id	sid	tid	token	lemma	pos
10_1101-2021_01_07_425723	1	1	1	1	LS
10_1101-2021_01_07_425723	1	2	Engineering	engineer	VBG
10_1101-2021_01_07_425723	1	3	the	the	DT
10_1101-2021_01_07_425723	1	4	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	1	5	industrial	industrial	JJ
10_1101-2021_01_07_425723	1	6	yeast	yeast	NN
10_1101-2021_01_07_425723	1	7	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	1	8	marxianus	marxianus	NN
10_1101-2021_01_07_425723	1	9	for	for	IN
10_1101-2021_01_07_425723	1	10	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1	11	growth	growth	NN
10_1101-2021_01_07_425723	1	12	1	1	CD
10_1101-2021_01_07_425723	1	13	Wijbrand	Wijbrand	NNP
10_1101-2021_01_07_425723	1	14	J.	J.	NNP
10_1101-2021_01_07_425723	1	15	C.	C.	NNP
10_1101-2021_01_07_425723	1	16	Dekker	Dekker	NNP
10_1101-2021_01_07_425723	1	17	,	,	,
10_1101-2021_01_07_425723	1	18	Raúl	Raúl	NNP
10_1101-2021_01_07_425723	1	19	A.	A.	NNP
10_1101-2021_01_07_425723	1	20	Ortiz	Ortiz	NNP
10_1101-2021_01_07_425723	1	21	-	-	HYPH
10_1101-2021_01_07_425723	1	22	Merino	Merino	NNP
10_1101-2021_01_07_425723	1	23	,	,	,
10_1101-2021_01_07_425723	1	24	Astrid	Astrid	NNP
10_1101-2021_01_07_425723	1	25	Kaljouw	Kaljouw	NNP
10_1101-2021_01_07_425723	1	26	,	,	,
10_1101-2021_01_07_425723	1	27	Julius	Julius	NNP
10_1101-2021_01_07_425723	1	28	Battjes	Battjes	NNP
10_1101-2021_01_07_425723	1	29	,	,	,
10_1101-2021_01_07_425723	1	30	Frank	Frank	NNP
10_1101-2021_01_07_425723	1	31	W.	W.	NNP
10_1101-2021_01_07_425723	1	32	Wiering	Wiering	NNP
10_1101-2021_01_07_425723	1	33	,	,	,
10_1101-2021_01_07_425723	1	34	Christiaan	Christiaan	NNP
10_1101-2021_01_07_425723	1	35	2	2	CD
10_1101-2021_01_07_425723	1	36	Mooiman	Mooiman	NNP
10_1101-2021_01_07_425723	1	37	,	,	,
10_1101-2021_01_07_425723	1	38	Pilar	Pilar	NNP
10_1101-2021_01_07_425723	1	39	de	de	NNP
10_1101-2021_01_07_425723	1	40	la	la	NNP
10_1101-2021_01_07_425723	1	41	Torre	Torre	NNP
10_1101-2021_01_07_425723	1	42	,	,	,
10_1101-2021_01_07_425723	1	43	and	and	CC
10_1101-2021_01_07_425723	1	44	Jack	Jack	NNP
10_1101-2021_01_07_425723	1	45	T.	T.	NNP
10_1101-2021_01_07_425723	1	46	Pronk	Pronk	NNP
10_1101-2021_01_07_425723	1	47	*	*	NFP
10_1101-2021_01_07_425723	1	48	3	3	CD
10_1101-2021_01_07_425723	1	49	Department	Department	NNP
10_1101-2021_01_07_425723	1	50	of	of	IN
10_1101-2021_01_07_425723	1	51	Biotechnology	Biotechnology	NNP
10_1101-2021_01_07_425723	1	52	,	,	,
10_1101-2021_01_07_425723	1	53	Delft	Delft	NNP
10_1101-2021_01_07_425723	1	54	University	University	NNP
10_1101-2021_01_07_425723	1	55	of	of	IN
10_1101-2021_01_07_425723	1	56	Technology	Technology	NNP
10_1101-2021_01_07_425723	1	57	,	,	,
10_1101-2021_01_07_425723	1	58	van	van	NNP
10_1101-2021_01_07_425723	1	59	der	der	NNP
10_1101-2021_01_07_425723	1	60	Maasweg	Maasweg	NNP
10_1101-2021_01_07_425723	1	61	9	9	CD
10_1101-2021_01_07_425723	1	62	,	,	,
10_1101-2021_01_07_425723	1	63	2629	2629	CD
10_1101-2021_01_07_425723	1	64	HZ	HZ	NNP
10_1101-2021_01_07_425723	1	65	Delft	Delft	NNP
10_1101-2021_01_07_425723	1	66	,	,	,
10_1101-2021_01_07_425723	1	67	The	the	DT
10_1101-2021_01_07_425723	1	68	4	4	CD
10_1101-2021_01_07_425723	1	69	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	1	70	5	5	CD
10_1101-2021_01_07_425723	1	71	*	*	NFP
10_1101-2021_01_07_425723	1	72	Corresponding	Corresponding	NNP
10_1101-2021_01_07_425723	1	73	author	author	NN
10_1101-2021_01_07_425723	1	74	:	:	:
10_1101-2021_01_07_425723	1	75	Department	Department	NNP
10_1101-2021_01_07_425723	1	76	of	of	IN
10_1101-2021_01_07_425723	1	77	Biotechnology	Biotechnology	NNP
10_1101-2021_01_07_425723	1	78	,	,	,
10_1101-2021_01_07_425723	1	79	Delft	Delft	NNP
10_1101-2021_01_07_425723	1	80	University	University	NNP
10_1101-2021_01_07_425723	1	81	of	of	IN
10_1101-2021_01_07_425723	1	82	Technology	Technology	NNP
10_1101-2021_01_07_425723	1	83	,	,	,
10_1101-2021_01_07_425723	1	84	van	van	NNP
10_1101-2021_01_07_425723	1	85	der	der	NNP
10_1101-2021_01_07_425723	1	86	Maasweg	Maasweg	NNP
10_1101-2021_01_07_425723	1	87	6	6	CD
10_1101-2021_01_07_425723	1	88	9	9	CD
10_1101-2021_01_07_425723	1	89	,	,	,
10_1101-2021_01_07_425723	1	90	2629	2629	CD
10_1101-2021_01_07_425723	1	91	HZ	HZ	NNP
10_1101-2021_01_07_425723	1	92	Delft	Delft	NNP
10_1101-2021_01_07_425723	1	93	,	,	,
10_1101-2021_01_07_425723	1	94	The	the	DT
10_1101-2021_01_07_425723	1	95	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	1	96	,	,	,
10_1101-2021_01_07_425723	1	97	E	e	NN
10_1101-2021_01_07_425723	1	98	-	-	NN
10_1101-2021_01_07_425723	1	99	mail	mail	NN
10_1101-2021_01_07_425723	1	100	:	:	:
10_1101-2021_01_07_425723	1	101	j.t.pronk@tudelft.nl	j.t.pronk@tudelft.nl	UH
10_1101-2021_01_07_425723	1	102	,	,	,
10_1101-2021_01_07_425723	1	103	Tel	tel	NN
10_1101-2021_01_07_425723	1	104	:	:	:
10_1101-2021_01_07_425723	1	105	+31	+31	CD
10_1101-2021_01_07_425723	1	106	15	15	CD
10_1101-2021_01_07_425723	1	107	2783214	2783214	CD
10_1101-2021_01_07_425723	1	108	.	.	.
10_1101-2021_01_07_425723	2	1	7	7	CD
10_1101-2021_01_07_425723	2	2	Wijbrand	Wijbrand	NNP
10_1101-2021_01_07_425723	2	3	J.C.	J.C.	NNP
10_1101-2021_01_07_425723	2	4	Dekker	Dekker	NNP
10_1101-2021_01_07_425723	2	5	w.j.c.dekker@tudelft.nl	w.j.c.dekker@tudelft.nl	NNP
10_1101-2021_01_07_425723	2	6	8	8	CD
10_1101-2021_01_07_425723	2	7	Raúl	Raúl	NNP
10_1101-2021_01_07_425723	2	8	A.	A.	NNP
10_1101-2021_01_07_425723	2	9	Ortiz	Ortiz	NNP
10_1101-2021_01_07_425723	2	10	-	-	HYPH
10_1101-2021_01_07_425723	2	11	Merino	Merino	NNP
10_1101-2021_01_07_425723	2	12	raul.ortiz@tudelft.nl	raul.ortiz@tudelft.nl	NNS
10_1101-2021_01_07_425723	2	13	https://orcid.org/0000-0003-4186-8941	https://orcid.org/0000-0003-4186-8941	JJ
10_1101-2021_01_07_425723	2	14	9	9	CD
10_1101-2021_01_07_425723	2	15	Astrid	Astrid	NNP
10_1101-2021_01_07_425723	2	16	Kaljouw	Kaljouw	NNPS
10_1101-2021_01_07_425723	2	17	astridk20@gmail.com	astridk20@gmail.com	ADD
10_1101-2021_01_07_425723	2	18	10	10	CD
10_1101-2021_01_07_425723	2	19	Julius	Julius	NNP
10_1101-2021_01_07_425723	2	20	Battjes	Battjes	NNP
10_1101-2021_01_07_425723	2	21	juliusbattjes@hotmail.com	juliusbattjes@hotmail.com	ADD
10_1101-2021_01_07_425723	2	22	11	11	CD
10_1101-2021_01_07_425723	2	23	Frank	Frank	NNP
10_1101-2021_01_07_425723	2	24	Willem	Willem	NNP
10_1101-2021_01_07_425723	2	25	Wiering	Wiering	NNP
10_1101-2021_01_07_425723	2	26	frank.wiering@gmail.com	frank.wiering@gmail.com	ADD
10_1101-2021_01_07_425723	2	27	12	12	CD
10_1101-2021_01_07_425723	2	28	Christiaan	Christiaan	NNP
10_1101-2021_01_07_425723	2	29	Mooiman	Mooiman	NNP
10_1101-2021_01_07_425723	2	30	c.mooiman@tudelft.nl	c.mooiman@tudelft.nl	NNP
10_1101-2021_01_07_425723	2	31	13	13	CD
10_1101-2021_01_07_425723	2	32	Pilar	Pilar	NNP
10_1101-2021_01_07_425723	2	33	de	de	NNP
10_1101-2021_01_07_425723	2	34	la	la	NNP
10_1101-2021_01_07_425723	2	35	Torre	Torre	NNP
10_1101-2021_01_07_425723	2	36	pilartocortes@gmail.com	pilartocortes@gmail.com	NNP
10_1101-2021_01_07_425723	2	37	14	14	CD
10_1101-2021_01_07_425723	2	38	Jack	Jack	NNP
10_1101-2021_01_07_425723	2	39	T.	T.	NNP
10_1101-2021_01_07_425723	2	40	Pronk	Pronk	NNP
10_1101-2021_01_07_425723	2	41	j.t.pronk@tudelft.nl	j.t.pronk@tudelft.nl	NNP
10_1101-2021_01_07_425723	2	42	https://orcid.org/0000-0002-5617-4611	https://orcid.org/0000-0002-5617-4611	NNP
10_1101-2021_01_07_425723	2	43	15	15	CD
10_1101-2021_01_07_425723	2	44	Manuscript	manuscript	NN
10_1101-2021_01_07_425723	2	45	for	for	IN
10_1101-2021_01_07_425723	2	46	submission	submission	NN
10_1101-2021_01_07_425723	2	47	in	in	IN
10_1101-2021_01_07_425723	2	48	Nature	Nature	NNP
10_1101-2021_01_07_425723	2	49	Biotechnology	Biotechnology	NNP
10_1101-2021_01_07_425723	2	50	,	,	,
10_1101-2021_01_07_425723	2	51	section	section	NN
10_1101-2021_01_07_425723	2	52	:	:	:
10_1101-2021_01_07_425723	2	53	Article	article	NN
10_1101-2021_01_07_425723	2	54	.	.	.
10_1101-2021_01_07_425723	3	1	16	16	CD
10_1101-2021_01_07_425723	3	2	.CC	.CC	:
10_1101-2021_01_07_425723	3	3	-	-	HYPH
10_1101-2021_01_07_425723	3	4	BY	by	IN
10_1101-2021_01_07_425723	3	5	-	-	HYPH
10_1101-2021_01_07_425723	3	6	NC	NC	NNP
10_1101-2021_01_07_425723	3	7	-	-	HYPH
10_1101-2021_01_07_425723	3	8	ND	ND	NNP
10_1101-2021_01_07_425723	3	9	4.0	4.0	CD
10_1101-2021_01_07_425723	3	10	International	International	NNP
10_1101-2021_01_07_425723	3	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	3	12	under	under	IN
10_1101-2021_01_07_425723	3	13	a	a	DT
10_1101-2021_01_07_425723	3	14	(	(	-LRB-
10_1101-2021_01_07_425723	3	15	which	which	WDT
10_1101-2021_01_07_425723	3	16	was	be	VBD
10_1101-2021_01_07_425723	3	17	not	not	RB
10_1101-2021_01_07_425723	3	18	certified	certify	VBN
10_1101-2021_01_07_425723	3	19	by	by	IN
10_1101-2021_01_07_425723	3	20	peer	peer	NN
10_1101-2021_01_07_425723	3	21	review	review	NN
10_1101-2021_01_07_425723	3	22	)	)	-RRB-
10_1101-2021_01_07_425723	3	23	is	be	VBZ
10_1101-2021_01_07_425723	3	24	the	the	DT
10_1101-2021_01_07_425723	3	25	author	author	NN
10_1101-2021_01_07_425723	3	26	/	/	SYM
10_1101-2021_01_07_425723	3	27	funder	funder	NN
10_1101-2021_01_07_425723	3	28	,	,	,
10_1101-2021_01_07_425723	3	29	who	who	WP
10_1101-2021_01_07_425723	3	30	has	have	VBZ
10_1101-2021_01_07_425723	3	31	granted	grant	VBN
10_1101-2021_01_07_425723	3	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	3	33	a	a	DT
10_1101-2021_01_07_425723	3	34	license	license	NN
10_1101-2021_01_07_425723	3	35	to	to	TO
10_1101-2021_01_07_425723	3	36	display	display	VB
10_1101-2021_01_07_425723	3	37	the	the	DT
10_1101-2021_01_07_425723	3	38	preprint	preprint	NN
10_1101-2021_01_07_425723	3	39	in	in	IN
10_1101-2021_01_07_425723	3	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	3	41	.	.	.
10_1101-2021_01_07_425723	4	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	4	2	is	be	VBZ
10_1101-2021_01_07_425723	4	3	made	make	VBN
10_1101-2021_01_07_425723	4	4	The	the	DT
10_1101-2021_01_07_425723	4	5	copyright	copyright	NN
10_1101-2021_01_07_425723	4	6	holder	holder	NN
10_1101-2021_01_07_425723	4	7	for	for	IN
10_1101-2021_01_07_425723	4	8	this	this	DT
10_1101-2021_01_07_425723	4	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	4	10	version	version	NN
10_1101-2021_01_07_425723	4	11	posted	post	VBD
10_1101-2021_01_07_425723	4	12	January	January	NNP
10_1101-2021_01_07_425723	4	13	8	8	CD
10_1101-2021_01_07_425723	4	14	,	,	,
10_1101-2021_01_07_425723	4	15	2021	2021	CD
10_1101-2021_01_07_425723	4	16	.	.	.
10_1101-2021_01_07_425723	4	17	;	;	:
10_1101-2021_01_07_425723	4	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	4	19	:	:	:
10_1101-2021_01_07_425723	4	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	4	21	preprint	preprint	NN
10_1101-2021_01_07_425723	4	22	mailto:j.t.pronk@tudelft.nl	mailto:j.t.pronk@tudelft.nl	NNP
10_1101-2021_01_07_425723	4	23	mailto:w.j.c.dekker@tudelft.nl	mailto:w.j.c.dekker@tudelft.nl	NNP
10_1101-2021_01_07_425723	4	24	mailto:raul.ortiz@tudelft.nl	mailto:raul.ortiz@tudelft.nl	NNP
10_1101-2021_01_07_425723	4	25	https://orcid.org/0000-0003-4186-8941	https://orcid.org/0000-0003-4186-8941	NNP
10_1101-2021_01_07_425723	4	26	mailto:c.mooiman@tudelft.nl	mailto:c.mooiman@tudelft.nl	NNP
10_1101-2021_01_07_425723	4	27	mailto:j.t.pronk@tudelft.nl	mailto:j.t.pronk@tudelft.nl	NNP
10_1101-2021_01_07_425723	4	28	https://orcid.org/0000-0002-5617-4611	https://orcid.org/0000-0002-5617-4611	NNP
10_1101-2021_01_07_425723	4	29	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	4	30	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	4	31	2	2	CD
10_1101-2021_01_07_425723	4	32	Abstract	Abstract	NNP
10_1101-2021_01_07_425723	4	33	17	17	CD
10_1101-2021_01_07_425723	4	34	Current	current	JJ
10_1101-2021_01_07_425723	4	35	large	large	JJ
10_1101-2021_01_07_425723	4	36	-	-	HYPH
10_1101-2021_01_07_425723	4	37	scale	scale	NN
10_1101-2021_01_07_425723	4	38	,	,	,
10_1101-2021_01_07_425723	4	39	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	4	40	industrial	industrial	JJ
10_1101-2021_01_07_425723	4	41	processes	process	NNS
10_1101-2021_01_07_425723	4	42	for	for	IN
10_1101-2021_01_07_425723	4	43	ethanol	ethanol	NN
10_1101-2021_01_07_425723	4	44	production	production	NN
10_1101-2021_01_07_425723	4	45	from	from	IN
10_1101-2021_01_07_425723	4	46	renewable	renewable	JJ
10_1101-2021_01_07_425723	4	47	18	18	CD
10_1101-2021_01_07_425723	4	48	carbohydrates	carbohydrate	NNS
10_1101-2021_01_07_425723	4	49	predominantly	predominantly	RB
10_1101-2021_01_07_425723	4	50	rely	rely	VBP
10_1101-2021_01_07_425723	4	51	on	on	IN
10_1101-2021_01_07_425723	4	52	the	the	DT
10_1101-2021_01_07_425723	4	53	mesophilic	mesophilic	JJ
10_1101-2021_01_07_425723	4	54	yeast	yeast	NN
10_1101-2021_01_07_425723	4	55	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_07_425723	4	56	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	4	57	.	.	.
10_1101-2021_01_07_425723	5	1	Use	use	NN
10_1101-2021_01_07_425723	5	2	of	of	IN
10_1101-2021_01_07_425723	5	3	19	19	CD
10_1101-2021_01_07_425723	5	4	thermotolerant	thermotolerant	NN
10_1101-2021_01_07_425723	5	5	,	,	,
10_1101-2021_01_07_425723	5	6	facultatively	facultatively	RB
10_1101-2021_01_07_425723	5	7	fermentative	fermentative	JJ
10_1101-2021_01_07_425723	5	8	yeasts	yeast	NNS
10_1101-2021_01_07_425723	5	9	such	such	JJ
10_1101-2021_01_07_425723	5	10	as	as	IN
10_1101-2021_01_07_425723	5	11	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	5	12	marxianus	marxianus	NN
10_1101-2021_01_07_425723	5	13	could	could	MD
10_1101-2021_01_07_425723	5	14	confer	confer	VB
10_1101-2021_01_07_425723	5	15	20	20	CD
10_1101-2021_01_07_425723	5	16	significant	significant	JJ
10_1101-2021_01_07_425723	5	17	economic	economic	JJ
10_1101-2021_01_07_425723	5	18	benefits	benefit	NNS
10_1101-2021_01_07_425723	5	19	.	.	.
10_1101-2021_01_07_425723	6	1	However	however	RB
10_1101-2021_01_07_425723	6	2	,	,	,
10_1101-2021_01_07_425723	6	3	in	in	IN
10_1101-2021_01_07_425723	6	4	contrast	contrast	NN
10_1101-2021_01_07_425723	6	5	to	to	IN
10_1101-2021_01_07_425723	6	6	S.	S.	NNP
10_1101-2021_01_07_425723	6	7	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	6	8	,	,	,
10_1101-2021_01_07_425723	6	9	these	these	DT
10_1101-2021_01_07_425723	6	10	yeasts	yeast	NNS
10_1101-2021_01_07_425723	6	11	can	can	MD
10_1101-2021_01_07_425723	6	12	not	not	RB
10_1101-2021_01_07_425723	6	13	grow	grow	VB
10_1101-2021_01_07_425723	6	14	in	in	IN
10_1101-2021_01_07_425723	6	15	the	the	DT
10_1101-2021_01_07_425723	6	16	21	21	CD
10_1101-2021_01_07_425723	6	17	absence	absence	NN
10_1101-2021_01_07_425723	6	18	of	of	IN
10_1101-2021_01_07_425723	6	19	oxygen	oxygen	NN
10_1101-2021_01_07_425723	6	20	.	.	.
10_1101-2021_01_07_425723	7	1	Response	response	NN
10_1101-2021_01_07_425723	7	2	of	of	IN
10_1101-2021_01_07_425723	7	3	K.	K.	NNP
10_1101-2021_01_07_425723	7	4	marxianus	marxianus	NN
10_1101-2021_01_07_425723	7	5	and	and	CC
10_1101-2021_01_07_425723	7	6	S.	S.	NNP
10_1101-2021_01_07_425723	7	7	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	7	8	to	to	IN
10_1101-2021_01_07_425723	7	9	different	different	JJ
10_1101-2021_01_07_425723	7	10	oxygen	oxygen	NN
10_1101-2021_01_07_425723	7	11	-	-	HYPH
10_1101-2021_01_07_425723	7	12	limitation	limitation	NN
10_1101-2021_01_07_425723	7	13	regimes	regime	NNS
10_1101-2021_01_07_425723	7	14	22	22	CD
10_1101-2021_01_07_425723	7	15	were	be	VBD
10_1101-2021_01_07_425723	7	16	analyzed	analyze	VBN
10_1101-2021_01_07_425723	7	17	in	in	IN
10_1101-2021_01_07_425723	7	18	chemostats	chemostat	NNS
10_1101-2021_01_07_425723	7	19	.	.	.
10_1101-2021_01_07_425723	8	1	Genome	genome	JJ
10_1101-2021_01_07_425723	8	2	and	and	CC
10_1101-2021_01_07_425723	8	3	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	8	4	analysis	analysis	NN
10_1101-2021_01_07_425723	8	5	,	,	,
10_1101-2021_01_07_425723	8	6	physiological	physiological	JJ
10_1101-2021_01_07_425723	8	7	responses	response	NNS
10_1101-2021_01_07_425723	8	8	to	to	TO
10_1101-2021_01_07_425723	8	9	sterol	sterol	VB
10_1101-2021_01_07_425723	8	10	23	23	CD
10_1101-2021_01_07_425723	8	11	supplementation	supplementation	NN
10_1101-2021_01_07_425723	8	12	and	and	CC
10_1101-2021_01_07_425723	8	13	sterol	sterol	NN
10_1101-2021_01_07_425723	8	14	-	-	HYPH
10_1101-2021_01_07_425723	8	15	uptake	uptake	NN
10_1101-2021_01_07_425723	8	16	measurements	measurement	NNS
10_1101-2021_01_07_425723	8	17	identified	identify	VBN
10_1101-2021_01_07_425723	8	18	absence	absence	NN
10_1101-2021_01_07_425723	8	19	of	of	IN
10_1101-2021_01_07_425723	8	20	a	a	DT
10_1101-2021_01_07_425723	8	21	functional	functional	JJ
10_1101-2021_01_07_425723	8	22	sterol	sterol	NN
10_1101-2021_01_07_425723	8	23	-	-	HYPH
10_1101-2021_01_07_425723	8	24	uptake	uptake	VB
10_1101-2021_01_07_425723	8	25	24	24	CD
10_1101-2021_01_07_425723	8	26	mechanism	mechanism	NN
10_1101-2021_01_07_425723	8	27	as	as	IN
10_1101-2021_01_07_425723	8	28	a	a	DT
10_1101-2021_01_07_425723	8	29	key	key	JJ
10_1101-2021_01_07_425723	8	30	factor	factor	NN
10_1101-2021_01_07_425723	8	31	underlying	underlie	VBG
10_1101-2021_01_07_425723	8	32	the	the	DT
10_1101-2021_01_07_425723	8	33	oxygen	oxygen	NN
10_1101-2021_01_07_425723	8	34	requirement	requirement	NN
10_1101-2021_01_07_425723	8	35	of	of	IN
10_1101-2021_01_07_425723	8	36	K.	K.	NNP
10_1101-2021_01_07_425723	8	37	marxianus	marxianus	NN
10_1101-2021_01_07_425723	8	38	.	.	.
10_1101-2021_01_07_425723	9	1	Heterologous	heterologous	JJ
10_1101-2021_01_07_425723	9	2	expression	expression	NN
10_1101-2021_01_07_425723	9	3	25	25	CD
10_1101-2021_01_07_425723	9	4	of	of	IN
10_1101-2021_01_07_425723	9	5	a	a	DT
10_1101-2021_01_07_425723	9	6	squalene	squalene	NN
10_1101-2021_01_07_425723	9	7	-	-	HYPH
10_1101-2021_01_07_425723	9	8	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	9	9	cyclase	cyclase	NN
10_1101-2021_01_07_425723	9	10	enabled	enable	VBD
10_1101-2021_01_07_425723	9	11	oxygen	oxygen	NN
10_1101-2021_01_07_425723	9	12	-	-	HYPH
10_1101-2021_01_07_425723	9	13	independent	independent	JJ
10_1101-2021_01_07_425723	9	14	synthesis	synthesis	NN
10_1101-2021_01_07_425723	9	15	of	of	IN
10_1101-2021_01_07_425723	9	16	the	the	DT
10_1101-2021_01_07_425723	9	17	sterol	sterol	NN
10_1101-2021_01_07_425723	9	18	surrogate	surrogate	NN
10_1101-2021_01_07_425723	9	19	26	26	CD
10_1101-2021_01_07_425723	9	20	tetrahymanol	tetrahymanol	NNS
10_1101-2021_01_07_425723	9	21	in	in	IN
10_1101-2021_01_07_425723	9	22	K.	K.	NNP
10_1101-2021_01_07_425723	9	23	marxianus	marxianus	NN
10_1101-2021_01_07_425723	9	24	.	.	.
10_1101-2021_01_07_425723	10	1	After	after	IN
10_1101-2021_01_07_425723	10	2	a	a	DT
10_1101-2021_01_07_425723	10	3	brief	brief	JJ
10_1101-2021_01_07_425723	10	4	adaptation	adaptation	NN
10_1101-2021_01_07_425723	10	5	under	under	IN
10_1101-2021_01_07_425723	10	6	oxygen	oxygen	NN
10_1101-2021_01_07_425723	10	7	-	-	HYPH
10_1101-2021_01_07_425723	10	8	limited	limit	VBN
10_1101-2021_01_07_425723	10	9	conditions	condition	NNS
10_1101-2021_01_07_425723	10	10	,	,	,
10_1101-2021_01_07_425723	10	11	tetrahymanol-27	tetrahymanol-27	NN
10_1101-2021_01_07_425723	10	12	expressing	express	VBG
10_1101-2021_01_07_425723	10	13	K.	K.	NNP
10_1101-2021_01_07_425723	10	14	marxianus	marxianus	NN
10_1101-2021_01_07_425723	10	15	strains	strain	NNS
10_1101-2021_01_07_425723	10	16	grew	grow	VBD
10_1101-2021_01_07_425723	10	17	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	10	18	on	on	IN
10_1101-2021_01_07_425723	10	19	glucose	glucose	NN
10_1101-2021_01_07_425723	10	20	at	at	IN
10_1101-2021_01_07_425723	10	21	temperatures	temperature	NNS
10_1101-2021_01_07_425723	10	22	of	of	IN
10_1101-2021_01_07_425723	10	23	up	up	IN
10_1101-2021_01_07_425723	10	24	to	to	TO
10_1101-2021_01_07_425723	10	25	45	45	CD
10_1101-2021_01_07_425723	10	26	°	°	NNS
10_1101-2021_01_07_425723	10	27	C	C	NNP
10_1101-2021_01_07_425723	10	28	.	.	.
10_1101-2021_01_07_425723	11	1	These	these	DT
10_1101-2021_01_07_425723	11	2	28	28	CD
10_1101-2021_01_07_425723	11	3	results	result	NNS
10_1101-2021_01_07_425723	11	4	open	open	VBP
10_1101-2021_01_07_425723	11	5	up	up	RP
10_1101-2021_01_07_425723	11	6	new	new	JJ
10_1101-2021_01_07_425723	11	7	directions	direction	NNS
10_1101-2021_01_07_425723	11	8	in	in	IN
10_1101-2021_01_07_425723	11	9	the	the	DT
10_1101-2021_01_07_425723	11	10	development	development	NN
10_1101-2021_01_07_425723	11	11	of	of	IN
10_1101-2021_01_07_425723	11	12	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	11	13	yeast	yeast	NN
10_1101-2021_01_07_425723	11	14	strains	strain	NNS
10_1101-2021_01_07_425723	11	15	for	for	IN
10_1101-2021_01_07_425723	11	16	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	11	17	29	29	CD
10_1101-2021_01_07_425723	11	18	industrial	industrial	JJ
10_1101-2021_01_07_425723	11	19	applications	application	NNS
10_1101-2021_01_07_425723	11	20	.	.	.
10_1101-2021_01_07_425723	12	1	30	30	CD
10_1101-2021_01_07_425723	12	2	Keywords	keyword	NNS
10_1101-2021_01_07_425723	12	3	:	:	:
10_1101-2021_01_07_425723	12	4	Ergosterol	ergosterol	UH
10_1101-2021_01_07_425723	12	5	,	,	,
10_1101-2021_01_07_425723	12	6	tetrahymanol	tetrahymanol	NNS
10_1101-2021_01_07_425723	12	7	,	,	,
10_1101-2021_01_07_425723	12	8	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	12	9	metabolism	metabolism	NN
10_1101-2021_01_07_425723	12	10	,	,	,
10_1101-2021_01_07_425723	12	11	thermotolerance	thermotolerance	NN
10_1101-2021_01_07_425723	12	12	,	,	,
10_1101-2021_01_07_425723	12	13	ethanol	ethanol	NN
10_1101-2021_01_07_425723	12	14	production	production	NN
10_1101-2021_01_07_425723	12	15	,	,	,
10_1101-2021_01_07_425723	12	16	31	31	CD
10_1101-2021_01_07_425723	12	17	yeast	yeast	NN
10_1101-2021_01_07_425723	12	18	biotechnology	biotechnology	NN
10_1101-2021_01_07_425723	12	19	,	,	,
10_1101-2021_01_07_425723	12	20	metabolic	metabolic	NNP
10_1101-2021_01_07_425723	12	21	engineering	engineer	VBG
10_1101-2021_01_07_425723	12	22	32	32	CD
10_1101-2021_01_07_425723	12	23	.CC	.CC	,
10_1101-2021_01_07_425723	12	24	-	-	HYPH
10_1101-2021_01_07_425723	12	25	BY	by	IN
10_1101-2021_01_07_425723	12	26	-	-	HYPH
10_1101-2021_01_07_425723	12	27	NC	NC	NNP
10_1101-2021_01_07_425723	12	28	-	-	HYPH
10_1101-2021_01_07_425723	12	29	ND	ND	NNP
10_1101-2021_01_07_425723	12	30	4.0	4.0	CD
10_1101-2021_01_07_425723	12	31	International	International	NNP
10_1101-2021_01_07_425723	12	32	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	12	33	under	under	IN
10_1101-2021_01_07_425723	12	34	a	a	DT
10_1101-2021_01_07_425723	12	35	(	(	-LRB-
10_1101-2021_01_07_425723	12	36	which	which	WDT
10_1101-2021_01_07_425723	12	37	was	be	VBD
10_1101-2021_01_07_425723	12	38	not	not	RB
10_1101-2021_01_07_425723	12	39	certified	certify	VBN
10_1101-2021_01_07_425723	12	40	by	by	IN
10_1101-2021_01_07_425723	12	41	peer	peer	NN
10_1101-2021_01_07_425723	12	42	review	review	NN
10_1101-2021_01_07_425723	12	43	)	)	-RRB-
10_1101-2021_01_07_425723	12	44	is	be	VBZ
10_1101-2021_01_07_425723	12	45	the	the	DT
10_1101-2021_01_07_425723	12	46	author	author	NN
10_1101-2021_01_07_425723	12	47	/	/	SYM
10_1101-2021_01_07_425723	12	48	funder	funder	NN
10_1101-2021_01_07_425723	12	49	,	,	,
10_1101-2021_01_07_425723	12	50	who	who	WP
10_1101-2021_01_07_425723	12	51	has	have	VBZ
10_1101-2021_01_07_425723	12	52	granted	grant	VBN
10_1101-2021_01_07_425723	12	53	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	12	54	a	a	DT
10_1101-2021_01_07_425723	12	55	license	license	NN
10_1101-2021_01_07_425723	12	56	to	to	TO
10_1101-2021_01_07_425723	12	57	display	display	VB
10_1101-2021_01_07_425723	12	58	the	the	DT
10_1101-2021_01_07_425723	12	59	preprint	preprint	NN
10_1101-2021_01_07_425723	12	60	in	in	IN
10_1101-2021_01_07_425723	12	61	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	12	62	.	.	.
10_1101-2021_01_07_425723	13	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	13	2	is	be	VBZ
10_1101-2021_01_07_425723	13	3	made	make	VBN
10_1101-2021_01_07_425723	13	4	The	the	DT
10_1101-2021_01_07_425723	13	5	copyright	copyright	NN
10_1101-2021_01_07_425723	13	6	holder	holder	NN
10_1101-2021_01_07_425723	13	7	for	for	IN
10_1101-2021_01_07_425723	13	8	this	this	DT
10_1101-2021_01_07_425723	13	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	13	10	version	version	NN
10_1101-2021_01_07_425723	13	11	posted	post	VBD
10_1101-2021_01_07_425723	13	12	January	January	NNP
10_1101-2021_01_07_425723	13	13	8	8	CD
10_1101-2021_01_07_425723	13	14	,	,	,
10_1101-2021_01_07_425723	13	15	2021	2021	CD
10_1101-2021_01_07_425723	13	16	.	.	.
10_1101-2021_01_07_425723	13	17	;	;	:
10_1101-2021_01_07_425723	13	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	13	19	:	:	:
10_1101-2021_01_07_425723	13	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	13	21	preprint	preprint	NN
10_1101-2021_01_07_425723	13	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	13	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	13	24	3	3	CD
10_1101-2021_01_07_425723	13	25	In	in	IN
10_1101-2021_01_07_425723	13	26	terms	term	NNS
10_1101-2021_01_07_425723	13	27	of	of	IN
10_1101-2021_01_07_425723	13	28	product	product	NN
10_1101-2021_01_07_425723	13	29	volume	volume	NN
10_1101-2021_01_07_425723	13	30	(	(	-LRB-
10_1101-2021_01_07_425723	13	31	87	87	CD
10_1101-2021_01_07_425723	13	32	Mton	Mton	NNP
10_1101-2021_01_07_425723	13	33	y-1)1,2	y-1)1,2	NN
10_1101-2021_01_07_425723	13	34	,	,	,
10_1101-2021_01_07_425723	13	35	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	13	36	conversion	conversion	NN
10_1101-2021_01_07_425723	13	37	of	of	IN
10_1101-2021_01_07_425723	13	38	carbohydrates	carbohydrate	NNS
10_1101-2021_01_07_425723	13	39	into	into	IN
10_1101-2021_01_07_425723	13	40	ethanol	ethanol	NN
10_1101-2021_01_07_425723	13	41	by	by	IN
10_1101-2021_01_07_425723	13	42	the	the	DT
10_1101-2021_01_07_425723	13	43	33	33	CD
10_1101-2021_01_07_425723	13	44	yeast	yeast	NN
10_1101-2021_01_07_425723	13	45	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	13	46	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	13	47	is	be	VBZ
10_1101-2021_01_07_425723	13	48	the	the	DT
10_1101-2021_01_07_425723	13	49	single	single	JJ
10_1101-2021_01_07_425723	13	50	largest	large	JJS
10_1101-2021_01_07_425723	13	51	process	process	NN
10_1101-2021_01_07_425723	13	52	in	in	IN
10_1101-2021_01_07_425723	13	53	industrial	industrial	JJ
10_1101-2021_01_07_425723	13	54	biotechnology	biotechnology	NN
10_1101-2021_01_07_425723	13	55	.	.	.
10_1101-2021_01_07_425723	14	1	For	for	IN
10_1101-2021_01_07_425723	14	2	34	34	CD
10_1101-2021_01_07_425723	14	3	fermentation	fermentation	NN
10_1101-2021_01_07_425723	14	4	products	product	NNS
10_1101-2021_01_07_425723	14	5	such	such	JJ
10_1101-2021_01_07_425723	14	6	as	as	IN
10_1101-2021_01_07_425723	14	7	ethanol	ethanol	NN
10_1101-2021_01_07_425723	14	8	,	,	,
10_1101-2021_01_07_425723	14	9	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	14	10	process	process	NN
10_1101-2021_01_07_425723	14	11	conditions	condition	NNS
10_1101-2021_01_07_425723	14	12	are	be	VBP
10_1101-2021_01_07_425723	14	13	required	require	VBN
10_1101-2021_01_07_425723	14	14	to	to	TO
10_1101-2021_01_07_425723	14	15	maximize	maximize	VB
10_1101-2021_01_07_425723	14	16	product	product	NN
10_1101-2021_01_07_425723	14	17	35	35	CD
10_1101-2021_01_07_425723	14	18	yields	yield	NNS
10_1101-2021_01_07_425723	14	19	and	and	CC
10_1101-2021_01_07_425723	14	20	to	to	TO
10_1101-2021_01_07_425723	14	21	minimize	minimize	VB
10_1101-2021_01_07_425723	14	22	both	both	DT
10_1101-2021_01_07_425723	14	23	cooling	cool	VBG
10_1101-2021_01_07_425723	14	24	costs	cost	NNS
10_1101-2021_01_07_425723	14	25	and	and	CC
10_1101-2021_01_07_425723	14	26	complexity	complexity	NN
10_1101-2021_01_07_425723	14	27	of	of	IN
10_1101-2021_01_07_425723	14	28	bioreactors3	bioreactors3	NN
10_1101-2021_01_07_425723	14	29	.	.	.
10_1101-2021_01_07_425723	15	1	While	while	IN
10_1101-2021_01_07_425723	15	2	S.	S.	NNP
10_1101-2021_01_07_425723	15	3	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	15	4	is	be	VBZ
10_1101-2021_01_07_425723	15	5	applied	apply	VBN
10_1101-2021_01_07_425723	15	6	in	in	IN
10_1101-2021_01_07_425723	15	7	36	36	CD
10_1101-2021_01_07_425723	15	8	many	many	JJ
10_1101-2021_01_07_425723	15	9	large	large	JJ
10_1101-2021_01_07_425723	15	10	-	-	HYPH
10_1101-2021_01_07_425723	15	11	scale	scale	NN
10_1101-2021_01_07_425723	15	12	processes	process	NNS
10_1101-2021_01_07_425723	15	13	and	and	CC
10_1101-2021_01_07_425723	15	14	is	be	VBZ
10_1101-2021_01_07_425723	15	15	readily	readily	RB
10_1101-2021_01_07_425723	15	16	accessible	accessible	JJ
10_1101-2021_01_07_425723	15	17	to	to	IN
10_1101-2021_01_07_425723	15	18	modern	modern	JJ
10_1101-2021_01_07_425723	15	19	genome	genome	NN
10_1101-2021_01_07_425723	15	20	-	-	HYPH
10_1101-2021_01_07_425723	15	21	editing	editing	NN
10_1101-2021_01_07_425723	15	22	techniques4,5	techniques4,5	NN
10_1101-2021_01_07_425723	15	23	,	,	,
10_1101-2021_01_07_425723	15	24	several	several	JJ
10_1101-2021_01_07_425723	15	25	37	37	CD
10_1101-2021_01_07_425723	15	26	non	non	NNS
10_1101-2021_01_07_425723	15	27	-	-	NNS
10_1101-2021_01_07_425723	15	28	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	15	29	yeasts	yeast	NNS
10_1101-2021_01_07_425723	15	30	have	have	VBP
10_1101-2021_01_07_425723	15	31	traits	trait	NNS
10_1101-2021_01_07_425723	15	32	that	that	WDT
10_1101-2021_01_07_425723	15	33	are	be	VBP
10_1101-2021_01_07_425723	15	34	attractive	attractive	JJ
10_1101-2021_01_07_425723	15	35	for	for	IN
10_1101-2021_01_07_425723	15	36	industrial	industrial	JJ
10_1101-2021_01_07_425723	15	37	application	application	NN
10_1101-2021_01_07_425723	15	38	.	.	.
10_1101-2021_01_07_425723	16	1	In	in	IN
10_1101-2021_01_07_425723	16	2	particular	particular	JJ
10_1101-2021_01_07_425723	16	3	,	,	,
10_1101-2021_01_07_425723	16	4	the	the	DT
10_1101-2021_01_07_425723	16	5	high	high	JJ
10_1101-2021_01_07_425723	16	6	38	38	CD
10_1101-2021_01_07_425723	16	7	maximum	maximum	JJ
10_1101-2021_01_07_425723	16	8	growth	growth	NN
10_1101-2021_01_07_425723	16	9	temperature	temperature	NN
10_1101-2021_01_07_425723	16	10	of	of	IN
10_1101-2021_01_07_425723	16	11	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	16	12	yeasts	yeast	NNS
10_1101-2021_01_07_425723	16	13	,	,	,
10_1101-2021_01_07_425723	16	14	such	such	JJ
10_1101-2021_01_07_425723	16	15	as	as	IN
10_1101-2021_01_07_425723	16	16	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	16	17	marxianus	marxianus	NN
10_1101-2021_01_07_425723	16	18	(	(	-LRB-
10_1101-2021_01_07_425723	16	19	up	up	IN
10_1101-2021_01_07_425723	16	20	to	to	TO
10_1101-2021_01_07_425723	16	21	50	50	CD
10_1101-2021_01_07_425723	16	22	°	°	,
10_1101-2021_01_07_425723	16	23	C	C	NNP
10_1101-2021_01_07_425723	16	24	39	39	CD
10_1101-2021_01_07_425723	16	25	as	as	IN
10_1101-2021_01_07_425723	16	26	opposed	oppose	VBN
10_1101-2021_01_07_425723	16	27	to	to	IN
10_1101-2021_01_07_425723	16	28	39	39	CD
10_1101-2021_01_07_425723	16	29	°	°	,
10_1101-2021_01_07_425723	16	30	C	C	NNP
10_1101-2021_01_07_425723	16	31	for	for	IN
10_1101-2021_01_07_425723	16	32	S.	S.	NNP
10_1101-2021_01_07_425723	16	33	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	16	34	)	)	-RRB-
10_1101-2021_01_07_425723	16	35	,	,	,
10_1101-2021_01_07_425723	16	36	could	could	MD
10_1101-2021_01_07_425723	16	37	enable	enable	VB
10_1101-2021_01_07_425723	16	38	lower	low	JJR
10_1101-2021_01_07_425723	16	39	cooling	cooling	NN
10_1101-2021_01_07_425723	16	40	costs6–8	costs6–8	JJ
10_1101-2021_01_07_425723	16	41	.	.	.
10_1101-2021_01_07_425723	17	1	Moreover	moreover	RB
10_1101-2021_01_07_425723	17	2	,	,	,
10_1101-2021_01_07_425723	17	3	it	-PRON-	PRP
10_1101-2021_01_07_425723	17	4	could	could	MD
10_1101-2021_01_07_425723	17	5	reduce	reduce	VB
10_1101-2021_01_07_425723	17	6	the	the	DT
10_1101-2021_01_07_425723	17	7	40	40	CD
10_1101-2021_01_07_425723	17	8	required	require	VBN
10_1101-2021_01_07_425723	17	9	dosage	dosage	NN
10_1101-2021_01_07_425723	17	10	of	of	IN
10_1101-2021_01_07_425723	17	11	fungal	fungal	JJ
10_1101-2021_01_07_425723	17	12	polysaccharide	polysaccharide	NN
10_1101-2021_01_07_425723	17	13	hydrolases	hydrolase	NNS
10_1101-2021_01_07_425723	17	14	during	during	IN
10_1101-2021_01_07_425723	17	15	simultaneous	simultaneous	JJ
10_1101-2021_01_07_425723	17	16	saccharification	saccharification	NN
10_1101-2021_01_07_425723	17	17	and	and	CC
10_1101-2021_01_07_425723	17	18	41	41	CD
10_1101-2021_01_07_425723	17	19	fermentation	fermentation	NN
10_1101-2021_01_07_425723	17	20	(	(	-LRB-
10_1101-2021_01_07_425723	17	21	SSF	ssf	NN
10_1101-2021_01_07_425723	17	22	)	)	-RRB-
10_1101-2021_01_07_425723	17	23	processes9,10	processes9,10	UH
10_1101-2021_01_07_425723	17	24	.	.	.
10_1101-2021_01_07_425723	18	1	However	however	RB
10_1101-2021_01_07_425723	18	2	,	,	,
10_1101-2021_01_07_425723	18	3	as	as	IN
10_1101-2021_01_07_425723	18	4	yet	yet	RB
10_1101-2021_01_07_425723	18	5	unidentified	unidentified	JJ
10_1101-2021_01_07_425723	18	6	oxygen	oxygen	NN
10_1101-2021_01_07_425723	18	7	requirements	requirement	NNS
10_1101-2021_01_07_425723	18	8	hamper	hamper	VBP
10_1101-2021_01_07_425723	18	9	42	42	CD
10_1101-2021_01_07_425723	18	10	implementation	implementation	NN
10_1101-2021_01_07_425723	18	11	of	of	IN
10_1101-2021_01_07_425723	18	12	K.	K.	NNP
10_1101-2021_01_07_425723	18	13	marxianus	marxianus	NN
10_1101-2021_01_07_425723	18	14	in	in	IN
10_1101-2021_01_07_425723	18	15	large	large	JJ
10_1101-2021_01_07_425723	18	16	-	-	HYPH
10_1101-2021_01_07_425723	18	17	scale	scale	NN
10_1101-2021_01_07_425723	18	18	anaerobic	anaerobic	NN
10_1101-2021_01_07_425723	18	19	processes11–13	processes11–13	NNP
10_1101-2021_01_07_425723	18	20	.	.	.
10_1101-2021_01_07_425723	19	1	43	43	CD
10_1101-2021_01_07_425723	19	2	In	in	IN
10_1101-2021_01_07_425723	19	3	S.	S.	NNP
10_1101-2021_01_07_425723	19	4	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	19	5	,	,	,
10_1101-2021_01_07_425723	19	6	fast	fast	JJ
10_1101-2021_01_07_425723	19	7	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	19	8	growth	growth	NN
10_1101-2021_01_07_425723	19	9	on	on	IN
10_1101-2021_01_07_425723	19	10	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	19	11	media	media	NN
10_1101-2021_01_07_425723	19	12	requires	require	VBZ
10_1101-2021_01_07_425723	19	13	supplementation	supplementation	NN
10_1101-2021_01_07_425723	19	14	with	with	IN
10_1101-2021_01_07_425723	19	15	a	a	DT
10_1101-2021_01_07_425723	19	16	source	source	NN
10_1101-2021_01_07_425723	19	17	of	of	IN
10_1101-2021_01_07_425723	19	18	44	44	CD
10_1101-2021_01_07_425723	19	19	unsaturated	unsaturated	JJ
10_1101-2021_01_07_425723	19	20	fatty	fatty	NN
10_1101-2021_01_07_425723	19	21	acids	acid	NNS
10_1101-2021_01_07_425723	19	22	(	(	-LRB-
10_1101-2021_01_07_425723	19	23	UFA	UFA	NNP
10_1101-2021_01_07_425723	19	24	)	)	-RRB-
10_1101-2021_01_07_425723	19	25	,	,	,
10_1101-2021_01_07_425723	19	26	sterols	sterol	NNS
10_1101-2021_01_07_425723	19	27	,	,	,
10_1101-2021_01_07_425723	19	28	as	as	RB
10_1101-2021_01_07_425723	19	29	well	well	RB
10_1101-2021_01_07_425723	19	30	as	as	IN
10_1101-2021_01_07_425723	19	31	several	several	JJ
10_1101-2021_01_07_425723	19	32	vitamins14–17	vitamins14–17	NN
10_1101-2021_01_07_425723	19	33	.	.	.
10_1101-2021_01_07_425723	20	1	These	these	DT
10_1101-2021_01_07_425723	20	2	nutritional	nutritional	JJ
10_1101-2021_01_07_425723	20	3	requirements	requirement	NNS
10_1101-2021_01_07_425723	20	4	45	45	CD
10_1101-2021_01_07_425723	20	5	reflect	reflect	VBP
10_1101-2021_01_07_425723	20	6	well	well	RB
10_1101-2021_01_07_425723	20	7	-	-	HYPH
10_1101-2021_01_07_425723	20	8	characterized	characterize	VBN
10_1101-2021_01_07_425723	20	9	,	,	,
10_1101-2021_01_07_425723	20	10	oxygen	oxygen	NN
10_1101-2021_01_07_425723	20	11	-	-	HYPH
10_1101-2021_01_07_425723	20	12	dependent	dependent	JJ
10_1101-2021_01_07_425723	20	13	biosynthetic	biosynthetic	JJ
10_1101-2021_01_07_425723	20	14	reactions	reaction	NNS
10_1101-2021_01_07_425723	20	15	.	.	.
10_1101-2021_01_07_425723	21	1	UFA	UFA	NNP
10_1101-2021_01_07_425723	21	2	synthesis	synthesis	NN
10_1101-2021_01_07_425723	21	3	involves	involve	VBZ
10_1101-2021_01_07_425723	21	4	the	the	DT
10_1101-2021_01_07_425723	21	5	oxygen-46	oxygen-46	NNP
10_1101-2021_01_07_425723	21	6	dependent	dependent	NNP
10_1101-2021_01_07_425723	21	7	acyl	acyl	NNP
10_1101-2021_01_07_425723	21	8	-	-	HYPH
10_1101-2021_01_07_425723	21	9	CoA	CoA	NNP
10_1101-2021_01_07_425723	21	10	desaturase	desaturase	NNP
10_1101-2021_01_07_425723	21	11	Ole1	Ole1	NNP
10_1101-2021_01_07_425723	21	12	,	,	,
10_1101-2021_01_07_425723	21	13	NAD+	NAD+	NNP
10_1101-2021_01_07_425723	21	14	synthesis	synthesis	NN
10_1101-2021_01_07_425723	21	15	depends	depend	VBZ
10_1101-2021_01_07_425723	21	16	on	on	IN
10_1101-2021_01_07_425723	21	17	the	the	DT
10_1101-2021_01_07_425723	21	18	oxygenases	oxygenase	NNS
10_1101-2021_01_07_425723	21	19	Bna2	Bna2	NNP
10_1101-2021_01_07_425723	21	20	,	,	,
10_1101-2021_01_07_425723	21	21	Bna4	bna4	UH
10_1101-2021_01_07_425723	21	22	,	,	,
10_1101-2021_01_07_425723	21	23	and	and	CC
10_1101-2021_01_07_425723	21	24	Bna1	Bna1	NNP
10_1101-2021_01_07_425723	21	25	,	,	,
10_1101-2021_01_07_425723	21	26	47	47	CD
10_1101-2021_01_07_425723	21	27	while	while	IN
10_1101-2021_01_07_425723	21	28	synthesis	synthesis	NN
10_1101-2021_01_07_425723	21	29	of	of	IN
10_1101-2021_01_07_425723	21	30	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	21	31	,	,	,
10_1101-2021_01_07_425723	21	32	the	the	DT
10_1101-2021_01_07_425723	21	33	main	main	JJ
10_1101-2021_01_07_425723	21	34	yeast	yeast	NN
10_1101-2021_01_07_425723	21	35	sterol	sterol	NN
10_1101-2021_01_07_425723	21	36	,	,	,
10_1101-2021_01_07_425723	21	37	even	even	RB
10_1101-2021_01_07_425723	21	38	requires	require	VBZ
10_1101-2021_01_07_425723	21	39	12	12	CD
10_1101-2021_01_07_425723	21	40	moles	mole	NNS
10_1101-2021_01_07_425723	21	41	of	of	IN
10_1101-2021_01_07_425723	21	42	oxygen	oxygen	NN
10_1101-2021_01_07_425723	21	43	per	per	IN
10_1101-2021_01_07_425723	21	44	mole	mole	NN
10_1101-2021_01_07_425723	21	45	.	.	.
10_1101-2021_01_07_425723	22	1	48	48	CD
10_1101-2021_01_07_425723	22	2	Oxygen	oxygen	NN
10_1101-2021_01_07_425723	22	3	-	-	HYPH
10_1101-2021_01_07_425723	22	4	dependent	dependent	JJ
10_1101-2021_01_07_425723	22	5	reactions	reaction	NNS
10_1101-2021_01_07_425723	22	6	in	in	IN
10_1101-2021_01_07_425723	22	7	NAD+	NAD+	NNP
10_1101-2021_01_07_425723	22	8	synthesis	synthesis	NN
10_1101-2021_01_07_425723	22	9	can	can	MD
10_1101-2021_01_07_425723	22	10	be	be	VB
10_1101-2021_01_07_425723	22	11	bypassed	bypass	VBN
10_1101-2021_01_07_425723	22	12	by	by	IN
10_1101-2021_01_07_425723	22	13	nutritional	nutritional	JJ
10_1101-2021_01_07_425723	22	14	supplementation	supplementation	NN
10_1101-2021_01_07_425723	22	15	of	of	IN
10_1101-2021_01_07_425723	22	16	49	49	CD
10_1101-2021_01_07_425723	22	17	nicotinic	nicotinic	JJ
10_1101-2021_01_07_425723	22	18	acid	acid	NN
10_1101-2021_01_07_425723	22	19	,	,	,
10_1101-2021_01_07_425723	22	20	which	which	WDT
10_1101-2021_01_07_425723	22	21	is	be	VBZ
10_1101-2021_01_07_425723	22	22	a	a	DT
10_1101-2021_01_07_425723	22	23	standard	standard	JJ
10_1101-2021_01_07_425723	22	24	ingredient	ingredient	NN
10_1101-2021_01_07_425723	22	25	of	of	IN
10_1101-2021_01_07_425723	22	26	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	22	27	media	medium	NNS
10_1101-2021_01_07_425723	22	28	for	for	IN
10_1101-2021_01_07_425723	22	29	cultivation	cultivation	NN
10_1101-2021_01_07_425723	22	30	of	of	IN
10_1101-2021_01_07_425723	22	31	S.	S.	NNP
10_1101-2021_01_07_425723	22	32	cerevisiae17,18	cerevisiae17,18	NNP
10_1101-2021_01_07_425723	22	33	.	.	.
10_1101-2021_01_07_425723	23	1	50	50	CD
10_1101-2021_01_07_425723	23	2	Ergosterol	Ergosterol	NNS
10_1101-2021_01_07_425723	23	3	and	and	CC
10_1101-2021_01_07_425723	23	4	the	the	DT
10_1101-2021_01_07_425723	23	5	UFA	UFA	NNP
10_1101-2021_01_07_425723	23	6	source	source	NN
10_1101-2021_01_07_425723	23	7	Tween	Tween	NNP
10_1101-2021_01_07_425723	23	8	80	80	CD
10_1101-2021_01_07_425723	23	9	(	(	-LRB-
10_1101-2021_01_07_425723	23	10	polyethoxylated	polyethoxylate	VBN
10_1101-2021_01_07_425723	23	11	sorbitan	sorbitan	NNP
10_1101-2021_01_07_425723	23	12	oleate	oleate	NN
10_1101-2021_01_07_425723	23	13	)	)	-RRB-
10_1101-2021_01_07_425723	23	14	are	be	VBP
10_1101-2021_01_07_425723	23	15	routinely	routinely	RB
10_1101-2021_01_07_425723	23	16	included	include	VBN
10_1101-2021_01_07_425723	23	17	in	in	IN
10_1101-2021_01_07_425723	23	18	51	51	CD
10_1101-2021_01_07_425723	23	19	media	medium	NNS
10_1101-2021_01_07_425723	23	20	for	for	IN
10_1101-2021_01_07_425723	23	21	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	23	22	cultivation	cultivation	NN
10_1101-2021_01_07_425723	23	23	as	as	IN
10_1101-2021_01_07_425723	23	24	‘	'	``
10_1101-2021_01_07_425723	23	25	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	23	26	growth	growth	NN
10_1101-2021_01_07_425723	23	27	factors	factor	NNS
10_1101-2021_01_07_425723	23	28	’	'	''
10_1101-2021_01_07_425723	23	29	(	(	-LRB-
10_1101-2021_01_07_425723	23	30	AGF)15,17,19	agf)15,17,19	UH
10_1101-2021_01_07_425723	23	31	.	.	.
10_1101-2021_01_07_425723	24	1	Under	under	IN
10_1101-2021_01_07_425723	24	2	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	24	3	conditions	condition	NNS
10_1101-2021_01_07_425723	24	4	,	,	,
10_1101-2021_01_07_425723	24	5	S.	S.	NNP
10_1101-2021_01_07_425723	24	6	52	52	CD
10_1101-2021_01_07_425723	24	7	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	24	8	imports	import	NNS
10_1101-2021_01_07_425723	24	9	exogenous	exogenous	JJ
10_1101-2021_01_07_425723	24	10	sterols	sterol	NNS
10_1101-2021_01_07_425723	24	11	via	via	IN
10_1101-2021_01_07_425723	24	12	the	the	DT
10_1101-2021_01_07_425723	24	13	ABC	ABC	NNP
10_1101-2021_01_07_425723	24	14	transporters	transporter	NNS
10_1101-2021_01_07_425723	24	15	Aus1	Aus1	NNP
10_1101-2021_01_07_425723	24	16	and	and	CC
10_1101-2021_01_07_425723	24	17	Pdr1120	Pdr1120	NNP
10_1101-2021_01_07_425723	24	18	.	.	.
10_1101-2021_01_07_425723	25	1	Mechanisms	mechanism	NNS
10_1101-2021_01_07_425723	25	2	for	for	IN
10_1101-2021_01_07_425723	25	3	uptake	uptake	JJ
10_1101-2021_01_07_425723	25	4	53	53	CD
10_1101-2021_01_07_425723	25	5	and	and	CC
10_1101-2021_01_07_425723	25	6	hydrolysis	hydrolysis	NN
10_1101-2021_01_07_425723	25	7	of	of	IN
10_1101-2021_01_07_425723	25	8	Tween	Tween	NNP
10_1101-2021_01_07_425723	25	9	80	80	CD
10_1101-2021_01_07_425723	25	10	by	by	IN
10_1101-2021_01_07_425723	25	11	S.	S.	NNP
10_1101-2021_01_07_425723	25	12	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	25	13	are	be	VBP
10_1101-2021_01_07_425723	25	14	unknown	unknown	JJ
10_1101-2021_01_07_425723	25	15	but	but	CC
10_1101-2021_01_07_425723	25	16	,	,	,
10_1101-2021_01_07_425723	25	17	after	after	IN
10_1101-2021_01_07_425723	25	18	its	-PRON-	PRP$
10_1101-2021_01_07_425723	25	19	release	release	NN
10_1101-2021_01_07_425723	25	20	,	,	,
10_1101-2021_01_07_425723	25	21	oleate	oleate	NN
10_1101-2021_01_07_425723	25	22	is	be	VBZ
10_1101-2021_01_07_425723	25	23	activated	activate	VBN
10_1101-2021_01_07_425723	25	24	by	by	IN
10_1101-2021_01_07_425723	25	25	the	the	DT
10_1101-2021_01_07_425723	25	26	54	54	CD
10_1101-2021_01_07_425723	25	27	acyl	acyl	NNP
10_1101-2021_01_07_425723	25	28	-	-	HYPH
10_1101-2021_01_07_425723	25	29	CoA	CoA	NNP
10_1101-2021_01_07_425723	25	30	synthetases	synthetase	VBZ
10_1101-2021_01_07_425723	25	31	Faa1	Faa1	NNP
10_1101-2021_01_07_425723	25	32	and	and	CC
10_1101-2021_01_07_425723	25	33	Faa421,22	Faa421,22	NNP
10_1101-2021_01_07_425723	25	34	.	.	.
10_1101-2021_01_07_425723	26	1	55	55	CD
10_1101-2021_01_07_425723	26	2	.CC	.CC	:
10_1101-2021_01_07_425723	26	3	-	-	HYPH
10_1101-2021_01_07_425723	26	4	BY	by	IN
10_1101-2021_01_07_425723	26	5	-	-	HYPH
10_1101-2021_01_07_425723	26	6	NC	NC	NNP
10_1101-2021_01_07_425723	26	7	-	-	HYPH
10_1101-2021_01_07_425723	26	8	ND	ND	NNP
10_1101-2021_01_07_425723	26	9	4.0	4.0	CD
10_1101-2021_01_07_425723	26	10	International	International	NNP
10_1101-2021_01_07_425723	26	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	26	12	under	under	IN
10_1101-2021_01_07_425723	26	13	a	a	DT
10_1101-2021_01_07_425723	26	14	(	(	-LRB-
10_1101-2021_01_07_425723	26	15	which	which	WDT
10_1101-2021_01_07_425723	26	16	was	be	VBD
10_1101-2021_01_07_425723	26	17	not	not	RB
10_1101-2021_01_07_425723	26	18	certified	certify	VBN
10_1101-2021_01_07_425723	26	19	by	by	IN
10_1101-2021_01_07_425723	26	20	peer	peer	NN
10_1101-2021_01_07_425723	26	21	review	review	NN
10_1101-2021_01_07_425723	26	22	)	)	-RRB-
10_1101-2021_01_07_425723	26	23	is	be	VBZ
10_1101-2021_01_07_425723	26	24	the	the	DT
10_1101-2021_01_07_425723	26	25	author	author	NN
10_1101-2021_01_07_425723	26	26	/	/	SYM
10_1101-2021_01_07_425723	26	27	funder	funder	NN
10_1101-2021_01_07_425723	26	28	,	,	,
10_1101-2021_01_07_425723	26	29	who	who	WP
10_1101-2021_01_07_425723	26	30	has	have	VBZ
10_1101-2021_01_07_425723	26	31	granted	grant	VBN
10_1101-2021_01_07_425723	26	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	26	33	a	a	DT
10_1101-2021_01_07_425723	26	34	license	license	NN
10_1101-2021_01_07_425723	26	35	to	to	TO
10_1101-2021_01_07_425723	26	36	display	display	VB
10_1101-2021_01_07_425723	26	37	the	the	DT
10_1101-2021_01_07_425723	26	38	preprint	preprint	NN
10_1101-2021_01_07_425723	26	39	in	in	IN
10_1101-2021_01_07_425723	26	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	26	41	.	.	.
10_1101-2021_01_07_425723	27	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	27	2	is	be	VBZ
10_1101-2021_01_07_425723	27	3	made	make	VBN
10_1101-2021_01_07_425723	27	4	The	the	DT
10_1101-2021_01_07_425723	27	5	copyright	copyright	NN
10_1101-2021_01_07_425723	27	6	holder	holder	NN
10_1101-2021_01_07_425723	27	7	for	for	IN
10_1101-2021_01_07_425723	27	8	this	this	DT
10_1101-2021_01_07_425723	27	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	27	10	version	version	NN
10_1101-2021_01_07_425723	27	11	posted	post	VBD
10_1101-2021_01_07_425723	27	12	January	January	NNP
10_1101-2021_01_07_425723	27	13	8	8	CD
10_1101-2021_01_07_425723	27	14	,	,	,
10_1101-2021_01_07_425723	27	15	2021	2021	CD
10_1101-2021_01_07_425723	27	16	.	.	.
10_1101-2021_01_07_425723	27	17	;	;	:
10_1101-2021_01_07_425723	27	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	27	19	:	:	:
10_1101-2021_01_07_425723	27	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	27	21	preprint	preprint	NN
10_1101-2021_01_07_425723	27	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	27	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	27	24	4	4	CD
10_1101-2021_01_07_425723	27	25	Outside	outside	IN
10_1101-2021_01_07_425723	27	26	the	the	DT
10_1101-2021_01_07_425723	27	27	whole	whole	RB
10_1101-2021_01_07_425723	27	28	-	-	HYPH
10_1101-2021_01_07_425723	27	29	genome	genome	NN
10_1101-2021_01_07_425723	27	30	duplicated	duplicate	VBN
10_1101-2021_01_07_425723	27	31	(	(	-LRB-
10_1101-2021_01_07_425723	27	32	WGD	WGD	NNP
10_1101-2021_01_07_425723	27	33	)	)	-RRB-
10_1101-2021_01_07_425723	27	34	clade	clade	NN
10_1101-2021_01_07_425723	27	35	of	of	IN
10_1101-2021_01_07_425723	27	36	Saccharomycotina	Saccharomycotina	NNP
10_1101-2021_01_07_425723	27	37	yeasts	yeast	NNS
10_1101-2021_01_07_425723	27	38	,	,	,
10_1101-2021_01_07_425723	27	39	only	only	RB
10_1101-2021_01_07_425723	27	40	few	few	JJ
10_1101-2021_01_07_425723	27	41	yeasts	yeast	NNS
10_1101-2021_01_07_425723	27	42	56	56	CD
10_1101-2021_01_07_425723	27	43	(	(	-LRB-
10_1101-2021_01_07_425723	27	44	including	include	VBG
10_1101-2021_01_07_425723	27	45	Candida	Candida	NNP
10_1101-2021_01_07_425723	27	46	albicans	albicans	NNPS
10_1101-2021_01_07_425723	27	47	and	and	CC
10_1101-2021_01_07_425723	27	48	Brettanomyces	Brettanomyces	NNPS
10_1101-2021_01_07_425723	27	49	bruxellensis	bruxellensis	NN
10_1101-2021_01_07_425723	27	50	)	)	-RRB-
10_1101-2021_01_07_425723	27	51	are	be	VBP
10_1101-2021_01_07_425723	27	52	capable	capable	JJ
10_1101-2021_01_07_425723	27	53	of	of	IN
10_1101-2021_01_07_425723	27	54	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	27	55	growth	growth	NN
10_1101-2021_01_07_425723	27	56	in	in	IN
10_1101-2021_01_07_425723	27	57	57	57	CD
10_1101-2021_01_07_425723	27	58	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	27	59	media	medium	NNS
10_1101-2021_01_07_425723	27	60	supplemented	supplement	VBN
10_1101-2021_01_07_425723	27	61	with	with	IN
10_1101-2021_01_07_425723	27	62	vitamins	vitamin	NNS
10_1101-2021_01_07_425723	27	63	,	,	,
10_1101-2021_01_07_425723	27	64	ergosterol	ergosterol	UH
10_1101-2021_01_07_425723	27	65	and	and	CC
10_1101-2021_01_07_425723	27	66	Tween	Tween	NNP
10_1101-2021_01_07_425723	27	67	8012,13,23,24	8012,13,23,24	CD
10_1101-2021_01_07_425723	27	68	.	.	.
10_1101-2021_01_07_425723	28	1	However	however	RB
10_1101-2021_01_07_425723	28	2	,	,	,
10_1101-2021_01_07_425723	28	3	most	most	RBS
10_1101-2021_01_07_425723	28	4	currently	currently	RB
10_1101-2021_01_07_425723	28	5	58	58	CD
10_1101-2021_01_07_425723	28	6	known	know	VBN
10_1101-2021_01_07_425723	28	7	yeast	yeast	NN
10_1101-2021_01_07_425723	28	8	species	specie	NNS
10_1101-2021_01_07_425723	28	9	readily	readily	RB
10_1101-2021_01_07_425723	28	10	ferment	ferment	NN
10_1101-2021_01_07_425723	28	11	glucose	glucose	NN
10_1101-2021_01_07_425723	28	12	to	to	IN
10_1101-2021_01_07_425723	28	13	ethanol	ethanol	NN
10_1101-2021_01_07_425723	28	14	and	and	CC
10_1101-2021_01_07_425723	28	15	carbon	carbon	NN
10_1101-2021_01_07_425723	28	16	dioxide	dioxide	NN
10_1101-2021_01_07_425723	28	17	when	when	WRB
10_1101-2021_01_07_425723	28	18	exposed	expose	VBN
10_1101-2021_01_07_425723	28	19	to	to	IN
10_1101-2021_01_07_425723	28	20	oxygen-59	oxygen-59	JJ
10_1101-2021_01_07_425723	28	21	limited	limited	JJ
10_1101-2021_01_07_425723	28	22	growth	growth	NN
10_1101-2021_01_07_425723	28	23	conditions13,25,26	conditions13,25,26	NN
10_1101-2021_01_07_425723	28	24	,	,	,
10_1101-2021_01_07_425723	28	25	indicating	indicate	VBG
10_1101-2021_01_07_425723	28	26	that	that	IN
10_1101-2021_01_07_425723	28	27	they	-PRON-	PRP
10_1101-2021_01_07_425723	28	28	do	do	VBP
10_1101-2021_01_07_425723	28	29	not	not	RB
10_1101-2021_01_07_425723	28	30	depend	depend	VB
10_1101-2021_01_07_425723	28	31	on	on	IN
10_1101-2021_01_07_425723	28	32	respiration	respiration	NN
10_1101-2021_01_07_425723	28	33	for	for	IN
10_1101-2021_01_07_425723	28	34	energy	energy	NN
10_1101-2021_01_07_425723	28	35	60	60	CD
10_1101-2021_01_07_425723	28	36	conservation	conservation	NN
10_1101-2021_01_07_425723	28	37	.	.	.
10_1101-2021_01_07_425723	29	1	The	the	DT
10_1101-2021_01_07_425723	29	2	inability	inability	NN
10_1101-2021_01_07_425723	29	3	of	of	IN
10_1101-2021_01_07_425723	29	4	the	the	DT
10_1101-2021_01_07_425723	29	5	large	large	JJ
10_1101-2021_01_07_425723	29	6	majority	majority	NN
10_1101-2021_01_07_425723	29	7	of	of	IN
10_1101-2021_01_07_425723	29	8	facultatively	facultatively	RB
10_1101-2021_01_07_425723	29	9	fermentative	fermentative	JJ
10_1101-2021_01_07_425723	29	10	yeast	yeast	NN
10_1101-2021_01_07_425723	29	11	species	specie	NNS
10_1101-2021_01_07_425723	29	12	to	to	TO
10_1101-2021_01_07_425723	29	13	grow	grow	VB
10_1101-2021_01_07_425723	29	14	61	61	CD
10_1101-2021_01_07_425723	29	15	under	under	IN
10_1101-2021_01_07_425723	29	16	strictly	strictly	RB
10_1101-2021_01_07_425723	29	17	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	29	18	conditions	condition	NNS
10_1101-2021_01_07_425723	29	19	is	be	VBZ
10_1101-2021_01_07_425723	29	20	therefore	therefore	RB
10_1101-2021_01_07_425723	29	21	commonly	commonly	RB
10_1101-2021_01_07_425723	29	22	attributed	attribute	VBN
10_1101-2021_01_07_425723	29	23	to	to	IN
10_1101-2021_01_07_425723	29	24	incompletely	incompletely	RB
10_1101-2021_01_07_425723	29	25	understood	understand	VBN
10_1101-2021_01_07_425723	29	26	62	62	CD
10_1101-2021_01_07_425723	29	27	oxygen	oxygen	NN
10_1101-2021_01_07_425723	29	28	requirements	requirement	NNS
10_1101-2021_01_07_425723	29	29	for	for	IN
10_1101-2021_01_07_425723	29	30	biosynthetic	biosynthetic	JJ
10_1101-2021_01_07_425723	29	31	processes11	processes11	NN
10_1101-2021_01_07_425723	29	32	.	.	.
10_1101-2021_01_07_425723	30	1	Several	several	JJ
10_1101-2021_01_07_425723	30	2	oxygen	oxygen	NN
10_1101-2021_01_07_425723	30	3	-	-	HYPH
10_1101-2021_01_07_425723	30	4	requiring	require	VBG
10_1101-2021_01_07_425723	30	5	processes	process	NNS
10_1101-2021_01_07_425723	30	6	have	have	VBP
10_1101-2021_01_07_425723	30	7	been	be	VBN
10_1101-2021_01_07_425723	30	8	63	63	CD
10_1101-2021_01_07_425723	30	9	proposed	propose	VBN
10_1101-2021_01_07_425723	30	10	including	include	VBG
10_1101-2021_01_07_425723	30	11	involvement	involvement	NN
10_1101-2021_01_07_425723	30	12	of	of	IN
10_1101-2021_01_07_425723	30	13	a	a	DT
10_1101-2021_01_07_425723	30	14	respiration	respiration	NN
10_1101-2021_01_07_425723	30	15	-	-	HYPH
10_1101-2021_01_07_425723	30	16	coupled	couple	VBN
10_1101-2021_01_07_425723	30	17	dihydroorotate	dihydroorotate	JJ
10_1101-2021_01_07_425723	30	18	dehydrogenase	dehydrogenase	NN
10_1101-2021_01_07_425723	30	19	in	in	IN
10_1101-2021_01_07_425723	30	20	pyrimidine	pyrimidine	JJ
10_1101-2021_01_07_425723	30	21	64	64	CD
10_1101-2021_01_07_425723	30	22	biosynthesis	biosynthesis	NN
10_1101-2021_01_07_425723	30	23	,	,	,
10_1101-2021_01_07_425723	30	24	limitations	limitation	NNS
10_1101-2021_01_07_425723	30	25	in	in	IN
10_1101-2021_01_07_425723	30	26	uptake	uptake	JJ
10_1101-2021_01_07_425723	30	27	and/or	and/or	CC
10_1101-2021_01_07_425723	30	28	metabolism	metabolism	NN
10_1101-2021_01_07_425723	30	29	of	of	IN
10_1101-2021_01_07_425723	30	30	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	30	31	growth	growth	NN
10_1101-2021_01_07_425723	30	32	factors	factor	NNS
10_1101-2021_01_07_425723	30	33	,	,	,
10_1101-2021_01_07_425723	30	34	and	and	CC
10_1101-2021_01_07_425723	30	35	redox	redox	NN
10_1101-2021_01_07_425723	30	36	-	-	HYPH
10_1101-2021_01_07_425723	30	37	cofactor	cofactor	NN
10_1101-2021_01_07_425723	30	38	65	65	CD
10_1101-2021_01_07_425723	30	39	balancing	balancing	NN
10_1101-2021_01_07_425723	30	40	constraints11,13,27	constraints11,13,27	NN
10_1101-2021_01_07_425723	30	41	.	.	.
10_1101-2021_01_07_425723	31	1	66	66	CD
10_1101-2021_01_07_425723	31	2	Quantitation	quantitation	NN
10_1101-2021_01_07_425723	31	3	,	,	,
10_1101-2021_01_07_425723	31	4	identification	identification	NN
10_1101-2021_01_07_425723	31	5	and	and	CC
10_1101-2021_01_07_425723	31	6	elimination	elimination	NN
10_1101-2021_01_07_425723	31	7	of	of	IN
10_1101-2021_01_07_425723	31	8	oxygen	oxygen	NN
10_1101-2021_01_07_425723	31	9	requirements	requirement	NNS
10_1101-2021_01_07_425723	31	10	in	in	IN
10_1101-2021_01_07_425723	31	11	non	non	JJ
10_1101-2021_01_07_425723	31	12	-	-	JJ
10_1101-2021_01_07_425723	31	13	Saccharomyces	saccharomyces	JJ
10_1101-2021_01_07_425723	31	14	yeasts	yeast	NNS
10_1101-2021_01_07_425723	31	15	is	be	VBZ
10_1101-2021_01_07_425723	31	16	67	67	CD
10_1101-2021_01_07_425723	31	17	hampered	hamper	VBN
10_1101-2021_01_07_425723	31	18	by	by	IN
10_1101-2021_01_07_425723	31	19	the	the	DT
10_1101-2021_01_07_425723	31	20	very	very	RB
10_1101-2021_01_07_425723	31	21	small	small	JJ
10_1101-2021_01_07_425723	31	22	amounts	amount	NNS
10_1101-2021_01_07_425723	31	23	of	of	IN
10_1101-2021_01_07_425723	31	24	oxygen	oxygen	NN
10_1101-2021_01_07_425723	31	25	required	require	VBN
10_1101-2021_01_07_425723	31	26	for	for	IN
10_1101-2021_01_07_425723	31	27	non	non	JJ
10_1101-2021_01_07_425723	31	28	-	-	JJ
10_1101-2021_01_07_425723	31	29	dissimilatory	dissimilatory	JJ
10_1101-2021_01_07_425723	31	30	purposes	purpose	NNS
10_1101-2021_01_07_425723	31	31	.	.	.
10_1101-2021_01_07_425723	32	1	For	for	IN
10_1101-2021_01_07_425723	32	2	example	example	NN
10_1101-2021_01_07_425723	32	3	,	,	,
10_1101-2021_01_07_425723	32	4	68	68	CD
10_1101-2021_01_07_425723	32	5	preventing	prevent	VBG
10_1101-2021_01_07_425723	32	6	entry	entry	NN
10_1101-2021_01_07_425723	32	7	of	of	IN
10_1101-2021_01_07_425723	32	8	the	the	DT
10_1101-2021_01_07_425723	32	9	small	small	JJ
10_1101-2021_01_07_425723	32	10	amounts	amount	NNS
10_1101-2021_01_07_425723	32	11	of	of	IN
10_1101-2021_01_07_425723	32	12	oxygen	oxygen	NN
10_1101-2021_01_07_425723	32	13	required	require	VBN
10_1101-2021_01_07_425723	32	14	for	for	IN
10_1101-2021_01_07_425723	32	15	sterol	sterol	NN
10_1101-2021_01_07_425723	32	16	and	and	CC
10_1101-2021_01_07_425723	32	17	UFA	UFA	NNP
10_1101-2021_01_07_425723	32	18	synthesis	synthesis	NN
10_1101-2021_01_07_425723	32	19	in	in	IN
10_1101-2021_01_07_425723	32	20	laboratory-69	laboratory-69	NN
10_1101-2021_01_07_425723	32	21	scale	scale	NN
10_1101-2021_01_07_425723	32	22	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	32	23	cultures	culture	NNS
10_1101-2021_01_07_425723	32	24	of	of	IN
10_1101-2021_01_07_425723	32	25	S.	S.	NNP
10_1101-2021_01_07_425723	32	26	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	32	27	requires	require	VBZ
10_1101-2021_01_07_425723	32	28	extreme	extreme	JJ
10_1101-2021_01_07_425723	32	29	measures	measure	NNS
10_1101-2021_01_07_425723	32	30	,	,	,
10_1101-2021_01_07_425723	32	31	such	such	JJ
10_1101-2021_01_07_425723	32	32	as	as	IN
10_1101-2021_01_07_425723	32	33	sparging	sparge	VBG
10_1101-2021_01_07_425723	32	34	with	with	IN
10_1101-2021_01_07_425723	32	35	ultra	ultra	JJ
10_1101-2021_01_07_425723	32	36	-	-	JJ
10_1101-2021_01_07_425723	32	37	pure	pure	JJ
10_1101-2021_01_07_425723	32	38	70	70	CD
10_1101-2021_01_07_425723	32	39	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	32	40	gas	gas	NN
10_1101-2021_01_07_425723	32	41	and	and	CC
10_1101-2021_01_07_425723	32	42	use	use	NN
10_1101-2021_01_07_425723	32	43	of	of	IN
10_1101-2021_01_07_425723	32	44	tubing	tubing	NN
10_1101-2021_01_07_425723	32	45	and	and	CC
10_1101-2021_01_07_425723	32	46	seals	seal	NNS
10_1101-2021_01_07_425723	32	47	that	that	WDT
10_1101-2021_01_07_425723	32	48	are	be	VBP
10_1101-2021_01_07_425723	32	49	resistant	resistant	JJ
10_1101-2021_01_07_425723	32	50	to	to	TO
10_1101-2021_01_07_425723	32	51	oxygen	oxygen	VB
10_1101-2021_01_07_425723	32	52	diffusion25,28	diffusion25,28	JJ
10_1101-2021_01_07_425723	32	53	.	.	.
10_1101-2021_01_07_425723	33	1	This	this	DT
10_1101-2021_01_07_425723	33	2	technical	technical	JJ
10_1101-2021_01_07_425723	33	3	71	71	CD
10_1101-2021_01_07_425723	33	4	challenge	challenge	NN
10_1101-2021_01_07_425723	33	5	contributes	contribute	NNS
10_1101-2021_01_07_425723	33	6	to	to	IN
10_1101-2021_01_07_425723	33	7	conflicting	conflicting	JJ
10_1101-2021_01_07_425723	33	8	reports	report	NNS
10_1101-2021_01_07_425723	33	9	on	on	IN
10_1101-2021_01_07_425723	33	10	the	the	DT
10_1101-2021_01_07_425723	33	11	ability	ability	NN
10_1101-2021_01_07_425723	33	12	of	of	IN
10_1101-2021_01_07_425723	33	13	non	non	JJ
10_1101-2021_01_07_425723	33	14	-	-	JJ
10_1101-2021_01_07_425723	33	15	Saccharomyces	saccharomyces	JJ
10_1101-2021_01_07_425723	33	16	yeasts	yeast	NNS
10_1101-2021_01_07_425723	33	17	to	to	TO
10_1101-2021_01_07_425723	33	18	grow	grow	VB
10_1101-2021_01_07_425723	33	19	72	72	CD
10_1101-2021_01_07_425723	33	20	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	33	21	,	,	,
10_1101-2021_01_07_425723	33	22	as	as	IN
10_1101-2021_01_07_425723	33	23	exemplified	exemplify	VBN
10_1101-2021_01_07_425723	33	24	by	by	IN
10_1101-2021_01_07_425723	33	25	studies	study	NNS
10_1101-2021_01_07_425723	33	26	on	on	IN
10_1101-2021_01_07_425723	33	27	the	the	DT
10_1101-2021_01_07_425723	33	28	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	33	29	yeast	yeast	NN
10_1101-2021_01_07_425723	33	30	K.	K.	NNP
10_1101-2021_01_07_425723	33	31	marxianus29–31	marxianus29–31	NNP
10_1101-2021_01_07_425723	33	32	.	.	.
10_1101-2021_01_07_425723	34	1	Paradoxically	paradoxically	RB
10_1101-2021_01_07_425723	34	2	,	,	,
10_1101-2021_01_07_425723	34	3	73	73	CD
10_1101-2021_01_07_425723	34	4	the	the	DT
10_1101-2021_01_07_425723	34	5	same	same	JJ
10_1101-2021_01_07_425723	34	6	small	small	JJ
10_1101-2021_01_07_425723	34	7	oxygen	oxygen	NN
10_1101-2021_01_07_425723	34	8	requirements	requirement	NNS
10_1101-2021_01_07_425723	34	9	can	can	MD
10_1101-2021_01_07_425723	34	10	represent	represent	VB
10_1101-2021_01_07_425723	34	11	a	a	DT
10_1101-2021_01_07_425723	34	12	real	real	JJ
10_1101-2021_01_07_425723	34	13	challenge	challenge	NN
10_1101-2021_01_07_425723	34	14	in	in	IN
10_1101-2021_01_07_425723	34	15	large	large	JJ
10_1101-2021_01_07_425723	34	16	-	-	HYPH
10_1101-2021_01_07_425723	34	17	scale	scale	NN
10_1101-2021_01_07_425723	34	18	bioreactors	bioreactor	NNS
10_1101-2021_01_07_425723	34	19	,	,	,
10_1101-2021_01_07_425723	34	20	in	in	IN
10_1101-2021_01_07_425723	34	21	which	which	WDT
10_1101-2021_01_07_425723	34	22	74	74	CD
10_1101-2021_01_07_425723	34	23	oxygen	oxygen	NN
10_1101-2021_01_07_425723	34	24	availability	availability	NN
10_1101-2021_01_07_425723	34	25	is	be	VBZ
10_1101-2021_01_07_425723	34	26	limited	limit	VBN
10_1101-2021_01_07_425723	34	27	by	by	IN
10_1101-2021_01_07_425723	34	28	low	low	JJ
10_1101-2021_01_07_425723	34	29	surface	surface	NN
10_1101-2021_01_07_425723	34	30	-	-	HYPH
10_1101-2021_01_07_425723	34	31	to	to	IN
10_1101-2021_01_07_425723	34	32	-	-	HYPH
10_1101-2021_01_07_425723	34	33	volume	volume	NN
10_1101-2021_01_07_425723	34	34	ratios	ratio	NNS
10_1101-2021_01_07_425723	34	35	and	and	CC
10_1101-2021_01_07_425723	34	36	vigorous	vigorous	JJ
10_1101-2021_01_07_425723	34	37	carbon	carbon	NN
10_1101-2021_01_07_425723	34	38	-	-	HYPH
10_1101-2021_01_07_425723	34	39	dioxide	dioxide	NN
10_1101-2021_01_07_425723	34	40	production	production	NN
10_1101-2021_01_07_425723	34	41	.	.	.
10_1101-2021_01_07_425723	35	1	75	75	CD
10_1101-2021_01_07_425723	35	2	Identification	identification	NN
10_1101-2021_01_07_425723	35	3	of	of	IN
10_1101-2021_01_07_425723	35	4	the	the	DT
10_1101-2021_01_07_425723	35	5	non	non	JJ
10_1101-2021_01_07_425723	35	6	-	-	JJ
10_1101-2021_01_07_425723	35	7	dissimilatory	dissimilatory	JJ
10_1101-2021_01_07_425723	35	8	oxygen	oxygen	NN
10_1101-2021_01_07_425723	35	9	requirements	requirement	NNS
10_1101-2021_01_07_425723	35	10	of	of	IN
10_1101-2021_01_07_425723	35	11	non	non	JJ
10_1101-2021_01_07_425723	35	12	-	-	JJ
10_1101-2021_01_07_425723	35	13	conventional	conventional	JJ
10_1101-2021_01_07_425723	35	14	yeast	yeast	NN
10_1101-2021_01_07_425723	35	15	species	specie	NNS
10_1101-2021_01_07_425723	35	16	is	be	VBZ
10_1101-2021_01_07_425723	35	17	76	76	CD
10_1101-2021_01_07_425723	35	18	required	require	VBN
10_1101-2021_01_07_425723	35	19	to	to	TO
10_1101-2021_01_07_425723	35	20	eliminate	eliminate	VB
10_1101-2021_01_07_425723	35	21	a	a	DT
10_1101-2021_01_07_425723	35	22	key	key	JJ
10_1101-2021_01_07_425723	35	23	bottleneck	bottleneck	NN
10_1101-2021_01_07_425723	35	24	for	for	IN
10_1101-2021_01_07_425723	35	25	their	-PRON-	PRP$
10_1101-2021_01_07_425723	35	26	application	application	NN
10_1101-2021_01_07_425723	35	27	in	in	IN
10_1101-2021_01_07_425723	35	28	industrial	industrial	JJ
10_1101-2021_01_07_425723	35	29	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	35	30	processes	process	NNS
10_1101-2021_01_07_425723	35	31	and	and	CC
10_1101-2021_01_07_425723	35	32	,	,	,
10_1101-2021_01_07_425723	35	33	on	on	IN
10_1101-2021_01_07_425723	35	34	a	a	DT
10_1101-2021_01_07_425723	35	35	77	77	CD
10_1101-2021_01_07_425723	35	36	fundamental	fundamental	JJ
10_1101-2021_01_07_425723	35	37	level	level	NN
10_1101-2021_01_07_425723	35	38	,	,	,
10_1101-2021_01_07_425723	35	39	can	can	MD
10_1101-2021_01_07_425723	35	40	shed	shed	VB
10_1101-2021_01_07_425723	35	41	light	light	NN
10_1101-2021_01_07_425723	35	42	on	on	IN
10_1101-2021_01_07_425723	35	43	the	the	DT
10_1101-2021_01_07_425723	35	44	roles	role	NNS
10_1101-2021_01_07_425723	35	45	of	of	IN
10_1101-2021_01_07_425723	35	46	oxygen	oxygen	NN
10_1101-2021_01_07_425723	35	47	in	in	IN
10_1101-2021_01_07_425723	35	48	eukaryotic	eukaryotic	JJ
10_1101-2021_01_07_425723	35	49	metabolism	metabolism	NN
10_1101-2021_01_07_425723	35	50	.	.	.
10_1101-2021_01_07_425723	36	1	The	the	DT
10_1101-2021_01_07_425723	36	2	goal	goal	NN
10_1101-2021_01_07_425723	36	3	of	of	IN
10_1101-2021_01_07_425723	36	4	this	this	DT
10_1101-2021_01_07_425723	36	5	study	study	NN
10_1101-2021_01_07_425723	36	6	78	78	CD
10_1101-2021_01_07_425723	36	7	.CC	.CC	:
10_1101-2021_01_07_425723	36	8	-	-	HYPH
10_1101-2021_01_07_425723	36	9	BY	by	IN
10_1101-2021_01_07_425723	36	10	-	-	HYPH
10_1101-2021_01_07_425723	36	11	NC	NC	NNP
10_1101-2021_01_07_425723	36	12	-	-	HYPH
10_1101-2021_01_07_425723	36	13	ND	ND	NNP
10_1101-2021_01_07_425723	36	14	4.0	4.0	CD
10_1101-2021_01_07_425723	36	15	International	International	NNP
10_1101-2021_01_07_425723	36	16	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	36	17	under	under	IN
10_1101-2021_01_07_425723	36	18	a	a	DT
10_1101-2021_01_07_425723	36	19	(	(	-LRB-
10_1101-2021_01_07_425723	36	20	which	which	WDT
10_1101-2021_01_07_425723	36	21	was	be	VBD
10_1101-2021_01_07_425723	36	22	not	not	RB
10_1101-2021_01_07_425723	36	23	certified	certify	VBN
10_1101-2021_01_07_425723	36	24	by	by	IN
10_1101-2021_01_07_425723	36	25	peer	peer	NN
10_1101-2021_01_07_425723	36	26	review	review	NN
10_1101-2021_01_07_425723	36	27	)	)	-RRB-
10_1101-2021_01_07_425723	36	28	is	be	VBZ
10_1101-2021_01_07_425723	36	29	the	the	DT
10_1101-2021_01_07_425723	36	30	author	author	NN
10_1101-2021_01_07_425723	36	31	/	/	SYM
10_1101-2021_01_07_425723	36	32	funder	funder	NN
10_1101-2021_01_07_425723	36	33	,	,	,
10_1101-2021_01_07_425723	36	34	who	who	WP
10_1101-2021_01_07_425723	36	35	has	have	VBZ
10_1101-2021_01_07_425723	36	36	granted	grant	VBN
10_1101-2021_01_07_425723	36	37	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	36	38	a	a	DT
10_1101-2021_01_07_425723	36	39	license	license	NN
10_1101-2021_01_07_425723	36	40	to	to	TO
10_1101-2021_01_07_425723	36	41	display	display	VB
10_1101-2021_01_07_425723	36	42	the	the	DT
10_1101-2021_01_07_425723	36	43	preprint	preprint	NN
10_1101-2021_01_07_425723	36	44	in	in	IN
10_1101-2021_01_07_425723	36	45	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	36	46	.	.	.
10_1101-2021_01_07_425723	37	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	37	2	is	be	VBZ
10_1101-2021_01_07_425723	37	3	made	make	VBN
10_1101-2021_01_07_425723	37	4	The	the	DT
10_1101-2021_01_07_425723	37	5	copyright	copyright	NN
10_1101-2021_01_07_425723	37	6	holder	holder	NN
10_1101-2021_01_07_425723	37	7	for	for	IN
10_1101-2021_01_07_425723	37	8	this	this	DT
10_1101-2021_01_07_425723	37	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	37	10	version	version	NN
10_1101-2021_01_07_425723	37	11	posted	post	VBD
10_1101-2021_01_07_425723	37	12	January	January	NNP
10_1101-2021_01_07_425723	37	13	8	8	CD
10_1101-2021_01_07_425723	37	14	,	,	,
10_1101-2021_01_07_425723	37	15	2021	2021	CD
10_1101-2021_01_07_425723	37	16	.	.	.
10_1101-2021_01_07_425723	37	17	;	;	:
10_1101-2021_01_07_425723	37	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	37	19	:	:	:
10_1101-2021_01_07_425723	37	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	37	21	preprint	preprint	NN
10_1101-2021_01_07_425723	37	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	37	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	37	24	5	5	CD
10_1101-2021_01_07_425723	37	25	was	be	VBD
10_1101-2021_01_07_425723	37	26	to	to	TO
10_1101-2021_01_07_425723	37	27	identify	identify	VB
10_1101-2021_01_07_425723	37	28	and	and	CC
10_1101-2021_01_07_425723	37	29	eliminate	eliminate	VB
10_1101-2021_01_07_425723	37	30	the	the	DT
10_1101-2021_01_07_425723	37	31	non	non	JJ
10_1101-2021_01_07_425723	37	32	-	-	JJ
10_1101-2021_01_07_425723	37	33	dissimilatory	dissimilatory	JJ
10_1101-2021_01_07_425723	37	34	oxygen	oxygen	NN
10_1101-2021_01_07_425723	37	35	requirements	requirement	NNS
10_1101-2021_01_07_425723	37	36	of	of	IN
10_1101-2021_01_07_425723	37	37	the	the	DT
10_1101-2021_01_07_425723	37	38	facultatively	facultatively	RB
10_1101-2021_01_07_425723	37	39	79	79	CD
10_1101-2021_01_07_425723	37	40	fermentative	fermentative	JJ
10_1101-2021_01_07_425723	37	41	,	,	,
10_1101-2021_01_07_425723	37	42	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	37	43	yeast	yeast	NN
10_1101-2021_01_07_425723	37	44	K.	K.	NNP
10_1101-2021_01_07_425723	37	45	marxianus	marxianus	NN
10_1101-2021_01_07_425723	37	46	.	.	.
10_1101-2021_01_07_425723	38	1	To	to	IN
10_1101-2021_01_07_425723	38	2	this	this	DT
10_1101-2021_01_07_425723	38	3	end	end	NN
10_1101-2021_01_07_425723	38	4	,	,	,
10_1101-2021_01_07_425723	38	5	we	-PRON-	PRP
10_1101-2021_01_07_425723	38	6	analyzed	analyze	VBD
10_1101-2021_01_07_425723	38	7	and	and	CC
10_1101-2021_01_07_425723	38	8	compared	compare	VBN
10_1101-2021_01_07_425723	38	9	physiological	physiological	JJ
10_1101-2021_01_07_425723	38	10	80	80	CD
10_1101-2021_01_07_425723	38	11	and	and	CC
10_1101-2021_01_07_425723	38	12	transcriptional	transcriptional	JJ
10_1101-2021_01_07_425723	38	13	responses	response	NNS
10_1101-2021_01_07_425723	38	14	of	of	IN
10_1101-2021_01_07_425723	38	15	K.	K.	NNP
10_1101-2021_01_07_425723	38	16	marxianus	marxianus	NN
10_1101-2021_01_07_425723	38	17	and	and	CC
10_1101-2021_01_07_425723	38	18	S.	S.	NNP
10_1101-2021_01_07_425723	38	19	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	38	20	to	to	IN
10_1101-2021_01_07_425723	38	21	different	different	JJ
10_1101-2021_01_07_425723	38	22	oxygen-	oxygen-	NN
10_1101-2021_01_07_425723	38	23	and	and	CC
10_1101-2021_01_07_425723	38	24	anaerobic-81	anaerobic-81	NNP
10_1101-2021_01_07_425723	38	25	growth	growth	NN
10_1101-2021_01_07_425723	38	26	factor	factor	NN
10_1101-2021_01_07_425723	38	27	limitation	limitation	NN
10_1101-2021_01_07_425723	38	28	regimes	regime	NNS
10_1101-2021_01_07_425723	38	29	in	in	IN
10_1101-2021_01_07_425723	38	30	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	38	31	cultures	culture	NNS
10_1101-2021_01_07_425723	38	32	.	.	.
10_1101-2021_01_07_425723	39	1	Based	base	VBN
10_1101-2021_01_07_425723	39	2	on	on	IN
10_1101-2021_01_07_425723	39	3	the	the	DT
10_1101-2021_01_07_425723	39	4	outcome	outcome	NN
10_1101-2021_01_07_425723	39	5	of	of	IN
10_1101-2021_01_07_425723	39	6	this	this	DT
10_1101-2021_01_07_425723	39	7	comparative	comparative	JJ
10_1101-2021_01_07_425723	39	8	82	82	CD
10_1101-2021_01_07_425723	39	9	analysis	analysis	NN
10_1101-2021_01_07_425723	39	10	,	,	,
10_1101-2021_01_07_425723	39	11	subsequent	subsequent	JJ
10_1101-2021_01_07_425723	39	12	experiments	experiment	NNS
10_1101-2021_01_07_425723	39	13	focused	focus	VBD
10_1101-2021_01_07_425723	39	14	on	on	IN
10_1101-2021_01_07_425723	39	15	characterization	characterization	NN
10_1101-2021_01_07_425723	39	16	and	and	CC
10_1101-2021_01_07_425723	39	17	engineering	engineering	NN
10_1101-2021_01_07_425723	39	18	of	of	IN
10_1101-2021_01_07_425723	39	19	sterol	sterol	NN
10_1101-2021_01_07_425723	39	20	metabolism	metabolism	NN
10_1101-2021_01_07_425723	39	21	and	and	CC
10_1101-2021_01_07_425723	39	22	83	83	CD
10_1101-2021_01_07_425723	39	23	yielded	yielded	NNP
10_1101-2021_01_07_425723	39	24	K.	K.	NNP
10_1101-2021_01_07_425723	39	25	marxianus	marxianus	NN
10_1101-2021_01_07_425723	39	26	strains	strain	VBZ
10_1101-2021_01_07_425723	39	27	that	that	WDT
10_1101-2021_01_07_425723	39	28	grew	grow	VBD
10_1101-2021_01_07_425723	39	29	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	39	30	at	at	IN
10_1101-2021_01_07_425723	39	31	45	45	CD
10_1101-2021_01_07_425723	39	32	°	°	NNS
10_1101-2021_01_07_425723	39	33	C	C	NNP
10_1101-2021_01_07_425723	39	34	.	.	.
10_1101-2021_01_07_425723	40	1	84	84	CD
10_1101-2021_01_07_425723	40	2	Results	result	NNS
10_1101-2021_01_07_425723	40	3	85	85	CD
10_1101-2021_01_07_425723	40	4	K.	k.	NN
10_1101-2021_01_07_425723	40	5	marxianus	marxianus	NN
10_1101-2021_01_07_425723	40	6	and	and	CC
10_1101-2021_01_07_425723	40	7	S.	S.	NNP
10_1101-2021_01_07_425723	40	8	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	40	9	show	show	VBP
10_1101-2021_01_07_425723	40	10	different	different	JJ
10_1101-2021_01_07_425723	40	11	physiological	physiological	JJ
10_1101-2021_01_07_425723	40	12	responses	response	NNS
10_1101-2021_01_07_425723	40	13	to	to	IN
10_1101-2021_01_07_425723	40	14	extreme	extreme	JJ
10_1101-2021_01_07_425723	40	15	oxygen	oxygen	NN
10_1101-2021_01_07_425723	40	16	limitation	limitation	NN
10_1101-2021_01_07_425723	40	17	86	86	CD
10_1101-2021_01_07_425723	40	18	To	to	TO
10_1101-2021_01_07_425723	40	19	investigate	investigate	VB
10_1101-2021_01_07_425723	40	20	oxygen	oxygen	NN
10_1101-2021_01_07_425723	40	21	requirements	requirement	NNS
10_1101-2021_01_07_425723	40	22	of	of	IN
10_1101-2021_01_07_425723	40	23	K.	K.	NNP
10_1101-2021_01_07_425723	40	24	marxianus	marxianus	NN
10_1101-2021_01_07_425723	40	25	,	,	,
10_1101-2021_01_07_425723	40	26	physiological	physiological	JJ
10_1101-2021_01_07_425723	40	27	responses	response	NNS
10_1101-2021_01_07_425723	40	28	of	of	IN
10_1101-2021_01_07_425723	40	29	strain	strain	NN
10_1101-2021_01_07_425723	40	30	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	40	31	were	be	VBD
10_1101-2021_01_07_425723	40	32	87	87	CD
10_1101-2021_01_07_425723	40	33	studied	study	VBN
10_1101-2021_01_07_425723	40	34	in	in	IN
10_1101-2021_01_07_425723	40	35	glucose	glucose	NN
10_1101-2021_01_07_425723	40	36	-	-	HYPH
10_1101-2021_01_07_425723	40	37	grown	grow	VBN
10_1101-2021_01_07_425723	40	38	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	40	39	cultures	culture	NNS
10_1101-2021_01_07_425723	40	40	operated	operate	VBN
10_1101-2021_01_07_425723	40	41	at	at	IN
10_1101-2021_01_07_425723	40	42	a	a	DT
10_1101-2021_01_07_425723	40	43	dilution	dilution	NN
10_1101-2021_01_07_425723	40	44	rate	rate	NN
10_1101-2021_01_07_425723	40	45	of	of	IN
10_1101-2021_01_07_425723	40	46	0.10	0.10	CD
10_1101-2021_01_07_425723	40	47	h-1	h-1	NNS
10_1101-2021_01_07_425723	40	48	and	and	CC
10_1101-2021_01_07_425723	40	49	subjected	subject	VBN
10_1101-2021_01_07_425723	40	50	to	to	IN
10_1101-2021_01_07_425723	40	51	88	88	CD
10_1101-2021_01_07_425723	40	52	different	different	JJ
10_1101-2021_01_07_425723	40	53	oxygenation	oxygenation	NN
10_1101-2021_01_07_425723	40	54	and	and	CC
10_1101-2021_01_07_425723	40	55	AGF	AGF	NNP
10_1101-2021_01_07_425723	40	56	limitation	limitation	NN
10_1101-2021_01_07_425723	40	57	regimes	regime	NNS
10_1101-2021_01_07_425723	40	58	(	(	-LRB-
10_1101-2021_01_07_425723	40	59	Fig	fig	NN
10_1101-2021_01_07_425723	40	60	.	.	.
10_1101-2021_01_07_425723	41	1	1a	1a	LS
10_1101-2021_01_07_425723	41	2	)	)	-RRB-
10_1101-2021_01_07_425723	41	3	.	.	.
10_1101-2021_01_07_425723	42	1	Physiological	physiological	JJ
10_1101-2021_01_07_425723	42	2	parameters	parameter	NNS
10_1101-2021_01_07_425723	42	3	of	of	IN
10_1101-2021_01_07_425723	42	4	K.	K.	NNP
10_1101-2021_01_07_425723	42	5	marxianus	marxianus	NN
10_1101-2021_01_07_425723	42	6	in	in	IN
10_1101-2021_01_07_425723	42	7	89	89	CD
10_1101-2021_01_07_425723	42	8	these	these	DT
10_1101-2021_01_07_425723	42	9	cultures	culture	NNS
10_1101-2021_01_07_425723	42	10	were	be	VBD
10_1101-2021_01_07_425723	42	11	compared	compare	VBN
10_1101-2021_01_07_425723	42	12	to	to	IN
10_1101-2021_01_07_425723	42	13	those	those	DT
10_1101-2021_01_07_425723	42	14	of	of	IN
10_1101-2021_01_07_425723	42	15	S.	S.	NNP
10_1101-2021_01_07_425723	42	16	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	42	17	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	42	18	-	-	HYPH
10_1101-2021_01_07_425723	42	19	7D	7D	NNP
10_1101-2021_01_07_425723	42	20	subjected	subject	VBN
10_1101-2021_01_07_425723	42	21	to	to	IN
10_1101-2021_01_07_425723	42	22	the	the	DT
10_1101-2021_01_07_425723	42	23	same	same	JJ
10_1101-2021_01_07_425723	42	24	cultivation	cultivation	NN
10_1101-2021_01_07_425723	42	25	90	90	CD
10_1101-2021_01_07_425723	42	26	regimes	regime	NNS
10_1101-2021_01_07_425723	42	27	.	.	.
10_1101-2021_01_07_425723	43	1	91	91	CD
10_1101-2021_01_07_425723	43	2	In	in	IN
10_1101-2021_01_07_425723	43	3	glucose	glucose	NN
10_1101-2021_01_07_425723	43	4	-	-	HYPH
10_1101-2021_01_07_425723	43	5	limited	limited	JJ
10_1101-2021_01_07_425723	43	6	,	,	,
10_1101-2021_01_07_425723	43	7	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	43	8	chemostat	chemostat	NN
10_1101-2021_01_07_425723	43	9	cultures	culture	NNS
10_1101-2021_01_07_425723	43	10	(	(	-LRB-
10_1101-2021_01_07_425723	43	11	supplied	supply	VBN
10_1101-2021_01_07_425723	43	12	with	with	IN
10_1101-2021_01_07_425723	43	13	0.5	0.5	CD
10_1101-2021_01_07_425723	43	14	L	L	NNP
10_1101-2021_01_07_425723	43	15	air·min-1	air·min-1	NNP
10_1101-2021_01_07_425723	43	16	,	,	,
10_1101-2021_01_07_425723	43	17	corresponding	correspond	VBG
10_1101-2021_01_07_425723	43	18	to	to	IN
10_1101-2021_01_07_425723	43	19	54	54	CD
10_1101-2021_01_07_425723	43	20	mmol	mmol	NN
10_1101-2021_01_07_425723	43	21	92	92	CD
10_1101-2021_01_07_425723	43	22	O2	o2	NN
10_1101-2021_01_07_425723	43	23	h-1	h-1	NNP
10_1101-2021_01_07_425723	43	24	)	)	-RRB-
10_1101-2021_01_07_425723	43	25	,	,	,
10_1101-2021_01_07_425723	43	26	the	the	DT
10_1101-2021_01_07_425723	43	27	Crabtree	Crabtree	NNP
10_1101-2021_01_07_425723	43	28	-	-	HYPH
10_1101-2021_01_07_425723	43	29	negative	negative	JJ
10_1101-2021_01_07_425723	43	30	yeast	yeast	NN
10_1101-2021_01_07_425723	43	31	K.	K.	NNP
10_1101-2021_01_07_425723	43	32	marxianus32	marxianus32	NNP
10_1101-2021_01_07_425723	43	33	and	and	CC
10_1101-2021_01_07_425723	43	34	the	the	DT
10_1101-2021_01_07_425723	43	35	Crabtree	Crabtree	NNP
10_1101-2021_01_07_425723	43	36	-	-	HYPH
10_1101-2021_01_07_425723	43	37	positive	positive	JJ
10_1101-2021_01_07_425723	43	38	yeast	yeast	NN
10_1101-2021_01_07_425723	43	39	S.	S.	NNP
10_1101-2021_01_07_425723	43	40	cerevisiae33	cerevisiae33	NNP
10_1101-2021_01_07_425723	43	41	both	both	DT
10_1101-2021_01_07_425723	43	42	93	93	CD
10_1101-2021_01_07_425723	43	43	exhibited	exhibit	VBD
10_1101-2021_01_07_425723	43	44	a	a	DT
10_1101-2021_01_07_425723	43	45	fully	fully	RB
10_1101-2021_01_07_425723	43	46	respiratory	respiratory	JJ
10_1101-2021_01_07_425723	43	47	dissimilation	dissimilation	NN
10_1101-2021_01_07_425723	43	48	of	of	IN
10_1101-2021_01_07_425723	43	49	glucose	glucose	NN
10_1101-2021_01_07_425723	43	50	,	,	,
10_1101-2021_01_07_425723	43	51	as	as	RB
10_1101-2021_01_07_425723	43	52	evident	evident	JJ
10_1101-2021_01_07_425723	43	53	from	from	IN
10_1101-2021_01_07_425723	43	54	absence	absence	NN
10_1101-2021_01_07_425723	43	55	of	of	IN
10_1101-2021_01_07_425723	43	56	ethanol	ethanol	NN
10_1101-2021_01_07_425723	43	57	production	production	NN
10_1101-2021_01_07_425723	43	58	and	and	CC
10_1101-2021_01_07_425723	43	59	94	94	CD
10_1101-2021_01_07_425723	43	60	a	a	DT
10_1101-2021_01_07_425723	43	61	respiratory	respiratory	JJ
10_1101-2021_01_07_425723	43	62	quotient	quotient	NN
10_1101-2021_01_07_425723	43	63	(	(	-LRB-
10_1101-2021_01_07_425723	43	64	RQ	RQ	NNP
10_1101-2021_01_07_425723	43	65	)	)	-RRB-
10_1101-2021_01_07_425723	43	66	close	close	JJ
10_1101-2021_01_07_425723	43	67	to	to	IN
10_1101-2021_01_07_425723	43	68	1	1	CD
10_1101-2021_01_07_425723	43	69	(	(	-LRB-
10_1101-2021_01_07_425723	43	70	Table	table	NN
10_1101-2021_01_07_425723	43	71	1	1	CD
10_1101-2021_01_07_425723	43	72	)	)	-RRB-
10_1101-2021_01_07_425723	43	73	.	.	.
10_1101-2021_01_07_425723	44	1	Apparent	apparent	JJ
10_1101-2021_01_07_425723	44	2	biomass	biomass	NN
10_1101-2021_01_07_425723	44	3	yields	yield	NNS
10_1101-2021_01_07_425723	44	4	on	on	IN
10_1101-2021_01_07_425723	44	5	glucose	glucose	NN
10_1101-2021_01_07_425723	44	6	of	of	IN
10_1101-2021_01_07_425723	44	7	both	both	DT
10_1101-2021_01_07_425723	44	8	yeasts	yeast	NNS
10_1101-2021_01_07_425723	44	9	95	95	CD
10_1101-2021_01_07_425723	44	10	exceeded	exceed	VBD
10_1101-2021_01_07_425723	44	11	0.5	0.5	CD
10_1101-2021_01_07_425723	44	12	g	g	NN
10_1101-2021_01_07_425723	44	13	biomass	biomass	NN
10_1101-2021_01_07_425723	44	14	(	(	-LRB-
10_1101-2021_01_07_425723	44	15	g	g	NNP
10_1101-2021_01_07_425723	44	16	glucose)-1	glucose)-1	CD
10_1101-2021_01_07_425723	44	17	and	and	CC
10_1101-2021_01_07_425723	44	18	were	be	VBD
10_1101-2021_01_07_425723	44	19	approximately	approximately	RB
10_1101-2021_01_07_425723	44	20	10	10	CD
10_1101-2021_01_07_425723	44	21	%	%	NN
10_1101-2021_01_07_425723	44	22	higher	high	JJR
10_1101-2021_01_07_425723	44	23	than	than	IN
10_1101-2021_01_07_425723	44	24	previously	previously	RB
10_1101-2021_01_07_425723	44	25	reported	report	VBN
10_1101-2021_01_07_425723	44	26	due	due	JJ
10_1101-2021_01_07_425723	44	27	96	96	CD
10_1101-2021_01_07_425723	44	28	to	to	TO
10_1101-2021_01_07_425723	44	29	co	co	NN
10_1101-2021_01_07_425723	44	30	-	-	NN
10_1101-2021_01_07_425723	44	31	consumption	consumption	NN
10_1101-2021_01_07_425723	44	32	of	of	IN
10_1101-2021_01_07_425723	44	33	ethanol	ethanol	NN
10_1101-2021_01_07_425723	44	34	,	,	,
10_1101-2021_01_07_425723	44	35	which	which	WDT
10_1101-2021_01_07_425723	44	36	was	be	VBD
10_1101-2021_01_07_425723	44	37	used	use	VBN
10_1101-2021_01_07_425723	44	38	as	as	IN
10_1101-2021_01_07_425723	44	39	solvent	solvent	NN
10_1101-2021_01_07_425723	44	40	for	for	IN
10_1101-2021_01_07_425723	44	41	the	the	DT
10_1101-2021_01_07_425723	44	42	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	44	43	growth	growth	NN
10_1101-2021_01_07_425723	44	44	factor	factor	NN
10_1101-2021_01_07_425723	44	45	ergosterol32,34	ergosterol32,34	NNP
10_1101-2021_01_07_425723	44	46	.	.	.
10_1101-2021_01_07_425723	45	1	97	97	CD
10_1101-2021_01_07_425723	45	2	At	at	IN
10_1101-2021_01_07_425723	45	3	a	a	DT
10_1101-2021_01_07_425723	45	4	reduced	reduce	VBN
10_1101-2021_01_07_425723	45	5	oxygen	oxygen	NN
10_1101-2021_01_07_425723	45	6	-	-	HYPH
10_1101-2021_01_07_425723	45	7	supply	supply	NN
10_1101-2021_01_07_425723	45	8	rate	rate	NN
10_1101-2021_01_07_425723	45	9	of	of	IN
10_1101-2021_01_07_425723	45	10	0.4	0.4	CD
10_1101-2021_01_07_425723	45	11	mmol	mmol	NN
10_1101-2021_01_07_425723	45	12	O2	O2	NNP
10_1101-2021_01_07_425723	45	13	h-1	h-1	NNP
10_1101-2021_01_07_425723	45	14	,	,	,
10_1101-2021_01_07_425723	45	15	both	both	DT
10_1101-2021_01_07_425723	45	16	yeasts	yeast	NNS
10_1101-2021_01_07_425723	45	17	exhibited	exhibit	VBD
10_1101-2021_01_07_425723	45	18	a	a	DT
10_1101-2021_01_07_425723	45	19	mixed	mixed	JJ
10_1101-2021_01_07_425723	45	20	respiro	respiro	NNP
10_1101-2021_01_07_425723	45	21	-	-	HYPH
10_1101-2021_01_07_425723	45	22	fermentative	fermentative	NNP
10_1101-2021_01_07_425723	45	23	98	98	CD
10_1101-2021_01_07_425723	45	24	glucose	glucose	NN
10_1101-2021_01_07_425723	45	25	metabolism	metabolism	NN
10_1101-2021_01_07_425723	45	26	.	.	.
10_1101-2021_01_07_425723	46	1	RQ	RQ	NNP
10_1101-2021_01_07_425723	46	2	values	value	NNS
10_1101-2021_01_07_425723	46	3	close	close	RB
10_1101-2021_01_07_425723	46	4	to	to	IN
10_1101-2021_01_07_425723	46	5	50	50	CD
10_1101-2021_01_07_425723	46	6	and	and	CC
10_1101-2021_01_07_425723	46	7	biomass	biomass	NN
10_1101-2021_01_07_425723	46	8	-	-	HYPH
10_1101-2021_01_07_425723	46	9	specific	specific	JJ
10_1101-2021_01_07_425723	46	10	ethanol	ethanol	NN
10_1101-2021_01_07_425723	46	11	-	-	HYPH
10_1101-2021_01_07_425723	46	12	production	production	NN
10_1101-2021_01_07_425723	46	13	rates	rate	NNS
10_1101-2021_01_07_425723	46	14	of	of	IN
10_1101-2021_01_07_425723	46	15	11.5	11.5	CD
10_1101-2021_01_07_425723	46	16	±	±	CD
10_1101-2021_01_07_425723	46	17	0.6	0.6	CD
10_1101-2021_01_07_425723	46	18	99	99	CD
10_1101-2021_01_07_425723	46	19	mmol·g·h-1	mmol·g·h-1	NNS
10_1101-2021_01_07_425723	46	20	for	for	IN
10_1101-2021_01_07_425723	46	21	K.	K.	NNP
10_1101-2021_01_07_425723	46	22	marxianus	marxianu	NNS
10_1101-2021_01_07_425723	46	23	and	and	CC
10_1101-2021_01_07_425723	46	24	7.5	7.5	CD
10_1101-2021_01_07_425723	46	25	±	±	CD
10_1101-2021_01_07_425723	46	26	0.1	0.1	CD
10_1101-2021_01_07_425723	46	27	mmol·g·h-1	mmol·g·h-1	NNS
10_1101-2021_01_07_425723	46	28	for	for	IN
10_1101-2021_01_07_425723	46	29	S.	S.	NNP
10_1101-2021_01_07_425723	46	30	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	46	31	(	(	-LRB-
10_1101-2021_01_07_425723	46	32	Table	table	NN
10_1101-2021_01_07_425723	46	33	1	1	CD
10_1101-2021_01_07_425723	46	34	)	)	-RRB-
10_1101-2021_01_07_425723	46	35	,	,	,
10_1101-2021_01_07_425723	46	36	indicated	indicate	VBD
10_1101-2021_01_07_425723	46	37	that	that	IN
10_1101-2021_01_07_425723	46	38	glucose	glucose	NN
10_1101-2021_01_07_425723	46	39	100	100	CD
10_1101-2021_01_07_425723	46	40	.CC	.CC	,
10_1101-2021_01_07_425723	46	41	-	-	HYPH
10_1101-2021_01_07_425723	46	42	BY	by	IN
10_1101-2021_01_07_425723	46	43	-	-	HYPH
10_1101-2021_01_07_425723	46	44	NC	NC	NNP
10_1101-2021_01_07_425723	46	45	-	-	HYPH
10_1101-2021_01_07_425723	46	46	ND	ND	NNP
10_1101-2021_01_07_425723	46	47	4.0	4.0	CD
10_1101-2021_01_07_425723	46	48	International	International	NNP
10_1101-2021_01_07_425723	46	49	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	46	50	under	under	IN
10_1101-2021_01_07_425723	46	51	a	a	DT
10_1101-2021_01_07_425723	46	52	(	(	-LRB-
10_1101-2021_01_07_425723	46	53	which	which	WDT
10_1101-2021_01_07_425723	46	54	was	be	VBD
10_1101-2021_01_07_425723	46	55	not	not	RB
10_1101-2021_01_07_425723	46	56	certified	certify	VBN
10_1101-2021_01_07_425723	46	57	by	by	IN
10_1101-2021_01_07_425723	46	58	peer	peer	NN
10_1101-2021_01_07_425723	46	59	review	review	NN
10_1101-2021_01_07_425723	46	60	)	)	-RRB-
10_1101-2021_01_07_425723	46	61	is	be	VBZ
10_1101-2021_01_07_425723	46	62	the	the	DT
10_1101-2021_01_07_425723	46	63	author	author	NN
10_1101-2021_01_07_425723	46	64	/	/	SYM
10_1101-2021_01_07_425723	46	65	funder	funder	NN
10_1101-2021_01_07_425723	46	66	,	,	,
10_1101-2021_01_07_425723	46	67	who	who	WP
10_1101-2021_01_07_425723	46	68	has	have	VBZ
10_1101-2021_01_07_425723	46	69	granted	grant	VBN
10_1101-2021_01_07_425723	46	70	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	46	71	a	a	DT
10_1101-2021_01_07_425723	46	72	license	license	NN
10_1101-2021_01_07_425723	46	73	to	to	TO
10_1101-2021_01_07_425723	46	74	display	display	VB
10_1101-2021_01_07_425723	46	75	the	the	DT
10_1101-2021_01_07_425723	46	76	preprint	preprint	NN
10_1101-2021_01_07_425723	46	77	in	in	IN
10_1101-2021_01_07_425723	46	78	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	46	79	.	.	.
10_1101-2021_01_07_425723	47	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	47	2	is	be	VBZ
10_1101-2021_01_07_425723	47	3	made	make	VBN
10_1101-2021_01_07_425723	47	4	The	the	DT
10_1101-2021_01_07_425723	47	5	copyright	copyright	NN
10_1101-2021_01_07_425723	47	6	holder	holder	NN
10_1101-2021_01_07_425723	47	7	for	for	IN
10_1101-2021_01_07_425723	47	8	this	this	DT
10_1101-2021_01_07_425723	47	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	47	10	version	version	NN
10_1101-2021_01_07_425723	47	11	posted	post	VBD
10_1101-2021_01_07_425723	47	12	January	January	NNP
10_1101-2021_01_07_425723	47	13	8	8	CD
10_1101-2021_01_07_425723	47	14	,	,	,
10_1101-2021_01_07_425723	47	15	2021	2021	CD
10_1101-2021_01_07_425723	47	16	.	.	.
10_1101-2021_01_07_425723	47	17	;	;	:
10_1101-2021_01_07_425723	47	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	47	19	:	:	:
10_1101-2021_01_07_425723	47	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	47	21	preprint	preprint	NN
10_1101-2021_01_07_425723	47	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	47	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	47	24	6	6	CD
10_1101-2021_01_07_425723	47	25	dissimilation	dissimilation	NN
10_1101-2021_01_07_425723	47	26	in	in	IN
10_1101-2021_01_07_425723	47	27	these	these	DT
10_1101-2021_01_07_425723	47	28	cultures	culture	NNS
10_1101-2021_01_07_425723	47	29	was	be	VBD
10_1101-2021_01_07_425723	47	30	predominantly	predominantly	RB
10_1101-2021_01_07_425723	47	31	fermentative	fermentative	JJ
10_1101-2021_01_07_425723	47	32	.	.	.
10_1101-2021_01_07_425723	48	1	Biomass	biomass	NN
10_1101-2021_01_07_425723	48	2	-	-	HYPH
10_1101-2021_01_07_425723	48	3	specific	specific	JJ
10_1101-2021_01_07_425723	48	4	rates	rate	NNS
10_1101-2021_01_07_425723	48	5	of	of	IN
10_1101-2021_01_07_425723	48	6	glycerol	glycerol	NN
10_1101-2021_01_07_425723	48	7	101	101	CD
10_1101-2021_01_07_425723	48	8	production	production	NN
10_1101-2021_01_07_425723	48	9	which	which	WDT
10_1101-2021_01_07_425723	48	10	,	,	,
10_1101-2021_01_07_425723	48	11	under	under	IN
10_1101-2021_01_07_425723	48	12	oxygen	oxygen	NN
10_1101-2021_01_07_425723	48	13	-	-	HYPH
10_1101-2021_01_07_425723	48	14	limited	limit	VBN
10_1101-2021_01_07_425723	48	15	conditions	condition	NNS
10_1101-2021_01_07_425723	48	16	,	,	,
10_1101-2021_01_07_425723	48	17	enables	enable	NNS
10_1101-2021_01_07_425723	48	18	re	re	NN
10_1101-2021_01_07_425723	48	19	-	-	NN
10_1101-2021_01_07_425723	48	20	oxidation	oxidation	NN
10_1101-2021_01_07_425723	48	21	of	of	IN
10_1101-2021_01_07_425723	48	22	NADH	NADH	NNP
10_1101-2021_01_07_425723	48	23	generated	generate	VBN
10_1101-2021_01_07_425723	48	24	in	in	IN
10_1101-2021_01_07_425723	48	25	102	102	CD
10_1101-2021_01_07_425723	48	26	biosynthetic	biosynthetic	JJ
10_1101-2021_01_07_425723	48	27	reactions35	reactions35	NN
10_1101-2021_01_07_425723	48	28	,	,	,
10_1101-2021_01_07_425723	48	29	were	be	VBD
10_1101-2021_01_07_425723	48	30	approximately	approximately	RB
10_1101-2021_01_07_425723	48	31	2.5-fold	2.5-fold	CD
10_1101-2021_01_07_425723	48	32	higher	high	JJR
10_1101-2021_01_07_425723	48	33	(	(	-LRB-
10_1101-2021_01_07_425723	48	34	p	p	NN
10_1101-2021_01_07_425723	48	35	=	=	SYM
10_1101-2021_01_07_425723	48	36	2.3·10	2.3·10	CD
10_1101-2021_01_07_425723	48	37	-	-	SYM
10_1101-2021_01_07_425723	48	38	4	4	CD
10_1101-2021_01_07_425723	48	39	)	)	-RRB-
10_1101-2021_01_07_425723	48	40	in	in	IN
10_1101-2021_01_07_425723	48	41	K.	K.	NNP
10_1101-2021_01_07_425723	48	42	marxianus	marxianus	NN
10_1101-2021_01_07_425723	48	43	than	than	IN
10_1101-2021_01_07_425723	48	44	in	in	IN
10_1101-2021_01_07_425723	48	45	S.	S.	NNP
10_1101-2021_01_07_425723	48	46	103	103	CD
10_1101-2021_01_07_425723	48	47	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	48	48	.	.	.
10_1101-2021_01_07_425723	49	1	Glycerol	glycerol	NN
10_1101-2021_01_07_425723	49	2	production	production	NN
10_1101-2021_01_07_425723	49	3	showed	show	VBD
10_1101-2021_01_07_425723	49	4	that	that	IN
10_1101-2021_01_07_425723	49	5	the	the	DT
10_1101-2021_01_07_425723	49	6	reduced	reduced	JJ
10_1101-2021_01_07_425723	49	7	oxygen	oxygen	NN
10_1101-2021_01_07_425723	49	8	-	-	HYPH
10_1101-2021_01_07_425723	49	9	supply	supply	NN
10_1101-2021_01_07_425723	49	10	rate	rate	NN
10_1101-2021_01_07_425723	49	11	constrained	constrain	VBN
10_1101-2021_01_07_425723	49	12	mitochondrial	mitochondrial	NN
10_1101-2021_01_07_425723	49	13	104	104	CD
10_1101-2021_01_07_425723	49	14	respiration	respiration	NN
10_1101-2021_01_07_425723	49	15	.	.	.
10_1101-2021_01_07_425723	50	1	However	however	RB
10_1101-2021_01_07_425723	50	2	,	,	,
10_1101-2021_01_07_425723	50	3	low	low	JJ
10_1101-2021_01_07_425723	50	4	residual	residual	JJ
10_1101-2021_01_07_425723	50	5	glucose	glucose	NN
10_1101-2021_01_07_425723	50	6	concentrations	concentration	NNS
10_1101-2021_01_07_425723	50	7	(	(	-LRB-
10_1101-2021_01_07_425723	50	8	Table	table	NN
10_1101-2021_01_07_425723	50	9	1	1	CD
10_1101-2021_01_07_425723	50	10	)	)	-RRB-
10_1101-2021_01_07_425723	50	11	indicated	indicate	VBD
10_1101-2021_01_07_425723	50	12	that	that	IN
10_1101-2021_01_07_425723	50	13	sufficient	sufficient	JJ
10_1101-2021_01_07_425723	50	14	oxygen	oxygen	NN
10_1101-2021_01_07_425723	50	15	was	be	VBD
10_1101-2021_01_07_425723	50	16	105	105	CD
10_1101-2021_01_07_425723	50	17	provided	provide	VBN
10_1101-2021_01_07_425723	50	18	to	to	TO
10_1101-2021_01_07_425723	50	19	meet	meet	VB
10_1101-2021_01_07_425723	50	20	most	most	JJS
10_1101-2021_01_07_425723	50	21	or	or	CC
10_1101-2021_01_07_425723	50	22	all	all	DT
10_1101-2021_01_07_425723	50	23	of	of	IN
10_1101-2021_01_07_425723	50	24	the	the	DT
10_1101-2021_01_07_425723	50	25	biosynthetic	biosynthetic	JJ
10_1101-2021_01_07_425723	50	26	oxygen	oxygen	NN
10_1101-2021_01_07_425723	50	27	requirements	requirement	NNS
10_1101-2021_01_07_425723	50	28	of	of	IN
10_1101-2021_01_07_425723	50	29	K.	K.	NNP
10_1101-2021_01_07_425723	50	30	marxianus	marxianus	NN
10_1101-2021_01_07_425723	50	31	.	.	.
10_1101-2021_01_07_425723	51	1	106	106	CD
10_1101-2021_01_07_425723	51	2	To	to	TO
10_1101-2021_01_07_425723	51	3	explore	explore	VB
10_1101-2021_01_07_425723	51	4	growth	growth	NN
10_1101-2021_01_07_425723	51	5	of	of	IN
10_1101-2021_01_07_425723	51	6	K.	K.	NNP
10_1101-2021_01_07_425723	51	7	marxianus	marxianus	NN
10_1101-2021_01_07_425723	51	8	under	under	IN
10_1101-2021_01_07_425723	51	9	an	an	DT
10_1101-2021_01_07_425723	51	10	even	even	RB
10_1101-2021_01_07_425723	51	11	more	more	RBR
10_1101-2021_01_07_425723	51	12	stringent	stringent	JJ
10_1101-2021_01_07_425723	51	13	oxygen	oxygen	NN
10_1101-2021_01_07_425723	51	14	-	-	HYPH
10_1101-2021_01_07_425723	51	15	limitation	limitation	NN
10_1101-2021_01_07_425723	51	16	,	,	,
10_1101-2021_01_07_425723	51	17	we	-PRON-	PRP
10_1101-2021_01_07_425723	51	18	exploited	exploit	VBD
10_1101-2021_01_07_425723	51	19	107	107	CD
10_1101-2021_01_07_425723	51	20	previously	previously	RB
10_1101-2021_01_07_425723	51	21	documented	document	VBN
10_1101-2021_01_07_425723	51	22	challenges	challenge	NNS
10_1101-2021_01_07_425723	51	23	in	in	IN
10_1101-2021_01_07_425723	51	24	achieving	achieve	VBG
10_1101-2021_01_07_425723	51	25	complete	complete	JJ
10_1101-2021_01_07_425723	51	26	anaerobiosis	anaerobiosis	NN
10_1101-2021_01_07_425723	51	27	in	in	IN
10_1101-2021_01_07_425723	51	28	laboratory	laboratory	NN
10_1101-2021_01_07_425723	51	29	bioreactors19,28	bioreactors19,28	NNP
10_1101-2021_01_07_425723	51	30	.	.	.
10_1101-2021_01_07_425723	52	1	108	108	CD
10_1101-2021_01_07_425723	52	2	Even	even	RB
10_1101-2021_01_07_425723	52	3	in	in	IN
10_1101-2021_01_07_425723	52	4	chemostats	chemostat	NNS
10_1101-2021_01_07_425723	52	5	sparged	sparge	VBN
10_1101-2021_01_07_425723	52	6	with	with	IN
10_1101-2021_01_07_425723	52	7	pure	pure	JJ
10_1101-2021_01_07_425723	52	8	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	52	9	,	,	,
10_1101-2021_01_07_425723	52	10	S.	S.	NNP
10_1101-2021_01_07_425723	52	11	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	52	12	grew	grow	VBD
10_1101-2021_01_07_425723	52	13	on	on	IN
10_1101-2021_01_07_425723	52	14	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	52	15	medium	medium	NN
10_1101-2021_01_07_425723	52	16	lacking	lack	VBG
10_1101-2021_01_07_425723	52	17	Tween	Tween	NNP
10_1101-2021_01_07_425723	52	18	109	109	CD
10_1101-2021_01_07_425723	52	19	80	80	CD
10_1101-2021_01_07_425723	52	20	and	and	CC
10_1101-2021_01_07_425723	52	21	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	52	22	,	,	,
10_1101-2021_01_07_425723	52	23	albeit	albeit	IN
10_1101-2021_01_07_425723	52	24	at	at	IN
10_1101-2021_01_07_425723	52	25	an	an	DT
10_1101-2021_01_07_425723	52	26	increased	increase	VBN
10_1101-2021_01_07_425723	52	27	residual	residual	JJ
10_1101-2021_01_07_425723	52	28	glucose	glucose	NN
10_1101-2021_01_07_425723	52	29	concentration	concentration	NN
10_1101-2021_01_07_425723	52	30	(	(	-LRB-
10_1101-2021_01_07_425723	52	31	Fig	fig	NN
10_1101-2021_01_07_425723	52	32	.	.	.
10_1101-2021_01_07_425723	53	1	1	1	LS
10_1101-2021_01_07_425723	53	2	,	,	,
10_1101-2021_01_07_425723	53	3	Table	table	NN
10_1101-2021_01_07_425723	53	4	1	1	CD
10_1101-2021_01_07_425723	53	5	)	)	-RRB-
10_1101-2021_01_07_425723	53	6	.	.	.
10_1101-2021_01_07_425723	54	1	In	in	IN
10_1101-2021_01_07_425723	54	2	contrast	contrast	NN
10_1101-2021_01_07_425723	54	3	,	,	,
10_1101-2021_01_07_425723	54	4	K.	K.	NNP
10_1101-2021_01_07_425723	54	5	110	110	CD
10_1101-2021_01_07_425723	54	6	marxianus	marxianus	NN
10_1101-2021_01_07_425723	54	7	cultures	culture	NNS
10_1101-2021_01_07_425723	54	8	sparged	sparge	VBN
10_1101-2021_01_07_425723	54	9	with	with	IN
10_1101-2021_01_07_425723	54	10	pure	pure	JJ
10_1101-2021_01_07_425723	54	11	N2	N2	NNP
10_1101-2021_01_07_425723	54	12	and	and	CC
10_1101-2021_01_07_425723	54	13	supplemented	supplement	VBN
10_1101-2021_01_07_425723	54	14	with	with	IN
10_1101-2021_01_07_425723	54	15	both	both	DT
10_1101-2021_01_07_425723	54	16	AGFs	agf	NNS
10_1101-2021_01_07_425723	54	17	consumed	consume	VBN
10_1101-2021_01_07_425723	54	18	only	only	RB
10_1101-2021_01_07_425723	54	19	20	20	CD
10_1101-2021_01_07_425723	54	20	%	%	NN
10_1101-2021_01_07_425723	54	21	of	of	IN
10_1101-2021_01_07_425723	54	22	the	the	DT
10_1101-2021_01_07_425723	54	23	111	111	CD
10_1101-2021_01_07_425723	54	24	glucose	glucose	NN
10_1101-2021_01_07_425723	54	25	fed	feed	VBN
10_1101-2021_01_07_425723	54	26	to	to	IN
10_1101-2021_01_07_425723	54	27	the	the	DT
10_1101-2021_01_07_425723	54	28	cultures	culture	NNS
10_1101-2021_01_07_425723	54	29	.	.	.
10_1101-2021_01_07_425723	55	1	These	these	DT
10_1101-2021_01_07_425723	55	2	severely	severely	RB
10_1101-2021_01_07_425723	55	3	oxygen	oxygen	NN
10_1101-2021_01_07_425723	55	4	-	-	HYPH
10_1101-2021_01_07_425723	55	5	limited	limit	VBN
10_1101-2021_01_07_425723	55	6	cultures	culture	NNS
10_1101-2021_01_07_425723	55	7	showed	show	VBD
10_1101-2021_01_07_425723	55	8	a	a	DT
10_1101-2021_01_07_425723	55	9	residual	residual	JJ
10_1101-2021_01_07_425723	55	10	glucose	glucose	NN
10_1101-2021_01_07_425723	55	11	112	112	CD
10_1101-2021_01_07_425723	55	12	concentration	concentration	NN
10_1101-2021_01_07_425723	55	13	of	of	IN
10_1101-2021_01_07_425723	55	14	15.9	15.9	CD
10_1101-2021_01_07_425723	55	15	±	±	CD
10_1101-2021_01_07_425723	55	16	0.3	0.3	CD
10_1101-2021_01_07_425723	55	17	g·L-1	g·L-1	NNP
10_1101-2021_01_07_425723	55	18	and	and	CC
10_1101-2021_01_07_425723	55	19	a	a	DT
10_1101-2021_01_07_425723	55	20	low	low	JJ
10_1101-2021_01_07_425723	55	21	but	but	CC
10_1101-2021_01_07_425723	55	22	constant	constant	JJ
10_1101-2021_01_07_425723	55	23	biomass	biomass	NN
10_1101-2021_01_07_425723	55	24	concentration	concentration	NN
10_1101-2021_01_07_425723	55	25	of	of	IN
10_1101-2021_01_07_425723	55	26	0.4	0.4	CD
10_1101-2021_01_07_425723	55	27	±	±	CD
10_1101-2021_01_07_425723	55	28	0.0	0.0	CD
10_1101-2021_01_07_425723	55	29	g·L-1	g·l-1	NN
10_1101-2021_01_07_425723	55	30	.	.	.
10_1101-2021_01_07_425723	56	1	This	this	DT
10_1101-2021_01_07_425723	56	2	113	113	CD
10_1101-2021_01_07_425723	56	3	pronounced	pronounce	VBD
10_1101-2021_01_07_425723	56	4	response	response	NN
10_1101-2021_01_07_425723	56	5	of	of	IN
10_1101-2021_01_07_425723	56	6	K.	K.	NNP
10_1101-2021_01_07_425723	56	7	marxianus	marxianus	NN
10_1101-2021_01_07_425723	56	8	to	to	IN
10_1101-2021_01_07_425723	56	9	extreme	extreme	JJ
10_1101-2021_01_07_425723	56	10	oxygen	oxygen	NN
10_1101-2021_01_07_425723	56	11	-	-	HYPH
10_1101-2021_01_07_425723	56	12	limitation	limitation	NN
10_1101-2021_01_07_425723	56	13	provided	provide	VBD
10_1101-2021_01_07_425723	56	14	an	an	DT
10_1101-2021_01_07_425723	56	15	experimental	experimental	JJ
10_1101-2021_01_07_425723	56	16	context	context	NN
10_1101-2021_01_07_425723	56	17	114	114	CD
10_1101-2021_01_07_425723	56	18	for	for	IN
10_1101-2021_01_07_425723	56	19	further	further	RB
10_1101-2021_01_07_425723	56	20	analyzing	analyze	VBG
10_1101-2021_01_07_425723	56	21	its	-PRON-	PRP$
10_1101-2021_01_07_425723	56	22	unknown	unknown	JJ
10_1101-2021_01_07_425723	56	23	oxygen	oxygen	NN
10_1101-2021_01_07_425723	56	24	requirements	requirement	NNS
10_1101-2021_01_07_425723	56	25	.	.	.
10_1101-2021_01_07_425723	57	1	115	115	CD
10_1101-2021_01_07_425723	57	2	S.	S.	NNP
10_1101-2021_01_07_425723	57	3	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	57	4	can	can	MD
10_1101-2021_01_07_425723	57	5	import	import	VB
10_1101-2021_01_07_425723	57	6	exogenous	exogenous	JJ
10_1101-2021_01_07_425723	57	7	sterols	sterol	NNS
10_1101-2021_01_07_425723	57	8	under	under	IN
10_1101-2021_01_07_425723	57	9	severely	severely	RB
10_1101-2021_01_07_425723	57	10	oxygen	oxygen	NN
10_1101-2021_01_07_425723	57	11	-	-	HYPH
10_1101-2021_01_07_425723	57	12	limited	limit	VBN
10_1101-2021_01_07_425723	57	13	or	or	CC
10_1101-2021_01_07_425723	57	14	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	57	15	conditions20	conditions20	NNP
10_1101-2021_01_07_425723	57	16	.	.	.
10_1101-2021_01_07_425723	58	1	If	if	IN
10_1101-2021_01_07_425723	58	2	116	116	CD
10_1101-2021_01_07_425723	58	3	the	the	DT
10_1101-2021_01_07_425723	58	4	latter	latter	JJ
10_1101-2021_01_07_425723	58	5	were	be	VBD
10_1101-2021_01_07_425723	58	6	also	also	RB
10_1101-2021_01_07_425723	58	7	true	true	JJ
10_1101-2021_01_07_425723	58	8	for	for	IN
10_1101-2021_01_07_425723	58	9	K.	K.	NNP
10_1101-2021_01_07_425723	58	10	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	58	11	,	,	,
10_1101-2021_01_07_425723	58	12	omission	omission	NN
10_1101-2021_01_07_425723	58	13	of	of	IN
10_1101-2021_01_07_425723	58	14	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	58	15	from	from	IN
10_1101-2021_01_07_425723	58	16	the	the	DT
10_1101-2021_01_07_425723	58	17	growth	growth	NN
10_1101-2021_01_07_425723	58	18	medium	medium	NN
10_1101-2021_01_07_425723	58	19	of	of	IN
10_1101-2021_01_07_425723	58	20	severely	severely	RB
10_1101-2021_01_07_425723	58	21	117	117	CD
10_1101-2021_01_07_425723	58	22	oxygen	oxygen	NN
10_1101-2021_01_07_425723	58	23	-	-	HYPH
10_1101-2021_01_07_425723	58	24	limited	limit	VBN
10_1101-2021_01_07_425723	58	25	cultures	culture	NNS
10_1101-2021_01_07_425723	58	26	would	would	MD
10_1101-2021_01_07_425723	58	27	increase	increase	VB
10_1101-2021_01_07_425723	58	28	biomass	biomass	NN
10_1101-2021_01_07_425723	58	29	-	-	HYPH
10_1101-2021_01_07_425723	58	30	specific	specific	JJ
10_1101-2021_01_07_425723	58	31	oxygen	oxygen	NN
10_1101-2021_01_07_425723	58	32	requirements	requirement	NNS
10_1101-2021_01_07_425723	58	33	and	and	CC
10_1101-2021_01_07_425723	58	34	lead	lead	VBP
10_1101-2021_01_07_425723	58	35	to	to	IN
10_1101-2021_01_07_425723	58	36	an	an	DT
10_1101-2021_01_07_425723	58	37	even	even	RB
10_1101-2021_01_07_425723	58	38	lower	low	JJR
10_1101-2021_01_07_425723	58	39	118	118	CD
10_1101-2021_01_07_425723	58	40	biomass	biomass	NN
10_1101-2021_01_07_425723	58	41	concentration	concentration	NN
10_1101-2021_01_07_425723	58	42	.	.	.
10_1101-2021_01_07_425723	59	1	In	in	IN
10_1101-2021_01_07_425723	59	2	practice	practice	NN
10_1101-2021_01_07_425723	59	3	however	however	RB
10_1101-2021_01_07_425723	59	4	,	,	,
10_1101-2021_01_07_425723	59	5	omission	omission	NN
10_1101-2021_01_07_425723	59	6	of	of	IN
10_1101-2021_01_07_425723	59	7	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	59	8	led	lead	VBD
10_1101-2021_01_07_425723	59	9	to	to	IN
10_1101-2021_01_07_425723	59	10	a	a	DT
10_1101-2021_01_07_425723	59	11	small	small	JJ
10_1101-2021_01_07_425723	59	12	increase	increase	NN
10_1101-2021_01_07_425723	59	13	of	of	IN
10_1101-2021_01_07_425723	59	14	the	the	DT
10_1101-2021_01_07_425723	59	15	119	119	CD
10_1101-2021_01_07_425723	59	16	biomass	biomass	NN
10_1101-2021_01_07_425723	59	17	concentration	concentration	NN
10_1101-2021_01_07_425723	59	18	and	and	CC
10_1101-2021_01_07_425723	59	19	a	a	DT
10_1101-2021_01_07_425723	59	20	corresponding	correspond	VBG
10_1101-2021_01_07_425723	59	21	decrease	decrease	NN
10_1101-2021_01_07_425723	59	22	of	of	IN
10_1101-2021_01_07_425723	59	23	the	the	DT
10_1101-2021_01_07_425723	59	24	residual	residual	JJ
10_1101-2021_01_07_425723	59	25	glucose	glucose	NNP
10_1101-2021_01_07_425723	59	26	concentration	concentration	NN
10_1101-2021_01_07_425723	59	27	in	in	IN
10_1101-2021_01_07_425723	59	28	severely	severely	RB
10_1101-2021_01_07_425723	59	29	120	120	CD
10_1101-2021_01_07_425723	59	30	oxygen	oxygen	NN
10_1101-2021_01_07_425723	59	31	-	-	HYPH
10_1101-2021_01_07_425723	59	32	limited	limit	VBN
10_1101-2021_01_07_425723	59	33	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	59	34	cultures	culture	NNS
10_1101-2021_01_07_425723	59	35	(	(	-LRB-
10_1101-2021_01_07_425723	59	36	Fig	fig	NN
10_1101-2021_01_07_425723	59	37	.	.	.
10_1101-2021_01_07_425723	60	1	1b	1b	NNP
10_1101-2021_01_07_425723	60	2	,	,	,
10_1101-2021_01_07_425723	60	3	Table	Table	NNP
10_1101-2021_01_07_425723	60	4	1	1	CD
10_1101-2021_01_07_425723	60	5	)	)	-RRB-
10_1101-2021_01_07_425723	60	6	.	.	.
10_1101-2021_01_07_425723	61	1	This	this	DT
10_1101-2021_01_07_425723	61	2	observation	observation	NN
10_1101-2021_01_07_425723	61	3	suggested	suggest	VBD
10_1101-2021_01_07_425723	61	4	that	that	IN
10_1101-2021_01_07_425723	61	5	,	,	,
10_1101-2021_01_07_425723	61	6	in	in	IN
10_1101-2021_01_07_425723	61	7	contrast	contrast	NN
10_1101-2021_01_07_425723	61	8	to	to	IN
10_1101-2021_01_07_425723	61	9	S.	S.	NNP
10_1101-2021_01_07_425723	61	10	121	121	CD
10_1101-2021_01_07_425723	61	11	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	61	12	,	,	,
10_1101-2021_01_07_425723	61	13	K.	K.	NNP
10_1101-2021_01_07_425723	61	14	marxianus	marxianus	NN
10_1101-2021_01_07_425723	61	15	can	can	MD
10_1101-2021_01_07_425723	61	16	not	not	RB
10_1101-2021_01_07_425723	61	17	replace	replace	VB
10_1101-2021_01_07_425723	61	18	de	de	FW
10_1101-2021_01_07_425723	61	19	novo	novo	NNP
10_1101-2021_01_07_425723	61	20	oxygen	oxygen	NN
10_1101-2021_01_07_425723	61	21	-	-	HYPH
10_1101-2021_01_07_425723	61	22	dependent	dependent	JJ
10_1101-2021_01_07_425723	61	23	sterol	sterol	JJ
10_1101-2021_01_07_425723	61	24	synthesis	synthesis	NN
10_1101-2021_01_07_425723	61	25	by	by	IN
10_1101-2021_01_07_425723	61	26	uptake	uptake	NN
10_1101-2021_01_07_425723	61	27	of	of	IN
10_1101-2021_01_07_425723	61	28	122	122	CD
10_1101-2021_01_07_425723	61	29	exogenous	exogenous	JJ
10_1101-2021_01_07_425723	61	30	sterols	sterol	NNS
10_1101-2021_01_07_425723	61	31	.	.	.
10_1101-2021_01_07_425723	62	1	123	123	CD
10_1101-2021_01_07_425723	62	2	.CC	.CC	:
10_1101-2021_01_07_425723	62	3	-	-	HYPH
10_1101-2021_01_07_425723	62	4	BY	by	IN
10_1101-2021_01_07_425723	62	5	-	-	HYPH
10_1101-2021_01_07_425723	62	6	NC	NC	NNP
10_1101-2021_01_07_425723	62	7	-	-	HYPH
10_1101-2021_01_07_425723	62	8	ND	ND	NNP
10_1101-2021_01_07_425723	62	9	4.0	4.0	CD
10_1101-2021_01_07_425723	62	10	International	International	NNP
10_1101-2021_01_07_425723	62	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	62	12	under	under	IN
10_1101-2021_01_07_425723	62	13	a	a	DT
10_1101-2021_01_07_425723	62	14	(	(	-LRB-
10_1101-2021_01_07_425723	62	15	which	which	WDT
10_1101-2021_01_07_425723	62	16	was	be	VBD
10_1101-2021_01_07_425723	62	17	not	not	RB
10_1101-2021_01_07_425723	62	18	certified	certify	VBN
10_1101-2021_01_07_425723	62	19	by	by	IN
10_1101-2021_01_07_425723	62	20	peer	peer	NN
10_1101-2021_01_07_425723	62	21	review	review	NN
10_1101-2021_01_07_425723	62	22	)	)	-RRB-
10_1101-2021_01_07_425723	62	23	is	be	VBZ
10_1101-2021_01_07_425723	62	24	the	the	DT
10_1101-2021_01_07_425723	62	25	author	author	NN
10_1101-2021_01_07_425723	62	26	/	/	SYM
10_1101-2021_01_07_425723	62	27	funder	funder	NN
10_1101-2021_01_07_425723	62	28	,	,	,
10_1101-2021_01_07_425723	62	29	who	who	WP
10_1101-2021_01_07_425723	62	30	has	have	VBZ
10_1101-2021_01_07_425723	62	31	granted	grant	VBN
10_1101-2021_01_07_425723	62	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	62	33	a	a	DT
10_1101-2021_01_07_425723	62	34	license	license	NN
10_1101-2021_01_07_425723	62	35	to	to	TO
10_1101-2021_01_07_425723	62	36	display	display	VB
10_1101-2021_01_07_425723	62	37	the	the	DT
10_1101-2021_01_07_425723	62	38	preprint	preprint	NN
10_1101-2021_01_07_425723	62	39	in	in	IN
10_1101-2021_01_07_425723	62	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	62	41	.	.	.
10_1101-2021_01_07_425723	63	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	63	2	is	be	VBZ
10_1101-2021_01_07_425723	63	3	made	make	VBN
10_1101-2021_01_07_425723	63	4	The	the	DT
10_1101-2021_01_07_425723	63	5	copyright	copyright	NN
10_1101-2021_01_07_425723	63	6	holder	holder	NN
10_1101-2021_01_07_425723	63	7	for	for	IN
10_1101-2021_01_07_425723	63	8	this	this	DT
10_1101-2021_01_07_425723	63	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	63	10	version	version	NN
10_1101-2021_01_07_425723	63	11	posted	post	VBD
10_1101-2021_01_07_425723	63	12	January	January	NNP
10_1101-2021_01_07_425723	63	13	8	8	CD
10_1101-2021_01_07_425723	63	14	,	,	,
10_1101-2021_01_07_425723	63	15	2021	2021	CD
10_1101-2021_01_07_425723	63	16	.	.	.
10_1101-2021_01_07_425723	63	17	;	;	:
10_1101-2021_01_07_425723	63	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	63	19	:	:	:
10_1101-2021_01_07_425723	63	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	63	21	preprint	preprint	NN
10_1101-2021_01_07_425723	63	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	63	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	63	24	7	7	CD
10_1101-2021_01_07_425723	63	25	Fig	Fig	NNP
10_1101-2021_01_07_425723	63	26	.	.	.
10_1101-2021_01_07_425723	64	1	1	1	CD
10_1101-2021_01_07_425723	64	2	|	|	JJ
10_1101-2021_01_07_425723	64	3	Chemostat	chemostat	JJ
10_1101-2021_01_07_425723	64	4	cultivation	cultivation	NN
10_1101-2021_01_07_425723	64	5	of	of	IN
10_1101-2021_01_07_425723	64	6	S.	S.	NNP
10_1101-2021_01_07_425723	64	7	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	64	8	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	64	9	-	-	HYPH
10_1101-2021_01_07_425723	64	10	7D	7D	NNP
10_1101-2021_01_07_425723	64	11	and	and	CC
10_1101-2021_01_07_425723	64	12	K.	K.	NNP
10_1101-2021_01_07_425723	64	13	marxianus	marxianus	NN
10_1101-2021_01_07_425723	64	14	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	64	15	under	under	IN
10_1101-2021_01_07_425723	64	16	124	124	CD
10_1101-2021_01_07_425723	64	17	different	different	JJ
10_1101-2021_01_07_425723	64	18	aeration	aeration	NN
10_1101-2021_01_07_425723	64	19	and	and	CC
10_1101-2021_01_07_425723	64	20	anaerobic	anaerobic	NN
10_1101-2021_01_07_425723	64	21	-	-	HYPH
10_1101-2021_01_07_425723	64	22	growth	growth	NN
10_1101-2021_01_07_425723	64	23	-	-	HYPH
10_1101-2021_01_07_425723	64	24	factor	factor	NN
10_1101-2021_01_07_425723	64	25	(	(	-LRB-
10_1101-2021_01_07_425723	64	26	AGF	AGF	NNP
10_1101-2021_01_07_425723	64	27	)	)	-RRB-
10_1101-2021_01_07_425723	64	28	supplementation	supplementation	NN
10_1101-2021_01_07_425723	64	29	regimes	regime	NNS
10_1101-2021_01_07_425723	64	30	.	.	.
10_1101-2021_01_07_425723	65	1	The	the	DT
10_1101-2021_01_07_425723	65	2	ingoing	ingoing	JJ
10_1101-2021_01_07_425723	65	3	gas	gas	NN
10_1101-2021_01_07_425723	65	4	flow	flow	NN
10_1101-2021_01_07_425723	65	5	125	125	CD
10_1101-2021_01_07_425723	65	6	of	of	IN
10_1101-2021_01_07_425723	65	7	all	all	DT
10_1101-2021_01_07_425723	65	8	cultures	culture	NNS
10_1101-2021_01_07_425723	65	9	was	be	VBD
10_1101-2021_01_07_425723	65	10	500	500	CD
10_1101-2021_01_07_425723	65	11	mL·min-1	mL·min-1	NNS
10_1101-2021_01_07_425723	65	12	,	,	,
10_1101-2021_01_07_425723	65	13	with	with	IN
10_1101-2021_01_07_425723	65	14	oxygen	oxygen	NN
10_1101-2021_01_07_425723	65	15	partial	partial	JJ
10_1101-2021_01_07_425723	65	16	pressures	pressure	NNS
10_1101-2021_01_07_425723	65	17	of	of	IN
10_1101-2021_01_07_425723	65	18	21·104	21·104	CD
10_1101-2021_01_07_425723	65	19	ppm	ppm	NNP
10_1101-2021_01_07_425723	65	20	(	(	-LRB-
10_1101-2021_01_07_425723	65	21	O21·104	o21·104	CD
10_1101-2021_01_07_425723	65	22	)	)	-RRB-
10_1101-2021_01_07_425723	65	23	,	,	,
10_1101-2021_01_07_425723	65	24	840	840	CD
10_1101-2021_01_07_425723	65	25	ppm	ppm	NN
10_1101-2021_01_07_425723	65	26	126	126	CD
10_1101-2021_01_07_425723	65	27	(	(	-LRB-
10_1101-2021_01_07_425723	65	28	O840	O840	NNP
10_1101-2021_01_07_425723	65	29	)	)	-RRB-
10_1101-2021_01_07_425723	65	30	,	,	,
10_1101-2021_01_07_425723	65	31	or	or	CC
10_1101-2021_01_07_425723	65	32	<	<	XX
10_1101-2021_01_07_425723	65	33	0.5	0.5	CD
10_1101-2021_01_07_425723	65	34	ppm	ppm	NN
10_1101-2021_01_07_425723	65	35	(	(	-LRB-
10_1101-2021_01_07_425723	65	36	O0.5	O0.5	NNP
10_1101-2021_01_07_425723	65	37	)	)	-RRB-
10_1101-2021_01_07_425723	65	38	.	.	.
10_1101-2021_01_07_425723	66	1	The	the	DT
10_1101-2021_01_07_425723	66	2	AGFs	agf	NNS
10_1101-2021_01_07_425723	66	3	Ergosterol	ergosterol	VBP
10_1101-2021_01_07_425723	66	4	(	(	-LRB-
10_1101-2021_01_07_425723	66	5	E	e	NN
10_1101-2021_01_07_425723	66	6	)	)	-RRB-
10_1101-2021_01_07_425723	66	7	and/or	and/or	CC
10_1101-2021_01_07_425723	66	8	Tween	tween	NN
10_1101-2021_01_07_425723	66	9	80	80	CD
10_1101-2021_01_07_425723	66	10	(	(	-LRB-
10_1101-2021_01_07_425723	66	11	T	t	NN
10_1101-2021_01_07_425723	66	12	)	)	-RRB-
10_1101-2021_01_07_425723	66	13	were	be	VBD
10_1101-2021_01_07_425723	66	14	added	add	VBN
10_1101-2021_01_07_425723	66	15	to	to	IN
10_1101-2021_01_07_425723	66	16	media	medium	NNS
10_1101-2021_01_07_425723	66	17	as	as	IN
10_1101-2021_01_07_425723	66	18	127	127	CD
10_1101-2021_01_07_425723	66	19	indicated	indicate	VBD
10_1101-2021_01_07_425723	66	20	.	.	.
10_1101-2021_01_07_425723	67	1	a	a	DT
10_1101-2021_01_07_425723	67	2	,	,	,
10_1101-2021_01_07_425723	67	3	Schematic	schematic	JJ
10_1101-2021_01_07_425723	67	4	representation	representation	NN
10_1101-2021_01_07_425723	67	5	of	of	IN
10_1101-2021_01_07_425723	67	6	experimental	experimental	JJ
10_1101-2021_01_07_425723	67	7	set	set	NN
10_1101-2021_01_07_425723	67	8	-	-	HYPH
10_1101-2021_01_07_425723	67	9	up	up	RP
10_1101-2021_01_07_425723	67	10	.	.	.
10_1101-2021_01_07_425723	68	1	Data	datum	NNS
10_1101-2021_01_07_425723	68	2	for	for	IN
10_1101-2021_01_07_425723	68	3	each	each	DT
10_1101-2021_01_07_425723	68	4	cultivation	cultivation	NN
10_1101-2021_01_07_425723	68	5	regime	regime	NN
10_1101-2021_01_07_425723	68	6	were	be	VBD
10_1101-2021_01_07_425723	68	7	128	128	CD
10_1101-2021_01_07_425723	68	8	obtained	obtain	VBN
10_1101-2021_01_07_425723	68	9	from	from	IN
10_1101-2021_01_07_425723	68	10	independent	independent	JJ
10_1101-2021_01_07_425723	68	11	replicate	replicate	NN
10_1101-2021_01_07_425723	68	12	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	68	13	cultures	culture	NNS
10_1101-2021_01_07_425723	68	14	.	.	.
10_1101-2021_01_07_425723	69	1	b	b	LS
10_1101-2021_01_07_425723	69	2	,	,	,
10_1101-2021_01_07_425723	69	3	Residual	residual	JJ
10_1101-2021_01_07_425723	69	4	glucose	glucose	NN
10_1101-2021_01_07_425723	69	5	concentrations	concentration	NNS
10_1101-2021_01_07_425723	69	6	and	and	CC
10_1101-2021_01_07_425723	69	7	129	129	CD
10_1101-2021_01_07_425723	69	8	.CC	.CC	,
10_1101-2021_01_07_425723	69	9	-	-	HYPH
10_1101-2021_01_07_425723	69	10	BY	by	IN
10_1101-2021_01_07_425723	69	11	-	-	HYPH
10_1101-2021_01_07_425723	69	12	NC	NC	NNP
10_1101-2021_01_07_425723	69	13	-	-	HYPH
10_1101-2021_01_07_425723	69	14	ND	ND	NNP
10_1101-2021_01_07_425723	69	15	4.0	4.0	CD
10_1101-2021_01_07_425723	69	16	International	International	NNP
10_1101-2021_01_07_425723	69	17	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	69	18	under	under	IN
10_1101-2021_01_07_425723	69	19	a	a	DT
10_1101-2021_01_07_425723	69	20	(	(	-LRB-
10_1101-2021_01_07_425723	69	21	which	which	WDT
10_1101-2021_01_07_425723	69	22	was	be	VBD
10_1101-2021_01_07_425723	69	23	not	not	RB
10_1101-2021_01_07_425723	69	24	certified	certify	VBN
10_1101-2021_01_07_425723	69	25	by	by	IN
10_1101-2021_01_07_425723	69	26	peer	peer	NN
10_1101-2021_01_07_425723	69	27	review	review	NN
10_1101-2021_01_07_425723	69	28	)	)	-RRB-
10_1101-2021_01_07_425723	69	29	is	be	VBZ
10_1101-2021_01_07_425723	69	30	the	the	DT
10_1101-2021_01_07_425723	69	31	author	author	NN
10_1101-2021_01_07_425723	69	32	/	/	SYM
10_1101-2021_01_07_425723	69	33	funder	funder	NN
10_1101-2021_01_07_425723	69	34	,	,	,
10_1101-2021_01_07_425723	69	35	who	who	WP
10_1101-2021_01_07_425723	69	36	has	have	VBZ
10_1101-2021_01_07_425723	69	37	granted	grant	VBN
10_1101-2021_01_07_425723	69	38	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	69	39	a	a	DT
10_1101-2021_01_07_425723	69	40	license	license	NN
10_1101-2021_01_07_425723	69	41	to	to	TO
10_1101-2021_01_07_425723	69	42	display	display	VB
10_1101-2021_01_07_425723	69	43	the	the	DT
10_1101-2021_01_07_425723	69	44	preprint	preprint	NN
10_1101-2021_01_07_425723	69	45	in	in	IN
10_1101-2021_01_07_425723	69	46	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	69	47	.	.	.
10_1101-2021_01_07_425723	70	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	70	2	is	be	VBZ
10_1101-2021_01_07_425723	70	3	made	make	VBN
10_1101-2021_01_07_425723	70	4	The	the	DT
10_1101-2021_01_07_425723	70	5	copyright	copyright	NN
10_1101-2021_01_07_425723	70	6	holder	holder	NN
10_1101-2021_01_07_425723	70	7	for	for	IN
10_1101-2021_01_07_425723	70	8	this	this	DT
10_1101-2021_01_07_425723	70	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	70	10	version	version	NN
10_1101-2021_01_07_425723	70	11	posted	post	VBD
10_1101-2021_01_07_425723	70	12	January	January	NNP
10_1101-2021_01_07_425723	70	13	8	8	CD
10_1101-2021_01_07_425723	70	14	,	,	,
10_1101-2021_01_07_425723	70	15	2021	2021	CD
10_1101-2021_01_07_425723	70	16	.	.	.
10_1101-2021_01_07_425723	70	17	;	;	:
10_1101-2021_01_07_425723	70	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	70	19	:	:	:
10_1101-2021_01_07_425723	70	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	70	21	preprint	preprint	NN
10_1101-2021_01_07_425723	70	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	70	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	70	24	8	8	CD
10_1101-2021_01_07_425723	70	25	biomass	biomass	NN
10_1101-2021_01_07_425723	70	26	-	-	HYPH
10_1101-2021_01_07_425723	70	27	specific	specific	JJ
10_1101-2021_01_07_425723	70	28	oxygen	oxygen	NN
10_1101-2021_01_07_425723	70	29	consumption	consumption	NN
10_1101-2021_01_07_425723	70	30	rates	rate	NNS
10_1101-2021_01_07_425723	70	31	(	(	-LRB-
10_1101-2021_01_07_425723	70	32	qO2	qO2	NNP
10_1101-2021_01_07_425723	70	33	)	)	-RRB-
10_1101-2021_01_07_425723	70	34	under	under	IN
10_1101-2021_01_07_425723	70	35	different	different	JJ
10_1101-2021_01_07_425723	70	36	aeration	aeration	NN
10_1101-2021_01_07_425723	70	37	and	and	CC
10_1101-2021_01_07_425723	70	38	AGF	AGF	NNP
10_1101-2021_01_07_425723	70	39	-	-	HYPH
10_1101-2021_01_07_425723	70	40	supplementation	supplementation	NNP
10_1101-2021_01_07_425723	70	41	130	130	CD
10_1101-2021_01_07_425723	70	42	regimes	regime	NNS
10_1101-2021_01_07_425723	70	43	.	.	.
10_1101-2021_01_07_425723	71	1	Data	datum	NNS
10_1101-2021_01_07_425723	71	2	represent	represent	VBP
10_1101-2021_01_07_425723	71	3	mean	mean	JJ
10_1101-2021_01_07_425723	71	4	and	and	CC
10_1101-2021_01_07_425723	71	5	standard	standard	JJ
10_1101-2021_01_07_425723	71	6	deviation	deviation	NN
10_1101-2021_01_07_425723	71	7	of	of	IN
10_1101-2021_01_07_425723	71	8	independent	independent	JJ
10_1101-2021_01_07_425723	71	9	replicate	replicate	NN
10_1101-2021_01_07_425723	71	10	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	71	11	cultures	culture	NNS
10_1101-2021_01_07_425723	71	12	.	.	.
10_1101-2021_01_07_425723	72	1	c	c	LS
10_1101-2021_01_07_425723	72	2	,	,	,
10_1101-2021_01_07_425723	72	3	131	131	CD
10_1101-2021_01_07_425723	72	4	Distribution	distribution	NN
10_1101-2021_01_07_425723	72	5	of	of	IN
10_1101-2021_01_07_425723	72	6	consumed	consume	VBN
10_1101-2021_01_07_425723	72	7	glucose	glucose	NN
10_1101-2021_01_07_425723	72	8	over	over	IN
10_1101-2021_01_07_425723	72	9	biomass	biomass	NN
10_1101-2021_01_07_425723	72	10	and	and	CC
10_1101-2021_01_07_425723	72	11	products	product	NNS
10_1101-2021_01_07_425723	72	12	in	in	IN
10_1101-2021_01_07_425723	72	13	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	72	14	cultures	culture	NNS
10_1101-2021_01_07_425723	72	15	of	of	IN
10_1101-2021_01_07_425723	72	16	S.	S.	NNP
10_1101-2021_01_07_425723	72	17	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	72	18	(	(	-LRB-
10_1101-2021_01_07_425723	72	19	left	left	RB
10_1101-2021_01_07_425723	72	20	132	132	CD
10_1101-2021_01_07_425723	72	21	column	column	NN
10_1101-2021_01_07_425723	72	22	)	)	-RRB-
10_1101-2021_01_07_425723	72	23	and	and	CC
10_1101-2021_01_07_425723	72	24	K.	K.	NNP
10_1101-2021_01_07_425723	72	25	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	72	26	(	(	-LRB-
10_1101-2021_01_07_425723	72	27	right	right	JJ
10_1101-2021_01_07_425723	72	28	column	column	NN
10_1101-2021_01_07_425723	72	29	)	)	-RRB-
10_1101-2021_01_07_425723	72	30	,	,	,
10_1101-2021_01_07_425723	72	31	normalized	normalize	VBD
10_1101-2021_01_07_425723	72	32	to	to	IN
10_1101-2021_01_07_425723	72	33	a	a	DT
10_1101-2021_01_07_425723	72	34	glucose	glucose	NN
10_1101-2021_01_07_425723	72	35	uptake	uptake	JJ
10_1101-2021_01_07_425723	72	36	rate	rate	NN
10_1101-2021_01_07_425723	72	37	of	of	IN
10_1101-2021_01_07_425723	72	38	1.00	1.00	CD
10_1101-2021_01_07_425723	72	39	mol·h-1	mol·h-1	NNS
10_1101-2021_01_07_425723	72	40	.	.	.
10_1101-2021_01_07_425723	73	1	Numbers	number	NNS
10_1101-2021_01_07_425723	73	2	133	133	CD
10_1101-2021_01_07_425723	73	3	in	in	IN
10_1101-2021_01_07_425723	73	4	boxes	box	NNS
10_1101-2021_01_07_425723	73	5	indicate	indicate	VBP
10_1101-2021_01_07_425723	73	6	averages	average	NNS
10_1101-2021_01_07_425723	73	7	of	of	IN
10_1101-2021_01_07_425723	73	8	measured	measured	JJ
10_1101-2021_01_07_425723	73	9	metabolite	metabolite	JJ
10_1101-2021_01_07_425723	73	10	formation	formation	NN
10_1101-2021_01_07_425723	73	11	rates	rate	NNS
10_1101-2021_01_07_425723	73	12	(	(	-LRB-
10_1101-2021_01_07_425723	73	13	mol·h-1	mol·h-1	NNP
10_1101-2021_01_07_425723	73	14	)	)	-RRB-
10_1101-2021_01_07_425723	73	15	and	and	CC
10_1101-2021_01_07_425723	73	16	biomass	biomass	NN
10_1101-2021_01_07_425723	73	17	production	production	NN
10_1101-2021_01_07_425723	73	18	134	134	CD
10_1101-2021_01_07_425723	73	19	rates	rate	NNS
10_1101-2021_01_07_425723	73	20	(	(	-LRB-
10_1101-2021_01_07_425723	73	21	g	g	NNP
10_1101-2021_01_07_425723	73	22	dry	dry	JJ
10_1101-2021_01_07_425723	73	23	weight·h-1	weight·h-1	NNP
10_1101-2021_01_07_425723	73	24	)	)	-RRB-
10_1101-2021_01_07_425723	73	25	for	for	IN
10_1101-2021_01_07_425723	73	26	each	each	DT
10_1101-2021_01_07_425723	73	27	aeration	aeration	NN
10_1101-2021_01_07_425723	73	28	and	and	CC
10_1101-2021_01_07_425723	73	29	AGF	AGF	NNP
10_1101-2021_01_07_425723	73	30	supplementation	supplementation	NN
10_1101-2021_01_07_425723	73	31	regime	regime	NN
10_1101-2021_01_07_425723	73	32	.	.	.
10_1101-2021_01_07_425723	74	1	135	135	CD
10_1101-2021_01_07_425723	74	2	Table	table	NN
10_1101-2021_01_07_425723	74	3	1	1	CD
10_1101-2021_01_07_425723	74	4	|	|	NNP
10_1101-2021_01_07_425723	74	5	Physiology	Physiology	NNP
10_1101-2021_01_07_425723	74	6	of	of	IN
10_1101-2021_01_07_425723	74	7	S.	S.	NNP
10_1101-2021_01_07_425723	74	8	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	74	9	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	74	10	-	-	HYPH
10_1101-2021_01_07_425723	74	11	7D	7D	NNP
10_1101-2021_01_07_425723	74	12	and	and	CC
10_1101-2021_01_07_425723	74	13	K.	K.	NNP
10_1101-2021_01_07_425723	74	14	marxianus	marxianus	NN
10_1101-2021_01_07_425723	74	15	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	74	16	in	in	IN
10_1101-2021_01_07_425723	74	17	glucose	glucose	NN
10_1101-2021_01_07_425723	74	18	-	-	HYPH
10_1101-2021_01_07_425723	74	19	grown	grow	VBN
10_1101-2021_01_07_425723	74	20	136	136	CD
10_1101-2021_01_07_425723	74	21	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	74	22	cultures	culture	NNS
10_1101-2021_01_07_425723	74	23	with	with	IN
10_1101-2021_01_07_425723	74	24	different	different	JJ
10_1101-2021_01_07_425723	74	25	aeration	aeration	NN
10_1101-2021_01_07_425723	74	26	and	and	CC
10_1101-2021_01_07_425723	74	27	anaerobic	anaerobic	NN
10_1101-2021_01_07_425723	74	28	-	-	HYPH
10_1101-2021_01_07_425723	74	29	growth	growth	NN
10_1101-2021_01_07_425723	74	30	-	-	HYPH
10_1101-2021_01_07_425723	74	31	factor	factor	NN
10_1101-2021_01_07_425723	74	32	(	(	-LRB-
10_1101-2021_01_07_425723	74	33	AGF	AGF	NNP
10_1101-2021_01_07_425723	74	34	)	)	-RRB-
10_1101-2021_01_07_425723	74	35	supplementation	supplementation	NN
10_1101-2021_01_07_425723	74	36	137	137	CD
10_1101-2021_01_07_425723	74	37	regimes	regime	NNS
10_1101-2021_01_07_425723	74	38	.	.	.
10_1101-2021_01_07_425723	75	1	Cultures	culture	NNS
10_1101-2021_01_07_425723	75	2	were	be	VBD
10_1101-2021_01_07_425723	75	3	grown	grow	VBN
10_1101-2021_01_07_425723	75	4	at	at	IN
10_1101-2021_01_07_425723	75	5	pH	pH	NNP
10_1101-2021_01_07_425723	75	6	6.0	6.0	CD
10_1101-2021_01_07_425723	75	7	on	on	IN
10_1101-2021_01_07_425723	75	8	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	75	9	medium	medium	NN
10_1101-2021_01_07_425723	75	10	with	with	IN
10_1101-2021_01_07_425723	75	11	urea	urea	NNP
10_1101-2021_01_07_425723	75	12	as	as	IN
10_1101-2021_01_07_425723	75	13	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	75	14	source	source	NN
10_1101-2021_01_07_425723	75	15	and	and	CC
10_1101-2021_01_07_425723	75	16	7.5	7.5	CD
10_1101-2021_01_07_425723	75	17	g·L-1	g·L-1	NNP
10_1101-2021_01_07_425723	75	18	138	138	CD
10_1101-2021_01_07_425723	75	19	glucose	glucose	NN
10_1101-2021_01_07_425723	75	20	(	(	-LRB-
10_1101-2021_01_07_425723	75	21	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	75	22	cultures	culture	NNS
10_1101-2021_01_07_425723	75	23	)	)	-RRB-
10_1101-2021_01_07_425723	75	24	or	or	CC
10_1101-2021_01_07_425723	75	25	20	20	CD
10_1101-2021_01_07_425723	75	26	g·L-1	g·l-1	CD
10_1101-2021_01_07_425723	75	27	glucose	glucose	NN
10_1101-2021_01_07_425723	75	28	(	(	-LRB-
10_1101-2021_01_07_425723	75	29	oxygen	oxygen	NN
10_1101-2021_01_07_425723	75	30	-	-	HYPH
10_1101-2021_01_07_425723	75	31	limited	limit	VBN
10_1101-2021_01_07_425723	75	32	cultures	culture	NNS
10_1101-2021_01_07_425723	75	33	)	)	-RRB-
10_1101-2021_01_07_425723	75	34	as	as	IN
10_1101-2021_01_07_425723	75	35	carbon	carbon	NN
10_1101-2021_01_07_425723	75	36	and	and	CC
10_1101-2021_01_07_425723	75	37	energy	energy	NN
10_1101-2021_01_07_425723	75	38	source	source	NN
10_1101-2021_01_07_425723	75	39	.	.	.
10_1101-2021_01_07_425723	76	1	139	139	CD
10_1101-2021_01_07_425723	76	2	Data	datum	NNS
10_1101-2021_01_07_425723	76	3	are	be	VBP
10_1101-2021_01_07_425723	76	4	represented	represent	VBN
10_1101-2021_01_07_425723	76	5	as	as	IN
10_1101-2021_01_07_425723	76	6	mean	mean	NNP
10_1101-2021_01_07_425723	76	7	±	±	NNP
10_1101-2021_01_07_425723	76	8	SE	SE	NNP
10_1101-2021_01_07_425723	76	9	of	of	IN
10_1101-2021_01_07_425723	76	10	data	datum	NNS
10_1101-2021_01_07_425723	76	11	from	from	IN
10_1101-2021_01_07_425723	76	12	independent	independent	JJ
10_1101-2021_01_07_425723	76	13	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	76	14	cultures	culture	NNS
10_1101-2021_01_07_425723	76	15	for	for	IN
10_1101-2021_01_07_425723	76	16	each	each	DT
10_1101-2021_01_07_425723	76	17	condition	condition	NN
10_1101-2021_01_07_425723	76	18	.	.	.
10_1101-2021_01_07_425723	77	1	140	140	CD
10_1101-2021_01_07_425723	77	2	The	the	DT
10_1101-2021_01_07_425723	77	3	AGFs	agf	NNS
10_1101-2021_01_07_425723	77	4	ergosterol	ergosterol	VBP
10_1101-2021_01_07_425723	77	5	(	(	-LRB-
10_1101-2021_01_07_425723	77	6	E	e	NN
10_1101-2021_01_07_425723	77	7	)	)	-RRB-
10_1101-2021_01_07_425723	77	8	and	and	CC
10_1101-2021_01_07_425723	77	9	Tween	tween	NN
10_1101-2021_01_07_425723	77	10	80	80	CD
10_1101-2021_01_07_425723	77	11	(	(	-LRB-
10_1101-2021_01_07_425723	77	12	T	t	NN
10_1101-2021_01_07_425723	77	13	)	)	-RRB-
10_1101-2021_01_07_425723	77	14	were	be	VBD
10_1101-2021_01_07_425723	77	15	added	add	VBN
10_1101-2021_01_07_425723	77	16	to	to	IN
10_1101-2021_01_07_425723	77	17	the	the	DT
10_1101-2021_01_07_425723	77	18	media	medium	NNS
10_1101-2021_01_07_425723	77	19	as	as	IN
10_1101-2021_01_07_425723	77	20	indicated	indicate	VBN
10_1101-2021_01_07_425723	77	21	.	.	.
10_1101-2021_01_07_425723	78	1	Cultures	culture	NNS
10_1101-2021_01_07_425723	78	2	were	be	VBD
10_1101-2021_01_07_425723	78	3	aerated	aerate	VBN
10_1101-2021_01_07_425723	78	4	141	141	CD
10_1101-2021_01_07_425723	78	5	at	at	IN
10_1101-2021_01_07_425723	78	6	500	500	CD
10_1101-2021_01_07_425723	78	7	mL·min-1	mL·min-1	NNS
10_1101-2021_01_07_425723	78	8	with	with	IN
10_1101-2021_01_07_425723	78	9	gas	gas	NN
10_1101-2021_01_07_425723	78	10	mixtures	mixture	NNS
10_1101-2021_01_07_425723	78	11	containing	contain	VBG
10_1101-2021_01_07_425723	78	12	21·104	21·104	CD
10_1101-2021_01_07_425723	78	13	ppm	ppm	NNP
10_1101-2021_01_07_425723	78	14	O2	O2	NNP
10_1101-2021_01_07_425723	78	15	(	(	-LRB-
10_1101-2021_01_07_425723	78	16	O21·104	O21·104	NNP
10_1101-2021_01_07_425723	78	17	)	)	-RRB-
10_1101-2021_01_07_425723	78	18	,	,	,
10_1101-2021_01_07_425723	78	19	840	840	CD
10_1101-2021_01_07_425723	78	20	ppm	ppm	NN
10_1101-2021_01_07_425723	78	21	O2	O2	NNP
10_1101-2021_01_07_425723	78	22	(	(	-LRB-
10_1101-2021_01_07_425723	78	23	O840	o840	NN
10_1101-2021_01_07_425723	78	24	)	)	-RRB-
10_1101-2021_01_07_425723	78	25	or	or	CC
10_1101-2021_01_07_425723	78	26	<	<	XX
10_1101-2021_01_07_425723	78	27	0.5	0.5	CD
10_1101-2021_01_07_425723	78	28	ppm	ppm	NN
10_1101-2021_01_07_425723	78	29	142	142	CD
10_1101-2021_01_07_425723	78	30	O2	o2	NN
10_1101-2021_01_07_425723	78	31	(	(	-LRB-
10_1101-2021_01_07_425723	78	32	O0.5	O0.5	NNP
10_1101-2021_01_07_425723	78	33	)	)	-RRB-
10_1101-2021_01_07_425723	78	34	.	.	.
10_1101-2021_01_07_425723	79	1	Tween	tween	NN
10_1101-2021_01_07_425723	79	2	80	80	CD
10_1101-2021_01_07_425723	79	3	was	be	VBD
10_1101-2021_01_07_425723	79	4	omitted	omit	VBN
10_1101-2021_01_07_425723	79	5	from	from	IN
10_1101-2021_01_07_425723	79	6	media	medium	NNS
10_1101-2021_01_07_425723	79	7	used	use	VBN
10_1101-2021_01_07_425723	79	8	for	for	IN
10_1101-2021_01_07_425723	79	9	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	79	10	cultivation	cultivation	NN
10_1101-2021_01_07_425723	79	11	to	to	TO
10_1101-2021_01_07_425723	79	12	prevent	prevent	VB
10_1101-2021_01_07_425723	79	13	excessive	excessive	JJ
10_1101-2021_01_07_425723	79	14	foaming	foaming	NN
10_1101-2021_01_07_425723	79	15	.	.	.
10_1101-2021_01_07_425723	80	1	143	143	CD
10_1101-2021_01_07_425723	80	2	Ethanol	ethanol	NN
10_1101-2021_01_07_425723	80	3	measurements	measurement	NNS
10_1101-2021_01_07_425723	80	4	were	be	VBD
10_1101-2021_01_07_425723	80	5	corrected	correct	VBN
10_1101-2021_01_07_425723	80	6	for	for	IN
10_1101-2021_01_07_425723	80	7	evaporation	evaporation	NN
10_1101-2021_01_07_425723	80	8	(	(	-LRB-
10_1101-2021_01_07_425723	80	9	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	80	10	Fig	Fig	NNP
10_1101-2021_01_07_425723	80	11	.	.	.
10_1101-2021_01_07_425723	81	1	1	1	LS
10_1101-2021_01_07_425723	81	2	)	)	-RRB-
10_1101-2021_01_07_425723	81	3	.	.	.
10_1101-2021_01_07_425723	82	1	Positive	positive	JJ
10_1101-2021_01_07_425723	82	2	and	and	CC
10_1101-2021_01_07_425723	82	3	negative	negative	JJ
10_1101-2021_01_07_425723	82	4	144	144	CD
10_1101-2021_01_07_425723	82	5	biomass	biomass	NN
10_1101-2021_01_07_425723	82	6	-	-	HYPH
10_1101-2021_01_07_425723	82	7	specific	specific	JJ
10_1101-2021_01_07_425723	82	8	conversion	conversion	NN
10_1101-2021_01_07_425723	82	9	rates	rate	NNS
10_1101-2021_01_07_425723	82	10	(	(	-LRB-
10_1101-2021_01_07_425723	82	11	q	q	NNP
10_1101-2021_01_07_425723	82	12	)	)	-RRB-
10_1101-2021_01_07_425723	82	13	represent	represent	VB
10_1101-2021_01_07_425723	82	14	consumption	consumption	NN
10_1101-2021_01_07_425723	82	15	and	and	CC
10_1101-2021_01_07_425723	82	16	production	production	NN
10_1101-2021_01_07_425723	82	17	rates	rate	NNS
10_1101-2021_01_07_425723	82	18	,	,	,
10_1101-2021_01_07_425723	82	19	respectively	respectively	RB
10_1101-2021_01_07_425723	82	20	.	.	.
