key: cord-104092-yau3r79c
authors: Tamming, Renee J.; Dumeaux, Vanessa; Langlois, Luana; Ellegood, Jacob; Qiu, Lily R.; Jiang, Yan; Lerch, Jason P.; Bérubé, Nathalie G.
title: Atrx deletion in neurons leads to sexually-dimorphic dysregulation of miR-137 and spatial learning and memory deficits
date: 2019-04-13
journal: bioRxiv
DOI: 10.1101/606442
sha: 
doc_id: 104092
cord_uid: yau3r79c

Mutations in the ATRX chromatin remodeler are associated with syndromic and non-syndromic intellectual disability. Emerging evidence points to key roles for ATRX in preserving neuroprogenitor cell genomic stability, whereas ATRX function in differentiated neurons and memory processes are still unresolved. Here, we show that Atrx deletion in mouse forebrain glutamatergic neurons causes distinct hippocampal structural defects identified by magnetic resonance imaging. Ultrastructural analysis revealed fewer presynaptic vesicles and an enlarged postsynaptic area at CA1 apical dendrite-axon junctions. These synaptic defects are associated with impaired long-term contextual memory in male, but not female mice. Mechanistically, we identify ATRX-dependent and sex-specific alterations in synaptic gene expression linked to Mir137 levels, a known regulator of presynaptic processes and spatial memory. We conclude that ablation of Atrx in excitatory forebrain neurons leads to sexually dimorphic outcomes on miR-137 and on spatial memory, identifying a promising therapeutic target for neurological disorders caused by ATRX dysfunction. Summary statement Ablation of the ATRX chromatin remodeler specifically in forebrain excitatory neurons of mice causes male-specific deficits in long-term spatial memory associated with miR-137 overexpression, transcriptional changes and structural alterations corresponding to pre- and post-synaptic abnormalities.

Alpha-thalassemia X-linked intellectual disability syndrome, or ATR-X syndrome, is a rare congenital X-linked disorder resulting in moderate to severe intellectual disability (ID), developmental delay, microcephaly, hypomyelination, and a mild form of alphathalassemia [OMIM: 301040] 1 . In a recent study of approximately 1000 individuals with ID, ATRX mutations were identified as one of the most frequent cause of non-syndromic ID 2 , emphasizing a key requirement for this gene in cognitive processes. ATRX-related ID arises from hypomorphic mutations in the ATRX gene, most commonly in the highly conserved ATRX/DNMT3/DNMT3L (ADD) and Switch/Sucrose non-fermenting (SWI/SNF) domains 3, 4 . The former targets ATRX to chromatin by means of a histone reader domain that recognizes specific histone tail modifications 5 , and the latter confers ATPase activity and is critical for its chromatin remodeling activity 6,7 .

ATRX, in a complex with the histone chaperone DAXX, promotes the deposition of the histone variant H3.3 at heterochromatic domains including telomeres and pericentromeres 8, 9 . However, ATRX is also required for H3.3 deposition within the gene body of a subset of G-rich genes, presumably to reduce G-quadruplex formation and promote transcriptional elongation 10 . ATRX is also required for the postnatal suppression of a network of imprinted genes in the neonatal brain by promoting long range chromatin interactions via CTCF and cohesin 11 .

In mice, germline deletion of Atrx results in embryonic lethality 12 while conditional deletion of Atrx in neuroprogenitors leads to excessive DNA damage caused by DNA replication stress and subsequent Tp53-dependent apoptosis 13, 14 . Mice with deletion of exon 2 of Atrx (Atrx ΔE2 ) were generated that result in global reduction of Atrx expression.

These mice are viable and exhibit impaired novel object recognition memory, spatial memory in the Barnes maze, and contextual fear memory 15 . Some of the molecular defects identified in these mice included decreased activation of CaMKII and the AMPA receptor in the hippocampus as well as decreased spine density in the medial prefrontal cortex, and altered DNA methylation and increased expression of Xlr3b in neurons 16 . Our group also reported similar behavioural impairments in female mice exhibiting mosaic expression of ATRX in the central nervous system 17 . However, the contribution of different cell types and sex difference to behavioural abnormalities have not yet been resolved.

