01_06_425657	81	23	parallel	parallel	NN
10_1101-2021_01_06_425657	81	24	the	the	DT
10_1101-2021_01_06_425657	81	25	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	81	26	IP	IP	NNP
10_1101-2021_01_06_425657	81	27	with	with	IN
10_1101-2021_01_06_425657	81	28	cells	cell	NNS
10_1101-2021_01_06_425657	81	29	grown	grow	VBN
10_1101-2021_01_06_425657	81	30	in	in	IN
10_1101-2021_01_06_425657	81	31	both	both	CC
10_1101-2021_01_06_425657	81	32	high	high	JJ
10_1101-2021_01_06_425657	81	33	and	and	CC
10_1101-2021_01_06_425657	81	34	low	low	JJ
10_1101-2021_01_06_425657	81	35	sulfur	sulfur	NN
10_1101-2021_01_06_425657	81	36	223	223	CD
10_1101-2021_01_06_425657	81	37	conditions	condition	NNS
10_1101-2021_01_06_425657	81	38	,	,	,
10_1101-2021_01_06_425657	81	39	with	with	IN
10_1101-2021_01_06_425657	81	40	and	and	CC
10_1101-2021_01_06_425657	81	41	without	without	IN
10_1101-2021_01_06_425657	81	42	reducing	reduce	VBG
10_1101-2021_01_06_425657	81	43	agent	agent	NN
10_1101-2021_01_06_425657	81	44	in	in	IN
10_1101-2021_01_06_425657	81	45	the	the	DT
10_1101-2021_01_06_425657	81	46	IP	IP	NNP
10_1101-2021_01_06_425657	81	47	.	.	.
10_1101-2021_01_06_425657	82	1	Silver	silver	NN
10_1101-2021_01_06_425657	82	2	stains	stain	NNS
10_1101-2021_01_06_425657	82	3	of	of	IN
10_1101-2021_01_06_425657	82	4	the	the	DT
10_1101-2021_01_06_425657	82	5	eluted	elute	VBN
10_1101-2021_01_06_425657	82	6	co	co	JJ
10_1101-2021_01_06_425657	82	7	-	-	JJ
10_1101-2021_01_06_425657	82	8	IP	ip	JJ
10_1101-2021_01_06_425657	82	9	Met30	Met30	NNP
10_1101-2021_01_06_425657	82	10	224	224	CD
10_1101-2021_01_06_425657	82	11	complexes	complex	NNS
10_1101-2021_01_06_425657	82	12	showed	show	VBD
10_1101-2021_01_06_425657	82	13	similar	similar	JJ
10_1101-2021_01_06_425657	82	14	levels	level	NNS
10_1101-2021_01_06_425657	82	15	of	of	IN
10_1101-2021_01_06_425657	82	16	total	total	JJ
10_1101-2021_01_06_425657	82	17	protein	protein	NN
10_1101-2021_01_06_425657	82	18	overall	overall	JJ
10_1101-2021_01_06_425657	82	19	and	and	CC
10_1101-2021_01_06_425657	82	20	little	little	JJ
10_1101-2021_01_06_425657	82	21	difference	difference	NN
10_1101-2021_01_06_425657	82	22	in	in	IN
10_1101-2021_01_06_425657	82	23	the	the	DT
10_1101-2021_01_06_425657	82	24	abundance	abundance	NN
10_1101-2021_01_06_425657	82	25	of	of	IN
10_1101-2021_01_06_425657	82	26	225	225	CD
10_1101-2021_01_06_425657	82	27	major	major	JJ
10_1101-2021_01_06_425657	82	28	binding	bind	VBG
10_1101-2021_01_06_425657	82	29	partners	partner	NNS
10_1101-2021_01_06_425657	82	30	between	between	IN
10_1101-2021_01_06_425657	82	31	the	the	DT
10_1101-2021_01_06_425657	82	32	four	four	CD
10_1101-2021_01_06_425657	82	33	conditions	condition	NNS
10_1101-2021_01_06_425657	82	34	(	(	-LRB-
10_1101-2021_01_06_425657	82	35	Figure	figure	NN
10_1101-2021_01_06_425657	82	36	S3C	S3C	NNS
10_1101-2021_01_06_425657	82	37	)	)	-RRB-
10_1101-2021_01_06_425657	82	38	.	.	.
10_1101-2021_01_06_425657	83	1	Western	western	JJ
10_1101-2021_01_06_425657	83	2	blots	blot	NNS
10_1101-2021_01_06_425657	83	3	of	of	IN
10_1101-2021_01_06_425657	83	4	the	the	DT
10_1101-2021_01_06_425657	83	5	co	co	JJ
10_1101-2021_01_06_425657	83	6	-	-	JJ
10_1101-2021_01_06_425657	83	7	IP	IP	NNP
10_1101-2021_01_06_425657	83	8	226	226	CD
10_1101-2021_01_06_425657	83	9	samples	sample	NNS
10_1101-2021_01_06_425657	83	10	for	for	IN
10_1101-2021_01_06_425657	83	11	the	the	DT
10_1101-2021_01_06_425657	83	12	Cdc53	Cdc53	NNP
10_1101-2021_01_06_425657	83	13	/	/	SYM
10_1101-2021_01_06_425657	83	14	cullin	cullin	NNP
10_1101-2021_01_06_425657	83	15	scaffold	scaffold	NNP
10_1101-2021_01_06_425657	83	16	showed	show	VBD
10_1101-2021_01_06_425657	83	17	similar	similar	JJ
10_1101-2021_01_06_425657	83	18	binding	binding	NN
10_1101-2021_01_06_425657	83	19	between	between	IN
10_1101-2021_01_06_425657	83	20	the	the	DT
10_1101-2021_01_06_425657	83	21	samples	sample	NNS
10_1101-2021_01_06_425657	83	22	with	with	IN
10_1101-2021_01_06_425657	83	23	the	the	DT
10_1101-2021_01_06_425657	83	24	227	227	CD
10_1101-2021_01_06_425657	83	25	exception	exception	NN
10_1101-2021_01_06_425657	83	26	of	of	IN
10_1101-2021_01_06_425657	83	27	the	the	DT
10_1101-2021_01_06_425657	83	28	−sulfur	−sulfur	NNS
10_1101-2021_01_06_425657	83	29	,	,	,
10_1101-2021_01_06_425657	83	30	−DTT	−DTT	NFP
10_1101-2021_01_06_425657	83	31	sample	sample	NN
10_1101-2021_01_06_425657	83	32	which	which	WDT
10_1101-2021_01_06_425657	83	33	had	have	VBD
10_1101-2021_01_06_425657	83	34	approximately	approximately	RB
10_1101-2021_01_06_425657	83	35	a	a	DT
10_1101-2021_01_06_425657	83	36	third	third	JJ
10_1101-2021_01_06_425657	83	37	of	of	IN
10_1101-2021_01_06_425657	83	38	the	the	DT
10_1101-2021_01_06_425657	83	39	amount	amount	NN
10_1101-2021_01_06_425657	83	40	of	of	IN
10_1101-2021_01_06_425657	83	41	Cdc53	Cdc53	NNP
10_1101-2021_01_06_425657	83	42	228	228	CD
10_1101-2021_01_06_425657	83	43	bound	bind	VBN
10_1101-2021_01_06_425657	83	44	to	to	IN
10_1101-2021_01_06_425657	83	45	Met30	Met30	NNP
10_1101-2021_01_06_425657	83	46	(	(	-LRB-
10_1101-2021_01_06_425657	83	47	Figure	Figure	NNP
10_1101-2021_01_06_425657	83	48	S3D	s3d	NN
10_1101-2021_01_06_425657	83	49	)	)	-RRB-
10_1101-2021_01_06_425657	83	50	.	.	.
10_1101-2021_01_06_425657	84	1	We	-PRON-	PRP
10_1101-2021_01_06_425657	84	2	suspect	suspect	VBP
10_1101-2021_01_06_425657	84	3	this	this	DT
10_1101-2021_01_06_425657	84	4	difference	difference	NN
10_1101-2021_01_06_425657	84	5	is	be	VBZ
10_1101-2021_01_06_425657	84	6	due	due	JJ
10_1101-2021_01_06_425657	84	7	to	to	IN
10_1101-2021_01_06_425657	84	8	the	the	DT
10_1101-2021_01_06_425657	84	9	canonical	canonical	JJ
10_1101-2021_01_06_425657	84	10	regulation	regulation	NN
10_1101-2021_01_06_425657	84	11	of	of	IN
10_1101-2021_01_06_425657	84	12	SCF	SCF	NNP
10_1101-2021_01_06_425657	84	13	229	229	CD
10_1101-2021_01_06_425657	84	14	E3	e3	NN
10_1101-2021_01_06_425657	84	15	ligases	ligase	NNS
10_1101-2021_01_06_425657	84	16	,	,	,
10_1101-2021_01_06_425657	84	17	which	which	WDT
10_1101-2021_01_06_425657	84	18	uses	use	VBZ
10_1101-2021_01_06_425657	84	19	cyclic	cyclic	JJ
10_1101-2021_01_06_425657	84	20	changes	change	NNS
10_1101-2021_01_06_425657	84	21	in	in	IN
10_1101-2021_01_06_425657	84	22	the	the	DT
10_1101-2021_01_06_425657	84	23	affinity	affinity	NN
10_1101-2021_01_06_425657	84	24	of	of	IN
10_1101-2021_01_06_425657	84	25	Skp1	Skp1	NNP
10_1101-2021_01_06_425657	84	26	/	/	SYM
10_1101-2021_01_06_425657	84	27	F	F	NNP
10_1101-2021_01_06_425657	84	28	-	-	HYPH
10_1101-2021_01_06_425657	84	29	box	box	NN
10_1101-2021_01_06_425657	84	30	protein	protein	NN
10_1101-2021_01_06_425657	84	31	heterodimers	heterodimer	NNS
10_1101-2021_01_06_425657	84	32	to	to	IN
10_1101-2021_01_06_425657	84	33	the	the	DT
10_1101-2021_01_06_425657	84	34	230	230	CD
10_1101-2021_01_06_425657	84	35	cullin	cullin	NNP
10_1101-2021_01_06_425657	84	36	scaffold	scaffold	NN
10_1101-2021_01_06_425657	84	37	based	base	VBN
10_1101-2021_01_06_425657	84	38	on	on	IN
10_1101-2021_01_06_425657	84	39	binding	bind	VBG
10_1101-2021_01_06_425657	84	40	between	between	IN
10_1101-2021_01_06_425657	84	41	the	the	DT
10_1101-2021_01_06_425657	84	42	F	F	NNP
10_1101-2021_01_06_425657	84	43	-	-	HYPH
10_1101-2021_01_06_425657	84	44	box	box	NNP
10_1101-2021_01_06_425657	84	45	protein	protein	NN
10_1101-2021_01_06_425657	84	46	and	and	CC
10_1101-2021_01_06_425657	84	47	its	-PRON-	PRP$
10_1101-2021_01_06_425657	84	48	substrate	substrate	NN
10_1101-2021_01_06_425657	84	49	(	(	-LRB-
10_1101-2021_01_06_425657	84	50	Reitsma	Reitsma	NNP
10_1101-2021_01_06_425657	84	51	et	et	NNP
10_1101-2021_01_06_425657	84	52	al	al	NNP
10_1101-2021_01_06_425657	84	53	.	.	NNP
10_1101-2021_01_06_425657	84	54	,	,	,
10_1101-2021_01_06_425657	84	55	2017	2017	CD
10_1101-2021_01_06_425657	84	56	)	)	-RRB-
10_1101-2021_01_06_425657	84	57	.	.	.
10_1101-2021_01_06_425657	85	1	231	231	CD
10_1101-2021_01_06_425657	85	2	After	after	IN
10_1101-2021_01_06_425657	85	3	performing	perform	VBG
10_1101-2021_01_06_425657	85	4	the	the	DT
10_1101-2021_01_06_425657	85	5	initial	initial	JJ
10_1101-2021_01_06_425657	85	6	IP	ip	NN
10_1101-2021_01_06_425657	85	7	and	and	CC
10_1101-2021_01_06_425657	85	8	washing	wash	VBG
10_1101-2021_01_06_425657	85	9	the	the	DT
10_1101-2021_01_06_425657	85	10	beads	bead	NNS
10_1101-2021_01_06_425657	85	11	in	in	IN
10_1101-2021_01_06_425657	85	12	buffer	buffer	NN
10_1101-2021_01_06_425657	85	13	with	with	IN
10_1101-2021_01_06_425657	85	14	and	and	CC
10_1101-2021_01_06_425657	85	15	without	without	IN
10_1101-2021_01_06_425657	85	16	reducing	reduce	VBG
10_1101-2021_01_06_425657	85	17	agent	agent	NN
10_1101-2021_01_06_425657	85	18	,	,	,
10_1101-2021_01_06_425657	85	19	232	232	CD
10_1101-2021_01_06_425657	85	20	the	the	DT
10_1101-2021_01_06_425657	85	21	final	final	JJ
10_1101-2021_01_06_425657	85	22	wash	wash	NN
10_1101-2021_01_06_425657	85	23	step	step	NN
10_1101-2021_01_06_425657	85	24	and	and	CC
10_1101-2021_01_06_425657	85	25	Flag	Flag	NNP
10_1101-2021_01_06_425657	85	26	peptide	peptide	NN
10_1101-2021_01_06_425657	85	27	elution	elution	NN
10_1101-2021_01_06_425657	85	28	were	be	VBD
10_1101-2021_01_06_425657	85	29	done	do	VBN
10_1101-2021_01_06_425657	85	30	without	without	IN
10_1101-2021_01_06_425657	85	31	reducing	reduce	VBG
10_1101-2021_01_06_425657	85	32	agent	agent	NN
10_1101-2021_01_06_425657	85	33	in	in	IN
10_1101-2021_01_06_425657	85	34	the	the	DT
10_1101-2021_01_06_425657	85	35	buffer	buffer	NN
10_1101-2021_01_06_425657	85	36	for	for	IN
10_1101-2021_01_06_425657	85	37	all	all	DT
10_1101-2021_01_06_425657	85	38	233	233	CD
10_1101-2021_01_06_425657	85	39	four	four	CD
10_1101-2021_01_06_425657	85	40	IP	IP	NNP
10_1101-2021_01_06_425657	85	41	conditions	condition	NNS
10_1101-2021_01_06_425657	85	42	in	in	IN
10_1101-2021_01_06_425657	85	43	order	order	NN
10_1101-2021_01_06_425657	85	44	to	to	TO
10_1101-2021_01_06_425657	85	45	remove	remove	VB
10_1101-2021_01_06_425657	85	46	any	any	DT
10_1101-2021_01_06_425657	85	47	residual	residual	JJ
10_1101-2021_01_06_425657	85	48	reducing	reduce	VBG
10_1101-2021_01_06_425657	85	49	agent	agent	NN
10_1101-2021_01_06_425657	85	50	from	from	IN
10_1101-2021_01_06_425657	85	51	the	the	DT
10_1101-2021_01_06_425657	85	52	final	final	JJ
10_1101-2021_01_06_425657	85	53	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	85	54	234	234	CD
10_1101-2021_01_06_425657	85	55	reaction	reaction	NN
10_1101-2021_01_06_425657	85	56	,	,	,
10_1101-2021_01_06_425657	85	57	which	which	WDT
10_1101-2021_01_06_425657	85	58	was	be	VBD
10_1101-2021_01_06_425657	85	59	also	also	RB
10_1101-2021_01_06_425657	85	60	performed	perform	VBN
10_1101-2021_01_06_425657	85	61	without	without	IN
10_1101-2021_01_06_425657	85	62	reducing	reduce	VBG
10_1101-2021_01_06_425657	85	63	agent	agent	NN
10_1101-2021_01_06_425657	85	64	.	.	.
10_1101-2021_01_06_425657	86	1	A	a	DT
10_1101-2021_01_06_425657	86	2	small	small	JJ
10_1101-2021_01_06_425657	86	3	aliquot	aliquot	NNS
10_1101-2021_01_06_425657	86	4	of	of	IN
10_1101-2021_01_06_425657	86	5	the	the	DT
10_1101-2021_01_06_425657	86	6	rich	rich	JJ
10_1101-2021_01_06_425657	86	7	and	and	CC
10_1101-2021_01_06_425657	86	8	−sulfur	−sulfur	NNP
10_1101-2021_01_06_425657	86	9	235	235	CD
10_1101-2021_01_06_425657	86	10	“	"	``
10_1101-2021_01_06_425657	86	11	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	86	12	”	"	''
10_1101-2021_01_06_425657	86	13	immunopurified	immunopurifie	VBD
10_1101-2021_01_06_425657	86	14	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	86	15	was	be	VBD
10_1101-2021_01_06_425657	86	16	transferred	transfer	VBN
10_1101-2021_01_06_425657	86	17	to	to	IN
10_1101-2021_01_06_425657	86	18	a	a	DT
10_1101-2021_01_06_425657	86	19	new	new	JJ
10_1101-2021_01_06_425657	86	20	tube	tube	NN
10_1101-2021_01_06_425657	86	21	and	and	CC
10_1101-2021_01_06_425657	86	22	treated	treat	VBN
10_1101-2021_01_06_425657	86	23	with	with	IN
10_1101-2021_01_06_425657	86	24	5	5	CD
10_1101-2021_01_06_425657	86	25	mM	mM	NNP
10_1101-2021_01_06_425657	86	26	TCEP	TCEP	NNP
10_1101-2021_01_06_425657	86	27	,	,	,
10_1101-2021_01_06_425657	86	28	a	a	DT
10_1101-2021_01_06_425657	86	29	236	236	CD
10_1101-2021_01_06_425657	86	30	non	non	JJ
10_1101-2021_01_06_425657	86	31	-	-	JJ
10_1101-2021_01_06_425657	86	32	thiol	thiol	JJ
10_1101-2021_01_06_425657	86	33	,	,	,
10_1101-2021_01_06_425657	86	34	phosphine	phosphine	NN
10_1101-2021_01_06_425657	86	35	-	-	HYPH
10_1101-2021_01_06_425657	86	36	based	base	VBN
10_1101-2021_01_06_425657	86	37	reducing	reduce	VBG
10_1101-2021_01_06_425657	86	38	agent	agent	NN
10_1101-2021_01_06_425657	86	39	,	,	,
10_1101-2021_01_06_425657	86	40	for	for	IN
10_1101-2021_01_06_425657	86	41	approximately	approximately	RB
10_1101-2021_01_06_425657	86	42	30	30	CD
10_1101-2021_01_06_425657	86	43	min	min	NN
10_1101-2021_01_06_425657	86	44	while	while	IN
10_1101-2021_01_06_425657	86	45	the	the	DT
10_1101-2021_01_06_425657	86	46	in	in	FW
10_1101-2021_01_06_425657	86	47	vitro	vitro	FW
10_1101-2021_01_06_425657	86	48	237	237	CD
10_1101-2021_01_06_425657	86	49	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	86	50	assays	assays	RB
10_1101-2021_01_06_425657	86	51	were	be	VBD
10_1101-2021_01_06_425657	86	52	set	set	VBN
10_1101-2021_01_06_425657	86	53	up	up	RP
10_1101-2021_01_06_425657	86	54	to	to	TO
10_1101-2021_01_06_425657	86	55	test	test	VB
10_1101-2021_01_06_425657	86	56	if	if	IN
10_1101-2021_01_06_425657	86	57	the	the	DT
10_1101-2021_01_06_425657	86	58	low	low	JJ
10_1101-2021_01_06_425657	86	59	activity	activity	NN
10_1101-2021_01_06_425657	86	60	of	of	IN
10_1101-2021_01_06_425657	86	61	the	the	DT
10_1101-2021_01_06_425657	86	62	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	86	63	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	86	64	complex	complex	NN
10_1101-2021_01_06_425657	86	65	could	could	MD
10_1101-2021_01_06_425657	86	66	238	238	CD
10_1101-2021_01_06_425657	86	67	be	be	VB
10_1101-2021_01_06_425657	86	68	rescued	rescue	VBN
10_1101-2021_01_06_425657	86	69	by	by	IN
10_1101-2021_01_06_425657	86	70	treating	treat	VBG
10_1101-2021_01_06_425657	86	71	with	with	IN
10_1101-2021_01_06_425657	86	72	another	another	DT
10_1101-2021_01_06_425657	86	73	reducing	reduce	VBG
10_1101-2021_01_06_425657	86	74	agent	agent	NN
10_1101-2021_01_06_425657	86	75	before	before	IN
10_1101-2021_01_06_425657	86	76	addition	addition	NN
10_1101-2021_01_06_425657	86	77	to	to	IN
10_1101-2021_01_06_425657	86	78	the	the	DT
10_1101-2021_01_06_425657	86	79	final	final	JJ
10_1101-2021_01_06_425657	86	80	reaction	reaction	NN
10_1101-2021_01_06_425657	86	81	.	.	.
10_1101-2021_01_06_425657	87	1	The	the	DT
10_1101-2021_01_06_425657	87	2	data	datum	NNS
10_1101-2021_01_06_425657	87	3	239	239	CD
10_1101-2021_01_06_425657	87	4	clearly	clearly	RB
10_1101-2021_01_06_425657	87	5	demonstrate	demonstrate	VBP
10_1101-2021_01_06_425657	87	6	that	that	IN
10_1101-2021_01_06_425657	87	7	the	the	DT
10_1101-2021_01_06_425657	87	8	presence	presence	NN
10_1101-2021_01_06_425657	87	9	of	of	IN
10_1101-2021_01_06_425657	87	10	reducing	reduce	VBG
10_1101-2021_01_06_425657	87	11	agent	agent	NN
10_1101-2021_01_06_425657	87	12	in	in	IN
10_1101-2021_01_06_425657	87	13	the	the	DT
10_1101-2021_01_06_425657	87	14	IP	IP	NNP
10_1101-2021_01_06_425657	87	15	and	and	CC
10_1101-2021_01_06_425657	87	16	wash	wash	VB
10_1101-2021_01_06_425657	87	17	buffer	buffer	NN
10_1101-2021_01_06_425657	87	18	,	,	,
10_1101-2021_01_06_425657	87	19	but	but	CC
10_1101-2021_01_06_425657	87	20	not	not	RB
10_1101-2021_01_06_425657	87	21	in	in	IN
10_1101-2021_01_06_425657	87	22	the	the	DT
10_1101-2021_01_06_425657	87	23	240	240	CD
10_1101-2021_01_06_425657	87	24	elution	elution	NN
10_1101-2021_01_06_425657	87	25	or	or	CC
10_1101-2021_01_06_425657	87	26	final	final	JJ
10_1101-2021_01_06_425657	87	27	reaction	reaction	NN
10_1101-2021_01_06_425657	87	28	,	,	,
10_1101-2021_01_06_425657	87	29	significantly	significantly	RB
10_1101-2021_01_06_425657	87	30	increased	increase	VBD
10_1101-2021_01_06_425657	87	31	the	the	DT
10_1101-2021_01_06_425657	87	32	E3	E3	NNP
10_1101-2021_01_06_425657	87	33	ligase	ligase	NN
10_1101-2021_01_06_425657	87	34	activity	activity	NN
10_1101-2021_01_06_425657	87	35	of	of	IN
10_1101-2021_01_06_425657	87	36	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	87	37	in	in	IN
10_1101-2021_01_06_425657	87	38	vitro	vitro	FW
10_1101-2021_01_06_425657	87	39	regardless	regardless	RB
10_1101-2021_01_06_425657	87	40	241	241	CD
10_1101-2021_01_06_425657	87	41	of	of	IN
10_1101-2021_01_06_425657	87	42	whether	whether	IN
10_1101-2021_01_06_425657	87	43	the	the	DT
10_1101-2021_01_06_425657	87	44	cells	cell	NNS
10_1101-2021_01_06_425657	87	45	were	be	VBD
10_1101-2021_01_06_425657	87	46	grown	grow	VBN
10_1101-2021_01_06_425657	87	47	in	in	IN
10_1101-2021_01_06_425657	87	48	high	high	JJ
10_1101-2021_01_06_425657	87	49	(	(	-LRB-
10_1101-2021_01_06_425657	87	50	Figure	figure	NN
10_1101-2021_01_06_425657	87	51	4C	4c	NN
10_1101-2021_01_06_425657	87	52	)	)	-RRB-
10_1101-2021_01_06_425657	87	53	or	or	CC
10_1101-2021_01_06_425657	87	54	low	low	JJ
10_1101-2021_01_06_425657	87	55	sulfur	sulfur	NN
10_1101-2021_01_06_425657	87	56	media	medium	NNS
10_1101-2021_01_06_425657	87	57	(	(	-LRB-
10_1101-2021_01_06_425657	87	58	Figure	figure	NN
10_1101-2021_01_06_425657	87	59	4D	4d	NN
10_1101-2021_01_06_425657	87	60	)	)	-RRB-
10_1101-2021_01_06_425657	87	61	.	.	.
10_1101-2021_01_06_425657	88	1	Further	further	RB
10_1101-2021_01_06_425657	88	2	242	242	CD
10_1101-2021_01_06_425657	88	3	supporting	support	VBG
10_1101-2021_01_06_425657	88	4	our	-PRON-	PRP$
10_1101-2021_01_06_425657	88	5	hypothesis	hypothesis	NN
10_1101-2021_01_06_425657	88	6	,	,	,
10_1101-2021_01_06_425657	88	7	brief	brief	JJ
10_1101-2021_01_06_425657	88	8	treatment	treatment	NN
10_1101-2021_01_06_425657	88	9	of	of	IN
10_1101-2021_01_06_425657	88	10	the	the	DT
10_1101-2021_01_06_425657	88	11	oxidized	oxidized	JJ
10_1101-2021_01_06_425657	88	12	−DTT	−dtt	SYM
10_1101-2021_01_06_425657	88	13	IP	IP	NNP
10_1101-2021_01_06_425657	88	14	complex	complex	NN
10_1101-2021_01_06_425657	88	15	with	with	IN
10_1101-2021_01_06_425657	88	16	TCEP	TCEP	NNP
10_1101-2021_01_06_425657	88	17	243	243	CD
10_1101-2021_01_06_425657	88	18	(	(	-LRB-
10_1101-2021_01_06_425657	88	19	−DTT/+TCEP	−DTT/+TCEP	NNP
10_1101-2021_01_06_425657	88	20	)	)	-RRB-
10_1101-2021_01_06_425657	88	21	rescued	rescue	VBD
10_1101-2021_01_06_425657	88	22	the	the	DT
10_1101-2021_01_06_425657	88	23	activity	activity	NN
10_1101-2021_01_06_425657	88	24	of	of	IN
10_1101-2021_01_06_425657	88	25	the	the	DT
10_1101-2021_01_06_425657	88	26	E3	E3	NNP
10_1101-2021_01_06_425657	88	27	complex	complex	NN
10_1101-2021_01_06_425657	88	28	in	in	FW
10_1101-2021_01_06_425657	88	29	vitro	vitro	FW
10_1101-2021_01_06_425657	88	30	(	(	-LRB-
10_1101-2021_01_06_425657	88	31	Figures	figure	NNS
10_1101-2021_01_06_425657	88	32	4B	4b	JJ
10_1101-2021_01_06_425657	88	33	and	and	CC
10_1101-2021_01_06_425657	88	34	C	C	NNP
10_1101-2021_01_06_425657	88	35	)	)	-RRB-
10_1101-2021_01_06_425657	88	36	.	.	.
10_1101-2021_01_06_425657	89	1	The	the	DT
10_1101-2021_01_06_425657	89	2	same	same	JJ
10_1101-2021_01_06_425657	89	3	+	+	SYM
10_1101-2021_01_06_425657	89	4	/	/	SYM
10_1101-2021_01_06_425657	89	5	244	244	CD
10_1101-2021_01_06_425657	89	6	−	−	NNP
10_1101-2021_01_06_425657	89	7	DTT	DTT	NNP
10_1101-2021_01_06_425657	89	8	in	in	IN
10_1101-2021_01_06_425657	89	9	vitro	vitro	FW
10_1101-2021_01_06_425657	89	10	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	89	11	experiment	experiment	NN
10_1101-2021_01_06_425657	89	12	done	do	VBN
10_1101-2021_01_06_425657	89	13	with	with	IN
10_1101-2021_01_06_425657	89	14	the	the	DT
10_1101-2021_01_06_425657	89	15	C414S	c414s	NN
10_1101-2021_01_06_425657	89	16	and	and	CC
10_1101-2021_01_06_425657	89	17	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	89	18	Met30	Met30	NNP
10_1101-2021_01_06_425657	89	19	245	245	CD
10_1101-2021_01_06_425657	89	20	mutants	mutant	NNS
10_1101-2021_01_06_425657	89	21	showed	show	VBD
10_1101-2021_01_06_425657	89	22	lower	low	JJR
10_1101-2021_01_06_425657	89	23	E3	E3	NNP
10_1101-2021_01_06_425657	89	24	ligase	ligase	NN
10_1101-2021_01_06_425657	89	25	activity	activity	NN
10_1101-2021_01_06_425657	89	26	overall	overall	RB
10_1101-2021_01_06_425657	89	27	relative	relative	JJ
10_1101-2021_01_06_425657	89	28	to	to	IN
10_1101-2021_01_06_425657	89	29	wild	wild	JJ
10_1101-2021_01_06_425657	89	30	type	type	NN
10_1101-2021_01_06_425657	89	31	Met30	Met30	NNP
10_1101-2021_01_06_425657	89	32	,	,	,
10_1101-2021_01_06_425657	89	33	but	but	CC
10_1101-2021_01_06_425657	89	34	smaller	small	JJR
10_1101-2021_01_06_425657	89	35	246	246	CD
10_1101-2021_01_06_425657	89	36	differences	difference	NNS
10_1101-2021_01_06_425657	89	37	between	between	IN
10_1101-2021_01_06_425657	89	38	the	the	DT
10_1101-2021_01_06_425657	89	39	plus	plus	NN
10_1101-2021_01_06_425657	89	40	and	and	CC
10_1101-2021_01_06_425657	89	41	minus	minus	CC
10_1101-2021_01_06_425657	89	42	reducing	reduce	VBG
10_1101-2021_01_06_425657	89	43	agent	agent	NN
10_1101-2021_01_06_425657	89	44	condition	condition	NN
10_1101-2021_01_06_425657	89	45	(	(	-LRB-
10_1101-2021_01_06_425657	89	46	Figure	figure	NN
10_1101-2021_01_06_425657	89	47	S4A	s4a	NN
10_1101-2021_01_06_425657	89	48	)	)	-RRB-
10_1101-2021_01_06_425657	89	49	.	.	.
10_1101-2021_01_06_425657	90	1	247	247	CD
10_1101-2021_01_06_425657	90	2	248	248	CD
10_1101-2021_01_06_425657	90	3	As	as	IN
10_1101-2021_01_06_425657	90	4	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	90	5	E3	e3	CC
10_1101-2021_01_06_425657	90	6	ligase	ligase	NN
10_1101-2021_01_06_425657	90	7	activity	activity	NN
10_1101-2021_01_06_425657	90	8	in	in	IN
10_1101-2021_01_06_425657	90	9	vitro	vitro	FW
10_1101-2021_01_06_425657	90	10	is	be	VBZ
10_1101-2021_01_06_425657	90	11	independent	independent	JJ
10_1101-2021_01_06_425657	90	12	of	of	IN
10_1101-2021_01_06_425657	90	13	the	the	DT
10_1101-2021_01_06_425657	90	14	sulfur	sulfur	NN
10_1101-2021_01_06_425657	90	15	-	-	HYPH
10_1101-2021_01_06_425657	90	16	replete	replete	JJ
10_1101-2021_01_06_425657	90	17	or	or	CC
10_1101-2021_01_06_425657	90	18	-starved	-starved	JJ
10_1101-2021_01_06_425657	90	19	state	state	NN
10_1101-2021_01_06_425657	90	20	of	of	IN
10_1101-2021_01_06_425657	90	21	the	the	DT
10_1101-2021_01_06_425657	90	22	249	249	CD
10_1101-2021_01_06_425657	90	23	cells	cell	NNS
10_1101-2021_01_06_425657	90	24	from	from	IN
10_1101-2021_01_06_425657	90	25	which	which	WDT
10_1101-2021_01_06_425657	90	26	the	the	DT
10_1101-2021_01_06_425657	90	27	co	co	JJ
10_1101-2021_01_06_425657	90	28	-	-	JJ
10_1101-2021_01_06_425657	90	29	IP	ip	JJ
10_1101-2021_01_06_425657	90	30	concentrate	concentrate	NN
10_1101-2021_01_06_425657	90	31	is	be	VBZ
10_1101-2021_01_06_425657	90	32	produced	produce	VBN
10_1101-2021_01_06_425657	90	33	,	,	,
10_1101-2021_01_06_425657	90	34	and	and	CC
10_1101-2021_01_06_425657	90	35	that	that	IN
10_1101-2021_01_06_425657	90	36	the	the	DT
10_1101-2021_01_06_425657	90	37	activity	activity	NN
10_1101-2021_01_06_425657	90	38	of	of	IN
10_1101-2021_01_06_425657	90	39	the	the	DT
10_1101-2021_01_06_425657	90	40	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	90	41	co	co	JJ
10_1101-2021_01_06_425657	90	42	-	-	JJ
10_1101-2021_01_06_425657	90	43	IP	IP	NNP
10_1101-2021_01_06_425657	90	44	250	250	CD
10_1101-2021_01_06_425657	90	45	.CC	.CC	:
10_1101-2021_01_06_425657	90	46	-	-	:
10_1101-2021_01_06_425657	90	47	BY	by	IN
10_1101-2021_01_06_425657	90	48	4.0	4.0	CD
10_1101-2021_01_06_425657	90	49	International	International	NNP
10_1101-2021_01_06_425657	90	50	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	90	51	under	under	IN
10_1101-2021_01_06_425657	90	52	a	a	DT
10_1101-2021_01_06_425657	90	53	(	(	-LRB-
10_1101-2021_01_06_425657	90	54	which	which	WDT
10_1101-2021_01_06_425657	90	55	was	be	VBD
10_1101-2021_01_06_425657	90	56	not	not	RB
10_1101-2021_01_06_425657	90	57	certified	certify	VBN
10_1101-2021_01_06_425657	90	58	by	by	IN
10_1101-2021_01_06_425657	90	59	peer	peer	NN
10_1101-2021_01_06_425657	90	60	review	review	NN
10_1101-2021_01_06_425657	90	61	)	)	-RRB-
10_1101-2021_01_06_425657	90	62	is	be	VBZ
10_1101-2021_01_06_425657	90	63	the	the	DT
10_1101-2021_01_06_425657	90	64	author	author	NN
10_1101-2021_01_06_425657	90	65	/	/	SYM
10_1101-2021_01_06_425657	90	66	funder	funder	NN
10_1101-2021_01_06_425657	90	67	,	,	,
10_1101-2021_01_06_425657	90	68	who	who	WP
10_1101-2021_01_06_425657	90	69	has	have	VBZ
10_1101-2021_01_06_425657	90	70	granted	grant	VBN
10_1101-2021_01_06_425657	90	71	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	90	72	a	a	DT
10_1101-2021_01_06_425657	90	73	license	license	NN
10_1101-2021_01_06_425657	90	74	to	to	TO
10_1101-2021_01_06_425657	90	75	display	display	VB
10_1101-2021_01_06_425657	90	76	the	the	DT
10_1101-2021_01_06_425657	90	77	preprint	preprint	NN
10_1101-2021_01_06_425657	90	78	in	in	IN
10_1101-2021_01_06_425657	90	79	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	90	80	.	.	.
10_1101-2021_01_06_425657	91	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	91	2	is	be	VBZ
10_1101-2021_01_06_425657	91	3	made	make	VBN
10_1101-2021_01_06_425657	91	4	The	the	DT
10_1101-2021_01_06_425657	91	5	copyright	copyright	NN
10_1101-2021_01_06_425657	91	6	holder	holder	NN
10_1101-2021_01_06_425657	91	7	for	for	IN
10_1101-2021_01_06_425657	91	8	this	this	DT
10_1101-2021_01_06_425657	91	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	91	10	version	version	NN
10_1101-2021_01_06_425657	91	11	posted	post	VBD
10_1101-2021_01_06_425657	91	12	January	January	NNP
10_1101-2021_01_06_425657	91	13	7	7	CD
10_1101-2021_01_06_425657	91	14	,	,	,
10_1101-2021_01_06_425657	91	15	2021	2021	CD
10_1101-2021_01_06_425657	91	16	.	.	.
10_1101-2021_01_06_425657	91	17	;	;	:
10_1101-2021_01_06_425657	91	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	91	19	:	:	:
10_1101-2021_01_06_425657	91	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	91	21	preprint	preprint	NN
10_1101-2021_01_06_425657	91	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	91	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	91	24	8	8	CD
10_1101-2021_01_06_425657	91	25	concentrate	concentrate	NN
10_1101-2021_01_06_425657	91	26	purified	purify	VBN
10_1101-2021_01_06_425657	91	27	in	in	IN
10_1101-2021_01_06_425657	91	28	the	the	DT
10_1101-2021_01_06_425657	91	29	absence	absence	NN
10_1101-2021_01_06_425657	91	30	of	of	IN
10_1101-2021_01_06_425657	91	31	reducing	reduce	VBG
10_1101-2021_01_06_425657	91	32	agent	agent	NN
10_1101-2021_01_06_425657	91	33	can	can	MD
10_1101-2021_01_06_425657	91	34	be	be	VB
10_1101-2021_01_06_425657	91	35	rescued	rescue	VBN
10_1101-2021_01_06_425657	91	36	by	by	IN
10_1101-2021_01_06_425657	91	37	treatment	treatment	NN
10_1101-2021_01_06_425657	91	38	with	with	IN
10_1101-2021_01_06_425657	91	39	another	another	DT
10_1101-2021_01_06_425657	91	40	251	251	CD
10_1101-2021_01_06_425657	91	41	reducing	reduce	VBG
10_1101-2021_01_06_425657	91	42	agent	agent	NN
10_1101-2021_01_06_425657	91	43	,	,	,
10_1101-2021_01_06_425657	91	44	we	-PRON-	PRP
10_1101-2021_01_06_425657	91	45	hypothesized	hypothesize	VBD
10_1101-2021_01_06_425657	91	46	that	that	IN
10_1101-2021_01_06_425657	91	47	the	the	DT
10_1101-2021_01_06_425657	91	48	low	low	JJ
10_1101-2021_01_06_425657	91	49	E3	e3	NN
10_1101-2021_01_06_425657	91	50	ligase	ligase	NN
10_1101-2021_01_06_425657	91	51	activity	activity	NN
10_1101-2021_01_06_425657	91	52	of	of	IN
10_1101-2021_01_06_425657	91	53	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	91	54	purified	purify	VBN
10_1101-2021_01_06_425657	91	55	in	in	IN
10_1101-2021_01_06_425657	91	56	the	the	DT
10_1101-2021_01_06_425657	91	57	absence	absence	NN
10_1101-2021_01_06_425657	91	58	252	252	CD
10_1101-2021_01_06_425657	91	59	of	of	IN
10_1101-2021_01_06_425657	91	60	reducing	reduce	VBG
10_1101-2021_01_06_425657	91	61	agent	agent	NN
10_1101-2021_01_06_425657	91	62	is	be	VBZ
10_1101-2021_01_06_425657	91	63	due	due	JJ
10_1101-2021_01_06_425657	91	64	to	to	IN
10_1101-2021_01_06_425657	91	65	decreased	decrease	VBN
10_1101-2021_01_06_425657	91	66	binding	bind	VBG
10_1101-2021_01_06_425657	91	67	between	between	IN
10_1101-2021_01_06_425657	91	68	Met30	Met30	NNP
10_1101-2021_01_06_425657	91	69	and	and	CC
10_1101-2021_01_06_425657	91	70	Met4	Met4	NNP
10_1101-2021_01_06_425657	91	71	,	,	,
10_1101-2021_01_06_425657	91	72	and	and	CC
10_1101-2021_01_06_425657	91	73	not	not	RB
10_1101-2021_01_06_425657	91	74	decreased	decrease	VBN
10_1101-2021_01_06_425657	91	75	binding	bind	VBG
10_1101-2021_01_06_425657	91	76	253	253	CD
10_1101-2021_01_06_425657	91	77	between	between	IN
10_1101-2021_01_06_425657	91	78	Met30	Met30	NNP
10_1101-2021_01_06_425657	91	79	and	and	CC
10_1101-2021_01_06_425657	91	80	the	the	DT
10_1101-2021_01_06_425657	91	81	other	other	JJ
10_1101-2021_01_06_425657	91	82	core	core	NN
10_1101-2021_01_06_425657	91	83	SCF	scf	NN
10_1101-2021_01_06_425657	91	84	components	component	NNS
10_1101-2021_01_06_425657	91	85	.	.	.
10_1101-2021_01_06_425657	92	1	To	to	TO
10_1101-2021_01_06_425657	92	2	test	test	VB
10_1101-2021_01_06_425657	92	3	this	this	DT
10_1101-2021_01_06_425657	92	4	possibility	possibility	NN
10_1101-2021_01_06_425657	92	5	,	,	,
10_1101-2021_01_06_425657	92	6	lysate	lysate	NN
10_1101-2021_01_06_425657	92	7	for	for	IN
10_1101-2021_01_06_425657	92	8	“	"	``
10_1101-2021_01_06_425657	92	9	rich	rich	JJ
10_1101-2021_01_06_425657	92	10	”	"	''
10_1101-2021_01_06_425657	92	11	and	and	CC
10_1101-2021_01_06_425657	92	12	254	254	CD
10_1101-2021_01_06_425657	92	13	“	"	``
10_1101-2021_01_06_425657	92	14	−sulfur	−sulfur	JJ
10_1101-2021_01_06_425657	92	15	”	"	''
10_1101-2021_01_06_425657	92	16	cells	cell	NNS
10_1101-2021_01_06_425657	92	17	was	be	VBD
10_1101-2021_01_06_425657	92	18	prepared	prepare	VBN
10_1101-2021_01_06_425657	92	19	and	and	CC
10_1101-2021_01_06_425657	92	20	each	each	DT
10_1101-2021_01_06_425657	92	21	was	be	VBD
10_1101-2021_01_06_425657	92	22	split	split	VBN
10_1101-2021_01_06_425657	92	23	into	into	IN
10_1101-2021_01_06_425657	92	24	three	three	CD
10_1101-2021_01_06_425657	92	25	groups	group	NNS
10_1101-2021_01_06_425657	92	26	,	,	,
10_1101-2021_01_06_425657	92	27	with	with	IN
10_1101-2021_01_06_425657	92	28	either	either	DT
10_1101-2021_01_06_425657	92	29	reducing	reduce	VBG
10_1101-2021_01_06_425657	92	30	agent	agent	NN
10_1101-2021_01_06_425657	92	31	255	255	CD
10_1101-2021_01_06_425657	92	32	(	(	-LRB-
10_1101-2021_01_06_425657	92	33	+	+	SYM
10_1101-2021_01_06_425657	92	34	DTT	DTT	NNP
10_1101-2021_01_06_425657	92	35	)	)	-RRB-
10_1101-2021_01_06_425657	92	36	,	,	,
10_1101-2021_01_06_425657	92	37	the	the	DT
10_1101-2021_01_06_425657	92	38	thiol	thiol	NN
10_1101-2021_01_06_425657	92	39	-	-	HYPH
10_1101-2021_01_06_425657	92	40	specific	specific	JJ
10_1101-2021_01_06_425657	92	41	oxidizing	oxidizing	JJ
10_1101-2021_01_06_425657	92	42	agent	agent	NN
10_1101-2021_01_06_425657	92	43	tetramethylazodicarboxamide	tetramethylazodicarboxamide	NN
10_1101-2021_01_06_425657	92	44	(	(	-LRB-
10_1101-2021_01_06_425657	92	45	+	+	SYM
10_1101-2021_01_06_425657	92	46	Diamide	diamide	NN
10_1101-2021_01_06_425657	92	47	)	)	-RRB-
10_1101-2021_01_06_425657	92	48	,	,	,
10_1101-2021_01_06_425657	92	49	or	or	CC
10_1101-2021_01_06_425657	92	50	control	control	NN
10_1101-2021_01_06_425657	92	51	256	256	CD
10_1101-2021_01_06_425657	92	52	(	(	-LRB-
10_1101-2021_01_06_425657	92	53	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	92	54	)	)	-RRB-
10_1101-2021_01_06_425657	92	55	(	(	-LRB-
10_1101-2021_01_06_425657	92	56	Figure	figure	NN
10_1101-2021_01_06_425657	92	57	4A	4A	NNP
10_1101-2021_01_06_425657	92	58	)	)	-RRB-
10_1101-2021_01_06_425657	92	59	.	.	.
10_1101-2021_01_06_425657	93	1	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	93	2	IPs	IPs	NNPS
10_1101-2021_01_06_425657	93	3	were	be	VBD
10_1101-2021_01_06_425657	93	4	performed	perform	VBN
10_1101-2021_01_06_425657	93	5	as	as	IN
10_1101-2021_01_06_425657	93	6	previously	previously	RB
10_1101-2021_01_06_425657	93	7	described	describe	VBN
10_1101-2021_01_06_425657	93	8	for	for	IN
10_1101-2021_01_06_425657	93	9	the	the	DT
10_1101-2021_01_06_425657	93	10	in	in	FW
10_1101-2021_01_06_425657	93	11	vitro	vitro	FW
10_1101-2021_01_06_425657	93	12	257	257	CD
10_1101-2021_01_06_425657	93	13	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	93	14	assay	assay	NN
10_1101-2021_01_06_425657	93	15	,	,	,
10_1101-2021_01_06_425657	93	16	except	except	IN
10_1101-2021_01_06_425657	93	17	instead	instead	RB
10_1101-2021_01_06_425657	93	18	of	of	IN
10_1101-2021_01_06_425657	93	19	eluting	elute	VBG
10_1101-2021_01_06_425657	93	20	Met30	Met30	NNP
10_1101-2021_01_06_425657	93	21	off	off	IN
10_1101-2021_01_06_425657	93	22	of	of	IN
10_1101-2021_01_06_425657	93	23	the	the	DT
10_1101-2021_01_06_425657	93	24	beads	bead	NNS
10_1101-2021_01_06_425657	93	25	,	,	,
10_1101-2021_01_06_425657	93	26	the	the	DT
10_1101-2021_01_06_425657	93	27	+	+	SYM
10_1101-2021_01_06_425657	93	28	DTT	DTT	NNP
10_1101-2021_01_06_425657	93	29	,	,	,
10_1101-2021_01_06_425657	93	30	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	93	31	,	,	,
10_1101-2021_01_06_425657	93	32	and	and	CC
10_1101-2021_01_06_425657	93	33	258	258	CD
10_1101-2021_01_06_425657	93	34	+	+	CC
10_1101-2021_01_06_425657	93	35	Diamide	diamide	NN
10_1101-2021_01_06_425657	93	36	beads	bead	NNS
10_1101-2021_01_06_425657	93	37	were	be	VBD
10_1101-2021_01_06_425657	93	38	each	each	DT
10_1101-2021_01_06_425657	93	39	split	split	VBN
10_1101-2021_01_06_425657	93	40	into	into	IN
10_1101-2021_01_06_425657	93	41	two	two	CD
10_1101-2021_01_06_425657	93	42	tubes	tube	NNS
10_1101-2021_01_06_425657	93	43	containing	contain	VBG
10_1101-2021_01_06_425657	93	44	IP	IP	NNP
10_1101-2021_01_06_425657	93	45	buffer	buffer	NN
10_1101-2021_01_06_425657	93	46	±DTT	±dtt	NN
10_1101-2021_01_06_425657	93	47	and	and	CC
10_1101-2021_01_06_425657	93	48	bacterially	bacterially	RB
10_1101-2021_01_06_425657	93	49	purified	purify	VBD
10_1101-2021_01_06_425657	93	50	259	259	CD
10_1101-2021_01_06_425657	93	51	Met4	Met4	NNP
10_1101-2021_01_06_425657	93	52	.	.	.
10_1101-2021_01_06_425657	94	1	The	the	DT
10_1101-2021_01_06_425657	94	2	beads	bead	NNS
10_1101-2021_01_06_425657	94	3	were	be	VBD
10_1101-2021_01_06_425657	94	4	incubated	incubate	VBN
10_1101-2021_01_06_425657	94	5	with	with	IN
10_1101-2021_01_06_425657	94	6	purified	purify	VBN
10_1101-2021_01_06_425657	94	7	Met4	Met4	NNP
10_1101-2021_01_06_425657	94	8	prior	prior	RB
10_1101-2021_01_06_425657	94	9	to	to	IN
10_1101-2021_01_06_425657	94	10	washing	wash	VBG
10_1101-2021_01_06_425657	94	11	with	with	IN
10_1101-2021_01_06_425657	94	12	IP	IP	NNP
10_1101-2021_01_06_425657	94	13	buffer	buffer	NN
10_1101-2021_01_06_425657	94	14	with	with	IN
10_1101-2021_01_06_425657	94	15	or	or	CC
10_1101-2021_01_06_425657	94	16	without	without	IN
10_1101-2021_01_06_425657	94	17	260	260	CD
10_1101-2021_01_06_425657	94	18	DTT	DTT	NNP
10_1101-2021_01_06_425657	94	19	.	.	.
10_1101-2021_01_06_425657	95	1	We	-PRON-	PRP
10_1101-2021_01_06_425657	95	2	observed	observe	VBD
10_1101-2021_01_06_425657	95	3	a	a	DT
10_1101-2021_01_06_425657	95	4	clear	clear	JJ
10_1101-2021_01_06_425657	95	5	,	,	,
10_1101-2021_01_06_425657	95	6	DTT	DTT	NNP
10_1101-2021_01_06_425657	95	7	-	-	HYPH
10_1101-2021_01_06_425657	95	8	dependent	dependent	JJ
10_1101-2021_01_06_425657	95	9	increase	increase	NN
10_1101-2021_01_06_425657	95	10	in	in	IN
10_1101-2021_01_06_425657	95	11	the	the	DT
10_1101-2021_01_06_425657	95	12	fraction	fraction	NN
10_1101-2021_01_06_425657	95	13	of	of	IN
10_1101-2021_01_06_425657	95	14	Met4	Met4	NNP
10_1101-2021_01_06_425657	95	15	bound	bind	VBN
10_1101-2021_01_06_425657	95	16	to	to	IN
10_1101-2021_01_06_425657	95	17	the	the	DT
10_1101-2021_01_06_425657	95	18	Met30	Met30	NNP
10_1101-2021_01_06_425657	95	19	-	-	HYPH
10_1101-2021_01_06_425657	95	20	261	261	CD
10_1101-2021_01_06_425657	95	21	Flag	flag	NN
10_1101-2021_01_06_425657	95	22	beads	bead	NNS
10_1101-2021_01_06_425657	95	23	,	,	,
10_1101-2021_01_06_425657	95	24	with	with	IN
10_1101-2021_01_06_425657	95	25	the	the	DT
10_1101-2021_01_06_425657	95	26	“	"	``
10_1101-2021_01_06_425657	95	27	+	+	SYM
10_1101-2021_01_06_425657	95	28	DTT	DTT	NNP
10_1101-2021_01_06_425657	95	29	”	"	''
10_1101-2021_01_06_425657	95	30	Met30	Met30	NNP
10_1101-2021_01_06_425657	95	31	IP	IP	NNP
10_1101-2021_01_06_425657	95	32	showing	show	VBG
10_1101-2021_01_06_425657	95	33	a	a	DT
10_1101-2021_01_06_425657	95	34	larger	large	JJR
10_1101-2021_01_06_425657	95	35	initial	initial	JJ
10_1101-2021_01_06_425657	95	36	amount	amount	NN
10_1101-2021_01_06_425657	95	37	of	of	IN
10_1101-2021_01_06_425657	95	38	bound	bind	VBN
10_1101-2021_01_06_425657	95	39	Met4	Met4	NNP
10_1101-2021_01_06_425657	95	40	compared	compare	VBN
10_1101-2021_01_06_425657	95	41	262	262	CD
10_1101-2021_01_06_425657	95	42	to	to	IN
10_1101-2021_01_06_425657	95	43	the	the	DT
10_1101-2021_01_06_425657	95	44	“	"	``
10_1101-2021_01_06_425657	95	45	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	95	46	”	"	''
10_1101-2021_01_06_425657	95	47	Met30	Met30	NNP
10_1101-2021_01_06_425657	95	48	IP	IP	NNP
10_1101-2021_01_06_425657	95	49	,	,	,
10_1101-2021_01_06_425657	95	50	with	with	IN
10_1101-2021_01_06_425657	95	51	even	even	RB
10_1101-2021_01_06_425657	95	52	less	less	RBR
10_1101-2021_01_06_425657	95	53	Met4	met4	JJ
10_1101-2021_01_06_425657	95	54	bound	bind	VBN
10_1101-2021_01_06_425657	95	55	to	to	IN
10_1101-2021_01_06_425657	95	56	the	the	DT
10_1101-2021_01_06_425657	95	57	“	"	``
10_1101-2021_01_06_425657	95	58	+	+	NNP
10_1101-2021_01_06_425657	95	59	Diamide	Diamide	NNP
10_1101-2021_01_06_425657	95	60	”	"	''
10_1101-2021_01_06_425657	95	61	Met30-Flag	met30-flag	JJ
10_1101-2021_01_06_425657	95	62	beads	bead	NNS
10_1101-2021_01_06_425657	95	63	.	.	.
10_1101-2021_01_06_425657	96	1	263	263	CD
10_1101-2021_01_06_425657	96	2	Consistent	consistent	JJ
10_1101-2021_01_06_425657	96	3	with	with	IN
10_1101-2021_01_06_425657	96	4	our	-PRON-	PRP$
10_1101-2021_01_06_425657	96	5	hypothesis	hypothesis	NN
10_1101-2021_01_06_425657	96	6	,	,	,
10_1101-2021_01_06_425657	96	7	the	the	DT
10_1101-2021_01_06_425657	96	8	addition	addition	NN
10_1101-2021_01_06_425657	96	9	of	of	IN
10_1101-2021_01_06_425657	96	10	DTT	DTT	NNP
10_1101-2021_01_06_425657	96	11	to	to	IN
10_1101-2021_01_06_425657	96	12	the	the	DT
10_1101-2021_01_06_425657	96	13	Met4	met4	JJ
10_1101-2021_01_06_425657	96	14	co	co	JJ
10_1101-2021_01_06_425657	96	15	-	-	JJ
10_1101-2021_01_06_425657	96	16	IP	ip	NN
10_1101-2021_01_06_425657	96	17	with	with	IN
10_1101-2021_01_06_425657	96	18	“	"	``
10_1101-2021_01_06_425657	96	19	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	96	20	”	"	''
10_1101-2021_01_06_425657	96	21	or	or	CC
10_1101-2021_01_06_425657	96	22	264	264	CD
10_1101-2021_01_06_425657	96	23	“	"	``
10_1101-2021_01_06_425657	96	24	+	+	NNP
10_1101-2021_01_06_425657	96	25	Diamide	Diamide	NNP
10_1101-2021_01_06_425657	96	26	”	"	''
10_1101-2021_01_06_425657	96	27	Met30-Flag	met30-flag	JJ
10_1101-2021_01_06_425657	96	28	beads	bead	NNS
10_1101-2021_01_06_425657	96	29	restored	restore	VBD
10_1101-2021_01_06_425657	96	30	the	the	DT
10_1101-2021_01_06_425657	96	31	Met30	Met30	NNP
10_1101-2021_01_06_425657	96	32	/	/	SYM
10_1101-2021_01_06_425657	96	33	Met4	Met4	NNP
10_1101-2021_01_06_425657	96	34	interaction	interaction	NN
10_1101-2021_01_06_425657	96	35	to	to	IN
10_1101-2021_01_06_425657	96	36	the	the	DT
10_1101-2021_01_06_425657	96	37	degree	degree	NN
10_1101-2021_01_06_425657	96	38	seen	see	VBN
10_1101-2021_01_06_425657	96	39	in	in	IN
10_1101-2021_01_06_425657	96	40	the	the	DT
10_1101-2021_01_06_425657	96	41	265	265	CD
10_1101-2021_01_06_425657	96	42	“	"	``
10_1101-2021_01_06_425657	96	43	+	+	SYM
10_1101-2021_01_06_425657	96	44	DTT	DTT	NNP
10_1101-2021_01_06_425657	96	45	”	"	''
10_1101-2021_01_06_425657	96	46	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	96	47	beads	bead	NNS
10_1101-2021_01_06_425657	96	48	.	.	.
10_1101-2021_01_06_425657	97	1	We	-PRON-	PRP
10_1101-2021_01_06_425657	97	2	then	then	RB
10_1101-2021_01_06_425657	97	3	performed	perform	VBD
10_1101-2021_01_06_425657	97	4	the	the	DT
10_1101-2021_01_06_425657	97	5	same	same	JJ
10_1101-2021_01_06_425657	97	6	experiment	experiment	NN
10_1101-2021_01_06_425657	97	7	with	with	IN
10_1101-2021_01_06_425657	97	8	our	-PRON-	PRP$
10_1101-2021_01_06_425657	97	9	Met30	Met30	NNP
10_1101-2021_01_06_425657	97	10	cysteine	cysteine	NN
10_1101-2021_01_06_425657	97	11	266	266	CD
10_1101-2021_01_06_425657	97	12	point	point	NN
10_1101-2021_01_06_425657	97	13	mutants	mutant	NNS
10_1101-2021_01_06_425657	97	14	.	.	.
10_1101-2021_01_06_425657	98	1	The	the	DT
10_1101-2021_01_06_425657	98	2	amount	amount	NN
10_1101-2021_01_06_425657	98	3	of	of	IN
10_1101-2021_01_06_425657	98	4	Met4	Met4	NNP
10_1101-2021_01_06_425657	98	5	bound	bind	VBN
10_1101-2021_01_06_425657	98	6	to	to	IN
10_1101-2021_01_06_425657	98	7	these	these	DT
10_1101-2021_01_06_425657	98	8	mutants	mutant	NNS
10_1101-2021_01_06_425657	98	9	was	be	VBD
10_1101-2021_01_06_425657	98	10	less	less	RBR
10_1101-2021_01_06_425657	98	11	sensitive	sensitive	JJ
10_1101-2021_01_06_425657	98	12	to	to	IN
10_1101-2021_01_06_425657	98	13	the	the	DT
10_1101-2021_01_06_425657	98	14	presence	presence	NN
10_1101-2021_01_06_425657	98	15	or	or	CC
10_1101-2021_01_06_425657	98	16	267	267	CD
10_1101-2021_01_06_425657	98	17	absence	absence	NN
10_1101-2021_01_06_425657	98	18	of	of	IN
10_1101-2021_01_06_425657	98	19	reducing	reduce	VBG
10_1101-2021_01_06_425657	98	20	agent	agent	NN
10_1101-2021_01_06_425657	98	21	(	(	-LRB-
10_1101-2021_01_06_425657	98	22	Figure	Figure	NNP
10_1101-2021_01_06_425657	98	23	S4B	s4b	NN
10_1101-2021_01_06_425657	98	24	)	)	-RRB-
10_1101-2021_01_06_425657	98	25	.	.	.
10_1101-2021_01_06_425657	99	1	Collectively	collectively	RB
10_1101-2021_01_06_425657	99	2	,	,	,
10_1101-2021_01_06_425657	99	3	these	these	DT
10_1101-2021_01_06_425657	99	4	data	datum	NNS
10_1101-2021_01_06_425657	99	5	suggest	suggest	VBP
10_1101-2021_01_06_425657	99	6	that	that	IN
10_1101-2021_01_06_425657	99	7	the	the	DT
10_1101-2021_01_06_425657	99	8	reduced	reduce	VBN
10_1101-2021_01_06_425657	99	9	form	form	NN
10_1101-2021_01_06_425657	99	10	of	of	IN
10_1101-2021_01_06_425657	99	11	268	268	CD
10_1101-2021_01_06_425657	99	12	key	key	JJ
10_1101-2021_01_06_425657	99	13	cysteine	cysteine	NN
10_1101-2021_01_06_425657	99	14	residues	residue	NNS
10_1101-2021_01_06_425657	99	15	in	in	IN
10_1101-2021_01_06_425657	99	16	Met30	Met30	NNP
10_1101-2021_01_06_425657	99	17	enables	enable	VBZ
10_1101-2021_01_06_425657	99	18	it	-PRON-	PRP
10_1101-2021_01_06_425657	99	19	to	to	TO
10_1101-2021_01_06_425657	99	20	engage	engage	VB
10_1101-2021_01_06_425657	99	21	its	-PRON-	PRP$
10_1101-2021_01_06_425657	99	22	Met4	met4	JJ
10_1101-2021_01_06_425657	99	23	substrate	substrate	NN
10_1101-2021_01_06_425657	99	24	and	and	CC
10_1101-2021_01_06_425657	99	25	facilitate	facilitate	VB
10_1101-2021_01_06_425657	99	26	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	99	27	.	.	.
10_1101-2021_01_06_425657	100	1	269	269	CD
10_1101-2021_01_06_425657	100	2	270	270	CD
10_1101-2021_01_06_425657	100	3	DISCUSSION	discussion	NN
10_1101-2021_01_06_425657	100	4	271	271	CD
10_1101-2021_01_06_425657	100	5	272	272	CD
10_1101-2021_01_06_425657	100	6	The	the	DT
10_1101-2021_01_06_425657	100	7	unique	unique	JJ
10_1101-2021_01_06_425657	100	8	redox	redox	NN
10_1101-2021_01_06_425657	100	9	chemistry	chemistry	NN
10_1101-2021_01_06_425657	100	10	offered	offer	VBN
10_1101-2021_01_06_425657	100	11	by	by	IN
10_1101-2021_01_06_425657	100	12	sulfur	sulfur	NN
10_1101-2021_01_06_425657	100	13	and	and	CC
10_1101-2021_01_06_425657	100	14	sulfur	sulfur	NN
10_1101-2021_01_06_425657	100	15	-	-	HYPH
10_1101-2021_01_06_425657	100	16	containing	contain	VBG
10_1101-2021_01_06_425657	100	17	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	100	18	renders	render	VBZ
10_1101-2021_01_06_425657	100	19	many	many	JJ
10_1101-2021_01_06_425657	100	20	of	of	IN
10_1101-2021_01_06_425657	100	21	273	273	CD
10_1101-2021_01_06_425657	100	22	the	the	DT
10_1101-2021_01_06_425657	100	23	biochemical	biochemical	JJ
10_1101-2021_01_06_425657	100	24	reactions	reaction	NNS
10_1101-2021_01_06_425657	100	25	required	require	VBN
10_1101-2021_01_06_425657	100	26	for	for	IN
10_1101-2021_01_06_425657	100	27	life	life	NN
10_1101-2021_01_06_425657	100	28	possible	possible	JJ
10_1101-2021_01_06_425657	100	29	.	.	.
10_1101-2021_01_06_425657	101	1	The	the	DT
10_1101-2021_01_06_425657	101	2	ability	ability	NN
10_1101-2021_01_06_425657	101	3	to	to	TO
10_1101-2021_01_06_425657	101	4	carefully	carefully	RB
10_1101-2021_01_06_425657	101	5	regulate	regulate	VB
10_1101-2021_01_06_425657	101	6	the	the	DT
10_1101-2021_01_06_425657	101	7	levels	level	NNS
10_1101-2021_01_06_425657	101	8	of	of	IN
10_1101-2021_01_06_425657	101	9	274	274	CD
10_1101-2021_01_06_425657	101	10	these	these	DT
10_1101-2021_01_06_425657	101	11	sulfur	sulfur	NN
10_1101-2021_01_06_425657	101	12	-	-	HYPH
10_1101-2021_01_06_425657	101	13	containing	contain	VBG
10_1101-2021_01_06_425657	101	14	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	101	15	is	be	VBZ
10_1101-2021_01_06_425657	101	16	of	of	IN
10_1101-2021_01_06_425657	101	17	critical	critical	JJ
10_1101-2021_01_06_425657	101	18	importance	importance	NN
10_1101-2021_01_06_425657	101	19	to	to	IN
10_1101-2021_01_06_425657	101	20	cells	cell	NNS
10_1101-2021_01_06_425657	101	21	as	as	IN
10_1101-2021_01_06_425657	101	22	evidenced	evidence	VBN
10_1101-2021_01_06_425657	101	23	by	by	IN
10_1101-2021_01_06_425657	101	24	an	an	DT
10_1101-2021_01_06_425657	101	25	exquisite	exquisite	JJ
10_1101-2021_01_06_425657	101	26	275	275	CD
10_1101-2021_01_06_425657	101	27	sulfur	sulfur	NN
10_1101-2021_01_06_425657	101	28	-	-	HYPH
10_1101-2021_01_06_425657	101	29	sparing	sparing	NN
10_1101-2021_01_06_425657	101	30	response	response	NN
10_1101-2021_01_06_425657	101	31	.	.	.
10_1101-2021_01_06_425657	102	1	Sulfur	sulfur	NN
10_1101-2021_01_06_425657	102	2	starvation	starvation	NN
10_1101-2021_01_06_425657	102	3	induces	induce	VBZ
10_1101-2021_01_06_425657	102	4	the	the	DT
10_1101-2021_01_06_425657	102	5	transcription	transcription	NN
10_1101-2021_01_06_425657	102	6	of	of	IN
10_1101-2021_01_06_425657	102	7	MET	MET	NNP
10_1101-2021_01_06_425657	102	8	genes	gene	NNS
10_1101-2021_01_06_425657	102	9	and	and	CC
10_1101-2021_01_06_425657	102	10	specific	specific	JJ
10_1101-2021_01_06_425657	102	11	276	276	CD
10_1101-2021_01_06_425657	102	12	isozymes	isozyme	NNS
10_1101-2021_01_06_425657	102	13	,	,	,
10_1101-2021_01_06_425657	102	14	which	which	WDT
10_1101-2021_01_06_425657	102	15	themselves	-PRON-	PRP
10_1101-2021_01_06_425657	102	16	contain	contain	VBP
10_1101-2021_01_06_425657	102	17	few	few	JJ
10_1101-2021_01_06_425657	102	18	methionine	methionine	NN
10_1101-2021_01_06_425657	102	19	and	and	CC
10_1101-2021_01_06_425657	102	20	cysteine	cysteine	NN
10_1101-2021_01_06_425657	102	21	residues	residue	NNS
10_1101-2021_01_06_425657	102	22	(	(	-LRB-
10_1101-2021_01_06_425657	102	23	Fauchon	Fauchon	NNP
10_1101-2021_01_06_425657	102	24	et	et	FW
10_1101-2021_01_06_425657	102	25	al	al	NNP
10_1101-2021_01_06_425657	102	26	.	.	NNP
10_1101-2021_01_06_425657	102	27	,	,	,
10_1101-2021_01_06_425657	102	28	2002	2002	CD
10_1101-2021_01_06_425657	102	29	)	)	-RRB-
10_1101-2021_01_06_425657	102	30	.	.	.
10_1101-2021_01_06_425657	103	1	277	277	CD
10_1101-2021_01_06_425657	103	2	Furthermore	furthermore	RB
10_1101-2021_01_06_425657	103	3	,	,	,
10_1101-2021_01_06_425657	103	4	along	along	IN
10_1101-2021_01_06_425657	103	5	with	with	IN
10_1101-2021_01_06_425657	103	6	the	the	DT
10_1101-2021_01_06_425657	103	7	dedicated	dedicated	JJ
10_1101-2021_01_06_425657	103	8	cell	cell	NN
10_1101-2021_01_06_425657	103	9	cycle	cycle	NN
10_1101-2021_01_06_425657	103	10	F	F	NNP
10_1101-2021_01_06_425657	103	11	-	-	HYPH
10_1101-2021_01_06_425657	103	12	box	box	NN
10_1101-2021_01_06_425657	103	13	protein	protein	NN
10_1101-2021_01_06_425657	103	14	Cdc4	Cdc4	NNP
10_1101-2021_01_06_425657	103	15	,	,	,
10_1101-2021_01_06_425657	103	16	Met30	Met30	NNP
10_1101-2021_01_06_425657	103	17	is	be	VBZ
10_1101-2021_01_06_425657	103	18	the	the	DT
10_1101-2021_01_06_425657	103	19	only	only	JJ
10_1101-2021_01_06_425657	103	20	other	other	JJ
10_1101-2021_01_06_425657	103	21	278	278	CD
10_1101-2021_01_06_425657	103	22	essential	essential	JJ
10_1101-2021_01_06_425657	103	23	F	F	NNP
10_1101-2021_01_06_425657	103	24	-	-	HYPH
10_1101-2021_01_06_425657	103	25	box	box	NN
10_1101-2021_01_06_425657	103	26	protein	protein	NN
10_1101-2021_01_06_425657	103	27	in	in	IN
10_1101-2021_01_06_425657	103	28	yeast	yeast	NN
10_1101-2021_01_06_425657	103	29	,	,	,
10_1101-2021_01_06_425657	103	30	linking	link	VBG
10_1101-2021_01_06_425657	103	31	sulfur	sulfur	NN
10_1101-2021_01_06_425657	103	32	metabolite	metabolite	JJ
10_1101-2021_01_06_425657	103	33	levels	level	NNS
10_1101-2021_01_06_425657	103	34	to	to	TO
10_1101-2021_01_06_425657	103	35	cell	cell	NN
10_1101-2021_01_06_425657	103	36	cycle	cycle	NN
10_1101-2021_01_06_425657	103	37	progression	progression	NN
10_1101-2021_01_06_425657	103	38	(	(	-LRB-
10_1101-2021_01_06_425657	103	39	Su	Su	NNP
10_1101-2021_01_06_425657	103	40	et	et	NNP
10_1101-2021_01_06_425657	103	41	279	279	CD
10_1101-2021_01_06_425657	103	42	al	al	NNP
10_1101-2021_01_06_425657	103	43	.	.	NNP
10_1101-2021_01_06_425657	103	44	,	,	,
10_1101-2021_01_06_425657	103	45	2005	2005	CD
10_1101-2021_01_06_425657	103	46	,	,	,
10_1101-2021_01_06_425657	103	47	Su	Su	NNP
10_1101-2021_01_06_425657	103	48	et	et	FW
10_1101-2021_01_06_425657	103	49	al	al	NNP
10_1101-2021_01_06_425657	103	50	.	.	NNP
10_1101-2021_01_06_425657	103	51	,	,	,
10_1101-2021_01_06_425657	103	52	2008	2008	CD
10_1101-2021_01_06_425657	103	53	)	)	-RRB-
10_1101-2021_01_06_425657	103	54	.	.	.
10_1101-2021_01_06_425657	104	1	Our	-PRON-	PRP$
10_1101-2021_01_06_425657	104	2	findings	finding	NNS
10_1101-2021_01_06_425657	104	3	highlight	highlight	VBP
10_1101-2021_01_06_425657	104	4	the	the	DT
10_1101-2021_01_06_425657	104	5	intimate	intimate	JJ
10_1101-2021_01_06_425657	104	6	relationship	relationship	NN
10_1101-2021_01_06_425657	104	7	between	between	IN
10_1101-2021_01_06_425657	104	8	sulfur	sulfur	NN
10_1101-2021_01_06_425657	104	9	280	280	CD
10_1101-2021_01_06_425657	104	10	metabolism	metabolism	NN
10_1101-2021_01_06_425657	104	11	and	and	CC
10_1101-2021_01_06_425657	104	12	redox	redox	NN
10_1101-2021_01_06_425657	104	13	chemistry	chemistry	NN
10_1101-2021_01_06_425657	104	14	in	in	IN
10_1101-2021_01_06_425657	104	15	cellular	cellular	JJ
10_1101-2021_01_06_425657	104	16	biology	biology	NN
10_1101-2021_01_06_425657	104	17	,	,	,
10_1101-2021_01_06_425657	104	18	revealing	reveal	VBG
10_1101-2021_01_06_425657	104	19	that	that	IN
10_1101-2021_01_06_425657	104	20	the	the	DT
10_1101-2021_01_06_425657	104	21	key	key	JJ
10_1101-2021_01_06_425657	104	22	sensor	sensor	NN
10_1101-2021_01_06_425657	104	23	of	of	IN
10_1101-2021_01_06_425657	104	24	sulfur	sulfur	NN
10_1101-2021_01_06_425657	104	25	281	281	CD
10_1101-2021_01_06_425657	104	26	metabolite	metabolite	JJ
10_1101-2021_01_06_425657	104	27	levels	level	NNS
10_1101-2021_01_06_425657	104	28	in	in	IN
10_1101-2021_01_06_425657	104	29	yeast	yeast	NN
10_1101-2021_01_06_425657	104	30	,	,	,
10_1101-2021_01_06_425657	104	31	Met30	Met30	NNP
10_1101-2021_01_06_425657	104	32	,	,	,
10_1101-2021_01_06_425657	104	33	is	be	VBZ
10_1101-2021_01_06_425657	104	34	regulated	regulate	VBN
10_1101-2021_01_06_425657	104	35	by	by	IN
10_1101-2021_01_06_425657	104	36	reversible	reversible	JJ
10_1101-2021_01_06_425657	104	37	cysteine	cysteine	NN
10_1101-2021_01_06_425657	104	38	oxidation	oxidation	NN
10_1101-2021_01_06_425657	104	39	.	.	.
10_1101-2021_01_06_425657	105	1	Such	such	JJ
10_1101-2021_01_06_425657	105	2	oxidation	oxidation	NN
10_1101-2021_01_06_425657	105	3	of	of	IN
10_1101-2021_01_06_425657	105	4	282	282	CD
10_1101-2021_01_06_425657	105	5	Met30	Met30	NNP
10_1101-2021_01_06_425657	105	6	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	105	7	in	in	IN
10_1101-2021_01_06_425657	105	8	turn	turn	NN
10_1101-2021_01_06_425657	105	9	influences	influence	VBZ
10_1101-2021_01_06_425657	105	10	the	the	DT
10_1101-2021_01_06_425657	105	11	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	105	12	status	status	NN
10_1101-2021_01_06_425657	105	13	and	and	CC
10_1101-2021_01_06_425657	105	14	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	105	15	activity	activity	NN
10_1101-2021_01_06_425657	105	16	of	of	IN
10_1101-2021_01_06_425657	105	17	the	the	DT
10_1101-2021_01_06_425657	105	18	283	283	CD
10_1101-2021_01_06_425657	105	19	master	master	NN
10_1101-2021_01_06_425657	105	20	sulfur	sulfur	NN
10_1101-2021_01_06_425657	105	21	metabolism	metabolism	NN
10_1101-2021_01_06_425657	105	22	transcription	transcription	NNP
10_1101-2021_01_06_425657	105	23	factor	factor	NN
10_1101-2021_01_06_425657	105	24	Met4	Met4	NNP
10_1101-2021_01_06_425657	105	25	.	.	.
10_1101-2021_01_06_425657	106	1	While	while	IN
10_1101-2021_01_06_425657	106	2	much	much	JJ
10_1101-2021_01_06_425657	106	3	work	work	NN
10_1101-2021_01_06_425657	106	4	has	have	VBZ
10_1101-2021_01_06_425657	106	5	been	be	VBN
10_1101-2021_01_06_425657	106	6	done	do	VBN
10_1101-2021_01_06_425657	106	7	to	to	IN
10_1101-2021_01_06_425657	106	8	284	284	CD
10_1101-2021_01_06_425657	106	9	characterize	characterize	VB
10_1101-2021_01_06_425657	106	10	the	the	DT
10_1101-2021_01_06_425657	106	11	molecular	molecular	JJ
10_1101-2021_01_06_425657	106	12	basis	basis	NN
10_1101-2021_01_06_425657	106	13	of	of	IN
10_1101-2021_01_06_425657	106	14	sulfur	sulfur	NN
10_1101-2021_01_06_425657	106	15	metabolic	metabolic	JJ
10_1101-2021_01_06_425657	106	16	regulation	regulation	NN
10_1101-2021_01_06_425657	106	17	in	in	IN
10_1101-2021_01_06_425657	106	18	yeast	yeast	NN
10_1101-2021_01_06_425657	106	19	between	between	IN
10_1101-2021_01_06_425657	106	20	Met30	Met30	NNP
10_1101-2021_01_06_425657	106	21	and	and	CC
10_1101-2021_01_06_425657	106	22	Met4	Met4	NNP
10_1101-2021_01_06_425657	106	23	,	,	,
10_1101-2021_01_06_425657	106	24	285	285	CD
10_1101-2021_01_06_425657	106	25	this	this	DT
10_1101-2021_01_06_425657	106	26	work	work	NN
10_1101-2021_01_06_425657	106	27	describes	describe	VBZ
10_1101-2021_01_06_425657	106	28	the	the	DT
10_1101-2021_01_06_425657	106	29	biochemical	biochemical	JJ
10_1101-2021_01_06_425657	106	30	basis	basis	NN
10_1101-2021_01_06_425657	106	31	for	for	IN
10_1101-2021_01_06_425657	106	32	sulfur	sulfur	NN
10_1101-2021_01_06_425657	106	33	sensing	sense	VBG
10_1101-2021_01_06_425657	106	34	by	by	IN
10_1101-2021_01_06_425657	106	35	the	the	DT
10_1101-2021_01_06_425657	106	36	Met30	Met30	NNP
10_1101-2021_01_06_425657	106	37	E3	e3	NN
10_1101-2021_01_06_425657	106	38	ligase	ligase	NN
10_1101-2021_01_06_425657	106	39	(	(	-LRB-
10_1101-2021_01_06_425657	106	40	Figure	Figure	NNP
10_1101-2021_01_06_425657	106	41	5	5	CD
10_1101-2021_01_06_425657	106	42	)	)	-RRB-
10_1101-2021_01_06_425657	106	43	.	.	.
10_1101-2021_01_06_425657	107	1	286	286	CD
10_1101-2021_01_06_425657	107	2	287	287	CD
10_1101-2021_01_06_425657	107	3	The	the	DT
10_1101-2021_01_06_425657	107	4	ability	ability	NN
10_1101-2021_01_06_425657	107	5	of	of	IN
10_1101-2021_01_06_425657	107	6	Met30	Met30	NNP
10_1101-2021_01_06_425657	107	7	to	to	TO
10_1101-2021_01_06_425657	107	8	act	act	VB
10_1101-2021_01_06_425657	107	9	as	as	IN
10_1101-2021_01_06_425657	107	10	a	a	DT
10_1101-2021_01_06_425657	107	11	cysteine	cysteine	JJ
10_1101-2021_01_06_425657	107	12	redox	redox	NN
10_1101-2021_01_06_425657	107	13	-	-	HYPH
10_1101-2021_01_06_425657	107	14	responsive	responsive	JJ
10_1101-2021_01_06_425657	107	15	E3	E3	NNP
10_1101-2021_01_06_425657	107	16	ligase	ligase	NN
10_1101-2021_01_06_425657	107	17	is	be	VBZ
10_1101-2021_01_06_425657	107	18	unique	unique	JJ
10_1101-2021_01_06_425657	107	19	in	in	IN
10_1101-2021_01_06_425657	107	20	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_06_425657	107	21	288	288	CD
10_1101-2021_01_06_425657	107	22	cerevisiae	cerevisiae	NNS
10_1101-2021_01_06_425657	107	23	,	,	,
10_1101-2021_01_06_425657	107	24	but	but	CC
10_1101-2021_01_06_425657	107	25	is	be	VBZ
10_1101-2021_01_06_425657	107	26	reminiscent	reminiscent	JJ
10_1101-2021_01_06_425657	107	27	of	of	IN
10_1101-2021_01_06_425657	107	28	the	the	DT
10_1101-2021_01_06_425657	107	29	redox	redox	NN
10_1101-2021_01_06_425657	107	30	-	-	HYPH
10_1101-2021_01_06_425657	107	31	responsive	responsive	JJ
10_1101-2021_01_06_425657	107	32	Keap1	keap1	NN
10_1101-2021_01_06_425657	107	33	E3	E3	NNP
10_1101-2021_01_06_425657	107	34	ligase	ligase	NN
10_1101-2021_01_06_425657	107	35	in	in	IN
10_1101-2021_01_06_425657	107	36	humans	human	NNS
10_1101-2021_01_06_425657	107	37	.	.	.
10_1101-2021_01_06_425657	108	1	In	in	IN
10_1101-2021_01_06_425657	108	2	humans	human	NNS
10_1101-2021_01_06_425657	108	3	,	,	,
10_1101-2021_01_06_425657	108	4	289	289	CD
10_1101-2021_01_06_425657	108	5	Keap1	keap1	CD
10_1101-2021_01_06_425657	108	6	ubiquitinates	ubiquitinate	NNS
10_1101-2021_01_06_425657	108	7	and	and	CC
10_1101-2021_01_06_425657	108	8	degrades	degrade	VBZ
10_1101-2021_01_06_425657	108	9	its	-PRON-	PRP$
10_1101-2021_01_06_425657	108	10	Nrf2	nrf2	JJ
10_1101-2021_01_06_425657	108	11	substrate	substrate	NN
10_1101-2021_01_06_425657	108	12	to	to	TO
10_1101-2021_01_06_425657	108	13	regulate	regulate	VB
10_1101-2021_01_06_425657	108	14	the	the	DT
10_1101-2021_01_06_425657	108	15	cellular	cellular	JJ
10_1101-2021_01_06_425657	108	16	response	response	NN
10_1101-2021_01_06_425657	108	17	to	to	IN
10_1101-2021_01_06_425657	108	18	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	108	19	290	290	CD
10_1101-2021_01_06_425657	108	20	.CC	.CC	,
10_1101-2021_01_06_425657	108	21	-	-	:
10_1101-2021_01_06_425657	108	22	BY	by	IN
10_1101-2021_01_06_425657	108	23	4.0	4.0	CD
10_1101-2021_01_06_425657	108	24	International	International	NNP
10_1101-2021_01_06_425657	108	25	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	108	26	under	under	IN
10_1101-2021_01_06_425657	108	27	a	a	DT
10_1101-2021_01_06_425657	108	28	(	(	-LRB-
10_1101-2021_01_06_425657	108	29	which	which	WDT
10_1101-2021_01_06_425657	108	30	was	be	VBD
10_1101-2021_01_06_425657	108	31	not	not	RB
10_1101-2021_01_06_425657	108	32	certified	certify	VBN
10_1101-2021_01_06_425657	108	33	by	by	IN
10_1101-2021_01_06_425657	108	34	peer	peer	NN
10_1101-2021_01_06_425657	108	35	review	review	NN
10_1101-2021_01_06_425657	108	36	)	)	-RRB-
10_1101-2021_01_06_425657	108	37	is	be	VBZ
10_1101-2021_01_06_425657	108	38	the	the	DT
10_1101-2021_01_06_425657	108	39	author	author	NN
10_1101-2021_01_06_425657	108	40	/	/	SYM
10_1101-2021_01_06_425657	108	41	funder	funder	NN
10_1101-2021_01_06_425657	108	42	,	,	,
10_1101-2021_01_06_425657	108	43	who	who	WP
10_1101-2021_01_06_425657	108	44	has	have	VBZ
10_1101-2021_01_06_425657	108	45	granted	grant	VBN
10_1101-2021_01_06_425657	108	46	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	108	47	a	a	DT
10_1101-2021_01_06_425657	108	48	license	license	NN
10_1101-2021_01_06_425657	108	49	to	to	TO
10_1101-2021_01_06_425657	108	50	display	display	VB
10_1101-2021_01_06_425657	108	51	the	the	DT
10_1101-2021_01_06_425657	108	52	preprint	preprint	NN
10_1101-2021_01_06_425657	108	53	in	in	IN
10_1101-2021_01_06_425657	108	54	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	108	55	.	.	.
10_1101-2021_01_06_425657	109	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	109	2	is	be	VBZ
10_1101-2021_01_06_425657	109	3	made	make	VBN
10_1101-2021_01_06_425657	109	4	The	the	DT
10_1101-2021_01_06_425657	109	5	copyright	copyright	NN
10_1101-2021_01_06_425657	109	6	holder	holder	NN
10_1101-2021_01_06_425657	109	7	for	for	IN
10_1101-2021_01_06_425657	109	8	this	this	DT
10_1101-2021_01_06_425657	109	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	109	10	version	version	NN
10_1101-2021_01_06_425657	109	11	posted	post	VBD
10_1101-2021_01_06_425657	109	12	January	January	NNP
10_1101-2021_01_06_425657	109	13	7	7	CD
10_1101-2021_01_06_425657	109	14	,	,	,
10_1101-2021_01_06_425657	109	15	2021	2021	CD
10_1101-2021_01_06_425657	109	16	.	.	.
10_1101-2021_01_06_425657	109	17	;	;	:
10_1101-2021_01_06_425657	109	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	109	19	:	:	:
10_1101-2021_01_06_425657	109	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	109	21	preprint	preprint	NN
10_1101-2021_01_06_425657	109	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NN
10_1101-2021_01_06_425657	109	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	109	24	9	9	CD
10_1101-2021_01_06_425657	109	25	stress	stress	NN
10_1101-2021_01_06_425657	109	26	.	.	.
10_1101-2021_01_06_425657	110	1	When	when	WRB
10_1101-2021_01_06_425657	110	2	cells	cell	NNS
10_1101-2021_01_06_425657	110	3	are	be	VBP
10_1101-2021_01_06_425657	110	4	exposed	expose	VBN
10_1101-2021_01_06_425657	110	5	to	to	IN
10_1101-2021_01_06_425657	110	6	electrophilic	electrophilic	JJ
10_1101-2021_01_06_425657	110	7	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	110	8	or	or	CC
10_1101-2021_01_06_425657	110	9	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	110	10	stress	stress	NN
10_1101-2021_01_06_425657	110	11	,	,	,
10_1101-2021_01_06_425657	110	12	key	key	JJ
10_1101-2021_01_06_425657	110	13	cysteine	cysteine	NN
10_1101-2021_01_06_425657	110	14	291	291	CD
10_1101-2021_01_06_425657	110	15	residues	residue	NNS
10_1101-2021_01_06_425657	110	16	are	be	VBP
10_1101-2021_01_06_425657	110	17	either	either	CC
10_1101-2021_01_06_425657	110	18	alkylated	alkylate	VBN
10_1101-2021_01_06_425657	110	19	or	or	CC
10_1101-2021_01_06_425657	110	20	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	110	21	into	into	IN
10_1101-2021_01_06_425657	110	22	disulfides	disulfide	NNS
10_1101-2021_01_06_425657	110	23	,	,	,
10_1101-2021_01_06_425657	110	24	resulting	result	VBG
10_1101-2021_01_06_425657	110	25	in	in	IN
10_1101-2021_01_06_425657	110	26	conformational	conformational	JJ
10_1101-2021_01_06_425657	110	27	changes	change	NNS
10_1101-2021_01_06_425657	110	28	that	that	IN
10_1101-2021_01_06_425657	110	29	,	,	,
10_1101-2021_01_06_425657	110	30	292	292	CD
10_1101-2021_01_06_425657	110	31	in	in	IN
10_1101-2021_01_06_425657	110	32	turn	turn	NN
10_1101-2021_01_06_425657	110	33	,	,	,
10_1101-2021_01_06_425657	110	34	either	either	CC
10_1101-2021_01_06_425657	110	35	disrupt	disrupt	VB
10_1101-2021_01_06_425657	110	36	Keap1	Keap1	NNP
10_1101-2021_01_06_425657	110	37	association	association	NN
10_1101-2021_01_06_425657	110	38	with	with	IN
10_1101-2021_01_06_425657	110	39	Cul3	Cul3	NNP
10_1101-2021_01_06_425657	110	40	or	or	CC
10_1101-2021_01_06_425657	110	41	Nrf2	Nrf2	NNP
10_1101-2021_01_06_425657	110	42	,	,	,
10_1101-2021_01_06_425657	110	43	both	both	DT
10_1101-2021_01_06_425657	110	44	leading	lead	VBG
10_1101-2021_01_06_425657	110	45	to	to	IN
10_1101-2021_01_06_425657	110	46	Nrf2	nrf2	JJ
10_1101-2021_01_06_425657	110	47	activation	activation	NN
10_1101-2021_01_06_425657	110	48	293	293	CD
10_1101-2021_01_06_425657	110	49	(	(	-LRB-
10_1101-2021_01_06_425657	110	50	Yamamoto	Yamamoto	NNP
10_1101-2021_01_06_425657	110	51	et	et	NNP
10_1101-2021_01_06_425657	110	52	al	al	NNP
10_1101-2021_01_06_425657	110	53	.	.	NNP
10_1101-2021_01_06_425657	110	54	,	,	,
10_1101-2021_01_06_425657	110	55	2018	2018	CD
10_1101-2021_01_06_425657	110	56	)	)	-RRB-
10_1101-2021_01_06_425657	110	57	.	.	.
10_1101-2021_01_06_425657	111	1	Our	-PRON-	PRP$
10_1101-2021_01_06_425657	111	2	data	datum	NNS
10_1101-2021_01_06_425657	111	3	suggest	suggest	VBP
10_1101-2021_01_06_425657	111	4	that	that	IN
10_1101-2021_01_06_425657	111	5	in	in	IN
10_1101-2021_01_06_425657	111	6	response	response	NN
10_1101-2021_01_06_425657	111	7	to	to	IN
10_1101-2021_01_06_425657	111	8	sulfur	sulfur	NN
10_1101-2021_01_06_425657	111	9	starvation	starvation	NN
10_1101-2021_01_06_425657	111	10	,	,	,
10_1101-2021_01_06_425657	111	11	Met30	Met30	NNP
10_1101-2021_01_06_425657	111	12	can	can	MD
10_1101-2021_01_06_425657	111	13	still	still	RB
10_1101-2021_01_06_425657	111	14	294	294	CD
10_1101-2021_01_06_425657	111	15	maintain	maintain	VB
10_1101-2021_01_06_425657	111	16	its	-PRON-	PRP$
10_1101-2021_01_06_425657	111	17	association	association	NN
10_1101-2021_01_06_425657	111	18	with	with	IN
10_1101-2021_01_06_425657	111	19	the	the	DT
10_1101-2021_01_06_425657	111	20	SCF	SCF	NNP
10_1101-2021_01_06_425657	111	21	E3	e3	CC
10_1101-2021_01_06_425657	111	22	ligase	ligase	NN
10_1101-2021_01_06_425657	111	23	cullin	cullin	NNP
10_1101-2021_01_06_425657	111	24	scaffold	scaffold	NNP
10_1101-2021_01_06_425657	111	25	,	,	,
10_1101-2021_01_06_425657	111	26	but	but	CC
10_1101-2021_01_06_425657	111	27	that	that	DT
10_1101-2021_01_06_425657	111	28	treatment	treatment	NN
10_1101-2021_01_06_425657	111	29	of	of	IN
10_1101-2021_01_06_425657	111	30	the	the	DT
10_1101-2021_01_06_425657	111	31	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	111	32	295	295	CD
10_1101-2021_01_06_425657	111	33	complex	complex	NN
10_1101-2021_01_06_425657	111	34	with	with	IN
10_1101-2021_01_06_425657	111	35	reducing	reduce	VBG
10_1101-2021_01_06_425657	111	36	agent	agent	NN
10_1101-2021_01_06_425657	111	37	is	be	VBZ
10_1101-2021_01_06_425657	111	38	sufficient	sufficient	JJ
10_1101-2021_01_06_425657	111	39	to	to	TO
10_1101-2021_01_06_425657	111	40	stimulate	stimulate	VB
10_1101-2021_01_06_425657	111	41	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	111	42	of	of	IN
10_1101-2021_01_06_425657	111	43	Met4	Met4	NNP
10_1101-2021_01_06_425657	111	44	in	in	IN
10_1101-2021_01_06_425657	111	45	vitro	vitro	FW
10_1101-2021_01_06_425657	111	46	.	.	.
10_1101-2021_01_06_425657	112	1	This	this	DT
10_1101-2021_01_06_425657	112	2	,	,	,
10_1101-2021_01_06_425657	112	3	along	along	IN
10_1101-2021_01_06_425657	112	4	296	296	CD
10_1101-2021_01_06_425657	112	5	with	with	IN
10_1101-2021_01_06_425657	112	6	the	the	DT
10_1101-2021_01_06_425657	112	7	in	in	IN
10_1101-2021_01_06_425657	112	8	vivo	vivo	NNP
10_1101-2021_01_06_425657	112	9	and	and	CC
10_1101-2021_01_06_425657	112	10	in	in	FW
10_1101-2021_01_06_425657	112	11	vitro	vitro	FW
10_1101-2021_01_06_425657	112	12	Met30	Met30	NNP
10_1101-2021_01_06_425657	112	13	cysteine	cysteine	NN
10_1101-2021_01_06_425657	112	14	point	point	NN
10_1101-2021_01_06_425657	112	15	mutant	mutant	JJ
10_1101-2021_01_06_425657	112	16	data	datum	NNS
10_1101-2021_01_06_425657	112	17	,	,	,
10_1101-2021_01_06_425657	112	18	leads	lead	VBZ
10_1101-2021_01_06_425657	112	19	us	-PRON-	PRP
10_1101-2021_01_06_425657	112	20	to	to	TO
10_1101-2021_01_06_425657	112	21	conclude	conclude	VB
10_1101-2021_01_06_425657	112	22	that	that	IN
10_1101-2021_01_06_425657	112	23	it	-PRON-	PRP
10_1101-2021_01_06_425657	112	24	is	be	VBZ
10_1101-2021_01_06_425657	112	25	the	the	DT
10_1101-2021_01_06_425657	112	26	297	297	CD
10_1101-2021_01_06_425657	112	27	ability	ability	NN
10_1101-2021_01_06_425657	112	28	of	of	IN
10_1101-2021_01_06_425657	112	29	Met30	Met30	NNP
10_1101-2021_01_06_425657	112	30	to	to	TO
10_1101-2021_01_06_425657	112	31	bind	bind	VB
10_1101-2021_01_06_425657	112	32	its	-PRON-	PRP$
10_1101-2021_01_06_425657	112	33	substrate	substrate	NN
10_1101-2021_01_06_425657	112	34	Met4	Met4	NNP
10_1101-2021_01_06_425657	112	35	that	that	WDT
10_1101-2021_01_06_425657	112	36	is	be	VBZ
10_1101-2021_01_06_425657	112	37	being	be	VBG
10_1101-2021_01_06_425657	112	38	disrupted	disrupt	VBN
10_1101-2021_01_06_425657	112	39	by	by	IN
10_1101-2021_01_06_425657	112	40	cysteine	cysteine	NN
10_1101-2021_01_06_425657	112	41	oxidation	oxidation	NN
10_1101-2021_01_06_425657	112	42	.	.	.
10_1101-2021_01_06_425657	113	1	298	298	CD
10_1101-2021_01_06_425657	113	2	299	299	CD
10_1101-2021_01_06_425657	113	3	Previous	previous	JJ
10_1101-2021_01_06_425657	113	4	work	work	NN
10_1101-2021_01_06_425657	113	5	on	on	IN
10_1101-2021_01_06_425657	113	6	the	the	DT
10_1101-2021_01_06_425657	113	7	yeast	yeast	NN
10_1101-2021_01_06_425657	113	8	response	response	NN
10_1101-2021_01_06_425657	113	9	to	to	IN
10_1101-2021_01_06_425657	113	10	cadmium	cadmium	NN
10_1101-2021_01_06_425657	113	11	toxicity	toxicity	NN
10_1101-2021_01_06_425657	113	12	demonstrated	demonstrate	VBD
10_1101-2021_01_06_425657	113	13	that	that	IN
10_1101-2021_01_06_425657	113	14	Met30	Met30	NNP
10_1101-2021_01_06_425657	113	15	is	be	VBZ
10_1101-2021_01_06_425657	113	16	stripped	strip	VBN
10_1101-2021_01_06_425657	113	17	from	from	IN
10_1101-2021_01_06_425657	113	18	300	300	CD
10_1101-2021_01_06_425657	113	19	SCF	scf	NN
10_1101-2021_01_06_425657	113	20	complexes	complex	NNS
10_1101-2021_01_06_425657	113	21	by	by	IN
10_1101-2021_01_06_425657	113	22	the	the	DT
10_1101-2021_01_06_425657	113	23	p97	p97	NN
10_1101-2021_01_06_425657	113	24	/	/	SYM
10_1101-2021_01_06_425657	113	25	Cdc48	Cdc48	NNP
10_1101-2021_01_06_425657	113	26	segregase	segregase	NN
10_1101-2021_01_06_425657	113	27	upon	upon	IN
10_1101-2021_01_06_425657	113	28	treatment	treatment	NN
10_1101-2021_01_06_425657	113	29	with	with	IN
10_1101-2021_01_06_425657	113	30	cadmium	cadmium	NN
10_1101-2021_01_06_425657	113	31	,	,	,
10_1101-2021_01_06_425657	113	32	suggesting	suggest	VBG
10_1101-2021_01_06_425657	113	33	that	that	IN
10_1101-2021_01_06_425657	113	34	like	like	UH
10_1101-2021_01_06_425657	113	35	301	301	CD
10_1101-2021_01_06_425657	113	36	Keap1	Keap1	NNS
10_1101-2021_01_06_425657	113	37	,	,	,
10_1101-2021_01_06_425657	113	38	Met30	Met30	NNP
10_1101-2021_01_06_425657	113	39	can	can	MD
10_1101-2021_01_06_425657	113	40	utilize	utilize	VB
10_1101-2021_01_06_425657	113	41	both	both	DT
10_1101-2021_01_06_425657	113	42	dissociation	dissociation	NN
10_1101-2021_01_06_425657	113	43	from	from	IN
10_1101-2021_01_06_425657	113	44	SCF	scf	NN
10_1101-2021_01_06_425657	113	45	complexes	complex	NNS
10_1101-2021_01_06_425657	113	46	and	and	CC
10_1101-2021_01_06_425657	113	47	disrupted	disrupt	VBD
10_1101-2021_01_06_425657	113	48	interaction	interaction	NN
10_1101-2021_01_06_425657	113	49	with	with	IN
10_1101-2021_01_06_425657	113	50	302	302	CD
10_1101-2021_01_06_425657	113	51	Met4	Met4	NNP
10_1101-2021_01_06_425657	113	52	to	to	TO
10_1101-2021_01_06_425657	113	53	modulate	modulate	VB
10_1101-2021_01_06_425657	113	54	Met4	met4	JJ
10_1101-2021_01_06_425657	113	55	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	113	56	activation	activation	NN
10_1101-2021_01_06_425657	113	57	(	(	-LRB-
10_1101-2021_01_06_425657	113	58	Barbey	Barbey	NNP
10_1101-2021_01_06_425657	113	59	et	et	NNP
10_1101-2021_01_06_425657	113	60	al	al	NNP
10_1101-2021_01_06_425657	113	61	.	.	NNP
10_1101-2021_01_06_425657	113	62	,	,	,
10_1101-2021_01_06_425657	113	63	2005	2005	CD
10_1101-2021_01_06_425657	113	64	,	,	,
10_1101-2021_01_06_425657	113	65	Yen	Yen	NNP
10_1101-2021_01_06_425657	113	66	et	et	FW
10_1101-2021_01_06_425657	113	67	al	al	NNP
10_1101-2021_01_06_425657	113	68	.	.	NNP
10_1101-2021_01_06_425657	113	69	,	,	,
10_1101-2021_01_06_425657	113	70	2012	2012	CD
10_1101-2021_01_06_425657	113	71	)	)	-RRB-
10_1101-2021_01_06_425657	113	72	.	.	.
10_1101-2021_01_06_425657	114	1	Recent	recent	JJ
10_1101-2021_01_06_425657	114	2	303	303	CD
10_1101-2021_01_06_425657	114	3	work	work	NN
10_1101-2021_01_06_425657	114	4	on	on	IN
10_1101-2021_01_06_425657	114	5	the	the	DT
10_1101-2021_01_06_425657	114	6	sensing	sensing	NN
10_1101-2021_01_06_425657	114	7	of	of	IN
10_1101-2021_01_06_425657	114	8	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	114	9	stress	stress	NN
10_1101-2021_01_06_425657	114	10	by	by	IN
10_1101-2021_01_06_425657	114	11	Keap1	Keap1	NNP
10_1101-2021_01_06_425657	114	12	has	have	VBZ
10_1101-2021_01_06_425657	114	13	found	find	VBN
10_1101-2021_01_06_425657	114	14	that	that	IN
10_1101-2021_01_06_425657	114	15	multiple	multiple	JJ
10_1101-2021_01_06_425657	114	16	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	114	17	in	in	IN
10_1101-2021_01_06_425657	114	18	Keap1	Keap1	:
10_1101-2021_01_06_425657	114	19	can	can	MD
10_1101-2021_01_06_425657	114	20	304	304	CD
10_1101-2021_01_06_425657	114	21	act	act	VB
10_1101-2021_01_06_425657	114	22	cooperatively	cooperatively	RB
10_1101-2021_01_06_425657	114	23	to	to	TO
10_1101-2021_01_06_425657	114	24	form	form	VB
10_1101-2021_01_06_425657	114	25	disulfides	disulfide	NNS
10_1101-2021_01_06_425657	114	26	,	,	,
10_1101-2021_01_06_425657	114	27	and	and	CC
10_1101-2021_01_06_425657	114	28	that	that	IN
10_1101-2021_01_06_425657	114	29	the	the	DT
10_1101-2021_01_06_425657	114	30	use	use	NN
10_1101-2021_01_06_425657	114	31	of	of	IN
10_1101-2021_01_06_425657	114	32	multiples	multiple	NNS
10_1101-2021_01_06_425657	114	33	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	114	34	to	to	TO
10_1101-2021_01_06_425657	114	35	form	form	VB
10_1101-2021_01_06_425657	114	36	different	different	JJ
10_1101-2021_01_06_425657	114	37	305	305	CD
10_1101-2021_01_06_425657	114	38	disulfide	disulfide	JJ
10_1101-2021_01_06_425657	114	39	bridges	bridge	NNS
10_1101-2021_01_06_425657	114	40	creates	create	VBZ
10_1101-2021_01_06_425657	114	41	an	an	DT
10_1101-2021_01_06_425657	114	42	“	"	``
10_1101-2021_01_06_425657	114	43	elaborate	elaborate	JJ
10_1101-2021_01_06_425657	114	44	fail	fail	NN
10_1101-2021_01_06_425657	114	45	-	-	HYPH
10_1101-2021_01_06_425657	114	46	safe	safe	JJ
10_1101-2021_01_06_425657	114	47	mechanism	mechanism	NN
10_1101-2021_01_06_425657	114	48	”	"	''
10_1101-2021_01_06_425657	114	49	to	to	TO
10_1101-2021_01_06_425657	114	50	sense	sense	VB
10_1101-2021_01_06_425657	114	51	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	114	52	stress	stress	NN
10_1101-2021_01_06_425657	114	53	(	(	-LRB-
10_1101-2021_01_06_425657	114	54	Suzuki	Suzuki	NNP
10_1101-2021_01_06_425657	114	55	et	et	NNP
10_1101-2021_01_06_425657	114	56	306	306	CD
10_1101-2021_01_06_425657	114	57	al	al	NNP
10_1101-2021_01_06_425657	114	58	.	.	NNP
10_1101-2021_01_06_425657	114	59	,	,	,
10_1101-2021_01_06_425657	114	60	2019	2019	CD
10_1101-2021_01_06_425657	114	61	)	)	-RRB-
10_1101-2021_01_06_425657	114	62	.	.	.
10_1101-2021_01_06_425657	115	1	In	in	IN
10_1101-2021_01_06_425657	115	2	light	light	NN
10_1101-2021_01_06_425657	115	3	of	of	IN
10_1101-2021_01_06_425657	115	4	our	-PRON-	PRP$
10_1101-2021_01_06_425657	115	5	findings	finding	NNS
10_1101-2021_01_06_425657	115	6	,	,	,
10_1101-2021_01_06_425657	115	7	we	-PRON-	PRP
10_1101-2021_01_06_425657	115	8	suspect	suspect	VBP
10_1101-2021_01_06_425657	115	9	Met30	Met30	NNP
10_1101-2021_01_06_425657	115	10	might	may	MD
10_1101-2021_01_06_425657	115	11	similarly	similarly	RB
10_1101-2021_01_06_425657	115	12	use	use	VB
10_1101-2021_01_06_425657	115	13	multiple	multiple	JJ
10_1101-2021_01_06_425657	115	14	cysteine	cysteine	NN
10_1101-2021_01_06_425657	115	15	residues	residue	VBZ
10_1101-2021_01_06_425657	115	16	307	307	CD
10_1101-2021_01_06_425657	115	17	in	in	IN
10_1101-2021_01_06_425657	115	18	a	a	DT
10_1101-2021_01_06_425657	115	19	cooperative	cooperative	JJ
10_1101-2021_01_06_425657	115	20	disulfide	disulfide	JJ
10_1101-2021_01_06_425657	115	21	formation	formation	NN
10_1101-2021_01_06_425657	115	22	mechanism	mechanism	NN
10_1101-2021_01_06_425657	115	23	to	to	TO
10_1101-2021_01_06_425657	115	24	disrupt	disrupt	VB
10_1101-2021_01_06_425657	115	25	the	the	DT
10_1101-2021_01_06_425657	115	26	binding	bind	VBG
10_1101-2021_01_06_425657	115	27	interface	interface	NN
10_1101-2021_01_06_425657	115	28	between	between	IN
10_1101-2021_01_06_425657	115	29	Met30	Met30	NNP
10_1101-2021_01_06_425657	115	30	308	308	CD
10_1101-2021_01_06_425657	115	31	and	and	CC
10_1101-2021_01_06_425657	115	32	Met4	Met4	NNP
10_1101-2021_01_06_425657	115	33	,	,	,
10_1101-2021_01_06_425657	115	34	but	but	CC
10_1101-2021_01_06_425657	115	35	more	more	JJR
10_1101-2021_01_06_425657	115	36	work	work	NN
10_1101-2021_01_06_425657	115	37	will	will	MD
10_1101-2021_01_06_425657	115	38	be	be	VB
10_1101-2021_01_06_425657	115	39	needed	need	VBN
10_1101-2021_01_06_425657	115	40	to	to	TO
10_1101-2021_01_06_425657	115	41	demonstrate	demonstrate	VB
10_1101-2021_01_06_425657	115	42	this	this	DT
10_1101-2021_01_06_425657	115	43	definitively	definitively	RB
10_1101-2021_01_06_425657	115	44	.	.	.
10_1101-2021_01_06_425657	116	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	116	2	is	be	VBZ
10_1101-2021_01_06_425657	116	3	worth	worth	JJ
10_1101-2021_01_06_425657	116	4	noting	note	VBG
10_1101-2021_01_06_425657	116	5	the	the	DT
10_1101-2021_01_06_425657	116	6	309	309	CD
10_1101-2021_01_06_425657	116	7	curious	curious	JJ
10_1101-2021_01_06_425657	116	8	spacing	spacing	NN
10_1101-2021_01_06_425657	116	9	and	and	CC
10_1101-2021_01_06_425657	116	10	clustering	clustering	NN
10_1101-2021_01_06_425657	116	11	of	of	IN
10_1101-2021_01_06_425657	116	12	cysteine	cysteine	NN
10_1101-2021_01_06_425657	116	13	residues	residue	NNS
10_1101-2021_01_06_425657	116	14	in	in	IN
10_1101-2021_01_06_425657	116	15	Met30	Met30	NNP
10_1101-2021_01_06_425657	116	16	,	,	,
10_1101-2021_01_06_425657	116	17	with	with	IN
10_1101-2021_01_06_425657	116	18	the	the	DT
10_1101-2021_01_06_425657	116	19	highest	high	JJS
10_1101-2021_01_06_425657	116	20	density	density	NN
10_1101-2021_01_06_425657	116	21	and	and	CC
10_1101-2021_01_06_425657	116	22	closest	close	JJS
10_1101-2021_01_06_425657	116	23	310	310	CD
10_1101-2021_01_06_425657	116	24	spacing	spacing	NN
10_1101-2021_01_06_425657	116	25	of	of	IN
10_1101-2021_01_06_425657	116	26	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	116	27	found	find	VBN
10_1101-2021_01_06_425657	116	28	in	in	IN
10_1101-2021_01_06_425657	116	29	two	two	CD
10_1101-2021_01_06_425657	116	30	WD-40	WD-40	NNP
10_1101-2021_01_06_425657	116	31	repeats	repeat	NNS
10_1101-2021_01_06_425657	116	32	that	that	WDT
10_1101-2021_01_06_425657	116	33	are	be	VBP
10_1101-2021_01_06_425657	116	34	expected	expect	VBN
10_1101-2021_01_06_425657	116	35	to	to	TO
10_1101-2021_01_06_425657	116	36	be	be	VB
10_1101-2021_01_06_425657	116	37	directly	directly	RB
10_1101-2021_01_06_425657	116	38	across	across	IN
10_1101-2021_01_06_425657	116	39	from	from	IN
10_1101-2021_01_06_425657	116	40	each	each	DT
10_1101-2021_01_06_425657	116	41	311	311	CD
10_1101-2021_01_06_425657	116	42	other	other	JJ
10_1101-2021_01_06_425657	116	43	in	in	IN
10_1101-2021_01_06_425657	116	44	the	the	DT
10_1101-2021_01_06_425657	116	45	3D	3d	JJ
10_1101-2021_01_06_425657	116	46	structure	structure	NN
10_1101-2021_01_06_425657	116	47	(	(	-LRB-
10_1101-2021_01_06_425657	116	48	Figure	Figure	NNP
10_1101-2021_01_06_425657	116	49	2A	2a	NN
10_1101-2021_01_06_425657	116	50	)	)	-RRB-
10_1101-2021_01_06_425657	116	51	.	.	.
10_1101-2021_01_06_425657	117	1	That	that	IN
10_1101-2021_01_06_425657	117	2	the	the	DT
10_1101-2021_01_06_425657	117	3	mutation	mutation	NN
10_1101-2021_01_06_425657	117	4	of	of	IN
10_1101-2021_01_06_425657	117	5	these	these	DT
10_1101-2021_01_06_425657	117	6	cysteine	cysteine	NN
10_1101-2021_01_06_425657	117	7	clusters	cluster	NNS
10_1101-2021_01_06_425657	117	8	to	to	TO
10_1101-2021_01_06_425657	117	9	serine	serine	NNP
10_1101-2021_01_06_425657	117	10	have	have	VB
10_1101-2021_01_06_425657	117	11	312	312	CD
10_1101-2021_01_06_425657	117	12	the	the	DT
10_1101-2021_01_06_425657	117	13	largest	large	JJS
10_1101-2021_01_06_425657	117	14	in	in	IN
10_1101-2021_01_06_425657	117	15	vivo	vivo	NNP
10_1101-2021_01_06_425657	117	16	effect	effect	NN
10_1101-2021_01_06_425657	117	17	,	,	,
10_1101-2021_01_06_425657	117	18	but	but	CC
10_1101-2021_01_06_425657	117	19	mutation	mutation	NN
10_1101-2021_01_06_425657	117	20	of	of	IN
10_1101-2021_01_06_425657	117	21	any	any	DT
10_1101-2021_01_06_425657	117	22	one	one	CD
10_1101-2021_01_06_425657	117	23	cysteine	cysteine	NN
10_1101-2021_01_06_425657	117	24	to	to	IN
10_1101-2021_01_06_425657	117	25	serine	serine	NNP
10_1101-2021_01_06_425657	117	26	(	(	-LRB-
10_1101-2021_01_06_425657	117	27	with	with	IN
10_1101-2021_01_06_425657	117	28	the	the	DT
10_1101-2021_01_06_425657	117	29	notable	notable	JJ
10_1101-2021_01_06_425657	117	30	exception	exception	NN
10_1101-2021_01_06_425657	117	31	of	of	IN
10_1101-2021_01_06_425657	117	32	313	313	CD
10_1101-2021_01_06_425657	117	33	Cys414	cys414	CD
10_1101-2021_01_06_425657	117	34	)	)	-RRB-
10_1101-2021_01_06_425657	117	35	has	have	VBZ
10_1101-2021_01_06_425657	117	36	no	no	DT
10_1101-2021_01_06_425657	117	37	effect	effect	NN
10_1101-2021_01_06_425657	117	38	,	,	,
10_1101-2021_01_06_425657	117	39	implies	imply	VBZ
10_1101-2021_01_06_425657	117	40	some	some	DT
10_1101-2021_01_06_425657	117	41	built	build	VBN
10_1101-2021_01_06_425657	117	42	-	-	HYPH
10_1101-2021_01_06_425657	117	43	in	in	RP
10_1101-2021_01_06_425657	117	44	redundancy	redundancy	NN
10_1101-2021_01_06_425657	117	45	in	in	IN
10_1101-2021_01_06_425657	117	46	the	the	DT
10_1101-2021_01_06_425657	117	47	cysteine	cysteine	NN
10_1101-2021_01_06_425657	117	48	-	-	HYPH
10_1101-2021_01_06_425657	117	49	based	base	VBN
10_1101-2021_01_06_425657	117	50	redox	redox	NN
10_1101-2021_01_06_425657	117	51	-	-	HYPH
10_1101-2021_01_06_425657	117	52	sensing	sense	VBG
10_1101-2021_01_06_425657	117	53	314	314	CD
10_1101-2021_01_06_425657	117	54	mechanism	mechanism	NN
10_1101-2021_01_06_425657	117	55	(	(	-LRB-
10_1101-2021_01_06_425657	117	56	Figure	Figure	NNP
10_1101-2021_01_06_425657	117	57	S2B	S2B	NNP
10_1101-2021_01_06_425657	117	58	)	)	-RRB-
10_1101-2021_01_06_425657	117	59	.	.	.