10_1101-2021_01_07_425723	83	1	145	145	CD
10_1101-2021_01_07_425723	83	2	S.	S.	NNP
10_1101-2021_01_07_425723	83	3	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	83	4	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	83	5	-	-	HYPH
10_1101-2021_01_07_425723	83	6	7D	7D	NNP
10_1101-2021_01_07_425723	83	7	K.	K.	NNP
10_1101-2021_01_07_425723	83	8	marxianus	marxianus	NN
10_1101-2021_01_07_425723	83	9	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	83	10	Condition	Condition	NNP
10_1101-2021_01_07_425723	83	11	1	1	CD
10_1101-2021_01_07_425723	83	12	2	2	CD
10_1101-2021_01_07_425723	83	13	3	3	CD
10_1101-2021_01_07_425723	83	14	4	4	CD
10_1101-2021_01_07_425723	83	15	5	5	CD
10_1101-2021_01_07_425723	83	16	1	1	CD
10_1101-2021_01_07_425723	83	17	2	2	CD
10_1101-2021_01_07_425723	83	18	3	3	CD
10_1101-2021_01_07_425723	83	19	4	4	CD
10_1101-2021_01_07_425723	83	20	Aeration	Aeration	NNP
10_1101-2021_01_07_425723	83	21	regime	regime	NN
10_1101-2021_01_07_425723	83	22	O21·1	o21·1	$
10_1101-2021_01_07_425723	83	23	04	04	CD
10_1101-2021_01_07_425723	83	24	O840	O840	NNP
10_1101-2021_01_07_425723	83	25	O0.5	O0.5	NNP
10_1101-2021_01_07_425723	83	26	O0.5	O0.5	NNP
10_1101-2021_01_07_425723	83	27	O0.5	O0.5	NNP
10_1101-2021_01_07_425723	83	28	O21·1	O21·1	NNP
10_1101-2021_01_07_425723	83	29	04	04	CD
10_1101-2021_01_07_425723	83	30	O840	O840	NNP
10_1101-2021_01_07_425723	83	31	O0.5	O0.5	NNP
10_1101-2021_01_07_425723	83	32	O0.5	O0.5	NNP
10_1101-2021_01_07_425723	83	33	AGF	AGF	NNP
10_1101-2021_01_07_425723	83	34	E	E	NNP
10_1101-2021_01_07_425723	83	35	TE	TE	NNP
10_1101-2021_01_07_425723	83	36	TE	TE	NNP
10_1101-2021_01_07_425723	83	37	T	T	NNP
10_1101-2021_01_07_425723	83	38	-	-	HYPH
10_1101-2021_01_07_425723	83	39	E	E	NNP
10_1101-2021_01_07_425723	83	40	TE	TE	NNP
10_1101-2021_01_07_425723	83	41	TE	TE	NNP
10_1101-2021_01_07_425723	83	42	T	T	NNP
10_1101-2021_01_07_425723	83	43	Replicates	replicate	NNS
10_1101-2021_01_07_425723	83	44	3	3	CD
10_1101-2021_01_07_425723	83	45	3	3	CD
10_1101-2021_01_07_425723	83	46	2	2	CD
10_1101-2021_01_07_425723	83	47	5	5	CD
10_1101-2021_01_07_425723	83	48	2	2	CD
10_1101-2021_01_07_425723	83	49	2	2	CD
10_1101-2021_01_07_425723	83	50	5	5	CD
10_1101-2021_01_07_425723	83	51	2	2	CD
10_1101-2021_01_07_425723	83	52	2	2	CD
10_1101-2021_01_07_425723	83	53	D	d	NN
10_1101-2021_01_07_425723	83	54	(	(	-LRB-
10_1101-2021_01_07_425723	83	55	h-1	h-1	NNP
10_1101-2021_01_07_425723	83	56	)	)	-RRB-
10_1101-2021_01_07_425723	83	57	0.10	0.10	CD
10_1101-2021_01_07_425723	83	58	±	±	CD
10_1101-2021_01_07_425723	83	59	0.00	0.00	CD
10_1101-2021_01_07_425723	83	60	0.10	0.10	CD
10_1101-2021_01_07_425723	83	61	±	±	CD
10_1101-2021_01_07_425723	83	62	0.00	0.00	CD
10_1101-2021_01_07_425723	83	63	0.10	0.10	CD
10_1101-2021_01_07_425723	83	64	±	±	CD
10_1101-2021_01_07_425723	83	65	0.00	0.00	CD
10_1101-2021_01_07_425723	83	66	0.10	0.10	CD
10_1101-2021_01_07_425723	83	67	±	±	CD
10_1101-2021_01_07_425723	83	68	0.00	0.00	CD
10_1101-2021_01_07_425723	83	69	0.10	0.10	CD
10_1101-2021_01_07_425723	83	70	±	±	CD
10_1101-2021_01_07_425723	83	71	0.00	0.00	CD
10_1101-2021_01_07_425723	83	72	0.10	0.10	CD
10_1101-2021_01_07_425723	83	73	±	±	CD
10_1101-2021_01_07_425723	83	74	0.00	0.00	CD
10_1101-2021_01_07_425723	83	75	0.11	0.11	CD
10_1101-2021_01_07_425723	83	76	±	±	CD
10_1101-2021_01_07_425723	83	77	0.01	0.01	CD
10_1101-2021_01_07_425723	83	78	0.12	0.12	CD
10_1101-2021_01_07_425723	83	79	±	±	CD
10_1101-2021_01_07_425723	83	80	0.01	0.01	CD
10_1101-2021_01_07_425723	83	81	0.12	0.12	CD
10_1101-2021_01_07_425723	83	82	±	±	CD
10_1101-2021_01_07_425723	83	83	0.01	0.01	CD
10_1101-2021_01_07_425723	83	84	Biomass	Biomass	NNP
10_1101-2021_01_07_425723	83	85	(	(	-LRB-
10_1101-2021_01_07_425723	83	86	g·L-1	g·L-1	NNP
10_1101-2021_01_07_425723	83	87	)	)	-RRB-
10_1101-2021_01_07_425723	83	88	4.22	4.22	CD
10_1101-2021_01_07_425723	83	89	±	±	CD
10_1101-2021_01_07_425723	83	90	0.06	0.06	CD
10_1101-2021_01_07_425723	83	91	2.29	2.29	CD
10_1101-2021_01_07_425723	83	92	±	±	CD
10_1101-2021_01_07_425723	83	93	0.04	0.04	CD
10_1101-2021_01_07_425723	83	94	1.98	1.98	CD
10_1101-2021_01_07_425723	83	95	±	±	CD
10_1101-2021_01_07_425723	83	96	0.01	0.01	CD
10_1101-2021_01_07_425723	83	97	1.56	1.56	CD
10_1101-2021_01_07_425723	83	98	±	±	CD
10_1101-2021_01_07_425723	83	99	0.03	0.03	CD
10_1101-2021_01_07_425723	83	100	1.12	1.12	CD
10_1101-2021_01_07_425723	83	101	±	±	CD
10_1101-2021_01_07_425723	83	102	0.02	0.02	CD
10_1101-2021_01_07_425723	83	103	3.79	3.79	CD
10_1101-2021_01_07_425723	83	104	±	±	CD
10_1101-2021_01_07_425723	83	105	0.02	0.02	CD
10_1101-2021_01_07_425723	83	106	1.57	1.57	CD
10_1101-2021_01_07_425723	83	107	±	±	CD
10_1101-2021_01_07_425723	83	108	0.10	0.10	CD
10_1101-2021_01_07_425723	83	109	0.35	0.35	CD
10_1101-2021_01_07_425723	83	110	±	±	CD
10_1101-2021_01_07_425723	83	111	0.02	0.02	CD
10_1101-2021_01_07_425723	83	112	0.50	0.50	CD
10_1101-2021_01_07_425723	83	113	±	±	CD
10_1101-2021_01_07_425723	83	114	0.04	0.04	CD
10_1101-2021_01_07_425723	83	115	Residual	residual	JJ
10_1101-2021_01_07_425723	83	116	glucose	glucose	NN
10_1101-2021_01_07_425723	83	117	(	(	-LRB-
10_1101-2021_01_07_425723	83	118	g·L-1	g·l-1	UH
10_1101-2021_01_07_425723	83	119	)	)	-RRB-
10_1101-2021_01_07_425723	83	120	0.00	0.00	CD
10_1101-2021_01_07_425723	83	121	±	±	CD
10_1101-2021_01_07_425723	83	122	0.00	0.00	CD
10_1101-2021_01_07_425723	83	123	0.07	0.07	CD
10_1101-2021_01_07_425723	83	124	±	±	CD
10_1101-2021_01_07_425723	83	125	0.00	0.00	CD
10_1101-2021_01_07_425723	83	126	0.06	0.06	CD
10_1101-2021_01_07_425723	83	127	±	±	CD
10_1101-2021_01_07_425723	83	128	0.02	0.02	CD
10_1101-2021_01_07_425723	83	129	0.23	0.23	CD
10_1101-2021_01_07_425723	83	130	±	±	CD
10_1101-2021_01_07_425723	83	131	0.04	0.04	CD
10_1101-2021_01_07_425723	83	132	1.47	1.47	CD
10_1101-2021_01_07_425723	83	133	±	±	CD
10_1101-2021_01_07_425723	83	134	0.01	0.01	CD
10_1101-2021_01_07_425723	83	135	0.00	0.00	CD
10_1101-2021_01_07_425723	83	136	±	±	CD
10_1101-2021_01_07_425723	83	137	0.00	0.00	CD
10_1101-2021_01_07_425723	83	138	0.10	0.10	CD
10_1101-2021_01_07_425723	83	139	±	±	CD
10_1101-2021_01_07_425723	83	140	0.02	0.02	CD
10_1101-2021_01_07_425723	83	141	15.92	15.92	CD
10_1101-2021_01_07_425723	83	142	±	±	CD
10_1101-2021_01_07_425723	83	143	0.26	0.26	CD
10_1101-2021_01_07_425723	83	144	13.67	13.67	CD
10_1101-2021_01_07_425723	83	145	±	±	CD
10_1101-2021_01_07_425723	83	146	0.16	0.16	CD
10_1101-2021_01_07_425723	83	147	Y	Y	NNP
10_1101-2021_01_07_425723	83	148	biomass	biomass	NN
10_1101-2021_01_07_425723	83	149	/	/	SYM
10_1101-2021_01_07_425723	83	150	glucose	glucose	NN
10_1101-2021_01_07_425723	83	151	(	(	-LRB-
10_1101-2021_01_07_425723	83	152	g·g-1	g·g-1	NNP
10_1101-2021_01_07_425723	83	153	)	)	-RRB-
10_1101-2021_01_07_425723	83	154	0.57	0.57	CD
10_1101-2021_01_07_425723	83	155	±	±	CD
10_1101-2021_01_07_425723	83	156	0.01	0.01	CD
10_1101-2021_01_07_425723	83	157	0.12	0.12	CD
10_1101-2021_01_07_425723	83	158	±	±	CD
10_1101-2021_01_07_425723	83	159	0.00	0.00	CD
10_1101-2021_01_07_425723	83	160	0.10	0.10	CD
10_1101-2021_01_07_425723	83	161	±	±	CD
10_1101-2021_01_07_425723	83	162	0.00	0.00	CD
10_1101-2021_01_07_425723	83	163	0.08	0.08	CD
10_1101-2021_01_07_425723	83	164	±	±	CD
10_1101-2021_01_07_425723	83	165	0.00	0.00	CD
10_1101-2021_01_07_425723	83	166	0.06	0.06	CD
10_1101-2021_01_07_425723	83	167	±	±	CD
10_1101-2021_01_07_425723	83	168	0.00	0.00	CD
10_1101-2021_01_07_425723	83	169	0.53	0.53	CD
10_1101-2021_01_07_425723	83	170	±	±	CD
10_1101-2021_01_07_425723	83	171	0.00	0.00	CD
10_1101-2021_01_07_425723	83	172	0.08	0.08	CD
10_1101-2021_01_07_425723	83	173	±	±	CD
10_1101-2021_01_07_425723	83	174	0.00	0.00	CD
10_1101-2021_01_07_425723	83	175	0.09	0.09	CD
10_1101-2021_01_07_425723	83	176	±	±	CD
10_1101-2021_01_07_425723	83	177	0.00	0.00	CD
10_1101-2021_01_07_425723	83	178	0.09	0.09	CD
10_1101-2021_01_07_425723	83	179	±	±	CD
10_1101-2021_01_07_425723	83	180	0.01	0.01	CD
10_1101-2021_01_07_425723	83	181	.CC	.CC	:
10_1101-2021_01_07_425723	83	182	-	-	HYPH
10_1101-2021_01_07_425723	83	183	BY	by	IN
10_1101-2021_01_07_425723	83	184	-	-	HYPH
10_1101-2021_01_07_425723	83	185	NC	NC	NNP
10_1101-2021_01_07_425723	83	186	-	-	HYPH
10_1101-2021_01_07_425723	83	187	ND	ND	NNP
10_1101-2021_01_07_425723	83	188	4.0	4.0	CD
10_1101-2021_01_07_425723	83	189	International	International	NNP
10_1101-2021_01_07_425723	83	190	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	83	191	under	under	IN
10_1101-2021_01_07_425723	83	192	a	a	DT
10_1101-2021_01_07_425723	83	193	(	(	-LRB-
10_1101-2021_01_07_425723	83	194	which	which	WDT
10_1101-2021_01_07_425723	83	195	was	be	VBD
10_1101-2021_01_07_425723	83	196	not	not	RB
10_1101-2021_01_07_425723	83	197	certified	certify	VBN
10_1101-2021_01_07_425723	83	198	by	by	IN
10_1101-2021_01_07_425723	83	199	peer	peer	NN
10_1101-2021_01_07_425723	83	200	review	review	NN
10_1101-2021_01_07_425723	83	201	)	)	-RRB-
10_1101-2021_01_07_425723	83	202	is	be	VBZ
10_1101-2021_01_07_425723	83	203	the	the	DT
10_1101-2021_01_07_425723	83	204	author	author	NN
10_1101-2021_01_07_425723	83	205	/	/	SYM
10_1101-2021_01_07_425723	83	206	funder	funder	NN
10_1101-2021_01_07_425723	83	207	,	,	,
10_1101-2021_01_07_425723	83	208	who	who	WP
10_1101-2021_01_07_425723	83	209	has	have	VBZ
10_1101-2021_01_07_425723	83	210	granted	grant	VBN
10_1101-2021_01_07_425723	83	211	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	83	212	a	a	DT
10_1101-2021_01_07_425723	83	213	license	license	NN
10_1101-2021_01_07_425723	83	214	to	to	TO
10_1101-2021_01_07_425723	83	215	display	display	VB
10_1101-2021_01_07_425723	83	216	the	the	DT
10_1101-2021_01_07_425723	83	217	preprint	preprint	NN
10_1101-2021_01_07_425723	83	218	in	in	IN
10_1101-2021_01_07_425723	83	219	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	83	220	.	.	.
10_1101-2021_01_07_425723	84	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	84	2	is	be	VBZ
10_1101-2021_01_07_425723	84	3	made	make	VBN
10_1101-2021_01_07_425723	84	4	The	the	DT
10_1101-2021_01_07_425723	84	5	copyright	copyright	NN
10_1101-2021_01_07_425723	84	6	holder	holder	NN
10_1101-2021_01_07_425723	84	7	for	for	IN
10_1101-2021_01_07_425723	84	8	this	this	DT
10_1101-2021_01_07_425723	84	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	84	10	version	version	NN
10_1101-2021_01_07_425723	84	11	posted	post	VBD
10_1101-2021_01_07_425723	84	12	January	January	NNP
10_1101-2021_01_07_425723	84	13	8	8	CD
10_1101-2021_01_07_425723	84	14	,	,	,
10_1101-2021_01_07_425723	84	15	2021	2021	CD
10_1101-2021_01_07_425723	84	16	.	.	.
10_1101-2021_01_07_425723	84	17	;	;	:
10_1101-2021_01_07_425723	84	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	84	19	:	:	:
10_1101-2021_01_07_425723	84	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	84	21	preprint	preprint	NN
10_1101-2021_01_07_425723	84	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	84	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	84	24	9	9	CD
10_1101-2021_01_07_425723	84	25	Y	Y	NNP
10_1101-2021_01_07_425723	84	26	ethanol	ethanol	NN
10_1101-2021_01_07_425723	84	27	/	/	SYM
10_1101-2021_01_07_425723	84	28	glucose	glucose	NN
10_1101-2021_01_07_425723	84	29	(	(	-LRB-
10_1101-2021_01_07_425723	84	30	g·g-1	g·g-1	NNP
10_1101-2021_01_07_425723	84	31	)	)	-RRB-
10_1101-2021_01_07_425723	84	32	-	-	:
10_1101-2021_01_07_425723	84	33	1.67	1.67	CD
10_1101-2021_01_07_425723	84	34	±	±	CD
10_1101-2021_01_07_425723	84	35	0.06	0.06	CD
10_1101-2021_01_07_425723	84	36	1.63	1.63	CD
10_1101-2021_01_07_425723	84	37	±	±	CD
10_1101-2021_01_07_425723	84	38	0.02	0.02	CD
10_1101-2021_01_07_425723	84	39	1.65	1.65	CD
10_1101-2021_01_07_425723	84	40	±	±	CD
10_1101-2021_01_07_425723	84	41	0.02	0.02	CD
10_1101-2021_01_07_425723	84	42	1.68	1.68	CD
10_1101-2021_01_07_425723	84	43	±	±	CD
10_1101-2021_01_07_425723	84	44	0.02	0.02	CD
10_1101-2021_01_07_425723	84	45	-	-	HYPH
10_1101-2021_01_07_425723	84	46	1.53	1.53	CD
10_1101-2021_01_07_425723	84	47	±	±	CD
10_1101-2021_01_07_425723	84	48	0.03	0.03	CD
10_1101-2021_01_07_425723	84	49	1.31	1.31	CD
10_1101-2021_01_07_425723	84	50	±	±	CD
10_1101-2021_01_07_425723	84	51	0.05	0.05	CD
10_1101-2021_01_07_425723	84	52	1.40	1.40	CD
10_1101-2021_01_07_425723	84	53	±	±	CD
10_1101-2021_01_07_425723	84	54	0.02	0.02	CD
10_1101-2021_01_07_425723	84	55	qglucose	qglucose	NN
10_1101-2021_01_07_425723	84	56	(	(	-LRB-
10_1101-2021_01_07_425723	84	57	mmol·g·h-1	mmol·g·h-1	NNP
10_1101-2021_01_07_425723	84	58	)	)	-RRB-
10_1101-2021_01_07_425723	84	59	-0.95	-0.95	:
10_1101-2021_01_07_425723	84	60	±	±	CD
10_1101-2021_01_07_425723	84	61	0.03	0.03	CD
10_1101-2021_01_07_425723	84	62	-4.59	-4.59	CD
10_1101-2021_01_07_425723	84	63	±	±	CD
10_1101-2021_01_07_425723	84	64	0.10	0.10	CD
10_1101-2021_01_07_425723	84	65	-5.25	-5.25	CD
10_1101-2021_01_07_425723	84	66	±	±	CD
10_1101-2021_01_07_425723	84	67	0.04	0.04	CD
10_1101-2021_01_07_425723	84	68	-6.77	-6.77	CD
10_1101-2021_01_07_425723	84	69	±	±	CD
10_1101-2021_01_07_425723	84	70	0.27	0.27	CD
10_1101-2021_01_07_425723	84	71	-9.06	-9.06	CD
10_1101-2021_01_07_425723	84	72	±	±	CD
10_1101-2021_01_07_425723	84	73	0.15	0.15	CD
10_1101-2021_01_07_425723	84	74	-1.05	-1.05	CD
10_1101-2021_01_07_425723	84	75	±	±	CD
10_1101-2021_01_07_425723	84	76	0.00	0.00	CD
10_1101-2021_01_07_425723	84	77	-7.46	-7.46	CD
10_1101-2021_01_07_425723	84	78	±	±	CD
10_1101-2021_01_07_425723	84	79	0.30	0.30	CD
10_1101-2021_01_07_425723	84	80	-7.30	-7.30	CD
10_1101-2021_01_07_425723	84	81	±	±	CD
10_1101-2021_01_07_425723	84	82	0.81	0.81	CD
10_1101-2021_01_07_425723	84	83	-8.53	-8.53	CD
10_1101-2021_01_07_425723	84	84	±	±	CD
10_1101-2021_01_07_425723	84	85	0.00	0.00	CD
10_1101-2021_01_07_425723	84	86	qethanol	qethanol	NN
10_1101-2021_01_07_425723	84	87	(	(	-LRB-
10_1101-2021_01_07_425723	84	88	mmol·g·h-1	mmol·g·h-1	NNP
10_1101-2021_01_07_425723	84	89	)	)	-RRB-
10_1101-2021_01_07_425723	84	90	-0.44	-0.44	CD
10_1101-2021_01_07_425723	84	91	±	±	CD
10_1101-2021_01_07_425723	84	92	0.03	0.03	CD
10_1101-2021_01_07_425723	84	93	7.48	7.48	CD
10_1101-2021_01_07_425723	84	94	±	±	CD
10_1101-2021_01_07_425723	84	95	0.10	0.10	CD
10_1101-2021_01_07_425723	84	96	8.40	8.40	CD
10_1101-2021_01_07_425723	84	97	±	±	CD
10_1101-2021_01_07_425723	84	98	0.02	0.02	CD
10_1101-2021_01_07_425723	84	99	10.96	10.96	CD
10_1101-2021_01_07_425723	84	100	±	±	CD
10_1101-2021_01_07_425723	84	101	0.56	0.56	CD
10_1101-2021_01_07_425723	84	102	15.03	15.03	CD
10_1101-2021_01_07_425723	84	103	±	±	CD
10_1101-2021_01_07_425723	84	104	0.47	0.47	CD
10_1101-2021_01_07_425723	84	105	-0.52	-0.52	CD
10_1101-2021_01_07_425723	84	106	±	±	CD
10_1101-2021_01_07_425723	84	107	0.00	0.00	CD
10_1101-2021_01_07_425723	84	108	11.49	11.49	CD
10_1101-2021_01_07_425723	84	109	±	±	CD
10_1101-2021_01_07_425723	84	110	0.44	0.44	CD
10_1101-2021_01_07_425723	84	111	10.25	10.25	CD
10_1101-2021_01_07_425723	84	112	±	±	CD
10_1101-2021_01_07_425723	84	113	0.66	0.66	CD
10_1101-2021_01_07_425723	84	114	12.69	12.69	CD
10_1101-2021_01_07_425723	84	115	±	±	CD
10_1101-2021_01_07_425723	84	116	0.11	0.11	CD
10_1101-2021_01_07_425723	84	117	RQ	RQ	NNP
10_1101-2021_01_07_425723	84	118	1.08	1.08	CD
10_1101-2021_01_07_425723	84	119	±	±	CD
10_1101-2021_01_07_425723	84	120	0.02	0.02	CD
10_1101-2021_01_07_425723	84	121	52.2	52.2	CD
10_1101-2021_01_07_425723	84	122	±	±	CD
10_1101-2021_01_07_425723	84	123	2.4	2.4	CD
10_1101-2021_01_07_425723	84	124	-	-	HYPH
10_1101-2021_01_07_425723	84	125	-	-	:
10_1101-2021_01_07_425723	84	126	-	-	HYPH
10_1101-2021_01_07_425723	84	127	1.06	1.06	CD
10_1101-2021_01_07_425723	84	128	±	±	CD
10_1101-2021_01_07_425723	84	129	0.01	0.01	CD
10_1101-2021_01_07_425723	84	130	49.3	49.3	CD
10_1101-2021_01_07_425723	84	131	±	±	CD
10_1101-2021_01_07_425723	84	132	7.5	7.5	CD
10_1101-2021_01_07_425723	84	133	-	-	HYPH
10_1101-2021_01_07_425723	84	134	-	-	:
10_1101-2021_01_07_425723	84	135	Glycerol	Glycerol	NNP
10_1101-2021_01_07_425723	84	136	/	/	SYM
10_1101-2021_01_07_425723	84	137	biomass	biomass	NN
10_1101-2021_01_07_425723	84	138	(	(	-LRB-
10_1101-2021_01_07_425723	84	139	mmol·(g	mmol·(g	NNP
10_1101-2021_01_07_425723	84	140	biomass)-1	biomass)-1	NN
10_1101-2021_01_07_425723	84	141	)	)	-RRB-
10_1101-2021_01_07_425723	84	142	0.00	0.00	CD
10_1101-2021_01_07_425723	84	143	±	±	CD
10_1101-2021_01_07_425723	84	144	0.00	0.00	CD
10_1101-2021_01_07_425723	84	145	3.67	3.67	CD
10_1101-2021_01_07_425723	84	146	±	±	CD
10_1101-2021_01_07_425723	84	147	0.05	0.05	CD
10_1101-2021_01_07_425723	84	148	5.58	5.58	CD
10_1101-2021_01_07_425723	84	149	±	±	CD
10_1101-2021_01_07_425723	84	150	0.02	0.02	CD
10_1101-2021_01_07_425723	84	151	6.73	6.73	CD
10_1101-2021_01_07_425723	84	152	±	±	CD
10_1101-2021_01_07_425723	84	153	0.25	0.25	CD
10_1101-2021_01_07_425723	84	154	11.26	11.26	CD
10_1101-2021_01_07_425723	84	155	±	±	CD
10_1101-2021_01_07_425723	84	156	0.40	0.40	CD
10_1101-2021_01_07_425723	84	157	0.00	0.00	CD
10_1101-2021_01_07_425723	84	158	±	±	CD
10_1101-2021_01_07_425723	84	159	0.00	0.00	CD
10_1101-2021_01_07_425723	84	160	9.51	9.51	CD
10_1101-2021_01_07_425723	84	161	±	±	CD
10_1101-2021_01_07_425723	84	162	0.46	0.46	CD
10_1101-2021_01_07_425723	84	163	16.90	16.90	CD
10_1101-2021_01_07_425723	84	164	±	±	CD
10_1101-2021_01_07_425723	84	165	0.76	0.76	CD
10_1101-2021_01_07_425723	84	166	18.45	18.45	CD
10_1101-2021_01_07_425723	84	167	±	±	CD
10_1101-2021_01_07_425723	84	168	2.09	2.09	CD
10_1101-2021_01_07_425723	84	169	Carbon	carbon	NN
10_1101-2021_01_07_425723	84	170	recovery	recovery	NN
10_1101-2021_01_07_425723	84	171	(	(	-LRB-
10_1101-2021_01_07_425723	84	172	%	%	NN
10_1101-2021_01_07_425723	84	173	)	)	-RRB-
10_1101-2021_01_07_425723	84	174	99.9	99.9	CD
10_1101-2021_01_07_425723	84	175	±	±	CD
10_1101-2021_01_07_425723	84	176	0.7	0.7	CD
10_1101-2021_01_07_425723	84	177	101.2	101.2	CD
10_1101-2021_01_07_425723	84	178	±	±	CD
10_1101-2021_01_07_425723	84	179	3.3	3.3	CD
10_1101-2021_01_07_425723	84	180	100.4	100.4	CD
10_1101-2021_01_07_425723	84	181	±	±	CD
10_1101-2021_01_07_425723	84	182	0.1	0.1	CD
10_1101-2021_01_07_425723	84	183	100.1	100.1	CD
10_1101-2021_01_07_425723	84	184	±	±	CD
10_1101-2021_01_07_425723	84	185	1.3	1.3	CD
10_1101-2021_01_07_425723	84	186	104.0	104.0	CD
10_1101-2021_01_07_425723	84	187	±	±	CD
10_1101-2021_01_07_425723	84	188	0.2	0.2	CD
10_1101-2021_01_07_425723	84	189	100.5	100.5	CD
10_1101-2021_01_07_425723	84	190	±	±	CD
10_1101-2021_01_07_425723	84	191	0.1	0.1	CD
10_1101-2021_01_07_425723	84	192	91.1	91.1	CD
10_1101-2021_01_07_425723	84	193	±	±	CD
10_1101-2021_01_07_425723	84	194	2.0	2.0	CD
10_1101-2021_01_07_425723	84	195	101.6	101.6	CD
10_1101-2021_01_07_425723	84	196	±	±	CD
10_1101-2021_01_07_425723	84	197	6.5	6.5	CD
10_1101-2021_01_07_425723	84	198	99.7	99.7	CD
10_1101-2021_01_07_425723	84	199	±	±	CD
10_1101-2021_01_07_425723	84	200	3.9	3.9	CD
10_1101-2021_01_07_425723	84	201	Degree	Degree	NNP
10_1101-2021_01_07_425723	84	202	of	of	IN
10_1101-2021_01_07_425723	84	203	reduction	reduction	NN
10_1101-2021_01_07_425723	84	204	recovery	recovery	NN
10_1101-2021_01_07_425723	84	205	(	(	-LRB-
10_1101-2021_01_07_425723	84	206	%	%	NN
10_1101-2021_01_07_425723	84	207	)	)	-RRB-
10_1101-2021_01_07_425723	84	208	98.4	98.4	CD
10_1101-2021_01_07_425723	84	209	±	±	CD
10_1101-2021_01_07_425723	84	210	0.7	0.7	CD
10_1101-2021_01_07_425723	84	211	100.9	100.9	CD
10_1101-2021_01_07_425723	84	212	±	±	CD
10_1101-2021_01_07_425723	84	213	0.8	0.8	CD
10_1101-2021_01_07_425723	84	214	100.1	100.1	CD
10_1101-2021_01_07_425723	84	215	±	±	CD
10_1101-2021_01_07_425723	84	216	0.9	0.9	CD
10_1101-2021_01_07_425723	84	217	98.1	98.1	CD
10_1101-2021_01_07_425723	84	218	±	±	CD
10_1101-2021_01_07_425723	84	219	0.6	0.6	CD
10_1101-2021_01_07_425723	84	220	100.1	100.1	CD
10_1101-2021_01_07_425723	84	221	±	±	CD
10_1101-2021_01_07_425723	84	222	1.8	1.8	CD
10_1101-2021_01_07_425723	84	223	98.8	98.8	CD
10_1101-2021_01_07_425723	84	224	±	±	CD
10_1101-2021_01_07_425723	84	225	0.1	0.1	CD
10_1101-2021_01_07_425723	84	226	94.5	94.5	CD
10_1101-2021_01_07_425723	84	227	±	±	CD
10_1101-2021_01_07_425723	84	228	0.4	0.4	CD
10_1101-2021_01_07_425723	84	229	97.8	97.8	CD
10_1101-2021_01_07_425723	84	230	±	±	CD
10_1101-2021_01_07_425723	84	231	6.2	6.2	CD
10_1101-2021_01_07_425723	84	232	99.1	99.1	CD
10_1101-2021_01_07_425723	84	233	±	±	CD
10_1101-2021_01_07_425723	84	234	3.5	3.5	CD
10_1101-2021_01_07_425723	84	235	146	146	CD
10_1101-2021_01_07_425723	84	236	Transcriptional	transcriptional	JJ
10_1101-2021_01_07_425723	84	237	responses	response	NNS
10_1101-2021_01_07_425723	84	238	of	of	IN
10_1101-2021_01_07_425723	84	239	K.	K.	NNP
10_1101-2021_01_07_425723	84	240	marxianus	marxianus	NN
10_1101-2021_01_07_425723	84	241	to	to	IN
10_1101-2021_01_07_425723	84	242	oxygen	oxygen	NN
10_1101-2021_01_07_425723	84	243	limitation	limitation	NN
10_1101-2021_01_07_425723	84	244	involve	involve	VBP
10_1101-2021_01_07_425723	84	245	ergosterol	ergosterol	JJ
10_1101-2021_01_07_425723	84	246	metabolism	metabolism	NN
10_1101-2021_01_07_425723	84	247	147	147	CD
10_1101-2021_01_07_425723	84	248	To	to	TO
10_1101-2021_01_07_425723	84	249	further	further	RB
10_1101-2021_01_07_425723	84	250	investigate	investigate	VB
10_1101-2021_01_07_425723	84	251	the	the	DT
10_1101-2021_01_07_425723	84	252	non	non	JJ
10_1101-2021_01_07_425723	84	253	-	-	JJ
10_1101-2021_01_07_425723	84	254	dissimilatory	dissimilatory	JJ
10_1101-2021_01_07_425723	84	255	oxygen	oxygen	NN
10_1101-2021_01_07_425723	84	256	requirements	requirement	NNS
10_1101-2021_01_07_425723	84	257	of	of	IN
10_1101-2021_01_07_425723	84	258	K.	K.	NNP
10_1101-2021_01_07_425723	84	259	marxianus	marxianus	NN
10_1101-2021_01_07_425723	84	260	,	,	,
10_1101-2021_01_07_425723	84	261	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	84	262	148	148	CD
10_1101-2021_01_07_425723	84	263	analyses	analysis	NNS
10_1101-2021_01_07_425723	84	264	were	be	VBD
10_1101-2021_01_07_425723	84	265	performed	perform	VBN
10_1101-2021_01_07_425723	84	266	on	on	IN
10_1101-2021_01_07_425723	84	267	cultures	culture	NNS
10_1101-2021_01_07_425723	84	268	of	of	IN
10_1101-2021_01_07_425723	84	269	S.	S.	NNP
10_1101-2021_01_07_425723	84	270	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	84	271	and	and	CC
10_1101-2021_01_07_425723	84	272	K.	K.	NNP
10_1101-2021_01_07_425723	84	273	marxianus	marxianu	NNS
10_1101-2021_01_07_425723	84	274	grown	grow	VBN
10_1101-2021_01_07_425723	84	275	under	under	IN
10_1101-2021_01_07_425723	84	276	the	the	DT
10_1101-2021_01_07_425723	84	277	aeration	aeration	NN
10_1101-2021_01_07_425723	84	278	and	and	CC
10_1101-2021_01_07_425723	84	279	149	149	CD
10_1101-2021_01_07_425723	84	280	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	84	281	-	-	HYPH
10_1101-2021_01_07_425723	84	282	growth	growth	NN
10_1101-2021_01_07_425723	84	283	-	-	HYPH
10_1101-2021_01_07_425723	84	284	factor	factor	NN
10_1101-2021_01_07_425723	84	285	supplementation	supplementation	NN
10_1101-2021_01_07_425723	84	286	regimes	regime	NNS
10_1101-2021_01_07_425723	84	287	discussed	discuss	VBN
10_1101-2021_01_07_425723	84	288	above	above	RB
10_1101-2021_01_07_425723	84	289	.	.	.
10_1101-2021_01_07_425723	85	1	The	the	DT
10_1101-2021_01_07_425723	85	2	genome	genome	JJ
10_1101-2021_01_07_425723	85	3	sequence	sequence	NN
10_1101-2021_01_07_425723	85	4	of	of	IN
10_1101-2021_01_07_425723	85	5	K.	K.	NNP
10_1101-2021_01_07_425723	85	6	150	150	CD
10_1101-2021_01_07_425723	85	7	marxianus	marxianus	NN
10_1101-2021_01_07_425723	85	8	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	85	9	was	be	VBD
10_1101-2021_01_07_425723	85	10	only	only	RB
10_1101-2021_01_07_425723	85	11	available	available	JJ
10_1101-2021_01_07_425723	85	12	as	as	IN
10_1101-2021_01_07_425723	85	13	draft	draft	NN
10_1101-2021_01_07_425723	85	14	assembly	assembly	NN
10_1101-2021_01_07_425723	85	15	and	and	CC
10_1101-2021_01_07_425723	85	16	was	be	VBD
10_1101-2021_01_07_425723	85	17	not	not	RB
10_1101-2021_01_07_425723	85	18	annotated36	annotated36	VBN
10_1101-2021_01_07_425723	85	19	.	.	.
10_1101-2021_01_07_425723	86	1	Therefore	therefore	RB
10_1101-2021_01_07_425723	86	2	,	,	,
10_1101-2021_01_07_425723	86	3	long	long	RB
10_1101-2021_01_07_425723	86	4	-	-	HYPH
10_1101-2021_01_07_425723	86	5	read	read	VBN
10_1101-2021_01_07_425723	86	6	151	151	CD
10_1101-2021_01_07_425723	86	7	genome	genome	JJ
10_1101-2021_01_07_425723	86	8	sequencing	sequencing	NN
10_1101-2021_01_07_425723	86	9	,	,	,
10_1101-2021_01_07_425723	86	10	assembly	assembly	NN
10_1101-2021_01_07_425723	86	11	and	and	CC
10_1101-2021_01_07_425723	86	12	de	de	NNP
10_1101-2021_01_07_425723	86	13	novo	novo	NNP
10_1101-2021_01_07_425723	86	14	genome	genome	NNP
10_1101-2021_01_07_425723	86	15	annotation	annotation	NN
10_1101-2021_01_07_425723	86	16	were	be	VBD
10_1101-2021_01_07_425723	86	17	performed	perform	VBN
10_1101-2021_01_07_425723	86	18	,	,	,
10_1101-2021_01_07_425723	86	19	the	the	DT
10_1101-2021_01_07_425723	86	20	annotation	annotation	NN
10_1101-2021_01_07_425723	86	21	was	be	VBD
10_1101-2021_01_07_425723	86	22	152	152	CD
10_1101-2021_01_07_425723	86	23	refined	refine	VBN
10_1101-2021_01_07_425723	86	24	by	by	IN
10_1101-2021_01_07_425723	86	25	using	use	VBG
10_1101-2021_01_07_425723	86	26	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	86	27	assemblies	assembly	NNS
10_1101-2021_01_07_425723	86	28	(	(	-LRB-
10_1101-2021_01_07_425723	86	29	Data	datum	NNS
10_1101-2021_01_07_425723	86	30	availability	availability	NN
10_1101-2021_01_07_425723	86	31	)	)	-RRB-
10_1101-2021_01_07_425723	86	32	.	.	.
10_1101-2021_01_07_425723	87	1	Comparative	comparative	JJ
10_1101-2021_01_07_425723	87	2	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	87	3	analysis	analysis	NN
10_1101-2021_01_07_425723	87	4	of	of	IN
10_1101-2021_01_07_425723	87	5	S.	S.	NNP
10_1101-2021_01_07_425723	87	6	153	153	CD
10_1101-2021_01_07_425723	87	7	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	87	8	and	and	CC
10_1101-2021_01_07_425723	87	9	K.	K.	NNP
10_1101-2021_01_07_425723	87	10	marxianus	marxianus	NN
10_1101-2021_01_07_425723	87	11	focused	focus	VBD
10_1101-2021_01_07_425723	87	12	on	on	IN
10_1101-2021_01_07_425723	87	13	orthologous	orthologous	JJ
10_1101-2021_01_07_425723	87	14	genes	gene	NNS
10_1101-2021_01_07_425723	87	15	with	with	IN
10_1101-2021_01_07_425723	87	16	divergent	divergent	JJ
10_1101-2021_01_07_425723	87	17	expression	expression	NN
10_1101-2021_01_07_425723	87	18	patterns	pattern	NNS
10_1101-2021_01_07_425723	87	19	that	that	IN
10_1101-2021_01_07_425723	87	20	154	154	CD
10_1101-2021_01_07_425723	87	21	revealed	reveal	VBD
10_1101-2021_01_07_425723	87	22	a	a	DT
10_1101-2021_01_07_425723	87	23	strikingly	strikingly	RB
10_1101-2021_01_07_425723	87	24	different	different	JJ
10_1101-2021_01_07_425723	87	25	transcriptional	transcriptional	JJ
10_1101-2021_01_07_425723	87	26	response	response	NN
10_1101-2021_01_07_425723	87	27	to	to	IN
10_1101-2021_01_07_425723	87	28	growth	growth	NN
10_1101-2021_01_07_425723	87	29	limitation	limitation	NN
10_1101-2021_01_07_425723	87	30	by	by	IN
10_1101-2021_01_07_425723	87	31	oxygen	oxygen	NN
10_1101-2021_01_07_425723	87	32	and/or	and/or	CC
10_1101-2021_01_07_425723	87	33	anaerobic-155	anaerobic-155	NNP
10_1101-2021_01_07_425723	87	34	growth	growth	NN
10_1101-2021_01_07_425723	87	35	-	-	HYPH
10_1101-2021_01_07_425723	87	36	factor	factor	NN
10_1101-2021_01_07_425723	87	37	availability	availability	NN
10_1101-2021_01_07_425723	87	38	(	(	-LRB-
10_1101-2021_01_07_425723	87	39	Fig	fig	NN
10_1101-2021_01_07_425723	87	40	.	.	.
10_1101-2021_01_07_425723	88	1	2	2	LS
10_1101-2021_01_07_425723	88	2	)	)	-RRB-
10_1101-2021_01_07_425723	88	3	.	.	.
10_1101-2021_01_07_425723	89	1	156	156	CD
10_1101-2021_01_07_425723	89	2	In	in	IN
10_1101-2021_01_07_425723	89	3	S.	S.	NNP
10_1101-2021_01_07_425723	89	4	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	89	5	,	,	,
10_1101-2021_01_07_425723	89	6	import	import	NN
10_1101-2021_01_07_425723	89	7	of	of	IN
10_1101-2021_01_07_425723	89	8	exogenous	exogenous	JJ
10_1101-2021_01_07_425723	89	9	sterols	sterol	NNS
10_1101-2021_01_07_425723	89	10	by	by	IN
10_1101-2021_01_07_425723	89	11	Aus1	Aus1	NNP
10_1101-2021_01_07_425723	89	12	and	and	CC
10_1101-2021_01_07_425723	89	13	Pdr11	Pdr11	NNP
10_1101-2021_01_07_425723	89	14	can	can	MD
10_1101-2021_01_07_425723	89	15	alleviate	alleviate	VB
10_1101-2021_01_07_425723	89	16	the	the	DT
10_1101-2021_01_07_425723	89	17	impact	impact	NN
10_1101-2021_01_07_425723	89	18	of	of	IN
10_1101-2021_01_07_425723	89	19	oxygen	oxygen	NN
10_1101-2021_01_07_425723	89	20	157	157	CD
10_1101-2021_01_07_425723	89	21	limitation	limitation	NN
10_1101-2021_01_07_425723	89	22	on	on	IN
10_1101-2021_01_07_425723	89	23	sterol	sterol	JJ
10_1101-2021_01_07_425723	89	24	biosynthesis20	biosynthesis20	NNP
10_1101-2021_01_07_425723	89	25	.	.	.
10_1101-2021_01_07_425723	90	1	Consistent	consistent	JJ
10_1101-2021_01_07_425723	90	2	with	with	IN
10_1101-2021_01_07_425723	90	3	this	this	DT
10_1101-2021_01_07_425723	90	4	role	role	NN
10_1101-2021_01_07_425723	90	5	of	of	IN
10_1101-2021_01_07_425723	90	6	sterol	sterol	NN
10_1101-2021_01_07_425723	90	7	uptake	uptake	JJ
10_1101-2021_01_07_425723	90	8	,	,	,
10_1101-2021_01_07_425723	90	9	sterol	sterol	JJ
10_1101-2021_01_07_425723	90	10	biosynthetic	biosynthetic	JJ
10_1101-2021_01_07_425723	90	11	genes	gene	NNS
10_1101-2021_01_07_425723	90	12	in	in	IN
10_1101-2021_01_07_425723	90	13	158	158	CD
10_1101-2021_01_07_425723	90	14	S.	S.	NNP
10_1101-2021_01_07_425723	90	15	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	90	16	were	be	VBD
10_1101-2021_01_07_425723	90	17	only	only	RB
10_1101-2021_01_07_425723	90	18	highly	highly	RB
10_1101-2021_01_07_425723	90	19	upregulated	upregulated	JJ
10_1101-2021_01_07_425723	90	20	in	in	IN
10_1101-2021_01_07_425723	90	21	severely	severely	RB
10_1101-2021_01_07_425723	90	22	oxygen	oxygen	NN
10_1101-2021_01_07_425723	90	23	-	-	HYPH
10_1101-2021_01_07_425723	90	24	limited	limit	VBN
10_1101-2021_01_07_425723	90	25	cultures	culture	NNS
10_1101-2021_01_07_425723	90	26	when	when	WRB
10_1101-2021_01_07_425723	90	27	ergosterol	ergosterol	NNP
10_1101-2021_01_07_425723	90	28	was	be	VBD
10_1101-2021_01_07_425723	90	29	159	159	CD
10_1101-2021_01_07_425723	90	30	omitted	omit	VBN
10_1101-2021_01_07_425723	90	31	from	from	IN
10_1101-2021_01_07_425723	90	32	the	the	DT
10_1101-2021_01_07_425723	90	33	growth	growth	NN
10_1101-2021_01_07_425723	90	34	medium	medium	NN
10_1101-2021_01_07_425723	90	35	(	(	-LRB-
10_1101-2021_01_07_425723	90	36	Fig	fig	NN
10_1101-2021_01_07_425723	90	37	.	.	.
10_1101-2021_01_07_425723	91	1	3b	3b	LS
10_1101-2021_01_07_425723	91	2	,	,	,
10_1101-2021_01_07_425723	91	3	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	91	4	Fig	Fig	NNP
10_1101-2021_01_07_425723	91	5	.	.	.
10_1101-2021_01_07_425723	92	1	6	6	CD
10_1101-2021_01_07_425723	92	2	,	,	,
10_1101-2021_01_07_425723	92	3	contrast	contrast	NN
10_1101-2021_01_07_425723	92	4	43	43	CD
10_1101-2021_01_07_425723	92	5	)	)	-RRB-
10_1101-2021_01_07_425723	92	6	.	.	.
10_1101-2021_01_07_425723	93	1	Also	also	RB
10_1101-2021_01_07_425723	93	2	the	the	DT
10_1101-2021_01_07_425723	93	3	mevalonate	mevalonate	NN
10_1101-2021_01_07_425723	93	4	160	160	CD
10_1101-2021_01_07_425723	93	5	pathway	pathway	NN
10_1101-2021_01_07_425723	93	6	for	for	IN
10_1101-2021_01_07_425723	93	7	synthesis	synthesis	NN
10_1101-2021_01_07_425723	93	8	of	of	IN
10_1101-2021_01_07_425723	93	9	the	the	DT
10_1101-2021_01_07_425723	93	10	sterol	sterol	JJ
10_1101-2021_01_07_425723	93	11	precursor	precursor	NN
10_1101-2021_01_07_425723	93	12	squalene	squalene	NN
10_1101-2021_01_07_425723	93	13	,	,	,
10_1101-2021_01_07_425723	93	14	which	which	WDT
10_1101-2021_01_07_425723	93	15	does	do	VBZ
10_1101-2021_01_07_425723	93	16	not	not	RB
10_1101-2021_01_07_425723	93	17	require	require	VB
10_1101-2021_01_07_425723	93	18	oxygen	oxygen	NN
10_1101-2021_01_07_425723	93	19	,	,	,
10_1101-2021_01_07_425723	93	20	was	be	VBD
10_1101-2021_01_07_425723	93	21	upregulated	upregulated	JJ
10_1101-2021_01_07_425723	93	22	161	161	CD
10_1101-2021_01_07_425723	93	23	.CC	.CC	NFP
10_1101-2021_01_07_425723	93	24	-	-	HYPH
10_1101-2021_01_07_425723	93	25	BY	by	IN
10_1101-2021_01_07_425723	93	26	-	-	HYPH
10_1101-2021_01_07_425723	93	27	NC	NC	NNP
10_1101-2021_01_07_425723	93	28	-	-	HYPH
10_1101-2021_01_07_425723	93	29	ND	ND	NNP
10_1101-2021_01_07_425723	93	30	4.0	4.0	CD
10_1101-2021_01_07_425723	93	31	International	International	NNP
10_1101-2021_01_07_425723	93	32	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	93	33	under	under	IN
10_1101-2021_01_07_425723	93	34	a	a	DT
10_1101-2021_01_07_425723	93	35	(	(	-LRB-
10_1101-2021_01_07_425723	93	36	which	which	WDT
10_1101-2021_01_07_425723	93	37	was	be	VBD
10_1101-2021_01_07_425723	93	38	not	not	RB
10_1101-2021_01_07_425723	93	39	certified	certify	VBN
10_1101-2021_01_07_425723	93	40	by	by	IN
10_1101-2021_01_07_425723	93	41	peer	peer	NN
10_1101-2021_01_07_425723	93	42	review	review	NN
10_1101-2021_01_07_425723	93	43	)	)	-RRB-
10_1101-2021_01_07_425723	93	44	is	be	VBZ
10_1101-2021_01_07_425723	93	45	the	the	DT
10_1101-2021_01_07_425723	93	46	author	author	NN
10_1101-2021_01_07_425723	93	47	/	/	SYM
10_1101-2021_01_07_425723	93	48	funder	funder	NN
10_1101-2021_01_07_425723	93	49	,	,	,
10_1101-2021_01_07_425723	93	50	who	who	WP
10_1101-2021_01_07_425723	93	51	has	have	VBZ
10_1101-2021_01_07_425723	93	52	granted	grant	VBN
10_1101-2021_01_07_425723	93	53	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	93	54	a	a	DT
10_1101-2021_01_07_425723	93	55	license	license	NN
10_1101-2021_01_07_425723	93	56	to	to	TO
10_1101-2021_01_07_425723	93	57	display	display	VB
10_1101-2021_01_07_425723	93	58	the	the	DT
10_1101-2021_01_07_425723	93	59	preprint	preprint	NN
10_1101-2021_01_07_425723	93	60	in	in	IN
10_1101-2021_01_07_425723	93	61	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	93	62	.	.	.
10_1101-2021_01_07_425723	94	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	94	2	is	be	VBZ
10_1101-2021_01_07_425723	94	3	made	make	VBN
10_1101-2021_01_07_425723	94	4	The	the	DT
10_1101-2021_01_07_425723	94	5	copyright	copyright	NN
10_1101-2021_01_07_425723	94	6	holder	holder	NN
10_1101-2021_01_07_425723	94	7	for	for	IN
10_1101-2021_01_07_425723	94	8	this	this	DT
10_1101-2021_01_07_425723	94	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	94	10	version	version	NN
10_1101-2021_01_07_425723	94	11	posted	post	VBD
10_1101-2021_01_07_425723	94	12	January	January	NNP
10_1101-2021_01_07_425723	94	13	8	8	CD
10_1101-2021_01_07_425723	94	14	,	,	,
10_1101-2021_01_07_425723	94	15	2021	2021	CD
10_1101-2021_01_07_425723	94	16	.	.	.
10_1101-2021_01_07_425723	94	17	;	;	:
10_1101-2021_01_07_425723	94	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	94	19	:	:	:
10_1101-2021_01_07_425723	94	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	94	21	preprint	preprint	NN
10_1101-2021_01_07_425723	94	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	94	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	94	24	10	10	CD
10_1101-2021_01_07_425723	94	25	(	(	-LRB-
10_1101-2021_01_07_425723	94	26	contrast	contrast	NN
10_1101-2021_01_07_425723	94	27	43	43	CD
10_1101-2021_01_07_425723	94	28	)	)	-RRB-
10_1101-2021_01_07_425723	94	29	,	,	,
10_1101-2021_01_07_425723	94	30	reflecting	reflect	VBG
10_1101-2021_01_07_425723	94	31	a	a	DT
10_1101-2021_01_07_425723	94	32	relief	relief	NN
10_1101-2021_01_07_425723	94	33	of	of	IN
10_1101-2021_01_07_425723	94	34	feedback	feedback	NN
10_1101-2021_01_07_425723	94	35	regulation	regulation	NN
10_1101-2021_01_07_425723	94	36	by	by	IN
10_1101-2021_01_07_425723	94	37	ergosterol37	ergosterol37	NNP
10_1101-2021_01_07_425723	94	38	.	.	.
10_1101-2021_01_07_425723	95	1	In	in	IN
10_1101-2021_01_07_425723	95	2	contrast	contrast	NN
10_1101-2021_01_07_425723	95	3	,	,	,
10_1101-2021_01_07_425723	95	4	K.	K.	NNP
10_1101-2021_01_07_425723	95	5	marxianus	marxianus	NN
10_1101-2021_01_07_425723	95	6	showed	show	VBD
10_1101-2021_01_07_425723	95	7	162	162	CD
10_1101-2021_01_07_425723	95	8	a	a	DT
10_1101-2021_01_07_425723	95	9	pronounced	pronounced	JJ
10_1101-2021_01_07_425723	95	10	upregulation	upregulation	NN
10_1101-2021_01_07_425723	95	11	of	of	IN
10_1101-2021_01_07_425723	95	12	genes	gene	NNS
10_1101-2021_01_07_425723	95	13	involved	involve	VBN
10_1101-2021_01_07_425723	95	14	in	in	IN
10_1101-2021_01_07_425723	95	15	sterol	sterol	NN
10_1101-2021_01_07_425723	95	16	,	,	,
10_1101-2021_01_07_425723	95	17	isoprenoid	isoprenoid	JJ
10_1101-2021_01_07_425723	95	18	and	and	CC
10_1101-2021_01_07_425723	95	19	fatty	fatty	NN
10_1101-2021_01_07_425723	95	20	-	-	HYPH
10_1101-2021_01_07_425723	95	21	acid	acid	NN
10_1101-2021_01_07_425723	95	22	metabolism	metabolism	NN
10_1101-2021_01_07_425723	95	23	(	(	-LRB-
10_1101-2021_01_07_425723	95	24	Fig	fig	NN
10_1101-2021_01_07_425723	95	25	.	.	.
10_1101-2021_01_07_425723	96	1	2ab	2ab	NNP
10_1101-2021_01_07_425723	96	2	,	,	,
10_1101-2021_01_07_425723	96	3	163	163	CD
10_1101-2021_01_07_425723	96	4	Fig	Fig	NNP
10_1101-2021_01_07_425723	96	5	.	.	.
10_1101-2021_01_07_425723	97	1	3	3	LS
10_1101-2021_01_07_425723	97	2	,	,	,
10_1101-2021_01_07_425723	97	3	contrast	contrast	NN
10_1101-2021_01_07_425723	97	4	31	31	CD
10_1101-2021_01_07_425723	97	5	)	)	-RRB-
10_1101-2021_01_07_425723	97	6	in	in	IN
10_1101-2021_01_07_425723	97	7	severely	severely	RB
10_1101-2021_01_07_425723	97	8	oxygen	oxygen	NN
10_1101-2021_01_07_425723	97	9	-	-	HYPH
10_1101-2021_01_07_425723	97	10	limited	limit	VBN
10_1101-2021_01_07_425723	97	11	cultures	culture	NNS
10_1101-2021_01_07_425723	97	12	supplemented	supplement	VBN
10_1101-2021_01_07_425723	97	13	with	with	IN
10_1101-2021_01_07_425723	97	14	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	97	15	and	and	CC
10_1101-2021_01_07_425723	97	16	Tween	Tween	NNP
10_1101-2021_01_07_425723	97	17	80	80	CD
10_1101-2021_01_07_425723	97	18	.	.	.
10_1101-2021_01_07_425723	98	1	No	no	DT
10_1101-2021_01_07_425723	98	2	164	164	CD
10_1101-2021_01_07_425723	98	3	further	further	JJ
10_1101-2021_01_07_425723	98	4	increase	increase	NN
10_1101-2021_01_07_425723	98	5	of	of	IN
10_1101-2021_01_07_425723	98	6	the	the	DT
10_1101-2021_01_07_425723	98	7	expression	expression	NN
10_1101-2021_01_07_425723	98	8	levels	level	NNS
10_1101-2021_01_07_425723	98	9	of	of	IN
10_1101-2021_01_07_425723	98	10	sterol	sterol	JJ
10_1101-2021_01_07_425723	98	11	biosynthetic	biosynthetic	JJ
10_1101-2021_01_07_425723	98	12	genes	gene	NNS
10_1101-2021_01_07_425723	98	13	was	be	VBD
10_1101-2021_01_07_425723	98	14	observed	observe	VBN
10_1101-2021_01_07_425723	98	15	upon	upon	IN
10_1101-2021_01_07_425723	98	16	omission	omission	NN
10_1101-2021_01_07_425723	98	17	of	of	IN
10_1101-2021_01_07_425723	98	18	165	165	CD
10_1101-2021_01_07_425723	98	19	these	these	DT
10_1101-2021_01_07_425723	98	20	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	98	21	growth	growth	NN
10_1101-2021_01_07_425723	98	22	factors	factor	NNS
10_1101-2021_01_07_425723	98	23	from	from	IN
10_1101-2021_01_07_425723	98	24	the	the	DT
10_1101-2021_01_07_425723	98	25	medium	medium	NN
10_1101-2021_01_07_425723	98	26	of	of	IN
10_1101-2021_01_07_425723	98	27	these	these	DT
10_1101-2021_01_07_425723	98	28	cultures	culture	NNS
10_1101-2021_01_07_425723	98	29	(	(	-LRB-
10_1101-2021_01_07_425723	98	30	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	98	31	Fig	Fig	NNP
10_1101-2021_01_07_425723	98	32	.	.	.
10_1101-2021_01_07_425723	99	1	6	6	CD
10_1101-2021_01_07_425723	99	2	,	,	,
10_1101-2021_01_07_425723	99	3	contrast	contrast	NN
10_1101-2021_01_07_425723	99	4	43	43	CD
10_1101-2021_01_07_425723	99	5	)	)	-RRB-
10_1101-2021_01_07_425723	99	6	.	.	.
10_1101-2021_01_07_425723	100	1	166	166	CD
10_1101-2021_01_07_425723	100	2	These	these	DT
10_1101-2021_01_07_425723	100	3	observations	observation	NNS
10_1101-2021_01_07_425723	100	4	suggested	suggest	VBD
10_1101-2021_01_07_425723	100	5	that	that	IN
10_1101-2021_01_07_425723	100	6	K.	K.	NNP
10_1101-2021_01_07_425723	100	7	marxianus	marxianus	NN
10_1101-2021_01_07_425723	100	8	may	may	MD
10_1101-2021_01_07_425723	100	9	be	be	VB
10_1101-2021_01_07_425723	100	10	unable	unable	JJ
10_1101-2021_01_07_425723	100	11	to	to	TO
10_1101-2021_01_07_425723	100	12	import	import	VB
10_1101-2021_01_07_425723	100	13	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	100	14	when	when	WRB
10_1101-2021_01_07_425723	100	15	sterol	sterol	NN
10_1101-2021_01_07_425723	100	16	167	167	CD
10_1101-2021_01_07_425723	100	17	synthesis	synthesis	NN
10_1101-2021_01_07_425723	100	18	is	be	VBZ
10_1101-2021_01_07_425723	100	19	compromised	compromise	VBN
10_1101-2021_01_07_425723	100	20	.	.	.
10_1101-2021_01_07_425723	101	1	Consistent	consistent	JJ
10_1101-2021_01_07_425723	101	2	with	with	IN
10_1101-2021_01_07_425723	101	3	this	this	DT
10_1101-2021_01_07_425723	101	4	hypothesis	hypothesis	NN
10_1101-2021_01_07_425723	101	5	,	,	,
10_1101-2021_01_07_425723	101	6	co	co	NN
10_1101-2021_01_07_425723	101	7	-	-	JJ
10_1101-2021_01_07_425723	101	8	orthology	orthology	JJ
10_1101-2021_01_07_425723	101	9	prediction	prediction	NN
10_1101-2021_01_07_425723	101	10	with	with	IN
10_1101-2021_01_07_425723	101	11	Proteinortho38	Proteinortho38	NNP
10_1101-2021_01_07_425723	101	12	168	168	CD
10_1101-2021_01_07_425723	101	13	revealed	reveal	VBD
10_1101-2021_01_07_425723	101	14	no	no	DT
10_1101-2021_01_07_425723	101	15	orthologs	ortholog	NNS
10_1101-2021_01_07_425723	101	16	of	of	IN
10_1101-2021_01_07_425723	101	17	the	the	DT
10_1101-2021_01_07_425723	101	18	S.	S.	NNP
10_1101-2021_01_07_425723	101	19	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	101	20	sterol	sterol	NN
10_1101-2021_01_07_425723	101	21	transporters	transporter	NNS
10_1101-2021_01_07_425723	101	22	Aus1	Aus1	NNP
10_1101-2021_01_07_425723	101	23	and	and	CC
10_1101-2021_01_07_425723	101	24	Pdr11	Pdr11	NNP
10_1101-2021_01_07_425723	101	25	in	in	IN
10_1101-2021_01_07_425723	101	26	K.	K.	NNP
10_1101-2021_01_07_425723	101	27	marxianus	marxianus	NN
10_1101-2021_01_07_425723	101	28	.	.	.
10_1101-2021_01_07_425723	102	1	169	169	CD
10_1101-2021_01_07_425723	102	2	K.	K.	NNP
10_1101-2021_01_07_425723	102	3	marxianus	marxianus	NN
10_1101-2021_01_07_425723	102	4	harbors	harbor	VBZ
10_1101-2021_01_07_425723	102	5	two	two	CD
10_1101-2021_01_07_425723	102	6	dihydroorotate	dihydroorotate	JJ
10_1101-2021_01_07_425723	102	7	dehydrogenases	dehydrogenase	NNS
10_1101-2021_01_07_425723	102	8	,	,	,
10_1101-2021_01_07_425723	102	9	a	a	DT
10_1101-2021_01_07_425723	102	10	cytosolic	cytosolic	JJ
10_1101-2021_01_07_425723	102	11	fumarate	fumarate	RB
10_1101-2021_01_07_425723	102	12	-	-	HYPH
10_1101-2021_01_07_425723	102	13	dependent	dependent	JJ
10_1101-2021_01_07_425723	102	14	enzyme	enzyme	NNS
10_1101-2021_01_07_425723	102	15	170	170	CD
10_1101-2021_01_07_425723	102	16	(	(	-LRB-
10_1101-2021_01_07_425723	102	17	KmUra1	KmUra1	NNP
10_1101-2021_01_07_425723	102	18	)	)	-RRB-
10_1101-2021_01_07_425723	102	19	and	and	CC
10_1101-2021_01_07_425723	102	20	a	a	DT
10_1101-2021_01_07_425723	102	21	mitochondrial	mitochondrial	NN
10_1101-2021_01_07_425723	102	22	quinone	quinone	NN
10_1101-2021_01_07_425723	102	23	-	-	HYPH
10_1101-2021_01_07_425723	102	24	dependent	dependent	JJ
10_1101-2021_01_07_425723	102	25	enzyme	enzyme	NNS
10_1101-2021_01_07_425723	102	26	(	(	-LRB-
10_1101-2021_01_07_425723	102	27	KmUra9	KmUra9	NNP
10_1101-2021_01_07_425723	102	28	)	)	-RRB-
10_1101-2021_01_07_425723	102	29	.	.	.
10_1101-2021_01_07_425723	103	1	In	in	IN
10_1101-2021_01_07_425723	103	2	vivo	vivo	NN
10_1101-2021_01_07_425723	103	3	activity	activity	NN
10_1101-2021_01_07_425723	103	4	of	of	IN
10_1101-2021_01_07_425723	103	5	the	the	DT
10_1101-2021_01_07_425723	103	6	latter	latter	JJ
10_1101-2021_01_07_425723	103	7	171	171	CD
10_1101-2021_01_07_425723	103	8	requires	require	VBZ
10_1101-2021_01_07_425723	103	9	oxygen	oxygen	NN
10_1101-2021_01_07_425723	103	10	because	because	IN
10_1101-2021_01_07_425723	103	11	the	the	DT
10_1101-2021_01_07_425723	103	12	reduced	reduced	JJ
10_1101-2021_01_07_425723	103	13	quinone	quinone	NN
10_1101-2021_01_07_425723	103	14	is	be	VBZ
10_1101-2021_01_07_425723	103	15	reoxidized	reoxidize	VBN
10_1101-2021_01_07_425723	103	16	by	by	IN
10_1101-2021_01_07_425723	103	17	the	the	DT
10_1101-2021_01_07_425723	103	18	mitochondrial	mitochondrial	NN
10_1101-2021_01_07_425723	103	19	respiratory	respiratory	JJ
10_1101-2021_01_07_425723	103	20	chain39	chain39	NNP
10_1101-2021_01_07_425723	103	21	.	.	.
10_1101-2021_01_07_425723	104	1	172	172	CD
10_1101-2021_01_07_425723	104	2	Consistent	consistent	JJ
10_1101-2021_01_07_425723	104	3	with	with	IN
10_1101-2021_01_07_425723	104	4	these	these	DT
10_1101-2021_01_07_425723	104	5	different	different	JJ
10_1101-2021_01_07_425723	104	6	oxygen	oxygen	NN
10_1101-2021_01_07_425723	104	7	requirements	requirement	NNS
10_1101-2021_01_07_425723	104	8	,	,	,
10_1101-2021_01_07_425723	104	9	KmURA9	KmURA9	NNP
10_1101-2021_01_07_425723	104	10	was	be	VBD
10_1101-2021_01_07_425723	104	11	down	down	RB
10_1101-2021_01_07_425723	104	12	-	-	HYPH
10_1101-2021_01_07_425723	104	13	regulated	regulated	JJ
10_1101-2021_01_07_425723	104	14	under	under	IN
10_1101-2021_01_07_425723	104	15	severely	severely	RB
10_1101-2021_01_07_425723	104	16	173	173	CD
10_1101-2021_01_07_425723	104	17	oxygen	oxygen	NN
10_1101-2021_01_07_425723	104	18	-	-	HYPH
10_1101-2021_01_07_425723	104	19	limited	limit	VBN
10_1101-2021_01_07_425723	104	20	conditions	condition	NNS
10_1101-2021_01_07_425723	104	21	,	,	,
10_1101-2021_01_07_425723	104	22	while	while	IN
10_1101-2021_01_07_425723	104	23	KmURA1	KmURA1	NNP
10_1101-2021_01_07_425723	104	24	was	be	VBD
10_1101-2021_01_07_425723	104	25	upregulated	upregulated	JJ
10_1101-2021_01_07_425723	104	26	(	(	-LRB-
10_1101-2021_01_07_425723	104	27	Fig	fig	NN
10_1101-2021_01_07_425723	104	28	.	.	.
10_1101-2021_01_07_425723	105	1	2b	2b	NNP
10_1101-2021_01_07_425723	105	2	,	,	,
10_1101-2021_01_07_425723	105	3	contrast	contrast	NN
10_1101-2021_01_07_425723	105	4	31	31	CD
10_1101-2021_01_07_425723	105	5	)	)	-RRB-
10_1101-2021_01_07_425723	105	6	.	.	.
10_1101-2021_01_07_425723	106	1	Upregulation	upregulation	NN
10_1101-2021_01_07_425723	106	2	of	of	IN
10_1101-2021_01_07_425723	106	3	174	174	CD
10_1101-2021_01_07_425723	106	4	KmURA1	KmURA1	NNP
10_1101-2021_01_07_425723	106	5	coincided	coincide	VBN
10_1101-2021_01_07_425723	106	6	with	with	IN
10_1101-2021_01_07_425723	106	7	increased	increase	VBN
10_1101-2021_01_07_425723	106	8	production	production	NN
10_1101-2021_01_07_425723	106	9	of	of	IN
10_1101-2021_01_07_425723	106	10	succinate	succinate	NN
10_1101-2021_01_07_425723	106	11	(	(	-LRB-
10_1101-2021_01_07_425723	106	12	Table	table	NN
10_1101-2021_01_07_425723	106	13	1	1	CD
10_1101-2021_01_07_425723	106	14	)	)	-RRB-
10_1101-2021_01_07_425723	106	15	.	.	.
10_1101-2021_01_07_425723	107	1	175	175	CD
10_1101-2021_01_07_425723	107	2	.CC	.CC	:
10_1101-2021_01_07_425723	107	3	-	-	HYPH
10_1101-2021_01_07_425723	107	4	BY	by	IN
10_1101-2021_01_07_425723	107	5	-	-	HYPH
10_1101-2021_01_07_425723	107	6	NC	NC	NNP
10_1101-2021_01_07_425723	107	7	-	-	HYPH
10_1101-2021_01_07_425723	107	8	ND	ND	NNP
10_1101-2021_01_07_425723	107	9	4.0	4.0	CD
10_1101-2021_01_07_425723	107	10	International	International	NNP
10_1101-2021_01_07_425723	107	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	107	12	under	under	IN
10_1101-2021_01_07_425723	107	13	a	a	DT
10_1101-2021_01_07_425723	107	14	(	(	-LRB-
10_1101-2021_01_07_425723	107	15	which	which	WDT
10_1101-2021_01_07_425723	107	16	was	be	VBD
10_1101-2021_01_07_425723	107	17	not	not	RB
10_1101-2021_01_07_425723	107	18	certified	certify	VBN
10_1101-2021_01_07_425723	107	19	by	by	IN
10_1101-2021_01_07_425723	107	20	peer	peer	NN
10_1101-2021_01_07_425723	107	21	review	review	NN
10_1101-2021_01_07_425723	107	22	)	)	-RRB-
10_1101-2021_01_07_425723	107	23	is	be	VBZ
10_1101-2021_01_07_425723	107	24	the	the	DT
10_1101-2021_01_07_425723	107	25	author	author	NN
10_1101-2021_01_07_425723	107	26	/	/	SYM
10_1101-2021_01_07_425723	107	27	funder	funder	NN
10_1101-2021_01_07_425723	107	28	,	,	,
10_1101-2021_01_07_425723	107	29	who	who	WP
10_1101-2021_01_07_425723	107	30	has	have	VBZ
10_1101-2021_01_07_425723	107	31	granted	grant	VBN
10_1101-2021_01_07_425723	107	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	107	33	a	a	DT
10_1101-2021_01_07_425723	107	34	license	license	NN
10_1101-2021_01_07_425723	107	35	to	to	TO
10_1101-2021_01_07_425723	107	36	display	display	VB
10_1101-2021_01_07_425723	107	37	the	the	DT
10_1101-2021_01_07_425723	107	38	preprint	preprint	NN
10_1101-2021_01_07_425723	107	39	in	in	IN
10_1101-2021_01_07_425723	107	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	107	41	.	.	.
10_1101-2021_01_07_425723	108	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	108	2	is	be	VBZ
10_1101-2021_01_07_425723	108	3	made	make	VBN
10_1101-2021_01_07_425723	108	4	The	the	DT
10_1101-2021_01_07_425723	108	5	copyright	copyright	NN
10_1101-2021_01_07_425723	108	6	holder	holder	NN
10_1101-2021_01_07_425723	108	7	for	for	IN
10_1101-2021_01_07_425723	108	8	this	this	DT
10_1101-2021_01_07_425723	108	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	108	10	version	version	NN
10_1101-2021_01_07_425723	108	11	posted	post	VBD
10_1101-2021_01_07_425723	108	12	January	January	NNP
10_1101-2021_01_07_425723	108	13	8	8	CD
10_1101-2021_01_07_425723	108	14	,	,	,
10_1101-2021_01_07_425723	108	15	2021	2021	CD
10_1101-2021_01_07_425723	108	16	.	.	.
10_1101-2021_01_07_425723	108	17	;	;	:
10_1101-2021_01_07_425723	108	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	108	19	:	:	:
10_1101-2021_01_07_425723	108	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	108	21	preprint	preprint	NN
10_1101-2021_01_07_425723	108	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	108	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	108	24	11	11	CD
10_1101-2021_01_07_425723	108	25	Fig	Fig	NNP
10_1101-2021_01_07_425723	108	26	.	.	.
10_1101-2021_01_07_425723	109	1	2	2	CD
10_1101-2021_01_07_425723	109	2	|	|	JJ
10_1101-2021_01_07_425723	109	3	Transcriptional	transcriptional	JJ
10_1101-2021_01_07_425723	109	4	response	response	NN
10_1101-2021_01_07_425723	109	5	of	of	IN
10_1101-2021_01_07_425723	109	6	K.	K.	NNP
10_1101-2021_01_07_425723	109	7	marxianus	marxianus	NN
10_1101-2021_01_07_425723	109	8	and	and	CC
10_1101-2021_01_07_425723	109	9	S.	S.	NNP
10_1101-2021_01_07_425723	109	10	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	109	11	to	to	TO
10_1101-2021_01_07_425723	109	12	oxygen	oxygen	VB
10_1101-2021_01_07_425723	109	13	limitation	limitation	NN
10_1101-2021_01_07_425723	109	14	and	and	CC
10_1101-2021_01_07_425723	109	15	sterol	sterol	NN
10_1101-2021_01_07_425723	109	16	,	,	,
10_1101-2021_01_07_425723	109	17	176	176	CD
10_1101-2021_01_07_425723	109	18	Tween	Tween	NNP
10_1101-2021_01_07_425723	109	19	80	80	CD
10_1101-2021_01_07_425723	109	20	supplementation	supplementation	NN
10_1101-2021_01_07_425723	109	21	.	.	.
10_1101-2021_01_07_425723	110	1	Transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	110	2	analyses	analysis	NNS
10_1101-2021_01_07_425723	110	3	were	be	VBD
10_1101-2021_01_07_425723	110	4	performed	perform	VBN
10_1101-2021_01_07_425723	110	5	for	for	IN
10_1101-2021_01_07_425723	110	6	each	each	DT
10_1101-2021_01_07_425723	110	7	cultivation	cultivation	NN
10_1101-2021_01_07_425723	110	8	regime	regime	NN
10_1101-2021_01_07_425723	110	9	(	(	-LRB-
10_1101-2021_01_07_425723	110	10	1	1	CD
10_1101-2021_01_07_425723	110	11	to	to	IN
10_1101-2021_01_07_425723	110	12	177	177	CD
10_1101-2021_01_07_425723	110	13	5	5	CD
10_1101-2021_01_07_425723	110	14	)	)	-RRB-
10_1101-2021_01_07_425723	110	15	of	of	IN
10_1101-2021_01_07_425723	110	16	S.	S.	NNP
10_1101-2021_01_07_425723	110	17	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	110	18	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	110	19	-	-	HYPH
10_1101-2021_01_07_425723	110	20	7D	7D	NNP
10_1101-2021_01_07_425723	110	21	(	(	-LRB-
10_1101-2021_01_07_425723	110	22	scer	scer	NN
10_1101-2021_01_07_425723	110	23	)	)	-RRB-
10_1101-2021_01_07_425723	110	24	and	and	CC
10_1101-2021_01_07_425723	110	25	K.	K.	NNP
10_1101-2021_01_07_425723	110	26	marxianus	marxianus	NN
10_1101-2021_01_07_425723	110	27	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	110	28	(	(	-LRB-
10_1101-2021_01_07_425723	110	29	kmar	kmar	NNP
10_1101-2021_01_07_425723	110	30	)	)	-RRB-
10_1101-2021_01_07_425723	110	31	.	.	.
10_1101-2021_01_07_425723	111	1	Data	datum	NNS
10_1101-2021_01_07_425723	111	2	for	for	IN
10_1101-2021_01_07_425723	111	3	each	each	DT
10_1101-2021_01_07_425723	111	4	regime	regime	NN
10_1101-2021_01_07_425723	111	5	were	be	VBD
10_1101-2021_01_07_425723	111	6	178	178	CD
10_1101-2021_01_07_425723	111	7	obtained	obtain	VBN
10_1101-2021_01_07_425723	111	8	from	from	IN
10_1101-2021_01_07_425723	111	9	independent	independent	JJ
10_1101-2021_01_07_425723	111	10	replicate	replicate	NN
10_1101-2021_01_07_425723	111	11	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	111	12	cultures	culture	NNS
10_1101-2021_01_07_425723	111	13	(	(	-LRB-
10_1101-2021_01_07_425723	111	14	Fig	fig	NN
10_1101-2021_01_07_425723	111	15	.	.	.
10_1101-2021_01_07_425723	112	1	1	1	LS
10_1101-2021_01_07_425723	112	2	)	)	-RRB-
10_1101-2021_01_07_425723	112	3	.	.	.
10_1101-2021_01_07_425723	113	1	a	a	LS
10_1101-2021_01_07_425723	113	2	,	,	,
10_1101-2021_01_07_425723	113	3	Comparison	Comparison	NNP
10_1101-2021_01_07_425723	113	4	of	of	IN
10_1101-2021_01_07_425723	113	5	GO	GO	NNP
10_1101-2021_01_07_425723	113	6	-	-	HYPH
10_1101-2021_01_07_425723	113	7	term	term	NN
10_1101-2021_01_07_425723	113	8	gene	gene	NN
10_1101-2021_01_07_425723	113	9	-	-	HYPH
10_1101-2021_01_07_425723	113	10	set	set	VBN
10_1101-2021_01_07_425723	113	11	179	179	CD
10_1101-2021_01_07_425723	113	12	enrichment	enrichment	NN
10_1101-2021_01_07_425723	113	13	analysis	analysis	NN
10_1101-2021_01_07_425723	113	14	of	of	IN
10_1101-2021_01_07_425723	113	15	biological	biological	JJ
10_1101-2021_01_07_425723	113	16	processes	process	NNS
10_1101-2021_01_07_425723	113	17	in	in	IN
10_1101-2021_01_07_425723	113	18	contrast	contrast	NN
10_1101-2021_01_07_425723	113	19	31	31	CD
10_1101-2021_01_07_425723	113	20	of	of	IN
10_1101-2021_01_07_425723	113	21	S.	S.	NNP
10_1101-2021_01_07_425723	113	22	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	113	23	and	and	CC
10_1101-2021_01_07_425723	113	24	K.	K.	NNP
10_1101-2021_01_07_425723	113	25	marxianus	marxianus	NN
10_1101-2021_01_07_425723	113	26	with	with	IN
10_1101-2021_01_07_425723	113	27	short	short	JJ
10_1101-2021_01_07_425723	113	28	180	180	CD
10_1101-2021_01_07_425723	113	29	description	description	NN
10_1101-2021_01_07_425723	113	30	of	of	IN
10_1101-2021_01_07_425723	113	31	GO	go	NN
10_1101-2021_01_07_425723	113	32	-	-	HYPH
10_1101-2021_01_07_425723	113	33	terms	term	NNS
10_1101-2021_01_07_425723	113	34	(	(	-LRB-
10_1101-2021_01_07_425723	113	35	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	113	36	Fig	Fig	NNP
10_1101-2021_01_07_425723	113	37	.	.	.
10_1101-2021_01_07_425723	114	1	2	2	LS
10_1101-2021_01_07_425723	114	2	-	-	SYM
10_1101-2021_01_07_425723	114	3	5	5	CD
10_1101-2021_01_07_425723	114	4	)	)	-RRB-
10_1101-2021_01_07_425723	114	5	.	.	.
10_1101-2021_01_07_425723	115	1	GO	go	NN
10_1101-2021_01_07_425723	115	2	-	-	HYPH
10_1101-2021_01_07_425723	115	3	terms	term	NNS
10_1101-2021_01_07_425723	115	4	were	be	VBD
10_1101-2021_01_07_425723	115	5	vertically	vertically	RB
10_1101-2021_01_07_425723	115	6	ordered	order	VBN
10_1101-2021_01_07_425723	115	7	based	base	VBN
10_1101-2021_01_07_425723	115	8	on	on	IN
10_1101-2021_01_07_425723	115	9	their	-PRON-	PRP$
10_1101-2021_01_07_425723	115	10	181	181	CD
10_1101-2021_01_07_425723	115	11	distinct	distinct	JJ
10_1101-2021_01_07_425723	115	12	directionality	directionality	NN
10_1101-2021_01_07_425723	115	13	calculated	calculate	VBN
10_1101-2021_01_07_425723	115	14	with	with	IN
10_1101-2021_01_07_425723	115	15	Piano40	Piano40	NNP
10_1101-2021_01_07_425723	115	16	with	with	IN
10_1101-2021_01_07_425723	115	17	GO	GO	NNP
10_1101-2021_01_07_425723	115	18	-	-	HYPH
10_1101-2021_01_07_425723	115	19	terms	term	NNS
10_1101-2021_01_07_425723	115	20	enriched	enrich	VBN
10_1101-2021_01_07_425723	115	21	solely	solely	RB
10_1101-2021_01_07_425723	115	22	with	with	IN
10_1101-2021_01_07_425723	115	23	up	up	RB
10_1101-2021_01_07_425723	115	24	-	-	HYPH
10_1101-2021_01_07_425723	115	25	regulated	regulate	VBN
10_1101-2021_01_07_425723	115	26	genes	gene	NNS
10_1101-2021_01_07_425723	115	27	182	182	CD
10_1101-2021_01_07_425723	115	28	(	(	-LRB-
10_1101-2021_01_07_425723	115	29	blue	blue	NNP
10_1101-2021_01_07_425723	115	30	)	)	-RRB-
10_1101-2021_01_07_425723	115	31	at	at	IN
10_1101-2021_01_07_425723	115	32	the	the	DT
10_1101-2021_01_07_425723	115	33	top	top	NN
10_1101-2021_01_07_425723	115	34	,	,	,
10_1101-2021_01_07_425723	115	35	GO	GO	NNP
10_1101-2021_01_07_425723	115	36	-	-	HYPH
10_1101-2021_01_07_425723	115	37	terms	term	NNS
10_1101-2021_01_07_425723	115	38	with	with	IN
10_1101-2021_01_07_425723	115	39	mixed-	mixed-	NNP
10_1101-2021_01_07_425723	115	40	or	or	CC
10_1101-2021_01_07_425723	115	41	no	no	DT
10_1101-2021_01_07_425723	115	42	-	-	HYPH
10_1101-2021_01_07_425723	115	43	directionality	directionality	NN
10_1101-2021_01_07_425723	115	44	in	in	IN
10_1101-2021_01_07_425723	115	45	the	the	DT
10_1101-2021_01_07_425723	115	46	middle	middle	NNP
10_1101-2021_01_07_425723	115	47	(	(	-LRB-
10_1101-2021_01_07_425723	115	48	white	white	NNP
10_1101-2021_01_07_425723	115	49	)	)	-RRB-
10_1101-2021_01_07_425723	115	50	and	and	CC
10_1101-2021_01_07_425723	115	51	GO	GO	NNP
10_1101-2021_01_07_425723	115	52	-	-	HYPH
10_1101-2021_01_07_425723	115	53	terms	term	NNS
10_1101-2021_01_07_425723	115	54	with	with	IN
10_1101-2021_01_07_425723	115	55	183	183	CD
10_1101-2021_01_07_425723	115	56	solely	solely	RB
10_1101-2021_01_07_425723	115	57	down	down	RB
10_1101-2021_01_07_425723	115	58	-	-	HYPH
10_1101-2021_01_07_425723	115	59	regulated	regulate	VBN
10_1101-2021_01_07_425723	115	60	genes	gene	NNS
10_1101-2021_01_07_425723	115	61	at	at	IN
10_1101-2021_01_07_425723	115	62	the	the	DT
10_1101-2021_01_07_425723	115	63	bottom	bottom	NN
10_1101-2021_01_07_425723	115	64	(	(	-LRB-
10_1101-2021_01_07_425723	115	65	brown	brown	NNP
10_1101-2021_01_07_425723	115	66	)	)	-RRB-
10_1101-2021_01_07_425723	115	67	.	.	.
10_1101-2021_01_07_425723	116	1	b	b	NNP
10_1101-2021_01_07_425723	116	2	,	,	,
10_1101-2021_01_07_425723	116	3	c	c	NNP
10_1101-2021_01_07_425723	116	4	,	,	,
10_1101-2021_01_07_425723	116	5	d	d	NNP
10_1101-2021_01_07_425723	116	6	,	,	,
10_1101-2021_01_07_425723	116	7	Subsets	Subsets	NNPS
10_1101-2021_01_07_425723	116	8	of	of	IN
10_1101-2021_01_07_425723	116	9	differentially	differentially	RB
10_1101-2021_01_07_425723	116	10	expressed	express	VBD
10_1101-2021_01_07_425723	116	11	184	184	CD
10_1101-2021_01_07_425723	116	12	orthologous	orthologous	JJ
10_1101-2021_01_07_425723	116	13	genes	gene	NNS
10_1101-2021_01_07_425723	116	14	obtained	obtain	VBN
10_1101-2021_01_07_425723	116	15	from	from	IN
10_1101-2021_01_07_425723	116	16	the	the	DT
10_1101-2021_01_07_425723	116	17	gene	gene	NN
10_1101-2021_01_07_425723	116	18	-	-	HYPH
10_1101-2021_01_07_425723	116	19	set	set	VBN
10_1101-2021_01_07_425723	116	20	analyses	analysis	NNS
10_1101-2021_01_07_425723	116	21	for	for	IN
10_1101-2021_01_07_425723	116	22	both	both	DT
10_1101-2021_01_07_425723	116	23	yeasts	yeast	NNS
10_1101-2021_01_07_425723	116	24	in	in	IN
10_1101-2021_01_07_425723	116	25	contrasts	contrasts	NNP
10_1101-2021_01_07_425723	116	26	31	31	CD
10_1101-2021_01_07_425723	116	27	and	and	CC
10_1101-2021_01_07_425723	116	28	43	43	CD
10_1101-2021_01_07_425723	116	29	,	,	,
10_1101-2021_01_07_425723	116	30	and	and	CC
10_1101-2021_01_07_425723	116	31	with	with	IN
10_1101-2021_01_07_425723	116	32	185	185	CD
10_1101-2021_01_07_425723	116	33	genes	gene	NNS
10_1101-2021_01_07_425723	116	34	without	without	IN
10_1101-2021_01_07_425723	116	35	orthologs	ortholog	NNS
10_1101-2021_01_07_425723	116	36	depicted	depict	VBN
10_1101-2021_01_07_425723	116	37	with	with	IN
10_1101-2021_01_07_425723	116	38	logFC	logfc	IN
10_1101-2021_01_07_425723	116	39	value	value	NN
10_1101-2021_01_07_425723	116	40	of	of	IN
10_1101-2021_01_07_425723	116	41	0	0	CD
10_1101-2021_01_07_425723	116	42	in	in	IN
10_1101-2021_01_07_425723	116	43	the	the	DT
10_1101-2021_01_07_425723	116	44	respective	respective	JJ
10_1101-2021_01_07_425723	116	45	yeast	yeast	NN
10_1101-2021_01_07_425723	116	46	.	.	.
10_1101-2021_01_07_425723	117	1	b	b	LS
10_1101-2021_01_07_425723	117	2	,	,	,
10_1101-2021_01_07_425723	117	3	S.	S.	NNP
10_1101-2021_01_07_425723	117	4	cerevisiae	cerevisiae	NN
10_1101-2021_01_07_425723	117	5	genes	gene	NNS
10_1101-2021_01_07_425723	117	6	186	186	CD
10_1101-2021_01_07_425723	117	7	previously	previously	RB
10_1101-2021_01_07_425723	117	8	shown	show	VBN
10_1101-2021_01_07_425723	117	9	as	as	IN
10_1101-2021_01_07_425723	117	10	consistently	consistently	RB
10_1101-2021_01_07_425723	117	11	upregulated	upregulate	VBN
10_1101-2021_01_07_425723	117	12	under	under	IN
10_1101-2021_01_07_425723	117	13	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	117	14	conditions	condition	NNS
10_1101-2021_01_07_425723	117	15	in	in	IN
10_1101-2021_01_07_425723	117	16	four	four	CD
10_1101-2021_01_07_425723	117	17	different	different	JJ
10_1101-2021_01_07_425723	117	18	nutrient-187	nutrient-187	HYPH
10_1101-2021_01_07_425723	117	19	.CC	.CC	,
10_1101-2021_01_07_425723	117	20	-	-	HYPH
10_1101-2021_01_07_425723	117	21	BY	by	IN
10_1101-2021_01_07_425723	117	22	-	-	HYPH
10_1101-2021_01_07_425723	117	23	NC	NC	NNP
10_1101-2021_01_07_425723	117	24	-	-	HYPH
10_1101-2021_01_07_425723	117	25	ND	ND	NNP
10_1101-2021_01_07_425723	117	26	4.0	4.0	CD
10_1101-2021_01_07_425723	117	27	International	International	NNP
10_1101-2021_01_07_425723	117	28	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	117	29	under	under	IN
10_1101-2021_01_07_425723	117	30	a	a	DT
10_1101-2021_01_07_425723	117	31	(	(	-LRB-
10_1101-2021_01_07_425723	117	32	which	which	WDT
10_1101-2021_01_07_425723	117	33	was	be	VBD
10_1101-2021_01_07_425723	117	34	not	not	RB
10_1101-2021_01_07_425723	117	35	certified	certify	VBN
10_1101-2021_01_07_425723	117	36	by	by	IN
10_1101-2021_01_07_425723	117	37	peer	peer	NN
10_1101-2021_01_07_425723	117	38	review	review	NN
10_1101-2021_01_07_425723	117	39	)	)	-RRB-
10_1101-2021_01_07_425723	117	40	is	be	VBZ
10_1101-2021_01_07_425723	117	41	the	the	DT
10_1101-2021_01_07_425723	117	42	author	author	NN
10_1101-2021_01_07_425723	117	43	/	/	SYM
10_1101-2021_01_07_425723	117	44	funder	funder	NN
10_1101-2021_01_07_425723	117	45	,	,	,
10_1101-2021_01_07_425723	117	46	who	who	WP
10_1101-2021_01_07_425723	117	47	has	have	VBZ
10_1101-2021_01_07_425723	117	48	granted	grant	VBN
10_1101-2021_01_07_425723	117	49	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	117	50	a	a	DT
10_1101-2021_01_07_425723	117	51	license	license	NN
10_1101-2021_01_07_425723	117	52	to	to	TO
10_1101-2021_01_07_425723	117	53	display	display	VB
10_1101-2021_01_07_425723	117	54	the	the	DT
10_1101-2021_01_07_425723	117	55	preprint	preprint	NN
10_1101-2021_01_07_425723	117	56	in	in	IN
10_1101-2021_01_07_425723	117	57	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	117	58	.	.	.
10_1101-2021_01_07_425723	118	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	118	2	is	be	VBZ
10_1101-2021_01_07_425723	118	3	made	make	VBN
10_1101-2021_01_07_425723	118	4	The	the	DT
10_1101-2021_01_07_425723	118	5	copyright	copyright	NN
10_1101-2021_01_07_425723	118	6	holder	holder	NN
10_1101-2021_01_07_425723	118	7	for	for	IN
10_1101-2021_01_07_425723	118	8	this	this	DT
10_1101-2021_01_07_425723	118	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	118	10	version	version	NN
10_1101-2021_01_07_425723	118	11	posted	post	VBD
10_1101-2021_01_07_425723	118	12	January	January	NNP
10_1101-2021_01_07_425723	118	13	8	8	CD
10_1101-2021_01_07_425723	118	14	,	,	,
10_1101-2021_01_07_425723	118	15	2021	2021	CD
10_1101-2021_01_07_425723	118	16	.	.	.
10_1101-2021_01_07_425723	118	17	;	;	:
10_1101-2021_01_07_425723	118	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	118	19	:	:	:
10_1101-2021_01_07_425723	118	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	118	21	preprint	preprint	NN
10_1101-2021_01_07_425723	118	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	118	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	118	24	12	12	CD
10_1101-2021_01_07_425723	118	25	limitations41	limitations41	CD
10_1101-2021_01_07_425723	118	26	.	.	.
10_1101-2021_01_07_425723	119	1	c	c	LS
10_1101-2021_01_07_425723	119	2	,	,	,
10_1101-2021_01_07_425723	119	3	As	as	IN
10_1101-2021_01_07_425723	119	4	described	describe	VBN
10_1101-2021_01_07_425723	119	5	for	for	IN
10_1101-2021_01_07_425723	119	6	panel	panel	NN
10_1101-2021_01_07_425723	119	7	b	b	NNP
10_1101-2021_01_07_425723	119	8	but	but	CC
10_1101-2021_01_07_425723	119	9	for	for	IN
10_1101-2021_01_07_425723	119	10	downregulated	downregulated	JJ
10_1101-2021_01_07_425723	119	11	genes	gene	NNS
10_1101-2021_01_07_425723	119	12	.	.	.
10_1101-2021_01_07_425723	120	1	d	d	LS
10_1101-2021_01_07_425723	120	2	,	,	,
10_1101-2021_01_07_425723	120	3	Differentially	Differentially	NNP
10_1101-2021_01_07_425723	120	4	expressed	express	VBD
10_1101-2021_01_07_425723	120	5	genes	gene	NNS
10_1101-2021_01_07_425723	120	6	188	188	CD
10_1101-2021_01_07_425723	120	7	uniquely	uniquely	RB
10_1101-2021_01_07_425723	120	8	found	find	VBN
10_1101-2021_01_07_425723	120	9	in	in	IN
10_1101-2021_01_07_425723	120	10	this	this	DT
10_1101-2021_01_07_425723	120	11	study	study	NN
10_1101-2021_01_07_425723	120	12	.	.	.
10_1101-2021_01_07_425723	121	1	e	e	NNP
10_1101-2021_01_07_425723	121	2	,	,	,
10_1101-2021_01_07_425723	121	3	f	f	NNP
10_1101-2021_01_07_425723	121	4	,	,	,
10_1101-2021_01_07_425723	121	5	g	g	NNP
10_1101-2021_01_07_425723	121	6	,	,	,
10_1101-2021_01_07_425723	121	7	h	h	NN
10_1101-2021_01_07_425723	121	8	,	,	,
10_1101-2021_01_07_425723	121	9	Highlighted	highlight	VBN
10_1101-2021_01_07_425723	121	10	gene	gene	NN
10_1101-2021_01_07_425723	121	11	-	-	HYPH
10_1101-2021_01_07_425723	121	12	sets	set	NNS
10_1101-2021_01_07_425723	121	13	showing	show	VBG
10_1101-2021_01_07_425723	121	14	divergent	divergent	JJ
10_1101-2021_01_07_425723	121	15	expression	expression	NN
10_1101-2021_01_07_425723	121	16	patterns	pattern	NNS
10_1101-2021_01_07_425723	121	17	189	189	CD
10_1101-2021_01_07_425723	121	18	across	across	IN
10_1101-2021_01_07_425723	121	19	the	the	DT
10_1101-2021_01_07_425723	121	20	two	two	CD
10_1101-2021_01_07_425723	121	21	yeasts	yeast	NNS
10_1101-2021_01_07_425723	121	22	.	.	.
10_1101-2021_01_07_425723	122	1	e	e	LS
10_1101-2021_01_07_425723	122	2	,	,	,
10_1101-2021_01_07_425723	122	3	S.	S.	NNP
10_1101-2021_01_07_425723	122	4	cerevisiae	cerevisiae	NN
10_1101-2021_01_07_425723	122	5	genes	gene	NNS
10_1101-2021_01_07_425723	122	6	upregulated	upregulate	VBN
10_1101-2021_01_07_425723	122	7	in	in	IN
10_1101-2021_01_07_425723	122	8	contrast	contrast	NN
10_1101-2021_01_07_425723	122	9	31	31	CD
10_1101-2021_01_07_425723	122	10	but	but	CC
10_1101-2021_01_07_425723	122	11	downregulated	downregulate	VBN
10_1101-2021_01_07_425723	122	12	in	in	IN
10_1101-2021_01_07_425723	122	13	K.	K.	NNP
10_1101-2021_01_07_425723	122	14	190	190	CD
10_1101-2021_01_07_425723	122	15	marxianus	marxianus	NN
10_1101-2021_01_07_425723	122	16	.	.	.
10_1101-2021_01_07_425723	123	1	f	f	LS
10_1101-2021_01_07_425723	123	2	,	,	,
10_1101-2021_01_07_425723	123	3	S.	S.	NNP
10_1101-2021_01_07_425723	123	4	cerevisiae	cerevisiae	NN
10_1101-2021_01_07_425723	123	5	genes	gene	NNS
10_1101-2021_01_07_425723	123	6	downregulated	downregulate	VBN
10_1101-2021_01_07_425723	123	7	in	in	IN
10_1101-2021_01_07_425723	123	8	contrast	contrast	NN
10_1101-2021_01_07_425723	123	9	31	31	CD
10_1101-2021_01_07_425723	123	10	but	but	CC
10_1101-2021_01_07_425723	123	11	upregulated	upregulated	JJ
10_1101-2021_01_07_425723	123	12	in	in	IN
10_1101-2021_01_07_425723	123	13	K.	K.	NNP
10_1101-2021_01_07_425723	123	14	marxianus	marxianus	NN
10_1101-2021_01_07_425723	123	15	.	.	.
10_1101-2021_01_07_425723	124	1	g	g	NNP
10_1101-2021_01_07_425723	124	2	,	,	,
10_1101-2021_01_07_425723	124	3	h	h	NN
10_1101-2021_01_07_425723	124	4	,	,	,
10_1101-2021_01_07_425723	124	5	191	191	CD
10_1101-2021_01_07_425723	124	6	Similar	similar	JJ
10_1101-2021_01_07_425723	124	7	to	to	IN
10_1101-2021_01_07_425723	124	8	e	e	NN
10_1101-2021_01_07_425723	124	9	and	and	CC
10_1101-2021_01_07_425723	124	10	f	f	NNP
10_1101-2021_01_07_425723	124	11	but	but	CC
10_1101-2021_01_07_425723	124	12	for	for	IN
10_1101-2021_01_07_425723	124	13	contrast	contrast	NN
10_1101-2021_01_07_425723	124	14	43	43	CD
10_1101-2021_01_07_425723	124	15	.	.	.
10_1101-2021_01_07_425723	125	1	192	192	CD
10_1101-2021_01_07_425723	125	2	Fig	fig	NN
10_1101-2021_01_07_425723	125	3	.	.	.
10_1101-2021_01_07_425723	126	1	3	3	CD
10_1101-2021_01_07_425723	126	2	|	|	NNP
10_1101-2021_01_07_425723	126	3	Different	different	JJ
10_1101-2021_01_07_425723	126	4	transcriptional	transcriptional	JJ
10_1101-2021_01_07_425723	126	5	regulation	regulation	NN
10_1101-2021_01_07_425723	126	6	of	of	IN
10_1101-2021_01_07_425723	126	7	ergosterol	ergosterol	JJ
10_1101-2021_01_07_425723	126	8	-	-	HYPH
10_1101-2021_01_07_425723	126	9	biosynthesis	biosynthesis	NN
10_1101-2021_01_07_425723	126	10	in	in	IN
10_1101-2021_01_07_425723	126	11	K.	K.	NNP
10_1101-2021_01_07_425723	126	12	marxianus	marxianus	NN
10_1101-2021_01_07_425723	126	13	and	and	CC
10_1101-2021_01_07_425723	126	14	S.	S.	NNP
10_1101-2021_01_07_425723	126	15	193	193	CD
10_1101-2021_01_07_425723	126	16	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	126	17	.	.	.
10_1101-2021_01_07_425723	127	1	a	a	LS
10_1101-2021_01_07_425723	127	2	,	,	,
10_1101-2021_01_07_425723	127	3	RNAseq	RNAseq	NNP
10_1101-2021_01_07_425723	127	4	was	be	VBD
10_1101-2021_01_07_425723	127	5	performed	perform	VBN
10_1101-2021_01_07_425723	127	6	on	on	IN
10_1101-2021_01_07_425723	127	7	independent	independent	JJ
10_1101-2021_01_07_425723	127	8	replicate	replicate	NN
10_1101-2021_01_07_425723	127	9	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	127	10	cultures	culture	NNS
10_1101-2021_01_07_425723	127	11	of	of	IN
10_1101-2021_01_07_425723	127	12	S.	S.	NNP
10_1101-2021_01_07_425723	127	13	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	127	14	194	194	CD
10_1101-2021_01_07_425723	127	15	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	127	16	-	-	HYPH
10_1101-2021_01_07_425723	127	17	7D	7D	NNP
10_1101-2021_01_07_425723	127	18	and	and	CC
10_1101-2021_01_07_425723	127	19	K.	K.	NNP
10_1101-2021_01_07_425723	127	20	marxianus	marxianus	NN
10_1101-2021_01_07_425723	127	21	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	127	22	for	for	IN
10_1101-2021_01_07_425723	127	23	each	each	DT
10_1101-2021_01_07_425723	127	24	aeration	aeration	NN
10_1101-2021_01_07_425723	127	25	and	and	CC
10_1101-2021_01_07_425723	127	26	anaerobic	anaerobic	NN
10_1101-2021_01_07_425723	127	27	-	-	HYPH
10_1101-2021_01_07_425723	127	28	growth	growth	NN
10_1101-2021_01_07_425723	127	29	-	-	HYPH
10_1101-2021_01_07_425723	127	30	factor	factor	NN
10_1101-2021_01_07_425723	127	31	195	195	CD
10_1101-2021_01_07_425723	127	32	supplementation	supplementation	NN
10_1101-2021_01_07_425723	127	33	regime	regime	NN
10_1101-2021_01_07_425723	127	34	(	(	-LRB-
10_1101-2021_01_07_425723	127	35	1	1	CD
10_1101-2021_01_07_425723	127	36	to	to	IN
10_1101-2021_01_07_425723	127	37	5	5	CD
10_1101-2021_01_07_425723	127	38	;	;	:
10_1101-2021_01_07_425723	127	39	Fig	Fig	NNP
10_1101-2021_01_07_425723	127	40	.	.	.
10_1101-2021_01_07_425723	128	1	1	1	LS
10_1101-2021_01_07_425723	128	2	)	)	-RRB-
10_1101-2021_01_07_425723	128	3	.	.	.
10_1101-2021_01_07_425723	129	1	b	b	LS
10_1101-2021_01_07_425723	129	2	,	,	,
10_1101-2021_01_07_425723	129	3	Transcriptional	transcriptional	JJ
10_1101-2021_01_07_425723	129	4	differences	difference	NNS
10_1101-2021_01_07_425723	129	5	in	in	IN
10_1101-2021_01_07_425723	129	6	the	the	DT
10_1101-2021_01_07_425723	129	7	mevalonate-	mevalonate-	NNS
10_1101-2021_01_07_425723	129	8	and	and	CC
10_1101-2021_01_07_425723	129	9	196	196	CD
10_1101-2021_01_07_425723	129	10	ergosterol	ergosterol	JJ
10_1101-2021_01_07_425723	129	11	-	-	HYPH
10_1101-2021_01_07_425723	129	12	pathway	pathway	NN
10_1101-2021_01_07_425723	129	13	genes	gene	NNS
10_1101-2021_01_07_425723	129	14	of	of	IN
10_1101-2021_01_07_425723	129	15	S.	S.	NNP
10_1101-2021_01_07_425723	129	16	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	129	17	and	and	CC
10_1101-2021_01_07_425723	129	18	K.	K.	NNP
10_1101-2021_01_07_425723	129	19	marxianus	marxianus	NN
10_1101-2021_01_07_425723	129	20	for	for	IN
10_1101-2021_01_07_425723	129	21	contrasts	contrast	NNS
10_1101-2021_01_07_425723	129	22	21	21	CD
10_1101-2021_01_07_425723	129	23	(	(	-LRB-
10_1101-2021_01_07_425723	129	24	O2	o2	NN
10_1101-2021_01_07_425723	129	25	840	840	CD
10_1101-2021_01_07_425723	129	26	TE	te	NN
10_1101-2021_01_07_425723	129	27	|O	|o	CD
10_1101-2021_01_07_425723	129	28	21·104	21·104	CD
10_1101-2021_01_07_425723	129	29	E	E	NNP
10_1101-2021_01_07_425723	129	30	)	)	-RRB-
10_1101-2021_01_07_425723	129	31	,	,	,
10_1101-2021_01_07_425723	129	32	31	31	CD
10_1101-2021_01_07_425723	129	33	197	197	CD
10_1101-2021_01_07_425723	129	34	.CC	.CC	:
10_1101-2021_01_07_425723	129	35	-	-	HYPH
10_1101-2021_01_07_425723	129	36	BY	by	IN
10_1101-2021_01_07_425723	129	37	-	-	HYPH
10_1101-2021_01_07_425723	129	38	NC	NC	NNP
10_1101-2021_01_07_425723	129	39	-	-	HYPH
10_1101-2021_01_07_425723	129	40	ND	ND	NNP
10_1101-2021_01_07_425723	129	41	4.0	4.0	CD
10_1101-2021_01_07_425723	129	42	International	International	NNP
10_1101-2021_01_07_425723	129	43	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	129	44	under	under	IN
10_1101-2021_01_07_425723	129	45	a	a	DT
10_1101-2021_01_07_425723	129	46	(	(	-LRB-
10_1101-2021_01_07_425723	129	47	which	which	WDT
10_1101-2021_01_07_425723	129	48	was	be	VBD
10_1101-2021_01_07_425723	129	49	not	not	RB
10_1101-2021_01_07_425723	129	50	certified	certify	VBN
10_1101-2021_01_07_425723	129	51	by	by	IN
10_1101-2021_01_07_425723	129	52	peer	peer	NN
10_1101-2021_01_07_425723	129	53	review	review	NN
10_1101-2021_01_07_425723	129	54	)	)	-RRB-
10_1101-2021_01_07_425723	129	55	is	be	VBZ
10_1101-2021_01_07_425723	129	56	the	the	DT
10_1101-2021_01_07_425723	129	57	author	author	NN
10_1101-2021_01_07_425723	129	58	/	/	SYM
10_1101-2021_01_07_425723	129	59	funder	funder	NN
10_1101-2021_01_07_425723	129	60	,	,	,
10_1101-2021_01_07_425723	129	61	who	who	WP
10_1101-2021_01_07_425723	129	62	has	have	VBZ
10_1101-2021_01_07_425723	129	63	granted	grant	VBN
10_1101-2021_01_07_425723	129	64	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	129	65	a	a	DT
10_1101-2021_01_07_425723	129	66	license	license	NN
10_1101-2021_01_07_425723	129	67	to	to	TO
10_1101-2021_01_07_425723	129	68	display	display	VB
10_1101-2021_01_07_425723	129	69	the	the	DT
10_1101-2021_01_07_425723	129	70	preprint	preprint	NN
10_1101-2021_01_07_425723	129	71	in	in	IN
10_1101-2021_01_07_425723	129	72	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	129	73	.	.	.
10_1101-2021_01_07_425723	130	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	130	2	is	be	VBZ
10_1101-2021_01_07_425723	130	3	made	make	VBN
10_1101-2021_01_07_425723	130	4	The	the	DT
10_1101-2021_01_07_425723	130	5	copyright	copyright	NN
10_1101-2021_01_07_425723	130	6	holder	holder	NN
10_1101-2021_01_07_425723	130	7	for	for	IN
10_1101-2021_01_07_425723	130	8	this	this	DT
10_1101-2021_01_07_425723	130	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	130	10	version	version	NN
10_1101-2021_01_07_425723	130	11	posted	post	VBD
10_1101-2021_01_07_425723	130	12	January	January	NNP
10_1101-2021_01_07_425723	130	13	8	8	CD
10_1101-2021_01_07_425723	130	14	,	,	,
10_1101-2021_01_07_425723	130	15	2021	2021	CD
10_1101-2021_01_07_425723	130	16	.	.	.
10_1101-2021_01_07_425723	130	17	;	;	:
10_1101-2021_01_07_425723	130	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	130	19	:	:	:
10_1101-2021_01_07_425723	130	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	130	21	preprint	preprint	NN
10_1101-2021_01_07_425723	130	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	130	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	130	24	13	13	CD
10_1101-2021_01_07_425723	130	25	(	(	-LRB-
10_1101-2021_01_07_425723	130	26	O2	o2	NN
10_1101-2021_01_07_425723	130	27	0.5	0.5	CD
10_1101-2021_01_07_425723	130	28	TE	TE	NNP
10_1101-2021_01_07_425723	130	29	|	|	NNP
10_1101-2021_01_07_425723	130	30	O	o	NN
10_1101-2021_01_07_425723	130	31	21·104	21·104	CD
10_1101-2021_01_07_425723	130	32	E	e	NN
10_1101-2021_01_07_425723	130	33	)	)	-RRB-
10_1101-2021_01_07_425723	130	34	,	,	,
10_1101-2021_01_07_425723	130	35	32	32	CD
10_1101-2021_01_07_425723	130	36	(	(	-LRB-
10_1101-2021_01_07_425723	130	37	O2	o2	NN
10_1101-2021_01_07_425723	130	38	0.5	0.5	CD
10_1101-2021_01_07_425723	130	39	TE	TE	NNP
10_1101-2021_01_07_425723	130	40	|	|	CD
10_1101-2021_01_07_425723	130	41	O2	O2	VBN
10_1101-2021_01_07_425723	130	42	840	840	CD
10_1101-2021_01_07_425723	130	43	TE	TE	NNP
10_1101-2021_01_07_425723	130	44	)	)	-RRB-
10_1101-2021_01_07_425723	130	45	,	,	,
10_1101-2021_01_07_425723	130	46	43	43	CD
10_1101-2021_01_07_425723	130	47	(	(	-LRB-
10_1101-2021_01_07_425723	130	48	O2	o2	NN
10_1101-2021_01_07_425723	130	49	0.5	0.5	CD
10_1101-2021_01_07_425723	130	50	T	T	NNP
10_1101-2021_01_07_425723	130	51	|	|	CD
10_1101-2021_01_07_425723	130	52	O2	O2	VBN
10_1101-2021_01_07_425723	130	53	0.5	0.5	CD
10_1101-2021_01_07_425723	130	54	TE	TE	NNP
10_1101-2021_01_07_425723	130	55	)	)	-RRB-
10_1101-2021_01_07_425723	130	56	,	,	,
10_1101-2021_01_07_425723	130	57	54	54	CD
10_1101-2021_01_07_425723	130	58	(	(	-LRB-
10_1101-2021_01_07_425723	130	59	O2	o2	NN
10_1101-2021_01_07_425723	130	60	0.5	0.5	CD
10_1101-2021_01_07_425723	130	61	|	|	CD
10_1101-2021_01_07_425723	130	62	O2	O2	VBN
10_1101-2021_01_07_425723	130	63	0.5	0.5	CD
10_1101-2021_01_07_425723	130	64	T	t	NN
10_1101-2021_01_07_425723	130	65	)	)	-RRB-
10_1101-2021_01_07_425723	130	66	.	.	.
10_1101-2021_01_07_425723	131	1	198	198	CD
10_1101-2021_01_07_425723	131	2	Lumped	Lumped	NNP
10_1101-2021_01_07_425723	131	3	biochemical	biochemical	JJ
10_1101-2021_01_07_425723	131	4	reactions	reaction	NNS
10_1101-2021_01_07_425723	131	5	are	be	VBP
10_1101-2021_01_07_425723	131	6	represented	represent	VBN
10_1101-2021_01_07_425723	131	7	by	by	IN
10_1101-2021_01_07_425723	131	8	arrows	arrow	NNS
10_1101-2021_01_07_425723	131	9	.	.	.
10_1101-2021_01_07_425723	132	1	Colors	color	NNS
10_1101-2021_01_07_425723	132	2	indicate	indicate	VBP
10_1101-2021_01_07_425723	132	3	up-	up-	CD
10_1101-2021_01_07_425723	132	4	(	(	-LRB-
10_1101-2021_01_07_425723	132	5	blue	blue	JJ
10_1101-2021_01_07_425723	132	6	)	)	-RRB-
10_1101-2021_01_07_425723	132	7	or	or	CC
10_1101-2021_01_07_425723	132	8	down	down	IN
10_1101-2021_01_07_425723	132	9	-	-	HYPH
10_1101-2021_01_07_425723	132	10	regulation	regulation	NN
10_1101-2021_01_07_425723	132	11	199	199	CD
10_1101-2021_01_07_425723	132	12	(	(	-LRB-
10_1101-2021_01_07_425723	132	13	brown	brown	NNP
10_1101-2021_01_07_425723	132	14	)	)	-RRB-
10_1101-2021_01_07_425723	132	15	with	with	IN
10_1101-2021_01_07_425723	132	16	color	color	NN
10_1101-2021_01_07_425723	132	17	intensity	intensity	NN
10_1101-2021_01_07_425723	132	18	indicating	indicate	VBG
10_1101-2021_01_07_425723	132	19	the	the	DT
10_1101-2021_01_07_425723	132	20	log	log	NN
10_1101-2021_01_07_425723	132	21	2	2	CD
10_1101-2021_01_07_425723	132	22	fold	fold	JJ
10_1101-2021_01_07_425723	132	23	change	change	NN
10_1101-2021_01_07_425723	132	24	with	with	IN
10_1101-2021_01_07_425723	132	25	color	color	NN
10_1101-2021_01_07_425723	132	26	range	range	NN
10_1101-2021_01_07_425723	132	27	capped	cap	VBN
10_1101-2021_01_07_425723	132	28	to	to	IN
10_1101-2021_01_07_425723	132	29	a	a	DT
10_1101-2021_01_07_425723	132	30	maximum	maximum	NN
10_1101-2021_01_07_425723	132	31	of	of	IN
10_1101-2021_01_07_425723	132	32	4	4	CD
10_1101-2021_01_07_425723	132	33	.	.	.
10_1101-2021_01_07_425723	133	1	200	200	CD
10_1101-2021_01_07_425723	133	2	Reactions	reaction	NNS
10_1101-2021_01_07_425723	133	3	are	be	VBP
10_1101-2021_01_07_425723	133	4	annotated	annotate	VBN
10_1101-2021_01_07_425723	133	5	with	with	IN
10_1101-2021_01_07_425723	133	6	corresponding	correspond	VBG
10_1101-2021_01_07_425723	133	7	gene	gene	NN
10_1101-2021_01_07_425723	133	8	,	,	,
10_1101-2021_01_07_425723	133	9	K.	K.	NNP
10_1101-2021_01_07_425723	133	10	marxianus	marxianus	NN
10_1101-2021_01_07_425723	133	11	genes	gene	NNS
10_1101-2021_01_07_425723	133	12	are	be	VBP
10_1101-2021_01_07_425723	133	13	indicated	indicate	VBN
10_1101-2021_01_07_425723	133	14	with	with	IN
10_1101-2021_01_07_425723	133	15	the	the	DT
10_1101-2021_01_07_425723	133	16	name	name	NN
10_1101-2021_01_07_425723	133	17	of	of	IN
10_1101-2021_01_07_425723	133	18	201	201	CD
10_1101-2021_01_07_425723	133	19	the	the	DT
10_1101-2021_01_07_425723	133	20	S.	S.	NNP
10_1101-2021_01_07_425723	133	21	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	133	22	orthologs	ortholog	VBZ
10_1101-2021_01_07_425723	133	23	.	.	.
10_1101-2021_01_07_425723	134	1	Ergosterol	Ergosterol	NNP
10_1101-2021_01_07_425723	134	2	uptake	uptake	NN
10_1101-2021_01_07_425723	134	3	by	by	IN
10_1101-2021_01_07_425723	134	4	S.	S.	NNP
10_1101-2021_01_07_425723	134	5	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	134	6	requires	require	VBZ
10_1101-2021_01_07_425723	134	7	additional	additional	JJ
10_1101-2021_01_07_425723	134	8	factors	factor	NNS
10_1101-2021_01_07_425723	134	9	beyond	beyond	IN
10_1101-2021_01_07_425723	134	10	the	the	DT
10_1101-2021_01_07_425723	134	11	202	202	CD
10_1101-2021_01_07_425723	134	12	membrane	membrane	NN
10_1101-2021_01_07_425723	134	13	transporters	transporter	NNS
10_1101-2021_01_07_425723	134	14	Aus1	Aus1	NNP
10_1101-2021_01_07_425723	134	15	and	and	CC
10_1101-2021_01_07_425723	134	16	Pdr1142	Pdr1142	NNP
10_1101-2021_01_07_425723	134	17	.	.	.
10_1101-2021_01_07_425723	135	1	No	no	DT
10_1101-2021_01_07_425723	135	2	orthologs	ortholog	NNS
10_1101-2021_01_07_425723	135	3	of	of	IN
10_1101-2021_01_07_425723	135	4	the	the	DT
10_1101-2021_01_07_425723	135	5	sterol	sterol	NN
10_1101-2021_01_07_425723	135	6	-	-	HYPH
10_1101-2021_01_07_425723	135	7	transporters	transporter	NNS
10_1101-2021_01_07_425723	135	8	or	or	CC
10_1101-2021_01_07_425723	135	9	Hmg2	Hmg2	NNP
10_1101-2021_01_07_425723	135	10	were	be	VBD
10_1101-2021_01_07_425723	135	11	203	203	CD
10_1101-2021_01_07_425723	135	12	identified	identify	VBN
10_1101-2021_01_07_425723	135	13	for	for	IN
10_1101-2021_01_07_425723	135	14	K.	K.	NNP
10_1101-2021_01_07_425723	135	15	marxianus	marxianus	NN
10_1101-2021_01_07_425723	135	16	and	and	CC
10_1101-2021_01_07_425723	135	17	low	low	JJ
10_1101-2021_01_07_425723	135	18	read	read	VBN
10_1101-2021_01_07_425723	135	19	counts	count	NNS
10_1101-2021_01_07_425723	135	20	for	for	IN
10_1101-2021_01_07_425723	135	21	Erg3	Erg3	NNP
10_1101-2021_01_07_425723	135	22	,	,	,
10_1101-2021_01_07_425723	135	23	Erg9	Erg9	NNP
10_1101-2021_01_07_425723	135	24	and	and	CC
10_1101-2021_01_07_425723	135	25	Erg20	Erg20	NNP
10_1101-2021_01_07_425723	135	26	precluded	preclude	VBD
10_1101-2021_01_07_425723	135	27	differential	differential	NN
10_1101-2021_01_07_425723	135	28	gene	gene	NN
10_1101-2021_01_07_425723	135	29	204	204	CD
10_1101-2021_01_07_425723	135	30	expression	expression	NN
10_1101-2021_01_07_425723	135	31	analysis	analysis	NN
10_1101-2021_01_07_425723	135	32	across	across	IN
10_1101-2021_01_07_425723	135	33	all	all	DT
10_1101-2021_01_07_425723	135	34	conditions	condition	NNS
10_1101-2021_01_07_425723	135	35	(	(	-LRB-
10_1101-2021_01_07_425723	135	36	dark	dark	JJ
10_1101-2021_01_07_425723	135	37	grey	grey	NN
10_1101-2021_01_07_425723	135	38	)	)	-RRB-
10_1101-2021_01_07_425723	135	39	.	.	.
10_1101-2021_01_07_425723	136	1	Enzyme	Enzyme	NNS
10_1101-2021_01_07_425723	136	2	abbreviations	abbreviation	NNS
10_1101-2021_01_07_425723	136	3	:	:	:
10_1101-2021_01_07_425723	136	4	Erg10	erg10	NN
10_1101-2021_01_07_425723	136	5	acetyl	acetyl	NN
10_1101-2021_01_07_425723	136	6	-	-	HYPH
10_1101-2021_01_07_425723	136	7	CoA	CoA	NNP
10_1101-2021_01_07_425723	136	8	205	205	CD
10_1101-2021_01_07_425723	136	9	acetyltransferase	acetyltransferase	NN
10_1101-2021_01_07_425723	136	10	,	,	,
10_1101-2021_01_07_425723	136	11	Erg13	Erg13	NNP
10_1101-2021_01_07_425723	136	12	3-hydroxy-3-methylglutaryl	3-hydroxy-3-methylglutaryl	NNP
10_1101-2021_01_07_425723	136	13	-	-	HYPH
10_1101-2021_01_07_425723	136	14	CoA	CoA	NNP
10_1101-2021_01_07_425723	136	15	(	(	-LRB-
10_1101-2021_01_07_425723	136	16	HMG	HMG	NNP
10_1101-2021_01_07_425723	136	17	-	-	HYPH
10_1101-2021_01_07_425723	136	18	CoA	CoA	NNP
10_1101-2021_01_07_425723	136	19	)	)	-RRB-
10_1101-2021_01_07_425723	136	20	synthase	synthase	NN
10_1101-2021_01_07_425723	136	21	,	,	,
10_1101-2021_01_07_425723	136	22	Hmg1	Hmg1	NNP
10_1101-2021_01_07_425723	136	23	/	/	SYM
10_1101-2021_01_07_425723	136	24	Hmg2	Hmg2	NNP
10_1101-2021_01_07_425723	136	25	HMG	HMG	NNP
10_1101-2021_01_07_425723	136	26	-	-	HYPH
10_1101-2021_01_07_425723	136	27	CoA	CoA	NNP
10_1101-2021_01_07_425723	136	28	206	206	CD
10_1101-2021_01_07_425723	136	29	reductase	reductase	NN
10_1101-2021_01_07_425723	136	30	,	,	,
10_1101-2021_01_07_425723	136	31	Erg12	Erg12	NNP
10_1101-2021_01_07_425723	136	32	mevalonate	mevalonate	NN
10_1101-2021_01_07_425723	136	33	kinase	kinase	NN
10_1101-2021_01_07_425723	136	34	,	,	,
10_1101-2021_01_07_425723	136	35	Erg8	erg8	RB
10_1101-2021_01_07_425723	136	36	phosphomevalonate	phosphomevalonate	NN
10_1101-2021_01_07_425723	136	37	kinase	kinase	NN
10_1101-2021_01_07_425723	136	38	,	,	,
10_1101-2021_01_07_425723	136	39	Mvd1	Mvd1	NNP
10_1101-2021_01_07_425723	136	40	mevalonate	mevalonate	VB
10_1101-2021_01_07_425723	136	41	207	207	CD
10_1101-2021_01_07_425723	136	42	pyrophosphate	pyrophosphate	NN
10_1101-2021_01_07_425723	136	43	decarboxylase	decarboxylase	NN
10_1101-2021_01_07_425723	136	44	,	,	,
10_1101-2021_01_07_425723	136	45	Idi1	idi1	NN
10_1101-2021_01_07_425723	136	46	isopentenyl	isopentenyl	RB
10_1101-2021_01_07_425723	136	47	diphosphate	diphosphate	VB
10_1101-2021_01_07_425723	136	48	:	:	:
10_1101-2021_01_07_425723	136	49	dimethylallyl	dimethylallyl	JJ
10_1101-2021_01_07_425723	136	50	diphosphate	diphosphate	NNP
10_1101-2021_01_07_425723	136	51	(	(	-LRB-
10_1101-2021_01_07_425723	136	52	IPP	IPP	NNP
10_1101-2021_01_07_425723	136	53	)	)	-RRB-
10_1101-2021_01_07_425723	136	54	isomerase	isomerase	NN
10_1101-2021_01_07_425723	136	55	,	,	,
10_1101-2021_01_07_425723	136	56	208	208	CD
10_1101-2021_01_07_425723	136	57	Erg20	Erg20	NNP
10_1101-2021_01_07_425723	136	58	farnesyl	farnesyl	JJ
10_1101-2021_01_07_425723	136	59	pyrophosphate	pyrophosphate	NN
10_1101-2021_01_07_425723	136	60	synthetase	synthetase	NN
10_1101-2021_01_07_425723	136	61	,	,	,
10_1101-2021_01_07_425723	136	62	Erg9	erg9	JJ
10_1101-2021_01_07_425723	136	63	farnesyl	farnesyl	NN
10_1101-2021_01_07_425723	136	64	-	-	HYPH
10_1101-2021_01_07_425723	136	65	diphosphate	diphosphate	NN
10_1101-2021_01_07_425723	136	66	transferase	transferase	NN
10_1101-2021_01_07_425723	136	67	(	(	-LRB-
10_1101-2021_01_07_425723	136	68	squalene	squalene	NNP
10_1101-2021_01_07_425723	136	69	synthase	synthase	NNP
10_1101-2021_01_07_425723	136	70	)	)	-RRB-
10_1101-2021_01_07_425723	136	71	,	,	,
10_1101-2021_01_07_425723	136	72	209	209	CD
10_1101-2021_01_07_425723	136	73	Erg7	erg7	JJ
10_1101-2021_01_07_425723	136	74	lanosterol	lanosterol	NN
10_1101-2021_01_07_425723	136	75	synthase	synthase	NN
10_1101-2021_01_07_425723	136	76	,	,	,
10_1101-2021_01_07_425723	136	77	Erg11	Erg11	NNP
10_1101-2021_01_07_425723	136	78	lanosterol	lanosterol	NN
10_1101-2021_01_07_425723	136	79	14α	14α	NNS
10_1101-2021_01_07_425723	136	80	-	-	:
10_1101-2021_01_07_425723	136	81	demethylase	demethylase	NN
10_1101-2021_01_07_425723	136	82	,	,	,
10_1101-2021_01_07_425723	136	83	Cyb5	Cyb5	NNP
10_1101-2021_01_07_425723	136	84	cytochrome	cytochrome	VB
10_1101-2021_01_07_425723	136	85	b5	b5	NN
10_1101-2021_01_07_425723	136	86	(	(	-LRB-
10_1101-2021_01_07_425723	136	87	electron	electron	NN
10_1101-2021_01_07_425723	136	88	donor	donor	NN
10_1101-2021_01_07_425723	136	89	for	for	IN
10_1101-2021_01_07_425723	136	90	210	210	CD
10_1101-2021_01_07_425723	136	91	sterol	sterol	NN
10_1101-2021_01_07_425723	136	92	C5	C5	NNP
10_1101-2021_01_07_425723	136	93	-	-	HYPH
10_1101-2021_01_07_425723	136	94	6	6	CD
10_1101-2021_01_07_425723	136	95	desaturation	desaturation	NN
10_1101-2021_01_07_425723	136	96	)	)	-RRB-
10_1101-2021_01_07_425723	136	97	,	,	,
10_1101-2021_01_07_425723	136	98	Ncp1	Ncp1	NNP
10_1101-2021_01_07_425723	136	99	NADP	NADP	NNP
10_1101-2021_01_07_425723	136	100	-	-	HYPH
10_1101-2021_01_07_425723	136	101	cytochrome	cytochrome	NNP
10_1101-2021_01_07_425723	136	102	P450	p450	NN
10_1101-2021_01_07_425723	136	103	reductase	reductase	NN
10_1101-2021_01_07_425723	136	104	,	,	,
10_1101-2021_01_07_425723	136	105	Erg24	Erg24	NNP
10_1101-2021_01_07_425723	136	106	C-14	c-14	CD
10_1101-2021_01_07_425723	136	107	sterol	sterol	JJ
10_1101-2021_01_07_425723	136	108	reductase	reductase	NN
10_1101-2021_01_07_425723	136	109	,	,	,
10_1101-2021_01_07_425723	136	110	Erg25	Erg25	NNP
10_1101-2021_01_07_425723	136	111	C-211	C-211	NNP
10_1101-2021_01_07_425723	136	112	4	4	CD
10_1101-2021_01_07_425723	136	113	methyl	methyl	NN
10_1101-2021_01_07_425723	136	114	sterol	sterol	NN
10_1101-2021_01_07_425723	136	115	oxidase	oxidase	NN
10_1101-2021_01_07_425723	136	116	,	,	,
10_1101-2021_01_07_425723	136	117	Erg26	Erg26	NNP
10_1101-2021_01_07_425723	136	118	C-3	C-3	NNP
10_1101-2021_01_07_425723	136	119	sterol	sterol	NN
10_1101-2021_01_07_425723	136	120	dehydrogenase	dehydrogenase	NN
10_1101-2021_01_07_425723	136	121	,	,	,
10_1101-2021_01_07_425723	136	122	Erg27	Erg27	NNP
10_1101-2021_01_07_425723	136	123	3-keto	3-keto	NNP
10_1101-2021_01_07_425723	136	124	-	-	HYPH
10_1101-2021_01_07_425723	136	125	sterol	sterol	NN
10_1101-2021_01_07_425723	136	126	reductase	reductase	NN
10_1101-2021_01_07_425723	136	127	,	,	,
10_1101-2021_01_07_425723	136	128	Erg28	Erg28	NNP
10_1101-2021_01_07_425723	136	129	212	212	CD
10_1101-2021_01_07_425723	136	130	endoplasmic	endoplasmic	JJ
10_1101-2021_01_07_425723	136	131	reticulum	reticulum	NN
10_1101-2021_01_07_425723	136	132	membrane	membrane	NN
10_1101-2021_01_07_425723	136	133	protein	protein	NN
10_1101-2021_01_07_425723	136	134	(	(	-LRB-
10_1101-2021_01_07_425723	136	135	may	may	MD
10_1101-2021_01_07_425723	136	136	facilitate	facilitate	VB
10_1101-2021_01_07_425723	136	137	protein	protein	NN
10_1101-2021_01_07_425723	136	138	-	-	HYPH
10_1101-2021_01_07_425723	136	139	protein	protein	NN
10_1101-2021_01_07_425723	136	140	interactions	interaction	NNS
10_1101-2021_01_07_425723	136	141	between	between	IN
10_1101-2021_01_07_425723	136	142	Erg26	Erg26	NNP
10_1101-2021_01_07_425723	136	143	213	213	CD
10_1101-2021_01_07_425723	136	144	and	and	CC
10_1101-2021_01_07_425723	136	145	Erg27	Erg27	NNP
10_1101-2021_01_07_425723	136	146	,	,	,
10_1101-2021_01_07_425723	136	147	or	or	CC
10_1101-2021_01_07_425723	136	148	tether	tether	RB
10_1101-2021_01_07_425723	136	149	these	these	DT
10_1101-2021_01_07_425723	136	150	to	to	IN
10_1101-2021_01_07_425723	136	151	the	the	DT
10_1101-2021_01_07_425723	136	152	ER	ER	NNP
10_1101-2021_01_07_425723	136	153	)	)	-RRB-
10_1101-2021_01_07_425723	136	154	,	,	,
10_1101-2021_01_07_425723	136	155	Erg6	Erg6	NNP
10_1101-2021_01_07_425723	136	156	Δ24-sterol	Δ24-sterol	NNP
10_1101-2021_01_07_425723	136	157	C	C	NNP
10_1101-2021_01_07_425723	136	158	-	-	HYPH
10_1101-2021_01_07_425723	136	159	methyltransferase	methyltransferase	NNP
10_1101-2021_01_07_425723	136	160	,	,	,
10_1101-2021_01_07_425723	136	161	Erg2	Erg2	NNP
10_1101-2021_01_07_425723	136	162	Δ24-sterol	Δ24-sterol	NNP
10_1101-2021_01_07_425723	136	163	C-214	C-214	NNP
10_1101-2021_01_07_425723	136	164	methyltransferase	methyltransferase	NN
10_1101-2021_01_07_425723	136	165	,	,	,
10_1101-2021_01_07_425723	136	166	Erg3	erg3	JJ
10_1101-2021_01_07_425723	136	167	C-5	C-5	NNP
10_1101-2021_01_07_425723	136	168	sterol	sterol	NN
10_1101-2021_01_07_425723	136	169	desaturase	desaturase	NN
10_1101-2021_01_07_425723	136	170	,	,	,
10_1101-2021_01_07_425723	136	171	Erg5	Erg5	NNP
10_1101-2021_01_07_425723	136	172	C-22	c-22	CD
10_1101-2021_01_07_425723	136	173	sterol	sterol	NN
10_1101-2021_01_07_425723	136	174	desaturase	desaturase	NN
10_1101-2021_01_07_425723	136	175	,	,	,
10_1101-2021_01_07_425723	136	176	Erg4	erg4	VB
10_1101-2021_01_07_425723	136	177	C24/28	C24/28	NNP
10_1101-2021_01_07_425723	136	178	sterol	sterol	NN
10_1101-2021_01_07_425723	136	179	215	215	CD
10_1101-2021_01_07_425723	136	180	reductase	reductase	NN
10_1101-2021_01_07_425723	136	181	,	,	,
10_1101-2021_01_07_425723	136	182	Aus1	Aus1	NNP
10_1101-2021_01_07_425723	136	183	/	/	SYM
10_1101-2021_01_07_425723	136	184	Pdr11	Pdr11	NNP
10_1101-2021_01_07_425723	136	185	plasma	plasma	NN
10_1101-2021_01_07_425723	136	186	-	-	HYPH
10_1101-2021_01_07_425723	136	187	membrane	membrane	NNP
10_1101-2021_01_07_425723	136	188	sterol	sterol	NN
10_1101-2021_01_07_425723	136	189	transporter	transporter	NN
10_1101-2021_01_07_425723	136	190	.	.	.
10_1101-2021_01_07_425723	137	1	216	216	CD
10_1101-2021_01_07_425723	137	2	.CC	.CC	:
10_1101-2021_01_07_425723	137	3	-	-	:
10_1101-2021_01_07_425723	137	4	BY	by	IN
10_1101-2021_01_07_425723	137	5	-	-	HYPH
10_1101-2021_01_07_425723	137	6	NC	NC	NNP
10_1101-2021_01_07_425723	137	7	-	-	HYPH
10_1101-2021_01_07_425723	137	8	ND	ND	NNP
10_1101-2021_01_07_425723	137	9	4.0	4.0	CD
10_1101-2021_01_07_425723	137	10	International	International	NNP
10_1101-2021_01_07_425723	137	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	137	12	under	under	IN
10_1101-2021_01_07_425723	137	13	a	a	DT
10_1101-2021_01_07_425723	137	14	(	(	-LRB-
10_1101-2021_01_07_425723	137	15	which	which	WDT
10_1101-2021_01_07_425723	137	16	was	be	VBD
10_1101-2021_01_07_425723	137	17	not	not	RB
10_1101-2021_01_07_425723	137	18	certified	certify	VBN
10_1101-2021_01_07_425723	137	19	by	by	IN
10_1101-2021_01_07_425723	137	20	peer	peer	NN
10_1101-2021_01_07_425723	137	21	review	review	NN
10_1101-2021_01_07_425723	137	22	)	)	-RRB-
10_1101-2021_01_07_425723	137	23	is	be	VBZ
10_1101-2021_01_07_425723	137	24	the	the	DT
10_1101-2021_01_07_425723	137	25	author	author	NN
10_1101-2021_01_07_425723	137	26	/	/	SYM
10_1101-2021_01_07_425723	137	27	funder	funder	NN
10_1101-2021_01_07_425723	137	28	,	,	,
10_1101-2021_01_07_425723	137	29	who	who	WP
10_1101-2021_01_07_425723	137	30	has	have	VBZ
10_1101-2021_01_07_425723	137	31	granted	grant	VBN
10_1101-2021_01_07_425723	137	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	137	33	a	a	DT
10_1101-2021_01_07_425723	137	34	license	license	NN
10_1101-2021_01_07_425723	137	35	to	to	TO
10_1101-2021_01_07_425723	137	36	display	display	VB
10_1101-2021_01_07_425723	137	37	the	the	DT
10_1101-2021_01_07_425723	137	38	preprint	preprint	NN
10_1101-2021_01_07_425723	137	39	in	in	IN
10_1101-2021_01_07_425723	137	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	137	41	.	.	.
10_1101-2021_01_07_425723	138	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	138	2	is	be	VBZ
10_1101-2021_01_07_425723	138	3	made	make	VBN
10_1101-2021_01_07_425723	138	4	The	the	DT
10_1101-2021_01_07_425723	138	5	copyright	copyright	NN
10_1101-2021_01_07_425723	138	6	holder	holder	NN
10_1101-2021_01_07_425723	138	7	for	for	IN
10_1101-2021_01_07_425723	138	8	this	this	DT
10_1101-2021_01_07_425723	138	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	138	10	version	version	NN
10_1101-2021_01_07_425723	138	11	posted	post	VBD
10_1101-2021_01_07_425723	138	12	January	January	NNP
10_1101-2021_01_07_425723	138	13	8	8	CD
10_1101-2021_01_07_425723	138	14	,	,	,
10_1101-2021_01_07_425723	138	15	2021	2021	CD
10_1101-2021_01_07_425723	138	16	.	.	.
10_1101-2021_01_07_425723	138	17	;	;	:
10_1101-2021_01_07_425723	138	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	138	19	:	:	:
10_1101-2021_01_07_425723	138	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	138	21	preprint	preprint	NN
10_1101-2021_01_07_425723	138	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	138	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	RB
10_1101-2021_01_07_425723	138	24	14	14	CD
10_1101-2021_01_07_425723	138	25	Absence	absence	NN
10_1101-2021_01_07_425723	138	26	of	of	IN
10_1101-2021_01_07_425723	138	27	sterol	sterol	NN
10_1101-2021_01_07_425723	138	28	import	import	NN
10_1101-2021_01_07_425723	138	29	in	in	IN
10_1101-2021_01_07_425723	138	30	K.	K.	NNP
10_1101-2021_01_07_425723	138	31	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	138	32	217	217	CD
10_1101-2021_01_07_425723	138	33	To	to	TO
10_1101-2021_01_07_425723	138	34	test	test	VB
10_1101-2021_01_07_425723	138	35	the	the	DT
10_1101-2021_01_07_425723	138	36	hypothesis	hypothesis	NN
10_1101-2021_01_07_425723	138	37	that	that	WDT
10_1101-2021_01_07_425723	138	38	K.	K.	NNP
10_1101-2021_01_07_425723	138	39	marxianus	marxianus	NN
10_1101-2021_01_07_425723	138	40	lacks	lack	VBZ
10_1101-2021_01_07_425723	138	41	a	a	DT
10_1101-2021_01_07_425723	138	42	functional	functional	JJ
10_1101-2021_01_07_425723	138	43	sterol	sterol	JJ
10_1101-2021_01_07_425723	138	44	-	-	HYPH
10_1101-2021_01_07_425723	138	45	uptake	uptake	NN
10_1101-2021_01_07_425723	138	46	mechanism	mechanism	NN
10_1101-2021_01_07_425723	138	47	,	,	,
10_1101-2021_01_07_425723	138	48	uptake	uptake	JJ
10_1101-2021_01_07_425723	138	49	of	of	IN
10_1101-2021_01_07_425723	138	50	218	218	CD
10_1101-2021_01_07_425723	138	51	fluorescent	fluorescent	NN
10_1101-2021_01_07_425723	138	52	sterol	sterol	NN
10_1101-2021_01_07_425723	138	53	derivative	derivative	JJ
10_1101-2021_01_07_425723	138	54	25-NBD	25-nbd	CD
10_1101-2021_01_07_425723	138	55	-	-	HYPH
10_1101-2021_01_07_425723	138	56	cholesterol	cholesterol	NN
10_1101-2021_01_07_425723	138	57	(	(	-LRB-
10_1101-2021_01_07_425723	138	58	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	138	59	)	)	-RRB-
10_1101-2021_01_07_425723	138	60	was	be	VBD
10_1101-2021_01_07_425723	138	61	measured	measure	VBN
10_1101-2021_01_07_425723	138	62	by	by	IN
10_1101-2021_01_07_425723	138	63	flow	flow	NN
10_1101-2021_01_07_425723	138	64	cytometry43	cytometry43	NNS
10_1101-2021_01_07_425723	138	65	.	.	.
10_1101-2021_01_07_425723	139	1	Since	since	IN
10_1101-2021_01_07_425723	139	2	S.	S.	NNP
10_1101-2021_01_07_425723	139	3	219	219	CD
10_1101-2021_01_07_425723	139	4	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	139	5	sterol	sterol	NN
10_1101-2021_01_07_425723	139	6	transporters	transporter	NNS
10_1101-2021_01_07_425723	139	7	are	be	VBP
10_1101-2021_01_07_425723	139	8	not	not	RB
10_1101-2021_01_07_425723	139	9	expressed	express	VBN
10_1101-2021_01_07_425723	139	10	in	in	IN
10_1101-2021_01_07_425723	139	11	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	139	12	conditions20	conditions20	NN
10_1101-2021_01_07_425723	139	13	and	and	CC
10_1101-2021_01_07_425723	139	14	to	to	TO
10_1101-2021_01_07_425723	139	15	avoid	avoid	VB
10_1101-2021_01_07_425723	139	16	interference	interference	NN
10_1101-2021_01_07_425723	139	17	of	of	IN
10_1101-2021_01_07_425723	139	18	220	220	CD
10_1101-2021_01_07_425723	139	19	sterol	sterol	JJ
10_1101-2021_01_07_425723	139	20	synthesis	synthesis	NN
10_1101-2021_01_07_425723	139	21	,	,	,
10_1101-2021_01_07_425723	139	22	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	139	23	uptake	uptake	NN
10_1101-2021_01_07_425723	139	24	was	be	VBD
10_1101-2021_01_07_425723	139	25	analysed	analyse	VBN
10_1101-2021_01_07_425723	139	26	in	in	IN
10_1101-2021_01_07_425723	139	27	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	139	28	cell	cell	NN
10_1101-2021_01_07_425723	139	29	suspensions	suspension	NNS
10_1101-2021_01_07_425723	139	30	(	(	-LRB-
10_1101-2021_01_07_425723	139	31	Fig	fig	NN
10_1101-2021_01_07_425723	139	32	.	.	.
10_1101-2021_01_07_425723	140	1	4a	4a	LS
10_1101-2021_01_07_425723	140	2	)	)	-RRB-
10_1101-2021_01_07_425723	140	3	.	.	.
10_1101-2021_01_07_425723	141	1	Four	four	CD
10_1101-2021_01_07_425723	141	2	hours	hour	NNS
10_1101-2021_01_07_425723	141	3	after	after	IN
10_1101-2021_01_07_425723	141	4	221	221	CD
10_1101-2021_01_07_425723	141	5	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	141	6	addition	addition	NN
10_1101-2021_01_07_425723	141	7	to	to	IN
10_1101-2021_01_07_425723	141	8	cell	cell	NN
10_1101-2021_01_07_425723	141	9	suspensions	suspension	NNS
10_1101-2021_01_07_425723	141	10	of	of	IN
10_1101-2021_01_07_425723	141	11	the	the	DT
10_1101-2021_01_07_425723	141	12	reference	reference	NN
10_1101-2021_01_07_425723	141	13	strain	strain	NN
10_1101-2021_01_07_425723	141	14	S.	S.	NNP
10_1101-2021_01_07_425723	141	15	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	141	16	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	141	17	,	,	,
10_1101-2021_01_07_425723	141	18	median	median	JJ
10_1101-2021_01_07_425723	141	19	single	single	JJ
10_1101-2021_01_07_425723	141	20	-	-	HYPH
10_1101-2021_01_07_425723	141	21	cell	cell	NN
10_1101-2021_01_07_425723	141	22	222	222	CD
10_1101-2021_01_07_425723	141	23	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	141	24	increased	increase	VBN
10_1101-2021_01_07_425723	141	25	by	by	IN
10_1101-2021_01_07_425723	141	26	66-fold	66-fold	CD
10_1101-2021_01_07_425723	141	27	(	(	-LRB-
10_1101-2021_01_07_425723	141	28	Fig	fig	NN
10_1101-2021_01_07_425723	141	29	.	.	.
10_1101-2021_01_07_425723	142	1	4bc	4bc	NNP
10_1101-2021_01_07_425723	142	2	)	)	-RRB-
10_1101-2021_01_07_425723	142	3	.	.	.
10_1101-2021_01_07_425723	143	1	In	in	IN
10_1101-2021_01_07_425723	143	2	contrast	contrast	NN
10_1101-2021_01_07_425723	143	3	,	,	,
10_1101-2021_01_07_425723	143	4	the	the	DT
10_1101-2021_01_07_425723	143	5	congenic	congenic	JJ
10_1101-2021_01_07_425723	143	6	sterol	sterol	JJ
10_1101-2021_01_07_425723	143	7	-	-	HYPH
10_1101-2021_01_07_425723	143	8	transporter	transporter	NN
10_1101-2021_01_07_425723	143	9	-	-	HYPH
10_1101-2021_01_07_425723	143	10	deficient	deficient	JJ
10_1101-2021_01_07_425723	143	11	strain	strain	NN
10_1101-2021_01_07_425723	143	12	223	223	CD
10_1101-2021_01_07_425723	143	13	IMK809	IMK809	NNP
10_1101-2021_01_07_425723	143	14	(	(	-LRB-
10_1101-2021_01_07_425723	143	15	aus1Δ	aus1Δ	NNP
10_1101-2021_01_07_425723	143	16	pdr11Δ	pdr11Δ	NNP
10_1101-2021_01_07_425723	143	17	)	)	-RRB-
10_1101-2021_01_07_425723	143	18	only	only	RB
10_1101-2021_01_07_425723	143	19	showed	show	VBD
10_1101-2021_01_07_425723	143	20	a	a	DT
10_1101-2021_01_07_425723	143	21	6-fold	6-fold	CD
10_1101-2021_01_07_425723	143	22	increase	increase	NN
10_1101-2021_01_07_425723	143	23	of	of	IN
10_1101-2021_01_07_425723	143	24	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	143	25	,	,	,
10_1101-2021_01_07_425723	143	26	probably	probably	RB
10_1101-2021_01_07_425723	143	27	reflected	reflect	VBD
10_1101-2021_01_07_425723	143	28	detergent-224	detergent-224	JJ
10_1101-2021_01_07_425723	143	29	resistant	resistant	JJ
10_1101-2021_01_07_425723	143	30	binding	binding	NN
10_1101-2021_01_07_425723	143	31	of	of	IN
10_1101-2021_01_07_425723	143	32	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	143	33	to	to	IN
10_1101-2021_01_07_425723	143	34	S.	S.	NNP
10_1101-2021_01_07_425723	143	35	cerevisiae	cerevisiae	NNP
10_1101-2021_01_07_425723	143	36	cell	cell	NN
10_1101-2021_01_07_425723	143	37	-	-	HYPH
10_1101-2021_01_07_425723	143	38	wall	wall	NN
10_1101-2021_01_07_425723	143	39	proteins43,44	proteins43,44	NNP
10_1101-2021_01_07_425723	143	40	.	.	.
10_1101-2021_01_07_425723	144	1	K.	K.	NNP
10_1101-2021_01_07_425723	144	2	marxianus	marxianus	NN
10_1101-2021_01_07_425723	144	3	strains	strain	VBZ
10_1101-2021_01_07_425723	144	4	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	144	5	and	and	CC
10_1101-2021_01_07_425723	144	6	225	225	CD
10_1101-2021_01_07_425723	144	7	NBRC1777	NBRC1777	NNPS
10_1101-2021_01_07_425723	144	8	did	do	VBD
10_1101-2021_01_07_425723	144	9	not	not	RB
10_1101-2021_01_07_425723	144	10	show	show	VB
10_1101-2021_01_07_425723	144	11	increased	increase	VBN
10_1101-2021_01_07_425723	144	12	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	144	13	,	,	,
10_1101-2021_01_07_425723	144	14	neither	neither	CC
10_1101-2021_01_07_425723	144	15	after	after	IN
10_1101-2021_01_07_425723	144	16	4	4	CD
10_1101-2021_01_07_425723	144	17	h	h	NN
10_1101-2021_01_07_425723	144	18	nor	nor	CC
10_1101-2021_01_07_425723	144	19	after	after	IN
10_1101-2021_01_07_425723	144	20	23	23	CD
10_1101-2021_01_07_425723	144	21	h	h	NNS
10_1101-2021_01_07_425723	144	22	of	of	IN
10_1101-2021_01_07_425723	144	23	incubation	incubation	NN
10_1101-2021_01_07_425723	144	24	with	with	IN
10_1101-2021_01_07_425723	144	25	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	144	26	226	226	CD
10_1101-2021_01_07_425723	144	27	(	(	-LRB-
10_1101-2021_01_07_425723	144	28	<	<	XX
10_1101-2021_01_07_425723	144	29	2-fold	2-fold	CD
10_1101-2021_01_07_425723	144	30	,	,	,
10_1101-2021_01_07_425723	144	31	Fig	Fig	NNP
10_1101-2021_01_07_425723	144	32	.	.	.
10_1101-2021_01_07_425723	145	1	4bc	4bc	JJ
10_1101-2021_01_07_425723	145	2	,	,	,
10_1101-2021_01_07_425723	145	3	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	145	4	Fig	Fig	NNP
10_1101-2021_01_07_425723	145	5	.	.	.
10_1101-2021_01_07_425723	146	1	7	7	LS
10_1101-2021_01_07_425723	146	2	)	)	-RRB-
10_1101-2021_01_07_425723	146	3	.	.	.
10_1101-2021_01_07_425723	147	1	227	227	CD
10_1101-2021_01_07_425723	147	2	Fig	fig	NN
10_1101-2021_01_07_425723	147	3	.	.	.
10_1101-2021_01_07_425723	148	1	4	4	CD
10_1101-2021_01_07_425723	148	2	|	|	CD
10_1101-2021_01_07_425723	148	3	Uptake	Uptake	NNP
10_1101-2021_01_07_425723	148	4	of	of	IN
10_1101-2021_01_07_425723	148	5	the	the	DT
10_1101-2021_01_07_425723	148	6	fluorescent	fluorescent	NN
10_1101-2021_01_07_425723	148	7	sterol	sterol	NN
10_1101-2021_01_07_425723	148	8	derivative	derivative	JJ
10_1101-2021_01_07_425723	148	9	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	148	10	by	by	IN
10_1101-2021_01_07_425723	148	11	S.	S.	NNP
10_1101-2021_01_07_425723	148	12	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	148	13	and	and	CC
10_1101-2021_01_07_425723	148	14	K.	K.	NNP
10_1101-2021_01_07_425723	148	15	marxianus	marxianus	NN
10_1101-2021_01_07_425723	148	16	strains	strain	VBZ
10_1101-2021_01_07_425723	148	17	.	.	.
10_1101-2021_01_07_425723	149	1	a	a	DT
10_1101-2021_01_07_425723	149	2	,	,	,
10_1101-2021_01_07_425723	149	3	228	228	CD
10_1101-2021_01_07_425723	149	4	Experimental	experimental	JJ
10_1101-2021_01_07_425723	149	5	approach	approach	NN
10_1101-2021_01_07_425723	149	6	.	.	.
10_1101-2021_01_07_425723	150	1	S.	S.	NNP
10_1101-2021_01_07_425723	150	2	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	150	3	strains	strain	VBZ
10_1101-2021_01_07_425723	150	4	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	150	5	(	(	-LRB-
10_1101-2021_01_07_425723	150	6	reference	reference	NN
10_1101-2021_01_07_425723	150	7	)	)	-RRB-
10_1101-2021_01_07_425723	150	8	and	and	CC
10_1101-2021_01_07_425723	150	9	IMK809	IMK809	NNP
10_1101-2021_01_07_425723	150	10	(	(	-LRB-
10_1101-2021_01_07_425723	150	11	aus1Δ	aus1Δ	NNP
10_1101-2021_01_07_425723	150	12	pdr11Δ	pdr11Δ	NNP
10_1101-2021_01_07_425723	150	13	)	)	-RRB-
10_1101-2021_01_07_425723	150	14	,	,	,
10_1101-2021_01_07_425723	150	15	and	and	CC
10_1101-2021_01_07_425723	150	16	K.	K.	NNP
10_1101-2021_01_07_425723	150	17	229	229	CD
10_1101-2021_01_07_425723	150	18	marxianus	marxianus	NN
10_1101-2021_01_07_425723	150	19	strains	strain	VBZ
10_1101-2021_01_07_425723	150	20	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	150	21	and	and	CC
10_1101-2021_01_07_425723	150	22	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	150	23	were	be	VBD
10_1101-2021_01_07_425723	150	24	each	each	DT
10_1101-2021_01_07_425723	150	25	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	150	26	incubated	incubate	VBN
10_1101-2021_01_07_425723	150	27	in	in	IN
10_1101-2021_01_07_425723	150	28	four	four	CD
10_1101-2021_01_07_425723	150	29	replicate	replicate	NN
10_1101-2021_01_07_425723	150	30	shake-230	shake-230	JJ
10_1101-2021_01_07_425723	150	31	.CC	.CC	NFP
10_1101-2021_01_07_425723	150	32	-	-	HYPH
10_1101-2021_01_07_425723	150	33	BY	by	IN
10_1101-2021_01_07_425723	150	34	-	-	HYPH
10_1101-2021_01_07_425723	150	35	NC	NC	NNP
10_1101-2021_01_07_425723	150	36	-	-	HYPH
10_1101-2021_01_07_425723	150	37	ND	ND	NNP
10_1101-2021_01_07_425723	150	38	4.0	4.0	CD
10_1101-2021_01_07_425723	150	39	International	International	NNP
10_1101-2021_01_07_425723	150	40	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	150	41	under	under	IN
10_1101-2021_01_07_425723	150	42	a	a	DT
10_1101-2021_01_07_425723	150	43	(	(	-LRB-
10_1101-2021_01_07_425723	150	44	which	which	WDT
10_1101-2021_01_07_425723	150	45	was	be	VBD
10_1101-2021_01_07_425723	150	46	not	not	RB
10_1101-2021_01_07_425723	150	47	certified	certify	VBN
10_1101-2021_01_07_425723	150	48	by	by	IN
10_1101-2021_01_07_425723	150	49	peer	peer	NN
10_1101-2021_01_07_425723	150	50	review	review	NN
10_1101-2021_01_07_425723	150	51	)	)	-RRB-
10_1101-2021_01_07_425723	150	52	is	be	VBZ
10_1101-2021_01_07_425723	150	53	the	the	DT
10_1101-2021_01_07_425723	150	54	author	author	NN
10_1101-2021_01_07_425723	150	55	/	/	SYM
10_1101-2021_01_07_425723	150	56	funder	funder	NN
10_1101-2021_01_07_425723	150	57	,	,	,
10_1101-2021_01_07_425723	150	58	who	who	WP
10_1101-2021_01_07_425723	150	59	has	have	VBZ
10_1101-2021_01_07_425723	150	60	granted	grant	VBN
10_1101-2021_01_07_425723	150	61	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	150	62	a	a	DT
10_1101-2021_01_07_425723	150	63	license	license	NN
10_1101-2021_01_07_425723	150	64	to	to	TO
10_1101-2021_01_07_425723	150	65	display	display	VB
10_1101-2021_01_07_425723	150	66	the	the	DT
10_1101-2021_01_07_425723	150	67	preprint	preprint	NN
10_1101-2021_01_07_425723	150	68	in	in	IN
10_1101-2021_01_07_425723	150	69	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	150	70	.	.	.
10_1101-2021_01_07_425723	151	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	151	2	is	be	VBZ
10_1101-2021_01_07_425723	151	3	made	make	VBN
10_1101-2021_01_07_425723	151	4	The	the	DT
10_1101-2021_01_07_425723	151	5	copyright	copyright	NN
10_1101-2021_01_07_425723	151	6	holder	holder	NN
10_1101-2021_01_07_425723	151	7	for	for	IN
10_1101-2021_01_07_425723	151	8	this	this	DT
10_1101-2021_01_07_425723	151	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	151	10	version	version	NN
10_1101-2021_01_07_425723	151	11	posted	post	VBD
10_1101-2021_01_07_425723	151	12	January	January	NNP
10_1101-2021_01_07_425723	151	13	8	8	CD
10_1101-2021_01_07_425723	151	14	,	,	,
10_1101-2021_01_07_425723	151	15	2021	2021	CD
10_1101-2021_01_07_425723	151	16	.	.	.
10_1101-2021_01_07_425723	151	17	;	;	:
10_1101-2021_01_07_425723	151	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	151	19	:	:	:
10_1101-2021_01_07_425723	151	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	151	21	preprint	preprint	NN
10_1101-2021_01_07_425723	151	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	151	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	151	24	15	15	CD
10_1101-2021_01_07_425723	151	25	flask	flask	NN
10_1101-2021_01_07_425723	151	26	cultures	culture	NNS
10_1101-2021_01_07_425723	151	27	.	.	.
10_1101-2021_01_07_425723	152	1	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	152	2	and	and	CC
10_1101-2021_01_07_425723	152	3	Tween	tween	NN
10_1101-2021_01_07_425723	152	4	80	80	CD
10_1101-2021_01_07_425723	152	5	(	(	-LRB-
10_1101-2021_01_07_425723	152	6	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	152	7	T	T	NNP
10_1101-2021_01_07_425723	152	8	)	)	-RRB-
10_1101-2021_01_07_425723	152	9	were	be	VBD
10_1101-2021_01_07_425723	152	10	added	add	VBN
10_1101-2021_01_07_425723	152	11	to	to	IN
10_1101-2021_01_07_425723	152	12	two	two	CD
10_1101-2021_01_07_425723	152	13	cultures	culture	NNS
10_1101-2021_01_07_425723	152	14	,	,	,
10_1101-2021_01_07_425723	152	15	while	while	IN
10_1101-2021_01_07_425723	152	16	only	only	RB
10_1101-2021_01_07_425723	152	17	Tween	Tween	NNP
10_1101-2021_01_07_425723	152	18	80	80	CD
10_1101-2021_01_07_425723	152	19	(	(	-LRB-
10_1101-2021_01_07_425723	152	20	T	T	NNP
10_1101-2021_01_07_425723	152	21	)	)	-RRB-
10_1101-2021_01_07_425723	152	22	was	be	VBD
10_1101-2021_01_07_425723	152	23	231	231	CD
10_1101-2021_01_07_425723	152	24	added	add	VBN
10_1101-2021_01_07_425723	152	25	to	to	IN
10_1101-2021_01_07_425723	152	26	the	the	DT
10_1101-2021_01_07_425723	152	27	other	other	JJ
10_1101-2021_01_07_425723	152	28	two	two	CD
10_1101-2021_01_07_425723	152	29	.	.	.
10_1101-2021_01_07_425723	153	1	After	after	IN
10_1101-2021_01_07_425723	153	2	4	4	CD
10_1101-2021_01_07_425723	153	3	h	h	NN
10_1101-2021_01_07_425723	153	4	incubation	incubation	NN
10_1101-2021_01_07_425723	153	5	,	,	,
10_1101-2021_01_07_425723	153	6	cells	cell	NNS
10_1101-2021_01_07_425723	153	7	were	be	VBD
10_1101-2021_01_07_425723	153	8	stained	stain	VBN
10_1101-2021_01_07_425723	153	9	with	with	IN
10_1101-2021_01_07_425723	153	10	propidium	propidium	NN
10_1101-2021_01_07_425723	153	11	iodide	iodide	NN
10_1101-2021_01_07_425723	153	12	(	(	-LRB-
10_1101-2021_01_07_425723	153	13	PI	PI	NNP
10_1101-2021_01_07_425723	153	14	)	)	-RRB-
10_1101-2021_01_07_425723	153	15	and	and	CC
10_1101-2021_01_07_425723	153	16	analysed	analyse	VBD
10_1101-2021_01_07_425723	153	17	232	232	CD
10_1101-2021_01_07_425723	153	18	by	by	IN
10_1101-2021_01_07_425723	153	19	flow	flow	NN
10_1101-2021_01_07_425723	153	20	cytometry	cytometry	NN
10_1101-2021_01_07_425723	153	21	.	.	.
10_1101-2021_01_07_425723	154	1	PI	PI	NNP
10_1101-2021_01_07_425723	154	2	staining	staining	NN
10_1101-2021_01_07_425723	154	3	was	be	VBD
10_1101-2021_01_07_425723	154	4	used	use	VBN
10_1101-2021_01_07_425723	154	5	to	to	TO
10_1101-2021_01_07_425723	154	6	eliminate	eliminate	VB
10_1101-2021_01_07_425723	154	7	cells	cell	NNS
10_1101-2021_01_07_425723	154	8	with	with	IN
10_1101-2021_01_07_425723	154	9	compromised	compromised	JJ
10_1101-2021_01_07_425723	154	10	membrane	membrane	NN
10_1101-2021_01_07_425723	154	11	integrity	integrity	NN
10_1101-2021_01_07_425723	154	12	from	from	IN
10_1101-2021_01_07_425723	154	13	233	233	CD
10_1101-2021_01_07_425723	154	14	analysis	analysis	NN
10_1101-2021_01_07_425723	154	15	of	of	IN
10_1101-2021_01_07_425723	154	16	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	154	17	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	154	18	.	.	.
10_1101-2021_01_07_425723	155	1	Cultivation	cultivation	NN
10_1101-2021_01_07_425723	155	2	conditions	condition	NNS
10_1101-2021_01_07_425723	155	3	and	and	CC
10_1101-2021_01_07_425723	155	4	flow	flow	NN
10_1101-2021_01_07_425723	155	5	cytometry	cytometry	NN
10_1101-2021_01_07_425723	155	6	gating	gating	NN
10_1101-2021_01_07_425723	155	7	are	be	VBP
10_1101-2021_01_07_425723	155	8	described	describe	VBN
10_1101-2021_01_07_425723	155	9	in	in	IN
10_1101-2021_01_07_425723	155	10	234	234	CD
10_1101-2021_01_07_425723	155	11	Methods	Methods	NNPS
10_1101-2021_01_07_425723	155	12	and	and	CC
10_1101-2021_01_07_425723	155	13	in	in	IN
10_1101-2021_01_07_425723	155	14	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	155	15	Fig	Fig	NNP
10_1101-2021_01_07_425723	155	16	.	.	.
10_1101-2021_01_07_425723	156	1	8	8	LS
10_1101-2021_01_07_425723	156	2	,	,	,
10_1101-2021_01_07_425723	156	3	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	156	4	Data	Data	NNP
10_1101-2021_01_07_425723	156	5	set	set	VBD
10_1101-2021_01_07_425723	156	6	1	1	CD
10_1101-2021_01_07_425723	156	7	and	and	CC
10_1101-2021_01_07_425723	156	8	2	2	CD
10_1101-2021_01_07_425723	156	9	.	.	.
10_1101-2021_01_07_425723	156	10	b	b	LS
10_1101-2021_01_07_425723	156	11	,	,	,
10_1101-2021_01_07_425723	156	12	Median	Median	NNP
10_1101-2021_01_07_425723	156	13	and	and	CC
10_1101-2021_01_07_425723	156	14	pooled	pool	VBD
10_1101-2021_01_07_425723	156	15	standard	standard	JJ
10_1101-2021_01_07_425723	156	16	235	235	CD
10_1101-2021_01_07_425723	156	17	deviation	deviation	NN
10_1101-2021_01_07_425723	156	18	of	of	IN
10_1101-2021_01_07_425723	156	19	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	156	20	intensity	intensity	NN
10_1101-2021_01_07_425723	156	21	(	(	-LRB-
10_1101-2021_01_07_425723	156	22	λex	λex	NNP
10_1101-2021_01_07_425723	156	23	488	488	CD
10_1101-2021_01_07_425723	156	24	nm	nm	NNP
10_1101-2021_01_07_425723	156	25	|	|	NNP
10_1101-2021_01_07_425723	156	26	λem	λem	NN
10_1101-2021_01_07_425723	156	27	533/30	533/30	CD
10_1101-2021_01_07_425723	156	28	nm	nm	RB
10_1101-2021_01_07_425723	156	29	,	,	,
10_1101-2021_01_07_425723	156	30	FL1-A	FL1-A	NNP
10_1101-2021_01_07_425723	156	31	)	)	-RRB-
10_1101-2021_01_07_425723	156	32	of	of	IN
10_1101-2021_01_07_425723	156	33	PI	pi	NN
10_1101-2021_01_07_425723	156	34	-	-	HYPH
10_1101-2021_01_07_425723	156	35	negative	negative	JJ
10_1101-2021_01_07_425723	156	36	cells	cell	NNS
10_1101-2021_01_07_425723	156	37	with	with	IN
10_1101-2021_01_07_425723	156	38	variance	variance	NN
10_1101-2021_01_07_425723	156	39	236	236	CD
10_1101-2021_01_07_425723	156	40	of	of	IN
10_1101-2021_01_07_425723	156	41	biological	biological	JJ
10_1101-2021_01_07_425723	156	42	replicates	replicate	NNS
10_1101-2021_01_07_425723	156	43	after	after	IN
10_1101-2021_01_07_425723	156	44	4	4	CD
10_1101-2021_01_07_425723	156	45	h	h	NN
10_1101-2021_01_07_425723	156	46	exposure	exposure	NN
10_1101-2021_01_07_425723	156	47	to	to	IN
10_1101-2021_01_07_425723	156	48	Tween	Tween	NNP
10_1101-2021_01_07_425723	156	49	80	80	CD
10_1101-2021_01_07_425723	156	50	(	(	-LRB-
10_1101-2021_01_07_425723	156	51	white	white	JJ
10_1101-2021_01_07_425723	156	52	bars	bar	NNS
10_1101-2021_01_07_425723	156	53	)	)	-RRB-
10_1101-2021_01_07_425723	156	54	or	or	CC
10_1101-2021_01_07_425723	156	55	Tween	Tween	NNP
10_1101-2021_01_07_425723	156	56	80	80	CD
10_1101-2021_01_07_425723	156	57	and	and	CC
10_1101-2021_01_07_425723	156	58	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	156	59	(	(	-LRB-
10_1101-2021_01_07_425723	156	60	blue	blue	JJ
10_1101-2021_01_07_425723	156	61	bars	bar	NNS
10_1101-2021_01_07_425723	156	62	)	)	-RRB-
10_1101-2021_01_07_425723	156	63	.	.	.
10_1101-2021_01_07_425723	157	1	237	237	CD
10_1101-2021_01_07_425723	157	2	Variance	variance	NN
10_1101-2021_01_07_425723	157	3	was	be	VBD
10_1101-2021_01_07_425723	157	4	pooled	pool	VBN
10_1101-2021_01_07_425723	157	5	for	for	IN
10_1101-2021_01_07_425723	157	6	the	the	DT
10_1101-2021_01_07_425723	157	7	strains	strain	NNS
10_1101-2021_01_07_425723	157	8	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	157	9	,	,	,
10_1101-2021_01_07_425723	157	10	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	157	11	and	and	CC
10_1101-2021_01_07_425723	157	12	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	157	13	by	by	IN
10_1101-2021_01_07_425723	157	14	repeating	repeat	VBG
10_1101-2021_01_07_425723	157	15	the	the	DT
10_1101-2021_01_07_425723	157	16	experiment	experiment	NN
10_1101-2021_01_07_425723	157	17	.	.	.
10_1101-2021_01_07_425723	158	1	c	c	LS
10_1101-2021_01_07_425723	158	2	,	,	,
10_1101-2021_01_07_425723	158	3	238	238	CD
10_1101-2021_01_07_425723	158	4	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	158	5	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	158	6	-	-	HYPH
10_1101-2021_01_07_425723	158	7	intensity	intensity	NN
10_1101-2021_01_07_425723	158	8	distribution	distribution	NN
10_1101-2021_01_07_425723	158	9	of	of	IN
10_1101-2021_01_07_425723	158	10	cells	cell	NNS
10_1101-2021_01_07_425723	158	11	in	in	IN
10_1101-2021_01_07_425723	158	12	a	a	DT
10_1101-2021_01_07_425723	158	13	sample	sample	NN
10_1101-2021_01_07_425723	158	14	from	from	IN
10_1101-2021_01_07_425723	158	15	a	a	DT
10_1101-2021_01_07_425723	158	16	single	single	JJ
10_1101-2021_01_07_425723	158	17	culture	culture	NN
10_1101-2021_01_07_425723	158	18	for	for	IN
10_1101-2021_01_07_425723	158	19	each	each	DT
10_1101-2021_01_07_425723	158	20	strain	strain	NN
10_1101-2021_01_07_425723	158	21	,	,	,
10_1101-2021_01_07_425723	158	22	shown	show	VBD
10_1101-2021_01_07_425723	158	23	239	239	CD
10_1101-2021_01_07_425723	158	24	as	as	IN
10_1101-2021_01_07_425723	158	25	modal	modal	NN
10_1101-2021_01_07_425723	158	26	-	-	HYPH
10_1101-2021_01_07_425723	158	27	scaled	scale	VBN
10_1101-2021_01_07_425723	158	28	density	density	NN
10_1101-2021_01_07_425723	158	29	function	function	NN
10_1101-2021_01_07_425723	158	30	.	.	.
10_1101-2021_01_07_425723	159	1	Dashed	dash	VBN
10_1101-2021_01_07_425723	159	2	lines	line	NNS
10_1101-2021_01_07_425723	159	3	represent	represent	VBP
10_1101-2021_01_07_425723	159	4	background	background	NN
10_1101-2021_01_07_425723	159	5	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	159	6	of	of	IN
10_1101-2021_01_07_425723	159	7	unstained	unstained	JJ
10_1101-2021_01_07_425723	159	8	cells	cell	NNS
10_1101-2021_01_07_425723	159	9	of	of	IN
10_1101-2021_01_07_425723	159	10	240	240	CD
10_1101-2021_01_07_425723	159	11	S.	S.	NNP
10_1101-2021_01_07_425723	159	12	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	159	13	and	and	CC
10_1101-2021_01_07_425723	159	14	K.	K.	NNP
10_1101-2021_01_07_425723	159	15	marxianus	marxianus	NN
10_1101-2021_01_07_425723	159	16	.	.	.
10_1101-2021_01_07_425723	160	1	Fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	160	2	data	datum	NNS
10_1101-2021_01_07_425723	160	3	for	for	IN
10_1101-2021_01_07_425723	160	4	23-h	23-h	CD
10_1101-2021_01_07_425723	160	5	incubations	incubation	NNS
10_1101-2021_01_07_425723	160	6	with	with	IN
10_1101-2021_01_07_425723	160	7	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	160	8	are	be	VBP
10_1101-2021_01_07_425723	160	9	shown	show	VBN
10_1101-2021_01_07_425723	160	10	in	in	IN
10_1101-2021_01_07_425723	160	11	241	241	CD
10_1101-2021_01_07_425723	160	12	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	160	13	Fig	Fig	NNP
10_1101-2021_01_07_425723	160	14	.	.	.
10_1101-2021_01_07_425723	161	1	7	7	LS
10_1101-2021_01_07_425723	161	2	.	.	.
10_1101-2021_01_07_425723	162	1	242	242	CD
10_1101-2021_01_07_425723	162	2	Engineering	Engineering	NNP
10_1101-2021_01_07_425723	162	3	K.	K.	NNP
10_1101-2021_01_07_425723	162	4	marxianus	marxianus	NN
10_1101-2021_01_07_425723	162	5	for	for	IN
10_1101-2021_01_07_425723	162	6	oxygen	oxygen	NN
10_1101-2021_01_07_425723	162	7	-	-	HYPH
10_1101-2021_01_07_425723	162	8	independent	independent	JJ
10_1101-2021_01_07_425723	162	9	growth	growth	NN
10_1101-2021_01_07_425723	162	10	243	243	CD
10_1101-2021_01_07_425723	162	11	Sterol	Sterol	NNP
10_1101-2021_01_07_425723	162	12	uptake	uptake	NN
10_1101-2021_01_07_425723	162	13	by	by	IN
10_1101-2021_01_07_425723	162	14	S.	S.	NNP
10_1101-2021_01_07_425723	162	15	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	162	16	,	,	,
10_1101-2021_01_07_425723	162	17	which	which	WDT
10_1101-2021_01_07_425723	162	18	requires	require	VBZ
10_1101-2021_01_07_425723	162	19	cell	cell	NN
10_1101-2021_01_07_425723	162	20	wall	wall	NN
10_1101-2021_01_07_425723	162	21	proteins	protein	NNS
10_1101-2021_01_07_425723	162	22	as	as	RB
10_1101-2021_01_07_425723	162	23	well	well	RB
10_1101-2021_01_07_425723	162	24	as	as	IN
10_1101-2021_01_07_425723	162	25	a	a	DT
10_1101-2021_01_07_425723	162	26	membrane	membrane	NN
10_1101-2021_01_07_425723	162	27	transporter	transporter	NN
10_1101-2021_01_07_425723	162	28	,	,	,
10_1101-2021_01_07_425723	162	29	has	have	VBZ
10_1101-2021_01_07_425723	162	30	244	244	CD
10_1101-2021_01_07_425723	162	31	not	not	RB
10_1101-2021_01_07_425723	162	32	yet	yet	RB
10_1101-2021_01_07_425723	162	33	been	be	VBN
10_1101-2021_01_07_425723	162	34	fully	fully	RB
10_1101-2021_01_07_425723	162	35	resolved42,43	resolved42,43	JJ
10_1101-2021_01_07_425723	162	36	.	.	.
10_1101-2021_01_07_425723	163	1	Instead	instead	RB
10_1101-2021_01_07_425723	163	2	of	of	IN
10_1101-2021_01_07_425723	163	3	expressing	express	VBG
10_1101-2021_01_07_425723	163	4	a	a	DT
10_1101-2021_01_07_425723	163	5	heterologous	heterologous	JJ
10_1101-2021_01_07_425723	163	6	sterol	sterol	NN
10_1101-2021_01_07_425723	163	7	-	-	HYPH
10_1101-2021_01_07_425723	163	8	import	import	NN
10_1101-2021_01_07_425723	163	9	system	system	NN
10_1101-2021_01_07_425723	163	10	in	in	IN
10_1101-2021_01_07_425723	163	11	K.	K.	NNP
10_1101-2021_01_07_425723	163	12	245	245	CD
10_1101-2021_01_07_425723	163	13	marxianus	marxianus	NN
10_1101-2021_01_07_425723	163	14	,	,	,
10_1101-2021_01_07_425723	163	15	we	-PRON-	PRP
10_1101-2021_01_07_425723	163	16	therefore	therefore	RB
10_1101-2021_01_07_425723	163	17	explored	explore	VBD
10_1101-2021_01_07_425723	163	18	production	production	NN
10_1101-2021_01_07_425723	163	19	of	of	IN
10_1101-2021_01_07_425723	163	20	tetrahymanol	tetrahymanol	NNS
10_1101-2021_01_07_425723	163	21	,	,	,
10_1101-2021_01_07_425723	163	22	which	which	WDT
10_1101-2021_01_07_425723	163	23	acts	act	VBZ
10_1101-2021_01_07_425723	163	24	as	as	IN
10_1101-2021_01_07_425723	163	25	a	a	DT
10_1101-2021_01_07_425723	163	26	sterol	sterol	JJ
10_1101-2021_01_07_425723	163	27	surrogate	surrogate	NN
10_1101-2021_01_07_425723	163	28	in	in	IN
10_1101-2021_01_07_425723	163	29	246	246	CD
10_1101-2021_01_07_425723	163	30	strictly	strictly	RB
10_1101-2021_01_07_425723	163	31	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	163	32	fungi	fungi	NNP
10_1101-2021_01_07_425723	163	33	45	45	CD
10_1101-2021_01_07_425723	163	34	.	.	.
10_1101-2021_01_07_425723	164	1	Expression	expression	NN
10_1101-2021_01_07_425723	164	2	of	of	IN
10_1101-2021_01_07_425723	164	3	a	a	DT
10_1101-2021_01_07_425723	164	4	squalene	squalene	NN
10_1101-2021_01_07_425723	164	5	-	-	HYPH
10_1101-2021_01_07_425723	164	6	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	164	7	cyclase	cyclase	NN
10_1101-2021_01_07_425723	164	8	from	from	IN
10_1101-2021_01_07_425723	164	9	Tetrahymena	Tetrahymena	NNP
10_1101-2021_01_07_425723	164	10	247	247	CD
10_1101-2021_01_07_425723	164	11	thermophila	thermophila	NN
10_1101-2021_01_07_425723	164	12	(	(	-LRB-
10_1101-2021_01_07_425723	164	13	TtSTC1	ttstc1	NN
10_1101-2021_01_07_425723	164	14	)	)	-RRB-
10_1101-2021_01_07_425723	164	15	,	,	,
10_1101-2021_01_07_425723	164	16	which	which	WDT
10_1101-2021_01_07_425723	164	17	catalyzes	catalyze	VBZ
10_1101-2021_01_07_425723	164	18	the	the	DT
10_1101-2021_01_07_425723	164	19	single	single	JJ
10_1101-2021_01_07_425723	164	20	-	-	HYPH
10_1101-2021_01_07_425723	164	21	step	step	NN
10_1101-2021_01_07_425723	164	22	oxygen	oxygen	NN
10_1101-2021_01_07_425723	164	23	-	-	HYPH
10_1101-2021_01_07_425723	164	24	independent	independent	JJ
10_1101-2021_01_07_425723	164	25	conversion	conversion	NN
10_1101-2021_01_07_425723	164	26	of	of	IN
10_1101-2021_01_07_425723	164	27	squalene	squalene	NN
10_1101-2021_01_07_425723	164	28	into	into	IN
10_1101-2021_01_07_425723	164	29	248	248	CD
10_1101-2021_01_07_425723	164	30	tetrahymanol	tetrahymanol	NNS
10_1101-2021_01_07_425723	164	31	(	(	-LRB-
10_1101-2021_01_07_425723	164	32	Fig	fig	NN
10_1101-2021_01_07_425723	164	33	.	.	.
10_1101-2021_01_07_425723	165	1	5a	5a	LS
10_1101-2021_01_07_425723	165	2	)	)	-RRB-
10_1101-2021_01_07_425723	165	3	,	,	,
10_1101-2021_01_07_425723	165	4	was	be	VBD
10_1101-2021_01_07_425723	165	5	recently	recently	RB
10_1101-2021_01_07_425723	165	6	shown	show	VBN
10_1101-2021_01_07_425723	165	7	to	to	TO
10_1101-2021_01_07_425723	165	8	enable	enable	VB
10_1101-2021_01_07_425723	165	9	sterol	sterol	JJ
10_1101-2021_01_07_425723	165	10	-	-	HYPH
10_1101-2021_01_07_425723	165	11	independent	independent	JJ
10_1101-2021_01_07_425723	165	12	growth	growth	NN
10_1101-2021_01_07_425723	165	13	of	of	IN
10_1101-2021_01_07_425723	165	14	S.	S.	NNP
10_1101-2021_01_07_425723	165	15	cerevisiae46	cerevisiae46	NNP
10_1101-2021_01_07_425723	165	16	.	.	.
10_1101-2021_01_07_425723	166	1	249	249	CD
10_1101-2021_01_07_425723	166	2	TtSTC1	ttstc1	CD
10_1101-2021_01_07_425723	166	3	was	be	VBD
10_1101-2021_01_07_425723	166	4	expressed	express	VBN
10_1101-2021_01_07_425723	166	5	in	in	IN
10_1101-2021_01_07_425723	166	6	K.	K.	NNP
10_1101-2021_01_07_425723	166	7	marxianus	marxianus	JJ
10_1101-2021_01_07_425723	166	8	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	166	9	,	,	,
10_1101-2021_01_07_425723	166	10	which	which	WDT
10_1101-2021_01_07_425723	166	11	is	be	VBZ
10_1101-2021_01_07_425723	166	12	more	more	RBR
10_1101-2021_01_07_425723	166	13	genetically	genetically	RB
10_1101-2021_01_07_425723	166	14	amenable	amenable	JJ
10_1101-2021_01_07_425723	166	15	than	than	IN
10_1101-2021_01_07_425723	166	16	strain	strain	VB
10_1101-2021_01_07_425723	166	17	250	250	CD
10_1101-2021_01_07_425723	166	18	CBS655647	cbs655647	NN
10_1101-2021_01_07_425723	166	19	.	.	.
10_1101-2021_01_07_425723	167	1	After	after	IN
10_1101-2021_01_07_425723	167	2	40	40	CD
10_1101-2021_01_07_425723	167	3	h	h	NN
10_1101-2021_01_07_425723	167	4	of	of	IN
10_1101-2021_01_07_425723	167	5	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	167	6	incubation	incubation	NN
10_1101-2021_01_07_425723	167	7	,	,	,
10_1101-2021_01_07_425723	167	8	the	the	DT
10_1101-2021_01_07_425723	167	9	resulting	result	VBG
10_1101-2021_01_07_425723	167	10	strain	strain	NN
10_1101-2021_01_07_425723	167	11	contained	contain	VBD
10_1101-2021_01_07_425723	167	12	2.4	2.4	CD
10_1101-2021_01_07_425723	167	13	±	±	CD
10_1101-2021_01_07_425723	167	14	0.4	0.4	CD
10_1101-2021_01_07_425723	167	15	mg·(g	mg·(g	NNP
10_1101-2021_01_07_425723	167	16	biomass)-1	biomass)-1	CD
10_1101-2021_01_07_425723	167	17	251	251	CD
10_1101-2021_01_07_425723	167	18	tetrahymanol	tetrahymanol	NNS
10_1101-2021_01_07_425723	167	19	,	,	,
10_1101-2021_01_07_425723	167	20	0.4	0.4	CD
10_1101-2021_01_07_425723	167	21	±	±	CD
10_1101-2021_01_07_425723	167	22	0.1	0.1	CD
10_1101-2021_01_07_425723	167	23	mg·g-1	mg·g-1	NNP
10_1101-2021_01_07_425723	167	24	ergosterol	ergosterol	UH
10_1101-2021_01_07_425723	167	25	and	and	CC
10_1101-2021_01_07_425723	167	26	no	no	DT
10_1101-2021_01_07_425723	167	27	detectable	detectable	JJ
10_1101-2021_01_07_425723	167	28	squalene	squalene	NN
10_1101-2021_01_07_425723	167	29	,	,	,
10_1101-2021_01_07_425723	167	30	while	while	IN
10_1101-2021_01_07_425723	167	31	strain	strain	NN
10_1101-2021_01_07_425723	167	32	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	167	33	contained	contain	VBD
10_1101-2021_01_07_425723	167	34	252	252	CD
10_1101-2021_01_07_425723	167	35	3.5	3.5	CD
10_1101-2021_01_07_425723	167	36	±	±	CD
10_1101-2021_01_07_425723	167	37	0.1	0.1	CD
10_1101-2021_01_07_425723	167	38	mg·g-1	mg·g-1	NN
10_1101-2021_01_07_425723	167	39	squalene	squalene	NN
10_1101-2021_01_07_425723	167	40	and	and	CC
10_1101-2021_01_07_425723	167	41	3.4	3.4	CD
10_1101-2021_01_07_425723	167	42	±	±	CD
10_1101-2021_01_07_425723	167	43	0.2	0.2	CD
10_1101-2021_01_07_425723	167	44	mg·g-1	mg·g-1	NN
10_1101-2021_01_07_425723	167	45	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	167	46	(	(	-LRB-
10_1101-2021_01_07_425723	167	47	Fig	fig	NN
10_1101-2021_01_07_425723	167	48	.	.	.
10_1101-2021_01_07_425723	168	1	5b	5b	NN
10_1101-2021_01_07_425723	168	2	)	)	-RRB-
10_1101-2021_01_07_425723	168	3	.	.	.
10_1101-2021_01_07_425723	169	1	In	in	IN
10_1101-2021_01_07_425723	169	2	strictly	strictly	RB
10_1101-2021_01_07_425723	169	3	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	169	4	cultures	culture	NNS
10_1101-2021_01_07_425723	169	5	on	on	IN
10_1101-2021_01_07_425723	169	6	sterol-253	sterol-253	NNP
10_1101-2021_01_07_425723	169	7	.CC	.CC	:
10_1101-2021_01_07_425723	169	8	-	-	HYPH
10_1101-2021_01_07_425723	169	9	BY	by	IN
10_1101-2021_01_07_425723	169	10	-	-	HYPH
10_1101-2021_01_07_425723	169	11	NC	NC	NNP
10_1101-2021_01_07_425723	169	12	-	-	HYPH
10_1101-2021_01_07_425723	169	13	ND	ND	NNP
10_1101-2021_01_07_425723	169	14	4.0	4.0	CD
10_1101-2021_01_07_425723	169	15	International	International	NNP
10_1101-2021_01_07_425723	169	16	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	169	17	under	under	IN
10_1101-2021_01_07_425723	169	18	a	a	DT
10_1101-2021_01_07_425723	169	19	(	(	-LRB-
10_1101-2021_01_07_425723	169	20	which	which	WDT
10_1101-2021_01_07_425723	169	21	was	be	VBD
10_1101-2021_01_07_425723	169	22	not	not	RB
10_1101-2021_01_07_425723	169	23	certified	certify	VBN
10_1101-2021_01_07_425723	169	24	by	by	IN
10_1101-2021_01_07_425723	169	25	peer	peer	NN
10_1101-2021_01_07_425723	169	26	review	review	NN
10_1101-2021_01_07_425723	169	27	)	)	-RRB-
10_1101-2021_01_07_425723	169	28	is	be	VBZ
10_1101-2021_01_07_425723	169	29	the	the	DT
10_1101-2021_01_07_425723	169	30	author	author	NN
10_1101-2021_01_07_425723	169	31	/	/	SYM
10_1101-2021_01_07_425723	169	32	funder	funder	NN
10_1101-2021_01_07_425723	169	33	,	,	,
10_1101-2021_01_07_425723	169	34	who	who	WP
10_1101-2021_01_07_425723	169	35	has	have	VBZ
10_1101-2021_01_07_425723	169	36	granted	grant	VBN
10_1101-2021_01_07_425723	169	37	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	169	38	a	a	DT
10_1101-2021_01_07_425723	169	39	license	license	NN
10_1101-2021_01_07_425723	169	40	to	to	TO
10_1101-2021_01_07_425723	169	41	display	display	VB
10_1101-2021_01_07_425723	169	42	the	the	DT
10_1101-2021_01_07_425723	169	43	preprint	preprint	NN
10_1101-2021_01_07_425723	169	44	in	in	IN
10_1101-2021_01_07_425723	169	45	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	169	46	.	.	.
10_1101-2021_01_07_425723	170	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	170	2	is	be	VBZ
10_1101-2021_01_07_425723	170	3	made	make	VBN
10_1101-2021_01_07_425723	170	4	The	the	DT
10_1101-2021_01_07_425723	170	5	copyright	copyright	NN
10_1101-2021_01_07_425723	170	6	holder	holder	NN
10_1101-2021_01_07_425723	170	7	for	for	IN
10_1101-2021_01_07_425723	170	8	this	this	DT
10_1101-2021_01_07_425723	170	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	170	10	version	version	NN
10_1101-2021_01_07_425723	170	11	posted	post	VBD
10_1101-2021_01_07_425723	170	12	January	January	NNP
10_1101-2021_01_07_425723	170	13	8	8	CD
10_1101-2021_01_07_425723	170	14	,	,	,
10_1101-2021_01_07_425723	170	15	2021	2021	CD
10_1101-2021_01_07_425723	170	16	.	.	.
10_1101-2021_01_07_425723	170	17	;	;	:
10_1101-2021_01_07_425723	170	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	170	19	:	:	:
10_1101-2021_01_07_425723	170	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	170	21	preprint	preprint	NN
10_1101-2021_01_07_425723	170	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	170	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	170	24	16	16	CD
10_1101-2021_01_07_425723	170	25	free	free	JJ
10_1101-2021_01_07_425723	170	26	medium	medium	NN
10_1101-2021_01_07_425723	170	27	,	,	,
10_1101-2021_01_07_425723	170	28	strain	strain	NN
10_1101-2021_01_07_425723	170	29	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	170	30	grew	grow	VBD
10_1101-2021_01_07_425723	170	31	immediately	immediately	RB
10_1101-2021_01_07_425723	170	32	after	after	IN
10_1101-2021_01_07_425723	170	33	inoculation	inoculation	NN
10_1101-2021_01_07_425723	170	34	but	but	CC
10_1101-2021_01_07_425723	170	35	not	not	RB
10_1101-2021_01_07_425723	170	36	after	after	IN
10_1101-2021_01_07_425723	170	37	transfer	transfer	NN
10_1101-2021_01_07_425723	170	38	to	to	IN
10_1101-2021_01_07_425723	170	39	a	a	DT
10_1101-2021_01_07_425723	170	40	second	second	JJ
10_1101-2021_01_07_425723	170	41	254	254	CD
10_1101-2021_01_07_425723	170	42	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	170	43	culture	culture	NN
10_1101-2021_01_07_425723	170	44	(	(	-LRB-
10_1101-2021_01_07_425723	170	45	Fig	fig	NN
10_1101-2021_01_07_425723	170	46	.	.	.
10_1101-2021_01_07_425723	171	1	5c	5c	LS
10_1101-2021_01_07_425723	171	2	)	)	-RRB-
10_1101-2021_01_07_425723	171	3	,	,	,
10_1101-2021_01_07_425723	171	4	consistent	consistent	JJ
10_1101-2021_01_07_425723	171	5	with	with	IN
10_1101-2021_01_07_425723	171	6	‘	'	``
10_1101-2021_01_07_425723	171	7	carry	carry	VB
10_1101-2021_01_07_425723	171	8	-	-	HYPH
10_1101-2021_01_07_425723	171	9	over	over	RP
10_1101-2021_01_07_425723	171	10	’	'	''
10_1101-2021_01_07_425723	171	11	of	of	IN
10_1101-2021_01_07_425723	171	12	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	171	13	from	from	IN
10_1101-2021_01_07_425723	171	14	the	the	DT
10_1101-2021_01_07_425723	171	15	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	171	16	preculture19	preculture19	NN
10_1101-2021_01_07_425723	171	17	.	.	.
10_1101-2021_01_07_425723	172	1	The	the	DT
10_1101-2021_01_07_425723	172	2	255	255	CD
10_1101-2021_01_07_425723	172	3	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	172	4	-	-	HYPH
10_1101-2021_01_07_425723	172	5	producing	produce	VBG
10_1101-2021_01_07_425723	172	6	strain	strain	NN
10_1101-2021_01_07_425723	172	7	did	do	VBD
10_1101-2021_01_07_425723	172	8	not	not	RB
10_1101-2021_01_07_425723	172	9	grow	grow	VB
10_1101-2021_01_07_425723	172	10	under	under	IN
10_1101-2021_01_07_425723	172	11	these	these	DT
10_1101-2021_01_07_425723	172	12	conditions	condition	NNS
10_1101-2021_01_07_425723	172	13	(	(	-LRB-
10_1101-2021_01_07_425723	172	14	Fig	fig	NN
10_1101-2021_01_07_425723	172	15	.	.	.
10_1101-2021_01_07_425723	173	1	5c	5c	LS
10_1101-2021_01_07_425723	173	2	)	)	-RRB-
10_1101-2021_01_07_425723	173	3	but	but	CC
10_1101-2021_01_07_425723	173	4	showed	show	VBD
10_1101-2021_01_07_425723	173	5	sustained	sustained	JJ
10_1101-2021_01_07_425723	173	6	256	256	CD
10_1101-2021_01_07_425723	173	7	growth	growth	NN
10_1101-2021_01_07_425723	173	8	under	under	IN
10_1101-2021_01_07_425723	173	9	severely	severely	RB
10_1101-2021_01_07_425723	173	10	oxygen	oxygen	NN
10_1101-2021_01_07_425723	173	11	-	-	HYPH
10_1101-2021_01_07_425723	173	12	limited	limit	VBN
10_1101-2021_01_07_425723	173	13	conditions	condition	NNS
10_1101-2021_01_07_425723	173	14	that	that	WDT
10_1101-2021_01_07_425723	173	15	did	do	VBD
10_1101-2021_01_07_425723	173	16	not	not	RB
10_1101-2021_01_07_425723	173	17	support	support	VB
10_1101-2021_01_07_425723	173	18	growth	growth	NN
10_1101-2021_01_07_425723	173	19	of	of	IN
10_1101-2021_01_07_425723	173	20	strain	strain	NN
10_1101-2021_01_07_425723	173	21	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	173	22	(	(	-LRB-
10_1101-2021_01_07_425723	173	23	Fig	fig	NN
10_1101-2021_01_07_425723	173	24	.	.	.
10_1101-2021_01_07_425723	174	1	257	257	CD
10_1101-2021_01_07_425723	174	2	5de	5de	NNP
10_1101-2021_01_07_425723	174	3	)	)	-RRB-
10_1101-2021_01_07_425723	174	4	.	.	.
10_1101-2021_01_07_425723	175	1	Single	single	JJ
10_1101-2021_01_07_425723	175	2	-	-	HYPH
10_1101-2021_01_07_425723	175	3	cell	cell	NN
10_1101-2021_01_07_425723	175	4	isolates	isolate	NNS
10_1101-2021_01_07_425723	175	5	derived	derive	VBN
10_1101-2021_01_07_425723	175	6	from	from	IN
10_1101-2021_01_07_425723	175	7	these	these	DT
10_1101-2021_01_07_425723	175	8	oxygen	oxygen	NN
10_1101-2021_01_07_425723	175	9	-	-	HYPH
10_1101-2021_01_07_425723	175	10	limited	limit	VBN
10_1101-2021_01_07_425723	175	11	cultures	culture	NNS
10_1101-2021_01_07_425723	175	12	(	(	-LRB-
10_1101-2021_01_07_425723	175	13	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	175	14	,	,	,
10_1101-2021_01_07_425723	175	15	IMS1131	IMS1131	NNP
10_1101-2021_01_07_425723	175	16	,	,	,
10_1101-2021_01_07_425723	175	17	IMS1132	IMS1132	NNP
10_1101-2021_01_07_425723	175	18	,	,	,
10_1101-2021_01_07_425723	175	19	258	258	CD
10_1101-2021_01_07_425723	175	20	IMS1133	IMS1133	NNP
10_1101-2021_01_07_425723	175	21	)	)	-RRB-
10_1101-2021_01_07_425723	175	22	showed	show	VBD
10_1101-2021_01_07_425723	175	23	instantaneous	instantaneous	JJ
10_1101-2021_01_07_425723	175	24	as	as	RB
10_1101-2021_01_07_425723	175	25	well	well	RB
10_1101-2021_01_07_425723	175	26	as	as	IN
10_1101-2021_01_07_425723	175	27	sustained	sustain	VBN
10_1101-2021_01_07_425723	175	28	growth	growth	NN
10_1101-2021_01_07_425723	175	29	under	under	IN
10_1101-2021_01_07_425723	175	30	strictly	strictly	RB
10_1101-2021_01_07_425723	175	31	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	175	32	conditions	condition	NNS
10_1101-2021_01_07_425723	175	33	(	(	-LRB-
10_1101-2021_01_07_425723	175	34	Figure	Figure	NNP
10_1101-2021_01_07_425723	175	35	259	259	CD
10_1101-2021_01_07_425723	175	36	5f	5f	NNS
10_1101-2021_01_07_425723	175	37	and	and	CC
10_1101-2021_01_07_425723	175	38	5	5	CD
10_1101-2021_01_07_425723	175	39	g	g	NN
10_1101-2021_01_07_425723	175	40	)	)	-RRB-
10_1101-2021_01_07_425723	175	41	.	.	.
10_1101-2021_01_07_425723	176	1	Tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	176	2	contents	content	VBZ
10_1101-2021_01_07_425723	176	3	in	in	IN
10_1101-2021_01_07_425723	176	4	the	the	DT
10_1101-2021_01_07_425723	176	5	first	first	JJ
10_1101-2021_01_07_425723	176	6	,	,	,
10_1101-2021_01_07_425723	176	7	second	second	JJ
10_1101-2021_01_07_425723	176	8	and	and	CC
10_1101-2021_01_07_425723	176	9	third	third	JJ
10_1101-2021_01_07_425723	176	10	cycle	cycle	NN
10_1101-2021_01_07_425723	176	11	of	of	IN
10_1101-2021_01_07_425723	176	12	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	176	13	cultivation	cultivation	NN
10_1101-2021_01_07_425723	176	14	of	of	IN
10_1101-2021_01_07_425723	176	15	isolate	isolate	NN
10_1101-2021_01_07_425723	176	16	260	260	CD
10_1101-2021_01_07_425723	176	17	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	176	18	were	be	VBD
10_1101-2021_01_07_425723	176	19	7.6	7.6	CD
10_1101-2021_01_07_425723	176	20	±	±	CD
10_1101-2021_01_07_425723	176	21	0.0	0.0	CD
10_1101-2021_01_07_425723	176	22	mg·g-1	mg·g-1	CD
10_1101-2021_01_07_425723	176	23	,	,	,
10_1101-2021_01_07_425723	176	24	28.0	28.0	CD
10_1101-2021_01_07_425723	176	25	±	±	CD
10_1101-2021_01_07_425723	176	26	13.0	13.0	CD
10_1101-2021_01_07_425723	176	27	mg·g-1	mg·g-1	NNP
10_1101-2021_01_07_425723	176	28	and	and	CC
10_1101-2021_01_07_425723	176	29	11.5	11.5	CD
10_1101-2021_01_07_425723	176	30	±	±	CD
10_1101-2021_01_07_425723	176	31	0.1	0.1	CD
10_1101-2021_01_07_425723	176	32	mg·g-1	mg·g-1	NNP
10_1101-2021_01_07_425723	176	33	,	,	,
10_1101-2021_01_07_425723	176	34	respectively	respectively	RB
10_1101-2021_01_07_425723	176	35	(	(	-LRB-
10_1101-2021_01_07_425723	176	36	Fig	fig	NN
10_1101-2021_01_07_425723	176	37	.	.	.