To start addressing these questions, we deleted Atrx specifically in glutamatergic forebrain neurons in male and female mice. This approach bypasses deleterious effects of ATRX loss of function that we previously observed during brain development caused by replication stress in proliferating neuroprogenitors 12, 13 . A comprehensive analysis of these mice reveals that ATRX promotes long-term spatial learning and memory associated with morphological and synaptic ultrastructural changes in the hippocampus.

We show that female mice lacking ATRX in neurons are protected from spatial learning and memory defects and identify sex-specific effects of ATRX loss on the expression of synaptic genes and miR-137. Overall, we identify a novel sex-specific function for ATRX in neurons in the regulation of long-term spatial memory associated with abnormal synapse ultrastructure.

Animal care and husbandry. Mice were exposed to a 12-hour-light/12-hour-dark cycle and with water and chow ad libitum. The Atrx loxP mice have been described previously 18 .

Atrx loxP mice were mated with C57BL/6 mice expressing Cre recombinase under the control of the αCaMKII gene promoter 19 . The progeny includes hemizygous male mice that produce no ATRX protein in forebrain excitatory neurons (Atrx-cKO). The Atrx-cKO males were mated to Atrx loxP females to yield homozygous deletion of Atrx in female mice (Atrx-cKO Fem ). Male and female littermate floxed mice lacking the Cre allele were used as controls (Ctrl; Ctrl Fem ). Genotyping of tail biopsies for the presence of the floxed and Cre alleles was performed as described previously 18 ARRIVE guidelines were followed: mouse groups were randomized, experimenters were blind to the genotypes, and software-based analysis was used to score mouse performance in all the tasks. All behavioural experiments were performed between 9:00 AM and 4:00 PM.

Immunofluorescence staining. Mice were perfused with 25mL phosphate buffered saline (PBS) followed by 25mL 4% paraformaldehyde (PFA) in PBS and the brain fixed for 24 hours in 4% PFA in PBS and cryopreserved in 30% sucrose/PBS. Brains were flash frozen in Cryomatrix (Thermo Scientific) and sectioned at 8µm thickness as described previously 13 . For immunostaining, antigen retrieval was performed by incubating slides in 10 mM sodium citrate at 95°C for 10 min. Cooled sections were washed and blocked with 10% normal goat serum (Sigma). The slides were incubated overnight in primary antibody Sections were washed again three times for 5 min, counterstained with DAPI and mounted with SlowFade Gold (Invitrogen). All images were captured using an inverted microscope (Leica DMI 6000b) with a digital camera (Hamamatsu ORCA-ER). Openlab image software was used for manual image capture, and images were processed using the Volocity software (Demo Version 6.0.1; PerkinElmer) and Adobe Photoshop CS6 (Version 13.0). Cell counts of DAPI, GFAP, and IBA1 were performed in Adobe

Photoshop. DAPI was counted per mm 2 and GFAP and IBA1 were counted as percentages of DAPI + cells. One section from five pairs of Ctrl/Atrx-cKO was counted.

Reverse transcriptase real-time PCR (qRT-PCR). Total RNA was isolated from control and Atrx-cKO frontal cortex and hippocampus using the miRVANA total RNA isolation kit (ThermoFisher) and reverse transcribed to cDNA using 1 μg RNA and SuperScript II Reverse Transcriptase (Invitrogen). Real-time PCR was performed in duplicate using gene-specific primers under the following conditions: 95°C for 10 s, 58°C for 20 s, 72°C for 30 s for 35 cycles. All data were normalized against β-actin expression levels. Primers used were as follows: β-actin (forward CTGTCGAGTCGCGTCCACCC, reverse ACATGCCGGAGCCGTTGTCG); Atrx (forward AGAAATTGAGGATGCTTCACC, reverse TGAACCTGGGGACTTCTTTG).