10_1101-2021_01_06_425657	118	1	We	-PRON-	PRP
10_1101-2021_01_06_425657	118	2	speculate	speculate	VBP
10_1101-2021_01_06_425657	118	3	that	that	IN
10_1101-2021_01_06_425657	118	4	the	the	DT
10_1101-2021_01_06_425657	118	5	oxidation	oxidation	NN
10_1101-2021_01_06_425657	118	6	of	of	IN
10_1101-2021_01_06_425657	118	7	the	the	DT
10_1101-2021_01_06_425657	118	8	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	118	9	in	in	IN
10_1101-2021_01_06_425657	118	10	the	the	DT
10_1101-2021_01_06_425657	118	11	WD-40	WD-40	NNP
10_1101-2021_01_06_425657	118	12	repeat	repeat	NN
10_1101-2021_01_06_425657	118	13	315	315	CD
10_1101-2021_01_06_425657	118	14	region	region	NN
10_1101-2021_01_06_425657	118	15	of	of	IN
10_1101-2021_01_06_425657	118	16	Met30	Met30	NNP
10_1101-2021_01_06_425657	118	17	work	work	NN
10_1101-2021_01_06_425657	118	18	cooperatively	cooperatively	RB
10_1101-2021_01_06_425657	118	19	to	to	TO
10_1101-2021_01_06_425657	118	20	produce	produce	VB
10_1101-2021_01_06_425657	118	21	structural	structural	JJ
10_1101-2021_01_06_425657	118	22	changes	change	NNS
10_1101-2021_01_06_425657	118	23	that	that	WDT
10_1101-2021_01_06_425657	118	24	position	position	VBP
10_1101-2021_01_06_425657	118	25	Cys414	cys414	CD
10_1101-2021_01_06_425657	118	26	to	to	TO
10_1101-2021_01_06_425657	118	27	make	make	VB
10_1101-2021_01_06_425657	118	28	a	a	DT
10_1101-2021_01_06_425657	118	29	316	316	CD
10_1101-2021_01_06_425657	118	30	key	key	JJ
10_1101-2021_01_06_425657	118	31	disulfide	disulfide	JJ
10_1101-2021_01_06_425657	118	32	linkage	linkage	NN
10_1101-2021_01_06_425657	118	33	that	that	WDT
10_1101-2021_01_06_425657	118	34	disrupts	disrupt	VBZ
10_1101-2021_01_06_425657	118	35	the	the	DT
10_1101-2021_01_06_425657	118	36	interaction	interaction	NN
10_1101-2021_01_06_425657	118	37	with	with	IN
10_1101-2021_01_06_425657	118	38	Met4	Met4	NNP
10_1101-2021_01_06_425657	118	39	.	.	.
10_1101-2021_01_06_425657	119	1	317	317	CD
10_1101-2021_01_06_425657	119	2	318	318	CD
10_1101-2021_01_06_425657	119	3	It	-PRON-	PRP
10_1101-2021_01_06_425657	119	4	was	be	VBD
10_1101-2021_01_06_425657	119	5	previously	previously	RB
10_1101-2021_01_06_425657	119	6	hypothesized	hypothesize	VBN
10_1101-2021_01_06_425657	119	7	that	that	IN
10_1101-2021_01_06_425657	119	8	an	an	DT
10_1101-2021_01_06_425657	119	9	observed	observe	VBN
10_1101-2021_01_06_425657	119	10	,	,	,
10_1101-2021_01_06_425657	119	11	faster	fast	RBR
10_1101-2021_01_06_425657	119	12	-	-	HYPH
10_1101-2021_01_06_425657	119	13	migrating	migrate	VBG
10_1101-2021_01_06_425657	119	14	proteoform	proteoform	NN
10_1101-2021_01_06_425657	119	15	of	of	IN
10_1101-2021_01_06_425657	119	16	Met30	Met30	NNP
10_1101-2021_01_06_425657	119	17	might	may	MD
10_1101-2021_01_06_425657	119	18	be	be	VB
10_1101-2021_01_06_425657	119	19	319	319	CD
10_1101-2021_01_06_425657	119	20	involved	involve	VBN
10_1101-2021_01_06_425657	119	21	in	in	IN
10_1101-2021_01_06_425657	119	22	the	the	DT
10_1101-2021_01_06_425657	119	23	regulation	regulation	NN
10_1101-2021_01_06_425657	119	24	of	of	IN
10_1101-2021_01_06_425657	119	25	sulfur	sulfur	NN
10_1101-2021_01_06_425657	119	26	metabolism	metabolism	NN
10_1101-2021_01_06_425657	119	27	(	(	-LRB-
10_1101-2021_01_06_425657	119	28	Sadhu	Sadhu	NNP
10_1101-2021_01_06_425657	119	29	et	et	NNP
10_1101-2021_01_06_425657	119	30	al	al	NNP
10_1101-2021_01_06_425657	119	31	.	.	NNP
10_1101-2021_01_06_425657	119	32	,	,	,
10_1101-2021_01_06_425657	119	33	2014	2014	CD
10_1101-2021_01_06_425657	119	34	)	)	-RRB-
10_1101-2021_01_06_425657	119	35	.	.	.
10_1101-2021_01_06_425657	120	1	We	-PRON-	PRP
10_1101-2021_01_06_425657	120	2	deduced	deduce	VBD
10_1101-2021_01_06_425657	120	3	that	that	IN
10_1101-2021_01_06_425657	120	4	the	the	DT
10_1101-2021_01_06_425657	120	5	lower	low	JJR
10_1101-2021_01_06_425657	120	6	320	320	CD
10_1101-2021_01_06_425657	120	7	form	form	NN
10_1101-2021_01_06_425657	120	8	of	of	IN
10_1101-2021_01_06_425657	120	9	Met30	Met30	NNP
10_1101-2021_01_06_425657	120	10	does	do	VBZ
10_1101-2021_01_06_425657	120	11	appear	appear	VB
10_1101-2021_01_06_425657	120	12	to	to	TO
10_1101-2021_01_06_425657	120	13	be	be	VB
10_1101-2021_01_06_425657	120	14	the	the	DT
10_1101-2021_01_06_425657	120	15	result	result	NN
10_1101-2021_01_06_425657	120	16	of	of	IN
10_1101-2021_01_06_425657	120	17	transcriptionally	transcriptionally	RB
10_1101-2021_01_06_425657	120	18	-	-	HYPH
10_1101-2021_01_06_425657	120	19	guided	guide	VBN
10_1101-2021_01_06_425657	120	20	,	,	,
10_1101-2021_01_06_425657	120	21	alternative	alternative	JJ
10_1101-2021_01_06_425657	120	22	translational	translational	JJ
10_1101-2021_01_06_425657	120	23	321	321	CD
10_1101-2021_01_06_425657	120	24	initiation	initiation	NN
10_1101-2021_01_06_425657	120	25	.	.	.
10_1101-2021_01_06_425657	121	1	However	however	RB
10_1101-2021_01_06_425657	121	2	,	,	,
10_1101-2021_01_06_425657	121	3	this	this	DT
10_1101-2021_01_06_425657	121	4	faster	fast	RBR
10_1101-2021_01_06_425657	121	5	-	-	HYPH
10_1101-2021_01_06_425657	121	6	migrating	migrate	VBG
10_1101-2021_01_06_425657	121	7	proteoform	proteoform	NN
10_1101-2021_01_06_425657	121	8	appears	appear	VBZ
10_1101-2021_01_06_425657	121	9	dispensable	dispensable	JJ
10_1101-2021_01_06_425657	121	10	for	for	IN
10_1101-2021_01_06_425657	121	11	sulfur	sulfur	NN
10_1101-2021_01_06_425657	121	12	metabolic	metabolic	JJ
10_1101-2021_01_06_425657	121	13	322	322	CD
10_1101-2021_01_06_425657	121	14	regulation	regulation	NN
10_1101-2021_01_06_425657	121	15	under	under	IN
10_1101-2021_01_06_425657	121	16	the	the	DT
10_1101-2021_01_06_425657	121	17	conditions	condition	NNS
10_1101-2021_01_06_425657	121	18	we	-PRON-	PRP
10_1101-2021_01_06_425657	121	19	examined	examine	VBD
10_1101-2021_01_06_425657	121	20	.	.	.
10_1101-2021_01_06_425657	122	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	122	2	is	be	VBZ
10_1101-2021_01_06_425657	122	3	curious	curious	JJ
10_1101-2021_01_06_425657	122	4	that	that	IN
10_1101-2021_01_06_425657	122	5	such	such	PDT
10_1101-2021_01_06_425657	122	6	an	an	DT
10_1101-2021_01_06_425657	122	7	ostensibly	ostensibly	RB
10_1101-2021_01_06_425657	122	8	obvious	obvious	JJ
10_1101-2021_01_06_425657	122	9	feedback	feedback	NN
10_1101-2021_01_06_425657	122	10	323	323	CD
10_1101-2021_01_06_425657	122	11	loop	loop	NN
10_1101-2021_01_06_425657	122	12	between	between	IN
10_1101-2021_01_06_425657	122	13	Met30	Met30	NNP
10_1101-2021_01_06_425657	122	14	and	and	CC
10_1101-2021_01_06_425657	122	15	Met4	Met4	NNP
10_1101-2021_01_06_425657	122	16	would	would	MD
10_1101-2021_01_06_425657	122	17	appear	appear	VB
10_1101-2021_01_06_425657	122	18	to	to	TO
10_1101-2021_01_06_425657	122	19	have	have	VB
10_1101-2021_01_06_425657	122	20	little	little	JJ
10_1101-2021_01_06_425657	122	21	to	to	IN
10_1101-2021_01_06_425657	122	22	no	no	DT
10_1101-2021_01_06_425657	122	23	effect	effect	NN
10_1101-2021_01_06_425657	122	24	on	on	IN
10_1101-2021_01_06_425657	122	25	sulfur	sulfur	NN
10_1101-2021_01_06_425657	122	26	metabolic	metabolic	NNP
10_1101-2021_01_06_425657	122	27	324	324	CD
10_1101-2021_01_06_425657	122	28	regulation	regulation	NN
10_1101-2021_01_06_425657	122	29	.	.	.
10_1101-2021_01_06_425657	123	1	However	however	RB
10_1101-2021_01_06_425657	123	2	,	,	,
10_1101-2021_01_06_425657	123	3	during	during	IN
10_1101-2021_01_06_425657	123	4	sulfur	sulfur	NN
10_1101-2021_01_06_425657	123	5	starvation	starvation	NN
10_1101-2021_01_06_425657	123	6	,	,	,
10_1101-2021_01_06_425657	123	7	a	a	DT
10_1101-2021_01_06_425657	123	8	decrease	decrease	NN
10_1101-2021_01_06_425657	123	9	in	in	IN
10_1101-2021_01_06_425657	123	10	global	global	JJ
10_1101-2021_01_06_425657	123	11	translation	translation	NN
10_1101-2021_01_06_425657	123	12	coincides	coincide	NNS
10_1101-2021_01_06_425657	123	13	with	with	IN
10_1101-2021_01_06_425657	123	14	an	an	DT
10_1101-2021_01_06_425657	123	15	325	325	CD
10_1101-2021_01_06_425657	123	16	increase	increase	NN
10_1101-2021_01_06_425657	123	17	in	in	IN
10_1101-2021_01_06_425657	123	18	ribosomes	ribosome	NNS
10_1101-2021_01_06_425657	123	19	containing	contain	VBG
10_1101-2021_01_06_425657	123	20	one	one	CD
10_1101-2021_01_06_425657	123	21	,	,	,
10_1101-2021_01_06_425657	123	22	instead	instead	RB
10_1101-2021_01_06_425657	123	23	of	of	IN
10_1101-2021_01_06_425657	123	24	two	two	CD
10_1101-2021_01_06_425657	123	25	,	,	,
10_1101-2021_01_06_425657	123	26	methyl	methyl	NN
10_1101-2021_01_06_425657	123	27	groups	group	NNS
10_1101-2021_01_06_425657	123	28	at	at	IN
10_1101-2021_01_06_425657	123	29	universally	universally	RB
10_1101-2021_01_06_425657	123	30	conserved	conserve	VBN
10_1101-2021_01_06_425657	123	31	,	,	,
10_1101-2021_01_06_425657	123	32	326	326	CD
10_1101-2021_01_06_425657	123	33	tandem	tandem	NN
10_1101-2021_01_06_425657	123	34	adenosines	adenosine	NNS
10_1101-2021_01_06_425657	123	35	near	near	IN
10_1101-2021_01_06_425657	123	36	the	the	DT
10_1101-2021_01_06_425657	123	37	3’end	3’end	CD
10_1101-2021_01_06_425657	123	38	of	of	IN
10_1101-2021_01_06_425657	123	39	18S	18S	NNP
10_1101-2021_01_06_425657	123	40	rRNA	rrna	NN
10_1101-2021_01_06_425657	123	41	(	(	-LRB-
10_1101-2021_01_06_425657	123	42	Liu	Liu	NNP
10_1101-2021_01_06_425657	123	43	et	et	NNP
10_1101-2021_01_06_425657	123	44	al	al	NNP
10_1101-2021_01_06_425657	123	45	.	.	.
10_1101-2021_01_06_425657	123	46	)	)	-RRB-
10_1101-2021_01_06_425657	124	1	We	-PRON-	PRP
10_1101-2021_01_06_425657	124	2	speculate	speculate	VBP
10_1101-2021_01_06_425657	124	3	that	that	IN
10_1101-2021_01_06_425657	124	4	these	these	DT
10_1101-2021_01_06_425657	124	5	ribosomes	ribosome	NNS
10_1101-2021_01_06_425657	124	6	327	327	CD
10_1101-2021_01_06_425657	124	7	might	may	MD
10_1101-2021_01_06_425657	124	8	preferentially	preferentially	RB
10_1101-2021_01_06_425657	124	9	translate	translate	VB
10_1101-2021_01_06_425657	124	10	MET	MET	NNP
10_1101-2021_01_06_425657	124	11	gene	gene	VB
10_1101-2021_01_06_425657	124	12	mRNAs	mrnas	PRP
10_1101-2021_01_06_425657	124	13	,	,	,
10_1101-2021_01_06_425657	124	14	as	as	RB
10_1101-2021_01_06_425657	124	15	well	well	RB
10_1101-2021_01_06_425657	124	16	as	as	IN
10_1101-2021_01_06_425657	124	17	preferentially	preferentially	RB
10_1101-2021_01_06_425657	124	18	initiate	initiate	VBP
10_1101-2021_01_06_425657	124	19	translation	translation	NN
10_1101-2021_01_06_425657	124	20	at	at	IN
10_1101-2021_01_06_425657	124	21	the	the	DT
10_1101-2021_01_06_425657	124	22	328	328	CD
10_1101-2021_01_06_425657	124	23	internal	internal	JJ
10_1101-2021_01_06_425657	124	24	30	30	CD
10_1101-2021_01_06_425657	124	25	,	,	,
10_1101-2021_01_06_425657	124	26	35	35	CD
10_1101-2021_01_06_425657	124	27	,	,	,
10_1101-2021_01_06_425657	124	28	and	and	CC
10_1101-2021_01_06_425657	124	29	36th	36th	JJ
10_1101-2021_01_06_425657	124	30	methionine	methionine	NN
10_1101-2021_01_06_425657	124	31	residues	residue	NNS
10_1101-2021_01_06_425657	124	32	of	of	IN
10_1101-2021_01_06_425657	124	33	Met30	Met30	NNP
10_1101-2021_01_06_425657	124	34	.	.	.
10_1101-2021_01_06_425657	125	1	329	329	CD
10_1101-2021_01_06_425657	125	2	330	330	CD
10_1101-2021_01_06_425657	125	3	.CC	.CC	:
10_1101-2021_01_06_425657	125	4	-	-	:
10_1101-2021_01_06_425657	125	5	BY	by	IN
10_1101-2021_01_06_425657	125	6	4.0	4.0	CD
10_1101-2021_01_06_425657	125	7	International	International	NNP
10_1101-2021_01_06_425657	125	8	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	125	9	under	under	IN
10_1101-2021_01_06_425657	125	10	a	a	DT
10_1101-2021_01_06_425657	125	11	(	(	-LRB-
10_1101-2021_01_06_425657	125	12	which	which	WDT
10_1101-2021_01_06_425657	125	13	was	be	VBD
10_1101-2021_01_06_425657	125	14	not	not	RB
10_1101-2021_01_06_425657	125	15	certified	certify	VBN
10_1101-2021_01_06_425657	125	16	by	by	IN
10_1101-2021_01_06_425657	125	17	peer	peer	NN
10_1101-2021_01_06_425657	125	18	review	review	NN
10_1101-2021_01_06_425657	125	19	)	)	-RRB-
10_1101-2021_01_06_425657	125	20	is	be	VBZ
10_1101-2021_01_06_425657	125	21	the	the	DT
10_1101-2021_01_06_425657	125	22	author	author	NN
10_1101-2021_01_06_425657	125	23	/	/	SYM
10_1101-2021_01_06_425657	125	24	funder	funder	NN
10_1101-2021_01_06_425657	125	25	,	,	,
10_1101-2021_01_06_425657	125	26	who	who	WP
10_1101-2021_01_06_425657	125	27	has	have	VBZ
10_1101-2021_01_06_425657	125	28	granted	grant	VBN
10_1101-2021_01_06_425657	125	29	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	125	30	a	a	DT
10_1101-2021_01_06_425657	125	31	license	license	NN
10_1101-2021_01_06_425657	125	32	to	to	TO
10_1101-2021_01_06_425657	125	33	display	display	VB
10_1101-2021_01_06_425657	125	34	the	the	DT
10_1101-2021_01_06_425657	125	35	preprint	preprint	NN
10_1101-2021_01_06_425657	125	36	in	in	IN
10_1101-2021_01_06_425657	125	37	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	125	38	.	.	.
10_1101-2021_01_06_425657	126	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	126	2	is	be	VBZ
10_1101-2021_01_06_425657	126	3	made	make	VBN
10_1101-2021_01_06_425657	126	4	The	the	DT
10_1101-2021_01_06_425657	126	5	copyright	copyright	NN
10_1101-2021_01_06_425657	126	6	holder	holder	NN
10_1101-2021_01_06_425657	126	7	for	for	IN
10_1101-2021_01_06_425657	126	8	this	this	DT
10_1101-2021_01_06_425657	126	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	126	10	version	version	NN
10_1101-2021_01_06_425657	126	11	posted	post	VBD
10_1101-2021_01_06_425657	126	12	January	January	NNP
10_1101-2021_01_06_425657	126	13	7	7	CD
10_1101-2021_01_06_425657	126	14	,	,	,
10_1101-2021_01_06_425657	126	15	2021	2021	CD
10_1101-2021_01_06_425657	126	16	.	.	.
10_1101-2021_01_06_425657	126	17	;	;	:
10_1101-2021_01_06_425657	126	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	126	19	:	:	:
10_1101-2021_01_06_425657	126	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	126	21	preprint	preprint	NN
10_1101-2021_01_06_425657	126	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	126	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	126	24	10	10	CD
10_1101-2021_01_06_425657	126	25	The	the	DT
10_1101-2021_01_06_425657	126	26	utilization	utilization	NN
10_1101-2021_01_06_425657	126	27	of	of	IN
10_1101-2021_01_06_425657	126	28	a	a	DT
10_1101-2021_01_06_425657	126	29	redox	redox	JJ
10_1101-2021_01_06_425657	126	30	mechanism	mechanism	NN
10_1101-2021_01_06_425657	126	31	for	for	IN
10_1101-2021_01_06_425657	126	32	Met30	Met30	NNP
10_1101-2021_01_06_425657	126	33	draws	draw	VBZ
10_1101-2021_01_06_425657	126	34	interesting	interesting	JJ
10_1101-2021_01_06_425657	126	35	comparisons	comparison	NNS
10_1101-2021_01_06_425657	126	36	to	to	IN
10_1101-2021_01_06_425657	126	37	the	the	DT
10_1101-2021_01_06_425657	126	38	regulation	regulation	NN
10_1101-2021_01_06_425657	126	39	331	331	CD
10_1101-2021_01_06_425657	126	40	of	of	IN
10_1101-2021_01_06_425657	126	41	Met4	Met4	NNP
10_1101-2021_01_06_425657	126	42	via	via	IN
10_1101-2021_01_06_425657	126	43	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	126	44	in	in	IN
10_1101-2021_01_06_425657	126	45	that	that	DT
10_1101-2021_01_06_425657	126	46	both	both	DT
10_1101-2021_01_06_425657	126	47	mechanisms	mechanism	NNS
10_1101-2021_01_06_425657	126	48	are	be	VBP
10_1101-2021_01_06_425657	126	49	rapid	rapid	JJ
10_1101-2021_01_06_425657	126	50	and	and	CC
10_1101-2021_01_06_425657	126	51	readily	readily	RB
10_1101-2021_01_06_425657	126	52	reversible	reversible	JJ
10_1101-2021_01_06_425657	126	53	,	,	,
10_1101-2021_01_06_425657	126	54	require	require	VBP
10_1101-2021_01_06_425657	126	55	no	no	DT
10_1101-2021_01_06_425657	126	56	332	332	CD
10_1101-2021_01_06_425657	126	57	new	new	JJ
10_1101-2021_01_06_425657	126	58	RNA	RNA	NNP
10_1101-2021_01_06_425657	126	59	or	or	CC
10_1101-2021_01_06_425657	126	60	protein	protein	NN
10_1101-2021_01_06_425657	126	61	synthesis	synthesis	NN
10_1101-2021_01_06_425657	126	62	,	,	,
10_1101-2021_01_06_425657	126	63	and	and	CC
10_1101-2021_01_06_425657	126	64	there	there	EX
10_1101-2021_01_06_425657	126	65	is	be	VBZ
10_1101-2021_01_06_425657	126	66	no	no	DT
10_1101-2021_01_06_425657	126	67	requirement	requirement	NN
10_1101-2021_01_06_425657	126	68	for	for	IN
10_1101-2021_01_06_425657	126	69	the	the	DT
10_1101-2021_01_06_425657	126	70	consumption	consumption	NN
10_1101-2021_01_06_425657	126	71	of	of	IN
10_1101-2021_01_06_425657	126	72	sulfur	sulfur	NN
10_1101-2021_01_06_425657	126	73	333	333	CD
10_1101-2021_01_06_425657	126	74	equivalents	equivalent	NNS
10_1101-2021_01_06_425657	126	75	so	so	IN
10_1101-2021_01_06_425657	126	76	as	as	IN
10_1101-2021_01_06_425657	126	77	to	to	TO
10_1101-2021_01_06_425657	126	78	spare	spare	VB
10_1101-2021_01_06_425657	126	79	them	-PRON-	PRP
10_1101-2021_01_06_425657	126	80	for	for	IN
10_1101-2021_01_06_425657	126	81	use	use	NN
10_1101-2021_01_06_425657	126	82	in	in	IN
10_1101-2021_01_06_425657	126	83	MET	MET	NNP
10_1101-2021_01_06_425657	126	84	gene	gene	NN
10_1101-2021_01_06_425657	126	85	translation	translation	NN
10_1101-2021_01_06_425657	126	86	under	under	IN
10_1101-2021_01_06_425657	126	87	conditions	condition	NNS
10_1101-2021_01_06_425657	126	88	of	of	IN
10_1101-2021_01_06_425657	126	89	sulfur	sulfur	NN
10_1101-2021_01_06_425657	126	90	scarcity	scarcity	NN
10_1101-2021_01_06_425657	126	91	.	.	.
10_1101-2021_01_06_425657	127	1	334	334	CD
10_1101-2021_01_06_425657	127	2	It	-PRON-	PRP
10_1101-2021_01_06_425657	127	3	is	be	VBZ
10_1101-2021_01_06_425657	127	4	also	also	RB
10_1101-2021_01_06_425657	127	5	striking	strike	VBG
10_1101-2021_01_06_425657	127	6	that	that	IN
10_1101-2021_01_06_425657	127	7	while	while	IN
10_1101-2021_01_06_425657	127	8	Met30	Met30	NNP
10_1101-2021_01_06_425657	127	9	contains	contain	VBZ
10_1101-2021_01_06_425657	127	10	many	many	JJ
10_1101-2021_01_06_425657	127	11	cysteine	cysteine	NN
10_1101-2021_01_06_425657	127	12	residues	residue	NNS
10_1101-2021_01_06_425657	127	13	,	,	,
10_1101-2021_01_06_425657	127	14	Met4	Met4	NNP
10_1101-2021_01_06_425657	127	15	contains	contain	VBZ
10_1101-2021_01_06_425657	127	16	none	none	NN
10_1101-2021_01_06_425657	127	17	–	–	:
10_1101-2021_01_06_425657	127	18	which	which	WDT
10_1101-2021_01_06_425657	127	19	335	335	NNP
10_1101-2021_01_06_425657	127	20	has	have	VBZ
10_1101-2021_01_06_425657	127	21	the	the	DT
10_1101-2021_01_06_425657	127	22	consequence	consequence	NN
10_1101-2021_01_06_425657	127	23	that	that	IN
10_1101-2021_01_06_425657	127	24	as	as	IN
10_1101-2021_01_06_425657	127	25	Met30	Met30	NNP
10_1101-2021_01_06_425657	127	26	cysteines	cysteine	NNS
10_1101-2021_01_06_425657	127	27	are	be	VBP
10_1101-2021_01_06_425657	127	28	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	127	29	,	,	,
10_1101-2021_01_06_425657	127	30	there	there	EX
10_1101-2021_01_06_425657	127	31	is	be	VBZ
10_1101-2021_01_06_425657	127	32	no	no	DT
10_1101-2021_01_06_425657	127	33	possibility	possibility	NN
10_1101-2021_01_06_425657	127	34	that	that	IN
10_1101-2021_01_06_425657	127	35	Met4	Met4	NNP
10_1101-2021_01_06_425657	127	36	can	can	MD
10_1101-2021_01_06_425657	127	37	336	336	CD
10_1101-2021_01_06_425657	127	38	make	make	VB
10_1101-2021_01_06_425657	127	39	an	an	DT
10_1101-2021_01_06_425657	127	40	intermolecular	intermolecular	JJ
10_1101-2021_01_06_425657	127	41	disulfide	disulfide	JJ
10_1101-2021_01_06_425657	127	42	linkage	linkage	NN
10_1101-2021_01_06_425657	127	43	that	that	WDT
10_1101-2021_01_06_425657	127	44	might	may	MD
10_1101-2021_01_06_425657	127	45	interfere	interfere	VB
10_1101-2021_01_06_425657	127	46	with	with	IN
10_1101-2021_01_06_425657	127	47	its	-PRON-	PRP$
10_1101-2021_01_06_425657	127	48	release	release	NN
10_1101-2021_01_06_425657	127	49	and	and	CC
10_1101-2021_01_06_425657	127	50	recruitment	recruitment	NN
10_1101-2021_01_06_425657	127	51	to	to	IN
10_1101-2021_01_06_425657	127	52	337	337	CD
10_1101-2021_01_06_425657	127	53	the	the	DT
10_1101-2021_01_06_425657	127	54	promoters	promoter	NNS
10_1101-2021_01_06_425657	127	55	of	of	IN
10_1101-2021_01_06_425657	127	56	MET	MET	NNP
10_1101-2021_01_06_425657	127	57	genes	gene	NNS
10_1101-2021_01_06_425657	127	58	.	.	.
10_1101-2021_01_06_425657	128	1	Upon	upon	IN
10_1101-2021_01_06_425657	128	2	repletion	repletion	NN
10_1101-2021_01_06_425657	128	3	of	of	IN
10_1101-2021_01_06_425657	128	4	sulfur	sulfur	NN
10_1101-2021_01_06_425657	128	5	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	128	6	,	,	,
10_1101-2021_01_06_425657	128	7	cellular	cellular	JJ
10_1101-2021_01_06_425657	128	8	reducing	reduce	VBG
10_1101-2021_01_06_425657	128	9	capacity	capacity	NN
10_1101-2021_01_06_425657	128	10	is	be	VBZ
10_1101-2021_01_06_425657	128	11	338	338	CD
10_1101-2021_01_06_425657	128	12	restored	restore	VBN
10_1101-2021_01_06_425657	128	13	,	,	,
10_1101-2021_01_06_425657	128	14	and	and	CC
10_1101-2021_01_06_425657	128	15	Met30	Met30	NNP
10_1101-2021_01_06_425657	128	16	cysteine	cysteine	NN
10_1101-2021_01_06_425657	128	17	reduction	reduction	NN
10_1101-2021_01_06_425657	128	18	couples	couple	VBZ
10_1101-2021_01_06_425657	128	19	the	the	DT
10_1101-2021_01_06_425657	128	20	regulation	regulation	NN
10_1101-2021_01_06_425657	128	21	of	of	IN
10_1101-2021_01_06_425657	128	22	MET	MET	NNP
10_1101-2021_01_06_425657	128	23	gene	gene	NN
10_1101-2021_01_06_425657	128	24	activation	activation	NN
10_1101-2021_01_06_425657	128	25	to	to	TO
10_1101-2021_01_06_425657	128	26	sulfur	sulfur	NN
10_1101-2021_01_06_425657	128	27	339	339	CD
10_1101-2021_01_06_425657	128	28	assimilation	assimilation	NN
10_1101-2021_01_06_425657	128	29	,	,	,
10_1101-2021_01_06_425657	128	30	both	both	DT
10_1101-2021_01_06_425657	128	31	of	of	IN
10_1101-2021_01_06_425657	128	32	which	which	WDT
10_1101-2021_01_06_425657	128	33	require	require	VBP
10_1101-2021_01_06_425657	128	34	significant	significant	JJ
10_1101-2021_01_06_425657	128	35	reducing	reduce	VBG
10_1101-2021_01_06_425657	128	36	equivalents	equivalent	NNS
10_1101-2021_01_06_425657	128	37	.	.	.
10_1101-2021_01_06_425657	129	1	340	340	CD
10_1101-2021_01_06_425657	129	2	341	341	CD
10_1101-2021_01_06_425657	129	3	Lastly	lastly	RB
10_1101-2021_01_06_425657	129	4	,	,	,
10_1101-2021_01_06_425657	129	5	we	-PRON-	PRP
10_1101-2021_01_06_425657	129	6	highlight	highlight	VBP
10_1101-2021_01_06_425657	129	7	the	the	DT
10_1101-2021_01_06_425657	129	8	observation	observation	NN
10_1101-2021_01_06_425657	129	9	that	that	IN
10_1101-2021_01_06_425657	129	10	nearly	nearly	RB
10_1101-2021_01_06_425657	129	11	all	all	DT
10_1101-2021_01_06_425657	129	12	of	of	IN
10_1101-2021_01_06_425657	129	13	the	the	DT
10_1101-2021_01_06_425657	129	14	Met30	Met30	NNP
10_1101-2021_01_06_425657	129	15	protein	protein	NN
10_1101-2021_01_06_425657	129	16	becomes	become	VBZ
10_1101-2021_01_06_425657	129	17	rapidly	rapidly	RB
10_1101-2021_01_06_425657	129	18	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	129	19	342	342	CD
10_1101-2021_01_06_425657	129	20	within	within	IN
10_1101-2021_01_06_425657	129	21	15	15	CD
10_1101-2021_01_06_425657	129	22	min	min	NN
10_1101-2021_01_06_425657	129	23	of	of	IN
10_1101-2021_01_06_425657	129	24	sulfur	sulfur	NN
10_1101-2021_01_06_425657	129	25	starvation	starvation	NN
10_1101-2021_01_06_425657	129	26	,	,	,
10_1101-2021_01_06_425657	129	27	in	in	IN
10_1101-2021_01_06_425657	129	28	contrast	contrast	NN
10_1101-2021_01_06_425657	129	29	to	to	IN
10_1101-2021_01_06_425657	129	30	other	other	JJ
10_1101-2021_01_06_425657	129	31	nucleocytosolic	nucleocytosolic	JJ
10_1101-2021_01_06_425657	129	32	proteins	protein	NNS
10_1101-2021_01_06_425657	129	33	(	(	-LRB-
10_1101-2021_01_06_425657	129	34	Fig	fig	NN
10_1101-2021_01_06_425657	129	35	.	.	.
10_1101-2021_01_06_425657	130	1	2B	2B	NNP
10_1101-2021_01_06_425657	130	2	)	)	-RRB-
10_1101-2021_01_06_425657	130	3	.	.	.
10_1101-2021_01_06_425657	131	1	Bulk	Bulk	NNP
10_1101-2021_01_06_425657	131	2	343	343	CD
10_1101-2021_01_06_425657	131	3	levels	level	NNS
10_1101-2021_01_06_425657	131	4	of	of	IN
10_1101-2021_01_06_425657	131	5	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	131	6	versus	versus	IN
10_1101-2021_01_06_425657	131	7	reduced	reduce	VBN
10_1101-2021_01_06_425657	131	8	glutathione	glutathione	NN
10_1101-2021_01_06_425657	131	9	are	be	VBP
10_1101-2021_01_06_425657	131	10	also	also	RB
10_1101-2021_01_06_425657	131	11	minimally	minimally	RB
10_1101-2021_01_06_425657	131	12	changed	change	VBN
10_1101-2021_01_06_425657	131	13	within	within	IN
10_1101-2021_01_06_425657	131	14	this	this	DT
10_1101-2021_01_06_425657	131	15	timeframe	timeframe	NN
10_1101-2021_01_06_425657	131	16	.	.	.
10_1101-2021_01_06_425657	132	1	344	344	CD
10_1101-2021_01_06_425657	132	2	These	these	DT
10_1101-2021_01_06_425657	132	3	considerations	consideration	NNS
10_1101-2021_01_06_425657	132	4	suggest	suggest	VBP
10_1101-2021_01_06_425657	132	5	that	that	IN
10_1101-2021_01_06_425657	132	6	Met30	Met30	NNP
10_1101-2021_01_06_425657	132	7	is	be	VBZ
10_1101-2021_01_06_425657	132	8	either	either	CC
10_1101-2021_01_06_425657	132	9	located	locate	VBN
10_1101-2021_01_06_425657	132	10	in	in	IN
10_1101-2021_01_06_425657	132	11	a	a	DT
10_1101-2021_01_06_425657	132	12	redox	redox	RB
10_1101-2021_01_06_425657	132	13	-	-	HYPH
10_1101-2021_01_06_425657	132	14	responsive	responsive	JJ
10_1101-2021_01_06_425657	132	15	microenvironment	microenvironment	NN
10_1101-2021_01_06_425657	132	16	345	345	CD
10_1101-2021_01_06_425657	132	17	within	within	IN
10_1101-2021_01_06_425657	132	18	cells	cell	NNS
10_1101-2021_01_06_425657	132	19	,	,	,
10_1101-2021_01_06_425657	132	20	or	or	CC
10_1101-2021_01_06_425657	132	21	that	that	DT
10_1101-2021_01_06_425657	132	22	key	key	JJ
10_1101-2021_01_06_425657	132	23	cysteine	cysteine	NN
10_1101-2021_01_06_425657	132	24	residues	residue	NNS
10_1101-2021_01_06_425657	132	25	such	such	JJ
10_1101-2021_01_06_425657	132	26	as	as	IN
10_1101-2021_01_06_425657	132	27	Cys414	cys414	CD
10_1101-2021_01_06_425657	132	28	are	be	VBP
10_1101-2021_01_06_425657	132	29	predisposed	predispose	VBN
10_1101-2021_01_06_425657	132	30	to	to	IN
10_1101-2021_01_06_425657	132	31	becoming	become	VBG
10_1101-2021_01_06_425657	132	32	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	132	33	346	346	CD
10_1101-2021_01_06_425657	132	34	to	to	TO
10_1101-2021_01_06_425657	132	35	subsequently	subsequently	RB
10_1101-2021_01_06_425657	132	36	inhibit	inhibit	VB
10_1101-2021_01_06_425657	132	37	binding	bind	VBG
10_1101-2021_01_06_425657	132	38	and	and	CC
10_1101-2021_01_06_425657	132	39	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	132	40	of	of	IN
10_1101-2021_01_06_425657	132	41	Met4	Met4	NNP
10_1101-2021_01_06_425657	132	42	.	.	.
10_1101-2021_01_06_425657	133	1	Future	future	JJ
10_1101-2021_01_06_425657	133	2	structural	structural	JJ
10_1101-2021_01_06_425657	133	3	characterization	characterization	NN
10_1101-2021_01_06_425657	133	4	of	of	IN
10_1101-2021_01_06_425657	133	5	347	347	CD
10_1101-2021_01_06_425657	133	6	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	133	7	in	in	IN
10_1101-2021_01_06_425657	133	8	its	-PRON-	PRP$
10_1101-2021_01_06_425657	133	9	reduced	reduce	VBN
10_1101-2021_01_06_425657	133	10	and	and	CC
10_1101-2021_01_06_425657	133	11	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	133	12	states	state	NNS
10_1101-2021_01_06_425657	133	13	may	may	MD
10_1101-2021_01_06_425657	133	14	reveal	reveal	VB
10_1101-2021_01_06_425657	133	15	the	the	DT
10_1101-2021_01_06_425657	133	16	underlying	underlie	VBG
10_1101-2021_01_06_425657	133	17	basis	basis	NN
10_1101-2021_01_06_425657	133	18	of	of	IN
10_1101-2021_01_06_425657	133	19	its	-PRON-	PRP$
10_1101-2021_01_06_425657	133	20	exquisite	exquisite	JJ
10_1101-2021_01_06_425657	133	21	348	348	CD
10_1101-2021_01_06_425657	133	22	sensitivity	sensitivity	NN
10_1101-2021_01_06_425657	133	23	to	to	IN
10_1101-2021_01_06_425657	133	24	,	,	,
10_1101-2021_01_06_425657	133	25	and	and	CC
10_1101-2021_01_06_425657	133	26	regulation	regulation	NN
10_1101-2021_01_06_425657	133	27	by	by	IN
10_1101-2021_01_06_425657	133	28	,	,	,
10_1101-2021_01_06_425657	133	29	oxidation	oxidation	NN
10_1101-2021_01_06_425657	133	30	.	.	.
10_1101-2021_01_06_425657	134	1	Nonetheless	nonetheless	RB
10_1101-2021_01_06_425657	134	2	,	,	,
10_1101-2021_01_06_425657	134	3	along	along	IN
10_1101-2021_01_06_425657	134	4	with	with	IN
10_1101-2021_01_06_425657	134	5	SoxR	SoxR	NNP
10_1101-2021_01_06_425657	134	6	and	and	CC
10_1101-2021_01_06_425657	134	7	OxyR	OxyR	NNP
10_1101-2021_01_06_425657	134	8	transcription	transcription	NN
10_1101-2021_01_06_425657	134	9	349	349	CD
10_1101-2021_01_06_425657	134	10	factors	factor	NNS
10_1101-2021_01_06_425657	134	11	in	in	IN
10_1101-2021_01_06_425657	134	12	E.	E.	NNP
10_1101-2021_01_06_425657	134	13	coli	coli	NNS
10_1101-2021_01_06_425657	134	14	(	(	-LRB-
10_1101-2021_01_06_425657	134	15	Imlay	Imlay	NNP
10_1101-2021_01_06_425657	134	16	,	,	,
10_1101-2021_01_06_425657	134	17	2013	2013	CD
10_1101-2021_01_06_425657	134	18	)	)	-RRB-
10_1101-2021_01_06_425657	134	19	the	the	DT
10_1101-2021_01_06_425657	134	20	Yap1	Yap1	NNP
10_1101-2021_01_06_425657	134	21	transcription	transcription	NN
10_1101-2021_01_06_425657	134	22	factor	factor	NN
10_1101-2021_01_06_425657	134	23	in	in	IN
10_1101-2021_01_06_425657	134	24	yeast	yeast	NN
10_1101-2021_01_06_425657	134	25	(	(	-LRB-
10_1101-2021_01_06_425657	134	26	Herrero	Herrero	NNP
10_1101-2021_01_06_425657	134	27	et	et	NNP
10_1101-2021_01_06_425657	134	28	al	al	NNP
10_1101-2021_01_06_425657	134	29	.	.	NNP
10_1101-2021_01_06_425657	134	30	,	,	,
10_1101-2021_01_06_425657	134	31	2008	2008	CD
10_1101-2021_01_06_425657	134	32	)	)	-RRB-
10_1101-2021_01_06_425657	134	33	,	,	,
10_1101-2021_01_06_425657	134	34	and	and	CC
10_1101-2021_01_06_425657	134	35	350	350	CD
10_1101-2021_01_06_425657	134	36	Keap1	Keap1	NNS
10_1101-2021_01_06_425657	134	37	in	in	IN
10_1101-2021_01_06_425657	134	38	mammalian	mammalian	JJ
10_1101-2021_01_06_425657	134	39	cells	cell	NNS
10_1101-2021_01_06_425657	134	40	,	,	,
10_1101-2021_01_06_425657	134	41	our	-PRON-	PRP$
10_1101-2021_01_06_425657	134	42	studies	study	NNS
10_1101-2021_01_06_425657	134	43	add	add	VBP
10_1101-2021_01_06_425657	134	44	the	the	DT
10_1101-2021_01_06_425657	134	45	F	F	NNP
10_1101-2021_01_06_425657	134	46	-	-	HYPH
10_1101-2021_01_06_425657	134	47	box	box	NN
10_1101-2021_01_06_425657	134	48	protein	protein	NN
10_1101-2021_01_06_425657	134	49	Met30	Met30	NNP
10_1101-2021_01_06_425657	134	50	to	to	IN
10_1101-2021_01_06_425657	134	51	the	the	DT
10_1101-2021_01_06_425657	134	52	exclusive	exclusive	JJ
10_1101-2021_01_06_425657	134	53	list	list	NN
10_1101-2021_01_06_425657	134	54	of	of	IN
10_1101-2021_01_06_425657	134	55	bona	bona	NN
10_1101-2021_01_06_425657	134	56	351	351	CD
10_1101-2021_01_06_425657	134	57	fide	fide	JJ
10_1101-2021_01_06_425657	134	58	cellular	cellular	JJ
10_1101-2021_01_06_425657	134	59	redox	redox	NN
10_1101-2021_01_06_425657	134	60	sensors	sensor	NNS
10_1101-2021_01_06_425657	134	61	that	that	WDT
10_1101-2021_01_06_425657	134	62	can	can	MD
10_1101-2021_01_06_425657	134	63	initiate	initiate	VB
10_1101-2021_01_06_425657	134	64	a	a	DT
10_1101-2021_01_06_425657	134	65	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	134	66	response	response	NN
10_1101-2021_01_06_425657	134	67	.	.	.
10_1101-2021_01_06_425657	135	1	352	352	CD
10_1101-2021_01_06_425657	135	2	353	353	CD
10_1101-2021_01_06_425657	135	3	ACKNOWLEDGMENTS	acknowledgment	NNS
10_1101-2021_01_06_425657	135	4	354	354	CD
10_1101-2021_01_06_425657	135	5	355	355	CD
10_1101-2021_01_06_425657	135	6	We	-PRON-	PRP
10_1101-2021_01_06_425657	135	7	thank	thank	VBP
10_1101-2021_01_06_425657	135	8	members	member	NNS
10_1101-2021_01_06_425657	135	9	of	of	IN
10_1101-2021_01_06_425657	135	10	the	the	DT
10_1101-2021_01_06_425657	135	11	Tu	Tu	NNP
10_1101-2021_01_06_425657	135	12	lab	lab	NN
10_1101-2021_01_06_425657	135	13	,	,	,
10_1101-2021_01_06_425657	135	14	Deepak	Deepak	NNP
10_1101-2021_01_06_425657	135	15	Nijhawan	Nijhawan	NNP
10_1101-2021_01_06_425657	135	16	,	,	,
10_1101-2021_01_06_425657	135	17	Hongtao	Hongtao	NNP
10_1101-2021_01_06_425657	135	18	Yu	Yu	NNP
10_1101-2021_01_06_425657	135	19	,	,	,
10_1101-2021_01_06_425657	135	20	and	and	CC
10_1101-2021_01_06_425657	135	21	George	George	NNP
10_1101-2021_01_06_425657	135	22	DeMartino	DeMartino	NNP
10_1101-2021_01_06_425657	135	23	for	for	IN
10_1101-2021_01_06_425657	135	24	356	356	CD
10_1101-2021_01_06_425657	135	25	helpful	helpful	JJ
10_1101-2021_01_06_425657	135	26	discussions	discussion	NNS
10_1101-2021_01_06_425657	135	27	.	.	.
10_1101-2021_01_06_425657	136	1	This	this	DT
10_1101-2021_01_06_425657	136	2	work	work	NN
10_1101-2021_01_06_425657	136	3	was	be	VBD
10_1101-2021_01_06_425657	136	4	supported	support	VBN
10_1101-2021_01_06_425657	136	5	by	by	IN
10_1101-2021_01_06_425657	136	6	NIH	NIH	NNP
10_1101-2021_01_06_425657	136	7	R01GM094314	R01GM094314	NNP
10_1101-2021_01_06_425657	136	8	,	,	,
10_1101-2021_01_06_425657	136	9	R35GM136370	R35GM136370	NNP
10_1101-2021_01_06_425657	136	10	,	,	,
10_1101-2021_01_06_425657	136	11	and	and	CC
10_1101-2021_01_06_425657	136	12	an	an	DT
10_1101-2021_01_06_425657	136	13	357	357	CD
10_1101-2021_01_06_425657	136	14	HHMI	HHMI	NNP
10_1101-2021_01_06_425657	136	15	-	-	HYPH
10_1101-2021_01_06_425657	136	16	Simons	Simons	NNP
10_1101-2021_01_06_425657	136	17	Faculty	Faculty	NNP
10_1101-2021_01_06_425657	136	18	Scholars	Scholars	NNPS
10_1101-2021_01_06_425657	136	19	Award	Award	NNP
10_1101-2021_01_06_425657	136	20	to	to	IN
10_1101-2021_01_06_425657	136	21	B.P.T.	B.P.T.	NNP
10_1101-2021_01_06_425657	137	1	358	358	CD
10_1101-2021_01_06_425657	137	2	359	359	CD
10_1101-2021_01_06_425657	137	3	AUTHOR	AUTHOR	NNP
10_1101-2021_01_06_425657	137	4	CONTRIBUTIONS	CONTRIBUTIONS	NNP
10_1101-2021_01_06_425657	137	5	360	360	CD
10_1101-2021_01_06_425657	137	6	361	361	CD
10_1101-2021_01_06_425657	137	7	This	this	DT
10_1101-2021_01_06_425657	137	8	study	study	NN
10_1101-2021_01_06_425657	137	9	was	be	VBD
10_1101-2021_01_06_425657	137	10	conceived	conceive	VBN
10_1101-2021_01_06_425657	137	11	by	by	IN
10_1101-2021_01_06_425657	137	12	Z.J.	Z.J.	NNP
10_1101-2021_01_06_425657	138	1	and	and	CC
10_1101-2021_01_06_425657	138	2	B.P.T.	B.P.T.	NNP
10_1101-2021_01_06_425657	139	1	B.M.S.	b.m.s.	NN
10_1101-2021_01_06_425657	140	1	performed	perform	VBN
10_1101-2021_01_06_425657	140	2	Met30	Met30	NNP
10_1101-2021_01_06_425657	140	3	cysteine	cysteine	NN
10_1101-2021_01_06_425657	140	4	point	point	NN
10_1101-2021_01_06_425657	140	5	mutant	mutant	NN
10_1101-2021_01_06_425657	140	6	strain	strain	NN
10_1101-2021_01_06_425657	140	7	362	362	CD
10_1101-2021_01_06_425657	140	8	construction	construction	NN
10_1101-2021_01_06_425657	140	9	,	,	,
10_1101-2021_01_06_425657	140	10	Y.W.	Y.W.	NNP
10_1101-2021_01_06_425657	141	1	performed	perform	VBN
10_1101-2021_01_06_425657	141	2	cysteine	cysteine	NNP
10_1101-2021_01_06_425657	141	3	point	point	NNP
10_1101-2021_01_06_425657	141	4	mutant	mutant	JJ
10_1101-2021_01_06_425657	141	5	cloning	cloning	NN
10_1101-2021_01_06_425657	141	6	and	and	CC
10_1101-2021_01_06_425657	141	7	Cdc34	Cdc34	NNP
10_1101-2021_01_06_425657	141	8	protein	protein	NN
10_1101-2021_01_06_425657	141	9	purification	purification	NN
10_1101-2021_01_06_425657	141	10	,	,	,
10_1101-2021_01_06_425657	141	11	and	and	CC
10_1101-2021_01_06_425657	141	12	363	363	CD
10_1101-2021_01_06_425657	141	13	all	all	DT
10_1101-2021_01_06_425657	141	14	remaining	remain	VBG
10_1101-2021_01_06_425657	141	15	experiments	experiment	NNS
10_1101-2021_01_06_425657	141	16	were	be	VBD
10_1101-2021_01_06_425657	141	17	directed	direct	VBN
10_1101-2021_01_06_425657	141	18	and	and	CC
10_1101-2021_01_06_425657	141	19	performed	perform	VBN
10_1101-2021_01_06_425657	141	20	by	by	IN
10_1101-2021_01_06_425657	141	21	Z.J.	Z.J.	NNP
10_1101-2021_01_06_425657	142	1	The	the	DT
10_1101-2021_01_06_425657	142	2	paper	paper	NN
10_1101-2021_01_06_425657	142	3	was	be	VBD
10_1101-2021_01_06_425657	142	4	written	write	VBN
10_1101-2021_01_06_425657	142	5	by	by	IN
10_1101-2021_01_06_425657	142	6	Z.J.	Z.J.	NNP
10_1101-2021_01_06_425657	143	1	and	and	CC
10_1101-2021_01_06_425657	143	2	364	364	CD
10_1101-2021_01_06_425657	143	3	B.P.T.	B.P.T.	NNP
10_1101-2021_01_06_425657	144	1	and	and	CC
10_1101-2021_01_06_425657	144	2	has	have	VBZ
10_1101-2021_01_06_425657	144	3	been	be	VBN
10_1101-2021_01_06_425657	144	4	approved	approve	VBN
10_1101-2021_01_06_425657	144	5	by	by	IN
10_1101-2021_01_06_425657	144	6	all	all	DT
10_1101-2021_01_06_425657	144	7	authors	author	NNS
10_1101-2021_01_06_425657	144	8	.	.	.
10_1101-2021_01_06_425657	145	1	365	365	CD
10_1101-2021_01_06_425657	145	2	366	366	CD
10_1101-2021_01_06_425657	145	3	DECLARATION	DECLARATION	NNP
10_1101-2021_01_06_425657	145	4	OF	of	IN
10_1101-2021_01_06_425657	145	5	INTERESTS	INTERESTS	NNP
10_1101-2021_01_06_425657	145	6	367	367	CD
10_1101-2021_01_06_425657	145	7	368	368	CD
10_1101-2021_01_06_425657	145	8	The	the	DT
10_1101-2021_01_06_425657	145	9	authors	author	NNS
10_1101-2021_01_06_425657	145	10	declare	declare	VBP
10_1101-2021_01_06_425657	145	11	no	no	DT
10_1101-2021_01_06_425657	145	12	competing	compete	VBG
10_1101-2021_01_06_425657	145	13	interests	interest	NNS
10_1101-2021_01_06_425657	145	14	.	.	.
10_1101-2021_01_06_425657	146	1	369	369	CD
10_1101-2021_01_06_425657	146	2	370	370	CD
10_1101-2021_01_06_425657	146	3	.CC	.cc	CD
10_1101-2021_01_06_425657	146	4	-	-	:
10_1101-2021_01_06_425657	146	5	BY	by	IN
10_1101-2021_01_06_425657	146	6	4.0	4.0	CD
10_1101-2021_01_06_425657	146	7	International	International	NNP
10_1101-2021_01_06_425657	146	8	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	146	9	under	under	IN
10_1101-2021_01_06_425657	146	10	a	a	DT
10_1101-2021_01_06_425657	146	11	(	(	-LRB-
10_1101-2021_01_06_425657	146	12	which	which	WDT
10_1101-2021_01_06_425657	146	13	was	be	VBD
10_1101-2021_01_06_425657	146	14	not	not	RB
10_1101-2021_01_06_425657	146	15	certified	certify	VBN
10_1101-2021_01_06_425657	146	16	by	by	IN
10_1101-2021_01_06_425657	146	17	peer	peer	NN
10_1101-2021_01_06_425657	146	18	review	review	NN
10_1101-2021_01_06_425657	146	19	)	)	-RRB-
10_1101-2021_01_06_425657	146	20	is	be	VBZ
10_1101-2021_01_06_425657	146	21	the	the	DT
10_1101-2021_01_06_425657	146	22	author	author	NN
10_1101-2021_01_06_425657	146	23	/	/	SYM
10_1101-2021_01_06_425657	146	24	funder	funder	NN
10_1101-2021_01_06_425657	146	25	,	,	,
10_1101-2021_01_06_425657	146	26	who	who	WP
10_1101-2021_01_06_425657	146	27	has	have	VBZ
10_1101-2021_01_06_425657	146	28	granted	grant	VBN
10_1101-2021_01_06_425657	146	29	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	146	30	a	a	DT
10_1101-2021_01_06_425657	146	31	license	license	NN
10_1101-2021_01_06_425657	146	32	to	to	TO
10_1101-2021_01_06_425657	146	33	display	display	VB
10_1101-2021_01_06_425657	146	34	the	the	DT
10_1101-2021_01_06_425657	146	35	preprint	preprint	NN
10_1101-2021_01_06_425657	146	36	in	in	IN
10_1101-2021_01_06_425657	146	37	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	146	38	.	.	.
10_1101-2021_01_06_425657	147	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	147	2	is	be	VBZ
10_1101-2021_01_06_425657	147	3	made	make	VBN
10_1101-2021_01_06_425657	147	4	The	the	DT
10_1101-2021_01_06_425657	147	5	copyright	copyright	NN
10_1101-2021_01_06_425657	147	6	holder	holder	NN
10_1101-2021_01_06_425657	147	7	for	for	IN
10_1101-2021_01_06_425657	147	8	this	this	DT
10_1101-2021_01_06_425657	147	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	147	10	version	version	NN
10_1101-2021_01_06_425657	147	11	posted	post	VBD
10_1101-2021_01_06_425657	147	12	January	January	NNP
10_1101-2021_01_06_425657	147	13	7	7	CD
10_1101-2021_01_06_425657	147	14	,	,	,
10_1101-2021_01_06_425657	147	15	2021	2021	CD
10_1101-2021_01_06_425657	147	16	.	.	.
10_1101-2021_01_06_425657	147	17	;	;	:
10_1101-2021_01_06_425657	147	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	147	19	:	:	:
10_1101-2021_01_06_425657	147	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	147	21	preprint	preprint	NN
10_1101-2021_01_06_425657	147	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NN
10_1101-2021_01_06_425657	147	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	147	24	11	11	CD
10_1101-2021_01_06_425657	147	25	EXPERIMENTAL	EXPERIMENTAL	NNP
10_1101-2021_01_06_425657	147	26	PROCEDURES	procedures	NN
10_1101-2021_01_06_425657	147	27	371	371	CD
10_1101-2021_01_06_425657	147	28	372	372	CD
10_1101-2021_01_06_425657	147	29	Yeast	Yeast	NNP
10_1101-2021_01_06_425657	147	30	strains	strain	NNS
10_1101-2021_01_06_425657	147	31	,	,	,
10_1101-2021_01_06_425657	147	32	construction	construction	NN
10_1101-2021_01_06_425657	147	33	,	,	,
10_1101-2021_01_06_425657	147	34	and	and	CC
10_1101-2021_01_06_425657	147	35	growth	growth	NN
10_1101-2021_01_06_425657	147	36	media	medium	NNS
10_1101-2021_01_06_425657	147	37	373	373	CD
10_1101-2021_01_06_425657	147	38	The	the	DT
10_1101-2021_01_06_425657	147	39	prototrophic	prototrophic	JJ
10_1101-2021_01_06_425657	147	40	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	147	41	strain	strain	NN
10_1101-2021_01_06_425657	147	42	background	background	NN
10_1101-2021_01_06_425657	147	43	(	(	-LRB-
10_1101-2021_01_06_425657	147	44	van	van	NNP
10_1101-2021_01_06_425657	147	45	Dijken	Dijken	NNP
10_1101-2021_01_06_425657	147	46	et	et	NNP
10_1101-2021_01_06_425657	147	47	al	al	NNP
10_1101-2021_01_06_425657	147	48	.	.	NNP
10_1101-2021_01_06_425657	147	49	,	,	,
10_1101-2021_01_06_425657	147	50	2000	2000	CD
10_1101-2021_01_06_425657	147	51	)	)	-RRB-
10_1101-2021_01_06_425657	147	52	was	be	VBD
10_1101-2021_01_06_425657	147	53	used	use	VBN
10_1101-2021_01_06_425657	147	54	in	in	IN
10_1101-2021_01_06_425657	147	55	all	all	DT
10_1101-2021_01_06_425657	147	56	experiments	experiment	NNS
10_1101-2021_01_06_425657	147	57	.	.	.
10_1101-2021_01_06_425657	148	1	374	374	CD
10_1101-2021_01_06_425657	148	2	Strains	strain	NNS
10_1101-2021_01_06_425657	148	3	used	use	VBN
10_1101-2021_01_06_425657	148	4	in	in	IN
10_1101-2021_01_06_425657	148	5	this	this	DT
10_1101-2021_01_06_425657	148	6	study	study	NN
10_1101-2021_01_06_425657	148	7	are	be	VBP
10_1101-2021_01_06_425657	148	8	listed	list	VBN
10_1101-2021_01_06_425657	148	9	in	in	IN
10_1101-2021_01_06_425657	148	10	Table	table	NN
10_1101-2021_01_06_425657	148	11	S1	S1	NNS
10_1101-2021_01_06_425657	148	12	.	.	.
10_1101-2021_01_06_425657	149	1	Gene	gene	NN
10_1101-2021_01_06_425657	149	2	deletions	deletion	NNS
10_1101-2021_01_06_425657	149	3	were	be	VBD
10_1101-2021_01_06_425657	149	4	carried	carry	VBN
10_1101-2021_01_06_425657	149	5	out	out	RP
10_1101-2021_01_06_425657	149	6	using	use	VBG
10_1101-2021_01_06_425657	149	7	either	either	CC
10_1101-2021_01_06_425657	149	8	tetrad	tetrad	NN
10_1101-2021_01_06_425657	149	9	375	375	CD
10_1101-2021_01_06_425657	149	10	dissection	dissection	NN
10_1101-2021_01_06_425657	149	11	or	or	CC
10_1101-2021_01_06_425657	149	12	standard	standard	JJ
10_1101-2021_01_06_425657	149	13	PCR	PCR	NNP
10_1101-2021_01_06_425657	149	14	-	-	HYPH
10_1101-2021_01_06_425657	149	15	based	base	VBN
10_1101-2021_01_06_425657	149	16	strategies	strategy	NNS
10_1101-2021_01_06_425657	149	17	to	to	TO
10_1101-2021_01_06_425657	149	18	amplify	amplify	VB
10_1101-2021_01_06_425657	149	19	resistance	resistance	NN
10_1101-2021_01_06_425657	149	20	cassettes	cassette	NNS
10_1101-2021_01_06_425657	149	21	with	with	IN
10_1101-2021_01_06_425657	149	22	appropriate	appropriate	JJ
10_1101-2021_01_06_425657	149	23	376	376	CD
10_1101-2021_01_06_425657	149	24	flanking	flank	VBG
10_1101-2021_01_06_425657	149	25	sequences	sequence	NNS
10_1101-2021_01_06_425657	149	26	,	,	,
10_1101-2021_01_06_425657	149	27	and	and	CC
10_1101-2021_01_06_425657	149	28	replacing	replace	VBG
10_1101-2021_01_06_425657	149	29	the	the	DT
10_1101-2021_01_06_425657	149	30	target	target	NN
10_1101-2021_01_06_425657	149	31	gene	gene	NN
10_1101-2021_01_06_425657	149	32	by	by	IN
10_1101-2021_01_06_425657	149	33	homologous	homologous	JJ
10_1101-2021_01_06_425657	149	34	recombination	recombination	NN
10_1101-2021_01_06_425657	149	35	(	(	-LRB-
10_1101-2021_01_06_425657	149	36	Longtine	Longtine	NNP
10_1101-2021_01_06_425657	149	37	et	et	NNP
10_1101-2021_01_06_425657	149	38	al	al	NNP
10_1101-2021_01_06_425657	149	39	.	.	NNP
10_1101-2021_01_06_425657	149	40	,	,	,
10_1101-2021_01_06_425657	149	41	377	377	CD
10_1101-2021_01_06_425657	149	42	1998	1998	CD
10_1101-2021_01_06_425657	149	43	)	)	-RRB-
10_1101-2021_01_06_425657	149	44	.	.	.
10_1101-2021_01_06_425657	150	1	C	C	NNP
10_1101-2021_01_06_425657	150	2	-	-	HYPH
10_1101-2021_01_06_425657	150	3	terminal	terminal	NN
10_1101-2021_01_06_425657	150	4	epitope	epitope	NN
10_1101-2021_01_06_425657	150	5	tagged	tag	VBD
10_1101-2021_01_06_425657	150	6	strains	strain	NNS
10_1101-2021_01_06_425657	150	7	were	be	VBD
10_1101-2021_01_06_425657	150	8	similarly	similarly	RB
10_1101-2021_01_06_425657	150	9	made	make	VBN
10_1101-2021_01_06_425657	150	10	with	with	IN
10_1101-2021_01_06_425657	150	11	the	the	DT
10_1101-2021_01_06_425657	150	12	PCR	PCR	NNP
10_1101-2021_01_06_425657	150	13	-	-	HYPH
10_1101-2021_01_06_425657	150	14	based	base	VBN
10_1101-2021_01_06_425657	150	15	method	method	NN
10_1101-2021_01_06_425657	150	16	to	to	IN
10_1101-2021_01_06_425657	150	17	378	378	CD
10_1101-2021_01_06_425657	150	18	amplify	amplify	JJ
10_1101-2021_01_06_425657	150	19	resistance	resistance	NN
10_1101-2021_01_06_425657	150	20	cassettes	cassette	VBZ
10_1101-2021_01_06_425657	150	21	with	with	IN
10_1101-2021_01_06_425657	150	22	flanking	flank	VBG
10_1101-2021_01_06_425657	150	23	sequences	sequence	NNS
10_1101-2021_01_06_425657	150	24	.	.	.
10_1101-2021_01_06_425657	151	1	Point	point	NN
10_1101-2021_01_06_425657	151	2	mutations	mutation	NNS
10_1101-2021_01_06_425657	151	3	were	be	VBD
10_1101-2021_01_06_425657	151	4	made	make	VBN
10_1101-2021_01_06_425657	151	5	by	by	IN
10_1101-2021_01_06_425657	151	6	cloning	clone	VBG
10_1101-2021_01_06_425657	151	7	the	the	DT
10_1101-2021_01_06_425657	151	8	379	379	CD
10_1101-2021_01_06_425657	151	9	gene	gene	NN
10_1101-2021_01_06_425657	151	10	into	into	IN
10_1101-2021_01_06_425657	151	11	the	the	DT
10_1101-2021_01_06_425657	151	12	tagging	tag	VBG
10_1101-2021_01_06_425657	151	13	plasmids	plasmid	NNS
10_1101-2021_01_06_425657	151	14	,	,	,
10_1101-2021_01_06_425657	151	15	making	make	VBG
10_1101-2021_01_06_425657	151	16	the	the	DT
10_1101-2021_01_06_425657	151	17	specific	specific	JJ
10_1101-2021_01_06_425657	151	18	point	point	NN
10_1101-2021_01_06_425657	151	19	mutation(s	mutation(s	NNP
10_1101-2021_01_06_425657	151	20	)	)	-RRB-
10_1101-2021_01_06_425657	151	21	by	by	IN
10_1101-2021_01_06_425657	151	22	PCR	PCR	NNP
10_1101-2021_01_06_425657	151	23	,	,	,
10_1101-2021_01_06_425657	151	24	and	and	CC
10_1101-2021_01_06_425657	151	25	amplifying	amplifying	NN
10_1101-2021_01_06_425657	151	26	and	and	CC
10_1101-2021_01_06_425657	151	27	380	380	CD
10_1101-2021_01_06_425657	151	28	transforming	transform	VBG
10_1101-2021_01_06_425657	151	29	the	the	DT
10_1101-2021_01_06_425657	151	30	entire	entire	JJ
10_1101-2021_01_06_425657	151	31	gene	gene	NN
10_1101-2021_01_06_425657	151	32	locus	locus	NN
10_1101-2021_01_06_425657	151	33	and	and	CC
10_1101-2021_01_06_425657	151	34	resistance	resistance	NN
10_1101-2021_01_06_425657	151	35	markers	marker	NNS
10_1101-2021_01_06_425657	151	36	with	with	IN
10_1101-2021_01_06_425657	151	37	appropriate	appropriate	JJ
10_1101-2021_01_06_425657	151	38	flanking	flanking	NN
10_1101-2021_01_06_425657	151	39	sequences	sequence	NNS
10_1101-2021_01_06_425657	151	40	381	381	CD
10_1101-2021_01_06_425657	151	41	using	use	VBG
10_1101-2021_01_06_425657	151	42	the	the	DT
10_1101-2021_01_06_425657	151	43	lithium	lithium	NN
10_1101-2021_01_06_425657	151	44	acetate	acetate	NN
10_1101-2021_01_06_425657	151	45	method	method	NN
10_1101-2021_01_06_425657	151	46	.	.	.
10_1101-2021_01_06_425657	152	1	382	382	CD
10_1101-2021_01_06_425657	152	2	383	383	CD
10_1101-2021_01_06_425657	152	3	Media	medium	NNS
10_1101-2021_01_06_425657	152	4	used	use	VBN
10_1101-2021_01_06_425657	152	5	in	in	IN
10_1101-2021_01_06_425657	152	6	this	this	DT
10_1101-2021_01_06_425657	152	7	study	study	NN
10_1101-2021_01_06_425657	152	8	:	:	:
10_1101-2021_01_06_425657	152	9	YPL	YPL	NNP
10_1101-2021_01_06_425657	152	10	(	(	-LRB-
10_1101-2021_01_06_425657	152	11	1	1	CD
10_1101-2021_01_06_425657	152	12	%	%	NN
10_1101-2021_01_06_425657	152	13	yeast	yeast	NN
10_1101-2021_01_06_425657	152	14	extract	extract	NN
10_1101-2021_01_06_425657	152	15	,	,	,
10_1101-2021_01_06_425657	152	16	2	2	CD
10_1101-2021_01_06_425657	152	17	%	%	NN
10_1101-2021_01_06_425657	152	18	peptone	peptone	NN
10_1101-2021_01_06_425657	152	19	and	and	CC
10_1101-2021_01_06_425657	152	20	2	2	CD
10_1101-2021_01_06_425657	152	21	%	%	NN
10_1101-2021_01_06_425657	152	22	lactate	lactate	NN
10_1101-2021_01_06_425657	152	23	)	)	-RRB-
10_1101-2021_01_06_425657	152	24	;	;	:
10_1101-2021_01_06_425657	152	25	sulfur	sulfur	NN
10_1101-2021_01_06_425657	152	26	-	-	HYPH
10_1101-2021_01_06_425657	152	27	free	free	JJ
10_1101-2021_01_06_425657	152	28	glucose	glucose	NN
10_1101-2021_01_06_425657	152	29	384	384	CD
10_1101-2021_01_06_425657	152	30	and	and	CC
10_1101-2021_01_06_425657	152	31	lactate	lactate	JJ
10_1101-2021_01_06_425657	152	32	media	medium	NNS
10_1101-2021_01_06_425657	152	33	(	(	-LRB-
10_1101-2021_01_06_425657	152	34	SFD	SFD	NNP
10_1101-2021_01_06_425657	152	35	/	/	SYM
10_1101-2021_01_06_425657	152	36	L	L	NNP
10_1101-2021_01_06_425657	152	37	)	)	-RRB-
10_1101-2021_01_06_425657	152	38	media	medium	NNS
10_1101-2021_01_06_425657	152	39	composition	composition	NN
10_1101-2021_01_06_425657	152	40	is	be	VBZ
10_1101-2021_01_06_425657	152	41	detailed	detail	VBN
10_1101-2021_01_06_425657	152	42	in	in	IN
10_1101-2021_01_06_425657	152	43	Table	Table	NNP
10_1101-2021_01_06_425657	152	44	S2	s2	NN
10_1101-2021_01_06_425657	152	45	,	,	,
10_1101-2021_01_06_425657	152	46	with	with	IN
10_1101-2021_01_06_425657	152	47	glucose	glucose	NN
10_1101-2021_01_06_425657	152	48	or	or	CC
10_1101-2021_01_06_425657	152	49	lactate	lactate	VB
10_1101-2021_01_06_425657	152	50	385	385	CD
10_1101-2021_01_06_425657	152	51	diluted	dilute	VBN
10_1101-2021_01_06_425657	152	52	to	to	IN
10_1101-2021_01_06_425657	152	53	2	2	CD
10_1101-2021_01_06_425657	152	54	%	%	NN
10_1101-2021_01_06_425657	152	55	each	each	DT
10_1101-2021_01_06_425657	152	56	;	;	:
10_1101-2021_01_06_425657	152	57	YPD	YPD	NNP
10_1101-2021_01_06_425657	152	58	(	(	-LRB-
10_1101-2021_01_06_425657	152	59	1	1	CD
10_1101-2021_01_06_425657	152	60	%	%	NN
10_1101-2021_01_06_425657	152	61	yeast	yeast	NN
10_1101-2021_01_06_425657	152	62	extract	extract	NN
10_1101-2021_01_06_425657	152	63	,	,	,
10_1101-2021_01_06_425657	152	64	2	2	CD
10_1101-2021_01_06_425657	152	65	%	%	NN
10_1101-2021_01_06_425657	152	66	peptone	peptone	NN
10_1101-2021_01_06_425657	152	67	and	and	CC
10_1101-2021_01_06_425657	152	68	2	2	CD
10_1101-2021_01_06_425657	152	69	%	%	NN
10_1101-2021_01_06_425657	152	70	glucose	glucose	NN
10_1101-2021_01_06_425657	152	71	)	)	-RRB-
10_1101-2021_01_06_425657	152	72	.	.	.
10_1101-2021_01_06_425657	153	1	386	386	CD
10_1101-2021_01_06_425657	153	2	387	387	CD
10_1101-2021_01_06_425657	153	3	Whole	whole	JJ
10_1101-2021_01_06_425657	153	4	cell	cell	NN
10_1101-2021_01_06_425657	153	5	lysate	lysate	NN
10_1101-2021_01_06_425657	153	6	Western	western	JJ
10_1101-2021_01_06_425657	153	7	blot	blot	NN
10_1101-2021_01_06_425657	153	8	preparation	preparation	NN
10_1101-2021_01_06_425657	153	9	388	388	CD
10_1101-2021_01_06_425657	153	10	Five	five	CD
10_1101-2021_01_06_425657	153	11	OD600	od600	NN
10_1101-2021_01_06_425657	153	12	units	unit	NNS
10_1101-2021_01_06_425657	153	13	of	of	IN
10_1101-2021_01_06_425657	153	14	yeast	yeast	NN
10_1101-2021_01_06_425657	153	15	culture	culture	NN
10_1101-2021_01_06_425657	153	16	were	be	VBD
10_1101-2021_01_06_425657	153	17	quenched	quench	VBN
10_1101-2021_01_06_425657	153	18	in	in	IN
10_1101-2021_01_06_425657	153	19	15	15	CD
10_1101-2021_01_06_425657	153	20	%	%	NN
10_1101-2021_01_06_425657	153	21	TCA	TCA	NNP
10_1101-2021_01_06_425657	153	22	for	for	IN
10_1101-2021_01_06_425657	153	23	15	15	CD
10_1101-2021_01_06_425657	153	24	min	min	NN
10_1101-2021_01_06_425657	153	25	,	,	,
10_1101-2021_01_06_425657	153	26	pelleted	pellete	VBN
10_1101-2021_01_06_425657	153	27	,	,	,
10_1101-2021_01_06_425657	153	28	washed	wash	VBD
10_1101-2021_01_06_425657	153	29	with	with	IN
10_1101-2021_01_06_425657	153	30	389	389	CD
10_1101-2021_01_06_425657	153	31	100	100	CD
10_1101-2021_01_06_425657	153	32	%	%	NN
10_1101-2021_01_06_425657	153	33	EtOH	etoh	NN
10_1101-2021_01_06_425657	153	34	,	,	,
10_1101-2021_01_06_425657	153	35	and	and	CC
10_1101-2021_01_06_425657	153	36	stored	store	VBN
10_1101-2021_01_06_425657	153	37	at	at	IN
10_1101-2021_01_06_425657	153	38	−20	−20	NNP
10_1101-2021_01_06_425657	153	39	°	°	,
10_1101-2021_01_06_425657	153	40	C	C	NNP
10_1101-2021_01_06_425657	153	41	.	.	.
10_1101-2021_01_06_425657	154	1	Cell	cell	NN
10_1101-2021_01_06_425657	154	2	pellets	pellet	NNS
10_1101-2021_01_06_425657	154	3	were	be	VBD
10_1101-2021_01_06_425657	154	4	resuspended	resuspend	VBN
10_1101-2021_01_06_425657	154	5	in	in	IN
10_1101-2021_01_06_425657	154	6	325	325	CD
10_1101-2021_01_06_425657	154	7	µL	µL	NNP
10_1101-2021_01_06_425657	154	8	EtOH	EtOH	NNP
10_1101-2021_01_06_425657	154	9	containing	contain	VBG
10_1101-2021_01_06_425657	154	10	1	1	CD
10_1101-2021_01_06_425657	154	11	390	390	CD
10_1101-2021_01_06_425657	154	12	mM	mm	NN
10_1101-2021_01_06_425657	154	13	PMSF	pmsf	NN
10_1101-2021_01_06_425657	154	14	and	and	CC
10_1101-2021_01_06_425657	154	15	lysed	lyse	VBN
10_1101-2021_01_06_425657	154	16	by	by	IN
10_1101-2021_01_06_425657	154	17	bead	bead	NNP
10_1101-2021_01_06_425657	154	18	beating	beat	VBG
10_1101-2021_01_06_425657	154	19	.	.	.
10_1101-2021_01_06_425657	155	1	The	the	DT
10_1101-2021_01_06_425657	155	2	lysate	lysate	NN
10_1101-2021_01_06_425657	155	3	was	be	VBD
10_1101-2021_01_06_425657	155	4	separated	separate	VBN
10_1101-2021_01_06_425657	155	5	from	from	IN
10_1101-2021_01_06_425657	155	6	beads	bead	NNS
10_1101-2021_01_06_425657	155	7	by	by	IN
10_1101-2021_01_06_425657	155	8	inverting	invert	VBG
10_1101-2021_01_06_425657	155	9	the	the	DT
10_1101-2021_01_06_425657	155	10	391	391	CD
10_1101-2021_01_06_425657	155	11	screwcap	screwcap	NN
10_1101-2021_01_06_425657	155	12	tubes	tube	NNS
10_1101-2021_01_06_425657	155	13	,	,	,
10_1101-2021_01_06_425657	155	14	puncturing	puncture	VBG
10_1101-2021_01_06_425657	155	15	the	the	DT
10_1101-2021_01_06_425657	155	16	bottom	bottom	NN
10_1101-2021_01_06_425657	155	17	with	with	IN
10_1101-2021_01_06_425657	155	18	a	a	DT
10_1101-2021_01_06_425657	155	19	23	23	CD
10_1101-2021_01_06_425657	155	20	G	g	NN
10_1101-2021_01_06_425657	155	21	needle	needle	NN
10_1101-2021_01_06_425657	155	22	,	,	,
10_1101-2021_01_06_425657	155	23	and	and	CC
10_1101-2021_01_06_425657	155	24	spinning	spin	VBG
10_1101-2021_01_06_425657	155	25	the	the	DT
10_1101-2021_01_06_425657	155	26	lysate	lysate	NN
10_1101-2021_01_06_425657	155	27	at	at	IN
10_1101-2021_01_06_425657	155	28	2,500xg	2,500xg	CD
10_1101-2021_01_06_425657	155	29	into	into	IN
10_1101-2021_01_06_425657	155	30	392	392	CD
10_1101-2021_01_06_425657	155	31	an	an	DT
10_1101-2021_01_06_425657	155	32	Eppendorf	Eppendorf	NNP
10_1101-2021_01_06_425657	155	33	for	for	IN
10_1101-2021_01_06_425657	155	34	1	1	CD
10_1101-2021_01_06_425657	155	35	min	min	NN
10_1101-2021_01_06_425657	155	36	.	.	.
10_1101-2021_01_06_425657	156	1	Beads	bead	NNS
10_1101-2021_01_06_425657	156	2	were	be	VBD
10_1101-2021_01_06_425657	156	3	washed	wash	VBN
10_1101-2021_01_06_425657	156	4	with	with	IN
10_1101-2021_01_06_425657	156	5	200	200	CD
10_1101-2021_01_06_425657	156	6	µL	µl	CD
10_1101-2021_01_06_425657	156	7	of	of	IN
10_1101-2021_01_06_425657	156	8	EtOH	EtOH	NNP
10_1101-2021_01_06_425657	156	9	and	and	CC
10_1101-2021_01_06_425657	156	10	spun	spin	VBD
10_1101-2021_01_06_425657	156	11	again	again	RB
10_1101-2021_01_06_425657	156	12	before	before	IN
10_1101-2021_01_06_425657	156	13	393	393	CD
10_1101-2021_01_06_425657	156	14	discarding	discard	VBG
10_1101-2021_01_06_425657	156	15	the	the	DT
10_1101-2021_01_06_425657	156	16	bead	bead	NN
10_1101-2021_01_06_425657	156	17	-	-	HYPH
10_1101-2021_01_06_425657	156	18	containing	contain	VBG
10_1101-2021_01_06_425657	156	19	screwcap	screwcap	NN
10_1101-2021_01_06_425657	156	20	tube	tube	NN
10_1101-2021_01_06_425657	156	21	and	and	CC
10_1101-2021_01_06_425657	156	22	pelleting	pellete	VBG
10_1101-2021_01_06_425657	156	23	protein	protein	NN
10_1101-2021_01_06_425657	156	24	extract	extract	NN
10_1101-2021_01_06_425657	156	25	at	at	IN
10_1101-2021_01_06_425657	156	26	21,000xg	21,000xg	CD
10_1101-2021_01_06_425657	156	27	for	for	IN
10_1101-2021_01_06_425657	156	28	10	10	CD
10_1101-2021_01_06_425657	156	29	min	min	NN
10_1101-2021_01_06_425657	156	30	394	394	CD
10_1101-2021_01_06_425657	156	31	in	in	IN
10_1101-2021_01_06_425657	156	32	the	the	DT
10_1101-2021_01_06_425657	156	33	new	new	JJ
10_1101-2021_01_06_425657	156	34	Eppendorf	Eppendorf	NNP
10_1101-2021_01_06_425657	156	35	tube	tube	NN
10_1101-2021_01_06_425657	156	36	.	.	.
10_1101-2021_01_06_425657	157	1	The	the	DT
10_1101-2021_01_06_425657	157	2	EtOH	EtOH	NNP
10_1101-2021_01_06_425657	157	3	was	be	VBD
10_1101-2021_01_06_425657	157	4	aspirated	aspirate	VBN
10_1101-2021_01_06_425657	157	5	and	and	CC
10_1101-2021_01_06_425657	157	6	EtOH	EtOH	NNP
10_1101-2021_01_06_425657	157	7	precipitated	precipitate	VBD
10_1101-2021_01_06_425657	157	8	protein	protein	NN
10_1101-2021_01_06_425657	157	9	pellets	pellet	NNS
10_1101-2021_01_06_425657	157	10	were	be	VBD
10_1101-2021_01_06_425657	157	11	395	395	CD
10_1101-2021_01_06_425657	157	12	resuspended	resuspend	VBD
10_1101-2021_01_06_425657	157	13	in	in	IN
10_1101-2021_01_06_425657	157	14	150	150	CD
10_1101-2021_01_06_425657	157	15	µL	µL	NNP
10_1101-2021_01_06_425657	157	16	of	of	IN
10_1101-2021_01_06_425657	157	17	sample	sample	NN
10_1101-2021_01_06_425657	157	18	buffer	buffer	NN
10_1101-2021_01_06_425657	157	19	(	(	-LRB-
10_1101-2021_01_06_425657	157	20	200	200	CD
10_1101-2021_01_06_425657	157	21	mM	mM	NNP
10_1101-2021_01_06_425657	157	22	Tris	Tris	NNP
10_1101-2021_01_06_425657	157	23	pH	pH	NNP
10_1101-2021_01_06_425657	157	24	6.8	6.8	CD
10_1101-2021_01_06_425657	157	25	,	,	,
10_1101-2021_01_06_425657	157	26	4	4	CD
10_1101-2021_01_06_425657	157	27	%	%	NN
10_1101-2021_01_06_425657	157	28	SDS	sds	NN
10_1101-2021_01_06_425657	157	29	,	,	,
10_1101-2021_01_06_425657	157	30	20	20	CD
10_1101-2021_01_06_425657	157	31	%	%	NN
10_1101-2021_01_06_425657	157	32	glycerol	glycerol	NN
10_1101-2021_01_06_425657	157	33	,	,	,
10_1101-2021_01_06_425657	157	34	0.2	0.2	CD
10_1101-2021_01_06_425657	157	35	mg	mg	CD
10_1101-2021_01_06_425657	157	36	/	/	SYM
10_1101-2021_01_06_425657	157	37	ml	ml	NNP
10_1101-2021_01_06_425657	157	38	396	396	CD
10_1101-2021_01_06_425657	157	39	bromophenol	bromophenol	NN
10_1101-2021_01_06_425657	157	40	blue	blue	JJ
10_1101-2021_01_06_425657	157	41	)	)	-RRB-
10_1101-2021_01_06_425657	157	42	,	,	,
10_1101-2021_01_06_425657	157	43	heated	heat	VBN
10_1101-2021_01_06_425657	157	44	at	at	IN
10_1101-2021_01_06_425657	157	45	42	42	CD
10_1101-2021_01_06_425657	157	46	°	°	,
10_1101-2021_01_06_425657	157	47	C	C	NNP
10_1101-2021_01_06_425657	157	48	for	for	IN
10_1101-2021_01_06_425657	157	49	45	45	CD
10_1101-2021_01_06_425657	157	50	min	min	NN
10_1101-2021_01_06_425657	157	51	,	,	,
10_1101-2021_01_06_425657	157	52	and	and	CC
10_1101-2021_01_06_425657	157	53	debris	debris	NNP
10_1101-2021_01_06_425657	157	54	was	be	VBD
10_1101-2021_01_06_425657	157	55	pelleted	pellete	VBN
10_1101-2021_01_06_425657	157	56	at	at	IN
10_1101-2021_01_06_425657	157	57	16,000xg	16,000xg	CD
10_1101-2021_01_06_425657	157	58	for	for	IN
10_1101-2021_01_06_425657	157	59	3	3	CD
10_1101-2021_01_06_425657	157	60	min	min	NN
10_1101-2021_01_06_425657	157	61	.	.	.
10_1101-2021_01_06_425657	158	1	DTT	DTT	NNP
10_1101-2021_01_06_425657	158	2	397	397	CD
10_1101-2021_01_06_425657	158	3	was	be	VBD
10_1101-2021_01_06_425657	158	4	added	add	VBN
10_1101-2021_01_06_425657	158	5	to	to	IN
10_1101-2021_01_06_425657	158	6	a	a	DT
10_1101-2021_01_06_425657	158	7	final	final	JJ
10_1101-2021_01_06_425657	158	8	concentration	concentration	NN
10_1101-2021_01_06_425657	158	9	of	of	IN
10_1101-2021_01_06_425657	158	10	25	25	CD
10_1101-2021_01_06_425657	158	11	mM	mM	NNS
10_1101-2021_01_06_425657	158	12	and	and	CC
10_1101-2021_01_06_425657	158	13	incubated	incubate	VBD
10_1101-2021_01_06_425657	158	14	at	at	IN
10_1101-2021_01_06_425657	158	15	RT	RT	NNP
10_1101-2021_01_06_425657	158	16	for	for	IN
10_1101-2021_01_06_425657	158	17	30	30	CD
10_1101-2021_01_06_425657	158	18	min	min	NN
10_1101-2021_01_06_425657	158	19	before	before	IN
10_1101-2021_01_06_425657	158	20	equivalent	equivalent	JJ
10_1101-2021_01_06_425657	158	21	398	398	CD
10_1101-2021_01_06_425657	158	22	amounts	amount	NNS
10_1101-2021_01_06_425657	158	23	of	of	IN
10_1101-2021_01_06_425657	158	24	protein	protein	NN
10_1101-2021_01_06_425657	158	25	were	be	VBD
10_1101-2021_01_06_425657	158	26	loaded	load	VBN
10_1101-2021_01_06_425657	158	27	onto	onto	IN
10_1101-2021_01_06_425657	158	28	NuPAGE	nupage	NN
10_1101-2021_01_06_425657	158	29	4	4	CD
10_1101-2021_01_06_425657	158	30	-	-	SYM
10_1101-2021_01_06_425657	158	31	12	12	CD
10_1101-2021_01_06_425657	158	32	%	%	NN
10_1101-2021_01_06_425657	158	33	bis	bis	NN
10_1101-2021_01_06_425657	158	34	-	-	HYPH
10_1101-2021_01_06_425657	158	35	tris	tris	NN
10_1101-2021_01_06_425657	158	36	or	or	CC
10_1101-2021_01_06_425657	158	37	3	3	CD
10_1101-2021_01_06_425657	158	38	-	-	SYM
10_1101-2021_01_06_425657	158	39	8	8	CD
10_1101-2021_01_06_425657	158	40	%	%	NN
10_1101-2021_01_06_425657	158	41	tris	tris	NN
10_1101-2021_01_06_425657	158	42	-	-	HYPH
10_1101-2021_01_06_425657	158	43	acetate	acetate	NNP
10_1101-2021_01_06_425657	158	44	gels	gel	NNS
10_1101-2021_01_06_425657	158	45	.	.	.
10_1101-2021_01_06_425657	159	1	For	for	IN
10_1101-2021_01_06_425657	159	2	protein	protein	NN
10_1101-2021_01_06_425657	159	3	399	399	CD
10_1101-2021_01_06_425657	159	4	samples	sample	NNS
10_1101-2021_01_06_425657	159	5	modified	modify	VBN
10_1101-2021_01_06_425657	159	6	with	with	IN
10_1101-2021_01_06_425657	159	7	mPEG2K	mPEG2K	NNP
10_1101-2021_01_06_425657	159	8	-	-	HYPH
10_1101-2021_01_06_425657	159	9	mal	mal	NNP
10_1101-2021_01_06_425657	159	10	,	,	,
10_1101-2021_01_06_425657	159	11	an	an	DT
10_1101-2021_01_06_425657	159	12	aliquot	aliquot	NNS
10_1101-2021_01_06_425657	159	13	of	of	IN
10_1101-2021_01_06_425657	159	14	the	the	DT
10_1101-2021_01_06_425657	159	15	sample	sample	NN
10_1101-2021_01_06_425657	159	16	buffer	buffer	NN
10_1101-2021_01_06_425657	159	17	resuspended	resuspend	VBD
10_1101-2021_01_06_425657	159	18	protein	protein	NN
10_1101-2021_01_06_425657	159	19	pellets	pellet	NNS
10_1101-2021_01_06_425657	159	20	400	400	CD
10_1101-2021_01_06_425657	159	21	was	be	VBD
10_1101-2021_01_06_425657	159	22	moved	move	VBN
10_1101-2021_01_06_425657	159	23	to	to	IN
10_1101-2021_01_06_425657	159	24	a	a	DT
10_1101-2021_01_06_425657	159	25	fresh	fresh	JJ
10_1101-2021_01_06_425657	159	26	Eppendorf	Eppendorf	NNP
10_1101-2021_01_06_425657	159	27	and	and	CC
10_1101-2021_01_06_425657	159	28	sample	sample	NN
10_1101-2021_01_06_425657	159	29	buffer	buffer	NN
10_1101-2021_01_06_425657	159	30	containing	contain	VBG
10_1101-2021_01_06_425657	159	31	15	15	CD
10_1101-2021_01_06_425657	159	32	mM	mM	NNP
10_1101-2021_01_06_425657	159	33	mPEG2K	mPEG2K	NNP
10_1101-2021_01_06_425657	159	34	-	-	HYPH
10_1101-2021_01_06_425657	159	35	mal	mal	NNP
10_1101-2021_01_06_425657	159	36	was	be	VBD
10_1101-2021_01_06_425657	159	37	added	add	VBN
10_1101-2021_01_06_425657	159	38	401	401	CD
10_1101-2021_01_06_425657	159	39	for	for	IN
10_1101-2021_01_06_425657	159	40	a	a	DT
10_1101-2021_01_06_425657	159	41	final	final	JJ
10_1101-2021_01_06_425657	159	42	concentration	concentration	NN
10_1101-2021_01_06_425657	159	43	of	of	IN
10_1101-2021_01_06_425657	159	44	5	5	CD
10_1101-2021_01_06_425657	159	45	mM	mM	NNP
10_1101-2021_01_06_425657	159	46	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	159	47	-	-	HYPH
10_1101-2021_01_06_425657	159	48	mal	mal	JJ
10_1101-2021_01_06_425657	159	49	before	before	IN
10_1101-2021_01_06_425657	159	50	heating	heating	NN
10_1101-2021_01_06_425657	159	51	at	at	IN
10_1101-2021_01_06_425657	159	52	42	42	CD
10_1101-2021_01_06_425657	159	53	°	°	,
10_1101-2021_01_06_425657	159	54	C	C	NNP
10_1101-2021_01_06_425657	159	55	for	for	IN
10_1101-2021_01_06_425657	159	56	45	45	CD
10_1101-2021_01_06_425657	159	57	min	min	NN
10_1101-2021_01_06_425657	159	58	,	,	,
10_1101-2021_01_06_425657	159	59	pelleting	pellete	VBG
10_1101-2021_01_06_425657	159	60	402	402	CD
10_1101-2021_01_06_425657	159	61	debris	debris	NN
10_1101-2021_01_06_425657	159	62	,	,	,
10_1101-2021_01_06_425657	159	63	and	and	CC
10_1101-2021_01_06_425657	159	64	adding	add	VBG
10_1101-2021_01_06_425657	159	65	DTT	DTT	NNP
10_1101-2021_01_06_425657	159	66	.	.	.
10_1101-2021_01_06_425657	160	1	403	403	CD
10_1101-2021_01_06_425657	160	2	404	404	CD
10_1101-2021_01_06_425657	160	3	Western	western	JJ
10_1101-2021_01_06_425657	160	4	blots	blot	NNS
10_1101-2021_01_06_425657	160	5	405	405	CD
10_1101-2021_01_06_425657	160	6	Western	western	JJ
10_1101-2021_01_06_425657	160	7	blots	blot	NNS
10_1101-2021_01_06_425657	160	8	were	be	VBD
10_1101-2021_01_06_425657	160	9	carried	carry	VBN
10_1101-2021_01_06_425657	160	10	out	out	RP
10_1101-2021_01_06_425657	160	11	by	by	IN
10_1101-2021_01_06_425657	160	12	transferring	transfer	VBG
10_1101-2021_01_06_425657	160	13	whole	whole	JJ
10_1101-2021_01_06_425657	160	14	cell	cell	NN
10_1101-2021_01_06_425657	160	15	lysate	lysate	NN
10_1101-2021_01_06_425657	160	16	extracts	extract	NNS
10_1101-2021_01_06_425657	160	17	or	or	CC
10_1101-2021_01_06_425657	160	18	in	in	IN
10_1101-2021_01_06_425657	160	19	vitro	vitro	FW
10_1101-2021_01_06_425657	160	20	ubiquitination	ubiquitination	NNP
10_1101-2021_01_06_425657	160	21	406	406	CD
10_1101-2021_01_06_425657	160	22	or	or	CC
10_1101-2021_01_06_425657	160	23	binding	bind	VBG
10_1101-2021_01_06_425657	160	24	assay	assay	NN
10_1101-2021_01_06_425657	160	25	samples	sample	NNS
10_1101-2021_01_06_425657	160	26	onto	onto	IN
10_1101-2021_01_06_425657	160	27	0.45	0.45	CD
10_1101-2021_01_06_425657	160	28	micron	micron	NNP
10_1101-2021_01_06_425657	160	29	nitrocellulose	nitrocellulose	NNP
10_1101-2021_01_06_425657	160	30	membranes	membranes	NNPS
10_1101-2021_01_06_425657	160	31	and	and	CC
10_1101-2021_01_06_425657	160	32	wet	wet	JJ
10_1101-2021_01_06_425657	160	33	transfers	transfer	NNS
10_1101-2021_01_06_425657	160	34	were	be	VBD
10_1101-2021_01_06_425657	160	35	407	407	CD
10_1101-2021_01_06_425657	160	36	carried	carry	VBN
10_1101-2021_01_06_425657	160	37	out	out	RP
10_1101-2021_01_06_425657	160	38	at	at	IN
10_1101-2021_01_06_425657	160	39	300	300	CD
10_1101-2021_01_06_425657	160	40	mA	mA	NNP
10_1101-2021_01_06_425657	160	41	constant	constant	NN
10_1101-2021_01_06_425657	160	42	for	for	IN
10_1101-2021_01_06_425657	160	43	90	90	CD
10_1101-2021_01_06_425657	160	44	min	min	NN
10_1101-2021_01_06_425657	160	45	at	at	IN
10_1101-2021_01_06_425657	160	46	4	4	CD
10_1101-2021_01_06_425657	160	47	°	°	NNS
10_1101-2021_01_06_425657	160	48	C	C	NNP
10_1101-2021_01_06_425657	160	49	.	.	.
10_1101-2021_01_06_425657	161	1	Membranes	Membranes	NNP
10_1101-2021_01_06_425657	161	2	were	be	VBD
10_1101-2021_01_06_425657	161	3	incubated	incubate	VBN
10_1101-2021_01_06_425657	161	4	with	with	IN
10_1101-2021_01_06_425657	161	5	ponceau	ponceau	JJ
10_1101-2021_01_06_425657	161	6	S	S	NNP
10_1101-2021_01_06_425657	161	7	,	,	,
10_1101-2021_01_06_425657	161	8	408	408	CD
10_1101-2021_01_06_425657	161	9	washed	wash	VBD
10_1101-2021_01_06_425657	161	10	with	with	IN
10_1101-2021_01_06_425657	161	11	TBST	TBST	NNP
10_1101-2021_01_06_425657	161	12	,	,	,
10_1101-2021_01_06_425657	161	13	blocked	block	VBN
10_1101-2021_01_06_425657	161	14	with	with	IN
10_1101-2021_01_06_425657	161	15	5	5	CD
10_1101-2021_01_06_425657	161	16	%	%	NN
10_1101-2021_01_06_425657	161	17	milk	milk	NN
10_1101-2021_01_06_425657	161	18	in	in	IN
10_1101-2021_01_06_425657	161	19	TBST	TBST	NNP
10_1101-2021_01_06_425657	161	20	for	for	IN
10_1101-2021_01_06_425657	161	21	1	1	CD
10_1101-2021_01_06_425657	161	22	h	h	NN
10_1101-2021_01_06_425657	161	23	,	,	,
10_1101-2021_01_06_425657	161	24	and	and	CC
10_1101-2021_01_06_425657	161	25	incubated	incubate	VBN
10_1101-2021_01_06_425657	161	26	with	with	IN
10_1101-2021_01_06_425657	161	27	1:5000	1:5000	CD
10_1101-2021_01_06_425657	161	28	Mouse	Mouse	NNP
10_1101-2021_01_06_425657	161	29	409	409	CD
10_1101-2021_01_06_425657	161	30	anti	anti	JJ
10_1101-2021_01_06_425657	161	31	-	-	JJ
10_1101-2021_01_06_425657	161	32	FLAG	flag	JJ
10_1101-2021_01_06_425657	161	33	M2	M2	NNP
10_1101-2021_01_06_425657	161	34	antibody	antibody	NN
10_1101-2021_01_06_425657	161	35	(	(	-LRB-
10_1101-2021_01_06_425657	161	36	Sigma	Sigma	NNP
10_1101-2021_01_06_425657	161	37	,	,	,
10_1101-2021_01_06_425657	161	38	Cat#F3165	Cat#F3165	NNP
10_1101-2021_01_06_425657	161	39	)	)	-RRB-
10_1101-2021_01_06_425657	161	40	,	,	,
10_1101-2021_01_06_425657	161	41	1:5000	1:5000	CD
10_1101-2021_01_06_425657	161	42	Mouse	mouse	NN
10_1101-2021_01_06_425657	161	43	anti	anti	JJ
10_1101-2021_01_06_425657	161	44	-	-	JJ
10_1101-2021_01_06_425657	161	45	HA(12CA5	ha(12ca5	JJ
10_1101-2021_01_06_425657	161	46	)	)	-RRB-
10_1101-2021_01_06_425657	161	47	(	(	-LRB-
10_1101-2021_01_06_425657	161	48	Roche	Roche	NNP
10_1101-2021_01_06_425657	161	49	,	,	,
10_1101-2021_01_06_425657	161	50	410	410	CD
10_1101-2021_01_06_425657	161	51	.CC	.CC	NFP
10_1101-2021_01_06_425657	161	52	-	-	:
10_1101-2021_01_06_425657	161	53	BY	by	IN
10_1101-2021_01_06_425657	161	54	4.0	4.0	CD
10_1101-2021_01_06_425657	161	55	International	International	NNP
10_1101-2021_01_06_425657	161	56	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	161	57	under	under	IN
10_1101-2021_01_06_425657	161	58	a	a	DT
10_1101-2021_01_06_425657	161	59	(	(	-LRB-
10_1101-2021_01_06_425657	161	60	which	which	WDT
10_1101-2021_01_06_425657	161	61	was	be	VBD
10_1101-2021_01_06_425657	161	62	not	not	RB
10_1101-2021_01_06_425657	161	63	certified	certify	VBN
10_1101-2021_01_06_425657	161	64	by	by	IN
10_1101-2021_01_06_425657	161	65	peer	peer	NN
10_1101-2021_01_06_425657	161	66	review	review	NN
10_1101-2021_01_06_425657	161	67	)	)	-RRB-
10_1101-2021_01_06_425657	161	68	is	be	VBZ
10_1101-2021_01_06_425657	161	69	the	the	DT
10_1101-2021_01_06_425657	161	70	author	author	NN
10_1101-2021_01_06_425657	161	71	/	/	SYM
10_1101-2021_01_06_425657	161	72	funder	funder	NN
10_1101-2021_01_06_425657	161	73	,	,	,
10_1101-2021_01_06_425657	161	74	who	who	WP
10_1101-2021_01_06_425657	161	75	has	have	VBZ
10_1101-2021_01_06_425657	161	76	granted	grant	VBN
10_1101-2021_01_06_425657	161	77	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	161	78	a	a	DT
10_1101-2021_01_06_425657	161	79	license	license	NN
10_1101-2021_01_06_425657	161	80	to	to	TO
10_1101-2021_01_06_425657	161	81	display	display	VB
10_1101-2021_01_06_425657	161	82	the	the	DT
10_1101-2021_01_06_425657	161	83	preprint	preprint	NN
10_1101-2021_01_06_425657	161	84	in	in	IN
10_1101-2021_01_06_425657	161	85	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	161	86	.	.	.
10_1101-2021_01_06_425657	162	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	162	2	is	be	VBZ
10_1101-2021_01_06_425657	162	3	made	make	VBN
10_1101-2021_01_06_425657	162	4	The	the	DT
10_1101-2021_01_06_425657	162	5	copyright	copyright	NN
10_1101-2021_01_06_425657	162	6	holder	holder	NN
10_1101-2021_01_06_425657	162	7	for	for	IN
10_1101-2021_01_06_425657	162	8	this	this	DT
10_1101-2021_01_06_425657	162	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	162	10	version	version	NN
10_1101-2021_01_06_425657	162	11	posted	post	VBD
10_1101-2021_01_06_425657	162	12	January	January	NNP
10_1101-2021_01_06_425657	162	13	7	7	CD
10_1101-2021_01_06_425657	162	14	,	,	,
10_1101-2021_01_06_425657	162	15	2021	2021	CD
10_1101-2021_01_06_425657	162	16	.	.	.
10_1101-2021_01_06_425657	162	17	;	;	:
10_1101-2021_01_06_425657	162	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	162	19	:	:	:
10_1101-2021_01_06_425657	162	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	162	21	preprint	preprint	NN
10_1101-2021_01_06_425657	162	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	162	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	162	24	12	12	CD
10_1101-2021_01_06_425657	162	25	Ref#11583816001	Ref#11583816001	NNP
10_1101-2021_01_06_425657	162	26	)	)	-RRB-
10_1101-2021_01_06_425657	162	27	,	,	,
10_1101-2021_01_06_425657	162	28	1:50,000	1:50,000	CD
10_1101-2021_01_06_425657	162	29	Rabbit	Rabbit	NNP
10_1101-2021_01_06_425657	162	30	anti	anti	NN
10_1101-2021_01_06_425657	162	31	-	-	NN
10_1101-2021_01_06_425657	162	32	RPN10	rpn10	NN
10_1101-2021_01_06_425657	162	33	(	(	-LRB-
10_1101-2021_01_06_425657	162	34	Abcam	abcam	RB
10_1101-2021_01_06_425657	162	35	,	,	,
10_1101-2021_01_06_425657	162	36	ab98843	ab98843	NNP
10_1101-2021_01_06_425657	162	37	)	)	-RRB-
10_1101-2021_01_06_425657	162	38	,	,	,
10_1101-2021_01_06_425657	162	39	or	or	CC
10_1101-2021_01_06_425657	162	40	1:3000	1:3000	CD
10_1101-2021_01_06_425657	162	41	Goat	Goat	NNP
10_1101-2021_01_06_425657	162	42	anti	anti	JJ
10_1101-2021_01_06_425657	162	43	-	-	JJ
10_1101-2021_01_06_425657	162	44	Cdc53	Cdc53	NNP
10_1101-2021_01_06_425657	162	45	411	411	CD
10_1101-2021_01_06_425657	162	46	(	(	-LRB-
10_1101-2021_01_06_425657	162	47	Santa	Santa	NNP
10_1101-2021_01_06_425657	162	48	Cruz	Cruz	NNP
10_1101-2021_01_06_425657	162	49	,	,	,
10_1101-2021_01_06_425657	162	50	yC-17	yC-17	NNP
10_1101-2021_01_06_425657	162	51	)	)	-RRB-
10_1101-2021_01_06_425657	162	52	in	in	IN
10_1101-2021_01_06_425657	162	53	5	5	CD
10_1101-2021_01_06_425657	162	54	%	%	NN
10_1101-2021_01_06_425657	162	55	milk	milk	NN
10_1101-2021_01_06_425657	162	56	in	in	IN
10_1101-2021_01_06_425657	162	57	TBST	TBST	NNP
10_1101-2021_01_06_425657	162	58	overnight	overnight	RB
10_1101-2021_01_06_425657	162	59	at	at	IN
10_1101-2021_01_06_425657	162	60	4	4	CD
10_1101-2021_01_06_425657	162	61	°	°	NNS
10_1101-2021_01_06_425657	162	62	C	C	NNP
10_1101-2021_01_06_425657	162	63	.	.	.
10_1101-2021_01_06_425657	163	1	After	after	IN
10_1101-2021_01_06_425657	163	2	discarding	discard	VBG
10_1101-2021_01_06_425657	163	3	primary	primary	JJ
10_1101-2021_01_06_425657	163	4	antibody	antibody	NN
10_1101-2021_01_06_425657	163	5	,	,	,
10_1101-2021_01_06_425657	163	6	412	412	CD
10_1101-2021_01_06_425657	163	7	membranes	membrane	NNS
10_1101-2021_01_06_425657	163	8	were	be	VBD
10_1101-2021_01_06_425657	163	9	washed	wash	VBN
10_1101-2021_01_06_425657	163	10	3	3	CD
10_1101-2021_01_06_425657	163	11	times	time	NNS
10_1101-2021_01_06_425657	163	12	for	for	IN
10_1101-2021_01_06_425657	163	13	5	5	CD
10_1101-2021_01_06_425657	163	14	min	min	NN
10_1101-2021_01_06_425657	163	15	each	each	DT
10_1101-2021_01_06_425657	163	16	before	before	IN
10_1101-2021_01_06_425657	163	17	incubation	incubation	NN
10_1101-2021_01_06_425657	163	18	with	with	IN
10_1101-2021_01_06_425657	163	19	appropriate	appropriate	JJ
10_1101-2021_01_06_425657	163	20	HRP-413	hrp-413	UH
10_1101-2021_01_06_425657	163	21	conjugated	conjugate	VBN
10_1101-2021_01_06_425657	163	22	secondary	secondary	JJ
10_1101-2021_01_06_425657	163	23	antibody	antibody	NN
10_1101-2021_01_06_425657	163	24	for	for	IN
10_1101-2021_01_06_425657	163	25	1	1	CD
10_1101-2021_01_06_425657	163	26	h	h	NN
10_1101-2021_01_06_425657	163	27	in	in	IN
10_1101-2021_01_06_425657	163	28	5	5	CD
10_1101-2021_01_06_425657	163	29	%	%	NN
10_1101-2021_01_06_425657	163	30	milk	milk	NN
10_1101-2021_01_06_425657	163	31	/	/	SYM
10_1101-2021_01_06_425657	163	32	TBST	TBST	NNP
10_1101-2021_01_06_425657	163	33	.	.	.
10_1101-2021_01_06_425657	164	1	Membranes	Membranes	NNP
10_1101-2021_01_06_425657	164	2	were	be	VBD
10_1101-2021_01_06_425657	164	3	then	then	RB
10_1101-2021_01_06_425657	164	4	washed	wash	VBN
10_1101-2021_01_06_425657	164	5	3	3	CD
10_1101-2021_01_06_425657	164	6	times	time	NNS
10_1101-2021_01_06_425657	164	7	414	414	CD
10_1101-2021_01_06_425657	164	8	for	for	IN
10_1101-2021_01_06_425657	164	9	5	5	CD
10_1101-2021_01_06_425657	164	10	min	min	NN
10_1101-2021_01_06_425657	164	11	each	each	DT
10_1101-2021_01_06_425657	164	12	before	before	IN
10_1101-2021_01_06_425657	164	13	incubating	incubate	VBG
10_1101-2021_01_06_425657	164	14	with	with	IN
10_1101-2021_01_06_425657	164	15	Pierce	Pierce	NNP
10_1101-2021_01_06_425657	164	16	ECL	ECL	NNP
10_1101-2021_01_06_425657	164	17	western	western	JJ
10_1101-2021_01_06_425657	164	18	blotting	blot	VBG
10_1101-2021_01_06_425657	164	19	substrate	substrate	NN
10_1101-2021_01_06_425657	164	20	and	and	CC
10_1101-2021_01_06_425657	164	21	exposing	expose	VBG
10_1101-2021_01_06_425657	164	22	to	to	TO
10_1101-2021_01_06_425657	164	23	film	film	VB
10_1101-2021_01_06_425657	164	24	.	.	.
10_1101-2021_01_06_425657	165	1	415	415	CD
10_1101-2021_01_06_425657	165	2	416	416	CD
10_1101-2021_01_06_425657	165	3	RNA	RNA	NNP
10_1101-2021_01_06_425657	165	4	Extraction	Extraction	NNP
10_1101-2021_01_06_425657	165	5	and	and	CC
10_1101-2021_01_06_425657	165	6	Real	Real	NNP
10_1101-2021_01_06_425657	165	7	Time	Time	NNP
10_1101-2021_01_06_425657	165	8	Quantitative	Quantitative	NNP
10_1101-2021_01_06_425657	165	9	PCR	PCR	NNP
10_1101-2021_01_06_425657	165	10	(	(	-LRB-
10_1101-2021_01_06_425657	165	11	RT	RT	NNP
10_1101-2021_01_06_425657	165	12	-	-	HYPH
10_1101-2021_01_06_425657	165	13	qPCR	qPCR	NNP
10_1101-2021_01_06_425657	165	14	)	)	-RRB-
10_1101-2021_01_06_425657	165	15	Analysis	analysis	NN
10_1101-2021_01_06_425657	165	16	417	417	CD
10_1101-2021_01_06_425657	165	17	RNA	rna	NN
10_1101-2021_01_06_425657	165	18	isolation	isolation	NN
10_1101-2021_01_06_425657	165	19	of	of	IN
10_1101-2021_01_06_425657	165	20	five	five	CD
10_1101-2021_01_06_425657	165	21	OD600	od600	NN
10_1101-2021_01_06_425657	165	22	units	unit	NNS
10_1101-2021_01_06_425657	165	23	of	of	IN
10_1101-2021_01_06_425657	165	24	cells	cell	NNS
10_1101-2021_01_06_425657	165	25	under	under	IN
10_1101-2021_01_06_425657	165	26	different	different	JJ
10_1101-2021_01_06_425657	165	27	growth	growth	NN
10_1101-2021_01_06_425657	165	28	conditions	condition	NNS
10_1101-2021_01_06_425657	165	29	was	be	VBD
10_1101-2021_01_06_425657	165	30	carried	carry	VBN
10_1101-2021_01_06_425657	165	31	out	out	RP
10_1101-2021_01_06_425657	165	32	418	418	CD
10_1101-2021_01_06_425657	165	33	following	follow	VBG
10_1101-2021_01_06_425657	165	34	the	the	DT
10_1101-2021_01_06_425657	165	35	manufacture	manufacture	NN
10_1101-2021_01_06_425657	165	36	manual	manual	NN
10_1101-2021_01_06_425657	165	37	using	use	VBG
10_1101-2021_01_06_425657	165	38	MasterPure	MasterPure	NNP
10_1101-2021_01_06_425657	165	39	yeast	yeast	NN
10_1101-2021_01_06_425657	165	40	RNA	RNA	NNP
10_1101-2021_01_06_425657	165	41	purification	purification	NN
10_1101-2021_01_06_425657	165	42	kit	kit	NN
10_1101-2021_01_06_425657	165	43	(	(	-LRB-
10_1101-2021_01_06_425657	165	44	epicentre	epicentre	NNP
10_1101-2021_01_06_425657	165	45	)	)	-RRB-
10_1101-2021_01_06_425657	165	46	.	.	.
10_1101-2021_01_06_425657	166	1	RNA	RNA	NNP
10_1101-2021_01_06_425657	166	2	419	419	CD
10_1101-2021_01_06_425657	166	3	concentration	concentration	NN
10_1101-2021_01_06_425657	166	4	was	be	VBD
10_1101-2021_01_06_425657	166	5	determined	determine	VBN
10_1101-2021_01_06_425657	166	6	by	by	IN
10_1101-2021_01_06_425657	166	7	absorption	absorption	NN
10_1101-2021_01_06_425657	166	8	spectrometer	spectrometer	NN
10_1101-2021_01_06_425657	166	9	.	.	.
10_1101-2021_01_06_425657	167	1	5	5	CD
10_1101-2021_01_06_425657	167	2	μg	μg	NN
10_1101-2021_01_06_425657	167	3	RNA	RNA	NNP
10_1101-2021_01_06_425657	167	4	was	be	VBD
10_1101-2021_01_06_425657	167	5	reverse	reverse	RB
10_1101-2021_01_06_425657	167	6	transcribed	transcribe	VBN
10_1101-2021_01_06_425657	167	7	to	to	IN
10_1101-2021_01_06_425657	167	8	420	420	CD
10_1101-2021_01_06_425657	167	9	cDNA	cdna	NN
10_1101-2021_01_06_425657	167	10	using	use	VBG
10_1101-2021_01_06_425657	167	11	Superscript	Superscript	NNP
10_1101-2021_01_06_425657	167	12	III	III	NNP
10_1101-2021_01_06_425657	167	13	Reverse	Reverse	NNP
10_1101-2021_01_06_425657	167	14	Transcriptase	Transcriptase	NNP
10_1101-2021_01_06_425657	167	15	from	from	IN
10_1101-2021_01_06_425657	167	16	Invitrogen	Invitrogen	NNP
10_1101-2021_01_06_425657	167	17	.	.	.