10_1101-2021_01_07_425723	177	1	5b	5b	NN
10_1101-2021_01_07_425723	177	2	)	)	-RRB-
10_1101-2021_01_07_425723	177	3	,	,	,
10_1101-2021_01_07_425723	177	4	while	while	IN
10_1101-2021_01_07_425723	177	5	no	no	DT
10_1101-2021_01_07_425723	177	6	261	261	CD
10_1101-2021_01_07_425723	177	7	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	177	8	was	be	VBD
10_1101-2021_01_07_425723	177	9	detected	detect	VBN
10_1101-2021_01_07_425723	177	10	.	.	.
10_1101-2021_01_07_425723	178	1	262	262	CD
10_1101-2021_01_07_425723	178	2	To	to	TO
10_1101-2021_01_07_425723	178	3	identify	identify	VB
10_1101-2021_01_07_425723	178	4	whether	whether	IN
10_1101-2021_01_07_425723	178	5	adaptation	adaptation	NN
10_1101-2021_01_07_425723	178	6	of	of	IN
10_1101-2021_01_07_425723	178	7	the	the	DT
10_1101-2021_01_07_425723	178	8	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	178	9	-	-	HYPH
10_1101-2021_01_07_425723	178	10	producing	produce	VBG
10_1101-2021_01_07_425723	178	11	strain	strain	NN
10_1101-2021_01_07_425723	178	12	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	178	13	to	to	TO
10_1101-2021_01_07_425723	178	14	anaerobic	anaerobic	VB
10_1101-2021_01_07_425723	178	15	growth	growth	NN
10_1101-2021_01_07_425723	178	16	263	263	CD
10_1101-2021_01_07_425723	178	17	involved	involve	VBD
10_1101-2021_01_07_425723	178	18	genetic	genetic	JJ
10_1101-2021_01_07_425723	178	19	changes	change	NNS
10_1101-2021_01_07_425723	178	20	,	,	,
10_1101-2021_01_07_425723	178	21	its	-PRON-	PRP$
10_1101-2021_01_07_425723	178	22	genome	genome	NN
10_1101-2021_01_07_425723	178	23	and	and	CC
10_1101-2021_01_07_425723	178	24	those	those	DT
10_1101-2021_01_07_425723	178	25	of	of	IN
10_1101-2021_01_07_425723	178	26	the	the	DT
10_1101-2021_01_07_425723	178	27	four	four	CD
10_1101-2021_01_07_425723	178	28	adapted	adapt	VBN
10_1101-2021_01_07_425723	178	29	isolates	isolate	NNS
10_1101-2021_01_07_425723	178	30	were	be	VBD
10_1101-2021_01_07_425723	178	31	sequenced	sequence	VBN
10_1101-2021_01_07_425723	178	32	264	264	CD
10_1101-2021_01_07_425723	178	33	(	(	-LRB-
10_1101-2021_01_07_425723	178	34	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	178	35	Table	Table	NNP
10_1101-2021_01_07_425723	178	36	1	1	CD
10_1101-2021_01_07_425723	178	37	)	)	-RRB-
10_1101-2021_01_07_425723	178	38	.	.	.
10_1101-2021_01_07_425723	179	1	No	no	DT
10_1101-2021_01_07_425723	179	2	copy	copy	NN
10_1101-2021_01_07_425723	179	3	number	number	NN
10_1101-2021_01_07_425723	179	4	variations	variation	NNS
10_1101-2021_01_07_425723	179	5	were	be	VBD
10_1101-2021_01_07_425723	179	6	detected	detect	VBN
10_1101-2021_01_07_425723	179	7	in	in	IN
10_1101-2021_01_07_425723	179	8	any	any	DT
10_1101-2021_01_07_425723	179	9	of	of	IN
10_1101-2021_01_07_425723	179	10	the	the	DT
10_1101-2021_01_07_425723	179	11	four	four	CD
10_1101-2021_01_07_425723	179	12	adapted	adapt	VBN
10_1101-2021_01_07_425723	179	13	isolates	isolate	NNS
10_1101-2021_01_07_425723	179	14	.	.	.
10_1101-2021_01_07_425723	180	1	265	265	CD
10_1101-2021_01_07_425723	180	2	Only	only	RB
10_1101-2021_01_07_425723	180	3	strain	strain	VB
10_1101-2021_01_07_425723	180	4	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	180	5	showed	show	VBD
10_1101-2021_01_07_425723	180	6	two	two	CD
10_1101-2021_01_07_425723	180	7	non	non	JJ
10_1101-2021_01_07_425723	180	8	-	-	JJ
10_1101-2021_01_07_425723	180	9	conservative	conservative	JJ
10_1101-2021_01_07_425723	180	10	mutations	mutation	NNS
10_1101-2021_01_07_425723	180	11	in	in	IN
10_1101-2021_01_07_425723	180	12	coding	code	VBG
10_1101-2021_01_07_425723	180	13	regions	region	NNS
10_1101-2021_01_07_425723	180	14	:	:	:
10_1101-2021_01_07_425723	180	15	a	a	DT
10_1101-2021_01_07_425723	180	16	single	single	JJ
10_1101-2021_01_07_425723	180	17	-	-	HYPH
10_1101-2021_01_07_425723	180	18	nucleotide	nucleotide	NN
10_1101-2021_01_07_425723	180	19	266	266	CD
10_1101-2021_01_07_425723	180	20	insertion	insertion	NN
10_1101-2021_01_07_425723	180	21	in	in	IN
10_1101-2021_01_07_425723	180	22	a	a	DT
10_1101-2021_01_07_425723	180	23	transposon	transposon	NNP
10_1101-2021_01_07_425723	180	24	-	-	HYPH
10_1101-2021_01_07_425723	180	25	borne	bear	VBN
10_1101-2021_01_07_425723	180	26	gene	gene	NN
10_1101-2021_01_07_425723	180	27	and	and	CC
10_1101-2021_01_07_425723	180	28	a	a	DT
10_1101-2021_01_07_425723	180	29	stop	stop	NN
10_1101-2021_01_07_425723	180	30	codon	codon	NN
10_1101-2021_01_07_425723	180	31	at	at	IN
10_1101-2021_01_07_425723	180	32	position	position	NN
10_1101-2021_01_07_425723	180	33	350	350	CD
10_1101-2021_01_07_425723	180	34	(	(	-LRB-
10_1101-2021_01_07_425723	180	35	of	of	IN
10_1101-2021_01_07_425723	180	36	496	496	CD
10_1101-2021_01_07_425723	180	37	bp	bp	NN
10_1101-2021_01_07_425723	180	38	)	)	-RRB-
10_1101-2021_01_07_425723	180	39	in	in	IN
10_1101-2021_01_07_425723	180	40	KmCLN3	KmCLN3	NNP
10_1101-2021_01_07_425723	180	41	,	,	,
10_1101-2021_01_07_425723	180	42	which	which	WDT
10_1101-2021_01_07_425723	180	43	267	267	CD
10_1101-2021_01_07_425723	180	44	encodes	encode	NNS
10_1101-2021_01_07_425723	180	45	for	for	IN
10_1101-2021_01_07_425723	180	46	a	a	DT
10_1101-2021_01_07_425723	180	47	G1	g1	NN
10_1101-2021_01_07_425723	180	48	cyclin48	cyclin48	NN
10_1101-2021_01_07_425723	180	49	.	.	.
10_1101-2021_01_07_425723	181	1	The	the	DT
10_1101-2021_01_07_425723	181	2	apparent	apparent	JJ
10_1101-2021_01_07_425723	181	3	absence	absence	NN
10_1101-2021_01_07_425723	181	4	of	of	IN
10_1101-2021_01_07_425723	181	5	mutations	mutation	NNS
10_1101-2021_01_07_425723	181	6	in	in	IN
10_1101-2021_01_07_425723	181	7	the	the	DT
10_1101-2021_01_07_425723	181	8	three	three	CD
10_1101-2021_01_07_425723	181	9	other	other	JJ
10_1101-2021_01_07_425723	181	10	,	,	,
10_1101-2021_01_07_425723	181	11	independently	independently	RB
10_1101-2021_01_07_425723	181	12	adapted	adapt	VBD
10_1101-2021_01_07_425723	181	13	268	268	CD
10_1101-2021_01_07_425723	181	14	strains	strain	NNS
10_1101-2021_01_07_425723	181	15	indicated	indicate	VBD
10_1101-2021_01_07_425723	181	16	that	that	IN
10_1101-2021_01_07_425723	181	17	their	-PRON-	PRP$
10_1101-2021_01_07_425723	181	18	ability	ability	NN
10_1101-2021_01_07_425723	181	19	to	to	TO
10_1101-2021_01_07_425723	181	20	grow	grow	VB
10_1101-2021_01_07_425723	181	21	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	181	22	reflected	reflect	VBN
10_1101-2021_01_07_425723	181	23	a	a	DT
10_1101-2021_01_07_425723	181	24	non	non	JJ
10_1101-2021_01_07_425723	181	25	-	-	JJ
10_1101-2021_01_07_425723	181	26	genetic	genetic	JJ
10_1101-2021_01_07_425723	181	27	adaptation	adaptation	NN
10_1101-2021_01_07_425723	181	28	.	.	.
10_1101-2021_01_07_425723	182	1	269	269	CD
10_1101-2021_01_07_425723	182	2	.CC	.CC	:
10_1101-2021_01_07_425723	182	3	-	-	HYPH
10_1101-2021_01_07_425723	182	4	BY	by	IN
10_1101-2021_01_07_425723	182	5	-	-	HYPH
10_1101-2021_01_07_425723	182	6	NC	NC	NNP
10_1101-2021_01_07_425723	182	7	-	-	HYPH
10_1101-2021_01_07_425723	182	8	ND	ND	NNP
10_1101-2021_01_07_425723	182	9	4.0	4.0	CD
10_1101-2021_01_07_425723	182	10	International	International	NNP
10_1101-2021_01_07_425723	182	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	182	12	under	under	IN
10_1101-2021_01_07_425723	182	13	a	a	DT
10_1101-2021_01_07_425723	182	14	(	(	-LRB-
10_1101-2021_01_07_425723	182	15	which	which	WDT
10_1101-2021_01_07_425723	182	16	was	be	VBD
10_1101-2021_01_07_425723	182	17	not	not	RB
10_1101-2021_01_07_425723	182	18	certified	certify	VBN
10_1101-2021_01_07_425723	182	19	by	by	IN
10_1101-2021_01_07_425723	182	20	peer	peer	NN
10_1101-2021_01_07_425723	182	21	review	review	NN
10_1101-2021_01_07_425723	182	22	)	)	-RRB-
10_1101-2021_01_07_425723	182	23	is	be	VBZ
10_1101-2021_01_07_425723	182	24	the	the	DT
10_1101-2021_01_07_425723	182	25	author	author	NN
10_1101-2021_01_07_425723	182	26	/	/	SYM
10_1101-2021_01_07_425723	182	27	funder	funder	NN
10_1101-2021_01_07_425723	182	28	,	,	,
10_1101-2021_01_07_425723	182	29	who	who	WP
10_1101-2021_01_07_425723	182	30	has	have	VBZ
10_1101-2021_01_07_425723	182	31	granted	grant	VBN
10_1101-2021_01_07_425723	182	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	182	33	a	a	DT
10_1101-2021_01_07_425723	182	34	license	license	NN
10_1101-2021_01_07_425723	182	35	to	to	TO
10_1101-2021_01_07_425723	182	36	display	display	VB
10_1101-2021_01_07_425723	182	37	the	the	DT
10_1101-2021_01_07_425723	182	38	preprint	preprint	NN
10_1101-2021_01_07_425723	182	39	in	in	IN
10_1101-2021_01_07_425723	182	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	182	41	.	.	.
10_1101-2021_01_07_425723	183	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	183	2	is	be	VBZ
10_1101-2021_01_07_425723	183	3	made	make	VBN
10_1101-2021_01_07_425723	183	4	The	the	DT
10_1101-2021_01_07_425723	183	5	copyright	copyright	NN
10_1101-2021_01_07_425723	183	6	holder	holder	NN
10_1101-2021_01_07_425723	183	7	for	for	IN
10_1101-2021_01_07_425723	183	8	this	this	DT
10_1101-2021_01_07_425723	183	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	183	10	version	version	NN
10_1101-2021_01_07_425723	183	11	posted	post	VBD
10_1101-2021_01_07_425723	183	12	January	January	NNP
10_1101-2021_01_07_425723	183	13	8	8	CD
10_1101-2021_01_07_425723	183	14	,	,	,
10_1101-2021_01_07_425723	183	15	2021	2021	CD
10_1101-2021_01_07_425723	183	16	.	.	.
10_1101-2021_01_07_425723	183	17	;	;	:
10_1101-2021_01_07_425723	183	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	183	19	:	:	:
10_1101-2021_01_07_425723	183	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	183	21	preprint	preprint	NN
10_1101-2021_01_07_425723	183	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	183	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	183	24	17	17	CD
10_1101-2021_01_07_425723	183	25	Fig	Fig	NNP
10_1101-2021_01_07_425723	183	26	.	.	.
10_1101-2021_01_07_425723	184	1	5	5	CD
10_1101-2021_01_07_425723	184	2	|	|	NNP
10_1101-2021_01_07_425723	184	3	Sterol	Sterol	NNP
10_1101-2021_01_07_425723	184	4	-	-	HYPH
10_1101-2021_01_07_425723	184	5	independent	independent	JJ
10_1101-2021_01_07_425723	184	6	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	184	7	growth	growth	NN
10_1101-2021_01_07_425723	184	8	of	of	IN
10_1101-2021_01_07_425723	184	9	K.	K.	NNP
10_1101-2021_01_07_425723	184	10	marxianus	marxianus	NN
10_1101-2021_01_07_425723	184	11	strains	strain	VBZ
10_1101-2021_01_07_425723	184	12	expressing	express	VBG
10_1101-2021_01_07_425723	184	13	TtSTC1	ttstc1	CD
10_1101-2021_01_07_425723	184	14	.	.	.
10_1101-2021_01_07_425723	185	1	a	a	LS
10_1101-2021_01_07_425723	185	2	,	,	,
10_1101-2021_01_07_425723	185	3	Oxygen-270	oxygen-270	ADD
10_1101-2021_01_07_425723	185	4	dependent	dependent	JJ
10_1101-2021_01_07_425723	185	5	sterol	sterol	JJ
10_1101-2021_01_07_425723	185	6	synthesis	synthesis	NN
10_1101-2021_01_07_425723	185	7	and	and	CC
10_1101-2021_01_07_425723	185	8	cyclisation	cyclisation	NN
10_1101-2021_01_07_425723	185	9	of	of	IN
10_1101-2021_01_07_425723	185	10	squalene	squalene	NN
10_1101-2021_01_07_425723	185	11	to	to	IN
10_1101-2021_01_07_425723	185	12	tetrahymanol	tetrahymanol	NNS
10_1101-2021_01_07_425723	185	13	by	by	IN
10_1101-2021_01_07_425723	185	14	TtStc1	ttstc1	NN
10_1101-2021_01_07_425723	185	15	.	.	.
10_1101-2021_01_07_425723	186	1	b	b	LS
10_1101-2021_01_07_425723	186	2	,	,	,
10_1101-2021_01_07_425723	186	3	Squalene	Squalene	NNP
10_1101-2021_01_07_425723	186	4	,	,	,
10_1101-2021_01_07_425723	186	5	271	271	CD
10_1101-2021_01_07_425723	186	6	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	186	7	,	,	,
10_1101-2021_01_07_425723	186	8	and	and	CC
10_1101-2021_01_07_425723	186	9	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	186	10	contents	content	NNS
10_1101-2021_01_07_425723	186	11	with	with	IN
10_1101-2021_01_07_425723	186	12	mean	mean	JJ
10_1101-2021_01_07_425723	186	13	and	and	CC
10_1101-2021_01_07_425723	186	14	standard	standard	JJ
10_1101-2021_01_07_425723	186	15	error	error	NN
10_1101-2021_01_07_425723	186	16	of	of	IN
10_1101-2021_01_07_425723	186	17	the	the	DT
10_1101-2021_01_07_425723	186	18	mean	mean	NN
10_1101-2021_01_07_425723	186	19	of	of	IN
10_1101-2021_01_07_425723	186	20	(	(	-LRB-
10_1101-2021_01_07_425723	186	21	left	left	JJ
10_1101-2021_01_07_425723	186	22	panel	panel	NN
10_1101-2021_01_07_425723	186	23	)	)	-RRB-
10_1101-2021_01_07_425723	186	24	S.	S.	NNP
10_1101-2021_01_07_425723	186	25	272	272	CD
10_1101-2021_01_07_425723	186	26	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	186	27	strains	strain	VBZ
10_1101-2021_01_07_425723	186	28	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	186	29	(	(	-LRB-
10_1101-2021_01_07_425723	186	30	reference	reference	NN
10_1101-2021_01_07_425723	186	31	)	)	-RRB-
10_1101-2021_01_07_425723	186	32	,	,	,
10_1101-2021_01_07_425723	186	33	IMX1438	IMX1438	NNP
10_1101-2021_01_07_425723	186	34	(	(	-LRB-
10_1101-2021_01_07_425723	186	35	sga1Δ::TtSTC1	sga1Δ::TtSTC1	NNP
10_1101-2021_01_07_425723	186	36	)	)	-RRB-
10_1101-2021_01_07_425723	186	37	,	,	,
10_1101-2021_01_07_425723	186	38	and	and	CC
10_1101-2021_01_07_425723	186	39	K.	K.	NNP
10_1101-2021_01_07_425723	186	40	marxianus	marxianus	NN
10_1101-2021_01_07_425723	186	41	strains	strain	VBZ
10_1101-2021_01_07_425723	186	42	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	186	43	273	273	CD
10_1101-2021_01_07_425723	186	44	(	(	-LRB-
10_1101-2021_01_07_425723	186	45	reference	reference	NN
10_1101-2021_01_07_425723	186	46	)	)	-RRB-
10_1101-2021_01_07_425723	186	47	,	,	,
10_1101-2021_01_07_425723	186	48	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	186	49	(	(	-LRB-
10_1101-2021_01_07_425723	186	50	TtSTC1	TtSTC1	NNP
10_1101-2021_01_07_425723	186	51	)	)	-RRB-
10_1101-2021_01_07_425723	186	52	.	.	.
10_1101-2021_01_07_425723	187	1	Lipid	lipid	NN
10_1101-2021_01_07_425723	187	2	composition	composition	NN
10_1101-2021_01_07_425723	187	3	of	of	IN
10_1101-2021_01_07_425723	187	4	single	single	JJ
10_1101-2021_01_07_425723	187	5	-	-	HYPH
10_1101-2021_01_07_425723	187	6	cell	cell	NN
10_1101-2021_01_07_425723	187	7	isolate	isolate	NN
10_1101-2021_01_07_425723	187	8	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	187	9	(	(	-LRB-
10_1101-2021_01_07_425723	187	10	TtSTC1	TtSTC1	NNP
10_1101-2021_01_07_425723	187	11	)	)	-RRB-
10_1101-2021_01_07_425723	187	12	(	(	-LRB-
10_1101-2021_01_07_425723	187	13	right	right	JJ
10_1101-2021_01_07_425723	187	14	panel	panel	NN
10_1101-2021_01_07_425723	187	15	)	)	-RRB-
10_1101-2021_01_07_425723	187	16	274	274	CD
10_1101-2021_01_07_425723	187	17	over	over	IN
10_1101-2021_01_07_425723	187	18	3	3	CD
10_1101-2021_01_07_425723	187	19	serial	serial	JJ
10_1101-2021_01_07_425723	187	20	transfers	transfer	NNS
10_1101-2021_01_07_425723	187	21	(	(	-LRB-
10_1101-2021_01_07_425723	187	22	C1-C3	C1-C3	NNP
10_1101-2021_01_07_425723	187	23	)	)	-RRB-
10_1101-2021_01_07_425723	187	24	.	.	.
10_1101-2021_01_07_425723	188	1	Data	datum	NNS
10_1101-2021_01_07_425723	188	2	from	from	IN
10_1101-2021_01_07_425723	188	3	replicate	replicate	NN
10_1101-2021_01_07_425723	188	4	cultures	culture	NNS
10_1101-2021_01_07_425723	188	5	grown	grow	VBN
10_1101-2021_01_07_425723	188	6	in	in	IN
10_1101-2021_01_07_425723	188	7	strictly	strictly	RB
10_1101-2021_01_07_425723	188	8	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	188	9	(	(	-LRB-
10_1101-2021_01_07_425723	188	10	c	c	NN
10_1101-2021_01_07_425723	188	11	,	,	,
10_1101-2021_01_07_425723	188	12	f	f	NNP
10_1101-2021_01_07_425723	188	13	,	,	,
10_1101-2021_01_07_425723	188	14	g	g	NNP
10_1101-2021_01_07_425723	188	15	)	)	-RRB-
10_1101-2021_01_07_425723	188	16	or	or	CC
10_1101-2021_01_07_425723	188	17	275	275	CD
10_1101-2021_01_07_425723	188	18	severely	severely	RB
10_1101-2021_01_07_425723	188	19	oxygen	oxygen	NN
10_1101-2021_01_07_425723	188	20	-	-	HYPH
10_1101-2021_01_07_425723	188	21	limited	limit	VBN
10_1101-2021_01_07_425723	188	22	shake	shake	NN
10_1101-2021_01_07_425723	188	23	-	-	HYPH
10_1101-2021_01_07_425723	188	24	flask	flask	NN
10_1101-2021_01_07_425723	188	25	cultures	culture	NNS
10_1101-2021_01_07_425723	188	26	(	(	-LRB-
10_1101-2021_01_07_425723	188	27	d	d	NN
10_1101-2021_01_07_425723	188	28	,	,	,
10_1101-2021_01_07_425723	188	29	e	e	NNP
10_1101-2021_01_07_425723	188	30	)	)	-RRB-
10_1101-2021_01_07_425723	188	31	.	.	.
10_1101-2021_01_07_425723	189	1	Aerobic	Aerobic	NNP
10_1101-2021_01_07_425723	189	2	grown	grow	VBD
10_1101-2021_01_07_425723	189	3	pre	pre	JJ
10_1101-2021_01_07_425723	189	4	-	-	NNS
10_1101-2021_01_07_425723	189	5	cultures	culture	NNS
10_1101-2021_01_07_425723	189	6	were	be	VBD
10_1101-2021_01_07_425723	189	7	used	use	VBN
10_1101-2021_01_07_425723	189	8	to	to	TO
10_1101-2021_01_07_425723	189	9	inoculate	inoculate	VB
10_1101-2021_01_07_425723	189	10	276	276	CD
10_1101-2021_01_07_425723	189	11	the	the	DT
10_1101-2021_01_07_425723	189	12	first	first	JJ
10_1101-2021_01_07_425723	189	13	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	189	14	culture	culture	NN
10_1101-2021_01_07_425723	189	15	on	on	IN
10_1101-2021_01_07_425723	189	16	SMG	SMG	NNP
10_1101-2021_01_07_425723	189	17	-	-	HYPH
10_1101-2021_01_07_425723	189	18	urea	urea	NNP
10_1101-2021_01_07_425723	189	19	and	and	CC
10_1101-2021_01_07_425723	189	20	Tween	Tween	NNP
10_1101-2021_01_07_425723	189	21	80	80	CD
10_1101-2021_01_07_425723	189	22	,	,	,
10_1101-2021_01_07_425723	189	23	when	when	WRB
10_1101-2021_01_07_425723	189	24	the	the	DT
10_1101-2021_01_07_425723	189	25	optical	optical	JJ
10_1101-2021_01_07_425723	189	26	density	density	NN
10_1101-2021_01_07_425723	189	27	started	start	VBD
10_1101-2021_01_07_425723	189	28	to	to	TO
10_1101-2021_01_07_425723	189	29	stabilize	stabilize	VB
10_1101-2021_01_07_425723	189	30	the	the	DT
10_1101-2021_01_07_425723	189	31	277	277	CD
10_1101-2021_01_07_425723	189	32	cultures	culture	NNS
10_1101-2021_01_07_425723	189	33	were	be	VBD
10_1101-2021_01_07_425723	189	34	transferred	transfer	VBN
10_1101-2021_01_07_425723	189	35	to	to	IN
10_1101-2021_01_07_425723	189	36	new	new	JJ
10_1101-2021_01_07_425723	189	37	media	medium	NNS
10_1101-2021_01_07_425723	189	38	.	.	.
10_1101-2021_01_07_425723	190	1	Data	datum	NNS
10_1101-2021_01_07_425723	190	2	depicted	depict	VBN
10_1101-2021_01_07_425723	190	3	are	be	VBP
10_1101-2021_01_07_425723	190	4	of	of	IN
10_1101-2021_01_07_425723	190	5	each	each	DT
10_1101-2021_01_07_425723	190	6	replicate	replicate	NN
10_1101-2021_01_07_425723	190	7	culture	culture	NN
10_1101-2021_01_07_425723	190	8	(	(	-LRB-
10_1101-2021_01_07_425723	190	9	points	point	NNS
10_1101-2021_01_07_425723	190	10	)	)	-RRB-
10_1101-2021_01_07_425723	190	11	and	and	CC
10_1101-2021_01_07_425723	190	12	the	the	DT
10_1101-2021_01_07_425723	190	13	278	278	CD
10_1101-2021_01_07_425723	190	14	.CC	.CC	,
10_1101-2021_01_07_425723	190	15	-	-	HYPH
10_1101-2021_01_07_425723	190	16	BY	by	IN
10_1101-2021_01_07_425723	190	17	-	-	HYPH
10_1101-2021_01_07_425723	190	18	NC	NC	NNP
10_1101-2021_01_07_425723	190	19	-	-	HYPH
10_1101-2021_01_07_425723	190	20	ND	ND	NNP
10_1101-2021_01_07_425723	190	21	4.0	4.0	CD
10_1101-2021_01_07_425723	190	22	International	International	NNP
10_1101-2021_01_07_425723	190	23	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	190	24	under	under	IN
10_1101-2021_01_07_425723	190	25	a	a	DT
10_1101-2021_01_07_425723	190	26	(	(	-LRB-
10_1101-2021_01_07_425723	190	27	which	which	WDT
10_1101-2021_01_07_425723	190	28	was	be	VBD
10_1101-2021_01_07_425723	190	29	not	not	RB
10_1101-2021_01_07_425723	190	30	certified	certify	VBN
10_1101-2021_01_07_425723	190	31	by	by	IN
10_1101-2021_01_07_425723	190	32	peer	peer	NN
10_1101-2021_01_07_425723	190	33	review	review	NN
10_1101-2021_01_07_425723	190	34	)	)	-RRB-
10_1101-2021_01_07_425723	190	35	is	be	VBZ
10_1101-2021_01_07_425723	190	36	the	the	DT
10_1101-2021_01_07_425723	190	37	author	author	NN
10_1101-2021_01_07_425723	190	38	/	/	SYM
10_1101-2021_01_07_425723	190	39	funder	funder	NN
10_1101-2021_01_07_425723	190	40	,	,	,
10_1101-2021_01_07_425723	190	41	who	who	WP
10_1101-2021_01_07_425723	190	42	has	have	VBZ
10_1101-2021_01_07_425723	190	43	granted	grant	VBN
10_1101-2021_01_07_425723	190	44	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	190	45	a	a	DT
10_1101-2021_01_07_425723	190	46	license	license	NN
10_1101-2021_01_07_425723	190	47	to	to	TO
10_1101-2021_01_07_425723	190	48	display	display	VB
10_1101-2021_01_07_425723	190	49	the	the	DT
10_1101-2021_01_07_425723	190	50	preprint	preprint	NN
10_1101-2021_01_07_425723	190	51	in	in	IN
10_1101-2021_01_07_425723	190	52	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	190	53	.	.	.
10_1101-2021_01_07_425723	191	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	191	2	is	be	VBZ
10_1101-2021_01_07_425723	191	3	made	make	VBN
10_1101-2021_01_07_425723	191	4	The	the	DT
10_1101-2021_01_07_425723	191	5	copyright	copyright	NN
10_1101-2021_01_07_425723	191	6	holder	holder	NN
10_1101-2021_01_07_425723	191	7	for	for	IN
10_1101-2021_01_07_425723	191	8	this	this	DT
10_1101-2021_01_07_425723	191	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	191	10	version	version	NN
10_1101-2021_01_07_425723	191	11	posted	post	VBD
10_1101-2021_01_07_425723	191	12	January	January	NNP
10_1101-2021_01_07_425723	191	13	8	8	CD
10_1101-2021_01_07_425723	191	14	,	,	,
10_1101-2021_01_07_425723	191	15	2021	2021	CD
10_1101-2021_01_07_425723	191	16	.	.	.
10_1101-2021_01_07_425723	191	17	;	;	:
10_1101-2021_01_07_425723	191	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	191	19	:	:	:
10_1101-2021_01_07_425723	191	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	191	21	preprint	preprint	NN
10_1101-2021_01_07_425723	191	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	191	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	191	24	18	18	CD
10_1101-2021_01_07_425723	191	25	mean	mean	NN
10_1101-2021_01_07_425723	191	26	(	(	-LRB-
10_1101-2021_01_07_425723	191	27	dotted	dotted	JJ
10_1101-2021_01_07_425723	191	28	line	line	NN
10_1101-2021_01_07_425723	191	29	)	)	-RRB-
10_1101-2021_01_07_425723	191	30	from	from	IN
10_1101-2021_01_07_425723	191	31	independent	independent	JJ
10_1101-2021_01_07_425723	191	32	biological	biological	JJ
10_1101-2021_01_07_425723	191	33	duplicate	duplicate	JJ
10_1101-2021_01_07_425723	191	34	cultures	culture	NNS
10_1101-2021_01_07_425723	191	35	,	,	,
10_1101-2021_01_07_425723	191	36	serial	serial	JJ
10_1101-2021_01_07_425723	191	37	transfers	transfer	NNS
10_1101-2021_01_07_425723	191	38	cultures	culture	NNS
10_1101-2021_01_07_425723	191	39	are	be	VBP
10_1101-2021_01_07_425723	191	40	279	279	CD
10_1101-2021_01_07_425723	191	41	represented	represent	VBN
10_1101-2021_01_07_425723	191	42	with	with	IN
10_1101-2021_01_07_425723	191	43	C1-C5	C1-C5	NNP
10_1101-2021_01_07_425723	191	44	.	.	.
10_1101-2021_01_07_425723	192	1	Strains	Strains	NNP
10_1101-2021_01_07_425723	192	2	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	192	3	(	(	-LRB-
10_1101-2021_01_07_425723	192	4	wild	wild	JJ
10_1101-2021_01_07_425723	192	5	-	-	HYPH
10_1101-2021_01_07_425723	192	6	type	type	NN
10_1101-2021_01_07_425723	192	7	,	,	,
10_1101-2021_01_07_425723	192	8	upward	upward	RB
10_1101-2021_01_07_425723	192	9	red	red	JJ
10_1101-2021_01_07_425723	192	10	triangles	triangle	NNS
10_1101-2021_01_07_425723	192	11	)	)	-RRB-
10_1101-2021_01_07_425723	192	12	,	,	,
10_1101-2021_01_07_425723	192	13	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	192	14	(	(	-LRB-
10_1101-2021_01_07_425723	192	15	TtSTC1	TtSTC1	NNP
10_1101-2021_01_07_425723	192	16	,	,	,
10_1101-2021_01_07_425723	192	17	cyan	cyan	NNP
10_1101-2021_01_07_425723	192	18	280	280	CD
10_1101-2021_01_07_425723	192	19	downward	downward	JJ
10_1101-2021_01_07_425723	192	20	triangle	triangle	NN
10_1101-2021_01_07_425723	192	21	)	)	-RRB-
10_1101-2021_01_07_425723	192	22	,	,	,
10_1101-2021_01_07_425723	192	23	and	and	CC
10_1101-2021_01_07_425723	192	24	the	the	DT
10_1101-2021_01_07_425723	192	25	single	single	JJ
10_1101-2021_01_07_425723	192	26	-	-	HYPH
10_1101-2021_01_07_425723	192	27	cell	cell	NN
10_1101-2021_01_07_425723	192	28	isolates	isolate	VBZ
10_1101-2021_01_07_425723	192	29	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	192	30	(	(	-LRB-
10_1101-2021_01_07_425723	192	31	TtSTC1	TtSTC1	NNP
10_1101-2021_01_07_425723	192	32	,	,	,
10_1101-2021_01_07_425723	192	33	orange	orange	NNP
10_1101-2021_01_07_425723	192	34	circles	circle	NNS
10_1101-2021_01_07_425723	192	35	)	)	-RRB-
10_1101-2021_01_07_425723	192	36	,	,	,
10_1101-2021_01_07_425723	192	37	IMS1131	IMS1131	NNP
10_1101-2021_01_07_425723	192	38	(	(	-LRB-
10_1101-2021_01_07_425723	192	39	TtSTC1	ttstc1	CD
10_1101-2021_01_07_425723	192	40	,	,	,
10_1101-2021_01_07_425723	192	41	blue	blue	JJ
10_1101-2021_01_07_425723	192	42	281	281	CD
10_1101-2021_01_07_425723	192	43	circles	circle	NNS
10_1101-2021_01_07_425723	192	44	)	)	-RRB-
10_1101-2021_01_07_425723	192	45	,	,	,
10_1101-2021_01_07_425723	192	46	IMS1132	IMS1132	NNP
10_1101-2021_01_07_425723	192	47	(	(	-LRB-
10_1101-2021_01_07_425723	192	48	TtSTC1	ttstc1	CD
10_1101-2021_01_07_425723	192	49	,	,	,
10_1101-2021_01_07_425723	192	50	yellow	yellow	JJ
10_1101-2021_01_07_425723	192	51	circles	circle	NNS
10_1101-2021_01_07_425723	192	52	)	)	-RRB-
10_1101-2021_01_07_425723	192	53	,	,	,
10_1101-2021_01_07_425723	192	54	IMS1133	IMS1133	NNP
10_1101-2021_01_07_425723	192	55	(	(	-LRB-
10_1101-2021_01_07_425723	192	56	TtSTC1	TtSTC1	NNP
10_1101-2021_01_07_425723	192	57	,	,	,
10_1101-2021_01_07_425723	192	58	purple	purple	JJ
10_1101-2021_01_07_425723	192	59	circles	circle	NNS
10_1101-2021_01_07_425723	192	60	)	)	-RRB-
10_1101-2021_01_07_425723	192	61	.	.	.
10_1101-2021_01_07_425723	193	1	S.	S.	NNP
10_1101-2021_01_07_425723	193	2	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	193	3	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	193	4	282	282	CD
10_1101-2021_01_07_425723	193	5	(	(	-LRB-
10_1101-2021_01_07_425723	193	6	reference	reference	NN
10_1101-2021_01_07_425723	193	7	,	,	,
10_1101-2021_01_07_425723	193	8	purple	purple	JJ
10_1101-2021_01_07_425723	193	9	circle	circle	NN
10_1101-2021_01_07_425723	193	10	)	)	-RRB-
10_1101-2021_01_07_425723	193	11	and	and	CC
10_1101-2021_01_07_425723	193	12	IMX1438	IMX1438	NNP
10_1101-2021_01_07_425723	193	13	(	(	-LRB-
10_1101-2021_01_07_425723	193	14	TtSTC1	ttstc1	CD
10_1101-2021_01_07_425723	193	15	,	,	,
10_1101-2021_01_07_425723	193	16	orange	orange	NNP
10_1101-2021_01_07_425723	193	17	circles	circle	NNS
10_1101-2021_01_07_425723	193	18	)	)	-RRB-
10_1101-2021_01_07_425723	193	19	.	.	.
10_1101-2021_01_07_425723	194	1	c	c	LS
10_1101-2021_01_07_425723	194	2	,	,	,
10_1101-2021_01_07_425723	194	3	Extended	extended	JJ
10_1101-2021_01_07_425723	194	4	data	datum	NNS
10_1101-2021_01_07_425723	194	5	with	with	IN
10_1101-2021_01_07_425723	194	6	double	double	JJ
10_1101-2021_01_07_425723	194	7	inoculum	inoculum	NNP
10_1101-2021_01_07_425723	194	8	283	283	CD
10_1101-2021_01_07_425723	194	9	size	size	NN
10_1101-2021_01_07_425723	194	10	is	be	VBZ
10_1101-2021_01_07_425723	194	11	available	available	JJ
10_1101-2021_01_07_425723	194	12	in	in	IN
10_1101-2021_01_07_425723	194	13	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	194	14	Fig	Fig	NNP
10_1101-2021_01_07_425723	194	15	.	.	.
10_1101-2021_01_07_425723	195	1	10	10	CD
10_1101-2021_01_07_425723	195	2	.	.	.
10_1101-2021_01_07_425723	195	3	d	d	NNP
10_1101-2021_01_07_425723	195	4	,	,	,
10_1101-2021_01_07_425723	195	5	Extended	extended	JJ
10_1101-2021_01_07_425723	195	6	data	data	NN
10_1101-2021_01_07_425723	195	7	is	be	VBZ
10_1101-2021_01_07_425723	195	8	available	available	JJ
10_1101-2021_01_07_425723	195	9	in	in	IN
10_1101-2021_01_07_425723	195	10	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	195	11	Fig	Fig	NNP
10_1101-2021_01_07_425723	195	12	.	.	.
10_1101-2021_01_07_425723	196	1	9a	9a	UH
10_1101-2021_01_07_425723	196	2	.	.	.
10_1101-2021_01_07_425723	197	1	284	284	CD
10_1101-2021_01_07_425723	197	2	Test	test	NN
10_1101-2021_01_07_425723	197	3	of	of	IN
10_1101-2021_01_07_425723	197	4	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	197	5	thermotolerance	thermotolerance	NN
10_1101-2021_01_07_425723	197	6	and	and	CC
10_1101-2021_01_07_425723	197	7	selection	selection	NN
10_1101-2021_01_07_425723	197	8	for	for	IN
10_1101-2021_01_07_425723	197	9	fast	fast	JJ
10_1101-2021_01_07_425723	197	10	growing	grow	VBG
10_1101-2021_01_07_425723	197	11	anaerobes	anaerobe	NNS
10_1101-2021_01_07_425723	197	12	285	285	CD
10_1101-2021_01_07_425723	197	13	One	one	CD
10_1101-2021_01_07_425723	197	14	of	of	IN
10_1101-2021_01_07_425723	197	15	the	the	DT
10_1101-2021_01_07_425723	197	16	attractive	attractive	JJ
10_1101-2021_01_07_425723	197	17	phenotypes	phenotype	NNS
10_1101-2021_01_07_425723	197	18	of	of	IN
10_1101-2021_01_07_425723	197	19	K.	K.	NNP
10_1101-2021_01_07_425723	197	20	marxianus	marxianus	NN
10_1101-2021_01_07_425723	197	21	for	for	IN
10_1101-2021_01_07_425723	197	22	industrial	industrial	JJ
10_1101-2021_01_07_425723	197	23	application	application	NN
10_1101-2021_01_07_425723	197	24	is	be	VBZ
10_1101-2021_01_07_425723	197	25	its	-PRON-	PRP$
10_1101-2021_01_07_425723	197	26	high	high	JJ
10_1101-2021_01_07_425723	197	27	thermotolerance	thermotolerance	NN
10_1101-2021_01_07_425723	197	28	286	286	CD
10_1101-2021_01_07_425723	197	29	with	with	IN
10_1101-2021_01_07_425723	197	30	reported	report	VBN
10_1101-2021_01_07_425723	197	31	maximum	maximum	JJ
10_1101-2021_01_07_425723	197	32	growth	growth	NN
10_1101-2021_01_07_425723	197	33	temperatures	temperature	NNS
10_1101-2021_01_07_425723	197	34	of	of	IN
10_1101-2021_01_07_425723	197	35	46	46	CD
10_1101-2021_01_07_425723	197	36	-	-	SYM
10_1101-2021_01_07_425723	197	37	52	52	CD
10_1101-2021_01_07_425723	197	38	°	°	,
10_1101-2021_01_07_425723	197	39	C49,50	C49,50	NNP
10_1101-2021_01_07_425723	197	40	.	.	.
10_1101-2021_01_07_425723	198	1	To	to	TO
10_1101-2021_01_07_425723	198	2	test	test	VB
10_1101-2021_01_07_425723	198	3	if	if	IN
10_1101-2021_01_07_425723	198	4	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	198	5	growing	grow	VBG
10_1101-2021_01_07_425723	198	6	287	287	CD
10_1101-2021_01_07_425723	198	7	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	198	8	-	-	HYPH
10_1101-2021_01_07_425723	198	9	producing	produce	VBG
10_1101-2021_01_07_425723	198	10	strains	strain	NNS
10_1101-2021_01_07_425723	198	11	retained	retain	VBN
10_1101-2021_01_07_425723	198	12	thermotolerance	thermotolerance	NN
10_1101-2021_01_07_425723	198	13	,	,	,
10_1101-2021_01_07_425723	198	14	strain	strain	VB
10_1101-2021_01_07_425723	198	15	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	198	16	was	be	VBD
10_1101-2021_01_07_425723	198	17	grown	grow	VBN
10_1101-2021_01_07_425723	198	18	in	in	IN
10_1101-2021_01_07_425723	198	19	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	198	20	288	288	CD
10_1101-2021_01_07_425723	198	21	sequential	sequential	JJ
10_1101-2021_01_07_425723	198	22	-	-	HYPH
10_1101-2021_01_07_425723	198	23	batch	batch	NN
10_1101-2021_01_07_425723	198	24	-	-	HYPH
10_1101-2021_01_07_425723	198	25	reactor	reactor	NN
10_1101-2021_01_07_425723	198	26	(	(	-LRB-
10_1101-2021_01_07_425723	198	27	SBR	SBR	NNP
10_1101-2021_01_07_425723	198	28	)	)	-RRB-
10_1101-2021_01_07_425723	198	29	cultures	culture	NNS
10_1101-2021_01_07_425723	198	30	(	(	-LRB-
10_1101-2021_01_07_425723	198	31	Fig	fig	NN
10_1101-2021_01_07_425723	198	32	.	.	.
10_1101-2021_01_07_425723	199	1	6	6	LS
10_1101-2021_01_07_425723	199	2	)	)	-RRB-
10_1101-2021_01_07_425723	199	3	in	in	IN
10_1101-2021_01_07_425723	199	4	which	which	WDT
10_1101-2021_01_07_425723	199	5	,	,	,
10_1101-2021_01_07_425723	199	6	after	after	IN
10_1101-2021_01_07_425723	199	7	an	an	DT
10_1101-2021_01_07_425723	199	8	initial	initial	JJ
10_1101-2021_01_07_425723	199	9	growth	growth	NN
10_1101-2021_01_07_425723	199	10	cycle	cycle	NN
10_1101-2021_01_07_425723	199	11	at	at	IN
10_1101-2021_01_07_425723	199	12	30	30	CD
10_1101-2021_01_07_425723	199	13	°	°	,
10_1101-2021_01_07_425723	199	14	C	C	NNP
10_1101-2021_01_07_425723	199	15	,	,	,
10_1101-2021_01_07_425723	199	16	the	the	DT
10_1101-2021_01_07_425723	199	17	growth	growth	NN
10_1101-2021_01_07_425723	199	18	289	289	CD
10_1101-2021_01_07_425723	199	19	temperature	temperature	NN
10_1101-2021_01_07_425723	199	20	was	be	VBD
10_1101-2021_01_07_425723	199	21	shifted	shift	VBN
10_1101-2021_01_07_425723	199	22	to	to	IN
10_1101-2021_01_07_425723	199	23	42	42	CD
10_1101-2021_01_07_425723	199	24	°	°	NNS
10_1101-2021_01_07_425723	199	25	C	C	NNP
10_1101-2021_01_07_425723	199	26	.	.	.
10_1101-2021_01_07_425723	200	1	Specific	specific	JJ
10_1101-2021_01_07_425723	200	2	growth	growth	NN
10_1101-2021_01_07_425723	200	3	at	at	IN
10_1101-2021_01_07_425723	200	4	42	42	CD
10_1101-2021_01_07_425723	200	5	°	°	NNS
10_1101-2021_01_07_425723	200	6	C	C	NNP
10_1101-2021_01_07_425723	200	7	progressively	progressively	RB
10_1101-2021_01_07_425723	200	8	accelerated	accelerate	VBD
10_1101-2021_01_07_425723	200	9	from	from	IN
10_1101-2021_01_07_425723	200	10	0.06	0.06	CD
10_1101-2021_01_07_425723	200	11	h-1	h-1	NNP
10_1101-2021_01_07_425723	200	12	to	to	IN
10_1101-2021_01_07_425723	200	13	290	290	CD
10_1101-2021_01_07_425723	200	14	0.13	0.13	CD
10_1101-2021_01_07_425723	200	15	h-1	h-1	NN
10_1101-2021_01_07_425723	200	16	over	over	IN
10_1101-2021_01_07_425723	200	17	17	17	CD
10_1101-2021_01_07_425723	200	18	SBR	SBR	NNP
10_1101-2021_01_07_425723	200	19	cycles	cycle	NNS
10_1101-2021_01_07_425723	200	20	(	(	-LRB-
10_1101-2021_01_07_425723	200	21	corresponding	correspond	VBG
10_1101-2021_01_07_425723	200	22	to	to	IN
10_1101-2021_01_07_425723	200	23	ca	ca	NNP
10_1101-2021_01_07_425723	200	24	.	.	.
10_1101-2021_01_07_425723	201	1	290	290	CD
10_1101-2021_01_07_425723	201	2	generations	generation	NNS
10_1101-2021_01_07_425723	201	3	;	;	:
10_1101-2021_01_07_425723	201	4	Fig	Fig	NNP
10_1101-2021_01_07_425723	201	5	.	.	.
10_1101-2021_01_07_425723	202	1	6b	6b	LS
10_1101-2021_01_07_425723	202	2	)	)	-RRB-
10_1101-2021_01_07_425723	202	3	.	.	.
10_1101-2021_01_07_425723	203	1	A	a	DT
10_1101-2021_01_07_425723	203	2	subsequent	subsequent	JJ
10_1101-2021_01_07_425723	203	3	temperature	temperature	NN
10_1101-2021_01_07_425723	203	4	291	291	CD
10_1101-2021_01_07_425723	203	5	increase	increase	NN
10_1101-2021_01_07_425723	203	6	to	to	IN
10_1101-2021_01_07_425723	203	7	45	45	CD
10_1101-2021_01_07_425723	203	8	°	°	,
10_1101-2021_01_07_425723	203	9	C	C	NNP
10_1101-2021_01_07_425723	203	10	led	lead	VBD
10_1101-2021_01_07_425723	203	11	to	to	IN
10_1101-2021_01_07_425723	203	12	a	a	DT
10_1101-2021_01_07_425723	203	13	strong	strong	JJ
10_1101-2021_01_07_425723	203	14	decrease	decrease	NN
10_1101-2021_01_07_425723	203	15	of	of	IN
10_1101-2021_01_07_425723	203	16	the	the	DT
10_1101-2021_01_07_425723	203	17	specific	specific	JJ
10_1101-2021_01_07_425723	203	18	growth	growth	NN
10_1101-2021_01_07_425723	203	19	rate	rate	NN
10_1101-2021_01_07_425723	203	20	which	which	WDT
10_1101-2021_01_07_425723	203	21	,	,	,
10_1101-2021_01_07_425723	203	22	after	after	IN
10_1101-2021_01_07_425723	203	23	approximately	approximately	RB
10_1101-2021_01_07_425723	203	24	1000	1000	CD
10_1101-2021_01_07_425723	203	25	292	292	CD
10_1101-2021_01_07_425723	203	26	generations	generation	NNS
10_1101-2021_01_07_425723	203	27	of	of	IN
10_1101-2021_01_07_425723	203	28	selective	selective	JJ
10_1101-2021_01_07_425723	203	29	growth	growth	NN
10_1101-2021_01_07_425723	203	30	,	,	,
10_1101-2021_01_07_425723	203	31	stabilized	stabilize	VBD
10_1101-2021_01_07_425723	203	32	at	at	IN
10_1101-2021_01_07_425723	203	33	approximately	approximately	RB
10_1101-2021_01_07_425723	203	34	0.08	0.08	CD
10_1101-2021_01_07_425723	203	35	h-1	h-1	NNP
10_1101-2021_01_07_425723	203	36	.	.	.
10_1101-2021_01_07_425723	204	1	Whole	whole	JJ
10_1101-2021_01_07_425723	204	2	-	-	HYPH
10_1101-2021_01_07_425723	204	3	population	population	NN
10_1101-2021_01_07_425723	204	4	genome	genome	NN
10_1101-2021_01_07_425723	204	5	293	293	CD
10_1101-2021_01_07_425723	204	6	sequencing	sequencing	NN
10_1101-2021_01_07_425723	204	7	of	of	IN
10_1101-2021_01_07_425723	204	8	the	the	DT
10_1101-2021_01_07_425723	204	9	evolved	evolved	JJ
10_1101-2021_01_07_425723	204	10	populations	population	NNS
10_1101-2021_01_07_425723	204	11	revealed	reveal	VBD
10_1101-2021_01_07_425723	204	12	no	no	DT
10_1101-2021_01_07_425723	204	13	common	common	JJ
10_1101-2021_01_07_425723	204	14	mutations	mutation	NNS
10_1101-2021_01_07_425723	204	15	or	or	CC
10_1101-2021_01_07_425723	204	16	chromosomal	chromosomal	NN
10_1101-2021_01_07_425723	204	17	copy	copy	NN
10_1101-2021_01_07_425723	204	18	number	number	NN
10_1101-2021_01_07_425723	204	19	294	294	CD
10_1101-2021_01_07_425723	204	20	variations	variation	NNS
10_1101-2021_01_07_425723	204	21	(	(	-LRB-
10_1101-2021_01_07_425723	204	22	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	204	23	Table	Table	NNP
10_1101-2021_01_07_425723	204	24	1	1	CD
10_1101-2021_01_07_425723	204	25	)	)	-RRB-
10_1101-2021_01_07_425723	204	26	.	.	.
10_1101-2021_01_07_425723	205	1	These	these	DT
10_1101-2021_01_07_425723	205	2	data	datum	NNS
10_1101-2021_01_07_425723	205	3	show	show	VBP
10_1101-2021_01_07_425723	205	4	that	that	IN
10_1101-2021_01_07_425723	205	5	TtSTC1-expressing	ttstc1-expresse	VBG
10_1101-2021_01_07_425723	205	6	K.	K.	NNP
10_1101-2021_01_07_425723	205	7	marxianus	marxianus	NN
10_1101-2021_01_07_425723	205	8	can	can	MD
10_1101-2021_01_07_425723	205	9	grow	grow	VB
10_1101-2021_01_07_425723	205	10	295	295	CD
10_1101-2021_01_07_425723	205	11	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	205	12	at	at	IN
10_1101-2021_01_07_425723	205	13	temperatures	temperature	NNS
10_1101-2021_01_07_425723	205	14	up	up	RB
10_1101-2021_01_07_425723	205	15	to	to	IN
10_1101-2021_01_07_425723	205	16	at	at	RB
10_1101-2021_01_07_425723	205	17	least	least	RBS
10_1101-2021_01_07_425723	205	18	45	45	CD
10_1101-2021_01_07_425723	205	19	°	°	,
10_1101-2021_01_07_425723	205	20	C	C	NNP
10_1101-2021_01_07_425723	205	21	.	.	.
10_1101-2021_01_07_425723	206	1	296	296	CD
10_1101-2021_01_07_425723	206	2	.CC	.CC	:
10_1101-2021_01_07_425723	206	3	-	-	HYPH
10_1101-2021_01_07_425723	206	4	BY	by	IN
10_1101-2021_01_07_425723	206	5	-	-	HYPH
10_1101-2021_01_07_425723	206	6	NC	NC	NNP
10_1101-2021_01_07_425723	206	7	-	-	HYPH
10_1101-2021_01_07_425723	206	8	ND	ND	NNP
10_1101-2021_01_07_425723	206	9	4.0	4.0	CD
10_1101-2021_01_07_425723	206	10	International	International	NNP
10_1101-2021_01_07_425723	206	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	206	12	under	under	IN
10_1101-2021_01_07_425723	206	13	a	a	DT
10_1101-2021_01_07_425723	206	14	(	(	-LRB-
10_1101-2021_01_07_425723	206	15	which	which	WDT
10_1101-2021_01_07_425723	206	16	was	be	VBD
10_1101-2021_01_07_425723	206	17	not	not	RB
10_1101-2021_01_07_425723	206	18	certified	certify	VBN
10_1101-2021_01_07_425723	206	19	by	by	IN
10_1101-2021_01_07_425723	206	20	peer	peer	NN
10_1101-2021_01_07_425723	206	21	review	review	NN
10_1101-2021_01_07_425723	206	22	)	)	-RRB-
10_1101-2021_01_07_425723	206	23	is	be	VBZ
10_1101-2021_01_07_425723	206	24	the	the	DT
10_1101-2021_01_07_425723	206	25	author	author	NN
10_1101-2021_01_07_425723	206	26	/	/	SYM
10_1101-2021_01_07_425723	206	27	funder	funder	NN
10_1101-2021_01_07_425723	206	28	,	,	,
10_1101-2021_01_07_425723	206	29	who	who	WP
10_1101-2021_01_07_425723	206	30	has	have	VBZ
10_1101-2021_01_07_425723	206	31	granted	grant	VBN
10_1101-2021_01_07_425723	206	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	206	33	a	a	DT
10_1101-2021_01_07_425723	206	34	license	license	NN
10_1101-2021_01_07_425723	206	35	to	to	TO
10_1101-2021_01_07_425723	206	36	display	display	VB
10_1101-2021_01_07_425723	206	37	the	the	DT
10_1101-2021_01_07_425723	206	38	preprint	preprint	NN
10_1101-2021_01_07_425723	206	39	in	in	IN
10_1101-2021_01_07_425723	206	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	206	41	.	.	.
10_1101-2021_01_07_425723	207	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	207	2	is	be	VBZ
10_1101-2021_01_07_425723	207	3	made	make	VBN
10_1101-2021_01_07_425723	207	4	The	the	DT
10_1101-2021_01_07_425723	207	5	copyright	copyright	NN
10_1101-2021_01_07_425723	207	6	holder	holder	NN
10_1101-2021_01_07_425723	207	7	for	for	IN
10_1101-2021_01_07_425723	207	8	this	this	DT
10_1101-2021_01_07_425723	207	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	207	10	version	version	NN
10_1101-2021_01_07_425723	207	11	posted	post	VBD
10_1101-2021_01_07_425723	207	12	January	January	NNP
10_1101-2021_01_07_425723	207	13	8	8	CD
10_1101-2021_01_07_425723	207	14	,	,	,
10_1101-2021_01_07_425723	207	15	2021	2021	CD
10_1101-2021_01_07_425723	207	16	.	.	.
10_1101-2021_01_07_425723	207	17	;	;	:
10_1101-2021_01_07_425723	207	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	207	19	:	:	:
10_1101-2021_01_07_425723	207	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	207	21	preprint	preprint	NN
10_1101-2021_01_07_425723	207	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	207	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	RB
10_1101-2021_01_07_425723	207	24	19	19	CD
10_1101-2021_01_07_425723	207	25	Fig	fig	NN
10_1101-2021_01_07_425723	207	26	.	.	.
10_1101-2021_01_07_425723	208	1	6	6	CD
10_1101-2021_01_07_425723	208	2	|	|	NNS
10_1101-2021_01_07_425723	208	3	Thermotolerance	thermotolerance	NN
10_1101-2021_01_07_425723	208	4	and	and	CC
10_1101-2021_01_07_425723	208	5	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	208	6	growth	growth	NN
10_1101-2021_01_07_425723	208	7	of	of	IN
10_1101-2021_01_07_425723	208	8	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	208	9	-	-	HYPH
10_1101-2021_01_07_425723	208	10	producing	produce	VBG
10_1101-2021_01_07_425723	208	11	K.	K.	NNP
10_1101-2021_01_07_425723	208	12	marxianus	marxianus	NN
10_1101-2021_01_07_425723	208	13	strain	strain	NN
10_1101-2021_01_07_425723	208	14	.	.	.
10_1101-2021_01_07_425723	209	1	The	the	DT
10_1101-2021_01_07_425723	209	2	297	297	CD
10_1101-2021_01_07_425723	209	3	strain	strain	NN
10_1101-2021_01_07_425723	209	4	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	209	5	was	be	VBD
10_1101-2021_01_07_425723	209	6	grown	grow	VBN
10_1101-2021_01_07_425723	209	7	in	in	IN
10_1101-2021_01_07_425723	209	8	triplicate	triplicate	NN
10_1101-2021_01_07_425723	209	9	sequential	sequential	JJ
10_1101-2021_01_07_425723	209	10	batch	batch	NN
10_1101-2021_01_07_425723	209	11	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	209	12	cultivations	cultivation	NNS
10_1101-2021_01_07_425723	209	13	in	in	IN
10_1101-2021_01_07_425723	209	14	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	209	15	media	medium	NNS
10_1101-2021_01_07_425723	209	16	298	298	CD
10_1101-2021_01_07_425723	209	17	supplemented	supplement	VBD
10_1101-2021_01_07_425723	209	18	with	with	IN
10_1101-2021_01_07_425723	209	19	20	20	CD
10_1101-2021_01_07_425723	209	20	g·L-1	g·L-1	NNP
10_1101-2021_01_07_425723	209	21	glucose	glucose	NN
10_1101-2021_01_07_425723	209	22	and	and	CC
10_1101-2021_01_07_425723	209	23	420	420	CD
10_1101-2021_01_07_425723	209	24	mg·L-1	mg·L-1	NNP
10_1101-2021_01_07_425723	209	25	Tween	Tween	NNP
10_1101-2021_01_07_425723	209	26	80	80	CD
10_1101-2021_01_07_425723	209	27	at	at	IN
10_1101-2021_01_07_425723	209	28	pH	pH	NNP
10_1101-2021_01_07_425723	209	29	5.0	5.0	CD
10_1101-2021_01_07_425723	209	30	.	.	.
10_1101-2021_01_07_425723	209	31	a	a	DT
10_1101-2021_01_07_425723	209	32	,	,	,
10_1101-2021_01_07_425723	209	33	Experimental	experimental	JJ
10_1101-2021_01_07_425723	209	34	design	design	NN
10_1101-2021_01_07_425723	209	35	of	of	IN
10_1101-2021_01_07_425723	209	36	299	299	CD
10_1101-2021_01_07_425723	209	37	sequential	sequential	JJ
10_1101-2021_01_07_425723	209	38	batch	batch	NN
10_1101-2021_01_07_425723	209	39	fermentation	fermentation	NN
10_1101-2021_01_07_425723	209	40	with	with	IN
10_1101-2021_01_07_425723	209	41	cycles	cycle	NNS
10_1101-2021_01_07_425723	209	42	at	at	IN
10_1101-2021_01_07_425723	209	43	step	step	NN
10_1101-2021_01_07_425723	209	44	-	-	HYPH
10_1101-2021_01_07_425723	209	45	wise	wise	JJ
10_1101-2021_01_07_425723	209	46	increasing	increase	VBG
10_1101-2021_01_07_425723	209	47	temperatures	temperature	NNS
10_1101-2021_01_07_425723	209	48	to	to	TO
10_1101-2021_01_07_425723	209	49	select	select	VB
10_1101-2021_01_07_425723	209	50	for	for	IN
10_1101-2021_01_07_425723	209	51	faster	fast	JJR
10_1101-2021_01_07_425723	209	52	300	300	CD
10_1101-2021_01_07_425723	209	53	growing	grow	VBG
10_1101-2021_01_07_425723	209	54	mutants	mutant	NNS
10_1101-2021_01_07_425723	209	55	,	,	,
10_1101-2021_01_07_425723	209	56	each	each	DT
10_1101-2021_01_07_425723	209	57	cycle	cycle	NN
10_1101-2021_01_07_425723	209	58	consisted	consist	VBD
10_1101-2021_01_07_425723	209	59	of	of	IN
10_1101-2021_01_07_425723	209	60	three	three	CD
10_1101-2021_01_07_425723	209	61	phases	phase	NNS
10_1101-2021_01_07_425723	209	62	;	;	:
10_1101-2021_01_07_425723	209	63	(	(	-LRB-
10_1101-2021_01_07_425723	209	64	i	i	NN
10_1101-2021_01_07_425723	209	65	)	)	-RRB-
10_1101-2021_01_07_425723	209	66	(	(	-LRB-
10_1101-2021_01_07_425723	209	67	re)filling	re)fille	VBG
10_1101-2021_01_07_425723	209	68	of	of	IN
10_1101-2021_01_07_425723	209	69	the	the	DT
10_1101-2021_01_07_425723	209	70	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	209	71	with	with	IN
10_1101-2021_01_07_425723	209	72	fresh	fresh	JJ
10_1101-2021_01_07_425723	209	73	media	medium	NNS
10_1101-2021_01_07_425723	209	74	301	301	CD
10_1101-2021_01_07_425723	209	75	up	up	IN
10_1101-2021_01_07_425723	209	76	to	to	TO
10_1101-2021_01_07_425723	209	77	100	100	CD
10_1101-2021_01_07_425723	209	78	mL	ml	NN
10_1101-2021_01_07_425723	209	79	and	and	CC
10_1101-2021_01_07_425723	209	80	adjustment	adjustment	NN
10_1101-2021_01_07_425723	209	81	of	of	IN
10_1101-2021_01_07_425723	209	82	temperature	temperature	NN
10_1101-2021_01_07_425723	209	83	to	to	IN
10_1101-2021_01_07_425723	209	84	a	a	DT
10_1101-2021_01_07_425723	209	85	new	new	JJ
10_1101-2021_01_07_425723	209	86	set	set	NN
10_1101-2021_01_07_425723	209	87	-	-	HYPH
10_1101-2021_01_07_425723	209	88	point	point	NN
10_1101-2021_01_07_425723	209	89	,	,	,
10_1101-2021_01_07_425723	209	90	(	(	-LRB-
10_1101-2021_01_07_425723	209	91	ii	ii	NNP
10_1101-2021_01_07_425723	209	92	)	)	-RRB-
10_1101-2021_01_07_425723	209	93	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	209	94	batch	batch	NNP
10_1101-2021_01_07_425723	209	95	fermentation	fermentation	NN
10_1101-2021_01_07_425723	209	96	at	at	IN
10_1101-2021_01_07_425723	209	97	a	a	DT
10_1101-2021_01_07_425723	209	98	302	302	CD
10_1101-2021_01_07_425723	209	99	fixed	fix	VBN
10_1101-2021_01_07_425723	209	100	culture	culture	NN
10_1101-2021_01_07_425723	209	101	temperature	temperature	NN
10_1101-2021_01_07_425723	209	102	with	with	IN
10_1101-2021_01_07_425723	209	103	continuous	continuous	JJ
10_1101-2021_01_07_425723	209	104	N2	N2	NNP
10_1101-2021_01_07_425723	209	105	sparging	sparge	VBG
10_1101-2021_01_07_425723	209	106	for	for	IN
10_1101-2021_01_07_425723	209	107	monitoring	monitoring	NN
10_1101-2021_01_07_425723	209	108	of	of	IN
10_1101-2021_01_07_425723	209	109	CO2	CO2	NNP
10_1101-2021_01_07_425723	209	110	in	in	IN
10_1101-2021_01_07_425723	209	111	the	the	DT
10_1101-2021_01_07_425723	209	112	culture	culture	NN
10_1101-2021_01_07_425723	209	113	off	off	IN
10_1101-2021_01_07_425723	209	114	-	-	HYPH
10_1101-2021_01_07_425723	209	115	gas	gas	NN
10_1101-2021_01_07_425723	209	116	,	,	,
10_1101-2021_01_07_425723	209	117	and	and	CC
10_1101-2021_01_07_425723	209	118	303	303	CD
10_1101-2021_01_07_425723	209	119	(	(	-LRB-
10_1101-2021_01_07_425723	209	120	iii	iii	NNP
10_1101-2021_01_07_425723	209	121	)	)	-RRB-
10_1101-2021_01_07_425723	209	122	fast	fast	JJ
10_1101-2021_01_07_425723	209	123	broth	broth	NN
10_1101-2021_01_07_425723	209	124	withdrawal	withdrawal	NN
10_1101-2021_01_07_425723	209	125	leaving	leave	VBG
10_1101-2021_01_07_425723	209	126	7	7	CD
10_1101-2021_01_07_425723	209	127	mL	mL	NNP
10_1101-2021_01_07_425723	209	128	(	(	-LRB-
10_1101-2021_01_07_425723	209	129	14.3	14.3	CD
10_1101-2021_01_07_425723	209	130	fold	fold	JJ
10_1101-2021_01_07_425723	209	131	dilution	dilution	NN
10_1101-2021_01_07_425723	209	132	)	)	-RRB-
10_1101-2021_01_07_425723	209	133	to	to	TO
10_1101-2021_01_07_425723	209	134	inoculate	inoculate	VB
10_1101-2021_01_07_425723	209	135	the	the	DT
10_1101-2021_01_07_425723	209	136	next	next	JJ
10_1101-2021_01_07_425723	209	137	batch	batch	NN
10_1101-2021_01_07_425723	209	138	.	.	.
10_1101-2021_01_07_425723	210	1	b	b	LS
10_1101-2021_01_07_425723	210	2	,	,	,
10_1101-2021_01_07_425723	210	3	Maximum	Maximum	NNP
10_1101-2021_01_07_425723	210	4	304	304	CD
10_1101-2021_01_07_425723	210	5	specific	specific	JJ
10_1101-2021_01_07_425723	210	6	estimated	estimate	VBN
10_1101-2021_01_07_425723	210	7	growth	growth	NN
10_1101-2021_01_07_425723	210	8	rate	rate	NN
10_1101-2021_01_07_425723	210	9	(	(	-LRB-
10_1101-2021_01_07_425723	210	10	circles	circle	NNS
10_1101-2021_01_07_425723	210	11	)	)	-RRB-
10_1101-2021_01_07_425723	210	12	of	of	IN
10_1101-2021_01_07_425723	210	13	each	each	DT
10_1101-2021_01_07_425723	210	14	batch	batch	NN
10_1101-2021_01_07_425723	210	15	cycle	cycle	NN
10_1101-2021_01_07_425723	210	16	for	for	IN
10_1101-2021_01_07_425723	210	17	the	the	DT
10_1101-2021_01_07_425723	210	18	three	three	CD
10_1101-2021_01_07_425723	210	19	independent	independent	JJ
10_1101-2021_01_07_425723	210	20	bioreactor	bioreactor	NNP
10_1101-2021_01_07_425723	210	21	305	305	CD
10_1101-2021_01_07_425723	210	22	cultivations	cultivation	NNS
10_1101-2021_01_07_425723	210	23	(	(	-LRB-
10_1101-2021_01_07_425723	210	24	M3R	M3R	NNP
10_1101-2021_01_07_425723	210	25	blue	blue	NNP
10_1101-2021_01_07_425723	210	26	,	,	,
10_1101-2021_01_07_425723	210	27	M5R	M5R	NNP
10_1101-2021_01_07_425723	210	28	orange	orange	NNP
10_1101-2021_01_07_425723	210	29	,	,	,
10_1101-2021_01_07_425723	210	30	M6L	M6L	NNP
10_1101-2021_01_07_425723	210	31	grey	grey	NNP
10_1101-2021_01_07_425723	210	32	)	)	-RRB-
10_1101-2021_01_07_425723	210	33	with	with	IN
10_1101-2021_01_07_425723	210	34	the	the	DT
10_1101-2021_01_07_425723	210	35	estimated	estimate	VBN
10_1101-2021_01_07_425723	210	36	number	number	NN
10_1101-2021_01_07_425723	210	37	of	of	IN
10_1101-2021_01_07_425723	210	38	generations	generation	NNS
10_1101-2021_01_07_425723	210	39	.	.	.
10_1101-2021_01_07_425723	211	1	The	the	DT
10_1101-2021_01_07_425723	211	2	growth	growth	NN
10_1101-2021_01_07_425723	211	3	306	306	CD
10_1101-2021_01_07_425723	211	4	rate	rate	NN
10_1101-2021_01_07_425723	211	5	was	be	VBD
10_1101-2021_01_07_425723	211	6	calculated	calculate	VBN
10_1101-2021_01_07_425723	211	7	from	from	IN
10_1101-2021_01_07_425723	211	8	the	the	DT
10_1101-2021_01_07_425723	211	9	CO2	CO2	NNP
10_1101-2021_01_07_425723	211	10	production	production	NN
10_1101-2021_01_07_425723	211	11	as	as	IN
10_1101-2021_01_07_425723	211	12	measured	measure	VBN
10_1101-2021_01_07_425723	211	13	in	in	IN
10_1101-2021_01_07_425723	211	14	the	the	DT
10_1101-2021_01_07_425723	211	15	off	off	JJ
10_1101-2021_01_07_425723	211	16	-	-	HYPH
10_1101-2021_01_07_425723	211	17	gas	gas	NN
10_1101-2021_01_07_425723	211	18	and	and	CC
10_1101-2021_01_07_425723	211	19	should	should	MD
10_1101-2021_01_07_425723	211	20	be	be	VB
10_1101-2021_01_07_425723	211	21	interpreted	interpret	VBN
10_1101-2021_01_07_425723	211	22	as	as	IN
10_1101-2021_01_07_425723	211	23	an	an	DT
10_1101-2021_01_07_425723	211	24	307	307	CD
10_1101-2021_01_07_425723	211	25	estimate	estimate	NN
10_1101-2021_01_07_425723	211	26	and	and	CC
10_1101-2021_01_07_425723	211	27	in	in	IN
10_1101-2021_01_07_425723	211	28	some	some	DT
10_1101-2021_01_07_425723	211	29	cases	case	NNS
10_1101-2021_01_07_425723	211	30	could	could	MD
10_1101-2021_01_07_425723	211	31	not	not	RB
10_1101-2021_01_07_425723	211	32	be	be	VB
10_1101-2021_01_07_425723	211	33	calculated	calculate	VBN
10_1101-2021_01_07_425723	211	34	.	.	.
10_1101-2021_01_07_425723	212	1	The	the	DT
10_1101-2021_01_07_425723	212	2	culture	culture	NN
10_1101-2021_01_07_425723	212	3	temperature	temperature	NN
10_1101-2021_01_07_425723	212	4	profile	profile	NN
10_1101-2021_01_07_425723	212	5	(	(	-LRB-
10_1101-2021_01_07_425723	212	6	dotted	dotted	JJ
10_1101-2021_01_07_425723	212	7	line	line	NN
10_1101-2021_01_07_425723	212	8	)	)	-RRB-
10_1101-2021_01_07_425723	212	9	for	for	IN
10_1101-2021_01_07_425723	212	10	308	308	CD
10_1101-2021_01_07_425723	212	11	.CC	.CC	:
10_1101-2021_01_07_425723	212	12	-	-	HYPH
10_1101-2021_01_07_425723	212	13	BY	by	IN
10_1101-2021_01_07_425723	212	14	-	-	HYPH
10_1101-2021_01_07_425723	212	15	NC	NC	NNP
10_1101-2021_01_07_425723	212	16	-	-	HYPH
10_1101-2021_01_07_425723	212	17	ND	ND	NNP
10_1101-2021_01_07_425723	212	18	4.0	4.0	CD
10_1101-2021_01_07_425723	212	19	International	International	NNP
10_1101-2021_01_07_425723	212	20	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	212	21	under	under	IN
10_1101-2021_01_07_425723	212	22	a	a	DT
10_1101-2021_01_07_425723	212	23	(	(	-LRB-
10_1101-2021_01_07_425723	212	24	which	which	WDT
10_1101-2021_01_07_425723	212	25	was	be	VBD
10_1101-2021_01_07_425723	212	26	not	not	RB
10_1101-2021_01_07_425723	212	27	certified	certify	VBN
10_1101-2021_01_07_425723	212	28	by	by	IN
10_1101-2021_01_07_425723	212	29	peer	peer	NN
10_1101-2021_01_07_425723	212	30	review	review	NN
10_1101-2021_01_07_425723	212	31	)	)	-RRB-
10_1101-2021_01_07_425723	212	32	is	be	VBZ
10_1101-2021_01_07_425723	212	33	the	the	DT
10_1101-2021_01_07_425723	212	34	author	author	NN
10_1101-2021_01_07_425723	212	35	/	/	SYM
10_1101-2021_01_07_425723	212	36	funder	funder	NN
10_1101-2021_01_07_425723	212	37	,	,	,
10_1101-2021_01_07_425723	212	38	who	who	WP
10_1101-2021_01_07_425723	212	39	has	have	VBZ
10_1101-2021_01_07_425723	212	40	granted	grant	VBN
10_1101-2021_01_07_425723	212	41	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	212	42	a	a	DT
10_1101-2021_01_07_425723	212	43	license	license	NN
10_1101-2021_01_07_425723	212	44	to	to	TO
10_1101-2021_01_07_425723	212	45	display	display	VB
10_1101-2021_01_07_425723	212	46	the	the	DT
10_1101-2021_01_07_425723	212	47	preprint	preprint	NN
10_1101-2021_01_07_425723	212	48	in	in	IN
10_1101-2021_01_07_425723	212	49	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	212	50	.	.	.
10_1101-2021_01_07_425723	213	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	213	2	is	be	VBZ
10_1101-2021_01_07_425723	213	3	made	make	VBN
10_1101-2021_01_07_425723	213	4	The	the	DT
10_1101-2021_01_07_425723	213	5	copyright	copyright	NN
10_1101-2021_01_07_425723	213	6	holder	holder	NN
10_1101-2021_01_07_425723	213	7	for	for	IN
10_1101-2021_01_07_425723	213	8	this	this	DT
10_1101-2021_01_07_425723	213	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	213	10	version	version	NN
10_1101-2021_01_07_425723	213	11	posted	post	VBD
10_1101-2021_01_07_425723	213	12	January	January	NNP
10_1101-2021_01_07_425723	213	13	8	8	CD
10_1101-2021_01_07_425723	213	14	,	,	,
10_1101-2021_01_07_425723	213	15	2021	2021	CD
10_1101-2021_01_07_425723	213	16	.	.	.
10_1101-2021_01_07_425723	213	17	;	;	:
10_1101-2021_01_07_425723	213	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	213	19	:	:	:
10_1101-2021_01_07_425723	213	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	213	21	preprint	preprint	NN
10_1101-2021_01_07_425723	213	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	213	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CC
10_1101-2021_01_07_425723	213	24	20	20	CD
10_1101-2021_01_07_425723	213	25	each	each	DT
10_1101-2021_01_07_425723	213	26	independent	independent	JJ
10_1101-2021_01_07_425723	213	27	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	213	28	cultivation	cultivation	NN
10_1101-2021_01_07_425723	213	29	(	(	-LRB-
10_1101-2021_01_07_425723	213	30	blue	blue	JJ
10_1101-2021_01_07_425723	213	31	,	,	,
10_1101-2021_01_07_425723	213	32	grey	grey	NNP
10_1101-2021_01_07_425723	213	33	,	,	,
10_1101-2021_01_07_425723	213	34	orange	orange	NNP
10_1101-2021_01_07_425723	213	35	)	)	-RRB-
10_1101-2021_01_07_425723	213	36	consisted	consist	VBD
10_1101-2021_01_07_425723	213	37	of	of	IN
10_1101-2021_01_07_425723	213	38	a	a	DT
10_1101-2021_01_07_425723	213	39	step	step	NN
10_1101-2021_01_07_425723	213	40	-	-	HYPH
10_1101-2021_01_07_425723	213	41	wise	wise	JJ
10_1101-2021_01_07_425723	213	42	increment	increment	NN
10_1101-2021_01_07_425723	213	43	of	of	IN
10_1101-2021_01_07_425723	213	44	the	the	DT
10_1101-2021_01_07_425723	213	45	309	309	CD
10_1101-2021_01_07_425723	213	46	temperature	temperature	NN
10_1101-2021_01_07_425723	213	47	at	at	IN
10_1101-2021_01_07_425723	213	48	the	the	DT
10_1101-2021_01_07_425723	213	49	onset	onset	NN
10_1101-2021_01_07_425723	213	50	of	of	IN
10_1101-2021_01_07_425723	213	51	the	the	DT
10_1101-2021_01_07_425723	213	52	fermentation	fermentation	NN
10_1101-2021_01_07_425723	213	53	phase	phase	NN
10_1101-2021_01_07_425723	213	54	in	in	IN
10_1101-2021_01_07_425723	213	55	each	each	DT
10_1101-2021_01_07_425723	213	56	batch	batch	NN
10_1101-2021_01_07_425723	213	57	cycle	cycle	NN
10_1101-2021_01_07_425723	213	58	.	.	.
10_1101-2021_01_07_425723	214	1	c	c	LS
10_1101-2021_01_07_425723	214	2	,	,	,
10_1101-2021_01_07_425723	214	3	Representative	Representative	NNP
10_1101-2021_01_07_425723	214	4	section	section	NN
10_1101-2021_01_07_425723	214	5	of	of	IN
10_1101-2021_01_07_425723	214	6	310	310	CD
10_1101-2021_01_07_425723	214	7	CO2	CO2	NNP
10_1101-2021_01_07_425723	214	8	off	off	IN
10_1101-2021_01_07_425723	214	9	-	-	HYPH
10_1101-2021_01_07_425723	214	10	gas	gas	NN
10_1101-2021_01_07_425723	214	11	profiles	profile	NNS
10_1101-2021_01_07_425723	214	12	of	of	IN
10_1101-2021_01_07_425723	214	13	the	the	DT
10_1101-2021_01_07_425723	214	14	individual	individual	JJ
10_1101-2021_01_07_425723	214	15	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	214	16	(	(	-LRB-
10_1101-2021_01_07_425723	214	17	M5R	m5r	NN
10_1101-2021_01_07_425723	214	18	)	)	-RRB-
10_1101-2021_01_07_425723	214	19	cultivation	cultivation	NN
10_1101-2021_01_07_425723	214	20	over	over	IN
10_1101-2021_01_07_425723	214	21	time	time	NN
10_1101-2021_01_07_425723	214	22	with	with	IN
10_1101-2021_01_07_425723	214	23	CO2	CO2	NNP
10_1101-2021_01_07_425723	214	24	fraction	fraction	NN
10_1101-2021_01_07_425723	214	25	(	(	-LRB-
10_1101-2021_01_07_425723	214	26	orange	orange	NNP
10_1101-2021_01_07_425723	214	27	311	311	CD
10_1101-2021_01_07_425723	214	28	line	line	NN
10_1101-2021_01_07_425723	214	29	)	)	-RRB-
10_1101-2021_01_07_425723	214	30	and	and	CC
10_1101-2021_01_07_425723	214	31	culture	culture	NN
10_1101-2021_01_07_425723	214	32	temperature	temperature	NN
10_1101-2021_01_07_425723	214	33	(	(	-LRB-
10_1101-2021_01_07_425723	214	34	grey	grey	JJ
10_1101-2021_01_07_425723	214	35	dotted	dotted	JJ
10_1101-2021_01_07_425723	214	36	line	line	NN
10_1101-2021_01_07_425723	214	37	)	)	-RRB-
10_1101-2021_01_07_425723	214	38	,	,	,
10_1101-2021_01_07_425723	214	39	data	datum	NNS
10_1101-2021_01_07_425723	214	40	of	of	IN
10_1101-2021_01_07_425723	214	41	the	the	DT
10_1101-2021_01_07_425723	214	42	entire	entire	JJ
10_1101-2021_01_07_425723	214	43	experiment	experiment	NN
10_1101-2021_01_07_425723	214	44	is	be	VBZ
10_1101-2021_01_07_425723	214	45	available	available	JJ
10_1101-2021_01_07_425723	214	46	in	in	IN
10_1101-2021_01_07_425723	214	47	312	312	CD
10_1101-2021_01_07_425723	214	48	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	214	49	Fig	Fig	NNP
10_1101-2021_01_07_425723	214	50	.	.	.
10_1101-2021_01_07_425723	215	1	11	11	CD
10_1101-2021_01_07_425723	215	2	(	(	-LRB-
10_1101-2021_01_07_425723	215	3	Data	datum	NNS
10_1101-2021_01_07_425723	215	4	availability	availability	NN
10_1101-2021_01_07_425723	215	5	)	)	-RRB-
10_1101-2021_01_07_425723	215	6	.	.	.
10_1101-2021_01_07_425723	216	1	313	313	CD
10_1101-2021_01_07_425723	216	2	Discussion	discussion	NN
10_1101-2021_01_07_425723	216	3	314	314	CD
10_1101-2021_01_07_425723	216	4	Industrial	industrial	JJ
10_1101-2021_01_07_425723	216	5	production	production	NN
10_1101-2021_01_07_425723	216	6	of	of	IN
10_1101-2021_01_07_425723	216	7	ethanol	ethanol	NN
10_1101-2021_01_07_425723	216	8	from	from	IN
10_1101-2021_01_07_425723	216	9	carbohydrates	carbohydrate	NNS
10_1101-2021_01_07_425723	216	10	relies	rely	VBZ
10_1101-2021_01_07_425723	216	11	on	on	IN
10_1101-2021_01_07_425723	216	12	S.	S.	NNP
10_1101-2021_01_07_425723	216	13	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	216	14	,	,	,
10_1101-2021_01_07_425723	216	15	due	due	IN
10_1101-2021_01_07_425723	216	16	to	to	IN
10_1101-2021_01_07_425723	216	17	its	-PRON-	PRP$
10_1101-2021_01_07_425723	216	18	capacity	capacity	NN
10_1101-2021_01_07_425723	216	19	for	for	IN
10_1101-2021_01_07_425723	216	20	315	315	CD
10_1101-2021_01_07_425723	216	21	efficient	efficient	JJ
10_1101-2021_01_07_425723	216	22	,	,	,
10_1101-2021_01_07_425723	216	23	fast	fast	JJ
10_1101-2021_01_07_425723	216	24	alcoholic	alcoholic	JJ
10_1101-2021_01_07_425723	216	25	fermentation	fermentation	NN
10_1101-2021_01_07_425723	216	26	and	and	CC
10_1101-2021_01_07_425723	216	27	growth	growth	NN
10_1101-2021_01_07_425723	216	28	under	under	IN
10_1101-2021_01_07_425723	216	29	strictly	strictly	RB
10_1101-2021_01_07_425723	216	30	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	216	31	process	process	NN
10_1101-2021_01_07_425723	216	32	conditions	condition	NNS
10_1101-2021_01_07_425723	216	33	.	.	.
10_1101-2021_01_07_425723	217	1	Many	many	JJ
10_1101-2021_01_07_425723	217	2	316	316	CD
10_1101-2021_01_07_425723	217	3	facultatively	facultatively	RB
10_1101-2021_01_07_425723	217	4	fermentative	fermentative	JJ
10_1101-2021_01_07_425723	217	5	yeast	yeast	NN
10_1101-2021_01_07_425723	217	6	species	specie	NNS
10_1101-2021_01_07_425723	217	7	outside	outside	IN
10_1101-2021_01_07_425723	217	8	the	the	DT
10_1101-2021_01_07_425723	217	9	Saccharomycotina	Saccharomycotina	NNP
10_1101-2021_01_07_425723	217	10	WGD	WGD	NNP
10_1101-2021_01_07_425723	217	11	-	-	HYPH
10_1101-2021_01_07_425723	217	12	clade	clade	NNP
10_1101-2021_01_07_425723	217	13	also	also	RB
10_1101-2021_01_07_425723	217	14	rapidly	rapidly	RB
10_1101-2021_01_07_425723	217	15	ferment	ferment	VB
10_1101-2021_01_07_425723	217	16	317	317	CD
10_1101-2021_01_07_425723	217	17	sugars	sugar	NNS
10_1101-2021_01_07_425723	217	18	to	to	IN
10_1101-2021_01_07_425723	217	19	ethanol	ethanol	NN
10_1101-2021_01_07_425723	217	20	under	under	IN
10_1101-2021_01_07_425723	217	21	oxygen	oxygen	NN
10_1101-2021_01_07_425723	217	22	-	-	HYPH
10_1101-2021_01_07_425723	217	23	limited	limit	VBN
10_1101-2021_01_07_425723	217	24	conditions26	conditions26	NNS
10_1101-2021_01_07_425723	217	25	,	,	,
10_1101-2021_01_07_425723	217	26	but	but	CC
10_1101-2021_01_07_425723	217	27	can	can	MD
10_1101-2021_01_07_425723	217	28	not	not	RB
10_1101-2021_01_07_425723	217	29	grow	grow	VB
10_1101-2021_01_07_425723	217	30	and	and	CC
10_1101-2021_01_07_425723	217	31	ferment	ferment	VB
10_1101-2021_01_07_425723	217	32	in	in	IN
10_1101-2021_01_07_425723	217	33	the	the	DT
10_1101-2021_01_07_425723	217	34	complete	complete	JJ
10_1101-2021_01_07_425723	217	35	318	318	CD
10_1101-2021_01_07_425723	217	36	absence	absence	NN
10_1101-2021_01_07_425723	217	37	of	of	IN
10_1101-2021_01_07_425723	217	38	oxygen11,13,25	oxygen11,13,25	NNP
10_1101-2021_01_07_425723	217	39	.	.	.
10_1101-2021_01_07_425723	218	1	Identifying	identify	VBG
10_1101-2021_01_07_425723	218	2	and	and	CC
10_1101-2021_01_07_425723	218	3	eliminating	eliminate	VBG
10_1101-2021_01_07_425723	218	4	oxygen	oxygen	NN
10_1101-2021_01_07_425723	218	5	requirements	requirement	NNS
10_1101-2021_01_07_425723	218	6	of	of	IN
10_1101-2021_01_07_425723	218	7	these	these	DT
10_1101-2021_01_07_425723	218	8	yeasts	yeast	NNS
10_1101-2021_01_07_425723	218	9	is	be	VBZ
10_1101-2021_01_07_425723	218	10	essential	essential	JJ
10_1101-2021_01_07_425723	218	11	to	to	TO
10_1101-2021_01_07_425723	218	12	319	319	CD
10_1101-2021_01_07_425723	218	13	unlock	unlock	VB
10_1101-2021_01_07_425723	218	14	their	-PRON-	PRP$
10_1101-2021_01_07_425723	218	15	industrially	industrially	RB
10_1101-2021_01_07_425723	218	16	relevant	relevant	JJ
10_1101-2021_01_07_425723	218	17	traits	trait	NNS
10_1101-2021_01_07_425723	218	18	for	for	IN
10_1101-2021_01_07_425723	218	19	application	application	NN
10_1101-2021_01_07_425723	218	20	.	.	.
10_1101-2021_01_07_425723	219	1	Here	here	RB
10_1101-2021_01_07_425723	219	2	,	,	,
10_1101-2021_01_07_425723	219	3	this	this	DT
10_1101-2021_01_07_425723	219	4	challenge	challenge	NN
10_1101-2021_01_07_425723	219	5	was	be	VBD
10_1101-2021_01_07_425723	219	6	addressed	address	VBN
10_1101-2021_01_07_425723	219	7	for	for	IN
10_1101-2021_01_07_425723	219	8	the	the	DT
10_1101-2021_01_07_425723	219	9	320	320	CD
10_1101-2021_01_07_425723	219	10	thermotolerant	thermotolerant	NN
10_1101-2021_01_07_425723	219	11	yeast	yeast	NN
10_1101-2021_01_07_425723	219	12	K.	K.	NNP
10_1101-2021_01_07_425723	219	13	marxianus	marxianus	NN
10_1101-2021_01_07_425723	219	14	,	,	,
10_1101-2021_01_07_425723	219	15	using	use	VBG
10_1101-2021_01_07_425723	219	16	a	a	DT
10_1101-2021_01_07_425723	219	17	systematic	systematic	JJ
10_1101-2021_01_07_425723	219	18	approach	approach	NN
10_1101-2021_01_07_425723	219	19	based	base	VBN
10_1101-2021_01_07_425723	219	20	on	on	IN
10_1101-2021_01_07_425723	219	21	chemostat	chemostat	NNP
10_1101-2021_01_07_425723	219	22	-	-	HYPH
10_1101-2021_01_07_425723	219	23	based	base	VBN
10_1101-2021_01_07_425723	219	24	quantitative	quantitative	JJ
10_1101-2021_01_07_425723	219	25	321	321	CD
10_1101-2021_01_07_425723	219	26	physiology	physiology	NN
10_1101-2021_01_07_425723	219	27	,	,	,
10_1101-2021_01_07_425723	219	28	genome	genome	JJ
10_1101-2021_01_07_425723	219	29	and	and	CC
10_1101-2021_01_07_425723	219	30	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	219	31	analysis	analysis	NN
10_1101-2021_01_07_425723	219	32	,	,	,
10_1101-2021_01_07_425723	219	33	sterol	sterol	NN
10_1101-2021_01_07_425723	219	34	-	-	HYPH
10_1101-2021_01_07_425723	219	35	uptake	uptake	NN
10_1101-2021_01_07_425723	219	36	assays	assay	NNS
10_1101-2021_01_07_425723	219	37	and	and	CC
10_1101-2021_01_07_425723	219	38	genetic	genetic	JJ
10_1101-2021_01_07_425723	219	39	modification	modification	NN
10_1101-2021_01_07_425723	219	40	.	.	.
10_1101-2021_01_07_425723	220	1	S.	S.	NNP
10_1101-2021_01_07_425723	220	2	322	322	CD
10_1101-2021_01_07_425723	220	3	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	220	4	,	,	,
10_1101-2021_01_07_425723	220	5	which	which	WDT
10_1101-2021_01_07_425723	220	6	was	be	VBD
10_1101-2021_01_07_425723	220	7	used	use	VBN
10_1101-2021_01_07_425723	220	8	as	as	IN
10_1101-2021_01_07_425723	220	9	a	a	DT
10_1101-2021_01_07_425723	220	10	reference	reference	NN
10_1101-2021_01_07_425723	220	11	in	in	IN
10_1101-2021_01_07_425723	220	12	this	this	DT
10_1101-2021_01_07_425723	220	13	study	study	NN
10_1101-2021_01_07_425723	220	14	,	,	,
10_1101-2021_01_07_425723	220	15	shows	show	VBZ
10_1101-2021_01_07_425723	220	16	strongly	strongly	RB
10_1101-2021_01_07_425723	220	17	different	different	JJ
10_1101-2021_01_07_425723	220	18	genome	genome	NN
10_1101-2021_01_07_425723	220	19	-	-	HYPH
10_1101-2021_01_07_425723	220	20	wide	wide	JJ
10_1101-2021_01_07_425723	220	21	323	323	CD
10_1101-2021_01_07_425723	220	22	expression	expression	NN
10_1101-2021_01_07_425723	220	23	profiles	profile	NNS
10_1101-2021_01_07_425723	220	24	under	under	IN
10_1101-2021_01_07_425723	220	25	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	220	26	and	and	CC
10_1101-2021_01_07_425723	220	27	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	220	28	or	or	CC
10_1101-2021_01_07_425723	220	29	oxygen	oxygen	NN
10_1101-2021_01_07_425723	220	30	-	-	HYPH
10_1101-2021_01_07_425723	220	31	limited	limit	VBN
10_1101-2021_01_07_425723	220	32	conditions51	conditions51	NN
10_1101-2021_01_07_425723	220	33	.	.	.
10_1101-2021_01_07_425723	221	1	Although	although	IN
10_1101-2021_01_07_425723	221	2	only	only	RB
10_1101-2021_01_07_425723	221	3	a	a	DT
10_1101-2021_01_07_425723	221	4	small	small	JJ
10_1101-2021_01_07_425723	221	5	324	324	CD
10_1101-2021_01_07_425723	221	6	fraction	fraction	NN
10_1101-2021_01_07_425723	221	7	of	of	IN
10_1101-2021_01_07_425723	221	8	these	these	DT
10_1101-2021_01_07_425723	221	9	differences	difference	NNS
10_1101-2021_01_07_425723	221	10	were	be	VBD
10_1101-2021_01_07_425723	221	11	conserved	conserve	VBN
10_1101-2021_01_07_425723	221	12	in	in	IN
10_1101-2021_01_07_425723	221	13	K.	K.	NNP
10_1101-2021_01_07_425723	221	14	marxianus	marxianus	NN
10_1101-2021_01_07_425723	221	15	(	(	-LRB-
10_1101-2021_01_07_425723	221	16	Fig	fig	NN
10_1101-2021_01_07_425723	221	17	.	.	.
10_1101-2021_01_07_425723	222	1	2	2	LS
10_1101-2021_01_07_425723	222	2	)	)	-RRB-
10_1101-2021_01_07_425723	222	3	,	,	,
10_1101-2021_01_07_425723	222	4	we	-PRON-	PRP
10_1101-2021_01_07_425723	222	5	were	be	VBD
10_1101-2021_01_07_425723	222	6	able	able	JJ
10_1101-2021_01_07_425723	222	7	to	to	TO
10_1101-2021_01_07_425723	222	8	identify	identify	VB
10_1101-2021_01_07_425723	222	9	absence	absence	NN
10_1101-2021_01_07_425723	222	10	325	325	CD
10_1101-2021_01_07_425723	222	11	of	of	IN
10_1101-2021_01_07_425723	222	12	a	a	DT
10_1101-2021_01_07_425723	222	13	functional	functional	JJ
10_1101-2021_01_07_425723	222	14	sterol	sterol	JJ
10_1101-2021_01_07_425723	222	15	import	import	NN
10_1101-2021_01_07_425723	222	16	system	system	NN
10_1101-2021_01_07_425723	222	17	as	as	IN
10_1101-2021_01_07_425723	222	18	the	the	DT
10_1101-2021_01_07_425723	222	19	critical	critical	JJ
10_1101-2021_01_07_425723	222	20	cause	cause	NN
10_1101-2021_01_07_425723	222	21	for	for	IN
10_1101-2021_01_07_425723	222	22	its	-PRON-	PRP$
10_1101-2021_01_07_425723	222	23	inability	inability	NN
10_1101-2021_01_07_425723	222	24	to	to	TO
10_1101-2021_01_07_425723	222	25	grow	grow	VB
10_1101-2021_01_07_425723	222	26	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	222	27	.	.	.
10_1101-2021_01_07_425723	223	1	Enabling	enable	VBG
10_1101-2021_01_07_425723	223	2	326	326	CD
10_1101-2021_01_07_425723	223	3	synthesis	synthesis	NN
10_1101-2021_01_07_425723	223	4	of	of	IN
10_1101-2021_01_07_425723	223	5	the	the	DT
10_1101-2021_01_07_425723	223	6	sterol	sterol	JJ
10_1101-2021_01_07_425723	223	7	surrogate	surrogate	JJ
10_1101-2021_01_07_425723	223	8	tetrahymanol	tetrahymanol	NNS
10_1101-2021_01_07_425723	223	9	yielded	yield	VBD
10_1101-2021_01_07_425723	223	10	strains	strain	NNS
10_1101-2021_01_07_425723	223	11	that	that	WDT
10_1101-2021_01_07_425723	223	12	grew	grow	VBD
10_1101-2021_01_07_425723	223	13	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	223	14	at	at	IN
10_1101-2021_01_07_425723	223	15	temperatures	temperature	NNS
10_1101-2021_01_07_425723	223	16	327	327	CD
10_1101-2021_01_07_425723	223	17	above	above	IN
10_1101-2021_01_07_425723	223	18	the	the	DT
10_1101-2021_01_07_425723	223	19	permissive	permissive	JJ
10_1101-2021_01_07_425723	223	20	temperature	temperature	NN
10_1101-2021_01_07_425723	223	21	range	range	NN
10_1101-2021_01_07_425723	223	22	of	of	IN
10_1101-2021_01_07_425723	223	23	S.	S.	NNP
10_1101-2021_01_07_425723	223	24	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	223	25	.	.	.
10_1101-2021_01_07_425723	224	1	328	328	CD
10_1101-2021_01_07_425723	224	2	A	a	DT
10_1101-2021_01_07_425723	224	3	short	short	JJ
10_1101-2021_01_07_425723	224	4	adaptation	adaptation	NN
10_1101-2021_01_07_425723	224	5	phase	phase	NN
10_1101-2021_01_07_425723	224	6	of	of	IN
10_1101-2021_01_07_425723	224	7	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	224	8	-	-	HYPH
10_1101-2021_01_07_425723	224	9	producing	produce	VBG
10_1101-2021_01_07_425723	224	10	K.	K.	NNP
10_1101-2021_01_07_425723	224	11	marxianus	marxianus	NN
10_1101-2021_01_07_425723	224	12	strains	strain	VBZ
10_1101-2021_01_07_425723	224	13	under	under	IN
10_1101-2021_01_07_425723	224	14	oxygen	oxygen	NN
10_1101-2021_01_07_425723	224	15	-	-	HYPH
10_1101-2021_01_07_425723	224	16	limited	limit	VBN
10_1101-2021_01_07_425723	224	17	329	329	CD
10_1101-2021_01_07_425723	224	18	conditions	condition	NNS
10_1101-2021_01_07_425723	224	19	reproducibly	reproducibly	RB
10_1101-2021_01_07_425723	224	20	enabled	enable	VBD
10_1101-2021_01_07_425723	224	21	strictly	strictly	RB
10_1101-2021_01_07_425723	224	22	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	224	23	growth	growth	NN
10_1101-2021_01_07_425723	224	24	.	.	.
10_1101-2021_01_07_425723	225	1	Although	although	IN
10_1101-2021_01_07_425723	225	2	this	this	DT
10_1101-2021_01_07_425723	225	3	ability	ability	NN
10_1101-2021_01_07_425723	225	4	was	be	VBD
10_1101-2021_01_07_425723	225	5	retained	retain	VBN
10_1101-2021_01_07_425723	225	6	after	after	IN
10_1101-2021_01_07_425723	225	7	330	330	CD
10_1101-2021_01_07_425723	225	8	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	225	9	isolation	isolation	NN
10_1101-2021_01_07_425723	225	10	of	of	IN
10_1101-2021_01_07_425723	225	11	single	single	JJ
10_1101-2021_01_07_425723	225	12	-	-	HYPH
10_1101-2021_01_07_425723	225	13	cell	cell	NN
10_1101-2021_01_07_425723	225	14	lines	line	NNS
10_1101-2021_01_07_425723	225	15	,	,	,
10_1101-2021_01_07_425723	225	16	we	-PRON-	PRP
10_1101-2021_01_07_425723	225	17	were	be	VBD
10_1101-2021_01_07_425723	225	18	unable	unable	JJ
10_1101-2021_01_07_425723	225	19	to	to	TO
10_1101-2021_01_07_425723	225	20	attribute	attribute	VB
10_1101-2021_01_07_425723	225	21	this	this	DT
10_1101-2021_01_07_425723	225	22	adaptation	adaptation	NN
10_1101-2021_01_07_425723	225	23	to	to	IN
10_1101-2021_01_07_425723	225	24	mutations	mutation	NNS
10_1101-2021_01_07_425723	225	25	.	.	.
10_1101-2021_01_07_425723	226	1	In	in	IN
10_1101-2021_01_07_425723	226	2	331	331	CD
10_1101-2021_01_07_425723	226	3	.CC	.CC	,
10_1101-2021_01_07_425723	226	4	-	-	HYPH
10_1101-2021_01_07_425723	226	5	BY	by	IN
10_1101-2021_01_07_425723	226	6	-	-	HYPH
10_1101-2021_01_07_425723	226	7	NC	NC	NNP
10_1101-2021_01_07_425723	226	8	-	-	HYPH
10_1101-2021_01_07_425723	226	9	ND	ND	NNP
10_1101-2021_01_07_425723	226	10	4.0	4.0	CD
10_1101-2021_01_07_425723	226	11	International	International	NNP
10_1101-2021_01_07_425723	226	12	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	226	13	under	under	IN
10_1101-2021_01_07_425723	226	14	a	a	DT
10_1101-2021_01_07_425723	226	15	(	(	-LRB-
10_1101-2021_01_07_425723	226	16	which	which	WDT
10_1101-2021_01_07_425723	226	17	was	be	VBD
10_1101-2021_01_07_425723	226	18	not	not	RB
10_1101-2021_01_07_425723	226	19	certified	certify	VBN
10_1101-2021_01_07_425723	226	20	by	by	IN
10_1101-2021_01_07_425723	226	21	peer	peer	NN
10_1101-2021_01_07_425723	226	22	review	review	NN
10_1101-2021_01_07_425723	226	23	)	)	-RRB-
10_1101-2021_01_07_425723	226	24	is	be	VBZ
10_1101-2021_01_07_425723	226	25	the	the	DT
10_1101-2021_01_07_425723	226	26	author	author	NN
10_1101-2021_01_07_425723	226	27	/	/	SYM
10_1101-2021_01_07_425723	226	28	funder	funder	NN
10_1101-2021_01_07_425723	226	29	,	,	,
10_1101-2021_01_07_425723	226	30	who	who	WP
10_1101-2021_01_07_425723	226	31	has	have	VBZ
10_1101-2021_01_07_425723	226	32	granted	grant	VBN
10_1101-2021_01_07_425723	226	33	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	226	34	a	a	DT
10_1101-2021_01_07_425723	226	35	license	license	NN
10_1101-2021_01_07_425723	226	36	to	to	TO
10_1101-2021_01_07_425723	226	37	display	display	VB
10_1101-2021_01_07_425723	226	38	the	the	DT
10_1101-2021_01_07_425723	226	39	preprint	preprint	NN
10_1101-2021_01_07_425723	226	40	in	in	IN
10_1101-2021_01_07_425723	226	41	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	226	42	.	.	.
10_1101-2021_01_07_425723	227	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	227	2	is	be	VBZ
10_1101-2021_01_07_425723	227	3	made	make	VBN
10_1101-2021_01_07_425723	227	4	The	the	DT
10_1101-2021_01_07_425723	227	5	copyright	copyright	NN
10_1101-2021_01_07_425723	227	6	holder	holder	NN
10_1101-2021_01_07_425723	227	7	for	for	IN
10_1101-2021_01_07_425723	227	8	this	this	DT
10_1101-2021_01_07_425723	227	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	227	10	version	version	NN
10_1101-2021_01_07_425723	227	11	posted	post	VBD
10_1101-2021_01_07_425723	227	12	January	January	NNP
10_1101-2021_01_07_425723	227	13	8	8	CD
10_1101-2021_01_07_425723	227	14	,	,	,
10_1101-2021_01_07_425723	227	15	2021	2021	CD
10_1101-2021_01_07_425723	227	16	.	.	.
10_1101-2021_01_07_425723	227	17	;	;	:
10_1101-2021_01_07_425723	227	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	227	19	:	:	:
10_1101-2021_01_07_425723	227	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	227	21	preprint	preprint	NN
10_1101-2021_01_07_425723	227	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	227	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	RB
10_1101-2021_01_07_425723	227	24	21	21	CD
10_1101-2021_01_07_425723	227	25	contrast	contrast	NN
10_1101-2021_01_07_425723	227	26	to	to	IN
10_1101-2021_01_07_425723	227	27	wild	wild	JJ
10_1101-2021_01_07_425723	227	28	-	-	HYPH
10_1101-2021_01_07_425723	227	29	type	type	NN
10_1101-2021_01_07_425723	227	30	K.	K.	NNP
10_1101-2021_01_07_425723	227	31	marxianus	marxianus	NN
10_1101-2021_01_07_425723	227	32	,	,	,
10_1101-2021_01_07_425723	227	33	a	a	DT
10_1101-2021_01_07_425723	227	34	non	non	JJ
10_1101-2021_01_07_425723	227	35	-	-	JJ
10_1101-2021_01_07_425723	227	36	adapted	adapted	JJ
10_1101-2021_01_07_425723	227	37	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	227	38	-	-	HYPH
10_1101-2021_01_07_425723	227	39	producing	produce	VBG
10_1101-2021_01_07_425723	227	40	strain	strain	NN
10_1101-2021_01_07_425723	227	41	did	do	VBD
10_1101-2021_01_07_425723	227	42	not	not	RB
10_1101-2021_01_07_425723	227	43	show	show	VB
10_1101-2021_01_07_425723	227	44	‘	'	``
10_1101-2021_01_07_425723	227	45	carry-332	carry-332	NN
10_1101-2021_01_07_425723	227	46	over	over	IN
10_1101-2021_01_07_425723	227	47	growth	growth	NN
10_1101-2021_01_07_425723	227	48	’	'	''
10_1101-2021_01_07_425723	227	49	after	after	IN
10_1101-2021_01_07_425723	227	50	transfer	transfer	NN
10_1101-2021_01_07_425723	227	51	from	from	IN
10_1101-2021_01_07_425723	227	52	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	227	53	to	to	TO
10_1101-2021_01_07_425723	227	54	strictly	strictly	RB
10_1101-2021_01_07_425723	227	55	anaerobic	anaerobic	VB
10_1101-2021_01_07_425723	227	56	conditions	condition	NNS
10_1101-2021_01_07_425723	227	57	and	and	CC
10_1101-2021_01_07_425723	227	58	adapted	adapt	VBN
10_1101-2021_01_07_425723	227	59	cultures	culture	NNS
10_1101-2021_01_07_425723	227	60	showed	show	VBD
10_1101-2021_01_07_425723	227	61	333	333	CD
10_1101-2021_01_07_425723	227	62	reduced	reduced	JJ
10_1101-2021_01_07_425723	227	63	squalene	squalene	NN
10_1101-2021_01_07_425723	227	64	contents	content	NNS
10_1101-2021_01_07_425723	227	65	(	(	-LRB-
10_1101-2021_01_07_425723	227	66	Fig	fig	NN
10_1101-2021_01_07_425723	227	67	.	.	.
10_1101-2021_01_07_425723	228	1	5	5	LS
10_1101-2021_01_07_425723	228	2	)	)	-RRB-
10_1101-2021_01_07_425723	228	3	.	.	.
10_1101-2021_01_07_425723	229	1	These	these	DT
10_1101-2021_01_07_425723	229	2	observations	observation	NNS
10_1101-2021_01_07_425723	229	3	suggest	suggest	VBP
10_1101-2021_01_07_425723	229	4	that	that	IN
10_1101-2021_01_07_425723	229	5	interactions	interaction	NNS
10_1101-2021_01_07_425723	229	6	between	between	IN
10_1101-2021_01_07_425723	229	7	tetrahymanol	tetrahymanol	NNS
10_1101-2021_01_07_425723	229	8	,	,	,
10_1101-2021_01_07_425723	229	9	334	334	CD
10_1101-2021_01_07_425723	229	10	ergosterol	ergosterol	JJ
10_1101-2021_01_07_425723	229	11	and/or	and/or	CC
10_1101-2021_01_07_425723	229	12	squalene	squalene	VB
10_1101-2021_01_07_425723	229	13	influence	influence	NN
10_1101-2021_01_07_425723	229	14	the	the	DT
10_1101-2021_01_07_425723	229	15	onset	onset	NN
10_1101-2021_01_07_425723	229	16	of	of	IN
10_1101-2021_01_07_425723	229	17	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	229	18	growth	growth	NN
10_1101-2021_01_07_425723	229	19	and	and	CC
10_1101-2021_01_07_425723	229	20	that	that	IN
10_1101-2021_01_07_425723	229	21	oxygen	oxygen	NN
10_1101-2021_01_07_425723	229	22	-	-	HYPH
10_1101-2021_01_07_425723	229	23	limited	limit	VBN
10_1101-2021_01_07_425723	229	24	growth	growth	NN
10_1101-2021_01_07_425723	229	25	335	335	CD
10_1101-2021_01_07_425723	229	26	results	result	NNS
10_1101-2021_01_07_425723	229	27	in	in	IN
10_1101-2021_01_07_425723	229	28	a	a	DT
10_1101-2021_01_07_425723	229	29	stable	stable	JJ
10_1101-2021_01_07_425723	229	30	balance	balance	NN
10_1101-2021_01_07_425723	229	31	between	between	IN
10_1101-2021_01_07_425723	229	32	these	these	DT
10_1101-2021_01_07_425723	229	33	lipids	lipid	NNS
10_1101-2021_01_07_425723	229	34	that	that	WDT
10_1101-2021_01_07_425723	229	35	is	be	VBZ
10_1101-2021_01_07_425723	229	36	permissive	permissive	JJ
10_1101-2021_01_07_425723	229	37	for	for	IN
10_1101-2021_01_07_425723	229	38	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	229	39	growth	growth	NN
10_1101-2021_01_07_425723	229	40	.	.	.
10_1101-2021_01_07_425723	230	1	336	336	CD
10_1101-2021_01_07_425723	230	2	Comparative	comparative	JJ
10_1101-2021_01_07_425723	230	3	genomic	genomic	JJ
10_1101-2021_01_07_425723	230	4	studies	study	NNS
10_1101-2021_01_07_425723	230	5	in	in	IN
10_1101-2021_01_07_425723	230	6	Saccharomycotina	Saccharomycotina	NNP
10_1101-2021_01_07_425723	230	7	yeasts	yeast	NNS
10_1101-2021_01_07_425723	230	8	have	have	VBP
10_1101-2021_01_07_425723	230	9	previously	previously	RB
10_1101-2021_01_07_425723	230	10	led	lead	VBN
10_1101-2021_01_07_425723	230	11	to	to	IN
10_1101-2021_01_07_425723	230	12	the	the	DT
10_1101-2021_01_07_425723	230	13	hypothesis	hypothesis	NN
10_1101-2021_01_07_425723	230	14	that	that	IN
10_1101-2021_01_07_425723	230	15	337	337	CD
10_1101-2021_01_07_425723	230	16	sterol	sterol	JJ
10_1101-2021_01_07_425723	230	17	transporters	transporter	NNS
10_1101-2021_01_07_425723	230	18	are	be	VBP
10_1101-2021_01_07_425723	230	19	absent	absent	JJ
10_1101-2021_01_07_425723	230	20	from	from	IN
10_1101-2021_01_07_425723	230	21	pre	pre	JJ
10_1101-2021_01_07_425723	230	22	-	-	JJ
10_1101-2021_01_07_425723	230	23	WGD	wgd	JJ
10_1101-2021_01_07_425723	230	24	yeast	yeast	NN
10_1101-2021_01_07_425723	230	25	species11,52	species11,52	RB
10_1101-2021_01_07_425723	230	26	.	.	.
10_1101-2021_01_07_425723	231	1	While	while	IN
10_1101-2021_01_07_425723	231	2	our	-PRON-	PRP$
10_1101-2021_01_07_425723	231	3	observations	observation	NNS
10_1101-2021_01_07_425723	231	4	on	on	IN
10_1101-2021_01_07_425723	231	5	K.	K.	NNP
10_1101-2021_01_07_425723	231	6	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	231	7	338	338	CD
10_1101-2021_01_07_425723	231	8	reinforce	reinforce	NN
10_1101-2021_01_07_425723	231	9	this	this	DT
10_1101-2021_01_07_425723	231	10	hypothesis	hypothesis	NN
10_1101-2021_01_07_425723	231	11	,	,	,
10_1101-2021_01_07_425723	231	12	which	which	WDT
10_1101-2021_01_07_425723	231	13	was	be	VBD
10_1101-2021_01_07_425723	231	14	hitherto	hitherto	VBN
10_1101-2021_01_07_425723	231	15	not	not	RB
10_1101-2021_01_07_425723	231	16	experimentally	experimentally	RB
10_1101-2021_01_07_425723	231	17	tested	test	VBN
10_1101-2021_01_07_425723	231	18	,	,	,
10_1101-2021_01_07_425723	231	19	they	-PRON-	PRP
10_1101-2021_01_07_425723	231	20	do	do	VBP
10_1101-2021_01_07_425723	231	21	not	not	RB
10_1101-2021_01_07_425723	231	22	exclude	exclude	VB
10_1101-2021_01_07_425723	231	23	339	339	CD
10_1101-2021_01_07_425723	231	24	involvement	involvement	NN
10_1101-2021_01_07_425723	231	25	of	of	IN
10_1101-2021_01_07_425723	231	26	additional	additional	JJ
10_1101-2021_01_07_425723	231	27	oxygen	oxygen	NN
10_1101-2021_01_07_425723	231	28	-	-	HYPH
10_1101-2021_01_07_425723	231	29	requiring	require	VBG
10_1101-2021_01_07_425723	231	30	reactions	reaction	NNS
10_1101-2021_01_07_425723	231	31	in	in	IN
10_1101-2021_01_07_425723	231	32	other	other	JJ
10_1101-2021_01_07_425723	231	33	non	non	JJ
10_1101-2021_01_07_425723	231	34	-	-	JJ
10_1101-2021_01_07_425723	231	35	Saccharomyces	saccharomyces	JJ
10_1101-2021_01_07_425723	231	36	yeasts	yeast	NNS
10_1101-2021_01_07_425723	231	37	.	.	.
10_1101-2021_01_07_425723	232	1	For	for	IN
10_1101-2021_01_07_425723	232	2	example	example	NN
10_1101-2021_01_07_425723	232	3	,	,	,
10_1101-2021_01_07_425723	232	4	340	340	CD
10_1101-2021_01_07_425723	232	5	pyrimidine	pyrimidine	JJ
10_1101-2021_01_07_425723	232	6	biosynthesis	biosynthesis	NN
10_1101-2021_01_07_425723	232	7	is	be	VBZ
10_1101-2021_01_07_425723	232	8	often	often	RB
10_1101-2021_01_07_425723	232	9	cited	cite	VBN
10_1101-2021_01_07_425723	232	10	as	as	IN
10_1101-2021_01_07_425723	232	11	a	a	DT
10_1101-2021_01_07_425723	232	12	key	key	JJ
10_1101-2021_01_07_425723	232	13	oxygen	oxygen	NN
10_1101-2021_01_07_425723	232	14	-	-	HYPH
10_1101-2021_01_07_425723	232	15	requiring	require	VBG
10_1101-2021_01_07_425723	232	16	process	process	NN
10_1101-2021_01_07_425723	232	17	in	in	IN
10_1101-2021_01_07_425723	232	18	non	non	JJ
10_1101-2021_01_07_425723	232	19	-	-	JJ
10_1101-2021_01_07_425723	232	20	Saccharomyces	saccharomyces	JJ
10_1101-2021_01_07_425723	232	21	yeasts	yeast	NNS
10_1101-2021_01_07_425723	232	22	,	,	,
10_1101-2021_01_07_425723	232	23	341	341	CD
10_1101-2021_01_07_425723	232	24	due	due	IN
10_1101-2021_01_07_425723	232	25	to	to	IN
10_1101-2021_01_07_425723	232	26	involvement	involvement	NN
10_1101-2021_01_07_425723	232	27	of	of	IN
10_1101-2021_01_07_425723	232	28	a	a	DT
10_1101-2021_01_07_425723	232	29	respiratory	respiratory	JJ
10_1101-2021_01_07_425723	232	30	-	-	HYPH
10_1101-2021_01_07_425723	232	31	chain	chain	NN
10_1101-2021_01_07_425723	232	32	-	-	HYPH
10_1101-2021_01_07_425723	232	33	linked	link	VBN
10_1101-2021_01_07_425723	232	34	dihydroorotate	dihydroorotate	JJ
10_1101-2021_01_07_425723	232	35	dehydrogenase	dehydrogenase	NN
10_1101-2021_01_07_425723	232	36	(	(	-LRB-
10_1101-2021_01_07_425723	232	37	DHOD)53,54	dhod)53,54	NN
10_1101-2021_01_07_425723	232	38	.	.	.
10_1101-2021_01_07_425723	233	1	K.	K.	NNP
10_1101-2021_01_07_425723	233	2	342	342	CD
10_1101-2021_01_07_425723	233	3	marxianus	marxianus	NN
10_1101-2021_01_07_425723	233	4	,	,	,
10_1101-2021_01_07_425723	233	5	is	be	VBZ
10_1101-2021_01_07_425723	233	6	among	among	IN
10_1101-2021_01_07_425723	233	7	a	a	DT
10_1101-2021_01_07_425723	233	8	small	small	JJ
10_1101-2021_01_07_425723	233	9	number	number	NN
10_1101-2021_01_07_425723	233	10	of	of	IN
10_1101-2021_01_07_425723	233	11	yeast	yeast	NN
10_1101-2021_01_07_425723	233	12	species	specie	NNS
10_1101-2021_01_07_425723	233	13	that	that	WDT
10_1101-2021_01_07_425723	233	14	,	,	,
10_1101-2021_01_07_425723	233	15	in	in	IN
10_1101-2021_01_07_425723	233	16	addition	addition	NN
10_1101-2021_01_07_425723	233	17	to	to	IN
10_1101-2021_01_07_425723	233	18	this	this	DT
10_1101-2021_01_07_425723	233	19	respiration	respiration	NN
10_1101-2021_01_07_425723	233	20	dependent	dependent	JJ
10_1101-2021_01_07_425723	233	21	343	343	CD
10_1101-2021_01_07_425723	233	22	enzyme	enzyme	NNS
10_1101-2021_01_07_425723	233	23	(	(	-LRB-
10_1101-2021_01_07_425723	233	24	KmUra9	KmUra9	NNP
10_1101-2021_01_07_425723	233	25	)	)	-RRB-
10_1101-2021_01_07_425723	233	26	,	,	,
10_1101-2021_01_07_425723	233	27	also	also	RB
10_1101-2021_01_07_425723	233	28	harbors	harbor	VBZ
10_1101-2021_01_07_425723	233	29	a	a	DT
10_1101-2021_01_07_425723	233	30	fumarate	fumarate	RB
10_1101-2021_01_07_425723	233	31	-	-	HYPH
10_1101-2021_01_07_425723	233	32	dependent	dependent	JJ
10_1101-2021_01_07_425723	233	33	DHOD	DHOD	NNP
10_1101-2021_01_07_425723	233	34	(	(	-LRB-
10_1101-2021_01_07_425723	233	35	KmUra1)55	KmUra1)55	NNP
10_1101-2021_01_07_425723	233	36	.	.	.
10_1101-2021_01_07_425723	234	1	In	in	IN
10_1101-2021_01_07_425723	234	2	K.	K.	NNP
10_1101-2021_01_07_425723	234	3	marxianus	marxianus	NN
10_1101-2021_01_07_425723	234	4	the	the	DT
10_1101-2021_01_07_425723	234	5	activation	activation	NN
10_1101-2021_01_07_425723	234	6	344	344	CD
10_1101-2021_01_07_425723	234	7	of	of	IN
10_1101-2021_01_07_425723	234	8	this	this	DT
10_1101-2021_01_07_425723	234	9	oxygen	oxygen	NN
10_1101-2021_01_07_425723	234	10	-	-	HYPH
10_1101-2021_01_07_425723	234	11	independent	independent	JJ
10_1101-2021_01_07_425723	234	12	KmUra1	KmUra1	NNP
10_1101-2021_01_07_425723	234	13	is	be	VBZ
10_1101-2021_01_07_425723	234	14	a	a	DT
10_1101-2021_01_07_425723	234	15	crucial	crucial	JJ
10_1101-2021_01_07_425723	234	16	adaptation	adaptation	NN
10_1101-2021_01_07_425723	234	17	for	for	IN
10_1101-2021_01_07_425723	234	18	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	234	19	pyrimidine	pyrimidine	JJ
10_1101-2021_01_07_425723	234	20	biosynthesis	biosynthesis	NN
10_1101-2021_01_07_425723	234	21	.	.	.
10_1101-2021_01_07_425723	235	1	The	the	DT
10_1101-2021_01_07_425723	235	2	345	345	CD
10_1101-2021_01_07_425723	235	3	experimental	experimental	JJ
10_1101-2021_01_07_425723	235	4	approach	approach	NN
10_1101-2021_01_07_425723	235	5	followed	follow	VBN
10_1101-2021_01_07_425723	235	6	in	in	IN
10_1101-2021_01_07_425723	235	7	the	the	DT
10_1101-2021_01_07_425723	235	8	present	present	JJ
10_1101-2021_01_07_425723	235	9	study	study	NN
10_1101-2021_01_07_425723	235	10	should	should	MD
10_1101-2021_01_07_425723	235	11	be	be	VB
10_1101-2021_01_07_425723	235	12	applicable	applicable	JJ
10_1101-2021_01_07_425723	235	13	to	to	TO
10_1101-2021_01_07_425723	235	14	resolve	resolve	VB
10_1101-2021_01_07_425723	235	15	the	the	DT
10_1101-2021_01_07_425723	235	16	role	role	NN
10_1101-2021_01_07_425723	235	17	of	of	IN
10_1101-2021_01_07_425723	235	18	346	346	CD
10_1101-2021_01_07_425723	235	19	pyrimidine	pyrimidine	JJ
10_1101-2021_01_07_425723	235	20	biosynthesis	biosynthesis	NN
10_1101-2021_01_07_425723	235	21	and	and	CC
10_1101-2021_01_07_425723	235	22	other	other	JJ
10_1101-2021_01_07_425723	235	23	oxygen	oxygen	NN
10_1101-2021_01_07_425723	235	24	-	-	HYPH
10_1101-2021_01_07_425723	235	25	requiring	require	VBG
10_1101-2021_01_07_425723	235	26	reactions	reaction	NNS
10_1101-2021_01_07_425723	235	27	in	in	IN
10_1101-2021_01_07_425723	235	28	additional	additional	JJ
10_1101-2021_01_07_425723	235	29	yeast	yeast	NN
10_1101-2021_01_07_425723	235	30	species	specie	NNS
10_1101-2021_01_07_425723	235	31	.	.	.
10_1101-2021_01_07_425723	236	1	347	347	CD
10_1101-2021_01_07_425723	236	2	Enabling	enable	VBG
10_1101-2021_01_07_425723	236	3	K.	K.	NNP
10_1101-2021_01_07_425723	236	4	marxianus	marxianus	NN
10_1101-2021_01_07_425723	236	5	to	to	TO
10_1101-2021_01_07_425723	236	6	grow	grow	VB
10_1101-2021_01_07_425723	236	7	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	236	8	represents	represent	VBZ
10_1101-2021_01_07_425723	236	9	an	an	DT
10_1101-2021_01_07_425723	236	10	important	important	JJ
10_1101-2021_01_07_425723	236	11	step	step	NN
10_1101-2021_01_07_425723	236	12	towards	towards	IN
10_1101-2021_01_07_425723	236	13	application	application	NN
10_1101-2021_01_07_425723	236	14	of	of	IN
10_1101-2021_01_07_425723	236	15	this	this	DT
10_1101-2021_01_07_425723	236	16	348	348	CD
10_1101-2021_01_07_425723	236	17	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	236	18	yeast	yeast	NN
10_1101-2021_01_07_425723	236	19	in	in	IN
10_1101-2021_01_07_425723	236	20	large	large	JJ
10_1101-2021_01_07_425723	236	21	-	-	HYPH
10_1101-2021_01_07_425723	236	22	scale	scale	NN
10_1101-2021_01_07_425723	236	23	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	236	24	bioprocesses	bioprocesse	NNS
10_1101-2021_01_07_425723	236	25	.	.	.
10_1101-2021_01_07_425723	237	1	However	however	RB
10_1101-2021_01_07_425723	237	2	,	,	,
10_1101-2021_01_07_425723	237	3	specific	specific	JJ
10_1101-2021_01_07_425723	237	4	growth	growth	NN
10_1101-2021_01_07_425723	237	5	rates	rate	NNS
10_1101-2021_01_07_425723	237	6	and	and	CC
10_1101-2021_01_07_425723	237	7	biomass	biomass	NN
10_1101-2021_01_07_425723	237	8	349	349	CD
10_1101-2021_01_07_425723	237	9	yields	yield	NNS
10_1101-2021_01_07_425723	237	10	of	of	IN
10_1101-2021_01_07_425723	237	11	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	237	12	-	-	HYPH
10_1101-2021_01_07_425723	237	13	expressing	express	VBG
10_1101-2021_01_07_425723	237	14	K.	K.	NNP
10_1101-2021_01_07_425723	237	15	marxianus	marxianus	NN
10_1101-2021_01_07_425723	237	16	in	in	IN
10_1101-2021_01_07_425723	237	17	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	237	18	cultures	culture	NNS
10_1101-2021_01_07_425723	237	19	were	be	VBD
10_1101-2021_01_07_425723	237	20	lower	low	JJR
10_1101-2021_01_07_425723	237	21	than	than	IN
10_1101-2021_01_07_425723	237	22	those	those	DT
10_1101-2021_01_07_425723	237	23	of	of	IN
10_1101-2021_01_07_425723	237	24	wild	wild	JJ
10_1101-2021_01_07_425723	237	25	-	-	HYPH
10_1101-2021_01_07_425723	237	26	type	type	NN
10_1101-2021_01_07_425723	237	27	350	350	CD
10_1101-2021_01_07_425723	237	28	S.	S.	NNP
10_1101-2021_01_07_425723	237	29	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	237	30	strains	strain	VBZ
10_1101-2021_01_07_425723	237	31	.	.	.
10_1101-2021_01_07_425723	238	1	A	a	DT
10_1101-2021_01_07_425723	238	2	similar	similar	JJ
10_1101-2021_01_07_425723	238	3	phenotype	phenotype	NN
10_1101-2021_01_07_425723	238	4	of	of	IN
10_1101-2021_01_07_425723	238	5	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	238	6	-	-	HYPH
10_1101-2021_01_07_425723	238	7	producing	produce	VBG
10_1101-2021_01_07_425723	238	8	S.	S.	NNP
10_1101-2021_01_07_425723	238	9	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	238	10	was	be	VBD
10_1101-2021_01_07_425723	238	11	proposed	propose	VBN
10_1101-2021_01_07_425723	238	12	to	to	IN
10_1101-2021_01_07_425723	238	13	351	351	CD
10_1101-2021_01_07_425723	238	14	reflect	reflect	VB
10_1101-2021_01_07_425723	238	15	an	an	DT
10_1101-2021_01_07_425723	238	16	increased	increase	VBN
10_1101-2021_01_07_425723	238	17	membrane	membrane	NN
10_1101-2021_01_07_425723	238	18	permeability46	permeability46	NNS
10_1101-2021_01_07_425723	238	19	.	.	.
10_1101-2021_01_07_425723	239	1	Additional	additional	JJ
10_1101-2021_01_07_425723	239	2	membrane	membrane	NN
10_1101-2021_01_07_425723	239	3	engineering	engineering	NN
10_1101-2021_01_07_425723	239	4	or	or	CC
10_1101-2021_01_07_425723	239	5	expression	expression	NN
10_1101-2021_01_07_425723	239	6	of	of	IN
10_1101-2021_01_07_425723	239	7	a	a	DT
10_1101-2021_01_07_425723	239	8	352	352	CD
10_1101-2021_01_07_425723	239	9	functional	functional	JJ
10_1101-2021_01_07_425723	239	10	sterol	sterol	JJ
10_1101-2021_01_07_425723	239	11	transport	transport	NN
10_1101-2021_01_07_425723	239	12	system	system	NN
10_1101-2021_01_07_425723	239	13	is	be	VBZ
10_1101-2021_01_07_425723	239	14	therefore	therefore	RB
10_1101-2021_01_07_425723	239	15	required	require	VBN
10_1101-2021_01_07_425723	239	16	for	for	IN
10_1101-2021_01_07_425723	239	17	further	further	JJ
10_1101-2021_01_07_425723	239	18	development	development	NN
10_1101-2021_01_07_425723	239	19	of	of	IN
10_1101-2021_01_07_425723	239	20	robust	robust	JJ
10_1101-2021_01_07_425723	239	21	,	,	,
10_1101-2021_01_07_425723	239	22	anaerobically	anaerobically	RB
10_1101-2021_01_07_425723	239	23	353	353	CD
10_1101-2021_01_07_425723	239	24	growing	grow	VBG
10_1101-2021_01_07_425723	239	25	industrial	industrial	JJ
10_1101-2021_01_07_425723	239	26	strains	strain	NNS
10_1101-2021_01_07_425723	239	27	of	of	IN
10_1101-2021_01_07_425723	239	28	K.	K.	NNP
10_1101-2021_01_07_425723	239	29	marxianus56	marxianus56	NNP
10_1101-2021_01_07_425723	239	30	.	.	.
10_1101-2021_01_07_425723	240	1	354	354	CD
10_1101-2021_01_07_425723	240	2	.CC	.CC	:
10_1101-2021_01_07_425723	240	3	-	-	HYPH
10_1101-2021_01_07_425723	240	4	BY	by	IN
10_1101-2021_01_07_425723	240	5	-	-	HYPH
10_1101-2021_01_07_425723	240	6	NC	NC	NNP
10_1101-2021_01_07_425723	240	7	-	-	HYPH
10_1101-2021_01_07_425723	240	8	ND	ND	NNP
10_1101-2021_01_07_425723	240	9	4.0	4.0	CD
10_1101-2021_01_07_425723	240	10	International	International	NNP
10_1101-2021_01_07_425723	240	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	240	12	under	under	IN
10_1101-2021_01_07_425723	240	13	a	a	DT
10_1101-2021_01_07_425723	240	14	(	(	-LRB-
10_1101-2021_01_07_425723	240	15	which	which	WDT
10_1101-2021_01_07_425723	240	16	was	be	VBD
10_1101-2021_01_07_425723	240	17	not	not	RB
10_1101-2021_01_07_425723	240	18	certified	certify	VBN
10_1101-2021_01_07_425723	240	19	by	by	IN
10_1101-2021_01_07_425723	240	20	peer	peer	NN
10_1101-2021_01_07_425723	240	21	review	review	NN
10_1101-2021_01_07_425723	240	22	)	)	-RRB-
10_1101-2021_01_07_425723	240	23	is	be	VBZ
10_1101-2021_01_07_425723	240	24	the	the	DT
10_1101-2021_01_07_425723	240	25	author	author	NN
10_1101-2021_01_07_425723	240	26	/	/	SYM
10_1101-2021_01_07_425723	240	27	funder	funder	NN
10_1101-2021_01_07_425723	240	28	,	,	,
10_1101-2021_01_07_425723	240	29	who	who	WP
10_1101-2021_01_07_425723	240	30	has	have	VBZ
10_1101-2021_01_07_425723	240	31	granted	grant	VBN
10_1101-2021_01_07_425723	240	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	240	33	a	a	DT
10_1101-2021_01_07_425723	240	34	license	license	NN
10_1101-2021_01_07_425723	240	35	to	to	TO
10_1101-2021_01_07_425723	240	36	display	display	VB
10_1101-2021_01_07_425723	240	37	the	the	DT
10_1101-2021_01_07_425723	240	38	preprint	preprint	NN
10_1101-2021_01_07_425723	240	39	in	in	IN
10_1101-2021_01_07_425723	240	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	240	41	.	.	.
10_1101-2021_01_07_425723	241	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	241	2	is	be	VBZ
10_1101-2021_01_07_425723	241	3	made	make	VBN
10_1101-2021_01_07_425723	241	4	The	the	DT
10_1101-2021_01_07_425723	241	5	copyright	copyright	NN
10_1101-2021_01_07_425723	241	6	holder	holder	NN
10_1101-2021_01_07_425723	241	7	for	for	IN
10_1101-2021_01_07_425723	241	8	this	this	DT
10_1101-2021_01_07_425723	241	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	241	10	version	version	NN
10_1101-2021_01_07_425723	241	11	posted	post	VBD
10_1101-2021_01_07_425723	241	12	January	January	NNP
10_1101-2021_01_07_425723	241	13	8	8	CD
10_1101-2021_01_07_425723	241	14	,	,	,
10_1101-2021_01_07_425723	241	15	2021	2021	CD
10_1101-2021_01_07_425723	241	16	.	.	.
10_1101-2021_01_07_425723	241	17	;	;	:
10_1101-2021_01_07_425723	241	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	241	19	:	:	:
10_1101-2021_01_07_425723	241	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	241	21	preprint	preprint	NN
10_1101-2021_01_07_425723	241	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	241	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	241	24	22	22	CD
10_1101-2021_01_07_425723	241	25	online	online	JJ
10_1101-2021_01_07_425723	241	26	Methods	Methods	NNP
10_1101-2021_01_07_425723	241	27	355	355	CD
10_1101-2021_01_07_425723	241	28	Yeast	yeast	NN
10_1101-2021_01_07_425723	241	29	strains	strain	NNS
10_1101-2021_01_07_425723	241	30	,	,	,
10_1101-2021_01_07_425723	241	31	maintenance	maintenance	NN
10_1101-2021_01_07_425723	241	32	and	and	CC
10_1101-2021_01_07_425723	241	33	shake	shake	NN
10_1101-2021_01_07_425723	241	34	-	-	HYPH
10_1101-2021_01_07_425723	241	35	flask	flask	NN
10_1101-2021_01_07_425723	241	36	cultivation	cultivation	NN
10_1101-2021_01_07_425723	241	37	356	356	CD
10_1101-2021_01_07_425723	241	38	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_07_425723	241	39	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	241	40	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	241	41	-	-	HYPH
10_1101-2021_01_07_425723	241	42	7D57,58	7d57,58	CD
10_1101-2021_01_07_425723	241	43	(	(	-LRB-
10_1101-2021_01_07_425723	241	44	MATa	MATa	NNPS
10_1101-2021_01_07_425723	241	45	MAL2	MAL2	NNP
10_1101-2021_01_07_425723	241	46	-	-	HYPH
10_1101-2021_01_07_425723	241	47	8c	8c	NNP
10_1101-2021_01_07_425723	241	48	SUC2	SUC2	NNP
10_1101-2021_01_07_425723	241	49	)	)	-RRB-
10_1101-2021_01_07_425723	241	50	was	be	VBD
10_1101-2021_01_07_425723	241	51	obtained	obtain	VBN
10_1101-2021_01_07_425723	241	52	from	from	IN
10_1101-2021_01_07_425723	241	53	Dr.	Dr.	NNP
10_1101-2021_01_07_425723	241	54	Peter	Peter	NNP
10_1101-2021_01_07_425723	241	55	Kötter	Kötter	NNP
10_1101-2021_01_07_425723	241	56	,	,	,
10_1101-2021_01_07_425723	241	57	357	357	CD
10_1101-2021_01_07_425723	241	58	J.W.	J.W.	NNP
10_1101-2021_01_07_425723	242	1	Goethe	Goethe	NNP
10_1101-2021_01_07_425723	242	2	University	University	NNP
10_1101-2021_01_07_425723	242	3	,	,	,
10_1101-2021_01_07_425723	242	4	Frankfurt	Frankfurt	NNP
10_1101-2021_01_07_425723	242	5	.	.	.
10_1101-2021_01_07_425723	243	1	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	243	2	marxianus	marxianus	NN
10_1101-2021_01_07_425723	243	3	strains	strain	VBZ
10_1101-2021_01_07_425723	243	4	CBS	CBS	NNP
10_1101-2021_01_07_425723	243	5	6556	6556	CD
10_1101-2021_01_07_425723	243	6	(	(	-LRB-
10_1101-2021_01_07_425723	243	7	ATCC	ATCC	NNP
10_1101-2021_01_07_425723	243	8	26548	26548	CD
10_1101-2021_01_07_425723	243	9	;	;	:
10_1101-2021_01_07_425723	243	10	NCYC	NCYC	NNP
10_1101-2021_01_07_425723	243	11	2597	2597	CD
10_1101-2021_01_07_425723	243	12	;	;	:
10_1101-2021_01_07_425723	243	13	358	358	CD
10_1101-2021_01_07_425723	243	14	NRRL	NRRL	NNP
10_1101-2021_01_07_425723	243	15	Y-7571	y-7571	NN
10_1101-2021_01_07_425723	243	16	)	)	-RRB-
10_1101-2021_01_07_425723	243	17	and	and	CC
10_1101-2021_01_07_425723	243	18	NBRC	NBRC	NNP
10_1101-2021_01_07_425723	243	19	1777	1777	CD
10_1101-2021_01_07_425723	243	20	(	(	-LRB-
10_1101-2021_01_07_425723	243	21	IFO	IFO	NNP
10_1101-2021_01_07_425723	243	22	1777	1777	CD
10_1101-2021_01_07_425723	243	23	)	)	-RRB-
10_1101-2021_01_07_425723	243	24	were	be	VBD
10_1101-2021_01_07_425723	243	25	obtained	obtain	VBN
10_1101-2021_01_07_425723	243	26	from	from	IN
10_1101-2021_01_07_425723	243	27	the	the	DT
10_1101-2021_01_07_425723	243	28	Westerdijk	Westerdijk	NNP
10_1101-2021_01_07_425723	243	29	Fungal	Fungal	NNP
10_1101-2021_01_07_425723	243	30	Biodiversity	Biodiversity	NNP
10_1101-2021_01_07_425723	243	31	359	359	CD
10_1101-2021_01_07_425723	243	32	Institute	Institute	NNP
10_1101-2021_01_07_425723	243	33	(	(	-LRB-
10_1101-2021_01_07_425723	243	34	Utrecht	Utrecht	NNP
10_1101-2021_01_07_425723	243	35	,	,	,
10_1101-2021_01_07_425723	243	36	The	the	DT
10_1101-2021_01_07_425723	243	37	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	243	38	)	)	-RRB-
10_1101-2021_01_07_425723	243	39	and	and	CC
10_1101-2021_01_07_425723	243	40	the	the	DT
10_1101-2021_01_07_425723	243	41	Biological	Biological	NNP
10_1101-2021_01_07_425723	243	42	Resource	Resource	NNP
10_1101-2021_01_07_425723	243	43	Center	Center	NNP
10_1101-2021_01_07_425723	243	44	,	,	,
10_1101-2021_01_07_425723	243	45	NITE	NITE	NNP
10_1101-2021_01_07_425723	243	46	(	(	-LRB-
10_1101-2021_01_07_425723	243	47	NBRC	NBRC	NNP
10_1101-2021_01_07_425723	243	48	)	)	-RRB-
10_1101-2021_01_07_425723	243	49	(	(	-LRB-
10_1101-2021_01_07_425723	243	50	Chiba	Chiba	NNP
10_1101-2021_01_07_425723	243	51	,	,	,
10_1101-2021_01_07_425723	243	52	Japan	Japan	NNP
10_1101-2021_01_07_425723	243	53	)	)	-RRB-
10_1101-2021_01_07_425723	243	54	,	,	,
10_1101-2021_01_07_425723	243	55	360	360	CD
10_1101-2021_01_07_425723	243	56	respectively	respectively	RB
10_1101-2021_01_07_425723	243	57	.	.	.
10_1101-2021_01_07_425723	244	1	Stock	stock	NN
10_1101-2021_01_07_425723	244	2	cultures	culture	NNS
10_1101-2021_01_07_425723	244	3	of	of	IN
10_1101-2021_01_07_425723	244	4	S.	S.	NNP
10_1101-2021_01_07_425723	244	5	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	244	6	were	be	VBD
10_1101-2021_01_07_425723	244	7	grown	grow	VBN
10_1101-2021_01_07_425723	244	8	at	at	IN
10_1101-2021_01_07_425723	244	9	30	30	CD
10_1101-2021_01_07_425723	244	10	°	°	,
10_1101-2021_01_07_425723	244	11	C	C	NNP
10_1101-2021_01_07_425723	244	12	in	in	IN
10_1101-2021_01_07_425723	244	13	an	an	DT
10_1101-2021_01_07_425723	244	14	orbital	orbital	JJ
10_1101-2021_01_07_425723	244	15	shaker	shaker	NN
10_1101-2021_01_07_425723	244	16	set	set	VBN
10_1101-2021_01_07_425723	244	17	at	at	IN
10_1101-2021_01_07_425723	244	18	200	200	CD
10_1101-2021_01_07_425723	244	19	rpm	rpm	NN
10_1101-2021_01_07_425723	244	20	,	,	,
10_1101-2021_01_07_425723	244	21	in	in	IN
10_1101-2021_01_07_425723	244	22	361	361	CD
10_1101-2021_01_07_425723	244	23	500	500	CD
10_1101-2021_01_07_425723	244	24	mL	mL	NNP
10_1101-2021_01_07_425723	244	25	shake	shake	VBP
10_1101-2021_01_07_425723	244	26	flasks	flask	NNS
10_1101-2021_01_07_425723	244	27	containing	contain	VBG
10_1101-2021_01_07_425723	244	28	100	100	CD
10_1101-2021_01_07_425723	244	29	mL	mL	NNP
10_1101-2021_01_07_425723	244	30	YPD	YPD	NNP
10_1101-2021_01_07_425723	244	31	(	(	-LRB-
10_1101-2021_01_07_425723	244	32	10	10	CD
10_1101-2021_01_07_425723	244	33	g·L-1	g·l-1	CD
10_1101-2021_01_07_425723	244	34	Bacto	Bacto	NNP
10_1101-2021_01_07_425723	244	35	yeast	yeast	NN
10_1101-2021_01_07_425723	244	36	extract	extract	NN
10_1101-2021_01_07_425723	244	37	,	,	,
10_1101-2021_01_07_425723	244	38	20	20	CD
10_1101-2021_01_07_425723	244	39	g·L-1	g·l-1	CD
10_1101-2021_01_07_425723	244	40	Bacto	Bacto	NNP
10_1101-2021_01_07_425723	244	41	peptone	peptone	NN
10_1101-2021_01_07_425723	244	42	,	,	,
10_1101-2021_01_07_425723	244	43	20	20	CD
10_1101-2021_01_07_425723	244	44	g·L-1	g·L-1	NNP
10_1101-2021_01_07_425723	244	45	362	362	CD
10_1101-2021_01_07_425723	244	46	glucose	glucose	NN
10_1101-2021_01_07_425723	244	47	)	)	-RRB-
10_1101-2021_01_07_425723	244	48	.	.	.
10_1101-2021_01_07_425723	245	1	For	for	IN
10_1101-2021_01_07_425723	245	2	cultures	culture	NNS
10_1101-2021_01_07_425723	245	3	of	of	IN
10_1101-2021_01_07_425723	245	4	K.	K.	NNP
10_1101-2021_01_07_425723	245	5	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	245	6	,	,	,
10_1101-2021_01_07_425723	245	7	the	the	DT
10_1101-2021_01_07_425723	245	8	glucose	glucose	NNP
10_1101-2021_01_07_425723	245	9	concentration	concentration	NN
10_1101-2021_01_07_425723	245	10	was	be	VBD
10_1101-2021_01_07_425723	245	11	reduced	reduce	VBN
10_1101-2021_01_07_425723	245	12	to	to	IN
10_1101-2021_01_07_425723	245	13	7.5	7.5	CD
10_1101-2021_01_07_425723	245	14	g·L-1	g·L-1	NNP
10_1101-2021_01_07_425723	245	15	.	.	.
10_1101-2021_01_07_425723	246	1	After	after	IN
10_1101-2021_01_07_425723	246	2	addition	addition	NN
10_1101-2021_01_07_425723	246	3	363	363	CD
10_1101-2021_01_07_425723	246	4	of	of	IN
10_1101-2021_01_07_425723	246	5	glycerol	glycerol	NN
10_1101-2021_01_07_425723	246	6	to	to	IN
10_1101-2021_01_07_425723	246	7	early	early	JJ
10_1101-2021_01_07_425723	246	8	stationary	stationary	JJ
10_1101-2021_01_07_425723	246	9	-	-	HYPH
10_1101-2021_01_07_425723	246	10	phase	phase	NN
10_1101-2021_01_07_425723	246	11	cultures	culture	NNS
10_1101-2021_01_07_425723	246	12	,	,	,
10_1101-2021_01_07_425723	246	13	to	to	IN
10_1101-2021_01_07_425723	246	14	a	a	DT
10_1101-2021_01_07_425723	246	15	concentration	concentration	NN
10_1101-2021_01_07_425723	246	16	of	of	IN
10_1101-2021_01_07_425723	246	17	30	30	CD
10_1101-2021_01_07_425723	246	18	%	%	NN
10_1101-2021_01_07_425723	246	19	(	(	-LRB-
10_1101-2021_01_07_425723	246	20	v	v	NN
10_1101-2021_01_07_425723	246	21	/	/	SYM
10_1101-2021_01_07_425723	246	22	v	v	NNP
10_1101-2021_01_07_425723	246	23	)	)	-RRB-
10_1101-2021_01_07_425723	246	24	,	,	,
10_1101-2021_01_07_425723	246	25	2	2	CD
10_1101-2021_01_07_425723	246	26	mL	mL	NNP
10_1101-2021_01_07_425723	246	27	aliquots	aliquot	NNS
10_1101-2021_01_07_425723	246	28	were	be	VBD
10_1101-2021_01_07_425723	246	29	stored	store	VBN
10_1101-2021_01_07_425723	246	30	364	364	CD
10_1101-2021_01_07_425723	246	31	at	at	IN
10_1101-2021_01_07_425723	246	32	-80	-80	NNP
10_1101-2021_01_07_425723	246	33	°	°	NNP
10_1101-2021_01_07_425723	246	34	C	C	NNP
10_1101-2021_01_07_425723	246	35	.	.	.
10_1101-2021_01_07_425723	247	1	Shake	shake	NN
10_1101-2021_01_07_425723	247	2	-	-	HYPH
10_1101-2021_01_07_425723	247	3	flask	flask	NN
10_1101-2021_01_07_425723	247	4	precultures	preculture	NNS
10_1101-2021_01_07_425723	247	5	for	for	IN
10_1101-2021_01_07_425723	247	6	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	247	7	experiments	experiment	NNS
10_1101-2021_01_07_425723	247	8	were	be	VBD
10_1101-2021_01_07_425723	247	9	grown	grow	VBN
10_1101-2021_01_07_425723	247	10	in	in	IN
10_1101-2021_01_07_425723	247	11	100	100	CD
10_1101-2021_01_07_425723	247	12	mL	mL	NNP
10_1101-2021_01_07_425723	247	13	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	247	14	medium	medium	NN
10_1101-2021_01_07_425723	247	15	365	365	CD
10_1101-2021_01_07_425723	247	16	(	(	-LRB-
10_1101-2021_01_07_425723	247	17	SM	SM	NNP
10_1101-2021_01_07_425723	247	18	)	)	-RRB-
10_1101-2021_01_07_425723	247	19	with	with	IN
10_1101-2021_01_07_425723	247	20	glucose	glucose	NN
10_1101-2021_01_07_425723	247	21	as	as	IN
10_1101-2021_01_07_425723	247	22	carbon	carbon	NN
10_1101-2021_01_07_425723	247	23	source	source	NN
10_1101-2021_01_07_425723	247	24	and	and	CC
10_1101-2021_01_07_425723	247	25	urea	urea	NNP
10_1101-2021_01_07_425723	247	26	as	as	IN
10_1101-2021_01_07_425723	247	27	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	247	28	source	source	NN
10_1101-2021_01_07_425723	247	29	(	(	-LRB-
10_1101-2021_01_07_425723	247	30	SMG	smg	NN
10_1101-2021_01_07_425723	247	31	-	-	HYPH
10_1101-2021_01_07_425723	247	32	urea)17,59	urea)17,59	NNP
10_1101-2021_01_07_425723	247	33	.	.	.
10_1101-2021_01_07_425723	248	1	For	for	IN
10_1101-2021_01_07_425723	248	2	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	248	3	366	366	CD
10_1101-2021_01_07_425723	248	4	cultivation	cultivation	NN
10_1101-2021_01_07_425723	248	5	,	,	,
10_1101-2021_01_07_425723	248	6	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	248	7	medium	medium	NN
10_1101-2021_01_07_425723	248	8	was	be	VBD
10_1101-2021_01_07_425723	248	9	supplemented	supplement	VBN
10_1101-2021_01_07_425723	248	10	with	with	IN
10_1101-2021_01_07_425723	248	11	ergosterol	ergosterol	NN
10_1101-2021_01_07_425723	248	12	(	(	-LRB-
10_1101-2021_01_07_425723	248	13	10	10	CD
10_1101-2021_01_07_425723	248	14	mg·L-1	mg·l-1	NN
10_1101-2021_01_07_425723	248	15	)	)	-RRB-
10_1101-2021_01_07_425723	248	16	and	and	CC
10_1101-2021_01_07_425723	248	17	Tween	Tween	NNP
10_1101-2021_01_07_425723	248	18	80	80	CD
10_1101-2021_01_07_425723	248	19	(	(	-LRB-
10_1101-2021_01_07_425723	248	20	420	420	CD
10_1101-2021_01_07_425723	248	21	mg·L-1	mg·l-1	NN
10_1101-2021_01_07_425723	248	22	)	)	-RRB-
10_1101-2021_01_07_425723	248	23	367	367	CD
10_1101-2021_01_07_425723	248	24	as	as	IN
10_1101-2021_01_07_425723	248	25	described	describe	VBN
10_1101-2021_01_07_425723	248	26	previously14,17,19	previously14,17,19	NN
10_1101-2021_01_07_425723	248	27	.	.	.
10_1101-2021_01_07_425723	249	1	368	368	CD
10_1101-2021_01_07_425723	249	2	Expression	expression	NN
10_1101-2021_01_07_425723	249	3	cassette	cassette	NN
10_1101-2021_01_07_425723	249	4	and	and	CC
10_1101-2021_01_07_425723	249	5	plasmid	plasmid	NN
10_1101-2021_01_07_425723	249	6	construction	construction	NN
10_1101-2021_01_07_425723	249	7	369	369	CD
10_1101-2021_01_07_425723	249	8	Plasmids	Plasmids	NNPS
10_1101-2021_01_07_425723	249	9	used	use	VBN
10_1101-2021_01_07_425723	249	10	in	in	IN
10_1101-2021_01_07_425723	249	11	this	this	DT
10_1101-2021_01_07_425723	249	12	study	study	NN
10_1101-2021_01_07_425723	249	13	are	be	VBP
10_1101-2021_01_07_425723	249	14	described	describe	VBN
10_1101-2021_01_07_425723	249	15	in	in	IN
10_1101-2021_01_07_425723	249	16	(	(	-LRB-
10_1101-2021_01_07_425723	249	17	Table	table	NN
10_1101-2021_01_07_425723	249	18	4	4	CD
10_1101-2021_01_07_425723	249	19	)	)	-RRB-
10_1101-2021_01_07_425723	249	20	.	.	.
10_1101-2021_01_07_425723	250	1	To	to	TO
10_1101-2021_01_07_425723	250	2	construct	construct	VB
10_1101-2021_01_07_425723	250	3	plasmids	plasmids	NNP
10_1101-2021_01_07_425723	250	4	pUDE659	pUDE659	NNP
10_1101-2021_01_07_425723	250	5	(	(	-LRB-
10_1101-2021_01_07_425723	250	6	gRNAAUS1	grnaaus1	NN
10_1101-2021_01_07_425723	250	7	)	)	-RRB-
10_1101-2021_01_07_425723	250	8	and	and	CC
10_1101-2021_01_07_425723	250	9	370	370	CD
10_1101-2021_01_07_425723	250	10	pUDE663	pUDE663	NNS
10_1101-2021_01_07_425723	250	11	(	(	-LRB-
10_1101-2021_01_07_425723	250	12	gRNAPDR11	gRNAPDR11	NNP
10_1101-2021_01_07_425723	250	13	)	)	-RRB-
10_1101-2021_01_07_425723	250	14	,	,	,
10_1101-2021_01_07_425723	250	15	the	the	DT
10_1101-2021_01_07_425723	250	16	pROS11	pROS11	NNP
10_1101-2021_01_07_425723	250	17	plasmid	plasmid	NN
10_1101-2021_01_07_425723	250	18	-	-	HYPH
10_1101-2021_01_07_425723	250	19	backbone	backbone	NN
10_1101-2021_01_07_425723	250	20	was	be	VBD
10_1101-2021_01_07_425723	250	21	PCR	PCR	NNP
10_1101-2021_01_07_425723	250	22	amplified	amplify	VBD
10_1101-2021_01_07_425723	250	23	using	use	VBG
10_1101-2021_01_07_425723	250	24	Phusion	Phusion	NNP
10_1101-2021_01_07_425723	250	25	HF	HF	NNP
10_1101-2021_01_07_425723	250	26	polymerase	polymerase	NN
10_1101-2021_01_07_425723	250	27	371	371	CD
10_1101-2021_01_07_425723	250	28	(	(	-LRB-
10_1101-2021_01_07_425723	250	29	Thermo	Thermo	NNP
10_1101-2021_01_07_425723	250	30	Scientific	Scientific	NNP
10_1101-2021_01_07_425723	250	31	,	,	,
10_1101-2021_01_07_425723	250	32	Waltham	Waltham	NNP
10_1101-2021_01_07_425723	250	33	,	,	,
10_1101-2021_01_07_425723	250	34	MA	MA	NNP
10_1101-2021_01_07_425723	250	35	)	)	-RRB-
10_1101-2021_01_07_425723	250	36	with	with	IN
10_1101-2021_01_07_425723	250	37	the	the	DT
10_1101-2021_01_07_425723	250	38	double	double	RB
10_1101-2021_01_07_425723	250	39	-	-	HYPH
10_1101-2021_01_07_425723	250	40	binding	bind	VBG
10_1101-2021_01_07_425723	250	41	primer	primer	NN
10_1101-2021_01_07_425723	250	42	6005	6005	CD
10_1101-2021_01_07_425723	250	43	.	.	.
10_1101-2021_01_07_425723	251	1	PCR	PCR	NNP
10_1101-2021_01_07_425723	251	2	amplifications	amplification	NNS
10_1101-2021_01_07_425723	251	3	were	be	VBD
10_1101-2021_01_07_425723	251	4	372	372	CD
10_1101-2021_01_07_425723	251	5	performed	perform	VBN
10_1101-2021_01_07_425723	251	6	with	with	IN
10_1101-2021_01_07_425723	251	7	desalted	desalt	VBN
10_1101-2021_01_07_425723	251	8	or	or	CC
10_1101-2021_01_07_425723	251	9	PAGE	page	NN
10_1101-2021_01_07_425723	251	10	-	-	HYPH
10_1101-2021_01_07_425723	251	11	purified	purify	VBN
10_1101-2021_01_07_425723	251	12	oligonucleotide	oligonucleotide	JJ
10_1101-2021_01_07_425723	251	13	primers	primer	NNS
10_1101-2021_01_07_425723	251	14	(	(	-LRB-
10_1101-2021_01_07_425723	251	15	Sigma	Sigma	NNP
10_1101-2021_01_07_425723	251	16	-	-	HYPH
10_1101-2021_01_07_425723	251	17	Aldrich	Aldrich	NNP
10_1101-2021_01_07_425723	251	18	,	,	,
10_1101-2021_01_07_425723	251	19	St	St	NNP
10_1101-2021_01_07_425723	251	20	Louis	Louis	NNP
10_1101-2021_01_07_425723	251	21	,	,	,
10_1101-2021_01_07_425723	251	22	MO	MO	NNP
10_1101-2021_01_07_425723	251	23	)	)	-RRB-
10_1101-2021_01_07_425723	251	24	373	373	CD
10_1101-2021_01_07_425723	251	25	according	accord	VBG
10_1101-2021_01_07_425723	251	26	to	to	IN
10_1101-2021_01_07_425723	251	27	manufacturer	manufacturer	NN
10_1101-2021_01_07_425723	251	28	’s	’s	POS
10_1101-2021_01_07_425723	251	29	instructions	instruction	NNS
10_1101-2021_01_07_425723	251	30	.	.	.
10_1101-2021_01_07_425723	252	1	To	to	TO
10_1101-2021_01_07_425723	252	2	introduce	introduce	VB
10_1101-2021_01_07_425723	252	3	the	the	DT
10_1101-2021_01_07_425723	252	4	gRNA	grna	NN
10_1101-2021_01_07_425723	252	5	-	-	HYPH
10_1101-2021_01_07_425723	252	6	encoding	encode	VBG
10_1101-2021_01_07_425723	252	7	nucleotide	nucleotide	JJ
10_1101-2021_01_07_425723	252	8	sequences	sequence	NNS
10_1101-2021_01_07_425723	252	9	into	into	IN
10_1101-2021_01_07_425723	252	10	374	374	CD
10_1101-2021_01_07_425723	252	11	gRNA	grna	CD
10_1101-2021_01_07_425723	252	12	-	-	HYPH
10_1101-2021_01_07_425723	252	13	expression	expression	NN
10_1101-2021_01_07_425723	252	14	plasmids	plasmid	NNS
10_1101-2021_01_07_425723	252	15	,	,	,
10_1101-2021_01_07_425723	252	16	a	a	DT
10_1101-2021_01_07_425723	252	17	2μm	2μm	JJ
10_1101-2021_01_07_425723	252	18	fragment	fragment	NN
10_1101-2021_01_07_425723	252	19	was	be	VBD
10_1101-2021_01_07_425723	252	20	first	first	RB
10_1101-2021_01_07_425723	252	21	amplified	amplify	VBN
10_1101-2021_01_07_425723	252	22	with	with	IN
10_1101-2021_01_07_425723	252	23	primers	primer	NNS
10_1101-2021_01_07_425723	252	24	11228	11228	CD
10_1101-2021_01_07_425723	252	25	and	and	CC
10_1101-2021_01_07_425723	252	26	11232	11232	CD
10_1101-2021_01_07_425723	252	27	375	375	CD
10_1101-2021_01_07_425723	252	28	containing	contain	VBG
10_1101-2021_01_07_425723	252	29	the	the	DT
10_1101-2021_01_07_425723	252	30	specific	specific	JJ
10_1101-2021_01_07_425723	252	31	sequence	sequence	NN
10_1101-2021_01_07_425723	252	32	as	as	IN
10_1101-2021_01_07_425723	252	33	primer	primer	NNP
10_1101-2021_01_07_425723	252	34	overhang	overhang	NN
10_1101-2021_01_07_425723	252	35	using	use	VBG
10_1101-2021_01_07_425723	252	36	pROS11	pROS11	NNP
10_1101-2021_01_07_425723	252	37	as	as	IN
10_1101-2021_01_07_425723	252	38	template	template	NN
10_1101-2021_01_07_425723	252	39	.	.	.
10_1101-2021_01_07_425723	253	1	PCR	PCR	NNP
10_1101-2021_01_07_425723	253	2	products	product	NNS
10_1101-2021_01_07_425723	253	3	were	be	VBD
10_1101-2021_01_07_425723	253	4	376	376	CD
10_1101-2021_01_07_425723	253	5	purified	purify	VBN
10_1101-2021_01_07_425723	253	6	with	with	IN
10_1101-2021_01_07_425723	253	7	genElutePCR	genElutePCR	NNP
10_1101-2021_01_07_425723	253	8	Clean	Clean	NNP
10_1101-2021_01_07_425723	253	9	-	-	HYPH
10_1101-2021_01_07_425723	253	10	Up	up	RP
10_1101-2021_01_07_425723	253	11	Kit	kit	NN
10_1101-2021_01_07_425723	253	12	(	(	-LRB-
10_1101-2021_01_07_425723	253	13	Sigma	Sigma	NNP
10_1101-2021_01_07_425723	253	14	-	-	HYPH
10_1101-2021_01_07_425723	253	15	Aldrich	Aldrich	NNP
10_1101-2021_01_07_425723	253	16	)	)	-RRB-
10_1101-2021_01_07_425723	253	17	or	or	CC
10_1101-2021_01_07_425723	253	18	Gel	Gel	NNP
10_1101-2021_01_07_425723	253	19	DNA	DNA	NNP
10_1101-2021_01_07_425723	253	20	Recovery	Recovery	NNP
10_1101-2021_01_07_425723	253	21	Kit	Kit	NNP
10_1101-2021_01_07_425723	253	22	(	(	-LRB-
10_1101-2021_01_07_425723	253	23	Zymo	Zymo	NNP
10_1101-2021_01_07_425723	253	24	Research	Research	NNP
10_1101-2021_01_07_425723	253	25	,	,	,
10_1101-2021_01_07_425723	253	26	Irvine	Irvine	NNP
10_1101-2021_01_07_425723	253	27	,	,	,
10_1101-2021_01_07_425723	253	28	377	377	CD
10_1101-2021_01_07_425723	253	29	.CC	.CC	NFP
10_1101-2021_01_07_425723	253	30	-	-	HYPH
10_1101-2021_01_07_425723	253	31	BY	by	IN
10_1101-2021_01_07_425723	253	32	-	-	HYPH
10_1101-2021_01_07_425723	253	33	NC	NC	NNP
10_1101-2021_01_07_425723	253	34	-	-	HYPH
10_1101-2021_01_07_425723	253	35	ND	ND	NNP
10_1101-2021_01_07_425723	253	36	4.0	4.0	CD
10_1101-2021_01_07_425723	253	37	International	International	NNP
10_1101-2021_01_07_425723	253	38	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	253	39	under	under	IN
10_1101-2021_01_07_425723	253	40	a	a	DT
10_1101-2021_01_07_425723	253	41	(	(	-LRB-
10_1101-2021_01_07_425723	253	42	which	which	WDT
10_1101-2021_01_07_425723	253	43	was	be	VBD
10_1101-2021_01_07_425723	253	44	not	not	RB
10_1101-2021_01_07_425723	253	45	certified	certify	VBN
10_1101-2021_01_07_425723	253	46	by	by	IN
10_1101-2021_01_07_425723	253	47	peer	peer	NN
10_1101-2021_01_07_425723	253	48	review	review	NN
10_1101-2021_01_07_425723	253	49	)	)	-RRB-
10_1101-2021_01_07_425723	253	50	is	be	VBZ
10_1101-2021_01_07_425723	253	51	the	the	DT
10_1101-2021_01_07_425723	253	52	author	author	NN
10_1101-2021_01_07_425723	253	53	/	/	SYM
10_1101-2021_01_07_425723	253	54	funder	funder	NN
10_1101-2021_01_07_425723	253	55	,	,	,
10_1101-2021_01_07_425723	253	56	who	who	WP
10_1101-2021_01_07_425723	253	57	has	have	VBZ
10_1101-2021_01_07_425723	253	58	granted	grant	VBN
10_1101-2021_01_07_425723	253	59	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	253	60	a	a	DT
10_1101-2021_01_07_425723	253	61	license	license	NN
10_1101-2021_01_07_425723	253	62	to	to	TO
10_1101-2021_01_07_425723	253	63	display	display	VB
10_1101-2021_01_07_425723	253	64	the	the	DT
10_1101-2021_01_07_425723	253	65	preprint	preprint	NN
10_1101-2021_01_07_425723	253	66	in	in	IN
10_1101-2021_01_07_425723	253	67	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	253	68	.	.	.
10_1101-2021_01_07_425723	254	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	254	2	is	be	VBZ
10_1101-2021_01_07_425723	254	3	made	make	VBN
10_1101-2021_01_07_425723	254	4	The	the	DT
10_1101-2021_01_07_425723	254	5	copyright	copyright	NN
10_1101-2021_01_07_425723	254	6	holder	holder	NN
10_1101-2021_01_07_425723	254	7	for	for	IN
10_1101-2021_01_07_425723	254	8	this	this	DT
10_1101-2021_01_07_425723	254	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	254	10	version	version	NN
10_1101-2021_01_07_425723	254	11	posted	post	VBD
10_1101-2021_01_07_425723	254	12	January	January	NNP
10_1101-2021_01_07_425723	254	13	8	8	CD
10_1101-2021_01_07_425723	254	14	,	,	,
10_1101-2021_01_07_425723	254	15	2021	2021	CD
10_1101-2021_01_07_425723	254	16	.	.	.
10_1101-2021_01_07_425723	254	17	;	;	:
10_1101-2021_01_07_425723	254	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	254	19	:	:	:
10_1101-2021_01_07_425723	254	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	254	21	preprint	preprint	NN
10_1101-2021_01_07_425723	254	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	254	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	254	24	23	23	CD
10_1101-2021_01_07_425723	254	25	CA	CA	NNP
10_1101-2021_01_07_425723	254	26	)	)	-RRB-
10_1101-2021_01_07_425723	254	27	.	.	.
10_1101-2021_01_07_425723	255	1	The	the	DT
10_1101-2021_01_07_425723	255	2	two	two	CD
10_1101-2021_01_07_425723	255	3	DNA	DNA	NNP
10_1101-2021_01_07_425723	255	4	fragments	fragment	NNS
10_1101-2021_01_07_425723	255	5	were	be	VBD
10_1101-2021_01_07_425723	255	6	then	then	RB
10_1101-2021_01_07_425723	255	7	assembled	assemble	VBN
10_1101-2021_01_07_425723	255	8	by	by	IN
10_1101-2021_01_07_425723	255	9	Gibson	Gibson	NNP
10_1101-2021_01_07_425723	255	10	Assembly	Assembly	NNP
10_1101-2021_01_07_425723	255	11	(	(	-LRB-
10_1101-2021_01_07_425723	255	12	New	New	NNP
10_1101-2021_01_07_425723	255	13	England	England	NNP
10_1101-2021_01_07_425723	255	14	Biolabs	Biolabs	NNP
10_1101-2021_01_07_425723	255	15	,	,	,
10_1101-2021_01_07_425723	255	16	Ipswich	Ipswich	NNP
10_1101-2021_01_07_425723	255	17	,	,	,
10_1101-2021_01_07_425723	255	18	378	378	CD
10_1101-2021_01_07_425723	255	19	MA	MA	NNP
10_1101-2021_01_07_425723	255	20	)	)	-RRB-
10_1101-2021_01_07_425723	255	21	according	accord	VBG
10_1101-2021_01_07_425723	255	22	to	to	IN
10_1101-2021_01_07_425723	255	23	the	the	DT
10_1101-2021_01_07_425723	255	24	manufacturer	manufacturer	NN
10_1101-2021_01_07_425723	255	25	’s	’s	POS
10_1101-2021_01_07_425723	255	26	instructions	instruction	NNS
10_1101-2021_01_07_425723	255	27	.	.	.
10_1101-2021_01_07_425723	256	1	Gibson	Gibson	NNP
10_1101-2021_01_07_425723	256	2	assembly	assembly	NN
10_1101-2021_01_07_425723	256	3	reaction	reaction	NN
10_1101-2021_01_07_425723	256	4	volumes	volume	NNS
10_1101-2021_01_07_425723	256	5	were	be	VBD
10_1101-2021_01_07_425723	256	6	downscaled	downscale	VBN
10_1101-2021_01_07_425723	256	7	379	379	CD
10_1101-2021_01_07_425723	256	8	to	to	TO
10_1101-2021_01_07_425723	256	9	10	10	CD
10_1101-2021_01_07_425723	256	10	µL	µl	CD
10_1101-2021_01_07_425723	256	11	and	and	CC
10_1101-2021_01_07_425723	256	12	0.01	0.01	CD
10_1101-2021_01_07_425723	256	13	pmol·µL-1	pmol·µL-1	NNS
10_1101-2021_01_07_425723	256	14	DNA	DNA	NNP
10_1101-2021_01_07_425723	256	15	fragments	fragment	NNS
10_1101-2021_01_07_425723	256	16	at	at	IN
10_1101-2021_01_07_425723	256	17	1:1	1:1	CD
10_1101-2021_01_07_425723	256	18	molar	molar	JJ
10_1101-2021_01_07_425723	256	19	ratio	ratio	NN
10_1101-2021_01_07_425723	256	20	for	for	IN
10_1101-2021_01_07_425723	256	21	1	1	CD
10_1101-2021_01_07_425723	256	22	h	h	NN
10_1101-2021_01_07_425723	256	23	at	at	IN
10_1101-2021_01_07_425723	256	24	50	50	CD
10_1101-2021_01_07_425723	256	25	°	°	NNS
10_1101-2021_01_07_425723	256	26	C	C	NNP
10_1101-2021_01_07_425723	256	27	.	.	.
10_1101-2021_01_07_425723	257	1	Chemically	chemically	RB
10_1101-2021_01_07_425723	257	2	competent	competent	JJ
10_1101-2021_01_07_425723	257	3	E.	e.	NN
10_1101-2021_01_07_425723	257	4	380	380	CD
10_1101-2021_01_07_425723	257	5	coli	coli	NNS
10_1101-2021_01_07_425723	257	6	XL1-Blue	XL1-Blue	NNP
10_1101-2021_01_07_425723	257	7	was	be	VBD
10_1101-2021_01_07_425723	257	8	transformed	transform	VBN
10_1101-2021_01_07_425723	257	9	with	with	IN
10_1101-2021_01_07_425723	257	10	the	the	DT
10_1101-2021_01_07_425723	257	11	Gibson	Gibson	NNP
10_1101-2021_01_07_425723	257	12	assembly	assembly	NN
10_1101-2021_01_07_425723	257	13	mix	mix	NN
10_1101-2021_01_07_425723	257	14	via	via	IN
10_1101-2021_01_07_425723	257	15	a	a	DT
10_1101-2021_01_07_425723	257	16	5	5	CD
10_1101-2021_01_07_425723	257	17	min	min	NN
10_1101-2021_01_07_425723	257	18	incubation	incubation	NN
10_1101-2021_01_07_425723	257	19	on	on	IN
10_1101-2021_01_07_425723	257	20	ice	ice	NN
10_1101-2021_01_07_425723	257	21	followed	follow	VBN
10_1101-2021_01_07_425723	257	22	by	by	IN
10_1101-2021_01_07_425723	257	23	a	a	DT
10_1101-2021_01_07_425723	257	24	381	381	CD
10_1101-2021_01_07_425723	257	25	40	40	CD
10_1101-2021_01_07_425723	257	26	s	s	POS
10_1101-2021_01_07_425723	257	27	heat	heat	NN
10_1101-2021_01_07_425723	257	28	shock	shock	NN
10_1101-2021_01_07_425723	257	29	at	at	IN
10_1101-2021_01_07_425723	257	30	42	42	CD
10_1101-2021_01_07_425723	257	31	°	°	NNS
10_1101-2021_01_07_425723	257	32	C	C	NNP
10_1101-2021_01_07_425723	257	33	and	and	CC
10_1101-2021_01_07_425723	257	34	1	1	CD
10_1101-2021_01_07_425723	257	35	h	h	NN
10_1101-2021_01_07_425723	257	36	recovery	recovery	NN
10_1101-2021_01_07_425723	257	37	in	in	IN
10_1101-2021_01_07_425723	257	38	non	non	JJ
10_1101-2021_01_07_425723	257	39	-	-	JJ
10_1101-2021_01_07_425723	257	40	selective	selective	JJ
10_1101-2021_01_07_425723	257	41	LB	LB	NNP
10_1101-2021_01_07_425723	257	42	medium	medium	NN
10_1101-2021_01_07_425723	257	43	.	.	.
10_1101-2021_01_07_425723	258	1	Transformants	transformant	NNS
10_1101-2021_01_07_425723	258	2	were	be	VBD
10_1101-2021_01_07_425723	258	3	selected	select	VBN
10_1101-2021_01_07_425723	258	4	on	on	IN
10_1101-2021_01_07_425723	258	5	382	382	CD
10_1101-2021_01_07_425723	258	6	LB	LB	NNP
10_1101-2021_01_07_425723	258	7	agar	agar	NN
10_1101-2021_01_07_425723	258	8	containing	contain	VBG
10_1101-2021_01_07_425723	258	9	the	the	DT
10_1101-2021_01_07_425723	258	10	appropriate	appropriate	JJ
10_1101-2021_01_07_425723	258	11	antibiotic	antibiotic	NN
10_1101-2021_01_07_425723	258	12	.	.	.
10_1101-2021_01_07_425723	259	1	Golden	Golden	NNP
10_1101-2021_01_07_425723	259	2	Gate	Gate	NNP
10_1101-2021_01_07_425723	259	3	assembly	assembly	NN
10_1101-2021_01_07_425723	259	4	with	with	IN
10_1101-2021_01_07_425723	259	5	the	the	DT
10_1101-2021_01_07_425723	259	6	yeast	yeast	NN
10_1101-2021_01_07_425723	259	7	tool	tool	NN
10_1101-2021_01_07_425723	259	8	kit60	kit60	NNS
10_1101-2021_01_07_425723	259	9	was	be	VBD
10_1101-2021_01_07_425723	259	10	383	383	CD
10_1101-2021_01_07_425723	259	11	performed	perform	VBN
10_1101-2021_01_07_425723	259	12	in	in	IN
10_1101-2021_01_07_425723	259	13	20	20	CD
10_1101-2021_01_07_425723	259	14	µL	µL	NNP
10_1101-2021_01_07_425723	259	15	reaction	reaction	NN
10_1101-2021_01_07_425723	259	16	mixtures	mixture	NNS
10_1101-2021_01_07_425723	259	17	containing	contain	VBG
10_1101-2021_01_07_425723	259	18	0.75	0.75	CD
10_1101-2021_01_07_425723	259	19	µL	µL	.
10_1101-2021_01_07_425723	259	20	BsaI	BsaI	NNP
10_1101-2021_01_07_425723	259	21	HF	HF	NNP
10_1101-2021_01_07_425723	259	22	V2	V2	NNP
10_1101-2021_01_07_425723	259	23	(	(	-LRB-
10_1101-2021_01_07_425723	259	24	NEB	NEB	NNP
10_1101-2021_01_07_425723	259	25	,	,	,
10_1101-2021_01_07_425723	259	26	#	#	NNP
10_1101-2021_01_07_425723	259	27	R3733	R3733	NNP
10_1101-2021_01_07_425723	259	28	)	)	-RRB-
10_1101-2021_01_07_425723	259	29	,	,	,
10_1101-2021_01_07_425723	259	30	2	2	CD
10_1101-2021_01_07_425723	259	31	µL	µL	NNP
10_1101-2021_01_07_425723	259	32	DNA	DNA	NNP
10_1101-2021_01_07_425723	259	33	ligase	ligase	NN
10_1101-2021_01_07_425723	259	34	384	384	CD
10_1101-2021_01_07_425723	259	35	buffer	buffer	NN
10_1101-2021_01_07_425723	259	36	with	with	IN
10_1101-2021_01_07_425723	259	37	ATP	ATP	NNP
10_1101-2021_01_07_425723	259	38	(	(	-LRB-
10_1101-2021_01_07_425723	259	39	New	New	NNP
10_1101-2021_01_07_425723	259	40	England	England	NNP
10_1101-2021_01_07_425723	259	41	Biolabs	Biolabs	NNP
10_1101-2021_01_07_425723	259	42	)	)	-RRB-
10_1101-2021_01_07_425723	259	43	,	,	,
10_1101-2021_01_07_425723	259	44	0.5	0.5	CD
10_1101-2021_01_07_425723	259	45	µL	µL	NNP
10_1101-2021_01_07_425723	259	46	T7-ligase	T7-ligase	NNP
10_1101-2021_01_07_425723	259	47	(	(	-LRB-
10_1101-2021_01_07_425723	259	48	NEB	NEB	NNP
10_1101-2021_01_07_425723	259	49	)	)	-RRB-
10_1101-2021_01_07_425723	259	50	with	with	IN
10_1101-2021_01_07_425723	259	51	20	20	CD
10_1101-2021_01_07_425723	259	52	fmol	fmol	JJ
10_1101-2021_01_07_425723	259	53	DNA	dna	NN
10_1101-2021_01_07_425723	259	54	donor	donor	NN
10_1101-2021_01_07_425723	259	55	fragments	fragment	NNS
10_1101-2021_01_07_425723	259	56	and	and	CC
10_1101-2021_01_07_425723	259	57	385	385	CD
10_1101-2021_01_07_425723	259	58	MilliQ	milliq	NN
10_1101-2021_01_07_425723	259	59	water	water	NN
10_1101-2021_01_07_425723	259	60	.	.	.
10_1101-2021_01_07_425723	260	1	Before	before	IN
10_1101-2021_01_07_425723	260	2	ligation	ligation	NN
10_1101-2021_01_07_425723	260	3	at	at	IN
10_1101-2021_01_07_425723	260	4	16	16	CD
10_1101-2021_01_07_425723	260	5	°	°	NNS
10_1101-2021_01_07_425723	260	6	C	C	NNP
10_1101-2021_01_07_425723	260	7	was	be	VBD
10_1101-2021_01_07_425723	260	8	initiated	initiate	VBN
10_1101-2021_01_07_425723	260	9	by	by	IN
10_1101-2021_01_07_425723	260	10	addition	addition	NN
10_1101-2021_01_07_425723	260	11	of	of	IN
10_1101-2021_01_07_425723	260	12	T7	T7	NNP
10_1101-2021_01_07_425723	260	13	DNA	DNA	NNP
10_1101-2021_01_07_425723	260	14	ligase	ligase	NN
10_1101-2021_01_07_425723	260	15	,	,	,
10_1101-2021_01_07_425723	260	16	an	an	DT
10_1101-2021_01_07_425723	260	17	initial	initial	JJ
10_1101-2021_01_07_425723	260	18	BsaI	BsaI	NNP
10_1101-2021_01_07_425723	260	19	digestion	digestion	NN
10_1101-2021_01_07_425723	260	20	386	386	CD
10_1101-2021_01_07_425723	260	21	(	(	-LRB-
10_1101-2021_01_07_425723	260	22	30	30	CD
10_1101-2021_01_07_425723	260	23	min	min	NN
10_1101-2021_01_07_425723	260	24	at	at	IN
10_1101-2021_01_07_425723	260	25	37	37	CD
10_1101-2021_01_07_425723	260	26	°	°	,
10_1101-2021_01_07_425723	260	27	C	C	NNP
10_1101-2021_01_07_425723	260	28	)	)	-RRB-
10_1101-2021_01_07_425723	260	29	was	be	VBD
10_1101-2021_01_07_425723	260	30	performed	perform	VBN
10_1101-2021_01_07_425723	260	31	.	.	.
10_1101-2021_01_07_425723	261	1	Then	then	RB
10_1101-2021_01_07_425723	261	2	30	30	CD
10_1101-2021_01_07_425723	261	3	cycles	cycle	NNS
10_1101-2021_01_07_425723	261	4	of	of	IN
10_1101-2021_01_07_425723	261	5	digestion	digestion	NN
10_1101-2021_01_07_425723	261	6	and	and	CC
10_1101-2021_01_07_425723	261	7	ligation	ligation	NN
10_1101-2021_01_07_425723	261	8	at	at	IN
10_1101-2021_01_07_425723	261	9	37	37	CD
10_1101-2021_01_07_425723	261	10	°	°	NNS
10_1101-2021_01_07_425723	261	11	C	C	NNP
10_1101-2021_01_07_425723	261	12	and	and	CC
10_1101-2021_01_07_425723	261	13	16	16	CD
10_1101-2021_01_07_425723	261	14	°	°	,
10_1101-2021_01_07_425723	261	15	C	C	NNP
10_1101-2021_01_07_425723	261	16	,	,	,
10_1101-2021_01_07_425723	261	17	387	387	CD
10_1101-2021_01_07_425723	261	18	respectively	respectively	RB
10_1101-2021_01_07_425723	261	19	,	,	,
10_1101-2021_01_07_425723	261	20	were	be	VBD
10_1101-2021_01_07_425723	261	21	performed	perform	VBN
10_1101-2021_01_07_425723	261	22	,	,	,
10_1101-2021_01_07_425723	261	23	with	with	IN
10_1101-2021_01_07_425723	261	24	5	5	CD
10_1101-2021_01_07_425723	261	25	min	min	NN
10_1101-2021_01_07_425723	261	26	incubation	incubation	NN
10_1101-2021_01_07_425723	261	27	times	time	NNS
10_1101-2021_01_07_425723	261	28	for	for	IN
10_1101-2021_01_07_425723	261	29	each	each	DT
10_1101-2021_01_07_425723	261	30	reaction	reaction	NN
10_1101-2021_01_07_425723	261	31	.	.	.
10_1101-2021_01_07_425723	262	1	Thermocycling	thermocycling	NN
10_1101-2021_01_07_425723	262	2	was	be	VBD
10_1101-2021_01_07_425723	262	3	388	388	CD
10_1101-2021_01_07_425723	262	4	terminated	terminate	VBN
10_1101-2021_01_07_425723	262	5	with	with	IN
10_1101-2021_01_07_425723	262	6	a	a	DT
10_1101-2021_01_07_425723	262	7	5	5	CD
10_1101-2021_01_07_425723	262	8	min	min	NN
10_1101-2021_01_07_425723	262	9	final	final	JJ
10_1101-2021_01_07_425723	262	10	digestion	digestion	NN
10_1101-2021_01_07_425723	262	11	step	step	NN
10_1101-2021_01_07_425723	262	12	at	at	IN
10_1101-2021_01_07_425723	262	13	60	60	CD
10_1101-2021_01_07_425723	262	14	°	°	NNS
10_1101-2021_01_07_425723	262	15	C	C	NNP
10_1101-2021_01_07_425723	262	16	.	.	.
10_1101-2021_01_07_425723	263	1	389	389	CD
10_1101-2021_01_07_425723	263	2	To	to	TO
10_1101-2021_01_07_425723	263	3	construct	construct	VB
10_1101-2021_01_07_425723	263	4	a	a	DT
10_1101-2021_01_07_425723	263	5	TtSTC1	ttstc1	CD
10_1101-2021_01_07_425723	263	6	expression	expression	NN
10_1101-2021_01_07_425723	263	7	vector	vector	NN
10_1101-2021_01_07_425723	263	8	,	,	,
10_1101-2021_01_07_425723	263	9	the	the	DT
10_1101-2021_01_07_425723	263	10	coding	code	VBG
10_1101-2021_01_07_425723	263	11	sequence	sequence	NN
10_1101-2021_01_07_425723	263	12	of	of	IN
10_1101-2021_01_07_425723	263	13	TtSTC1	ttstc1	NN
10_1101-2021_01_07_425723	263	14	(	(	-LRB-
10_1101-2021_01_07_425723	263	15	pUD696	pUD696	NNP
10_1101-2021_01_07_425723	263	16	)	)	-RRB-
10_1101-2021_01_07_425723	263	17	was	be	VBD
10_1101-2021_01_07_425723	263	18	PCR	PCR	NNP
10_1101-2021_01_07_425723	263	19	amplified	amplify	VBD
10_1101-2021_01_07_425723	263	20	390	390	CD
10_1101-2021_01_07_425723	263	21	with	with	IN
10_1101-2021_01_07_425723	263	22	primer	primer	NNP
10_1101-2021_01_07_425723	263	23	pair	pair	NNP
10_1101-2021_01_07_425723	263	24	16096/16097	16096/16097	NNP
10_1101-2021_01_07_425723	263	25	and	and	CC
10_1101-2021_01_07_425723	263	26	Golden	golden	JJ
10_1101-2021_01_07_425723	263	27	gate	gate	NN
10_1101-2021_01_07_425723	263	28	assembled	assemble	VBN
10_1101-2021_01_07_425723	263	29	with	with	IN
10_1101-2021_01_07_425723	263	30	the	the	DT
10_1101-2021_01_07_425723	263	31	donor	donor	NN
10_1101-2021_01_07_425723	263	32	plasmids	plasmid	NNS
10_1101-2021_01_07_425723	263	33	pGGkd015	pggkd015	CD
10_1101-2021_01_07_425723	263	34	(	(	-LRB-
10_1101-2021_01_07_425723	263	35	ori	ori	RB
10_1101-2021_01_07_425723	263	36	391	391	CD
10_1101-2021_01_07_425723	263	37	ampR	ampr	CD
10_1101-2021_01_07_425723	263	38	)	)	-RRB-
10_1101-2021_01_07_425723	263	39	,	,	,
10_1101-2021_01_07_425723	263	40	pP2	pp2	NN
10_1101-2021_01_07_425723	263	41	(	(	-LRB-
10_1101-2021_01_07_425723	263	42	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	263	43	)	)	-RRB-
10_1101-2021_01_07_425723	263	44	,	,	,
10_1101-2021_01_07_425723	263	45	pYTK053	pytk053	NN
10_1101-2021_01_07_425723	263	46	(	(	-LRB-
10_1101-2021_01_07_425723	263	47	ScADH1	scadh1	CD
10_1101-2021_01_07_425723	263	48	t	t	NNP
10_1101-2021_01_07_425723	263	49	)	)	-RRB-
10_1101-2021_01_07_425723	263	50	resulting	result	VBG
10_1101-2021_01_07_425723	263	51	in	in	IN
10_1101-2021_01_07_425723	263	52	pUDE909	pUDE909	NNP
10_1101-2021_01_07_425723	263	53	(	(	-LRB-
10_1101-2021_01_07_425723	263	54	ori	ori	NN
10_1101-2021_01_07_425723	263	55	ampR	ampR	NNP
10_1101-2021_01_07_425723	263	56	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	263	57	-	-	HYPH
10_1101-2021_01_07_425723	263	58	TtSTC1	ttstc1	CD
10_1101-2021_01_07_425723	263	59	-	-	HYPH
10_1101-2021_01_07_425723	263	60	392	392	CD
10_1101-2021_01_07_425723	263	61	ScADH1	scadh1	CD
10_1101-2021_01_07_425723	263	62	t	t	NN
10_1101-2021_01_07_425723	263	63	)	)	-RRB-
10_1101-2021_01_07_425723	263	64	.	.	.
10_1101-2021_01_07_425723	264	1	For	for	IN
10_1101-2021_01_07_425723	264	2	integration	integration	NN
10_1101-2021_01_07_425723	264	3	of	of	IN
10_1101-2021_01_07_425723	264	4	TtSTC1	ttstc1	JJ
10_1101-2021_01_07_425723	264	5	cassette	cassette	NN
10_1101-2021_01_07_425723	264	6	into	into	IN
10_1101-2021_01_07_425723	264	7	the	the	DT
10_1101-2021_01_07_425723	264	8	lac4	lac4	NNP
10_1101-2021_01_07_425723	264	9	locus	locus	NNP
10_1101-2021_01_07_425723	264	10	both	both	DT
10_1101-2021_01_07_425723	264	11	upstream	upstream	NNP
10_1101-2021_01_07_425723	264	12	and	and	CC
10_1101-2021_01_07_425723	264	13	downstream	downstream	JJ
10_1101-2021_01_07_425723	264	14	flanks	flank	VBZ
10_1101-2021_01_07_425723	264	15	393	393	CD
10_1101-2021_01_07_425723	264	16	(	(	-LRB-
10_1101-2021_01_07_425723	264	17	877/878	877/878	NNP
10_1101-2021_01_07_425723	264	18	bps	bps	NNP
10_1101-2021_01_07_425723	264	19	)	)	-RRB-
10_1101-2021_01_07_425723	264	20	of	of	IN
10_1101-2021_01_07_425723	264	21	the	the	DT
10_1101-2021_01_07_425723	264	22	lac4	lac4	NNP
10_1101-2021_01_07_425723	264	23	locus	locus	NN
10_1101-2021_01_07_425723	264	24	were	be	VBD
10_1101-2021_01_07_425723	264	25	PCR	PCR	NNP
10_1101-2021_01_07_425723	264	26	amplified	amplify	VBN
10_1101-2021_01_07_425723	264	27	with	with	IN
10_1101-2021_01_07_425723	264	28	the	the	DT
10_1101-2021_01_07_425723	264	29	primer	primer	NNP
10_1101-2021_01_07_425723	264	30	pairs	pairs	NNP
10_1101-2021_01_07_425723	264	31	14197/14198	14197/14198	CD
10_1101-2021_01_07_425723	264	32	and	and	CC
10_1101-2021_01_07_425723	264	33	394	394	CD
10_1101-2021_01_07_425723	264	34	14199/14200	14199/14200	CD
10_1101-2021_01_07_425723	264	35	,	,	,
10_1101-2021_01_07_425723	264	36	respectively	respectively	RB
10_1101-2021_01_07_425723	264	37	.	.	.