Total RNA was also used for reverse transcription of miRNA using the TaqMan Advanced MicroRNA reverse transcription kit (ThermoFisher). qRT-PCR was performed using the short-term memory, mice were exposed to the original object (A) and a novel object (B; a blue plastic pyramid attached on top of a green prism base) 1.5 hours after training. To test long-term memory, mice were exposed to (A) and (B) 24 hours after training. Novel object recognition was expressed as the percentage of time spent with the novel object as a fraction of the total time spent interacting. Interaction was defined as sniffing or touching the object, but not leaning against or climbing on the object.

Morris water maze. The Morris water maze was conducted as described previously 36 Touchscreen assays. The paired associate learning (dPAL) and visual paired discrimination (VPD) and reversal tasks were performed as previously described 37-39 .

Animals were food-restricted to 85% starting body weight. Animals were separated into two counter-balanced subgroups to control for time of day of testing, and equipment variation. Mice were tested in Bussey-Saksida mouse touch screen chambers (Lafayette Neuroscience) with strawberry milkshake given as a reward.

For the dPAL acquisition phase, animals were tested for their ability to associate objects with locations. Mice were presented with two images in two of three windows; one image was in its correct location (S+) and one was in one of its two incorrect locations (S-). The third window was blank. A correct response triggered reward presentation and start of an inter-trial period. The pre-training was repeated until mice reached criterion (completion of 36 trials within 60 minutes). The dPAL evaluation phase was performed for 45 sessions over 9 weeks. A correct response triggered reward presentation, whereas an incorrect response caused a 5 s time out and the house lights to turn on. An incorrect response also resulted in a correction trial, where the same S+/S-images were presented in the same two locations until the mouse responded correctly. The mouse was given 36 trials over 60 minutes per day. Percent correct, number of correction trials, latency to a correct or incorrect response, and latency to retrieve reward were recorded for each week.

VPD acquisition required the animal to touch the same image (S+) no matter which window it appeared in. The other screen had an incorrect image (S-). A correct response triggered reward presentation, whereas an incorrect response triggered the house lights to turn on, a time out of 5 s, and a correction trial to begin (previous trial repeated until a correct choice is made). This was repeated until mice reached criterion of 24/30 trials correct within 60 minutes over 2 consecutive days, after which baseline measurements were done for two sessions. Parameters for baseline were identical to the acquisition steps.

Immediately following baseline measurements, the VPD task reversal began, where most parameters were the same as the acquisition, but the correct image associated with the reward was S-, and the incorrect response that triggers house lights was S+. this also determined total number of vesicles per synapse. Vesicle cluster size was measured to calculate vesicle density. The area of the post-synaptic density was also quantified. Statistics were calculated by two-way repeated measures ANOVA with Sidak's multiple comparison test or unpaired Student's T-tests where applicable.

Statistical analyses. All data were analyzed using GraphPad Prism software with Student's T test (unpaired, two-tailed) or one or two-way repeated measures ANOVA with

Sidak's post-test where applicable. All results are depicted as mean +/-SEM unless indicated otherwise. P values of less than 0.05 were considered to indicate significance.

We generated mice lacking ATRX in postnatal forebrain excitatory neurons by Cre/loxP mediated recombination of the mouse Atrx gene with the CaMKII-Cre driver line of mice 49 . To confirm loss of ATRX, we performed immunofluorescence staining of control and conditional knockout (Atrx-cKO) brain cryosections obtained from 3-month-old mice (Figure 1a,b) . ATRX is highly expressed in excitatory neurons of the hippocampus of control mice, including the cortex and hippocampal CA1, CA2/3, and dentate gyrus neurons, but is absent in these cells in the Atrx-cKO mice. Additional validation of Atrx inactivation in Atrx-cKO mice was achieved by qRT-PCR (Figure 1c) , showing that Atrx expression is decreased by 78% (+/-9.4%) and 81% (+/-1.7%) in the cortex and the hippocampus, respectively, which is expected from a neuron-specific deletion. The brain sub-region specificity of ATRX loss was demonstrated by western blot analysis, showing reduced protein levels in the rostral and caudal cortices and hippocampus, but not in the cerebellum (Figure 1d ). The mice survived to adulthood and had normal general appearance and behaviour. However, body weight measurements revealed a small but significant reduction in Atrx-cKO compared to control mice (Figure 1e ). These findings demonstrate that we achieved specific deletion of Atrx in excitatory neurons and while the mice were slightly smaller, they survived to adulthood, allowing further analyses in the adult brain.