10_1101-2021_01_06_425657	168	1	cDNA	cDNA	NNP
10_1101-2021_01_06_425657	168	2	was	be	VBD
10_1101-2021_01_06_425657	168	3	diluted	dilute	VBN
10_1101-2021_01_06_425657	168	4	1:100	1:100	CD
10_1101-2021_01_06_425657	168	5	and	and	CC
10_1101-2021_01_06_425657	168	6	421	421	CD
10_1101-2021_01_06_425657	168	7	real	real	JJ
10_1101-2021_01_06_425657	168	8	-	-	HYPH
10_1101-2021_01_06_425657	168	9	time	time	NN
10_1101-2021_01_06_425657	168	10	PCR	PCR	NNP
10_1101-2021_01_06_425657	168	11	was	be	VBD
10_1101-2021_01_06_425657	168	12	performed	perform	VBN
10_1101-2021_01_06_425657	168	13	in	in	IN
10_1101-2021_01_06_425657	168	14	triplicate	triplicate	NN
10_1101-2021_01_06_425657	168	15	with	with	IN
10_1101-2021_01_06_425657	168	16	iQ	iq	JJ
10_1101-2021_01_06_425657	168	17	SYBR	sybr	JJ
10_1101-2021_01_06_425657	168	18	Green	Green	NNP
10_1101-2021_01_06_425657	168	19	Supermix	Supermix	NNP
10_1101-2021_01_06_425657	168	20	from	from	IN
10_1101-2021_01_06_425657	168	21	BioRad	BioRad	NNP
10_1101-2021_01_06_425657	168	22	.	.	.
10_1101-2021_01_06_425657	169	1	422	422	CD
10_1101-2021_01_06_425657	169	2	Transcripts	Transcripts	NNPS
10_1101-2021_01_06_425657	169	3	levels	level	NNS
10_1101-2021_01_06_425657	169	4	of	of	IN
10_1101-2021_01_06_425657	169	5	genes	gene	NNS
10_1101-2021_01_06_425657	169	6	were	be	VBD
10_1101-2021_01_06_425657	169	7	normalized	normalized	JJ
10_1101-2021_01_06_425657	169	8	to	to	IN
10_1101-2021_01_06_425657	169	9	ACT1	ACT1	NNP
10_1101-2021_01_06_425657	169	10	.	.	.
10_1101-2021_01_06_425657	170	1	All	all	PDT
10_1101-2021_01_06_425657	170	2	the	the	DT
10_1101-2021_01_06_425657	170	3	primers	primer	NNS
10_1101-2021_01_06_425657	170	4	used	use	VBN
10_1101-2021_01_06_425657	170	5	in	in	IN
10_1101-2021_01_06_425657	170	6	RT	RT	NNP
10_1101-2021_01_06_425657	170	7	-	-	HYPH
10_1101-2021_01_06_425657	170	8	qPCR	qPCR	NNP
10_1101-2021_01_06_425657	170	9	have	have	VBP
10_1101-2021_01_06_425657	170	10	423	423	CD
10_1101-2021_01_06_425657	170	11	efficiency	efficiency	NN
10_1101-2021_01_06_425657	170	12	close	close	RB
10_1101-2021_01_06_425657	170	13	to	to	TO
10_1101-2021_01_06_425657	170	14	100	100	CD
10_1101-2021_01_06_425657	170	15	%	%	NN
10_1101-2021_01_06_425657	170	16	,	,	,
10_1101-2021_01_06_425657	170	17	and	and	CC
10_1101-2021_01_06_425657	170	18	their	-PRON-	PRP$
10_1101-2021_01_06_425657	170	19	sequences	sequence	NNS
10_1101-2021_01_06_425657	170	20	are	be	VBP
10_1101-2021_01_06_425657	170	21	listed	list	VBN
10_1101-2021_01_06_425657	170	22	below	below	RB
10_1101-2021_01_06_425657	170	23	.	.	.
10_1101-2021_01_06_425657	171	1	424	424	CD
10_1101-2021_01_06_425657	171	2	425	425	CD
10_1101-2021_01_06_425657	171	3	ACT1_RT_F	act1_rt_f	NN
10_1101-2021_01_06_425657	171	4	TCCGGTGATGGTGTTACTCA	TCCGGTGATGGTGTTACTCA	NNP
10_1101-2021_01_06_425657	171	5	426	426	CD
10_1101-2021_01_06_425657	171	6	ACT1_RT_R	ACT1_RT_R	NNP
10_1101-2021_01_06_425657	171	7	GGCCAAATCGATTCTCAAAA	GGCCAAATCGATTCTCAAAA	NNP
10_1101-2021_01_06_425657	171	8	427	427	CD
10_1101-2021_01_06_425657	171	9	MET17_RT_F	met17_rt_f	NN
10_1101-2021_01_06_425657	171	10	CGGTTTCGGTGGTGTCTTAT	CGGTTTCGGTGGTGTCTTAT	NNP
10_1101-2021_01_06_425657	171	11	428	428	CD
10_1101-2021_01_06_425657	171	12	MET17_RT_R	met17_rt_r	NN
10_1101-2021_01_06_425657	171	13	CAACAACTTGAGCACCAGAAAG	caacaacttgagcaccagaaag	NN
10_1101-2021_01_06_425657	171	14	429	429	CD
10_1101-2021_01_06_425657	171	15	GSH1_RT_F	GSH1_RT_F	NNP
10_1101-2021_01_06_425657	171	16	CACCGATGTGGAAACTGAAGA	CACCGATGTGGAAACTGAAGA	NNP
10_1101-2021_01_06_425657	171	17	430	430	CD
10_1101-2021_01_06_425657	171	18	GSH1_RT_R	gsh1_rt_r	NN
10_1101-2021_01_06_425657	171	19	GGCATAGGATTGGCGTAACA	GGCATAGGATTGGCGTAACA	NNP
10_1101-2021_01_06_425657	171	20	431	431	CD
10_1101-2021_01_06_425657	171	21	SAM1_RT_F	SAM1_RT_F	NNP
10_1101-2021_01_06_425657	171	22	CAGAGGGTTTGCCTTTGACTA	CAGAGGGTTTGCCTTTGACTA	NNP
10_1101-2021_01_06_425657	171	23	432	432	CD
10_1101-2021_01_06_425657	171	24	SAM1_RT_R	sam1_rt_r	CD
10_1101-2021_01_06_425657	171	25	CTGGTCTCAACCACGCTAAA	CTGGTCTCAACCACGCTAAA	NNP
10_1101-2021_01_06_425657	171	26	433	433	CD
10_1101-2021_01_06_425657	171	27	434	434	CD
10_1101-2021_01_06_425657	171	28	Metabolite	metabolite	JJ
10_1101-2021_01_06_425657	171	29	extraction	extraction	NN
10_1101-2021_01_06_425657	171	30	and	and	CC
10_1101-2021_01_06_425657	171	31	quantitation	quantitation	NN
10_1101-2021_01_06_425657	171	32	435	435	CD
10_1101-2021_01_06_425657	171	33	Intracellular	intracellular	JJ
10_1101-2021_01_06_425657	171	34	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	171	35	were	be	VBD
10_1101-2021_01_06_425657	171	36	extracted	extract	VBN
10_1101-2021_01_06_425657	171	37	from	from	IN
10_1101-2021_01_06_425657	171	38	yeast	yeast	NN
10_1101-2021_01_06_425657	171	39	using	use	VBG
10_1101-2021_01_06_425657	171	40	a	a	DT
10_1101-2021_01_06_425657	171	41	previous	previous	JJ
10_1101-2021_01_06_425657	171	42	established	establish	VBN
10_1101-2021_01_06_425657	171	43	method	method	NN
10_1101-2021_01_06_425657	171	44	(	(	-LRB-
10_1101-2021_01_06_425657	171	45	Tu	Tu	NNP
10_1101-2021_01_06_425657	171	46	et	et	NNP
10_1101-2021_01_06_425657	171	47	al	al	NNP
10_1101-2021_01_06_425657	171	48	.	.	NNP
10_1101-2021_01_06_425657	171	49	,	,	,
10_1101-2021_01_06_425657	171	50	436	436	CD
10_1101-2021_01_06_425657	171	51	2007	2007	CD
10_1101-2021_01_06_425657	171	52	)	)	-RRB-
10_1101-2021_01_06_425657	171	53	.	.	.
10_1101-2021_01_06_425657	172	1	Briefly	briefly	RB
10_1101-2021_01_06_425657	172	2	,	,	,
10_1101-2021_01_06_425657	172	3	at	at	IN
10_1101-2021_01_06_425657	172	4	each	each	DT
10_1101-2021_01_06_425657	172	5	time	time	NN
10_1101-2021_01_06_425657	172	6	point	point	NN
10_1101-2021_01_06_425657	172	7	,	,	,
10_1101-2021_01_06_425657	172	8	~12.5	~12.5	NFP
10_1101-2021_01_06_425657	172	9	OD600	od600	NN
10_1101-2021_01_06_425657	172	10	units	unit	NNS
10_1101-2021_01_06_425657	172	11	of	of	IN
10_1101-2021_01_06_425657	172	12	cells	cell	NNS
10_1101-2021_01_06_425657	172	13	were	be	VBD
10_1101-2021_01_06_425657	172	14	rapidly	rapidly	RB
10_1101-2021_01_06_425657	172	15	quenched	quench	VBN
10_1101-2021_01_06_425657	172	16	to	to	TO
10_1101-2021_01_06_425657	172	17	stop	stop	VB
10_1101-2021_01_06_425657	172	18	437	437	CD
10_1101-2021_01_06_425657	172	19	metabolism	metabolism	NN
10_1101-2021_01_06_425657	172	20	by	by	IN
10_1101-2021_01_06_425657	172	21	addition	addition	NN
10_1101-2021_01_06_425657	172	22	into	into	IN
10_1101-2021_01_06_425657	172	23	37.5	37.5	CD
10_1101-2021_01_06_425657	172	24	mL	mL	NNP
10_1101-2021_01_06_425657	172	25	quenching	quenching	NN
10_1101-2021_01_06_425657	172	26	buffer	buffer	NN
10_1101-2021_01_06_425657	172	27	containing	contain	VBG
10_1101-2021_01_06_425657	172	28	60	60	CD
10_1101-2021_01_06_425657	172	29	%	%	NN
10_1101-2021_01_06_425657	172	30	methanol	methanol	NN
10_1101-2021_01_06_425657	172	31	and	and	CC
10_1101-2021_01_06_425657	172	32	10	10	CD
10_1101-2021_01_06_425657	172	33	mM	mM	NNP
10_1101-2021_01_06_425657	172	34	438	438	CD
10_1101-2021_01_06_425657	172	35	Tricine	Tricine	NNP
10_1101-2021_01_06_425657	172	36	,	,	,
10_1101-2021_01_06_425657	172	37	pH	pH	NNP
10_1101-2021_01_06_425657	172	38	7.4	7.4	CD
10_1101-2021_01_06_425657	172	39	.	.	.
10_1101-2021_01_06_425657	173	1	After	after	IN
10_1101-2021_01_06_425657	173	2	holding	hold	VBG
10_1101-2021_01_06_425657	173	3	at	at	IN
10_1101-2021_01_06_425657	173	4	-40	-40	NNP
10_1101-2021_01_06_425657	173	5	°	°	NNP
10_1101-2021_01_06_425657	173	6	C	C	NNP
10_1101-2021_01_06_425657	173	7	for	for	IN
10_1101-2021_01_06_425657	173	8	at	at	RB
10_1101-2021_01_06_425657	173	9	least	least	JJS
10_1101-2021_01_06_425657	173	10	3	3	CD
10_1101-2021_01_06_425657	173	11	min	min	NN
10_1101-2021_01_06_425657	173	12	,	,	,
10_1101-2021_01_06_425657	173	13	cells	cell	NNS
10_1101-2021_01_06_425657	173	14	were	be	VBD
10_1101-2021_01_06_425657	173	15	spun	spin	VBN
10_1101-2021_01_06_425657	173	16	at	at	IN
10_1101-2021_01_06_425657	173	17	5,000xg	5,000xg	CD
10_1101-2021_01_06_425657	173	18	for	for	IN
10_1101-2021_01_06_425657	173	19	2	2	CD
10_1101-2021_01_06_425657	173	20	min	min	NN
10_1101-2021_01_06_425657	173	21	at	at	IN
10_1101-2021_01_06_425657	173	22	439	439	CD
10_1101-2021_01_06_425657	173	23	0	0	CD
10_1101-2021_01_06_425657	173	24	°	°	,
10_1101-2021_01_06_425657	173	25	C	C	NNP
10_1101-2021_01_06_425657	173	26	,	,	,
10_1101-2021_01_06_425657	173	27	washed	wash	VBD
10_1101-2021_01_06_425657	173	28	with	with	IN
10_1101-2021_01_06_425657	173	29	1	1	CD
10_1101-2021_01_06_425657	173	30	mL	ml	NN
10_1101-2021_01_06_425657	173	31	of	of	IN
10_1101-2021_01_06_425657	173	32	the	the	DT
10_1101-2021_01_06_425657	173	33	same	same	JJ
10_1101-2021_01_06_425657	173	34	buffer	buffer	NN
10_1101-2021_01_06_425657	173	35	,	,	,
10_1101-2021_01_06_425657	173	36	and	and	CC
10_1101-2021_01_06_425657	173	37	then	then	RB
10_1101-2021_01_06_425657	173	38	resuspended	resuspend	VBD
10_1101-2021_01_06_425657	173	39	in	in	IN
10_1101-2021_01_06_425657	173	40	1	1	CD
10_1101-2021_01_06_425657	173	41	mL	mL	NNP
10_1101-2021_01_06_425657	173	42	extraction	extraction	NN
10_1101-2021_01_06_425657	173	43	buffer	buffer	NN
10_1101-2021_01_06_425657	173	44	440	440	CD
10_1101-2021_01_06_425657	173	45	containing	contain	VBG
10_1101-2021_01_06_425657	173	46	75	75	CD
10_1101-2021_01_06_425657	173	47	%	%	NN
10_1101-2021_01_06_425657	173	48	ethanol	ethanol	NN
10_1101-2021_01_06_425657	173	49	and	and	CC
10_1101-2021_01_06_425657	173	50	0.1	0.1	CD
10_1101-2021_01_06_425657	173	51	%	%	NN
10_1101-2021_01_06_425657	173	52	formic	formic	NN
10_1101-2021_01_06_425657	173	53	acid	acid	NN
10_1101-2021_01_06_425657	173	54	.	.	.
10_1101-2021_01_06_425657	174	1	Intracellular	intracellular	JJ
10_1101-2021_01_06_425657	174	2	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	174	3	were	be	VBD
10_1101-2021_01_06_425657	174	4	extracted	extract	VBN
10_1101-2021_01_06_425657	174	5	by	by	IN
10_1101-2021_01_06_425657	174	6	441	441	CD
10_1101-2021_01_06_425657	174	7	incubating	incubate	VBG
10_1101-2021_01_06_425657	174	8	at	at	IN
10_1101-2021_01_06_425657	174	9	75	75	CD
10_1101-2021_01_06_425657	174	10	°	°	,
10_1101-2021_01_06_425657	174	11	C	C	NNP
10_1101-2021_01_06_425657	174	12	for	for	IN
10_1101-2021_01_06_425657	174	13	3	3	CD
10_1101-2021_01_06_425657	174	14	min	min	NN
10_1101-2021_01_06_425657	174	15	,	,	,
10_1101-2021_01_06_425657	174	16	followed	follow	VBN
10_1101-2021_01_06_425657	174	17	by	by	IN
10_1101-2021_01_06_425657	174	18	incubation	incubation	NN
10_1101-2021_01_06_425657	174	19	at	at	IN
10_1101-2021_01_06_425657	174	20	4	4	CD
10_1101-2021_01_06_425657	174	21	°	°	,
10_1101-2021_01_06_425657	174	22	C	C	NNP
10_1101-2021_01_06_425657	174	23	for	for	IN
10_1101-2021_01_06_425657	174	24	5	5	CD
10_1101-2021_01_06_425657	174	25	min	min	NN
10_1101-2021_01_06_425657	174	26	.	.	.
10_1101-2021_01_06_425657	175	1	Samples	sample	NNS
10_1101-2021_01_06_425657	175	2	were	be	VBD
10_1101-2021_01_06_425657	175	3	spun	spin	VBN
10_1101-2021_01_06_425657	175	4	at	at	IN
10_1101-2021_01_06_425657	175	5	442	442	CD
10_1101-2021_01_06_425657	175	6	20,000xg	20,000xg	CD
10_1101-2021_01_06_425657	175	7	for	for	IN
10_1101-2021_01_06_425657	175	8	1	1	CD
10_1101-2021_01_06_425657	175	9	min	min	NN
10_1101-2021_01_06_425657	175	10	to	to	IN
10_1101-2021_01_06_425657	175	11	pellet	pellet	NNP
10_1101-2021_01_06_425657	175	12	cell	cell	NN
10_1101-2021_01_06_425657	175	13	debris	debris	NN
10_1101-2021_01_06_425657	175	14	,	,	,
10_1101-2021_01_06_425657	175	15	and	and	CC
10_1101-2021_01_06_425657	175	16	0.9	0.9	CD
10_1101-2021_01_06_425657	175	17	mL	ml	NN
10_1101-2021_01_06_425657	175	18	of	of	IN
10_1101-2021_01_06_425657	175	19	the	the	DT
10_1101-2021_01_06_425657	175	20	supernatant	supernatant	JJ
10_1101-2021_01_06_425657	175	21	was	be	VBD
10_1101-2021_01_06_425657	175	22	transferred	transfer	VBN
10_1101-2021_01_06_425657	175	23	to	to	IN
10_1101-2021_01_06_425657	175	24	a	a	DT
10_1101-2021_01_06_425657	175	25	new	new	JJ
10_1101-2021_01_06_425657	175	26	443	443	CD
10_1101-2021_01_06_425657	175	27	tube	tube	NN
10_1101-2021_01_06_425657	175	28	.	.	.
10_1101-2021_01_06_425657	176	1	After	after	IN
10_1101-2021_01_06_425657	176	2	a	a	DT
10_1101-2021_01_06_425657	176	3	second	second	JJ
10_1101-2021_01_06_425657	176	4	spin	spin	NN
10_1101-2021_01_06_425657	176	5	at	at	IN
10_1101-2021_01_06_425657	176	6	20,000xg	20,000xg	CD
10_1101-2021_01_06_425657	176	7	for	for	IN
10_1101-2021_01_06_425657	176	8	10	10	CD
10_1101-2021_01_06_425657	176	9	min	min	NN
10_1101-2021_01_06_425657	176	10	,	,	,
10_1101-2021_01_06_425657	176	11	0.8	0.8	CD
10_1101-2021_01_06_425657	176	12	mL	ml	NN
10_1101-2021_01_06_425657	176	13	of	of	IN
10_1101-2021_01_06_425657	176	14	the	the	DT
10_1101-2021_01_06_425657	176	15	supernatant	supernatant	JJ
10_1101-2021_01_06_425657	176	16	was	be	VBD
10_1101-2021_01_06_425657	176	17	transferred	transfer	VBN
10_1101-2021_01_06_425657	176	18	to	to	IN
10_1101-2021_01_06_425657	176	19	a	a	DT
10_1101-2021_01_06_425657	176	20	444	444	CD
10_1101-2021_01_06_425657	176	21	new	new	JJ
10_1101-2021_01_06_425657	176	22	tube	tube	NN
10_1101-2021_01_06_425657	176	23	.	.	.
10_1101-2021_01_06_425657	177	1	Metabolites	metabolite	NNS
10_1101-2021_01_06_425657	177	2	in	in	IN
10_1101-2021_01_06_425657	177	3	the	the	DT
10_1101-2021_01_06_425657	177	4	extraction	extraction	NN
10_1101-2021_01_06_425657	177	5	buffer	buffer	NN
10_1101-2021_01_06_425657	177	6	were	be	VBD
10_1101-2021_01_06_425657	177	7	dried	dry	VBN
10_1101-2021_01_06_425657	177	8	using	use	VBG
10_1101-2021_01_06_425657	177	9	SpeedVac	SpeedVac	NNP
10_1101-2021_01_06_425657	177	10	and	and	CC
10_1101-2021_01_06_425657	177	11	stored	store	VBN
10_1101-2021_01_06_425657	177	12	at	at	IN
10_1101-2021_01_06_425657	177	13	−80	−80	NNP
10_1101-2021_01_06_425657	177	14	°	°	,
10_1101-2021_01_06_425657	177	15	C	C	NNP
10_1101-2021_01_06_425657	177	16	445	445	CD
10_1101-2021_01_06_425657	177	17	until	until	IN
10_1101-2021_01_06_425657	177	18	analysis	analysis	NN
10_1101-2021_01_06_425657	177	19	.	.	.
10_1101-2021_01_06_425657	178	1	Methionine	Methionine	NNP
10_1101-2021_01_06_425657	178	2	,	,	,
10_1101-2021_01_06_425657	178	3	SAM	SAM	NNP
10_1101-2021_01_06_425657	178	4	,	,	,
10_1101-2021_01_06_425657	178	5	SAH	SAH	NNP
10_1101-2021_01_06_425657	178	6	,	,	,
10_1101-2021_01_06_425657	178	7	cysteine	cysteine	NN
10_1101-2021_01_06_425657	178	8	,	,	,
10_1101-2021_01_06_425657	178	9	GSH	GSH	NNP
10_1101-2021_01_06_425657	178	10	and	and	CC
10_1101-2021_01_06_425657	178	11	other	other	JJ
10_1101-2021_01_06_425657	178	12	cellular	cellular	JJ
10_1101-2021_01_06_425657	178	13	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	178	14	were	be	VBD
10_1101-2021_01_06_425657	178	15	446	446	CD
10_1101-2021_01_06_425657	178	16	quantitated	quantitate	VBN
10_1101-2021_01_06_425657	178	17	by	by	IN
10_1101-2021_01_06_425657	178	18	LC	LC	NNP
10_1101-2021_01_06_425657	178	19	-	-	HYPH
10_1101-2021_01_06_425657	178	20	MS	MS	NNP
10_1101-2021_01_06_425657	178	21	/	/	SYM
10_1101-2021_01_06_425657	178	22	MS	MS	NNP
10_1101-2021_01_06_425657	178	23	with	with	IN
10_1101-2021_01_06_425657	178	24	a	a	DT
10_1101-2021_01_06_425657	178	25	triple	triple	JJ
10_1101-2021_01_06_425657	178	26	quadrupole	quadrupole	JJ
10_1101-2021_01_06_425657	178	27	mass	mass	NN
10_1101-2021_01_06_425657	178	28	spectrometer	spectrometer	NN
10_1101-2021_01_06_425657	178	29	(	(	-LRB-
10_1101-2021_01_06_425657	178	30	3200	3200	CD
10_1101-2021_01_06_425657	178	31	QTRAP	QTRAP	NNP
10_1101-2021_01_06_425657	178	32	,	,	,
10_1101-2021_01_06_425657	178	33	AB	AB	NNP
10_1101-2021_01_06_425657	178	34	SCIEX	SCIEX	NNP
10_1101-2021_01_06_425657	178	35	)	)	-RRB-
10_1101-2021_01_06_425657	178	36	447	447	CD
10_1101-2021_01_06_425657	178	37	using	use	VBG
10_1101-2021_01_06_425657	178	38	previously	previously	RB
10_1101-2021_01_06_425657	178	39	established	establish	VBN
10_1101-2021_01_06_425657	178	40	methods	method	NNS
10_1101-2021_01_06_425657	178	41	(	(	-LRB-
10_1101-2021_01_06_425657	178	42	Tu	Tu	NNP
10_1101-2021_01_06_425657	178	43	et	et	NNP
10_1101-2021_01_06_425657	178	44	al	al	NNP
10_1101-2021_01_06_425657	178	45	.	.	NNP
10_1101-2021_01_06_425657	178	46	,	,	,
10_1101-2021_01_06_425657	178	47	2007	2007	CD
10_1101-2021_01_06_425657	178	48	)	)	-RRB-
10_1101-2021_01_06_425657	178	49	.	.	.
10_1101-2021_01_06_425657	179	1	Briefly	briefly	RB
10_1101-2021_01_06_425657	179	2	,	,	,
10_1101-2021_01_06_425657	179	3	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	179	4	were	be	VBD
10_1101-2021_01_06_425657	179	5	separated	separate	VBN
10_1101-2021_01_06_425657	179	6	448	448	CD
10_1101-2021_01_06_425657	179	7	chromatographically	chromatographically	RB
10_1101-2021_01_06_425657	179	8	on	on	IN
10_1101-2021_01_06_425657	179	9	a	a	DT
10_1101-2021_01_06_425657	179	10	C18-based	C18-based	NNP
10_1101-2021_01_06_425657	179	11	column	column	NN
10_1101-2021_01_06_425657	179	12	with	with	IN
10_1101-2021_01_06_425657	179	13	polar	polar	JJ
10_1101-2021_01_06_425657	179	14	embedded	embed	VBN
10_1101-2021_01_06_425657	179	15	groups	group	NNS
10_1101-2021_01_06_425657	179	16	(	(	-LRB-
10_1101-2021_01_06_425657	179	17	Synergi	Synergi	NNP
10_1101-2021_01_06_425657	179	18	Fusion	Fusion	NNP
10_1101-2021_01_06_425657	179	19	-	-	HYPH
10_1101-2021_01_06_425657	179	20	RP	RP	NNP
10_1101-2021_01_06_425657	179	21	,	,	,
10_1101-2021_01_06_425657	179	22	449	449	CD
10_1101-2021_01_06_425657	179	23	150	150	CD
10_1101-2021_01_06_425657	179	24	3	3	CD
10_1101-2021_01_06_425657	179	25	2.00	2.00	CD
10_1101-2021_01_06_425657	179	26	mm	mm	CD
10_1101-2021_01_06_425657	179	27	4	4	CD
10_1101-2021_01_06_425657	179	28	micron	micron	NNP
10_1101-2021_01_06_425657	179	29	,	,	,
10_1101-2021_01_06_425657	179	30	Phenomenex	Phenomenex	NNP
10_1101-2021_01_06_425657	179	31	)	)	-RRB-
10_1101-2021_01_06_425657	179	32	,	,	,
10_1101-2021_01_06_425657	179	33	using	use	VBG
10_1101-2021_01_06_425657	179	34	a	a	DT
10_1101-2021_01_06_425657	179	35	Shimadzu	Shimadzu	NNP
10_1101-2021_01_06_425657	179	36	Prominence	Prominence	NNP
10_1101-2021_01_06_425657	179	37	LC20	LC20	NNP
10_1101-2021_01_06_425657	179	38	/	/	SYM
10_1101-2021_01_06_425657	179	39	SIL-20AC	SIL-20AC	NNP
10_1101-2021_01_06_425657	179	40	HPLC-450	HPLC-450	NNP
10_1101-2021_01_06_425657	179	41	autosampler	autosampler	NN
10_1101-2021_01_06_425657	179	42	coupled	couple	VBN
10_1101-2021_01_06_425657	179	43	to	to	IN
10_1101-2021_01_06_425657	179	44	the	the	DT
10_1101-2021_01_06_425657	179	45	mass	mass	NN
10_1101-2021_01_06_425657	179	46	spectrometer	spectrometer	NN
10_1101-2021_01_06_425657	179	47	.	.	.
10_1101-2021_01_06_425657	180	1	Flow	flow	NN
10_1101-2021_01_06_425657	180	2	rate	rate	NN
10_1101-2021_01_06_425657	180	3	was	be	VBD
10_1101-2021_01_06_425657	180	4	0.5	0.5	CD
10_1101-2021_01_06_425657	180	5	ml	ml	NN
10_1101-2021_01_06_425657	180	6	/	/	SYM
10_1101-2021_01_06_425657	180	7	min	min	NN
10_1101-2021_01_06_425657	180	8	using	use	VBG
10_1101-2021_01_06_425657	180	9	the	the	DT
10_1101-2021_01_06_425657	180	10	following	follow	VBG
10_1101-2021_01_06_425657	180	11	451	451	CD
10_1101-2021_01_06_425657	180	12	.CC	.CC	,
10_1101-2021_01_06_425657	180	13	-	-	:
10_1101-2021_01_06_425657	180	14	BY	by	IN
10_1101-2021_01_06_425657	180	15	4.0	4.0	CD
10_1101-2021_01_06_425657	180	16	International	International	NNP
10_1101-2021_01_06_425657	180	17	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	180	18	under	under	IN
10_1101-2021_01_06_425657	180	19	a	a	DT
10_1101-2021_01_06_425657	180	20	(	(	-LRB-
10_1101-2021_01_06_425657	180	21	which	which	WDT
10_1101-2021_01_06_425657	180	22	was	be	VBD
10_1101-2021_01_06_425657	180	23	not	not	RB
10_1101-2021_01_06_425657	180	24	certified	certify	VBN
10_1101-2021_01_06_425657	180	25	by	by	IN
10_1101-2021_01_06_425657	180	26	peer	peer	NN
10_1101-2021_01_06_425657	180	27	review	review	NN
10_1101-2021_01_06_425657	180	28	)	)	-RRB-
10_1101-2021_01_06_425657	180	29	is	be	VBZ
10_1101-2021_01_06_425657	180	30	the	the	DT
10_1101-2021_01_06_425657	180	31	author	author	NN
10_1101-2021_01_06_425657	180	32	/	/	SYM
10_1101-2021_01_06_425657	180	33	funder	funder	NN
10_1101-2021_01_06_425657	180	34	,	,	,
10_1101-2021_01_06_425657	180	35	who	who	WP
10_1101-2021_01_06_425657	180	36	has	have	VBZ
10_1101-2021_01_06_425657	180	37	granted	grant	VBN
10_1101-2021_01_06_425657	180	38	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	180	39	a	a	DT
10_1101-2021_01_06_425657	180	40	license	license	NN
10_1101-2021_01_06_425657	180	41	to	to	TO
10_1101-2021_01_06_425657	180	42	display	display	VB
10_1101-2021_01_06_425657	180	43	the	the	DT
10_1101-2021_01_06_425657	180	44	preprint	preprint	NN
10_1101-2021_01_06_425657	180	45	in	in	IN
10_1101-2021_01_06_425657	180	46	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	180	47	.	.	.
10_1101-2021_01_06_425657	181	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	181	2	is	be	VBZ
10_1101-2021_01_06_425657	181	3	made	make	VBN
10_1101-2021_01_06_425657	181	4	The	the	DT
10_1101-2021_01_06_425657	181	5	copyright	copyright	NN
10_1101-2021_01_06_425657	181	6	holder	holder	NN
10_1101-2021_01_06_425657	181	7	for	for	IN
10_1101-2021_01_06_425657	181	8	this	this	DT
10_1101-2021_01_06_425657	181	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	181	10	version	version	NN
10_1101-2021_01_06_425657	181	11	posted	post	VBD
10_1101-2021_01_06_425657	181	12	January	January	NNP
10_1101-2021_01_06_425657	181	13	7	7	CD
10_1101-2021_01_06_425657	181	14	,	,	,
10_1101-2021_01_06_425657	181	15	2021	2021	CD
10_1101-2021_01_06_425657	181	16	.	.	.
10_1101-2021_01_06_425657	181	17	;	;	:
10_1101-2021_01_06_425657	181	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	181	19	:	:	:
10_1101-2021_01_06_425657	181	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	181	21	preprint	preprint	NN
10_1101-2021_01_06_425657	181	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	181	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	181	24	13	13	CD
10_1101-2021_01_06_425657	181	25	method	method	NN
10_1101-2021_01_06_425657	181	26	:	:	:
10_1101-2021_01_06_425657	181	27	Buffer	Buffer	NNP
10_1101-2021_01_06_425657	181	28	A	a	NN
10_1101-2021_01_06_425657	181	29	:	:	:
10_1101-2021_01_06_425657	181	30	99.9	99.9	CD
10_1101-2021_01_06_425657	181	31	%	%	NN
10_1101-2021_01_06_425657	181	32	H2O/0.1	h2o/0.1	NN
10_1101-2021_01_06_425657	181	33	%	%	NN
10_1101-2021_01_06_425657	181	34	formic	formic	NN
10_1101-2021_01_06_425657	181	35	acid	acid	NN
10_1101-2021_01_06_425657	181	36	,	,	,
10_1101-2021_01_06_425657	181	37	Buffer	Buffer	NNP
10_1101-2021_01_06_425657	181	38	B	B	NNP
10_1101-2021_01_06_425657	181	39	:	:	:
10_1101-2021_01_06_425657	181	40	99.9	99.9	CD
10_1101-2021_01_06_425657	181	41	%	%	NN
10_1101-2021_01_06_425657	181	42	methanol	methanol	NN
10_1101-2021_01_06_425657	181	43	/0.1	/0.1	.
10_1101-2021_01_06_425657	181	44	%	%	NN
10_1101-2021_01_06_425657	181	45	formic	formic	NN
10_1101-2021_01_06_425657	181	46	acid	acid	NN
10_1101-2021_01_06_425657	181	47	.	.	.
10_1101-2021_01_06_425657	182	1	T	T	NNP
10_1101-2021_01_06_425657	182	2	452	452	CD
10_1101-2021_01_06_425657	182	3	=	=	SYM
10_1101-2021_01_06_425657	182	4	0	0	CD
10_1101-2021_01_06_425657	182	5	min	min	NN
10_1101-2021_01_06_425657	182	6	,	,	,
10_1101-2021_01_06_425657	182	7	0	0	CD
10_1101-2021_01_06_425657	182	8	%	%	NN
10_1101-2021_01_06_425657	182	9	B	b	NN
10_1101-2021_01_06_425657	182	10	;	;	:
10_1101-2021_01_06_425657	182	11	T	T	NNP
10_1101-2021_01_06_425657	182	12	=	=	SYM
10_1101-2021_01_06_425657	182	13	4	4	CD
10_1101-2021_01_06_425657	182	14	min	min	NN
10_1101-2021_01_06_425657	182	15	,	,	,
10_1101-2021_01_06_425657	182	16	0	0	CD
10_1101-2021_01_06_425657	182	17	%	%	NN
10_1101-2021_01_06_425657	182	18	B	b	NN
10_1101-2021_01_06_425657	182	19	;	;	:
10_1101-2021_01_06_425657	182	20	T	T	NNP
10_1101-2021_01_06_425657	182	21	=	=	SYM
10_1101-2021_01_06_425657	182	22	11	11	CD
10_1101-2021_01_06_425657	182	23	min	min	NN
10_1101-2021_01_06_425657	182	24	,	,	,
10_1101-2021_01_06_425657	182	25	50	50	CD
10_1101-2021_01_06_425657	182	26	%	%	NN
10_1101-2021_01_06_425657	182	27	B	b	NN
10_1101-2021_01_06_425657	182	28	;	;	:
10_1101-2021_01_06_425657	182	29	T	T	NNP
10_1101-2021_01_06_425657	182	30	=	=	SYM
10_1101-2021_01_06_425657	182	31	13	13	CD
10_1101-2021_01_06_425657	182	32	min	min	NN
10_1101-2021_01_06_425657	182	33	,	,	,
10_1101-2021_01_06_425657	182	34	100	100	CD
10_1101-2021_01_06_425657	182	35	%	%	NN
10_1101-2021_01_06_425657	182	36	B	b	NN
10_1101-2021_01_06_425657	182	37	;	;	:
10_1101-2021_01_06_425657	182	38	T	T	NNP
10_1101-2021_01_06_425657	182	39	=	=	SYM
10_1101-2021_01_06_425657	182	40	15	15	CD
10_1101-2021_01_06_425657	182	41	min	min	NN
10_1101-2021_01_06_425657	182	42	,	,	,
10_1101-2021_01_06_425657	182	43	100	100	CD
10_1101-2021_01_06_425657	182	44	%	%	NN
10_1101-2021_01_06_425657	182	45	B	b	NN
10_1101-2021_01_06_425657	182	46	,	,	,
10_1101-2021_01_06_425657	182	47	453	453	CD
10_1101-2021_01_06_425657	182	48	T	t	NN
10_1101-2021_01_06_425657	182	49	=	=	SYM
10_1101-2021_01_06_425657	182	50	16	16	CD
10_1101-2021_01_06_425657	182	51	min	min	NN
10_1101-2021_01_06_425657	182	52	,	,	,
10_1101-2021_01_06_425657	182	53	0	0	CD
10_1101-2021_01_06_425657	182	54	%	%	NN
10_1101-2021_01_06_425657	182	55	B	b	NN
10_1101-2021_01_06_425657	182	56	;	;	:
10_1101-2021_01_06_425657	182	57	T	T	NNP
10_1101-2021_01_06_425657	182	58	=	=	SYM
10_1101-2021_01_06_425657	182	59	20	20	CD
10_1101-2021_01_06_425657	182	60	min	min	NN
10_1101-2021_01_06_425657	182	61	,	,	,
10_1101-2021_01_06_425657	182	62	stop	stop	VB
10_1101-2021_01_06_425657	182	63	.	.	.
10_1101-2021_01_06_425657	183	1	For	for	IN
10_1101-2021_01_06_425657	183	2	each	each	DT
10_1101-2021_01_06_425657	183	3	metabolite	metabolite	NN
10_1101-2021_01_06_425657	183	4	,	,	,
10_1101-2021_01_06_425657	183	5	a	a	DT
10_1101-2021_01_06_425657	183	6	1	1	CD
10_1101-2021_01_06_425657	183	7	mM	mm	NN
10_1101-2021_01_06_425657	183	8	standard	standard	JJ
10_1101-2021_01_06_425657	183	9	solution	solution	NN
10_1101-2021_01_06_425657	183	10	was	be	VBD
10_1101-2021_01_06_425657	183	11	infused	infuse	VBN
10_1101-2021_01_06_425657	183	12	454	454	CD
10_1101-2021_01_06_425657	183	13	into	into	IN
10_1101-2021_01_06_425657	183	14	a	a	DT
10_1101-2021_01_06_425657	183	15	Applied	Applied	NNP
10_1101-2021_01_06_425657	183	16	Biosystems	Biosystems	NNP
10_1101-2021_01_06_425657	183	17	3200	3200	CD
10_1101-2021_01_06_425657	183	18	QTRAP	QTRAP	NNP
10_1101-2021_01_06_425657	183	19	triple	triple	JJ
10_1101-2021_01_06_425657	183	20	quadrupole	quadrupole	NN
10_1101-2021_01_06_425657	183	21	-	-	HYPH
10_1101-2021_01_06_425657	183	22	linear	linear	JJ
10_1101-2021_01_06_425657	183	23	ion	ion	NN
10_1101-2021_01_06_425657	183	24	trap	trap	NN
10_1101-2021_01_06_425657	183	25	mass	mass	NN
10_1101-2021_01_06_425657	183	26	spectrometer	spectrometer	NN
10_1101-2021_01_06_425657	183	27	for	for	IN
10_1101-2021_01_06_425657	183	28	455	455	CD
10_1101-2021_01_06_425657	183	29	quantitative	quantitative	JJ
10_1101-2021_01_06_425657	183	30	optimization	optimization	NN
10_1101-2021_01_06_425657	183	31	detection	detection	NN
10_1101-2021_01_06_425657	183	32	of	of	IN
10_1101-2021_01_06_425657	183	33	daughter	daughter	NN
10_1101-2021_01_06_425657	183	34	ions	ion	NNS
10_1101-2021_01_06_425657	183	35	upon	upon	IN
10_1101-2021_01_06_425657	183	36	collision	collision	NN
10_1101-2021_01_06_425657	183	37	-	-	HYPH
10_1101-2021_01_06_425657	183	38	induced	induce	VBN
10_1101-2021_01_06_425657	183	39	fragmentation	fragmentation	NN
10_1101-2021_01_06_425657	183	40	of	of	IN
10_1101-2021_01_06_425657	183	41	the	the	DT
10_1101-2021_01_06_425657	183	42	456	456	CD
10_1101-2021_01_06_425657	183	43	parent	parent	NN
10_1101-2021_01_06_425657	183	44	ion	ion	NN
10_1101-2021_01_06_425657	183	45	[	[	-LRB-
10_1101-2021_01_06_425657	183	46	multiple	multiple	JJ
10_1101-2021_01_06_425657	183	47	reaction	reaction	NN
10_1101-2021_01_06_425657	183	48	monitoring	monitoring	NN
10_1101-2021_01_06_425657	183	49	(	(	-LRB-
10_1101-2021_01_06_425657	183	50	MRM	MRM	NNP
10_1101-2021_01_06_425657	183	51	)	)	-RRB-
10_1101-2021_01_06_425657	183	52	]	]	-RRB-
10_1101-2021_01_06_425657	183	53	.	.	.
10_1101-2021_01_06_425657	184	1	The	the	DT
10_1101-2021_01_06_425657	184	2	parent	parent	NN
10_1101-2021_01_06_425657	184	3	ion	ion	NN
10_1101-2021_01_06_425657	184	4	mass	mass	NN
10_1101-2021_01_06_425657	184	5	was	be	VBD
10_1101-2021_01_06_425657	184	6	scanned	scan	VBN
10_1101-2021_01_06_425657	184	7	for	for	IN
10_1101-2021_01_06_425657	184	8	first	first	JJ
10_1101-2021_01_06_425657	184	9	in	in	IN
10_1101-2021_01_06_425657	184	10	457	457	CD
10_1101-2021_01_06_425657	184	11	positive	positive	JJ
10_1101-2021_01_06_425657	184	12	mode	mode	NN
10_1101-2021_01_06_425657	184	13	(	(	-LRB-
10_1101-2021_01_06_425657	184	14	usually	usually	RB
10_1101-2021_01_06_425657	184	15	MW	MW	NNP
10_1101-2021_01_06_425657	184	16	+	+	SYM
10_1101-2021_01_06_425657	184	17	1	1	CD
10_1101-2021_01_06_425657	184	18	)	)	-RRB-
10_1101-2021_01_06_425657	184	19	.	.	.
10_1101-2021_01_06_425657	185	1	For	for	IN
10_1101-2021_01_06_425657	185	2	each	each	DT
10_1101-2021_01_06_425657	185	3	metabolite	metabolite	NN
10_1101-2021_01_06_425657	185	4	,	,	,
10_1101-2021_01_06_425657	185	5	the	the	DT
10_1101-2021_01_06_425657	185	6	optimized	optimize	VBN
10_1101-2021_01_06_425657	185	7	parameters	parameter	NNS
10_1101-2021_01_06_425657	185	8	for	for	IN
10_1101-2021_01_06_425657	185	9	quantitation	quantitation	NN
10_1101-2021_01_06_425657	185	10	458	458	CD
10_1101-2021_01_06_425657	185	11	of	of	IN
10_1101-2021_01_06_425657	185	12	the	the	DT
10_1101-2021_01_06_425657	185	13	two	two	CD
10_1101-2021_01_06_425657	185	14	most	most	RBS
10_1101-2021_01_06_425657	185	15	abundant	abundant	JJ
10_1101-2021_01_06_425657	185	16	daughter	daughter	NN
10_1101-2021_01_06_425657	185	17	ions	ion	NNS
10_1101-2021_01_06_425657	185	18	(	(	-LRB-
10_1101-2021_01_06_425657	185	19	i.e.	i.e.	FW
10_1101-2021_01_06_425657	185	20	,	,	,
10_1101-2021_01_06_425657	185	21	two	two	CD
10_1101-2021_01_06_425657	185	22	MRMs	mrm	NNS
10_1101-2021_01_06_425657	185	23	per	per	IN
10_1101-2021_01_06_425657	185	24	metabolite	metabolite	NN
10_1101-2021_01_06_425657	185	25	)	)	-RRB-
10_1101-2021_01_06_425657	185	26	were	be	VBD
10_1101-2021_01_06_425657	185	27	selected	select	VBN
10_1101-2021_01_06_425657	185	28	for	for	IN
10_1101-2021_01_06_425657	185	29	459	459	CD
10_1101-2021_01_06_425657	185	30	inclusion	inclusion	NN
10_1101-2021_01_06_425657	185	31	in	in	IN
10_1101-2021_01_06_425657	185	32	further	further	JJ
10_1101-2021_01_06_425657	185	33	method	method	NN
10_1101-2021_01_06_425657	185	34	development	development	NN
10_1101-2021_01_06_425657	185	35	.	.	.
10_1101-2021_01_06_425657	186	1	For	for	IN
10_1101-2021_01_06_425657	186	2	running	running	NN
10_1101-2021_01_06_425657	186	3	samples	sample	NNS
10_1101-2021_01_06_425657	186	4	,	,	,
10_1101-2021_01_06_425657	186	5	dried	dry	VBN
10_1101-2021_01_06_425657	186	6	extracts	extract	NNS
10_1101-2021_01_06_425657	186	7	(	(	-LRB-
10_1101-2021_01_06_425657	186	8	typically	typically	RB
10_1101-2021_01_06_425657	186	9	12.5	12.5	CD
10_1101-2021_01_06_425657	186	10	OD	OD	NNP
10_1101-2021_01_06_425657	186	11	460	460	CD
10_1101-2021_01_06_425657	186	12	units	unit	NNS
10_1101-2021_01_06_425657	186	13	)	)	-RRB-
10_1101-2021_01_06_425657	186	14	were	be	VBD
10_1101-2021_01_06_425657	186	15	resuspended	resuspend	VBN
10_1101-2021_01_06_425657	186	16	in	in	IN
10_1101-2021_01_06_425657	186	17	150	150	CD
10_1101-2021_01_06_425657	186	18	mL	mL	NNP
10_1101-2021_01_06_425657	186	19	0.1	0.1	CD
10_1101-2021_01_06_425657	186	20	%	%	NN
10_1101-2021_01_06_425657	186	21	formic	formic	NN
10_1101-2021_01_06_425657	186	22	acid	acid	NN
10_1101-2021_01_06_425657	186	23	,	,	,
10_1101-2021_01_06_425657	186	24	spun	spin	VBD
10_1101-2021_01_06_425657	186	25	at	at	IN
10_1101-2021_01_06_425657	186	26	21,000xg	21,000xg	CD
10_1101-2021_01_06_425657	186	27	for	for	IN
10_1101-2021_01_06_425657	186	28	5	5	CD
10_1101-2021_01_06_425657	186	29	min	min	NN
10_1101-2021_01_06_425657	186	30	at	at	IN
10_1101-2021_01_06_425657	186	31	4	4	CD
10_1101-2021_01_06_425657	186	32	°	°	NNS
10_1101-2021_01_06_425657	186	33	C	C	NNP
10_1101-2021_01_06_425657	186	34	,	,	,
10_1101-2021_01_06_425657	186	35	and	and	CC
10_1101-2021_01_06_425657	186	36	125	125	CD
10_1101-2021_01_06_425657	186	37	461	461	CD
10_1101-2021_01_06_425657	186	38	µL	µl	CD
10_1101-2021_01_06_425657	186	39	was	be	VBD
10_1101-2021_01_06_425657	186	40	moved	move	VBN
10_1101-2021_01_06_425657	186	41	to	to	IN
10_1101-2021_01_06_425657	186	42	a	a	DT
10_1101-2021_01_06_425657	186	43	fresh	fresh	JJ
10_1101-2021_01_06_425657	186	44	Eppendorf	Eppendorf	NNP
10_1101-2021_01_06_425657	186	45	.	.	.
10_1101-2021_01_06_425657	187	1	The	the	DT
10_1101-2021_01_06_425657	187	2	125	125	CD
10_1101-2021_01_06_425657	187	3	µL	µL	NNP
10_1101-2021_01_06_425657	187	4	was	be	VBD
10_1101-2021_01_06_425657	187	5	spun	spin	VBN
10_1101-2021_01_06_425657	187	6	again	again	RB
10_1101-2021_01_06_425657	187	7	at	at	IN
10_1101-2021_01_06_425657	187	8	21,000xg	21,000xg	CD
10_1101-2021_01_06_425657	187	9	for	for	IN
10_1101-2021_01_06_425657	187	10	5	5	CD
10_1101-2021_01_06_425657	187	11	min	min	NN
10_1101-2021_01_06_425657	187	12	at	at	IN
10_1101-2021_01_06_425657	187	13	4	4	CD
10_1101-2021_01_06_425657	187	14	°	°	NNS
10_1101-2021_01_06_425657	187	15	C	C	NNP
10_1101-2021_01_06_425657	187	16	,	,	,
10_1101-2021_01_06_425657	187	17	462	462	CD
10_1101-2021_01_06_425657	187	18	and	and	CC
10_1101-2021_01_06_425657	187	19	100	100	CD
10_1101-2021_01_06_425657	187	20	µL	µl	CD
10_1101-2021_01_06_425657	187	21	was	be	VBD
10_1101-2021_01_06_425657	187	22	moved	move	VBN
10_1101-2021_01_06_425657	187	23	to	to	IN
10_1101-2021_01_06_425657	187	24	mass	mass	JJ
10_1101-2021_01_06_425657	187	25	-	-	HYPH
10_1101-2021_01_06_425657	187	26	spec	spec	NN
10_1101-2021_01_06_425657	187	27	vials	vial	NNS
10_1101-2021_01_06_425657	187	28	for	for	IN
10_1101-2021_01_06_425657	187	29	injection	injection	NN
10_1101-2021_01_06_425657	187	30	(	(	-LRB-
10_1101-2021_01_06_425657	187	31	typically	typically	RB
10_1101-2021_01_06_425657	187	32	50	50	CD
10_1101-2021_01_06_425657	187	33	µL	µl	CD
10_1101-2021_01_06_425657	187	34	injection	injection	NN
10_1101-2021_01_06_425657	187	35	volume	volume	NN
10_1101-2021_01_06_425657	187	36	)	)	-RRB-
10_1101-2021_01_06_425657	187	37	.	.	.
10_1101-2021_01_06_425657	188	1	The	the	DT
10_1101-2021_01_06_425657	188	2	463	463	CD
10_1101-2021_01_06_425657	188	3	retention	retention	NN
10_1101-2021_01_06_425657	188	4	time	time	NN
10_1101-2021_01_06_425657	188	5	for	for	IN
10_1101-2021_01_06_425657	188	6	each	each	DT
10_1101-2021_01_06_425657	188	7	MRM	MRM	NNP
10_1101-2021_01_06_425657	188	8	peak	peak	NN
10_1101-2021_01_06_425657	188	9	was	be	VBD
10_1101-2021_01_06_425657	188	10	compared	compare	VBN
10_1101-2021_01_06_425657	188	11	to	to	IN
10_1101-2021_01_06_425657	188	12	an	an	DT
10_1101-2021_01_06_425657	188	13	appropriate	appropriate	JJ
10_1101-2021_01_06_425657	188	14	standard	standard	NN
10_1101-2021_01_06_425657	188	15	.	.	.
10_1101-2021_01_06_425657	189	1	The	the	DT
10_1101-2021_01_06_425657	189	2	area	area	NN
10_1101-2021_01_06_425657	189	3	under	under	IN
10_1101-2021_01_06_425657	189	4	each	each	DT
10_1101-2021_01_06_425657	189	5	464	464	CD
10_1101-2021_01_06_425657	189	6	peak	peak	NN
10_1101-2021_01_06_425657	189	7	was	be	VBD
10_1101-2021_01_06_425657	189	8	then	then	RB
10_1101-2021_01_06_425657	189	9	quantitated	quantitate	VBN
10_1101-2021_01_06_425657	189	10	by	by	IN
10_1101-2021_01_06_425657	189	11	using	use	VBG
10_1101-2021_01_06_425657	189	12	Analyst	Analyst	NNP
10_1101-2021_01_06_425657	189	13	®	®	NNPS
10_1101-2021_01_06_425657	189	14	1.6.3	1.6.3	CD
10_1101-2021_01_06_425657	189	15	,	,	,
10_1101-2021_01_06_425657	189	16	and	and	CC
10_1101-2021_01_06_425657	189	17	were	be	VBD
10_1101-2021_01_06_425657	189	18	re	re	VBN
10_1101-2021_01_06_425657	189	19	-	-	VBN
10_1101-2021_01_06_425657	189	20	inspected	inspect	VBN
10_1101-2021_01_06_425657	189	21	for	for	IN
10_1101-2021_01_06_425657	189	22	accuracy	accuracy	NN
10_1101-2021_01_06_425657	189	23	.	.	.
10_1101-2021_01_06_425657	190	1	465	465	CD
10_1101-2021_01_06_425657	190	2	Normalization	normalization	NN
10_1101-2021_01_06_425657	190	3	was	be	VBD
10_1101-2021_01_06_425657	190	4	done	do	VBN
10_1101-2021_01_06_425657	190	5	by	by	IN
10_1101-2021_01_06_425657	190	6	normalizing	normalize	VBG
10_1101-2021_01_06_425657	190	7	total	total	JJ
10_1101-2021_01_06_425657	190	8	spectral	spectral	JJ
10_1101-2021_01_06_425657	190	9	counts	count	NNS
10_1101-2021_01_06_425657	190	10	of	of	IN
10_1101-2021_01_06_425657	190	11	a	a	DT
10_1101-2021_01_06_425657	190	12	given	give	VBN
10_1101-2021_01_06_425657	190	13	metabolite	metabolite	NN
10_1101-2021_01_06_425657	190	14	by	by	IN
10_1101-2021_01_06_425657	190	15	OD600	OD600	NNP
10_1101-2021_01_06_425657	190	16	units	unit	NNS
10_1101-2021_01_06_425657	190	17	466	466	CD
10_1101-2021_01_06_425657	190	18	of	of	IN
10_1101-2021_01_06_425657	190	19	the	the	DT
10_1101-2021_01_06_425657	190	20	sample	sample	NN
10_1101-2021_01_06_425657	190	21	.	.	.
10_1101-2021_01_06_425657	191	1	Data	datum	NNS
10_1101-2021_01_06_425657	191	2	represents	represent	VBZ
10_1101-2021_01_06_425657	191	3	the	the	DT
10_1101-2021_01_06_425657	191	4	average	average	NN
10_1101-2021_01_06_425657	191	5	of	of	IN
10_1101-2021_01_06_425657	191	6	two	two	CD
10_1101-2021_01_06_425657	191	7	biological	biological	JJ
10_1101-2021_01_06_425657	191	8	replicates	replicate	NNS
10_1101-2021_01_06_425657	191	9	.	.	.
10_1101-2021_01_06_425657	192	1	467	467	CD
10_1101-2021_01_06_425657	192	2	468	468	CD
10_1101-2021_01_06_425657	192	3	Protein	protein	NN
10_1101-2021_01_06_425657	192	4	purification	purification	NN
10_1101-2021_01_06_425657	192	5	469	469	CD
10_1101-2021_01_06_425657	192	6	6xHis	6xhis	CD
10_1101-2021_01_06_425657	192	7	-	-	HYPH
10_1101-2021_01_06_425657	192	8	Uba1	uba1	NN
10_1101-2021_01_06_425657	192	9	(	(	-LRB-
10_1101-2021_01_06_425657	192	10	E1	e1	NN
10_1101-2021_01_06_425657	192	11	)	)	-RRB-
10_1101-2021_01_06_425657	192	12	was	be	VBD
10_1101-2021_01_06_425657	192	13	purified	purify	VBN
10_1101-2021_01_06_425657	192	14	as	as	IN
10_1101-2021_01_06_425657	192	15	previously	previously	RB
10_1101-2021_01_06_425657	192	16	described	describe	VBN
10_1101-2021_01_06_425657	192	17	(	(	-LRB-
10_1101-2021_01_06_425657	192	18	Petroski	Petroski	NNP
10_1101-2021_01_06_425657	192	19	and	and	CC
10_1101-2021_01_06_425657	192	20	Deshaies	Deshaies	NNP
10_1101-2021_01_06_425657	192	21	,	,	,
10_1101-2021_01_06_425657	192	22	2005	2005	CD
10_1101-2021_01_06_425657	192	23	)	)	-RRB-
10_1101-2021_01_06_425657	192	24	,	,	,
10_1101-2021_01_06_425657	192	25	with	with	IN
10_1101-2021_01_06_425657	192	26	the	the	DT
10_1101-2021_01_06_425657	192	27	470	470	CD
10_1101-2021_01_06_425657	192	28	exception	exception	NN
10_1101-2021_01_06_425657	192	29	that	that	WDT
10_1101-2021_01_06_425657	192	30	the	the	DT
10_1101-2021_01_06_425657	192	31	strain	strain	NN
10_1101-2021_01_06_425657	192	32	was	be	VBD
10_1101-2021_01_06_425657	192	33	made	make	VBN
10_1101-2021_01_06_425657	192	34	in	in	IN
10_1101-2021_01_06_425657	192	35	the	the	DT
10_1101-2021_01_06_425657	192	36	cen.pk	cen.pk	NNP
10_1101-2021_01_06_425657	192	37	background	background	NN
10_1101-2021_01_06_425657	192	38	and	and	CC
10_1101-2021_01_06_425657	192	39	the	the	DT
10_1101-2021_01_06_425657	192	40	His6-tag	His6-tag	NNP
10_1101-2021_01_06_425657	192	41	was	be	VBD
10_1101-2021_01_06_425657	192	42	appended	append	VBN
10_1101-2021_01_06_425657	192	43	to	to	IN
10_1101-2021_01_06_425657	192	44	the	the	DT
10_1101-2021_01_06_425657	192	45	471	471	CD
10_1101-2021_01_06_425657	192	46	N	N	NNP
10_1101-2021_01_06_425657	192	47	-	-	HYPH
10_1101-2021_01_06_425657	192	48	terminus	terminus	NN
10_1101-2021_01_06_425657	192	49	of	of	IN
10_1101-2021_01_06_425657	192	50	Uba1	uba1	NN
10_1101-2021_01_06_425657	192	51	.	.	.
10_1101-2021_01_06_425657	193	1	Additionally	additionally	RB
10_1101-2021_01_06_425657	193	2	,	,	,
10_1101-2021_01_06_425657	193	3	lysis	lysis	NN
10_1101-2021_01_06_425657	193	4	was	be	VBD
10_1101-2021_01_06_425657	193	5	performed	perform	VBN
10_1101-2021_01_06_425657	193	6	by	by	IN
10_1101-2021_01_06_425657	193	7	cryomilling	cryomille	VBG
10_1101-2021_01_06_425657	193	8	frozen	frozen	JJ
10_1101-2021_01_06_425657	193	9	yeast	yeast	NN
10_1101-2021_01_06_425657	193	10	pellets	pellet	NNS
10_1101-2021_01_06_425657	193	11	by	by	IN
10_1101-2021_01_06_425657	193	12	472	472	CD
10_1101-2021_01_06_425657	193	13	adding	add	VBG
10_1101-2021_01_06_425657	193	14	the	the	DT
10_1101-2021_01_06_425657	193	15	pellet	pellet	NN
10_1101-2021_01_06_425657	193	16	to	to	IN
10_1101-2021_01_06_425657	193	17	a	a	DT
10_1101-2021_01_06_425657	193	18	pre	pre	JJ
10_1101-2021_01_06_425657	193	19	-	-	VBN
10_1101-2021_01_06_425657	193	20	cooled	cool	VBN
10_1101-2021_01_06_425657	193	21	50	50	CD
10_1101-2021_01_06_425657	193	22	ml	ml	NN
10_1101-2021_01_06_425657	193	23	milling	milling	NN
10_1101-2021_01_06_425657	193	24	jar	jar	NN
10_1101-2021_01_06_425657	193	25	containing	contain	VBG
10_1101-2021_01_06_425657	193	26	a	a	DT
10_1101-2021_01_06_425657	193	27	20	20	CD
10_1101-2021_01_06_425657	193	28	mm	mm	CD
10_1101-2021_01_06_425657	193	29	stainless	stainless	JJ
10_1101-2021_01_06_425657	193	30	steel	steel	NN
10_1101-2021_01_06_425657	193	31	ball	ball	NN
10_1101-2021_01_06_425657	193	32	.	.	.
10_1101-2021_01_06_425657	194	1	Yeast	yeast	NN
10_1101-2021_01_06_425657	194	2	473	473	CD
10_1101-2021_01_06_425657	194	3	cell	cell	NN
10_1101-2021_01_06_425657	194	4	lysis	lysis	NN
10_1101-2021_01_06_425657	194	5	was	be	VBD
10_1101-2021_01_06_425657	194	6	performed	perform	VBN
10_1101-2021_01_06_425657	194	7	by	by	IN
10_1101-2021_01_06_425657	194	8	milling	mill	VBG
10_1101-2021_01_06_425657	194	9	in	in	IN
10_1101-2021_01_06_425657	194	10	3	3	CD
10_1101-2021_01_06_425657	194	11	cycles	cycle	NNS
10_1101-2021_01_06_425657	194	12	at	at	IN
10_1101-2021_01_06_425657	194	13	25	25	CD
10_1101-2021_01_06_425657	194	14	Hrz	hrz	NN
10_1101-2021_01_06_425657	194	15	for	for	IN
10_1101-2021_01_06_425657	194	16	3	3	CD
10_1101-2021_01_06_425657	194	17	min	min	NN
10_1101-2021_01_06_425657	194	18	and	and	CC
10_1101-2021_01_06_425657	194	19	chilling	chill	VBG
10_1101-2021_01_06_425657	194	20	in	in	IN
10_1101-2021_01_06_425657	194	21	liquid	liquid	JJ
10_1101-2021_01_06_425657	194	22	nitrogen	nitrogen	NN
10_1101-2021_01_06_425657	194	23	474	474	CD
10_1101-2021_01_06_425657	194	24	for	for	IN
10_1101-2021_01_06_425657	194	25	1	1	CD
10_1101-2021_01_06_425657	194	26	min	min	NN
10_1101-2021_01_06_425657	194	27	.	.	.
10_1101-2021_01_06_425657	195	1	Lysate	Lysate	NNP
10_1101-2021_01_06_425657	195	2	was	be	VBD
10_1101-2021_01_06_425657	195	3	made	make	VBN
10_1101-2021_01_06_425657	195	4	by	by	IN
10_1101-2021_01_06_425657	195	5	adding	add	VBG
10_1101-2021_01_06_425657	195	6	4	4	CD
10_1101-2021_01_06_425657	195	7	ml	ml	NNS
10_1101-2021_01_06_425657	195	8	of	of	IN
10_1101-2021_01_06_425657	195	9	buffer	buffer	NN
10_1101-2021_01_06_425657	195	10	for	for	IN
10_1101-2021_01_06_425657	195	11	every	every	DT
10_1101-2021_01_06_425657	195	12	gram	gram	NN
10_1101-2021_01_06_425657	195	13	of	of	IN
10_1101-2021_01_06_425657	195	14	cryomilled	cryomille	VBN
10_1101-2021_01_06_425657	195	15	yeast	yeast	NN
10_1101-2021_01_06_425657	195	16	powder	powder	NN
10_1101-2021_01_06_425657	195	17	,	,	,
10_1101-2021_01_06_425657	195	18	475	475	CD
10_1101-2021_01_06_425657	195	19	and	and	CC
10_1101-2021_01_06_425657	195	20	clarification	clarification	NN
10_1101-2021_01_06_425657	195	21	was	be	VBD
10_1101-2021_01_06_425657	195	22	performed	perform	VBN
10_1101-2021_01_06_425657	195	23	at	at	IN
10_1101-2021_01_06_425657	195	24	35,000xg	35,000xg	NN
10_1101-2021_01_06_425657	195	25	instead	instead	RB
10_1101-2021_01_06_425657	195	26	of	of	IN
10_1101-2021_01_06_425657	195	27	50,000xg	50,000xg	CD
10_1101-2021_01_06_425657	195	28	.	.	.
10_1101-2021_01_06_425657	196	1	476	476	CD
10_1101-2021_01_06_425657	196	2	477	477	CD
10_1101-2021_01_06_425657	196	3	Cdc34	Cdc34	NNP
10_1101-2021_01_06_425657	196	4	-	-	HYPH
10_1101-2021_01_06_425657	196	5	6xHis	6xHis	NNP
10_1101-2021_01_06_425657	196	6	(	(	-LRB-
10_1101-2021_01_06_425657	196	7	E2	e2	NN
10_1101-2021_01_06_425657	196	8	)	)	-RRB-
10_1101-2021_01_06_425657	196	9	similarly	similarly	RB
10_1101-2021_01_06_425657	196	10	was	be	VBD
10_1101-2021_01_06_425657	196	11	purified	purify	VBN
10_1101-2021_01_06_425657	196	12	according	accord	VBG
10_1101-2021_01_06_425657	196	13	to	to	IN
10_1101-2021_01_06_425657	196	14	previously	previously	RB
10_1101-2021_01_06_425657	196	15	described	describe	VBN
10_1101-2021_01_06_425657	196	16	protocols	protocol	NNS
10_1101-2021_01_06_425657	196	17	(	(	-LRB-
10_1101-2021_01_06_425657	196	18	Petroski	Petroski	NNP
10_1101-2021_01_06_425657	196	19	478	478	CD
10_1101-2021_01_06_425657	196	20	and	and	CC
10_1101-2021_01_06_425657	196	21	Deshaies	Deshaies	NNPS
10_1101-2021_01_06_425657	196	22	,	,	,
10_1101-2021_01_06_425657	196	23	2005	2005	CD
10_1101-2021_01_06_425657	196	24	)	)	-RRB-
10_1101-2021_01_06_425657	196	25	,	,	,
10_1101-2021_01_06_425657	196	26	with	with	IN
10_1101-2021_01_06_425657	196	27	the	the	DT
10_1101-2021_01_06_425657	196	28	following	follow	VBG
10_1101-2021_01_06_425657	196	29	exceptions	exception	NNS
10_1101-2021_01_06_425657	196	30	;	;	:
10_1101-2021_01_06_425657	196	31	the	the	DT
10_1101-2021_01_06_425657	196	32	CDC34	CDC34	NNP
10_1101-2021_01_06_425657	196	33	ORF	ORF	NNP
10_1101-2021_01_06_425657	196	34	was	be	VBD
10_1101-2021_01_06_425657	196	35	cloned	clone	VBN
10_1101-2021_01_06_425657	196	36	into	into	IN
10_1101-2021_01_06_425657	196	37	pHIS	phis	NN
10_1101-2021_01_06_425657	196	38	479	479	CD
10_1101-2021_01_06_425657	196	39	parallel	parallel	JJ
10_1101-2021_01_06_425657	196	40	vector	vector	NN
10_1101-2021_01_06_425657	196	41	such	such	JJ
10_1101-2021_01_06_425657	196	42	that	that	IN
10_1101-2021_01_06_425657	196	43	the	the	DT
10_1101-2021_01_06_425657	196	44	N	n	NN
10_1101-2021_01_06_425657	196	45	-	-	HYPH
10_1101-2021_01_06_425657	196	46	terminal	terminal	NN
10_1101-2021_01_06_425657	196	47	His	-PRON-	PRP$
10_1101-2021_01_06_425657	196	48	tag	tag	NN
10_1101-2021_01_06_425657	196	49	was	be	VBD
10_1101-2021_01_06_425657	196	50	eliminated	eliminate	VBN
10_1101-2021_01_06_425657	196	51	from	from	IN
10_1101-2021_01_06_425657	196	52	the	the	DT
10_1101-2021_01_06_425657	196	53	vector	vector	NN
10_1101-2021_01_06_425657	196	54	while	while	IN
10_1101-2021_01_06_425657	196	55	incorporating	incorporate	VBG
10_1101-2021_01_06_425657	196	56	480	480	CD
10_1101-2021_01_06_425657	196	57	a	a	DT
10_1101-2021_01_06_425657	196	58	C	c	NN
10_1101-2021_01_06_425657	196	59	-	-	HYPH
10_1101-2021_01_06_425657	196	60	terminal	terminal	JJ
10_1101-2021_01_06_425657	196	61	6xHis	6xhis	NN
10_1101-2021_01_06_425657	196	62	tag	tag	NN
10_1101-2021_01_06_425657	196	63	by	by	IN
10_1101-2021_01_06_425657	196	64	PCR	PCR	NNP
10_1101-2021_01_06_425657	196	65	.	.	.
10_1101-2021_01_06_425657	197	1	BL21	BL21	NNP
10_1101-2021_01_06_425657	197	2	transformants	transformant	NNS
10_1101-2021_01_06_425657	197	3	were	be	VBD
10_1101-2021_01_06_425657	197	4	grown	grow	VBN
10_1101-2021_01_06_425657	197	5	in	in	IN
10_1101-2021_01_06_425657	197	6	LB	LB	NNP
10_1101-2021_01_06_425657	197	7	medium	medium	NN
10_1101-2021_01_06_425657	197	8	and	and	CC
10_1101-2021_01_06_425657	197	9	expression	expression	NN
10_1101-2021_01_06_425657	197	10	481	481	CD
10_1101-2021_01_06_425657	197	11	was	be	VBD
10_1101-2021_01_06_425657	197	12	induced	induce	VBN
10_1101-2021_01_06_425657	197	13	by	by	IN
10_1101-2021_01_06_425657	197	14	addition	addition	NN
10_1101-2021_01_06_425657	197	15	of	of	IN
10_1101-2021_01_06_425657	197	16	0.1	0.1	CD
10_1101-2021_01_06_425657	197	17	mM	mM	NNP
10_1101-2021_01_06_425657	197	18	IPTG	iptg	NN
10_1101-2021_01_06_425657	197	19	.	.	.
10_1101-2021_01_06_425657	198	1	Cells	cell	NNS
10_1101-2021_01_06_425657	198	2	were	be	VBD
10_1101-2021_01_06_425657	198	3	lysed	lyse	VBN
10_1101-2021_01_06_425657	198	4	by	by	IN
10_1101-2021_01_06_425657	198	5	sonication	sonication	NN
10_1101-2021_01_06_425657	198	6	and	and	CC
10_1101-2021_01_06_425657	198	7	clarification	clarification	NN
10_1101-2021_01_06_425657	198	8	was	be	VBD
10_1101-2021_01_06_425657	198	9	482	482	CD
10_1101-2021_01_06_425657	198	10	done	do	VBN
10_1101-2021_01_06_425657	198	11	by	by	IN
10_1101-2021_01_06_425657	198	12	spinning	spin	VBG
10_1101-2021_01_06_425657	198	13	at	at	IN
10_1101-2021_01_06_425657	198	14	35,000xg	35,000xg	CD
10_1101-2021_01_06_425657	198	15	for	for	IN
10_1101-2021_01_06_425657	198	16	20	20	CD
10_1101-2021_01_06_425657	198	17	min	min	NN
10_1101-2021_01_06_425657	198	18	at	at	IN
10_1101-2021_01_06_425657	198	19	4	4	CD
10_1101-2021_01_06_425657	198	20	°	°	NNS
10_1101-2021_01_06_425657	198	21	C	C	NNP
10_1101-2021_01_06_425657	198	22	before	before	IN
10_1101-2021_01_06_425657	198	23	the	the	DT
10_1101-2021_01_06_425657	198	24	Ni	Ni	NNP
10_1101-2021_01_06_425657	198	25	-	-	HYPH
10_1101-2021_01_06_425657	198	26	NTA	NTA	NNP
10_1101-2021_01_06_425657	198	27	purification	purification	NN
10_1101-2021_01_06_425657	198	28	was	be	VBD
10_1101-2021_01_06_425657	198	29	performed	perform	VBN
10_1101-2021_01_06_425657	198	30	as	as	IN
10_1101-2021_01_06_425657	198	31	483	483	CD
10_1101-2021_01_06_425657	198	32	previously	previously	RB
10_1101-2021_01_06_425657	198	33	described	describe	VBN
10_1101-2021_01_06_425657	198	34	(	(	-LRB-
10_1101-2021_01_06_425657	198	35	Petroski	Petroski	NNP
10_1101-2021_01_06_425657	198	36	and	and	CC
10_1101-2021_01_06_425657	198	37	Deshaies	Deshaies	NNP
10_1101-2021_01_06_425657	198	38	,	,	,
10_1101-2021_01_06_425657	198	39	2005	2005	CD
10_1101-2021_01_06_425657	198	40	)	)	-RRB-
10_1101-2021_01_06_425657	198	41	.	.	.
10_1101-2021_01_06_425657	199	1	484	484	CD
10_1101-2021_01_06_425657	199	2	485	485	CD
10_1101-2021_01_06_425657	199	3	His	-PRON-	PRP$
10_1101-2021_01_06_425657	199	4	-	-	HYPH
10_1101-2021_01_06_425657	199	5	SUMO	SUMO	NNP
10_1101-2021_01_06_425657	199	6	-	-	HYPH
10_1101-2021_01_06_425657	199	7	Met4-Strep	Met4-Strep	NNP
10_1101-2021_01_06_425657	199	8	-	-	HYPH
10_1101-2021_01_06_425657	199	9	tagII	tagII	NNP
10_1101-2021_01_06_425657	199	10	-	-	HYPH
10_1101-2021_01_06_425657	199	11	HA	HA	NNP
10_1101-2021_01_06_425657	199	12	was	be	VBD
10_1101-2021_01_06_425657	199	13	purified	purify	VBN
10_1101-2021_01_06_425657	199	14	by	by	IN
10_1101-2021_01_06_425657	199	15	cloning	clone	VBG
10_1101-2021_01_06_425657	199	16	the	the	DT
10_1101-2021_01_06_425657	199	17	MET4	MET4	NNP
10_1101-2021_01_06_425657	199	18	ORF	ORF	NNP
10_1101-2021_01_06_425657	199	19	into	into	IN
10_1101-2021_01_06_425657	199	20	pET	pet	NN
10_1101-2021_01_06_425657	199	21	His6	His6	NNP
10_1101-2021_01_06_425657	199	22	Sumo	Sumo	NNP
10_1101-2021_01_06_425657	199	23	486	486	CD
10_1101-2021_01_06_425657	199	24	vector	vector	NN
10_1101-2021_01_06_425657	199	25	while	while	IN
10_1101-2021_01_06_425657	199	26	incorporating	incorporate	VBG
10_1101-2021_01_06_425657	199	27	a	a	DT
10_1101-2021_01_06_425657	199	28	C	C	NNP
10_1101-2021_01_06_425657	199	29	-	-	HYPH
10_1101-2021_01_06_425657	199	30	terminal	terminal	NN
10_1101-2021_01_06_425657	199	31	Strep	Strep	NNP
10_1101-2021_01_06_425657	199	32	-	-	,
10_1101-2021_01_06_425657	199	33	tagII	tagii	ADD
10_1101-2021_01_06_425657	199	34	and	and	CC
10_1101-2021_01_06_425657	199	35	a	a	DT
10_1101-2021_01_06_425657	199	36	single	single	JJ
10_1101-2021_01_06_425657	199	37	HA	HA	NNP
10_1101-2021_01_06_425657	199	38	tag	tag	NN
10_1101-2021_01_06_425657	199	39	by	by	IN
10_1101-2021_01_06_425657	199	40	PCR	PCR	NNP
10_1101-2021_01_06_425657	199	41	.	.	.
10_1101-2021_01_06_425657	200	1	BL21	BL21	NNP
10_1101-2021_01_06_425657	200	2	487	487	CD
10_1101-2021_01_06_425657	200	3	transformants	transformant	NNS
10_1101-2021_01_06_425657	200	4	were	be	VBD
10_1101-2021_01_06_425657	200	5	grown	grow	VBN
10_1101-2021_01_06_425657	200	6	in	in	IN
10_1101-2021_01_06_425657	200	7	2	2	CD
10_1101-2021_01_06_425657	200	8	liters	liter	NNS
10_1101-2021_01_06_425657	200	9	LB	LB	NNP
10_1101-2021_01_06_425657	200	10	medium	medium	NN
10_1101-2021_01_06_425657	200	11	and	and	CC
10_1101-2021_01_06_425657	200	12	induced	induce	VBN
10_1101-2021_01_06_425657	200	13	by	by	IN
10_1101-2021_01_06_425657	200	14	addition	addition	NN
10_1101-2021_01_06_425657	200	15	of	of	IN
10_1101-2021_01_06_425657	200	16	0.1	0.1	CD
10_1101-2021_01_06_425657	200	17	mM	mM	NNP
10_1101-2021_01_06_425657	200	18	IPTG	iptg	VB
10_1101-2021_01_06_425657	200	19	O	o	NN
10_1101-2021_01_06_425657	200	20	/	/	SYM
10_1101-2021_01_06_425657	200	21	N	n	NN
10_1101-2021_01_06_425657	200	22	488	488	CD
10_1101-2021_01_06_425657	200	23	at	at	IN
10_1101-2021_01_06_425657	200	24	16	16	CD
10_1101-2021_01_06_425657	200	25	°	°	NNS
10_1101-2021_01_06_425657	200	26	C	C	NNP
10_1101-2021_01_06_425657	200	27	at	at	IN
10_1101-2021_01_06_425657	200	28	200	200	CD
10_1101-2021_01_06_425657	200	29	rpm	rpm	NN
10_1101-2021_01_06_425657	200	30	.	.	.
10_1101-2021_01_06_425657	201	1	Cell	cell	NN
10_1101-2021_01_06_425657	201	2	pellets	pellet	NNS
10_1101-2021_01_06_425657	201	3	were	be	VBD
10_1101-2021_01_06_425657	201	4	collected	collect	VBN
10_1101-2021_01_06_425657	201	5	and	and	CC
10_1101-2021_01_06_425657	201	6	lysed	lyse	VBN
10_1101-2021_01_06_425657	201	7	by	by	IN
10_1101-2021_01_06_425657	201	8	sonication	sonication	NN
10_1101-2021_01_06_425657	201	9	in	in	IN
10_1101-2021_01_06_425657	201	10	buffer	buffer	NN
10_1101-2021_01_06_425657	201	11	containing	contain	VBG
10_1101-2021_01_06_425657	201	12	50	50	CD
10_1101-2021_01_06_425657	201	13	489	489	CD
10_1101-2021_01_06_425657	201	14	mM	mM	NNP
10_1101-2021_01_06_425657	201	15	Tris	Tris	NNP
10_1101-2021_01_06_425657	201	16	pH	pH	NNP
10_1101-2021_01_06_425657	201	17	7.5	7.5	CD
10_1101-2021_01_06_425657	201	18	,	,	,
10_1101-2021_01_06_425657	201	19	300	300	CD
10_1101-2021_01_06_425657	201	20	mM	mM	NNP
10_1101-2021_01_06_425657	201	21	NaCl	NaCl	NNP
10_1101-2021_01_06_425657	201	22	,	,	,
10_1101-2021_01_06_425657	201	23	10	10	CD
10_1101-2021_01_06_425657	201	24	%	%	NN
10_1101-2021_01_06_425657	201	25	glycerol	glycerol	NN
10_1101-2021_01_06_425657	201	26	,	,	,
10_1101-2021_01_06_425657	201	27	20	20	CD
10_1101-2021_01_06_425657	201	28	mM	mM	NNP
10_1101-2021_01_06_425657	201	29	imidazole	imidazole	NN
10_1101-2021_01_06_425657	201	30	,	,	,
10_1101-2021_01_06_425657	201	31	1	1	CD
10_1101-2021_01_06_425657	201	32	mM	mm	NN
10_1101-2021_01_06_425657	201	33	PMSF	pmsf	NN
10_1101-2021_01_06_425657	201	34	,	,	,
10_1101-2021_01_06_425657	201	35	10	10	CD
10_1101-2021_01_06_425657	201	36	µM	µM	NNP
10_1101-2021_01_06_425657	201	37	leupeptin	leupeptin	NN
10_1101-2021_01_06_425657	201	38	,	,	,
10_1101-2021_01_06_425657	201	39	490	490	CD
10_1101-2021_01_06_425657	201	40	50	50	CD
10_1101-2021_01_06_425657	201	41	mM	mm	NN
10_1101-2021_01_06_425657	201	42	NaF	naf	NN
10_1101-2021_01_06_425657	201	43	,	,	,
10_1101-2021_01_06_425657	201	44	5	5	CD
10_1101-2021_01_06_425657	201	45	µM	µM	NNP
10_1101-2021_01_06_425657	201	46	pepstatin	pepstatin	NN
10_1101-2021_01_06_425657	201	47	,	,	,
10_1101-2021_01_06_425657	201	48	0.5	0.5	CD
10_1101-2021_01_06_425657	201	49	%	%	NN
10_1101-2021_01_06_425657	201	50	NP-40	NP-40	NNP
10_1101-2021_01_06_425657	201	51	,	,	,
10_1101-2021_01_06_425657	201	52	and	and	CC
10_1101-2021_01_06_425657	201	53	2x	2x	CD
10_1101-2021_01_06_425657	201	54	roche	roche	NNP
10_1101-2021_01_06_425657	201	55	EDTA	EDTA	NNP
10_1101-2021_01_06_425657	201	56	-	-	HYPH
10_1101-2021_01_06_425657	201	57	free	free	JJ
10_1101-2021_01_06_425657	201	58	protease	protease	NN
10_1101-2021_01_06_425657	201	59	inhibitor	inhibitor	NN
10_1101-2021_01_06_425657	201	60	cocktail	cocktail	NN
10_1101-2021_01_06_425657	201	61	491	491	CD
10_1101-2021_01_06_425657	201	62	.CC	.CC	,
10_1101-2021_01_06_425657	201	63	-	-	:
10_1101-2021_01_06_425657	201	64	BY	by	IN
10_1101-2021_01_06_425657	201	65	4.0	4.0	CD
10_1101-2021_01_06_425657	201	66	International	International	NNP
10_1101-2021_01_06_425657	201	67	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	201	68	under	under	IN
10_1101-2021_01_06_425657	201	69	a	a	DT
10_1101-2021_01_06_425657	201	70	(	(	-LRB-
10_1101-2021_01_06_425657	201	71	which	which	WDT
10_1101-2021_01_06_425657	201	72	was	be	VBD
10_1101-2021_01_06_425657	201	73	not	not	RB
10_1101-2021_01_06_425657	201	74	certified	certify	VBN
10_1101-2021_01_06_425657	201	75	by	by	IN
10_1101-2021_01_06_425657	201	76	peer	peer	NN
10_1101-2021_01_06_425657	201	77	review	review	NN
10_1101-2021_01_06_425657	201	78	)	)	-RRB-
10_1101-2021_01_06_425657	201	79	is	be	VBZ
10_1101-2021_01_06_425657	201	80	the	the	DT
10_1101-2021_01_06_425657	201	81	author	author	NN
10_1101-2021_01_06_425657	201	82	/	/	SYM
10_1101-2021_01_06_425657	201	83	funder	funder	NN
10_1101-2021_01_06_425657	201	84	,	,	,
10_1101-2021_01_06_425657	201	85	who	who	WP
10_1101-2021_01_06_425657	201	86	has	have	VBZ
10_1101-2021_01_06_425657	201	87	granted	grant	VBN
10_1101-2021_01_06_425657	201	88	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	201	89	a	a	DT
10_1101-2021_01_06_425657	201	90	license	license	NN
10_1101-2021_01_06_425657	201	91	to	to	TO
10_1101-2021_01_06_425657	201	92	display	display	VB
10_1101-2021_01_06_425657	201	93	the	the	DT
10_1101-2021_01_06_425657	201	94	preprint	preprint	NN
10_1101-2021_01_06_425657	201	95	in	in	IN
10_1101-2021_01_06_425657	201	96	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	201	97	.	.	.
10_1101-2021_01_06_425657	202	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	202	2	is	be	VBZ
10_1101-2021_01_06_425657	202	3	made	make	VBN
10_1101-2021_01_06_425657	202	4	The	the	DT
10_1101-2021_01_06_425657	202	5	copyright	copyright	NN
10_1101-2021_01_06_425657	202	6	holder	holder	NN
10_1101-2021_01_06_425657	202	7	for	for	IN
10_1101-2021_01_06_425657	202	8	this	this	DT
10_1101-2021_01_06_425657	202	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	202	10	version	version	NN
10_1101-2021_01_06_425657	202	11	posted	post	VBD
10_1101-2021_01_06_425657	202	12	January	January	NNP
10_1101-2021_01_06_425657	202	13	7	7	CD
10_1101-2021_01_06_425657	202	14	,	,	,
10_1101-2021_01_06_425657	202	15	2021	2021	CD
10_1101-2021_01_06_425657	202	16	.	.	.
10_1101-2021_01_06_425657	202	17	;	;	:
10_1101-2021_01_06_425657	202	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	202	19	:	:	:
10_1101-2021_01_06_425657	202	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	202	21	preprint	preprint	NN
10_1101-2021_01_06_425657	202	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	202	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	202	24	14	14	CD
10_1101-2021_01_06_425657	202	25	tablet	tablet	NN
10_1101-2021_01_06_425657	202	26	.	.	.
10_1101-2021_01_06_425657	203	1	Lysate	Lysate	NNP
10_1101-2021_01_06_425657	203	2	was	be	VBD
10_1101-2021_01_06_425657	203	3	clarified	clarify	VBN
10_1101-2021_01_06_425657	203	4	by	by	IN
10_1101-2021_01_06_425657	203	5	centrifugation	centrifugation	NN
10_1101-2021_01_06_425657	203	6	at	at	IN
10_1101-2021_01_06_425657	203	7	35,000xg	35,000xg	CD
10_1101-2021_01_06_425657	203	8	for	for	IN
10_1101-2021_01_06_425657	203	9	20	20	CD
10_1101-2021_01_06_425657	203	10	min	min	NN
10_1101-2021_01_06_425657	203	11	at	at	IN
10_1101-2021_01_06_425657	203	12	4	4	CD
10_1101-2021_01_06_425657	203	13	°	°	NNS
10_1101-2021_01_06_425657	203	14	C	C	NNP
10_1101-2021_01_06_425657	203	15	and	and	CC
10_1101-2021_01_06_425657	203	16	the	the	DT
10_1101-2021_01_06_425657	203	17	supernatant	supernatant	JJ
10_1101-2021_01_06_425657	203	18	492	492	CD
10_1101-2021_01_06_425657	203	19	was	be	VBD
10_1101-2021_01_06_425657	203	20	transferred	transfer	VBN
10_1101-2021_01_06_425657	203	21	to	to	IN
10_1101-2021_01_06_425657	203	22	a	a	DT
10_1101-2021_01_06_425657	203	23	50	50	CD
10_1101-2021_01_06_425657	203	24	ml	ml	NN
10_1101-2021_01_06_425657	203	25	conical	conical	JJ
10_1101-2021_01_06_425657	203	26	and	and	CC
10_1101-2021_01_06_425657	203	27	Met4	Met4	NNP
10_1101-2021_01_06_425657	203	28	was	be	VBD
10_1101-2021_01_06_425657	203	29	batch	batch	NN
10_1101-2021_01_06_425657	203	30	purified	purify	VBN
10_1101-2021_01_06_425657	203	31	with	with	IN
10_1101-2021_01_06_425657	203	32	1.5	1.5	CD
10_1101-2021_01_06_425657	203	33	ml	ml	NNS
10_1101-2021_01_06_425657	203	34	of	of	IN
10_1101-2021_01_06_425657	203	35	Ni	Ni	NNP
10_1101-2021_01_06_425657	203	36	-	-	HYPH
10_1101-2021_01_06_425657	203	37	NTA	NTA	NNP
10_1101-2021_01_06_425657	203	38	agarose	agarose	NN
10_1101-2021_01_06_425657	203	39	by	by	IN
10_1101-2021_01_06_425657	203	40	493	493	CD
10_1101-2021_01_06_425657	203	41	incubating	incubate	VBG
10_1101-2021_01_06_425657	203	42	for	for	IN
10_1101-2021_01_06_425657	203	43	30	30	CD
10_1101-2021_01_06_425657	203	44	min	min	NN
10_1101-2021_01_06_425657	203	45	at	at	IN
10_1101-2021_01_06_425657	203	46	4	4	CD
10_1101-2021_01_06_425657	203	47	°	°	NNS
10_1101-2021_01_06_425657	203	48	C	C	NNP
10_1101-2021_01_06_425657	203	49	.	.	.
10_1101-2021_01_06_425657	204	1	After	after	IN
10_1101-2021_01_06_425657	204	2	spinning	spin	VBG
10_1101-2021_01_06_425657	204	3	down	down	RP
10_1101-2021_01_06_425657	204	4	the	the	DT
10_1101-2021_01_06_425657	204	5	Ni	Ni	NNP
10_1101-2021_01_06_425657	204	6	-	-	HYPH
10_1101-2021_01_06_425657	204	7	NTA	NTA	NNP
10_1101-2021_01_06_425657	204	8	agarose	agarose	NN
10_1101-2021_01_06_425657	204	9	,	,	,
10_1101-2021_01_06_425657	204	10	the	the	DT
10_1101-2021_01_06_425657	204	11	supernatant	supernatant	NN
10_1101-2021_01_06_425657	204	12	was	be	VBD
10_1101-2021_01_06_425657	204	13	494	494	CD
10_1101-2021_01_06_425657	204	14	removed	remove	VBN
10_1101-2021_01_06_425657	204	15	and	and	CC
10_1101-2021_01_06_425657	204	16	the	the	DT
10_1101-2021_01_06_425657	204	17	agarose	agarose	NN
10_1101-2021_01_06_425657	204	18	was	be	VBD
10_1101-2021_01_06_425657	204	19	resuspended	resuspend	VBN
10_1101-2021_01_06_425657	204	20	in	in	IN
10_1101-2021_01_06_425657	204	21	the	the	DT
10_1101-2021_01_06_425657	204	22	same	same	JJ
10_1101-2021_01_06_425657	204	23	buffer	buffer	NN
10_1101-2021_01_06_425657	204	24	and	and	CC
10_1101-2021_01_06_425657	204	25	moved	move	VBD
10_1101-2021_01_06_425657	204	26	to	to	IN
10_1101-2021_01_06_425657	204	27	a	a	DT
10_1101-2021_01_06_425657	204	28	gravity	gravity	NN
10_1101-2021_01_06_425657	204	29	flow	flow	NN
10_1101-2021_01_06_425657	204	30	column	column	NN
10_1101-2021_01_06_425657	204	31	495	495	CD
10_1101-2021_01_06_425657	204	32	and	and	CC
10_1101-2021_01_06_425657	204	33	washed	wash	VBD
10_1101-2021_01_06_425657	204	34	3	3	CD
10_1101-2021_01_06_425657	204	35	times	time	NNS
10_1101-2021_01_06_425657	204	36	with	with	IN
10_1101-2021_01_06_425657	204	37	50	50	CD
10_1101-2021_01_06_425657	204	38	mM	mM	NNP
10_1101-2021_01_06_425657	204	39	Tris	Tris	NNP
10_1101-2021_01_06_425657	204	40	pH	pH	NNP
10_1101-2021_01_06_425657	204	41	7.5	7.5	CD
10_1101-2021_01_06_425657	204	42	,	,	,
10_1101-2021_01_06_425657	204	43	300	300	CD
10_1101-2021_01_06_425657	204	44	mM	mM	NNP
10_1101-2021_01_06_425657	204	45	NaCl	NaCl	NNP
10_1101-2021_01_06_425657	204	46	,	,	,
10_1101-2021_01_06_425657	204	47	10	10	CD
10_1101-2021_01_06_425657	204	48	%	%	NN
10_1101-2021_01_06_425657	204	49	glycerol	glycerol	NN
10_1101-2021_01_06_425657	204	50	,	,	,
10_1101-2021_01_06_425657	204	51	and	and	CC
10_1101-2021_01_06_425657	204	52	20	20	CD
10_1101-2021_01_06_425657	204	53	mM	mM	NNP
10_1101-2021_01_06_425657	204	54	imidazole	imidazole	NN
10_1101-2021_01_06_425657	204	55	496	496	CD
10_1101-2021_01_06_425657	204	56	before	before	IN
10_1101-2021_01_06_425657	204	57	elution	elution	NN
10_1101-2021_01_06_425657	204	58	with	with	IN
10_1101-2021_01_06_425657	204	59	the	the	DT
10_1101-2021_01_06_425657	204	60	same	same	JJ
10_1101-2021_01_06_425657	204	61	buffer	buffer	NN
10_1101-2021_01_06_425657	204	62	containing	contain	VBG
10_1101-2021_01_06_425657	204	63	200	200	CD
10_1101-2021_01_06_425657	204	64	mM	mM	NNP
10_1101-2021_01_06_425657	204	65	imidazole	imidazole	NN
10_1101-2021_01_06_425657	204	66	.	.	.
10_1101-2021_01_06_425657	205	1	Eluted	Eluted	NNP
10_1101-2021_01_06_425657	205	2	Met4	Met4	NNP
10_1101-2021_01_06_425657	205	3	was	be	VBD
10_1101-2021_01_06_425657	205	4	then	then	RB
10_1101-2021_01_06_425657	205	5	run	run	VBN
10_1101-2021_01_06_425657	205	6	over	over	IN
10_1101-2021_01_06_425657	205	7	497	497	CD
10_1101-2021_01_06_425657	205	8	2	2	CD
10_1101-2021_01_06_425657	205	9	ml	ml	CD
10_1101-2021_01_06_425657	205	10	of	of	IN
10_1101-2021_01_06_425657	205	11	Strep	Strep	NNP
10_1101-2021_01_06_425657	205	12	-	-	HYPH
10_1101-2021_01_06_425657	205	13	Tactin	Tactin	NNP
10_1101-2021_01_06_425657	205	14	Sepharose	Sepharose	NNP
10_1101-2021_01_06_425657	205	15	in	in	IN
10_1101-2021_01_06_425657	205	16	a	a	DT
10_1101-2021_01_06_425657	205	17	10	10	CD
10_1101-2021_01_06_425657	205	18	ml	ml	NN
10_1101-2021_01_06_425657	205	19	gravity	gravity	NN
10_1101-2021_01_06_425657	205	20	flow	flow	NN
10_1101-2021_01_06_425657	205	21	column	column	NN
10_1101-2021_01_06_425657	205	22	,	,	,
10_1101-2021_01_06_425657	205	23	washed	wash	VBD
10_1101-2021_01_06_425657	205	24	with	with	IN
10_1101-2021_01_06_425657	205	25	5	5	CD
10_1101-2021_01_06_425657	205	26	CVs	cv	NNS
10_1101-2021_01_06_425657	205	27	Strep	Strep	NNP
10_1101-2021_01_06_425657	205	28	-	-	HYPH
10_1101-2021_01_06_425657	205	29	Tactin	Tactin	NNP
10_1101-2021_01_06_425657	205	30	498	498	CD
10_1101-2021_01_06_425657	205	31	wash	wash	NN
10_1101-2021_01_06_425657	205	32	buffer	buffer	NN
10_1101-2021_01_06_425657	205	33	(	(	-LRB-
10_1101-2021_01_06_425657	205	34	100	100	CD
10_1101-2021_01_06_425657	205	35	mM	mM	NNP
10_1101-2021_01_06_425657	205	36	Tris	Tris	NNP
10_1101-2021_01_06_425657	205	37	pH	pH	NNP
10_1101-2021_01_06_425657	205	38	8.0	8.0	CD
10_1101-2021_01_06_425657	205	39	,	,	,
10_1101-2021_01_06_425657	205	40	150	150	CD
10_1101-2021_01_06_425657	205	41	mM	mm	NN
10_1101-2021_01_06_425657	205	42	NaCl	NaCl	NNP
10_1101-2021_01_06_425657	205	43	)	)	-RRB-
10_1101-2021_01_06_425657	205	44	,	,	,
10_1101-2021_01_06_425657	205	45	and	and	CC
10_1101-2021_01_06_425657	205	46	eluted	elute	VBN
10_1101-2021_01_06_425657	205	47	by	by	IN
10_1101-2021_01_06_425657	205	48	diluting	dilute	VBG
10_1101-2021_01_06_425657	205	49	1	1	CD
10_1101-2021_01_06_425657	205	50	ml	ml	NNP
10_1101-2021_01_06_425657	205	51	10X	10X	NNP
10_1101-2021_01_06_425657	205	52	Strep	Strep	NNP
10_1101-2021_01_06_425657	205	53	-	-	HYPH
10_1101-2021_01_06_425657	205	54	Tactin	Tactin	NNP
10_1101-2021_01_06_425657	205	55	499	499	CD
10_1101-2021_01_06_425657	205	56	Elution	Elution	NNP
10_1101-2021_01_06_425657	205	57	buffer	buffer	NN
10_1101-2021_01_06_425657	205	58	in	in	IN
10_1101-2021_01_06_425657	205	59	9	9	CD
10_1101-2021_01_06_425657	205	60	ml	ml	NNP
10_1101-2021_01_06_425657	205	61	Strep	Strep	NNP
10_1101-2021_01_06_425657	205	62	-	-	HYPH
10_1101-2021_01_06_425657	205	63	Tactin	Tactin	NNP
10_1101-2021_01_06_425657	205	64	wash	wash	NN
10_1101-2021_01_06_425657	205	65	buffer	buffer	NN
10_1101-2021_01_06_425657	205	66	and	and	CC
10_1101-2021_01_06_425657	205	67	collecting	collect	VBG
10_1101-2021_01_06_425657	205	68	1.5	1.5	CD
10_1101-2021_01_06_425657	205	69	ml	ml	NN
10_1101-2021_01_06_425657	205	70	fractions	fraction	NNS
10_1101-2021_01_06_425657	205	71	.	.	.
10_1101-2021_01_06_425657	206	1	Fractions	fraction	NNS
10_1101-2021_01_06_425657	206	2	500	500	CD
10_1101-2021_01_06_425657	206	3	containing	contain	VBG
10_1101-2021_01_06_425657	206	4	pure	pure	JJ
10_1101-2021_01_06_425657	206	5	,	,	,
10_1101-2021_01_06_425657	206	6	full	full	JJ
10_1101-2021_01_06_425657	206	7	-	-	HYPH
10_1101-2021_01_06_425657	206	8	length	length	NN
10_1101-2021_01_06_425657	206	9	Met4	Met4	NNP
10_1101-2021_01_06_425657	206	10	were	be	VBD
10_1101-2021_01_06_425657	206	11	pooled	pool	VBN
10_1101-2021_01_06_425657	206	12	and	and	CC
10_1101-2021_01_06_425657	206	13	concentrated	concentrate	VBN
10_1101-2021_01_06_425657	206	14	while	while	IN
10_1101-2021_01_06_425657	206	15	exchanging	exchange	VBG
10_1101-2021_01_06_425657	206	16	the	the	DT
10_1101-2021_01_06_425657	206	17	buffer	buffer	NN
10_1101-2021_01_06_425657	206	18	with	with	IN
10_1101-2021_01_06_425657	206	19	501	501	CD
10_1101-2021_01_06_425657	206	20	buffer	buffer	NN
10_1101-2021_01_06_425657	206	21	containing	contain	VBG
10_1101-2021_01_06_425657	206	22	30	30	CD
10_1101-2021_01_06_425657	206	23	mM	mM	NNP
10_1101-2021_01_06_425657	206	24	Tris	Tris	NNP
10_1101-2021_01_06_425657	206	25	pH	pH	NNP
10_1101-2021_01_06_425657	206	26	7.6	7.6	CD
10_1101-2021_01_06_425657	206	27	,	,	,
10_1101-2021_01_06_425657	206	28	100	100	CD
10_1101-2021_01_06_425657	206	29	mM	mM	NNP
10_1101-2021_01_06_425657	206	30	NaCl	NaCl	NNP
10_1101-2021_01_06_425657	206	31	,	,	,
10_1101-2021_01_06_425657	206	32	5	5	CD
10_1101-2021_01_06_425657	206	33	mM	mM	NNP
10_1101-2021_01_06_425657	206	34	MgCl2	mgcl2	NN
10_1101-2021_01_06_425657	206	35	,	,	,
10_1101-2021_01_06_425657	206	36	15	15	CD
10_1101-2021_01_06_425657	206	37	%	%	NN
10_1101-2021_01_06_425657	206	38	glycerol	glycerol	NN
10_1101-2021_01_06_425657	206	39	,	,	,
10_1101-2021_01_06_425657	206	40	and	and	CC
10_1101-2021_01_06_425657	206	41	2	2	CD
10_1101-2021_01_06_425657	206	42	mM	mM	NNP
10_1101-2021_01_06_425657	206	43	502	502	CD
10_1101-2021_01_06_425657	206	44	DTT	DTT	NNP
10_1101-2021_01_06_425657	206	45	.	.	.
10_1101-2021_01_06_425657	207	1	Protein	protein	NN
10_1101-2021_01_06_425657	207	2	concentration	concentration	NN
10_1101-2021_01_06_425657	207	3	was	be	VBD
10_1101-2021_01_06_425657	207	4	measured	measure	VBN
10_1101-2021_01_06_425657	207	5	and	and	CC
10_1101-2021_01_06_425657	207	6	1	1	CD
10_1101-2021_01_06_425657	207	7	mg	mg	NNP
10_1101-2021_01_06_425657	207	8	/	/	SYM
10_1101-2021_01_06_425657	207	9	ml	ml	NNP
10_1101-2021_01_06_425657	207	10	aliquots	aliquot	NNS
10_1101-2021_01_06_425657	207	11	were	be	VBD
10_1101-2021_01_06_425657	207	12	made	make	VBN
10_1101-2021_01_06_425657	207	13	and	and	CC
10_1101-2021_01_06_425657	207	14	stored	store	VBN
10_1101-2021_01_06_425657	207	15	at	at	IN
10_1101-2021_01_06_425657	207	16	−80	−80	NNP
10_1101-2021_01_06_425657	207	17	°	°	,
10_1101-2021_01_06_425657	207	18	C	C	NNP
10_1101-2021_01_06_425657	207	19	.	.	.
10_1101-2021_01_06_425657	208	1	503	503	CD
10_1101-2021_01_06_425657	208	2	504	504	CD
10_1101-2021_01_06_425657	208	3	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	208	4	IP	IP	NNP
10_1101-2021_01_06_425657	208	5	and	and	CC
10_1101-2021_01_06_425657	208	6	in	in	FW
10_1101-2021_01_06_425657	208	7	vitro	vitro	FW
10_1101-2021_01_06_425657	208	8	ubiquitination	ubiquitination	NNP
10_1101-2021_01_06_425657	208	9	assay	assay	NNP
10_1101-2021_01_06_425657	208	10	505	505	CD
10_1101-2021_01_06_425657	208	11	Strains	Strains	NNP
10_1101-2021_01_06_425657	208	12	containing	contain	VBG
10_1101-2021_01_06_425657	208	13	Flag	flag	NN
10_1101-2021_01_06_425657	208	14	-	-	HYPH
10_1101-2021_01_06_425657	208	15	tagged	tag	VBN
10_1101-2021_01_06_425657	208	16	Met30	Met30	NNP
10_1101-2021_01_06_425657	208	17	were	be	VBD
10_1101-2021_01_06_425657	208	18	grown	grow	VBN
10_1101-2021_01_06_425657	208	19	in	in	IN
10_1101-2021_01_06_425657	208	20	rich	rich	JJ
10_1101-2021_01_06_425657	208	21	YPL	YPL	NNP
10_1101-2021_01_06_425657	208	22	media	medium	NNS
10_1101-2021_01_06_425657	208	23	overnight	overnight	RB
10_1101-2021_01_06_425657	208	24	to	to	IN
10_1101-2021_01_06_425657	208	25	mid	mid	JJ
10_1101-2021_01_06_425657	208	26	-	-	JJ
10_1101-2021_01_06_425657	208	27	late	late	JJ
10_1101-2021_01_06_425657	208	28	log	log	NN
10_1101-2021_01_06_425657	208	29	506	506	CD
10_1101-2021_01_06_425657	208	30	phase	phase	NN
10_1101-2021_01_06_425657	208	31	before	before	IN
10_1101-2021_01_06_425657	208	32	dilution	dilution	NN
10_1101-2021_01_06_425657	208	33	with	with	IN
10_1101-2021_01_06_425657	208	34	more	more	JJR
10_1101-2021_01_06_425657	208	35	YPL	YPL	NNP
10_1101-2021_01_06_425657	208	36	and	and	CC
10_1101-2021_01_06_425657	208	37	grown	grow	VBN
10_1101-2021_01_06_425657	208	38	for	for	IN
10_1101-2021_01_06_425657	208	39	3	3	CD
10_1101-2021_01_06_425657	208	40	h	h	NN
10_1101-2021_01_06_425657	208	41	before	before	IN
10_1101-2021_01_06_425657	208	42	half	half	NN
10_1101-2021_01_06_425657	208	43	of	of	IN
10_1101-2021_01_06_425657	208	44	the	the	DT
10_1101-2021_01_06_425657	208	45	culture	culture	NN
10_1101-2021_01_06_425657	208	46	was	be	VBD
10_1101-2021_01_06_425657	208	47	separated	separate	VBN
10_1101-2021_01_06_425657	208	48	507	507	CD
10_1101-2021_01_06_425657	208	49	and	and	CC
10_1101-2021_01_06_425657	208	50	switched	switch	VBD
10_1101-2021_01_06_425657	208	51	−sulfur	−sulfur	NNP
10_1101-2021_01_06_425657	208	52	SFL	SFL	NNP
10_1101-2021_01_06_425657	208	53	media	medium	NNS
10_1101-2021_01_06_425657	208	54	for	for	IN
10_1101-2021_01_06_425657	208	55	15	15	CD
10_1101-2021_01_06_425657	208	56	min	min	NN
10_1101-2021_01_06_425657	208	57	.	.	.
10_1101-2021_01_06_425657	209	1	Subsequently	subsequently	RB
10_1101-2021_01_06_425657	209	2	,	,	,
10_1101-2021_01_06_425657	209	3	approximately	approximately	RB
10_1101-2021_01_06_425657	209	4	3000	3000	CD
10_1101-2021_01_06_425657	209	5	OD600	od600	NN
10_1101-2021_01_06_425657	209	6	units	unit	NNS
10_1101-2021_01_06_425657	209	7	each	each	DT
10_1101-2021_01_06_425657	209	8	508	508	CD
10_1101-2021_01_06_425657	209	9	of	of	IN
10_1101-2021_01_06_425657	209	10	YPL	YPL	NNP
10_1101-2021_01_06_425657	209	11	and	and	CC
10_1101-2021_01_06_425657	209	12	SFL	SFL	NNP
10_1101-2021_01_06_425657	209	13	cultured	cultured	JJ
10_1101-2021_01_06_425657	209	14	yeast	yeast	NN
10_1101-2021_01_06_425657	209	15	were	be	VBD
10_1101-2021_01_06_425657	209	16	spun	spin	VBN
10_1101-2021_01_06_425657	209	17	down	down	RP
10_1101-2021_01_06_425657	209	18	and	and	CC
10_1101-2021_01_06_425657	209	19	frozen	freeze	VBN
10_1101-2021_01_06_425657	209	20	in	in	IN
10_1101-2021_01_06_425657	209	21	liquid	liquid	JJ
10_1101-2021_01_06_425657	209	22	nitrogen	nitrogen	NN
10_1101-2021_01_06_425657	209	23	.	.	.
10_1101-2021_01_06_425657	210	1	Frozen	frozen	JJ
10_1101-2021_01_06_425657	210	2	yeast	yeast	NN
10_1101-2021_01_06_425657	210	3	pellets	pellet	NNS
10_1101-2021_01_06_425657	210	4	509	509	CD
10_1101-2021_01_06_425657	210	5	were	be	VBD
10_1101-2021_01_06_425657	210	6	cryomilled	cryomille	VBN
10_1101-2021_01_06_425657	210	7	by	by	IN
10_1101-2021_01_06_425657	210	8	adding	add	VBG
10_1101-2021_01_06_425657	210	9	the	the	DT
10_1101-2021_01_06_425657	210	10	pellet	pellet	NN
10_1101-2021_01_06_425657	210	11	to	to	IN
10_1101-2021_01_06_425657	210	12	a	a	DT
10_1101-2021_01_06_425657	210	13	pre	pre	JJ
10_1101-2021_01_06_425657	210	14	-	-	VBN
10_1101-2021_01_06_425657	210	15	cooled	cool	VBN
10_1101-2021_01_06_425657	210	16	50	50	CD
10_1101-2021_01_06_425657	210	17	ml	ml	NN
10_1101-2021_01_06_425657	210	18	milling	milling	NN
10_1101-2021_01_06_425657	210	19	jar	jar	NN
10_1101-2021_01_06_425657	210	20	containing	contain	VBG
10_1101-2021_01_06_425657	210	21	a	a	DT
10_1101-2021_01_06_425657	210	22	20	20	CD
10_1101-2021_01_06_425657	210	23	mm	mm	CD
10_1101-2021_01_06_425657	210	24	stainless	stainless	NN
10_1101-2021_01_06_425657	210	25	510	510	CD
10_1101-2021_01_06_425657	210	26	steel	steel	NN
10_1101-2021_01_06_425657	210	27	ball	ball	NN
10_1101-2021_01_06_425657	210	28	.	.	.
10_1101-2021_01_06_425657	211	1	Yeast	yeast	NN
10_1101-2021_01_06_425657	211	2	cell	cell	NN
10_1101-2021_01_06_425657	211	3	lysis	lysis	NN
10_1101-2021_01_06_425657	211	4	was	be	VBD
10_1101-2021_01_06_425657	211	5	performed	perform	VBN
10_1101-2021_01_06_425657	211	6	by	by	IN
10_1101-2021_01_06_425657	211	7	milling	mill	VBG
10_1101-2021_01_06_425657	211	8	in	in	IN
10_1101-2021_01_06_425657	211	9	3	3	CD
10_1101-2021_01_06_425657	211	10	cycles	cycle	NNS
10_1101-2021_01_06_425657	211	11	at	at	IN
10_1101-2021_01_06_425657	211	12	25	25	CD
10_1101-2021_01_06_425657	211	13	Hrz	hrz	NN
10_1101-2021_01_06_425657	211	14	for	for	IN
10_1101-2021_01_06_425657	211	15	3	3	CD
10_1101-2021_01_06_425657	211	16	min	min	NN
10_1101-2021_01_06_425657	211	17	and	and	CC
10_1101-2021_01_06_425657	211	18	chilling	chill	VBG
10_1101-2021_01_06_425657	211	19	in	in	IN
10_1101-2021_01_06_425657	211	20	511	511	CD
10_1101-2021_01_06_425657	211	21	liquid	liquid	JJ
10_1101-2021_01_06_425657	211	22	nitrogen	nitrogen	NN
10_1101-2021_01_06_425657	211	23	for	for	IN
10_1101-2021_01_06_425657	211	24	1	1	CD
10_1101-2021_01_06_425657	211	25	min	min	NN
10_1101-2021_01_06_425657	211	26	.	.	.
10_1101-2021_01_06_425657	212	1	Cryomilled	cryomille	VBN
10_1101-2021_01_06_425657	212	2	yeast	yeast	NN
10_1101-2021_01_06_425657	212	3	powder	powder	NN
10_1101-2021_01_06_425657	212	4	(	(	-LRB-
10_1101-2021_01_06_425657	212	5	~	~	NFP
10_1101-2021_01_06_425657	212	6	4	4	CD
10_1101-2021_01_06_425657	212	7	grams	gram	NNS
10_1101-2021_01_06_425657	212	8	)	)	-RRB-
10_1101-2021_01_06_425657	212	9	was	be	VBD
10_1101-2021_01_06_425657	212	10	moved	move	VBN
10_1101-2021_01_06_425657	212	11	to	to	IN
10_1101-2021_01_06_425657	212	12	a	a	DT
10_1101-2021_01_06_425657	212	13	50	50	CD
10_1101-2021_01_06_425657	212	14	ml	ml	NN
10_1101-2021_01_06_425657	212	15	conical	conical	JJ
10_1101-2021_01_06_425657	212	16	and	and	CC
10_1101-2021_01_06_425657	212	17	512	512	CD
10_1101-2021_01_06_425657	212	18	resuspended	resuspend	VBD
10_1101-2021_01_06_425657	212	19	in	in	IN
10_1101-2021_01_06_425657	212	20	16	16	CD
10_1101-2021_01_06_425657	212	21	ml	ml	NNP
10_1101-2021_01_06_425657	212	22	SCF	SCF	NNP
10_1101-2021_01_06_425657	212	23	IP	IP	NNP
10_1101-2021_01_06_425657	212	24	buffer	buffer	NN
10_1101-2021_01_06_425657	212	25	(	(	-LRB-
10_1101-2021_01_06_425657	212	26	50	50	CD
10_1101-2021_01_06_425657	212	27	mM	mM	NNP
10_1101-2021_01_06_425657	212	28	Tris	Tris	NNP
10_1101-2021_01_06_425657	212	29	pH	pH	NNP
10_1101-2021_01_06_425657	212	30	7.5	7.5	CD
10_1101-2021_01_06_425657	212	31	,	,	,
10_1101-2021_01_06_425657	212	32	150	150	CD
10_1101-2021_01_06_425657	212	33	mM	mm	NN
10_1101-2021_01_06_425657	212	34	NaCl	NaCl	NNP
10_1101-2021_01_06_425657	212	35	,	,	,
10_1101-2021_01_06_425657	212	36	10	10	CD
10_1101-2021_01_06_425657	212	37	mM	mm	NN
10_1101-2021_01_06_425657	212	38	NaF	naf	NN
10_1101-2021_01_06_425657	212	39	,	,	,
10_1101-2021_01_06_425657	212	40	1	1	CD
10_1101-2021_01_06_425657	212	41	%	%	NN
10_1101-2021_01_06_425657	212	42	NP-40	NP-40	NNP
10_1101-2021_01_06_425657	212	43	,	,	,
10_1101-2021_01_06_425657	212	44	513	513	CD
10_1101-2021_01_06_425657	212	45	1	1	CD
10_1101-2021_01_06_425657	212	46	mM	mm	NN
10_1101-2021_01_06_425657	212	47	EDTA	EDTA	NNP
10_1101-2021_01_06_425657	212	48	,	,	,
10_1101-2021_01_06_425657	212	49	5	5	CD
10_1101-2021_01_06_425657	212	50	%	%	NN
10_1101-2021_01_06_425657	212	51	glycerol	glycerol	NN
10_1101-2021_01_06_425657	212	52	)	)	-RRB-
10_1101-2021_01_06_425657	212	53	containing	contain	VBG
10_1101-2021_01_06_425657	212	54	10	10	CD
10_1101-2021_01_06_425657	212	55	µM	µM	NNP
10_1101-2021_01_06_425657	212	56	leupeptin	leupeptin	NN
10_1101-2021_01_06_425657	212	57	,	,	,
10_1101-2021_01_06_425657	212	58	1	1	CD
10_1101-2021_01_06_425657	212	59	mM	mm	NN
10_1101-2021_01_06_425657	212	60	PMSF	PMSF	NNP
10_1101-2021_01_06_425657	212	61	,	,	,
10_1101-2021_01_06_425657	212	62	5	5	CD
10_1101-2021_01_06_425657	212	63	µM	µM	NNP
10_1101-2021_01_06_425657	212	64	pepstatin	pepstatin	NN
10_1101-2021_01_06_425657	212	65	,	,	,
10_1101-2021_01_06_425657	212	66	100	100	CD
10_1101-2021_01_06_425657	212	67	µM	µM	NNP
10_1101-2021_01_06_425657	212	68	514	514	CD
10_1101-2021_01_06_425657	212	69	sodium	sodium	NN
10_1101-2021_01_06_425657	212	70	orthovanadate	orthovanadate	NN
10_1101-2021_01_06_425657	212	71	,	,	,
10_1101-2021_01_06_425657	212	72	2	2	CD
10_1101-2021_01_06_425657	212	73	mM	mM	NNP
10_1101-2021_01_06_425657	212	74	1	1	CD
10_1101-2021_01_06_425657	212	75	,	,	,
10_1101-2021_01_06_425657	212	76	10-phenanthroline	10-phenanthroline	CD
10_1101-2021_01_06_425657	212	77	,	,	,
10_1101-2021_01_06_425657	212	78	1	1	CD
10_1101-2021_01_06_425657	212	79	µM	µM	NNP
10_1101-2021_01_06_425657	212	80	MLN4924	MLN4924	NNP
10_1101-2021_01_06_425657	212	81	,	,	,
10_1101-2021_01_06_425657	212	82	1X	1x	NN
10_1101-2021_01_06_425657	212	83	Roche	Roche	NNP
10_1101-2021_01_06_425657	212	84	EDTA	EDTA	NNP
10_1101-2021_01_06_425657	212	85	-	-	HYPH
10_1101-2021_01_06_425657	212	86	free	free	JJ
10_1101-2021_01_06_425657	212	87	515	515	CD
10_1101-2021_01_06_425657	212	88	protease	protease	NN
10_1101-2021_01_06_425657	212	89	inhibitor	inhibitor	NN
10_1101-2021_01_06_425657	212	90	cocktail	cocktail	NN
10_1101-2021_01_06_425657	212	91	tablet	tablet	NN
10_1101-2021_01_06_425657	212	92	,	,	,
10_1101-2021_01_06_425657	212	93	and	and	CC
10_1101-2021_01_06_425657	212	94	1	1	CD
10_1101-2021_01_06_425657	212	95	mM	mM	NNP
10_1101-2021_01_06_425657	212	96	DTT	DTT	NNP
10_1101-2021_01_06_425657	212	97	when	when	WRB
10_1101-2021_01_06_425657	212	98	specified	specify	VBD
10_1101-2021_01_06_425657	212	99	.	.	.