10_1101-2021_01_07_425723	265	1	An	an	DT
10_1101-2021_01_07_425723	265	2	empty	empty	JJ
10_1101-2021_01_07_425723	265	3	integration	integration	NN
10_1101-2021_01_07_425723	265	4	vector	vector	NN
10_1101-2021_01_07_425723	265	5	,	,	,
10_1101-2021_01_07_425723	265	6	pGGKd068	pGGKd068	NNP
10_1101-2021_01_07_425723	265	7	,	,	,
10_1101-2021_01_07_425723	265	8	was	be	VBD
10_1101-2021_01_07_425723	265	9	constructed	construct	VBN
10_1101-2021_01_07_425723	265	10	by	by	IN
10_1101-2021_01_07_425723	265	11	BsaI	BsaI	NNP
10_1101-2021_01_07_425723	265	12	golden	golden	JJ
10_1101-2021_01_07_425723	265	13	395	395	CD
10_1101-2021_01_07_425723	265	14	gate	gate	NN
10_1101-2021_01_07_425723	265	15	cloning	cloning	NN
10_1101-2021_01_07_425723	265	16	of	of	IN
10_1101-2021_01_07_425723	265	17	pYTK047	pYTK047	NNP
10_1101-2021_01_07_425723	265	18	(	(	-LRB-
10_1101-2021_01_07_425723	265	19	GFP	GFP	NNP
10_1101-2021_01_07_425723	265	20	-	-	HYPH
10_1101-2021_01_07_425723	265	21	dropout	dropout	NNP
10_1101-2021_01_07_425723	265	22	)	)	-RRB-
10_1101-2021_01_07_425723	265	23	,	,	,
10_1101-2021_01_07_425723	265	24	pYTK079	pYTK079	NNP
10_1101-2021_01_07_425723	265	25	(	(	-LRB-
10_1101-2021_01_07_425723	265	26	hygB	hygB	NNP
10_1101-2021_01_07_425723	265	27	)	)	-RRB-
10_1101-2021_01_07_425723	265	28	,	,	,
10_1101-2021_01_07_425723	265	29	pYTK090	pYTK090	NNP
10_1101-2021_01_07_425723	265	30	(	(	-LRB-
10_1101-2021_01_07_425723	265	31	kanR	kanR	NNP
10_1101-2021_01_07_425723	265	32	)	)	-RRB-
10_1101-2021_01_07_425723	265	33	,	,	,
10_1101-2021_01_07_425723	265	34	pYTK073	pYTK073	NNP
10_1101-2021_01_07_425723	265	35	(	(	-LRB-
10_1101-2021_01_07_425723	265	36	ConRE	ConRE	NNP
10_1101-2021_01_07_425723	265	37	’	'	''
10_1101-2021_01_07_425723	265	38	)	)	-RRB-
10_1101-2021_01_07_425723	265	39	,	,	,
10_1101-2021_01_07_425723	265	40	pYTK008	pYTK008	NNP
10_1101-2021_01_07_425723	265	41	396	396	CD
10_1101-2021_01_07_425723	265	42	(	(	-LRB-
10_1101-2021_01_07_425723	265	43	ConLS	ConLS	NNP
10_1101-2021_01_07_425723	265	44	’	'	''
10_1101-2021_01_07_425723	265	45	)	)	-RRB-
10_1101-2021_01_07_425723	265	46	together	together	RB
10_1101-2021_01_07_425723	265	47	with	with	IN
10_1101-2021_01_07_425723	265	48	the	the	DT
10_1101-2021_01_07_425723	265	49	two	two	CD
10_1101-2021_01_07_425723	265	50	lac4	lac4	NN
10_1101-2021_01_07_425723	265	51	homologous	homologous	JJ
10_1101-2021_01_07_425723	265	52	nucleotide	nucleotide	JJ
10_1101-2021_01_07_425723	265	53	sequences	sequence	NNS
10_1101-2021_01_07_425723	265	54	.	.	.
10_1101-2021_01_07_425723	266	1	Plasmid	Plasmid	NNP
10_1101-2021_01_07_425723	266	2	assembly	assembly	NN
10_1101-2021_01_07_425723	266	3	was	be	VBD
10_1101-2021_01_07_425723	266	4	verified	verify	VBN
10_1101-2021_01_07_425723	266	5	397	397	CD
10_1101-2021_01_07_425723	266	6	by	by	IN
10_1101-2021_01_07_425723	266	7	PCR	PCR	NNP
10_1101-2021_01_07_425723	266	8	amplification	amplification	NN
10_1101-2021_01_07_425723	266	9	with	with	IN
10_1101-2021_01_07_425723	266	10	primers	primer	NNS
10_1101-2021_01_07_425723	266	11	15210	15210	CD
10_1101-2021_01_07_425723	266	12	,	,	,
10_1101-2021_01_07_425723	266	13	9335	9335	CD
10_1101-2021_01_07_425723	266	14	,	,	,
10_1101-2021_01_07_425723	266	15	16274	16274	CD
10_1101-2021_01_07_425723	266	16	and	and	CC
10_1101-2021_01_07_425723	266	17	16275	16275	CD
10_1101-2021_01_07_425723	266	18	and	and	CC
10_1101-2021_01_07_425723	266	19	by	by	IN
10_1101-2021_01_07_425723	266	20	digestion	digestion	NN
10_1101-2021_01_07_425723	266	21	with	with	IN
10_1101-2021_01_07_425723	266	22	BsmBI	BsmBI	NNP
10_1101-2021_01_07_425723	266	23	(	(	-LRB-
10_1101-2021_01_07_425723	266	24	New	New	NNP
10_1101-2021_01_07_425723	266	25	398	398	CD
10_1101-2021_01_07_425723	266	26	England	England	NNP
10_1101-2021_01_07_425723	266	27	Biolabs	Biolabs	NNP
10_1101-2021_01_07_425723	266	28	,	,	,
10_1101-2021_01_07_425723	266	29	#	#	NNP
10_1101-2021_01_07_425723	266	30	R0580	R0580	NNP
10_1101-2021_01_07_425723	266	31	)	)	-RRB-
10_1101-2021_01_07_425723	266	32	.	.	.
10_1101-2021_01_07_425723	267	1	The	the	DT
10_1101-2021_01_07_425723	267	2	integration	integration	NN
10_1101-2021_01_07_425723	267	3	vector	vector	NN
10_1101-2021_01_07_425723	267	4	pUDI246	pUDI246	NNP
10_1101-2021_01_07_425723	267	5	with	with	IN
10_1101-2021_01_07_425723	267	6	the	the	DT
10_1101-2021_01_07_425723	267	7	TtSTC1	ttstc1	JJ
10_1101-2021_01_07_425723	267	8	expression	expression	NN
10_1101-2021_01_07_425723	267	9	cassette	cassette	NN
10_1101-2021_01_07_425723	267	10	was	be	VBD
10_1101-2021_01_07_425723	267	11	399	399	CD
10_1101-2021_01_07_425723	267	12	constructed	construct	VBN
10_1101-2021_01_07_425723	267	13	by	by	IN
10_1101-2021_01_07_425723	267	14	Gibson	Gibson	NNP
10_1101-2021_01_07_425723	267	15	assembly	assembly	NN
10_1101-2021_01_07_425723	267	16	of	of	IN
10_1101-2021_01_07_425723	267	17	the	the	DT
10_1101-2021_01_07_425723	267	18	PCR	PCR	NNP
10_1101-2021_01_07_425723	267	19	amplified	amplify	VBD
10_1101-2021_01_07_425723	267	20	pGGKd068	pGGKd068	NNP
10_1101-2021_01_07_425723	267	21	and	and	CC
10_1101-2021_01_07_425723	267	22	pUDE909	pUDE909	NNPS
10_1101-2021_01_07_425723	267	23	with	with	IN
10_1101-2021_01_07_425723	267	24	primer	primer	NNP
10_1101-2021_01_07_425723	267	25	pairs	pairs	NNP
10_1101-2021_01_07_425723	267	26	400	400	CD
10_1101-2021_01_07_425723	267	27	16274/16275	16274/16275	CD
10_1101-2021_01_07_425723	267	28	and	and	CC
10_1101-2021_01_07_425723	267	29	16272/16273	16272/16273	CD
10_1101-2021_01_07_425723	267	30	,	,	,
10_1101-2021_01_07_425723	267	31	thereby	thereby	RB
10_1101-2021_01_07_425723	267	32	adding	add	VBG
10_1101-2021_01_07_425723	267	33	20	20	CD
10_1101-2021_01_07_425723	267	34	bp	bp	NN
10_1101-2021_01_07_425723	267	35	overlaps	overlap	NNS
10_1101-2021_01_07_425723	267	36	for	for	IN
10_1101-2021_01_07_425723	267	37	assembly	assembly	NN
10_1101-2021_01_07_425723	267	38	.	.	.
10_1101-2021_01_07_425723	268	1	For	for	IN
10_1101-2021_01_07_425723	268	2	this	this	DT
10_1101-2021_01_07_425723	268	3	step	step	NN
10_1101-2021_01_07_425723	268	4	,	,	,
10_1101-2021_01_07_425723	268	5	the	the	DT
10_1101-2021_01_07_425723	268	6	401	401	CD
10_1101-2021_01_07_425723	268	7	.CC	.CC	:
10_1101-2021_01_07_425723	268	8	-	-	HYPH
10_1101-2021_01_07_425723	268	9	BY	by	IN
10_1101-2021_01_07_425723	268	10	-	-	HYPH
10_1101-2021_01_07_425723	268	11	NC	NC	NNP
10_1101-2021_01_07_425723	268	12	-	-	HYPH
10_1101-2021_01_07_425723	268	13	ND	ND	NNP
10_1101-2021_01_07_425723	268	14	4.0	4.0	CD
10_1101-2021_01_07_425723	268	15	International	International	NNP
10_1101-2021_01_07_425723	268	16	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	268	17	under	under	IN
10_1101-2021_01_07_425723	268	18	a	a	DT
10_1101-2021_01_07_425723	268	19	(	(	-LRB-
10_1101-2021_01_07_425723	268	20	which	which	WDT
10_1101-2021_01_07_425723	268	21	was	be	VBD
10_1101-2021_01_07_425723	268	22	not	not	RB
10_1101-2021_01_07_425723	268	23	certified	certify	VBN
10_1101-2021_01_07_425723	268	24	by	by	IN
10_1101-2021_01_07_425723	268	25	peer	peer	NN
10_1101-2021_01_07_425723	268	26	review	review	NN
10_1101-2021_01_07_425723	268	27	)	)	-RRB-
10_1101-2021_01_07_425723	268	28	is	be	VBZ
10_1101-2021_01_07_425723	268	29	the	the	DT
10_1101-2021_01_07_425723	268	30	author	author	NN
10_1101-2021_01_07_425723	268	31	/	/	SYM
10_1101-2021_01_07_425723	268	32	funder	funder	NN
10_1101-2021_01_07_425723	268	33	,	,	,
10_1101-2021_01_07_425723	268	34	who	who	WP
10_1101-2021_01_07_425723	268	35	has	have	VBZ
10_1101-2021_01_07_425723	268	36	granted	grant	VBN
10_1101-2021_01_07_425723	268	37	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	268	38	a	a	DT
10_1101-2021_01_07_425723	268	39	license	license	NN
10_1101-2021_01_07_425723	268	40	to	to	TO
10_1101-2021_01_07_425723	268	41	display	display	VB
10_1101-2021_01_07_425723	268	42	the	the	DT
10_1101-2021_01_07_425723	268	43	preprint	preprint	NN
10_1101-2021_01_07_425723	268	44	in	in	IN
10_1101-2021_01_07_425723	268	45	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	268	46	.	.	.
10_1101-2021_01_07_425723	269	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	269	2	is	be	VBZ
10_1101-2021_01_07_425723	269	3	made	make	VBN
10_1101-2021_01_07_425723	269	4	The	the	DT
10_1101-2021_01_07_425723	269	5	copyright	copyright	NN
10_1101-2021_01_07_425723	269	6	holder	holder	NN
10_1101-2021_01_07_425723	269	7	for	for	IN
10_1101-2021_01_07_425723	269	8	this	this	DT
10_1101-2021_01_07_425723	269	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	269	10	version	version	NN
10_1101-2021_01_07_425723	269	11	posted	post	VBD
10_1101-2021_01_07_425723	269	12	January	January	NNP
10_1101-2021_01_07_425723	269	13	8	8	CD
10_1101-2021_01_07_425723	269	14	,	,	,
10_1101-2021_01_07_425723	269	15	2021	2021	CD
10_1101-2021_01_07_425723	269	16	.	.	.
10_1101-2021_01_07_425723	269	17	;	;	:
10_1101-2021_01_07_425723	269	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	269	19	:	:	:
10_1101-2021_01_07_425723	269	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	269	21	preprint	preprint	NN
10_1101-2021_01_07_425723	269	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	269	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	269	24	24	24	CD
10_1101-2021_01_07_425723	269	25	incubation	incubation	NN
10_1101-2021_01_07_425723	269	26	time	time	NN
10_1101-2021_01_07_425723	269	27	of	of	IN
10_1101-2021_01_07_425723	269	28	the	the	DT
10_1101-2021_01_07_425723	269	29	Gibson	Gibson	NNP
10_1101-2021_01_07_425723	269	30	assembly	assembly	NN
10_1101-2021_01_07_425723	269	31	was	be	VBD
10_1101-2021_01_07_425723	269	32	increased	increase	VBN
10_1101-2021_01_07_425723	269	33	to	to	IN
10_1101-2021_01_07_425723	269	34	90	90	CD
10_1101-2021_01_07_425723	269	35	min	min	NN
10_1101-2021_01_07_425723	269	36	.	.	.
10_1101-2021_01_07_425723	270	1	Plasmid	Plasmid	NNP
10_1101-2021_01_07_425723	270	2	assembly	assembly	NN
10_1101-2021_01_07_425723	270	3	was	be	VBD
10_1101-2021_01_07_425723	270	4	verified	verify	VBN
10_1101-2021_01_07_425723	270	5	by	by	IN
10_1101-2021_01_07_425723	270	6	402	402	CD
10_1101-2021_01_07_425723	270	7	diagnostic	diagnostic	JJ
10_1101-2021_01_07_425723	270	8	PCR	PCR	NNP
10_1101-2021_01_07_425723	270	9	amplification	amplification	NN
10_1101-2021_01_07_425723	270	10	using	use	VBG
10_1101-2021_01_07_425723	270	11	DreamTaq	DreamTaq	NNP
10_1101-2021_01_07_425723	270	12	polymerase	polymerase	NN
10_1101-2021_01_07_425723	270	13	(	(	-LRB-
10_1101-2021_01_07_425723	270	14	Thermo	Thermo	NNP
10_1101-2021_01_07_425723	270	15	Scientific	Scientific	NNP
10_1101-2021_01_07_425723	270	16	)	)	-RRB-
10_1101-2021_01_07_425723	270	17	with	with	IN
10_1101-2021_01_07_425723	270	18	primers	primer	NNS
10_1101-2021_01_07_425723	270	19	5941	5941	CD
10_1101-2021_01_07_425723	270	20	,	,	,
10_1101-2021_01_07_425723	270	21	8442	8442	CD
10_1101-2021_01_07_425723	270	22	,	,	,
10_1101-2021_01_07_425723	270	23	403	403	CD
10_1101-2021_01_07_425723	270	24	15216	15216	CD
10_1101-2021_01_07_425723	270	25	and	and	CC
10_1101-2021_01_07_425723	270	26	subsequent	subsequent	JJ
10_1101-2021_01_07_425723	270	27	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	270	28	short	short	JJ
10_1101-2021_01_07_425723	270	29	-	-	HYPH
10_1101-2021_01_07_425723	270	30	read	read	NN
10_1101-2021_01_07_425723	270	31	sequencing	sequencing	NN
10_1101-2021_01_07_425723	270	32	.	.	.
10_1101-2021_01_07_425723	271	1	404	404	CD
10_1101-2021_01_07_425723	271	2	Table	table	NN
10_1101-2021_01_07_425723	271	3	2	2	CD
10_1101-2021_01_07_425723	271	4	|	|	NNP
10_1101-2021_01_07_425723	271	5	Strains	Strains	NNP
10_1101-2021_01_07_425723	271	6	used	use	VBN
10_1101-2021_01_07_425723	271	7	in	in	IN
10_1101-2021_01_07_425723	271	8	this	this	DT
10_1101-2021_01_07_425723	271	9	study	study	NN
10_1101-2021_01_07_425723	271	10	.	.	.
10_1101-2021_01_07_425723	272	1	Abbreviations	abbreviation	NNS
10_1101-2021_01_07_425723	272	2	:	:	:
10_1101-2021_01_07_425723	272	3	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	272	4	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	272	5	(	(	-LRB-
10_1101-2021_01_07_425723	272	6	Sc	Sc	NNP
10_1101-2021_01_07_425723	272	7	)	)	-RRB-
10_1101-2021_01_07_425723	272	8	,	,	,
10_1101-2021_01_07_425723	272	9	Kluyveromyces	kluyveromyce	NNS
10_1101-2021_01_07_425723	272	10	405	405	CD
10_1101-2021_01_07_425723	272	11	marxianus	marxianu	NNS
10_1101-2021_01_07_425723	272	12	(	(	-LRB-
10_1101-2021_01_07_425723	272	13	Km	Km	NNP
10_1101-2021_01_07_425723	272	14	)	)	-RRB-
10_1101-2021_01_07_425723	272	15	,	,	,
10_1101-2021_01_07_425723	272	16	Tetrahymena	Tetrahymena	NNP
10_1101-2021_01_07_425723	272	17	thermophila	thermophila	NN
10_1101-2021_01_07_425723	272	18	(	(	-LRB-
10_1101-2021_01_07_425723	272	19	Tt	Tt	NNP
10_1101-2021_01_07_425723	272	20	)	)	-RRB-
10_1101-2021_01_07_425723	272	21	.	.	.
10_1101-2021_01_07_425723	273	1	406	406	CD
10_1101-2021_01_07_425723	273	2	Genus	Genus	NNP
10_1101-2021_01_07_425723	273	3	Strain	Strain	NNP
10_1101-2021_01_07_425723	273	4	Relevant	relevant	JJ
10_1101-2021_01_07_425723	273	5	genotype	genotype	NN
10_1101-2021_01_07_425723	273	6	Reference	Reference	NNP
10_1101-2021_01_07_425723	273	7	S.	S.	NNP
10_1101-2021_01_07_425723	273	8	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	273	9	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	273	10	-	-	HYPH
10_1101-2021_01_07_425723	273	11	7D	7d	NN
10_1101-2021_01_07_425723	273	12	MATa	MATa	NNS
10_1101-2021_01_07_425723	273	13	URA3	URA3	NNP
10_1101-2021_01_07_425723	273	14	HIS3	HIS3	NNP
10_1101-2021_01_07_425723	273	15	LEU2	LEU2	NNP
10_1101-2021_01_07_425723	273	16	TRP1	TRP1	NNP
10_1101-2021_01_07_425723	273	17	MAL2	MAL2	NNP
10_1101-2021_01_07_425723	273	18	-	-	HYPH
10_1101-2021_01_07_425723	273	19	8c	8c	NNP
10_1101-2021_01_07_425723	273	20	SUC2	SUC2	NNP
10_1101-2021_01_07_425723	273	21	Entian	Entian	NNP
10_1101-2021_01_07_425723	273	22	and	and	CC
10_1101-2021_01_07_425723	273	23	Kötter	Kötter	NNP
10_1101-2021_01_07_425723	273	24	,	,	,
10_1101-2021_01_07_425723	273	25	2007	2007	CD
10_1101-2021_01_07_425723	273	26	57	57	CD
10_1101-2021_01_07_425723	273	27	S.	s.	NN
10_1101-2021_01_07_425723	273	28	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	273	29	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	273	30	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	273	31	-	-	HYPH
10_1101-2021_01_07_425723	273	32	7D	7d	NN
10_1101-2021_01_07_425723	273	33	can1Δ::cas9-natNT2	can1Δ::cas9-natNT2	NNPS
10_1101-2021_01_07_425723	273	34	Mans	Mans	NNPS
10_1101-2021_01_07_425723	273	35	et	et	NNP
10_1101-2021_01_07_425723	273	36	al	al	NNP
10_1101-2021_01_07_425723	273	37	.	.	NNP
10_1101-2021_01_07_425723	273	38	,	,	,
10_1101-2021_01_07_425723	273	39	2015	2015	CD
10_1101-2021_01_07_425723	273	40	61	61	CD
10_1101-2021_01_07_425723	273	41	S.	S.	NNP
10_1101-2021_01_07_425723	273	42	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	273	43	IMX1438	IMX1438	NNP
10_1101-2021_01_07_425723	273	44	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	273	45	sga1Δ::TtSTC1	sga1Δ::TtSTC1	NNP
10_1101-2021_01_07_425723	273	46	Wiersma	Wiersma	NNP
10_1101-2021_01_07_425723	273	47	et	et	NNP
10_1101-2021_01_07_425723	273	48	al	al	NNP
10_1101-2021_01_07_425723	273	49	.	.	NNP
10_1101-2021_01_07_425723	273	50	,	,	,
10_1101-2021_01_07_425723	273	51	2020	2020	CD
10_1101-2021_01_07_425723	273	52	46	46	CD
10_1101-2021_01_07_425723	273	53	S.	S.	NNP
10_1101-2021_01_07_425723	273	54	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	273	55	IMK802	IMK802	NNP
10_1101-2021_01_07_425723	273	56	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	273	57	aus1Δ	aus1Δ	NNP
10_1101-2021_01_07_425723	273	58	This	this	DT
10_1101-2021_01_07_425723	273	59	study	study	NN
10_1101-2021_01_07_425723	273	60	S.	S.	NNP
10_1101-2021_01_07_425723	273	61	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	273	62	IMK806	IMK806	NNP
10_1101-2021_01_07_425723	273	63	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	273	64	pdr11Δ	pdr11Δ	NNP
10_1101-2021_01_07_425723	273	65	This	this	DT
10_1101-2021_01_07_425723	273	66	study	study	NN
10_1101-2021_01_07_425723	273	67	S.	S.	NNP
10_1101-2021_01_07_425723	273	68	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	273	69	IMK809	IMK809	NNP
10_1101-2021_01_07_425723	273	70	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	273	71	aus1Δ	aus1Δ	NNP
10_1101-2021_01_07_425723	273	72	pdr11Δ	pdr11Δ	NNP
10_1101-2021_01_07_425723	273	73	This	this	DT
10_1101-2021_01_07_425723	273	74	study	study	NN
10_1101-2021_01_07_425723	273	75	K.	K.	NNP
10_1101-2021_01_07_425723	273	76	marxianus	marxianus	NN
10_1101-2021_01_07_425723	273	77	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	273	78	URA3	URA3	NNP
10_1101-2021_01_07_425723	273	79	HIS3	HIS3	NNP
10_1101-2021_01_07_425723	273	80	LEU2	LEU2	NNP
10_1101-2021_01_07_425723	273	81	TRP1	TRP1	NNP
10_1101-2021_01_07_425723	273	82	CBS	CBS	NNP
10_1101-2021_01_07_425723	273	83	-	-	HYPH
10_1101-2021_01_07_425723	273	84	KNAW	KNAW	NNP
10_1101-2021_01_07_425723	273	85	*	*	NFP
10_1101-2021_01_07_425723	273	86	K.	K.	NNP
10_1101-2021_01_07_425723	273	87	marxianus	marxianus	NN
10_1101-2021_01_07_425723	273	88	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	273	89	URA3	URA3	NNP
10_1101-2021_01_07_425723	273	90	HIS3	HIS3	NNP
10_1101-2021_01_07_425723	273	91	LEU2	LEU2	NNP
10_1101-2021_01_07_425723	273	92	TRP1	TRP1	NNP
10_1101-2021_01_07_425723	273	93	NBRC	NBRC	NNP
10_1101-2021_01_07_425723	273	94	*	*	NFP
10_1101-2021_01_07_425723	273	95	*	*	NFP
10_1101-2021_01_07_425723	273	96	K.	K.	NNP
10_1101-2021_01_07_425723	273	97	marxianus	marxianus	NN
10_1101-2021_01_07_425723	273	98	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	273	99	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	273	100	-	-	HYPH
10_1101-2021_01_07_425723	273	101	TtSTC1-ScADH1t	TtSTC1-ScADH1t	NNP
10_1101-2021_01_07_425723	273	102	-	-	HYPH
10_1101-2021_01_07_425723	273	103	hygB	hygB	NNP
10_1101-2021_01_07_425723	273	104	This	this	DT
10_1101-2021_01_07_425723	273	105	study	study	NN
10_1101-2021_01_07_425723	273	106	K.	K.	NNP
10_1101-2021_01_07_425723	273	107	marxianus	marxianus	NN
10_1101-2021_01_07_425723	273	108	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	273	109	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	273	110	-	-	HYPH
10_1101-2021_01_07_425723	273	111	TtSTC1-ScADH1t	TtSTC1-ScADH1t	NNP
10_1101-2021_01_07_425723	273	112	-	-	HYPH
10_1101-2021_01_07_425723	273	113	hygB	hygB	NNP
10_1101-2021_01_07_425723	273	114	This	this	DT
10_1101-2021_01_07_425723	273	115	study	study	NN
10_1101-2021_01_07_425723	273	116	K.	K.	NNP
10_1101-2021_01_07_425723	273	117	marxianus	marxianus	NN
10_1101-2021_01_07_425723	273	118	IMS1112	IMS1112	NNP
10_1101-2021_01_07_425723	273	119	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	273	120	-	-	HYPH
10_1101-2021_01_07_425723	273	121	TtSTC1-ScADH1t	TtSTC1-ScADH1t	NNP
10_1101-2021_01_07_425723	273	122	-	-	HYPH
10_1101-2021_01_07_425723	273	123	hygB	hygB	NNP
10_1101-2021_01_07_425723	273	124	This	this	DT
10_1101-2021_01_07_425723	273	125	study	study	NN
10_1101-2021_01_07_425723	273	126	K.	K.	NNP
10_1101-2021_01_07_425723	273	127	marxianus	marxianus	NN
10_1101-2021_01_07_425723	273	128	IMS1113	IMS1113	NNP
10_1101-2021_01_07_425723	273	129	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	273	130	-	-	HYPH
10_1101-2021_01_07_425723	273	131	TtSTC1-ScADH1t	TtSTC1-ScADH1t	NNP
10_1101-2021_01_07_425723	273	132	-	-	HYPH
10_1101-2021_01_07_425723	273	133	hygB	hygB	NNP
10_1101-2021_01_07_425723	273	134	This	this	DT
10_1101-2021_01_07_425723	273	135	study	study	NN
10_1101-2021_01_07_425723	273	136	K.	K.	NNP
10_1101-2021_01_07_425723	273	137	marxianus	marxianus	NN
10_1101-2021_01_07_425723	273	138	IMS1131	IMS1131	NNP
10_1101-2021_01_07_425723	273	139	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	273	140	-	-	HYPH
10_1101-2021_01_07_425723	273	141	TtSTC1-ScADH1t	TtSTC1-ScADH1t	NNP
10_1101-2021_01_07_425723	273	142	-	-	HYPH
10_1101-2021_01_07_425723	273	143	hygB	hygB	NNP
10_1101-2021_01_07_425723	273	144	This	this	DT
10_1101-2021_01_07_425723	273	145	study	study	NN
10_1101-2021_01_07_425723	273	146	K.	K.	NNP
10_1101-2021_01_07_425723	273	147	marxianus	marxianus	NN
10_1101-2021_01_07_425723	273	148	IMS1132	IMS1132	NNP
10_1101-2021_01_07_425723	273	149	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	273	150	-	-	HYPH
10_1101-2021_01_07_425723	273	151	TtSTC1-ScADH1t	TtSTC1-ScADH1t	NNP
10_1101-2021_01_07_425723	273	152	-	-	HYPH
10_1101-2021_01_07_425723	273	153	hygB	hygB	NNP
10_1101-2021_01_07_425723	273	154	This	this	DT
10_1101-2021_01_07_425723	273	155	study	study	NN
10_1101-2021_01_07_425723	273	156	K.	K.	NNP
10_1101-2021_01_07_425723	273	157	marxianus	marxianus	NN
10_1101-2021_01_07_425723	273	158	IMS1133	IMS1133	NNP
10_1101-2021_01_07_425723	273	159	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	273	160	-	-	HYPH
10_1101-2021_01_07_425723	273	161	TtSTC1-ScADH1t	TtSTC1-ScADH1t	NNP
10_1101-2021_01_07_425723	273	162	-	-	HYPH
10_1101-2021_01_07_425723	273	163	hygB	hygB	NNP
10_1101-2021_01_07_425723	273	164	This	this	DT
10_1101-2021_01_07_425723	273	165	study	study	NN
10_1101-2021_01_07_425723	273	166	407	407	CD
10_1101-2021_01_07_425723	273	167	.CC	.CC	,
10_1101-2021_01_07_425723	273	168	-	-	HYPH
10_1101-2021_01_07_425723	273	169	BY	by	IN
10_1101-2021_01_07_425723	273	170	-	-	HYPH
10_1101-2021_01_07_425723	273	171	NC	NC	NNP
10_1101-2021_01_07_425723	273	172	-	-	HYPH
10_1101-2021_01_07_425723	273	173	ND	ND	NNP
10_1101-2021_01_07_425723	273	174	4.0	4.0	CD
10_1101-2021_01_07_425723	273	175	International	International	NNP
10_1101-2021_01_07_425723	273	176	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	273	177	under	under	IN
10_1101-2021_01_07_425723	273	178	a	a	DT
10_1101-2021_01_07_425723	273	179	(	(	-LRB-
10_1101-2021_01_07_425723	273	180	which	which	WDT
10_1101-2021_01_07_425723	273	181	was	be	VBD
10_1101-2021_01_07_425723	273	182	not	not	RB
10_1101-2021_01_07_425723	273	183	certified	certify	VBN
10_1101-2021_01_07_425723	273	184	by	by	IN
10_1101-2021_01_07_425723	273	185	peer	peer	NN
10_1101-2021_01_07_425723	273	186	review	review	NN
10_1101-2021_01_07_425723	273	187	)	)	-RRB-
10_1101-2021_01_07_425723	273	188	is	be	VBZ
10_1101-2021_01_07_425723	273	189	the	the	DT
10_1101-2021_01_07_425723	273	190	author	author	NN
10_1101-2021_01_07_425723	273	191	/	/	SYM
10_1101-2021_01_07_425723	273	192	funder	funder	NN
10_1101-2021_01_07_425723	273	193	,	,	,
10_1101-2021_01_07_425723	273	194	who	who	WP
10_1101-2021_01_07_425723	273	195	has	have	VBZ
10_1101-2021_01_07_425723	273	196	granted	grant	VBN
10_1101-2021_01_07_425723	273	197	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	273	198	a	a	DT
10_1101-2021_01_07_425723	273	199	license	license	NN
10_1101-2021_01_07_425723	273	200	to	to	TO
10_1101-2021_01_07_425723	273	201	display	display	VB
10_1101-2021_01_07_425723	273	202	the	the	DT
10_1101-2021_01_07_425723	273	203	preprint	preprint	NN
10_1101-2021_01_07_425723	273	204	in	in	IN
10_1101-2021_01_07_425723	273	205	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	273	206	.	.	.
10_1101-2021_01_07_425723	274	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	274	2	is	be	VBZ
10_1101-2021_01_07_425723	274	3	made	make	VBN
10_1101-2021_01_07_425723	274	4	The	the	DT
10_1101-2021_01_07_425723	274	5	copyright	copyright	NN
10_1101-2021_01_07_425723	274	6	holder	holder	NN
10_1101-2021_01_07_425723	274	7	for	for	IN
10_1101-2021_01_07_425723	274	8	this	this	DT
10_1101-2021_01_07_425723	274	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	274	10	version	version	NN
10_1101-2021_01_07_425723	274	11	posted	post	VBD
10_1101-2021_01_07_425723	274	12	January	January	NNP
10_1101-2021_01_07_425723	274	13	8	8	CD
10_1101-2021_01_07_425723	274	14	,	,	,
10_1101-2021_01_07_425723	274	15	2021	2021	CD
10_1101-2021_01_07_425723	274	16	.	.	.
10_1101-2021_01_07_425723	274	17	;	;	:
10_1101-2021_01_07_425723	274	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	274	19	:	:	:
10_1101-2021_01_07_425723	274	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	274	21	preprint	preprint	NN
10_1101-2021_01_07_425723	274	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	274	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	274	24	25	25	CD
10_1101-2021_01_07_425723	274	25	Table	table	NN
10_1101-2021_01_07_425723	274	26	3	3	CD
10_1101-2021_01_07_425723	274	27	|	|	CD
10_1101-2021_01_07_425723	274	28	CRISPR	CRISPR	NNP
10_1101-2021_01_07_425723	274	29	gRNA	grna	IN
10_1101-2021_01_07_425723	274	30	target	target	NN
10_1101-2021_01_07_425723	274	31	sequences	sequence	NNS
10_1101-2021_01_07_425723	274	32	used	use	VBN
10_1101-2021_01_07_425723	274	33	in	in	IN
10_1101-2021_01_07_425723	274	34	this	this	DT
10_1101-2021_01_07_425723	274	35	study	study	NN
10_1101-2021_01_07_425723	274	36	.	.	.
10_1101-2021_01_07_425723	275	1	gRNA	gRNA	NNP
10_1101-2021_01_07_425723	275	2	target	target	NN
10_1101-2021_01_07_425723	275	3	sequences	sequence	NNS
10_1101-2021_01_07_425723	275	4	are	be	VBP
10_1101-2021_01_07_425723	275	5	shown	show	VBN
10_1101-2021_01_07_425723	275	6	with	with	IN
10_1101-2021_01_07_425723	275	7	408	408	CD
10_1101-2021_01_07_425723	275	8	PAM	PAM	NNP
10_1101-2021_01_07_425723	275	9	sequences	sequence	NNS
10_1101-2021_01_07_425723	275	10	underlined	underline	VBD
10_1101-2021_01_07_425723	275	11	.	.	.
10_1101-2021_01_07_425723	276	1	Position	position	NN
10_1101-2021_01_07_425723	276	2	in	in	IN
10_1101-2021_01_07_425723	276	3	ORF	ORF	NNP
10_1101-2021_01_07_425723	276	4	indicates	indicate	VBZ
10_1101-2021_01_07_425723	276	5	the	the	DT
10_1101-2021_01_07_425723	276	6	base	base	NN
10_1101-2021_01_07_425723	276	7	pair	pair	NN
10_1101-2021_01_07_425723	276	8	after	after	IN
10_1101-2021_01_07_425723	276	9	which	which	WDT
10_1101-2021_01_07_425723	276	10	the	the	DT
10_1101-2021_01_07_425723	276	11	Cas9-mediated	Cas9-mediated	NNP
10_1101-2021_01_07_425723	276	12	409	409	CD
10_1101-2021_01_07_425723	276	13	double	double	JJ
10_1101-2021_01_07_425723	276	14	-	-	HYPH
10_1101-2021_01_07_425723	276	15	strand	strand	NN
10_1101-2021_01_07_425723	276	16	break	break	NN
10_1101-2021_01_07_425723	276	17	is	be	VBZ
10_1101-2021_01_07_425723	276	18	introduced	introduce	VBN
10_1101-2021_01_07_425723	276	19	.	.	.
10_1101-2021_01_07_425723	277	1	AT	at	IN
10_1101-2021_01_07_425723	277	2	score	score	NN
10_1101-2021_01_07_425723	277	3	indicates	indicate	VBZ
10_1101-2021_01_07_425723	277	4	the	the	DT
10_1101-2021_01_07_425723	277	5	AT	AT	NNP
10_1101-2021_01_07_425723	277	6	content	content	NN
10_1101-2021_01_07_425723	277	7	of	of	IN
10_1101-2021_01_07_425723	277	8	the	the	DT
10_1101-2021_01_07_425723	277	9	20-bp	20-bp	CD
10_1101-2021_01_07_425723	277	10	target	target	VB
10_1101-2021_01_07_425723	277	11	sequence	sequence	NN
10_1101-2021_01_07_425723	277	12	and	and	CC
10_1101-2021_01_07_425723	277	13	410	410	CD
10_1101-2021_01_07_425723	277	14	RNA	RNA	NNP
10_1101-2021_01_07_425723	277	15	score	score	NN
10_1101-2021_01_07_425723	277	16	indicates	indicate	VBZ
10_1101-2021_01_07_425723	277	17	the	the	DT
10_1101-2021_01_07_425723	277	18	fraction	fraction	NN
10_1101-2021_01_07_425723	277	19	of	of	IN
10_1101-2021_01_07_425723	277	20	unpaired	unpaired	JJ
10_1101-2021_01_07_425723	277	21	nucleotides	nucleotide	NNS
10_1101-2021_01_07_425723	277	22	of	of	IN
10_1101-2021_01_07_425723	277	23	the	the	DT
10_1101-2021_01_07_425723	277	24	20-bp	20-bp	CD
10_1101-2021_01_07_425723	277	25	target	target	NN
10_1101-2021_01_07_425723	277	26	sequence	sequence	NN
10_1101-2021_01_07_425723	277	27	,	,	,
10_1101-2021_01_07_425723	277	28	predicted	predict	VBD
10_1101-2021_01_07_425723	277	29	with	with	IN
10_1101-2021_01_07_425723	277	30	411	411	CD
10_1101-2021_01_07_425723	277	31	the	the	DT
10_1101-2021_01_07_425723	277	32	complete	complete	JJ
10_1101-2021_01_07_425723	277	33	gRNA	grna	NN
10_1101-2021_01_07_425723	277	34	sequence	sequence	NN
10_1101-2021_01_07_425723	277	35	using	use	VBG
10_1101-2021_01_07_425723	277	36	a	a	DT
10_1101-2021_01_07_425723	277	37	minimum	minimum	JJ
10_1101-2021_01_07_425723	277	38	free	free	JJ
10_1101-2021_01_07_425723	277	39	energy	energy	NN
10_1101-2021_01_07_425723	277	40	prediction	prediction	NN
10_1101-2021_01_07_425723	277	41	by	by	IN
10_1101-2021_01_07_425723	277	42	the	the	DT
10_1101-2021_01_07_425723	277	43	RNAfold	rnafold	NN
10_1101-2021_01_07_425723	277	44	algorithm62	algorithm62	NN
10_1101-2021_01_07_425723	277	45	.	.	.
10_1101-2021_01_07_425723	278	1	412	412	CD
10_1101-2021_01_07_425723	278	2	Locus	Locus	NNP
10_1101-2021_01_07_425723	278	3	Target	Target	NNP
10_1101-2021_01_07_425723	278	4	sequence	sequence	NN
10_1101-2021_01_07_425723	278	5	(	(	-LRB-
10_1101-2021_01_07_425723	278	6	5'-3	5'-3	CD
10_1101-2021_01_07_425723	278	7	'	'	POS
10_1101-2021_01_07_425723	278	8	)	)	-RRB-
10_1101-2021_01_07_425723	278	9	Position	position	NN
10_1101-2021_01_07_425723	278	10	in	in	IN
10_1101-2021_01_07_425723	278	11	ORF	ORF	NNP
10_1101-2021_01_07_425723	278	12	(	(	-LRB-
10_1101-2021_01_07_425723	278	13	bp	bp	NN
10_1101-2021_01_07_425723	278	14	)	)	-RRB-
10_1101-2021_01_07_425723	278	15	AT	at	IN
10_1101-2021_01_07_425723	278	16	score	score	NN
10_1101-2021_01_07_425723	278	17	RNA	RNA	NNP
10_1101-2021_01_07_425723	278	18	score	score	NN
10_1101-2021_01_07_425723	278	19	AUS1	AUS1	NNP
10_1101-2021_01_07_425723	278	20	CATTATTGTAAATGATTTGGTGG	CATTATTGTAAATGATTTGGTGG	NNP
10_1101-2021_01_07_425723	278	21	320/4184	320/4184	CD
10_1101-2021_01_07_425723	278	22	0.75	0.75	CD
10_1101-2021_01_07_425723	278	23	1	1	CD
10_1101-2021_01_07_425723	278	24	PDR11	PDR11	NNP
10_1101-2021_01_07_425723	278	25	ATCTTTCATATAAATAACATAGG	ATCTTTCATATAAATAACATAGG	NNP
10_1101-2021_01_07_425723	278	26	1627/4235	1627/4235	CD
10_1101-2021_01_07_425723	278	27	0.85	0.85	CD
10_1101-2021_01_07_425723	278	28	1	1	CD
10_1101-2021_01_07_425723	278	29	413	413	CD
10_1101-2021_01_07_425723	278	30	Table	table	NN
10_1101-2021_01_07_425723	278	31	4	4	CD
10_1101-2021_01_07_425723	278	32	|	|	NNP
10_1101-2021_01_07_425723	278	33	Plasmids	Plasmids	NNPS
10_1101-2021_01_07_425723	278	34	used	use	VBN
10_1101-2021_01_07_425723	278	35	in	in	IN
10_1101-2021_01_07_425723	278	36	this	this	DT
10_1101-2021_01_07_425723	278	37	study	study	NN
10_1101-2021_01_07_425723	278	38	.	.	.
10_1101-2021_01_07_425723	279	1	Restriction	restriction	NN
10_1101-2021_01_07_425723	279	2	enzyme	enzyme	NNS
10_1101-2021_01_07_425723	279	3	recognition	recognition	NN
10_1101-2021_01_07_425723	279	4	sites	site	NNS
10_1101-2021_01_07_425723	279	5	are	be	VBP
10_1101-2021_01_07_425723	279	6	indicated	indicate	VBN
10_1101-2021_01_07_425723	279	7	in	in	IN
10_1101-2021_01_07_425723	279	8	superscript	superscript	NN
10_1101-2021_01_07_425723	279	9	.	.	.
10_1101-2021_01_07_425723	280	1	414	414	CD
10_1101-2021_01_07_425723	280	2	US	US	NNP
10_1101-2021_01_07_425723	280	3	/	/	SYM
10_1101-2021_01_07_425723	280	4	DS	DS	NNP
10_1101-2021_01_07_425723	280	5	represent	represent	VBP
10_1101-2021_01_07_425723	280	6	upstream	upstream	JJ
10_1101-2021_01_07_425723	280	7	and	and	CC
10_1101-2021_01_07_425723	280	8	downstream	downstream	JJ
10_1101-2021_01_07_425723	280	9	homologous	homologous	JJ
10_1101-2021_01_07_425723	280	10	recombination	recombination	NN
10_1101-2021_01_07_425723	280	11	sequences	sequence	NNS
10_1101-2021_01_07_425723	280	12	used	use	VBN
10_1101-2021_01_07_425723	280	13	for	for	IN
10_1101-2021_01_07_425723	280	14	genomic	genomic	JJ
10_1101-2021_01_07_425723	280	15	415	415	CD
10_1101-2021_01_07_425723	280	16	integration	integration	NN
10_1101-2021_01_07_425723	280	17	into	into	IN
10_1101-2021_01_07_425723	280	18	the	the	DT
10_1101-2021_01_07_425723	280	19	K.	K.	NNP
10_1101-2021_01_07_425723	280	20	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	280	21	lac4	lac4	NNP
10_1101-2021_01_07_425723	280	22	locus	locus	NN
10_1101-2021_01_07_425723	280	23	.	.	.
10_1101-2021_01_07_425723	281	1	Abbreviations	abbreviation	NNS
10_1101-2021_01_07_425723	281	2	:	:	:
10_1101-2021_01_07_425723	281	3	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	281	4	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	281	5	(	(	-LRB-
10_1101-2021_01_07_425723	281	6	Sc	Sc	NNP
10_1101-2021_01_07_425723	281	7	)	)	-RRB-
10_1101-2021_01_07_425723	281	8	,	,	,
10_1101-2021_01_07_425723	281	9	416	416	CD
10_1101-2021_01_07_425723	281	10	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	281	11	marxianus	marxianus	NN
10_1101-2021_01_07_425723	281	12	(	(	-LRB-
10_1101-2021_01_07_425723	281	13	Km	Km	NNP
10_1101-2021_01_07_425723	281	14	)	)	-RRB-
10_1101-2021_01_07_425723	281	15	,	,	,
10_1101-2021_01_07_425723	281	16	Tetrahymena	Tetrahymena	NNP
10_1101-2021_01_07_425723	281	17	thermophila	thermophila	NN
10_1101-2021_01_07_425723	281	18	(	(	-LRB-
10_1101-2021_01_07_425723	281	19	Tt	Tt	NNP
10_1101-2021_01_07_425723	281	20	)	)	-RRB-
10_1101-2021_01_07_425723	281	21	.	.	.
10_1101-2021_01_07_425723	282	1	417	417	CD
10_1101-2021_01_07_425723	282	2	Plasmid	Plasmid	NNP
10_1101-2021_01_07_425723	282	3	Characteristics	Characteristics	NNP
10_1101-2021_01_07_425723	282	4	Source	Source	NNP
10_1101-2021_01_07_425723	282	5	pGGkd015	pggkd015	CD
10_1101-2021_01_07_425723	282	6	ori	ori	NN
10_1101-2021_01_07_425723	282	7	ampR	ampR	NNP
10_1101-2021_01_07_425723	282	8	ConLS	ConLS	NNP
10_1101-2021_01_07_425723	282	9	GFP	GFP	NNP
10_1101-2021_01_07_425723	282	10	ConR1	ConR1	NNP
10_1101-2021_01_07_425723	282	11	Hassing	Hassing	NNP
10_1101-2021_01_07_425723	282	12	et	et	NNP
10_1101-2021_01_07_425723	282	13	al	al	NNP
10_1101-2021_01_07_425723	282	14	.	.	NNP
10_1101-2021_01_07_425723	282	15	,	,	,
10_1101-2021_01_07_425723	282	16	2019	2019	CD
10_1101-2021_01_07_425723	282	17	63	63	CD
10_1101-2021_01_07_425723	282	18	pGGKd068	pGGKd068	NNPS
10_1101-2021_01_07_425723	282	19	ori	ori	VBP
10_1101-2021_01_07_425723	282	20	kanR	kanr	CD
10_1101-2021_01_07_425723	282	21	NotIKmlac4US	NotIKmlac4US	NNP
10_1101-2021_01_07_425723	282	22	BsmBIConRE’BsaIsfGFPBsaI	BsmBIConRE’BsaIsfGFPBsaI	NNP
10_1101-2021_01_07_425723	282	23	ConLS’BsmBI	conls’bsmbi	NN
10_1101-2021_01_07_425723	282	24	hygB	hygB	VBZ
10_1101-2021_01_07_425723	282	25	Kmlac4DSNotI	Kmlac4DSNotI	VBD
10_1101-2021_01_07_425723	282	26	This	this	DT
10_1101-2021_01_07_425723	282	27	study	study	NN
10_1101-2021_01_07_425723	282	28	pP2	pp2	NN
10_1101-2021_01_07_425723	282	29	ori	ori	NN
10_1101-2021_01_07_425723	282	30	camR	camR	VBZ
10_1101-2021_01_07_425723	282	31	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	282	32	Rajkumar	Rajkumar	NNP
10_1101-2021_01_07_425723	282	33	et	et	FW
10_1101-2021_01_07_425723	282	34	al	al	NNP
10_1101-2021_01_07_425723	282	35	.	.	NNP
10_1101-2021_01_07_425723	282	36	,	,	,
10_1101-2021_01_07_425723	282	37	2019	2019	CD
10_1101-2021_01_07_425723	282	38	47	47	CD
10_1101-2021_01_07_425723	282	39	pROS11	pros11	CD
10_1101-2021_01_07_425723	282	40	ori	ori	NN
10_1101-2021_01_07_425723	282	41	ampR	ampR	NNP
10_1101-2021_01_07_425723	282	42	2μm	2μm	JJ
10_1101-2021_01_07_425723	282	43	amdSYM	amdSYM	NNP
10_1101-2021_01_07_425723	282	44	pSNR52-gRNACAN1	psnr52-grnacan1	NN
10_1101-2021_01_07_425723	282	45	pRSNR52-gRNAADE2	pRSNR52-gRNAADE2	NNP
10_1101-2021_01_07_425723	282	46	Mans	Mans	NNPS
10_1101-2021_01_07_425723	282	47	et	et	NNP
10_1101-2021_01_07_425723	282	48	al	al	NNP
10_1101-2021_01_07_425723	282	49	.	.	NNP
10_1101-2021_01_07_425723	282	50	,	,	,
10_1101-2021_01_07_425723	282	51	2015	2015	CD
10_1101-2021_01_07_425723	282	52	61	61	CD
10_1101-2021_01_07_425723	282	53	pUD696	pUD696	NNP
10_1101-2021_01_07_425723	282	54	ori	ori	VBP
10_1101-2021_01_07_425723	282	55	kanR	kanr	CD
10_1101-2021_01_07_425723	282	56	TtSTC1	ttstc1	CD
10_1101-2021_01_07_425723	282	57	Wiersma	Wiersma	NNP
10_1101-2021_01_07_425723	282	58	et	et	NNP
10_1101-2021_01_07_425723	282	59	al	al	NNP
10_1101-2021_01_07_425723	282	60	.	.	NNP
10_1101-2021_01_07_425723	282	61	,	,	,
10_1101-2021_01_07_425723	282	62	2020	2020	CD
10_1101-2021_01_07_425723	282	63	46	46	CD
10_1101-2021_01_07_425723	282	64	pUDE659	pUDE659	NNPS
10_1101-2021_01_07_425723	282	65	ori	ori	VB
10_1101-2021_01_07_425723	282	66	ampR	ampR	NNP
10_1101-2021_01_07_425723	282	67	2μm	2μm	JJ
10_1101-2021_01_07_425723	282	68	amdSYM	amdSYM	NNP
10_1101-2021_01_07_425723	282	69	pSNR52-gRNAAUS1	psnr52-grnaaus1	NN
10_1101-2021_01_07_425723	282	70	pRSNR52-gRNAAUS1	pRSNR52-gRNAAUS1	NNS
10_1101-2021_01_07_425723	282	71	This	this	DT
10_1101-2021_01_07_425723	282	72	study	study	NN
10_1101-2021_01_07_425723	282	73	pUDE663	pUDE663	NNP
10_1101-2021_01_07_425723	282	74	ori	ori	VBP
10_1101-2021_01_07_425723	282	75	ampR	ampr	JJ
10_1101-2021_01_07_425723	282	76	2μm	2μm	JJ
10_1101-2021_01_07_425723	282	77	amdSYM	amdSYM	NNP
10_1101-2021_01_07_425723	282	78	pSNR52-gRNAPDR11	pSNR52-gRNAPDR11	NNP
10_1101-2021_01_07_425723	282	79	pRSNR52-gRNAPDR11	pRSNR52-gRNAPDR11	NNP
10_1101-2021_01_07_425723	282	80	This	this	DT
10_1101-2021_01_07_425723	282	81	study	study	NN
10_1101-2021_01_07_425723	282	82	pUDE909	pUDE909	NNS
10_1101-2021_01_07_425723	282	83	ori	ori	VBP
10_1101-2021_01_07_425723	282	84	ampR	ampR	NNP
10_1101-2021_01_07_425723	282	85	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	282	86	-	-	HYPH
10_1101-2021_01_07_425723	282	87	TtSTC1-ScADH1	TtSTC1-ScADH1	NNP
10_1101-2021_01_07_425723	282	88	t	t	NN
10_1101-2021_01_07_425723	282	89	This	this	DT
10_1101-2021_01_07_425723	282	90	study	study	NN
10_1101-2021_01_07_425723	282	91	pUDI246	pUDI246	NNP
10_1101-2021_01_07_425723	282	92	ori	ori	VBP
10_1101-2021_01_07_425723	282	93	kanR	kanr	CD
10_1101-2021_01_07_425723	282	94	NotIKmlac4US	NotIKmlac4US	NNP
10_1101-2021_01_07_425723	282	95	KmPDC1p	KmPDC1p	NNP
10_1101-2021_01_07_425723	282	96	-	-	:
10_1101-2021_01_07_425723	282	97	TtSTC1-ScADH1	TtSTC1-ScADH1	NNP
10_1101-2021_01_07_425723	282	98	t	t	NN
10_1101-2021_01_07_425723	282	99	hygB	hygB	NNS
10_1101-2021_01_07_425723	282	100	Kmlac4DSNotI	Kmlac4DSNotI	VBD
10_1101-2021_01_07_425723	282	101	This	this	DT
10_1101-2021_01_07_425723	282	102	study	study	NN
10_1101-2021_01_07_425723	282	103	pYTK008	pytk008	NN
10_1101-2021_01_07_425723	282	104	ori	ori	NN
10_1101-2021_01_07_425723	282	105	camR	camR	NNP
10_1101-2021_01_07_425723	282	106	ConLS	ConLS	NNP
10_1101-2021_01_07_425723	282	107	’	'	''
10_1101-2021_01_07_425723	282	108	Lee	Lee	NNP
10_1101-2021_01_07_425723	282	109	et	et	NNP
10_1101-2021_01_07_425723	282	110	al	al	NNP
10_1101-2021_01_07_425723	282	111	.	.	NNP
10_1101-2021_01_07_425723	282	112	,	,	,
10_1101-2021_01_07_425723	282	113	2015	2015	CD
10_1101-2021_01_07_425723	282	114	60	60	CD
10_1101-2021_01_07_425723	282	115	pYTK047	pYTK047	NNS
10_1101-2021_01_07_425723	282	116	ori	ori	RB
10_1101-2021_01_07_425723	282	117	camR	camr	JJ
10_1101-2021_01_07_425723	282	118	GFP	GFP	NNP
10_1101-2021_01_07_425723	282	119	dropout	dropout	NN
10_1101-2021_01_07_425723	282	120	Lee	Lee	NNP
10_1101-2021_01_07_425723	282	121	et	et	FW
10_1101-2021_01_07_425723	282	122	al	al	NNP
10_1101-2021_01_07_425723	282	123	.	.	NNP
10_1101-2021_01_07_425723	282	124	,	,	,
10_1101-2021_01_07_425723	282	125	2015	2015	CD
10_1101-2021_01_07_425723	282	126	60	60	CD
10_1101-2021_01_07_425723	282	127	pYTK053	pYTK053	NNP
10_1101-2021_01_07_425723	282	128	ori	ori	NN
10_1101-2021_01_07_425723	282	129	camR	camR	NNP
10_1101-2021_01_07_425723	282	130	ScADH1	ScADH1	NNP
10_1101-2021_01_07_425723	282	131	t	t	NNP
10_1101-2021_01_07_425723	282	132	Lee	Lee	NNP
10_1101-2021_01_07_425723	282	133	et	et	FW
10_1101-2021_01_07_425723	282	134	al	al	NNP
10_1101-2021_01_07_425723	282	135	.	.	NNP
10_1101-2021_01_07_425723	282	136	,	,	,
10_1101-2021_01_07_425723	282	137	2015	2015	CD
10_1101-2021_01_07_425723	282	138	60	60	CD
10_1101-2021_01_07_425723	282	139	pYTK073	pYTK073	NNP
10_1101-2021_01_07_425723	282	140	ori	ori	NN
10_1101-2021_01_07_425723	282	141	camR	camr	NN
10_1101-2021_01_07_425723	282	142	ConRE	ConRE	NNP
10_1101-2021_01_07_425723	282	143	'	'	''
10_1101-2021_01_07_425723	282	144	Lee	Lee	NNP
10_1101-2021_01_07_425723	282	145	et	et	NNP
10_1101-2021_01_07_425723	282	146	al	al	NNP
10_1101-2021_01_07_425723	282	147	.	.	NNP
10_1101-2021_01_07_425723	282	148	,	,	,
10_1101-2021_01_07_425723	282	149	2015	2015	CD
10_1101-2021_01_07_425723	282	150	60	60	CD
10_1101-2021_01_07_425723	282	151	pYTK079	pYTK079	NNP
10_1101-2021_01_07_425723	282	152	ori	ori	NN
10_1101-2021_01_07_425723	282	153	camR	camr	NN
10_1101-2021_01_07_425723	282	154	hygB	hygb	ADD
10_1101-2021_01_07_425723	282	155	Lee	Lee	NNP
10_1101-2021_01_07_425723	282	156	et	et	NNP
10_1101-2021_01_07_425723	282	157	al	al	NNP
10_1101-2021_01_07_425723	282	158	.	.	NNP
10_1101-2021_01_07_425723	282	159	,	,	,
10_1101-2021_01_07_425723	282	160	2015	2015	CD
10_1101-2021_01_07_425723	282	161	60	60	CD
10_1101-2021_01_07_425723	282	162	418	418	CD
10_1101-2021_01_07_425723	282	163	.CC	.CC	:
10_1101-2021_01_07_425723	282	164	-	-	HYPH
10_1101-2021_01_07_425723	282	165	BY	by	IN
10_1101-2021_01_07_425723	282	166	-	-	HYPH
10_1101-2021_01_07_425723	282	167	NC	NC	NNP
10_1101-2021_01_07_425723	282	168	-	-	HYPH
10_1101-2021_01_07_425723	282	169	ND	ND	NNP
10_1101-2021_01_07_425723	282	170	4.0	4.0	CD
10_1101-2021_01_07_425723	282	171	International	International	NNP
10_1101-2021_01_07_425723	282	172	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	282	173	under	under	IN
10_1101-2021_01_07_425723	282	174	a	a	DT
10_1101-2021_01_07_425723	282	175	(	(	-LRB-
10_1101-2021_01_07_425723	282	176	which	which	WDT
10_1101-2021_01_07_425723	282	177	was	be	VBD
10_1101-2021_01_07_425723	282	178	not	not	RB
10_1101-2021_01_07_425723	282	179	certified	certify	VBN
10_1101-2021_01_07_425723	282	180	by	by	IN
10_1101-2021_01_07_425723	282	181	peer	peer	NN
10_1101-2021_01_07_425723	282	182	review	review	NN
10_1101-2021_01_07_425723	282	183	)	)	-RRB-
10_1101-2021_01_07_425723	282	184	is	be	VBZ
10_1101-2021_01_07_425723	282	185	the	the	DT
10_1101-2021_01_07_425723	282	186	author	author	NN
10_1101-2021_01_07_425723	282	187	/	/	SYM
10_1101-2021_01_07_425723	282	188	funder	funder	NN
10_1101-2021_01_07_425723	282	189	,	,	,
10_1101-2021_01_07_425723	282	190	who	who	WP
10_1101-2021_01_07_425723	282	191	has	have	VBZ
10_1101-2021_01_07_425723	282	192	granted	grant	VBN
10_1101-2021_01_07_425723	282	193	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	282	194	a	a	DT
10_1101-2021_01_07_425723	282	195	license	license	NN
10_1101-2021_01_07_425723	282	196	to	to	TO
10_1101-2021_01_07_425723	282	197	display	display	VB
10_1101-2021_01_07_425723	282	198	the	the	DT
10_1101-2021_01_07_425723	282	199	preprint	preprint	NN
10_1101-2021_01_07_425723	282	200	in	in	IN
10_1101-2021_01_07_425723	282	201	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	282	202	.	.	.
10_1101-2021_01_07_425723	283	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	283	2	is	be	VBZ
10_1101-2021_01_07_425723	283	3	made	make	VBN
10_1101-2021_01_07_425723	283	4	The	the	DT
10_1101-2021_01_07_425723	283	5	copyright	copyright	NN
10_1101-2021_01_07_425723	283	6	holder	holder	NN
10_1101-2021_01_07_425723	283	7	for	for	IN
10_1101-2021_01_07_425723	283	8	this	this	DT
10_1101-2021_01_07_425723	283	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	283	10	version	version	NN
10_1101-2021_01_07_425723	283	11	posted	post	VBD
10_1101-2021_01_07_425723	283	12	January	January	NNP
10_1101-2021_01_07_425723	283	13	8	8	CD
10_1101-2021_01_07_425723	283	14	,	,	,
10_1101-2021_01_07_425723	283	15	2021	2021	CD
10_1101-2021_01_07_425723	283	16	.	.	.
10_1101-2021_01_07_425723	283	17	;	;	:
10_1101-2021_01_07_425723	283	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	283	19	:	:	:
10_1101-2021_01_07_425723	283	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	283	21	preprint	preprint	NN
10_1101-2021_01_07_425723	283	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	283	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CC
10_1101-2021_01_07_425723	283	24	26	26	CD
10_1101-2021_01_07_425723	283	25	Table	table	NN
10_1101-2021_01_07_425723	283	26	5	5	CD
10_1101-2021_01_07_425723	283	27	|	|	CD
10_1101-2021_01_07_425723	283	28	Oligonucleotide	oligonucleotide	JJ
10_1101-2021_01_07_425723	283	29	primers	primer	NNS
10_1101-2021_01_07_425723	283	30	used	use	VBN
10_1101-2021_01_07_425723	283	31	in	in	IN
10_1101-2021_01_07_425723	283	32	this	this	DT
10_1101-2021_01_07_425723	283	33	study	study	NN
10_1101-2021_01_07_425723	283	34	.	.	.
10_1101-2021_01_07_425723	284	1	419	419	CD
10_1101-2021_01_07_425723	284	2	Primer	Primer	NNP
10_1101-2021_01_07_425723	284	3	Sequence	Sequence	NNP
10_1101-2021_01_07_425723	284	4	(	(	-LRB-
10_1101-2021_01_07_425723	284	5	5'->3	5'->3	CD
10_1101-2021_01_07_425723	284	6	'	'	POS
10_1101-2021_01_07_425723	284	7	)	)	-RRB-
10_1101-2021_01_07_425723	284	8	11228	11228	CD
10_1101-2021_01_07_425723	284	9	TGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCCATTATTGTAAATGATTTGGGTTTTA	TGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCCATTATTGTAAATGATTTGGGTTTTA	NNP
10_1101-2021_01_07_425723	284	10	GAGCTAGAAATAGCAAGTTAAAATAAG	GAGCTAGAAATAGCAAGTTAAAATAAG	NNP
10_1101-2021_01_07_425723	284	11	11232	11232	CD
10_1101-2021_01_07_425723	284	12	TGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCATCTTTCATATAAATAACATGTTTTA	TGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCATCTTTCATATAAATAACATGTTTTA	NNP
10_1101-2021_01_07_425723	284	13	GAGCTAGAAATAGCAAGTTAAAATAAG	GAGCTAGAAATAGCAAGTTAAAATAAG	NNP
10_1101-2021_01_07_425723	284	14	11233	11233	CD
10_1101-2021_01_07_425723	284	15	TAGTAAAGACTGCTGTAATTCATCTCTCAGTCCTTGCAGTCTGCTTTTTCTGGAATTAATTACCATTTTTAAATAT	TAGTAAAGACTGCTGTAATTCATCTCTCAGTCCTTGCAGTCTGCTTTTTCTGGAATTAATTACCATTTTTAAATAT	NNP
10_1101-2021_01_07_425723	284	16	ATTTCTACTTTCTACTTAATAGCAATTTTAATTAATCTAATTAT	atttctactttctacttaatagcaattttaattaatctaattat	NN
10_1101-2021_01_07_425723	284	17	11234	11234	CD
10_1101-2021_01_07_425723	284	18	ATAATTAGATTAATTAAAATTGCTATTAAGTAGAAAGTAGAAATATATTTAAAAATGGTAATTAATTCCAGAAAAA	ATAATTAGATTAATTAAAATTGCTATTAAGTAGAAAGTAGAAATATATTTAAAAATGGTAATTAATTCCAGAAAAA	NNP
10_1101-2021_01_07_425723	284	19	GCAGACTGCAAGGACTGAGAGATGAATTACAGCAGTCTTTACTA	GCAGACTGCAAGGACTGAGAGATGAATTACAGCAGTCTTTACTA	NNP
10_1101-2021_01_07_425723	284	20	11241	11241	CD
10_1101-2021_01_07_425723	284	21	TAGCAAAAAAATTCACAACTAAACACGATAGAGTAAAATTAGAGAAGCAACGCCTCGCGGTCAGTGAATAGCGTTC	tagcaaaaaaattcacaactaaacacgatagagtaaaattagagaagcaacgcctcgcggtcagtgaatagcgttc	NN
10_1101-2021_01_07_425723	284	22	CGTTAGAAAACATTCAAAATTACCTAATACTATTCAACAGTTCT	CGTTAGAAAACATTCAAAATTACCTAATACTATTCAACAGTTCT	VBD
10_1101-2021_01_07_425723	284	23	11242	11242	CD
10_1101-2021_01_07_425723	284	24	AGAACTGTTGAATAGTATTAGGTAATTTTGAATGTTTTCTAACGGAACGCTATTCACTGACCGCGAGGCGTTGCTT	AGAACTGTTGAATAGTATTAGGTAATTTTGAATGTTTTCTAACGGAACGCTATTCACTGACCGCGAGGCGTTGCTT	NNP
10_1101-2021_01_07_425723	284	25	CTCTAATTTTACTCTATCGTGTTTAGTTGTGAATTTTTTTGCTA	CTCTAATTTTACTCTATCGTGTTTAGTTGTGAATTTTTTTGCTA	NNP
10_1101-2021_01_07_425723	284	26	11243	11243	CD
10_1101-2021_01_07_425723	284	27	TGTCACTACAGCCACAGCAG	tgtcactacagccacagcag	NN
10_1101-2021_01_07_425723	284	28	11244	11244	CD
10_1101-2021_01_07_425723	284	29	TTGGTAAGGCGCCACACTAG	TTGGTAAGGCGCCACACTAG	VBD
10_1101-2021_01_07_425723	284	30	11251	11251	CD
10_1101-2021_01_07_425723	284	31	AGAGAAGCGCCACATAGACG	AGAGAAGCGCCACATAGACG	NNP
10_1101-2021_01_07_425723	284	32	11252	11252	CD
10_1101-2021_01_07_425723	284	33	TGCATATGCTACGGGTGACG	tgcatatgctacgggtgacg	NN
10_1101-2021_01_07_425723	284	34	11897	11897	CD
10_1101-2021_01_07_425723	284	35	CACCCAAGTATGGTGGGTAG	CACCCAAGTATGGTGGGTAG	VBD
10_1101-2021_01_07_425723	284	36	14148	14148	CD
10_1101-2021_01_07_425723	284	37	AAGCATCGTCTCATCGGTCTCATATGTCAATTTCAAAGTACTTCACTCCCGTTGCTGAC	AAGCATCGTCTCATCGGTCTCATATGTCAATTTCAAAGTACTTCACTCCCGTTGCTGAC	NNP
10_1101-2021_01_07_425723	284	38	14149	14149	CD
10_1101-2021_01_07_425723	284	39	TTATGCCGTCTCAGGTCTCAGGATTTAGTTCTGTACAGGCTTCTTC	ttatgccgtctcaggtctcaggatttagttctgtacaggcttcttc	NN
10_1101-2021_01_07_425723	284	40	14150	14150	CD
10_1101-2021_01_07_425723	284	41	TTATGCCGTCTCAGGTCTCAAGAATTAGTTCTGTACAGGCTTCTTC	ttatgccgtctcaggtctcaagaattagttctgtacaggcttcttc	NN
10_1101-2021_01_07_425723	284	42	14151	14151	CD
10_1101-2021_01_07_425723	284	43	AAGCATCGTCTCATCGGTCTCATATGTCTTTCACTAAAATCGCTGCCTTATTAG	aagcatcgtctcatcggtctcatatgtctttcactaaaatcgctgccttattag	JJ
10_1101-2021_01_07_425723	284	44	14152	14152	CD
10_1101-2021_01_07_425723	284	45	TTATGCCGTCTCAGGTCTCAGGATATCATAAGAGCATAGCAGCGGCACCGGCAATAG	TTATGCCGTCTCAGGTCTCAGGATATCATAAGAGCATAGCAGCGGCACCGGCAATAG	NNP
10_1101-2021_01_07_425723	284	46	14197	14197	CD
10_1101-2021_01_07_425723	284	47	AAGCATCGTCTCATCGGTCTCACAATGAAAGTGATTGAAGAACCCTCAAAC	AAGCATCGTCTCATCGGTCTCACAATGAAAGTGATTGAAGAACCCTCAAAC	NNP
10_1101-2021_01_07_425723	284	48	14198	14198	CD
10_1101-2021_01_07_425723	284	49	TTATGCCGTCTCAGGTCTCAAGGGTTAAGCAATTGGATCCTACC	TTATGCCGTCTCAGGTCTCAAGGGTTAAGCAATTGGATCCTACC	NNP
10_1101-2021_01_07_425723	284	50	14199	14199	CD
10_1101-2021_01_07_425723	284	51	AAGCATCGTCTCATCGGTCTCAGAGTTGCTTAATTAGCTTGTACATGGCTTTG	AAGCATCGTCTCATCGGTCTCAGAGTTGCTTAATTAGCTTGTACATGGCTTTG	NNP
10_1101-2021_01_07_425723	284	52	14200	14200	CD
10_1101-2021_01_07_425723	284	53	TTATGCCGTCTCAGGTCTCATCGGGAAGGCCCATATTGAAGACG	ttatgccgtctcaggtctcatcgggaaggcccatattgaagacg	NN
10_1101-2021_01_07_425723	284	54	14339	14339	CD
10_1101-2021_01_07_425723	284	55	CCCAAATCATTTACAATAATGGATCATTTATC	cccaaatcatttacaataatggatcatttatc	NN
10_1101-2021_01_07_425723	284	56	14340	14340	CD
10_1101-2021_01_07_425723	284	57	CATGTTATTTATATGAAAGATGATCATTTATC	catgttatttatatgaaagatgatcatttatc	NN
10_1101-2021_01_07_425723	284	58	16366	16366	CD
10_1101-2021_01_07_425723	284	59	GTCCCTAGGTTCGTCATT	GTCCCTAGGTTCGTCATT	NNP
10_1101-2021_01_07_425723	284	60	16367	16367	CD
10_1101-2021_01_07_425723	284	61	CAAGATCAATGGTGGCTCTC	CAAGATCAATGGTGGCTCTC	NNP
10_1101-2021_01_07_425723	284	62	420	420	CD
10_1101-2021_01_07_425723	284	63	Strain	strain	NN
10_1101-2021_01_07_425723	284	64	construction	construction	NN
10_1101-2021_01_07_425723	284	65	421	421	CD
10_1101-2021_01_07_425723	284	66	The	the	DT
10_1101-2021_01_07_425723	284	67	lithium	lithium	NN
10_1101-2021_01_07_425723	284	68	-	-	HYPH
10_1101-2021_01_07_425723	284	69	acetate	acetate	JJ
10_1101-2021_01_07_425723	284	70	/	/	SYM
10_1101-2021_01_07_425723	284	71	polyethylene	polyethylene	NN
10_1101-2021_01_07_425723	284	72	-	-	HYPH
10_1101-2021_01_07_425723	284	73	glycol	glycol	JJ
10_1101-2021_01_07_425723	284	74	method	method	NN
10_1101-2021_01_07_425723	284	75	was	be	VBD
10_1101-2021_01_07_425723	284	76	used	use	VBN
10_1101-2021_01_07_425723	284	77	for	for	IN
10_1101-2021_01_07_425723	284	78	yeast	yeast	NN
10_1101-2021_01_07_425723	284	79	transformation64	transformation64	NN
10_1101-2021_01_07_425723	284	80	.	.	.
10_1101-2021_01_07_425723	285	1	Homologous	homologous	JJ
10_1101-2021_01_07_425723	285	2	422	422	CD
10_1101-2021_01_07_425723	285	3	repair	repair	NN
10_1101-2021_01_07_425723	285	4	(	(	-LRB-
10_1101-2021_01_07_425723	285	5	HR	hr	NN
10_1101-2021_01_07_425723	285	6	)	)	-RRB-
10_1101-2021_01_07_425723	285	7	DNA	dna	NN
10_1101-2021_01_07_425723	285	8	fragments	fragment	NNS
10_1101-2021_01_07_425723	285	9	for	for	IN
10_1101-2021_01_07_425723	285	10	markerless	markerless	JJ
10_1101-2021_01_07_425723	285	11	CRISPR	CRISPR	NNP
10_1101-2021_01_07_425723	285	12	-	-	HYPH
10_1101-2021_01_07_425723	285	13	Cas9-mediated	cas9-mediate	VBN
10_1101-2021_01_07_425723	285	14	gene	gene	NN
10_1101-2021_01_07_425723	285	15	deletions	deletion	NNS
10_1101-2021_01_07_425723	285	16	in	in	IN
10_1101-2021_01_07_425723	285	17	S.	S.	NNP
10_1101-2021_01_07_425723	285	18	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	285	19	were	be	VBD
10_1101-2021_01_07_425723	285	20	423	423	CD
10_1101-2021_01_07_425723	285	21	constructed	construct	VBN
10_1101-2021_01_07_425723	285	22	by	by	IN
10_1101-2021_01_07_425723	285	23	annealing	anneal	VBG
10_1101-2021_01_07_425723	285	24	two	two	CD
10_1101-2021_01_07_425723	285	25	120	120	CD
10_1101-2021_01_07_425723	285	26	bp	bp	NN
10_1101-2021_01_07_425723	285	27	primers	primer	NNS
10_1101-2021_01_07_425723	285	28	,	,	,
10_1101-2021_01_07_425723	285	29	using	use	VBG
10_1101-2021_01_07_425723	285	30	primer	primer	NNP
10_1101-2021_01_07_425723	285	31	pairs	pairs	NNP
10_1101-2021_01_07_425723	285	32	11241/11242	11241/11242	CD
10_1101-2021_01_07_425723	285	33	and	and	CC
10_1101-2021_01_07_425723	285	34	11233/11234	11233/11234	CD
10_1101-2021_01_07_425723	285	35	for	for	IN
10_1101-2021_01_07_425723	285	36	424	424	CD
10_1101-2021_01_07_425723	285	37	deletion	deletion	NN
10_1101-2021_01_07_425723	285	38	of	of	IN
10_1101-2021_01_07_425723	285	39	PDR11	PDR11	NNP
10_1101-2021_01_07_425723	285	40	and	and	CC
10_1101-2021_01_07_425723	285	41	AUS1	AUS1	NNP
10_1101-2021_01_07_425723	285	42	,	,	,
10_1101-2021_01_07_425723	285	43	respectively	respectively	RB
10_1101-2021_01_07_425723	285	44	.	.	.
10_1101-2021_01_07_425723	286	1	After	after	IN
10_1101-2021_01_07_425723	286	2	transformation	transformation	NN
10_1101-2021_01_07_425723	286	3	of	of	IN
10_1101-2021_01_07_425723	286	4	S.	S.	NNP
10_1101-2021_01_07_425723	286	5	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	286	6	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	286	7	with	with	IN
10_1101-2021_01_07_425723	286	8	gRNA	grna	NN
10_1101-2021_01_07_425723	286	9	425	425	CD
10_1101-2021_01_07_425723	286	10	plasmids	plasmid	NNS
10_1101-2021_01_07_425723	286	11	pUDE659	pUDE659	NNPS
10_1101-2021_01_07_425723	286	12	and	and	CC
10_1101-2021_01_07_425723	286	13	pUDE663	pUDE663	NNP
10_1101-2021_01_07_425723	286	14	and	and	CC
10_1101-2021_01_07_425723	286	15	double	double	JJ
10_1101-2021_01_07_425723	286	16	-	-	HYPH
10_1101-2021_01_07_425723	286	17	stranded	strand	VBN
10_1101-2021_01_07_425723	286	18	repair	repair	NN
10_1101-2021_01_07_425723	286	19	fragments	fragment	NNS
10_1101-2021_01_07_425723	286	20	,	,	,
10_1101-2021_01_07_425723	286	21	transformants	transformant	NNS
10_1101-2021_01_07_425723	286	22	were	be	VBD
10_1101-2021_01_07_425723	286	23	selected	select	VBN
10_1101-2021_01_07_425723	286	24	426	426	CD
10_1101-2021_01_07_425723	286	25	on	on	IN
10_1101-2021_01_07_425723	286	26	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	286	27	medium	medium	NN
10_1101-2021_01_07_425723	286	28	with	with	IN
10_1101-2021_01_07_425723	286	29	acetamide	acetamide	NN
10_1101-2021_01_07_425723	286	30	as	as	IN
10_1101-2021_01_07_425723	286	31	sole	sole	JJ
10_1101-2021_01_07_425723	286	32	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	286	33	source65	source65	VBD
10_1101-2021_01_07_425723	286	34	.	.	.
10_1101-2021_01_07_425723	287	1	Deletion	deletion	NN
10_1101-2021_01_07_425723	287	2	of	of	IN
10_1101-2021_01_07_425723	287	3	AUS1	AUS1	NNP
10_1101-2021_01_07_425723	287	4	and	and	CC
10_1101-2021_01_07_425723	287	5	PDR11	PDR11	NNP
10_1101-2021_01_07_425723	287	6	was	be	VBD
10_1101-2021_01_07_425723	287	7	427	427	CD
10_1101-2021_01_07_425723	287	8	.CC	.CC	:
10_1101-2021_01_07_425723	287	9	-	-	HYPH
10_1101-2021_01_07_425723	287	10	BY	by	IN
10_1101-2021_01_07_425723	287	11	-	-	HYPH
10_1101-2021_01_07_425723	287	12	NC	NC	NNP
10_1101-2021_01_07_425723	287	13	-	-	HYPH
10_1101-2021_01_07_425723	287	14	ND	ND	NNP
10_1101-2021_01_07_425723	287	15	4.0	4.0	CD
10_1101-2021_01_07_425723	287	16	International	International	NNP
10_1101-2021_01_07_425723	287	17	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	287	18	under	under	IN
10_1101-2021_01_07_425723	287	19	a	a	DT
10_1101-2021_01_07_425723	287	20	(	(	-LRB-
10_1101-2021_01_07_425723	287	21	which	which	WDT
10_1101-2021_01_07_425723	287	22	was	be	VBD
10_1101-2021_01_07_425723	287	23	not	not	RB
10_1101-2021_01_07_425723	287	24	certified	certify	VBN
10_1101-2021_01_07_425723	287	25	by	by	IN
10_1101-2021_01_07_425723	287	26	peer	peer	NN
10_1101-2021_01_07_425723	287	27	review	review	NN
10_1101-2021_01_07_425723	287	28	)	)	-RRB-
10_1101-2021_01_07_425723	287	29	is	be	VBZ
10_1101-2021_01_07_425723	287	30	the	the	DT
10_1101-2021_01_07_425723	287	31	author	author	NN
10_1101-2021_01_07_425723	287	32	/	/	SYM
10_1101-2021_01_07_425723	287	33	funder	funder	NN
10_1101-2021_01_07_425723	287	34	,	,	,
10_1101-2021_01_07_425723	287	35	who	who	WP
10_1101-2021_01_07_425723	287	36	has	have	VBZ
10_1101-2021_01_07_425723	287	37	granted	grant	VBN
10_1101-2021_01_07_425723	287	38	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	287	39	a	a	DT
10_1101-2021_01_07_425723	287	40	license	license	NN
10_1101-2021_01_07_425723	287	41	to	to	TO
10_1101-2021_01_07_425723	287	42	display	display	VB
10_1101-2021_01_07_425723	287	43	the	the	DT
10_1101-2021_01_07_425723	287	44	preprint	preprint	NN
10_1101-2021_01_07_425723	287	45	in	in	IN
10_1101-2021_01_07_425723	287	46	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	287	47	.	.	.
10_1101-2021_01_07_425723	288	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	288	2	is	be	VBZ
10_1101-2021_01_07_425723	288	3	made	make	VBN
10_1101-2021_01_07_425723	288	4	The	the	DT
10_1101-2021_01_07_425723	288	5	copyright	copyright	NN
10_1101-2021_01_07_425723	288	6	holder	holder	NN
10_1101-2021_01_07_425723	288	7	for	for	IN
10_1101-2021_01_07_425723	288	8	this	this	DT
10_1101-2021_01_07_425723	288	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	288	10	version	version	NN
10_1101-2021_01_07_425723	288	11	posted	post	VBD
10_1101-2021_01_07_425723	288	12	January	January	NNP
10_1101-2021_01_07_425723	288	13	8	8	CD
10_1101-2021_01_07_425723	288	14	,	,	,
10_1101-2021_01_07_425723	288	15	2021	2021	CD
10_1101-2021_01_07_425723	288	16	.	.	.
10_1101-2021_01_07_425723	288	17	;	;	:
10_1101-2021_01_07_425723	288	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	288	19	:	:	:
10_1101-2021_01_07_425723	288	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	288	21	preprint	preprint	NN
10_1101-2021_01_07_425723	288	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	288	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	288	24	27	27	CD
10_1101-2021_01_07_425723	288	25	confirmed	confirm	VBN
10_1101-2021_01_07_425723	288	26	by	by	IN
10_1101-2021_01_07_425723	288	27	PCR	PCR	NNP
10_1101-2021_01_07_425723	288	28	amplification	amplification	NN
10_1101-2021_01_07_425723	288	29	with	with	IN
10_1101-2021_01_07_425723	288	30	primer	primer	NNP
10_1101-2021_01_07_425723	288	31	pairs	pairs	NNP
10_1101-2021_01_07_425723	288	32	11243/11244	11243/11244	CD
10_1101-2021_01_07_425723	288	33	and	and	CC
10_1101-2021_01_07_425723	288	34	11251/11252	11251/11252	CD
10_1101-2021_01_07_425723	288	35	,	,	,
10_1101-2021_01_07_425723	288	36	respectively	respectively	RB
10_1101-2021_01_07_425723	288	37	.	.	.
10_1101-2021_01_07_425723	289	1	Loss	loss	NN
10_1101-2021_01_07_425723	289	2	of	of	IN
10_1101-2021_01_07_425723	289	3	428	428	CD
10_1101-2021_01_07_425723	289	4	gRNA	grna	NN
10_1101-2021_01_07_425723	289	5	plasmids	plasmid	NNS
10_1101-2021_01_07_425723	289	6	was	be	VBD
10_1101-2021_01_07_425723	289	7	induced	induce	VBN
10_1101-2021_01_07_425723	289	8	by	by	IN
10_1101-2021_01_07_425723	289	9	cultivation	cultivation	NN
10_1101-2021_01_07_425723	289	10	of	of	IN
10_1101-2021_01_07_425723	289	11	single	single	JJ
10_1101-2021_01_07_425723	289	12	-	-	HYPH
10_1101-2021_01_07_425723	289	13	colony	colony	NN
10_1101-2021_01_07_425723	289	14	isolates	isolate	NNS
10_1101-2021_01_07_425723	289	15	on	on	IN
10_1101-2021_01_07_425723	289	16	YPD	YPD	NNP
10_1101-2021_01_07_425723	289	17	,	,	,
10_1101-2021_01_07_425723	289	18	after	after	IN
10_1101-2021_01_07_425723	289	19	which	which	WDT
10_1101-2021_01_07_425723	289	20	plasmid	plasmid	NN
10_1101-2021_01_07_425723	289	21	loss	loss	NN
10_1101-2021_01_07_425723	289	22	was	be	VBD
10_1101-2021_01_07_425723	289	23	429	429	CD
10_1101-2021_01_07_425723	289	24	assessed	assess	VBN
10_1101-2021_01_07_425723	289	25	by	by	IN
10_1101-2021_01_07_425723	289	26	absence	absence	NN
10_1101-2021_01_07_425723	289	27	of	of	IN
10_1101-2021_01_07_425723	289	28	growth	growth	NN
10_1101-2021_01_07_425723	289	29	of	of	IN
10_1101-2021_01_07_425723	289	30	single	single	JJ
10_1101-2021_01_07_425723	289	31	-	-	HYPH
10_1101-2021_01_07_425723	289	32	cell	cell	NN
10_1101-2021_01_07_425723	289	33	isolates	isolate	NNS
10_1101-2021_01_07_425723	289	34	on	on	IN
10_1101-2021_01_07_425723	289	35	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	289	36	medium	medium	NN
10_1101-2021_01_07_425723	289	37	with	with	IN
10_1101-2021_01_07_425723	289	38	acetamide	acetamide	NN
10_1101-2021_01_07_425723	289	39	as	as	IN
10_1101-2021_01_07_425723	289	40	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	289	41	430	430	CD
10_1101-2021_01_07_425723	289	42	source	source	NN
10_1101-2021_01_07_425723	289	43	.	.	.
10_1101-2021_01_07_425723	290	1	An	an	DT
10_1101-2021_01_07_425723	290	2	aus1Δ	aus1Δ	NNP
10_1101-2021_01_07_425723	290	3	pdr11Δ	pdr11Δ	NNP
10_1101-2021_01_07_425723	290	4	double	double	JJ
10_1101-2021_01_07_425723	290	5	-	-	HYPH
10_1101-2021_01_07_425723	290	6	deletion	deletion	NN
10_1101-2021_01_07_425723	290	7	strain	strain	NN
10_1101-2021_01_07_425723	290	8	was	be	VBD
10_1101-2021_01_07_425723	290	9	similarly	similarly	RB
10_1101-2021_01_07_425723	290	10	constructed	construct	VBN
10_1101-2021_01_07_425723	290	11	by	by	IN
10_1101-2021_01_07_425723	290	12	chemical	chemical	JJ
10_1101-2021_01_07_425723	290	13	transformation	transformation	NN
10_1101-2021_01_07_425723	290	14	of	of	IN
10_1101-2021_01_07_425723	290	15	431	431	CD
10_1101-2021_01_07_425723	290	16	S.	S.	NNP
10_1101-2021_01_07_425723	290	17	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	290	18	IMK802	IMK802	NNP
10_1101-2021_01_07_425723	290	19	with	with	IN
10_1101-2021_01_07_425723	290	20	pUDE663	pUDE663	NNP
10_1101-2021_01_07_425723	290	21	and	and	CC
10_1101-2021_01_07_425723	290	22	repair	repair	NN
10_1101-2021_01_07_425723	290	23	DNA	dna	NN
10_1101-2021_01_07_425723	290	24	.	.	.
10_1101-2021_01_07_425723	291	1	To	to	TO
10_1101-2021_01_07_425723	291	2	integrate	integrate	VB
10_1101-2021_01_07_425723	291	3	a	a	DT
10_1101-2021_01_07_425723	291	4	TtSTC1	ttstc1	JJ
10_1101-2021_01_07_425723	291	5	expression	expression	NN
10_1101-2021_01_07_425723	291	6	cassette	cassette	NN
10_1101-2021_01_07_425723	291	7	into	into	IN
10_1101-2021_01_07_425723	291	8	the	the	DT
10_1101-2021_01_07_425723	291	9	432	432	CD
10_1101-2021_01_07_425723	291	10	K.	K.	NNP
10_1101-2021_01_07_425723	291	11	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	291	12	lac4	lac4	NNP
10_1101-2021_01_07_425723	291	13	locus	locus	NN
10_1101-2021_01_07_425723	291	14	,	,	,
10_1101-2021_01_07_425723	291	15	K.	K.	NNP
10_1101-2021_01_07_425723	291	16	marxianus	marxianus	NN
10_1101-2021_01_07_425723	291	17	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	291	18	was	be	VBD
10_1101-2021_01_07_425723	291	19	transformed	transform	VBN
10_1101-2021_01_07_425723	291	20	with	with	IN
10_1101-2021_01_07_425723	291	21	2	2	CD
10_1101-2021_01_07_425723	291	22	μg	μg	,
10_1101-2021_01_07_425723	291	23	DNA	DNA	NNP
10_1101-2021_01_07_425723	291	24	NotI	NotI	NNP
10_1101-2021_01_07_425723	291	25	-	-	HYPH
10_1101-2021_01_07_425723	291	26	digested	digest	VBN
10_1101-2021_01_07_425723	291	27	433	433	CD
10_1101-2021_01_07_425723	291	28	pUDI246	pUDI246	NNP
10_1101-2021_01_07_425723	291	29	.	.	.
10_1101-2021_01_07_425723	292	1	After	after	IN
10_1101-2021_01_07_425723	292	2	centrifugation	centrifugation	NN
10_1101-2021_01_07_425723	292	3	,	,	,
10_1101-2021_01_07_425723	292	4	cells	cell	NNS
10_1101-2021_01_07_425723	292	5	were	be	VBD
10_1101-2021_01_07_425723	292	6	resuspended	resuspend	VBN
10_1101-2021_01_07_425723	292	7	in	in	IN
10_1101-2021_01_07_425723	292	8	YPD	YPD	NNP
10_1101-2021_01_07_425723	292	9	and	and	CC
10_1101-2021_01_07_425723	292	10	incubated	incubate	VBD
10_1101-2021_01_07_425723	292	11	at	at	IN
10_1101-2021_01_07_425723	292	12	30	30	CD
10_1101-2021_01_07_425723	292	13	°	°	,
10_1101-2021_01_07_425723	292	14	C	C	NNP
10_1101-2021_01_07_425723	292	15	for	for	IN
10_1101-2021_01_07_425723	292	16	3	3	CD
10_1101-2021_01_07_425723	292	17	h.	h.	NN
10_1101-2021_01_07_425723	292	18	Cells	Cells	NNPS
10_1101-2021_01_07_425723	292	19	were	be	VBD
10_1101-2021_01_07_425723	292	20	434	434	CD
10_1101-2021_01_07_425723	292	21	then	then	RB
10_1101-2021_01_07_425723	292	22	again	again	RB
10_1101-2021_01_07_425723	292	23	centrifuged	centrifuge	VBN
10_1101-2021_01_07_425723	292	24	,	,	,
10_1101-2021_01_07_425723	292	25	resuspended	resuspend	VBN
10_1101-2021_01_07_425723	292	26	in	in	IN
10_1101-2021_01_07_425723	292	27	demineralized	demineralized	JJ
10_1101-2021_01_07_425723	292	28	water	water	NN
10_1101-2021_01_07_425723	292	29	and	and	CC
10_1101-2021_01_07_425723	292	30	plated	plate	VBN
10_1101-2021_01_07_425723	292	31	on	on	IN
10_1101-2021_01_07_425723	292	32	200	200	CD
10_1101-2021_01_07_425723	292	33	µg·L-1	µg·l-1	JJ
10_1101-2021_01_07_425723	292	34	hygromycin	hygromycin	NN
10_1101-2021_01_07_425723	292	35	B	B	NNP
10_1101-2021_01_07_425723	292	36	435	435	CD
10_1101-2021_01_07_425723	292	37	(	(	-LRB-
10_1101-2021_01_07_425723	292	38	InvivoGen	invivogen	NN
10_1101-2021_01_07_425723	292	39	,	,	,
10_1101-2021_01_07_425723	292	40	Toulouse	Toulouse	NNP
10_1101-2021_01_07_425723	292	41	,	,	,
10_1101-2021_01_07_425723	292	42	France	France	NNP
10_1101-2021_01_07_425723	292	43	)	)	-RRB-
10_1101-2021_01_07_425723	292	44	containing	contain	VBG
10_1101-2021_01_07_425723	292	45	agar	agar	NN
10_1101-2021_01_07_425723	292	46	with	with	IN
10_1101-2021_01_07_425723	292	47	40	40	CD
10_1101-2021_01_07_425723	292	48	µg·L-1	µg·L-1	NNP
10_1101-2021_01_07_425723	292	49	X	x	NN
10_1101-2021_01_07_425723	292	50	-	-	NN
10_1101-2021_01_07_425723	292	51	gal	gal	NNP
10_1101-2021_01_07_425723	292	52	,	,	,
10_1101-2021_01_07_425723	292	53	5-bromo-4-chloro-3-indolyl	5-bromo-4-chloro-3-indolyl	CD
10_1101-2021_01_07_425723	292	54	-	-	HYPH
10_1101-2021_01_07_425723	292	55	β	β	FW
10_1101-2021_01_07_425723	292	56	-	-	HYPH
10_1101-2021_01_07_425723	292	57	D-436	D-436	NNP
10_1101-2021_01_07_425723	292	58	galactopyranoside	galactopyranoside	NN
10_1101-2021_01_07_425723	292	59	(	(	-LRB-
10_1101-2021_01_07_425723	292	60	Fermentas	Fermentas	NNP
10_1101-2021_01_07_425723	292	61	,	,	,
10_1101-2021_01_07_425723	292	62	Waltham	Waltham	NNP
10_1101-2021_01_07_425723	292	63	,	,	,
10_1101-2021_01_07_425723	292	64	MA	MA	NNP
10_1101-2021_01_07_425723	292	65	)	)	-RRB-
10_1101-2021_01_07_425723	292	66	.	.	.
10_1101-2021_01_07_425723	293	1	Colonies	colony	NNS
10_1101-2021_01_07_425723	293	2	that	that	WDT
10_1101-2021_01_07_425723	293	3	could	could	MD
10_1101-2021_01_07_425723	293	4	not	not	RB
10_1101-2021_01_07_425723	293	5	convert	convert	VB
10_1101-2021_01_07_425723	293	6	X	x	NN
10_1101-2021_01_07_425723	293	7	-	-	NN
10_1101-2021_01_07_425723	293	8	gal	gal	NNP
10_1101-2021_01_07_425723	293	9	were	be	VBD
10_1101-2021_01_07_425723	293	10	analyzed	analyze	VBN
10_1101-2021_01_07_425723	293	11	for	for	IN
10_1101-2021_01_07_425723	293	12	437	437	CD
10_1101-2021_01_07_425723	293	13	correct	correct	JJ
10_1101-2021_01_07_425723	293	14	genomic	genomic	JJ
10_1101-2021_01_07_425723	293	15	integration	integration	NN
10_1101-2021_01_07_425723	293	16	of	of	IN
10_1101-2021_01_07_425723	293	17	the	the	DT
10_1101-2021_01_07_425723	293	18	TtSTC1	ttstc1	NN
10_1101-2021_01_07_425723	293	19	by	by	IN
10_1101-2021_01_07_425723	293	20	diagnostic	diagnostic	JJ
10_1101-2021_01_07_425723	293	21	PCR	PCR	NNP
10_1101-2021_01_07_425723	293	22	with	with	IN
10_1101-2021_01_07_425723	293	23	primers	primer	NNS
10_1101-2021_01_07_425723	293	24	16366	16366	CD
10_1101-2021_01_07_425723	293	25	,	,	,
10_1101-2021_01_07_425723	293	26	16367	16367	CD
10_1101-2021_01_07_425723	293	27	and	and	CC
10_1101-2021_01_07_425723	293	28	11897	11897	CD
10_1101-2021_01_07_425723	293	29	.	.	.
10_1101-2021_01_07_425723	294	1	438	438	CD
10_1101-2021_01_07_425723	294	2	Genomic	genomic	JJ
10_1101-2021_01_07_425723	294	3	integration	integration	NN
10_1101-2021_01_07_425723	294	4	of	of	IN
10_1101-2021_01_07_425723	294	5	TtSTC1	ttstc1	NN
10_1101-2021_01_07_425723	294	6	into	into	IN
10_1101-2021_01_07_425723	294	7	the	the	DT
10_1101-2021_01_07_425723	294	8	chromosome	chromosome	NN
10_1101-2021_01_07_425723	294	9	outside	outside	IN
10_1101-2021_01_07_425723	294	10	the	the	DT
10_1101-2021_01_07_425723	294	11	lac4	lac4	NNP
10_1101-2021_01_07_425723	294	12	locus	locus	NN
10_1101-2021_01_07_425723	294	13	was	be	VBD
10_1101-2021_01_07_425723	294	14	confirmed	confirm	VBN
10_1101-2021_01_07_425723	294	15	by	by	IN
10_1101-2021_01_07_425723	294	16	short	short	JJ
10_1101-2021_01_07_425723	294	17	-	-	HYPH
10_1101-2021_01_07_425723	294	18	read	read	VBN
10_1101-2021_01_07_425723	294	19	439	439	CD
10_1101-2021_01_07_425723	294	20	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	294	21	sequencing	sequencing	NN
10_1101-2021_01_07_425723	294	22	.	.	.
10_1101-2021_01_07_425723	295	1	440	440	CD
10_1101-2021_01_07_425723	295	2	Chemostat	chemostat	JJ
10_1101-2021_01_07_425723	295	3	cultivation	cultivation	NN
10_1101-2021_01_07_425723	295	4	441	441	CD
10_1101-2021_01_07_425723	295	5	Chemostat	chemostat	JJ
10_1101-2021_01_07_425723	295	6	cultures	culture	NNS
10_1101-2021_01_07_425723	295	7	were	be	VBD
10_1101-2021_01_07_425723	295	8	grown	grow	VBN
10_1101-2021_01_07_425723	295	9	at	at	IN
10_1101-2021_01_07_425723	295	10	30	30	CD
10_1101-2021_01_07_425723	295	11	°	°	,
10_1101-2021_01_07_425723	295	12	C	C	NNP
10_1101-2021_01_07_425723	295	13	in	in	IN
10_1101-2021_01_07_425723	295	14	2	2	CD
10_1101-2021_01_07_425723	295	15	L	l	NN
10_1101-2021_01_07_425723	295	16	bioreactors	bioreactor	NNS
10_1101-2021_01_07_425723	295	17	(	(	-LRB-
10_1101-2021_01_07_425723	295	18	Applikon	Applikon	NNP
10_1101-2021_01_07_425723	295	19	,	,	,
10_1101-2021_01_07_425723	295	20	Delft	Delft	NNP
10_1101-2021_01_07_425723	295	21	,	,	,
10_1101-2021_01_07_425723	295	22	the	the	DT
10_1101-2021_01_07_425723	295	23	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	295	24	)	)	-RRB-
10_1101-2021_01_07_425723	295	25	with	with	IN
10_1101-2021_01_07_425723	295	26	a	a	DT
10_1101-2021_01_07_425723	295	27	442	442	CD
10_1101-2021_01_07_425723	295	28	stirrer	stirrer	NN
10_1101-2021_01_07_425723	295	29	speed	speed	NN
10_1101-2021_01_07_425723	295	30	of	of	IN
10_1101-2021_01_07_425723	295	31	800	800	CD
10_1101-2021_01_07_425723	295	32	rpm	rpm	NN
10_1101-2021_01_07_425723	295	33	.	.	.
10_1101-2021_01_07_425723	296	1	The	the	DT
10_1101-2021_01_07_425723	296	2	dilution	dilution	NN
10_1101-2021_01_07_425723	296	3	rate	rate	NN
10_1101-2021_01_07_425723	296	4	was	be	VBD
10_1101-2021_01_07_425723	296	5	set	set	VBN
10_1101-2021_01_07_425723	296	6	at	at	IN
10_1101-2021_01_07_425723	296	7	0.10	0.10	CD
10_1101-2021_01_07_425723	296	8	h-1	h-1	NNP
10_1101-2021_01_07_425723	296	9	and	and	CC
10_1101-2021_01_07_425723	296	10	a	a	DT
10_1101-2021_01_07_425723	296	11	constant	constant	JJ
10_1101-2021_01_07_425723	296	12	working	work	VBG
10_1101-2021_01_07_425723	296	13	volume	volume	NN
10_1101-2021_01_07_425723	296	14	of	of	IN
10_1101-2021_01_07_425723	296	15	1.2	1.2	CD
10_1101-2021_01_07_425723	296	16	L	L	NNP
10_1101-2021_01_07_425723	296	17	443	443	CD
10_1101-2021_01_07_425723	296	18	was	be	VBD
10_1101-2021_01_07_425723	296	19	maintained	maintain	VBN
10_1101-2021_01_07_425723	296	20	by	by	IN
10_1101-2021_01_07_425723	296	21	connecting	connect	VBG
10_1101-2021_01_07_425723	296	22	the	the	DT
10_1101-2021_01_07_425723	296	23	effluent	effluent	JJ
10_1101-2021_01_07_425723	296	24	pump	pump	NN
10_1101-2021_01_07_425723	296	25	to	to	IN
10_1101-2021_01_07_425723	296	26	a	a	DT
10_1101-2021_01_07_425723	296	27	level	level	NN
10_1101-2021_01_07_425723	296	28	sensor	sensor	NN
10_1101-2021_01_07_425723	296	29	.	.	.
10_1101-2021_01_07_425723	297	1	Cultures	culture	NNS
10_1101-2021_01_07_425723	297	2	were	be	VBD
10_1101-2021_01_07_425723	297	3	grown	grow	VBN
10_1101-2021_01_07_425723	297	4	on	on	IN
10_1101-2021_01_07_425723	297	5	synthetic	synthetic	JJ
10_1101-2021_01_07_425723	297	6	444	444	CD
10_1101-2021_01_07_425723	297	7	medium	medium	NN
10_1101-2021_01_07_425723	297	8	with	with	IN
10_1101-2021_01_07_425723	297	9	vitamins17	vitamins17	NN
10_1101-2021_01_07_425723	297	10	.	.	.
10_1101-2021_01_07_425723	298	1	Concentrated	concentrated	JJ
10_1101-2021_01_07_425723	298	2	glucose	glucose	NN
10_1101-2021_01_07_425723	298	3	solutions	solution	NNS
10_1101-2021_01_07_425723	298	4	were	be	VBD
10_1101-2021_01_07_425723	298	5	autoclaved	autoclave	VBN
10_1101-2021_01_07_425723	298	6	separately	separately	RB
10_1101-2021_01_07_425723	298	7	at	at	IN
10_1101-2021_01_07_425723	298	8	110	110	CD
10_1101-2021_01_07_425723	298	9	°	°	,
10_1101-2021_01_07_425723	298	10	C	C	NNP
10_1101-2021_01_07_425723	298	11	for	for	IN
10_1101-2021_01_07_425723	298	12	20	20	CD
10_1101-2021_01_07_425723	298	13	445	445	CD
10_1101-2021_01_07_425723	298	14	min	min	NN
10_1101-2021_01_07_425723	298	15	and	and	CC
10_1101-2021_01_07_425723	298	16	added	add	VBN
10_1101-2021_01_07_425723	298	17	at	at	IN
10_1101-2021_01_07_425723	298	18	the	the	DT
10_1101-2021_01_07_425723	298	19	concentrations	concentration	NNS
10_1101-2021_01_07_425723	298	20	indicated	indicate	VBN
10_1101-2021_01_07_425723	298	21	,	,	,
10_1101-2021_01_07_425723	298	22	along	along	IN
10_1101-2021_01_07_425723	298	23	with	with	IN
10_1101-2021_01_07_425723	298	24	sterile	sterile	JJ
10_1101-2021_01_07_425723	298	25	antifoam	antifoam	NNP
10_1101-2021_01_07_425723	298	26	pluronic	pluronic	NNP
10_1101-2021_01_07_425723	298	27	6100	6100	CD
10_1101-2021_01_07_425723	298	28	PE	PE	NNP
10_1101-2021_01_07_425723	298	29	(	(	-LRB-
10_1101-2021_01_07_425723	298	30	BASF	BASF	NNP
10_1101-2021_01_07_425723	298	31	,	,	,
10_1101-2021_01_07_425723	298	32	446	446	CD
10_1101-2021_01_07_425723	298	33	Ludwigshafen	Ludwigshafen	NNP
10_1101-2021_01_07_425723	298	34	,	,	,
10_1101-2021_01_07_425723	298	35	Germany	Germany	NNP
10_1101-2021_01_07_425723	298	36	;	;	:
10_1101-2021_01_07_425723	298	37	final	final	JJ
10_1101-2021_01_07_425723	298	38	concentration	concentration	NN
10_1101-2021_01_07_425723	298	39	0.2	0.2	CD
10_1101-2021_01_07_425723	298	40	g·L-1	g·L-1	NNP
10_1101-2021_01_07_425723	298	41	)	)	-RRB-
10_1101-2021_01_07_425723	298	42	.	.	.
10_1101-2021_01_07_425723	299	1	Before	before	IN
10_1101-2021_01_07_425723	299	2	autoclaving	autoclaving	NN
10_1101-2021_01_07_425723	299	3	,	,	,
10_1101-2021_01_07_425723	299	4	bioreactors	bioreactor	NNS
10_1101-2021_01_07_425723	299	5	were	be	VBD
10_1101-2021_01_07_425723	299	6	tested	test	VBN
10_1101-2021_01_07_425723	299	7	for	for	IN
10_1101-2021_01_07_425723	299	8	447	447	CD
10_1101-2021_01_07_425723	299	9	gas	gas	NN
10_1101-2021_01_07_425723	299	10	leakage	leakage	NN
10_1101-2021_01_07_425723	299	11	by	by	IN
10_1101-2021_01_07_425723	299	12	submerging	submerge	VBG
10_1101-2021_01_07_425723	299	13	them	-PRON-	PRP
10_1101-2021_01_07_425723	299	14	in	in	IN
10_1101-2021_01_07_425723	299	15	water	water	NN
10_1101-2021_01_07_425723	299	16	while	while	IN
10_1101-2021_01_07_425723	299	17	applying	apply	VBG
10_1101-2021_01_07_425723	299	18	a	a	DT
10_1101-2021_01_07_425723	299	19	0.3	0.3	CD
10_1101-2021_01_07_425723	299	20	bar	bar	NN
10_1101-2021_01_07_425723	299	21	overpressure	overpressure	NN
10_1101-2021_01_07_425723	299	22	.	.	.
10_1101-2021_01_07_425723	300	1	448	448	CD
10_1101-2021_01_07_425723	300	2	Anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	300	3	conditions	condition	NNS
10_1101-2021_01_07_425723	300	4	of	of	IN
10_1101-2021_01_07_425723	300	5	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	300	6	cultivations	cultivation	NNS
10_1101-2021_01_07_425723	300	7	were	be	VBD
10_1101-2021_01_07_425723	300	8	maintained	maintain	VBN
10_1101-2021_01_07_425723	300	9	by	by	IN
10_1101-2021_01_07_425723	300	10	continuous	continuous	JJ
10_1101-2021_01_07_425723	300	11	reactor	reactor	NN
10_1101-2021_01_07_425723	300	12	headspace	headspace	NN
10_1101-2021_01_07_425723	300	13	449	449	CD
10_1101-2021_01_07_425723	300	14	aeration	aeration	NN
10_1101-2021_01_07_425723	300	15	with	with	IN
10_1101-2021_01_07_425723	300	16	pure	pure	JJ
10_1101-2021_01_07_425723	300	17	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	300	18	gas	gas	NN
10_1101-2021_01_07_425723	300	19	(	(	-LRB-
10_1101-2021_01_07_425723	300	20	≤	≤	NNP
10_1101-2021_01_07_425723	300	21	0.5	0.5	CD
10_1101-2021_01_07_425723	300	22	ppm	ppm	NN
10_1101-2021_01_07_425723	300	23	O2	O2	VBN
10_1101-2021_01_07_425723	300	24	,	,	,
10_1101-2021_01_07_425723	300	25	HiQ	HiQ	NNP
10_1101-2021_01_07_425723	300	26	Nitrogen	Nitrogen	NNP
10_1101-2021_01_07_425723	300	27	6.0	6.0	CD
10_1101-2021_01_07_425723	300	28	,	,	,
10_1101-2021_01_07_425723	300	29	Linde	Linde	NNP
10_1101-2021_01_07_425723	300	30	AG	AG	NNP
10_1101-2021_01_07_425723	300	31	,	,	,
10_1101-2021_01_07_425723	300	32	Schiedam	Schiedam	NNP
10_1101-2021_01_07_425723	300	33	,	,	,
10_1101-2021_01_07_425723	300	34	the	the	DT
10_1101-2021_01_07_425723	300	35	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	300	36	)	)	-RRB-
10_1101-2021_01_07_425723	300	37	450	450	CD
10_1101-2021_01_07_425723	300	38	.CC	.CC	:
10_1101-2021_01_07_425723	300	39	-	-	HYPH
10_1101-2021_01_07_425723	300	40	BY	by	IN
10_1101-2021_01_07_425723	300	41	-	-	HYPH
10_1101-2021_01_07_425723	300	42	NC	NC	NNP
10_1101-2021_01_07_425723	300	43	-	-	HYPH
10_1101-2021_01_07_425723	300	44	ND	ND	NNP
10_1101-2021_01_07_425723	300	45	4.0	4.0	CD
10_1101-2021_01_07_425723	300	46	International	International	NNP
10_1101-2021_01_07_425723	300	47	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	300	48	under	under	IN
10_1101-2021_01_07_425723	300	49	a	a	DT
10_1101-2021_01_07_425723	300	50	(	(	-LRB-
10_1101-2021_01_07_425723	300	51	which	which	WDT
10_1101-2021_01_07_425723	300	52	was	be	VBD
10_1101-2021_01_07_425723	300	53	not	not	RB
10_1101-2021_01_07_425723	300	54	certified	certify	VBN
10_1101-2021_01_07_425723	300	55	by	by	IN
10_1101-2021_01_07_425723	300	56	peer	peer	NN
10_1101-2021_01_07_425723	300	57	review	review	NN
10_1101-2021_01_07_425723	300	58	)	)	-RRB-
10_1101-2021_01_07_425723	300	59	is	be	VBZ
10_1101-2021_01_07_425723	300	60	the	the	DT
10_1101-2021_01_07_425723	300	61	author	author	NN
10_1101-2021_01_07_425723	300	62	/	/	SYM
10_1101-2021_01_07_425723	300	63	funder	funder	NN
10_1101-2021_01_07_425723	300	64	,	,	,
10_1101-2021_01_07_425723	300	65	who	who	WP
10_1101-2021_01_07_425723	300	66	has	have	VBZ
10_1101-2021_01_07_425723	300	67	granted	grant	VBN
10_1101-2021_01_07_425723	300	68	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	300	69	a	a	DT
10_1101-2021_01_07_425723	300	70	license	license	NN
10_1101-2021_01_07_425723	300	71	to	to	TO
10_1101-2021_01_07_425723	300	72	display	display	VB
10_1101-2021_01_07_425723	300	73	the	the	DT
10_1101-2021_01_07_425723	300	74	preprint	preprint	NN
10_1101-2021_01_07_425723	300	75	in	in	IN
10_1101-2021_01_07_425723	300	76	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	300	77	.	.	.
10_1101-2021_01_07_425723	301	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	301	2	is	be	VBZ
10_1101-2021_01_07_425723	301	3	made	make	VBN
10_1101-2021_01_07_425723	301	4	The	the	DT
10_1101-2021_01_07_425723	301	5	copyright	copyright	NN
10_1101-2021_01_07_425723	301	6	holder	holder	NN
10_1101-2021_01_07_425723	301	7	for	for	IN
10_1101-2021_01_07_425723	301	8	this	this	DT
10_1101-2021_01_07_425723	301	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	301	10	version	version	NN
10_1101-2021_01_07_425723	301	11	posted	post	VBD
10_1101-2021_01_07_425723	301	12	January	January	NNP
10_1101-2021_01_07_425723	301	13	8	8	CD
10_1101-2021_01_07_425723	301	14	,	,	,
10_1101-2021_01_07_425723	301	15	2021	2021	CD
10_1101-2021_01_07_425723	301	16	.	.	.
10_1101-2021_01_07_425723	301	17	;	;	:
10_1101-2021_01_07_425723	301	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	301	19	:	:	:
10_1101-2021_01_07_425723	301	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	301	21	preprint	preprint	NN
10_1101-2021_01_07_425723	301	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	301	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	301	24	28	28	CD
10_1101-2021_01_07_425723	301	25	at	at	IN
10_1101-2021_01_07_425723	301	26	a	a	DT
10_1101-2021_01_07_425723	301	27	flowrate	flowrate	NN
10_1101-2021_01_07_425723	301	28	of	of	IN
10_1101-2021_01_07_425723	301	29	500	500	CD
10_1101-2021_01_07_425723	301	30	mL	mL	NNP
10_1101-2021_01_07_425723	301	31	N2	N2	NNP
10_1101-2021_01_07_425723	301	32	min-1	min-1	NNP
10_1101-2021_01_07_425723	301	33	(	(	-LRB-
10_1101-2021_01_07_425723	301	34	2.4	2.4	CD
10_1101-2021_01_07_425723	301	35	vvm	vvm	NN
10_1101-2021_01_07_425723	301	36	)	)	-RRB-
10_1101-2021_01_07_425723	301	37	.	.	.
10_1101-2021_01_07_425723	302	1	Gas	gas	NN
10_1101-2021_01_07_425723	302	2	pressure	pressure	NN
10_1101-2021_01_07_425723	302	3	of	of	IN
10_1101-2021_01_07_425723	302	4	1.2	1.2	CD
10_1101-2021_01_07_425723	302	5	bar	bar	NN
10_1101-2021_01_07_425723	302	6	of	of	IN
10_1101-2021_01_07_425723	302	7	the	the	DT
10_1101-2021_01_07_425723	302	8	reactor	reactor	NN
10_1101-2021_01_07_425723	302	9	headspace	headspace	NN
10_1101-2021_01_07_425723	302	10	was	be	VBD
10_1101-2021_01_07_425723	302	11	set	set	VBN
10_1101-2021_01_07_425723	302	12	with	with	IN
10_1101-2021_01_07_425723	302	13	451	451	CD
10_1101-2021_01_07_425723	302	14	a	a	DT
10_1101-2021_01_07_425723	302	15	reduction	reduction	NN
10_1101-2021_01_07_425723	302	16	valve	valve	NN
10_1101-2021_01_07_425723	302	17	(	(	-LRB-
10_1101-2021_01_07_425723	302	18	Tescom	Tescom	NNP
10_1101-2021_01_07_425723	302	19	Europe	Europe	NNP
10_1101-2021_01_07_425723	302	20	,	,	,
10_1101-2021_01_07_425723	302	21	Hannover	Hannover	NNP
10_1101-2021_01_07_425723	302	22	,	,	,
10_1101-2021_01_07_425723	302	23	Germany	Germany	NNP
10_1101-2021_01_07_425723	302	24	)	)	-RRB-
10_1101-2021_01_07_425723	302	25	and	and	CC
10_1101-2021_01_07_425723	302	26	remained	remain	VBD
10_1101-2021_01_07_425723	302	27	constant	constant	JJ
10_1101-2021_01_07_425723	302	28	during	during	IN
10_1101-2021_01_07_425723	302	29	cultivation	cultivation	NN
10_1101-2021_01_07_425723	302	30	.	.	.
10_1101-2021_01_07_425723	303	1	To	to	IN
10_1101-2021_01_07_425723	303	2	452	452	CD
10_1101-2021_01_07_425723	303	3	prevent	prevent	VB
10_1101-2021_01_07_425723	303	4	oxygen	oxygen	NN
10_1101-2021_01_07_425723	303	5	diffusion	diffusion	NN
10_1101-2021_01_07_425723	303	6	into	into	IN
10_1101-2021_01_07_425723	303	7	the	the	DT
10_1101-2021_01_07_425723	303	8	cultivation	cultivation	NN
10_1101-2021_01_07_425723	303	9	the	the	DT
10_1101-2021_01_07_425723	303	10	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	303	11	was	be	VBD
10_1101-2021_01_07_425723	303	12	equipped	equip	VBN
10_1101-2021_01_07_425723	303	13	with	with	IN
10_1101-2021_01_07_425723	303	14	Fluran	fluran	JJ
10_1101-2021_01_07_425723	303	15	tubing	tubing	NN
10_1101-2021_01_07_425723	303	16	(	(	-LRB-
10_1101-2021_01_07_425723	303	17	14	14	CD
10_1101-2021_01_07_425723	303	18	Barrer	Barrer	NNP
10_1101-2021_01_07_425723	303	19	453	453	CD
10_1101-2021_01_07_425723	303	20	O2	o2	CD
10_1101-2021_01_07_425723	303	21	,	,	,
10_1101-2021_01_07_425723	303	22	F-5500-A	f-5500-a	NN
10_1101-2021_01_07_425723	303	23	,	,	,
10_1101-2021_01_07_425723	303	24	Saint	Saint	NNP
10_1101-2021_01_07_425723	303	25	-	-	HYPH
10_1101-2021_01_07_425723	303	26	Gobain	Gobain	NNP
10_1101-2021_01_07_425723	303	27	,	,	,
10_1101-2021_01_07_425723	303	28	Courbevoie	Courbevoie	NNP
10_1101-2021_01_07_425723	303	29	,	,	,
10_1101-2021_01_07_425723	303	30	France	France	NNP
10_1101-2021_01_07_425723	303	31	)	)	-RRB-
10_1101-2021_01_07_425723	303	32	,	,	,
10_1101-2021_01_07_425723	303	33	Viton	Viton	NNP
10_1101-2021_01_07_425723	303	34	O	O	NNP
10_1101-2021_01_07_425723	303	35	-	-	HYPH
10_1101-2021_01_07_425723	303	36	rings	ring	NNS
10_1101-2021_01_07_425723	303	37	(	(	-LRB-
10_1101-2021_01_07_425723	303	38	Eriks	Eriks	NNP
10_1101-2021_01_07_425723	303	39	,	,	,
10_1101-2021_01_07_425723	303	40	Alkmaar	Alkmaar	NNP
10_1101-2021_01_07_425723	303	41	,	,	,
10_1101-2021_01_07_425723	303	42	the	the	DT
10_1101-2021_01_07_425723	303	43	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	303	44	)	)	-RRB-
10_1101-2021_01_07_425723	303	45	,	,	,
10_1101-2021_01_07_425723	303	46	and	and	CC
10_1101-2021_01_07_425723	303	47	no	no	DT
10_1101-2021_01_07_425723	303	48	454	454	CD
10_1101-2021_01_07_425723	303	49	pH	pH	NNP
10_1101-2021_01_07_425723	303	50	probes	probe	NNS
10_1101-2021_01_07_425723	303	51	were	be	VBD
10_1101-2021_01_07_425723	303	52	mounted	mount	VBN
10_1101-2021_01_07_425723	303	53	.	.	.
10_1101-2021_01_07_425723	304	1	The	the	DT
10_1101-2021_01_07_425723	304	2	medium	medium	JJ
10_1101-2021_01_07_425723	304	3	reservoir	reservoir	NN
10_1101-2021_01_07_425723	304	4	was	be	VBD
10_1101-2021_01_07_425723	304	5	deoxygenated	deoxygenate	VBN
10_1101-2021_01_07_425723	304	6	by	by	IN
10_1101-2021_01_07_425723	304	7	sparge	sparge	NN
10_1101-2021_01_07_425723	304	8	aeration	aeration	NN
10_1101-2021_01_07_425723	304	9	with	with	IN
10_1101-2021_01_07_425723	304	10	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	304	11	455	455	CD
10_1101-2021_01_07_425723	304	12	gas	gas	NN
10_1101-2021_01_07_425723	304	13	(	(	-LRB-
10_1101-2021_01_07_425723	304	14	≤	≤	NNP
10_1101-2021_01_07_425723	304	15	1	1	CD
10_1101-2021_01_07_425723	304	16	ppm	ppm	NN
10_1101-2021_01_07_425723	304	17	O2	O2	NNP
10_1101-2021_01_07_425723	304	18	,	,	,
10_1101-2021_01_07_425723	304	19	HiQ	HiQ	NNP
10_1101-2021_01_07_425723	304	20	Nitrogen	Nitrogen	NNP
10_1101-2021_01_07_425723	304	21	5.0	5.0	CD
10_1101-2021_01_07_425723	304	22	,	,	,
10_1101-2021_01_07_425723	304	23	Linde	Linde	NNP
10_1101-2021_01_07_425723	304	24	AG	AG	NNP
10_1101-2021_01_07_425723	304	25	)	)	-RRB-
10_1101-2021_01_07_425723	304	26	.	.	.
10_1101-2021_01_07_425723	305	1	456	456	CD
10_1101-2021_01_07_425723	305	2	For	for	IN
10_1101-2021_01_07_425723	305	3	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	305	4	cultivation	cultivation	NN
10_1101-2021_01_07_425723	305	5	the	the	DT
10_1101-2021_01_07_425723	305	6	reactor	reactor	NN
10_1101-2021_01_07_425723	305	7	was	be	VBD
10_1101-2021_01_07_425723	305	8	sparged	sparge	VBN
10_1101-2021_01_07_425723	305	9	continuously	continuously	RB
10_1101-2021_01_07_425723	305	10	with	with	IN
10_1101-2021_01_07_425723	305	11	dried	dry	VBN
10_1101-2021_01_07_425723	305	12	air	air	NN
10_1101-2021_01_07_425723	305	13	at	at	IN
10_1101-2021_01_07_425723	305	14	a	a	DT
10_1101-2021_01_07_425723	305	15	flowrate	flowrate	NN
10_1101-2021_01_07_425723	305	16	of	of	IN
10_1101-2021_01_07_425723	305	17	500	500	CD
10_1101-2021_01_07_425723	305	18	mL	mL	NNP
10_1101-2021_01_07_425723	305	19	air	air	NN
10_1101-2021_01_07_425723	305	20	457	457	CD
10_1101-2021_01_07_425723	305	21	min-1	min-1	NNS
10_1101-2021_01_07_425723	305	22	(	(	-LRB-
10_1101-2021_01_07_425723	305	23	2.4	2.4	CD
10_1101-2021_01_07_425723	305	24	vvm	vvm	NN
10_1101-2021_01_07_425723	305	25	)	)	-RRB-
10_1101-2021_01_07_425723	305	26	.	.	.
10_1101-2021_01_07_425723	306	1	Dissolved	dissolved	JJ
10_1101-2021_01_07_425723	306	2	oxygen	oxygen	NN
10_1101-2021_01_07_425723	306	3	levels	level	NNS
10_1101-2021_01_07_425723	306	4	were	be	VBD
10_1101-2021_01_07_425723	306	5	analyzed	analyze	VBN
10_1101-2021_01_07_425723	306	6	by	by	IN
10_1101-2021_01_07_425723	306	7	Clark	Clark	NNP
10_1101-2021_01_07_425723	306	8	electrodes	electrode	NNS
10_1101-2021_01_07_425723	306	9	(	(	-LRB-
10_1101-2021_01_07_425723	306	10	AppliSens	AppliSens	NNP
10_1101-2021_01_07_425723	306	11	,	,	,
10_1101-2021_01_07_425723	306	12	Applikon	Applikon	NNP
10_1101-2021_01_07_425723	306	13	)	)	-RRB-
10_1101-2021_01_07_425723	306	14	and	and	CC
10_1101-2021_01_07_425723	306	15	458	458	CD
10_1101-2021_01_07_425723	306	16	remained	remain	VBD
10_1101-2021_01_07_425723	306	17	above	above	IN
10_1101-2021_01_07_425723	306	18	40	40	CD
10_1101-2021_01_07_425723	306	19	%	%	NN
10_1101-2021_01_07_425723	306	20	during	during	IN
10_1101-2021_01_07_425723	306	21	the	the	DT
10_1101-2021_01_07_425723	306	22	cultivation	cultivation	NN
10_1101-2021_01_07_425723	306	23	.	.	.
10_1101-2021_01_07_425723	307	1	For	for	IN
10_1101-2021_01_07_425723	307	2	micro	micro	JJ
10_1101-2021_01_07_425723	307	3	-	-	JJ
10_1101-2021_01_07_425723	307	4	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	307	5	cultivations	cultivation	NNS
10_1101-2021_01_07_425723	307	6	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	307	7	(	(	-LRB-
10_1101-2021_01_07_425723	307	8	≤	≤	NNP
10_1101-2021_01_07_425723	307	9	1	1	CD
10_1101-2021_01_07_425723	307	10	ppm	ppm	NN
10_1101-2021_01_07_425723	307	11	O2	O2	NNP
10_1101-2021_01_07_425723	307	12	,	,	,
10_1101-2021_01_07_425723	307	13	HiQ	HiQ	NNP
10_1101-2021_01_07_425723	307	14	459	459	CD
10_1101-2021_01_07_425723	307	15	Nitrogen	Nitrogen	NNP
10_1101-2021_01_07_425723	307	16	5.0	5.0	CD
10_1101-2021_01_07_425723	307	17	,	,	,
10_1101-2021_01_07_425723	307	18	Linde	Linde	NNP
10_1101-2021_01_07_425723	307	19	AG	AG	NNP
10_1101-2021_01_07_425723	307	20	)	)	-RRB-
10_1101-2021_01_07_425723	307	21	and	and	CC
10_1101-2021_01_07_425723	307	22	air	air	NN
10_1101-2021_01_07_425723	307	23	were	be	VBD
10_1101-2021_01_07_425723	307	24	mixed	mix	VBN
10_1101-2021_01_07_425723	307	25	continuously	continuously	RB
10_1101-2021_01_07_425723	307	26	by	by	IN
10_1101-2021_01_07_425723	307	27	controlling	control	VBG
10_1101-2021_01_07_425723	307	28	the	the	DT
10_1101-2021_01_07_425723	307	29	fractions	fraction	NNS
10_1101-2021_01_07_425723	307	30	of	of	IN
10_1101-2021_01_07_425723	307	31	mass	mass	JJ
10_1101-2021_01_07_425723	307	32	flow	flow	NN
10_1101-2021_01_07_425723	307	33	rate	rate	NN
10_1101-2021_01_07_425723	307	34	of	of	IN
10_1101-2021_01_07_425723	307	35	460	460	CD
10_1101-2021_01_07_425723	307	36	the	the	DT
10_1101-2021_01_07_425723	307	37	dry	dry	JJ
10_1101-2021_01_07_425723	307	38	gas	gas	NN
10_1101-2021_01_07_425723	307	39	to	to	IN
10_1101-2021_01_07_425723	307	40	a	a	DT
10_1101-2021_01_07_425723	307	41	total	total	JJ
10_1101-2021_01_07_425723	307	42	flow	flow	NN
10_1101-2021_01_07_425723	307	43	of	of	IN
10_1101-2021_01_07_425723	307	44	500	500	CD
10_1101-2021_01_07_425723	307	45	mL	mL	NNP
10_1101-2021_01_07_425723	307	46	min-1	min-1	NNS
10_1101-2021_01_07_425723	307	47	per	per	IN
10_1101-2021_01_07_425723	307	48	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	307	49	.	.	.
10_1101-2021_01_07_425723	308	1	The	the	DT
10_1101-2021_01_07_425723	308	2	mixed	mixed	JJ
10_1101-2021_01_07_425723	308	3	gas	gas	NN
10_1101-2021_01_07_425723	308	4	was	be	VBD
10_1101-2021_01_07_425723	308	5	distributed	distribute	VBN
10_1101-2021_01_07_425723	308	6	to	to	IN
10_1101-2021_01_07_425723	308	7	each	each	DT
10_1101-2021_01_07_425723	308	8	461	461	CD
10_1101-2021_01_07_425723	308	9	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	308	10	and	and	CC
10_1101-2021_01_07_425723	308	11	analyzed	analyze	VBD
10_1101-2021_01_07_425723	308	12	separately	separately	RB
10_1101-2021_01_07_425723	308	13	in	in	IN
10_1101-2021_01_07_425723	308	14	real	real	JJ
10_1101-2021_01_07_425723	308	15	-	-	HYPH
10_1101-2021_01_07_425723	308	16	time	time	NN
10_1101-2021_01_07_425723	308	17	.	.	.
10_1101-2021_01_07_425723	309	1	Continuous	continuous	JJ
10_1101-2021_01_07_425723	309	2	cultures	culture	NNS
10_1101-2021_01_07_425723	309	3	were	be	VBD
10_1101-2021_01_07_425723	309	4	assumed	assume	VBN
10_1101-2021_01_07_425723	309	5	to	to	TO
10_1101-2021_01_07_425723	309	6	be	be	VB
10_1101-2021_01_07_425723	309	7	in	in	IN
10_1101-2021_01_07_425723	309	8	steady	steady	JJ
10_1101-2021_01_07_425723	309	9	state	state	NN
10_1101-2021_01_07_425723	309	10	462	462	CD
10_1101-2021_01_07_425723	309	11	when	when	WRB
10_1101-2021_01_07_425723	309	12	after	after	IN
10_1101-2021_01_07_425723	309	13	at	at	RB
10_1101-2021_01_07_425723	309	14	least	least	JJS
10_1101-2021_01_07_425723	309	15	5	5	CD
10_1101-2021_01_07_425723	309	16	volumes	volume	NNS
10_1101-2021_01_07_425723	309	17	changes	change	NNS
10_1101-2021_01_07_425723	309	18	,	,	,
10_1101-2021_01_07_425723	309	19	culture	culture	NN
10_1101-2021_01_07_425723	309	20	dry	dry	JJ
10_1101-2021_01_07_425723	309	21	weight	weight	NN
10_1101-2021_01_07_425723	309	22	and	and	CC
10_1101-2021_01_07_425723	309	23	the	the	DT
10_1101-2021_01_07_425723	309	24	specific	specific	JJ
10_1101-2021_01_07_425723	309	25	carbon	carbon	NN
10_1101-2021_01_07_425723	309	26	dioxide	dioxide	NN
10_1101-2021_01_07_425723	309	27	production	production	NN
10_1101-2021_01_07_425723	309	28	463	463	CD
10_1101-2021_01_07_425723	309	29	rates	rate	NNS
10_1101-2021_01_07_425723	309	30	changed	change	VBN
10_1101-2021_01_07_425723	309	31	by	by	IN
10_1101-2021_01_07_425723	309	32	less	less	JJR
10_1101-2021_01_07_425723	309	33	than	than	IN
10_1101-2021_01_07_425723	309	34	10	10	CD
10_1101-2021_01_07_425723	309	35	%	%	NN
10_1101-2021_01_07_425723	309	36	.	.	.
10_1101-2021_01_07_425723	310	1	464	464	CD
10_1101-2021_01_07_425723	310	2	Cell	Cell	NNP
10_1101-2021_01_07_425723	310	3	density	density	NN
10_1101-2021_01_07_425723	310	4	was	be	VBD
10_1101-2021_01_07_425723	310	5	routinely	routinely	RB
10_1101-2021_01_07_425723	310	6	measured	measure	VBN
10_1101-2021_01_07_425723	310	7	at	at	IN
10_1101-2021_01_07_425723	310	8	a	a	DT
10_1101-2021_01_07_425723	310	9	wavelength	wavelength	NN
10_1101-2021_01_07_425723	310	10	of	of	IN
10_1101-2021_01_07_425723	310	11	660	660	CD
10_1101-2021_01_07_425723	310	12	nm	nm	NN
10_1101-2021_01_07_425723	310	13	with	with	IN
10_1101-2021_01_07_425723	310	14	spectrophotometer	spectrophotometer	NN
10_1101-2021_01_07_425723	310	15	Jenway	Jenway	NNP
10_1101-2021_01_07_425723	310	16	7200	7200	CD
10_1101-2021_01_07_425723	310	17	465	465	CD
10_1101-2021_01_07_425723	310	18	(	(	-LRB-
10_1101-2021_01_07_425723	310	19	Cole	Cole	NNP
10_1101-2021_01_07_425723	310	20	Palmer	Palmer	NNP
10_1101-2021_01_07_425723	310	21	,	,	,
10_1101-2021_01_07_425723	310	22	Staffordshire	Staffordshire	NNP
10_1101-2021_01_07_425723	310	23	,	,	,
10_1101-2021_01_07_425723	310	24	UK	UK	NNP
10_1101-2021_01_07_425723	310	25	)	)	-RRB-
10_1101-2021_01_07_425723	310	26	.	.	.
10_1101-2021_01_07_425723	311	1	Cell	cell	NN
10_1101-2021_01_07_425723	311	2	dry	dry	JJ
10_1101-2021_01_07_425723	311	3	weight	weight	NN
10_1101-2021_01_07_425723	311	4	of	of	IN
10_1101-2021_01_07_425723	311	5	the	the	DT
10_1101-2021_01_07_425723	311	6	cultures	culture	NNS
10_1101-2021_01_07_425723	311	7	were	be	VBD
10_1101-2021_01_07_425723	311	8	determined	determine	VBN
10_1101-2021_01_07_425723	311	9	by	by	IN
10_1101-2021_01_07_425723	311	10	filtering	filter	VBG
10_1101-2021_01_07_425723	311	11	exactly	exactly	RB
10_1101-2021_01_07_425723	311	12	10	10	CD
10_1101-2021_01_07_425723	311	13	466	466	CD
10_1101-2021_01_07_425723	311	14	mL	ml	NN
10_1101-2021_01_07_425723	311	15	of	of	IN
10_1101-2021_01_07_425723	311	16	culture	culture	NN
10_1101-2021_01_07_425723	311	17	broth	broth	NN
10_1101-2021_01_07_425723	311	18	over	over	IN
10_1101-2021_01_07_425723	311	19	pre	pre	JJ
10_1101-2021_01_07_425723	311	20	-	-	VBN
10_1101-2021_01_07_425723	311	21	dried	dry	VBN
10_1101-2021_01_07_425723	311	22	and	and	CC
10_1101-2021_01_07_425723	311	23	weighed	weigh	VBD
10_1101-2021_01_07_425723	311	24	membrane	membrane	NN
10_1101-2021_01_07_425723	311	25	filters	filter	NNS
10_1101-2021_01_07_425723	311	26	(	(	-LRB-
10_1101-2021_01_07_425723	311	27	0.45	0.45	CD
10_1101-2021_01_07_425723	311	28	µm	µm	NNP
10_1101-2021_01_07_425723	311	29	,	,	,
10_1101-2021_01_07_425723	311	30	Thermo	Thermo	NNP
10_1101-2021_01_07_425723	311	31	Fisher	Fisher	NNP
10_1101-2021_01_07_425723	311	32	Scientific	Scientific	NNP
10_1101-2021_01_07_425723	311	33	)	)	-RRB-
10_1101-2021_01_07_425723	311	34	,	,	,
10_1101-2021_01_07_425723	311	35	467	467	CD
10_1101-2021_01_07_425723	311	36	which	which	WDT
10_1101-2021_01_07_425723	311	37	were	be	VBD
10_1101-2021_01_07_425723	311	38	subsequently	subsequently	RB
10_1101-2021_01_07_425723	311	39	washed	wash	VBN
10_1101-2021_01_07_425723	311	40	with	with	IN
10_1101-2021_01_07_425723	311	41	demineralized	demineralized	JJ
10_1101-2021_01_07_425723	311	42	water	water	NN
10_1101-2021_01_07_425723	311	43	,	,	,
10_1101-2021_01_07_425723	311	44	dried	dry	VBN
10_1101-2021_01_07_425723	311	45	in	in	IN
10_1101-2021_01_07_425723	311	46	a	a	DT
10_1101-2021_01_07_425723	311	47	microwave	microwave	NN
10_1101-2021_01_07_425723	311	48	oven	oven	NN
10_1101-2021_01_07_425723	311	49	(	(	-LRB-
10_1101-2021_01_07_425723	311	50	20	20	CD
10_1101-2021_01_07_425723	311	51	min	min	NN
10_1101-2021_01_07_425723	311	52	,	,	,
10_1101-2021_01_07_425723	311	53	350	350	CD
10_1101-2021_01_07_425723	311	54	W	w	NN
10_1101-2021_01_07_425723	311	55	)	)	-RRB-
10_1101-2021_01_07_425723	311	56	468	468	CD
10_1101-2021_01_07_425723	311	57	and	and	CC
10_1101-2021_01_07_425723	311	58	weighed	weigh	VBD
10_1101-2021_01_07_425723	311	59	again66	again66	NNP
10_1101-2021_01_07_425723	311	60	.	.	.
10_1101-2021_01_07_425723	312	1	469	469	CD
10_1101-2021_01_07_425723	312	2	Metabolite	metabolite	JJ
10_1101-2021_01_07_425723	312	3	analysis	analysis	NN
10_1101-2021_01_07_425723	312	4	470	470	CD
10_1101-2021_01_07_425723	312	5	For	for	IN
10_1101-2021_01_07_425723	312	6	determination	determination	NN
10_1101-2021_01_07_425723	312	7	of	of	IN
10_1101-2021_01_07_425723	312	8	substrate	substrate	NN
10_1101-2021_01_07_425723	312	9	and	and	CC
10_1101-2021_01_07_425723	312	10	extracellular	extracellular	JJ
10_1101-2021_01_07_425723	312	11	metabolite	metabolite	JJ
10_1101-2021_01_07_425723	312	12	concentrations	concentration	NNS
10_1101-2021_01_07_425723	312	13	,	,	,
10_1101-2021_01_07_425723	312	14	culture	culture	NN
10_1101-2021_01_07_425723	312	15	supernatants	supernatant	NNS
10_1101-2021_01_07_425723	312	16	were	be	VBD
10_1101-2021_01_07_425723	312	17	471	471	CD
10_1101-2021_01_07_425723	312	18	obtained	obtain	VBN
10_1101-2021_01_07_425723	312	19	by	by	IN
10_1101-2021_01_07_425723	312	20	centrifugation	centrifugation	NN
10_1101-2021_01_07_425723	312	21	of	of	IN
10_1101-2021_01_07_425723	312	22	culture	culture	NN
10_1101-2021_01_07_425723	312	23	samples	sample	NNS
10_1101-2021_01_07_425723	312	24	(	(	-LRB-
10_1101-2021_01_07_425723	312	25	5	5	CD
10_1101-2021_01_07_425723	312	26	min	min	NN
10_1101-2021_01_07_425723	312	27	at	at	IN
10_1101-2021_01_07_425723	312	28	13000	13000	CD
10_1101-2021_01_07_425723	312	29	rpm	rpm	NNP
10_1101-2021_01_07_425723	312	30	)	)	-RRB-
10_1101-2021_01_07_425723	312	31	and	and	CC
10_1101-2021_01_07_425723	312	32	analyzed	analyze	VBN
10_1101-2021_01_07_425723	312	33	by	by	IN
10_1101-2021_01_07_425723	312	34	high	high	JJ
10_1101-2021_01_07_425723	312	35	-	-	HYPH
10_1101-2021_01_07_425723	312	36	performance	performance	NN
10_1101-2021_01_07_425723	312	37	472	472	CD
10_1101-2021_01_07_425723	312	38	liquid	liquid	JJ
10_1101-2021_01_07_425723	312	39	chromatography	chromatography	NN
10_1101-2021_01_07_425723	312	40	(	(	-LRB-
10_1101-2021_01_07_425723	312	41	HPLC	HPLC	NNP
10_1101-2021_01_07_425723	312	42	)	)	-RRB-
10_1101-2021_01_07_425723	312	43	on	on	IN
10_1101-2021_01_07_425723	312	44	a	a	DT
10_1101-2021_01_07_425723	312	45	Waters	Waters	NNP
10_1101-2021_01_07_425723	312	46	Alliance	Alliance	NNP
10_1101-2021_01_07_425723	312	47	2690	2690	CD
10_1101-2021_01_07_425723	312	48	HPLC	hplc	NN
10_1101-2021_01_07_425723	312	49	(	(	-LRB-
10_1101-2021_01_07_425723	312	50	Waters	Waters	NNP
10_1101-2021_01_07_425723	312	51	,	,	,
10_1101-2021_01_07_425723	312	52	MA	MA	NNP
10_1101-2021_01_07_425723	312	53	,	,	,
10_1101-2021_01_07_425723	312	54	USA	USA	NNP
10_1101-2021_01_07_425723	312	55	)	)	-RRB-
10_1101-2021_01_07_425723	312	56	equipped	equip	VBD
10_1101-2021_01_07_425723	312	57	with	with	IN
10_1101-2021_01_07_425723	312	58	a	a	DT
10_1101-2021_01_07_425723	312	59	Bio-473	bio-473	CD
10_1101-2021_01_07_425723	312	60	.CC	.CC	:
10_1101-2021_01_07_425723	312	61	-	-	:
10_1101-2021_01_07_425723	312	62	BY	by	IN
10_1101-2021_01_07_425723	312	63	-	-	HYPH
10_1101-2021_01_07_425723	312	64	NC	NC	NNP
10_1101-2021_01_07_425723	312	65	-	-	HYPH
10_1101-2021_01_07_425723	312	66	ND	ND	NNP
10_1101-2021_01_07_425723	312	67	4.0	4.0	CD
10_1101-2021_01_07_425723	312	68	International	International	NNP
10_1101-2021_01_07_425723	312	69	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	312	70	under	under	IN
10_1101-2021_01_07_425723	312	71	a	a	DT
10_1101-2021_01_07_425723	312	72	(	(	-LRB-
10_1101-2021_01_07_425723	312	73	which	which	WDT
10_1101-2021_01_07_425723	312	74	was	be	VBD
10_1101-2021_01_07_425723	312	75	not	not	RB
10_1101-2021_01_07_425723	312	76	certified	certify	VBN
10_1101-2021_01_07_425723	312	77	by	by	IN
10_1101-2021_01_07_425723	312	78	peer	peer	NN
10_1101-2021_01_07_425723	312	79	review	review	NN
10_1101-2021_01_07_425723	312	80	)	)	-RRB-
10_1101-2021_01_07_425723	312	81	is	be	VBZ
10_1101-2021_01_07_425723	312	82	the	the	DT
10_1101-2021_01_07_425723	312	83	author	author	NN
10_1101-2021_01_07_425723	312	84	/	/	SYM
10_1101-2021_01_07_425723	312	85	funder	funder	NN
10_1101-2021_01_07_425723	312	86	,	,	,
10_1101-2021_01_07_425723	312	87	who	who	WP
10_1101-2021_01_07_425723	312	88	has	have	VBZ
10_1101-2021_01_07_425723	312	89	granted	grant	VBN
10_1101-2021_01_07_425723	312	90	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	312	91	a	a	DT
10_1101-2021_01_07_425723	312	92	license	license	NN
10_1101-2021_01_07_425723	312	93	to	to	TO
10_1101-2021_01_07_425723	312	94	display	display	VB
10_1101-2021_01_07_425723	312	95	the	the	DT
10_1101-2021_01_07_425723	312	96	preprint	preprint	NN
10_1101-2021_01_07_425723	312	97	in	in	IN
10_1101-2021_01_07_425723	312	98	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	312	99	.	.	.
10_1101-2021_01_07_425723	313	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	313	2	is	be	VBZ
10_1101-2021_01_07_425723	313	3	made	make	VBN
10_1101-2021_01_07_425723	313	4	The	the	DT
10_1101-2021_01_07_425723	313	5	copyright	copyright	NN
10_1101-2021_01_07_425723	313	6	holder	holder	NN
10_1101-2021_01_07_425723	313	7	for	for	IN
10_1101-2021_01_07_425723	313	8	this	this	DT
10_1101-2021_01_07_425723	313	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	313	10	version	version	NN
10_1101-2021_01_07_425723	313	11	posted	post	VBD
10_1101-2021_01_07_425723	313	12	January	January	NNP
10_1101-2021_01_07_425723	313	13	8	8	CD
10_1101-2021_01_07_425723	313	14	,	,	,
10_1101-2021_01_07_425723	313	15	2021	2021	CD
10_1101-2021_01_07_425723	313	16	.	.	.
10_1101-2021_01_07_425723	313	17	;	;	:
10_1101-2021_01_07_425723	313	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	313	19	:	:	:
10_1101-2021_01_07_425723	313	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	313	21	preprint	preprint	NN
10_1101-2021_01_07_425723	313	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	313	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	313	24	29	29	CD
10_1101-2021_01_07_425723	313	25	Rad	Rad	NNP
10_1101-2021_01_07_425723	313	26	HPX-87H	hpx-87h	NN
10_1101-2021_01_07_425723	313	27	ion	ion	NN
10_1101-2021_01_07_425723	313	28	exchange	exchange	NN
10_1101-2021_01_07_425723	313	29	column	column	NN
10_1101-2021_01_07_425723	313	30	(	(	-LRB-
10_1101-2021_01_07_425723	313	31	BioRad	BioRad	NNP
10_1101-2021_01_07_425723	313	32	,	,	,
10_1101-2021_01_07_425723	313	33	Veenendaal	Veenendaal	NNP
10_1101-2021_01_07_425723	313	34	,	,	,
10_1101-2021_01_07_425723	313	35	the	the	DT
10_1101-2021_01_07_425723	313	36	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	313	37	)	)	-RRB-
10_1101-2021_01_07_425723	313	38	operated	operate	VBD
10_1101-2021_01_07_425723	313	39	at	at	IN
10_1101-2021_01_07_425723	313	40	60	60	CD
10_1101-2021_01_07_425723	313	41	°	°	NNS
10_1101-2021_01_07_425723	313	42	C	C	NNP
10_1101-2021_01_07_425723	313	43	with	with	IN
10_1101-2021_01_07_425723	313	44	a	a	DT
10_1101-2021_01_07_425723	313	45	474	474	CD
10_1101-2021_01_07_425723	313	46	mobile	mobile	JJ
10_1101-2021_01_07_425723	313	47	phase	phase	NN
10_1101-2021_01_07_425723	313	48	of	of	IN
10_1101-2021_01_07_425723	313	49	5	5	CD
10_1101-2021_01_07_425723	313	50	mM	mM	NNP
10_1101-2021_01_07_425723	313	51	H2SO4	H2SO4	NNP
10_1101-2021_01_07_425723	313	52	at	at	IN
10_1101-2021_01_07_425723	313	53	a	a	DT
10_1101-2021_01_07_425723	313	54	flowrate	flowrate	NN
10_1101-2021_01_07_425723	313	55	of	of	IN
10_1101-2021_01_07_425723	313	56	0.6	0.6	CD
10_1101-2021_01_07_425723	313	57	mL·min-1	mL·min-1	NNS
10_1101-2021_01_07_425723	313	58	.	.	.
10_1101-2021_01_07_425723	314	1	Compounds	compound	NNS
10_1101-2021_01_07_425723	314	2	were	be	VBD
10_1101-2021_01_07_425723	314	3	detected	detect	VBN
10_1101-2021_01_07_425723	314	4	by	by	IN
10_1101-2021_01_07_425723	314	5	means	mean	NNS
10_1101-2021_01_07_425723	314	6	of	of	IN
10_1101-2021_01_07_425723	314	7	a	a	DT
10_1101-2021_01_07_425723	314	8	475	475	CD
10_1101-2021_01_07_425723	314	9	dual	dual	JJ
10_1101-2021_01_07_425723	314	10	-	-	HYPH
10_1101-2021_01_07_425723	314	11	wavelength	wavelength	NN
10_1101-2021_01_07_425723	314	12	absorbance	absorbance	NN
10_1101-2021_01_07_425723	314	13	detector	detector	NN
10_1101-2021_01_07_425723	314	14	(	(	-LRB-
10_1101-2021_01_07_425723	314	15	Waters	Waters	NNP
10_1101-2021_01_07_425723	314	16	2487	2487	CD
10_1101-2021_01_07_425723	314	17	)	)	-RRB-
10_1101-2021_01_07_425723	314	18	and	and	CC
10_1101-2021_01_07_425723	314	19	a	a	DT
10_1101-2021_01_07_425723	314	20	refractive	refractive	JJ
10_1101-2021_01_07_425723	314	21	index	index	NN
10_1101-2021_01_07_425723	314	22	detector	detector	NN
10_1101-2021_01_07_425723	314	23	(	(	-LRB-
10_1101-2021_01_07_425723	314	24	Waters	Waters	NNP
10_1101-2021_01_07_425723	314	25	2410	2410	CD
10_1101-2021_01_07_425723	314	26	)	)	-RRB-
10_1101-2021_01_07_425723	314	27	and	and	CC
10_1101-2021_01_07_425723	314	28	476	476	CD
10_1101-2021_01_07_425723	314	29	compared	compare	VBN
10_1101-2021_01_07_425723	314	30	to	to	TO
10_1101-2021_01_07_425723	314	31	reference	reference	VB
10_1101-2021_01_07_425723	314	32	compounds	compound	NNS
10_1101-2021_01_07_425723	314	33	(	(	-LRB-
10_1101-2021_01_07_425723	314	34	Sigma	Sigma	NNP
10_1101-2021_01_07_425723	314	35	-	-	HYPH
10_1101-2021_01_07_425723	314	36	Aldrich	Aldrich	NNP
10_1101-2021_01_07_425723	314	37	)	)	-RRB-
10_1101-2021_01_07_425723	314	38	.	.	.
10_1101-2021_01_07_425723	315	1	Residual	residual	JJ
10_1101-2021_01_07_425723	315	2	glucose	glucose	NN
10_1101-2021_01_07_425723	315	3	concentrations	concentration	NNS
10_1101-2021_01_07_425723	315	4	in	in	IN
10_1101-2021_01_07_425723	315	5	continuous	continuous	JJ
10_1101-2021_01_07_425723	315	6	477	477	CD
10_1101-2021_01_07_425723	315	7	cultivations	cultivation	NNS
10_1101-2021_01_07_425723	315	8	were	be	VBD
10_1101-2021_01_07_425723	315	9	determined	determine	VBN
10_1101-2021_01_07_425723	315	10	by	by	IN
10_1101-2021_01_07_425723	315	11	HPLC	hplc	NN
10_1101-2021_01_07_425723	315	12	analysis	analysis	NN
10_1101-2021_01_07_425723	315	13	from	from	IN
10_1101-2021_01_07_425723	315	14	rapid	rapid	JJ
10_1101-2021_01_07_425723	315	15	quenched	quench	VBN
10_1101-2021_01_07_425723	315	16	culture	culture	NN
10_1101-2021_01_07_425723	315	17	samples	sample	NNS
10_1101-2021_01_07_425723	315	18	with	with	IN
10_1101-2021_01_07_425723	315	19	cold	cold	JJ
10_1101-2021_01_07_425723	315	20	steel	steel	NN
10_1101-2021_01_07_425723	315	21	478	478	CD
10_1101-2021_01_07_425723	315	22	beads67	beads67	NNS
10_1101-2021_01_07_425723	315	23	.	.	.
10_1101-2021_01_07_425723	316	1	479	479	CD
10_1101-2021_01_07_425723	316	2	Gas	gas	NN
10_1101-2021_01_07_425723	316	3	analysis	analysis	NN
10_1101-2021_01_07_425723	316	4	480	480	CD
10_1101-2021_01_07_425723	316	5	The	the	DT
10_1101-2021_01_07_425723	316	6	off	off	IN
10_1101-2021_01_07_425723	316	7	-	-	HYPH
10_1101-2021_01_07_425723	316	8	gas	gas	NN
10_1101-2021_01_07_425723	316	9	from	from	IN
10_1101-2021_01_07_425723	316	10	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	316	11	cultures	culture	NNS
10_1101-2021_01_07_425723	316	12	was	be	VBD
10_1101-2021_01_07_425723	316	13	cooled	cool	VBN
10_1101-2021_01_07_425723	316	14	with	with	IN
10_1101-2021_01_07_425723	316	15	a	a	DT
10_1101-2021_01_07_425723	316	16	condenser	condenser	NN
10_1101-2021_01_07_425723	316	17	(	(	-LRB-
10_1101-2021_01_07_425723	316	18	2	2	CD
10_1101-2021_01_07_425723	316	19	°	°	,
10_1101-2021_01_07_425723	316	20	C	C	NNP
10_1101-2021_01_07_425723	316	21	)	)	-RRB-
10_1101-2021_01_07_425723	316	22	and	and	CC
10_1101-2021_01_07_425723	316	23	dried	dry	VBN
10_1101-2021_01_07_425723	316	24	with	with	IN
10_1101-2021_01_07_425723	316	25	PermaPure	PermaPure	NNP
10_1101-2021_01_07_425723	316	26	Dryer	Dryer	NNP
10_1101-2021_01_07_425723	316	27	481	481	CD
10_1101-2021_01_07_425723	316	28	(	(	-LRB-
10_1101-2021_01_07_425723	316	29	Inacom	Inacom	NNP
10_1101-2021_01_07_425723	316	30	Instruments	Instruments	NNP
10_1101-2021_01_07_425723	316	31	,	,	,
10_1101-2021_01_07_425723	316	32	Veenendaal	Veenendaal	NNP
10_1101-2021_01_07_425723	316	33	,	,	,
10_1101-2021_01_07_425723	316	34	the	the	DT
10_1101-2021_01_07_425723	316	35	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	316	36	)	)	-RRB-
10_1101-2021_01_07_425723	316	37	prior	prior	RB
10_1101-2021_01_07_425723	316	38	to	to	IN
10_1101-2021_01_07_425723	316	39	analysis	analysis	NN
10_1101-2021_01_07_425723	316	40	of	of	IN
10_1101-2021_01_07_425723	316	41	the	the	DT
10_1101-2021_01_07_425723	316	42	carbon	carbon	NN
10_1101-2021_01_07_425723	316	43	dioxide	dioxide	NN
10_1101-2021_01_07_425723	316	44	and	and	CC
10_1101-2021_01_07_425723	316	45	oxygen	oxygen	NN
10_1101-2021_01_07_425723	316	46	482	482	CD
10_1101-2021_01_07_425723	316	47	fraction	fraction	NN
10_1101-2021_01_07_425723	316	48	with	with	IN
10_1101-2021_01_07_425723	316	49	a	a	DT
10_1101-2021_01_07_425723	316	50	Rosemount	Rosemount	NNP
10_1101-2021_01_07_425723	316	51	NGA	NGA	NNP
10_1101-2021_01_07_425723	316	52	2000	2000	CD
10_1101-2021_01_07_425723	316	53	Analyser	Analyser	NNP
10_1101-2021_01_07_425723	316	54	(	(	-LRB-
10_1101-2021_01_07_425723	316	55	Baar	Baar	NNP
10_1101-2021_01_07_425723	316	56	,	,	,
10_1101-2021_01_07_425723	316	57	Switzerland	Switzerland	NNP
10_1101-2021_01_07_425723	316	58	)	)	-RRB-
10_1101-2021_01_07_425723	316	59	.	.	.
10_1101-2021_01_07_425723	317	1	The	the	DT
10_1101-2021_01_07_425723	317	2	Rosemount	Rosemount	NNP
10_1101-2021_01_07_425723	317	3	gas	gas	NN
10_1101-2021_01_07_425723	317	4	analyzer	analyzer	NN
10_1101-2021_01_07_425723	317	5	was	be	VBD
10_1101-2021_01_07_425723	317	6	483	483	CD
10_1101-2021_01_07_425723	317	7	calibrated	calibrate	VBN
10_1101-2021_01_07_425723	317	8	with	with	IN
10_1101-2021_01_07_425723	317	9	defined	define	VBN
10_1101-2021_01_07_425723	317	10	mixtures	mixture	NNS
10_1101-2021_01_07_425723	317	11	of	of	IN
10_1101-2021_01_07_425723	317	12	1.98	1.98	CD
10_1101-2021_01_07_425723	317	13	%	%	NN
10_1101-2021_01_07_425723	317	14	O2	o2	CD
10_1101-2021_01_07_425723	317	15	,	,	,
10_1101-2021_01_07_425723	317	16	3.01	3.01	CD
10_1101-2021_01_07_425723	317	17	%	%	NN
10_1101-2021_01_07_425723	317	18	CO2	CO2	NNP
10_1101-2021_01_07_425723	317	19	and	and	CC
10_1101-2021_01_07_425723	317	20	high	high	JJ
10_1101-2021_01_07_425723	317	21	quality	quality	NN
10_1101-2021_01_07_425723	317	22	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	317	23	gas	gas	NN
10_1101-2021_01_07_425723	317	24	N6	n6	NN
10_1101-2021_01_07_425723	317	25	(	(	-LRB-
10_1101-2021_01_07_425723	317	26	Linde	Linde	NNP
10_1101-2021_01_07_425723	317	27	AG	AG	NNP
10_1101-2021_01_07_425723	317	28	)	)	-RRB-
10_1101-2021_01_07_425723	317	29	.	.	.
10_1101-2021_01_07_425723	318	1	484	484	CD
10_1101-2021_01_07_425723	318	2	Ethanol	Ethanol	NNP
10_1101-2021_01_07_425723	318	3	evaporation	evaporation	NN
10_1101-2021_01_07_425723	318	4	rate	rate	NN
10_1101-2021_01_07_425723	318	5	485	485	CD
10_1101-2021_01_07_425723	318	6	To	to	TO
10_1101-2021_01_07_425723	318	7	correct	correct	VB
10_1101-2021_01_07_425723	318	8	for	for	IN
10_1101-2021_01_07_425723	318	9	ethanol	ethanol	NN
10_1101-2021_01_07_425723	318	10	evaporation	evaporation	NN
10_1101-2021_01_07_425723	318	11	in	in	IN
10_1101-2021_01_07_425723	318	12	the	the	DT
10_1101-2021_01_07_425723	318	13	continuous	continuous	JJ
10_1101-2021_01_07_425723	318	14	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	318	15	cultivations	cultivation	VBZ
10_1101-2021_01_07_425723	318	16	the	the	DT
10_1101-2021_01_07_425723	318	17	ethanol	ethanol	NN
10_1101-2021_01_07_425723	318	18	evaporation	evaporation	NN
10_1101-2021_01_07_425723	318	19	486	486	CD
10_1101-2021_01_07_425723	318	20	rate	rate	NN
10_1101-2021_01_07_425723	318	21	was	be	VBD
10_1101-2021_01_07_425723	318	22	determined	determine	VBN
10_1101-2021_01_07_425723	318	23	in	in	IN
10_1101-2021_01_07_425723	318	24	the	the	DT
10_1101-2021_01_07_425723	318	25	same	same	JJ
10_1101-2021_01_07_425723	318	26	experimental	experimental	JJ
10_1101-2021_01_07_425723	318	27	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	318	28	set	set	NN
10_1101-2021_01_07_425723	318	29	-	-	HYPH
10_1101-2021_01_07_425723	318	30	up	up	RP
10_1101-2021_01_07_425723	318	31	without	without	IN
10_1101-2021_01_07_425723	318	32	the	the	DT
10_1101-2021_01_07_425723	318	33	yeast	yeast	NN
10_1101-2021_01_07_425723	318	34	.	.	.
10_1101-2021_01_07_425723	319	1	To	to	IN
10_1101-2021_01_07_425723	319	2	SM	SM	NNP
10_1101-2021_01_07_425723	319	3	glucose	glucose	VB
10_1101-2021_01_07_425723	319	4	487	487	CD
10_1101-2021_01_07_425723	319	5	media	medium	NNS
10_1101-2021_01_07_425723	319	6	with	with	IN
10_1101-2021_01_07_425723	319	7	urea	urea	NNP
10_1101-2021_01_07_425723	319	8	400	400	CD
10_1101-2021_01_07_425723	319	9	mM	mM	NNP
10_1101-2021_01_07_425723	319	10	of	of	IN
10_1101-2021_01_07_425723	319	11	ethanol	ethanol	NN
10_1101-2021_01_07_425723	319	12	was	be	VBD
10_1101-2021_01_07_425723	319	13	added	add	VBN
10_1101-2021_01_07_425723	319	14	after	after	IN
10_1101-2021_01_07_425723	319	15	which	which	WDT
10_1101-2021_01_07_425723	319	16	the	the	DT
10_1101-2021_01_07_425723	319	17	decrease	decrease	NN
10_1101-2021_01_07_425723	319	18	in	in	IN
10_1101-2021_01_07_425723	319	19	the	the	DT
10_1101-2021_01_07_425723	319	20	ethanol	ethanol	NN
10_1101-2021_01_07_425723	319	21	concentration	concentration	NN
10_1101-2021_01_07_425723	319	22	488	488	CD
10_1101-2021_01_07_425723	319	23	was	be	VBD
10_1101-2021_01_07_425723	319	24	measured	measure	VBN
10_1101-2021_01_07_425723	319	25	over	over	IN
10_1101-2021_01_07_425723	319	26	time	time	NN
10_1101-2021_01_07_425723	319	27	by	by	IN
10_1101-2021_01_07_425723	319	28	periodic	periodic	JJ
10_1101-2021_01_07_425723	319	29	measurements	measurement	NNS
10_1101-2021_01_07_425723	319	30	and	and	CC
10_1101-2021_01_07_425723	319	31	quantification	quantification	NN
10_1101-2021_01_07_425723	319	32	by	by	IN
10_1101-2021_01_07_425723	319	33	HPLC	hplc	NN
10_1101-2021_01_07_425723	319	34	analysis	analysis	NN
10_1101-2021_01_07_425723	319	35	over	over	IN
10_1101-2021_01_07_425723	319	36	the	the	DT
10_1101-2021_01_07_425723	319	37	course	course	NN
10_1101-2021_01_07_425723	319	38	489	489	CD
10_1101-2021_01_07_425723	319	39	of	of	IN
10_1101-2021_01_07_425723	319	40	at	at	RB
10_1101-2021_01_07_425723	319	41	least	least	RBS
10_1101-2021_01_07_425723	319	42	140	140	CD
10_1101-2021_01_07_425723	319	43	hours	hour	NNS
10_1101-2021_01_07_425723	319	44	.	.	.
10_1101-2021_01_07_425723	320	1	To	to	TO
10_1101-2021_01_07_425723	320	2	reflect	reflect	VB
10_1101-2021_01_07_425723	320	3	the	the	DT
10_1101-2021_01_07_425723	320	4	media	medium	NNS
10_1101-2021_01_07_425723	320	5	composition	composition	NN
10_1101-2021_01_07_425723	320	6	used	use	VBN
10_1101-2021_01_07_425723	320	7	for	for	IN
10_1101-2021_01_07_425723	320	8	the	the	DT
10_1101-2021_01_07_425723	320	9	different	different	JJ
10_1101-2021_01_07_425723	320	10	oxygen	oxygen	NN
10_1101-2021_01_07_425723	320	11	regimes	regime	NNS
10_1101-2021_01_07_425723	320	12	and	and	CC
10_1101-2021_01_07_425723	320	13	490	490	CD
10_1101-2021_01_07_425723	320	14	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	320	15	growth	growth	NN
10_1101-2021_01_07_425723	320	16	factor	factor	NN
10_1101-2021_01_07_425723	320	17	supplementation	supplementation	NN
10_1101-2021_01_07_425723	320	18	,	,	,
10_1101-2021_01_07_425723	320	19	the	the	DT
10_1101-2021_01_07_425723	320	20	ethanol	ethanol	NN
10_1101-2021_01_07_425723	320	21	evaporation	evaporation	NN
10_1101-2021_01_07_425723	320	22	was	be	VBD
10_1101-2021_01_07_425723	320	23	measured	measure	VBN
10_1101-2021_01_07_425723	320	24	for	for	IN
10_1101-2021_01_07_425723	320	25	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	320	26	sparge	sparge	NN
10_1101-2021_01_07_425723	320	27	491	491	CD
10_1101-2021_01_07_425723	320	28	aeration	aeration	NN
10_1101-2021_01_07_425723	320	29	with	with	IN
10_1101-2021_01_07_425723	320	30	Tween	Tween	NNP
10_1101-2021_01_07_425723	320	31	80	80	CD
10_1101-2021_01_07_425723	320	32	,	,	,
10_1101-2021_01_07_425723	320	33	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	320	34	head	head	NN
10_1101-2021_01_07_425723	320	35	-	-	HYPH
10_1101-2021_01_07_425723	320	36	space	space	NN
10_1101-2021_01_07_425723	320	37	aeration	aeration	NN
10_1101-2021_01_07_425723	320	38	both	both	CC
10_1101-2021_01_07_425723	320	39	with	with	IN
10_1101-2021_01_07_425723	320	40	and	and	CC
10_1101-2021_01_07_425723	320	41	without	without	IN
10_1101-2021_01_07_425723	320	42	Tween	Tween	NNP
10_1101-2021_01_07_425723	320	43	80	80	CD
10_1101-2021_01_07_425723	320	44	.	.	.
10_1101-2021_01_07_425723	321	1	The	the	DT
10_1101-2021_01_07_425723	321	2	ethanol	ethanol	NN
10_1101-2021_01_07_425723	321	3	492	492	CD
10_1101-2021_01_07_425723	321	4	evaporation	evaporation	NN
10_1101-2021_01_07_425723	321	5	rate	rate	NN
10_1101-2021_01_07_425723	321	6	was	be	VBD
10_1101-2021_01_07_425723	321	7	measured	measure	VBN
10_1101-2021_01_07_425723	321	8	for	for	IN
10_1101-2021_01_07_425723	321	9	each	each	DT
10_1101-2021_01_07_425723	321	10	condition	condition	NN
10_1101-2021_01_07_425723	321	11	in	in	IN
10_1101-2021_01_07_425723	321	12	triplicate	triplicate	NN
10_1101-2021_01_07_425723	321	13	.	.	.
10_1101-2021_01_07_425723	322	1	493	493	CD
10_1101-2021_01_07_425723	322	2	Lipid	Lipid	NNP
10_1101-2021_01_07_425723	322	3	extractions	extraction	NNS
10_1101-2021_01_07_425723	322	4	&	&	CC
10_1101-2021_01_07_425723	322	5	GC	GC	NNP
10_1101-2021_01_07_425723	322	6	analysis	analysis	NN
10_1101-2021_01_07_425723	322	7	494	494	CD
10_1101-2021_01_07_425723	322	8	.CC	.CC	,
10_1101-2021_01_07_425723	322	9	-	-	HYPH
10_1101-2021_01_07_425723	322	10	BY	by	IN
10_1101-2021_01_07_425723	322	11	-	-	HYPH
10_1101-2021_01_07_425723	322	12	NC	NC	NNP
10_1101-2021_01_07_425723	322	13	-	-	HYPH
10_1101-2021_01_07_425723	322	14	ND	ND	NNP
10_1101-2021_01_07_425723	322	15	4.0	4.0	CD
10_1101-2021_01_07_425723	322	16	International	International	NNP
10_1101-2021_01_07_425723	322	17	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	322	18	under	under	IN
10_1101-2021_01_07_425723	322	19	a	a	DT
10_1101-2021_01_07_425723	322	20	(	(	-LRB-
10_1101-2021_01_07_425723	322	21	which	which	WDT
10_1101-2021_01_07_425723	322	22	was	be	VBD
10_1101-2021_01_07_425723	322	23	not	not	RB
10_1101-2021_01_07_425723	322	24	certified	certify	VBN
10_1101-2021_01_07_425723	322	25	by	by	IN
10_1101-2021_01_07_425723	322	26	peer	peer	NN
10_1101-2021_01_07_425723	322	27	review	review	NN
10_1101-2021_01_07_425723	322	28	)	)	-RRB-
10_1101-2021_01_07_425723	322	29	is	be	VBZ
10_1101-2021_01_07_425723	322	30	the	the	DT
10_1101-2021_01_07_425723	322	31	author	author	NN
10_1101-2021_01_07_425723	322	32	/	/	SYM
10_1101-2021_01_07_425723	322	33	funder	funder	NN
10_1101-2021_01_07_425723	322	34	,	,	,
10_1101-2021_01_07_425723	322	35	who	who	WP
10_1101-2021_01_07_425723	322	36	has	have	VBZ
10_1101-2021_01_07_425723	322	37	granted	grant	VBN
10_1101-2021_01_07_425723	322	38	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	322	39	a	a	DT
10_1101-2021_01_07_425723	322	40	license	license	NN
10_1101-2021_01_07_425723	322	41	to	to	TO
10_1101-2021_01_07_425723	322	42	display	display	VB
10_1101-2021_01_07_425723	322	43	the	the	DT
10_1101-2021_01_07_425723	322	44	preprint	preprint	NN
10_1101-2021_01_07_425723	322	45	in	in	IN
10_1101-2021_01_07_425723	322	46	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	322	47	.	.	.
10_1101-2021_01_07_425723	323	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	323	2	is	be	VBZ
10_1101-2021_01_07_425723	323	3	made	make	VBN
10_1101-2021_01_07_425723	323	4	The	the	DT
10_1101-2021_01_07_425723	323	5	copyright	copyright	NN
10_1101-2021_01_07_425723	323	6	holder	holder	NN
10_1101-2021_01_07_425723	323	7	for	for	IN
10_1101-2021_01_07_425723	323	8	this	this	DT
10_1101-2021_01_07_425723	323	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	323	10	version	version	NN
10_1101-2021_01_07_425723	323	11	posted	post	VBD
10_1101-2021_01_07_425723	323	12	January	January	NNP
10_1101-2021_01_07_425723	323	13	8	8	CD
10_1101-2021_01_07_425723	323	14	,	,	,
10_1101-2021_01_07_425723	323	15	2021	2021	CD
10_1101-2021_01_07_425723	323	16	.	.	.
10_1101-2021_01_07_425723	323	17	;	;	:
10_1101-2021_01_07_425723	323	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	323	19	:	:	:
10_1101-2021_01_07_425723	323	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	323	21	preprint	preprint	NN
10_1101-2021_01_07_425723	323	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	323	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	RB
10_1101-2021_01_07_425723	323	24	30	30	CD
10_1101-2021_01_07_425723	323	25	For	for	IN
10_1101-2021_01_07_425723	323	26	analysis	analysis	NN
10_1101-2021_01_07_425723	323	27	of	of	IN
10_1101-2021_01_07_425723	323	28	triterpene	triterpene	JJ
10_1101-2021_01_07_425723	323	29	and	and	CC
10_1101-2021_01_07_425723	323	30	triterpenoid	triterpenoid	JJ
10_1101-2021_01_07_425723	323	31	cell	cell	NN
10_1101-2021_01_07_425723	323	32	contents	content	NNS
10_1101-2021_01_07_425723	323	33	biomass	biomass	NNP
10_1101-2021_01_07_425723	323	34	was	be	VBD
10_1101-2021_01_07_425723	323	35	harvested	harvest	VBN
10_1101-2021_01_07_425723	323	36	,	,	,
10_1101-2021_01_07_425723	323	37	washed	wash	VBD
10_1101-2021_01_07_425723	323	38	once	once	RB
10_1101-2021_01_07_425723	323	39	with	with	IN
10_1101-2021_01_07_425723	323	40	495	495	CD
10_1101-2021_01_07_425723	323	41	demineralized	demineralized	JJ
10_1101-2021_01_07_425723	323	42	water	water	NN
10_1101-2021_01_07_425723	323	43	and	and	CC
10_1101-2021_01_07_425723	323	44	stored	store	VBD
10_1101-2021_01_07_425723	323	45	as	as	IN
10_1101-2021_01_07_425723	323	46	pellet	pellet	NN
10_1101-2021_01_07_425723	323	47	at	at	IN
10_1101-2021_01_07_425723	323	48	-80	-80	NNP
10_1101-2021_01_07_425723	323	49	°	°	NNP
10_1101-2021_01_07_425723	323	50	C	C	NNP
10_1101-2021_01_07_425723	323	51	before	before	IN
10_1101-2021_01_07_425723	323	52	freeze	freeze	NN
10_1101-2021_01_07_425723	323	53	-	-	HYPH
10_1101-2021_01_07_425723	323	54	drying	dry	VBG
10_1101-2021_01_07_425723	323	55	the	the	DT
10_1101-2021_01_07_425723	323	56	pellets	pellet	NNS
10_1101-2021_01_07_425723	323	57	using	use	VBG
10_1101-2021_01_07_425723	323	58	an	an	DT
10_1101-2021_01_07_425723	323	59	Alpha	alpha	NN
10_1101-2021_01_07_425723	323	60	1	1	CD
10_1101-2021_01_07_425723	323	61	-	-	SYM
10_1101-2021_01_07_425723	323	62	4	4	CD
10_1101-2021_01_07_425723	323	63	LD	LD	NNP
10_1101-2021_01_07_425723	323	64	496	496	CD
10_1101-2021_01_07_425723	323	65	Plus	plus	CC
10_1101-2021_01_07_425723	323	66	(	(	-LRB-
10_1101-2021_01_07_425723	323	67	Martin	Martin	NNP
10_1101-2021_01_07_425723	323	68	Christ	Christ	NNP
10_1101-2021_01_07_425723	323	69	,	,	,
10_1101-2021_01_07_425723	323	70	Osterode	Osterode	NNP
10_1101-2021_01_07_425723	323	71	am	be	VBP
10_1101-2021_01_07_425723	323	72	Harz	Harz	NNP
10_1101-2021_01_07_425723	323	73	,	,	,
10_1101-2021_01_07_425723	323	74	Germany	Germany	NNP
10_1101-2021_01_07_425723	323	75	)	)	-RRB-
10_1101-2021_01_07_425723	323	76	at	at	IN
10_1101-2021_01_07_425723	323	77	-60	-60	NNP
10_1101-2021_01_07_425723	323	78	°	°	NNP
10_1101-2021_01_07_425723	323	79	C	C	NNP
10_1101-2021_01_07_425723	323	80	and	and	CC
10_1101-2021_01_07_425723	323	81	0.05	0.05	CD
10_1101-2021_01_07_425723	323	82	mbar	mbar	NN
10_1101-2021_01_07_425723	323	83	.	.	.
10_1101-2021_01_07_425723	324	1	Freeze	freeze	VB
10_1101-2021_01_07_425723	324	2	-	-	HYPH
10_1101-2021_01_07_425723	324	3	dried	dry	VBN
10_1101-2021_01_07_425723	324	4	biomass	biomass	NN
10_1101-2021_01_07_425723	324	5	was	be	VBD
10_1101-2021_01_07_425723	324	6	497	497	CD
10_1101-2021_01_07_425723	324	7	saponificated	saponificate	VBN
10_1101-2021_01_07_425723	324	8	with	with	IN
10_1101-2021_01_07_425723	324	9	2.0	2.0	CD
10_1101-2021_01_07_425723	324	10	M	m	NN
10_1101-2021_01_07_425723	324	11	NaOH	naoh	NN
10_1101-2021_01_07_425723	324	12	(	(	-LRB-
10_1101-2021_01_07_425723	324	13	Bio	Bio	NNP
10_1101-2021_01_07_425723	324	14	-	-	HYPH
10_1101-2021_01_07_425723	324	15	Ultra	Ultra	NNP
10_1101-2021_01_07_425723	324	16	,	,	,
10_1101-2021_01_07_425723	324	17	Sigma	Sigma	NNP
10_1101-2021_01_07_425723	324	18	-	-	HYPH
10_1101-2021_01_07_425723	324	19	Aldrich	Aldrich	NNP
10_1101-2021_01_07_425723	324	20	)	)	-RRB-
10_1101-2021_01_07_425723	324	21	in	in	IN
10_1101-2021_01_07_425723	324	22	methylation	methylation	NN
10_1101-2021_01_07_425723	324	23	glass	glass	NN
10_1101-2021_01_07_425723	324	24	tubes	tube	NNS
10_1101-2021_01_07_425723	324	25	(	(	-LRB-
10_1101-2021_01_07_425723	324	26	PYREXTM	PYREXTM	NNP
10_1101-2021_01_07_425723	324	27	498	498	CD
10_1101-2021_01_07_425723	324	28	Boroslicate	Boroslicate	NNP
10_1101-2021_01_07_425723	324	29	glass	glass	NN
10_1101-2021_01_07_425723	324	30	,	,	,
10_1101-2021_01_07_425723	324	31	Thermo	Thermo	NNP
10_1101-2021_01_07_425723	324	32	Fisher	Fisher	NNP
10_1101-2021_01_07_425723	324	33	Scientific	Scientific	NNP
10_1101-2021_01_07_425723	324	34	)	)	-RRB-
10_1101-2021_01_07_425723	324	35	at	at	IN
10_1101-2021_01_07_425723	324	36	70	70	CD
10_1101-2021_01_07_425723	324	37	°	°	,
10_1101-2021_01_07_425723	324	38	C	C	NNP
10_1101-2021_01_07_425723	324	39	.	.	.
10_1101-2021_01_07_425723	325	1	As	as	IN
10_1101-2021_01_07_425723	325	2	internal	internal	JJ
10_1101-2021_01_07_425723	325	3	standard	standard	JJ
10_1101-2021_01_07_425723	325	4	5α	5α	NNP
10_1101-2021_01_07_425723	325	5	-	-	HYPH
10_1101-2021_01_07_425723	325	6	cholestane	cholestane	NNP
10_1101-2021_01_07_425723	325	7	(	(	-LRB-
10_1101-2021_01_07_425723	325	8	Sigma	Sigma	NNP
10_1101-2021_01_07_425723	325	9	-	-	HYPH
10_1101-2021_01_07_425723	325	10	Aldrich	Aldrich	NNP
10_1101-2021_01_07_425723	325	11	)	)	-RRB-
10_1101-2021_01_07_425723	325	12	499	499	CD
10_1101-2021_01_07_425723	325	13	was	be	VBD
10_1101-2021_01_07_425723	325	14	added	add	VBN
10_1101-2021_01_07_425723	325	15	to	to	IN
10_1101-2021_01_07_425723	325	16	the	the	DT
10_1101-2021_01_07_425723	325	17	saponified	saponified	JJ
10_1101-2021_01_07_425723	325	18	biomass	biomass	NN
10_1101-2021_01_07_425723	325	19	suspension	suspension	NN
10_1101-2021_01_07_425723	325	20	.	.	.
10_1101-2021_01_07_425723	326	1	Subsequently	subsequently	RB
10_1101-2021_01_07_425723	326	2	tert	tert	NN
10_1101-2021_01_07_425723	326	3	-	-	HYPH
10_1101-2021_01_07_425723	326	4	butyl	butyl	NN
10_1101-2021_01_07_425723	326	5	-	-	HYPH
10_1101-2021_01_07_425723	326	6	methyl	methyl	NN
10_1101-2021_01_07_425723	326	7	-	-	HYPH
10_1101-2021_01_07_425723	326	8	ether	ether	NN
10_1101-2021_01_07_425723	326	9	(	(	-LRB-
10_1101-2021_01_07_425723	326	10	tBME	tbme	NN
10_1101-2021_01_07_425723	326	11	,	,	,
10_1101-2021_01_07_425723	326	12	Sigma-500	Sigma-500	.
10_1101-2021_01_07_425723	326	13	Aldrich	Aldrich	NNP
10_1101-2021_01_07_425723	326	14	)	)	-RRB-
10_1101-2021_01_07_425723	326	15	was	be	VBD
10_1101-2021_01_07_425723	326	16	added	add	VBN
10_1101-2021_01_07_425723	326	17	for	for	IN
10_1101-2021_01_07_425723	326	18	organic	organic	JJ
10_1101-2021_01_07_425723	326	19	phase	phase	NN
10_1101-2021_01_07_425723	326	20	extraction	extraction	NN
10_1101-2021_01_07_425723	326	21	.	.	.
10_1101-2021_01_07_425723	327	1	Samples	sample	NNS
10_1101-2021_01_07_425723	327	2	were	be	VBD
10_1101-2021_01_07_425723	327	3	extracted	extract	VBN
10_1101-2021_01_07_425723	327	4	twice	twice	RB
10_1101-2021_01_07_425723	327	5	using	use	VBG
10_1101-2021_01_07_425723	327	6	tBME	tbme	NN
10_1101-2021_01_07_425723	327	7	and	and	CC
10_1101-2021_01_07_425723	327	8	dried	dry	VBD
10_1101-2021_01_07_425723	327	9	501	501	CD
10_1101-2021_01_07_425723	327	10	with	with	IN
10_1101-2021_01_07_425723	327	11	sodium	sodium	NN
10_1101-2021_01_07_425723	327	12	-	-	HYPH
10_1101-2021_01_07_425723	327	13	sulfate	sulfate	NN
10_1101-2021_01_07_425723	327	14	(	(	-LRB-
10_1101-2021_01_07_425723	327	15	Merck	Merck	NNP
10_1101-2021_01_07_425723	327	16	,	,	,
10_1101-2021_01_07_425723	327	17	Darmstadt	Darmstadt	NNP
10_1101-2021_01_07_425723	327	18	,	,	,
10_1101-2021_01_07_425723	327	19	Germany	Germany	NNP
10_1101-2021_01_07_425723	327	20	)	)	-RRB-
10_1101-2021_01_07_425723	327	21	to	to	TO
10_1101-2021_01_07_425723	327	22	remove	remove	VB
10_1101-2021_01_07_425723	327	23	remaining	remain	VBG
10_1101-2021_01_07_425723	327	24	traces	trace	NNS
10_1101-2021_01_07_425723	327	25	of	of	IN
10_1101-2021_01_07_425723	327	26	water	water	NN
10_1101-2021_01_07_425723	327	27	.	.	.
10_1101-2021_01_07_425723	328	1	The	the	DT
10_1101-2021_01_07_425723	328	2	organic	organic	JJ
10_1101-2021_01_07_425723	328	3	502	502	CD
10_1101-2021_01_07_425723	328	4	phase	phase	NN
10_1101-2021_01_07_425723	328	5	was	be	VBD
10_1101-2021_01_07_425723	328	6	either	either	CC
10_1101-2021_01_07_425723	328	7	concentrated	concentrate	VBN
10_1101-2021_01_07_425723	328	8	by	by	IN
10_1101-2021_01_07_425723	328	9	evaporation	evaporation	NN
10_1101-2021_01_07_425723	328	10	with	with	IN
10_1101-2021_01_07_425723	328	11	N2	N2	NNP
10_1101-2021_01_07_425723	328	12	gas	gas	NN
10_1101-2021_01_07_425723	328	13	aeration	aeration	NN
10_1101-2021_01_07_425723	328	14	or	or	CC
10_1101-2021_01_07_425723	328	15	transferred	transfer	VBD
10_1101-2021_01_07_425723	328	16	directly	directly	RB
10_1101-2021_01_07_425723	328	17	to	to	IN
10_1101-2021_01_07_425723	328	18	an	an	DT
10_1101-2021_01_07_425723	328	19	503	503	CD
10_1101-2021_01_07_425723	328	20	injection	injection	NN
10_1101-2021_01_07_425723	328	21	vial	vial	NN
10_1101-2021_01_07_425723	328	22	(	(	-LRB-
10_1101-2021_01_07_425723	328	23	VWR	VWR	NNP
10_1101-2021_01_07_425723	328	24	International	International	NNP
10_1101-2021_01_07_425723	328	25	,	,	,
10_1101-2021_01_07_425723	328	26	Amsterdam	Amsterdam	NNP
10_1101-2021_01_07_425723	328	27	,	,	,
10_1101-2021_01_07_425723	328	28	the	the	DT
10_1101-2021_01_07_425723	328	29	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	328	30	)	)	-RRB-
10_1101-2021_01_07_425723	328	31	.	.	.
10_1101-2021_01_07_425723	329	1	The	the	DT
10_1101-2021_01_07_425723	329	2	contents	content	NNS
10_1101-2021_01_07_425723	329	3	were	be	VBD
10_1101-2021_01_07_425723	329	4	measured	measure	VBN
10_1101-2021_01_07_425723	329	5	by	by	IN
10_1101-2021_01_07_425723	329	6	GC	GC	NNP
10_1101-2021_01_07_425723	329	7	-	-	HYPH
10_1101-2021_01_07_425723	329	8	FID	FID	NNP
10_1101-2021_01_07_425723	329	9	504	504	CD
10_1101-2021_01_07_425723	329	10	using	use	VBG
10_1101-2021_01_07_425723	329	11	Agilent	Agilent	NNP
10_1101-2021_01_07_425723	329	12	7890A	7890A	NNP
10_1101-2021_01_07_425723	329	13	Gas	Gas	NNP
10_1101-2021_01_07_425723	329	14	Chromatograph	Chromatograph	NNP
10_1101-2021_01_07_425723	329	15	(	(	-LRB-
10_1101-2021_01_07_425723	329	16	Agilent	Agilent	NNP
10_1101-2021_01_07_425723	329	17	Technologies	Technologies	NNP
10_1101-2021_01_07_425723	329	18	,	,	,
10_1101-2021_01_07_425723	329	19	Santa	Santa	NNP
10_1101-2021_01_07_425723	329	20	Clara	Clara	NNP
10_1101-2021_01_07_425723	329	21	,	,	,
10_1101-2021_01_07_425723	329	22	CA	CA	NNP
10_1101-2021_01_07_425723	329	23	)	)	-RRB-
10_1101-2021_01_07_425723	329	24	equipped	equip	VBD
10_1101-2021_01_07_425723	329	25	with	with	IN
10_1101-2021_01_07_425723	329	26	an	an	DT
10_1101-2021_01_07_425723	329	27	505	505	CD
10_1101-2021_01_07_425723	329	28	Agilent	Agilent	NNP
10_1101-2021_01_07_425723	329	29	CP9013	cp9013	NN
10_1101-2021_01_07_425723	329	30	column	column	NN
10_1101-2021_01_07_425723	329	31	(	(	-LRB-
10_1101-2021_01_07_425723	329	32	Agilent	Agilent	NNP
10_1101-2021_01_07_425723	329	33	)	)	-RRB-
10_1101-2021_01_07_425723	329	34	.	.	.
10_1101-2021_01_07_425723	330	1	The	the	DT
10_1101-2021_01_07_425723	330	2	oven	oven	NN
10_1101-2021_01_07_425723	330	3	was	be	VBD
10_1101-2021_01_07_425723	330	4	programmed	program	VBN
10_1101-2021_01_07_425723	330	5	to	to	TO
10_1101-2021_01_07_425723	330	6	start	start	VB
10_1101-2021_01_07_425723	330	7	at	at	IN
10_1101-2021_01_07_425723	330	8	80	80	CD
10_1101-2021_01_07_425723	330	9	°	°	,
10_1101-2021_01_07_425723	330	10	C	C	NNP
10_1101-2021_01_07_425723	330	11	for	for	IN
10_1101-2021_01_07_425723	330	12	1	1	CD
10_1101-2021_01_07_425723	330	13	min	min	NNP
10_1101-2021_01_07_425723	330	14	,	,	,
10_1101-2021_01_07_425723	330	15	ramp	ramp	NNP
10_1101-2021_01_07_425723	330	16	first	first	RB
10_1101-2021_01_07_425723	330	17	to	to	IN
10_1101-2021_01_07_425723	330	18	280	280	CD
10_1101-2021_01_07_425723	330	19	506	506	CD
10_1101-2021_01_07_425723	330	20	°	°	,
10_1101-2021_01_07_425723	330	21	C	C	NNP
10_1101-2021_01_07_425723	330	22	with	with	IN
10_1101-2021_01_07_425723	330	23	60	60	CD
10_1101-2021_01_07_425723	330	24	°	°	NNS
10_1101-2021_01_07_425723	330	25	C·min-1	C·min-1	NNP
10_1101-2021_01_07_425723	330	26	and	and	CC
10_1101-2021_01_07_425723	330	27	secondly	secondly	RB
10_1101-2021_01_07_425723	330	28	to	to	IN
10_1101-2021_01_07_425723	330	29	320	320	CD
10_1101-2021_01_07_425723	330	30	°	°	,
10_1101-2021_01_07_425723	330	31	C	C	NNP
10_1101-2021_01_07_425723	330	32	with	with	IN
10_1101-2021_01_07_425723	330	33	a	a	DT
10_1101-2021_01_07_425723	330	34	rate	rate	NN
10_1101-2021_01_07_425723	330	35	of	of	IN
10_1101-2021_01_07_425723	330	36	10	10	CD
10_1101-2021_01_07_425723	330	37	°	°	,
10_1101-2021_01_07_425723	330	38	C·min-1	C·min-1	NNP
10_1101-2021_01_07_425723	330	39	with	with	IN
10_1101-2021_01_07_425723	330	40	a	a	DT
10_1101-2021_01_07_425723	330	41	final	final	JJ
10_1101-2021_01_07_425723	330	42	temperature	temperature	NN
10_1101-2021_01_07_425723	330	43	hold	hold	NN
10_1101-2021_01_07_425723	330	44	of	of	IN
10_1101-2021_01_07_425723	330	45	15	15	CD
10_1101-2021_01_07_425723	330	46	507	507	CD
10_1101-2021_01_07_425723	330	47	min	min	NN
10_1101-2021_01_07_425723	330	48	.	.	.
10_1101-2021_01_07_425723	331	1	Spectra	Spectra	NNP
10_1101-2021_01_07_425723	331	2	were	be	VBD
10_1101-2021_01_07_425723	331	3	compared	compare	VBN
10_1101-2021_01_07_425723	331	4	to	to	IN
10_1101-2021_01_07_425723	331	5	separate	separate	JJ
10_1101-2021_01_07_425723	331	6	calibration	calibration	NN
10_1101-2021_01_07_425723	331	7	lines	line	NNS
10_1101-2021_01_07_425723	331	8	of	of	IN
10_1101-2021_01_07_425723	331	9	squalene	squalene	NN
10_1101-2021_01_07_425723	331	10	,	,	,
10_1101-2021_01_07_425723	331	11	ergosterol	ergosterol	UH
10_1101-2021_01_07_425723	331	12	,	,	,
10_1101-2021_01_07_425723	331	13	α	α	NNP
10_1101-2021_01_07_425723	331	14	-	-	HYPH
10_1101-2021_01_07_425723	331	15	cholestane	cholestane	NNP
10_1101-2021_01_07_425723	331	16	,	,	,
10_1101-2021_01_07_425723	331	17	508	508	CD
10_1101-2021_01_07_425723	331	18	cholesterol	cholesterol	NN
10_1101-2021_01_07_425723	331	19	and	and	CC
10_1101-2021_01_07_425723	331	20	tetrahymanol	tetrahymanol	NNS
10_1101-2021_01_07_425723	331	21	as	as	IN
10_1101-2021_01_07_425723	331	22	described	describe	VBN
10_1101-2021_01_07_425723	331	23	previously46	previously46	CD
10_1101-2021_01_07_425723	331	24	.	.	.