We first examined control and Atrx-cKO mouse brains for neuroanatomical anomalies by magnetic resonance imaging (MRI). Using a T2-weighted MRI sequence, we were able to analyze and compare the entire brain as well as independent brain regions from 16 control and 13 Atrx-cKO male animals. The data obtained showed that the overall volume of the Atrx-cKO brain is significantly smaller compared to controls (92.8% of control volume, P<0.0001), as indicated by whole volume in mm 3 and cumulative serial slices of control and Atrx-cKO brains (Figure 2a,b) , which correlates with the smaller body size of the mice. Due to the reduction in body size and absolute total brain and hippocampal volumes of the Atrx-cKO mice, we next examined hippocampal neuroanatomy relative to total brain volume ( We postulated that the increase in relative volume of the CA1 SR/SLM may be due to increased length or branching of CA1 apical dendrites. To investigate this possibility, Golgi staining was used to sporadically label neurons (Figure 3a ) and Sholl analysis was performed on confocal microscopy images to evaluate apical dendrite branching of CA1 hippocampal neurons. However, no significant difference in dendritic branching or length was observed between control and Atrx-cKO mice, whether analyzed separately for apical or basal dendrites (Figure 3b-g) . Increased relative volume might also be caused by an increased number of cells, but immunofluorescence staining and quantification of astrocytes (GFAP+) and microglia (IBA1+) and total number of cells (inferred from DAPI+ staining) revealed no differences in Atrx-cKO hippocampi (Figure 3h-j) . Overall, the increased relative volume of the CA1 SR/SLM cannot be explained by increased length or complexity of dendritic trees or by an increased number of glial cells.

Based on the hippocampal structural alterations we detected by MRI, we looked more closely at potential ultrastructural changes in the CA1 SR/SLM area using transmission electron microscopy (TEM) (Figure 4a) . The presynaptic boutons were divided in 50nm bins from the active zone, and the number of vesicles in each bin was counted. The spatial distribution of vesicles in relation to the cleft was unchanged between the Atrx-cKO mice and controls (Figure 4b) . However, we found that the total number of vesicles, the density of the vesicles, and the number of docked vesicles was significantly decreased at Atrx-cKO compared to control synapses (Figure 4c-e) . We also analysed other structural aspects of synapses and found that the size of the postsynaptic density and the width of the synaptic cleft were both increased in Atrx-cKO compared to controls (Figure 4f,g) . The length of the active zone, cluster size, or diameter of the vesicles did not vary significantly between control and Atrx-cKO samples ( Figure   4h -j). These results suggest that ATRX is required for structural integrity of the pre-and post-synapse, including maintenance of the synaptic vesicle pool at pre-synaptic termini and potential defects in postsynaptic protein clustering.

We To investigate the effects of neuronal-specific ATRX ablation on spatial learning and memory, we tested the mice in the Morris water maze task. The Atrx-cKO mice showed a significant delay in latency to find the platform on day 3 of the learning portion of the task; however, by day 4 they were able to find the platform as quickly as the control mice (F=4.622, P=0.0404; Figure 5a ). This finding was reflected in the distance traveled P=0.0251; Figure 5f , g). These behavioural analyses suggest that ATRX in required in excitatory neurons for long-term hippocampal-dependent spatial learning and memory.

To determine whether loss of ATRX in female mice would exhibit similar behavioural defects as seen in male mice, we generated Atrx-cKO female mice (Atrx- 

Given the observed male-specific defects in spatial memory, we performed additional translational cognitive tasks on the Atrx-cKO male mice. The dPAL touchscreen task in mice is analogous to cognitive testing done in humans by the Cambridge Neuropsychological Test Automated Battery (CANTAB) 50,51 and normal performance in this task is thought to partly depend on the hippocampus 39,52 .