10_1101-2021_01_06_425657	213	1	Small	small	JJ
10_1101-2021_01_06_425657	213	2	molecule	molecule	JJ
10_1101-2021_01_06_425657	213	3	inhibitors	inhibitor	NNS
10_1101-2021_01_06_425657	213	4	of	of	IN
10_1101-2021_01_06_425657	213	5	516	516	CD
10_1101-2021_01_06_425657	213	6	neddylation	neddylation	NN
10_1101-2021_01_06_425657	213	7	and	and	CC
10_1101-2021_01_06_425657	213	8	deneddylation	deneddylation	NN
10_1101-2021_01_06_425657	213	9	were	be	VBD
10_1101-2021_01_06_425657	213	10	included	include	VBN
10_1101-2021_01_06_425657	213	11	,	,	,
10_1101-2021_01_06_425657	213	12	and	and	CC
10_1101-2021_01_06_425657	213	13	along	along	IN
10_1101-2021_01_06_425657	213	14	with	with	IN
10_1101-2021_01_06_425657	213	15	a	a	DT
10_1101-2021_01_06_425657	213	16	short	short	JJ
10_1101-2021_01_06_425657	213	17	IP	IP	NNP
10_1101-2021_01_06_425657	213	18	time	time	NN
10_1101-2021_01_06_425657	213	19	,	,	,
10_1101-2021_01_06_425657	213	20	intended	intend	VBN
10_1101-2021_01_06_425657	213	21	to	to	TO
10_1101-2021_01_06_425657	213	22	minimize	minimize	VB
10_1101-2021_01_06_425657	213	23	517	517	CD
10_1101-2021_01_06_425657	213	24	exchange	exchange	NN
10_1101-2021_01_06_425657	213	25	and	and	CC
10_1101-2021_01_06_425657	213	26	preserve	preserve	VB
10_1101-2021_01_06_425657	213	27	F	F	NNP
10_1101-2021_01_06_425657	213	28	-	-	HYPH
10_1101-2021_01_06_425657	213	29	box	box	NNP
10_1101-2021_01_06_425657	213	30	protein	protein	NN
10_1101-2021_01_06_425657	213	31	/	/	,
10_1101-2021_01_06_425657	213	32	Skp1	skp1	CC
10_1101-2021_01_06_425657	213	33	substrate	substrate	VB
10_1101-2021_01_06_425657	213	34	recognition	recognition	NN
10_1101-2021_01_06_425657	213	35	modules	module	NNS
10_1101-2021_01_06_425657	213	36	(	(	-LRB-
10_1101-2021_01_06_425657	213	37	Reitsma	Reitsma	NNP
10_1101-2021_01_06_425657	213	38	et	et	NNP
10_1101-2021_01_06_425657	213	39	al	al	NNP
10_1101-2021_01_06_425657	213	40	.	.	NNP
10_1101-2021_01_06_425657	213	41	,	,	,
10_1101-2021_01_06_425657	213	42	2017	2017	CD
10_1101-2021_01_06_425657	213	43	)	)	-RRB-
10_1101-2021_01_06_425657	213	44	.	.	.
10_1101-2021_01_06_425657	214	1	518	518	CD
10_1101-2021_01_06_425657	214	2	The	the	DT
10_1101-2021_01_06_425657	214	3	lysate	lysate	NN
10_1101-2021_01_06_425657	214	4	was	be	VBD
10_1101-2021_01_06_425657	214	5	then	then	RB
10_1101-2021_01_06_425657	214	6	briefly	briefly	RB
10_1101-2021_01_06_425657	214	7	sonicated	sonicate	VBN
10_1101-2021_01_06_425657	214	8	to	to	IN
10_1101-2021_01_06_425657	214	9	sheer	sheer	JJ
10_1101-2021_01_06_425657	214	10	DNA	dna	NN
10_1101-2021_01_06_425657	214	11	and	and	CC
10_1101-2021_01_06_425657	214	12	subsequently	subsequently	RB
10_1101-2021_01_06_425657	214	13	clarified	clarify	VBN
10_1101-2021_01_06_425657	214	14	at	at	IN
10_1101-2021_01_06_425657	214	15	35,000xg	35,000xg	CD
10_1101-2021_01_06_425657	214	16	for	for	IN
10_1101-2021_01_06_425657	214	17	20	20	CD
10_1101-2021_01_06_425657	214	18	519	519	CD
10_1101-2021_01_06_425657	214	19	min	min	NN
10_1101-2021_01_06_425657	214	20	and	and	CC
10_1101-2021_01_06_425657	214	21	the	the	DT
10_1101-2021_01_06_425657	214	22	supernatant	supernatant	JJ
10_1101-2021_01_06_425657	214	23	was	be	VBD
10_1101-2021_01_06_425657	214	24	incubated	incubate	VBN
10_1101-2021_01_06_425657	214	25	with	with	IN
10_1101-2021_01_06_425657	214	26	with	with	IN
10_1101-2021_01_06_425657	214	27	50	50	CD
10_1101-2021_01_06_425657	214	28	µL	µl	CD
10_1101-2021_01_06_425657	214	29	of	of	IN
10_1101-2021_01_06_425657	214	30	Thermo	Thermo	NNP
10_1101-2021_01_06_425657	214	31	Fisher	Fisher	NNP
10_1101-2021_01_06_425657	214	32	protein	protein	NN
10_1101-2021_01_06_425657	214	33	G	g	NN
10_1101-2021_01_06_425657	214	34	dynabeads	dynabead	VBZ
10_1101-2021_01_06_425657	214	35	520	520	CD
10_1101-2021_01_06_425657	214	36	(	(	-LRB-
10_1101-2021_01_06_425657	214	37	Cat	Cat	NNP
10_1101-2021_01_06_425657	214	38	#	#	NNP
10_1101-2021_01_06_425657	214	39	10004D	10004D	NNP
10_1101-2021_01_06_425657	214	40	)	)	-RRB-
10_1101-2021_01_06_425657	214	41	DMP	DMP	NNP
10_1101-2021_01_06_425657	214	42	crosslinked	crosslinke	VBD
10_1101-2021_01_06_425657	214	43	to	to	IN
10_1101-2021_01_06_425657	214	44	25	25	CD
10_1101-2021_01_06_425657	214	45	µL	µl	CD
10_1101-2021_01_06_425657	214	46	of	of	IN
10_1101-2021_01_06_425657	214	47	Mouse	Mouse	NNP
10_1101-2021_01_06_425657	214	48	anti	anti	NNP
10_1101-2021_01_06_425657	214	49	-	-	NNP
10_1101-2021_01_06_425657	214	50	FLAG	FLAG	NNP
10_1101-2021_01_06_425657	214	51	M2	M2	NNP
10_1101-2021_01_06_425657	214	52	antibody	antibody	NN
10_1101-2021_01_06_425657	214	53	(	(	-LRB-
10_1101-2021_01_06_425657	214	54	Sigma	Sigma	NNP
10_1101-2021_01_06_425657	214	55	,	,	,
10_1101-2021_01_06_425657	214	56	Cat#F3165	Cat#F3165	NNP
10_1101-2021_01_06_425657	214	57	)	)	-RRB-
10_1101-2021_01_06_425657	214	58	521	521	CD
10_1101-2021_01_06_425657	214	59	for	for	IN
10_1101-2021_01_06_425657	214	60	30	30	CD
10_1101-2021_01_06_425657	214	61	min	min	NN
10_1101-2021_01_06_425657	214	62	at	at	IN
10_1101-2021_01_06_425657	214	63	4	4	CD
10_1101-2021_01_06_425657	214	64	°	°	NNS
10_1101-2021_01_06_425657	214	65	C	C	NNP
10_1101-2021_01_06_425657	214	66	.	.	.
10_1101-2021_01_06_425657	215	1	The	the	DT
10_1101-2021_01_06_425657	215	2	agarose	agarose	NN
10_1101-2021_01_06_425657	215	3	was	be	VBD
10_1101-2021_01_06_425657	215	4	pelleted	pellete	VBN
10_1101-2021_01_06_425657	215	5	at	at	IN
10_1101-2021_01_06_425657	215	6	500xg	500xg	NNP
10_1101-2021_01_06_425657	215	7	for	for	IN
10_1101-2021_01_06_425657	215	8	5	5	CD
10_1101-2021_01_06_425657	215	9	min	min	NN
10_1101-2021_01_06_425657	215	10	,	,	,
10_1101-2021_01_06_425657	215	11	the	the	DT
10_1101-2021_01_06_425657	215	12	supernatant	supernatant	JJ
10_1101-2021_01_06_425657	215	13	was	be	VBD
10_1101-2021_01_06_425657	215	14	aspirated	aspirate	VBN
10_1101-2021_01_06_425657	215	15	,	,	,
10_1101-2021_01_06_425657	215	16	and	and	CC
10_1101-2021_01_06_425657	215	17	522	522	CD
10_1101-2021_01_06_425657	215	18	the	the	DT
10_1101-2021_01_06_425657	215	19	magnetic	magnetic	JJ
10_1101-2021_01_06_425657	215	20	beads	bead	NNS
10_1101-2021_01_06_425657	215	21	transferred	transfer	VBN
10_1101-2021_01_06_425657	215	22	to	to	IN
10_1101-2021_01_06_425657	215	23	an	an	DT
10_1101-2021_01_06_425657	215	24	Eppendorf	Eppendorf	NNP
10_1101-2021_01_06_425657	215	25	tube	tube	NN
10_1101-2021_01_06_425657	215	26	.	.	.
10_1101-2021_01_06_425657	216	1	The	the	DT
10_1101-2021_01_06_425657	216	2	beads	bead	NNS
10_1101-2021_01_06_425657	216	3	were	be	VBD
10_1101-2021_01_06_425657	216	4	washed	wash	VBN
10_1101-2021_01_06_425657	216	5	5	5	CD
10_1101-2021_01_06_425657	216	6	times	time	NNS
10_1101-2021_01_06_425657	216	7	with	with	IN
10_1101-2021_01_06_425657	216	8	1	1	CD
10_1101-2021_01_06_425657	216	9	ml	ml	NNP
10_1101-2021_01_06_425657	216	10	523	523	CD
10_1101-2021_01_06_425657	216	11	SCF	SCF	NNP
10_1101-2021_01_06_425657	216	12	IP	IP	NNP
10_1101-2021_01_06_425657	216	13	buffer	buffer	VBP
10_1101-2021_01_06_425657	216	14	with	with	IN
10_1101-2021_01_06_425657	216	15	or	or	CC
10_1101-2021_01_06_425657	216	16	without	without	IN
10_1101-2021_01_06_425657	216	17	DTT	DTT	NNP
10_1101-2021_01_06_425657	216	18	before	before	IN
10_1101-2021_01_06_425657	216	19	elution	elution	NN
10_1101-2021_01_06_425657	216	20	with	with	IN
10_1101-2021_01_06_425657	216	21	1	1	CD
10_1101-2021_01_06_425657	216	22	mg	mg	NNP
10_1101-2021_01_06_425657	216	23	/	/	SYM
10_1101-2021_01_06_425657	216	24	ml	ml	NNP
10_1101-2021_01_06_425657	216	25	Flag	Flag	NNP
10_1101-2021_01_06_425657	216	26	peptide	peptide	NN
10_1101-2021_01_06_425657	216	27	in	in	IN
10_1101-2021_01_06_425657	216	28	PBS	PBS	NNP
10_1101-2021_01_06_425657	216	29	.	.	.
10_1101-2021_01_06_425657	217	1	The	the	DT
10_1101-2021_01_06_425657	217	2	eluent	eluent	NN
10_1101-2021_01_06_425657	217	3	524	524	CD
10_1101-2021_01_06_425657	217	4	was	be	VBD
10_1101-2021_01_06_425657	217	5	concentrated	concentrate	VBN
10_1101-2021_01_06_425657	217	6	in	in	IN
10_1101-2021_01_06_425657	217	7	Amicon	Amicon	NNP
10_1101-2021_01_06_425657	217	8	Ultra-0.5	Ultra-0.5	NNP
10_1101-2021_01_06_425657	217	9	centrifugal	centrifugal	JJ
10_1101-2021_01_06_425657	217	10	filter	filter	NN
10_1101-2021_01_06_425657	217	11	units	unit	NNS
10_1101-2021_01_06_425657	217	12	with	with	IN
10_1101-2021_01_06_425657	217	13	10	10	CD
10_1101-2021_01_06_425657	217	14	kDa	kDa	NNS
10_1101-2021_01_06_425657	217	15	MW	MW	NNP
10_1101-2021_01_06_425657	217	16	cutoffs	cutoff	NNS
10_1101-2021_01_06_425657	217	17	to	to	IN
10_1101-2021_01_06_425657	217	18	a	a	DT
10_1101-2021_01_06_425657	217	19	final	final	JJ
10_1101-2021_01_06_425657	217	20	525	525	CD
10_1101-2021_01_06_425657	217	21	volume	volume	NN
10_1101-2021_01_06_425657	217	22	of	of	IN
10_1101-2021_01_06_425657	217	23	~	~	NFP
10_1101-2021_01_06_425657	217	24	40	40	CD
10_1101-2021_01_06_425657	217	25	µL.	µl.	NN
10_1101-2021_01_06_425657	218	1	Silver	silver	NN
10_1101-2021_01_06_425657	218	2	stains	stain	NNS
10_1101-2021_01_06_425657	218	3	of	of	IN
10_1101-2021_01_06_425657	218	4	the	the	DT
10_1101-2021_01_06_425657	218	5	IPs	ip	NNS
10_1101-2021_01_06_425657	218	6	were	be	VBD
10_1101-2021_01_06_425657	218	7	carried	carry	VBN
10_1101-2021_01_06_425657	218	8	out	out	RP
10_1101-2021_01_06_425657	218	9	using	use	VBG
10_1101-2021_01_06_425657	218	10	the	the	DT
10_1101-2021_01_06_425657	218	11	Pierce	Pierce	NNP
10_1101-2021_01_06_425657	218	12	Silver	Silver	NNP
10_1101-2021_01_06_425657	218	13	Stain	Stain	NNP
10_1101-2021_01_06_425657	218	14	for	for	IN
10_1101-2021_01_06_425657	218	15	Mass	Mass	NNP
10_1101-2021_01_06_425657	218	16	526	526	CD
10_1101-2021_01_06_425657	218	17	Spectrometry	Spectrometry	NNP
10_1101-2021_01_06_425657	218	18	kit	kit	NN
10_1101-2021_01_06_425657	218	19	(	(	-LRB-
10_1101-2021_01_06_425657	218	20	Cat#24600	cat#24600	NN
10_1101-2021_01_06_425657	218	21	)	)	-RRB-
10_1101-2021_01_06_425657	218	22	according	accord	VBG
10_1101-2021_01_06_425657	218	23	to	to	IN
10_1101-2021_01_06_425657	218	24	the	the	DT
10_1101-2021_01_06_425657	218	25	manufacturers	manufacturer	NNS
10_1101-2021_01_06_425657	218	26	protocol	protocol	NNP
10_1101-2021_01_06_425657	218	27	.	.	.
10_1101-2021_01_06_425657	219	1	The	the	DT
10_1101-2021_01_06_425657	219	2	in	in	FW
10_1101-2021_01_06_425657	219	3	vitro	vitro	FW
10_1101-2021_01_06_425657	219	4	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	219	5	527	527	CD
10_1101-2021_01_06_425657	219	6	assay	assay	NNP
10_1101-2021_01_06_425657	219	7	was	be	VBD
10_1101-2021_01_06_425657	219	8	performed	perform	VBN
10_1101-2021_01_06_425657	219	9	by	by	IN
10_1101-2021_01_06_425657	219	10	placing	place	VBG
10_1101-2021_01_06_425657	219	11	a	a	DT
10_1101-2021_01_06_425657	219	12	PCR	PCR	NNP
10_1101-2021_01_06_425657	219	13	tube	tube	NN
10_1101-2021_01_06_425657	219	14	on	on	IN
10_1101-2021_01_06_425657	219	15	ice	ice	NN
10_1101-2021_01_06_425657	219	16	and	and	CC
10_1101-2021_01_06_425657	219	17	adding	add	VBG
10_1101-2021_01_06_425657	219	18	to	to	IN
10_1101-2021_01_06_425657	219	19	it	-PRON-	PRP
10_1101-2021_01_06_425657	219	20	29	29	CD
10_1101-2021_01_06_425657	219	21	µL	µl	CD
10_1101-2021_01_06_425657	219	22	of	of	IN
10_1101-2021_01_06_425657	219	23	water	water	NN
10_1101-2021_01_06_425657	219	24	,	,	,
10_1101-2021_01_06_425657	219	25	8	8	CD
10_1101-2021_01_06_425657	219	26	µL	µl	CD
10_1101-2021_01_06_425657	219	27	of	of	IN
10_1101-2021_01_06_425657	219	28	5X	5X	NNP
10_1101-2021_01_06_425657	219	29	528	528	CD
10_1101-2021_01_06_425657	219	30	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	219	31	assay	assay	NNP
10_1101-2021_01_06_425657	219	32	buffer	buffer	NNP
10_1101-2021_01_06_425657	219	33	(	(	-LRB-
10_1101-2021_01_06_425657	219	34	250	250	CD
10_1101-2021_01_06_425657	219	35	mM	mM	NNP
10_1101-2021_01_06_425657	219	36	Tris	Tris	NNP
10_1101-2021_01_06_425657	219	37	pH	pH	NNP
10_1101-2021_01_06_425657	219	38	7.5	7.5	CD
10_1101-2021_01_06_425657	219	39	,	,	,
10_1101-2021_01_06_425657	219	40	5	5	CD
10_1101-2021_01_06_425657	219	41	mM	mm	NN
10_1101-2021_01_06_425657	219	42	ATP	atp	NN
10_1101-2021_01_06_425657	219	43	,	,	,
10_1101-2021_01_06_425657	219	44	25	25	CD
10_1101-2021_01_06_425657	219	45	mM	mm	NN
10_1101-2021_01_06_425657	219	46	MgCl2	mgcl2	NN
10_1101-2021_01_06_425657	219	47	,	,	,
10_1101-2021_01_06_425657	219	48	25	25	CD
10_1101-2021_01_06_425657	219	49	%	%	NN
10_1101-2021_01_06_425657	219	50	glycerol	glycerol	NN
10_1101-2021_01_06_425657	219	51	)	)	-RRB-
10_1101-2021_01_06_425657	219	52	,	,	,
10_1101-2021_01_06_425657	219	53	1.2	1.2	CD
10_1101-2021_01_06_425657	219	54	529	529	CD
10_1101-2021_01_06_425657	219	55	µL	µL	.
10_1101-2021_01_06_425657	219	56	Uba1	uba1	JJ
10_1101-2021_01_06_425657	219	57	(	(	-LRB-
10_1101-2021_01_06_425657	219	58	FC	FC	NNP
10_1101-2021_01_06_425657	219	59	=	=	SYM
10_1101-2021_01_06_425657	219	60	220	220	CD
10_1101-2021_01_06_425657	219	61	nM	nM	NNP
10_1101-2021_01_06_425657	219	62	)	)	-RRB-
10_1101-2021_01_06_425657	219	63	,	,	,
10_1101-2021_01_06_425657	219	64	1.2	1.2	CD
10_1101-2021_01_06_425657	219	65	µL	µL	NNP
10_1101-2021_01_06_425657	219	66	Cdc34	Cdc34	NNP
10_1101-2021_01_06_425657	219	67	(	(	-LRB-
10_1101-2021_01_06_425657	219	68	FC	FC	NNP
10_1101-2021_01_06_425657	219	69	=	=	SYM
10_1101-2021_01_06_425657	219	70	880	880	CD
10_1101-2021_01_06_425657	219	71	nM	nM	NNP
10_1101-2021_01_06_425657	219	72	)	)	-RRB-
10_1101-2021_01_06_425657	219	73	,	,	,
10_1101-2021_01_06_425657	219	74	0.5	0.5	CD
10_1101-2021_01_06_425657	219	75	µL	µl	CD
10_1101-2021_01_06_425657	219	76	yeast	yeast	NN
10_1101-2021_01_06_425657	219	77	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	219	78	(	(	-LRB-
10_1101-2021_01_06_425657	219	79	Boston	Boston	NNP
10_1101-2021_01_06_425657	219	80	Biochem	Biochem	NNP
10_1101-2021_01_06_425657	219	81	,	,	,
10_1101-2021_01_06_425657	219	82	530	530	CD
10_1101-2021_01_06_425657	219	83	FC	fc	NN
10_1101-2021_01_06_425657	219	84	=	=	SYM
10_1101-2021_01_06_425657	219	85	15.5	15.5	CD
10_1101-2021_01_06_425657	219	86	µM	µM	NNP
10_1101-2021_01_06_425657	219	87	)	)	-RRB-
10_1101-2021_01_06_425657	219	88	and	and	CC
10_1101-2021_01_06_425657	219	89	incubating	incubate	VBG
10_1101-2021_01_06_425657	219	90	at	at	IN
10_1101-2021_01_06_425657	219	91	RT	RT	NNP
10_1101-2021_01_06_425657	219	92	for	for	IN
10_1101-2021_01_06_425657	219	93	20	20	CD
10_1101-2021_01_06_425657	219	94	min	min	NN
10_1101-2021_01_06_425657	219	95	.	.	.
10_1101-2021_01_06_425657	220	1	The	the	DT
10_1101-2021_01_06_425657	220	2	PCR	PCR	NNP
10_1101-2021_01_06_425657	220	3	tubes	tube	NNS
10_1101-2021_01_06_425657	220	4	were	be	VBD
10_1101-2021_01_06_425657	220	5	then	then	RB
10_1101-2021_01_06_425657	220	6	placed	place	VBN
10_1101-2021_01_06_425657	220	7	back	back	RB
10_1101-2021_01_06_425657	220	8	on	on	IN
10_1101-2021_01_06_425657	220	9	ice	ice	NN
10_1101-2021_01_06_425657	220	10	and	and	CC
10_1101-2021_01_06_425657	220	11	531	531	CD
10_1101-2021_01_06_425657	220	12	.CC	.CC	:
10_1101-2021_01_06_425657	220	13	-	-	:
10_1101-2021_01_06_425657	220	14	BY	by	IN
10_1101-2021_01_06_425657	220	15	4.0	4.0	CD
10_1101-2021_01_06_425657	220	16	International	International	NNP
10_1101-2021_01_06_425657	220	17	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	220	18	under	under	IN
10_1101-2021_01_06_425657	220	19	a	a	DT
10_1101-2021_01_06_425657	220	20	(	(	-LRB-
10_1101-2021_01_06_425657	220	21	which	which	WDT
10_1101-2021_01_06_425657	220	22	was	be	VBD
10_1101-2021_01_06_425657	220	23	not	not	RB
10_1101-2021_01_06_425657	220	24	certified	certify	VBN
10_1101-2021_01_06_425657	220	25	by	by	IN
10_1101-2021_01_06_425657	220	26	peer	peer	NN
10_1101-2021_01_06_425657	220	27	review	review	NN
10_1101-2021_01_06_425657	220	28	)	)	-RRB-
10_1101-2021_01_06_425657	220	29	is	be	VBZ
10_1101-2021_01_06_425657	220	30	the	the	DT
10_1101-2021_01_06_425657	220	31	author	author	NN
10_1101-2021_01_06_425657	220	32	/	/	SYM
10_1101-2021_01_06_425657	220	33	funder	funder	NN
10_1101-2021_01_06_425657	220	34	,	,	,
10_1101-2021_01_06_425657	220	35	who	who	WP
10_1101-2021_01_06_425657	220	36	has	have	VBZ
10_1101-2021_01_06_425657	220	37	granted	grant	VBN
10_1101-2021_01_06_425657	220	38	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	220	39	a	a	DT
10_1101-2021_01_06_425657	220	40	license	license	NN
10_1101-2021_01_06_425657	220	41	to	to	TO
10_1101-2021_01_06_425657	220	42	display	display	VB
10_1101-2021_01_06_425657	220	43	the	the	DT
10_1101-2021_01_06_425657	220	44	preprint	preprint	NN
10_1101-2021_01_06_425657	220	45	in	in	IN
10_1101-2021_01_06_425657	220	46	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	220	47	.	.	.
10_1101-2021_01_06_425657	221	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	221	2	is	be	VBZ
10_1101-2021_01_06_425657	221	3	made	make	VBN
10_1101-2021_01_06_425657	221	4	The	the	DT
10_1101-2021_01_06_425657	221	5	copyright	copyright	NN
10_1101-2021_01_06_425657	221	6	holder	holder	NN
10_1101-2021_01_06_425657	221	7	for	for	IN
10_1101-2021_01_06_425657	221	8	this	this	DT
10_1101-2021_01_06_425657	221	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	221	10	version	version	NN
10_1101-2021_01_06_425657	221	11	posted	post	VBD
10_1101-2021_01_06_425657	221	12	January	January	NNP
10_1101-2021_01_06_425657	221	13	7	7	CD
10_1101-2021_01_06_425657	221	14	,	,	,
10_1101-2021_01_06_425657	221	15	2021	2021	CD
10_1101-2021_01_06_425657	221	16	.	.	.
10_1101-2021_01_06_425657	221	17	;	;	:
10_1101-2021_01_06_425657	221	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	221	19	:	:	:
10_1101-2021_01_06_425657	221	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	221	21	preprint	preprint	NN
10_1101-2021_01_06_425657	221	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	221	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	221	24	15	15	CD
10_1101-2021_01_06_425657	221	25	20	20	CD
10_1101-2021_01_06_425657	221	26	µL	µl	CD
10_1101-2021_01_06_425657	221	27	of	of	IN
10_1101-2021_01_06_425657	221	28	water	water	NN
10_1101-2021_01_06_425657	221	29	,	,	,
10_1101-2021_01_06_425657	221	30	8	8	CD
10_1101-2021_01_06_425657	221	31	µL	µl	CD
10_1101-2021_01_06_425657	221	32	of	of	IN
10_1101-2021_01_06_425657	221	33	5X	5X	NNP
10_1101-2021_01_06_425657	221	34	ubiquitination	ubiquitination	NNP
10_1101-2021_01_06_425657	221	35	assay	assay	NNP
10_1101-2021_01_06_425657	221	36	buffer	buffer	NNP
10_1101-2021_01_06_425657	221	37	,	,	,
10_1101-2021_01_06_425657	221	38	10	10	CD
10_1101-2021_01_06_425657	221	39	µL	µl	CD
10_1101-2021_01_06_425657	221	40	of	of	IN
10_1101-2021_01_06_425657	221	41	concentrated	concentrated	JJ
10_1101-2021_01_06_425657	221	42	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	221	43	IP	IP	NNP
10_1101-2021_01_06_425657	221	44	,	,	,
10_1101-2021_01_06_425657	221	45	532	532	CD
10_1101-2021_01_06_425657	221	46	and	and	CC
10_1101-2021_01_06_425657	221	47	2	2	CD
10_1101-2021_01_06_425657	221	48	µL	µl	CD
10_1101-2021_01_06_425657	221	49	of	of	IN
10_1101-2021_01_06_425657	221	50	purified	purify	VBN
10_1101-2021_01_06_425657	221	51	Met4	Met4	NNP
10_1101-2021_01_06_425657	221	52	(	(	-LRB-
10_1101-2021_01_06_425657	221	53	FC	FC	NNP
10_1101-2021_01_06_425657	221	54	=	=	NNP
10_1101-2021_01_06_425657	221	55	200	200	CD
10_1101-2021_01_06_425657	221	56	nM	nM	NNP
10_1101-2021_01_06_425657	221	57	)	)	-RRB-
10_1101-2021_01_06_425657	221	58	were	be	VBD
10_1101-2021_01_06_425657	221	59	added	add	VBN
10_1101-2021_01_06_425657	221	60	,	,	,
10_1101-2021_01_06_425657	221	61	the	the	DT
10_1101-2021_01_06_425657	221	62	tubes	tube	NNS
10_1101-2021_01_06_425657	221	63	were	be	VBD
10_1101-2021_01_06_425657	221	64	moved	move	VBN
10_1101-2021_01_06_425657	221	65	back	back	RB
10_1101-2021_01_06_425657	221	66	to	to	IN
10_1101-2021_01_06_425657	221	67	RT	RT	NNP
10_1101-2021_01_06_425657	221	68	,	,	,
10_1101-2021_01_06_425657	221	69	and	and	CC
10_1101-2021_01_06_425657	221	70	20	20	CD
10_1101-2021_01_06_425657	221	71	533	533	CD
10_1101-2021_01_06_425657	221	72	µL	µl	CD
10_1101-2021_01_06_425657	221	73	aliquots	aliquot	NNS
10_1101-2021_01_06_425657	221	74	of	of	IN
10_1101-2021_01_06_425657	221	75	the	the	DT
10_1101-2021_01_06_425657	221	76	reaction	reaction	NN
10_1101-2021_01_06_425657	221	77	were	be	VBD
10_1101-2021_01_06_425657	221	78	removed	remove	VBN
10_1101-2021_01_06_425657	221	79	,	,	,
10_1101-2021_01_06_425657	221	80	mixed	mix	VBN
10_1101-2021_01_06_425657	221	81	with	with	IN
10_1101-2021_01_06_425657	221	82	2X	2X	NNP
10_1101-2021_01_06_425657	221	83	sample	sample	NN
10_1101-2021_01_06_425657	221	84	buffer	buffer	NN
10_1101-2021_01_06_425657	221	85	,	,	,
10_1101-2021_01_06_425657	221	86	and	and	CC
10_1101-2021_01_06_425657	221	87	frozen	freeze	VBN
10_1101-2021_01_06_425657	221	88	in	in	IN
10_1101-2021_01_06_425657	221	89	liquid	liquid	JJ
10_1101-2021_01_06_425657	221	90	534	534	CD
10_1101-2021_01_06_425657	221	91	nitrogen	nitrogen	NN
10_1101-2021_01_06_425657	221	92	over	over	IN
10_1101-2021_01_06_425657	221	93	the	the	DT
10_1101-2021_01_06_425657	221	94	time	time	NN
10_1101-2021_01_06_425657	221	95	course	course	NN
10_1101-2021_01_06_425657	221	96	.	.	.
10_1101-2021_01_06_425657	222	1	535	535	CD
10_1101-2021_01_06_425657	222	2	536	536	CD
10_1101-2021_01_06_425657	222	3	SCFMet30-Flag	scfmet30-flag	SYM
10_1101-2021_01_06_425657	222	4	IP	IP	NNP
10_1101-2021_01_06_425657	222	5	and	and	CC
10_1101-2021_01_06_425657	222	6	in	in	FW
10_1101-2021_01_06_425657	222	7	vitro	vitro	FW
10_1101-2021_01_06_425657	222	8	Met4	Met4	NNP
10_1101-2021_01_06_425657	222	9	binding	bind	VBG
10_1101-2021_01_06_425657	222	10	assay	assay	NN
10_1101-2021_01_06_425657	222	11	537	537	CD
10_1101-2021_01_06_425657	222	12	For	for	IN
10_1101-2021_01_06_425657	222	13	the	the	DT
10_1101-2021_01_06_425657	222	14	Met4	met4	JJ
10_1101-2021_01_06_425657	222	15	binding	bind	VBG
10_1101-2021_01_06_425657	222	16	assay	assay	NN
10_1101-2021_01_06_425657	222	17	,	,	,
10_1101-2021_01_06_425657	222	18	yeast	yeast	NN
10_1101-2021_01_06_425657	222	19	cell	cell	NN
10_1101-2021_01_06_425657	222	20	lysate	lysate	NN
10_1101-2021_01_06_425657	222	21	was	be	VBD
10_1101-2021_01_06_425657	222	22	prepared	prepare	VBN
10_1101-2021_01_06_425657	222	23	as	as	IN
10_1101-2021_01_06_425657	222	24	described	describe	VBN
10_1101-2021_01_06_425657	222	25	for	for	IN
10_1101-2021_01_06_425657	222	26	the	the	DT
10_1101-2021_01_06_425657	222	27	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	222	28	538	538	CD
10_1101-2021_01_06_425657	222	29	experiment	experiment	NN
10_1101-2021_01_06_425657	222	30	,	,	,
10_1101-2021_01_06_425657	222	31	except	except	IN
10_1101-2021_01_06_425657	222	32	that	that	IN
10_1101-2021_01_06_425657	222	33	the	the	DT
10_1101-2021_01_06_425657	222	34	lysate	lysate	NN
10_1101-2021_01_06_425657	222	35	was	be	VBD
10_1101-2021_01_06_425657	222	36	split	split	VBN
10_1101-2021_01_06_425657	222	37	three	three	CD
10_1101-2021_01_06_425657	222	38	ways	way	NNS
10_1101-2021_01_06_425657	222	39	,	,	,
10_1101-2021_01_06_425657	222	40	with	with	IN
10_1101-2021_01_06_425657	222	41	1	1	CD
10_1101-2021_01_06_425657	222	42	mM	mM	NNP
10_1101-2021_01_06_425657	222	43	DTT	DTT	NNP
10_1101-2021_01_06_425657	222	44	,	,	,
10_1101-2021_01_06_425657	222	45	1	1	CD
10_1101-2021_01_06_425657	222	46	mM	mm	NN
10_1101-2021_01_06_425657	222	47	539	539	CD
10_1101-2021_01_06_425657	222	48	tetramethylazodicarboxamide	tetramethylazodicarboxamide	NN
10_1101-2021_01_06_425657	222	49	(	(	-LRB-
10_1101-2021_01_06_425657	222	50	Diamide	diamide	NN
10_1101-2021_01_06_425657	222	51	)	)	-RRB-
10_1101-2021_01_06_425657	222	52	(	(	-LRB-
10_1101-2021_01_06_425657	222	53	Sigma	Sigma	NNP
10_1101-2021_01_06_425657	222	54	,	,	,
10_1101-2021_01_06_425657	222	55	Cat#D3648	Cat#D3648	NNP
10_1101-2021_01_06_425657	222	56	)	)	-RRB-
10_1101-2021_01_06_425657	222	57	,	,	,
10_1101-2021_01_06_425657	222	58	or	or	CC
10_1101-2021_01_06_425657	222	59	nothing	nothing	NN
10_1101-2021_01_06_425657	222	60	added	add	VBN
10_1101-2021_01_06_425657	222	61	to	to	IN
10_1101-2021_01_06_425657	222	62	the	the	DT
10_1101-2021_01_06_425657	222	63	lysate	lysate	NN
10_1101-2021_01_06_425657	222	64	prior	prior	RB
10_1101-2021_01_06_425657	222	65	540	540	CD
10_1101-2021_01_06_425657	222	66	to	to	TO
10_1101-2021_01_06_425657	222	67	centrifugation	centrifugation	VB
10_1101-2021_01_06_425657	222	68	at	at	IN
10_1101-2021_01_06_425657	222	69	21,000xg	21,000xg	CD
10_1101-2021_01_06_425657	222	70	for	for	IN
10_1101-2021_01_06_425657	222	71	30	30	CD
10_1101-2021_01_06_425657	222	72	min	min	NN
10_1101-2021_01_06_425657	222	73	at	at	IN
10_1101-2021_01_06_425657	222	74	4	4	CD
10_1101-2021_01_06_425657	222	75	°	°	NNS
10_1101-2021_01_06_425657	222	76	C	C	NNP
10_1101-2021_01_06_425657	222	77	.	.	.
10_1101-2021_01_06_425657	223	1	The	the	DT
10_1101-2021_01_06_425657	223	2	supernatant	supernatant	JJ
10_1101-2021_01_06_425657	223	3	was	be	VBD
10_1101-2021_01_06_425657	223	4	transferred	transfer	VBN
10_1101-2021_01_06_425657	223	5	to	to	IN
10_1101-2021_01_06_425657	223	6	new	new	JJ
10_1101-2021_01_06_425657	223	7	tubes	tube	NNS
10_1101-2021_01_06_425657	223	8	and	and	CC
10_1101-2021_01_06_425657	223	9	541	541	CD
10_1101-2021_01_06_425657	223	10	100	100	CD
10_1101-2021_01_06_425657	223	11	µL	µl	CD
10_1101-2021_01_06_425657	223	12	of	of	IN
10_1101-2021_01_06_425657	223	13	Thermo	Thermo	NNP
10_1101-2021_01_06_425657	223	14	Fisher	Fisher	NNP
10_1101-2021_01_06_425657	223	15	protein	protein	NN
10_1101-2021_01_06_425657	223	16	G	g	NN
10_1101-2021_01_06_425657	223	17	dynabeads	dynabead	NNS
10_1101-2021_01_06_425657	223	18	(	(	-LRB-
10_1101-2021_01_06_425657	223	19	Cat	Cat	NNP
10_1101-2021_01_06_425657	223	20	#	#	NNP
10_1101-2021_01_06_425657	223	21	10004D	10004D	NNP
10_1101-2021_01_06_425657	223	22	)	)	-RRB-
10_1101-2021_01_06_425657	223	23	DMP	DMP	NNP
10_1101-2021_01_06_425657	223	24	crosslinked	crosslinke	VBD
10_1101-2021_01_06_425657	223	25	to	to	IN
10_1101-2021_01_06_425657	223	26	50	50	CD
10_1101-2021_01_06_425657	223	27	µL	µl	CD
10_1101-2021_01_06_425657	223	28	of	of	IN
10_1101-2021_01_06_425657	223	29	542	542	CD
10_1101-2021_01_06_425657	223	30	Mouse	Mouse	NNP
10_1101-2021_01_06_425657	223	31	anti	anti	JJ
10_1101-2021_01_06_425657	223	32	-	-	JJ
10_1101-2021_01_06_425657	223	33	FLAG	FLAG	NNP
10_1101-2021_01_06_425657	223	34	M2	M2	NNP
10_1101-2021_01_06_425657	223	35	antibody	antibody	NN
10_1101-2021_01_06_425657	223	36	(	(	-LRB-
10_1101-2021_01_06_425657	223	37	Sigma	Sigma	NNP
10_1101-2021_01_06_425657	223	38	,	,	,
10_1101-2021_01_06_425657	223	39	Cat#F3165	Cat#F3165	NNP
10_1101-2021_01_06_425657	223	40	)	)	-RRB-
10_1101-2021_01_06_425657	223	41	was	be	VBD
10_1101-2021_01_06_425657	223	42	divided	divide	VBN
10_1101-2021_01_06_425657	223	43	evenly	evenly	RB
10_1101-2021_01_06_425657	223	44	between	between	IN
10_1101-2021_01_06_425657	223	45	the	the	DT
10_1101-2021_01_06_425657	223	46	six	six	CD
10_1101-2021_01_06_425657	223	47	Met30	Met30	NNP
10_1101-2021_01_06_425657	223	48	-	-	HYPH
10_1101-2021_01_06_425657	223	49	543	543	CD
10_1101-2021_01_06_425657	223	50	Flag	Flag	NNP
10_1101-2021_01_06_425657	223	51	IP	IP	NNP
10_1101-2021_01_06_425657	223	52	conditions	condition	NNS
10_1101-2021_01_06_425657	223	53	and	and	CC
10_1101-2021_01_06_425657	223	54	incubated	incubate	VBD
10_1101-2021_01_06_425657	223	55	for	for	IN
10_1101-2021_01_06_425657	223	56	2	2	CD
10_1101-2021_01_06_425657	223	57	h	h	NN
10_1101-2021_01_06_425657	223	58	at	at	IN
10_1101-2021_01_06_425657	223	59	4	4	CD
10_1101-2021_01_06_425657	223	60	°	°	NNS
10_1101-2021_01_06_425657	223	61	C	C	NNP
10_1101-2021_01_06_425657	223	62	while	while	IN
10_1101-2021_01_06_425657	223	63	rotating	rotate	VBG
10_1101-2021_01_06_425657	223	64	end	end	NN
10_1101-2021_01_06_425657	223	65	over	over	IN
10_1101-2021_01_06_425657	223	66	end	end	NN
10_1101-2021_01_06_425657	223	67	.	.	.
10_1101-2021_01_06_425657	224	1	After	after	IN
10_1101-2021_01_06_425657	224	2	incubation	incubation	NN
10_1101-2021_01_06_425657	224	3	,	,	,
10_1101-2021_01_06_425657	224	4	the	the	DT
10_1101-2021_01_06_425657	224	5	544	544	CD
10_1101-2021_01_06_425657	224	6	beads	bead	NNS
10_1101-2021_01_06_425657	224	7	were	be	VBD
10_1101-2021_01_06_425657	224	8	washed	wash	VBN
10_1101-2021_01_06_425657	224	9	with	with	IN
10_1101-2021_01_06_425657	224	10	IP	IP	NNP
10_1101-2021_01_06_425657	224	11	buffer	buffer	NN
10_1101-2021_01_06_425657	224	12	containing	contain	VBG
10_1101-2021_01_06_425657	224	13	1	1	CD
10_1101-2021_01_06_425657	224	14	mM	mM	NNP
10_1101-2021_01_06_425657	224	15	DTT	DTT	NNP
10_1101-2021_01_06_425657	224	16	,	,	,
10_1101-2021_01_06_425657	224	17	1	1	CD
10_1101-2021_01_06_425657	224	18	mM	mm	NN
10_1101-2021_01_06_425657	224	19	Diamide	Diamide	NNP
10_1101-2021_01_06_425657	224	20	,	,	,
10_1101-2021_01_06_425657	224	21	or	or	CC
10_1101-2021_01_06_425657	224	22	nothing	nothing	NN
10_1101-2021_01_06_425657	224	23	twice	twice	RB
10_1101-2021_01_06_425657	224	24	before	before	IN
10_1101-2021_01_06_425657	224	25	545	545	CD
10_1101-2021_01_06_425657	224	26	a	a	DT
10_1101-2021_01_06_425657	224	27	final	final	JJ
10_1101-2021_01_06_425657	224	28	wash	wash	NN
10_1101-2021_01_06_425657	224	29	with	with	IN
10_1101-2021_01_06_425657	224	30	plain	plain	JJ
10_1101-2021_01_06_425657	224	31	IP	IP	NNP
10_1101-2021_01_06_425657	224	32	buffer	buffer	NN
10_1101-2021_01_06_425657	224	33	.	.	.
10_1101-2021_01_06_425657	225	1	Each	each	DT
10_1101-2021_01_06_425657	225	2	set	set	NN
10_1101-2021_01_06_425657	225	3	of	of	IN
10_1101-2021_01_06_425657	225	4	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	225	5	bound	bind	VBN
10_1101-2021_01_06_425657	225	6	beads	bead	NNS
10_1101-2021_01_06_425657	225	7	prepared	prepare	VBN
10_1101-2021_01_06_425657	225	8	in	in	IN
10_1101-2021_01_06_425657	225	9	the	the	DT
10_1101-2021_01_06_425657	225	10	different	different	JJ
10_1101-2021_01_06_425657	225	11	IP	IP	NNP
10_1101-2021_01_06_425657	225	12	546	546	CD
10_1101-2021_01_06_425657	225	13	conditions	condition	NNS
10_1101-2021_01_06_425657	225	14	was	be	VBD
10_1101-2021_01_06_425657	225	15	brought	bring	VBN
10_1101-2021_01_06_425657	225	16	up	up	RP
10_1101-2021_01_06_425657	225	17	to	to	IN
10_1101-2021_01_06_425657	225	18	80	80	CD
10_1101-2021_01_06_425657	225	19	µL	µL	.
10_1101-2021_01_06_425657	225	20	with	with	IN
10_1101-2021_01_06_425657	225	21	plain	plain	JJ
10_1101-2021_01_06_425657	225	22	IP	IP	NNP
10_1101-2021_01_06_425657	225	23	buffer	buffer	NN
10_1101-2021_01_06_425657	225	24	,	,	,
10_1101-2021_01_06_425657	225	25	and	and	CC
10_1101-2021_01_06_425657	225	26	40	40	CD
10_1101-2021_01_06_425657	225	27	µL	µl	CD
10_1101-2021_01_06_425657	225	28	was	be	VBD
10_1101-2021_01_06_425657	225	29	dispensed	dispense	VBN
10_1101-2021_01_06_425657	225	30	to	to	IN
10_1101-2021_01_06_425657	225	31	new	new	JJ
10_1101-2021_01_06_425657	225	32	tubes	tube	NNS
10_1101-2021_01_06_425657	225	33	547	547	CD
10_1101-2021_01_06_425657	225	34	containing	contain	VBG
10_1101-2021_01_06_425657	225	35	1	1	CD
10_1101-2021_01_06_425657	225	36	mL	mL	NNP
10_1101-2021_01_06_425657	225	37	of	of	IN
10_1101-2021_01_06_425657	225	38	IP	IP	NNP
10_1101-2021_01_06_425657	225	39	buffer	buffer	NN
10_1101-2021_01_06_425657	225	40	±	±	NNP
10_1101-2021_01_06_425657	225	41	1	1	CD
10_1101-2021_01_06_425657	225	42	mM	mM	NNP
10_1101-2021_01_06_425657	225	43	DTT	DTT	NNP
10_1101-2021_01_06_425657	225	44	and	and	CC
10_1101-2021_01_06_425657	225	45	1	1	CD
10_1101-2021_01_06_425657	225	46	µg	µg	NN
10_1101-2021_01_06_425657	225	47	of	of	IN
10_1101-2021_01_06_425657	225	48	purified	purify	VBN
10_1101-2021_01_06_425657	225	49	recombinant	recombinant	JJ
10_1101-2021_01_06_425657	225	50	Met4	Met4	NNP
10_1101-2021_01_06_425657	225	51	,	,	,
10_1101-2021_01_06_425657	225	52	and	and	CC
10_1101-2021_01_06_425657	225	53	were	be	VBD
10_1101-2021_01_06_425657	225	54	548	548	CD
10_1101-2021_01_06_425657	225	55	incubated	incubate	VBN
10_1101-2021_01_06_425657	225	56	for	for	IN
10_1101-2021_01_06_425657	225	57	2	2	CD
10_1101-2021_01_06_425657	225	58	h	h	NN
10_1101-2021_01_06_425657	225	59	at	at	IN
10_1101-2021_01_06_425657	225	60	4	4	CD
10_1101-2021_01_06_425657	225	61	°	°	NNS
10_1101-2021_01_06_425657	225	62	C	C	NNP
10_1101-2021_01_06_425657	225	63	while	while	IN
10_1101-2021_01_06_425657	225	64	rotating	rotate	VBG
10_1101-2021_01_06_425657	225	65	end	end	NN
10_1101-2021_01_06_425657	225	66	over	over	IN
10_1101-2021_01_06_425657	225	67	end	end	NN
10_1101-2021_01_06_425657	225	68	for	for	IN
10_1101-2021_01_06_425657	225	69	a	a	DT
10_1101-2021_01_06_425657	225	70	total	total	NN
10_1101-2021_01_06_425657	225	71	of	of	IN
10_1101-2021_01_06_425657	225	72	twelve	twelve	CD
10_1101-2021_01_06_425657	225	73	Met4	met4	JJ
10_1101-2021_01_06_425657	225	74	co	co	JJ
10_1101-2021_01_06_425657	225	75	-	-	JJ
10_1101-2021_01_06_425657	225	76	IP	ip	JJ
10_1101-2021_01_06_425657	225	77	conditions	condition	NNS
10_1101-2021_01_06_425657	225	78	.	.	.
10_1101-2021_01_06_425657	226	1	549	549	CD
10_1101-2021_01_06_425657	226	2	The	the	DT
10_1101-2021_01_06_425657	226	3	beads	bead	NNS
10_1101-2021_01_06_425657	226	4	were	be	VBD
10_1101-2021_01_06_425657	226	5	then	then	RB
10_1101-2021_01_06_425657	226	6	collected	collect	VBN
10_1101-2021_01_06_425657	226	7	,	,	,
10_1101-2021_01_06_425657	226	8	washed	wash	VBD
10_1101-2021_01_06_425657	226	9	3	3	CD
10_1101-2021_01_06_425657	226	10	times	time	NNS
10_1101-2021_01_06_425657	226	11	with	with	IN
10_1101-2021_01_06_425657	226	12	IP	IP	NNP
10_1101-2021_01_06_425657	226	13	buffer	buffer	NN
10_1101-2021_01_06_425657	226	14	±	±	NNP
10_1101-2021_01_06_425657	226	15	1	1	CD
10_1101-2021_01_06_425657	226	16	mM	mM	NNP
10_1101-2021_01_06_425657	226	17	DTT	DTT	NNP
10_1101-2021_01_06_425657	226	18	,	,	,
10_1101-2021_01_06_425657	226	19	resuspended	resuspend	VBD
10_1101-2021_01_06_425657	226	20	in	in	IN
10_1101-2021_01_06_425657	226	21	60	60	CD
10_1101-2021_01_06_425657	226	22	µL	µL	NNP
10_1101-2021_01_06_425657	226	23	550	550	CD
10_1101-2021_01_06_425657	226	24	2X	2x	NN
10_1101-2021_01_06_425657	226	25	sample	sample	NN
10_1101-2021_01_06_425657	226	26	buffer	buffer	NN
10_1101-2021_01_06_425657	226	27	,	,	,
10_1101-2021_01_06_425657	226	28	and	and	CC
10_1101-2021_01_06_425657	226	29	heated	heat	VBD
10_1101-2021_01_06_425657	226	30	at	at	IN
10_1101-2021_01_06_425657	226	31	70	70	CD
10_1101-2021_01_06_425657	226	32	°	°	,
10_1101-2021_01_06_425657	226	33	C	C	NNP
10_1101-2021_01_06_425657	226	34	for	for	IN
10_1101-2021_01_06_425657	226	35	10	10	CD
10_1101-2021_01_06_425657	226	36	min	min	NN
10_1101-2021_01_06_425657	226	37	before	before	IN
10_1101-2021_01_06_425657	226	38	Western	western	JJ
10_1101-2021_01_06_425657	226	39	blotting	blotting	NN
10_1101-2021_01_06_425657	226	40	for	for	IN
10_1101-2021_01_06_425657	226	41	both	both	CC
10_1101-2021_01_06_425657	226	42	Met4	Met4	NNP
10_1101-2021_01_06_425657	226	43	and	and	CC
10_1101-2021_01_06_425657	226	44	Met30	Met30	NNP
10_1101-2021_01_06_425657	226	45	.	.	.
10_1101-2021_01_06_425657	227	1	551	551	CD
10_1101-2021_01_06_425657	227	2	552	552	CD
10_1101-2021_01_06_425657	227	3	553	553	CD
10_1101-2021_01_06_425657	227	4	554	554	CD
10_1101-2021_01_06_425657	227	5	.CC	.CC	:
10_1101-2021_01_06_425657	227	6	-	-	:
10_1101-2021_01_06_425657	227	7	BY	by	IN
10_1101-2021_01_06_425657	227	8	4.0	4.0	CD
10_1101-2021_01_06_425657	227	9	International	International	NNP
10_1101-2021_01_06_425657	227	10	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	227	11	under	under	IN
10_1101-2021_01_06_425657	227	12	a	a	DT
10_1101-2021_01_06_425657	227	13	(	(	-LRB-
10_1101-2021_01_06_425657	227	14	which	which	WDT
10_1101-2021_01_06_425657	227	15	was	be	VBD
10_1101-2021_01_06_425657	227	16	not	not	RB
10_1101-2021_01_06_425657	227	17	certified	certify	VBN
10_1101-2021_01_06_425657	227	18	by	by	IN
10_1101-2021_01_06_425657	227	19	peer	peer	NN
10_1101-2021_01_06_425657	227	20	review	review	NN
10_1101-2021_01_06_425657	227	21	)	)	-RRB-
10_1101-2021_01_06_425657	227	22	is	be	VBZ
10_1101-2021_01_06_425657	227	23	the	the	DT
10_1101-2021_01_06_425657	227	24	author	author	NN
10_1101-2021_01_06_425657	227	25	/	/	SYM
10_1101-2021_01_06_425657	227	26	funder	funder	NN
10_1101-2021_01_06_425657	227	27	,	,	,
10_1101-2021_01_06_425657	227	28	who	who	WP
10_1101-2021_01_06_425657	227	29	has	have	VBZ
10_1101-2021_01_06_425657	227	30	granted	grant	VBN
10_1101-2021_01_06_425657	227	31	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	227	32	a	a	DT
10_1101-2021_01_06_425657	227	33	license	license	NN
10_1101-2021_01_06_425657	227	34	to	to	TO
10_1101-2021_01_06_425657	227	35	display	display	VB
10_1101-2021_01_06_425657	227	36	the	the	DT
10_1101-2021_01_06_425657	227	37	preprint	preprint	NN
10_1101-2021_01_06_425657	227	38	in	in	IN
10_1101-2021_01_06_425657	227	39	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	227	40	.	.	.
10_1101-2021_01_06_425657	228	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	228	2	is	be	VBZ
10_1101-2021_01_06_425657	228	3	made	make	VBN
10_1101-2021_01_06_425657	228	4	The	the	DT
10_1101-2021_01_06_425657	228	5	copyright	copyright	NN
10_1101-2021_01_06_425657	228	6	holder	holder	NN
10_1101-2021_01_06_425657	228	7	for	for	IN
10_1101-2021_01_06_425657	228	8	this	this	DT
10_1101-2021_01_06_425657	228	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	228	10	version	version	NN
10_1101-2021_01_06_425657	228	11	posted	post	VBD
10_1101-2021_01_06_425657	228	12	January	January	NNP
10_1101-2021_01_06_425657	228	13	7	7	CD
10_1101-2021_01_06_425657	228	14	,	,	,
10_1101-2021_01_06_425657	228	15	2021	2021	CD
10_1101-2021_01_06_425657	228	16	.	.	.
10_1101-2021_01_06_425657	228	17	;	;	:
10_1101-2021_01_06_425657	228	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	228	19	:	:	:
10_1101-2021_01_06_425657	228	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	228	21	preprint	preprint	NN
10_1101-2021_01_06_425657	228	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NN
10_1101-2021_01_06_425657	228	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	228	24	16	16	CD
10_1101-2021_01_06_425657	228	25	REFERENCES	reference	NNS
10_1101-2021_01_06_425657	228	26	555	555	CD
10_1101-2021_01_06_425657	228	27	556	556	CD
10_1101-2021_01_06_425657	228	28	BARBEY	BARBEY	NNP
10_1101-2021_01_06_425657	228	29	,	,	,
10_1101-2021_01_06_425657	228	30	R.	R.	NNP
10_1101-2021_01_06_425657	228	31	,	,	,
10_1101-2021_01_06_425657	228	32	BAUDOUIN	BAUDOUIN	NNP
10_1101-2021_01_06_425657	228	33	-	-	HYPH
10_1101-2021_01_06_425657	228	34	CORNU	CORNU	NNP
10_1101-2021_01_06_425657	228	35	,	,	,
10_1101-2021_01_06_425657	228	36	P.	P.	NNP
10_1101-2021_01_06_425657	228	37	,	,	,
10_1101-2021_01_06_425657	228	38	LEE	LEE	NNP
10_1101-2021_01_06_425657	228	39	,	,	,
10_1101-2021_01_06_425657	228	40	T.	T.	NNP
10_1101-2021_01_06_425657	228	41	A.	A.	NNP
10_1101-2021_01_06_425657	228	42	,	,	,
10_1101-2021_01_06_425657	228	43	ROUILLON	ROUILLON	NNP
10_1101-2021_01_06_425657	228	44	,	,	,
10_1101-2021_01_06_425657	228	45	A.	a.	NN
10_1101-2021_01_06_425657	228	46	,	,	,
10_1101-2021_01_06_425657	228	47	ZARZOV	ZARZOV	NNP
10_1101-2021_01_06_425657	228	48	,	,	,
10_1101-2021_01_06_425657	228	49	P.	P.	NNP
10_1101-2021_01_06_425657	228	50	,	,	,
10_1101-2021_01_06_425657	228	51	TYERS	TYERS	NNP
10_1101-2021_01_06_425657	228	52	,	,	,
10_1101-2021_01_06_425657	228	53	557	557	CD
10_1101-2021_01_06_425657	228	54	M.	M.	NNP
10_1101-2021_01_06_425657	228	55	&	&	CC
10_1101-2021_01_06_425657	228	56	THOMAS	THOMAS	NNP
10_1101-2021_01_06_425657	228	57	,	,	,
10_1101-2021_01_06_425657	228	58	D.	D.	NNP
10_1101-2021_01_06_425657	228	59	2005	2005	CD
10_1101-2021_01_06_425657	228	60	.	.	.
10_1101-2021_01_06_425657	229	1	Inducible	inducible	JJ
10_1101-2021_01_06_425657	229	2	dissociation	dissociation	NN
10_1101-2021_01_06_425657	229	3	of	of	IN
10_1101-2021_01_06_425657	229	4	SCF(Met30	SCF(Met30	NNP
10_1101-2021_01_06_425657	229	5	)	)	-RRB-
10_1101-2021_01_06_425657	229	6	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	229	7	ligase	ligase	NN
10_1101-2021_01_06_425657	229	8	558	558	CD
10_1101-2021_01_06_425657	229	9	mediates	mediate	VBZ
10_1101-2021_01_06_425657	229	10	a	a	DT
10_1101-2021_01_06_425657	229	11	rapid	rapid	JJ
10_1101-2021_01_06_425657	229	12	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	229	13	response	response	NN
10_1101-2021_01_06_425657	229	14	to	to	IN
10_1101-2021_01_06_425657	229	15	cadmium	cadmium	NN
10_1101-2021_01_06_425657	229	16	.	.	.
10_1101-2021_01_06_425657	230	1	EMBO	EMBO	NNP
10_1101-2021_01_06_425657	230	2	J	J	NNP
10_1101-2021_01_06_425657	230	3	,	,	,
10_1101-2021_01_06_425657	230	4	24	24	CD
10_1101-2021_01_06_425657	230	5	,	,	,
10_1101-2021_01_06_425657	230	6	521	521	CD
10_1101-2021_01_06_425657	230	7	-	-	SYM
10_1101-2021_01_06_425657	230	8	32	32	CD
10_1101-2021_01_06_425657	230	9	.	.	.
10_1101-2021_01_06_425657	231	1	559	559	CD
10_1101-2021_01_06_425657	231	2	BLAISEAU	BLAISEAU	NNP
10_1101-2021_01_06_425657	231	3	,	,	,
10_1101-2021_01_06_425657	231	4	P.	P.	NNP
10_1101-2021_01_06_425657	231	5	L.	L.	NNP
10_1101-2021_01_06_425657	231	6	&	&	CC
10_1101-2021_01_06_425657	231	7	THOMAS	THOMAS	NNP
10_1101-2021_01_06_425657	231	8	,	,	,
10_1101-2021_01_06_425657	231	9	D.	D.	NNP
10_1101-2021_01_06_425657	231	10	1998	1998	CD
10_1101-2021_01_06_425657	231	11	.	.	.
10_1101-2021_01_06_425657	232	1	Multiple	multiple	JJ
10_1101-2021_01_06_425657	232	2	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	232	3	activation	activation	NN
10_1101-2021_01_06_425657	232	4	complexes	complex	NNS
10_1101-2021_01_06_425657	232	5	tether	tether	VBP
10_1101-2021_01_06_425657	232	6	560	560	CD
10_1101-2021_01_06_425657	232	7	the	the	DT
10_1101-2021_01_06_425657	232	8	yeast	yeast	NN
10_1101-2021_01_06_425657	232	9	activator	activator	NN
10_1101-2021_01_06_425657	232	10	Met4	Met4	NNP
10_1101-2021_01_06_425657	232	11	to	to	IN
10_1101-2021_01_06_425657	232	12	DNA	DNA	NNP
10_1101-2021_01_06_425657	232	13	.	.	.
10_1101-2021_01_06_425657	233	1	EMBO	EMBO	NNP
10_1101-2021_01_06_425657	233	2	J	J	NNP
10_1101-2021_01_06_425657	233	3	,	,	,
10_1101-2021_01_06_425657	233	4	17	17	CD
10_1101-2021_01_06_425657	233	5	,	,	,
10_1101-2021_01_06_425657	233	6	6327	6327	CD
10_1101-2021_01_06_425657	233	7	-	-	SYM
10_1101-2021_01_06_425657	233	8	36	36	CD
10_1101-2021_01_06_425657	233	9	.	.	.
10_1101-2021_01_06_425657	234	1	561	561	CD
10_1101-2021_01_06_425657	234	2	CANTONI	CANTONI	NNP
10_1101-2021_01_06_425657	234	3	,	,	,
10_1101-2021_01_06_425657	234	4	G.	G.	NNP
10_1101-2021_01_06_425657	234	5	L.	L.	NNP
10_1101-2021_01_06_425657	234	6	1975	1975	CD
10_1101-2021_01_06_425657	234	7	.	.	.
10_1101-2021_01_06_425657	235	1	Biological	biological	JJ
10_1101-2021_01_06_425657	235	2	methylation	methylation	NN
10_1101-2021_01_06_425657	235	3	:	:	:
10_1101-2021_01_06_425657	235	4	selected	select	VBN
10_1101-2021_01_06_425657	235	5	aspects	aspect	NNS
10_1101-2021_01_06_425657	235	6	.	.	.
10_1101-2021_01_06_425657	236	1	Annu	Annu	NNP
10_1101-2021_01_06_425657	236	2	Rev	Rev	NNP
10_1101-2021_01_06_425657	236	3	Biochem	Biochem	NNP
10_1101-2021_01_06_425657	236	4	,	,	,
10_1101-2021_01_06_425657	236	5	44	44	CD
10_1101-2021_01_06_425657	236	6	,	,	,
10_1101-2021_01_06_425657	236	7	435	435	CD
10_1101-2021_01_06_425657	236	8	-	-	SYM
10_1101-2021_01_06_425657	236	9	562	562	CD
10_1101-2021_01_06_425657	236	10	51	51	CD
10_1101-2021_01_06_425657	236	11	.	.	.
10_1101-2021_01_06_425657	237	1	563	563	CD
10_1101-2021_01_06_425657	237	2	CUOZZO	CUOZZO	NNP
10_1101-2021_01_06_425657	237	3	,	,	,
10_1101-2021_01_06_425657	237	4	J.	J.	NNP
10_1101-2021_01_06_425657	237	5	W.	W.	NNP
10_1101-2021_01_06_425657	237	6	&	&	CC
10_1101-2021_01_06_425657	237	7	KAISER	KAISER	NNP
10_1101-2021_01_06_425657	237	8	,	,	,
10_1101-2021_01_06_425657	237	9	C.	C.	NNP
10_1101-2021_01_06_425657	237	10	A.	A.	NNP
10_1101-2021_01_06_425657	238	1	1999	1999	CD
10_1101-2021_01_06_425657	238	2	.	.	.
10_1101-2021_01_06_425657	239	1	Competition	competition	NN
10_1101-2021_01_06_425657	239	2	between	between	IN
10_1101-2021_01_06_425657	239	3	glutathione	glutathione	NN
10_1101-2021_01_06_425657	239	4	and	and	CC
10_1101-2021_01_06_425657	239	5	protein	protein	NN
10_1101-2021_01_06_425657	239	6	thiols	thiol	NNS
10_1101-2021_01_06_425657	239	7	for	for	IN
10_1101-2021_01_06_425657	239	8	564	564	CD
10_1101-2021_01_06_425657	239	9	disulphide	disulphide	NN
10_1101-2021_01_06_425657	239	10	-	-	HYPH
10_1101-2021_01_06_425657	239	11	bond	bond	NN
10_1101-2021_01_06_425657	239	12	formation	formation	NN
10_1101-2021_01_06_425657	239	13	.	.	.
10_1101-2021_01_06_425657	240	1	Nature	nature	NN
10_1101-2021_01_06_425657	240	2	cell	cell	NN
10_1101-2021_01_06_425657	240	3	biology	biology	NN
10_1101-2021_01_06_425657	240	4	,	,	,
10_1101-2021_01_06_425657	240	5	1	1	CD
10_1101-2021_01_06_425657	240	6	,	,	,
10_1101-2021_01_06_425657	240	7	130	130	CD
10_1101-2021_01_06_425657	240	8	-	-	SYM
10_1101-2021_01_06_425657	240	9	135	135	CD
10_1101-2021_01_06_425657	240	10	.	.	.
10_1101-2021_01_06_425657	241	1	565	565	CD
10_1101-2021_01_06_425657	241	2	FAUCHON	FAUCHON	NNP
10_1101-2021_01_06_425657	241	3	,	,	,
10_1101-2021_01_06_425657	241	4	M.	M.	NNP
10_1101-2021_01_06_425657	241	5	,	,	,
10_1101-2021_01_06_425657	241	6	LAGNIEL	LAGNIEL	NNP
10_1101-2021_01_06_425657	241	7	,	,	,
10_1101-2021_01_06_425657	241	8	G.	G.	NNP
10_1101-2021_01_06_425657	241	9	,	,	,
10_1101-2021_01_06_425657	241	10	AUDE	AUDE	NNP
10_1101-2021_01_06_425657	241	11	,	,	,
10_1101-2021_01_06_425657	241	12	J.-C.	J.-C.	NNP
10_1101-2021_01_06_425657	241	13	,	,	,
10_1101-2021_01_06_425657	241	14	LOMBARDIA	LOMBARDIA	NNP
10_1101-2021_01_06_425657	241	15	,	,	,
10_1101-2021_01_06_425657	241	16	L.	L.	NNP
10_1101-2021_01_06_425657	241	17	,	,	,
10_1101-2021_01_06_425657	241	18	SOULARUE	SOULARUE	NNP
10_1101-2021_01_06_425657	241	19	,	,	,
10_1101-2021_01_06_425657	241	20	P.	P.	NNP
10_1101-2021_01_06_425657	241	21	,	,	,
10_1101-2021_01_06_425657	241	22	PETAT	PETAT	NNP
10_1101-2021_01_06_425657	241	23	,	,	,
10_1101-2021_01_06_425657	241	24	C.	C.	NNP
10_1101-2021_01_06_425657	241	25	,	,	,
10_1101-2021_01_06_425657	241	26	566	566	CD
10_1101-2021_01_06_425657	241	27	MARGUERIE	MARGUERIE	NNP
10_1101-2021_01_06_425657	241	28	,	,	,
10_1101-2021_01_06_425657	241	29	G.	G.	NNP
10_1101-2021_01_06_425657	241	30	,	,	,
10_1101-2021_01_06_425657	241	31	SENTENAC	SENTENAC	NNP
10_1101-2021_01_06_425657	241	32	,	,	,
10_1101-2021_01_06_425657	241	33	A.	a.	NN
10_1101-2021_01_06_425657	241	34	,	,	,
10_1101-2021_01_06_425657	241	35	WERNER	WERNER	NNP
10_1101-2021_01_06_425657	241	36	,	,	,
10_1101-2021_01_06_425657	241	37	M.	M.	NNP
10_1101-2021_01_06_425657	241	38	&	&	CC
10_1101-2021_01_06_425657	241	39	LABARRE	LABARRE	NNP
10_1101-2021_01_06_425657	241	40	,	,	,
10_1101-2021_01_06_425657	241	41	J.	J.	NNP
10_1101-2021_01_06_425657	242	1	2002	2002	CD
10_1101-2021_01_06_425657	242	2	.	.	.
10_1101-2021_01_06_425657	243	1	Sulfur	sulfur	NN
10_1101-2021_01_06_425657	243	2	567	567	CD
10_1101-2021_01_06_425657	243	3	sparing	spare	VBG
10_1101-2021_01_06_425657	243	4	in	in	IN
10_1101-2021_01_06_425657	243	5	the	the	DT
10_1101-2021_01_06_425657	243	6	yeast	yeast	NN
10_1101-2021_01_06_425657	243	7	proteome	proteome	NN
10_1101-2021_01_06_425657	243	8	in	in	IN
10_1101-2021_01_06_425657	243	9	response	response	NN
10_1101-2021_01_06_425657	243	10	to	to	IN
10_1101-2021_01_06_425657	243	11	sulfur	sulfur	NN
10_1101-2021_01_06_425657	243	12	demand	demand	NN
10_1101-2021_01_06_425657	243	13	.	.	.
10_1101-2021_01_06_425657	244	1	Molecular	molecular	JJ
10_1101-2021_01_06_425657	244	2	cell	cell	NN
10_1101-2021_01_06_425657	244	3	,	,	,
10_1101-2021_01_06_425657	244	4	9	9	CD
10_1101-2021_01_06_425657	244	5	,	,	,
10_1101-2021_01_06_425657	244	6	713	713	CD
10_1101-2021_01_06_425657	244	7	-	-	SYM
10_1101-2021_01_06_425657	244	8	723	723	CD
10_1101-2021_01_06_425657	244	9	.	.	.
10_1101-2021_01_06_425657	245	1	568	568	CD
10_1101-2021_01_06_425657	245	2	FLICK	FLICK	NNP
10_1101-2021_01_06_425657	245	3	,	,	,
10_1101-2021_01_06_425657	245	4	K.	K.	NNP
10_1101-2021_01_06_425657	245	5	,	,	,
10_1101-2021_01_06_425657	245	6	OUNI	OUNI	NNP
10_1101-2021_01_06_425657	245	7	,	,	,
10_1101-2021_01_06_425657	245	8	I.	I.	NNP
10_1101-2021_01_06_425657	245	9	,	,	,
10_1101-2021_01_06_425657	245	10	WOHLSCHLEGEL	WOHLSCHLEGEL	NNP
10_1101-2021_01_06_425657	245	11	,	,	,
10_1101-2021_01_06_425657	245	12	J.	J.	NNP
10_1101-2021_01_06_425657	246	1	A.	A.	NNP
10_1101-2021_01_06_425657	246	2	,	,	,
10_1101-2021_01_06_425657	246	3	CAPATI	CAPATI	NNP
10_1101-2021_01_06_425657	246	4	,	,	,
10_1101-2021_01_06_425657	246	5	C.	C.	NNP
10_1101-2021_01_06_425657	246	6	,	,	,
10_1101-2021_01_06_425657	246	7	MCDONALD	MCDONALD	NNP
10_1101-2021_01_06_425657	246	8	,	,	,
10_1101-2021_01_06_425657	246	9	W.	W.	NNP
10_1101-2021_01_06_425657	246	10	H.	H.	NNP
10_1101-2021_01_06_425657	246	11	,	,	,
10_1101-2021_01_06_425657	246	12	YATES	YATES	NNP
10_1101-2021_01_06_425657	246	13	,	,	,
10_1101-2021_01_06_425657	246	14	J.	J.	NNP
10_1101-2021_01_06_425657	247	1	569	569	CD
10_1101-2021_01_06_425657	247	2	R.	R.	NNP
10_1101-2021_01_06_425657	247	3	&	&	CC
10_1101-2021_01_06_425657	247	4	KAISER	KAISER	NNP
10_1101-2021_01_06_425657	247	5	,	,	,
10_1101-2021_01_06_425657	247	6	P.	P.	NNP
10_1101-2021_01_06_425657	247	7	2004	2004	CD
10_1101-2021_01_06_425657	247	8	.	.	.
10_1101-2021_01_06_425657	248	1	Proteolysis	proteolysis	NN
10_1101-2021_01_06_425657	248	2	-	-	HYPH
10_1101-2021_01_06_425657	248	3	independent	independent	JJ
10_1101-2021_01_06_425657	248	4	regulation	regulation	NN
10_1101-2021_01_06_425657	248	5	of	of	IN
10_1101-2021_01_06_425657	248	6	the	the	DT
10_1101-2021_01_06_425657	248	7	transcription	transcription	NN
10_1101-2021_01_06_425657	248	8	factor	factor	NN
10_1101-2021_01_06_425657	248	9	570	570	CD
10_1101-2021_01_06_425657	248	10	Met4	met4	NN
10_1101-2021_01_06_425657	248	11	by	by	IN
10_1101-2021_01_06_425657	248	12	a	a	DT
10_1101-2021_01_06_425657	248	13	single	single	JJ
10_1101-2021_01_06_425657	248	14	Lys	Lys	NNP
10_1101-2021_01_06_425657	248	15	48-linked	48-linked	CD
10_1101-2021_01_06_425657	248	16	ubiquitin	ubiquitin	NN
10_1101-2021_01_06_425657	248	17	chain	chain	NN
10_1101-2021_01_06_425657	248	18	.	.	.
10_1101-2021_01_06_425657	249	1	Nat	Nat	NNP
10_1101-2021_01_06_425657	249	2	Cell	Cell	NNP
10_1101-2021_01_06_425657	249	3	Biol	Biol	NNP
10_1101-2021_01_06_425657	249	4	,	,	,
10_1101-2021_01_06_425657	249	5	6	6	CD
10_1101-2021_01_06_425657	249	6	,	,	,
10_1101-2021_01_06_425657	249	7	634	634	CD
10_1101-2021_01_06_425657	249	8	-	-	SYM
10_1101-2021_01_06_425657	249	9	41	41	CD
10_1101-2021_01_06_425657	249	10	.	.	.
10_1101-2021_01_06_425657	250	1	571	571	CD
10_1101-2021_01_06_425657	250	2	FLICK	flick	NN
10_1101-2021_01_06_425657	250	3	,	,	,
10_1101-2021_01_06_425657	250	4	K.	K.	NNP
10_1101-2021_01_06_425657	250	5	,	,	,
10_1101-2021_01_06_425657	250	6	RAASI	RAASI	NNP
10_1101-2021_01_06_425657	250	7	,	,	,
10_1101-2021_01_06_425657	250	8	S.	S.	NNP
10_1101-2021_01_06_425657	250	9	,	,	,
10_1101-2021_01_06_425657	250	10	ZHANG	ZHANG	NNP
10_1101-2021_01_06_425657	250	11	,	,	,
10_1101-2021_01_06_425657	250	12	H.	H.	NNP
10_1101-2021_01_06_425657	250	13	,	,	,
10_1101-2021_01_06_425657	250	14	YEN	YEN	NNP
10_1101-2021_01_06_425657	250	15	,	,	,
10_1101-2021_01_06_425657	250	16	J.	J.	NNP
10_1101-2021_01_06_425657	250	17	L.	L.	NNP
10_1101-2021_01_06_425657	250	18	&	&	CC
10_1101-2021_01_06_425657	250	19	KAISER	KAISER	NNP
10_1101-2021_01_06_425657	250	20	,	,	,
10_1101-2021_01_06_425657	250	21	P.	P.	NNP
10_1101-2021_01_06_425657	250	22	2006	2006	CD
10_1101-2021_01_06_425657	250	23	.	.	.
10_1101-2021_01_06_425657	251	1	A	a	DT
10_1101-2021_01_06_425657	251	2	ubiquitin	ubiquitin	NN
10_1101-2021_01_06_425657	251	3	-	-	HYPH
10_1101-2021_01_06_425657	251	4	interacting	interact	VBG
10_1101-2021_01_06_425657	251	5	572	572	CD
10_1101-2021_01_06_425657	251	6	motif	motif	NN
10_1101-2021_01_06_425657	251	7	protects	protect	NNS
10_1101-2021_01_06_425657	251	8	polyubiquitinated	polyubiquitinate	VBD
10_1101-2021_01_06_425657	251	9	Met4	Met4	NNP
10_1101-2021_01_06_425657	251	10	from	from	IN
10_1101-2021_01_06_425657	251	11	degradation	degradation	NN
10_1101-2021_01_06_425657	251	12	by	by	IN
10_1101-2021_01_06_425657	251	13	the	the	DT
10_1101-2021_01_06_425657	251	14	26S	26S	NNP
10_1101-2021_01_06_425657	251	15	proteasome	proteasome	NN
10_1101-2021_01_06_425657	251	16	.	.	.
10_1101-2021_01_06_425657	252	1	Nat	Nat	NNP
10_1101-2021_01_06_425657	252	2	Cell	Cell	NNP
10_1101-2021_01_06_425657	252	3	573	573	CD
10_1101-2021_01_06_425657	252	4	Biol	Biol	NNP
10_1101-2021_01_06_425657	252	5	,	,	,
10_1101-2021_01_06_425657	252	6	8	8	CD
10_1101-2021_01_06_425657	252	7	,	,	,
10_1101-2021_01_06_425657	252	8	509	509	CD
10_1101-2021_01_06_425657	252	9	-	-	SYM
10_1101-2021_01_06_425657	252	10	15	15	CD
10_1101-2021_01_06_425657	252	11	.	.	.
10_1101-2021_01_06_425657	253	1	574	574	CD
10_1101-2021_01_06_425657	253	2	HANSEN	HANSEN	NNP
10_1101-2021_01_06_425657	253	3	,	,	,
10_1101-2021_01_06_425657	253	4	J.	J.	NNP
10_1101-2021_01_06_425657	254	1	&	&	CC
10_1101-2021_01_06_425657	254	2	JOHANNESEN	JOHANNESEN	NNP
10_1101-2021_01_06_425657	254	3	,	,	,
10_1101-2021_01_06_425657	254	4	P.	P.	NNP
10_1101-2021_01_06_425657	254	5	F.	F.	NNP
10_1101-2021_01_06_425657	254	6	2000	2000	CD
10_1101-2021_01_06_425657	254	7	.	.	.
10_1101-2021_01_06_425657	255	1	Cysteine	Cysteine	NNP
10_1101-2021_01_06_425657	255	2	is	be	VBZ
10_1101-2021_01_06_425657	255	3	essential	essential	JJ
10_1101-2021_01_06_425657	255	4	for	for	IN
10_1101-2021_01_06_425657	255	5	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	255	6	regulation	regulation	NN
10_1101-2021_01_06_425657	255	7	575	575	CD
10_1101-2021_01_06_425657	255	8	of	of	IN
10_1101-2021_01_06_425657	255	9	the	the	DT
10_1101-2021_01_06_425657	255	10	sulfur	sulfur	NN
10_1101-2021_01_06_425657	255	11	assimilation	assimilation	NN
10_1101-2021_01_06_425657	255	12	genes	gene	NNS
10_1101-2021_01_06_425657	255	13	in	in	IN
10_1101-2021_01_06_425657	255	14	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_06_425657	255	15	cerevisiae	cerevisiae	NNS
10_1101-2021_01_06_425657	255	16	.	.	.
10_1101-2021_01_06_425657	256	1	Molecular	Molecular	NNP
10_1101-2021_01_06_425657	256	2	and	and	CC
10_1101-2021_01_06_425657	256	3	General	General	NNP
10_1101-2021_01_06_425657	256	4	576	576	NNP
10_1101-2021_01_06_425657	256	5	Genetics	Genetics	NNP
10_1101-2021_01_06_425657	256	6	MGG	MGG	NNP
10_1101-2021_01_06_425657	256	7	,	,	,
10_1101-2021_01_06_425657	256	8	263	263	CD
10_1101-2021_01_06_425657	256	9	,	,	,
10_1101-2021_01_06_425657	256	10	535	535	CD
10_1101-2021_01_06_425657	256	11	-	-	SYM
10_1101-2021_01_06_425657	256	12	542	542	CD
10_1101-2021_01_06_425657	256	13	.	.	.
10_1101-2021_01_06_425657	257	1	577	577	CD
10_1101-2021_01_06_425657	257	2	HERRERO	HERRERO	NNP
10_1101-2021_01_06_425657	257	3	,	,	,
10_1101-2021_01_06_425657	257	4	E.	E.	NNP
10_1101-2021_01_06_425657	257	5	,	,	,
10_1101-2021_01_06_425657	257	6	ROS	ROS	NNP
10_1101-2021_01_06_425657	257	7	,	,	,
10_1101-2021_01_06_425657	257	8	J.	J.	NNP
10_1101-2021_01_06_425657	257	9	,	,	,
10_1101-2021_01_06_425657	257	10	BELLÍ	BELLÍ	NNP
10_1101-2021_01_06_425657	257	11	,	,	,
10_1101-2021_01_06_425657	257	12	G.	G.	NNP
10_1101-2021_01_06_425657	257	13	&	&	CC
10_1101-2021_01_06_425657	257	14	CABISCOL	CABISCOL	NNP
10_1101-2021_01_06_425657	257	15	,	,	,
10_1101-2021_01_06_425657	257	16	E.	E.	NNP
10_1101-2021_01_06_425657	257	17	2008	2008	CD
10_1101-2021_01_06_425657	257	18	.	.	.
10_1101-2021_01_06_425657	258	1	Redox	redox	NN
10_1101-2021_01_06_425657	258	2	control	control	NN
10_1101-2021_01_06_425657	258	3	and	and	CC
10_1101-2021_01_06_425657	258	4	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	258	5	stress	stress	NN
10_1101-2021_01_06_425657	258	6	578	578	CD
10_1101-2021_01_06_425657	258	7	in	in	IN
10_1101-2021_01_06_425657	258	8	yeast	yeast	NN
10_1101-2021_01_06_425657	258	9	cells	cell	NNS
10_1101-2021_01_06_425657	258	10	.	.	.
10_1101-2021_01_06_425657	259	1	Biochimica	Biochimica	NNP
10_1101-2021_01_06_425657	259	2	et	et	NNP
10_1101-2021_01_06_425657	259	3	Biophysica	Biophysica	NNP
10_1101-2021_01_06_425657	259	4	Acta	Acta	NNP
10_1101-2021_01_06_425657	259	5	(	(	-LRB-
10_1101-2021_01_06_425657	259	6	BBA)-General	BBA)-General	NNP
10_1101-2021_01_06_425657	259	7	Subjects	Subjects	NNP
10_1101-2021_01_06_425657	259	8	,	,	,
10_1101-2021_01_06_425657	259	9	1780	1780	CD
10_1101-2021_01_06_425657	259	10	,	,	,
10_1101-2021_01_06_425657	259	11	1217	1217	CD
10_1101-2021_01_06_425657	259	12	-	-	SYM
10_1101-2021_01_06_425657	259	13	1235	1235	CD
10_1101-2021_01_06_425657	259	14	.	.	.
10_1101-2021_01_06_425657	260	1	579	579	CD
10_1101-2021_01_06_425657	260	2	IMLAY	IMLAY	NNS
10_1101-2021_01_06_425657	260	3	,	,	,
10_1101-2021_01_06_425657	260	4	J.	J.	NNP
10_1101-2021_01_06_425657	261	1	A.	A.	NNP
10_1101-2021_01_06_425657	262	1	2013	2013	CD
10_1101-2021_01_06_425657	262	2	.	.	.
10_1101-2021_01_06_425657	263	1	The	the	DT
10_1101-2021_01_06_425657	263	2	molecular	molecular	JJ
10_1101-2021_01_06_425657	263	3	mechanisms	mechanism	NNS
10_1101-2021_01_06_425657	263	4	and	and	CC
10_1101-2021_01_06_425657	263	5	physiological	physiological	JJ
10_1101-2021_01_06_425657	263	6	consequences	consequence	NNS
10_1101-2021_01_06_425657	263	7	of	of	IN
10_1101-2021_01_06_425657	263	8	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	263	9	580	580	CD
10_1101-2021_01_06_425657	263	10	stress	stress	NN
10_1101-2021_01_06_425657	263	11	:	:	:
10_1101-2021_01_06_425657	263	12	lessons	lesson	NNS
10_1101-2021_01_06_425657	263	13	from	from	IN
10_1101-2021_01_06_425657	263	14	a	a	DT
10_1101-2021_01_06_425657	263	15	model	model	NN
10_1101-2021_01_06_425657	263	16	bacterium	bacterium	NN
10_1101-2021_01_06_425657	263	17	.	.	.
10_1101-2021_01_06_425657	264	1	Nature	Nature	NNP
10_1101-2021_01_06_425657	264	2	Reviews	Reviews	NNPS
10_1101-2021_01_06_425657	264	3	Microbiology	Microbiology	NNP
10_1101-2021_01_06_425657	264	4	,	,	,
10_1101-2021_01_06_425657	264	5	11	11	CD
10_1101-2021_01_06_425657	264	6	,	,	,
10_1101-2021_01_06_425657	264	7	443	443	CD
10_1101-2021_01_06_425657	264	8	-	-	SYM
10_1101-2021_01_06_425657	264	9	454	454	CD
10_1101-2021_01_06_425657	264	10	.	.	.
10_1101-2021_01_06_425657	265	1	581	581	CD
10_1101-2021_01_06_425657	265	2	KAISER	KAISER	NNP
10_1101-2021_01_06_425657	265	3	,	,	,
10_1101-2021_01_06_425657	265	4	P.	P.	NNP
10_1101-2021_01_06_425657	265	5	,	,	,
10_1101-2021_01_06_425657	265	6	FLICK	FLICK	NNP
10_1101-2021_01_06_425657	265	7	,	,	,
10_1101-2021_01_06_425657	265	8	K.	K.	NNP
10_1101-2021_01_06_425657	265	9	,	,	,
10_1101-2021_01_06_425657	265	10	WITTENBERG	WITTENBERG	NNP
10_1101-2021_01_06_425657	265	11	,	,	,
10_1101-2021_01_06_425657	265	12	C.	C.	NNP
10_1101-2021_01_06_425657	265	13	&	&	CC
10_1101-2021_01_06_425657	265	14	REED	REED	NNP
10_1101-2021_01_06_425657	265	15	,	,	,
10_1101-2021_01_06_425657	265	16	S.	S.	NNP
10_1101-2021_01_06_425657	265	17	I.	I.	NNP
10_1101-2021_01_06_425657	266	1	2000	2000	CD
10_1101-2021_01_06_425657	266	2	.	.	.
10_1101-2021_01_06_425657	267	1	Regulation	regulation	NN
10_1101-2021_01_06_425657	267	2	of	of	IN
10_1101-2021_01_06_425657	267	3	transcription	transcription	NN
10_1101-2021_01_06_425657	267	4	by	by	IN
10_1101-2021_01_06_425657	267	5	582	582	CD
10_1101-2021_01_06_425657	267	6	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	267	7	without	without	IN
10_1101-2021_01_06_425657	267	8	proteolysis	proteolysis	NN
10_1101-2021_01_06_425657	267	9	:	:	:
10_1101-2021_01_06_425657	267	10	Cdc34	Cdc34	NNP
10_1101-2021_01_06_425657	267	11	/	/	SYM
10_1101-2021_01_06_425657	267	12	SCFMet30-mediated	SCFMet30-mediated	NNP
10_1101-2021_01_06_425657	267	13	inactivation	inactivation	NN
10_1101-2021_01_06_425657	267	14	of	of	IN
10_1101-2021_01_06_425657	267	15	the	the	DT
10_1101-2021_01_06_425657	267	16	583	583	CD
10_1101-2021_01_06_425657	267	17	transcription	transcription	NN
10_1101-2021_01_06_425657	267	18	factor	factor	NN
10_1101-2021_01_06_425657	267	19	Met4	Met4	NNP
10_1101-2021_01_06_425657	267	20	.	.	.
10_1101-2021_01_06_425657	268	1	Cell	cell	NN
10_1101-2021_01_06_425657	268	2	,	,	,
10_1101-2021_01_06_425657	268	3	102	102	CD
10_1101-2021_01_06_425657	268	4	,	,	,
10_1101-2021_01_06_425657	268	5	303	303	CD
10_1101-2021_01_06_425657	268	6	-	-	SYM
10_1101-2021_01_06_425657	268	7	314	314	CD
10_1101-2021_01_06_425657	268	8	.	.	.
10_1101-2021_01_06_425657	269	1	584	584	CD
10_1101-2021_01_06_425657	269	2	KATO	KATO	NNP
10_1101-2021_01_06_425657	269	3	,	,	,
10_1101-2021_01_06_425657	269	4	M.	M.	NNP
10_1101-2021_01_06_425657	269	5	,	,	,
10_1101-2021_01_06_425657	269	6	YANG	YANG	NNP
10_1101-2021_01_06_425657	269	7	,	,	,
10_1101-2021_01_06_425657	269	8	Y.	Y.	NNP
10_1101-2021_01_06_425657	269	9	S.	S.	NNP
10_1101-2021_01_06_425657	269	10	,	,	,
10_1101-2021_01_06_425657	269	11	SUTTER	SUTTER	NNP
10_1101-2021_01_06_425657	269	12	,	,	,
10_1101-2021_01_06_425657	269	13	B.	B.	NNP
10_1101-2021_01_06_425657	269	14	M.	M.	NNP
10_1101-2021_01_06_425657	269	15	,	,	,
10_1101-2021_01_06_425657	269	16	WANG	WANG	NNP
10_1101-2021_01_06_425657	269	17	,	,	,
10_1101-2021_01_06_425657	269	18	Y.	Y.	NNP
10_1101-2021_01_06_425657	269	19	,	,	,
10_1101-2021_01_06_425657	269	20	MCKNIGHT	MCKNIGHT	NNP
10_1101-2021_01_06_425657	269	21	,	,	,
10_1101-2021_01_06_425657	269	22	S.	S.	NNP
10_1101-2021_01_06_425657	269	23	L.	L.	NNP
10_1101-2021_01_06_425657	269	24	&	&	CC
10_1101-2021_01_06_425657	269	25	TU	TU	NNP
10_1101-2021_01_06_425657	269	26	,	,	,
10_1101-2021_01_06_425657	269	27	B.	B.	NNP
10_1101-2021_01_06_425657	269	28	P.	P.	NNP
10_1101-2021_01_06_425657	269	29	2019	2019	CD
10_1101-2021_01_06_425657	269	30	.	.	.
10_1101-2021_01_06_425657	270	1	585	585	CD
10_1101-2021_01_06_425657	270	2	Redox	Redox	NNP
10_1101-2021_01_06_425657	270	3	State	State	NNP
10_1101-2021_01_06_425657	270	4	Controls	Controls	NNPS
10_1101-2021_01_06_425657	270	5	Phase	Phase	NNP
10_1101-2021_01_06_425657	270	6	Separation	separation	NN
10_1101-2021_01_06_425657	270	7	of	of	IN
10_1101-2021_01_06_425657	270	8	the	the	DT
10_1101-2021_01_06_425657	270	9	Yeast	Yeast	NNP
10_1101-2021_01_06_425657	270	10	Ataxin-2	Ataxin-2	NNP
10_1101-2021_01_06_425657	270	11	Protein	Protein	NNP
10_1101-2021_01_06_425657	270	12	via	via	IN
10_1101-2021_01_06_425657	270	13	Reversible	reversible	NN
10_1101-2021_01_06_425657	270	14	586	586	CD
10_1101-2021_01_06_425657	270	15	Oxidation	oxidation	NN
10_1101-2021_01_06_425657	270	16	of	of	IN
10_1101-2021_01_06_425657	270	17	Its	-PRON-	PRP$
10_1101-2021_01_06_425657	270	18	Methionine	Methionine	NNP
10_1101-2021_01_06_425657	270	19	-	-	HYPH
10_1101-2021_01_06_425657	270	20	Rich	Rich	NNP
10_1101-2021_01_06_425657	270	21	Low	Low	NNP
10_1101-2021_01_06_425657	270	22	-	-	HYPH
10_1101-2021_01_06_425657	270	23	Complexity	Complexity	NNP
10_1101-2021_01_06_425657	270	24	Domain	Domain	NNP
10_1101-2021_01_06_425657	270	25	.	.	.
10_1101-2021_01_06_425657	271	1	Cell	cell	NN
10_1101-2021_01_06_425657	271	2	,	,	,
10_1101-2021_01_06_425657	271	3	177	177	CD
10_1101-2021_01_06_425657	271	4	,	,	,
10_1101-2021_01_06_425657	271	5	711	711	CD
10_1101-2021_01_06_425657	271	6	-	-	HYPH
10_1101-2021_01_06_425657	271	7	721	721	CD
10_1101-2021_01_06_425657	271	8	e8	e8	NNS
10_1101-2021_01_06_425657	271	9	.	.	.
10_1101-2021_01_06_425657	272	1	587	587	CD
10_1101-2021_01_06_425657	272	2	KURAS	KURAS	NNP
10_1101-2021_01_06_425657	272	3	,	,	,
10_1101-2021_01_06_425657	272	4	L.	L.	NNP
10_1101-2021_01_06_425657	272	5	,	,	,
10_1101-2021_01_06_425657	272	6	CHEREST	CHEREST	NNP
10_1101-2021_01_06_425657	272	7	,	,	,
10_1101-2021_01_06_425657	272	8	H.	H.	NNP
10_1101-2021_01_06_425657	272	9	,	,	,
10_1101-2021_01_06_425657	272	10	SURDIN	SURDIN	NNP
10_1101-2021_01_06_425657	272	11	-	-	HYPH
10_1101-2021_01_06_425657	272	12	KERJAN	KERJAN	NNP
10_1101-2021_01_06_425657	272	13	,	,	,
10_1101-2021_01_06_425657	272	14	Y.	Y.	NNP
10_1101-2021_01_06_425657	273	1	&	&	CC
10_1101-2021_01_06_425657	273	2	THOMAS	THOMAS	NNP
10_1101-2021_01_06_425657	273	3	,	,	,
10_1101-2021_01_06_425657	273	4	D.	D.	NNP
10_1101-2021_01_06_425657	273	5	1996	1996	CD
10_1101-2021_01_06_425657	273	6	.	.	.
10_1101-2021_01_06_425657	274	1	A	a	DT
10_1101-2021_01_06_425657	274	2	heteromeric	heteromeric	NN
10_1101-2021_01_06_425657	274	3	588	588	CD
10_1101-2021_01_06_425657	274	4	complex	complex	NN
10_1101-2021_01_06_425657	274	5	containing	contain	VBG
10_1101-2021_01_06_425657	274	6	the	the	DT
10_1101-2021_01_06_425657	274	7	centromere	centromere	NN
10_1101-2021_01_06_425657	274	8	binding	bind	VBG
10_1101-2021_01_06_425657	274	9	factor	factor	NN
10_1101-2021_01_06_425657	274	10	1	1	CD
10_1101-2021_01_06_425657	274	11	and	and	CC
10_1101-2021_01_06_425657	274	12	two	two	CD
10_1101-2021_01_06_425657	274	13	basic	basic	JJ
10_1101-2021_01_06_425657	274	14	leucine	leucine	NN
10_1101-2021_01_06_425657	274	15	zipper	zipper	NN
10_1101-2021_01_06_425657	274	16	factors	factor	NNS
10_1101-2021_01_06_425657	274	17	,	,	,
10_1101-2021_01_06_425657	274	18	589	589	CD
10_1101-2021_01_06_425657	274	19	.CC	.CC	NFP
10_1101-2021_01_06_425657	274	20	-	-	:
10_1101-2021_01_06_425657	274	21	BY	by	IN
10_1101-2021_01_06_425657	274	22	4.0	4.0	CD
10_1101-2021_01_06_425657	274	23	International	International	NNP
10_1101-2021_01_06_425657	274	24	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	274	25	under	under	IN
10_1101-2021_01_06_425657	274	26	a	a	DT
10_1101-2021_01_06_425657	274	27	(	(	-LRB-
10_1101-2021_01_06_425657	274	28	which	which	WDT
10_1101-2021_01_06_425657	274	29	was	be	VBD
10_1101-2021_01_06_425657	274	30	not	not	RB
10_1101-2021_01_06_425657	274	31	certified	certify	VBN
10_1101-2021_01_06_425657	274	32	by	by	IN
10_1101-2021_01_06_425657	274	33	peer	peer	NN
10_1101-2021_01_06_425657	274	34	review	review	NN
10_1101-2021_01_06_425657	274	35	)	)	-RRB-
10_1101-2021_01_06_425657	274	36	is	be	VBZ
10_1101-2021_01_06_425657	274	37	the	the	DT
10_1101-2021_01_06_425657	274	38	author	author	NN
10_1101-2021_01_06_425657	274	39	/	/	SYM
10_1101-2021_01_06_425657	274	40	funder	funder	NN
10_1101-2021_01_06_425657	274	41	,	,	,
10_1101-2021_01_06_425657	274	42	who	who	WP
10_1101-2021_01_06_425657	274	43	has	have	VBZ
10_1101-2021_01_06_425657	274	44	granted	grant	VBN
10_1101-2021_01_06_425657	274	45	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	274	46	a	a	DT
10_1101-2021_01_06_425657	274	47	license	license	NN
10_1101-2021_01_06_425657	274	48	to	to	TO
10_1101-2021_01_06_425657	274	49	display	display	VB
10_1101-2021_01_06_425657	274	50	the	the	DT
10_1101-2021_01_06_425657	274	51	preprint	preprint	NN
10_1101-2021_01_06_425657	274	52	in	in	IN
10_1101-2021_01_06_425657	274	53	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	274	54	.	.	.
10_1101-2021_01_06_425657	275	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	275	2	is	be	VBZ
10_1101-2021_01_06_425657	275	3	made	make	VBN
10_1101-2021_01_06_425657	275	4	The	the	DT
10_1101-2021_01_06_425657	275	5	copyright	copyright	NN
10_1101-2021_01_06_425657	275	6	holder	holder	NN
10_1101-2021_01_06_425657	275	7	for	for	IN
10_1101-2021_01_06_425657	275	8	this	this	DT
10_1101-2021_01_06_425657	275	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	275	10	version	version	NN
10_1101-2021_01_06_425657	275	11	posted	post	VBD
10_1101-2021_01_06_425657	275	12	January	January	NNP
10_1101-2021_01_06_425657	275	13	7	7	CD
10_1101-2021_01_06_425657	275	14	,	,	,
10_1101-2021_01_06_425657	275	15	2021	2021	CD
10_1101-2021_01_06_425657	275	16	.	.	.
10_1101-2021_01_06_425657	275	17	;	;	:
10_1101-2021_01_06_425657	275	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	275	19	:	:	:
10_1101-2021_01_06_425657	275	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	275	21	preprint	preprint	NN
10_1101-2021_01_06_425657	275	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	275	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	275	24	17	17	CD
10_1101-2021_01_06_425657	275	25	Met4	Met4	NNP
10_1101-2021_01_06_425657	275	26	and	and	CC
10_1101-2021_01_06_425657	275	27	Met28	Met28	NNP
10_1101-2021_01_06_425657	275	28	,	,	,
10_1101-2021_01_06_425657	275	29	mediates	mediate	VBZ
10_1101-2021_01_06_425657	275	30	the	the	DT
10_1101-2021_01_06_425657	275	31	transcription	transcription	NN
10_1101-2021_01_06_425657	275	32	activation	activation	NN
10_1101-2021_01_06_425657	275	33	of	of	IN
10_1101-2021_01_06_425657	275	34	yeast	yeast	NN
10_1101-2021_01_06_425657	275	35	sulfur	sulfur	NN
10_1101-2021_01_06_425657	275	36	metabolism	metabolism	NN
10_1101-2021_01_06_425657	275	37	.	.	.
10_1101-2021_01_06_425657	276	1	EMBO	EMBO	NNP
10_1101-2021_01_06_425657	276	2	590	590	CD
10_1101-2021_01_06_425657	276	3	J	J	NNP
10_1101-2021_01_06_425657	276	4	,	,	,
10_1101-2021_01_06_425657	276	5	15	15	CD
10_1101-2021_01_06_425657	276	6	,	,	,
10_1101-2021_01_06_425657	276	7	2519	2519	CD
10_1101-2021_01_06_425657	276	8	-	-	SYM
10_1101-2021_01_06_425657	276	9	29	29	CD
10_1101-2021_01_06_425657	276	10	.	.	.
10_1101-2021_01_06_425657	277	1	591	591	CD
10_1101-2021_01_06_425657	277	2	KURAS	KURAS	NNP
10_1101-2021_01_06_425657	277	3	,	,	,
10_1101-2021_01_06_425657	277	4	L.	L.	NNP
10_1101-2021_01_06_425657	277	5	,	,	,
10_1101-2021_01_06_425657	277	6	ROUILLON	ROUILLON	NNP
10_1101-2021_01_06_425657	277	7	,	,	,
10_1101-2021_01_06_425657	277	8	A.	A.	NNP
10_1101-2021_01_06_425657	277	9	,	,	,
10_1101-2021_01_06_425657	277	10	LEE	LEE	NNP
10_1101-2021_01_06_425657	277	11	,	,	,
10_1101-2021_01_06_425657	277	12	T.	T.	NNP
10_1101-2021_01_06_425657	277	13	,	,	,
10_1101-2021_01_06_425657	277	14	BARBEY	BARBEY	NNP
10_1101-2021_01_06_425657	277	15	,	,	,
10_1101-2021_01_06_425657	277	16	R.	R.	NNP
10_1101-2021_01_06_425657	277	17	,	,	,
10_1101-2021_01_06_425657	277	18	TYERS	TYERS	NNP
10_1101-2021_01_06_425657	277	19	,	,	,
10_1101-2021_01_06_425657	277	20	M.	M.	NNP
10_1101-2021_01_06_425657	277	21	&	&	CC
10_1101-2021_01_06_425657	277	22	THOMAS	THOMAS	NNP
10_1101-2021_01_06_425657	277	23	,	,	,
10_1101-2021_01_06_425657	277	24	D.	D.	NNP
10_1101-2021_01_06_425657	277	25	2002	2002	CD
10_1101-2021_01_06_425657	277	26	.	.	.
10_1101-2021_01_06_425657	278	1	Dual	dual	JJ
10_1101-2021_01_06_425657	278	2	592	592	CD
10_1101-2021_01_06_425657	278	3	regulation	regulation	NN
10_1101-2021_01_06_425657	278	4	of	of	IN
10_1101-2021_01_06_425657	278	5	the	the	DT
10_1101-2021_01_06_425657	278	6	met4	met4	NN
10_1101-2021_01_06_425657	278	7	transcription	transcription	NN
10_1101-2021_01_06_425657	278	8	factor	factor	NN
10_1101-2021_01_06_425657	278	9	by	by	IN
10_1101-2021_01_06_425657	278	10	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	278	11	-	-	HYPH
10_1101-2021_01_06_425657	278	12	dependent	dependent	JJ
10_1101-2021_01_06_425657	278	13	degradation	degradation	NN
10_1101-2021_01_06_425657	278	14	and	and	CC
10_1101-2021_01_06_425657	278	15	593	593	CD
10_1101-2021_01_06_425657	278	16	inhibition	inhibition	NN
10_1101-2021_01_06_425657	278	17	of	of	IN
10_1101-2021_01_06_425657	278	18	promoter	promoter	NN
10_1101-2021_01_06_425657	278	19	recruitment	recruitment	NN
10_1101-2021_01_06_425657	278	20	.	.	.
10_1101-2021_01_06_425657	279	1	Mol	Mol	NNP
10_1101-2021_01_06_425657	279	2	Cell	Cell	NNP
10_1101-2021_01_06_425657	279	3	,	,	,
10_1101-2021_01_06_425657	279	4	10	10	CD
10_1101-2021_01_06_425657	279	5	,	,	,
10_1101-2021_01_06_425657	279	6	69	69	CD
10_1101-2021_01_06_425657	279	7	-	-	SYM
10_1101-2021_01_06_425657	279	8	80	80	CD
10_1101-2021_01_06_425657	279	9	.	.	.
10_1101-2021_01_06_425657	280	1	594	594	CD
10_1101-2021_01_06_425657	280	2	LAXMAN	LAXMAN	NNP
10_1101-2021_01_06_425657	280	3	,	,	,
10_1101-2021_01_06_425657	280	4	S.	S.	NNP
10_1101-2021_01_06_425657	280	5	,	,	,
10_1101-2021_01_06_425657	280	6	SUTTER	SUTTER	NNP
10_1101-2021_01_06_425657	280	7	,	,	,
10_1101-2021_01_06_425657	280	8	B.	B.	NNP
10_1101-2021_01_06_425657	280	9	M.	M.	NNP
10_1101-2021_01_06_425657	280	10	,	,	,
10_1101-2021_01_06_425657	280	11	WU	WU	NNP
10_1101-2021_01_06_425657	280	12	,	,	,
10_1101-2021_01_06_425657	280	13	X.	X.	NNP
10_1101-2021_01_06_425657	280	14	,	,	,
10_1101-2021_01_06_425657	280	15	KUMAR	KUMAR	NNP
10_1101-2021_01_06_425657	280	16	,	,	,
10_1101-2021_01_06_425657	280	17	S.	S.	NNP
10_1101-2021_01_06_425657	280	18	,	,	,
10_1101-2021_01_06_425657	280	19	GUO	GUO	NNP
10_1101-2021_01_06_425657	280	20	,	,	,
10_1101-2021_01_06_425657	280	21	X.	X.	NNP
10_1101-2021_01_06_425657	280	22	,	,	,
10_1101-2021_01_06_425657	280	23	TRUDGIAN	TRUDGIAN	NNP
10_1101-2021_01_06_425657	280	24	,	,	,
10_1101-2021_01_06_425657	280	25	D.	D.	NNP
10_1101-2021_01_06_425657	280	26	C.	C.	NNP
10_1101-2021_01_06_425657	280	27	,	,	,
10_1101-2021_01_06_425657	280	28	595	595	CD
10_1101-2021_01_06_425657	280	29	MIRZAEI	MIRZAEI	NNP
10_1101-2021_01_06_425657	280	30	,	,	,
10_1101-2021_01_06_425657	280	31	H.	H.	NNP
10_1101-2021_01_06_425657	280	32	&	&	CC
10_1101-2021_01_06_425657	280	33	TU	TU	NNP
10_1101-2021_01_06_425657	280	34	,	,	,
10_1101-2021_01_06_425657	280	35	B.	B.	NNP
10_1101-2021_01_06_425657	280	36	P.	P.	NNP
10_1101-2021_01_06_425657	280	37	2013	2013	CD
10_1101-2021_01_06_425657	280	38	.	.	.
10_1101-2021_01_06_425657	281	1	Sulfur	sulfur	NN
10_1101-2021_01_06_425657	281	2	amino	amino	JJ
10_1101-2021_01_06_425657	281	3	acids	acid	NNS
10_1101-2021_01_06_425657	281	4	regulate	regulate	VBP
10_1101-2021_01_06_425657	281	5	translational	translational	JJ
10_1101-2021_01_06_425657	281	6	capacity	capacity	NN
10_1101-2021_01_06_425657	281	7	and	and	CC
10_1101-2021_01_06_425657	281	8	596	596	CD
10_1101-2021_01_06_425657	281	9	metabolic	metabolic	JJ
10_1101-2021_01_06_425657	281	10	homeostasis	homeostasis	NN
10_1101-2021_01_06_425657	281	11	through	through	IN
10_1101-2021_01_06_425657	281	12	modulation	modulation	NN
10_1101-2021_01_06_425657	281	13	of	of	IN
10_1101-2021_01_06_425657	281	14	tRNA	trna	NN
10_1101-2021_01_06_425657	281	15	thiolation	thiolation	NN
10_1101-2021_01_06_425657	281	16	.	.	.
10_1101-2021_01_06_425657	282	1	Cell	cell	NN
10_1101-2021_01_06_425657	282	2	,	,	,
10_1101-2021_01_06_425657	282	3	154	154	CD
10_1101-2021_01_06_425657	282	4	,	,	,
10_1101-2021_01_06_425657	282	5	416	416	CD
10_1101-2021_01_06_425657	282	6	-	-	SYM
10_1101-2021_01_06_425657	282	7	29	29	CD
10_1101-2021_01_06_425657	282	8	.	.	.
10_1101-2021_01_06_425657	283	1	597	597	CD
10_1101-2021_01_06_425657	283	2	LIU	LIU	NNP
10_1101-2021_01_06_425657	283	3	,	,	,
10_1101-2021_01_06_425657	283	4	K.	K.	NNP
10_1101-2021_01_06_425657	283	5	,	,	,
10_1101-2021_01_06_425657	283	6	SANTOS	SANTOS	NNP
10_1101-2021_01_06_425657	283	7	,	,	,
10_1101-2021_01_06_425657	283	8	D.	D.	NNP
10_1101-2021_01_06_425657	283	9	A.	A.	NNP
10_1101-2021_01_06_425657	283	10	,	,	,
10_1101-2021_01_06_425657	283	11	HUSSMANN	HUSSMANN	NNP
10_1101-2021_01_06_425657	283	12	,	,	,
10_1101-2021_01_06_425657	283	13	J.	J.	NNP
10_1101-2021_01_06_425657	284	1	A.	A.	NNP
10_1101-2021_01_06_425657	284	2	,	,	,
10_1101-2021_01_06_425657	284	3	SUTTER	SUTTER	NNP
10_1101-2021_01_06_425657	284	4	,	,	,
10_1101-2021_01_06_425657	284	5	B.	B.	NNP
10_1101-2021_01_06_425657	284	6	M.	M.	NNP
10_1101-2021_01_06_425657	284	7	,	,	,
10_1101-2021_01_06_425657	284	8	WANG	WANG	NNP
10_1101-2021_01_06_425657	284	9	,	,	,
10_1101-2021_01_06_425657	284	10	Y.	Y.	NNP
10_1101-2021_01_06_425657	284	11	,	,	,
10_1101-2021_01_06_425657	284	12	WEISSMAN	WEISSMAN	NNP
10_1101-2021_01_06_425657	284	13	,	,	,
10_1101-2021_01_06_425657	284	14	J.	J.	NNP
10_1101-2021_01_06_425657	284	15	S.	S.	NNP
10_1101-2021_01_06_425657	284	16	598	598	NNP
10_1101-2021_01_06_425657	284	17	&	&	CC
10_1101-2021_01_06_425657	284	18	TU	TU	NNP
10_1101-2021_01_06_425657	284	19	,	,	,
10_1101-2021_01_06_425657	284	20	B.	B.	NNP
10_1101-2021_01_06_425657	284	21	P.	P.	NNP
10_1101-2021_01_06_425657	284	22	Regulation	Regulation	NNP
10_1101-2021_01_06_425657	284	23	of	of	IN
10_1101-2021_01_06_425657	284	24	translation	translation	NN
10_1101-2021_01_06_425657	284	25	by	by	IN
10_1101-2021_01_06_425657	284	26	18S	18s	CD
10_1101-2021_01_06_425657	284	27	rRNA	rrna	CD
10_1101-2021_01_06_425657	284	28	methylation	methylation	NN
10_1101-2021_01_06_425657	284	29	multiplicity	multiplicity	NN
10_1101-2021_01_06_425657	284	30	.	.	.