10_1101-2021_01_07_425723	332	1	509	509	CD
10_1101-2021_01_07_425723	332	2	Sterol	Sterol	NNP
10_1101-2021_01_07_425723	332	3	uptake	uptake	NN
10_1101-2021_01_07_425723	332	4	assay	assay	NN
10_1101-2021_01_07_425723	332	5	510	510	CD
10_1101-2021_01_07_425723	332	6	Sterol	Sterol	NNP
10_1101-2021_01_07_425723	332	7	uptake	uptake	NN
10_1101-2021_01_07_425723	332	8	was	be	VBD
10_1101-2021_01_07_425723	332	9	monitored	monitor	VBN
10_1101-2021_01_07_425723	332	10	by	by	IN
10_1101-2021_01_07_425723	332	11	the	the	DT
10_1101-2021_01_07_425723	332	12	uptake	uptake	NN
10_1101-2021_01_07_425723	332	13	of	of	IN
10_1101-2021_01_07_425723	332	14	fluorescently	fluorescently	RB
10_1101-2021_01_07_425723	332	15	labelled	label	VBN
10_1101-2021_01_07_425723	332	16	25-NBD	25-nbd	CD
10_1101-2021_01_07_425723	332	17	-	-	HYPH
10_1101-2021_01_07_425723	332	18	cholesterol	cholesterol	NN
10_1101-2021_01_07_425723	332	19	(	(	-LRB-
10_1101-2021_01_07_425723	332	20	Avanti	Avanti	NNP
10_1101-2021_01_07_425723	332	21	Polar	Polar	NNP
10_1101-2021_01_07_425723	332	22	511	511	CD
10_1101-2021_01_07_425723	332	23	Lipids	Lipids	NNPS
10_1101-2021_01_07_425723	332	24	,	,	,
10_1101-2021_01_07_425723	332	25	Alabaster	Alabaster	NNP
10_1101-2021_01_07_425723	332	26	,	,	,
10_1101-2021_01_07_425723	332	27	AL	AL	NNP
10_1101-2021_01_07_425723	332	28	)	)	-RRB-
10_1101-2021_01_07_425723	332	29	.	.	.
10_1101-2021_01_07_425723	333	1	A	a	DT
10_1101-2021_01_07_425723	333	2	stock	stock	NN
10_1101-2021_01_07_425723	333	3	solution	solution	NN
10_1101-2021_01_07_425723	333	4	of	of	IN
10_1101-2021_01_07_425723	333	5	25-NBD	25-nbd	CD
10_1101-2021_01_07_425723	333	6	-	-	HYPH
10_1101-2021_01_07_425723	333	7	cholesterol	cholesterol	NN
10_1101-2021_01_07_425723	333	8	(	(	-LRB-
10_1101-2021_01_07_425723	333	9	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	333	10	)	)	-RRB-
10_1101-2021_01_07_425723	333	11	was	be	VBD
10_1101-2021_01_07_425723	333	12	prepared	prepare	VBN
10_1101-2021_01_07_425723	333	13	in	in	IN
10_1101-2021_01_07_425723	333	14	ethanol	ethanol	NN
10_1101-2021_01_07_425723	333	15	under	under	IN
10_1101-2021_01_07_425723	333	16	an	an	DT
10_1101-2021_01_07_425723	333	17	512	512	CD
10_1101-2021_01_07_425723	333	18	argon	argon	NN
10_1101-2021_01_07_425723	333	19	atmosphere	atmosphere	NN
10_1101-2021_01_07_425723	333	20	and	and	CC
10_1101-2021_01_07_425723	333	21	stored	store	VBD
10_1101-2021_01_07_425723	333	22	at	at	IN
10_1101-2021_01_07_425723	333	23	-20	-20	NNP
10_1101-2021_01_07_425723	333	24	°	°	NNP
10_1101-2021_01_07_425723	333	25	C	C	NNP
10_1101-2021_01_07_425723	333	26	.	.	.
10_1101-2021_01_07_425723	334	1	Shake	shake	VB
10_1101-2021_01_07_425723	334	2	flasks	flask	NNS
10_1101-2021_01_07_425723	334	3	with	with	IN
10_1101-2021_01_07_425723	334	4	10	10	CD
10_1101-2021_01_07_425723	334	5	mL	mL	NNP
10_1101-2021_01_07_425723	334	6	SM	SM	NNP
10_1101-2021_01_07_425723	334	7	glucose	glucose	NN
10_1101-2021_01_07_425723	334	8	media	medium	NNS
10_1101-2021_01_07_425723	334	9	were	be	VBD
10_1101-2021_01_07_425723	334	10	inoculated	inoculate	VBN
10_1101-2021_01_07_425723	334	11	with	with	IN
10_1101-2021_01_07_425723	334	12	513	513	CD
10_1101-2021_01_07_425723	334	13	yeast	yeast	NN
10_1101-2021_01_07_425723	334	14	strains	strain	NNS
10_1101-2021_01_07_425723	334	15	from	from	IN
10_1101-2021_01_07_425723	334	16	a	a	DT
10_1101-2021_01_07_425723	334	17	cryo	cryo	NN
10_1101-2021_01_07_425723	334	18	-	-	HYPH
10_1101-2021_01_07_425723	334	19	stock	stock	NN
10_1101-2021_01_07_425723	334	20	and	and	CC
10_1101-2021_01_07_425723	334	21	cultivated	cultivate	VBN
10_1101-2021_01_07_425723	334	22	aerobically	aerobically	RB
10_1101-2021_01_07_425723	334	23	at	at	IN
10_1101-2021_01_07_425723	334	24	200	200	CD
10_1101-2021_01_07_425723	334	25	rpm	rpm	NN
10_1101-2021_01_07_425723	334	26	at	at	IN
10_1101-2021_01_07_425723	334	27	30	30	CD
10_1101-2021_01_07_425723	334	28	°	°	,
10_1101-2021_01_07_425723	334	29	C	C	NNP
10_1101-2021_01_07_425723	334	30	overnight	overnight	RB
10_1101-2021_01_07_425723	334	31	.	.	.
10_1101-2021_01_07_425723	335	1	The	the	DT
10_1101-2021_01_07_425723	335	2	yeast	yeast	NN
10_1101-2021_01_07_425723	335	3	514	514	CD
10_1101-2021_01_07_425723	335	4	cultures	culture	NNS
10_1101-2021_01_07_425723	335	5	were	be	VBD
10_1101-2021_01_07_425723	335	6	subsequently	subsequently	RB
10_1101-2021_01_07_425723	335	7	diluted	dilute	VBN
10_1101-2021_01_07_425723	335	8	to	to	IN
10_1101-2021_01_07_425723	335	9	an	an	DT
10_1101-2021_01_07_425723	335	10	OD660	od660	NN
10_1101-2021_01_07_425723	335	11	of	of	IN
10_1101-2021_01_07_425723	335	12	0.2	0.2	CD
10_1101-2021_01_07_425723	335	13	in	in	IN
10_1101-2021_01_07_425723	335	14	400	400	CD
10_1101-2021_01_07_425723	335	15	mL	mL	NNP
10_1101-2021_01_07_425723	335	16	SM	SM	NNP
10_1101-2021_01_07_425723	335	17	glucose	glucose	NN
10_1101-2021_01_07_425723	335	18	media	medium	NNS
10_1101-2021_01_07_425723	335	19	in	in	IN
10_1101-2021_01_07_425723	335	20	500	500	CD
10_1101-2021_01_07_425723	335	21	mL	mL	NNP
10_1101-2021_01_07_425723	335	22	shake	shake	VBP
10_1101-2021_01_07_425723	335	23	515	515	CD
10_1101-2021_01_07_425723	335	24	flasks	flask	NNS
10_1101-2021_01_07_425723	335	25	to	to	TO
10_1101-2021_01_07_425723	335	26	gradually	gradually	RB
10_1101-2021_01_07_425723	335	27	reduce	reduce	VB
10_1101-2021_01_07_425723	335	28	the	the	DT
10_1101-2021_01_07_425723	335	29	availability	availability	NN
10_1101-2021_01_07_425723	335	30	of	of	IN
10_1101-2021_01_07_425723	335	31	oxygen	oxygen	NN
10_1101-2021_01_07_425723	335	32	and	and	CC
10_1101-2021_01_07_425723	335	33	incubated	incubate	VBD
10_1101-2021_01_07_425723	335	34	overnight	overnight	RB
10_1101-2021_01_07_425723	335	35	.	.	.
10_1101-2021_01_07_425723	336	1	Yeast	yeast	NN
10_1101-2021_01_07_425723	336	2	cultures	culture	NNS
10_1101-2021_01_07_425723	336	3	were	be	VBD
10_1101-2021_01_07_425723	336	4	516	516	CD
10_1101-2021_01_07_425723	336	5	transferred	transfer	VBN
10_1101-2021_01_07_425723	336	6	to	to	IN
10_1101-2021_01_07_425723	336	7	fresh	fresh	JJ
10_1101-2021_01_07_425723	336	8	SM	SM	NNP
10_1101-2021_01_07_425723	336	9	media	medium	NNS
10_1101-2021_01_07_425723	336	10	with	with	IN
10_1101-2021_01_07_425723	336	11	40	40	CD
10_1101-2021_01_07_425723	336	12	g·L-1	g·l-1	CD
10_1101-2021_01_07_425723	336	13	glucose	glucose	NN
10_1101-2021_01_07_425723	336	14	and	and	CC
10_1101-2021_01_07_425723	336	15	incubated	incubate	VBD
10_1101-2021_01_07_425723	336	16	under	under	IN
10_1101-2021_01_07_425723	336	17	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	336	18	conditions	condition	NNS
10_1101-2021_01_07_425723	336	19	at	at	IN
10_1101-2021_01_07_425723	336	20	30	30	CD
10_1101-2021_01_07_425723	336	21	°	°	,
10_1101-2021_01_07_425723	336	22	C	C	NNP
10_1101-2021_01_07_425723	336	23	517	517	CD
10_1101-2021_01_07_425723	336	24	.CC	.CC	:
10_1101-2021_01_07_425723	336	25	-	-	HYPH
10_1101-2021_01_07_425723	336	26	BY	by	IN
10_1101-2021_01_07_425723	336	27	-	-	HYPH
10_1101-2021_01_07_425723	336	28	NC	NC	NNP
10_1101-2021_01_07_425723	336	29	-	-	HYPH
10_1101-2021_01_07_425723	336	30	ND	ND	NNP
10_1101-2021_01_07_425723	336	31	4.0	4.0	CD
10_1101-2021_01_07_425723	336	32	International	International	NNP
10_1101-2021_01_07_425723	336	33	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	336	34	under	under	IN
10_1101-2021_01_07_425723	336	35	a	a	DT
10_1101-2021_01_07_425723	336	36	(	(	-LRB-
10_1101-2021_01_07_425723	336	37	which	which	WDT
10_1101-2021_01_07_425723	336	38	was	be	VBD
10_1101-2021_01_07_425723	336	39	not	not	RB
10_1101-2021_01_07_425723	336	40	certified	certify	VBN
10_1101-2021_01_07_425723	336	41	by	by	IN
10_1101-2021_01_07_425723	336	42	peer	peer	NN
10_1101-2021_01_07_425723	336	43	review	review	NN
10_1101-2021_01_07_425723	336	44	)	)	-RRB-
10_1101-2021_01_07_425723	336	45	is	be	VBZ
10_1101-2021_01_07_425723	336	46	the	the	DT
10_1101-2021_01_07_425723	336	47	author	author	NN
10_1101-2021_01_07_425723	336	48	/	/	SYM
10_1101-2021_01_07_425723	336	49	funder	funder	NN
10_1101-2021_01_07_425723	336	50	,	,	,
10_1101-2021_01_07_425723	336	51	who	who	WP
10_1101-2021_01_07_425723	336	52	has	have	VBZ
10_1101-2021_01_07_425723	336	53	granted	grant	VBN
10_1101-2021_01_07_425723	336	54	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	336	55	a	a	DT
10_1101-2021_01_07_425723	336	56	license	license	NN
10_1101-2021_01_07_425723	336	57	to	to	TO
10_1101-2021_01_07_425723	336	58	display	display	VB
10_1101-2021_01_07_425723	336	59	the	the	DT
10_1101-2021_01_07_425723	336	60	preprint	preprint	NN
10_1101-2021_01_07_425723	336	61	in	in	IN
10_1101-2021_01_07_425723	336	62	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	336	63	.	.	.
10_1101-2021_01_07_425723	337	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	337	2	is	be	VBZ
10_1101-2021_01_07_425723	337	3	made	make	VBN
10_1101-2021_01_07_425723	337	4	The	the	DT
10_1101-2021_01_07_425723	337	5	copyright	copyright	NN
10_1101-2021_01_07_425723	337	6	holder	holder	NN
10_1101-2021_01_07_425723	337	7	for	for	IN
10_1101-2021_01_07_425723	337	8	this	this	DT
10_1101-2021_01_07_425723	337	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	337	10	version	version	NN
10_1101-2021_01_07_425723	337	11	posted	post	VBD
10_1101-2021_01_07_425723	337	12	January	January	NNP
10_1101-2021_01_07_425723	337	13	8	8	CD
10_1101-2021_01_07_425723	337	14	,	,	,
10_1101-2021_01_07_425723	337	15	2021	2021	CD
10_1101-2021_01_07_425723	337	16	.	.	.
10_1101-2021_01_07_425723	337	17	;	;	:
10_1101-2021_01_07_425723	337	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	337	19	:	:	:
10_1101-2021_01_07_425723	337	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	337	21	preprint	preprint	NN
10_1101-2021_01_07_425723	337	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	337	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	337	24	31	31	CD
10_1101-2021_01_07_425723	337	25	at	at	IN
10_1101-2021_01_07_425723	337	26	200	200	CD
10_1101-2021_01_07_425723	337	27	rpm	rpm	NN
10_1101-2021_01_07_425723	337	28	.	.	.
10_1101-2021_01_07_425723	338	1	After	after	IN
10_1101-2021_01_07_425723	338	2	22	22	CD
10_1101-2021_01_07_425723	338	3	hours	hour	NNS
10_1101-2021_01_07_425723	338	4	of	of	IN
10_1101-2021_01_07_425723	338	5	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	338	6	incubation	incubation	NN
10_1101-2021_01_07_425723	338	7	4	4	CD
10_1101-2021_01_07_425723	338	8	µg·L-1	µg·L-1	NNP
10_1101-2021_01_07_425723	338	9	NBD	NBD	NNP
10_1101-2021_01_07_425723	338	10	-	-	HYPH
10_1101-2021_01_07_425723	338	11	cholesterol	cholesterol	NN
10_1101-2021_01_07_425723	338	12	with	with	IN
10_1101-2021_01_07_425723	338	13	420	420	CD
10_1101-2021_01_07_425723	338	14	mg·L-1	mg·l-1	NN
10_1101-2021_01_07_425723	338	15	Tween	Tween	NNP
10_1101-2021_01_07_425723	338	16	80	80	CD
10_1101-2021_01_07_425723	338	17	518	518	CD
10_1101-2021_01_07_425723	338	18	were	be	VBD
10_1101-2021_01_07_425723	338	19	pulsed	pulse	VBN
10_1101-2021_01_07_425723	338	20	to	to	IN
10_1101-2021_01_07_425723	338	21	the	the	DT
10_1101-2021_01_07_425723	338	22	cultures	culture	NNS
10_1101-2021_01_07_425723	338	23	.	.	.
10_1101-2021_01_07_425723	339	1	Samples	sample	NNS
10_1101-2021_01_07_425723	339	2	were	be	VBD
10_1101-2021_01_07_425723	339	3	taken	take	VBN
10_1101-2021_01_07_425723	339	4	and	and	CC
10_1101-2021_01_07_425723	339	5	washed	wash	VBN
10_1101-2021_01_07_425723	339	6	with	with	IN
10_1101-2021_01_07_425723	339	7	PBS	PBS	NNP
10_1101-2021_01_07_425723	339	8	5	5	CD
10_1101-2021_01_07_425723	339	9	mL·L-1	mL·L-1	NNP
10_1101-2021_01_07_425723	339	10	Tergitol	Tergitol	NNP
10_1101-2021_01_07_425723	339	11	NP-40	NP-40	NNP
10_1101-2021_01_07_425723	339	12	pH	pH	NNP
10_1101-2021_01_07_425723	339	13	7.0	7.0	CD
10_1101-2021_01_07_425723	339	14	519	519	CD
10_1101-2021_01_07_425723	339	15	(	(	-LRB-
10_1101-2021_01_07_425723	339	16	Sigma	Sigma	NNP
10_1101-2021_01_07_425723	339	17	-	-	HYPH
10_1101-2021_01_07_425723	339	18	Aldrich	Aldrich	NNP
10_1101-2021_01_07_425723	339	19	)	)	-RRB-
10_1101-2021_01_07_425723	339	20	twice	twice	RB
10_1101-2021_01_07_425723	339	21	before	before	IN
10_1101-2021_01_07_425723	339	22	resuspension	resuspension	NN
10_1101-2021_01_07_425723	339	23	in	in	IN
10_1101-2021_01_07_425723	339	24	PBS	PBS	NNP
10_1101-2021_01_07_425723	339	25	and	and	CC
10_1101-2021_01_07_425723	339	26	subsequent	subsequent	JJ
10_1101-2021_01_07_425723	339	27	analysis	analysis	NN
10_1101-2021_01_07_425723	339	28	.	.	.
10_1101-2021_01_07_425723	340	1	Propidium	Propidium	NNP
10_1101-2021_01_07_425723	340	2	Iodide	Iodide	NNP
10_1101-2021_01_07_425723	340	3	(	(	-LRB-
10_1101-2021_01_07_425723	340	4	PI	PI	NNP
10_1101-2021_01_07_425723	340	5	)	)	-RRB-
10_1101-2021_01_07_425723	340	6	520	520	CD
10_1101-2021_01_07_425723	340	7	(	(	-LRB-
10_1101-2021_01_07_425723	340	8	Invitrogen	Invitrogen	NNP
10_1101-2021_01_07_425723	340	9	)	)	-RRB-
10_1101-2021_01_07_425723	340	10	was	be	VBD
10_1101-2021_01_07_425723	340	11	added	add	VBN
10_1101-2021_01_07_425723	340	12	to	to	IN
10_1101-2021_01_07_425723	340	13	the	the	DT
10_1101-2021_01_07_425723	340	14	sample	sample	NN
10_1101-2021_01_07_425723	340	15	(	(	-LRB-
10_1101-2021_01_07_425723	340	16	20	20	CD
10_1101-2021_01_07_425723	340	17	µM	µM	NNP
10_1101-2021_01_07_425723	340	18	)	)	-RRB-
10_1101-2021_01_07_425723	340	19	and	and	CC
10_1101-2021_01_07_425723	340	20	stained	stain	VBN
10_1101-2021_01_07_425723	340	21	according	accord	VBG
10_1101-2021_01_07_425723	340	22	to	to	IN
10_1101-2021_01_07_425723	340	23	the	the	DT
10_1101-2021_01_07_425723	340	24	manufacturer	manufacturer	NN
10_1101-2021_01_07_425723	340	25	’s	’s	POS
10_1101-2021_01_07_425723	340	26	521	521	CD
10_1101-2021_01_07_425723	340	27	instructions68	instructions68	NNS
10_1101-2021_01_07_425723	340	28	.	.	.
10_1101-2021_01_07_425723	341	1	PI	pi	NN
10_1101-2021_01_07_425723	341	2	intercalates	intercalate	NNS
10_1101-2021_01_07_425723	341	3	with	with	IN
10_1101-2021_01_07_425723	341	4	DNA	dna	NN
10_1101-2021_01_07_425723	341	5	in	in	IN
10_1101-2021_01_07_425723	341	6	cells	cell	NNS
10_1101-2021_01_07_425723	341	7	with	with	IN
10_1101-2021_01_07_425723	341	8	a	a	DT
10_1101-2021_01_07_425723	341	9	compromised	compromised	JJ
10_1101-2021_01_07_425723	341	10	cell	cell	NN
10_1101-2021_01_07_425723	341	11	membrane	membrane	NN
10_1101-2021_01_07_425723	341	12	,	,	,
10_1101-2021_01_07_425723	341	13	which	which	WDT
10_1101-2021_01_07_425723	341	14	results	result	VBZ
10_1101-2021_01_07_425723	341	15	in	in	IN
10_1101-2021_01_07_425723	341	16	red	red	JJ
10_1101-2021_01_07_425723	341	17	522	522	CD
10_1101-2021_01_07_425723	341	18	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	341	19	.	.	.
10_1101-2021_01_07_425723	342	1	Samples	sample	NNS
10_1101-2021_01_07_425723	342	2	both	both	CC
10_1101-2021_01_07_425723	342	3	unstained	unstained	JJ
10_1101-2021_01_07_425723	342	4	and	and	CC
10_1101-2021_01_07_425723	342	5	stained	stain	VBN
10_1101-2021_01_07_425723	342	6	with	with	IN
10_1101-2021_01_07_425723	342	7	PI	PI	NNP
10_1101-2021_01_07_425723	342	8	were	be	VBD
10_1101-2021_01_07_425723	342	9	analyzed	analyze	VBN
10_1101-2021_01_07_425723	342	10	with	with	IN
10_1101-2021_01_07_425723	342	11	Accuri	Accuri	NNP
10_1101-2021_01_07_425723	342	12	C6	C6	NNP
10_1101-2021_01_07_425723	342	13	flow	flow	NN
10_1101-2021_01_07_425723	342	14	cytometer	cytometer	NN
10_1101-2021_01_07_425723	342	15	523	523	CD
10_1101-2021_01_07_425723	342	16	(	(	-LRB-
10_1101-2021_01_07_425723	342	17	BD	BD	NNP
10_1101-2021_01_07_425723	342	18	Biosciences	Biosciences	NNP
10_1101-2021_01_07_425723	342	19	,	,	,
10_1101-2021_01_07_425723	342	20	Franklin	Franklin	NNP
10_1101-2021_01_07_425723	342	21	Lakes	Lakes	NNP
10_1101-2021_01_07_425723	342	22	,	,	,
10_1101-2021_01_07_425723	342	23	NJ	NJ	NNP
10_1101-2021_01_07_425723	342	24	)	)	-RRB-
10_1101-2021_01_07_425723	342	25	with	with	IN
10_1101-2021_01_07_425723	342	26	a	a	DT
10_1101-2021_01_07_425723	342	27	488	488	CD
10_1101-2021_01_07_425723	342	28	nm	nm	NNP
10_1101-2021_01_07_425723	342	29	laser	laser	NN
10_1101-2021_01_07_425723	342	30	and	and	CC
10_1101-2021_01_07_425723	342	31	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	342	32	was	be	VBD
10_1101-2021_01_07_425723	342	33	measured	measure	VBN
10_1101-2021_01_07_425723	342	34	with	with	IN
10_1101-2021_01_07_425723	342	35	emission	emission	NN
10_1101-2021_01_07_425723	342	36	524	524	CD
10_1101-2021_01_07_425723	342	37	filter	filter	NN
10_1101-2021_01_07_425723	342	38	of	of	IN
10_1101-2021_01_07_425723	342	39	533/30	533/30	CD
10_1101-2021_01_07_425723	342	40	nm	nm	IN
10_1101-2021_01_07_425723	342	41	(	(	-LRB-
10_1101-2021_01_07_425723	342	42	FL1	FL1	NNP
10_1101-2021_01_07_425723	342	43	)	)	-RRB-
10_1101-2021_01_07_425723	342	44	for	for	IN
10_1101-2021_01_07_425723	342	45	NBD	NBD	NNP
10_1101-2021_01_07_425723	342	46	-	-	HYPH
10_1101-2021_01_07_425723	342	47	cholesterol	cholesterol	NN
10_1101-2021_01_07_425723	342	48	and	and	CC
10_1101-2021_01_07_425723	342	49	>	>	XX
10_1101-2021_01_07_425723	342	50	670	670	CD
10_1101-2021_01_07_425723	342	51	nm	nm	CD
10_1101-2021_01_07_425723	342	52	(	(	-LRB-
10_1101-2021_01_07_425723	342	53	FL3	FL3	NNP
10_1101-2021_01_07_425723	342	54	)	)	-RRB-
10_1101-2021_01_07_425723	342	55	for	for	IN
10_1101-2021_01_07_425723	342	56	PI	PI	NNP
10_1101-2021_01_07_425723	342	57	.	.	.
10_1101-2021_01_07_425723	343	1	Cell	cell	NN
10_1101-2021_01_07_425723	343	2	gating	gate	VBG
10_1101-2021_01_07_425723	343	3	and	and	CC
10_1101-2021_01_07_425723	343	4	median	median	JJ
10_1101-2021_01_07_425723	343	5	525	525	CD
10_1101-2021_01_07_425723	343	6	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	343	7	of	of	IN
10_1101-2021_01_07_425723	343	8	cells	cell	NNS
10_1101-2021_01_07_425723	343	9	were	be	VBD
10_1101-2021_01_07_425723	343	10	determined	determine	VBN
10_1101-2021_01_07_425723	343	11	using	use	VBG
10_1101-2021_01_07_425723	343	12	FlowJo	FlowJo	NNP
10_1101-2021_01_07_425723	343	13	(	(	-LRB-
10_1101-2021_01_07_425723	343	14	v10	v10	NN
10_1101-2021_01_07_425723	343	15	,	,	,
10_1101-2021_01_07_425723	343	16	BD	BD	NNP
10_1101-2021_01_07_425723	343	17	Bioscience	Bioscience	NNP
10_1101-2021_01_07_425723	343	18	)	)	-RRB-
10_1101-2021_01_07_425723	343	19	.	.	.
10_1101-2021_01_07_425723	344	1	Cells	cell	NNS
10_1101-2021_01_07_425723	344	2	were	be	VBD
10_1101-2021_01_07_425723	344	3	gated	gate	VBN
10_1101-2021_01_07_425723	344	4	based	base	VBN
10_1101-2021_01_07_425723	344	5	on	on	IN
10_1101-2021_01_07_425723	344	6	526	526	CD
10_1101-2021_01_07_425723	344	7	forward	forward	JJ
10_1101-2021_01_07_425723	344	8	side	side	NN
10_1101-2021_01_07_425723	344	9	scatter	scatter	NN
10_1101-2021_01_07_425723	344	10	(	(	-LRB-
10_1101-2021_01_07_425723	344	11	FSC	FSC	NNP
10_1101-2021_01_07_425723	344	12	)	)	-RRB-
10_1101-2021_01_07_425723	344	13	and	and	CC
10_1101-2021_01_07_425723	344	14	side	side	NN
10_1101-2021_01_07_425723	344	15	-	-	HYPH
10_1101-2021_01_07_425723	344	16	scatter	scatter	NN
10_1101-2021_01_07_425723	344	17	(	(	-LRB-
10_1101-2021_01_07_425723	344	18	SSC	SSC	NNP
10_1101-2021_01_07_425723	344	19	)	)	-RRB-
10_1101-2021_01_07_425723	344	20	to	to	TO
10_1101-2021_01_07_425723	344	21	exclude	exclude	VB
10_1101-2021_01_07_425723	344	22	potential	potential	JJ
10_1101-2021_01_07_425723	344	23	artifacts	artifact	NNS
10_1101-2021_01_07_425723	344	24	or	or	CC
10_1101-2021_01_07_425723	344	25	clumping	clump	VBG
10_1101-2021_01_07_425723	344	26	cells	cell	NNS
10_1101-2021_01_07_425723	344	27	.	.	.
10_1101-2021_01_07_425723	345	1	Within	within	IN
10_1101-2021_01_07_425723	345	2	527	527	CD
10_1101-2021_01_07_425723	345	3	this	this	DT
10_1101-2021_01_07_425723	345	4	gated	gate	VBN
10_1101-2021_01_07_425723	345	5	population	population	NN
10_1101-2021_01_07_425723	345	6	PI	pi	IN
10_1101-2021_01_07_425723	345	7	positive	positive	JJ
10_1101-2021_01_07_425723	345	8	and	and	CC
10_1101-2021_01_07_425723	345	9	negatively	negatively	RB
10_1101-2021_01_07_425723	345	10	stained	stain	VBN
10_1101-2021_01_07_425723	345	11	cells	cell	NNS
10_1101-2021_01_07_425723	345	12	were	be	VBD
10_1101-2021_01_07_425723	345	13	differentiated	differentiate	VBN
10_1101-2021_01_07_425723	345	14	based	base	VBN
10_1101-2021_01_07_425723	345	15	on	on	IN
10_1101-2021_01_07_425723	345	16	the	the	DT
10_1101-2021_01_07_425723	345	17	cell	cell	NN
10_1101-2021_01_07_425723	345	18	528	528	CD
10_1101-2021_01_07_425723	345	19	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	345	20	across	across	IN
10_1101-2021_01_07_425723	345	21	a	a	DT
10_1101-2021_01_07_425723	345	22	FL3	FL3	NNP
10_1101-2021_01_07_425723	345	23	FL1	FL1	NNP
10_1101-2021_01_07_425723	345	24	dimension	dimension	NN
10_1101-2021_01_07_425723	345	25	.	.	.
10_1101-2021_01_07_425723	346	1	Flow	flow	VB
10_1101-2021_01_07_425723	346	2	cytometric	cytometric	NN
10_1101-2021_01_07_425723	346	3	gates	gate	NNS
10_1101-2021_01_07_425723	346	4	were	be	VBD
10_1101-2021_01_07_425723	346	5	drafted	draft	VBN
10_1101-2021_01_07_425723	346	6	for	for	IN
10_1101-2021_01_07_425723	346	7	each	each	DT
10_1101-2021_01_07_425723	346	8	yeast	yeast	NN
10_1101-2021_01_07_425723	346	9	species	specie	NNS
10_1101-2021_01_07_425723	346	10	and	and	CC
10_1101-2021_01_07_425723	346	11	529	529	CD
10_1101-2021_01_07_425723	346	12	used	use	VBD
10_1101-2021_01_07_425723	346	13	for	for	IN
10_1101-2021_01_07_425723	346	14	all	all	DT
10_1101-2021_01_07_425723	346	15	samples	sample	NNS
10_1101-2021_01_07_425723	346	16	.	.	.
10_1101-2021_01_07_425723	347	1	The	the	DT
10_1101-2021_01_07_425723	347	2	gating	gate	VBG
10_1101-2021_01_07_425723	347	3	strategy	strategy	NN
10_1101-2021_01_07_425723	347	4	is	be	VBZ
10_1101-2021_01_07_425723	347	5	given	give	VBN
10_1101-2021_01_07_425723	347	6	in	in	IN
10_1101-2021_01_07_425723	347	7	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	347	8	Fig	Fig	NNP
10_1101-2021_01_07_425723	347	9	.	.	.
10_1101-2021_01_07_425723	348	1	8	8	LS
10_1101-2021_01_07_425723	348	2	.	.	.
10_1101-2021_01_07_425723	349	1	Fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	349	2	of	of	IN
10_1101-2021_01_07_425723	349	3	a	a	DT
10_1101-2021_01_07_425723	349	4	strain	strain	NN
10_1101-2021_01_07_425723	349	5	was	be	VBD
10_1101-2021_01_07_425723	349	6	530	530	CD
10_1101-2021_01_07_425723	349	7	determined	determine	VBN
10_1101-2021_01_07_425723	349	8	by	by	IN
10_1101-2021_01_07_425723	349	9	a	a	DT
10_1101-2021_01_07_425723	349	10	sample	sample	NN
10_1101-2021_01_07_425723	349	11	of	of	IN
10_1101-2021_01_07_425723	349	12	cells	cell	NNS
10_1101-2021_01_07_425723	349	13	from	from	IN
10_1101-2021_01_07_425723	349	14	independent	independent	JJ
10_1101-2021_01_07_425723	349	15	shake	shake	NN
10_1101-2021_01_07_425723	349	16	-	-	HYPH
10_1101-2021_01_07_425723	349	17	flask	flask	NN
10_1101-2021_01_07_425723	349	18	cultures	culture	NNS
10_1101-2021_01_07_425723	349	19	and	and	CC
10_1101-2021_01_07_425723	349	20	compared	compare	VBN
10_1101-2021_01_07_425723	349	21	to	to	IN
10_1101-2021_01_07_425723	349	22	cells	cell	NNS
10_1101-2021_01_07_425723	349	23	from	from	IN
10_1101-2021_01_07_425723	349	24	531	531	CD
10_1101-2021_01_07_425723	349	25	identical	identical	JJ
10_1101-2021_01_07_425723	349	26	unstained	unstained	JJ
10_1101-2021_01_07_425723	349	27	cultures	culture	NNS
10_1101-2021_01_07_425723	349	28	of	of	IN
10_1101-2021_01_07_425723	349	29	cells	cell	NNS
10_1101-2021_01_07_425723	349	30	with	with	IN
10_1101-2021_01_07_425723	349	31	the	the	DT
10_1101-2021_01_07_425723	349	32	exact	exact	JJ
10_1101-2021_01_07_425723	349	33	same	same	JJ
10_1101-2021_01_07_425723	349	34	chronological	chronological	JJ
10_1101-2021_01_07_425723	349	35	age	age	NN
10_1101-2021_01_07_425723	349	36	.	.	.
10_1101-2021_01_07_425723	350	1	The	the	DT
10_1101-2021_01_07_425723	350	2	staining	staining	JJ
10_1101-2021_01_07_425723	350	3	experiment	experiment	NN
10_1101-2021_01_07_425723	350	4	of	of	IN
10_1101-2021_01_07_425723	350	5	532	532	CD
10_1101-2021_01_07_425723	350	6	the	the	DT
10_1101-2021_01_07_425723	350	7	strains	strain	NNS
10_1101-2021_01_07_425723	350	8	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	350	9	,	,	,
10_1101-2021_01_07_425723	350	10	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	350	11	and	and	CC
10_1101-2021_01_07_425723	350	12	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	350	13	samples	sample	NNS
10_1101-2021_01_07_425723	350	14	was	be	VBD
10_1101-2021_01_07_425723	350	15	repeated	repeat	VBN
10_1101-2021_01_07_425723	350	16	twice	twice	RB
10_1101-2021_01_07_425723	350	17	for	for	IN
10_1101-2021_01_07_425723	350	18	reproducibility	reproducibility	NN
10_1101-2021_01_07_425723	350	19	,	,	,
10_1101-2021_01_07_425723	350	20	the	the	DT
10_1101-2021_01_07_425723	350	21	mean	mean	NNP
10_1101-2021_01_07_425723	350	22	533	533	CD
10_1101-2021_01_07_425723	350	23	and	and	CC
10_1101-2021_01_07_425723	350	24	pooled	pool	VBN
10_1101-2021_01_07_425723	350	25	variance	variance	NN
10_1101-2021_01_07_425723	350	26	was	be	VBD
10_1101-2021_01_07_425723	350	27	subsequently	subsequently	RB
10_1101-2021_01_07_425723	350	28	calculated	calculate	VBN
10_1101-2021_01_07_425723	350	29	from	from	IN
10_1101-2021_01_07_425723	350	30	the	the	DT
10_1101-2021_01_07_425723	350	31	biological	biological	JJ
10_1101-2021_01_07_425723	350	32	duplicates	duplicate	NNS
10_1101-2021_01_07_425723	350	33	of	of	IN
10_1101-2021_01_07_425723	350	34	the	the	DT
10_1101-2021_01_07_425723	350	35	two	two	CD
10_1101-2021_01_07_425723	350	36	experiments	experiment	NNS
10_1101-2021_01_07_425723	350	37	.	.	.
10_1101-2021_01_07_425723	351	1	534	534	CD
10_1101-2021_01_07_425723	351	2	The	the	DT
10_1101-2021_01_07_425723	351	3	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	351	4	intensity	intensity	NN
10_1101-2021_01_07_425723	351	5	and	and	CC
10_1101-2021_01_07_425723	351	6	cell	cell	NN
10_1101-2021_01_07_425723	351	7	counts	count	NNS
10_1101-2021_01_07_425723	351	8	obtained	obtain	VBN
10_1101-2021_01_07_425723	351	9	from	from	IN
10_1101-2021_01_07_425723	351	10	the	the	DT
10_1101-2021_01_07_425723	351	11	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	351	12	experiments	experiment	NNS
10_1101-2021_01_07_425723	351	13	are	be	VBP
10_1101-2021_01_07_425723	351	14	available	available	JJ
10_1101-2021_01_07_425723	351	15	for	for	IN
10_1101-2021_01_07_425723	351	16	re	re	NN
10_1101-2021_01_07_425723	351	17	-	-	NN
10_1101-2021_01_07_425723	351	18	analysis	analysis	NN
10_1101-2021_01_07_425723	351	19	in	in	IN
10_1101-2021_01_07_425723	351	20	535	535	CD
10_1101-2021_01_07_425723	351	21	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	351	22	Data	Data	NNP
10_1101-2021_01_07_425723	351	23	set	set	NN
10_1101-2021_01_07_425723	351	24	1	1	CD
10_1101-2021_01_07_425723	351	25	,	,	,
10_1101-2021_01_07_425723	351	26	and	and	CC
10_1101-2021_01_07_425723	351	27	raw	raw	JJ
10_1101-2021_01_07_425723	351	28	flow	flow	NN
10_1101-2021_01_07_425723	351	29	cytometry	cytometry	NN
10_1101-2021_01_07_425723	351	30	plots	plot	NNS
10_1101-2021_01_07_425723	351	31	are	be	VBP
10_1101-2021_01_07_425723	351	32	depicted	depict	VBN
10_1101-2021_01_07_425723	351	33	in	in	IN
10_1101-2021_01_07_425723	351	34	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	351	35	Data	Data	NNP
10_1101-2021_01_07_425723	351	36	set	set	NN
10_1101-2021_01_07_425723	351	37	2	2	CD
10_1101-2021_01_07_425723	351	38	.	.	.
10_1101-2021_01_07_425723	352	1	536	536	CD
10_1101-2021_01_07_425723	352	2	Long	long	RB
10_1101-2021_01_07_425723	352	3	read	read	VBD
10_1101-2021_01_07_425723	352	4	sequencing	sequencing	NN
10_1101-2021_01_07_425723	352	5	,	,	,
10_1101-2021_01_07_425723	352	6	assembly	assembly	NN
10_1101-2021_01_07_425723	352	7	,	,	,
10_1101-2021_01_07_425723	352	8	and	and	CC
10_1101-2021_01_07_425723	352	9	annotation	annotation	NN
10_1101-2021_01_07_425723	352	10	537	537	CD
10_1101-2021_01_07_425723	352	11	Cells	cell	NNS
10_1101-2021_01_07_425723	352	12	were	be	VBD
10_1101-2021_01_07_425723	352	13	grown	grow	VBN
10_1101-2021_01_07_425723	352	14	overnight	overnight	RB
10_1101-2021_01_07_425723	352	15	in	in	IN
10_1101-2021_01_07_425723	352	16	500-mL	500-ml	CD
10_1101-2021_01_07_425723	352	17	shake	shake	NN
10_1101-2021_01_07_425723	352	18	flasks	flask	NNS
10_1101-2021_01_07_425723	352	19	containing	contain	VBG
10_1101-2021_01_07_425723	352	20	100	100	CD
10_1101-2021_01_07_425723	352	21	mL	mL	NNP
10_1101-2021_01_07_425723	352	22	liquid	liquid	JJ
10_1101-2021_01_07_425723	352	23	YPD	YPD	NNP
10_1101-2021_01_07_425723	352	24	medium	medium	NN
10_1101-2021_01_07_425723	352	25	at	at	IN
10_1101-2021_01_07_425723	352	26	30	30	CD
10_1101-2021_01_07_425723	352	27	°	°	,
10_1101-2021_01_07_425723	352	28	C	C	NNP
10_1101-2021_01_07_425723	352	29	in	in	IN
10_1101-2021_01_07_425723	352	30	an	an	DT
10_1101-2021_01_07_425723	352	31	538	538	CD
10_1101-2021_01_07_425723	352	32	orbital	orbital	JJ
10_1101-2021_01_07_425723	352	33	shaker	shaker	NN
10_1101-2021_01_07_425723	352	34	at	at	IN
10_1101-2021_01_07_425723	352	35	200	200	CD
10_1101-2021_01_07_425723	352	36	rpm	rpm	NN
10_1101-2021_01_07_425723	352	37	.	.	.
10_1101-2021_01_07_425723	353	1	After	after	IN
10_1101-2021_01_07_425723	353	2	reaching	reach	VBG
10_1101-2021_01_07_425723	353	3	stationary	stationary	JJ
10_1101-2021_01_07_425723	353	4	phase	phase	NN
10_1101-2021_01_07_425723	353	5	the	the	DT
10_1101-2021_01_07_425723	353	6	cells	cell	NNS
10_1101-2021_01_07_425723	353	7	were	be	VBD
10_1101-2021_01_07_425723	353	8	harvested	harvest	VBN
10_1101-2021_01_07_425723	353	9	for	for	IN
10_1101-2021_01_07_425723	353	10	a	a	DT
10_1101-2021_01_07_425723	353	11	total	total	JJ
10_1101-2021_01_07_425723	353	12	OD660	od660	NN
10_1101-2021_01_07_425723	353	13	of	of	IN
10_1101-2021_01_07_425723	353	14	539	539	CD
10_1101-2021_01_07_425723	353	15	600	600	CD
10_1101-2021_01_07_425723	353	16	by	by	IN
10_1101-2021_01_07_425723	353	17	centrifugation	centrifugation	NN
10_1101-2021_01_07_425723	353	18	for	for	IN
10_1101-2021_01_07_425723	353	19	5	5	CD
10_1101-2021_01_07_425723	353	20	min	min	NN
10_1101-2021_01_07_425723	353	21	at	at	IN
10_1101-2021_01_07_425723	353	22	4000	4000	CD
10_1101-2021_01_07_425723	353	23	g.	g.	NNP
10_1101-2021_01_07_425723	353	24	Genomic	Genomic	NNP
10_1101-2021_01_07_425723	353	25	DNA	DNA	NNP
10_1101-2021_01_07_425723	353	26	of	of	IN
10_1101-2021_01_07_425723	353	27	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	353	28	and	and	CC
10_1101-2021_01_07_425723	353	29	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	353	30	was	be	VBD
10_1101-2021_01_07_425723	353	31	isolated	isolate	VBN
10_1101-2021_01_07_425723	353	32	using	use	VBG
10_1101-2021_01_07_425723	353	33	540	540	CD
10_1101-2021_01_07_425723	353	34	.CC	.CC	NFP
10_1101-2021_01_07_425723	353	35	-	-	:
10_1101-2021_01_07_425723	353	36	BY	by	IN
10_1101-2021_01_07_425723	353	37	-	-	HYPH
10_1101-2021_01_07_425723	353	38	NC	NC	NNP
10_1101-2021_01_07_425723	353	39	-	-	HYPH
10_1101-2021_01_07_425723	353	40	ND	ND	NNP
10_1101-2021_01_07_425723	353	41	4.0	4.0	CD
10_1101-2021_01_07_425723	353	42	International	International	NNP
10_1101-2021_01_07_425723	353	43	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	353	44	under	under	IN
10_1101-2021_01_07_425723	353	45	a	a	DT
10_1101-2021_01_07_425723	353	46	(	(	-LRB-
10_1101-2021_01_07_425723	353	47	which	which	WDT
10_1101-2021_01_07_425723	353	48	was	be	VBD
10_1101-2021_01_07_425723	353	49	not	not	RB
10_1101-2021_01_07_425723	353	50	certified	certify	VBN
10_1101-2021_01_07_425723	353	51	by	by	IN
10_1101-2021_01_07_425723	353	52	peer	peer	NN
10_1101-2021_01_07_425723	353	53	review	review	NN
10_1101-2021_01_07_425723	353	54	)	)	-RRB-
10_1101-2021_01_07_425723	353	55	is	be	VBZ
10_1101-2021_01_07_425723	353	56	the	the	DT
10_1101-2021_01_07_425723	353	57	author	author	NN
10_1101-2021_01_07_425723	353	58	/	/	SYM
10_1101-2021_01_07_425723	353	59	funder	funder	NN
10_1101-2021_01_07_425723	353	60	,	,	,
10_1101-2021_01_07_425723	353	61	who	who	WP
10_1101-2021_01_07_425723	353	62	has	have	VBZ
10_1101-2021_01_07_425723	353	63	granted	grant	VBN
10_1101-2021_01_07_425723	353	64	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	353	65	a	a	DT
10_1101-2021_01_07_425723	353	66	license	license	NN
10_1101-2021_01_07_425723	353	67	to	to	TO
10_1101-2021_01_07_425723	353	68	display	display	VB
10_1101-2021_01_07_425723	353	69	the	the	DT
10_1101-2021_01_07_425723	353	70	preprint	preprint	NN
10_1101-2021_01_07_425723	353	71	in	in	IN
10_1101-2021_01_07_425723	353	72	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	353	73	.	.	.
10_1101-2021_01_07_425723	354	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	354	2	is	be	VBZ
10_1101-2021_01_07_425723	354	3	made	make	VBN
10_1101-2021_01_07_425723	354	4	The	the	DT
10_1101-2021_01_07_425723	354	5	copyright	copyright	NN
10_1101-2021_01_07_425723	354	6	holder	holder	NN
10_1101-2021_01_07_425723	354	7	for	for	IN
10_1101-2021_01_07_425723	354	8	this	this	DT
10_1101-2021_01_07_425723	354	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	354	10	version	version	NN
10_1101-2021_01_07_425723	354	11	posted	post	VBD
10_1101-2021_01_07_425723	354	12	January	January	NNP
10_1101-2021_01_07_425723	354	13	8	8	CD
10_1101-2021_01_07_425723	354	14	,	,	,
10_1101-2021_01_07_425723	354	15	2021	2021	CD
10_1101-2021_01_07_425723	354	16	.	.	.
10_1101-2021_01_07_425723	354	17	;	;	:
10_1101-2021_01_07_425723	354	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	354	19	:	:	:
10_1101-2021_01_07_425723	354	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	354	21	preprint	preprint	NN
10_1101-2021_01_07_425723	354	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	354	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	354	24	32	32	CD
10_1101-2021_01_07_425723	354	25	the	the	DT
10_1101-2021_01_07_425723	354	26	Qiagen	Qiagen	NNP
10_1101-2021_01_07_425723	354	27	genomic	genomic	JJ
10_1101-2021_01_07_425723	354	28	DNA	DNA	NNP
10_1101-2021_01_07_425723	354	29	100	100	CD
10_1101-2021_01_07_425723	354	30	/	/	SYM
10_1101-2021_01_07_425723	354	31	G	g	NN
10_1101-2021_01_07_425723	354	32	kit	kit	NN
10_1101-2021_01_07_425723	354	33	(	(	-LRB-
10_1101-2021_01_07_425723	354	34	Qiagen	Qiagen	NNP
10_1101-2021_01_07_425723	354	35	,	,	,
10_1101-2021_01_07_425723	354	36	Hilden	Hilden	NNP
10_1101-2021_01_07_425723	354	37	,	,	,
10_1101-2021_01_07_425723	354	38	Germany	Germany	NNP
10_1101-2021_01_07_425723	354	39	)	)	-RRB-
10_1101-2021_01_07_425723	354	40	according	accord	VBG
10_1101-2021_01_07_425723	354	41	to	to	IN
10_1101-2021_01_07_425723	354	42	the	the	DT
10_1101-2021_01_07_425723	354	43	manufacturer	manufacturer	NN
10_1101-2021_01_07_425723	354	44	’s	’s	POS
10_1101-2021_01_07_425723	354	45	541	541	CD
10_1101-2021_01_07_425723	354	46	instructions	instruction	NNS
10_1101-2021_01_07_425723	354	47	.	.	.
10_1101-2021_01_07_425723	355	1	MinION	MinION	NNP
10_1101-2021_01_07_425723	355	2	genomic	genomic	JJ
10_1101-2021_01_07_425723	355	3	libraries	library	NNS
10_1101-2021_01_07_425723	355	4	were	be	VBD
10_1101-2021_01_07_425723	355	5	prepared	prepare	VBN
10_1101-2021_01_07_425723	355	6	using	use	VBG
10_1101-2021_01_07_425723	355	7	the	the	DT
10_1101-2021_01_07_425723	355	8	1D	1d	JJ
10_1101-2021_01_07_425723	355	9	Genomic	Genomic	NNP
10_1101-2021_01_07_425723	355	10	DNA	DNA	NNP
10_1101-2021_01_07_425723	355	11	by	by	IN
10_1101-2021_01_07_425723	355	12	ligation	ligation	NN
10_1101-2021_01_07_425723	355	13	(	(	-LRB-
10_1101-2021_01_07_425723	355	14	SQK-542	sqk-542	XX
10_1101-2021_01_07_425723	355	15	LSK108	LSK108	NNP
10_1101-2021_01_07_425723	355	16	)	)	-RRB-
10_1101-2021_01_07_425723	355	17	for	for	IN
10_1101-2021_01_07_425723	355	18	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	355	19	,	,	,
10_1101-2021_01_07_425723	355	20	and	and	CC
10_1101-2021_01_07_425723	355	21	the	the	DT
10_1101-2021_01_07_425723	355	22	1D	1D	NNP
10_1101-2021_01_07_425723	355	23	native	native	JJ
10_1101-2021_01_07_425723	355	24	barcoding	barcode	VBG
10_1101-2021_01_07_425723	355	25	Genomic	Genomic	NNP
10_1101-2021_01_07_425723	355	26	DNA	DNA	NNP
10_1101-2021_01_07_425723	355	27	(	(	-LRB-
10_1101-2021_01_07_425723	355	28	EXP	EXP	NNP
10_1101-2021_01_07_425723	355	29	-	-	HYPH
10_1101-2021_01_07_425723	355	30	NBD103	NBD103	NNP
10_1101-2021_01_07_425723	355	31	&	&	CC
10_1101-2021_01_07_425723	355	32	LSK108	LSK108	NNP
10_1101-2021_01_07_425723	355	33	)	)	-RRB-
10_1101-2021_01_07_425723	355	34	for	for	IN
10_1101-2021_01_07_425723	355	35	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	355	36	543	543	CD
10_1101-2021_01_07_425723	355	37	according	accord	VBG
10_1101-2021_01_07_425723	355	38	to	to	IN
10_1101-2021_01_07_425723	355	39	the	the	DT
10_1101-2021_01_07_425723	355	40	manufacturer	manufacturer	NN
10_1101-2021_01_07_425723	355	41	’s	’s	POS
10_1101-2021_01_07_425723	355	42	instructions	instruction	NNS
10_1101-2021_01_07_425723	355	43	with	with	IN
10_1101-2021_01_07_425723	355	44	the	the	DT
10_1101-2021_01_07_425723	355	45	exception	exception	NN
10_1101-2021_01_07_425723	355	46	of	of	IN
10_1101-2021_01_07_425723	355	47	using	use	VBG
10_1101-2021_01_07_425723	355	48	80	80	CD
10_1101-2021_01_07_425723	355	49	%	%	NN
10_1101-2021_01_07_425723	355	50	EtOH	etoh	NN
10_1101-2021_01_07_425723	355	51	during	during	IN
10_1101-2021_01_07_425723	355	52	the	the	DT
10_1101-2021_01_07_425723	355	53	‘	'	``
10_1101-2021_01_07_425723	355	54	End	End	NNP
10_1101-2021_01_07_425723	355	55	544	544	CD
10_1101-2021_01_07_425723	355	56	Repair	repair	NN
10_1101-2021_01_07_425723	355	57	/	/	SYM
10_1101-2021_01_07_425723	355	58	dA	dA	NNP
10_1101-2021_01_07_425723	355	59	-	-	HYPH
10_1101-2021_01_07_425723	355	60	tailing	tail	VBG
10_1101-2021_01_07_425723	355	61	module	module	NN
10_1101-2021_01_07_425723	355	62	’	'	''
10_1101-2021_01_07_425723	355	63	step	step	NN
10_1101-2021_01_07_425723	355	64	.	.	.
10_1101-2021_01_07_425723	356	1	Flow	flow	JJ
10_1101-2021_01_07_425723	356	2	cell	cell	NN
10_1101-2021_01_07_425723	356	3	quality	quality	NN
10_1101-2021_01_07_425723	356	4	was	be	VBD
10_1101-2021_01_07_425723	356	5	tested	test	VBN
10_1101-2021_01_07_425723	356	6	by	by	IN
10_1101-2021_01_07_425723	356	7	running	run	VBG
10_1101-2021_01_07_425723	356	8	the	the	DT
10_1101-2021_01_07_425723	356	9	MinKNOW	MinKNOW	NNP
10_1101-2021_01_07_425723	356	10	platform	platform	NN
10_1101-2021_01_07_425723	356	11	QC	QC	NNP
10_1101-2021_01_07_425723	356	12	545	545	CD
10_1101-2021_01_07_425723	356	13	(	(	-LRB-
10_1101-2021_01_07_425723	356	14	Oxford	Oxford	NNP
10_1101-2021_01_07_425723	356	15	Nanopore	Nanopore	NNP
10_1101-2021_01_07_425723	356	16	Technology	Technology	NNP
10_1101-2021_01_07_425723	356	17	,	,	,
10_1101-2021_01_07_425723	356	18	Oxford	Oxford	NNP
10_1101-2021_01_07_425723	356	19	,	,	,
10_1101-2021_01_07_425723	356	20	UK	UK	NNP
10_1101-2021_01_07_425723	356	21	)	)	-RRB-
10_1101-2021_01_07_425723	356	22	.	.	.
10_1101-2021_01_07_425723	357	1	Flow	flow	NN
10_1101-2021_01_07_425723	357	2	cells	cell	NNS
10_1101-2021_01_07_425723	357	3	were	be	VBD
10_1101-2021_01_07_425723	357	4	prepared	prepare	VBN
10_1101-2021_01_07_425723	357	5	by	by	IN
10_1101-2021_01_07_425723	357	6	removing	remove	VBG
10_1101-2021_01_07_425723	357	7	20	20	CD
10_1101-2021_01_07_425723	357	8	μL	μL	NNP
10_1101-2021_01_07_425723	357	9	buffer	buffer	NNP
10_1101-2021_01_07_425723	357	10	and	and	CC
10_1101-2021_01_07_425723	357	11	546	546	CD
10_1101-2021_01_07_425723	357	12	subsequently	subsequently	RB
10_1101-2021_01_07_425723	357	13	primed	prime	VBN
10_1101-2021_01_07_425723	357	14	with	with	IN
10_1101-2021_01_07_425723	357	15	priming	priming	NN
10_1101-2021_01_07_425723	357	16	buffer	buffer	NN
10_1101-2021_01_07_425723	357	17	.	.	.
10_1101-2021_01_07_425723	358	1	The	the	DT
10_1101-2021_01_07_425723	358	2	DNA	dna	NN
10_1101-2021_01_07_425723	358	3	library	library	NN
10_1101-2021_01_07_425723	358	4	was	be	VBD
10_1101-2021_01_07_425723	358	5	loaded	load	VBN
10_1101-2021_01_07_425723	358	6	dropwise	dropwise	NN
10_1101-2021_01_07_425723	358	7	into	into	IN
10_1101-2021_01_07_425723	358	8	the	the	DT
10_1101-2021_01_07_425723	358	9	flow	flow	NN
10_1101-2021_01_07_425723	358	10	cell	cell	NN
10_1101-2021_01_07_425723	358	11	for	for	IN
10_1101-2021_01_07_425723	358	12	547	547	CD
10_1101-2021_01_07_425723	358	13	sequencing	sequencing	NN
10_1101-2021_01_07_425723	358	14	.	.	.
10_1101-2021_01_07_425723	359	1	The	the	DT
10_1101-2021_01_07_425723	359	2	SQK	SQK	NNP
10_1101-2021_01_07_425723	359	3	-	-	HYPH
10_1101-2021_01_07_425723	359	4	LSK108	LSK108	NNP
10_1101-2021_01_07_425723	359	5	library	library	NN
10_1101-2021_01_07_425723	359	6	was	be	VBD
10_1101-2021_01_07_425723	359	7	sequenced	sequence	VBN
10_1101-2021_01_07_425723	359	8	on	on	IN
10_1101-2021_01_07_425723	359	9	a	a	DT
10_1101-2021_01_07_425723	359	10	R9	r9	JJ
10_1101-2021_01_07_425723	359	11	chemistry	chemistry	NN
10_1101-2021_01_07_425723	359	12	flow	flow	NN
10_1101-2021_01_07_425723	359	13	cell	cell	NN
10_1101-2021_01_07_425723	359	14	(	(	-LRB-
10_1101-2021_01_07_425723	359	15	FLO	FLO	NNP
10_1101-2021_01_07_425723	359	16	-	-	HYPH
10_1101-2021_01_07_425723	359	17	MIN106	MIN106	NNP
10_1101-2021_01_07_425723	359	18	)	)	-RRB-
10_1101-2021_01_07_425723	359	19	for	for	IN
10_1101-2021_01_07_425723	359	20	48	48	CD
10_1101-2021_01_07_425723	359	21	h.	h.	NN
10_1101-2021_01_07_425723	359	22	548	548	CD
10_1101-2021_01_07_425723	359	23	Base	Base	NNP
10_1101-2021_01_07_425723	359	24	-	-	HYPH
10_1101-2021_01_07_425723	359	25	calling	calling	NN
10_1101-2021_01_07_425723	359	26	was	be	VBD
10_1101-2021_01_07_425723	359	27	performed	perform	VBN
10_1101-2021_01_07_425723	359	28	using	use	VBG
10_1101-2021_01_07_425723	359	29	Albacore	Albacore	NNP
10_1101-2021_01_07_425723	359	30	(	(	-LRB-
10_1101-2021_01_07_425723	359	31	v2.3.1	v2.3.1	NNP
10_1101-2021_01_07_425723	359	32	,	,	,
10_1101-2021_01_07_425723	359	33	Oxford	Oxford	NNP
10_1101-2021_01_07_425723	359	34	Nanopore	Nanopore	NNP
10_1101-2021_01_07_425723	359	35	Technologies	Technologies	NNPS
10_1101-2021_01_07_425723	359	36	)	)	-RRB-
10_1101-2021_01_07_425723	359	37	for	for	IN
10_1101-2021_01_07_425723	359	38	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	359	39	,	,	,
10_1101-2021_01_07_425723	359	40	and	and	CC
10_1101-2021_01_07_425723	359	41	for	for	IN
10_1101-2021_01_07_425723	359	42	549	549	CD
10_1101-2021_01_07_425723	359	43	NBRC1777	NBRC1777	NNPS
10_1101-2021_01_07_425723	359	44	with	with	IN
10_1101-2021_01_07_425723	359	45	Guppy	Guppy	NNP
10_1101-2021_01_07_425723	359	46	(	(	-LRB-
10_1101-2021_01_07_425723	359	47	v2.1.3	v2.1.3	NNP
10_1101-2021_01_07_425723	359	48	,	,	,
10_1101-2021_01_07_425723	359	49	Oxford	Oxford	NNP
10_1101-2021_01_07_425723	359	50	Nanopore	Nanopore	NNP
10_1101-2021_01_07_425723	359	51	Technologies	Technologies	NNPS
10_1101-2021_01_07_425723	359	52	)	)	-RRB-
10_1101-2021_01_07_425723	359	53	using	use	VBG
10_1101-2021_01_07_425723	359	54	dna_r9.4.1_450bps_flipflop.cfg	dna_r9.4.1_450bps_flipflop.cfg	NNP
10_1101-2021_01_07_425723	359	55	.	.	.
10_1101-2021_01_07_425723	360	1	550	550	CD
10_1101-2021_01_07_425723	360	2	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	360	3	reads	read	NNS
10_1101-2021_01_07_425723	360	4	were	be	VBD
10_1101-2021_01_07_425723	360	5	assembled	assemble	VBN
10_1101-2021_01_07_425723	360	6	using	use	VBG
10_1101-2021_01_07_425723	360	7	Canu	Canu	NNP
10_1101-2021_01_07_425723	360	8	(	(	-LRB-
10_1101-2021_01_07_425723	360	9	v1.8)69	v1.8)69	:
10_1101-2021_01_07_425723	360	10	,	,	,
10_1101-2021_01_07_425723	360	11	and	and	CC
10_1101-2021_01_07_425723	360	12	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	360	13	reads	read	NNS
10_1101-2021_01_07_425723	360	14	were	be	VBD
10_1101-2021_01_07_425723	360	15	assembled	assemble	VBN
10_1101-2021_01_07_425723	360	16	using	use	VBG
10_1101-2021_01_07_425723	360	17	Flye	Flye	NNP
10_1101-2021_01_07_425723	360	18	551	551	CD
10_1101-2021_01_07_425723	360	19	(	(	-LRB-
10_1101-2021_01_07_425723	360	20	v2.7.1-b1673)70	v2.7.1-b1673)70	FW
10_1101-2021_01_07_425723	360	21	.	.	.
10_1101-2021_01_07_425723	361	1	Assemblies	assembly	NNS
10_1101-2021_01_07_425723	361	2	were	be	VBD
10_1101-2021_01_07_425723	361	3	polished	polish	VBN
10_1101-2021_01_07_425723	361	4	with	with	IN
10_1101-2021_01_07_425723	361	5	Pilon	Pilon	NNP
10_1101-2021_01_07_425723	361	6	(	(	-LRB-
10_1101-2021_01_07_425723	361	7	v1.18)71	v1.18)71	NNP
10_1101-2021_01_07_425723	361	8	using	use	VBG
10_1101-2021_01_07_425723	361	9	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	361	10	data	datum	NNS
10_1101-2021_01_07_425723	361	11	available	available	JJ
10_1101-2021_01_07_425723	361	12	at	at	IN
10_1101-2021_01_07_425723	361	13	the	the	DT
10_1101-2021_01_07_425723	361	14	552	552	CD
10_1101-2021_01_07_425723	361	15	Sequence	Sequence	NNP
10_1101-2021_01_07_425723	361	16	Read	Read	VBD
10_1101-2021_01_07_425723	361	17	Archive	Archive	NNP
10_1101-2021_01_07_425723	361	18	under	under	IN
10_1101-2021_01_07_425723	361	19	accessions	accession	NNS
10_1101-2021_01_07_425723	361	20	SRX3637961	SRX3637961	NNP
10_1101-2021_01_07_425723	361	21	and	and	CC
10_1101-2021_01_07_425723	361	22	SRX3541357	SRX3541357	NNP
10_1101-2021_01_07_425723	361	23	.	.	.
10_1101-2021_01_07_425723	362	1	Both	both	DT
10_1101-2021_01_07_425723	362	2	de	de	IN
10_1101-2021_01_07_425723	362	3	novo	novo	NNP
10_1101-2021_01_07_425723	362	4	genome	genome	NNP
10_1101-2021_01_07_425723	362	5	553	553	CD
10_1101-2021_01_07_425723	362	6	assemblies	assembly	NNS
10_1101-2021_01_07_425723	362	7	were	be	VBD
10_1101-2021_01_07_425723	362	8	annotated	annotate	VBN
10_1101-2021_01_07_425723	362	9	using	use	VBG
10_1101-2021_01_07_425723	362	10	Funannotate	Funannotate	NNP
10_1101-2021_01_07_425723	362	11	(	(	-LRB-
10_1101-2021_01_07_425723	362	12	v1.7.1)72	v1.7.1)72	NNP
10_1101-2021_01_07_425723	362	13	,	,	,
10_1101-2021_01_07_425723	362	14	trained	trained	JJ
10_1101-2021_01_07_425723	362	15	and	and	CC
10_1101-2021_01_07_425723	362	16	refined	refine	VBN
10_1101-2021_01_07_425723	362	17	using	use	VBG
10_1101-2021_01_07_425723	362	18	de	de	NNP
10_1101-2021_01_07_425723	362	19	novo	novo	NNP
10_1101-2021_01_07_425723	362	20	554	554	CD
10_1101-2021_01_07_425723	362	21	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	362	22	assemblies	assembly	NNS
10_1101-2021_01_07_425723	362	23	(	(	-LRB-
10_1101-2021_01_07_425723	362	24	see	see	VB
10_1101-2021_01_07_425723	362	25	below	below	RB
10_1101-2021_01_07_425723	362	26	)	)	-RRB-
10_1101-2021_01_07_425723	362	27	,	,	,
10_1101-2021_01_07_425723	362	28	adding	add	VBG
10_1101-2021_01_07_425723	362	29	functional	functional	JJ
10_1101-2021_01_07_425723	362	30	annotation	annotation	NN
10_1101-2021_01_07_425723	362	31	with	with	IN
10_1101-2021_01_07_425723	362	32	Interproscan	Interproscan	NNP
10_1101-2021_01_07_425723	362	33	(	(	-LRB-
10_1101-2021_01_07_425723	362	34	v5.25	v5.25	NN
10_1101-2021_01_07_425723	362	35	-	-	HYPH
10_1101-2021_01_07_425723	362	36	64.0)73	64.0)73	NN
10_1101-2021_01_07_425723	362	37	.	.	.
10_1101-2021_01_07_425723	363	1	555	555	CD
10_1101-2021_01_07_425723	363	2	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	363	3	sequencing	sequence	VBG
10_1101-2021_01_07_425723	363	4	556	556	CD
10_1101-2021_01_07_425723	363	5	Plasmids	Plasmids	NNPS
10_1101-2021_01_07_425723	363	6	were	be	VBD
10_1101-2021_01_07_425723	363	7	sequenced	sequence	VBN
10_1101-2021_01_07_425723	363	8	on	on	IN
10_1101-2021_01_07_425723	363	9	a	a	DT
10_1101-2021_01_07_425723	363	10	MiniSeq	MiniSeq	NNP
10_1101-2021_01_07_425723	363	11	(	(	-LRB-
10_1101-2021_01_07_425723	363	12	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	363	13	,	,	,
10_1101-2021_01_07_425723	363	14	San	San	NNP
10_1101-2021_01_07_425723	363	15	Diego	Diego	NNP
10_1101-2021_01_07_425723	363	16	,	,	,
10_1101-2021_01_07_425723	363	17	CA	CA	NNP
10_1101-2021_01_07_425723	363	18	)	)	-RRB-
10_1101-2021_01_07_425723	363	19	platform	platform	NN
10_1101-2021_01_07_425723	363	20	.	.	.
10_1101-2021_01_07_425723	364	1	Library	library	JJ
10_1101-2021_01_07_425723	364	2	preparation	preparation	NN
10_1101-2021_01_07_425723	364	3	was	be	VBD
10_1101-2021_01_07_425723	364	4	557	557	CD
10_1101-2021_01_07_425723	364	5	performed	perform	VBN
10_1101-2021_01_07_425723	364	6	with	with	IN
10_1101-2021_01_07_425723	364	7	Nextera	Nextera	NNP
10_1101-2021_01_07_425723	364	8	XT	XT	NNP
10_1101-2021_01_07_425723	364	9	DNA	dna	NN
10_1101-2021_01_07_425723	364	10	library	library	NN
10_1101-2021_01_07_425723	364	11	preparation	preparation	NN
10_1101-2021_01_07_425723	364	12	according	accord	VBG
10_1101-2021_01_07_425723	364	13	to	to	IN
10_1101-2021_01_07_425723	364	14	the	the	DT
10_1101-2021_01_07_425723	364	15	manufacturer	manufacturer	NN
10_1101-2021_01_07_425723	364	16	’s	’s	POS
10_1101-2021_01_07_425723	364	17	instructions	instruction	NNS
10_1101-2021_01_07_425723	364	18	558	558	CD
10_1101-2021_01_07_425723	364	19	(	(	-LRB-
10_1101-2021_01_07_425723	364	20	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	364	21	)	)	-RRB-
10_1101-2021_01_07_425723	364	22	.	.	.
10_1101-2021_01_07_425723	365	1	The	the	DT
10_1101-2021_01_07_425723	365	2	library	library	NN
10_1101-2021_01_07_425723	365	3	preparation	preparation	NN
10_1101-2021_01_07_425723	365	4	included	include	VBD
10_1101-2021_01_07_425723	365	5	the	the	DT
10_1101-2021_01_07_425723	365	6	MiniSeq	MiniSeq	NNP
10_1101-2021_01_07_425723	365	7	Mid	Mid	NNP
10_1101-2021_01_07_425723	365	8	Output	Output	NNP
10_1101-2021_01_07_425723	365	9	kit	kit	NN
10_1101-2021_01_07_425723	365	10	(	(	-LRB-
10_1101-2021_01_07_425723	365	11	300	300	CD
10_1101-2021_01_07_425723	365	12	cycles	cycle	NNS
10_1101-2021_01_07_425723	365	13	)	)	-RRB-
10_1101-2021_01_07_425723	365	14	and	and	CC
10_1101-2021_01_07_425723	365	15	the	the	DT
10_1101-2021_01_07_425723	365	16	input	input	NN
10_1101-2021_01_07_425723	365	17	&	&	CC
10_1101-2021_01_07_425723	365	18	final	final	JJ
10_1101-2021_01_07_425723	365	19	559	559	CD
10_1101-2021_01_07_425723	365	20	DNA	DNA	NNP
10_1101-2021_01_07_425723	365	21	was	be	VBD
10_1101-2021_01_07_425723	365	22	quantified	quantify	VBN
10_1101-2021_01_07_425723	365	23	with	with	IN
10_1101-2021_01_07_425723	365	24	the	the	DT
10_1101-2021_01_07_425723	365	25	Qubit	qubit	JJ
10_1101-2021_01_07_425723	365	26	HS	hs	NN
10_1101-2021_01_07_425723	365	27	dsDNA	dsdna	FW
10_1101-2021_01_07_425723	365	28	kit	kit	NN
10_1101-2021_01_07_425723	365	29	(	(	-LRB-
10_1101-2021_01_07_425723	365	30	Life	Life	NNP
10_1101-2021_01_07_425723	365	31	Technologies	Technologies	NNPS
10_1101-2021_01_07_425723	365	32	,	,	,
10_1101-2021_01_07_425723	365	33	Thermo	Thermo	NNP
10_1101-2021_01_07_425723	365	34	Fisher	Fisher	NNP
10_1101-2021_01_07_425723	365	35	Scientific	Scientific	NNP
10_1101-2021_01_07_425723	365	36	)	)	-RRB-
10_1101-2021_01_07_425723	365	37	.	.	.
10_1101-2021_01_07_425723	366	1	560	560	CD
10_1101-2021_01_07_425723	366	2	Nucleotide	nucleotide	JJ
10_1101-2021_01_07_425723	366	3	sequences	sequence	NNS
10_1101-2021_01_07_425723	366	4	were	be	VBD
10_1101-2021_01_07_425723	366	5	assembled	assemble	VBN
10_1101-2021_01_07_425723	366	6	with	with	IN
10_1101-2021_01_07_425723	366	7	SPAdes74	SPAdes74	NNP
10_1101-2021_01_07_425723	366	8	and	and	CC
10_1101-2021_01_07_425723	366	9	compared	compare	VBN
10_1101-2021_01_07_425723	366	10	to	to	IN
10_1101-2021_01_07_425723	366	11	the	the	DT
10_1101-2021_01_07_425723	366	12	intended	intend	VBN
10_1101-2021_01_07_425723	366	13	in	in	IN
10_1101-2021_01_07_425723	366	14	silico	silico	NNP
10_1101-2021_01_07_425723	366	15	DNA	dna	NN
10_1101-2021_01_07_425723	366	16	561	561	CD
10_1101-2021_01_07_425723	366	17	construct	construct	NN
10_1101-2021_01_07_425723	366	18	.	.	.
10_1101-2021_01_07_425723	367	1	For	for	IN
10_1101-2021_01_07_425723	367	2	whole	whole	JJ
10_1101-2021_01_07_425723	367	3	-	-	HYPH
10_1101-2021_01_07_425723	367	4	genome	genome	NN
10_1101-2021_01_07_425723	367	5	sequencing	sequencing	NN
10_1101-2021_01_07_425723	367	6	,	,	,
10_1101-2021_01_07_425723	367	7	yeast	yeast	NN
10_1101-2021_01_07_425723	367	8	cells	cell	NNS
10_1101-2021_01_07_425723	367	9	were	be	VBD
10_1101-2021_01_07_425723	367	10	harvested	harvest	VBN
10_1101-2021_01_07_425723	367	11	from	from	IN
10_1101-2021_01_07_425723	367	12	overnight	overnight	JJ
10_1101-2021_01_07_425723	367	13	cultures	culture	NNS
10_1101-2021_01_07_425723	367	14	and	and	CC
10_1101-2021_01_07_425723	367	15	DNA	dna	NN
10_1101-2021_01_07_425723	367	16	562	562	CD
10_1101-2021_01_07_425723	367	17	was	be	VBD
10_1101-2021_01_07_425723	367	18	isolated	isolate	VBN
10_1101-2021_01_07_425723	367	19	with	with	IN
10_1101-2021_01_07_425723	367	20	the	the	DT
10_1101-2021_01_07_425723	367	21	Qiagen	Qiagen	NNP
10_1101-2021_01_07_425723	367	22	genomic	genomic	JJ
10_1101-2021_01_07_425723	367	23	DNA	DNA	NNP
10_1101-2021_01_07_425723	367	24	100	100	CD
10_1101-2021_01_07_425723	367	25	/	/	SYM
10_1101-2021_01_07_425723	367	26	G	g	NN
10_1101-2021_01_07_425723	367	27	kit	kit	NN
10_1101-2021_01_07_425723	367	28	(	(	-LRB-
10_1101-2021_01_07_425723	367	29	Qiagen	Qiagen	NNP
10_1101-2021_01_07_425723	367	30	)	)	-RRB-
10_1101-2021_01_07_425723	367	31	as	as	IN
10_1101-2021_01_07_425723	367	32	described	describe	VBN
10_1101-2021_01_07_425723	367	33	earlier	early	RBR
10_1101-2021_01_07_425723	367	34	.	.	.
10_1101-2021_01_07_425723	368	1	DNA	dna	NN
10_1101-2021_01_07_425723	368	2	quantity	quantity	NN
10_1101-2021_01_07_425723	368	3	was	be	VBD
10_1101-2021_01_07_425723	368	4	563	563	CD
10_1101-2021_01_07_425723	368	5	.CC	.CC	:
10_1101-2021_01_07_425723	368	6	-	-	:
10_1101-2021_01_07_425723	368	7	BY	by	IN
10_1101-2021_01_07_425723	368	8	-	-	HYPH
10_1101-2021_01_07_425723	368	9	NC	NC	NNP
10_1101-2021_01_07_425723	368	10	-	-	HYPH
10_1101-2021_01_07_425723	368	11	ND	ND	NNP
10_1101-2021_01_07_425723	368	12	4.0	4.0	CD
10_1101-2021_01_07_425723	368	13	International	International	NNP
10_1101-2021_01_07_425723	368	14	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	368	15	under	under	IN
10_1101-2021_01_07_425723	368	16	a	a	DT
10_1101-2021_01_07_425723	368	17	(	(	-LRB-
10_1101-2021_01_07_425723	368	18	which	which	WDT
10_1101-2021_01_07_425723	368	19	was	be	VBD
10_1101-2021_01_07_425723	368	20	not	not	RB
10_1101-2021_01_07_425723	368	21	certified	certify	VBN
10_1101-2021_01_07_425723	368	22	by	by	IN
10_1101-2021_01_07_425723	368	23	peer	peer	NN
10_1101-2021_01_07_425723	368	24	review	review	NN
10_1101-2021_01_07_425723	368	25	)	)	-RRB-
10_1101-2021_01_07_425723	368	26	is	be	VBZ
10_1101-2021_01_07_425723	368	27	the	the	DT
10_1101-2021_01_07_425723	368	28	author	author	NN
10_1101-2021_01_07_425723	368	29	/	/	SYM
10_1101-2021_01_07_425723	368	30	funder	funder	NN
10_1101-2021_01_07_425723	368	31	,	,	,
10_1101-2021_01_07_425723	368	32	who	who	WP
10_1101-2021_01_07_425723	368	33	has	have	VBZ
10_1101-2021_01_07_425723	368	34	granted	grant	VBN
10_1101-2021_01_07_425723	368	35	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	368	36	a	a	DT
10_1101-2021_01_07_425723	368	37	license	license	NN
10_1101-2021_01_07_425723	368	38	to	to	TO
10_1101-2021_01_07_425723	368	39	display	display	VB
10_1101-2021_01_07_425723	368	40	the	the	DT
10_1101-2021_01_07_425723	368	41	preprint	preprint	NN
10_1101-2021_01_07_425723	368	42	in	in	IN
10_1101-2021_01_07_425723	368	43	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	368	44	.	.	.
10_1101-2021_01_07_425723	369	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	369	2	is	be	VBZ
10_1101-2021_01_07_425723	369	3	made	make	VBN
10_1101-2021_01_07_425723	369	4	The	the	DT
10_1101-2021_01_07_425723	369	5	copyright	copyright	NN
10_1101-2021_01_07_425723	369	6	holder	holder	NN
10_1101-2021_01_07_425723	369	7	for	for	IN
10_1101-2021_01_07_425723	369	8	this	this	DT
10_1101-2021_01_07_425723	369	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	369	10	version	version	NN
10_1101-2021_01_07_425723	369	11	posted	post	VBD
10_1101-2021_01_07_425723	369	12	January	January	NNP
10_1101-2021_01_07_425723	369	13	8	8	CD
10_1101-2021_01_07_425723	369	14	,	,	,
10_1101-2021_01_07_425723	369	15	2021	2021	CD
10_1101-2021_01_07_425723	369	16	.	.	.
10_1101-2021_01_07_425723	369	17	;	;	:
10_1101-2021_01_07_425723	369	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	369	19	:	:	:
10_1101-2021_01_07_425723	369	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	369	21	preprint	preprint	NN
10_1101-2021_01_07_425723	369	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	369	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	369	24	33	33	CD
10_1101-2021_01_07_425723	369	25	measured	measure	VBN
10_1101-2021_01_07_425723	369	26	with	with	IN
10_1101-2021_01_07_425723	369	27	the	the	DT
10_1101-2021_01_07_425723	369	28	QuBit	QuBit	NNP
10_1101-2021_01_07_425723	369	29	BR	br	NN
10_1101-2021_01_07_425723	369	30	dsDNA	dsdna	JJ
10_1101-2021_01_07_425723	369	31	kit	kit	NN
10_1101-2021_01_07_425723	369	32	(	(	-LRB-
10_1101-2021_01_07_425723	369	33	Thermo	Thermo	NNP
10_1101-2021_01_07_425723	369	34	Fisher	Fisher	NNP
10_1101-2021_01_07_425723	369	35	Scientific	Scientific	NNP
10_1101-2021_01_07_425723	369	36	)	)	-RRB-
10_1101-2021_01_07_425723	369	37	.	.	.
10_1101-2021_01_07_425723	370	1	300	300	CD
10_1101-2021_01_07_425723	370	2	bp	bp	NNP
10_1101-2021_01_07_425723	370	3	paired	pair	VBN
10_1101-2021_01_07_425723	370	4	-	-	HYPH
10_1101-2021_01_07_425723	370	5	end	end	NN
10_1101-2021_01_07_425723	370	6	libraries	library	NNS
10_1101-2021_01_07_425723	370	7	were	be	VBD
10_1101-2021_01_07_425723	370	8	564	564	CD
10_1101-2021_01_07_425723	370	9	prepared	prepare	VBN
10_1101-2021_01_07_425723	370	10	with	with	IN
10_1101-2021_01_07_425723	370	11	the	the	DT
10_1101-2021_01_07_425723	370	12	TruSeq	TruSeq	NNP
10_1101-2021_01_07_425723	370	13	DNA	DNA	NNP
10_1101-2021_01_07_425723	370	14	PCR	PCR	NNP
10_1101-2021_01_07_425723	370	15	-	-	HYPH
10_1101-2021_01_07_425723	370	16	free	free	JJ
10_1101-2021_01_07_425723	370	17	library	library	NN
10_1101-2021_01_07_425723	370	18	prep	prep	NN
10_1101-2021_01_07_425723	370	19	kit	kit	NN
10_1101-2021_01_07_425723	370	20	(	(	-LRB-
10_1101-2021_01_07_425723	370	21	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	370	22	)	)	-RRB-
10_1101-2021_01_07_425723	370	23	according	accord	VBG
10_1101-2021_01_07_425723	370	24	to	to	IN
10_1101-2021_01_07_425723	370	25	the	the	DT
10_1101-2021_01_07_425723	370	26	manufacturer	manufacturer	NN
10_1101-2021_01_07_425723	370	27	’s	’s	POS
10_1101-2021_01_07_425723	370	28	565	565	CD
10_1101-2021_01_07_425723	370	29	instructions	instruction	NNS
10_1101-2021_01_07_425723	370	30	.	.	.
10_1101-2021_01_07_425723	371	1	Short	short	JJ
10_1101-2021_01_07_425723	371	2	read	read	VB
10_1101-2021_01_07_425723	371	3	whole	whole	RB
10_1101-2021_01_07_425723	371	4	-	-	HYPH
10_1101-2021_01_07_425723	371	5	genome	genome	RB
10_1101-2021_01_07_425723	371	6	sequencing	sequencing	NN
10_1101-2021_01_07_425723	371	7	was	be	VBD
10_1101-2021_01_07_425723	371	8	performed	perform	VBN
10_1101-2021_01_07_425723	371	9	on	on	IN
10_1101-2021_01_07_425723	371	10	a	a	DT
10_1101-2021_01_07_425723	371	11	MiSeq	MiSeq	NNP
10_1101-2021_01_07_425723	371	12	platform	platform	NN
10_1101-2021_01_07_425723	371	13	(	(	-LRB-
10_1101-2021_01_07_425723	371	14	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	371	15	)	)	-RRB-
10_1101-2021_01_07_425723	371	16	.	.	.
10_1101-2021_01_07_425723	372	1	566	566	CD
10_1101-2021_01_07_425723	372	2	RNA	rna	NN
10_1101-2021_01_07_425723	372	3	isolation	isolation	NN
10_1101-2021_01_07_425723	372	4	,	,	,
10_1101-2021_01_07_425723	372	5	sequencing	sequencing	NN
10_1101-2021_01_07_425723	372	6	and	and	CC
10_1101-2021_01_07_425723	372	7	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	372	8	analysis	analysis	NN
10_1101-2021_01_07_425723	372	9	567	567	CD
10_1101-2021_01_07_425723	372	10	Culture	Culture	NNP
10_1101-2021_01_07_425723	372	11	broth	broth	NN
10_1101-2021_01_07_425723	372	12	from	from	IN
10_1101-2021_01_07_425723	372	13	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	372	14	cultures	culture	NNS
10_1101-2021_01_07_425723	372	15	was	be	VBD
10_1101-2021_01_07_425723	372	16	directly	directly	RB
10_1101-2021_01_07_425723	372	17	sampled	sample	VBN
10_1101-2021_01_07_425723	372	18	into	into	IN
10_1101-2021_01_07_425723	372	19	liquid	liquid	JJ
10_1101-2021_01_07_425723	372	20	nitrogen	nitrogen	NN
10_1101-2021_01_07_425723	372	21	to	to	TO
10_1101-2021_01_07_425723	372	22	prevent	prevent	VB
10_1101-2021_01_07_425723	372	23	mRNA	mrna	RP
10_1101-2021_01_07_425723	372	24	568	568	CD
10_1101-2021_01_07_425723	372	25	turnover	turnover	NN
10_1101-2021_01_07_425723	372	26	.	.	.
10_1101-2021_01_07_425723	373	1	The	the	DT
10_1101-2021_01_07_425723	373	2	cell	cell	NN
10_1101-2021_01_07_425723	373	3	cultures	culture	NNS
10_1101-2021_01_07_425723	373	4	were	be	VBD
10_1101-2021_01_07_425723	373	5	stored	store	VBN
10_1101-2021_01_07_425723	373	6	at	at	IN
10_1101-2021_01_07_425723	373	7	-80	-80	NNP
10_1101-2021_01_07_425723	373	8	°	°	NNP
10_1101-2021_01_07_425723	373	9	C	C	NNP
10_1101-2021_01_07_425723	373	10	and	and	CC
10_1101-2021_01_07_425723	373	11	processed	process	VBD
10_1101-2021_01_07_425723	373	12	within	within	IN
10_1101-2021_01_07_425723	373	13	10	10	CD
10_1101-2021_01_07_425723	373	14	days	day	NNS
10_1101-2021_01_07_425723	373	15	after	after	IN
10_1101-2021_01_07_425723	373	16	sampling	sampling	NN
10_1101-2021_01_07_425723	373	17	.	.	.
10_1101-2021_01_07_425723	374	1	After	after	IN
10_1101-2021_01_07_425723	374	2	569	569	CD
10_1101-2021_01_07_425723	374	3	thawing	thaw	VBG
10_1101-2021_01_07_425723	374	4	on	on	IN
10_1101-2021_01_07_425723	374	5	ice	ice	NN
10_1101-2021_01_07_425723	374	6	,	,	,
10_1101-2021_01_07_425723	374	7	cells	cell	NNS
10_1101-2021_01_07_425723	374	8	were	be	VBD
10_1101-2021_01_07_425723	374	9	harvested	harvest	VBN
10_1101-2021_01_07_425723	374	10	by	by	IN
10_1101-2021_01_07_425723	374	11	centrifugation	centrifugation	NN
10_1101-2021_01_07_425723	374	12	.	.	.
10_1101-2021_01_07_425723	375	1	Total	Total	NNP
10_1101-2021_01_07_425723	375	2	RNA	RNA	NNP
10_1101-2021_01_07_425723	375	3	was	be	VBD
10_1101-2021_01_07_425723	375	4	extracted	extract	VBN
10_1101-2021_01_07_425723	375	5	by	by	IN
10_1101-2021_01_07_425723	375	6	a	a	DT
10_1101-2021_01_07_425723	375	7	5	5	CD
10_1101-2021_01_07_425723	375	8	min	min	NN
10_1101-2021_01_07_425723	375	9	heatshock	heatshock	NN
10_1101-2021_01_07_425723	375	10	at	at	IN
10_1101-2021_01_07_425723	375	11	570	570	CD
10_1101-2021_01_07_425723	375	12	65	65	CD
10_1101-2021_01_07_425723	375	13	°	°	,
10_1101-2021_01_07_425723	375	14	C	C	NNP
10_1101-2021_01_07_425723	375	15	with	with	IN
10_1101-2021_01_07_425723	375	16	a	a	DT
10_1101-2021_01_07_425723	375	17	mix	mix	NN
10_1101-2021_01_07_425723	375	18	of	of	IN
10_1101-2021_01_07_425723	375	19	isoamyl	isoamyl	NNP
10_1101-2021_01_07_425723	375	20	alcohol	alcohol	NNP
10_1101-2021_01_07_425723	375	21	,	,	,
10_1101-2021_01_07_425723	375	22	phenol	phenol	NN
10_1101-2021_01_07_425723	375	23	and	and	CC
10_1101-2021_01_07_425723	375	24	chloroform	chloroform	NN
10_1101-2021_01_07_425723	375	25	at	at	IN
10_1101-2021_01_07_425723	375	26	a	a	DT
10_1101-2021_01_07_425723	375	27	ratio	ratio	NN
10_1101-2021_01_07_425723	375	28	of	of	IN
10_1101-2021_01_07_425723	375	29	125:24:1	125:24:1	CD
10_1101-2021_01_07_425723	375	30	,	,	,
10_1101-2021_01_07_425723	375	31	respectively	respectively	RB
10_1101-2021_01_07_425723	375	32	571	571	CD
10_1101-2021_01_07_425723	375	33	(	(	-LRB-
10_1101-2021_01_07_425723	375	34	Invitrogen	Invitrogen	NNP
10_1101-2021_01_07_425723	375	35	)	)	-RRB-
10_1101-2021_01_07_425723	375	36	.	.	.
10_1101-2021_01_07_425723	376	1	RNA	RNA	NNP
10_1101-2021_01_07_425723	376	2	was	be	VBD
10_1101-2021_01_07_425723	376	3	extracted	extract	VBN
10_1101-2021_01_07_425723	376	4	from	from	IN
10_1101-2021_01_07_425723	376	5	the	the	DT
10_1101-2021_01_07_425723	376	6	organic	organic	JJ
10_1101-2021_01_07_425723	376	7	phase	phase	NN
10_1101-2021_01_07_425723	376	8	with	with	IN
10_1101-2021_01_07_425723	376	9	Tris	Tris	NNP
10_1101-2021_01_07_425723	376	10	-	-	HYPH
10_1101-2021_01_07_425723	376	11	HCl	HCl	NNP
10_1101-2021_01_07_425723	376	12	and	and	CC
10_1101-2021_01_07_425723	376	13	subsequently	subsequently	RB
10_1101-2021_01_07_425723	376	14	precipitated	precipitate	VBN
10_1101-2021_01_07_425723	376	15	by	by	IN
10_1101-2021_01_07_425723	376	16	572	572	CD
10_1101-2021_01_07_425723	376	17	the	the	DT
10_1101-2021_01_07_425723	376	18	addition	addition	NN
10_1101-2021_01_07_425723	376	19	of	of	IN
10_1101-2021_01_07_425723	376	20	3	3	CD
10_1101-2021_01_07_425723	376	21	M	M	NNP
10_1101-2021_01_07_425723	376	22	Nac	Nac	NNP
10_1101-2021_01_07_425723	376	23	-	-	HYPH
10_1101-2021_01_07_425723	376	24	acetate	acetate	NNP
10_1101-2021_01_07_425723	376	25	and	and	CC
10_1101-2021_01_07_425723	376	26	40	40	CD
10_1101-2021_01_07_425723	376	27	%	%	NN
10_1101-2021_01_07_425723	376	28	(	(	-LRB-
10_1101-2021_01_07_425723	376	29	v	v	NN
10_1101-2021_01_07_425723	376	30	/	/	SYM
10_1101-2021_01_07_425723	376	31	v	v	NN
10_1101-2021_01_07_425723	376	32	)	)	-RRB-
10_1101-2021_01_07_425723	376	33	ethanol	ethanol	NN
10_1101-2021_01_07_425723	376	34	at	at	IN
10_1101-2021_01_07_425723	376	35	-20	-20	NNP
10_1101-2021_01_07_425723	376	36	°	°	NNP
10_1101-2021_01_07_425723	376	37	C	C	NNP
10_1101-2021_01_07_425723	376	38	.	.	.
10_1101-2021_01_07_425723	377	1	Precipitated	Precipitated	NNP
10_1101-2021_01_07_425723	377	2	RNA	RNA	NNP
10_1101-2021_01_07_425723	377	3	was	be	VBD
10_1101-2021_01_07_425723	377	4	washed	wash	VBN
10_1101-2021_01_07_425723	377	5	with	with	IN
10_1101-2021_01_07_425723	377	6	573	573	CD
10_1101-2021_01_07_425723	377	7	ethanol	ethanol	NNS
10_1101-2021_01_07_425723	377	8	,	,	,
10_1101-2021_01_07_425723	377	9	collected	collect	VBN
10_1101-2021_01_07_425723	377	10	and	and	CC
10_1101-2021_01_07_425723	377	11	after	after	IN
10_1101-2021_01_07_425723	377	12	drying	drying	NN
10_1101-2021_01_07_425723	377	13	resuspended	resuspend	VBD
10_1101-2021_01_07_425723	377	14	in	in	IN
10_1101-2021_01_07_425723	377	15	RNAse	RNAse	NNP
10_1101-2021_01_07_425723	377	16	free	free	JJ
10_1101-2021_01_07_425723	377	17	water	water	NN
10_1101-2021_01_07_425723	377	18	.	.	.
10_1101-2021_01_07_425723	378	1	The	the	DT
10_1101-2021_01_07_425723	378	2	quantity	quantity	NN
10_1101-2021_01_07_425723	378	3	of	of	IN
10_1101-2021_01_07_425723	378	4	total	total	NN
10_1101-2021_01_07_425723	378	5	RNA	RNA	NNP
10_1101-2021_01_07_425723	378	6	was	be	VBD
10_1101-2021_01_07_425723	378	7	574	574	CD
10_1101-2021_01_07_425723	378	8	determined	determine	VBN
10_1101-2021_01_07_425723	378	9	with	with	IN
10_1101-2021_01_07_425723	378	10	a	a	DT
10_1101-2021_01_07_425723	378	11	Qubit	Qubit	NNP
10_1101-2021_01_07_425723	378	12	RNA	RNA	NNP
10_1101-2021_01_07_425723	378	13	BR	BR	NNP
10_1101-2021_01_07_425723	378	14	assay	assay	NN
10_1101-2021_01_07_425723	378	15	kit	kit	NN
10_1101-2021_01_07_425723	378	16	(	(	-LRB-
10_1101-2021_01_07_425723	378	17	Thermo	Thermo	NNP
10_1101-2021_01_07_425723	378	18	Fisher	Fisher	NNP
10_1101-2021_01_07_425723	378	19	Scientific	Scientific	NNP
10_1101-2021_01_07_425723	378	20	)	)	-RRB-
10_1101-2021_01_07_425723	378	21	.	.	.
10_1101-2021_01_07_425723	379	1	RNA	RNA	NNP
10_1101-2021_01_07_425723	379	2	quality	quality	NN
10_1101-2021_01_07_425723	379	3	was	be	VBD
10_1101-2021_01_07_425723	379	4	determined	determine	VBN
10_1101-2021_01_07_425723	379	5	by	by	IN
10_1101-2021_01_07_425723	379	6	the	the	DT
10_1101-2021_01_07_425723	379	7	575	575	CD
10_1101-2021_01_07_425723	379	8	RNA	RNA	NNP
10_1101-2021_01_07_425723	379	9	integrity	integrity	NN
10_1101-2021_01_07_425723	379	10	number	number	NN
10_1101-2021_01_07_425723	379	11	with	with	IN
10_1101-2021_01_07_425723	379	12	RNA	RNA	NNP
10_1101-2021_01_07_425723	379	13	screen	screen	NN
10_1101-2021_01_07_425723	379	14	tape	tape	NN
10_1101-2021_01_07_425723	379	15	using	use	VBG
10_1101-2021_01_07_425723	379	16	a	a	DT
10_1101-2021_01_07_425723	379	17	Tapestation	Tapestation	NNP
10_1101-2021_01_07_425723	379	18	(	(	-LRB-
10_1101-2021_01_07_425723	379	19	Agilent	Agilent	NNP
10_1101-2021_01_07_425723	379	20	)	)	-RRB-
10_1101-2021_01_07_425723	379	21	.	.	.
10_1101-2021_01_07_425723	380	1	RNA	RNA	NNP
10_1101-2021_01_07_425723	380	2	libraries	library	NNS
10_1101-2021_01_07_425723	380	3	were	be	VBD
10_1101-2021_01_07_425723	380	4	prepared	prepare	VBN
10_1101-2021_01_07_425723	380	5	576	576	CD
10_1101-2021_01_07_425723	380	6	with	with	IN
10_1101-2021_01_07_425723	380	7	the	the	DT
10_1101-2021_01_07_425723	380	8	TruSeq	TruSeq	NNP
10_1101-2021_01_07_425723	380	9	Stranded	Stranded	NNP
10_1101-2021_01_07_425723	380	10	mRNA	mrna	NN
10_1101-2021_01_07_425723	380	11	LT	LT	NNP
10_1101-2021_01_07_425723	380	12	protocol	protocol	NNP
10_1101-2021_01_07_425723	380	13	(	(	-LRB-
10_1101-2021_01_07_425723	380	14	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	380	15	,	,	,
10_1101-2021_01_07_425723	380	16	#	#	$
10_1101-2021_01_07_425723	380	17	15031047	15031047	CD
10_1101-2021_01_07_425723	380	18	)	)	-RRB-
10_1101-2021_01_07_425723	380	19	and	and	CC
10_1101-2021_01_07_425723	380	20	subjected	subject	VBN
10_1101-2021_01_07_425723	380	21	to	to	IN
10_1101-2021_01_07_425723	380	22	paired	pair	VBN
10_1101-2021_01_07_425723	380	23	-	-	HYPH
10_1101-2021_01_07_425723	380	24	end	end	VB
10_1101-2021_01_07_425723	380	25	577	577	CD
10_1101-2021_01_07_425723	380	26	sequencing	sequencing	NN
10_1101-2021_01_07_425723	380	27	(	(	-LRB-
10_1101-2021_01_07_425723	380	28	151	151	CD
10_1101-2021_01_07_425723	380	29	bp	bp	NN
10_1101-2021_01_07_425723	380	30	read	read	VB
10_1101-2021_01_07_425723	380	31	length	length	NN
10_1101-2021_01_07_425723	380	32	,	,	,
10_1101-2021_01_07_425723	380	33	NovaSeq	NovaSeq	NNP
10_1101-2021_01_07_425723	380	34	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	380	35	)	)	-RRB-
10_1101-2021_01_07_425723	380	36	by	by	IN
10_1101-2021_01_07_425723	380	37	Macrogen	Macrogen	NNP
10_1101-2021_01_07_425723	380	38	(	(	-LRB-
10_1101-2021_01_07_425723	380	39	Macrogen	Macrogen	NNP
10_1101-2021_01_07_425723	380	40	Europe	Europe	NNP
10_1101-2021_01_07_425723	380	41	,	,	,
10_1101-2021_01_07_425723	380	42	Amsterdam	Amsterdam	NNP
10_1101-2021_01_07_425723	380	43	,	,	,
10_1101-2021_01_07_425723	380	44	the	the	DT
10_1101-2021_01_07_425723	380	45	578	578	CD
10_1101-2021_01_07_425723	380	46	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	380	47	)	)	-RRB-
10_1101-2021_01_07_425723	380	48	.	.	.
10_1101-2021_01_07_425723	381	1	579	579	CD
10_1101-2021_01_07_425723	381	2	Pooled	pool	VBN
10_1101-2021_01_07_425723	381	3	RNAseq	RNAseq	NNP
10_1101-2021_01_07_425723	381	4	libraries	library	NNS
10_1101-2021_01_07_425723	381	5	were	be	VBD
10_1101-2021_01_07_425723	381	6	used	use	VBN
10_1101-2021_01_07_425723	381	7	to	to	TO
10_1101-2021_01_07_425723	381	8	perform	perform	VB
10_1101-2021_01_07_425723	381	9	de	de	FW
10_1101-2021_01_07_425723	381	10	novo	novo	NNP
10_1101-2021_01_07_425723	381	11	transcriptome	transcriptome	NNP
10_1101-2021_01_07_425723	381	12	assembly	assembly	NN
10_1101-2021_01_07_425723	381	13	using	use	VBG
10_1101-2021_01_07_425723	381	14	Trinity	Trinity	NNP
10_1101-2021_01_07_425723	381	15	(	(	-LRB-
10_1101-2021_01_07_425723	381	16	v2.8.3)75	v2.8.3)75	NNP
10_1101-2021_01_07_425723	381	17	580	580	CD
10_1101-2021_01_07_425723	381	18	which	which	WDT
10_1101-2021_01_07_425723	381	19	was	be	VBD
10_1101-2021_01_07_425723	381	20	subsequently	subsequently	RB
10_1101-2021_01_07_425723	381	21	used	use	VBN
10_1101-2021_01_07_425723	381	22	as	as	IN
10_1101-2021_01_07_425723	381	23	evidence	evidence	NN
10_1101-2021_01_07_425723	381	24	for	for	IN
10_1101-2021_01_07_425723	381	25	both	both	CC
10_1101-2021_01_07_425723	381	26	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	381	27	and	and	CC
10_1101-2021_01_07_425723	381	28	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	381	29	genome	genome	JJ
10_1101-2021_01_07_425723	381	30	annotations	annotation	NNS
10_1101-2021_01_07_425723	381	31	.	.	.
10_1101-2021_01_07_425723	382	1	581	581	CD
10_1101-2021_01_07_425723	382	2	RNAseq	RNAseq	NNP
10_1101-2021_01_07_425723	382	3	libraries	library	NNS
10_1101-2021_01_07_425723	382	4	were	be	VBD
10_1101-2021_01_07_425723	382	5	mapped	map	VBN
10_1101-2021_01_07_425723	382	6	into	into	IN
10_1101-2021_01_07_425723	382	7	the	the	DT
10_1101-2021_01_07_425723	382	8	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	382	9	genome	genome	NNP
10_1101-2021_01_07_425723	382	10	assembly	assembly	NNP
10_1101-2021_01_07_425723	382	11	described	describe	VBN
10_1101-2021_01_07_425723	382	12	above	above	RB
10_1101-2021_01_07_425723	382	13	,	,	,
10_1101-2021_01_07_425723	382	14	using	use	VBG
10_1101-2021_01_07_425723	382	15	bowtie	bowtie	NN
10_1101-2021_01_07_425723	382	16	582	582	CD
10_1101-2021_01_07_425723	382	17	(	(	-LRB-
10_1101-2021_01_07_425723	382	18	v1.2.1.1)76	v1.2.1.1)76	NN
10_1101-2021_01_07_425723	382	19	with	with	IN
10_1101-2021_01_07_425723	382	20	parameters	parameter	NNS
10_1101-2021_01_07_425723	382	21	(	(	-LRB-
10_1101-2021_01_07_425723	382	22	-v	-v	NFP
10_1101-2021_01_07_425723	382	23	0	0	CD
10_1101-2021_01_07_425723	382	24	-k	-k	SYM
10_1101-2021_01_07_425723	382	25	10	10	CD
10_1101-2021_01_07_425723	382	26	--best	--best	JJ
10_1101-2021_01_07_425723	382	27	-M	-M	:
10_1101-2021_01_07_425723	382	28	1	1	CD
10_1101-2021_01_07_425723	382	29	)	)	-RRB-
10_1101-2021_01_07_425723	382	30	to	to	TO
10_1101-2021_01_07_425723	382	31	allow	allow	VB
10_1101-2021_01_07_425723	382	32	no	no	DT
10_1101-2021_01_07_425723	382	33	mismatches	mismatch	NNS
10_1101-2021_01_07_425723	382	34	,	,	,
10_1101-2021_01_07_425723	382	35	select	select	VB
10_1101-2021_01_07_425723	382	36	the	the	DT
10_1101-2021_01_07_425723	382	37	best	good	JJS
10_1101-2021_01_07_425723	382	38	out	out	IN
10_1101-2021_01_07_425723	382	39	of	of	IN
10_1101-2021_01_07_425723	382	40	10	10	CD
10_1101-2021_01_07_425723	382	41	583	583	CD
10_1101-2021_01_07_425723	382	42	possible	possible	JJ
10_1101-2021_01_07_425723	382	43	alignments	alignment	NNS
10_1101-2021_01_07_425723	382	44	per	per	IN
10_1101-2021_01_07_425723	382	45	read	read	NN
10_1101-2021_01_07_425723	382	46	,	,	,
10_1101-2021_01_07_425723	382	47	and	and	CC
10_1101-2021_01_07_425723	382	48	for	for	IN
10_1101-2021_01_07_425723	382	49	reads	read	NNS
10_1101-2021_01_07_425723	382	50	having	have	VBG
10_1101-2021_01_07_425723	382	51	more	more	JJR
10_1101-2021_01_07_425723	382	52	than	than	IN
10_1101-2021_01_07_425723	382	53	one	one	CD
10_1101-2021_01_07_425723	382	54	possible	possible	JJ
10_1101-2021_01_07_425723	382	55	alignment	alignment	NN
10_1101-2021_01_07_425723	382	56	randomly	randomly	RB
10_1101-2021_01_07_425723	382	57	report	report	VB
10_1101-2021_01_07_425723	382	58	584	584	CD
10_1101-2021_01_07_425723	382	59	only	only	RB
10_1101-2021_01_07_425723	382	60	one	one	CD
10_1101-2021_01_07_425723	382	61	.	.	.
10_1101-2021_01_07_425723	383	1	Alignments	alignment	NNS
10_1101-2021_01_07_425723	383	2	were	be	VBD
10_1101-2021_01_07_425723	383	3	filtered	filter	VBN
10_1101-2021_01_07_425723	383	4	and	and	CC
10_1101-2021_01_07_425723	383	5	sorted	sort	VBN
10_1101-2021_01_07_425723	383	6	using	use	VBG
10_1101-2021_01_07_425723	383	7	samtools	samtool	NNS
10_1101-2021_01_07_425723	383	8	(	(	-LRB-
10_1101-2021_01_07_425723	383	9	v1.3.1)77	v1.3.1)77	NNP
10_1101-2021_01_07_425723	383	10	.	.	.
10_1101-2021_01_07_425723	384	1	Read	Read	VBN
10_1101-2021_01_07_425723	384	2	counts	count	NNS
10_1101-2021_01_07_425723	384	3	were	be	VBD
10_1101-2021_01_07_425723	384	4	obtained	obtain	VBN
10_1101-2021_01_07_425723	384	5	585	585	CD
10_1101-2021_01_07_425723	384	6	.CC	.CC	:
10_1101-2021_01_07_425723	384	7	-	-	HYPH
10_1101-2021_01_07_425723	384	8	BY	by	IN
10_1101-2021_01_07_425723	384	9	-	-	HYPH
10_1101-2021_01_07_425723	384	10	NC	NC	NNP
10_1101-2021_01_07_425723	384	11	-	-	HYPH
10_1101-2021_01_07_425723	384	12	ND	ND	NNP
10_1101-2021_01_07_425723	384	13	4.0	4.0	CD
10_1101-2021_01_07_425723	384	14	International	International	NNP
10_1101-2021_01_07_425723	384	15	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	384	16	under	under	IN
10_1101-2021_01_07_425723	384	17	a	a	DT
10_1101-2021_01_07_425723	384	18	(	(	-LRB-
10_1101-2021_01_07_425723	384	19	which	which	WDT
10_1101-2021_01_07_425723	384	20	was	be	VBD
10_1101-2021_01_07_425723	384	21	not	not	RB
10_1101-2021_01_07_425723	384	22	certified	certify	VBN
10_1101-2021_01_07_425723	384	23	by	by	IN
10_1101-2021_01_07_425723	384	24	peer	peer	NN
10_1101-2021_01_07_425723	384	25	review	review	NN
10_1101-2021_01_07_425723	384	26	)	)	-RRB-
10_1101-2021_01_07_425723	384	27	is	be	VBZ
10_1101-2021_01_07_425723	384	28	the	the	DT
10_1101-2021_01_07_425723	384	29	author	author	NN
10_1101-2021_01_07_425723	384	30	/	/	SYM
10_1101-2021_01_07_425723	384	31	funder	funder	NN
10_1101-2021_01_07_425723	384	32	,	,	,
10_1101-2021_01_07_425723	384	33	who	who	WP
10_1101-2021_01_07_425723	384	34	has	have	VBZ
10_1101-2021_01_07_425723	384	35	granted	grant	VBN
10_1101-2021_01_07_425723	384	36	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	384	37	a	a	DT
10_1101-2021_01_07_425723	384	38	license	license	NN
10_1101-2021_01_07_425723	384	39	to	to	TO
10_1101-2021_01_07_425723	384	40	display	display	VB
10_1101-2021_01_07_425723	384	41	the	the	DT
10_1101-2021_01_07_425723	384	42	preprint	preprint	NN
10_1101-2021_01_07_425723	384	43	in	in	IN
10_1101-2021_01_07_425723	384	44	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	384	45	.	.	.
10_1101-2021_01_07_425723	385	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	385	2	is	be	VBZ
10_1101-2021_01_07_425723	385	3	made	make	VBN
10_1101-2021_01_07_425723	385	4	The	the	DT
10_1101-2021_01_07_425723	385	5	copyright	copyright	NN
10_1101-2021_01_07_425723	385	6	holder	holder	NN
10_1101-2021_01_07_425723	385	7	for	for	IN
10_1101-2021_01_07_425723	385	8	this	this	DT
10_1101-2021_01_07_425723	385	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	385	10	version	version	NN
10_1101-2021_01_07_425723	385	11	posted	post	VBD
10_1101-2021_01_07_425723	385	12	January	January	NNP
10_1101-2021_01_07_425723	385	13	8	8	CD
10_1101-2021_01_07_425723	385	14	,	,	,
10_1101-2021_01_07_425723	385	15	2021	2021	CD
10_1101-2021_01_07_425723	385	16	.	.	.
10_1101-2021_01_07_425723	385	17	;	;	:
10_1101-2021_01_07_425723	385	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	385	19	:	:	:
10_1101-2021_01_07_425723	385	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	385	21	preprint	preprint	NN
10_1101-2021_01_07_425723	385	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	385	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	385	24	34	34	CD
10_1101-2021_01_07_425723	385	25	with	with	IN
10_1101-2021_01_07_425723	385	26	featureCounts	featurecount	NNS
10_1101-2021_01_07_425723	385	27	(	(	-LRB-
10_1101-2021_01_07_425723	385	28	v1.6.0)78	v1.6.0)78	NN
10_1101-2021_01_07_425723	385	29	using	use	VBG
10_1101-2021_01_07_425723	385	30	parameters	parameter	NNS
10_1101-2021_01_07_425723	385	31	(	(	-LRB-
10_1101-2021_01_07_425723	385	32	-B	-B	:
10_1101-2021_01_07_425723	385	33	-C	-C	NFP
10_1101-2021_01_07_425723	385	34	)	)	-RRB-
10_1101-2021_01_07_425723	385	35	to	to	TO
10_1101-2021_01_07_425723	385	36	only	only	RB
10_1101-2021_01_07_425723	385	37	count	count	VB
10_1101-2021_01_07_425723	385	38	reads	read	VBZ
10_1101-2021_01_07_425723	385	39	for	for	IN
10_1101-2021_01_07_425723	385	40	which	which	WDT
10_1101-2021_01_07_425723	385	41	both	both	DT
10_1101-2021_01_07_425723	385	42	pairs	pair	NNS
10_1101-2021_01_07_425723	385	43	are	be	VBP
10_1101-2021_01_07_425723	385	44	586	586	CD
10_1101-2021_01_07_425723	385	45	aligned	align	VBN
10_1101-2021_01_07_425723	385	46	into	into	IN
10_1101-2021_01_07_425723	385	47	the	the	DT
10_1101-2021_01_07_425723	385	48	same	same	JJ
10_1101-2021_01_07_425723	385	49	chromosome	chromosome	NN
10_1101-2021_01_07_425723	385	50	.	.	.
10_1101-2021_01_07_425723	386	1	587	587	CD
10_1101-2021_01_07_425723	386	2	Differential	differential	NN
10_1101-2021_01_07_425723	386	3	gene	gene	NN
10_1101-2021_01_07_425723	386	4	expression	expression	NN
10_1101-2021_01_07_425723	386	5	(	(	-LRB-
10_1101-2021_01_07_425723	386	6	DGE	DGE	NNP
10_1101-2021_01_07_425723	386	7	)	)	-RRB-
10_1101-2021_01_07_425723	386	8	analysis	analysis	NN
10_1101-2021_01_07_425723	386	9	was	be	VBD
10_1101-2021_01_07_425723	386	10	performed	perform	VBN
10_1101-2021_01_07_425723	386	11	using	use	VBG
10_1101-2021_01_07_425723	386	12	edgeR	edgeR	NNP
10_1101-2021_01_07_425723	386	13	(	(	-LRB-
10_1101-2021_01_07_425723	386	14	v3.28.1)79	v3.28.1)79	CD
10_1101-2021_01_07_425723	386	15	.	.	.
10_1101-2021_01_07_425723	387	1	Genes	gene	NNS
10_1101-2021_01_07_425723	387	2	with	with	IN
10_1101-2021_01_07_425723	387	3	0	0	CD
10_1101-2021_01_07_425723	387	4	read	read	NN
10_1101-2021_01_07_425723	387	5	588	588	CD
10_1101-2021_01_07_425723	387	6	counts	count	NNS
10_1101-2021_01_07_425723	387	7	in	in	IN
10_1101-2021_01_07_425723	387	8	all	all	DT
10_1101-2021_01_07_425723	387	9	conditions	condition	NNS
10_1101-2021_01_07_425723	387	10	were	be	VBD
10_1101-2021_01_07_425723	387	11	filtered	filter	VBN
10_1101-2021_01_07_425723	387	12	out	out	RP
10_1101-2021_01_07_425723	387	13	from	from	IN
10_1101-2021_01_07_425723	387	14	the	the	DT
10_1101-2021_01_07_425723	387	15	analysis	analysis	NN
10_1101-2021_01_07_425723	387	16	,	,	,
10_1101-2021_01_07_425723	387	17	same	same	JJ
10_1101-2021_01_07_425723	387	18	as	as	IN
10_1101-2021_01_07_425723	387	19	genes	gene	NNS
10_1101-2021_01_07_425723	387	20	with	with	IN
10_1101-2021_01_07_425723	387	21	less	less	JJR
10_1101-2021_01_07_425723	387	22	than	than	IN
10_1101-2021_01_07_425723	387	23	10	10	CD
10_1101-2021_01_07_425723	387	24	counts	count	NNS
10_1101-2021_01_07_425723	387	25	per	per	IN
10_1101-2021_01_07_425723	387	26	589	589	CD
10_1101-2021_01_07_425723	387	27	million	million	CD
10_1101-2021_01_07_425723	387	28	.	.	.
10_1101-2021_01_07_425723	388	1	Counts	count	NNS
10_1101-2021_01_07_425723	388	2	were	be	VBD
10_1101-2021_01_07_425723	388	3	normalized	normalized	JJ
10_1101-2021_01_07_425723	388	4	using	use	VBG
10_1101-2021_01_07_425723	388	5	the	the	DT
10_1101-2021_01_07_425723	388	6	trimmed	trim	VBN
10_1101-2021_01_07_425723	388	7	mean	mean	NN
10_1101-2021_01_07_425723	388	8	of	of	IN
10_1101-2021_01_07_425723	388	9	M	M	NNP
10_1101-2021_01_07_425723	388	10	values	value	NNS
10_1101-2021_01_07_425723	388	11	(	(	-LRB-
10_1101-2021_01_07_425723	388	12	TMM	TMM	NNP
10_1101-2021_01_07_425723	388	13	)	)	-RRB-
10_1101-2021_01_07_425723	388	14	method80	method80	NNP
10_1101-2021_01_07_425723	388	15	,	,	,
10_1101-2021_01_07_425723	388	16	and	and	CC
10_1101-2021_01_07_425723	388	17	dispersion	dispersion	NN
10_1101-2021_01_07_425723	388	18	590	590	CD
10_1101-2021_01_07_425723	388	19	was	be	VBD
10_1101-2021_01_07_425723	388	20	estimated	estimate	VBN
10_1101-2021_01_07_425723	388	21	using	use	VBG
10_1101-2021_01_07_425723	388	22	generalized	generalize	VBN
10_1101-2021_01_07_425723	388	23	linear	linear	JJ
10_1101-2021_01_07_425723	388	24	models	model	NNS
10_1101-2021_01_07_425723	388	25	.	.	.
10_1101-2021_01_07_425723	389	1	Differentially	differentially	RB
10_1101-2021_01_07_425723	389	2	expressed	express	VBD
10_1101-2021_01_07_425723	389	3	genes	gene	NNS
10_1101-2021_01_07_425723	389	4	were	be	VBD
10_1101-2021_01_07_425723	389	5	then	then	RB
10_1101-2021_01_07_425723	389	6	calculated	calculate	VBN
10_1101-2021_01_07_425723	389	7	591	591	CD
10_1101-2021_01_07_425723	389	8	using	use	VBG
10_1101-2021_01_07_425723	389	9	a	a	DT
10_1101-2021_01_07_425723	389	10	log	log	NN
10_1101-2021_01_07_425723	389	11	ratio	ratio	NN
10_1101-2021_01_07_425723	389	12	test	test	NN
10_1101-2021_01_07_425723	389	13	adjusted	adjust	VBN
10_1101-2021_01_07_425723	389	14	with	with	IN
10_1101-2021_01_07_425723	389	15	the	the	DT
10_1101-2021_01_07_425723	389	16	Benjamini	Benjamini	NNP
10_1101-2021_01_07_425723	389	17	-	-	HYPH
10_1101-2021_01_07_425723	389	18	Hochberg	Hochberg	NNP
10_1101-2021_01_07_425723	389	19	method	method	NN
10_1101-2021_01_07_425723	389	20	.	.	.
10_1101-2021_01_07_425723	390	1	Absolute	absolute	JJ
10_1101-2021_01_07_425723	390	2	log2	log2	NN
10_1101-2021_01_07_425723	390	3	fold	fold	JJ
10_1101-2021_01_07_425723	390	4	-	-	HYPH
10_1101-2021_01_07_425723	390	5	change	change	NN
10_1101-2021_01_07_425723	390	6	values	value	NNS
10_1101-2021_01_07_425723	390	7	>	>	.
10_1101-2021_01_07_425723	390	8	592	592	CD
10_1101-2021_01_07_425723	390	9	2	2	CD
10_1101-2021_01_07_425723	390	10	,	,	,
10_1101-2021_01_07_425723	390	11	false	false	JJ
10_1101-2021_01_07_425723	390	12	discovery	discovery	NN
10_1101-2021_01_07_425723	390	13	rate	rate	NN
10_1101-2021_01_07_425723	390	14	<	<	XX
10_1101-2021_01_07_425723	390	15	0.5	0.5	CD
10_1101-2021_01_07_425723	390	16	,	,	,
10_1101-2021_01_07_425723	390	17	and	and	CC
10_1101-2021_01_07_425723	390	18	P	p	NN
10_1101-2021_01_07_425723	390	19	value	value	NN
10_1101-2021_01_07_425723	390	20	<	<	XX
10_1101-2021_01_07_425723	390	21	0.05	0.05	CD
10_1101-2021_01_07_425723	390	22	were	be	VBD
10_1101-2021_01_07_425723	390	23	used	use	VBN
10_1101-2021_01_07_425723	390	24	as	as	IN
10_1101-2021_01_07_425723	390	25	significance	significance	NN
10_1101-2021_01_07_425723	390	26	cutoffs	cutoff	NNS
10_1101-2021_01_07_425723	390	27	.	.	.
10_1101-2021_01_07_425723	391	1	593	593	CD
10_1101-2021_01_07_425723	391	2	Gene	gene	NN
10_1101-2021_01_07_425723	391	3	set	set	NN
10_1101-2021_01_07_425723	391	4	analysis	analysis	NN
10_1101-2021_01_07_425723	391	5	(	(	-LRB-
10_1101-2021_01_07_425723	391	6	GSA	GSA	NNP
10_1101-2021_01_07_425723	391	7	)	)	-RRB-
10_1101-2021_01_07_425723	391	8	based	base	VBN
10_1101-2021_01_07_425723	391	9	on	on	IN
10_1101-2021_01_07_425723	391	10	gene	gene	NN
10_1101-2021_01_07_425723	391	11	ontology	ontology	NN
10_1101-2021_01_07_425723	391	12	(	(	-LRB-
10_1101-2021_01_07_425723	391	13	GO	GO	NNP
10_1101-2021_01_07_425723	391	14	)	)	-RRB-
10_1101-2021_01_07_425723	391	15	terms	term	NNS
10_1101-2021_01_07_425723	391	16	was	be	VBD
10_1101-2021_01_07_425723	391	17	used	use	VBN
10_1101-2021_01_07_425723	391	18	to	to	TO
10_1101-2021_01_07_425723	391	19	get	get	VB
10_1101-2021_01_07_425723	391	20	a	a	DT
10_1101-2021_01_07_425723	391	21	functional	functional	JJ
10_1101-2021_01_07_425723	391	22	interpretation	interpretation	NN
10_1101-2021_01_07_425723	391	23	594	594	CD
10_1101-2021_01_07_425723	391	24	of	of	IN
10_1101-2021_01_07_425723	391	25	the	the	DT
10_1101-2021_01_07_425723	391	26	DGE	DGE	NNP
10_1101-2021_01_07_425723	391	27	analysis	analysis	NN
10_1101-2021_01_07_425723	391	28	.	.	.
10_1101-2021_01_07_425723	392	1	For	for	IN
10_1101-2021_01_07_425723	392	2	this	this	DT
10_1101-2021_01_07_425723	392	3	purpose	purpose	NN
10_1101-2021_01_07_425723	392	4	,	,	,
10_1101-2021_01_07_425723	392	5	GO	GO	NNP
10_1101-2021_01_07_425723	392	6	terms	term	NNS
10_1101-2021_01_07_425723	392	7	were	be	VBD
10_1101-2021_01_07_425723	392	8	first	first	RB
10_1101-2021_01_07_425723	392	9	obtained	obtain	VBN
10_1101-2021_01_07_425723	392	10	for	for	IN
10_1101-2021_01_07_425723	392	11	the	the	DT
10_1101-2021_01_07_425723	392	12	S.	S.	NNP
10_1101-2021_01_07_425723	392	13	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	392	14	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	392	15	-	-	HYPH
10_1101-2021_01_07_425723	392	16	7D	7D	NNP
10_1101-2021_01_07_425723	392	17	595	595	CD
10_1101-2021_01_07_425723	392	18	(	(	-LRB-
10_1101-2021_01_07_425723	392	19	GCA_002571405.2	GCA_002571405.2	NNP
10_1101-2021_01_07_425723	392	20	)	)	-RRB-
10_1101-2021_01_07_425723	392	21	and	and	CC
10_1101-2021_01_07_425723	392	22	K.	K.	NNP
10_1101-2021_01_07_425723	392	23	marxianus	marxianus	NN
10_1101-2021_01_07_425723	392	24	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	392	25	genome	genome	NNP
10_1101-2021_01_07_425723	392	26	annotations	annotation	NNS
10_1101-2021_01_07_425723	392	27	using	use	VBG
10_1101-2021_01_07_425723	392	28	Funannotate	Funannotate	NNP
10_1101-2021_01_07_425723	392	29	and	and	CC
10_1101-2021_01_07_425723	392	30	596	596	CD
10_1101-2021_01_07_425723	392	31	Interproscan	Interproscan	NNPS
10_1101-2021_01_07_425723	392	32	as	as	IN
10_1101-2021_01_07_425723	392	33	described	describe	VBN
10_1101-2021_01_07_425723	392	34	above	above	RB
10_1101-2021_01_07_425723	392	35	.	.	.
10_1101-2021_01_07_425723	393	1	Afterwards	afterwards	RB
10_1101-2021_01_07_425723	393	2	,	,	,
10_1101-2021_01_07_425723	393	3	Funannotate	Funannotate	NNP
10_1101-2021_01_07_425723	393	4	compare	compare	NN
10_1101-2021_01_07_425723	393	5	was	be	VBD
10_1101-2021_01_07_425723	393	6	used	use	VBN
10_1101-2021_01_07_425723	393	7	to	to	TO
10_1101-2021_01_07_425723	393	8	get	get	VB
10_1101-2021_01_07_425723	393	9	(	(	-LRB-
10_1101-2021_01_07_425723	393	10	co)ortholog	co)ortholog	NN
10_1101-2021_01_07_425723	393	11	597	597	CD
10_1101-2021_01_07_425723	393	12	groups	group	NNS
10_1101-2021_01_07_425723	393	13	of	of	IN
10_1101-2021_01_07_425723	393	14	genes	gene	NNS
10_1101-2021_01_07_425723	393	15	generated	generate	VBN
10_1101-2021_01_07_425723	393	16	with	with	IN
10_1101-2021_01_07_425723	393	17	ProteinOrtho538	ProteinOrtho538	NNP
10_1101-2021_01_07_425723	393	18	using	use	VBG
10_1101-2021_01_07_425723	393	19	the	the	DT
10_1101-2021_01_07_425723	393	20	following	follow	VBG
10_1101-2021_01_07_425723	393	21	public	public	JJ
10_1101-2021_01_07_425723	393	22	genome	genome	JJ
10_1101-2021_01_07_425723	393	23	annotations	annotation	NNS
10_1101-2021_01_07_425723	393	24	S.	S.	NNP
10_1101-2021_01_07_425723	393	25	598	598	CD
10_1101-2021_01_07_425723	393	26	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	393	27	S288C	s288c	CD
10_1101-2021_01_07_425723	393	28	(	(	-LRB-
10_1101-2021_01_07_425723	393	29	GCF_000146045.2	GCF_000146045.2	NNP
10_1101-2021_01_07_425723	393	30	)	)	-RRB-
10_1101-2021_01_07_425723	393	31	,	,	,
10_1101-2021_01_07_425723	393	32	K.	K.	NNP
10_1101-2021_01_07_425723	393	33	marxianus	marxianus	NN
10_1101-2021_01_07_425723	393	34	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	393	35	(	(	-LRB-
10_1101-2021_01_07_425723	393	36	GCA_001417835.1	GCA_001417835.1	NNP
10_1101-2021_01_07_425723	393	37	)	)	-RRB-
10_1101-2021_01_07_425723	393	38	,	,	,
10_1101-2021_01_07_425723	393	39	K.	K.	NNP
10_1101-2021_01_07_425723	393	40	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	393	41	599	599	CD
10_1101-2021_01_07_425723	393	42	DMKU3	DMKU3	NNP
10_1101-2021_01_07_425723	393	43	-	-	HYPH
10_1101-2021_01_07_425723	393	44	1042	1042	CD
10_1101-2021_01_07_425723	393	45	(	(	-LRB-
10_1101-2021_01_07_425723	393	46	GCF_001417885.1	GCF_001417885.1	NNP
10_1101-2021_01_07_425723	393	47	)	)	-RRB-
10_1101-2021_01_07_425723	393	48	,	,	,
10_1101-2021_01_07_425723	393	49	in	in	IN
10_1101-2021_01_07_425723	393	50	addition	addition	NN
10_1101-2021_01_07_425723	393	51	to	to	IN
10_1101-2021_01_07_425723	393	52	the	the	DT
10_1101-2021_01_07_425723	393	53	new	new	JJ
10_1101-2021_01_07_425723	393	54	genome	genome	JJ
10_1101-2021_01_07_425723	393	55	annotations	annotation	NNS
10_1101-2021_01_07_425723	393	56	generated	generate	VBN
10_1101-2021_01_07_425723	393	57	here	here	RB
10_1101-2021_01_07_425723	393	58	for	for	IN
10_1101-2021_01_07_425723	393	59	S.	S.	NNP
10_1101-2021_01_07_425723	393	60	600	600	CD
10_1101-2021_01_07_425723	393	61	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	393	62	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	393	63	-	-	HYPH
10_1101-2021_01_07_425723	393	64	7D	7D	NNP
10_1101-2021_01_07_425723	393	65	,	,	,
10_1101-2021_01_07_425723	393	66	and	and	CC
10_1101-2021_01_07_425723	393	67	K.	K.	NNP
10_1101-2021_01_07_425723	393	68	marxianus	marxianus	NN
10_1101-2021_01_07_425723	393	69	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	393	70	and	and	CC
10_1101-2021_01_07_425723	393	71	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	393	72	.	.	.
10_1101-2021_01_07_425723	394	1	Predicted	predict	VBN
10_1101-2021_01_07_425723	394	2	GO	GO	NNP
10_1101-2021_01_07_425723	394	3	terms	term	NNS
10_1101-2021_01_07_425723	394	4	for	for	IN
10_1101-2021_01_07_425723	394	5	S.	S.	NNP
10_1101-2021_01_07_425723	394	6	601	601	CD
10_1101-2021_01_07_425723	394	7	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	394	8	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	394	9	-	-	HYPH
10_1101-2021_01_07_425723	394	10	7D	7D	NNP
10_1101-2021_01_07_425723	394	11	and	and	CC
10_1101-2021_01_07_425723	394	12	K.	K.	NNP
10_1101-2021_01_07_425723	394	13	marxianus	marxianus	NN
10_1101-2021_01_07_425723	394	14	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	394	15	were	be	VBD
10_1101-2021_01_07_425723	394	16	kept	keep	VBN
10_1101-2021_01_07_425723	394	17	,	,	,
10_1101-2021_01_07_425723	394	18	and	and	CC
10_1101-2021_01_07_425723	394	19	merged	merge	VBN
10_1101-2021_01_07_425723	394	20	with	with	IN
10_1101-2021_01_07_425723	394	21	those	those	DT
10_1101-2021_01_07_425723	394	22	from	from	IN
10_1101-2021_01_07_425723	394	23	602	602	CD
10_1101-2021_01_07_425723	394	24	corresponding	corresponding	JJ
10_1101-2021_01_07_425723	394	25	(	(	-LRB-
10_1101-2021_01_07_425723	394	26	co)orthologs	co)orthologs	NNP
10_1101-2021_01_07_425723	394	27	from	from	IN
10_1101-2021_01_07_425723	394	28	S.	S.	NNP
10_1101-2021_01_07_425723	394	29	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	394	30	S288C.	s288c.	XX
10_1101-2021_01_07_425723	395	1	Genes	gene	NNS
10_1101-2021_01_07_425723	395	2	with	with	IN
10_1101-2021_01_07_425723	395	3	term	term	NN
10_1101-2021_01_07_425723	395	4	GO:0005840	GO:0005840	NNP
10_1101-2021_01_07_425723	395	5	(	(	-LRB-
10_1101-2021_01_07_425723	395	6	ribosome	ribosome	VBN
10_1101-2021_01_07_425723	395	7	)	)	-RRB-
10_1101-2021_01_07_425723	395	8	were	be	VBD
10_1101-2021_01_07_425723	395	9	603	603	CD
10_1101-2021_01_07_425723	395	10	not	not	RB
10_1101-2021_01_07_425723	395	11	considered	consider	VBN
10_1101-2021_01_07_425723	395	12	for	for	IN
10_1101-2021_01_07_425723	395	13	further	further	JJ
10_1101-2021_01_07_425723	395	14	analyses	analysis	NNS
10_1101-2021_01_07_425723	395	15	.	.	.
10_1101-2021_01_07_425723	396	1	GSA	GSA	NNP
10_1101-2021_01_07_425723	396	2	was	be	VBD
10_1101-2021_01_07_425723	396	3	then	then	RB
10_1101-2021_01_07_425723	396	4	performed	perform	VBN
10_1101-2021_01_07_425723	396	5	with	with	IN
10_1101-2021_01_07_425723	396	6	Piano	Piano	NNP
10_1101-2021_01_07_425723	396	7	(	(	-LRB-
10_1101-2021_01_07_425723	396	8	v2.4.0)40	v2.4.0)40	NN
10_1101-2021_01_07_425723	396	9	.	.	.
10_1101-2021_01_07_425723	397	1	Gene	gene	NN
10_1101-2021_01_07_425723	397	2	set	set	NN
10_1101-2021_01_07_425723	397	3	statistics	statistic	NNS
10_1101-2021_01_07_425723	397	4	604	604	CD
10_1101-2021_01_07_425723	397	5	were	be	VBD
10_1101-2021_01_07_425723	397	6	first	first	RB
10_1101-2021_01_07_425723	397	7	calculated	calculate	VBN
10_1101-2021_01_07_425723	397	8	with	with	IN
10_1101-2021_01_07_425723	397	9	the	the	DT
10_1101-2021_01_07_425723	397	10	Stouffer	Stouffer	NNP
10_1101-2021_01_07_425723	397	11	,	,	,
10_1101-2021_01_07_425723	397	12	Wilcoxon	Wilcoxon	NNP
10_1101-2021_01_07_425723	397	13	rank	rank	NN
10_1101-2021_01_07_425723	397	14	-	-	HYPH
10_1101-2021_01_07_425723	397	15	sum	sum	NN
10_1101-2021_01_07_425723	397	16	test	test	NN
10_1101-2021_01_07_425723	397	17	,	,	,
10_1101-2021_01_07_425723	397	18	and	and	CC
10_1101-2021_01_07_425723	397	19	reporter	reporter	NN
10_1101-2021_01_07_425723	397	20	methods	method	NNS
10_1101-2021_01_07_425723	397	21	implemented	implement	VBN
10_1101-2021_01_07_425723	397	22	in	in	IN
10_1101-2021_01_07_425723	397	23	605	605	CD
10_1101-2021_01_07_425723	397	24	Piano	Piano	NNP
10_1101-2021_01_07_425723	397	25	.	.	.
10_1101-2021_01_07_425723	398	1	Afterwards	afterwards	RB
10_1101-2021_01_07_425723	398	2	,	,	,
10_1101-2021_01_07_425723	398	3	consensus	consensus	NN
10_1101-2021_01_07_425723	398	4	results	result	NNS
10_1101-2021_01_07_425723	398	5	were	be	VBD
10_1101-2021_01_07_425723	398	6	derived	derive	VBN
10_1101-2021_01_07_425723	398	7	by	by	IN
10_1101-2021_01_07_425723	398	8	p	p	NN
10_1101-2021_01_07_425723	398	9	-	-	HYPH
10_1101-2021_01_07_425723	398	10	value	value	NN
10_1101-2021_01_07_425723	398	11	and	and	CC
10_1101-2021_01_07_425723	398	12	rank	rank	NN
10_1101-2021_01_07_425723	398	13	aggregation	aggregation	NN
10_1101-2021_01_07_425723	398	14	,	,	,
10_1101-2021_01_07_425723	398	15	considered	consider	VBD
10_1101-2021_01_07_425723	398	16	606	606	CD
10_1101-2021_01_07_425723	398	17	significant	significant	JJ
10_1101-2021_01_07_425723	398	18	if	if	IN
10_1101-2021_01_07_425723	398	19	absolute	absolute	JJ
10_1101-2021_01_07_425723	398	20	Fold	Fold	NNP
10_1101-2021_01_07_425723	398	21	Change	Change	NNP
10_1101-2021_01_07_425723	398	22	values	value	NNS
10_1101-2021_01_07_425723	398	23	>	>	XX
10_1101-2021_01_07_425723	398	24	1	1	CD
10_1101-2021_01_07_425723	398	25	.	.	.
10_1101-2021_01_07_425723	399	1	ComplexHeatmap	ComplexHeatmap	NNP
10_1101-2021_01_07_425723	399	2	(	(	-LRB-
10_1101-2021_01_07_425723	399	3	v2.4.3)81	v2.4.3)81	NNP
10_1101-2021_01_07_425723	399	4	was	be	VBD
10_1101-2021_01_07_425723	399	5	used	use	VBN
10_1101-2021_01_07_425723	399	6	to	to	TO
10_1101-2021_01_07_425723	399	7	draw	draw	VB
10_1101-2021_01_07_425723	399	8	GSA	GSA	NNP
10_1101-2021_01_07_425723	399	9	results	result	VBZ
10_1101-2021_01_07_425723	399	10	607	607	CD
10_1101-2021_01_07_425723	399	11	.CC	.CC	,
10_1101-2021_01_07_425723	399	12	-	-	HYPH
10_1101-2021_01_07_425723	399	13	BY	by	IN
10_1101-2021_01_07_425723	399	14	-	-	HYPH
10_1101-2021_01_07_425723	399	15	NC	NC	NNP
10_1101-2021_01_07_425723	399	16	-	-	HYPH
10_1101-2021_01_07_425723	399	17	ND	ND	NNP
10_1101-2021_01_07_425723	399	18	4.0	4.0	CD
10_1101-2021_01_07_425723	399	19	International	International	NNP
10_1101-2021_01_07_425723	399	20	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	399	21	under	under	IN
10_1101-2021_01_07_425723	399	22	a	a	DT
10_1101-2021_01_07_425723	399	23	(	(	-LRB-
10_1101-2021_01_07_425723	399	24	which	which	WDT
10_1101-2021_01_07_425723	399	25	was	be	VBD
10_1101-2021_01_07_425723	399	26	not	not	RB
10_1101-2021_01_07_425723	399	27	certified	certify	VBN
10_1101-2021_01_07_425723	399	28	by	by	IN
10_1101-2021_01_07_425723	399	29	peer	peer	NN
10_1101-2021_01_07_425723	399	30	review	review	NN
10_1101-2021_01_07_425723	399	31	)	)	-RRB-
10_1101-2021_01_07_425723	399	32	is	be	VBZ
10_1101-2021_01_07_425723	399	33	the	the	DT
10_1101-2021_01_07_425723	399	34	author	author	NN
10_1101-2021_01_07_425723	399	35	/	/	SYM
10_1101-2021_01_07_425723	399	36	funder	funder	NN
10_1101-2021_01_07_425723	399	37	,	,	,
10_1101-2021_01_07_425723	399	38	who	who	WP
10_1101-2021_01_07_425723	399	39	has	have	VBZ
10_1101-2021_01_07_425723	399	40	granted	grant	VBN
10_1101-2021_01_07_425723	399	41	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	399	42	a	a	DT
10_1101-2021_01_07_425723	399	43	license	license	NN
10_1101-2021_01_07_425723	399	44	to	to	TO
10_1101-2021_01_07_425723	399	45	display	display	VB
10_1101-2021_01_07_425723	399	46	the	the	DT
10_1101-2021_01_07_425723	399	47	preprint	preprint	NN
10_1101-2021_01_07_425723	399	48	in	in	IN
10_1101-2021_01_07_425723	399	49	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	399	50	.	.	.
10_1101-2021_01_07_425723	400	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	400	2	is	be	VBZ
10_1101-2021_01_07_425723	400	3	made	make	VBN
10_1101-2021_01_07_425723	400	4	The	the	DT
10_1101-2021_01_07_425723	400	5	copyright	copyright	NN
10_1101-2021_01_07_425723	400	6	holder	holder	NN
10_1101-2021_01_07_425723	400	7	for	for	IN
10_1101-2021_01_07_425723	400	8	this	this	DT
10_1101-2021_01_07_425723	400	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	400	10	version	version	NN
10_1101-2021_01_07_425723	400	11	posted	post	VBD
10_1101-2021_01_07_425723	400	12	January	January	NNP
10_1101-2021_01_07_425723	400	13	8	8	CD
10_1101-2021_01_07_425723	400	14	,	,	,
10_1101-2021_01_07_425723	400	15	2021	2021	CD
10_1101-2021_01_07_425723	400	16	.	.	.
10_1101-2021_01_07_425723	400	17	;	;	:
10_1101-2021_01_07_425723	400	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	400	19	:	:	:
10_1101-2021_01_07_425723	400	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	400	21	preprint	preprint	NN
10_1101-2021_01_07_425723	400	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	400	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CC
10_1101-2021_01_07_425723	400	24	35	35	CD
10_1101-2021_01_07_425723	400	25	into	into	IN
10_1101-2021_01_07_425723	400	26	Fig	Fig	NNP
10_1101-2021_01_07_425723	400	27	.	.	.
10_1101-2021_01_07_425723	401	1	2	2	CD
10_1101-2021_01_07_425723	401	2	,	,	,
10_1101-2021_01_07_425723	401	3	highlighting	highlight	VBG
10_1101-2021_01_07_425723	401	4	differentially	differentially	RB
10_1101-2021_01_07_425723	401	5	expressed	express	VBN
10_1101-2021_01_07_425723	401	6	genes	gene	NNS
10_1101-2021_01_07_425723	401	7	found	find	VBN
10_1101-2021_01_07_425723	401	8	in	in	IN
10_1101-2021_01_07_425723	401	9	a	a	DT
10_1101-2021_01_07_425723	401	10	previous	previous	JJ
10_1101-2021_01_07_425723	401	11	study51	study51	NNS
10_1101-2021_01_07_425723	401	12	.	.	.
10_1101-2021_01_07_425723	402	1	DGE	DGE	NNP
10_1101-2021_01_07_425723	402	2	and	and	CC
10_1101-2021_01_07_425723	402	3	GSA	GSA	NNP
10_1101-2021_01_07_425723	402	4	were	be	VBD
10_1101-2021_01_07_425723	402	5	608	608	CD
10_1101-2021_01_07_425723	402	6	performed	perform	VBN
10_1101-2021_01_07_425723	402	7	using	use	VBG
10_1101-2021_01_07_425723	402	8	R	r	NN
10_1101-2021_01_07_425723	402	9	(	(	-LRB-
10_1101-2021_01_07_425723	402	10	v4.0.2)82	v4.0.2)82	NN
10_1101-2021_01_07_425723	402	11	.	.	.
10_1101-2021_01_07_425723	403	1	609	609	CD
10_1101-2021_01_07_425723	403	2	Anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	403	3	growth	growth	NN
10_1101-2021_01_07_425723	403	4	experiments	experiment	NNS
10_1101-2021_01_07_425723	403	5	610	610	CD
10_1101-2021_01_07_425723	403	6	Anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	403	7	shake	shake	NN
10_1101-2021_01_07_425723	403	8	-	-	HYPH
10_1101-2021_01_07_425723	403	9	flask	flask	NN
10_1101-2021_01_07_425723	403	10	experiments	experiment	NNS
10_1101-2021_01_07_425723	403	11	were	be	VBD
10_1101-2021_01_07_425723	403	12	performed	perform	VBN
10_1101-2021_01_07_425723	403	13	in	in	IN
10_1101-2021_01_07_425723	403	14	a	a	DT
10_1101-2021_01_07_425723	403	15	Bactron	Bactron	NNP
10_1101-2021_01_07_425723	403	16	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	403	17	workstation	workstation	NN
10_1101-2021_01_07_425723	403	18	(	(	-LRB-
10_1101-2021_01_07_425723	403	19	BACTRON300	BACTRON300	NNP
10_1101-2021_01_07_425723	403	20	-	-	HYPH
10_1101-2021_01_07_425723	403	21	611	611	CD
10_1101-2021_01_07_425723	403	22	2	2	CD
10_1101-2021_01_07_425723	403	23	,	,	,
10_1101-2021_01_07_425723	403	24	Sheldon	Sheldon	NNP
10_1101-2021_01_07_425723	403	25	Manufacturing	Manufacturing	NNP
10_1101-2021_01_07_425723	403	26	,	,	,
10_1101-2021_01_07_425723	403	27	Cornelius	Cornelius	NNP
10_1101-2021_01_07_425723	403	28	,	,	,
10_1101-2021_01_07_425723	403	29	OR	or	CC
10_1101-2021_01_07_425723	403	30	)	)	-RRB-
10_1101-2021_01_07_425723	403	31	at	at	IN
10_1101-2021_01_07_425723	403	32	30	30	CD
10_1101-2021_01_07_425723	403	33	°	°	,
10_1101-2021_01_07_425723	403	34	C	C	NNP
10_1101-2021_01_07_425723	403	35	.	.	.
10_1101-2021_01_07_425723	404	1	The	the	DT
10_1101-2021_01_07_425723	404	2	gas	gas	NN
10_1101-2021_01_07_425723	404	3	atmosphere	atmosphere	NN
10_1101-2021_01_07_425723	404	4	consisted	consist	VBD
10_1101-2021_01_07_425723	404	5	of	of	IN
10_1101-2021_01_07_425723	404	6	85	85	CD
10_1101-2021_01_07_425723	404	7	%	%	NN
10_1101-2021_01_07_425723	404	8	N2	N2	NNP
10_1101-2021_01_07_425723	404	9	,	,	,
10_1101-2021_01_07_425723	404	10	10	10	CD
10_1101-2021_01_07_425723	404	11	%	%	NN
10_1101-2021_01_07_425723	404	12	CO2	CO2	NNP
10_1101-2021_01_07_425723	404	13	612	612	CD
10_1101-2021_01_07_425723	404	14	and	and	CC
10_1101-2021_01_07_425723	404	15	5	5	CD
10_1101-2021_01_07_425723	404	16	%	%	NN
10_1101-2021_01_07_425723	404	17	H2	h2	NN
10_1101-2021_01_07_425723	404	18	and	and	CC
10_1101-2021_01_07_425723	404	19	was	be	VBD
10_1101-2021_01_07_425723	404	20	maintained	maintain	VBN
10_1101-2021_01_07_425723	404	21	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	404	22	by	by	IN
10_1101-2021_01_07_425723	404	23	a	a	DT
10_1101-2021_01_07_425723	404	24	Pd	Pd	NNP
10_1101-2021_01_07_425723	404	25	catalyst	catalyst	NN
10_1101-2021_01_07_425723	404	26	.	.	.
10_1101-2021_01_07_425723	405	1	The	the	DT
10_1101-2021_01_07_425723	405	2	catalyst	catalyst	NN
10_1101-2021_01_07_425723	405	3	was	be	VBD
10_1101-2021_01_07_425723	405	4	re	re	VBN
10_1101-2021_01_07_425723	405	5	-	-	VBN
10_1101-2021_01_07_425723	405	6	generated	generate	VBN
10_1101-2021_01_07_425723	405	7	by	by	IN
10_1101-2021_01_07_425723	405	8	heating	heating	NN
10_1101-2021_01_07_425723	405	9	till	till	IN
10_1101-2021_01_07_425723	405	10	613	613	CD
10_1101-2021_01_07_425723	405	11	160	160	CD
10_1101-2021_01_07_425723	405	12	°	°	,
10_1101-2021_01_07_425723	405	13	C	c	NN
10_1101-2021_01_07_425723	405	14	every	every	DT
10_1101-2021_01_07_425723	405	15	week	week	NN
10_1101-2021_01_07_425723	405	16	and	and	CC
10_1101-2021_01_07_425723	405	17	interchanged	interchange	VBN
10_1101-2021_01_07_425723	405	18	by	by	IN
10_1101-2021_01_07_425723	405	19	placing	place	VBG
10_1101-2021_01_07_425723	405	20	it	-PRON-	PRP
10_1101-2021_01_07_425723	405	21	in	in	IN
10_1101-2021_01_07_425723	405	22	the	the	DT
10_1101-2021_01_07_425723	405	23	airlock	airlock	NN
10_1101-2021_01_07_425723	405	24	whenever	whenever	WRB
10_1101-2021_01_07_425723	405	25	the	the	DT
10_1101-2021_01_07_425723	405	26	pass	pass	NN
10_1101-2021_01_07_425723	405	27	-	-	HYPH
10_1101-2021_01_07_425723	405	28	box	box	NN
10_1101-2021_01_07_425723	405	29	was	be	VBD
10_1101-2021_01_07_425723	405	30	used	use	VBN
10_1101-2021_01_07_425723	405	31	.	.	.
10_1101-2021_01_07_425723	406	1	50-mL	50-ml	RB
10_1101-2021_01_07_425723	406	2	614	614	CD
10_1101-2021_01_07_425723	406	3	Shake	shake	NN
10_1101-2021_01_07_425723	406	4	flasks	flask	NNS
10_1101-2021_01_07_425723	406	5	were	be	VBD
10_1101-2021_01_07_425723	406	6	filled	fill	VBN
10_1101-2021_01_07_425723	406	7	with	with	IN
10_1101-2021_01_07_425723	406	8	40	40	CD
10_1101-2021_01_07_425723	406	9	mL	ml	NN
10_1101-2021_01_07_425723	406	10	(	(	-LRB-
10_1101-2021_01_07_425723	406	11	80	80	CD
10_1101-2021_01_07_425723	406	12	%	%	NN
10_1101-2021_01_07_425723	406	13	volumetric	volumetric	NN
10_1101-2021_01_07_425723	406	14	)	)	-RRB-
10_1101-2021_01_07_425723	406	15	media	medium	NNS
10_1101-2021_01_07_425723	406	16	and	and	CC
10_1101-2021_01_07_425723	406	17	placed	place	VBN
10_1101-2021_01_07_425723	406	18	on	on	IN
10_1101-2021_01_07_425723	406	19	an	an	DT
10_1101-2021_01_07_425723	406	20	orbital	orbital	JJ
10_1101-2021_01_07_425723	406	21	shaker	shaker	NN
10_1101-2021_01_07_425723	406	22	(	(	-LRB-
10_1101-2021_01_07_425723	406	23	KS	KS	NNP
10_1101-2021_01_07_425723	406	24	130	130	CD
10_1101-2021_01_07_425723	406	25	615	615	CD
10_1101-2021_01_07_425723	406	26	basic	basic	JJ
10_1101-2021_01_07_425723	406	27	,	,	,
10_1101-2021_01_07_425723	406	28	IKA	IKA	NNP
10_1101-2021_01_07_425723	406	29	,	,	,
10_1101-2021_01_07_425723	406	30	Staufen	Staufen	NNP
10_1101-2021_01_07_425723	406	31	,	,	,
10_1101-2021_01_07_425723	406	32	Germany	Germany	NNP
10_1101-2021_01_07_425723	406	33	)	)	-RRB-
10_1101-2021_01_07_425723	406	34	set	set	VBD
10_1101-2021_01_07_425723	406	35	at	at	IN
10_1101-2021_01_07_425723	406	36	240	240	CD
10_1101-2021_01_07_425723	406	37	rpm	rpm	NN
10_1101-2021_01_07_425723	406	38	inside	inside	IN
10_1101-2021_01_07_425723	406	39	the	the	DT
10_1101-2021_01_07_425723	406	40	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	406	41	chamber	chamber	NN
10_1101-2021_01_07_425723	406	42	.	.	.
10_1101-2021_01_07_425723	407	1	Sterile	sterile	JJ
10_1101-2021_01_07_425723	407	2	growth	growth	NN
10_1101-2021_01_07_425723	407	3	media	medium	NNS
10_1101-2021_01_07_425723	407	4	was	be	VBD
10_1101-2021_01_07_425723	407	5	616	616	CD
10_1101-2021_01_07_425723	407	6	placed	place	VBN
10_1101-2021_01_07_425723	407	7	inside	inside	IN
10_1101-2021_01_07_425723	407	8	the	the	DT
10_1101-2021_01_07_425723	407	9	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	407	10	chamber	chamber	NNP
10_1101-2021_01_07_425723	407	11	24	24	CD
10_1101-2021_01_07_425723	407	12	h	h	NNS
10_1101-2021_01_07_425723	407	13	prior	prior	RB
10_1101-2021_01_07_425723	407	14	to	to	IN
10_1101-2021_01_07_425723	407	15	inoculation	inoculation	NN
10_1101-2021_01_07_425723	407	16	to	to	TO
10_1101-2021_01_07_425723	407	17	ensure	ensure	VB
10_1101-2021_01_07_425723	407	18	complete	complete	JJ
10_1101-2021_01_07_425723	407	19	removal	removal	NN
10_1101-2021_01_07_425723	407	20	of	of	IN
10_1101-2021_01_07_425723	407	21	traces	trace	NNS
10_1101-2021_01_07_425723	407	22	of	of	IN
10_1101-2021_01_07_425723	407	23	617	617	CD
10_1101-2021_01_07_425723	407	24	oxygen	oxygen	NN
10_1101-2021_01_07_425723	407	25	.	.	.
10_1101-2021_01_07_425723	408	1	618	618	CD
10_1101-2021_01_07_425723	408	2	The	the	DT
10_1101-2021_01_07_425723	408	3	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	408	4	growth	growth	NN
10_1101-2021_01_07_425723	408	5	ability	ability	NN
10_1101-2021_01_07_425723	408	6	of	of	IN
10_1101-2021_01_07_425723	408	7	the	the	DT
10_1101-2021_01_07_425723	408	8	yeast	yeast	NN
10_1101-2021_01_07_425723	408	9	strains	strain	NNS
10_1101-2021_01_07_425723	408	10	was	be	VBD
10_1101-2021_01_07_425723	408	11	tested	test	VBN
10_1101-2021_01_07_425723	408	12	on	on	IN
10_1101-2021_01_07_425723	408	13	SMG	SMG	NNP
10_1101-2021_01_07_425723	408	14	-	-	HYPH
10_1101-2021_01_07_425723	408	15	urea	urea	NNP
10_1101-2021_01_07_425723	408	16	with	with	IN
10_1101-2021_01_07_425723	408	17	50	50	CD
10_1101-2021_01_07_425723	408	18	g·L-1	g·l-1	CD
10_1101-2021_01_07_425723	408	19	glucose	glucose	NN
10_1101-2021_01_07_425723	408	20	at	at	IN
10_1101-2021_01_07_425723	408	21	pH	pH	NNP
10_1101-2021_01_07_425723	408	22	6.0	6.0	CD
10_1101-2021_01_07_425723	408	23	619	619	CD
10_1101-2021_01_07_425723	408	24	with	with	IN
10_1101-2021_01_07_425723	408	25	Tween	Tween	NNP
10_1101-2021_01_07_425723	408	26	80	80	CD
10_1101-2021_01_07_425723	408	27	prepared	prepare	VBD
10_1101-2021_01_07_425723	408	28	as	as	IN
10_1101-2021_01_07_425723	408	29	described	describe	VBN
10_1101-2021_01_07_425723	408	30	earlier	early	RBR
10_1101-2021_01_07_425723	408	31	.	.	.
10_1101-2021_01_07_425723	409	1	The	the	DT
10_1101-2021_01_07_425723	409	2	growth	growth	NN
10_1101-2021_01_07_425723	409	3	experiments	experiment	NNS
10_1101-2021_01_07_425723	409	4	were	be	VBD
10_1101-2021_01_07_425723	409	5	started	start	VBN
10_1101-2021_01_07_425723	409	6	from	from	IN
10_1101-2021_01_07_425723	409	7	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	409	8	pre-620	pre-620	NN
10_1101-2021_01_07_425723	409	9	cultures	culture	NNS
10_1101-2021_01_07_425723	409	10	on	on	IN
10_1101-2021_01_07_425723	409	11	SMG	SMG	NNP
10_1101-2021_01_07_425723	409	12	-	-	HYPH
10_1101-2021_01_07_425723	409	13	urea	urea	NNP
10_1101-2021_01_07_425723	409	14	media	medium	NNS
10_1101-2021_01_07_425723	409	15	and	and	CC
10_1101-2021_01_07_425723	409	16	the	the	DT
10_1101-2021_01_07_425723	409	17	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	409	18	shake	shake	NN
10_1101-2021_01_07_425723	409	19	flasks	flask	NNS
10_1101-2021_01_07_425723	409	20	were	be	VBD
10_1101-2021_01_07_425723	409	21	inoculated	inoculate	VBN
10_1101-2021_01_07_425723	409	22	at	at	IN
10_1101-2021_01_07_425723	409	23	an	an	DT
10_1101-2021_01_07_425723	409	24	OD660	od660	NN
10_1101-2021_01_07_425723	409	25	of	of	IN
10_1101-2021_01_07_425723	409	26	0.2	0.2	CD
10_1101-2021_01_07_425723	409	27	621	621	CD
10_1101-2021_01_07_425723	409	28	(	(	-LRB-
10_1101-2021_01_07_425723	409	29	corresponding	correspond	VBG
10_1101-2021_01_07_425723	409	30	to	to	IN
10_1101-2021_01_07_425723	409	31	an	an	DT
10_1101-2021_01_07_425723	409	32	OD600	od600	NN
10_1101-2021_01_07_425723	409	33	of	of	IN
10_1101-2021_01_07_425723	409	34	0.14	0.14	CD
10_1101-2021_01_07_425723	409	35	)	)	-RRB-
10_1101-2021_01_07_425723	409	36	.	.	.
10_1101-2021_01_07_425723	410	1	In	in	IN
10_1101-2021_01_07_425723	410	2	order	order	NN
10_1101-2021_01_07_425723	410	3	to	to	TO
10_1101-2021_01_07_425723	410	4	minimize	minimize	VB
10_1101-2021_01_07_425723	410	5	opening	open	VBG
10_1101-2021_01_07_425723	410	6	the	the	DT
10_1101-2021_01_07_425723	410	7	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	410	8	chamber	chamber	NN
10_1101-2021_01_07_425723	410	9	,	,	,
10_1101-2021_01_07_425723	410	10	culture	culture	NN
10_1101-2021_01_07_425723	410	11	622	622	CD
10_1101-2021_01_07_425723	410	12	growth	growth	NN
10_1101-2021_01_07_425723	410	13	was	be	VBD
10_1101-2021_01_07_425723	410	14	monitored	monitor	VBN
10_1101-2021_01_07_425723	410	15	by	by	IN
10_1101-2021_01_07_425723	410	16	optical	optical	JJ
10_1101-2021_01_07_425723	410	17	density	density	NN
10_1101-2021_01_07_425723	410	18	measurements	measurement	NNS
10_1101-2021_01_07_425723	410	19	inside	inside	IN
10_1101-2021_01_07_425723	410	20	the	the	DT
10_1101-2021_01_07_425723	410	21	chamber	chamber	NN
10_1101-2021_01_07_425723	410	22	using	use	VBG
10_1101-2021_01_07_425723	410	23	an	an	DT
10_1101-2021_01_07_425723	410	24	Ultrospec	Ultrospec	NNP
10_1101-2021_01_07_425723	410	25	10	10	CD
10_1101-2021_01_07_425723	410	26	cell	cell	NN
10_1101-2021_01_07_425723	410	27	623	623	CD
10_1101-2021_01_07_425723	410	28	density	density	NN
10_1101-2021_01_07_425723	410	29	meter	meter	NN
10_1101-2021_01_07_425723	410	30	(	(	-LRB-
10_1101-2021_01_07_425723	410	31	Biochrom	Biochrom	NNP
10_1101-2021_01_07_425723	410	32	,	,	,
10_1101-2021_01_07_425723	410	33	Cambridge	Cambridge	NNP
10_1101-2021_01_07_425723	410	34	,	,	,
10_1101-2021_01_07_425723	410	35	UK	UK	NNP
10_1101-2021_01_07_425723	410	36	)	)	-RRB-
10_1101-2021_01_07_425723	410	37	at	at	IN
10_1101-2021_01_07_425723	410	38	a	a	DT
10_1101-2021_01_07_425723	410	39	600	600	CD
10_1101-2021_01_07_425723	410	40	nm	nm	CD
10_1101-2021_01_07_425723	410	41	wavelength	wavelength	NN
10_1101-2021_01_07_425723	410	42	.	.	.
10_1101-2021_01_07_425723	411	1	When	when	WRB
10_1101-2021_01_07_425723	411	2	the	the	DT
10_1101-2021_01_07_425723	411	3	optical	optical	JJ
10_1101-2021_01_07_425723	411	4	density	density	NN
10_1101-2021_01_07_425723	411	5	of	of	IN
10_1101-2021_01_07_425723	411	6	culture	culture	NN
10_1101-2021_01_07_425723	411	7	624	624	CD
10_1101-2021_01_07_425723	411	8	no	no	RB
10_1101-2021_01_07_425723	411	9	longer	long	RBR
10_1101-2021_01_07_425723	411	10	increased	increase	VBD
10_1101-2021_01_07_425723	411	11	or	or	CC
10_1101-2021_01_07_425723	411	12	decreased	decrease	VBD
10_1101-2021_01_07_425723	411	13	new	new	JJ
10_1101-2021_01_07_425723	411	14	shake	shake	NN
10_1101-2021_01_07_425723	411	15	-	-	HYPH
10_1101-2021_01_07_425723	411	16	flask	flask	NN
10_1101-2021_01_07_425723	411	17	cultures	culture	NNS
10_1101-2021_01_07_425723	411	18	were	be	VBD
10_1101-2021_01_07_425723	411	19	inoculated	inoculate	VBN
10_1101-2021_01_07_425723	411	20	by	by	IN
10_1101-2021_01_07_425723	411	21	serial	serial	JJ
10_1101-2021_01_07_425723	411	22	transfer	transfer	NN
10_1101-2021_01_07_425723	411	23	at	at	IN
10_1101-2021_01_07_425723	411	24	an	an	DT
10_1101-2021_01_07_425723	411	25	initial	initial	JJ
10_1101-2021_01_07_425723	411	26	625	625	CD
10_1101-2021_01_07_425723	411	27	OD600	od600	NN
10_1101-2021_01_07_425723	411	28	of	of	IN
10_1101-2021_01_07_425723	411	29	0.2	0.2	CD
10_1101-2021_01_07_425723	411	30	.	.	.
10_1101-2021_01_07_425723	412	1	626	626	CD
10_1101-2021_01_07_425723	412	2	Laboratory	laboratory	NN
10_1101-2021_01_07_425723	412	3	evolution	evolution	NN
10_1101-2021_01_07_425723	412	4	in	in	IN
10_1101-2021_01_07_425723	412	5	low	low	JJ
10_1101-2021_01_07_425723	412	6	oxygen	oxygen	NN
10_1101-2021_01_07_425723	412	7	atmosphere	atmosphere	NN
10_1101-2021_01_07_425723	412	8	627	627	CD
10_1101-2021_01_07_425723	412	9	Adaptive	adaptive	JJ
10_1101-2021_01_07_425723	412	10	laboratory	laboratory	NN
10_1101-2021_01_07_425723	412	11	evolution	evolution	NN
10_1101-2021_01_07_425723	412	12	for	for	IN
10_1101-2021_01_07_425723	412	13	strict	strict	JJ
10_1101-2021_01_07_425723	412	14	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	412	15	growth	growth	NN
10_1101-2021_01_07_425723	412	16	was	be	VBD
10_1101-2021_01_07_425723	412	17	performed	perform	VBN
10_1101-2021_01_07_425723	412	18	in	in	IN
10_1101-2021_01_07_425723	412	19	a	a	DT
10_1101-2021_01_07_425723	412	20	Bactron	Bactron	NNP
10_1101-2021_01_07_425723	412	21	anaerobic	anaerobic	NN
10_1101-2021_01_07_425723	412	22	628	628	CD
10_1101-2021_01_07_425723	412	23	workstation	workstation	NN
10_1101-2021_01_07_425723	412	24	(	(	-LRB-
10_1101-2021_01_07_425723	412	25	BACTRON	BACTRON	NNP
10_1101-2021_01_07_425723	412	26	BAC	BAC	NNP
10_1101-2021_01_07_425723	412	27	-	-	HYPH
10_1101-2021_01_07_425723	412	28	X-2E	X-2E	NNP
10_1101-2021_01_07_425723	412	29	,	,	,
10_1101-2021_01_07_425723	412	30	Sheldon	Sheldon	NNP
10_1101-2021_01_07_425723	412	31	Manufacturing	Manufacturing	NNP
10_1101-2021_01_07_425723	412	32	)	)	-RRB-
10_1101-2021_01_07_425723	412	33	at	at	IN
10_1101-2021_01_07_425723	412	34	30	30	CD
10_1101-2021_01_07_425723	412	35	°	°	,
10_1101-2021_01_07_425723	412	36	C	C	NNP
10_1101-2021_01_07_425723	412	37	.	.	.
10_1101-2021_01_07_425723	413	1	50-mL	50-ml	JJ
10_1101-2021_01_07_425723	413	2	Shake	shake	NN
10_1101-2021_01_07_425723	413	3	flasks	flask	NNS
10_1101-2021_01_07_425723	413	4	were	be	VBD
10_1101-2021_01_07_425723	413	5	filled	fill	VBN
10_1101-2021_01_07_425723	413	6	with	with	IN
10_1101-2021_01_07_425723	413	7	629	629	CD
10_1101-2021_01_07_425723	413	8	.CC	.CC	,
10_1101-2021_01_07_425723	413	9	-	-	HYPH
10_1101-2021_01_07_425723	413	10	BY	by	IN
10_1101-2021_01_07_425723	413	11	-	-	HYPH
10_1101-2021_01_07_425723	413	12	NC	NC	NNP
10_1101-2021_01_07_425723	413	13	-	-	HYPH
10_1101-2021_01_07_425723	413	14	ND	ND	NNP
10_1101-2021_01_07_425723	413	15	4.0	4.0	CD
10_1101-2021_01_07_425723	413	16	International	International	NNP
10_1101-2021_01_07_425723	413	17	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	413	18	under	under	IN
10_1101-2021_01_07_425723	413	19	a	a	DT
10_1101-2021_01_07_425723	413	20	(	(	-LRB-
10_1101-2021_01_07_425723	413	21	which	which	WDT
10_1101-2021_01_07_425723	413	22	was	be	VBD
10_1101-2021_01_07_425723	413	23	not	not	RB
10_1101-2021_01_07_425723	413	24	certified	certify	VBN
10_1101-2021_01_07_425723	413	25	by	by	IN
10_1101-2021_01_07_425723	413	26	peer	peer	NN
10_1101-2021_01_07_425723	413	27	review	review	NN
10_1101-2021_01_07_425723	413	28	)	)	-RRB-
10_1101-2021_01_07_425723	413	29	is	be	VBZ
10_1101-2021_01_07_425723	413	30	the	the	DT
10_1101-2021_01_07_425723	413	31	author	author	NN
10_1101-2021_01_07_425723	413	32	/	/	SYM
10_1101-2021_01_07_425723	413	33	funder	funder	NN
10_1101-2021_01_07_425723	413	34	,	,	,
10_1101-2021_01_07_425723	413	35	who	who	WP
10_1101-2021_01_07_425723	413	36	has	have	VBZ
10_1101-2021_01_07_425723	413	37	granted	grant	VBN
10_1101-2021_01_07_425723	413	38	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	413	39	a	a	DT
10_1101-2021_01_07_425723	413	40	license	license	NN
10_1101-2021_01_07_425723	413	41	to	to	TO
10_1101-2021_01_07_425723	413	42	display	display	VB
10_1101-2021_01_07_425723	413	43	the	the	DT
10_1101-2021_01_07_425723	413	44	preprint	preprint	NN
10_1101-2021_01_07_425723	413	45	in	in	IN
10_1101-2021_01_07_425723	413	46	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	413	47	.	.	.
10_1101-2021_01_07_425723	414	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	414	2	is	be	VBZ
10_1101-2021_01_07_425723	414	3	made	make	VBN
10_1101-2021_01_07_425723	414	4	The	the	DT
10_1101-2021_01_07_425723	414	5	copyright	copyright	NN
10_1101-2021_01_07_425723	414	6	holder	holder	NN
10_1101-2021_01_07_425723	414	7	for	for	IN
10_1101-2021_01_07_425723	414	8	this	this	DT
10_1101-2021_01_07_425723	414	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	414	10	version	version	NN
10_1101-2021_01_07_425723	414	11	posted	post	VBD
10_1101-2021_01_07_425723	414	12	January	January	NNP
10_1101-2021_01_07_425723	414	13	8	8	CD
10_1101-2021_01_07_425723	414	14	,	,	,
10_1101-2021_01_07_425723	414	15	2021	2021	CD
10_1101-2021_01_07_425723	414	16	.	.	.
10_1101-2021_01_07_425723	414	17	;	;	:
10_1101-2021_01_07_425723	414	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	414	19	:	:	:
10_1101-2021_01_07_425723	414	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	414	21	preprint	preprint	NN
10_1101-2021_01_07_425723	414	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	414	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	414	24	36	36	CD
10_1101-2021_01_07_425723	414	25	40	40	CD
10_1101-2021_01_07_425723	414	26	mL	mL	NNP
10_1101-2021_01_07_425723	414	27	SMG	SMG	NNP
10_1101-2021_01_07_425723	414	28	-	-	HYPH
10_1101-2021_01_07_425723	414	29	urea	urea	NNP
10_1101-2021_01_07_425723	414	30	with	with	IN
10_1101-2021_01_07_425723	414	31	50	50	CD
10_1101-2021_01_07_425723	414	32	g·L-1	g·l-1	CD
10_1101-2021_01_07_425723	414	33	glucose	glucose	NN
10_1101-2021_01_07_425723	414	34	and	and	CC
10_1101-2021_01_07_425723	414	35	including	include	VBG
10_1101-2021_01_07_425723	414	36	420	420	CD
10_1101-2021_01_07_425723	414	37	mg·L-1	mg·l-1	NN
10_1101-2021_01_07_425723	414	38	Tween	Tween	NNP
10_1101-2021_01_07_425723	414	39	80	80	CD
10_1101-2021_01_07_425723	414	40	.	.	.
10_1101-2021_01_07_425723	415	1	Subsequently	subsequently	RB
10_1101-2021_01_07_425723	415	2	the	the	DT
10_1101-2021_01_07_425723	415	3	shake	shake	NN
10_1101-2021_01_07_425723	415	4	-	-	HYPH
10_1101-2021_01_07_425723	415	5	flask	flask	NN
10_1101-2021_01_07_425723	415	6	630	630	CD
10_1101-2021_01_07_425723	415	7	media	medium	NNS
10_1101-2021_01_07_425723	415	8	were	be	VBD
10_1101-2021_01_07_425723	415	9	inoculated	inoculate	VBN
10_1101-2021_01_07_425723	415	10	with	with	IN
10_1101-2021_01_07_425723	415	11	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	415	12	from	from	IN
10_1101-2021_01_07_425723	415	13	glycerol	glycerol	NNP
10_1101-2021_01_07_425723	415	14	cryo	cryo	NN
10_1101-2021_01_07_425723	415	15	-	-	HYPH
10_1101-2021_01_07_425723	415	16	stock	stock	NN
10_1101-2021_01_07_425723	415	17	at	at	IN
10_1101-2021_01_07_425723	415	18	OD660	od660	NN
10_1101-2021_01_07_425723	415	19	<	<	XX
10_1101-2021_01_07_425723	415	20	0.01	0.01	XX
10_1101-2021_01_07_425723	415	21	and	and	CC
10_1101-2021_01_07_425723	415	22	thereafter	thereafter	RB
10_1101-2021_01_07_425723	415	23	placed	place	VBD
10_1101-2021_01_07_425723	415	24	631	631	CD
10_1101-2021_01_07_425723	415	25	inside	inside	IN
10_1101-2021_01_07_425723	415	26	the	the	DT
10_1101-2021_01_07_425723	415	27	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	415	28	chamber	chamber	NN
10_1101-2021_01_07_425723	415	29	.	.	.
10_1101-2021_01_07_425723	416	1	Due	due	IN
10_1101-2021_01_07_425723	416	2	to	to	IN
10_1101-2021_01_07_425723	416	3	frequent	frequent	JJ
10_1101-2021_01_07_425723	416	4	opening	opening	NN
10_1101-2021_01_07_425723	416	5	of	of	IN
10_1101-2021_01_07_425723	416	6	the	the	DT
10_1101-2021_01_07_425723	416	7	pass	pass	NN
10_1101-2021_01_07_425723	416	8	-	-	HYPH
10_1101-2021_01_07_425723	416	9	box	box	NN
10_1101-2021_01_07_425723	416	10	and	and	CC
10_1101-2021_01_07_425723	416	11	lack	lack	NN
10_1101-2021_01_07_425723	416	12	of	of	IN
10_1101-2021_01_07_425723	416	13	catalyst	catalyst	NN
10_1101-2021_01_07_425723	416	14	inside	inside	IN
10_1101-2021_01_07_425723	416	15	the	the	DT
10_1101-2021_01_07_425723	416	16	632	632	CD
10_1101-2021_01_07_425723	416	17	pass	pass	NN
10_1101-2021_01_07_425723	416	18	-	-	HYPH
10_1101-2021_01_07_425723	416	19	box	box	NN
10_1101-2021_01_07_425723	416	20	oxygen	oxygen	NN
10_1101-2021_01_07_425723	416	21	entry	entry	NN
10_1101-2021_01_07_425723	416	22	was	be	VBD
10_1101-2021_01_07_425723	416	23	more	more	RBR
10_1101-2021_01_07_425723	416	24	permissive	permissive	JJ
10_1101-2021_01_07_425723	416	25	.	.	.
10_1101-2021_01_07_425723	417	1	After	after	IN
10_1101-2021_01_07_425723	417	2	the	the	DT
10_1101-2021_01_07_425723	417	3	optical	optical	JJ
10_1101-2021_01_07_425723	417	4	density	density	NN
10_1101-2021_01_07_425723	417	5	of	of	IN
10_1101-2021_01_07_425723	417	6	the	the	DT
10_1101-2021_01_07_425723	417	7	cultures	culture	NNS
10_1101-2021_01_07_425723	417	8	no	no	RB
10_1101-2021_01_07_425723	417	9	longer	long	RBR
10_1101-2021_01_07_425723	417	10	633	633	CD
10_1101-2021_01_07_425723	417	11	increased	increase	VBD
10_1101-2021_01_07_425723	417	12	,	,	,
10_1101-2021_01_07_425723	417	13	cultures	culture	NNS
10_1101-2021_01_07_425723	417	14	were	be	VBD
10_1101-2021_01_07_425723	417	15	transferred	transfer	VBN
10_1101-2021_01_07_425723	417	16	to	to	IN
10_1101-2021_01_07_425723	417	17	new	new	JJ
10_1101-2021_01_07_425723	417	18	media	medium	NNS
10_1101-2021_01_07_425723	417	19	by	by	IN
10_1101-2021_01_07_425723	417	20	40	40	CD
10_1101-2021_01_07_425723	417	21	-	-	HYPH
10_1101-2021_01_07_425723	417	22	50x	50x	NNS
10_1101-2021_01_07_425723	417	23	serial	serial	JJ
10_1101-2021_01_07_425723	417	24	dilution	dilution	NN
10_1101-2021_01_07_425723	417	25	.	.	.
10_1101-2021_01_07_425723	418	1	For	for	IN
10_1101-2021_01_07_425723	418	2	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	418	3	,	,	,
10_1101-2021_01_07_425723	418	4	IMS1112	IMS1112	NNP
10_1101-2021_01_07_425723	418	5	,	,	,
10_1101-2021_01_07_425723	418	6	634	634	CD
10_1101-2021_01_07_425723	418	7	IMS1113	ims1113	NN
10_1101-2021_01_07_425723	418	8	three	three	CD
10_1101-2021_01_07_425723	418	9	and	and	CC
10_1101-2021_01_07_425723	418	10	for	for	IN
10_1101-2021_01_07_425723	418	11	IMS1131	IMS1131	NNP
10_1101-2021_01_07_425723	418	12	,	,	,
10_1101-2021_01_07_425723	418	13	IMS1132	IMS1132	NNP
10_1101-2021_01_07_425723	418	14	,	,	,
10_1101-2021_01_07_425723	418	15	IMS1133	IMS1133	NNP
10_1101-2021_01_07_425723	418	16	four	four	CD
10_1101-2021_01_07_425723	418	17	serial	serial	JJ
10_1101-2021_01_07_425723	418	18	transfers	transfer	NNS
10_1101-2021_01_07_425723	418	19	in	in	IN
10_1101-2021_01_07_425723	418	20	shake	shake	NN
10_1101-2021_01_07_425723	418	21	-	-	HYPH
10_1101-2021_01_07_425723	418	22	flask	flask	NN
10_1101-2021_01_07_425723	418	23	media	medium	NNS
10_1101-2021_01_07_425723	418	24	were	be	VBD
10_1101-2021_01_07_425723	418	25	635	635	CD
10_1101-2021_01_07_425723	418	26	performed	perform	VBN
10_1101-2021_01_07_425723	418	27	after	after	IN
10_1101-2021_01_07_425723	418	28	which	which	WDT
10_1101-2021_01_07_425723	418	29	single	single	JJ
10_1101-2021_01_07_425723	418	30	colony	colony	NN
10_1101-2021_01_07_425723	418	31	isolates	isolate	NNS
10_1101-2021_01_07_425723	418	32	were	be	VBD
10_1101-2021_01_07_425723	418	33	made	make	VBN
10_1101-2021_01_07_425723	418	34	by	by	IN
10_1101-2021_01_07_425723	418	35	plating	plate	VBG
10_1101-2021_01_07_425723	418	36	on	on	IN
10_1101-2021_01_07_425723	418	37	YPD	YPD	NNP
10_1101-2021_01_07_425723	418	38	agar	agar	NN
10_1101-2021_01_07_425723	418	39	media	medium	NNS
10_1101-2021_01_07_425723	418	40	with	with	IN
10_1101-2021_01_07_425723	418	41	hygromycin	hygromycin	NNP
10_1101-2021_01_07_425723	418	42	636	636	CD
10_1101-2021_01_07_425723	418	43	antibiotic	antibiotic	JJ
10_1101-2021_01_07_425723	418	44	at	at	IN
10_1101-2021_01_07_425723	418	45	30	30	CD
10_1101-2021_01_07_425723	418	46	°	°	,
10_1101-2021_01_07_425723	418	47	C	C	NNP
10_1101-2021_01_07_425723	418	48	aerobically	aerobically	RB
10_1101-2021_01_07_425723	418	49	.	.	.
10_1101-2021_01_07_425723	419	1	Single	single	JJ
10_1101-2021_01_07_425723	419	2	colony	colony	NN
10_1101-2021_01_07_425723	419	3	isolates	isolate	NNS
10_1101-2021_01_07_425723	419	4	were	be	VBD
10_1101-2021_01_07_425723	419	5	subsequently	subsequently	RB
10_1101-2021_01_07_425723	419	6	restreaked	restreake	VBN
10_1101-2021_01_07_425723	419	7	sequentially	sequentially	RB
10_1101-2021_01_07_425723	419	8	for	for	IN
10_1101-2021_01_07_425723	419	9	637	637	CD
10_1101-2021_01_07_425723	419	10	three	three	CD
10_1101-2021_01_07_425723	419	11	times	time	NNS
10_1101-2021_01_07_425723	419	12	on	on	IN
10_1101-2021_01_07_425723	419	13	the	the	DT
10_1101-2021_01_07_425723	419	14	same	same	JJ
10_1101-2021_01_07_425723	419	15	media	medium	NNS
10_1101-2021_01_07_425723	419	16	before	before	IN
10_1101-2021_01_07_425723	419	17	the	the	DT
10_1101-2021_01_07_425723	419	18	isolates	isolate	NNS
10_1101-2021_01_07_425723	419	19	were	be	VBD
10_1101-2021_01_07_425723	419	20	propagated	propagate	VBN
10_1101-2021_01_07_425723	419	21	in	in	IN
10_1101-2021_01_07_425723	419	22	SM	SM	NNP
10_1101-2021_01_07_425723	419	23	glucose	glucose	NNP
10_1101-2021_01_07_425723	419	24	media	medium	NNS
10_1101-2021_01_07_425723	419	25	and	and	CC
10_1101-2021_01_07_425723	419	26	glycerol	glycerol	NN
10_1101-2021_01_07_425723	419	27	638	638	CD
10_1101-2021_01_07_425723	419	28	cryo	cryo	NN
10_1101-2021_01_07_425723	419	29	stocked	stock	VBN
10_1101-2021_01_07_425723	419	30	.	.	.
10_1101-2021_01_07_425723	420	1	639	639	CD
10_1101-2021_01_07_425723	420	2	To	to	TO
10_1101-2021_01_07_425723	420	3	determine	determine	VB
10_1101-2021_01_07_425723	420	4	if	if	IN
10_1101-2021_01_07_425723	420	5	an	an	DT
10_1101-2021_01_07_425723	420	6	oxygen	oxygen	NN
10_1101-2021_01_07_425723	420	7	-	-	HYPH
10_1101-2021_01_07_425723	420	8	limited	limit	VBN
10_1101-2021_01_07_425723	420	9	pre	pre	JJ
10_1101-2021_01_07_425723	420	10	-	-	NN
10_1101-2021_01_07_425723	420	11	culture	culture	NN
10_1101-2021_01_07_425723	420	12	was	be	VBD
10_1101-2021_01_07_425723	420	13	required	require	VBN
10_1101-2021_01_07_425723	420	14	for	for	IN
10_1101-2021_01_07_425723	420	15	the	the	DT
10_1101-2021_01_07_425723	420	16	strict	strict	JJ
10_1101-2021_01_07_425723	420	17	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	420	18	growth	growth	NN
10_1101-2021_01_07_425723	420	19	of	of	IN
10_1101-2021_01_07_425723	420	20	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	420	21	640	640	CD
10_1101-2021_01_07_425723	420	22	strain	strain	VBP
10_1101-2021_01_07_425723	420	23	a	a	DT
10_1101-2021_01_07_425723	420	24	cross	cross	JJ
10_1101-2021_01_07_425723	420	25	-	-	JJ
10_1101-2021_01_07_425723	420	26	validation	validation	JJ
10_1101-2021_01_07_425723	420	27	experiment	experiment	NN
10_1101-2021_01_07_425723	420	28	was	be	VBD
10_1101-2021_01_07_425723	420	29	performed	perform	VBN
10_1101-2021_01_07_425723	420	30	.	.	.
10_1101-2021_01_07_425723	421	1	In	in	IN
10_1101-2021_01_07_425723	421	2	parallel	parallel	NN
10_1101-2021_01_07_425723	421	3	,	,	,
10_1101-2021_01_07_425723	421	4	yeast	yeast	NN
10_1101-2021_01_07_425723	421	5	strains	strain	NNS
10_1101-2021_01_07_425723	421	6	were	be	VBD
10_1101-2021_01_07_425723	421	7	cultivated	cultivate	VBN
10_1101-2021_01_07_425723	421	8	in	in	IN
10_1101-2021_01_07_425723	421	9	50-mL	50-ml	RB
10_1101-2021_01_07_425723	421	10	641	641	CD
10_1101-2021_01_07_425723	421	11	shake	shake	NN
10_1101-2021_01_07_425723	421	12	-	-	HYPH
10_1101-2021_01_07_425723	421	13	flask	flask	NN
10_1101-2021_01_07_425723	421	14	cultures	culture	NNS
10_1101-2021_01_07_425723	421	15	with	with	IN
10_1101-2021_01_07_425723	421	16	SMG	SMG	NNP
10_1101-2021_01_07_425723	421	17	-	-	HYPH
10_1101-2021_01_07_425723	421	18	urea	urea	NNP
10_1101-2021_01_07_425723	421	19	with	with	IN
10_1101-2021_01_07_425723	421	20	50	50	CD
10_1101-2021_01_07_425723	421	21	g·L-1	g·l-1	CD
10_1101-2021_01_07_425723	421	22	glucose	glucose	NN
10_1101-2021_01_07_425723	421	23	at	at	IN
10_1101-2021_01_07_425723	421	24	pH	pH	NNP
10_1101-2021_01_07_425723	421	25	6.0	6.0	CD
10_1101-2021_01_07_425723	421	26	with	with	IN
10_1101-2021_01_07_425723	421	27	Tween	Tween	NNP
10_1101-2021_01_07_425723	421	28	80	80	CD
10_1101-2021_01_07_425723	421	29	in	in	IN
10_1101-2021_01_07_425723	421	30	both	both	CC
10_1101-2021_01_07_425723	421	31	the	the	DT
10_1101-2021_01_07_425723	421	32	Bactron	Bactron	NNP
10_1101-2021_01_07_425723	421	33	642	642	CD
10_1101-2021_01_07_425723	421	34	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	421	35	workstation	workstation	NN
10_1101-2021_01_07_425723	421	36	(	(	-LRB-
10_1101-2021_01_07_425723	421	37	BACTRON	BACTRON	NNP
10_1101-2021_01_07_425723	421	38	BAC	BAC	NNP
10_1101-2021_01_07_425723	421	39	-	-	HYPH
10_1101-2021_01_07_425723	421	40	X-2E	X-2E	NNP
10_1101-2021_01_07_425723	421	41	,	,	,
10_1101-2021_01_07_425723	421	42	Sheldon	Sheldon	NNP
10_1101-2021_01_07_425723	421	43	Manufacturing	Manufacturing	NNP
10_1101-2021_01_07_425723	421	44	)	)	-RRB-
10_1101-2021_01_07_425723	421	45	with	with	IN
10_1101-2021_01_07_425723	421	46	low	low	JJ
10_1101-2021_01_07_425723	421	47	levels	level	NNS
10_1101-2021_01_07_425723	421	48	of	of	IN
10_1101-2021_01_07_425723	421	49	oxygen-643	oxygen-643	JJ
10_1101-2021_01_07_425723	421	50	contamination	contamination	NN
10_1101-2021_01_07_425723	421	51	,	,	,
10_1101-2021_01_07_425723	421	52	and	and	CC
10_1101-2021_01_07_425723	421	53	in	in	IN
10_1101-2021_01_07_425723	421	54	the	the	DT
10_1101-2021_01_07_425723	421	55	Bactron	Bactron	NNP
10_1101-2021_01_07_425723	421	56	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	421	57	workstation	workstation	NN
10_1101-2021_01_07_425723	421	58	(	(	-LRB-
10_1101-2021_01_07_425723	421	59	BACTRON300	BACTRON300	NNP
10_1101-2021_01_07_425723	421	60	-	-	HYPH
10_1101-2021_01_07_425723	421	61	2	2	CD
10_1101-2021_01_07_425723	421	62	,	,	,
10_1101-2021_01_07_425723	421	63	Sheldon	Sheldon	NNP
10_1101-2021_01_07_425723	421	64	Manufacturing	Manufacturing	NNP
10_1101-2021_01_07_425723	421	65	)	)	-RRB-
10_1101-2021_01_07_425723	421	66	with	with	IN
10_1101-2021_01_07_425723	421	67	644	644	CD
10_1101-2021_01_07_425723	421	68	strict	strict	JJ
10_1101-2021_01_07_425723	421	69	control	control	NN
10_1101-2021_01_07_425723	421	70	of	of	IN
10_1101-2021_01_07_425723	421	71	oxygen	oxygen	NN
10_1101-2021_01_07_425723	421	72	-	-	HYPH
10_1101-2021_01_07_425723	421	73	contamination	contamination	NN
10_1101-2021_01_07_425723	421	74	.	.	.
10_1101-2021_01_07_425723	422	1	After	after	IN
10_1101-2021_01_07_425723	422	2	stagnation	stagnation	NN
10_1101-2021_01_07_425723	422	3	of	of	IN
10_1101-2021_01_07_425723	422	4	growth	growth	NN
10_1101-2021_01_07_425723	422	5	was	be	VBD
10_1101-2021_01_07_425723	422	6	observed	observe	VBN
10_1101-2021_01_07_425723	422	7	in	in	IN
10_1101-2021_01_07_425723	422	8	the	the	DT
10_1101-2021_01_07_425723	422	9	second	second	JJ
10_1101-2021_01_07_425723	422	10	serial	serial	JJ
10_1101-2021_01_07_425723	422	11	645	645	CD
10_1101-2021_01_07_425723	422	12	transfer	transfer	NN
10_1101-2021_01_07_425723	422	13	of	of	IN
10_1101-2021_01_07_425723	422	14	the	the	DT
10_1101-2021_01_07_425723	422	15	shake	shake	NN
10_1101-2021_01_07_425723	422	16	-	-	HYPH
10_1101-2021_01_07_425723	422	17	flask	flask	NN
10_1101-2021_01_07_425723	422	18	cultures	culture	VBZ
10_1101-2021_01_07_425723	422	19	a	a	DT
10_1101-2021_01_07_425723	422	20	1.5	1.5	CD
10_1101-2021_01_07_425723	422	21	mL	ml	NN
10_1101-2021_01_07_425723	422	22	sample	sample	NN
10_1101-2021_01_07_425723	422	23	of	of	IN
10_1101-2021_01_07_425723	422	24	each	each	DT
10_1101-2021_01_07_425723	422	25	culture	culture	NN
10_1101-2021_01_07_425723	422	26	was	be	VBD
10_1101-2021_01_07_425723	422	27	taken	take	VBN
10_1101-2021_01_07_425723	422	28	,	,	,
10_1101-2021_01_07_425723	422	29	sealed	seal	VBN
10_1101-2021_01_07_425723	422	30	,	,	,
10_1101-2021_01_07_425723	422	31	and	and	CC
10_1101-2021_01_07_425723	422	32	used	use	VBD
10_1101-2021_01_07_425723	422	33	to	to	TO
10_1101-2021_01_07_425723	422	34	646	646	CD
10_1101-2021_01_07_425723	422	35	inoculate	inoculate	VB
10_1101-2021_01_07_425723	422	36	fresh	fresh	JJ
10_1101-2021_01_07_425723	422	37	-	-	HYPH
10_1101-2021_01_07_425723	422	38	media	medium	NNS
10_1101-2021_01_07_425723	422	39	in	in	IN
10_1101-2021_01_07_425723	422	40	the	the	DT
10_1101-2021_01_07_425723	422	41	other	other	JJ
10_1101-2021_01_07_425723	422	42	Bactron	Bactron	NNP
10_1101-2021_01_07_425723	422	43	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	422	44	workstation	workstation	NN
10_1101-2021_01_07_425723	422	45	.	.	.