Control and Atrx-cKO mice were trained to identify the position of three images as depicted in Figure 6a , undergoing 36 trials per day for 10 weeks. The results demonstrate that the Atrx-cKO mice exhibit a profound deficit in this task, indicated by both the percent correct (F=10.53, P=0.0031; Figure 6b ) and the number of correction trials required (F=30.64, P<0.0001; Figure 6c ) (Supplementary video 1, 2) . These defects were not due to an inability to perform within the chamber or to attentional deficits, as latency to a correct answer (F=0.4802, P=0.4943), to an incorrect answer (F=0.1259, P=0.7255), and to retrieve the reward (F=0.9840, P=0.3300) was not significantly different between control and Atrx-cKO mice (Figure 6d-f) . To determine if the impairment in the dPAL task is caused by a vision problem rather than a learning defect, the mice were also tested in the visual paired discrimination (VPD) touchscreen task which requires the mice to discriminate between two images regardless of position on the screen. While the Atrx-cKO mice took significantly longer to reach the criterion pre-testing (T=2.945, P=0.0067; 

To identify the molecular mechanism(s) leading to spatial memory impairment, we performed RNA-sequencing in both male and female hippocampi obtained from three pairs of littermate-matched Ctrl/Atrx-cKO and Ctrl Fem /Atrx-cKO Fem mice. There were 1520 transcripts differentially expressed in the Atrx-cKO males compared to control counterparts and 9068 transcripts in Atrx-cKO Fem compared to the female controls (FDR < 0.20). To isolate transcripts that were likely to be causative to the impaired learning and memory phenotype in the male mice which was not found in the female mice, we focused on transcripts whose changes in expression with the Atrx-cKO were differential between male and female mice (n = 1054 transcripts, interaction term FDR < 0.05). The expression heat map of these transcripts illustrates that their expression levels are similar in control males and females but are differentially expressed when ATRX is lost depending on sex (Figure 7a) . We then utilized PANTHER 53 , a tool for gene enrichment analysis based on functional annotations to examine Gene Ontology biological processes for which our list of transcripts was enriched (Figure 7b) . The top five pathways included neurotransmitter receptor transport to postsynaptic membrane, protein localization to postsynaptic membrane, non-motile cilium assembly, and vesicle-mediated transport to the membrane. Therefore, the RNA sequencing revealed many transcripts related to synapses, supporting the TEM data.

Certain miRNA are enriched within presynaptic terminals and have been Figure 5a ) as well as an enrichment for targets of miR-137 (Supp. Figure 5b) . We compared the list of genes downregulated in the Atrx-cKO male hippocampi to those predicted to be regulated by miR-137 through miRNA.org (Supp. Table 1) . We found Shank2, Cadps2, Glrb, and Sgip1 expression to be inversely 64 . This data provides additional evidence that loss of ATRX in the cortex and hippocampus of male mice leads to increased miR-137 expression and consequent downregulation of its target genes, starting at early stages of forebrain development.

This study presents evidence that ATRX is required in a sex-specific manner in excitatory forebrain neurons for normal spatial learning and memory (Figure 8) [75] [76] [77] . In humans, neurological disorders such as autismspectrum disorders tend to preferentially affect males rather than females, possibly due to combinatorial contributions of hormonal and genetic factors in a phenomenon known as the female protective effect [78] [79] [80] , and this is regularly supported with mouse models [81] [82] [83] . The presence of estrogen and estrogen receptor in the female brain has been shown to be neuroprotective and leads to enhanced Schaffer-collateral LTP 84 . In addition, certain X-linked genes involved in chromatin regulation (e.g. Utx, a histone demethylase) are able to escape X-inactivation and so are expressed two-fold in females compared to males 85 In conclusion, our study presents strong evidence that ATRX is required in forebrain excitatory neurons for spatial learning and long-term memory and regulation of genes required for efficient synaptic transmission.

VPD touchscreen assays were performed at the Robarts Research Institute neurobehavioural core facility, TEM imaging at the Biotron at Western University and the RNA sequencing at the London Regional Genomics Centre. 

Mutations in a putative global transcriptional regulator cause X-linked mental retardation with alpha-thalassemia (ATR-X syndrome)

Targeted Next-Generation Sequencing Analysis of 1,000 Individuals with Intellectual Disability

Mutations in transcriptional regulator ATRX establish the functional significance of a PHD-like domain

microRNA-34a regulates neurite outgrowth, spinal morphology, and function

miR-27b shapes the presynaptic transcriptome and influences neurotransmission by silencing the polycomb group protein Bmi1

The schizophrenia risk gene product miR-137 alters presynaptic plasticity

The SWI/SNF protein ATRX co-regulates pseudoautosomal genes that have translocated to autosomes in the mouse genome

ToppGene Suite for gene list enrichment analysis and candidate gene prioritization

The Shank family of scaffold proteins

The glycine receptor

Cloning and characterization of human CADPS and CADPS2, new members of the Ca2+-dependent activator for secretion protein family

Intersectin 1 forms complexes with SGIP1 and Reps1 in clathrin-coated pits

Disruption of the direct perforant path input to the CA1 subregion of the dorsal hippocampus interferes with spatial working memory and novelty detection

A macromolecular synthesis-dependent late phase of long-term potentiation requiring cAMP in the medial perforant pathway of rat hippocampal slices

Abnormal Microglia and Enhanced Inflammation-Related Gene Transcription in Mice with Conditional Deletion of Ctcf in Camk2a-Cre-Expressing Neurons

Lipopolysaccharide-induced microglial activation induces learning and memory deficits without neuronal cell death in rats

Learning, memory, and glial cell changes following recovery from chronic unpredictable stress

Disruption of the perineuronal net in the hippocampus or medial prefrontal cortex impairs fear conditioning

Modification of extracellular matrix by enzymatic removal of chondroitin sulfate and by lack of tenascin-R differentially affects several forms of synaptic plasticity in the hippocampus

New translational assays for preclinical modelling of cognition in schizophrenia: the touchscreen testing method for mice and rats

Synaptic scaffold evolution generated components of vertebrate cognitive complexity

X-linked alphathalassemia/mental retardation (ATR-X) syndrome: localization to Xq12-q21.31 by X inactivation and linkage analysis

Sexually dimorphic behavior, neuronal activity, and gene expression in Chd8-mutant mice

Mecp2 organizes juvenile social behavior in a sex-specific manner

MeCP2 Modulates Sex Differences in the Postsynaptic Development of the Valproate Animal Model of Autism

Epidemiology of pervasive developmental disorders

A higher mutational burden in females supports a "female protective model" in neurodevelopmental disorders

Transcriptomic analysis of autistic brain reveals convergent molecular pathology

Human CRMP4 mutation and disrupted Crmp4 expression in mice are associated with ASD characteristics and sexual dimorphism

SHANK1 Deletions in Males with

Investigation of sex differences in the expression of RORA and its transcriptional targets in the brain as a potential contributor to the sex bias in autism

Memory-Related Synaptic Plasticity Is Sexually Dimorphic in Rodent Hippocampus

Sex-specific differences in expression of histone demethylases Utx and Uty in mouse brain and neurons

miRNA Expression profile after status epilepticus and hippocampal neuroprotection by targeting miR-132

Microarray based analysis of microRNA expression in rat cerebral cortex after traumatic brain injury

The brain-specific microRNA miR-128b regulates the formation of fear-extinction memory

Supplementary Figure 5: Transcriptional profiling reveals dysregulation of presynaptic genes in Atrx-FoxG1 mice. (A) Differentially expressed genes between Control and Atrx-FoxG1 P0.5 forebrain were used for Gene Ontology analysis and top 25 Biological Processes were listed by P-value. (B) Top miRNA predicted to regulate differentially expressed genes from Control and Atrx-FoxG1 mice

We are grateful to Doug Higgs and Richard Gibbons for the Atrx floxed mice, Vania Prado and Marco Prado for the CaMKII-Cre mice, Michael Miller for advice on statistical analyses, and Tim Bussey for discussions on the touchscreen assays. The dPAL and

The authors declare no competing or financial interests. 0