10_1101-2021_01_06_425657	285	1	599	599	CD
10_1101-2021_01_06_425657	285	2	LJUNGDAHL	LJUNGDAHL	NNP
10_1101-2021_01_06_425657	285	3	,	,	,
10_1101-2021_01_06_425657	285	4	P.	P.	NNP
10_1101-2021_01_06_425657	285	5	O.	O.	NNP
10_1101-2021_01_06_425657	286	1	&	&	CC
10_1101-2021_01_06_425657	286	2	DAIGNAN	DAIGNAN	NNP
10_1101-2021_01_06_425657	286	3	-	-	HYPH
10_1101-2021_01_06_425657	286	4	FORNIER	FORNIER	NNP
10_1101-2021_01_06_425657	286	5	,	,	,
10_1101-2021_01_06_425657	286	6	B.	B.	NNP
10_1101-2021_01_06_425657	287	1	2012	2012	CD
10_1101-2021_01_06_425657	287	2	.	.	.
10_1101-2021_01_06_425657	288	1	Regulation	regulation	NN
10_1101-2021_01_06_425657	288	2	of	of	IN
10_1101-2021_01_06_425657	288	3	amino	amino	NN
10_1101-2021_01_06_425657	288	4	acid	acid	NN
10_1101-2021_01_06_425657	288	5	,	,	,
10_1101-2021_01_06_425657	288	6	nucleotide	nucleotide	RB
10_1101-2021_01_06_425657	288	7	,	,	,
10_1101-2021_01_06_425657	288	8	600	600	CD
10_1101-2021_01_06_425657	288	9	and	and	CC
10_1101-2021_01_06_425657	288	10	phosphate	phosphate	VB
10_1101-2021_01_06_425657	288	11	metabolism	metabolism	NN
10_1101-2021_01_06_425657	288	12	in	in	IN
10_1101-2021_01_06_425657	288	13	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_06_425657	288	14	cerevisiae	cerevisiae	NNS
10_1101-2021_01_06_425657	288	15	.	.	.
10_1101-2021_01_06_425657	289	1	Genetics	Genetics	NNP
10_1101-2021_01_06_425657	289	2	,	,	,
10_1101-2021_01_06_425657	289	3	190	190	CD
10_1101-2021_01_06_425657	289	4	,	,	,
10_1101-2021_01_06_425657	289	5	885	885	CD
10_1101-2021_01_06_425657	289	6	-	-	SYM
10_1101-2021_01_06_425657	289	7	929	929	CD
10_1101-2021_01_06_425657	289	8	.	.	.
10_1101-2021_01_06_425657	290	1	601	601	CD
10_1101-2021_01_06_425657	290	2	LONGTINE	LONGTINE	NNP
10_1101-2021_01_06_425657	290	3	,	,	,
10_1101-2021_01_06_425657	290	4	M.	M.	NNP
10_1101-2021_01_06_425657	290	5	S.	S.	NNP
10_1101-2021_01_06_425657	290	6	,	,	,
10_1101-2021_01_06_425657	290	7	MCKENZIE	MCKENZIE	NNP
10_1101-2021_01_06_425657	290	8	,	,	,
10_1101-2021_01_06_425657	290	9	A.	a.	NN
10_1101-2021_01_06_425657	290	10	,	,	,
10_1101-2021_01_06_425657	290	11	3RD	3rd	CD
10_1101-2021_01_06_425657	290	12	,	,	,
10_1101-2021_01_06_425657	290	13	DEMARINI	DEMARINI	NNP
10_1101-2021_01_06_425657	290	14	,	,	,
10_1101-2021_01_06_425657	290	15	D.	D.	NNP
10_1101-2021_01_06_425657	290	16	J.	J.	NNP
10_1101-2021_01_06_425657	290	17	,	,	,
10_1101-2021_01_06_425657	290	18	SHAH	SHAH	NNP
10_1101-2021_01_06_425657	290	19	,	,	,
10_1101-2021_01_06_425657	290	20	N.	N.	NNP
10_1101-2021_01_06_425657	290	21	G.	G.	NNP
10_1101-2021_01_06_425657	290	22	,	,	,
10_1101-2021_01_06_425657	290	23	WACH	WACH	NNP
10_1101-2021_01_06_425657	290	24	,	,	,
10_1101-2021_01_06_425657	290	25	A.	a.	NN
10_1101-2021_01_06_425657	290	26	,	,	,
10_1101-2021_01_06_425657	290	27	602	602	CD
10_1101-2021_01_06_425657	290	28	BRACHAT	BRACHAT	NNP
10_1101-2021_01_06_425657	290	29	,	,	,
10_1101-2021_01_06_425657	290	30	A.	a.	NN
10_1101-2021_01_06_425657	290	31	,	,	,
10_1101-2021_01_06_425657	290	32	PHILIPPSEN	PHILIPPSEN	NNP
10_1101-2021_01_06_425657	290	33	,	,	,
10_1101-2021_01_06_425657	290	34	P.	P.	NNP
10_1101-2021_01_06_425657	290	35	&	&	CC
10_1101-2021_01_06_425657	290	36	PRINGLE	PRINGLE	NNP
10_1101-2021_01_06_425657	290	37	,	,	,
10_1101-2021_01_06_425657	290	38	J.	J.	NNP
10_1101-2021_01_06_425657	290	39	R.	R.	NNP
10_1101-2021_01_06_425657	290	40	1998	1998	CD
10_1101-2021_01_06_425657	290	41	.	.	.
10_1101-2021_01_06_425657	291	1	Additional	additional	JJ
10_1101-2021_01_06_425657	291	2	modules	module	NNS
10_1101-2021_01_06_425657	291	3	for	for	IN
10_1101-2021_01_06_425657	291	4	603	603	CD
10_1101-2021_01_06_425657	291	5	versatile	versatile	JJ
10_1101-2021_01_06_425657	291	6	and	and	CC
10_1101-2021_01_06_425657	291	7	economical	economical	JJ
10_1101-2021_01_06_425657	291	8	PCR	PCR	NNP
10_1101-2021_01_06_425657	291	9	-	-	HYPH
10_1101-2021_01_06_425657	291	10	based	base	VBN
10_1101-2021_01_06_425657	291	11	gene	gene	NN
10_1101-2021_01_06_425657	291	12	deletion	deletion	NN
10_1101-2021_01_06_425657	291	13	and	and	CC
10_1101-2021_01_06_425657	291	14	modification	modification	NN
10_1101-2021_01_06_425657	291	15	in	in	IN
10_1101-2021_01_06_425657	291	16	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_06_425657	291	17	604	604	CD
10_1101-2021_01_06_425657	291	18	cerevisiae	cerevisiae	NNS
10_1101-2021_01_06_425657	291	19	.	.	.
10_1101-2021_01_06_425657	292	1	Yeast	yeast	NN
10_1101-2021_01_06_425657	292	2	,	,	,
10_1101-2021_01_06_425657	292	3	14	14	CD
10_1101-2021_01_06_425657	292	4	,	,	,
10_1101-2021_01_06_425657	292	5	953	953	CD
10_1101-2021_01_06_425657	292	6	-	-	SYM
10_1101-2021_01_06_425657	292	7	61	61	CD
10_1101-2021_01_06_425657	292	8	.	.	.
10_1101-2021_01_06_425657	293	1	605	605	CD
10_1101-2021_01_06_425657	293	2	MENANT	MENANT	NNP
10_1101-2021_01_06_425657	293	3	,	,	,
10_1101-2021_01_06_425657	293	4	A.	a.	NN
10_1101-2021_01_06_425657	293	5	,	,	,
10_1101-2021_01_06_425657	293	6	BAUDOUIN	BAUDOUIN	NNP
10_1101-2021_01_06_425657	293	7	-	-	HYPH
10_1101-2021_01_06_425657	293	8	CORNU	CORNU	NNP
10_1101-2021_01_06_425657	293	9	,	,	,
10_1101-2021_01_06_425657	293	10	P.	P.	NNP
10_1101-2021_01_06_425657	293	11	,	,	,
10_1101-2021_01_06_425657	293	12	PEYRAUD	PEYRAUD	NNP
10_1101-2021_01_06_425657	293	13	,	,	,
10_1101-2021_01_06_425657	293	14	C.	C.	NNP
10_1101-2021_01_06_425657	293	15	,	,	,
10_1101-2021_01_06_425657	293	16	TYERS	TYERS	NNP
10_1101-2021_01_06_425657	293	17	,	,	,
10_1101-2021_01_06_425657	293	18	M.	M.	NNP
10_1101-2021_01_06_425657	293	19	&	&	CC
10_1101-2021_01_06_425657	293	20	THOMAS	THOMAS	NNP
10_1101-2021_01_06_425657	293	21	,	,	,
10_1101-2021_01_06_425657	293	22	D.	D.	NNP
10_1101-2021_01_06_425657	293	23	2006	2006	CD
10_1101-2021_01_06_425657	293	24	.	.	.
10_1101-2021_01_06_425657	294	1	606	606	CD
10_1101-2021_01_06_425657	294	2	Determinants	determinant	NNS
10_1101-2021_01_06_425657	294	3	of	of	IN
10_1101-2021_01_06_425657	294	4	the	the	DT
10_1101-2021_01_06_425657	294	5	ubiquitin	ubiquitin	NN
10_1101-2021_01_06_425657	294	6	-	-	HYPH
10_1101-2021_01_06_425657	294	7	mediated	mediate	VBN
10_1101-2021_01_06_425657	294	8	degradation	degradation	NN
10_1101-2021_01_06_425657	294	9	of	of	IN
10_1101-2021_01_06_425657	294	10	the	the	DT
10_1101-2021_01_06_425657	294	11	Met4	Met4	NNP
10_1101-2021_01_06_425657	294	12	transcription	transcription	NN
10_1101-2021_01_06_425657	294	13	factor	factor	NN
10_1101-2021_01_06_425657	294	14	.	.	.
10_1101-2021_01_06_425657	295	1	J	J	NNP
10_1101-2021_01_06_425657	295	2	607	607	CD
10_1101-2021_01_06_425657	295	3	Biol	Biol	NNP
10_1101-2021_01_06_425657	295	4	Chem	Chem	NNP
10_1101-2021_01_06_425657	295	5	,	,	,
10_1101-2021_01_06_425657	295	6	281	281	CD
10_1101-2021_01_06_425657	295	7	,	,	,
10_1101-2021_01_06_425657	295	8	11744	11744	CD
10_1101-2021_01_06_425657	295	9	-	-	SYM
10_1101-2021_01_06_425657	295	10	54	54	CD
10_1101-2021_01_06_425657	295	11	.	.	.
10_1101-2021_01_06_425657	296	1	608	608	CD
10_1101-2021_01_06_425657	296	2	MILLER	MILLER	NNP
10_1101-2021_01_06_425657	296	3	,	,	,
10_1101-2021_01_06_425657	296	4	A.	a.	NN
10_1101-2021_01_06_425657	296	5	W.	W.	NNP
10_1101-2021_01_06_425657	296	6	,	,	,
10_1101-2021_01_06_425657	296	7	BEFORT	BEFORT	NNP
10_1101-2021_01_06_425657	296	8	,	,	,
10_1101-2021_01_06_425657	296	9	C.	C.	NNP
10_1101-2021_01_06_425657	296	10	,	,	,
10_1101-2021_01_06_425657	296	11	KERR	KERR	NNP
10_1101-2021_01_06_425657	296	12	,	,	,
10_1101-2021_01_06_425657	296	13	E.	E.	NNP
10_1101-2021_01_06_425657	296	14	O.	O.	NNP
10_1101-2021_01_06_425657	297	1	&	&	CC
10_1101-2021_01_06_425657	297	2	DUNHAM	DUNHAM	NNP
10_1101-2021_01_06_425657	297	3	,	,	,
10_1101-2021_01_06_425657	297	4	M.	M.	NNP
10_1101-2021_01_06_425657	297	5	J.	J.	NNP
10_1101-2021_01_06_425657	298	1	2013	2013	CD
10_1101-2021_01_06_425657	298	2	.	.	.
10_1101-2021_01_06_425657	299	1	Design	design	NN
10_1101-2021_01_06_425657	299	2	and	and	CC
10_1101-2021_01_06_425657	299	3	use	use	NN
10_1101-2021_01_06_425657	299	4	of	of	IN
10_1101-2021_01_06_425657	299	5	609	609	CD
10_1101-2021_01_06_425657	299	6	multiplexed	multiplexe	VBN
10_1101-2021_01_06_425657	299	7	chemostat	chemostat	JJ
10_1101-2021_01_06_425657	299	8	arrays	array	NNS
10_1101-2021_01_06_425657	299	9	.	.	.
10_1101-2021_01_06_425657	300	1	JoVE	JoVE	NNP
10_1101-2021_01_06_425657	300	2	(	(	-LRB-
10_1101-2021_01_06_425657	300	3	Journal	Journal	NNP
10_1101-2021_01_06_425657	300	4	of	of	IN
10_1101-2021_01_06_425657	300	5	Visualized	Visualized	NNP
10_1101-2021_01_06_425657	300	6	Experiments	Experiments	NNPS
10_1101-2021_01_06_425657	300	7	)	)	-RRB-
10_1101-2021_01_06_425657	300	8	,	,	,
10_1101-2021_01_06_425657	300	9	e50262	e50262	NNS
10_1101-2021_01_06_425657	300	10	.	.	.
10_1101-2021_01_06_425657	301	1	610	610	CD
10_1101-2021_01_06_425657	301	2	PENNINCKX	PENNINCKX	NNP
10_1101-2021_01_06_425657	301	3	,	,	,
10_1101-2021_01_06_425657	301	4	M.	M.	NNP
10_1101-2021_01_06_425657	301	5	2000	2000	CD
10_1101-2021_01_06_425657	301	6	.	.	.
10_1101-2021_01_06_425657	302	1	A	a	DT
10_1101-2021_01_06_425657	302	2	short	short	JJ
10_1101-2021_01_06_425657	302	3	review	review	NN
10_1101-2021_01_06_425657	302	4	on	on	IN
10_1101-2021_01_06_425657	302	5	the	the	DT
10_1101-2021_01_06_425657	302	6	role	role	NN
10_1101-2021_01_06_425657	302	7	of	of	IN
10_1101-2021_01_06_425657	302	8	glutathione	glutathione	NN
10_1101-2021_01_06_425657	302	9	in	in	IN
10_1101-2021_01_06_425657	302	10	the	the	DT
10_1101-2021_01_06_425657	302	11	response	response	NN
10_1101-2021_01_06_425657	302	12	of	of	IN
10_1101-2021_01_06_425657	302	13	yeasts	yeast	NNS
10_1101-2021_01_06_425657	302	14	to	to	IN
10_1101-2021_01_06_425657	302	15	611	611	CD
10_1101-2021_01_06_425657	302	16	nutritional	nutritional	JJ
10_1101-2021_01_06_425657	302	17	,	,	,
10_1101-2021_01_06_425657	302	18	environmental	environmental	JJ
10_1101-2021_01_06_425657	302	19	,	,	,
10_1101-2021_01_06_425657	302	20	and	and	CC
10_1101-2021_01_06_425657	302	21	oxidative	oxidative	JJ
10_1101-2021_01_06_425657	302	22	stresses	stress	NNS
10_1101-2021_01_06_425657	302	23	.	.	.
10_1101-2021_01_06_425657	303	1	Enzyme	Enzyme	NNP
10_1101-2021_01_06_425657	303	2	Microb	Microb	NNP
10_1101-2021_01_06_425657	303	3	Technol	Technol	NNP
10_1101-2021_01_06_425657	303	4	,	,	,
10_1101-2021_01_06_425657	303	5	26	26	CD
10_1101-2021_01_06_425657	303	6	,	,	,
10_1101-2021_01_06_425657	303	7	737	737	CD
10_1101-2021_01_06_425657	303	8	-	-	SYM
10_1101-2021_01_06_425657	303	9	742	742	CD
10_1101-2021_01_06_425657	303	10	.	.	.
10_1101-2021_01_06_425657	304	1	612	612	CD
10_1101-2021_01_06_425657	304	2	PETROSKI	PETROSKI	NNP
10_1101-2021_01_06_425657	304	3	,	,	,
10_1101-2021_01_06_425657	304	4	M.	M.	NNP
10_1101-2021_01_06_425657	304	5	D.	D.	NNP
10_1101-2021_01_06_425657	304	6	&	&	CC
10_1101-2021_01_06_425657	304	7	DESHAIES	DESHAIES	NNP
10_1101-2021_01_06_425657	304	8	,	,	,
10_1101-2021_01_06_425657	304	9	R.	R.	NNP
10_1101-2021_01_06_425657	304	10	J.	J.	NNP
10_1101-2021_01_06_425657	305	1	2005	2005	CD
10_1101-2021_01_06_425657	305	2	.	.	.
10_1101-2021_01_06_425657	306	1	In	in	IN
10_1101-2021_01_06_425657	306	2	vitro	vitro	FW
10_1101-2021_01_06_425657	306	3	reconstitution	reconstitution	NN
10_1101-2021_01_06_425657	306	4	of	of	IN
10_1101-2021_01_06_425657	306	5	SCF	SCF	NNP
10_1101-2021_01_06_425657	306	6	substrate	substrate	VBP
10_1101-2021_01_06_425657	306	7	613	613	CD
10_1101-2021_01_06_425657	306	8	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	306	9	with	with	IN
10_1101-2021_01_06_425657	306	10	purified	purify	VBN
10_1101-2021_01_06_425657	306	11	proteins	protein	NNS
10_1101-2021_01_06_425657	306	12	.	.	.
10_1101-2021_01_06_425657	307	1	Methods	Methods	NNP
10_1101-2021_01_06_425657	307	2	Enzymol	Enzymol	NNP
10_1101-2021_01_06_425657	307	3	,	,	,
10_1101-2021_01_06_425657	307	4	398	398	CD
10_1101-2021_01_06_425657	307	5	,	,	,
10_1101-2021_01_06_425657	307	6	143	143	CD
10_1101-2021_01_06_425657	307	7	-	-	SYM
10_1101-2021_01_06_425657	307	8	58	58	CD
10_1101-2021_01_06_425657	307	9	.	.	.
10_1101-2021_01_06_425657	308	1	614	614	CD
10_1101-2021_01_06_425657	308	2	POMPELLA	POMPELLA	NNP
10_1101-2021_01_06_425657	308	3	,	,	,
10_1101-2021_01_06_425657	308	4	A.	a.	NN
10_1101-2021_01_06_425657	308	5	,	,	,
10_1101-2021_01_06_425657	308	6	VISVIKIS	VISVIKIS	NNP
10_1101-2021_01_06_425657	308	7	,	,	,
10_1101-2021_01_06_425657	308	8	A.	a.	NN
10_1101-2021_01_06_425657	308	9	,	,	,
10_1101-2021_01_06_425657	308	10	PAOLICCHI	PAOLICCHI	NNP
10_1101-2021_01_06_425657	308	11	,	,	,
10_1101-2021_01_06_425657	308	12	A.	a.	NN
10_1101-2021_01_06_425657	308	13	,	,	,
10_1101-2021_01_06_425657	308	14	DE	DE	NNP
10_1101-2021_01_06_425657	308	15	TATA	TATA	NNP
10_1101-2021_01_06_425657	308	16	,	,	,
10_1101-2021_01_06_425657	308	17	V.	V.	NNP
10_1101-2021_01_06_425657	308	18	&	&	CC
10_1101-2021_01_06_425657	308	19	CASINI	CASINI	NNP
10_1101-2021_01_06_425657	308	20	,	,	,
10_1101-2021_01_06_425657	308	21	A.	A.	NNP
10_1101-2021_01_06_425657	308	22	F.	F.	NNP
10_1101-2021_01_06_425657	308	23	2003	2003	CD
10_1101-2021_01_06_425657	308	24	.	.	.
10_1101-2021_01_06_425657	309	1	The	the	DT
10_1101-2021_01_06_425657	309	2	615	615	CD
10_1101-2021_01_06_425657	309	3	changing	change	VBG
10_1101-2021_01_06_425657	309	4	faces	face	NNS
10_1101-2021_01_06_425657	309	5	of	of	IN
10_1101-2021_01_06_425657	309	6	glutathione	glutathione	NN
10_1101-2021_01_06_425657	309	7	,	,	,
10_1101-2021_01_06_425657	309	8	a	a	DT
10_1101-2021_01_06_425657	309	9	cellular	cellular	JJ
10_1101-2021_01_06_425657	309	10	protagonist	protagonist	NN
10_1101-2021_01_06_425657	309	11	.	.	.
10_1101-2021_01_06_425657	310	1	Biochem	Biochem	NNP
10_1101-2021_01_06_425657	310	2	Pharmacol	Pharmacol	NNP
10_1101-2021_01_06_425657	310	3	,	,	,
10_1101-2021_01_06_425657	310	4	66	66	CD
10_1101-2021_01_06_425657	310	5	,	,	,
10_1101-2021_01_06_425657	310	6	1499	1499	CD
10_1101-2021_01_06_425657	310	7	-	-	SYM
10_1101-2021_01_06_425657	310	8	503	503	CD
10_1101-2021_01_06_425657	310	9	.	.	.
10_1101-2021_01_06_425657	311	1	616	616	CD
10_1101-2021_01_06_425657	311	2	REITSMA	REITSMA	NNP
10_1101-2021_01_06_425657	311	3	,	,	,
10_1101-2021_01_06_425657	311	4	J.	J.	NNP
10_1101-2021_01_06_425657	311	5	M.	M.	NNP
10_1101-2021_01_06_425657	311	6	,	,	,
10_1101-2021_01_06_425657	311	7	LIU	LIU	NNP
10_1101-2021_01_06_425657	311	8	,	,	,
10_1101-2021_01_06_425657	311	9	X.	X.	NNP
10_1101-2021_01_06_425657	311	10	,	,	,
10_1101-2021_01_06_425657	311	11	REICHERMEIER	REICHERMEIER	NNP
10_1101-2021_01_06_425657	311	12	,	,	,
10_1101-2021_01_06_425657	311	13	K.	K.	NNP
10_1101-2021_01_06_425657	311	14	M.	M.	NNP
10_1101-2021_01_06_425657	311	15	,	,	,
10_1101-2021_01_06_425657	311	16	MORADIAN	MORADIAN	NNP
10_1101-2021_01_06_425657	311	17	,	,	,
10_1101-2021_01_06_425657	311	18	A.	a.	NN
10_1101-2021_01_06_425657	311	19	,	,	,
10_1101-2021_01_06_425657	311	20	SWEREDOSKI	SWEREDOSKI	NNP
10_1101-2021_01_06_425657	311	21	,	,	,
10_1101-2021_01_06_425657	311	22	M.	M.	NNP
10_1101-2021_01_06_425657	311	23	J.	J.	NNP
10_1101-2021_01_06_425657	311	24	,	,	,
10_1101-2021_01_06_425657	311	25	617	617	CD
10_1101-2021_01_06_425657	311	26	HESS	HESS	NNP
10_1101-2021_01_06_425657	311	27	,	,	,
10_1101-2021_01_06_425657	311	28	S.	S.	NNP
10_1101-2021_01_06_425657	311	29	&	&	CC
10_1101-2021_01_06_425657	311	30	DESHAIES	DESHAIES	NNP
10_1101-2021_01_06_425657	311	31	,	,	,
10_1101-2021_01_06_425657	311	32	R.	R.	NNP
10_1101-2021_01_06_425657	311	33	J.	J.	NNP
10_1101-2021_01_06_425657	312	1	2017	2017	CD
10_1101-2021_01_06_425657	312	2	.	.	.
10_1101-2021_01_06_425657	313	1	Composition	composition	NN
10_1101-2021_01_06_425657	313	2	and	and	CC
10_1101-2021_01_06_425657	313	3	regulation	regulation	NN
10_1101-2021_01_06_425657	313	4	of	of	IN
10_1101-2021_01_06_425657	313	5	the	the	DT
10_1101-2021_01_06_425657	313	6	cellular	cellular	JJ
10_1101-2021_01_06_425657	313	7	618	618	CD
10_1101-2021_01_06_425657	313	8	repertoire	repertoire	NN
10_1101-2021_01_06_425657	313	9	of	of	IN
10_1101-2021_01_06_425657	313	10	SCF	SCF	NNP
10_1101-2021_01_06_425657	313	11	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	313	12	ligases	ligase	NNS
10_1101-2021_01_06_425657	313	13	.	.	.
10_1101-2021_01_06_425657	314	1	Cell	cell	NN
10_1101-2021_01_06_425657	314	2	,	,	,
10_1101-2021_01_06_425657	314	3	171	171	CD
10_1101-2021_01_06_425657	314	4	,	,	,
10_1101-2021_01_06_425657	314	5	1326	1326	CD
10_1101-2021_01_06_425657	314	6	-	-	SYM
10_1101-2021_01_06_425657	314	7	1339	1339	CD
10_1101-2021_01_06_425657	314	8	.	.	.
10_1101-2021_01_06_425657	314	9	e14	e14	CD
10_1101-2021_01_06_425657	314	10	.	.	.
10_1101-2021_01_06_425657	315	1	619	619	CD
10_1101-2021_01_06_425657	315	2	ROUILLON	ROUILLON	NNP
10_1101-2021_01_06_425657	315	3	,	,	,
10_1101-2021_01_06_425657	315	4	A.	A.	NNP
10_1101-2021_01_06_425657	315	5	,	,	,
10_1101-2021_01_06_425657	315	6	BARBEY	BARBEY	NNP
10_1101-2021_01_06_425657	315	7	,	,	,
10_1101-2021_01_06_425657	315	8	R.	R.	NNP
10_1101-2021_01_06_425657	315	9	,	,	,
10_1101-2021_01_06_425657	315	10	PATTON	PATTON	NNP
10_1101-2021_01_06_425657	315	11	,	,	,
10_1101-2021_01_06_425657	315	12	E.	E.	NNP
10_1101-2021_01_06_425657	315	13	E.	E.	NNP
10_1101-2021_01_06_425657	315	14	,	,	,
10_1101-2021_01_06_425657	315	15	TYERS	TYERS	NNP
10_1101-2021_01_06_425657	315	16	,	,	,
10_1101-2021_01_06_425657	315	17	M.	M.	NNP
10_1101-2021_01_06_425657	315	18	&	&	CC
10_1101-2021_01_06_425657	315	19	THOMAS	THOMAS	NNP
10_1101-2021_01_06_425657	315	20	,	,	,
10_1101-2021_01_06_425657	315	21	D.	D.	NNP
10_1101-2021_01_06_425657	315	22	2000	2000	CD
10_1101-2021_01_06_425657	315	23	.	.	.
10_1101-2021_01_06_425657	316	1	Feedback-620	feedback-620	JJ
10_1101-2021_01_06_425657	316	2	regulated	regulated	JJ
10_1101-2021_01_06_425657	316	3	degradation	degradation	NN
10_1101-2021_01_06_425657	316	4	of	of	IN
10_1101-2021_01_06_425657	316	5	the	the	DT
10_1101-2021_01_06_425657	316	6	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	316	7	activator	activator	NN
10_1101-2021_01_06_425657	316	8	Met4	Met4	NNP
10_1101-2021_01_06_425657	316	9	is	be	VBZ
10_1101-2021_01_06_425657	316	10	triggered	trigger	VBN
10_1101-2021_01_06_425657	316	11	by	by	IN
10_1101-2021_01_06_425657	316	12	the	the	DT
10_1101-2021_01_06_425657	316	13	SCF(Met30	SCF(Met30	NNP
10_1101-2021_01_06_425657	316	14	621	621	CD
10_1101-2021_01_06_425657	316	15	)	)	-RRB-
10_1101-2021_01_06_425657	316	16	complex	complex	JJ
10_1101-2021_01_06_425657	316	17	.	.	.
10_1101-2021_01_06_425657	317	1	EMBO	EMBO	NNP
10_1101-2021_01_06_425657	317	2	J	J	NNP
10_1101-2021_01_06_425657	317	3	,	,	,
10_1101-2021_01_06_425657	317	4	19	19	CD
10_1101-2021_01_06_425657	317	5	,	,	,
10_1101-2021_01_06_425657	317	6	282	282	CD
10_1101-2021_01_06_425657	317	7	-	-	SYM
10_1101-2021_01_06_425657	317	8	94	94	CD
10_1101-2021_01_06_425657	317	9	.	.	.
10_1101-2021_01_06_425657	318	1	622	622	CD
10_1101-2021_01_06_425657	318	2	.CC	.CC	:
10_1101-2021_01_06_425657	318	3	-	-	:
10_1101-2021_01_06_425657	318	4	BY	by	IN
10_1101-2021_01_06_425657	318	5	4.0	4.0	CD
10_1101-2021_01_06_425657	318	6	International	International	NNP
10_1101-2021_01_06_425657	318	7	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	318	8	under	under	IN
10_1101-2021_01_06_425657	318	9	a	a	DT
10_1101-2021_01_06_425657	318	10	(	(	-LRB-
10_1101-2021_01_06_425657	318	11	which	which	WDT
10_1101-2021_01_06_425657	318	12	was	be	VBD
10_1101-2021_01_06_425657	318	13	not	not	RB
10_1101-2021_01_06_425657	318	14	certified	certify	VBN
10_1101-2021_01_06_425657	318	15	by	by	IN
10_1101-2021_01_06_425657	318	16	peer	peer	NN
10_1101-2021_01_06_425657	318	17	review	review	NN
10_1101-2021_01_06_425657	318	18	)	)	-RRB-
10_1101-2021_01_06_425657	318	19	is	be	VBZ
10_1101-2021_01_06_425657	318	20	the	the	DT
10_1101-2021_01_06_425657	318	21	author	author	NN
10_1101-2021_01_06_425657	318	22	/	/	SYM
10_1101-2021_01_06_425657	318	23	funder	funder	NN
10_1101-2021_01_06_425657	318	24	,	,	,
10_1101-2021_01_06_425657	318	25	who	who	WP
10_1101-2021_01_06_425657	318	26	has	have	VBZ
10_1101-2021_01_06_425657	318	27	granted	grant	VBN
10_1101-2021_01_06_425657	318	28	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	318	29	a	a	DT
10_1101-2021_01_06_425657	318	30	license	license	NN
10_1101-2021_01_06_425657	318	31	to	to	TO
10_1101-2021_01_06_425657	318	32	display	display	VB
10_1101-2021_01_06_425657	318	33	the	the	DT
10_1101-2021_01_06_425657	318	34	preprint	preprint	NN
10_1101-2021_01_06_425657	318	35	in	in	IN
10_1101-2021_01_06_425657	318	36	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	318	37	.	.	.
10_1101-2021_01_06_425657	319	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	319	2	is	be	VBZ
10_1101-2021_01_06_425657	319	3	made	make	VBN
10_1101-2021_01_06_425657	319	4	The	the	DT
10_1101-2021_01_06_425657	319	5	copyright	copyright	NN
10_1101-2021_01_06_425657	319	6	holder	holder	NN
10_1101-2021_01_06_425657	319	7	for	for	IN
10_1101-2021_01_06_425657	319	8	this	this	DT
10_1101-2021_01_06_425657	319	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	319	10	version	version	NN
10_1101-2021_01_06_425657	319	11	posted	post	VBD
10_1101-2021_01_06_425657	319	12	January	January	NNP
10_1101-2021_01_06_425657	319	13	7	7	CD
10_1101-2021_01_06_425657	319	14	,	,	,
10_1101-2021_01_06_425657	319	15	2021	2021	CD
10_1101-2021_01_06_425657	319	16	.	.	.
10_1101-2021_01_06_425657	319	17	;	;	:
10_1101-2021_01_06_425657	319	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	319	19	:	:	:
10_1101-2021_01_06_425657	319	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	319	21	preprint	preprint	NN
10_1101-2021_01_06_425657	319	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NN
10_1101-2021_01_06_425657	319	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	319	24	18	18	CD
10_1101-2021_01_06_425657	319	25	SADHU	SADHU	NNP
10_1101-2021_01_06_425657	319	26	,	,	,
10_1101-2021_01_06_425657	319	27	M.	M.	NNP
10_1101-2021_01_06_425657	319	28	J.	J.	NNP
10_1101-2021_01_06_425657	319	29	,	,	,
10_1101-2021_01_06_425657	319	30	MORESCO	MORESCO	NNP
10_1101-2021_01_06_425657	319	31	,	,	,
10_1101-2021_01_06_425657	319	32	J.	J.	NNP
10_1101-2021_01_06_425657	319	33	J.	J.	NNP
10_1101-2021_01_06_425657	319	34	,	,	,
10_1101-2021_01_06_425657	319	35	ZIMMER	ZIMMER	NNP
10_1101-2021_01_06_425657	319	36	,	,	,
10_1101-2021_01_06_425657	319	37	A.	A.	NNP
10_1101-2021_01_06_425657	319	38	D.	D.	NNP
10_1101-2021_01_06_425657	319	39	,	,	,
10_1101-2021_01_06_425657	319	40	YATES	YATES	NNP
10_1101-2021_01_06_425657	319	41	,	,	,
10_1101-2021_01_06_425657	319	42	J.	J.	NNP
10_1101-2021_01_06_425657	319	43	R.	R.	NNP
10_1101-2021_01_06_425657	319	44	,	,	,
10_1101-2021_01_06_425657	319	45	3RD	3RD	NNP
10_1101-2021_01_06_425657	319	46	&	&	CC
10_1101-2021_01_06_425657	319	47	RINE	RINE	NNP
10_1101-2021_01_06_425657	319	48	,	,	,
10_1101-2021_01_06_425657	319	49	J.	J.	NNP
10_1101-2021_01_06_425657	320	1	2014	2014	CD
10_1101-2021_01_06_425657	320	2	.	.	.
10_1101-2021_01_06_425657	321	1	623	623	CD
10_1101-2021_01_06_425657	321	2	Multiple	multiple	JJ
10_1101-2021_01_06_425657	321	3	inputs	input	NNS
10_1101-2021_01_06_425657	321	4	control	control	VBP
10_1101-2021_01_06_425657	321	5	sulfur	sulfur	NN
10_1101-2021_01_06_425657	321	6	-	-	HYPH
10_1101-2021_01_06_425657	321	7	containing	contain	VBG
10_1101-2021_01_06_425657	321	8	amino	amino	JJ
10_1101-2021_01_06_425657	321	9	acid	acid	NN
10_1101-2021_01_06_425657	321	10	synthesis	synthesis	NN
10_1101-2021_01_06_425657	321	11	in	in	IN
10_1101-2021_01_06_425657	321	12	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_06_425657	321	13	624	624	CD
10_1101-2021_01_06_425657	321	14	cerevisiae	cerevisiae	NNS
10_1101-2021_01_06_425657	321	15	.	.	.
10_1101-2021_01_06_425657	322	1	Mol	Mol	NNP
10_1101-2021_01_06_425657	322	2	Biol	Biol	NNP
10_1101-2021_01_06_425657	322	3	Cell	Cell	NNP
10_1101-2021_01_06_425657	322	4	,	,	,
10_1101-2021_01_06_425657	322	5	25	25	CD
10_1101-2021_01_06_425657	322	6	,	,	,
10_1101-2021_01_06_425657	322	7	1653	1653	CD
10_1101-2021_01_06_425657	322	8	-	-	SYM
10_1101-2021_01_06_425657	322	9	65	65	CD
10_1101-2021_01_06_425657	322	10	.	.	.
10_1101-2021_01_06_425657	323	1	625	625	CD
10_1101-2021_01_06_425657	323	2	SU	SU	NNP
10_1101-2021_01_06_425657	323	3	,	,	,
10_1101-2021_01_06_425657	323	4	N.	N.	NNP
10_1101-2021_01_06_425657	323	5	Y.	Y.	NNP
10_1101-2021_01_06_425657	323	6	,	,	,
10_1101-2021_01_06_425657	323	7	FLICK	FLICK	NNP
10_1101-2021_01_06_425657	323	8	,	,	,
10_1101-2021_01_06_425657	323	9	K.	K.	NNP
10_1101-2021_01_06_425657	323	10	&	&	CC
10_1101-2021_01_06_425657	323	11	KAISER	KAISER	NNP
10_1101-2021_01_06_425657	323	12	,	,	,
10_1101-2021_01_06_425657	323	13	P.	P.	NNP
10_1101-2021_01_06_425657	323	14	2005	2005	CD
10_1101-2021_01_06_425657	323	15	.	.	.
10_1101-2021_01_06_425657	324	1	The	the	DT
10_1101-2021_01_06_425657	324	2	F	F	NNP
10_1101-2021_01_06_425657	324	3	-	-	HYPH
10_1101-2021_01_06_425657	324	4	box	box	NN
10_1101-2021_01_06_425657	324	5	protein	protein	NN
10_1101-2021_01_06_425657	324	6	Met30	Met30	NNP
10_1101-2021_01_06_425657	324	7	is	be	VBZ
10_1101-2021_01_06_425657	324	8	required	require	VBN
10_1101-2021_01_06_425657	324	9	for	for	IN
10_1101-2021_01_06_425657	324	10	multiple	multiple	JJ
10_1101-2021_01_06_425657	324	11	626	626	CD
10_1101-2021_01_06_425657	324	12	steps	step	NNS
10_1101-2021_01_06_425657	324	13	in	in	IN
10_1101-2021_01_06_425657	324	14	the	the	DT
10_1101-2021_01_06_425657	324	15	budding	budding	JJ
10_1101-2021_01_06_425657	324	16	yeast	yeast	NN
10_1101-2021_01_06_425657	324	17	cell	cell	NN
10_1101-2021_01_06_425657	324	18	cycle	cycle	NN
10_1101-2021_01_06_425657	324	19	.	.	.
10_1101-2021_01_06_425657	325	1	Mol	Mol	NNP
10_1101-2021_01_06_425657	325	2	Cell	Cell	NNP
10_1101-2021_01_06_425657	325	3	Biol	Biol	NNP
10_1101-2021_01_06_425657	325	4	,	,	,
10_1101-2021_01_06_425657	325	5	25	25	CD
10_1101-2021_01_06_425657	325	6	,	,	,
10_1101-2021_01_06_425657	325	7	3875	3875	CD
10_1101-2021_01_06_425657	325	8	-	-	SYM
10_1101-2021_01_06_425657	325	9	85	85	CD
10_1101-2021_01_06_425657	325	10	.	.	.
10_1101-2021_01_06_425657	326	1	627	627	CD
10_1101-2021_01_06_425657	326	2	SU	SU	NNP
10_1101-2021_01_06_425657	326	3	,	,	,
10_1101-2021_01_06_425657	326	4	N.	N.	NNP
10_1101-2021_01_06_425657	326	5	Y.	Y.	NNP
10_1101-2021_01_06_425657	326	6	,	,	,
10_1101-2021_01_06_425657	326	7	OUNI	OUNI	NNP
10_1101-2021_01_06_425657	326	8	,	,	,
10_1101-2021_01_06_425657	326	9	I.	I.	NNP
10_1101-2021_01_06_425657	326	10	,	,	,
10_1101-2021_01_06_425657	326	11	PAPAGIANNIS	PAPAGIANNIS	NNP
10_1101-2021_01_06_425657	326	12	,	,	,
10_1101-2021_01_06_425657	326	13	C.	C.	NNP
10_1101-2021_01_06_425657	326	14	V.	V.	NNP
10_1101-2021_01_06_425657	326	15	&	&	CC
10_1101-2021_01_06_425657	326	16	KAISER	KAISER	NNP
10_1101-2021_01_06_425657	326	17	,	,	,
10_1101-2021_01_06_425657	326	18	P.	P.	NNP
10_1101-2021_01_06_425657	326	19	2008	2008	CD
10_1101-2021_01_06_425657	326	20	.	.	.
10_1101-2021_01_06_425657	327	1	A	a	DT
10_1101-2021_01_06_425657	327	2	dominant	dominant	JJ
10_1101-2021_01_06_425657	327	3	suppressor	suppressor	NN
10_1101-2021_01_06_425657	327	4	628	628	CD
10_1101-2021_01_06_425657	327	5	mutation	mutation	NN
10_1101-2021_01_06_425657	327	6	of	of	IN
10_1101-2021_01_06_425657	327	7	the	the	DT
10_1101-2021_01_06_425657	327	8	met30	met30	JJ
10_1101-2021_01_06_425657	327	9	cell	cell	NN
10_1101-2021_01_06_425657	327	10	cycle	cycle	NN
10_1101-2021_01_06_425657	327	11	defect	defect	NN
10_1101-2021_01_06_425657	327	12	suggests	suggest	VBZ
10_1101-2021_01_06_425657	327	13	regulation	regulation	NN
10_1101-2021_01_06_425657	327	14	of	of	IN
10_1101-2021_01_06_425657	327	15	the	the	DT
10_1101-2021_01_06_425657	327	16	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_06_425657	327	17	629	629	CD
10_1101-2021_01_06_425657	327	18	cerevisiae	cerevisiae	NNS
10_1101-2021_01_06_425657	327	19	Met4-Cbf1	Met4-Cbf1	NNP
10_1101-2021_01_06_425657	327	20	transcription	transcription	NN
10_1101-2021_01_06_425657	327	21	complex	complex	NN
10_1101-2021_01_06_425657	327	22	by	by	IN
10_1101-2021_01_06_425657	327	23	Met32	Met32	NNP
10_1101-2021_01_06_425657	327	24	.	.	.
10_1101-2021_01_06_425657	328	1	J	J	NNP
10_1101-2021_01_06_425657	328	2	Biol	Biol	NNP
10_1101-2021_01_06_425657	328	3	Chem	Chem	NNP
10_1101-2021_01_06_425657	328	4	,	,	,
10_1101-2021_01_06_425657	328	5	283	283	CD
10_1101-2021_01_06_425657	328	6	,	,	,
10_1101-2021_01_06_425657	328	7	11615	11615	CD
10_1101-2021_01_06_425657	328	8	-	-	SYM
10_1101-2021_01_06_425657	328	9	24	24	CD
10_1101-2021_01_06_425657	328	10	.	.	.
10_1101-2021_01_06_425657	329	1	630	630	CD
10_1101-2021_01_06_425657	329	2	SUTTER	SUTTER	NNP
10_1101-2021_01_06_425657	329	3	,	,	,
10_1101-2021_01_06_425657	329	4	B.	B.	NNP
10_1101-2021_01_06_425657	329	5	M.	M.	NNP
10_1101-2021_01_06_425657	329	6	,	,	,
10_1101-2021_01_06_425657	329	7	WU	WU	NNP
10_1101-2021_01_06_425657	329	8	,	,	,
10_1101-2021_01_06_425657	329	9	X.	X.	NNP
10_1101-2021_01_06_425657	329	10	,	,	,
10_1101-2021_01_06_425657	329	11	LAXMAN	LAXMAN	NNP
10_1101-2021_01_06_425657	329	12	,	,	,
10_1101-2021_01_06_425657	329	13	S.	S.	NNP
10_1101-2021_01_06_425657	329	14	&	&	CC
10_1101-2021_01_06_425657	329	15	TU	TU	NNP
10_1101-2021_01_06_425657	329	16	,	,	,
10_1101-2021_01_06_425657	329	17	B.	B.	NNP
10_1101-2021_01_06_425657	329	18	P.	P.	NNP
10_1101-2021_01_06_425657	329	19	2013	2013	CD
10_1101-2021_01_06_425657	329	20	.	.	.
10_1101-2021_01_06_425657	330	1	Methionine	methionine	JJ
10_1101-2021_01_06_425657	330	2	inhibits	inhibit	NNS
10_1101-2021_01_06_425657	330	3	autophagy	autophagy	NNS
10_1101-2021_01_06_425657	330	4	and	and	CC
10_1101-2021_01_06_425657	330	5	631	631	CD
10_1101-2021_01_06_425657	330	6	promotes	promote	VBZ
10_1101-2021_01_06_425657	330	7	growth	growth	NN
10_1101-2021_01_06_425657	330	8	by	by	IN
10_1101-2021_01_06_425657	330	9	inducing	induce	VBG
10_1101-2021_01_06_425657	330	10	the	the	DT
10_1101-2021_01_06_425657	330	11	SAM	SAM	NNP
10_1101-2021_01_06_425657	330	12	-	-	HYPH
10_1101-2021_01_06_425657	330	13	responsive	responsive	JJ
10_1101-2021_01_06_425657	330	14	methylation	methylation	NN
10_1101-2021_01_06_425657	330	15	of	of	IN
10_1101-2021_01_06_425657	330	16	PP2A.	PP2A.	NNP
10_1101-2021_01_06_425657	331	1	Cell	cell	NN
10_1101-2021_01_06_425657	331	2	,	,	,
10_1101-2021_01_06_425657	331	3	154	154	CD
10_1101-2021_01_06_425657	331	4	,	,	,
10_1101-2021_01_06_425657	331	5	403	403	CD
10_1101-2021_01_06_425657	331	6	-	-	SYM
10_1101-2021_01_06_425657	331	7	632	632	CD
10_1101-2021_01_06_425657	331	8	15	15	CD
10_1101-2021_01_06_425657	331	9	.	.	.
10_1101-2021_01_06_425657	332	1	633	633	CD
10_1101-2021_01_06_425657	332	2	SUZUKI	SUZUKI	NNP
10_1101-2021_01_06_425657	332	3	,	,	,
10_1101-2021_01_06_425657	332	4	T.	t.	NN
10_1101-2021_01_06_425657	332	5	,	,	,
10_1101-2021_01_06_425657	332	6	MURAMATSU	MURAMATSU	NNP
10_1101-2021_01_06_425657	332	7	,	,	,
10_1101-2021_01_06_425657	332	8	A.	A.	NNP
10_1101-2021_01_06_425657	332	9	,	,	,
10_1101-2021_01_06_425657	332	10	SAITO	SAITO	NNP
10_1101-2021_01_06_425657	332	11	,	,	,
10_1101-2021_01_06_425657	332	12	R.	R.	NNP
10_1101-2021_01_06_425657	332	13	,	,	,
10_1101-2021_01_06_425657	332	14	ISO	ISO	NNP
10_1101-2021_01_06_425657	332	15	,	,	,
10_1101-2021_01_06_425657	332	16	T.	t.	NN
10_1101-2021_01_06_425657	332	17	,	,	,
10_1101-2021_01_06_425657	332	18	SHIBATA	SHIBATA	NNP
10_1101-2021_01_06_425657	332	19	,	,	,
10_1101-2021_01_06_425657	332	20	T.	t.	NN
10_1101-2021_01_06_425657	332	21	,	,	,
10_1101-2021_01_06_425657	332	22	KUWATA	KUWATA	NNP
10_1101-2021_01_06_425657	332	23	,	,	,
10_1101-2021_01_06_425657	332	24	K.	K.	NNP
10_1101-2021_01_06_425657	332	25	,	,	,
10_1101-2021_01_06_425657	332	26	634	634	CD
10_1101-2021_01_06_425657	332	27	KAWAGUCHI	KAWAGUCHI	NNP
10_1101-2021_01_06_425657	332	28	,	,	,
10_1101-2021_01_06_425657	332	29	S.	S.	NNP
10_1101-2021_01_06_425657	332	30	I.	I.	NNP
10_1101-2021_01_06_425657	332	31	,	,	,
10_1101-2021_01_06_425657	332	32	IWAWAKI	IWAWAKI	NNP
10_1101-2021_01_06_425657	332	33	,	,	,
10_1101-2021_01_06_425657	332	34	T.	T.	NNP
10_1101-2021_01_06_425657	332	35	,	,	,
10_1101-2021_01_06_425657	332	36	ADACHI	ADACHI	NNP
10_1101-2021_01_06_425657	332	37	,	,	,
10_1101-2021_01_06_425657	332	38	S.	S.	NNP
10_1101-2021_01_06_425657	332	39	,	,	,
10_1101-2021_01_06_425657	332	40	SUDA	SUDA	NNP
10_1101-2021_01_06_425657	332	41	,	,	,
10_1101-2021_01_06_425657	332	42	H.	H.	NNP
10_1101-2021_01_06_425657	332	43	,	,	,
10_1101-2021_01_06_425657	332	44	MORITA	MORITA	NNP
10_1101-2021_01_06_425657	332	45	,	,	,
10_1101-2021_01_06_425657	332	46	M.	M.	NNP
10_1101-2021_01_06_425657	332	47	,	,	,
10_1101-2021_01_06_425657	332	48	635	635	CD
10_1101-2021_01_06_425657	332	49	UCHIDA	UCHIDA	NNP
10_1101-2021_01_06_425657	332	50	,	,	,
10_1101-2021_01_06_425657	332	51	K.	K.	NNP
10_1101-2021_01_06_425657	332	52	,	,	,
10_1101-2021_01_06_425657	332	53	BAIRD	BAIRD	NNP
10_1101-2021_01_06_425657	332	54	,	,	,
10_1101-2021_01_06_425657	332	55	L.	L.	NNP
10_1101-2021_01_06_425657	332	56	&	&	CC
10_1101-2021_01_06_425657	332	57	YAMAMOTO	YAMAMOTO	NNP
10_1101-2021_01_06_425657	332	58	,	,	,
10_1101-2021_01_06_425657	332	59	M.	M.	NNP
10_1101-2021_01_06_425657	332	60	2019	2019	CD
10_1101-2021_01_06_425657	332	61	.	.	.
10_1101-2021_01_06_425657	333	1	Molecular	molecular	JJ
10_1101-2021_01_06_425657	333	2	Mechanism	Mechanism	NNP
10_1101-2021_01_06_425657	333	3	of	of	IN
10_1101-2021_01_06_425657	333	4	Cellular	Cellular	NNP
10_1101-2021_01_06_425657	333	5	636	636	CD
10_1101-2021_01_06_425657	333	6	Oxidative	Oxidative	NNP
10_1101-2021_01_06_425657	333	7	Stress	stress	NN
10_1101-2021_01_06_425657	333	8	Sensing	sense	VBG
10_1101-2021_01_06_425657	333	9	by	by	IN
10_1101-2021_01_06_425657	333	10	Keap1	keap1	NN
10_1101-2021_01_06_425657	333	11	.	.	.
10_1101-2021_01_06_425657	334	1	Cell	Cell	NNP
10_1101-2021_01_06_425657	334	2	Rep	Rep	NNP
10_1101-2021_01_06_425657	334	3	,	,	,
10_1101-2021_01_06_425657	334	4	28	28	CD
10_1101-2021_01_06_425657	334	5	,	,	,
10_1101-2021_01_06_425657	334	6	746	746	CD
10_1101-2021_01_06_425657	334	7	-	-	SYM
10_1101-2021_01_06_425657	334	8	758	758	CD
10_1101-2021_01_06_425657	334	9	e4	e4	NN
10_1101-2021_01_06_425657	334	10	.	.	.
10_1101-2021_01_06_425657	335	1	637	637	CD
10_1101-2021_01_06_425657	335	2	THOMAS	THOMAS	NNP
10_1101-2021_01_06_425657	335	3	,	,	,
10_1101-2021_01_06_425657	335	4	D.	D.	NNP
10_1101-2021_01_06_425657	335	5	,	,	,
10_1101-2021_01_06_425657	335	6	KURAS	KURAS	NNP
10_1101-2021_01_06_425657	335	7	,	,	,
10_1101-2021_01_06_425657	335	8	L.	L.	NNP
10_1101-2021_01_06_425657	335	9	,	,	,
10_1101-2021_01_06_425657	335	10	BARBEY	BARBEY	NNP
10_1101-2021_01_06_425657	335	11	,	,	,
10_1101-2021_01_06_425657	335	12	R.	R.	NNP
10_1101-2021_01_06_425657	335	13	,	,	,
10_1101-2021_01_06_425657	335	14	CHEREST	CHEREST	NNP
10_1101-2021_01_06_425657	335	15	,	,	,
10_1101-2021_01_06_425657	335	16	H.	H.	NNP
10_1101-2021_01_06_425657	335	17	,	,	,
10_1101-2021_01_06_425657	335	18	BLAISEAU	BLAISEAU	NNP
10_1101-2021_01_06_425657	335	19	,	,	,
10_1101-2021_01_06_425657	335	20	P.	P.	NNP
10_1101-2021_01_06_425657	335	21	L.	L.	NNP
10_1101-2021_01_06_425657	335	22	&	&	CC
10_1101-2021_01_06_425657	335	23	SURDIN-638	SURDIN-638	NNP
10_1101-2021_01_06_425657	335	24	KERJAN	KERJAN	NNP
10_1101-2021_01_06_425657	335	25	,	,	,
10_1101-2021_01_06_425657	335	26	Y.	Y.	NNP
10_1101-2021_01_06_425657	336	1	1995	1995	CD
10_1101-2021_01_06_425657	336	2	.	.	.
10_1101-2021_01_06_425657	337	1	Met30p	Met30p	NNP
10_1101-2021_01_06_425657	337	2	,	,	,
10_1101-2021_01_06_425657	337	3	a	a	DT
10_1101-2021_01_06_425657	337	4	yeast	yeast	NN
10_1101-2021_01_06_425657	337	5	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	337	6	inhibitor	inhibitor	NN
10_1101-2021_01_06_425657	337	7	that	that	WDT
10_1101-2021_01_06_425657	337	8	responds	respond	VBZ
10_1101-2021_01_06_425657	337	9	to	to	IN
10_1101-2021_01_06_425657	337	10	S-639	S-639	NNP
10_1101-2021_01_06_425657	337	11	adenosylmethionine	adenosylmethionine	NN
10_1101-2021_01_06_425657	337	12	,	,	,
10_1101-2021_01_06_425657	337	13	is	be	VBZ
10_1101-2021_01_06_425657	337	14	an	an	DT
10_1101-2021_01_06_425657	337	15	essential	essential	JJ
10_1101-2021_01_06_425657	337	16	protein	protein	NN
10_1101-2021_01_06_425657	337	17	with	with	IN
10_1101-2021_01_06_425657	337	18	WD40	WD40	NNP
10_1101-2021_01_06_425657	337	19	repeats	repeat	NNS
10_1101-2021_01_06_425657	337	20	.	.	.
10_1101-2021_01_06_425657	338	1	Mol	Mol	NNP
10_1101-2021_01_06_425657	338	2	Cell	Cell	NNP
10_1101-2021_01_06_425657	338	3	Biol	Biol	NNP
10_1101-2021_01_06_425657	338	4	,	,	,
10_1101-2021_01_06_425657	338	5	15	15	CD
10_1101-2021_01_06_425657	338	6	,	,	,
10_1101-2021_01_06_425657	338	7	6526	6526	CD
10_1101-2021_01_06_425657	338	8	-	-	SYM
10_1101-2021_01_06_425657	338	9	640	640	CD
10_1101-2021_01_06_425657	338	10	34	34	CD
10_1101-2021_01_06_425657	338	11	.	.	.
10_1101-2021_01_06_425657	339	1	641	641	CD
10_1101-2021_01_06_425657	339	2	TU	TU	NNP
10_1101-2021_01_06_425657	339	3	,	,	,
10_1101-2021_01_06_425657	339	4	B.	B.	NNP
10_1101-2021_01_06_425657	339	5	P.	P.	NNP
10_1101-2021_01_06_425657	339	6	,	,	,
10_1101-2021_01_06_425657	339	7	MOHLER	MOHLER	NNP
10_1101-2021_01_06_425657	339	8	,	,	,
10_1101-2021_01_06_425657	339	9	R.	R.	NNP
10_1101-2021_01_06_425657	339	10	E.	E.	NNP
10_1101-2021_01_06_425657	339	11	,	,	,
10_1101-2021_01_06_425657	339	12	LIU	LIU	NNP
10_1101-2021_01_06_425657	339	13	,	,	,
10_1101-2021_01_06_425657	339	14	J.	J.	NNP
10_1101-2021_01_06_425657	339	15	C.	C.	NNP
10_1101-2021_01_06_425657	339	16	,	,	,
10_1101-2021_01_06_425657	339	17	DOMBEK	DOMBEK	NNP
10_1101-2021_01_06_425657	339	18	,	,	,
10_1101-2021_01_06_425657	339	19	K.	K.	NNP
10_1101-2021_01_06_425657	339	20	M.	M.	NNP
10_1101-2021_01_06_425657	339	21	,	,	,
10_1101-2021_01_06_425657	339	22	YOUNG	YOUNG	NNP
10_1101-2021_01_06_425657	339	23	,	,	,
10_1101-2021_01_06_425657	339	24	E.	E.	NNP
10_1101-2021_01_06_425657	339	25	T.	T.	NNP
10_1101-2021_01_06_425657	339	26	,	,	,
10_1101-2021_01_06_425657	339	27	SYNOVEC	SYNOVEC	NNP
10_1101-2021_01_06_425657	339	28	,	,	,
10_1101-2021_01_06_425657	339	29	R.	R.	NNP
10_1101-2021_01_06_425657	339	30	E.	E.	NNP
10_1101-2021_01_06_425657	339	31	&	&	CC
10_1101-2021_01_06_425657	339	32	642	642	CD
10_1101-2021_01_06_425657	339	33	MCKNIGHT	MCKNIGHT	NNP
10_1101-2021_01_06_425657	339	34	,	,	,
10_1101-2021_01_06_425657	339	35	S.	S.	NNP
10_1101-2021_01_06_425657	339	36	L.	L.	NNP
10_1101-2021_01_06_425657	339	37	2007	2007	CD
10_1101-2021_01_06_425657	339	38	.	.	.
10_1101-2021_01_06_425657	340	1	Cyclic	cyclic	JJ
10_1101-2021_01_06_425657	340	2	changes	change	NNS
10_1101-2021_01_06_425657	340	3	in	in	IN
10_1101-2021_01_06_425657	340	4	metabolic	metabolic	JJ
10_1101-2021_01_06_425657	340	5	state	state	NN
10_1101-2021_01_06_425657	340	6	during	during	IN
10_1101-2021_01_06_425657	340	7	the	the	DT
10_1101-2021_01_06_425657	340	8	life	life	NN
10_1101-2021_01_06_425657	340	9	of	of	IN
10_1101-2021_01_06_425657	340	10	a	a	DT
10_1101-2021_01_06_425657	340	11	yeast	yeast	NN
10_1101-2021_01_06_425657	340	12	cell	cell	NN
10_1101-2021_01_06_425657	340	13	.	.	.
10_1101-2021_01_06_425657	341	1	643	643	CD
10_1101-2021_01_06_425657	341	2	Proc	Proc	NNP
10_1101-2021_01_06_425657	341	3	Natl	Natl	NNP
10_1101-2021_01_06_425657	341	4	Acad	Acad	NNP
10_1101-2021_01_06_425657	341	5	Sci	Sci	NNP
10_1101-2021_01_06_425657	341	6	U	U	NNP
10_1101-2021_01_06_425657	341	7	S	S	NNP
10_1101-2021_01_06_425657	341	8	A	A	NNP
10_1101-2021_01_06_425657	341	9	,	,	,
10_1101-2021_01_06_425657	341	10	104	104	CD
10_1101-2021_01_06_425657	341	11	,	,	,
10_1101-2021_01_06_425657	341	12	16886	16886	CD
10_1101-2021_01_06_425657	341	13	-	-	SYM
10_1101-2021_01_06_425657	341	14	91	91	CD
10_1101-2021_01_06_425657	341	15	.	.	.
10_1101-2021_01_06_425657	342	1	644	644	CD
10_1101-2021_01_06_425657	342	2	VAN	VAN	NNP
10_1101-2021_01_06_425657	342	3	DIJKEN	DIJKEN	NNP
10_1101-2021_01_06_425657	342	4	,	,	,
10_1101-2021_01_06_425657	342	5	J.	J.	NNP
10_1101-2021_01_06_425657	342	6	P.	P.	NNP
10_1101-2021_01_06_425657	342	7	,	,	,
10_1101-2021_01_06_425657	342	8	BAUER	BAUER	NNP
10_1101-2021_01_06_425657	342	9	,	,	,
10_1101-2021_01_06_425657	342	10	J.	J.	NNP
10_1101-2021_01_06_425657	342	11	,	,	,
10_1101-2021_01_06_425657	342	12	BRAMBILLA	BRAMBILLA	NNP
10_1101-2021_01_06_425657	342	13	,	,	,
10_1101-2021_01_06_425657	342	14	L.	L.	NNP
10_1101-2021_01_06_425657	342	15	,	,	,
10_1101-2021_01_06_425657	342	16	DUBOC	DUBOC	NNP
10_1101-2021_01_06_425657	342	17	,	,	,
10_1101-2021_01_06_425657	342	18	P.	P.	NNP
10_1101-2021_01_06_425657	342	19	,	,	,
10_1101-2021_01_06_425657	342	20	FRANCOIS	FRANCOIS	NNP
10_1101-2021_01_06_425657	342	21	,	,	,
10_1101-2021_01_06_425657	342	22	J.	J.	NNP
10_1101-2021_01_06_425657	342	23	M.	M.	NNP
10_1101-2021_01_06_425657	342	24	,	,	,
10_1101-2021_01_06_425657	342	25	645	645	CD
10_1101-2021_01_06_425657	342	26	GANCEDO	GANCEDO	NNP
10_1101-2021_01_06_425657	342	27	,	,	,
10_1101-2021_01_06_425657	342	28	C.	C.	NNP
10_1101-2021_01_06_425657	342	29	,	,	,
10_1101-2021_01_06_425657	342	30	GIUSEPPIN	GIUSEPPIN	NNP
10_1101-2021_01_06_425657	342	31	,	,	,
10_1101-2021_01_06_425657	342	32	M.	M.	NNP
10_1101-2021_01_06_425657	342	33	L.	L.	NNP
10_1101-2021_01_06_425657	342	34	,	,	,
10_1101-2021_01_06_425657	342	35	HEIJNEN	HEIJNEN	NNP
10_1101-2021_01_06_425657	342	36	,	,	,
10_1101-2021_01_06_425657	342	37	J.	J.	NNP
10_1101-2021_01_06_425657	342	38	J.	J.	NNP
10_1101-2021_01_06_425657	342	39	,	,	,
10_1101-2021_01_06_425657	342	40	HOARE	HOARE	NNP
10_1101-2021_01_06_425657	342	41	,	,	,
10_1101-2021_01_06_425657	342	42	M.	M.	NNP
10_1101-2021_01_06_425657	342	43	,	,	,
10_1101-2021_01_06_425657	342	44	LANGE	LANGE	NNP
10_1101-2021_01_06_425657	342	45	,	,	,
10_1101-2021_01_06_425657	342	46	H.	H.	NNP
10_1101-2021_01_06_425657	342	47	C.	C.	NNP
10_1101-2021_01_06_425657	342	48	,	,	,
10_1101-2021_01_06_425657	342	49	646	646	CD
10_1101-2021_01_06_425657	342	50	MADDEN	MADDEN	NNP
10_1101-2021_01_06_425657	342	51	,	,	,
10_1101-2021_01_06_425657	342	52	E.	E.	NNP
10_1101-2021_01_06_425657	342	53	A.	A.	NNP
10_1101-2021_01_06_425657	342	54	,	,	,
10_1101-2021_01_06_425657	342	55	NIEDERBERGER	NIEDERBERGER	NNP
10_1101-2021_01_06_425657	342	56	,	,	,
10_1101-2021_01_06_425657	342	57	P.	P.	NNP
10_1101-2021_01_06_425657	342	58	,	,	,
10_1101-2021_01_06_425657	342	59	NIELSEN	NIELSEN	NNP
10_1101-2021_01_06_425657	342	60	,	,	,
10_1101-2021_01_06_425657	342	61	J.	J.	NNP
10_1101-2021_01_06_425657	342	62	,	,	,
10_1101-2021_01_06_425657	342	63	PARROU	PARROU	NNP
10_1101-2021_01_06_425657	342	64	,	,	,
10_1101-2021_01_06_425657	342	65	J.	J.	NNP
10_1101-2021_01_06_425657	342	66	L.	L.	NNP
10_1101-2021_01_06_425657	342	67	,	,	,
10_1101-2021_01_06_425657	342	68	PETIT	PETIT	NNP
10_1101-2021_01_06_425657	342	69	,	,	,
10_1101-2021_01_06_425657	342	70	T.	t.	NN
10_1101-2021_01_06_425657	342	71	,	,	,
10_1101-2021_01_06_425657	342	72	647	647	CD
10_1101-2021_01_06_425657	342	73	PORRO	PORRO	NNP
10_1101-2021_01_06_425657	342	74	,	,	,
10_1101-2021_01_06_425657	342	75	D.	D.	NNP
10_1101-2021_01_06_425657	342	76	,	,	,
10_1101-2021_01_06_425657	342	77	REUSS	REUSS	NNP
10_1101-2021_01_06_425657	342	78	,	,	,
10_1101-2021_01_06_425657	342	79	M.	M.	NNP
10_1101-2021_01_06_425657	342	80	,	,	,
10_1101-2021_01_06_425657	342	81	VAN	VAN	NNP
10_1101-2021_01_06_425657	342	82	RIEL	RIEL	NNP
10_1101-2021_01_06_425657	342	83	,	,	,
10_1101-2021_01_06_425657	342	84	N.	N.	NNP
10_1101-2021_01_06_425657	342	85	,	,	,
10_1101-2021_01_06_425657	342	86	RIZZI	RIZZI	NNP
10_1101-2021_01_06_425657	342	87	,	,	,
10_1101-2021_01_06_425657	342	88	M.	M.	NNP
10_1101-2021_01_06_425657	342	89	,	,	,
10_1101-2021_01_06_425657	342	90	STEENSMA	STEENSMA	NNP
10_1101-2021_01_06_425657	342	91	,	,	,
10_1101-2021_01_06_425657	342	92	H.	H.	NNP
10_1101-2021_01_06_425657	342	93	Y.	Y.	NNP
10_1101-2021_01_06_425657	342	94	,	,	,
10_1101-2021_01_06_425657	342	95	VERRIPS	VERRIPS	NNP
10_1101-2021_01_06_425657	342	96	,	,	,
10_1101-2021_01_06_425657	342	97	C.	C.	NNP
10_1101-2021_01_06_425657	342	98	648	648	CD
10_1101-2021_01_06_425657	342	99	T.	T.	NNP
10_1101-2021_01_06_425657	342	100	,	,	,
10_1101-2021_01_06_425657	342	101	VINDELOV	VINDELOV	NNP
10_1101-2021_01_06_425657	342	102	,	,	,
10_1101-2021_01_06_425657	342	103	J.	J.	NNP
10_1101-2021_01_06_425657	343	1	&	&	CC
10_1101-2021_01_06_425657	343	2	PRONK	PRONK	NNP
10_1101-2021_01_06_425657	343	3	,	,	,
10_1101-2021_01_06_425657	343	4	J.	J.	NNP
10_1101-2021_01_06_425657	343	5	T.	T.	NNP
10_1101-2021_01_06_425657	343	6	2000	2000	CD
10_1101-2021_01_06_425657	343	7	.	.	.
10_1101-2021_01_06_425657	344	1	An	an	DT
10_1101-2021_01_06_425657	344	2	interlaboratory	interlaboratory	JJ
10_1101-2021_01_06_425657	344	3	comparison	comparison	NN
10_1101-2021_01_06_425657	344	4	of	of	IN
10_1101-2021_01_06_425657	344	5	649	649	CD
10_1101-2021_01_06_425657	344	6	physiological	physiological	JJ
10_1101-2021_01_06_425657	344	7	and	and	CC
10_1101-2021_01_06_425657	344	8	genetic	genetic	JJ
10_1101-2021_01_06_425657	344	9	properties	property	NNS
10_1101-2021_01_06_425657	344	10	of	of	IN
10_1101-2021_01_06_425657	344	11	four	four	CD
10_1101-2021_01_06_425657	344	12	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_06_425657	344	13	cerevisiae	cerevisiae	NN
10_1101-2021_01_06_425657	344	14	strains	strain	VBZ
10_1101-2021_01_06_425657	344	15	.	.	.
10_1101-2021_01_06_425657	345	1	Enzyme	Enzyme	NNP
10_1101-2021_01_06_425657	345	2	650	650	CD
10_1101-2021_01_06_425657	345	3	Microb	Microb	NNP
10_1101-2021_01_06_425657	345	4	Technol	Technol	NNP
10_1101-2021_01_06_425657	345	5	,	,	,
10_1101-2021_01_06_425657	345	6	26	26	CD
10_1101-2021_01_06_425657	345	7	,	,	,
10_1101-2021_01_06_425657	345	8	706	706	CD
10_1101-2021_01_06_425657	345	9	-	-	SYM
10_1101-2021_01_06_425657	345	10	714	714	CD
10_1101-2021_01_06_425657	345	11	.	.	.
10_1101-2021_01_06_425657	346	1	651	651	CD
10_1101-2021_01_06_425657	346	2	WU	WU	NNP
10_1101-2021_01_06_425657	346	3	,	,	,
10_1101-2021_01_06_425657	346	4	G.	G.	NNP
10_1101-2021_01_06_425657	346	5	,	,	,
10_1101-2021_01_06_425657	346	6	FANG	FANG	NNP
10_1101-2021_01_06_425657	346	7	,	,	,
10_1101-2021_01_06_425657	346	8	Y.	Y.	NNP
10_1101-2021_01_06_425657	347	1	Z.	Z.	NNP
10_1101-2021_01_06_425657	347	2	,	,	,
10_1101-2021_01_06_425657	347	3	YANG	YANG	NNP
10_1101-2021_01_06_425657	347	4	,	,	,
10_1101-2021_01_06_425657	347	5	S.	S.	NNP
10_1101-2021_01_06_425657	347	6	,	,	,
10_1101-2021_01_06_425657	347	7	LUPTON	LUPTON	NNP
10_1101-2021_01_06_425657	347	8	,	,	,
10_1101-2021_01_06_425657	347	9	J.	J.	NNP
10_1101-2021_01_06_425657	347	10	R.	R.	NNP
10_1101-2021_01_06_425657	347	11	&	&	CC
10_1101-2021_01_06_425657	347	12	TURNER	TURNER	NNP
10_1101-2021_01_06_425657	347	13	,	,	,
10_1101-2021_01_06_425657	347	14	N.	N.	NNP
10_1101-2021_01_06_425657	347	15	D.	D.	NNP
10_1101-2021_01_06_425657	347	16	2004	2004	CD
10_1101-2021_01_06_425657	347	17	.	.	.
10_1101-2021_01_06_425657	348	1	Glutathione	glutathione	NN
10_1101-2021_01_06_425657	348	2	652	652	CD
10_1101-2021_01_06_425657	348	3	metabolism	metabolism	NN
10_1101-2021_01_06_425657	348	4	and	and	CC
10_1101-2021_01_06_425657	348	5	its	-PRON-	PRP$
10_1101-2021_01_06_425657	348	6	implications	implication	NNS
10_1101-2021_01_06_425657	348	7	for	for	IN
10_1101-2021_01_06_425657	348	8	health	health	NN
10_1101-2021_01_06_425657	348	9	.	.	.
10_1101-2021_01_06_425657	349	1	J	J	NNP
10_1101-2021_01_06_425657	349	2	Nutr	Nutr	NNP
10_1101-2021_01_06_425657	349	3	,	,	,
10_1101-2021_01_06_425657	349	4	134	134	CD
10_1101-2021_01_06_425657	349	5	,	,	,
10_1101-2021_01_06_425657	349	6	489	489	CD
10_1101-2021_01_06_425657	349	7	-	-	SYM
10_1101-2021_01_06_425657	349	8	92	92	CD
10_1101-2021_01_06_425657	349	9	.	.	.
10_1101-2021_01_06_425657	350	1	653	653	CD
10_1101-2021_01_06_425657	350	2	WU	WU	NNP
10_1101-2021_01_06_425657	350	3	,	,	,
10_1101-2021_01_06_425657	350	4	X.	X.	NNP
10_1101-2021_01_06_425657	351	1	&	&	CC
10_1101-2021_01_06_425657	351	2	TU	TU	NNP
10_1101-2021_01_06_425657	351	3	,	,	,
10_1101-2021_01_06_425657	351	4	B.	B.	NNP
10_1101-2021_01_06_425657	351	5	P.	P.	NNP
10_1101-2021_01_06_425657	351	6	2011	2011	CD
10_1101-2021_01_06_425657	351	7	.	.	.
10_1101-2021_01_06_425657	352	1	Selective	selective	JJ
10_1101-2021_01_06_425657	352	2	regulation	regulation	NN
10_1101-2021_01_06_425657	352	3	of	of	IN
10_1101-2021_01_06_425657	352	4	autophagy	autophagy	NN
10_1101-2021_01_06_425657	352	5	by	by	IN
10_1101-2021_01_06_425657	352	6	the	the	DT
10_1101-2021_01_06_425657	352	7	Iml1-Npr2-Npr3	Iml1-Npr2-Npr3	NNP
10_1101-2021_01_06_425657	352	8	complex	complex	NN
10_1101-2021_01_06_425657	352	9	in	in	IN
10_1101-2021_01_06_425657	352	10	654	654	CD
10_1101-2021_01_06_425657	352	11	the	the	DT
10_1101-2021_01_06_425657	352	12	absence	absence	NN
10_1101-2021_01_06_425657	352	13	of	of	IN
10_1101-2021_01_06_425657	352	14	nitrogen	nitrogen	NN
10_1101-2021_01_06_425657	352	15	starvation	starvation	NN
10_1101-2021_01_06_425657	352	16	.	.	.
10_1101-2021_01_06_425657	353	1	Mol	Mol	NNP
10_1101-2021_01_06_425657	353	2	Biol	Biol	NNP
10_1101-2021_01_06_425657	353	3	Cell	Cell	NNP
10_1101-2021_01_06_425657	353	4	,	,	,
10_1101-2021_01_06_425657	353	5	22	22	CD
10_1101-2021_01_06_425657	353	6	,	,	,
10_1101-2021_01_06_425657	353	7	4124	4124	CD
10_1101-2021_01_06_425657	353	8	-	-	SYM
10_1101-2021_01_06_425657	353	9	33	33	CD
10_1101-2021_01_06_425657	353	10	.	.	.
10_1101-2021_01_06_425657	354	1	655	655	CD
10_1101-2021_01_06_425657	354	2	YAMAMOTO	YAMAMOTO	NNP
10_1101-2021_01_06_425657	354	3	,	,	,
10_1101-2021_01_06_425657	354	4	M.	M.	NNP
10_1101-2021_01_06_425657	354	5	,	,	,
10_1101-2021_01_06_425657	354	6	KENSLER	KENSLER	NNP
10_1101-2021_01_06_425657	354	7	,	,	,
10_1101-2021_01_06_425657	354	8	T.	T.	NNP
10_1101-2021_01_06_425657	354	9	W.	W.	NNP
10_1101-2021_01_06_425657	354	10	&	&	CC
10_1101-2021_01_06_425657	354	11	MOTOHASHI	MOTOHASHI	NNP
10_1101-2021_01_06_425657	354	12	,	,	,
10_1101-2021_01_06_425657	354	13	H.	H.	NNP
10_1101-2021_01_06_425657	354	14	2018	2018	CD
10_1101-2021_01_06_425657	354	15	.	.	.
10_1101-2021_01_06_425657	355	1	The	the	DT
10_1101-2021_01_06_425657	355	2	KEAP1-NRF2	KEAP1-NRF2	NNP
10_1101-2021_01_06_425657	355	3	System	system	NN
10_1101-2021_01_06_425657	355	4	:	:	:
10_1101-2021_01_06_425657	355	5	a	a	DT
10_1101-2021_01_06_425657	355	6	656	656	CD
10_1101-2021_01_06_425657	355	7	Thiol	Thiol	NNP
10_1101-2021_01_06_425657	355	8	-	-	HYPH
10_1101-2021_01_06_425657	355	9	Based	base	VBN
10_1101-2021_01_06_425657	355	10	Sensor	Sensor	NNP
10_1101-2021_01_06_425657	355	11	-	-	HYPH
10_1101-2021_01_06_425657	355	12	Effector	Effector	NNP
10_1101-2021_01_06_425657	355	13	Apparatus	Apparatus	NNP
10_1101-2021_01_06_425657	355	14	for	for	IN
10_1101-2021_01_06_425657	355	15	Maintaining	maintain	VBG
10_1101-2021_01_06_425657	355	16	Redox	Redox	NNP
10_1101-2021_01_06_425657	355	17	Homeostasis	Homeostasis	NNP
10_1101-2021_01_06_425657	355	18	.	.	.
10_1101-2021_01_06_425657	356	1	Physiol	Physiol	NNP
10_1101-2021_01_06_425657	356	2	657	657	CD
10_1101-2021_01_06_425657	356	3	Rev	Rev	NNP
10_1101-2021_01_06_425657	356	4	,	,	,
10_1101-2021_01_06_425657	356	5	98	98	CD
10_1101-2021_01_06_425657	356	6	,	,	,
10_1101-2021_01_06_425657	356	7	1169	1169	CD
10_1101-2021_01_06_425657	356	8	-	-	SYM
10_1101-2021_01_06_425657	356	9	1203	1203	CD
10_1101-2021_01_06_425657	356	10	.	.	.
10_1101-2021_01_06_425657	357	1	658	658	CD
10_1101-2021_01_06_425657	357	2	.CC	.CC	NFP
10_1101-2021_01_06_425657	357	3	-	-	:
10_1101-2021_01_06_425657	357	4	BY	by	IN
10_1101-2021_01_06_425657	357	5	4.0	4.0	CD
10_1101-2021_01_06_425657	357	6	International	International	NNP
10_1101-2021_01_06_425657	357	7	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	357	8	under	under	IN
10_1101-2021_01_06_425657	357	9	a	a	DT
10_1101-2021_01_06_425657	357	10	(	(	-LRB-
10_1101-2021_01_06_425657	357	11	which	which	WDT
10_1101-2021_01_06_425657	357	12	was	be	VBD
10_1101-2021_01_06_425657	357	13	not	not	RB
10_1101-2021_01_06_425657	357	14	certified	certify	VBN
10_1101-2021_01_06_425657	357	15	by	by	IN
10_1101-2021_01_06_425657	357	16	peer	peer	NN
10_1101-2021_01_06_425657	357	17	review	review	NN
10_1101-2021_01_06_425657	357	18	)	)	-RRB-
10_1101-2021_01_06_425657	357	19	is	be	VBZ
10_1101-2021_01_06_425657	357	20	the	the	DT
10_1101-2021_01_06_425657	357	21	author	author	NN
10_1101-2021_01_06_425657	357	22	/	/	SYM
10_1101-2021_01_06_425657	357	23	funder	funder	NN
10_1101-2021_01_06_425657	357	24	,	,	,
10_1101-2021_01_06_425657	357	25	who	who	WP
10_1101-2021_01_06_425657	357	26	has	have	VBZ
10_1101-2021_01_06_425657	357	27	granted	grant	VBN
10_1101-2021_01_06_425657	357	28	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	357	29	a	a	DT
10_1101-2021_01_06_425657	357	30	license	license	NN
10_1101-2021_01_06_425657	357	31	to	to	TO
10_1101-2021_01_06_425657	357	32	display	display	VB
10_1101-2021_01_06_425657	357	33	the	the	DT
10_1101-2021_01_06_425657	357	34	preprint	preprint	NN
10_1101-2021_01_06_425657	357	35	in	in	IN
10_1101-2021_01_06_425657	357	36	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	357	37	.	.	.
10_1101-2021_01_06_425657	358	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	358	2	is	be	VBZ
10_1101-2021_01_06_425657	358	3	made	make	VBN
10_1101-2021_01_06_425657	358	4	The	the	DT
10_1101-2021_01_06_425657	358	5	copyright	copyright	NN
10_1101-2021_01_06_425657	358	6	holder	holder	NN
10_1101-2021_01_06_425657	358	7	for	for	IN
10_1101-2021_01_06_425657	358	8	this	this	DT
10_1101-2021_01_06_425657	358	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	358	10	version	version	NN
10_1101-2021_01_06_425657	358	11	posted	post	VBD
10_1101-2021_01_06_425657	358	12	January	January	NNP
10_1101-2021_01_06_425657	358	13	7	7	CD
10_1101-2021_01_06_425657	358	14	,	,	,
10_1101-2021_01_06_425657	358	15	2021	2021	CD
10_1101-2021_01_06_425657	358	16	.	.	.
10_1101-2021_01_06_425657	358	17	;	;	:
10_1101-2021_01_06_425657	358	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	358	19	:	:	:
10_1101-2021_01_06_425657	358	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	358	21	preprint	preprint	NN
10_1101-2021_01_06_425657	358	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	358	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	358	24	19	19	CD
10_1101-2021_01_06_425657	358	25	YANG	yang	NN
10_1101-2021_01_06_425657	358	26	,	,	,
10_1101-2021_01_06_425657	358	27	Y.	Y.	NNP
10_1101-2021_01_06_425657	358	28	S.	S.	NNP
10_1101-2021_01_06_425657	358	29	,	,	,
10_1101-2021_01_06_425657	358	30	KATO	KATO	NNP
10_1101-2021_01_06_425657	358	31	,	,	,
10_1101-2021_01_06_425657	358	32	M.	M.	NNP
10_1101-2021_01_06_425657	358	33	,	,	,
10_1101-2021_01_06_425657	358	34	WU	WU	NNP
10_1101-2021_01_06_425657	358	35	,	,	,
10_1101-2021_01_06_425657	358	36	X.	X.	NNP
10_1101-2021_01_06_425657	358	37	,	,	,
10_1101-2021_01_06_425657	358	38	LITSIOS	LITSIOS	NNP
10_1101-2021_01_06_425657	358	39	,	,	,
10_1101-2021_01_06_425657	358	40	A.	A.	NNP
10_1101-2021_01_06_425657	358	41	,	,	,
10_1101-2021_01_06_425657	358	42	SUTTER	SUTTER	NNP
10_1101-2021_01_06_425657	358	43	,	,	,
10_1101-2021_01_06_425657	358	44	B.	B.	NNP
10_1101-2021_01_06_425657	358	45	M.	M.	NNP
10_1101-2021_01_06_425657	358	46	,	,	,
10_1101-2021_01_06_425657	358	47	WANG	WANG	NNP
10_1101-2021_01_06_425657	358	48	,	,	,
10_1101-2021_01_06_425657	358	49	Y.	Y.	NNP
10_1101-2021_01_06_425657	358	50	,	,	,
10_1101-2021_01_06_425657	358	51	HSU	HSU	NNP
10_1101-2021_01_06_425657	358	52	,	,	,
10_1101-2021_01_06_425657	358	53	C.	C.	NNP
10_1101-2021_01_06_425657	358	54	H.	H.	NNP
10_1101-2021_01_06_425657	358	55	,	,	,
10_1101-2021_01_06_425657	358	56	659	659	CD
10_1101-2021_01_06_425657	358	57	WOOD	wood	NN
10_1101-2021_01_06_425657	358	58	,	,	,
10_1101-2021_01_06_425657	358	59	N.	N.	NNP
10_1101-2021_01_06_425657	358	60	E.	E.	NNP
10_1101-2021_01_06_425657	358	61	,	,	,
10_1101-2021_01_06_425657	358	62	LEMOFF	LEMOFF	NNP
10_1101-2021_01_06_425657	358	63	,	,	,
10_1101-2021_01_06_425657	358	64	A.	A.	NNP
10_1101-2021_01_06_425657	358	65	,	,	,
10_1101-2021_01_06_425657	358	66	MIRZAEI	MIRZAEI	NNP
10_1101-2021_01_06_425657	358	67	,	,	,
10_1101-2021_01_06_425657	358	68	H.	H.	NNP
10_1101-2021_01_06_425657	358	69	,	,	,
10_1101-2021_01_06_425657	358	70	HEINEMANN	HEINEMANN	NNP
10_1101-2021_01_06_425657	358	71	,	,	,
10_1101-2021_01_06_425657	358	72	M.	M.	NNP
10_1101-2021_01_06_425657	358	73	&	&	CC
10_1101-2021_01_06_425657	358	74	TU	TU	NNP
10_1101-2021_01_06_425657	358	75	,	,	,
10_1101-2021_01_06_425657	358	76	B.	B.	NNP
10_1101-2021_01_06_425657	358	77	P.	P.	NNP
10_1101-2021_01_06_425657	358	78	2019	2019	CD
10_1101-2021_01_06_425657	358	79	.	.	.
10_1101-2021_01_06_425657	359	1	660	660	CD
10_1101-2021_01_06_425657	359	2	Yeast	Yeast	NNP
10_1101-2021_01_06_425657	359	3	Ataxin-2	Ataxin-2	NNP
10_1101-2021_01_06_425657	359	4	Forms	form	VBZ
10_1101-2021_01_06_425657	359	5	an	an	DT
10_1101-2021_01_06_425657	359	6	Intracellular	Intracellular	NNP
10_1101-2021_01_06_425657	359	7	Condensate	Condensate	NNP
10_1101-2021_01_06_425657	359	8	Required	require	VBN
10_1101-2021_01_06_425657	359	9	for	for	IN
10_1101-2021_01_06_425657	359	10	the	the	DT
10_1101-2021_01_06_425657	359	11	Inhibition	inhibition	NN
10_1101-2021_01_06_425657	359	12	of	of	IN
10_1101-2021_01_06_425657	359	13	TORC1	torc1	NN
10_1101-2021_01_06_425657	359	14	661	661	CD
10_1101-2021_01_06_425657	359	15	Signaling	signal	VBG
10_1101-2021_01_06_425657	359	16	during	during	IN
10_1101-2021_01_06_425657	359	17	Respiratory	respiratory	JJ
10_1101-2021_01_06_425657	359	18	Growth	Growth	NNP
10_1101-2021_01_06_425657	359	19	.	.	.
10_1101-2021_01_06_425657	360	1	Cell	cell	NN
10_1101-2021_01_06_425657	360	2	,	,	,
10_1101-2021_01_06_425657	360	3	177	177	CD
10_1101-2021_01_06_425657	360	4	,	,	,
10_1101-2021_01_06_425657	360	5	697	697	CD
10_1101-2021_01_06_425657	360	6	-	-	SYM
10_1101-2021_01_06_425657	360	7	710	710	CD
10_1101-2021_01_06_425657	360	8	e17	e17	NN
10_1101-2021_01_06_425657	360	9	.	.	.
10_1101-2021_01_06_425657	361	1	662	662	CD
10_1101-2021_01_06_425657	361	2	YE	YE	NNP
10_1101-2021_01_06_425657	361	3	,	,	,
10_1101-2021_01_06_425657	361	4	C.	C.	NNP
10_1101-2021_01_06_425657	361	5	,	,	,
10_1101-2021_01_06_425657	361	6	SUTTER	SUTTER	NNP
10_1101-2021_01_06_425657	361	7	,	,	,
10_1101-2021_01_06_425657	361	8	B.	B.	NNP
10_1101-2021_01_06_425657	361	9	M.	M.	NNP
10_1101-2021_01_06_425657	361	10	,	,	,
10_1101-2021_01_06_425657	361	11	WANG	WANG	NNP
10_1101-2021_01_06_425657	361	12	,	,	,
10_1101-2021_01_06_425657	361	13	Y.	Y.	NNP
10_1101-2021_01_06_425657	361	14	,	,	,
10_1101-2021_01_06_425657	361	15	KUANG	KUANG	NNP
10_1101-2021_01_06_425657	361	16	,	,	,
10_1101-2021_01_06_425657	361	17	Z.	Z.	NNP
10_1101-2021_01_06_425657	362	1	&	&	CC
10_1101-2021_01_06_425657	362	2	TU	TU	NNP
10_1101-2021_01_06_425657	362	3	,	,	,
10_1101-2021_01_06_425657	362	4	B.	B.	NNP
10_1101-2021_01_06_425657	362	5	P.	P.	NNP
10_1101-2021_01_06_425657	362	6	2017	2017	CD
10_1101-2021_01_06_425657	362	7	.	.	.
10_1101-2021_01_06_425657	363	1	A	a	DT
10_1101-2021_01_06_425657	363	2	Metabolic	metabolic	JJ
10_1101-2021_01_06_425657	363	3	Function	Function	NNP
10_1101-2021_01_06_425657	363	4	for	for	IN
10_1101-2021_01_06_425657	363	5	663	663	CD
10_1101-2021_01_06_425657	363	6	Phospholipid	Phospholipid	NNP
10_1101-2021_01_06_425657	363	7	and	and	CC
10_1101-2021_01_06_425657	363	8	Histone	Histone	NNP
10_1101-2021_01_06_425657	363	9	Methylation	Methylation	NNP
10_1101-2021_01_06_425657	363	10	.	.	.
10_1101-2021_01_06_425657	364	1	Mol	Mol	NNP
10_1101-2021_01_06_425657	364	2	Cell	Cell	NNP
10_1101-2021_01_06_425657	364	3	,	,	,
10_1101-2021_01_06_425657	364	4	66	66	CD
10_1101-2021_01_06_425657	364	5	,	,	,
10_1101-2021_01_06_425657	364	6	180	180	CD
10_1101-2021_01_06_425657	364	7	-	-	SYM
10_1101-2021_01_06_425657	364	8	193	193	CD
10_1101-2021_01_06_425657	364	9	e8	e8	NNS
10_1101-2021_01_06_425657	364	10	.	.	.
10_1101-2021_01_06_425657	365	1	664	664	CD
10_1101-2021_01_06_425657	365	2	YE	YE	NNP
10_1101-2021_01_06_425657	365	3	,	,	,
10_1101-2021_01_06_425657	365	4	C.	C.	NNP
10_1101-2021_01_06_425657	365	5	,	,	,
10_1101-2021_01_06_425657	365	6	SUTTER	SUTTER	NNP
10_1101-2021_01_06_425657	365	7	,	,	,
10_1101-2021_01_06_425657	365	8	B.	B.	NNP
10_1101-2021_01_06_425657	365	9	M.	M.	NNP
10_1101-2021_01_06_425657	365	10	,	,	,
10_1101-2021_01_06_425657	365	11	WANG	WANG	NNP
10_1101-2021_01_06_425657	365	12	,	,	,
10_1101-2021_01_06_425657	365	13	Y.	Y.	NNP
10_1101-2021_01_06_425657	365	14	,	,	,
10_1101-2021_01_06_425657	365	15	KUANG	KUANG	NNP
10_1101-2021_01_06_425657	365	16	,	,	,
10_1101-2021_01_06_425657	365	17	Z.	Z.	NNP
10_1101-2021_01_06_425657	365	18	,	,	,
10_1101-2021_01_06_425657	365	19	ZHAO	ZHAO	NNP
10_1101-2021_01_06_425657	365	20	,	,	,
10_1101-2021_01_06_425657	365	21	X.	X.	NNP
10_1101-2021_01_06_425657	365	22	,	,	,
10_1101-2021_01_06_425657	365	23	YU	YU	NNP
10_1101-2021_01_06_425657	365	24	,	,	,
10_1101-2021_01_06_425657	365	25	Y.	Y.	NNP
10_1101-2021_01_06_425657	366	1	&	&	CC
10_1101-2021_01_06_425657	366	2	TU	TU	NNP
10_1101-2021_01_06_425657	366	3	,	,	,
10_1101-2021_01_06_425657	366	4	B.	B.	NNP
10_1101-2021_01_06_425657	366	5	P.	P.	NNP
10_1101-2021_01_06_425657	366	6	2019	2019	CD
10_1101-2021_01_06_425657	366	7	.	.	.
10_1101-2021_01_06_425657	367	1	665	665	CD
10_1101-2021_01_06_425657	367	2	Demethylation	demethylation	NN
10_1101-2021_01_06_425657	367	3	of	of	IN
10_1101-2021_01_06_425657	367	4	the	the	DT
10_1101-2021_01_06_425657	367	5	Protein	Protein	NNP
10_1101-2021_01_06_425657	367	6	Phosphatase	Phosphatase	NNP
10_1101-2021_01_06_425657	367	7	PP2A	PP2A	NNP
10_1101-2021_01_06_425657	367	8	Promotes	Promotes	NNPS
10_1101-2021_01_06_425657	367	9	Demethylation	Demethylation	NNP
10_1101-2021_01_06_425657	367	10	of	of	IN
10_1101-2021_01_06_425657	367	11	Histones	Histones	NNPS
10_1101-2021_01_06_425657	367	12	to	to	IN
10_1101-2021_01_06_425657	367	13	666	666	CD
10_1101-2021_01_06_425657	367	14	Enable	enable	VB
10_1101-2021_01_06_425657	367	15	Their	-PRON-	PRP$
10_1101-2021_01_06_425657	367	16	Function	function	NN
10_1101-2021_01_06_425657	367	17	as	as	IN
10_1101-2021_01_06_425657	367	18	a	a	DT
10_1101-2021_01_06_425657	367	19	Methyl	Methyl	NNP
10_1101-2021_01_06_425657	367	20	Group	Group	NNP
10_1101-2021_01_06_425657	367	21	Sink	Sink	NNP
10_1101-2021_01_06_425657	367	22	.	.	.
10_1101-2021_01_06_425657	368	1	Mol	Mol	NNP
10_1101-2021_01_06_425657	368	2	Cell	Cell	NNP
10_1101-2021_01_06_425657	368	3	,	,	,
10_1101-2021_01_06_425657	368	4	73	73	CD
10_1101-2021_01_06_425657	368	5	,	,	,
10_1101-2021_01_06_425657	368	6	1115	1115	CD
10_1101-2021_01_06_425657	368	7	-	-	SYM
10_1101-2021_01_06_425657	368	8	1126	1126	CD
10_1101-2021_01_06_425657	368	9	e6	e6	NNS
10_1101-2021_01_06_425657	368	10	.	.	.
10_1101-2021_01_06_425657	369	1	667	667	CD
10_1101-2021_01_06_425657	369	2	YEN	YEN	NNP
10_1101-2021_01_06_425657	369	3	,	,	,
10_1101-2021_01_06_425657	369	4	J.	J.	NNP
10_1101-2021_01_06_425657	369	5	L.	L.	NNP
10_1101-2021_01_06_425657	369	6	,	,	,
10_1101-2021_01_06_425657	369	7	FLICK	FLICK	NNP
10_1101-2021_01_06_425657	369	8	,	,	,
10_1101-2021_01_06_425657	369	9	K.	K.	NNP
10_1101-2021_01_06_425657	369	10	,	,	,
10_1101-2021_01_06_425657	369	11	PAPAGIANNIS	PAPAGIANNIS	NNP
10_1101-2021_01_06_425657	369	12	,	,	,
10_1101-2021_01_06_425657	369	13	C.	C.	NNP
10_1101-2021_01_06_425657	369	14	V.	V.	NNP
10_1101-2021_01_06_425657	369	15	,	,	,
10_1101-2021_01_06_425657	369	16	MATHUR	MATHUR	NNP
10_1101-2021_01_06_425657	369	17	,	,	,
10_1101-2021_01_06_425657	369	18	R.	R.	NNP
10_1101-2021_01_06_425657	369	19	,	,	,
10_1101-2021_01_06_425657	369	20	TYRRELL	TYRRELL	NNP
10_1101-2021_01_06_425657	369	21	,	,	,
10_1101-2021_01_06_425657	369	22	A.	A.	NNP
10_1101-2021_01_06_425657	369	23	,	,	,
10_1101-2021_01_06_425657	369	24	OUNI	OUNI	NNP
10_1101-2021_01_06_425657	369	25	,	,	,
10_1101-2021_01_06_425657	369	26	I.	I.	NNP
10_1101-2021_01_06_425657	369	27	,	,	,
10_1101-2021_01_06_425657	369	28	668	668	CD
10_1101-2021_01_06_425657	369	29	KAAKE	KAAKE	NNP
10_1101-2021_01_06_425657	369	30	,	,	,
10_1101-2021_01_06_425657	369	31	R.	R.	NNP
10_1101-2021_01_06_425657	369	32	M.	M.	NNP
10_1101-2021_01_06_425657	369	33	,	,	,
10_1101-2021_01_06_425657	369	34	HUANG	HUANG	NNP
10_1101-2021_01_06_425657	369	35	,	,	,
10_1101-2021_01_06_425657	369	36	L.	L.	NNP
10_1101-2021_01_06_425657	369	37	&	&	CC
10_1101-2021_01_06_425657	369	38	KAISER	KAISER	NNP
10_1101-2021_01_06_425657	369	39	,	,	,
10_1101-2021_01_06_425657	369	40	P.	P.	NNP
10_1101-2021_01_06_425657	369	41	2012	2012	CD
10_1101-2021_01_06_425657	369	42	.	.	.
10_1101-2021_01_06_425657	370	1	Signal	signal	NN
10_1101-2021_01_06_425657	370	2	-	-	HYPH
10_1101-2021_01_06_425657	370	3	induced	induce	VBN
10_1101-2021_01_06_425657	370	4	disassembly	disassembly	RB
10_1101-2021_01_06_425657	370	5	of	of	IN
10_1101-2021_01_06_425657	370	6	the	the	DT
10_1101-2021_01_06_425657	370	7	669	669	CD
10_1101-2021_01_06_425657	370	8	SCF	SCF	NNP
10_1101-2021_01_06_425657	370	9	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	370	10	ligase	ligase	NN
10_1101-2021_01_06_425657	370	11	complex	complex	NN
10_1101-2021_01_06_425657	370	12	by	by	IN
10_1101-2021_01_06_425657	370	13	Cdc48	Cdc48	NNP
10_1101-2021_01_06_425657	370	14	/	/	SYM
10_1101-2021_01_06_425657	370	15	p97	p97	NN
10_1101-2021_01_06_425657	370	16	.	.	.
10_1101-2021_01_06_425657	371	1	Mol	Mol	NNP
10_1101-2021_01_06_425657	371	2	Cell	Cell	NNP
10_1101-2021_01_06_425657	371	3	,	,	,
10_1101-2021_01_06_425657	371	4	48	48	CD
10_1101-2021_01_06_425657	371	5	,	,	,
10_1101-2021_01_06_425657	371	6	288	288	CD
10_1101-2021_01_06_425657	371	7	-	-	SYM
10_1101-2021_01_06_425657	371	8	97	97	CD
10_1101-2021_01_06_425657	371	9	.	.	.
10_1101-2021_01_06_425657	372	1	670	670	CD
10_1101-2021_01_06_425657	372	2	YEN	YEN	NNP
10_1101-2021_01_06_425657	372	3	,	,	,
10_1101-2021_01_06_425657	372	4	J.	J.	NNP
10_1101-2021_01_06_425657	372	5	L.	L.	NNP
10_1101-2021_01_06_425657	372	6	,	,	,
10_1101-2021_01_06_425657	372	7	SU	SU	NNP
10_1101-2021_01_06_425657	372	8	,	,	,
10_1101-2021_01_06_425657	372	9	N.	N.	NNP
10_1101-2021_01_06_425657	372	10	Y.	Y.	NNP
10_1101-2021_01_06_425657	373	1	&	&	CC
10_1101-2021_01_06_425657	373	2	KAISER	KAISER	NNP
10_1101-2021_01_06_425657	373	3	,	,	,
10_1101-2021_01_06_425657	373	4	P.	P.	NNP
10_1101-2021_01_06_425657	373	5	2005	2005	CD
10_1101-2021_01_06_425657	373	6	.	.	.
10_1101-2021_01_06_425657	374	1	The	the	DT
10_1101-2021_01_06_425657	374	2	yeast	yeast	NN
10_1101-2021_01_06_425657	374	3	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	374	4	ligase	ligase	NN
10_1101-2021_01_06_425657	374	5	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	374	6	regulates	regulate	VBZ
10_1101-2021_01_06_425657	374	7	671	671	CD
10_1101-2021_01_06_425657	374	8	heavy	heavy	JJ
10_1101-2021_01_06_425657	374	9	metal	metal	NN
10_1101-2021_01_06_425657	374	10	response	response	NN
10_1101-2021_01_06_425657	374	11	.	.	.
10_1101-2021_01_06_425657	375	1	Mol	Mol	NNP
10_1101-2021_01_06_425657	375	2	Biol	Biol	NNP
10_1101-2021_01_06_425657	375	3	Cell	Cell	NNP
10_1101-2021_01_06_425657	375	4	,	,	,
10_1101-2021_01_06_425657	375	5	16	16	CD
10_1101-2021_01_06_425657	375	6	,	,	,
10_1101-2021_01_06_425657	375	7	1872	1872	CD
10_1101-2021_01_06_425657	375	8	-	-	SYM
10_1101-2021_01_06_425657	375	9	82	82	CD
10_1101-2021_01_06_425657	375	10	.	.	.
10_1101-2021_01_06_425657	376	1	672	672	CD
10_1101-2021_01_06_425657	376	2	673	673	CD
10_1101-2021_01_06_425657	376	3	674	674	CD
10_1101-2021_01_06_425657	376	4	.CC	.cc	CD
10_1101-2021_01_06_425657	376	5	-	-	:
10_1101-2021_01_06_425657	376	6	BY	by	IN
10_1101-2021_01_06_425657	376	7	4.0	4.0	CD
10_1101-2021_01_06_425657	376	8	International	International	NNP
10_1101-2021_01_06_425657	376	9	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	376	10	under	under	IN
10_1101-2021_01_06_425657	376	11	a	a	DT
10_1101-2021_01_06_425657	376	12	(	(	-LRB-
10_1101-2021_01_06_425657	376	13	which	which	WDT
10_1101-2021_01_06_425657	376	14	was	be	VBD
10_1101-2021_01_06_425657	376	15	not	not	RB
10_1101-2021_01_06_425657	376	16	certified	certify	VBN
10_1101-2021_01_06_425657	376	17	by	by	IN
10_1101-2021_01_06_425657	376	18	peer	peer	NN
10_1101-2021_01_06_425657	376	19	review	review	NN
10_1101-2021_01_06_425657	376	20	)	)	-RRB-
10_1101-2021_01_06_425657	376	21	is	be	VBZ
10_1101-2021_01_06_425657	376	22	the	the	DT
10_1101-2021_01_06_425657	376	23	author	author	NN
10_1101-2021_01_06_425657	376	24	/	/	SYM
10_1101-2021_01_06_425657	376	25	funder	funder	NN
10_1101-2021_01_06_425657	376	26	,	,	,
10_1101-2021_01_06_425657	376	27	who	who	WP
10_1101-2021_01_06_425657	376	28	has	have	VBZ
10_1101-2021_01_06_425657	376	29	granted	grant	VBN
10_1101-2021_01_06_425657	376	30	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	376	31	a	a	DT
10_1101-2021_01_06_425657	376	32	license	license	NN
10_1101-2021_01_06_425657	376	33	to	to	TO
10_1101-2021_01_06_425657	376	34	display	display	VB
10_1101-2021_01_06_425657	376	35	the	the	DT
10_1101-2021_01_06_425657	376	36	preprint	preprint	NN
10_1101-2021_01_06_425657	376	37	in	in	IN
10_1101-2021_01_06_425657	376	38	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	376	39	.	.	.
10_1101-2021_01_06_425657	377	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	377	2	is	be	VBZ
10_1101-2021_01_06_425657	377	3	made	make	VBN
10_1101-2021_01_06_425657	377	4	The	the	DT
10_1101-2021_01_06_425657	377	5	copyright	copyright	NN
10_1101-2021_01_06_425657	377	6	holder	holder	NN
10_1101-2021_01_06_425657	377	7	for	for	IN
10_1101-2021_01_06_425657	377	8	this	this	DT
10_1101-2021_01_06_425657	377	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	377	10	version	version	NN
10_1101-2021_01_06_425657	377	11	posted	post	VBD
10_1101-2021_01_06_425657	377	12	January	January	NNP
10_1101-2021_01_06_425657	377	13	7	7	CD
10_1101-2021_01_06_425657	377	14	,	,	,
10_1101-2021_01_06_425657	377	15	2021	2021	CD
10_1101-2021_01_06_425657	377	16	.	.	.
10_1101-2021_01_06_425657	377	17	;	;	:
10_1101-2021_01_06_425657	377	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	377	19	:	:	:
10_1101-2021_01_06_425657	377	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	377	21	preprint	preprint	NN
10_1101-2021_01_06_425657	377	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	377	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	377	24	20	20	CD
10_1101-2021_01_06_425657	377	25	FIGURE	figure	NN
10_1101-2021_01_06_425657	377	26	LEGENDS	legend	NNS
10_1101-2021_01_06_425657	377	27	675	675	CD
10_1101-2021_01_06_425657	377	28	676	676	CD
10_1101-2021_01_06_425657	377	29	Figure	figure	NN
10_1101-2021_01_06_425657	377	30	1	1	CD
10_1101-2021_01_06_425657	377	31	.	.	.
10_1101-2021_01_06_425657	378	1	Met30	met30	JJ
10_1101-2021_01_06_425657	378	2	and	and	CC
10_1101-2021_01_06_425657	378	3	Met4	met4	JJ
10_1101-2021_01_06_425657	378	4	response	response	NN
10_1101-2021_01_06_425657	378	5	to	to	IN
10_1101-2021_01_06_425657	378	6	sulfur	sulfur	NN
10_1101-2021_01_06_425657	378	7	starvation	starvation	NN
10_1101-2021_01_06_425657	378	8	and	and	CC
10_1101-2021_01_06_425657	378	9	repletion	repletion	NN
10_1101-2021_01_06_425657	378	10	under	under	IN
10_1101-2021_01_06_425657	378	11	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	378	12	677	677	CD
10_1101-2021_01_06_425657	378	13	growth	growth	NN
10_1101-2021_01_06_425657	378	14	conditions	condition	NNS
10_1101-2021_01_06_425657	378	15	.	.	.
10_1101-2021_01_06_425657	379	1	678	678	CD
10_1101-2021_01_06_425657	379	2	(	(	-LRB-
10_1101-2021_01_06_425657	379	3	A	a	NN
10_1101-2021_01_06_425657	379	4	)	)	-RRB-
10_1101-2021_01_06_425657	379	5	Western	western	JJ
10_1101-2021_01_06_425657	379	6	blot	blot	NN
10_1101-2021_01_06_425657	379	7	analysis	analysis	NN
10_1101-2021_01_06_425657	379	8	of	of	IN
10_1101-2021_01_06_425657	379	9	a	a	DT
10_1101-2021_01_06_425657	379	10	time	time	NN
10_1101-2021_01_06_425657	379	11	course	course	NN
10_1101-2021_01_06_425657	379	12	performed	perform	VBN
10_1101-2021_01_06_425657	379	13	with	with	IN
10_1101-2021_01_06_425657	379	14	yeast	yeast	NN
10_1101-2021_01_06_425657	379	15	containing	contain	VBG
10_1101-2021_01_06_425657	379	16	endogenously	endogenously	RB
10_1101-2021_01_06_425657	379	17	tagged	tag	VBN
10_1101-2021_01_06_425657	379	18	679	679	CD
10_1101-2021_01_06_425657	379	19	Met30	Met30	NNP
10_1101-2021_01_06_425657	379	20	and	and	CC
10_1101-2021_01_06_425657	379	21	Met4	Met4	NNP
10_1101-2021_01_06_425657	379	22	that	that	WDT
10_1101-2021_01_06_425657	379	23	were	be	VBD
10_1101-2021_01_06_425657	379	24	cultured	culture	VBN
10_1101-2021_01_06_425657	379	25	in	in	IN
10_1101-2021_01_06_425657	379	26	rich	rich	JJ
10_1101-2021_01_06_425657	379	27	lactate	lactate	JJ
10_1101-2021_01_06_425657	379	28	media	medium	NNS
10_1101-2021_01_06_425657	379	29	(	(	-LRB-
10_1101-2021_01_06_425657	379	30	Rich	Rich	NNP
10_1101-2021_01_06_425657	379	31	)	)	-RRB-
10_1101-2021_01_06_425657	379	32	overnight	overnight	RB
10_1101-2021_01_06_425657	379	33	to	to	IN
10_1101-2021_01_06_425657	379	34	mid	mid	JJ
10_1101-2021_01_06_425657	379	35	log	log	NN
10_1101-2021_01_06_425657	379	36	phase	phase	NN
10_1101-2021_01_06_425657	379	37	before	before	IN
10_1101-2021_01_06_425657	379	38	680	680	CD
10_1101-2021_01_06_425657	379	39	switching	switch	VBG
10_1101-2021_01_06_425657	379	40	cells	cell	NNS
10_1101-2021_01_06_425657	379	41	to	to	IN
10_1101-2021_01_06_425657	379	42	sulfur	sulfur	NN
10_1101-2021_01_06_425657	379	43	-	-	HYPH
10_1101-2021_01_06_425657	379	44	free	free	JJ
10_1101-2021_01_06_425657	379	45	lactate	lactate	JJ
10_1101-2021_01_06_425657	379	46	media	medium	NNS
10_1101-2021_01_06_425657	379	47	(	(	-LRB-
10_1101-2021_01_06_425657	379	48	−sulfur	−sulfur	NN
10_1101-2021_01_06_425657	379	49	)	)	-RRB-
10_1101-2021_01_06_425657	379	50	for	for	IN
10_1101-2021_01_06_425657	379	51	1	1	CD
10_1101-2021_01_06_425657	379	52	h	h	NN
10_1101-2021_01_06_425657	379	53	,	,	,
10_1101-2021_01_06_425657	379	54	followed	follow	VBN
10_1101-2021_01_06_425657	379	55	by	by	IN
10_1101-2021_01_06_425657	379	56	the	the	DT
10_1101-2021_01_06_425657	379	57	addition	addition	NN
10_1101-2021_01_06_425657	379	58	of	of	IN
10_1101-2021_01_06_425657	379	59	a	a	DT
10_1101-2021_01_06_425657	379	60	mix	mix	NN
10_1101-2021_01_06_425657	379	61	of	of	IN
10_1101-2021_01_06_425657	379	62	681	681	CD
10_1101-2021_01_06_425657	379	63	the	the	DT
10_1101-2021_01_06_425657	379	64	sulfur	sulfur	NN
10_1101-2021_01_06_425657	379	65	containing	contain	VBG
10_1101-2021_01_06_425657	379	66	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	379	67	methionine	methionine	NNP
10_1101-2021_01_06_425657	379	68	,	,	,
10_1101-2021_01_06_425657	379	69	homocysteine	homocysteine	JJ
10_1101-2021_01_06_425657	379	70	,	,	,
10_1101-2021_01_06_425657	379	71	and	and	CC
10_1101-2021_01_06_425657	379	72	cysteine	cysteine	VB
10_1101-2021_01_06_425657	379	73	at	at	IN
10_1101-2021_01_06_425657	379	74	0.5	0.5	CD
10_1101-2021_01_06_425657	379	75	mM	mm	NN
10_1101-2021_01_06_425657	379	76	each	each	DT
10_1101-2021_01_06_425657	379	77	682	682	CD
10_1101-2021_01_06_425657	379	78	(	(	-LRB-
10_1101-2021_01_06_425657	379	79	+	+	DT
10_1101-2021_01_06_425657	379	80	Met	Met	NNP
10_1101-2021_01_06_425657	379	81	/	/	SYM
10_1101-2021_01_06_425657	379	82	Cys	Cys	NNP
10_1101-2021_01_06_425657	379	83	/	/	SYM
10_1101-2021_01_06_425657	379	84	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	379	85	)	)	-RRB-
10_1101-2021_01_06_425657	379	86	.	.	.
10_1101-2021_01_06_425657	380	1	683	683	CD
10_1101-2021_01_06_425657	380	2	(	(	-LRB-
10_1101-2021_01_06_425657	380	3	B	b	NN
10_1101-2021_01_06_425657	380	4	)	)	-RRB-
10_1101-2021_01_06_425657	380	5	Expression	expression	NN
10_1101-2021_01_06_425657	380	6	of	of	IN
10_1101-2021_01_06_425657	380	7	MET	MET	NNP
10_1101-2021_01_06_425657	380	8	gene	gene	NN
10_1101-2021_01_06_425657	380	9	transcript	transcript	NN
10_1101-2021_01_06_425657	380	10	levels	level	NNS
10_1101-2021_01_06_425657	380	11	was	be	VBD
10_1101-2021_01_06_425657	380	12	assessed	assess	VBN
10_1101-2021_01_06_425657	380	13	by	by	IN
10_1101-2021_01_06_425657	380	14	qPCR	qpcr	NN
10_1101-2021_01_06_425657	380	15	over	over	IN
10_1101-2021_01_06_425657	380	16	the	the	DT
10_1101-2021_01_06_425657	380	17	time	time	NN
10_1101-2021_01_06_425657	380	18	course	course	NN
10_1101-2021_01_06_425657	380	19	shown	show	VBD
10_1101-2021_01_06_425657	380	20	684	684	CD
10_1101-2021_01_06_425657	380	21	in	in	IN
10_1101-2021_01_06_425657	380	22	(	(	-LRB-
10_1101-2021_01_06_425657	380	23	A	a	NN
10_1101-2021_01_06_425657	380	24	)	)	-RRB-
10_1101-2021_01_06_425657	380	25	.	.	.
10_1101-2021_01_06_425657	381	1	Data	datum	NNS
10_1101-2021_01_06_425657	381	2	are	be	VBP
10_1101-2021_01_06_425657	381	3	presented	present	VBN
10_1101-2021_01_06_425657	381	4	as	as	IN
10_1101-2021_01_06_425657	381	5	mean	mean	JJ
10_1101-2021_01_06_425657	381	6	and	and	CC
10_1101-2021_01_06_425657	381	7	SEM	SEM	NNP
10_1101-2021_01_06_425657	381	8	of	of	IN
10_1101-2021_01_06_425657	381	9	technical	technical	JJ
10_1101-2021_01_06_425657	381	10	triplicates	triplicate	NNS
10_1101-2021_01_06_425657	381	11	.	.	.