10_1101-2021_01_07_425723	423	1	Simultaneously	simultaneously	RB
10_1101-2021_01_07_425723	423	2	,	,	,
10_1101-2021_01_07_425723	423	3	the	the	DT
10_1101-2021_01_07_425723	423	4	original	original	JJ
10_1101-2021_01_07_425723	423	5	culture	culture	NN
10_1101-2021_01_07_425723	423	6	647	647	CD
10_1101-2021_01_07_425723	423	7	was	be	VBD
10_1101-2021_01_07_425723	423	8	used	use	VBN
10_1101-2021_01_07_425723	423	9	to	to	TO
10_1101-2021_01_07_425723	423	10	inoculate	inoculate	VB
10_1101-2021_01_07_425723	423	11	fresh	fresh	JJ
10_1101-2021_01_07_425723	423	12	media	medium	NNS
10_1101-2021_01_07_425723	423	13	in	in	IN
10_1101-2021_01_07_425723	423	14	the	the	DT
10_1101-2021_01_07_425723	423	15	same	same	JJ
10_1101-2021_01_07_425723	423	16	Bactron	Bactron	NNP
10_1101-2021_01_07_425723	423	17	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	423	18	workstation	workstation	NN
10_1101-2021_01_07_425723	423	19	,	,	,
10_1101-2021_01_07_425723	423	20	thereby	thereby	RB
10_1101-2021_01_07_425723	423	21	resulting	result	VBG
10_1101-2021_01_07_425723	423	22	in	in	IN
10_1101-2021_01_07_425723	423	23	4	4	CD
10_1101-2021_01_07_425723	423	24	648	648	CD
10_1101-2021_01_07_425723	423	25	parallel	parallel	JJ
10_1101-2021_01_07_425723	423	26	cultures	culture	NNS
10_1101-2021_01_07_425723	423	27	of	of	IN
10_1101-2021_01_07_425723	423	28	each	each	DT
10_1101-2021_01_07_425723	423	29	strain	strain	NN
10_1101-2021_01_07_425723	423	30	of	of	IN
10_1101-2021_01_07_425723	423	31	which	which	WDT
10_1101-2021_01_07_425723	423	32	halve	halve	NN
10_1101-2021_01_07_425723	423	33	were	be	VBD
10_1101-2021_01_07_425723	423	34	derived	derive	VBN
10_1101-2021_01_07_425723	423	35	from	from	IN
10_1101-2021_01_07_425723	423	36	the	the	DT
10_1101-2021_01_07_425723	423	37	other	other	JJ
10_1101-2021_01_07_425723	423	38	Bactron	Bactron	NNP
10_1101-2021_01_07_425723	423	39	anaerobic	anaerobic	VBD
10_1101-2021_01_07_425723	423	40	649	649	CD
10_1101-2021_01_07_425723	423	41	workstation	workstation	NN
10_1101-2021_01_07_425723	423	42	.	.	.
10_1101-2021_01_07_425723	424	1	650	650	CD
10_1101-2021_01_07_425723	424	2	Laboratory	laboratory	NN
10_1101-2021_01_07_425723	424	3	evolution	evolution	NN
10_1101-2021_01_07_425723	424	4	in	in	IN
10_1101-2021_01_07_425723	424	5	sequential	sequential	JJ
10_1101-2021_01_07_425723	424	6	batch	batch	NN
10_1101-2021_01_07_425723	424	7	reactors	reactor	NNS
10_1101-2021_01_07_425723	424	8	651	651	CD
10_1101-2021_01_07_425723	424	9	.CC	.CC	,
10_1101-2021_01_07_425723	424	10	-	-	HYPH
10_1101-2021_01_07_425723	424	11	BY	by	IN
10_1101-2021_01_07_425723	424	12	-	-	HYPH
10_1101-2021_01_07_425723	424	13	NC	NC	NNP
10_1101-2021_01_07_425723	424	14	-	-	HYPH
10_1101-2021_01_07_425723	424	15	ND	ND	NNP
10_1101-2021_01_07_425723	424	16	4.0	4.0	CD
10_1101-2021_01_07_425723	424	17	International	International	NNP
10_1101-2021_01_07_425723	424	18	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	424	19	under	under	IN
10_1101-2021_01_07_425723	424	20	a	a	DT
10_1101-2021_01_07_425723	424	21	(	(	-LRB-
10_1101-2021_01_07_425723	424	22	which	which	WDT
10_1101-2021_01_07_425723	424	23	was	be	VBD
10_1101-2021_01_07_425723	424	24	not	not	RB
10_1101-2021_01_07_425723	424	25	certified	certify	VBN
10_1101-2021_01_07_425723	424	26	by	by	IN
10_1101-2021_01_07_425723	424	27	peer	peer	NN
10_1101-2021_01_07_425723	424	28	review	review	NN
10_1101-2021_01_07_425723	424	29	)	)	-RRB-
10_1101-2021_01_07_425723	424	30	is	be	VBZ
10_1101-2021_01_07_425723	424	31	the	the	DT
10_1101-2021_01_07_425723	424	32	author	author	NN
10_1101-2021_01_07_425723	424	33	/	/	SYM
10_1101-2021_01_07_425723	424	34	funder	funder	NN
10_1101-2021_01_07_425723	424	35	,	,	,
10_1101-2021_01_07_425723	424	36	who	who	WP
10_1101-2021_01_07_425723	424	37	has	have	VBZ
10_1101-2021_01_07_425723	424	38	granted	grant	VBN
10_1101-2021_01_07_425723	424	39	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	424	40	a	a	DT
10_1101-2021_01_07_425723	424	41	license	license	NN
10_1101-2021_01_07_425723	424	42	to	to	TO
10_1101-2021_01_07_425723	424	43	display	display	VB
10_1101-2021_01_07_425723	424	44	the	the	DT
10_1101-2021_01_07_425723	424	45	preprint	preprint	NN
10_1101-2021_01_07_425723	424	46	in	in	IN
10_1101-2021_01_07_425723	424	47	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	424	48	.	.	.
10_1101-2021_01_07_425723	425	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	425	2	is	be	VBZ
10_1101-2021_01_07_425723	425	3	made	make	VBN
10_1101-2021_01_07_425723	425	4	The	the	DT
10_1101-2021_01_07_425723	425	5	copyright	copyright	NN
10_1101-2021_01_07_425723	425	6	holder	holder	NN
10_1101-2021_01_07_425723	425	7	for	for	IN
10_1101-2021_01_07_425723	425	8	this	this	DT
10_1101-2021_01_07_425723	425	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	425	10	version	version	NN
10_1101-2021_01_07_425723	425	11	posted	post	VBD
10_1101-2021_01_07_425723	425	12	January	January	NNP
10_1101-2021_01_07_425723	425	13	8	8	CD
10_1101-2021_01_07_425723	425	14	,	,	,
10_1101-2021_01_07_425723	425	15	2021	2021	CD
10_1101-2021_01_07_425723	425	16	.	.	.
10_1101-2021_01_07_425723	425	17	;	;	:
10_1101-2021_01_07_425723	425	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	425	19	:	:	:
10_1101-2021_01_07_425723	425	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	425	21	preprint	preprint	NN
10_1101-2021_01_07_425723	425	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	425	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	425	24	37	37	CD
10_1101-2021_01_07_425723	425	25	Laboratory	Laboratory	NNP
10_1101-2021_01_07_425723	425	26	evolution	evolution	NN
10_1101-2021_01_07_425723	425	27	for	for	IN
10_1101-2021_01_07_425723	425	28	selection	selection	NN
10_1101-2021_01_07_425723	425	29	of	of	IN
10_1101-2021_01_07_425723	425	30	fast	fast	JJ
10_1101-2021_01_07_425723	425	31	growth	growth	NN
10_1101-2021_01_07_425723	425	32	at	at	IN
10_1101-2021_01_07_425723	425	33	high	high	JJ
10_1101-2021_01_07_425723	425	34	temperatures	temperature	NNS
10_1101-2021_01_07_425723	425	35	was	be	VBD
10_1101-2021_01_07_425723	425	36	performed	perform	VBN
10_1101-2021_01_07_425723	425	37	in	in	IN
10_1101-2021_01_07_425723	425	38	400-mL	400-ml	CD
10_1101-2021_01_07_425723	425	39	652	652	CD
10_1101-2021_01_07_425723	425	40	MultiFors	MultiFors	NNP
10_1101-2021_01_07_425723	425	41	(	(	-LRB-
10_1101-2021_01_07_425723	425	42	Infors	Infors	NNPS
10_1101-2021_01_07_425723	425	43	Benelux	Benelux	NNP
10_1101-2021_01_07_425723	425	44	,	,	,
10_1101-2021_01_07_425723	425	45	Velp	Velp	NNP
10_1101-2021_01_07_425723	425	46	,	,	,
10_1101-2021_01_07_425723	425	47	the	the	DT
10_1101-2021_01_07_425723	425	48	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	425	49	)	)	-RRB-
10_1101-2021_01_07_425723	425	50	bioreactors	bioreactor	NNS
10_1101-2021_01_07_425723	425	51	with	with	IN
10_1101-2021_01_07_425723	425	52	a	a	DT
10_1101-2021_01_07_425723	425	53	working	work	VBG
10_1101-2021_01_07_425723	425	54	volume	volume	NN
10_1101-2021_01_07_425723	425	55	of	of	IN
10_1101-2021_01_07_425723	425	56	100	100	CD
10_1101-2021_01_07_425723	425	57	mL	ml	NN
10_1101-2021_01_07_425723	425	58	for	for	IN
10_1101-2021_01_07_425723	425	59	the	the	DT
10_1101-2021_01_07_425723	425	60	653	653	CD
10_1101-2021_01_07_425723	425	61	strain	strain	NN
10_1101-2021_01_07_425723	425	62	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	425	63	on	on	IN
10_1101-2021_01_07_425723	425	64	SMG	SMG	NNP
10_1101-2021_01_07_425723	425	65	20	20	CD
10_1101-2021_01_07_425723	425	66	g·L-1	g·l-1	CD
10_1101-2021_01_07_425723	425	67	glucose	glucose	VBP
10_1101-2021_01_07_425723	425	68	media	medium	NNS
10_1101-2021_01_07_425723	425	69	with	with	IN
10_1101-2021_01_07_425723	425	70	Tween	Tween	NNP
10_1101-2021_01_07_425723	425	71	80	80	CD
10_1101-2021_01_07_425723	425	72	in	in	IN
10_1101-2021_01_07_425723	425	73	triplicate	triplicate	NN
10_1101-2021_01_07_425723	425	74	.	.	.
10_1101-2021_01_07_425723	426	1	Anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	426	2	conditions	condition	NNS
10_1101-2021_01_07_425723	426	3	were	be	VBD
10_1101-2021_01_07_425723	426	4	654	654	CD
10_1101-2021_01_07_425723	426	5	created	create	VBN
10_1101-2021_01_07_425723	426	6	and	and	CC
10_1101-2021_01_07_425723	426	7	maintained	maintain	VBN
10_1101-2021_01_07_425723	426	8	by	by	IN
10_1101-2021_01_07_425723	426	9	continuous	continuous	JJ
10_1101-2021_01_07_425723	426	10	aeration	aeration	NN
10_1101-2021_01_07_425723	426	11	of	of	IN
10_1101-2021_01_07_425723	426	12	the	the	DT
10_1101-2021_01_07_425723	426	13	cultures	culture	NNS
10_1101-2021_01_07_425723	426	14	with	with	IN
10_1101-2021_01_07_425723	426	15	50	50	CD
10_1101-2021_01_07_425723	426	16	mL·min-1	mL·min-1	NNS
10_1101-2021_01_07_425723	426	17	(	(	-LRB-
10_1101-2021_01_07_425723	426	18	0.5	0.5	CD
10_1101-2021_01_07_425723	426	19	vvm	vvm	NN
10_1101-2021_01_07_425723	426	20	)	)	-RRB-
10_1101-2021_01_07_425723	426	21	N2	N2	NNP
10_1101-2021_01_07_425723	426	22	gas	gas	NN
10_1101-2021_01_07_425723	426	23	and	and	CC
10_1101-2021_01_07_425723	426	24	655	655	CD
10_1101-2021_01_07_425723	426	25	continuous	continuous	JJ
10_1101-2021_01_07_425723	426	26	aeration	aeration	NN
10_1101-2021_01_07_425723	426	27	of	of	IN
10_1101-2021_01_07_425723	426	28	the	the	DT
10_1101-2021_01_07_425723	426	29	media	medium	NNS
10_1101-2021_01_07_425723	426	30	vessels	vessel	NNS
10_1101-2021_01_07_425723	426	31	with	with	IN
10_1101-2021_01_07_425723	426	32	N2	N2	NNP
10_1101-2021_01_07_425723	426	33	gas	gas	NN
10_1101-2021_01_07_425723	426	34	.	.	.
10_1101-2021_01_07_425723	427	1	The	the	DT
10_1101-2021_01_07_425723	427	2	pH	pH	NNP
10_1101-2021_01_07_425723	427	3	was	be	VBD
10_1101-2021_01_07_425723	427	4	set	set	VBN
10_1101-2021_01_07_425723	427	5	at	at	IN
10_1101-2021_01_07_425723	427	6	5.0	5.0	CD
10_1101-2021_01_07_425723	427	7	and	and	CC
10_1101-2021_01_07_425723	427	8	maintained	maintain	VBN
10_1101-2021_01_07_425723	427	9	by	by	IN
10_1101-2021_01_07_425723	427	10	the	the	DT
10_1101-2021_01_07_425723	427	11	656	656	CD
10_1101-2021_01_07_425723	427	12	continuous	continuous	JJ
10_1101-2021_01_07_425723	427	13	addition	addition	NN
10_1101-2021_01_07_425723	427	14	of	of	IN
10_1101-2021_01_07_425723	427	15	sterile	sterile	JJ
10_1101-2021_01_07_425723	427	16	2	2	CD
10_1101-2021_01_07_425723	427	17	M	M	NNP
10_1101-2021_01_07_425723	427	18	KOH	KOH	NNP
10_1101-2021_01_07_425723	427	19	.	.	.
10_1101-2021_01_07_425723	428	1	Growth	growth	NN
10_1101-2021_01_07_425723	428	2	was	be	VBD
10_1101-2021_01_07_425723	428	3	monitored	monitor	VBN
10_1101-2021_01_07_425723	428	4	by	by	IN
10_1101-2021_01_07_425723	428	5	analysis	analysis	NN
10_1101-2021_01_07_425723	428	6	of	of	IN
10_1101-2021_01_07_425723	428	7	the	the	DT
10_1101-2021_01_07_425723	428	8	CO2	CO2	NNP
10_1101-2021_01_07_425723	428	9	in	in	IN
10_1101-2021_01_07_425723	428	10	the	the	DT
10_1101-2021_01_07_425723	428	11	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	428	12	657	657	CD
10_1101-2021_01_07_425723	428	13	off	off	IN
10_1101-2021_01_07_425723	428	14	-	-	HYPH
10_1101-2021_01_07_425723	428	15	gas	gas	NN
10_1101-2021_01_07_425723	428	16	and	and	CC
10_1101-2021_01_07_425723	428	17	a	a	DT
10_1101-2021_01_07_425723	428	18	new	new	JJ
10_1101-2021_01_07_425723	428	19	empty	empty	JJ
10_1101-2021_01_07_425723	428	20	-	-	HYPH
10_1101-2021_01_07_425723	428	21	refill	refill	NN
10_1101-2021_01_07_425723	428	22	cycle	cycle	NN
10_1101-2021_01_07_425723	428	23	was	be	VBD
10_1101-2021_01_07_425723	428	24	initiated	initiate	VBN
10_1101-2021_01_07_425723	428	25	when	when	WRB
10_1101-2021_01_07_425723	428	26	the	the	DT
10_1101-2021_01_07_425723	428	27	batch	batch	NN
10_1101-2021_01_07_425723	428	28	time	time	NN
10_1101-2021_01_07_425723	428	29	had	have	VBD
10_1101-2021_01_07_425723	428	30	at	at	IN
10_1101-2021_01_07_425723	428	31	least	least	JJS
10_1101-2021_01_07_425723	428	32	elapsed	elapse	VBN
10_1101-2021_01_07_425723	428	33	15	15	CD
10_1101-2021_01_07_425723	428	34	hours	hour	NNS
10_1101-2021_01_07_425723	428	35	and	and	CC
10_1101-2021_01_07_425723	428	36	658	658	CD
10_1101-2021_01_07_425723	428	37	the	the	DT
10_1101-2021_01_07_425723	428	38	CO2	CO2	NNP
10_1101-2021_01_07_425723	428	39	signal	signal	NN
10_1101-2021_01_07_425723	428	40	dropped	drop	VBD
10_1101-2021_01_07_425723	428	41	to	to	IN
10_1101-2021_01_07_425723	428	42	70	70	CD
10_1101-2021_01_07_425723	428	43	%	%	NN
10_1101-2021_01_07_425723	428	44	of	of	IN
10_1101-2021_01_07_425723	428	45	the	the	DT
10_1101-2021_01_07_425723	428	46	maximum	maximum	NN
10_1101-2021_01_07_425723	428	47	reached	reach	VBN
10_1101-2021_01_07_425723	428	48	in	in	IN
10_1101-2021_01_07_425723	428	49	each	each	DT
10_1101-2021_01_07_425723	428	50	batch	batch	NN
10_1101-2021_01_07_425723	428	51	.	.	.
10_1101-2021_01_07_425723	429	1	The	the	DT
10_1101-2021_01_07_425723	429	2	dilution	dilution	NN
10_1101-2021_01_07_425723	429	3	factor	factor	NN
10_1101-2021_01_07_425723	429	4	of	of	IN
10_1101-2021_01_07_425723	429	5	each	each	DT
10_1101-2021_01_07_425723	429	6	659	659	CD
10_1101-2021_01_07_425723	429	7	empty	empty	JJ
10_1101-2021_01_07_425723	429	8	-	-	HYPH
10_1101-2021_01_07_425723	429	9	refill	refill	NN
10_1101-2021_01_07_425723	429	10	cycle	cycle	NN
10_1101-2021_01_07_425723	429	11	was	be	VBD
10_1101-2021_01_07_425723	429	12	14.3-fold	14.3-fold	CD
10_1101-2021_01_07_425723	429	13	(	(	-LRB-
10_1101-2021_01_07_425723	429	14	100	100	CD
10_1101-2021_01_07_425723	429	15	mL	mL	NNP
10_1101-2021_01_07_425723	429	16	working	working	NN
10_1101-2021_01_07_425723	429	17	volume	volume	NN
10_1101-2021_01_07_425723	429	18	,	,	,
10_1101-2021_01_07_425723	429	19	7	7	CD
10_1101-2021_01_07_425723	429	20	mL	mL	NNP
10_1101-2021_01_07_425723	429	21	residual	residual	JJ
10_1101-2021_01_07_425723	429	22	volume	volume	NN
10_1101-2021_01_07_425723	429	23	)	)	-RRB-
10_1101-2021_01_07_425723	429	24	.	.	.
10_1101-2021_01_07_425723	430	1	The	the	DT
10_1101-2021_01_07_425723	430	2	first	first	JJ
10_1101-2021_01_07_425723	430	3	batch	batch	NN
10_1101-2021_01_07_425723	430	4	660	660	CD
10_1101-2021_01_07_425723	430	5	fermentation	fermentation	NN
10_1101-2021_01_07_425723	430	6	was	be	VBD
10_1101-2021_01_07_425723	430	7	performed	perform	VBN
10_1101-2021_01_07_425723	430	8	at	at	IN
10_1101-2021_01_07_425723	430	9	30	30	CD
10_1101-2021_01_07_425723	430	10	°	°	,
10_1101-2021_01_07_425723	430	11	C	C	NNP
10_1101-2021_01_07_425723	430	12	after	after	IN
10_1101-2021_01_07_425723	430	13	which	which	WDT
10_1101-2021_01_07_425723	430	14	in	in	IN
10_1101-2021_01_07_425723	430	15	the	the	DT
10_1101-2021_01_07_425723	430	16	second	second	JJ
10_1101-2021_01_07_425723	430	17	batch	batch	NN
10_1101-2021_01_07_425723	430	18	the	the	DT
10_1101-2021_01_07_425723	430	19	temperature	temperature	NN
10_1101-2021_01_07_425723	430	20	was	be	VBD
10_1101-2021_01_07_425723	430	21	increased	increase	VBN
10_1101-2021_01_07_425723	430	22	to	to	IN
10_1101-2021_01_07_425723	430	23	661	661	CD
10_1101-2021_01_07_425723	430	24	42	42	CD
10_1101-2021_01_07_425723	430	25	°	°	NNS
10_1101-2021_01_07_425723	430	26	C	C	NNP
10_1101-2021_01_07_425723	430	27	and	and	CC
10_1101-2021_01_07_425723	430	28	maintained	maintain	VBD
10_1101-2021_01_07_425723	430	29	at	at	IN
10_1101-2021_01_07_425723	430	30	for	for	IN
10_1101-2021_01_07_425723	430	31	18	18	CD
10_1101-2021_01_07_425723	430	32	consecutive	consecutive	JJ
10_1101-2021_01_07_425723	430	33	sequential	sequential	JJ
10_1101-2021_01_07_425723	430	34	batches	batch	NNS
10_1101-2021_01_07_425723	430	35	.	.	.
10_1101-2021_01_07_425723	431	1	After	after	IN
10_1101-2021_01_07_425723	431	2	the	the	DT
10_1101-2021_01_07_425723	431	3	18	18	CD
10_1101-2021_01_07_425723	431	4	batch	batch	NN
10_1101-2021_01_07_425723	431	5	cycle	cycle	NN
10_1101-2021_01_07_425723	431	6	at	at	IN
10_1101-2021_01_07_425723	431	7	42	42	CD
10_1101-2021_01_07_425723	431	8	°	°	,
10_1101-2021_01_07_425723	431	9	C	C	NNP
10_1101-2021_01_07_425723	431	10	the	the	DT
10_1101-2021_01_07_425723	431	11	662	662	CD
10_1101-2021_01_07_425723	431	12	culture	culture	NN
10_1101-2021_01_07_425723	431	13	temperature	temperature	NN
10_1101-2021_01_07_425723	431	14	was	be	VBD
10_1101-2021_01_07_425723	431	15	again	again	RB
10_1101-2021_01_07_425723	431	16	increased	increase	VBN
10_1101-2021_01_07_425723	431	17	to	to	IN
10_1101-2021_01_07_425723	431	18	45	45	CD
10_1101-2021_01_07_425723	431	19	°	°	NNS
10_1101-2021_01_07_425723	431	20	C	C	NNP
10_1101-2021_01_07_425723	431	21	and	and	CC
10_1101-2021_01_07_425723	431	22	maintained	maintain	VBD
10_1101-2021_01_07_425723	431	23	subsequently	subsequently	RB
10_1101-2021_01_07_425723	431	24	.	.	.
10_1101-2021_01_07_425723	432	1	Growth	growth	NN
10_1101-2021_01_07_425723	432	2	rate	rate	NN
10_1101-2021_01_07_425723	432	3	was	be	VBD
10_1101-2021_01_07_425723	432	4	663	663	CD
10_1101-2021_01_07_425723	432	5	calculated	calculate	VBN
10_1101-2021_01_07_425723	432	6	based	base	VBN
10_1101-2021_01_07_425723	432	7	on	on	IN
10_1101-2021_01_07_425723	432	8	the	the	DT
10_1101-2021_01_07_425723	432	9	CO2	CO2	NNP
10_1101-2021_01_07_425723	432	10	production	production	NN
10_1101-2021_01_07_425723	432	11	as	as	IN
10_1101-2021_01_07_425723	432	12	measured	measure	VBN
10_1101-2021_01_07_425723	432	13	by	by	IN
10_1101-2021_01_07_425723	432	14	the	the	DT
10_1101-2021_01_07_425723	432	15	CO2	CO2	NNP
10_1101-2021_01_07_425723	432	16	fraction	fraction	NN
10_1101-2021_01_07_425723	432	17	in	in	IN
10_1101-2021_01_07_425723	432	18	the	the	DT
10_1101-2021_01_07_425723	432	19	culture	culture	NN
10_1101-2021_01_07_425723	432	20	off	off	IN
10_1101-2021_01_07_425723	432	21	-	-	HYPH
10_1101-2021_01_07_425723	432	22	gas	gas	NN
10_1101-2021_01_07_425723	432	23	in	in	IN
10_1101-2021_01_07_425723	432	24	664	664	CD
10_1101-2021_01_07_425723	432	25	essence	essence	NN
10_1101-2021_01_07_425723	432	26	as	as	IN
10_1101-2021_01_07_425723	432	27	described	describe	VBN
10_1101-2021_01_07_425723	432	28	previously83	previously83	NNP
10_1101-2021_01_07_425723	432	29	.	.	.
10_1101-2021_01_07_425723	433	1	In	in	IN
10_1101-2021_01_07_425723	433	2	short	short	JJ
10_1101-2021_01_07_425723	433	3	,	,	,
10_1101-2021_01_07_425723	433	4	the	the	DT
10_1101-2021_01_07_425723	433	5	CO2	CO2	NNP
10_1101-2021_01_07_425723	433	6	fraction	fraction	NN
10_1101-2021_01_07_425723	433	7	in	in	IN
10_1101-2021_01_07_425723	433	8	the	the	DT
10_1101-2021_01_07_425723	433	9	off	off	JJ
10_1101-2021_01_07_425723	433	10	-	-	HYPH
10_1101-2021_01_07_425723	433	11	gas	gas	NN
10_1101-2021_01_07_425723	433	12	was	be	VBD
10_1101-2021_01_07_425723	433	13	converted	convert	VBN
10_1101-2021_01_07_425723	433	14	to	to	IN
10_1101-2021_01_07_425723	433	15	a	a	DT
10_1101-2021_01_07_425723	433	16	CO2	CO2	NNP
10_1101-2021_01_07_425723	433	17	665	665	CD
10_1101-2021_01_07_425723	433	18	evolution	evolution	NN
10_1101-2021_01_07_425723	433	19	rate	rate	NN
10_1101-2021_01_07_425723	433	20	of	of	IN
10_1101-2021_01_07_425723	433	21	mmol	mmol	NN
10_1101-2021_01_07_425723	433	22	per	per	IN
10_1101-2021_01_07_425723	433	23	hour	hour	NN
10_1101-2021_01_07_425723	433	24	and	and	CC
10_1101-2021_01_07_425723	433	25	subsequently	subsequently	RB
10_1101-2021_01_07_425723	433	26	summed	sum	VBD
10_1101-2021_01_07_425723	433	27	over	over	IN
10_1101-2021_01_07_425723	433	28	time	time	NN
10_1101-2021_01_07_425723	433	29	for	for	IN
10_1101-2021_01_07_425723	433	30	each	each	DT
10_1101-2021_01_07_425723	433	31	cycle	cycle	NN
10_1101-2021_01_07_425723	433	32	.	.	.
10_1101-2021_01_07_425723	434	1	The	the	DT
10_1101-2021_01_07_425723	434	2	corresponding	corresponding	JJ
10_1101-2021_01_07_425723	434	3	666	666	CD
10_1101-2021_01_07_425723	434	4	cumulative	cumulative	JJ
10_1101-2021_01_07_425723	434	5	CO2	CO2	NNP
10_1101-2021_01_07_425723	434	6	profile	profile	NN
10_1101-2021_01_07_425723	434	7	was	be	VBD
10_1101-2021_01_07_425723	434	8	transformed	transform	VBN
10_1101-2021_01_07_425723	434	9	to	to	IN
10_1101-2021_01_07_425723	434	10	natural	natural	JJ
10_1101-2021_01_07_425723	434	11	log	log	NN
10_1101-2021_01_07_425723	434	12	after	after	IN
10_1101-2021_01_07_425723	434	13	which	which	WDT
10_1101-2021_01_07_425723	434	14	the	the	DT
10_1101-2021_01_07_425723	434	15	stepwise	stepwise	JJ
10_1101-2021_01_07_425723	434	16	slope	slope	NN
10_1101-2021_01_07_425723	434	17	of	of	IN
10_1101-2021_01_07_425723	434	18	the	the	DT
10_1101-2021_01_07_425723	434	19	log	log	NN
10_1101-2021_01_07_425723	434	20	667	667	CD
10_1101-2021_01_07_425723	434	21	transformed	transform	VBN
10_1101-2021_01_07_425723	434	22	data	datum	NNS
10_1101-2021_01_07_425723	434	23	was	be	VBD
10_1101-2021_01_07_425723	434	24	calculated	calculate	VBN
10_1101-2021_01_07_425723	434	25	.	.	.
10_1101-2021_01_07_425723	435	1	Subsequently	subsequently	RB
10_1101-2021_01_07_425723	435	2	an	an	DT
10_1101-2021_01_07_425723	435	3	iterative	iterative	JJ
10_1101-2021_01_07_425723	435	4	exclusion	exclusion	NN
10_1101-2021_01_07_425723	435	5	of	of	IN
10_1101-2021_01_07_425723	435	6	datapoints	datapoint	NNS
10_1101-2021_01_07_425723	435	7	of	of	IN
10_1101-2021_01_07_425723	435	8	the	the	DT
10_1101-2021_01_07_425723	435	9	stepwise	stepwise	JJ
10_1101-2021_01_07_425723	435	10	668	668	CD
10_1101-2021_01_07_425723	435	11	slope	slope	NN
10_1101-2021_01_07_425723	435	12	of	of	IN
10_1101-2021_01_07_425723	435	13	the	the	DT
10_1101-2021_01_07_425723	435	14	log	log	NN
10_1101-2021_01_07_425723	435	15	transformed	transform	VBN
10_1101-2021_01_07_425723	435	16	cumulative	cumulative	JJ
10_1101-2021_01_07_425723	435	17	CO2	CO2	NNP
10_1101-2021_01_07_425723	435	18	profile	profile	NN
10_1101-2021_01_07_425723	435	19	was	be	VBD
10_1101-2021_01_07_425723	435	20	performed	perform	VBN
10_1101-2021_01_07_425723	435	21	with	with	IN
10_1101-2021_01_07_425723	435	22	exclusion	exclusion	NN
10_1101-2021_01_07_425723	435	23	criteria	criterion	NNS
10_1101-2021_01_07_425723	435	24	of	of	IN
10_1101-2021_01_07_425723	435	25	more	more	JJR
10_1101-2021_01_07_425723	435	26	than	than	IN
10_1101-2021_01_07_425723	435	27	669	669	CD
10_1101-2021_01_07_425723	435	28	one	one	CD
10_1101-2021_01_07_425723	435	29	standard	standard	JJ
10_1101-2021_01_07_425723	435	30	deviation	deviation	NN
10_1101-2021_01_07_425723	435	31	below	below	IN
10_1101-2021_01_07_425723	435	32	the	the	DT
10_1101-2021_01_07_425723	435	33	mean	mean	NN
10_1101-2021_01_07_425723	435	34	.	.	.
10_1101-2021_01_07_425723	436	1	670	670	CD
10_1101-2021_01_07_425723	436	2	Variant	variant	JJ
10_1101-2021_01_07_425723	436	3	calling	call	VBG
10_1101-2021_01_07_425723	436	4	671	671	CD
10_1101-2021_01_07_425723	436	5	DNA	dna	NN
10_1101-2021_01_07_425723	436	6	sequencing	sequencing	NN
10_1101-2021_01_07_425723	436	7	reads	read	NNS
10_1101-2021_01_07_425723	436	8	were	be	VBD
10_1101-2021_01_07_425723	436	9	aligned	align	VBN
10_1101-2021_01_07_425723	436	10	into	into	IN
10_1101-2021_01_07_425723	436	11	the	the	DT
10_1101-2021_01_07_425723	436	12	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	436	13	described	describe	VBN
10_1101-2021_01_07_425723	436	14	above	above	IN
10_1101-2021_01_07_425723	436	15	including	include	VBG
10_1101-2021_01_07_425723	436	16	an	an	DT
10_1101-2021_01_07_425723	436	17	additional	additional	JJ
10_1101-2021_01_07_425723	436	18	672	672	CD
10_1101-2021_01_07_425723	436	19	sequence	sequence	NN
10_1101-2021_01_07_425723	436	20	with	with	IN
10_1101-2021_01_07_425723	436	21	TtSTC1	ttstc1	JJ
10_1101-2021_01_07_425723	436	22	construct	construct	NN
10_1101-2021_01_07_425723	436	23	,	,	,
10_1101-2021_01_07_425723	436	24	and	and	CC
10_1101-2021_01_07_425723	436	25	used	use	VBD
10_1101-2021_01_07_425723	436	26	to	to	TO
10_1101-2021_01_07_425723	436	27	detect	detect	VB
10_1101-2021_01_07_425723	436	28	sequence	sequence	NN
10_1101-2021_01_07_425723	436	29	variants	variant	NNS
10_1101-2021_01_07_425723	436	30	using	use	VBG
10_1101-2021_01_07_425723	436	31	a	a	DT
10_1101-2021_01_07_425723	436	32	method	method	NN
10_1101-2021_01_07_425723	436	33	previously	previously	RB
10_1101-2021_01_07_425723	436	34	673	673	CD
10_1101-2021_01_07_425723	436	35	reported84	reported84	NN
10_1101-2021_01_07_425723	436	36	.	.	.
10_1101-2021_01_07_425723	437	1	Briefly	briefly	RB
10_1101-2021_01_07_425723	437	2	,	,	,
10_1101-2021_01_07_425723	437	3	reads	read	NNS
10_1101-2021_01_07_425723	437	4	were	be	VBD
10_1101-2021_01_07_425723	437	5	aligned	align	VBN
10_1101-2021_01_07_425723	437	6	using	use	VBG
10_1101-2021_01_07_425723	437	7	BWA	BWA	NNP
10_1101-2021_01_07_425723	437	8	(	(	-LRB-
10_1101-2021_01_07_425723	437	9	v0.7.15-r1142-dirty)85	v0.7.15-r1142-dirty)85	NN
10_1101-2021_01_07_425723	437	10	,	,	,
10_1101-2021_01_07_425723	437	11	alignments	alignment	NNS
10_1101-2021_01_07_425723	437	12	were	be	VBD
10_1101-2021_01_07_425723	437	13	processed	process	VBN
10_1101-2021_01_07_425723	437	14	674	674	CD
10_1101-2021_01_07_425723	437	15	.CC	.CC	,
10_1101-2021_01_07_425723	437	16	-	-	HYPH
10_1101-2021_01_07_425723	437	17	BY	by	IN
10_1101-2021_01_07_425723	437	18	-	-	HYPH
10_1101-2021_01_07_425723	437	19	NC	NC	NNP
10_1101-2021_01_07_425723	437	20	-	-	HYPH
10_1101-2021_01_07_425723	437	21	ND	ND	NNP
10_1101-2021_01_07_425723	437	22	4.0	4.0	CD
10_1101-2021_01_07_425723	437	23	International	International	NNP
10_1101-2021_01_07_425723	437	24	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	437	25	under	under	IN
10_1101-2021_01_07_425723	437	26	a	a	DT
10_1101-2021_01_07_425723	437	27	(	(	-LRB-
10_1101-2021_01_07_425723	437	28	which	which	WDT
10_1101-2021_01_07_425723	437	29	was	be	VBD
10_1101-2021_01_07_425723	437	30	not	not	RB
10_1101-2021_01_07_425723	437	31	certified	certify	VBN
10_1101-2021_01_07_425723	437	32	by	by	IN
10_1101-2021_01_07_425723	437	33	peer	peer	NN
10_1101-2021_01_07_425723	437	34	review	review	NN
10_1101-2021_01_07_425723	437	35	)	)	-RRB-
10_1101-2021_01_07_425723	437	36	is	be	VBZ
10_1101-2021_01_07_425723	437	37	the	the	DT
10_1101-2021_01_07_425723	437	38	author	author	NN
10_1101-2021_01_07_425723	437	39	/	/	SYM
10_1101-2021_01_07_425723	437	40	funder	funder	NN
10_1101-2021_01_07_425723	437	41	,	,	,
10_1101-2021_01_07_425723	437	42	who	who	WP
10_1101-2021_01_07_425723	437	43	has	have	VBZ
10_1101-2021_01_07_425723	437	44	granted	grant	VBN
10_1101-2021_01_07_425723	437	45	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	437	46	a	a	DT
10_1101-2021_01_07_425723	437	47	license	license	NN
10_1101-2021_01_07_425723	437	48	to	to	TO
10_1101-2021_01_07_425723	437	49	display	display	VB
10_1101-2021_01_07_425723	437	50	the	the	DT
10_1101-2021_01_07_425723	437	51	preprint	preprint	NN
10_1101-2021_01_07_425723	437	52	in	in	IN
10_1101-2021_01_07_425723	437	53	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	437	54	.	.	.
10_1101-2021_01_07_425723	438	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	438	2	is	be	VBZ
10_1101-2021_01_07_425723	438	3	made	make	VBN
10_1101-2021_01_07_425723	438	4	The	the	DT
10_1101-2021_01_07_425723	438	5	copyright	copyright	NN
10_1101-2021_01_07_425723	438	6	holder	holder	NN
10_1101-2021_01_07_425723	438	7	for	for	IN
10_1101-2021_01_07_425723	438	8	this	this	DT
10_1101-2021_01_07_425723	438	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	438	10	version	version	NN
10_1101-2021_01_07_425723	438	11	posted	post	VBD
10_1101-2021_01_07_425723	438	12	January	January	NNP
10_1101-2021_01_07_425723	438	13	8	8	CD
10_1101-2021_01_07_425723	438	14	,	,	,
10_1101-2021_01_07_425723	438	15	2021	2021	CD
10_1101-2021_01_07_425723	438	16	.	.	.
10_1101-2021_01_07_425723	438	17	;	;	:
10_1101-2021_01_07_425723	438	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	438	19	:	:	:
10_1101-2021_01_07_425723	438	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	438	21	preprint	preprint	NN
10_1101-2021_01_07_425723	438	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	438	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	438	24	38	38	CD
10_1101-2021_01_07_425723	438	25	using	use	VBG
10_1101-2021_01_07_425723	438	26	samtools	samtool	NNS
10_1101-2021_01_07_425723	438	27	(	(	-LRB-
10_1101-2021_01_07_425723	438	28	v1.3.1)77	v1.3.1)77	NNP
10_1101-2021_01_07_425723	438	29	and	and	CC
10_1101-2021_01_07_425723	438	30	Picard	Picard	NNP
10_1101-2021_01_07_425723	438	31	tools	tool	NNS
10_1101-2021_01_07_425723	438	32	(	(	-LRB-
10_1101-2021_01_07_425723	438	33	v2.20.2-SNAPSHOT	v2.20.2-snapshot	NN
10_1101-2021_01_07_425723	438	34	)	)	-RRB-
10_1101-2021_01_07_425723	438	35	(	(	-LRB-
10_1101-2021_01_07_425723	438	36	http://broadinstitute.github.io/picard	http://broadinstitute.github.io/picard	NN
10_1101-2021_01_07_425723	438	37	)	)	-RRB-
10_1101-2021_01_07_425723	438	38	,	,	,
10_1101-2021_01_07_425723	438	39	675	675	CD
10_1101-2021_01_07_425723	438	40	and	and	CC
10_1101-2021_01_07_425723	438	41	variants	variant	NNS
10_1101-2021_01_07_425723	438	42	were	be	VBD
10_1101-2021_01_07_425723	438	43	then	then	RB
10_1101-2021_01_07_425723	438	44	called	call	VBN
10_1101-2021_01_07_425723	438	45	using	use	VBG
10_1101-2021_01_07_425723	438	46	the	the	DT
10_1101-2021_01_07_425723	438	47	Genome	Genome	NNP
10_1101-2021_01_07_425723	438	48	Analysis	Analysis	NNP
10_1101-2021_01_07_425723	438	49	Toolkit	Toolkit	NNP
10_1101-2021_01_07_425723	438	50	(	(	-LRB-
10_1101-2021_01_07_425723	438	51	v3.8	v3.8	NNP
10_1101-2021_01_07_425723	438	52	-	-	HYPH
10_1101-2021_01_07_425723	438	53	1	1	CD
10_1101-2021_01_07_425723	438	54	-	-	HYPH
10_1101-2021_01_07_425723	438	55	0-gf15c1c3ef)86	0-gf15c1c3ef)86	CD
10_1101-2021_01_07_425723	438	56	HaplotypeCaller	HaplotypeCaller	NNP
10_1101-2021_01_07_425723	438	57	676	676	CD
10_1101-2021_01_07_425723	438	58	in	in	IN
10_1101-2021_01_07_425723	438	59	DISCOVERY	DISCOVERY	NNP
10_1101-2021_01_07_425723	438	60	and	and	CC
10_1101-2021_01_07_425723	438	61	GVCF	GVCF	NNP
10_1101-2021_01_07_425723	438	62	modes	mode	NNS
10_1101-2021_01_07_425723	438	63	.	.	.
10_1101-2021_01_07_425723	439	1	Variants	variant	NNS
10_1101-2021_01_07_425723	439	2	were	be	VBD
10_1101-2021_01_07_425723	439	3	only	only	RB
10_1101-2021_01_07_425723	439	4	called	call	VBN
10_1101-2021_01_07_425723	439	5	at	at	IN
10_1101-2021_01_07_425723	439	6	sites	site	NNS
10_1101-2021_01_07_425723	439	7	with	with	IN
10_1101-2021_01_07_425723	439	8	minimum	minimum	JJ
10_1101-2021_01_07_425723	439	9	variant	variant	JJ
10_1101-2021_01_07_425723	439	10	confidence	confidence	NN
10_1101-2021_01_07_425723	439	11	677	677	CD
10_1101-2021_01_07_425723	439	12	normalized	normalize	VBN
10_1101-2021_01_07_425723	439	13	by	by	IN
10_1101-2021_01_07_425723	439	14	unfiltered	unfiltered	JJ
10_1101-2021_01_07_425723	439	15	depth	depth	NN
10_1101-2021_01_07_425723	439	16	of	of	IN
10_1101-2021_01_07_425723	439	17	variant	variant	JJ
10_1101-2021_01_07_425723	439	18	samples	sample	NNS
10_1101-2021_01_07_425723	439	19	(	(	-LRB-
10_1101-2021_01_07_425723	439	20	QD	QD	NNP
10_1101-2021_01_07_425723	439	21	)	)	-RRB-
10_1101-2021_01_07_425723	439	22	of	of	IN
10_1101-2021_01_07_425723	439	23	20	20	CD
10_1101-2021_01_07_425723	439	24	,	,	,
10_1101-2021_01_07_425723	439	25	read	read	VBD
10_1101-2021_01_07_425723	439	26	depth	depth	NN
10_1101-2021_01_07_425723	439	27	(	(	-LRB-
10_1101-2021_01_07_425723	439	28	DP	DP	NNP
10_1101-2021_01_07_425723	439	29	)	)	-RRB-
10_1101-2021_01_07_425723	439	30	≥	≥	NN
10_1101-2021_01_07_425723	439	31	5	5	CD
10_1101-2021_01_07_425723	439	32	,	,	,
10_1101-2021_01_07_425723	439	33	and	and	CC
10_1101-2021_01_07_425723	439	34	genotype	genotype	NNP
10_1101-2021_01_07_425723	439	35	quality	quality	NN
10_1101-2021_01_07_425723	439	36	678	678	CD
10_1101-2021_01_07_425723	439	37	(	(	-LRB-
10_1101-2021_01_07_425723	439	38	GQ	GQ	NNP
10_1101-2021_01_07_425723	439	39	)	)	-RRB-
10_1101-2021_01_07_425723	439	40	>	>	XX
10_1101-2021_01_07_425723	439	41	20	20	CD
10_1101-2021_01_07_425723	439	42	,	,	,
10_1101-2021_01_07_425723	439	43	excluding	exclude	VBG
10_1101-2021_01_07_425723	439	44	a	a	DT
10_1101-2021_01_07_425723	439	45	7.1	7.1	CD
10_1101-2021_01_07_425723	439	46	kb	kb	NN
10_1101-2021_01_07_425723	439	47	region	region	NN
10_1101-2021_01_07_425723	439	48	in	in	IN
10_1101-2021_01_07_425723	439	49	chromosome	chromosome	NN
10_1101-2021_01_07_425723	439	50	5	5	CD
10_1101-2021_01_07_425723	439	51	containing	contain	VBG
10_1101-2021_01_07_425723	439	52	rDNA	rdna	NN
10_1101-2021_01_07_425723	439	53	.	.	.
10_1101-2021_01_07_425723	440	1	Variants	variant	NNS
10_1101-2021_01_07_425723	440	2	were	be	VBD
10_1101-2021_01_07_425723	440	3	annotated	annotate	VBN
10_1101-2021_01_07_425723	440	4	using	use	VBG
10_1101-2021_01_07_425723	440	5	679	679	CD
10_1101-2021_01_07_425723	440	6	the	the	DT
10_1101-2021_01_07_425723	440	7	genome	genome	JJ
10_1101-2021_01_07_425723	440	8	annotation	annotation	NN
10_1101-2021_01_07_425723	440	9	described	describe	VBN
10_1101-2021_01_07_425723	440	10	above	above	RB
10_1101-2021_01_07_425723	440	11	,	,	,
10_1101-2021_01_07_425723	440	12	including	include	VBG
10_1101-2021_01_07_425723	440	13	the	the	DT
10_1101-2021_01_07_425723	440	14	TtSTC1	ttstc1	NN
10_1101-2021_01_07_425723	440	15	construct	construct	NN
10_1101-2021_01_07_425723	440	16	,	,	,
10_1101-2021_01_07_425723	440	17	with	with	IN
10_1101-2021_01_07_425723	440	18	SnpEff	SnpEff	NNP
10_1101-2021_01_07_425723	440	19	(	(	-LRB-
10_1101-2021_01_07_425723	440	20	v5.0)87	v5.0)87	:
10_1101-2021_01_07_425723	440	21	and	and	CC
10_1101-2021_01_07_425723	440	22	680	680	CD
10_1101-2021_01_07_425723	440	23	VCFannotator	VCFannotator	NNP
10_1101-2021_01_07_425723	440	24	(	(	-LRB-
10_1101-2021_01_07_425723	440	25	http://vcfannotator.sourceforge.net	http://vcfannotator.sourceforge.net	NNP
10_1101-2021_01_07_425723	440	26	)	)	-RRB-
10_1101-2021_01_07_425723	440	27	.	.	.
10_1101-2021_01_07_425723	441	1	681	681	CD
10_1101-2021_01_07_425723	441	2	Statistics	statistic	NNS
10_1101-2021_01_07_425723	441	3	682	682	CD
10_1101-2021_01_07_425723	441	4	Statistical	statistical	JJ
10_1101-2021_01_07_425723	441	5	test	test	NN
10_1101-2021_01_07_425723	441	6	performed	perform	VBN
10_1101-2021_01_07_425723	441	7	are	be	VBP
10_1101-2021_01_07_425723	441	8	given	give	VBN
10_1101-2021_01_07_425723	441	9	as	as	IN
10_1101-2021_01_07_425723	441	10	two	two	CD
10_1101-2021_01_07_425723	441	11	sided	side	VBN
10_1101-2021_01_07_425723	441	12	with	with	IN
10_1101-2021_01_07_425723	441	13	unequal	unequal	JJ
10_1101-2021_01_07_425723	441	14	variance	variance	NN
10_1101-2021_01_07_425723	441	15	t	t	NN
10_1101-2021_01_07_425723	441	16	-	-	HYPH
10_1101-2021_01_07_425723	441	17	test	test	NN
10_1101-2021_01_07_425723	441	18	unless	unless	IN
10_1101-2021_01_07_425723	441	19	specifically	specifically	RB
10_1101-2021_01_07_425723	441	20	stated	state	VBN
10_1101-2021_01_07_425723	441	21	683	683	CD
10_1101-2021_01_07_425723	441	22	otherwise	otherwise	RB
10_1101-2021_01_07_425723	441	23	.	.	.
10_1101-2021_01_07_425723	442	1	We	-PRON-	PRP
10_1101-2021_01_07_425723	442	2	denote	denote	VBP
10_1101-2021_01_07_425723	442	3	technical	technical	JJ
10_1101-2021_01_07_425723	442	4	replicates	replicate	NNS
10_1101-2021_01_07_425723	442	5	as	as	IN
10_1101-2021_01_07_425723	442	6	measurements	measurement	NNS
10_1101-2021_01_07_425723	442	7	derived	derive	VBN
10_1101-2021_01_07_425723	442	8	from	from	IN
10_1101-2021_01_07_425723	442	9	a	a	DT
10_1101-2021_01_07_425723	442	10	single	single	JJ
10_1101-2021_01_07_425723	442	11	cell	cell	NN
10_1101-2021_01_07_425723	442	12	culture	culture	NN
10_1101-2021_01_07_425723	442	13	.	.	.
10_1101-2021_01_07_425723	443	1	Biological	biological	JJ
10_1101-2021_01_07_425723	443	2	684	684	CD
10_1101-2021_01_07_425723	443	3	replicates	replicate	NNS
10_1101-2021_01_07_425723	443	4	are	be	VBP
10_1101-2021_01_07_425723	443	5	measurements	measurement	NNS
10_1101-2021_01_07_425723	443	6	originating	originate	VBG
10_1101-2021_01_07_425723	443	7	from	from	IN
10_1101-2021_01_07_425723	443	8	independent	independent	JJ
10_1101-2021_01_07_425723	443	9	cell	cell	NN
10_1101-2021_01_07_425723	443	10	cultures	culture	NNS
10_1101-2021_01_07_425723	443	11	.	.	.
10_1101-2021_01_07_425723	444	1	Independent	independent	JJ
10_1101-2021_01_07_425723	444	2	experiments	experiment	NNS
10_1101-2021_01_07_425723	444	3	are	be	VBP
10_1101-2021_01_07_425723	444	4	685	685	CD
10_1101-2021_01_07_425723	444	5	two	two	CD
10_1101-2021_01_07_425723	444	6	experiments	experiment	NNS
10_1101-2021_01_07_425723	444	7	identical	identical	JJ
10_1101-2021_01_07_425723	444	8	in	in	IN
10_1101-2021_01_07_425723	444	9	set	set	VBN
10_1101-2021_01_07_425723	444	10	-	-	HYPH
10_1101-2021_01_07_425723	444	11	up	up	RP
10_1101-2021_01_07_425723	444	12	separated	separate	VBN
10_1101-2021_01_07_425723	444	13	by	by	IN
10_1101-2021_01_07_425723	444	14	the	the	DT
10_1101-2021_01_07_425723	444	15	difference	difference	NN
10_1101-2021_01_07_425723	444	16	in	in	IN
10_1101-2021_01_07_425723	444	17	execution	execution	NN
10_1101-2021_01_07_425723	444	18	days	day	NNS
10_1101-2021_01_07_425723	444	19	.	.	.
10_1101-2021_01_07_425723	445	1	If	if	IN
10_1101-2021_01_07_425723	445	2	possible	possible	JJ
10_1101-2021_01_07_425723	445	3	variance	variance	NN
10_1101-2021_01_07_425723	445	4	686	686	CD
10_1101-2021_01_07_425723	445	5	from	from	IN
10_1101-2021_01_07_425723	445	6	independent	independent	JJ
10_1101-2021_01_07_425723	445	7	experiments	experiment	NNS
10_1101-2021_01_07_425723	445	8	with	with	IN
10_1101-2021_01_07_425723	445	9	identical	identical	JJ
10_1101-2021_01_07_425723	445	10	setup	setup	NN
10_1101-2021_01_07_425723	445	11	were	be	VBD
10_1101-2021_01_07_425723	445	12	pooled	pool	VBN
10_1101-2021_01_07_425723	445	13	together	together	RB
10_1101-2021_01_07_425723	445	14	,	,	,
10_1101-2021_01_07_425723	445	15	but	but	CC
10_1101-2021_01_07_425723	445	16	independent	independent	JJ
10_1101-2021_01_07_425723	445	17	687	687	CD
10_1101-2021_01_07_425723	445	18	experiments	experiment	NNS
10_1101-2021_01_07_425723	445	19	from	from	IN
10_1101-2021_01_07_425723	445	20	time	time	NN
10_1101-2021_01_07_425723	445	21	-	-	HYPH
10_1101-2021_01_07_425723	445	22	course	course	NN
10_1101-2021_01_07_425723	445	23	experiments	experiment	NNS
10_1101-2021_01_07_425723	445	24	(	(	-LRB-
10_1101-2021_01_07_425723	445	25	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	445	26	growth	growth	NN
10_1101-2021_01_07_425723	445	27	studies	study	NNS
10_1101-2021_01_07_425723	445	28	)	)	-RRB-
10_1101-2021_01_07_425723	445	29	are	be	VBP
10_1101-2021_01_07_425723	445	30	reported	report	VBN
10_1101-2021_01_07_425723	445	31	separately	separately	RB
10_1101-2021_01_07_425723	445	32	.	.	.
10_1101-2021_01_07_425723	446	1	p-688	p-688	NNP
10_1101-2021_01_07_425723	446	2	values	value	NNS
10_1101-2021_01_07_425723	446	3	were	be	VBD
10_1101-2021_01_07_425723	446	4	corrected	correct	VBN
10_1101-2021_01_07_425723	446	5	for	for	IN
10_1101-2021_01_07_425723	446	6	multiple	multiple	JJ
10_1101-2021_01_07_425723	446	7	-	-	HYPH
10_1101-2021_01_07_425723	446	8	hypothesis	hypothesis	NN
10_1101-2021_01_07_425723	446	9	testing	testing	NN
10_1101-2021_01_07_425723	446	10	which	which	WDT
10_1101-2021_01_07_425723	446	11	is	be	VBZ
10_1101-2021_01_07_425723	446	12	specifically	specifically	RB
10_1101-2021_01_07_425723	446	13	reported	report	VBN
10_1101-2021_01_07_425723	446	14	each	each	DT
10_1101-2021_01_07_425723	446	15	time	time	NN
10_1101-2021_01_07_425723	446	16	.	.	.
10_1101-2021_01_07_425723	447	1	No	no	DT
10_1101-2021_01_07_425723	447	2	data	data	NN
10_1101-2021_01_07_425723	447	3	689	689	CD
10_1101-2021_01_07_425723	447	4	was	be	VBD
10_1101-2021_01_07_425723	447	5	excluded	exclude	VBN
10_1101-2021_01_07_425723	447	6	based	base	VBN
10_1101-2021_01_07_425723	447	7	on	on	IN
10_1101-2021_01_07_425723	447	8	the	the	DT
10_1101-2021_01_07_425723	447	9	resulting	result	VBG
10_1101-2021_01_07_425723	447	10	data	datum	NNS
10_1101-2021_01_07_425723	447	11	out	out	RB
10_1101-2021_01_07_425723	447	12	-	-	HYPH
10_1101-2021_01_07_425723	447	13	come	come	VB
10_1101-2021_01_07_425723	447	14	.	.	.
10_1101-2021_01_07_425723	448	1	690	690	CD
10_1101-2021_01_07_425723	448	2	Data	datum	NNS
10_1101-2021_01_07_425723	448	3	availability	availability	NN
10_1101-2021_01_07_425723	448	4	691	691	CD
10_1101-2021_01_07_425723	448	5	Data	datum	NNS
10_1101-2021_01_07_425723	448	6	supporting	support	VBG
10_1101-2021_01_07_425723	448	7	the	the	DT
10_1101-2021_01_07_425723	448	8	findings	finding	NNS
10_1101-2021_01_07_425723	448	9	of	of	IN
10_1101-2021_01_07_425723	448	10	this	this	DT
10_1101-2021_01_07_425723	448	11	work	work	NN
10_1101-2021_01_07_425723	448	12	are	be	VBP
10_1101-2021_01_07_425723	448	13	available	available	JJ
10_1101-2021_01_07_425723	448	14	within	within	IN
10_1101-2021_01_07_425723	448	15	the	the	DT
10_1101-2021_01_07_425723	448	16	paper	paper	NN
10_1101-2021_01_07_425723	448	17	and	and	CC
10_1101-2021_01_07_425723	448	18	source	source	NN
10_1101-2021_01_07_425723	448	19	data	datum	NNS
10_1101-2021_01_07_425723	448	20	for	for	IN
10_1101-2021_01_07_425723	448	21	all	all	DT
10_1101-2021_01_07_425723	448	22	figures	figure	NNS
10_1101-2021_01_07_425723	448	23	in	in	IN
10_1101-2021_01_07_425723	448	24	692	692	CD
10_1101-2021_01_07_425723	448	25	this	this	DT
10_1101-2021_01_07_425723	448	26	study	study	NN
10_1101-2021_01_07_425723	448	27	are	be	VBP
10_1101-2021_01_07_425723	448	28	available	available	JJ
10_1101-2021_01_07_425723	448	29	at	at	IN
10_1101-2021_01_07_425723	448	30	the	the	DT
10_1101-2021_01_07_425723	448	31	www.data.4TU.nl	www.data.4TU.nl	JJR
10_1101-2021_01_07_425723	448	32	repository	repository	NN
10_1101-2021_01_07_425723	448	33	with	with	IN
10_1101-2021_01_07_425723	448	34	the	the	DT
10_1101-2021_01_07_425723	448	35	doi:10.4121/13265552	doi:10.4121/13265552	NN
10_1101-2021_01_07_425723	448	36	.	.	.
10_1101-2021_01_07_425723	449	1	693	693	CD
10_1101-2021_01_07_425723	449	2	The	the	DT
10_1101-2021_01_07_425723	449	3	raw	raw	JJ
10_1101-2021_01_07_425723	449	4	RNA	RNA	NNP
10_1101-2021_01_07_425723	449	5	-	-	HYPH
10_1101-2021_01_07_425723	449	6	sequencing	sequence	VBG
10_1101-2021_01_07_425723	449	7	data	datum	NNS
10_1101-2021_01_07_425723	449	8	that	that	WDT
10_1101-2021_01_07_425723	449	9	supports	support	VBZ
10_1101-2021_01_07_425723	449	10	the	the	DT
10_1101-2021_01_07_425723	449	11	findings	finding	NNS
10_1101-2021_01_07_425723	449	12	of	of	IN
10_1101-2021_01_07_425723	449	13	this	this	DT
10_1101-2021_01_07_425723	449	14	study	study	NN
10_1101-2021_01_07_425723	449	15	are	be	VBP
10_1101-2021_01_07_425723	449	16	available	available	JJ
10_1101-2021_01_07_425723	449	17	from	from	IN
10_1101-2021_01_07_425723	449	18	the	the	DT
10_1101-2021_01_07_425723	449	19	Genome	Genome	NNP
10_1101-2021_01_07_425723	449	20	694	694	CD
10_1101-2021_01_07_425723	449	21	Expression	Expression	NNP
10_1101-2021_01_07_425723	449	22	Omnibus	Omnibus	NNP
10_1101-2021_01_07_425723	449	23	(	(	-LRB-
10_1101-2021_01_07_425723	449	24	GEO	GEO	NNP
10_1101-2021_01_07_425723	449	25	)	)	-RRB-
10_1101-2021_01_07_425723	449	26	website	website	NN
10_1101-2021_01_07_425723	449	27	(	(	-LRB-
10_1101-2021_01_07_425723	449	28	https://www.ncbi.nlm.nih.gov/geo/	https://www.ncbi.nlm.nih.gov/geo/	NNP
10_1101-2021_01_07_425723	449	29	)	)	-RRB-
10_1101-2021_01_07_425723	449	30	with	with	IN
10_1101-2021_01_07_425723	449	31	number	number	NN
10_1101-2021_01_07_425723	449	32	GSE164344	gse164344	NN
10_1101-2021_01_07_425723	449	33	.	.	.
10_1101-2021_01_07_425723	450	1	695	695	CD
10_1101-2021_01_07_425723	450	2	.CC	.CC	:
10_1101-2021_01_07_425723	450	3	-	-	HYPH
10_1101-2021_01_07_425723	450	4	BY	by	IN
10_1101-2021_01_07_425723	450	5	-	-	HYPH
10_1101-2021_01_07_425723	450	6	NC	NC	NNP
10_1101-2021_01_07_425723	450	7	-	-	HYPH
10_1101-2021_01_07_425723	450	8	ND	ND	NNP
10_1101-2021_01_07_425723	450	9	4.0	4.0	CD
10_1101-2021_01_07_425723	450	10	International	International	NNP
10_1101-2021_01_07_425723	450	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	450	12	under	under	IN
10_1101-2021_01_07_425723	450	13	a	a	DT
10_1101-2021_01_07_425723	450	14	(	(	-LRB-
10_1101-2021_01_07_425723	450	15	which	which	WDT
10_1101-2021_01_07_425723	450	16	was	be	VBD
10_1101-2021_01_07_425723	450	17	not	not	RB
10_1101-2021_01_07_425723	450	18	certified	certify	VBN
10_1101-2021_01_07_425723	450	19	by	by	IN
10_1101-2021_01_07_425723	450	20	peer	peer	NN
10_1101-2021_01_07_425723	450	21	review	review	NN
10_1101-2021_01_07_425723	450	22	)	)	-RRB-
10_1101-2021_01_07_425723	450	23	is	be	VBZ
10_1101-2021_01_07_425723	450	24	the	the	DT
10_1101-2021_01_07_425723	450	25	author	author	NN
10_1101-2021_01_07_425723	450	26	/	/	SYM
10_1101-2021_01_07_425723	450	27	funder	funder	NN
10_1101-2021_01_07_425723	450	28	,	,	,
10_1101-2021_01_07_425723	450	29	who	who	WP
10_1101-2021_01_07_425723	450	30	has	have	VBZ
10_1101-2021_01_07_425723	450	31	granted	grant	VBN
10_1101-2021_01_07_425723	450	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	450	33	a	a	DT
10_1101-2021_01_07_425723	450	34	license	license	NN
10_1101-2021_01_07_425723	450	35	to	to	TO
10_1101-2021_01_07_425723	450	36	display	display	VB
10_1101-2021_01_07_425723	450	37	the	the	DT
10_1101-2021_01_07_425723	450	38	preprint	preprint	NN
10_1101-2021_01_07_425723	450	39	in	in	IN
10_1101-2021_01_07_425723	450	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	450	41	.	.	.
10_1101-2021_01_07_425723	451	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	451	2	is	be	VBZ
10_1101-2021_01_07_425723	451	3	made	make	VBN
10_1101-2021_01_07_425723	451	4	The	the	DT
10_1101-2021_01_07_425723	451	5	copyright	copyright	NN
10_1101-2021_01_07_425723	451	6	holder	holder	NN
10_1101-2021_01_07_425723	451	7	for	for	IN
10_1101-2021_01_07_425723	451	8	this	this	DT
10_1101-2021_01_07_425723	451	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	451	10	version	version	NN
10_1101-2021_01_07_425723	451	11	posted	post	VBD
10_1101-2021_01_07_425723	451	12	January	January	NNP
10_1101-2021_01_07_425723	451	13	8	8	CD
10_1101-2021_01_07_425723	451	14	,	,	,
10_1101-2021_01_07_425723	451	15	2021	2021	CD
10_1101-2021_01_07_425723	451	16	.	.	.
10_1101-2021_01_07_425723	451	17	;	;	:
10_1101-2021_01_07_425723	451	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	451	19	:	:	:
10_1101-2021_01_07_425723	451	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	451	21	preprint	preprint	NN
10_1101-2021_01_07_425723	451	22	http://www.data.4tu.nl/	http://www.data.4tu.nl/	''
10_1101-2021_01_07_425723	451	23	https://www.ncbi.nlm.nih.gov/geo/	https://www.ncbi.nlm.nih.gov/geo/	NNP
10_1101-2021_01_07_425723	451	24	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	451	25	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CC
10_1101-2021_01_07_425723	451	26	39	39	CD
10_1101-2021_01_07_425723	451	27	Whole	whole	RB
10_1101-2021_01_07_425723	451	28	-	-	HYPH
10_1101-2021_01_07_425723	451	29	genome	genome	NN
10_1101-2021_01_07_425723	451	30	sequencing	sequencing	NN
10_1101-2021_01_07_425723	451	31	data	datum	NNS
10_1101-2021_01_07_425723	451	32	of	of	IN
10_1101-2021_01_07_425723	451	33	the	the	DT
10_1101-2021_01_07_425723	451	34	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	451	35	,	,	,
10_1101-2021_01_07_425723	451	36	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	451	37	and	and	CC
10_1101-2021_01_07_425723	451	38	evolved	evolve	VBD
10_1101-2021_01_07_425723	451	39	strains	strain	NNS
10_1101-2021_01_07_425723	451	40	were	be	VBD
10_1101-2021_01_07_425723	451	41	deposited	deposit	VBN
10_1101-2021_01_07_425723	451	42	at	at	IN
10_1101-2021_01_07_425723	451	43	NCBI	NCBI	NNP
10_1101-2021_01_07_425723	451	44	696	696	CD
10_1101-2021_01_07_425723	451	45	(	(	-LRB-
10_1101-2021_01_07_425723	451	46	https://www.ncbi.nlm.nih.gov/	https://www.ncbi.nlm.nih.gov/	NNP
10_1101-2021_01_07_425723	451	47	)	)	-RRB-
10_1101-2021_01_07_425723	451	48	under	under	IN
10_1101-2021_01_07_425723	451	49	BioProject	BioProject	NNP
10_1101-2021_01_07_425723	451	50	accession	accession	NN
10_1101-2021_01_07_425723	451	51	number	number	NN
10_1101-2021_01_07_425723	451	52	PRJNA679749	PRJNA679749	NNP
10_1101-2021_01_07_425723	451	53	.	.	.
10_1101-2021_01_07_425723	452	1	697	697	CD
10_1101-2021_01_07_425723	452	2	Code	code	NN
10_1101-2021_01_07_425723	452	3	availability	availability	NN
10_1101-2021_01_07_425723	452	4	698	698	CD
10_1101-2021_01_07_425723	452	5	The	the	DT
10_1101-2021_01_07_425723	452	6	code	code	NN
10_1101-2021_01_07_425723	452	7	that	that	WDT
10_1101-2021_01_07_425723	452	8	were	be	VBD
10_1101-2021_01_07_425723	452	9	used	use	VBN
10_1101-2021_01_07_425723	452	10	to	to	TO
10_1101-2021_01_07_425723	452	11	generate	generate	VB
10_1101-2021_01_07_425723	452	12	the	the	DT
10_1101-2021_01_07_425723	452	13	results	result	NNS
10_1101-2021_01_07_425723	452	14	obtained	obtain	VBN
10_1101-2021_01_07_425723	452	15	in	in	IN
10_1101-2021_01_07_425723	452	16	this	this	DT
10_1101-2021_01_07_425723	452	17	study	study	NN
10_1101-2021_01_07_425723	452	18	are	be	VBP
10_1101-2021_01_07_425723	452	19	archived	archive	VBN
10_1101-2021_01_07_425723	452	20	in	in	IN
10_1101-2021_01_07_425723	452	21	a	a	DT
10_1101-2021_01_07_425723	452	22	Gitlab	Gitlab	NNP
10_1101-2021_01_07_425723	452	23	699	699	CD
10_1101-2021_01_07_425723	452	24	repository	repository	NN
10_1101-2021_01_07_425723	452	25	(	(	-LRB-
10_1101-2021_01_07_425723	452	26	https://gitlab.tudelft.nl/rortizmerino/kmar_anaerobic	https://gitlab.tudelft.nl/rortizmerino/kmar_anaerobic	NN
10_1101-2021_01_07_425723	452	27	)	)	-RRB-
10_1101-2021_01_07_425723	452	28	.	.	.
10_1101-2021_01_07_425723	453	1	700	700	CD
10_1101-2021_01_07_425723	453	2	Author	author	NN
10_1101-2021_01_07_425723	453	3	’s	’s	POS
10_1101-2021_01_07_425723	453	4	contributions	contribution	NNS
10_1101-2021_01_07_425723	453	5	701	701	CD
10_1101-2021_01_07_425723	453	6	WD	WD	NNP
10_1101-2021_01_07_425723	453	7	and	and	CC
10_1101-2021_01_07_425723	453	8	JTP	JTP	NNP
10_1101-2021_01_07_425723	453	9	designed	design	VBD
10_1101-2021_01_07_425723	453	10	the	the	DT
10_1101-2021_01_07_425723	453	11	study	study	NN
10_1101-2021_01_07_425723	453	12	and	and	CC
10_1101-2021_01_07_425723	453	13	wrote	write	VBD
10_1101-2021_01_07_425723	453	14	the	the	DT
10_1101-2021_01_07_425723	453	15	manuscript	manuscript	NN
10_1101-2021_01_07_425723	453	16	.	.	.
10_1101-2021_01_07_425723	454	1	WD	WD	NNP
10_1101-2021_01_07_425723	454	2	performed	perform	VBD
10_1101-2021_01_07_425723	454	3	molecular	molecular	JJ
10_1101-2021_01_07_425723	454	4	cloning	cloning	NN
10_1101-2021_01_07_425723	454	5	,	,	,
10_1101-2021_01_07_425723	454	6	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	454	7	702	702	CD
10_1101-2021_01_07_425723	454	8	cultivation	cultivation	NN
10_1101-2021_01_07_425723	454	9	experiment	experiment	NN
10_1101-2021_01_07_425723	454	10	,	,	,
10_1101-2021_01_07_425723	454	11	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	454	12	analysis	analysis	NN
10_1101-2021_01_07_425723	454	13	and	and	CC
10_1101-2021_01_07_425723	454	14	sterol	sterol	NN
10_1101-2021_01_07_425723	454	15	-	-	HYPH
10_1101-2021_01_07_425723	454	16	uptake	uptake	JJ
10_1101-2021_01_07_425723	454	17	experiments	experiment	NNS
10_1101-2021_01_07_425723	454	18	.	.	.
10_1101-2021_01_07_425723	455	1	JB	JB	NNP
10_1101-2021_01_07_425723	455	2	contributed	contribute	VBD
10_1101-2021_01_07_425723	455	3	to	to	IN
10_1101-2021_01_07_425723	455	4	703	703	CD
10_1101-2021_01_07_425723	455	5	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	455	6	cultivation	cultivation	NN
10_1101-2021_01_07_425723	455	7	experiments	experiment	NNS
10_1101-2021_01_07_425723	455	8	and	and	CC
10_1101-2021_01_07_425723	455	9	molecular	molecular	JJ
10_1101-2021_01_07_425723	455	10	cloning	cloning	NN
10_1101-2021_01_07_425723	455	11	.	.	.
10_1101-2021_01_07_425723	456	1	FW	FW	NNP
10_1101-2021_01_07_425723	456	2	contributed	contribute	VBD
10_1101-2021_01_07_425723	456	3	to	to	IN
10_1101-2021_01_07_425723	456	4	the	the	DT
10_1101-2021_01_07_425723	456	5	molecular	molecular	JJ
10_1101-2021_01_07_425723	456	6	cloning	cloning	NN
10_1101-2021_01_07_425723	456	7	and	and	CC
10_1101-2021_01_07_425723	456	8	704	704	CD
10_1101-2021_01_07_425723	456	9	sterol	sterol	JJ
10_1101-2021_01_07_425723	456	10	-	-	HYPH
10_1101-2021_01_07_425723	456	11	uptake	uptake	NN
10_1101-2021_01_07_425723	456	12	experiments	experiment	NNS
10_1101-2021_01_07_425723	456	13	.	.	.
10_1101-2021_01_07_425723	457	1	AK	AK	NNP
10_1101-2021_01_07_425723	457	2	and	and	CC
10_1101-2021_01_07_425723	457	3	CM	CM	NNP
10_1101-2021_01_07_425723	457	4	contributed	contribute	VBD
10_1101-2021_01_07_425723	457	5	to	to	IN
10_1101-2021_01_07_425723	457	6	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	457	7	experiments	experiment	NNS
10_1101-2021_01_07_425723	457	8	and	and	CC
10_1101-2021_01_07_425723	457	9	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	457	10	705	705	CD
10_1101-2021_01_07_425723	457	11	studies	study	NNS
10_1101-2021_01_07_425723	457	12	.	.	.
10_1101-2021_01_07_425723	458	1	PdlT	PdlT	NNP
10_1101-2021_01_07_425723	458	2	performed	perform	VBD
10_1101-2021_01_07_425723	458	3	plasmid	plasmid	NN
10_1101-2021_01_07_425723	458	4	and	and	CC
10_1101-2021_01_07_425723	458	5	genome	genome	JJ
10_1101-2021_01_07_425723	458	6	sequencing	sequencing	NN
10_1101-2021_01_07_425723	458	7	.	.	.
10_1101-2021_01_07_425723	459	1	RO	RO	NNP
10_1101-2021_01_07_425723	459	2	contributed	contribute	VBD
10_1101-2021_01_07_425723	459	3	to	to	IN
10_1101-2021_01_07_425723	459	4	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	459	5	analysis	analysis	NN
10_1101-2021_01_07_425723	459	6	and	and	CC
10_1101-2021_01_07_425723	459	7	706	706	CD
10_1101-2021_01_07_425723	459	8	performed	perform	VBN
10_1101-2021_01_07_425723	459	9	sequence	sequence	NN
10_1101-2021_01_07_425723	459	10	annotation	annotation	NN
10_1101-2021_01_07_425723	459	11	and	and	CC
10_1101-2021_01_07_425723	459	12	assembly	assembly	NN
10_1101-2021_01_07_425723	459	13	.	.	.
10_1101-2021_01_07_425723	460	1	707	707	CD
10_1101-2021_01_07_425723	460	2	Acknowledgements	acknowledgement	NNS
10_1101-2021_01_07_425723	460	3	708	708	CD
10_1101-2021_01_07_425723	460	4	We	-PRON-	PRP
10_1101-2021_01_07_425723	460	5	thank	thank	VBP
10_1101-2021_01_07_425723	460	6	Mark	Mark	NNP
10_1101-2021_01_07_425723	460	7	Bisschops	Bisschops	NNP
10_1101-2021_01_07_425723	460	8	and	and	CC
10_1101-2021_01_07_425723	460	9	Hannes	Hannes	NNP
10_1101-2021_01_07_425723	460	10	Jürgens	Jürgens	NNP
10_1101-2021_01_07_425723	460	11	for	for	IN
10_1101-2021_01_07_425723	460	12	fruitful	fruitful	JJ
10_1101-2021_01_07_425723	460	13	discussions	discussion	NNS
10_1101-2021_01_07_425723	460	14	.	.	.
10_1101-2021_01_07_425723	461	1	We	-PRON-	PRP
10_1101-2021_01_07_425723	461	2	thank	thank	VBP
10_1101-2021_01_07_425723	461	3	Erik	Erik	NNP
10_1101-2021_01_07_425723	461	4	de	de	FW
10_1101-2021_01_07_425723	461	5	Hulster	Hulster	NNP
10_1101-2021_01_07_425723	461	6	for	for	IN
10_1101-2021_01_07_425723	461	7	709	709	CD
10_1101-2021_01_07_425723	461	8	fermentation	fermentation	NN
10_1101-2021_01_07_425723	461	9	support	support	NN
10_1101-2021_01_07_425723	461	10	and	and	CC
10_1101-2021_01_07_425723	461	11	Marcel	Marcel	NNP
10_1101-2021_01_07_425723	461	12	van	van	NNP
10_1101-2021_01_07_425723	461	13	den	den	NNP
10_1101-2021_01_07_425723	461	14	Broek	Broek	NNP
10_1101-2021_01_07_425723	461	15	for	for	IN
10_1101-2021_01_07_425723	461	16	input	input	NN
10_1101-2021_01_07_425723	461	17	on	on	IN
10_1101-2021_01_07_425723	461	18	the	the	DT
10_1101-2021_01_07_425723	461	19	bioinformatics	bioinformatic	NNS
10_1101-2021_01_07_425723	461	20	analyses	analysis	NNS
10_1101-2021_01_07_425723	461	21	.	.	.
10_1101-2021_01_07_425723	462	1	710	710	CD
10_1101-2021_01_07_425723	462	2	Competing	compete	VBG
10_1101-2021_01_07_425723	462	3	interest	interest	NN
10_1101-2021_01_07_425723	462	4	711	711	CD
10_1101-2021_01_07_425723	462	5	WD	WD	NNP
10_1101-2021_01_07_425723	462	6	and	and	CC
10_1101-2021_01_07_425723	462	7	JTP	JTP	NNP
10_1101-2021_01_07_425723	462	8	are	be	VBP
10_1101-2021_01_07_425723	462	9	co	co	NNS
10_1101-2021_01_07_425723	462	10	-	-	NNS
10_1101-2021_01_07_425723	462	11	inventors	inventor	NNS
10_1101-2021_01_07_425723	462	12	on	on	IN
10_1101-2021_01_07_425723	462	13	a	a	DT
10_1101-2021_01_07_425723	462	14	patent	patent	NN
10_1101-2021_01_07_425723	462	15	application	application	NN
10_1101-2021_01_07_425723	462	16	that	that	WDT
10_1101-2021_01_07_425723	462	17	covers	cover	VBZ
10_1101-2021_01_07_425723	462	18	aspects	aspect	NNS
10_1101-2021_01_07_425723	462	19	of	of	IN
10_1101-2021_01_07_425723	462	20	this	this	DT
10_1101-2021_01_07_425723	462	21	work	work	NN
10_1101-2021_01_07_425723	462	22	.	.	.
10_1101-2021_01_07_425723	463	1	The	the	DT
10_1101-2021_01_07_425723	463	2	authors	author	NNS
10_1101-2021_01_07_425723	463	3	712	712	CD
10_1101-2021_01_07_425723	463	4	declare	declare	VBP
10_1101-2021_01_07_425723	463	5	no	no	DT
10_1101-2021_01_07_425723	463	6	conflict	conflict	NN
10_1101-2021_01_07_425723	463	7	of	of	IN
10_1101-2021_01_07_425723	463	8	interest	interest	NN
10_1101-2021_01_07_425723	463	9	.	.	.
10_1101-2021_01_07_425723	464	1	713	713	CD
10_1101-2021_01_07_425723	464	2	Funding	funding	NN
10_1101-2021_01_07_425723	464	3	714	714	CD
10_1101-2021_01_07_425723	464	4	This	this	DT
10_1101-2021_01_07_425723	464	5	work	work	NN
10_1101-2021_01_07_425723	464	6	was	be	VBD
10_1101-2021_01_07_425723	464	7	supported	support	VBN
10_1101-2021_01_07_425723	464	8	by	by	IN
10_1101-2021_01_07_425723	464	9	Advanced	Advanced	NNP
10_1101-2021_01_07_425723	464	10	Grant	Grant	NNP
10_1101-2021_01_07_425723	464	11	(	(	-LRB-
10_1101-2021_01_07_425723	464	12	grant	grant	VB
10_1101-2021_01_07_425723	464	13	#	#	$
10_1101-2021_01_07_425723	464	14	694633	694633	CD
10_1101-2021_01_07_425723	464	15	)	)	-RRB-
10_1101-2021_01_07_425723	464	16	of	of	IN
10_1101-2021_01_07_425723	464	17	the	the	DT
10_1101-2021_01_07_425723	464	18	European	European	NNP
10_1101-2021_01_07_425723	464	19	Research	Research	NNP
10_1101-2021_01_07_425723	464	20	Council	Council	NNP
10_1101-2021_01_07_425723	464	21	to	to	IN
10_1101-2021_01_07_425723	464	22	JTP	JTP	NNP
10_1101-2021_01_07_425723	464	23	.	.	.
10_1101-2021_01_07_425723	465	1	715	715	CD
10_1101-2021_01_07_425723	465	2	.CC	.CC	NFP
10_1101-2021_01_07_425723	465	3	-	-	HYPH
10_1101-2021_01_07_425723	465	4	BY	by	IN
10_1101-2021_01_07_425723	465	5	-	-	HYPH
10_1101-2021_01_07_425723	465	6	NC	NC	NNP
10_1101-2021_01_07_425723	465	7	-	-	HYPH
10_1101-2021_01_07_425723	465	8	ND	ND	NNP
10_1101-2021_01_07_425723	465	9	4.0	4.0	CD
10_1101-2021_01_07_425723	465	10	International	International	NNP
10_1101-2021_01_07_425723	465	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	465	12	under	under	IN
10_1101-2021_01_07_425723	465	13	a	a	DT
10_1101-2021_01_07_425723	465	14	(	(	-LRB-
10_1101-2021_01_07_425723	465	15	which	which	WDT
10_1101-2021_01_07_425723	465	16	was	be	VBD
10_1101-2021_01_07_425723	465	17	not	not	RB
10_1101-2021_01_07_425723	465	18	certified	certify	VBN
10_1101-2021_01_07_425723	465	19	by	by	IN
10_1101-2021_01_07_425723	465	20	peer	peer	NN
10_1101-2021_01_07_425723	465	21	review	review	NN
10_1101-2021_01_07_425723	465	22	)	)	-RRB-
10_1101-2021_01_07_425723	465	23	is	be	VBZ
10_1101-2021_01_07_425723	465	24	the	the	DT
10_1101-2021_01_07_425723	465	25	author	author	NN
10_1101-2021_01_07_425723	465	26	/	/	SYM
10_1101-2021_01_07_425723	465	27	funder	funder	NN
10_1101-2021_01_07_425723	465	28	,	,	,
10_1101-2021_01_07_425723	465	29	who	who	WP
10_1101-2021_01_07_425723	465	30	has	have	VBZ
10_1101-2021_01_07_425723	465	31	granted	grant	VBN
10_1101-2021_01_07_425723	465	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	465	33	a	a	DT
10_1101-2021_01_07_425723	465	34	license	license	NN
10_1101-2021_01_07_425723	465	35	to	to	TO
10_1101-2021_01_07_425723	465	36	display	display	VB
10_1101-2021_01_07_425723	465	37	the	the	DT
10_1101-2021_01_07_425723	465	38	preprint	preprint	NN
10_1101-2021_01_07_425723	465	39	in	in	IN
10_1101-2021_01_07_425723	465	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	465	41	.	.	.
10_1101-2021_01_07_425723	466	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	466	2	is	be	VBZ
10_1101-2021_01_07_425723	466	3	made	make	VBN
10_1101-2021_01_07_425723	466	4	The	the	DT
10_1101-2021_01_07_425723	466	5	copyright	copyright	NN
10_1101-2021_01_07_425723	466	6	holder	holder	NN
10_1101-2021_01_07_425723	466	7	for	for	IN
10_1101-2021_01_07_425723	466	8	this	this	DT
10_1101-2021_01_07_425723	466	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	466	10	version	version	NN
10_1101-2021_01_07_425723	466	11	posted	post	VBD
10_1101-2021_01_07_425723	466	12	January	January	NNP
10_1101-2021_01_07_425723	466	13	8	8	CD
10_1101-2021_01_07_425723	466	14	,	,	,
10_1101-2021_01_07_425723	466	15	2021	2021	CD
10_1101-2021_01_07_425723	466	16	.	.	.
10_1101-2021_01_07_425723	466	17	;	;	:
10_1101-2021_01_07_425723	466	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	466	19	:	:	:
10_1101-2021_01_07_425723	466	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	466	21	preprint	preprint	NN
10_1101-2021_01_07_425723	466	22	https://gitlab.tudelft.nl/rortizmerino/kmar_anaerobic	https://gitlab.tudelft.nl/rortizmerino/kmar_anaerobic	-RRB-
10_1101-2021_01_07_425723	466	23	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	466	24	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	466	25	40	40	CD
10_1101-2021_01_07_425723	466	26	References	reference	NNS
10_1101-2021_01_07_425723	466	27	716	716	CD
10_1101-2021_01_07_425723	466	28	1	1	CD
10_1101-2021_01_07_425723	466	29	.	.	.
10_1101-2021_01_07_425723	467	1	Annual	Annual	NNP
10_1101-2021_01_07_425723	467	2	World	World	NNP
10_1101-2021_01_07_425723	467	3	Fuel	Fuel	NNP
10_1101-2021_01_07_425723	467	4	Ethanol	Ethanol	NNP
10_1101-2021_01_07_425723	467	5	Production	Production	NNP
10_1101-2021_01_07_425723	467	6	.	.	.
10_1101-2021_01_07_425723	468	1	Renewable	renewable	JJ
10_1101-2021_01_07_425723	468	2	Fuels	Fuels	NNPS
10_1101-2021_01_07_425723	468	3	Association	Association	NNP
10_1101-2021_01_07_425723	468	4	(	(	-LRB-
10_1101-2021_01_07_425723	468	5	2020	2020	CD
10_1101-2021_01_07_425723	468	6	)	)	-RRB-
10_1101-2021_01_07_425723	468	7	.	.	.
10_1101-2021_01_07_425723	469	1	Available	available	JJ
10_1101-2021_01_07_425723	469	2	at	at	IN
10_1101-2021_01_07_425723	469	3	:	:	:
10_1101-2021_01_07_425723	469	4	717	717	CD
10_1101-2021_01_07_425723	469	5	https://ethanolrfa.org/statistics/annual-ethanol-production/.	https://ethanolrfa.org/statistics/annual-ethanol-production/.	.
10_1101-2021_01_07_425723	470	1	(	(	-LRB-
10_1101-2021_01_07_425723	470	2	Accessed	access	VBN
10_1101-2021_01_07_425723	470	3	:	:	:
10_1101-2021_01_07_425723	470	4	2nd	2nd	JJ
10_1101-2021_01_07_425723	470	5	May	May	NNP
10_1101-2021_01_07_425723	470	6	2020	2020	CD
10_1101-2021_01_07_425723	470	7	)	)	-RRB-
10_1101-2021_01_07_425723	470	8	718	718	CD
10_1101-2021_01_07_425723	470	9	2	2	CD
10_1101-2021_01_07_425723	470	10	.	.	.
10_1101-2021_01_07_425723	471	1	Jansen	Jansen	NNP
10_1101-2021_01_07_425723	471	2	,	,	,
10_1101-2021_01_07_425723	471	3	M.	M.	NNP
10_1101-2021_01_07_425723	471	4	L.	L.	NNP
10_1101-2021_01_07_425723	471	5	A.	A.	NNP
10_1101-2021_01_07_425723	471	6	et	et	FW
10_1101-2021_01_07_425723	471	7	al	al	NNP
10_1101-2021_01_07_425723	471	8	.	.	.
10_1101-2021_01_07_425723	472	1	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	472	2	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	472	3	strains	strain	VBZ
10_1101-2021_01_07_425723	472	4	for	for	IN
10_1101-2021_01_07_425723	472	5	second	second	JJ
10_1101-2021_01_07_425723	472	6	-	-	HYPH
10_1101-2021_01_07_425723	472	7	generation	generation	NN
10_1101-2021_01_07_425723	472	8	ethanol	ethanol	NN
10_1101-2021_01_07_425723	472	9	719	719	CD
10_1101-2021_01_07_425723	472	10	production	production	NN
10_1101-2021_01_07_425723	472	11	:	:	:
10_1101-2021_01_07_425723	472	12	from	from	IN
10_1101-2021_01_07_425723	472	13	academic	academic	JJ
10_1101-2021_01_07_425723	472	14	exploration	exploration	NN
10_1101-2021_01_07_425723	472	15	to	to	IN
10_1101-2021_01_07_425723	472	16	industrial	industrial	JJ
10_1101-2021_01_07_425723	472	17	implementation	implementation	NN
10_1101-2021_01_07_425723	472	18	.	.	.
10_1101-2021_01_07_425723	473	1	FEMS	FEMS	NNP
10_1101-2021_01_07_425723	473	2	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	473	3	Res	res	NN
10_1101-2021_01_07_425723	473	4	.	.	.
10_1101-2021_01_07_425723	474	1	17	17	CD
10_1101-2021_01_07_425723	474	2	,	,	,
10_1101-2021_01_07_425723	474	3	1–20	1–20	CD
10_1101-2021_01_07_425723	474	4	720	720	CD
10_1101-2021_01_07_425723	474	5	(	(	-LRB-
10_1101-2021_01_07_425723	474	6	2017	2017	CD
10_1101-2021_01_07_425723	474	7	)	)	-RRB-
10_1101-2021_01_07_425723	474	8	.	.	.
10_1101-2021_01_07_425723	475	1	721	721	CD
10_1101-2021_01_07_425723	475	2	3	3	CD
10_1101-2021_01_07_425723	475	3	.	.	.
10_1101-2021_01_07_425723	476	1	Weusthuis	Weusthuis	NNP
10_1101-2021_01_07_425723	476	2	,	,	,
10_1101-2021_01_07_425723	476	3	R.	R.	NNP
10_1101-2021_01_07_425723	476	4	A.	A.	NNP
10_1101-2021_01_07_425723	476	5	,	,	,
10_1101-2021_01_07_425723	476	6	Lamot	Lamot	NNP
10_1101-2021_01_07_425723	476	7	,	,	,
10_1101-2021_01_07_425723	476	8	I.	I.	NNP
10_1101-2021_01_07_425723	476	9	,	,	,
10_1101-2021_01_07_425723	476	10	van	van	NNP
10_1101-2021_01_07_425723	476	11	der	der	NNP
10_1101-2021_01_07_425723	476	12	Oost	Oost	NNP
10_1101-2021_01_07_425723	476	13	,	,	,
10_1101-2021_01_07_425723	476	14	J.	J.	NNP
10_1101-2021_01_07_425723	477	1	&	&	CC
10_1101-2021_01_07_425723	477	2	Sanders	Sanders	NNP
10_1101-2021_01_07_425723	477	3	,	,	,
10_1101-2021_01_07_425723	477	4	J.	J.	NNP
10_1101-2021_01_07_425723	477	5	P.	P.	NNP
10_1101-2021_01_07_425723	477	6	M.	M.	NNP
10_1101-2021_01_07_425723	477	7	Microbial	Microbial	NNP
10_1101-2021_01_07_425723	477	8	production	production	NN
10_1101-2021_01_07_425723	477	9	of	of	IN
10_1101-2021_01_07_425723	477	10	bulk	bulk	NN
10_1101-2021_01_07_425723	477	11	722	722	CD
10_1101-2021_01_07_425723	477	12	chemicals	chemical	NNS
10_1101-2021_01_07_425723	477	13	:	:	:
10_1101-2021_01_07_425723	477	14	development	development	NN
10_1101-2021_01_07_425723	477	15	of	of	IN
10_1101-2021_01_07_425723	477	16	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	477	17	processes	process	NNS
10_1101-2021_01_07_425723	477	18	.	.	.
10_1101-2021_01_07_425723	478	1	Trends	Trends	NNPS
10_1101-2021_01_07_425723	478	2	Biotechnol	Biotechnol	NNP
10_1101-2021_01_07_425723	478	3	.	.	.
10_1101-2021_01_07_425723	479	1	29	29	CD
10_1101-2021_01_07_425723	479	2	,	,	,
10_1101-2021_01_07_425723	479	3	153–158	153–158	CD
10_1101-2021_01_07_425723	479	4	(	(	-LRB-
10_1101-2021_01_07_425723	479	5	2011	2011	CD
10_1101-2021_01_07_425723	479	6	)	)	-RRB-
10_1101-2021_01_07_425723	479	7	.	.	.
10_1101-2021_01_07_425723	480	1	723	723	CD
10_1101-2021_01_07_425723	480	2	4	4	CD
10_1101-2021_01_07_425723	480	3	.	.	.
10_1101-2021_01_07_425723	481	1	Favaro	Favaro	NNP
10_1101-2021_01_07_425723	481	2	,	,	,
10_1101-2021_01_07_425723	481	3	L.	L.	NNP
10_1101-2021_01_07_425723	481	4	,	,	,
10_1101-2021_01_07_425723	481	5	Jansen	Jansen	NNP
10_1101-2021_01_07_425723	481	6	,	,	,
10_1101-2021_01_07_425723	481	7	T.	T.	NNP
10_1101-2021_01_07_425723	481	8	&	&	CC
10_1101-2021_01_07_425723	481	9	van	van	NNP
10_1101-2021_01_07_425723	481	10	Zyl	Zyl	NNP
10_1101-2021_01_07_425723	481	11	,	,	,
10_1101-2021_01_07_425723	481	12	W.	W.	NNP
10_1101-2021_01_07_425723	481	13	H.	H.	NNP
10_1101-2021_01_07_425723	481	14	Exploring	Exploring	NNP
10_1101-2021_01_07_425723	481	15	industrial	industrial	JJ
10_1101-2021_01_07_425723	481	16	and	and	CC
10_1101-2021_01_07_425723	481	17	natural	natural	JJ
10_1101-2021_01_07_425723	481	18	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_07_425723	481	19	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	481	20	724	724	CD
10_1101-2021_01_07_425723	481	21	strains	strain	NNS
10_1101-2021_01_07_425723	481	22	for	for	IN
10_1101-2021_01_07_425723	481	23	the	the	DT
10_1101-2021_01_07_425723	481	24	bio	bio	NNP
10_1101-2021_01_07_425723	481	25	-	-	HYPH
10_1101-2021_01_07_425723	481	26	based	base	VBN
10_1101-2021_01_07_425723	481	27	economy	economy	NN
10_1101-2021_01_07_425723	481	28	from	from	IN
10_1101-2021_01_07_425723	481	29	biomass	biomass	NN
10_1101-2021_01_07_425723	481	30	:	:	:
10_1101-2021_01_07_425723	481	31	the	the	DT
10_1101-2021_01_07_425723	481	32	case	case	NN
10_1101-2021_01_07_425723	481	33	of	of	IN
10_1101-2021_01_07_425723	481	34	bioethanol	bioethanol	NN
10_1101-2021_01_07_425723	481	35	.	.	.
10_1101-2021_01_07_425723	482	1	Crit	Crit	NNP
10_1101-2021_01_07_425723	482	2	.	.	.
10_1101-2021_01_07_425723	483	1	Rev.	Rev.	NNP
10_1101-2021_01_07_425723	484	1	Biotechnol	Biotechnol	NNS
10_1101-2021_01_07_425723	484	2	.	.	.
10_1101-2021_01_07_425723	485	1	39	39	CD
10_1101-2021_01_07_425723	485	2	,	,	,
10_1101-2021_01_07_425723	485	3	725	725	CD
10_1101-2021_01_07_425723	485	4	800–816	800–816	CD
10_1101-2021_01_07_425723	485	5	(	(	-LRB-
10_1101-2021_01_07_425723	485	6	2019	2019	CD
10_1101-2021_01_07_425723	485	7	)	)	-RRB-
10_1101-2021_01_07_425723	485	8	.	.	.
10_1101-2021_01_07_425723	486	1	726	726	CD
10_1101-2021_01_07_425723	486	2	5	5	CD
10_1101-2021_01_07_425723	486	3	.	.	.
10_1101-2021_01_07_425723	487	1	Stovicek	Stovicek	NNP
10_1101-2021_01_07_425723	487	2	,	,	,
10_1101-2021_01_07_425723	487	3	V.	V.	NNP
10_1101-2021_01_07_425723	487	4	,	,	,
10_1101-2021_01_07_425723	487	5	Holkenbrink	Holkenbrink	NNP
10_1101-2021_01_07_425723	487	6	,	,	,
10_1101-2021_01_07_425723	487	7	C.	C.	NNP
10_1101-2021_01_07_425723	487	8	&	&	CC
10_1101-2021_01_07_425723	487	9	Borodina	Borodina	NNP
10_1101-2021_01_07_425723	487	10	,	,	,
10_1101-2021_01_07_425723	487	11	I.	I.	NNP
10_1101-2021_01_07_425723	487	12	CRISPR	CRISPR	NNP
10_1101-2021_01_07_425723	487	13	/	/	SYM
10_1101-2021_01_07_425723	487	14	Cas	Cas	NNP
10_1101-2021_01_07_425723	487	15	system	system	NN
10_1101-2021_01_07_425723	487	16	for	for	IN
10_1101-2021_01_07_425723	487	17	yeast	yeast	NN
10_1101-2021_01_07_425723	487	18	genome	genome	JJ
10_1101-2021_01_07_425723	487	19	engineering	engineering	NN
10_1101-2021_01_07_425723	487	20	:	:	:
10_1101-2021_01_07_425723	487	21	727	727	CD
10_1101-2021_01_07_425723	487	22	advances	advance	NNS
10_1101-2021_01_07_425723	487	23	and	and	CC
10_1101-2021_01_07_425723	487	24	applications	application	NNS
10_1101-2021_01_07_425723	487	25	.	.	.
10_1101-2021_01_07_425723	488	1	FEMS	FEMS	NNP
10_1101-2021_01_07_425723	488	2	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	488	3	Res	res	NN
10_1101-2021_01_07_425723	488	4	.	.	.
10_1101-2021_01_07_425723	489	1	17	17	CD
10_1101-2021_01_07_425723	489	2	,	,	,
10_1101-2021_01_07_425723	489	3	1–16	1–16	CD
10_1101-2021_01_07_425723	489	4	(	(	-LRB-
10_1101-2021_01_07_425723	489	5	2017	2017	CD
10_1101-2021_01_07_425723	489	6	)	)	-RRB-
10_1101-2021_01_07_425723	489	7	.	.	.
10_1101-2021_01_07_425723	490	1	728	728	CD
10_1101-2021_01_07_425723	490	2	6	6	CD
10_1101-2021_01_07_425723	490	3	.	.	.
10_1101-2021_01_07_425723	491	1	Hong	Hong	NNP
10_1101-2021_01_07_425723	491	2	,	,	,
10_1101-2021_01_07_425723	491	3	J.	J.	NNP
10_1101-2021_01_07_425723	491	4	,	,	,
10_1101-2021_01_07_425723	491	5	Wang	Wang	NNP
10_1101-2021_01_07_425723	491	6	,	,	,
10_1101-2021_01_07_425723	491	7	Y.	Y.	NNP
10_1101-2021_01_07_425723	491	8	,	,	,
10_1101-2021_01_07_425723	491	9	Kumagai	Kumagai	NNP
10_1101-2021_01_07_425723	491	10	,	,	,
10_1101-2021_01_07_425723	491	11	H.	H.	NNP
10_1101-2021_01_07_425723	491	12	&	&	CC
10_1101-2021_01_07_425723	491	13	Tamaki	Tamaki	NNP
10_1101-2021_01_07_425723	491	14	,	,	,
10_1101-2021_01_07_425723	491	15	H.	H.	NNP
10_1101-2021_01_07_425723	491	16	Construction	Construction	NNP
10_1101-2021_01_07_425723	491	17	of	of	IN
10_1101-2021_01_07_425723	491	18	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	491	19	yeast	yeast	NN
10_1101-2021_01_07_425723	491	20	expressing	express	VBG
10_1101-2021_01_07_425723	491	21	729	729	CD
10_1101-2021_01_07_425723	491	22	thermostable	thermostable	JJ
10_1101-2021_01_07_425723	491	23	cellulase	cellulase	NN
10_1101-2021_01_07_425723	491	24	genes	gene	NNS
10_1101-2021_01_07_425723	491	25	.	.	.
10_1101-2021_01_07_425723	492	1	J.	J.	NNP
10_1101-2021_01_07_425723	492	2	Biotechnol	Biotechnol	NNP
10_1101-2021_01_07_425723	492	3	.	.	.
10_1101-2021_01_07_425723	493	1	130	130	CD
10_1101-2021_01_07_425723	493	2	,	,	,
10_1101-2021_01_07_425723	493	3	114–123	114–123	CD
10_1101-2021_01_07_425723	493	4	(	(	-LRB-
10_1101-2021_01_07_425723	493	5	2007	2007	CD
10_1101-2021_01_07_425723	493	6	)	)	-RRB-
10_1101-2021_01_07_425723	493	7	.	.	.
10_1101-2021_01_07_425723	494	1	730	730	CD
10_1101-2021_01_07_425723	494	2	7	7	CD
10_1101-2021_01_07_425723	494	3	.	.	.
10_1101-2021_01_07_425723	495	1	Laman	Laman	NNP
10_1101-2021_01_07_425723	495	2	Trip	Trip	NNP
10_1101-2021_01_07_425723	495	3	,	,	,
10_1101-2021_01_07_425723	495	4	D.	D.	NNP
10_1101-2021_01_07_425723	495	5	S.	S.	NNP
10_1101-2021_01_07_425723	495	6	&	&	CC
10_1101-2021_01_07_425723	495	7	Youk	Youk	NNP
10_1101-2021_01_07_425723	495	8	,	,	,
10_1101-2021_01_07_425723	495	9	H.	H.	NNP
10_1101-2021_01_07_425723	495	10	Yeasts	Yeasts	NNPS
10_1101-2021_01_07_425723	495	11	collectively	collectively	RB
10_1101-2021_01_07_425723	495	12	extend	extend	VBP
10_1101-2021_01_07_425723	495	13	the	the	DT
10_1101-2021_01_07_425723	495	14	limits	limit	NNS
10_1101-2021_01_07_425723	495	15	of	of	IN
10_1101-2021_01_07_425723	495	16	habitable	habitable	JJ
10_1101-2021_01_07_425723	495	17	temperatures	temperature	NNS
10_1101-2021_01_07_425723	495	18	by	by	IN
10_1101-2021_01_07_425723	495	19	731	731	CD
10_1101-2021_01_07_425723	495	20	secreting	secrete	VBG
10_1101-2021_01_07_425723	495	21	glutathione	glutathione	NN
10_1101-2021_01_07_425723	495	22	.	.	.
10_1101-2021_01_07_425723	496	1	Nat	Nat	NNP
10_1101-2021_01_07_425723	496	2	.	.	.
10_1101-2021_01_07_425723	497	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	497	2	.	.	.
10_1101-2021_01_07_425723	498	1	5	5	CD
10_1101-2021_01_07_425723	498	2	,	,	,
10_1101-2021_01_07_425723	498	3	943–954	943–954	CD
10_1101-2021_01_07_425723	498	4	(	(	-LRB-
10_1101-2021_01_07_425723	498	5	2020	2020	CD
10_1101-2021_01_07_425723	498	6	)	)	-RRB-
10_1101-2021_01_07_425723	498	7	.	.	.
10_1101-2021_01_07_425723	499	1	732	732	CD
10_1101-2021_01_07_425723	499	2	8	8	CD
10_1101-2021_01_07_425723	499	3	.	.	.
10_1101-2021_01_07_425723	500	1	Choudhary	Choudhary	NNP
10_1101-2021_01_07_425723	500	2	,	,	,
10_1101-2021_01_07_425723	500	3	J.	J.	NNP
10_1101-2021_01_07_425723	500	4	,	,	,
10_1101-2021_01_07_425723	500	5	Singh	Singh	NNP
10_1101-2021_01_07_425723	500	6	,	,	,
10_1101-2021_01_07_425723	500	7	S.	S.	NNP
10_1101-2021_01_07_425723	500	8	&	&	CC
10_1101-2021_01_07_425723	500	9	Nain	Nain	NNP
10_1101-2021_01_07_425723	500	10	,	,	,
10_1101-2021_01_07_425723	500	11	L.	L.	NNP
10_1101-2021_01_07_425723	500	12	Thermotolerant	Thermotolerant	NNP
10_1101-2021_01_07_425723	500	13	fermenting	ferment	VBG
10_1101-2021_01_07_425723	500	14	yeasts	yeast	NNS
10_1101-2021_01_07_425723	500	15	for	for	IN
10_1101-2021_01_07_425723	500	16	simultaneous	simultaneous	JJ
10_1101-2021_01_07_425723	500	17	733	733	CD
10_1101-2021_01_07_425723	500	18	saccharification	saccharification	NN
10_1101-2021_01_07_425723	500	19	fermentation	fermentation	NN
10_1101-2021_01_07_425723	500	20	of	of	IN
10_1101-2021_01_07_425723	500	21	lignocellulosic	lignocellulosic	NN
10_1101-2021_01_07_425723	500	22	biomass	biomass	NN
10_1101-2021_01_07_425723	500	23	.	.	.
10_1101-2021_01_07_425723	501	1	Electron	Electron	NNP
10_1101-2021_01_07_425723	501	2	.	.	.
10_1101-2021_01_07_425723	502	1	J.	J.	NNP
10_1101-2021_01_07_425723	502	2	Biotechnol	Biotechnol	NNP
10_1101-2021_01_07_425723	502	3	.	.	.
10_1101-2021_01_07_425723	503	1	21	21	CD
10_1101-2021_01_07_425723	503	2	,	,	,
10_1101-2021_01_07_425723	503	3	82–92	82–92	CD
10_1101-2021_01_07_425723	503	4	(	(	-LRB-
10_1101-2021_01_07_425723	503	5	2016	2016	CD
10_1101-2021_01_07_425723	503	6	)	)	-RRB-
10_1101-2021_01_07_425723	503	7	.	.	.
10_1101-2021_01_07_425723	504	1	734	734	CD
10_1101-2021_01_07_425723	504	2	9	9	CD
10_1101-2021_01_07_425723	504	3	.	.	.
10_1101-2021_01_07_425723	505	1	Thorwall	Thorwall	NNP
10_1101-2021_01_07_425723	505	2	,	,	,
10_1101-2021_01_07_425723	505	3	S.	S.	NNP
10_1101-2021_01_07_425723	505	4	,	,	,
10_1101-2021_01_07_425723	505	5	Schwartz	Schwartz	NNP
10_1101-2021_01_07_425723	505	6	,	,	,
10_1101-2021_01_07_425723	505	7	C.	C.	NNP
10_1101-2021_01_07_425723	505	8	,	,	,
10_1101-2021_01_07_425723	505	9	Chartron	Chartron	NNP
10_1101-2021_01_07_425723	505	10	,	,	,
10_1101-2021_01_07_425723	505	11	J.	J.	NNP
10_1101-2021_01_07_425723	505	12	W.	W.	NNP
10_1101-2021_01_07_425723	505	13	&	&	CC
10_1101-2021_01_07_425723	505	14	Wheeldon	Wheeldon	NNP
10_1101-2021_01_07_425723	505	15	,	,	,
10_1101-2021_01_07_425723	505	16	I.	I.	NNP
10_1101-2021_01_07_425723	505	17	Stress	stress	NN
10_1101-2021_01_07_425723	505	18	-	-	HYPH
10_1101-2021_01_07_425723	505	19	tolerant	tolerant	JJ
10_1101-2021_01_07_425723	505	20	non	non	JJ
10_1101-2021_01_07_425723	505	21	-	-	JJ
10_1101-2021_01_07_425723	505	22	conventional	conventional	JJ
10_1101-2021_01_07_425723	505	23	735	735	CD
10_1101-2021_01_07_425723	505	24	microbes	microbe	NNS
10_1101-2021_01_07_425723	505	25	enable	enable	VBP
10_1101-2021_01_07_425723	505	26	next	next	JJ
10_1101-2021_01_07_425723	505	27	-	-	HYPH
10_1101-2021_01_07_425723	505	28	generation	generation	NN
10_1101-2021_01_07_425723	505	29	chemical	chemical	NN
10_1101-2021_01_07_425723	505	30	biosynthesis	biosynthesis	NN
10_1101-2021_01_07_425723	505	31	.	.	.
10_1101-2021_01_07_425723	506	1	Nat	Nat	NNP
10_1101-2021_01_07_425723	506	2	.	.	.
10_1101-2021_01_07_425723	507	1	Chem	Chem	NNP
10_1101-2021_01_07_425723	507	2	.	.	.
10_1101-2021_01_07_425723	508	1	Biol	Biol	NNP
10_1101-2021_01_07_425723	508	2	.	.	.
10_1101-2021_01_07_425723	509	1	16	16	CD
10_1101-2021_01_07_425723	509	2	,	,	,
10_1101-2021_01_07_425723	509	3	113–121	113–121	CD
10_1101-2021_01_07_425723	509	4	(	(	-LRB-
10_1101-2021_01_07_425723	509	5	2020	2020	CD
10_1101-2021_01_07_425723	509	6	)	)	-RRB-
10_1101-2021_01_07_425723	509	7	.	.	.
10_1101-2021_01_07_425723	510	1	736	736	CD
10_1101-2021_01_07_425723	510	2	10	10	CD
10_1101-2021_01_07_425723	510	3	.	.	.
10_1101-2021_01_07_425723	511	1	Mejía	Mejía	NNP
10_1101-2021_01_07_425723	511	2	-	-	HYPH
10_1101-2021_01_07_425723	511	3	Barajas	Barajas	NNP
10_1101-2021_01_07_425723	511	4	,	,	,
10_1101-2021_01_07_425723	511	5	J.	J.	NNP
10_1101-2021_01_07_425723	512	1	A.	A.	NNP
10_1101-2021_01_07_425723	512	2	et	et	FW
10_1101-2021_01_07_425723	512	3	al	al	NNP
10_1101-2021_01_07_425723	512	4	.	.	.
10_1101-2021_01_07_425723	513	1	Second	second	JJ
10_1101-2021_01_07_425723	513	2	-	-	HYPH
10_1101-2021_01_07_425723	513	3	Generation	Generation	NNP
10_1101-2021_01_07_425723	513	4	Bioethanol	Bioethanol	NNP
10_1101-2021_01_07_425723	513	5	Production	Production	NNP
10_1101-2021_01_07_425723	513	6	through	through	IN
10_1101-2021_01_07_425723	513	7	a	a	DT
10_1101-2021_01_07_425723	513	8	Simultaneous	simultaneous	JJ
10_1101-2021_01_07_425723	513	9	737	737	CD
10_1101-2021_01_07_425723	513	10	Saccharification	Saccharification	NNP
10_1101-2021_01_07_425723	513	11	-	-	HYPH
10_1101-2021_01_07_425723	513	12	Fermentation	fermentation	NN
10_1101-2021_01_07_425723	513	13	Process	Process	NNP
10_1101-2021_01_07_425723	513	14	Using	Using	NNP
10_1101-2021_01_07_425723	513	15	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	513	16	Marxianus	Marxianus	NNP
10_1101-2021_01_07_425723	513	17	Thermotolerant	Thermotolerant	NNP
10_1101-2021_01_07_425723	513	18	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	513	19	.	.	.
10_1101-2021_01_07_425723	514	1	in	in	IN
10_1101-2021_01_07_425723	514	2	738	738	CD
10_1101-2021_01_07_425723	514	3	Special	Special	NNP
10_1101-2021_01_07_425723	514	4	Topics	Topics	NNPS
10_1101-2021_01_07_425723	514	5	in	in	IN
10_1101-2021_01_07_425723	514	6	Renewable	renewable	JJ
10_1101-2021_01_07_425723	514	7	Energy	Energy	NNP
10_1101-2021_01_07_425723	514	8	Systems	Systems	NNPS
10_1101-2021_01_07_425723	514	9	(	(	-LRB-
10_1101-2021_01_07_425723	514	10	InTech	InTech	NNP
10_1101-2021_01_07_425723	514	11	,	,	,
10_1101-2021_01_07_425723	514	12	2018	2018	CD
10_1101-2021_01_07_425723	514	13	)	)	-RRB-
10_1101-2021_01_07_425723	514	14	.	.	.
10_1101-2021_01_07_425723	515	1	doi:10.5772	doi:10.5772	NNP
10_1101-2021_01_07_425723	515	2	/	/	SYM
10_1101-2021_01_07_425723	515	3	intechopen.78052	intechopen.78052	NNP
10_1101-2021_01_07_425723	515	4	739	739	CD
10_1101-2021_01_07_425723	515	5	11	11	CD
10_1101-2021_01_07_425723	515	6	.	.	.
10_1101-2021_01_07_425723	516	1	Snoek	Snoek	NNP
10_1101-2021_01_07_425723	516	2	,	,	,
10_1101-2021_01_07_425723	516	3	I.	I.	NNP
10_1101-2021_01_07_425723	516	4	S.	S.	NNP
10_1101-2021_01_07_425723	516	5	I.	I.	NNP
10_1101-2021_01_07_425723	517	1	&	&	CC
10_1101-2021_01_07_425723	517	2	Steensma	Steensma	NNP
10_1101-2021_01_07_425723	517	3	,	,	,
10_1101-2021_01_07_425723	517	4	H.	H.	NNP
10_1101-2021_01_07_425723	517	5	Y.	Y.	NNP
10_1101-2021_01_07_425723	518	1	Why	why	WRB
10_1101-2021_01_07_425723	518	2	does	do	VBZ
10_1101-2021_01_07_425723	518	3	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	518	4	lactis	lactis	RB
10_1101-2021_01_07_425723	518	5	not	not	RB
10_1101-2021_01_07_425723	518	6	grow	grow	VB
10_1101-2021_01_07_425723	518	7	under	under	IN
10_1101-2021_01_07_425723	518	8	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	518	9	740	740	CD
10_1101-2021_01_07_425723	518	10	conditions	condition	NNS
10_1101-2021_01_07_425723	518	11	?	?	.
10_1101-2021_01_07_425723	519	1	Comparison	comparison	NN
10_1101-2021_01_07_425723	519	2	of	of	IN
10_1101-2021_01_07_425723	519	3	essential	essential	JJ
10_1101-2021_01_07_425723	519	4	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	519	5	genes	gene	NNS
10_1101-2021_01_07_425723	519	6	of	of	IN
10_1101-2021_01_07_425723	519	7	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_07_425723	519	8	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	519	9	with	with	IN
10_1101-2021_01_07_425723	519	10	the	the	DT
10_1101-2021_01_07_425723	519	11	741	741	CD
10_1101-2021_01_07_425723	519	12	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	519	13	lactis	lactis	JJ
10_1101-2021_01_07_425723	519	14	genome	genome	NN
10_1101-2021_01_07_425723	519	15	.	.	.
10_1101-2021_01_07_425723	520	1	FEMS	FEMS	NNP
10_1101-2021_01_07_425723	520	2	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	520	3	Res	res	NN
10_1101-2021_01_07_425723	520	4	.	.	.
10_1101-2021_01_07_425723	521	1	6	6	CD
10_1101-2021_01_07_425723	521	2	,	,	,
10_1101-2021_01_07_425723	521	3	393–403	393–403	CD
10_1101-2021_01_07_425723	521	4	(	(	-LRB-
10_1101-2021_01_07_425723	521	5	2006	2006	CD
10_1101-2021_01_07_425723	521	6	)	)	-RRB-
10_1101-2021_01_07_425723	521	7	.	.	.
10_1101-2021_01_07_425723	522	1	742	742	CD
10_1101-2021_01_07_425723	522	2	12	12	CD
10_1101-2021_01_07_425723	522	3	.	.	.
10_1101-2021_01_07_425723	523	1	Visser	Visser	NNP
10_1101-2021_01_07_425723	523	2	,	,	,
10_1101-2021_01_07_425723	523	3	W.	W.	NNP
10_1101-2021_01_07_425723	523	4	,	,	,
10_1101-2021_01_07_425723	523	5	Scheffers	Scheffers	NNP
10_1101-2021_01_07_425723	523	6	,	,	,
10_1101-2021_01_07_425723	523	7	W.	W.	NNP
10_1101-2021_01_07_425723	523	8	A.	A.	NNP
10_1101-2021_01_07_425723	523	9	,	,	,
10_1101-2021_01_07_425723	523	10	Batenburg	Batenburg	NNP
10_1101-2021_01_07_425723	523	11	-	-	HYPH
10_1101-2021_01_07_425723	523	12	Van	Van	NNP
10_1101-2021_01_07_425723	523	13	der	der	NN
10_1101-2021_01_07_425723	523	14	Vegte	Vegte	NNP
10_1101-2021_01_07_425723	523	15	,	,	,
10_1101-2021_01_07_425723	523	16	W.	W.	NNP
10_1101-2021_01_07_425723	523	17	H.	H.	NNP
10_1101-2021_01_07_425723	523	18	&	&	CC
10_1101-2021_01_07_425723	523	19	Van	Van	NNP
10_1101-2021_01_07_425723	523	20	Dijken	Dijken	NNP
10_1101-2021_01_07_425723	523	21	,	,	,
10_1101-2021_01_07_425723	523	22	J.	J.	NNP
10_1101-2021_01_07_425723	523	23	P.	P.	NNP
10_1101-2021_01_07_425723	523	24	Oxygen	Oxygen	NNP
10_1101-2021_01_07_425723	523	25	743	743	CD
10_1101-2021_01_07_425723	523	26	requirements	requirement	NNS
10_1101-2021_01_07_425723	523	27	of	of	IN
10_1101-2021_01_07_425723	523	28	yeasts	yeast	NNS
10_1101-2021_01_07_425723	523	29	.	.	.
10_1101-2021_01_07_425723	524	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	524	2	.	.	.
10_1101-2021_01_07_425723	525	1	Environ	Environ	NNP
10_1101-2021_01_07_425723	525	2	.	.	.
10_1101-2021_01_07_425723	526	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	526	2	.	.	.
10_1101-2021_01_07_425723	527	1	56	56	CD
10_1101-2021_01_07_425723	527	2	,	,	,
10_1101-2021_01_07_425723	527	3	3785–3792	3785–3792	CD
10_1101-2021_01_07_425723	527	4	(	(	-LRB-
10_1101-2021_01_07_425723	527	5	1990	1990	CD
10_1101-2021_01_07_425723	527	6	)	)	-RRB-
10_1101-2021_01_07_425723	527	7	.	.	.
10_1101-2021_01_07_425723	528	1	744	744	CD
10_1101-2021_01_07_425723	528	2	13	13	CD
10_1101-2021_01_07_425723	528	3	.	.	.
10_1101-2021_01_07_425723	529	1	Merico	Merico	NNP
10_1101-2021_01_07_425723	529	2	,	,	,
10_1101-2021_01_07_425723	529	3	A.	a.	NN
10_1101-2021_01_07_425723	529	4	,	,	,
10_1101-2021_01_07_425723	529	5	Sulo	Sulo	NNP
10_1101-2021_01_07_425723	529	6	,	,	,
10_1101-2021_01_07_425723	529	7	P.	P.	NNP
10_1101-2021_01_07_425723	529	8	,	,	,
10_1101-2021_01_07_425723	529	9	Piškur	Piškur	NNP
10_1101-2021_01_07_425723	529	10	,	,	,
10_1101-2021_01_07_425723	529	11	J.	J.	NNP
10_1101-2021_01_07_425723	530	1	&	&	CC
10_1101-2021_01_07_425723	530	2	Compagno	Compagno	NNP
10_1101-2021_01_07_425723	530	3	,	,	,
10_1101-2021_01_07_425723	530	4	C.	C.	NNP
10_1101-2021_01_07_425723	530	5	Fermentative	Fermentative	NNP
10_1101-2021_01_07_425723	530	6	lifestyle	lifestyle	NN
10_1101-2021_01_07_425723	530	7	in	in	IN
10_1101-2021_01_07_425723	530	8	yeasts	yeast	NNS
10_1101-2021_01_07_425723	530	9	belonging	belong	VBG
10_1101-2021_01_07_425723	530	10	to	to	IN
10_1101-2021_01_07_425723	530	11	the	the	DT
10_1101-2021_01_07_425723	530	12	745	745	CD
10_1101-2021_01_07_425723	530	13	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_07_425723	530	14	complex	complex	JJ
10_1101-2021_01_07_425723	530	15	.	.	.
10_1101-2021_01_07_425723	531	1	FEBS	FEBS	NNP
10_1101-2021_01_07_425723	531	2	J.	J.	NNP
10_1101-2021_01_07_425723	532	1	274	274	CD
10_1101-2021_01_07_425723	532	2	,	,	,
10_1101-2021_01_07_425723	532	3	976–989	976–989	CD
10_1101-2021_01_07_425723	532	4	(	(	-LRB-
10_1101-2021_01_07_425723	532	5	2007	2007	CD
10_1101-2021_01_07_425723	532	6	)	)	-RRB-
10_1101-2021_01_07_425723	532	7	.	.	.
10_1101-2021_01_07_425723	533	1	746	746	CD
10_1101-2021_01_07_425723	533	2	14	14	CD
10_1101-2021_01_07_425723	533	3	.	.	.
10_1101-2021_01_07_425723	534	1	Andreasen	Andreasen	NNP
10_1101-2021_01_07_425723	534	2	,	,	,
10_1101-2021_01_07_425723	534	3	A.	a.	NN
10_1101-2021_01_07_425723	535	1	A.	A.	NNP
10_1101-2021_01_07_425723	536	1	&	&	CC
10_1101-2021_01_07_425723	536	2	Stier	Stier	NNP
10_1101-2021_01_07_425723	536	3	,	,	,
10_1101-2021_01_07_425723	536	4	T.	T.	NNP
10_1101-2021_01_07_425723	536	5	J.	J.	NNP
10_1101-2021_01_07_425723	537	1	B.	B.	NNP
10_1101-2021_01_07_425723	537	2	Anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	537	3	nutrition	nutrition	NN
10_1101-2021_01_07_425723	537	4	of	of	IN
10_1101-2021_01_07_425723	537	5	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	537	6	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	537	7	I.	I.	NNP
10_1101-2021_01_07_425723	537	8	Ergosterol	Ergosterol	NNP
10_1101-2021_01_07_425723	537	9	747	747	CD
10_1101-2021_01_07_425723	537	10	requirement	requirement	NN
10_1101-2021_01_07_425723	537	11	for	for	IN
10_1101-2021_01_07_425723	537	12	growth	growth	NN
10_1101-2021_01_07_425723	537	13	in	in	IN
10_1101-2021_01_07_425723	537	14	a	a	DT
10_1101-2021_01_07_425723	537	15	defined	define	VBN
10_1101-2021_01_07_425723	537	16	medium	medium	NN
10_1101-2021_01_07_425723	537	17	.	.	.
10_1101-2021_01_07_425723	538	1	J.	J.	NNP
10_1101-2021_01_07_425723	539	1	Cell	cell	NN
10_1101-2021_01_07_425723	539	2	.	.	.
10_1101-2021_01_07_425723	540	1	Physiol	Physiol	NNP
10_1101-2021_01_07_425723	540	2	.	.	.
10_1101-2021_01_07_425723	541	1	41	41	CD
10_1101-2021_01_07_425723	541	2	,	,	,
10_1101-2021_01_07_425723	541	3	23–26	23–26	CD
10_1101-2021_01_07_425723	541	4	(	(	-LRB-
10_1101-2021_01_07_425723	541	5	1953	1953	CD
10_1101-2021_01_07_425723	541	6	)	)	-RRB-
10_1101-2021_01_07_425723	541	7	.	.	.
10_1101-2021_01_07_425723	542	1	748	748	CD
10_1101-2021_01_07_425723	542	2	15	15	CD
10_1101-2021_01_07_425723	542	3	.	.	.
10_1101-2021_01_07_425723	543	1	Andreasen	Andreasen	NNP
10_1101-2021_01_07_425723	543	2	,	,	,
10_1101-2021_01_07_425723	543	3	A.	a.	NN
10_1101-2021_01_07_425723	544	1	A.	A.	NNP
10_1101-2021_01_07_425723	545	1	&	&	CC
10_1101-2021_01_07_425723	545	2	Stier	Stier	NNP
10_1101-2021_01_07_425723	545	3	,	,	,
10_1101-2021_01_07_425723	545	4	T.	T.	NNP
10_1101-2021_01_07_425723	545	5	J.	J.	NNP
10_1101-2021_01_07_425723	546	1	B.	B.	NNP
10_1101-2021_01_07_425723	546	2	Anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	546	3	nutrition	nutrition	NN
10_1101-2021_01_07_425723	546	4	of	of	IN
10_1101-2021_01_07_425723	546	5	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	546	6	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	546	7	II	ii	CD
10_1101-2021_01_07_425723	546	8	.	.	.
10_1101-2021_01_07_425723	547	1	Unsaturated	Unsaturated	NNP
10_1101-2021_01_07_425723	547	2	749	749	CD
10_1101-2021_01_07_425723	547	3	fatty	fatty	NN
10_1101-2021_01_07_425723	547	4	acid	acid	NN
10_1101-2021_01_07_425723	547	5	requirement	requirement	NN
10_1101-2021_01_07_425723	547	6	for	for	IN
10_1101-2021_01_07_425723	547	7	growth	growth	NN
10_1101-2021_01_07_425723	547	8	in	in	IN
10_1101-2021_01_07_425723	547	9	a	a	DT
10_1101-2021_01_07_425723	547	10	defined	define	VBN
10_1101-2021_01_07_425723	547	11	medium	medium	NN
10_1101-2021_01_07_425723	547	12	.	.	.
10_1101-2021_01_07_425723	548	1	J.	J.	NNP
10_1101-2021_01_07_425723	549	1	Cell	cell	NN
10_1101-2021_01_07_425723	549	2	.	.	.
10_1101-2021_01_07_425723	550	1	Physiol	Physiol	NNP
10_1101-2021_01_07_425723	550	2	.	.	.
10_1101-2021_01_07_425723	551	1	43	43	CD
10_1101-2021_01_07_425723	551	2	,	,	,
10_1101-2021_01_07_425723	551	3	271–281	271–281	CD
10_1101-2021_01_07_425723	551	4	(	(	-LRB-
10_1101-2021_01_07_425723	551	5	1953	1953	CD
10_1101-2021_01_07_425723	551	6	)	)	-RRB-
10_1101-2021_01_07_425723	551	7	.	.	.
10_1101-2021_01_07_425723	552	1	750	750	CD
10_1101-2021_01_07_425723	552	2	16	16	CD
10_1101-2021_01_07_425723	552	3	.	.	.
10_1101-2021_01_07_425723	553	1	Passi	Passi	NNP
10_1101-2021_01_07_425723	553	2	,	,	,
10_1101-2021_01_07_425723	553	3	S.	S.	NNP
10_1101-2021_01_07_425723	553	4	et	et	NNP
10_1101-2021_01_07_425723	553	5	al	al	NNP
10_1101-2021_01_07_425723	553	6	.	.	.
10_1101-2021_01_07_425723	554	1	Saturated	saturate	VBN
10_1101-2021_01_07_425723	554	2	dicarboxylic	dicarboxylic	JJ
10_1101-2021_01_07_425723	554	3	acids	acid	NNS
10_1101-2021_01_07_425723	554	4	as	as	IN
10_1101-2021_01_07_425723	554	5	products	product	NNS
10_1101-2021_01_07_425723	554	6	of	of	IN
10_1101-2021_01_07_425723	554	7	unsaturated	unsaturated	JJ
10_1101-2021_01_07_425723	554	8	fatty	fatty	NN
10_1101-2021_01_07_425723	554	9	acid	acid	NN
10_1101-2021_01_07_425723	554	10	oxidation	oxidation	NN
10_1101-2021_01_07_425723	554	11	.	.	.
10_1101-2021_01_07_425723	555	1	751	751	CD
10_1101-2021_01_07_425723	555	2	Biochim	Biochim	NNP
10_1101-2021_01_07_425723	555	3	.	.	.
10_1101-2021_01_07_425723	556	1	Biophys	Biophys	NNP
10_1101-2021_01_07_425723	556	2	.	.	.
10_1101-2021_01_07_425723	557	1	Acta	Acta	NNP
10_1101-2021_01_07_425723	557	2	-	-	HYPH
10_1101-2021_01_07_425723	557	3	Lipids	Lipids	NNP
10_1101-2021_01_07_425723	557	4	Lipid	Lipid	NNP
10_1101-2021_01_07_425723	557	5	Metab	Metab	NNP
10_1101-2021_01_07_425723	557	6	.	.	.
10_1101-2021_01_07_425723	558	1	1168	1168	CD
10_1101-2021_01_07_425723	558	2	,	,	,
10_1101-2021_01_07_425723	558	3	190–198	190–198	CD
10_1101-2021_01_07_425723	558	4	(	(	-LRB-
10_1101-2021_01_07_425723	558	5	1993	1993	CD
10_1101-2021_01_07_425723	558	6	)	)	-RRB-
10_1101-2021_01_07_425723	558	7	.	.	.
10_1101-2021_01_07_425723	559	1	752	752	CD
10_1101-2021_01_07_425723	559	2	17	17	CD
10_1101-2021_01_07_425723	559	3	.	.	.
10_1101-2021_01_07_425723	560	1	Verduyn	Verduyn	NNP
10_1101-2021_01_07_425723	560	2	,	,	,
10_1101-2021_01_07_425723	560	3	C.	C.	NNP
10_1101-2021_01_07_425723	560	4	,	,	,
10_1101-2021_01_07_425723	560	5	Postma	Postma	NNP
10_1101-2021_01_07_425723	560	6	,	,	,
10_1101-2021_01_07_425723	560	7	E.	E.	NNP
10_1101-2021_01_07_425723	560	8	,	,	,
10_1101-2021_01_07_425723	560	9	Scheffers	Scheffers	NNP
10_1101-2021_01_07_425723	560	10	,	,	,
10_1101-2021_01_07_425723	560	11	W.	W.	NNP
10_1101-2021_01_07_425723	560	12	A.	A.	NNP
10_1101-2021_01_07_425723	561	1	&	&	CC
10_1101-2021_01_07_425723	561	2	van	van	NNP
10_1101-2021_01_07_425723	561	3	Dijken	Dijken	NNP
10_1101-2021_01_07_425723	561	4	,	,	,
10_1101-2021_01_07_425723	561	5	J.	J.	NNP
10_1101-2021_01_07_425723	561	6	P.	P.	NNP
10_1101-2021_01_07_425723	561	7	Physiology	Physiology	NNP
10_1101-2021_01_07_425723	561	8	of	of	IN
10_1101-2021_01_07_425723	561	9	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_07_425723	561	10	753	753	CD
10_1101-2021_01_07_425723	561	11	Cerevisiae	Cerevisiae	NNPS
10_1101-2021_01_07_425723	561	12	in	in	IN
10_1101-2021_01_07_425723	561	13	Anaerobic	Anaerobic	NNP
10_1101-2021_01_07_425723	561	14	Glucose	Glucose	NNP
10_1101-2021_01_07_425723	561	15	-	-	HYPH
10_1101-2021_01_07_425723	561	16	Limited	Limited	NNP
10_1101-2021_01_07_425723	561	17	Chemostat	Chemostat	NNP
10_1101-2021_01_07_425723	561	18	Cultures	Cultures	NNPS
10_1101-2021_01_07_425723	561	19	.	.	.
10_1101-2021_01_07_425723	562	1	J.	J.	NNP
10_1101-2021_01_07_425723	562	2	Gen.	Gen.	NNP
10_1101-2021_01_07_425723	562	3	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	562	4	.	.	.
10_1101-2021_01_07_425723	563	1	136	136	CD
10_1101-2021_01_07_425723	563	2	,	,	,
10_1101-2021_01_07_425723	563	3	395–403	395–403	CD
10_1101-2021_01_07_425723	563	4	754	754	CD
10_1101-2021_01_07_425723	563	5	.CC	.CC	:
10_1101-2021_01_07_425723	563	6	-	-	HYPH
10_1101-2021_01_07_425723	563	7	BY	by	IN
10_1101-2021_01_07_425723	563	8	-	-	HYPH
10_1101-2021_01_07_425723	563	9	NC	NC	NNP
10_1101-2021_01_07_425723	563	10	-	-	HYPH
10_1101-2021_01_07_425723	563	11	ND	ND	NNP
10_1101-2021_01_07_425723	563	12	4.0	4.0	CD
10_1101-2021_01_07_425723	563	13	International	International	NNP
10_1101-2021_01_07_425723	563	14	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	563	15	under	under	IN
10_1101-2021_01_07_425723	563	16	a	a	DT
10_1101-2021_01_07_425723	563	17	(	(	-LRB-
10_1101-2021_01_07_425723	563	18	which	which	WDT
10_1101-2021_01_07_425723	563	19	was	be	VBD
10_1101-2021_01_07_425723	563	20	not	not	RB
10_1101-2021_01_07_425723	563	21	certified	certify	VBN
10_1101-2021_01_07_425723	563	22	by	by	IN
10_1101-2021_01_07_425723	563	23	peer	peer	NN
10_1101-2021_01_07_425723	563	24	review	review	NN
10_1101-2021_01_07_425723	563	25	)	)	-RRB-
10_1101-2021_01_07_425723	563	26	is	be	VBZ
10_1101-2021_01_07_425723	563	27	the	the	DT
10_1101-2021_01_07_425723	563	28	author	author	NN
10_1101-2021_01_07_425723	563	29	/	/	SYM
10_1101-2021_01_07_425723	563	30	funder	funder	NN
10_1101-2021_01_07_425723	563	31	,	,	,
10_1101-2021_01_07_425723	563	32	who	who	WP
10_1101-2021_01_07_425723	563	33	has	have	VBZ
10_1101-2021_01_07_425723	563	34	granted	grant	VBN
10_1101-2021_01_07_425723	563	35	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	563	36	a	a	DT
10_1101-2021_01_07_425723	563	37	license	license	NN
10_1101-2021_01_07_425723	563	38	to	to	TO
10_1101-2021_01_07_425723	563	39	display	display	VB
10_1101-2021_01_07_425723	563	40	the	the	DT
10_1101-2021_01_07_425723	563	41	preprint	preprint	NN
10_1101-2021_01_07_425723	563	42	in	in	IN
10_1101-2021_01_07_425723	563	43	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	563	44	.	.	.
10_1101-2021_01_07_425723	564	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	564	2	is	be	VBZ
10_1101-2021_01_07_425723	564	3	made	make	VBN
10_1101-2021_01_07_425723	564	4	The	the	DT
10_1101-2021_01_07_425723	564	5	copyright	copyright	NN
10_1101-2021_01_07_425723	564	6	holder	holder	NN
10_1101-2021_01_07_425723	564	7	for	for	IN
10_1101-2021_01_07_425723	564	8	this	this	DT
10_1101-2021_01_07_425723	564	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	564	10	version	version	NN
10_1101-2021_01_07_425723	564	11	posted	post	VBD
10_1101-2021_01_07_425723	564	12	January	January	NNP
10_1101-2021_01_07_425723	564	13	8	8	CD
10_1101-2021_01_07_425723	564	14	,	,	,
10_1101-2021_01_07_425723	564	15	2021	2021	CD
10_1101-2021_01_07_425723	564	16	.	.	.
10_1101-2021_01_07_425723	564	17	;	;	:
10_1101-2021_01_07_425723	564	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	564	19	:	:	:
10_1101-2021_01_07_425723	564	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	564	21	preprint	preprint	NN
10_1101-2021_01_07_425723	564	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	564	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	564	24	41	41	CD
10_1101-2021_01_07_425723	564	25	(	(	-LRB-
10_1101-2021_01_07_425723	564	26	1990	1990	CD
10_1101-2021_01_07_425723	564	27	)	)	-RRB-
10_1101-2021_01_07_425723	564	28	.	.	.
10_1101-2021_01_07_425723	565	1	755	755	CD
10_1101-2021_01_07_425723	565	2	18	18	CD
10_1101-2021_01_07_425723	565	3	.	.	.
10_1101-2021_01_07_425723	566	1	Perli	Perli	NNP
10_1101-2021_01_07_425723	566	2	,	,	,
10_1101-2021_01_07_425723	566	3	T.	T.	NNP
10_1101-2021_01_07_425723	566	4	,	,	,
10_1101-2021_01_07_425723	566	5	Wronska	Wronska	NNP
10_1101-2021_01_07_425723	566	6	,	,	,
10_1101-2021_01_07_425723	566	7	A.	A.	NNP
10_1101-2021_01_07_425723	566	8	K.	K.	NNP
10_1101-2021_01_07_425723	566	9	,	,	,
10_1101-2021_01_07_425723	566	10	Ortiz	Ortiz	NNP
10_1101-2021_01_07_425723	566	11	-	-	HYPH
10_1101-2021_01_07_425723	566	12	Merino	Merino	NNP
10_1101-2021_01_07_425723	566	13	,	,	,
10_1101-2021_01_07_425723	566	14	R.	R.	NNP
10_1101-2021_01_07_425723	566	15	A.	A.	NNP
10_1101-2021_01_07_425723	566	16	,	,	,
10_1101-2021_01_07_425723	566	17	Pronk	Pronk	NNP
10_1101-2021_01_07_425723	566	18	,	,	,
10_1101-2021_01_07_425723	566	19	J.	J.	NNP
10_1101-2021_01_07_425723	566	20	T.	T.	NNP
10_1101-2021_01_07_425723	566	21	&	&	CC
10_1101-2021_01_07_425723	566	22	Daran	Daran	NNP
10_1101-2021_01_07_425723	566	23	,	,	,
10_1101-2021_01_07_425723	566	24	J.	J.	NNP
10_1101-2021_01_07_425723	566	25	M.	M.	NNP
10_1101-2021_01_07_425723	566	26	Vitamin	Vitamin	NNP
10_1101-2021_01_07_425723	566	27	requirements	requirement	NNS
10_1101-2021_01_07_425723	566	28	and	and	CC
10_1101-2021_01_07_425723	566	29	756	756	CD
10_1101-2021_01_07_425723	566	30	biosynthesis	biosynthesis	NN
10_1101-2021_01_07_425723	566	31	in	in	IN
10_1101-2021_01_07_425723	566	32	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	566	33	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	566	34	.	.	.
10_1101-2021_01_07_425723	567	1	Yeast	yeast	NN
10_1101-2021_01_07_425723	567	2	1–22	1–22	CD
10_1101-2021_01_07_425723	567	3	(	(	-LRB-
10_1101-2021_01_07_425723	567	4	2020	2020	CD
10_1101-2021_01_07_425723	567	5	)	)	-RRB-
10_1101-2021_01_07_425723	567	6	.	.	.
10_1101-2021_01_07_425723	568	1	doi:10.1002	doi:10.1002	NNP
10_1101-2021_01_07_425723	568	2	/	/	SYM
10_1101-2021_01_07_425723	568	3	yea.3461	yea.3461	NNP
10_1101-2021_01_07_425723	568	4	757	757	CD
10_1101-2021_01_07_425723	568	5	19	19	CD
10_1101-2021_01_07_425723	568	6	.	.	.
10_1101-2021_01_07_425723	569	1	Dekker	Dekker	NNP
10_1101-2021_01_07_425723	569	2	,	,	,
10_1101-2021_01_07_425723	569	3	W.	W.	NNP
10_1101-2021_01_07_425723	569	4	J.	J.	NNP
10_1101-2021_01_07_425723	569	5	C.	C.	NNP
10_1101-2021_01_07_425723	569	6	,	,	,
10_1101-2021_01_07_425723	569	7	Wiersma	Wiersma	NNP
10_1101-2021_01_07_425723	569	8	,	,	,
10_1101-2021_01_07_425723	569	9	S.	S.	NNP
10_1101-2021_01_07_425723	569	10	J.	J.	NNP
10_1101-2021_01_07_425723	569	11	,	,	,
10_1101-2021_01_07_425723	569	12	Bouwknegt	Bouwknegt	NNP
10_1101-2021_01_07_425723	569	13	,	,	,
10_1101-2021_01_07_425723	569	14	J.	J.	NNP
10_1101-2021_01_07_425723	569	15	,	,	,
10_1101-2021_01_07_425723	569	16	Mooiman	Mooiman	NNP
10_1101-2021_01_07_425723	569	17	,	,	,
10_1101-2021_01_07_425723	569	18	C.	C.	NNP
10_1101-2021_01_07_425723	569	19	&	&	CC
10_1101-2021_01_07_425723	569	20	Pronk	Pronk	NNP
10_1101-2021_01_07_425723	569	21	,	,	,
10_1101-2021_01_07_425723	569	22	J.	J.	NNP
10_1101-2021_01_07_425723	569	23	T.	T.	NNP
10_1101-2021_01_07_425723	569	24	Anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	569	25	growth	growth	NN
10_1101-2021_01_07_425723	569	26	of	of	IN
10_1101-2021_01_07_425723	569	27	758	758	CD
10_1101-2021_01_07_425723	569	28	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_07_425723	569	29	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	569	30	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	569	31	-	-	HYPH
10_1101-2021_01_07_425723	569	32	7D	7D	NNP
10_1101-2021_01_07_425723	569	33	does	do	VBZ
10_1101-2021_01_07_425723	569	34	not	not	RB
10_1101-2021_01_07_425723	569	35	depend	depend	VB
10_1101-2021_01_07_425723	569	36	on	on	IN
10_1101-2021_01_07_425723	569	37	synthesis	synthesis	NN
10_1101-2021_01_07_425723	569	38	or	or	CC
10_1101-2021_01_07_425723	569	39	supplementation	supplementation	NN
10_1101-2021_01_07_425723	569	40	of	of	IN
10_1101-2021_01_07_425723	569	41	759	759	CD
10_1101-2021_01_07_425723	569	42	unsaturated	unsaturated	JJ
10_1101-2021_01_07_425723	569	43	fatty	fatty	NN
10_1101-2021_01_07_425723	569	44	acids	acid	NNS
10_1101-2021_01_07_425723	569	45	.	.	.
10_1101-2021_01_07_425723	570	1	FEMS	FEMS	NNP
10_1101-2021_01_07_425723	570	2	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	570	3	Res	res	NN
10_1101-2021_01_07_425723	570	4	.	.	.
10_1101-2021_01_07_425723	571	1	19	19	CD
10_1101-2021_01_07_425723	571	2	,	,	,
10_1101-2021_01_07_425723	571	3	(	(	-LRB-
10_1101-2021_01_07_425723	571	4	2019	2019	CD
10_1101-2021_01_07_425723	571	5	)	)	-RRB-
10_1101-2021_01_07_425723	571	6	.	.	.
10_1101-2021_01_07_425723	572	1	760	760	CD
10_1101-2021_01_07_425723	572	2	20	20	CD
10_1101-2021_01_07_425723	572	3	.	.	.
10_1101-2021_01_07_425723	573	1	Wilcox	Wilcox	NNP
10_1101-2021_01_07_425723	573	2	,	,	,
10_1101-2021_01_07_425723	573	3	L.	L.	NNP
10_1101-2021_01_07_425723	573	4	J.	J.	NNP
10_1101-2021_01_07_425723	573	5	et	et	NNP
10_1101-2021_01_07_425723	573	6	al	al	NNP
10_1101-2021_01_07_425723	573	7	.	.	.
10_1101-2021_01_07_425723	574	1	Transcriptional	transcriptional	JJ
10_1101-2021_01_07_425723	574	2	profiling	profiling	NN
10_1101-2021_01_07_425723	574	3	identifies	identifie	NNS
10_1101-2021_01_07_425723	574	4	two	two	CD
10_1101-2021_01_07_425723	574	5	members	member	NNS
10_1101-2021_01_07_425723	574	6	of	of	IN
10_1101-2021_01_07_425723	574	7	the	the	DT
10_1101-2021_01_07_425723	574	8	ATP	atp	NN
10_1101-2021_01_07_425723	574	9	-	-	HYPH
10_1101-2021_01_07_425723	574	10	binding	bind	VBG
10_1101-2021_01_07_425723	574	11	cassette	cassette	NN
10_1101-2021_01_07_425723	574	12	761	761	CD
10_1101-2021_01_07_425723	574	13	transporter	transporter	NN
10_1101-2021_01_07_425723	574	14	superfamily	superfamily	RB
10_1101-2021_01_07_425723	574	15	required	require	VBN
10_1101-2021_01_07_425723	574	16	for	for	IN
10_1101-2021_01_07_425723	574	17	sterol	sterol	NN
10_1101-2021_01_07_425723	574	18	uptake	uptake	NNP
10_1101-2021_01_07_425723	574	19	in	in	IN
10_1101-2021_01_07_425723	574	20	yeast	yeast	NN
10_1101-2021_01_07_425723	574	21	.	.	.
10_1101-2021_01_07_425723	575	1	J.	J.	NNP
10_1101-2021_01_07_425723	575	2	Biol	Biol	NNP
10_1101-2021_01_07_425723	575	3	.	.	.
10_1101-2021_01_07_425723	576	1	Chem	Chem	NNP
10_1101-2021_01_07_425723	576	2	.	.	.
10_1101-2021_01_07_425723	577	1	277	277	CD
10_1101-2021_01_07_425723	577	2	,	,	,
10_1101-2021_01_07_425723	577	3	32466–32472	32466–32472	CD
10_1101-2021_01_07_425723	577	4	762	762	CD
10_1101-2021_01_07_425723	577	5	(	(	-LRB-
10_1101-2021_01_07_425723	577	6	2002	2002	CD
10_1101-2021_01_07_425723	577	7	)	)	-RRB-
10_1101-2021_01_07_425723	577	8	.	.	.
10_1101-2021_01_07_425723	578	1	763	763	CD
10_1101-2021_01_07_425723	578	2	21	21	CD
10_1101-2021_01_07_425723	578	3	.	.	.
10_1101-2021_01_07_425723	579	1	Black	Black	NNP
10_1101-2021_01_07_425723	579	2	,	,	,
10_1101-2021_01_07_425723	579	3	P.	P.	NNP
10_1101-2021_01_07_425723	579	4	N.	N.	NNP
10_1101-2021_01_07_425723	579	5	&	&	CC
10_1101-2021_01_07_425723	579	6	DiRusso	DiRusso	NNP
10_1101-2021_01_07_425723	579	7	,	,	,
10_1101-2021_01_07_425723	579	8	C.	C.	NNP
10_1101-2021_01_07_425723	579	9	C.	C.	NNP
10_1101-2021_01_07_425723	579	10	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	579	11	acyl	acyl	NN
10_1101-2021_01_07_425723	579	12	-	-	HYPH
10_1101-2021_01_07_425723	579	13	CoA	CoA	NNP
10_1101-2021_01_07_425723	579	14	synthetases	synthetase	VBZ
10_1101-2021_01_07_425723	579	15	at	at	IN
10_1101-2021_01_07_425723	579	16	the	the	DT
10_1101-2021_01_07_425723	579	17	crossroads	crossroad	NNS
10_1101-2021_01_07_425723	579	18	of	of	IN
10_1101-2021_01_07_425723	579	19	fatty	fatty	NN
10_1101-2021_01_07_425723	579	20	acid	acid	VBP
10_1101-2021_01_07_425723	579	21	764	764	CD
10_1101-2021_01_07_425723	579	22	metabolism	metabolism	NN
10_1101-2021_01_07_425723	579	23	and	and	CC
10_1101-2021_01_07_425723	579	24	regulation	regulation	NN
10_1101-2021_01_07_425723	579	25	.	.	.
10_1101-2021_01_07_425723	580	1	Biochim	Biochim	NNP
10_1101-2021_01_07_425723	580	2	.	.	.
10_1101-2021_01_07_425723	581	1	Biophys	Biophys	NNP
10_1101-2021_01_07_425723	581	2	.	.	.
10_1101-2021_01_07_425723	582	1	Acta	Acta	NNP
10_1101-2021_01_07_425723	582	2	-	-	HYPH
10_1101-2021_01_07_425723	582	3	Mol	Mol	NNP
10_1101-2021_01_07_425723	582	4	.	.	.
10_1101-2021_01_07_425723	583	1	Cell	Cell	NNP
10_1101-2021_01_07_425723	583	2	Biol	Biol	NNP
10_1101-2021_01_07_425723	583	3	.	.	.
10_1101-2021_01_07_425723	584	1	Lipids	lipid	NNS
10_1101-2021_01_07_425723	584	2	1771	1771	CD
10_1101-2021_01_07_425723	584	3	,	,	,
10_1101-2021_01_07_425723	584	4	286–298	286–298	CD
10_1101-2021_01_07_425723	584	5	(	(	-LRB-
10_1101-2021_01_07_425723	584	6	2007	2007	CD
10_1101-2021_01_07_425723	584	7	)	)	-RRB-
10_1101-2021_01_07_425723	584	8	.	.	.
10_1101-2021_01_07_425723	585	1	765	765	CD
10_1101-2021_01_07_425723	585	2	22	22	CD
10_1101-2021_01_07_425723	585	3	.	.	.
10_1101-2021_01_07_425723	586	1	Jacquier	Jacquier	NNP
10_1101-2021_01_07_425723	586	2	,	,	,
10_1101-2021_01_07_425723	586	3	N.	N.	NNP
10_1101-2021_01_07_425723	586	4	&	&	CC
10_1101-2021_01_07_425723	586	5	Schneiter	Schneiter	NNP
10_1101-2021_01_07_425723	586	6	,	,	,
10_1101-2021_01_07_425723	586	7	R.	R.	NNP
10_1101-2021_01_07_425723	586	8	Ypk1	Ypk1	NNP
10_1101-2021_01_07_425723	586	9	,	,	,
10_1101-2021_01_07_425723	586	10	the	the	DT
10_1101-2021_01_07_425723	586	11	yeast	yeast	NN
10_1101-2021_01_07_425723	586	12	orthologue	orthologue	NN
10_1101-2021_01_07_425723	586	13	of	of	IN
10_1101-2021_01_07_425723	586	14	the	the	DT
10_1101-2021_01_07_425723	586	15	human	human	JJ
10_1101-2021_01_07_425723	586	16	serum-	serum-	NN
10_1101-2021_01_07_425723	586	17	and	and	CC
10_1101-2021_01_07_425723	586	18	glucocorticoid-766	glucocorticoid-766	NNP
10_1101-2021_01_07_425723	586	19	induced	induce	VBN
10_1101-2021_01_07_425723	586	20	kinase	kinase	NN
10_1101-2021_01_07_425723	586	21	,	,	,
10_1101-2021_01_07_425723	586	22	is	be	VBZ
10_1101-2021_01_07_425723	586	23	required	require	VBN
10_1101-2021_01_07_425723	586	24	for	for	IN
10_1101-2021_01_07_425723	586	25	efficient	efficient	JJ
10_1101-2021_01_07_425723	586	26	uptake	uptake	NN
10_1101-2021_01_07_425723	586	27	of	of	IN
10_1101-2021_01_07_425723	586	28	fatty	fatty	NN
10_1101-2021_01_07_425723	586	29	acids	acid	NNS
10_1101-2021_01_07_425723	586	30	.	.	.
10_1101-2021_01_07_425723	587	1	J.	J.	NNP
10_1101-2021_01_07_425723	588	1	Cell	Cell	NNP
10_1101-2021_01_07_425723	588	2	Sci	Sci	NNP
10_1101-2021_01_07_425723	588	3	.	.	.
10_1101-2021_01_07_425723	589	1	123	123	CD
10_1101-2021_01_07_425723	589	2	,	,	,
10_1101-2021_01_07_425723	589	3	2218–2227	2218–2227	CD
10_1101-2021_01_07_425723	589	4	(	(	-LRB-
10_1101-2021_01_07_425723	589	5	2010	2010	CD
10_1101-2021_01_07_425723	589	6	)	)	-RRB-
10_1101-2021_01_07_425723	589	7	.	.	.
10_1101-2021_01_07_425723	590	1	767	767	CD
10_1101-2021_01_07_425723	590	2	23	23	CD
10_1101-2021_01_07_425723	590	3	.	.	.
10_1101-2021_01_07_425723	591	1	Blomqvist	Blomqvist	NNP
10_1101-2021_01_07_425723	591	2	,	,	,
10_1101-2021_01_07_425723	591	3	J.	J.	NNP
10_1101-2021_01_07_425723	591	4	,	,	,
10_1101-2021_01_07_425723	591	5	Nogue	Nogue	NNP
10_1101-2021_01_07_425723	591	6	,	,	,
10_1101-2021_01_07_425723	591	7	V.	V.	NNP
10_1101-2021_01_07_425723	591	8	S.	S.	NNP
10_1101-2021_01_07_425723	591	9	,	,	,
10_1101-2021_01_07_425723	591	10	Gorwa	Gorwa	NNP
10_1101-2021_01_07_425723	591	11	-	-	HYPH
10_1101-2021_01_07_425723	591	12	Grauslund	Grauslund	NNP
10_1101-2021_01_07_425723	591	13	,	,	,
10_1101-2021_01_07_425723	591	14	M.	M.	NNP
10_1101-2021_01_07_425723	591	15	&	&	CC
10_1101-2021_01_07_425723	591	16	Passoth	Passoth	NNP
10_1101-2021_01_07_425723	591	17	,	,	,
10_1101-2021_01_07_425723	591	18	V.	V.	NNP
10_1101-2021_01_07_425723	591	19	Physiological	physiological	JJ
10_1101-2021_01_07_425723	591	20	requirements	requirement	NNS
10_1101-2021_01_07_425723	591	21	for	for	IN
10_1101-2021_01_07_425723	591	22	768	768	CD
10_1101-2021_01_07_425723	591	23	growth	growth	NN
10_1101-2021_01_07_425723	591	24	and	and	CC
10_1101-2021_01_07_425723	591	25	competitveness	competitveness	NN
10_1101-2021_01_07_425723	591	26	of	of	IN
10_1101-2021_01_07_425723	591	27	Dekkera	Dekkera	NNP
10_1101-2021_01_07_425723	591	28	bruxellensis	bruxellensis	NN
10_1101-2021_01_07_425723	591	29	under	under	IN
10_1101-2021_01_07_425723	591	30	oxygen	oxygen	NN
10_1101-2021_01_07_425723	591	31	limited	limit	VBN
10_1101-2021_01_07_425723	591	32	or	or	CC
10_1101-2021_01_07_425723	591	33	anaerobic	anaerobic	VBD
10_1101-2021_01_07_425723	591	34	769	769	CD
10_1101-2021_01_07_425723	591	35	conditions	condition	NNS
10_1101-2021_01_07_425723	591	36	.	.	.
10_1101-2021_01_07_425723	592	1	Yeast	yeast	NN
10_1101-2021_01_07_425723	592	2	29	29	CD
10_1101-2021_01_07_425723	592	3	,	,	,
10_1101-2021_01_07_425723	592	4	265–274	265–274	CD
10_1101-2021_01_07_425723	592	5	(	(	-LRB-
10_1101-2021_01_07_425723	592	6	2012	2012	CD
10_1101-2021_01_07_425723	592	7	)	)	-RRB-
10_1101-2021_01_07_425723	592	8	.	.	.
10_1101-2021_01_07_425723	593	1	770	770	CD
10_1101-2021_01_07_425723	593	2	24	24	CD
10_1101-2021_01_07_425723	593	3	.	.	.
10_1101-2021_01_07_425723	594	1	Zavrel	Zavrel	NNP
10_1101-2021_01_07_425723	594	2	,	,	,
10_1101-2021_01_07_425723	594	3	M.	M.	NNP
10_1101-2021_01_07_425723	594	4	,	,	,
10_1101-2021_01_07_425723	594	5	Hoot	Hoot	NNP
10_1101-2021_01_07_425723	594	6	,	,	,
10_1101-2021_01_07_425723	594	7	S.	S.	NNP
10_1101-2021_01_07_425723	594	8	J.	J.	NNP
10_1101-2021_01_07_425723	595	1	&	&	CC
10_1101-2021_01_07_425723	595	2	White	White	NNP
10_1101-2021_01_07_425723	595	3	,	,	,
10_1101-2021_01_07_425723	595	4	T.	T.	NNP
10_1101-2021_01_07_425723	595	5	C.	C.	NNP
10_1101-2021_01_07_425723	595	6	Comparison	Comparison	NNP
10_1101-2021_01_07_425723	595	7	of	of	IN
10_1101-2021_01_07_425723	595	8	sterol	sterol	NN
10_1101-2021_01_07_425723	595	9	import	import	NN
10_1101-2021_01_07_425723	595	10	under	under	IN
10_1101-2021_01_07_425723	595	11	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	595	12	and	and	CC
10_1101-2021_01_07_425723	595	13	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	595	14	771	771	CD
10_1101-2021_01_07_425723	595	15	conditions	condition	NNS
10_1101-2021_01_07_425723	595	16	in	in	IN
10_1101-2021_01_07_425723	595	17	three	three	CD
10_1101-2021_01_07_425723	595	18	fungal	fungal	JJ
10_1101-2021_01_07_425723	595	19	species	specie	NNS
10_1101-2021_01_07_425723	595	20	,	,	,
10_1101-2021_01_07_425723	595	21	Candida	Candida	NNP
10_1101-2021_01_07_425723	595	22	albicans	albican	NNS
10_1101-2021_01_07_425723	595	23	,	,	,
10_1101-2021_01_07_425723	595	24	Candida	Candida	NNP
10_1101-2021_01_07_425723	595	25	glabrata	glabrata	NN
10_1101-2021_01_07_425723	595	26	,	,	,
10_1101-2021_01_07_425723	595	27	and	and	CC
10_1101-2021_01_07_425723	595	28	Saccharomyces	saccharomyce	VBZ
10_1101-2021_01_07_425723	595	29	772	772	CD
10_1101-2021_01_07_425723	595	30	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	595	31	.	.	.
10_1101-2021_01_07_425723	596	1	Eukaryot	Eukaryot	NNP
10_1101-2021_01_07_425723	596	2	.	.	.
10_1101-2021_01_07_425723	597	1	Cell	cell	NN
10_1101-2021_01_07_425723	597	2	12	12	CD
10_1101-2021_01_07_425723	597	3	,	,	,
10_1101-2021_01_07_425723	597	4	725–738	725–738	CD
10_1101-2021_01_07_425723	597	5	(	(	-LRB-
10_1101-2021_01_07_425723	597	6	2013	2013	CD
10_1101-2021_01_07_425723	597	7	)	)	-RRB-
10_1101-2021_01_07_425723	597	8	.	.	.
10_1101-2021_01_07_425723	598	1	773	773	CD
10_1101-2021_01_07_425723	598	2	25	25	CD
10_1101-2021_01_07_425723	598	3	.	.	.
10_1101-2021_01_07_425723	599	1	Visser	Visser	NNP
10_1101-2021_01_07_425723	599	2	,	,	,
10_1101-2021_01_07_425723	599	3	W.	W.	NNP
10_1101-2021_01_07_425723	599	4	,	,	,
10_1101-2021_01_07_425723	599	5	Scheffers	Scheffers	NNP
10_1101-2021_01_07_425723	599	6	,	,	,
10_1101-2021_01_07_425723	599	7	W.	W.	NNP
10_1101-2021_01_07_425723	599	8	A.	A.	NNP
10_1101-2021_01_07_425723	599	9	,	,	,
10_1101-2021_01_07_425723	599	10	Batenburg	Batenburg	NNP
10_1101-2021_01_07_425723	599	11	-	-	HYPH
10_1101-2021_01_07_425723	599	12	Van	Van	NNP
10_1101-2021_01_07_425723	599	13	der	der	NN
10_1101-2021_01_07_425723	599	14	Vegte	Vegte	NNP
10_1101-2021_01_07_425723	599	15	,	,	,
10_1101-2021_01_07_425723	599	16	W.	W.	NNP
10_1101-2021_01_07_425723	599	17	H.	H.	NNP
10_1101-2021_01_07_425723	599	18	&	&	CC
10_1101-2021_01_07_425723	599	19	Van	Van	NNP
10_1101-2021_01_07_425723	599	20	Dijken	Dijken	NNP
10_1101-2021_01_07_425723	599	21	,	,	,
10_1101-2021_01_07_425723	599	22	J.	J.	NNP
10_1101-2021_01_07_425723	599	23	P.	P.	NNP
10_1101-2021_01_07_425723	599	24	Oxygen	Oxygen	NNP
10_1101-2021_01_07_425723	599	25	774	774	CD
10_1101-2021_01_07_425723	599	26	requirements	requirement	NNS
10_1101-2021_01_07_425723	599	27	of	of	IN
10_1101-2021_01_07_425723	599	28	yeasts	yeast	NNS
10_1101-2021_01_07_425723	599	29	.	.	.
10_1101-2021_01_07_425723	600	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	600	2	.	.	.
10_1101-2021_01_07_425723	601	1	Environ	Environ	NNP
10_1101-2021_01_07_425723	601	2	.	.	.
10_1101-2021_01_07_425723	602	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	602	2	.	.	.
10_1101-2021_01_07_425723	603	1	56	56	CD
10_1101-2021_01_07_425723	603	2	,	,	,
10_1101-2021_01_07_425723	603	3	3785–3792	3785–3792	CD
10_1101-2021_01_07_425723	603	4	(	(	-LRB-
10_1101-2021_01_07_425723	603	5	1990	1990	CD
10_1101-2021_01_07_425723	603	6	)	)	-RRB-
10_1101-2021_01_07_425723	603	7	.	.	.
10_1101-2021_01_07_425723	604	1	775	775	CD
10_1101-2021_01_07_425723	604	2	26	26	CD
10_1101-2021_01_07_425723	604	3	.	.	.
10_1101-2021_01_07_425723	605	1	Dashko	Dashko	NNP
10_1101-2021_01_07_425723	605	2	,	,	,
10_1101-2021_01_07_425723	605	3	S.	S.	NNP
10_1101-2021_01_07_425723	605	4	,	,	,
10_1101-2021_01_07_425723	605	5	Zhou	Zhou	NNP
10_1101-2021_01_07_425723	605	6	,	,	,
10_1101-2021_01_07_425723	605	7	N.	N.	NNP
10_1101-2021_01_07_425723	605	8	,	,	,
10_1101-2021_01_07_425723	605	9	Compagno	Compagno	NNP
10_1101-2021_01_07_425723	605	10	,	,	,
10_1101-2021_01_07_425723	605	11	C.	C.	NNP
10_1101-2021_01_07_425723	605	12	&	&	CC
10_1101-2021_01_07_425723	605	13	Piškur	Piškur	NNP
10_1101-2021_01_07_425723	605	14	,	,	,
10_1101-2021_01_07_425723	605	15	J.	J.	NNP
10_1101-2021_01_07_425723	606	1	Why	why	WRB
10_1101-2021_01_07_425723	606	2	,	,	,
10_1101-2021_01_07_425723	606	3	when	when	WRB
10_1101-2021_01_07_425723	606	4	,	,	,
10_1101-2021_01_07_425723	606	5	and	and	CC
10_1101-2021_01_07_425723	606	6	how	how	WRB
10_1101-2021_01_07_425723	606	7	did	do	VBD
10_1101-2021_01_07_425723	606	8	yeast	yeast	NN
10_1101-2021_01_07_425723	606	9	evolve	evolve	VB
10_1101-2021_01_07_425723	606	10	alcoholic	alcoholic	JJ
10_1101-2021_01_07_425723	606	11	776	776	CD
10_1101-2021_01_07_425723	606	12	fermentation	fermentation	NN
10_1101-2021_01_07_425723	606	13	?	?	.
10_1101-2021_01_07_425723	607	1	FEMS	FEMS	NNP
10_1101-2021_01_07_425723	607	2	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	607	3	Res	res	NN
10_1101-2021_01_07_425723	607	4	.	.	.
10_1101-2021_01_07_425723	608	1	14	14	CD
10_1101-2021_01_07_425723	608	2	,	,	,
10_1101-2021_01_07_425723	608	3	826–832	826–832	CD
10_1101-2021_01_07_425723	608	4	(	(	-LRB-
10_1101-2021_01_07_425723	608	5	2014	2014	CD
10_1101-2021_01_07_425723	608	6	)	)	-RRB-
10_1101-2021_01_07_425723	608	7	.	.	.
10_1101-2021_01_07_425723	609	1	777	777	CD
10_1101-2021_01_07_425723	609	2	27	27	CD
10_1101-2021_01_07_425723	609	3	.	.	.
10_1101-2021_01_07_425723	610	1	Snoek	Snoek	NNP
10_1101-2021_01_07_425723	610	2	,	,	,
10_1101-2021_01_07_425723	610	3	I.	I.	NNP
10_1101-2021_01_07_425723	610	4	S.	S.	NNP
10_1101-2021_01_07_425723	610	5	I.	I.	NNP
10_1101-2021_01_07_425723	611	1	&	&	CC
10_1101-2021_01_07_425723	611	2	Steensma	Steensma	NNP
10_1101-2021_01_07_425723	611	3	,	,	,
10_1101-2021_01_07_425723	611	4	H.	H.	NNP
10_1101-2021_01_07_425723	611	5	Y.	Y.	NNP
10_1101-2021_01_07_425723	612	1	Factors	factor	NNS
10_1101-2021_01_07_425723	612	2	involved	involve	VBN
10_1101-2021_01_07_425723	612	3	in	in	IN
10_1101-2021_01_07_425723	612	4	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	612	5	growth	growth	NN
10_1101-2021_01_07_425723	612	6	of	of	IN
10_1101-2021_01_07_425723	612	7	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	612	8	778	778	CD
10_1101-2021_01_07_425723	612	9	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	612	10	.	.	.
10_1101-2021_01_07_425723	613	1	Yeast	yeast	NN
10_1101-2021_01_07_425723	613	2	24	24	CD
10_1101-2021_01_07_425723	613	3	,	,	,
10_1101-2021_01_07_425723	613	4	1–10	1–10	CD
10_1101-2021_01_07_425723	613	5	(	(	-LRB-
10_1101-2021_01_07_425723	613	6	2007	2007	CD
10_1101-2021_01_07_425723	613	7	)	)	-RRB-
10_1101-2021_01_07_425723	613	8	.	.	.
10_1101-2021_01_07_425723	614	1	779	779	CD
10_1101-2021_01_07_425723	614	2	28	28	CD
10_1101-2021_01_07_425723	614	3	.	.	.
10_1101-2021_01_07_425723	615	1	Vale	Vale	NNP
10_1101-2021_01_07_425723	615	2	da	da	NNP
10_1101-2021_01_07_425723	615	3	Costa	Costa	NNP
10_1101-2021_01_07_425723	615	4	,	,	,
10_1101-2021_01_07_425723	615	5	B.	B.	NNP
10_1101-2021_01_07_425723	615	6	L.	L.	NNP
10_1101-2021_01_07_425723	615	7	,	,	,
10_1101-2021_01_07_425723	615	8	Basso	Basso	NNP
10_1101-2021_01_07_425723	615	9	,	,	,
10_1101-2021_01_07_425723	615	10	T.	T.	NNP
10_1101-2021_01_07_425723	615	11	O.	O.	NNP
10_1101-2021_01_07_425723	615	12	,	,	,
10_1101-2021_01_07_425723	615	13	Raghavendran	Raghavendran	NNP
10_1101-2021_01_07_425723	615	14	,	,	,
10_1101-2021_01_07_425723	615	15	V.	V.	NNP
10_1101-2021_01_07_425723	615	16	&	&	CC
10_1101-2021_01_07_425723	615	17	Gombert	Gombert	NNP
10_1101-2021_01_07_425723	615	18	,	,	,
10_1101-2021_01_07_425723	615	19	A.	A.	NNP
10_1101-2021_01_07_425723	615	20	K.	K.	NNP
10_1101-2021_01_07_425723	615	21	Anaerobiosis	Anaerobiosis	NNP
10_1101-2021_01_07_425723	615	22	revisited	revisit	VBD
10_1101-2021_01_07_425723	615	23	:	:	:
10_1101-2021_01_07_425723	615	24	780	780	CD
10_1101-2021_01_07_425723	615	25	growth	growth	NN
10_1101-2021_01_07_425723	615	26	of	of	IN
10_1101-2021_01_07_425723	615	27	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	615	28	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	615	29	under	under	IN
10_1101-2021_01_07_425723	615	30	extremely	extremely	RB
10_1101-2021_01_07_425723	615	31	low	low	JJ
10_1101-2021_01_07_425723	615	32	oxygen	oxygen	NN
10_1101-2021_01_07_425723	615	33	availability	availability	NN
10_1101-2021_01_07_425723	615	34	.	.	.
10_1101-2021_01_07_425723	616	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	616	2	.	.	.
10_1101-2021_01_07_425723	617	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	617	2	.	.	.
10_1101-2021_01_07_425723	618	1	781	781	CD
10_1101-2021_01_07_425723	618	2	Biotechnol	Biotechnol	NNPS
10_1101-2021_01_07_425723	618	3	.	.	.
10_1101-2021_01_07_425723	619	1	1–16	1–16	CD
10_1101-2021_01_07_425723	619	2	(	(	-LRB-
10_1101-2021_01_07_425723	619	3	2018	2018	CD
10_1101-2021_01_07_425723	619	4	)	)	-RRB-
10_1101-2021_01_07_425723	619	5	.	.	.
10_1101-2021_01_07_425723	620	1	doi:10.1007	doi:10.1007	NNP
10_1101-2021_01_07_425723	620	2	/	/	SYM
10_1101-2021_01_07_425723	620	3	s00253	s00253	NNP
10_1101-2021_01_07_425723	620	4	-	-	HYPH
10_1101-2021_01_07_425723	620	5	017	017	CD
10_1101-2021_01_07_425723	620	6	-	-	HYPH
10_1101-2021_01_07_425723	620	7	8732	8732	CD
10_1101-2021_01_07_425723	620	8	-	-	SYM
10_1101-2021_01_07_425723	620	9	4	4	CD
10_1101-2021_01_07_425723	620	10	782	782	CD
10_1101-2021_01_07_425723	620	11	29	29	CD
10_1101-2021_01_07_425723	620	12	.	.	.
10_1101-2021_01_07_425723	621	1	Wilkins	Wilkins	NNP
10_1101-2021_01_07_425723	621	2	,	,	,
10_1101-2021_01_07_425723	621	3	M.	M.	NNP
10_1101-2021_01_07_425723	621	4	R.	R.	NNP
10_1101-2021_01_07_425723	621	5	,	,	,
10_1101-2021_01_07_425723	621	6	Mueller	Mueller	NNP
10_1101-2021_01_07_425723	621	7	,	,	,
10_1101-2021_01_07_425723	621	8	M.	M.	NNP
10_1101-2021_01_07_425723	621	9	,	,	,
10_1101-2021_01_07_425723	621	10	Eichling	Eichling	NNP
10_1101-2021_01_07_425723	621	11	,	,	,
10_1101-2021_01_07_425723	621	12	S.	S.	NNP
10_1101-2021_01_07_425723	621	13	&	&	CC
10_1101-2021_01_07_425723	621	14	Banat	Banat	NNP
10_1101-2021_01_07_425723	621	15	,	,	,
10_1101-2021_01_07_425723	621	16	I.	I.	NNP
10_1101-2021_01_07_425723	621	17	M.	M.	NNP
10_1101-2021_01_07_425723	621	18	Fermentation	Fermentation	NNP
10_1101-2021_01_07_425723	621	19	of	of	IN
10_1101-2021_01_07_425723	621	20	xylose	xylose	NN
10_1101-2021_01_07_425723	621	21	by	by	IN
10_1101-2021_01_07_425723	621	22	the	the	DT
10_1101-2021_01_07_425723	621	23	783	783	CD
10_1101-2021_01_07_425723	621	24	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	621	25	yeast	yeast	NN
10_1101-2021_01_07_425723	621	26	strains	strain	VBZ
10_1101-2021_01_07_425723	621	27	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	621	28	marxianus	marxianus	NN
10_1101-2021_01_07_425723	621	29	IMB2	IMB2	NNP
10_1101-2021_01_07_425723	621	30	,	,	,
10_1101-2021_01_07_425723	621	31	IMB4	IMB4	NNP
10_1101-2021_01_07_425723	621	32	,	,	,
10_1101-2021_01_07_425723	621	33	and	and	CC
10_1101-2021_01_07_425723	621	34	IMB5	IMB5	NNP
10_1101-2021_01_07_425723	621	35	under	under	IN
10_1101-2021_01_07_425723	621	36	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	621	37	784	784	CD
10_1101-2021_01_07_425723	621	38	conditions	condition	NNS
10_1101-2021_01_07_425723	621	39	.	.	.
10_1101-2021_01_07_425723	622	1	Process	Process	NNP
10_1101-2021_01_07_425723	622	2	Biochem	Biochem	NNP
10_1101-2021_01_07_425723	622	3	.	.	.
10_1101-2021_01_07_425723	623	1	43	43	CD
10_1101-2021_01_07_425723	623	2	,	,	,
10_1101-2021_01_07_425723	623	3	346–350	346–350	CD
10_1101-2021_01_07_425723	623	4	(	(	-LRB-
10_1101-2021_01_07_425723	623	5	2008	2008	CD
10_1101-2021_01_07_425723	623	6	)	)	-RRB-
10_1101-2021_01_07_425723	623	7	.	.	.
10_1101-2021_01_07_425723	624	1	785	785	CD
10_1101-2021_01_07_425723	624	2	30	30	CD
10_1101-2021_01_07_425723	624	3	.	.	.
10_1101-2021_01_07_425723	625	1	Hughes	Hughes	NNP
10_1101-2021_01_07_425723	625	2	,	,	,
10_1101-2021_01_07_425723	625	3	S.	S.	NNP
10_1101-2021_01_07_425723	625	4	R.	R.	NNP
10_1101-2021_01_07_425723	625	5	et	et	NNP
10_1101-2021_01_07_425723	625	6	al	al	NNP
10_1101-2021_01_07_425723	625	7	.	.	.
10_1101-2021_01_07_425723	626	1	Automated	automated	JJ
10_1101-2021_01_07_425723	626	2	UV	uv	NN
10_1101-2021_01_07_425723	626	3	-	-	HYPH
10_1101-2021_01_07_425723	626	4	C	C	NNP
10_1101-2021_01_07_425723	626	5	Mutagenesis	Mutagenesis	NNP
10_1101-2021_01_07_425723	626	6	of	of	IN
10_1101-2021_01_07_425723	626	7	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	626	8	marxianus	marxianus	NN
10_1101-2021_01_07_425723	626	9	NRRL	NRRL	NNP
10_1101-2021_01_07_425723	626	10	Y-1109	y-1109	NN
10_1101-2021_01_07_425723	626	11	and	and	CC
10_1101-2021_01_07_425723	626	12	786	786	CD
10_1101-2021_01_07_425723	626	13	Selection	Selection	NNP
10_1101-2021_01_07_425723	626	14	for	for	IN
10_1101-2021_01_07_425723	626	15	Microaerophilic	Microaerophilic	NNP
10_1101-2021_01_07_425723	626	16	Growth	Growth	NNP
10_1101-2021_01_07_425723	626	17	and	and	CC
10_1101-2021_01_07_425723	626	18	Ethanol	Ethanol	NNP
10_1101-2021_01_07_425723	626	19	Production	Production	NNP
10_1101-2021_01_07_425723	626	20	at	at	IN
10_1101-2021_01_07_425723	626	21	Elevated	elevated	JJ
10_1101-2021_01_07_425723	626	22	Temperature	temperature	NN
10_1101-2021_01_07_425723	626	23	on	on	IN
10_1101-2021_01_07_425723	626	24	787	787	CD
10_1101-2021_01_07_425723	626	25	Biomass	Biomass	NNP
10_1101-2021_01_07_425723	626	26	Sugars	Sugars	NNPS
10_1101-2021_01_07_425723	626	27	.	.	.
10_1101-2021_01_07_425723	627	1	J.	J.	NNP
10_1101-2021_01_07_425723	628	1	Lab	lab	NN
10_1101-2021_01_07_425723	628	2	.	.	.
10_1101-2021_01_07_425723	629	1	Autom	autom	NN
10_1101-2021_01_07_425723	629	2	.	.	.
10_1101-2021_01_07_425723	630	1	18	18	CD
10_1101-2021_01_07_425723	630	2	,	,	,
10_1101-2021_01_07_425723	630	3	276–290	276–290	CD
10_1101-2021_01_07_425723	630	4	(	(	-LRB-
10_1101-2021_01_07_425723	630	5	2013	2013	CD
10_1101-2021_01_07_425723	630	6	)	)	-RRB-
10_1101-2021_01_07_425723	630	7	.	.	.
10_1101-2021_01_07_425723	631	1	788	788	CD
10_1101-2021_01_07_425723	631	2	31	31	CD
10_1101-2021_01_07_425723	631	3	.	.	.
10_1101-2021_01_07_425723	632	1	Tetsuya	Tetsuya	NNP
10_1101-2021_01_07_425723	632	2	,	,	,
10_1101-2021_01_07_425723	632	3	G.	G.	NNP
10_1101-2021_01_07_425723	632	4	et	et	NNP
10_1101-2021_01_07_425723	632	5	al	al	NNP
10_1101-2021_01_07_425723	632	6	.	.	.
10_1101-2021_01_07_425723	633	1	Bioethanol	Bioethanol	NNP
10_1101-2021_01_07_425723	633	2	Production	Production	NNP
10_1101-2021_01_07_425723	633	3	from	from	IN
10_1101-2021_01_07_425723	633	4	Lignocellulosic	Lignocellulosic	NNP
10_1101-2021_01_07_425723	633	5	Biomass	Biomass	NNP
10_1101-2021_01_07_425723	633	6	by	by	IN
10_1101-2021_01_07_425723	633	7	a	a	DT
10_1101-2021_01_07_425723	633	8	Novel	Novel	NNP
10_1101-2021_01_07_425723	633	9	Kluyveromyces	Kluyveromyces	NNPS
10_1101-2021_01_07_425723	633	10	789	789	CD
10_1101-2021_01_07_425723	633	11	marxianus	marxianus	JJ
10_1101-2021_01_07_425723	633	12	Strain	Strain	NNP
10_1101-2021_01_07_425723	633	13	.	.	.
10_1101-2021_01_07_425723	634	1	Biosci	Biosci	NNP
10_1101-2021_01_07_425723	634	2	.	.	.
10_1101-2021_01_07_425723	635	1	Biotechnol	Biotechnol	NNS
10_1101-2021_01_07_425723	635	2	.	.	.
10_1101-2021_01_07_425723	636	1	Biochem	Biochem	NNP
10_1101-2021_01_07_425723	636	2	.	.	.
10_1101-2021_01_07_425723	637	1	77	77	CD
10_1101-2021_01_07_425723	637	2	,	,	,
10_1101-2021_01_07_425723	637	3	1505–1510	1505–1510	CD
10_1101-2021_01_07_425723	637	4	(	(	-LRB-
10_1101-2021_01_07_425723	637	5	2013	2013	CD
10_1101-2021_01_07_425723	637	6	)	)	-RRB-
10_1101-2021_01_07_425723	637	7	.	.	.
10_1101-2021_01_07_425723	638	1	790	790	CD
10_1101-2021_01_07_425723	638	2	32	32	CD
10_1101-2021_01_07_425723	638	3	.	.	.
10_1101-2021_01_07_425723	638	4	van	van	NNP
10_1101-2021_01_07_425723	638	5	Urk	Urk	NNP
10_1101-2021_01_07_425723	638	6	,	,	,
10_1101-2021_01_07_425723	638	7	H.	H.	NNP
10_1101-2021_01_07_425723	638	8	,	,	,
10_1101-2021_01_07_425723	638	9	Postma	Postma	NNP
10_1101-2021_01_07_425723	638	10	,	,	,
10_1101-2021_01_07_425723	638	11	E.	E.	NNP
10_1101-2021_01_07_425723	638	12	,	,	,
10_1101-2021_01_07_425723	638	13	Scheffers	Scheffers	NNP
10_1101-2021_01_07_425723	638	14	,	,	,
10_1101-2021_01_07_425723	638	15	W.	W.	NNP
10_1101-2021_01_07_425723	638	16	A.	A.	NNP
10_1101-2021_01_07_425723	639	1	&	&	CC
10_1101-2021_01_07_425723	639	2	van	van	NNP
10_1101-2021_01_07_425723	639	3	Dijken	Dijken	NNP
10_1101-2021_01_07_425723	639	4	,	,	,
10_1101-2021_01_07_425723	639	5	J.	J.	NNP
10_1101-2021_01_07_425723	639	6	P.	P.	NNP
10_1101-2021_01_07_425723	639	7	Glucose	Glucose	NNP
10_1101-2021_01_07_425723	639	8	Transport	Transport	NNP
10_1101-2021_01_07_425723	639	9	in	in	IN
10_1101-2021_01_07_425723	639	10	Crabtree	Crabtree	NNP
10_1101-2021_01_07_425723	639	11	-	-	HYPH
10_1101-2021_01_07_425723	639	12	positive	positive	JJ
10_1101-2021_01_07_425723	639	13	791	791	CD
10_1101-2021_01_07_425723	639	14	and	and	CC
10_1101-2021_01_07_425723	639	15	Crabtree	Crabtree	NNP
10_1101-2021_01_07_425723	639	16	-	-	HYPH
10_1101-2021_01_07_425723	639	17	negative	negative	JJ
10_1101-2021_01_07_425723	639	18	Yeasts	Yeasts	NNPS
10_1101-2021_01_07_425723	639	19	.	.	.
10_1101-2021_01_07_425723	640	1	J.	J.	NNP
10_1101-2021_01_07_425723	640	2	Gen.	Gen.	NNP
10_1101-2021_01_07_425723	640	3	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	640	4	.	.	.
10_1101-2021_01_07_425723	641	1	135	135	CD
10_1101-2021_01_07_425723	641	2	,	,	,
10_1101-2021_01_07_425723	641	3	2399–2406	2399–2406	CD
10_1101-2021_01_07_425723	641	4	(	(	-LRB-
10_1101-2021_01_07_425723	641	5	1989	1989	CD
10_1101-2021_01_07_425723	641	6	)	)	-RRB-
10_1101-2021_01_07_425723	641	7	.	.	.
10_1101-2021_01_07_425723	642	1	792	792	CD
10_1101-2021_01_07_425723	642	2	33	33	CD
10_1101-2021_01_07_425723	642	3	.	.	.
10_1101-2021_01_07_425723	642	4	von	von	NNP
10_1101-2021_01_07_425723	642	5	Meyenburg	Meyenburg	NNP
10_1101-2021_01_07_425723	642	6	,	,	,
10_1101-2021_01_07_425723	642	7	K.	K.	NNP
10_1101-2021_01_07_425723	642	8	Katabolit	Katabolit	NNP
10_1101-2021_01_07_425723	642	9	-	-	HYPH
10_1101-2021_01_07_425723	642	10	Repression	Repression	NNP
10_1101-2021_01_07_425723	642	11	und	und	RB
10_1101-2021_01_07_425723	642	12	der	der	IN
10_1101-2021_01_07_425723	642	13	Sprossungszyklus	Sprossungszyklus	NNP
10_1101-2021_01_07_425723	642	14	von	von	NNP
10_1101-2021_01_07_425723	642	15	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_07_425723	642	16	793	793	CD
10_1101-2021_01_07_425723	642	17	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	642	18	.	.	.
10_1101-2021_01_07_425723	643	1	(	(	-LRB-
10_1101-2021_01_07_425723	643	2	ETH	ETH	NNP
10_1101-2021_01_07_425723	643	3	Zürich	Zürich	NNP
10_1101-2021_01_07_425723	643	4	,	,	,
10_1101-2021_01_07_425723	643	5	1969	1969	CD
10_1101-2021_01_07_425723	643	6	)	)	-RRB-
10_1101-2021_01_07_425723	643	7	.	.	.
10_1101-2021_01_07_425723	644	1	doi:10.3929	doi:10.3929	LS
10_1101-2021_01_07_425723	644	2	/	/	SYM
10_1101-2021_01_07_425723	644	3	ethz	ethz	NNP
10_1101-2021_01_07_425723	644	4	-	-	HYPH
10_1101-2021_01_07_425723	644	5	a-000099923	a-000099923	CD
10_1101-2021_01_07_425723	644	6	794	794	CD
10_1101-2021_01_07_425723	644	7	.CC	.CC	:
10_1101-2021_01_07_425723	644	8	-	-	HYPH
10_1101-2021_01_07_425723	644	9	BY	by	IN
10_1101-2021_01_07_425723	644	10	-	-	HYPH
10_1101-2021_01_07_425723	644	11	NC	NC	NNP
10_1101-2021_01_07_425723	644	12	-	-	HYPH
10_1101-2021_01_07_425723	644	13	ND	ND	NNP
10_1101-2021_01_07_425723	644	14	4.0	4.0	CD
10_1101-2021_01_07_425723	644	15	International	International	NNP
10_1101-2021_01_07_425723	644	16	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	644	17	under	under	IN
10_1101-2021_01_07_425723	644	18	a	a	DT
10_1101-2021_01_07_425723	644	19	(	(	-LRB-
10_1101-2021_01_07_425723	644	20	which	which	WDT
10_1101-2021_01_07_425723	644	21	was	be	VBD
10_1101-2021_01_07_425723	644	22	not	not	RB
10_1101-2021_01_07_425723	644	23	certified	certify	VBN
10_1101-2021_01_07_425723	644	24	by	by	IN
10_1101-2021_01_07_425723	644	25	peer	peer	NN
10_1101-2021_01_07_425723	644	26	review	review	NN
10_1101-2021_01_07_425723	644	27	)	)	-RRB-
10_1101-2021_01_07_425723	644	28	is	be	VBZ
10_1101-2021_01_07_425723	644	29	the	the	DT
10_1101-2021_01_07_425723	644	30	author	author	NN
10_1101-2021_01_07_425723	644	31	/	/	SYM
10_1101-2021_01_07_425723	644	32	funder	funder	NN
10_1101-2021_01_07_425723	644	33	,	,	,
10_1101-2021_01_07_425723	644	34	who	who	WP
10_1101-2021_01_07_425723	644	35	has	have	VBZ
10_1101-2021_01_07_425723	644	36	granted	grant	VBN
10_1101-2021_01_07_425723	644	37	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	644	38	a	a	DT
10_1101-2021_01_07_425723	644	39	license	license	NN
10_1101-2021_01_07_425723	644	40	to	to	TO
10_1101-2021_01_07_425723	644	41	display	display	VB
10_1101-2021_01_07_425723	644	42	the	the	DT
10_1101-2021_01_07_425723	644	43	preprint	preprint	NN
10_1101-2021_01_07_425723	644	44	in	in	IN
10_1101-2021_01_07_425723	644	45	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	644	46	.	.	.
10_1101-2021_01_07_425723	645	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	645	2	is	be	VBZ
10_1101-2021_01_07_425723	645	3	made	make	VBN
10_1101-2021_01_07_425723	645	4	The	the	DT
10_1101-2021_01_07_425723	645	5	copyright	copyright	NN
10_1101-2021_01_07_425723	645	6	holder	holder	NN
10_1101-2021_01_07_425723	645	7	for	for	IN
10_1101-2021_01_07_425723	645	8	this	this	DT
10_1101-2021_01_07_425723	645	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	645	10	version	version	NN
10_1101-2021_01_07_425723	645	11	posted	post	VBD
10_1101-2021_01_07_425723	645	12	January	January	NNP
10_1101-2021_01_07_425723	645	13	8	8	CD
10_1101-2021_01_07_425723	645	14	,	,	,
10_1101-2021_01_07_425723	645	15	2021	2021	CD
10_1101-2021_01_07_425723	645	16	.	.	.
10_1101-2021_01_07_425723	645	17	;	;	:
10_1101-2021_01_07_425723	645	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	645	19	:	:	:
10_1101-2021_01_07_425723	645	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	645	21	preprint	preprint	NN
10_1101-2021_01_07_425723	645	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	645	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	645	24	42	42	CD
10_1101-2021_01_07_425723	645	25	34	34	CD
10_1101-2021_01_07_425723	645	26	.	.	.
10_1101-2021_01_07_425723	646	1	Rouwenhorst	Rouwenhorst	NNP
10_1101-2021_01_07_425723	646	2	,	,	,
10_1101-2021_01_07_425723	646	3	R.	R.	NNP
10_1101-2021_01_07_425723	646	4	J.	J.	NNP
10_1101-2021_01_07_425723	646	5	,	,	,
10_1101-2021_01_07_425723	646	6	Visser	Visser	NNP
10_1101-2021_01_07_425723	646	7	,	,	,
10_1101-2021_01_07_425723	646	8	L.	L.	NNP
10_1101-2021_01_07_425723	646	9	E.	E.	NNP
10_1101-2021_01_07_425723	646	10	,	,	,
10_1101-2021_01_07_425723	646	11	Van	Van	NNP
10_1101-2021_01_07_425723	646	12	Der	Der	NNP
10_1101-2021_01_07_425723	646	13	Baan	Baan	NNP
10_1101-2021_01_07_425723	646	14	,	,	,
10_1101-2021_01_07_425723	646	15	A.	A.	NNP
10_1101-2021_01_07_425723	647	1	A.	A.	NNP
10_1101-2021_01_07_425723	647	2	,	,	,
10_1101-2021_01_07_425723	647	3	Scheffers	Scheffers	NNP
10_1101-2021_01_07_425723	647	4	,	,	,
10_1101-2021_01_07_425723	647	5	W.	W.	NNP
10_1101-2021_01_07_425723	647	6	A.	A.	NNP
10_1101-2021_01_07_425723	648	1	&	&	CC
10_1101-2021_01_07_425723	648	2	Van	Van	NNP
10_1101-2021_01_07_425723	648	3	Dijken	Dijken	NNP
10_1101-2021_01_07_425723	648	4	,	,	,
10_1101-2021_01_07_425723	648	5	J.	J.	NNP
10_1101-2021_01_07_425723	648	6	P.	P.	NNP
10_1101-2021_01_07_425723	648	7	795	795	CD
10_1101-2021_01_07_425723	648	8	Production	Production	NNP
10_1101-2021_01_07_425723	648	9	,	,	,
10_1101-2021_01_07_425723	648	10	Distribution	distribution	NN
10_1101-2021_01_07_425723	648	11	,	,	,
10_1101-2021_01_07_425723	648	12	and	and	CC
10_1101-2021_01_07_425723	648	13	Kinetic	Kinetic	NNP
10_1101-2021_01_07_425723	648	14	Properties	Properties	NNPS
10_1101-2021_01_07_425723	648	15	of	of	IN
10_1101-2021_01_07_425723	648	16	Inulinase	Inulinase	NNP
10_1101-2021_01_07_425723	648	17	in	in	IN
10_1101-2021_01_07_425723	648	18	Continuous	continuous	JJ
10_1101-2021_01_07_425723	648	19	Cultures	Cultures	NNPS
10_1101-2021_01_07_425723	648	20	of	of	IN
10_1101-2021_01_07_425723	648	21	796	796	CD
10_1101-2021_01_07_425723	648	22	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	648	23	marxianus	marxianus	NN
10_1101-2021_01_07_425723	648	24	CBS	CBS	NNP
10_1101-2021_01_07_425723	648	25	6556	6556	CD
10_1101-2021_01_07_425723	648	26	.	.	.