10_1101-2021_01_06_425657	382	1	685	685	CD
10_1101-2021_01_06_425657	382	2	(	(	-LRB-
10_1101-2021_01_06_425657	382	3	C	c	NN
10_1101-2021_01_06_425657	382	4	)	)	-RRB-
10_1101-2021_01_06_425657	382	5	Levels	level	NNS
10_1101-2021_01_06_425657	382	6	of	of	IN
10_1101-2021_01_06_425657	382	7	key	key	JJ
10_1101-2021_01_06_425657	382	8	sulfur	sulfur	NN
10_1101-2021_01_06_425657	382	9	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	382	10	were	be	VBD
10_1101-2021_01_06_425657	382	11	measured	measure	VBN
10_1101-2021_01_06_425657	382	12	over	over	IN
10_1101-2021_01_06_425657	382	13	the	the	DT
10_1101-2021_01_06_425657	382	14	same	same	JJ
10_1101-2021_01_06_425657	382	15	time	time	NN
10_1101-2021_01_06_425657	382	16	course	course	NN
10_1101-2021_01_06_425657	382	17	as	as	IN
10_1101-2021_01_06_425657	382	18	in	in	IN
10_1101-2021_01_06_425657	382	19	(	(	-LRB-
10_1101-2021_01_06_425657	382	20	A	a	NN
10_1101-2021_01_06_425657	382	21	)	)	-RRB-
10_1101-2021_01_06_425657	382	22	and	and	CC
10_1101-2021_01_06_425657	382	23	(	(	-LRB-
10_1101-2021_01_06_425657	382	24	B	b	NN
10_1101-2021_01_06_425657	382	25	)	)	-RRB-
10_1101-2021_01_06_425657	382	26	,	,	,
10_1101-2021_01_06_425657	382	27	686	686	CD
10_1101-2021_01_06_425657	382	28	as	as	IN
10_1101-2021_01_06_425657	382	29	determined	determine	VBN
10_1101-2021_01_06_425657	382	30	by	by	IN
10_1101-2021_01_06_425657	382	31	LC	LC	NNP
10_1101-2021_01_06_425657	382	32	-	-	HYPH
10_1101-2021_01_06_425657	382	33	MS	MS	NNP
10_1101-2021_01_06_425657	382	34	/	/	SYM
10_1101-2021_01_06_425657	382	35	MS	MS	NNP
10_1101-2021_01_06_425657	382	36	.	.	.
10_1101-2021_01_06_425657	383	1	Data	datum	NNS
10_1101-2021_01_06_425657	383	2	represent	represent	VBP
10_1101-2021_01_06_425657	383	3	the	the	DT
10_1101-2021_01_06_425657	383	4	mean	mean	NN
10_1101-2021_01_06_425657	383	5	and	and	CC
10_1101-2021_01_06_425657	383	6	SD	sd	NN
10_1101-2021_01_06_425657	383	7	of	of	IN
10_1101-2021_01_06_425657	383	8	two	two	CD
10_1101-2021_01_06_425657	383	9	biological	biological	JJ
10_1101-2021_01_06_425657	383	10	replicates	replicate	NNS
10_1101-2021_01_06_425657	383	11	.	.	.
10_1101-2021_01_06_425657	384	1	687	687	CD
10_1101-2021_01_06_425657	384	2	(	(	-LRB-
10_1101-2021_01_06_425657	384	3	D	D	NNP
10_1101-2021_01_06_425657	384	4	)	)	-RRB-
10_1101-2021_01_06_425657	384	5	met6∆	met6∆	NN
10_1101-2021_01_06_425657	384	6	or	or	CC
10_1101-2021_01_06_425657	384	7	str3∆	str3∆	NNP
10_1101-2021_01_06_425657	384	8	strains	strain	NNS
10_1101-2021_01_06_425657	384	9	were	be	VBD
10_1101-2021_01_06_425657	384	10	grown	grow	VBN
10_1101-2021_01_06_425657	384	11	in	in	IN
10_1101-2021_01_06_425657	384	12	“	"	``
10_1101-2021_01_06_425657	384	13	Rich	rich	JJ
10_1101-2021_01_06_425657	384	14	”	"	''
10_1101-2021_01_06_425657	384	15	YPL	YPL	NNP
10_1101-2021_01_06_425657	384	16	and	and	CC
10_1101-2021_01_06_425657	384	17	switched	switch	VBD
10_1101-2021_01_06_425657	384	18	to	to	IN
10_1101-2021_01_06_425657	384	19	“	"	``
10_1101-2021_01_06_425657	384	20	−sulfur	−sulfur	JJ
10_1101-2021_01_06_425657	384	21	”	"	''
10_1101-2021_01_06_425657	384	22	SFL	sfl	NN
10_1101-2021_01_06_425657	384	23	for	for	IN
10_1101-2021_01_06_425657	384	24	1	1	CD
10_1101-2021_01_06_425657	384	25	h	h	NN
10_1101-2021_01_06_425657	384	26	to	to	IN
10_1101-2021_01_06_425657	384	27	688	688	CD
10_1101-2021_01_06_425657	384	28	induce	induce	VB
10_1101-2021_01_06_425657	384	29	sulfur	sulfur	NN
10_1101-2021_01_06_425657	384	30	starvation	starvation	NN
10_1101-2021_01_06_425657	384	31	before	before	IN
10_1101-2021_01_06_425657	384	32	the	the	DT
10_1101-2021_01_06_425657	384	33	addition	addition	NN
10_1101-2021_01_06_425657	384	34	of	of	IN
10_1101-2021_01_06_425657	384	35	either	either	DT
10_1101-2021_01_06_425657	384	36	0.5	0.5	CD
10_1101-2021_01_06_425657	384	37	mM	mm	NN
10_1101-2021_01_06_425657	384	38	homocysteine	homocysteine	NN
10_1101-2021_01_06_425657	384	39	(	(	-LRB-
10_1101-2021_01_06_425657	384	40	+	+	CC
10_1101-2021_01_06_425657	384	41	HCY	HCY	NNP
10_1101-2021_01_06_425657	384	42	)	)	-RRB-
10_1101-2021_01_06_425657	384	43	,	,	,
10_1101-2021_01_06_425657	384	44	0.5	0.5	CD
10_1101-2021_01_06_425657	384	45	mM	mM	NNP
10_1101-2021_01_06_425657	384	46	689	689	CD
10_1101-2021_01_06_425657	384	47	methionine	methionine	NN
10_1101-2021_01_06_425657	384	48	(	(	-LRB-
10_1101-2021_01_06_425657	384	49	+	+	CC
10_1101-2021_01_06_425657	384	50	MET	MET	NNP
10_1101-2021_01_06_425657	384	51	)	)	-RRB-
10_1101-2021_01_06_425657	384	52	,	,	,
10_1101-2021_01_06_425657	384	53	or	or	CC
10_1101-2021_01_06_425657	384	54	0.5	0.5	CD
10_1101-2021_01_06_425657	384	55	mM	mm	NN
10_1101-2021_01_06_425657	384	56	cysteine	cysteine	NN
10_1101-2021_01_06_425657	384	57	(	(	-LRB-
10_1101-2021_01_06_425657	384	58	+	+	SYM
10_1101-2021_01_06_425657	384	59	CYS	CYS	NNP
10_1101-2021_01_06_425657	384	60	)	)	-RRB-
10_1101-2021_01_06_425657	384	61	.	.	.
10_1101-2021_01_06_425657	385	1	690	690	CD
10_1101-2021_01_06_425657	385	2	(	(	-LRB-
10_1101-2021_01_06_425657	385	3	E	e	NN
10_1101-2021_01_06_425657	385	4	)	)	-RRB-
10_1101-2021_01_06_425657	385	5	Simplified	simplify	VBN
10_1101-2021_01_06_425657	385	6	diagram	diagram	NN
10_1101-2021_01_06_425657	385	7	of	of	IN
10_1101-2021_01_06_425657	385	8	the	the	DT
10_1101-2021_01_06_425657	385	9	sulfur	sulfur	NN
10_1101-2021_01_06_425657	385	10	metabolic	metabolic	JJ
10_1101-2021_01_06_425657	385	11	pathway	pathway	NN
10_1101-2021_01_06_425657	385	12	in	in	IN
10_1101-2021_01_06_425657	385	13	yeast	yeast	NN
10_1101-2021_01_06_425657	385	14	.	.	.
10_1101-2021_01_06_425657	386	1	691	691	CD
10_1101-2021_01_06_425657	386	2	692	692	CD
10_1101-2021_01_06_425657	386	3	Figure	figure	NN
10_1101-2021_01_06_425657	386	4	2	2	CD
10_1101-2021_01_06_425657	386	5	.	.	.
10_1101-2021_01_06_425657	387	1	Met30	Met30	NNP
10_1101-2021_01_06_425657	387	2	cysteine	cysteine	NN
10_1101-2021_01_06_425657	387	3	residues	residue	NNS
10_1101-2021_01_06_425657	387	4	become	become	VBP
10_1101-2021_01_06_425657	387	5	oxidized	oxidize	VBN
10_1101-2021_01_06_425657	387	6	during	during	IN
10_1101-2021_01_06_425657	387	7	sulfur	sulfur	NN
10_1101-2021_01_06_425657	387	8	starvation	starvation	NN
10_1101-2021_01_06_425657	387	9	.	.	.
10_1101-2021_01_06_425657	388	1	693	693	CD
10_1101-2021_01_06_425657	388	2	(	(	-LRB-
10_1101-2021_01_06_425657	388	3	A	a	NN
10_1101-2021_01_06_425657	388	4	)	)	-RRB-
10_1101-2021_01_06_425657	388	5	Schematic	schematic	JJ
10_1101-2021_01_06_425657	388	6	of	of	IN
10_1101-2021_01_06_425657	388	7	Met30	Met30	NNP
10_1101-2021_01_06_425657	388	8	protein	protein	NN
10_1101-2021_01_06_425657	388	9	architecture	architecture	NN
10_1101-2021_01_06_425657	388	10	and	and	CC
10_1101-2021_01_06_425657	388	11	cysteine	cysteine	JJ
10_1101-2021_01_06_425657	388	12	residue	residue	NN
10_1101-2021_01_06_425657	388	13	location	location	NN
10_1101-2021_01_06_425657	388	14	.	.	.
10_1101-2021_01_06_425657	389	1	694	694	CD
10_1101-2021_01_06_425657	389	2	(	(	-LRB-
10_1101-2021_01_06_425657	389	3	B	b	NN
10_1101-2021_01_06_425657	389	4	)	)	-RRB-
10_1101-2021_01_06_425657	389	5	Western	western	JJ
10_1101-2021_01_06_425657	389	6	blot	blot	NN
10_1101-2021_01_06_425657	389	7	analysis	analysis	NN
10_1101-2021_01_06_425657	389	8	of	of	IN
10_1101-2021_01_06_425657	389	9	Met30	Met30	NNP
10_1101-2021_01_06_425657	389	10	cysteine	cysteine	NN
10_1101-2021_01_06_425657	389	11	redox	redox	JJ
10_1101-2021_01_06_425657	389	12	state	state	NN
10_1101-2021_01_06_425657	389	13	in	in	IN
10_1101-2021_01_06_425657	389	14	lactate	lactate	JJ
10_1101-2021_01_06_425657	389	15	media	medium	NNS
10_1101-2021_01_06_425657	389	16	as	as	IN
10_1101-2021_01_06_425657	389	17	determined	determine	VBN
10_1101-2021_01_06_425657	389	18	by	by	IN
10_1101-2021_01_06_425657	389	19	695	695	CD
10_1101-2021_01_06_425657	389	20	methoxy	methoxy	JJ
10_1101-2021_01_06_425657	389	21	-	-	HYPH
10_1101-2021_01_06_425657	389	22	PEG	peg	NN
10_1101-2021_01_06_425657	389	23	-	-	HYPH
10_1101-2021_01_06_425657	389	24	maleimide	maleimide	NN
10_1101-2021_01_06_425657	389	25	(	(	-LRB-
10_1101-2021_01_06_425657	389	26	mPEG2K	mPEG2K	NNP
10_1101-2021_01_06_425657	389	27	-	-	HYPH
10_1101-2021_01_06_425657	389	28	mal	mal	NNP
10_1101-2021_01_06_425657	389	29	)	)	-RRB-
10_1101-2021_01_06_425657	389	30	modification	modification	NN
10_1101-2021_01_06_425657	389	31	of	of	IN
10_1101-2021_01_06_425657	389	32	reduced	reduce	VBN
10_1101-2021_01_06_425657	389	33	protein	protein	NN
10_1101-2021_01_06_425657	389	34	thiols	thiol	NNS
10_1101-2021_01_06_425657	389	35	.	.	.
10_1101-2021_01_06_425657	390	1	For	for	IN
10_1101-2021_01_06_425657	390	2	every	every	DT
10_1101-2021_01_06_425657	390	3	696	696	CD
10_1101-2021_01_06_425657	390	4	reduced	reduce	VBN
10_1101-2021_01_06_425657	390	5	cysteine	cysteine	NN
10_1101-2021_01_06_425657	390	6	thiol	thiol	NN
10_1101-2021_01_06_425657	390	7	in	in	IN
10_1101-2021_01_06_425657	390	8	a	a	DT
10_1101-2021_01_06_425657	390	9	protein	protein	NN
10_1101-2021_01_06_425657	390	10	,	,	,
10_1101-2021_01_06_425657	390	11	mPEG2K	mPEG2K	NNP
10_1101-2021_01_06_425657	390	12	-	-	HYPH
10_1101-2021_01_06_425657	390	13	mal	mal	NNP
10_1101-2021_01_06_425657	390	14	adds	add	VBZ
10_1101-2021_01_06_425657	390	15	~	~	NFP
10_1101-2021_01_06_425657	390	16	2	2	CD
10_1101-2021_01_06_425657	390	17	kDa	kDa	NNS
10_1101-2021_01_06_425657	390	18	in	in	IN
10_1101-2021_01_06_425657	390	19	apparent	apparent	JJ
10_1101-2021_01_06_425657	390	20	molecular	molecular	JJ
10_1101-2021_01_06_425657	390	21	weight	weight	NN
10_1101-2021_01_06_425657	390	22	.	.	.
10_1101-2021_01_06_425657	391	1	697	697	CD
10_1101-2021_01_06_425657	391	2	(	(	-LRB-
10_1101-2021_01_06_425657	391	3	C	C	NNP
10_1101-2021_01_06_425657	391	4	)	)	-RRB-
10_1101-2021_01_06_425657	391	5	Same	same	JJ
10_1101-2021_01_06_425657	391	6	Western	western	JJ
10_1101-2021_01_06_425657	391	7	blot	blot	NN
10_1101-2021_01_06_425657	391	8	analysis	analysis	NN
10_1101-2021_01_06_425657	391	9	as	as	IN
10_1101-2021_01_06_425657	391	10	in	in	IN
10_1101-2021_01_06_425657	391	11	(	(	-LRB-
10_1101-2021_01_06_425657	391	12	B	b	NN
10_1101-2021_01_06_425657	391	13	)	)	-RRB-
10_1101-2021_01_06_425657	391	14	,	,	,
10_1101-2021_01_06_425657	391	15	except	except	IN
10_1101-2021_01_06_425657	391	16	that	that	DT
10_1101-2021_01_06_425657	391	17	yeast	yeast	NN
10_1101-2021_01_06_425657	391	18	were	be	VBD
10_1101-2021_01_06_425657	391	19	cultured	culture	VBN
10_1101-2021_01_06_425657	391	20	in	in	IN
10_1101-2021_01_06_425657	391	21	sulfur	sulfur	NN
10_1101-2021_01_06_425657	391	22	-	-	HYPH
10_1101-2021_01_06_425657	391	23	free	free	JJ
10_1101-2021_01_06_425657	391	24	glucose	glucose	NN
10_1101-2021_01_06_425657	391	25	698	698	CD
10_1101-2021_01_06_425657	391	26	media	medium	NNS
10_1101-2021_01_06_425657	391	27	(	(	-LRB-
10_1101-2021_01_06_425657	391	28	SFD	SFD	NNP
10_1101-2021_01_06_425657	391	29	)	)	-RRB-
10_1101-2021_01_06_425657	391	30	for	for	IN
10_1101-2021_01_06_425657	391	31	3	3	CD
10_1101-2021_01_06_425657	391	32	h	h	NN
10_1101-2021_01_06_425657	391	33	before	before	IN
10_1101-2021_01_06_425657	391	34	the	the	DT
10_1101-2021_01_06_425657	391	35	addition	addition	NN
10_1101-2021_01_06_425657	391	36	of	of	IN
10_1101-2021_01_06_425657	391	37	0.5	0.5	CD
10_1101-2021_01_06_425657	391	38	mM	mm	NN
10_1101-2021_01_06_425657	391	39	each	each	DT
10_1101-2021_01_06_425657	391	40	of	of	IN
10_1101-2021_01_06_425657	391	41	the	the	DT
10_1101-2021_01_06_425657	391	42	sulfur	sulfur	NN
10_1101-2021_01_06_425657	391	43	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	391	44	homocysteine	homocysteine	JJ
10_1101-2021_01_06_425657	391	45	,	,	,
10_1101-2021_01_06_425657	391	46	699	699	CD
10_1101-2021_01_06_425657	391	47	methionine	methionine	NN
10_1101-2021_01_06_425657	391	48	,	,	,
10_1101-2021_01_06_425657	391	49	and	and	CC
10_1101-2021_01_06_425657	391	50	cysteine	cysteine	NN
10_1101-2021_01_06_425657	391	51	(	(	-LRB-
10_1101-2021_01_06_425657	391	52	+	+	CC
10_1101-2021_01_06_425657	391	53	Met	Met	NNP
10_1101-2021_01_06_425657	391	54	/	/	SYM
10_1101-2021_01_06_425657	391	55	Cys	Cys	NNP
10_1101-2021_01_06_425657	391	56	/	/	SYM
10_1101-2021_01_06_425657	391	57	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	391	58	)	)	-RRB-
10_1101-2021_01_06_425657	391	59	.	.	.
10_1101-2021_01_06_425657	392	1	700	700	CD
10_1101-2021_01_06_425657	392	2	(	(	-LRB-
10_1101-2021_01_06_425657	392	3	D	d	NN
10_1101-2021_01_06_425657	392	4	)	)	-RRB-
10_1101-2021_01_06_425657	392	5	Yeast	yeast	NN
10_1101-2021_01_06_425657	392	6	were	be	VBD
10_1101-2021_01_06_425657	392	7	subjected	subject	VBN
10_1101-2021_01_06_425657	392	8	to	to	IN
10_1101-2021_01_06_425657	392	9	the	the	DT
10_1101-2021_01_06_425657	392	10	same	same	JJ
10_1101-2021_01_06_425657	392	11	rich	rich	JJ
10_1101-2021_01_06_425657	392	12	to	to	IN
10_1101-2021_01_06_425657	392	13	−sulfur	−sulfur	CD
10_1101-2021_01_06_425657	392	14	media	medium	NNS
10_1101-2021_01_06_425657	392	15	switch	switch	VB
10_1101-2021_01_06_425657	392	16	as	as	IN
10_1101-2021_01_06_425657	392	17	in	in	IN
10_1101-2021_01_06_425657	392	18	(	(	-LRB-
10_1101-2021_01_06_425657	392	19	B	b	NN
10_1101-2021_01_06_425657	392	20	)	)	-RRB-
10_1101-2021_01_06_425657	392	21	,	,	,
10_1101-2021_01_06_425657	392	22	except	except	IN
10_1101-2021_01_06_425657	392	23	that	that	IN
10_1101-2021_01_06_425657	392	24	following	follow	VBG
10_1101-2021_01_06_425657	392	25	701	701	CD
10_1101-2021_01_06_425657	392	26	the	the	DT
10_1101-2021_01_06_425657	392	27	15	15	CD
10_1101-2021_01_06_425657	392	28	min	min	NN
10_1101-2021_01_06_425657	392	29	time	time	NN
10_1101-2021_01_06_425657	392	30	point	point	NN
10_1101-2021_01_06_425657	392	31	,	,	,
10_1101-2021_01_06_425657	392	32	5	5	CD
10_1101-2021_01_06_425657	392	33	mM	mM	NNP
10_1101-2021_01_06_425657	392	34	DTT	DTT	NNP
10_1101-2021_01_06_425657	392	35	was	be	VBD
10_1101-2021_01_06_425657	392	36	added	add	VBN
10_1101-2021_01_06_425657	392	37	to	to	IN
10_1101-2021_01_06_425657	392	38	the	the	DT
10_1101-2021_01_06_425657	392	39	culture	culture	NN
10_1101-2021_01_06_425657	392	40	for	for	IN
10_1101-2021_01_06_425657	392	41	15	15	CD
10_1101-2021_01_06_425657	392	42	min	min	NN
10_1101-2021_01_06_425657	392	43	and	and	CC
10_1101-2021_01_06_425657	392	44	Met30	Met30	NNP
10_1101-2021_01_06_425657	392	45	cysteine	cysteine	NN
10_1101-2021_01_06_425657	392	46	residue	residue	VBP
10_1101-2021_01_06_425657	392	47	702	702	CD
10_1101-2021_01_06_425657	392	48	redox	redox	NN
10_1101-2021_01_06_425657	392	49	state	state	NN
10_1101-2021_01_06_425657	392	50	and	and	CC
10_1101-2021_01_06_425657	392	51	Met4	Met4	NNP
10_1101-2021_01_06_425657	392	52	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	392	53	were	be	VBD
10_1101-2021_01_06_425657	392	54	assessed	assess	VBN
10_1101-2021_01_06_425657	392	55	by	by	IN
10_1101-2021_01_06_425657	392	56	Western	western	JJ
10_1101-2021_01_06_425657	392	57	blot	blot	NN
10_1101-2021_01_06_425657	392	58	.	.	.
10_1101-2021_01_06_425657	393	1	703	703	CD
10_1101-2021_01_06_425657	393	2	704	704	CD
10_1101-2021_01_06_425657	393	3	Figure	figure	NN
10_1101-2021_01_06_425657	393	4	3	3	CD
10_1101-2021_01_06_425657	393	5	.	.	.
10_1101-2021_01_06_425657	394	1	Met30	Met30	NNP
10_1101-2021_01_06_425657	394	2	cysteine	cysteine	NN
10_1101-2021_01_06_425657	394	3	point	point	NN
10_1101-2021_01_06_425657	394	4	mutants	mutant	NNS
10_1101-2021_01_06_425657	394	5	display	display	VBP
10_1101-2021_01_06_425657	394	6	dysregulated	dysregulate	VBD
10_1101-2021_01_06_425657	394	7	sulfur	sulfur	NN
10_1101-2021_01_06_425657	394	8	sensing	sensing	NN
10_1101-2021_01_06_425657	394	9	.	.	.
10_1101-2021_01_06_425657	395	1	705	705	CD
10_1101-2021_01_06_425657	395	2	(	(	-LRB-
10_1101-2021_01_06_425657	395	3	A	a	NN
10_1101-2021_01_06_425657	395	4	)	)	-RRB-
10_1101-2021_01_06_425657	395	5	Western	western	JJ
10_1101-2021_01_06_425657	395	6	blot	blot	NN
10_1101-2021_01_06_425657	395	7	analysis	analysis	NN
10_1101-2021_01_06_425657	395	8	of	of	IN
10_1101-2021_01_06_425657	395	9	Met30	Met30	NNP
10_1101-2021_01_06_425657	395	10	cysteine	cysteine	NN
10_1101-2021_01_06_425657	395	11	redox	redox	NN
10_1101-2021_01_06_425657	395	12	state	state	NN
10_1101-2021_01_06_425657	395	13	and	and	CC
10_1101-2021_01_06_425657	395	14	Met4	met4	JJ
10_1101-2021_01_06_425657	395	15	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	395	16	status	status	NN
10_1101-2021_01_06_425657	395	17	in	in	IN
10_1101-2021_01_06_425657	395	18	WT	WT	NNP
10_1101-2021_01_06_425657	395	19	and	and	CC
10_1101-2021_01_06_425657	395	20	706	706	CD
10_1101-2021_01_06_425657	395	21	two	two	CD
10_1101-2021_01_06_425657	395	22	cysteine	cysteine	NN
10_1101-2021_01_06_425657	395	23	to	to	IN
10_1101-2021_01_06_425657	395	24	serine	serine	JJ
10_1101-2021_01_06_425657	395	25	mutants	mutant	NNS
10_1101-2021_01_06_425657	395	26	,	,	,
10_1101-2021_01_06_425657	395	27	C414S	C414S	NNP
10_1101-2021_01_06_425657	395	28	and	and	CC
10_1101-2021_01_06_425657	395	29	C614/616/622/630S.	C614/616/622/630S.	NNP
10_1101-2021_01_06_425657	396	1	707	707	CD
10_1101-2021_01_06_425657	396	2	(	(	-LRB-
10_1101-2021_01_06_425657	396	3	B	b	NN
10_1101-2021_01_06_425657	396	4	)	)	-RRB-
10_1101-2021_01_06_425657	396	5	MET	MET	NNP
10_1101-2021_01_06_425657	396	6	gene	gene	NN
10_1101-2021_01_06_425657	396	7	transcript	transcript	NN
10_1101-2021_01_06_425657	396	8	levels	level	NNS
10_1101-2021_01_06_425657	396	9	over	over	IN
10_1101-2021_01_06_425657	396	10	the	the	DT
10_1101-2021_01_06_425657	396	11	same	same	JJ
10_1101-2021_01_06_425657	396	12	time	time	NN
10_1101-2021_01_06_425657	396	13	course	course	NN
10_1101-2021_01_06_425657	396	14	as	as	IN
10_1101-2021_01_06_425657	396	15	(	(	-LRB-
10_1101-2021_01_06_425657	396	16	A	a	NN
10_1101-2021_01_06_425657	396	17	)	)	-RRB-
10_1101-2021_01_06_425657	396	18	for	for	IN
10_1101-2021_01_06_425657	396	19	the	the	DT
10_1101-2021_01_06_425657	396	20	three	three	CD
10_1101-2021_01_06_425657	396	21	strains	strain	NNS
10_1101-2021_01_06_425657	396	22	,	,	,
10_1101-2021_01_06_425657	396	23	as	as	IN
10_1101-2021_01_06_425657	396	24	assessed	assess	VBN
10_1101-2021_01_06_425657	396	25	708	708	CD
10_1101-2021_01_06_425657	396	26	by	by	IN
10_1101-2021_01_06_425657	396	27	qPCR	qpcr	NN
10_1101-2021_01_06_425657	396	28	.	.	.
10_1101-2021_01_06_425657	397	1	Data	datum	NNS
10_1101-2021_01_06_425657	397	2	are	be	VBP
10_1101-2021_01_06_425657	397	3	presented	present	VBN
10_1101-2021_01_06_425657	397	4	as	as	IN
10_1101-2021_01_06_425657	397	5	mean	mean	JJ
10_1101-2021_01_06_425657	397	6	and	and	CC
10_1101-2021_01_06_425657	397	7	SEM	SEM	NNP
10_1101-2021_01_06_425657	397	8	of	of	IN
10_1101-2021_01_06_425657	397	9	technical	technical	JJ
10_1101-2021_01_06_425657	397	10	triplicates	triplicate	NNS
10_1101-2021_01_06_425657	397	11	.	.	.
10_1101-2021_01_06_425657	398	1	709	709	LS
10_1101-2021_01_06_425657	398	2	(	(	-LRB-
10_1101-2021_01_06_425657	398	3	C	C	NNP
10_1101-2021_01_06_425657	398	4	)	)	-RRB-
10_1101-2021_01_06_425657	398	5	Growth	growth	NN
10_1101-2021_01_06_425657	398	6	curves	curve	NNS
10_1101-2021_01_06_425657	398	7	of	of	IN
10_1101-2021_01_06_425657	398	8	the	the	DT
10_1101-2021_01_06_425657	398	9	three	three	CD
10_1101-2021_01_06_425657	398	10	yeast	yeast	NN
10_1101-2021_01_06_425657	398	11	strains	strain	NNS
10_1101-2021_01_06_425657	398	12	used	use	VBN
10_1101-2021_01_06_425657	398	13	in	in	IN
10_1101-2021_01_06_425657	398	14	(	(	-LRB-
10_1101-2021_01_06_425657	398	15	A	a	NN
10_1101-2021_01_06_425657	398	16	)	)	-RRB-
10_1101-2021_01_06_425657	398	17	and	and	CC
10_1101-2021_01_06_425657	398	18	(	(	-LRB-
10_1101-2021_01_06_425657	398	19	B	b	NN
10_1101-2021_01_06_425657	398	20	)	)	-RRB-
10_1101-2021_01_06_425657	398	21	in	in	IN
10_1101-2021_01_06_425657	398	22	sulfur	sulfur	NN
10_1101-2021_01_06_425657	398	23	-	-	HYPH
10_1101-2021_01_06_425657	398	24	rich	rich	JJ
10_1101-2021_01_06_425657	398	25	YPL	YPL	NNP
10_1101-2021_01_06_425657	398	26	media	medium	NNS
10_1101-2021_01_06_425657	398	27	or	or	CC
10_1101-2021_01_06_425657	398	28	−sulfur	−sulfur	CD
10_1101-2021_01_06_425657	398	29	710	710	CD
10_1101-2021_01_06_425657	398	30	SFL	SFL	NNP
10_1101-2021_01_06_425657	398	31	media	medium	NNS
10_1101-2021_01_06_425657	398	32	supplemented	supplement	VBN
10_1101-2021_01_06_425657	398	33	with	with	IN
10_1101-2021_01_06_425657	398	34	0.2	0.2	CD
10_1101-2021_01_06_425657	398	35	mM	mm	NN
10_1101-2021_01_06_425657	398	36	homocysteine	homocysteine	NN
10_1101-2021_01_06_425657	398	37	.	.	.
10_1101-2021_01_06_425657	399	1	Cells	cell	NNS
10_1101-2021_01_06_425657	399	2	were	be	VBD
10_1101-2021_01_06_425657	399	3	grown	grow	VBN
10_1101-2021_01_06_425657	399	4	to	to	IN
10_1101-2021_01_06_425657	399	5	mid	mid	JJ
10_1101-2021_01_06_425657	399	6	-	-	JJ
10_1101-2021_01_06_425657	399	7	log	log	JJ
10_1101-2021_01_06_425657	399	8	phase	phase	NN
10_1101-2021_01_06_425657	399	9	in	in	IN
10_1101-2021_01_06_425657	399	10	YPL	YPL	NNP
10_1101-2021_01_06_425657	399	11	711	711	CD
10_1101-2021_01_06_425657	399	12	media	medium	NNS
10_1101-2021_01_06_425657	399	13	before	before	IN
10_1101-2021_01_06_425657	399	14	pelleting	pellete	VBG
10_1101-2021_01_06_425657	399	15	,	,	,
10_1101-2021_01_06_425657	399	16	washing	wash	VBG
10_1101-2021_01_06_425657	399	17	with	with	IN
10_1101-2021_01_06_425657	399	18	water	water	NN
10_1101-2021_01_06_425657	399	19	,	,	,
10_1101-2021_01_06_425657	399	20	and	and	CC
10_1101-2021_01_06_425657	399	21	back	back	JJ
10_1101-2021_01_06_425657	399	22	-	-	HYPH
10_1101-2021_01_06_425657	399	23	diluting	diluting	NN
10_1101-2021_01_06_425657	399	24	yeast	yeast	NN
10_1101-2021_01_06_425657	399	25	into	into	IN
10_1101-2021_01_06_425657	399	26	the	the	DT
10_1101-2021_01_06_425657	399	27	two	two	CD
10_1101-2021_01_06_425657	399	28	media	medium	NNS
10_1101-2021_01_06_425657	399	29	conditions	condition	NNS
10_1101-2021_01_06_425657	399	30	.	.	.
10_1101-2021_01_06_425657	400	1	712	712	CD
10_1101-2021_01_06_425657	400	2	Data	datum	NNS
10_1101-2021_01_06_425657	400	3	represent	represent	VBP
10_1101-2021_01_06_425657	400	4	mean	mean	NN
10_1101-2021_01_06_425657	400	5	and	and	CC
10_1101-2021_01_06_425657	400	6	SD	sd	NN
10_1101-2021_01_06_425657	400	7	of	of	IN
10_1101-2021_01_06_425657	400	8	technical	technical	JJ
10_1101-2021_01_06_425657	400	9	triplicates	triplicate	NNS
10_1101-2021_01_06_425657	400	10	.	.	.
10_1101-2021_01_06_425657	401	1	713	713	CD
10_1101-2021_01_06_425657	401	2	714	714	CD
10_1101-2021_01_06_425657	401	3	.CC	.cc	NN
10_1101-2021_01_06_425657	401	4	-	-	:
10_1101-2021_01_06_425657	401	5	BY	by	IN
10_1101-2021_01_06_425657	401	6	4.0	4.0	CD
10_1101-2021_01_06_425657	401	7	International	International	NNP
10_1101-2021_01_06_425657	401	8	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	401	9	under	under	IN
10_1101-2021_01_06_425657	401	10	a	a	DT
10_1101-2021_01_06_425657	401	11	(	(	-LRB-
10_1101-2021_01_06_425657	401	12	which	which	WDT
10_1101-2021_01_06_425657	401	13	was	be	VBD
10_1101-2021_01_06_425657	401	14	not	not	RB
10_1101-2021_01_06_425657	401	15	certified	certify	VBN
10_1101-2021_01_06_425657	401	16	by	by	IN
10_1101-2021_01_06_425657	401	17	peer	peer	NN
10_1101-2021_01_06_425657	401	18	review	review	NN
10_1101-2021_01_06_425657	401	19	)	)	-RRB-
10_1101-2021_01_06_425657	401	20	is	be	VBZ
10_1101-2021_01_06_425657	401	21	the	the	DT
10_1101-2021_01_06_425657	401	22	author	author	NN
10_1101-2021_01_06_425657	401	23	/	/	SYM
10_1101-2021_01_06_425657	401	24	funder	funder	NN
10_1101-2021_01_06_425657	401	25	,	,	,
10_1101-2021_01_06_425657	401	26	who	who	WP
10_1101-2021_01_06_425657	401	27	has	have	VBZ
10_1101-2021_01_06_425657	401	28	granted	grant	VBN
10_1101-2021_01_06_425657	401	29	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	401	30	a	a	DT
10_1101-2021_01_06_425657	401	31	license	license	NN
10_1101-2021_01_06_425657	401	32	to	to	TO
10_1101-2021_01_06_425657	401	33	display	display	VB
10_1101-2021_01_06_425657	401	34	the	the	DT
10_1101-2021_01_06_425657	401	35	preprint	preprint	NN
10_1101-2021_01_06_425657	401	36	in	in	IN
10_1101-2021_01_06_425657	401	37	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	401	38	.	.	.
10_1101-2021_01_06_425657	402	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	402	2	is	be	VBZ
10_1101-2021_01_06_425657	402	3	made	make	VBN
10_1101-2021_01_06_425657	402	4	The	the	DT
10_1101-2021_01_06_425657	402	5	copyright	copyright	NN
10_1101-2021_01_06_425657	402	6	holder	holder	NN
10_1101-2021_01_06_425657	402	7	for	for	IN
10_1101-2021_01_06_425657	402	8	this	this	DT
10_1101-2021_01_06_425657	402	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	402	10	version	version	NN
10_1101-2021_01_06_425657	402	11	posted	post	VBD
10_1101-2021_01_06_425657	402	12	January	January	NNP
10_1101-2021_01_06_425657	402	13	7	7	CD
10_1101-2021_01_06_425657	402	14	,	,	,
10_1101-2021_01_06_425657	402	15	2021	2021	CD
10_1101-2021_01_06_425657	402	16	.	.	.
10_1101-2021_01_06_425657	402	17	;	;	:
10_1101-2021_01_06_425657	402	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	402	19	:	:	:
10_1101-2021_01_06_425657	402	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	402	21	preprint	preprint	NN
10_1101-2021_01_06_425657	402	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	402	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	402	24	21	21	CD
10_1101-2021_01_06_425657	402	25	Figure	figure	NN
10_1101-2021_01_06_425657	402	26	4	4	CD
10_1101-2021_01_06_425657	402	27	.	.	.
10_1101-2021_01_06_425657	403	1	Met30	met30	JJ
10_1101-2021_01_06_425657	403	2	cysteine	cysteine	JJ
10_1101-2021_01_06_425657	403	3	oxidation	oxidation	NN
10_1101-2021_01_06_425657	403	4	disrupts	disrupt	NNS
10_1101-2021_01_06_425657	403	5	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	403	6	and	and	CC
10_1101-2021_01_06_425657	403	7	reduces	reduce	NNS
10_1101-2021_01_06_425657	403	8	binding	bind	VBG
10_1101-2021_01_06_425657	403	9	to	to	IN
10_1101-2021_01_06_425657	403	10	Met4	Met4	NNP
10_1101-2021_01_06_425657	403	11	in	in	IN
10_1101-2021_01_06_425657	403	12	715	715	CD
10_1101-2021_01_06_425657	403	13	vitro	vitro	NNS
10_1101-2021_01_06_425657	403	14	.	.	.
10_1101-2021_01_06_425657	404	1	716	716	CD
10_1101-2021_01_06_425657	404	2	(	(	-LRB-
10_1101-2021_01_06_425657	404	3	A	a	NN
10_1101-2021_01_06_425657	404	4	)	)	-RRB-
10_1101-2021_01_06_425657	404	5	Schematic	schematic	JJ
10_1101-2021_01_06_425657	404	6	for	for	IN
10_1101-2021_01_06_425657	404	7	the	the	DT
10_1101-2021_01_06_425657	404	8	large	large	JJ
10_1101-2021_01_06_425657	404	9	-	-	HYPH
10_1101-2021_01_06_425657	404	10	scale	scale	NN
10_1101-2021_01_06_425657	404	11	SCFMet30-Flag	scfmet30-flag	NN
10_1101-2021_01_06_425657	404	12	immunopurification	immunopurification	NN
10_1101-2021_01_06_425657	404	13	from	from	IN
10_1101-2021_01_06_425657	404	14	rich	rich	JJ
10_1101-2021_01_06_425657	404	15	high	high	JJ
10_1101-2021_01_06_425657	404	16	sulfur	sulfur	NN
10_1101-2021_01_06_425657	404	17	(	(	-LRB-
10_1101-2021_01_06_425657	404	18	YPL	YPL	NNP
10_1101-2021_01_06_425657	404	19	)	)	-RRB-
10_1101-2021_01_06_425657	404	20	717	717	CD
10_1101-2021_01_06_425657	404	21	and	and	CC
10_1101-2021_01_06_425657	404	22	−sulfur	−sulfur	JJ
10_1101-2021_01_06_425657	404	23	(	(	-LRB-
10_1101-2021_01_06_425657	404	24	SFL	SFL	NNP
10_1101-2021_01_06_425657	404	25	)	)	-RRB-
10_1101-2021_01_06_425657	404	26	conditions	condition	NNS
10_1101-2021_01_06_425657	404	27	for	for	IN
10_1101-2021_01_06_425657	404	28	use	use	NN
10_1101-2021_01_06_425657	404	29	in	in	RB
10_1101-2021_01_06_425657	404	30	in	in	FW
10_1101-2021_01_06_425657	404	31	vitro	vitro	FW
10_1101-2021_01_06_425657	404	32	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	404	33	or	or	CC
10_1101-2021_01_06_425657	404	34	binding	bind	VBG
10_1101-2021_01_06_425657	404	35	assays	assay	NNS
10_1101-2021_01_06_425657	404	36	with	with	IN
10_1101-2021_01_06_425657	404	37	recombinant	recombinant	JJ
10_1101-2021_01_06_425657	404	38	718	718	CD
10_1101-2021_01_06_425657	404	39	Met4	met4	JJ
10_1101-2021_01_06_425657	404	40	protein	protein	NN
10_1101-2021_01_06_425657	404	41	.	.	.
10_1101-2021_01_06_425657	405	1	719	719	CD
10_1101-2021_01_06_425657	405	2	(	(	-LRB-
10_1101-2021_01_06_425657	405	3	B	b	NN
10_1101-2021_01_06_425657	405	4	)	)	-RRB-
10_1101-2021_01_06_425657	405	5	Western	western	JJ
10_1101-2021_01_06_425657	405	6	blot	blot	NN
10_1101-2021_01_06_425657	405	7	analysis	analysis	NN
10_1101-2021_01_06_425657	405	8	of	of	IN
10_1101-2021_01_06_425657	405	9	Met4	Met4	NNP
10_1101-2021_01_06_425657	405	10	in	in	FW
10_1101-2021_01_06_425657	405	11	vitro	vitro	FW
10_1101-2021_01_06_425657	405	12	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	405	13	by	by	IN
10_1101-2021_01_06_425657	405	14	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	405	15	immunopurifications	immunopurification	NNS
10_1101-2021_01_06_425657	405	16	720	720	CD
10_1101-2021_01_06_425657	405	17	from	from	IN
10_1101-2021_01_06_425657	405	18	cells	cell	NNS
10_1101-2021_01_06_425657	405	19	cultured	culture	VBN
10_1101-2021_01_06_425657	405	20	in	in	IN
10_1101-2021_01_06_425657	405	21	sulfur	sulfur	NN
10_1101-2021_01_06_425657	405	22	-	-	HYPH
10_1101-2021_01_06_425657	405	23	replete	replete	JJ
10_1101-2021_01_06_425657	405	24	rich	rich	JJ
10_1101-2021_01_06_425657	405	25	media	medium	NNS
10_1101-2021_01_06_425657	405	26	.	.	.
10_1101-2021_01_06_425657	406	1	Cryomilled	cryomille	VBN
10_1101-2021_01_06_425657	406	2	YPL	YPL	NNP
10_1101-2021_01_06_425657	406	3	yeast	yeast	NN
10_1101-2021_01_06_425657	406	4	powder	powder	NN
10_1101-2021_01_06_425657	406	5	was	be	VBD
10_1101-2021_01_06_425657	406	6	divided	divide	VBN
10_1101-2021_01_06_425657	406	7	evenly	evenly	RB
10_1101-2021_01_06_425657	406	8	721	721	CD
10_1101-2021_01_06_425657	406	9	for	for	IN
10_1101-2021_01_06_425657	406	10	two	two	CD
10_1101-2021_01_06_425657	406	11	Flag	Flag	NNP
10_1101-2021_01_06_425657	406	12	IPs	ip	NNS
10_1101-2021_01_06_425657	406	13	performed	perform	VBD
10_1101-2021_01_06_425657	406	14	identically	identically	RB
10_1101-2021_01_06_425657	406	15	with	with	IN
10_1101-2021_01_06_425657	406	16	the	the	DT
10_1101-2021_01_06_425657	406	17	exception	exception	NN
10_1101-2021_01_06_425657	406	18	that	that	WDT
10_1101-2021_01_06_425657	406	19	one	one	CD
10_1101-2021_01_06_425657	406	20	was	be	VBD
10_1101-2021_01_06_425657	406	21	done	do	VBN
10_1101-2021_01_06_425657	406	22	in	in	IN
10_1101-2021_01_06_425657	406	23	the	the	DT
10_1101-2021_01_06_425657	406	24	presence	presence	NN
10_1101-2021_01_06_425657	406	25	of	of	IN
10_1101-2021_01_06_425657	406	26	1	1	CD
10_1101-2021_01_06_425657	406	27	722	722	CD
10_1101-2021_01_06_425657	406	28	mM	mM	NNP
10_1101-2021_01_06_425657	406	29	DTT	DTT	NNP
10_1101-2021_01_06_425657	406	30	(	(	-LRB-
10_1101-2021_01_06_425657	406	31	+	+	SYM
10_1101-2021_01_06_425657	406	32	DTT	DTT	NNP
10_1101-2021_01_06_425657	406	33	)	)	-RRB-
10_1101-2021_01_06_425657	406	34	and	and	CC
10_1101-2021_01_06_425657	406	35	the	the	DT
10_1101-2021_01_06_425657	406	36	other	other	JJ
10_1101-2021_01_06_425657	406	37	was	be	VBD
10_1101-2021_01_06_425657	406	38	performed	perform	VBN
10_1101-2021_01_06_425657	406	39	without	without	IN
10_1101-2021_01_06_425657	406	40	reducing	reduce	VBG
10_1101-2021_01_06_425657	406	41	agent	agent	NN
10_1101-2021_01_06_425657	406	42	present	present	JJ
10_1101-2021_01_06_425657	406	43	(	(	-LRB-
10_1101-2021_01_06_425657	406	44	−DTT	−DTT	NNP
10_1101-2021_01_06_425657	406	45	)	)	-RRB-
10_1101-2021_01_06_425657	406	46	.	.	.
10_1101-2021_01_06_425657	407	1	To	to	TO
10_1101-2021_01_06_425657	407	2	test	test	VB
10_1101-2021_01_06_425657	407	3	if	if	IN
10_1101-2021_01_06_425657	407	4	723	723	CD
10_1101-2021_01_06_425657	407	5	the	the	DT
10_1101-2021_01_06_425657	407	6	addition	addition	NN
10_1101-2021_01_06_425657	407	7	of	of	IN
10_1101-2021_01_06_425657	407	8	reducing	reduce	VBG
10_1101-2021_01_06_425657	407	9	agent	agent	NN
10_1101-2021_01_06_425657	407	10	could	could	MD
10_1101-2021_01_06_425657	407	11	rescue	rescue	VB
10_1101-2021_01_06_425657	407	12	the	the	DT
10_1101-2021_01_06_425657	407	13	activity	activity	NN
10_1101-2021_01_06_425657	407	14	of	of	IN
10_1101-2021_01_06_425657	407	15	the	the	DT
10_1101-2021_01_06_425657	407	16	“	"	``
10_1101-2021_01_06_425657	407	17	−DTT	−DTT	NNP
10_1101-2021_01_06_425657	407	18	”	"	''
10_1101-2021_01_06_425657	407	19	IP	IP	NNP
10_1101-2021_01_06_425657	407	20	,	,	,
10_1101-2021_01_06_425657	407	21	a	a	DT
10_1101-2021_01_06_425657	407	22	small	small	JJ
10_1101-2021_01_06_425657	407	23	aliquot	aliquot	NNS
10_1101-2021_01_06_425657	407	24	of	of	IN
10_1101-2021_01_06_425657	407	25	the	the	DT
10_1101-2021_01_06_425657	407	26	724	724	CD
10_1101-2021_01_06_425657	407	27	“	"	``
10_1101-2021_01_06_425657	407	28	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	407	29	”	"	''
10_1101-2021_01_06_425657	407	30	SCFMet30-Flag	scfmet30-flag	NN
10_1101-2021_01_06_425657	407	31	complex	complex	NN
10_1101-2021_01_06_425657	407	32	was	be	VBD
10_1101-2021_01_06_425657	407	33	transferred	transfer	VBN
10_1101-2021_01_06_425657	407	34	to	to	IN
10_1101-2021_01_06_425657	407	35	a	a	DT
10_1101-2021_01_06_425657	407	36	new	new	JJ
10_1101-2021_01_06_425657	407	37	tube	tube	NN
10_1101-2021_01_06_425657	407	38	and	and	CC
10_1101-2021_01_06_425657	407	39	was	be	VBD
10_1101-2021_01_06_425657	407	40	treated	treat	VBN
10_1101-2021_01_06_425657	407	41	briefly	briefly	RB
10_1101-2021_01_06_425657	407	42	with	with	IN
10_1101-2021_01_06_425657	407	43	5	5	CD
10_1101-2021_01_06_425657	407	44	mM	mM	NNP
10_1101-2021_01_06_425657	407	45	725	725	CD
10_1101-2021_01_06_425657	407	46	TCEP	tcep	NN
10_1101-2021_01_06_425657	407	47	while	while	IN
10_1101-2021_01_06_425657	407	48	the	the	DT
10_1101-2021_01_06_425657	407	49	in	in	FW
10_1101-2021_01_06_425657	407	50	vitro	vitro	FW
10_1101-2021_01_06_425657	407	51	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	407	52	reaction	reaction	NN
10_1101-2021_01_06_425657	407	53	was	be	VBD
10_1101-2021_01_06_425657	407	54	set	set	VBN
10_1101-2021_01_06_425657	407	55	up	up	RP
10_1101-2021_01_06_425657	407	56	(	(	-LRB-
10_1101-2021_01_06_425657	407	57	−DTT/+TCEP	−DTT/+TCEP	NNP
10_1101-2021_01_06_425657	407	58	)	)	-RRB-
10_1101-2021_01_06_425657	407	59	.	.	.
10_1101-2021_01_06_425657	408	1	The	the	DT
10_1101-2021_01_06_425657	408	2	first	first	JJ
10_1101-2021_01_06_425657	408	3	three	three	CD
10_1101-2021_01_06_425657	408	4	lanes	lane	NNS
10_1101-2021_01_06_425657	408	5	726	726	CD
10_1101-2021_01_06_425657	408	6	are	be	VBP
10_1101-2021_01_06_425657	408	7	negative	negative	JJ
10_1101-2021_01_06_425657	408	8	control	control	NN
10_1101-2021_01_06_425657	408	9	reactions	reaction	NNS
10_1101-2021_01_06_425657	408	10	performed	perform	VBD
10_1101-2021_01_06_425657	408	11	either	either	CC
10_1101-2021_01_06_425657	408	12	without	without	IN
10_1101-2021_01_06_425657	408	13	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	408	14	IP	IP	NNP
10_1101-2021_01_06_425657	408	15	,	,	,
10_1101-2021_01_06_425657	408	16	recombinant	recombinant	JJ
10_1101-2021_01_06_425657	408	17	Met4	Met4	NNP
10_1101-2021_01_06_425657	408	18	,	,	,
10_1101-2021_01_06_425657	408	19	or	or	CC
10_1101-2021_01_06_425657	408	20	727	727	CD
10_1101-2021_01_06_425657	408	21	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	408	22	.	.	.
10_1101-2021_01_06_425657	409	1	728	728	CD
10_1101-2021_01_06_425657	409	2	(	(	-LRB-
10_1101-2021_01_06_425657	409	3	C	C	NNP
10_1101-2021_01_06_425657	409	4	)	)	-RRB-
10_1101-2021_01_06_425657	409	5	The	the	DT
10_1101-2021_01_06_425657	409	6	same	same	JJ
10_1101-2021_01_06_425657	409	7	Western	western	JJ
10_1101-2021_01_06_425657	409	8	blot	blot	NN
10_1101-2021_01_06_425657	409	9	analysis	analysis	NN
10_1101-2021_01_06_425657	409	10	of	of	IN
10_1101-2021_01_06_425657	409	11	Met4	Met4	NNP
10_1101-2021_01_06_425657	409	12	in	in	FW
10_1101-2021_01_06_425657	409	13	vitro	vitro	FW
10_1101-2021_01_06_425657	409	14	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	409	15	as	as	IN
10_1101-2021_01_06_425657	409	16	in	in	IN
10_1101-2021_01_06_425657	409	17	(	(	-LRB-
10_1101-2021_01_06_425657	409	18	B	b	NN
10_1101-2021_01_06_425657	409	19	)	)	-RRB-
10_1101-2021_01_06_425657	409	20	,	,	,
10_1101-2021_01_06_425657	409	21	except	except	IN
10_1101-2021_01_06_425657	409	22	that	that	IN
10_1101-2021_01_06_425657	409	23	the	the	DT
10_1101-2021_01_06_425657	409	24	729	729	CD
10_1101-2021_01_06_425657	409	25	SCFMet30-Flag	scfmet30-flag	NN
10_1101-2021_01_06_425657	409	26	complex	complex	NN
10_1101-2021_01_06_425657	409	27	was	be	VBD
10_1101-2021_01_06_425657	409	28	produced	produce	VBN
10_1101-2021_01_06_425657	409	29	from	from	IN
10_1101-2021_01_06_425657	409	30	−sulfur	−sulfur	NNP
10_1101-2021_01_06_425657	409	31	SFL	SFL	NNP
10_1101-2021_01_06_425657	409	32	cells	cell	NNS
10_1101-2021_01_06_425657	409	33	.	.	.
10_1101-2021_01_06_425657	410	1	730	730	CD
10_1101-2021_01_06_425657	410	2	(	(	-LRB-
10_1101-2021_01_06_425657	410	3	D	d	NN
10_1101-2021_01_06_425657	410	4	)	)	-RRB-
10_1101-2021_01_06_425657	410	5	Western	western	JJ
10_1101-2021_01_06_425657	410	6	blot	blot	NN
10_1101-2021_01_06_425657	410	7	analysis	analysis	NN
10_1101-2021_01_06_425657	410	8	of	of	IN
10_1101-2021_01_06_425657	410	9	the	the	DT
10_1101-2021_01_06_425657	410	10	Met4	Met4	NNP
10_1101-2021_01_06_425657	410	11	binding	bind	VBG
10_1101-2021_01_06_425657	410	12	assay	assay	NN
10_1101-2021_01_06_425657	410	13	illustrated	illustrate	VBN
10_1101-2021_01_06_425657	410	14	in	in	IN
10_1101-2021_01_06_425657	410	15	(	(	-LRB-
10_1101-2021_01_06_425657	410	16	A	a	NN
10_1101-2021_01_06_425657	410	17	)	)	-RRB-
10_1101-2021_01_06_425657	410	18	.	.	.
10_1101-2021_01_06_425657	411	1	Rich	rich	JJ
10_1101-2021_01_06_425657	411	2	and	and	CC
10_1101-2021_01_06_425657	411	3	−sulfur	−sulfur	CD
10_1101-2021_01_06_425657	411	4	lysate	lysate	NN
10_1101-2021_01_06_425657	411	5	731	731	CD
10_1101-2021_01_06_425657	411	6	were	be	VBD
10_1101-2021_01_06_425657	411	7	both	both	DT
10_1101-2021_01_06_425657	411	8	split	split	VBN
10_1101-2021_01_06_425657	411	9	three	three	CD
10_1101-2021_01_06_425657	411	10	ways	way	NNS
10_1101-2021_01_06_425657	411	11	,	,	,
10_1101-2021_01_06_425657	411	12	and	and	CC
10_1101-2021_01_06_425657	411	13	lysate	lysate	VB
10_1101-2021_01_06_425657	411	14	with	with	IN
10_1101-2021_01_06_425657	411	15	1	1	CD
10_1101-2021_01_06_425657	411	16	mM	mM	NNP
10_1101-2021_01_06_425657	411	17	DTT	DTT	NNP
10_1101-2021_01_06_425657	411	18	(	(	-LRB-
10_1101-2021_01_06_425657	411	19	+	+	SYM
10_1101-2021_01_06_425657	411	20	DTT	DTT	NNP
10_1101-2021_01_06_425657	411	21	)	)	-RRB-
10_1101-2021_01_06_425657	411	22	,	,	,
10_1101-2021_01_06_425657	411	23	1	1	CD
10_1101-2021_01_06_425657	411	24	mM	mm	NN
10_1101-2021_01_06_425657	411	25	diamide	diamide	NN
10_1101-2021_01_06_425657	411	26	(	(	-LRB-
10_1101-2021_01_06_425657	411	27	+	+	NFP
10_1101-2021_01_06_425657	411	28	Diamide	diamide	NN
10_1101-2021_01_06_425657	411	29	)	)	-RRB-
10_1101-2021_01_06_425657	411	30	,	,	,
10_1101-2021_01_06_425657	411	31	or	or	CC
10_1101-2021_01_06_425657	411	32	732	732	CD
10_1101-2021_01_06_425657	411	33	control	control	NN
10_1101-2021_01_06_425657	411	34	(	(	-LRB-
10_1101-2021_01_06_425657	411	35	−DTT	−dtt	NN
10_1101-2021_01_06_425657	411	36	)	)	-RRB-
10_1101-2021_01_06_425657	411	37	were	be	VBD
10_1101-2021_01_06_425657	411	38	incubated	incubate	VBN
10_1101-2021_01_06_425657	411	39	with	with	IN
10_1101-2021_01_06_425657	411	40	anti	anti	JJ
10_1101-2021_01_06_425657	411	41	-	-	JJ
10_1101-2021_01_06_425657	411	42	Flag	flag	JJ
10_1101-2021_01_06_425657	411	43	magnetic	magnetic	JJ
10_1101-2021_01_06_425657	411	44	beads	bead	NNS
10_1101-2021_01_06_425657	411	45	to	to	TO
10_1101-2021_01_06_425657	411	46	isolate	isolate	VB
10_1101-2021_01_06_425657	411	47	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	411	48	complex	complex	NN
10_1101-2021_01_06_425657	411	49	.	.	.
10_1101-2021_01_06_425657	412	1	The	the	DT
10_1101-2021_01_06_425657	412	2	733	733	CD
10_1101-2021_01_06_425657	412	3	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	412	4	bound	bind	VBN
10_1101-2021_01_06_425657	412	5	beads	bead	NNS
10_1101-2021_01_06_425657	412	6	from	from	IN
10_1101-2021_01_06_425657	412	7	each	each	DT
10_1101-2021_01_06_425657	412	8	condition	condition	NN
10_1101-2021_01_06_425657	412	9	were	be	VBD
10_1101-2021_01_06_425657	412	10	then	then	RB
10_1101-2021_01_06_425657	412	11	split	split	VBN
10_1101-2021_01_06_425657	412	12	in	in	IN
10_1101-2021_01_06_425657	412	13	half	half	NN
10_1101-2021_01_06_425657	412	14	and	and	CC
10_1101-2021_01_06_425657	412	15	distributed	distribute	VBN
10_1101-2021_01_06_425657	412	16	into	into	IN
10_1101-2021_01_06_425657	412	17	tubes	tube	NNS
10_1101-2021_01_06_425657	412	18	734	734	CD
10_1101-2021_01_06_425657	412	19	containing	contain	VBG
10_1101-2021_01_06_425657	412	20	IP	IP	NNP
10_1101-2021_01_06_425657	412	21	buffer	buffer	NN
10_1101-2021_01_06_425657	412	22	±	±	NNP
10_1101-2021_01_06_425657	412	23	1	1	CD
10_1101-2021_01_06_425657	412	24	mM	mM	NNP
10_1101-2021_01_06_425657	412	25	DTT	dtt	NN
10_1101-2021_01_06_425657	412	26	and	and	CC
10_1101-2021_01_06_425657	412	27	purified	purify	VBD
10_1101-2021_01_06_425657	412	28	recombinant	recombinant	JJ
10_1101-2021_01_06_425657	412	29	Met4	Met4	NNP
10_1101-2021_01_06_425657	412	30	.	.	.
10_1101-2021_01_06_425657	413	1	The	the	DT
10_1101-2021_01_06_425657	413	2	mixture	mixture	NN
10_1101-2021_01_06_425657	413	3	was	be	VBD
10_1101-2021_01_06_425657	413	4	allowed	allow	VBN
10_1101-2021_01_06_425657	413	5	to	to	IN
10_1101-2021_01_06_425657	413	6	735	735	CD
10_1101-2021_01_06_425657	413	7	incubate	incubate	NN
10_1101-2021_01_06_425657	413	8	for	for	IN
10_1101-2021_01_06_425657	413	9	2	2	CD
10_1101-2021_01_06_425657	413	10	h	h	NN
10_1101-2021_01_06_425657	413	11	before	before	IN
10_1101-2021_01_06_425657	413	12	the	the	DT
10_1101-2021_01_06_425657	413	13	beads	bead	NNS
10_1101-2021_01_06_425657	413	14	were	be	VBD
10_1101-2021_01_06_425657	413	15	washed	wash	VBN
10_1101-2021_01_06_425657	413	16	,	,	,
10_1101-2021_01_06_425657	413	17	boiled	boil	VBN
10_1101-2021_01_06_425657	413	18	in	in	IN
10_1101-2021_01_06_425657	413	19	sample	sample	NN
10_1101-2021_01_06_425657	413	20	buffer	buffer	NN
10_1101-2021_01_06_425657	413	21	,	,	,
10_1101-2021_01_06_425657	413	22	and	and	CC
10_1101-2021_01_06_425657	413	23	bound	bind	VBN
10_1101-2021_01_06_425657	413	24	proteins	protein	NNS
10_1101-2021_01_06_425657	413	25	were	be	VBD
10_1101-2021_01_06_425657	413	26	736	736	CD
10_1101-2021_01_06_425657	413	27	separated	separate	VBN
10_1101-2021_01_06_425657	413	28	on	on	IN
10_1101-2021_01_06_425657	413	29	SDS	SDS	NNP
10_1101-2021_01_06_425657	413	30	-	-	HYPH
10_1101-2021_01_06_425657	413	31	PAGE	PAGE	NNP
10_1101-2021_01_06_425657	413	32	gels	gel	NNS
10_1101-2021_01_06_425657	413	33	and	and	CC
10_1101-2021_01_06_425657	413	34	Western	western	JJ
10_1101-2021_01_06_425657	413	35	blots	blot	NNS
10_1101-2021_01_06_425657	413	36	were	be	VBD
10_1101-2021_01_06_425657	413	37	performed	perform	VBN
10_1101-2021_01_06_425657	413	38	for	for	IN
10_1101-2021_01_06_425657	413	39	both	both	DT
10_1101-2021_01_06_425657	413	40	Met30	Met30	NNP
10_1101-2021_01_06_425657	413	41	and	and	CC
10_1101-2021_01_06_425657	413	42	Met4	Met4	NNP
10_1101-2021_01_06_425657	413	43	.	.	.
10_1101-2021_01_06_425657	414	1	737	737	CD
10_1101-2021_01_06_425657	414	2	738	738	CD
10_1101-2021_01_06_425657	414	3	Figure	Figure	NNP
10_1101-2021_01_06_425657	414	4	5	5	CD
10_1101-2021_01_06_425657	414	5	.	.	.
10_1101-2021_01_06_425657	415	1	Model	model	NN
10_1101-2021_01_06_425657	415	2	for	for	IN
10_1101-2021_01_06_425657	415	3	sulfur	sulfur	NN
10_1101-2021_01_06_425657	415	4	-	-	HYPH
10_1101-2021_01_06_425657	415	5	sensing	sensing	NN
10_1101-2021_01_06_425657	415	6	and	and	CC
10_1101-2021_01_06_425657	415	7	MET	MET	NNP
10_1101-2021_01_06_425657	415	8	gene	gene	NN
10_1101-2021_01_06_425657	415	9	regulation	regulation	NN
10_1101-2021_01_06_425657	415	10	by	by	IN
10_1101-2021_01_06_425657	415	11	the	the	DT
10_1101-2021_01_06_425657	415	12	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	415	13	E3	E3	NNP
10_1101-2021_01_06_425657	415	14	ligase	ligase	NN
10_1101-2021_01_06_425657	415	15	.	.	.
10_1101-2021_01_06_425657	416	1	739	739	CD
10_1101-2021_01_06_425657	416	2	In	in	IN
10_1101-2021_01_06_425657	416	3	conditions	condition	NNS
10_1101-2021_01_06_425657	416	4	of	of	IN
10_1101-2021_01_06_425657	416	5	high	high	JJ
10_1101-2021_01_06_425657	416	6	sulfur	sulfur	NN
10_1101-2021_01_06_425657	416	7	metabolite	metabolite	JJ
10_1101-2021_01_06_425657	416	8	levels	level	NNS
10_1101-2021_01_06_425657	416	9	,	,	,
10_1101-2021_01_06_425657	416	10	cysteine	cysteine	NN
10_1101-2021_01_06_425657	416	11	residues	residue	NNS
10_1101-2021_01_06_425657	416	12	in	in	IN
10_1101-2021_01_06_425657	416	13	the	the	DT
10_1101-2021_01_06_425657	416	14	WD-40	WD-40	NNP
10_1101-2021_01_06_425657	416	15	repeat	repeat	NN
10_1101-2021_01_06_425657	416	16	region	region	NN
10_1101-2021_01_06_425657	416	17	of	of	IN
10_1101-2021_01_06_425657	416	18	740	740	CD
10_1101-2021_01_06_425657	416	19	Met30	Met30	NNPS
10_1101-2021_01_06_425657	416	20	are	be	VBP
10_1101-2021_01_06_425657	416	21	reduced	reduce	VBN
10_1101-2021_01_06_425657	416	22	,	,	,
10_1101-2021_01_06_425657	416	23	allowing	allow	VBG
10_1101-2021_01_06_425657	416	24	Met30	Met30	NNP
10_1101-2021_01_06_425657	416	25	to	to	TO
10_1101-2021_01_06_425657	416	26	bind	bind	VB
10_1101-2021_01_06_425657	416	27	and	and	CC
10_1101-2021_01_06_425657	416	28	facilitate	facilitate	VB
10_1101-2021_01_06_425657	416	29	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	416	30	of	of	IN
10_1101-2021_01_06_425657	416	31	Met4	Met4	NNP
10_1101-2021_01_06_425657	416	32	in	in	IN
10_1101-2021_01_06_425657	416	33	order	order	NN
10_1101-2021_01_06_425657	416	34	to	to	IN
10_1101-2021_01_06_425657	416	35	741	741	CD
10_1101-2021_01_06_425657	416	36	negatively	negatively	RB
10_1101-2021_01_06_425657	416	37	regulate	regulate	VB
10_1101-2021_01_06_425657	416	38	the	the	DT
10_1101-2021_01_06_425657	416	39	transcriptional	transcriptional	JJ
10_1101-2021_01_06_425657	416	40	activation	activation	NN
10_1101-2021_01_06_425657	416	41	of	of	IN
10_1101-2021_01_06_425657	416	42	the	the	DT
10_1101-2021_01_06_425657	416	43	MET	MET	NNP
10_1101-2021_01_06_425657	416	44	regulon	regulon	NN
10_1101-2021_01_06_425657	416	45	.	.	.
10_1101-2021_01_06_425657	417	1	Upon	upon	IN
10_1101-2021_01_06_425657	417	2	sulfur	sulfur	NN
10_1101-2021_01_06_425657	417	3	starvation	starvation	NN
10_1101-2021_01_06_425657	417	4	,	,	,
10_1101-2021_01_06_425657	417	5	742	742	CD
10_1101-2021_01_06_425657	417	6	Met30	Met30	NNP
10_1101-2021_01_06_425657	417	7	cysteine	cysteine	NN
10_1101-2021_01_06_425657	417	8	residues	residue	NNS
10_1101-2021_01_06_425657	417	9	become	become	VBP
10_1101-2021_01_06_425657	417	10	oxidized	oxidized	JJ
10_1101-2021_01_06_425657	417	11	,	,	,
10_1101-2021_01_06_425657	417	12	resulting	result	VBG
10_1101-2021_01_06_425657	417	13	in	in	IN
10_1101-2021_01_06_425657	417	14	conformational	conformational	JJ
10_1101-2021_01_06_425657	417	15	changes	change	NNS
10_1101-2021_01_06_425657	417	16	in	in	IN
10_1101-2021_01_06_425657	417	17	Met30	Met30	NNP
10_1101-2021_01_06_425657	417	18	that	that	WDT
10_1101-2021_01_06_425657	417	19	allow	allow	VBP
10_1101-2021_01_06_425657	417	20	743	743	CD
10_1101-2021_01_06_425657	417	21	Met4	met4	DT
10_1101-2021_01_06_425657	417	22	to	to	TO
10_1101-2021_01_06_425657	417	23	be	be	VB
10_1101-2021_01_06_425657	417	24	released	release	VBN
10_1101-2021_01_06_425657	417	25	from	from	IN
10_1101-2021_01_06_425657	417	26	the	the	DT
10_1101-2021_01_06_425657	417	27	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	417	28	complex	complex	NN
10_1101-2021_01_06_425657	417	29	,	,	,
10_1101-2021_01_06_425657	417	30	deubiquitinated	deubiquitinate	VBD
10_1101-2021_01_06_425657	417	31	,	,	,
10_1101-2021_01_06_425657	417	32	and	and	CC
10_1101-2021_01_06_425657	417	33	transcriptionally	transcriptionally	RB
10_1101-2021_01_06_425657	417	34	active	active	JJ
10_1101-2021_01_06_425657	417	35	.	.	.
10_1101-2021_01_06_425657	418	1	744	744	CD
10_1101-2021_01_06_425657	418	2	745	745	CD
10_1101-2021_01_06_425657	418	3	.CC	.CC	NFP
10_1101-2021_01_06_425657	418	4	-	-	:
10_1101-2021_01_06_425657	418	5	BY	by	IN
10_1101-2021_01_06_425657	418	6	4.0	4.0	CD
10_1101-2021_01_06_425657	418	7	International	International	NNP
10_1101-2021_01_06_425657	418	8	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	418	9	under	under	IN
10_1101-2021_01_06_425657	418	10	a	a	DT
10_1101-2021_01_06_425657	418	11	(	(	-LRB-
10_1101-2021_01_06_425657	418	12	which	which	WDT
10_1101-2021_01_06_425657	418	13	was	be	VBD
10_1101-2021_01_06_425657	418	14	not	not	RB
10_1101-2021_01_06_425657	418	15	certified	certify	VBN
10_1101-2021_01_06_425657	418	16	by	by	IN
10_1101-2021_01_06_425657	418	17	peer	peer	NN
10_1101-2021_01_06_425657	418	18	review	review	NN
10_1101-2021_01_06_425657	418	19	)	)	-RRB-
10_1101-2021_01_06_425657	418	20	is	be	VBZ
10_1101-2021_01_06_425657	418	21	the	the	DT
10_1101-2021_01_06_425657	418	22	author	author	NN
10_1101-2021_01_06_425657	418	23	/	/	SYM
10_1101-2021_01_06_425657	418	24	funder	funder	NN
10_1101-2021_01_06_425657	418	25	,	,	,
10_1101-2021_01_06_425657	418	26	who	who	WP
10_1101-2021_01_06_425657	418	27	has	have	VBZ
10_1101-2021_01_06_425657	418	28	granted	grant	VBN
10_1101-2021_01_06_425657	418	29	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	418	30	a	a	DT
10_1101-2021_01_06_425657	418	31	license	license	NN
10_1101-2021_01_06_425657	418	32	to	to	TO
10_1101-2021_01_06_425657	418	33	display	display	VB
10_1101-2021_01_06_425657	418	34	the	the	DT
10_1101-2021_01_06_425657	418	35	preprint	preprint	NN
10_1101-2021_01_06_425657	418	36	in	in	IN
10_1101-2021_01_06_425657	418	37	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	418	38	.	.	.
10_1101-2021_01_06_425657	419	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	419	2	is	be	VBZ
10_1101-2021_01_06_425657	419	3	made	make	VBN
10_1101-2021_01_06_425657	419	4	The	the	DT
10_1101-2021_01_06_425657	419	5	copyright	copyright	NN
10_1101-2021_01_06_425657	419	6	holder	holder	NN
10_1101-2021_01_06_425657	419	7	for	for	IN
10_1101-2021_01_06_425657	419	8	this	this	DT
10_1101-2021_01_06_425657	419	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	419	10	version	version	NN
10_1101-2021_01_06_425657	419	11	posted	post	VBD
10_1101-2021_01_06_425657	419	12	January	January	NNP
10_1101-2021_01_06_425657	419	13	7	7	CD
10_1101-2021_01_06_425657	419	14	,	,	,
10_1101-2021_01_06_425657	419	15	2021	2021	CD
10_1101-2021_01_06_425657	419	16	.	.	.
10_1101-2021_01_06_425657	419	17	;	;	:
10_1101-2021_01_06_425657	419	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	419	19	:	:	:
10_1101-2021_01_06_425657	419	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	419	21	preprint	preprint	NN
10_1101-2021_01_06_425657	419	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	419	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	419	24	22	22	CD
10_1101-2021_01_06_425657	419	25	SUPPLEMENTAL	supplemental	NN
10_1101-2021_01_06_425657	419	26	FIGURE	FIGURE	VBZ
10_1101-2021_01_06_425657	419	27	LEGENDS	legend	NNS
10_1101-2021_01_06_425657	419	28	746	746	CD
10_1101-2021_01_06_425657	419	29	747	747	NNP
10_1101-2021_01_06_425657	419	30	Figure	Figure	NNP
10_1101-2021_01_06_425657	419	31	S1	S1	NNS
10_1101-2021_01_06_425657	419	32	.	.	.
10_1101-2021_01_06_425657	420	1	Characterization	characterization	NN
10_1101-2021_01_06_425657	420	2	of	of	IN
10_1101-2021_01_06_425657	420	3	the	the	DT
10_1101-2021_01_06_425657	420	4	faster	fast	RBR
10_1101-2021_01_06_425657	420	5	-	-	HYPH
10_1101-2021_01_06_425657	420	6	migrating	migrate	VBG
10_1101-2021_01_06_425657	420	7	proteoform	proteoform	NN
10_1101-2021_01_06_425657	420	8	of	of	IN
10_1101-2021_01_06_425657	420	9	Met30	Met30	NNP
10_1101-2021_01_06_425657	420	10	.	.	.
10_1101-2021_01_06_425657	421	1	748	748	CD
10_1101-2021_01_06_425657	421	2	(	(	-LRB-
10_1101-2021_01_06_425657	421	3	A	a	DT
10_1101-2021_01_06_425657	421	4	)	)	-RRB-
10_1101-2021_01_06_425657	421	5	Western	western	JJ
10_1101-2021_01_06_425657	421	6	blot	blot	NN
10_1101-2021_01_06_425657	421	7	of	of	IN
10_1101-2021_01_06_425657	421	8	yeast	yeast	NN
10_1101-2021_01_06_425657	421	9	treated	treat	VBN
10_1101-2021_01_06_425657	421	10	with	with	IN
10_1101-2021_01_06_425657	421	11	200	200	CD
10_1101-2021_01_06_425657	421	12	µg	µg	NN
10_1101-2021_01_06_425657	421	13	/	/	SYM
10_1101-2021_01_06_425657	421	14	ml	ml	NN
10_1101-2021_01_06_425657	421	15	cycloheximide	cycloheximide	NN
10_1101-2021_01_06_425657	421	16	during	during	IN
10_1101-2021_01_06_425657	421	17	sulfur	sulfur	NN
10_1101-2021_01_06_425657	421	18	starvation	starvation	NN
10_1101-2021_01_06_425657	421	19	749	749	CD
10_1101-2021_01_06_425657	421	20	demonstrates	demonstrate	VBZ
10_1101-2021_01_06_425657	421	21	that	that	DT
10_1101-2021_01_06_425657	421	22	production	production	NN
10_1101-2021_01_06_425657	421	23	of	of	IN
10_1101-2021_01_06_425657	421	24	the	the	DT
10_1101-2021_01_06_425657	421	25	faster	fast	RBR
10_1101-2021_01_06_425657	421	26	-	-	HYPH
10_1101-2021_01_06_425657	421	27	migrating	migrate	VBG
10_1101-2021_01_06_425657	421	28	proteoform	proteoform	NN
10_1101-2021_01_06_425657	421	29	is	be	VBZ
10_1101-2021_01_06_425657	421	30	dependent	dependent	JJ
10_1101-2021_01_06_425657	421	31	on	on	IN
10_1101-2021_01_06_425657	421	32	new	new	JJ
10_1101-2021_01_06_425657	421	33	translation	translation	NN
10_1101-2021_01_06_425657	421	34	.	.	.
10_1101-2021_01_06_425657	422	1	750	750	CD
10_1101-2021_01_06_425657	422	2	(	(	-LRB-
10_1101-2021_01_06_425657	422	3	B	b	NN
10_1101-2021_01_06_425657	422	4	)	)	-RRB-
10_1101-2021_01_06_425657	422	5	The	the	DT
10_1101-2021_01_06_425657	422	6	faster	fast	RBR
10_1101-2021_01_06_425657	422	7	-	-	HYPH
10_1101-2021_01_06_425657	422	8	migrating	migrate	VBG
10_1101-2021_01_06_425657	422	9	proteoform	proteoform	NN
10_1101-2021_01_06_425657	422	10	persists	persist	VBZ
10_1101-2021_01_06_425657	422	11	after	after	IN
10_1101-2021_01_06_425657	422	12	rescue	rescue	NN
10_1101-2021_01_06_425657	422	13	from	from	IN
10_1101-2021_01_06_425657	422	14	sulfur	sulfur	NN
10_1101-2021_01_06_425657	422	15	starvation	starvation	NN
10_1101-2021_01_06_425657	422	16	when	when	WRB
10_1101-2021_01_06_425657	422	17	treated	treat	VBN
10_1101-2021_01_06_425657	422	18	with	with	IN
10_1101-2021_01_06_425657	422	19	751	751	CD
10_1101-2021_01_06_425657	422	20	a	a	DT
10_1101-2021_01_06_425657	422	21	proteasome	proteasome	JJ
10_1101-2021_01_06_425657	422	22	inhibitor	inhibitor	NN
10_1101-2021_01_06_425657	422	23	.	.	.
10_1101-2021_01_06_425657	423	1	Cells	cell	NNS
10_1101-2021_01_06_425657	423	2	were	be	VBD
10_1101-2021_01_06_425657	423	3	starved	starve	VBN
10_1101-2021_01_06_425657	423	4	of	of	IN
10_1101-2021_01_06_425657	423	5	sulfur	sulfur	NN
10_1101-2021_01_06_425657	423	6	for	for	IN
10_1101-2021_01_06_425657	423	7	3	3	CD
10_1101-2021_01_06_425657	423	8	h	h	NN
10_1101-2021_01_06_425657	423	9	to	to	TO
10_1101-2021_01_06_425657	423	10	accumulate	accumulate	VB
10_1101-2021_01_06_425657	423	11	the	the	DT
10_1101-2021_01_06_425657	423	12	faster	fast	RBR
10_1101-2021_01_06_425657	423	13	-	-	HYPH
10_1101-2021_01_06_425657	423	14	migrating	migrate	VBG
10_1101-2021_01_06_425657	423	15	752	752	CD
10_1101-2021_01_06_425657	423	16	proteoform	proteoform	NN
10_1101-2021_01_06_425657	423	17	,	,	,
10_1101-2021_01_06_425657	423	18	and	and	CC
10_1101-2021_01_06_425657	423	19	then	then	RB
10_1101-2021_01_06_425657	423	20	sulfur	sulfur	NN
10_1101-2021_01_06_425657	423	21	metabolites	metabolite	NNS
10_1101-2021_01_06_425657	423	22	were	be	VBD
10_1101-2021_01_06_425657	423	23	added	add	VBN
10_1101-2021_01_06_425657	423	24	back	back	RB
10_1101-2021_01_06_425657	423	25	concomitantly	concomitantly	RB
10_1101-2021_01_06_425657	423	26	with	with	IN
10_1101-2021_01_06_425657	423	27	MG132	mg132	NN
10_1101-2021_01_06_425657	423	28	(	(	-LRB-
10_1101-2021_01_06_425657	423	29	50	50	CD
10_1101-2021_01_06_425657	423	30	µM	µM	NNP
10_1101-2021_01_06_425657	423	31	)	)	-RRB-
10_1101-2021_01_06_425657	423	32	.	.	.
10_1101-2021_01_06_425657	424	1	753	753	CD
10_1101-2021_01_06_425657	424	2	(	(	-LRB-
10_1101-2021_01_06_425657	424	3	C	C	NNP
10_1101-2021_01_06_425657	424	4	)	)	-RRB-
10_1101-2021_01_06_425657	424	5	The	the	DT
10_1101-2021_01_06_425657	424	6	faster	fast	RBR
10_1101-2021_01_06_425657	424	7	-	-	HYPH
10_1101-2021_01_06_425657	424	8	migrating	migrate	VBG
10_1101-2021_01_06_425657	424	9	proteoform	proteoform	NN
10_1101-2021_01_06_425657	424	10	of	of	IN
10_1101-2021_01_06_425657	424	11	Met30	Met30	NNP
10_1101-2021_01_06_425657	424	12	is	be	VBZ
10_1101-2021_01_06_425657	424	13	dependent	dependent	JJ
10_1101-2021_01_06_425657	424	14	on	on	IN
10_1101-2021_01_06_425657	424	15	Met4	Met4	NNP
10_1101-2021_01_06_425657	424	16	.	.	.
10_1101-2021_01_06_425657	425	1	The	the	DT
10_1101-2021_01_06_425657	425	2	met4∆	met4∆	NN
10_1101-2021_01_06_425657	425	3	yeast	yeast	NN
10_1101-2021_01_06_425657	425	4	strain	strain	NN
10_1101-2021_01_06_425657	425	5	does	do	VBZ
10_1101-2021_01_06_425657	425	6	754	754	CD
10_1101-2021_01_06_425657	425	7	not	not	RB
10_1101-2021_01_06_425657	425	8	produce	produce	VB
10_1101-2021_01_06_425657	425	9	the	the	DT
10_1101-2021_01_06_425657	425	10	second	second	JJ
10_1101-2021_01_06_425657	425	11	proteoform	proteoform	NN
10_1101-2021_01_06_425657	425	12	of	of	IN
10_1101-2021_01_06_425657	425	13	Met30	Met30	NNP
10_1101-2021_01_06_425657	425	14	when	when	WRB
10_1101-2021_01_06_425657	425	15	starved	starve	VBN
10_1101-2021_01_06_425657	425	16	of	of	IN
10_1101-2021_01_06_425657	425	17	sulfur	sulfur	NN
10_1101-2021_01_06_425657	425	18	.	.	.
10_1101-2021_01_06_425657	426	1	755	755	CD
10_1101-2021_01_06_425657	426	2	(	(	-LRB-
10_1101-2021_01_06_425657	426	3	D	d	NN
10_1101-2021_01_06_425657	426	4	)	)	-RRB-
10_1101-2021_01_06_425657	426	5	Western	western	JJ
10_1101-2021_01_06_425657	426	6	blot	blot	NN
10_1101-2021_01_06_425657	426	7	analysis	analysis	NN
10_1101-2021_01_06_425657	426	8	of	of	IN
10_1101-2021_01_06_425657	426	9	strains	strain	NNS
10_1101-2021_01_06_425657	426	10	expressing	express	VBG
10_1101-2021_01_06_425657	426	11	either	either	CC
10_1101-2021_01_06_425657	426	12	wild	wild	JJ
10_1101-2021_01_06_425657	426	13	type	type	NN
10_1101-2021_01_06_425657	426	14	Met30	Met30	NNP
10_1101-2021_01_06_425657	426	15	,	,	,
10_1101-2021_01_06_425657	426	16	Met30	Met30	NNP
10_1101-2021_01_06_425657	426	17	D1	d1	NN
10_1101-2021_01_06_425657	426	18	-	-	HYPH
10_1101-2021_01_06_425657	426	19	20aa	20aa	NN
10_1101-2021_01_06_425657	426	20	,	,	,
10_1101-2021_01_06_425657	426	21	or	or	CC
10_1101-2021_01_06_425657	426	22	Met30	Met30	NNP
10_1101-2021_01_06_425657	426	23	756	756	CD
10_1101-2021_01_06_425657	426	24	M30/35/36A.	M30/35/36A.	NNS
10_1101-2021_01_06_425657	427	1	Yeast	yeast	NN
10_1101-2021_01_06_425657	427	2	cells	cell	NNS
10_1101-2021_01_06_425657	427	3	harboring	harbor	VBG
10_1101-2021_01_06_425657	427	4	the	the	DT
10_1101-2021_01_06_425657	427	5	N	n	NN
10_1101-2021_01_06_425657	427	6	-	-	HYPH
10_1101-2021_01_06_425657	427	7	terminal	terminal	NN
10_1101-2021_01_06_425657	427	8	deletion	deletion	NN
10_1101-2021_01_06_425657	427	9	of	of	IN
10_1101-2021_01_06_425657	427	10	the	the	DT
10_1101-2021_01_06_425657	427	11	first	first	JJ
10_1101-2021_01_06_425657	427	12	twenty	twenty	CD
10_1101-2021_01_06_425657	427	13	amino	amino	JJ
10_1101-2021_01_06_425657	427	14	acids	acid	NNS
10_1101-2021_01_06_425657	427	15	of	of	IN
10_1101-2021_01_06_425657	427	16	757	757	CD
10_1101-2021_01_06_425657	427	17	Met30	Met30	NNP
10_1101-2021_01_06_425657	427	18	(	(	-LRB-
10_1101-2021_01_06_425657	427	19	which	which	WDT
10_1101-2021_01_06_425657	427	20	contain	contain	VBP
10_1101-2021_01_06_425657	427	21	the	the	DT
10_1101-2021_01_06_425657	427	22	first	first	JJ
10_1101-2021_01_06_425657	427	23	three	three	CD
10_1101-2021_01_06_425657	427	24	methionine	methionine	NN
10_1101-2021_01_06_425657	427	25	residues	residue	NNS
10_1101-2021_01_06_425657	427	26	)	)	-RRB-
10_1101-2021_01_06_425657	427	27	or	or	CC
10_1101-2021_01_06_425657	427	28	have	have	VB
10_1101-2021_01_06_425657	427	29	the	the	DT
10_1101-2021_01_06_425657	427	30	subsequent	subsequent	JJ
10_1101-2021_01_06_425657	427	31	three	three	CD
10_1101-2021_01_06_425657	427	32	methionine	methionine	JJ
10_1101-2021_01_06_425657	427	33	758	758	CD
10_1101-2021_01_06_425657	427	34	residues	residue	NNS
10_1101-2021_01_06_425657	427	35	(	(	-LRB-
10_1101-2021_01_06_425657	427	36	M30/35/36	M30/35/36	NNP
10_1101-2021_01_06_425657	427	37	)	)	-RRB-
10_1101-2021_01_06_425657	427	38	mutated	mutate	VBD
10_1101-2021_01_06_425657	427	39	to	to	TO
10_1101-2021_01_06_425657	427	40	alanine	alanine	VB
10_1101-2021_01_06_425657	427	41	do	do	VBP
10_1101-2021_01_06_425657	427	42	not	not	RB
10_1101-2021_01_06_425657	427	43	create	create	VB
10_1101-2021_01_06_425657	427	44	faster	fast	RBR
10_1101-2021_01_06_425657	427	45	-	-	HYPH
10_1101-2021_01_06_425657	427	46	migrating	migrate	VBG
10_1101-2021_01_06_425657	427	47	proteoforms	proteoform	NNS
10_1101-2021_01_06_425657	427	48	.	.	.
10_1101-2021_01_06_425657	428	1	759	759	CD
10_1101-2021_01_06_425657	428	2	(	(	-LRB-
10_1101-2021_01_06_425657	428	3	E	e	NN
10_1101-2021_01_06_425657	428	4	)	)	-RRB-
10_1101-2021_01_06_425657	428	5	Met30(D1	met30(d1	NN
10_1101-2021_01_06_425657	428	6	-	-	HYPH
10_1101-2021_01_06_425657	428	7	20aa	20aa	NN
10_1101-2021_01_06_425657	428	8	)	)	-RRB-
10_1101-2021_01_06_425657	428	9	and	and	CC
10_1101-2021_01_06_425657	428	10	Met30(M30/35/36A	met30(m30/35/36a	NN
10_1101-2021_01_06_425657	428	11	)	)	-RRB-
10_1101-2021_01_06_425657	428	12	strains	strain	NNS
10_1101-2021_01_06_425657	428	13	do	do	VBP
10_1101-2021_01_06_425657	428	14	not	not	RB
10_1101-2021_01_06_425657	428	15	exhibit	exhibit	VB
10_1101-2021_01_06_425657	428	16	any	any	DT
10_1101-2021_01_06_425657	428	17	growth	growth	NN
10_1101-2021_01_06_425657	428	18	phenotypes	phenotype	NNS
10_1101-2021_01_06_425657	428	19	in	in	IN
10_1101-2021_01_06_425657	428	20	760	760	CD
10_1101-2021_01_06_425657	428	21	−sulfur	−sulfur	CD
10_1101-2021_01_06_425657	428	22	glucose	glucose	VBP
10_1101-2021_01_06_425657	428	23	media	medium	NNS
10_1101-2021_01_06_425657	428	24	with	with	IN
10_1101-2021_01_06_425657	428	25	or	or	CC
10_1101-2021_01_06_425657	428	26	without	without	IN
10_1101-2021_01_06_425657	428	27	supplemented	supplemented	JJ
10_1101-2021_01_06_425657	428	28	methionine	methionine	NN
10_1101-2021_01_06_425657	428	29	.	.	.
10_1101-2021_01_06_425657	429	1	There	there	EX
10_1101-2021_01_06_425657	429	2	are	be	VBP
10_1101-2021_01_06_425657	429	3	also	also	RB
10_1101-2021_01_06_425657	429	4	no	no	DT
10_1101-2021_01_06_425657	429	5	defects	defect	NNS
10_1101-2021_01_06_425657	429	6	in	in	IN
10_1101-2021_01_06_425657	429	7	761	761	CD
10_1101-2021_01_06_425657	429	8	growth	growth	NN
10_1101-2021_01_06_425657	429	9	rate	rate	NN
10_1101-2021_01_06_425657	429	10	following	follow	VBG
10_1101-2021_01_06_425657	429	11	repletion	repletion	NN
10_1101-2021_01_06_425657	429	12	of	of	IN
10_1101-2021_01_06_425657	429	13	methionine	methionine	NNP
10_1101-2021_01_06_425657	429	14	.	.	.
10_1101-2021_01_06_425657	430	1	Data	datum	NNS
10_1101-2021_01_06_425657	430	2	represent	represent	VBP
10_1101-2021_01_06_425657	430	3	mean	mean	NN
10_1101-2021_01_06_425657	430	4	and	and	CC
10_1101-2021_01_06_425657	430	5	SD	sd	NN
10_1101-2021_01_06_425657	430	6	of	of	IN
10_1101-2021_01_06_425657	430	7	technical	technical	JJ
10_1101-2021_01_06_425657	430	8	triplicates	triplicate	NNS
10_1101-2021_01_06_425657	430	9	.	.	.
10_1101-2021_01_06_425657	431	1	762	762	CD
10_1101-2021_01_06_425657	431	2	763	763	CD
10_1101-2021_01_06_425657	431	3	Figure	figure	NN
10_1101-2021_01_06_425657	431	4	S2	s2	NN
10_1101-2021_01_06_425657	431	5	.	.	.
10_1101-2021_01_06_425657	432	1	Identification	identification	NN
10_1101-2021_01_06_425657	432	2	of	of	IN
10_1101-2021_01_06_425657	432	3	key	key	JJ
10_1101-2021_01_06_425657	432	4	cysteine	cysteine	NN
10_1101-2021_01_06_425657	432	5	residues	residue	NNS
10_1101-2021_01_06_425657	432	6	in	in	IN
10_1101-2021_01_06_425657	432	7	Met30	Met30	NNP
10_1101-2021_01_06_425657	432	8	involved	involve	VBN
10_1101-2021_01_06_425657	432	9	specifically	specifically	RB
10_1101-2021_01_06_425657	432	10	in	in	IN
10_1101-2021_01_06_425657	432	11	sulfur	sulfur	NN
10_1101-2021_01_06_425657	432	12	764	764	CD
10_1101-2021_01_06_425657	432	13	amino	amino	NN
10_1101-2021_01_06_425657	432	14	acid	acid	NN
10_1101-2021_01_06_425657	432	15	sensing	sensing	NN
10_1101-2021_01_06_425657	432	16	.	.	.
10_1101-2021_01_06_425657	433	1	765	765	CD
10_1101-2021_01_06_425657	433	2	(	(	-LRB-
10_1101-2021_01_06_425657	433	3	A	a	NN
10_1101-2021_01_06_425657	433	4	)	)	-RRB-
10_1101-2021_01_06_425657	433	5	Schematic	schematic	JJ
10_1101-2021_01_06_425657	433	6	of	of	IN
10_1101-2021_01_06_425657	433	7	Met30	Met30	NNP
10_1101-2021_01_06_425657	433	8	protein	protein	NN
10_1101-2021_01_06_425657	433	9	architecture	architecture	NN
10_1101-2021_01_06_425657	433	10	and	and	CC
10_1101-2021_01_06_425657	433	11	cysteine	cysteine	JJ
10_1101-2021_01_06_425657	433	12	residue	residue	NN
10_1101-2021_01_06_425657	433	13	location	location	NN
10_1101-2021_01_06_425657	433	14	.	.	.
10_1101-2021_01_06_425657	434	1	766	766	CD
10_1101-2021_01_06_425657	434	2	(	(	-LRB-
10_1101-2021_01_06_425657	434	3	B	b	NN
10_1101-2021_01_06_425657	434	4	)	)	-RRB-
10_1101-2021_01_06_425657	434	5	Western	western	JJ
10_1101-2021_01_06_425657	434	6	blot	blot	NN
10_1101-2021_01_06_425657	434	7	analysis	analysis	NN
10_1101-2021_01_06_425657	434	8	of	of	IN
10_1101-2021_01_06_425657	434	9	various	various	JJ
10_1101-2021_01_06_425657	434	10	Met30	Met30	NNP
10_1101-2021_01_06_425657	434	11	cysteine	cysteine	NN
10_1101-2021_01_06_425657	434	12	point	point	NN
10_1101-2021_01_06_425657	434	13	mutants	mutant	NNS
10_1101-2021_01_06_425657	434	14	and	and	CC
10_1101-2021_01_06_425657	434	15	Met4	met4	JJ
10_1101-2021_01_06_425657	434	16	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	434	17	status	status	NN
10_1101-2021_01_06_425657	434	18	767	767	CD
10_1101-2021_01_06_425657	434	19	in	in	IN
10_1101-2021_01_06_425657	434	20	rich	rich	JJ
10_1101-2021_01_06_425657	434	21	and	and	CC
10_1101-2021_01_06_425657	434	22	−sulfur	−sulfur	JJ
10_1101-2021_01_06_425657	434	23	media	medium	NNS
10_1101-2021_01_06_425657	434	24	.	.	.
10_1101-2021_01_06_425657	435	1	768	768	CD
10_1101-2021_01_06_425657	435	2	(	(	-LRB-
10_1101-2021_01_06_425657	435	3	C	C	NNP
10_1101-2021_01_06_425657	435	4	)	)	-RRB-
10_1101-2021_01_06_425657	435	5	Western	western	JJ
10_1101-2021_01_06_425657	435	6	blot	blot	NN
10_1101-2021_01_06_425657	435	7	analysis	analysis	NN
10_1101-2021_01_06_425657	435	8	of	of	IN
10_1101-2021_01_06_425657	435	9	Met30	Met30	NNP
10_1101-2021_01_06_425657	435	10	cysteine	cysteine	NN
10_1101-2021_01_06_425657	435	11	redox	redox	NN
10_1101-2021_01_06_425657	435	12	state	state	NN
10_1101-2021_01_06_425657	435	13	and	and	CC
10_1101-2021_01_06_425657	435	14	Met4	met4	JJ
10_1101-2021_01_06_425657	435	15	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	435	16	status	status	NN
10_1101-2021_01_06_425657	435	17	in	in	IN
10_1101-2021_01_06_425657	435	18	WT	WT	NNP
10_1101-2021_01_06_425657	435	19	and	and	CC
10_1101-2021_01_06_425657	435	20	769	769	CD
10_1101-2021_01_06_425657	435	21	two	two	CD
10_1101-2021_01_06_425657	435	22	cysteine	cysteine	NN
10_1101-2021_01_06_425657	435	23	to	to	IN
10_1101-2021_01_06_425657	435	24	serine	serine	JJ
10_1101-2021_01_06_425657	435	25	mutants	mutant	NNS
10_1101-2021_01_06_425657	435	26	,	,	,
10_1101-2021_01_06_425657	435	27	C414S	C414S	NNP
10_1101-2021_01_06_425657	435	28	and	and	CC
10_1101-2021_01_06_425657	435	29	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	435	30	,	,	,
10_1101-2021_01_06_425657	435	31	following	follow	VBG
10_1101-2021_01_06_425657	435	32	treatment	treatment	NN
10_1101-2021_01_06_425657	435	33	with	with	IN
10_1101-2021_01_06_425657	435	34	500	500	CD
10_1101-2021_01_06_425657	435	35	µM	µM	NNP
10_1101-2021_01_06_425657	435	36	770	770	CD
10_1101-2021_01_06_425657	435	37	CdCl2	cdcl2	CD
10_1101-2021_01_06_425657	435	38	.	.	.
10_1101-2021_01_06_425657	436	1	771	771	CD
10_1101-2021_01_06_425657	436	2	772	772	CD
10_1101-2021_01_06_425657	436	3	Figure	Figure	NNP
10_1101-2021_01_06_425657	436	4	S3	S3	NNP
10_1101-2021_01_06_425657	436	5	.	.	.
10_1101-2021_01_06_425657	437	1	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	437	2	IP	IP	NNP
10_1101-2021_01_06_425657	437	3	/	/	SYM
10_1101-2021_01_06_425657	437	4	in	in	IN
10_1101-2021_01_06_425657	437	5	vitro	vitro	FW
10_1101-2021_01_06_425657	437	6	ubiquitination	ubiquitination	NNP
10_1101-2021_01_06_425657	437	7	assay	assay	NNP
10_1101-2021_01_06_425657	437	8	demonstrating	demonstrate	VBG
10_1101-2021_01_06_425657	437	9	the	the	DT
10_1101-2021_01_06_425657	437	10	dependence	dependence	NN
10_1101-2021_01_06_425657	437	11	of	of	IN
10_1101-2021_01_06_425657	437	12	773	773	CD
10_1101-2021_01_06_425657	437	13	reducing	reduce	VBG
10_1101-2021_01_06_425657	437	14	agent	agent	NN
10_1101-2021_01_06_425657	437	15	in	in	IN
10_1101-2021_01_06_425657	437	16	the	the	DT
10_1101-2021_01_06_425657	437	17	IP	IP	NNP
10_1101-2021_01_06_425657	437	18	on	on	IN
10_1101-2021_01_06_425657	437	19	SCFMet30	SCFMet30	NNP
10_1101-2021_01_06_425657	437	20	E3	E3	NNP
10_1101-2021_01_06_425657	437	21	ligase	ligase	NN
10_1101-2021_01_06_425657	437	22	activity	activity	NN
10_1101-2021_01_06_425657	437	23	.	.	.
10_1101-2021_01_06_425657	438	1	774	774	LS
10_1101-2021_01_06_425657	438	2	(	(	-LRB-
10_1101-2021_01_06_425657	438	3	A	a	NN
10_1101-2021_01_06_425657	438	4	)	)	-RRB-
10_1101-2021_01_06_425657	438	5	Initial	initial	JJ
10_1101-2021_01_06_425657	438	6	IPs	ip	NNS
10_1101-2021_01_06_425657	438	7	for	for	IN
10_1101-2021_01_06_425657	438	8	SCFMet30-Flag	scfmet30-flag	NN
10_1101-2021_01_06_425657	438	9	complex	complex	NN
10_1101-2021_01_06_425657	438	10	were	be	VBD
10_1101-2021_01_06_425657	438	11	performed	perform	VBN
10_1101-2021_01_06_425657	438	12	in	in	IN
10_1101-2021_01_06_425657	438	13	the	the	DT
10_1101-2021_01_06_425657	438	14	presence	presence	NN
10_1101-2021_01_06_425657	438	15	of	of	IN
10_1101-2021_01_06_425657	438	16	1	1	CD
10_1101-2021_01_06_425657	438	17	mM	mM	NNP
10_1101-2021_01_06_425657	438	18	DTT	DTT	NNP
10_1101-2021_01_06_425657	438	19	prior	prior	RB
10_1101-2021_01_06_425657	438	20	to	to	IN
10_1101-2021_01_06_425657	438	21	775	775	CD
10_1101-2021_01_06_425657	438	22	Flag	Flag	NNP
10_1101-2021_01_06_425657	438	23	peptide	peptide	NN
10_1101-2021_01_06_425657	438	24	elution	elution	NN
10_1101-2021_01_06_425657	438	25	and	and	CC
10_1101-2021_01_06_425657	438	26	concentration	concentration	NN
10_1101-2021_01_06_425657	438	27	.	.	.
10_1101-2021_01_06_425657	439	1	No	no	DT
10_1101-2021_01_06_425657	439	2	DTT	DTT	NNP
10_1101-2021_01_06_425657	439	3	was	be	VBD
10_1101-2021_01_06_425657	439	4	used	use	VBN
10_1101-2021_01_06_425657	439	5	in	in	IN
10_1101-2021_01_06_425657	439	6	the	the	DT
10_1101-2021_01_06_425657	439	7	in	in	FW
10_1101-2021_01_06_425657	439	8	vitro	vitro	FW
10_1101-2021_01_06_425657	439	9	ubiquitination	ubiquitination	NNP
10_1101-2021_01_06_425657	439	10	assay	assay	NNP
10_1101-2021_01_06_425657	439	11	itself	-PRON-	PRP
10_1101-2021_01_06_425657	439	12	,	,	,
10_1101-2021_01_06_425657	439	13	776	776	CD
10_1101-2021_01_06_425657	439	14	yet	yet	CC
10_1101-2021_01_06_425657	439	15	the	the	DT
10_1101-2021_01_06_425657	439	16	E3	e3	JJ
10_1101-2021_01_06_425657	439	17	ligase	ligase	NN
10_1101-2021_01_06_425657	439	18	activities	activity	NNS
10_1101-2021_01_06_425657	439	19	for	for	IN
10_1101-2021_01_06_425657	439	20	the	the	DT
10_1101-2021_01_06_425657	439	21	E3	e3	RBS
10_1101-2021_01_06_425657	439	22	complex	complex	NN
10_1101-2021_01_06_425657	439	23	were	be	VBD
10_1101-2021_01_06_425657	439	24	indistinguishable	indistinguishable	JJ
10_1101-2021_01_06_425657	439	25	between	between	IN
10_1101-2021_01_06_425657	439	26	complex	complex	NN
10_1101-2021_01_06_425657	439	27	isolated	isolate	VBN
10_1101-2021_01_06_425657	439	28	777	777	CD
10_1101-2021_01_06_425657	439	29	from	from	IN
10_1101-2021_01_06_425657	439	30	high	high	JJ
10_1101-2021_01_06_425657	439	31	sulfur	sulfur	NN
10_1101-2021_01_06_425657	439	32	versus	versus	IN
10_1101-2021_01_06_425657	439	33	low	low	JJ
10_1101-2021_01_06_425657	439	34	sulfur	sulfur	NN
10_1101-2021_01_06_425657	439	35	cells	cell	NNS
10_1101-2021_01_06_425657	439	36	.	.	.
10_1101-2021_01_06_425657	440	1	778	778	CD
10_1101-2021_01_06_425657	440	2	(	(	-LRB-
10_1101-2021_01_06_425657	440	3	B	B	NNP
10_1101-2021_01_06_425657	440	4	)	)	-RRB-
10_1101-2021_01_06_425657	440	5	The	the	DT
10_1101-2021_01_06_425657	440	6	same	same	JJ
10_1101-2021_01_06_425657	440	7	IP	IP	NNP
10_1101-2021_01_06_425657	440	8	/	/	,
10_1101-2021_01_06_425657	440	9	in	in	IN
10_1101-2021_01_06_425657	440	10	vitro	vitro	FW
10_1101-2021_01_06_425657	440	11	assay	assay	NNP
10_1101-2021_01_06_425657	440	12	as	as	IN
10_1101-2021_01_06_425657	440	13	in	in	IN
10_1101-2021_01_06_425657	440	14	(	(	-LRB-
10_1101-2021_01_06_425657	440	15	A	a	NN
10_1101-2021_01_06_425657	440	16	)	)	-RRB-
10_1101-2021_01_06_425657	440	17	,	,	,
10_1101-2021_01_06_425657	440	18	with	with	IN
10_1101-2021_01_06_425657	440	19	the	the	DT
10_1101-2021_01_06_425657	440	20	sole	sole	JJ
10_1101-2021_01_06_425657	440	21	exception	exception	NN
10_1101-2021_01_06_425657	440	22	that	that	WDT
10_1101-2021_01_06_425657	440	23	DTT	DTT	NNP
10_1101-2021_01_06_425657	440	24	was	be	VBD
10_1101-2021_01_06_425657	440	25	not	not	RB
10_1101-2021_01_06_425657	440	26	included	include	VBN
10_1101-2021_01_06_425657	440	27	during	during	IN
10_1101-2021_01_06_425657	440	28	779	779	CD
10_1101-2021_01_06_425657	440	29	the	the	DT
10_1101-2021_01_06_425657	440	30	IP	IP	NNP
10_1101-2021_01_06_425657	440	31	and	and	CC
10_1101-2021_01_06_425657	440	32	wash	wash	VB
10_1101-2021_01_06_425657	440	33	steps	step	NNS
10_1101-2021_01_06_425657	440	34	.	.	.
10_1101-2021_01_06_425657	441	1	780	780	CD
10_1101-2021_01_06_425657	441	2	(	(	-LRB-
10_1101-2021_01_06_425657	441	3	C	C	NNP
10_1101-2021_01_06_425657	441	4	)	)	-RRB-
10_1101-2021_01_06_425657	441	5	Silver	silver	NN
10_1101-2021_01_06_425657	441	6	stains	stain	NNS
10_1101-2021_01_06_425657	441	7	of	of	IN
10_1101-2021_01_06_425657	441	8	immunopurified	immunopurifie	VBN
10_1101-2021_01_06_425657	441	9	SCFMet30-Flag	scfmet30-flag	NN
10_1101-2021_01_06_425657	441	10	complex	complex	NN
10_1101-2021_01_06_425657	441	11	isolated	isolate	VBN
10_1101-2021_01_06_425657	441	12	from	from	IN
10_1101-2021_01_06_425657	441	13	rich	rich	JJ
10_1101-2021_01_06_425657	441	14	and	and	CC
10_1101-2021_01_06_425657	441	15	−sulfur	−sulfur	JJ
10_1101-2021_01_06_425657	441	16	cells	cell	NNS
10_1101-2021_01_06_425657	441	17	781	781	CD
10_1101-2021_01_06_425657	441	18	prepared	prepare	VBD
10_1101-2021_01_06_425657	441	19	in	in	IN
10_1101-2021_01_06_425657	441	20	the	the	DT
10_1101-2021_01_06_425657	441	21	presence	presence	NN
10_1101-2021_01_06_425657	441	22	or	or	CC
10_1101-2021_01_06_425657	441	23	absence	absence	NN
10_1101-2021_01_06_425657	441	24	of	of	IN
10_1101-2021_01_06_425657	441	25	DTT	DTT	NNP
10_1101-2021_01_06_425657	441	26	used	use	VBN
10_1101-2021_01_06_425657	441	27	in	in	IN
10_1101-2021_01_06_425657	441	28	Figures	figure	NNS
10_1101-2021_01_06_425657	441	29	4B	4b	NN
10_1101-2021_01_06_425657	441	30	and	and	CC
10_1101-2021_01_06_425657	441	31	C.	C.	NNP
10_1101-2021_01_06_425657	441	32	782	782	NNP
10_1101-2021_01_06_425657	441	33	(	(	-LRB-
10_1101-2021_01_06_425657	441	34	D	d	NN
10_1101-2021_01_06_425657	441	35	)	)	-RRB-
10_1101-2021_01_06_425657	441	36	Western	western	JJ
10_1101-2021_01_06_425657	441	37	blot	blot	NN
10_1101-2021_01_06_425657	441	38	of	of	IN
10_1101-2021_01_06_425657	441	39	Cdc53	Cdc53	NNP
10_1101-2021_01_06_425657	441	40	amounts	amount	VBZ
10_1101-2021_01_06_425657	441	41	from	from	IN
10_1101-2021_01_06_425657	441	42	immunopurified	immunopurifie	VBN
10_1101-2021_01_06_425657	441	43	SCFMet30-Flag	scfmet30-flag	NN
10_1101-2021_01_06_425657	441	44	complex	complex	JJ
10_1101-2021_01_06_425657	441	45	shown	show	VBN
10_1101-2021_01_06_425657	441	46	in	in	IN
10_1101-2021_01_06_425657	441	47	S2C	s2c	CD
10_1101-2021_01_06_425657	441	48	783	783	CD
10_1101-2021_01_06_425657	441	49	and	and	CC
10_1101-2021_01_06_425657	441	50	used	use	VBN
10_1101-2021_01_06_425657	441	51	in	in	IN
10_1101-2021_01_06_425657	441	52	Figures	figure	NNS
10_1101-2021_01_06_425657	441	53	4B	4b	NN
10_1101-2021_01_06_425657	441	54	and	and	CC
10_1101-2021_01_06_425657	441	55	C.	C.	NNP
10_1101-2021_01_06_425657	441	56	We	-PRON-	PRP
10_1101-2021_01_06_425657	441	57	speculate	speculate	VBP
10_1101-2021_01_06_425657	441	58	the	the	DT
10_1101-2021_01_06_425657	441	59	reduced	reduce	VBN
10_1101-2021_01_06_425657	441	60	Cdc53	Cdc53	NNP
10_1101-2021_01_06_425657	441	61	abundance	abundance	NN
10_1101-2021_01_06_425657	441	62	in	in	IN
10_1101-2021_01_06_425657	441	63	the	the	DT
10_1101-2021_01_06_425657	441	64	−sulfur	−sulfur	NNS
10_1101-2021_01_06_425657	441	65	,	,	,
10_1101-2021_01_06_425657	441	66	−DTT	−DTT	NNP
10_1101-2021_01_06_425657	441	67	784	784	CD
10_1101-2021_01_06_425657	441	68	IP	IP	NNP
10_1101-2021_01_06_425657	441	69	is	be	VBZ
10_1101-2021_01_06_425657	441	70	the	the	DT
10_1101-2021_01_06_425657	441	71	result	result	NN
10_1101-2021_01_06_425657	441	72	of	of	IN
10_1101-2021_01_06_425657	441	73	the	the	DT
10_1101-2021_01_06_425657	441	74	canonical	canonical	JJ
10_1101-2021_01_06_425657	441	75	regulation	regulation	NN
10_1101-2021_01_06_425657	441	76	of	of	IN
10_1101-2021_01_06_425657	441	77	SCF	SCF	NNP
10_1101-2021_01_06_425657	441	78	E3	e3	NN
10_1101-2021_01_06_425657	441	79	ligases	ligase	NNS
10_1101-2021_01_06_425657	441	80	,	,	,
10_1101-2021_01_06_425657	441	81	which	which	WDT
10_1101-2021_01_06_425657	441	82	causes	cause	VBZ
10_1101-2021_01_06_425657	441	83	reduced	reduce	VBN
10_1101-2021_01_06_425657	441	84	association	association	NN
10_1101-2021_01_06_425657	441	85	785	785	CD
10_1101-2021_01_06_425657	441	86	.CC	.CC	,
10_1101-2021_01_06_425657	441	87	-	-	:
10_1101-2021_01_06_425657	441	88	BY	by	IN
10_1101-2021_01_06_425657	441	89	4.0	4.0	CD
10_1101-2021_01_06_425657	441	90	International	International	NNP
10_1101-2021_01_06_425657	441	91	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	441	92	under	under	IN
10_1101-2021_01_06_425657	441	93	a	a	DT
10_1101-2021_01_06_425657	441	94	(	(	-LRB-
10_1101-2021_01_06_425657	441	95	which	which	WDT
10_1101-2021_01_06_425657	441	96	was	be	VBD
10_1101-2021_01_06_425657	441	97	not	not	RB
10_1101-2021_01_06_425657	441	98	certified	certify	VBN
10_1101-2021_01_06_425657	441	99	by	by	IN
10_1101-2021_01_06_425657	441	100	peer	peer	NN
10_1101-2021_01_06_425657	441	101	review	review	NN
10_1101-2021_01_06_425657	441	102	)	)	-RRB-
10_1101-2021_01_06_425657	441	103	is	be	VBZ
10_1101-2021_01_06_425657	441	104	the	the	DT
10_1101-2021_01_06_425657	441	105	author	author	NN
10_1101-2021_01_06_425657	441	106	/	/	SYM
10_1101-2021_01_06_425657	441	107	funder	funder	NN
10_1101-2021_01_06_425657	441	108	,	,	,
10_1101-2021_01_06_425657	441	109	who	who	WP
10_1101-2021_01_06_425657	441	110	has	have	VBZ
10_1101-2021_01_06_425657	441	111	granted	grant	VBN
10_1101-2021_01_06_425657	441	112	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	441	113	a	a	DT
10_1101-2021_01_06_425657	441	114	license	license	NN
10_1101-2021_01_06_425657	441	115	to	to	TO
10_1101-2021_01_06_425657	441	116	display	display	VB
10_1101-2021_01_06_425657	441	117	the	the	DT
10_1101-2021_01_06_425657	441	118	preprint	preprint	NN
10_1101-2021_01_06_425657	441	119	in	in	IN
10_1101-2021_01_06_425657	441	120	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	441	121	.	.	.
10_1101-2021_01_06_425657	442	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	442	2	is	be	VBZ
10_1101-2021_01_06_425657	442	3	made	make	VBN
10_1101-2021_01_06_425657	442	4	The	the	DT
10_1101-2021_01_06_425657	442	5	copyright	copyright	NN
10_1101-2021_01_06_425657	442	6	holder	holder	NN
10_1101-2021_01_06_425657	442	7	for	for	IN
10_1101-2021_01_06_425657	442	8	this	this	DT
10_1101-2021_01_06_425657	442	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	442	10	version	version	NN
10_1101-2021_01_06_425657	442	11	posted	post	VBD
10_1101-2021_01_06_425657	442	12	January	January	NNP
10_1101-2021_01_06_425657	442	13	7	7	CD
10_1101-2021_01_06_425657	442	14	,	,	,
10_1101-2021_01_06_425657	442	15	2021	2021	CD
10_1101-2021_01_06_425657	442	16	.	.	.
10_1101-2021_01_06_425657	442	17	;	;	:
10_1101-2021_01_06_425657	442	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	442	19	:	:	:
10_1101-2021_01_06_425657	442	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	442	21	preprint	preprint	NN
10_1101-2021_01_06_425657	442	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	442	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	442	24	23	23	CD
10_1101-2021_01_06_425657	442	25	between	between	IN
10_1101-2021_01_06_425657	442	26	Skp1	Skp1	NNP
10_1101-2021_01_06_425657	442	27	/	/	SYM
10_1101-2021_01_06_425657	442	28	F	F	NNP
10_1101-2021_01_06_425657	442	29	-	-	HYPH
10_1101-2021_01_06_425657	442	30	box	box	NNP
10_1101-2021_01_06_425657	442	31	heterodimers	heterodimer	NNS
10_1101-2021_01_06_425657	442	32	to	to	IN
10_1101-2021_01_06_425657	442	33	the	the	DT
10_1101-2021_01_06_425657	442	34	Cdc53	Cdc53	NNP
10_1101-2021_01_06_425657	442	35	scaffold	scaffold	NN
10_1101-2021_01_06_425657	442	36	when	when	WRB
10_1101-2021_01_06_425657	442	37	binding	bind	VBG
10_1101-2021_01_06_425657	442	38	between	between	IN
10_1101-2021_01_06_425657	442	39	the	the	DT
10_1101-2021_01_06_425657	442	40	F	F	NNP
10_1101-2021_01_06_425657	442	41	-	-	HYPH
10_1101-2021_01_06_425657	442	42	box	box	NNP
10_1101-2021_01_06_425657	442	43	and	and	CC
10_1101-2021_01_06_425657	442	44	its	-PRON-	PRP$
10_1101-2021_01_06_425657	442	45	786	786	CD
10_1101-2021_01_06_425657	442	46	substrate	substrate	NN
10_1101-2021_01_06_425657	442	47	is	be	VBZ
10_1101-2021_01_06_425657	442	48	reduced	reduce	VBN
10_1101-2021_01_06_425657	442	49	.	.	.
10_1101-2021_01_06_425657	443	1	787	787	CD
10_1101-2021_01_06_425657	443	2	788	788	CD
10_1101-2021_01_06_425657	443	3	Figure	figure	NN
10_1101-2021_01_06_425657	443	4	S4	s4	NN
10_1101-2021_01_06_425657	443	5	.	.	.
10_1101-2021_01_06_425657	444	1	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	444	2	IP	IP	NNP
10_1101-2021_01_06_425657	444	3	/	/	SYM
10_1101-2021_01_06_425657	444	4	in	in	IN
10_1101-2021_01_06_425657	444	5	vitro	vitro	FW
10_1101-2021_01_06_425657	444	6	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	444	7	assay	assay	NNP
10_1101-2021_01_06_425657	444	8	using	use	VBG
10_1101-2021_01_06_425657	444	9	Met30	Met30	NNP
10_1101-2021_01_06_425657	444	10	cysteine	cysteine	NN
10_1101-2021_01_06_425657	444	11	point	point	NN
10_1101-2021_01_06_425657	444	12	mutants	mutant	NNS
10_1101-2021_01_06_425657	444	13	789	789	CD
10_1101-2021_01_06_425657	444	14	(	(	-LRB-
10_1101-2021_01_06_425657	444	15	A	a	NN
10_1101-2021_01_06_425657	444	16	)	)	-RRB-
10_1101-2021_01_06_425657	444	17	In	in	IN
10_1101-2021_01_06_425657	444	18	vitro	vitro	FW
10_1101-2021_01_06_425657	444	19	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	444	20	assays	assays	RB
10_1101-2021_01_06_425657	444	21	were	be	VBD
10_1101-2021_01_06_425657	444	22	carried	carry	VBN
10_1101-2021_01_06_425657	444	23	out	out	RP
10_1101-2021_01_06_425657	444	24	as	as	IN
10_1101-2021_01_06_425657	444	25	described	describe	VBN
10_1101-2021_01_06_425657	444	26	in	in	IN
10_1101-2021_01_06_425657	444	27	Figure	Figure	NNP
10_1101-2021_01_06_425657	444	28	4B	4b	NN
10_1101-2021_01_06_425657	444	29	with	with	IN
10_1101-2021_01_06_425657	444	30	cell	cell	NN
10_1101-2021_01_06_425657	444	31	lysate	lysate	NN
10_1101-2021_01_06_425657	444	32	790	790	CD
10_1101-2021_01_06_425657	444	33	powder	powder	NN
10_1101-2021_01_06_425657	444	34	from	from	IN
10_1101-2021_01_06_425657	444	35	WT	WT	NNP
10_1101-2021_01_06_425657	444	36	,	,	,
10_1101-2021_01_06_425657	444	37	C414S	C414S	NNP
10_1101-2021_01_06_425657	444	38	,	,	,
10_1101-2021_01_06_425657	444	39	and	and	CC
10_1101-2021_01_06_425657	444	40	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	444	41	Met30	Met30	NNP
10_1101-2021_01_06_425657	444	42	strains	strain	VBZ
10_1101-2021_01_06_425657	444	43	grown	grow	VBN
10_1101-2021_01_06_425657	444	44	in	in	IN
10_1101-2021_01_06_425657	444	45	rich	rich	JJ
10_1101-2021_01_06_425657	444	46	media	medium	NNS
10_1101-2021_01_06_425657	444	47	.	.	.
10_1101-2021_01_06_425657	445	1	The	the	DT
10_1101-2021_01_06_425657	445	2	heavier	heavy	JJR
10_1101-2021_01_06_425657	445	3	791	791	CD
10_1101-2021_01_06_425657	445	4	loading	loading	NN
10_1101-2021_01_06_425657	445	5	of	of	IN
10_1101-2021_01_06_425657	445	6	the	the	DT
10_1101-2021_01_06_425657	445	7	C414S	C414S	NNP
10_1101-2021_01_06_425657	445	8	mutant	mutant	NN
10_1101-2021_01_06_425657	445	9	is	be	VBZ
10_1101-2021_01_06_425657	445	10	likely	likely	JJ
10_1101-2021_01_06_425657	445	11	due	due	IN
10_1101-2021_01_06_425657	445	12	to	to	IN
10_1101-2021_01_06_425657	445	13	a	a	DT
10_1101-2021_01_06_425657	445	14	difference	difference	NN
10_1101-2021_01_06_425657	445	15	in	in	IN
10_1101-2021_01_06_425657	445	16	cryomill	cryomill	NN
10_1101-2021_01_06_425657	445	17	lysis	lysis	NN
10_1101-2021_01_06_425657	445	18	efficiency	efficiency	NN
10_1101-2021_01_06_425657	445	19	,	,	,
10_1101-2021_01_06_425657	445	20	and	and	CC
10_1101-2021_01_06_425657	445	21	is	be	VBZ
10_1101-2021_01_06_425657	445	22	not	not	RB
10_1101-2021_01_06_425657	445	23	a	a	DT
10_1101-2021_01_06_425657	445	24	792	792	CD
10_1101-2021_01_06_425657	445	25	difference	difference	NN
10_1101-2021_01_06_425657	445	26	in	in	IN
10_1101-2021_01_06_425657	445	27	the	the	DT
10_1101-2021_01_06_425657	445	28	amount	amount	NN
10_1101-2021_01_06_425657	445	29	of	of	IN
10_1101-2021_01_06_425657	445	30	starting	start	VBG
10_1101-2021_01_06_425657	445	31	material	material	NN
10_1101-2021_01_06_425657	445	32	used	use	VBN
10_1101-2021_01_06_425657	445	33	.	.	.
10_1101-2021_01_06_425657	446	1	793	793	CD
10_1101-2021_01_06_425657	446	2	(	(	-LRB-
10_1101-2021_01_06_425657	446	3	B	b	NN
10_1101-2021_01_06_425657	446	4	)	)	-RRB-
10_1101-2021_01_06_425657	446	5	Met4	met4	NN
10_1101-2021_01_06_425657	446	6	binding	binding	NN
10_1101-2021_01_06_425657	446	7	was	be	VBD
10_1101-2021_01_06_425657	446	8	assessed	assess	VBN
10_1101-2021_01_06_425657	446	9	in	in	IN
10_1101-2021_01_06_425657	446	10	the	the	DT
10_1101-2021_01_06_425657	446	11	C414S	C414S	NNP
10_1101-2021_01_06_425657	446	12	and	and	CC
10_1101-2021_01_06_425657	446	13	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	446	14	mutants	mutant	NNS
10_1101-2021_01_06_425657	446	15	as	as	IN
10_1101-2021_01_06_425657	446	16	described	describe	VBN
10_1101-2021_01_06_425657	446	17	in	in	IN
10_1101-2021_01_06_425657	446	18	794	794	CD
10_1101-2021_01_06_425657	446	19	Figure	Figure	NNP
10_1101-2021_01_06_425657	446	20	4D	4d	NN
10_1101-2021_01_06_425657	446	21	using	use	VBG
10_1101-2021_01_06_425657	446	22	cell	cell	NN
10_1101-2021_01_06_425657	446	23	lysate	lysate	NN
10_1101-2021_01_06_425657	446	24	powder	powder	NN
10_1101-2021_01_06_425657	446	25	from	from	IN
10_1101-2021_01_06_425657	446	26	cells	cell	NNS
10_1101-2021_01_06_425657	446	27	grown	grow	VBN
10_1101-2021_01_06_425657	446	28	in	in	IN
10_1101-2021_01_06_425657	446	29	rich	rich	JJ
10_1101-2021_01_06_425657	446	30	media	medium	NNS
10_1101-2021_01_06_425657	446	31	.	.	.
10_1101-2021_01_06_425657	447	1	The	the	DT
10_1101-2021_01_06_425657	447	2	fold	fold	JJ
10_1101-2021_01_06_425657	447	3	change	change	NN
10_1101-2021_01_06_425657	447	4	in	in	IN
10_1101-2021_01_06_425657	447	5	Met4	Met4	NNP
10_1101-2021_01_06_425657	447	6	795	795	CD
10_1101-2021_01_06_425657	447	7	binding	bind	VBG
10_1101-2021_01_06_425657	447	8	in	in	IN
10_1101-2021_01_06_425657	447	9	the	the	DT
10_1101-2021_01_06_425657	447	10	presence	presence	NN
10_1101-2021_01_06_425657	447	11	and	and	CC
10_1101-2021_01_06_425657	447	12	absence	absence	NN
10_1101-2021_01_06_425657	447	13	of	of	IN
10_1101-2021_01_06_425657	447	14	DTT	DTT	NNP
10_1101-2021_01_06_425657	447	15	was	be	VBD
10_1101-2021_01_06_425657	447	16	quantified	quantify	VBN
10_1101-2021_01_06_425657	447	17	for	for	IN
10_1101-2021_01_06_425657	447	18	each	each	DT
10_1101-2021_01_06_425657	447	19	strain	strain	NN
10_1101-2021_01_06_425657	447	20	and	and	CC
10_1101-2021_01_06_425657	447	21	for	for	IN
10_1101-2021_01_06_425657	447	22	each	each	DT
10_1101-2021_01_06_425657	447	23	Met30	Met30	NNP
10_1101-2021_01_06_425657	447	24	796	796	CD
10_1101-2021_01_06_425657	447	25	immunopurification	immunopurification	NN
10_1101-2021_01_06_425657	447	26	condition	condition	NN
10_1101-2021_01_06_425657	447	27	using	use	VBG
10_1101-2021_01_06_425657	447	28	ImageJ	ImageJ	NNP
10_1101-2021_01_06_425657	447	29	(	(	-LRB-
10_1101-2021_01_06_425657	447	30	version	version	NN
10_1101-2021_01_06_425657	447	31	1.53	1.53	CD
10_1101-2021_01_06_425657	447	32	)	)	-RRB-
10_1101-2021_01_06_425657	447	33	.	.	.
10_1101-2021_01_06_425657	448	1	797	797	CD
10_1101-2021_01_06_425657	448	2	.CC	.CC	:
10_1101-2021_01_06_425657	448	3	-	-	:
10_1101-2021_01_06_425657	448	4	BY	by	IN
10_1101-2021_01_06_425657	448	5	4.0	4.0	CD
10_1101-2021_01_06_425657	448	6	International	International	NNP
10_1101-2021_01_06_425657	448	7	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	448	8	under	under	IN
10_1101-2021_01_06_425657	448	9	a	a	DT
10_1101-2021_01_06_425657	448	10	(	(	-LRB-
10_1101-2021_01_06_425657	448	11	which	which	WDT
10_1101-2021_01_06_425657	448	12	was	be	VBD
10_1101-2021_01_06_425657	448	13	not	not	RB
10_1101-2021_01_06_425657	448	14	certified	certify	VBN
10_1101-2021_01_06_425657	448	15	by	by	IN
10_1101-2021_01_06_425657	448	16	peer	peer	NN
10_1101-2021_01_06_425657	448	17	review	review	NN
10_1101-2021_01_06_425657	448	18	)	)	-RRB-
10_1101-2021_01_06_425657	448	19	is	be	VBZ
10_1101-2021_01_06_425657	448	20	the	the	DT
10_1101-2021_01_06_425657	448	21	author	author	NN
10_1101-2021_01_06_425657	448	22	/	/	SYM
10_1101-2021_01_06_425657	448	23	funder	funder	NN
10_1101-2021_01_06_425657	448	24	,	,	,
10_1101-2021_01_06_425657	448	25	who	who	WP
10_1101-2021_01_06_425657	448	26	has	have	VBZ
10_1101-2021_01_06_425657	448	27	granted	grant	VBN
10_1101-2021_01_06_425657	448	28	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	448	29	a	a	DT
10_1101-2021_01_06_425657	448	30	license	license	NN
10_1101-2021_01_06_425657	448	31	to	to	TO
10_1101-2021_01_06_425657	448	32	display	display	VB
10_1101-2021_01_06_425657	448	33	the	the	DT
10_1101-2021_01_06_425657	448	34	preprint	preprint	NN
10_1101-2021_01_06_425657	448	35	in	in	IN
10_1101-2021_01_06_425657	448	36	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	448	37	.	.	.
10_1101-2021_01_06_425657	449	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	449	2	is	be	VBZ
10_1101-2021_01_06_425657	449	3	made	make	VBN
10_1101-2021_01_06_425657	449	4	The	the	DT
10_1101-2021_01_06_425657	449	5	copyright	copyright	NN
10_1101-2021_01_06_425657	449	6	holder	holder	NN
10_1101-2021_01_06_425657	449	7	for	for	IN
10_1101-2021_01_06_425657	449	8	this	this	DT
10_1101-2021_01_06_425657	449	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	449	10	version	version	NN
10_1101-2021_01_06_425657	449	11	posted	post	VBD
10_1101-2021_01_06_425657	449	12	January	January	NNP
10_1101-2021_01_06_425657	449	13	7	7	CD
10_1101-2021_01_06_425657	449	14	,	,	,
10_1101-2021_01_06_425657	449	15	2021	2021	CD
10_1101-2021_01_06_425657	449	16	.	.	.
10_1101-2021_01_06_425657	449	17	;	;	:
10_1101-2021_01_06_425657	449	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	449	19	:	:	:
10_1101-2021_01_06_425657	449	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	449	21	preprint	preprint	NN
10_1101-2021_01_06_425657	449	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	449	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	449	24	24	24	CD
10_1101-2021_01_06_425657	449	25	Table	table	NN
10_1101-2021_01_06_425657	449	26	S1	S1	NNS
10_1101-2021_01_06_425657	449	27	.	.	.
10_1101-2021_01_06_425657	450	1	Strains	strain	NNS
10_1101-2021_01_06_425657	450	2	used	use	VBN
10_1101-2021_01_06_425657	450	3	in	in	IN
10_1101-2021_01_06_425657	450	4	this	this	DT
10_1101-2021_01_06_425657	450	5	study	study	NN
10_1101-2021_01_06_425657	450	6	.	.	.
10_1101-2021_01_06_425657	451	1	798	798	CD
10_1101-2021_01_06_425657	451	2	BACKGROUND	BACKGROUND	NNP
10_1101-2021_01_06_425657	451	3	GENOTYPE	GENOTYPE	NNP
10_1101-2021_01_06_425657	451	4	SOURCE	SOURCE	NNP
10_1101-2021_01_06_425657	451	5	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	6	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	7	(	(	-LRB-
10_1101-2021_01_06_425657	451	8	van	van	NNP
10_1101-2021_01_06_425657	451	9	Dijken	Dijken	NNP
10_1101-2021_01_06_425657	451	10	et	et	NNP
10_1101-2021_01_06_425657	451	11	al	al	NNP
10_1101-2021_01_06_425657	451	12	.	.	NNP
10_1101-2021_01_06_425657	451	13	,	,	,
10_1101-2021_01_06_425657	451	14	2000	2000	CD
10_1101-2021_01_06_425657	451	15	)	)	-RRB-
10_1101-2021_01_06_425657	451	16	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	17	MATa	MATa	NNP
10_1101-2021_01_06_425657	451	18	(	(	-LRB-
10_1101-2021_01_06_425657	451	19	van	van	NNP
10_1101-2021_01_06_425657	451	20	Dijken	Dijken	NNP
10_1101-2021_01_06_425657	451	21	et	et	NNP
10_1101-2021_01_06_425657	451	22	al	al	NNP
10_1101-2021_01_06_425657	451	23	.	.	NNP
10_1101-2021_01_06_425657	451	24	,	,	,
10_1101-2021_01_06_425657	451	25	2000	2000	CD
10_1101-2021_01_06_425657	451	26	)	)	-RRB-
10_1101-2021_01_06_425657	451	27	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	28	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	29	;	;	:
10_1101-2021_01_06_425657	451	30	MET30-FLAG::KanMX	MET30-FLAG::KanMX	NNS
10_1101-2021_01_06_425657	451	31	This	this	DT
10_1101-2021_01_06_425657	451	32	study	study	NN
10_1101-2021_01_06_425657	451	33	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	34	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	35	;	;	:
10_1101-2021_01_06_425657	451	36	MET30-FLAG::KanMX	MET30-FLAG::KanMX	VBZ
10_1101-2021_01_06_425657	451	37	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	38	This	this	DT
10_1101-2021_01_06_425657	451	39	study	study	NN
10_1101-2021_01_06_425657	451	40	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	41	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	42	;	;	:
10_1101-2021_01_06_425657	451	43	MET30-FLAG::KanMX	MET30-FLAG::KanMX	NNP
10_1101-2021_01_06_425657	451	44	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	45	met6D::Nat	met6D::Nat	NNP
10_1101-2021_01_06_425657	451	46	This	this	DT
10_1101-2021_01_06_425657	451	47	study	study	VB
10_1101-2021_01_06_425657	451	48	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	49	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	50	;	;	:
10_1101-2021_01_06_425657	451	51	MET30-FLAG::KanMX	MET30-FLAG::KanMX	NNP
10_1101-2021_01_06_425657	451	52	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	53	str3D::Nat	str3d::nat	NN
10_1101-2021_01_06_425657	451	54	This	this	DT
10_1101-2021_01_06_425657	451	55	study	study	NN
10_1101-2021_01_06_425657	451	56	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	57	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	58	;	;	:
10_1101-2021_01_06_425657	451	59	met30::MET30-C414S	met30::met30-c414s	NN
10_1101-2021_01_06_425657	451	60	-	-	HYPH
10_1101-2021_01_06_425657	451	61	FLAG::KanMX	flag::kanmx	JJ
10_1101-2021_01_06_425657	451	62	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	63	This	this	DT
10_1101-2021_01_06_425657	451	64	study	study	NN
10_1101-2021_01_06_425657	451	65	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	66	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	67	;	;	:
10_1101-2021_01_06_425657	451	68	met30::MET30-C614/616/622/630S-	met30::met30-c614/616/622/630s-	DT
10_1101-2021_01_06_425657	451	69	FLAG::KanMX	FLAG::KanMX	NNP
10_1101-2021_01_06_425657	451	70	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	71	This	this	DT
10_1101-2021_01_06_425657	451	72	study	study	NN
10_1101-2021_01_06_425657	451	73	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	74	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	75	;	;	:
10_1101-2021_01_06_425657	451	76	met30D::Phleo	met30D::Phleo	NNP
10_1101-2021_01_06_425657	451	77	HO::MET30-FLAG::Nat	HO::MET30-FLAG::Nat	NNP
10_1101-2021_01_06_425657	451	78	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	79	This	this	DT
10_1101-2021_01_06_425657	451	80	study	study	NN
10_1101-2021_01_06_425657	451	81	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	82	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	83	;	;	:
10_1101-2021_01_06_425657	451	84	met30D::Phleo	met30D::Phleo	NNP
10_1101-2021_01_06_425657	451	85	HO::MET30Daa1	HO::MET30Daa1	NNP
10_1101-2021_01_06_425657	451	86	-	-	HYPH
10_1101-2021_01_06_425657	451	87	20-	20-	NNP
10_1101-2021_01_06_425657	451	88	FLAG::Nat	FLAG::Nat	NNP
10_1101-2021_01_06_425657	451	89	Met4-HA::Hyg	Met4-HA::Hyg	NNS
10_1101-2021_01_06_425657	451	90	This	this	DT
10_1101-2021_01_06_425657	451	91	study	study	NN
10_1101-2021_01_06_425657	451	92	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	93	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	94	;	;	:
10_1101-2021_01_06_425657	451	95	met30D::Phleo	met30d::phleo	NN
10_1101-2021_01_06_425657	451	96	HO::MET30-M30/35/36A-	ho::met30-m30/35/36a-	RB
10_1101-2021_01_06_425657	451	97	FLAG::Nat	FLAG::Nat	NNP
10_1101-2021_01_06_425657	451	98	Met4-HA::Hyg	Met4-HA::Hyg	NNS
10_1101-2021_01_06_425657	451	99	This	this	DT
10_1101-2021_01_06_425657	451	100	study	study	NN
10_1101-2021_01_06_425657	451	101	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	102	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	103	;	;	:
10_1101-2021_01_06_425657	451	104	MET30-FLAG::KanMX	MET30-FLAG::KanMX	NNP
10_1101-2021_01_06_425657	451	105	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	106	pdr5D::Nat	pdr5D::Nat	NNP
10_1101-2021_01_06_425657	451	107	This	this	DT
10_1101-2021_01_06_425657	451	108	study	study	VB
10_1101-2021_01_06_425657	451	109	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	110	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	111	;	;	:
10_1101-2021_01_06_425657	451	112	met4D::KanMX	met4D::KanMX	NNP
10_1101-2021_01_06_425657	451	113	MET30-FLAG::Hyg	MET30-FLAG::Hyg	NNS
10_1101-2021_01_06_425657	451	114	This	this	DT
10_1101-2021_01_06_425657	451	115	study	study	NN
10_1101-2021_01_06_425657	451	116	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	117	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	118	;	;	:
10_1101-2021_01_06_425657	451	119	cup1p-6xHis	cup1p-6xhis	NN
10_1101-2021_01_06_425657	451	120	-	-	HYPH
10_1101-2021_01_06_425657	451	121	TEV	tev	NN
10_1101-2021_01_06_425657	451	122	-	-	HYPH
10_1101-2021_01_06_425657	451	123	UBA1::Hyg	UBA1::Hyg	NNP
10_1101-2021_01_06_425657	451	124	This	this	DT
10_1101-2021_01_06_425657	451	125	study	study	NN
10_1101-2021_01_06_425657	451	126	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	127	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	128	;	;	:
10_1101-2021_01_06_425657	451	129	met30::MET30-C201S	met30::met30-c201s	CD
10_1101-2021_01_06_425657	451	130	-	-	HYPH
10_1101-2021_01_06_425657	451	131	FLAG::KanMX	flag::kanmx	NN
10_1101-2021_01_06_425657	451	132	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	133	This	this	DT
10_1101-2021_01_06_425657	451	134	study	study	NN
10_1101-2021_01_06_425657	451	135	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	136	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	137	;	;	:
10_1101-2021_01_06_425657	451	138	met30::MET30-C374S	met30::met30-c374s	NN
10_1101-2021_01_06_425657	451	139	-	-	HYPH
10_1101-2021_01_06_425657	451	140	FLAG::KanMX	flag::kanmx	JJ
10_1101-2021_01_06_425657	451	141	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	142	This	this	DT
10_1101-2021_01_06_425657	451	143	study	study	NN
10_1101-2021_01_06_425657	451	144	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	145	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	146	;	;	:
10_1101-2021_01_06_425657	451	147	met30::MET30-C426S	met30::met30-c426s	JJ
10_1101-2021_01_06_425657	451	148	-	-	HYPH
10_1101-2021_01_06_425657	451	149	FLAG::KanMX	flag::kanmx	NN
10_1101-2021_01_06_425657	451	150	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	151	This	this	DT
10_1101-2021_01_06_425657	451	152	study	study	NN
10_1101-2021_01_06_425657	451	153	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	154	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	155	;	;	:
10_1101-2021_01_06_425657	451	156	met30::MET30-C436S	met30::met30-c436s	NN
10_1101-2021_01_06_425657	451	157	-	-	HYPH
10_1101-2021_01_06_425657	451	158	FLAG::KanMX	FLAG::KanMX	NNP
10_1101-2021_01_06_425657	451	159	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	160	This	this	DT
10_1101-2021_01_06_425657	451	161	study	study	NN
10_1101-2021_01_06_425657	451	162	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	451	163	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	164	;	;	:
10_1101-2021_01_06_425657	451	165	met30::MET30-C439S	met30::met30-c439s	NN
10_1101-2021_01_06_425657	451	166	-	-	HYPH
10_1101-2021_01_06_425657	451	167	FLAG::KanMX	FLAG::KanMX	NNP
10_1101-2021_01_06_425657	451	168	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	169	This	this	DT
10_1101-2021_01_06_425657	451	170	study	study	NN
10_1101-2021_01_06_425657	451	171	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	172	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	173	;	;	:
10_1101-2021_01_06_425657	451	174	met30::MET30-C455S	met30::met30-c455s	NN
10_1101-2021_01_06_425657	451	175	-	-	HYPH
10_1101-2021_01_06_425657	451	176	FLAG::KanMX	FLAG::KanMX	NNP
10_1101-2021_01_06_425657	451	177	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	178	This	this	DT
10_1101-2021_01_06_425657	451	179	study	study	NN
10_1101-2021_01_06_425657	451	180	CEN.PK	cen.pk	JJ
10_1101-2021_01_06_425657	451	181	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	182	;	;	:
10_1101-2021_01_06_425657	451	183	met30::MET30-C528S	met30::met30-c528s	NN
10_1101-2021_01_06_425657	451	184	-	-	HYPH
10_1101-2021_01_06_425657	451	185	FLAG::KanMX	flag::kanmx	NN
10_1101-2021_01_06_425657	451	186	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	187	This	this	DT
10_1101-2021_01_06_425657	451	188	study	study	NN
10_1101-2021_01_06_425657	451	189	CEN.PK	cen.pk	JJ
10_1101-2021_01_06_425657	451	190	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	191	;	;	:
10_1101-2021_01_06_425657	451	192	met30::MET30-C544S	met30::met30-c544s	NN
10_1101-2021_01_06_425657	451	193	-	-	HYPH
10_1101-2021_01_06_425657	451	194	FLAG::KanMX	flag::kanmx	NN
10_1101-2021_01_06_425657	451	195	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	196	This	this	DT
10_1101-2021_01_06_425657	451	197	study	study	NN
10_1101-2021_01_06_425657	451	198	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	451	199	MATa	MATa	NNS
10_1101-2021_01_06_425657	451	200	;	;	:
10_1101-2021_01_06_425657	451	201	met30::MET30-C584S	met30::met30-c584s	NN
10_1101-2021_01_06_425657	451	202	-	-	HYPH
10_1101-2021_01_06_425657	451	203	FLAG::KanMX	FLAG::KanMX	NNS
10_1101-2021_01_06_425657	451	204	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	451	205	This	this	DT
10_1101-2021_01_06_425657	451	206	study	study	NN
10_1101-2021_01_06_425657	451	207	.CC	.CC	:
10_1101-2021_01_06_425657	451	208	-	-	:
10_1101-2021_01_06_425657	451	209	BY	by	IN
10_1101-2021_01_06_425657	451	210	4.0	4.0	CD
10_1101-2021_01_06_425657	451	211	International	International	NNP
10_1101-2021_01_06_425657	451	212	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	451	213	under	under	IN
10_1101-2021_01_06_425657	451	214	a	a	DT
10_1101-2021_01_06_425657	451	215	(	(	-LRB-
10_1101-2021_01_06_425657	451	216	which	which	WDT
10_1101-2021_01_06_425657	451	217	was	be	VBD
10_1101-2021_01_06_425657	451	218	not	not	RB
10_1101-2021_01_06_425657	451	219	certified	certify	VBN
10_1101-2021_01_06_425657	451	220	by	by	IN
10_1101-2021_01_06_425657	451	221	peer	peer	NN
10_1101-2021_01_06_425657	451	222	review	review	NN
10_1101-2021_01_06_425657	451	223	)	)	-RRB-
10_1101-2021_01_06_425657	451	224	is	be	VBZ
10_1101-2021_01_06_425657	451	225	the	the	DT
10_1101-2021_01_06_425657	451	226	author	author	NN
10_1101-2021_01_06_425657	451	227	/	/	SYM
10_1101-2021_01_06_425657	451	228	funder	funder	NN
10_1101-2021_01_06_425657	451	229	,	,	,
10_1101-2021_01_06_425657	451	230	who	who	WP
10_1101-2021_01_06_425657	451	231	has	have	VBZ
10_1101-2021_01_06_425657	451	232	granted	grant	VBN
10_1101-2021_01_06_425657	451	233	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	451	234	a	a	DT
10_1101-2021_01_06_425657	451	235	license	license	NN
10_1101-2021_01_06_425657	451	236	to	to	TO
10_1101-2021_01_06_425657	451	237	display	display	VB
10_1101-2021_01_06_425657	451	238	the	the	DT
10_1101-2021_01_06_425657	451	239	preprint	preprint	NN
10_1101-2021_01_06_425657	451	240	in	in	IN
10_1101-2021_01_06_425657	451	241	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	451	242	.	.	.
10_1101-2021_01_06_425657	452	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	452	2	is	be	VBZ
10_1101-2021_01_06_425657	452	3	made	make	VBN
10_1101-2021_01_06_425657	452	4	The	the	DT
10_1101-2021_01_06_425657	452	5	copyright	copyright	NN
10_1101-2021_01_06_425657	452	6	holder	holder	NN
10_1101-2021_01_06_425657	452	7	for	for	IN
10_1101-2021_01_06_425657	452	8	this	this	DT
10_1101-2021_01_06_425657	452	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	452	10	version	version	NN
10_1101-2021_01_06_425657	452	11	posted	post	VBD
10_1101-2021_01_06_425657	452	12	January	January	NNP
10_1101-2021_01_06_425657	452	13	7	7	CD
10_1101-2021_01_06_425657	452	14	,	,	,
10_1101-2021_01_06_425657	452	15	2021	2021	CD
10_1101-2021_01_06_425657	452	16	.	.	.
10_1101-2021_01_06_425657	452	17	;	;	:
10_1101-2021_01_06_425657	452	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	452	19	:	:	:
10_1101-2021_01_06_425657	452	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	452	21	preprint	preprint	NN
10_1101-2021_01_06_425657	452	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	452	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	452	24	25	25	CD
10_1101-2021_01_06_425657	452	25	CEN.PK	cen.pk	CD
10_1101-2021_01_06_425657	452	26	MATa	MATa	NNS
10_1101-2021_01_06_425657	452	27	;	;	:
10_1101-2021_01_06_425657	452	28	met30::MET30-C614S	met30::met30-c614s	NN
10_1101-2021_01_06_425657	452	29	-	-	HYPH
10_1101-2021_01_06_425657	452	30	FLAG::KanMX	flag::kanmx	NN
10_1101-2021_01_06_425657	452	31	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	452	32	This	this	DT
10_1101-2021_01_06_425657	452	33	study	study	NN
10_1101-2021_01_06_425657	452	34	CEN.PK	CEN.PK	NNP
10_1101-2021_01_06_425657	452	35	MATa	MATa	NNS
10_1101-2021_01_06_425657	452	36	;	;	:
10_1101-2021_01_06_425657	452	37	met30::MET30-C616S	met30::met30-c616s	NN
10_1101-2021_01_06_425657	452	38	-	-	HYPH
10_1101-2021_01_06_425657	452	39	FLAG::KanMX	flag::kanmx	NN
10_1101-2021_01_06_425657	452	40	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	452	41	This	this	DT
10_1101-2021_01_06_425657	452	42	study	study	NN
10_1101-2021_01_06_425657	452	43	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	452	44	MATa	MATa	NNS
10_1101-2021_01_06_425657	452	45	;	;	:
10_1101-2021_01_06_425657	452	46	met30::MET30-C584/622S	met30::met30-c584/622s	NN
10_1101-2021_01_06_425657	452	47	-	-	HYPH
10_1101-2021_01_06_425657	452	48	FLAG::KanMX	FLAG::KanMX	NNS
10_1101-2021_01_06_425657	452	49	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	452	50	This	this	DT
10_1101-2021_01_06_425657	452	51	study	study	NN
10_1101-2021_01_06_425657	452	52	CEN.PK	cen.pk	NN
10_1101-2021_01_06_425657	452	53	MATa	MATa	NNS
10_1101-2021_01_06_425657	452	54	;	;	:
10_1101-2021_01_06_425657	452	55	met30::MET30-C630S	met30::met30-c630s	NN
10_1101-2021_01_06_425657	452	56	-	-	HYPH
10_1101-2021_01_06_425657	452	57	FLAG::KanMX	flag::kanmx	NN
10_1101-2021_01_06_425657	452	58	MET4-HA::Hyg	MET4-HA::Hyg	NNP
10_1101-2021_01_06_425657	452	59	This	this	DT
10_1101-2021_01_06_425657	452	60	study	study	NN
10_1101-2021_01_06_425657	452	61	799	799	CD
10_1101-2021_01_06_425657	452	62	.CC	.CC	,
10_1101-2021_01_06_425657	452	63	-	-	:
10_1101-2021_01_06_425657	452	64	BY	by	IN
10_1101-2021_01_06_425657	452	65	4.0	4.0	CD
10_1101-2021_01_06_425657	452	66	International	International	NNP
10_1101-2021_01_06_425657	452	67	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	452	68	under	under	IN
10_1101-2021_01_06_425657	452	69	a	a	DT
10_1101-2021_01_06_425657	452	70	(	(	-LRB-
10_1101-2021_01_06_425657	452	71	which	which	WDT
10_1101-2021_01_06_425657	452	72	was	be	VBD
10_1101-2021_01_06_425657	452	73	not	not	RB
10_1101-2021_01_06_425657	452	74	certified	certify	VBN
10_1101-2021_01_06_425657	452	75	by	by	IN
10_1101-2021_01_06_425657	452	76	peer	peer	NN
10_1101-2021_01_06_425657	452	77	review	review	NN
10_1101-2021_01_06_425657	452	78	)	)	-RRB-
10_1101-2021_01_06_425657	452	79	is	be	VBZ
10_1101-2021_01_06_425657	452	80	the	the	DT
10_1101-2021_01_06_425657	452	81	author	author	NN
10_1101-2021_01_06_425657	452	82	/	/	SYM
10_1101-2021_01_06_425657	452	83	funder	funder	NN
10_1101-2021_01_06_425657	452	84	,	,	,
10_1101-2021_01_06_425657	452	85	who	who	WP
10_1101-2021_01_06_425657	452	86	has	have	VBZ
10_1101-2021_01_06_425657	452	87	granted	grant	VBN
10_1101-2021_01_06_425657	452	88	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	452	89	a	a	DT
10_1101-2021_01_06_425657	452	90	license	license	NN
10_1101-2021_01_06_425657	452	91	to	to	TO
10_1101-2021_01_06_425657	452	92	display	display	VB
10_1101-2021_01_06_425657	452	93	the	the	DT
10_1101-2021_01_06_425657	452	94	preprint	preprint	NN
10_1101-2021_01_06_425657	452	95	in	in	IN
10_1101-2021_01_06_425657	452	96	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	452	97	.	.	.
10_1101-2021_01_06_425657	453	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	453	2	is	be	VBZ
10_1101-2021_01_06_425657	453	3	made	make	VBN
10_1101-2021_01_06_425657	453	4	The	the	DT
10_1101-2021_01_06_425657	453	5	copyright	copyright	NN
10_1101-2021_01_06_425657	453	6	holder	holder	NN
10_1101-2021_01_06_425657	453	7	for	for	IN
10_1101-2021_01_06_425657	453	8	this	this	DT
10_1101-2021_01_06_425657	453	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	453	10	version	version	NN
10_1101-2021_01_06_425657	453	11	posted	post	VBD
10_1101-2021_01_06_425657	453	12	January	January	NNP
10_1101-2021_01_06_425657	453	13	7	7	CD
10_1101-2021_01_06_425657	453	14	,	,	,
10_1101-2021_01_06_425657	453	15	2021	2021	CD
10_1101-2021_01_06_425657	453	16	.	.	.
10_1101-2021_01_06_425657	453	17	;	;	:
10_1101-2021_01_06_425657	453	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	453	19	:	:	:
10_1101-2021_01_06_425657	453	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	453	21	preprint	preprint	NN
10_1101-2021_01_06_425657	453	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	453	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	453	24	26	26	CD
10_1101-2021_01_06_425657	453	25	Table	Table	NNP
10_1101-2021_01_06_425657	453	26	S2	s2	NN
10_1101-2021_01_06_425657	453	27	.	.	.
10_1101-2021_01_06_425657	454	1	Recipe	recipe	NN
10_1101-2021_01_06_425657	454	2	for	for	IN
10_1101-2021_01_06_425657	454	3	sulfur	sulfur	NN
10_1101-2021_01_06_425657	454	4	-	-	HYPH
10_1101-2021_01_06_425657	454	5	free	free	JJ
10_1101-2021_01_06_425657	454	6	media	medium	NNS
10_1101-2021_01_06_425657	454	7	.	.	.
10_1101-2021_01_06_425657	455	1	800	800	CD
10_1101-2021_01_06_425657	455	2	salts	salt	NNS
10_1101-2021_01_06_425657	455	3	(	(	-LRB-
10_1101-2021_01_06_425657	455	4	g	g	NNP
10_1101-2021_01_06_425657	455	5	L-1	L-1	NNP
10_1101-2021_01_06_425657	455	6	)	)	-RRB-
10_1101-2021_01_06_425657	455	7	CaCl2•2H2O	cacl2•2h2o	CD
10_1101-2021_01_06_425657	455	8	0.1	0.1	CD
10_1101-2021_01_06_425657	455	9	NaCl	NaCl	NNP
10_1101-2021_01_06_425657	455	10	0.1	0.1	CD
10_1101-2021_01_06_425657	455	11	MgCl2•6H2O	mgcl2•6h2o	CD
10_1101-2021_01_06_425657	455	12	0.412	0.412	CD
10_1101-2021_01_06_425657	455	13	NH4Cl	nh4cl	CD
10_1101-2021_01_06_425657	455	14	4.05	4.05	CD
10_1101-2021_01_06_425657	455	15	KH2PO4	kh2po4	NN
10_1101-2021_01_06_425657	455	16	1	1	CD
10_1101-2021_01_06_425657	455	17	metals	metal	NNS
10_1101-2021_01_06_425657	455	18	(	(	-LRB-
10_1101-2021_01_06_425657	455	19	mg	mg	NNP
10_1101-2021_01_06_425657	455	20	L-1	L-1	NNP
10_1101-2021_01_06_425657	455	21	)	)	-RRB-
10_1101-2021_01_06_425657	455	22	boric	boric	NN
10_1101-2021_01_06_425657	455	23	acid	acid	NN
10_1101-2021_01_06_425657	455	24	0.5	0.5	CD
10_1101-2021_01_06_425657	455	25	CuCl2•2H2O	cucl2•2h2o	CD
10_1101-2021_01_06_425657	455	26	0.0273	0.0273	CD
10_1101-2021_01_06_425657	455	27	KI	KI	NNP
10_1101-2021_01_06_425657	455	28	0.1	0.1	CD
10_1101-2021_01_06_425657	455	29	FeCl3•6H2O	fecl3•6h2o	CD
10_1101-2021_01_06_425657	455	30	0.2	0.2	CD
10_1101-2021_01_06_425657	455	31	MnCl2•4H2O	mncl2•4h2o	CD
10_1101-2021_01_06_425657	455	32	0.4684	0.4684	CD
10_1101-2021_01_06_425657	455	33	Na2MoO4•2H2O	na2moo4•2h2o	NN
10_1101-2021_01_06_425657	455	34	0.2	0.2	CD
10_1101-2021_01_06_425657	455	35	ZnCl2•H2O	zncl2•h2o	NN
10_1101-2021_01_06_425657	455	36	0.1895	0.1895	CD
10_1101-2021_01_06_425657	455	37	vitamins	vitamin	NNS
10_1101-2021_01_06_425657	455	38	(	(	-LRB-
10_1101-2021_01_06_425657	455	39	mg	mg	NNP
10_1101-2021_01_06_425657	455	40	L-1	L-1	NNP
10_1101-2021_01_06_425657	455	41	)	)	-RRB-
10_1101-2021_01_06_425657	455	42	biotin	biotin	JJ
10_1101-2021_01_06_425657	455	43	0.002	0.002	CD
10_1101-2021_01_06_425657	455	44	calcium	calcium	NN
10_1101-2021_01_06_425657	455	45	pantothenate	pantothenate	VBP
10_1101-2021_01_06_425657	455	46	0.4	0.4	CD
10_1101-2021_01_06_425657	455	47	folic	folic	JJ
10_1101-2021_01_06_425657	455	48	acid	acid	NN
10_1101-2021_01_06_425657	455	49	0.002	0.002	CD
10_1101-2021_01_06_425657	455	50	inositol	inositol	NNP
10_1101-2021_01_06_425657	455	51	2	2	CD
10_1101-2021_01_06_425657	455	52	niacin	niacin	NNPS
10_1101-2021_01_06_425657	455	53	0.4	0.4	CD
10_1101-2021_01_06_425657	455	54	4-aminobenzoic	4-aminobenzoic	CD
10_1101-2021_01_06_425657	455	55	acid	acid	NN
10_1101-2021_01_06_425657	455	56	0.2	0.2	CD
10_1101-2021_01_06_425657	455	57	pyridoxine	pyridoxine	JJ
10_1101-2021_01_06_425657	455	58	HCl	HCl	NNP
10_1101-2021_01_06_425657	455	59	0.4	0.4	CD
10_1101-2021_01_06_425657	455	60	riboflavin	riboflavin	VBP
10_1101-2021_01_06_425657	455	61	0.2	0.2	CD
10_1101-2021_01_06_425657	455	62	thiamine	thiamine	NN
10_1101-2021_01_06_425657	455	63	-	-	HYPH
10_1101-2021_01_06_425657	455	64	HCl	HCl	NNS
10_1101-2021_01_06_425657	455	65	0.4	0.4	CD
10_1101-2021_01_06_425657	455	66	801	801	CD
10_1101-2021_01_06_425657	455	67	Recipes	Recipes	NNPS
10_1101-2021_01_06_425657	455	68	are	be	VBP
10_1101-2021_01_06_425657	455	69	derived	derive	VBN
10_1101-2021_01_06_425657	455	70	from	from	IN
10_1101-2021_01_06_425657	455	71	(	(	-LRB-
10_1101-2021_01_06_425657	455	72	Miller	Miller	NNP
10_1101-2021_01_06_425657	455	73	et	et	NNP
10_1101-2021_01_06_425657	455	74	al	al	NNP
10_1101-2021_01_06_425657	455	75	.	.	NNP
10_1101-2021_01_06_425657	455	76	,	,	,
10_1101-2021_01_06_425657	455	77	2013	2013	CD
10_1101-2021_01_06_425657	455	78	)	)	-RRB-
10_1101-2021_01_06_425657	455	79	.	.	.
10_1101-2021_01_06_425657	456	1	802	802	CD
10_1101-2021_01_06_425657	456	2	.CC	.CC	:
10_1101-2021_01_06_425657	456	3	-	-	:
10_1101-2021_01_06_425657	456	4	BY	by	IN
10_1101-2021_01_06_425657	456	5	4.0	4.0	CD
10_1101-2021_01_06_425657	456	6	International	International	NNP
10_1101-2021_01_06_425657	456	7	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	456	8	under	under	IN
10_1101-2021_01_06_425657	456	9	a	a	DT
10_1101-2021_01_06_425657	456	10	(	(	-LRB-
10_1101-2021_01_06_425657	456	11	which	which	WDT
10_1101-2021_01_06_425657	456	12	was	be	VBD
10_1101-2021_01_06_425657	456	13	not	not	RB
10_1101-2021_01_06_425657	456	14	certified	certify	VBN
10_1101-2021_01_06_425657	456	15	by	by	IN
10_1101-2021_01_06_425657	456	16	peer	peer	NN
10_1101-2021_01_06_425657	456	17	review	review	NN
10_1101-2021_01_06_425657	456	18	)	)	-RRB-
10_1101-2021_01_06_425657	456	19	is	be	VBZ
10_1101-2021_01_06_425657	456	20	the	the	DT
10_1101-2021_01_06_425657	456	21	author	author	NN
10_1101-2021_01_06_425657	456	22	/	/	SYM
10_1101-2021_01_06_425657	456	23	funder	funder	NN
10_1101-2021_01_06_425657	456	24	,	,	,
10_1101-2021_01_06_425657	456	25	who	who	WP
10_1101-2021_01_06_425657	456	26	has	have	VBZ
10_1101-2021_01_06_425657	456	27	granted	grant	VBN
10_1101-2021_01_06_425657	456	28	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	456	29	a	a	DT
10_1101-2021_01_06_425657	456	30	license	license	NN
10_1101-2021_01_06_425657	456	31	to	to	TO
10_1101-2021_01_06_425657	456	32	display	display	VB
10_1101-2021_01_06_425657	456	33	the	the	DT
10_1101-2021_01_06_425657	456	34	preprint	preprint	NN
10_1101-2021_01_06_425657	456	35	in	in	IN
10_1101-2021_01_06_425657	456	36	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	456	37	.	.	.
10_1101-2021_01_06_425657	457	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	457	2	is	be	VBZ
10_1101-2021_01_06_425657	457	3	made	make	VBN
10_1101-2021_01_06_425657	457	4	The	the	DT
10_1101-2021_01_06_425657	457	5	copyright	copyright	NN
10_1101-2021_01_06_425657	457	6	holder	holder	NN
10_1101-2021_01_06_425657	457	7	for	for	IN
10_1101-2021_01_06_425657	457	8	this	this	DT
10_1101-2021_01_06_425657	457	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	457	10	version	version	NN
10_1101-2021_01_06_425657	457	11	posted	post	VBD
10_1101-2021_01_06_425657	457	12	January	January	NNP
10_1101-2021_01_06_425657	457	13	7	7	CD
10_1101-2021_01_06_425657	457	14	,	,	,
10_1101-2021_01_06_425657	457	15	2021	2021	CD
10_1101-2021_01_06_425657	457	16	.	.	.
10_1101-2021_01_06_425657	457	17	;	;	:
10_1101-2021_01_06_425657	457	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	457	19	:	:	:
10_1101-2021_01_06_425657	457	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	457	21	preprint	preprint	NN
10_1101-2021_01_06_425657	457	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	457	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	457	24	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	457	25	Rich	Rich	NNP
10_1101-2021_01_06_425657	457	26	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	457	27	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	457	28	75	75	CD
10_1101-2021_01_06_425657	457	29	kDa	kDa	NNS
10_1101-2021_01_06_425657	457	30	100	100	CD
10_1101-2021_01_06_425657	457	31	kDa	kDa	NNS
10_1101-2021_01_06_425657	457	32	150	150	CD
10_1101-2021_01_06_425657	457	33	kDa	kDa	NNS
10_1101-2021_01_06_425657	457	34	−Sulfur	−sulfur	CD
10_1101-2021_01_06_425657	457	35	+	+	CC
10_1101-2021_01_06_425657	457	36	Met	Met	NNP
10_1101-2021_01_06_425657	457	37	/	/	SYM
10_1101-2021_01_06_425657	457	38	Cys	Cys	NNP
10_1101-2021_01_06_425657	457	39	/	/	SYM
10_1101-2021_01_06_425657	457	40	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	457	41	Time	Time	NNP
10_1101-2021_01_06_425657	457	42	(	(	-LRB-
10_1101-2021_01_06_425657	457	43	min	min	NNP
10_1101-2021_01_06_425657	457	44	)	)	-RRB-
10_1101-2021_01_06_425657	457	45	0	0	CD
10_1101-2021_01_06_425657	457	46	15	15	CD
10_1101-2021_01_06_425657	457	47	60	60	CD
10_1101-2021_01_06_425657	457	48	15	15	CD
10_1101-2021_01_06_425657	457	49	60	60	CD
10_1101-2021_01_06_425657	457	50	A	A	NNP
10_1101-2021_01_06_425657	457	51	Lactate	Lactate	NNP
10_1101-2021_01_06_425657	457	52	(	(	-LRB-
10_1101-2021_01_06_425657	457	53	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	457	54	)	)	-RRB-
10_1101-2021_01_06_425657	457	55	75	75	CD
10_1101-2021_01_06_425657	457	56	kDa	kDa	NNS
10_1101-2021_01_06_425657	457	57	100	100	CD
10_1101-2021_01_06_425657	457	58	kDa	kDa	NNS
10_1101-2021_01_06_425657	457	59	150	150	CD
10_1101-2021_01_06_425657	457	60	kDa	kDa	NNS
10_1101-2021_01_06_425657	457	61	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	457	62	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	457	63	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	457	64	Time	Time	NNP
10_1101-2021_01_06_425657	457	65	(	(	-LRB-
10_1101-2021_01_06_425657	457	66	min	min	NNP
10_1101-2021_01_06_425657	457	67	)	)	-RRB-
10_1101-2021_01_06_425657	457	68	Rich	Rich	NNP
10_1101-2021_01_06_425657	457	69	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	457	70	0	0	CD
10_1101-2021_01_06_425657	457	71	15	15	CD
10_1101-2021_01_06_425657	457	72	60	60	CD
10_1101-2021_01_06_425657	457	73	15	15	CD
10_1101-2021_01_06_425657	457	74	60	60	CD
10_1101-2021_01_06_425657	457	75	15	15	CD
10_1101-2021_01_06_425657	457	76	60	60	CD
10_1101-2021_01_06_425657	457	77	0	0	CD
10_1101-2021_01_06_425657	457	78	15	15	CD
10_1101-2021_01_06_425657	457	79	60	60	CD
10_1101-2021_01_06_425657	457	80	15	15	CD
10_1101-2021_01_06_425657	457	81	60	60	CD
10_1101-2021_01_06_425657	457	82	15	15	CD
10_1101-2021_01_06_425657	457	83	60	60	CD
10_1101-2021_01_06_425657	457	84	met6∆	met6∆	NN
10_1101-2021_01_06_425657	457	85	str3∆	str3∆	NN
10_1101-2021_01_06_425657	457	86	D	D	NNP
10_1101-2021_01_06_425657	457	87	Lactate	Lactate	NNP
10_1101-2021_01_06_425657	457	88	(	(	-LRB-
10_1101-2021_01_06_425657	457	89	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	457	90	)	)	-RRB-
10_1101-2021_01_06_425657	457	91	+	+	NFP
10_1101-2021_01_06_425657	457	92	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	457	93	+	+	CC
10_1101-2021_01_06_425657	457	94	Met	Met	NNP
10_1101-2021_01_06_425657	457	95	Rich	Rich	NNP
10_1101-2021_01_06_425657	457	96	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	457	97	+	+	SYM
10_1101-2021_01_06_425657	457	98	Cys	Cys	NNP
10_1101-2021_01_06_425657	457	99	+	+	SYM
10_1101-2021_01_06_425657	457	100	Met	Met	NNP
10_1101-2021_01_06_425657	457	101	R	R	NNP
10_1101-2021_01_06_425657	457	102	-S	-S	NNP
10_1101-2021_01_06_425657	457	103	15	15	CD
10_1101-2021_01_06_425657	457	104	-S	-s	CD
10_1101-2021_01_06_425657	457	105	60	60	CD
10_1101-2021_01_06_425657	457	106	+	+	NN
10_1101-2021_01_06_425657	457	107	M	M	NNP
10_1101-2021_01_06_425657	457	108	CH	CH	NNP
10_1101-2021_01_06_425657	457	109	15	15	CD
10_1101-2021_01_06_425657	457	110	+	+	NN
10_1101-2021_01_06_425657	457	111	M	M	NNP
10_1101-2021_01_06_425657	457	112	CH	CH	NNP
10_1101-2021_01_06_425657	457	113	60	60	CD
10_1101-2021_01_06_425657	457	114	0.01	0.01	CD
10_1101-2021_01_06_425657	457	115	0.1	0.1	CD
10_1101-2021_01_06_425657	457	116	1	1	CD
10_1101-2021_01_06_425657	457	117	10	10	CD
10_1101-2021_01_06_425657	457	118	100	100	CD
10_1101-2021_01_06_425657	457	119	R	r	NN
10_1101-2021_01_06_425657	457	120	el	el	NNP
10_1101-2021_01_06_425657	457	121	at	at	IN
10_1101-2021_01_06_425657	457	122	iv	iv	NNP
10_1101-2021_01_06_425657	457	123	e	e	NNP
10_1101-2021_01_06_425657	457	124	ab	ab	NNP
10_1101-2021_01_06_425657	457	125	un	un	NNP
10_1101-2021_01_06_425657	457	126	da	da	NNP
10_1101-2021_01_06_425657	457	127	nc	nc	NNP
10_1101-2021_01_06_425657	457	128	e	e	NNP
10_1101-2021_01_06_425657	457	129	Methionine	Methionine	NNP
10_1101-2021_01_06_425657	457	130	R	R	NNP
10_1101-2021_01_06_425657	457	131	-S	-S	:
10_1101-2021_01_06_425657	457	132	15	15	CD
10_1101-2021_01_06_425657	457	133	-S	-s	CD
10_1101-2021_01_06_425657	457	134	60	60	CD
10_1101-2021_01_06_425657	457	135	+	+	NN
10_1101-2021_01_06_425657	457	136	M	M	NNP
10_1101-2021_01_06_425657	457	137	CH	CH	NNP
10_1101-2021_01_06_425657	457	138	15	15	CD
10_1101-2021_01_06_425657	457	139	+	+	NN
10_1101-2021_01_06_425657	457	140	M	M	NNP
10_1101-2021_01_06_425657	457	141	CH	CH	NNP
10_1101-2021_01_06_425657	457	142	60	60	CD
10_1101-2021_01_06_425657	457	143	0.1	0.1	CD
10_1101-2021_01_06_425657	457	144	1	1	CD
10_1101-2021_01_06_425657	457	145	10	10	CD
10_1101-2021_01_06_425657	457	146	R	r	NN
10_1101-2021_01_06_425657	457	147	el	el	NNP
10_1101-2021_01_06_425657	457	148	at	at	IN
10_1101-2021_01_06_425657	457	149	iv	iv	NNP
10_1101-2021_01_06_425657	457	150	e	e	NNP
10_1101-2021_01_06_425657	457	151	ab	ab	NNP
10_1101-2021_01_06_425657	457	152	un	un	NNP
10_1101-2021_01_06_425657	457	153	da	da	NNP
10_1101-2021_01_06_425657	457	154	nc	nc	NNP
10_1101-2021_01_06_425657	457	155	e	e	NNP
10_1101-2021_01_06_425657	457	156	GSH	GSH	NNP
10_1101-2021_01_06_425657	457	157	R	R	NNP
10_1101-2021_01_06_425657	457	158	-S	-S	:
10_1101-2021_01_06_425657	457	159	15	15	CD
10_1101-2021_01_06_425657	457	160	-S	-s	CD
10_1101-2021_01_06_425657	457	161	60	60	CD
10_1101-2021_01_06_425657	457	162	+	+	NN
10_1101-2021_01_06_425657	457	163	M	M	NNP
10_1101-2021_01_06_425657	457	164	CH	CH	NNP
10_1101-2021_01_06_425657	457	165	15	15	CD
10_1101-2021_01_06_425657	457	166	+	+	NN
10_1101-2021_01_06_425657	457	167	M	M	NNP
10_1101-2021_01_06_425657	457	168	CH	CH	NNP
10_1101-2021_01_06_425657	457	169	60	60	CD
10_1101-2021_01_06_425657	457	170	0.1	0.1	CD
10_1101-2021_01_06_425657	457	171	1	1	CD
10_1101-2021_01_06_425657	457	172	10	10	CD
10_1101-2021_01_06_425657	457	173	100	100	CD
10_1101-2021_01_06_425657	457	174	R	r	NN
10_1101-2021_01_06_425657	457	175	el	el	NNP
10_1101-2021_01_06_425657	457	176	at	at	IN
10_1101-2021_01_06_425657	457	177	iv	iv	NNP
10_1101-2021_01_06_425657	457	178	e	e	NNP
10_1101-2021_01_06_425657	457	179	ab	ab	NNP
10_1101-2021_01_06_425657	457	180	un	un	NNP
10_1101-2021_01_06_425657	457	181	da	da	NNP
10_1101-2021_01_06_425657	457	182	nc	nc	FW
10_1101-2021_01_06_425657	457	183	e	e	NNP
10_1101-2021_01_06_425657	457	184	Cysteine	Cysteine	NNP
10_1101-2021_01_06_425657	457	185	R	R	NNP
10_1101-2021_01_06_425657	457	186	-S	-S	NNP
10_1101-2021_01_06_425657	457	187	15	15	CD
10_1101-2021_01_06_425657	457	188	-S	-s	CD
10_1101-2021_01_06_425657	457	189	60	60	CD
10_1101-2021_01_06_425657	457	190	+	+	NN
10_1101-2021_01_06_425657	457	191	M	M	NNP
10_1101-2021_01_06_425657	457	192	CH	CH	NNP
10_1101-2021_01_06_425657	457	193	15	15	CD
10_1101-2021_01_06_425657	457	194	+	+	NN
10_1101-2021_01_06_425657	457	195	M	M	NNP
10_1101-2021_01_06_425657	457	196	CH	CH	NNP
10_1101-2021_01_06_425657	457	197	60	60	CD
10_1101-2021_01_06_425657	457	198	0.1	0.1	CD
10_1101-2021_01_06_425657	457	199	1	1	CD
10_1101-2021_01_06_425657	457	200	10	10	CD
10_1101-2021_01_06_425657	457	201	R	r	NN
10_1101-2021_01_06_425657	457	202	el	el	NNP
10_1101-2021_01_06_425657	457	203	at	at	IN
10_1101-2021_01_06_425657	457	204	iv	iv	NNP
10_1101-2021_01_06_425657	457	205	e	e	NNP
10_1101-2021_01_06_425657	457	206	ab	ab	NNP
10_1101-2021_01_06_425657	457	207	un	un	NNP
10_1101-2021_01_06_425657	457	208	da	da	NNP
10_1101-2021_01_06_425657	457	209	nc	nc	NNP
10_1101-2021_01_06_425657	457	210	e	e	NNP
10_1101-2021_01_06_425657	457	211	GSSG	GSSG	NNP
10_1101-2021_01_06_425657	457	212	R	R	NNP
10_1101-2021_01_06_425657	457	213	-S	-S	:
10_1101-2021_01_06_425657	457	214	15	15	CD
10_1101-2021_01_06_425657	457	215	-S	-s	CD
10_1101-2021_01_06_425657	457	216	60	60	CD
10_1101-2021_01_06_425657	457	217	+	+	NN
10_1101-2021_01_06_425657	457	218	M	M	NNP
10_1101-2021_01_06_425657	457	219	CH	CH	NNP
10_1101-2021_01_06_425657	457	220	15	15	CD
10_1101-2021_01_06_425657	457	221	+	+	NN
10_1101-2021_01_06_425657	457	222	M	M	NNP
10_1101-2021_01_06_425657	457	223	CH	CH	NNP
10_1101-2021_01_06_425657	457	224	60	60	CD
10_1101-2021_01_06_425657	457	225	0.1	0.1	CD
10_1101-2021_01_06_425657	457	226	1	1	CD
10_1101-2021_01_06_425657	457	227	10	10	CD
10_1101-2021_01_06_425657	457	228	100	100	CD
10_1101-2021_01_06_425657	457	229	R	r	NN
10_1101-2021_01_06_425657	457	230	el	el	NNP
10_1101-2021_01_06_425657	457	231	at	at	IN
10_1101-2021_01_06_425657	457	232	iv	iv	NNP
10_1101-2021_01_06_425657	457	233	e	e	NNP
10_1101-2021_01_06_425657	457	234	ab	ab	NNP
10_1101-2021_01_06_425657	457	235	un	un	NNP
10_1101-2021_01_06_425657	457	236	da	da	NNP
10_1101-2021_01_06_425657	457	237	nc	nc	FW
10_1101-2021_01_06_425657	457	238	e	e	NNP
10_1101-2021_01_06_425657	457	239	Cystathionine	Cystathionine	NNP
10_1101-2021_01_06_425657	457	240	R	R	NNP
10_1101-2021_01_06_425657	457	241	-S	-S	NNP
10_1101-2021_01_06_425657	457	242	15	15	CD
10_1101-2021_01_06_425657	457	243	-S	-s	CD
10_1101-2021_01_06_425657	457	244	60	60	CD
10_1101-2021_01_06_425657	457	245	+	+	NN
10_1101-2021_01_06_425657	457	246	M	M	NNP
10_1101-2021_01_06_425657	457	247	CH	CH	NNP
10_1101-2021_01_06_425657	457	248	15	15	CD
10_1101-2021_01_06_425657	457	249	+	+	NN
10_1101-2021_01_06_425657	457	250	M	M	NNP
10_1101-2021_01_06_425657	457	251	CH	CH	NNP
10_1101-2021_01_06_425657	457	252	60	60	CD
10_1101-2021_01_06_425657	457	253	0.01	0.01	CD
10_1101-2021_01_06_425657	457	254	0.1	0.1	CD
10_1101-2021_01_06_425657	457	255	1	1	CD
10_1101-2021_01_06_425657	457	256	10	10	CD
10_1101-2021_01_06_425657	457	257	R	r	NN
10_1101-2021_01_06_425657	457	258	el	el	NNP
10_1101-2021_01_06_425657	457	259	at	at	IN
10_1101-2021_01_06_425657	457	260	iv	iv	NNP
10_1101-2021_01_06_425657	457	261	e	e	NNP
10_1101-2021_01_06_425657	457	262	ab	ab	NNP
10_1101-2021_01_06_425657	457	263	un	un	NNP
10_1101-2021_01_06_425657	457	264	da	da	NNP
10_1101-2021_01_06_425657	457	265	nc	nc	NNP
10_1101-2021_01_06_425657	457	266	e	e	NNP
10_1101-2021_01_06_425657	457	267	SAM	SAM	NNP
10_1101-2021_01_06_425657	457	268	R	R	NNP
10_1101-2021_01_06_425657	457	269	-S	-S	NNP
10_1101-2021_01_06_425657	457	270	15	15	CD
10_1101-2021_01_06_425657	457	271	-S	-s	CD
10_1101-2021_01_06_425657	457	272	60	60	CD
10_1101-2021_01_06_425657	457	273	+	+	NN
10_1101-2021_01_06_425657	457	274	M	M	NNP
10_1101-2021_01_06_425657	457	275	CH	CH	NNP
10_1101-2021_01_06_425657	457	276	15	15	CD
10_1101-2021_01_06_425657	457	277	+	+	NN
10_1101-2021_01_06_425657	457	278	M	M	NNP
10_1101-2021_01_06_425657	457	279	CH	CH	NNP
10_1101-2021_01_06_425657	457	280	60	60	CD
10_1101-2021_01_06_425657	457	281	0.1	0.1	CD
10_1101-2021_01_06_425657	457	282	1	1	CD
10_1101-2021_01_06_425657	457	283	10	10	CD
10_1101-2021_01_06_425657	457	284	100	100	CD
10_1101-2021_01_06_425657	457	285	R	r	NN
10_1101-2021_01_06_425657	457	286	el	el	NNP
10_1101-2021_01_06_425657	457	287	at	at	IN
10_1101-2021_01_06_425657	457	288	iv	iv	NNP
10_1101-2021_01_06_425657	457	289	e	e	NNP
10_1101-2021_01_06_425657	457	290	ab	ab	NNP
10_1101-2021_01_06_425657	457	291	un	un	NNP
10_1101-2021_01_06_425657	457	292	da	da	NNP
10_1101-2021_01_06_425657	457	293	nc	nc	NNP
10_1101-2021_01_06_425657	457	294	e	e	NNP
10_1101-2021_01_06_425657	457	295	SAH	SAH	NNP
10_1101-2021_01_06_425657	457	296	C	C	NNP
10_1101-2021_01_06_425657	457	297	SO4	SO4	NNP
10_1101-2021_01_06_425657	457	298	2-	2-	NNP
10_1101-2021_01_06_425657	457	299	homocysteine	homocysteine	JJ
10_1101-2021_01_06_425657	457	300	methionine	methionine	JJ
10_1101-2021_01_06_425657	457	301	SAM	SAM	NNP
10_1101-2021_01_06_425657	457	302	GSH	GSH	NNP
10_1101-2021_01_06_425657	457	303	SAH	SAH	NNP
10_1101-2021_01_06_425657	457	304	cystathionine	cystathionine	NN
10_1101-2021_01_06_425657	457	305	cysteine	cysteine	NN
10_1101-2021_01_06_425657	457	306	MET6	MET6	NNP
10_1101-2021_01_06_425657	457	307	STR3	STR3	NNP
10_1101-2021_01_06_425657	457	308	CYS4	CYS4	NNP
10_1101-2021_01_06_425657	457	309	STR2CYS3	STR2CYS3	NNP
10_1101-2021_01_06_425657	457	310	GSH1	GSH1	NNP
10_1101-2021_01_06_425657	457	311	GSH2	GSH2	NNP
10_1101-2021_01_06_425657	457	312	SAH1	SAH1	NNP
10_1101-2021_01_06_425657	457	313	SAM1	SAM1	NNP
10_1101-2021_01_06_425657	457	314	SAM2	SAM2	NNP
10_1101-2021_01_06_425657	457	315	E	E	NNP
10_1101-2021_01_06_425657	457	316	B	B	NNP
10_1101-2021_01_06_425657	457	317	Figure	figure	NN
10_1101-2021_01_06_425657	457	318	1	1	CD
10_1101-2021_01_06_425657	457	319	Ub	Ub	NNP
10_1101-2021_01_06_425657	457	320	-	-	HYPH
10_1101-2021_01_06_425657	457	321	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	457	322	Ub	Ub	NNP
10_1101-2021_01_06_425657	457	323	-	-	HYPH
10_1101-2021_01_06_425657	457	324	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	457	325	R	R	NNP
10_1101-2021_01_06_425657	457	326	-S	-S	NNP
10_1101-2021_01_06_425657	457	327	15	15	CD
10_1101-2021_01_06_425657	457	328	-S	-s	CD
10_1101-2021_01_06_425657	457	329	60	60	CD
10_1101-2021_01_06_425657	457	330	+	+	NN
10_1101-2021_01_06_425657	457	331	M	M	NNP
10_1101-2021_01_06_425657	457	332	CH	CH	NNP
10_1101-2021_01_06_425657	457	333	15	15	CD
10_1101-2021_01_06_425657	457	334	+	+	NN
10_1101-2021_01_06_425657	457	335	M	M	NNP
10_1101-2021_01_06_425657	457	336	CH	CH	NNP
10_1101-2021_01_06_425657	457	337	60	60	CD
10_1101-2021_01_06_425657	457	338	0	0	CD
10_1101-2021_01_06_425657	457	339	5	5	CD
10_1101-2021_01_06_425657	457	340	10	10	CD
10_1101-2021_01_06_425657	457	341	15	15	CD
10_1101-2021_01_06_425657	457	342	20	20	CD
10_1101-2021_01_06_425657	457	343	25	25	CD
10_1101-2021_01_06_425657	457	344	R	r	NN
10_1101-2021_01_06_425657	457	345	el	el	NN
10_1101-2021_01_06_425657	457	346	at	at	IN
10_1101-2021_01_06_425657	457	347	iv	iv	NNP
10_1101-2021_01_06_425657	457	348	e	e	NNP
10_1101-2021_01_06_425657	457	349	m	m	NNP
10_1101-2021_01_06_425657	457	350	R	R	NNP
10_1101-2021_01_06_425657	457	351	N	N	NNP
10_1101-2021_01_06_425657	457	352	A	A	NNP
10_1101-2021_01_06_425657	457	353	E	e	NN
10_1101-2021_01_06_425657	457	354	xp	xp	NN
10_1101-2021_01_06_425657	457	355	re	re	NN
10_1101-2021_01_06_425657	457	356	ss	ss	NNP
10_1101-2021_01_06_425657	457	357	io	io	NNP
10_1101-2021_01_06_425657	457	358	n	n	CC
10_1101-2021_01_06_425657	457	359	MET17	MET17	NNP
10_1101-2021_01_06_425657	457	360	R	R	NNP
10_1101-2021_01_06_425657	457	361	-S	-S	NNP
10_1101-2021_01_06_425657	457	362	15	15	CD
10_1101-2021_01_06_425657	457	363	-S	-s	CD
10_1101-2021_01_06_425657	457	364	60	60	CD
10_1101-2021_01_06_425657	457	365	+	+	NN
10_1101-2021_01_06_425657	457	366	M	M	NNP
10_1101-2021_01_06_425657	457	367	CH	CH	NNP
10_1101-2021_01_06_425657	457	368	15	15	CD
10_1101-2021_01_06_425657	457	369	+	+	NN
10_1101-2021_01_06_425657	457	370	M	M	NNP
10_1101-2021_01_06_425657	457	371	CH	CH	NNP
10_1101-2021_01_06_425657	457	372	60	60	CD
10_1101-2021_01_06_425657	457	373	0	0	CD
10_1101-2021_01_06_425657	457	374	1	1	CD
10_1101-2021_01_06_425657	457	375	2	2	CD
10_1101-2021_01_06_425657	457	376	3	3	CD
10_1101-2021_01_06_425657	457	377	SAM1	SAM1	NNP
10_1101-2021_01_06_425657	457	378	R	R	NNP
10_1101-2021_01_06_425657	457	379	el	el	NNP
10_1101-2021_01_06_425657	457	380	at	at	IN
10_1101-2021_01_06_425657	457	381	iv	iv	NNP
10_1101-2021_01_06_425657	457	382	e	e	NNP
10_1101-2021_01_06_425657	457	383	m	m	NNP
10_1101-2021_01_06_425657	457	384	R	R	NNP
10_1101-2021_01_06_425657	457	385	N	N	NNP
10_1101-2021_01_06_425657	457	386	A	A	NNP
10_1101-2021_01_06_425657	457	387	E	e	NN
10_1101-2021_01_06_425657	457	388	xp	xp	NN
10_1101-2021_01_06_425657	457	389	re	re	NN
10_1101-2021_01_06_425657	457	390	ss	ss	XX
10_1101-2021_01_06_425657	457	391	io	io	NNP
10_1101-2021_01_06_425657	457	392	n	n	CC
10_1101-2021_01_06_425657	457	393	R	R	NNP
10_1101-2021_01_06_425657	457	394	-S	-S	NNP
10_1101-2021_01_06_425657	457	395	15	15	CD
10_1101-2021_01_06_425657	457	396	-S	-s	CD
10_1101-2021_01_06_425657	457	397	60	60	CD
10_1101-2021_01_06_425657	457	398	+	+	NN
10_1101-2021_01_06_425657	457	399	M	M	NNP
10_1101-2021_01_06_425657	457	400	CH	CH	NNP
10_1101-2021_01_06_425657	457	401	15	15	CD
10_1101-2021_01_06_425657	457	402	+	+	NN
10_1101-2021_01_06_425657	457	403	M	M	NNP
10_1101-2021_01_06_425657	457	404	CH	CH	NNP
10_1101-2021_01_06_425657	457	405	60	60	CD
10_1101-2021_01_06_425657	457	406	0	0	CD
10_1101-2021_01_06_425657	457	407	5	5	CD
10_1101-2021_01_06_425657	457	408	10	10	CD
10_1101-2021_01_06_425657	457	409	15	15	CD
10_1101-2021_01_06_425657	457	410	GSH1	GSH1	NNS
10_1101-2021_01_06_425657	457	411	R	R	NNP
10_1101-2021_01_06_425657	457	412	el	el	NNP
10_1101-2021_01_06_425657	457	413	at	at	IN
10_1101-2021_01_06_425657	457	414	iv	iv	NNP
10_1101-2021_01_06_425657	457	415	e	e	NNP
10_1101-2021_01_06_425657	457	416	m	m	NNP
10_1101-2021_01_06_425657	457	417	R	R	NNP
10_1101-2021_01_06_425657	457	418	N	N	NNP
10_1101-2021_01_06_425657	457	419	A	A	NNP
10_1101-2021_01_06_425657	457	420	E	e	NN
10_1101-2021_01_06_425657	457	421	xp	xp	NN
10_1101-2021_01_06_425657	457	422	re	re	NN
10_1101-2021_01_06_425657	457	423	ss	ss	XX
10_1101-2021_01_06_425657	457	424	io	io	NNP
10_1101-2021_01_06_425657	457	425	n	n	NNP
10_1101-2021_01_06_425657	457	426	.CC	.CC	:
10_1101-2021_01_06_425657	457	427	-	-	:
10_1101-2021_01_06_425657	457	428	BY	by	IN
10_1101-2021_01_06_425657	457	429	4.0	4.0	CD
10_1101-2021_01_06_425657	457	430	International	International	NNP
10_1101-2021_01_06_425657	457	431	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	457	432	under	under	IN
10_1101-2021_01_06_425657	457	433	a	a	DT
10_1101-2021_01_06_425657	457	434	(	(	-LRB-
10_1101-2021_01_06_425657	457	435	which	which	WDT
10_1101-2021_01_06_425657	457	436	was	be	VBD
10_1101-2021_01_06_425657	457	437	not	not	RB
10_1101-2021_01_06_425657	457	438	certified	certify	VBN
10_1101-2021_01_06_425657	457	439	by	by	IN
10_1101-2021_01_06_425657	457	440	peer	peer	NN
10_1101-2021_01_06_425657	457	441	review	review	NN
10_1101-2021_01_06_425657	457	442	)	)	-RRB-
10_1101-2021_01_06_425657	457	443	is	be	VBZ
10_1101-2021_01_06_425657	457	444	the	the	DT
10_1101-2021_01_06_425657	457	445	author	author	NN
10_1101-2021_01_06_425657	457	446	/	/	SYM
10_1101-2021_01_06_425657	457	447	funder	funder	NN
10_1101-2021_01_06_425657	457	448	,	,	,
10_1101-2021_01_06_425657	457	449	who	who	WP
10_1101-2021_01_06_425657	457	450	has	have	VBZ
10_1101-2021_01_06_425657	457	451	granted	grant	VBN
10_1101-2021_01_06_425657	457	452	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	457	453	a	a	DT
10_1101-2021_01_06_425657	457	454	license	license	NN
10_1101-2021_01_06_425657	457	455	to	to	TO
10_1101-2021_01_06_425657	457	456	display	display	VB
10_1101-2021_01_06_425657	457	457	the	the	DT
10_1101-2021_01_06_425657	457	458	preprint	preprint	NN
10_1101-2021_01_06_425657	457	459	in	in	IN
10_1101-2021_01_06_425657	457	460	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	457	461	.	.	.
10_1101-2021_01_06_425657	458	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	458	2	is	be	VBZ
10_1101-2021_01_06_425657	458	3	made	make	VBN
10_1101-2021_01_06_425657	458	4	The	the	DT
10_1101-2021_01_06_425657	458	5	copyright	copyright	NN
10_1101-2021_01_06_425657	458	6	holder	holder	NN
10_1101-2021_01_06_425657	458	7	for	for	IN
10_1101-2021_01_06_425657	458	8	this	this	DT
10_1101-2021_01_06_425657	458	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	458	10	version	version	NN
10_1101-2021_01_06_425657	458	11	posted	post	VBD
10_1101-2021_01_06_425657	458	12	January	January	NNP
10_1101-2021_01_06_425657	458	13	7	7	CD
10_1101-2021_01_06_425657	458	14	,	,	,
10_1101-2021_01_06_425657	458	15	2021	2021	CD
10_1101-2021_01_06_425657	458	16	.	.	.
10_1101-2021_01_06_425657	458	17	;	;	:
10_1101-2021_01_06_425657	458	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	458	19	:	:	:
10_1101-2021_01_06_425657	458	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	458	21	preprint	preprint	NN
10_1101-2021_01_06_425657	458	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	FW
10_1101-2021_01_06_425657	458	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	458	24	WD	WD	NNP
10_1101-2021_01_06_425657	458	25	8	8	CD
10_1101-2021_01_06_425657	458	26	WD	WD	NNP
10_1101-2021_01_06_425657	458	27	7	7	CD
10_1101-2021_01_06_425657	458	28	WD	WD	NNP
10_1101-2021_01_06_425657	458	29	6	6	CD
10_1101-2021_01_06_425657	458	30	WD	WD	NNP
10_1101-2021_01_06_425657	458	31	5	5	CD
10_1101-2021_01_06_425657	458	32	WD	WD	NNP
10_1101-2021_01_06_425657	458	33	4	4	CD
10_1101-2021_01_06_425657	458	34	WD	WD	NNP
10_1101-2021_01_06_425657	458	35	3	3	CD
10_1101-2021_01_06_425657	458	36	WD	WD	NNP
10_1101-2021_01_06_425657	458	37	2	2	CD
10_1101-2021_01_06_425657	458	38	WD	WD	NNP
10_1101-2021_01_06_425657	458	39	1F	1F	NNP
10_1101-2021_01_06_425657	458	40	-	-	:
10_1101-2021_01_06_425657	458	41	Box	Box	NNP
10_1101-2021_01_06_425657	458	42	95111	95111	CD
10_1101-2021_01_06_425657	458	43	164	164	CD
10_1101-2021_01_06_425657	458	44	201	201	CD
10_1101-2021_01_06_425657	458	45	205	205	CD
10_1101-2021_01_06_425657	458	46	211	211	CD
10_1101-2021_01_06_425657	458	47	228	228	CD
10_1101-2021_01_06_425657	458	48	614	614	CD
10_1101-2021_01_06_425657	458	49	616	616	CD
10_1101-2021_01_06_425657	458	50	622	622	CD
10_1101-2021_01_06_425657	458	51	630	630	CD
10_1101-2021_01_06_425657	458	52	236	236	CD
10_1101-2021_01_06_425657	458	53	239	239	CD
10_1101-2021_01_06_425657	458	54	293	293	CD
10_1101-2021_01_06_425657	458	55	374	374	CD
10_1101-2021_01_06_425657	458	56	414	414	CD
10_1101-2021_01_06_425657	458	57	426	426	CD
10_1101-2021_01_06_425657	458	58	436	436	CD
10_1101-2021_01_06_425657	458	59	439	439	CD
10_1101-2021_01_06_425657	458	60	455	455	CD
10_1101-2021_01_06_425657	458	61	528	528	CD
10_1101-2021_01_06_425657	458	62	544	544	CD
10_1101-2021_01_06_425657	458	63	584	584	CD
10_1101-2021_01_06_425657	458	64	640607	640607	CD
10_1101-2021_01_06_425657	458	65	-	-	SYM
10_1101-2021_01_06_425657	458	66	635550	635550	CD
10_1101-2021_01_06_425657	458	67	-	-	HYPH
10_1101-2021_01_06_425657	458	68	578509	578509	CD
10_1101-2021_01_06_425657	458	69	-	-	HYPH
10_1101-2021_01_06_425657	458	70	538461	538461	CD
10_1101-2021_01_06_425657	458	71	-	-	HYPH
10_1101-2021_01_06_425657	458	72	499419	499419	CD
10_1101-2021_01_06_425657	458	73	-	-	HYPH
10_1101-2021_01_06_425657	458	74	449380	449380	CD
10_1101-2021_01_06_425657	458	75	-	-	HYPH
10_1101-2021_01_06_425657	458	76	408340	408340	CD
10_1101-2021_01_06_425657	458	77	-	-	HYPH
10_1101-2021_01_06_425657	458	78	368300	368300	CD
10_1101-2021_01_06_425657	458	79	-	-	HYPH
10_1101-2021_01_06_425657	458	80	328180	328180	CD
10_1101-2021_01_06_425657	458	81	-	-	HYPH
10_1101-2021_01_06_425657	458	82	227a.a	227a.a	CD
10_1101-2021_01_06_425657	458	83	.	.	.
10_1101-2021_01_06_425657	459	1	1	1	CD
10_1101-2021_01_06_425657	459	2	SCF	scf	NN
10_1101-2021_01_06_425657	459	3	-	-	HYPH
10_1101-2021_01_06_425657	459	4	Binding	bind	VBG
10_1101-2021_01_06_425657	459	5	Met4-BindingA	Met4-BindingA	VBZ
10_1101-2021_01_06_425657	459	6	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	459	7	B	B	NNP
10_1101-2021_01_06_425657	459	8	75	75	CD
10_1101-2021_01_06_425657	459	9	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	10	100	100	CD
10_1101-2021_01_06_425657	459	11	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	12	100	100	CD
10_1101-2021_01_06_425657	459	13	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	14	150	150	CD
10_1101-2021_01_06_425657	459	15	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	16	75	75	CD
10_1101-2021_01_06_425657	459	17	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	18	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	459	19	-	-	HYPH
10_1101-2021_01_06_425657	459	20	mal	mal	NNP
10_1101-2021_01_06_425657	459	21	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	459	22	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	459	23	-	-	HYPH
10_1101-2021_01_06_425657	459	24	mal	mal	JJ
10_1101-2021_01_06_425657	459	25	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	459	26	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	459	27	Rich	Rich	NNP
10_1101-2021_01_06_425657	459	28	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	459	29	150	150	CD
10_1101-2021_01_06_425657	459	30	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	31	−Sulfur	−sulfur	CD
10_1101-2021_01_06_425657	459	32	+	+	CC
10_1101-2021_01_06_425657	459	33	Met	Met	NNP
10_1101-2021_01_06_425657	459	34	/	/	SYM
10_1101-2021_01_06_425657	459	35	Cys	Cys	NNP
10_1101-2021_01_06_425657	459	36	/	/	SYM
10_1101-2021_01_06_425657	459	37	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	459	38	Time	Time	NNP
10_1101-2021_01_06_425657	459	39	(	(	-LRB-
10_1101-2021_01_06_425657	459	40	min	min	NNP
10_1101-2021_01_06_425657	459	41	)	)	-RRB-
10_1101-2021_01_06_425657	459	42	0	0	CD
10_1101-2021_01_06_425657	459	43	15	15	CD
10_1101-2021_01_06_425657	459	44	60	60	CD
10_1101-2021_01_06_425657	459	45	15	15	CD
10_1101-2021_01_06_425657	459	46	60	60	CD
10_1101-2021_01_06_425657	459	47	Lactate	Lactate	NNP
10_1101-2021_01_06_425657	459	48	(	(	-LRB-
10_1101-2021_01_06_425657	459	49	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	459	50	)	)	-RRB-
10_1101-2021_01_06_425657	459	51	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	459	52	C	C	NNP
10_1101-2021_01_06_425657	459	53	75	75	CD
10_1101-2021_01_06_425657	459	54	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	55	100	100	CD
10_1101-2021_01_06_425657	459	56	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	57	100	100	CD
10_1101-2021_01_06_425657	459	58	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	59	150	150	CD
10_1101-2021_01_06_425657	459	60	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	61	75	75	CD
10_1101-2021_01_06_425657	459	62	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	63	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	459	64	-	-	HYPH
10_1101-2021_01_06_425657	459	65	mal	mal	NNP
10_1101-2021_01_06_425657	459	66	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	459	67	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	459	68	-	-	HYPH
10_1101-2021_01_06_425657	459	69	mal	mal	JJ
10_1101-2021_01_06_425657	459	70	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	459	71	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	459	72	+	+	CC
10_1101-2021_01_06_425657	459	73	Met	Met	NNP
10_1101-2021_01_06_425657	459	74	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	459	75	150	150	CD
10_1101-2021_01_06_425657	459	76	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	77	−Sulfur	−sulfur	CD
10_1101-2021_01_06_425657	459	78	+	+	CC
10_1101-2021_01_06_425657	459	79	Met	Met	NNP
10_1101-2021_01_06_425657	459	80	/	/	SYM
10_1101-2021_01_06_425657	459	81	Cys	Cys	NNP
10_1101-2021_01_06_425657	459	82	/	/	SYM
10_1101-2021_01_06_425657	459	83	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	459	84	Time	Time	NNP
10_1101-2021_01_06_425657	459	85	(	(	-LRB-
10_1101-2021_01_06_425657	459	86	min	min	NNP
10_1101-2021_01_06_425657	459	87	)	)	-RRB-
10_1101-2021_01_06_425657	459	88	0	0	NFP
10_1101-2021_01_06_425657	459	89	90	90	CD
10_1101-2021_01_06_425657	459	90	180	180	CD
10_1101-2021_01_06_425657	459	91	15	15	CD
10_1101-2021_01_06_425657	459	92	60	60	CD
10_1101-2021_01_06_425657	459	93	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	459	94	(	(	-LRB-
10_1101-2021_01_06_425657	459	95	glycolytic	glycolytic	JJ
10_1101-2021_01_06_425657	459	96	)	)	-RRB-
10_1101-2021_01_06_425657	459	97	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	459	98	D	D	NNP
10_1101-2021_01_06_425657	459	99	75	75	CD
10_1101-2021_01_06_425657	459	100	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	101	100	100	CD
10_1101-2021_01_06_425657	459	102	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	103	100	100	CD
10_1101-2021_01_06_425657	459	104	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	105	150	150	CD
10_1101-2021_01_06_425657	459	106	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	107	75	75	CD
10_1101-2021_01_06_425657	459	108	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	109	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	459	110	-	-	HYPH
10_1101-2021_01_06_425657	459	111	mal	mal	JJ
10_1101-2021_01_06_425657	459	112	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	459	113	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	459	114	Rich	Rich	NNP
10_1101-2021_01_06_425657	459	115	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	459	116	150	150	CD
10_1101-2021_01_06_425657	459	117	kDa	kDa	NNS
10_1101-2021_01_06_425657	459	118	−Sulfur	−sulfur	CD
10_1101-2021_01_06_425657	459	119	+	+	SYM
10_1101-2021_01_06_425657	459	120	DTT	DTT	NNP
10_1101-2021_01_06_425657	459	121	Time	Time	NNP
10_1101-2021_01_06_425657	459	122	(	(	-LRB-
10_1101-2021_01_06_425657	459	123	min	min	NNP
10_1101-2021_01_06_425657	459	124	)	)	-RRB-
10_1101-2021_01_06_425657	459	125	0	0	CD
10_1101-2021_01_06_425657	459	126	15	15	CD
10_1101-2021_01_06_425657	459	127	15	15	CD
10_1101-2021_01_06_425657	459	128	Lactate	Lactate	NNP
10_1101-2021_01_06_425657	459	129	(	(	-LRB-
10_1101-2021_01_06_425657	459	130	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	459	131	)	)	-RRB-
10_1101-2021_01_06_425657	459	132	Figure	figure	NN
10_1101-2021_01_06_425657	459	133	2	2	CD
10_1101-2021_01_06_425657	459	134	Ub	Ub	NNP
10_1101-2021_01_06_425657	459	135	-	-	HYPH
10_1101-2021_01_06_425657	459	136	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	459	137	Red	Red	NNP
10_1101-2021_01_06_425657	459	138	-	-	HYPH
10_1101-2021_01_06_425657	459	139	Met30	Met30	NNP
10_1101-2021_01_06_425657	459	140	Ox	Ox	NNP
10_1101-2021_01_06_425657	459	141	-	-	HYPH
10_1101-2021_01_06_425657	459	142	Met30	Met30	NNP
10_1101-2021_01_06_425657	459	143	Ub	Ub	NNP
10_1101-2021_01_06_425657	459	144	-	-	HYPH
10_1101-2021_01_06_425657	459	145	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	459	146	Red	Red	NNP
10_1101-2021_01_06_425657	459	147	-	-	HYPH
10_1101-2021_01_06_425657	459	148	Met30	Met30	NNP
10_1101-2021_01_06_425657	459	149	Ox	Ox	NNP
10_1101-2021_01_06_425657	459	150	-	-	HYPH
10_1101-2021_01_06_425657	459	151	Met30	Met30	NNP
10_1101-2021_01_06_425657	459	152	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	459	153	-	-	HYPH
10_1101-2021_01_06_425657	459	154	mal	mal	JJ
10_1101-2021_01_06_425657	459	155	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	459	156	Red	Red	NNP
10_1101-2021_01_06_425657	459	157	-	-	HYPH
10_1101-2021_01_06_425657	459	158	Met30	Met30	NNP
10_1101-2021_01_06_425657	459	159	Ox	Ox	NNP
10_1101-2021_01_06_425657	459	160	-	-	HYPH
10_1101-2021_01_06_425657	459	161	Met30	Met30	NNP
10_1101-2021_01_06_425657	459	162	Ub	Ub	NNP
10_1101-2021_01_06_425657	459	163	-	-	HYPH
10_1101-2021_01_06_425657	459	164	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	459	165	Ox	Ox	NNP
10_1101-2021_01_06_425657	459	166	Red	Red	NNP
10_1101-2021_01_06_425657	459	167	.CC	.CC	NFP
10_1101-2021_01_06_425657	459	168	-	-	:
10_1101-2021_01_06_425657	459	169	BY	by	IN
10_1101-2021_01_06_425657	459	170	4.0	4.0	CD
10_1101-2021_01_06_425657	459	171	International	International	NNP
10_1101-2021_01_06_425657	459	172	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	459	173	under	under	IN
10_1101-2021_01_06_425657	459	174	a	a	DT
10_1101-2021_01_06_425657	459	175	(	(	-LRB-
10_1101-2021_01_06_425657	459	176	which	which	WDT
10_1101-2021_01_06_425657	459	177	was	be	VBD
10_1101-2021_01_06_425657	459	178	not	not	RB
10_1101-2021_01_06_425657	459	179	certified	certify	VBN
10_1101-2021_01_06_425657	459	180	by	by	IN
10_1101-2021_01_06_425657	459	181	peer	peer	NN
10_1101-2021_01_06_425657	459	182	review	review	NN
10_1101-2021_01_06_425657	459	183	)	)	-RRB-
10_1101-2021_01_06_425657	459	184	is	be	VBZ
10_1101-2021_01_06_425657	459	185	the	the	DT
10_1101-2021_01_06_425657	459	186	author	author	NN
10_1101-2021_01_06_425657	459	187	/	/	SYM
10_1101-2021_01_06_425657	459	188	funder	funder	NN
10_1101-2021_01_06_425657	459	189	,	,	,
10_1101-2021_01_06_425657	459	190	who	who	WP
10_1101-2021_01_06_425657	459	191	has	have	VBZ
10_1101-2021_01_06_425657	459	192	granted	grant	VBN
10_1101-2021_01_06_425657	459	193	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	459	194	a	a	DT
10_1101-2021_01_06_425657	459	195	license	license	NN
10_1101-2021_01_06_425657	459	196	to	to	TO
10_1101-2021_01_06_425657	459	197	display	display	VB
10_1101-2021_01_06_425657	459	198	the	the	DT
10_1101-2021_01_06_425657	459	199	preprint	preprint	NN
10_1101-2021_01_06_425657	459	200	in	in	IN
10_1101-2021_01_06_425657	459	201	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	459	202	.	.	.
10_1101-2021_01_06_425657	460	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	460	2	is	be	VBZ
10_1101-2021_01_06_425657	460	3	made	make	VBN
10_1101-2021_01_06_425657	460	4	The	the	DT
10_1101-2021_01_06_425657	460	5	copyright	copyright	NN
10_1101-2021_01_06_425657	460	6	holder	holder	NN
10_1101-2021_01_06_425657	460	7	for	for	IN
10_1101-2021_01_06_425657	460	8	this	this	DT
10_1101-2021_01_06_425657	460	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	460	10	version	version	NN
10_1101-2021_01_06_425657	460	11	posted	post	VBD
10_1101-2021_01_06_425657	460	12	January	January	NNP
10_1101-2021_01_06_425657	460	13	7	7	CD
10_1101-2021_01_06_425657	460	14	,	,	,
10_1101-2021_01_06_425657	460	15	2021	2021	CD
10_1101-2021_01_06_425657	460	16	.	.	.
10_1101-2021_01_06_425657	460	17	;	;	:
10_1101-2021_01_06_425657	460	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	460	19	:	:	:
10_1101-2021_01_06_425657	460	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	460	21	preprint	preprint	NN
10_1101-2021_01_06_425657	460	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	460	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	460	24	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	460	25	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	460	26	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	460	27	75	75	CD
10_1101-2021_01_06_425657	460	28	kDa	kDa	NNS
10_1101-2021_01_06_425657	460	29	100	100	CD
10_1101-2021_01_06_425657	460	30	kDa	kDa	NNS
10_1101-2021_01_06_425657	460	31	150	150	CD
10_1101-2021_01_06_425657	460	32	kDa	kDa	NNS
10_1101-2021_01_06_425657	460	33	100	100	CD
10_1101-2021_01_06_425657	460	34	kDa	kDa	NNS
10_1101-2021_01_06_425657	460	35	150	150	CD
10_1101-2021_01_06_425657	460	36	kDa	kDa	NNS
10_1101-2021_01_06_425657	460	37	75	75	CD
10_1101-2021_01_06_425657	460	38	kDa	kDa	NNS
10_1101-2021_01_06_425657	460	39	Lactate	Lactate	NNP
10_1101-2021_01_06_425657	460	40	(	(	-LRB-
10_1101-2021_01_06_425657	460	41	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	460	42	)	)	-RRB-
10_1101-2021_01_06_425657	460	43	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	460	44	-	-	HYPH
10_1101-2021_01_06_425657	460	45	mal	mal	JJ
10_1101-2021_01_06_425657	460	46	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	460	47	Rich	Rich	NNP
10_1101-2021_01_06_425657	460	48	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	460	49	+	+	CC
10_1101-2021_01_06_425657	460	50	Met	Met	NNP
10_1101-2021_01_06_425657	460	51	/	/	SYM
10_1101-2021_01_06_425657	460	52	Cys	Cys	NNP
10_1101-2021_01_06_425657	460	53	/	/	SYM
10_1101-2021_01_06_425657	460	54	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	460	55	Time	Time	NNP
10_1101-2021_01_06_425657	460	56	(	(	-LRB-
10_1101-2021_01_06_425657	460	57	min	min	NNP
10_1101-2021_01_06_425657	460	58	)	)	-RRB-
10_1101-2021_01_06_425657	460	59	0	0	CD
10_1101-2021_01_06_425657	460	60	15	15	CD
10_1101-2021_01_06_425657	460	61	60	60	CD
10_1101-2021_01_06_425657	460	62	15	15	CD
10_1101-2021_01_06_425657	460	63	60	60	CD
10_1101-2021_01_06_425657	460	64	WT	WT	NNP
10_1101-2021_01_06_425657	460	65	Rich	Rich	NNP
10_1101-2021_01_06_425657	460	66	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	460	67	+	+	CC
10_1101-2021_01_06_425657	460	68	Met	Met	NNP
10_1101-2021_01_06_425657	460	69	/	/	SYM
10_1101-2021_01_06_425657	460	70	Cys	Cys	NNP
10_1101-2021_01_06_425657	460	71	/	/	SYM
10_1101-2021_01_06_425657	460	72	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	460	73	0	0	CD
10_1101-2021_01_06_425657	460	74	15	15	CD
10_1101-2021_01_06_425657	460	75	60	60	CD
10_1101-2021_01_06_425657	460	76	15	15	CD
10_1101-2021_01_06_425657	460	77	60	60	CD
10_1101-2021_01_06_425657	460	78	C414S	c414s	CD
10_1101-2021_01_06_425657	460	79	Rich	Rich	NNP
10_1101-2021_01_06_425657	460	80	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	460	81	+	+	CC
10_1101-2021_01_06_425657	460	82	Met	Met	NNP
10_1101-2021_01_06_425657	460	83	/	/	SYM
10_1101-2021_01_06_425657	460	84	Cys	Cys	NNP
10_1101-2021_01_06_425657	460	85	/	/	SYM
10_1101-2021_01_06_425657	460	86	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	460	87	0	0	CD
10_1101-2021_01_06_425657	460	88	15	15	CD
10_1101-2021_01_06_425657	460	89	60	60	CD
10_1101-2021_01_06_425657	460	90	15	15	CD
10_1101-2021_01_06_425657	460	91	60	60	CD
10_1101-2021_01_06_425657	460	92	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	460	93	A	a	NN
10_1101-2021_01_06_425657	460	94	R	r	NN
10_1101-2021_01_06_425657	460	95	-S	-S	HYPH
10_1101-2021_01_06_425657	460	96	15	15	CD
10_1101-2021_01_06_425657	460	97	-S	-s	CD
10_1101-2021_01_06_425657	460	98	60	60	CD
10_1101-2021_01_06_425657	460	99	+	+	NN
10_1101-2021_01_06_425657	460	100	M	M	NNP
10_1101-2021_01_06_425657	460	101	CH	CH	NNP
10_1101-2021_01_06_425657	460	102	15	15	CD
10_1101-2021_01_06_425657	460	103	+	+	NN
10_1101-2021_01_06_425657	460	104	M	M	NNP
10_1101-2021_01_06_425657	460	105	CH	CH	NNP
10_1101-2021_01_06_425657	460	106	60	60	CD
10_1101-2021_01_06_425657	460	107	R	r	NN
10_1101-2021_01_06_425657	460	108	-S	-S	HYPH
10_1101-2021_01_06_425657	460	109	15	15	CD
10_1101-2021_01_06_425657	460	110	-S	-s	CD
10_1101-2021_01_06_425657	460	111	60	60	CD
10_1101-2021_01_06_425657	460	112	+	+	NN
10_1101-2021_01_06_425657	460	113	M	M	NNP
10_1101-2021_01_06_425657	460	114	CH	CH	NNP
10_1101-2021_01_06_425657	460	115	15	15	CD
10_1101-2021_01_06_425657	460	116	+	+	NN
10_1101-2021_01_06_425657	460	117	M	M	NNP
10_1101-2021_01_06_425657	460	118	CH	CH	NNP
10_1101-2021_01_06_425657	460	119	60	60	CD
10_1101-2021_01_06_425657	460	120	R	r	NN
10_1101-2021_01_06_425657	460	121	-S	-S	HYPH
10_1101-2021_01_06_425657	460	122	15	15	CD
10_1101-2021_01_06_425657	460	123	-S	-s	CD
10_1101-2021_01_06_425657	460	124	60	60	CD
10_1101-2021_01_06_425657	460	125	+	+	NN
10_1101-2021_01_06_425657	460	126	M	M	NNP
10_1101-2021_01_06_425657	460	127	CH	CH	NNP
10_1101-2021_01_06_425657	460	128	15	15	CD
10_1101-2021_01_06_425657	460	129	+	+	NN
10_1101-2021_01_06_425657	460	130	M	M	NNP
10_1101-2021_01_06_425657	460	131	CH	CH	NNP
10_1101-2021_01_06_425657	460	132	60	60	CD
10_1101-2021_01_06_425657	460	133	0	0	CD
10_1101-2021_01_06_425657	460	134	2	2	CD
10_1101-2021_01_06_425657	460	135	4	4	CD
10_1101-2021_01_06_425657	460	136	6	6	CD
10_1101-2021_01_06_425657	460	137	R	r	NN
10_1101-2021_01_06_425657	460	138	el	el	NN
10_1101-2021_01_06_425657	460	139	at	at	IN
10_1101-2021_01_06_425657	460	140	iv	iv	NNP
10_1101-2021_01_06_425657	460	141	e	e	NNP
10_1101-2021_01_06_425657	460	142	m	m	NNP
10_1101-2021_01_06_425657	460	143	R	R	NNP
10_1101-2021_01_06_425657	460	144	N	N	NNP
10_1101-2021_01_06_425657	460	145	A	A	NNP
10_1101-2021_01_06_425657	460	146	E	e	NN
10_1101-2021_01_06_425657	460	147	xp	xp	NN
10_1101-2021_01_06_425657	460	148	re	re	NN
10_1101-2021_01_06_425657	460	149	ss	ss	NNP
10_1101-2021_01_06_425657	460	150	io	io	NNP
10_1101-2021_01_06_425657	460	151	n	n	CC
10_1101-2021_01_06_425657	460	152	MET17	MET17	NNP
10_1101-2021_01_06_425657	460	153	R	R	NNP
10_1101-2021_01_06_425657	460	154	-S	-S	NNP
10_1101-2021_01_06_425657	460	155	15	15	CD
10_1101-2021_01_06_425657	460	156	-S	-s	CD
10_1101-2021_01_06_425657	460	157	60	60	CD
10_1101-2021_01_06_425657	460	158	+	+	NN
10_1101-2021_01_06_425657	460	159	M	M	NNP
10_1101-2021_01_06_425657	460	160	CH	CH	NNP
10_1101-2021_01_06_425657	460	161	15	15	CD
10_1101-2021_01_06_425657	460	162	+	+	NN
10_1101-2021_01_06_425657	460	163	M	M	NNP
10_1101-2021_01_06_425657	460	164	CH	CH	NNP
10_1101-2021_01_06_425657	460	165	60	60	CD
10_1101-2021_01_06_425657	460	166	R	r	NN
10_1101-2021_01_06_425657	460	167	-S	-S	HYPH
10_1101-2021_01_06_425657	460	168	15	15	CD
10_1101-2021_01_06_425657	460	169	-S	-s	CD
10_1101-2021_01_06_425657	460	170	60	60	CD
10_1101-2021_01_06_425657	460	171	+	+	NN
10_1101-2021_01_06_425657	460	172	M	M	NNP
10_1101-2021_01_06_425657	460	173	CH	CH	NNP
10_1101-2021_01_06_425657	460	174	15	15	CD
10_1101-2021_01_06_425657	460	175	+	+	NN
10_1101-2021_01_06_425657	460	176	M	M	NNP
10_1101-2021_01_06_425657	460	177	CH	CH	NNP
10_1101-2021_01_06_425657	460	178	60	60	CD
10_1101-2021_01_06_425657	460	179	R	r	NN
10_1101-2021_01_06_425657	460	180	-S	-S	HYPH
10_1101-2021_01_06_425657	460	181	15	15	CD
10_1101-2021_01_06_425657	460	182	-S	-s	CD
10_1101-2021_01_06_425657	460	183	60	60	CD
10_1101-2021_01_06_425657	460	184	+	+	NN
10_1101-2021_01_06_425657	460	185	M	M	NNP
10_1101-2021_01_06_425657	460	186	CH	CH	NNP
10_1101-2021_01_06_425657	460	187	15	15	CD
10_1101-2021_01_06_425657	460	188	+	+	NN
10_1101-2021_01_06_425657	460	189	M	M	NNP
10_1101-2021_01_06_425657	460	190	CH	CH	NNP
10_1101-2021_01_06_425657	460	191	60	60	CD
10_1101-2021_01_06_425657	460	192	0	0	CD
10_1101-2021_01_06_425657	460	193	10	10	CD
10_1101-2021_01_06_425657	460	194	20	20	CD
10_1101-2021_01_06_425657	460	195	30	30	CD
10_1101-2021_01_06_425657	460	196	R	r	NN
10_1101-2021_01_06_425657	460	197	el	el	NNP
10_1101-2021_01_06_425657	460	198	at	at	IN
10_1101-2021_01_06_425657	460	199	iv	iv	NNP
10_1101-2021_01_06_425657	460	200	e	e	NNP
10_1101-2021_01_06_425657	460	201	m	m	NNP
10_1101-2021_01_06_425657	460	202	R	R	NNP
10_1101-2021_01_06_425657	460	203	N	N	NNP
10_1101-2021_01_06_425657	460	204	A	A	NNP
10_1101-2021_01_06_425657	460	205	E	e	NN
10_1101-2021_01_06_425657	460	206	xp	xp	NN
10_1101-2021_01_06_425657	460	207	re	re	NN
10_1101-2021_01_06_425657	460	208	ss	ss	NNP
10_1101-2021_01_06_425657	460	209	io	io	NNP
10_1101-2021_01_06_425657	460	210	n	n	CC
10_1101-2021_01_06_425657	460	211	SAM1	SAM1	NNP
10_1101-2021_01_06_425657	460	212	R	R	NNP
10_1101-2021_01_06_425657	460	213	-S	-S	NNP
10_1101-2021_01_06_425657	460	214	15	15	CD
10_1101-2021_01_06_425657	460	215	-S	-s	CD
10_1101-2021_01_06_425657	460	216	60	60	CD
10_1101-2021_01_06_425657	460	217	+	+	NN
10_1101-2021_01_06_425657	460	218	M	M	NNP
10_1101-2021_01_06_425657	460	219	CH	CH	NNP
10_1101-2021_01_06_425657	460	220	15	15	CD
10_1101-2021_01_06_425657	460	221	+	+	NN
10_1101-2021_01_06_425657	460	222	M	M	NNP
10_1101-2021_01_06_425657	460	223	CH	CH	NNP
10_1101-2021_01_06_425657	460	224	60	60	CD
10_1101-2021_01_06_425657	460	225	R	r	NN
10_1101-2021_01_06_425657	460	226	-S	-S	HYPH
10_1101-2021_01_06_425657	460	227	15	15	CD
10_1101-2021_01_06_425657	460	228	-S	-s	CD
10_1101-2021_01_06_425657	460	229	60	60	CD
10_1101-2021_01_06_425657	460	230	+	+	NN
10_1101-2021_01_06_425657	460	231	M	M	NNP
10_1101-2021_01_06_425657	460	232	CH	CH	NNP
10_1101-2021_01_06_425657	460	233	15	15	CD
10_1101-2021_01_06_425657	460	234	+	+	NN
10_1101-2021_01_06_425657	460	235	M	M	NNP
10_1101-2021_01_06_425657	460	236	CH	CH	NNP
10_1101-2021_01_06_425657	460	237	60	60	CD
10_1101-2021_01_06_425657	460	238	R	r	NN
10_1101-2021_01_06_425657	460	239	-S	-S	HYPH
10_1101-2021_01_06_425657	460	240	15	15	CD
10_1101-2021_01_06_425657	460	241	-S	-s	CD
10_1101-2021_01_06_425657	460	242	60	60	CD
10_1101-2021_01_06_425657	460	243	+	+	NN
10_1101-2021_01_06_425657	460	244	M	M	NNP
10_1101-2021_01_06_425657	460	245	CH	CH	NNP
10_1101-2021_01_06_425657	460	246	15	15	CD
10_1101-2021_01_06_425657	460	247	+	+	NN
10_1101-2021_01_06_425657	460	248	M	M	NNP
10_1101-2021_01_06_425657	460	249	CH	CH	NNP
10_1101-2021_01_06_425657	460	250	60	60	CD
10_1101-2021_01_06_425657	460	251	0	0	CD
10_1101-2021_01_06_425657	460	252	5	5	CD
10_1101-2021_01_06_425657	460	253	10	10	CD
10_1101-2021_01_06_425657	460	254	15	15	CD
10_1101-2021_01_06_425657	460	255	GSH1	GSH1	NNS
10_1101-2021_01_06_425657	460	256	R	R	NNP
10_1101-2021_01_06_425657	460	257	el	el	NNP
10_1101-2021_01_06_425657	460	258	at	at	IN
10_1101-2021_01_06_425657	460	259	iv	iv	NNP
10_1101-2021_01_06_425657	460	260	e	e	NNP
10_1101-2021_01_06_425657	460	261	m	m	NNP
10_1101-2021_01_06_425657	460	262	R	R	NNP
10_1101-2021_01_06_425657	460	263	N	N	NNP
10_1101-2021_01_06_425657	460	264	A	A	NNP
10_1101-2021_01_06_425657	460	265	E	e	NN
10_1101-2021_01_06_425657	460	266	xp	xp	NN
10_1101-2021_01_06_425657	460	267	re	re	NN
10_1101-2021_01_06_425657	460	268	ss	ss	NNP
10_1101-2021_01_06_425657	460	269	io	io	NNP
10_1101-2021_01_06_425657	460	270	n	n	NNP
10_1101-2021_01_06_425657	460	271	WT	WT	NNP
10_1101-2021_01_06_425657	460	272	C414S	C414S	NNP
10_1101-2021_01_06_425657	460	273	C614/616/	c614/616/	NN
10_1101-2021_01_06_425657	460	274	622/630S	622/630s	CD
10_1101-2021_01_06_425657	460	275	B	B	NNP
10_1101-2021_01_06_425657	460	276	0.0	0.0	CD
10_1101-2021_01_06_425657	460	277	1.5	1.5	CD
10_1101-2021_01_06_425657	460	278	3.0	3.0	CD
10_1101-2021_01_06_425657	460	279	4.5	4.5	CD
10_1101-2021_01_06_425657	460	280	6.0	6.0	CD
10_1101-2021_01_06_425657	460	281	7.5	7.5	CD
10_1101-2021_01_06_425657	460	282	9.0	9.0	CD
10_1101-2021_01_06_425657	460	283	0.0	0.0	CD
10_1101-2021_01_06_425657	460	284	0.5	0.5	CD
10_1101-2021_01_06_425657	460	285	1.0	1.0	CD
10_1101-2021_01_06_425657	460	286	1.5	1.5	CD
10_1101-2021_01_06_425657	460	287	Time	time	NN
10_1101-2021_01_06_425657	460	288	(	(	-LRB-
10_1101-2021_01_06_425657	460	289	h	h	NNP
10_1101-2021_01_06_425657	460	290	)	)	-RRB-
10_1101-2021_01_06_425657	460	291	in	in	IN
10_1101-2021_01_06_425657	460	292	YPL	YPL	NNP
10_1101-2021_01_06_425657	460	293	O	o	NN
10_1101-2021_01_06_425657	460	294	D	D	NNP
10_1101-2021_01_06_425657	460	295	60	60	CD
10_1101-2021_01_06_425657	460	296	0	0	CD
10_1101-2021_01_06_425657	460	297	WT	WT	NNP
10_1101-2021_01_06_425657	460	298	C414S	C414S	NNP
10_1101-2021_01_06_425657	460	299	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	460	300	C	C	NNP
10_1101-2021_01_06_425657	460	301	0	0	CD
10_1101-2021_01_06_425657	460	302	3	3	CD
10_1101-2021_01_06_425657	460	303	6	6	CD
10_1101-2021_01_06_425657	460	304	9	9	CD
10_1101-2021_01_06_425657	460	305	12	12	CD
10_1101-2021_01_06_425657	460	306	15	15	CD
10_1101-2021_01_06_425657	460	307	18	18	CD
10_1101-2021_01_06_425657	460	308	21	21	CD
10_1101-2021_01_06_425657	460	309	24	24	CD
10_1101-2021_01_06_425657	460	310	0.0	0.0	CD
10_1101-2021_01_06_425657	460	311	0.1	0.1	CD
10_1101-2021_01_06_425657	460	312	0.2	0.2	CD
10_1101-2021_01_06_425657	460	313	0.3	0.3	CD
10_1101-2021_01_06_425657	460	314	0.4	0.4	CD
10_1101-2021_01_06_425657	460	315	0.5	0.5	CD
10_1101-2021_01_06_425657	460	316	Time	time	NN
10_1101-2021_01_06_425657	460	317	(	(	-LRB-
10_1101-2021_01_06_425657	460	318	h	h	NNP
10_1101-2021_01_06_425657	460	319	)	)	-RRB-
10_1101-2021_01_06_425657	460	320	in	in	IN
10_1101-2021_01_06_425657	460	321	SFL	SFL	NNP
10_1101-2021_01_06_425657	460	322	+	+	CC
10_1101-2021_01_06_425657	460	323	0.2	0.2	CD
10_1101-2021_01_06_425657	460	324	mM	mm	NN
10_1101-2021_01_06_425657	460	325	Hcy	Hcy	NNP
10_1101-2021_01_06_425657	460	326	after	after	IN
10_1101-2021_01_06_425657	460	327	switch	switch	NN
10_1101-2021_01_06_425657	460	328	O	o	NN
10_1101-2021_01_06_425657	460	329	D	d	NN
10_1101-2021_01_06_425657	460	330	60	60	CD
10_1101-2021_01_06_425657	460	331	0	0	CD
10_1101-2021_01_06_425657	460	332	WT	WT	NNP
10_1101-2021_01_06_425657	460	333	C414S	C414S	NNP
10_1101-2021_01_06_425657	460	334	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	460	335	Figure	Figure	NNP
10_1101-2021_01_06_425657	460	336	3	3	CD
10_1101-2021_01_06_425657	460	337	Ub	Ub	NNP
10_1101-2021_01_06_425657	460	338	-	-	HYPH
10_1101-2021_01_06_425657	460	339	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	460	340	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	460	341	-	-	HYPH
10_1101-2021_01_06_425657	460	342	mal	mal	JJ
10_1101-2021_01_06_425657	460	343	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	460	344	Red	Red	NNP
10_1101-2021_01_06_425657	460	345	-	-	HYPH
10_1101-2021_01_06_425657	460	346	Met30	Met30	NNP
10_1101-2021_01_06_425657	460	347	Ox	Ox	NNP
10_1101-2021_01_06_425657	460	348	-	-	HYPH
10_1101-2021_01_06_425657	460	349	Met30	Met30	NNP
10_1101-2021_01_06_425657	460	350	.CC	.CC	,
10_1101-2021_01_06_425657	460	351	-	-	:
10_1101-2021_01_06_425657	460	352	BY	by	IN
10_1101-2021_01_06_425657	460	353	4.0	4.0	CD
10_1101-2021_01_06_425657	460	354	International	International	NNP
10_1101-2021_01_06_425657	460	355	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	460	356	under	under	IN
10_1101-2021_01_06_425657	460	357	a	a	DT
10_1101-2021_01_06_425657	460	358	(	(	-LRB-
10_1101-2021_01_06_425657	460	359	which	which	WDT
10_1101-2021_01_06_425657	460	360	was	be	VBD
10_1101-2021_01_06_425657	460	361	not	not	RB
10_1101-2021_01_06_425657	460	362	certified	certify	VBN
10_1101-2021_01_06_425657	460	363	by	by	IN
10_1101-2021_01_06_425657	460	364	peer	peer	NN
10_1101-2021_01_06_425657	460	365	review	review	NN
10_1101-2021_01_06_425657	460	366	)	)	-RRB-
10_1101-2021_01_06_425657	460	367	is	be	VBZ
10_1101-2021_01_06_425657	460	368	the	the	DT
10_1101-2021_01_06_425657	460	369	author	author	NN
10_1101-2021_01_06_425657	460	370	/	/	SYM
10_1101-2021_01_06_425657	460	371	funder	funder	NN
10_1101-2021_01_06_425657	460	372	,	,	,
10_1101-2021_01_06_425657	460	373	who	who	WP
10_1101-2021_01_06_425657	460	374	has	have	VBZ
10_1101-2021_01_06_425657	460	375	granted	grant	VBN
10_1101-2021_01_06_425657	460	376	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	460	377	a	a	DT
10_1101-2021_01_06_425657	460	378	license	license	NN
10_1101-2021_01_06_425657	460	379	to	to	TO
10_1101-2021_01_06_425657	460	380	display	display	VB
10_1101-2021_01_06_425657	460	381	the	the	DT
10_1101-2021_01_06_425657	460	382	preprint	preprint	NN
10_1101-2021_01_06_425657	460	383	in	in	IN
10_1101-2021_01_06_425657	460	384	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	460	385	.	.	.
10_1101-2021_01_06_425657	461	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	461	2	is	be	VBZ
10_1101-2021_01_06_425657	461	3	made	make	VBN
10_1101-2021_01_06_425657	461	4	The	the	DT
10_1101-2021_01_06_425657	461	5	copyright	copyright	NN
10_1101-2021_01_06_425657	461	6	holder	holder	NN
10_1101-2021_01_06_425657	461	7	for	for	IN
10_1101-2021_01_06_425657	461	8	this	this	DT
10_1101-2021_01_06_425657	461	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	461	10	version	version	NN
10_1101-2021_01_06_425657	461	11	posted	post	VBD
10_1101-2021_01_06_425657	461	12	January	January	NNP
10_1101-2021_01_06_425657	461	13	7	7	CD
10_1101-2021_01_06_425657	461	14	,	,	,
10_1101-2021_01_06_425657	461	15	2021	2021	CD
10_1101-2021_01_06_425657	461	16	.	.	.
10_1101-2021_01_06_425657	461	17	;	;	:
10_1101-2021_01_06_425657	461	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	461	19	:	:	:
10_1101-2021_01_06_425657	461	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	461	21	preprint	preprint	NN
10_1101-2021_01_06_425657	461	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	461	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	461	24	75	75	CD
10_1101-2021_01_06_425657	461	25	kDa	kDa	NNS
10_1101-2021_01_06_425657	461	26	100	100	CD
10_1101-2021_01_06_425657	461	27	kDa	kDa	NNS
10_1101-2021_01_06_425657	461	28	150	150	CD
10_1101-2021_01_06_425657	461	29	kDa	kDa	NNS
10_1101-2021_01_06_425657	461	30	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	461	31	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	461	32	Time	Time	NNP
10_1101-2021_01_06_425657	461	33	(	(	-LRB-
10_1101-2021_01_06_425657	461	34	min	min	NNP
10_1101-2021_01_06_425657	461	35	)	)	-RRB-
10_1101-2021_01_06_425657	461	36	60	60	CD
10_1101-2021_01_06_425657	461	37	60	60	CD
10_1101-2021_01_06_425657	461	38	60	60	CD
10_1101-2021_01_06_425657	461	39	0	0	CD
10_1101-2021_01_06_425657	461	40	30	30	CD
10_1101-2021_01_06_425657	461	41	60	60	CD
10_1101-2021_01_06_425657	461	42	180	180	CD
10_1101-2021_01_06_425657	461	43	60	60	CD
10_1101-2021_01_06_425657	461	44	60	60	CD
10_1101-2021_01_06_425657	461	45	60	60	CD
10_1101-2021_01_06_425657	461	46	0	0	CD
10_1101-2021_01_06_425657	461	47	30	30	CD
10_1101-2021_01_06_425657	461	48	60	60	CD
10_1101-2021_01_06_425657	461	49	180	180	CD
10_1101-2021_01_06_425657	461	50	0	0	CD
10_1101-2021_01_06_425657	461	51	30	30	CD
10_1101-2021_01_06_425657	461	52	60	60	CD
10_1101-2021_01_06_425657	461	53	180	180	CD
10_1101-2021_01_06_425657	461	54	+	+	CD
10_1101-2021_01_06_425657	461	55	+	+	SYM
10_1101-2021_01_06_425657	461	56	−	−	NNP
10_1101-2021_01_06_425657	461	57	+	+	SYM
10_1101-2021_01_06_425657	461	58	+	+	SYM
10_1101-2021_01_06_425657	461	59	+	+	SYM
10_1101-2021_01_06_425657	461	60	+	+	SYM
10_1101-2021_01_06_425657	461	61	+	+	SYM
10_1101-2021_01_06_425657	461	62	+	+	SYM
10_1101-2021_01_06_425657	461	63	−	−	NNP
10_1101-2021_01_06_425657	461	64	+	+	SYM
10_1101-2021_01_06_425657	461	65	+	+	SYM
10_1101-2021_01_06_425657	461	66	+	+	SYM
10_1101-2021_01_06_425657	461	67	+	+	SYM
10_1101-2021_01_06_425657	461	68	+	+	SYM
10_1101-2021_01_06_425657	461	69	+	+	SYM
10_1101-2021_01_06_425657	461	70	+	+	SYM
10_1101-2021_01_06_425657	461	71	+	+	SYM
10_1101-2021_01_06_425657	461	72	+	+	SYM
10_1101-2021_01_06_425657	461	73	−	−	NNP
10_1101-2021_01_06_425657	461	74	+	+	SYM
10_1101-2021_01_06_425657	461	75	+	+	SYM
10_1101-2021_01_06_425657	461	76	+	+	SYM
10_1101-2021_01_06_425657	461	77	+	+	SYM
10_1101-2021_01_06_425657	461	78	+	+	SYM
10_1101-2021_01_06_425657	461	79	+	+	SYM
10_1101-2021_01_06_425657	461	80	−	−	NNP
10_1101-2021_01_06_425657	461	81	+	+	SYM
10_1101-2021_01_06_425657	461	82	+	+	SYM
10_1101-2021_01_06_425657	461	83	+	+	SYM
10_1101-2021_01_06_425657	461	84	+	+	SYM
10_1101-2021_01_06_425657	461	85	+	+	SYM
10_1101-2021_01_06_425657	461	86	+	+	SYM
10_1101-2021_01_06_425657	461	87	+	+	SYM
10_1101-2021_01_06_425657	461	88	+	+	SYM
10_1101-2021_01_06_425657	461	89	+	+	SYM
10_1101-2021_01_06_425657	461	90	−	−	NNP
10_1101-2021_01_06_425657	461	91	+	+	SYM
10_1101-2021_01_06_425657	461	92	+	+	SYM
10_1101-2021_01_06_425657	461	93	+	+	SYM
10_1101-2021_01_06_425657	461	94	+	+	SYM
10_1101-2021_01_06_425657	461	95	+	+	SYM
10_1101-2021_01_06_425657	461	96	+	+	SYM
10_1101-2021_01_06_425657	461	97	−	−	NNP
10_1101-2021_01_06_425657	461	98	+	+	SYM
10_1101-2021_01_06_425657	461	99	+	+	SYM
10_1101-2021_01_06_425657	461	100	+	+	SYM
10_1101-2021_01_06_425657	461	101	+	+	SYM
10_1101-2021_01_06_425657	461	102	+	+	SYM
10_1101-2021_01_06_425657	461	103	+	+	SYM
10_1101-2021_01_06_425657	461	104	+	+	SYM
10_1101-2021_01_06_425657	461	105	+	+	SYM
10_1101-2021_01_06_425657	461	106	+	+	SYM
10_1101-2021_01_06_425657	461	107	+	+	SYM
10_1101-2021_01_06_425657	461	108	Flag	flag	NN
10_1101-2021_01_06_425657	461	109	purification	purification	NN
10_1101-2021_01_06_425657	461	110	Rich	Rich	NNP
10_1101-2021_01_06_425657	461	111	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	461	112	Ubiquitin	Ubiquitin	NNP
10_1101-2021_01_06_425657	461	113	Met4	Met4	NNP
10_1101-2021_01_06_425657	461	114	+	+	SYM
10_1101-2021_01_06_425657	461	115	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	116	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	117	−DTT/	−dtt/	NN
10_1101-2021_01_06_425657	461	118	+	+	SYM
10_1101-2021_01_06_425657	461	119	TCEP	TCEP	NNP
10_1101-2021_01_06_425657	461	120	B	B	NNP
10_1101-2021_01_06_425657	461	121	75	75	CD
10_1101-2021_01_06_425657	461	122	kDa	kDa	NNS
10_1101-2021_01_06_425657	461	123	100	100	CD
10_1101-2021_01_06_425657	461	124	kDa	kDa	NNS
10_1101-2021_01_06_425657	461	125	150	150	CD
10_1101-2021_01_06_425657	461	126	kDa	kDa	NNS
10_1101-2021_01_06_425657	461	127	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	461	128	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	461	129	Time	Time	NNP
10_1101-2021_01_06_425657	461	130	(	(	-LRB-
10_1101-2021_01_06_425657	461	131	min	min	NNP
10_1101-2021_01_06_425657	461	132	)	)	-RRB-
10_1101-2021_01_06_425657	461	133	60	60	CD
10_1101-2021_01_06_425657	461	134	60	60	CD
10_1101-2021_01_06_425657	461	135	60	60	CD
10_1101-2021_01_06_425657	461	136	0	0	CD
10_1101-2021_01_06_425657	461	137	30	30	CD
10_1101-2021_01_06_425657	461	138	60	60	CD
10_1101-2021_01_06_425657	461	139	180	180	CD
10_1101-2021_01_06_425657	461	140	60	60	CD
10_1101-2021_01_06_425657	461	141	60	60	CD
10_1101-2021_01_06_425657	461	142	60	60	CD
10_1101-2021_01_06_425657	461	143	0	0	CD
10_1101-2021_01_06_425657	461	144	30	30	CD
10_1101-2021_01_06_425657	461	145	60	60	CD
10_1101-2021_01_06_425657	461	146	180	180	CD
10_1101-2021_01_06_425657	461	147	0	0	CD
10_1101-2021_01_06_425657	461	148	30	30	CD
10_1101-2021_01_06_425657	461	149	60	60	CD
10_1101-2021_01_06_425657	461	150	180	180	CD
10_1101-2021_01_06_425657	461	151	+	+	CD
10_1101-2021_01_06_425657	461	152	+	+	SYM
10_1101-2021_01_06_425657	461	153	−	−	NNP
10_1101-2021_01_06_425657	461	154	+	+	SYM
10_1101-2021_01_06_425657	461	155	+	+	SYM
10_1101-2021_01_06_425657	461	156	+	+	SYM
10_1101-2021_01_06_425657	461	157	+	+	SYM
10_1101-2021_01_06_425657	461	158	+	+	SYM
10_1101-2021_01_06_425657	461	159	+	+	SYM
10_1101-2021_01_06_425657	461	160	−	−	NNP
10_1101-2021_01_06_425657	461	161	+	+	SYM
10_1101-2021_01_06_425657	461	162	+	+	SYM
10_1101-2021_01_06_425657	461	163	+	+	SYM
10_1101-2021_01_06_425657	461	164	+	+	SYM
10_1101-2021_01_06_425657	461	165	+	+	SYM
10_1101-2021_01_06_425657	461	166	+	+	SYM
10_1101-2021_01_06_425657	461	167	+	+	SYM
10_1101-2021_01_06_425657	461	168	+	+	SYM
10_1101-2021_01_06_425657	461	169	+	+	SYM
10_1101-2021_01_06_425657	461	170	−	−	NNP
10_1101-2021_01_06_425657	461	171	+	+	SYM
10_1101-2021_01_06_425657	461	172	+	+	SYM
10_1101-2021_01_06_425657	461	173	+	+	SYM
10_1101-2021_01_06_425657	461	174	+	+	SYM
10_1101-2021_01_06_425657	461	175	+	+	SYM
10_1101-2021_01_06_425657	461	176	+	+	SYM
10_1101-2021_01_06_425657	461	177	−	−	NNP
10_1101-2021_01_06_425657	461	178	+	+	SYM
10_1101-2021_01_06_425657	461	179	+	+	SYM
10_1101-2021_01_06_425657	461	180	+	+	SYM
10_1101-2021_01_06_425657	461	181	+	+	SYM
10_1101-2021_01_06_425657	461	182	+	+	SYM
10_1101-2021_01_06_425657	461	183	+	+	SYM
10_1101-2021_01_06_425657	461	184	+	+	SYM
10_1101-2021_01_06_425657	461	185	+	+	SYM
10_1101-2021_01_06_425657	461	186	+	+	SYM
10_1101-2021_01_06_425657	461	187	−	−	NNP
10_1101-2021_01_06_425657	461	188	+	+	SYM
10_1101-2021_01_06_425657	461	189	+	+	SYM
10_1101-2021_01_06_425657	461	190	+	+	SYM
10_1101-2021_01_06_425657	461	191	+	+	SYM
10_1101-2021_01_06_425657	461	192	+	+	SYM
10_1101-2021_01_06_425657	461	193	+	+	SYM
10_1101-2021_01_06_425657	461	194	−	−	NNP
10_1101-2021_01_06_425657	461	195	+	+	SYM
10_1101-2021_01_06_425657	461	196	+	+	SYM
10_1101-2021_01_06_425657	461	197	+	+	SYM
10_1101-2021_01_06_425657	461	198	+	+	SYM
10_1101-2021_01_06_425657	461	199	+	+	SYM
10_1101-2021_01_06_425657	461	200	+	+	SYM
10_1101-2021_01_06_425657	461	201	+	+	SYM
10_1101-2021_01_06_425657	461	202	+	+	SYM
10_1101-2021_01_06_425657	461	203	+	+	SYM
10_1101-2021_01_06_425657	461	204	+	+	SYM
10_1101-2021_01_06_425657	461	205	Flag	flag	NN
10_1101-2021_01_06_425657	461	206	purification	purification	NN
10_1101-2021_01_06_425657	461	207	−Sulfur	−sulfur	CD
10_1101-2021_01_06_425657	461	208	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	461	209	Ubiquitin	Ubiquitin	NNP
10_1101-2021_01_06_425657	461	210	Met4	Met4	NNP
10_1101-2021_01_06_425657	461	211	+	+	SYM
10_1101-2021_01_06_425657	461	212	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	213	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	214	−DTT/	−dtt/	NN
10_1101-2021_01_06_425657	461	215	+	+	SYM
10_1101-2021_01_06_425657	461	216	TCEP	tcep	NN
10_1101-2021_01_06_425657	461	217	C	C	NNP
10_1101-2021_01_06_425657	461	218	A	A	NNP
10_1101-2021_01_06_425657	461	219	Rich	Rich	NNP
10_1101-2021_01_06_425657	461	220	−SulfurRich	−SulfurRich	NNP
10_1101-2021_01_06_425657	461	221	Rich	Rich	NNP
10_1101-2021_01_06_425657	461	222	Switch	Switch	NNP
10_1101-2021_01_06_425657	461	223	50	50	CD
10_1101-2021_01_06_425657	461	224	%	%	NN
10_1101-2021_01_06_425657	461	225	of	of	IN
10_1101-2021_01_06_425657	461	226	cells	cell	NNS
10_1101-2021_01_06_425657	461	227	to	to	IN
10_1101-2021_01_06_425657	461	228	−Sulfur	−sulfur	CD
10_1101-2021_01_06_425657	461	229	media	medium	NNS
10_1101-2021_01_06_425657	461	230	Collect	collect	VB
10_1101-2021_01_06_425657	461	231	and	and	CC
10_1101-2021_01_06_425657	461	232	cryomill	cryomill	NN
10_1101-2021_01_06_425657	461	233	cell	cell	NN
10_1101-2021_01_06_425657	461	234	pellets	pellet	NNS
10_1101-2021_01_06_425657	461	235	"	"	``
10_1101-2021_01_06_425657	461	236	Rich	rich	JJ
10_1101-2021_01_06_425657	461	237	"	"	''
10_1101-2021_01_06_425657	461	238	cell	cell	NN
10_1101-2021_01_06_425657	461	239	lysate	lysate	NN
10_1101-2021_01_06_425657	461	240	powder	powder	NN
10_1101-2021_01_06_425657	461	241	"	"	``
10_1101-2021_01_06_425657	461	242	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	461	243	"	"	''
10_1101-2021_01_06_425657	461	244	cell	cell	NN
10_1101-2021_01_06_425657	461	245	lysate	lysate	NN
10_1101-2021_01_06_425657	461	246	powder	powder	NN
10_1101-2021_01_06_425657	461	247	Met30	Met30	NNP
10_1101-2021_01_06_425657	461	248	IP	IP	NNP
10_1101-2021_01_06_425657	461	249	and	and	CC
10_1101-2021_01_06_425657	461	250	in	in	IN
10_1101-2021_01_06_425657	461	251	vitro	vitro	FW
10_1101-2021_01_06_425657	461	252	Met4	Met4	NNP
10_1101-2021_01_06_425657	461	253	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	461	254	assay	assay	VB
10_1101-2021_01_06_425657	461	255	Add	Add	NNP
10_1101-2021_01_06_425657	461	256	IP	IP	NNP
10_1101-2021_01_06_425657	461	257	buffer	buffer	NN
10_1101-2021_01_06_425657	461	258	to	to	IN
10_1101-2021_01_06_425657	461	259	Rich	Rich	NNP
10_1101-2021_01_06_425657	461	260	and	and	CC
10_1101-2021_01_06_425657	461	261	−Sulfur	−sulfur	DT
10_1101-2021_01_06_425657	461	262	powder	powder	NN
10_1101-2021_01_06_425657	461	263	Split	Split	NNP
10_1101-2021_01_06_425657	461	264	lysate	lysate	NN
10_1101-2021_01_06_425657	461	265	,	,	,
10_1101-2021_01_06_425657	461	266	IP	IP	NNP
10_1101-2021_01_06_425657	461	267	Met30	Met30	NNP
10_1101-2021_01_06_425657	461	268	and	and	CC
10_1101-2021_01_06_425657	461	269	SCF	scf	NN
10_1101-2021_01_06_425657	461	270	core	core	NN
10_1101-2021_01_06_425657	461	271	components	component	NNS
10_1101-2021_01_06_425657	461	272	+	+	SYM
10_1101-2021_01_06_425657	461	273	/−	/−	NNP
10_1101-2021_01_06_425657	461	274	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	275	+	+	SYM
10_1101-2021_01_06_425657	461	276	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	277	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	278	+	+	SYM
10_1101-2021_01_06_425657	461	279	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	280	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	281	Wash	Wash	NNP
10_1101-2021_01_06_425657	461	282	Met30-bound	met30-bound	NN
10_1101-2021_01_06_425657	461	283	beads	bead	NNS
10_1101-2021_01_06_425657	461	284	,	,	,
10_1101-2021_01_06_425657	461	285	elute	elute	VB
10_1101-2021_01_06_425657	461	286	and	and	CC
10_1101-2021_01_06_425657	461	287	concentrate	concentrate	VB
10_1101-2021_01_06_425657	461	288	the	the	DT
10_1101-2021_01_06_425657	461	289	Met30	Met30	NNP
10_1101-2021_01_06_425657	461	290	E3	e3	NN
10_1101-2021_01_06_425657	461	291	complex	complex	NN
10_1101-2021_01_06_425657	461	292	,	,	,
10_1101-2021_01_06_425657	461	293	and	and	CC
10_1101-2021_01_06_425657	461	294	perform	perform	VB
10_1101-2021_01_06_425657	461	295	in	in	IN
10_1101-2021_01_06_425657	461	296	vitro	vitro	FW
10_1101-2021_01_06_425657	461	297	ubiquitination	ubiquitination	NNP
10_1101-2021_01_06_425657	461	298	assays	assays	RB
10_1101-2021_01_06_425657	461	299	with	with	IN
10_1101-2021_01_06_425657	461	300	purified	purified	JJ
10_1101-2021_01_06_425657	461	301	E1	E1	NNP
10_1101-2021_01_06_425657	461	302	(	(	-LRB-
10_1101-2021_01_06_425657	461	303	Uba1	uba1	JJ
10_1101-2021_01_06_425657	461	304	)	)	-RRB-
10_1101-2021_01_06_425657	461	305	,	,	,
10_1101-2021_01_06_425657	461	306	E2	E2	NNP
10_1101-2021_01_06_425657	461	307	(	(	-LRB-
10_1101-2021_01_06_425657	461	308	Cdc34	Cdc34	NNP
10_1101-2021_01_06_425657	461	309	)	)	-RRB-
10_1101-2021_01_06_425657	461	310	,	,	,
10_1101-2021_01_06_425657	461	311	ubiquitin	ubiquitin	JJ
10_1101-2021_01_06_425657	461	312	,	,	,
10_1101-2021_01_06_425657	461	313	and	and	CC
10_1101-2021_01_06_425657	461	314	Met4	Met4	NNP
10_1101-2021_01_06_425657	461	315	Met30	Met30	NNP
10_1101-2021_01_06_425657	461	316	IP	IP	NNP
10_1101-2021_01_06_425657	461	317	and	and	CC
10_1101-2021_01_06_425657	461	318	in	in	FW
10_1101-2021_01_06_425657	461	319	vitro	vitro	FW
10_1101-2021_01_06_425657	461	320	Met4	Met4	NNP
10_1101-2021_01_06_425657	461	321	binding	bind	VBG
10_1101-2021_01_06_425657	461	322	assay	assay	NN
10_1101-2021_01_06_425657	461	323	Prepare	Prepare	NNP
10_1101-2021_01_06_425657	461	324	Rich	Rich	NNP
10_1101-2021_01_06_425657	461	325	and	and	CC
10_1101-2021_01_06_425657	461	326	−Sulfur	−sulfur	CD
10_1101-2021_01_06_425657	461	327	lysate	lysate	NN
10_1101-2021_01_06_425657	461	328	identically	identically	RB
10_1101-2021_01_06_425657	461	329	as	as	IN
10_1101-2021_01_06_425657	461	330	for	for	IN
10_1101-2021_01_06_425657	461	331	the	the	DT
10_1101-2021_01_06_425657	461	332	ubiquitination	ubiquitination	NN
10_1101-2021_01_06_425657	461	333	experiment	experiment	NN
10_1101-2021_01_06_425657	461	334	Split	Split	NNP
10_1101-2021_01_06_425657	461	335	lysate	lysate	NN
10_1101-2021_01_06_425657	461	336	,	,	,
10_1101-2021_01_06_425657	461	337	IP	IP	NNP
10_1101-2021_01_06_425657	461	338	Met30	Met30	NNP
10_1101-2021_01_06_425657	461	339	in	in	IN
10_1101-2021_01_06_425657	461	340	the	the	DT
10_1101-2021_01_06_425657	461	341	presence	presence	NN
10_1101-2021_01_06_425657	461	342	of	of	IN
10_1101-2021_01_06_425657	461	343	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	344	,	,	,
10_1101-2021_01_06_425657	461	345	Diamide	Diamide	NNP
10_1101-2021_01_06_425657	461	346	,	,	,
10_1101-2021_01_06_425657	461	347	or	or	CC
10_1101-2021_01_06_425657	461	348	control	control	NN
10_1101-2021_01_06_425657	461	349	−DTT+DTT	−dtt+dtt	NN
10_1101-2021_01_06_425657	461	350	+	+	CC
10_1101-2021_01_06_425657	461	351	Diamide	diamide	NN
10_1101-2021_01_06_425657	461	352	Wash	Wash	NNP
10_1101-2021_01_06_425657	461	353	Met30-bound	met30-bound	NN
10_1101-2021_01_06_425657	461	354	beads	bead	NNS
10_1101-2021_01_06_425657	461	355	of	of	IN
10_1101-2021_01_06_425657	461	356	unbound	unbound	NN
10_1101-2021_01_06_425657	461	357	Met4	Met4	NNP
10_1101-2021_01_06_425657	461	358	,	,	,
10_1101-2021_01_06_425657	461	359	boil	boil	VB
10_1101-2021_01_06_425657	461	360	beads	bead	NNS
10_1101-2021_01_06_425657	461	361	in	in	IN
10_1101-2021_01_06_425657	461	362	sample	sample	NN
10_1101-2021_01_06_425657	461	363	buffer	buffer	NN
10_1101-2021_01_06_425657	461	364	,	,	,
10_1101-2021_01_06_425657	461	365	and	and	CC
10_1101-2021_01_06_425657	461	366	Western	western	JJ
10_1101-2021_01_06_425657	461	367	blot	blot	NN
10_1101-2021_01_06_425657	461	368	for	for	IN
10_1101-2021_01_06_425657	461	369	Met4	met4	NN
10_1101-2021_01_06_425657	461	370	to	to	TO
10_1101-2021_01_06_425657	461	371	assess	assess	VB
10_1101-2021_01_06_425657	461	372	binding	bind	VBG
10_1101-2021_01_06_425657	461	373	Wash	Wash	NNP
10_1101-2021_01_06_425657	461	374	Met30-bound	met30-bound	NN
10_1101-2021_01_06_425657	461	375	beads	bead	NNS
10_1101-2021_01_06_425657	461	376	,	,	,
10_1101-2021_01_06_425657	461	377	split	split	VBD
10_1101-2021_01_06_425657	461	378	each	each	DT
10_1101-2021_01_06_425657	461	379	Met30	Met30	NNP
10_1101-2021_01_06_425657	461	380	IP	IP	NNP
10_1101-2021_01_06_425657	461	381	in	in	IN
10_1101-2021_01_06_425657	461	382	half	half	NN
10_1101-2021_01_06_425657	461	383	,	,	,
10_1101-2021_01_06_425657	461	384	and	and	CC
10_1101-2021_01_06_425657	461	385	incubate	incubate	VB
10_1101-2021_01_06_425657	461	386	beads	bead	NNS
10_1101-2021_01_06_425657	461	387	with	with	IN
10_1101-2021_01_06_425657	461	388	purified	purify	VBN
10_1101-2021_01_06_425657	461	389	Met4	Met4	NNP
10_1101-2021_01_06_425657	461	390	+	+	SYM
10_1101-2021_01_06_425657	461	391	/−	/−	NNP
10_1101-2021_01_06_425657	461	392	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	393	+	+	SYM
10_1101-2021_01_06_425657	461	394	/−DTT	/−dtt	SYM
10_1101-2021_01_06_425657	461	395	+	+	NFP
10_1101-2021_01_06_425657	461	396	/−DTT	/−dtt	SYM
10_1101-2021_01_06_425657	461	397	+	+	NFP
10_1101-2021_01_06_425657	461	398	/−DTT	/−dtt	SYM
10_1101-2021_01_06_425657	461	399	−DTT+DTT	−dtt+dtt	NN
10_1101-2021_01_06_425657	461	400	+	+	CC
10_1101-2021_01_06_425657	461	401	Diamide	diamide	NN
10_1101-2021_01_06_425657	461	402	+	+	SYM
10_1101-2021_01_06_425657	461	403	/−DTT	/−dtt	SYM
10_1101-2021_01_06_425657	461	404	+	+	NFP
10_1101-2021_01_06_425657	461	405	/−DTT	/−dtt	SYM
10_1101-2021_01_06_425657	461	406	+	+	NFP
10_1101-2021_01_06_425657	461	407	/−DTT	/−DTT	,
10_1101-2021_01_06_425657	461	408	Rich	Rich	NNP
10_1101-2021_01_06_425657	461	409	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	461	410	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	461	411	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	461	412	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	461	413	IP	IP	NNP
10_1101-2021_01_06_425657	461	414	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	461	415	co	co	JJ
10_1101-2021_01_06_425657	461	416	-	-	NNS
10_1101-2021_01_06_425657	461	417	IP	ip	JJ
10_1101-2021_01_06_425657	461	418	+	+	SYM
10_1101-2021_01_06_425657	461	419	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	420	+	+	SYM
10_1101-2021_01_06_425657	461	421	DTT	dtt	NN
10_1101-2021_01_06_425657	461	422	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	423	+	+	SYM
10_1101-2021_01_06_425657	461	424	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	425	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	426	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	427	+	+	SYM
10_1101-2021_01_06_425657	461	428	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	429	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	430	+	+	CC
10_1101-2021_01_06_425657	461	431	Diamide	diamide	NN
10_1101-2021_01_06_425657	461	432	+	+	SYM
10_1101-2021_01_06_425657	461	433	DTT	dtt	NN
10_1101-2021_01_06_425657	461	434	+	+	SYM
10_1101-2021_01_06_425657	461	435	DTT	dtt	NN
10_1101-2021_01_06_425657	461	436	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	437	+	+	SYM
10_1101-2021_01_06_425657	461	438	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	439	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	440	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	441	+	+	SYM
10_1101-2021_01_06_425657	461	442	DTT	DTT	NNP
10_1101-2021_01_06_425657	461	443	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	461	444	+	+	SYM
10_1101-2021_01_06_425657	461	445	DiamideInput	DiamideInput	NNP
10_1101-2021_01_06_425657	461	446	Rich	Rich	NNP
10_1101-2021_01_06_425657	461	447	−Sulfur	−sulfur	CD
10_1101-2021_01_06_425657	461	448	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	461	449	D	D	NNP
10_1101-2021_01_06_425657	461	450	Figure	Figure	NNP
10_1101-2021_01_06_425657	461	451	4	4	CD
10_1101-2021_01_06_425657	461	452	Ub	Ub	NNP
10_1101-2021_01_06_425657	461	453	-	-	HYPH
10_1101-2021_01_06_425657	461	454	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	461	455	Ub	Ub	NNP
10_1101-2021_01_06_425657	461	456	-	-	HYPH
10_1101-2021_01_06_425657	461	457	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	461	458	.CC	.CC	NFP
10_1101-2021_01_06_425657	461	459	-	-	:
10_1101-2021_01_06_425657	461	460	BY	by	IN
10_1101-2021_01_06_425657	461	461	4.0	4.0	CD
10_1101-2021_01_06_425657	461	462	International	International	NNP
10_1101-2021_01_06_425657	461	463	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	461	464	under	under	IN
10_1101-2021_01_06_425657	461	465	a	a	DT
10_1101-2021_01_06_425657	461	466	(	(	-LRB-
10_1101-2021_01_06_425657	461	467	which	which	WDT
10_1101-2021_01_06_425657	461	468	was	be	VBD
10_1101-2021_01_06_425657	461	469	not	not	RB
10_1101-2021_01_06_425657	461	470	certified	certify	VBN
10_1101-2021_01_06_425657	461	471	by	by	IN
10_1101-2021_01_06_425657	461	472	peer	peer	NN
10_1101-2021_01_06_425657	461	473	review	review	NN
10_1101-2021_01_06_425657	461	474	)	)	-RRB-
10_1101-2021_01_06_425657	461	475	is	be	VBZ
10_1101-2021_01_06_425657	461	476	the	the	DT
10_1101-2021_01_06_425657	461	477	author	author	NN
10_1101-2021_01_06_425657	461	478	/	/	SYM
10_1101-2021_01_06_425657	461	479	funder	funder	NN
10_1101-2021_01_06_425657	461	480	,	,	,
10_1101-2021_01_06_425657	461	481	who	who	WP
10_1101-2021_01_06_425657	461	482	has	have	VBZ
10_1101-2021_01_06_425657	461	483	granted	grant	VBN
10_1101-2021_01_06_425657	461	484	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	461	485	a	a	DT
10_1101-2021_01_06_425657	461	486	license	license	NN
10_1101-2021_01_06_425657	461	487	to	to	TO
10_1101-2021_01_06_425657	461	488	display	display	VB
10_1101-2021_01_06_425657	461	489	the	the	DT
10_1101-2021_01_06_425657	461	490	preprint	preprint	NN
10_1101-2021_01_06_425657	461	491	in	in	IN
10_1101-2021_01_06_425657	461	492	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	461	493	.	.	.
10_1101-2021_01_06_425657	462	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	462	2	is	be	VBZ
10_1101-2021_01_06_425657	462	3	made	make	VBN
10_1101-2021_01_06_425657	462	4	The	the	DT
10_1101-2021_01_06_425657	462	5	copyright	copyright	NN
10_1101-2021_01_06_425657	462	6	holder	holder	NN
10_1101-2021_01_06_425657	462	7	for	for	IN
10_1101-2021_01_06_425657	462	8	this	this	DT
10_1101-2021_01_06_425657	462	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	462	10	version	version	NN
10_1101-2021_01_06_425657	462	11	posted	post	VBD
10_1101-2021_01_06_425657	462	12	January	January	NNP
10_1101-2021_01_06_425657	462	13	7	7	CD
10_1101-2021_01_06_425657	462	14	,	,	,
10_1101-2021_01_06_425657	462	15	2021	2021	CD
10_1101-2021_01_06_425657	462	16	.	.	.
10_1101-2021_01_06_425657	462	17	;	;	:
10_1101-2021_01_06_425657	462	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	462	19	:	:	:
10_1101-2021_01_06_425657	462	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	462	21	preprint	preprint	NN
10_1101-2021_01_06_425657	462	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	462	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	462	24	A	a	NN
10_1101-2021_01_06_425657	462	25	C	C	NNP
10_1101-2021_01_06_425657	462	26	dc	dc	NNP
10_1101-2021_01_06_425657	462	27	53	53	CD
10_1101-2021_01_06_425657	462	28	Low	Low	NNP
10_1101-2021_01_06_425657	462	29	sulfur	sulfur	NN
10_1101-2021_01_06_425657	462	30	metabolite	metabolite	JJ
10_1101-2021_01_06_425657	462	31	levels	level	NNS
10_1101-2021_01_06_425657	462	32	Hrt1	hrt1	POS
10_1101-2021_01_06_425657	462	33	N8	N8	NNP
10_1101-2021_01_06_425657	462	34	Ub	Ub	NNP
10_1101-2021_01_06_425657	462	35	Ub	Ub	NNP
10_1101-2021_01_06_425657	462	36	Skp1	Skp1	NNP
10_1101-2021_01_06_425657	462	37	Met4	Met4	NNP
10_1101-2021_01_06_425657	462	38	Met30	Met30	NNP
10_1101-2021_01_06_425657	462	39	Met30	Met30	NNP
10_1101-2021_01_06_425657	462	40	S	S	NNP
10_1101-2021_01_06_425657	462	41	——	——	:
10_1101-2021_01_06_425657	462	42	S	S	NNP
10_1101-2021_01_06_425657	462	43	High	High	NNP
10_1101-2021_01_06_425657	462	44	sulfur	sulfur	NN
10_1101-2021_01_06_425657	462	45	metabolite	metabolite	JJ
10_1101-2021_01_06_425657	462	46	levels	level	NNS
10_1101-2021_01_06_425657	462	47	E2	e2	VBP
10_1101-2021_01_06_425657	462	48	Ub	Ub	NNP
10_1101-2021_01_06_425657	462	49	Ub	Ub	NNP
10_1101-2021_01_06_425657	462	50	Ub	Ub	NNP
10_1101-2021_01_06_425657	462	51	SH	SH	NNP
10_1101-2021_01_06_425657	462	52	HS	HS	NNP
10_1101-2021_01_06_425657	462	53	Met31/32	met31/32	NN
10_1101-2021_01_06_425657	462	54	Met	Met	NNP
10_1101-2021_01_06_425657	462	55	genes	gene	NNS
10_1101-2021_01_06_425657	462	56	OFF	OFF	NNP
10_1101-2021_01_06_425657	462	57	C	C	NNP
10_1101-2021_01_06_425657	462	58	dc	dc	NNP
10_1101-2021_01_06_425657	462	59	53	53	CD
10_1101-2021_01_06_425657	462	60	Hrt1	Hrt1	NNP
10_1101-2021_01_06_425657	462	61	N8	N8	NNP
10_1101-2021_01_06_425657	462	62	Skp1	Skp1	NNP
10_1101-2021_01_06_425657	462	63	Met4	Met4	NNP
10_1101-2021_01_06_425657	462	64	E2	E2	NNP
10_1101-2021_01_06_425657	462	65	Ub	Ub	NNP
10_1101-2021_01_06_425657	462	66	Met31/32	met31/32	NN
10_1101-2021_01_06_425657	462	67	Met	Met	NNP
10_1101-2021_01_06_425657	462	68	genes	gene	NNS
10_1101-2021_01_06_425657	462	69	ON	on	IN
10_1101-2021_01_06_425657	462	70	Met4	Met4	NNP
10_1101-2021_01_06_425657	462	71	Figure	Figure	NNP
10_1101-2021_01_06_425657	462	72	5	5	CD
10_1101-2021_01_06_425657	462	73	.CC	.CC	NFP
10_1101-2021_01_06_425657	462	74	-	-	:
10_1101-2021_01_06_425657	462	75	BY	by	IN
10_1101-2021_01_06_425657	462	76	4.0	4.0	CD
10_1101-2021_01_06_425657	462	77	International	International	NNP
10_1101-2021_01_06_425657	462	78	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	462	79	under	under	IN
10_1101-2021_01_06_425657	462	80	a	a	DT
10_1101-2021_01_06_425657	462	81	(	(	-LRB-
10_1101-2021_01_06_425657	462	82	which	which	WDT
10_1101-2021_01_06_425657	462	83	was	be	VBD
10_1101-2021_01_06_425657	462	84	not	not	RB
10_1101-2021_01_06_425657	462	85	certified	certify	VBN
10_1101-2021_01_06_425657	462	86	by	by	IN
10_1101-2021_01_06_425657	462	87	peer	peer	NN
10_1101-2021_01_06_425657	462	88	review	review	NN
10_1101-2021_01_06_425657	462	89	)	)	-RRB-
10_1101-2021_01_06_425657	462	90	is	be	VBZ
10_1101-2021_01_06_425657	462	91	the	the	DT
10_1101-2021_01_06_425657	462	92	author	author	NN
10_1101-2021_01_06_425657	462	93	/	/	SYM
10_1101-2021_01_06_425657	462	94	funder	funder	NN
10_1101-2021_01_06_425657	462	95	,	,	,
10_1101-2021_01_06_425657	462	96	who	who	WP
10_1101-2021_01_06_425657	462	97	has	have	VBZ
10_1101-2021_01_06_425657	462	98	granted	grant	VBN
10_1101-2021_01_06_425657	462	99	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	462	100	a	a	DT
10_1101-2021_01_06_425657	462	101	license	license	NN
10_1101-2021_01_06_425657	462	102	to	to	TO
10_1101-2021_01_06_425657	462	103	display	display	VB
10_1101-2021_01_06_425657	462	104	the	the	DT
10_1101-2021_01_06_425657	462	105	preprint	preprint	NN
10_1101-2021_01_06_425657	462	106	in	in	IN
10_1101-2021_01_06_425657	462	107	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	462	108	.	.	.
10_1101-2021_01_06_425657	463	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	463	2	is	be	VBZ
10_1101-2021_01_06_425657	463	3	made	make	VBN
10_1101-2021_01_06_425657	463	4	The	the	DT
10_1101-2021_01_06_425657	463	5	copyright	copyright	NN
10_1101-2021_01_06_425657	463	6	holder	holder	NN
10_1101-2021_01_06_425657	463	7	for	for	IN
10_1101-2021_01_06_425657	463	8	this	this	DT
10_1101-2021_01_06_425657	463	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	463	10	version	version	NN
10_1101-2021_01_06_425657	463	11	posted	post	VBD
10_1101-2021_01_06_425657	463	12	January	January	NNP
10_1101-2021_01_06_425657	463	13	7	7	CD
10_1101-2021_01_06_425657	463	14	,	,	,
10_1101-2021_01_06_425657	463	15	2021	2021	CD
10_1101-2021_01_06_425657	463	16	.	.	.
10_1101-2021_01_06_425657	463	17	;	;	:
10_1101-2021_01_06_425657	463	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	463	19	:	:	:
10_1101-2021_01_06_425657	463	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	463	21	preprint	preprint	NN
10_1101-2021_01_06_425657	463	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	463	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	463	24	Time	Time	NNP
10_1101-2021_01_06_425657	463	25	(	(	-LRB-
10_1101-2021_01_06_425657	463	26	min	min	NNP
10_1101-2021_01_06_425657	463	27	)	)	-RRB-
10_1101-2021_01_06_425657	463	28	0	0	NFP
10_1101-2021_01_06_425657	463	29	60	60	CD
10_1101-2021_01_06_425657	463	30	120	120	CD
10_1101-2021_01_06_425657	463	31	180	180	CD
10_1101-2021_01_06_425657	463	32	15	15	CD
10_1101-2021_01_06_425657	463	33	45	45	CD
10_1101-2021_01_06_425657	463	34	90	90	CD
10_1101-2021_01_06_425657	463	35	0	0	CD
10_1101-2021_01_06_425657	463	36	60	60	CD
10_1101-2021_01_06_425657	463	37	120	120	CD
10_1101-2021_01_06_425657	463	38	180	180	CD
10_1101-2021_01_06_425657	463	39	15	15	CD
10_1101-2021_01_06_425657	463	40	45	45	CD
10_1101-2021_01_06_425657	463	41	90	90	CD
10_1101-2021_01_06_425657	463	42	0	0	CD
10_1101-2021_01_06_425657	463	43	60	60	CD
10_1101-2021_01_06_425657	463	44	120	120	CD
10_1101-2021_01_06_425657	463	45	180	180	CD
10_1101-2021_01_06_425657	463	46	15	15	CD
10_1101-2021_01_06_425657	463	47	45	45	CD
10_1101-2021_01_06_425657	463	48	90	90	CD
10_1101-2021_01_06_425657	463	49	Time	Time	NNP
10_1101-2021_01_06_425657	463	50	(	(	-LRB-
10_1101-2021_01_06_425657	463	51	min	min	NNP
10_1101-2021_01_06_425657	463	52	)	)	-RRB-
10_1101-2021_01_06_425657	463	53	0	0	NFP
10_1101-2021_01_06_425657	463	54	30	30	CD
10_1101-2021_01_06_425657	463	55	60	60	CD
10_1101-2021_01_06_425657	463	56	60	60	CD
10_1101-2021_01_06_425657	463	57	120	120	CD
10_1101-2021_01_06_425657	463	58	120	120	CD
10_1101-2021_01_06_425657	463	59	180	180	CD
10_1101-2021_01_06_425657	463	60	180	180	CD
10_1101-2021_01_06_425657	463	61	Met4-HA	met4-ha	JJ
10_1101-2021_01_06_425657	463	62	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	463	63	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	463	64	100	100	CD
10_1101-2021_01_06_425657	463	65	kDa	kDa	NNS
10_1101-2021_01_06_425657	463	66	150	150	CD
10_1101-2021_01_06_425657	463	67	kDa	kDa	NNS
10_1101-2021_01_06_425657	463	68	−	−	NNP
10_1101-2021_01_06_425657	463	69	−	−	NNP
10_1101-2021_01_06_425657	463	70	−	−	NNP
10_1101-2021_01_06_425657	463	71	+	+	SYM
10_1101-2021_01_06_425657	463	72	−	−	NNP
10_1101-2021_01_06_425657	463	73	+	+	SYM
10_1101-2021_01_06_425657	463	74	−	−	NNP
10_1101-2021_01_06_425657	463	75	+	+	SYM
10_1101-2021_01_06_425657	463	76	CHX	CHX	NNP
10_1101-2021_01_06_425657	463	77	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	463	78	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	463	79	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	463	80	100	100	CD
10_1101-2021_01_06_425657	463	81	kDa	kDa	NNS
10_1101-2021_01_06_425657	463	82	150	150	CD
10_1101-2021_01_06_425657	463	83	kDa	kDa	NNS
10_1101-2021_01_06_425657	463	84	−Sulfur+Met	−Sulfur+Met	NNP
10_1101-2021_01_06_425657	463	85	Time	Time	NNP
10_1101-2021_01_06_425657	463	86	(	(	-LRB-
10_1101-2021_01_06_425657	463	87	min	min	NNP
10_1101-2021_01_06_425657	463	88	)	)	-RRB-
10_1101-2021_01_06_425657	463	89	0	0	NFP
10_1101-2021_01_06_425657	463	90	30	30	CD
10_1101-2021_01_06_425657	463	91	60	60	CD
10_1101-2021_01_06_425657	463	92	120	120	CD
10_1101-2021_01_06_425657	463	93	180	180	CD
10_1101-2021_01_06_425657	463	94	15	15	CD
10_1101-2021_01_06_425657	463	95	45	45	CD
10_1101-2021_01_06_425657	463	96	90	90	CD
10_1101-2021_01_06_425657	463	97	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	463	98	Rpn10	Rpn10	NNPS
10_1101-2021_01_06_425657	463	99	+	+	CC
10_1101-2021_01_06_425657	463	100	Met	Met	NNP
10_1101-2021_01_06_425657	463	101	−Sulfur+Met	−Sulfur+Met	NNP
10_1101-2021_01_06_425657	463	102	+	+	SYM
10_1101-2021_01_06_425657	463	103	Met	Met	NNP
10_1101-2021_01_06_425657	463	104	WT	WT	NNP
10_1101-2021_01_06_425657	463	105	0	0	CD
10_1101-2021_01_06_425657	463	106	30	30	CD
10_1101-2021_01_06_425657	463	107	60	60	CD
10_1101-2021_01_06_425657	463	108	120	120	CD
10_1101-2021_01_06_425657	463	109	180	180	CD
10_1101-2021_01_06_425657	463	110	15	15	CD
10_1101-2021_01_06_425657	463	111	45	45	CD
10_1101-2021_01_06_425657	463	112	90	90	CD
10_1101-2021_01_06_425657	463	113	met4∆	met4∆	NN
10_1101-2021_01_06_425657	463	114	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	463	115	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	463	116	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	463	117	A	A	NNP
10_1101-2021_01_06_425657	463	118	C	c	NN
10_1101-2021_01_06_425657	463	119	D	d	NN
10_1101-2021_01_06_425657	463	120	E	e	NN
10_1101-2021_01_06_425657	463	121	0	0	CD
10_1101-2021_01_06_425657	463	122	2	2	CD
10_1101-2021_01_06_425657	463	123	4	4	CD
10_1101-2021_01_06_425657	463	124	6	6	CD
10_1101-2021_01_06_425657	463	125	8	8	CD
10_1101-2021_01_06_425657	463	126	0	0	CD
10_1101-2021_01_06_425657	463	127	1	1	CD
10_1101-2021_01_06_425657	463	128	2	2	CD
10_1101-2021_01_06_425657	463	129	3	3	CD
10_1101-2021_01_06_425657	463	130	4	4	CD
10_1101-2021_01_06_425657	463	131	Time	time	NN
10_1101-2021_01_06_425657	463	132	(	(	-LRB-
10_1101-2021_01_06_425657	463	133	h	h	NNP
10_1101-2021_01_06_425657	463	134	)	)	-RRB-
10_1101-2021_01_06_425657	463	135	in	in	IN
10_1101-2021_01_06_425657	463	136	+	+	CC
10_1101-2021_01_06_425657	463	137	Met	Met	NNP
10_1101-2021_01_06_425657	463	138	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	463	139	O	O	NNP
10_1101-2021_01_06_425657	463	140	D	d	NN
10_1101-2021_01_06_425657	463	141	60	60	CD
10_1101-2021_01_06_425657	463	142	0	0	CD
10_1101-2021_01_06_425657	463	143	0	0	CD
10_1101-2021_01_06_425657	463	144	2	2	CD
10_1101-2021_01_06_425657	463	145	4	4	CD
10_1101-2021_01_06_425657	463	146	6	6	CD
10_1101-2021_01_06_425657	463	147	8	8	CD
10_1101-2021_01_06_425657	463	148	0.0	0.0	CD
10_1101-2021_01_06_425657	463	149	0.5	0.5	CD
10_1101-2021_01_06_425657	463	150	1.0	1.0	CD
10_1101-2021_01_06_425657	463	151	1.5	1.5	CD
10_1101-2021_01_06_425657	463	152	2.0	2.0	CD
10_1101-2021_01_06_425657	463	153	Time	time	NN
10_1101-2021_01_06_425657	463	154	(	(	-LRB-
10_1101-2021_01_06_425657	463	155	h	h	NNP
10_1101-2021_01_06_425657	463	156	)	)	-RRB-
10_1101-2021_01_06_425657	463	157	in	in	IN
10_1101-2021_01_06_425657	463	158	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	463	159	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	463	160	O	O	NNP
10_1101-2021_01_06_425657	463	161	D	D	NNP
10_1101-2021_01_06_425657	463	162	60	60	CD
10_1101-2021_01_06_425657	463	163	0	0	CD
10_1101-2021_01_06_425657	463	164	+	+	CC
10_1101-2021_01_06_425657	463	165	Met	Met	NNP
10_1101-2021_01_06_425657	463	166	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	463	167	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	463	168	(	(	-LRB-
10_1101-2021_01_06_425657	463	169	glycolytic	glycolytic	JJ
10_1101-2021_01_06_425657	463	170	)	)	-RRB-
10_1101-2021_01_06_425657	463	171	Time	Time	NNP
10_1101-2021_01_06_425657	463	172	(	(	-LRB-
10_1101-2021_01_06_425657	463	173	min	min	NNP
10_1101-2021_01_06_425657	463	174	)	)	-RRB-
10_1101-2021_01_06_425657	463	175	0	0	CD
10_1101-2021_01_06_425657	463	176	180	180	CD
10_1101-2021_01_06_425657	463	177	15	15	CD
10_1101-2021_01_06_425657	463	178	15	15	CD
10_1101-2021_01_06_425657	463	179	30	30	CD
10_1101-2021_01_06_425657	463	180	30	30	CD
10_1101-2021_01_06_425657	463	181	60	60	CD
10_1101-2021_01_06_425657	463	182	60	60	CD
10_1101-2021_01_06_425657	463	183	−	−	NNP
10_1101-2021_01_06_425657	463	184	−	−	NNP
10_1101-2021_01_06_425657	463	185	−	−	NNP
10_1101-2021_01_06_425657	463	186	+	+	SYM
10_1101-2021_01_06_425657	463	187	−	−	NNP
10_1101-2021_01_06_425657	463	188	+	+	SYM
10_1101-2021_01_06_425657	463	189	−	−	NNP
10_1101-2021_01_06_425657	463	190	+	+	SYM
10_1101-2021_01_06_425657	463	191	MG132	mg132	NN
10_1101-2021_01_06_425657	463	192	B	b	NN
10_1101-2021_01_06_425657	463	193	+	+	CC
10_1101-2021_01_06_425657	463	194	Met	Met	NNP
10_1101-2021_01_06_425657	463	195	+	+	NFP
10_1101-2021_01_06_425657	463	196	Met	Met	NNP
10_1101-2021_01_06_425657	463	197	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	463	198	(	(	-LRB-
10_1101-2021_01_06_425657	463	199	glycolytic	glycolytic	JJ
10_1101-2021_01_06_425657	463	200	)	)	-RRB-
10_1101-2021_01_06_425657	463	201	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	463	202	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	463	203	(	(	-LRB-
10_1101-2021_01_06_425657	463	204	glycolytic	glycolytic	JJ
10_1101-2021_01_06_425657	463	205	)	)	-RRB-
10_1101-2021_01_06_425657	463	206	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	463	207	(	(	-LRB-
10_1101-2021_01_06_425657	463	208	glycolytic	glycolytic	JJ
10_1101-2021_01_06_425657	463	209	)	)	-RRB-
10_1101-2021_01_06_425657	463	210	−Sulfur+Met	−Sulfur+Met	NNP
10_1101-2021_01_06_425657	463	211	+	+	CC
10_1101-2021_01_06_425657	463	212	Met	Met	NNP
10_1101-2021_01_06_425657	463	213	WT	WT	NNP
10_1101-2021_01_06_425657	463	214	−Sulfur+Met	−Sulfur+Met	NNP
10_1101-2021_01_06_425657	463	215	+	+	SYM
10_1101-2021_01_06_425657	463	216	Met	Met	NNP
10_1101-2021_01_06_425657	463	217	∆1	∆1	NNP
10_1101-2021_01_06_425657	463	218	-	-	:
10_1101-2021_01_06_425657	463	219	20	20	CD
10_1101-2021_01_06_425657	463	220	−Sulfur+Met	−sulfur+met	NN
10_1101-2021_01_06_425657	463	221	+	+	CC
10_1101-2021_01_06_425657	463	222	Met	Met	NNP
10_1101-2021_01_06_425657	463	223	M30/35/36A	M30/35/36A	NNP
10_1101-2021_01_06_425657	463	224	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	463	225	(	(	-LRB-
10_1101-2021_01_06_425657	463	226	glycolytic	glycolytic	JJ
10_1101-2021_01_06_425657	463	227	)	)	-RRB-
10_1101-2021_01_06_425657	463	228	Figure	figure	NN
10_1101-2021_01_06_425657	463	229	S1	s1	NN
10_1101-2021_01_06_425657	463	230	100	100	CD
10_1101-2021_01_06_425657	463	231	kDa	kDa	NNS
10_1101-2021_01_06_425657	463	232	150	150	CD
10_1101-2021_01_06_425657	463	233	kDa	kDa	NNS
10_1101-2021_01_06_425657	463	234	0	0	CD
10_1101-2021_01_06_425657	463	235	2	2	CD
10_1101-2021_01_06_425657	463	236	4	4	CD
10_1101-2021_01_06_425657	463	237	6	6	CD
10_1101-2021_01_06_425657	463	238	8	8	CD
10_1101-2021_01_06_425657	463	239	0.0	0.0	CD
10_1101-2021_01_06_425657	463	240	0.5	0.5	CD
10_1101-2021_01_06_425657	463	241	1.0	1.0	CD
10_1101-2021_01_06_425657	463	242	1.5	1.5	CD
10_1101-2021_01_06_425657	463	243	2.0	2.0	CD
10_1101-2021_01_06_425657	463	244	Time	time	NN
10_1101-2021_01_06_425657	463	245	(	(	-LRB-
10_1101-2021_01_06_425657	463	246	h	h	NNP
10_1101-2021_01_06_425657	463	247	)	)	-RRB-
10_1101-2021_01_06_425657	463	248	in	in	IN
10_1101-2021_01_06_425657	463	249	+	+	CC
10_1101-2021_01_06_425657	463	250	Met	Met	NNP
10_1101-2021_01_06_425657	463	251	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	463	252	after	after	IN
10_1101-2021_01_06_425657	463	253	switch	switch	NN
10_1101-2021_01_06_425657	463	254	from	from	IN
10_1101-2021_01_06_425657	463	255	−Sulfur	−sulfur	CD
10_1101-2021_01_06_425657	463	256	Glucose	Glucose	NNP
10_1101-2021_01_06_425657	463	257	(	(	-LRB-
10_1101-2021_01_06_425657	463	258	3h	3h	NN
10_1101-2021_01_06_425657	463	259	)	)	-RRB-
10_1101-2021_01_06_425657	463	260	O	o	NN
10_1101-2021_01_06_425657	463	261	D	D	NNP
10_1101-2021_01_06_425657	463	262	60	60	CD
10_1101-2021_01_06_425657	463	263	0	0	CD
10_1101-2021_01_06_425657	463	264	WT	WT	NNP
10_1101-2021_01_06_425657	463	265	Δ1	δ1	NN
10_1101-2021_01_06_425657	463	266	-	-	HYPH
10_1101-2021_01_06_425657	463	267	20	20	CD
10_1101-2021_01_06_425657	463	268	M30/35/36A	M30/35/36A	NNP
10_1101-2021_01_06_425657	463	269	Ub	Ub	NNP
10_1101-2021_01_06_425657	463	270	-	-	HYPH
10_1101-2021_01_06_425657	463	271	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	463	272	Ub	Ub	NNP
10_1101-2021_01_06_425657	463	273	-	-	HYPH
10_1101-2021_01_06_425657	463	274	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	463	275	.CC	.CC	NFP
10_1101-2021_01_06_425657	463	276	-	-	:
10_1101-2021_01_06_425657	463	277	BY	by	IN
10_1101-2021_01_06_425657	463	278	4.0	4.0	CD
10_1101-2021_01_06_425657	463	279	International	International	NNP
10_1101-2021_01_06_425657	463	280	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	463	281	under	under	IN
10_1101-2021_01_06_425657	463	282	a	a	DT
10_1101-2021_01_06_425657	463	283	(	(	-LRB-
10_1101-2021_01_06_425657	463	284	which	which	WDT
10_1101-2021_01_06_425657	463	285	was	be	VBD
10_1101-2021_01_06_425657	463	286	not	not	RB
10_1101-2021_01_06_425657	463	287	certified	certify	VBN
10_1101-2021_01_06_425657	463	288	by	by	IN
10_1101-2021_01_06_425657	463	289	peer	peer	NN
10_1101-2021_01_06_425657	463	290	review	review	NN
10_1101-2021_01_06_425657	463	291	)	)	-RRB-
10_1101-2021_01_06_425657	463	292	is	be	VBZ
10_1101-2021_01_06_425657	463	293	the	the	DT
10_1101-2021_01_06_425657	463	294	author	author	NN
10_1101-2021_01_06_425657	463	295	/	/	SYM
10_1101-2021_01_06_425657	463	296	funder	funder	NN
10_1101-2021_01_06_425657	463	297	,	,	,
10_1101-2021_01_06_425657	463	298	who	who	WP
10_1101-2021_01_06_425657	463	299	has	have	VBZ
10_1101-2021_01_06_425657	463	300	granted	grant	VBN
10_1101-2021_01_06_425657	463	301	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	463	302	a	a	DT
10_1101-2021_01_06_425657	463	303	license	license	NN
10_1101-2021_01_06_425657	463	304	to	to	TO
10_1101-2021_01_06_425657	463	305	display	display	VB
10_1101-2021_01_06_425657	463	306	the	the	DT
10_1101-2021_01_06_425657	463	307	preprint	preprint	NN
10_1101-2021_01_06_425657	463	308	in	in	IN
10_1101-2021_01_06_425657	463	309	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	463	310	.	.	.
10_1101-2021_01_06_425657	464	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	464	2	is	be	VBZ
10_1101-2021_01_06_425657	464	3	made	make	VBN
10_1101-2021_01_06_425657	464	4	The	the	DT
10_1101-2021_01_06_425657	464	5	copyright	copyright	NN
10_1101-2021_01_06_425657	464	6	holder	holder	NN
10_1101-2021_01_06_425657	464	7	for	for	IN
10_1101-2021_01_06_425657	464	8	this	this	DT
10_1101-2021_01_06_425657	464	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	464	10	version	version	NN
10_1101-2021_01_06_425657	464	11	posted	post	VBD
10_1101-2021_01_06_425657	464	12	January	January	NNP
10_1101-2021_01_06_425657	464	13	7	7	CD
10_1101-2021_01_06_425657	464	14	,	,	,
10_1101-2021_01_06_425657	464	15	2021	2021	CD
10_1101-2021_01_06_425657	464	16	.	.	.
10_1101-2021_01_06_425657	464	17	;	;	:
10_1101-2021_01_06_425657	464	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	464	19	:	:	:
10_1101-2021_01_06_425657	464	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	464	21	preprint	preprint	NN
10_1101-2021_01_06_425657	464	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	FW
10_1101-2021_01_06_425657	464	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	464	24	WD	WD	NNP
10_1101-2021_01_06_425657	464	25	8	8	CD
10_1101-2021_01_06_425657	464	26	WD	WD	NNP
10_1101-2021_01_06_425657	464	27	7	7	CD
10_1101-2021_01_06_425657	464	28	WD	WD	NNP
10_1101-2021_01_06_425657	464	29	6	6	CD
10_1101-2021_01_06_425657	464	30	WD	WD	NNP
10_1101-2021_01_06_425657	464	31	5	5	CD
10_1101-2021_01_06_425657	464	32	WD	WD	NNP
10_1101-2021_01_06_425657	464	33	4	4	CD
10_1101-2021_01_06_425657	464	34	WD	WD	NNP
10_1101-2021_01_06_425657	464	35	3	3	CD
10_1101-2021_01_06_425657	464	36	WD	WD	NNP
10_1101-2021_01_06_425657	464	37	2	2	CD
10_1101-2021_01_06_425657	464	38	WD	WD	NNP
10_1101-2021_01_06_425657	464	39	1F	1F	NNP
10_1101-2021_01_06_425657	464	40	-	-	:
10_1101-2021_01_06_425657	464	41	Box	Box	NNP
10_1101-2021_01_06_425657	464	42	95111	95111	CD
10_1101-2021_01_06_425657	464	43	164	164	CD
10_1101-2021_01_06_425657	464	44	201	201	CD
10_1101-2021_01_06_425657	464	45	205	205	CD
10_1101-2021_01_06_425657	464	46	211	211	CD
10_1101-2021_01_06_425657	464	47	228	228	CD
10_1101-2021_01_06_425657	464	48	614	614	CD
10_1101-2021_01_06_425657	464	49	616	616	CD
10_1101-2021_01_06_425657	464	50	622	622	CD
10_1101-2021_01_06_425657	464	51	630	630	CD
10_1101-2021_01_06_425657	464	52	236	236	CD
10_1101-2021_01_06_425657	464	53	239	239	CD
10_1101-2021_01_06_425657	464	54	293	293	CD
10_1101-2021_01_06_425657	464	55	374	374	CD
10_1101-2021_01_06_425657	464	56	414	414	CD
10_1101-2021_01_06_425657	464	57	426	426	CD
10_1101-2021_01_06_425657	464	58	436	436	CD
10_1101-2021_01_06_425657	464	59	439	439	CD
10_1101-2021_01_06_425657	464	60	455	455	CD
10_1101-2021_01_06_425657	464	61	528	528	CD
10_1101-2021_01_06_425657	464	62	544	544	CD
10_1101-2021_01_06_425657	464	63	584	584	CD
10_1101-2021_01_06_425657	464	64	640607	640607	CD
10_1101-2021_01_06_425657	464	65	-	-	SYM
10_1101-2021_01_06_425657	464	66	635550	635550	CD
10_1101-2021_01_06_425657	464	67	-	-	HYPH
10_1101-2021_01_06_425657	464	68	578509	578509	CD
10_1101-2021_01_06_425657	464	69	-	-	HYPH
10_1101-2021_01_06_425657	464	70	538461	538461	CD
10_1101-2021_01_06_425657	464	71	-	-	HYPH
10_1101-2021_01_06_425657	464	72	499419	499419	CD
10_1101-2021_01_06_425657	464	73	-	-	HYPH
10_1101-2021_01_06_425657	464	74	449380	449380	CD
10_1101-2021_01_06_425657	464	75	-	-	HYPH
10_1101-2021_01_06_425657	464	76	408340	408340	CD
10_1101-2021_01_06_425657	464	77	-	-	HYPH
10_1101-2021_01_06_425657	464	78	368300	368300	CD
10_1101-2021_01_06_425657	464	79	-	-	HYPH
10_1101-2021_01_06_425657	464	80	328180	328180	CD
10_1101-2021_01_06_425657	464	81	-	-	HYPH
10_1101-2021_01_06_425657	464	82	227a.a	227a.a	CD
10_1101-2021_01_06_425657	464	83	.	.	.
10_1101-2021_01_06_425657	465	1	1	1	CD
10_1101-2021_01_06_425657	465	2	SCF	scf	NN
10_1101-2021_01_06_425657	465	3	-	-	HYPH
10_1101-2021_01_06_425657	465	4	Binding	bind	VBG
10_1101-2021_01_06_425657	465	5	Met4-BindingA	Met4-BindingA	VBZ
10_1101-2021_01_06_425657	465	6	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	465	7	B	B	NNP
10_1101-2021_01_06_425657	465	8	75	75	CD
10_1101-2021_01_06_425657	465	9	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	10	100	100	CD
10_1101-2021_01_06_425657	465	11	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	12	100	100	CD
10_1101-2021_01_06_425657	465	13	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	14	150	150	CD
10_1101-2021_01_06_425657	465	15	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	16	75	75	CD
10_1101-2021_01_06_425657	465	17	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	18	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	465	19	R	R	NNP
10_1101-2021_01_06_425657	465	20	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	465	21	150	150	CD
10_1101-2021_01_06_425657	465	22	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	23	−S	−S	NNP
10_1101-2021_01_06_425657	465	24	Time	Time	NNP
10_1101-2021_01_06_425657	465	25	(	(	-LRB-
10_1101-2021_01_06_425657	465	26	min	min	NNP
10_1101-2021_01_06_425657	465	27	)	)	-RRB-
10_1101-2021_01_06_425657	465	28	0	0	CD
10_1101-2021_01_06_425657	465	29	15	15	CD
10_1101-2021_01_06_425657	465	30	15	15	CD
10_1101-2021_01_06_425657	465	31	0	0	CD
10_1101-2021_01_06_425657	465	32	15	15	CD
10_1101-2021_01_06_425657	465	33	0	0	CD
10_1101-2021_01_06_425657	465	34	15	15	CD
10_1101-2021_01_06_425657	465	35	0	0	CD
10_1101-2021_01_06_425657	465	36	15	15	CD
10_1101-2021_01_06_425657	465	37	0	0	CD
10_1101-2021_01_06_425657	465	38	15	15	CD
10_1101-2021_01_06_425657	465	39	0	0	CD
10_1101-2021_01_06_425657	465	40	15	15	CD
10_1101-2021_01_06_425657	465	41	0	0	CD
10_1101-2021_01_06_425657	465	42	15	15	CD
10_1101-2021_01_06_425657	465	43	0	0	CD
10_1101-2021_01_06_425657	465	44	15	15	CD
10_1101-2021_01_06_425657	465	45	WT	WT	NNP
10_1101-2021_01_06_425657	465	46	Ub	Ub	NNP
10_1101-2021_01_06_425657	465	47	-	-	HYPH
10_1101-2021_01_06_425657	465	48	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	465	49	Lactate	Lactate	NNP
10_1101-2021_01_06_425657	465	50	(	(	-LRB-
10_1101-2021_01_06_425657	465	51	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	465	52	)	)	-RRB-
10_1101-2021_01_06_425657	465	53	+	+	NFP
10_1101-2021_01_06_425657	465	54	DTT	DTT	NNP
10_1101-2021_01_06_425657	465	55	R	R	NNP
10_1101-2021_01_06_425657	465	56	−S	−S	NNP
10_1101-2021_01_06_425657	465	57	C201S	C201S	NNP
10_1101-2021_01_06_425657	465	58	R	R	NNP
10_1101-2021_01_06_425657	465	59	−S	−S	NNP
10_1101-2021_01_06_425657	465	60	C374S	C374S	NNP
10_1101-2021_01_06_425657	465	61	R	R	NNP
10_1101-2021_01_06_425657	465	62	−S	−S	NNP
10_1101-2021_01_06_425657	465	63	C414S	C414S	NNP
10_1101-2021_01_06_425657	465	64	R	R	NNP
10_1101-2021_01_06_425657	465	65	−S	−S	NNP
10_1101-2021_01_06_425657	465	66	C426S	C426S	NNP
10_1101-2021_01_06_425657	465	67	R	R	NNP
10_1101-2021_01_06_425657	465	68	−S	−S	NNP
10_1101-2021_01_06_425657	465	69	C436S	C436S	NNP
10_1101-2021_01_06_425657	465	70	R	R	NNP
10_1101-2021_01_06_425657	465	71	−S	−S	NNP
10_1101-2021_01_06_425657	465	72	C439S	C439S	NNP
10_1101-2021_01_06_425657	465	73	R	R	NNP
10_1101-2021_01_06_425657	465	74	−S	−S	NNP
10_1101-2021_01_06_425657	465	75	C455S	C455S	NNP
10_1101-2021_01_06_425657	465	76	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	465	77	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	465	78	R	R	NNP
10_1101-2021_01_06_425657	465	79	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	465	80	−S	−S	NNP
10_1101-2021_01_06_425657	465	81	Time	Time	NNP
10_1101-2021_01_06_425657	465	82	(	(	-LRB-
10_1101-2021_01_06_425657	465	83	min	min	NNP
10_1101-2021_01_06_425657	465	84	)	)	-RRB-
10_1101-2021_01_06_425657	465	85	0	0	CD
10_1101-2021_01_06_425657	465	86	15	15	CD
10_1101-2021_01_06_425657	465	87	0	0	CD
10_1101-2021_01_06_425657	465	88	15	15	CD
10_1101-2021_01_06_425657	465	89	0	0	CD
10_1101-2021_01_06_425657	465	90	15	15	CD
10_1101-2021_01_06_425657	465	91	0	0	CD
10_1101-2021_01_06_425657	465	92	15	15	CD
10_1101-2021_01_06_425657	465	93	0	0	CD
10_1101-2021_01_06_425657	465	94	15	15	CD
10_1101-2021_01_06_425657	465	95	0	0	CD
10_1101-2021_01_06_425657	465	96	15	15	CD
10_1101-2021_01_06_425657	465	97	0	0	CD
10_1101-2021_01_06_425657	465	98	15	15	CD
10_1101-2021_01_06_425657	465	99	0	0	CD
10_1101-2021_01_06_425657	465	100	15	15	CD
10_1101-2021_01_06_425657	465	101	WT	WT	NNP
10_1101-2021_01_06_425657	465	102	Ub	Ub	NNP
10_1101-2021_01_06_425657	465	103	-	-	HYPH
10_1101-2021_01_06_425657	465	104	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	465	105	R	r	NN
10_1101-2021_01_06_425657	465	106	−S	−S	NNP
10_1101-2021_01_06_425657	465	107	C528S	C528S	NNP
10_1101-2021_01_06_425657	465	108	R	R	NNP
10_1101-2021_01_06_425657	465	109	−S	−S	NNP
10_1101-2021_01_06_425657	465	110	C544S	C544S	NNP
10_1101-2021_01_06_425657	465	111	R	r	NN
10_1101-2021_01_06_425657	465	112	−S	−S	NNP
10_1101-2021_01_06_425657	465	113	C584S	C584S	NNP
10_1101-2021_01_06_425657	465	114	R	R	NNP
10_1101-2021_01_06_425657	465	115	−S	−S	NNP
10_1101-2021_01_06_425657	465	116	C614S	C614S	NNP
10_1101-2021_01_06_425657	465	117	R	r	NN
10_1101-2021_01_06_425657	465	118	−S	−S	NNP
10_1101-2021_01_06_425657	465	119	C616S	C616S	NNP
10_1101-2021_01_06_425657	465	120	R	R	NNP
10_1101-2021_01_06_425657	465	121	−S	−S	NNP
10_1101-2021_01_06_425657	465	122	C584/622S	c584/622s	NN
10_1101-2021_01_06_425657	465	123	R	R	NNP
10_1101-2021_01_06_425657	465	124	−S	−S	NNP
10_1101-2021_01_06_425657	465	125	C630S	C630S	NNP
10_1101-2021_01_06_425657	465	126	Figure	Figure	NNP
10_1101-2021_01_06_425657	465	127	S2	S2	NNP
10_1101-2021_01_06_425657	465	128	C	C	NNP
10_1101-2021_01_06_425657	465	129	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	465	130	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	465	131	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	465	132	75	75	CD
10_1101-2021_01_06_425657	465	133	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	134	100	100	CD
10_1101-2021_01_06_425657	465	135	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	136	150	150	CD
10_1101-2021_01_06_425657	465	137	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	138	100	100	CD
10_1101-2021_01_06_425657	465	139	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	140	150	150	CD
10_1101-2021_01_06_425657	465	141	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	142	75	75	CD
10_1101-2021_01_06_425657	465	143	kDa	kDa	NNS
10_1101-2021_01_06_425657	465	144	Lactate	Lactate	NNP
10_1101-2021_01_06_425657	465	145	(	(	-LRB-
10_1101-2021_01_06_425657	465	146	respiratory	respiratory	JJ
10_1101-2021_01_06_425657	465	147	)	)	-RRB-
10_1101-2021_01_06_425657	465	148	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	465	149	-	-	HYPH
10_1101-2021_01_06_425657	465	150	mal	mal	JJ
10_1101-2021_01_06_425657	465	151	Rpn10	Rpn10	NNP
10_1101-2021_01_06_425657	465	152	Rich	Rich	NNP
10_1101-2021_01_06_425657	465	153	+	+	SYM
10_1101-2021_01_06_425657	465	154	Cd	Cd	NNP
10_1101-2021_01_06_425657	465	155	Time	Time	NNP
10_1101-2021_01_06_425657	465	156	(	(	-LRB-
10_1101-2021_01_06_425657	465	157	min	min	NNP
10_1101-2021_01_06_425657	465	158	)	)	-RRB-
10_1101-2021_01_06_425657	465	159	0	0	CD
10_1101-2021_01_06_425657	465	160	15	15	CD
10_1101-2021_01_06_425657	465	161	45	45	CD
10_1101-2021_01_06_425657	465	162	90	90	CD
10_1101-2021_01_06_425657	465	163	0	0	CD
10_1101-2021_01_06_425657	465	164	15	15	CD
10_1101-2021_01_06_425657	465	165	45	45	CD
10_1101-2021_01_06_425657	465	166	90	90	CD
10_1101-2021_01_06_425657	465	167	0	0	CD
10_1101-2021_01_06_425657	465	168	15	15	CD
10_1101-2021_01_06_425657	465	169	45	45	CD
10_1101-2021_01_06_425657	465	170	90	90	CD
10_1101-2021_01_06_425657	465	171	WT	WT	NNP
10_1101-2021_01_06_425657	465	172	Rich	Rich	NNP
10_1101-2021_01_06_425657	465	173	+	+	SYM
10_1101-2021_01_06_425657	465	174	Cd	Cd	NNP
10_1101-2021_01_06_425657	465	175	C414S	C414S	NNP
10_1101-2021_01_06_425657	465	176	Rich	Rich	NNP
10_1101-2021_01_06_425657	465	177	+	+	SYM
10_1101-2021_01_06_425657	465	178	Cd	Cd	NNP
10_1101-2021_01_06_425657	465	179	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	465	180	Ub	Ub	NNP
10_1101-2021_01_06_425657	465	181	-	-	HYPH
10_1101-2021_01_06_425657	465	182	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	465	183	mPEG2K	mpeg2k	JJ
10_1101-2021_01_06_425657	465	184	-	-	HYPH
10_1101-2021_01_06_425657	465	185	mal	mal	JJ
10_1101-2021_01_06_425657	465	186	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	465	187	Red	Red	NNP
10_1101-2021_01_06_425657	465	188	-	-	HYPH
10_1101-2021_01_06_425657	465	189	Met30	Met30	NNP
10_1101-2021_01_06_425657	465	190	Ox	Ox	NNP
10_1101-2021_01_06_425657	465	191	-	-	HYPH
10_1101-2021_01_06_425657	465	192	Met30	Met30	NNP
10_1101-2021_01_06_425657	465	193	.CC	.CC	,
10_1101-2021_01_06_425657	465	194	-	-	:
10_1101-2021_01_06_425657	465	195	BY	by	IN
10_1101-2021_01_06_425657	465	196	4.0	4.0	CD
10_1101-2021_01_06_425657	465	197	International	International	NNP
10_1101-2021_01_06_425657	465	198	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	465	199	under	under	IN
10_1101-2021_01_06_425657	465	200	a	a	DT
10_1101-2021_01_06_425657	465	201	(	(	-LRB-
10_1101-2021_01_06_425657	465	202	which	which	WDT
10_1101-2021_01_06_425657	465	203	was	be	VBD
10_1101-2021_01_06_425657	465	204	not	not	RB
10_1101-2021_01_06_425657	465	205	certified	certify	VBN
10_1101-2021_01_06_425657	465	206	by	by	IN
10_1101-2021_01_06_425657	465	207	peer	peer	NN
10_1101-2021_01_06_425657	465	208	review	review	NN
10_1101-2021_01_06_425657	465	209	)	)	-RRB-
10_1101-2021_01_06_425657	465	210	is	be	VBZ
10_1101-2021_01_06_425657	465	211	the	the	DT
10_1101-2021_01_06_425657	465	212	author	author	NN
10_1101-2021_01_06_425657	465	213	/	/	SYM
10_1101-2021_01_06_425657	465	214	funder	funder	NN
10_1101-2021_01_06_425657	465	215	,	,	,
10_1101-2021_01_06_425657	465	216	who	who	WP
10_1101-2021_01_06_425657	465	217	has	have	VBZ
10_1101-2021_01_06_425657	465	218	granted	grant	VBN
10_1101-2021_01_06_425657	465	219	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	465	220	a	a	DT
10_1101-2021_01_06_425657	465	221	license	license	NN
10_1101-2021_01_06_425657	465	222	to	to	TO
10_1101-2021_01_06_425657	465	223	display	display	VB
10_1101-2021_01_06_425657	465	224	the	the	DT
10_1101-2021_01_06_425657	465	225	preprint	preprint	NN
10_1101-2021_01_06_425657	465	226	in	in	IN
10_1101-2021_01_06_425657	465	227	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	465	228	.	.	.
10_1101-2021_01_06_425657	466	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	466	2	is	be	VBZ
10_1101-2021_01_06_425657	466	3	made	make	VBN
10_1101-2021_01_06_425657	466	4	The	the	DT
10_1101-2021_01_06_425657	466	5	copyright	copyright	NN
10_1101-2021_01_06_425657	466	6	holder	holder	NN
10_1101-2021_01_06_425657	466	7	for	for	IN
10_1101-2021_01_06_425657	466	8	this	this	DT
10_1101-2021_01_06_425657	466	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	466	10	version	version	NN
10_1101-2021_01_06_425657	466	11	posted	post	VBD
10_1101-2021_01_06_425657	466	12	January	January	NNP
10_1101-2021_01_06_425657	466	13	7	7	CD
10_1101-2021_01_06_425657	466	14	,	,	,
10_1101-2021_01_06_425657	466	15	2021	2021	CD
10_1101-2021_01_06_425657	466	16	.	.	.
10_1101-2021_01_06_425657	466	17	;	;	:
10_1101-2021_01_06_425657	466	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	466	19	:	:	:
10_1101-2021_01_06_425657	466	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	466	21	preprint	preprint	NN
10_1101-2021_01_06_425657	466	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	466	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD
10_1101-2021_01_06_425657	466	24	75	75	CD
10_1101-2021_01_06_425657	466	25	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	26	100	100	CD
10_1101-2021_01_06_425657	466	27	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	28	150	150	CD
10_1101-2021_01_06_425657	466	29	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	30	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	466	31	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	466	32	Time	Time	NNP
10_1101-2021_01_06_425657	466	33	(	(	-LRB-
10_1101-2021_01_06_425657	466	34	min	min	NNP
10_1101-2021_01_06_425657	466	35	)	)	-RRB-
10_1101-2021_01_06_425657	466	36	60	60	CD
10_1101-2021_01_06_425657	466	37	60	60	CD
10_1101-2021_01_06_425657	466	38	60	60	CD
10_1101-2021_01_06_425657	466	39	0	0	CD
10_1101-2021_01_06_425657	466	40	15	15	CD
10_1101-2021_01_06_425657	466	41	30	30	CD
10_1101-2021_01_06_425657	466	42	60	60	CD
10_1101-2021_01_06_425657	466	43	180	180	CD
10_1101-2021_01_06_425657	466	44	60	60	CD
10_1101-2021_01_06_425657	466	45	60	60	CD
10_1101-2021_01_06_425657	466	46	60	60	CD
10_1101-2021_01_06_425657	466	47	0	0	CD
10_1101-2021_01_06_425657	466	48	15	15	CD
10_1101-2021_01_06_425657	466	49	30	30	CD
10_1101-2021_01_06_425657	466	50	60	60	CD
10_1101-2021_01_06_425657	466	51	180	180	CD
10_1101-2021_01_06_425657	466	52	+	+	CD
10_1101-2021_01_06_425657	466	53	+	+	SYM
10_1101-2021_01_06_425657	466	54	−	−	NNP
10_1101-2021_01_06_425657	466	55	+	+	SYM
10_1101-2021_01_06_425657	466	56	+	+	SYM
10_1101-2021_01_06_425657	466	57	+	+	SYM
10_1101-2021_01_06_425657	466	58	+	+	SYM
10_1101-2021_01_06_425657	466	59	+	+	SYM
10_1101-2021_01_06_425657	466	60	+	+	SYM
10_1101-2021_01_06_425657	466	61	+	+	SYM
10_1101-2021_01_06_425657	466	62	−	−	NNP
10_1101-2021_01_06_425657	466	63	+	+	SYM
10_1101-2021_01_06_425657	466	64	+	+	SYM
10_1101-2021_01_06_425657	466	65	+	+	SYM
10_1101-2021_01_06_425657	466	66	+	+	SYM
10_1101-2021_01_06_425657	466	67	+	+	SYM
10_1101-2021_01_06_425657	466	68	+	+	SYM
10_1101-2021_01_06_425657	466	69	−	−	NNP
10_1101-2021_01_06_425657	466	70	+	+	SYM
10_1101-2021_01_06_425657	466	71	+	+	SYM
10_1101-2021_01_06_425657	466	72	+	+	SYM
10_1101-2021_01_06_425657	466	73	+	+	SYM
10_1101-2021_01_06_425657	466	74	+	+	SYM
10_1101-2021_01_06_425657	466	75	+	+	SYM
10_1101-2021_01_06_425657	466	76	+	+	SYM
10_1101-2021_01_06_425657	466	77	−	−	NNP
10_1101-2021_01_06_425657	466	78	+	+	SYM
10_1101-2021_01_06_425657	466	79	+	+	SYM
10_1101-2021_01_06_425657	466	80	+	+	SYM
10_1101-2021_01_06_425657	466	81	+	+	SYM
10_1101-2021_01_06_425657	466	82	+	+	SYM
10_1101-2021_01_06_425657	466	83	+	+	SYM
10_1101-2021_01_06_425657	466	84	−	−	NNP
10_1101-2021_01_06_425657	466	85	+	+	SYM
10_1101-2021_01_06_425657	466	86	+	+	SYM
10_1101-2021_01_06_425657	466	87	+	+	SYM
10_1101-2021_01_06_425657	466	88	+	+	SYM
10_1101-2021_01_06_425657	466	89	+	+	SYM
10_1101-2021_01_06_425657	466	90	+	+	SYM
10_1101-2021_01_06_425657	466	91	+	+	SYM
10_1101-2021_01_06_425657	466	92	−	−	NNP
10_1101-2021_01_06_425657	466	93	+	+	SYM
10_1101-2021_01_06_425657	466	94	+	+	SYM
10_1101-2021_01_06_425657	466	95	+	+	SYM
10_1101-2021_01_06_425657	466	96	+	+	SYM
10_1101-2021_01_06_425657	466	97	+	+	SYM
10_1101-2021_01_06_425657	466	98	+	+	SYM
10_1101-2021_01_06_425657	466	99	+	+	SYM
10_1101-2021_01_06_425657	466	100	Flag	flag	NN
10_1101-2021_01_06_425657	466	101	purification	purification	NN
10_1101-2021_01_06_425657	466	102	+	+	CC
10_1101-2021_01_06_425657	466	103	DTT	DTT	NNP
10_1101-2021_01_06_425657	466	104	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	466	105	Ubiquitin	Ubiquitin	NNP
10_1101-2021_01_06_425657	466	106	Met4	Met4	NNP
10_1101-2021_01_06_425657	466	107	Rich	Rich	NNP
10_1101-2021_01_06_425657	466	108	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	466	109	A	A	NNP
10_1101-2021_01_06_425657	466	110	75	75	CD
10_1101-2021_01_06_425657	466	111	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	112	100	100	CD
10_1101-2021_01_06_425657	466	113	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	114	150	150	CD
10_1101-2021_01_06_425657	466	115	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	116	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	466	117	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	466	118	Time	Time	NNP
10_1101-2021_01_06_425657	466	119	(	(	-LRB-
10_1101-2021_01_06_425657	466	120	min	min	NNP
10_1101-2021_01_06_425657	466	121	)	)	-RRB-
10_1101-2021_01_06_425657	466	122	60	60	CD
10_1101-2021_01_06_425657	466	123	60	60	CD
10_1101-2021_01_06_425657	466	124	60	60	CD
10_1101-2021_01_06_425657	466	125	0	0	CD
10_1101-2021_01_06_425657	466	126	15	15	CD
10_1101-2021_01_06_425657	466	127	30	30	CD
10_1101-2021_01_06_425657	466	128	60	60	CD
10_1101-2021_01_06_425657	466	129	180	180	CD
10_1101-2021_01_06_425657	466	130	60	60	CD
10_1101-2021_01_06_425657	466	131	60	60	CD
10_1101-2021_01_06_425657	466	132	60	60	CD
10_1101-2021_01_06_425657	466	133	0	0	CD
10_1101-2021_01_06_425657	466	134	15	15	CD
10_1101-2021_01_06_425657	466	135	30	30	CD
10_1101-2021_01_06_425657	466	136	60	60	CD
10_1101-2021_01_06_425657	466	137	180	180	CD
10_1101-2021_01_06_425657	466	138	+	+	CD
10_1101-2021_01_06_425657	466	139	+	+	SYM
10_1101-2021_01_06_425657	466	140	−	−	NNP
10_1101-2021_01_06_425657	466	141	+	+	SYM
10_1101-2021_01_06_425657	466	142	+	+	SYM
10_1101-2021_01_06_425657	466	143	+	+	SYM
10_1101-2021_01_06_425657	466	144	+	+	SYM
10_1101-2021_01_06_425657	466	145	+	+	SYM
10_1101-2021_01_06_425657	466	146	+	+	SYM
10_1101-2021_01_06_425657	466	147	+	+	SYM
10_1101-2021_01_06_425657	466	148	−	−	NNP
10_1101-2021_01_06_425657	466	149	+	+	SYM
10_1101-2021_01_06_425657	466	150	+	+	SYM
10_1101-2021_01_06_425657	466	151	+	+	SYM
10_1101-2021_01_06_425657	466	152	+	+	SYM
10_1101-2021_01_06_425657	466	153	+	+	SYM
10_1101-2021_01_06_425657	466	154	+	+	SYM
10_1101-2021_01_06_425657	466	155	−	−	NNP
10_1101-2021_01_06_425657	466	156	+	+	SYM
10_1101-2021_01_06_425657	466	157	+	+	SYM
10_1101-2021_01_06_425657	466	158	+	+	SYM
10_1101-2021_01_06_425657	466	159	+	+	SYM
10_1101-2021_01_06_425657	466	160	+	+	SYM
10_1101-2021_01_06_425657	466	161	+	+	SYM
10_1101-2021_01_06_425657	466	162	+	+	SYM
10_1101-2021_01_06_425657	466	163	−	−	NNP
10_1101-2021_01_06_425657	466	164	+	+	SYM
10_1101-2021_01_06_425657	466	165	+	+	SYM
10_1101-2021_01_06_425657	466	166	+	+	SYM
10_1101-2021_01_06_425657	466	167	+	+	SYM
10_1101-2021_01_06_425657	466	168	+	+	SYM
10_1101-2021_01_06_425657	466	169	+	+	SYM
10_1101-2021_01_06_425657	466	170	−	−	NNP
10_1101-2021_01_06_425657	466	171	+	+	SYM
10_1101-2021_01_06_425657	466	172	+	+	SYM
10_1101-2021_01_06_425657	466	173	+	+	SYM
10_1101-2021_01_06_425657	466	174	+	+	SYM
10_1101-2021_01_06_425657	466	175	+	+	SYM
10_1101-2021_01_06_425657	466	176	+	+	SYM
10_1101-2021_01_06_425657	466	177	+	+	SYM
10_1101-2021_01_06_425657	466	178	−	−	NNP
10_1101-2021_01_06_425657	466	179	+	+	SYM
10_1101-2021_01_06_425657	466	180	+	+	SYM
10_1101-2021_01_06_425657	466	181	+	+	SYM
10_1101-2021_01_06_425657	466	182	+	+	SYM
10_1101-2021_01_06_425657	466	183	+	+	SYM
10_1101-2021_01_06_425657	466	184	+	+	SYM
10_1101-2021_01_06_425657	466	185	+	+	SYM
10_1101-2021_01_06_425657	466	186	Flag	flag	NN
10_1101-2021_01_06_425657	466	187	purification	purification	NN
10_1101-2021_01_06_425657	466	188	−DTT	−DTT	VBZ
10_1101-2021_01_06_425657	466	189	SCFMet30-Flag	scfmet30-flag	DT
10_1101-2021_01_06_425657	466	190	Ubiquitin	Ubiquitin	NNP
10_1101-2021_01_06_425657	466	191	Met4	Met4	NNP
10_1101-2021_01_06_425657	466	192	Rich	Rich	NNP
10_1101-2021_01_06_425657	466	193	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	466	194	B	B	NNP
10_1101-2021_01_06_425657	466	195	C	c	NN
10_1101-2021_01_06_425657	466	196	+	+	SYM
10_1101-2021_01_06_425657	466	197	DTT	DTT	NNP
10_1101-2021_01_06_425657	466	198	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	466	199	+	+	SYM
10_1101-2021_01_06_425657	466	200	DTT	DTT	NNP
10_1101-2021_01_06_425657	466	201	−DTT	−DTT	NNP
10_1101-2021_01_06_425657	466	202	Rich	Rich	NNP
10_1101-2021_01_06_425657	466	203	−Sulfur	−Sulfur	NNP
10_1101-2021_01_06_425657	466	204	150	150	CD
10_1101-2021_01_06_425657	466	205	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	206	100	100	CD
10_1101-2021_01_06_425657	466	207	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	208	75	75	CD
10_1101-2021_01_06_425657	466	209	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	210	50	50	CD
10_1101-2021_01_06_425657	466	211	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	212	37	37	CD
10_1101-2021_01_06_425657	466	213	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	214	25	25	CD
10_1101-2021_01_06_425657	466	215	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	216	20	20	CD
10_1101-2021_01_06_425657	466	217	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	218	Cdc53	Cdc53	NNP
10_1101-2021_01_06_425657	466	219	Met30	Met30	NNP
10_1101-2021_01_06_425657	466	220	Skp1	Skp1	NNP
10_1101-2021_01_06_425657	466	221	Cdc53	Cdc53	NNP
10_1101-2021_01_06_425657	466	222	100	100	CD
10_1101-2021_01_06_425657	466	223	kDa	kDa	NNS
10_1101-2021_01_06_425657	466	224	+	+	SYM
10_1101-2021_01_06_425657	466	225	DTT	DTT	NNP
10_1101-2021_01_06_425657	466	226	−DTT	−DTT	NNP
10_1101-2021_01_06_425657	466	227	Rich	rich	JJ
10_1101-2021_01_06_425657	466	228	+	+	SYM
10_1101-2021_01_06_425657	466	229	DTT	DTT	NNP
10_1101-2021_01_06_425657	466	230	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	466	231	−SulfurD	−sulfurd	DT
10_1101-2021_01_06_425657	466	232	Figure	figure	NN
10_1101-2021_01_06_425657	466	233	S3	S3	NNP
10_1101-2021_01_06_425657	466	234	Ub	Ub	NNP
10_1101-2021_01_06_425657	466	235	-	-	HYPH
10_1101-2021_01_06_425657	466	236	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	466	237	Ub	Ub	NNP
10_1101-2021_01_06_425657	466	238	-	-	HYPH
10_1101-2021_01_06_425657	466	239	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	466	240	.CC	.CC	NFP
10_1101-2021_01_06_425657	466	241	-	-	:
10_1101-2021_01_06_425657	466	242	BY	by	IN
10_1101-2021_01_06_425657	466	243	4.0	4.0	CD
10_1101-2021_01_06_425657	466	244	International	International	NNP
10_1101-2021_01_06_425657	466	245	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	466	246	under	under	IN
10_1101-2021_01_06_425657	466	247	a	a	DT
10_1101-2021_01_06_425657	466	248	(	(	-LRB-
10_1101-2021_01_06_425657	466	249	which	which	WDT
10_1101-2021_01_06_425657	466	250	was	be	VBD
10_1101-2021_01_06_425657	466	251	not	not	RB
10_1101-2021_01_06_425657	466	252	certified	certify	VBN
10_1101-2021_01_06_425657	466	253	by	by	IN
10_1101-2021_01_06_425657	466	254	peer	peer	NN
10_1101-2021_01_06_425657	466	255	review	review	NN
10_1101-2021_01_06_425657	466	256	)	)	-RRB-
10_1101-2021_01_06_425657	466	257	is	be	VBZ
10_1101-2021_01_06_425657	466	258	the	the	DT
10_1101-2021_01_06_425657	466	259	author	author	NN
10_1101-2021_01_06_425657	466	260	/	/	SYM
10_1101-2021_01_06_425657	466	261	funder	funder	NN
10_1101-2021_01_06_425657	466	262	,	,	,
10_1101-2021_01_06_425657	466	263	who	who	WP
10_1101-2021_01_06_425657	466	264	has	have	VBZ
10_1101-2021_01_06_425657	466	265	granted	grant	VBN
10_1101-2021_01_06_425657	466	266	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	466	267	a	a	DT
10_1101-2021_01_06_425657	466	268	license	license	NN
10_1101-2021_01_06_425657	466	269	to	to	TO
10_1101-2021_01_06_425657	466	270	display	display	VB
10_1101-2021_01_06_425657	466	271	the	the	DT
10_1101-2021_01_06_425657	466	272	preprint	preprint	NN
10_1101-2021_01_06_425657	466	273	in	in	IN
10_1101-2021_01_06_425657	466	274	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	466	275	.	.	.
10_1101-2021_01_06_425657	467	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	467	2	is	be	VBZ
10_1101-2021_01_06_425657	467	3	made	make	VBN
10_1101-2021_01_06_425657	467	4	The	the	DT
10_1101-2021_01_06_425657	467	5	copyright	copyright	NN
10_1101-2021_01_06_425657	467	6	holder	holder	NN
10_1101-2021_01_06_425657	467	7	for	for	IN
10_1101-2021_01_06_425657	467	8	this	this	DT
10_1101-2021_01_06_425657	467	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	467	10	version	version	NN
10_1101-2021_01_06_425657	467	11	posted	post	VBD
10_1101-2021_01_06_425657	467	12	January	January	NNP
10_1101-2021_01_06_425657	467	13	7	7	CD
10_1101-2021_01_06_425657	467	14	,	,	,
10_1101-2021_01_06_425657	467	15	2021	2021	CD
10_1101-2021_01_06_425657	467	16	.	.	.
10_1101-2021_01_06_425657	467	17	;	;	:
10_1101-2021_01_06_425657	467	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	467	19	:	:	:
10_1101-2021_01_06_425657	467	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	467	21	preprint	preprint	NN
10_1101-2021_01_06_425657	467	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	NNP
10_1101-2021_01_06_425657	467	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	-LRB-
10_1101-2021_01_06_425657	467	24	Figure	Figure	NNP
10_1101-2021_01_06_425657	467	25	S4	s4	NN
10_1101-2021_01_06_425657	467	26	75	75	CD
10_1101-2021_01_06_425657	467	27	kDa	kDa	NNS
10_1101-2021_01_06_425657	467	28	100	100	CD
10_1101-2021_01_06_425657	467	29	kDa	kDa	NNS
10_1101-2021_01_06_425657	467	30	150	150	CD
10_1101-2021_01_06_425657	467	31	kDa	kDa	NNS
10_1101-2021_01_06_425657	467	32	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	467	33	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	467	34	Time	Time	NNP
10_1101-2021_01_06_425657	467	35	(	(	-LRB-
10_1101-2021_01_06_425657	467	36	min	min	NNP
10_1101-2021_01_06_425657	467	37	)	)	-RRB-
10_1101-2021_01_06_425657	467	38	0	0	NFP
10_1101-2021_01_06_425657	467	39	60	60	CD
10_1101-2021_01_06_425657	467	40	180	180	CD
10_1101-2021_01_06_425657	467	41	0	0	CD
10_1101-2021_01_06_425657	467	42	60	60	CD
10_1101-2021_01_06_425657	467	43	180	180	CD
10_1101-2021_01_06_425657	467	44	0	0	CD
10_1101-2021_01_06_425657	467	45	60	60	CD
10_1101-2021_01_06_425657	467	46	180	180	CD
10_1101-2021_01_06_425657	467	47	0	0	CD
10_1101-2021_01_06_425657	467	48	60	60	CD
10_1101-2021_01_06_425657	467	49	180	180	CD
10_1101-2021_01_06_425657	467	50	0	0	CD
10_1101-2021_01_06_425657	467	51	60	60	CD
10_1101-2021_01_06_425657	467	52	180	180	CD
10_1101-2021_01_06_425657	467	53	0	0	CD
10_1101-2021_01_06_425657	467	54	60	60	CD
10_1101-2021_01_06_425657	467	55	180	180	CD
10_1101-2021_01_06_425657	467	56	+	+	CD
10_1101-2021_01_06_425657	467	57	+	+	SYM
10_1101-2021_01_06_425657	467	58	+	+	SYM
10_1101-2021_01_06_425657	467	59	+	+	SYM
10_1101-2021_01_06_425657	467	60	+	+	SYM
10_1101-2021_01_06_425657	467	61	+	+	SYM
10_1101-2021_01_06_425657	467	62	+	+	SYM
10_1101-2021_01_06_425657	467	63	+	+	SYM
10_1101-2021_01_06_425657	467	64	+	+	SYM
10_1101-2021_01_06_425657	467	65	+	+	SYM
10_1101-2021_01_06_425657	467	66	+	+	SYM
10_1101-2021_01_06_425657	467	67	+	+	SYM
10_1101-2021_01_06_425657	467	68	+	+	SYM
10_1101-2021_01_06_425657	467	69	+	+	SYM
10_1101-2021_01_06_425657	467	70	+	+	SYM
10_1101-2021_01_06_425657	467	71	+	+	SYM
10_1101-2021_01_06_425657	467	72	+	+	SYM
10_1101-2021_01_06_425657	467	73	+	+	SYM
10_1101-2021_01_06_425657	467	74	+	+	SYM
10_1101-2021_01_06_425657	467	75	+	+	SYM
10_1101-2021_01_06_425657	467	76	+	+	SYM
10_1101-2021_01_06_425657	467	77	+	+	SYM
10_1101-2021_01_06_425657	467	78	+	+	SYM
10_1101-2021_01_06_425657	467	79	+	+	SYM
10_1101-2021_01_06_425657	467	80	+	+	SYM
10_1101-2021_01_06_425657	467	81	+	+	SYM
10_1101-2021_01_06_425657	467	82	+	+	SYM
10_1101-2021_01_06_425657	467	83	+	+	SYM
10_1101-2021_01_06_425657	467	84	+	+	SYM
10_1101-2021_01_06_425657	467	85	+	+	SYM
10_1101-2021_01_06_425657	467	86	+	+	SYM
10_1101-2021_01_06_425657	467	87	+	+	SYM
10_1101-2021_01_06_425657	467	88	+	+	SYM
10_1101-2021_01_06_425657	467	89	+	+	SYM
10_1101-2021_01_06_425657	467	90	+	+	SYM
10_1101-2021_01_06_425657	467	91	+	+	SYM
10_1101-2021_01_06_425657	467	92	+	+	SYM
10_1101-2021_01_06_425657	467	93	+	+	SYM
10_1101-2021_01_06_425657	467	94	+	+	SYM
10_1101-2021_01_06_425657	467	95	+	+	SYM
10_1101-2021_01_06_425657	467	96	+	+	SYM
10_1101-2021_01_06_425657	467	97	+	+	SYM
10_1101-2021_01_06_425657	467	98	+	+	SYM
10_1101-2021_01_06_425657	467	99	+	+	SYM
10_1101-2021_01_06_425657	467	100	+	+	SYM
10_1101-2021_01_06_425657	467	101	+	+	SYM
10_1101-2021_01_06_425657	467	102	+	+	SYM
10_1101-2021_01_06_425657	467	103	+	+	SYM
10_1101-2021_01_06_425657	467	104	+	+	SYM
10_1101-2021_01_06_425657	467	105	+	+	SYM
10_1101-2021_01_06_425657	467	106	+	+	SYM
10_1101-2021_01_06_425657	467	107	+	+	SYM
10_1101-2021_01_06_425657	467	108	+	+	SYM
10_1101-2021_01_06_425657	467	109	+	+	SYM
10_1101-2021_01_06_425657	467	110	Flag	flag	NN
10_1101-2021_01_06_425657	467	111	purification	purification	NN
10_1101-2021_01_06_425657	467	112	Rich	Rich	NNP
10_1101-2021_01_06_425657	467	113	SCFMet30-Flag	SCFMet30-Flag	NNP
10_1101-2021_01_06_425657	467	114	Ubiquitin	Ubiquitin	NNP
10_1101-2021_01_06_425657	467	115	Met4	Met4	NNP
10_1101-2021_01_06_425657	467	116	+	+	SYM
10_1101-2021_01_06_425657	467	117	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	118	A	a	DT
10_1101-2021_01_06_425657	467	119	Ub	Ub	NNP
10_1101-2021_01_06_425657	467	120	-	-	HYPH
10_1101-2021_01_06_425657	467	121	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	467	122	+	+	CC
10_1101-2021_01_06_425657	467	123	D	D	NNP
10_1101-2021_01_06_425657	467	124	TT	TT	NNP
10_1101-2021_01_06_425657	467	125	−D	−D	NNP
10_1101-2021_01_06_425657	467	126	TT	TT	NNP
10_1101-2021_01_06_425657	467	127	+	+	CC
10_1101-2021_01_06_425657	467	128	D	d	NN
10_1101-2021_01_06_425657	467	129	iam	iam	NNP
10_1101-2021_01_06_425657	467	130	i	-PRON-	PRP
10_1101-2021_01_06_425657	467	131	d	d	NN
10_1101-2021_01_06_425657	467	132	e	e	NN
10_1101-2021_01_06_425657	467	133	+	+	NN
10_1101-2021_01_06_425657	467	134	D	D	NNP
10_1101-2021_01_06_425657	467	135	TT	TT	NNP
10_1101-2021_01_06_425657	467	136	−D	−D	NNP
10_1101-2021_01_06_425657	467	137	TT	TT	NNP
10_1101-2021_01_06_425657	467	138	+	+	CC
10_1101-2021_01_06_425657	467	139	D	d	NN
10_1101-2021_01_06_425657	467	140	iam	iam	NNP
10_1101-2021_01_06_425657	467	141	i	-PRON-	PRP
10_1101-2021_01_06_425657	467	142	d	d	NN
10_1101-2021_01_06_425657	467	143	e	e	NN
10_1101-2021_01_06_425657	467	144	+	+	NN
10_1101-2021_01_06_425657	467	145	D	D	NNP
10_1101-2021_01_06_425657	467	146	TT	TT	NNP
10_1101-2021_01_06_425657	467	147	−D	−D	NNP
10_1101-2021_01_06_425657	467	148	TT	TT	NNP
10_1101-2021_01_06_425657	467	149	+	+	CC
10_1101-2021_01_06_425657	467	150	D	d	NN
10_1101-2021_01_06_425657	467	151	iam	iam	NNP
10_1101-2021_01_06_425657	467	152	i	-PRON-	PRP
10_1101-2021_01_06_425657	467	153	d	d	NN
10_1101-2021_01_06_425657	467	154	e	e	NNP
10_1101-2021_01_06_425657	467	155	0	0	CD
10_1101-2021_01_06_425657	467	156	2	2	CD
10_1101-2021_01_06_425657	467	157	4	4	CD
10_1101-2021_01_06_425657	467	158	6	6	CD
10_1101-2021_01_06_425657	467	159	M	M	NNP
10_1101-2021_01_06_425657	467	160	et	et	NN
10_1101-2021_01_06_425657	467	161	4	4	CD
10_1101-2021_01_06_425657	467	162	pu	pu	NNP
10_1101-2021_01_06_425657	467	163	lld	lld	NN
10_1101-2021_01_06_425657	467	164	ow	ow	NNP
10_1101-2021_01_06_425657	467	165	n	n	NNP
10_1101-2021_01_06_425657	467	166	(	(	-LRB-
10_1101-2021_01_06_425657	467	167	+	+	CC
10_1101-2021_01_06_425657	467	168	D	d	NN
10_1101-2021_01_06_425657	467	169	TT	TT	NNP
10_1101-2021_01_06_425657	467	170	/	/	,
10_1101-2021_01_06_425657	467	171	–	–	:
10_1101-2021_01_06_425657	467	172	D	D	NNP
10_1101-2021_01_06_425657	467	173	TT	TT	NNP
10_1101-2021_01_06_425657	467	174	)	)	-RRB-
10_1101-2021_01_06_425657	467	175	WT	WT	NNP
10_1101-2021_01_06_425657	467	176	C414S	C414S	NNP
10_1101-2021_01_06_425657	467	177	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	467	178	Input	input	NN
10_1101-2021_01_06_425657	467	179	+	+	SYM
10_1101-2021_01_06_425657	467	180	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	181	−DTT	−dtt	CD
10_1101-2021_01_06_425657	467	182	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	467	183	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	467	184	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	467	185	Met30-Flag	Met30-Flag	NNP
10_1101-2021_01_06_425657	467	186	IP	IP	NNP
10_1101-2021_01_06_425657	467	187	Met4-HA	Met4-HA	NNP
10_1101-2021_01_06_425657	467	188	co	co	JJ
10_1101-2021_01_06_425657	467	189	-	-	JJ
10_1101-2021_01_06_425657	467	190	IP	ip	JJ
10_1101-2021_01_06_425657	467	191	WT	WT	NNP
10_1101-2021_01_06_425657	467	192	C414S	C414S	NNP
10_1101-2021_01_06_425657	467	193	+	+	SYM
10_1101-2021_01_06_425657	467	194	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	195	+	+	SYM
10_1101-2021_01_06_425657	467	196	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	197	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	198	+	+	SYM
10_1101-2021_01_06_425657	467	199	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	200	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	201	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	202	+	+	SYM
10_1101-2021_01_06_425657	467	203	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	204	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	205	+	+	CC
10_1101-2021_01_06_425657	467	206	Diamide	diamide	NN
10_1101-2021_01_06_425657	467	207	+	+	SYM
10_1101-2021_01_06_425657	467	208	DTT	dtt	NN
10_1101-2021_01_06_425657	467	209	+	+	SYM
10_1101-2021_01_06_425657	467	210	DTT	dtt	NN
10_1101-2021_01_06_425657	467	211	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	212	+	+	SYM
10_1101-2021_01_06_425657	467	213	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	214	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	215	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	216	+	+	SYM
10_1101-2021_01_06_425657	467	217	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	218	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	219	+	+	CC
10_1101-2021_01_06_425657	467	220	Diamide	diamide	NN
10_1101-2021_01_06_425657	467	221	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	467	222	+	+	SYM
10_1101-2021_01_06_425657	467	223	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	224	+	+	SYM
10_1101-2021_01_06_425657	467	225	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	226	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	227	+	+	SYM
10_1101-2021_01_06_425657	467	228	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	229	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	230	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	231	+	+	SYM
10_1101-2021_01_06_425657	467	232	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	233	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	234	+	+	CC
10_1101-2021_01_06_425657	467	235	Diamide	diamide	NN
10_1101-2021_01_06_425657	467	236	WT	WT	NNP
10_1101-2021_01_06_425657	467	237	C414S	c414s	IN
10_1101-2021_01_06_425657	467	238	C614/616/622/630S	c614/616/622/630s	NN
10_1101-2021_01_06_425657	467	239	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	240	+	+	SYM
10_1101-2021_01_06_425657	467	241	DTT	DTT	NNP
10_1101-2021_01_06_425657	467	242	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	243	+	+	SYM
10_1101-2021_01_06_425657	467	244	DTT	dtt	NN
10_1101-2021_01_06_425657	467	245	−DTT	−DTT	NNS
10_1101-2021_01_06_425657	467	246	B	b	NN
10_1101-2021_01_06_425657	467	247	.CC	.CC	,
10_1101-2021_01_06_425657	467	248	-	-	:
10_1101-2021_01_06_425657	467	249	BY	by	IN
10_1101-2021_01_06_425657	467	250	4.0	4.0	CD
10_1101-2021_01_06_425657	467	251	International	International	NNP
10_1101-2021_01_06_425657	467	252	licenseavailable	licenseavailable	NN
10_1101-2021_01_06_425657	467	253	under	under	IN
10_1101-2021_01_06_425657	467	254	a	a	DT
10_1101-2021_01_06_425657	467	255	(	(	-LRB-
10_1101-2021_01_06_425657	467	256	which	which	WDT
10_1101-2021_01_06_425657	467	257	was	be	VBD
10_1101-2021_01_06_425657	467	258	not	not	RB
10_1101-2021_01_06_425657	467	259	certified	certify	VBN
10_1101-2021_01_06_425657	467	260	by	by	IN
10_1101-2021_01_06_425657	467	261	peer	peer	NN
10_1101-2021_01_06_425657	467	262	review	review	NN
10_1101-2021_01_06_425657	467	263	)	)	-RRB-
10_1101-2021_01_06_425657	467	264	is	be	VBZ
10_1101-2021_01_06_425657	467	265	the	the	DT
10_1101-2021_01_06_425657	467	266	author	author	NN
10_1101-2021_01_06_425657	467	267	/	/	SYM
10_1101-2021_01_06_425657	467	268	funder	funder	NN
10_1101-2021_01_06_425657	467	269	,	,	,
10_1101-2021_01_06_425657	467	270	who	who	WP
10_1101-2021_01_06_425657	467	271	has	have	VBZ
10_1101-2021_01_06_425657	467	272	granted	grant	VBN
10_1101-2021_01_06_425657	467	273	bioRxiv	biorxiv	IN
10_1101-2021_01_06_425657	467	274	a	a	DT
10_1101-2021_01_06_425657	467	275	license	license	NN
10_1101-2021_01_06_425657	467	276	to	to	TO
10_1101-2021_01_06_425657	467	277	display	display	VB
10_1101-2021_01_06_425657	467	278	the	the	DT
10_1101-2021_01_06_425657	467	279	preprint	preprint	NN
10_1101-2021_01_06_425657	467	280	in	in	IN
10_1101-2021_01_06_425657	467	281	perpetuity	perpetuity	NN
10_1101-2021_01_06_425657	467	282	.	.	.
10_1101-2021_01_06_425657	468	1	It	-PRON-	PRP
10_1101-2021_01_06_425657	468	2	is	be	VBZ
10_1101-2021_01_06_425657	468	3	made	make	VBN
10_1101-2021_01_06_425657	468	4	The	the	DT
10_1101-2021_01_06_425657	468	5	copyright	copyright	NN
10_1101-2021_01_06_425657	468	6	holder	holder	NN
10_1101-2021_01_06_425657	468	7	for	for	IN
10_1101-2021_01_06_425657	468	8	this	this	DT
10_1101-2021_01_06_425657	468	9	preprintthis	preprintthis	NN
10_1101-2021_01_06_425657	468	10	version	version	NN
10_1101-2021_01_06_425657	468	11	posted	post	VBD
10_1101-2021_01_06_425657	468	12	January	January	NNP
10_1101-2021_01_06_425657	468	13	7	7	CD
10_1101-2021_01_06_425657	468	14	,	,	,
10_1101-2021_01_06_425657	468	15	2021	2021	CD
10_1101-2021_01_06_425657	468	16	.	.	.
10_1101-2021_01_06_425657	468	17	;	;	:
10_1101-2021_01_06_425657	468	18	https://doi.org/10.1101/2021.01.06.425657doi	https://doi.org/10.1101/2021.01.06.425657doi	NFP
10_1101-2021_01_06_425657	468	19	:	:	:
10_1101-2021_01_06_425657	468	20	bioRxiv	biorxiv	VB
10_1101-2021_01_06_425657	468	21	preprint	preprint	NN
10_1101-2021_01_06_425657	468	22	https://doi.org/10.1101/2021.01.06.425657	https://doi.org/10.1101/2021.01.06.425657	ADD
10_1101-2021_01_06_425657	468	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	ADD