10_1101-2021_01_07_425723	649	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	649	2	.	.	.
10_1101-2021_01_07_425723	650	1	Environ	Environ	NNP
10_1101-2021_01_07_425723	650	2	.	.	.
10_1101-2021_01_07_425723	651	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	651	2	.	.	.
10_1101-2021_01_07_425723	652	1	54	54	CD
10_1101-2021_01_07_425723	652	2	,	,	,
10_1101-2021_01_07_425723	652	3	1131–1137	1131–1137	CD
10_1101-2021_01_07_425723	652	4	(	(	-LRB-
10_1101-2021_01_07_425723	652	5	1988	1988	CD
10_1101-2021_01_07_425723	652	6	)	)	-RRB-
10_1101-2021_01_07_425723	652	7	.	.	.
10_1101-2021_01_07_425723	653	1	797	797	CD
10_1101-2021_01_07_425723	653	2	35	35	CD
10_1101-2021_01_07_425723	653	3	.	.	.
10_1101-2021_01_07_425723	654	1	Bakker	Bakker	NNP
10_1101-2021_01_07_425723	654	2	,	,	,
10_1101-2021_01_07_425723	654	3	B.	B.	NNP
10_1101-2021_01_07_425723	654	4	M.	M.	NNP
10_1101-2021_01_07_425723	654	5	et	et	NNP
10_1101-2021_01_07_425723	654	6	al	al	NNP
10_1101-2021_01_07_425723	654	7	.	.	.
10_1101-2021_01_07_425723	655	1	Stoichiometry	stoichiometry	NN
10_1101-2021_01_07_425723	655	2	and	and	CC
10_1101-2021_01_07_425723	655	3	compartmentation	compartmentation	NN
10_1101-2021_01_07_425723	655	4	of	of	IN
10_1101-2021_01_07_425723	655	5	NADH	NADH	NNP
10_1101-2021_01_07_425723	655	6	metabolism	metabolism	NN
10_1101-2021_01_07_425723	655	7	in	in	IN
10_1101-2021_01_07_425723	655	8	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_07_425723	655	9	798	798	CD
10_1101-2021_01_07_425723	655	10	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	655	11	.	.	.
10_1101-2021_01_07_425723	656	1	FEMS	FEMS	NNP
10_1101-2021_01_07_425723	656	2	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	656	3	.	.	.
10_1101-2021_01_07_425723	657	1	Rev.	Rev.	NNP
10_1101-2021_01_07_425723	658	1	25	25	CD
10_1101-2021_01_07_425723	658	2	,	,	,
10_1101-2021_01_07_425723	658	3	15–37	15–37	CD
10_1101-2021_01_07_425723	658	4	(	(	-LRB-
10_1101-2021_01_07_425723	658	5	2001	2001	CD
10_1101-2021_01_07_425723	658	6	)	)	-RRB-
10_1101-2021_01_07_425723	658	7	.	.	.
10_1101-2021_01_07_425723	659	1	799	799	CD
10_1101-2021_01_07_425723	659	2	36	36	CD
10_1101-2021_01_07_425723	659	3	.	.	.
10_1101-2021_01_07_425723	660	1	Jeong	Jeong	NNP
10_1101-2021_01_07_425723	660	2	,	,	,
10_1101-2021_01_07_425723	660	3	H.	H.	NNP
10_1101-2021_01_07_425723	660	4	et	et	NNP
10_1101-2021_01_07_425723	660	5	al	al	NNP
10_1101-2021_01_07_425723	660	6	.	.	.
10_1101-2021_01_07_425723	661	1	Genome	genome	JJ
10_1101-2021_01_07_425723	661	2	sequence	sequence	NN
10_1101-2021_01_07_425723	661	3	of	of	IN
10_1101-2021_01_07_425723	661	4	the	the	DT
10_1101-2021_01_07_425723	661	5	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	661	6	yeast	yeast	NN
10_1101-2021_01_07_425723	661	7	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	661	8	marxianus	marxianus	JJ
10_1101-2021_01_07_425723	661	9	var	var	NN
10_1101-2021_01_07_425723	661	10	.	.	.
10_1101-2021_01_07_425723	662	1	800	800	CD
10_1101-2021_01_07_425723	662	2	marxianus	marxianus	JJ
10_1101-2021_01_07_425723	662	3	KCTC	KCTC	NNP
10_1101-2021_01_07_425723	662	4	17555	17555	CD
10_1101-2021_01_07_425723	662	5	.	.	.
10_1101-2021_01_07_425723	663	1	Eukaryot	Eukaryot	NNP
10_1101-2021_01_07_425723	663	2	.	.	.
10_1101-2021_01_07_425723	664	1	Cell	cell	NN
10_1101-2021_01_07_425723	664	2	11	11	CD
10_1101-2021_01_07_425723	664	3	,	,	,
10_1101-2021_01_07_425723	664	4	1584–1585	1584–1585	CD
10_1101-2021_01_07_425723	664	5	(	(	-LRB-
10_1101-2021_01_07_425723	664	6	2012	2012	CD
10_1101-2021_01_07_425723	664	7	)	)	-RRB-
10_1101-2021_01_07_425723	664	8	.	.	.
10_1101-2021_01_07_425723	665	1	801	801	CD
10_1101-2021_01_07_425723	665	2	37	37	CD
10_1101-2021_01_07_425723	665	3	.	.	.
10_1101-2021_01_07_425723	666	1	Jordá	Jordá	NNP
10_1101-2021_01_07_425723	666	2	,	,	,
10_1101-2021_01_07_425723	666	3	T.	T.	NNP
10_1101-2021_01_07_425723	666	4	&	&	CC
10_1101-2021_01_07_425723	666	5	Puig	Puig	NNP
10_1101-2021_01_07_425723	666	6	,	,	,
10_1101-2021_01_07_425723	666	7	S.	S.	NNP
10_1101-2021_01_07_425723	666	8	Regulation	Regulation	NNP
10_1101-2021_01_07_425723	666	9	of	of	IN
10_1101-2021_01_07_425723	666	10	Ergosterol	Ergosterol	NNP
10_1101-2021_01_07_425723	666	11	Biosynthesis	Biosynthesis	NNP
10_1101-2021_01_07_425723	666	12	in	in	IN
10_1101-2021_01_07_425723	666	13	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_07_425723	666	14	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	666	15	.	.	.
10_1101-2021_01_07_425723	667	1	Genes	gene	NNS
10_1101-2021_01_07_425723	667	2	802	802	CD
10_1101-2021_01_07_425723	667	3	(	(	-LRB-
10_1101-2021_01_07_425723	667	4	Basel	Basel	NNP
10_1101-2021_01_07_425723	667	5	)	)	-RRB-
10_1101-2021_01_07_425723	667	6	.	.	.
10_1101-2021_01_07_425723	668	1	11	11	CD
10_1101-2021_01_07_425723	668	2	,	,	,
10_1101-2021_01_07_425723	668	3	795	795	CD
10_1101-2021_01_07_425723	668	4	(	(	-LRB-
10_1101-2021_01_07_425723	668	5	2020	2020	CD
10_1101-2021_01_07_425723	668	6	)	)	-RRB-
10_1101-2021_01_07_425723	668	7	.	.	.
10_1101-2021_01_07_425723	669	1	803	803	CD
10_1101-2021_01_07_425723	669	2	38	38	CD
10_1101-2021_01_07_425723	669	3	.	.	.
10_1101-2021_01_07_425723	670	1	Lechner	Lechner	NNP
10_1101-2021_01_07_425723	670	2	,	,	,
10_1101-2021_01_07_425723	670	3	M.	M.	NNP
10_1101-2021_01_07_425723	670	4	et	et	NNP
10_1101-2021_01_07_425723	670	5	al	al	NNP
10_1101-2021_01_07_425723	670	6	.	.	.
10_1101-2021_01_07_425723	671	1	Proteinortho	Proteinortho	NNP
10_1101-2021_01_07_425723	671	2	:	:	:
10_1101-2021_01_07_425723	671	3	Detection	detection	NN
10_1101-2021_01_07_425723	671	4	of	of	IN
10_1101-2021_01_07_425723	671	5	(	(	-LRB-
10_1101-2021_01_07_425723	671	6	Co-)orthologs	Co-)orthologs	NNP
10_1101-2021_01_07_425723	671	7	in	in	IN
10_1101-2021_01_07_425723	671	8	large	large	JJ
10_1101-2021_01_07_425723	671	9	-	-	HYPH
10_1101-2021_01_07_425723	671	10	scale	scale	NN
10_1101-2021_01_07_425723	671	11	analysis	analysis	NN
10_1101-2021_01_07_425723	671	12	.	.	.
10_1101-2021_01_07_425723	672	1	BMC	BMC	NNP
10_1101-2021_01_07_425723	672	2	804	804	CD
10_1101-2021_01_07_425723	672	3	Bioinformatics	Bioinformatics	NNP
10_1101-2021_01_07_425723	672	4	12	12	CD
10_1101-2021_01_07_425723	672	5	,	,	,
10_1101-2021_01_07_425723	672	6	124	124	CD
10_1101-2021_01_07_425723	672	7	(	(	-LRB-
10_1101-2021_01_07_425723	672	8	2011	2011	CD
10_1101-2021_01_07_425723	672	9	)	)	-RRB-
10_1101-2021_01_07_425723	672	10	.	.	.
10_1101-2021_01_07_425723	673	1	805	805	CD
10_1101-2021_01_07_425723	673	2	39	39	CD
10_1101-2021_01_07_425723	673	3	.	.	.
10_1101-2021_01_07_425723	674	1	Nagy	Nagy	NNP
10_1101-2021_01_07_425723	674	2	,	,	,
10_1101-2021_01_07_425723	674	3	M.	M.	NNP
10_1101-2021_01_07_425723	674	4	,	,	,
10_1101-2021_01_07_425723	674	5	Lacroute	Lacroute	NNP
10_1101-2021_01_07_425723	674	6	,	,	,
10_1101-2021_01_07_425723	674	7	F.	F.	NNP
10_1101-2021_01_07_425723	674	8	&	&	CC
10_1101-2021_01_07_425723	674	9	Thomas	Thomas	NNP
10_1101-2021_01_07_425723	674	10	,	,	,
10_1101-2021_01_07_425723	674	11	D.	D.	NNP
10_1101-2021_01_07_425723	674	12	Divergent	Divergent	NNP
10_1101-2021_01_07_425723	674	13	evolution	evolution	NN
10_1101-2021_01_07_425723	674	14	of	of	IN
10_1101-2021_01_07_425723	674	15	pyrimidine	pyrimidine	JJ
10_1101-2021_01_07_425723	674	16	biosynthesis	biosynthesis	NN
10_1101-2021_01_07_425723	674	17	between	between	IN
10_1101-2021_01_07_425723	674	18	806	806	CD
10_1101-2021_01_07_425723	674	19	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	674	20	and	and	CC
10_1101-2021_01_07_425723	674	21	aerobic	aerobic	JJ
10_1101-2021_01_07_425723	674	22	yeasts	yeast	NNS
10_1101-2021_01_07_425723	674	23	.	.	.
10_1101-2021_01_07_425723	675	1	Proc	Proc	NNP
10_1101-2021_01_07_425723	675	2	.	.	.
10_1101-2021_01_07_425723	676	1	Natl	Natl	NNP
10_1101-2021_01_07_425723	676	2	.	.	.
10_1101-2021_01_07_425723	677	1	Acad	Acad	NNS
10_1101-2021_01_07_425723	677	2	.	.	.
10_1101-2021_01_07_425723	678	1	Sci	Sci	NNP
10_1101-2021_01_07_425723	678	2	.	.	.
10_1101-2021_01_07_425723	679	1	U.	U.	NNP
10_1101-2021_01_07_425723	679	2	S.	S.	NNP
10_1101-2021_01_07_425723	679	3	A.	a.	NN
10_1101-2021_01_07_425723	680	1	89	89	CD
10_1101-2021_01_07_425723	680	2	,	,	,
10_1101-2021_01_07_425723	680	3	8966–8970	8966–8970	CD
10_1101-2021_01_07_425723	680	4	(	(	-LRB-
10_1101-2021_01_07_425723	680	5	1992	1992	CD
10_1101-2021_01_07_425723	680	6	)	)	-RRB-
10_1101-2021_01_07_425723	680	7	.	.	.
10_1101-2021_01_07_425723	681	1	807	807	CD
10_1101-2021_01_07_425723	681	2	40	40	CD
10_1101-2021_01_07_425723	681	3	.	.	.
10_1101-2021_01_07_425723	682	1	Väremo	Väremo	NNP
10_1101-2021_01_07_425723	682	2	,	,	,
10_1101-2021_01_07_425723	682	3	L.	L.	NNP
10_1101-2021_01_07_425723	682	4	,	,	,
10_1101-2021_01_07_425723	682	5	Nielsen	Nielsen	NNP
10_1101-2021_01_07_425723	682	6	,	,	,
10_1101-2021_01_07_425723	682	7	J.	J.	NNP
10_1101-2021_01_07_425723	683	1	&	&	CC
10_1101-2021_01_07_425723	683	2	Nookaew	Nookaew	NNP
10_1101-2021_01_07_425723	683	3	,	,	,
10_1101-2021_01_07_425723	683	4	I.	I.	NNP
10_1101-2021_01_07_425723	684	1	Enriching	enrich	VBG
10_1101-2021_01_07_425723	684	2	the	the	DT
10_1101-2021_01_07_425723	684	3	gene	gene	NN
10_1101-2021_01_07_425723	684	4	set	set	VBD
10_1101-2021_01_07_425723	684	5	analysis	analysis	NN
10_1101-2021_01_07_425723	684	6	of	of	IN
10_1101-2021_01_07_425723	684	7	genome	genome	NN
10_1101-2021_01_07_425723	684	8	-	-	HYPH
10_1101-2021_01_07_425723	684	9	wide	wide	JJ
10_1101-2021_01_07_425723	684	10	data	datum	NNS
10_1101-2021_01_07_425723	684	11	by	by	IN
10_1101-2021_01_07_425723	684	12	808	808	CD
10_1101-2021_01_07_425723	684	13	incorporating	incorporate	VBG
10_1101-2021_01_07_425723	684	14	directionality	directionality	NN
10_1101-2021_01_07_425723	684	15	of	of	IN
10_1101-2021_01_07_425723	684	16	gene	gene	NN
10_1101-2021_01_07_425723	684	17	expression	expression	NN
10_1101-2021_01_07_425723	684	18	and	and	CC
10_1101-2021_01_07_425723	684	19	combining	combine	VBG
10_1101-2021_01_07_425723	684	20	statistical	statistical	JJ
10_1101-2021_01_07_425723	684	21	hypotheses	hypothesis	NNS
10_1101-2021_01_07_425723	684	22	and	and	CC
10_1101-2021_01_07_425723	684	23	809	809	CD
10_1101-2021_01_07_425723	684	24	methods	method	NNS
10_1101-2021_01_07_425723	684	25	.	.	.
10_1101-2021_01_07_425723	685	1	Nucleic	Nucleic	NNP
10_1101-2021_01_07_425723	685	2	Acids	Acids	NNPS
10_1101-2021_01_07_425723	685	3	Res	Res	NNP
10_1101-2021_01_07_425723	685	4	.	.	.
10_1101-2021_01_07_425723	686	1	41	41	CD
10_1101-2021_01_07_425723	686	2	,	,	,
10_1101-2021_01_07_425723	686	3	4378–4391	4378–4391	CD
10_1101-2021_01_07_425723	686	4	(	(	-LRB-
10_1101-2021_01_07_425723	686	5	2013	2013	CD
10_1101-2021_01_07_425723	686	6	)	)	-RRB-
10_1101-2021_01_07_425723	686	7	.	.	.
10_1101-2021_01_07_425723	687	1	810	810	CD
10_1101-2021_01_07_425723	687	2	41	41	CD
10_1101-2021_01_07_425723	687	3	.	.	.
10_1101-2021_01_07_425723	688	1	Tai	Tai	NNP
10_1101-2021_01_07_425723	688	2	,	,	,
10_1101-2021_01_07_425723	688	3	S.	S.	NNP
10_1101-2021_01_07_425723	688	4	L.	L.	NNP
10_1101-2021_01_07_425723	688	5	et	et	NNP
10_1101-2021_01_07_425723	688	6	al	al	NNP
10_1101-2021_01_07_425723	688	7	.	.	.
10_1101-2021_01_07_425723	689	1	Two	two	CD
10_1101-2021_01_07_425723	689	2	-	-	HYPH
10_1101-2021_01_07_425723	689	3	dimensional	dimensional	JJ
10_1101-2021_01_07_425723	689	4	transcriptome	transcriptome	NNP
10_1101-2021_01_07_425723	689	5	analysis	analysis	NN
10_1101-2021_01_07_425723	689	6	in	in	IN
10_1101-2021_01_07_425723	689	7	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	689	8	cultures	culture	NNS
10_1101-2021_01_07_425723	689	9	:	:	:
10_1101-2021_01_07_425723	689	10	Combinatorial	combinatorial	NN
10_1101-2021_01_07_425723	689	11	811	811	CD
10_1101-2021_01_07_425723	689	12	effects	effect	NNS
10_1101-2021_01_07_425723	689	13	of	of	IN
10_1101-2021_01_07_425723	689	14	oxygen	oxygen	NN
10_1101-2021_01_07_425723	689	15	availability	availability	NN
10_1101-2021_01_07_425723	689	16	and	and	CC
10_1101-2021_01_07_425723	689	17	macronutrient	macronutrient	NN
10_1101-2021_01_07_425723	689	18	limitation	limitation	NN
10_1101-2021_01_07_425723	689	19	in	in	IN
10_1101-2021_01_07_425723	689	20	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_07_425723	689	21	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	689	22	.	.	.
10_1101-2021_01_07_425723	690	1	J.	J.	NNP
10_1101-2021_01_07_425723	690	2	Biol	Biol	NNP
10_1101-2021_01_07_425723	690	3	.	.	.
10_1101-2021_01_07_425723	691	1	812	812	CD
10_1101-2021_01_07_425723	691	2	Chem	Chem	NNP
10_1101-2021_01_07_425723	691	3	.	.	.
10_1101-2021_01_07_425723	692	1	280	280	CD
10_1101-2021_01_07_425723	692	2	,	,	,
10_1101-2021_01_07_425723	692	3	437–447	437–447	CD
10_1101-2021_01_07_425723	692	4	(	(	-LRB-
10_1101-2021_01_07_425723	692	5	2005	2005	CD
10_1101-2021_01_07_425723	692	6	)	)	-RRB-
10_1101-2021_01_07_425723	692	7	.	.	.
10_1101-2021_01_07_425723	693	1	813	813	CD
10_1101-2021_01_07_425723	693	2	42	42	CD
10_1101-2021_01_07_425723	693	3	.	.	.
10_1101-2021_01_07_425723	694	1	Alimardani	Alimardani	NNP
10_1101-2021_01_07_425723	694	2	,	,	,
10_1101-2021_01_07_425723	694	3	P.	P.	NNP
10_1101-2021_01_07_425723	694	4	et	et	NNP
10_1101-2021_01_07_425723	694	5	al	al	NNP
10_1101-2021_01_07_425723	694	6	.	.	.
10_1101-2021_01_07_425723	695	1	SUT1-promoted	sut1-promote	VBN
10_1101-2021_01_07_425723	695	2	sterol	sterol	NN
10_1101-2021_01_07_425723	695	3	uptake	uptake	NN
10_1101-2021_01_07_425723	695	4	involves	involve	VBZ
10_1101-2021_01_07_425723	695	5	the	the	DT
10_1101-2021_01_07_425723	695	6	ABC	ABC	NNP
10_1101-2021_01_07_425723	695	7	transporter	transporter	NN
10_1101-2021_01_07_425723	695	8	Aus1	Aus1	NNP
10_1101-2021_01_07_425723	695	9	and	and	CC
10_1101-2021_01_07_425723	695	10	the	the	DT
10_1101-2021_01_07_425723	695	11	814	814	CD
10_1101-2021_01_07_425723	695	12	mannoprotein	mannoprotein	NN
10_1101-2021_01_07_425723	695	13	Dan1	Dan1	NNP
10_1101-2021_01_07_425723	695	14	whose	whose	WP$
10_1101-2021_01_07_425723	695	15	synergistic	synergistic	JJ
10_1101-2021_01_07_425723	695	16	action	action	NN
10_1101-2021_01_07_425723	695	17	is	be	VBZ
10_1101-2021_01_07_425723	695	18	sufficient	sufficient	JJ
10_1101-2021_01_07_425723	695	19	for	for	IN
10_1101-2021_01_07_425723	695	20	this	this	DT
10_1101-2021_01_07_425723	695	21	process	process	NN
10_1101-2021_01_07_425723	695	22	.	.	.
10_1101-2021_01_07_425723	696	1	Biochem	Biochem	NNP
10_1101-2021_01_07_425723	696	2	.	.	.
10_1101-2021_01_07_425723	697	1	J.	J.	NNP
10_1101-2021_01_07_425723	698	1	381	381	CD
10_1101-2021_01_07_425723	698	2	,	,	,
10_1101-2021_01_07_425723	698	3	195–815	195–815	CD
10_1101-2021_01_07_425723	698	4	202	202	CD
10_1101-2021_01_07_425723	698	5	(	(	-LRB-
10_1101-2021_01_07_425723	698	6	2004	2004	CD
10_1101-2021_01_07_425723	698	7	)	)	-RRB-
10_1101-2021_01_07_425723	698	8	.	.	.
10_1101-2021_01_07_425723	699	1	816	816	CD
10_1101-2021_01_07_425723	699	2	43	43	CD
10_1101-2021_01_07_425723	699	3	.	.	.
10_1101-2021_01_07_425723	700	1	Marek	Marek	NNP
10_1101-2021_01_07_425723	700	2	,	,	,
10_1101-2021_01_07_425723	700	3	M.	M.	NNP
10_1101-2021_01_07_425723	700	4	,	,	,
10_1101-2021_01_07_425723	700	5	Silvestro	Silvestro	NNP
10_1101-2021_01_07_425723	700	6	,	,	,
10_1101-2021_01_07_425723	700	7	D.	D.	NNP
10_1101-2021_01_07_425723	700	8	,	,	,
10_1101-2021_01_07_425723	700	9	Fredslund	Fredslund	NNP
10_1101-2021_01_07_425723	700	10	,	,	,
10_1101-2021_01_07_425723	700	11	M.	M.	NNP
10_1101-2021_01_07_425723	700	12	D.	D.	NNP
10_1101-2021_01_07_425723	700	13	,	,	,
10_1101-2021_01_07_425723	700	14	Andersen	Andersen	NNP
10_1101-2021_01_07_425723	700	15	,	,	,
10_1101-2021_01_07_425723	700	16	T.	T.	NNP
10_1101-2021_01_07_425723	700	17	G.	G.	NNP
10_1101-2021_01_07_425723	700	18	&	&	CC
10_1101-2021_01_07_425723	700	19	Pomorski	Pomorski	NNP
10_1101-2021_01_07_425723	700	20	,	,	,
10_1101-2021_01_07_425723	700	21	T.	T.	NNP
10_1101-2021_01_07_425723	700	22	G.	G.	NNP
10_1101-2021_01_07_425723	700	23	Serum	Serum	NNP
10_1101-2021_01_07_425723	700	24	albumin	albumin	NN
10_1101-2021_01_07_425723	700	25	817	817	CD
10_1101-2021_01_07_425723	700	26	promotes	promote	VBZ
10_1101-2021_01_07_425723	700	27	ATP	atp	NN
10_1101-2021_01_07_425723	700	28	-	-	HYPH
10_1101-2021_01_07_425723	700	29	binding	bind	VBG
10_1101-2021_01_07_425723	700	30	cassette	cassette	NN
10_1101-2021_01_07_425723	700	31	transporter	transporter	NN
10_1101-2021_01_07_425723	700	32	-	-	HYPH
10_1101-2021_01_07_425723	700	33	dependent	dependent	JJ
10_1101-2021_01_07_425723	700	34	sterol	sterol	NN
10_1101-2021_01_07_425723	700	35	uptake	uptake	NN
10_1101-2021_01_07_425723	700	36	in	in	IN
10_1101-2021_01_07_425723	700	37	yeast	yeast	NN
10_1101-2021_01_07_425723	700	38	.	.	.
10_1101-2021_01_07_425723	701	1	FEMS	FEMS	NNP
10_1101-2021_01_07_425723	701	2	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	701	3	Res	res	NN
10_1101-2021_01_07_425723	701	4	.	.	.
10_1101-2021_01_07_425723	702	1	818	818	CD
10_1101-2021_01_07_425723	702	2	14	14	CD
10_1101-2021_01_07_425723	702	3	,	,	,
10_1101-2021_01_07_425723	702	4	1223–1233	1223–1233	CD
10_1101-2021_01_07_425723	702	5	(	(	-LRB-
10_1101-2021_01_07_425723	702	6	2014	2014	CD
10_1101-2021_01_07_425723	702	7	)	)	-RRB-
10_1101-2021_01_07_425723	702	8	.	.	.
10_1101-2021_01_07_425723	703	1	819	819	CD
10_1101-2021_01_07_425723	703	2	44	44	CD
10_1101-2021_01_07_425723	703	3	.	.	.
10_1101-2021_01_07_425723	704	1	Marek	Marek	NNP
10_1101-2021_01_07_425723	704	2	,	,	,
10_1101-2021_01_07_425723	704	3	M.	M.	NNP
10_1101-2021_01_07_425723	704	4	et	et	NNP
10_1101-2021_01_07_425723	704	5	al	al	NNP
10_1101-2021_01_07_425723	704	6	.	.	.
10_1101-2021_01_07_425723	705	1	The	the	DT
10_1101-2021_01_07_425723	705	2	yeast	yeast	NN
10_1101-2021_01_07_425723	705	3	plasma	plasma	NN
10_1101-2021_01_07_425723	705	4	membrane	membrane	NN
10_1101-2021_01_07_425723	705	5	ATP	ATP	NNP
10_1101-2021_01_07_425723	705	6	binding	bind	VBG
10_1101-2021_01_07_425723	705	7	cassette	cassette	NN
10_1101-2021_01_07_425723	705	8	(	(	-LRB-
10_1101-2021_01_07_425723	705	9	ABC	ABC	NNP
10_1101-2021_01_07_425723	705	10	)	)	-RRB-
10_1101-2021_01_07_425723	705	11	transporter	transporter	NN
10_1101-2021_01_07_425723	705	12	Aus1	Aus1	NNP
10_1101-2021_01_07_425723	705	13	:	:	:
10_1101-2021_01_07_425723	705	14	820	820	CD
10_1101-2021_01_07_425723	705	15	Purification	Purification	NNP
10_1101-2021_01_07_425723	705	16	,	,	,
10_1101-2021_01_07_425723	705	17	characterization	characterization	NN
10_1101-2021_01_07_425723	705	18	,	,	,
10_1101-2021_01_07_425723	705	19	and	and	CC
10_1101-2021_01_07_425723	705	20	the	the	DT
10_1101-2021_01_07_425723	705	21	effect	effect	NN
10_1101-2021_01_07_425723	705	22	of	of	IN
10_1101-2021_01_07_425723	705	23	lipids	lipid	NNS
10_1101-2021_01_07_425723	705	24	on	on	IN
10_1101-2021_01_07_425723	705	25	its	-PRON-	PRP$
10_1101-2021_01_07_425723	705	26	activity	activity	NN
10_1101-2021_01_07_425723	705	27	.	.	.
10_1101-2021_01_07_425723	706	1	J.	J.	NNP
10_1101-2021_01_07_425723	706	2	Biol	Biol	NNP
10_1101-2021_01_07_425723	706	3	.	.	.
10_1101-2021_01_07_425723	707	1	Chem	Chem	NNP
10_1101-2021_01_07_425723	707	2	.	.	.
10_1101-2021_01_07_425723	708	1	286	286	CD
10_1101-2021_01_07_425723	708	2	,	,	,
10_1101-2021_01_07_425723	708	3	21835–821	21835–821	CD
10_1101-2021_01_07_425723	708	4	21843	21843	CD
10_1101-2021_01_07_425723	708	5	(	(	-LRB-
10_1101-2021_01_07_425723	708	6	2011	2011	CD
10_1101-2021_01_07_425723	708	7	)	)	-RRB-
10_1101-2021_01_07_425723	708	8	.	.	.
10_1101-2021_01_07_425723	709	1	822	822	CD
10_1101-2021_01_07_425723	709	2	45	45	CD
10_1101-2021_01_07_425723	709	3	.	.	.
10_1101-2021_01_07_425723	710	1	Takishita	Takishita	NNP
10_1101-2021_01_07_425723	710	2	,	,	,
10_1101-2021_01_07_425723	710	3	K.	K.	NNP
10_1101-2021_01_07_425723	710	4	et	et	NNP
10_1101-2021_01_07_425723	710	5	al	al	NNP
10_1101-2021_01_07_425723	710	6	.	.	.
10_1101-2021_01_07_425723	711	1	Lateral	lateral	JJ
10_1101-2021_01_07_425723	711	2	transfer	transfer	NN
10_1101-2021_01_07_425723	711	3	of	of	IN
10_1101-2021_01_07_425723	711	4	tetrahymanol	tetrahymanol	NN
10_1101-2021_01_07_425723	711	5	-	-	HYPH
10_1101-2021_01_07_425723	711	6	synthesizing	synthesize	VBG
10_1101-2021_01_07_425723	711	7	genes	gene	NNS
10_1101-2021_01_07_425723	711	8	has	have	VBZ
10_1101-2021_01_07_425723	711	9	allowed	allow	VBN
10_1101-2021_01_07_425723	711	10	multiple	multiple	JJ
10_1101-2021_01_07_425723	711	11	823	823	CD
10_1101-2021_01_07_425723	711	12	diverse	diverse	JJ
10_1101-2021_01_07_425723	711	13	eukaryote	eukaryote	NN
10_1101-2021_01_07_425723	711	14	lineages	lineage	NNS
10_1101-2021_01_07_425723	711	15	to	to	TO
10_1101-2021_01_07_425723	711	16	independently	independently	RB
10_1101-2021_01_07_425723	711	17	adapt	adapt	VB
10_1101-2021_01_07_425723	711	18	to	to	IN
10_1101-2021_01_07_425723	711	19	environments	environment	NNS
10_1101-2021_01_07_425723	711	20	without	without	IN
10_1101-2021_01_07_425723	711	21	oxygen	oxygen	NN
10_1101-2021_01_07_425723	711	22	.	.	.
10_1101-2021_01_07_425723	712	1	Biol	Biol	NNP
10_1101-2021_01_07_425723	712	2	.	.	.
10_1101-2021_01_07_425723	713	1	Direct	direct	JJ
10_1101-2021_01_07_425723	713	2	824	824	CD
10_1101-2021_01_07_425723	713	3	7	7	CD
10_1101-2021_01_07_425723	713	4	,	,	,
10_1101-2021_01_07_425723	713	5	5	5	CD
10_1101-2021_01_07_425723	713	6	(	(	-LRB-
10_1101-2021_01_07_425723	713	7	2012	2012	CD
10_1101-2021_01_07_425723	713	8	)	)	-RRB-
10_1101-2021_01_07_425723	713	9	.	.	.
10_1101-2021_01_07_425723	714	1	825	825	CD
10_1101-2021_01_07_425723	714	2	46	46	CD
10_1101-2021_01_07_425723	714	3	.	.	.
10_1101-2021_01_07_425723	715	1	Wiersma	Wiersma	NNP
10_1101-2021_01_07_425723	715	2	,	,	,
10_1101-2021_01_07_425723	715	3	S.	S.	NNP
10_1101-2021_01_07_425723	715	4	J.	J.	NNP
10_1101-2021_01_07_425723	715	5	,	,	,
10_1101-2021_01_07_425723	715	6	Mooiman	Mooiman	NNP
10_1101-2021_01_07_425723	715	7	,	,	,
10_1101-2021_01_07_425723	715	8	C.	C.	NNP
10_1101-2021_01_07_425723	715	9	,	,	,
10_1101-2021_01_07_425723	715	10	Giera	Giera	NNP
10_1101-2021_01_07_425723	715	11	,	,	,
10_1101-2021_01_07_425723	715	12	M.	M.	NNP
10_1101-2021_01_07_425723	715	13	&	&	CC
10_1101-2021_01_07_425723	715	14	Pronk	Pronk	NNP
10_1101-2021_01_07_425723	715	15	,	,	,
10_1101-2021_01_07_425723	715	16	J.	J.	NNP
10_1101-2021_01_07_425723	715	17	T.	T.	NNP
10_1101-2021_01_07_425723	715	18	Squalene	Squalene	NNP
10_1101-2021_01_07_425723	715	19	-	-	HYPH
10_1101-2021_01_07_425723	715	20	Tetrahymanol	Tetrahymanol	NNP
10_1101-2021_01_07_425723	715	21	Cyclase	Cyclase	NNP
10_1101-2021_01_07_425723	715	22	Expression	expression	NN
10_1101-2021_01_07_425723	715	23	826	826	CD
10_1101-2021_01_07_425723	715	24	Enables	Enables	NNP
10_1101-2021_01_07_425723	715	25	Sterol	Sterol	NNP
10_1101-2021_01_07_425723	715	26	-	-	HYPH
10_1101-2021_01_07_425723	715	27	Independent	Independent	NNP
10_1101-2021_01_07_425723	715	28	Growth	Growth	NNP
10_1101-2021_01_07_425723	715	29	of	of	IN
10_1101-2021_01_07_425723	715	30	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_07_425723	715	31	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	715	32	.	.	.
10_1101-2021_01_07_425723	716	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	716	2	.	.	.
10_1101-2021_01_07_425723	717	1	Environ	Environ	NNP
10_1101-2021_01_07_425723	717	2	.	.	.
10_1101-2021_01_07_425723	718	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	718	2	.	.	.
10_1101-2021_01_07_425723	719	1	86	86	CD
10_1101-2021_01_07_425723	719	2	,	,	,
10_1101-2021_01_07_425723	719	3	1–827	1–827	CD
10_1101-2021_01_07_425723	719	4	15	15	CD
10_1101-2021_01_07_425723	719	5	(	(	-LRB-
10_1101-2021_01_07_425723	719	6	2020	2020	CD
10_1101-2021_01_07_425723	719	7	)	)	-RRB-
10_1101-2021_01_07_425723	719	8	.	.	.
10_1101-2021_01_07_425723	720	1	828	828	CD
10_1101-2021_01_07_425723	720	2	47	47	CD
10_1101-2021_01_07_425723	720	3	.	.	.
10_1101-2021_01_07_425723	721	1	Rajkumar	Rajkumar	NNP
10_1101-2021_01_07_425723	721	2	,	,	,
10_1101-2021_01_07_425723	721	3	A.	a.	NN
10_1101-2021_01_07_425723	721	4	S.	S.	NNP
10_1101-2021_01_07_425723	721	5	,	,	,
10_1101-2021_01_07_425723	721	6	Varela	Varela	NNP
10_1101-2021_01_07_425723	721	7	,	,	,
10_1101-2021_01_07_425723	721	8	J.	J.	NNP
10_1101-2021_01_07_425723	722	1	A.	A.	NNP
10_1101-2021_01_07_425723	722	2	,	,	,
10_1101-2021_01_07_425723	722	3	Juergens	Juergens	NNP
10_1101-2021_01_07_425723	722	4	,	,	,
10_1101-2021_01_07_425723	722	5	H.	H.	NNP
10_1101-2021_01_07_425723	722	6	,	,	,
10_1101-2021_01_07_425723	722	7	Daran	Daran	NNP
10_1101-2021_01_07_425723	722	8	,	,	,
10_1101-2021_01_07_425723	722	9	J.	J.	NNP
10_1101-2021_01_07_425723	722	10	G.	G.	NNP
10_1101-2021_01_07_425723	722	11	&	&	CC
10_1101-2021_01_07_425723	722	12	Morrissey	Morrissey	NNP
10_1101-2021_01_07_425723	722	13	,	,	,
10_1101-2021_01_07_425723	722	14	J.	J.	NNP
10_1101-2021_01_07_425723	722	15	P.	P.	NNP
10_1101-2021_01_07_425723	722	16	Biological	Biological	NNP
10_1101-2021_01_07_425723	722	17	Parts	Parts	NNPS
10_1101-2021_01_07_425723	722	18	for	for	IN
10_1101-2021_01_07_425723	722	19	829	829	CD
10_1101-2021_01_07_425723	722	20	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	722	21	marxianus	marxianus	NN
10_1101-2021_01_07_425723	722	22	Synthetic	Synthetic	NNP
10_1101-2021_01_07_425723	722	23	Biology	biology	NN
10_1101-2021_01_07_425723	722	24	.	.	.
10_1101-2021_01_07_425723	723	1	Front	front	NN
10_1101-2021_01_07_425723	723	2	.	.	.
10_1101-2021_01_07_425723	724	1	Bioeng	Bioeng	NNP
10_1101-2021_01_07_425723	724	2	.	.	.
10_1101-2021_01_07_425723	725	1	Biotechnol	Biotechnol	NNS
10_1101-2021_01_07_425723	725	2	.	.	.
10_1101-2021_01_07_425723	726	1	7	7	LS
10_1101-2021_01_07_425723	726	2	,	,	,
10_1101-2021_01_07_425723	726	3	1–15	1–15	CD
10_1101-2021_01_07_425723	726	4	(	(	-LRB-
10_1101-2021_01_07_425723	726	5	2019	2019	CD
10_1101-2021_01_07_425723	726	6	)	)	-RRB-
10_1101-2021_01_07_425723	726	7	.	.	.
10_1101-2021_01_07_425723	727	1	830	830	CD
10_1101-2021_01_07_425723	727	2	48	48	CD
10_1101-2021_01_07_425723	727	3	.	.	.
10_1101-2021_01_07_425723	728	1	Landry	Landry	NNP
10_1101-2021_01_07_425723	728	2	,	,	,
10_1101-2021_01_07_425723	728	3	B.	B.	NNP
10_1101-2021_01_07_425723	728	4	D.	D.	NNP
10_1101-2021_01_07_425723	728	5	,	,	,
10_1101-2021_01_07_425723	728	6	Doyle	Doyle	NNP
10_1101-2021_01_07_425723	728	7	,	,	,
10_1101-2021_01_07_425723	728	8	J.	J.	NNP
10_1101-2021_01_07_425723	728	9	P.	P.	NNP
10_1101-2021_01_07_425723	728	10	,	,	,
10_1101-2021_01_07_425723	728	11	Toczyski	Toczyski	NNP
10_1101-2021_01_07_425723	728	12	,	,	,
10_1101-2021_01_07_425723	728	13	D.	D.	NNP
10_1101-2021_01_07_425723	728	14	P.	P.	NNP
10_1101-2021_01_07_425723	728	15	&	&	CC
10_1101-2021_01_07_425723	728	16	Benanti	Benanti	NNP
10_1101-2021_01_07_425723	728	17	,	,	,
10_1101-2021_01_07_425723	728	18	J.	J.	NNP
10_1101-2021_01_07_425723	729	1	A.	A.	NNP
10_1101-2021_01_07_425723	729	2	F	F	NNP
10_1101-2021_01_07_425723	729	3	-	-	HYPH
10_1101-2021_01_07_425723	729	4	Box	Box	NNP
10_1101-2021_01_07_425723	729	5	Protein	Protein	NNP
10_1101-2021_01_07_425723	729	6	Specificity	Specificity	NNP
10_1101-2021_01_07_425723	729	7	for	for	IN
10_1101-2021_01_07_425723	729	8	G1	G1	NNP
10_1101-2021_01_07_425723	729	9	Cyclins	Cyclins	NNP
10_1101-2021_01_07_425723	729	10	Is	be	VBZ
10_1101-2021_01_07_425723	729	11	831	831	CD
10_1101-2021_01_07_425723	729	12	Dictated	dictate	VBN
10_1101-2021_01_07_425723	729	13	by	by	IN
10_1101-2021_01_07_425723	729	14	Subcellular	Subcellular	NNP
10_1101-2021_01_07_425723	729	15	Localization	Localization	NNP
10_1101-2021_01_07_425723	729	16	.	.	.
10_1101-2021_01_07_425723	730	1	PLoS	PLoS	NNP
10_1101-2021_01_07_425723	730	2	Genet	Genet	NNP
10_1101-2021_01_07_425723	730	3	.	.	.
10_1101-2021_01_07_425723	731	1	8	8	CD
10_1101-2021_01_07_425723	731	2	,	,	,
10_1101-2021_01_07_425723	731	3	e1002851	e1002851	NNP
10_1101-2021_01_07_425723	731	4	(	(	-LRB-
10_1101-2021_01_07_425723	731	5	2012	2012	CD
10_1101-2021_01_07_425723	731	6	)	)	-RRB-
10_1101-2021_01_07_425723	731	7	.	.	.
10_1101-2021_01_07_425723	732	1	832	832	CD
10_1101-2021_01_07_425723	732	2	49	49	CD
10_1101-2021_01_07_425723	732	3	.	.	.
10_1101-2021_01_07_425723	733	1	Fonseca	Fonseca	NNP
10_1101-2021_01_07_425723	733	2	,	,	,
10_1101-2021_01_07_425723	733	3	G.	G.	NNP
10_1101-2021_01_07_425723	733	4	G.	G.	NNP
10_1101-2021_01_07_425723	733	5	,	,	,
10_1101-2021_01_07_425723	733	6	Heinzle	Heinzle	NNP
10_1101-2021_01_07_425723	733	7	,	,	,
10_1101-2021_01_07_425723	733	8	E.	E.	NNP
10_1101-2021_01_07_425723	733	9	,	,	,
10_1101-2021_01_07_425723	733	10	Wittmann	Wittmann	NNP
10_1101-2021_01_07_425723	733	11	,	,	,
10_1101-2021_01_07_425723	733	12	C.	C.	NNP
10_1101-2021_01_07_425723	733	13	&	&	CC
10_1101-2021_01_07_425723	733	14	Gombert	Gombert	NNP
10_1101-2021_01_07_425723	733	15	,	,	,
10_1101-2021_01_07_425723	733	16	A.	A.	NNP
10_1101-2021_01_07_425723	733	17	K.	K.	NNP
10_1101-2021_01_07_425723	733	18	The	the	DT
10_1101-2021_01_07_425723	733	19	yeast	yeast	NN
10_1101-2021_01_07_425723	733	20	Kluyveromyces	kluyveromyce	VBZ
10_1101-2021_01_07_425723	733	21	marxianus	marxianus	NN
10_1101-2021_01_07_425723	733	22	833	833	CD
10_1101-2021_01_07_425723	733	23	and	and	CC
10_1101-2021_01_07_425723	733	24	its	-PRON-	PRP$
10_1101-2021_01_07_425723	733	25	biotechnological	biotechnological	JJ
10_1101-2021_01_07_425723	733	26	potential	potential	NN
10_1101-2021_01_07_425723	733	27	.	.	.
10_1101-2021_01_07_425723	734	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	734	2	.	.	.
10_1101-2021_01_07_425723	735	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	735	2	.	.	.
10_1101-2021_01_07_425723	736	1	Biotechnol	Biotechnol	NNS
10_1101-2021_01_07_425723	736	2	.	.	.
10_1101-2021_01_07_425723	737	1	79	79	CD
10_1101-2021_01_07_425723	737	2	,	,	,
10_1101-2021_01_07_425723	737	3	339–354	339–354	CD
10_1101-2021_01_07_425723	737	4	(	(	-LRB-
10_1101-2021_01_07_425723	737	5	2008	2008	CD
10_1101-2021_01_07_425723	737	6	)	)	-RRB-
10_1101-2021_01_07_425723	737	7	.	.	.
10_1101-2021_01_07_425723	738	1	834	834	CD
10_1101-2021_01_07_425723	738	2	50	50	CD
10_1101-2021_01_07_425723	738	3	.	.	.
10_1101-2021_01_07_425723	739	1	Madeira	Madeira	NNP
10_1101-2021_01_07_425723	739	2	-	-	HYPH
10_1101-2021_01_07_425723	739	3	Jr	Jr	NNP
10_1101-2021_01_07_425723	739	4	,	,	,
10_1101-2021_01_07_425723	739	5	J.	J.	NNP
10_1101-2021_01_07_425723	739	6	V.	V.	NNP
10_1101-2021_01_07_425723	739	7	&	&	CC
10_1101-2021_01_07_425723	739	8	Gombert	Gombert	NNP
10_1101-2021_01_07_425723	739	9	,	,	,
10_1101-2021_01_07_425723	739	10	A.	A.	NNP
10_1101-2021_01_07_425723	739	11	K.	K.	NNP
10_1101-2021_01_07_425723	739	12	Towards	towards	IN
10_1101-2021_01_07_425723	739	13	high	high	JJ
10_1101-2021_01_07_425723	739	14	-	-	HYPH
10_1101-2021_01_07_425723	739	15	temperature	temperature	NN
10_1101-2021_01_07_425723	739	16	fuel	fuel	NN
10_1101-2021_01_07_425723	739	17	ethanol	ethanol	NN
10_1101-2021_01_07_425723	739	18	production	production	NN
10_1101-2021_01_07_425723	739	19	using	use	VBG
10_1101-2021_01_07_425723	739	20	835	835	CD
10_1101-2021_01_07_425723	739	21	.CC	.CC	,
10_1101-2021_01_07_425723	739	22	-	-	:
10_1101-2021_01_07_425723	739	23	BY	by	IN
10_1101-2021_01_07_425723	739	24	-	-	HYPH
10_1101-2021_01_07_425723	739	25	NC	NC	NNP
10_1101-2021_01_07_425723	739	26	-	-	HYPH
10_1101-2021_01_07_425723	739	27	ND	ND	NNP
10_1101-2021_01_07_425723	739	28	4.0	4.0	CD
10_1101-2021_01_07_425723	739	29	International	International	NNP
10_1101-2021_01_07_425723	739	30	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	739	31	under	under	IN
10_1101-2021_01_07_425723	739	32	a	a	DT
10_1101-2021_01_07_425723	739	33	(	(	-LRB-
10_1101-2021_01_07_425723	739	34	which	which	WDT
10_1101-2021_01_07_425723	739	35	was	be	VBD
10_1101-2021_01_07_425723	739	36	not	not	RB
10_1101-2021_01_07_425723	739	37	certified	certify	VBN
10_1101-2021_01_07_425723	739	38	by	by	IN
10_1101-2021_01_07_425723	739	39	peer	peer	NN
10_1101-2021_01_07_425723	739	40	review	review	NN
10_1101-2021_01_07_425723	739	41	)	)	-RRB-
10_1101-2021_01_07_425723	739	42	is	be	VBZ
10_1101-2021_01_07_425723	739	43	the	the	DT
10_1101-2021_01_07_425723	739	44	author	author	NN
10_1101-2021_01_07_425723	739	45	/	/	SYM
10_1101-2021_01_07_425723	739	46	funder	funder	NN
10_1101-2021_01_07_425723	739	47	,	,	,
10_1101-2021_01_07_425723	739	48	who	who	WP
10_1101-2021_01_07_425723	739	49	has	have	VBZ
10_1101-2021_01_07_425723	739	50	granted	grant	VBN
10_1101-2021_01_07_425723	739	51	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	739	52	a	a	DT
10_1101-2021_01_07_425723	739	53	license	license	NN
10_1101-2021_01_07_425723	739	54	to	to	TO
10_1101-2021_01_07_425723	739	55	display	display	VB
10_1101-2021_01_07_425723	739	56	the	the	DT
10_1101-2021_01_07_425723	739	57	preprint	preprint	NN
10_1101-2021_01_07_425723	739	58	in	in	IN
10_1101-2021_01_07_425723	739	59	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	739	60	.	.	.
10_1101-2021_01_07_425723	740	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	740	2	is	be	VBZ
10_1101-2021_01_07_425723	740	3	made	make	VBN
10_1101-2021_01_07_425723	740	4	The	the	DT
10_1101-2021_01_07_425723	740	5	copyright	copyright	NN
10_1101-2021_01_07_425723	740	6	holder	holder	NN
10_1101-2021_01_07_425723	740	7	for	for	IN
10_1101-2021_01_07_425723	740	8	this	this	DT
10_1101-2021_01_07_425723	740	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	740	10	version	version	NN
10_1101-2021_01_07_425723	740	11	posted	post	VBD
10_1101-2021_01_07_425723	740	12	January	January	NNP
10_1101-2021_01_07_425723	740	13	8	8	CD
10_1101-2021_01_07_425723	740	14	,	,	,
10_1101-2021_01_07_425723	740	15	2021	2021	CD
10_1101-2021_01_07_425723	740	16	.	.	.
10_1101-2021_01_07_425723	740	17	;	;	:
10_1101-2021_01_07_425723	740	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	740	19	:	:	:
10_1101-2021_01_07_425723	740	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	740	21	preprint	preprint	NN
10_1101-2021_01_07_425723	740	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	740	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NNP
10_1101-2021_01_07_425723	740	24	43	43	CD
10_1101-2021_01_07_425723	740	25	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	740	26	marxianus	marxianus	NN
10_1101-2021_01_07_425723	740	27	:	:	:
10_1101-2021_01_07_425723	740	28	On	on	IN
10_1101-2021_01_07_425723	740	29	the	the	DT
10_1101-2021_01_07_425723	740	30	search	search	NN
10_1101-2021_01_07_425723	740	31	for	for	IN
10_1101-2021_01_07_425723	740	32	plug	plug	NN
10_1101-2021_01_07_425723	740	33	-	-	HYPH
10_1101-2021_01_07_425723	740	34	in	in	RP
10_1101-2021_01_07_425723	740	35	strains	strain	NNS
10_1101-2021_01_07_425723	740	36	for	for	IN
10_1101-2021_01_07_425723	740	37	the	the	DT
10_1101-2021_01_07_425723	740	38	Brazilian	brazilian	JJ
10_1101-2021_01_07_425723	740	39	sugarcane	sugarcane	NN
10_1101-2021_01_07_425723	740	40	-	-	HYPH
10_1101-2021_01_07_425723	740	41	based	base	VBN
10_1101-2021_01_07_425723	740	42	836	836	CD
10_1101-2021_01_07_425723	740	43	biorefinery	biorefinery	NN
10_1101-2021_01_07_425723	740	44	.	.	.
10_1101-2021_01_07_425723	741	1	Biomass	Biomass	NNP
10_1101-2021_01_07_425723	741	2	and	and	CC
10_1101-2021_01_07_425723	741	3	Bioenergy	Bioenergy	NNP
10_1101-2021_01_07_425723	741	4	119	119	CD
10_1101-2021_01_07_425723	741	5	,	,	,
10_1101-2021_01_07_425723	741	6	217–228	217–228	CD
10_1101-2021_01_07_425723	741	7	(	(	-LRB-
10_1101-2021_01_07_425723	741	8	2018	2018	CD
10_1101-2021_01_07_425723	741	9	)	)	-RRB-
10_1101-2021_01_07_425723	741	10	.	.	.
10_1101-2021_01_07_425723	742	1	837	837	CD
10_1101-2021_01_07_425723	742	2	51	51	CD
10_1101-2021_01_07_425723	742	3	.	.	.
10_1101-2021_01_07_425723	743	1	Tai	Tai	NNP
10_1101-2021_01_07_425723	743	2	,	,	,
10_1101-2021_01_07_425723	743	3	S.	S.	NNP
10_1101-2021_01_07_425723	743	4	L.	L.	NNP
10_1101-2021_01_07_425723	743	5	et	et	NNP
10_1101-2021_01_07_425723	743	6	al	al	NNP
10_1101-2021_01_07_425723	743	7	.	.	.
10_1101-2021_01_07_425723	744	1	Two	two	CD
10_1101-2021_01_07_425723	744	2	-	-	HYPH
10_1101-2021_01_07_425723	744	3	dimensional	dimensional	JJ
10_1101-2021_01_07_425723	744	4	transcriptome	transcriptome	NNP
10_1101-2021_01_07_425723	744	5	analysis	analysis	NN
10_1101-2021_01_07_425723	744	6	in	in	IN
10_1101-2021_01_07_425723	744	7	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	744	8	cultures	culture	NNS
10_1101-2021_01_07_425723	744	9	:	:	:
10_1101-2021_01_07_425723	744	10	Combinatorial	combinatorial	NN
10_1101-2021_01_07_425723	744	11	838	838	CD
10_1101-2021_01_07_425723	744	12	effects	effect	NNS
10_1101-2021_01_07_425723	744	13	of	of	IN
10_1101-2021_01_07_425723	744	14	oxygen	oxygen	NN
10_1101-2021_01_07_425723	744	15	availability	availability	NN
10_1101-2021_01_07_425723	744	16	and	and	CC
10_1101-2021_01_07_425723	744	17	macronutrient	macronutrient	NN
10_1101-2021_01_07_425723	744	18	limitation	limitation	NN
10_1101-2021_01_07_425723	744	19	in	in	IN
10_1101-2021_01_07_425723	744	20	Saccharomyces	Saccharomyces	NNP
10_1101-2021_01_07_425723	744	21	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	744	22	.	.	.
10_1101-2021_01_07_425723	745	1	J.	J.	NNP
10_1101-2021_01_07_425723	745	2	Biol	Biol	NNP
10_1101-2021_01_07_425723	745	3	.	.	.
10_1101-2021_01_07_425723	746	1	839	839	CD
10_1101-2021_01_07_425723	746	2	Chem	Chem	NNP
10_1101-2021_01_07_425723	746	3	.	.	.
10_1101-2021_01_07_425723	747	1	280	280	CD
10_1101-2021_01_07_425723	747	2	,	,	,
10_1101-2021_01_07_425723	747	3	437–447	437–447	CD
10_1101-2021_01_07_425723	747	4	(	(	-LRB-
10_1101-2021_01_07_425723	747	5	2005	2005	CD
10_1101-2021_01_07_425723	747	6	)	)	-RRB-
10_1101-2021_01_07_425723	747	7	.	.	.
10_1101-2021_01_07_425723	748	1	840	840	CD
10_1101-2021_01_07_425723	748	2	52	52	CD
10_1101-2021_01_07_425723	748	3	.	.	.
10_1101-2021_01_07_425723	749	1	Seret	Seret	NNP
10_1101-2021_01_07_425723	749	2	,	,	,
10_1101-2021_01_07_425723	749	3	M.	M.	NNP
10_1101-2021_01_07_425723	749	4	L.	L.	NNP
10_1101-2021_01_07_425723	749	5	,	,	,
10_1101-2021_01_07_425723	749	6	Diffels	Diffels	NNP
10_1101-2021_01_07_425723	749	7	,	,	,
10_1101-2021_01_07_425723	749	8	J.	J.	NNP
10_1101-2021_01_07_425723	749	9	F.	F.	NNP
10_1101-2021_01_07_425723	749	10	,	,	,
10_1101-2021_01_07_425723	749	11	Goffeau	Goffeau	NNP
10_1101-2021_01_07_425723	749	12	,	,	,
10_1101-2021_01_07_425723	749	13	A.	a.	NN
10_1101-2021_01_07_425723	750	1	&	&	CC
10_1101-2021_01_07_425723	750	2	Baret	Baret	NNP
10_1101-2021_01_07_425723	750	3	,	,	,
10_1101-2021_01_07_425723	750	4	P.	P.	NNP
10_1101-2021_01_07_425723	750	5	V.	V.	NNP
10_1101-2021_01_07_425723	750	6	Combined	Combined	NNP
10_1101-2021_01_07_425723	750	7	phylogeny	phylogeny	NN
10_1101-2021_01_07_425723	750	8	and	and	CC
10_1101-2021_01_07_425723	750	9	neighborhood	neighborhood	NN
10_1101-2021_01_07_425723	750	10	841	841	CD
10_1101-2021_01_07_425723	750	11	analysis	analysis	NN
10_1101-2021_01_07_425723	750	12	of	of	IN
10_1101-2021_01_07_425723	750	13	the	the	DT
10_1101-2021_01_07_425723	750	14	evolution	evolution	NN
10_1101-2021_01_07_425723	750	15	of	of	IN
10_1101-2021_01_07_425723	750	16	the	the	DT
10_1101-2021_01_07_425723	750	17	ABC	ABC	NNP
10_1101-2021_01_07_425723	750	18	transporters	transporter	NNS
10_1101-2021_01_07_425723	750	19	conferring	confer	VBG
10_1101-2021_01_07_425723	750	20	multiple	multiple	JJ
10_1101-2021_01_07_425723	750	21	drug	drug	NN
10_1101-2021_01_07_425723	750	22	resistance	resistance	NN
10_1101-2021_01_07_425723	750	23	in	in	IN
10_1101-2021_01_07_425723	750	24	842	842	CD
10_1101-2021_01_07_425723	750	25	hemiascomycete	hemiascomycete	JJ
10_1101-2021_01_07_425723	750	26	yeasts	yeast	NNS
10_1101-2021_01_07_425723	750	27	.	.	.
10_1101-2021_01_07_425723	751	1	BMC	BMC	NNP
10_1101-2021_01_07_425723	751	2	Genomics	Genomics	NNP
10_1101-2021_01_07_425723	751	3	10	10	CD
10_1101-2021_01_07_425723	751	4	,	,	,
10_1101-2021_01_07_425723	751	5	459	459	CD
10_1101-2021_01_07_425723	751	6	(	(	-LRB-
10_1101-2021_01_07_425723	751	7	2009	2009	CD
10_1101-2021_01_07_425723	751	8	)	)	-RRB-
10_1101-2021_01_07_425723	751	9	.	.	.
10_1101-2021_01_07_425723	752	1	843	843	CD
10_1101-2021_01_07_425723	752	2	53	53	CD
10_1101-2021_01_07_425723	752	3	.	.	.
10_1101-2021_01_07_425723	753	1	Shi	Shi	NNP
10_1101-2021_01_07_425723	753	2	,	,	,
10_1101-2021_01_07_425723	753	3	N.	N.	NNP
10_1101-2021_01_07_425723	753	4	Q.	Q.	NNP
10_1101-2021_01_07_425723	754	1	&	&	CC
10_1101-2021_01_07_425723	754	2	Jeffries	Jeffries	NNP
10_1101-2021_01_07_425723	754	3	,	,	,
10_1101-2021_01_07_425723	754	4	T.	T.	NNP
10_1101-2021_01_07_425723	754	5	W.	w.	NN
10_1101-2021_01_07_425723	754	6	Anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	754	7	growth	growth	NN
10_1101-2021_01_07_425723	754	8	and	and	CC
10_1101-2021_01_07_425723	754	9	improved	improved	JJ
10_1101-2021_01_07_425723	754	10	fermentation	fermentation	NN
10_1101-2021_01_07_425723	754	11	of	of	IN
10_1101-2021_01_07_425723	754	12	Pichia	Pichia	NNP
10_1101-2021_01_07_425723	754	13	stipitis	stipitis	NN
10_1101-2021_01_07_425723	754	14	bearing	bear	VBG
10_1101-2021_01_07_425723	754	15	844	844	CD
10_1101-2021_01_07_425723	754	16	a	a	DT
10_1101-2021_01_07_425723	754	17	URA1	URA1	NNP
10_1101-2021_01_07_425723	754	18	gene	gene	NN
10_1101-2021_01_07_425723	754	19	from	from	IN
10_1101-2021_01_07_425723	754	20	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	754	21	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	754	22	.	.	.
10_1101-2021_01_07_425723	755	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	755	2	.	.	.
10_1101-2021_01_07_425723	756	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	756	2	.	.	.
10_1101-2021_01_07_425723	757	1	Biotechnol	Biotechnol	NNS
10_1101-2021_01_07_425723	757	2	.	.	.
10_1101-2021_01_07_425723	758	1	50	50	CD
10_1101-2021_01_07_425723	758	2	,	,	,
10_1101-2021_01_07_425723	758	3	339–345	339–345	CD
10_1101-2021_01_07_425723	758	4	(	(	-LRB-
10_1101-2021_01_07_425723	758	5	1998	1998	CD
10_1101-2021_01_07_425723	758	6	)	)	-RRB-
10_1101-2021_01_07_425723	758	7	.	.	.
10_1101-2021_01_07_425723	759	1	845	845	CD
10_1101-2021_01_07_425723	759	2	54	54	CD
10_1101-2021_01_07_425723	759	3	.	.	.
10_1101-2021_01_07_425723	760	1	Gojković	Gojković	NNP
10_1101-2021_01_07_425723	760	2	,	,	,
10_1101-2021_01_07_425723	760	3	Z.	Z.	NNP
10_1101-2021_01_07_425723	760	4	et	et	FW
10_1101-2021_01_07_425723	760	5	al	al	NNP
10_1101-2021_01_07_425723	760	6	.	.	.
10_1101-2021_01_07_425723	761	1	Horizontal	horizontal	JJ
10_1101-2021_01_07_425723	761	2	gene	gene	NN
10_1101-2021_01_07_425723	761	3	transfer	transfer	NN
10_1101-2021_01_07_425723	761	4	promoted	promote	VBD
10_1101-2021_01_07_425723	761	5	evolution	evolution	NN
10_1101-2021_01_07_425723	761	6	of	of	IN
10_1101-2021_01_07_425723	761	7	the	the	DT
10_1101-2021_01_07_425723	761	8	ability	ability	NN
10_1101-2021_01_07_425723	761	9	to	to	TO
10_1101-2021_01_07_425723	761	10	propagate	propagate	VB
10_1101-2021_01_07_425723	761	11	under	under	IN
10_1101-2021_01_07_425723	761	12	846	846	CD
10_1101-2021_01_07_425723	761	13	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	761	14	conditions	condition	NNS
10_1101-2021_01_07_425723	761	15	in	in	IN
10_1101-2021_01_07_425723	761	16	yeasts	yeast	NNS
10_1101-2021_01_07_425723	761	17	.	.	.
10_1101-2021_01_07_425723	762	1	Mol	Mol	NNP
10_1101-2021_01_07_425723	762	2	.	.	.
10_1101-2021_01_07_425723	763	1	Genet	Genet	NNP
10_1101-2021_01_07_425723	763	2	.	.	.
10_1101-2021_01_07_425723	764	1	Genomics	Genomics	NNP
10_1101-2021_01_07_425723	764	2	271	271	CD
10_1101-2021_01_07_425723	764	3	,	,	,
10_1101-2021_01_07_425723	764	4	387–393	387–393	CD
10_1101-2021_01_07_425723	764	5	(	(	-LRB-
10_1101-2021_01_07_425723	764	6	2004	2004	CD
10_1101-2021_01_07_425723	764	7	)	)	-RRB-
10_1101-2021_01_07_425723	764	8	.	.	.
10_1101-2021_01_07_425723	765	1	847	847	CD
10_1101-2021_01_07_425723	765	2	55	55	CD
10_1101-2021_01_07_425723	765	3	.	.	.
10_1101-2021_01_07_425723	766	1	Riley	Riley	NNP
10_1101-2021_01_07_425723	766	2	,	,	,
10_1101-2021_01_07_425723	766	3	R.	R.	NNP
10_1101-2021_01_07_425723	766	4	et	et	NNP
10_1101-2021_01_07_425723	766	5	al	al	NNP
10_1101-2021_01_07_425723	766	6	.	.	.
10_1101-2021_01_07_425723	767	1	Comparative	comparative	JJ
10_1101-2021_01_07_425723	767	2	genomics	genomic	NNS
10_1101-2021_01_07_425723	767	3	of	of	IN
10_1101-2021_01_07_425723	767	4	biotechnologically	biotechnologically	RB
10_1101-2021_01_07_425723	767	5	important	important	JJ
10_1101-2021_01_07_425723	767	6	yeasts	yeast	NNS
10_1101-2021_01_07_425723	767	7	.	.	.
10_1101-2021_01_07_425723	768	1	Proc	Proc	NNP
10_1101-2021_01_07_425723	768	2	.	.	.
10_1101-2021_01_07_425723	769	1	Natl	Natl	NNP
10_1101-2021_01_07_425723	769	2	.	.	.
10_1101-2021_01_07_425723	770	1	Acad	Acad	NNS
10_1101-2021_01_07_425723	770	2	.	.	.
10_1101-2021_01_07_425723	771	1	Sci	Sci	NNP
10_1101-2021_01_07_425723	771	2	.	.	.
10_1101-2021_01_07_425723	772	1	848	848	CD
10_1101-2021_01_07_425723	772	2	U.	U.	NNP
10_1101-2021_01_07_425723	772	3	S.	S.	NNP
10_1101-2021_01_07_425723	772	4	A.	a.	NN
10_1101-2021_01_07_425723	773	1	113	113	CD
10_1101-2021_01_07_425723	773	2	,	,	,
10_1101-2021_01_07_425723	773	3	9882–9887	9882–9887	CD
10_1101-2021_01_07_425723	773	4	(	(	-LRB-
10_1101-2021_01_07_425723	773	5	2016	2016	CD
10_1101-2021_01_07_425723	773	6	)	)	-RRB-
10_1101-2021_01_07_425723	773	7	.	.	.
10_1101-2021_01_07_425723	774	1	849	849	CD
10_1101-2021_01_07_425723	774	2	56	56	CD
10_1101-2021_01_07_425723	774	3	.	.	.
10_1101-2021_01_07_425723	775	1	Guo	Guo	NNP
10_1101-2021_01_07_425723	775	2	,	,	,
10_1101-2021_01_07_425723	775	3	L.	L.	NNP
10_1101-2021_01_07_425723	775	4	,	,	,
10_1101-2021_01_07_425723	775	5	Pang	Pang	NNP
10_1101-2021_01_07_425723	775	6	,	,	,
10_1101-2021_01_07_425723	775	7	Z.	Z.	NNP
10_1101-2021_01_07_425723	775	8	,	,	,
10_1101-2021_01_07_425723	775	9	Gao	Gao	NNP
10_1101-2021_01_07_425723	775	10	,	,	,
10_1101-2021_01_07_425723	775	11	C.	C.	NNP
10_1101-2021_01_07_425723	775	12	,	,	,
10_1101-2021_01_07_425723	775	13	Chen	Chen	NNP
10_1101-2021_01_07_425723	775	14	,	,	,
10_1101-2021_01_07_425723	775	15	X.	X.	NNP
10_1101-2021_01_07_425723	776	1	&	&	CC
10_1101-2021_01_07_425723	776	2	Liu	Liu	NNP
10_1101-2021_01_07_425723	776	3	,	,	,
10_1101-2021_01_07_425723	776	4	L.	L.	NNP
10_1101-2021_01_07_425723	776	5	Engineering	Engineering	NNP
10_1101-2021_01_07_425723	776	6	microbial	microbial	JJ
10_1101-2021_01_07_425723	776	7	cell	cell	NN
10_1101-2021_01_07_425723	776	8	morphology	morphology	NN
10_1101-2021_01_07_425723	776	9	and	and	CC
10_1101-2021_01_07_425723	776	10	membrane	membrane	NN
10_1101-2021_01_07_425723	776	11	850	850	CD
10_1101-2021_01_07_425723	776	12	homeostasis	homeostasis	NN
10_1101-2021_01_07_425723	776	13	toward	toward	IN
10_1101-2021_01_07_425723	776	14	industrial	industrial	JJ
10_1101-2021_01_07_425723	776	15	applications	application	NNS
10_1101-2021_01_07_425723	776	16	.	.	.
10_1101-2021_01_07_425723	777	1	Curr	curr	UH
10_1101-2021_01_07_425723	777	2	.	.	.
10_1101-2021_01_07_425723	778	1	Opin	opin	JJ
10_1101-2021_01_07_425723	778	2	.	.	.
10_1101-2021_01_07_425723	779	1	Biotechnol	Biotechnol	NNS
10_1101-2021_01_07_425723	779	2	.	.	.
10_1101-2021_01_07_425723	780	1	66	66	CD
10_1101-2021_01_07_425723	780	2	,	,	,
10_1101-2021_01_07_425723	780	3	18–26	18–26	CD
10_1101-2021_01_07_425723	780	4	(	(	-LRB-
10_1101-2021_01_07_425723	780	5	2020	2020	CD
10_1101-2021_01_07_425723	780	6	)	)	-RRB-
10_1101-2021_01_07_425723	780	7	.	.	.
10_1101-2021_01_07_425723	781	1	851	851	CD
10_1101-2021_01_07_425723	781	2	57	57	CD
10_1101-2021_01_07_425723	781	3	.	.	.
10_1101-2021_01_07_425723	782	1	Entian	Entian	NNP
10_1101-2021_01_07_425723	782	2	,	,	,
10_1101-2021_01_07_425723	782	3	K.-D.	K.-D.	NNP
10_1101-2021_01_07_425723	782	4	&	&	CC
10_1101-2021_01_07_425723	782	5	Kötter	Kötter	NNP
10_1101-2021_01_07_425723	782	6	,	,	,
10_1101-2021_01_07_425723	782	7	P.	P.	NNP
10_1101-2021_01_07_425723	782	8	25	25	CD
10_1101-2021_01_07_425723	782	9	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	782	10	Genetic	Genetic	NNP
10_1101-2021_01_07_425723	782	11	Strain	Strain	NNP
10_1101-2021_01_07_425723	782	12	and	and	CC
10_1101-2021_01_07_425723	782	13	Plasmid	Plasmid	NNP
10_1101-2021_01_07_425723	782	14	Collections	Collections	NNPS
10_1101-2021_01_07_425723	782	15	.	.	.
10_1101-2021_01_07_425723	783	1	in	in	IN
10_1101-2021_01_07_425723	783	2	Methods	method	NNS
10_1101-2021_01_07_425723	783	3	in	in	IN
10_1101-2021_01_07_425723	783	4	852	852	CD
10_1101-2021_01_07_425723	783	5	Microbiology	Microbiology	NNP
10_1101-2021_01_07_425723	783	6	629–666	629–666	CD
10_1101-2021_01_07_425723	783	7	(	(	-LRB-
10_1101-2021_01_07_425723	783	8	2007	2007	CD
10_1101-2021_01_07_425723	783	9	)	)	-RRB-
10_1101-2021_01_07_425723	783	10	.	.	.
10_1101-2021_01_07_425723	784	1	doi:10.1016	doi:10.1016	JJ
10_1101-2021_01_07_425723	784	2	/	/	SYM
10_1101-2021_01_07_425723	784	3	S0580	S0580	NNP
10_1101-2021_01_07_425723	784	4	-	-	HYPH
10_1101-2021_01_07_425723	784	5	9517(06)36025	9517(06)36025	NNP
10_1101-2021_01_07_425723	784	6	-	-	HYPH
10_1101-2021_01_07_425723	784	7	4	4	CD
10_1101-2021_01_07_425723	784	8	853	853	CD
10_1101-2021_01_07_425723	784	9	58	58	CD
10_1101-2021_01_07_425723	784	10	.	.	.
10_1101-2021_01_07_425723	785	1	Nijkamp	Nijkamp	NNP
10_1101-2021_01_07_425723	785	2	,	,	,
10_1101-2021_01_07_425723	785	3	J.	J.	NNP
10_1101-2021_01_07_425723	785	4	F.	F.	NNP
10_1101-2021_01_07_425723	785	5	et	et	NNP
10_1101-2021_01_07_425723	785	6	al	al	NNP
10_1101-2021_01_07_425723	785	7	.	.	.
10_1101-2021_01_07_425723	786	1	De	De	NNP
10_1101-2021_01_07_425723	786	2	novo	novo	NNP
10_1101-2021_01_07_425723	786	3	sequencing	sequencing	NN
10_1101-2021_01_07_425723	786	4	,	,	,
10_1101-2021_01_07_425723	786	5	assembly	assembly	NN
10_1101-2021_01_07_425723	786	6	and	and	CC
10_1101-2021_01_07_425723	786	7	analysis	analysis	NN
10_1101-2021_01_07_425723	786	8	of	of	IN
10_1101-2021_01_07_425723	786	9	the	the	DT
10_1101-2021_01_07_425723	786	10	genome	genome	NN
10_1101-2021_01_07_425723	786	11	of	of	IN
10_1101-2021_01_07_425723	786	12	the	the	DT
10_1101-2021_01_07_425723	786	13	laboratory	laboratory	NN
10_1101-2021_01_07_425723	786	14	854	854	CD
10_1101-2021_01_07_425723	786	15	strain	strain	NN
10_1101-2021_01_07_425723	786	16	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_07_425723	786	17	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	786	18	CEN.PK113	CEN.PK113	NNP
10_1101-2021_01_07_425723	786	19	-	-	HYPH
10_1101-2021_01_07_425723	786	20	7D	7D	NNP
10_1101-2021_01_07_425723	786	21	,	,	,
10_1101-2021_01_07_425723	786	22	a	a	DT
10_1101-2021_01_07_425723	786	23	model	model	NN
10_1101-2021_01_07_425723	786	24	for	for	IN
10_1101-2021_01_07_425723	786	25	modern	modern	JJ
10_1101-2021_01_07_425723	786	26	industrial	industrial	JJ
10_1101-2021_01_07_425723	786	27	biotechnology	biotechnology	NN
10_1101-2021_01_07_425723	786	28	.	.	.
10_1101-2021_01_07_425723	787	1	855	855	CD
10_1101-2021_01_07_425723	787	2	Microb	Microb	NNP
10_1101-2021_01_07_425723	787	3	.	.	.
10_1101-2021_01_07_425723	788	1	Cell	Cell	NNP
10_1101-2021_01_07_425723	788	2	Fact	Fact	NNP
10_1101-2021_01_07_425723	788	3	.	.	.
10_1101-2021_01_07_425723	789	1	11	11	CD
10_1101-2021_01_07_425723	789	2	,	,	,
10_1101-2021_01_07_425723	789	3	36	36	CD
10_1101-2021_01_07_425723	789	4	(	(	-LRB-
10_1101-2021_01_07_425723	789	5	2012	2012	CD
10_1101-2021_01_07_425723	789	6	)	)	-RRB-
10_1101-2021_01_07_425723	789	7	.	.	.
10_1101-2021_01_07_425723	790	1	856	856	CD
10_1101-2021_01_07_425723	790	2	59	59	CD
10_1101-2021_01_07_425723	790	3	.	.	.
10_1101-2021_01_07_425723	791	1	Bracher	Bracher	NNP
10_1101-2021_01_07_425723	791	2	,	,	,
10_1101-2021_01_07_425723	791	3	J.	J.	NNP
10_1101-2021_01_07_425723	791	4	M.	M.	NNP
10_1101-2021_01_07_425723	791	5	et	et	NNP
10_1101-2021_01_07_425723	791	6	al	al	NNP
10_1101-2021_01_07_425723	791	7	.	.	.
10_1101-2021_01_07_425723	792	1	Laboratory	laboratory	NN
10_1101-2021_01_07_425723	792	2	evolution	evolution	NN
10_1101-2021_01_07_425723	792	3	of	of	IN
10_1101-2021_01_07_425723	792	4	a	a	DT
10_1101-2021_01_07_425723	792	5	biotin	biotin	NN
10_1101-2021_01_07_425723	792	6	-	-	HYPH
10_1101-2021_01_07_425723	792	7	requiring	require	VBG
10_1101-2021_01_07_425723	792	8	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	792	9	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	792	10	strain	strain	NN
10_1101-2021_01_07_425723	792	11	for	for	IN
10_1101-2021_01_07_425723	792	12	857	857	CD
10_1101-2021_01_07_425723	792	13	full	full	JJ
10_1101-2021_01_07_425723	792	14	biotin	biotin	JJ
10_1101-2021_01_07_425723	792	15	prototrophy	prototrophy	NN
10_1101-2021_01_07_425723	792	16	and	and	CC
10_1101-2021_01_07_425723	792	17	identification	identification	NN
10_1101-2021_01_07_425723	792	18	of	of	IN
10_1101-2021_01_07_425723	792	19	causal	causal	JJ
10_1101-2021_01_07_425723	792	20	mutations	mutation	NNS
10_1101-2021_01_07_425723	792	21	.	.	.
10_1101-2021_01_07_425723	793	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	793	2	.	.	.
10_1101-2021_01_07_425723	794	1	Environ	Environ	NNP
10_1101-2021_01_07_425723	794	2	.	.	.
10_1101-2021_01_07_425723	795	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	795	2	.	.	.
10_1101-2021_01_07_425723	796	1	83	83	CD
10_1101-2021_01_07_425723	796	2	,	,	,
10_1101-2021_01_07_425723	796	3	1–16	1–16	CD
10_1101-2021_01_07_425723	796	4	858	858	CD
10_1101-2021_01_07_425723	796	5	(	(	-LRB-
10_1101-2021_01_07_425723	796	6	2017	2017	CD
10_1101-2021_01_07_425723	796	7	)	)	-RRB-
10_1101-2021_01_07_425723	796	8	.	.	.
10_1101-2021_01_07_425723	797	1	859	859	CD
10_1101-2021_01_07_425723	797	2	60	60	CD
10_1101-2021_01_07_425723	797	3	.	.	.
10_1101-2021_01_07_425723	798	1	Lee	Lee	NNP
10_1101-2021_01_07_425723	798	2	,	,	,
10_1101-2021_01_07_425723	798	3	M.	M.	NNP
10_1101-2021_01_07_425723	798	4	E.	E.	NNP
10_1101-2021_01_07_425723	798	5	,	,	,
10_1101-2021_01_07_425723	798	6	DeLoache	DeLoache	NNP
10_1101-2021_01_07_425723	798	7	,	,	,
10_1101-2021_01_07_425723	798	8	W.	W.	NNP
10_1101-2021_01_07_425723	798	9	C.	C.	NNP
10_1101-2021_01_07_425723	798	10	,	,	,
10_1101-2021_01_07_425723	798	11	Cervantes	Cervantes	NNP
10_1101-2021_01_07_425723	798	12	,	,	,
10_1101-2021_01_07_425723	798	13	B.	B.	NNP
10_1101-2021_01_07_425723	799	1	&	&	CC
10_1101-2021_01_07_425723	799	2	Dueber	Dueber	NNP
10_1101-2021_01_07_425723	799	3	,	,	,
10_1101-2021_01_07_425723	799	4	J.	J.	NNP
10_1101-2021_01_07_425723	799	5	E.	E.	NNP
10_1101-2021_01_07_425723	799	6	A	A	NNP
10_1101-2021_01_07_425723	799	7	Highly	highly	RB
10_1101-2021_01_07_425723	799	8	Characterized	characterize	VBN
10_1101-2021_01_07_425723	799	9	Yeast	yeast	NN
10_1101-2021_01_07_425723	799	10	Toolkit	Toolkit	VBZ
10_1101-2021_01_07_425723	799	11	for	for	IN
10_1101-2021_01_07_425723	799	12	860	860	CD
10_1101-2021_01_07_425723	799	13	Modular	Modular	NNP
10_1101-2021_01_07_425723	799	14	,	,	,
10_1101-2021_01_07_425723	799	15	Multipart	Multipart	NNP
10_1101-2021_01_07_425723	799	16	Assembly	Assembly	NNP
10_1101-2021_01_07_425723	799	17	.	.	.
10_1101-2021_01_07_425723	800	1	ACS	ACS	NNP
10_1101-2021_01_07_425723	800	2	Synth	Synth	NNP
10_1101-2021_01_07_425723	800	3	.	.	.
10_1101-2021_01_07_425723	801	1	Biol	Biol	NNP
10_1101-2021_01_07_425723	801	2	.	.	.
10_1101-2021_01_07_425723	802	1	4	4	LS
10_1101-2021_01_07_425723	802	2	,	,	,
10_1101-2021_01_07_425723	802	3	975–986	975–986	CD
10_1101-2021_01_07_425723	802	4	(	(	-LRB-
10_1101-2021_01_07_425723	802	5	2015	2015	CD
10_1101-2021_01_07_425723	802	6	)	)	-RRB-
10_1101-2021_01_07_425723	802	7	.	.	.
10_1101-2021_01_07_425723	803	1	861	861	CD
10_1101-2021_01_07_425723	803	2	61	61	CD
10_1101-2021_01_07_425723	803	3	.	.	.
10_1101-2021_01_07_425723	804	1	Mans	Mans	NNP
10_1101-2021_01_07_425723	804	2	,	,	,
10_1101-2021_01_07_425723	804	3	R.	R.	NNP
10_1101-2021_01_07_425723	804	4	et	et	NNP
10_1101-2021_01_07_425723	804	5	al	al	NNP
10_1101-2021_01_07_425723	804	6	.	.	.
10_1101-2021_01_07_425723	805	1	CRISPR	CRISPR	NNP
10_1101-2021_01_07_425723	805	2	/	/	SYM
10_1101-2021_01_07_425723	805	3	Cas9	Cas9	NNP
10_1101-2021_01_07_425723	805	4	:	:	:
10_1101-2021_01_07_425723	805	5	A	a	DT
10_1101-2021_01_07_425723	805	6	molecular	molecular	JJ
10_1101-2021_01_07_425723	805	7	Swiss	swiss	JJ
10_1101-2021_01_07_425723	805	8	army	army	NN
10_1101-2021_01_07_425723	805	9	knife	knife	NN
10_1101-2021_01_07_425723	805	10	for	for	IN
10_1101-2021_01_07_425723	805	11	simultaneous	simultaneous	JJ
10_1101-2021_01_07_425723	805	12	introduction	introduction	NN
10_1101-2021_01_07_425723	805	13	of	of	IN
10_1101-2021_01_07_425723	805	14	862	862	CD
10_1101-2021_01_07_425723	805	15	multiple	multiple	JJ
10_1101-2021_01_07_425723	805	16	genetic	genetic	JJ
10_1101-2021_01_07_425723	805	17	modifications	modification	NNS
10_1101-2021_01_07_425723	805	18	in	in	IN
10_1101-2021_01_07_425723	805	19	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	805	20	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	805	21	.	.	.
10_1101-2021_01_07_425723	806	1	FEMS	FEMS	NNP
10_1101-2021_01_07_425723	806	2	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	806	3	Res	res	NN
10_1101-2021_01_07_425723	806	4	.	.	.
10_1101-2021_01_07_425723	807	1	15	15	CD
10_1101-2021_01_07_425723	807	2	,	,	,
10_1101-2021_01_07_425723	807	3	1–15	1–15	CD
10_1101-2021_01_07_425723	807	4	(	(	-LRB-
10_1101-2021_01_07_425723	807	5	2015	2015	CD
10_1101-2021_01_07_425723	807	6	)	)	-RRB-
10_1101-2021_01_07_425723	807	7	.	.	.
10_1101-2021_01_07_425723	808	1	863	863	CD
10_1101-2021_01_07_425723	808	2	62	62	CD
10_1101-2021_01_07_425723	808	3	.	.	.
10_1101-2021_01_07_425723	809	1	Lorenz	Lorenz	NNP
10_1101-2021_01_07_425723	809	2	,	,	,
10_1101-2021_01_07_425723	809	3	R.	R.	NNP
10_1101-2021_01_07_425723	809	4	et	et	NNP
10_1101-2021_01_07_425723	809	5	al	al	NNP
10_1101-2021_01_07_425723	809	6	.	.	.
10_1101-2021_01_07_425723	810	1	ViennaRNA	ViennaRNA	NFP
10_1101-2021_01_07_425723	810	2	Package	package	NN
10_1101-2021_01_07_425723	810	3	2.0	2.0	CD
10_1101-2021_01_07_425723	810	4	.	.	.
10_1101-2021_01_07_425723	811	1	Algorithms	Algorithms	NNP
10_1101-2021_01_07_425723	811	2	Mol	Mol	NNP
10_1101-2021_01_07_425723	811	3	.	.	.
10_1101-2021_01_07_425723	812	1	Biol	Biol	NNP
10_1101-2021_01_07_425723	812	2	.	.	.
10_1101-2021_01_07_425723	813	1	6	6	CD
10_1101-2021_01_07_425723	813	2	,	,	,
10_1101-2021_01_07_425723	813	3	26	26	CD
10_1101-2021_01_07_425723	813	4	(	(	-LRB-
10_1101-2021_01_07_425723	813	5	2011	2011	CD
10_1101-2021_01_07_425723	813	6	)	)	-RRB-
10_1101-2021_01_07_425723	813	7	.	.	.
10_1101-2021_01_07_425723	814	1	864	864	CD
10_1101-2021_01_07_425723	814	2	63	63	CD
10_1101-2021_01_07_425723	814	3	.	.	.
10_1101-2021_01_07_425723	815	1	Hassing	Hassing	NNP
10_1101-2021_01_07_425723	815	2	,	,	,
10_1101-2021_01_07_425723	815	3	E.	E.	NNP
10_1101-2021_01_07_425723	815	4	J.	J.	NNP
10_1101-2021_01_07_425723	815	5	,	,	,
10_1101-2021_01_07_425723	815	6	de	de	NNP
10_1101-2021_01_07_425723	815	7	Groot	Groot	NNP
10_1101-2021_01_07_425723	815	8	,	,	,
10_1101-2021_01_07_425723	815	9	P.	P.	NNP
10_1101-2021_01_07_425723	815	10	A.	A.	NNP
10_1101-2021_01_07_425723	815	11	,	,	,
10_1101-2021_01_07_425723	815	12	Marquenie	Marquenie	NNP
10_1101-2021_01_07_425723	815	13	,	,	,
10_1101-2021_01_07_425723	815	14	V.	V.	NNP
10_1101-2021_01_07_425723	815	15	R.	R.	NNP
10_1101-2021_01_07_425723	815	16	,	,	,
10_1101-2021_01_07_425723	815	17	Pronk	Pronk	NNP
10_1101-2021_01_07_425723	815	18	,	,	,
10_1101-2021_01_07_425723	815	19	J.	J.	NNP
10_1101-2021_01_07_425723	815	20	T.	T.	NNP
10_1101-2021_01_07_425723	815	21	&	&	CC
10_1101-2021_01_07_425723	815	22	Daran	Daran	NNP
10_1101-2021_01_07_425723	815	23	,	,	,
10_1101-2021_01_07_425723	815	24	J.	J.	NNP
10_1101-2021_01_07_425723	815	25	M.	M.	NNP
10_1101-2021_01_07_425723	815	26	G.	G.	NNP
10_1101-2021_01_07_425723	815	27	Connecting	Connecting	NNP
10_1101-2021_01_07_425723	815	28	central	central	JJ
10_1101-2021_01_07_425723	815	29	865	865	CD
10_1101-2021_01_07_425723	815	30	carbon	carbon	NN
10_1101-2021_01_07_425723	815	31	and	and	CC
10_1101-2021_01_07_425723	815	32	aromatic	aromatic	JJ
10_1101-2021_01_07_425723	815	33	amino	amino	NN
10_1101-2021_01_07_425723	815	34	acid	acid	NN
10_1101-2021_01_07_425723	815	35	metabolisms	metabolisms	NNP
10_1101-2021_01_07_425723	815	36	to	to	TO
10_1101-2021_01_07_425723	815	37	improve	improve	VB
10_1101-2021_01_07_425723	815	38	de	de	FW
10_1101-2021_01_07_425723	815	39	novo	novo	NNP
10_1101-2021_01_07_425723	815	40	2-phenylethanol	2-phenylethanol	CD
10_1101-2021_01_07_425723	815	41	production	production	NN
10_1101-2021_01_07_425723	815	42	in	in	IN
10_1101-2021_01_07_425723	815	43	866	866	CD
10_1101-2021_01_07_425723	815	44	Saccharomyces	Saccharomyces	NNPS
10_1101-2021_01_07_425723	815	45	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	815	46	.	.	.
10_1101-2021_01_07_425723	816	1	Metab	Metab	NNP
10_1101-2021_01_07_425723	816	2	.	.	.
10_1101-2021_01_07_425723	817	1	Eng	Eng	NNP
10_1101-2021_01_07_425723	817	2	.	.	.
10_1101-2021_01_07_425723	818	1	56	56	CD
10_1101-2021_01_07_425723	818	2	,	,	,
10_1101-2021_01_07_425723	818	3	165–180	165–180	CD
10_1101-2021_01_07_425723	818	4	(	(	-LRB-
10_1101-2021_01_07_425723	818	5	2019	2019	CD
10_1101-2021_01_07_425723	818	6	)	)	-RRB-
10_1101-2021_01_07_425723	818	7	.	.	.
10_1101-2021_01_07_425723	819	1	867	867	CD
10_1101-2021_01_07_425723	819	2	64	64	CD
10_1101-2021_01_07_425723	819	3	.	.	.
10_1101-2021_01_07_425723	820	1	Gietz	Gietz	NNP
10_1101-2021_01_07_425723	820	2	,	,	,
10_1101-2021_01_07_425723	820	3	R.	R.	NNP
10_1101-2021_01_07_425723	820	4	D.	D.	NNP
10_1101-2021_01_07_425723	820	5	&	&	CC
10_1101-2021_01_07_425723	820	6	Woods	Woods	NNP
10_1101-2021_01_07_425723	820	7	,	,	,
10_1101-2021_01_07_425723	820	8	R.	R.	NNP
10_1101-2021_01_07_425723	820	9	A.	A.	NNP
10_1101-2021_01_07_425723	821	1	Genetic	genetic	JJ
10_1101-2021_01_07_425723	821	2	Transformation	Transformation	NNP
10_1101-2021_01_07_425723	821	3	of	of	IN
10_1101-2021_01_07_425723	821	4	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	821	5	.	.	.
10_1101-2021_01_07_425723	822	1	Biotechniques	biotechnique	NNS
10_1101-2021_01_07_425723	822	2	30	30	CD
10_1101-2021_01_07_425723	822	3	,	,	,
10_1101-2021_01_07_425723	822	4	816–831	816–831	CD
10_1101-2021_01_07_425723	822	5	(	(	-LRB-
10_1101-2021_01_07_425723	822	6	2001	2001	CD
10_1101-2021_01_07_425723	822	7	)	)	-RRB-
10_1101-2021_01_07_425723	822	8	.	.	.
10_1101-2021_01_07_425723	823	1	868	868	CD
10_1101-2021_01_07_425723	823	2	65	65	CD
10_1101-2021_01_07_425723	823	3	.	.	.
10_1101-2021_01_07_425723	824	1	Solis	Solis	NNP
10_1101-2021_01_07_425723	824	2	-	-	HYPH
10_1101-2021_01_07_425723	824	3	Escalante	Escalante	NNP
10_1101-2021_01_07_425723	824	4	,	,	,
10_1101-2021_01_07_425723	824	5	D.	D.	NNP
10_1101-2021_01_07_425723	824	6	et	et	NNP
10_1101-2021_01_07_425723	824	7	al	al	NNP
10_1101-2021_01_07_425723	824	8	.	.	.
10_1101-2021_01_07_425723	825	1	amdSYM	amdSYM	NNP
10_1101-2021_01_07_425723	825	2	,	,	,
10_1101-2021_01_07_425723	825	3	A	a	DT
10_1101-2021_01_07_425723	825	4	new	new	JJ
10_1101-2021_01_07_425723	825	5	dominant	dominant	JJ
10_1101-2021_01_07_425723	825	6	recyclable	recyclable	JJ
10_1101-2021_01_07_425723	825	7	marker	marker	NN
10_1101-2021_01_07_425723	825	8	cassette	cassette	NN
10_1101-2021_01_07_425723	825	9	for	for	IN
10_1101-2021_01_07_425723	825	10	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	825	11	869	869	CD
10_1101-2021_01_07_425723	825	12	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	825	13	.	.	.
10_1101-2021_01_07_425723	826	1	FEMS	FEMS	NNP
10_1101-2021_01_07_425723	826	2	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	826	3	Res	res	NN
10_1101-2021_01_07_425723	826	4	.	.	.
10_1101-2021_01_07_425723	827	1	13	13	CD
10_1101-2021_01_07_425723	827	2	,	,	,
10_1101-2021_01_07_425723	827	3	126–139	126–139	CD
10_1101-2021_01_07_425723	827	4	(	(	-LRB-
10_1101-2021_01_07_425723	827	5	2013	2013	CD
10_1101-2021_01_07_425723	827	6	)	)	-RRB-
10_1101-2021_01_07_425723	827	7	.	.	.
10_1101-2021_01_07_425723	828	1	870	870	CD
10_1101-2021_01_07_425723	828	2	66	66	CD
10_1101-2021_01_07_425723	828	3	.	.	.
10_1101-2021_01_07_425723	829	1	Postma	Postma	NNP
10_1101-2021_01_07_425723	829	2	,	,	,
10_1101-2021_01_07_425723	829	3	E.	E.	NNP
10_1101-2021_01_07_425723	829	4	,	,	,
10_1101-2021_01_07_425723	829	5	Verduyn	Verduyn	NNP
10_1101-2021_01_07_425723	829	6	,	,	,
10_1101-2021_01_07_425723	829	7	C.	C.	NNP
10_1101-2021_01_07_425723	829	8	,	,	,
10_1101-2021_01_07_425723	829	9	Scheffers	Scheffers	NNP
10_1101-2021_01_07_425723	829	10	,	,	,
10_1101-2021_01_07_425723	829	11	W.	W.	NNP
10_1101-2021_01_07_425723	829	12	A.	A.	NNP
10_1101-2021_01_07_425723	830	1	&	&	CC
10_1101-2021_01_07_425723	830	2	Van	Van	NNP
10_1101-2021_01_07_425723	830	3	Dijken	Dijken	NNP
10_1101-2021_01_07_425723	830	4	,	,	,
10_1101-2021_01_07_425723	830	5	J.	J.	NNP
10_1101-2021_01_07_425723	830	6	P.	P.	NNP
10_1101-2021_01_07_425723	830	7	Enzymic	Enzymic	NNP
10_1101-2021_01_07_425723	830	8	analysis	analysis	NN
10_1101-2021_01_07_425723	830	9	of	of	IN
10_1101-2021_01_07_425723	830	10	the	the	DT
10_1101-2021_01_07_425723	830	11	crabtree	crabtree	NN
10_1101-2021_01_07_425723	830	12	871	871	CD
10_1101-2021_01_07_425723	830	13	effect	effect	NN
10_1101-2021_01_07_425723	830	14	in	in	IN
10_1101-2021_01_07_425723	830	15	glucose	glucose	NN
10_1101-2021_01_07_425723	830	16	-	-	HYPH
10_1101-2021_01_07_425723	830	17	limited	limit	VBN
10_1101-2021_01_07_425723	830	18	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	830	19	cultures	culture	NNS
10_1101-2021_01_07_425723	830	20	of	of	IN
10_1101-2021_01_07_425723	830	21	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	830	22	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	830	23	.	.	.
10_1101-2021_01_07_425723	831	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	831	2	.	.	.
10_1101-2021_01_07_425723	832	1	Environ	Environ	NNP
10_1101-2021_01_07_425723	832	2	.	.	.
10_1101-2021_01_07_425723	833	1	872	872	CD
10_1101-2021_01_07_425723	833	2	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	833	3	.	.	.
10_1101-2021_01_07_425723	834	1	55	55	CD
10_1101-2021_01_07_425723	834	2	,	,	,
10_1101-2021_01_07_425723	834	3	468–477	468–477	CD
10_1101-2021_01_07_425723	834	4	(	(	-LRB-
10_1101-2021_01_07_425723	834	5	1989	1989	CD
10_1101-2021_01_07_425723	834	6	)	)	-RRB-
10_1101-2021_01_07_425723	834	7	.	.	.
10_1101-2021_01_07_425723	835	1	873	873	CD
10_1101-2021_01_07_425723	835	2	67	67	CD
10_1101-2021_01_07_425723	835	3	.	.	.
10_1101-2021_01_07_425723	836	1	Mashego	Mashego	NNP
10_1101-2021_01_07_425723	836	2	,	,	,
10_1101-2021_01_07_425723	836	3	M.	M.	NNP
10_1101-2021_01_07_425723	836	4	R.	R.	NNP
10_1101-2021_01_07_425723	836	5	,	,	,
10_1101-2021_01_07_425723	836	6	van	van	NNP
10_1101-2021_01_07_425723	836	7	Gulik	Gulik	NNP
10_1101-2021_01_07_425723	836	8	,	,	,
10_1101-2021_01_07_425723	836	9	W.	W.	NNP
10_1101-2021_01_07_425723	836	10	M.	M.	NNP
10_1101-2021_01_07_425723	836	11	,	,	,
10_1101-2021_01_07_425723	836	12	Vinke	Vinke	NNP
10_1101-2021_01_07_425723	836	13	,	,	,
10_1101-2021_01_07_425723	836	14	J.	J.	NNP
10_1101-2021_01_07_425723	836	15	L.	L.	NNP
10_1101-2021_01_07_425723	836	16	&	&	CC
10_1101-2021_01_07_425723	836	17	Heijnen	Heijnen	NNP
10_1101-2021_01_07_425723	836	18	,	,	,
10_1101-2021_01_07_425723	836	19	J.	J.	NNP
10_1101-2021_01_07_425723	836	20	J.	J.	NNP
10_1101-2021_01_07_425723	837	1	Critical	critical	JJ
10_1101-2021_01_07_425723	837	2	evaluation	evaluation	NN
10_1101-2021_01_07_425723	837	3	of	of	IN
10_1101-2021_01_07_425723	837	4	sampling	sample	VBG
10_1101-2021_01_07_425723	837	5	874	874	CD
10_1101-2021_01_07_425723	837	6	techniques	technique	NNS
10_1101-2021_01_07_425723	837	7	for	for	IN
10_1101-2021_01_07_425723	837	8	residual	residual	JJ
10_1101-2021_01_07_425723	837	9	glucose	glucose	NN
10_1101-2021_01_07_425723	837	10	determination	determination	NN
10_1101-2021_01_07_425723	837	11	in	in	IN
10_1101-2021_01_07_425723	837	12	carbon	carbon	NN
10_1101-2021_01_07_425723	837	13	-	-	HYPH
10_1101-2021_01_07_425723	837	14	limited	limit	VBN
10_1101-2021_01_07_425723	837	15	chemostat	chemostat	JJ
10_1101-2021_01_07_425723	837	16	culture	culture	NN
10_1101-2021_01_07_425723	837	17	875	875	CD
10_1101-2021_01_07_425723	837	18	.CC	.CC	NFP
10_1101-2021_01_07_425723	837	19	-	-	HYPH
10_1101-2021_01_07_425723	837	20	BY	by	IN
10_1101-2021_01_07_425723	837	21	-	-	HYPH
10_1101-2021_01_07_425723	837	22	NC	NC	NNP
10_1101-2021_01_07_425723	837	23	-	-	HYPH
10_1101-2021_01_07_425723	837	24	ND	ND	NNP
10_1101-2021_01_07_425723	837	25	4.0	4.0	CD
10_1101-2021_01_07_425723	837	26	International	International	NNP
10_1101-2021_01_07_425723	837	27	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	837	28	under	under	IN
10_1101-2021_01_07_425723	837	29	a	a	DT
10_1101-2021_01_07_425723	837	30	(	(	-LRB-
10_1101-2021_01_07_425723	837	31	which	which	WDT
10_1101-2021_01_07_425723	837	32	was	be	VBD
10_1101-2021_01_07_425723	837	33	not	not	RB
10_1101-2021_01_07_425723	837	34	certified	certify	VBN
10_1101-2021_01_07_425723	837	35	by	by	IN
10_1101-2021_01_07_425723	837	36	peer	peer	NN
10_1101-2021_01_07_425723	837	37	review	review	NN
10_1101-2021_01_07_425723	837	38	)	)	-RRB-
10_1101-2021_01_07_425723	837	39	is	be	VBZ
10_1101-2021_01_07_425723	837	40	the	the	DT
10_1101-2021_01_07_425723	837	41	author	author	NN
10_1101-2021_01_07_425723	837	42	/	/	SYM
10_1101-2021_01_07_425723	837	43	funder	funder	NN
10_1101-2021_01_07_425723	837	44	,	,	,
10_1101-2021_01_07_425723	837	45	who	who	WP
10_1101-2021_01_07_425723	837	46	has	have	VBZ
10_1101-2021_01_07_425723	837	47	granted	grant	VBN
10_1101-2021_01_07_425723	837	48	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	837	49	a	a	DT
10_1101-2021_01_07_425723	837	50	license	license	NN
10_1101-2021_01_07_425723	837	51	to	to	TO
10_1101-2021_01_07_425723	837	52	display	display	VB
10_1101-2021_01_07_425723	837	53	the	the	DT
10_1101-2021_01_07_425723	837	54	preprint	preprint	NN
10_1101-2021_01_07_425723	837	55	in	in	IN
10_1101-2021_01_07_425723	837	56	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	837	57	.	.	.
10_1101-2021_01_07_425723	838	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	838	2	is	be	VBZ
10_1101-2021_01_07_425723	838	3	made	make	VBN
10_1101-2021_01_07_425723	838	4	The	the	DT
10_1101-2021_01_07_425723	838	5	copyright	copyright	NN
10_1101-2021_01_07_425723	838	6	holder	holder	NN
10_1101-2021_01_07_425723	838	7	for	for	IN
10_1101-2021_01_07_425723	838	8	this	this	DT
10_1101-2021_01_07_425723	838	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	838	10	version	version	NN
10_1101-2021_01_07_425723	838	11	posted	post	VBD
10_1101-2021_01_07_425723	838	12	January	January	NNP
10_1101-2021_01_07_425723	838	13	8	8	CD
10_1101-2021_01_07_425723	838	14	,	,	,
10_1101-2021_01_07_425723	838	15	2021	2021	CD
10_1101-2021_01_07_425723	838	16	.	.	.
10_1101-2021_01_07_425723	838	17	;	;	:
10_1101-2021_01_07_425723	838	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	838	19	:	:	:
10_1101-2021_01_07_425723	838	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	838	21	preprint	preprint	NN
10_1101-2021_01_07_425723	838	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	838	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	838	24	44	44	CD
10_1101-2021_01_07_425723	838	25	ofSaccharomyces	ofsaccharomyces	NN
10_1101-2021_01_07_425723	838	26	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	838	27	.	.	.
10_1101-2021_01_07_425723	839	1	Biotechnol	Biotechnol	NNS
10_1101-2021_01_07_425723	839	2	.	.	.
10_1101-2021_01_07_425723	840	1	Bioeng	Bioeng	NNP
10_1101-2021_01_07_425723	840	2	.	.	.
10_1101-2021_01_07_425723	841	1	83	83	CD
10_1101-2021_01_07_425723	841	2	,	,	,
10_1101-2021_01_07_425723	841	3	395–399	395–399	CD
10_1101-2021_01_07_425723	841	4	(	(	-LRB-
10_1101-2021_01_07_425723	841	5	2003	2003	CD
10_1101-2021_01_07_425723	841	6	)	)	-RRB-
10_1101-2021_01_07_425723	841	7	.	.	.
10_1101-2021_01_07_425723	842	1	876	876	CD
10_1101-2021_01_07_425723	842	2	68	68	CD
10_1101-2021_01_07_425723	842	3	.	.	.
10_1101-2021_01_07_425723	843	1	Boender	boender	NN
10_1101-2021_01_07_425723	843	2	,	,	,
10_1101-2021_01_07_425723	843	3	L.	L.	NNP
10_1101-2021_01_07_425723	843	4	G.	G.	NNP
10_1101-2021_01_07_425723	843	5	M.	M.	NNP
10_1101-2021_01_07_425723	843	6	,	,	,
10_1101-2021_01_07_425723	843	7	De	De	NNP
10_1101-2021_01_07_425723	843	8	Hulster	Hulster	NNP
10_1101-2021_01_07_425723	843	9	,	,	,
10_1101-2021_01_07_425723	843	10	E.	E.	NNP
10_1101-2021_01_07_425723	843	11	A.	a.	NN
10_1101-2021_01_07_425723	843	12	F.	F.	NNP
10_1101-2021_01_07_425723	843	13	,	,	,
10_1101-2021_01_07_425723	843	14	Van	Van	NNP
10_1101-2021_01_07_425723	843	15	Maris	Maris	NNP
10_1101-2021_01_07_425723	843	16	,	,	,
10_1101-2021_01_07_425723	843	17	A.	a.	NN
10_1101-2021_01_07_425723	843	18	J.	J.	NNP
10_1101-2021_01_07_425723	844	1	A.	A.	NNP
10_1101-2021_01_07_425723	844	2	,	,	,
10_1101-2021_01_07_425723	844	3	Daran	Daran	NNP
10_1101-2021_01_07_425723	844	4	-	-	HYPH
10_1101-2021_01_07_425723	844	5	Lapujade	Lapujade	NNP
10_1101-2021_01_07_425723	844	6	,	,	,
10_1101-2021_01_07_425723	844	7	P.	P.	NNP
10_1101-2021_01_07_425723	844	8	A.	A.	NNP
10_1101-2021_01_07_425723	844	9	S.	S.	NNP
10_1101-2021_01_07_425723	844	10	&	&	CC
10_1101-2021_01_07_425723	844	11	Pronk	Pronk	NNP
10_1101-2021_01_07_425723	844	12	,	,	,
10_1101-2021_01_07_425723	844	13	J.	J.	NNP
10_1101-2021_01_07_425723	844	14	T.	T.	NNP
10_1101-2021_01_07_425723	844	15	877	877	CD
10_1101-2021_01_07_425723	844	16	Quantitative	quantitative	JJ
10_1101-2021_01_07_425723	844	17	physiology	physiology	NN
10_1101-2021_01_07_425723	844	18	of	of	IN
10_1101-2021_01_07_425723	844	19	Saccharomyces	saccharomyce	NNS
10_1101-2021_01_07_425723	844	20	cerevisiae	cerevisiae	VBZ
10_1101-2021_01_07_425723	844	21	at	at	IN
10_1101-2021_01_07_425723	844	22	near	near	JJ
10_1101-2021_01_07_425723	844	23	-	-	HYPH
10_1101-2021_01_07_425723	844	24	zero	zero	CD
10_1101-2021_01_07_425723	844	25	specific	specific	JJ
10_1101-2021_01_07_425723	844	26	growth	growth	NN
10_1101-2021_01_07_425723	844	27	rates	rate	NNS
10_1101-2021_01_07_425723	844	28	.	.	.
10_1101-2021_01_07_425723	845	1	Appl	Appl	NNP
10_1101-2021_01_07_425723	845	2	.	.	.
10_1101-2021_01_07_425723	846	1	878	878	CD
10_1101-2021_01_07_425723	846	2	Environ	Environ	NNP
10_1101-2021_01_07_425723	846	3	.	.	.
10_1101-2021_01_07_425723	847	1	Microbiol	Microbiol	NNP
10_1101-2021_01_07_425723	847	2	.	.	.
10_1101-2021_01_07_425723	848	1	75	75	CD
10_1101-2021_01_07_425723	848	2	,	,	,
10_1101-2021_01_07_425723	848	3	5607–5614	5607–5614	CD
10_1101-2021_01_07_425723	848	4	(	(	-LRB-
10_1101-2021_01_07_425723	848	5	2009	2009	CD
10_1101-2021_01_07_425723	848	6	)	)	-RRB-
10_1101-2021_01_07_425723	848	7	.	.	.
10_1101-2021_01_07_425723	849	1	879	879	CD
10_1101-2021_01_07_425723	849	2	69	69	CD
10_1101-2021_01_07_425723	849	3	.	.	.
10_1101-2021_01_07_425723	850	1	Koren	Koren	NNP
10_1101-2021_01_07_425723	850	2	,	,	,
10_1101-2021_01_07_425723	850	3	S.	S.	NNP
10_1101-2021_01_07_425723	850	4	et	et	NNP
10_1101-2021_01_07_425723	850	5	al	al	NNP
10_1101-2021_01_07_425723	850	6	.	.	.
10_1101-2021_01_07_425723	851	1	Canu	Canu	NNP
10_1101-2021_01_07_425723	851	2	:	:	:
10_1101-2021_01_07_425723	851	3	Scalable	scalable	JJ
10_1101-2021_01_07_425723	851	4	and	and	CC
10_1101-2021_01_07_425723	851	5	accurate	accurate	JJ
10_1101-2021_01_07_425723	851	6	long	long	RB
10_1101-2021_01_07_425723	851	7	-	-	HYPH
10_1101-2021_01_07_425723	851	8	read	read	VBN
10_1101-2021_01_07_425723	851	9	assembly	assembly	NN
10_1101-2021_01_07_425723	851	10	via	via	IN
10_1101-2021_01_07_425723	851	11	adaptive	adaptive	JJ
10_1101-2021_01_07_425723	851	12	κ	κ	NNP
10_1101-2021_01_07_425723	851	13	-	-	HYPH
10_1101-2021_01_07_425723	851	14	mer	mer	NN
10_1101-2021_01_07_425723	851	15	weighting	weighting	NN
10_1101-2021_01_07_425723	851	16	and	and	CC
10_1101-2021_01_07_425723	851	17	880	880	CD
10_1101-2021_01_07_425723	851	18	repeat	repeat	NN
10_1101-2021_01_07_425723	851	19	separation	separation	NN
10_1101-2021_01_07_425723	851	20	.	.	.
10_1101-2021_01_07_425723	852	1	Genome	Genome	NNP
10_1101-2021_01_07_425723	852	2	Res	Res	NNP
10_1101-2021_01_07_425723	852	3	.	.	.
10_1101-2021_01_07_425723	853	1	27	27	CD
10_1101-2021_01_07_425723	853	2	,	,	,
10_1101-2021_01_07_425723	853	3	722–736	722–736	CD
10_1101-2021_01_07_425723	853	4	(	(	-LRB-
10_1101-2021_01_07_425723	853	5	2017	2017	CD
10_1101-2021_01_07_425723	853	6	)	)	-RRB-
10_1101-2021_01_07_425723	853	7	.	.	.
10_1101-2021_01_07_425723	854	1	881	881	CD
10_1101-2021_01_07_425723	854	2	70	70	CD
10_1101-2021_01_07_425723	854	3	.	.	.
10_1101-2021_01_07_425723	855	1	Kolmogorov	Kolmogorov	NNP
10_1101-2021_01_07_425723	855	2	,	,	,
10_1101-2021_01_07_425723	855	3	M.	M.	NNP
10_1101-2021_01_07_425723	855	4	,	,	,
10_1101-2021_01_07_425723	855	5	Yuan	Yuan	NNP
10_1101-2021_01_07_425723	855	6	,	,	,
10_1101-2021_01_07_425723	855	7	J.	J.	NNP
10_1101-2021_01_07_425723	855	8	,	,	,
10_1101-2021_01_07_425723	855	9	Lin	Lin	NNP
10_1101-2021_01_07_425723	855	10	,	,	,
10_1101-2021_01_07_425723	855	11	Y.	Y.	NNP
10_1101-2021_01_07_425723	856	1	&	&	CC
10_1101-2021_01_07_425723	856	2	Pevzner	Pevzner	NNP
10_1101-2021_01_07_425723	856	3	,	,	,
10_1101-2021_01_07_425723	856	4	P.	P.	NNP
10_1101-2021_01_07_425723	856	5	A.	A.	NNP
10_1101-2021_01_07_425723	857	1	Assembly	assembly	NN
10_1101-2021_01_07_425723	857	2	of	of	IN
10_1101-2021_01_07_425723	857	3	long	long	JJ
10_1101-2021_01_07_425723	857	4	,	,	,
10_1101-2021_01_07_425723	857	5	error	error	NN
10_1101-2021_01_07_425723	857	6	-	-	HYPH
10_1101-2021_01_07_425723	857	7	prone	prone	JJ
10_1101-2021_01_07_425723	857	8	reads	read	VBZ
10_1101-2021_01_07_425723	857	9	using	use	VBG
10_1101-2021_01_07_425723	857	10	882	882	CD
10_1101-2021_01_07_425723	857	11	repeat	repeat	NN
10_1101-2021_01_07_425723	857	12	graphs	graphs	NN
10_1101-2021_01_07_425723	857	13	.	.	.
10_1101-2021_01_07_425723	858	1	Nat	Nat	NNP
10_1101-2021_01_07_425723	858	2	.	.	.
10_1101-2021_01_07_425723	859	1	Biotechnol	Biotechnol	NNS
10_1101-2021_01_07_425723	859	2	.	.	.
10_1101-2021_01_07_425723	860	1	37	37	CD
10_1101-2021_01_07_425723	860	2	,	,	,
10_1101-2021_01_07_425723	860	3	540–546	540–546	CD
10_1101-2021_01_07_425723	860	4	(	(	-LRB-
10_1101-2021_01_07_425723	860	5	2019	2019	CD
10_1101-2021_01_07_425723	860	6	)	)	-RRB-
10_1101-2021_01_07_425723	860	7	.	.	.
10_1101-2021_01_07_425723	861	1	883	883	CD
10_1101-2021_01_07_425723	861	2	71	71	CD
10_1101-2021_01_07_425723	861	3	.	.	.
10_1101-2021_01_07_425723	862	1	Walker	Walker	NNP
10_1101-2021_01_07_425723	862	2	,	,	,
10_1101-2021_01_07_425723	862	3	B.	B.	NNP
10_1101-2021_01_07_425723	862	4	J.	J.	NNP
10_1101-2021_01_07_425723	862	5	et	et	NNP
10_1101-2021_01_07_425723	862	6	al	al	NNP
10_1101-2021_01_07_425723	862	7	.	.	.
10_1101-2021_01_07_425723	863	1	Pilon	pilon	NN
10_1101-2021_01_07_425723	863	2	 	 	_SP
10_1101-2021_01_07_425723	863	3	:	:	:
10_1101-2021_01_07_425723	863	4	An	an	DT
10_1101-2021_01_07_425723	863	5	Integrated	Integrated	NNP
10_1101-2021_01_07_425723	863	6	Tool	Tool	NNP
10_1101-2021_01_07_425723	863	7	for	for	IN
10_1101-2021_01_07_425723	863	8	Comprehensive	Comprehensive	NNP
10_1101-2021_01_07_425723	863	9	Microbial	Microbial	NNP
10_1101-2021_01_07_425723	863	10	Variant	Variant	NNP
10_1101-2021_01_07_425723	863	11	Detection	Detection	NNP
10_1101-2021_01_07_425723	863	12	and	and	CC
10_1101-2021_01_07_425723	863	13	884	884	CD
10_1101-2021_01_07_425723	863	14	Genome	Genome	NNP
10_1101-2021_01_07_425723	863	15	Assembly	Assembly	NNP
10_1101-2021_01_07_425723	863	16	Improvement	Improvement	NNP
10_1101-2021_01_07_425723	863	17	.	.	.
10_1101-2021_01_07_425723	864	1	PLoS	PLoS	:
10_1101-2021_01_07_425723	864	2	One	one	CD
10_1101-2021_01_07_425723	864	3	9	9	CD
10_1101-2021_01_07_425723	864	4	,	,	,
10_1101-2021_01_07_425723	864	5	(	(	-LRB-
10_1101-2021_01_07_425723	864	6	2014	2014	CD
10_1101-2021_01_07_425723	864	7	)	)	-RRB-
10_1101-2021_01_07_425723	864	8	.	.	.
10_1101-2021_01_07_425723	865	1	885	885	CD
10_1101-2021_01_07_425723	865	2	72	72	CD
10_1101-2021_01_07_425723	865	3	.	.	.
10_1101-2021_01_07_425723	866	1	Palmer	Palmer	NNP
10_1101-2021_01_07_425723	866	2	,	,	,
10_1101-2021_01_07_425723	866	3	J.	J.	NNP
10_1101-2021_01_07_425723	867	1	&	&	CC
10_1101-2021_01_07_425723	867	2	Stajich	Stajich	NNP
10_1101-2021_01_07_425723	867	3	,	,	,
10_1101-2021_01_07_425723	867	4	J.	J.	NNP
10_1101-2021_01_07_425723	867	5	funannotate	funannotate	NN
10_1101-2021_01_07_425723	867	6	.	.	.
10_1101-2021_01_07_425723	868	1	(	(	-LRB-
10_1101-2021_01_07_425723	868	2	2019	2019	CD
10_1101-2021_01_07_425723	868	3	)	)	-RRB-
10_1101-2021_01_07_425723	868	4	.	.	.
10_1101-2021_01_07_425723	869	1	doi:10.5281	doi:10.5281	NNP
10_1101-2021_01_07_425723	869	2	/	/	SYM
10_1101-2021_01_07_425723	869	3	zenodo.3548120	zenodo.3548120	NNP
10_1101-2021_01_07_425723	869	4	886	886	CD
10_1101-2021_01_07_425723	869	5	73	73	CD
10_1101-2021_01_07_425723	869	6	.	.	.
10_1101-2021_01_07_425723	870	1	Jones	Jones	NNP
10_1101-2021_01_07_425723	870	2	,	,	,
10_1101-2021_01_07_425723	870	3	P.	P.	NNP
10_1101-2021_01_07_425723	870	4	et	et	NNP
10_1101-2021_01_07_425723	870	5	al	al	NNP
10_1101-2021_01_07_425723	870	6	.	.	.
10_1101-2021_01_07_425723	871	1	InterProScan	InterProScan	NNP
10_1101-2021_01_07_425723	871	2	5	5	CD
10_1101-2021_01_07_425723	871	3	:	:	:
10_1101-2021_01_07_425723	871	4	Genome	genome	NN
10_1101-2021_01_07_425723	871	5	-	-	HYPH
10_1101-2021_01_07_425723	871	6	scale	scale	NN
10_1101-2021_01_07_425723	871	7	protein	protein	NN
10_1101-2021_01_07_425723	871	8	function	function	NN
10_1101-2021_01_07_425723	871	9	classification	classification	NN
10_1101-2021_01_07_425723	871	10	.	.	.
10_1101-2021_01_07_425723	872	1	Bioinformatics	Bioinformatics	NNP
10_1101-2021_01_07_425723	872	2	30	30	CD
10_1101-2021_01_07_425723	872	3	,	,	,
10_1101-2021_01_07_425723	872	4	887	887	CD
10_1101-2021_01_07_425723	872	5	1236–1240	1236–1240	CD
10_1101-2021_01_07_425723	872	6	(	(	-LRB-
10_1101-2021_01_07_425723	872	7	2014	2014	CD
10_1101-2021_01_07_425723	872	8	)	)	-RRB-
10_1101-2021_01_07_425723	872	9	.	.	.
10_1101-2021_01_07_425723	873	1	888	888	CD
10_1101-2021_01_07_425723	873	2	74	74	CD
10_1101-2021_01_07_425723	873	3	.	.	.
10_1101-2021_01_07_425723	874	1	Bankevich	Bankevich	NNP
10_1101-2021_01_07_425723	874	2	,	,	,
10_1101-2021_01_07_425723	874	3	A.	A.	NNP
10_1101-2021_01_07_425723	874	4	et	et	FW
10_1101-2021_01_07_425723	874	5	al	al	NNP
10_1101-2021_01_07_425723	874	6	.	.	.
10_1101-2021_01_07_425723	875	1	SPAdes	SPAdes	NNP
10_1101-2021_01_07_425723	875	2	:	:	:
10_1101-2021_01_07_425723	875	3	A	a	DT
10_1101-2021_01_07_425723	875	4	new	new	JJ
10_1101-2021_01_07_425723	875	5	genome	genome	JJ
10_1101-2021_01_07_425723	875	6	assembly	assembly	NN
10_1101-2021_01_07_425723	875	7	algorithm	algorithm	NN
10_1101-2021_01_07_425723	875	8	and	and	CC
10_1101-2021_01_07_425723	875	9	its	-PRON-	PRP$
10_1101-2021_01_07_425723	875	10	applications	application	NNS
10_1101-2021_01_07_425723	875	11	to	to	IN
10_1101-2021_01_07_425723	875	12	single	single	JJ
10_1101-2021_01_07_425723	875	13	-	-	HYPH
10_1101-2021_01_07_425723	875	14	cell	cell	NN
10_1101-2021_01_07_425723	875	15	889	889	CD
10_1101-2021_01_07_425723	875	16	sequencing	sequencing	NN
10_1101-2021_01_07_425723	875	17	.	.	.
10_1101-2021_01_07_425723	876	1	J.	J.	NNP
10_1101-2021_01_07_425723	876	2	Comput	Comput	NNP
10_1101-2021_01_07_425723	876	3	.	.	.
10_1101-2021_01_07_425723	877	1	Biol	Biol	NNP
10_1101-2021_01_07_425723	877	2	.	.	.
10_1101-2021_01_07_425723	878	1	19	19	CD
10_1101-2021_01_07_425723	878	2	,	,	,
10_1101-2021_01_07_425723	878	3	455–477	455–477	CD
10_1101-2021_01_07_425723	878	4	(	(	-LRB-
10_1101-2021_01_07_425723	878	5	2012	2012	CD
10_1101-2021_01_07_425723	878	6	)	)	-RRB-
10_1101-2021_01_07_425723	878	7	.	.	.
10_1101-2021_01_07_425723	879	1	890	890	CD
10_1101-2021_01_07_425723	879	2	75	75	CD
10_1101-2021_01_07_425723	879	3	.	.	.
10_1101-2021_01_07_425723	880	1	Grabherr	Grabherr	NNP
10_1101-2021_01_07_425723	880	2	,	,	,
10_1101-2021_01_07_425723	880	3	M.	M.	NNP
10_1101-2021_01_07_425723	880	4	G.	G.	NNP
10_1101-2021_01_07_425723	880	5	et	et	NNP
10_1101-2021_01_07_425723	880	6	al	al	NNP
10_1101-2021_01_07_425723	880	7	.	.	.
10_1101-2021_01_07_425723	881	1	Full	full	JJ
10_1101-2021_01_07_425723	881	2	-	-	HYPH
10_1101-2021_01_07_425723	881	3	length	length	NN
10_1101-2021_01_07_425723	881	4	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	881	5	assembly	assembly	NN
10_1101-2021_01_07_425723	881	6	from	from	IN
10_1101-2021_01_07_425723	881	7	RNA	RNA	NNP
10_1101-2021_01_07_425723	881	8	-	-	HYPH
10_1101-2021_01_07_425723	881	9	Seq	Seq	NNP
10_1101-2021_01_07_425723	881	10	data	datum	NNS
10_1101-2021_01_07_425723	881	11	without	without	IN
10_1101-2021_01_07_425723	881	12	a	a	DT
10_1101-2021_01_07_425723	881	13	reference	reference	NN
10_1101-2021_01_07_425723	881	14	891	891	CD
10_1101-2021_01_07_425723	881	15	genome	genome	NN
10_1101-2021_01_07_425723	881	16	.	.	.
10_1101-2021_01_07_425723	882	1	Nat	Nat	NNP
10_1101-2021_01_07_425723	882	2	.	.	.
10_1101-2021_01_07_425723	883	1	Biotechnol	Biotechnol	NNS
10_1101-2021_01_07_425723	883	2	.	.	.
10_1101-2021_01_07_425723	884	1	29	29	CD
10_1101-2021_01_07_425723	884	2	,	,	,
10_1101-2021_01_07_425723	884	3	644–652	644–652	CD
10_1101-2021_01_07_425723	884	4	(	(	-LRB-
10_1101-2021_01_07_425723	884	5	2011	2011	CD
10_1101-2021_01_07_425723	884	6	)	)	-RRB-
10_1101-2021_01_07_425723	884	7	.	.	.
10_1101-2021_01_07_425723	885	1	892	892	CD
10_1101-2021_01_07_425723	885	2	76	76	CD
10_1101-2021_01_07_425723	885	3	.	.	.
10_1101-2021_01_07_425723	886	1	Langmead	Langmead	NNP
10_1101-2021_01_07_425723	886	2	,	,	,
10_1101-2021_01_07_425723	886	3	B.	B.	NNP
10_1101-2021_01_07_425723	886	4	,	,	,
10_1101-2021_01_07_425723	886	5	Trapnell	Trapnell	NNP
10_1101-2021_01_07_425723	886	6	,	,	,
10_1101-2021_01_07_425723	886	7	C.	C.	NNP
10_1101-2021_01_07_425723	886	8	,	,	,
10_1101-2021_01_07_425723	886	9	Pop	Pop	NNP
10_1101-2021_01_07_425723	886	10	,	,	,
10_1101-2021_01_07_425723	886	11	M.	M.	NNP
10_1101-2021_01_07_425723	886	12	&	&	CC
10_1101-2021_01_07_425723	886	13	Salzberg	Salzberg	NNP
10_1101-2021_01_07_425723	886	14	,	,	,
10_1101-2021_01_07_425723	886	15	S.	S.	NNP
10_1101-2021_01_07_425723	886	16	L.	L.	NNP
10_1101-2021_01_07_425723	886	17	Ultrafast	Ultrafast	NNP
10_1101-2021_01_07_425723	886	18	and	and	CC
10_1101-2021_01_07_425723	886	19	memory	memory	NN
10_1101-2021_01_07_425723	886	20	-	-	HYPH
10_1101-2021_01_07_425723	886	21	efficient	efficient	JJ
10_1101-2021_01_07_425723	886	22	alignment	alignment	NN
10_1101-2021_01_07_425723	886	23	of	of	IN
10_1101-2021_01_07_425723	886	24	893	893	CD
10_1101-2021_01_07_425723	886	25	short	short	JJ
10_1101-2021_01_07_425723	886	26	DNA	DNA	NNP
10_1101-2021_01_07_425723	886	27	sequences	sequence	NNS
10_1101-2021_01_07_425723	886	28	to	to	IN
10_1101-2021_01_07_425723	886	29	the	the	DT
10_1101-2021_01_07_425723	886	30	human	human	JJ
10_1101-2021_01_07_425723	886	31	genome	genome	NN
10_1101-2021_01_07_425723	886	32	.	.	.
10_1101-2021_01_07_425723	887	1	Genome	Genome	NNP
10_1101-2021_01_07_425723	887	2	Biol	Biol	NNP
10_1101-2021_01_07_425723	887	3	.	.	.
10_1101-2021_01_07_425723	888	1	10	10	CD
10_1101-2021_01_07_425723	888	2	,	,	,
10_1101-2021_01_07_425723	888	3	R25	R25	NNP
10_1101-2021_01_07_425723	888	4	(	(	-LRB-
10_1101-2021_01_07_425723	888	5	2009	2009	CD
10_1101-2021_01_07_425723	888	6	)	)	-RRB-
10_1101-2021_01_07_425723	888	7	.	.	.
10_1101-2021_01_07_425723	889	1	894	894	CD
10_1101-2021_01_07_425723	889	2	77	77	CD
10_1101-2021_01_07_425723	889	3	.	.	.
10_1101-2021_01_07_425723	890	1	Li	Li	NNP
10_1101-2021_01_07_425723	890	2	,	,	,
10_1101-2021_01_07_425723	890	3	H.	H.	NNP
10_1101-2021_01_07_425723	890	4	et	et	NNP
10_1101-2021_01_07_425723	890	5	al	al	NNP
10_1101-2021_01_07_425723	890	6	.	.	.
10_1101-2021_01_07_425723	891	1	The	the	DT
10_1101-2021_01_07_425723	891	2	Sequence	Sequence	NNP
10_1101-2021_01_07_425723	891	3	Alignment	Alignment	NNP
10_1101-2021_01_07_425723	891	4	/	/	SYM
10_1101-2021_01_07_425723	891	5	Map	Map	NNP
10_1101-2021_01_07_425723	891	6	format	format	NN
10_1101-2021_01_07_425723	891	7	and	and	CC
10_1101-2021_01_07_425723	891	8	SAMtools	samtool	NNS
10_1101-2021_01_07_425723	891	9	.	.	.
10_1101-2021_01_07_425723	892	1	Bioinformatics	Bioinformatics	NNP
10_1101-2021_01_07_425723	892	2	25	25	CD
10_1101-2021_01_07_425723	892	3	,	,	,
10_1101-2021_01_07_425723	892	4	2078–2079	2078–2079	CD
10_1101-2021_01_07_425723	892	5	895	895	CD
10_1101-2021_01_07_425723	892	6	(	(	-LRB-
10_1101-2021_01_07_425723	892	7	2009	2009	CD
10_1101-2021_01_07_425723	892	8	)	)	-RRB-
10_1101-2021_01_07_425723	892	9	.	.	.
10_1101-2021_01_07_425723	893	1	896	896	CD
10_1101-2021_01_07_425723	893	2	78	78	CD
10_1101-2021_01_07_425723	893	3	.	.	.
10_1101-2021_01_07_425723	894	1	Liao	Liao	NNP
10_1101-2021_01_07_425723	894	2	,	,	,
10_1101-2021_01_07_425723	894	3	Y.	Y.	NNP
10_1101-2021_01_07_425723	894	4	,	,	,
10_1101-2021_01_07_425723	894	5	Smyth	Smyth	NNP
10_1101-2021_01_07_425723	894	6	,	,	,
10_1101-2021_01_07_425723	894	7	G.	G.	NNP
10_1101-2021_01_07_425723	894	8	K.	K.	NNP
10_1101-2021_01_07_425723	894	9	&	&	CC
10_1101-2021_01_07_425723	894	10	Shi	Shi	NNP
10_1101-2021_01_07_425723	894	11	,	,	,
10_1101-2021_01_07_425723	894	12	W.	W.	NNP
10_1101-2021_01_07_425723	894	13	FeatureCounts	FeatureCounts	NNP
10_1101-2021_01_07_425723	894	14	:	:	:
10_1101-2021_01_07_425723	894	15	An	an	DT
10_1101-2021_01_07_425723	894	16	efficient	efficient	JJ
10_1101-2021_01_07_425723	894	17	general	general	JJ
10_1101-2021_01_07_425723	894	18	purpose	purpose	NN
10_1101-2021_01_07_425723	894	19	program	program	NN
10_1101-2021_01_07_425723	894	20	for	for	IN
10_1101-2021_01_07_425723	894	21	assigning	assign	VBG
10_1101-2021_01_07_425723	894	22	897	897	CD
10_1101-2021_01_07_425723	894	23	sequence	sequence	NN
10_1101-2021_01_07_425723	894	24	reads	read	VBZ
10_1101-2021_01_07_425723	894	25	to	to	IN
10_1101-2021_01_07_425723	894	26	genomic	genomic	JJ
10_1101-2021_01_07_425723	894	27	features	feature	NNS
10_1101-2021_01_07_425723	894	28	.	.	.
10_1101-2021_01_07_425723	895	1	Bioinformatics	Bioinformatics	NNP
10_1101-2021_01_07_425723	895	2	30	30	CD
10_1101-2021_01_07_425723	895	3	,	,	,
10_1101-2021_01_07_425723	895	4	923–930	923–930	CD
10_1101-2021_01_07_425723	895	5	(	(	-LRB-
10_1101-2021_01_07_425723	895	6	2014	2014	CD
10_1101-2021_01_07_425723	895	7	)	)	-RRB-
10_1101-2021_01_07_425723	895	8	.	.	.
10_1101-2021_01_07_425723	896	1	898	898	CD
10_1101-2021_01_07_425723	896	2	79	79	CD
10_1101-2021_01_07_425723	896	3	.	.	.
10_1101-2021_01_07_425723	897	1	McCarthy	McCarthy	NNP
10_1101-2021_01_07_425723	897	2	,	,	,
10_1101-2021_01_07_425723	897	3	D.	D.	NNP
10_1101-2021_01_07_425723	897	4	J.	J.	NNP
10_1101-2021_01_07_425723	897	5	,	,	,
10_1101-2021_01_07_425723	897	6	Chen	Chen	NNP
10_1101-2021_01_07_425723	897	7	,	,	,
10_1101-2021_01_07_425723	897	8	Y.	Y.	NNP
10_1101-2021_01_07_425723	898	1	&	&	CC
10_1101-2021_01_07_425723	898	2	Smyth	Smyth	NNP
10_1101-2021_01_07_425723	898	3	,	,	,
10_1101-2021_01_07_425723	898	4	G.	G.	NNP
10_1101-2021_01_07_425723	898	5	K.	K.	NNP
10_1101-2021_01_07_425723	898	6	Differential	Differential	NNP
10_1101-2021_01_07_425723	898	7	expression	expression	NN
10_1101-2021_01_07_425723	898	8	analysis	analysis	NN
10_1101-2021_01_07_425723	898	9	of	of	IN
10_1101-2021_01_07_425723	898	10	multifactor	multifactor	NN
10_1101-2021_01_07_425723	898	11	RNA	RNA	NNP
10_1101-2021_01_07_425723	898	12	-	-	HYPH
10_1101-2021_01_07_425723	898	13	Seq	Seq	NNP
10_1101-2021_01_07_425723	898	14	899	899	CD
10_1101-2021_01_07_425723	898	15	experiments	experiment	NNS
10_1101-2021_01_07_425723	898	16	with	with	IN
10_1101-2021_01_07_425723	898	17	respect	respect	NN
10_1101-2021_01_07_425723	898	18	to	to	IN
10_1101-2021_01_07_425723	898	19	biological	biological	JJ
10_1101-2021_01_07_425723	898	20	variation	variation	NN
10_1101-2021_01_07_425723	898	21	.	.	.
10_1101-2021_01_07_425723	899	1	Nucleic	Nucleic	NNP
10_1101-2021_01_07_425723	899	2	Acids	Acids	NNPS
10_1101-2021_01_07_425723	899	3	Res	Res	NNP
10_1101-2021_01_07_425723	899	4	.	.	.
10_1101-2021_01_07_425723	900	1	40	40	CD
10_1101-2021_01_07_425723	900	2	,	,	,
10_1101-2021_01_07_425723	900	3	4288–4297	4288–4297	CD
10_1101-2021_01_07_425723	900	4	(	(	-LRB-
10_1101-2021_01_07_425723	900	5	2012	2012	CD
10_1101-2021_01_07_425723	900	6	)	)	-RRB-
10_1101-2021_01_07_425723	900	7	.	.	.
10_1101-2021_01_07_425723	901	1	900	900	CD
10_1101-2021_01_07_425723	901	2	80	80	CD
10_1101-2021_01_07_425723	901	3	.	.	.
10_1101-2021_01_07_425723	902	1	Robinson	Robinson	NNP
10_1101-2021_01_07_425723	902	2	,	,	,
10_1101-2021_01_07_425723	902	3	M.	M.	NNP
10_1101-2021_01_07_425723	902	4	D.	D.	NNP
10_1101-2021_01_07_425723	902	5	&	&	CC
10_1101-2021_01_07_425723	902	6	Oshlack	Oshlack	NNP
10_1101-2021_01_07_425723	902	7	,	,	,
10_1101-2021_01_07_425723	902	8	A.	a.	NN
10_1101-2021_01_07_425723	903	1	A	a	DT
10_1101-2021_01_07_425723	903	2	scaling	scale	VBG
10_1101-2021_01_07_425723	903	3	normalization	normalization	NN
10_1101-2021_01_07_425723	903	4	method	method	NN
10_1101-2021_01_07_425723	903	5	for	for	IN
10_1101-2021_01_07_425723	903	6	differential	differential	NN
10_1101-2021_01_07_425723	903	7	expression	expression	NN
10_1101-2021_01_07_425723	903	8	analysis	analysis	NN
10_1101-2021_01_07_425723	903	9	901	901	CD
10_1101-2021_01_07_425723	903	10	of	of	IN
10_1101-2021_01_07_425723	903	11	RNA	RNA	NNP
10_1101-2021_01_07_425723	903	12	-	-	HYPH
10_1101-2021_01_07_425723	903	13	seq	seq	NN
10_1101-2021_01_07_425723	903	14	data	datum	NNS
10_1101-2021_01_07_425723	903	15	.	.	.
10_1101-2021_01_07_425723	904	1	Genome	Genome	NNP
10_1101-2021_01_07_425723	904	2	Biol	Biol	NNP
10_1101-2021_01_07_425723	904	3	.	.	.
10_1101-2021_01_07_425723	905	1	11	11	CD
10_1101-2021_01_07_425723	905	2	,	,	,
10_1101-2021_01_07_425723	905	3	(	(	-LRB-
10_1101-2021_01_07_425723	905	4	2010	2010	CD
10_1101-2021_01_07_425723	905	5	)	)	-RRB-
10_1101-2021_01_07_425723	905	6	.	.	.
10_1101-2021_01_07_425723	906	1	902	902	CD
10_1101-2021_01_07_425723	906	2	81	81	CD
10_1101-2021_01_07_425723	906	3	.	.	.
10_1101-2021_01_07_425723	907	1	Gu	Gu	NNP
10_1101-2021_01_07_425723	907	2	,	,	,
10_1101-2021_01_07_425723	907	3	Z.	Z.	NNP
10_1101-2021_01_07_425723	907	4	,	,	,
10_1101-2021_01_07_425723	907	5	Eils	Eils	NNP
10_1101-2021_01_07_425723	907	6	,	,	,
10_1101-2021_01_07_425723	907	7	R.	R.	NNP
10_1101-2021_01_07_425723	907	8	&	&	CC
10_1101-2021_01_07_425723	907	9	Schlesner	Schlesner	NNP
10_1101-2021_01_07_425723	907	10	,	,	,
10_1101-2021_01_07_425723	907	11	M.	M.	NNP
10_1101-2021_01_07_425723	907	12	Complex	Complex	NNP
10_1101-2021_01_07_425723	907	13	heatmaps	heatmap	NNS
10_1101-2021_01_07_425723	907	14	reveal	reveal	VBP
10_1101-2021_01_07_425723	907	15	patterns	pattern	NNS
10_1101-2021_01_07_425723	907	16	and	and	CC
10_1101-2021_01_07_425723	907	17	correlations	correlation	NNS
10_1101-2021_01_07_425723	907	18	in	in	IN
10_1101-2021_01_07_425723	907	19	903	903	CD
10_1101-2021_01_07_425723	907	20	multidimensional	multidimensional	JJ
10_1101-2021_01_07_425723	907	21	genomic	genomic	JJ
10_1101-2021_01_07_425723	907	22	data	datum	NNS
10_1101-2021_01_07_425723	907	23	.	.	.
10_1101-2021_01_07_425723	908	1	Bioinformatics	Bioinformatics	NNP
10_1101-2021_01_07_425723	908	2	32	32	CD
10_1101-2021_01_07_425723	908	3	,	,	,
10_1101-2021_01_07_425723	908	4	2847–2849	2847–2849	CD
10_1101-2021_01_07_425723	908	5	(	(	-LRB-
10_1101-2021_01_07_425723	908	6	2016	2016	CD
10_1101-2021_01_07_425723	908	7	)	)	-RRB-
10_1101-2021_01_07_425723	908	8	.	.	.
10_1101-2021_01_07_425723	909	1	904	904	CD
10_1101-2021_01_07_425723	909	2	82	82	CD
10_1101-2021_01_07_425723	909	3	.	.	.
10_1101-2021_01_07_425723	910	1	R	R	NNP
10_1101-2021_01_07_425723	910	2	Core	Core	NNP
10_1101-2021_01_07_425723	910	3	Team	Team	NNP
10_1101-2021_01_07_425723	910	4	.	.	.
10_1101-2021_01_07_425723	911	1	R	r	NN
10_1101-2021_01_07_425723	911	2	:	:	:
10_1101-2021_01_07_425723	911	3	A	A	NNP
10_1101-2021_01_07_425723	911	4	Language	Language	NNP
10_1101-2021_01_07_425723	911	5	and	and	CC
10_1101-2021_01_07_425723	911	6	Environment	Environment	NNP
10_1101-2021_01_07_425723	911	7	for	for	IN
10_1101-2021_01_07_425723	911	8	Statistical	Statistical	NNP
10_1101-2021_01_07_425723	911	9	Computing	Computing	NNP
10_1101-2021_01_07_425723	911	10	.	.	.
10_1101-2021_01_07_425723	912	1	(	(	-LRB-
10_1101-2021_01_07_425723	912	2	2017	2017	CD
10_1101-2021_01_07_425723	912	3	)	)	-RRB-
10_1101-2021_01_07_425723	912	4	.	.	.
10_1101-2021_01_07_425723	913	1	905	905	CD
10_1101-2021_01_07_425723	913	2	83	83	CD
10_1101-2021_01_07_425723	913	3	.	.	.
10_1101-2021_01_07_425723	914	1	Juergens	Juergens	NNP
10_1101-2021_01_07_425723	914	2	,	,	,
10_1101-2021_01_07_425723	914	3	H.	H.	NNP
10_1101-2021_01_07_425723	914	4	et	et	NNP
10_1101-2021_01_07_425723	914	5	al	al	NNP
10_1101-2021_01_07_425723	914	6	.	.	.
10_1101-2021_01_07_425723	915	1	Evaluation	evaluation	NN
10_1101-2021_01_07_425723	915	2	of	of	IN
10_1101-2021_01_07_425723	915	3	a	a	DT
10_1101-2021_01_07_425723	915	4	novel	novel	JJ
10_1101-2021_01_07_425723	915	5	cloud	cloud	NN
10_1101-2021_01_07_425723	915	6	-	-	HYPH
10_1101-2021_01_07_425723	915	7	based	base	VBN
10_1101-2021_01_07_425723	915	8	software	software	NN
10_1101-2021_01_07_425723	915	9	platform	platform	NN
10_1101-2021_01_07_425723	915	10	for	for	IN
10_1101-2021_01_07_425723	915	11	structured	structured	JJ
10_1101-2021_01_07_425723	915	12	experiment	experiment	NN
10_1101-2021_01_07_425723	915	13	906	906	CD
10_1101-2021_01_07_425723	915	14	design	design	NN
10_1101-2021_01_07_425723	915	15	and	and	CC
10_1101-2021_01_07_425723	915	16	linked	link	VBD
10_1101-2021_01_07_425723	915	17	data	datum	NNS
10_1101-2021_01_07_425723	915	18	analytics	analytic	NNS
10_1101-2021_01_07_425723	915	19	.	.	.
10_1101-2021_01_07_425723	916	1	Sci	Sci	NNP
10_1101-2021_01_07_425723	916	2	.	.	.
10_1101-2021_01_07_425723	917	1	Data	datum	NNS
10_1101-2021_01_07_425723	917	2	5	5	CD
10_1101-2021_01_07_425723	917	3	,	,	,
10_1101-2021_01_07_425723	917	4	1–12	1–12	NNP
10_1101-2021_01_07_425723	917	5	(	(	-LRB-
10_1101-2021_01_07_425723	917	6	2018	2018	CD
10_1101-2021_01_07_425723	917	7	)	)	-RRB-
10_1101-2021_01_07_425723	917	8	.	.	.
10_1101-2021_01_07_425723	918	1	907	907	CD
10_1101-2021_01_07_425723	918	2	84	84	CD
10_1101-2021_01_07_425723	918	3	.	.	.
10_1101-2021_01_07_425723	919	1	Ortiz	Ortiz	NNP
10_1101-2021_01_07_425723	919	2	-	-	HYPH
10_1101-2021_01_07_425723	919	3	Merino	Merino	NNP
10_1101-2021_01_07_425723	919	4	,	,	,
10_1101-2021_01_07_425723	919	5	R.	R.	NNP
10_1101-2021_01_07_425723	919	6	A.	A.	NNP
10_1101-2021_01_07_425723	919	7	et	et	FW
10_1101-2021_01_07_425723	919	8	al	al	NNP
10_1101-2021_01_07_425723	919	9	.	.	.
10_1101-2021_01_07_425723	920	1	Ploidy	Ploidy	NNP
10_1101-2021_01_07_425723	920	2	Variation	Variation	NNP
10_1101-2021_01_07_425723	920	3	in	in	IN
10_1101-2021_01_07_425723	920	4	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	920	5	marxianus	marxianus	NN
10_1101-2021_01_07_425723	920	6	Separates	Separates	NNPS
10_1101-2021_01_07_425723	920	7	Dairy	Dairy	NNP
10_1101-2021_01_07_425723	920	8	and	and	CC
10_1101-2021_01_07_425723	920	9	Non-908	non-908	CD
10_1101-2021_01_07_425723	920	10	dairy	dairy	NN
10_1101-2021_01_07_425723	920	11	Isolates	Isolates	NNPS
10_1101-2021_01_07_425723	920	12	.	.	.
10_1101-2021_01_07_425723	921	1	Front	front	NN
10_1101-2021_01_07_425723	921	2	.	.	.
10_1101-2021_01_07_425723	922	1	Genet	Genet	NNP
10_1101-2021_01_07_425723	922	2	.	.	.
10_1101-2021_01_07_425723	923	1	9	9	CD
10_1101-2021_01_07_425723	923	2	,	,	,
10_1101-2021_01_07_425723	923	3	1–16	1–16	CD
10_1101-2021_01_07_425723	923	4	(	(	-LRB-
10_1101-2021_01_07_425723	923	5	2018	2018	CD
10_1101-2021_01_07_425723	923	6	)	)	-RRB-
10_1101-2021_01_07_425723	923	7	.	.	.
10_1101-2021_01_07_425723	924	1	909	909	CD
10_1101-2021_01_07_425723	924	2	85	85	CD
10_1101-2021_01_07_425723	924	3	.	.	.
10_1101-2021_01_07_425723	925	1	Li	Li	NNP
10_1101-2021_01_07_425723	925	2	,	,	,
10_1101-2021_01_07_425723	925	3	H.	H.	NNP
10_1101-2021_01_07_425723	925	4	&	&	CC
10_1101-2021_01_07_425723	925	5	Durbin	Durbin	NNP
10_1101-2021_01_07_425723	925	6	,	,	,
10_1101-2021_01_07_425723	925	7	R.	R.	NNP
10_1101-2021_01_07_425723	925	8	Fast	Fast	NNP
10_1101-2021_01_07_425723	925	9	and	and	CC
10_1101-2021_01_07_425723	925	10	accurate	accurate	JJ
10_1101-2021_01_07_425723	925	11	short	short	JJ
10_1101-2021_01_07_425723	925	12	read	read	NN
10_1101-2021_01_07_425723	925	13	alignment	alignment	NN
10_1101-2021_01_07_425723	925	14	with	with	IN
10_1101-2021_01_07_425723	925	15	Burrows	Burrows	NNP
10_1101-2021_01_07_425723	925	16	-	-	HYPH
10_1101-2021_01_07_425723	925	17	Wheeler	Wheeler	NNP
10_1101-2021_01_07_425723	925	18	transform	transform	NN
10_1101-2021_01_07_425723	925	19	.	.	.
10_1101-2021_01_07_425723	926	1	910	910	CD
10_1101-2021_01_07_425723	926	2	Bioinformatics	Bioinformatics	NNP
10_1101-2021_01_07_425723	926	3	25	25	CD
10_1101-2021_01_07_425723	926	4	,	,	,
10_1101-2021_01_07_425723	926	5	1754–1760	1754–1760	CD
10_1101-2021_01_07_425723	926	6	(	(	-LRB-
10_1101-2021_01_07_425723	926	7	2009	2009	CD
10_1101-2021_01_07_425723	926	8	)	)	-RRB-
10_1101-2021_01_07_425723	926	9	.	.	.
10_1101-2021_01_07_425723	927	1	911	911	CD
10_1101-2021_01_07_425723	927	2	86	86	CD
10_1101-2021_01_07_425723	927	3	.	.	.
10_1101-2021_01_07_425723	928	1	Auwera	Auwera	NNP
10_1101-2021_01_07_425723	928	2	,	,	,
10_1101-2021_01_07_425723	928	3	G.	G.	NNP
10_1101-2021_01_07_425723	928	4	A.	A.	NNP
10_1101-2021_01_07_425723	928	5	et	et	FW
10_1101-2021_01_07_425723	928	6	al	al	NNP
10_1101-2021_01_07_425723	928	7	.	.	.
10_1101-2021_01_07_425723	929	1	From	from	IN
10_1101-2021_01_07_425723	929	2	FastQ	FastQ	NNP
10_1101-2021_01_07_425723	929	3	Data	Data	NNP
10_1101-2021_01_07_425723	929	4	to	to	IN
10_1101-2021_01_07_425723	929	5	High	high	JJ
10_1101-2021_01_07_425723	929	6	-	-	HYPH
10_1101-2021_01_07_425723	929	7	Confidence	confidence	NN
10_1101-2021_01_07_425723	929	8	Variant	Variant	NNP
10_1101-2021_01_07_425723	929	9	Calls	call	NNS
10_1101-2021_01_07_425723	929	10	:	:	:
10_1101-2021_01_07_425723	929	11	The	The	NNP
10_1101-2021_01_07_425723	929	12	Genome	Genome	NNP
10_1101-2021_01_07_425723	929	13	Analysis	Analysis	NNP
10_1101-2021_01_07_425723	929	14	912	912	CD
10_1101-2021_01_07_425723	929	15	Toolkit	Toolkit	NNS
10_1101-2021_01_07_425723	929	16	Best	Best	NNP
10_1101-2021_01_07_425723	929	17	Practices	Practices	NNPS
10_1101-2021_01_07_425723	929	18	Pipeline	Pipeline	NNP
10_1101-2021_01_07_425723	929	19	.	.	.
10_1101-2021_01_07_425723	930	1	Curr	curr	UH
10_1101-2021_01_07_425723	930	2	.	.	.
10_1101-2021_01_07_425723	931	1	Protoc	Protoc	NNP
10_1101-2021_01_07_425723	931	2	.	.	.
10_1101-2021_01_07_425723	932	1	Bioinforma	Bioinforma	NNP
10_1101-2021_01_07_425723	932	2	.	.	.
10_1101-2021_01_07_425723	933	1	43	43	CD
10_1101-2021_01_07_425723	933	2	,	,	,
10_1101-2021_01_07_425723	933	3	11.10.1	11.10.1	CD
10_1101-2021_01_07_425723	933	4	-	-	SYM
10_1101-2021_01_07_425723	933	5	11.10.33	11.10.33	CD
10_1101-2021_01_07_425723	933	6	(	(	-LRB-
10_1101-2021_01_07_425723	933	7	2013	2013	CD
10_1101-2021_01_07_425723	933	8	)	)	-RRB-
10_1101-2021_01_07_425723	933	9	.	.	.
10_1101-2021_01_07_425723	934	1	913	913	CD
10_1101-2021_01_07_425723	934	2	87	87	CD
10_1101-2021_01_07_425723	934	3	.	.	.
10_1101-2021_01_07_425723	935	1	Cingolani	Cingolani	NNP
10_1101-2021_01_07_425723	935	2	,	,	,
10_1101-2021_01_07_425723	935	3	P.	P.	NNP
10_1101-2021_01_07_425723	935	4	et	et	NNP
10_1101-2021_01_07_425723	935	5	al	al	NNP
10_1101-2021_01_07_425723	935	6	.	.	.
10_1101-2021_01_07_425723	936	1	A	a	DT
10_1101-2021_01_07_425723	936	2	program	program	NN
10_1101-2021_01_07_425723	936	3	for	for	IN
10_1101-2021_01_07_425723	936	4	annotating	annotate	VBG
10_1101-2021_01_07_425723	936	5	and	and	CC
10_1101-2021_01_07_425723	936	6	predicting	predict	VBG
10_1101-2021_01_07_425723	936	7	the	the	DT
10_1101-2021_01_07_425723	936	8	effects	effect	NNS
10_1101-2021_01_07_425723	936	9	of	of	IN
10_1101-2021_01_07_425723	936	10	single	single	JJ
10_1101-2021_01_07_425723	936	11	nucleotide	nucleotide	JJ
10_1101-2021_01_07_425723	936	12	914	914	CD
10_1101-2021_01_07_425723	936	13	.CC	.CC	:
10_1101-2021_01_07_425723	936	14	-	-	HYPH
10_1101-2021_01_07_425723	936	15	BY	by	IN
10_1101-2021_01_07_425723	936	16	-	-	HYPH
10_1101-2021_01_07_425723	936	17	NC	NC	NNP
10_1101-2021_01_07_425723	936	18	-	-	HYPH
10_1101-2021_01_07_425723	936	19	ND	ND	NNP
10_1101-2021_01_07_425723	936	20	4.0	4.0	CD
10_1101-2021_01_07_425723	936	21	International	International	NNP
10_1101-2021_01_07_425723	936	22	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	936	23	under	under	IN
10_1101-2021_01_07_425723	936	24	a	a	DT
10_1101-2021_01_07_425723	936	25	(	(	-LRB-
10_1101-2021_01_07_425723	936	26	which	which	WDT
10_1101-2021_01_07_425723	936	27	was	be	VBD
10_1101-2021_01_07_425723	936	28	not	not	RB
10_1101-2021_01_07_425723	936	29	certified	certify	VBN
10_1101-2021_01_07_425723	936	30	by	by	IN
10_1101-2021_01_07_425723	936	31	peer	peer	NN
10_1101-2021_01_07_425723	936	32	review	review	NN
10_1101-2021_01_07_425723	936	33	)	)	-RRB-
10_1101-2021_01_07_425723	936	34	is	be	VBZ
10_1101-2021_01_07_425723	936	35	the	the	DT
10_1101-2021_01_07_425723	936	36	author	author	NN
10_1101-2021_01_07_425723	936	37	/	/	SYM
10_1101-2021_01_07_425723	936	38	funder	funder	NN
10_1101-2021_01_07_425723	936	39	,	,	,
10_1101-2021_01_07_425723	936	40	who	who	WP
10_1101-2021_01_07_425723	936	41	has	have	VBZ
10_1101-2021_01_07_425723	936	42	granted	grant	VBN
10_1101-2021_01_07_425723	936	43	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	936	44	a	a	DT
10_1101-2021_01_07_425723	936	45	license	license	NN
10_1101-2021_01_07_425723	936	46	to	to	TO
10_1101-2021_01_07_425723	936	47	display	display	VB
10_1101-2021_01_07_425723	936	48	the	the	DT
10_1101-2021_01_07_425723	936	49	preprint	preprint	NN
10_1101-2021_01_07_425723	936	50	in	in	IN
10_1101-2021_01_07_425723	936	51	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	936	52	.	.	.
10_1101-2021_01_07_425723	937	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	937	2	is	be	VBZ
10_1101-2021_01_07_425723	937	3	made	make	VBN
10_1101-2021_01_07_425723	937	4	The	the	DT
10_1101-2021_01_07_425723	937	5	copyright	copyright	NN
10_1101-2021_01_07_425723	937	6	holder	holder	NN
10_1101-2021_01_07_425723	937	7	for	for	IN
10_1101-2021_01_07_425723	937	8	this	this	DT
10_1101-2021_01_07_425723	937	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	937	10	version	version	NN
10_1101-2021_01_07_425723	937	11	posted	post	VBD
10_1101-2021_01_07_425723	937	12	January	January	NNP
10_1101-2021_01_07_425723	937	13	8	8	CD
10_1101-2021_01_07_425723	937	14	,	,	,
10_1101-2021_01_07_425723	937	15	2021	2021	CD
10_1101-2021_01_07_425723	937	16	.	.	.
10_1101-2021_01_07_425723	937	17	;	;	:
10_1101-2021_01_07_425723	937	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	937	19	:	:	:
10_1101-2021_01_07_425723	937	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	937	21	preprint	preprint	NN
10_1101-2021_01_07_425723	937	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	937	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CC
10_1101-2021_01_07_425723	937	24	45	45	CD
10_1101-2021_01_07_425723	937	25	polymorphisms	polymorphism	NNS
10_1101-2021_01_07_425723	937	26	,	,	,
10_1101-2021_01_07_425723	937	27	SnpEff	snpeff	NN
10_1101-2021_01_07_425723	937	28	:	:	:
10_1101-2021_01_07_425723	937	29	SNPs	snp	NNS
10_1101-2021_01_07_425723	937	30	in	in	IN
10_1101-2021_01_07_425723	937	31	the	the	DT
10_1101-2021_01_07_425723	937	32	genome	genome	NN
10_1101-2021_01_07_425723	937	33	of	of	IN
10_1101-2021_01_07_425723	937	34	Drosophila	Drosophila	NNP
10_1101-2021_01_07_425723	937	35	melanogaster	melanogaster	NN
10_1101-2021_01_07_425723	937	36	strain	strain	NN
10_1101-2021_01_07_425723	937	37	w1118	w1118	NN
10_1101-2021_01_07_425723	937	38	;	;	:
10_1101-2021_01_07_425723	937	39	iso-2	iso-2	UH
10_1101-2021_01_07_425723	937	40	;	;	:
10_1101-2021_01_07_425723	937	41	iso-915	iso-915	NN
10_1101-2021_01_07_425723	937	42	3	3	CD
10_1101-2021_01_07_425723	937	43	.	.	.
10_1101-2021_01_07_425723	938	1	Fly	Fly	NNP
10_1101-2021_01_07_425723	938	2	(	(	-LRB-
10_1101-2021_01_07_425723	938	3	Austin	Austin	NNP
10_1101-2021_01_07_425723	938	4	)	)	-RRB-
10_1101-2021_01_07_425723	938	5	.	.	.
10_1101-2021_01_07_425723	939	1	6	6	CD
10_1101-2021_01_07_425723	939	2	,	,	,
10_1101-2021_01_07_425723	939	3	80–92	80–92	NNP
10_1101-2021_01_07_425723	939	4	(	(	-LRB-
10_1101-2021_01_07_425723	939	5	2012	2012	CD
10_1101-2021_01_07_425723	939	6	)	)	-RRB-
10_1101-2021_01_07_425723	939	7	.	.	.
10_1101-2021_01_07_425723	940	1	916	916	CD
10_1101-2021_01_07_425723	940	2	917	917	CD
10_1101-2021_01_07_425723	940	3	.CC	.CC	:
10_1101-2021_01_07_425723	940	4	-	-	HYPH
10_1101-2021_01_07_425723	940	5	BY	by	IN
10_1101-2021_01_07_425723	940	6	-	-	HYPH
10_1101-2021_01_07_425723	940	7	NC	NC	NNP
10_1101-2021_01_07_425723	940	8	-	-	HYPH
10_1101-2021_01_07_425723	940	9	ND	ND	NNP
10_1101-2021_01_07_425723	940	10	4.0	4.0	CD
10_1101-2021_01_07_425723	940	11	International	International	NNP
10_1101-2021_01_07_425723	940	12	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	940	13	under	under	IN
10_1101-2021_01_07_425723	940	14	a	a	DT
10_1101-2021_01_07_425723	940	15	(	(	-LRB-
10_1101-2021_01_07_425723	940	16	which	which	WDT
10_1101-2021_01_07_425723	940	17	was	be	VBD
10_1101-2021_01_07_425723	940	18	not	not	RB
10_1101-2021_01_07_425723	940	19	certified	certify	VBN
10_1101-2021_01_07_425723	940	20	by	by	IN
10_1101-2021_01_07_425723	940	21	peer	peer	NN
10_1101-2021_01_07_425723	940	22	review	review	NN
10_1101-2021_01_07_425723	940	23	)	)	-RRB-
10_1101-2021_01_07_425723	940	24	is	be	VBZ
10_1101-2021_01_07_425723	940	25	the	the	DT
10_1101-2021_01_07_425723	940	26	author	author	NN
10_1101-2021_01_07_425723	940	27	/	/	SYM
10_1101-2021_01_07_425723	940	28	funder	funder	NN
10_1101-2021_01_07_425723	940	29	,	,	,
10_1101-2021_01_07_425723	940	30	who	who	WP
10_1101-2021_01_07_425723	940	31	has	have	VBZ
10_1101-2021_01_07_425723	940	32	granted	grant	VBN
10_1101-2021_01_07_425723	940	33	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	940	34	a	a	DT
10_1101-2021_01_07_425723	940	35	license	license	NN
10_1101-2021_01_07_425723	940	36	to	to	TO
10_1101-2021_01_07_425723	940	37	display	display	VB
10_1101-2021_01_07_425723	940	38	the	the	DT
10_1101-2021_01_07_425723	940	39	preprint	preprint	NN
10_1101-2021_01_07_425723	940	40	in	in	IN
10_1101-2021_01_07_425723	940	41	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	940	42	.	.	.
10_1101-2021_01_07_425723	941	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	941	2	is	be	VBZ
10_1101-2021_01_07_425723	941	3	made	make	VBN
10_1101-2021_01_07_425723	941	4	The	the	DT
10_1101-2021_01_07_425723	941	5	copyright	copyright	NN
10_1101-2021_01_07_425723	941	6	holder	holder	NN
10_1101-2021_01_07_425723	941	7	for	for	IN
10_1101-2021_01_07_425723	941	8	this	this	DT
10_1101-2021_01_07_425723	941	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	941	10	version	version	NN
10_1101-2021_01_07_425723	941	11	posted	post	VBD
10_1101-2021_01_07_425723	941	12	January	January	NNP
10_1101-2021_01_07_425723	941	13	8	8	CD
10_1101-2021_01_07_425723	941	14	,	,	,
10_1101-2021_01_07_425723	941	15	2021	2021	CD
10_1101-2021_01_07_425723	941	16	.	.	.
10_1101-2021_01_07_425723	941	17	;	;	:
10_1101-2021_01_07_425723	941	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	941	19	:	:	:
10_1101-2021_01_07_425723	941	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	941	21	preprint	preprint	NN
10_1101-2021_01_07_425723	941	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	941	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	941	24	46	46	CD
10_1101-2021_01_07_425723	941	25	Description	description	NN
10_1101-2021_01_07_425723	941	26	of	of	IN
10_1101-2021_01_07_425723	941	27	Additional	Additional	NNP
10_1101-2021_01_07_425723	941	28	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	941	29	Files	Files	NNP
10_1101-2021_01_07_425723	941	30	918	918	CD
10_1101-2021_01_07_425723	941	31	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	941	32	Data	Data	NNP
10_1101-2021_01_07_425723	941	33	Set	Set	NNP
10_1101-2021_01_07_425723	941	34	1	1	CD
10_1101-2021_01_07_425723	941	35	|	|	NNP
10_1101-2021_01_07_425723	941	36	Overview	Overview	NNP
10_1101-2021_01_07_425723	941	37	of	of	IN
10_1101-2021_01_07_425723	941	38	flow	flow	NN
10_1101-2021_01_07_425723	941	39	cytometry	cytometry	NN
10_1101-2021_01_07_425723	941	40	samples	sample	NNS
10_1101-2021_01_07_425723	941	41	with	with	IN
10_1101-2021_01_07_425723	941	42	meta	meta	JJ
10_1101-2021_01_07_425723	941	43	-	-	HYPH
10_1101-2021_01_07_425723	941	44	data	datum	NNS
10_1101-2021_01_07_425723	941	45	.	.	.
10_1101-2021_01_07_425723	942	1	Meta	meta	JJ
10_1101-2021_01_07_425723	942	2	-	-	HYPH
10_1101-2021_01_07_425723	942	3	data	datum	NNS
10_1101-2021_01_07_425723	942	4	Table	table	NN
10_1101-2021_01_07_425723	942	5	of	of	IN
10_1101-2021_01_07_425723	942	6	919	919	CD
10_1101-2021_01_07_425723	942	7	file	file	NN
10_1101-2021_01_07_425723	942	8	names	name	NNS
10_1101-2021_01_07_425723	942	9	,	,	,
10_1101-2021_01_07_425723	942	10	frequency	frequency	NN
10_1101-2021_01_07_425723	942	11	of	of	IN
10_1101-2021_01_07_425723	942	12	cells	cell	NNS
10_1101-2021_01_07_425723	942	13	compared	compare	VBN
10_1101-2021_01_07_425723	942	14	to	to	IN
10_1101-2021_01_07_425723	942	15	parent	parent	NN
10_1101-2021_01_07_425723	942	16	,	,	,
10_1101-2021_01_07_425723	942	17	number	number	NN
10_1101-2021_01_07_425723	942	18	of	of	IN
10_1101-2021_01_07_425723	942	19	cells	cell	NNS
10_1101-2021_01_07_425723	942	20	in	in	IN
10_1101-2021_01_07_425723	942	21	each	each	DT
10_1101-2021_01_07_425723	942	22	group	group	NN
10_1101-2021_01_07_425723	942	23	,	,	,
10_1101-2021_01_07_425723	942	24	strain	strain	VB
10_1101-2021_01_07_425723	942	25	name	name	NN
10_1101-2021_01_07_425723	942	26	,	,	,
10_1101-2021_01_07_425723	942	27	time	time	NN
10_1101-2021_01_07_425723	942	28	920	920	CD
10_1101-2021_01_07_425723	942	29	point	point	NN
10_1101-2021_01_07_425723	942	30	of	of	IN
10_1101-2021_01_07_425723	942	31	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	942	32	measurement	measurement	NN
10_1101-2021_01_07_425723	942	33	after	after	IN
10_1101-2021_01_07_425723	942	34	4	4	CD
10_1101-2021_01_07_425723	942	35	hours	hour	NNS
10_1101-2021_01_07_425723	942	36	(	(	-LRB-
10_1101-2021_01_07_425723	942	37	1	1	CD
10_1101-2021_01_07_425723	942	38	)	)	-RRB-
10_1101-2021_01_07_425723	942	39	or	or	CC
10_1101-2021_01_07_425723	942	40	23	23	CD
10_1101-2021_01_07_425723	942	41	hours	hour	NNS
10_1101-2021_01_07_425723	942	42	(	(	-LRB-
10_1101-2021_01_07_425723	942	43	2	2	CD
10_1101-2021_01_07_425723	942	44	)	)	-RRB-
10_1101-2021_01_07_425723	942	45	,	,	,
10_1101-2021_01_07_425723	942	46	staining	stain	VBG
10_1101-2021_01_07_425723	942	47	of	of	IN
10_1101-2021_01_07_425723	942	48	cells	cell	NNS
10_1101-2021_01_07_425723	942	49	with	with	IN
10_1101-2021_01_07_425723	942	50	propidium-921	propidium-921	NNP
10_1101-2021_01_07_425723	942	51	iodide	iodide	NNP
10_1101-2021_01_07_425723	942	52	(	(	-LRB-
10_1101-2021_01_07_425723	942	53	PI	PI	NNP
10_1101-2021_01_07_425723	942	54	)	)	-RRB-
10_1101-2021_01_07_425723	942	55	with	with	IN
10_1101-2021_01_07_425723	942	56	value	value	NN
10_1101-2021_01_07_425723	942	57	(	(	-LRB-
10_1101-2021_01_07_425723	942	58	PI	PI	NNP
10_1101-2021_01_07_425723	942	59	)	)	-RRB-
10_1101-2021_01_07_425723	942	60	or	or	CC
10_1101-2021_01_07_425723	942	61	without	without	IN
10_1101-2021_01_07_425723	942	62	PI	PI	NNP
10_1101-2021_01_07_425723	942	63	staining	staining	NN
10_1101-2021_01_07_425723	942	64	(	(	-LRB-
10_1101-2021_01_07_425723	942	65	-	-	HYPH
10_1101-2021_01_07_425723	942	66	)	)	-RRB-
10_1101-2021_01_07_425723	942	67	,	,	,
10_1101-2021_01_07_425723	942	68	staining	stain	VBG
10_1101-2021_01_07_425723	942	69	of	of	IN
10_1101-2021_01_07_425723	942	70	cells	cell	NNS
10_1101-2021_01_07_425723	942	71	with	with	IN
10_1101-2021_01_07_425723	942	72	Tween	Tween	NNP
10_1101-2021_01_07_425723	942	73	80	80	CD
10_1101-2021_01_07_425723	942	74	NBD	NBD	NNP
10_1101-2021_01_07_425723	942	75	-	-	HYPH
10_1101-2021_01_07_425723	942	76	cholesterol	cholesterol	NN
10_1101-2021_01_07_425723	942	77	(	(	-LRB-
10_1101-2021_01_07_425723	942	78	TN	TN	NNP
10_1101-2021_01_07_425723	942	79	)	)	-RRB-
10_1101-2021_01_07_425723	942	80	922	922	CD
10_1101-2021_01_07_425723	942	81	or	or	CC
10_1101-2021_01_07_425723	942	82	with	with	IN
10_1101-2021_01_07_425723	942	83	Tween	Tween	NNP
10_1101-2021_01_07_425723	942	84	80	80	CD
10_1101-2021_01_07_425723	942	85	only	only	RB
10_1101-2021_01_07_425723	942	86	(	(	-LRB-
10_1101-2021_01_07_425723	942	87	T	t	NN
10_1101-2021_01_07_425723	942	88	)	)	-RRB-
10_1101-2021_01_07_425723	942	89	,	,	,
10_1101-2021_01_07_425723	942	90	with	with	IN
10_1101-2021_01_07_425723	942	91	species	specie	NNS
10_1101-2021_01_07_425723	942	92	names	name	NNS
10_1101-2021_01_07_425723	942	93	abbreviated	abbreviate	VBD
10_1101-2021_01_07_425723	942	94	K.	K.	NNP
10_1101-2021_01_07_425723	942	95	marxianus	marxianus	NN
10_1101-2021_01_07_425723	942	96	(	(	-LRB-
10_1101-2021_01_07_425723	942	97	Km	Km	NNP
10_1101-2021_01_07_425723	942	98	)	)	-RRB-
10_1101-2021_01_07_425723	942	99	or	or	CC
10_1101-2021_01_07_425723	942	100	S.	S.	NNP
10_1101-2021_01_07_425723	942	101	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	942	102	(	(	-LRB-
10_1101-2021_01_07_425723	942	103	Sc	Sc	NNP
10_1101-2021_01_07_425723	942	104	)	)	-RRB-
10_1101-2021_01_07_425723	942	105	.	.	.
10_1101-2021_01_07_425723	943	1	923	923	CD
10_1101-2021_01_07_425723	943	2	[	[	-LRB-
10_1101-2021_01_07_425723	943	3	Example	example	NN
10_1101-2021_01_07_425723	943	4	picture	picture	NN
10_1101-2021_01_07_425723	943	5	of	of	IN
10_1101-2021_01_07_425723	943	6	file	file	NN
10_1101-2021_01_07_425723	943	7	FlowCyto_Table.xlsx	FlowCyto_Table.xlsx	.
10_1101-2021_01_07_425723	943	8	]	]	-RRB-
10_1101-2021_01_07_425723	943	9	924	924	CD
10_1101-2021_01_07_425723	943	10	925	925	CD
10_1101-2021_01_07_425723	943	11	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	943	12	Data	Data	NNP
10_1101-2021_01_07_425723	943	13	set	set	NN
10_1101-2021_01_07_425723	943	14	2	2	CD
10_1101-2021_01_07_425723	943	15	|	|	CD
10_1101-2021_01_07_425723	943	16	Flow	Flow	NNP
10_1101-2021_01_07_425723	943	17	cytometry	cytometry	NN
10_1101-2021_01_07_425723	943	18	non	non	JJ
10_1101-2021_01_07_425723	943	19	-	-	JJ
10_1101-2021_01_07_425723	943	20	gated	gated	JJ
10_1101-2021_01_07_425723	943	21	data	datum	NNS
10_1101-2021_01_07_425723	943	22	of	of	IN
10_1101-2021_01_07_425723	943	23	FL3-A	FL3-A	NNP
10_1101-2021_01_07_425723	943	24	versus	versus	IN
10_1101-2021_01_07_425723	943	25	FL1-A	FL1-A	NNP
10_1101-2021_01_07_425723	943	26	of	of	IN
10_1101-2021_01_07_425723	943	27	all	all	DT
10_1101-2021_01_07_425723	943	28	samples	sample	NNS
10_1101-2021_01_07_425723	943	29	.	.	.
10_1101-2021_01_07_425723	944	1	926	926	CD
10_1101-2021_01_07_425723	944	2	Flow	Flow	NNP
10_1101-2021_01_07_425723	944	3	cytometry	cytometry	NN
10_1101-2021_01_07_425723	944	4	data	datum	NNS
10_1101-2021_01_07_425723	944	5	of	of	IN
10_1101-2021_01_07_425723	944	6	showing	show	VBG
10_1101-2021_01_07_425723	944	7	fluorescent	fluorescent	NN
10_1101-2021_01_07_425723	944	8	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	944	9	uptake	uptake	JJ
10_1101-2021_01_07_425723	944	10	by	by	IN
10_1101-2021_01_07_425723	944	11	K.	K.	NNP
10_1101-2021_01_07_425723	944	12	marxianus	marxianus	NN
10_1101-2021_01_07_425723	944	13	,	,	,
10_1101-2021_01_07_425723	944	14	S.	S.	NNP
10_1101-2021_01_07_425723	944	15	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	944	16	strains	strain	VBZ
10_1101-2021_01_07_425723	944	17	with	with	IN
10_1101-2021_01_07_425723	944	18	for	for	IN
10_1101-2021_01_07_425723	944	19	927	927	CD
10_1101-2021_01_07_425723	944	20	each	each	DT
10_1101-2021_01_07_425723	944	21	sample	sample	NN
10_1101-2021_01_07_425723	944	22	the	the	DT
10_1101-2021_01_07_425723	944	23	intensity	intensity	NN
10_1101-2021_01_07_425723	944	24	of	of	IN
10_1101-2021_01_07_425723	944	25	counts	count	NNS
10_1101-2021_01_07_425723	944	26	(	(	-LRB-
10_1101-2021_01_07_425723	944	27	pseudo	pseudo	NNP
10_1101-2021_01_07_425723	944	28	-	-	JJ
10_1101-2021_01_07_425723	944	29	colored	colored	JJ
10_1101-2021_01_07_425723	944	30	)	)	-RRB-
10_1101-2021_01_07_425723	944	31	for	for	IN
10_1101-2021_01_07_425723	944	32	533/30	533/30	CD
10_1101-2021_01_07_425723	944	33	nm	nm	IN
10_1101-2021_01_07_425723	944	34	(	(	-LRB-
10_1101-2021_01_07_425723	944	35	FL1	FL1	NNP
10_1101-2021_01_07_425723	944	36	)	)	-RRB-
10_1101-2021_01_07_425723	944	37	for	for	IN
10_1101-2021_01_07_425723	944	38	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	944	39	and	and	CC
10_1101-2021_01_07_425723	944	40	>	>	XX
10_1101-2021_01_07_425723	944	41	670	670	CD
10_1101-2021_01_07_425723	944	42	nm	nm	CD
10_1101-2021_01_07_425723	944	43	(	(	-LRB-
10_1101-2021_01_07_425723	944	44	FL3	FL3	NNP
10_1101-2021_01_07_425723	944	45	)	)	-RRB-
10_1101-2021_01_07_425723	944	46	928	928	CD
10_1101-2021_01_07_425723	944	47	for	for	IN
10_1101-2021_01_07_425723	944	48	PI	PI	NNP
10_1101-2021_01_07_425723	944	49	.	.	.
10_1101-2021_01_07_425723	945	1	929	929	CD
10_1101-2021_01_07_425723	945	2	[	[	-LRB-
10_1101-2021_01_07_425723	945	3	Example	example	NN
10_1101-2021_01_07_425723	945	4	of	of	IN
10_1101-2021_01_07_425723	945	5	first	first	JJ
10_1101-2021_01_07_425723	945	6	row	row	NN
10_1101-2021_01_07_425723	945	7	of	of	IN
10_1101-2021_01_07_425723	945	8	FlowCyto_FL1_FL3.pdf	flowcyto_fl1_fl3.pdf	NN
10_1101-2021_01_07_425723	945	9	]	]	-RRB-
10_1101-2021_01_07_425723	945	10	930	930	CD
10_1101-2021_01_07_425723	945	11	Filename	Filename	NNP
10_1101-2021_01_07_425723	945	12	Strain	Strain	NNP
10_1101-2021_01_07_425723	945	13	Time	Time	NNP
10_1101-2021_01_07_425723	945	14	point	point	NN
10_1101-2021_01_07_425723	945	15	PI	pi	NN
10_1101-2021_01_07_425723	945	16	#	#	$
10_1101-2021_01_07_425723	945	17	Day	Day	NNP
10_1101-2021_01_07_425723	945	18	Staining	Staining	NNP
10_1101-2021_01_07_425723	945	19	Cells	Cells	NNPS
10_1101-2021_01_07_425723	945	20	/	/	SYM
10_1101-2021_01_07_425723	945	21	PI	PI	NNP
10_1101-2021_01_07_425723	945	22	-	-	HYPH
10_1101-2021_01_07_425723	945	23	ne	ne	NNP
10_1101-2021_01_07_425723	945	24	Cells	Cells	NNPS
10_1101-2021_01_07_425723	945	25	/	/	SYM
10_1101-2021_01_07_425723	945	26	PI	PI	NNP
10_1101-2021_01_07_425723	945	27	-	-	HYPH
10_1101-2021_01_07_425723	945	28	po	po	NNP
10_1101-2021_01_07_425723	945	29	Cells	Cells	NNPS
10_1101-2021_01_07_425723	945	30	/	/	SYM
10_1101-2021_01_07_425723	945	31	PI	PI	NNP
10_1101-2021_01_07_425723	945	32	-	-	HYPH
10_1101-2021_01_07_425723	945	33	ne	ne	NNP
10_1101-2021_01_07_425723	945	34	A09	A09	NNP
10_1101-2021_01_07_425723	945	35	CBS6556_T_A_PI_1.fcs	CBS6556_T_A_PI_1.fcs	NNP
10_1101-2021_01_07_425723	945	36	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	945	37	1	1	CD
10_1101-2021_01_07_425723	945	38	PI	PI	NNP
10_1101-2021_01_07_425723	945	39	A	a	NN
10_1101-2021_01_07_425723	945	40	1	1	CD
10_1101-2021_01_07_425723	945	41	T	t	NN
10_1101-2021_01_07_425723	945	42	576	576	CD
10_1101-2021_01_07_425723	945	43	411000	411000	CD
10_1101-2021_01_07_425723	945	44	75590	75590	CD
10_1101-2021_01_07_425723	945	45	B09	B09	NNP
10_1101-2021_01_07_425723	945	46	CBS6556_T_B_PI_1.fcs	CBS6556_T_B_PI_1.fcs	NNP
10_1101-2021_01_07_425723	945	47	CBS6556	CBS6556	NNP
10_1101-2021_01_07_425723	945	48	1	1	CD
10_1101-2021_01_07_425723	945	49	PI	PI	NNP
10_1101-2021_01_07_425723	945	50	B	B	NNP
10_1101-2021_01_07_425723	945	51	1	1	CD
10_1101-2021_01_07_425723	945	52	T	t	NN
10_1101-2021_01_07_425723	945	53	625	625	CD
10_1101-2021_01_07_425723	945	54	398024	398024	CD
10_1101-2021_01_07_425723	945	55	88212	88212	CD
10_1101-2021_01_07_425723	945	56	A01	A01	NNP
10_1101-2021_01_07_425723	945	57	IMX585_T_A___1.fcs	IMX585_T_A___1.fcs	NNP
10_1101-2021_01_07_425723	945	58	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	945	59	1	1	CD
10_1101-2021_01_07_425723	945	60	-	-	HYPH
10_1101-2021_01_07_425723	945	61	A	a	NN
10_1101-2021_01_07_425723	945	62	2	2	CD
10_1101-2021_01_07_425723	945	63	T	t	NN
10_1101-2021_01_07_425723	945	64	1391	1391	CD
10_1101-2021_01_07_425723	945	65	3	3	CD
10_1101-2021_01_07_425723	945	66	472000	472000	CD
10_1101-2021_01_07_425723	945	67	.CC	.CC	:
10_1101-2021_01_07_425723	945	68	-	-	HYPH
10_1101-2021_01_07_425723	945	69	BY	by	IN
10_1101-2021_01_07_425723	945	70	-	-	HYPH
10_1101-2021_01_07_425723	945	71	NC	NC	NNP
10_1101-2021_01_07_425723	945	72	-	-	HYPH
10_1101-2021_01_07_425723	945	73	ND	ND	NNP
10_1101-2021_01_07_425723	945	74	4.0	4.0	CD
10_1101-2021_01_07_425723	945	75	International	International	NNP
10_1101-2021_01_07_425723	945	76	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	945	77	under	under	IN
10_1101-2021_01_07_425723	945	78	a	a	DT
10_1101-2021_01_07_425723	945	79	(	(	-LRB-
10_1101-2021_01_07_425723	945	80	which	which	WDT
10_1101-2021_01_07_425723	945	81	was	be	VBD
10_1101-2021_01_07_425723	945	82	not	not	RB
10_1101-2021_01_07_425723	945	83	certified	certify	VBN
10_1101-2021_01_07_425723	945	84	by	by	IN
10_1101-2021_01_07_425723	945	85	peer	peer	NN
10_1101-2021_01_07_425723	945	86	review	review	NN
10_1101-2021_01_07_425723	945	87	)	)	-RRB-
10_1101-2021_01_07_425723	945	88	is	be	VBZ
10_1101-2021_01_07_425723	945	89	the	the	DT
10_1101-2021_01_07_425723	945	90	author	author	NN
10_1101-2021_01_07_425723	945	91	/	/	SYM
10_1101-2021_01_07_425723	945	92	funder	funder	NN
10_1101-2021_01_07_425723	945	93	,	,	,
10_1101-2021_01_07_425723	945	94	who	who	WP
10_1101-2021_01_07_425723	945	95	has	have	VBZ
10_1101-2021_01_07_425723	945	96	granted	grant	VBN
10_1101-2021_01_07_425723	945	97	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	945	98	a	a	DT
10_1101-2021_01_07_425723	945	99	license	license	NN
10_1101-2021_01_07_425723	945	100	to	to	TO
10_1101-2021_01_07_425723	945	101	display	display	VB
10_1101-2021_01_07_425723	945	102	the	the	DT
10_1101-2021_01_07_425723	945	103	preprint	preprint	NN
10_1101-2021_01_07_425723	945	104	in	in	IN
10_1101-2021_01_07_425723	945	105	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	945	106	.	.	.
10_1101-2021_01_07_425723	946	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	946	2	is	be	VBZ
10_1101-2021_01_07_425723	946	3	made	make	VBN
10_1101-2021_01_07_425723	946	4	The	the	DT
10_1101-2021_01_07_425723	946	5	copyright	copyright	NN
10_1101-2021_01_07_425723	946	6	holder	holder	NN
10_1101-2021_01_07_425723	946	7	for	for	IN
10_1101-2021_01_07_425723	946	8	this	this	DT
10_1101-2021_01_07_425723	946	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	946	10	version	version	NN
10_1101-2021_01_07_425723	946	11	posted	post	VBD
10_1101-2021_01_07_425723	946	12	January	January	NNP
10_1101-2021_01_07_425723	946	13	8	8	CD
10_1101-2021_01_07_425723	946	14	,	,	,
10_1101-2021_01_07_425723	946	15	2021	2021	CD
10_1101-2021_01_07_425723	946	16	.	.	.
10_1101-2021_01_07_425723	946	17	;	;	:
10_1101-2021_01_07_425723	946	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	946	19	:	:	:
10_1101-2021_01_07_425723	946	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	946	21	preprint	preprint	NN
10_1101-2021_01_07_425723	946	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	946	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	946	24	47	47	CD
10_1101-2021_01_07_425723	946	25	931	931	CD
10_1101-2021_01_07_425723	946	26	.CC	.CC	:
10_1101-2021_01_07_425723	946	27	-	-	HYPH
10_1101-2021_01_07_425723	946	28	BY	by	IN
10_1101-2021_01_07_425723	946	29	-	-	HYPH
10_1101-2021_01_07_425723	946	30	NC	NC	NNP
10_1101-2021_01_07_425723	946	31	-	-	HYPH
10_1101-2021_01_07_425723	946	32	ND	ND	NNP
10_1101-2021_01_07_425723	946	33	4.0	4.0	CD
10_1101-2021_01_07_425723	946	34	International	International	NNP
10_1101-2021_01_07_425723	946	35	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	946	36	under	under	IN
10_1101-2021_01_07_425723	946	37	a	a	DT
10_1101-2021_01_07_425723	946	38	(	(	-LRB-
10_1101-2021_01_07_425723	946	39	which	which	WDT
10_1101-2021_01_07_425723	946	40	was	be	VBD
10_1101-2021_01_07_425723	946	41	not	not	RB
10_1101-2021_01_07_425723	946	42	certified	certify	VBN
10_1101-2021_01_07_425723	946	43	by	by	IN
10_1101-2021_01_07_425723	946	44	peer	peer	NN
10_1101-2021_01_07_425723	946	45	review	review	NN
10_1101-2021_01_07_425723	946	46	)	)	-RRB-
10_1101-2021_01_07_425723	946	47	is	be	VBZ
10_1101-2021_01_07_425723	946	48	the	the	DT
10_1101-2021_01_07_425723	946	49	author	author	NN
10_1101-2021_01_07_425723	946	50	/	/	SYM
10_1101-2021_01_07_425723	946	51	funder	funder	NN
10_1101-2021_01_07_425723	946	52	,	,	,
10_1101-2021_01_07_425723	946	53	who	who	WP
10_1101-2021_01_07_425723	946	54	has	have	VBZ
10_1101-2021_01_07_425723	946	55	granted	grant	VBN
10_1101-2021_01_07_425723	946	56	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	946	57	a	a	DT
10_1101-2021_01_07_425723	946	58	license	license	NN
10_1101-2021_01_07_425723	946	59	to	to	TO
10_1101-2021_01_07_425723	946	60	display	display	VB
10_1101-2021_01_07_425723	946	61	the	the	DT
10_1101-2021_01_07_425723	946	62	preprint	preprint	NN
10_1101-2021_01_07_425723	946	63	in	in	IN
10_1101-2021_01_07_425723	946	64	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	946	65	.	.	.
10_1101-2021_01_07_425723	947	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	947	2	is	be	VBZ
10_1101-2021_01_07_425723	947	3	made	make	VBN
10_1101-2021_01_07_425723	947	4	The	the	DT
10_1101-2021_01_07_425723	947	5	copyright	copyright	NN
10_1101-2021_01_07_425723	947	6	holder	holder	NN
10_1101-2021_01_07_425723	947	7	for	for	IN
10_1101-2021_01_07_425723	947	8	this	this	DT
10_1101-2021_01_07_425723	947	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	947	10	version	version	NN
10_1101-2021_01_07_425723	947	11	posted	post	VBD
10_1101-2021_01_07_425723	947	12	January	January	NNP
10_1101-2021_01_07_425723	947	13	8	8	CD
10_1101-2021_01_07_425723	947	14	,	,	,
10_1101-2021_01_07_425723	947	15	2021	2021	CD
10_1101-2021_01_07_425723	947	16	.	.	.
10_1101-2021_01_07_425723	947	17	;	;	:
10_1101-2021_01_07_425723	947	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	947	19	:	:	:
10_1101-2021_01_07_425723	947	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	947	21	preprint	preprint	NN
10_1101-2021_01_07_425723	947	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	947	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	947	24	50	50	CD
10_1101-2021_01_07_425723	947	25	Supplemental	supplemental	JJ
10_1101-2021_01_07_425723	947	26	material	material	NN
10_1101-2021_01_07_425723	947	27	for	for	IN
10_1101-2021_01_07_425723	947	28	:	:	:
10_1101-2021_01_07_425723	947	29	934	934	CD
10_1101-2021_01_07_425723	947	30	Engineering	engineer	VBG
10_1101-2021_01_07_425723	947	31	the	the	DT
10_1101-2021_01_07_425723	947	32	thermotolerant	thermotolerant	JJ
10_1101-2021_01_07_425723	947	33	industrial	industrial	JJ
10_1101-2021_01_07_425723	947	34	yeast	yeast	NN
10_1101-2021_01_07_425723	947	35	Kluyveromyces	Kluyveromyces	NNP
10_1101-2021_01_07_425723	947	36	marxianus	marxianus	NN
10_1101-2021_01_07_425723	947	37	for	for	IN
10_1101-2021_01_07_425723	947	38	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	947	39	growth	growth	NN
10_1101-2021_01_07_425723	947	40	935	935	CD
10_1101-2021_01_07_425723	947	41	Wijbrand	Wijbrand	NNP
10_1101-2021_01_07_425723	947	42	J.	J.	NNP
10_1101-2021_01_07_425723	947	43	C.	C.	NNP
10_1101-2021_01_07_425723	947	44	Dekker	Dekker	NNP
10_1101-2021_01_07_425723	947	45	,	,	,
10_1101-2021_01_07_425723	947	46	Raúl	Raúl	NNP
10_1101-2021_01_07_425723	947	47	A.	A.	NNP
10_1101-2021_01_07_425723	947	48	Ortiz	Ortiz	NNP
10_1101-2021_01_07_425723	947	49	-	-	HYPH
10_1101-2021_01_07_425723	947	50	Merino	Merino	NNP
10_1101-2021_01_07_425723	947	51	,	,	,
10_1101-2021_01_07_425723	947	52	Astrid	Astrid	NNP
10_1101-2021_01_07_425723	947	53	Kaljouw	Kaljouw	NNP
10_1101-2021_01_07_425723	947	54	,	,	,
10_1101-2021_01_07_425723	947	55	Julius	Julius	NNP
10_1101-2021_01_07_425723	947	56	Battjes	Battjes	NNP
10_1101-2021_01_07_425723	947	57	,	,	,
10_1101-2021_01_07_425723	947	58	Frank	Frank	NNP
10_1101-2021_01_07_425723	947	59	Wiering	Wiering	NNP
10_1101-2021_01_07_425723	947	60	,	,	,
10_1101-2021_01_07_425723	947	61	Christiaan	Christiaan	NNP
10_1101-2021_01_07_425723	947	62	936	936	CD
10_1101-2021_01_07_425723	947	63	Mooiman	Mooiman	NNP
10_1101-2021_01_07_425723	947	64	,	,	,
10_1101-2021_01_07_425723	947	65	Pilar	Pilar	NNP
10_1101-2021_01_07_425723	947	66	de	de	NNP
10_1101-2021_01_07_425723	947	67	la	la	NNP
10_1101-2021_01_07_425723	947	68	Torre	Torre	NNP
10_1101-2021_01_07_425723	947	69	,	,	,
10_1101-2021_01_07_425723	947	70	and	and	CC
10_1101-2021_01_07_425723	947	71	Jack	Jack	NNP
10_1101-2021_01_07_425723	947	72	T.	T.	NNP
10_1101-2021_01_07_425723	947	73	Pronk	Pronk	NNP
10_1101-2021_01_07_425723	947	74	*	*	NFP
10_1101-2021_01_07_425723	947	75	937	937	CD
10_1101-2021_01_07_425723	947	76	Department	Department	NNP
10_1101-2021_01_07_425723	947	77	of	of	IN
10_1101-2021_01_07_425723	947	78	Biotechnology	Biotechnology	NNP
10_1101-2021_01_07_425723	947	79	,	,	,
10_1101-2021_01_07_425723	947	80	Delft	Delft	NNP
10_1101-2021_01_07_425723	947	81	University	University	NNP
10_1101-2021_01_07_425723	947	82	of	of	IN
10_1101-2021_01_07_425723	947	83	Technology	Technology	NNP
10_1101-2021_01_07_425723	947	84	,	,	,
10_1101-2021_01_07_425723	947	85	van	van	NNP
10_1101-2021_01_07_425723	947	86	der	der	NNP
10_1101-2021_01_07_425723	947	87	Maasweg	Maasweg	NNP
10_1101-2021_01_07_425723	947	88	9	9	CD
10_1101-2021_01_07_425723	947	89	,	,	,
10_1101-2021_01_07_425723	947	90	2629	2629	CD
10_1101-2021_01_07_425723	947	91	HZ	HZ	NNP
10_1101-2021_01_07_425723	947	92	Delft	Delft	NNP
10_1101-2021_01_07_425723	947	93	,	,	,
10_1101-2021_01_07_425723	947	94	The	the	DT
10_1101-2021_01_07_425723	947	95	938	938	CD
10_1101-2021_01_07_425723	947	96	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	947	97	939	939	CD
10_1101-2021_01_07_425723	947	98	*	*	NFP
10_1101-2021_01_07_425723	947	99	Corresponding	Corresponding	NNP
10_1101-2021_01_07_425723	947	100	author	author	NN
10_1101-2021_01_07_425723	947	101	:	:	:
10_1101-2021_01_07_425723	947	102	Department	Department	NNP
10_1101-2021_01_07_425723	947	103	of	of	IN
10_1101-2021_01_07_425723	947	104	Biotechnology	Biotechnology	NNP
10_1101-2021_01_07_425723	947	105	,	,	,
10_1101-2021_01_07_425723	947	106	Delft	Delft	NNP
10_1101-2021_01_07_425723	947	107	University	University	NNP
10_1101-2021_01_07_425723	947	108	of	of	IN
10_1101-2021_01_07_425723	947	109	Technology	Technology	NNP
10_1101-2021_01_07_425723	947	110	,	,	,
10_1101-2021_01_07_425723	947	111	Van	Van	NNP
10_1101-2021_01_07_425723	947	112	der	der	XX
10_1101-2021_01_07_425723	947	113	Maasweg	Maasweg	NNP
10_1101-2021_01_07_425723	947	114	940	940	CD
10_1101-2021_01_07_425723	947	115	9	9	CD
10_1101-2021_01_07_425723	947	116	,	,	,
10_1101-2021_01_07_425723	947	117	2629	2629	CD
10_1101-2021_01_07_425723	947	118	HZ	HZ	NNP
10_1101-2021_01_07_425723	947	119	Delft	Delft	NNP
10_1101-2021_01_07_425723	947	120	,	,	,
10_1101-2021_01_07_425723	947	121	The	the	DT
10_1101-2021_01_07_425723	947	122	Netherlands	Netherlands	NNP
10_1101-2021_01_07_425723	947	123	,	,	,
10_1101-2021_01_07_425723	947	124	E	e	NN
10_1101-2021_01_07_425723	947	125	-	-	NN
10_1101-2021_01_07_425723	947	126	mail	mail	NN
10_1101-2021_01_07_425723	947	127	:	:	:
10_1101-2021_01_07_425723	947	128	j.t.pronk@tudelft.nl	j.t.pronk@tudelft.nl	UH
10_1101-2021_01_07_425723	947	129	,	,	,
10_1101-2021_01_07_425723	947	130	Tel	tel	NN
10_1101-2021_01_07_425723	947	131	:	:	:
10_1101-2021_01_07_425723	947	132	+31	+31	CD
10_1101-2021_01_07_425723	947	133	15	15	CD
10_1101-2021_01_07_425723	947	134	2783214	2783214	CD
10_1101-2021_01_07_425723	947	135	.	.	.
10_1101-2021_01_07_425723	948	1	941	941	CD
10_1101-2021_01_07_425723	948	2	.CC	.CC	:
10_1101-2021_01_07_425723	948	3	-	-	HYPH
10_1101-2021_01_07_425723	948	4	BY	by	IN
10_1101-2021_01_07_425723	948	5	-	-	HYPH
10_1101-2021_01_07_425723	948	6	NC	NC	NNP
10_1101-2021_01_07_425723	948	7	-	-	HYPH
10_1101-2021_01_07_425723	948	8	ND	ND	NNP
10_1101-2021_01_07_425723	948	9	4.0	4.0	CD
10_1101-2021_01_07_425723	948	10	International	International	NNP
10_1101-2021_01_07_425723	948	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	948	12	under	under	IN
10_1101-2021_01_07_425723	948	13	a	a	DT
10_1101-2021_01_07_425723	948	14	(	(	-LRB-
10_1101-2021_01_07_425723	948	15	which	which	WDT
10_1101-2021_01_07_425723	948	16	was	be	VBD
10_1101-2021_01_07_425723	948	17	not	not	RB
10_1101-2021_01_07_425723	948	18	certified	certify	VBN
10_1101-2021_01_07_425723	948	19	by	by	IN
10_1101-2021_01_07_425723	948	20	peer	peer	NN
10_1101-2021_01_07_425723	948	21	review	review	NN
10_1101-2021_01_07_425723	948	22	)	)	-RRB-
10_1101-2021_01_07_425723	948	23	is	be	VBZ
10_1101-2021_01_07_425723	948	24	the	the	DT
10_1101-2021_01_07_425723	948	25	author	author	NN
10_1101-2021_01_07_425723	948	26	/	/	SYM
10_1101-2021_01_07_425723	948	27	funder	funder	NN
10_1101-2021_01_07_425723	948	28	,	,	,
10_1101-2021_01_07_425723	948	29	who	who	WP
10_1101-2021_01_07_425723	948	30	has	have	VBZ
10_1101-2021_01_07_425723	948	31	granted	grant	VBN
10_1101-2021_01_07_425723	948	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	948	33	a	a	DT
10_1101-2021_01_07_425723	948	34	license	license	NN
10_1101-2021_01_07_425723	948	35	to	to	TO
10_1101-2021_01_07_425723	948	36	display	display	VB
10_1101-2021_01_07_425723	948	37	the	the	DT
10_1101-2021_01_07_425723	948	38	preprint	preprint	NN
10_1101-2021_01_07_425723	948	39	in	in	IN
10_1101-2021_01_07_425723	948	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	948	41	.	.	.
10_1101-2021_01_07_425723	949	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	949	2	is	be	VBZ
10_1101-2021_01_07_425723	949	3	made	make	VBN
10_1101-2021_01_07_425723	949	4	The	the	DT
10_1101-2021_01_07_425723	949	5	copyright	copyright	NN
10_1101-2021_01_07_425723	949	6	holder	holder	NN
10_1101-2021_01_07_425723	949	7	for	for	IN
10_1101-2021_01_07_425723	949	8	this	this	DT
10_1101-2021_01_07_425723	949	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	949	10	version	version	NN
10_1101-2021_01_07_425723	949	11	posted	post	VBD
10_1101-2021_01_07_425723	949	12	January	January	NNP
10_1101-2021_01_07_425723	949	13	8	8	CD
10_1101-2021_01_07_425723	949	14	,	,	,
10_1101-2021_01_07_425723	949	15	2021	2021	CD
10_1101-2021_01_07_425723	949	16	.	.	.
10_1101-2021_01_07_425723	949	17	;	;	:
10_1101-2021_01_07_425723	949	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	949	19	:	:	:
10_1101-2021_01_07_425723	949	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	949	21	preprint	preprint	NN
10_1101-2021_01_07_425723	949	22	mailto:j.t.pronk@tudelft.nl	mailto:j.t.pronk@tudelft.nl	NN
10_1101-2021_01_07_425723	949	23	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	NNP
10_1101-2021_01_07_425723	949	24	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	949	25	51	51	CD
10_1101-2021_01_07_425723	949	26	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	949	27	Fig	Fig	NNP
10_1101-2021_01_07_425723	949	28	.	.	.
10_1101-2021_01_07_425723	950	1	1	1	CD
10_1101-2021_01_07_425723	950	2	|	|	NNP
10_1101-2021_01_07_425723	950	3	Ethanol	Ethanol	NNP
10_1101-2021_01_07_425723	950	4	evaporation	evaporation	NN
10_1101-2021_01_07_425723	950	5	rate	rate	NN
10_1101-2021_01_07_425723	950	6	.	.	.
10_1101-2021_01_07_425723	951	1	Ethanol	ethanol	NN
10_1101-2021_01_07_425723	951	2	concentration	concentration	NN
10_1101-2021_01_07_425723	951	3	over	over	IN
10_1101-2021_01_07_425723	951	4	time	time	NN
10_1101-2021_01_07_425723	951	5	with	with	IN
10_1101-2021_01_07_425723	951	6	reactor	reactor	NN
10_1101-2021_01_07_425723	951	7	volume	volume	NN
10_1101-2021_01_07_425723	951	8	942	942	CD
10_1101-2021_01_07_425723	951	9	of	of	IN
10_1101-2021_01_07_425723	951	10	1200	1200	CD
10_1101-2021_01_07_425723	951	11	mL	mL	NNP
10_1101-2021_01_07_425723	951	12	SM	SM	NNP
10_1101-2021_01_07_425723	951	13	glucose	glucose	NNP
10_1101-2021_01_07_425723	951	14	urea	urea	NNP
10_1101-2021_01_07_425723	951	15	media	medium	NNS
10_1101-2021_01_07_425723	951	16	maintained	maintain	VBD
10_1101-2021_01_07_425723	951	17	at	at	IN
10_1101-2021_01_07_425723	951	18	30	30	CD
10_1101-2021_01_07_425723	951	19	°	°	,
10_1101-2021_01_07_425723	951	20	C	C	NNP
10_1101-2021_01_07_425723	951	21	,	,	,
10_1101-2021_01_07_425723	951	22	stirred	stir	VBN
10_1101-2021_01_07_425723	951	23	with	with	IN
10_1101-2021_01_07_425723	951	24	800	800	CD
10_1101-2021_01_07_425723	951	25	rpm	rpm	NNS
10_1101-2021_01_07_425723	951	26	and	and	CC
10_1101-2021_01_07_425723	951	27	aerated	aerate	VBD
10_1101-2021_01_07_425723	951	28	with	with	IN
10_1101-2021_01_07_425723	951	29	a	a	DT
10_1101-2021_01_07_425723	951	30	943	943	CD
10_1101-2021_01_07_425723	951	31	volumetric	volumetric	NN
10_1101-2021_01_07_425723	951	32	gas	gas	NN
10_1101-2021_01_07_425723	951	33	flow	flow	NN
10_1101-2021_01_07_425723	951	34	rate	rate	NN
10_1101-2021_01_07_425723	951	35	of	of	IN
10_1101-2021_01_07_425723	951	36	500	500	CD
10_1101-2021_01_07_425723	951	37	mL·min-1	mL·min-1	NNS
10_1101-2021_01_07_425723	951	38	.	.	.
10_1101-2021_01_07_425723	952	1	The	the	DT
10_1101-2021_01_07_425723	952	2	reactor	reactor	NN
10_1101-2021_01_07_425723	952	3	off	off	IN
10_1101-2021_01_07_425723	952	4	-	-	HYPH
10_1101-2021_01_07_425723	952	5	gas	gas	NN
10_1101-2021_01_07_425723	952	6	was	be	VBD
10_1101-2021_01_07_425723	952	7	cooled	cool	VBN
10_1101-2021_01_07_425723	952	8	by	by	IN
10_1101-2021_01_07_425723	952	9	passing	pass	VBG
10_1101-2021_01_07_425723	952	10	through	through	IN
10_1101-2021_01_07_425723	952	11	a	a	DT
10_1101-2021_01_07_425723	952	12	condenser	condenser	NN
10_1101-2021_01_07_425723	952	13	944	944	CD
10_1101-2021_01_07_425723	952	14	cooled	cool	VBD
10_1101-2021_01_07_425723	952	15	at	at	IN
10_1101-2021_01_07_425723	952	16	2	2	CD
10_1101-2021_01_07_425723	952	17	°	°	,
10_1101-2021_01_07_425723	952	18	C	C	NNP
10_1101-2021_01_07_425723	952	19	.	.	.
10_1101-2021_01_07_425723	953	1	Circles	circle	NNS
10_1101-2021_01_07_425723	953	2	and	and	CC
10_1101-2021_01_07_425723	953	3	orange	orange	JJ
10_1101-2021_01_07_425723	953	4	line	line	NN
10_1101-2021_01_07_425723	953	5	represent	represent	VBP
10_1101-2021_01_07_425723	953	6	the	the	DT
10_1101-2021_01_07_425723	953	7	condition	condition	NN
10_1101-2021_01_07_425723	953	8	with	with	IN
10_1101-2021_01_07_425723	953	9	sparge	sparge	NN
10_1101-2021_01_07_425723	953	10	aeration	aeration	NN
10_1101-2021_01_07_425723	953	11	and	and	CC
10_1101-2021_01_07_425723	953	12	Tween	Tween	NNP
10_1101-2021_01_07_425723	953	13	80	80	CD
10_1101-2021_01_07_425723	953	14	(	(	-LRB-
10_1101-2021_01_07_425723	953	15	T	t	NN
10_1101-2021_01_07_425723	953	16	)	)	-RRB-
10_1101-2021_01_07_425723	953	17	945	945	CD
10_1101-2021_01_07_425723	953	18	media	medium	NNS
10_1101-2021_01_07_425723	953	19	supplementation	supplementation	NN
10_1101-2021_01_07_425723	953	20	,	,	,
10_1101-2021_01_07_425723	953	21	diamonds	diamond	NNS
10_1101-2021_01_07_425723	953	22	and	and	CC
10_1101-2021_01_07_425723	953	23	blue	blue	JJ
10_1101-2021_01_07_425723	953	24	line	line	NN
10_1101-2021_01_07_425723	953	25	head	head	NN
10_1101-2021_01_07_425723	953	26	-	-	HYPH
10_1101-2021_01_07_425723	953	27	space	space	NN
10_1101-2021_01_07_425723	953	28	aeration	aeration	NN
10_1101-2021_01_07_425723	953	29	with	with	IN
10_1101-2021_01_07_425723	953	30	Tween	Tween	NNP
10_1101-2021_01_07_425723	953	31	80	80	CD
10_1101-2021_01_07_425723	953	32	,	,	,
10_1101-2021_01_07_425723	953	33	triangle	triangle	NN
10_1101-2021_01_07_425723	953	34	and	and	CC
10_1101-2021_01_07_425723	953	35	red	red	JJ
10_1101-2021_01_07_425723	953	36	946	946	CD
10_1101-2021_01_07_425723	953	37	line	line	NN
10_1101-2021_01_07_425723	953	38	represent	represent	VBP
10_1101-2021_01_07_425723	953	39	head	head	NN
10_1101-2021_01_07_425723	953	40	space	space	NN
10_1101-2021_01_07_425723	953	41	aeration	aeration	NN
10_1101-2021_01_07_425723	953	42	and	and	CC
10_1101-2021_01_07_425723	953	43	Tween	Tween	NNP
10_1101-2021_01_07_425723	953	44	80	80	CD
10_1101-2021_01_07_425723	953	45	omission	omission	NN
10_1101-2021_01_07_425723	953	46	.	.	.
10_1101-2021_01_07_425723	954	1	Data	datum	NNS
10_1101-2021_01_07_425723	954	2	represent	represent	VBP
10_1101-2021_01_07_425723	954	3	mean	mean	VBP
10_1101-2021_01_07_425723	954	4	with	with	IN
10_1101-2021_01_07_425723	954	5	standard	standard	JJ
10_1101-2021_01_07_425723	954	6	947	947	CD
10_1101-2021_01_07_425723	954	7	deviation	deviation	NN
10_1101-2021_01_07_425723	954	8	from	from	IN
10_1101-2021_01_07_425723	954	9	three	three	CD
10_1101-2021_01_07_425723	954	10	independent	independent	JJ
10_1101-2021_01_07_425723	954	11	reactor	reactor	NN
10_1101-2021_01_07_425723	954	12	experiments	experiment	NNS
10_1101-2021_01_07_425723	954	13	.	.	.
10_1101-2021_01_07_425723	955	1	948	948	CD
10_1101-2021_01_07_425723	955	2	AGF	AGF	NNP
10_1101-2021_01_07_425723	955	3	Aeration	Aeration	NNP
10_1101-2021_01_07_425723	955	4	type	type	NN
10_1101-2021_01_07_425723	955	5	Ethanol	ethanol	NN
10_1101-2021_01_07_425723	955	6	evaporation	evaporation	NN
10_1101-2021_01_07_425723	955	7	(	(	-LRB-
10_1101-2021_01_07_425723	955	8	mmol·h-1	mmol·h-1	NNP
10_1101-2021_01_07_425723	955	9	)	)	-RRB-
10_1101-2021_01_07_425723	955	10	T	T	NNP
10_1101-2021_01_07_425723	955	11	Sparge	sparge	NN
10_1101-2021_01_07_425723	955	12	0.00578	0.00578	CD
10_1101-2021_01_07_425723	955	13	±	±	CD
10_1101-2021_01_07_425723	955	14	0.00062	0.00062	CD
10_1101-2021_01_07_425723	955	15	T	T	NNP
10_1101-2021_01_07_425723	955	16	Head	head	NN
10_1101-2021_01_07_425723	955	17	-	-	HYPH
10_1101-2021_01_07_425723	955	18	space	space	NN
10_1101-2021_01_07_425723	955	19	0.00625	0.00625	CD
10_1101-2021_01_07_425723	955	20	±	±	CD
10_1101-2021_01_07_425723	955	21	0.00032	0.00032	CD
10_1101-2021_01_07_425723	955	22	Head	head	NN
10_1101-2021_01_07_425723	955	23	-	-	HYPH
10_1101-2021_01_07_425723	955	24	space	space	NN
10_1101-2021_01_07_425723	955	25	0.00653	0.00653	CD
10_1101-2021_01_07_425723	955	26	±	±	CD
10_1101-2021_01_07_425723	955	27	0.00020	0.00020	CD
10_1101-2021_01_07_425723	955	28	949	949	CD
10_1101-2021_01_07_425723	955	29	950	950	CD
10_1101-2021_01_07_425723	955	30	100	100	CD
10_1101-2021_01_07_425723	955	31	150	150	CD
10_1101-2021_01_07_425723	955	32	200	200	CD
10_1101-2021_01_07_425723	955	33	250	250	CD
10_1101-2021_01_07_425723	955	34	300	300	CD
10_1101-2021_01_07_425723	955	35	350	350	CD
10_1101-2021_01_07_425723	955	36	400	400	CD
10_1101-2021_01_07_425723	955	37	450	450	CD
10_1101-2021_01_07_425723	955	38	0	0	CD
10_1101-2021_01_07_425723	955	39	24	24	CD
10_1101-2021_01_07_425723	955	40	48	48	CD
10_1101-2021_01_07_425723	955	41	72	72	CD
10_1101-2021_01_07_425723	955	42	96	96	CD
10_1101-2021_01_07_425723	955	43	120	120	CD
10_1101-2021_01_07_425723	955	44	144	144	CD
10_1101-2021_01_07_425723	955	45	168	168	CD
10_1101-2021_01_07_425723	955	46	192	192	CD
10_1101-2021_01_07_425723	955	47	c	c	NN
10_1101-2021_01_07_425723	955	48	e	e	NN
10_1101-2021_01_07_425723	955	49	th	th	XX
10_1101-2021_01_07_425723	955	50	an	an	DT
10_1101-2021_01_07_425723	955	51	ol	old	FW
10_1101-2021_01_07_425723	955	52	(	(	-LRB-
10_1101-2021_01_07_425723	955	53	m	m	NNP
10_1101-2021_01_07_425723	955	54	M	M	NNP
10_1101-2021_01_07_425723	955	55	)	)	-RRB-
10_1101-2021_01_07_425723	955	56	Time	Time	NNP
10_1101-2021_01_07_425723	955	57	(	(	-LRB-
10_1101-2021_01_07_425723	955	58	h	h	NNP
10_1101-2021_01_07_425723	955	59	)	)	-RRB-
10_1101-2021_01_07_425723	955	60	.CC	.CC	NFP
10_1101-2021_01_07_425723	955	61	-	-	:
10_1101-2021_01_07_425723	955	62	BY	by	IN
10_1101-2021_01_07_425723	955	63	-	-	HYPH
10_1101-2021_01_07_425723	955	64	NC	NC	NNP
10_1101-2021_01_07_425723	955	65	-	-	HYPH
10_1101-2021_01_07_425723	955	66	ND	ND	NNP
10_1101-2021_01_07_425723	955	67	4.0	4.0	CD
10_1101-2021_01_07_425723	955	68	International	International	NNP
10_1101-2021_01_07_425723	955	69	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	955	70	under	under	IN
10_1101-2021_01_07_425723	955	71	a	a	DT
10_1101-2021_01_07_425723	955	72	(	(	-LRB-
10_1101-2021_01_07_425723	955	73	which	which	WDT
10_1101-2021_01_07_425723	955	74	was	be	VBD
10_1101-2021_01_07_425723	955	75	not	not	RB
10_1101-2021_01_07_425723	955	76	certified	certify	VBN
10_1101-2021_01_07_425723	955	77	by	by	IN
10_1101-2021_01_07_425723	955	78	peer	peer	NN
10_1101-2021_01_07_425723	955	79	review	review	NN
10_1101-2021_01_07_425723	955	80	)	)	-RRB-
10_1101-2021_01_07_425723	955	81	is	be	VBZ
10_1101-2021_01_07_425723	955	82	the	the	DT
10_1101-2021_01_07_425723	955	83	author	author	NN
10_1101-2021_01_07_425723	955	84	/	/	SYM
10_1101-2021_01_07_425723	955	85	funder	funder	NN
10_1101-2021_01_07_425723	955	86	,	,	,
10_1101-2021_01_07_425723	955	87	who	who	WP
10_1101-2021_01_07_425723	955	88	has	have	VBZ
10_1101-2021_01_07_425723	955	89	granted	grant	VBN
10_1101-2021_01_07_425723	955	90	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	955	91	a	a	DT
10_1101-2021_01_07_425723	955	92	license	license	NN
10_1101-2021_01_07_425723	955	93	to	to	TO
10_1101-2021_01_07_425723	955	94	display	display	VB
10_1101-2021_01_07_425723	955	95	the	the	DT
10_1101-2021_01_07_425723	955	96	preprint	preprint	NN
10_1101-2021_01_07_425723	955	97	in	in	IN
10_1101-2021_01_07_425723	955	98	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	955	99	.	.	.
10_1101-2021_01_07_425723	956	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	956	2	is	be	VBZ
10_1101-2021_01_07_425723	956	3	made	make	VBN
10_1101-2021_01_07_425723	956	4	The	the	DT
10_1101-2021_01_07_425723	956	5	copyright	copyright	NN
10_1101-2021_01_07_425723	956	6	holder	holder	NN
10_1101-2021_01_07_425723	956	7	for	for	IN
10_1101-2021_01_07_425723	956	8	this	this	DT
10_1101-2021_01_07_425723	956	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	956	10	version	version	NN
10_1101-2021_01_07_425723	956	11	posted	post	VBD
10_1101-2021_01_07_425723	956	12	January	January	NNP
10_1101-2021_01_07_425723	956	13	8	8	CD
10_1101-2021_01_07_425723	956	14	,	,	,
10_1101-2021_01_07_425723	956	15	2021	2021	CD
10_1101-2021_01_07_425723	956	16	.	.	.
10_1101-2021_01_07_425723	956	17	;	;	:
10_1101-2021_01_07_425723	956	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	956	19	:	:	:
10_1101-2021_01_07_425723	956	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	956	21	preprint	preprint	NN
10_1101-2021_01_07_425723	956	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	956	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	956	24	52	52	CD
10_1101-2021_01_07_425723	956	25	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	956	26	Fig	Fig	NNP
10_1101-2021_01_07_425723	956	27	.	.	.
10_1101-2021_01_07_425723	957	1	2	2	CD
10_1101-2021_01_07_425723	957	2	|	|	NNP
10_1101-2021_01_07_425723	957	3	Consensus	Consensus	NNP
10_1101-2021_01_07_425723	957	4	biological	biological	JJ
10_1101-2021_01_07_425723	957	5	process	process	NN
10_1101-2021_01_07_425723	957	6	GO	GO	NNP
10_1101-2021_01_07_425723	957	7	term	term	NN
10_1101-2021_01_07_425723	957	8	enrichment	enrichment	NN
10_1101-2021_01_07_425723	957	9	for	for	IN
10_1101-2021_01_07_425723	957	10	K.	K.	NNP
10_1101-2021_01_07_425723	957	11	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	957	12	contrast	contrast	NNP
10_1101-2021_01_07_425723	957	13	951	951	CD
10_1101-2021_01_07_425723	957	14	31	31	CD
10_1101-2021_01_07_425723	957	15	.	.	.
10_1101-2021_01_07_425723	958	1	GO	GO	NNP
10_1101-2021_01_07_425723	958	2	terms	term	NNS
10_1101-2021_01_07_425723	958	3	are	be	VBP
10_1101-2021_01_07_425723	958	4	clustered	cluster	VBN
10_1101-2021_01_07_425723	958	5	according	accord	VBG
10_1101-2021_01_07_425723	958	6	to	to	IN
10_1101-2021_01_07_425723	958	7	their	-PRON-	PRP$
10_1101-2021_01_07_425723	958	8	rank	rank	NN
10_1101-2021_01_07_425723	958	9	.	.	.
10_1101-2021_01_07_425723	959	1	See	see	VB
10_1101-2021_01_07_425723	959	2	legend	legend	NN
10_1101-2021_01_07_425723	959	3	of	of	IN
10_1101-2021_01_07_425723	959	4	Fig	Fig	NNP
10_1101-2021_01_07_425723	959	5	.	.	.
10_1101-2021_01_07_425723	960	1	2	2	CD
10_1101-2021_01_07_425723	960	2	for	for	IN
10_1101-2021_01_07_425723	960	3	experimental	experimental	JJ
10_1101-2021_01_07_425723	960	4	details	detail	NNS
10_1101-2021_01_07_425723	960	5	.	.	.
10_1101-2021_01_07_425723	961	1	952	952	CD
10_1101-2021_01_07_425723	961	2	.CC	.CC	:
10_1101-2021_01_07_425723	961	3	-	-	HYPH
10_1101-2021_01_07_425723	961	4	BY	by	IN
10_1101-2021_01_07_425723	961	5	-	-	HYPH
10_1101-2021_01_07_425723	961	6	NC	NC	NNP
10_1101-2021_01_07_425723	961	7	-	-	HYPH
10_1101-2021_01_07_425723	961	8	ND	ND	NNP
10_1101-2021_01_07_425723	961	9	4.0	4.0	CD
10_1101-2021_01_07_425723	961	10	International	International	NNP
10_1101-2021_01_07_425723	961	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	961	12	under	under	IN
10_1101-2021_01_07_425723	961	13	a	a	DT
10_1101-2021_01_07_425723	961	14	(	(	-LRB-
10_1101-2021_01_07_425723	961	15	which	which	WDT
10_1101-2021_01_07_425723	961	16	was	be	VBD
10_1101-2021_01_07_425723	961	17	not	not	RB
10_1101-2021_01_07_425723	961	18	certified	certify	VBN
10_1101-2021_01_07_425723	961	19	by	by	IN
10_1101-2021_01_07_425723	961	20	peer	peer	NN
10_1101-2021_01_07_425723	961	21	review	review	NN
10_1101-2021_01_07_425723	961	22	)	)	-RRB-
10_1101-2021_01_07_425723	961	23	is	be	VBZ
10_1101-2021_01_07_425723	961	24	the	the	DT
10_1101-2021_01_07_425723	961	25	author	author	NN
10_1101-2021_01_07_425723	961	26	/	/	SYM
10_1101-2021_01_07_425723	961	27	funder	funder	NN
10_1101-2021_01_07_425723	961	28	,	,	,
10_1101-2021_01_07_425723	961	29	who	who	WP
10_1101-2021_01_07_425723	961	30	has	have	VBZ
10_1101-2021_01_07_425723	961	31	granted	grant	VBN
10_1101-2021_01_07_425723	961	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	961	33	a	a	DT
10_1101-2021_01_07_425723	961	34	license	license	NN
10_1101-2021_01_07_425723	961	35	to	to	TO
10_1101-2021_01_07_425723	961	36	display	display	VB
10_1101-2021_01_07_425723	961	37	the	the	DT
10_1101-2021_01_07_425723	961	38	preprint	preprint	NN
10_1101-2021_01_07_425723	961	39	in	in	IN
10_1101-2021_01_07_425723	961	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	961	41	.	.	.
10_1101-2021_01_07_425723	962	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	962	2	is	be	VBZ
10_1101-2021_01_07_425723	962	3	made	make	VBN
10_1101-2021_01_07_425723	962	4	The	the	DT
10_1101-2021_01_07_425723	962	5	copyright	copyright	NN
10_1101-2021_01_07_425723	962	6	holder	holder	NN
10_1101-2021_01_07_425723	962	7	for	for	IN
10_1101-2021_01_07_425723	962	8	this	this	DT
10_1101-2021_01_07_425723	962	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	962	10	version	version	NN
10_1101-2021_01_07_425723	962	11	posted	post	VBD
10_1101-2021_01_07_425723	962	12	January	January	NNP
10_1101-2021_01_07_425723	962	13	8	8	CD
10_1101-2021_01_07_425723	962	14	,	,	,
10_1101-2021_01_07_425723	962	15	2021	2021	CD
10_1101-2021_01_07_425723	962	16	.	.	.
10_1101-2021_01_07_425723	962	17	;	;	:
10_1101-2021_01_07_425723	962	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	962	19	:	:	:
10_1101-2021_01_07_425723	962	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	962	21	preprint	preprint	NN
10_1101-2021_01_07_425723	962	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	962	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	962	24	53	53	CD
10_1101-2021_01_07_425723	962	25	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	962	26	Fig	Fig	NNP
10_1101-2021_01_07_425723	962	27	.	.	.
10_1101-2021_01_07_425723	963	1	3	3	CD
10_1101-2021_01_07_425723	963	2	|	|	NNP
10_1101-2021_01_07_425723	963	3	Consensus	Consensus	NNP
10_1101-2021_01_07_425723	963	4	biological	biological	JJ
10_1101-2021_01_07_425723	963	5	process	process	NN
10_1101-2021_01_07_425723	963	6	GO	GO	NNP
10_1101-2021_01_07_425723	963	7	term	term	NN
10_1101-2021_01_07_425723	963	8	enrichment	enrichment	NN
10_1101-2021_01_07_425723	963	9	for	for	IN
10_1101-2021_01_07_425723	963	10	K.	K.	NNP
10_1101-2021_01_07_425723	963	11	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	963	12	contrast	contrast	NN
10_1101-2021_01_07_425723	963	13	953	953	CD
10_1101-2021_01_07_425723	963	14	43	43	CD
10_1101-2021_01_07_425723	963	15	.	.	.
10_1101-2021_01_07_425723	964	1	GO	GO	NNP
10_1101-2021_01_07_425723	964	2	terms	term	NNS
10_1101-2021_01_07_425723	964	3	are	be	VBP
10_1101-2021_01_07_425723	964	4	clustered	cluster	VBN
10_1101-2021_01_07_425723	964	5	according	accord	VBG
10_1101-2021_01_07_425723	964	6	to	to	IN
10_1101-2021_01_07_425723	964	7	their	-PRON-	PRP$
10_1101-2021_01_07_425723	964	8	rank	rank	NN
10_1101-2021_01_07_425723	964	9	.	.	.
10_1101-2021_01_07_425723	965	1	See	see	VB
10_1101-2021_01_07_425723	965	2	legend	legend	NN
10_1101-2021_01_07_425723	965	3	of	of	IN
10_1101-2021_01_07_425723	965	4	Fig	Fig	NNP
10_1101-2021_01_07_425723	965	5	.	.	.
10_1101-2021_01_07_425723	966	1	2	2	CD
10_1101-2021_01_07_425723	966	2	for	for	IN
10_1101-2021_01_07_425723	966	3	experimental	experimental	JJ
10_1101-2021_01_07_425723	966	4	details	detail	NNS
10_1101-2021_01_07_425723	966	5	.	.	.
10_1101-2021_01_07_425723	967	1	954	954	CD
10_1101-2021_01_07_425723	967	2	.CC	.CC	:
10_1101-2021_01_07_425723	967	3	-	-	HYPH
10_1101-2021_01_07_425723	967	4	BY	by	IN
10_1101-2021_01_07_425723	967	5	-	-	HYPH
10_1101-2021_01_07_425723	967	6	NC	NC	NNP
10_1101-2021_01_07_425723	967	7	-	-	HYPH
10_1101-2021_01_07_425723	967	8	ND	ND	NNP
10_1101-2021_01_07_425723	967	9	4.0	4.0	CD
10_1101-2021_01_07_425723	967	10	International	International	NNP
10_1101-2021_01_07_425723	967	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	967	12	under	under	IN
10_1101-2021_01_07_425723	967	13	a	a	DT
10_1101-2021_01_07_425723	967	14	(	(	-LRB-
10_1101-2021_01_07_425723	967	15	which	which	WDT
10_1101-2021_01_07_425723	967	16	was	be	VBD
10_1101-2021_01_07_425723	967	17	not	not	RB
10_1101-2021_01_07_425723	967	18	certified	certify	VBN
10_1101-2021_01_07_425723	967	19	by	by	IN
10_1101-2021_01_07_425723	967	20	peer	peer	NN
10_1101-2021_01_07_425723	967	21	review	review	NN
10_1101-2021_01_07_425723	967	22	)	)	-RRB-
10_1101-2021_01_07_425723	967	23	is	be	VBZ
10_1101-2021_01_07_425723	967	24	the	the	DT
10_1101-2021_01_07_425723	967	25	author	author	NN
10_1101-2021_01_07_425723	967	26	/	/	SYM
10_1101-2021_01_07_425723	967	27	funder	funder	NN
10_1101-2021_01_07_425723	967	28	,	,	,
10_1101-2021_01_07_425723	967	29	who	who	WP
10_1101-2021_01_07_425723	967	30	has	have	VBZ
10_1101-2021_01_07_425723	967	31	granted	grant	VBN
10_1101-2021_01_07_425723	967	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	967	33	a	a	DT
10_1101-2021_01_07_425723	967	34	license	license	NN
10_1101-2021_01_07_425723	967	35	to	to	TO
10_1101-2021_01_07_425723	967	36	display	display	VB
10_1101-2021_01_07_425723	967	37	the	the	DT
10_1101-2021_01_07_425723	967	38	preprint	preprint	NN
10_1101-2021_01_07_425723	967	39	in	in	IN
10_1101-2021_01_07_425723	967	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	967	41	.	.	.
10_1101-2021_01_07_425723	968	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	968	2	is	be	VBZ
10_1101-2021_01_07_425723	968	3	made	make	VBN
10_1101-2021_01_07_425723	968	4	The	the	DT
10_1101-2021_01_07_425723	968	5	copyright	copyright	NN
10_1101-2021_01_07_425723	968	6	holder	holder	NN
10_1101-2021_01_07_425723	968	7	for	for	IN
10_1101-2021_01_07_425723	968	8	this	this	DT
10_1101-2021_01_07_425723	968	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	968	10	version	version	NN
10_1101-2021_01_07_425723	968	11	posted	post	VBD
10_1101-2021_01_07_425723	968	12	January	January	NNP
10_1101-2021_01_07_425723	968	13	8	8	CD
10_1101-2021_01_07_425723	968	14	,	,	,
10_1101-2021_01_07_425723	968	15	2021	2021	CD
10_1101-2021_01_07_425723	968	16	.	.	.
10_1101-2021_01_07_425723	968	17	;	;	:
10_1101-2021_01_07_425723	968	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	968	19	:	:	:
10_1101-2021_01_07_425723	968	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	968	21	preprint	preprint	NN
10_1101-2021_01_07_425723	968	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	968	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	968	24	54	54	CD
10_1101-2021_01_07_425723	968	25	955	955	CD
10_1101-2021_01_07_425723	968	26	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	968	27	Fig	Fig	NNP
10_1101-2021_01_07_425723	968	28	.	.	.
10_1101-2021_01_07_425723	969	1	4	4	CD
10_1101-2021_01_07_425723	969	2	|	|	NNP
10_1101-2021_01_07_425723	969	3	Consensus	Consensus	NNP
10_1101-2021_01_07_425723	969	4	biological	biological	JJ
10_1101-2021_01_07_425723	969	5	process	process	NN
10_1101-2021_01_07_425723	969	6	GO	GO	NNP
10_1101-2021_01_07_425723	969	7	term	term	NN
10_1101-2021_01_07_425723	969	8	enrichment	enrichment	NN
10_1101-2021_01_07_425723	969	9	for	for	IN
10_1101-2021_01_07_425723	969	10	S.	S.	NNP
10_1101-2021_01_07_425723	969	11	cerevisiae	cerevisiae	NNP
10_1101-2021_01_07_425723	969	12	contrast	contrast	NN
10_1101-2021_01_07_425723	969	13	31	31	CD
10_1101-2021_01_07_425723	969	14	.	.	.
10_1101-2021_01_07_425723	970	1	956	956	CD
10_1101-2021_01_07_425723	970	2	GO	GO	NNP
10_1101-2021_01_07_425723	970	3	terms	term	NNS
10_1101-2021_01_07_425723	970	4	are	be	VBP
10_1101-2021_01_07_425723	970	5	clustered	cluster	VBN
10_1101-2021_01_07_425723	970	6	according	accord	VBG
10_1101-2021_01_07_425723	970	7	to	to	IN
10_1101-2021_01_07_425723	970	8	their	-PRON-	PRP$
10_1101-2021_01_07_425723	970	9	rank	rank	NN
10_1101-2021_01_07_425723	970	10	.	.	.
10_1101-2021_01_07_425723	971	1	See	see	VB
10_1101-2021_01_07_425723	971	2	legend	legend	NN
10_1101-2021_01_07_425723	971	3	of	of	IN
10_1101-2021_01_07_425723	971	4	Fig	Fig	NNP
10_1101-2021_01_07_425723	971	5	.	.	.
10_1101-2021_01_07_425723	972	1	2	2	CD
10_1101-2021_01_07_425723	972	2	for	for	IN
10_1101-2021_01_07_425723	972	3	experimental	experimental	JJ
10_1101-2021_01_07_425723	972	4	details	detail	NNS
10_1101-2021_01_07_425723	972	5	.	.	.
10_1101-2021_01_07_425723	973	1	957	957	CD
10_1101-2021_01_07_425723	973	2	.CC	.CC	:
10_1101-2021_01_07_425723	973	3	-	-	HYPH
10_1101-2021_01_07_425723	973	4	BY	by	IN
10_1101-2021_01_07_425723	973	5	-	-	HYPH
10_1101-2021_01_07_425723	973	6	NC	NC	NNP
10_1101-2021_01_07_425723	973	7	-	-	HYPH
10_1101-2021_01_07_425723	973	8	ND	ND	NNP
10_1101-2021_01_07_425723	973	9	4.0	4.0	CD
10_1101-2021_01_07_425723	973	10	International	International	NNP
10_1101-2021_01_07_425723	973	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	973	12	under	under	IN
10_1101-2021_01_07_425723	973	13	a	a	DT
10_1101-2021_01_07_425723	973	14	(	(	-LRB-
10_1101-2021_01_07_425723	973	15	which	which	WDT
10_1101-2021_01_07_425723	973	16	was	be	VBD
10_1101-2021_01_07_425723	973	17	not	not	RB
10_1101-2021_01_07_425723	973	18	certified	certify	VBN
10_1101-2021_01_07_425723	973	19	by	by	IN
10_1101-2021_01_07_425723	973	20	peer	peer	NN
10_1101-2021_01_07_425723	973	21	review	review	NN
10_1101-2021_01_07_425723	973	22	)	)	-RRB-
10_1101-2021_01_07_425723	973	23	is	be	VBZ
10_1101-2021_01_07_425723	973	24	the	the	DT
10_1101-2021_01_07_425723	973	25	author	author	NN
10_1101-2021_01_07_425723	973	26	/	/	SYM
10_1101-2021_01_07_425723	973	27	funder	funder	NN
10_1101-2021_01_07_425723	973	28	,	,	,
10_1101-2021_01_07_425723	973	29	who	who	WP
10_1101-2021_01_07_425723	973	30	has	have	VBZ
10_1101-2021_01_07_425723	973	31	granted	grant	VBN
10_1101-2021_01_07_425723	973	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	973	33	a	a	DT
10_1101-2021_01_07_425723	973	34	license	license	NN
10_1101-2021_01_07_425723	973	35	to	to	TO
10_1101-2021_01_07_425723	973	36	display	display	VB
10_1101-2021_01_07_425723	973	37	the	the	DT
10_1101-2021_01_07_425723	973	38	preprint	preprint	NN
10_1101-2021_01_07_425723	973	39	in	in	IN
10_1101-2021_01_07_425723	973	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	973	41	.	.	.
10_1101-2021_01_07_425723	974	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	974	2	is	be	VBZ
10_1101-2021_01_07_425723	974	3	made	make	VBN
10_1101-2021_01_07_425723	974	4	The	the	DT
10_1101-2021_01_07_425723	974	5	copyright	copyright	NN
10_1101-2021_01_07_425723	974	6	holder	holder	NN
10_1101-2021_01_07_425723	974	7	for	for	IN
10_1101-2021_01_07_425723	974	8	this	this	DT
10_1101-2021_01_07_425723	974	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	974	10	version	version	NN
10_1101-2021_01_07_425723	974	11	posted	post	VBD
10_1101-2021_01_07_425723	974	12	January	January	NNP
10_1101-2021_01_07_425723	974	13	8	8	CD
10_1101-2021_01_07_425723	974	14	,	,	,
10_1101-2021_01_07_425723	974	15	2021	2021	CD
10_1101-2021_01_07_425723	974	16	.	.	.
10_1101-2021_01_07_425723	974	17	;	;	:
10_1101-2021_01_07_425723	974	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	974	19	:	:	:
10_1101-2021_01_07_425723	974	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	974	21	preprint	preprint	NN
10_1101-2021_01_07_425723	974	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	974	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	974	24	55	55	CD
10_1101-2021_01_07_425723	974	25	958	958	CD
10_1101-2021_01_07_425723	974	26	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	974	27	Fig	Fig	NNP
10_1101-2021_01_07_425723	974	28	.	.	.
10_1101-2021_01_07_425723	975	1	5	5	CD
10_1101-2021_01_07_425723	975	2	|	|	NNP
10_1101-2021_01_07_425723	975	3	Consensus	Consensus	NNP
10_1101-2021_01_07_425723	975	4	biological	biological	JJ
10_1101-2021_01_07_425723	975	5	process	process	NN
10_1101-2021_01_07_425723	975	6	GO	GO	NNP
10_1101-2021_01_07_425723	975	7	term	term	NN
10_1101-2021_01_07_425723	975	8	enrichment	enrichment	NN
10_1101-2021_01_07_425723	975	9	for	for	IN
10_1101-2021_01_07_425723	975	10	S.	S.	NNP
10_1101-2021_01_07_425723	975	11	cerevisiae	cerevisiae	NNP
10_1101-2021_01_07_425723	975	12	contrast	contrast	NN
10_1101-2021_01_07_425723	975	13	43	43	CD
10_1101-2021_01_07_425723	975	14	.	.	.
10_1101-2021_01_07_425723	976	1	959	959	CD
10_1101-2021_01_07_425723	976	2	GO	GO	NNP
10_1101-2021_01_07_425723	976	3	terms	term	NNS
10_1101-2021_01_07_425723	976	4	are	be	VBP
10_1101-2021_01_07_425723	976	5	clustered	cluster	VBN
10_1101-2021_01_07_425723	976	6	according	accord	VBG
10_1101-2021_01_07_425723	976	7	to	to	IN
10_1101-2021_01_07_425723	976	8	their	-PRON-	PRP$
10_1101-2021_01_07_425723	976	9	rank	rank	NN
10_1101-2021_01_07_425723	976	10	.	.	.
10_1101-2021_01_07_425723	977	1	See	see	VB
10_1101-2021_01_07_425723	977	2	legend	legend	NN
10_1101-2021_01_07_425723	977	3	of	of	IN
10_1101-2021_01_07_425723	977	4	Fig	Fig	NNP
10_1101-2021_01_07_425723	977	5	.	.	.
10_1101-2021_01_07_425723	978	1	2	2	CD
10_1101-2021_01_07_425723	978	2	for	for	IN
10_1101-2021_01_07_425723	978	3	experimental	experimental	JJ
10_1101-2021_01_07_425723	978	4	details	detail	NNS
10_1101-2021_01_07_425723	978	5	.	.	.
10_1101-2021_01_07_425723	979	1	960	960	CD
10_1101-2021_01_07_425723	979	2	.CC	.CC	:
10_1101-2021_01_07_425723	979	3	-	-	HYPH
10_1101-2021_01_07_425723	979	4	BY	by	IN
10_1101-2021_01_07_425723	979	5	-	-	HYPH
10_1101-2021_01_07_425723	979	6	NC	NC	NNP
10_1101-2021_01_07_425723	979	7	-	-	HYPH
10_1101-2021_01_07_425723	979	8	ND	ND	NNP
10_1101-2021_01_07_425723	979	9	4.0	4.0	CD
10_1101-2021_01_07_425723	979	10	International	International	NNP
10_1101-2021_01_07_425723	979	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	979	12	under	under	IN
10_1101-2021_01_07_425723	979	13	a	a	DT
10_1101-2021_01_07_425723	979	14	(	(	-LRB-
10_1101-2021_01_07_425723	979	15	which	which	WDT
10_1101-2021_01_07_425723	979	16	was	be	VBD
10_1101-2021_01_07_425723	979	17	not	not	RB
10_1101-2021_01_07_425723	979	18	certified	certify	VBN
10_1101-2021_01_07_425723	979	19	by	by	IN
10_1101-2021_01_07_425723	979	20	peer	peer	NN
10_1101-2021_01_07_425723	979	21	review	review	NN
10_1101-2021_01_07_425723	979	22	)	)	-RRB-
10_1101-2021_01_07_425723	979	23	is	be	VBZ
10_1101-2021_01_07_425723	979	24	the	the	DT
10_1101-2021_01_07_425723	979	25	author	author	NN
10_1101-2021_01_07_425723	979	26	/	/	SYM
10_1101-2021_01_07_425723	979	27	funder	funder	NN
10_1101-2021_01_07_425723	979	28	,	,	,
10_1101-2021_01_07_425723	979	29	who	who	WP
10_1101-2021_01_07_425723	979	30	has	have	VBZ
10_1101-2021_01_07_425723	979	31	granted	grant	VBN
10_1101-2021_01_07_425723	979	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	979	33	a	a	DT
10_1101-2021_01_07_425723	979	34	license	license	NN
10_1101-2021_01_07_425723	979	35	to	to	TO
10_1101-2021_01_07_425723	979	36	display	display	VB
10_1101-2021_01_07_425723	979	37	the	the	DT
10_1101-2021_01_07_425723	979	38	preprint	preprint	NN
10_1101-2021_01_07_425723	979	39	in	in	IN
10_1101-2021_01_07_425723	979	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	979	41	.	.	.
10_1101-2021_01_07_425723	980	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	980	2	is	be	VBZ
10_1101-2021_01_07_425723	980	3	made	make	VBN
10_1101-2021_01_07_425723	980	4	The	the	DT
10_1101-2021_01_07_425723	980	5	copyright	copyright	NN
10_1101-2021_01_07_425723	980	6	holder	holder	NN
10_1101-2021_01_07_425723	980	7	for	for	IN
10_1101-2021_01_07_425723	980	8	this	this	DT
10_1101-2021_01_07_425723	980	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	980	10	version	version	NN
10_1101-2021_01_07_425723	980	11	posted	post	VBD
10_1101-2021_01_07_425723	980	12	January	January	NNP
10_1101-2021_01_07_425723	980	13	8	8	CD
10_1101-2021_01_07_425723	980	14	,	,	,
10_1101-2021_01_07_425723	980	15	2021	2021	CD
10_1101-2021_01_07_425723	980	16	.	.	.
10_1101-2021_01_07_425723	980	17	;	;	:
10_1101-2021_01_07_425723	980	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	980	19	:	:	:
10_1101-2021_01_07_425723	980	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	980	21	preprint	preprint	NN
10_1101-2021_01_07_425723	980	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	980	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	980	24	56	56	CD
10_1101-2021_01_07_425723	980	25	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	980	26	Fig	Fig	NNP
10_1101-2021_01_07_425723	980	27	.	.	.
10_1101-2021_01_07_425723	981	1	6	6	CD
10_1101-2021_01_07_425723	981	2	|	|	CD
10_1101-2021_01_07_425723	981	3	GO	GO	NNP
10_1101-2021_01_07_425723	981	4	term	term	NN
10_1101-2021_01_07_425723	981	5	enrichment	enrichment	NN
10_1101-2021_01_07_425723	981	6	comparison	comparison	NN
10_1101-2021_01_07_425723	981	7	of	of	IN
10_1101-2021_01_07_425723	981	8	biological	biological	JJ
10_1101-2021_01_07_425723	981	9	process	process	NN
10_1101-2021_01_07_425723	981	10	of	of	IN
10_1101-2021_01_07_425723	981	11	K.	K.	NNP
10_1101-2021_01_07_425723	981	12	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	981	13	(	(	-LRB-
10_1101-2021_01_07_425723	981	14	kmar	kmar	NNP
10_1101-2021_01_07_425723	981	15	)	)	-RRB-
10_1101-2021_01_07_425723	981	16	961	961	CD
10_1101-2021_01_07_425723	981	17	to	to	IN
10_1101-2021_01_07_425723	981	18	S.	S.	NNP
10_1101-2021_01_07_425723	981	19	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	981	20	(	(	-LRB-
10_1101-2021_01_07_425723	981	21	scer	scer	NN
10_1101-2021_01_07_425723	981	22	)	)	-RRB-
10_1101-2021_01_07_425723	981	23	of	of	IN
10_1101-2021_01_07_425723	981	24	contrast	contrast	NN
10_1101-2021_01_07_425723	981	25	43	43	CD
10_1101-2021_01_07_425723	981	26	.	.	.
10_1101-2021_01_07_425723	982	1	GO	GO	NNP
10_1101-2021_01_07_425723	982	2	terms	term	NNS
10_1101-2021_01_07_425723	982	3	were	be	VBD
10_1101-2021_01_07_425723	982	4	annotated	annotate	VBN
10_1101-2021_01_07_425723	982	5	with	with	IN
10_1101-2021_01_07_425723	982	6	the	the	DT
10_1101-2021_01_07_425723	982	7	color	color	NN
10_1101-2021_01_07_425723	982	8	of	of	IN
10_1101-2021_01_07_425723	982	9	distinct	distinct	JJ
10_1101-2021_01_07_425723	982	10	directionality	directionality	NN
10_1101-2021_01_07_425723	982	11	962	962	CD
10_1101-2021_01_07_425723	982	12	(	(	-LRB-
10_1101-2021_01_07_425723	982	13	up	up	IN
10_1101-2021_01_07_425723	982	14	(	(	-LRB-
10_1101-2021_01_07_425723	982	15	blue	blue	NNP
10_1101-2021_01_07_425723	982	16	)	)	-RRB-
10_1101-2021_01_07_425723	982	17	down	down	IN
10_1101-2021_01_07_425723	982	18	(	(	-LRB-
10_1101-2021_01_07_425723	982	19	brown	brown	NNP
10_1101-2021_01_07_425723	982	20	)	)	-RRB-
10_1101-2021_01_07_425723	982	21	)	)	-RRB-
10_1101-2021_01_07_425723	982	22	and	and	CC
10_1101-2021_01_07_425723	982	23	the	the	DT
10_1101-2021_01_07_425723	982	24	color	color	NN
10_1101-2021_01_07_425723	982	25	intensity	intensity	NN
10_1101-2021_01_07_425723	982	26	was	be	VBD
10_1101-2021_01_07_425723	982	27	determined	determine	VBN
10_1101-2021_01_07_425723	982	28	by	by	IN
10_1101-2021_01_07_425723	982	29	the	the	DT
10_1101-2021_01_07_425723	982	30	magnitude	magnitude	NN
10_1101-2021_01_07_425723	982	31	of	of	IN
10_1101-2021_01_07_425723	982	32	the	the	DT
10_1101-2021_01_07_425723	982	33	inverse	inverse	NN
10_1101-2021_01_07_425723	982	34	rank	rank	NN
10_1101-2021_01_07_425723	982	35	.	.	.
10_1101-2021_01_07_425723	983	1	963	963	CD
10_1101-2021_01_07_425723	983	2	GO	GO	NNP
10_1101-2021_01_07_425723	983	3	terms	term	NNS
10_1101-2021_01_07_425723	983	4	with	with	IN
10_1101-2021_01_07_425723	983	5	significant	significant	JJ
10_1101-2021_01_07_425723	983	6	mixed	mixed	JJ
10_1101-2021_01_07_425723	983	7	-	-	HYPH
10_1101-2021_01_07_425723	983	8	directionality	directionality	NN
10_1101-2021_01_07_425723	983	9	or	or	CC
10_1101-2021_01_07_425723	983	10	non	non	NN
10_1101-2021_01_07_425723	983	11	-	-	JJ
10_1101-2021_01_07_425723	983	12	directionality	directionality	JJ
10_1101-2021_01_07_425723	983	13	,	,	,
10_1101-2021_01_07_425723	983	14	as	as	IN
10_1101-2021_01_07_425723	983	15	having	have	VBG
10_1101-2021_01_07_425723	983	16	no	no	DT
10_1101-2021_01_07_425723	983	17	pronounced	pronounce	VBN
10_1101-2021_01_07_425723	983	18	distinct	distinct	JJ
10_1101-2021_01_07_425723	983	19	964	964	CD
10_1101-2021_01_07_425723	983	20	directionality	directionality	NN
10_1101-2021_01_07_425723	983	21	,	,	,
10_1101-2021_01_07_425723	983	22	are	be	VBP
10_1101-2021_01_07_425723	983	23	colored	color	VBN
10_1101-2021_01_07_425723	983	24	white	white	JJ
10_1101-2021_01_07_425723	983	25	.	.	.
10_1101-2021_01_07_425723	984	1	Shared	share	VBN
10_1101-2021_01_07_425723	984	2	GO	GO	NNP
10_1101-2021_01_07_425723	984	3	terms	term	NNS
10_1101-2021_01_07_425723	984	4	between	between	IN
10_1101-2021_01_07_425723	984	5	K.	K.	NNP
10_1101-2021_01_07_425723	984	6	marxianus	marxianus	NN
10_1101-2021_01_07_425723	984	7	and	and	CC
10_1101-2021_01_07_425723	984	8	S.	S.	NNP
10_1101-2021_01_07_425723	984	9	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	984	10	are	be	VBP
10_1101-2021_01_07_425723	984	11	965	965	CD
10_1101-2021_01_07_425723	984	12	connected	connect	VBN
10_1101-2021_01_07_425723	984	13	by	by	IN
10_1101-2021_01_07_425723	984	14	a	a	DT
10_1101-2021_01_07_425723	984	15	line.966	line.966	ADD
10_1101-2021_01_07_425723	984	16	.CC	.CC	:
10_1101-2021_01_07_425723	984	17	-	-	HYPH
10_1101-2021_01_07_425723	984	18	BY	by	IN
10_1101-2021_01_07_425723	984	19	-	-	HYPH
10_1101-2021_01_07_425723	984	20	NC	NC	NNP
10_1101-2021_01_07_425723	984	21	-	-	HYPH
10_1101-2021_01_07_425723	984	22	ND	ND	NNP
10_1101-2021_01_07_425723	984	23	4.0	4.0	CD
10_1101-2021_01_07_425723	984	24	International	International	NNP
10_1101-2021_01_07_425723	984	25	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	984	26	under	under	IN
10_1101-2021_01_07_425723	984	27	a	a	DT
10_1101-2021_01_07_425723	984	28	(	(	-LRB-
10_1101-2021_01_07_425723	984	29	which	which	WDT
10_1101-2021_01_07_425723	984	30	was	be	VBD
10_1101-2021_01_07_425723	984	31	not	not	RB
10_1101-2021_01_07_425723	984	32	certified	certify	VBN
10_1101-2021_01_07_425723	984	33	by	by	IN
10_1101-2021_01_07_425723	984	34	peer	peer	NN
10_1101-2021_01_07_425723	984	35	review	review	NN
10_1101-2021_01_07_425723	984	36	)	)	-RRB-
10_1101-2021_01_07_425723	984	37	is	be	VBZ
10_1101-2021_01_07_425723	984	38	the	the	DT
10_1101-2021_01_07_425723	984	39	author	author	NN
10_1101-2021_01_07_425723	984	40	/	/	SYM
10_1101-2021_01_07_425723	984	41	funder	funder	NN
10_1101-2021_01_07_425723	984	42	,	,	,
10_1101-2021_01_07_425723	984	43	who	who	WP
10_1101-2021_01_07_425723	984	44	has	have	VBZ
10_1101-2021_01_07_425723	984	45	granted	grant	VBN
10_1101-2021_01_07_425723	984	46	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	984	47	a	a	DT
10_1101-2021_01_07_425723	984	48	license	license	NN
10_1101-2021_01_07_425723	984	49	to	to	TO
10_1101-2021_01_07_425723	984	50	display	display	VB
10_1101-2021_01_07_425723	984	51	the	the	DT
10_1101-2021_01_07_425723	984	52	preprint	preprint	NN
10_1101-2021_01_07_425723	984	53	in	in	IN
10_1101-2021_01_07_425723	984	54	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	984	55	.	.	.
10_1101-2021_01_07_425723	985	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	985	2	is	be	VBZ
10_1101-2021_01_07_425723	985	3	made	make	VBN
10_1101-2021_01_07_425723	985	4	The	the	DT
10_1101-2021_01_07_425723	985	5	copyright	copyright	NN
10_1101-2021_01_07_425723	985	6	holder	holder	NN
10_1101-2021_01_07_425723	985	7	for	for	IN
10_1101-2021_01_07_425723	985	8	this	this	DT
10_1101-2021_01_07_425723	985	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	985	10	version	version	NN
10_1101-2021_01_07_425723	985	11	posted	post	VBD
10_1101-2021_01_07_425723	985	12	January	January	NNP
10_1101-2021_01_07_425723	985	13	8	8	CD
10_1101-2021_01_07_425723	985	14	,	,	,
10_1101-2021_01_07_425723	985	15	2021	2021	CD
10_1101-2021_01_07_425723	985	16	.	.	.
10_1101-2021_01_07_425723	985	17	;	;	:
10_1101-2021_01_07_425723	985	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	985	19	:	:	:
10_1101-2021_01_07_425723	985	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	985	21	preprint	preprint	NN
10_1101-2021_01_07_425723	985	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	985	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	985	24	57	57	CD
10_1101-2021_01_07_425723	985	25	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	985	26	Fig	Fig	NNP
10_1101-2021_01_07_425723	985	27	.	.	.
10_1101-2021_01_07_425723	986	1	7	7	CD
10_1101-2021_01_07_425723	986	2	|	|	NNP
10_1101-2021_01_07_425723	986	3	Uptake	Uptake	NNP
10_1101-2021_01_07_425723	986	4	of	of	IN
10_1101-2021_01_07_425723	986	5	the	the	DT
10_1101-2021_01_07_425723	986	6	fluorescent	fluorescent	NN
10_1101-2021_01_07_425723	986	7	sterol	sterol	NN
10_1101-2021_01_07_425723	986	8	derivative	derivative	JJ
10_1101-2021_01_07_425723	986	9	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	986	10	by	by	IN
10_1101-2021_01_07_425723	986	11	S.	S.	NNP
10_1101-2021_01_07_425723	986	12	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	986	13	and	and	CC
10_1101-2021_01_07_425723	986	14	K.	K.	NNP
10_1101-2021_01_07_425723	986	15	967	967	CD
10_1101-2021_01_07_425723	986	16	marxianus	marxianus	NN
10_1101-2021_01_07_425723	986	17	strains	strain	VBZ
10_1101-2021_01_07_425723	986	18	after	after	IN
10_1101-2021_01_07_425723	986	19	23	23	CD
10_1101-2021_01_07_425723	986	20	h	h	NN
10_1101-2021_01_07_425723	986	21	staining	staining	NN
10_1101-2021_01_07_425723	986	22	.	.	.
10_1101-2021_01_07_425723	987	1	968	968	CD
10_1101-2021_01_07_425723	987	2	Flow	Flow	NNP
10_1101-2021_01_07_425723	987	3	cytometry	cytometry	NN
10_1101-2021_01_07_425723	987	4	data	datum	NNS
10_1101-2021_01_07_425723	987	5	of	of	IN
10_1101-2021_01_07_425723	987	6	Fig	Fig	NNP
10_1101-2021_01_07_425723	987	7	.	.	.
10_1101-2021_01_07_425723	988	1	4	4	CD
10_1101-2021_01_07_425723	988	2	with	with	IN
10_1101-2021_01_07_425723	988	3	prolonged	prolong	VBN
10_1101-2021_01_07_425723	988	4	staining	staining	NN
10_1101-2021_01_07_425723	988	5	after	after	IN
10_1101-2021_01_07_425723	988	6	pulse	pulse	NN
10_1101-2021_01_07_425723	988	7	-	-	HYPH
10_1101-2021_01_07_425723	988	8	addition	addition	NN
10_1101-2021_01_07_425723	988	9	of	of	IN
10_1101-2021_01_07_425723	988	10	NBD	NBD	NNP
10_1101-2021_01_07_425723	988	11	-	-	HYPH
10_1101-2021_01_07_425723	988	12	cholesterol	cholesterol	NN
10_1101-2021_01_07_425723	988	13	to	to	IN
10_1101-2021_01_07_425723	988	14	the	the	DT
10_1101-2021_01_07_425723	988	15	969	969	CD
10_1101-2021_01_07_425723	988	16	shake	shake	NN
10_1101-2021_01_07_425723	988	17	-	-	HYPH
10_1101-2021_01_07_425723	988	18	flask	flask	NN
10_1101-2021_01_07_425723	988	19	cultures	culture	NNS
10_1101-2021_01_07_425723	988	20	for	for	IN
10_1101-2021_01_07_425723	988	21	23	23	CD
10_1101-2021_01_07_425723	988	22	h.	h.	NNS
10_1101-2021_01_07_425723	988	23	Bar	bar	VB
10_1101-2021_01_07_425723	988	24	charts	chart	NNS
10_1101-2021_01_07_425723	988	25	of	of	IN
10_1101-2021_01_07_425723	988	26	the	the	DT
10_1101-2021_01_07_425723	988	27	median	median	JJ
10_1101-2021_01_07_425723	988	28	and	and	CC
10_1101-2021_01_07_425723	988	29	pooled	pool	VBN
10_1101-2021_01_07_425723	988	30	standard	standard	JJ
10_1101-2021_01_07_425723	988	31	deviation	deviation	NN
10_1101-2021_01_07_425723	988	32	of	of	IN
10_1101-2021_01_07_425723	988	33	the	the	DT
10_1101-2021_01_07_425723	988	34	NBD-970	NBD-970	NNP
10_1101-2021_01_07_425723	988	35	cholesterol	cholesterol	NN
10_1101-2021_01_07_425723	988	36	fluorescence	fluorescence	NN
10_1101-2021_01_07_425723	988	37	intensity	intensity	NN
10_1101-2021_01_07_425723	988	38	of	of	IN
10_1101-2021_01_07_425723	988	39	PI	pi	NN
10_1101-2021_01_07_425723	988	40	-	-	HYPH
10_1101-2021_01_07_425723	988	41	negative	negative	JJ
10_1101-2021_01_07_425723	988	42	cells	cell	NNS
10_1101-2021_01_07_425723	988	43	with	with	IN
10_1101-2021_01_07_425723	988	44	pooled	pool	VBN
10_1101-2021_01_07_425723	988	45	variance	variance	NN
10_1101-2021_01_07_425723	988	46	from	from	IN
10_1101-2021_01_07_425723	988	47	the	the	DT
10_1101-2021_01_07_425723	988	48	biological	biological	JJ
10_1101-2021_01_07_425723	988	49	replicate	replicate	VB
10_1101-2021_01_07_425723	988	50	971	971	CD
10_1101-2021_01_07_425723	988	51	cultures	culture	NNS
10_1101-2021_01_07_425723	988	52	.	.	.
10_1101-2021_01_07_425723	989	1	See	see	VB
10_1101-2021_01_07_425723	989	2	legend	legend	NN
10_1101-2021_01_07_425723	989	3	Fig	Fig	NNP
10_1101-2021_01_07_425723	989	4	.	.	.
10_1101-2021_01_07_425723	990	1	4	4	CD
10_1101-2021_01_07_425723	990	2	for	for	IN
10_1101-2021_01_07_425723	990	3	experimental	experimental	JJ
10_1101-2021_01_07_425723	990	4	details	detail	NNS
10_1101-2021_01_07_425723	990	5	.	.	.
10_1101-2021_01_07_425723	991	1	972	972	CD
10_1101-2021_01_07_425723	991	2	.CC	.CC	NFP
10_1101-2021_01_07_425723	991	3	-	-	HYPH
10_1101-2021_01_07_425723	991	4	BY	by	IN
10_1101-2021_01_07_425723	991	5	-	-	HYPH
10_1101-2021_01_07_425723	991	6	NC	NC	NNP
10_1101-2021_01_07_425723	991	7	-	-	HYPH
10_1101-2021_01_07_425723	991	8	ND	ND	NNP
10_1101-2021_01_07_425723	991	9	4.0	4.0	CD
10_1101-2021_01_07_425723	991	10	International	International	NNP
10_1101-2021_01_07_425723	991	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	991	12	under	under	IN
10_1101-2021_01_07_425723	991	13	a	a	DT
10_1101-2021_01_07_425723	991	14	(	(	-LRB-
10_1101-2021_01_07_425723	991	15	which	which	WDT
10_1101-2021_01_07_425723	991	16	was	be	VBD
10_1101-2021_01_07_425723	991	17	not	not	RB
10_1101-2021_01_07_425723	991	18	certified	certify	VBN
10_1101-2021_01_07_425723	991	19	by	by	IN
10_1101-2021_01_07_425723	991	20	peer	peer	NN
10_1101-2021_01_07_425723	991	21	review	review	NN
10_1101-2021_01_07_425723	991	22	)	)	-RRB-
10_1101-2021_01_07_425723	991	23	is	be	VBZ
10_1101-2021_01_07_425723	991	24	the	the	DT
10_1101-2021_01_07_425723	991	25	author	author	NN
10_1101-2021_01_07_425723	991	26	/	/	SYM
10_1101-2021_01_07_425723	991	27	funder	funder	NN
10_1101-2021_01_07_425723	991	28	,	,	,
10_1101-2021_01_07_425723	991	29	who	who	WP
10_1101-2021_01_07_425723	991	30	has	have	VBZ
10_1101-2021_01_07_425723	991	31	granted	grant	VBN
10_1101-2021_01_07_425723	991	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	991	33	a	a	DT
10_1101-2021_01_07_425723	991	34	license	license	NN
10_1101-2021_01_07_425723	991	35	to	to	TO
10_1101-2021_01_07_425723	991	36	display	display	VB
10_1101-2021_01_07_425723	991	37	the	the	DT
10_1101-2021_01_07_425723	991	38	preprint	preprint	NN
10_1101-2021_01_07_425723	991	39	in	in	IN
10_1101-2021_01_07_425723	991	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	991	41	.	.	.
10_1101-2021_01_07_425723	992	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	992	2	is	be	VBZ
10_1101-2021_01_07_425723	992	3	made	make	VBN
10_1101-2021_01_07_425723	992	4	The	the	DT
10_1101-2021_01_07_425723	992	5	copyright	copyright	NN
10_1101-2021_01_07_425723	992	6	holder	holder	NN
10_1101-2021_01_07_425723	992	7	for	for	IN
10_1101-2021_01_07_425723	992	8	this	this	DT
10_1101-2021_01_07_425723	992	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	992	10	version	version	NN
10_1101-2021_01_07_425723	992	11	posted	post	VBD
10_1101-2021_01_07_425723	992	12	January	January	NNP
10_1101-2021_01_07_425723	992	13	8	8	CD
10_1101-2021_01_07_425723	992	14	,	,	,
10_1101-2021_01_07_425723	992	15	2021	2021	CD
10_1101-2021_01_07_425723	992	16	.	.	.
10_1101-2021_01_07_425723	992	17	;	;	:
10_1101-2021_01_07_425723	992	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	992	19	:	:	:
10_1101-2021_01_07_425723	992	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	992	21	preprint	preprint	NN
10_1101-2021_01_07_425723	992	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	992	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	RB
10_1101-2021_01_07_425723	992	24	58	58	CD
10_1101-2021_01_07_425723	992	25	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	992	26	Fig	Fig	NNP
10_1101-2021_01_07_425723	992	27	.	.	.
10_1101-2021_01_07_425723	993	1	8	8	CD
10_1101-2021_01_07_425723	993	2	|	|	CD
10_1101-2021_01_07_425723	993	3	Flow	Flow	NNP
10_1101-2021_01_07_425723	993	4	cytometry	cytometry	NN
10_1101-2021_01_07_425723	993	5	gating	gate	VBG
10_1101-2021_01_07_425723	993	6	strategy	strategy	NN
10_1101-2021_01_07_425723	993	7	of	of	IN
10_1101-2021_01_07_425723	993	8	both	both	DT
10_1101-2021_01_07_425723	993	9	K.	K.	NNP
10_1101-2021_01_07_425723	993	10	marxianus	marxianus	NN
10_1101-2021_01_07_425723	993	11	(	(	-LRB-
10_1101-2021_01_07_425723	993	12	left	leave	VBD
10_1101-2021_01_07_425723	993	13	panel	panel	NN
10_1101-2021_01_07_425723	993	14	)	)	-RRB-
10_1101-2021_01_07_425723	993	15	and	and	CC
10_1101-2021_01_07_425723	993	16	S.	S.	NNP
10_1101-2021_01_07_425723	993	17	973	973	CD
10_1101-2021_01_07_425723	993	18	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	993	19	(	(	-LRB-
10_1101-2021_01_07_425723	993	20	right	right	JJ
10_1101-2021_01_07_425723	993	21	panel	panel	NN
10_1101-2021_01_07_425723	993	22	)	)	-RRB-
10_1101-2021_01_07_425723	993	23	samples	sample	NNS
10_1101-2021_01_07_425723	993	24	.	.	.
10_1101-2021_01_07_425723	994	1	Gates	gate	NNS
10_1101-2021_01_07_425723	994	2	were	be	VBD
10_1101-2021_01_07_425723	994	3	set	set	VBN
10_1101-2021_01_07_425723	994	4	per	per	IN
10_1101-2021_01_07_425723	994	5	one	one	CD
10_1101-2021_01_07_425723	994	6	species	specie	NNS
10_1101-2021_01_07_425723	994	7	for	for	IN
10_1101-2021_01_07_425723	994	8	all	all	DT
10_1101-2021_01_07_425723	994	9	samples	sample	NNS
10_1101-2021_01_07_425723	994	10	independent	independent	JJ
10_1101-2021_01_07_425723	994	11	of	of	IN
10_1101-2021_01_07_425723	994	12	NBDC	NBDC	NNP
10_1101-2021_01_07_425723	994	13	974	974	CD
10_1101-2021_01_07_425723	994	14	staining	staining	NN
10_1101-2021_01_07_425723	994	15	.	.	.
10_1101-2021_01_07_425723	995	1	Density	density	NN
10_1101-2021_01_07_425723	995	2	of	of	IN
10_1101-2021_01_07_425723	995	3	events	event	NNS
10_1101-2021_01_07_425723	995	4	were	be	VBD
10_1101-2021_01_07_425723	995	5	calculated	calculate	VBN
10_1101-2021_01_07_425723	995	6	by	by	IN
10_1101-2021_01_07_425723	995	7	FlowJo	flowjo	DT
10_1101-2021_01_07_425723	995	8	software	software	NN
10_1101-2021_01_07_425723	995	9	and	and	CC
10_1101-2021_01_07_425723	995	10	represented	represent	VBD
10_1101-2021_01_07_425723	995	11	in	in	IN
10_1101-2021_01_07_425723	995	12	pseudo	pseudo	NN
10_1101-2021_01_07_425723	995	13	-	-	NN
10_1101-2021_01_07_425723	995	14	color	color	NN
10_1101-2021_01_07_425723	995	15	(	(	-LRB-
10_1101-2021_01_07_425723	995	16	blue	blue	JJ
10_1101-2021_01_07_425723	995	17	975	975	CD
10_1101-2021_01_07_425723	995	18	low	low	JJ
10_1101-2021_01_07_425723	995	19	density	density	NN
10_1101-2021_01_07_425723	995	20	,	,	,
10_1101-2021_01_07_425723	995	21	red	red	JJ
10_1101-2021_01_07_425723	995	22	high	high	JJ
10_1101-2021_01_07_425723	995	23	-	-	HYPH
10_1101-2021_01_07_425723	995	24	density	density	NN
10_1101-2021_01_07_425723	995	25	)	)	-RRB-
10_1101-2021_01_07_425723	995	26	.	.	.
10_1101-2021_01_07_425723	996	1	The	the	DT
10_1101-2021_01_07_425723	996	2	gate	gate	NN
10_1101-2021_01_07_425723	996	3	between	between	IN
10_1101-2021_01_07_425723	996	4	PI	pi	NN
10_1101-2021_01_07_425723	996	5	-	-	HYPH
10_1101-2021_01_07_425723	996	6	negative	negative	JJ
10_1101-2021_01_07_425723	996	7	and	and	CC
10_1101-2021_01_07_425723	996	8	PI	pi	NN
10_1101-2021_01_07_425723	996	9	-	-	HYPH
10_1101-2021_01_07_425723	996	10	positive	positive	JJ
10_1101-2021_01_07_425723	996	11	was	be	VBD
10_1101-2021_01_07_425723	996	12	inside	inside	IN
10_1101-2021_01_07_425723	996	13	the	the	DT
10_1101-2021_01_07_425723	996	14	“	"	``
10_1101-2021_01_07_425723	996	15	Cells	Cells	NNPS
10_1101-2021_01_07_425723	996	16	”	"	''
10_1101-2021_01_07_425723	996	17	976	976	CD
10_1101-2021_01_07_425723	996	18	gated	gate	VBN
10_1101-2021_01_07_425723	996	19	-	-	HYPH
10_1101-2021_01_07_425723	996	20	population	population	NN
10_1101-2021_01_07_425723	996	21	.	.	.
10_1101-2021_01_07_425723	997	1	977	977	CD
10_1101-2021_01_07_425723	997	2	.CC	.CC	:
10_1101-2021_01_07_425723	997	3	-	-	HYPH
10_1101-2021_01_07_425723	997	4	BY	by	IN
10_1101-2021_01_07_425723	997	5	-	-	HYPH
10_1101-2021_01_07_425723	997	6	NC	NC	NNP
10_1101-2021_01_07_425723	997	7	-	-	HYPH
10_1101-2021_01_07_425723	997	8	ND	ND	NNP
10_1101-2021_01_07_425723	997	9	4.0	4.0	CD
10_1101-2021_01_07_425723	997	10	International	International	NNP
10_1101-2021_01_07_425723	997	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	997	12	under	under	IN
10_1101-2021_01_07_425723	997	13	a	a	DT
10_1101-2021_01_07_425723	997	14	(	(	-LRB-
10_1101-2021_01_07_425723	997	15	which	which	WDT
10_1101-2021_01_07_425723	997	16	was	be	VBD
10_1101-2021_01_07_425723	997	17	not	not	RB
10_1101-2021_01_07_425723	997	18	certified	certify	VBN
10_1101-2021_01_07_425723	997	19	by	by	IN
10_1101-2021_01_07_425723	997	20	peer	peer	NN
10_1101-2021_01_07_425723	997	21	review	review	NN
10_1101-2021_01_07_425723	997	22	)	)	-RRB-
10_1101-2021_01_07_425723	997	23	is	be	VBZ
10_1101-2021_01_07_425723	997	24	the	the	DT
10_1101-2021_01_07_425723	997	25	author	author	NN
10_1101-2021_01_07_425723	997	26	/	/	SYM
10_1101-2021_01_07_425723	997	27	funder	funder	NN
10_1101-2021_01_07_425723	997	28	,	,	,
10_1101-2021_01_07_425723	997	29	who	who	WP
10_1101-2021_01_07_425723	997	30	has	have	VBZ
10_1101-2021_01_07_425723	997	31	granted	grant	VBN
10_1101-2021_01_07_425723	997	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	997	33	a	a	DT
10_1101-2021_01_07_425723	997	34	license	license	NN
10_1101-2021_01_07_425723	997	35	to	to	TO
10_1101-2021_01_07_425723	997	36	display	display	VB
10_1101-2021_01_07_425723	997	37	the	the	DT
10_1101-2021_01_07_425723	997	38	preprint	preprint	NN
10_1101-2021_01_07_425723	997	39	in	in	IN
10_1101-2021_01_07_425723	997	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	997	41	.	.	.
10_1101-2021_01_07_425723	998	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	998	2	is	be	VBZ
10_1101-2021_01_07_425723	998	3	made	make	VBN
10_1101-2021_01_07_425723	998	4	The	the	DT
10_1101-2021_01_07_425723	998	5	copyright	copyright	NN
10_1101-2021_01_07_425723	998	6	holder	holder	NN
10_1101-2021_01_07_425723	998	7	for	for	IN
10_1101-2021_01_07_425723	998	8	this	this	DT
10_1101-2021_01_07_425723	998	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	998	10	version	version	NN
10_1101-2021_01_07_425723	998	11	posted	post	VBD
10_1101-2021_01_07_425723	998	12	January	January	NNP
10_1101-2021_01_07_425723	998	13	8	8	CD
10_1101-2021_01_07_425723	998	14	,	,	,
10_1101-2021_01_07_425723	998	15	2021	2021	CD
10_1101-2021_01_07_425723	998	16	.	.	.
10_1101-2021_01_07_425723	998	17	;	;	:
10_1101-2021_01_07_425723	998	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	998	19	:	:	:
10_1101-2021_01_07_425723	998	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	998	21	preprint	preprint	NN
10_1101-2021_01_07_425723	998	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	998	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	998	24	59	59	CD
10_1101-2021_01_07_425723	998	25	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	998	26	Fig	Fig	NNP
10_1101-2021_01_07_425723	998	27	.	.	.
10_1101-2021_01_07_425723	999	1	9	9	CD
10_1101-2021_01_07_425723	999	2	|	|	NNP
10_1101-2021_01_07_425723	999	3	Cross	cross	NN
10_1101-2021_01_07_425723	999	4	-	-	NN
10_1101-2021_01_07_425723	999	5	validation	validation	NN
10_1101-2021_01_07_425723	999	6	of	of	IN
10_1101-2021_01_07_425723	999	7	oxygen	oxygen	NN
10_1101-2021_01_07_425723	999	8	-	-	HYPH
10_1101-2021_01_07_425723	999	9	limited	limit	VBN
10_1101-2021_01_07_425723	999	10	and	and	CC
10_1101-2021_01_07_425723	999	11	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	999	12	growth	growth	NN
10_1101-2021_01_07_425723	999	13	of	of	IN
10_1101-2021_01_07_425723	999	14	K.	K.	NNP
10_1101-2021_01_07_425723	999	15	marxianus	marxianus	NNP
10_1101-2021_01_07_425723	999	16	978	978	CD
10_1101-2021_01_07_425723	999	17	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	999	18	.	.	.
10_1101-2021_01_07_425723	1000	1	Strains	strain	NNS
10_1101-2021_01_07_425723	1000	2	were	be	VBD
10_1101-2021_01_07_425723	1000	3	grown	grow	VBN
10_1101-2021_01_07_425723	1000	4	in	in	IN
10_1101-2021_01_07_425723	1000	5	shake	shake	NN
10_1101-2021_01_07_425723	1000	6	-	-	HYPH
10_1101-2021_01_07_425723	1000	7	flask	flask	NN
10_1101-2021_01_07_425723	1000	8	cultures	culture	NNS
10_1101-2021_01_07_425723	1000	9	in	in	IN
10_1101-2021_01_07_425723	1000	10	an	an	DT
10_1101-2021_01_07_425723	1000	11	oxygen	oxygen	NN
10_1101-2021_01_07_425723	1000	12	-	-	HYPH
10_1101-2021_01_07_425723	1000	13	limited	limit	VBN
10_1101-2021_01_07_425723	1000	14	(	(	-LRB-
10_1101-2021_01_07_425723	1000	15	a	a	LS
10_1101-2021_01_07_425723	1000	16	)	)	-RRB-
10_1101-2021_01_07_425723	1000	17	and	and	CC
10_1101-2021_01_07_425723	1000	18	strict	strict	JJ
10_1101-2021_01_07_425723	1000	19	anaerobic	anaerobic	NN
10_1101-2021_01_07_425723	1000	20	979	979	CD
10_1101-2021_01_07_425723	1000	21	environment	environment	NN
10_1101-2021_01_07_425723	1000	22	(	(	-LRB-
10_1101-2021_01_07_425723	1000	23	b	b	NN
10_1101-2021_01_07_425723	1000	24	)	)	-RRB-
10_1101-2021_01_07_425723	1000	25	.	.	.
10_1101-2021_01_07_425723	1001	1	To	to	TO
10_1101-2021_01_07_425723	1001	2	perform	perform	VB
10_1101-2021_01_07_425723	1001	3	cross	cross	NN
10_1101-2021_01_07_425723	1001	4	-	-	NN
10_1101-2021_01_07_425723	1001	5	validation	validation	NN
10_1101-2021_01_07_425723	1001	6	between	between	IN
10_1101-2021_01_07_425723	1001	7	the	the	DT
10_1101-2021_01_07_425723	1001	8	two	two	CD
10_1101-2021_01_07_425723	1001	9	parallel	parallel	JJ
10_1101-2021_01_07_425723	1001	10	running	running	NN
10_1101-2021_01_07_425723	1001	11	experiments	experiment	NNS
10_1101-2021_01_07_425723	1001	12	,	,	,
10_1101-2021_01_07_425723	1001	13	1.5	1.5	CD
10_1101-2021_01_07_425723	1001	14	mL	ml	NN
10_1101-2021_01_07_425723	1001	15	980	980	CD
10_1101-2021_01_07_425723	1001	16	aliquot	aliquot	NNS
10_1101-2021_01_07_425723	1001	17	of	of	IN
10_1101-2021_01_07_425723	1001	18	each	each	DT
10_1101-2021_01_07_425723	1001	19	culture	culture	NN
10_1101-2021_01_07_425723	1001	20	was	be	VBD
10_1101-2021_01_07_425723	1001	21	sealed	seal	VBN
10_1101-2021_01_07_425723	1001	22	and	and	CC
10_1101-2021_01_07_425723	1001	23	transferred	transfer	VBN
10_1101-2021_01_07_425723	1001	24	quickly	quickly	RB
10_1101-2021_01_07_425723	1001	25	between	between	IN
10_1101-2021_01_07_425723	1001	26	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1001	27	chambers	chamber	NNS
10_1101-2021_01_07_425723	1001	28	and	and	CC
10_1101-2021_01_07_425723	1001	29	used	use	VBD
10_1101-2021_01_07_425723	1001	30	to	to	IN
10_1101-2021_01_07_425723	1001	31	981	981	CD
10_1101-2021_01_07_425723	1001	32	inoculate	inoculate	VB
10_1101-2021_01_07_425723	1001	33	two	two	CD
10_1101-2021_01_07_425723	1001	34	shake	shake	NN
10_1101-2021_01_07_425723	1001	35	-	-	HYPH
10_1101-2021_01_07_425723	1001	36	flask	flask	NN
10_1101-2021_01_07_425723	1001	37	cultures	culture	NNS
10_1101-2021_01_07_425723	1001	38	,	,	,
10_1101-2021_01_07_425723	1001	39	represented	represent	VBN
10_1101-2021_01_07_425723	1001	40	with	with	IN
10_1101-2021_01_07_425723	1001	41	crossed	cross	VBN
10_1101-2021_01_07_425723	1001	42	-	-	HYPH
10_1101-2021_01_07_425723	1001	43	arrows	arrow	NNS
10_1101-2021_01_07_425723	1001	44	(	(	-LRB-
10_1101-2021_01_07_425723	1001	45	⤮	⤮	NNP
10_1101-2021_01_07_425723	1001	46	)	)	-RRB-
10_1101-2021_01_07_425723	1001	47	.	.	.
10_1101-2021_01_07_425723	1002	1	The	the	DT
10_1101-2021_01_07_425723	1002	2	cultures	culture	NNS
10_1101-2021_01_07_425723	1002	3	from	from	IN
10_1101-2021_01_07_425723	1002	4	the	the	DT
10_1101-2021_01_07_425723	1002	5	strain	strain	NN
10_1101-2021_01_07_425723	1002	6	982	982	CD
10_1101-2021_01_07_425723	1002	7	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	1002	8	(	(	-LRB-
10_1101-2021_01_07_425723	1002	9	⤮	⤮	NNP
10_1101-2021_01_07_425723	1002	10	)	)	-RRB-
10_1101-2021_01_07_425723	1002	11	in	in	IN
10_1101-2021_01_07_425723	1002	12	the	the	DT
10_1101-2021_01_07_425723	1002	13	third	third	JJ
10_1101-2021_01_07_425723	1002	14	transfer	transfer	NN
10_1101-2021_01_07_425723	1002	15	(	(	-LRB-
10_1101-2021_01_07_425723	1002	16	C3	C3	NNP
10_1101-2021_01_07_425723	1002	17	)	)	-RRB-
10_1101-2021_01_07_425723	1002	18	in	in	IN
10_1101-2021_01_07_425723	1002	19	the	the	DT
10_1101-2021_01_07_425723	1002	20	strict	strict	JJ
10_1101-2021_01_07_425723	1002	21	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1002	22	environment	environment	NN
10_1101-2021_01_07_425723	1002	23	(	(	-LRB-
10_1101-2021_01_07_425723	1002	24	b	b	NN
10_1101-2021_01_07_425723	1002	25	)	)	-RRB-
10_1101-2021_01_07_425723	1002	26	were	be	VBD
10_1101-2021_01_07_425723	1002	27	hence	hence	RB
10_1101-2021_01_07_425723	1002	28	inoculated	inoculate	VBN
10_1101-2021_01_07_425723	1002	29	983	983	CD
10_1101-2021_01_07_425723	1002	30	from	from	IN
10_1101-2021_01_07_425723	1002	31	an	an	DT
10_1101-2021_01_07_425723	1002	32	aliquot	aliquot	NNS
10_1101-2021_01_07_425723	1002	33	of	of	IN
10_1101-2021_01_07_425723	1002	34	the	the	DT
10_1101-2021_01_07_425723	1002	35	cultures	culture	NNS
10_1101-2021_01_07_425723	1002	36	of	of	IN
10_1101-2021_01_07_425723	1002	37	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	1002	38	(	(	-LRB-
10_1101-2021_01_07_425723	1002	39	C2	c2	NN
10_1101-2021_01_07_425723	1002	40	)	)	-RRB-
10_1101-2021_01_07_425723	1002	41	grown	grow	VBN
10_1101-2021_01_07_425723	1002	42	in	in	IN
10_1101-2021_01_07_425723	1002	43	oxygen	oxygen	NN
10_1101-2021_01_07_425723	1002	44	-	-	HYPH
10_1101-2021_01_07_425723	1002	45	limited	limit	VBN
10_1101-2021_01_07_425723	1002	46	environment	environment	NN
10_1101-2021_01_07_425723	1002	47	(	(	-LRB-
10_1101-2021_01_07_425723	1002	48	a	a	DT
10_1101-2021_01_07_425723	1002	49	)	)	-RRB-
10_1101-2021_01_07_425723	1002	50	.	.	.
10_1101-2021_01_07_425723	1003	1	This	this	DT
10_1101-2021_01_07_425723	1003	2	resulted	result	VBD
10_1101-2021_01_07_425723	1003	3	984	984	CD
10_1101-2021_01_07_425723	1003	4	in	in	IN
10_1101-2021_01_07_425723	1003	5	a	a	DT
10_1101-2021_01_07_425723	1003	6	serial	serial	JJ
10_1101-2021_01_07_425723	1003	7	transfer	transfer	NN
10_1101-2021_01_07_425723	1003	8	of	of	IN
10_1101-2021_01_07_425723	1003	9	26.7	26.7	CD
10_1101-2021_01_07_425723	1003	10	times	time	NNS
10_1101-2021_01_07_425723	1003	11	dilution	dilution	NN
10_1101-2021_01_07_425723	1003	12	from	from	IN
10_1101-2021_01_07_425723	1003	13	transfer	transfer	NNP
10_1101-2021_01_07_425723	1003	14	C2	c2	NN
10_1101-2021_01_07_425723	1003	15	to	to	TO
10_1101-2021_01_07_425723	1003	16	C3	c3	VB
10_1101-2021_01_07_425723	1003	17	.	.	.
10_1101-2021_01_07_425723	1004	1	Aerobic	Aerobic	NNP
10_1101-2021_01_07_425723	1004	2	grown	grow	VBD
10_1101-2021_01_07_425723	1004	3	pre	pre	JJ
10_1101-2021_01_07_425723	1004	4	-	-	NNS
10_1101-2021_01_07_425723	1004	5	cultures	culture	NNS
10_1101-2021_01_07_425723	1004	6	were	be	VBD
10_1101-2021_01_07_425723	1004	7	used	use	VBN
10_1101-2021_01_07_425723	1004	8	985	985	CD
10_1101-2021_01_07_425723	1004	9	to	to	TO
10_1101-2021_01_07_425723	1004	10	inoculate	inoculate	VB
10_1101-2021_01_07_425723	1004	11	the	the	DT
10_1101-2021_01_07_425723	1004	12	first	first	JJ
10_1101-2021_01_07_425723	1004	13	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1004	14	culture	culture	NN
10_1101-2021_01_07_425723	1004	15	on	on	IN
10_1101-2021_01_07_425723	1004	16	SMG	SMG	NNP
10_1101-2021_01_07_425723	1004	17	-	-	HYPH
10_1101-2021_01_07_425723	1004	18	urea	urea	NNP
10_1101-2021_01_07_425723	1004	19	containing	contain	VBG
10_1101-2021_01_07_425723	1004	20	50	50	CD
10_1101-2021_01_07_425723	1004	21	g·L-1	g·l-1	CD
10_1101-2021_01_07_425723	1004	22	glucose	glucose	NN
10_1101-2021_01_07_425723	1004	23	and	and	CC
10_1101-2021_01_07_425723	1004	24	Tween	Tween	NNP
10_1101-2021_01_07_425723	1004	25	80	80	CD
10_1101-2021_01_07_425723	1004	26	.	.	.
10_1101-2021_01_07_425723	1005	1	Data	datum	NNS
10_1101-2021_01_07_425723	1005	2	986	986	CD
10_1101-2021_01_07_425723	1005	3	depicted	depict	VBN
10_1101-2021_01_07_425723	1005	4	are	be	VBP
10_1101-2021_01_07_425723	1005	5	of	of	IN
10_1101-2021_01_07_425723	1005	6	each	each	DT
10_1101-2021_01_07_425723	1005	7	replicate	replicate	NN
10_1101-2021_01_07_425723	1005	8	culture	culture	NN
10_1101-2021_01_07_425723	1005	9	(	(	-LRB-
10_1101-2021_01_07_425723	1005	10	points	point	NNS
10_1101-2021_01_07_425723	1005	11	)	)	-RRB-
10_1101-2021_01_07_425723	1005	12	and	and	CC
10_1101-2021_01_07_425723	1005	13	the	the	DT
10_1101-2021_01_07_425723	1005	14	mean	mean	JJ
10_1101-2021_01_07_425723	1005	15	(	(	-LRB-
10_1101-2021_01_07_425723	1005	16	dotted	dotted	JJ
10_1101-2021_01_07_425723	1005	17	line	line	NN
10_1101-2021_01_07_425723	1005	18	)	)	-RRB-
10_1101-2021_01_07_425723	1005	19	from	from	IN
10_1101-2021_01_07_425723	1005	20	independent	independent	JJ
10_1101-2021_01_07_425723	1005	21	biological	biological	JJ
10_1101-2021_01_07_425723	1005	22	987	987	CD
10_1101-2021_01_07_425723	1005	23	duplicate	duplicate	JJ
10_1101-2021_01_07_425723	1005	24	cultures	culture	NNS
10_1101-2021_01_07_425723	1005	25	,	,	,
10_1101-2021_01_07_425723	1005	26	serial	serial	JJ
10_1101-2021_01_07_425723	1005	27	transfers	transfer	NNS
10_1101-2021_01_07_425723	1005	28	cultures	culture	NNS
10_1101-2021_01_07_425723	1005	29	are	be	VBP
10_1101-2021_01_07_425723	1005	30	represented	represent	VBN
10_1101-2021_01_07_425723	1005	31	with	with	IN
10_1101-2021_01_07_425723	1005	32	the	the	DT
10_1101-2021_01_07_425723	1005	33	number	number	NN
10_1101-2021_01_07_425723	1005	34	of	of	IN
10_1101-2021_01_07_425723	1005	35	respective	respective	JJ
10_1101-2021_01_07_425723	1005	36	transfer	transfer	NN
10_1101-2021_01_07_425723	1005	37	(	(	-LRB-
10_1101-2021_01_07_425723	1005	38	C1	C1	NNP
10_1101-2021_01_07_425723	1005	39	-	-	HYPH
10_1101-2021_01_07_425723	1005	40	988	988	CD
10_1101-2021_01_07_425723	1005	41	3	3	CD
10_1101-2021_01_07_425723	1005	42	)	)	-RRB-
10_1101-2021_01_07_425723	1005	43	.989	.989	CD
10_1101-2021_01_07_425723	1005	44	.CC	.CC	NFP
10_1101-2021_01_07_425723	1005	45	-	-	HYPH
10_1101-2021_01_07_425723	1005	46	BY	by	IN
10_1101-2021_01_07_425723	1005	47	-	-	HYPH
10_1101-2021_01_07_425723	1005	48	NC	NC	NNP
10_1101-2021_01_07_425723	1005	49	-	-	HYPH
10_1101-2021_01_07_425723	1005	50	ND	ND	NNP
10_1101-2021_01_07_425723	1005	51	4.0	4.0	CD
10_1101-2021_01_07_425723	1005	52	International	International	NNP
10_1101-2021_01_07_425723	1005	53	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	1005	54	under	under	IN
10_1101-2021_01_07_425723	1005	55	a	a	DT
10_1101-2021_01_07_425723	1005	56	(	(	-LRB-
10_1101-2021_01_07_425723	1005	57	which	which	WDT
10_1101-2021_01_07_425723	1005	58	was	be	VBD
10_1101-2021_01_07_425723	1005	59	not	not	RB
10_1101-2021_01_07_425723	1005	60	certified	certify	VBN
10_1101-2021_01_07_425723	1005	61	by	by	IN
10_1101-2021_01_07_425723	1005	62	peer	peer	NN
10_1101-2021_01_07_425723	1005	63	review	review	NN
10_1101-2021_01_07_425723	1005	64	)	)	-RRB-
10_1101-2021_01_07_425723	1005	65	is	be	VBZ
10_1101-2021_01_07_425723	1005	66	the	the	DT
10_1101-2021_01_07_425723	1005	67	author	author	NN
10_1101-2021_01_07_425723	1005	68	/	/	SYM
10_1101-2021_01_07_425723	1005	69	funder	funder	NN
10_1101-2021_01_07_425723	1005	70	,	,	,
10_1101-2021_01_07_425723	1005	71	who	who	WP
10_1101-2021_01_07_425723	1005	72	has	have	VBZ
10_1101-2021_01_07_425723	1005	73	granted	grant	VBN
10_1101-2021_01_07_425723	1005	74	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	1005	75	a	a	DT
10_1101-2021_01_07_425723	1005	76	license	license	NN
10_1101-2021_01_07_425723	1005	77	to	to	TO
10_1101-2021_01_07_425723	1005	78	display	display	VB
10_1101-2021_01_07_425723	1005	79	the	the	DT
10_1101-2021_01_07_425723	1005	80	preprint	preprint	NN
10_1101-2021_01_07_425723	1005	81	in	in	IN
10_1101-2021_01_07_425723	1005	82	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	1005	83	.	.	.
10_1101-2021_01_07_425723	1006	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	1006	2	is	be	VBZ
10_1101-2021_01_07_425723	1006	3	made	make	VBN
10_1101-2021_01_07_425723	1006	4	The	the	DT
10_1101-2021_01_07_425723	1006	5	copyright	copyright	NN
10_1101-2021_01_07_425723	1006	6	holder	holder	NN
10_1101-2021_01_07_425723	1006	7	for	for	IN
10_1101-2021_01_07_425723	1006	8	this	this	DT
10_1101-2021_01_07_425723	1006	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	1006	10	version	version	NN
10_1101-2021_01_07_425723	1006	11	posted	post	VBD
10_1101-2021_01_07_425723	1006	12	January	January	NNP
10_1101-2021_01_07_425723	1006	13	8	8	CD
10_1101-2021_01_07_425723	1006	14	,	,	,
10_1101-2021_01_07_425723	1006	15	2021	2021	CD
10_1101-2021_01_07_425723	1006	16	.	.	.
10_1101-2021_01_07_425723	1006	17	;	;	:
10_1101-2021_01_07_425723	1006	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	1006	19	:	:	:
10_1101-2021_01_07_425723	1006	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	1006	21	preprint	preprint	NN
10_1101-2021_01_07_425723	1006	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	1006	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	NN
10_1101-2021_01_07_425723	1006	24	60	60	CD
10_1101-2021_01_07_425723	1006	25	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	1006	26	Fig	Fig	NNP
10_1101-2021_01_07_425723	1006	27	.	.	.
10_1101-2021_01_07_425723	1007	1	10	10	CD
10_1101-2021_01_07_425723	1007	2	|	|	NNP
10_1101-2021_01_07_425723	1007	3	Sterol	Sterol	NNP
10_1101-2021_01_07_425723	1007	4	-	-	HYPH
10_1101-2021_01_07_425723	1007	5	independent	independent	JJ
10_1101-2021_01_07_425723	1007	6	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1007	7	growth	growth	NN
10_1101-2021_01_07_425723	1007	8	of	of	IN
10_1101-2021_01_07_425723	1007	9	S.	S.	NNP
10_1101-2021_01_07_425723	1007	10	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	1007	11	IMX585	IMX585	NNP
10_1101-2021_01_07_425723	1007	12	(	(	-LRB-
10_1101-2021_01_07_425723	1007	13	reference	reference	NN
10_1101-2021_01_07_425723	1007	14	)	)	-RRB-
10_1101-2021_01_07_425723	1007	15	,	,	,
10_1101-2021_01_07_425723	1007	16	990	990	CD
10_1101-2021_01_07_425723	1007	17	IMX1438	IMX1438	NNP
10_1101-2021_01_07_425723	1007	18	(	(	-LRB-
10_1101-2021_01_07_425723	1007	19	TtSTC1	ttstc1	NN
10_1101-2021_01_07_425723	1007	20	)	)	-RRB-
10_1101-2021_01_07_425723	1007	21	,	,	,
10_1101-2021_01_07_425723	1007	22	K.	K.	NNP
10_1101-2021_01_07_425723	1007	23	marxianus	marxianus	NN
10_1101-2021_01_07_425723	1007	24	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	1007	25	(	(	-LRB-
10_1101-2021_01_07_425723	1007	26	reference	reference	NN
10_1101-2021_01_07_425723	1007	27	)	)	-RRB-
10_1101-2021_01_07_425723	1007	28	and	and	CC
10_1101-2021_01_07_425723	1007	29	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	1007	30	(	(	-LRB-
10_1101-2021_01_07_425723	1007	31	TtSTC1	TtSTC1	NNP
10_1101-2021_01_07_425723	1007	32	)	)	-RRB-
10_1101-2021_01_07_425723	1007	33	.	.	.
10_1101-2021_01_07_425723	1008	1	Aerobic	Aerobic	NNP
10_1101-2021_01_07_425723	1008	2	grown	grow	VBN
10_1101-2021_01_07_425723	1008	3	pre-991	pre-991	NN
10_1101-2021_01_07_425723	1008	4	cultures	culture	NNS
10_1101-2021_01_07_425723	1008	5	were	be	VBD
10_1101-2021_01_07_425723	1008	6	used	use	VBN
10_1101-2021_01_07_425723	1008	7	to	to	TO
10_1101-2021_01_07_425723	1008	8	inoculate	inoculate	VB
10_1101-2021_01_07_425723	1008	9	shake	shake	NN
10_1101-2021_01_07_425723	1008	10	-	-	HYPH
10_1101-2021_01_07_425723	1008	11	flask	flask	NN
10_1101-2021_01_07_425723	1008	12	cultures	culture	NNS
10_1101-2021_01_07_425723	1008	13	with	with	IN
10_1101-2021_01_07_425723	1008	14	SMG	SMG	NNP
10_1101-2021_01_07_425723	1008	15	-	-	HYPH
10_1101-2021_01_07_425723	1008	16	urea	urea	NNP
10_1101-2021_01_07_425723	1008	17	containing	contain	VBG
10_1101-2021_01_07_425723	1008	18	50	50	CD
10_1101-2021_01_07_425723	1008	19	g·L-1	g·L-1	NNP
10_1101-2021_01_07_425723	1008	20	glucose	glucose	NN
10_1101-2021_01_07_425723	1008	21	and	and	CC
10_1101-2021_01_07_425723	1008	22	992	992	CD
10_1101-2021_01_07_425723	1008	23	Tween	Tween	NNP
10_1101-2021_01_07_425723	1008	24	80	80	CD
10_1101-2021_01_07_425723	1008	25	in	in	IN
10_1101-2021_01_07_425723	1008	26	a	a	DT
10_1101-2021_01_07_425723	1008	27	strict	strict	JJ
10_1101-2021_01_07_425723	1008	28	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1008	29	environment	environment	NN
10_1101-2021_01_07_425723	1008	30	at	at	IN
10_1101-2021_01_07_425723	1008	31	an	an	DT
10_1101-2021_01_07_425723	1008	32	OD600	od600	NN
10_1101-2021_01_07_425723	1008	33	of	of	IN
10_1101-2021_01_07_425723	1008	34	0.1	0.1	CD
10_1101-2021_01_07_425723	1008	35	for	for	IN
10_1101-2021_01_07_425723	1008	36	all	all	DT
10_1101-2021_01_07_425723	1008	37	strains	strain	NNS
10_1101-2021_01_07_425723	1008	38	,	,	,
10_1101-2021_01_07_425723	1008	39	and	and	CC
10_1101-2021_01_07_425723	1008	40	both	both	CC
10_1101-2021_01_07_425723	1008	41	at	at	IN
10_1101-2021_01_07_425723	1008	42	OD600	od600	NN
10_1101-2021_01_07_425723	1008	43	of	of	IN
10_1101-2021_01_07_425723	1008	44	0.1	0.1	CD
10_1101-2021_01_07_425723	1008	45	and	and	CC
10_1101-2021_01_07_425723	1008	46	993	993	CD
10_1101-2021_01_07_425723	1008	47	0.6	0.6	CD
10_1101-2021_01_07_425723	1008	48	for	for	IN
10_1101-2021_01_07_425723	1008	49	NBRC1777	NBRC1777	NNP
10_1101-2021_01_07_425723	1008	50	and	and	CC
10_1101-2021_01_07_425723	1008	51	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	1008	52	.	.	.
10_1101-2021_01_07_425723	1009	1	Data	datum	NNS
10_1101-2021_01_07_425723	1009	2	depicted	depict	VBN
10_1101-2021_01_07_425723	1009	3	are	be	VBP
10_1101-2021_01_07_425723	1009	4	of	of	IN
10_1101-2021_01_07_425723	1009	5	each	each	DT
10_1101-2021_01_07_425723	1009	6	replicate	replicate	NN
10_1101-2021_01_07_425723	1009	7	culture	culture	NN
10_1101-2021_01_07_425723	1009	8	(	(	-LRB-
10_1101-2021_01_07_425723	1009	9	points	point	NNS
10_1101-2021_01_07_425723	1009	10	)	)	-RRB-
10_1101-2021_01_07_425723	1009	11	and	and	CC
10_1101-2021_01_07_425723	1009	12	the	the	DT
10_1101-2021_01_07_425723	1009	13	mean	mean	NNP
10_1101-2021_01_07_425723	1009	14	994	994	CD
10_1101-2021_01_07_425723	1009	15	(	(	-LRB-
10_1101-2021_01_07_425723	1009	16	dotted	dotted	JJ
10_1101-2021_01_07_425723	1009	17	line	line	NN
10_1101-2021_01_07_425723	1009	18	)	)	-RRB-
10_1101-2021_01_07_425723	1009	19	from	from	IN
10_1101-2021_01_07_425723	1009	20	independent	independent	JJ
10_1101-2021_01_07_425723	1009	21	biological	biological	JJ
10_1101-2021_01_07_425723	1009	22	duplicate	duplicate	JJ
10_1101-2021_01_07_425723	1009	23	cultures	culture	NNS
10_1101-2021_01_07_425723	1009	24	,	,	,
10_1101-2021_01_07_425723	1009	25	serial	serial	JJ
10_1101-2021_01_07_425723	1009	26	transfers	transfer	NNS
10_1101-2021_01_07_425723	1009	27	cultures	culture	NNS
10_1101-2021_01_07_425723	1009	28	are	be	VBP
10_1101-2021_01_07_425723	1009	29	represented	represent	VBN
10_1101-2021_01_07_425723	1009	30	995	995	CD
10_1101-2021_01_07_425723	1009	31	with	with	IN
10_1101-2021_01_07_425723	1009	32	the	the	DT
10_1101-2021_01_07_425723	1009	33	number	number	NN
10_1101-2021_01_07_425723	1009	34	of	of	IN
10_1101-2021_01_07_425723	1009	35	respective	respective	JJ
10_1101-2021_01_07_425723	1009	36	transfer	transfer	NN
10_1101-2021_01_07_425723	1009	37	(	(	-LRB-
10_1101-2021_01_07_425723	1009	38	C1	C1	NNP
10_1101-2021_01_07_425723	1009	39	-	-	HYPH
10_1101-2021_01_07_425723	1009	40	2	2	CD
10_1101-2021_01_07_425723	1009	41	)	)	-RRB-
10_1101-2021_01_07_425723	1009	42	.	.	.
10_1101-2021_01_07_425723	1010	1	996	996	CD
10_1101-2021_01_07_425723	1010	2	.CC	.CC	:
10_1101-2021_01_07_425723	1010	3	-	-	HYPH
10_1101-2021_01_07_425723	1010	4	BY	by	IN
10_1101-2021_01_07_425723	1010	5	-	-	HYPH
10_1101-2021_01_07_425723	1010	6	NC	NC	NNP
10_1101-2021_01_07_425723	1010	7	-	-	HYPH
10_1101-2021_01_07_425723	1010	8	ND	ND	NNP
10_1101-2021_01_07_425723	1010	9	4.0	4.0	CD
10_1101-2021_01_07_425723	1010	10	International	International	NNP
10_1101-2021_01_07_425723	1010	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	1010	12	under	under	IN
10_1101-2021_01_07_425723	1010	13	a	a	DT
10_1101-2021_01_07_425723	1010	14	(	(	-LRB-
10_1101-2021_01_07_425723	1010	15	which	which	WDT
10_1101-2021_01_07_425723	1010	16	was	be	VBD
10_1101-2021_01_07_425723	1010	17	not	not	RB
10_1101-2021_01_07_425723	1010	18	certified	certify	VBN
10_1101-2021_01_07_425723	1010	19	by	by	IN
10_1101-2021_01_07_425723	1010	20	peer	peer	NN
10_1101-2021_01_07_425723	1010	21	review	review	NN
10_1101-2021_01_07_425723	1010	22	)	)	-RRB-
10_1101-2021_01_07_425723	1010	23	is	be	VBZ
10_1101-2021_01_07_425723	1010	24	the	the	DT
10_1101-2021_01_07_425723	1010	25	author	author	NN
10_1101-2021_01_07_425723	1010	26	/	/	SYM
10_1101-2021_01_07_425723	1010	27	funder	funder	NN
10_1101-2021_01_07_425723	1010	28	,	,	,
10_1101-2021_01_07_425723	1010	29	who	who	WP
10_1101-2021_01_07_425723	1010	30	has	have	VBZ
10_1101-2021_01_07_425723	1010	31	granted	grant	VBN
10_1101-2021_01_07_425723	1010	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	1010	33	a	a	DT
10_1101-2021_01_07_425723	1010	34	license	license	NN
10_1101-2021_01_07_425723	1010	35	to	to	TO
10_1101-2021_01_07_425723	1010	36	display	display	VB
10_1101-2021_01_07_425723	1010	37	the	the	DT
10_1101-2021_01_07_425723	1010	38	preprint	preprint	NN
10_1101-2021_01_07_425723	1010	39	in	in	IN
10_1101-2021_01_07_425723	1010	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	1010	41	.	.	.
10_1101-2021_01_07_425723	1011	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	1011	2	is	be	VBZ
10_1101-2021_01_07_425723	1011	3	made	make	VBN
10_1101-2021_01_07_425723	1011	4	The	the	DT
10_1101-2021_01_07_425723	1011	5	copyright	copyright	NN
10_1101-2021_01_07_425723	1011	6	holder	holder	NN
10_1101-2021_01_07_425723	1011	7	for	for	IN
10_1101-2021_01_07_425723	1011	8	this	this	DT
10_1101-2021_01_07_425723	1011	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	1011	10	version	version	NN
10_1101-2021_01_07_425723	1011	11	posted	post	VBD
10_1101-2021_01_07_425723	1011	12	January	January	NNP
10_1101-2021_01_07_425723	1011	13	8	8	CD
10_1101-2021_01_07_425723	1011	14	,	,	,
10_1101-2021_01_07_425723	1011	15	2021	2021	CD
10_1101-2021_01_07_425723	1011	16	.	.	.
10_1101-2021_01_07_425723	1011	17	;	;	:
10_1101-2021_01_07_425723	1011	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	1011	19	:	:	:
10_1101-2021_01_07_425723	1011	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	1011	21	preprint	preprint	NN
10_1101-2021_01_07_425723	1011	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	1011	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	1011	24	61	61	CD
10_1101-2021_01_07_425723	1011	25	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	1011	26	Fig	Fig	NNP
10_1101-2021_01_07_425723	1011	27	.	.	.
10_1101-2021_01_07_425723	1012	1	11	11	CD
10_1101-2021_01_07_425723	1012	2	|	|	JJ
10_1101-2021_01_07_425723	1012	3	CO2	co2	JJ
10_1101-2021_01_07_425723	1012	4	fraction	fraction	NN
10_1101-2021_01_07_425723	1012	5	in	in	IN
10_1101-2021_01_07_425723	1012	6	the	the	DT
10_1101-2021_01_07_425723	1012	7	off	off	JJ
10_1101-2021_01_07_425723	1012	8	-	-	HYPH
10_1101-2021_01_07_425723	1012	9	gas	gas	NN
10_1101-2021_01_07_425723	1012	10	of	of	IN
10_1101-2021_01_07_425723	1012	11	K.	K.	NNP
10_1101-2021_01_07_425723	1012	12	marxianus	marxianus	NN
10_1101-2021_01_07_425723	1012	13	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	1012	14	.	.	.
10_1101-2021_01_07_425723	1013	1	Production	production	NN
10_1101-2021_01_07_425723	1013	2	of	of	IN
10_1101-2021_01_07_425723	1013	3	CO2	CO2	NNP
10_1101-2021_01_07_425723	1013	4	as	as	IN
10_1101-2021_01_07_425723	1013	5	997	997	CD
10_1101-2021_01_07_425723	1013	6	measured	measure	VBN
10_1101-2021_01_07_425723	1013	7	by	by	IN
10_1101-2021_01_07_425723	1013	8	the	the	DT
10_1101-2021_01_07_425723	1013	9	fraction	fraction	NN
10_1101-2021_01_07_425723	1013	10	of	of	IN
10_1101-2021_01_07_425723	1013	11	CO2	CO2	NNP
10_1101-2021_01_07_425723	1013	12	in	in	IN
10_1101-2021_01_07_425723	1013	13	the	the	DT
10_1101-2021_01_07_425723	1013	14	off	off	JJ
10_1101-2021_01_07_425723	1013	15	-	-	HYPH
10_1101-2021_01_07_425723	1013	16	gas	gas	NN
10_1101-2021_01_07_425723	1013	17	of	of	IN
10_1101-2021_01_07_425723	1013	18	the	the	DT
10_1101-2021_01_07_425723	1013	19	individual	individual	JJ
10_1101-2021_01_07_425723	1013	20	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	1013	21	cultivations	cultivation	NNS
10_1101-2021_01_07_425723	1013	22	of	of	IN
10_1101-2021_01_07_425723	1013	23	the	the	DT
10_1101-2021_01_07_425723	1013	24	K.	K.	NNP
10_1101-2021_01_07_425723	1013	25	998	998	CD
10_1101-2021_01_07_425723	1013	26	marxianus	marxianus	NN
10_1101-2021_01_07_425723	1013	27	strain	strain	NN
10_1101-2021_01_07_425723	1013	28	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	1013	29	on	on	IN
10_1101-2021_01_07_425723	1013	30	SMG	SMG	NNP
10_1101-2021_01_07_425723	1013	31	media	medium	NNS
10_1101-2021_01_07_425723	1013	32	pH	ph	NN
10_1101-2021_01_07_425723	1013	33	5.0	5.0	CD
10_1101-2021_01_07_425723	1013	34	with	with	IN
10_1101-2021_01_07_425723	1013	35	20	20	CD
10_1101-2021_01_07_425723	1013	36	g·L-1	g·L-1	NNP
10_1101-2021_01_07_425723	1013	37	glucose	glucose	NN
10_1101-2021_01_07_425723	1013	38	,	,	,
10_1101-2021_01_07_425723	1013	39	420	420	CD
10_1101-2021_01_07_425723	1013	40	mg·L-1	mg·l-1	NN
10_1101-2021_01_07_425723	1013	41	Tween	Tween	NNP
10_1101-2021_01_07_425723	1013	42	80	80	CD
10_1101-2021_01_07_425723	1013	43	over	over	IN
10_1101-2021_01_07_425723	1013	44	time	time	NN
10_1101-2021_01_07_425723	1013	45	999	999	CD
10_1101-2021_01_07_425723	1013	46	(	(	-LRB-
10_1101-2021_01_07_425723	1013	47	Left	left	JJ
10_1101-2021_01_07_425723	1013	48	panels	panel	NNS
10_1101-2021_01_07_425723	1013	49	)	)	-RRB-
10_1101-2021_01_07_425723	1013	50	.	.	.
10_1101-2021_01_07_425723	1014	1	The	the	DT
10_1101-2021_01_07_425723	1014	2	temperature	temperature	NN
10_1101-2021_01_07_425723	1014	3	profile	profile	NN
10_1101-2021_01_07_425723	1014	4	was	be	VBD
10_1101-2021_01_07_425723	1014	5	incrementally	incrementally	RB
10_1101-2021_01_07_425723	1014	6	increased	increase	VBN
10_1101-2021_01_07_425723	1014	7	at	at	IN
10_1101-2021_01_07_425723	1014	8	the	the	DT
10_1101-2021_01_07_425723	1014	9	beginning	beginning	NN
10_1101-2021_01_07_425723	1014	10	of	of	IN
10_1101-2021_01_07_425723	1014	11	a	a	DT
10_1101-2021_01_07_425723	1014	12	new	new	JJ
10_1101-2021_01_07_425723	1014	13	batch	batch	NN
10_1101-2021_01_07_425723	1014	14	cycle	cycle	NN
10_1101-2021_01_07_425723	1014	15	1000	1000	CD
10_1101-2021_01_07_425723	1014	16	(	(	-LRB-
10_1101-2021_01_07_425723	1014	17	right	right	JJ
10_1101-2021_01_07_425723	1014	18	panels	panel	NNS
10_1101-2021_01_07_425723	1014	19	)	)	-RRB-
10_1101-2021_01_07_425723	1014	20	.	.	.
10_1101-2021_01_07_425723	1015	1	After	after	IN
10_1101-2021_01_07_425723	1015	2	430	430	CD
10_1101-2021_01_07_425723	1015	3	h	h	NN
10_1101-2021_01_07_425723	1015	4	the	the	DT
10_1101-2021_01_07_425723	1015	5	performance	performance	NN
10_1101-2021_01_07_425723	1015	6	of	of	IN
10_1101-2021_01_07_425723	1015	7	the	the	DT
10_1101-2021_01_07_425723	1015	8	off	off	JJ
10_1101-2021_01_07_425723	1015	9	-	-	HYPH
10_1101-2021_01_07_425723	1015	10	gas	gas	NN
10_1101-2021_01_07_425723	1015	11	analyzer	analyzer	NN
10_1101-2021_01_07_425723	1015	12	of	of	IN
10_1101-2021_01_07_425723	1015	13	replicate	replicate	NN
10_1101-2021_01_07_425723	1015	14	M3R	M3R	NNP
10_1101-2021_01_07_425723	1015	15	deteriorated	deteriorate	VBD
10_1101-2021_01_07_425723	1015	16	.	.	.
10_1101-2021_01_07_425723	1016	1	1001	1001	CD
10_1101-2021_01_07_425723	1016	2	.CC	.CC	,
10_1101-2021_01_07_425723	1016	3	-	-	HYPH
10_1101-2021_01_07_425723	1016	4	BY	by	IN
10_1101-2021_01_07_425723	1016	5	-	-	HYPH
10_1101-2021_01_07_425723	1016	6	NC	NC	NNP
10_1101-2021_01_07_425723	1016	7	-	-	HYPH
10_1101-2021_01_07_425723	1016	8	ND	ND	NNP
10_1101-2021_01_07_425723	1016	9	4.0	4.0	CD
10_1101-2021_01_07_425723	1016	10	International	International	NNP
10_1101-2021_01_07_425723	1016	11	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	1016	12	under	under	IN
10_1101-2021_01_07_425723	1016	13	a	a	DT
10_1101-2021_01_07_425723	1016	14	(	(	-LRB-
10_1101-2021_01_07_425723	1016	15	which	which	WDT
10_1101-2021_01_07_425723	1016	16	was	be	VBD
10_1101-2021_01_07_425723	1016	17	not	not	RB
10_1101-2021_01_07_425723	1016	18	certified	certify	VBN
10_1101-2021_01_07_425723	1016	19	by	by	IN
10_1101-2021_01_07_425723	1016	20	peer	peer	NN
10_1101-2021_01_07_425723	1016	21	review	review	NN
10_1101-2021_01_07_425723	1016	22	)	)	-RRB-
10_1101-2021_01_07_425723	1016	23	is	be	VBZ
10_1101-2021_01_07_425723	1016	24	the	the	DT
10_1101-2021_01_07_425723	1016	25	author	author	NN
10_1101-2021_01_07_425723	1016	26	/	/	SYM
10_1101-2021_01_07_425723	1016	27	funder	funder	NN
10_1101-2021_01_07_425723	1016	28	,	,	,
10_1101-2021_01_07_425723	1016	29	who	who	WP
10_1101-2021_01_07_425723	1016	30	has	have	VBZ
10_1101-2021_01_07_425723	1016	31	granted	grant	VBN
10_1101-2021_01_07_425723	1016	32	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	1016	33	a	a	DT
10_1101-2021_01_07_425723	1016	34	license	license	NN
10_1101-2021_01_07_425723	1016	35	to	to	TO
10_1101-2021_01_07_425723	1016	36	display	display	VB
10_1101-2021_01_07_425723	1016	37	the	the	DT
10_1101-2021_01_07_425723	1016	38	preprint	preprint	NN
10_1101-2021_01_07_425723	1016	39	in	in	IN
10_1101-2021_01_07_425723	1016	40	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	1016	41	.	.	.
10_1101-2021_01_07_425723	1017	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	1017	2	is	be	VBZ
10_1101-2021_01_07_425723	1017	3	made	make	VBN
10_1101-2021_01_07_425723	1017	4	The	the	DT
10_1101-2021_01_07_425723	1017	5	copyright	copyright	NN
10_1101-2021_01_07_425723	1017	6	holder	holder	NN
10_1101-2021_01_07_425723	1017	7	for	for	IN
10_1101-2021_01_07_425723	1017	8	this	this	DT
10_1101-2021_01_07_425723	1017	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	1017	10	version	version	NN
10_1101-2021_01_07_425723	1017	11	posted	post	VBD
10_1101-2021_01_07_425723	1017	12	January	January	NNP
10_1101-2021_01_07_425723	1017	13	8	8	CD
10_1101-2021_01_07_425723	1017	14	,	,	,
10_1101-2021_01_07_425723	1017	15	2021	2021	CD
10_1101-2021_01_07_425723	1017	16	.	.	.
10_1101-2021_01_07_425723	1017	17	;	;	:
10_1101-2021_01_07_425723	1017	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	1017	19	:	:	:
10_1101-2021_01_07_425723	1017	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	1017	21	preprint	preprint	NN
10_1101-2021_01_07_425723	1017	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	1017	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	RB
10_1101-2021_01_07_425723	1017	24	62	62	CD
10_1101-2021_01_07_425723	1017	25	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	1017	26	Table	Table	NNP
10_1101-2021_01_07_425723	1017	27	1	1	CD
10_1101-2021_01_07_425723	1017	28	|	|	NNP
10_1101-2021_01_07_425723	1017	29	Mutations	Mutations	NNPS
10_1101-2021_01_07_425723	1017	30	identified	identify	VBN
10_1101-2021_01_07_425723	1017	31	by	by	IN
10_1101-2021_01_07_425723	1017	32	whole	whole	JJ
10_1101-2021_01_07_425723	1017	33	-	-	HYPH
10_1101-2021_01_07_425723	1017	34	genome	genome	RB
10_1101-2021_01_07_425723	1017	35	sequencing	sequencing	NN
10_1101-2021_01_07_425723	1017	36	in	in	IN
10_1101-2021_01_07_425723	1017	37	comparison	comparison	NN
10_1101-2021_01_07_425723	1017	38	to	to	IN
10_1101-2021_01_07_425723	1017	39	the	the	DT
10_1101-2021_01_07_425723	1017	40	1002	1002	CD
10_1101-2021_01_07_425723	1017	41	reference	reference	NN
10_1101-2021_01_07_425723	1017	42	K.	K.	NNP
10_1101-2021_01_07_425723	1017	43	marxianus	marxianus	NN
10_1101-2021_01_07_425723	1017	44	strain	strain	VBP
10_1101-2021_01_07_425723	1017	45	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	1017	46	.	.	.
10_1101-2021_01_07_425723	1018	1	Overview	overview	NN
10_1101-2021_01_07_425723	1018	2	of	of	IN
10_1101-2021_01_07_425723	1018	3	mutations	mutation	NNS
10_1101-2021_01_07_425723	1018	4	detected	detect	VBN
10_1101-2021_01_07_425723	1018	5	in	in	IN
10_1101-2021_01_07_425723	1018	6	the	the	DT
10_1101-2021_01_07_425723	1018	7	strains	strain	NNS
10_1101-2021_01_07_425723	1018	8	after	after	IN
10_1101-2021_01_07_425723	1018	9	selected	select	VBN
10_1101-2021_01_07_425723	1018	10	for	for	IN
10_1101-2021_01_07_425723	1018	11	1003	1003	CD
10_1101-2021_01_07_425723	1018	12	strict	strict	JJ
10_1101-2021_01_07_425723	1018	13	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1018	14	growth	growth	NN
10_1101-2021_01_07_425723	1018	15	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	1018	16	,	,	,
10_1101-2021_01_07_425723	1018	17	IMS1131	IMS1131	NNP
10_1101-2021_01_07_425723	1018	18	,	,	,
10_1101-2021_01_07_425723	1018	19	IMS1132	IMS1132	NNP
10_1101-2021_01_07_425723	1018	20	,	,	,
10_1101-2021_01_07_425723	1018	21	IMS1133	IMS1133	NNP
10_1101-2021_01_07_425723	1018	22	compared	compare	VBN
10_1101-2021_01_07_425723	1018	23	to	to	IN
10_1101-2021_01_07_425723	1018	24	the	the	DT
10_1101-2021_01_07_425723	1018	25	TtSTC1	ttstc1	NN
10_1101-2021_01_07_425723	1018	26	engineered	engineer	VBN
10_1101-2021_01_07_425723	1018	27	1004	1004	CD
10_1101-2021_01_07_425723	1018	28	strain	strain	NN
10_1101-2021_01_07_425723	1018	29	(	(	-LRB-
10_1101-2021_01_07_425723	1018	30	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	1018	31	)	)	-RRB-
10_1101-2021_01_07_425723	1018	32	.	.	.
10_1101-2021_01_07_425723	1019	1	Resequencing	resequence	VBG
10_1101-2021_01_07_425723	1019	2	of	of	IN
10_1101-2021_01_07_425723	1019	3	IMS1111	IMS1111	NNP
10_1101-2021_01_07_425723	1019	4	after	after	IN
10_1101-2021_01_07_425723	1019	5	4	4	CD
10_1101-2021_01_07_425723	1019	6	transfers	transfer	NNS
10_1101-2021_01_07_425723	1019	7	in	in	IN
10_1101-2021_01_07_425723	1019	8	strict	strict	JJ
10_1101-2021_01_07_425723	1019	9	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1019	10	conditions	condition	NNS
10_1101-2021_01_07_425723	1019	11	is	be	VBZ
10_1101-2021_01_07_425723	1019	12	for	for	IN
10_1101-2021_01_07_425723	1019	13	clarity	clarity	NN
10_1101-2021_01_07_425723	1019	14	1005	1005	CD
10_1101-2021_01_07_425723	1019	15	referred	refer	VBD
10_1101-2021_01_07_425723	1019	16	with	with	IN
10_1101-2021_01_07_425723	1019	17	the	the	DT
10_1101-2021_01_07_425723	1019	18	strain	strain	NN
10_1101-2021_01_07_425723	1019	19	name	name	NN
10_1101-2021_01_07_425723	1019	20	IMS1115	IMS1115	NNP
10_1101-2021_01_07_425723	1019	21	.	.	.
10_1101-2021_01_07_425723	1020	1	Overview	overview	NN
10_1101-2021_01_07_425723	1020	2	of	of	IN
10_1101-2021_01_07_425723	1020	3	mutations	mutation	NNS
10_1101-2021_01_07_425723	1020	4	of	of	IN
10_1101-2021_01_07_425723	1020	5	the	the	DT
10_1101-2021_01_07_425723	1020	6	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	1020	7	populations	population	NNS
10_1101-2021_01_07_425723	1020	8	after	after	IN
10_1101-2021_01_07_425723	1020	9	1006	1006	CD
10_1101-2021_01_07_425723	1020	10	prolonged	prolong	VBD
10_1101-2021_01_07_425723	1020	11	selection	selection	NN
10_1101-2021_01_07_425723	1020	12	for	for	IN
10_1101-2021_01_07_425723	1020	13	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1020	14	growth	growth	NN
10_1101-2021_01_07_425723	1020	15	at	at	IN
10_1101-2021_01_07_425723	1020	16	elevated	elevated	JJ
10_1101-2021_01_07_425723	1020	17	temperatures	temperature	NNS
10_1101-2021_01_07_425723	1020	18	,	,	,
10_1101-2021_01_07_425723	1020	19	represented	represent	VBN
10_1101-2021_01_07_425723	1020	20	by	by	IN
10_1101-2021_01_07_425723	1020	21	the	the	DT
10_1101-2021_01_07_425723	1020	22	bioreactor	bioreactor	NN
10_1101-2021_01_07_425723	1020	23	1007	1007	CD
10_1101-2021_01_07_425723	1020	24	replicates	replicates	NNP
10_1101-2021_01_07_425723	1020	25	(	(	-LRB-
10_1101-2021_01_07_425723	1020	26	M3R	M3R	NNP
10_1101-2021_01_07_425723	1020	27	,	,	,
10_1101-2021_01_07_425723	1020	28	M5R	M5R	NNP
10_1101-2021_01_07_425723	1020	29	,	,	,
10_1101-2021_01_07_425723	1020	30	and	and	CC
10_1101-2021_01_07_425723	1020	31	M6L	m6l	NN
10_1101-2021_01_07_425723	1020	32	)	)	-RRB-
10_1101-2021_01_07_425723	1020	33	.	.	.
10_1101-2021_01_07_425723	1021	1	Mutations	mutation	NNS
10_1101-2021_01_07_425723	1021	2	in	in	IN
10_1101-2021_01_07_425723	1021	3	coding	code	VBG
10_1101-2021_01_07_425723	1021	4	regions	region	NNS
10_1101-2021_01_07_425723	1021	5	are	be	VBP
10_1101-2021_01_07_425723	1021	6	annotated	annotate	VBN
10_1101-2021_01_07_425723	1021	7	as	as	IN
10_1101-2021_01_07_425723	1021	8	synonymous	synonymous	JJ
10_1101-2021_01_07_425723	1021	9	(	(	-LRB-
10_1101-2021_01_07_425723	1021	10	SYN	SYN	NNP
10_1101-2021_01_07_425723	1021	11	)	)	-RRB-
10_1101-2021_01_07_425723	1021	12	,	,	,
10_1101-2021_01_07_425723	1021	13	non-1008	non-1008	JJ
10_1101-2021_01_07_425723	1021	14	synonymous	synonymous	JJ
10_1101-2021_01_07_425723	1021	15	(	(	-LRB-
10_1101-2021_01_07_425723	1021	16	NSY	NSY	NNP
10_1101-2021_01_07_425723	1021	17	)	)	-RRB-
10_1101-2021_01_07_425723	1021	18	,	,	,
10_1101-2021_01_07_425723	1021	19	insertion	insertion	NN
10_1101-2021_01_07_425723	1021	20	or	or	CC
10_1101-2021_01_07_425723	1021	21	deletions	deletion	NNS
10_1101-2021_01_07_425723	1021	22	.	.	.
10_1101-2021_01_07_425723	1022	1	Mutations	mutation	NNS
10_1101-2021_01_07_425723	1022	2	in	in	IN
10_1101-2021_01_07_425723	1022	3	non	non	JJ
10_1101-2021_01_07_425723	1022	4	-	-	JJ
10_1101-2021_01_07_425723	1022	5	coding	coding	JJ
10_1101-2021_01_07_425723	1022	6	regions	region	NNS
10_1101-2021_01_07_425723	1022	7	are	be	VBP
10_1101-2021_01_07_425723	1022	8	reported	report	VBN
10_1101-2021_01_07_425723	1022	9	with	with	IN
10_1101-2021_01_07_425723	1022	10	the	the	DT
10_1101-2021_01_07_425723	1022	11	1009	1009	CD
10_1101-2021_01_07_425723	1022	12	identifier	identifier	NN
10_1101-2021_01_07_425723	1022	13	of	of	IN
10_1101-2021_01_07_425723	1022	14	the	the	DT
10_1101-2021_01_07_425723	1022	15	neighboring	neighboring	NN
10_1101-2021_01_07_425723	1022	16	gene	gene	NN
10_1101-2021_01_07_425723	1022	17	,	,	,
10_1101-2021_01_07_425723	1022	18	directionality	directionality	NN
10_1101-2021_01_07_425723	1022	19	and	and	CC
10_1101-2021_01_07_425723	1022	20	strand	strand	NNP
10_1101-2021_01_07_425723	1022	21	(	(	-LRB-
10_1101-2021_01_07_425723	1022	22	+	+	SYM
10_1101-2021_01_07_425723	1022	23	/-	/-	.
10_1101-2021_01_07_425723	1022	24	)	)	-RRB-
10_1101-2021_01_07_425723	1022	25	.	.	.
10_1101-2021_01_07_425723	1023	1	For	for	IN
10_1101-2021_01_07_425723	1023	2	K.	K.	NNP
10_1101-2021_01_07_425723	1023	3	marxianus	marxianus	JJ
10_1101-2021_01_07_425723	1023	4	genes	gene	NNS
10_1101-2021_01_07_425723	1023	5	,	,	,
10_1101-2021_01_07_425723	1023	6	corresponding	correspond	VBG
10_1101-2021_01_07_425723	1023	7	1010	1010	CD
10_1101-2021_01_07_425723	1023	8	S.	S.	NNP
10_1101-2021_01_07_425723	1023	9	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	1023	10	orthologs	ortholog	VBZ
10_1101-2021_01_07_425723	1023	11	with	with	IN
10_1101-2021_01_07_425723	1023	12	the	the	DT
10_1101-2021_01_07_425723	1023	13	S288C	S288C	NNP
10_1101-2021_01_07_425723	1023	14	identifier	identifier	NNP
10_1101-2021_01_07_425723	1023	15	are	be	VBP
10_1101-2021_01_07_425723	1023	16	listed	list	VBN
10_1101-2021_01_07_425723	1023	17	if	if	IN
10_1101-2021_01_07_425723	1023	18	applicable	applicable	JJ
10_1101-2021_01_07_425723	1023	19	.	.	.
10_1101-2021_01_07_425723	1024	1	QD	QD	NNP
10_1101-2021_01_07_425723	1024	2	refers	refer	VBZ
10_1101-2021_01_07_425723	1024	3	to	to	IN
10_1101-2021_01_07_425723	1024	4	quality	quality	NN
10_1101-2021_01_07_425723	1024	5	by	by	IN
10_1101-2021_01_07_425723	1024	6	depth	depth	NN
10_1101-2021_01_07_425723	1024	7	1011	1011	CD
10_1101-2021_01_07_425723	1024	8	calculated	calculate	VBN
10_1101-2021_01_07_425723	1024	9	by	by	IN
10_1101-2021_01_07_425723	1024	10	GATK	GATK	NNP
10_1101-2021_01_07_425723	1024	11	and	and	CC
10_1101-2021_01_07_425723	1024	12	genotyping	genotyping	NNP
10_1101-2021_01_07_425723	1024	13	overviews	overview	NNS
10_1101-2021_01_07_425723	1024	14	are	be	VBP
10_1101-2021_01_07_425723	1024	15	given	give	VBN
10_1101-2021_01_07_425723	1024	16	per	per	IN
10_1101-2021_01_07_425723	1024	17	strain	strain	NN
10_1101-2021_01_07_425723	1024	18	using	use	VBG
10_1101-2021_01_07_425723	1024	19	the	the	DT
10_1101-2021_01_07_425723	1024	20	GATK	GATK	NNP
10_1101-2021_01_07_425723	1024	21	fields	field	VBZ
10_1101-2021_01_07_425723	1024	22	GT	GT	NNP
10_1101-2021_01_07_425723	1024	23	:	:	:
10_1101-2021_01_07_425723	1024	24	1/1	1/1	CD
10_1101-2021_01_07_425723	1024	25	for	for	IN
10_1101-2021_01_07_425723	1024	26	1012	1012	CD
10_1101-2021_01_07_425723	1024	27	homozygous	homozygous	JJ
10_1101-2021_01_07_425723	1024	28	alternative	alternative	NN
10_1101-2021_01_07_425723	1024	29	,	,	,
10_1101-2021_01_07_425723	1024	30	1/0	1/0	CD
10_1101-2021_01_07_425723	1024	31	for	for	IN
10_1101-2021_01_07_425723	1024	32	heterozygous	heterozygous	JJ
10_1101-2021_01_07_425723	1024	33	,	,	,
10_1101-2021_01_07_425723	1024	34	AD	ad	NN
10_1101-2021_01_07_425723	1024	35	:	:	:
10_1101-2021_01_07_425723	1024	36	allelic	allelic	JJ
10_1101-2021_01_07_425723	1024	37	depth	depth	NN
10_1101-2021_01_07_425723	1024	38	(	(	-LRB-
10_1101-2021_01_07_425723	1024	39	number	number	NN
10_1101-2021_01_07_425723	1024	40	of	of	IN
10_1101-2021_01_07_425723	1024	41	reads	read	NNS
10_1101-2021_01_07_425723	1024	42	per	per	IN
10_1101-2021_01_07_425723	1024	43	reference	reference	NN
10_1101-2021_01_07_425723	1024	44	and	and	CC
10_1101-2021_01_07_425723	1024	45	1013	1013	CD
10_1101-2021_01_07_425723	1024	46	alternative	alternative	JJ
10_1101-2021_01_07_425723	1024	47	alleles	allele	NNS
10_1101-2021_01_07_425723	1024	48	called	call	VBD
10_1101-2021_01_07_425723	1024	49	)	)	-RRB-
10_1101-2021_01_07_425723	1024	50	,	,	,
10_1101-2021_01_07_425723	1024	51	DP	dp	NN
10_1101-2021_01_07_425723	1024	52	:	:	:
10_1101-2021_01_07_425723	1024	53	approximate	approximate	RB
10_1101-2021_01_07_425723	1024	54	read	read	VBD
10_1101-2021_01_07_425723	1024	55	depth	depth	NN
10_1101-2021_01_07_425723	1024	56	at	at	IN
10_1101-2021_01_07_425723	1024	57	the	the	DT
10_1101-2021_01_07_425723	1024	58	corresponding	correspond	VBG
10_1101-2021_01_07_425723	1024	59	genomic	genomic	JJ
10_1101-2021_01_07_425723	1024	60	position	position	NN
10_1101-2021_01_07_425723	1024	61	,	,	,
10_1101-2021_01_07_425723	1024	62	and	and	CC
10_1101-2021_01_07_425723	1024	63	GQ	GQ	NNP
10_1101-2021_01_07_425723	1024	64	:	:	:
10_1101-2021_01_07_425723	1024	65	1014	1014	CD
10_1101-2021_01_07_425723	1024	66	genotype	genotype	NNP
10_1101-2021_01_07_425723	1024	67	quality	quality	NN
10_1101-2021_01_07_425723	1024	68	.	.	.
10_1101-2021_01_07_425723	1025	1	NA	NA	NNP
10_1101-2021_01_07_425723	1025	2	indicates	indicate	VBZ
10_1101-2021_01_07_425723	1025	3	variants	variant	NNS
10_1101-2021_01_07_425723	1025	4	were	be	VBD
10_1101-2021_01_07_425723	1025	5	not	not	RB
10_1101-2021_01_07_425723	1025	6	called	call	VBN
10_1101-2021_01_07_425723	1025	7	in	in	IN
10_1101-2021_01_07_425723	1025	8	that	that	DT
10_1101-2021_01_07_425723	1025	9	position	position	NN
10_1101-2021_01_07_425723	1025	10	in	in	IN
10_1101-2021_01_07_425723	1025	11	the	the	DT
10_1101-2021_01_07_425723	1025	12	corresponding	corresponding	JJ
10_1101-2021_01_07_425723	1025	13	strain	strain	NN
10_1101-2021_01_07_425723	1025	14	.	.	.
10_1101-2021_01_07_425723	1026	1	1015	1015	CD
10_1101-2021_01_07_425723	1026	2	Chro	Chro	NNP
10_1101-2021_01_07_425723	1026	3	mos	mos	NN
10_1101-2021_01_07_425723	1026	4	ome	ome	UH
10_1101-2021_01_07_425723	1026	5	Po	Po	NNP
10_1101-2021_01_07_425723	1026	6	siti	siti	NNP
10_1101-2021_01_07_425723	1026	7	on	on	IN
10_1101-2021_01_07_425723	1026	8	Descri	Descri	NNP
10_1101-2021_01_07_425723	1026	9	ption	ption	NN
10_1101-2021_01_07_425723	1026	10	Type	Type	NNP
10_1101-2021_01_07_425723	1026	11	Kmar	Kmar	NNP
10_1101-2021_01_07_425723	1026	12	ID	ID	NNP
10_1101-2021_01_07_425723	1026	13	S28	S28	NNP
10_1101-2021_01_07_425723	1026	14	8cSy	8csy	CD
10_1101-2021_01_07_425723	1026	15	stID	stID	NNP
10_1101-2021_01_07_425723	1026	16	G	G	NNP
10_1101-2021_01_07_425723	1026	17	e	e	NN
10_1101-2021_01_07_425723	1026	18	n	n	NN
10_1101-2021_01_07_425723	1026	19	e	e	NN
10_1101-2021_01_07_425723	1026	20	Q	q	NN
10_1101-2021_01_07_425723	1026	21	D	d	NN
10_1101-2021_01_07_425723	1026	22	IM	IM	NNP
10_1101-2021_01_07_425723	1026	23	X2	x2	NN
10_1101-2021_01_07_425723	1026	24	32	32	CD
10_1101-2021_01_07_425723	1026	25	3	3	CD
10_1101-2021_01_07_425723	1026	26	IMS11	IMS11	NNP
10_1101-2021_01_07_425723	1026	27	11	11	CD
10_1101-2021_01_07_425723	1026	28	IMS	IMS	NNP
10_1101-2021_01_07_425723	1026	29	113	113	CD
10_1101-2021_01_07_425723	1026	30	1	1	CD
10_1101-2021_01_07_425723	1026	31	IMS1	ims1	CD
10_1101-2021_01_07_425723	1026	32	132	132	CD
10_1101-2021_01_07_425723	1026	33	IMS	IMS	NNP
10_1101-2021_01_07_425723	1026	34	113	113	CD
10_1101-2021_01_07_425723	1026	35	3	3	CD
10_1101-2021_01_07_425723	1026	36	IMS11	IMS11	NNP
10_1101-2021_01_07_425723	1026	37	15	15	CD
10_1101-2021_01_07_425723	1026	38	M3R	M3R	NNP
10_1101-2021_01_07_425723	1026	39	M5R	M5R	NNP
10_1101-2021_01_07_425723	1026	40	M6L	M6L	NNP
10_1101-2021_01_07_425723	1026	41	Mutation	Mutation	NNP
10_1101-2021_01_07_425723	1026	42	spectra	spectra	NN
10_1101-2021_01_07_425723	1026	43	of	of	IN
10_1101-2021_01_07_425723	1026	44	IMX2323	IMX2323	NNP
10_1101-2021_01_07_425723	1026	45	derived	derive	VBD
10_1101-2021_01_07_425723	1026	46	single	single	JJ
10_1101-2021_01_07_425723	1026	47	isolates	isolate	NNS
10_1101-2021_01_07_425723	1026	48	after	after	IN
10_1101-2021_01_07_425723	1026	49	selection	selection	NN
10_1101-2021_01_07_425723	1026	50	for	for	IN
10_1101-2021_01_07_425723	1026	51	strict	strict	JJ
10_1101-2021_01_07_425723	1026	52	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1026	53	growth	growth	NN
10_1101-2021_01_07_425723	1026	54	3	3	CD
10_1101-2021_01_07_425723	1026	55	89	89	CD
10_1101-2021_01_07_425723	1026	56	78	78	CD
10_1101-2021_01_07_425723	1026	57	44	44	CD
10_1101-2021_01_07_425723	1026	58	Asp-	Asp-	NNP
10_1101-2021_01_07_425723	1026	59	747-	747-	CD
10_1101-2021_01_07_425723	1026	60	Asp	Asp	NNP
10_1101-2021_01_07_425723	1026	61	CDS:(S	cds:(s	NN
10_1101-2021_01_07_425723	1026	62	YN	YN	NNP
10_1101-2021_01_07_425723	1026	63	)	)	-RRB-
10_1101-2021_01_07_425723	1026	64	TPUv	TPUv	VBZ
10_1101-2021_01_07_425723	1026	65	2_00	2_00	CD
10_1101-2021_01_07_425723	1026	66	2092	2092	CD
10_1101-2021_01_07_425723	1026	67	YDR	YDR	NNP
10_1101-2021_01_07_425723	1026	68	283	283	CD
10_1101-2021_01_07_425723	1026	69	C	c	NN
10_1101-2021_01_07_425723	1026	70	G	g	NN
10_1101-2021_01_07_425723	1026	71	cn	cn	NN
10_1101-2021_01_07_425723	1026	72	2	2	CD
10_1101-2021_01_07_425723	1026	73	3	3	CD
10_1101-2021_01_07_425723	1026	74	2	2	CD
10_1101-2021_01_07_425723	1026	75	NA	NA	NNP
10_1101-2021_01_07_425723	1026	76	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	77	,	,	,
10_1101-2021_01_07_425723	1026	78	120:1	120:1	CD
10_1101-2021_01_07_425723	1026	79	20:99	20:99	CD
10_1101-2021_01_07_425723	1026	80	NA	na	CD
10_1101-2021_01_07_425723	1026	81	NA	NA	NNP
10_1101-2021_01_07_425723	1026	82	NA	NA	NNP
10_1101-2021_01_07_425723	1026	83	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	84	,	,	,
10_1101-2021_01_07_425723	1026	85	105:1	105:1	CD
10_1101-2021_01_07_425723	1026	86	05:99	05:99	CD
10_1101-2021_01_07_425723	1026	87	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	88	,	,	,
10_1101-2021_01_07_425723	1026	89	99:9	99:9	CD
10_1101-2021_01_07_425723	1026	90	9:99	9:99	CD
10_1101-2021_01_07_425723	1026	91	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	92	,	,	,
10_1101-2021_01_07_425723	1026	93	110:1	110:1	CD
10_1101-2021_01_07_425723	1026	94	10:99	10:99	CD
10_1101-2021_01_07_425723	1026	95	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	96	,	,	,
10_1101-2021_01_07_425723	1026	97	118:1	118:1	CD
10_1101-2021_01_07_425723	1026	98	18:99	18:99	CD
10_1101-2021_01_07_425723	1026	99	8	8	CD
10_1101-2021_01_07_425723	1026	100	59	59	CD
10_1101-2021_01_07_425723	1026	101	15	15	CD
10_1101-2021_01_07_425723	1026	102	6	6	CD
10_1101-2021_01_07_425723	1026	103	codon	codon	NN
10_1101-2021_01_07_425723	1026	104	:	:	:
10_1101-2021_01_07_425723	1026	105	TCA	TCA	NNP
10_1101-2021_01_07_425723	1026	106	CDS	CDS	NNP
10_1101-2021_01_07_425723	1026	107	:	:	:
10_1101-2021_01_07_425723	1026	108	IN	in	IN
10_1101-2021_01_07_425723	1026	109	SERTI	SERTI	NNP
10_1101-2021_01_07_425723	1026	110	ON[1	ON[1	NNP
10_1101-2021_01_07_425723	1026	111	]	]	-RRB-
10_1101-2021_01_07_425723	1026	112	TPUv	TPUv	VBZ
10_1101-2021_01_07_425723	1026	113	2_00	2_00	CD
10_1101-2021_01_07_425723	1026	114	4766	4766	CD
10_1101-2021_01_07_425723	1026	115	Tran	Tran	NNP
10_1101-2021_01_07_425723	1026	116	spos	spo	VBD
10_1101-2021_01_07_425723	1026	117	on	on	IN
10_1101-2021_01_07_425723	1026	118	2	2	CD
10_1101-2021_01_07_425723	1026	119	7	7	CD
10_1101-2021_01_07_425723	1026	120	NA	NA	NNP
10_1101-2021_01_07_425723	1026	121	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	122	,	,	,
10_1101-2021_01_07_425723	1026	123	7:7:21	7:7:21	CD
10_1101-2021_01_07_425723	1026	124	NA	NA	NNP
10_1101-2021_01_07_425723	1026	125	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	126	,	,	,
10_1101-2021_01_07_425723	1026	127	15:1	15:1	CD
10_1101-2021_01_07_425723	1026	128	5:45	5:45	CD
10_1101-2021_01_07_425723	1026	129	1/1	1/1	CD
10_1101-2021_01_07_425723	1026	130	:	:	:
10_1101-2021_01_07_425723	1026	131	0,9	0,9	CD
10_1101-2021_01_07_425723	1026	132	:	:	:
10_1101-2021_01_07_425723	1026	133	9:27	9:27	CD
10_1101-2021_01_07_425723	1026	134	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	135	,	,	,
10_1101-2021_01_07_425723	1026	136	9:9:27	9:9:27	NNP
10_1101-2021_01_07_425723	1026	137	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	138	,	,	,
10_1101-2021_01_07_425723	1026	139	12:1	12:1	CD
10_1101-2021_01_07_425723	1026	140	2:36	2:36	CD
10_1101-2021_01_07_425723	1026	141	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	142	,	,	,
10_1101-2021_01_07_425723	1026	143	7:7:21	7:7:21	NNP
10_1101-2021_01_07_425723	1026	144	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	145	,	,	,
10_1101-2021_01_07_425723	1026	146	7:7:21	7:7:21	CD
10_1101-2021_01_07_425723	1026	147	8	8	CD
10_1101-2021_01_07_425723	1026	148	55	55	CD
10_1101-2021_01_07_425723	1026	149	04	04	CD
10_1101-2021_01_07_425723	1026	150	50	50	CD
10_1101-2021_01_07_425723	1026	151	Trp-	trp-	CD
10_1101-2021_01_07_425723	1026	152	350-	350-	CD
10_1101-2021_01_07_425723	1026	153	STP	STP	NNP
10_1101-2021_01_07_425723	1026	154	CDS:(N	cds:(n	NN
10_1101-2021_01_07_425723	1026	155	ON	on	NN
10_1101-2021_01_07_425723	1026	156	)	)	-RRB-
10_1101-2021_01_07_425723	1026	157	TPUv	TPUv	NNS
10_1101-2021_01_07_425723	1026	158	2_00	2_00	CD
10_1101-2021_01_07_425723	1026	159	4999	4999	CD
10_1101-2021_01_07_425723	1026	160	YAL	YAL	NNP
10_1101-2021_01_07_425723	1026	161	040	040	CD
10_1101-2021_01_07_425723	1026	162	C	c	NN
10_1101-2021_01_07_425723	1026	163	Cl	Cl	NNP
10_1101-2021_01_07_425723	1026	164	n	n	NN
10_1101-2021_01_07_425723	1026	165	3	3	CD
10_1101-2021_01_07_425723	1026	166	2	2	CD
10_1101-2021_01_07_425723	1026	167	3	3	CD
10_1101-2021_01_07_425723	1026	168	NA	NA	NNP
10_1101-2021_01_07_425723	1026	169	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	170	,	,	,
10_1101-2021_01_07_425723	1026	171	119:1	119:1	CD
10_1101-2021_01_07_425723	1026	172	19:99	19:99	CD
10_1101-2021_01_07_425723	1026	173	NA	na	NN
10_1101-2021_01_07_425723	1026	174	NA	NA	NNP
10_1101-2021_01_07_425723	1026	175	NA	NA	NNP
10_1101-2021_01_07_425723	1026	176	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	177	,	,	,
10_1101-2021_01_07_425723	1026	178	143:1	143:1	CD
10_1101-2021_01_07_425723	1026	179	43:99	43:99	CD
10_1101-2021_01_07_425723	1026	180	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	181	,	,	,
10_1101-2021_01_07_425723	1026	182	89:8	89:8	CD
10_1101-2021_01_07_425723	1026	183	9:99	9:99	CD
10_1101-2021_01_07_425723	1026	184	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	185	,	,	,
10_1101-2021_01_07_425723	1026	186	117:1	117:1	CD
10_1101-2021_01_07_425723	1026	187	17:99	17:99	CD
10_1101-2021_01_07_425723	1026	188	1/1:1	1/1:1	CD
10_1101-2021_01_07_425723	1026	189	,	,	,
10_1101-2021_01_07_425723	1026	190	98:99	98:99	CD
10_1101-2021_01_07_425723	1026	191	:	:	:
10_1101-2021_01_07_425723	1026	192	99	99	CD
10_1101-2021_01_07_425723	1026	193	4	4	CD
10_1101-2021_01_07_425723	1026	194	45	45	CD
10_1101-2021_01_07_425723	1026	195	97	97	CD
10_1101-2021_01_07_425723	1026	196	50	50	CD
10_1101-2021_01_07_425723	1026	197	TPUv2	tpuv2	NN
10_1101-2021_01_07_425723	1026	198	_	_	NNP
10_1101-2021_01_07_425723	1026	199	0026	0026	CD
10_1101-2021_01_07_425723	1026	200	39-T1	39-t1	CD
10_1101-2021_01_07_425723	1026	201	p3UTR	p3UTR	NNP
10_1101-2021_01_07_425723	1026	202	:	:	:
10_1101-2021_01_07_425723	1026	203	+	+	SYM
10_1101-2021_01_07_425723	1026	204	TPUv	TPUv	NNS
10_1101-2021_01_07_425723	1026	205	2_00	2_00	CD
10_1101-2021_01_07_425723	1026	206	2639	2639	CD
10_1101-2021_01_07_425723	1026	207	YGR	YGR	NNP
10_1101-2021_01_07_425723	1026	208	156	156	CD
10_1101-2021_01_07_425723	1026	209	W	W	NNP
10_1101-2021_01_07_425723	1026	210	Pt	Pt	NNP
10_1101-2021_01_07_425723	1026	211	i1	i1	NN
10_1101-2021_01_07_425723	1026	212	3	3	CD
10_1101-2021_01_07_425723	1026	213	5	5	CD
10_1101-2021_01_07_425723	1026	214	NA	NA	NNP
10_1101-2021_01_07_425723	1026	215	NA	NA	NNP
10_1101-2021_01_07_425723	1026	216	1/1	1/1	CD
10_1101-2021_01_07_425723	1026	217	:	:	:
10_1101-2021_01_07_425723	1026	218	0,9	0,9	CD
10_1101-2021_01_07_425723	1026	219	:	:	:
10_1101-2021_01_07_425723	1026	220	9:29	9:29	CD
10_1101-2021_01_07_425723	1026	221	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	222	,	,	,
10_1101-2021_01_07_425723	1026	223	9:11	9:11	CD
10_1101-2021_01_07_425723	1026	224	:	:	:
10_1101-2021_01_07_425723	1026	225	54	54	CD
10_1101-2021_01_07_425723	1026	226	1/1	1/1	CD
10_1101-2021_01_07_425723	1026	227	:	:	:
10_1101-2021_01_07_425723	1026	228	0,9	0,9	CD
10_1101-2021_01_07_425723	1026	229	:	:	:
10_1101-2021_01_07_425723	1026	230	9:38	9:38	CD
10_1101-2021_01_07_425723	1026	231	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	232	,	,	,
10_1101-2021_01_07_425723	1026	233	4:6:24	4:6:24	NNP
10_1101-2021_01_07_425723	1026	234	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	235	,	,	,
10_1101-2021_01_07_425723	1026	236	10:1	10:1	CD
10_1101-2021_01_07_425723	1026	237	0:35	0:35	CD
10_1101-2021_01_07_425723	1026	238	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	239	,	,	,
10_1101-2021_01_07_425723	1026	240	7:7:26	7:7:26	CD
10_1101-2021_01_07_425723	1026	241	NA	na	TO
10_1101-2021_01_07_425723	1026	242	5	5	CD
10_1101-2021_01_07_425723	1026	243	17	17	CD
10_1101-2021_01_07_425723	1026	244	74	74	CD
10_1101-2021_01_07_425723	1026	245	29	29	CD
10_1101-2021_01_07_425723	1026	246	TPUv2	tpuv2	NN
10_1101-2021_01_07_425723	1026	247	_	_	NNP
10_1101-2021_01_07_425723	1026	248	0031	0031	CD
10_1101-2021_01_07_425723	1026	249	61-T1	61-t1	CD
10_1101-2021_01_07_425723	1026	250	p5UTR	p5UTR	NNP
10_1101-2021_01_07_425723	1026	251	:	:	:
10_1101-2021_01_07_425723	1026	252	-	-	:
10_1101-2021_01_07_425723	1026	253	TPUv	TPUv	NNS
10_1101-2021_01_07_425723	1026	254	2_00	2_00	CD
10_1101-2021_01_07_425723	1026	255	3161	3161	CD
10_1101-2021_01_07_425723	1026	256	YBR	YBR	NNP
10_1101-2021_01_07_425723	1026	257	283	283	CD
10_1101-2021_01_07_425723	1026	258	C	C	NNP
10_1101-2021_01_07_425723	1026	259	Ss	Ss	NNP
10_1101-2021_01_07_425723	1026	260	h	h	NN
10_1101-2021_01_07_425723	1026	261	1	1	CD
10_1101-2021_01_07_425723	1026	262	2	2	CD
10_1101-2021_01_07_425723	1026	263	7	7	CD
10_1101-2021_01_07_425723	1026	264	NA	NA	NNP
10_1101-2021_01_07_425723	1026	265	NA	NA	NNP
10_1101-2021_01_07_425723	1026	266	1/1	1/1	CD
10_1101-2021_01_07_425723	1026	267	:	:	:
10_1101-2021_01_07_425723	1026	268	0,9	0,9	CD
10_1101-2021_01_07_425723	1026	269	:	:	:
10_1101-2021_01_07_425723	1026	270	9:27	9:27	CD
10_1101-2021_01_07_425723	1026	271	NA	NA	NNP
10_1101-2021_01_07_425723	1026	272	NA	NA	NNP
10_1101-2021_01_07_425723	1026	273	0/1:1	0/1:1	CD
10_1101-2021_01_07_425723	1026	274	,	,	,
10_1101-2021_01_07_425723	1026	275	7:8:21	7:8:21	VBG
10_1101-2021_01_07_425723	1026	276	NA	na	IN
10_1101-2021_01_07_425723	1026	277	NA	na	IN
10_1101-2021_01_07_425723	1026	278	NA	na	TO
10_1101-2021_01_07_425723	1026	279	5	5	CD
10_1101-2021_01_07_425723	1026	280	90	90	CD
10_1101-2021_01_07_425723	1026	281	94	94	CD
10_1101-2021_01_07_425723	1026	282	77	77	CD
10_1101-2021_01_07_425723	1026	283	UTP22	UTP22	NNP
10_1101-2021_01_07_425723	1026	284	p5UTR	p5UTR	NNP
10_1101-2021_01_07_425723	1026	285	:	:	:
10_1101-2021_01_07_425723	1026	286	+	+	SYM
10_1101-2021_01_07_425723	1026	287	TPUv	TPUv	NNS
10_1101-2021_01_07_425723	1026	288	2_00	2_00	CD
10_1101-2021_01_07_425723	1026	289	3518	3518	CD
10_1101-2021_01_07_425723	1026	290	YGR	YGR	NNP
10_1101-2021_01_07_425723	1026	291	090	090	CD
10_1101-2021_01_07_425723	1026	292	W	w	NN
10_1101-2021_01_07_425723	1026	293	U	u	NN
10_1101-2021_01_07_425723	1026	294	tp	tp	NN
10_1101-2021_01_07_425723	1026	295	2	2	CD
10_1101-2021_01_07_425723	1026	296	2	2	CD
10_1101-2021_01_07_425723	1026	297	3	3	CD
10_1101-2021_01_07_425723	1026	298	5	5	CD
10_1101-2021_01_07_425723	1026	299	NA	NA	NNP
10_1101-2021_01_07_425723	1026	300	1/1:1	1/1:1	CD
10_1101-2021_01_07_425723	1026	301	,	,	,
10_1101-2021_01_07_425723	1026	302	11:12	11:12	CD
10_1101-2021_01_07_425723	1026	303	:	:	:
10_1101-2021_01_07_425723	1026	304	34	34	CD
10_1101-2021_01_07_425723	1026	305	NA	na	NN
10_1101-2021_01_07_425723	1026	306	NA	NA	NNP
10_1101-2021_01_07_425723	1026	307	1/1	1/1	CD
10_1101-2021_01_07_425723	1026	308	:	:	:
10_1101-2021_01_07_425723	1026	309	1,8	1,8	CD
10_1101-2021_01_07_425723	1026	310	:	:	:
10_1101-2021_01_07_425723	1026	311	9:24	9:24	CD
10_1101-2021_01_07_425723	1026	312	1/1:0	1/1:0	CD
10_1101-2021_01_07_425723	1026	313	,	,	,
10_1101-2021_01_07_425723	1026	314	11:11	11:11	CD
10_1101-2021_01_07_425723	1026	315	:	:	SYM
10_1101-2021_01_07_425723	1026	316	36	36	CD
10_1101-2021_01_07_425723	1026	317	NA	na	NN
10_1101-2021_01_07_425723	1026	318	NA	NA	NNP
10_1101-2021_01_07_425723	1026	319	NA	NA	NNP
10_1101-2021_01_07_425723	1026	320	Mutations	Mutations	NNPS
10_1101-2021_01_07_425723	1026	321	in	in	IN
10_1101-2021_01_07_425723	1026	322	whole	whole	JJ
10_1101-2021_01_07_425723	1026	323	populations	population	NNS
10_1101-2021_01_07_425723	1026	324	after	after	IN
10_1101-2021_01_07_425723	1026	325	selection	selection	NN
10_1101-2021_01_07_425723	1026	326	for	for	IN
10_1101-2021_01_07_425723	1026	327	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1026	328	growth	growth	NN
10_1101-2021_01_07_425723	1026	329	at	at	IN
10_1101-2021_01_07_425723	1026	330	elevated	elevated	JJ
10_1101-2021_01_07_425723	1026	331	temperatures	temperature	NNS
10_1101-2021_01_07_425723	1026	332	.CC	.CC	NFP
10_1101-2021_01_07_425723	1026	333	-	-	:
10_1101-2021_01_07_425723	1026	334	BY	by	IN
10_1101-2021_01_07_425723	1026	335	-	-	HYPH
10_1101-2021_01_07_425723	1026	336	NC	NC	NNP
10_1101-2021_01_07_425723	1026	337	-	-	HYPH
10_1101-2021_01_07_425723	1026	338	ND	ND	NNP
10_1101-2021_01_07_425723	1026	339	4.0	4.0	CD
10_1101-2021_01_07_425723	1026	340	International	International	NNP
10_1101-2021_01_07_425723	1026	341	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	1026	342	under	under	IN
10_1101-2021_01_07_425723	1026	343	a	a	DT
10_1101-2021_01_07_425723	1026	344	(	(	-LRB-
10_1101-2021_01_07_425723	1026	345	which	which	WDT
10_1101-2021_01_07_425723	1026	346	was	be	VBD
10_1101-2021_01_07_425723	1026	347	not	not	RB
10_1101-2021_01_07_425723	1026	348	certified	certify	VBN
10_1101-2021_01_07_425723	1026	349	by	by	IN
10_1101-2021_01_07_425723	1026	350	peer	peer	NN
10_1101-2021_01_07_425723	1026	351	review	review	NN
10_1101-2021_01_07_425723	1026	352	)	)	-RRB-
10_1101-2021_01_07_425723	1026	353	is	be	VBZ
10_1101-2021_01_07_425723	1026	354	the	the	DT
10_1101-2021_01_07_425723	1026	355	author	author	NN
10_1101-2021_01_07_425723	1026	356	/	/	SYM
10_1101-2021_01_07_425723	1026	357	funder	funder	NN
10_1101-2021_01_07_425723	1026	358	,	,	,
10_1101-2021_01_07_425723	1026	359	who	who	WP
10_1101-2021_01_07_425723	1026	360	has	have	VBZ
10_1101-2021_01_07_425723	1026	361	granted	grant	VBN
10_1101-2021_01_07_425723	1026	362	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	1026	363	a	a	DT
10_1101-2021_01_07_425723	1026	364	license	license	NN
10_1101-2021_01_07_425723	1026	365	to	to	TO
10_1101-2021_01_07_425723	1026	366	display	display	VB
10_1101-2021_01_07_425723	1026	367	the	the	DT
10_1101-2021_01_07_425723	1026	368	preprint	preprint	NN
10_1101-2021_01_07_425723	1026	369	in	in	IN
10_1101-2021_01_07_425723	1026	370	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	1026	371	.	.	.
10_1101-2021_01_07_425723	1027	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	1027	2	is	be	VBZ
10_1101-2021_01_07_425723	1027	3	made	make	VBN
10_1101-2021_01_07_425723	1027	4	The	the	DT
10_1101-2021_01_07_425723	1027	5	copyright	copyright	NN
10_1101-2021_01_07_425723	1027	6	holder	holder	NN
10_1101-2021_01_07_425723	1027	7	for	for	IN
10_1101-2021_01_07_425723	1027	8	this	this	DT
10_1101-2021_01_07_425723	1027	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	1027	10	version	version	NN
10_1101-2021_01_07_425723	1027	11	posted	post	VBD
10_1101-2021_01_07_425723	1027	12	January	January	NNP
10_1101-2021_01_07_425723	1027	13	8	8	CD
10_1101-2021_01_07_425723	1027	14	,	,	,
10_1101-2021_01_07_425723	1027	15	2021	2021	CD
10_1101-2021_01_07_425723	1027	16	.	.	.
10_1101-2021_01_07_425723	1027	17	;	;	:
10_1101-2021_01_07_425723	1027	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	1027	19	:	:	:
10_1101-2021_01_07_425723	1027	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	1027	21	preprint	preprint	NN
10_1101-2021_01_07_425723	1027	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	1027	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	1027	24	63	63	CD
10_1101-2021_01_07_425723	1027	25	3	3	CD
10_1101-2021_01_07_425723	1027	26	13	13	CD
10_1101-2021_01_07_425723	1027	27	52	52	CD
10_1101-2021_01_07_425723	1027	28	43	43	CD
10_1101-2021_01_07_425723	1027	29	0	0	CD
10_1101-2021_01_07_425723	1027	30	codon	codon	NN
10_1101-2021_01_07_425723	1027	31	:	:	:
10_1101-2021_01_07_425723	1027	32	AAT	AAT	NNP
10_1101-2021_01_07_425723	1027	33	CDS	CDS	NNP
10_1101-2021_01_07_425723	1027	34	:	:	:
10_1101-2021_01_07_425723	1027	35	D	d	NN
10_1101-2021_01_07_425723	1027	36	ELETIO	eletio	JJ
10_1101-2021_01_07_425723	1027	37	N[-3	N[-3	NNS
10_1101-2021_01_07_425723	1027	38	]	]	-RRB-
10_1101-2021_01_07_425723	1027	39	TPUv	TPUv	NNS
10_1101-2021_01_07_425723	1027	40	2_00	2_00	CD
10_1101-2021_01_07_425723	1027	41	2327	2327	CD
10_1101-2021_01_07_425723	1027	42	YLR	YLR	NNP
10_1101-2021_01_07_425723	1027	43	352	352	CD
10_1101-2021_01_07_425723	1027	44	W	W	NNP
10_1101-2021_01_07_425723	1027	45	Lu	Lu	NNP
10_1101-2021_01_07_425723	1027	46	g	g	NN
10_1101-2021_01_07_425723	1027	47	1	1	CD
10_1101-2021_01_07_425723	1027	48	2	2	CD
10_1101-2021_01_07_425723	1027	49	2	2	CD
10_1101-2021_01_07_425723	1027	50	NA	na	NN
10_1101-2021_01_07_425723	1027	51	NA	NA	NNP
10_1101-2021_01_07_425723	1027	52	NA	NA	NNP
10_1101-2021_01_07_425723	1027	53	NA	NA	NNP
10_1101-2021_01_07_425723	1027	54	NA	NA	NNP
10_1101-2021_01_07_425723	1027	55	NA	NA	NNP
10_1101-2021_01_07_425723	1027	56	NA	NA	NNP
10_1101-2021_01_07_425723	1027	57	NA	NA	NNP
10_1101-2021_01_07_425723	1027	58	0/1:39	0/1:39	CD
10_1101-2021_01_07_425723	1027	59	,	,	,
10_1101-2021_01_07_425723	1027	60	65:10	65:10	CD
10_1101-2021_01_07_425723	1027	61	7:99	7:99	CD
10_1101-2021_01_07_425723	1027	62	8	8	CD
10_1101-2021_01_07_425723	1027	63	63	63	CD
10_1101-2021_01_07_425723	1027	64	57	57	CD
10_1101-2021_01_07_425723	1027	65	79	79	CD
10_1101-2021_01_07_425723	1027	66	codon	codon	NN
10_1101-2021_01_07_425723	1027	67	:	:	:
10_1101-2021_01_07_425723	1027	68	CAG	CAG	NNP
10_1101-2021_01_07_425723	1027	69	CDS	CDS	NNP
10_1101-2021_01_07_425723	1027	70	:	:	:
10_1101-2021_01_07_425723	1027	71	IN	in	IN
10_1101-2021_01_07_425723	1027	72	SERTI	SERTI	NNP
10_1101-2021_01_07_425723	1027	73	ON[9	ON[9	NNP
10_1101-2021_01_07_425723	1027	74	]	]	-RRB-
10_1101-2021_01_07_425723	1027	75	TPUv	TPUv	NNS
10_1101-2021_01_07_425723	1027	76	2_00	2_00	CD
10_1101-2021_01_07_425723	1027	77	5049	5049	CD
10_1101-2021_01_07_425723	1027	78	No	no	DT
10_1101-2021_01_07_425723	1027	79	similarity	similarity	NN
10_1101-2021_01_07_425723	1027	80	2	2	CD
10_1101-2021_01_07_425723	1027	81	6	6	CD
10_1101-2021_01_07_425723	1027	82	NA	na	NN
10_1101-2021_01_07_425723	1027	83	NA	NA	NNP
10_1101-2021_01_07_425723	1027	84	NA	NA	NNP
10_1101-2021_01_07_425723	1027	85	NA	NA	NNP
10_1101-2021_01_07_425723	1027	86	NA	NA	NNP
10_1101-2021_01_07_425723	1027	87	NA	NA	NNP
10_1101-2021_01_07_425723	1027	88	NA	NA	NNP
10_1101-2021_01_07_425723	1027	89	NA	NA	NNP
10_1101-2021_01_07_425723	1027	90	0/1:25	0/1:25	CD
10_1101-2021_01_07_425723	1027	91	,	,	,
10_1101-2021_01_07_425723	1027	92	49:74	49:74	CD
10_1101-2021_01_07_425723	1027	93	:	:	:
10_1101-2021_01_07_425723	1027	94	99	99	CD
10_1101-2021_01_07_425723	1027	95	1016	1016	CD
10_1101-2021_01_07_425723	1027	96	.CC	.CC	:
10_1101-2021_01_07_425723	1027	97	-	-	:
10_1101-2021_01_07_425723	1027	98	BY	by	IN
10_1101-2021_01_07_425723	1027	99	-	-	HYPH
10_1101-2021_01_07_425723	1027	100	NC	NC	NNP
10_1101-2021_01_07_425723	1027	101	-	-	HYPH
10_1101-2021_01_07_425723	1027	102	ND	ND	NNP
10_1101-2021_01_07_425723	1027	103	4.0	4.0	CD
10_1101-2021_01_07_425723	1027	104	International	International	NNP
10_1101-2021_01_07_425723	1027	105	licenseavailable	licenseavailable	NN
10_1101-2021_01_07_425723	1027	106	under	under	IN
10_1101-2021_01_07_425723	1027	107	a	a	DT
10_1101-2021_01_07_425723	1027	108	(	(	-LRB-
10_1101-2021_01_07_425723	1027	109	which	which	WDT
10_1101-2021_01_07_425723	1027	110	was	be	VBD
10_1101-2021_01_07_425723	1027	111	not	not	RB
10_1101-2021_01_07_425723	1027	112	certified	certify	VBN
10_1101-2021_01_07_425723	1027	113	by	by	IN
10_1101-2021_01_07_425723	1027	114	peer	peer	NN
10_1101-2021_01_07_425723	1027	115	review	review	NN
10_1101-2021_01_07_425723	1027	116	)	)	-RRB-
10_1101-2021_01_07_425723	1027	117	is	be	VBZ
10_1101-2021_01_07_425723	1027	118	the	the	DT
10_1101-2021_01_07_425723	1027	119	author	author	NN
10_1101-2021_01_07_425723	1027	120	/	/	SYM
10_1101-2021_01_07_425723	1027	121	funder	funder	NN
10_1101-2021_01_07_425723	1027	122	,	,	,
10_1101-2021_01_07_425723	1027	123	who	who	WP
10_1101-2021_01_07_425723	1027	124	has	have	VBZ
10_1101-2021_01_07_425723	1027	125	granted	grant	VBN
10_1101-2021_01_07_425723	1027	126	bioRxiv	biorxiv	IN
10_1101-2021_01_07_425723	1027	127	a	a	DT
10_1101-2021_01_07_425723	1027	128	license	license	NN
10_1101-2021_01_07_425723	1027	129	to	to	TO
10_1101-2021_01_07_425723	1027	130	display	display	VB
10_1101-2021_01_07_425723	1027	131	the	the	DT
10_1101-2021_01_07_425723	1027	132	preprint	preprint	NN
10_1101-2021_01_07_425723	1027	133	in	in	IN
10_1101-2021_01_07_425723	1027	134	perpetuity	perpetuity	NN
10_1101-2021_01_07_425723	1027	135	.	.	.
10_1101-2021_01_07_425723	1028	1	It	-PRON-	PRP
10_1101-2021_01_07_425723	1028	2	is	be	VBZ
10_1101-2021_01_07_425723	1028	3	made	make	VBN
10_1101-2021_01_07_425723	1028	4	The	the	DT
10_1101-2021_01_07_425723	1028	5	copyright	copyright	NN
10_1101-2021_01_07_425723	1028	6	holder	holder	NN
10_1101-2021_01_07_425723	1028	7	for	for	IN
10_1101-2021_01_07_425723	1028	8	this	this	DT
10_1101-2021_01_07_425723	1028	9	preprintthis	preprintthis	NN
10_1101-2021_01_07_425723	1028	10	version	version	NN
10_1101-2021_01_07_425723	1028	11	posted	post	VBD
10_1101-2021_01_07_425723	1028	12	January	January	NNP
10_1101-2021_01_07_425723	1028	13	8	8	CD
10_1101-2021_01_07_425723	1028	14	,	,	,
10_1101-2021_01_07_425723	1028	15	2021	2021	CD
10_1101-2021_01_07_425723	1028	16	.	.	.
10_1101-2021_01_07_425723	1028	17	;	;	:
10_1101-2021_01_07_425723	1028	18	https://doi.org/10.1101/2021.01.07.425723doi	https://doi.org/10.1101/2021.01.07.425723doi	ADD
10_1101-2021_01_07_425723	1028	19	:	:	:
10_1101-2021_01_07_425723	1028	20	bioRxiv	biorxiv	VB
10_1101-2021_01_07_425723	1028	21	preprint	preprint	NN
10_1101-2021_01_07_425723	1028	22	https://doi.org/10.1101/2021.01.07.425723	https://doi.org/10.1101/2021.01.07.425723	UH
10_1101-2021_01_07_425723	1028	23	http://creativecommons.org/licenses/by-nc-nd/4.0/	http://creativecommons.org/licenses/by-nc-nd/4.0/	CD
10_1101-2021_01_07_425723	1028	24	Abstract	Abstract	NNP
10_1101-2021_01_07_425723	1028	25	Results	Results	NNPS
10_1101-2021_01_07_425723	1028	26	K.	K.	NNP
10_1101-2021_01_07_425723	1028	27	marxianus	marxianus	NN
10_1101-2021_01_07_425723	1028	28	and	and	CC
10_1101-2021_01_07_425723	1028	29	S.	S.	NNP
10_1101-2021_01_07_425723	1028	30	cerevisiae	cerevisiae	NNS
10_1101-2021_01_07_425723	1028	31	show	show	VBP
10_1101-2021_01_07_425723	1028	32	different	different	JJ
10_1101-2021_01_07_425723	1028	33	physiological	physiological	JJ
10_1101-2021_01_07_425723	1028	34	responses	response	NNS
10_1101-2021_01_07_425723	1028	35	to	to	IN
10_1101-2021_01_07_425723	1028	36	extreme	extreme	JJ
10_1101-2021_01_07_425723	1028	37	oxygen	oxygen	NN
10_1101-2021_01_07_425723	1028	38	limitation	limitation	NN
10_1101-2021_01_07_425723	1028	39	Transcriptional	transcriptional	JJ
10_1101-2021_01_07_425723	1028	40	responses	response	NNS
10_1101-2021_01_07_425723	1028	41	of	of	IN
10_1101-2021_01_07_425723	1028	42	K.	K.	NNP
10_1101-2021_01_07_425723	1028	43	marxianus	marxianus	NN
10_1101-2021_01_07_425723	1028	44	to	to	IN
10_1101-2021_01_07_425723	1028	45	oxygen	oxygen	NN
10_1101-2021_01_07_425723	1028	46	limitation	limitation	NN
10_1101-2021_01_07_425723	1028	47	involve	involve	VBP
10_1101-2021_01_07_425723	1028	48	ergosterol	ergosterol	JJ
10_1101-2021_01_07_425723	1028	49	metabolism	metabolism	NN
10_1101-2021_01_07_425723	1028	50	Absence	Absence	NNP
10_1101-2021_01_07_425723	1028	51	of	of	IN
10_1101-2021_01_07_425723	1028	52	sterol	sterol	JJ
10_1101-2021_01_07_425723	1028	53	import	import	NN
10_1101-2021_01_07_425723	1028	54	in	in	IN
10_1101-2021_01_07_425723	1028	55	K.	K.	NNP
10_1101-2021_01_07_425723	1028	56	marxianus	marxianus	NN
10_1101-2021_01_07_425723	1028	57	Engineering	Engineering	NNP
10_1101-2021_01_07_425723	1028	58	K.	K.	NNP
10_1101-2021_01_07_425723	1028	59	marxianus	marxianus	NN
10_1101-2021_01_07_425723	1028	60	for	for	IN
10_1101-2021_01_07_425723	1028	61	oxygen	oxygen	NN
10_1101-2021_01_07_425723	1028	62	-	-	HYPH
10_1101-2021_01_07_425723	1028	63	independent	independent	JJ
10_1101-2021_01_07_425723	1028	64	growth	growth	NN
10_1101-2021_01_07_425723	1028	65	Test	test	NN
10_1101-2021_01_07_425723	1028	66	of	of	IN
10_1101-2021_01_07_425723	1028	67	anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1028	68	thermotolerance	thermotolerance	NN
10_1101-2021_01_07_425723	1028	69	and	and	CC
10_1101-2021_01_07_425723	1028	70	selection	selection	NN
10_1101-2021_01_07_425723	1028	71	for	for	IN
10_1101-2021_01_07_425723	1028	72	fast	fast	JJ
10_1101-2021_01_07_425723	1028	73	growing	grow	VBG
10_1101-2021_01_07_425723	1028	74	anaerobes	anaerobe	NNS
10_1101-2021_01_07_425723	1028	75	Discussion	Discussion	NNP
10_1101-2021_01_07_425723	1028	76	online	online	JJ
10_1101-2021_01_07_425723	1028	77	Methods	Methods	NNP
10_1101-2021_01_07_425723	1028	78	Yeast	Yeast	NNP
10_1101-2021_01_07_425723	1028	79	strains	strain	NNS
10_1101-2021_01_07_425723	1028	80	,	,	,
10_1101-2021_01_07_425723	1028	81	maintenance	maintenance	NN
10_1101-2021_01_07_425723	1028	82	and	and	CC
10_1101-2021_01_07_425723	1028	83	shake	shake	NN
10_1101-2021_01_07_425723	1028	84	-	-	HYPH
10_1101-2021_01_07_425723	1028	85	flask	flask	NN
10_1101-2021_01_07_425723	1028	86	cultivation	cultivation	NN
10_1101-2021_01_07_425723	1028	87	Expression	Expression	NNP
10_1101-2021_01_07_425723	1028	88	cassette	cassette	NN
10_1101-2021_01_07_425723	1028	89	and	and	CC
10_1101-2021_01_07_425723	1028	90	plasmid	plasmid	NN
10_1101-2021_01_07_425723	1028	91	construction	construction	NN
10_1101-2021_01_07_425723	1028	92	Strain	Strain	NNP
10_1101-2021_01_07_425723	1028	93	construction	construction	NN
10_1101-2021_01_07_425723	1028	94	Chemostat	chemostat	JJ
10_1101-2021_01_07_425723	1028	95	cultivation	cultivation	NN
10_1101-2021_01_07_425723	1028	96	Metabolite	metabolite	JJ
10_1101-2021_01_07_425723	1028	97	analysis	analysis	NN
10_1101-2021_01_07_425723	1028	98	Gas	Gas	NNP
10_1101-2021_01_07_425723	1028	99	analysis	analysis	NN
10_1101-2021_01_07_425723	1028	100	Ethanol	ethanol	NN
10_1101-2021_01_07_425723	1028	101	evaporation	evaporation	NN
10_1101-2021_01_07_425723	1028	102	rate	rate	NN
10_1101-2021_01_07_425723	1028	103	Lipid	Lipid	NNP
10_1101-2021_01_07_425723	1028	104	extractions	extraction	NNS
10_1101-2021_01_07_425723	1028	105	&	&	CC
10_1101-2021_01_07_425723	1028	106	GC	GC	NNP
10_1101-2021_01_07_425723	1028	107	analysis	analysis	NN
10_1101-2021_01_07_425723	1028	108	Sterol	Sterol	NNP
10_1101-2021_01_07_425723	1028	109	uptake	uptake	VBD
10_1101-2021_01_07_425723	1028	110	assay	assay	NN
10_1101-2021_01_07_425723	1028	111	Long	long	RB
10_1101-2021_01_07_425723	1028	112	read	read	VBD
10_1101-2021_01_07_425723	1028	113	sequencing	sequencing	NN
10_1101-2021_01_07_425723	1028	114	,	,	,
10_1101-2021_01_07_425723	1028	115	assembly	assembly	NN
10_1101-2021_01_07_425723	1028	116	,	,	,
10_1101-2021_01_07_425723	1028	117	and	and	CC
10_1101-2021_01_07_425723	1028	118	annotation	annotation	NN
10_1101-2021_01_07_425723	1028	119	Illumina	Illumina	NNP
10_1101-2021_01_07_425723	1028	120	sequencing	sequence	VBG
10_1101-2021_01_07_425723	1028	121	RNA	RNA	NNP
10_1101-2021_01_07_425723	1028	122	isolation	isolation	NN
10_1101-2021_01_07_425723	1028	123	,	,	,
10_1101-2021_01_07_425723	1028	124	sequencing	sequencing	NN
10_1101-2021_01_07_425723	1028	125	and	and	CC
10_1101-2021_01_07_425723	1028	126	transcriptome	transcriptome	DT
10_1101-2021_01_07_425723	1028	127	analysis	analysis	NN
10_1101-2021_01_07_425723	1028	128	Anaerobic	anaerobic	JJ
10_1101-2021_01_07_425723	1028	129	growth	growth	NN
10_1101-2021_01_07_425723	1028	130	experiments	experiment	VBZ
10_1101-2021_01_07_425723	1028	131	Laboratory	Laboratory	NNP
10_1101-2021_01_07_425723	1028	132	evolution	evolution	NN
10_1101-2021_01_07_425723	1028	133	in	in	IN
10_1101-2021_01_07_425723	1028	134	low	low	JJ
10_1101-2021_01_07_425723	1028	135	oxygen	oxygen	NN
10_1101-2021_01_07_425723	1028	136	atmosphere	atmosphere	NN
10_1101-2021_01_07_425723	1028	137	Laboratory	Laboratory	NNP
10_1101-2021_01_07_425723	1028	138	evolution	evolution	NN
10_1101-2021_01_07_425723	1028	139	in	in	IN
10_1101-2021_01_07_425723	1028	140	sequential	sequential	JJ
10_1101-2021_01_07_425723	1028	141	batch	batch	NN
10_1101-2021_01_07_425723	1028	142	reactors	reactor	NNS
10_1101-2021_01_07_425723	1028	143	Statistics	Statistics	NNPS
10_1101-2021_01_07_425723	1028	144	Data	Data	NNP
10_1101-2021_01_07_425723	1028	145	availability	availability	NN
10_1101-2021_01_07_425723	1028	146	Code	Code	NNP
10_1101-2021_01_07_425723	1028	147	availability	availability	NN
10_1101-2021_01_07_425723	1028	148	Author	author	NN
10_1101-2021_01_07_425723	1028	149	’s	’s	POS
10_1101-2021_01_07_425723	1028	150	contributions	contribution	NNS
10_1101-2021_01_07_425723	1028	151	Acknowledgements	Acknowledgements	NNP
10_1101-2021_01_07_425723	1028	152	Competing	compete	VBG
10_1101-2021_01_07_425723	1028	153	interest	interest	NN
10_1101-2021_01_07_425723	1028	154	Funding	funding	NN
10_1101-2021_01_07_425723	1028	155	References	References	NNPS
10_1101-2021_01_07_425723	1028	156	Description	description	NN
10_1101-2021_01_07_425723	1028	157	of	of	IN
10_1101-2021_01_07_425723	1028	158	Additional	Additional	NNP
10_1101-2021_01_07_425723	1028	159	Supplementary	Supplementary	NNP
10_1101-2021_01_07_425723	1028	160	Files	Files	NNPS
10_1101-2021_01_07_425723	1028	161	Reporting	Reporting	NNP
10_1101-2021_01_07_425723	1028	162	summary	summary	NN
10_1101-2021_01_07_425723	1028	163	Supplemental	supplemental	JJ
10_1101-2021_01_07_425723	1028	164	material	material	NN
10_1101-2021_01_07_425723	1028	165	for	for	IN
10_1101-2021_01_07_425723	1028	166	:	:	: