id	sid	tid	token	lemma	pos
cord-001824-7c37elh6	1	1	key	key	NN
cord-001824-7c37elh6	1	2	:	:	:
cord-001824-7c37elh6	2	1	cord-001824	cord-001824	NNP
cord-001824-7c37elh6	2	2	-	-	HYPH
cord-001824-7c37elh6	2	3	7c37elh6	7c37elh6	CD
cord-001824-7c37elh6	2	4	authors	author	NNS
cord-001824-7c37elh6	2	5	:	:	:
cord-001824-7c37elh6	2	6	Tükenmez	Tükenmez	NNP
cord-001824-7c37elh6	2	7	,	,	,
cord-001824-7c37elh6	2	8	Hasan	Hasan	NNP
cord-001824-7c37elh6	2	9	;	;	:
cord-001824-7c37elh6	2	10	Xu	Xu	NNP
cord-001824-7c37elh6	2	11	,	,	,
cord-001824-7c37elh6	2	12	Hao	Hao	NNP
cord-001824-7c37elh6	2	13	;	;	:
cord-001824-7c37elh6	2	14	Esberg	Esberg	NNP
cord-001824-7c37elh6	2	15	,	,	,
cord-001824-7c37elh6	2	16	Anders	Anders	NNP
cord-001824-7c37elh6	2	17	;	;	:
cord-001824-7c37elh6	2	18	Byström	Byström	NNP
cord-001824-7c37elh6	2	19	,	,	,
cord-001824-7c37elh6	2	20	Anders	Anders	NNP
cord-001824-7c37elh6	2	21	S.	S.	NNP
cord-001824-7c37elh6	2	22	title	title	NN
cord-001824-7c37elh6	2	23	:	:	:
cord-001824-7c37elh6	3	1	The	the	DT
cord-001824-7c37elh6	3	2	role	role	NN
cord-001824-7c37elh6	3	3	of	of	IN
cord-001824-7c37elh6	3	4	wobble	wobble	NN
cord-001824-7c37elh6	3	5	uridine	uridine	NN
cord-001824-7c37elh6	3	6	modifications	modification	NNS
cord-001824-7c37elh6	3	7	in	in	IN
cord-001824-7c37elh6	3	8	+1	+1	HYPH
cord-001824-7c37elh6	3	9	translational	translational	JJ
cord-001824-7c37elh6	3	10	frameshifting	frameshifting	NN
cord-001824-7c37elh6	3	11	in	in	IN
cord-001824-7c37elh6	3	12	eukaryotes	eukaryote	NNS
cord-001824-7c37elh6	3	13	date	date	NN
cord-001824-7c37elh6	3	14	:	:	:
cord-001824-7c37elh6	3	15	2015	2015	CD
cord-001824-7c37elh6	3	16	-	-	SYM
cord-001824-7c37elh6	3	17	10	10	CD
cord-001824-7c37elh6	3	18	-	-	SYM
cord-001824-7c37elh6	3	19	30	30	CD
cord-001824-7c37elh6	3	20	journal	journal	NN
cord-001824-7c37elh6	3	21	:	:	:
cord-001824-7c37elh6	3	22	Nucleic	nucleic	JJ
cord-001824-7c37elh6	3	23	Acids	acid	NNS
cord-001824-7c37elh6	3	24	Res	res	NN
cord-001824-7c37elh6	3	25	DOI	doi	NN
cord-001824-7c37elh6	3	26	:	:	:
cord-001824-7c37elh6	4	1	10.1093	10.1093	CD
cord-001824-7c37elh6	4	2	/	/	SYM
cord-001824-7c37elh6	4	3	nar	nar	NN
cord-001824-7c37elh6	4	4	/	/	SYM
cord-001824-7c37elh6	4	5	gkv832	gkv832	NNP
cord-001824-7c37elh6	4	6	sha	sha	NNP
cord-001824-7c37elh6	4	7	:	:	:
cord-001824-7c37elh6	5	1	053aa0c7280e2bb41a033cb0ae7c0d6bd07afc40	053aa0c7280e2bb41a033cb0ae7c0d6bd07afc40	NFP
cord-001824-7c37elh6	5	2	doc_id	doc_id	CD
cord-001824-7c37elh6	5	3	:	:	:
cord-001824-7c37elh6	6	1	1824	1824	CD
cord-001824-7c37elh6	6	2	cord_uid	cord_uid	NNS
cord-001824-7c37elh6	6	3	:	:	:
cord-001824-7c37elh6	6	4	7c37elh6	7c37elh6	CD
cord-001824-7c37elh6	7	1	In	in	IN
cord-001824-7c37elh6	7	2	Saccharomyces	Saccharomyces	NNP
cord-001824-7c37elh6	7	3	cerevisiae	cerevisiae	NNS
cord-001824-7c37elh6	7	4	,	,	,
cord-001824-7c37elh6	7	5	11	11	CD
cord-001824-7c37elh6	7	6	out	out	IN
cord-001824-7c37elh6	7	7	of	of	IN
cord-001824-7c37elh6	7	8	42	42	CD
cord-001824-7c37elh6	7	9	tRNA	tRNA	NNP
cord-001824-7c37elh6	7	10	species	specie	NNS
cord-001824-7c37elh6	7	11	contain	contain	VBP
cord-001824-7c37elh6	7	12	5-methoxycarbonylmethyl-2-thiouridine	5-methoxycarbonylmethyl-2-thiouridine	CD
cord-001824-7c37elh6	7	13	(	(	-LRB-
cord-001824-7c37elh6	7	14	mcm(5)s(2)U	mcm(5)s(2)U	NNP
cord-001824-7c37elh6	7	15	)	)	-RRB-
cord-001824-7c37elh6	7	16	,	,	,
cord-001824-7c37elh6	7	17	5-methoxycarbonylmethyluridine	5-methoxycarbonylmethyluridine	CD
cord-001824-7c37elh6	7	18	(	(	-LRB-
cord-001824-7c37elh6	7	19	mcm(5)U	mcm(5)U	NNP
cord-001824-7c37elh6	7	20	)	)	-RRB-
cord-001824-7c37elh6	7	21	,	,	,
cord-001824-7c37elh6	7	22	5-carbamoylmethyluridine	5-carbamoylmethyluridine	CD
cord-001824-7c37elh6	7	23	(	(	-LRB-
cord-001824-7c37elh6	7	24	ncm(5)U	ncm(5)u	JJ
cord-001824-7c37elh6	7	25	)	)	-RRB-
cord-001824-7c37elh6	7	26	or	or	CC
cord-001824-7c37elh6	7	27	5-carbamoylmethyl-2′-O	5-carbamoylmethyl-2′-o	CD
cord-001824-7c37elh6	7	28	-	-	HYPH
cord-001824-7c37elh6	7	29	methyluridine	methyluridine	NN
cord-001824-7c37elh6	7	30	(	(	-LRB-
cord-001824-7c37elh6	7	31	ncm(5)Um	ncm(5)Um	NNP
cord-001824-7c37elh6	7	32	)	)	-RRB-
cord-001824-7c37elh6	7	33	nucleosides	nucleoside	NNS
cord-001824-7c37elh6	7	34	in	in	IN
cord-001824-7c37elh6	7	35	the	the	DT
cord-001824-7c37elh6	7	36	anticodon	anticodon	NN
cord-001824-7c37elh6	7	37	at	at	IN
cord-001824-7c37elh6	7	38	the	the	DT
cord-001824-7c37elh6	7	39	wobble	wobble	NN
cord-001824-7c37elh6	7	40	position	position	NN
cord-001824-7c37elh6	7	41	(	(	-LRB-
cord-001824-7c37elh6	7	42	U(34	U(34	NNP
cord-001824-7c37elh6	7	43	)	)	-RRB-
cord-001824-7c37elh6	7	44	)	)	-RRB-
cord-001824-7c37elh6	7	45	.	.	.
cord-001824-7c37elh6	8	1	Earlier	early	RBR
cord-001824-7c37elh6	8	2	we	-PRON-	PRP
cord-001824-7c37elh6	8	3	showed	show	VBD
cord-001824-7c37elh6	8	4	that	that	IN
cord-001824-7c37elh6	8	5	mutants	mutant	NNS
cord-001824-7c37elh6	8	6	unable	unable	JJ
cord-001824-7c37elh6	8	7	to	to	TO
cord-001824-7c37elh6	8	8	form	form	VB
cord-001824-7c37elh6	8	9	the	the	DT
cord-001824-7c37elh6	8	10	side	side	NN
cord-001824-7c37elh6	8	11	chain	chain	NN
cord-001824-7c37elh6	8	12	at	at	IN
cord-001824-7c37elh6	8	13	position	position	NN
cord-001824-7c37elh6	8	14	5	5	CD
cord-001824-7c37elh6	8	15	(	(	-LRB-
cord-001824-7c37elh6	8	16	ncm(5	ncm(5	NNP
cord-001824-7c37elh6	8	17	)	)	-RRB-
cord-001824-7c37elh6	8	18	or	or	CC
cord-001824-7c37elh6	8	19	mcm(5	mcm(5	NN
cord-001824-7c37elh6	8	20	)	)	-RRB-
cord-001824-7c37elh6	8	21	)	)	-RRB-
cord-001824-7c37elh6	8	22	or	or	CC
cord-001824-7c37elh6	8	23	lacking	lack	VBG
cord-001824-7c37elh6	8	24	sulphur	sulphur	NN
cord-001824-7c37elh6	8	25	at	at	IN
cord-001824-7c37elh6	8	26	position	position	NN
cord-001824-7c37elh6	8	27	2	2	CD
cord-001824-7c37elh6	8	28	(	(	-LRB-
cord-001824-7c37elh6	8	29	s(2	s(2	NNP
cord-001824-7c37elh6	8	30	)	)	-RRB-
cord-001824-7c37elh6	8	31	)	)	-RRB-
cord-001824-7c37elh6	8	32	of	of	IN
cord-001824-7c37elh6	8	33	U(34	U(34	NNP
cord-001824-7c37elh6	8	34	)	)	-RRB-
cord-001824-7c37elh6	8	35	result	result	VB
cord-001824-7c37elh6	8	36	in	in	IN
cord-001824-7c37elh6	8	37	pleiotropic	pleiotropic	JJ
cord-001824-7c37elh6	8	38	phenotypes	phenotype	NNS
cord-001824-7c37elh6	8	39	,	,	,
cord-001824-7c37elh6	8	40	which	which	WDT
cord-001824-7c37elh6	8	41	are	be	VBP
cord-001824-7c37elh6	8	42	all	all	DT
cord-001824-7c37elh6	8	43	suppressed	suppress	VBN
cord-001824-7c37elh6	8	44	by	by	IN
cord-001824-7c37elh6	8	45	overexpression	overexpression	NN
cord-001824-7c37elh6	8	46	of	of	IN
cord-001824-7c37elh6	8	47	hypomodified	hypomodified	JJ
cord-001824-7c37elh6	8	48	tRNAs	trna	NNS
cord-001824-7c37elh6	8	49	.	.	.
cord-001824-7c37elh6	9	1	This	this	DT
cord-001824-7c37elh6	9	2	observation	observation	NN
cord-001824-7c37elh6	9	3	suggests	suggest	VBZ
cord-001824-7c37elh6	9	4	that	that	IN
cord-001824-7c37elh6	9	5	the	the	DT
cord-001824-7c37elh6	9	6	observed	observed	JJ
cord-001824-7c37elh6	9	7	phenotypes	phenotype	NNS
cord-001824-7c37elh6	9	8	are	be	VBP
cord-001824-7c37elh6	9	9	due	due	JJ
cord-001824-7c37elh6	9	10	to	to	IN
cord-001824-7c37elh6	9	11	inefficient	inefficient	JJ
cord-001824-7c37elh6	9	12	reading	reading	NN
cord-001824-7c37elh6	9	13	of	of	IN
cord-001824-7c37elh6	9	14	cognate	cognate	JJ
cord-001824-7c37elh6	9	15	codons	codon	NNS
cord-001824-7c37elh6	9	16	or	or	CC
cord-001824-7c37elh6	9	17	an	an	DT
cord-001824-7c37elh6	9	18	increased	increase	VBN
cord-001824-7c37elh6	9	19	frameshifting	frameshifting	NN
cord-001824-7c37elh6	9	20	.	.	.
cord-001824-7c37elh6	10	1	The	the	DT
cord-001824-7c37elh6	10	2	latter	latter	JJ
cord-001824-7c37elh6	10	3	may	may	MD
cord-001824-7c37elh6	10	4	be	be	VB
cord-001824-7c37elh6	10	5	caused	cause	VBN
cord-001824-7c37elh6	10	6	by	by	IN
cord-001824-7c37elh6	10	7	a	a	DT
cord-001824-7c37elh6	10	8	ternary	ternary	JJ
cord-001824-7c37elh6	10	9	complex	complex	NN
cord-001824-7c37elh6	10	10	(	(	-LRB-
cord-001824-7c37elh6	10	11	aminoacyl	aminoacyl	VBN
cord-001824-7c37elh6	10	12	-	-	HYPH
cord-001824-7c37elh6	10	13	tRNA*eEF1A*GTP	trna*eef1a*gtp	NN
cord-001824-7c37elh6	10	14	)	)	-RRB-
cord-001824-7c37elh6	10	15	with	with	IN
cord-001824-7c37elh6	10	16	a	a	DT
cord-001824-7c37elh6	10	17	modification	modification	NN
cord-001824-7c37elh6	10	18	deficient	deficient	JJ
cord-001824-7c37elh6	10	19	tRNA	trna	NN
cord-001824-7c37elh6	10	20	inefficiently	inefficiently	RB
cord-001824-7c37elh6	10	21	being	be	VBG
cord-001824-7c37elh6	10	22	accepted	accept	VBN
cord-001824-7c37elh6	10	23	to	to	IN
cord-001824-7c37elh6	10	24	the	the	DT
cord-001824-7c37elh6	10	25	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	10	26	A	a	NN
cord-001824-7c37elh6	10	27	-	-	HYPH
cord-001824-7c37elh6	10	28	site	site	NN
cord-001824-7c37elh6	10	29	and	and	CC
cord-001824-7c37elh6	10	30	thereby	thereby	RB
cord-001824-7c37elh6	10	31	allowing	allow	VBG
cord-001824-7c37elh6	10	32	an	an	DT
cord-001824-7c37elh6	10	33	increased	increase	VBN
cord-001824-7c37elh6	10	34	peptidyl	peptidyl	JJ
cord-001824-7c37elh6	10	35	-	-	HYPH
cord-001824-7c37elh6	10	36	tRNA	trna	NN
cord-001824-7c37elh6	10	37	slippage	slippage	NN
cord-001824-7c37elh6	10	38	and	and	CC
cord-001824-7c37elh6	10	39	thus	thus	RB
cord-001824-7c37elh6	10	40	a	a	DT
cord-001824-7c37elh6	10	41	frameshift	frameshift	NN
cord-001824-7c37elh6	10	42	error	error	NN
cord-001824-7c37elh6	10	43	.	.	.
cord-001824-7c37elh6	11	1	In	in	IN
cord-001824-7c37elh6	11	2	this	this	DT
cord-001824-7c37elh6	11	3	study	study	NN
cord-001824-7c37elh6	11	4	,	,	,
cord-001824-7c37elh6	11	5	we	-PRON-	PRP
cord-001824-7c37elh6	11	6	have	have	VBP
cord-001824-7c37elh6	11	7	investigated	investigate	VBN
cord-001824-7c37elh6	11	8	the	the	DT
cord-001824-7c37elh6	11	9	role	role	NN
cord-001824-7c37elh6	11	10	of	of	IN
cord-001824-7c37elh6	11	11	wobble	wobble	NN
cord-001824-7c37elh6	11	12	uridine	uridine	NN
cord-001824-7c37elh6	11	13	modifications	modification	NNS
cord-001824-7c37elh6	11	14	in	in	IN
cord-001824-7c37elh6	11	15	reading	read	VBG
cord-001824-7c37elh6	11	16	frame	frame	NN
cord-001824-7c37elh6	11	17	maintenance	maintenance	NN
cord-001824-7c37elh6	11	18	,	,	,
cord-001824-7c37elh6	11	19	using	use	VBG
cord-001824-7c37elh6	11	20	either	either	CC
cord-001824-7c37elh6	11	21	the	the	DT
cord-001824-7c37elh6	11	22	Renilla	Renilla	NNP
cord-001824-7c37elh6	11	23	/	/	SYM
cord-001824-7c37elh6	11	24	Firefly	Firefly	NNP
cord-001824-7c37elh6	11	25	luciferase	luciferase	NN
cord-001824-7c37elh6	11	26	bicistronic	bicistronic	JJ
cord-001824-7c37elh6	11	27	reporter	reporter	NN
cord-001824-7c37elh6	11	28	system	system	NN
cord-001824-7c37elh6	11	29	or	or	CC
cord-001824-7c37elh6	11	30	a	a	DT
cord-001824-7c37elh6	11	31	modified	modified	JJ
cord-001824-7c37elh6	11	32	Ty1	ty1	NN
cord-001824-7c37elh6	11	33	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	11	34	site	site	NN
cord-001824-7c37elh6	11	35	in	in	IN
cord-001824-7c37elh6	11	36	a	a	DT
cord-001824-7c37elh6	11	37	HIS4A::lacZ	HIS4A::lacZ	NNP
cord-001824-7c37elh6	11	38	reporter	reporter	NN
cord-001824-7c37elh6	11	39	system	system	NN
cord-001824-7c37elh6	11	40	.	.	.
cord-001824-7c37elh6	12	1	We	-PRON-	PRP
cord-001824-7c37elh6	12	2	here	here	RB
cord-001824-7c37elh6	12	3	show	show	VBP
cord-001824-7c37elh6	12	4	that	that	IN
cord-001824-7c37elh6	12	5	the	the	DT
cord-001824-7c37elh6	12	6	presence	presence	NN
cord-001824-7c37elh6	12	7	of	of	IN
cord-001824-7c37elh6	12	8	mcm(5	mcm(5	NN
cord-001824-7c37elh6	12	9	)	)	-RRB-
cord-001824-7c37elh6	12	10	and	and	CC
cord-001824-7c37elh6	12	11	s(2	s(2	NNP
cord-001824-7c37elh6	12	12	)	)	-RRB-
cord-001824-7c37elh6	12	13	side	side	NN
cord-001824-7c37elh6	12	14	groups	group	NNS
cord-001824-7c37elh6	12	15	at	at	IN
cord-001824-7c37elh6	12	16	wobble	wobble	NN
cord-001824-7c37elh6	12	17	uridines	uridine	NNS
cord-001824-7c37elh6	12	18	are	be	VBP
cord-001824-7c37elh6	12	19	important	important	JJ
cord-001824-7c37elh6	12	20	for	for	IN
cord-001824-7c37elh6	12	21	reading	read	VBG
cord-001824-7c37elh6	12	22	frame	frame	NN
cord-001824-7c37elh6	12	23	maintenance	maintenance	NN
cord-001824-7c37elh6	12	24	and	and	CC
cord-001824-7c37elh6	12	25	thus	thus	RB
cord-001824-7c37elh6	12	26	the	the	DT
cord-001824-7c37elh6	12	27	aforementioned	aforementioned	JJ
cord-001824-7c37elh6	12	28	mutant	mutant	JJ
cord-001824-7c37elh6	12	29	phenotypes	phenotype	NNS
cord-001824-7c37elh6	12	30	might	may	MD
cord-001824-7c37elh6	12	31	partly	partly	RB
cord-001824-7c37elh6	12	32	be	be	VB
cord-001824-7c37elh6	12	33	due	due	JJ
cord-001824-7c37elh6	12	34	to	to	IN
cord-001824-7c37elh6	12	35	frameshift	frameshift	NN
cord-001824-7c37elh6	12	36	errors	error	NNS
cord-001824-7c37elh6	12	37	.	.	.
cord-001824-7c37elh6	13	1	Transfer	transfer	NN
cord-001824-7c37elh6	13	2	of	of	IN
cord-001824-7c37elh6	13	3	genetic	genetic	JJ
cord-001824-7c37elh6	13	4	information	information	NN
cord-001824-7c37elh6	13	5	from	from	IN
cord-001824-7c37elh6	13	6	mRNA	mRNA	NNP
cord-001824-7c37elh6	13	7	into	into	IN
cord-001824-7c37elh6	13	8	proteins	protein	NNS
cord-001824-7c37elh6	13	9	is	be	VBZ
cord-001824-7c37elh6	13	10	the	the	DT
cord-001824-7c37elh6	13	11	most	most	JJS
cord-001824-7c37elh6	13	12	energy	energy	NN
cord-001824-7c37elh6	13	13	consuming	consuming	NN
cord-001824-7c37elh6	13	14	process	process	NN
cord-001824-7c37elh6	13	15	in	in	IN
cord-001824-7c37elh6	13	16	the	the	DT
cord-001824-7c37elh6	13	17	cell	cell	NN
cord-001824-7c37elh6	13	18	and	and	CC
cord-001824-7c37elh6	13	19	the	the	DT
cord-001824-7c37elh6	13	20	translation	translation	NN
cord-001824-7c37elh6	13	21	machinery	machinery	NN
cord-001824-7c37elh6	13	22	needs	need	VBZ
cord-001824-7c37elh6	13	23	to	to	TO
cord-001824-7c37elh6	13	24	decode	decode	VB
cord-001824-7c37elh6	13	25	mRNAs	mrnas	PRP
cord-001824-7c37elh6	13	26	with	with	IN
cord-001824-7c37elh6	13	27	high	high	JJ
cord-001824-7c37elh6	13	28	efficiency	efficiency	NN
cord-001824-7c37elh6	13	29	and	and	CC
cord-001824-7c37elh6	13	30	fidelity	fidelity	NN
cord-001824-7c37elh6	13	31	(	(	-LRB-
cord-001824-7c37elh6	13	32	1	1	CD
cord-001824-7c37elh6	13	33	)	)	-RRB-
cord-001824-7c37elh6	13	34	.	.	.
cord-001824-7c37elh6	14	1	Even	even	RB
cord-001824-7c37elh6	14	2	though	though	IN
cord-001824-7c37elh6	14	3	the	the	DT
cord-001824-7c37elh6	14	4	translational	translational	JJ
cord-001824-7c37elh6	14	5	machinery	machinery	NN
cord-001824-7c37elh6	14	6	transfers	transfer	VBZ
cord-001824-7c37elh6	14	7	the	the	DT
cord-001824-7c37elh6	14	8	information	information	NN
cord-001824-7c37elh6	14	9	in	in	IN
cord-001824-7c37elh6	14	10	mRNA	mrna	NN
cord-001824-7c37elh6	14	11	into	into	IN
cord-001824-7c37elh6	14	12	protein	protein	NN
cord-001824-7c37elh6	14	13	with	with	IN
cord-001824-7c37elh6	14	14	high	high	JJ
cord-001824-7c37elh6	14	15	fidelity	fidelity	NN
cord-001824-7c37elh6	14	16	,	,	,
cord-001824-7c37elh6	14	17	errors	error	NNS
cord-001824-7c37elh6	14	18	occur	occur	VBP
cord-001824-7c37elh6	14	19	at	at	IN
cord-001824-7c37elh6	14	20	a	a	DT
cord-001824-7c37elh6	14	21	low	low	JJ
cord-001824-7c37elh6	14	22	frequency	frequency	NN
cord-001824-7c37elh6	14	23	.	.	.
cord-001824-7c37elh6	15	1	Missense	missense	NN
cord-001824-7c37elh6	15	2	errors	error	NNS
cord-001824-7c37elh6	15	3	are	be	VBP
cord-001824-7c37elh6	15	4	in	in	IN
cord-001824-7c37elh6	15	5	most	most	JJS
cord-001824-7c37elh6	15	6	cases	case	NNS
cord-001824-7c37elh6	15	7	not	not	RB
cord-001824-7c37elh6	15	8	harmful	harmful	JJ
cord-001824-7c37elh6	15	9	to	to	IN
cord-001824-7c37elh6	15	10	the	the	DT
cord-001824-7c37elh6	15	11	function	function	NN
cord-001824-7c37elh6	15	12	of	of	IN
cord-001824-7c37elh6	15	13	a	a	DT
cord-001824-7c37elh6	15	14	protein	protein	NN
cord-001824-7c37elh6	15	15	,	,	,
cord-001824-7c37elh6	15	16	since	since	IN
cord-001824-7c37elh6	15	17	such	such	JJ
cord-001824-7c37elh6	15	18	errors	error	NNS
cord-001824-7c37elh6	15	19	alter	alter	VBP
cord-001824-7c37elh6	15	20	only	only	RB
cord-001824-7c37elh6	15	21	one	one	CD
cord-001824-7c37elh6	15	22	single	single	JJ
cord-001824-7c37elh6	15	23	amino	amino	NN
cord-001824-7c37elh6	15	24	acid	acid	NN
cord-001824-7c37elh6	15	25	,	,	,
cord-001824-7c37elh6	15	26	which	which	WDT
cord-001824-7c37elh6	15	27	will	will	MD
cord-001824-7c37elh6	15	28	not	not	RB
cord-001824-7c37elh6	15	29	interfere	interfere	VB
cord-001824-7c37elh6	15	30	with	with	IN
cord-001824-7c37elh6	15	31	the	the	DT
cord-001824-7c37elh6	15	32	function	function	NN
cord-001824-7c37elh6	15	33	or	or	CC
cord-001824-7c37elh6	15	34	stability	stability	NN
cord-001824-7c37elh6	15	35	of	of	IN
cord-001824-7c37elh6	15	36	the	the	DT
cord-001824-7c37elh6	15	37	protein	protein	NN
cord-001824-7c37elh6	15	38	if	if	IN
cord-001824-7c37elh6	15	39	they	-PRON-	PRP
cord-001824-7c37elh6	15	40	occur	occur	VBP
cord-001824-7c37elh6	15	41	in	in	IN
cord-001824-7c37elh6	15	42	non	non	JJ
cord-001824-7c37elh6	15	43	-	-	JJ
cord-001824-7c37elh6	15	44	critical	critical	JJ
cord-001824-7c37elh6	15	45	positions	position	NNS
cord-001824-7c37elh6	15	46	.	.	.
cord-001824-7c37elh6	16	1	In	in	IN
cord-001824-7c37elh6	16	2	contrast	contrast	NN
cord-001824-7c37elh6	16	3	,	,	,
cord-001824-7c37elh6	16	4	processivity	processivity	NN
cord-001824-7c37elh6	16	5	errors	error	NNS
cord-001824-7c37elh6	16	6	,	,	,
cord-001824-7c37elh6	16	7	like	like	IN
cord-001824-7c37elh6	16	8	frameshift	frameshift	NN
cord-001824-7c37elh6	16	9	errors	error	NNS
cord-001824-7c37elh6	16	10	,	,	,
cord-001824-7c37elh6	16	11	are	be	VBP
cord-001824-7c37elh6	16	12	detrimental	detrimental	JJ
cord-001824-7c37elh6	16	13	,	,	,
cord-001824-7c37elh6	16	14	since	since	IN
cord-001824-7c37elh6	16	15	they	-PRON-	PRP
cord-001824-7c37elh6	16	16	completely	completely	RB
cord-001824-7c37elh6	16	17	change	change	VBP
cord-001824-7c37elh6	16	18	the	the	DT
cord-001824-7c37elh6	16	19	amino	amino	NN
cord-001824-7c37elh6	16	20	acid	acid	NN
cord-001824-7c37elh6	16	21	sequence	sequence	NN
cord-001824-7c37elh6	16	22	downstream	downstream	RB
cord-001824-7c37elh6	16	23	of	of	IN
cord-001824-7c37elh6	16	24	the	the	DT
cord-001824-7c37elh6	16	25	frameshift	frameshift	NN
cord-001824-7c37elh6	16	26	site	site	NN
cord-001824-7c37elh6	16	27	.	.	.
cord-001824-7c37elh6	17	1	Moreover	moreover	RB
cord-001824-7c37elh6	17	2	,	,	,
cord-001824-7c37elh6	17	3	following	follow	VBG
cord-001824-7c37elh6	17	4	such	such	PDT
cord-001824-7c37elh6	17	5	an	an	DT
cord-001824-7c37elh6	17	6	error	error	NN
cord-001824-7c37elh6	17	7	,	,	,
cord-001824-7c37elh6	17	8	the	the	DT
cord-001824-7c37elh6	17	9	ribosome	ribosome	NN
cord-001824-7c37elh6	17	10	frequently	frequently	RB
cord-001824-7c37elh6	17	11	encounters	encounter	VBZ
cord-001824-7c37elh6	17	12	a	a	DT
cord-001824-7c37elh6	17	13	stop	stop	NN
cord-001824-7c37elh6	17	14	codon	codon	NN
cord-001824-7c37elh6	17	15	in	in	IN
cord-001824-7c37elh6	17	16	the	the	DT
cord-001824-7c37elh6	17	17	new	new	JJ
cord-001824-7c37elh6	17	18	reading	reading	NN
cord-001824-7c37elh6	17	19	frame	frame	NN
cord-001824-7c37elh6	17	20	resulting	result	VBG
cord-001824-7c37elh6	17	21	in	in	IN
cord-001824-7c37elh6	17	22	premature	premature	JJ
cord-001824-7c37elh6	17	23	termination	termination	NN
cord-001824-7c37elh6	17	24	of	of	IN
cord-001824-7c37elh6	17	25	translation	translation	NN
cord-001824-7c37elh6	17	26	.	.	.
cord-001824-7c37elh6	18	1	Accordingly	accordingly	RB
cord-001824-7c37elh6	18	2	,	,	,
cord-001824-7c37elh6	18	3	the	the	DT
cord-001824-7c37elh6	18	4	frequency	frequency	NN
cord-001824-7c37elh6	18	5	of	of	IN
cord-001824-7c37elh6	18	6	frameshift	frameshift	NN
cord-001824-7c37elh6	18	7	errors	error	NNS
cord-001824-7c37elh6	18	8	is	be	VBZ
cord-001824-7c37elh6	18	9	about	about	RB
cord-001824-7c37elh6	18	10	10-fold	10-fold	JJ
cord-001824-7c37elh6	18	11	lower	low	JJR
cord-001824-7c37elh6	18	12	than	than	IN
cord-001824-7c37elh6	18	13	the	the	DT
cord-001824-7c37elh6	18	14	frequency	frequency	NN
cord-001824-7c37elh6	18	15	of	of	IN
cord-001824-7c37elh6	18	16	missense	missense	NN
cord-001824-7c37elh6	18	17	errors	error	NNS
cord-001824-7c37elh6	18	18	(	(	-LRB-
cord-001824-7c37elh6	18	19	1	1	CD
cord-001824-7c37elh6	18	20	,	,	,
cord-001824-7c37elh6	18	21	2	2	CD
cord-001824-7c37elh6	18	22	)	)	-RRB-
cord-001824-7c37elh6	18	23	.	.	.
cord-001824-7c37elh6	19	1	There	there	EX
cord-001824-7c37elh6	19	2	are	be	VBP
cord-001824-7c37elh6	19	3	many	many	JJ
cord-001824-7c37elh6	19	4	examples	example	NNS
cord-001824-7c37elh6	19	5	where	where	WRB
cord-001824-7c37elh6	19	6	alterations	alteration	NNS
cord-001824-7c37elh6	19	7	in	in	IN
cord-001824-7c37elh6	19	8	the	the	DT
cord-001824-7c37elh6	19	9	tRNA	tRNA	NNP
cord-001824-7c37elh6	19	10	structure	structure	NN
cord-001824-7c37elh6	19	11	,	,	,
cord-001824-7c37elh6	19	12	e.g.	e.g.	IN
cord-001824-7c37elh6	19	13	lack	lack	NN
cord-001824-7c37elh6	19	14	of	of	IN
cord-001824-7c37elh6	19	15	a	a	DT
cord-001824-7c37elh6	19	16	modified	modified	JJ
cord-001824-7c37elh6	19	17	nucleoside	nucleoside	NN
cord-001824-7c37elh6	19	18	,	,	,
cord-001824-7c37elh6	19	19	will	will	MD
cord-001824-7c37elh6	19	20	affect	affect	VB
cord-001824-7c37elh6	19	21	the	the	DT
cord-001824-7c37elh6	19	22	fidelity	fidelity	NN
cord-001824-7c37elh6	19	23	of	of	IN
cord-001824-7c37elh6	19	24	reading	read	VBG
cord-001824-7c37elh6	19	25	frame	frame	NN
cord-001824-7c37elh6	19	26	maintenance	maintenance	NN
cord-001824-7c37elh6	19	27	(	(	-LRB-
cord-001824-7c37elh6	19	28	3	3	CD
cord-001824-7c37elh6	19	29	,	,	,
cord-001824-7c37elh6	19	30	4	4	CD
cord-001824-7c37elh6	19	31	)	)	-RRB-
cord-001824-7c37elh6	19	32	.	.	.
cord-001824-7c37elh6	20	1	In	in	IN
cord-001824-7c37elh6	20	2	bacteria	bacteria	NNS
cord-001824-7c37elh6	20	3	,	,	,
cord-001824-7c37elh6	20	4	modified	modify	VBN
cord-001824-7c37elh6	20	5	nucleosides	nucleoside	NNS
cord-001824-7c37elh6	20	6	of	of	IN
cord-001824-7c37elh6	20	7	different	different	JJ
cord-001824-7c37elh6	20	8	chemical	chemical	NN
cord-001824-7c37elh6	20	9	structures	structure	NNS
cord-001824-7c37elh6	20	10	,	,	,
cord-001824-7c37elh6	20	11	present	present	JJ
cord-001824-7c37elh6	20	12	in	in	IN
cord-001824-7c37elh6	20	13	different	different	JJ
cord-001824-7c37elh6	20	14	positions	position	NNS
cord-001824-7c37elh6	20	15	,	,	,
cord-001824-7c37elh6	20	16	and	and	CC
cord-001824-7c37elh6	20	17	in	in	IN
cord-001824-7c37elh6	20	18	different	different	JJ
cord-001824-7c37elh6	20	19	species	specie	NNS
cord-001824-7c37elh6	20	20	of	of	IN
cord-001824-7c37elh6	20	21	the	the	DT
cord-001824-7c37elh6	20	22	tRNA	trna	NN
cord-001824-7c37elh6	20	23	all	all	DT
cord-001824-7c37elh6	20	24	prevent	prevent	VBP
cord-001824-7c37elh6	20	25	frameshifts	frameshifts	NNP
cord-001824-7c37elh6	20	26	errors	error	NNS
cord-001824-7c37elh6	20	27	(	(	-LRB-
cord-001824-7c37elh6	20	28	5	5	CD
cord-001824-7c37elh6	20	29	,	,	,
cord-001824-7c37elh6	20	30	6	6	CD
cord-001824-7c37elh6	20	31	)	)	-RRB-
cord-001824-7c37elh6	20	32	.	.	.
cord-001824-7c37elh6	21	1	In	in	IN
cord-001824-7c37elh6	21	2	eukaryotes	eukaryote	NNS
cord-001824-7c37elh6	21	3	,	,	,
cord-001824-7c37elh6	21	4	both	both	DT
cord-001824-7c37elh6	21	5	wyosin	wyosin	NNP
cord-001824-7c37elh6	21	6	(	(	-LRB-
cord-001824-7c37elh6	21	7	yW	yW	NNP
cord-001824-7c37elh6	21	8	)	)	-RRB-
cord-001824-7c37elh6	21	9	and	and	CC
cord-001824-7c37elh6	21	10	queosine	queosine	NNP
cord-001824-7c37elh6	21	11	(	(	-LRB-
cord-001824-7c37elh6	21	12	Q	Q	NNP
cord-001824-7c37elh6	21	13	)	)	-RRB-
cord-001824-7c37elh6	21	14	in	in	IN
cord-001824-7c37elh6	21	15	rabbit	rabbit	NN
cord-001824-7c37elh6	21	16	reticulocytes	reticulocyte	NNS
cord-001824-7c37elh6	21	17	as	as	RB
cord-001824-7c37elh6	21	18	well	well	RB
cord-001824-7c37elh6	21	19	as	as	IN
cord-001824-7c37elh6	21	20	other	other	JJ
cord-001824-7c37elh6	21	21	modified	modify	VBN
cord-001824-7c37elh6	21	22	nucleosides	nucleoside	NNS
cord-001824-7c37elh6	21	23	present	present	JJ
cord-001824-7c37elh6	21	24	in	in	IN
cord-001824-7c37elh6	21	25	the	the	DT
cord-001824-7c37elh6	21	26	anticodon	anticodon	NN
cord-001824-7c37elh6	21	27	loop	loop	NN
cord-001824-7c37elh6	21	28	of	of	IN
cord-001824-7c37elh6	21	29	eukaryotic	eukaryotic	JJ
cord-001824-7c37elh6	22	1	tRNAs	trna	NNS
cord-001824-7c37elh6	22	2	are	be	VBP
cord-001824-7c37elh6	22	3	important	important	JJ
cord-001824-7c37elh6	22	4	to	to	TO
cord-001824-7c37elh6	22	5	maintain	maintain	VB
cord-001824-7c37elh6	22	6	the	the	DT
cord-001824-7c37elh6	22	7	reading	reading	NN
cord-001824-7c37elh6	22	8	frame	frame	NN
cord-001824-7c37elh6	22	9	(	(	-LRB-
cord-001824-7c37elh6	22	10	7	7	CD
cord-001824-7c37elh6	22	11	,	,	,
cord-001824-7c37elh6	22	12	8)	8)	NN
cord-001824-7c37elh6	22	13	.	.	.
cord-001824-7c37elh6	23	1	Synthesis	synthesis	NN
cord-001824-7c37elh6	23	2	of	of	IN
cord-001824-7c37elh6	23	3	yW	yW	NNP
cord-001824-7c37elh6	23	4	in	in	IN
cord-001824-7c37elh6	23	5	yeast	yeast	NN
cord-001824-7c37elh6	23	6	tRNA	trna	NN
cord-001824-7c37elh6	23	7	occurs	occur	VBZ
cord-001824-7c37elh6	23	8	in	in	IN
cord-001824-7c37elh6	23	9	several	several	JJ
cord-001824-7c37elh6	23	10	steps	step	NNS
cord-001824-7c37elh6	23	11	and	and	CC
cord-001824-7c37elh6	24	1	whereas	whereas	IN
cord-001824-7c37elh6	24	2	fully	fully	RB
cord-001824-7c37elh6	24	3	modified	modify	VBN
cord-001824-7c37elh6	24	4	yW	yW	NNP
cord-001824-7c37elh6	24	5	has	have	VBZ
cord-001824-7c37elh6	24	6	a	a	DT
cord-001824-7c37elh6	24	7	low	low	JJ
cord-001824-7c37elh6	24	8	frequency	frequency	NN
cord-001824-7c37elh6	24	9	of	of	IN
cord-001824-7c37elh6	24	10	frameshifting	frameshifting	NN
cord-001824-7c37elh6	24	11	,	,	,
cord-001824-7c37elh6	24	12	presence	presence	NN
cord-001824-7c37elh6	24	13	of	of	IN
cord-001824-7c37elh6	24	14	any	any	DT
cord-001824-7c37elh6	24	15	of	of	IN
cord-001824-7c37elh6	24	16	the	the	DT
cord-001824-7c37elh6	24	17	various	various	JJ
cord-001824-7c37elh6	24	18	intermediates	intermediate	NNS
cord-001824-7c37elh6	24	19	in	in	IN
cord-001824-7c37elh6	24	20	the	the	DT
cord-001824-7c37elh6	24	21	synthesis	synthesis	NN
cord-001824-7c37elh6	24	22	of	of	IN
cord-001824-7c37elh6	24	23	yW	yw	NN
cord-001824-7c37elh6	24	24	all	all	DT
cord-001824-7c37elh6	24	25	increase	increase	NN
cord-001824-7c37elh6	24	26	frameshifting	frameshifting	NN
cord-001824-7c37elh6	24	27	(	(	-LRB-
cord-001824-7c37elh6	24	28	9	9	CD
cord-001824-7c37elh6	24	29	)	)	-RRB-
cord-001824-7c37elh6	24	30	.	.	.
cord-001824-7c37elh6	25	1	Also	also	RB
cord-001824-7c37elh6	25	2	,	,	,
cord-001824-7c37elh6	25	3	lack	lack	NN
cord-001824-7c37elh6	25	4	of	of	IN
cord-001824-7c37elh6	25	5	either	either	DT
cord-001824-7c37elh6	25	6	cyclic	cyclic	NN
cord-001824-7c37elh6	26	1	N6-threonylcarbamoyladenosine	N6-threonylcarbamoyladenosine	NNP
cord-001824-7c37elh6	26	2	(	(	-LRB-
cord-001824-7c37elh6	26	3	ct	ct	NNP
cord-001824-7c37elh6	26	4	6	6	CD
cord-001824-7c37elh6	26	5	A	A	NNP
cord-001824-7c37elh6	26	6	)	)	-RRB-
cord-001824-7c37elh6	26	7	at	at	IN
cord-001824-7c37elh6	26	8	position	position	NN
cord-001824-7c37elh6	26	9	37	37	CD
cord-001824-7c37elh6	26	10	or	or	CC
cord-001824-7c37elh6	26	11	pseudouridine	pseudouridine	NN
cord-001824-7c37elh6	26	12	(	(	-LRB-
cord-001824-7c37elh6	26	13	)	)	-RRB-
cord-001824-7c37elh6	26	14	at	at	IN
cord-001824-7c37elh6	26	15	position	position	NN
cord-001824-7c37elh6	26	16	38	38	CD
cord-001824-7c37elh6	26	17	and	and	CC
cord-001824-7c37elh6	26	18	39	39	CD
cord-001824-7c37elh6	26	19	in	in	IN
cord-001824-7c37elh6	26	20	yeast	yeast	NN
cord-001824-7c37elh6	26	21	tRNA	trna	NN
cord-001824-7c37elh6	26	22	increases	increase	VBZ
cord-001824-7c37elh6	26	23	+1	+1	XX
cord-001824-7c37elh6	26	24	frameshifting	frameshifting	NN
cord-001824-7c37elh6	26	25	(	(	-LRB-
cord-001824-7c37elh6	26	26	10	10	CD
cord-001824-7c37elh6	26	27	)	)	-RRB-
cord-001824-7c37elh6	26	28	(	(	-LRB-
cord-001824-7c37elh6	26	29	11	11	CD
cord-001824-7c37elh6	26	30	)	)	-RRB-
cord-001824-7c37elh6	26	31	(	(	-LRB-
cord-001824-7c37elh6	26	32	12	12	CD
cord-001824-7c37elh6	26	33	)	)	-RRB-
cord-001824-7c37elh6	26	34	(	(	-LRB-
cord-001824-7c37elh6	26	35	13	13	CD
cord-001824-7c37elh6	26	36	)	)	-RRB-
cord-001824-7c37elh6	26	37	.	.	.
cord-001824-7c37elh6	27	1	Relevant	relevant	JJ
cord-001824-7c37elh6	27	2	for	for	IN
cord-001824-7c37elh6	27	3	this	this	DT
cord-001824-7c37elh6	27	4	study	study	NN
cord-001824-7c37elh6	27	5	,	,	,
cord-001824-7c37elh6	27	6	the	the	DT
cord-001824-7c37elh6	27	7	modified	modify	VBN
cord-001824-7c37elh6	27	8	wobble	wobble	NN
cord-001824-7c37elh6	27	9	nucleoside	nucleoside	RB
cord-001824-7c37elh6	27	10	5methylaminomethyl-2-thiouridine	5methylaminomethyl-2-thiouridine	CD
cord-001824-7c37elh6	28	1	(	(	-LRB-
cord-001824-7c37elh6	28	2	mnm	mnm	NNP
cord-001824-7c37elh6	28	3	5	5	NNP
cord-001824-7c37elh6	28	4	s	s	SYM
cord-001824-7c37elh6	28	5	2	2	CD
cord-001824-7c37elh6	28	6	U	U	NNP
cord-001824-7c37elh6	28	7	34	34	CD
cord-001824-7c37elh6	28	8	)	)	-RRB-
cord-001824-7c37elh6	28	9	present	present	JJ
cord-001824-7c37elh6	28	10	in	in	IN
cord-001824-7c37elh6	28	11	bacterial	bacterial	JJ
cord-001824-7c37elh6	28	12	tRNA	trna	NN
cord-001824-7c37elh6	28	13	specific	specific	JJ
cord-001824-7c37elh6	28	14	for	for	IN
cord-001824-7c37elh6	28	15	Gln	Gln	NNP
cord-001824-7c37elh6	28	16	,	,	,
cord-001824-7c37elh6	28	17	Lys	Lys	NNP
cord-001824-7c37elh6	28	18	and	and	CC
cord-001824-7c37elh6	28	19	Glu	Glu	NNP
cord-001824-7c37elh6	28	20	,	,	,
cord-001824-7c37elh6	28	21	is	be	VBZ
cord-001824-7c37elh6	28	22	important	important	JJ
cord-001824-7c37elh6	28	23	for	for	IN
cord-001824-7c37elh6	28	24	proper	proper	JJ
cord-001824-7c37elh6	28	25	reading	reading	NN
cord-001824-7c37elh6	28	26	frame	frame	NN
cord-001824-7c37elh6	28	27	maintenance	maintenance	NN
cord-001824-7c37elh6	29	1	(	(	-LRB-
cord-001824-7c37elh6	29	2	The	the	DT
cord-001824-7c37elh6	29	3	wobble	wobble	NN
cord-001824-7c37elh6	29	4	nucleoside	nucleoside	NN
cord-001824-7c37elh6	29	5	is	be	VBZ
cord-001824-7c37elh6	29	6	in	in	IN
cord-001824-7c37elh6	29	7	position	position	NN
cord-001824-7c37elh6	29	8	34	34	CD
cord-001824-7c37elh6	29	9	of	of	IN
cord-001824-7c37elh6	29	10	the	the	DT
cord-001824-7c37elh6	29	11	tRNA	tRNA	NNP
cord-001824-7c37elh6	30	1	and	and	CC
cord-001824-7c37elh6	30	2	we	-PRON-	PRP
cord-001824-7c37elh6	30	3	denote	denote	VBP
cord-001824-7c37elh6	30	4	such	such	PDT
cord-001824-7c37elh6	30	5	a	a	DT
cord-001824-7c37elh6	30	6	nucleoside	nucleoside	NN
cord-001824-7c37elh6	30	7	as	as	IN
cord-001824-7c37elh6	30	8	N	n	CD
cord-001824-7c37elh6	30	9	34	34	CD
cord-001824-7c37elh6	30	10	where	where	WRB
cord-001824-7c37elh6	30	11	N	N	NNP
cord-001824-7c37elh6	30	12	is	be	VBZ
cord-001824-7c37elh6	30	13	any	any	DT
cord-001824-7c37elh6	30	14	nucleoside	nucleoside	NN
cord-001824-7c37elh6	30	15	.	.	.
cord-001824-7c37elh6	30	16	)	)	-RRB-
cord-001824-7c37elh6	31	1	(	(	-LRB-
cord-001824-7c37elh6	31	2	6	6	CD
cord-001824-7c37elh6	31	3	,	,	,
cord-001824-7c37elh6	31	4	(	(	-LRB-
cord-001824-7c37elh6	31	5	14	14	CD
cord-001824-7c37elh6	31	6	)	)	-RRB-
cord-001824-7c37elh6	31	7	(	(	-LRB-
cord-001824-7c37elh6	31	8	15	15	CD
cord-001824-7c37elh6	31	9	)	)	-RRB-
cord-001824-7c37elh6	31	10	(	(	-LRB-
cord-001824-7c37elh6	31	11	16	16	CD
cord-001824-7c37elh6	31	12	)	)	-RRB-
cord-001824-7c37elh6	31	13	(	(	-LRB-
cord-001824-7c37elh6	31	14	17	17	CD
cord-001824-7c37elh6	31	15	)	)	-RRB-
cord-001824-7c37elh6	31	16	.	.	.
cord-001824-7c37elh6	32	1	Apparently	apparently	RB
cord-001824-7c37elh6	32	2	,	,	,
cord-001824-7c37elh6	32	3	modification	modification	NN
cord-001824-7c37elh6	32	4	status	status	NN
cord-001824-7c37elh6	32	5	both	both	CC
cord-001824-7c37elh6	32	6	in	in	IN
cord-001824-7c37elh6	32	7	bacteria	bacteria	NNS
cord-001824-7c37elh6	32	8	and	and	CC
cord-001824-7c37elh6	32	9	in	in	IN
cord-001824-7c37elh6	32	10	eukaryotes	eukaryote	NNS
cord-001824-7c37elh6	32	11	is	be	VBZ
cord-001824-7c37elh6	32	12	important	important	JJ
cord-001824-7c37elh6	32	13	for	for	IN
cord-001824-7c37elh6	32	14	a	a	DT
cord-001824-7c37elh6	32	15	proper	proper	JJ
cord-001824-7c37elh6	32	16	reading	reading	NN
cord-001824-7c37elh6	32	17	frame	frame	NN
cord-001824-7c37elh6	32	18	maintenance	maintenance	NN
cord-001824-7c37elh6	32	19	(	(	-LRB-
cord-001824-7c37elh6	32	20	3	3	CD
cord-001824-7c37elh6	32	21	,	,	,
cord-001824-7c37elh6	32	22	4	4	CD
cord-001824-7c37elh6	32	23	)	)	-RRB-
cord-001824-7c37elh6	32	24	.	.	.
cord-001824-7c37elh6	33	1	A	a	DT
cord-001824-7c37elh6	33	2	peptidyl	peptidyl	JJ
cord-001824-7c37elh6	33	3	-	-	HYPH
cord-001824-7c37elh6	33	4	tRNA	trna	NN
cord-001824-7c37elh6	33	5	slippage	slippage	NN
cord-001824-7c37elh6	33	6	model	model	NN
cord-001824-7c37elh6	33	7	of	of	IN
cord-001824-7c37elh6	33	8	how	how	WRB
cord-001824-7c37elh6	33	9	tRNA	trna	NN
cord-001824-7c37elh6	33	10	modification	modification	NN
cord-001824-7c37elh6	33	11	deficiency	deficiency	NN
cord-001824-7c37elh6	33	12	may	may	MD
cord-001824-7c37elh6	33	13	induce	induce	VB
cord-001824-7c37elh6	33	14	frameshifting	frameshifting	JJ
cord-001824-7c37elh6	33	15	errors	error	NNS
cord-001824-7c37elh6	33	16	is	be	VBZ
cord-001824-7c37elh6	33	17	well	well	RB
cord-001824-7c37elh6	33	18	established	establish	VBN
cord-001824-7c37elh6	33	19	(	(	-LRB-
cord-001824-7c37elh6	33	20	3	3	CD
cord-001824-7c37elh6	33	21	,	,	,
cord-001824-7c37elh6	33	22	4	4	CD
cord-001824-7c37elh6	33	23	,	,	,
cord-001824-7c37elh6	33	24	6	6	CD
cord-001824-7c37elh6	33	25	,	,	,
cord-001824-7c37elh6	33	26	(	(	-LRB-
cord-001824-7c37elh6	33	27	18	18	CD
cord-001824-7c37elh6	33	28	)	)	-RRB-
cord-001824-7c37elh6	33	29	(	(	-LRB-
cord-001824-7c37elh6	33	30	19	19	CD
cord-001824-7c37elh6	33	31	)	)	-RRB-
cord-001824-7c37elh6	33	32	(	(	-LRB-
cord-001824-7c37elh6	33	33	20	20	CD
cord-001824-7c37elh6	33	34	)	)	-RRB-
cord-001824-7c37elh6	33	35	(	(	-LRB-
cord-001824-7c37elh6	33	36	21	21	CD
cord-001824-7c37elh6	33	37	)	)	-RRB-
cord-001824-7c37elh6	33	38	(	(	-LRB-
cord-001824-7c37elh6	33	39	22	22	CD
cord-001824-7c37elh6	33	40	)	)	-RRB-
cord-001824-7c37elh6	33	41	(	(	-LRB-
cord-001824-7c37elh6	33	42	23	23	CD
cord-001824-7c37elh6	33	43	)	)	-RRB-
cord-001824-7c37elh6	33	44	(	(	-LRB-
cord-001824-7c37elh6	33	45	24	24	CD
cord-001824-7c37elh6	33	46	)	)	-RRB-
cord-001824-7c37elh6	33	47	.	.	.
cord-001824-7c37elh6	34	1	According	accord	VBG
cord-001824-7c37elh6	34	2	to	to	IN
cord-001824-7c37elh6	34	3	this	this	DT
cord-001824-7c37elh6	34	4	model	model	NN
cord-001824-7c37elh6	34	5	(	(	-LRB-
cord-001824-7c37elh6	34	6	Figure	figure	NN
cord-001824-7c37elh6	34	7	1	1	CD
cord-001824-7c37elh6	34	8	)	)	-RRB-
cord-001824-7c37elh6	34	9	modification	modification	NN
cord-001824-7c37elh6	34	10	deficient	deficient	JJ
cord-001824-7c37elh6	34	11	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	34	12	-	-	HYPH
cord-001824-7c37elh6	34	13	tRNAs	trna	NNS
cord-001824-7c37elh6	34	14	present	present	JJ
cord-001824-7c37elh6	34	15	Dual	dual	JJ
cord-001824-7c37elh6	34	16	-	-	HYPH
cord-001824-7c37elh6	34	17	error	error	NN
cord-001824-7c37elh6	34	18	frameshifting	frameshifting	NN
cord-001824-7c37elh6	34	19	model	model	NN
cord-001824-7c37elh6	34	20	.	.	.
cord-001824-7c37elh6	35	1	Modification	modification	NN
cord-001824-7c37elh6	35	2	deficient	deficient	JJ
cord-001824-7c37elh6	35	3	tRNAs	trna	NNS
cord-001824-7c37elh6	35	4	can	can	MD
cord-001824-7c37elh6	35	5	induce	induce	VB
cord-001824-7c37elh6	35	6	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	35	7	by	by	IN
cord-001824-7c37elh6	35	8	either	either	CC
cord-001824-7c37elh6	35	9	an	an	DT
cord-001824-7c37elh6	35	10	A	A	NNP
cord-001824-7c37elh6	35	11	-	-	:
cord-001824-7c37elh6	35	12	or	or	CC
cord-001824-7c37elh6	35	13	a	a	DT
cord-001824-7c37elh6	35	14	P	p	NN
cord-001824-7c37elh6	35	15	-	-	HYPH
cord-001824-7c37elh6	35	16	site	site	NN
cord-001824-7c37elh6	35	17	effect	effect	NN
cord-001824-7c37elh6	35	18	,	,	,
cord-001824-7c37elh6	35	19	or	or	CC
cord-001824-7c37elh6	35	20	a	a	DT
cord-001824-7c37elh6	35	21	combination	combination	NN
cord-001824-7c37elh6	35	22	thereof	thereof	RB
cord-001824-7c37elh6	35	23	.	.	.
cord-001824-7c37elh6	36	1	(	(	-LRB-
cord-001824-7c37elh6	36	2	A	a	DT
cord-001824-7c37elh6	36	3	)	)	-RRB-
cord-001824-7c37elh6	36	4	Lack	lack	NN
cord-001824-7c37elh6	36	5	of	of	IN
cord-001824-7c37elh6	36	6	wobble	wobble	NN
cord-001824-7c37elh6	36	7	uridine	uridine	JJ
cord-001824-7c37elh6	36	8	modification	modification	NN
cord-001824-7c37elh6	36	9	reduces	reduce	VBZ
cord-001824-7c37elh6	36	10	the	the	DT
cord-001824-7c37elh6	36	11	efficiency	efficiency	NN
cord-001824-7c37elh6	36	12	of	of	IN
cord-001824-7c37elh6	36	13	the	the	DT
cord-001824-7c37elh6	36	14	ternary	ternary	JJ
cord-001824-7c37elh6	36	15	complex	complex	NN
cord-001824-7c37elh6	36	16	(	(	-LRB-
cord-001824-7c37elh6	36	17	aminoacyl	aminoacyl	VBN
cord-001824-7c37elh6	36	18	-	-	HYPH
cord-001824-7c37elh6	36	19	tRNA*eEF1A*GTP	trna*eef1a*gtp	NN
cord-001824-7c37elh6	36	20	,	,	,
cord-001824-7c37elh6	36	21	here	here	RB
cord-001824-7c37elh6	36	22	shorten	shorten	VB
cord-001824-7c37elh6	36	23	as	as	IN
cord-001824-7c37elh6	36	24	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	36	25	-	-	HYPH
cord-001824-7c37elh6	36	26	tRNA	trna	NN
cord-001824-7c37elh6	36	27	)	)	-RRB-
cord-001824-7c37elh6	36	28	to	to	TO
cord-001824-7c37elh6	36	29	be	be	VB
cord-001824-7c37elh6	36	30	accepted	accept	VBN
cord-001824-7c37elh6	36	31	to	to	IN
cord-001824-7c37elh6	36	32	the	the	DT
cord-001824-7c37elh6	36	33	A	A	NNP
cord-001824-7c37elh6	36	34	-	-	HYPH
cord-001824-7c37elh6	36	35	site	site	NN
cord-001824-7c37elh6	36	36	,	,	,
cord-001824-7c37elh6	36	37	allowing	allow	VBG
cord-001824-7c37elh6	36	38	a	a	DT
cord-001824-7c37elh6	36	39	near	near	JJ
cord-001824-7c37elh6	36	40	cognate	cognate	JJ
cord-001824-7c37elh6	36	41	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	36	42	-	-	HYPH
cord-001824-7c37elh6	36	43	tRNA	trna	NN
cord-001824-7c37elh6	36	44	to	to	TO
cord-001824-7c37elh6	36	45	be	be	VB
cord-001824-7c37elh6	36	46	accepted	accept	VBN
cord-001824-7c37elh6	36	47	in	in	IN
cord-001824-7c37elh6	36	48	the	the	DT
cord-001824-7c37elh6	36	49	A	A	NNP
cord-001824-7c37elh6	36	50	-	-	HYPH
cord-001824-7c37elh6	36	51	site	site	NN
cord-001824-7c37elh6	36	52	.	.	.
cord-001824-7c37elh6	37	1	After	after	IN
cord-001824-7c37elh6	37	2	translocation	translocation	NN
cord-001824-7c37elh6	37	3	to	to	IN
cord-001824-7c37elh6	37	4	the	the	DT
cord-001824-7c37elh6	37	5	P	p	NN
cord-001824-7c37elh6	37	6	-	-	HYPH
cord-001824-7c37elh6	37	7	site	site	NN
cord-001824-7c37elh6	37	8	,	,	,
cord-001824-7c37elh6	37	9	the	the	DT
cord-001824-7c37elh6	37	10	near	near	JJ
cord-001824-7c37elh6	37	11	cognate	cognate	NNP
cord-001824-7c37elh6	37	12	tRNA	tRNA	NNP
cord-001824-7c37elh6	37	13	slips	slip	VBZ
cord-001824-7c37elh6	37	14	into	into	IN
cord-001824-7c37elh6	37	15	an	an	DT
cord-001824-7c37elh6	37	16	alternative	alternative	JJ
cord-001824-7c37elh6	37	17	reading	reading	NN
cord-001824-7c37elh6	37	18	frame	frame	NN
cord-001824-7c37elh6	37	19	,	,	,
cord-001824-7c37elh6	37	20	as	as	IN
cord-001824-7c37elh6	37	21	it	-PRON-	PRP
cord-001824-7c37elh6	37	22	does	do	VBZ
cord-001824-7c37elh6	37	23	not	not	RB
cord-001824-7c37elh6	37	24	perfectly	perfectly	RB
cord-001824-7c37elh6	37	25	fit	fit	VB
cord-001824-7c37elh6	37	26	in	in	IN
cord-001824-7c37elh6	37	27	the	the	DT
cord-001824-7c37elh6	37	28	P	p	NN
cord-001824-7c37elh6	37	29	-	-	HYPH
cord-001824-7c37elh6	37	30	site	site	NN
cord-001824-7c37elh6	37	31	.	.	.
cord-001824-7c37elh6	38	1	(	(	-LRB-
cord-001824-7c37elh6	38	2	B	b	NN
cord-001824-7c37elh6	38	3	)	)	-RRB-
cord-001824-7c37elh6	38	4	Lack	lack	NN
cord-001824-7c37elh6	38	5	of	of	IN
cord-001824-7c37elh6	38	6	wobble	wobble	NN
cord-001824-7c37elh6	38	7	uridine	uridine	JJ
cord-001824-7c37elh6	38	8	modification	modification	NN
cord-001824-7c37elh6	38	9	reduces	reduce	VBZ
cord-001824-7c37elh6	38	10	the	the	DT
cord-001824-7c37elh6	38	11	efficiency	efficiency	NN
cord-001824-7c37elh6	38	12	of	of	IN
cord-001824-7c37elh6	38	13	the	the	DT
cord-001824-7c37elh6	38	14	cognate	cognate	JJ
cord-001824-7c37elh6	38	15	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	38	16	-	-	HYPH
cord-001824-7c37elh6	38	17	tRNA	trna	NN
cord-001824-7c37elh6	38	18	to	to	TO
cord-001824-7c37elh6	38	19	be	be	VB
cord-001824-7c37elh6	38	20	accepted	accept	VBN
cord-001824-7c37elh6	38	21	to	to	IN
cord-001824-7c37elh6	38	22	the	the	DT
cord-001824-7c37elh6	38	23	A	A	NNP
cord-001824-7c37elh6	38	24	-	-	HYPH
cord-001824-7c37elh6	38	25	site	site	NN
cord-001824-7c37elh6	38	26	,	,	,
cord-001824-7c37elh6	38	27	which	which	WDT
cord-001824-7c37elh6	38	28	induces	induce	VBZ
cord-001824-7c37elh6	38	29	a	a	DT
cord-001824-7c37elh6	38	30	pause	pause	NN
cord-001824-7c37elh6	38	31	that	that	WDT
cord-001824-7c37elh6	38	32	allows	allow	VBZ
cord-001824-7c37elh6	38	33	the	the	DT
cord-001824-7c37elh6	38	34	tRNA	trna	NN
cord-001824-7c37elh6	38	35	in	in	IN
cord-001824-7c37elh6	38	36	the	the	DT
cord-001824-7c37elh6	38	37	P	p	NN
cord-001824-7c37elh6	38	38	-	-	HYPH
cord-001824-7c37elh6	38	39	site	site	NN
cord-001824-7c37elh6	38	40	to	to	IN
cord-001824-7c37elh6	38	41	frameshift	frameshift	VB
cord-001824-7c37elh6	38	42	.	.	.
cord-001824-7c37elh6	39	1	(	(	-LRB-
cord-001824-7c37elh6	39	2	C	C	NNP
cord-001824-7c37elh6	39	3	)	)	-RRB-
cord-001824-7c37elh6	40	1	The	the	DT
cord-001824-7c37elh6	40	2	hypomodified	hypomodifie	VBN
cord-001824-7c37elh6	40	3	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	40	4	-	-	HYPH
cord-001824-7c37elh6	40	5	tRNA	tRNA	NNP
cord-001824-7c37elh6	40	6	is	be	VBZ
cord-001824-7c37elh6	40	7	able	able	JJ
cord-001824-7c37elh6	40	8	to	to	TO
cord-001824-7c37elh6	40	9	enter	enter	VB
cord-001824-7c37elh6	40	10	the	the	DT
cord-001824-7c37elh6	40	11	A	A	NNP
cord-001824-7c37elh6	40	12	-	-	HYPH
cord-001824-7c37elh6	40	13	site	site	NN
cord-001824-7c37elh6	40	14	and	and	CC
cord-001824-7c37elh6	40	15	translocate	translocate	VB
cord-001824-7c37elh6	40	16	to	to	IN
cord-001824-7c37elh6	40	17	the	the	DT
cord-001824-7c37elh6	40	18	P	p	NN
cord-001824-7c37elh6	40	19	-	-	HYPH
cord-001824-7c37elh6	40	20	site	site	NN
cord-001824-7c37elh6	40	21	where	where	WRB
cord-001824-7c37elh6	40	22	it	-PRON-	PRP
cord-001824-7c37elh6	40	23	then	then	RB
cord-001824-7c37elh6	40	24	slips	slip	VBZ
cord-001824-7c37elh6	40	25	into	into	IN
cord-001824-7c37elh6	40	26	an	an	DT
cord-001824-7c37elh6	40	27	alternative	alternative	JJ
cord-001824-7c37elh6	40	28	reading	reading	NN
cord-001824-7c37elh6	40	29	frame	frame	NN
cord-001824-7c37elh6	40	30	due	due	IN
cord-001824-7c37elh6	40	31	to	to	IN
cord-001824-7c37elh6	40	32	a	a	DT
cord-001824-7c37elh6	40	33	reduced	reduce	VBN
cord-001824-7c37elh6	40	34	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	40	35	grip	grip	NN
cord-001824-7c37elh6	40	36	.	.	.
cord-001824-7c37elh6	41	1	in	in	IN
cord-001824-7c37elh6	41	2	a	a	DT
cord-001824-7c37elh6	41	3	ternary	ternary	JJ
cord-001824-7c37elh6	41	4	complex	complex	NN
cord-001824-7c37elh6	41	5	,	,	,
cord-001824-7c37elh6	41	6	i.e.	i.e.	FW
cord-001824-7c37elh6	41	7	aminoacyl	aminoacyl	VBN
cord-001824-7c37elh6	41	8	-	-	HYPH
cord-001824-7c37elh6	41	9	tRNA*eEF1A*GTP	tRNA*eEF1A*GTP	NNP
cord-001824-7c37elh6	41	10	(	(	-LRB-
cord-001824-7c37elh6	41	11	here	here	RB
cord-001824-7c37elh6	41	12	shorten	shorten	VBN
cord-001824-7c37elh6	41	13	as	as	IN
cord-001824-7c37elh6	41	14	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	41	15	-	-	HYPH
cord-001824-7c37elh6	41	16	tRNA	tRNA	NNP
cord-001824-7c37elh6	41	17	)	)	-RRB-
cord-001824-7c37elh6	41	18	induces	induce	VBZ
cord-001824-7c37elh6	41	19	frameshifts	frameshifts	NNP
cord-001824-7c37elh6	41	20	either	either	CC
cord-001824-7c37elh6	41	21	by	by	IN
cord-001824-7c37elh6	41	22	causing	cause	VBG
cord-001824-7c37elh6	41	23	an	an	DT
cord-001824-7c37elh6	41	24	A	A	NNP
cord-001824-7c37elh6	41	25	-	-	:
cord-001824-7c37elh6	41	26	or	or	CC
cord-001824-7c37elh6	41	27	a	a	DT
cord-001824-7c37elh6	41	28	P	p	NN
cord-001824-7c37elh6	41	29	-	-	HYPH
cord-001824-7c37elh6	41	30	site	site	NN
cord-001824-7c37elh6	41	31	effect	effect	NN
cord-001824-7c37elh6	41	32	,	,	,
cord-001824-7c37elh6	41	33	or	or	CC
cord-001824-7c37elh6	41	34	a	a	DT
cord-001824-7c37elh6	41	35	combination	combination	NN
cord-001824-7c37elh6	41	36	thereof	thereof	RB
cord-001824-7c37elh6	41	37	.	.	.
cord-001824-7c37elh6	42	1	Lack	lack	NN
cord-001824-7c37elh6	42	2	of	of	IN
cord-001824-7c37elh6	42	3	modification	modification	NN
cord-001824-7c37elh6	42	4	causes	cause	VBZ
cord-001824-7c37elh6	42	5	a	a	DT
cord-001824-7c37elh6	42	6	defect	defect	NN
cord-001824-7c37elh6	42	7	in	in	IN
cord-001824-7c37elh6	42	8	the	the	DT
cord-001824-7c37elh6	42	9	cognate	cognate	JJ
cord-001824-7c37elh6	42	10	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	42	11	-	-	HYPH
cord-001824-7c37elh6	42	12	tRNA	trna	NN
cord-001824-7c37elh6	42	13	selection	selection	NN
cord-001824-7c37elh6	42	14	step	step	NN
cord-001824-7c37elh6	42	15	(	(	-LRB-
cord-001824-7c37elh6	42	16	we	-PRON-	PRP
cord-001824-7c37elh6	42	17	denote	denote	VBP
cord-001824-7c37elh6	42	18	such	such	PDT
cord-001824-7c37elh6	42	19	an	an	DT
cord-001824-7c37elh6	42	20	error	error	NN
cord-001824-7c37elh6	42	21	as	as	IN
cord-001824-7c37elh6	42	22	an	an	DT
cord-001824-7c37elh6	42	23	A	a	CD
cord-001824-7c37elh6	42	24	-	-	HYPH
cord-001824-7c37elh6	42	25	site	site	NN
cord-001824-7c37elh6	42	26	effect	effect	NN
cord-001824-7c37elh6	42	27	by	by	IN
cord-001824-7c37elh6	42	28	modification	modification	NN
cord-001824-7c37elh6	42	29	deficiency	deficiency	NN
cord-001824-7c37elh6	42	30	)	)	-RRB-
cord-001824-7c37elh6	42	31	,	,	,
cord-001824-7c37elh6	42	32	allowing	allow	VBG
cord-001824-7c37elh6	42	33	a	a	DT
cord-001824-7c37elh6	42	34	ternary	ternary	JJ
cord-001824-7c37elh6	42	35	complex	complex	NN
cord-001824-7c37elh6	42	36	with	with	IN
cord-001824-7c37elh6	42	37	a	a	DT
cord-001824-7c37elh6	42	38	near	near	JJ
cord-001824-7c37elh6	42	39	cognate	cognate	JJ
cord-001824-7c37elh6	42	40	wild	wild	JJ
cord-001824-7c37elh6	42	41	type	type	NN
cord-001824-7c37elh6	42	42	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	42	43	-	-	:
cord-001824-7c37elh6	42	44	tRNA	tRNA	NNP
cord-001824-7c37elh6	42	45	instead	instead	RB
cord-001824-7c37elh6	42	46	of	of	IN
cord-001824-7c37elh6	42	47	a	a	DT
cord-001824-7c37elh6	42	48	cognate	cognate	JJ
cord-001824-7c37elh6	42	49	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	42	50	-	-	HYPH
cord-001824-7c37elh6	42	51	tRNA	trna	NN
cord-001824-7c37elh6	42	52	to	to	TO
cord-001824-7c37elh6	42	53	be	be	VB
cord-001824-7c37elh6	42	54	accepted	accept	VBN
cord-001824-7c37elh6	42	55	in	in	IN
cord-001824-7c37elh6	42	56	the	the	DT
cord-001824-7c37elh6	42	57	A	A	NNP
cord-001824-7c37elh6	42	58	-	-	HYPH
cord-001824-7c37elh6	42	59	site	site	NN
cord-001824-7c37elh6	42	60	.	.	.
cord-001824-7c37elh6	43	1	After	after	IN
cord-001824-7c37elh6	43	2	translocation	translocation	NN
cord-001824-7c37elh6	43	3	to	to	IN
cord-001824-7c37elh6	43	4	the	the	DT
cord-001824-7c37elh6	43	5	P	p	NN
cord-001824-7c37elh6	43	6	-	-	HYPH
cord-001824-7c37elh6	43	7	site	site	NN
cord-001824-7c37elh6	43	8	,	,	,
cord-001824-7c37elh6	43	9	the	the	DT
cord-001824-7c37elh6	43	10	fit	fit	NN
cord-001824-7c37elh6	43	11	of	of	IN
cord-001824-7c37elh6	43	12	the	the	DT
cord-001824-7c37elh6	43	13	near	near	JJ
cord-001824-7c37elh6	43	14	cognate	cognate	JJ
cord-001824-7c37elh6	43	15	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	43	16	-	-	HYPH
cord-001824-7c37elh6	43	17	tRNA	tRNA	NNP
cord-001824-7c37elh6	43	18	is	be	VBZ
cord-001824-7c37elh6	43	19	not	not	RB
cord-001824-7c37elh6	43	20	optimal	optimal	JJ
cord-001824-7c37elh6	43	21	why	why	WRB
cord-001824-7c37elh6	43	22	it	-PRON-	PRP
cord-001824-7c37elh6	43	23	slips	slip	VBZ
cord-001824-7c37elh6	43	24	one	one	CD
cord-001824-7c37elh6	43	25	nucleotide	nucleotide	NN
cord-001824-7c37elh6	43	26	forward	forward	RB
cord-001824-7c37elh6	44	1	(	(	-LRB-
cord-001824-7c37elh6	44	2	+1	+1	XX
cord-001824-7c37elh6	44	3	frameshift	frameshift	NN
cord-001824-7c37elh6	44	4	)	)	-RRB-
cord-001824-7c37elh6	44	5	(	(	-LRB-
cord-001824-7c37elh6	44	6	Figure	figure	NN
cord-001824-7c37elh6	44	7	1A	1a	NN
cord-001824-7c37elh6	44	8	)	)	-RRB-
cord-001824-7c37elh6	44	9	.	.	.
cord-001824-7c37elh6	45	1	Alternatively	alternatively	RB
cord-001824-7c37elh6	45	2	,	,	,
cord-001824-7c37elh6	45	3	lack	lack	NN
cord-001824-7c37elh6	45	4	of	of	IN
cord-001824-7c37elh6	45	5	a	a	DT
cord-001824-7c37elh6	45	6	modified	modified	JJ
cord-001824-7c37elh6	45	7	nucleoside	nucleoside	NN
cord-001824-7c37elh6	45	8	reduces	reduce	VBZ
cord-001824-7c37elh6	45	9	the	the	DT
cord-001824-7c37elh6	45	10	efficiency	efficiency	NN
cord-001824-7c37elh6	45	11	by	by	IN
cord-001824-7c37elh6	45	12	which	which	WDT
cord-001824-7c37elh6	45	13	a	a	DT
cord-001824-7c37elh6	45	14	cognate	cognate	JJ
cord-001824-7c37elh6	45	15	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	45	16	-	-	HYPH
cord-001824-7c37elh6	45	17	tRNA	tRNA	NNP
cord-001824-7c37elh6	45	18	is	be	VBZ
cord-001824-7c37elh6	45	19	accepted	accept	VBN
cord-001824-7c37elh6	45	20	to	to	IN
cord-001824-7c37elh6	45	21	the	the	DT
cord-001824-7c37elh6	45	22	Asite	Asite	NNP
cord-001824-7c37elh6	45	23	,	,	,
cord-001824-7c37elh6	45	24	which	which	WDT
cord-001824-7c37elh6	45	25	induces	induce	VBZ
cord-001824-7c37elh6	45	26	a	a	DT
cord-001824-7c37elh6	45	27	ribosomal	ribosomal	NN
cord-001824-7c37elh6	45	28	pause	pause	NN
cord-001824-7c37elh6	45	29	allowing	allow	VBG
cord-001824-7c37elh6	45	30	the	the	DT
cord-001824-7c37elh6	45	31	wild	wild	JJ
cord-001824-7c37elh6	45	32	type	type	NN
cord-001824-7c37elh6	45	33	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	45	34	-	-	HYPH
cord-001824-7c37elh6	45	35	tRNA	tRNA	NNP
cord-001824-7c37elh6	45	36	to	to	TO
cord-001824-7c37elh6	45	37	slip	slip	VB
cord-001824-7c37elh6	45	38	forward	forward	RB
cord-001824-7c37elh6	45	39	one	one	CD
cord-001824-7c37elh6	45	40	nucleotide	nucleotide	NN
cord-001824-7c37elh6	45	41	(	(	-LRB-
cord-001824-7c37elh6	45	42	denoted	denote	VBD
cord-001824-7c37elh6	45	43	an	an	DT
cord-001824-7c37elh6	45	44	A	A	NNP
cord-001824-7c37elh6	45	45	-	-	HYPH
cord-001824-7c37elh6	45	46	site	site	NN
cord-001824-7c37elh6	45	47	effect	effect	NN
cord-001824-7c37elh6	45	48	by	by	IN
cord-001824-7c37elh6	45	49	modification	modification	NN
cord-001824-7c37elh6	45	50	deficiency	deficiency	NN
cord-001824-7c37elh6	45	51	,	,	,
cord-001824-7c37elh6	45	52	Figure	figure	NN
cord-001824-7c37elh6	45	53	1B	1b	CD
cord-001824-7c37elh6	45	54	)	)	-RRB-
cord-001824-7c37elh6	45	55	.	.	.
cord-001824-7c37elh6	46	1	When	when	WRB
cord-001824-7c37elh6	46	2	frameshifting	frameshifting	NN
cord-001824-7c37elh6	46	3	is	be	VBZ
cord-001824-7c37elh6	46	4	caused	cause	VBN
cord-001824-7c37elh6	46	5	by	by	IN
cord-001824-7c37elh6	46	6	a	a	DT
cord-001824-7c37elh6	46	7	P	p	NN
cord-001824-7c37elh6	46	8	-	-	HYPH
cord-001824-7c37elh6	46	9	site	site	NN
cord-001824-7c37elh6	46	10	effect	effect	NN
cord-001824-7c37elh6	46	11	,	,	,
cord-001824-7c37elh6	46	12	the	the	DT
cord-001824-7c37elh6	46	13	hypomodified	hypomodifie	VBN
cord-001824-7c37elh6	46	14	tRNA	tRNA	NNP
cord-001824-7c37elh6	46	15	is	be	VBZ
cord-001824-7c37elh6	46	16	efficiently	efficiently	RB
cord-001824-7c37elh6	46	17	accepted	accept	VBN
cord-001824-7c37elh6	46	18	to	to	IN
cord-001824-7c37elh6	46	19	the	the	DT
cord-001824-7c37elh6	46	20	A	A	NNP
cord-001824-7c37elh6	46	21	-	-	HYPH
cord-001824-7c37elh6	46	22	site	site	NN
cord-001824-7c37elh6	46	23	,	,	,
cord-001824-7c37elh6	46	24	translocates	translocate	VBZ
cord-001824-7c37elh6	46	25	to	to	IN
cord-001824-7c37elh6	46	26	the	the	DT
cord-001824-7c37elh6	46	27	P	p	NN
cord-001824-7c37elh6	46	28	-	-	HYPH
cord-001824-7c37elh6	46	29	site	site	NN
cord-001824-7c37elh6	46	30	where	where	WRB
cord-001824-7c37elh6	46	31	its	-PRON-	PRP$
cord-001824-7c37elh6	46	32	fit	fit	NN
cord-001824-7c37elh6	46	33	is	be	VBZ
cord-001824-7c37elh6	46	34	not	not	RB
cord-001824-7c37elh6	46	35	optimal	optimal	JJ
cord-001824-7c37elh6	46	36	why	why	WRB
cord-001824-7c37elh6	46	37	it	-PRON-	PRP
cord-001824-7c37elh6	46	38	slips	slip	VBZ
cord-001824-7c37elh6	46	39	into	into	IN
cord-001824-7c37elh6	46	40	an	an	DT
cord-001824-7c37elh6	46	41	alternative	alternative	JJ
cord-001824-7c37elh6	46	42	reading	reading	NN
cord-001824-7c37elh6	46	43	frame	frame	NN
cord-001824-7c37elh6	46	44	due	due	IN
cord-001824-7c37elh6	46	45	to	to	IN
cord-001824-7c37elh6	46	46	a	a	DT
cord-001824-7c37elh6	46	47	reduced	reduce	VBN
cord-001824-7c37elh6	46	48	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	46	49	grip	grip	NN
cord-001824-7c37elh6	46	50	(	(	-LRB-
cord-001824-7c37elh6	46	51	P	p	NN
cord-001824-7c37elh6	46	52	-	-	HYPH
cord-001824-7c37elh6	46	53	site	site	NN
cord-001824-7c37elh6	46	54	effect	effect	NN
cord-001824-7c37elh6	46	55	by	by	IN
cord-001824-7c37elh6	46	56	modification	modification	NN
cord-001824-7c37elh6	46	57	deficiency	deficiency	NN
cord-001824-7c37elh6	46	58	,	,	,
cord-001824-7c37elh6	46	59	Figure	figure	NN
cord-001824-7c37elh6	46	60	1C	1c	NN
cord-001824-7c37elh6	46	61	)	)	-RRB-
cord-001824-7c37elh6	47	1	(	(	-LRB-
cord-001824-7c37elh6	47	2	3,6,20,21,23	3,6,20,21,23	RB
cord-001824-7c37elh6	47	3	)	)	-RRB-
cord-001824-7c37elh6	47	4	.	.	.
cord-001824-7c37elh6	48	1	Thus	thus	RB
cord-001824-7c37elh6	48	2	,	,	,
cord-001824-7c37elh6	48	3	in	in	IN
cord-001824-7c37elh6	48	4	some	some	DT
cord-001824-7c37elh6	48	5	cases	case	NNS
cord-001824-7c37elh6	48	6	,	,	,
cord-001824-7c37elh6	48	7	the	the	DT
cord-001824-7c37elh6	48	8	modification	modification	NN
cord-001824-7c37elh6	48	9	deficiency	deficiency	NN
cord-001824-7c37elh6	48	10	reduces	reduce	VBZ
cord-001824-7c37elh6	48	11	the	the	DT
cord-001824-7c37elh6	48	12	rate	rate	NN
cord-001824-7c37elh6	48	13	of	of	IN
cord-001824-7c37elh6	48	14	selection	selection	NN
cord-001824-7c37elh6	48	15	of	of	IN
cord-001824-7c37elh6	48	16	the	the	DT
cord-001824-7c37elh6	48	17	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	48	18	-	-	HYPH
cord-001824-7c37elh6	48	19	tRNA	trna	NN
cord-001824-7c37elh6	48	20	(	(	-LRB-
cord-001824-7c37elh6	48	21	A	a	DT
cord-001824-7c37elh6	48	22	-	-	HYPH
cord-001824-7c37elh6	48	23	site	site	NN
cord-001824-7c37elh6	48	24	effect	effect	NN
cord-001824-7c37elh6	48	25	)	)	-RRB-
cord-001824-7c37elh6	48	26	but	but	CC
cord-001824-7c37elh6	48	27	also	also	RB
cord-001824-7c37elh6	48	28	lack	lack	NN
cord-001824-7c37elh6	48	29	of	of	IN
cord-001824-7c37elh6	48	30	the	the	DT
cord-001824-7c37elh6	48	31	modification	modification	NN
cord-001824-7c37elh6	48	32	reduces	reduce	VBZ
cord-001824-7c37elh6	48	33	the	the	DT
cord-001824-7c37elh6	48	34	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	48	35	grip	grip	NN
cord-001824-7c37elh6	48	36	in	in	IN
cord-001824-7c37elh6	48	37	the	the	DT
cord-001824-7c37elh6	48	38	P	p	NN
cord-001824-7c37elh6	48	39	-	-	HYPH
cord-001824-7c37elh6	48	40	site	site	NN
cord-001824-7c37elh6	48	41	(	(	-LRB-
cord-001824-7c37elh6	48	42	P	p	NN
cord-001824-7c37elh6	48	43	-	-	HYPH
cord-001824-7c37elh6	48	44	site	site	NN
cord-001824-7c37elh6	48	45	effect	effect	NN
cord-001824-7c37elh6	48	46	)	)	-RRB-
cord-001824-7c37elh6	48	47	.	.	.
cord-001824-7c37elh6	49	1	Note	note	VB
cord-001824-7c37elh6	49	2	,	,	,
cord-001824-7c37elh6	49	3	in	in	IN
cord-001824-7c37elh6	49	4	all	all	DT
cord-001824-7c37elh6	49	5	cases	case	NNS
cord-001824-7c37elh6	49	6	explained	explain	VBN
cord-001824-7c37elh6	49	7	above	above	RB
cord-001824-7c37elh6	49	8	,	,	,
cord-001824-7c37elh6	49	9	the	the	DT
cord-001824-7c37elh6	49	10	error	error	NN
cord-001824-7c37elh6	49	11	in	in	IN
cord-001824-7c37elh6	49	12	reading	read	VBG
cord-001824-7c37elh6	49	13	frame	frame	NN
cord-001824-7c37elh6	49	14	maintenance	maintenance	NN
cord-001824-7c37elh6	49	15	is	be	VBZ
cord-001824-7c37elh6	49	16	due	due	JJ
cord-001824-7c37elh6	49	17	to	to	IN
cord-001824-7c37elh6	49	18	a	a	DT
cord-001824-7c37elh6	49	19	peptidyl	peptidyl	NN
cord-001824-7c37elh6	49	20	-	-	HYPH
cord-001824-7c37elh6	49	21	tRNA	trna	NN
cord-001824-7c37elh6	49	22	slippage	slippage	NN
cord-001824-7c37elh6	49	23	.	.	.
cord-001824-7c37elh6	50	1	Modifications	modification	NNS
cord-001824-7c37elh6	50	2	of	of	IN
cord-001824-7c37elh6	50	3	uridines	uridine	NNS
cord-001824-7c37elh6	50	4	in	in	IN
cord-001824-7c37elh6	50	5	the	the	DT
cord-001824-7c37elh6	50	6	wobble	wobble	NN
cord-001824-7c37elh6	50	7	position	position	NN
cord-001824-7c37elh6	50	8	of	of	IN
cord-001824-7c37elh6	50	9	tRNAs	trna	NNS
cord-001824-7c37elh6	50	10	are	be	VBP
cord-001824-7c37elh6	50	11	frequent	frequent	JJ
cord-001824-7c37elh6	50	12	in	in	IN
cord-001824-7c37elh6	50	13	all	all	DT
cord-001824-7c37elh6	50	14	three	three	CD
cord-001824-7c37elh6	50	15	domains	domain	NNS
cord-001824-7c37elh6	50	16	of	of	IN
cord-001824-7c37elh6	50	17	life	life	NN
cord-001824-7c37elh6	50	18	.	.	.
cord-001824-7c37elh6	51	1	In	in	IN
cord-001824-7c37elh6	51	2	Saccharomyces	saccharomyce	NNS
cord-001824-7c37elh6	51	3	cerevisiae	cerevisiae	NNS
cord-001824-7c37elh6	51	4	,	,	,
cord-001824-7c37elh6	51	5	there	there	EX
cord-001824-7c37elh6	51	6	are	be	VBP
cord-001824-7c37elh6	51	7	11	11	CD
cord-001824-7c37elh6	51	8	tRNA	tRNA	NNP
cord-001824-7c37elh6	51	9	species	specie	NNS
cord-001824-7c37elh6	51	10	having	have	VBG
cord-001824-7c37elh6	51	11	four	four	CD
cord-001824-7c37elh6	51	12	related	relate	VBN
cord-001824-7c37elh6	51	13	modified	modify	VBN
cord-001824-7c37elh6	51	14	uridine	uridine	NN
cord-001824-7c37elh6	51	15	nucleotides	nucleotide	NNS
cord-001824-7c37elh6	51	16	at	at	IN
cord-001824-7c37elh6	51	17	wobble	wobble	NN
cord-001824-7c37elh6	51	18	position	position	NN
cord-001824-7c37elh6	51	19	(	(	-LRB-
cord-001824-7c37elh6	51	20	25	25	CD
cord-001824-7c37elh6	51	21	)	)	-RRB-
cord-001824-7c37elh6	51	22	(	(	-LRB-
cord-001824-7c37elh6	51	23	26	26	CD
cord-001824-7c37elh6	51	24	)	)	-RRB-
cord-001824-7c37elh6	51	25	(	(	-LRB-
cord-001824-7c37elh6	51	26	27	27	CD
cord-001824-7c37elh6	51	27	)	)	-RRB-
cord-001824-7c37elh6	51	28	(	(	-LRB-
cord-001824-7c37elh6	51	29	28	28	CD
cord-001824-7c37elh6	51	30	)	)	-RRB-
cord-001824-7c37elh6	51	31	(	(	-LRB-
cord-001824-7c37elh6	51	32	29	29	CD
cord-001824-7c37elh6	51	33	)	)	-RRB-
cord-001824-7c37elh6	51	34	(	(	-LRB-
cord-001824-7c37elh6	51	35	30	30	CD
cord-001824-7c37elh6	51	36	)	)	-RRB-
cord-001824-7c37elh6	51	37	(	(	-LRB-
cord-001824-7c37elh6	51	38	31	31	CD
cord-001824-7c37elh6	51	39	)	)	-RRB-
cord-001824-7c37elh6	51	40	(	(	-LRB-
cord-001824-7c37elh6	51	41	32	32	CD
cord-001824-7c37elh6	51	42	)	)	-RRB-
cord-001824-7c37elh6	51	43	.	.	.
cord-001824-7c37elh6	52	1	These	these	DT
cord-001824-7c37elh6	52	2	modified	modify	VBN
cord-001824-7c37elh6	52	3	nucleosides	nucleoside	NNS
cord-001824-7c37elh6	52	4	are	be	VBP
cord-001824-7c37elh6	53	1	5-carbamoylmethyluridine	5-carbamoylmethyluridine	CD
cord-001824-7c37elh6	53	2	(	(	-LRB-
cord-001824-7c37elh6	53	3	ncm	ncm	NNP
cord-001824-7c37elh6	53	4	5	5	CD
cord-001824-7c37elh6	53	5	U	U	NNP
cord-001824-7c37elh6	53	6	34	34	CD
cord-001824-7c37elh6	53	7	)	)	-RRB-
cord-001824-7c37elh6	53	8	present	present	JJ
cord-001824-7c37elh6	53	9	in	in	IN
cord-001824-7c37elh6	53	10	five	five	CD
cord-001824-7c37elh6	53	11	(	(	-LRB-
cord-001824-7c37elh6	53	12	26	26	CD
cord-001824-7c37elh6	53	13	,	,	,
cord-001824-7c37elh6	53	14	27	27	CD
cord-001824-7c37elh6	53	15	,	,	,
cord-001824-7c37elh6	53	16	32	32	CD
cord-001824-7c37elh6	53	17	)	)	-RRB-
cord-001824-7c37elh6	53	18	,	,	.
cord-001824-7c37elh6	54	1	5-carbamoylmethyl-2	5-carbamoylmethyl-2	CD
cord-001824-7c37elh6	54	2	-Omethyluridine	-Omethyluridine	.
cord-001824-7c37elh6	55	1	(	(	-LRB-
cord-001824-7c37elh6	55	2	ncm	ncm	NNP
cord-001824-7c37elh6	55	3	5	5	CD
cord-001824-7c37elh6	55	4	U	U	NNP
cord-001824-7c37elh6	55	5	34	34	CD
cord-001824-7c37elh6	55	6	m	m	NN
cord-001824-7c37elh6	55	7	)	)	-RRB-
cord-001824-7c37elh6	55	8	present	present	NN
cord-001824-7c37elh6	55	9	in	in	IN
cord-001824-7c37elh6	55	10	one	one	CD
cord-001824-7c37elh6	55	11	(	(	-LRB-
cord-001824-7c37elh6	55	12	25	25	CD
cord-001824-7c37elh6	55	13	)	)	-RRB-
cord-001824-7c37elh6	55	14	,	,	.
cord-001824-7c37elh6	56	1	5methoxycarbonylmethyluridine	5methoxycarbonylmethyluridine	LS
cord-001824-7c37elh6	56	2	(	(	-LRB-
cord-001824-7c37elh6	56	3	mcm	mcm	NNP
cord-001824-7c37elh6	56	4	5	5	CD
cord-001824-7c37elh6	56	5	U	U	NNP
cord-001824-7c37elh6	56	6	34	34	CD
cord-001824-7c37elh6	56	7	)	)	-RRB-
cord-001824-7c37elh6	56	8	present	present	JJ
cord-001824-7c37elh6	56	9	in	in	IN
cord-001824-7c37elh6	56	10	two	two	CD
cord-001824-7c37elh6	56	11	(	(	-LRB-
cord-001824-7c37elh6	56	12	29	29	CD
cord-001824-7c37elh6	56	13	,	,	,
cord-001824-7c37elh6	56	14	30	30	CD
cord-001824-7c37elh6	56	15	)	)	-RRB-
cord-001824-7c37elh6	56	16	and	and	CC
cord-001824-7c37elh6	56	17	5-methoxycarbonylmethyl-2-thiouridine	5-methoxycarbonylmethyl-2-thiouridine	CD
cord-001824-7c37elh6	56	18	(	(	-LRB-
cord-001824-7c37elh6	56	19	mcm	mcm	NNP
cord-001824-7c37elh6	56	20	5	5	CD
cord-001824-7c37elh6	56	21	s	s	NN
cord-001824-7c37elh6	56	22	2	2	CD
cord-001824-7c37elh6	56	23	U	U	NNP
cord-001824-7c37elh6	56	24	34	34	CD
cord-001824-7c37elh6	56	25	)	)	-RRB-
cord-001824-7c37elh6	56	26	present	present	JJ
cord-001824-7c37elh6	56	27	in	in	IN
cord-001824-7c37elh6	56	28	three	three	CD
cord-001824-7c37elh6	56	29	tRNA	tRNA	NNP
cord-001824-7c37elh6	56	30	species	specie	NNS
cord-001824-7c37elh6	56	31	(	(	-LRB-
cord-001824-7c37elh6	56	32	Figures	figure	NNS
cord-001824-7c37elh6	56	33	2	2	CD
cord-001824-7c37elh6	56	34	and	and	CC
cord-001824-7c37elh6	56	35	3	3	LS
cord-001824-7c37elh6	56	36	)	)	-RRB-
cord-001824-7c37elh6	56	37	(	(	-LRB-
cord-001824-7c37elh6	56	38	28	28	CD
cord-001824-7c37elh6	56	39	,	,	,
cord-001824-7c37elh6	56	40	30	30	CD
cord-001824-7c37elh6	56	41	,	,	,
cord-001824-7c37elh6	56	42	31	31	CD
cord-001824-7c37elh6	56	43	)	)	-RRB-
cord-001824-7c37elh6	56	44	.	.	.
cord-001824-7c37elh6	57	1	The	the	DT
cord-001824-7c37elh6	57	2	first	first	JJ
cord-001824-7c37elh6	57	3	step	step	NN
cord-001824-7c37elh6	57	4	in	in	IN
cord-001824-7c37elh6	57	5	the	the	DT
cord-001824-7c37elh6	57	6	synthesis	synthesis	NN
cord-001824-7c37elh6	57	7	of	of	IN
cord-001824-7c37elh6	57	8	the	the	DT
cord-001824-7c37elh6	57	9	mcm	mcm	NNP
cord-001824-7c37elh6	57	10	5	5	CD
cord-001824-7c37elh6	57	11	and	and	CC
cord-001824-7c37elh6	57	12	ncm	ncm	NNP
cord-001824-7c37elh6	57	13	5	5	CD
cord-001824-7c37elh6	57	14	groups	group	NNS
cord-001824-7c37elh6	57	15	of	of	IN
cord-001824-7c37elh6	57	16	the	the	DT
cord-001824-7c37elh6	57	17	uridine	uridine	JJ
cord-001824-7c37elh6	57	18	modifications	modification	NNS
cord-001824-7c37elh6	57	19	mentioned	mention	VBN
cord-001824-7c37elh6	57	20	above	above	RB
cord-001824-7c37elh6	57	21	requires	require	VBZ
cord-001824-7c37elh6	57	22	the	the	DT
cord-001824-7c37elh6	57	23	six	six	CD
cord-001824-7c37elh6	57	24	-	-	HYPH
cord-001824-7c37elh6	57	25	subunit	subunit	NN
cord-001824-7c37elh6	57	26	Elongator	Elongator	NNP
cord-001824-7c37elh6	57	27	complex	complex	NN
cord-001824-7c37elh6	57	28	and	and	CC
cord-001824-7c37elh6	57	29	its	-PRON-	PRP$
cord-001824-7c37elh6	57	30	seven	seven	CD
cord-001824-7c37elh6	57	31	as-	as-	DT
cord-001824-7c37elh6	57	32	sociated	sociate	VBN
cord-001824-7c37elh6	57	33	proteins	protein	NNS
cord-001824-7c37elh6	57	34	(	(	-LRB-
cord-001824-7c37elh6	57	35	Reviewed	review	VBN
cord-001824-7c37elh6	57	36	in	in	IN
cord-001824-7c37elh6	57	37	Karlsborn	Karlsborn	NNP
cord-001824-7c37elh6	57	38	et	et	NNP
cord-001824-7c37elh6	57	39	al	al	NNP
cord-001824-7c37elh6	57	40	.	.	.
cord-001824-7c37elh6	58	1	(	(	-LRB-
cord-001824-7c37elh6	58	2	33	33	CD
cord-001824-7c37elh6	58	3	)	)	-RRB-
cord-001824-7c37elh6	58	4	)	)	-RRB-
cord-001824-7c37elh6	58	5	.	.	.
cord-001824-7c37elh6	59	1	Mutations	mutation	NNS
cord-001824-7c37elh6	59	2	in	in	IN
cord-001824-7c37elh6	59	3	any	any	DT
cord-001824-7c37elh6	59	4	of	of	IN
cord-001824-7c37elh6	59	5	the	the	DT
cord-001824-7c37elh6	59	6	corresponding	corresponding	JJ
cord-001824-7c37elh6	59	7	genes	gene	NNS
cord-001824-7c37elh6	59	8	result	result	VBP
cord-001824-7c37elh6	59	9	in	in	IN
cord-001824-7c37elh6	59	10	deficiency	deficiency	NN
cord-001824-7c37elh6	59	11	of	of	IN
cord-001824-7c37elh6	59	12	these	these	DT
cord-001824-7c37elh6	59	13	xm	xm	NNP
cord-001824-7c37elh6	59	14	5	5	CD
cord-001824-7c37elh6	59	15	-uridine	-uridine	SYM
cord-001824-7c37elh6	59	16	modifications	modification	NNS
cord-001824-7c37elh6	59	17	without	without	IN
cord-001824-7c37elh6	59	18	affecting	affect	VBG
cord-001824-7c37elh6	59	19	stability	stability	NN
cord-001824-7c37elh6	59	20	or	or	CC
cord-001824-7c37elh6	59	21	aminoacylation	aminoacylation	NN
cord-001824-7c37elh6	59	22	of	of	IN
cord-001824-7c37elh6	59	23	tRNA	tRNA	NNP
cord-001824-7c37elh6	59	24	(	(	-LRB-
cord-001824-7c37elh6	59	25	26	26	CD
cord-001824-7c37elh6	59	26	)	)	-RRB-
cord-001824-7c37elh6	59	27	.	.	.
cord-001824-7c37elh6	60	1	These	these	DT
cord-001824-7c37elh6	60	2	mutants	mutant	NNS
cord-001824-7c37elh6	60	3	also	also	RB
cord-001824-7c37elh6	60	4	show	show	VBP
cord-001824-7c37elh6	60	5	strong	strong	JJ
cord-001824-7c37elh6	60	6	pleiotropic	pleiotropic	JJ
cord-001824-7c37elh6	60	7	phenotypes	phenotype	NNS
cord-001824-7c37elh6	60	8	,	,	,
cord-001824-7c37elh6	60	9	such	such	JJ
cord-001824-7c37elh6	60	10	as	as	IN
cord-001824-7c37elh6	60	11	defects	defect	NNS
cord-001824-7c37elh6	60	12	in	in	IN
cord-001824-7c37elh6	60	13	growth	growth	NN
cord-001824-7c37elh6	60	14	,	,	,
cord-001824-7c37elh6	60	15	transcription	transcription	NN
cord-001824-7c37elh6	60	16	,	,	,
cord-001824-7c37elh6	60	17	chromatin	chromatin	NN
cord-001824-7c37elh6	60	18	remodelling	remodelling	NN
cord-001824-7c37elh6	60	19	,	,	,
cord-001824-7c37elh6	60	20	DNA	dna	NN
cord-001824-7c37elh6	60	21	repair	repair	NN
cord-001824-7c37elh6	60	22	and	and	CC
cord-001824-7c37elh6	60	23	secretion	secretion	NN
cord-001824-7c37elh6	60	24	(	(	-LRB-
cord-001824-7c37elh6	60	25	Reviewed	review	VBN
cord-001824-7c37elh6	60	26	in	in	IN
cord-001824-7c37elh6	60	27	Karlsborn	Karlsborn	NNP
cord-001824-7c37elh6	60	28	et	et	NNP
cord-001824-7c37elh6	60	29	al	al	NNP
cord-001824-7c37elh6	60	30	.	.	.
cord-001824-7c37elh6	61	1	(	(	-LRB-
cord-001824-7c37elh6	61	2	33	33	CD
cord-001824-7c37elh6	61	3	)	)	-RRB-
cord-001824-7c37elh6	61	4	)	)	-RRB-
cord-001824-7c37elh6	61	5	.	.	.
cord-001824-7c37elh6	62	1	All	all	PDT
cord-001824-7c37elh6	62	2	these	these	DT
cord-001824-7c37elh6	62	3	phenotypes	phenotype	NNS
cord-001824-7c37elh6	62	4	,	,	,
cord-001824-7c37elh6	62	5	except	except	IN
cord-001824-7c37elh6	62	6	lack	lack	NN
cord-001824-7c37elh6	62	7	of	of	IN
cord-001824-7c37elh6	62	8	xm	xm	NNP
cord-001824-7c37elh6	62	9	5	5	CD
cord-001824-7c37elh6	62	10	side	side	NN
cord-001824-7c37elh6	62	11	chains	chain	NNS
cord-001824-7c37elh6	62	12	,	,	,
cord-001824-7c37elh6	62	13	are	be	VBP
cord-001824-7c37elh6	62	14	suppressed	suppress	VBN
cord-001824-7c37elh6	62	15	by	by	IN
cord-001824-7c37elh6	62	16	overexpression	overexpression	NN
cord-001824-7c37elh6	62	17	of	of	IN
cord-001824-7c37elh6	62	18	hypomodified	hypomodified	JJ
cord-001824-7c37elh6	62	19	tRNAs	trna	NNS
cord-001824-7c37elh6	62	20	specific	specific	JJ
cord-001824-7c37elh6	62	21	for	for	IN
cord-001824-7c37elh6	62	22	Gln	Gln	NNP
cord-001824-7c37elh6	62	23	,	,	,
cord-001824-7c37elh6	62	24	Lys	Lys	NNP
cord-001824-7c37elh6	62	25	and	and	CC
cord-001824-7c37elh6	62	26	Glu	Glu	NNP
cord-001824-7c37elh6	62	27	that	that	IN
cord-001824-7c37elh6	62	28	in	in	IN
cord-001824-7c37elh6	62	29	a	a	DT
cord-001824-7c37elh6	62	30	wild	wild	JJ
cord-001824-7c37elh6	62	31	type	type	NN
cord-001824-7c37elh6	62	32	contains	contain	VBZ
cord-001824-7c37elh6	62	33	mcm	mcm	NNP
cord-001824-7c37elh6	62	34	5	5	CD
cord-001824-7c37elh6	62	35	s	s	NN
cord-001824-7c37elh6	62	36	2	2	CD
cord-001824-7c37elh6	62	37	U	U	NNP
cord-001824-7c37elh6	62	38	34	34	CD
cord-001824-7c37elh6	62	39	(	(	-LRB-
cord-001824-7c37elh6	62	40	34	34	CD
cord-001824-7c37elh6	62	41	,	,	,
cord-001824-7c37elh6	62	42	35	35	CD
cord-001824-7c37elh6	62	43	)	)	-RRB-
cord-001824-7c37elh6	62	44	.	.	.
cord-001824-7c37elh6	63	1	It	-PRON-	PRP
cord-001824-7c37elh6	63	2	was	be	VBD
cord-001824-7c37elh6	63	3	concluded	conclude	VBN
cord-001824-7c37elh6	63	4	that	that	IN
cord-001824-7c37elh6	63	5	lack	lack	NN
cord-001824-7c37elh6	63	6	of	of	IN
cord-001824-7c37elh6	63	7	this	this	DT
cord-001824-7c37elh6	63	8	wobble	wobble	NN
cord-001824-7c37elh6	63	9	nucleoside	nucleoside	RB
cord-001824-7c37elh6	63	10	reduces	reduce	VBZ
cord-001824-7c37elh6	63	11	the	the	DT
cord-001824-7c37elh6	63	12	efficiency	efficiency	NN
cord-001824-7c37elh6	63	13	to	to	TO
cord-001824-7c37elh6	63	14	recognize	recognize	VB
cord-001824-7c37elh6	63	15	the	the	DT
cord-001824-7c37elh6	63	16	cognate	cognate	JJ
cord-001824-7c37elh6	63	17	codons	codon	NNS
cord-001824-7c37elh6	63	18	for	for	IN
cord-001824-7c37elh6	63	19	these	these	DT
cord-001824-7c37elh6	63	20	tR	tR	NNP
cord-001824-7c37elh6	63	21	-	-	HYPH
cord-001824-7c37elh6	63	22	NAs	NAs	NNPS
cord-001824-7c37elh6	63	23	,	,	,
cord-001824-7c37elh6	63	24	which	which	WDT
cord-001824-7c37elh6	63	25	is	be	VBZ
cord-001824-7c37elh6	63	26	compensated	compensate	VBN
cord-001824-7c37elh6	63	27	by	by	IN
cord-001824-7c37elh6	63	28	an	an	DT
cord-001824-7c37elh6	63	29	increased	increase	VBN
cord-001824-7c37elh6	63	30	concentration	concentration	NN
cord-001824-7c37elh6	63	31	of	of	IN
cord-001824-7c37elh6	63	32	the	the	DT
cord-001824-7c37elh6	63	33	modification	modification	NN
cord-001824-7c37elh6	63	34	deficient	deficient	JJ
cord-001824-7c37elh6	63	35	tRNA	tRNA	NNP
cord-001824-7c37elh6	63	36	.	.	.
cord-001824-7c37elh6	64	1	Thus	thus	RB
cord-001824-7c37elh6	64	2	,	,	,
cord-001824-7c37elh6	64	3	the	the	DT
cord-001824-7c37elh6	64	4	many	many	JJ
cord-001824-7c37elh6	64	5	different	different	JJ
cord-001824-7c37elh6	64	6	phenotypes	phenotype	NNS
cord-001824-7c37elh6	64	7	of	of	IN
cord-001824-7c37elh6	64	8	Elongator	Elongator	NNP
cord-001824-7c37elh6	64	9	mutants	mutant	NNS
cord-001824-7c37elh6	64	10	are	be	VBP
cord-001824-7c37elh6	64	11	due	due	JJ
cord-001824-7c37elh6	64	12	to	to	IN
cord-001824-7c37elh6	64	13	reduced	reduce	VBN
cord-001824-7c37elh6	64	14	efficiency	efficiency	NN
cord-001824-7c37elh6	64	15	in	in	IN
cord-001824-7c37elh6	64	16	translating	translate	VBG
cord-001824-7c37elh6	64	17	some	some	DT
cord-001824-7c37elh6	64	18	key	key	NN
cord-001824-7c37elh6	64	19	mRNAs	mrnas	ADD
cord-001824-7c37elh6	64	20	encoding	encode	VBG
cord-001824-7c37elh6	64	21	proteins	protein	NNS
cord-001824-7c37elh6	64	22	important	important	JJ
cord-001824-7c37elh6	64	23	for	for	IN
cord-001824-7c37elh6	64	24	manifesting	manifest	VBG
cord-001824-7c37elh6	64	25	a	a	DT
cord-001824-7c37elh6	64	26	correct	correct	JJ
cord-001824-7c37elh6	64	27	phenotype	phenotype	NN
cord-001824-7c37elh6	64	28	.	.	.
cord-001824-7c37elh6	65	1	In	in	IN
cord-001824-7c37elh6	65	2	bacteria	bacteria	NNS
cord-001824-7c37elh6	65	3	,	,	,
cord-001824-7c37elh6	65	4	modified	modify	VBN
cord-001824-7c37elh6	65	5	wobble	wobble	NN
cord-001824-7c37elh6	65	6	uridines	uridine	NNS
cord-001824-7c37elh6	65	7	are	be	VBP
cord-001824-7c37elh6	65	8	important	important	JJ
cord-001824-7c37elh6	65	9	to	to	TO
cord-001824-7c37elh6	65	10	prevent	prevent	VB
cord-001824-7c37elh6	65	11	+1	+1	NNS
cord-001824-7c37elh6	65	12	frameshifting	frameshifting	NN
cord-001824-7c37elh6	65	13	(	(	-LRB-
cord-001824-7c37elh6	65	14	6	6	CD
cord-001824-7c37elh6	65	15	,	,	,
cord-001824-7c37elh6	65	16	36	36	CD
cord-001824-7c37elh6	65	17	)	)	-RRB-
cord-001824-7c37elh6	65	18	.	.	.
cord-001824-7c37elh6	66	1	In	in	IN
cord-001824-7c37elh6	66	2	eukaryotes	eukaryote	NNS
cord-001824-7c37elh6	66	3	,	,	,
cord-001824-7c37elh6	66	4	only	only	RB
cord-001824-7c37elh6	66	5	a	a	DT
cord-001824-7c37elh6	66	6	limited	limited	JJ
cord-001824-7c37elh6	66	7	study	study	NN
cord-001824-7c37elh6	66	8	has	have	VBZ
cord-001824-7c37elh6	66	9	been	be	VBN
cord-001824-7c37elh6	66	10	done	do	VBN
cord-001824-7c37elh6	66	11	,	,	,
cord-001824-7c37elh6	66	12	which	which	WDT
cord-001824-7c37elh6	66	13	focused	focus	VBD
cord-001824-7c37elh6	66	14	on	on	IN
cord-001824-7c37elh6	66	15	the	the	DT
cord-001824-7c37elh6	66	16	influence	influence	NN
cord-001824-7c37elh6	66	17	of	of	IN
cord-001824-7c37elh6	66	18	the	the	DT
cord-001824-7c37elh6	66	19	esterified	esterify	VBN
cord-001824-7c37elh6	66	20	methyl	methyl	NN
cord-001824-7c37elh6	66	21	group	group	NN
cord-001824-7c37elh6	66	22	of	of	IN
cord-001824-7c37elh6	66	23	mcm	mcm	NNP
cord-001824-7c37elh6	66	24	5	5	CD
cord-001824-7c37elh6	66	25	U	U	NNP
cord-001824-7c37elh6	66	26	34	34	CD
cord-001824-7c37elh6	66	27	in	in	IN
cord-001824-7c37elh6	66	28	reading	read	VBG
cord-001824-7c37elh6	66	29	frame	frame	NN
cord-001824-7c37elh6	66	30	maintenance	maintenance	NN
cord-001824-7c37elh6	66	31	(	(	-LRB-
cord-001824-7c37elh6	66	32	37	37	CD
cord-001824-7c37elh6	66	33	)	)	-RRB-
cord-001824-7c37elh6	66	34	.	.	.
cord-001824-7c37elh6	67	1	However	however	RB
cord-001824-7c37elh6	67	2	,	,	,
cord-001824-7c37elh6	67	3	no	no	DT
cord-001824-7c37elh6	67	4	specific	specific	JJ
cord-001824-7c37elh6	67	5	conclusion	conclusion	NN
cord-001824-7c37elh6	67	6	was	be	VBD
cord-001824-7c37elh6	67	7	made	make	VBN
cord-001824-7c37elh6	67	8	where	where	WRB
cord-001824-7c37elh6	67	9	the	the	DT
cord-001824-7c37elh6	67	10	frameshift	frameshift	NN
cord-001824-7c37elh6	67	11	errors	error	NNS
cord-001824-7c37elh6	67	12	occur	occur	VBP
cord-001824-7c37elh6	67	13	,	,	,
cord-001824-7c37elh6	67	14	since	since	IN
cord-001824-7c37elh6	67	15	the	the	DT
cord-001824-7c37elh6	67	16	frameshift	frameshift	NN
cord-001824-7c37elh6	67	17	window	window	NN
cord-001824-7c37elh6	67	18	used	use	VBN
cord-001824-7c37elh6	67	19	was	be	VBD
cord-001824-7c37elh6	67	20	very	very	RB
cord-001824-7c37elh6	67	21	large	large	JJ
cord-001824-7c37elh6	67	22	.	.	.
cord-001824-7c37elh6	68	1	Therefore	therefore	RB
cord-001824-7c37elh6	68	2	,	,	,
cord-001824-7c37elh6	68	3	no	no	DT
cord-001824-7c37elh6	68	4	extensive	extensive	JJ
cord-001824-7c37elh6	68	5	information	information	NN
cord-001824-7c37elh6	68	6	of	of	IN
cord-001824-7c37elh6	68	7	the	the	DT
cord-001824-7c37elh6	68	8	role	role	NN
cord-001824-7c37elh6	68	9	of	of	IN
cord-001824-7c37elh6	68	10	modified	modify	VBN
cord-001824-7c37elh6	68	11	wobble	wobble	NN
cord-001824-7c37elh6	68	12	uridines	uridine	NNS
cord-001824-7c37elh6	68	13	in	in	IN
cord-001824-7c37elh6	68	14	reading	read	VBG
cord-001824-7c37elh6	68	15	frame	frame	NN
cord-001824-7c37elh6	68	16	maintenance	maintenance	NN
cord-001824-7c37elh6	68	17	is	be	VBZ
cord-001824-7c37elh6	68	18	available	available	JJ
cord-001824-7c37elh6	68	19	for	for	IN
cord-001824-7c37elh6	68	20	eukaryotic	eukaryotic	JJ
cord-001824-7c37elh6	68	21	tRNA	tRNA	NNP
cord-001824-7c37elh6	68	22	.	.	.
cord-001824-7c37elh6	69	1	It	-PRON-	PRP
cord-001824-7c37elh6	69	2	was	be	VBD
cord-001824-7c37elh6	69	3	therefore	therefore	RB
cord-001824-7c37elh6	69	4	important	important	JJ
cord-001824-7c37elh6	69	5	to	to	TO
cord-001824-7c37elh6	69	6	investigate	investigate	VB
cord-001824-7c37elh6	69	7	whether	whether	IN
cord-001824-7c37elh6	69	8	or	or	CC
cord-001824-7c37elh6	69	9	not	not	RB
cord-001824-7c37elh6	69	10	lack	lack	NN
cord-001824-7c37elh6	69	11	of	of	IN
cord-001824-7c37elh6	69	12	the	the	DT
cord-001824-7c37elh6	69	13	xm	xm	NNP
cord-001824-7c37elh6	69	14	5	5	CD
cord-001824-7c37elh6	69	15	U	U	NNP
cord-001824-7c37elh6	69	16	or	or	CC
cord-001824-7c37elh6	69	17	mcm	mcm	NNP
cord-001824-7c37elh6	69	18	5	5	CD
cord-001824-7c37elh6	69	19	s	s	NN
cord-001824-7c37elh6	69	20	2	2	CD
cord-001824-7c37elh6	69	21	U	U	NNP
cord-001824-7c37elh6	69	22	modifications	modification	NNS
cord-001824-7c37elh6	69	23	are	be	VBP
cord-001824-7c37elh6	69	24	crucial	crucial	JJ
cord-001824-7c37elh6	69	25	for	for	IN
cord-001824-7c37elh6	69	26	reading	read	VBG
cord-001824-7c37elh6	69	27	frame	frame	NN
cord-001824-7c37elh6	69	28	maintenance	maintenance	NN
cord-001824-7c37elh6	69	29	.	.	.
cord-001824-7c37elh6	70	1	Here	here	RB
cord-001824-7c37elh6	70	2	,	,	,
cord-001824-7c37elh6	70	3	we	-PRON-	PRP
cord-001824-7c37elh6	70	4	show	show	VBP
cord-001824-7c37elh6	70	5	that	that	IN
cord-001824-7c37elh6	70	6	presence	presence	NN
cord-001824-7c37elh6	70	7	of	of	IN
cord-001824-7c37elh6	70	8	xm	xm	NNP
cord-001824-7c37elh6	70	9	5	5	CD
cord-001824-7c37elh6	70	10	-(x	-(x	NNP
cord-001824-7c37elh6	70	11	,	,	,
cord-001824-7c37elh6	70	12	any	any	DT
cord-001824-7c37elh6	70	13	substitution	substitution	NN
cord-001824-7c37elh6	70	14	)	)	-RRB-
cord-001824-7c37elh6	70	15	or	or	CC
cord-001824-7c37elh6	70	16	s	s	NN
cord-001824-7c37elh6	70	17	2	2	CD
cord-001824-7c37elh6	70	18	side	side	NN
cord-001824-7c37elh6	70	19	groups	group	NNS
cord-001824-7c37elh6	70	20	at	at	IN
cord-001824-7c37elh6	70	21	wobble	wobble	VB
cord-001824-7c37elh6	70	22	uridines	uridine	NNS
cord-001824-7c37elh6	70	23	in	in	IN
cord-001824-7c37elh6	70	24	yeast	yeast	NN
cord-001824-7c37elh6	70	25	is	be	VBZ
cord-001824-7c37elh6	70	26	pivotal	pivotal	JJ
cord-001824-7c37elh6	70	27	in	in	IN
cord-001824-7c37elh6	70	28	maintaining	maintain	VBG
cord-001824-7c37elh6	70	29	the	the	DT
cord-001824-7c37elh6	70	30	translational	translational	JJ
cord-001824-7c37elh6	70	31	reading	reading	NN
cord-001824-7c37elh6	70	32	frame	frame	NN
cord-001824-7c37elh6	70	33	.	.	.
cord-001824-7c37elh6	71	1	The	the	DT
cord-001824-7c37elh6	71	2	source	source	NN
cord-001824-7c37elh6	71	3	and	and	CC
cord-001824-7c37elh6	71	4	genotypes	genotype	NNS
cord-001824-7c37elh6	71	5	of	of	IN
cord-001824-7c37elh6	71	6	yeast	yeast	NN
cord-001824-7c37elh6	71	7	strains	strain	NNS
cord-001824-7c37elh6	71	8	used	use	VBN
cord-001824-7c37elh6	71	9	in	in	IN
cord-001824-7c37elh6	71	10	this	this	DT
cord-001824-7c37elh6	71	11	study	study	NN
cord-001824-7c37elh6	71	12	are	be	VBP
cord-001824-7c37elh6	71	13	listed	list	VBN
cord-001824-7c37elh6	71	14	in	in	IN
cord-001824-7c37elh6	71	15	Table	Table	NNP
cord-001824-7c37elh6	71	16	1	1	CD
cord-001824-7c37elh6	71	17	.	.	.
cord-001824-7c37elh6	72	1	E.	E.	NNP
cord-001824-7c37elh6	72	2	coli	coli	NNS
cord-001824-7c37elh6	72	3	strain	strain	NN
cord-001824-7c37elh6	72	4	used	use	VBN
cord-001824-7c37elh6	72	5	was	be	VBD
cord-001824-7c37elh6	72	6	DH5α	DH5α	NNP
cord-001824-7c37elh6	72	7	(	(	-LRB-
cord-001824-7c37elh6	72	8	Bethesda	Bethesda	NNP
cord-001824-7c37elh6	72	9	Research	Research	NNP
cord-001824-7c37elh6	72	10	Laboratories	Laboratories	NNP
cord-001824-7c37elh6	72	11	)	)	-RRB-
cord-001824-7c37elh6	72	12	.	.	.
cord-001824-7c37elh6	73	1	Yeast	yeast	NN
cord-001824-7c37elh6	73	2	transformation	transformation	NN
cord-001824-7c37elh6	73	3	(	(	-LRB-
cord-001824-7c37elh6	73	4	38	38	CD
cord-001824-7c37elh6	73	5	)	)	-RRB-
cord-001824-7c37elh6	73	6	,	,	,
cord-001824-7c37elh6	73	7	media	medium	NNS
cord-001824-7c37elh6	73	8	and	and	CC
cord-001824-7c37elh6	73	9	genetic	genetic	JJ
cord-001824-7c37elh6	73	10	procedures	procedure	NNS
cord-001824-7c37elh6	73	11	have	have	VBP
cord-001824-7c37elh6	73	12	been	be	VBN
cord-001824-7c37elh6	73	13	described	describe	VBN
cord-001824-7c37elh6	73	14	previously	previously	RB
cord-001824-7c37elh6	73	15	(	(	-LRB-
cord-001824-7c37elh6	73	16	39	39	CD
cord-001824-7c37elh6	73	17	)	)	-RRB-
cord-001824-7c37elh6	73	18	.	.	.
cord-001824-7c37elh6	74	1	Plasmid	Plasmid	NNP
cord-001824-7c37elh6	74	2	pJD375	pJD375	NNP
cord-001824-7c37elh6	74	3	contains	contain	VBZ
cord-001824-7c37elh6	74	4	a	a	DT
cord-001824-7c37elh6	74	5	Renilla	Renilla	NNP
cord-001824-7c37elh6	74	6	/	/	SYM
cord-001824-7c37elh6	74	7	Firefly	Firefly	NNP
cord-001824-7c37elh6	74	8	luciferase	luciferase	NN
cord-001824-7c37elh6	74	9	bicistronic	bicistronic	JJ
cord-001824-7c37elh6	74	10	reporter	reporter	NN
cord-001824-7c37elh6	74	11	system	system	NN
cord-001824-7c37elh6	74	12	(	(	-LRB-
cord-001824-7c37elh6	74	13	40	40	CD
cord-001824-7c37elh6	74	14	)	)	-RRB-
cord-001824-7c37elh6	74	15	.	.	.
cord-001824-7c37elh6	75	1	To	to	TO
cord-001824-7c37elh6	75	2	introduce	introduce	VB
cord-001824-7c37elh6	75	3	various	various	JJ
cord-001824-7c37elh6	75	4	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	75	5	windows	window	NNS
cord-001824-7c37elh6	75	6	between	between	IN
cord-001824-7c37elh6	75	7	the	the	DT
cord-001824-7c37elh6	75	8	luciferase	luciferase	NN
cord-001824-7c37elh6	75	9	genes	gene	NNS
cord-001824-7c37elh6	75	10	,	,	,
cord-001824-7c37elh6	75	11	a	a	DT
cord-001824-7c37elh6	75	12	BamHI	BamHI	NNP
cord-001824-7c37elh6	75	13	-	-	HYPH
cord-001824-7c37elh6	75	14	XhoI	XhoI	NNP
cord-001824-7c37elh6	75	15	fragment	fragment	NN
cord-001824-7c37elh6	75	16	from	from	IN
cord-001824-7c37elh6	75	17	plasmid	plasmid	NNP
cord-001824-7c37elh6	75	18	pJD375	pJD375	NNP
cord-001824-7c37elh6	75	19	containing	contain	VBG
cord-001824-7c37elh6	75	20	the	the	DT
cord-001824-7c37elh6	75	21	Firefly	Firefly	NNP
cord-001824-7c37elh6	75	22	luciferase	luciferase	NN
cord-001824-7c37elh6	75	23	gene	gene	NN
cord-001824-7c37elh6	75	24	was	be	VBD
cord-001824-7c37elh6	75	25	cloned	clone	VBN
cord-001824-7c37elh6	75	26	into	into	IN
cord-001824-7c37elh6	75	27	corresponding	correspond	VBG
cord-001824-7c37elh6	75	28	sites	site	NNS
cord-001824-7c37elh6	75	29	of	of	IN
cord-001824-7c37elh6	75	30	YCp50	YCp50	NNS
cord-001824-7c37elh6	75	31	,	,	,
cord-001824-7c37elh6	75	32	generating	generate	VBG
cord-001824-7c37elh6	75	33	plasmid	plasmid	NN
cord-001824-7c37elh6	75	34	YCp50-Firefly	ycp50-firefly	NN
cord-001824-7c37elh6	75	35	.	.	.
cord-001824-7c37elh6	76	1	Two	two	CD
cord-001824-7c37elh6	76	2	complementary	complementary	JJ
cord-001824-7c37elh6	76	3	oligonucleotides	oligonucleotide	NNS
cord-001824-7c37elh6	76	4	carrying	carry	VBG
cord-001824-7c37elh6	76	5	various	various	JJ
cord-001824-7c37elh6	76	6	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	76	7	windows	window	NNS
cord-001824-7c37elh6	76	8	(	(	-LRB-
cord-001824-7c37elh6	76	9	see	see	VB
cord-001824-7c37elh6	76	10	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	76	11	Table	Table	NNP
cord-001824-7c37elh6	76	12	S1	S1	NNP
cord-001824-7c37elh6	76	13	)	)	-RRB-
cord-001824-7c37elh6	76	14	were	be	VBD
cord-001824-7c37elh6	76	15	annealed	anneal	VBN
cord-001824-7c37elh6	76	16	into	into	IN
cord-001824-7c37elh6	76	17	the	the	DT
cord-001824-7c37elh6	76	18	BamHI	bamhi	NN
cord-001824-7c37elh6	76	19	and	and	CC
cord-001824-7c37elh6	76	20	SacI	SacI	NNP
cord-001824-7c37elh6	76	21	sites	site	NNS
cord-001824-7c37elh6	76	22	of	of	IN
cord-001824-7c37elh6	76	23	YCp50-Firefly	YCp50-Firefly	NNP
cord-001824-7c37elh6	76	24	.	.	.
cord-001824-7c37elh6	77	1	The	the	DT
cord-001824-7c37elh6	77	2	newly	newly	RB
cord-001824-7c37elh6	77	3	constructed	construct	VBN
cord-001824-7c37elh6	77	4	plasmids	plasmid	NNS
cord-001824-7c37elh6	77	5	were	be	VBD
cord-001824-7c37elh6	77	6	digested	digest	VBN
cord-001824-7c37elh6	77	7	with	with	IN
cord-001824-7c37elh6	77	8	restriction	restriction	NN
cord-001824-7c37elh6	77	9	enzymes	enzyme	NNS
cord-001824-7c37elh6	77	10	(	(	-LRB-
cord-001824-7c37elh6	77	11	BamHI	BamHI	NNP
cord-001824-7c37elh6	77	12	and	and	CC
cord-001824-7c37elh6	77	13	XhoI	XhoI	NNP
cord-001824-7c37elh6	77	14	)	)	-RRB-
cord-001824-7c37elh6	77	15	and	and	CC
cord-001824-7c37elh6	77	16	fragments	fragment	NNS
cord-001824-7c37elh6	77	17	containing	contain	VBG
cord-001824-7c37elh6	77	18	the	the	DT
cord-001824-7c37elh6	77	19	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	77	20	sites	site	NNS
cord-001824-7c37elh6	77	21	linked	link	VBN
cord-001824-7c37elh6	77	22	to	to	IN
cord-001824-7c37elh6	77	23	the	the	DT
cord-001824-7c37elh6	77	24	Firefly	Firefly	NNP
cord-001824-7c37elh6	77	25	luciferase	luciferase	NN
cord-001824-7c37elh6	77	26	gene	gene	NN
cord-001824-7c37elh6	77	27	were	be	VBD
cord-001824-7c37elh6	77	28	cloned	clone	VBN
cord-001824-7c37elh6	77	29	back	back	RB
cord-001824-7c37elh6	77	30	into	into	IN
cord-001824-7c37elh6	77	31	the	the	DT
cord-001824-7c37elh6	77	32	corresponding	correspond	VBG
cord-001824-7c37elh6	77	33	sites	site	NNS
cord-001824-7c37elh6	77	34	of	of	IN
cord-001824-7c37elh6	77	35	pJD375	pJD375	NNS
cord-001824-7c37elh6	77	36	restoring	restore	VBG
cord-001824-7c37elh6	77	37	the	the	DT
cord-001824-7c37elh6	77	38	bicistronic	bicistronic	JJ
cord-001824-7c37elh6	77	39	reporter	reporter	NN
cord-001824-7c37elh6	77	40	system	system	NN
cord-001824-7c37elh6	77	41	with	with	IN
cord-001824-7c37elh6	77	42	the	the	DT
cord-001824-7c37elh6	77	43	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	77	44	window	window	NN
cord-001824-7c37elh6	77	45	.	.	.
cord-001824-7c37elh6	78	1	Plasmids	plasmid	NNS
cord-001824-7c37elh6	78	2	pMB38	pMB38	NNS
cord-001824-7c37elh6	78	3	-	-	HYPH
cord-001824-7c37elh6	78	4	9mer	9mer	CD
cord-001824-7c37elh6	78	5	(	(	-LRB-
cord-001824-7c37elh6	78	6	FF	FF	NNP
cord-001824-7c37elh6	78	7	and	and	CC
cord-001824-7c37elh6	78	8	WT	WT	NNP
cord-001824-7c37elh6	78	9	)	)	-RRB-
cord-001824-7c37elh6	78	10	contain	contain	VBP
cord-001824-7c37elh6	78	11	a	a	DT
cord-001824-7c37elh6	78	12	HIS4A::lacZ	HIS4A::lacZ	NNP
cord-001824-7c37elh6	78	13	reporter	reporter	NN
cord-001824-7c37elh6	78	14	cassette	cassette	NN
cord-001824-7c37elh6	78	15	.	.	.
cord-001824-7c37elh6	79	1	In	in	IN
cord-001824-7c37elh6	79	2	pMB38	pMB38	NNS
cord-001824-7c37elh6	79	3	-	-	SYM
cord-001824-7c37elh6	79	4	9merFF	9merff	CD
cord-001824-7c37elh6	79	5	(	(	-LRB-
cord-001824-7c37elh6	79	6	inframe	inframe	NN
cord-001824-7c37elh6	79	7	control	control	NN
cord-001824-7c37elh6	79	8	construct	construct	VB
cord-001824-7c37elh6	79	9	)	)	-RRB-
cord-001824-7c37elh6	79	10	,	,	,
cord-001824-7c37elh6	79	11	the	the	DT
cord-001824-7c37elh6	79	12	lacZ	lacZ	NNP
cord-001824-7c37elh6	79	13	gene	gene	NN
cord-001824-7c37elh6	79	14	is	be	VBZ
cord-001824-7c37elh6	79	15	in	in	IN
cord-001824-7c37elh6	79	16	0	0	CD
cord-001824-7c37elh6	79	17	frame	frame	NN
cord-001824-7c37elh6	79	18	,	,	,
cord-001824-7c37elh6	79	19	while	while	IN
cord-001824-7c37elh6	79	20	in	in	IN
cord-001824-7c37elh6	79	21	pMB38	pMB38	NNS
cord-001824-7c37elh6	79	22	-	-	HYPH
cord-001824-7c37elh6	79	23	9merWT	9merwt	CD
cord-001824-7c37elh6	79	24	(	(	-LRB-
cord-001824-7c37elh6	79	25	test	test	NN
cord-001824-7c37elh6	79	26	construct	construct	VB
cord-001824-7c37elh6	79	27	)	)	-RRB-
cord-001824-7c37elh6	79	28	,	,	,
cord-001824-7c37elh6	79	29	the	the	DT
cord-001824-7c37elh6	79	30	lacZ	lacZ	NNP
cord-001824-7c37elh6	79	31	gene	gene	NN
cord-001824-7c37elh6	79	32	is	be	VBZ
cord-001824-7c37elh6	79	33	in	in	IN
cord-001824-7c37elh6	79	34	+1	+1	NN
cord-001824-7c37elh6	79	35	frame	frame	NN
cord-001824-7c37elh6	79	36	(	(	-LRB-
cord-001824-7c37elh6	79	37	Figure	figure	NN
cord-001824-7c37elh6	79	38	4B	4b	CD
cord-001824-7c37elh6	79	39	)	)	-RRB-
cord-001824-7c37elh6	79	40	(	(	-LRB-
cord-001824-7c37elh6	79	41	41	41	CD
cord-001824-7c37elh6	79	42	)	)	-RRB-
cord-001824-7c37elh6	79	43	.	.	.
cord-001824-7c37elh6	80	1	These	these	DT
cord-001824-7c37elh6	80	2	plasmids	plasmid	NNS
cord-001824-7c37elh6	80	3	were	be	VBD
cord-001824-7c37elh6	80	4	used	use	VBN
cord-001824-7c37elh6	80	5	as	as	IN
cord-001824-7c37elh6	80	6	templates	template	NNS
cord-001824-7c37elh6	80	7	for	for	IN
cord-001824-7c37elh6	80	8	PCR	PCR	NNP
cord-001824-7c37elh6	80	9	oligonucleotide	oligonucleotide	NN
cord-001824-7c37elh6	80	10	directed	direct	VBD
cord-001824-7c37elh6	80	11	mutagenesis	mutagenesis	NN
cord-001824-7c37elh6	80	12	to	to	TO
cord-001824-7c37elh6	80	13	alter	alter	VB
cord-001824-7c37elh6	80	14	the	the	DT
cord-001824-7c37elh6	80	15	Ty1	ty1	CD
cord-001824-7c37elh6	80	16	sequence	sequence	NN
cord-001824-7c37elh6	80	17	(	(	-LRB-
cord-001824-7c37elh6	80	18	CTT	CTT	NNP
cord-001824-7c37elh6	80	19	-	-	HYPH
cord-001824-7c37elh6	80	20	AGG	AGG	NNP
cord-001824-7c37elh6	80	21	-	-	HYPH
cord-001824-7c37elh6	80	22	C	C	NNP
cord-001824-7c37elh6	80	23	)	)	-RRB-
cord-001824-7c37elh6	80	24	(	(	-LRB-
cord-001824-7c37elh6	80	25	Figure	figure	NN
cord-001824-7c37elh6	80	26	4B	4b	NN
cord-001824-7c37elh6	80	27	and	and	CC
cord-001824-7c37elh6	80	28	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	80	29	Table	Table	NNP
cord-001824-7c37elh6	80	30	S2	S2	NNP
cord-001824-7c37elh6	80	31	)	)	-RRB-
cord-001824-7c37elh6	80	32	.	.	.
cord-001824-7c37elh6	81	1	For	for	IN
cord-001824-7c37elh6	81	2	the	the	DT
cord-001824-7c37elh6	81	3	overexpression	overexpression	NN
cord-001824-7c37elh6	81	4	of	of	IN
cord-001824-7c37elh6	81	5	the	the	DT
cord-001824-7c37elh6	81	6	Lys	Lys	NNP
cord-001824-7c37elh6	81	7	-	-	HYPH
cord-001824-7c37elh6	81	8	tRNA	tRNA	NNP
cord-001824-7c37elh6	81	9	encoded	encode	VBN
cord-001824-7c37elh6	81	10	by	by	IN
cord-001824-7c37elh6	81	11	the	the	DT
cord-001824-7c37elh6	81	12	tK(UUU)L	tK(UUU)L	NNP
cord-001824-7c37elh6	81	13	gene	gene	NN
cord-001824-7c37elh6	81	14	,	,	,
cord-001824-7c37elh6	81	15	we	-PRON-	PRP
cord-001824-7c37elh6	81	16	first	first	RB
cord-001824-7c37elh6	81	17	introduced	introduce	VBD
cord-001824-7c37elh6	81	18	SphI	SphI	NNP
cord-001824-7c37elh6	81	19	and	and	CC
cord-001824-7c37elh6	81	20	NheI	NheI	NNP
cord-001824-7c37elh6	81	21	restriction	restriction	NN
cord-001824-7c37elh6	81	22	sites	site	NNS
cord-001824-7c37elh6	81	23	to	to	IN
cord-001824-7c37elh6	81	24	plasmids	plasmid	NNS
cord-001824-7c37elh6	81	25	pMB38	pMB38	NNP
cord-001824-7c37elh6	81	26	-	-	HYPH
cord-001824-7c37elh6	81	27	9mer	9mer	CD
cord-001824-7c37elh6	81	28	(	(	-LRB-
cord-001824-7c37elh6	81	29	FF	FF	NNP
cord-001824-7c37elh6	81	30	and	and	CC
cord-001824-7c37elh6	81	31	WT	WT	NNP
cord-001824-7c37elh6	81	32	)	)	-RRB-
cord-001824-7c37elh6	81	33	carrying	carry	VBG
cord-001824-7c37elh6	81	34	the	the	DT
cord-001824-7c37elh6	81	35	'	'	``
cord-001824-7c37elh6	81	36	CUU	CUU	NNP
cord-001824-7c37elh6	81	37	-	-	HYPH
cord-001824-7c37elh6	81	38	AAA	AAA	NNP
cord-001824-7c37elh6	81	39	-	-	HYPH
cord-001824-7c37elh6	81	40	C	c	NN
cord-001824-7c37elh6	81	41	'	'	''
cord-001824-7c37elh6	81	42	sequence	sequence	NN
cord-001824-7c37elh6	81	43	by	by	IN
cord-001824-7c37elh6	81	44	PCR	PCR	NNP
cord-001824-7c37elh6	81	45	oligonucleotide	oligonucleotide	NN
cord-001824-7c37elh6	81	46	directed	direct	VBD
cord-001824-7c37elh6	81	47	mutagenesis	mutagenesis	NN
cord-001824-7c37elh6	81	48	.	.	.
cord-001824-7c37elh6	82	1	Oligonucleotides	oligonucleotides	NN
cord-001824-7c37elh6	82	2	used	use	VBD
cord-001824-7c37elh6	82	3	were	be	VBD
cord-001824-7c37elh6	82	4	5	5	CD
cord-001824-7c37elh6	82	5	-GGTGTCGGGGCGCATGCATGACCCAGTCAC-3	-ggtgtcggggcgcatgcatgacccagtcac-3	NN
cord-001824-7c37elh6	82	6	and	and	CC
cord-001824-7c37elh6	82	7	5	5	CD
cord-001824-7c37elh6	82	8	-AGAGTGCACCATATGCGGTGTGAGCT	-agagtgcaccatatgcggtgtgagct	ADD
cord-001824-7c37elh6	82	9	AGCGCACAGATGCG-3	AGCGCACAGATGCG-3	NNP
cord-001824-7c37elh6	82	10	.	.	.
cord-001824-7c37elh6	83	1	The	the	DT
cord-001824-7c37elh6	83	2	tK(UUU)L	tK(UUU)L	NNP
cord-001824-7c37elh6	83	3	gene	gene	NN
cord-001824-7c37elh6	83	4	was	be	VBD
cord-001824-7c37elh6	83	5	amplified	amplify	VBN
cord-001824-7c37elh6	83	6	from	from	IN
cord-001824-7c37elh6	83	7	strain	strain	NN
cord-001824-7c37elh6	83	8	UMY2067	UMY2067	VBN
cord-001824-7c37elh6	83	9	by	by	IN
cord-001824-7c37elh6	83	10	using	use	VBG
cord-001824-7c37elh6	83	11	oligonucleotides	oligonucleotide	NNS
cord-001824-7c37elh6	83	12	5	5	CD
cord-001824-7c37elh6	83	13	AAAAGCATGCCGGTAGAGTCTCTT	AAAAGCATGCCGGTAGAGTCTCTT	NNP
cord-001824-7c37elh6	83	14	-	-	HYPH
cord-001824-7c37elh6	83	15	CTTGGTC-3	CTTGGTC-3	NNP
cord-001824-7c37elh6	83	16	and	and	CC
cord-001824-7c37elh6	83	17	5	5	CD
cord-001824-7c37elh6	83	18	AAAAGCTAGCCGGTA	AAAAGCTAGCCGGTA	NNP
cord-001824-7c37elh6	83	19	-	-	HYPH
cord-001824-7c37elh6	83	20	AGAGAGAAACCTCCA-3	AGAGAGAAACCTCCA-3	NNP
cord-001824-7c37elh6	83	21	and	and	CC
cord-001824-7c37elh6	83	22	cloned	clone	VBN
cord-001824-7c37elh6	83	23	between	between	IN
cord-001824-7c37elh6	83	24	SphI	SphI	NNP
cord-001824-7c37elh6	83	25	and	and	CC
cord-001824-7c37elh6	83	26	NheI	NheI	NNP
cord-001824-7c37elh6	83	27	sites	site	NNS
cord-001824-7c37elh6	83	28	of	of	IN
cord-001824-7c37elh6	83	29	these	these	DT
cord-001824-7c37elh6	83	30	plasmids	plasmid	NNS
cord-001824-7c37elh6	83	31	.	.	.
cord-001824-7c37elh6	84	1	Three	three	CD
cord-001824-7c37elh6	84	2	individual	individual	JJ
cord-001824-7c37elh6	84	3	transformants	transformant	NNS
cord-001824-7c37elh6	84	4	of	of	IN
cord-001824-7c37elh6	84	5	each	each	DT
cord-001824-7c37elh6	84	6	dual	dual	JJ
cord-001824-7c37elh6	84	7	luciferase	luciferase	NN
cord-001824-7c37elh6	84	8	assay	assay	NN
cord-001824-7c37elh6	84	9	construct	construct	NN
cord-001824-7c37elh6	84	10	(	(	-LRB-
cord-001824-7c37elh6	84	11	biological	biological	JJ
cord-001824-7c37elh6	84	12	replicates	replicate	NNS
cord-001824-7c37elh6	84	13	)	)	-RRB-
cord-001824-7c37elh6	84	14	were	be	VBD
cord-001824-7c37elh6	84	15	grown	grow	VBN
cord-001824-7c37elh6	84	16	at	at	IN
cord-001824-7c37elh6	84	17	30	30	CD
cord-001824-7c37elh6	85	1	•	•	NNP
cord-001824-7c37elh6	85	2	C	C	NNP
cord-001824-7c37elh6	85	3	in	in	IN
cord-001824-7c37elh6	85	4	synthetic	synthetic	JJ
cord-001824-7c37elh6	85	5	complete	complete	JJ
cord-001824-7c37elh6	85	6	(	(	-LRB-
cord-001824-7c37elh6	85	7	SC)-Ura	sc)-ura	VB
cord-001824-7c37elh6	85	8	medium	medium	NN
cord-001824-7c37elh6	85	9	to	to	IN
cord-001824-7c37elh6	85	10	an	an	DT
cord-001824-7c37elh6	85	11	optical	optical	JJ
cord-001824-7c37elh6	85	12	density	density	NN
cord-001824-7c37elh6	85	13	at	at	IN
cord-001824-7c37elh6	85	14	600	600	CD
cord-001824-7c37elh6	85	15	nm	nm	NN
cord-001824-7c37elh6	86	1	(	(	-LRB-
cord-001824-7c37elh6	86	2	OD	OD	NNP
cord-001824-7c37elh6	86	3	600	600	CD
cord-001824-7c37elh6	86	4	)	)	-RRB-
cord-001824-7c37elh6	86	5	of	of	IN
cord-001824-7c37elh6	86	6	0.5	0.5	CD
cord-001824-7c37elh6	86	7	.	.	.
cord-001824-7c37elh6	87	1	For	for	IN
cord-001824-7c37elh6	87	2	each	each	DT
cord-001824-7c37elh6	87	3	transformant	transformant	JJ
cord-001824-7c37elh6	87	4	triplicate	triplicate	NN
cord-001824-7c37elh6	87	5	samples	sample	NNS
cord-001824-7c37elh6	87	6	(	(	-LRB-
cord-001824-7c37elh6	87	7	technical	technical	JJ
cord-001824-7c37elh6	87	8	replicates	replicate	NNS
cord-001824-7c37elh6	87	9	)	)	-RRB-
cord-001824-7c37elh6	87	10	of	of	IN
cord-001824-7c37elh6	87	11	10	10	CD
cord-001824-7c37elh6	87	12	l	l	NN
cord-001824-7c37elh6	87	13	cells	cell	NNS
cord-001824-7c37elh6	87	14	were	be	VBD
cord-001824-7c37elh6	87	15	collected	collect	VBN
cord-001824-7c37elh6	87	16	and	and	CC
cord-001824-7c37elh6	87	17	kept	keep	VBN
cord-001824-7c37elh6	87	18	at	at	IN
cord-001824-7c37elh6	87	19	-80	-80	NNP
cord-001824-7c37elh6	88	1	•	•	NNP
cord-001824-7c37elh6	89	1	C.	C.	NNP
cord-001824-7c37elh6	90	1	The	the	DT
cord-001824-7c37elh6	90	2	luciferase	luciferase	NN
cord-001824-7c37elh6	90	3	assays	assay	NNS
cord-001824-7c37elh6	90	4	were	be	VBD
cord-001824-7c37elh6	90	5	performed	perform	VBN
cord-001824-7c37elh6	90	6	according	accord	VBG
cord-001824-7c37elh6	90	7	to	to	IN
cord-001824-7c37elh6	90	8	the	the	DT
cord-001824-7c37elh6	90	9	instructions	instruction	NNS
cord-001824-7c37elh6	90	10	of	of	IN
cord-001824-7c37elh6	90	11	Dual	Dual	NNP
cord-001824-7c37elh6	90	12	-	-	HYPH
cord-001824-7c37elh6	90	13	Luciferase	Luciferase	NNP
cord-001824-7c37elh6	90	14	Reporter	reporter	NN
cord-001824-7c37elh6	90	15	Assay	Assay	NNP
cord-001824-7c37elh6	90	16	System	System	NNP
cord-001824-7c37elh6	90	17	(	(	-LRB-
cord-001824-7c37elh6	90	18	Promega	Promega	NNP
cord-001824-7c37elh6	90	19	,	,	,
cord-001824-7c37elh6	90	20	Catalog	Catalog	NNP
cord-001824-7c37elh6	90	21	No	no	NN
cord-001824-7c37elh6	90	22	.	.	.
cord-001824-7c37elh6	90	23	E1960	E1960	NNP
cord-001824-7c37elh6	90	24	)	)	-RRB-
cord-001824-7c37elh6	90	25	.	.	.
cord-001824-7c37elh6	91	1	The	the	DT
cord-001824-7c37elh6	91	2	luciferase	luciferase	NN
cord-001824-7c37elh6	91	3	activities	activity	NNS
cord-001824-7c37elh6	91	4	were	be	VBD
cord-001824-7c37elh6	91	5	determined	determine	VBN
cord-001824-7c37elh6	91	6	in	in	IN
cord-001824-7c37elh6	91	7	a	a	DT
cord-001824-7c37elh6	91	8	white	white	JJ
cord-001824-7c37elh6	91	9	96-well	96-well	CD
cord-001824-7c37elh6	91	10	plate	plate	NN
cord-001824-7c37elh6	91	11	(	(	-LRB-
cord-001824-7c37elh6	91	12	Thermo	Thermo	NNP
cord-001824-7c37elh6	91	13	Scientific	Scientific	NNP
cord-001824-7c37elh6	91	14	,	,	,
cord-001824-7c37elh6	91	15	#	#	$
cord-001824-7c37elh6	91	16	436111	436111	CD
cord-001824-7c37elh6	91	17	)	)	-RRB-
cord-001824-7c37elh6	91	18	using	use	VBG
cord-001824-7c37elh6	91	19	a	a	DT
cord-001824-7c37elh6	91	20	TECAN	TECAN	NNP
cord-001824-7c37elh6	91	21	infinite	infinite	JJ
cord-001824-7c37elh6	91	22	200	200	CD
cord-001824-7c37elh6	91	23	luminometer	luminometer	NN
cord-001824-7c37elh6	91	24	.	.	.
cord-001824-7c37elh6	92	1	The	the	DT
cord-001824-7c37elh6	92	2	levels	level	NNS
cord-001824-7c37elh6	92	3	of	of	IN
cord-001824-7c37elh6	92	4	+1	+1	NN
cord-001824-7c37elh6	92	5	frameshifting	frameshifting	NN
cord-001824-7c37elh6	92	6	(	(	-LRB-
cord-001824-7c37elh6	92	7	%	%	NN
cord-001824-7c37elh6	92	8	)	)	-RRB-
cord-001824-7c37elh6	92	9	were	be	VBD
cord-001824-7c37elh6	92	10	determined	determine	VBN
cord-001824-7c37elh6	92	11	by	by	IN
cord-001824-7c37elh6	92	12	normalization	normalization	NN
cord-001824-7c37elh6	92	13	of	of	IN
cord-001824-7c37elh6	92	14	each	each	DT
cord-001824-7c37elh6	92	15	biological	biological	JJ
cord-001824-7c37elh6	92	16	test	test	NN
cord-001824-7c37elh6	92	17	replicate	replicate	VBP
cord-001824-7c37elh6	92	18	with	with	IN
cord-001824-7c37elh6	92	19	the	the	DT
cord-001824-7c37elh6	92	20	average	average	NN
cord-001824-7c37elh6	92	21	of	of	IN
cord-001824-7c37elh6	92	22	the	the	DT
cord-001824-7c37elh6	92	23	three	three	CD
cord-001824-7c37elh6	92	24	biological	biological	JJ
cord-001824-7c37elh6	92	25	replicates	replicate	NNS
cord-001824-7c37elh6	92	26	of	of	IN
cord-001824-7c37elh6	92	27	the	the	DT
cord-001824-7c37elh6	92	28	in	in	IN
cord-001824-7c37elh6	92	29	-	-	HYPH
cord-001824-7c37elh6	92	30	frame	frame	NN
cord-001824-7c37elh6	92	31	control	control	NN
cord-001824-7c37elh6	92	32	.	.	.
cord-001824-7c37elh6	93	1	Each	each	DT
cord-001824-7c37elh6	93	2	value	value	NN
cord-001824-7c37elh6	93	3	of	of	IN
cord-001824-7c37elh6	93	4	the	the	DT
cord-001824-7c37elh6	93	5	biological	biological	JJ
cord-001824-7c37elh6	93	6	replicates	replicate	NNS
cord-001824-7c37elh6	93	7	was	be	VBD
cord-001824-7c37elh6	93	8	determined	determine	VBN
cord-001824-7c37elh6	93	9	by	by	IN
cord-001824-7c37elh6	93	10	taking	take	VBG
cord-001824-7c37elh6	93	11	the	the	DT
cord-001824-7c37elh6	93	12	median	median	NN
cord-001824-7c37elh6	93	13	of	of	IN
cord-001824-7c37elh6	93	14	the	the	DT
cord-001824-7c37elh6	93	15	three	three	CD
cord-001824-7c37elh6	93	16	technical	technical	JJ
cord-001824-7c37elh6	93	17	replicates	replicate	NNS
cord-001824-7c37elh6	93	18	.	.	.
cord-001824-7c37elh6	94	1	The	the	DT
cord-001824-7c37elh6	94	2	significant	significant	JJ
cord-001824-7c37elh6	94	3	differences	difference	NNS
cord-001824-7c37elh6	94	4	between	between	IN
cord-001824-7c37elh6	94	5	wild	wild	JJ
cord-001824-7c37elh6	94	6	type	type	NN
cord-001824-7c37elh6	94	7	and	and	CC
cord-001824-7c37elh6	94	8	mutant	mutant	NN
cord-001824-7c37elh6	94	9	were	be	VBD
cord-001824-7c37elh6	94	10	determined	determine	VBN
cord-001824-7c37elh6	94	11	by	by	IN
cord-001824-7c37elh6	94	12	two	two	CD
cord-001824-7c37elh6	94	13	-	-	HYPH
cord-001824-7c37elh6	94	14	tail	tail	NN
cord-001824-7c37elh6	94	15	t	t	NN
cord-001824-7c37elh6	94	16	-	-	HYPH
cord-001824-7c37elh6	94	17	test	test	NN
cord-001824-7c37elh6	94	18	.	.	.
cord-001824-7c37elh6	95	1	Three	three	CD
cord-001824-7c37elh6	95	2	transformants	transformant	NNS
cord-001824-7c37elh6	95	3	of	of	IN
cord-001824-7c37elh6	95	4	each	each	DT
cord-001824-7c37elh6	95	5	Ty1	ty1	CD
cord-001824-7c37elh6	95	6	assay	assay	NN
cord-001824-7c37elh6	95	7	construct	construct	NN
cord-001824-7c37elh6	95	8	(	(	-LRB-
cord-001824-7c37elh6	95	9	biological	biological	JJ
cord-001824-7c37elh6	95	10	replicates	replicate	NNS
cord-001824-7c37elh6	95	11	)	)	-RRB-
cord-001824-7c37elh6	95	12	were	be	VBD
cord-001824-7c37elh6	95	13	grown	grow	VBN
cord-001824-7c37elh6	95	14	in	in	IN
cord-001824-7c37elh6	95	15	SC	SC	NNP
cord-001824-7c37elh6	95	16	-	-	HYPH
cord-001824-7c37elh6	95	17	Ura	Ura	NNP
cord-001824-7c37elh6	95	18	to	to	TO
cord-001824-7c37elh6	95	19	OD	OD	NNP
cord-001824-7c37elh6	95	20	600	600	CD
cord-001824-7c37elh6	95	21	≈0.5	≈0.5	CD
cord-001824-7c37elh6	95	22	and	and	CC
cord-001824-7c37elh6	95	23	20	20	CD
cord-001824-7c37elh6	95	24	OD	OD	NNP
cord-001824-7c37elh6	95	25	600	600	CD
cord-001824-7c37elh6	95	26	-units	-units	:
cord-001824-7c37elh6	95	27	were	be	VBD
cord-001824-7c37elh6	95	28	collected	collect	VBN
cord-001824-7c37elh6	95	29	and	and	CC
cord-001824-7c37elh6	95	30	kept	keep	VBN
cord-001824-7c37elh6	95	31	at	at	IN
cord-001824-7c37elh6	95	32	-20	-20	.
cord-001824-7c37elh6	96	1	•	•	NNP
cord-001824-7c37elh6	96	2	C.	C.	NNP
cord-001824-7c37elh6	97	1	For	for	IN
cord-001824-7c37elh6	97	2	each	each	DT
cord-001824-7c37elh6	97	3	transformant	transformant	NN
cord-001824-7c37elh6	97	4	,	,	,
cord-001824-7c37elh6	97	5	␤	␤	IN
cord-001824-7c37elh6	97	6	-galactosidase	-galactosidase	CD
cord-001824-7c37elh6	97	7	measurements	measurement	NNS
cord-001824-7c37elh6	97	8	were	be	VBD
cord-001824-7c37elh6	97	9	done	do	VBN
cord-001824-7c37elh6	97	10	three	three	CD
cord-001824-7c37elh6	97	11	times	time	NNS
cord-001824-7c37elh6	97	12	(	(	-LRB-
cord-001824-7c37elh6	97	13	technical	technical	JJ
cord-001824-7c37elh6	97	14	replicates	replicate	NNS
cord-001824-7c37elh6	97	15	)	)	-RRB-
cord-001824-7c37elh6	97	16	.	.	.
cord-001824-7c37elh6	98	1	␤	␤	.
cord-001824-7c37elh6	99	1	-galactosidase	-galactosidase	:
cord-001824-7c37elh6	99	2	activities	activity	NNS
cord-001824-7c37elh6	99	3	were	be	VBD
cord-001824-7c37elh6	99	4	determined	determine	VBN
cord-001824-7c37elh6	99	5	as	as	IN
cord-001824-7c37elh6	99	6	described	describe	VBN
cord-001824-7c37elh6	99	7	previously	previously	RB
cord-001824-7c37elh6	99	8	(	(	-LRB-
cord-001824-7c37elh6	99	9	39	39	CD
cord-001824-7c37elh6	99	10	)	)	-RRB-
cord-001824-7c37elh6	99	11	.	.	.
cord-001824-7c37elh6	100	1	Values	value	NNS
cord-001824-7c37elh6	100	2	of	of	IN
cord-001824-7c37elh6	100	3	the	the	DT
cord-001824-7c37elh6	100	4	biological	biological	JJ
cord-001824-7c37elh6	100	5	replicates	replicate	NNS
cord-001824-7c37elh6	100	6	were	be	VBD
cord-001824-7c37elh6	100	7	determined	determine	VBN
cord-001824-7c37elh6	100	8	by	by	IN
cord-001824-7c37elh6	100	9	taking	take	VBG
cord-001824-7c37elh6	100	10	the	the	DT
cord-001824-7c37elh6	100	11	median	median	NN
cord-001824-7c37elh6	100	12	of	of	IN
cord-001824-7c37elh6	100	13	the	the	DT
cord-001824-7c37elh6	100	14	technical	technical	JJ
cord-001824-7c37elh6	100	15	replicates	replicate	NNS
cord-001824-7c37elh6	100	16	.	.	.
cord-001824-7c37elh6	101	1	The	the	DT
cord-001824-7c37elh6	101	2	levels	level	NNS
cord-001824-7c37elh6	101	3	of	of	IN
cord-001824-7c37elh6	101	4	+1	+1	NN
cord-001824-7c37elh6	101	5	frameshifting	frameshifting	NN
cord-001824-7c37elh6	101	6	(	(	-LRB-
cord-001824-7c37elh6	101	7	%	%	NN
cord-001824-7c37elh6	101	8	)	)	-RRB-
cord-001824-7c37elh6	101	9	were	be	VBD
cord-001824-7c37elh6	101	10	determined	determine	VBN
cord-001824-7c37elh6	101	11	by	by	IN
cord-001824-7c37elh6	101	12	normalization	normalization	NN
cord-001824-7c37elh6	101	13	of	of	IN
cord-001824-7c37elh6	101	14	each	each	DT
cord-001824-7c37elh6	101	15	biological	biological	JJ
cord-001824-7c37elh6	101	16	test	test	NN
cord-001824-7c37elh6	101	17	replicate	replicate	VBP
cord-001824-7c37elh6	101	18	with	with	IN
cord-001824-7c37elh6	101	19	the	the	DT
cord-001824-7c37elh6	101	20	average	average	NN
cord-001824-7c37elh6	101	21	of	of	IN
cord-001824-7c37elh6	101	22	the	the	DT
cord-001824-7c37elh6	101	23	three	three	CD
cord-001824-7c37elh6	101	24	biological	biological	JJ
cord-001824-7c37elh6	101	25	replicates	replicate	NNS
cord-001824-7c37elh6	101	26	of	of	IN
cord-001824-7c37elh6	101	27	the	the	DT
cord-001824-7c37elh6	101	28	in	in	IN
cord-001824-7c37elh6	101	29	-	-	HYPH
cord-001824-7c37elh6	101	30	frame	frame	NN
cord-001824-7c37elh6	101	31	control	control	NN
cord-001824-7c37elh6	101	32	.	.	.
cord-001824-7c37elh6	102	1	The	the	DT
cord-001824-7c37elh6	102	2	significant	significant	JJ
cord-001824-7c37elh6	102	3	differences	difference	NNS
cord-001824-7c37elh6	102	4	between	between	IN
cord-001824-7c37elh6	102	5	wild	wild	JJ
cord-001824-7c37elh6	102	6	type	type	NN
cord-001824-7c37elh6	102	7	and	and	CC
cord-001824-7c37elh6	102	8	mutant	mutant	NN
cord-001824-7c37elh6	102	9	were	be	VBD
cord-001824-7c37elh6	102	10	determined	determine	VBN
cord-001824-7c37elh6	102	11	by	by	IN
cord-001824-7c37elh6	102	12	two	two	CD
cord-001824-7c37elh6	102	13	-	-	HYPH
cord-001824-7c37elh6	102	14	tail	tail	NN
cord-001824-7c37elh6	102	15	t	t	NN
cord-001824-7c37elh6	102	16	-	-	HYPH
cord-001824-7c37elh6	102	17	test	test	NN
cord-001824-7c37elh6	102	18	.	.	.
cord-001824-7c37elh6	103	1	To	to	TO
cord-001824-7c37elh6	103	2	analyze	analyze	VB
cord-001824-7c37elh6	103	3	the	the	DT
cord-001824-7c37elh6	103	4	role	role	NN
cord-001824-7c37elh6	103	5	of	of	IN
cord-001824-7c37elh6	103	6	wobble	wobble	NN
cord-001824-7c37elh6	103	7	uridine	uridine	NN
cord-001824-7c37elh6	103	8	modifications	modification	NNS
cord-001824-7c37elh6	103	9	ncm	ncm	NNP
cord-001824-7c37elh6	103	10	5	5	CD
cord-001824-7c37elh6	103	11	U	U	NNP
cord-001824-7c37elh6	103	12	,	,	,
cord-001824-7c37elh6	103	13	ncm	ncm	NNP
cord-001824-7c37elh6	103	14	5	5	CD
cord-001824-7c37elh6	104	1	Um	um	UH
cord-001824-7c37elh6	104	2	,	,	,
cord-001824-7c37elh6	104	3	mcm	mcm	NN
cord-001824-7c37elh6	104	4	5	5	CD
cord-001824-7c37elh6	104	5	U	U	NNP
cord-001824-7c37elh6	104	6	or	or	CC
cord-001824-7c37elh6	104	7	mcm	mcm	NNP
cord-001824-7c37elh6	104	8	5	5	CD
cord-001824-7c37elh6	104	9	s	s	NN
cord-001824-7c37elh6	104	10	2	2	CD
cord-001824-7c37elh6	104	11	U	u	NN
cord-001824-7c37elh6	104	12	in	in	IN
cord-001824-7c37elh6	104	13	reading	read	VBG
cord-001824-7c37elh6	104	14	frame	frame	NN
cord-001824-7c37elh6	104	15	maintenance	maintenance	NN
cord-001824-7c37elh6	104	16	,	,	,
cord-001824-7c37elh6	104	17	we	-PRON-	PRP
cord-001824-7c37elh6	104	18	used	use	VBD
cord-001824-7c37elh6	104	19	defined	define	VBN
cord-001824-7c37elh6	104	20	yeast	yeast	NN
cord-001824-7c37elh6	104	21	mutants	mutant	NNS
cord-001824-7c37elh6	104	22	unable	unable	JJ
cord-001824-7c37elh6	104	23	to	to	TO
cord-001824-7c37elh6	104	24	form	form	VB
cord-001824-7c37elh6	104	25	the	the	DT
cord-001824-7c37elh6	104	26	s	s	NNP
cord-001824-7c37elh6	104	27	2	2	CD
cord-001824-7c37elh6	104	28	Figure	Figure	NNP
cord-001824-7c37elh6	104	29	4	4	CD
cord-001824-7c37elh6	104	30	.	.	.
cord-001824-7c37elh6	105	1	(	(	-LRB-
cord-001824-7c37elh6	105	2	A	a	DT
cord-001824-7c37elh6	105	3	)	)	-RRB-
cord-001824-7c37elh6	105	4	Schematic	schematic	JJ
cord-001824-7c37elh6	105	5	drawing	drawing	NN
cord-001824-7c37elh6	105	6	of	of	IN
cord-001824-7c37elh6	105	7	the	the	DT
cord-001824-7c37elh6	105	8	dual	dual	JJ
cord-001824-7c37elh6	105	9	-	-	HYPH
cord-001824-7c37elh6	105	10	luciferase	luciferase	NN
cord-001824-7c37elh6	105	11	assay	assay	NN
cord-001824-7c37elh6	105	12	system	system	NN
cord-001824-7c37elh6	105	13	.	.	.
cord-001824-7c37elh6	106	1	Transcription	transcription	NN
cord-001824-7c37elh6	106	2	of	of	IN
cord-001824-7c37elh6	106	3	the	the	DT
cord-001824-7c37elh6	106	4	genes	gene	NNS
cord-001824-7c37elh6	106	5	encoding	encode	VBG
cord-001824-7c37elh6	106	6	the	the	DT
cord-001824-7c37elh6	106	7	Renilla	Renilla	NNP
cord-001824-7c37elh6	106	8	-	-	:
cord-001824-7c37elh6	106	9	and	and	CC
cord-001824-7c37elh6	106	10	Firefly	Firefly	NNP
cord-001824-7c37elh6	106	11	-	-	HYPH
cord-001824-7c37elh6	106	12	luciferase	luciferase	NNP
cord-001824-7c37elh6	106	13	is	be	VBZ
cord-001824-7c37elh6	106	14	under	under	IN
cord-001824-7c37elh6	106	15	the	the	DT
cord-001824-7c37elh6	106	16	ADH1	ADH1	NNP
cord-001824-7c37elh6	106	17	promoter	promoter	NN
cord-001824-7c37elh6	106	18	and	and	CC
cord-001824-7c37elh6	106	19	terminated	terminate	VBN
cord-001824-7c37elh6	106	20	by	by	IN
cord-001824-7c37elh6	106	21	CYC1	cyc1	CD
cord-001824-7c37elh6	106	22	terminator	terminator	NN
cord-001824-7c37elh6	106	23	.	.	.
cord-001824-7c37elh6	107	1	Frameshift	frameshift	NN
cord-001824-7c37elh6	107	2	sites	site	NNS
cord-001824-7c37elh6	107	3	were	be	VBD
cord-001824-7c37elh6	107	4	cloned	clone	VBN
cord-001824-7c37elh6	107	5	between	between	IN
cord-001824-7c37elh6	107	6	the	the	DT
cord-001824-7c37elh6	107	7	luciferase	luciferase	NN
cord-001824-7c37elh6	107	8	genes	gene	NNS
cord-001824-7c37elh6	107	9	and	and	CC
cord-001824-7c37elh6	107	10	expression	expression	NN
cord-001824-7c37elh6	107	11	of	of	IN
cord-001824-7c37elh6	107	12	the	the	DT
cord-001824-7c37elh6	107	13	Firefly	Firefly	NNP
cord-001824-7c37elh6	107	14	luciferase	luciferase	NN
cord-001824-7c37elh6	107	15	gene	gene	NN
cord-001824-7c37elh6	107	16	requires	require	VBZ
cord-001824-7c37elh6	107	17	+1	+1	NNP
cord-001824-7c37elh6	107	18	frameshifting	frameshifting	NN
cord-001824-7c37elh6	107	19	.	.	.
cord-001824-7c37elh6	108	1	The	the	DT
cord-001824-7c37elh6	108	2	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	108	3	site	site	NN
cord-001824-7c37elh6	108	4	is	be	VBZ
cord-001824-7c37elh6	108	5	as	as	IN
cord-001824-7c37elh6	108	6	follows	follow	VBZ
cord-001824-7c37elh6	108	7	:	:	:
cord-001824-7c37elh6	109	1	XXX	XXX	NNP
cord-001824-7c37elh6	109	2	-	-	HYPH
cord-001824-7c37elh6	109	3	slippery	slippery	JJ
cord-001824-7c37elh6	109	4	site	site	NN
cord-001824-7c37elh6	109	5	,	,	,
cord-001824-7c37elh6	109	6	NNN	nnn	NN
cord-001824-7c37elh6	109	7	-	-	HYPH
cord-001824-7c37elh6	109	8	assay	assay	NN
cord-001824-7c37elh6	109	9	codon	codon	NN
cord-001824-7c37elh6	109	10	and	and	CC
cord-001824-7c37elh6	109	11	UAG	UAG	NNP
cord-001824-7c37elh6	109	12	-	-	HYPH
cord-001824-7c37elh6	109	13	stop	stop	NN
cord-001824-7c37elh6	109	14	codon	codon	NN
cord-001824-7c37elh6	109	15	(	(	-LRB-
cord-001824-7c37elh6	109	16	all	all	DT
cord-001824-7c37elh6	109	17	in	in	IN
cord-001824-7c37elh6	109	18	-	-	HYPH
cord-001824-7c37elh6	109	19	frame	frame	NN
cord-001824-7c37elh6	109	20	)	)	-RRB-
cord-001824-7c37elh6	109	21	.	.	.
cord-001824-7c37elh6	110	1	An	an	DT
cord-001824-7c37elh6	110	2	upstream	upstream	JJ
cord-001824-7c37elh6	110	3	stop	stop	NN
cord-001824-7c37elh6	110	4	codon	codon	NN
cord-001824-7c37elh6	110	5	(	(	-LRB-
cord-001824-7c37elh6	110	6	UAG	UAG	NNP
cord-001824-7c37elh6	110	7	)	)	-RRB-
cord-001824-7c37elh6	110	8	was	be	VBD
cord-001824-7c37elh6	110	9	placed	place	VBN
cord-001824-7c37elh6	110	10	in	in	IN
cord-001824-7c37elh6	110	11	the	the	DT
cord-001824-7c37elh6	110	12	+1	+1	HYPH
cord-001824-7c37elh6	110	13	frame	frame	NN
cord-001824-7c37elh6	110	14	to	to	TO
cord-001824-7c37elh6	110	15	eliminate	eliminate	VB
cord-001824-7c37elh6	110	16	frameshifting	frameshifting	JJ
cord-001824-7c37elh6	110	17	events	event	NNS
cord-001824-7c37elh6	110	18	occurring	occur	VBG
cord-001824-7c37elh6	110	19	before	before	IN
cord-001824-7c37elh6	110	20	the	the	DT
cord-001824-7c37elh6	110	21	assay	assay	NN
cord-001824-7c37elh6	110	22	site	site	NN
cord-001824-7c37elh6	110	23	.	.	.
cord-001824-7c37elh6	111	1	The	the	DT
cord-001824-7c37elh6	111	2	frame	frame	NN
cord-001824-7c37elh6	111	3	of	of	IN
cord-001824-7c37elh6	111	4	the	the	DT
cord-001824-7c37elh6	111	5	different	different	JJ
cord-001824-7c37elh6	111	6	luciferase	luciferase	NN
cord-001824-7c37elh6	111	7	genes	gene	NNS
cord-001824-7c37elh6	111	8	is	be	VBZ
cord-001824-7c37elh6	111	9	indicated	indicate	VBN
cord-001824-7c37elh6	111	10	.	.	.
cord-001824-7c37elh6	112	1	In	in	IN
cord-001824-7c37elh6	112	2	the	the	DT
cord-001824-7c37elh6	112	3	in	in	IN
cord-001824-7c37elh6	112	4	-	-	HYPH
cord-001824-7c37elh6	112	5	frame	frame	NN
cord-001824-7c37elh6	112	6	control	control	NN
cord-001824-7c37elh6	112	7	construct	construct	NN
cord-001824-7c37elh6	112	8	,	,	,
cord-001824-7c37elh6	112	9	Renilla	Renilla	NNP
cord-001824-7c37elh6	112	10	-	-	:
cord-001824-7c37elh6	112	11	and	and	CC
cord-001824-7c37elh6	112	12	Firefly	Firefly	NNP
cord-001824-7c37elh6	112	13	-	-	HYPH
cord-001824-7c37elh6	112	14	luciferase	luciferase	NN
cord-001824-7c37elh6	112	15	genes	gene	NNS
cord-001824-7c37elh6	112	16	are	be	VBP
cord-001824-7c37elh6	112	17	in	in	IN
cord-001824-7c37elh6	112	18	-	-	HYPH
cord-001824-7c37elh6	112	19	frame	frame	NN
cord-001824-7c37elh6	112	20	.	.	.
cord-001824-7c37elh6	113	1	(	(	-LRB-
cord-001824-7c37elh6	113	2	B	b	NN
cord-001824-7c37elh6	113	3	)	)	-RRB-
cord-001824-7c37elh6	113	4	Schematic	schematic	JJ
cord-001824-7c37elh6	113	5	drawing	drawing	NN
cord-001824-7c37elh6	113	6	of	of	IN
cord-001824-7c37elh6	113	7	the	the	DT
cord-001824-7c37elh6	113	8	Ty1	ty1	CD
cord-001824-7c37elh6	113	9	assay	assay	NN
cord-001824-7c37elh6	113	10	system	system	NN
cord-001824-7c37elh6	113	11	.	.	.
cord-001824-7c37elh6	114	1	Transcription	transcription	NN
cord-001824-7c37elh6	114	2	from	from	IN
cord-001824-7c37elh6	114	3	HIS4	HIS4	NNP
cord-001824-7c37elh6	114	4	promoter	promoter	NN
cord-001824-7c37elh6	114	5	generates	generate	VBZ
cord-001824-7c37elh6	114	6	a	a	DT
cord-001824-7c37elh6	114	7	transcript	transcript	NN
cord-001824-7c37elh6	114	8	containing	contain	VBG
cord-001824-7c37elh6	114	9	the	the	DT
cord-001824-7c37elh6	114	10	first	first	JJ
cord-001824-7c37elh6	114	11	100	100	CD
cord-001824-7c37elh6	114	12	nucleotides	nucleotide	NNS
cord-001824-7c37elh6	114	13	of	of	IN
cord-001824-7c37elh6	114	14	the	the	DT
cord-001824-7c37elh6	114	15	HIS4	HIS4	NNP
cord-001824-7c37elh6	114	16	gene	gene	NN
cord-001824-7c37elh6	114	17	in	in	IN
cord-001824-7c37elh6	114	18	the	the	DT
cord-001824-7c37elh6	114	19	in	in	IN
cord-001824-7c37elh6	114	20	-	-	HYPH
cord-001824-7c37elh6	114	21	frame	frame	NN
cord-001824-7c37elh6	114	22	and	and	CC
cord-001824-7c37elh6	114	23	the	the	DT
cord-001824-7c37elh6	114	24	lacZ	lacZ	NNP
cord-001824-7c37elh6	114	25	gene	gene	NN
cord-001824-7c37elh6	114	26	of	of	IN
cord-001824-7c37elh6	114	27	Escherichia	Escherichia	NNP
cord-001824-7c37elh6	114	28	coli	coli	NNS
cord-001824-7c37elh6	114	29	in	in	IN
cord-001824-7c37elh6	114	30	the	the	DT
cord-001824-7c37elh6	114	31	+1	+1	HYPH
cord-001824-7c37elh6	114	32	frame	frame	NN
cord-001824-7c37elh6	114	33	.	.	.
cord-001824-7c37elh6	115	1	Expression	expression	NN
cord-001824-7c37elh6	115	2	of	of	IN
cord-001824-7c37elh6	115	3	the	the	DT
cord-001824-7c37elh6	115	4	lacZ	lacZ	NNP
cord-001824-7c37elh6	115	5	gene	gene	NN
cord-001824-7c37elh6	115	6	is	be	VBZ
cord-001824-7c37elh6	115	7	dependent	dependent	JJ
cord-001824-7c37elh6	115	8	on	on	IN
cord-001824-7c37elh6	115	9	a	a	DT
cord-001824-7c37elh6	115	10	+1	+1	HYPH
cord-001824-7c37elh6	115	11	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	115	12	frameshift	frameshift	NN
cord-001824-7c37elh6	115	13	event	event	NN
cord-001824-7c37elh6	115	14	taking	take	VBG
cord-001824-7c37elh6	115	15	place	place	NN
cord-001824-7c37elh6	115	16	within	within	IN
cord-001824-7c37elh6	115	17	Ty1	ty1	JJ
cord-001824-7c37elh6	115	18	sequence	sequence	NN
cord-001824-7c37elh6	115	19	.	.	.
cord-001824-7c37elh6	116	1	An	an	DT
cord-001824-7c37elh6	116	2	upstream	upstream	JJ
cord-001824-7c37elh6	116	3	stop	stop	NN
cord-001824-7c37elh6	116	4	codon	codon	NN
cord-001824-7c37elh6	116	5	(	(	-LRB-
cord-001824-7c37elh6	116	6	UGA	UGA	NNP
cord-001824-7c37elh6	116	7	)	)	-RRB-
cord-001824-7c37elh6	116	8	was	be	VBD
cord-001824-7c37elh6	116	9	placed	place	VBN
cord-001824-7c37elh6	116	10	in	in	IN
cord-001824-7c37elh6	116	11	the	the	DT
cord-001824-7c37elh6	116	12	+1	+1	HYPH
cord-001824-7c37elh6	116	13	reading	reading	NN
cord-001824-7c37elh6	116	14	frame	frame	NN
cord-001824-7c37elh6	116	15	to	to	TO
cord-001824-7c37elh6	116	16	eliminate	eliminate	VB
cord-001824-7c37elh6	116	17	frameshifting	frameshifting	JJ
cord-001824-7c37elh6	116	18	events	event	NNS
cord-001824-7c37elh6	116	19	occurring	occur	VBG
cord-001824-7c37elh6	116	20	before	before	IN
cord-001824-7c37elh6	116	21	the	the	DT
cord-001824-7c37elh6	116	22	assay	assay	NN
cord-001824-7c37elh6	116	23	site	site	NN
cord-001824-7c37elh6	116	24	.	.	.
cord-001824-7c37elh6	117	1	In	in	IN
cord-001824-7c37elh6	117	2	the	the	DT
cord-001824-7c37elh6	117	3	in	in	IN
cord-001824-7c37elh6	117	4	-	-	HYPH
cord-001824-7c37elh6	117	5	frame	frame	NN
cord-001824-7c37elh6	117	6	control	control	NN
cord-001824-7c37elh6	117	7	construct	construct	NN
cord-001824-7c37elh6	117	8	,	,	,
cord-001824-7c37elh6	117	9	the	the	DT
cord-001824-7c37elh6	117	10	first	first	JJ
cord-001824-7c37elh6	117	11	100	100	CD
cord-001824-7c37elh6	117	12	nucleotides	nucleotide	NNS
cord-001824-7c37elh6	117	13	of	of	IN
cord-001824-7c37elh6	117	14	the	the	DT
cord-001824-7c37elh6	117	15	HIS4	HIS4	NNP
cord-001824-7c37elh6	117	16	gene	gene	NN
cord-001824-7c37elh6	117	17	and	and	CC
cord-001824-7c37elh6	117	18	lacZ	lacZ	NNP
cord-001824-7c37elh6	117	19	gene	gene	NN
cord-001824-7c37elh6	117	20	are	be	VBP
cord-001824-7c37elh6	117	21	in	in	IN
cord-001824-7c37elh6	117	22	-	-	HYPH
cord-001824-7c37elh6	117	23	frame	frame	NN
cord-001824-7c37elh6	117	24	.	.	.
cord-001824-7c37elh6	118	1	group	group	NN
cord-001824-7c37elh6	118	2	(	(	-LRB-
cord-001824-7c37elh6	118	3	tuc1Δ	tuc1δ	CD
cord-001824-7c37elh6	118	4	;	;	:
cord-001824-7c37elh6	118	5	also	also	RB
cord-001824-7c37elh6	118	6	denoted	denote	VBN
cord-001824-7c37elh6	118	7	as	as	IN
cord-001824-7c37elh6	118	8	ncs6Δ	ncs6Δ	NNP
cord-001824-7c37elh6	118	9	)	)	-RRB-
cord-001824-7c37elh6	118	10	,	,	,
cord-001824-7c37elh6	118	11	the	the	DT
cord-001824-7c37elh6	118	12	ncm	ncm	NNP
cord-001824-7c37elh6	118	13	5	5	CD
cord-001824-7c37elh6	118	14	or	or	CC
cord-001824-7c37elh6	118	15	mcm	mcm	NNP
cord-001824-7c37elh6	118	16	5	5	CD
cord-001824-7c37elh6	118	17	groups	group	NNS
cord-001824-7c37elh6	118	18	(	(	-LRB-
cord-001824-7c37elh6	118	19	elp3Δ	elp3δ	UH
cord-001824-7c37elh6	118	20	)	)	-RRB-
cord-001824-7c37elh6	118	21	or	or	CC
cord-001824-7c37elh6	118	22	the	the	DT
cord-001824-7c37elh6	118	23	esterified	esterify	VBN
cord-001824-7c37elh6	118	24	methyl	methyl	NN
cord-001824-7c37elh6	118	25	group	group	NN
cord-001824-7c37elh6	118	26	(	(	-LRB-
cord-001824-7c37elh6	118	27	trm9Δ	trm9Δ	NNP
cord-001824-7c37elh6	118	28	)	)	-RRB-
cord-001824-7c37elh6	118	29	of	of	IN
cord-001824-7c37elh6	118	30	the	the	DT
cord-001824-7c37elh6	118	31	mcm	mcm	NNP
cord-001824-7c37elh6	118	32	5	5	CD
cord-001824-7c37elh6	118	33	side	side	NN
cord-001824-7c37elh6	118	34	chain	chain	NN
cord-001824-7c37elh6	118	35	.	.	.
cord-001824-7c37elh6	119	1	The	the	DT
cord-001824-7c37elh6	119	2	ribosomal	ribosomal	NN
cord-001824-7c37elh6	119	3	+1	+1	XX
cord-001824-7c37elh6	119	4	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	119	5	assay	assay	NN
cord-001824-7c37elh6	119	6	system	system	NN
cord-001824-7c37elh6	119	7	used	use	VBD
cord-001824-7c37elh6	119	8	contains	contain	VBZ
cord-001824-7c37elh6	119	9	a	a	DT
cord-001824-7c37elh6	119	10	Renilla	Renilla	NNP
cord-001824-7c37elh6	119	11	luciferase	luciferase	NN
cord-001824-7c37elh6	119	12	(	(	-LRB-
cord-001824-7c37elh6	119	13	R	r	NN
cord-001824-7c37elh6	119	14	-	-	HYPH
cord-001824-7c37elh6	119	15	luc)/	luc)/	JJ
cord-001824-7c37elh6	119	16	Firefly	Firefly	NNP
cord-001824-7c37elh6	119	17	luciferase	luciferase	NN
cord-001824-7c37elh6	119	18	(	(	-LRB-
cord-001824-7c37elh6	119	19	F	F	NNP
cord-001824-7c37elh6	119	20	-	-	HYPH
cord-001824-7c37elh6	119	21	luc	luc	NNP
cord-001824-7c37elh6	119	22	)	)	-RRB-
cord-001824-7c37elh6	120	1	bicistronic	bicistronic	NNP
cord-001824-7c37elh6	120	2	reporter	reporter	NN
cord-001824-7c37elh6	120	3	system	system	NN
cord-001824-7c37elh6	120	4	(	(	-LRB-
cord-001824-7c37elh6	120	5	Figure	figure	NN
cord-001824-7c37elh6	120	6	4A	4a	CD
cord-001824-7c37elh6	120	7	)	)	-RRB-
cord-001824-7c37elh6	120	8	(	(	-LRB-
cord-001824-7c37elh6	120	9	see	see	VB
cord-001824-7c37elh6	120	10	Material	Material	NNP
cord-001824-7c37elh6	120	11	and	and	CC
cord-001824-7c37elh6	120	12	Methods	Methods	NNPS
cord-001824-7c37elh6	120	13	)	)	-RRB-
cord-001824-7c37elh6	120	14	(	(	-LRB-
cord-001824-7c37elh6	120	15	40	40	CD
cord-001824-7c37elh6	120	16	)	)	-RRB-
cord-001824-7c37elh6	120	17	.	.	.
cord-001824-7c37elh6	121	1	This	this	DT
cord-001824-7c37elh6	121	2	bicistronic	bicistronic	JJ
cord-001824-7c37elh6	121	3	mRNA	mrna	NN
cord-001824-7c37elh6	121	4	synthesizes	synthesize	VBZ
cord-001824-7c37elh6	121	5	a	a	DT
cord-001824-7c37elh6	121	6	two	two	CD
cord-001824-7c37elh6	121	7	domain	domain	NN
cord-001824-7c37elh6	121	8	protein	protein	NN
cord-001824-7c37elh6	121	9	with	with	IN
cord-001824-7c37elh6	121	10	the	the	DT
cord-001824-7c37elh6	121	11	indicated	indicate	VBN
cord-001824-7c37elh6	121	12	enzymatic	enzymatic	JJ
cord-001824-7c37elh6	121	13	activities	activity	NNS
cord-001824-7c37elh6	121	14	.	.	.
cord-001824-7c37elh6	122	1	To	to	TO
cord-001824-7c37elh6	122	2	analyze	analyze	VB
cord-001824-7c37elh6	122	3	a	a	DT
cord-001824-7c37elh6	122	4	+1	+1	NN
cord-001824-7c37elh6	122	5	frameshift	frameshift	NN
cord-001824-7c37elh6	122	6	event	event	NN
cord-001824-7c37elh6	122	7	a	a	DT
cord-001824-7c37elh6	122	8	sequence	sequence	NN
cord-001824-7c37elh6	122	9	is	be	VBZ
cord-001824-7c37elh6	122	10	introduced	introduce	VBN
cord-001824-7c37elh6	122	11	between	between	IN
cord-001824-7c37elh6	122	12	these	these	DT
cord-001824-7c37elh6	122	13	two	two	CD
cord-001824-7c37elh6	122	14	cistrons	cistron	NNS
cord-001824-7c37elh6	122	15	in	in	IN
cord-001824-7c37elh6	122	16	such	such	PDT
cord-001824-7c37elh6	122	17	a	a	DT
cord-001824-7c37elh6	122	18	way	way	NN
cord-001824-7c37elh6	122	19	that	that	DT
cord-001824-7c37elh6	122	20	translation	translation	NN
cord-001824-7c37elh6	122	21	of	of	IN
cord-001824-7c37elh6	122	22	Rluc	Rluc	NNP
cord-001824-7c37elh6	122	23	is	be	VBZ
cord-001824-7c37elh6	122	24	in	in	IN
cord-001824-7c37elh6	122	25	the	the	DT
cord-001824-7c37elh6	122	26	0	0	CD
cord-001824-7c37elh6	122	27	frame	frame	NN
cord-001824-7c37elh6	122	28	and	and	CC
cord-001824-7c37elh6	122	29	the	the	DT
cord-001824-7c37elh6	122	30	F	F	NNP
cord-001824-7c37elh6	122	31	-	-	HYPH
cord-001824-7c37elh6	122	32	luc	luc	NNP
cord-001824-7c37elh6	122	33	is	be	VBZ
cord-001824-7c37elh6	122	34	in	in	IN
cord-001824-7c37elh6	122	35	the	the	DT
cord-001824-7c37elh6	122	36	+1	+1	HYPH
cord-001824-7c37elh6	122	37	frame	frame	NN
cord-001824-7c37elh6	122	38	(	(	-LRB-
cord-001824-7c37elh6	122	39	Figure	figure	NN
cord-001824-7c37elh6	122	40	 	 	_SP
cord-001824-7c37elh6	122	41	4A	4a	CD
cord-001824-7c37elh6	122	42	)	)	-RRB-
cord-001824-7c37elh6	122	43	.	.	.
cord-001824-7c37elh6	123	1	To	to	TO
cord-001824-7c37elh6	123	2	obtain	obtain	VB
cord-001824-7c37elh6	123	3	F	F	NNP
cord-001824-7c37elh6	123	4	-	-	HYPH
cord-001824-7c37elh6	123	5	luc	luc	NNP
cord-001824-7c37elh6	123	6	activity	activity	NN
cord-001824-7c37elh6	123	7	the	the	DT
cord-001824-7c37elh6	123	8	ribosome	ribosome	NN
cord-001824-7c37elh6	123	9	must	must	MD
cord-001824-7c37elh6	123	10	shift	shift	VB
cord-001824-7c37elh6	123	11	into	into	IN
cord-001824-7c37elh6	123	12	the	the	DT
cord-001824-7c37elh6	123	13	+1	+1	HYPH
cord-001824-7c37elh6	123	14	frame	frame	NN
cord-001824-7c37elh6	123	15	before	before	IN
cord-001824-7c37elh6	123	16	entering	enter	VBG
cord-001824-7c37elh6	123	17	the	the	DT
cord-001824-7c37elh6	123	18	F	F	NNP
cord-001824-7c37elh6	123	19	-	-	HYPH
cord-001824-7c37elh6	123	20	luc	luc	NNP
cord-001824-7c37elh6	123	21	gene	gene	NN
cord-001824-7c37elh6	123	22	.	.	.
cord-001824-7c37elh6	124	1	The	the	DT
cord-001824-7c37elh6	124	2	inserted	insert	VBN
cord-001824-7c37elh6	124	3	sequence	sequence	NN
cord-001824-7c37elh6	124	4	between	between	IN
cord-001824-7c37elh6	124	5	the	the	DT
cord-001824-7c37elh6	124	6	R	R	NNP
cord-001824-7c37elh6	124	7	-	-	HYPH
cord-001824-7c37elh6	124	8	luc	luc	NNP
cord-001824-7c37elh6	124	9	and	and	CC
cord-001824-7c37elh6	124	10	the	the	DT
cord-001824-7c37elh6	124	11	F	F	NNP
cord-001824-7c37elh6	124	12	-	-	HYPH
cord-001824-7c37elh6	124	13	luc	luc	NNP
cord-001824-7c37elh6	124	14	reporter	reporter	NN
cord-001824-7c37elh6	124	15	genes	gene	NNS
cord-001824-7c37elh6	124	16	consists	consist	VBZ
cord-001824-7c37elh6	124	17	of	of	IN
cord-001824-7c37elh6	124	18	a	a	DT
cord-001824-7c37elh6	124	19	slippery	slippery	JJ
cord-001824-7c37elh6	124	20	codon	codon	NN
cord-001824-7c37elh6	124	21	(	(	-LRB-
cord-001824-7c37elh6	124	22	XXX	XXX	NNP
cord-001824-7c37elh6	124	23	)	)	-RRB-
cord-001824-7c37elh6	124	24	at	at	IN
cord-001824-7c37elh6	124	25	which	which	WDT
cord-001824-7c37elh6	124	26	the	the	DT
cord-001824-7c37elh6	124	27	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	124	28	-	-	HYPH
cord-001824-7c37elh6	124	29	tRNA	tRNA	NNP
cord-001824-7c37elh6	124	30	will	will	MD
cord-001824-7c37elh6	124	31	slip	slip	VB
cord-001824-7c37elh6	124	32	,	,	,
cord-001824-7c37elh6	124	33	the	the	DT
cord-001824-7c37elh6	124	34	codon	codon	NN
cord-001824-7c37elh6	124	35	to	to	TO
cord-001824-7c37elh6	124	36	be	be	VB
cord-001824-7c37elh6	124	37	assayed	assay	VBN
cord-001824-7c37elh6	124	38	for	for	IN
cord-001824-7c37elh6	124	39	A	a	DT
cord-001824-7c37elh6	124	40	-	-	HYPH
cord-001824-7c37elh6	124	41	site	site	NN
cord-001824-7c37elh6	124	42	selection	selection	NN
cord-001824-7c37elh6	124	43	(	(	-LRB-
cord-001824-7c37elh6	124	44	NNN	NNN	NNP
cord-001824-7c37elh6	124	45	)	)	-RRB-
cord-001824-7c37elh6	124	46	,	,	,
cord-001824-7c37elh6	124	47	followed	follow	VBN
cord-001824-7c37elh6	124	48	by	by	IN
cord-001824-7c37elh6	124	49	a	a	DT
cord-001824-7c37elh6	124	50	stop	stop	NN
cord-001824-7c37elh6	124	51	codon	codon	NN
cord-001824-7c37elh6	124	52	in	in	IN
cord-001824-7c37elh6	124	53	zero	zero	CD
cord-001824-7c37elh6	124	54	frame	frame	NN
cord-001824-7c37elh6	124	55	(	(	-LRB-
cord-001824-7c37elh6	124	56	UAG	UAG	NNP
cord-001824-7c37elh6	124	57	)	)	-RRB-
cord-001824-7c37elh6	124	58	(	(	-LRB-
cord-001824-7c37elh6	124	59	Figure	figure	NN
cord-001824-7c37elh6	124	60	4A	4a	CD
cord-001824-7c37elh6	124	61	)	)	-RRB-
cord-001824-7c37elh6	124	62	.	.	.
cord-001824-7c37elh6	125	1	To	to	TO
cord-001824-7c37elh6	125	2	terminate	terminate	VB
cord-001824-7c37elh6	125	3	all	all	DT
cord-001824-7c37elh6	125	4	ribosomes	ribosome	NNS
cord-001824-7c37elh6	125	5	that	that	WDT
cord-001824-7c37elh6	125	6	have	have	VBP
cord-001824-7c37elh6	125	7	accidentally	accidentally	RB
cord-001824-7c37elh6	125	8	slipped	slip	VBN
cord-001824-7c37elh6	125	9	into	into	IN
cord-001824-7c37elh6	125	10	the	the	DT
cord-001824-7c37elh6	125	11	+1	+1	HYPH
cord-001824-7c37elh6	125	12	frame	frame	NN
cord-001824-7c37elh6	125	13	upstream	upstream	IN
cord-001824-7c37elh6	125	14	the	the	DT
cord-001824-7c37elh6	125	15	slippery	slippery	JJ
cord-001824-7c37elh6	125	16	codon	codon	NN
cord-001824-7c37elh6	125	17	,	,	,
cord-001824-7c37elh6	125	18	a	a	DT
cord-001824-7c37elh6	125	19	stop	stop	NN
cord-001824-7c37elh6	125	20	codon	codon	NN
cord-001824-7c37elh6	125	21	was	be	VBD
cord-001824-7c37elh6	125	22	inserted	insert	VBN
cord-001824-7c37elh6	125	23	in	in	IN
cord-001824-7c37elh6	125	24	the	the	DT
cord-001824-7c37elh6	125	25	+1	+1	HYPH
cord-001824-7c37elh6	125	26	frame	frame	NN
cord-001824-7c37elh6	125	27	just	just	RB
cord-001824-7c37elh6	125	28	a	a	DT
cord-001824-7c37elh6	125	29	few	few	JJ
cord-001824-7c37elh6	125	30	nucleotides	nucleotide	NNS
cord-001824-7c37elh6	125	31	upstream	upstream	IN
cord-001824-7c37elh6	125	32	the	the	DT
cord-001824-7c37elh6	125	33	slippery	slippery	JJ
cord-001824-7c37elh6	125	34	codon	codon	NN
cord-001824-7c37elh6	126	1	(	(	-LRB-
cord-001824-7c37elh6	126	2	See	see	VB
cord-001824-7c37elh6	126	3	Figure	Figure	NNP
cord-001824-7c37elh6	126	4	4	4	CD
cord-001824-7c37elh6	126	5	)	)	-RRB-
cord-001824-7c37elh6	126	6	.	.	.
cord-001824-7c37elh6	127	1	Thus	thus	RB
cord-001824-7c37elh6	127	2	,	,	,
cord-001824-7c37elh6	127	3	to	to	TO
cord-001824-7c37elh6	127	4	obtain	obtain	VB
cord-001824-7c37elh6	127	5	F	F	NNP
cord-001824-7c37elh6	127	6	-	-	HYPH
cord-001824-7c37elh6	127	7	luc	luc	NNP
cord-001824-7c37elh6	127	8	activity	activity	NN
cord-001824-7c37elh6	127	9	a	a	DT
cord-001824-7c37elh6	127	10	+1	+1	XX
cord-001824-7c37elh6	127	11	frameshift	frameshift	NN
cord-001824-7c37elh6	127	12	must	must	MD
cord-001824-7c37elh6	127	13	occur	occur	VB
cord-001824-7c37elh6	127	14	at	at	IN
cord-001824-7c37elh6	127	15	the	the	DT
cord-001824-7c37elh6	127	16	+1	+1	XX
cord-001824-7c37elh6	127	17	frameshift	frameshift	NN
cord-001824-7c37elh6	127	18	sequence	sequence	NN
cord-001824-7c37elh6	127	19	upstream	upstream	RB
cord-001824-7c37elh6	127	20	of	of	IN
cord-001824-7c37elh6	127	21	the	the	DT
cord-001824-7c37elh6	127	22	stop	stop	NN
cord-001824-7c37elh6	127	23	codon	codon	NN
cord-001824-7c37elh6	127	24	in	in	IN
cord-001824-7c37elh6	127	25	the	the	DT
cord-001824-7c37elh6	127	26	zero	zero	CD
cord-001824-7c37elh6	127	27	frame	frame	NN
cord-001824-7c37elh6	127	28	.	.	.
cord-001824-7c37elh6	128	1	This	this	DT
cord-001824-7c37elh6	128	2	construct	construct	VB
cord-001824-7c37elh6	128	3	results	result	NNS
cord-001824-7c37elh6	128	4	in	in	IN
cord-001824-7c37elh6	128	5	a	a	DT
cord-001824-7c37elh6	128	6	very	very	RB
cord-001824-7c37elh6	128	7	short	short	JJ
cord-001824-7c37elh6	128	8	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	128	9	window	window	NN
cord-001824-7c37elh6	128	10	between	between	IN
cord-001824-7c37elh6	128	11	the	the	DT
cord-001824-7c37elh6	128	12	upstream	upstream	JJ
cord-001824-7c37elh6	128	13	stop	stop	NN
cord-001824-7c37elh6	128	14	codon	codon	NN
cord-001824-7c37elh6	128	15	in	in	IN
cord-001824-7c37elh6	128	16	the	the	DT
cord-001824-7c37elh6	128	17	+1	+1	HYPH
cord-001824-7c37elh6	128	18	frame	frame	NN
cord-001824-7c37elh6	128	19	and	and	CC
cord-001824-7c37elh6	128	20	the	the	DT
cord-001824-7c37elh6	128	21	downstream	downstream	NN
cord-001824-7c37elh6	128	22	in	in	IN
cord-001824-7c37elh6	128	23	-	-	HYPH
cord-001824-7c37elh6	128	24	frame	frame	NN
cord-001824-7c37elh6	128	25	stop	stop	NN
cord-001824-7c37elh6	128	26	codon	codon	NN
cord-001824-7c37elh6	128	27	.	.	.
cord-001824-7c37elh6	129	1	The	the	DT
cord-001824-7c37elh6	129	2	slippery	slippery	JJ
cord-001824-7c37elh6	129	3	codon	codon	NN
cord-001824-7c37elh6	129	4	is	be	VBZ
cord-001824-7c37elh6	129	5	determined	determine	VBN
cord-001824-7c37elh6	129	6	individually	individually	RB
cord-001824-7c37elh6	129	7	for	for	IN
cord-001824-7c37elh6	129	8	different	different	JJ
cord-001824-7c37elh6	129	9	assay	assay	NN
cord-001824-7c37elh6	129	10	sites	site	NNS
cord-001824-7c37elh6	129	11	in	in	IN
cord-001824-7c37elh6	129	12	order	order	NN
cord-001824-7c37elh6	129	13	to	to	TO
cord-001824-7c37elh6	129	14	optimize	optimize	VB
cord-001824-7c37elh6	129	15	the	the	DT
cord-001824-7c37elh6	129	16	slippage	slippage	NN
cord-001824-7c37elh6	129	17	of	of	IN
cord-001824-7c37elh6	129	18	the	the	DT
cord-001824-7c37elh6	129	19	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	129	20	tRNA	tRNA	NNP
cord-001824-7c37elh6	129	21	at	at	IN
cord-001824-7c37elh6	129	22	the	the	DT
cord-001824-7c37elh6	129	23	P	p	NN
cord-001824-7c37elh6	129	24	-	-	HYPH
cord-001824-7c37elh6	129	25	site	site	NN
cord-001824-7c37elh6	129	26	.	.	.
cord-001824-7c37elh6	130	1	We	-PRON-	PRP
cord-001824-7c37elh6	130	2	chose	choose	VBD
cord-001824-7c37elh6	130	3	UUU	UUU	NNP
cord-001824-7c37elh6	130	4	,	,	,
cord-001824-7c37elh6	130	5	CCC	CCC	NNP
cord-001824-7c37elh6	130	6	or	or	CC
cord-001824-7c37elh6	130	7	GGG	GGG	NNP
cord-001824-7c37elh6	130	8	codons	codon	NNS
cord-001824-7c37elh6	130	9	as	as	IN
cord-001824-7c37elh6	130	10	the	the	DT
cord-001824-7c37elh6	130	11	slippery	slippery	JJ
cord-001824-7c37elh6	130	12	codons	codon	NNS
cord-001824-7c37elh6	130	13	(	(	-LRB-
cord-001824-7c37elh6	130	14	Supplementary	supplementary	JJ
cord-001824-7c37elh6	130	15	Figure	Figure	NNP
cord-001824-7c37elh6	130	16	S1	S1	NNP
cord-001824-7c37elh6	130	17	and	and	CC
cord-001824-7c37elh6	130	18	Table	Table	NNP
cord-001824-7c37elh6	130	19	 	 	_SP
cord-001824-7c37elh6	130	20	2	2	CD
cord-001824-7c37elh6	130	21	and	and	CC
cord-001824-7c37elh6	130	22	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	130	23	Table	Table	NNP
cord-001824-7c37elh6	130	24	S1	S1	NNP
cord-001824-7c37elh6	130	25	)	)	-RRB-
cord-001824-7c37elh6	130	26	.	.	.
cord-001824-7c37elh6	131	1	Codon	Codon	NNP
cord-001824-7c37elh6	131	2	UUU	UUU	NNP
cord-001824-7c37elh6	131	3	is	be	VBZ
cord-001824-7c37elh6	131	4	decoded	decode	VBN
cord-001824-7c37elh6	131	5	by	by	IN
cord-001824-7c37elh6	131	6	tRNA	trna	NN
cord-001824-7c37elh6	131	7	Phe	Phe	NNP
cord-001824-7c37elh6	131	8	GAA	GAA	NNP
cord-001824-7c37elh6	131	9	,	,	,
cord-001824-7c37elh6	131	10	which	which	WDT
cord-001824-7c37elh6	131	11	has	have	VBZ
cord-001824-7c37elh6	131	12	the	the	DT
cord-001824-7c37elh6	131	13	wobble	wobble	NN
cord-001824-7c37elh6	131	14	nucleoside	nucleoside	RB
cord-001824-7c37elh6	132	1	Gm	Gm	NNP
cord-001824-7c37elh6	132	2	34	34	CD
cord-001824-7c37elh6	132	3	(	(	-LRB-
cord-001824-7c37elh6	132	4	42	42	CD
cord-001824-7c37elh6	132	5	)	)	-RRB-
cord-001824-7c37elh6	132	6	,	,	,
cord-001824-7c37elh6	132	7	and	and	CC
cord-001824-7c37elh6	132	8	its	-PRON-	PRP$
cord-001824-7c37elh6	132	9	structure	structure	NN
cord-001824-7c37elh6	132	10	is	be	VBZ
cord-001824-7c37elh6	132	11	not	not	RB
cord-001824-7c37elh6	132	12	affected	affect	VBN
cord-001824-7c37elh6	132	13	by	by	IN
cord-001824-7c37elh6	132	14	the	the	DT
cord-001824-7c37elh6	132	15	elp3	elp3	NN
cord-001824-7c37elh6	132	16	,	,	,
cord-001824-7c37elh6	132	17	tuc1	tuc1	IN
cord-001824-7c37elh6	132	18	or	or	CC
cord-001824-7c37elh6	132	19	trm9	trm9	NN
cord-001824-7c37elh6	132	20	mutations	mutation	NNS
cord-001824-7c37elh6	132	21	.	.	.
cord-001824-7c37elh6	133	1	Codon	Codon	NNP
cord-001824-7c37elh6	133	2	CCC	CCC	NNP
cord-001824-7c37elh6	133	3	is	be	VBZ
cord-001824-7c37elh6	133	4	read	read	VBN
cord-001824-7c37elh6	133	5	by	by	IN
cord-001824-7c37elh6	133	6	the	the	DT
cord-001824-7c37elh6	133	7	I	I	NNP
cord-001824-7c37elh6	133	8	34	34	CD
cord-001824-7c37elh6	133	9	(	(	-LRB-
cord-001824-7c37elh6	133	10	inosine	inosine	NNP
cord-001824-7c37elh6	133	11	)	)	-RRB-
cord-001824-7c37elh6	133	12	containing	contain	VBG
cord-001824-7c37elh6	133	13	tRNA	tRNA	NNP
cord-001824-7c37elh6	133	14	Pro	Pro	NNP
cord-001824-7c37elh6	133	15	IGG	IGG	NNP
cord-001824-7c37elh6	133	16	and	and	CC
cord-001824-7c37elh6	133	17	the	the	DT
cord-001824-7c37elh6	133	18	ncm	ncm	NNP
cord-001824-7c37elh6	133	19	5	5	CD
cord-001824-7c37elh6	133	20	U	U	NNP
cord-001824-7c37elh6	133	21	34	34	CD
cord-001824-7c37elh6	133	22	containing	contain	VBG
cord-001824-7c37elh6	133	23	tRNA	trna	NN
cord-001824-7c37elh6	133	24	Pro	pro	JJ
cord-001824-7c37elh6	133	25	ncm	ncm	NNP
cord-001824-7c37elh6	133	26	5	5	CD
cord-001824-7c37elh6	133	27	UGG	UGG	NNP
cord-001824-7c37elh6	133	28	and	and	CC
cord-001824-7c37elh6	133	29	the	the	DT
cord-001824-7c37elh6	133	30	slippery	slippery	JJ
cord-001824-7c37elh6	133	31	codon	codon	NN
cord-001824-7c37elh6	133	32	GGG	GGG	NNP
cord-001824-7c37elh6	133	33	is	be	VBZ
cord-001824-7c37elh6	133	34	read	read	VBN
cord-001824-7c37elh6	133	35	by	by	IN
cord-001824-7c37elh6	133	36	the	the	DT
cord-001824-7c37elh6	133	37	mcm	mcm	NNP
cord-001824-7c37elh6	133	38	5	5	CD
cord-001824-7c37elh6	133	39	U	U	NNP
cord-001824-7c37elh6	133	40	34	34	CD
cord-001824-7c37elh6	133	41	containing	contain	VBG
cord-001824-7c37elh6	133	42	tRNA	tRNA	NNP
cord-001824-7c37elh6	133	43	Gly	Gly	NNP
cord-001824-7c37elh6	133	44	mcm	mcm	NNP
cord-001824-7c37elh6	133	45	5	5	CD
cord-001824-7c37elh6	133	46	UCC	UCC	NNP
cord-001824-7c37elh6	133	47	and	and	CC
cord-001824-7c37elh6	133	48	the	the	DT
cord-001824-7c37elh6	133	49	C	C	NNP
cord-001824-7c37elh6	133	50	34	34	CD
cord-001824-7c37elh6	133	51	containing	contain	VBG
cord-001824-7c37elh6	133	52	tRNA	tRNA	NNP
cord-001824-7c37elh6	133	53	Gly	Gly	NNP
cord-001824-7c37elh6	133	54	CCC	CCC	NNP
cord-001824-7c37elh6	133	55	(	(	-LRB-
cord-001824-7c37elh6	133	56	Figure	figure	NN
cord-001824-7c37elh6	133	57	3	3	CD
cord-001824-7c37elh6	133	58	)	)	-RRB-
cord-001824-7c37elh6	133	59	(	(	-LRB-
cord-001824-7c37elh6	133	60	26	26	CD
cord-001824-7c37elh6	133	61	,	,	,
cord-001824-7c37elh6	133	62	30	30	CD
cord-001824-7c37elh6	133	63	,	,	,
cord-001824-7c37elh6	133	64	43	43	CD
cord-001824-7c37elh6	133	65	)	)	-RRB-
cord-001824-7c37elh6	133	66	.	.	.
cord-001824-7c37elh6	134	1	Note	note	VB
cord-001824-7c37elh6	134	2	that	that	IN
cord-001824-7c37elh6	134	3	the	the	DT
cord-001824-7c37elh6	134	4	structures	structure	NNS
cord-001824-7c37elh6	134	5	of	of	IN
cord-001824-7c37elh6	134	6	the	the	DT
cord-001824-7c37elh6	134	7	ncm	ncm	NNP
cord-001824-7c37elh6	134	8	5	5	CD
cord-001824-7c37elh6	134	9	U	U	NNP
cord-001824-7c37elh6	134	10	containing	contain	VBG
cord-001824-7c37elh6	134	11	tRNA	tRNA	NNP
cord-001824-7c37elh6	134	12	Pro	pro	JJ
cord-001824-7c37elh6	134	13	ncm	ncm	NNP
cord-001824-7c37elh6	134	14	5	5	CD
cord-001824-7c37elh6	134	15	UGG	UGG	NNP
cord-001824-7c37elh6	134	16	reading	read	VBG
cord-001824-7c37elh6	134	17	the	the	DT
cord-001824-7c37elh6	134	18	slippery	slippery	JJ
cord-001824-7c37elh6	134	19	codon	codon	NN
cord-001824-7c37elh6	134	20	CCC	CCC	NNP
cord-001824-7c37elh6	134	21	and	and	CC
cord-001824-7c37elh6	134	22	the	the	DT
cord-001824-7c37elh6	134	23	mcm	mcm	NNP
cord-001824-7c37elh6	134	24	5	5	CD
cord-001824-7c37elh6	134	25	U	U	NNP
cord-001824-7c37elh6	134	26	34	34	CD
cord-001824-7c37elh6	134	27	containing	contain	VBG
cord-001824-7c37elh6	134	28	tRNA	tRNA	NNP
cord-001824-7c37elh6	134	29	Gly	Gly	NNP
cord-001824-7c37elh6	134	30	mcm	mcm	NNP
cord-001824-7c37elh6	134	31	5	5	CD
cord-001824-7c37elh6	134	32	UCC	UCC	NNP
cord-001824-7c37elh6	134	33	reading	read	VBG
cord-001824-7c37elh6	134	34	the	the	DT
cord-001824-7c37elh6	134	35	slippery	slippery	JJ
cord-001824-7c37elh6	134	36	codon	codon	NN
cord-001824-7c37elh6	134	37	GGG	GGG	NNP
cord-001824-7c37elh6	134	38	are	be	VBP
cord-001824-7c37elh6	134	39	affected	affect	VBN
cord-001824-7c37elh6	134	40	by	by	IN
cord-001824-7c37elh6	134	41	the	the	DT
cord-001824-7c37elh6	134	42	elp3	elp3	NNP
cord-001824-7c37elh6	134	43	mutation	mutation	NN
cord-001824-7c37elh6	134	44	and	and	CC
cord-001824-7c37elh6	134	45	might	may	MD
cord-001824-7c37elh6	134	46	therefore	therefore	RB
cord-001824-7c37elh6	134	47	obscure	obscure	VB
cord-001824-7c37elh6	134	48	the	the	DT
cord-001824-7c37elh6	134	49	monitoring	monitoring	NN
cord-001824-7c37elh6	134	50	of	of	IN
cord-001824-7c37elh6	134	51	an	an	DT
cord-001824-7c37elh6	134	52	A	A	NNP
cord-001824-7c37elh6	134	53	-	-	HYPH
cord-001824-7c37elh6	134	54	site	site	NN
cord-001824-7c37elh6	134	55	effect	effect	NN
cord-001824-7c37elh6	134	56	at	at	IN
cord-001824-7c37elh6	134	57	these	these	DT
cord-001824-7c37elh6	134	58	test	test	NN
cord-001824-7c37elh6	134	59	codons	codon	NNS
cord-001824-7c37elh6	134	60	.	.	.
cord-001824-7c37elh6	135	1	These	these	DT
cord-001824-7c37elh6	135	2	issues	issue	NNS
cord-001824-7c37elh6	135	3	will	will	MD
cord-001824-7c37elh6	135	4	be	be	VB
cord-001824-7c37elh6	135	5	addressed	address	VBN
cord-001824-7c37elh6	135	6	below	below	RB
cord-001824-7c37elh6	135	7	.	.	.
cord-001824-7c37elh6	136	1	As	as	IN
cord-001824-7c37elh6	136	2	a	a	DT
cord-001824-7c37elh6	136	3	control	control	NN
cord-001824-7c37elh6	136	4	,	,	,
cord-001824-7c37elh6	136	5	we	-PRON-	PRP
cord-001824-7c37elh6	136	6	used	use	VBD
cord-001824-7c37elh6	136	7	a	a	DT
cord-001824-7c37elh6	136	8	construct	construct	NN
cord-001824-7c37elh6	136	9	carrying	carry	VBG
cord-001824-7c37elh6	136	10	the	the	DT
cord-001824-7c37elh6	136	11	R	R	NNP
cord-001824-7c37elh6	136	12	-	-	HYPH
cord-001824-7c37elh6	136	13	luc	luc	NNP
cord-001824-7c37elh6	136	14	and	and	CC
cord-001824-7c37elh6	136	15	F	F	NNP
cord-001824-7c37elh6	136	16	-	-	HYPH
cord-001824-7c37elh6	136	17	luc	luc	NNP
cord-001824-7c37elh6	136	18	genes	gene	NNS
cord-001824-7c37elh6	136	19	in	in	IN
cord-001824-7c37elh6	136	20	-	-	HYPH
cord-001824-7c37elh6	136	21	frame	frame	NN
cord-001824-7c37elh6	136	22	.	.	.
cord-001824-7c37elh6	137	1	By	by	IN
cord-001824-7c37elh6	137	2	dividing	divide	VBG
cord-001824-7c37elh6	137	3	the	the	DT
cord-001824-7c37elh6	137	4	ratio	ratio	NN
cord-001824-7c37elh6	137	5	of	of	IN
cord-001824-7c37elh6	137	6	F	F	NNP
cord-001824-7c37elh6	137	7	-	-	HYPH
cord-001824-7c37elh6	137	8	luc	luc	NNP
cord-001824-7c37elh6	137	9	/	/	SYM
cord-001824-7c37elh6	137	10	R	R	NNP
cord-001824-7c37elh6	137	11	-	-	HYPH
cord-001824-7c37elh6	137	12	luc	luc	NNP
cord-001824-7c37elh6	137	13	activities	activity	NNS
cord-001824-7c37elh6	137	14	generated	generate	VBN
cord-001824-7c37elh6	137	15	from	from	IN
cord-001824-7c37elh6	137	16	the	the	DT
cord-001824-7c37elh6	137	17	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	137	18	construct	construct	NN
cord-001824-7c37elh6	137	19	with	with	IN
cord-001824-7c37elh6	137	20	the	the	DT
cord-001824-7c37elh6	137	21	ratio	ratio	NN
cord-001824-7c37elh6	137	22	of	of	IN
cord-001824-7c37elh6	137	23	activities	activity	NNS
cord-001824-7c37elh6	137	24	from	from	IN
cord-001824-7c37elh6	137	25	the	the	DT
cord-001824-7c37elh6	137	26	F	F	NNP
cord-001824-7c37elh6	137	27	-	-	HYPH
cord-001824-7c37elh6	137	28	luc	luc	NNP
cord-001824-7c37elh6	137	29	/	/	SYM
cord-001824-7c37elh6	137	30	R	R	NNP
cord-001824-7c37elh6	137	31	-	-	HYPH
cord-001824-7c37elh6	137	32	luc	luc	NNP
cord-001824-7c37elh6	137	33	in	in	IN
cord-001824-7c37elh6	137	34	-	-	HYPH
cord-001824-7c37elh6	137	35	frame	frame	NN
cord-001824-7c37elh6	137	36	control	control	NN
cord-001824-7c37elh6	137	37	,	,	,
cord-001824-7c37elh6	137	38	the	the	DT
cord-001824-7c37elh6	137	39	level	level	NN
cord-001824-7c37elh6	137	40	of	of	IN
cord-001824-7c37elh6	137	41	frameshifting	frameshifting	NN
cord-001824-7c37elh6	137	42	was	be	VBD
cord-001824-7c37elh6	137	43	revealed	reveal	VBN
cord-001824-7c37elh6	137	44	.	.	.
cord-001824-7c37elh6	138	1	Using	use	VBG
cord-001824-7c37elh6	138	2	these	these	DT
cord-001824-7c37elh6	138	3	reporter	reporter	NN
cord-001824-7c37elh6	138	4	systems	system	NNS
cord-001824-7c37elh6	138	5	,	,	,
cord-001824-7c37elh6	138	6	the	the	DT
cord-001824-7c37elh6	138	7	level	level	NN
cord-001824-7c37elh6	138	8	of	of	IN
cord-001824-7c37elh6	138	9	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	138	10	for	for	IN
cord-001824-7c37elh6	138	11	specific	specific	JJ
cord-001824-7c37elh6	138	12	tRNA	tRNA	NNP
cord-001824-7c37elh6	138	13	isoacceptors	isoacceptor	NNS
cord-001824-7c37elh6	138	14	was	be	VBD
cord-001824-7c37elh6	138	15	investigated	investigate	VBN
cord-001824-7c37elh6	138	16	in	in	IN
cord-001824-7c37elh6	138	17	the	the	DT
cord-001824-7c37elh6	138	18	presence	presence	NN
cord-001824-7c37elh6	138	19	or	or	CC
cord-001824-7c37elh6	138	20	absence	absence	NN
cord-001824-7c37elh6	138	21	of	of	IN
cord-001824-7c37elh6	138	22	s	s	NNP
cord-001824-7c37elh6	138	23	2	2	CD
cord-001824-7c37elh6	138	24	,	,	,
cord-001824-7c37elh6	138	25	ncm	ncm	NNP
cord-001824-7c37elh6	138	26	5	5	CD
cord-001824-7c37elh6	138	27	,	,	,
cord-001824-7c37elh6	138	28	mcm	mcm	NNP
cord-001824-7c37elh6	138	29	5	5	CD
cord-001824-7c37elh6	138	30	groups	group	NNS
cord-001824-7c37elh6	138	31	or	or	CC
cord-001824-7c37elh6	138	32	the	the	DT
cord-001824-7c37elh6	138	33	esterified	esterify	VBN
cord-001824-7c37elh6	138	34	methyl	methyl	NN
cord-001824-7c37elh6	138	35	group	group	NN
cord-001824-7c37elh6	138	36	of	of	IN
cord-001824-7c37elh6	138	37	the	the	DT
cord-001824-7c37elh6	138	38	mcm	mcm	NNP
cord-001824-7c37elh6	138	39	5	5	CD
cord-001824-7c37elh6	138	40	side	side	NN
cord-001824-7c37elh6	138	41	chain	chain	NN
cord-001824-7c37elh6	138	42	at	at	IN
cord-001824-7c37elh6	138	43	U	U	NNP
cord-001824-7c37elh6	138	44	34	34	CD
cord-001824-7c37elh6	138	45	.	.	.
cord-001824-7c37elh6	139	1	In	in	IN
cord-001824-7c37elh6	139	2	the	the	DT
cord-001824-7c37elh6	139	3	bacterial	bacterial	JJ
cord-001824-7c37elh6	139	4	system	system	NN
cord-001824-7c37elh6	139	5	,	,	,
cord-001824-7c37elh6	139	6	modification	modification	NN
cord-001824-7c37elh6	139	7	deficiency	deficiency	NN
cord-001824-7c37elh6	139	8	of	of	IN
cord-001824-7c37elh6	139	9	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	139	10	-	-	HYPH
cord-001824-7c37elh6	139	11	tRNA	trna	NN
cord-001824-7c37elh6	139	12	in	in	IN
cord-001824-7c37elh6	139	13	the	the	DT
cord-001824-7c37elh6	139	14	ternary	ternary	JJ
cord-001824-7c37elh6	139	15	complex	complex	JJ
cord-001824-7c37elh6	139	16	causes	cause	NNS
cord-001824-7c37elh6	139	17	in	in	IN
cord-001824-7c37elh6	139	18	most	most	JJS
cord-001824-7c37elh6	139	19	cases	case	NNS
cord-001824-7c37elh6	139	20	a	a	DT
cord-001824-7c37elh6	139	21	slow	slow	JJ
cord-001824-7c37elh6	139	22	entry	entry	NN
cord-001824-7c37elh6	139	23	of	of	IN
cord-001824-7c37elh6	139	24	it	-PRON-	PRP
cord-001824-7c37elh6	139	25	to	to	IN
cord-001824-7c37elh6	139	26	the	the	DT
cord-001824-7c37elh6	139	27	A	A	NNP
cord-001824-7c37elh6	139	28	-	-	HYPH
cord-001824-7c37elh6	139	29	site	site	NN
cord-001824-7c37elh6	139	30	and	and	CC
cord-001824-7c37elh6	139	31	thereby	thereby	RB
cord-001824-7c37elh6	139	32	induces	induce	VBZ
cord-001824-7c37elh6	139	33	a	a	DT
cord-001824-7c37elh6	139	34	peptidyl	peptidyl	JJ
cord-001824-7c37elh6	139	35	-	-	HYPH
cord-001824-7c37elh6	139	36	tRNA	trna	NN
cord-001824-7c37elh6	139	37	slippage	slippage	NN
cord-001824-7c37elh6	139	38	(	(	-LRB-
cord-001824-7c37elh6	139	39	Figure	figure	NN
cord-001824-7c37elh6	139	40	1A	1a	NN
cord-001824-7c37elh6	139	41	and	and	CC
cord-001824-7c37elh6	139	42	B	b	NN
cord-001824-7c37elh6	139	43	)	)	-RRB-
cord-001824-7c37elh6	139	44	(	(	-LRB-
cord-001824-7c37elh6	139	45	6	6	CD
cord-001824-7c37elh6	139	46	)	)	-RRB-
cord-001824-7c37elh6	139	47	.	.	.
cord-001824-7c37elh6	140	1	Therefore	therefore	RB
cord-001824-7c37elh6	140	2	,	,	,
cord-001824-7c37elh6	140	3	we	-PRON-	PRP
cord-001824-7c37elh6	140	4	suspected	suspect	VBD
cord-001824-7c37elh6	140	5	that	that	IN
cord-001824-7c37elh6	140	6	in	in	IN
cord-001824-7c37elh6	140	7	the	the	DT
cord-001824-7c37elh6	140	8	cases	case	NNS
cord-001824-7c37elh6	140	9	below	below	IN
cord-001824-7c37elh6	140	10	where	where	WRB
cord-001824-7c37elh6	140	11	we	-PRON-	PRP
cord-001824-7c37elh6	140	12	observed	observe	VBD
cord-001824-7c37elh6	140	13	an	an	DT
cord-001824-7c37elh6	140	14	effect	effect	NN
cord-001824-7c37elh6	140	15	on	on	IN
cord-001824-7c37elh6	140	16	the	the	DT
cord-001824-7c37elh6	140	17	frequency	frequency	NN
cord-001824-7c37elh6	140	18	of	of	IN
cord-001824-7c37elh6	140	19	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	140	20	in	in	IN
cord-001824-7c37elh6	140	21	the	the	DT
cord-001824-7c37elh6	140	22	modification	modification	NN
cord-001824-7c37elh6	140	23	deficient	deficient	JJ
cord-001824-7c37elh6	140	24	mutants	mutant	NNS
cord-001824-7c37elh6	140	25	,	,	,
cord-001824-7c37elh6	140	26	it	-PRON-	PRP
cord-001824-7c37elh6	140	27	would	would	MD
cord-001824-7c37elh6	140	28	primarily	primarily	RB
cord-001824-7c37elh6	140	29	be	be	VB
cord-001824-7c37elh6	140	30	due	due	JJ
cord-001824-7c37elh6	140	31	to	to	IN
cord-001824-7c37elh6	140	32	an	an	DT
cord-001824-7c37elh6	140	33	A	a	NN
cord-001824-7c37elh6	140	34	-	-	HYPH
cord-001824-7c37elh6	140	35	site	site	NN
cord-001824-7c37elh6	140	36	effect	effect	NN
cord-001824-7c37elh6	140	37	,	,	,
cord-001824-7c37elh6	140	38	i.e.	i.e.	FW
cord-001824-7c37elh6	140	39	slow	slow	JJ
cord-001824-7c37elh6	140	40	entry	entry	NN
cord-001824-7c37elh6	140	41	of	of	IN
cord-001824-7c37elh6	140	42	the	the	DT
cord-001824-7c37elh6	140	43	ternary	ternary	JJ
cord-001824-7c37elh6	140	44	complex	complex	NN
cord-001824-7c37elh6	140	45	containing	contain	VBG
cord-001824-7c37elh6	140	46	aminoacyl	aminoacyl	NNP
cord-001824-7c37elh6	140	47	-	-	HYPH
cord-001824-7c37elh6	140	48	tRNA	trna	NN
cord-001824-7c37elh6	140	49	cognate	cognate	NN
cord-001824-7c37elh6	140	50	to	to	IN
cord-001824-7c37elh6	140	51	the	the	DT
cord-001824-7c37elh6	140	52	test	test	NN
cord-001824-7c37elh6	140	53	codon	codon	NN
cord-001824-7c37elh6	140	54	allowing	allow	VBG
cord-001824-7c37elh6	140	55	a	a	DT
cord-001824-7c37elh6	140	56	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	140	57	-	-	HYPH
cord-001824-7c37elh6	140	58	tRNA	trna	NN
cord-001824-7c37elh6	140	59	interacting	interact	VBG
cord-001824-7c37elh6	140	60	with	with	IN
cord-001824-7c37elh6	140	61	the	the	DT
cord-001824-7c37elh6	140	62	slippery	slippery	JJ
cord-001824-7c37elh6	140	63	codon	codon	NN
cord-001824-7c37elh6	140	64	XXX	XXX	NNP
cord-001824-7c37elh6	140	65	to	to	TO
cord-001824-7c37elh6	140	66	slip	slip	VB
cord-001824-7c37elh6	140	67	(	(	-LRB-
cord-001824-7c37elh6	140	68	Figure	figure	NN
cord-001824-7c37elh6	140	69	1A	1a	NN
cord-001824-7c37elh6	140	70	and	and	CC
cord-001824-7c37elh6	140	71	B	B	NNP
cord-001824-7c37elh6	140	72	)	)	-RRB-
cord-001824-7c37elh6	140	73	.	.	.
cord-001824-7c37elh6	141	1	In	in	IN
cord-001824-7c37elh6	141	2	the	the	DT
cord-001824-7c37elh6	141	3	constructs	construct	NNS
cord-001824-7c37elh6	141	4	used	use	VBN
cord-001824-7c37elh6	141	5	,	,	,
cord-001824-7c37elh6	141	6	all	all	DT
cord-001824-7c37elh6	141	7	have	have	VBP
cord-001824-7c37elh6	141	8	a	a	DT
cord-001824-7c37elh6	141	9	UAG	UAG	NNP
cord-001824-7c37elh6	141	10	stop	stop	NN
cord-001824-7c37elh6	141	11	codon	codon	NN
cord-001824-7c37elh6	141	12	just	just	RB
cord-001824-7c37elh6	141	13	after	after	IN
cord-001824-7c37elh6	141	14	the	the	DT
cord-001824-7c37elh6	141	15	test	test	NN
cord-001824-7c37elh6	141	16	codon	codon	NN
cord-001824-7c37elh6	141	17	NNN	NNN	NNP
cord-001824-7c37elh6	142	1	(	(	-LRB-
cord-001824-7c37elh6	142	2	i.e.	i.e.	FW
cord-001824-7c37elh6	142	3	the	the	DT
cord-001824-7c37elh6	142	4	sequence	sequence	NN
cord-001824-7c37elh6	142	5	is	be	VBZ
cord-001824-7c37elh6	142	6	in	in	IN
cord-001824-7c37elh6	142	7	zero	zero	CD
cord-001824-7c37elh6	142	8	frame	frame	NN
cord-001824-7c37elh6	142	9	-XXX	-xxx	ADD
cord-001824-7c37elh6	142	10	-	-	HYPH
cord-001824-7c37elh6	142	11	NNN	NNN	NNP
cord-001824-7c37elh6	142	12	-	-	HYPH
cord-001824-7c37elh6	142	13	UAG	UAG	NNP
cord-001824-7c37elh6	142	14	)	)	-RRB-
cord-001824-7c37elh6	142	15	.	.	.
cord-001824-7c37elh6	143	1	Translational	translational	JJ
cord-001824-7c37elh6	143	2	termination	termination	NN
cord-001824-7c37elh6	143	3	in	in	IN
cord-001824-7c37elh6	143	4	yeast	yeast	NN
cord-001824-7c37elh6	143	5	is	be	VBZ
cord-001824-7c37elh6	143	6	controlled	control	VBN
cord-001824-7c37elh6	143	7	by	by	IN
cord-001824-7c37elh6	143	8	two	two	CD
cord-001824-7c37elh6	143	9	interacting	interact	VBG
cord-001824-7c37elh6	143	10	protein	protein	NN
cord-001824-7c37elh6	143	11	chain	chain	NN
cord-001824-7c37elh6	143	12	release	release	NN
cord-001824-7c37elh6	143	13	factors	factor	NNS
cord-001824-7c37elh6	143	14	,	,	,
cord-001824-7c37elh6	143	15	eRF1	eRF1	NNP
cord-001824-7c37elh6	143	16	and	and	CC
cord-001824-7c37elh6	143	17	eRF3	eRF3	NNP
cord-001824-7c37elh6	143	18	.	.	.
cord-001824-7c37elh6	144	1	Whereas	whereas	IN
cord-001824-7c37elh6	144	2	eRF1	eRF1	NNP
cord-001824-7c37elh6	144	3	recognizes	recognize	VBZ
cord-001824-7c37elh6	144	4	all	all	DT
cord-001824-7c37elh6	144	5	three	three	CD
cord-001824-7c37elh6	144	6	stop	stop	NN
cord-001824-7c37elh6	144	7	codons	codon	NNS
cord-001824-7c37elh6	144	8	,	,	,
cord-001824-7c37elh6	144	9	binds	bind	VBZ
cord-001824-7c37elh6	144	10	to	to	IN
cord-001824-7c37elh6	144	11	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	144	12	Asite	Asite	NNP
cord-001824-7c37elh6	144	13	,	,	,
cord-001824-7c37elh6	144	14	and	and	CC
cord-001824-7c37elh6	144	15	promotes	promote	VBZ
cord-001824-7c37elh6	144	16	hydrolysis	hydrolysis	NN
cord-001824-7c37elh6	144	17	of	of	IN
cord-001824-7c37elh6	144	18	the	the	DT
cord-001824-7c37elh6	144	19	P	p	NN
cord-001824-7c37elh6	144	20	-	-	HYPH
cord-001824-7c37elh6	144	21	site	site	NN
cord-001824-7c37elh6	144	22	located	locate	VBN
cord-001824-7c37elh6	144	23	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	144	24	-	-	HYPH
cord-001824-7c37elh6	144	25	tRNA	tRNA	NNP
cord-001824-7c37elh6	144	26	,	,	,
cord-001824-7c37elh6	144	27	eRF3	eRF3	NNP
cord-001824-7c37elh6	144	28	stimulates	stimulate	VBZ
cord-001824-7c37elh6	144	29	the	the	DT
cord-001824-7c37elh6	144	30	termination	termination	NN
cord-001824-7c37elh6	144	31	activity	activity	NN
cord-001824-7c37elh6	144	32	of	of	IN
cord-001824-7c37elh6	144	33	eRF1	eRF1	NNP
cord-001824-7c37elh6	145	1	(	(	-LRB-
cord-001824-7c37elh6	145	2	Reviewed	review	VBN
cord-001824-7c37elh6	145	3	in	in	IN
cord-001824-7c37elh6	145	4	Kisselev	Kisselev	NNP
cord-001824-7c37elh6	145	5	and	and	CC
cord-001824-7c37elh6	145	6	Buckingham	Buckingham	NNP
cord-001824-7c37elh6	145	7	(	(	-LRB-
cord-001824-7c37elh6	145	8	44	44	CD
cord-001824-7c37elh6	145	9	)	)	-RRB-
cord-001824-7c37elh6	145	10	)	)	-RRB-
cord-001824-7c37elh6	145	11	.	.	.
cord-001824-7c37elh6	146	1	A	a	DT
cord-001824-7c37elh6	146	2	poor	poor	JJ
cord-001824-7c37elh6	146	3	eRF1	eRF1	NNP
cord-001824-7c37elh6	146	4	binding	bind	VBG
cord-001824-7c37elh6	146	5	to	to	IN
cord-001824-7c37elh6	146	6	the	the	DT
cord-001824-7c37elh6	146	7	UAG	UAG	NNP
cord-001824-7c37elh6	146	8	in	in	IN
cord-001824-7c37elh6	146	9	the	the	DT
cord-001824-7c37elh6	146	10	A	A	NNP
cord-001824-7c37elh6	146	11	-	-	HYPH
cord-001824-7c37elh6	146	12	site	site	NN
cord-001824-7c37elh6	146	13	may	may	MD
cord-001824-7c37elh6	146	14	induce	induce	VB
cord-001824-7c37elh6	146	15	slippage	slippage	NN
cord-001824-7c37elh6	146	16	by	by	IN
cord-001824-7c37elh6	146	17	the	the	DT
cord-001824-7c37elh6	146	18	modification	modification	NN
cord-001824-7c37elh6	146	19	deficient	deficient	JJ
cord-001824-7c37elh6	146	20	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	146	21	-	-	HYPH
cord-001824-7c37elh6	146	22	tRNA	tRNA	NNP
cord-001824-7c37elh6	146	23	from	from	IN
cord-001824-7c37elh6	146	24	cognate	cognate	JJ
cord-001824-7c37elh6	146	25	NNN	nnn	NN
cord-001824-7c37elh6	146	26	codon	codon	NN
cord-001824-7c37elh6	146	27	to	to	IN
cord-001824-7c37elh6	146	28	NN	NN	NNP
cord-001824-7c37elh6	146	29	-	-	HYPH
cord-001824-7c37elh6	146	30	U	U	NNP
cord-001824-7c37elh6	146	31	codon	codon	NN
cord-001824-7c37elh6	146	32	.	.	.
cord-001824-7c37elh6	147	1	Therefore	therefore	RB
cord-001824-7c37elh6	147	2	,	,	,
cord-001824-7c37elh6	147	3	the	the	DT
cord-001824-7c37elh6	147	4	+1	+1	XX
cord-001824-7c37elh6	147	5	frameshifting	frameshifting	NN
cord-001824-7c37elh6	147	6	observed	observe	VBD
cord-001824-7c37elh6	147	7	using	use	VBG
cord-001824-7c37elh6	147	8	the	the	DT
cord-001824-7c37elh6	147	9	luciferase	luciferase	NN
cord-001824-7c37elh6	147	10	assay	assay	NN
cord-001824-7c37elh6	147	11	may	may	MD
cord-001824-7c37elh6	147	12	be	be	VB
cord-001824-7c37elh6	147	13	caused	cause	VBN
cord-001824-7c37elh6	147	14	by	by	IN
cord-001824-7c37elh6	147	15	either	either	CC
cord-001824-7c37elh6	147	16	an	an	DT
cord-001824-7c37elh6	147	17	A	A	NNP
cord-001824-7c37elh6	147	18	-	-	HYPH
cord-001824-7c37elh6	147	19	site	site	NN
cord-001824-7c37elh6	147	20	or	or	CC
cord-001824-7c37elh6	147	21	a	a	DT
cord-001824-7c37elh6	147	22	P	p	NN
cord-001824-7c37elh6	147	23	-	-	HYPH
cord-001824-7c37elh6	147	24	site	site	NN
cord-001824-7c37elh6	147	25	effect	effect	NN
cord-001824-7c37elh6	147	26	or	or	CC
cord-001824-7c37elh6	147	27	both	both	DT
cord-001824-7c37elh6	147	28	.	.	.
cord-001824-7c37elh6	148	1	Note	note	VB
cord-001824-7c37elh6	148	2	that	that	IN
cord-001824-7c37elh6	148	3	,	,	,
cord-001824-7c37elh6	148	4	in	in	IN
cord-001824-7c37elh6	148	5	all	all	PDT
cord-001824-7c37elh6	148	6	these	these	DT
cord-001824-7c37elh6	148	7	cases	case	NNS
cord-001824-7c37elh6	148	8	the	the	DT
cord-001824-7c37elh6	148	9	error	error	NN
cord-001824-7c37elh6	148	10	occurs	occur	VBZ
cord-001824-7c37elh6	148	11	in	in	IN
cord-001824-7c37elh6	148	12	the	the	DT
cord-001824-7c37elh6	148	13	P	p	NN
cord-001824-7c37elh6	148	14	-	-	HYPH
cord-001824-7c37elh6	148	15	site	site	NN
cord-001824-7c37elh6	148	16	(	(	-LRB-
cord-001824-7c37elh6	148	17	either	either	CC
cord-001824-7c37elh6	148	18	by	by	IN
cord-001824-7c37elh6	148	19	the	the	DT
cord-001824-7c37elh6	148	20	tRNA	trna	NN
cord-001824-7c37elh6	148	21	reading	read	VBG
cord-001824-7c37elh6	148	22	the	the	DT
cord-001824-7c37elh6	148	23	slippery	slippery	JJ
cord-001824-7c37elh6	148	24	codon	codon	NN
cord-001824-7c37elh6	148	25	or	or	CC
cord-001824-7c37elh6	148	26	a	a	DT
cord-001824-7c37elh6	148	27	tRNA	trna	NN
cord-001824-7c37elh6	148	28	cognate	cognate	JJ
cord-001824-7c37elh6	148	29	to	to	IN
cord-001824-7c37elh6	148	30	the	the	DT
cord-001824-7c37elh6	148	31	test	test	NN
cord-001824-7c37elh6	148	32	codon	codon	NN
cord-001824-7c37elh6	148	33	)	)	-RRB-
cord-001824-7c37elh6	148	34	.	.	.
cord-001824-7c37elh6	149	1	Although	although	IN
cord-001824-7c37elh6	149	2	the	the	DT
cord-001824-7c37elh6	149	3	luciferase	luciferase	NN
cord-001824-7c37elh6	149	4	system	system	NN
cord-001824-7c37elh6	149	5	used	use	VBN
cord-001824-7c37elh6	149	6	by	by	IN
cord-001824-7c37elh6	149	7	us	-PRON-	PRP
cord-001824-7c37elh6	149	8	is	be	VBZ
cord-001824-7c37elh6	149	9	unable	unable	JJ
cord-001824-7c37elh6	149	10	to	to	TO
cord-001824-7c37elh6	149	11	distinguish	distinguish	VB
cord-001824-7c37elh6	149	12	between	between	IN
cord-001824-7c37elh6	149	13	an	an	DT
cord-001824-7c37elh6	149	14	A	a	NN
cord-001824-7c37elh6	149	15	-	-	:
cord-001824-7c37elh6	149	16	or	or	CC
cord-001824-7c37elh6	149	17	a	a	DT
cord-001824-7c37elh6	149	18	P	p	NN
cord-001824-7c37elh6	149	19	-	-	HYPH
cord-001824-7c37elh6	149	20	site	site	NN
cord-001824-7c37elh6	149	21	effect	effect	NN
cord-001824-7c37elh6	149	22	caused	cause	VBN
cord-001824-7c37elh6	149	23	by	by	IN
cord-001824-7c37elh6	149	24	modification	modification	NN
cord-001824-7c37elh6	149	25	deficiency	deficiency	NN
cord-001824-7c37elh6	149	26	,	,	,
cord-001824-7c37elh6	149	27	it	-PRON-	PRP
cord-001824-7c37elh6	149	28	is	be	VBZ
cord-001824-7c37elh6	149	29	still	still	RB
cord-001824-7c37elh6	149	30	a	a	DT
cord-001824-7c37elh6	149	31	valuable	valuable	JJ
cord-001824-7c37elh6	149	32	method	method	NN
cord-001824-7c37elh6	149	33	to	to	TO
cord-001824-7c37elh6	149	34	address	address	VB
cord-001824-7c37elh6	149	35	whether	whether	IN
cord-001824-7c37elh6	149	36	or	or	CC
cord-001824-7c37elh6	149	37	not	not	RB
cord-001824-7c37elh6	149	38	modification	modification	NN
cord-001824-7c37elh6	149	39	is	be	VBZ
cord-001824-7c37elh6	149	40	important	important	JJ
cord-001824-7c37elh6	149	41	for	for	IN
cord-001824-7c37elh6	149	42	maintaining	maintain	VBG
cord-001824-7c37elh6	149	43	the	the	DT
cord-001824-7c37elh6	149	44	reading	reading	NN
cord-001824-7c37elh6	149	45	frame	frame	NN
cord-001824-7c37elh6	149	46	.	.	.
cord-001824-7c37elh6	150	1	To	to	TO
cord-001824-7c37elh6	150	2	address	address	VB
cord-001824-7c37elh6	150	3	specifically	specifically	RB
cord-001824-7c37elh6	150	4	if	if	IN
cord-001824-7c37elh6	150	5	modification	modification	NN
cord-001824-7c37elh6	150	6	deficiency	deficiency	NN
cord-001824-7c37elh6	150	7	induces	induce	VBZ
cord-001824-7c37elh6	150	8	an	an	DT
cord-001824-7c37elh6	150	9	A	A	NNP
cord-001824-7c37elh6	150	10	-	-	:
cord-001824-7c37elh6	150	11	or	or	CC
cord-001824-7c37elh6	150	12	a	a	DT
cord-001824-7c37elh6	150	13	P	p	NN
cord-001824-7c37elh6	150	14	-	-	HYPH
cord-001824-7c37elh6	150	15	site	site	NN
cord-001824-7c37elh6	150	16	effect	effect	NN
cord-001824-7c37elh6	150	17	,	,	,
cord-001824-7c37elh6	150	18	we	-PRON-	PRP
cord-001824-7c37elh6	150	19	used	use	VBD
cord-001824-7c37elh6	150	20	the	the	DT
cord-001824-7c37elh6	150	21	Ty1	ty1	CD
cord-001824-7c37elh6	150	22	system	system	NN
cord-001824-7c37elh6	150	23	,	,	,
cord-001824-7c37elh6	150	24	which	which	WDT
cord-001824-7c37elh6	150	25	is	be	VBZ
cord-001824-7c37elh6	150	26	explained	explain	VBN
cord-001824-7c37elh6	150	27	below	below	RB
cord-001824-7c37elh6	150	28	.	.	.
cord-001824-7c37elh6	151	1	In	in	IN
cord-001824-7c37elh6	151	2	yeast	yeast	NN
cord-001824-7c37elh6	151	3	,	,	,
cord-001824-7c37elh6	151	4	there	there	EX
cord-001824-7c37elh6	151	5	are	be	VBP
cord-001824-7c37elh6	151	6	11	11	CD
cord-001824-7c37elh6	151	7	tRNA	tRNA	NNP
cord-001824-7c37elh6	151	8	species	specie	NNS
cord-001824-7c37elh6	151	9	having	have	VBG
cord-001824-7c37elh6	151	10	mcm	mcm	NNP
cord-001824-7c37elh6	151	11	5	5	CD
cord-001824-7c37elh6	151	12	s	s	NN
cord-001824-7c37elh6	151	13	2	2	CD
cord-001824-7c37elh6	151	14	U	U	NNP
cord-001824-7c37elh6	151	15	34	34	CD
cord-001824-7c37elh6	151	16	,	,	,
cord-001824-7c37elh6	151	17	mcm	mcm	NNP
cord-001824-7c37elh6	151	18	5	5	CD
cord-001824-7c37elh6	151	19	U	U	NNP
cord-001824-7c37elh6	151	20	34	34	CD
cord-001824-7c37elh6	151	21	,	,	,
cord-001824-7c37elh6	151	22	ncm	ncm	NNP
cord-001824-7c37elh6	151	23	5	5	CD
cord-001824-7c37elh6	151	24	U	U	NNP
cord-001824-7c37elh6	151	25	34	34	CD
cord-001824-7c37elh6	151	26	or	or	CC
cord-001824-7c37elh6	151	27	ncm	ncm	NNP
cord-001824-7c37elh6	151	28	5	5	CD
cord-001824-7c37elh6	152	1	U	U	NNP
cord-001824-7c37elh6	152	2	34	34	CD
cord-001824-7c37elh6	152	3	m	m	NN
cord-001824-7c37elh6	152	4	nucleosides	nucleoside	NNS
cord-001824-7c37elh6	152	5	at	at	IN
cord-001824-7c37elh6	152	6	wobble	wobble	NN
cord-001824-7c37elh6	152	7	position	position	NN
cord-001824-7c37elh6	152	8	(	(	-LRB-
cord-001824-7c37elh6	152	9	Figures	figure	NNS
cord-001824-7c37elh6	152	10	2	2	CD
cord-001824-7c37elh6	152	11	and	and	CC
cord-001824-7c37elh6	152	12	3	3	CD
cord-001824-7c37elh6	152	13	)	)	-RRB-
cord-001824-7c37elh6	152	14	.	.	.
cord-001824-7c37elh6	153	1	The	the	DT
cord-001824-7c37elh6	153	2	role	role	NN
cord-001824-7c37elh6	153	3	of	of	IN
cord-001824-7c37elh6	153	4	these	these	DT
cord-001824-7c37elh6	153	5	modified	modify	VBN
cord-001824-7c37elh6	153	6	uridines	uridine	NNS
cord-001824-7c37elh6	153	7	was	be	VBD
cord-001824-7c37elh6	153	8	analyzed	analyze	VBN
cord-001824-7c37elh6	153	9	for	for	IN
cord-001824-7c37elh6	153	10	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	153	11	+1	+1	NN
cord-001824-7c37elh6	153	12	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	153	13	using	use	VBG
cord-001824-7c37elh6	153	14	the	the	DT
cord-001824-7c37elh6	153	15	Renilla	Renilla	NNP
cord-001824-7c37elh6	153	16	/	/	SYM
cord-001824-7c37elh6	153	17	Firefly	Firefly	NNP
cord-001824-7c37elh6	153	18	luciferase	luciferase	NN
cord-001824-7c37elh6	153	19	bicistronic	bicistronic	JJ
cord-001824-7c37elh6	153	20	reporter	reporter	NN
cord-001824-7c37elh6	153	21	system	system	NN
cord-001824-7c37elh6	153	22	described	describe	VBN
cord-001824-7c37elh6	153	23	in	in	IN
cord-001824-7c37elh6	153	24	the	the	DT
cord-001824-7c37elh6	153	25	previous	previous	JJ
cord-001824-7c37elh6	153	26	section	section	NN
cord-001824-7c37elh6	153	27	.	.	.
cord-001824-7c37elh6	154	1	In	in	IN
cord-001824-7c37elh6	154	2	an	an	DT
cord-001824-7c37elh6	154	3	elp3	elp3	CD
cord-001824-7c37elh6	154	4	mutant	mutant	NN
cord-001824-7c37elh6	154	5	these	these	DT
cord-001824-7c37elh6	154	6	tRNA	tRNA	NNP
cord-001824-7c37elh6	154	7	species	specie	NNS
cord-001824-7c37elh6	154	8	are	be	VBP
cord-001824-7c37elh6	154	9	missing	miss	VBG
cord-001824-7c37elh6	154	10	the	the	DT
cord-001824-7c37elh6	154	11	ncm	ncm	NNP
cord-001824-7c37elh6	154	12	5	5	CD
cord-001824-7c37elh6	154	13	and	and	CC
cord-001824-7c37elh6	154	14	mcm	mcm	NNP
cord-001824-7c37elh6	154	15	5	5	CD
cord-001824-7c37elh6	154	16	groups	group	NNS
cord-001824-7c37elh6	154	17	at	at	IN
cord-001824-7c37elh6	154	18	wobble	wobble	NN
cord-001824-7c37elh6	154	19	position	position	NN
cord-001824-7c37elh6	154	20	(	(	-LRB-
cord-001824-7c37elh6	154	21	U	U	NNP
cord-001824-7c37elh6	154	22	34	34	CD
cord-001824-7c37elh6	154	23	)	)	-RRB-
cord-001824-7c37elh6	154	24	(	(	-LRB-
cord-001824-7c37elh6	154	25	26	26	CD
cord-001824-7c37elh6	154	26	,	,	,
cord-001824-7c37elh6	154	27	45	45	CD
cord-001824-7c37elh6	154	28	)	)	-RRB-
cord-001824-7c37elh6	154	29	.	.	.
cord-001824-7c37elh6	155	1	The	the	DT
cord-001824-7c37elh6	155	2	role	role	NN
cord-001824-7c37elh6	155	3	of	of	IN
cord-001824-7c37elh6	155	4	the	the	DT
cord-001824-7c37elh6	155	5	ncm	ncm	NNP
cord-001824-7c37elh6	155	6	5	5	CD
cord-001824-7c37elh6	155	7	and	and	CC
cord-001824-7c37elh6	155	8	mcm	mcm	NNP
cord-001824-7c37elh6	155	9	5	5	CD
cord-001824-7c37elh6	155	10	groups	group	NNS
cord-001824-7c37elh6	155	11	present	present	JJ
cord-001824-7c37elh6	155	12	in	in	IN
cord-001824-7c37elh6	155	13	these	these	DT
cord-001824-7c37elh6	155	14	tRNAs	trna	NNS
cord-001824-7c37elh6	155	15	in	in	IN
cord-001824-7c37elh6	155	16	reading	read	VBG
cord-001824-7c37elh6	155	17	frame	frame	NN
cord-001824-7c37elh6	155	18	maintenance	maintenance	NN
cord-001824-7c37elh6	155	19	was	be	VBD
cord-001824-7c37elh6	155	20	investigated	investigate	VBN
cord-001824-7c37elh6	155	21	in	in	IN
cord-001824-7c37elh6	155	22	a	a	DT
cord-001824-7c37elh6	155	23	wild	wild	JJ
cord-001824-7c37elh6	155	24	type	type	NN
cord-001824-7c37elh6	155	25	and	and	CC
cord-001824-7c37elh6	155	26	in	in	IN
cord-001824-7c37elh6	155	27	an	an	DT
cord-001824-7c37elh6	155	28	elp3	elp3	CD
cord-001824-7c37elh6	155	29	mutant	mutant	JJ
cord-001824-7c37elh6	155	30	strain	strain	NN
cord-001824-7c37elh6	155	31	using	use	VBG
cord-001824-7c37elh6	155	32	cognate	cognate	JJ
cord-001824-7c37elh6	155	33	or	or	CC
cord-001824-7c37elh6	155	34	near	near	IN
cord-001824-7c37elh6	155	35	cognate	cognate	JJ
cord-001824-7c37elh6	155	36	codons	codon	NNS
cord-001824-7c37elh6	155	37	as	as	IN
cord-001824-7c37elh6	155	38	test	test	NN
cord-001824-7c37elh6	155	39	codons	codon	NNS
cord-001824-7c37elh6	155	40	.	.	.
cord-001824-7c37elh6	156	1	Lack	lack	NN
cord-001824-7c37elh6	156	2	of	of	IN
cord-001824-7c37elh6	156	3	the	the	DT
cord-001824-7c37elh6	156	4	mcm	mcm	NNP
cord-001824-7c37elh6	156	5	5	5	CD
cord-001824-7c37elh6	156	6	side	side	NN
cord-001824-7c37elh6	156	7	chain	chain	NN
cord-001824-7c37elh6	156	8	in	in	IN
cord-001824-7c37elh6	156	9	tRNA	trna	NN
cord-001824-7c37elh6	156	10	Arg	Arg	NNP
cord-001824-7c37elh6	156	11	mcm	mcm	NNP
cord-001824-7c37elh6	156	12	5	5	CD
cord-001824-7c37elh6	156	13	UCU	UCU	NNP
cord-001824-7c37elh6	156	14	,	,	,
cord-001824-7c37elh6	156	15	tRNA	tRNA	NNP
cord-001824-7c37elh6	156	16	Gly	Gly	NNP
cord-001824-7c37elh6	156	17	mcm	mcm	NNP
cord-001824-7c37elh6	156	18	5	5	CD
cord-001824-7c37elh6	156	19	UCC	UCC	NNP
cord-001824-7c37elh6	156	20	,	,	,
cord-001824-7c37elh6	156	21	tRNA	tRNA	NNP
cord-001824-7c37elh6	156	22	Lys	Lys	NNP
cord-001824-7c37elh6	156	23	mcm	mcm	NNP
cord-001824-7c37elh6	156	24	5	5	CD
cord-001824-7c37elh6	156	25	s	s	NN
cord-001824-7c37elh6	156	26	2	2	CD
cord-001824-7c37elh6	156	27	UUU	UUU	NNP
cord-001824-7c37elh6	156	28	and	and	CC
cord-001824-7c37elh6	156	29	tRNA	tRNA	NNP
cord-001824-7c37elh6	157	1	Glu	Glu	NNP
cord-001824-7c37elh6	157	2	mcm	mcm	NNP
cord-001824-7c37elh6	158	1	5	5	LS
cord-001824-7c37elh6	158	2	s	s	POS
cord-001824-7c37elh6	158	3	2	2	CD
cord-001824-7c37elh6	158	4	UUC	UUC	NNP
cord-001824-7c37elh6	158	5	resulted	result	VBD
cord-001824-7c37elh6	158	6	in	in	IN
cord-001824-7c37elh6	158	7	significantly	significantly	RB
cord-001824-7c37elh6	158	8	higher	high	JJR
cord-001824-7c37elh6	158	9	levels	level	NNS
cord-001824-7c37elh6	158	10	of	of	IN
cord-001824-7c37elh6	158	11	+1	+1	NN
cord-001824-7c37elh6	158	12	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	158	13	with	with	IN
cord-001824-7c37elh6	158	14	either	either	CC
cord-001824-7c37elh6	158	15	A	a	DT
cord-001824-7c37elh6	158	16	-	-	HYPH
cord-001824-7c37elh6	158	17	ending	end	VBG
cord-001824-7c37elh6	158	18	cognate	cognate	NN
cord-001824-7c37elh6	158	19	or	or	CC
cord-001824-7c37elh6	158	20	G	g	NN
cord-001824-7c37elh6	158	21	-	-	HYPH
cord-001824-7c37elh6	158	22	ending	end	VBG
cord-001824-7c37elh6	158	23	near	near	IN
cord-001824-7c37elh6	158	24	cognate	cognate	JJ
cord-001824-7c37elh6	158	25	codons	codon	NNS
cord-001824-7c37elh6	158	26	(	(	-LRB-
cord-001824-7c37elh6	158	27	Table	Table	NNP
cord-001824-7c37elh6	158	28	2	2	CD
cord-001824-7c37elh6	158	29	and	and	CC
cord-001824-7c37elh6	158	30	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	158	31	Figure	Figure	NNP
cord-001824-7c37elh6	158	32	S1	S1	NNP
cord-001824-7c37elh6	158	33	)	)	-RRB-
cord-001824-7c37elh6	158	34	.	.	.
cord-001824-7c37elh6	159	1	However	however	RB
cord-001824-7c37elh6	159	2	,	,	,
cord-001824-7c37elh6	159	3	absence	absence	NN
cord-001824-7c37elh6	159	4	of	of	IN
cord-001824-7c37elh6	159	5	the	the	DT
cord-001824-7c37elh6	159	6	mcm	mcm	NNP
cord-001824-7c37elh6	159	7	5	5	CD
cord-001824-7c37elh6	159	8	group	group	NN
cord-001824-7c37elh6	159	9	in	in	IN
cord-001824-7c37elh6	159	10	tRNA	tRNA	NNP
cord-001824-7c37elh6	159	11	Gln	Gln	NNP
cord-001824-7c37elh6	159	12	mcm	mcm	NNP
cord-001824-7c37elh6	159	13	5	5	CD
cord-001824-7c37elh6	159	14	s	s	NN
cord-001824-7c37elh6	159	15	2	2	CD
cord-001824-7c37elh6	159	16	UUG	UUG	NNP
cord-001824-7c37elh6	159	17	did	do	VBD
cord-001824-7c37elh6	159	18	not	not	RB
cord-001824-7c37elh6	159	19	have	have	VB
cord-001824-7c37elh6	159	20	any	any	DT
cord-001824-7c37elh6	159	21	significant	significant	JJ
cord-001824-7c37elh6	159	22	effect	effect	NN
cord-001824-7c37elh6	159	23	on	on	IN
cord-001824-7c37elh6	159	24	reading	read	VBG
cord-001824-7c37elh6	159	25	frame	frame	NN
cord-001824-7c37elh6	159	26	maintenance	maintenance	NN
cord-001824-7c37elh6	159	27	for	for	IN
cord-001824-7c37elh6	159	28	the	the	DT
cord-001824-7c37elh6	159	29	Gln	Gln	NNP
cord-001824-7c37elh6	159	30	codons	codon	NNS
cord-001824-7c37elh6	159	31	CAA	CAA	NNP
cord-001824-7c37elh6	159	32	or	or	CC
cord-001824-7c37elh6	159	33	CAG	CAG	NNP
cord-001824-7c37elh6	159	34	(	(	-LRB-
cord-001824-7c37elh6	159	35	Table	Table	NNP
cord-001824-7c37elh6	159	36	2	2	CD
cord-001824-7c37elh6	159	37	)	)	-RRB-
cord-001824-7c37elh6	159	38	.	.	.
cord-001824-7c37elh6	160	1	Lack	lack	NN
cord-001824-7c37elh6	160	2	of	of	IN
cord-001824-7c37elh6	160	3	the	the	DT
cord-001824-7c37elh6	160	4	ncm	ncm	NNP
cord-001824-7c37elh6	160	5	5	5	CD
cord-001824-7c37elh6	160	6	group	group	NN
cord-001824-7c37elh6	160	7	of	of	IN
cord-001824-7c37elh6	160	8	U	U	NNP
cord-001824-7c37elh6	160	9	34	34	CD
cord-001824-7c37elh6	160	10	in	in	IN
cord-001824-7c37elh6	160	11	tRNA	trna	NN
cord-001824-7c37elh6	160	12	Val	Val	NNP
cord-001824-7c37elh6	160	13	ncm	ncm	NNP
cord-001824-7c37elh6	160	14	5	5	CD
cord-001824-7c37elh6	160	15	UAC	UAC	NNP
cord-001824-7c37elh6	160	16	and	and	CC
cord-001824-7c37elh6	160	17	tRNA	trna	NN
cord-001824-7c37elh6	161	1	Ser	Ser	NNP
cord-001824-7c37elh6	161	2	ncm	ncm	NNP
cord-001824-7c37elh6	161	3	5	5	CD
cord-001824-7c37elh6	161	4	UGA	UGA	NNP
cord-001824-7c37elh6	161	5	resulted	result	VBD
cord-001824-7c37elh6	161	6	in	in	IN
cord-001824-7c37elh6	161	7	an	an	DT
cord-001824-7c37elh6	161	8	increased	increase	VBN
cord-001824-7c37elh6	161	9	level	level	NN
cord-001824-7c37elh6	161	10	of	of	IN
cord-001824-7c37elh6	161	11	+1	+1	NN
cord-001824-7c37elh6	161	12	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	161	13	with	with	IN
cord-001824-7c37elh6	161	14	near	near	JJ
cord-001824-7c37elh6	161	15	cognate	cognate	JJ
cord-001824-7c37elh6	161	16	Val	val	NN
cord-001824-7c37elh6	161	17	codon	codon	NN
cord-001824-7c37elh6	161	18	GUG	GUG	NNP
cord-001824-7c37elh6	161	19	or	or	CC
cord-001824-7c37elh6	161	20	cognate	cognate	JJ
cord-001824-7c37elh6	161	21	Ser	Ser	NNP
cord-001824-7c37elh6	161	22	codon	codon	NN
cord-001824-7c37elh6	161	23	UCA	UCA	NNP
cord-001824-7c37elh6	161	24	.	.	.
cord-001824-7c37elh6	162	1	In	in	IN
cord-001824-7c37elh6	162	2	contrast	contrast	NN
cord-001824-7c37elh6	162	3	,	,	,
cord-001824-7c37elh6	162	4	absence	absence	NN
cord-001824-7c37elh6	162	5	of	of	IN
cord-001824-7c37elh6	162	6	the	the	DT
cord-001824-7c37elh6	162	7	ncm	ncm	NNP
cord-001824-7c37elh6	162	8	5	5	CD
cord-001824-7c37elh6	162	9	group	group	NN
cord-001824-7c37elh6	162	10	of	of	IN
cord-001824-7c37elh6	162	11	U	U	NNP
cord-001824-7c37elh6	162	12	34	34	CD
cord-001824-7c37elh6	162	13	in	in	IN
cord-001824-7c37elh6	162	14	tRNA	trna	NN
cord-001824-7c37elh6	162	15	Pro	pro	JJ
cord-001824-7c37elh6	162	16	ncm	ncm	NNP
cord-001824-7c37elh6	162	17	5	5	CD
cord-001824-7c37elh6	162	18	UGG	UGG	NNP
cord-001824-7c37elh6	162	19	resulted	result	VBD
cord-001824-7c37elh6	162	20	in	in	IN
cord-001824-7c37elh6	162	21	a	a	DT
cord-001824-7c37elh6	162	22	decreased	decreased	JJ
cord-001824-7c37elh6	162	23	level	level	NN
cord-001824-7c37elh6	162	24	of	of	IN
cord-001824-7c37elh6	162	25	+1	+1	NN
cord-001824-7c37elh6	162	26	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	162	27	with	with	IN
cord-001824-7c37elh6	162	28	near	near	JJ
cord-001824-7c37elh6	162	29	cognate	cognate	JJ
cord-001824-7c37elh6	162	30	Pro	pro	JJ
cord-001824-7c37elh6	162	31	codon	codon	NN
cord-001824-7c37elh6	162	32	CCG	ccg	NN
cord-001824-7c37elh6	162	33	.	.	.
cord-001824-7c37elh6	163	1	Lack	lack	NN
cord-001824-7c37elh6	163	2	of	of	IN
cord-001824-7c37elh6	163	3	the	the	DT
cord-001824-7c37elh6	163	4	ncm	ncm	NNP
cord-001824-7c37elh6	163	5	5	5	CD
cord-001824-7c37elh6	163	6	group	group	NN
cord-001824-7c37elh6	163	7	of	of	IN
cord-001824-7c37elh6	163	8	U	U	NNP
cord-001824-7c37elh6	163	9	34	34	CD
cord-001824-7c37elh6	163	10	of	of	IN
cord-001824-7c37elh6	163	11	the	the	DT
cord-001824-7c37elh6	163	12	remaining	remain	VBG
cord-001824-7c37elh6	163	13	tRNAs	trna	NNS
cord-001824-7c37elh6	163	14	did	do	VBD
cord-001824-7c37elh6	163	15	not	not	RB
cord-001824-7c37elh6	163	16	cause	cause	VB
cord-001824-7c37elh6	163	17	a	a	DT
cord-001824-7c37elh6	163	18	significant	significant	JJ
cord-001824-7c37elh6	163	19	difference	difference	NN
cord-001824-7c37elh6	163	20	in	in	IN
cord-001824-7c37elh6	163	21	levels	level	NNS
cord-001824-7c37elh6	163	22	of	of	IN
cord-001824-7c37elh6	163	23	+1	+1	NN
cord-001824-7c37elh6	163	24	frameshifting	frameshifting	NN
cord-001824-7c37elh6	163	25	(	(	-LRB-
cord-001824-7c37elh6	163	26	Table	table	NN
cord-001824-7c37elh6	163	27	2	2	CD
cord-001824-7c37elh6	163	28	and	and	CC
cord-001824-7c37elh6	163	29	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	163	30	Figure	Figure	NNP
cord-001824-7c37elh6	163	31	S1	S1	NNP
cord-001824-7c37elh6	163	32	)	)	-RRB-
cord-001824-7c37elh6	163	33	.	.	.
cord-001824-7c37elh6	164	1	We	-PRON-	PRP
cord-001824-7c37elh6	164	2	conclude	conclude	VBP
cord-001824-7c37elh6	164	3	that	that	IN
cord-001824-7c37elh6	164	4	in	in	IN
cord-001824-7c37elh6	164	5	the	the	DT
cord-001824-7c37elh6	164	6	xm	xm	NNP
cord-001824-7c37elh6	164	7	5	5	CD
cord-001824-7c37elh6	164	8	U	U	NNP
cord-001824-7c37elh6	164	9	and	and	CC
cord-001824-7c37elh6	164	10	mcm	mcm	NNP
cord-001824-7c37elh6	164	11	5	5	CD
cord-001824-7c37elh6	164	12	s	s	NN
cord-001824-7c37elh6	164	13	2	2	CD
cord-001824-7c37elh6	164	14	U	U	NNP
cord-001824-7c37elh6	164	15	tRNA	tRNA	NNP
cord-001824-7c37elh6	164	16	isoacceptors	isoacceptor	NNS
cord-001824-7c37elh6	164	17	,	,	,
cord-001824-7c37elh6	164	18	the	the	DT
cord-001824-7c37elh6	164	19	mcm	mcm	NNP
cord-001824-7c37elh6	164	20	5	5	CD
cord-001824-7c37elh6	164	21	group	group	NN
cord-001824-7c37elh6	164	22	plays	play	VBZ
cord-001824-7c37elh6	164	23	a	a	DT
cord-001824-7c37elh6	164	24	more	more	RBR
cord-001824-7c37elh6	164	25	vital	vital	JJ
cord-001824-7c37elh6	164	26	role	role	NN
cord-001824-7c37elh6	164	27	than	than	IN
cord-001824-7c37elh6	164	28	the	the	DT
cord-001824-7c37elh6	164	29	ncm	ncm	NNP
cord-001824-7c37elh6	164	30	5	5	CD
cord-001824-7c37elh6	164	31	group	group	NN
cord-001824-7c37elh6	164	32	in	in	IN
cord-001824-7c37elh6	164	33	reading	read	VBG
cord-001824-7c37elh6	164	34	frame	frame	NN
cord-001824-7c37elh6	164	35	maintenance	maintenance	NN
cord-001824-7c37elh6	164	36	.	.	.
cord-001824-7c37elh6	165	1	Codon	Codon	NNP
cord-001824-7c37elh6	165	2	CCC	CCC	NNP
cord-001824-7c37elh6	165	3	that	that	WDT
cord-001824-7c37elh6	165	4	can	can	MD
cord-001824-7c37elh6	165	5	be	be	VB
cord-001824-7c37elh6	165	6	read	read	VBN
cord-001824-7c37elh6	165	7	by	by	IN
cord-001824-7c37elh6	165	8	ncm	ncm	NNP
cord-001824-7c37elh6	165	9	5	5	CD
cord-001824-7c37elh6	165	10	U	U	NNP
cord-001824-7c37elh6	165	11	34	34	CD
cord-001824-7c37elh6	165	12	containing	contain	VBG
cord-001824-7c37elh6	165	13	tRNA	trna	NN
cord-001824-7c37elh6	165	14	Pro	pro	JJ
cord-001824-7c37elh6	165	15	ncm	ncm	NNP
cord-001824-7c37elh6	165	16	5	5	CD
cord-001824-7c37elh6	165	17	UGG	UGG	NNP
cord-001824-7c37elh6	165	18	is	be	VBZ
cord-001824-7c37elh6	165	19	used	use	VBN
cord-001824-7c37elh6	165	20	as	as	IN
cord-001824-7c37elh6	165	21	a	a	DT
cord-001824-7c37elh6	165	22	slippery	slippery	JJ
cord-001824-7c37elh6	165	23	codon	codon	NN
cord-001824-7c37elh6	165	24	upstream	upstream	RB
cord-001824-7c37elh6	165	25	next	next	RB
cord-001824-7c37elh6	165	26	to	to	IN
cord-001824-7c37elh6	165	27	Gln-	Gln-	NNP
cord-001824-7c37elh6	165	28	,	,	,
cord-001824-7c37elh6	165	29	Lys	Lys	NNP
cord-001824-7c37elh6	165	30	,	,	,
cord-001824-7c37elh6	165	31	Arg-	Arg-	NNP
cord-001824-7c37elh6	165	32	,	,	,
cord-001824-7c37elh6	165	33	Gly	Gly	NNP
cord-001824-7c37elh6	165	34	-	-	:
cord-001824-7c37elh6	165	35	and	and	CC
cord-001824-7c37elh6	165	36	Thr	Thr	NNP
cord-001824-7c37elh6	165	37	-	-	HYPH
cord-001824-7c37elh6	165	38	test	test	NN
cord-001824-7c37elh6	165	39	codons	codon	NNS
cord-001824-7c37elh6	165	40	(	(	-LRB-
cord-001824-7c37elh6	165	41	Table	Table	NNP
cord-001824-7c37elh6	165	42	2	2	CD
cord-001824-7c37elh6	165	43	and	and	CC
cord-001824-7c37elh6	165	44	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	165	45	Figure	Figure	NNP
cord-001824-7c37elh6	165	46	S1	S1	NNP
cord-001824-7c37elh6	165	47	)	)	-RRB-
cord-001824-7c37elh6	165	48	.	.	.
cord-001824-7c37elh6	166	1	Thus	thus	RB
cord-001824-7c37elh6	166	2	,	,	,
cord-001824-7c37elh6	166	3	the	the	DT
cord-001824-7c37elh6	166	4	ncm	ncm	NNP
cord-001824-7c37elh6	166	5	5	5	CD
cord-001824-7c37elh6	166	6	U	U	NNP
cord-001824-7c37elh6	166	7	34	34	CD
cord-001824-7c37elh6	166	8	present	present	NN
cord-001824-7c37elh6	166	9	in	in	IN
cord-001824-7c37elh6	166	10	the	the	DT
cord-001824-7c37elh6	166	11	potential	potential	JJ
cord-001824-7c37elh6	166	12	peptidyl	peptidyl	JJ
cord-001824-7c37elh6	166	13	-	-	HYPH
cord-001824-7c37elh6	166	14	Pro	pro	JJ
cord-001824-7c37elh6	166	15	-	-	JJ
cord-001824-7c37elh6	166	16	tRNA	trna	NN
cord-001824-7c37elh6	166	17	might	may	MD
cord-001824-7c37elh6	166	18	influence	influence	VB
cord-001824-7c37elh6	166	19	the	the	DT
cord-001824-7c37elh6	166	20	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	166	21	grip	grip	NN
cord-001824-7c37elh6	166	22	in	in	IN
cord-001824-7c37elh6	166	23	the	the	DT
cord-001824-7c37elh6	166	24	P	p	NN
cord-001824-7c37elh6	166	25	-	-	HYPH
cord-001824-7c37elh6	166	26	site	site	NN
cord-001824-7c37elh6	166	27	and	and	CC
cord-001824-7c37elh6	166	28	thus	thus	RB
cord-001824-7c37elh6	166	29	influence	influence	VB
cord-001824-7c37elh6	166	30	the	the	DT
cord-001824-7c37elh6	166	31	slippage	slippage	NN
cord-001824-7c37elh6	166	32	.	.	.
cord-001824-7c37elh6	167	1	To	to	TO
cord-001824-7c37elh6	167	2	test	test	VB
cord-001824-7c37elh6	167	3	directly	directly	RB
cord-001824-7c37elh6	167	4	the	the	DT
cord-001824-7c37elh6	167	5	influence	influence	NN
cord-001824-7c37elh6	167	6	of	of	IN
cord-001824-7c37elh6	167	7	the	the	DT
cord-001824-7c37elh6	167	8	ncm	ncm	NNP
cord-001824-7c37elh6	167	9	5	5	CD
cord-001824-7c37elh6	167	10	group	group	NN
cord-001824-7c37elh6	167	11	in	in	IN
cord-001824-7c37elh6	167	12	Pro	Pro	NNP
cord-001824-7c37elh6	167	13	-	-	JJ
cord-001824-7c37elh6	167	14	tRNA	trna	JJ
cord-001824-7c37elh6	167	15	in	in	IN
cord-001824-7c37elh6	167	16	peptidyl	peptidyl	JJ
cord-001824-7c37elh6	167	17	-	-	HYPH
cord-001824-7c37elh6	167	18	Pro	pro	JJ
cord-001824-7c37elh6	167	19	-	-	JJ
cord-001824-7c37elh6	167	20	tRNA	trna	JJ
cord-001824-7c37elh6	167	21	slippage	slippage	NN
cord-001824-7c37elh6	167	22	,	,	,
cord-001824-7c37elh6	167	23	we	-PRON-	PRP
cord-001824-7c37elh6	167	24	used	use	VBD
cord-001824-7c37elh6	167	25	a	a	DT
cord-001824-7c37elh6	167	26	construct	construct	NN
cord-001824-7c37elh6	167	27	-UUU	-UUU	-LRB-
cord-001824-7c37elh6	167	28	-	-	:
cord-001824-7c37elh6	167	29	CCC	CCC	NNP
cord-001824-7c37elh6	167	30	-	-	HYPH
cord-001824-7c37elh6	167	31	UAG	UAG	NNP
cord-001824-7c37elh6	167	32	-	-	:
cord-001824-7c37elh6	167	33	in	in	IN
cord-001824-7c37elh6	167	34	the	the	DT
cord-001824-7c37elh6	167	35	luciferase	luciferase	NN
cord-001824-7c37elh6	167	36	system	system	NN
cord-001824-7c37elh6	167	37	.	.	.
cord-001824-7c37elh6	168	1	The	the	DT
cord-001824-7c37elh6	168	2	stop	stop	NN
cord-001824-7c37elh6	168	3	codon	codon	NN
cord-001824-7c37elh6	168	4	UAG	UAG	NNP
cord-001824-7c37elh6	168	5	is	be	VBZ
cord-001824-7c37elh6	168	6	in	in	IN
cord-001824-7c37elh6	168	7	the	the	DT
cord-001824-7c37elh6	168	8	zero	zero	CD
cord-001824-7c37elh6	168	9	frame	frame	NN
cord-001824-7c37elh6	168	10	just	just	RB
cord-001824-7c37elh6	168	11	after	after	IN
cord-001824-7c37elh6	168	12	the	the	DT
cord-001824-7c37elh6	168	13	Pro	pro	JJ
cord-001824-7c37elh6	168	14	codon	codon	NN
cord-001824-7c37elh6	168	15	CCC	CCC	NNP
cord-001824-7c37elh6	168	16	.	.	.
cord-001824-7c37elh6	169	1	Since	since	IN
cord-001824-7c37elh6	169	2	eukaryotic	eukaryotic	JJ
cord-001824-7c37elh6	169	3	release	release	NN
cord-001824-7c37elh6	169	4	factor	factor	NN
cord-001824-7c37elh6	169	5	1	1	CD
cord-001824-7c37elh6	169	6	(	(	-LRB-
cord-001824-7c37elh6	169	7	eRF1	eRF1	NNP
cord-001824-7c37elh6	169	8	)	)	-RRB-
cord-001824-7c37elh6	169	9	acts	act	VBZ
cord-001824-7c37elh6	169	10	in	in	IN
cord-001824-7c37elh6	169	11	the	the	DT
cord-001824-7c37elh6	169	12	A	A	NNP
cord-001824-7c37elh6	169	13	-	-	HYPH
cord-001824-7c37elh6	169	14	site	site	NN
cord-001824-7c37elh6	169	15	(	(	-LRB-
cord-001824-7c37elh6	169	16	Reviewed	review	VBN
cord-001824-7c37elh6	169	17	in	in	IN
cord-001824-7c37elh6	169	18	Kisselev	Kisselev	NNP
cord-001824-7c37elh6	169	19	and	and	CC
cord-001824-7c37elh6	169	20	Buckingham	Buckingham	NNP
cord-001824-7c37elh6	169	21	(	(	-LRB-
cord-001824-7c37elh6	169	22	44	44	CD
cord-001824-7c37elh6	169	23	)	)	-RRB-
cord-001824-7c37elh6	169	24	)	)	-RRB-
cord-001824-7c37elh6	170	1	a	a	DT
cord-001824-7c37elh6	170	2	possible	possible	JJ
cord-001824-7c37elh6	170	3	+1	+1	XX
cord-001824-7c37elh6	170	4	frameshift	frameshift	NN
cord-001824-7c37elh6	170	5	by	by	IN
cord-001824-7c37elh6	170	6	Pro	Pro	NNP
cord-001824-7c37elh6	170	7	-	-	JJ
cord-001824-7c37elh6	170	8	tRNA	trna	JJ
cord-001824-7c37elh6	171	1	lacking	lacking	NNP
cord-001824-7c37elh6	171	2	ncm	ncm	NNP
cord-001824-7c37elh6	171	3	5	5	CD
cord-001824-7c37elh6	171	4	U	U	NNP
cord-001824-7c37elh6	171	5	would	would	MD
cord-001824-7c37elh6	171	6	occur	occur	VB
cord-001824-7c37elh6	171	7	in	in	IN
cord-001824-7c37elh6	171	8	the	the	DT
cord-001824-7c37elh6	171	9	P	p	NN
cord-001824-7c37elh6	171	10	-	-	HYPH
cord-001824-7c37elh6	171	11	site	site	NN
cord-001824-7c37elh6	171	12	.	.	.
cord-001824-7c37elh6	172	1	However	however	RB
cord-001824-7c37elh6	172	2	,	,	,
cord-001824-7c37elh6	172	3	no	no	DT
cord-001824-7c37elh6	172	4	significant	significant	JJ
cord-001824-7c37elh6	172	5	+1	+1	HYPH
cord-001824-7c37elh6	172	6	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	172	7	was	be	VBD
cord-001824-7c37elh6	172	8	observed	observe	VBN
cord-001824-7c37elh6	172	9	when	when	WRB
cord-001824-7c37elh6	172	10	the	the	DT
cord-001824-7c37elh6	172	11	CCC	CCC	NNP
cord-001824-7c37elh6	172	12	codon	codon	NN
cord-001824-7c37elh6	172	13	was	be	VBD
cord-001824-7c37elh6	172	14	just	just	RB
cord-001824-7c37elh6	172	15	upstream	upstream	RB
cord-001824-7c37elh6	172	16	the	the	DT
cord-001824-7c37elh6	172	17	stop	stop	NN
cord-001824-7c37elh6	172	18	codon	codon	NN
cord-001824-7c37elh6	172	19	and	and	CC
cord-001824-7c37elh6	172	20	thus	thus	RB
cord-001824-7c37elh6	172	21	in	in	IN
cord-001824-7c37elh6	172	22	the	the	DT
cord-001824-7c37elh6	172	23	P	p	NN
cord-001824-7c37elh6	172	24	-	-	HYPH
cord-001824-7c37elh6	172	25	site	site	NN
cord-001824-7c37elh6	172	26	(	(	-LRB-
cord-001824-7c37elh6	172	27	Table	Table	NNP
cord-001824-7c37elh6	172	28	2	2	CD
cord-001824-7c37elh6	172	29	and	and	CC
cord-001824-7c37elh6	172	30	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	172	31	Figure	Figure	NNP
cord-001824-7c37elh6	172	32	S1	S1	NNP
cord-001824-7c37elh6	172	33	)	)	-RRB-
cord-001824-7c37elh6	172	34	.	.	.
cord-001824-7c37elh6	173	1	We	-PRON-	PRP
cord-001824-7c37elh6	173	2	conclude	conclude	VBP
cord-001824-7c37elh6	173	3	that	that	IN
cord-001824-7c37elh6	173	4	the	the	DT
cord-001824-7c37elh6	173	5	ncm	ncm	NNP
cord-001824-7c37elh6	173	6	5	5	CD
cord-001824-7c37elh6	173	7	group	group	NN
cord-001824-7c37elh6	173	8	in	in	IN
cord-001824-7c37elh6	173	9	Pro	Pro	NNP
cord-001824-7c37elh6	173	10	-	-	NNP
cord-001824-7c37elh6	173	11	tRNA	trna	NN
cord-001824-7c37elh6	173	12	does	do	VBZ
cord-001824-7c37elh6	173	13	not	not	RB
cord-001824-7c37elh6	173	14	increase	increase	VB
cord-001824-7c37elh6	173	15	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	173	16	-	-	HYPH
cord-001824-7c37elh6	173	17	tRNA	trna	NN
cord-001824-7c37elh6	173	18	slippage	slippage	NN
cord-001824-7c37elh6	173	19	at	at	IN
cord-001824-7c37elh6	173	20	the	the	DT
cord-001824-7c37elh6	173	21	slippery	slippery	JJ
cord-001824-7c37elh6	173	22	codon	codon	NN
cord-001824-7c37elh6	173	23	CCC	CCC	NNP
cord-001824-7c37elh6	173	24	.	.	.
cord-001824-7c37elh6	174	1	The	the	DT
cord-001824-7c37elh6	174	2	slippery	slippery	JJ
cord-001824-7c37elh6	174	3	codon	codon	NN
cord-001824-7c37elh6	174	4	GGG	GGG	NNP
cord-001824-7c37elh6	174	5	is	be	VBZ
cord-001824-7c37elh6	174	6	decoded	decode	VBN
cord-001824-7c37elh6	174	7	by	by	IN
cord-001824-7c37elh6	174	8	both	both	DT
cord-001824-7c37elh6	174	9	C	C	NNP
cord-001824-7c37elh6	174	10	34	34	CD
cord-001824-7c37elh6	174	11	containing	contain	VBG
cord-001824-7c37elh6	174	12	tRNA	tRNA	NNP
cord-001824-7c37elh6	174	13	Gly	Gly	NNP
cord-001824-7c37elh6	174	14	CCC	CCC	NNP
cord-001824-7c37elh6	174	15	and	and	CC
cord-001824-7c37elh6	174	16	mcm	mcm	NNP
cord-001824-7c37elh6	174	17	5	5	CD
cord-001824-7c37elh6	174	18	U	U	NNP
cord-001824-7c37elh6	174	19	34	34	CD
cord-001824-7c37elh6	174	20	containing	contain	VBG
cord-001824-7c37elh6	174	21	tRNA	tRNA	NNP
cord-001824-7c37elh6	174	22	Gly	Gly	NNP
cord-001824-7c37elh6	174	23	mcm	mcm	NNP
cord-001824-7c37elh6	174	24	5	5	CD
cord-001824-7c37elh6	174	25	UCC	UCC	NNP
cord-001824-7c37elh6	174	26	.	.	.
cord-001824-7c37elh6	175	1	The	the	DT
cord-001824-7c37elh6	175	2	structure	structure	NN
cord-001824-7c37elh6	175	3	of	of	IN
cord-001824-7c37elh6	175	4	the	the	DT
cord-001824-7c37elh6	175	5	latter	latter	JJ
cord-001824-7c37elh6	175	6	tRNA	tRNA	NNP
cord-001824-7c37elh6	175	7	is	be	VBZ
cord-001824-7c37elh6	175	8	affected	affect	VBN
cord-001824-7c37elh6	175	9	by	by	IN
cord-001824-7c37elh6	175	10	the	the	DT
cord-001824-7c37elh6	175	11	elp3	elp3	NNP
cord-001824-7c37elh6	175	12	mutation	mutation	NN
cord-001824-7c37elh6	175	13	and	and	CC
cord-001824-7c37elh6	175	14	this	this	DT
cord-001824-7c37elh6	175	15	tRNA	tRNA	NNP
cord-001824-7c37elh6	175	16	reads	read	VBZ
cord-001824-7c37elh6	175	17	the	the	DT
cord-001824-7c37elh6	175	18	GGG	GGG	NNP
cord-001824-7c37elh6	175	19	codon	codon	NN
cord-001824-7c37elh6	175	20	very	very	RB
cord-001824-7c37elh6	175	21	inefficiently	inefficiently	RB
cord-001824-7c37elh6	175	22	compared	compare	VBN
cord-001824-7c37elh6	175	23	to	to	IN
cord-001824-7c37elh6	175	24	the	the	DT
cord-001824-7c37elh6	175	25	cognate	cognate	NN
cord-001824-7c37elh6	175	26	tRNA	trna	NN
cord-001824-7c37elh6	175	27	Gly	Gly	NNP
cord-001824-7c37elh6	175	28	CCC	CCC	NNP
cord-001824-7c37elh6	175	29	(	(	-LRB-
cord-001824-7c37elh6	175	30	26	26	CD
cord-001824-7c37elh6	175	31	)	)	-RRB-
cord-001824-7c37elh6	175	32	.	.	.
cord-001824-7c37elh6	176	1	Therefore	therefore	RB
cord-001824-7c37elh6	176	2	,	,	,
cord-001824-7c37elh6	176	3	in	in	IN
cord-001824-7c37elh6	176	4	the	the	DT
cord-001824-7c37elh6	176	5	elp3	elp3	NNP
cord-001824-7c37elh6	176	6	mutant	mutant	NN
cord-001824-7c37elh6	176	7	it	-PRON-	PRP
cord-001824-7c37elh6	176	8	is	be	VBZ
cord-001824-7c37elh6	176	9	not	not	RB
cord-001824-7c37elh6	176	10	likely	likely	JJ
cord-001824-7c37elh6	176	11	that	that	IN
cord-001824-7c37elh6	176	12	tRNA	tRNA	NNP
cord-001824-7c37elh6	176	13	Gly	Gly	NNP
cord-001824-7c37elh6	176	14	mcm	mcm	NNP
cord-001824-7c37elh6	176	15	5	5	CD
cord-001824-7c37elh6	176	16	UCC	UCC	NNP
cord-001824-7c37elh6	176	17	lack-	lack-	VBN
cord-001824-7c37elh6	176	18	Table	Table	NNP
cord-001824-7c37elh6	176	19	2	2	CD
cord-001824-7c37elh6	176	20	.	.	.
cord-001824-7c37elh6	177	1	Influence	influence	NN
cord-001824-7c37elh6	177	2	of	of	IN
cord-001824-7c37elh6	177	3	tRNA	tRNA	NNP
cord-001824-7c37elh6	177	4	modifications	modification	NNS
cord-001824-7c37elh6	177	5	mcm	mcm	NNP
cord-001824-7c37elh6	177	6	5	5	CD
cord-001824-7c37elh6	177	7	s	s	NN
cord-001824-7c37elh6	177	8	2	2	CD
cord-001824-7c37elh6	177	9	U	U	NNP
cord-001824-7c37elh6	177	10	34	34	CD
cord-001824-7c37elh6	177	11	,	,	,
cord-001824-7c37elh6	177	12	mcm	mcm	NNP
cord-001824-7c37elh6	177	13	5	5	CD
cord-001824-7c37elh6	177	14	U	U	NNP
cord-001824-7c37elh6	177	15	34	34	CD
cord-001824-7c37elh6	177	16	,	,	,
cord-001824-7c37elh6	178	1	ncm	ncm	NNP
cord-001824-7c37elh6	178	2	5	5	CD
cord-001824-7c37elh6	178	3	U	U	NNP
cord-001824-7c37elh6	178	4	34	34	CD
cord-001824-7c37elh6	178	5	and	and	CC
cord-001824-7c37elh6	178	6	ncm	ncm	NNP
cord-001824-7c37elh6	178	7	5	5	CD
cord-001824-7c37elh6	178	8	U	U	NNP
cord-001824-7c37elh6	178	9	34	34	CD
cord-001824-7c37elh6	178	10	m	m	NN
cord-001824-7c37elh6	178	11	on	on	IN
cord-001824-7c37elh6	178	12	reading	read	VBG
cord-001824-7c37elh6	178	13	frame	frame	NN
cord-001824-7c37elh6	178	14	maintenance	maintenance	NN
cord-001824-7c37elh6	178	15	based	base	VBN
cord-001824-7c37elh6	178	16	on	on	IN
cord-001824-7c37elh6	178	17	data	datum	NNS
cord-001824-7c37elh6	178	18	using	use	VBG
cord-001824-7c37elh6	178	19	the	the	DT
cord-001824-7c37elh6	178	20	Renilla	Renilla	NNP
cord-001824-7c37elh6	178	21	/	/	SYM
cord-001824-7c37elh6	178	22	Firefly	Firefly	NNP
cord-001824-7c37elh6	178	23	luciferase	luciferase	NN
cord-001824-7c37elh6	178	24	bicistronic	bicistronic	JJ
cord-001824-7c37elh6	178	25	reporter	reporter	NN
cord-001824-7c37elh6	178	26	system	system	NN
cord-001824-7c37elh6	179	1	a	a	DT
cord-001824-7c37elh6	179	2	Bold	bold	JJ
cord-001824-7c37elh6	179	3	indicate	indicate	VBP
cord-001824-7c37elh6	179	4	significant	significant	JJ
cord-001824-7c37elh6	179	5	difference	difference	NN
cord-001824-7c37elh6	179	6	in	in	IN
cord-001824-7c37elh6	179	7	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	179	8	levels	level	NNS
cord-001824-7c37elh6	179	9	between	between	IN
cord-001824-7c37elh6	179	10	indicated	indicate	VBN
cord-001824-7c37elh6	179	11	mutant	mutant	JJ
cord-001824-7c37elh6	179	12	and	and	CC
cord-001824-7c37elh6	179	13	wild	wild	JJ
cord-001824-7c37elh6	179	14	type	type	NN
cord-001824-7c37elh6	179	15	as	as	IN
cord-001824-7c37elh6	179	16	determined	determine	VBN
cord-001824-7c37elh6	179	17	by	by	IN
cord-001824-7c37elh6	179	18	two	two	CD
cord-001824-7c37elh6	179	19	-	-	HYPH
cord-001824-7c37elh6	179	20	tail	tail	NN
cord-001824-7c37elh6	179	21	t	t	NN
cord-001824-7c37elh6	179	22	-	-	HYPH
cord-001824-7c37elh6	179	23	test	test	NN
cord-001824-7c37elh6	179	24	.	.	.
cord-001824-7c37elh6	180	1	(	(	-LRB-
cord-001824-7c37elh6	180	2	*	*	NFP
cord-001824-7c37elh6	180	3	)	)	-RRB-
cord-001824-7c37elh6	180	4	indicates	indicate	VBZ
cord-001824-7c37elh6	180	5	P	p	NN
cord-001824-7c37elh6	180	6	<	<	XX
cord-001824-7c37elh6	180	7	0.05	0.05	CD
cord-001824-7c37elh6	180	8	and	and	CC
cord-001824-7c37elh6	181	1	(	(	-LRB-
cord-001824-7c37elh6	181	2	*	*	NFP
cord-001824-7c37elh6	181	3	*	*	NFP
cord-001824-7c37elh6	181	4	)	)	-RRB-
cord-001824-7c37elh6	181	5	indicates	indicate	VBZ
cord-001824-7c37elh6	181	6	P	p	NN
cord-001824-7c37elh6	181	7	<	<	XX
cord-001824-7c37elh6	181	8	0.01	0.01	CD
cord-001824-7c37elh6	181	9	.	.	.
cord-001824-7c37elh6	182	1	b	b	LS
cord-001824-7c37elh6	182	2	tRNA	trna	NN
cord-001824-7c37elh6	182	3	Tyr	Tyr	NNP
cord-001824-7c37elh6	182	4	G	G	NNP
cord-001824-7c37elh6	182	5	A	A	NNP
cord-001824-7c37elh6	182	6	has	have	VBZ
cord-001824-7c37elh6	182	7	an	an	DT
cord-001824-7c37elh6	182	8	unmodified	unmodified	JJ
cord-001824-7c37elh6	182	9	G	g	NN
cord-001824-7c37elh6	182	10	nucleoside	nucleoside	NN
cord-001824-7c37elh6	182	11	at	at	IN
cord-001824-7c37elh6	182	12	wobble	wobble	NN
cord-001824-7c37elh6	182	13	position	position	NN
cord-001824-7c37elh6	182	14	and	and	CC
cord-001824-7c37elh6	182	15	its	-PRON-	PRP$
cord-001824-7c37elh6	182	16	structure	structure	NN
cord-001824-7c37elh6	182	17	is	be	VBZ
cord-001824-7c37elh6	182	18	not	not	RB
cord-001824-7c37elh6	182	19	affected	affect	VBN
cord-001824-7c37elh6	182	20	by	by	IN
cord-001824-7c37elh6	182	21	the	the	DT
cord-001824-7c37elh6	182	22	elp3	elp3	NNP
cord-001824-7c37elh6	182	23	,	,	,
cord-001824-7c37elh6	182	24	trm9	trm9	NNP
cord-001824-7c37elh6	182	25	or	or	CC
cord-001824-7c37elh6	182	26	tuc1	tuc1	NN
cord-001824-7c37elh6	182	27	mutations	mutation	NNS
cord-001824-7c37elh6	182	28	,	,	,
cord-001824-7c37elh6	182	29	thus	thus	RB
cord-001824-7c37elh6	182	30	it	-PRON-	PRP
cord-001824-7c37elh6	182	31	is	be	VBZ
cord-001824-7c37elh6	182	32	used	use	VBN
cord-001824-7c37elh6	182	33	as	as	IN
cord-001824-7c37elh6	182	34	a	a	DT
cord-001824-7c37elh6	182	35	negative	negative	JJ
cord-001824-7c37elh6	182	36	control	control	NN
cord-001824-7c37elh6	182	37	(	(	-LRB-
cord-001824-7c37elh6	182	38	54	54	CD
cord-001824-7c37elh6	182	39	)	)	-RRB-
cord-001824-7c37elh6	182	40	.	.	.
cord-001824-7c37elh6	183	1	c	c	NNP
cord-001824-7c37elh6	184	1	In	in	IN
cord-001824-7c37elh6	184	2	an	an	DT
cord-001824-7c37elh6	184	3	elp3	elp3	CD
cord-001824-7c37elh6	184	4	mutant	mutant	NN
cord-001824-7c37elh6	184	5	,	,	,
cord-001824-7c37elh6	184	6	levels	level	NNS
cord-001824-7c37elh6	184	7	of	of	IN
cord-001824-7c37elh6	184	8	s	s	NNP
cord-001824-7c37elh6	184	9	2	2	CD
cord-001824-7c37elh6	184	10	group	group	NN
cord-001824-7c37elh6	184	11	is	be	VBZ
cord-001824-7c37elh6	184	12	reduced	reduce	VBN
cord-001824-7c37elh6	184	13	(	(	-LRB-
cord-001824-7c37elh6	184	14	55	55	CD
cord-001824-7c37elh6	184	15	)	)	-RRB-
cord-001824-7c37elh6	184	16	(	(	-LRB-
cord-001824-7c37elh6	184	17	56	56	CD
cord-001824-7c37elh6	184	18	)	)	-RRB-
cord-001824-7c37elh6	184	19	(	(	-LRB-
cord-001824-7c37elh6	184	20	57	57	CD
cord-001824-7c37elh6	184	21	)	)	-RRB-
cord-001824-7c37elh6	184	22	.	.	.
cord-001824-7c37elh6	185	1	d	d	NNP
cord-001824-7c37elh6	185	2	In	in	IN
cord-001824-7c37elh6	185	3	a	a	DT
cord-001824-7c37elh6	185	4	trm9	trm9	NNP
cord-001824-7c37elh6	185	5	mutant	mutant	NN
cord-001824-7c37elh6	185	6	,	,	,
cord-001824-7c37elh6	185	7	tRNA	trna	NN
cord-001824-7c37elh6	185	8	Arg	arg	NN
cord-001824-7c37elh6	185	9	mcm	mcm	NNP
cord-001824-7c37elh6	185	10	5	5	CD
cord-001824-7c37elh6	185	11	UCU	UCU	NNP
cord-001824-7c37elh6	185	12	and	and	CC
cord-001824-7c37elh6	185	13	tRNA	tRNA	NNP
cord-001824-7c37elh6	185	14	Glu	Glu	NNP
cord-001824-7c37elh6	185	15	mcm	mcm	NNP
cord-001824-7c37elh6	185	16	5	5	CD
cord-001824-7c37elh6	185	17	s	s	NNP
cord-001824-7c37elh6	185	18	2	2	CD
cord-001824-7c37elh6	185	19	UUC	UUC	NNP
cord-001824-7c37elh6	185	20	contain	contain	VBP
cord-001824-7c37elh6	185	21	a	a	DT
cord-001824-7c37elh6	185	22	mixture	mixture	NN
cord-001824-7c37elh6	185	23	of	of	IN
cord-001824-7c37elh6	185	24	ncm	ncm	NNP
cord-001824-7c37elh6	185	25	5	5	CD
cord-001824-7c37elh6	185	26	U	U	NNP
cord-001824-7c37elh6	185	27	/	/	SYM
cord-001824-7c37elh6	185	28	cm	cm	NN
cord-001824-7c37elh6	185	29	5	5	CD
cord-001824-7c37elh6	185	30	U	U	NNP
cord-001824-7c37elh6	185	31	and	and	CC
cord-001824-7c37elh6	185	32	ncm	ncm	NNP
cord-001824-7c37elh6	185	33	5	5	CD
cord-001824-7c37elh6	185	34	s	s	POS
cord-001824-7c37elh6	185	35	2	2	CD
cord-001824-7c37elh6	185	36	U	U	NNP
cord-001824-7c37elh6	185	37	/	/	SYM
cord-001824-7c37elh6	185	38	cm	cm	XX
cord-001824-7c37elh6	186	1	5	5	LS
cord-001824-7c37elh6	187	1	s	s	NNP
cord-001824-7c37elh6	188	1	2	2	LS
cord-001824-7c37elh6	188	2	U	U	NNP
cord-001824-7c37elh6	188	3	nucleosides	nucleoside	NNS
cord-001824-7c37elh6	188	4	,	,	,
cord-001824-7c37elh6	188	5	respectively	respectively	RB
cord-001824-7c37elh6	188	6	(	(	-LRB-
cord-001824-7c37elh6	188	7	53	53	CD
cord-001824-7c37elh6	188	8	)	)	-RRB-
cord-001824-7c37elh6	188	9	.	.	.
cord-001824-7c37elh6	189	1	n.a	n.a	NNP
cord-001824-7c37elh6	189	2	.	.	NNP
cord-001824-7c37elh6	189	3	,	,	,
cord-001824-7c37elh6	189	4	not	not	RB
cord-001824-7c37elh6	189	5	applicable	applicable	JJ
cord-001824-7c37elh6	189	6	.	.	.
cord-001824-7c37elh6	190	1	ing	e	VBG
cord-001824-7c37elh6	190	2	the	the	DT
cord-001824-7c37elh6	190	3	mcm	mcm	NNP
cord-001824-7c37elh6	190	4	5	5	CD
cord-001824-7c37elh6	190	5	side	side	NN
cord-001824-7c37elh6	190	6	chain	chain	NN
cord-001824-7c37elh6	190	7	at	at	IN
cord-001824-7c37elh6	190	8	U	U	NNP
cord-001824-7c37elh6	190	9	34	34	CD
cord-001824-7c37elh6	190	10	will	will	MD
cord-001824-7c37elh6	190	11	out	out	RB
cord-001824-7c37elh6	190	12	-	-	HYPH
cord-001824-7c37elh6	190	13	compete	compete	VB
cord-001824-7c37elh6	190	14	the	the	DT
cord-001824-7c37elh6	190	15	efficiently	efficiently	RB
cord-001824-7c37elh6	190	16	decoding	decode	VBG
cord-001824-7c37elh6	190	17	cognate	cognate	JJ
cord-001824-7c37elh6	190	18	tRNA	trna	NN
cord-001824-7c37elh6	190	19	Gly	Gly	NNP
cord-001824-7c37elh6	190	20	CCC	CCC	NNP
cord-001824-7c37elh6	190	21	at	at	IN
cord-001824-7c37elh6	190	22	GGG	GGG	NNP
cord-001824-7c37elh6	190	23	codons	codon	NNS
cord-001824-7c37elh6	190	24	.	.	.
cord-001824-7c37elh6	191	1	Consequently	consequently	RB
cord-001824-7c37elh6	191	2	,	,	,
cord-001824-7c37elh6	191	3	the	the	DT
cord-001824-7c37elh6	191	4	observed	observed	JJ
cord-001824-7c37elh6	191	5	+1	+1	XX
cord-001824-7c37elh6	191	6	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	191	7	for	for	IN
cord-001824-7c37elh6	191	8	tRNA	tRNA	NNP
cord-001824-7c37elh6	191	9	Glu	Glu	NNP
cord-001824-7c37elh6	191	10	mcm	mcm	NNP
cord-001824-7c37elh6	191	11	5	5	CD
cord-001824-7c37elh6	191	12	s	s	NNP
cord-001824-7c37elh6	191	13	2	2	CD
cord-001824-7c37elh6	191	14	UUC	UUC	NNP
cord-001824-7c37elh6	191	15	and	and	CC
cord-001824-7c37elh6	191	16	tRNA	tRNA	NNP
cord-001824-7c37elh6	191	17	Val	Val	NNP
cord-001824-7c37elh6	191	18	ncm	ncm	NNP
cord-001824-7c37elh6	192	1	5	5	CD
cord-001824-7c37elh6	192	2	UAC	UAC	NNP
cord-001824-7c37elh6	192	3	(	(	-LRB-
cord-001824-7c37elh6	192	4	Table	table	NN
cord-001824-7c37elh6	192	5	2	2	CD
cord-001824-7c37elh6	192	6	)	)	-RRB-
cord-001824-7c37elh6	192	7	is	be	VBZ
cord-001824-7c37elh6	192	8	most	most	RBS
cord-001824-7c37elh6	192	9	likely	likely	JJ
cord-001824-7c37elh6	192	10	not	not	RB
cord-001824-7c37elh6	192	11	caused	cause	VBN
cord-001824-7c37elh6	192	12	by	by	IN
cord-001824-7c37elh6	192	13	slippage	slippage	NN
cord-001824-7c37elh6	192	14	of	of	IN
cord-001824-7c37elh6	192	15	an	an	DT
cord-001824-7c37elh6	192	16	unmodified	unmodified	JJ
cord-001824-7c37elh6	192	17	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	192	18	-	-	HYPH
cord-001824-7c37elh6	192	19	tRNA	trna	NN
cord-001824-7c37elh6	192	20	Gly	Gly	NNP
cord-001824-7c37elh6	192	21	mcm	mcm	NNP
cord-001824-7c37elh6	192	22	5	5	CD
cord-001824-7c37elh6	192	23	UCC	UCC	NNP
cord-001824-7c37elh6	192	24	but	but	CC
cord-001824-7c37elh6	192	25	rather	rather	RB
cord-001824-7c37elh6	192	26	a	a	DT
cord-001824-7c37elh6	192	27	poor	poor	JJ
cord-001824-7c37elh6	192	28	A	a	NN
cord-001824-7c37elh6	192	29	-	-	HYPH
cord-001824-7c37elh6	192	30	site	site	NN
cord-001824-7c37elh6	192	31	entry	entry	NN
cord-001824-7c37elh6	192	32	by	by	IN
cord-001824-7c37elh6	192	33	tRNA	tRNA	NNP
cord-001824-7c37elh6	192	34	Glu	Glu	NNP
cord-001824-7c37elh6	192	35	mcm	mcm	NNP
cord-001824-7c37elh6	192	36	5	5	CD
cord-001824-7c37elh6	192	37	s	s	NNP
cord-001824-7c37elh6	192	38	2	2	CD
cord-001824-7c37elh6	192	39	UUC	UUC	NNP
cord-001824-7c37elh6	192	40	and	and	CC
cord-001824-7c37elh6	192	41	tRNA	tRNA	NNP
cord-001824-7c37elh6	192	42	Val	Val	NNP
cord-001824-7c37elh6	192	43	ncm	ncm	NNP
cord-001824-7c37elh6	192	44	5	5	CD
cord-001824-7c37elh6	192	45	UAC	UAC	NNP
cord-001824-7c37elh6	192	46	,	,	,
cord-001824-7c37elh6	192	47	respectively	respectively	RB
cord-001824-7c37elh6	192	48	.	.	.
cord-001824-7c37elh6	193	1	The	the	DT
cord-001824-7c37elh6	193	2	formation	formation	NN
cord-001824-7c37elh6	193	3	of	of	IN
cord-001824-7c37elh6	193	4	the	the	DT
cord-001824-7c37elh6	193	5	esterified	esterify	VBN
cord-001824-7c37elh6	193	6	methyl	methyl	NN
cord-001824-7c37elh6	193	7	group	group	NN
cord-001824-7c37elh6	193	8	of	of	IN
cord-001824-7c37elh6	193	9	mcm	mcm	NNP
cord-001824-7c37elh6	193	10	5	5	CD
cord-001824-7c37elh6	193	11	U	U	NNP
cord-001824-7c37elh6	193	12	,	,	,
cord-001824-7c37elh6	193	13	which	which	WDT
cord-001824-7c37elh6	193	14	is	be	VBZ
cord-001824-7c37elh6	193	15	the	the	DT
cord-001824-7c37elh6	193	16	last	last	JJ
cord-001824-7c37elh6	193	17	step	step	NN
cord-001824-7c37elh6	193	18	in	in	IN
cord-001824-7c37elh6	193	19	the	the	DT
cord-001824-7c37elh6	193	20	synthesis	synthesis	NN
cord-001824-7c37elh6	193	21	of	of	IN
cord-001824-7c37elh6	193	22	the	the	DT
cord-001824-7c37elh6	193	23	mcm	mcm	NNP
cord-001824-7c37elh6	193	24	5	5	CD
cord-001824-7c37elh6	193	25	side	side	NN
cord-001824-7c37elh6	193	26	chain	chain	NN
cord-001824-7c37elh6	193	27	,	,	,
cord-001824-7c37elh6	193	28	is	be	VBZ
cord-001824-7c37elh6	193	29	catalyzed	catalyze	VBN
cord-001824-7c37elh6	193	30	by	by	IN
cord-001824-7c37elh6	193	31	the	the	DT
cord-001824-7c37elh6	193	32	dimeric	dimeric	JJ
cord-001824-7c37elh6	193	33	Trm9	Trm9	NNP
cord-001824-7c37elh6	193	34	/	/	SYM
cord-001824-7c37elh6	193	35	Trm112	Trm112	NNP
cord-001824-7c37elh6	193	36	protein	protein	NN
cord-001824-7c37elh6	193	37	complex	complex	NN
cord-001824-7c37elh6	193	38	(	(	-LRB-
cord-001824-7c37elh6	193	39	46	46	CD
cord-001824-7c37elh6	193	40	,	,	,
cord-001824-7c37elh6	193	41	47	47	CD
cord-001824-7c37elh6	193	42	)	)	-RRB-
cord-001824-7c37elh6	193	43	.	.	.
cord-001824-7c37elh6	194	1	The	the	DT
cord-001824-7c37elh6	194	2	influence	influence	NN
cord-001824-7c37elh6	194	3	of	of	IN
cord-001824-7c37elh6	194	4	the	the	DT
cord-001824-7c37elh6	194	5	esterified	esterify	VBN
cord-001824-7c37elh6	194	6	methyl	methyl	NN
cord-001824-7c37elh6	194	7	group	group	NN
cord-001824-7c37elh6	194	8	of	of	IN
cord-001824-7c37elh6	194	9	the	the	DT
cord-001824-7c37elh6	194	10	mcm	mcm	NNP
cord-001824-7c37elh6	194	11	5	5	CD
cord-001824-7c37elh6	194	12	U	U	NNP
cord-001824-7c37elh6	194	13	34	34	CD
cord-001824-7c37elh6	194	14	and	and	CC
cord-001824-7c37elh6	194	15	mcm	mcm	NNP
cord-001824-7c37elh6	194	16	5	5	CD
cord-001824-7c37elh6	194	17	s	s	NN
cord-001824-7c37elh6	194	18	2	2	CD
cord-001824-7c37elh6	194	19	U	U	NNP
cord-001824-7c37elh6	194	20	34	34	CD
cord-001824-7c37elh6	194	21	nucleoside	nucleoside	NN
cord-001824-7c37elh6	194	22	in	in	IN
cord-001824-7c37elh6	194	23	reading	read	VBG
cord-001824-7c37elh6	194	24	frame	frame	NN
cord-001824-7c37elh6	194	25	maintenance	maintenance	NN
cord-001824-7c37elh6	194	26	was	be	VBD
cord-001824-7c37elh6	194	27	investigated	investigate	VBN
cord-001824-7c37elh6	194	28	in	in	IN
cord-001824-7c37elh6	194	29	a	a	DT
cord-001824-7c37elh6	194	30	wild	wild	JJ
cord-001824-7c37elh6	194	31	type	type	NN
cord-001824-7c37elh6	194	32	and	and	CC
cord-001824-7c37elh6	194	33	in	in	IN
cord-001824-7c37elh6	194	34	a	a	DT
cord-001824-7c37elh6	194	35	trm9	trm9	NNP
cord-001824-7c37elh6	194	36	mutant	mutant	JJ
cord-001824-7c37elh6	194	37	strain	strain	NN
cord-001824-7c37elh6	194	38	using	use	VBG
cord-001824-7c37elh6	194	39	cognate	cognate	JJ
cord-001824-7c37elh6	194	40	or	or	CC
cord-001824-7c37elh6	194	41	near	near	IN
cord-001824-7c37elh6	194	42	cognate	cognate	JJ
cord-001824-7c37elh6	194	43	codons	codon	NNS
cord-001824-7c37elh6	194	44	as	as	IN
cord-001824-7c37elh6	194	45	test	test	NN
cord-001824-7c37elh6	194	46	codons	codon	NNS
cord-001824-7c37elh6	194	47	(	(	-LRB-
cord-001824-7c37elh6	194	48	Table	table	NN
cord-001824-7c37elh6	194	49	2	2	CD
cord-001824-7c37elh6	194	50	)	)	-RRB-
cord-001824-7c37elh6	194	51	.	.	.
cord-001824-7c37elh6	195	1	Lack	lack	NN
cord-001824-7c37elh6	195	2	of	of	IN
cord-001824-7c37elh6	195	3	the	the	DT
cord-001824-7c37elh6	195	4	esterified	esterify	VBN
cord-001824-7c37elh6	195	5	methyl	methyl	NN
cord-001824-7c37elh6	195	6	group	group	NN
cord-001824-7c37elh6	195	7	of	of	IN
cord-001824-7c37elh6	195	8	the	the	DT
cord-001824-7c37elh6	195	9	mcm	mcm	NNP
cord-001824-7c37elh6	195	10	5	5	CD
cord-001824-7c37elh6	195	11	side	side	NN
cord-001824-7c37elh6	195	12	chain	chain	NN
cord-001824-7c37elh6	195	13	of	of	IN
cord-001824-7c37elh6	195	14	U	U	NNP
cord-001824-7c37elh6	195	15	34	34	CD
cord-001824-7c37elh6	195	16	in	in	IN
cord-001824-7c37elh6	195	17	tRNA	tRNA	NNP
cord-001824-7c37elh6	195	18	Gln	Gln	NNP
cord-001824-7c37elh6	195	19	mcm	mcm	NNP
cord-001824-7c37elh6	195	20	5	5	CD
cord-001824-7c37elh6	195	21	s	s	NN
cord-001824-7c37elh6	195	22	2	2	CD
cord-001824-7c37elh6	195	23	UUG	UUG	NNP
cord-001824-7c37elh6	195	24	resulted	result	VBD
cord-001824-7c37elh6	195	25	in	in	IN
cord-001824-7c37elh6	195	26	significantly	significantly	RB
cord-001824-7c37elh6	195	27	decreased	decrease	VBN
cord-001824-7c37elh6	195	28	+1	+1	NNS
cord-001824-7c37elh6	195	29	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	195	30	at	at	IN
cord-001824-7c37elh6	195	31	the	the	DT
cord-001824-7c37elh6	195	32	Gln	Gln	NNP
cord-001824-7c37elh6	195	33	codon	codon	NN
cord-001824-7c37elh6	195	34	CAA	caa	NN
cord-001824-7c37elh6	195	35	(	(	-LRB-
cord-001824-7c37elh6	195	36	Table	Table	NNP
cord-001824-7c37elh6	195	37	2	2	CD
cord-001824-7c37elh6	195	38	and	and	CC
cord-001824-7c37elh6	195	39	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	195	40	Figure	Figure	NNP
cord-001824-7c37elh6	195	41	S1	S1	NNP
cord-001824-7c37elh6	195	42	)	)	-RRB-
cord-001824-7c37elh6	195	43	.	.	.
cord-001824-7c37elh6	196	1	There	there	EX
cord-001824-7c37elh6	196	2	were	be	VBD
cord-001824-7c37elh6	196	3	no	no	DT
cord-001824-7c37elh6	196	4	significant	significant	JJ
cord-001824-7c37elh6	196	5	differences	difference	NNS
cord-001824-7c37elh6	196	6	in	in	IN
cord-001824-7c37elh6	196	7	the	the	DT
cord-001824-7c37elh6	196	8	levels	level	NNS
cord-001824-7c37elh6	196	9	of	of	IN
cord-001824-7c37elh6	196	10	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	196	11	between	between	IN
cord-001824-7c37elh6	196	12	wild	wild	JJ
cord-001824-7c37elh6	196	13	type	type	NN
cord-001824-7c37elh6	196	14	and	and	CC
cord-001824-7c37elh6	196	15	trm9	trm9	NN
cord-001824-7c37elh6	196	16	mutant	mutant	NN
cord-001824-7c37elh6	196	17	in	in	IN
cord-001824-7c37elh6	196	18	the	the	DT
cord-001824-7c37elh6	196	19	remaining	remain	VBG
cord-001824-7c37elh6	196	20	test	test	NN
cord-001824-7c37elh6	196	21	constructs	construct	NNS
cord-001824-7c37elh6	196	22	(	(	-LRB-
cord-001824-7c37elh6	196	23	Table	table	NN
cord-001824-7c37elh6	196	24	2	2	CD
cord-001824-7c37elh6	196	25	and	and	CC
cord-001824-7c37elh6	196	26	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	196	27	Figure	Figure	NNP
cord-001824-7c37elh6	196	28	S1	S1	NNP
cord-001824-7c37elh6	196	29	)	)	-RRB-
cord-001824-7c37elh6	196	30	.	.	.
cord-001824-7c37elh6	197	1	We	-PRON-	PRP
cord-001824-7c37elh6	197	2	conclude	conclude	VBP
cord-001824-7c37elh6	197	3	that	that	IN
cord-001824-7c37elh6	197	4	presence	presence	NN
cord-001824-7c37elh6	197	5	or	or	CC
cord-001824-7c37elh6	197	6	absence	absence	NN
cord-001824-7c37elh6	197	7	of	of	IN
cord-001824-7c37elh6	197	8	the	the	DT
cord-001824-7c37elh6	197	9	esterified	esterify	VBN
cord-001824-7c37elh6	197	10	methyl	methyl	NN
cord-001824-7c37elh6	197	11	group	group	NN
cord-001824-7c37elh6	197	12	in	in	IN
cord-001824-7c37elh6	197	13	the	the	DT
cord-001824-7c37elh6	197	14	mcm	mcm	NNP
cord-001824-7c37elh6	197	15	5	5	CD
cord-001824-7c37elh6	197	16	side	side	NN
cord-001824-7c37elh6	197	17	chain	chain	NN
cord-001824-7c37elh6	197	18	only	only	RB
cord-001824-7c37elh6	197	19	seem	seem	VBP
cord-001824-7c37elh6	197	20	to	to	TO
cord-001824-7c37elh6	197	21	play	play	VB
cord-001824-7c37elh6	197	22	a	a	DT
cord-001824-7c37elh6	197	23	minor	minor	JJ
cord-001824-7c37elh6	197	24	role	role	NN
cord-001824-7c37elh6	197	25	in	in	IN
cord-001824-7c37elh6	197	26	+1	+1	NN
cord-001824-7c37elh6	197	27	frameshifting	frameshifting	NN
cord-001824-7c37elh6	197	28	.	.	.
cord-001824-7c37elh6	198	1	In	in	IN
cord-001824-7c37elh6	198	2	a	a	DT
cord-001824-7c37elh6	198	3	tuc1	tuc1	NN
cord-001824-7c37elh6	198	4	mutant	mutant	NN
cord-001824-7c37elh6	198	5	,	,	,
cord-001824-7c37elh6	198	6	the	the	DT
cord-001824-7c37elh6	198	7	s	s	NNP
cord-001824-7c37elh6	198	8	2	2	CD
cord-001824-7c37elh6	198	9	group	group	NN
cord-001824-7c37elh6	198	10	of	of	IN
cord-001824-7c37elh6	198	11	mcm	mcm	NNP
cord-001824-7c37elh6	198	12	5	5	CD
cord-001824-7c37elh6	198	13	s	s	NNP
cord-001824-7c37elh6	199	1	2	2	LS
cord-001824-7c37elh6	199	2	U	u	NN
cord-001824-7c37elh6	199	3	at	at	IN
cord-001824-7c37elh6	199	4	the	the	DT
cord-001824-7c37elh6	199	5	wobble	wobble	NN
cord-001824-7c37elh6	199	6	position	position	NN
cord-001824-7c37elh6	199	7	(	(	-LRB-
cord-001824-7c37elh6	199	8	U	U	NNP
cord-001824-7c37elh6	199	9	34	34	CD
cord-001824-7c37elh6	199	10	)	)	-RRB-
cord-001824-7c37elh6	199	11	is	be	VBZ
cord-001824-7c37elh6	199	12	absent	absent	JJ
cord-001824-7c37elh6	199	13	in	in	IN
cord-001824-7c37elh6	199	14	tRNA	tRNA	NNP
cord-001824-7c37elh6	199	15	Gln	Gln	NNP
cord-001824-7c37elh6	199	16	mcm	mcm	NNP
cord-001824-7c37elh6	199	17	5	5	CD
cord-001824-7c37elh6	199	18	s	s	NN
cord-001824-7c37elh6	199	19	2	2	CD
cord-001824-7c37elh6	199	20	UUG	UUG	NNP
cord-001824-7c37elh6	199	21	,	,	,
cord-001824-7c37elh6	199	22	tRNA	tRNA	NNP
cord-001824-7c37elh6	199	23	Lys	Lys	NNP
cord-001824-7c37elh6	199	24	mcm	mcm	NNP
cord-001824-7c37elh6	199	25	5	5	CD
cord-001824-7c37elh6	199	26	s	s	NN
cord-001824-7c37elh6	199	27	2	2	CD
cord-001824-7c37elh6	199	28	UUU	UUU	NNP
cord-001824-7c37elh6	199	29	and	and	CC
cord-001824-7c37elh6	199	30	tRNA	tRNA	NNP
cord-001824-7c37elh6	200	1	Glu	Glu	NNP
cord-001824-7c37elh6	200	2	mcm	mcm	NNP
cord-001824-7c37elh6	200	3	5	5	CD
cord-001824-7c37elh6	201	1	s	s	NNP
cord-001824-7c37elh6	201	2	2	2	CD
cord-001824-7c37elh6	201	3	UUC	UUC	NNP
cord-001824-7c37elh6	201	4	(	(	-LRB-
cord-001824-7c37elh6	201	5	48	48	CD
cord-001824-7c37elh6	201	6	)	)	-RRB-
cord-001824-7c37elh6	201	7	.	.	.
cord-001824-7c37elh6	202	1	The	the	DT
cord-001824-7c37elh6	202	2	role	role	NN
cord-001824-7c37elh6	202	3	of	of	IN
cord-001824-7c37elh6	202	4	the	the	DT
cord-001824-7c37elh6	202	5	s	s	NNP
cord-001824-7c37elh6	202	6	2	2	CD
cord-001824-7c37elh6	202	7	group	group	NN
cord-001824-7c37elh6	202	8	present	present	NN
cord-001824-7c37elh6	202	9	in	in	IN
cord-001824-7c37elh6	202	10	these	these	DT
cord-001824-7c37elh6	202	11	tRNAs	trna	NNS
cord-001824-7c37elh6	202	12	in	in	IN
cord-001824-7c37elh6	202	13	reading	read	VBG
cord-001824-7c37elh6	202	14	frame	frame	NN
cord-001824-7c37elh6	202	15	maintenance	maintenance	NN
cord-001824-7c37elh6	202	16	was	be	VBD
cord-001824-7c37elh6	202	17	investigated	investigate	VBN
cord-001824-7c37elh6	202	18	in	in	IN
cord-001824-7c37elh6	202	19	a	a	DT
cord-001824-7c37elh6	202	20	wild	wild	JJ
cord-001824-7c37elh6	202	21	type	type	NN
cord-001824-7c37elh6	202	22	and	and	CC
cord-001824-7c37elh6	202	23	a	a	DT
cord-001824-7c37elh6	202	24	tuc1	tuc1	NN
cord-001824-7c37elh6	202	25	mutant	mutant	JJ
cord-001824-7c37elh6	202	26	strain	strain	NN
cord-001824-7c37elh6	202	27	using	use	VBG
cord-001824-7c37elh6	202	28	cognate	cognate	JJ
cord-001824-7c37elh6	202	29	or	or	CC
cord-001824-7c37elh6	202	30	near	near	IN
cord-001824-7c37elh6	202	31	cognate	cognate	JJ
cord-001824-7c37elh6	202	32	codons	codon	NNS
cord-001824-7c37elh6	202	33	as	as	IN
cord-001824-7c37elh6	202	34	test	test	NN
cord-001824-7c37elh6	202	35	codons	codon	NNS
cord-001824-7c37elh6	202	36	(	(	-LRB-
cord-001824-7c37elh6	202	37	Table	table	NN
cord-001824-7c37elh6	202	38	2	2	CD
cord-001824-7c37elh6	202	39	)	)	-RRB-
cord-001824-7c37elh6	202	40	.	.	.
cord-001824-7c37elh6	203	1	Absence	absence	NN
cord-001824-7c37elh6	203	2	of	of	IN
cord-001824-7c37elh6	203	3	the	the	DT
cord-001824-7c37elh6	203	4	s	s	NNP
cord-001824-7c37elh6	203	5	2	2	CD
cord-001824-7c37elh6	203	6	group	group	NN
cord-001824-7c37elh6	203	7	in	in	IN
cord-001824-7c37elh6	203	8	tRNA	tRNA	NNP
cord-001824-7c37elh6	203	9	Lys	Lys	NNP
cord-001824-7c37elh6	203	10	mcm	mcm	NNP
cord-001824-7c37elh6	203	11	5	5	CD
cord-001824-7c37elh6	203	12	s	s	NN
cord-001824-7c37elh6	203	13	2	2	CD
cord-001824-7c37elh6	203	14	UUU	UUU	NNP
cord-001824-7c37elh6	203	15	and	and	CC
cord-001824-7c37elh6	203	16	tRNA	tRNA	NNP
cord-001824-7c37elh6	203	17	Glu	Glu	NNP
cord-001824-7c37elh6	203	18	mcm	mcm	NNP
cord-001824-7c37elh6	204	1	5	5	LS
cord-001824-7c37elh6	204	2	s	s	POS
cord-001824-7c37elh6	204	3	2	2	CD
cord-001824-7c37elh6	204	4	UUC	UUC	NNP
cord-001824-7c37elh6	204	5	resulted	result	VBD
cord-001824-7c37elh6	204	6	in	in	IN
cord-001824-7c37elh6	204	7	significantly	significantly	RB
cord-001824-7c37elh6	204	8	higher	high	JJR
cord-001824-7c37elh6	204	9	levels	level	NNS
cord-001824-7c37elh6	204	10	of	of	IN
cord-001824-7c37elh6	204	11	+1	+1	NN
cord-001824-7c37elh6	204	12	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	204	13	with	with	IN
cord-001824-7c37elh6	204	14	either	either	CC
cord-001824-7c37elh6	204	15	A	a	DT
cord-001824-7c37elh6	204	16	-	-	HYPH
cord-001824-7c37elh6	204	17	ending	end	VBG
cord-001824-7c37elh6	204	18	cognate	cognate	NN
cord-001824-7c37elh6	204	19	or	or	CC
cord-001824-7c37elh6	204	20	G	g	NN
cord-001824-7c37elh6	204	21	-	-	HYPH
cord-001824-7c37elh6	204	22	ending	end	VBG
cord-001824-7c37elh6	204	23	near	near	IN
cord-001824-7c37elh6	204	24	cognate	cognate	JJ
cord-001824-7c37elh6	204	25	codons	codon	NNS
cord-001824-7c37elh6	204	26	(	(	-LRB-
cord-001824-7c37elh6	204	27	Table	Table	NNP
cord-001824-7c37elh6	204	28	2	2	CD
cord-001824-7c37elh6	204	29	and	and	CC
cord-001824-7c37elh6	204	30	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	204	31	Figure	Figure	NNP
cord-001824-7c37elh6	204	32	S1	S1	NNP
cord-001824-7c37elh6	204	33	)	)	-RRB-
cord-001824-7c37elh6	204	34	.	.	.
cord-001824-7c37elh6	205	1	However	however	RB
cord-001824-7c37elh6	205	2	,	,	,
cord-001824-7c37elh6	205	3	lack	lack	NN
cord-001824-7c37elh6	205	4	of	of	IN
cord-001824-7c37elh6	205	5	the	the	DT
cord-001824-7c37elh6	205	6	s	s	NNP
cord-001824-7c37elh6	205	7	2	2	CD
cord-001824-7c37elh6	205	8	group	group	NN
cord-001824-7c37elh6	205	9	in	in	IN
cord-001824-7c37elh6	205	10	tRNA	tRNA	NNP
cord-001824-7c37elh6	205	11	Gln	Gln	NNP
cord-001824-7c37elh6	205	12	mcm	mcm	NNP
cord-001824-7c37elh6	205	13	5	5	CD
cord-001824-7c37elh6	205	14	s	s	NN
cord-001824-7c37elh6	205	15	2	2	CD
cord-001824-7c37elh6	205	16	UUG	UUG	NNP
cord-001824-7c37elh6	205	17	resulted	result	VBD
cord-001824-7c37elh6	205	18	in	in	IN
cord-001824-7c37elh6	205	19	significantly	significantly	RB
cord-001824-7c37elh6	205	20	decreased	decrease	VBN
cord-001824-7c37elh6	205	21	+1	+1	NNS
cord-001824-7c37elh6	205	22	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	205	23	with	with	IN
cord-001824-7c37elh6	205	24	the	the	DT
cord-001824-7c37elh6	205	25	near	near	JJ
cord-001824-7c37elh6	205	26	cognate	cognate	JJ
cord-001824-7c37elh6	205	27	CAG	CAG	NNP
cord-001824-7c37elh6	205	28	(	(	-LRB-
cord-001824-7c37elh6	205	29	Table	Table	NNP
cord-001824-7c37elh6	205	30	2	2	CD
cord-001824-7c37elh6	205	31	and	and	CC
cord-001824-7c37elh6	205	32	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	205	33	Figure	Figure	NNP
cord-001824-7c37elh6	205	34	S1	S1	NNP
cord-001824-7c37elh6	205	35	)	)	-RRB-
cord-001824-7c37elh6	205	36	.	.	.
cord-001824-7c37elh6	206	1	In	in	IN
cord-001824-7c37elh6	206	2	the	the	DT
cord-001824-7c37elh6	206	3	cases	case	NNS
cord-001824-7c37elh6	206	4	stated	state	VBN
cord-001824-7c37elh6	206	5	above	above	RB
cord-001824-7c37elh6	206	6	,	,	,
cord-001824-7c37elh6	206	7	Gln	Gln	NNP
cord-001824-7c37elh6	206	8	-	-	HYPH
cord-001824-7c37elh6	206	9	and	and	CC
cord-001824-7c37elh6	206	10	Pro	Pro	NNP
cord-001824-7c37elh6	206	11	-	-	NNS
cord-001824-7c37elh6	206	12	tRNAs	tRNAs	NNP
cord-001824-7c37elh6	206	13	showed	show	VBD
cord-001824-7c37elh6	206	14	reduced	reduced	JJ
cord-001824-7c37elh6	206	15	levels	level	NNS
cord-001824-7c37elh6	206	16	of	of	IN
cord-001824-7c37elh6	206	17	+1	+1	NN
cord-001824-7c37elh6	206	18	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	206	19	due	due	IN
cord-001824-7c37elh6	206	20	to	to	IN
cord-001824-7c37elh6	206	21	lack	lack	NN
cord-001824-7c37elh6	206	22	of	of	IN
cord-001824-7c37elh6	206	23	esterified	esterify	VBN
cord-001824-7c37elh6	206	24	methyl	methyl	NN
cord-001824-7c37elh6	206	25	,	,	,
cord-001824-7c37elh6	206	26	s	s	NNP
cord-001824-7c37elh6	206	27	2	2	CD
cord-001824-7c37elh6	206	28	or	or	CC
cord-001824-7c37elh6	206	29	ncm	ncm	NNP
cord-001824-7c37elh6	206	30	5	5	CD
cord-001824-7c37elh6	206	31	groups	group	NNS
cord-001824-7c37elh6	206	32	(	(	-LRB-
cord-001824-7c37elh6	206	33	Table	Table	NNP
cord-001824-7c37elh6	206	34	2	2	CD
cord-001824-7c37elh6	206	35	)	)	-RRB-
cord-001824-7c37elh6	206	36	.	.	.
cord-001824-7c37elh6	207	1	This	this	DT
cord-001824-7c37elh6	207	2	reduced	reduce	VBN
cord-001824-7c37elh6	207	3	level	level	NN
cord-001824-7c37elh6	207	4	of	of	IN
cord-001824-7c37elh6	207	5	frameshifting	frameshifting	NN
cord-001824-7c37elh6	207	6	might	may	MD
cord-001824-7c37elh6	207	7	be	be	VB
cord-001824-7c37elh6	207	8	surprising	surprising	JJ
cord-001824-7c37elh6	207	9	but	but	CC
cord-001824-7c37elh6	207	10	similar	similar	JJ
cord-001824-7c37elh6	207	11	observations	observation	NNS
cord-001824-7c37elh6	207	12	were	be	VBD
cord-001824-7c37elh6	207	13	noted	note	VBN
cord-001824-7c37elh6	207	14	earlier	early	RBR
cord-001824-7c37elh6	207	15	.	.	.
cord-001824-7c37elh6	208	1	In	in	IN
cord-001824-7c37elh6	208	2	bacteria	bacteria	NNS
cord-001824-7c37elh6	208	3	the	the	DT
cord-001824-7c37elh6	208	4	Gln-	Gln-	NNPS
cord-001824-7c37elh6	208	5	,	,	,
cord-001824-7c37elh6	208	6	Lys	Lys	NNP
cord-001824-7c37elh6	208	7	-	-	:
cord-001824-7c37elh6	208	8	and	and	CC
cord-001824-7c37elh6	208	9	Glu	Glu	NNP
cord-001824-7c37elh6	208	10	-	-	HYPH
cord-001824-7c37elh6	208	11	tRNA	tRNA	NNP
cord-001824-7c37elh6	208	12	contain	contain	VBP
cord-001824-7c37elh6	208	13	as	as	IN
cord-001824-7c37elh6	208	14	wobble	wobble	NN
cord-001824-7c37elh6	209	1	nucleoside	nucleoside	RB
cord-001824-7c37elh6	210	1	the	the	DT
cord-001824-7c37elh6	210	2	mnm	mnm	NNP
cord-001824-7c37elh6	210	3	5	5	NNP
cord-001824-7c37elh6	210	4	s	s	NNP
cord-001824-7c37elh6	210	5	2	2	CD
cord-001824-7c37elh6	210	6	U	U	NNP
cord-001824-7c37elh6	210	7	,	,	,
cord-001824-7c37elh6	210	8	which	which	WDT
cord-001824-7c37elh6	210	9	is	be	VBZ
cord-001824-7c37elh6	210	10	structurally	structurally	RB
cord-001824-7c37elh6	210	11	related	relate	VBN
cord-001824-7c37elh6	210	12	to	to	IN
cord-001824-7c37elh6	210	13	the	the	DT
cord-001824-7c37elh6	210	14	mcm	mcm	NNP
cord-001824-7c37elh6	210	15	5	5	CD
cord-001824-7c37elh6	210	16	s	s	NN
cord-001824-7c37elh6	210	17	2	2	CD
cord-001824-7c37elh6	210	18	U	U	NNP
cord-001824-7c37elh6	210	19	present	present	JJ
cord-001824-7c37elh6	210	20	in	in	IN
cord-001824-7c37elh6	210	21	the	the	DT
cord-001824-7c37elh6	210	22	corresponding	correspond	VBG
cord-001824-7c37elh6	210	23	yeast	yeast	NN
cord-001824-7c37elh6	210	24	tRNAs	trna	NNS
cord-001824-7c37elh6	210	25	.	.	.
cord-001824-7c37elh6	211	1	Lack	lack	NN
cord-001824-7c37elh6	211	2	of	of	IN
cord-001824-7c37elh6	211	3	either	either	CC
cord-001824-7c37elh6	211	4	the	the	DT
cord-001824-7c37elh6	211	5	mnm	mnm	NNP
cord-001824-7c37elh6	211	6	5	5	CD
cord-001824-7c37elh6	211	7	side	side	NN
cord-001824-7c37elh6	211	8	chain	chain	NN
cord-001824-7c37elh6	211	9	or	or	CC
cord-001824-7c37elh6	211	10	the	the	DT
cord-001824-7c37elh6	211	11	sulphur	sulphur	NN
cord-001824-7c37elh6	211	12	at	at	IN
cord-001824-7c37elh6	211	13	position	position	NN
cord-001824-7c37elh6	211	14	2	2	CD
cord-001824-7c37elh6	211	15	reduced	reduce	VBN
cord-001824-7c37elh6	211	16	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	211	17	similarly	similarly	RB
cord-001824-7c37elh6	211	18	as	as	IN
cord-001824-7c37elh6	211	19	noted	note	VBN
cord-001824-7c37elh6	211	20	by	by	IN
cord-001824-7c37elh6	211	21	us	-PRON-	PRP
cord-001824-7c37elh6	211	22	for	for	IN
cord-001824-7c37elh6	211	23	the	the	DT
cord-001824-7c37elh6	211	24	two	two	CD
cord-001824-7c37elh6	211	25	aforementioned	aforementioned	JJ
cord-001824-7c37elh6	211	26	cases	case	NNS
cord-001824-7c37elh6	211	27	(	(	-LRB-
cord-001824-7c37elh6	211	28	15	15	CD
cord-001824-7c37elh6	211	29	,	,	,
cord-001824-7c37elh6	211	30	16	16	CD
cord-001824-7c37elh6	211	31	)	)	-RRB-
cord-001824-7c37elh6	211	32	.	.	.
cord-001824-7c37elh6	212	1	Although	although	IN
cord-001824-7c37elh6	212	2	these	these	DT
cord-001824-7c37elh6	212	3	results	result	NNS
cord-001824-7c37elh6	212	4	seems	seem	VBZ
cord-001824-7c37elh6	212	5	counterintuitively	counterintuitively	RB
cord-001824-7c37elh6	212	6	strange	strange	JJ
cord-001824-7c37elh6	212	7	,	,	,
cord-001824-7c37elh6	212	8	one	one	PRP
cord-001824-7c37elh6	212	9	has	have	VBZ
cord-001824-7c37elh6	212	10	to	to	TO
cord-001824-7c37elh6	212	11	remember	remember	VB
cord-001824-7c37elh6	212	12	that	that	IN
cord-001824-7c37elh6	212	13	the	the	DT
cord-001824-7c37elh6	212	14	structure	structure	NN
cord-001824-7c37elh6	212	15	of	of	IN
cord-001824-7c37elh6	212	16	the	the	DT
cord-001824-7c37elh6	212	17	different	different	JJ
cord-001824-7c37elh6	212	18	tRNA	tRNA	NNP
cord-001824-7c37elh6	212	19	species	specie	NNS
cord-001824-7c37elh6	212	20	is	be	VBZ
cord-001824-7c37elh6	212	21	optimized	optimize	VBN
cord-001824-7c37elh6	212	22	and	and	CC
cord-001824-7c37elh6	212	23	in	in	IN
cord-001824-7c37elh6	212	24	fact	fact	NN
cord-001824-7c37elh6	212	25	has	have	VBZ
cord-001824-7c37elh6	212	26	evolved	evolve	VBN
cord-001824-7c37elh6	212	27	to	to	TO
cord-001824-7c37elh6	212	28	have	have	VB
cord-001824-7c37elh6	212	29	similar	similar	JJ
cord-001824-7c37elh6	212	30	decoding	decoding	NN
cord-001824-7c37elh6	212	31	activity	activity	NN
cord-001824-7c37elh6	212	32	,	,	,
cord-001824-7c37elh6	212	33	which	which	WDT
cord-001824-7c37elh6	212	34	is	be	VBZ
cord-001824-7c37elh6	212	35	obtained	obtain	VBN
cord-001824-7c37elh6	212	36	partly	partly	RB
cord-001824-7c37elh6	212	37	due	due	JJ
cord-001824-7c37elh6	212	38	to	to	IN
cord-001824-7c37elh6	212	39	modification	modification	NN
cord-001824-7c37elh6	212	40	of	of	IN
cord-001824-7c37elh6	212	41	it	-PRON-	PRP
cord-001824-7c37elh6	212	42	(	(	-LRB-
cord-001824-7c37elh6	212	43	49	49	CD
cord-001824-7c37elh6	212	44	)	)	-RRB-
cord-001824-7c37elh6	212	45	.	.	.
cord-001824-7c37elh6	213	1	Therefore	therefore	RB
cord-001824-7c37elh6	213	2	,	,	,
cord-001824-7c37elh6	213	3	a	a	DT
cord-001824-7c37elh6	213	4	modification	modification	NN
cord-001824-7c37elh6	213	5	may	may	MD
cord-001824-7c37elh6	213	6	improve	improve	VB
cord-001824-7c37elh6	213	7	the	the	DT
cord-001824-7c37elh6	213	8	activity	activity	NN
cord-001824-7c37elh6	213	9	of	of	IN
cord-001824-7c37elh6	213	10	one	one	CD
cord-001824-7c37elh6	213	11	tRNA	trna	NN
cord-001824-7c37elh6	213	12	whereas	whereas	IN
cord-001824-7c37elh6	213	13	it	-PRON-	PRP
cord-001824-7c37elh6	213	14	might	may	MD
cord-001824-7c37elh6	213	15	reduce	reduce	VB
cord-001824-7c37elh6	213	16	the	the	DT
cord-001824-7c37elh6	213	17	activity	activity	NN
cord-001824-7c37elh6	213	18	of	of	IN
cord-001824-7c37elh6	213	19	another	another	DT
cord-001824-7c37elh6	213	20	tRNA	tRNA	NNP
cord-001824-7c37elh6	213	21	species	specie	NNS
cord-001824-7c37elh6	213	22	(	(	-LRB-
cord-001824-7c37elh6	214	1	See	see	VB
cord-001824-7c37elh6	214	2	discussion	discussion	NN
cord-001824-7c37elh6	214	3	of	of	IN
cord-001824-7c37elh6	214	4	this	this	DT
cord-001824-7c37elh6	214	5	issue	issue	NN
cord-001824-7c37elh6	214	6	in	in	IN
cord-001824-7c37elh6	214	7	Björk	Björk	NNP
cord-001824-7c37elh6	214	8	and	and	CC
cord-001824-7c37elh6	214	9	Hagervall	Hagervall	NNP
cord-001824-7c37elh6	214	10	(	(	-LRB-
cord-001824-7c37elh6	214	11	4	4	CD
cord-001824-7c37elh6	214	12	)	)	-RRB-
cord-001824-7c37elh6	214	13	)	)	-RRB-
cord-001824-7c37elh6	214	14	.	.	.
cord-001824-7c37elh6	215	1	From	from	IN
cord-001824-7c37elh6	215	2	such	such	JJ
cord-001824-7c37elh6	215	3	considerations	consideration	NNS
cord-001824-7c37elh6	215	4	,	,	,
cord-001824-7c37elh6	215	5	one	one	PRP
cord-001824-7c37elh6	215	6	would	would	MD
cord-001824-7c37elh6	215	7	expect	expect	VB
cord-001824-7c37elh6	215	8	that	that	IN
cord-001824-7c37elh6	215	9	when	when	WRB
cord-001824-7c37elh6	215	10	measuring	measure	VBG
cord-001824-7c37elh6	215	11	a	a	DT
cord-001824-7c37elh6	215	12	specific	specific	JJ
cord-001824-7c37elh6	215	13	activity	activity	NN
cord-001824-7c37elh6	215	14	of	of	IN
cord-001824-7c37elh6	215	15	a	a	DT
cord-001824-7c37elh6	215	16	tRNA	trna	NN
cord-001824-7c37elh6	215	17	,	,	,
cord-001824-7c37elh6	215	18	like	like	IN
cord-001824-7c37elh6	215	19	influencing	influence	VBG
cord-001824-7c37elh6	215	20	reading	reading	NN
cord-001824-7c37elh6	215	21	frame	frame	NN
cord-001824-7c37elh6	215	22	maintenance	maintenance	NN
cord-001824-7c37elh6	215	23	,	,	,
cord-001824-7c37elh6	215	24	a	a	DT
cord-001824-7c37elh6	215	25	modification	modification	NN
cord-001824-7c37elh6	215	26	might	may	MD
cord-001824-7c37elh6	215	27	improve	improve	VB
cord-001824-7c37elh6	215	28	or	or	CC
cord-001824-7c37elh6	215	29	reduce	reduce	VB
cord-001824-7c37elh6	215	30	the	the	DT
cord-001824-7c37elh6	215	31	fidelity	fidelity	NN
cord-001824-7c37elh6	215	32	of	of	IN
cord-001824-7c37elh6	215	33	it	-PRON-	PRP
cord-001824-7c37elh6	215	34	.	.	.
cord-001824-7c37elh6	216	1	A	a	DT
cord-001824-7c37elh6	216	2	key	key	JJ
cord-001824-7c37elh6	216	3	feature	feature	NN
cord-001824-7c37elh6	216	4	of	of	IN
cord-001824-7c37elh6	216	5	the	the	DT
cord-001824-7c37elh6	216	6	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	216	7	-	-	HYPH
cord-001824-7c37elh6	216	8	tRNA	trna	NN
cord-001824-7c37elh6	216	9	slippage	slippage	NN
cord-001824-7c37elh6	216	10	model	model	NN
cord-001824-7c37elh6	216	11	is	be	VBZ
cord-001824-7c37elh6	216	12	that	that	IN
cord-001824-7c37elh6	216	13	the	the	DT
cord-001824-7c37elh6	216	14	error	error	NN
cord-001824-7c37elh6	216	15	in	in	IN
cord-001824-7c37elh6	216	16	reading	read	VBG
cord-001824-7c37elh6	216	17	frame	frame	NN
cord-001824-7c37elh6	216	18	maintenance	maintenance	NN
cord-001824-7c37elh6	216	19	,	,	,
cord-001824-7c37elh6	216	20	induced	induce	VBN
cord-001824-7c37elh6	216	21	either	either	CC
cord-001824-7c37elh6	216	22	by	by	IN
cord-001824-7c37elh6	216	23	an	an	DT
cord-001824-7c37elh6	216	24	A	A	NNP
cord-001824-7c37elh6	216	25	-	-	:
cord-001824-7c37elh6	216	26	or	or	CC
cord-001824-7c37elh6	216	27	a	a	DT
cord-001824-7c37elh6	216	28	P	p	NN
cord-001824-7c37elh6	216	29	-	-	HYPH
cord-001824-7c37elh6	216	30	site	site	NN
cord-001824-7c37elh6	216	31	effect	effect	NN
cord-001824-7c37elh6	216	32	due	due	IN
cord-001824-7c37elh6	216	33	to	to	IN
cord-001824-7c37elh6	216	34	modification	modification	NN
cord-001824-7c37elh6	216	35	deficient	deficient	JJ
cord-001824-7c37elh6	216	36	tRNA	trna	NN
cord-001824-7c37elh6	216	37	,	,	,
cord-001824-7c37elh6	216	38	occurs	occur	VBZ
cord-001824-7c37elh6	216	39	in	in	IN
cord-001824-7c37elh6	216	40	the	the	DT
cord-001824-7c37elh6	216	41	P	p	NN
cord-001824-7c37elh6	216	42	-	-	HYPH
cord-001824-7c37elh6	216	43	site	site	NN
cord-001824-7c37elh6	216	44	by	by	IN
cord-001824-7c37elh6	216	45	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	216	46	-	-	HYPH
cord-001824-7c37elh6	216	47	tRNA	trna	NN
cord-001824-7c37elh6	216	48	slippage	slippage	NN
cord-001824-7c37elh6	216	49	.	.	.
cord-001824-7c37elh6	217	1	There	there	EX
cord-001824-7c37elh6	217	2	are	be	VBP
cord-001824-7c37elh6	217	3	two	two	CD
cord-001824-7c37elh6	217	4	ways	way	NNS
cord-001824-7c37elh6	217	5	to	to	TO
cord-001824-7c37elh6	217	6	establish	establish	VB
cord-001824-7c37elh6	217	7	if	if	IN
cord-001824-7c37elh6	217	8	the	the	DT
cord-001824-7c37elh6	217	9	frameshift	frameshift	NN
cord-001824-7c37elh6	217	10	errors	error	NNS
cord-001824-7c37elh6	217	11	occur	occur	VBP
cord-001824-7c37elh6	217	12	in	in	IN
cord-001824-7c37elh6	217	13	the	the	DT
cord-001824-7c37elh6	217	14	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	217	15	A	a	NN
cord-001824-7c37elh6	217	16	-	-	:
cord-001824-7c37elh6	217	17	or	or	CC
cord-001824-7c37elh6	217	18	P	p	NN
cord-001824-7c37elh6	217	19	-	-	HYPH
cord-001824-7c37elh6	217	20	site	site	NN
cord-001824-7c37elh6	217	21	.	.	.
cord-001824-7c37elh6	218	1	Either	either	CC
cord-001824-7c37elh6	218	2	one	one	NN
cord-001824-7c37elh6	218	3	determines	determine	VBZ
cord-001824-7c37elh6	218	4	the	the	DT
cord-001824-7c37elh6	218	5	amino	amino	NN
cord-001824-7c37elh6	218	6	acid	acid	NN
cord-001824-7c37elh6	218	7	sequence	sequence	NN
cord-001824-7c37elh6	218	8	of	of	IN
cord-001824-7c37elh6	218	9	the	the	DT
cord-001824-7c37elh6	218	10	frameshift	frameshift	NN
cord-001824-7c37elh6	218	11	peptide	peptide	NN
cord-001824-7c37elh6	218	12	covering	cover	VBG
cord-001824-7c37elh6	218	13	the	the	DT
cord-001824-7c37elh6	218	14	frameshift	frameshift	NN
cord-001824-7c37elh6	218	15	window	window	NN
cord-001824-7c37elh6	218	16	or	or	CC
cord-001824-7c37elh6	218	17	by	by	IN
cord-001824-7c37elh6	218	18	overexpressing	overexpresse	VBG
cord-001824-7c37elh6	218	19	the	the	DT
cord-001824-7c37elh6	218	20	tRNA	tRNA	NNP
cord-001824-7c37elh6	218	21	cognate	cognate	JJ
cord-001824-7c37elh6	218	22	to	to	IN
cord-001824-7c37elh6	218	23	the	the	DT
cord-001824-7c37elh6	218	24	Asite	Asite	NNP
cord-001824-7c37elh6	218	25	codon	codon	NN
cord-001824-7c37elh6	218	26	.	.	.
cord-001824-7c37elh6	219	1	In	in	IN
cord-001824-7c37elh6	219	2	the	the	DT
cord-001824-7c37elh6	219	3	latter	latter	JJ
cord-001824-7c37elh6	219	4	case	case	NN
cord-001824-7c37elh6	219	5	,	,	,
cord-001824-7c37elh6	219	6	if	if	IN
cord-001824-7c37elh6	219	7	the	the	DT
cord-001824-7c37elh6	219	8	frameshift	frameshift	NN
cord-001824-7c37elh6	219	9	error	error	NN
cord-001824-7c37elh6	219	10	occurs	occur	VBZ
cord-001824-7c37elh6	219	11	due	due	IN
cord-001824-7c37elh6	219	12	to	to	IN
cord-001824-7c37elh6	219	13	an	an	DT
cord-001824-7c37elh6	219	14	A	a	NN
cord-001824-7c37elh6	219	15	-	-	HYPH
cord-001824-7c37elh6	219	16	site	site	NN
cord-001824-7c37elh6	219	17	effect	effect	NN
cord-001824-7c37elh6	219	18	,	,	,
cord-001824-7c37elh6	219	19	such	such	JJ
cord-001824-7c37elh6	219	20	overexpression	overexpression	NN
cord-001824-7c37elh6	219	21	would	would	MD
cord-001824-7c37elh6	219	22	decrease	decrease	VB
cord-001824-7c37elh6	219	23	the	the	DT
cord-001824-7c37elh6	219	24	frameshift	frameshift	NN
cord-001824-7c37elh6	219	25	error	error	NN
cord-001824-7c37elh6	219	26	,	,	,
cord-001824-7c37elh6	219	27	since	since	IN
cord-001824-7c37elh6	219	28	it	-PRON-	PRP
cord-001824-7c37elh6	219	29	reduces	reduce	VBZ
cord-001824-7c37elh6	219	30	the	the	DT
cord-001824-7c37elh6	219	31	ribosomal	ribosomal	NN
cord-001824-7c37elh6	219	32	pause	pause	NN
cord-001824-7c37elh6	219	33	and	and	CC
cord-001824-7c37elh6	219	34	thereby	thereby	RB
cord-001824-7c37elh6	219	35	reduces	reduce	VBZ
cord-001824-7c37elh6	219	36	the	the	DT
cord-001824-7c37elh6	219	37	ability	ability	NN
cord-001824-7c37elh6	219	38	of	of	IN
cord-001824-7c37elh6	219	39	the	the	DT
cord-001824-7c37elh6	219	40	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	219	41	-	-	HYPH
cord-001824-7c37elh6	219	42	tRNA	tRNA	NNP
cord-001824-7c37elh6	219	43	to	to	TO
cord-001824-7c37elh6	219	44	slip	slip	VB
cord-001824-7c37elh6	219	45	forward	forward	RB
cord-001824-7c37elh6	219	46	.	.	.
cord-001824-7c37elh6	220	1	We	-PRON-	PRP
cord-001824-7c37elh6	220	2	chose	choose	VBD
cord-001824-7c37elh6	220	3	the	the	DT
cord-001824-7c37elh6	220	4	latter	latter	JJ
cord-001824-7c37elh6	220	5	method	method	NN
cord-001824-7c37elh6	220	6	,	,	,
cord-001824-7c37elh6	220	7	since	since	IN
cord-001824-7c37elh6	220	8	this	this	DT
cord-001824-7c37elh6	220	9	approach	approach	NN
cord-001824-7c37elh6	220	10	is	be	VBZ
cord-001824-7c37elh6	220	11	relevant	relevant	JJ
cord-001824-7c37elh6	220	12	for	for	IN
cord-001824-7c37elh6	220	13	this	this	DT
cord-001824-7c37elh6	220	14	study	study	NN
cord-001824-7c37elh6	220	15	,	,	,
cord-001824-7c37elh6	220	16	as	as	IN
cord-001824-7c37elh6	220	17	such	such	PDT
cord-001824-7c37elh6	220	18	a	a	DT
cord-001824-7c37elh6	220	19	treatment	treatment	NN
cord-001824-7c37elh6	220	20	also	also	RB
cord-001824-7c37elh6	220	21	suppresses	suppress	VBZ
cord-001824-7c37elh6	220	22	all	all	PDT
cord-001824-7c37elh6	220	23	the	the	DT
cord-001824-7c37elh6	220	24	pleiotropic	pleiotropic	JJ
cord-001824-7c37elh6	220	25	phenotypes	phenotype	NNS
cord-001824-7c37elh6	220	26	induced	induce	VBN
cord-001824-7c37elh6	220	27	by	by	IN
cord-001824-7c37elh6	220	28	a	a	DT
cord-001824-7c37elh6	220	29	mutation	mutation	NN
cord-001824-7c37elh6	220	30	in	in	IN
cord-001824-7c37elh6	220	31	,	,	,
cord-001824-7c37elh6	220	32	e.g.	e.g.	IN
cord-001824-7c37elh6	220	33	the	the	DT
cord-001824-7c37elh6	220	34	ELP3	ELP3	NNP
cord-001824-7c37elh6	220	35	gene	gene	NN
cord-001824-7c37elh6	220	36	.	.	.
cord-001824-7c37elh6	221	1	Thus	thus	RB
cord-001824-7c37elh6	221	2	,	,	,
cord-001824-7c37elh6	221	3	the	the	DT
cord-001824-7c37elh6	221	4	strong	strong	JJ
cord-001824-7c37elh6	221	5	pleiotropic	pleiotropic	JJ
cord-001824-7c37elh6	221	6	phenotypes	phenotype	NNS
cord-001824-7c37elh6	221	7	ob	ob	NNP
cord-001824-7c37elh6	221	8	-	-	:
cord-001824-7c37elh6	221	9	served	serve	VBN
cord-001824-7c37elh6	221	10	in	in	IN
cord-001824-7c37elh6	221	11	an	an	DT
cord-001824-7c37elh6	221	12	elp3	elp3	NNP
cord-001824-7c37elh6	221	13	mutant	mutant	NN
cord-001824-7c37elh6	221	14	might	may	MD
cord-001824-7c37elh6	221	15	be	be	VB
cord-001824-7c37elh6	221	16	due	due	JJ
cord-001824-7c37elh6	221	17	,	,	,
cord-001824-7c37elh6	221	18	at	at	IN
cord-001824-7c37elh6	221	19	least	least	JJS
cord-001824-7c37elh6	221	20	partly	partly	RB
cord-001824-7c37elh6	221	21	,	,	,
cord-001824-7c37elh6	221	22	to	to	IN
cord-001824-7c37elh6	221	23	errors	error	NNS
cord-001824-7c37elh6	221	24	in	in	IN
cord-001824-7c37elh6	221	25	reading	read	VBG
cord-001824-7c37elh6	221	26	frame	frame	NN
cord-001824-7c37elh6	221	27	maintenance	maintenance	NN
cord-001824-7c37elh6	221	28	of	of	IN
cord-001824-7c37elh6	221	29	some	some	DT
cord-001824-7c37elh6	221	30	key	key	NN
cord-001824-7c37elh6	221	31	mRNAs	mrna	NNS
cord-001824-7c37elh6	221	32	.	.	.
cord-001824-7c37elh6	222	1	As	as	IN
cord-001824-7c37elh6	222	2	stated	state	VBN
cord-001824-7c37elh6	222	3	in	in	IN
cord-001824-7c37elh6	222	4	the	the	DT
cord-001824-7c37elh6	222	5	description	description	NN
cord-001824-7c37elh6	222	6	of	of	IN
cord-001824-7c37elh6	222	7	the	the	DT
cord-001824-7c37elh6	222	8	assay	assay	NN
cord-001824-7c37elh6	222	9	system	system	NN
cord-001824-7c37elh6	222	10	,	,	,
cord-001824-7c37elh6	222	11	the	the	DT
cord-001824-7c37elh6	222	12	dual	dual	JJ
cord-001824-7c37elh6	222	13	-	-	HYPH
cord-001824-7c37elh6	222	14	luciferase	luciferase	NN
cord-001824-7c37elh6	222	15	assay	assay	NN
cord-001824-7c37elh6	222	16	system	system	NN
cord-001824-7c37elh6	222	17	is	be	VBZ
cord-001824-7c37elh6	222	18	not	not	RB
cord-001824-7c37elh6	222	19	designed	design	VBN
cord-001824-7c37elh6	222	20	to	to	TO
cord-001824-7c37elh6	222	21	clarify	clarify	VB
cord-001824-7c37elh6	222	22	the	the	DT
cord-001824-7c37elh6	222	23	difference	difference	NN
cord-001824-7c37elh6	222	24	between	between	IN
cord-001824-7c37elh6	222	25	an	an	DT
cord-001824-7c37elh6	222	26	A	A	NNP
cord-001824-7c37elh6	222	27	-	-	:
cord-001824-7c37elh6	222	28	or	or	CC
cord-001824-7c37elh6	222	29	a	a	DT
cord-001824-7c37elh6	222	30	P	p	NN
cord-001824-7c37elh6	222	31	-	-	HYPH
cord-001824-7c37elh6	222	32	site	site	NN
cord-001824-7c37elh6	222	33	effect	effect	NN
cord-001824-7c37elh6	222	34	caused	cause	VBN
cord-001824-7c37elh6	222	35	by	by	IN
cord-001824-7c37elh6	222	36	modification	modification	NN
cord-001824-7c37elh6	222	37	deficiency	deficiency	NN
cord-001824-7c37elh6	222	38	,	,	,
cord-001824-7c37elh6	222	39	we	-PRON-	PRP
cord-001824-7c37elh6	222	40	decided	decide	VBD
cord-001824-7c37elh6	222	41	to	to	TO
cord-001824-7c37elh6	222	42	use	use	VB
cord-001824-7c37elh6	222	43	Ty1	ty1	JJ
cord-001824-7c37elh6	222	44	assay	assay	NN
cord-001824-7c37elh6	222	45	system	system	NN
cord-001824-7c37elh6	222	46	to	to	TO
cord-001824-7c37elh6	222	47	address	address	VB
cord-001824-7c37elh6	222	48	this	this	DT
cord-001824-7c37elh6	222	49	question	question	NN
cord-001824-7c37elh6	222	50	.	.	.
cord-001824-7c37elh6	223	1	The	the	DT
cord-001824-7c37elh6	223	2	expression	expression	NN
cord-001824-7c37elh6	223	3	of	of	IN
cord-001824-7c37elh6	223	4	the	the	DT
cord-001824-7c37elh6	223	5	TYB	TYB	NNP
cord-001824-7c37elh6	223	6	gene	gene	NN
cord-001824-7c37elh6	223	7	of	of	IN
cord-001824-7c37elh6	223	8	yeast	yeast	NN
cord-001824-7c37elh6	224	1	Ty	Ty	NNP
cord-001824-7c37elh6	224	2	retrotransposon	retrotransposon	NNP
cord-001824-7c37elh6	224	3	requires	require	VBZ
cord-001824-7c37elh6	224	4	a	a	DT
cord-001824-7c37elh6	224	5	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	224	6	+1	+1	NN
cord-001824-7c37elh6	224	7	frameshift	frameshift	NN
cord-001824-7c37elh6	224	8	event	event	NN
cord-001824-7c37elh6	224	9	caused	cause	VBN
cord-001824-7c37elh6	224	10	by	by	IN
cord-001824-7c37elh6	224	11	a	a	DT
cord-001824-7c37elh6	224	12	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	224	13	-	-	HYPH
cord-001824-7c37elh6	224	14	tRNA	trna	NN
cord-001824-7c37elh6	224	15	slippage	slippage	NN
cord-001824-7c37elh6	224	16	(	(	-LRB-
cord-001824-7c37elh6	224	17	41	41	CD
cord-001824-7c37elh6	224	18	)	)	-RRB-
cord-001824-7c37elh6	224	19	.	.	.
cord-001824-7c37elh6	225	1	Only	only	RB
cord-001824-7c37elh6	225	2	a	a	DT
cord-001824-7c37elh6	225	3	seven	seven	CD
cord-001824-7c37elh6	225	4	nucleotide	nucleotide	JJ
cord-001824-7c37elh6	225	5	sequence	sequence	NN
cord-001824-7c37elh6	225	6	CUU	cuu	NN
cord-001824-7c37elh6	225	7	-	-	HYPH
cord-001824-7c37elh6	225	8	AGG	agg	NN
cord-001824-7c37elh6	225	9	-	-	HYPH
cord-001824-7c37elh6	225	10	C	C	NNP
cord-001824-7c37elh6	225	11	is	be	VBZ
cord-001824-7c37elh6	225	12	required	require	VBN
cord-001824-7c37elh6	225	13	for	for	IN
cord-001824-7c37elh6	225	14	the	the	DT
cord-001824-7c37elh6	225	15	+1	+1	HYPH
cord-001824-7c37elh6	225	16	frameshift	frameshift	NN
cord-001824-7c37elh6	225	17	event	event	NN
cord-001824-7c37elh6	225	18	to	to	TO
cord-001824-7c37elh6	225	19	occur	occur	VB
cord-001824-7c37elh6	225	20	and	and	CC
cord-001824-7c37elh6	225	21	thus	thus	RB
cord-001824-7c37elh6	225	22	only	only	RB
cord-001824-7c37elh6	225	23	two	two	CD
cord-001824-7c37elh6	225	24	tRNA	tRNA	NNP
cord-001824-7c37elh6	225	25	species	specie	NNS
cord-001824-7c37elh6	225	26	--	--	:
cord-001824-7c37elh6	225	27	tRNA	tRNA	NNP
cord-001824-7c37elh6	225	28	Leu	Leu	NNP
cord-001824-7c37elh6	225	29	UAG	UAG	NNP
cord-001824-7c37elh6	225	30	and	and	CC
cord-001824-7c37elh6	225	31	tRNA	trna	NN
cord-001824-7c37elh6	225	32	Arg	Arg	NNP
cord-001824-7c37elh6	225	33	CCU	CCU	NNP
cord-001824-7c37elh6	225	34	--are	--are	NN
cord-001824-7c37elh6	225	35	participating	participate	VBG
cord-001824-7c37elh6	225	36	in	in	IN
cord-001824-7c37elh6	225	37	this	this	DT
cord-001824-7c37elh6	225	38	event	event	NN
cord-001824-7c37elh6	225	39	.	.	.
cord-001824-7c37elh6	226	1	In	in	IN
cord-001824-7c37elh6	226	2	the	the	DT
cord-001824-7c37elh6	226	3	yeast	yeast	NN
cord-001824-7c37elh6	226	4	strain	strain	NN
cord-001824-7c37elh6	226	5	used	use	VBN
cord-001824-7c37elh6	226	6	,	,	,
cord-001824-7c37elh6	226	7	the	the	DT
cord-001824-7c37elh6	226	8	availability	availability	NN
cord-001824-7c37elh6	226	9	of	of	IN
cord-001824-7c37elh6	226	10	tRNA	trna	NN
cord-001824-7c37elh6	226	11	Arg	Arg	NNP
cord-001824-7c37elh6	226	12	CCU	CCU	NNP
cord-001824-7c37elh6	226	13	is	be	VBZ
cord-001824-7c37elh6	226	14	low	low	JJ
cord-001824-7c37elh6	226	15	resulting	result	VBG
cord-001824-7c37elh6	226	16	in	in	IN
cord-001824-7c37elh6	226	17	a	a	DT
cord-001824-7c37elh6	226	18	low	low	JJ
cord-001824-7c37elh6	226	19	rate	rate	NN
cord-001824-7c37elh6	226	20	of	of	IN
cord-001824-7c37elh6	226	21	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	226	22	A	a	NN
cord-001824-7c37elh6	226	23	-	-	HYPH
cord-001824-7c37elh6	226	24	site	site	NN
cord-001824-7c37elh6	226	25	selection	selection	NN
cord-001824-7c37elh6	226	26	,	,	,
cord-001824-7c37elh6	226	27	which	which	WDT
cord-001824-7c37elh6	226	28	induces	induce	VBZ
cord-001824-7c37elh6	226	29	a	a	DT
cord-001824-7c37elh6	226	30	slippage	slippage	NN
cord-001824-7c37elh6	226	31	by	by	IN
cord-001824-7c37elh6	226	32	tRNA	tRNA	NNP
cord-001824-7c37elh6	226	33	Leu	Leu	NNP
cord-001824-7c37elh6	226	34	UAG	UAG	NNP
cord-001824-7c37elh6	226	35	at	at	IN
cord-001824-7c37elh6	226	36	the	the	DT
cord-001824-7c37elh6	226	37	CUU	CUU	NNP
cord-001824-7c37elh6	226	38	P	p	NN
cord-001824-7c37elh6	226	39	-	-	HYPH
cord-001824-7c37elh6	226	40	site	site	NN
cord-001824-7c37elh6	226	41	codon	codon	NN
cord-001824-7c37elh6	226	42	into	into	IN
cord-001824-7c37elh6	226	43	the	the	DT
cord-001824-7c37elh6	226	44	+1	+1	HYPH
cord-001824-7c37elh6	226	45	frame	frame	NN
cord-001824-7c37elh6	226	46	(	(	-LRB-
cord-001824-7c37elh6	226	47	UU	UU	NNP
cord-001824-7c37elh6	226	48	-	-	HYPH
cord-001824-7c37elh6	226	49	A	A	NNP
cord-001824-7c37elh6	226	50	)	)	-RRB-
cord-001824-7c37elh6	226	51	(	(	-LRB-
cord-001824-7c37elh6	226	52	41	41	CD
cord-001824-7c37elh6	226	53	)	)	-RRB-
cord-001824-7c37elh6	226	54	.	.	.
cord-001824-7c37elh6	227	1	Therefore	therefore	RB
cord-001824-7c37elh6	227	2	,	,	,
cord-001824-7c37elh6	227	3	we	-PRON-	PRP
cord-001824-7c37elh6	227	4	decided	decide	VBD
cord-001824-7c37elh6	227	5	to	to	TO
cord-001824-7c37elh6	227	6	use	use	VB
cord-001824-7c37elh6	227	7	an	an	DT
cord-001824-7c37elh6	227	8	altered	altered	JJ
cord-001824-7c37elh6	227	9	version	version	NN
cord-001824-7c37elh6	227	10	of	of	IN
cord-001824-7c37elh6	227	11	the	the	DT
cord-001824-7c37elh6	227	12	Ty1	ty1	CD
cord-001824-7c37elh6	227	13	+1	+1	NFP
cord-001824-7c37elh6	228	1	frameshift	frameshift	NN
cord-001824-7c37elh6	228	2	system	system	NN
cord-001824-7c37elh6	228	3	to	to	TO
cord-001824-7c37elh6	228	4	study	study	VB
cord-001824-7c37elh6	228	5	whether	whether	IN
cord-001824-7c37elh6	228	6	or	or	CC
cord-001824-7c37elh6	228	7	not	not	RB
cord-001824-7c37elh6	228	8	the	the	DT
cord-001824-7c37elh6	228	9	+1	+1	HYPH
cord-001824-7c37elh6	228	10	frameshifting	frameshifting	NN
cord-001824-7c37elh6	228	11	caused	cause	VBN
cord-001824-7c37elh6	228	12	by	by	IN
cord-001824-7c37elh6	228	13	lack	lack	NN
cord-001824-7c37elh6	228	14	of	of	IN
cord-001824-7c37elh6	228	15	the	the	DT
cord-001824-7c37elh6	228	16	mcm	mcm	NNP
cord-001824-7c37elh6	228	17	5	5	CD
cord-001824-7c37elh6	228	18	side	side	NN
cord-001824-7c37elh6	228	19	chain	chain	NN
cord-001824-7c37elh6	228	20	in	in	IN
cord-001824-7c37elh6	228	21	the	the	DT
cord-001824-7c37elh6	228	22	R	R	NNP
cord-001824-7c37elh6	228	23	-	-	HYPH
cord-001824-7c37elh6	228	24	luc	luc	NNP
cord-001824-7c37elh6	228	25	-	-	HYPH
cord-001824-7c37elh6	228	26	F	F	NNP
cord-001824-7c37elh6	228	27	-	-	HYPH
cord-001824-7c37elh6	228	28	luc	luc	NNP
cord-001824-7c37elh6	228	29	system	system	NN
cord-001824-7c37elh6	228	30	,	,	,
cord-001824-7c37elh6	228	31	is	be	VBZ
cord-001824-7c37elh6	228	32	due	due	JJ
cord-001824-7c37elh6	228	33	to	to	IN
cord-001824-7c37elh6	228	34	a	a	DT
cord-001824-7c37elh6	228	35	peptidyl	peptidyl	NN
cord-001824-7c37elh6	228	36	-	-	HYPH
cord-001824-7c37elh6	228	37	tRNA	trna	NN
cord-001824-7c37elh6	228	38	slippage	slippage	NN
cord-001824-7c37elh6	228	39	.	.	.
cord-001824-7c37elh6	229	1	We	-PRON-	PRP
cord-001824-7c37elh6	229	2	altered	alter	VBD
cord-001824-7c37elh6	229	3	the	the	DT
cord-001824-7c37elh6	229	4	'	'	``
cord-001824-7c37elh6	229	5	CUU	CUU	NNP
cord-001824-7c37elh6	229	6	-	-	HYPH
cord-001824-7c37elh6	229	7	AGG	agg	NN
cord-001824-7c37elh6	229	8	-	-	HYPH
cord-001824-7c37elh6	229	9	C	c	NN
cord-001824-7c37elh6	229	10	'	'	''
cord-001824-7c37elh6	229	11	+1	+1	ADD
cord-001824-7c37elh6	230	1	frameshift	frameshift	NN
cord-001824-7c37elh6	230	2	site	site	NN
cord-001824-7c37elh6	230	3	by	by	IN
cord-001824-7c37elh6	230	4	changing	change	VBG
cord-001824-7c37elh6	230	5	the	the	DT
cord-001824-7c37elh6	230	6	Arg	Arg	NNP
cord-001824-7c37elh6	230	7	codon	codon	NN
cord-001824-7c37elh6	230	8	(	(	-LRB-
cord-001824-7c37elh6	230	9	AGG	agg	NN
cord-001824-7c37elh6	230	10	)	)	-RRB-
cord-001824-7c37elh6	230	11	into	into	IN
cord-001824-7c37elh6	230	12	either	either	CC
cord-001824-7c37elh6	230	13	a	a	DT
cord-001824-7c37elh6	230	14	Lys	Lys	NNP
cord-001824-7c37elh6	230	15	codon	codon	NN
cord-001824-7c37elh6	230	16	AAA	AAA	NNP
cord-001824-7c37elh6	230	17	decoded	decode	VBN
cord-001824-7c37elh6	230	18	by	by	IN
cord-001824-7c37elh6	230	19	tRNA	tRNA	NNP
cord-001824-7c37elh6	230	20	Lys	Lys	NNP
cord-001824-7c37elh6	230	21	mcm	mcm	NNP
cord-001824-7c37elh6	230	22	5	5	CD
cord-001824-7c37elh6	230	23	s	s	NN
cord-001824-7c37elh6	230	24	2	2	CD
cord-001824-7c37elh6	230	25	UUU	UUU	NNP
cord-001824-7c37elh6	230	26	or	or	CC
cord-001824-7c37elh6	230	27	an	an	DT
cord-001824-7c37elh6	230	28	Arg	arg	NN
cord-001824-7c37elh6	230	29	codon	codon	NN
cord-001824-7c37elh6	230	30	AGA	AGA	NNP
cord-001824-7c37elh6	230	31	decoded	decode	VBN
cord-001824-7c37elh6	230	32	by	by	IN
cord-001824-7c37elh6	230	33	tRNA	trna	NN
cord-001824-7c37elh6	230	34	Arg	Arg	NNP
cord-001824-7c37elh6	230	35	mcm	mcm	NNP
cord-001824-7c37elh6	230	36	5	5	CD
cord-001824-7c37elh6	230	37	UCU	UCU	NNP
cord-001824-7c37elh6	230	38	to	to	TO
cord-001824-7c37elh6	230	39	test	test	VB
cord-001824-7c37elh6	230	40	whether	whether	IN
cord-001824-7c37elh6	230	41	or	or	CC
cord-001824-7c37elh6	230	42	not	not	RB
cord-001824-7c37elh6	230	43	lack	lack	NN
cord-001824-7c37elh6	230	44	of	of	IN
cord-001824-7c37elh6	230	45	mcm	mcm	NNP
cord-001824-7c37elh6	230	46	5	5	CD
cord-001824-7c37elh6	230	47	side	side	NN
cord-001824-7c37elh6	230	48	chain	chain	NN
cord-001824-7c37elh6	230	49	of	of	IN
cord-001824-7c37elh6	230	50	these	these	DT
cord-001824-7c37elh6	231	1	tRNAs	trna	NNS
cord-001824-7c37elh6	231	2	induce	induce	VBP
cord-001824-7c37elh6	231	3	+1	+1	XX
cord-001824-7c37elh6	231	4	frameshifting	frameshifting	NN
cord-001824-7c37elh6	231	5	(	(	-LRB-
cord-001824-7c37elh6	231	6	Table	table	NN
cord-001824-7c37elh6	231	7	3	3	CD
cord-001824-7c37elh6	231	8	)	)	-RRB-
cord-001824-7c37elh6	231	9	.	.	.
cord-001824-7c37elh6	232	1	If	if	IN
cord-001824-7c37elh6	232	2	the	the	DT
cord-001824-7c37elh6	232	3	hypomodified	hypomodifie	VBN
cord-001824-7c37elh6	232	4	tRNA	tRNA	NNP
cord-001824-7c37elh6	232	5	is	be	VBZ
cord-001824-7c37elh6	232	6	inefficiently	inefficiently	RB
cord-001824-7c37elh6	232	7	accepted	accept	VBN
cord-001824-7c37elh6	232	8	to	to	IN
cord-001824-7c37elh6	232	9	the	the	DT
cord-001824-7c37elh6	232	10	A	A	NNP
cord-001824-7c37elh6	232	11	-	-	HYPH
cord-001824-7c37elh6	232	12	site	site	NN
cord-001824-7c37elh6	232	13	in	in	IN
cord-001824-7c37elh6	232	14	an	an	DT
cord-001824-7c37elh6	232	15	elp3	elp3	NNP
cord-001824-7c37elh6	232	16	mutant	mutant	NN
cord-001824-7c37elh6	232	17	,	,	,
cord-001824-7c37elh6	232	18	the	the	DT
cord-001824-7c37elh6	232	19	AAA	AAA	NNP
cord-001824-7c37elh6	232	20	(	(	-LRB-
cord-001824-7c37elh6	232	21	Lys	Lys	NNP
cord-001824-7c37elh6	232	22	)	)	-RRB-
cord-001824-7c37elh6	232	23	and/or	and/or	CC
cord-001824-7c37elh6	232	24	AGA	AGA	NNP
cord-001824-7c37elh6	232	25	(	(	-LRB-
cord-001824-7c37elh6	232	26	Arg	Arg	NNP
cord-001824-7c37elh6	232	27	)	)	-RRB-
cord-001824-7c37elh6	232	28	test	test	NN
cord-001824-7c37elh6	232	29	codons	codon	NNS
cord-001824-7c37elh6	232	30	will	will	MD
cord-001824-7c37elh6	232	31	act	act	VB
cord-001824-7c37elh6	232	32	similarly	similarly	RB
cord-001824-7c37elh6	232	33	as	as	IN
cord-001824-7c37elh6	232	34	codons	codon	NNS
cord-001824-7c37elh6	232	35	decoded	decode	VBN
cord-001824-7c37elh6	232	36	by	by	IN
cord-001824-7c37elh6	232	37	the	the	DT
cord-001824-7c37elh6	232	38	low	low	JJ
cord-001824-7c37elh6	232	39	available	available	JJ
cord-001824-7c37elh6	232	40	tRNA	trna	NN
cord-001824-7c37elh6	232	41	Arg	Arg	NNP
cord-001824-7c37elh6	232	42	CCU	CCU	NNP
cord-001824-7c37elh6	232	43	resulting	result	VBG
cord-001824-7c37elh6	232	44	in	in	IN
cord-001824-7c37elh6	232	45	a	a	DT
cord-001824-7c37elh6	232	46	slow	slow	JJ
cord-001824-7c37elh6	232	47	entry	entry	NN
cord-001824-7c37elh6	232	48	to	to	IN
cord-001824-7c37elh6	232	49	the	the	DT
cord-001824-7c37elh6	232	50	A	A	NNP
cord-001824-7c37elh6	232	51	-	-	HYPH
cord-001824-7c37elh6	232	52	site	site	NN
cord-001824-7c37elh6	232	53	by	by	IN
cord-001824-7c37elh6	232	54	the	the	DT
cord-001824-7c37elh6	232	55	ternary	ternary	JJ
cord-001824-7c37elh6	232	56	complex	complex	NN
cord-001824-7c37elh6	232	57	containing	contain	VBG
cord-001824-7c37elh6	232	58	the	the	DT
cord-001824-7c37elh6	232	59	unmodified	unmodified	JJ
cord-001824-7c37elh6	232	60	tRNA	tRNA	NNP
cord-001824-7c37elh6	232	61	.	.	.
cord-001824-7c37elh6	233	1	If	if	IN
cord-001824-7c37elh6	233	2	so	so	RB
cord-001824-7c37elh6	233	3	,	,	,
cord-001824-7c37elh6	233	4	the	the	DT
cord-001824-7c37elh6	233	5	tRNA	tRNA	NNP
cord-001824-7c37elh6	233	6	Leu	Leu	NNP
cord-001824-7c37elh6	233	7	UAG	UAG	NNP
cord-001824-7c37elh6	233	8	in	in	IN
cord-001824-7c37elh6	233	9	the	the	DT
cord-001824-7c37elh6	233	10	P	p	NN
cord-001824-7c37elh6	233	11	-	-	HYPH
cord-001824-7c37elh6	233	12	site	site	NN
cord-001824-7c37elh6	233	13	will	will	MD
cord-001824-7c37elh6	233	14	slip	slip	VB
cord-001824-7c37elh6	233	15	into	into	IN
cord-001824-7c37elh6	233	16	the	the	DT
cord-001824-7c37elh6	233	17	+1	+1	HYPH
cord-001824-7c37elh6	233	18	frame	frame	NN
cord-001824-7c37elh6	233	19	(	(	-LRB-
cord-001824-7c37elh6	233	20	from	from	IN
cord-001824-7c37elh6	233	21	cognate	cognate	JJ
cord-001824-7c37elh6	233	22	CUU	CUU	NNP
cord-001824-7c37elh6	233	23	to	to	IN
cord-001824-7c37elh6	233	24	non	non	JJ
cord-001824-7c37elh6	233	25	-	-	JJ
cord-001824-7c37elh6	233	26	cognate	cognate	JJ
cord-001824-7c37elh6	233	27	UU	UU	NNP
cord-001824-7c37elh6	233	28	-	-	HYPH
cord-001824-7c37elh6	233	29	A	A	NNP
cord-001824-7c37elh6	233	30	)	)	-RRB-
cord-001824-7c37elh6	233	31	.	.	.
cord-001824-7c37elh6	234	1	All	all	DT
cord-001824-7c37elh6	234	2	alterations	alteration	NNS
cord-001824-7c37elh6	234	3	of	of	IN
cord-001824-7c37elh6	234	4	the	the	DT
cord-001824-7c37elh6	234	5	Ty1	ty1	CD
cord-001824-7c37elh6	234	6	sequence	sequence	NN
cord-001824-7c37elh6	234	7	were	be	VBD
cord-001824-7c37elh6	234	8	made	make	VBN
cord-001824-7c37elh6	234	9	in	in	IN
cord-001824-7c37elh6	234	10	the	the	DT
cord-001824-7c37elh6	234	11	HIS4A::lacZ	his4a::lacz	CD
cord-001824-7c37elh6	234	12	frameshift	frameshift	NN
cord-001824-7c37elh6	234	13	reporter	reporter	NN
cord-001824-7c37elh6	234	14	plasmid	plasmid	NN
cord-001824-7c37elh6	234	15	(	(	-LRB-
cord-001824-7c37elh6	234	16	see	see	VB
cord-001824-7c37elh6	234	17	Materials	material	NNS
cord-001824-7c37elh6	234	18	and	and	CC
cord-001824-7c37elh6	234	19	Methods	method	NNS
cord-001824-7c37elh6	234	20	)	)	-RRB-
cord-001824-7c37elh6	235	1	(	(	-LRB-
cord-001824-7c37elh6	235	2	Figure	figure	NN
cord-001824-7c37elh6	235	3	4B	4b	CD
cord-001824-7c37elh6	235	4	)	)	-RRB-
cord-001824-7c37elh6	235	5	.	.	.
cord-001824-7c37elh6	236	1	The	the	DT
cord-001824-7c37elh6	236	2	levels	level	NNS
cord-001824-7c37elh6	236	3	of	of	IN
cord-001824-7c37elh6	236	4	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	236	5	were	be	VBD
cord-001824-7c37elh6	236	6	calculated	calculate	VBN
cord-001824-7c37elh6	236	7	by	by	IN
cord-001824-7c37elh6	236	8	dividing	divide	VBG
cord-001824-7c37elh6	236	9	the	the	DT
cord-001824-7c37elh6	236	10	␤	␤	NNP
cord-001824-7c37elh6	236	11	-galactosidase	-galactosidase	CD
cord-001824-7c37elh6	236	12	values	value	NNS
cord-001824-7c37elh6	236	13	generated	generate	VBN
cord-001824-7c37elh6	236	14	from	from	IN
cord-001824-7c37elh6	236	15	the	the	DT
cord-001824-7c37elh6	236	16	test	test	NN
cord-001824-7c37elh6	236	17	construct	construct	VBP
cord-001824-7c37elh6	236	18	with	with	IN
cord-001824-7c37elh6	236	19	the	the	DT
cord-001824-7c37elh6	236	20	values	value	NNS
cord-001824-7c37elh6	236	21	from	from	IN
cord-001824-7c37elh6	236	22	the	the	DT
cord-001824-7c37elh6	236	23	in	in	IN
cord-001824-7c37elh6	236	24	-	-	HYPH
cord-001824-7c37elh6	236	25	frame	frame	NN
cord-001824-7c37elh6	236	26	control	control	NN
cord-001824-7c37elh6	236	27	construct	construct	VB
cord-001824-7c37elh6	236	28	.	.	.
cord-001824-7c37elh6	237	1	Table	table	NN
cord-001824-7c37elh6	237	2	3	3	CD
cord-001824-7c37elh6	237	3	shows	show	VBZ
cord-001824-7c37elh6	237	4	that	that	IN
cord-001824-7c37elh6	237	5	for	for	IN
cord-001824-7c37elh6	237	6	the	the	DT
cord-001824-7c37elh6	237	7	'	'	``
cord-001824-7c37elh6	237	8	CUU	CUU	NNP
cord-001824-7c37elh6	237	9	-	-	HYPH
cord-001824-7c37elh6	237	10	AAA	AAA	NNP
cord-001824-7c37elh6	237	11	-	-	HYPH
cord-001824-7c37elh6	237	12	C	C	NNP
cord-001824-7c37elh6	237	13	'	'	''
cord-001824-7c37elh6	237	14	Lys	Lys	NNP
cord-001824-7c37elh6	237	15	codon	codon	NN
cord-001824-7c37elh6	237	16	test	test	NN
cord-001824-7c37elh6	237	17	construct	construct	NN
cord-001824-7c37elh6	237	18	,	,	,
cord-001824-7c37elh6	237	19	lack	lack	NN
cord-001824-7c37elh6	237	20	of	of	IN
cord-001824-7c37elh6	237	21	mcm	mcm	NNP
cord-001824-7c37elh6	237	22	5	5	CD
cord-001824-7c37elh6	237	23	side	side	NN
cord-001824-7c37elh6	237	24	group	group	NN
cord-001824-7c37elh6	237	25	in	in	IN
cord-001824-7c37elh6	237	26	the	the	DT
cord-001824-7c37elh6	237	27	mcm	mcm	NNP
cord-001824-7c37elh6	237	28	5	5	CD
cord-001824-7c37elh6	237	29	s	s	NNP
cord-001824-7c37elh6	238	1	2	2	LS
cord-001824-7c37elh6	238	2	U	u	NN
cord-001824-7c37elh6	238	3	nucleoside	nucleoside	RB
cord-001824-7c37elh6	238	4	of	of	IN
cord-001824-7c37elh6	238	5	tRNA	tRNA	NNP
cord-001824-7c37elh6	238	6	Lys	Lys	NNP
cord-001824-7c37elh6	238	7	mcm	mcm	NNP
cord-001824-7c37elh6	239	1	5	5	LS
cord-001824-7c37elh6	239	2	s	s	POS
cord-001824-7c37elh6	239	3	2	2	CD
cord-001824-7c37elh6	239	4	UUU	UUU	NNP
cord-001824-7c37elh6	239	5	resulted	result	VBD
cord-001824-7c37elh6	239	6	in	in	IN
cord-001824-7c37elh6	239	7	10-fold	10-fold	JJ
cord-001824-7c37elh6	239	8	increased	increase	VBN
cord-001824-7c37elh6	239	9	+1	+1	NNS
cord-001824-7c37elh6	239	10	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	239	11	in	in	IN
cord-001824-7c37elh6	239	12	the	the	DT
cord-001824-7c37elh6	239	13	elp3	elp3	NNP
cord-001824-7c37elh6	239	14	mutant	mutant	NN
cord-001824-7c37elh6	239	15	compared	compare	VBN
cord-001824-7c37elh6	239	16	to	to	IN
cord-001824-7c37elh6	239	17	wild	wild	JJ
cord-001824-7c37elh6	239	18	type	type	NN
cord-001824-7c37elh6	239	19	.	.	.
cord-001824-7c37elh6	240	1	In	in	IN
cord-001824-7c37elh6	240	2	contrast	contrast	NN
cord-001824-7c37elh6	240	3	,	,	,
cord-001824-7c37elh6	240	4	for	for	IN
cord-001824-7c37elh6	240	5	the	the	DT
cord-001824-7c37elh6	240	6	'	'	``
cord-001824-7c37elh6	240	7	CUU	CUU	NNP
cord-001824-7c37elh6	240	8	-	-	HYPH
cord-001824-7c37elh6	240	9	AGA	AGA	NNP
cord-001824-7c37elh6	240	10	-	-	HYPH
cord-001824-7c37elh6	240	11	C	C	NNP
cord-001824-7c37elh6	240	12	'	'	''
cord-001824-7c37elh6	240	13	Arg	arg	NN
cord-001824-7c37elh6	240	14	codon	codon	NN
cord-001824-7c37elh6	240	15	test	test	NN
cord-001824-7c37elh6	240	16	construct	construct	NN
cord-001824-7c37elh6	240	17	,	,	,
cord-001824-7c37elh6	240	18	lack	lack	NN
cord-001824-7c37elh6	240	19	of	of	IN
cord-001824-7c37elh6	240	20	mcm	mcm	NNP
cord-001824-7c37elh6	240	21	5	5	CD
cord-001824-7c37elh6	240	22	side	side	NN
cord-001824-7c37elh6	240	23	group	group	NN
cord-001824-7c37elh6	240	24	in	in	IN
cord-001824-7c37elh6	240	25	tRNA	tRNA	NNP
cord-001824-7c37elh6	240	26	Arg	Arg	NNP
cord-001824-7c37elh6	240	27	mcm	mcm	NNP
cord-001824-7c37elh6	240	28	5	5	CD
cord-001824-7c37elh6	240	29	UCU	UCU	NNP
cord-001824-7c37elh6	240	30	did	do	VBD
cord-001824-7c37elh6	240	31	not	not	RB
cord-001824-7c37elh6	240	32	increase	increase	VB
cord-001824-7c37elh6	240	33	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	240	34	in	in	IN
cord-001824-7c37elh6	240	35	the	the	DT
cord-001824-7c37elh6	240	36	elp3	elp3	NNP
cord-001824-7c37elh6	240	37	mutant	mutant	NN
cord-001824-7c37elh6	240	38	compared	compare	VBN
cord-001824-7c37elh6	240	39	to	to	IN
cord-001824-7c37elh6	240	40	the	the	DT
cord-001824-7c37elh6	240	41	wild	wild	JJ
cord-001824-7c37elh6	240	42	type	type	NN
cord-001824-7c37elh6	240	43	(	(	-LRB-
cord-001824-7c37elh6	240	44	Table	table	NN
cord-001824-7c37elh6	240	45	3	3	CD
cord-001824-7c37elh6	240	46	)	)	-RRB-
cord-001824-7c37elh6	240	47	.	.	.
cord-001824-7c37elh6	241	1	Thus	thus	RB
cord-001824-7c37elh6	241	2	,	,	,
cord-001824-7c37elh6	241	3	similar	similar	JJ
cord-001824-7c37elh6	241	4	to	to	IN
cord-001824-7c37elh6	241	5	the	the	DT
cord-001824-7c37elh6	241	6	results	result	NNS
cord-001824-7c37elh6	241	7	obtained	obtain	VBN
cord-001824-7c37elh6	241	8	by	by	IN
cord-001824-7c37elh6	241	9	the	the	DT
cord-001824-7c37elh6	241	10	luciferase	luciferase	NN
cord-001824-7c37elh6	241	11	system	system	NN
cord-001824-7c37elh6	241	12	lack	lack	NN
cord-001824-7c37elh6	241	13	of	of	IN
cord-001824-7c37elh6	241	14	the	the	DT
cord-001824-7c37elh6	241	15	mcm	mcm	NNP
cord-001824-7c37elh6	241	16	5	5	CD
cord-001824-7c37elh6	241	17	group	group	NN
cord-001824-7c37elh6	241	18	of	of	IN
cord-001824-7c37elh6	241	19	tRNA	tRNA	NNP
cord-001824-7c37elh6	241	20	Lys	Lys	NNP
cord-001824-7c37elh6	241	21	mcm	mcm	NNP
cord-001824-7c37elh6	241	22	5	5	CD
cord-001824-7c37elh6	241	23	s	s	NN
cord-001824-7c37elh6	241	24	2	2	CD
cord-001824-7c37elh6	242	1	UUU	UUU	NNP
cord-001824-7c37elh6	242	2	induced	induce	VBD
cord-001824-7c37elh6	242	3	increased	increase	VBD
cord-001824-7c37elh6	242	4	+1	+1	NNS
cord-001824-7c37elh6	242	5	frameshifting	frameshifting	NN
cord-001824-7c37elh6	242	6	.	.	.
cord-001824-7c37elh6	243	1	Although	although	IN
cord-001824-7c37elh6	243	2	we	-PRON-	PRP
cord-001824-7c37elh6	243	3	observed	observe	VBD
cord-001824-7c37elh6	243	4	an	an	DT
cord-001824-7c37elh6	243	5	increased	increase	VBN
cord-001824-7c37elh6	243	6	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	243	7	for	for	IN
cord-001824-7c37elh6	243	8	mcm	mcm	NNP
cord-001824-7c37elh6	243	9	5	5	CD
cord-001824-7c37elh6	243	10	deficient	deficient	JJ
cord-001824-7c37elh6	243	11	tRNA	trna	NN
cord-001824-7c37elh6	243	12	Arg	arg	NN
cord-001824-7c37elh6	243	13	mcm	mcm	NNP
cord-001824-7c37elh6	243	14	5	5	CD
cord-001824-7c37elh6	243	15	UCU	UCU	NNP
cord-001824-7c37elh6	243	16	in	in	IN
cord-001824-7c37elh6	243	17	the	the	DT
cord-001824-7c37elh6	243	18	luciferase	luciferase	NN
cord-001824-7c37elh6	243	19	assay	assay	NN
cord-001824-7c37elh6	243	20	system	system	NN
cord-001824-7c37elh6	243	21	(	(	-LRB-
cord-001824-7c37elh6	243	22	Table	Table	NNP
cord-001824-7c37elh6	243	23	2	2	CD
cord-001824-7c37elh6	243	24	)	)	-RRB-
cord-001824-7c37elh6	243	25	,	,	,
cord-001824-7c37elh6	243	26	this	this	DT
cord-001824-7c37elh6	243	27	was	be	VBD
cord-001824-7c37elh6	243	28	not	not	RB
cord-001824-7c37elh6	243	29	the	the	DT
cord-001824-7c37elh6	243	30	case	case	NN
cord-001824-7c37elh6	243	31	using	use	VBG
cord-001824-7c37elh6	243	32	the	the	DT
cord-001824-7c37elh6	243	33	Ty1	ty1	CD
cord-001824-7c37elh6	243	34	assay	assay	NN
cord-001824-7c37elh6	243	35	system	system	NN
cord-001824-7c37elh6	243	36	(	(	-LRB-
cord-001824-7c37elh6	243	37	Table	Table	NNP
cord-001824-7c37elh6	243	38	3	3	CD
cord-001824-7c37elh6	243	39	)	)	-RRB-
cord-001824-7c37elh6	243	40	.	.	.
cord-001824-7c37elh6	244	1	To	to	TO
cord-001824-7c37elh6	244	2	analyze	analyze	VB
cord-001824-7c37elh6	244	3	whether	whether	IN
cord-001824-7c37elh6	244	4	lack	lack	NN
cord-001824-7c37elh6	244	5	of	of	IN
cord-001824-7c37elh6	244	6	the	the	DT
cord-001824-7c37elh6	244	7	mcm	mcm	NNP
cord-001824-7c37elh6	244	8	5	5	CD
cord-001824-7c37elh6	244	9	group	group	NN
cord-001824-7c37elh6	244	10	of	of	IN
cord-001824-7c37elh6	244	11	tRNA	tRNA	NNP
cord-001824-7c37elh6	244	12	Lys	Lys	NNP
cord-001824-7c37elh6	244	13	mcm	mcm	NNP
cord-001824-7c37elh6	244	14	5	5	CD
cord-001824-7c37elh6	244	15	s	s	NN
cord-001824-7c37elh6	244	16	2	2	CD
cord-001824-7c37elh6	244	17	UUU	UUU	NNP
cord-001824-7c37elh6	244	18	could	could	MD
cord-001824-7c37elh6	244	19	induce	induce	VB
cord-001824-7c37elh6	244	20	+1	+1	XX
cord-001824-7c37elh6	244	21	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	244	22	due	due	IN
cord-001824-7c37elh6	244	23	to	to	IN
cord-001824-7c37elh6	244	24	a	a	DT
cord-001824-7c37elh6	244	25	Psite	Psite	NNP
cord-001824-7c37elh6	244	26	effect	effect	NN
cord-001824-7c37elh6	244	27	by	by	IN
cord-001824-7c37elh6	244	28	modification	modification	NN
cord-001824-7c37elh6	244	29	deficiency	deficiency	NN
cord-001824-7c37elh6	244	30	,	,	,
cord-001824-7c37elh6	244	31	we	-PRON-	PRP
cord-001824-7c37elh6	244	32	placed	place	VBD
cord-001824-7c37elh6	244	33	a	a	DT
cord-001824-7c37elh6	244	34	Lys	Lys	NNP
cord-001824-7c37elh6	244	35	codon	codon	NN
cord-001824-7c37elh6	244	36	AAA	aaa	NN
cord-001824-7c37elh6	244	37	instead	instead	RB
cord-001824-7c37elh6	244	38	of	of	IN
cord-001824-7c37elh6	244	39	the	the	DT
cord-001824-7c37elh6	244	40	CUU	CUU	NNP
cord-001824-7c37elh6	244	41	codon	codon	NN
cord-001824-7c37elh6	244	42	in	in	IN
cord-001824-7c37elh6	244	43	the	the	DT
cord-001824-7c37elh6	244	44	Ty1	ty1	CD
cord-001824-7c37elh6	244	45	assay	assay	NN
cord-001824-7c37elh6	244	46	system	system	NN
cord-001824-7c37elh6	244	47	and	and	CC
cord-001824-7c37elh6	244	48	varied	vary	VBD
cord-001824-7c37elh6	244	49	the	the	DT
cord-001824-7c37elh6	244	50	following	follow	VBG
cord-001824-7c37elh6	244	51	codon	codon	NN
cord-001824-7c37elh6	244	52	.	.	.
cord-001824-7c37elh6	245	1	The	the	DT
cord-001824-7c37elh6	245	2	concentration	concentration	NN
cord-001824-7c37elh6	245	3	of	of	IN
cord-001824-7c37elh6	245	4	a	a	DT
cord-001824-7c37elh6	245	5	tRNA	tRNA	NNP
cord-001824-7c37elh6	245	6	species	species	NN
cord-001824-7c37elh6	245	7	is	be	VBZ
cord-001824-7c37elh6	245	8	proportional	proportional	JJ
cord-001824-7c37elh6	245	9	to	to	IN
cord-001824-7c37elh6	245	10	the	the	DT
cord-001824-7c37elh6	245	11	number	number	NN
cord-001824-7c37elh6	245	12	of	of	IN
cord-001824-7c37elh6	245	13	the	the	DT
cord-001824-7c37elh6	245	14	corre	corre	NNP
cord-001824-7c37elh6	245	15	-	-	HYPH
cord-001824-7c37elh6	245	16	sponding	sponde	VBG
cord-001824-7c37elh6	245	17	tRNA	trna	NN
cord-001824-7c37elh6	245	18	genes	gene	NNS
cord-001824-7c37elh6	245	19	in	in	IN
cord-001824-7c37elh6	245	20	the	the	DT
cord-001824-7c37elh6	245	21	yeast	yeast	NN
cord-001824-7c37elh6	245	22	genome	genome	NN
cord-001824-7c37elh6	245	23	(	(	-LRB-
cord-001824-7c37elh6	245	24	50	50	CD
cord-001824-7c37elh6	245	25	)	)	-RRB-
cord-001824-7c37elh6	245	26	.	.	.
cord-001824-7c37elh6	246	1	Accordingly	accordingly	RB
cord-001824-7c37elh6	246	2	,	,	,
cord-001824-7c37elh6	246	3	by	by	IN
cord-001824-7c37elh6	246	4	placing	place	VBG
cord-001824-7c37elh6	246	5	different	different	JJ
cord-001824-7c37elh6	246	6	codons	codon	NNS
cord-001824-7c37elh6	246	7	in	in	IN
cord-001824-7c37elh6	246	8	the	the	DT
cord-001824-7c37elh6	246	9	A	A	NNP
cord-001824-7c37elh6	246	10	-	-	HYPH
cord-001824-7c37elh6	246	11	site	site	NN
cord-001824-7c37elh6	246	12	,	,	,
cord-001824-7c37elh6	246	13	the	the	DT
cord-001824-7c37elh6	246	14	concentration	concentration	NN
cord-001824-7c37elh6	246	15	of	of	IN
cord-001824-7c37elh6	246	16	the	the	DT
cord-001824-7c37elh6	246	17	corresponding	corresponding	JJ
cord-001824-7c37elh6	246	18	tRNAs	trna	NNS
cord-001824-7c37elh6	246	19	in	in	IN
cord-001824-7c37elh6	246	20	the	the	DT
cord-001824-7c37elh6	246	21	cell	cell	NN
cord-001824-7c37elh6	246	22	reading	read	VBG
cord-001824-7c37elh6	246	23	this	this	DT
cord-001824-7c37elh6	246	24	codon	codon	NN
cord-001824-7c37elh6	246	25	is	be	VBZ
cord-001824-7c37elh6	246	26	changed	change	VBN
cord-001824-7c37elh6	246	27	and	and	CC
cord-001824-7c37elh6	246	28	thereby	thereby	RB
cord-001824-7c37elh6	246	29	the	the	DT
cord-001824-7c37elh6	246	30	efficiency	efficiency	NN
cord-001824-7c37elh6	246	31	of	of	IN
cord-001824-7c37elh6	246	32	reading	read	VBG
cord-001824-7c37elh6	246	33	the	the	DT
cord-001824-7c37elh6	246	34	A	A	NNP
cord-001824-7c37elh6	246	35	-	-	HYPH
cord-001824-7c37elh6	246	36	site	site	NN
cord-001824-7c37elh6	246	37	codon	codon	NN
cord-001824-7c37elh6	246	38	is	be	VBZ
cord-001824-7c37elh6	246	39	altered	alter	VBN
cord-001824-7c37elh6	246	40	.	.	.
cord-001824-7c37elh6	247	1	Thus	thus	RB
cord-001824-7c37elh6	247	2	,	,	,
cord-001824-7c37elh6	247	3	to	to	TO
cord-001824-7c37elh6	247	4	test	test	VB
cord-001824-7c37elh6	247	5	for	for	IN
cord-001824-7c37elh6	247	6	a	a	DT
cord-001824-7c37elh6	247	7	possible	possible	JJ
cord-001824-7c37elh6	247	8	P	p	NN
cord-001824-7c37elh6	247	9	-	-	HYPH
cord-001824-7c37elh6	247	10	site	site	NN
cord-001824-7c37elh6	247	11	effect	effect	NN
cord-001824-7c37elh6	247	12	induced	induce	VBN
cord-001824-7c37elh6	247	13	by	by	IN
cord-001824-7c37elh6	247	14	a	a	DT
cord-001824-7c37elh6	247	15	lack	lack	NN
cord-001824-7c37elh6	247	16	of	of	IN
cord-001824-7c37elh6	247	17	the	the	DT
cord-001824-7c37elh6	247	18	mcm	mcm	NNP
cord-001824-7c37elh6	247	19	5	5	CD
cord-001824-7c37elh6	247	20	group	group	NNP
cord-001824-7c37elh6	247	21	of	of	IN
cord-001824-7c37elh6	247	22	mcm	mcm	NNP
cord-001824-7c37elh6	247	23	5	5	CD
cord-001824-7c37elh6	247	24	s	s	SYM
cord-001824-7c37elh6	247	25	2	2	CD
cord-001824-7c37elh6	247	26	U	U	NNP
cord-001824-7c37elh6	247	27	in	in	IN
cord-001824-7c37elh6	247	28	Lys	Lys	NNP
cord-001824-7c37elh6	247	29	-	-	HYPH
cord-001824-7c37elh6	247	30	tRNA	tRNA	NNP
cord-001824-7c37elh6	248	1	we	-PRON-	PRP
cord-001824-7c37elh6	248	2	placed	place	VBD
cord-001824-7c37elh6	248	3	an	an	DT
cord-001824-7c37elh6	248	4	Arg	arg	NN
cord-001824-7c37elh6	248	5	codon	codon	NN
cord-001824-7c37elh6	248	6	AGG	agg	NN
cord-001824-7c37elh6	248	7	read	read	VBN
cord-001824-7c37elh6	248	8	by	by	IN
cord-001824-7c37elh6	248	9	the	the	DT
cord-001824-7c37elh6	248	10	rare	rare	JJ
cord-001824-7c37elh6	248	11	cognate	cognate	NN
cord-001824-7c37elh6	248	12	tRNA	trna	NN
cord-001824-7c37elh6	248	13	Arg	Arg	NNP
cord-001824-7c37elh6	248	14	CCU	CCU	NNP
cord-001824-7c37elh6	248	15	(	(	-LRB-
cord-001824-7c37elh6	248	16	1	1	CD
cord-001824-7c37elh6	248	17	genomic	genomic	JJ
cord-001824-7c37elh6	248	18	copy	copy	NN
cord-001824-7c37elh6	248	19	)	)	-RRB-
cord-001824-7c37elh6	248	20	and	and	CC
cord-001824-7c37elh6	248	21	the	the	DT
cord-001824-7c37elh6	248	22	near	near	JJ
cord-001824-7c37elh6	248	23	cognate	cognate	NNP
cord-001824-7c37elh6	248	24	tRNA	trna	NN
cord-001824-7c37elh6	248	25	Arg	Arg	NNP
cord-001824-7c37elh6	248	26	mcm	mcm	NNP
cord-001824-7c37elh6	248	27	5	5	CD
cord-001824-7c37elh6	248	28	UCU	UCU	NNP
cord-001824-7c37elh6	248	29	(	(	-LRB-
cord-001824-7c37elh6	248	30	11	11	CD
cord-001824-7c37elh6	248	31	genomic	genomic	JJ
cord-001824-7c37elh6	248	32	copies	copy	NNS
cord-001824-7c37elh6	248	33	)	)	-RRB-
cord-001824-7c37elh6	248	34	after	after	IN
cord-001824-7c37elh6	248	35	the	the	DT
cord-001824-7c37elh6	248	36	Lys	Lys	NNP
cord-001824-7c37elh6	248	37	codon	codon	NN
cord-001824-7c37elh6	248	38	AAA	AAA	NNP
cord-001824-7c37elh6	248	39	.	.	.
cord-001824-7c37elh6	249	1	In	in	IN
cord-001824-7c37elh6	249	2	an	an	DT
cord-001824-7c37elh6	249	3	elp3	elp3	CD
cord-001824-7c37elh6	249	4	mutant	mutant	JJ
cord-001824-7c37elh6	249	5	tRNA	trna	NN
cord-001824-7c37elh6	249	6	Arg	Arg	NNP
cord-001824-7c37elh6	249	7	CCU	CCU	NNP
cord-001824-7c37elh6	249	8	is	be	VBZ
cord-001824-7c37elh6	249	9	essential	essential	JJ
cord-001824-7c37elh6	249	10	,	,	,
cord-001824-7c37elh6	249	11	demonstrating	demonstrate	VBG
cord-001824-7c37elh6	249	12	that	that	IN
cord-001824-7c37elh6	249	13	mcm	mcm	NNP
cord-001824-7c37elh6	249	14	5	5	CD
cord-001824-7c37elh6	249	15	group	group	NN
cord-001824-7c37elh6	249	16	of	of	IN
cord-001824-7c37elh6	249	17	the	the	DT
cord-001824-7c37elh6	249	18	near	near	JJ
cord-001824-7c37elh6	249	19	cognate	cognate	JJ
cord-001824-7c37elh6	249	20	Arg	arg	NN
cord-001824-7c37elh6	249	21	-	-	HYPH
cord-001824-7c37elh6	249	22	tRNA	tRNA	NNP
cord-001824-7c37elh6	249	23	is	be	VBZ
cord-001824-7c37elh6	249	24	required	require	VBN
cord-001824-7c37elh6	249	25	for	for	IN
cord-001824-7c37elh6	249	26	efficient	efficient	JJ
cord-001824-7c37elh6	249	27	reading	reading	NN
cord-001824-7c37elh6	249	28	of	of	IN
cord-001824-7c37elh6	249	29	the	the	DT
cord-001824-7c37elh6	249	30	Arg	arg	NN
cord-001824-7c37elh6	249	31	codon	codon	NN
cord-001824-7c37elh6	249	32	AGG	agg	NN
cord-001824-7c37elh6	249	33	(	(	-LRB-
cord-001824-7c37elh6	249	34	26	26	CD
cord-001824-7c37elh6	249	35	)	)	-RRB-
cord-001824-7c37elh6	249	36	.	.	.
cord-001824-7c37elh6	250	1	Therefore	therefore	RB
cord-001824-7c37elh6	250	2	,	,	,
cord-001824-7c37elh6	250	3	in	in	IN
cord-001824-7c37elh6	250	4	an	an	DT
cord-001824-7c37elh6	250	5	elp3	elp3	NNP
cord-001824-7c37elh6	250	6	mutant	mutant	NN
cord-001824-7c37elh6	250	7	,	,	,
cord-001824-7c37elh6	250	8	a	a	DT
cord-001824-7c37elh6	250	9	situation	situation	NN
cord-001824-7c37elh6	250	10	is	be	VBZ
cord-001824-7c37elh6	250	11	generated	generate	VBN
cord-001824-7c37elh6	250	12	where	where	WRB
cord-001824-7c37elh6	250	13	the	the	DT
cord-001824-7c37elh6	250	14	AGG	agg	NN
cord-001824-7c37elh6	250	15	codon	codon	NN
cord-001824-7c37elh6	250	16	is	be	VBZ
cord-001824-7c37elh6	250	17	read	read	VBN
cord-001824-7c37elh6	250	18	slowly	slowly	RB
cord-001824-7c37elh6	250	19	since	since	IN
cord-001824-7c37elh6	250	20	it	-PRON-	PRP
cord-001824-7c37elh6	250	21	is	be	VBZ
cord-001824-7c37elh6	250	22	read	read	VBN
cord-001824-7c37elh6	250	23	mainly	mainly	RB
cord-001824-7c37elh6	250	24	by	by	IN
cord-001824-7c37elh6	250	25	the	the	DT
cord-001824-7c37elh6	250	26	rare	rare	JJ
cord-001824-7c37elh6	250	27	cognate	cognate	NN
cord-001824-7c37elh6	250	28	tRNA	trna	NN
cord-001824-7c37elh6	250	29	Arg	Arg	NNP
cord-001824-7c37elh6	250	30	CCU	CCU	NNP
cord-001824-7c37elh6	250	31	and	and	CC
cord-001824-7c37elh6	250	32	inefficiently	inefficiently	RB
cord-001824-7c37elh6	250	33	by	by	IN
cord-001824-7c37elh6	250	34	the	the	DT
cord-001824-7c37elh6	250	35	more	more	RBR
cord-001824-7c37elh6	250	36	abundant	abundant	JJ
cord-001824-7c37elh6	250	37	modification	modification	NN
cord-001824-7c37elh6	250	38	deficient	deficient	JJ
cord-001824-7c37elh6	250	39	near	near	IN
cord-001824-7c37elh6	250	40	cognate	cognate	JJ
cord-001824-7c37elh6	250	41	tRNA	trna	NN
cord-001824-7c37elh6	250	42	Arg	Arg	NNP
cord-001824-7c37elh6	250	43	mcm	mcm	NNP
cord-001824-7c37elh6	250	44	5	5	CD
cord-001824-7c37elh6	250	45	UCU	UCU	NNP
cord-001824-7c37elh6	250	46	.	.	.
cord-001824-7c37elh6	251	1	Such	such	PDT
cord-001824-7c37elh6	251	2	a	a	DT
cord-001824-7c37elh6	251	3	condition	condition	NN
cord-001824-7c37elh6	251	4	would	would	MD
cord-001824-7c37elh6	251	5	allow	allow	VB
cord-001824-7c37elh6	251	6	tRNA	tRNA	NNP
cord-001824-7c37elh6	251	7	Lys	Lys	NNP
cord-001824-7c37elh6	251	8	mcm	mcm	NNP
cord-001824-7c37elh6	251	9	5	5	CD
cord-001824-7c37elh6	251	10	s	s	NN
cord-001824-7c37elh6	251	11	2	2	CD
cord-001824-7c37elh6	251	12	UUU	UUU	NNP
cord-001824-7c37elh6	251	13	at	at	IN
cord-001824-7c37elh6	251	14	the	the	DT
cord-001824-7c37elh6	251	15	Psite	Psite	NNP
cord-001824-7c37elh6	251	16	to	to	TO
cord-001824-7c37elh6	251	17	slip	slip	VB
cord-001824-7c37elh6	251	18	to	to	IN
cord-001824-7c37elh6	251	19	the	the	DT
cord-001824-7c37elh6	251	20	+1	+1	HYPH
cord-001824-7c37elh6	251	21	translational	translational	JJ
cord-001824-7c37elh6	251	22	frame	frame	NN
cord-001824-7c37elh6	251	23	.	.	.
cord-001824-7c37elh6	252	1	Furthermore	furthermore	RB
cord-001824-7c37elh6	252	2	,	,	,
cord-001824-7c37elh6	252	3	we	-PRON-	PRP
cord-001824-7c37elh6	252	4	made	make	VBD
cord-001824-7c37elh6	252	5	test	test	NN
cord-001824-7c37elh6	252	6	constructs	construct	NNS
cord-001824-7c37elh6	252	7	to	to	TO
cord-001824-7c37elh6	252	8	increase	increase	VB
cord-001824-7c37elh6	252	9	the	the	DT
cord-001824-7c37elh6	252	10	rate	rate	NN
cord-001824-7c37elh6	252	11	of	of	IN
cord-001824-7c37elh6	252	12	A	a	DT
cord-001824-7c37elh6	252	13	-	-	HYPH
cord-001824-7c37elh6	252	14	site	site	NN
cord-001824-7c37elh6	252	15	selection	selection	NN
cord-001824-7c37elh6	252	16	by	by	IN
cord-001824-7c37elh6	252	17	introducing	introduce	VBG
cord-001824-7c37elh6	252	18	either	either	CC
cord-001824-7c37elh6	252	19	an	an	DT
cord-001824-7c37elh6	252	20	Ile	Ile	NNP
cord-001824-7c37elh6	252	21	codon	codon	NN
cord-001824-7c37elh6	252	22	AUU	AUU	NNP
cord-001824-7c37elh6	252	23	decoded	decode	VBN
cord-001824-7c37elh6	252	24	by	by	IN
cord-001824-7c37elh6	252	25	cognate	cognate	NNP
cord-001824-7c37elh6	252	26	tRNA	tRNA	NNP
cord-001824-7c37elh6	252	27	Ile	Ile	NNP
cord-001824-7c37elh6	252	28	AAU	AAU	NNP
cord-001824-7c37elh6	252	29	present	present	JJ
cord-001824-7c37elh6	252	30	in	in	IN
cord-001824-7c37elh6	252	31	13	13	CD
cord-001824-7c37elh6	252	32	genomic	genomic	JJ
cord-001824-7c37elh6	252	33	copies	copy	NNS
cord-001824-7c37elh6	252	34	or	or	CC
cord-001824-7c37elh6	252	35	an	an	DT
cord-001824-7c37elh6	252	36	Arg	arg	NN
cord-001824-7c37elh6	252	37	codon	codon	NN
cord-001824-7c37elh6	252	38	CGU	CGU	NNP
cord-001824-7c37elh6	252	39	decoded	decode	VBN
cord-001824-7c37elh6	252	40	by	by	IN
cord-001824-7c37elh6	253	1	cognate	cognate	NNP
cord-001824-7c37elh6	253	2	tRNA	tRNA	NNP
cord-001824-7c37elh6	253	3	Arg	Arg	NNP
cord-001824-7c37elh6	253	4	ACG	ACG	NNP
cord-001824-7c37elh6	253	5	present	present	JJ
cord-001824-7c37elh6	253	6	in	in	IN
cord-001824-7c37elh6	253	7	6	6	CD
cord-001824-7c37elh6	253	8	genomic	genomic	JJ
cord-001824-7c37elh6	253	9	copies	copy	NNS
cord-001824-7c37elh6	253	10	after	after	IN
cord-001824-7c37elh6	253	11	Lys	Lys	NNP
cord-001824-7c37elh6	253	12	codon	codon	NN
cord-001824-7c37elh6	253	13	AAA	AAA	NNP
cord-001824-7c37elh6	253	14	(	(	-LRB-
cord-001824-7c37elh6	253	15	Table	Table	NNP
cord-001824-7c37elh6	253	16	3	3	CD
cord-001824-7c37elh6	253	17	)	)	-RRB-
cord-001824-7c37elh6	253	18	.	.	.
cord-001824-7c37elh6	254	1	By	by	IN
cord-001824-7c37elh6	254	2	varying	vary	VBG
cord-001824-7c37elh6	254	3	concentration	concentration	NN
cord-001824-7c37elh6	254	4	of	of	IN
cord-001824-7c37elh6	254	5	the	the	DT
cord-001824-7c37elh6	254	6	potential	potential	JJ
cord-001824-7c37elh6	254	7	A	a	NN
cord-001824-7c37elh6	254	8	-	-	HYPH
cord-001824-7c37elh6	254	9	site	site	NN
cord-001824-7c37elh6	254	10	coding	coding	NN
cord-001824-7c37elh6	254	11	tRNAs	trna	NNS
cord-001824-7c37elh6	254	12	from	from	IN
cord-001824-7c37elh6	254	13	1	1	CD
cord-001824-7c37elh6	254	14	genomic	genomic	JJ
cord-001824-7c37elh6	254	15	copy	copy	NN
cord-001824-7c37elh6	254	16	to	to	IN
cord-001824-7c37elh6	254	17	13	13	CD
cord-001824-7c37elh6	254	18	genomic	genomic	JJ
cord-001824-7c37elh6	254	19	copies	copy	NNS
cord-001824-7c37elh6	254	20	,	,	,
cord-001824-7c37elh6	254	21	we	-PRON-	PRP
cord-001824-7c37elh6	254	22	did	do	VBD
cord-001824-7c37elh6	254	23	not	not	RB
cord-001824-7c37elh6	254	24	observe	observe	VB
cord-001824-7c37elh6	254	25	any	any	DT
cord-001824-7c37elh6	254	26	significant	significant	JJ
cord-001824-7c37elh6	254	27	difference	difference	NN
cord-001824-7c37elh6	254	28	in	in	IN
cord-001824-7c37elh6	254	29	the	the	DT
cord-001824-7c37elh6	254	30	levels	level	NNS
cord-001824-7c37elh6	254	31	of	of	IN
cord-001824-7c37elh6	254	32	+1	+1	NN
cord-001824-7c37elh6	254	33	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	254	34	between	between	IN
cord-001824-7c37elh6	254	35	wild	wild	JJ
cord-001824-7c37elh6	254	36	type	type	NN
cord-001824-7c37elh6	254	37	and	and	CC
cord-001824-7c37elh6	254	38	elp3	elp3	NN
cord-001824-7c37elh6	254	39	mutant	mutant	JJ
cord-001824-7c37elh6	254	40	(	(	-LRB-
cord-001824-7c37elh6	254	41	Table	Table	NNP
cord-001824-7c37elh6	254	42	3	3	CD
cord-001824-7c37elh6	254	43	)	)	-RRB-
cord-001824-7c37elh6	254	44	.	.	.
cord-001824-7c37elh6	255	1	Apparently	apparently	RB
cord-001824-7c37elh6	255	2	,	,	,
cord-001824-7c37elh6	255	3	the	the	DT
cord-001824-7c37elh6	255	4	possible	possible	JJ
cord-001824-7c37elh6	255	5	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	255	6	-	-	HYPH
cord-001824-7c37elh6	255	7	tRNA	tRNA	NNP
cord-001824-7c37elh6	255	8	Lys	Lys	NNP
cord-001824-7c37elh6	255	9	mcm	mcm	NNP
cord-001824-7c37elh6	255	10	5	5	CD
cord-001824-7c37elh6	255	11	s	s	NN
cord-001824-7c37elh6	255	12	2	2	CD
cord-001824-7c37elh6	255	13	UUU	UUU	NNP
cord-001824-7c37elh6	255	14	slippage	slippage	NN
cord-001824-7c37elh6	255	15	is	be	VBZ
cord-001824-7c37elh6	255	16	not	not	RB
cord-001824-7c37elh6	255	17	sensitive	sensitive	JJ
cord-001824-7c37elh6	255	18	to	to	IN
cord-001824-7c37elh6	255	19	the	the	DT
cord-001824-7c37elh6	255	20	rate	rate	NN
cord-001824-7c37elh6	255	21	of	of	IN
cord-001824-7c37elh6	255	22	A	a	DT
cord-001824-7c37elh6	255	23	-	-	HYPH
cord-001824-7c37elh6	255	24	site	site	NN
cord-001824-7c37elh6	255	25	selection	selection	NN
cord-001824-7c37elh6	255	26	suggesting	suggest	VBG
cord-001824-7c37elh6	255	27	that	that	IN
cord-001824-7c37elh6	255	28	lack	lack	NN
cord-001824-7c37elh6	255	29	of	of	IN
cord-001824-7c37elh6	255	30	mcm	mcm	NNP
cord-001824-7c37elh6	255	31	5	5	CD
cord-001824-7c37elh6	255	32	s	s	NN
cord-001824-7c37elh6	255	33	2	2	CD
cord-001824-7c37elh6	256	1	U	U	NNP
cord-001824-7c37elh6	256	2	does	do	VBZ
cord-001824-7c37elh6	256	3	not	not	RB
cord-001824-7c37elh6	256	4	cause	cause	VB
cord-001824-7c37elh6	256	5	any	any	DT
cord-001824-7c37elh6	256	6	P	p	NN
cord-001824-7c37elh6	256	7	-	-	HYPH
cord-001824-7c37elh6	256	8	site	site	NN
cord-001824-7c37elh6	256	9	effect	effect	NN
cord-001824-7c37elh6	256	10	and	and	CC
cord-001824-7c37elh6	256	11	thus	thus	RB
cord-001824-7c37elh6	256	12	an	an	DT
cord-001824-7c37elh6	256	13	increased	increase	VBN
cord-001824-7c37elh6	256	14	peptidyl	peptidyl	NN
cord-001824-7c37elh6	256	15	-	-	HYPH
cord-001824-7c37elh6	256	16	tRNA	trna	NN
cord-001824-7c37elh6	256	17	slippage	slippage	NN
cord-001824-7c37elh6	256	18	.	.	.
cord-001824-7c37elh6	257	1	If	if	IN
cord-001824-7c37elh6	257	2	the	the	DT
cord-001824-7c37elh6	257	3	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	257	4	event	event	NN
cord-001824-7c37elh6	257	5	occurring	occur	VBG
cord-001824-7c37elh6	257	6	at	at	IN
cord-001824-7c37elh6	257	7	the	the	DT
cord-001824-7c37elh6	257	8	modified	modify	VBN
cord-001824-7c37elh6	257	9	Ty1	ty1	NN
cord-001824-7c37elh6	257	10	site	site	NN
cord-001824-7c37elh6	257	11	'	'	``
cord-001824-7c37elh6	257	12	CUU	CUU	NNP
cord-001824-7c37elh6	257	13	-	-	HYPH
cord-001824-7c37elh6	257	14	AAA	AAA	NNP
cord-001824-7c37elh6	257	15	-	-	HYPH
cord-001824-7c37elh6	257	16	C	C	NNP
cord-001824-7c37elh6	257	17	'	'	''
cord-001824-7c37elh6	257	18	was	be	VBD
cord-001824-7c37elh6	257	19	caused	cause	VBN
cord-001824-7c37elh6	257	20	by	by	IN
cord-001824-7c37elh6	257	21	a	a	DT
cord-001824-7c37elh6	257	22	slow	slow	JJ
cord-001824-7c37elh6	257	23	entry	entry	NN
cord-001824-7c37elh6	257	24	of	of	IN
cord-001824-7c37elh6	257	25	the	the	DT
cord-001824-7c37elh6	257	26	ternary	ternary	JJ
cord-001824-7c37elh6	257	27	complex	complex	NN
cord-001824-7c37elh6	257	28	containing	contain	VBG
cord-001824-7c37elh6	257	29	the	the	DT
cord-001824-7c37elh6	257	30	hypomodified	hypomodifie	VBN
cord-001824-7c37elh6	257	31	tRNA	tRNA	NNP
cord-001824-7c37elh6	257	32	Lys	Lys	NNP
cord-001824-7c37elh6	257	33	mcm	mcm	NNP
cord-001824-7c37elh6	257	34	5	5	CD
cord-001824-7c37elh6	257	35	s	s	NN
cord-001824-7c37elh6	257	36	2	2	CD
cord-001824-7c37elh6	257	37	UUU	UUU	NNP
cord-001824-7c37elh6	257	38	causing	cause	VBG
cord-001824-7c37elh6	257	39	a	a	DT
cord-001824-7c37elh6	257	40	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	257	41	-	-	HYPH
cord-001824-7c37elh6	257	42	tRNA	trna	NN
cord-001824-7c37elh6	257	43	Leu	Leu	NNP
cord-001824-7c37elh6	257	44	UAG	UAG	NNP
cord-001824-7c37elh6	257	45	slippage	slippage	NN
cord-001824-7c37elh6	257	46	to	to	IN
cord-001824-7c37elh6	257	47	+1	+1	XX
cord-001824-7c37elh6	257	48	translational	translational	JJ
cord-001824-7c37elh6	257	49	frame	frame	NN
cord-001824-7c37elh6	257	50	,	,	,
cord-001824-7c37elh6	258	1	an	an	DT
cord-001824-7c37elh6	258	2	elevated	elevated	JJ
cord-001824-7c37elh6	258	3	level	level	NN
cord-001824-7c37elh6	258	4	of	of	IN
cord-001824-7c37elh6	258	5	the	the	DT
cord-001824-7c37elh6	258	6	hypomod	hypomod	NN
cord-001824-7c37elh6	258	7	-	-	HYPH
cord-001824-7c37elh6	258	8	ified	ifie	VBN
cord-001824-7c37elh6	258	9	tRNA	tRNA	NNP
cord-001824-7c37elh6	258	10	Lys	Lys	NNP
cord-001824-7c37elh6	258	11	mcm	mcm	NNP
cord-001824-7c37elh6	258	12	5	5	CD
cord-001824-7c37elh6	258	13	s	s	NN
cord-001824-7c37elh6	258	14	2	2	CD
cord-001824-7c37elh6	258	15	UUU	UUU	NNP
cord-001824-7c37elh6	258	16	should	should	MD
cord-001824-7c37elh6	258	17	increase	increase	VB
cord-001824-7c37elh6	258	18	the	the	DT
cord-001824-7c37elh6	258	19	rate	rate	NN
cord-001824-7c37elh6	258	20	of	of	IN
cord-001824-7c37elh6	258	21	A	a	DT
cord-001824-7c37elh6	258	22	-	-	HYPH
cord-001824-7c37elh6	258	23	site	site	NN
cord-001824-7c37elh6	258	24	selection	selection	NN
cord-001824-7c37elh6	258	25	and	and	CC
cord-001824-7c37elh6	258	26	thereby	thereby	RB
cord-001824-7c37elh6	258	27	reducing	reduce	VBG
cord-001824-7c37elh6	258	28	+1	+1	XX
cord-001824-7c37elh6	258	29	frameshifting	frameshifting	NN
cord-001824-7c37elh6	258	30	(	(	-LRB-
cord-001824-7c37elh6	258	31	Figure	figure	NN
cord-001824-7c37elh6	258	32	1B	1b	CD
cord-001824-7c37elh6	258	33	)	)	-RRB-
cord-001824-7c37elh6	258	34	.	.	.
cord-001824-7c37elh6	259	1	We	-PRON-	PRP
cord-001824-7c37elh6	259	2	therefore	therefore	RB
cord-001824-7c37elh6	259	3	cloned	clone	VBD
cord-001824-7c37elh6	259	4	the	the	DT
cord-001824-7c37elh6	259	5	tK(UUU)L	tK(UUU)L	NNP
cord-001824-7c37elh6	259	6	gene	gene	NN
cord-001824-7c37elh6	259	7	,	,	,
cord-001824-7c37elh6	259	8	which	which	WDT
cord-001824-7c37elh6	259	9	encodes	encode	VBZ
cord-001824-7c37elh6	259	10	tRNA	tRNA	NNP
cord-001824-7c37elh6	259	11	Lys	Lys	NNP
cord-001824-7c37elh6	259	12	mcm	mcm	NNP
cord-001824-7c37elh6	259	13	5	5	CD
cord-001824-7c37elh6	259	14	s	s	NN
cord-001824-7c37elh6	259	15	2	2	CD
cord-001824-7c37elh6	259	16	UUU	UUU	NNP
cord-001824-7c37elh6	259	17	into	into	IN
cord-001824-7c37elh6	259	18	either	either	DT
cord-001824-7c37elh6	259	19	plasmid	plasmid	NN
cord-001824-7c37elh6	259	20	pMB38	pMB38	NNS
cord-001824-7c37elh6	259	21	-	-	HYPH
cord-001824-7c37elh6	259	22	9merWT	9merwt	CD
cord-001824-7c37elh6	259	23	(	(	-LRB-
cord-001824-7c37elh6	259	24	test	test	NN
cord-001824-7c37elh6	259	25	construct	construct	NN
cord-001824-7c37elh6	259	26	,	,	,
cord-001824-7c37elh6	259	27	containing	contain	VBG
cord-001824-7c37elh6	259	28	the	the	DT
cord-001824-7c37elh6	259	29	CUU	CUU	NNP
cord-001824-7c37elh6	259	30	-	-	HYPH
cord-001824-7c37elh6	259	31	AAA	AAA	NNP
cord-001824-7c37elh6	259	32	-	-	HYPH
cord-001824-7c37elh6	259	33	C	c	NN
cord-001824-7c37elh6	259	34	frameshift	frameshift	NN
cord-001824-7c37elh6	259	35	site	site	NN
cord-001824-7c37elh6	259	36	)	)	-RRB-
cord-001824-7c37elh6	259	37	and	and	CC
cord-001824-7c37elh6	259	38	pMB38	pMB38	NNS
cord-001824-7c37elh6	259	39	-	-	SYM
cord-001824-7c37elh6	259	40	9merFF	9merff	CD
cord-001824-7c37elh6	260	1	(	(	-LRB-
cord-001824-7c37elh6	260	2	corresponding	correspond	VBG
cord-001824-7c37elh6	260	3	in	in	IN
cord-001824-7c37elh6	260	4	-	-	HYPH
cord-001824-7c37elh6	260	5	frame	frame	NN
cord-001824-7c37elh6	260	6	control	control	NN
cord-001824-7c37elh6	260	7	construct	construct	VB
cord-001824-7c37elh6	260	8	,	,	,
cord-001824-7c37elh6	260	9	Figure	Figure	NNP
cord-001824-7c37elh6	260	10	4	4	CD
cord-001824-7c37elh6	260	11	and	and	CC
cord-001824-7c37elh6	260	12	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	260	13	Table	Table	NNP
cord-001824-7c37elh6	260	14	S2	S2	NNP
cord-001824-7c37elh6	260	15	)	)	-RRB-
cord-001824-7c37elh6	260	16	.	.	.
cord-001824-7c37elh6	261	1	Thus	thus	RB
cord-001824-7c37elh6	261	2	,	,	,
cord-001824-7c37elh6	261	3	the	the	DT
cord-001824-7c37elh6	261	4	plasmids	plasmid	NNS
cord-001824-7c37elh6	261	5	harbor	harbor	VBP
cord-001824-7c37elh6	261	6	both	both	PDT
cord-001824-7c37elh6	261	7	the	the	DT
cord-001824-7c37elh6	261	8	tRNA	tRNA	NNP
cord-001824-7c37elh6	261	9	gene	gene	NN
cord-001824-7c37elh6	261	10	and	and	CC
cord-001824-7c37elh6	261	11	the	the	DT
cord-001824-7c37elh6	261	12	␤	␤	CD
cord-001824-7c37elh6	261	13	galactosidase	galactosidase	NN
cord-001824-7c37elh6	261	14	gene	gene	NN
cord-001824-7c37elh6	261	15	with	with	IN
cord-001824-7c37elh6	261	16	either	either	CC
cord-001824-7c37elh6	261	17	a	a	DT
cord-001824-7c37elh6	261	18	frameshift	frameshift	NN
cord-001824-7c37elh6	261	19	site	site	NN
cord-001824-7c37elh6	261	20	or	or	CC
cord-001824-7c37elh6	261	21	an	an	DT
cord-001824-7c37elh6	261	22	inframe	inframe	NN
cord-001824-7c37elh6	261	23	control	control	NN
cord-001824-7c37elh6	261	24	.	.	.
cord-001824-7c37elh6	262	1	The	the	DT
cord-001824-7c37elh6	262	2	plasmid	plasmid	NN
cord-001824-7c37elh6	262	3	encoded	encode	VBD
cord-001824-7c37elh6	262	4	tK(UUU)L	tK(UUU)L	NNP
cord-001824-7c37elh6	262	5	gene	gene	NN
cord-001824-7c37elh6	262	6	results	result	NNS
cord-001824-7c37elh6	262	7	in	in	IN
cord-001824-7c37elh6	262	8	overexpression	overexpression	NN
cord-001824-7c37elh6	262	9	of	of	IN
cord-001824-7c37elh6	262	10	tRNA	tRNA	NNP
cord-001824-7c37elh6	262	11	Lys	Lys	NNP
cord-001824-7c37elh6	262	12	mcm	mcm	NNP
cord-001824-7c37elh6	262	13	5	5	CD
cord-001824-7c37elh6	262	14	s	s	NN
cord-001824-7c37elh6	262	15	2	2	CD
cord-001824-7c37elh6	262	16	UUU	UUU	NNP
cord-001824-7c37elh6	262	17	and	and	CC
cord-001824-7c37elh6	262	18	concomitantly	concomitantly	RB
cord-001824-7c37elh6	262	19	reduced	reduce	VBD
cord-001824-7c37elh6	262	20	the	the	DT
cord-001824-7c37elh6	262	21	levels	level	NNS
cord-001824-7c37elh6	262	22	of	of	IN
cord-001824-7c37elh6	262	23	+1	+1	NN
cord-001824-7c37elh6	262	24	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	262	25	in	in	IN
cord-001824-7c37elh6	262	26	the	the	DT
cord-001824-7c37elh6	262	27	elp3	elp3	NNP
cord-001824-7c37elh6	262	28	mutant	mutant	NN
cord-001824-7c37elh6	262	29	from	from	IN
cord-001824-7c37elh6	262	30	10-to	10-to	CD
cord-001824-7c37elh6	262	31	3-fold	3-fold	CD
cord-001824-7c37elh6	262	32	compared	compare	VBN
cord-001824-7c37elh6	262	33	to	to	IN
cord-001824-7c37elh6	262	34	wild	wild	JJ
cord-001824-7c37elh6	262	35	type	type	NN
cord-001824-7c37elh6	262	36	(	(	-LRB-
cord-001824-7c37elh6	262	37	Table	table	NN
cord-001824-7c37elh6	262	38	3	3	CD
cord-001824-7c37elh6	262	39	)	)	-RRB-
cord-001824-7c37elh6	262	40	.	.	.
cord-001824-7c37elh6	263	1	This	this	DT
cord-001824-7c37elh6	263	2	data	datum	NNS
cord-001824-7c37elh6	263	3	strongly	strongly	RB
cord-001824-7c37elh6	263	4	suggest	suggest	VBP
cord-001824-7c37elh6	263	5	that	that	IN
cord-001824-7c37elh6	263	6	the	the	DT
cord-001824-7c37elh6	263	7	+1	+1	HYPH
cord-001824-7c37elh6	263	8	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	263	9	event	event	NN
cord-001824-7c37elh6	263	10	at	at	IN
cord-001824-7c37elh6	263	11	'	'	``
cord-001824-7c37elh6	263	12	CUU	CUU	NNP
cord-001824-7c37elh6	263	13	-	-	HYPH
cord-001824-7c37elh6	263	14	AAA	AAA	NNP
cord-001824-7c37elh6	263	15	-	-	HYPH
cord-001824-7c37elh6	263	16	C	C	NNP
cord-001824-7c37elh6	263	17	'	'	''
cord-001824-7c37elh6	263	18	Lys	Lys	NNP
cord-001824-7c37elh6	263	19	codon	codon	NN
cord-001824-7c37elh6	263	20	test	test	NN
cord-001824-7c37elh6	263	21	construct	construct	NN
cord-001824-7c37elh6	263	22	occurs	occur	VBZ
cord-001824-7c37elh6	263	23	by	by	IN
cord-001824-7c37elh6	263	24	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	263	25	-	-	HYPH
cord-001824-7c37elh6	263	26	tRNA	tRNA	NNP
cord-001824-7c37elh6	263	27	Leu	Leu	NNP
cord-001824-7c37elh6	263	28	UAG	UAG	NNP
cord-001824-7c37elh6	263	29	slippage	slippage	NN
cord-001824-7c37elh6	263	30	due	due	IN
cord-001824-7c37elh6	263	31	to	to	IN
cord-001824-7c37elh6	263	32	an	an	DT
cord-001824-7c37elh6	263	33	A	a	NN
cord-001824-7c37elh6	263	34	-	-	HYPH
cord-001824-7c37elh6	263	35	site	site	NN
cord-001824-7c37elh6	263	36	effect	effect	NN
cord-001824-7c37elh6	263	37	caused	cause	VBN
cord-001824-7c37elh6	263	38	by	by	IN
cord-001824-7c37elh6	263	39	a	a	DT
cord-001824-7c37elh6	263	40	slow	slow	JJ
cord-001824-7c37elh6	263	41	entry	entry	NN
cord-001824-7c37elh6	263	42	of	of	IN
cord-001824-7c37elh6	263	43	the	the	DT
cord-001824-7c37elh6	263	44	hypomodified	hypomodifie	VBN
cord-001824-7c37elh6	263	45	tRNA	tRNA	NNP
cord-001824-7c37elh6	263	46	Lys	Lys	NNP
cord-001824-7c37elh6	263	47	mcm	mcm	NNP
cord-001824-7c37elh6	263	48	5	5	CD
cord-001824-7c37elh6	263	49	s	s	NN
cord-001824-7c37elh6	263	50	2	2	CD
cord-001824-7c37elh6	263	51	UUU	UUU	NNP
cord-001824-7c37elh6	263	52	.	.	.
cord-001824-7c37elh6	264	1	As	as	IN
cord-001824-7c37elh6	264	2	was	be	VBD
cord-001824-7c37elh6	264	3	suggested	suggest	VBN
cord-001824-7c37elh6	264	4	earlier	early	RBR
cord-001824-7c37elh6	264	5	by	by	IN
cord-001824-7c37elh6	264	6	us	-PRON-	PRP
cord-001824-7c37elh6	264	7	(	(	-LRB-
cord-001824-7c37elh6	264	8	34	34	CD
cord-001824-7c37elh6	264	9	,	,	,
cord-001824-7c37elh6	264	10	48	48	CD
cord-001824-7c37elh6	264	11	)	)	-RRB-
cord-001824-7c37elh6	264	12	and	and	CC
cord-001824-7c37elh6	264	13	confirmed	confirm	VBN
cord-001824-7c37elh6	264	14	by	by	IN
cord-001824-7c37elh6	264	15	Rezgui	Rezgui	NNP
cord-001824-7c37elh6	264	16	et	et	NNP
cord-001824-7c37elh6	264	17	al	al	NNP
cord-001824-7c37elh6	264	18	.	.	.
cord-001824-7c37elh6	265	1	(	(	-LRB-
cord-001824-7c37elh6	265	2	51	51	CD
cord-001824-7c37elh6	265	3	)	)	-RRB-
cord-001824-7c37elh6	265	4	,	,	,
cord-001824-7c37elh6	265	5	the	the	DT
cord-001824-7c37elh6	265	6	major	major	JJ
cord-001824-7c37elh6	265	7	function	function	NN
cord-001824-7c37elh6	265	8	of	of	IN
cord-001824-7c37elh6	265	9	the	the	DT
cord-001824-7c37elh6	265	10	mcm	mcm	NNP
cord-001824-7c37elh6	265	11	5	5	CD
cord-001824-7c37elh6	265	12	s	s	NN
cord-001824-7c37elh6	265	13	2	2	CD
cord-001824-7c37elh6	265	14	U	U	NNP
cord-001824-7c37elh6	265	15	34	34	CD
cord-001824-7c37elh6	265	16	nucleoside	nucleoside	NN
cord-001824-7c37elh6	265	17	in	in	IN
cord-001824-7c37elh6	265	18	Lys	Lys	NNP
cord-001824-7c37elh6	265	19	-	-	HYPH
cord-001824-7c37elh6	265	20	tRNA	tRNA	NNP
cord-001824-7c37elh6	265	21	is	be	VBZ
cord-001824-7c37elh6	265	22	to	to	TO
cord-001824-7c37elh6	265	23	improve	improve	VB
cord-001824-7c37elh6	265	24	the	the	DT
cord-001824-7c37elh6	265	25	reading	reading	NN
cord-001824-7c37elh6	265	26	of	of	IN
cord-001824-7c37elh6	265	27	the	the	DT
cord-001824-7c37elh6	265	28	cognate	cognate	JJ
cord-001824-7c37elh6	265	29	codon	codon	NN
cord-001824-7c37elh6	265	30	.	.	.
cord-001824-7c37elh6	266	1	Thus	thus	RB
cord-001824-7c37elh6	266	2	,	,	,
cord-001824-7c37elh6	266	3	mcm	mcm	NNP
cord-001824-7c37elh6	266	4	5	5	CD
cord-001824-7c37elh6	266	5	s	s	NN
cord-001824-7c37elh6	266	6	2	2	CD
cord-001824-7c37elh6	266	7	U	u	NN
cord-001824-7c37elh6	266	8	34	34	CD
cord-001824-7c37elh6	266	9	deficiency	deficiency	NN
cord-001824-7c37elh6	266	10	results	result	NNS
cord-001824-7c37elh6	266	11	in	in	IN
cord-001824-7c37elh6	266	12	slow	slow	JJ
cord-001824-7c37elh6	266	13	decoding	decoding	NN
cord-001824-7c37elh6	266	14	and	and	CC
cord-001824-7c37elh6	266	15	reduced	reduce	VBN
cord-001824-7c37elh6	266	16	translation	translation	NN
cord-001824-7c37elh6	266	17	elongation	elongation	NN
cord-001824-7c37elh6	266	18	rate	rate	NN
cord-001824-7c37elh6	266	19	but	but	CC
cord-001824-7c37elh6	266	20	also	also	RB
cord-001824-7c37elh6	266	21	,	,	,
cord-001824-7c37elh6	266	22	as	as	IN
cord-001824-7c37elh6	266	23	shown	show	VBN
cord-001824-7c37elh6	266	24	here	here	RB
cord-001824-7c37elh6	266	25	,	,	,
cord-001824-7c37elh6	266	26	induces	induce	VBZ
cord-001824-7c37elh6	266	27	+1	+1	XX
cord-001824-7c37elh6	266	28	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	266	29	by	by	IN
cord-001824-7c37elh6	266	30	reducing	reduce	VBG
cord-001824-7c37elh6	266	31	the	the	DT
cord-001824-7c37elh6	266	32	rate	rate	NN
cord-001824-7c37elh6	266	33	of	of	IN
cord-001824-7c37elh6	266	34	A	a	DT
cord-001824-7c37elh6	266	35	-	-	HYPH
cord-001824-7c37elh6	266	36	site	site	NN
cord-001824-7c37elh6	266	37	selection	selection	NN
cord-001824-7c37elh6	266	38	.	.	.
cord-001824-7c37elh6	267	1	Among	among	IN
cord-001824-7c37elh6	267	2	the	the	DT
cord-001824-7c37elh6	267	3	tRNA	tRNA	NNP
cord-001824-7c37elh6	267	4	isoacceptors	isoacceptor	NNS
cord-001824-7c37elh6	267	5	having	have	VBG
cord-001824-7c37elh6	267	6	xm	xm	NNP
cord-001824-7c37elh6	267	7	5	5	CD
cord-001824-7c37elh6	267	8	U	U	NNP
cord-001824-7c37elh6	267	9	34	34	CD
cord-001824-7c37elh6	267	10	or	or	CC
cord-001824-7c37elh6	267	11	xm	xm	NNP
cord-001824-7c37elh6	267	12	5	5	CD
cord-001824-7c37elh6	267	13	s	s	SYM
cord-001824-7c37elh6	267	14	2	2	CD
cord-001824-7c37elh6	267	15	U	U	NNP
cord-001824-7c37elh6	267	16	34	34	CD
cord-001824-7c37elh6	267	17	wobble	wobble	NN
cord-001824-7c37elh6	267	18	uridine	uridine	JJ
cord-001824-7c37elh6	267	19	nucleosides	nucleoside	NNS
cord-001824-7c37elh6	267	20	,	,	,
cord-001824-7c37elh6	267	21	only	only	RB
cord-001824-7c37elh6	267	22	Lys	Lys	NNP
cord-001824-7c37elh6	267	23	-	-	:
cord-001824-7c37elh6	267	24	and	and	CC
cord-001824-7c37elh6	267	25	Gln	Gln	NNP
cord-001824-7c37elh6	267	26	-	-	HYPH
cord-001824-7c37elh6	267	27	tRNAs	tRNAs	NNP
cord-001824-7c37elh6	267	28	has	have	VBZ
cord-001824-7c37elh6	267	29	been	be	VBN
cord-001824-7c37elh6	267	30	investigated	investigate	VBN
cord-001824-7c37elh6	267	31	for	for	IN
cord-001824-7c37elh6	267	32	+1	+1	HYPH
cord-001824-7c37elh6	267	33	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	267	34	in	in	IN
cord-001824-7c37elh6	267	35	both	both	DT
cord-001824-7c37elh6	267	36	bacteria	bacteria	NNS
cord-001824-7c37elh6	267	37	and	and	CC
cord-001824-7c37elh6	267	38	yeast	yeast	NN
cord-001824-7c37elh6	267	39	.	.	.
cord-001824-7c37elh6	268	1	The	the	DT
cord-001824-7c37elh6	268	2	modified	modify	VBN
cord-001824-7c37elh6	268	3	wobble	wobble	NN
cord-001824-7c37elh6	268	4	nucleoside	nucleoside	RB
cord-001824-7c37elh6	268	5	5-methoxycarbonylmethyl-2-thiouridine	5-methoxycarbonylmethyl-2-thiouridine	CD
cord-001824-7c37elh6	269	1	(	(	-LRB-
cord-001824-7c37elh6	269	2	mcm	mcm	NNP
cord-001824-7c37elh6	269	3	5	5	CD
cord-001824-7c37elh6	269	4	s	s	NN
cord-001824-7c37elh6	269	5	2	2	CD
cord-001824-7c37elh6	269	6	U	U	NNP
cord-001824-7c37elh6	269	7	34	34	CD
cord-001824-7c37elh6	269	8	)	)	-RRB-
cord-001824-7c37elh6	269	9	present	present	JJ
cord-001824-7c37elh6	269	10	in	in	IN
cord-001824-7c37elh6	269	11	yeast	yeast	NN
cord-001824-7c37elh6	270	1	tRNAs	trna	NNS
cord-001824-7c37elh6	270	2	specific	specific	JJ
cord-001824-7c37elh6	270	3	for	for	IN
cord-001824-7c37elh6	270	4	Gln	Gln	NNP
cord-001824-7c37elh6	270	5	,	,	,
cord-001824-7c37elh6	270	6	Lys	Lys	NNP
cord-001824-7c37elh6	270	7	and	and	CC
cord-001824-7c37elh6	270	8	Glu	Glu	NNP
cord-001824-7c37elh6	270	9	has	have	VBZ
cord-001824-7c37elh6	270	10	a	a	DT
cord-001824-7c37elh6	270	11	chemically	chemically	RB
cord-001824-7c37elh6	270	12	related	relate	VBN
cord-001824-7c37elh6	270	13	form	form	NN
cord-001824-7c37elh6	270	14	,	,	,
cord-001824-7c37elh6	270	15	5-methylaminomethyl-2thiouridine	5-methylaminomethyl-2thiouridine	CD
cord-001824-7c37elh6	270	16	(	(	-LRB-
cord-001824-7c37elh6	270	17	mnm	mnm	NNP
cord-001824-7c37elh6	270	18	5	5	NNP
cord-001824-7c37elh6	270	19	s	s	SYM
cord-001824-7c37elh6	270	20	2	2	CD
cord-001824-7c37elh6	270	21	U	U	NNP
cord-001824-7c37elh6	270	22	34	34	CD
cord-001824-7c37elh6	270	23	)	)	-RRB-
cord-001824-7c37elh6	270	24	present	present	JJ
cord-001824-7c37elh6	270	25	in	in	IN
cord-001824-7c37elh6	270	26	the	the	DT
cord-001824-7c37elh6	270	27	corresponding	corresponding	JJ
cord-001824-7c37elh6	270	28	bacterial	bacterial	JJ
cord-001824-7c37elh6	270	29	tRNAs	trna	NNS
cord-001824-7c37elh6	270	30	.	.	.
cord-001824-7c37elh6	271	1	In	in	IN
cord-001824-7c37elh6	271	2	bacteria	bacteria	NNS
cord-001824-7c37elh6	271	3	,	,	,
cord-001824-7c37elh6	271	4	lack	lack	NN
cord-001824-7c37elh6	271	5	of	of	IN
cord-001824-7c37elh6	271	6	the	the	DT
cord-001824-7c37elh6	271	7	mnm	mnm	NNP
cord-001824-7c37elh6	271	8	5	5	CD
cord-001824-7c37elh6	271	9	group	group	NN
cord-001824-7c37elh6	271	10	in	in	IN
cord-001824-7c37elh6	271	11	Gln	Gln	NNP
cord-001824-7c37elh6	271	12	-	-	HYPH
cord-001824-7c37elh6	271	13	tRNA	trna	NN
cord-001824-7c37elh6	271	14	results	result	NNS
cord-001824-7c37elh6	271	15	in	in	IN
cord-001824-7c37elh6	271	16	increased	increase	VBN
cord-001824-7c37elh6	271	17	+1	+1	NNS
cord-001824-7c37elh6	271	18	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	271	19	at	at	IN
cord-001824-7c37elh6	271	20	both	both	CC
cord-001824-7c37elh6	271	21	cognate	cognate	JJ
cord-001824-7c37elh6	271	22	(	(	-LRB-
cord-001824-7c37elh6	271	23	CAA	CAA	NNP
cord-001824-7c37elh6	271	24	)	)	-RRB-
cord-001824-7c37elh6	271	25	and	and	CC
cord-001824-7c37elh6	271	26	near	near	IN
cord-001824-7c37elh6	271	27	cognate	cognate	NNP
cord-001824-7c37elh6	271	28	(	(	-LRB-
cord-001824-7c37elh6	271	29	CAG	CAG	NNP
cord-001824-7c37elh6	271	30	)	)	-RRB-
cord-001824-7c37elh6	271	31	codons	codon	NNS
cord-001824-7c37elh6	271	32	,	,	,
cord-001824-7c37elh6	271	33	whereas	whereas	IN
cord-001824-7c37elh6	271	34	absence	absence	NN
cord-001824-7c37elh6	271	35	of	of	IN
cord-001824-7c37elh6	271	36	the	the	DT
cord-001824-7c37elh6	271	37	s	s	NNP
cord-001824-7c37elh6	271	38	2	2	CD
cord-001824-7c37elh6	271	39	group	group	NN
cord-001824-7c37elh6	271	40	results	result	NNS
cord-001824-7c37elh6	271	41	in	in	IN
cord-001824-7c37elh6	271	42	+1	+1	NN
cord-001824-7c37elh6	271	43	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	271	44	only	only	RB
cord-001824-7c37elh6	271	45	at	at	IN
cord-001824-7c37elh6	271	46	the	the	DT
cord-001824-7c37elh6	271	47	cognate	cognate	NN
cord-001824-7c37elh6	271	48	(	(	-LRB-
cord-001824-7c37elh6	271	49	CAA	CAA	NNP
cord-001824-7c37elh6	271	50	)	)	-RRB-
cord-001824-7c37elh6	271	51	codon	codon	NN
cord-001824-7c37elh6	271	52	(	(	-LRB-
cord-001824-7c37elh6	271	53	6	6	CD
cord-001824-7c37elh6	271	54	)	)	-RRB-
cord-001824-7c37elh6	271	55	.	.	.
cord-001824-7c37elh6	272	1	In	in	IN
cord-001824-7c37elh6	272	2	contrast	contrast	NN
cord-001824-7c37elh6	272	3	,	,	,
cord-001824-7c37elh6	272	4	lack	lack	NN
cord-001824-7c37elh6	272	5	of	of	IN
cord-001824-7c37elh6	272	6	mcm	mcm	NNP
cord-001824-7c37elh6	272	7	5	5	CD
cord-001824-7c37elh6	272	8	or	or	CC
cord-001824-7c37elh6	272	9	s	s	NNS
cord-001824-7c37elh6	272	10	2	2	CD
cord-001824-7c37elh6	272	11	groups	group	NNS
cord-001824-7c37elh6	272	12	in	in	IN
cord-001824-7c37elh6	272	13	yeast	yeast	NN
cord-001824-7c37elh6	272	14	Gln	Gln	NNP
cord-001824-7c37elh6	272	15	-	-	HYPH
cord-001824-7c37elh6	272	16	tRNA	tRNA	NNP
cord-001824-7c37elh6	272	17	does	do	VBZ
cord-001824-7c37elh6	272	18	not	not	RB
cord-001824-7c37elh6	272	19	result	result	VB
cord-001824-7c37elh6	272	20	in	in	IN
cord-001824-7c37elh6	272	21	increased	increase	VBN
cord-001824-7c37elh6	272	22	+1	+1	NNS
cord-001824-7c37elh6	272	23	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	272	24	at	at	IN
cord-001824-7c37elh6	272	25	either	either	CC
cord-001824-7c37elh6	272	26	CAA	CAA	NNP
cord-001824-7c37elh6	272	27	or	or	CC
cord-001824-7c37elh6	272	28	CAG	CAG	NNP
cord-001824-7c37elh6	272	29	codons	codon	NNS
cord-001824-7c37elh6	272	30	.	.	.
cord-001824-7c37elh6	273	1	Instead	instead	RB
cord-001824-7c37elh6	273	2	,	,	,
cord-001824-7c37elh6	273	3	absence	absence	NN
cord-001824-7c37elh6	273	4	of	of	IN
cord-001824-7c37elh6	273	5	the	the	DT
cord-001824-7c37elh6	273	6	s	s	NNP
cord-001824-7c37elh6	273	7	2	2	CD
cord-001824-7c37elh6	273	8	group	group	NN
cord-001824-7c37elh6	273	9	results	result	NNS
cord-001824-7c37elh6	273	10	in	in	IN
cord-001824-7c37elh6	273	11	reduced	reduce	VBN
cord-001824-7c37elh6	273	12	+1	+1	NNS
cord-001824-7c37elh6	273	13	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	273	14	at	at	IN
cord-001824-7c37elh6	273	15	the	the	DT
cord-001824-7c37elh6	273	16	CAG	CAG	NNP
cord-001824-7c37elh6	273	17	codon	codon	NN
cord-001824-7c37elh6	273	18	.	.	.
cord-001824-7c37elh6	274	1	In	in	IN
cord-001824-7c37elh6	274	2	bacteria	bacteria	NNS
cord-001824-7c37elh6	274	3	,	,	,
cord-001824-7c37elh6	274	4	lack	lack	NN
cord-001824-7c37elh6	274	5	of	of	IN
cord-001824-7c37elh6	274	6	mnm	mnm	NNP
cord-001824-7c37elh6	274	7	5	5	CD
cord-001824-7c37elh6	274	8	or	or	CC
cord-001824-7c37elh6	274	9	s	s	NNS
cord-001824-7c37elh6	274	10	2	2	CD
cord-001824-7c37elh6	274	11	groups	group	NNS
cord-001824-7c37elh6	274	12	in	in	IN
cord-001824-7c37elh6	274	13	Lys	Lys	NNP
cord-001824-7c37elh6	274	14	-	-	HYPH
cord-001824-7c37elh6	274	15	tRNA	tRNA	NNP
cord-001824-7c37elh6	274	16	cause	cause	NN
cord-001824-7c37elh6	274	17	increased	increase	VBN
cord-001824-7c37elh6	274	18	+1	+1	NNS
cord-001824-7c37elh6	274	19	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	274	20	at	at	IN
cord-001824-7c37elh6	274	21	both	both	CC
cord-001824-7c37elh6	274	22	cognate	cognate	JJ
cord-001824-7c37elh6	274	23	(	(	-LRB-
cord-001824-7c37elh6	274	24	AAA	AAA	NNP
cord-001824-7c37elh6	274	25	)	)	-RRB-
cord-001824-7c37elh6	274	26	and	and	CC
cord-001824-7c37elh6	275	1	near	near	IN
cord-001824-7c37elh6	275	2	cognate	cognate	NNP
cord-001824-7c37elh6	275	3	(	(	-LRB-
cord-001824-7c37elh6	275	4	AAG	AAG	NNP
cord-001824-7c37elh6	275	5	)	)	-RRB-
cord-001824-7c37elh6	275	6	codons	codon	NNS
cord-001824-7c37elh6	275	7	by	by	IN
cord-001824-7c37elh6	275	8	A	A	NNP
cord-001824-7c37elh6	275	9	-	-	:
cord-001824-7c37elh6	275	10	and	and	CC
cord-001824-7c37elh6	275	11	P	p	NN
cord-001824-7c37elh6	275	12	-	-	HYPH
cord-001824-7c37elh6	275	13	site	site	NN
cord-001824-7c37elh6	275	14	effects	effect	NNS
cord-001824-7c37elh6	275	15	(	(	-LRB-
cord-001824-7c37elh6	275	16	6	6	CD
cord-001824-7c37elh6	275	17	)	)	-RRB-
cord-001824-7c37elh6	275	18	.	.	.
cord-001824-7c37elh6	276	1	In	in	IN
cord-001824-7c37elh6	276	2	yeast	yeast	NN
cord-001824-7c37elh6	276	3	,	,	,
cord-001824-7c37elh6	276	4	we	-PRON-	PRP
cord-001824-7c37elh6	276	5	also	also	RB
cord-001824-7c37elh6	276	6	observed	observe	VBD
cord-001824-7c37elh6	276	7	an	an	DT
cord-001824-7c37elh6	276	8	increased	increase	VBN
cord-001824-7c37elh6	276	9	+1	+1	NNS
cord-001824-7c37elh6	276	10	frameshifting	frameshifting	NN
cord-001824-7c37elh6	276	11	due	due	IN
cord-001824-7c37elh6	276	12	to	to	IN
cord-001824-7c37elh6	276	13	lack	lack	NN
cord-001824-7c37elh6	276	14	of	of	IN
cord-001824-7c37elh6	276	15	mcm	mcm	NNP
cord-001824-7c37elh6	276	16	5	5	CD
cord-001824-7c37elh6	276	17	or	or	CC
cord-001824-7c37elh6	276	18	s	s	NNS
cord-001824-7c37elh6	276	19	2	2	CD
cord-001824-7c37elh6	276	20	groups	group	NNS
cord-001824-7c37elh6	276	21	of	of	IN
cord-001824-7c37elh6	276	22	Lys	Lys	NNP
cord-001824-7c37elh6	276	23	-	-	HYPH
cord-001824-7c37elh6	276	24	tRNA	tRNA	NNP
cord-001824-7c37elh6	276	25	at	at	IN
cord-001824-7c37elh6	276	26	AAA	AAA	NNP
cord-001824-7c37elh6	276	27	and	and	CC
cord-001824-7c37elh6	276	28	AAG	AAG	NNP
cord-001824-7c37elh6	276	29	codons	codon	NNS
cord-001824-7c37elh6	276	30	.	.	.
cord-001824-7c37elh6	277	1	However	however	RB
cord-001824-7c37elh6	277	2	,	,	,
cord-001824-7c37elh6	277	3	we	-PRON-	PRP
cord-001824-7c37elh6	277	4	show	show	VBP
cord-001824-7c37elh6	277	5	that	that	IN
cord-001824-7c37elh6	277	6	+1	+1	NFP
cord-001824-7c37elh6	277	7	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	277	8	at	at	IN
cord-001824-7c37elh6	277	9	the	the	DT
cord-001824-7c37elh6	277	10	cognate	cognate	JJ
cord-001824-7c37elh6	277	11	(	(	-LRB-
cord-001824-7c37elh6	277	12	AAA	AAA	NNP
cord-001824-7c37elh6	277	13	)	)	-RRB-
cord-001824-7c37elh6	277	14	codon	codon	NN
cord-001824-7c37elh6	277	15	is	be	VBZ
cord-001824-7c37elh6	277	16	induced	induce	VBN
cord-001824-7c37elh6	277	17	by	by	IN
cord-001824-7c37elh6	277	18	an	an	DT
cord-001824-7c37elh6	277	19	A	A	NNP
cord-001824-7c37elh6	277	20	-	-	HYPH
cord-001824-7c37elh6	277	21	site	site	NN
cord-001824-7c37elh6	277	22	effect	effect	NN
cord-001824-7c37elh6	277	23	,	,	,
cord-001824-7c37elh6	277	24	not	not	RB
cord-001824-7c37elh6	277	25	a	a	DT
cord-001824-7c37elh6	277	26	P	p	NN
cord-001824-7c37elh6	277	27	-	-	HYPH
cord-001824-7c37elh6	277	28	site	site	NN
cord-001824-7c37elh6	277	29	effect	effect	NN
cord-001824-7c37elh6	277	30	.	.	.
cord-001824-7c37elh6	278	1	It	-PRON-	PRP
cord-001824-7c37elh6	278	2	has	have	VBZ
cord-001824-7c37elh6	278	3	been	be	VBN
cord-001824-7c37elh6	278	4	shown	show	VBN
cord-001824-7c37elh6	278	5	that	that	DT
cord-001824-7c37elh6	278	6	presence	presence	NN
cord-001824-7c37elh6	278	7	of	of	IN
cord-001824-7c37elh6	278	8	modified	modify	VBN
cord-001824-7c37elh6	278	9	nucleosides	nucleoside	NNS
cord-001824-7c37elh6	278	10	in	in	IN
cord-001824-7c37elh6	278	11	tRNAs	trna	NNS
cord-001824-7c37elh6	278	12	are	be	VBP
cord-001824-7c37elh6	278	13	required	require	VBN
cord-001824-7c37elh6	278	14	for	for	IN
cord-001824-7c37elh6	278	15	tuning	tune	VBG
cord-001824-7c37elh6	278	16	the	the	DT
cord-001824-7c37elh6	278	17	decoding	decode	VBG
cord-001824-7c37elh6	278	18	activity	activity	NN
cord-001824-7c37elh6	278	19	in	in	IN
cord-001824-7c37elh6	278	20	order	order	NN
cord-001824-7c37elh6	278	21	to	to	TO
cord-001824-7c37elh6	278	22	maintain	maintain	VB
cord-001824-7c37elh6	278	23	uniformity	uniformity	NN
cord-001824-7c37elh6	278	24	in	in	IN
cord-001824-7c37elh6	278	25	translation	translation	NN
cord-001824-7c37elh6	278	26	(	(	-LRB-
cord-001824-7c37elh6	278	27	49	49	CD
cord-001824-7c37elh6	278	28	)	)	-RRB-
cord-001824-7c37elh6	278	29	.	.	.
cord-001824-7c37elh6	279	1	An	an	DT
cord-001824-7c37elh6	279	2	in	in	IN
cord-001824-7c37elh6	279	3	vitro	vitro	FW
cord-001824-7c37elh6	279	4	study	study	NN
cord-001824-7c37elh6	279	5	in	in	IN
cord-001824-7c37elh6	279	6	yeast	yeast	NN
cord-001824-7c37elh6	279	7	showed	show	VBD
cord-001824-7c37elh6	279	8	that	that	IN
cord-001824-7c37elh6	279	9	presence	presence	NN
cord-001824-7c37elh6	279	10	of	of	IN
cord-001824-7c37elh6	279	11	the	the	DT
cord-001824-7c37elh6	279	12	mcm	mcm	NNP
cord-001824-7c37elh6	279	13	5	5	CD
cord-001824-7c37elh6	279	14	and	and	CC
cord-001824-7c37elh6	279	15	s	s	NNS
cord-001824-7c37elh6	279	16	2	2	CD
cord-001824-7c37elh6	279	17	groups	group	NNS
cord-001824-7c37elh6	279	18	of	of	IN
cord-001824-7c37elh6	279	19	Lys	Lys	NNP
cord-001824-7c37elh6	279	20	-	-	HYPH
cord-001824-7c37elh6	279	21	tRNA	tRNA	NNP
cord-001824-7c37elh6	279	22	are	be	VBP
cord-001824-7c37elh6	279	23	required	require	VBN
cord-001824-7c37elh6	279	24	for	for	IN
cord-001824-7c37elh6	279	25	efficient	efficient	JJ
cord-001824-7c37elh6	279	26	A	a	DT
cord-001824-7c37elh6	279	27	-	-	HYPH
cord-001824-7c37elh6	279	28	site	site	NN
cord-001824-7c37elh6	279	29	binding	binding	NN
cord-001824-7c37elh6	279	30	(	(	-LRB-
cord-001824-7c37elh6	279	31	51	51	CD
cord-001824-7c37elh6	279	32	)	)	-RRB-
cord-001824-7c37elh6	279	33	.	.	.
cord-001824-7c37elh6	280	1	Consistent	consistent	JJ
cord-001824-7c37elh6	280	2	with	with	IN
cord-001824-7c37elh6	280	3	these	these	DT
cord-001824-7c37elh6	280	4	observations	observation	NNS
cord-001824-7c37elh6	280	5	,	,	,
cord-001824-7c37elh6	280	6	our	-PRON-	PRP$
cord-001824-7c37elh6	280	7	in	in	IN
cord-001824-7c37elh6	280	8	vivo	vivo	NNP
cord-001824-7c37elh6	280	9	studies	study	NNS
cord-001824-7c37elh6	280	10	show	show	VBP
cord-001824-7c37elh6	280	11	that	that	IN
cord-001824-7c37elh6	280	12	presence	presence	NN
cord-001824-7c37elh6	280	13	of	of	IN
cord-001824-7c37elh6	280	14	the	the	DT
cord-001824-7c37elh6	280	15	mcm	mcm	NNP
cord-001824-7c37elh6	280	16	5	5	CD
cord-001824-7c37elh6	280	17	group	group	NN
cord-001824-7c37elh6	280	18	of	of	IN
cord-001824-7c37elh6	280	19	Lys	Lys	NNP
cord-001824-7c37elh6	280	20	-	-	HYPH
cord-001824-7c37elh6	280	21	tRNA	tRNA	NNP
cord-001824-7c37elh6	280	22	promotes	promote	VBZ
cord-001824-7c37elh6	280	23	its	-PRON-	PRP$
cord-001824-7c37elh6	280	24	entry	entry	NN
cord-001824-7c37elh6	280	25	to	to	IN
cord-001824-7c37elh6	280	26	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	280	27	A	A	NNP
cord-001824-7c37elh6	280	28	-	-	HYPH
cord-001824-7c37elh6	280	29	site	site	NN
cord-001824-7c37elh6	280	30	and	and	CC
cord-001824-7c37elh6	280	31	thereby	thereby	RB
cord-001824-7c37elh6	280	32	avoids	avoid	VBZ
cord-001824-7c37elh6	280	33	+1	+1	HYPH
cord-001824-7c37elh6	280	34	frameshift	frameshift	NN
cord-001824-7c37elh6	280	35	errors	error	NNS
cord-001824-7c37elh6	280	36	.	.	.
cord-001824-7c37elh6	281	1	Thus	thus	RB
cord-001824-7c37elh6	281	2	,	,	,
cord-001824-7c37elh6	281	3	wobble	wobble	VB
cord-001824-7c37elh6	281	4	uridine	uridine	JJ
cord-001824-7c37elh6	281	5	modifications	modification	NNS
cord-001824-7c37elh6	281	6	are	be	VBP
cord-001824-7c37elh6	281	7	required	require	VBN
cord-001824-7c37elh6	281	8	to	to	TO
cord-001824-7c37elh6	281	9	optimize	optimize	VB
cord-001824-7c37elh6	281	10	the	the	DT
cord-001824-7c37elh6	281	11	function	function	NN
cord-001824-7c37elh6	281	12	of	of	IN
cord-001824-7c37elh6	281	13	tRNAs	trna	NNS
cord-001824-7c37elh6	281	14	and	and	CC
cord-001824-7c37elh6	281	15	thereby	thereby	RB
cord-001824-7c37elh6	281	16	promote	promote	VB
cord-001824-7c37elh6	281	17	a	a	DT
cord-001824-7c37elh6	281	18	proper	proper	JJ
cord-001824-7c37elh6	281	19	reading	reading	NN
cord-001824-7c37elh6	281	20	frame	frame	NN
cord-001824-7c37elh6	281	21	maintenance	maintenance	NN
cord-001824-7c37elh6	281	22	.	.	.
cord-001824-7c37elh6	282	1	Supplementary	Supplementary	NNP
cord-001824-7c37elh6	282	2	Data	Data	NNP
cord-001824-7c37elh6	282	3	are	be	VBP
cord-001824-7c37elh6	282	4	available	available	JJ
cord-001824-7c37elh6	282	5	at	at	IN
cord-001824-7c37elh6	282	6	NAR	NAR	NNP
cord-001824-7c37elh6	282	7	Online	Online	NNP
cord-001824-7c37elh6	282	8	.	.	.
cord-001824-7c37elh6	283	1	Translational	translational	JJ
cord-001824-7c37elh6	283	2	accuracy	accuracy	NN
cord-001824-7c37elh6	283	3	and	and	CC
cord-001824-7c37elh6	283	4	the	the	DT
cord-001824-7c37elh6	283	5	fitness	fitness	NN
cord-001824-7c37elh6	283	6	of	of	IN
cord-001824-7c37elh6	283	7	bacteria	bacteria	NNS
cord-001824-7c37elh6	283	8	Errors	error	NNS
cord-001824-7c37elh6	283	9	and	and	CC
cord-001824-7c37elh6	283	10	alternatives	alternative	NNS
cord-001824-7c37elh6	283	11	in	in	IN
cord-001824-7c37elh6	283	12	reading	read	VBG
cord-001824-7c37elh6	283	13	the	the	DT
cord-001824-7c37elh6	283	14	universal	universal	JJ
cord-001824-7c37elh6	283	15	genetic	genetic	JJ
cord-001824-7c37elh6	283	16	code	code	NN
cord-001824-7c37elh6	283	17	A	a	DT
cord-001824-7c37elh6	283	18	gripping	grip	VBG
cord-001824-7c37elh6	283	19	tale	tale	NN
cord-001824-7c37elh6	283	20	of	of	IN
cord-001824-7c37elh6	283	21	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	283	22	frameshifting	frameshifting	NN
cord-001824-7c37elh6	283	23	:	:	:
cord-001824-7c37elh6	283	24	extragenic	extragenic	NNP
cord-001824-7c37elh6	283	25	suppressors	suppressor	NNS
cord-001824-7c37elh6	283	26	of	of	IN
cord-001824-7c37elh6	283	27	frameshift	frameshift	NN
cord-001824-7c37elh6	283	28	mutations	mutation	NNS
cord-001824-7c37elh6	283	29	spotlight	spotlight	NN
cord-001824-7c37elh6	283	30	P	p	NN
cord-001824-7c37elh6	283	31	-	-	HYPH
cord-001824-7c37elh6	283	32	site	site	NN
cord-001824-7c37elh6	283	33	realignment	realignment	NN
cord-001824-7c37elh6	283	34	.	.	.
cord-001824-7c37elh6	284	1	Microbiol	Microbiol	NNP
cord-001824-7c37elh6	284	2	Transfer	Transfer	NNP
cord-001824-7c37elh6	284	3	RNA	RNA	NNP
cord-001824-7c37elh6	284	4	Modification	modification	NN
cord-001824-7c37elh6	284	5	:	:	:
cord-001824-7c37elh6	284	6	Presence	Presence	NNP
cord-001824-7c37elh6	284	7	,	,	,
cord-001824-7c37elh6	284	8	Synthesis	Synthesis	NNP
cord-001824-7c37elh6	284	9	,	,	,
cord-001824-7c37elh6	284	10	and	and	CC
cord-001824-7c37elh6	284	11	Function	Function	NNP
cord-001824-7c37elh6	284	12	Prevention	Prevention	NNP
cord-001824-7c37elh6	284	13	of	of	IN
cord-001824-7c37elh6	284	14	translational	translational	JJ
cord-001824-7c37elh6	284	15	frameshifting	frameshifting	NN
cord-001824-7c37elh6	284	16	by	by	IN
cord-001824-7c37elh6	284	17	the	the	DT
cord-001824-7c37elh6	284	18	modified	modify	VBN
cord-001824-7c37elh6	284	19	nucleoside	nucleoside	NN
cord-001824-7c37elh6	284	20	1-methylguanosine	1-methylguanosine	CD
cord-001824-7c37elh6	285	1	Improvement	improvement	NN
cord-001824-7c37elh6	285	2	of	of	IN
cord-001824-7c37elh6	285	3	reading	read	VBG
cord-001824-7c37elh6	285	4	frame	frame	NN
cord-001824-7c37elh6	285	5	maintenance	maintenance	NN
cord-001824-7c37elh6	285	6	is	be	VBZ
cord-001824-7c37elh6	285	7	a	a	DT
cord-001824-7c37elh6	285	8	common	common	JJ
cord-001824-7c37elh6	285	9	function	function	NN
cord-001824-7c37elh6	285	10	for	for	IN
cord-001824-7c37elh6	285	11	several	several	JJ
cord-001824-7c37elh6	285	12	tRNA	tRNA	NNP
cord-001824-7c37elh6	285	13	modifications	modification	NNS
cord-001824-7c37elh6	285	14	Transfer	Transfer	NNP
cord-001824-7c37elh6	285	15	RNA	RNA	NNP
cord-001824-7c37elh6	285	16	modification	modification	NN
cord-001824-7c37elh6	285	17	status	status	NN
cord-001824-7c37elh6	285	18	influences	influence	NNS
cord-001824-7c37elh6	285	19	retroviral	retroviral	VBP
cord-001824-7c37elh6	285	20	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	285	21	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	285	22	)	)	-RRB-
cord-001824-7c37elh6	285	23	1-Methylguanosine	1-methylguanosine	CD
cord-001824-7c37elh6	285	24	in	in	IN
cord-001824-7c37elh6	285	25	place	place	NN
cord-001824-7c37elh6	285	26	of	of	IN
cord-001824-7c37elh6	285	27	Y	Y	NNP
cord-001824-7c37elh6	285	28	base	base	NN
cord-001824-7c37elh6	285	29	at	at	IN
cord-001824-7c37elh6	285	30	position	position	NN
cord-001824-7c37elh6	285	31	37	37	CD
cord-001824-7c37elh6	285	32	in	in	IN
cord-001824-7c37elh6	285	33	phenylalanine	phenylalanine	NN
cord-001824-7c37elh6	285	34	tRNA	tRNA	NNP
cord-001824-7c37elh6	285	35	is	be	VBZ
cord-001824-7c37elh6	285	36	responsible	responsible	JJ
cord-001824-7c37elh6	285	37	for	for	IN
cord-001824-7c37elh6	285	38	its	-PRON-	PRP$
cord-001824-7c37elh6	285	39	shiftiness	shiftiness	NN
cord-001824-7c37elh6	285	40	in	in	IN
cord-001824-7c37elh6	285	41	retroviral	retroviral	JJ
cord-001824-7c37elh6	285	42	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	285	43	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	285	44	Role	role	NN
cord-001824-7c37elh6	285	45	of	of	IN
cord-001824-7c37elh6	285	46	a	a	DT
cord-001824-7c37elh6	285	47	tRNA	trna	NN
cord-001824-7c37elh6	285	48	base	base	NN
cord-001824-7c37elh6	285	49	modification	modification	NN
cord-001824-7c37elh6	285	50	and	and	CC
cord-001824-7c37elh6	285	51	its	-PRON-	PRP$
cord-001824-7c37elh6	285	52	precursors	precursor	NNS
cord-001824-7c37elh6	285	53	in	in	IN
cord-001824-7c37elh6	285	54	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	285	55	in	in	IN
cord-001824-7c37elh6	285	56	eukaryotes	eukaryote	NNS
cord-001824-7c37elh6	285	57	Lack	lack	NN
cord-001824-7c37elh6	285	58	of	of	IN
cord-001824-7c37elh6	285	59	pseudouridine	pseudouridine	NN
cord-001824-7c37elh6	285	60	38/39	38/39	CD
cord-001824-7c37elh6	285	61	in	in	IN
cord-001824-7c37elh6	285	62	the	the	DT
cord-001824-7c37elh6	285	63	anticodon	anticodon	NN
cord-001824-7c37elh6	285	64	arm	arm	NN
cord-001824-7c37elh6	285	65	of	of	IN
cord-001824-7c37elh6	285	66	yeast	yeast	NN
cord-001824-7c37elh6	285	67	cytoplasmic	cytoplasmic	JJ
cord-001824-7c37elh6	285	68	tRNA	tRNA	NNP
cord-001824-7c37elh6	285	69	decreases	decrease	VBZ
cord-001824-7c37elh6	285	70	in	in	IN
cord-001824-7c37elh6	285	71	vivo	vivo	NN
cord-001824-7c37elh6	285	72	recoding	recode	VBG
cord-001824-7c37elh6	285	73	efficiency	efficiency	NN
cord-001824-7c37elh6	286	1	The	the	DT
cord-001824-7c37elh6	286	2	Sua5	Sua5	NNP
cord-001824-7c37elh6	286	3	protein	protein	NN
cord-001824-7c37elh6	286	4	is	be	VBZ
cord-001824-7c37elh6	286	5	essential	essential	JJ
cord-001824-7c37elh6	286	6	for	for	IN
cord-001824-7c37elh6	286	7	normal	normal	JJ
cord-001824-7c37elh6	286	8	translational	translational	JJ
cord-001824-7c37elh6	286	9	regulation	regulation	NN
cord-001824-7c37elh6	286	10	in	in	IN
cord-001824-7c37elh6	286	11	yeast	yeast	NN
cord-001824-7c37elh6	286	12	A	a	DT
cord-001824-7c37elh6	286	13	role	role	NN
cord-001824-7c37elh6	286	14	for	for	IN
cord-001824-7c37elh6	286	15	the	the	DT
cord-001824-7c37elh6	286	16	universal	universal	JJ
cord-001824-7c37elh6	286	17	Kae1	Kae1	NNP
cord-001824-7c37elh6	286	18	/	/	SYM
cord-001824-7c37elh6	286	19	Qri7	Qri7	NNP
cord-001824-7c37elh6	286	20	/	/	SYM
cord-001824-7c37elh6	286	21	YgjD	YgjD	NNP
cord-001824-7c37elh6	286	22	(	(	-LRB-
cord-001824-7c37elh6	286	23	COG0533	COG0533	NNP
cord-001824-7c37elh6	286	24	)	)	-RRB-
cord-001824-7c37elh6	286	25	family	family	NN
cord-001824-7c37elh6	286	26	in	in	IN
cord-001824-7c37elh6	286	27	tRNA	tRNA	NNP
cord-001824-7c37elh6	287	1	modification	modification	NN
cord-001824-7c37elh6	287	2	A	a	DT
cord-001824-7c37elh6	287	3	cyclic	cyclic	JJ
cord-001824-7c37elh6	287	4	form	form	NN
cord-001824-7c37elh6	287	5	of	of	IN
cord-001824-7c37elh6	287	6	N6-threonylcarbamoyladenosine	N6-threonylcarbamoyladenosine	NNP
cord-001824-7c37elh6	287	7	as	as	IN
cord-001824-7c37elh6	287	8	a	a	DT
cord-001824-7c37elh6	287	9	widely	widely	RB
cord-001824-7c37elh6	287	10	distributed	distribute	VBN
cord-001824-7c37elh6	287	11	tRNA	tRNA	NNP
cord-001824-7c37elh6	287	12	hypermodification	hypermodification	NN
cord-001824-7c37elh6	287	13	Expression	expression	NN
cord-001824-7c37elh6	287	14	of	of	IN
cord-001824-7c37elh6	287	15	a	a	DT
cord-001824-7c37elh6	287	16	coronavirus	coronavirus	NN
cord-001824-7c37elh6	287	17	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	287	18	frameshift	frameshift	NN
cord-001824-7c37elh6	287	19	signal	signal	NN
cord-001824-7c37elh6	287	20	in	in	IN
cord-001824-7c37elh6	287	21	Escherichia	Escherichia	NNP
cord-001824-7c37elh6	287	22	coli	coli	NNS
cord-001824-7c37elh6	287	23	:	:	:
cord-001824-7c37elh6	287	24	influence	influence	NN
cord-001824-7c37elh6	287	25	of	of	IN
cord-001824-7c37elh6	287	26	tRNA	tRNA	NNP
cord-001824-7c37elh6	287	27	anticodon	anticodon	NN
cord-001824-7c37elh6	287	28	modification	modification	NN
cord-001824-7c37elh6	287	29	on	on	IN
cord-001824-7c37elh6	287	30	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	287	31	Programmed	program	VBN
cord-001824-7c37elh6	287	32	translational	translational	JJ
cord-001824-7c37elh6	288	1	-1	-1	.
cord-001824-7c37elh6	289	1	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	289	2	on	on	IN
cord-001824-7c37elh6	289	3	hexanucleotide	hexanucleotide	JJ
cord-001824-7c37elh6	289	4	motifs	motif	NNS
cord-001824-7c37elh6	289	5	and	and	CC
cord-001824-7c37elh6	289	6	the	the	DT
cord-001824-7c37elh6	289	7	wobble	wobble	NN
cord-001824-7c37elh6	289	8	properties	property	NNS
cord-001824-7c37elh6	289	9	of	of	IN
cord-001824-7c37elh6	289	10	tRNAs	tRNAs	NNPS
cord-001824-7c37elh6	289	11	Transfer	Transfer	NNP
cord-001824-7c37elh6	289	12	RNA	RNA	NNP
cord-001824-7c37elh6	289	13	modifications	modification	NNS
cord-001824-7c37elh6	289	14	that	that	WDT
cord-001824-7c37elh6	289	15	alter	alter	VBP
cord-001824-7c37elh6	289	16	+1	+1	NN
cord-001824-7c37elh6	289	17	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	289	18	in	in	IN
cord-001824-7c37elh6	289	19	general	general	JJ
cord-001824-7c37elh6	289	20	fail	fail	VBP
cord-001824-7c37elh6	289	21	to	to	TO
cord-001824-7c37elh6	289	22	affect	affect	VB
cord-001824-7c37elh6	289	23	-1	-1	.
cord-001824-7c37elh6	290	1	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	290	2	Competing	compete	VBG
cord-001824-7c37elh6	290	3	pathways	pathway	NNS
cord-001824-7c37elh6	290	4	control	control	VBP
cord-001824-7c37elh6	290	5	host	host	NN
cord-001824-7c37elh6	290	6	resistance	resistance	NN
cord-001824-7c37elh6	290	7	to	to	IN
cord-001824-7c37elh6	290	8	virus	virus	NN
cord-001824-7c37elh6	290	9	via	via	IN
cord-001824-7c37elh6	290	10	tRNA	trna	NN
cord-001824-7c37elh6	290	11	modification	modification	NN
cord-001824-7c37elh6	290	12	and	and	CC
cord-001824-7c37elh6	290	13	programmed	program	VBD
cord-001824-7c37elh6	290	14	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	290	15	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	290	16	Programmed	program	VBN
cord-001824-7c37elh6	290	17	translational	translational	JJ
cord-001824-7c37elh6	291	1	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	291	2	Programmed	program	VBD
cord-001824-7c37elh6	291	3	translational	translational	JJ
cord-001824-7c37elh6	291	4	frameshifting	frameshifting	NNP
cord-001824-7c37elh6	291	5	Transfer	Transfer	NNP
cord-001824-7c37elh6	291	6	RNA	RNA	NNP
cord-001824-7c37elh6	291	7	modification	modification	NN
cord-001824-7c37elh6	291	8	:	:	:
cord-001824-7c37elh6	291	9	influence	influence	NN
cord-001824-7c37elh6	291	10	on	on	IN
cord-001824-7c37elh6	291	11	translational	translational	JJ
cord-001824-7c37elh6	291	12	frameshifting	frameshifting	NN
cord-001824-7c37elh6	291	13	and	and	CC
cord-001824-7c37elh6	291	14	metabolism	metabolism	NN
cord-001824-7c37elh6	292	1	How	how	WRB
cord-001824-7c37elh6	292	2	translational	translational	JJ
cord-001824-7c37elh6	292	3	accuracy	accuracy	NN
cord-001824-7c37elh6	292	4	influences	influence	NNS
cord-001824-7c37elh6	292	5	reading	read	VBG
cord-001824-7c37elh6	292	6	frame	frame	NN
cord-001824-7c37elh6	292	7	maintenance	maintenance	NN
cord-001824-7c37elh6	293	1	The	the	DT
cord-001824-7c37elh6	293	2	unbearable	unbearable	JJ
cord-001824-7c37elh6	293	3	lightness	lightness	NN
cord-001824-7c37elh6	293	4	of	of	IN
cord-001824-7c37elh6	293	5	peptidyl	peptidyl	NN
cord-001824-7c37elh6	293	6	-	-	HYPH
cord-001824-7c37elh6	293	7	tRNA	tRNA	NNP
cord-001824-7c37elh6	294	1	The	the	DT
cord-001824-7c37elh6	294	2	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	294	3	grip	grip	NN
cord-001824-7c37elh6	294	4	of	of	IN
cord-001824-7c37elh6	294	5	the	the	DT
cord-001824-7c37elh6	294	6	peptidyl	peptidyl	NNP
cord-001824-7c37elh6	294	7	-	-	HYPH
cord-001824-7c37elh6	294	8	tRNA	tRNA	NNP
cord-001824-7c37elh6	294	9	is	be	VBZ
cord-001824-7c37elh6	294	10	critical	critical	JJ
cord-001824-7c37elh6	294	11	for	for	IN
cord-001824-7c37elh6	294	12	reading	read	VBG
cord-001824-7c37elh6	294	13	frame	frame	NN
cord-001824-7c37elh6	294	14	maintenance	maintenance	NN
cord-001824-7c37elh6	295	1	The	the	DT
cord-001824-7c37elh6	295	2	phenotype	phenotype	NN
cord-001824-7c37elh6	295	3	of	of	IN
cord-001824-7c37elh6	295	4	many	many	JJ
cord-001824-7c37elh6	295	5	independently	independently	RB
cord-001824-7c37elh6	295	6	isolated	isolate	VBN
cord-001824-7c37elh6	295	7	+1	+1	HYPH
cord-001824-7c37elh6	295	8	frameshift	frameshift	NN
cord-001824-7c37elh6	295	9	suppressor	suppressor	NN
cord-001824-7c37elh6	295	10	mutants	mutant	NNS
cord-001824-7c37elh6	295	11	supports	support	VBZ
cord-001824-7c37elh6	295	12	a	a	DT
cord-001824-7c37elh6	295	13	pivotal	pivotal	JJ
cord-001824-7c37elh6	295	14	role	role	NN
cord-001824-7c37elh6	295	15	of	of	IN
cord-001824-7c37elh6	295	16	the	the	DT
cord-001824-7c37elh6	295	17	P	p	NN
cord-001824-7c37elh6	295	18	-	-	HYPH
cord-001824-7c37elh6	295	19	site	site	NN
cord-001824-7c37elh6	295	20	in	in	IN
cord-001824-7c37elh6	295	21	reading	read	VBG
cord-001824-7c37elh6	295	22	frame	frame	NN
cord-001824-7c37elh6	295	23	maintenance	maintenance	NN
cord-001824-7c37elh6	295	24	Presence	Presence	NNP
cord-001824-7c37elh6	295	25	and	and	CC
cord-001824-7c37elh6	295	26	coding	code	VBG
cord-001824-7c37elh6	295	27	properties	property	NNS
cord-001824-7c37elh6	295	28	of	of	IN
cord-001824-7c37elh6	295	29	2	2	CD
cord-001824-7c37elh6	295	30	-O	-o	CD
cord-001824-7c37elh6	295	31	-	-	:
cord-001824-7c37elh6	295	32	methyl-5-carbamoylmethyluridine	methyl-5-carbamoylmethyluridine	NNP
cord-001824-7c37elh6	295	33	(	(	-LRB-
cord-001824-7c37elh6	295	34	ncm5Um	ncm5Um	NNP
cord-001824-7c37elh6	295	35	)	)	-RRB-
cord-001824-7c37elh6	295	36	in	in	IN
cord-001824-7c37elh6	295	37	the	the	DT
cord-001824-7c37elh6	295	38	wobble	wobble	NN
cord-001824-7c37elh6	295	39	position	position	NN
cord-001824-7c37elh6	295	40	of	of	IN
cord-001824-7c37elh6	295	41	the	the	DT
cord-001824-7c37elh6	295	42	anticodon	anticodon	NN
cord-001824-7c37elh6	295	43	of	of	IN
cord-001824-7c37elh6	295	44	tRNA(Leu	tRNA(Leu	NNP
cord-001824-7c37elh6	295	45	)	)	-RRB-
cord-001824-7c37elh6	295	46	(	(	-LRB-
cord-001824-7c37elh6	295	47	U*AA	u*aa	NN
cord-001824-7c37elh6	295	48	)	)	-RRB-
cord-001824-7c37elh6	295	49	from	from	IN
cord-001824-7c37elh6	295	50	brewer	brewer	NN
cord-001824-7c37elh6	295	51	's	's	POS
cord-001824-7c37elh6	295	52	yeast	yeast	NN
cord-001824-7c37elh6	295	53	Eukaryotic	Eukaryotic	NNP
cord-001824-7c37elh6	295	54	wobble	wobble	VBP
cord-001824-7c37elh6	295	55	uridine	uridine	NN
cord-001824-7c37elh6	295	56	modifications	modification	NNS
cord-001824-7c37elh6	295	57	promote	promote	VBP
cord-001824-7c37elh6	295	58	a	a	DT
cord-001824-7c37elh6	295	59	functionally	functionally	RB
cord-001824-7c37elh6	295	60	redundant	redundant	JJ
cord-001824-7c37elh6	295	61	decoding	decoding	NN
cord-001824-7c37elh6	295	62	system	system	NN
cord-001824-7c37elh6	295	63	Eukaryotic	Eukaryotic	NNP
cord-001824-7c37elh6	295	64	tRNAs(Pro	tRNAs(Pro	NFP
cord-001824-7c37elh6	295	65	)	)	-RRB-
cord-001824-7c37elh6	295	66	:	:	:
cord-001824-7c37elh6	295	67	primary	primary	JJ
cord-001824-7c37elh6	295	68	structure	structure	NN
cord-001824-7c37elh6	295	69	of	of	IN
cord-001824-7c37elh6	295	70	the	the	DT
cord-001824-7c37elh6	295	71	anticodon	anticodon	NNP
cord-001824-7c37elh6	295	72	loop	loop	NN
cord-001824-7c37elh6	295	73	;	;	:
cord-001824-7c37elh6	295	74	presence	presence	NN
cord-001824-7c37elh6	295	75	of	of	IN
cord-001824-7c37elh6	295	76	5-carbamoylmethyluridine	5-carbamoylmethyluridine	CD
cord-001824-7c37elh6	295	77	or	or	CC
cord-001824-7c37elh6	295	78	inosine	inosine	JJ
cord-001824-7c37elh6	295	79	as	as	IN
cord-001824-7c37elh6	295	80	the	the	DT
cord-001824-7c37elh6	295	81	first	first	JJ
cord-001824-7c37elh6	295	82	nucleoside	nucleoside	NN
cord-001824-7c37elh6	295	83	of	of	IN
cord-001824-7c37elh6	295	84	the	the	DT
cord-001824-7c37elh6	295	85	anticodon	anticodon	NN
cord-001824-7c37elh6	296	1	The	the	DT
cord-001824-7c37elh6	296	2	primary	primary	JJ
cord-001824-7c37elh6	296	3	structure	structure	NN
cord-001824-7c37elh6	296	4	of	of	IN
cord-001824-7c37elh6	296	5	yeast	yeast	NN
cord-001824-7c37elh6	296	6	glutamic	glutamic	NN
cord-001824-7c37elh6	296	7	acid	acid	NN
cord-001824-7c37elh6	296	8	tRNA	tRNA	NNP
cord-001824-7c37elh6	296	9	specific	specific	JJ
cord-001824-7c37elh6	296	10	to	to	IN
cord-001824-7c37elh6	296	11	the	the	DT
cord-001824-7c37elh6	296	12	GAA	GAA	NNP
cord-001824-7c37elh6	296	13	codon	codon	NN
cord-001824-7c37elh6	296	14	Presence	Presence	NNP
cord-001824-7c37elh6	296	15	of	of	IN
cord-001824-7c37elh6	296	16	the	the	DT
cord-001824-7c37elh6	296	17	methylester	methylester	NNP
cord-001824-7c37elh6	296	18	of	of	IN
cord-001824-7c37elh6	296	19	5-carboxymethyl	5-carboxymethyl	CD
cord-001824-7c37elh6	296	20	uridine	uridine	NN
cord-001824-7c37elh6	296	21	in	in	IN
cord-001824-7c37elh6	296	22	the	the	DT
cord-001824-7c37elh6	296	23	wobble	wobble	NN
cord-001824-7c37elh6	296	24	position	position	NN
cord-001824-7c37elh6	296	25	of	of	IN
cord-001824-7c37elh6	296	26	the	the	DT
cord-001824-7c37elh6	296	27	anticodon	anticodon	NN
cord-001824-7c37elh6	296	28	of	of	IN
cord-001824-7c37elh6	296	29	tRNAIII	tRNAIII	NNP
cord-001824-7c37elh6	296	30	Arg	Arg	NNP
cord-001824-7c37elh6	296	31	from	from	IN
cord-001824-7c37elh6	296	32	brewer	brewer	NN
cord-001824-7c37elh6	296	33	's	's	POS
cord-001824-7c37elh6	296	34	yeast	yeast	NN
cord-001824-7c37elh6	296	35	The	the	DT
cord-001824-7c37elh6	296	36	Kluyveromyces	Kluyveromyces	NNPS
cord-001824-7c37elh6	296	37	lactis	lactis	RB
cord-001824-7c37elh6	297	1	␥	␥	XX
cord-001824-7c37elh6	298	1	-toxin	-toxin	NFP
cord-001824-7c37elh6	298	2	targets	target	VBZ
cord-001824-7c37elh6	298	3	tRNA	tRNA	NNP
cord-001824-7c37elh6	298	4	anticodons	anticodons	NNP
cord-001824-7c37elh6	299	1	The	the	DT
cord-001824-7c37elh6	299	2	nucleotide	nucleotide	JJ
cord-001824-7c37elh6	299	3	sequences	sequence	NNS
cord-001824-7c37elh6	299	4	and	and	CC
cord-001824-7c37elh6	299	5	coding	code	VBG
cord-001824-7c37elh6	299	6	properties	property	NNS
cord-001824-7c37elh6	299	7	of	of	IN
cord-001824-7c37elh6	299	8	the	the	DT
cord-001824-7c37elh6	299	9	major	major	JJ
cord-001824-7c37elh6	299	10	and	and	CC
cord-001824-7c37elh6	299	11	minor	minor	JJ
cord-001824-7c37elh6	299	12	lysine	lysine	NN
cord-001824-7c37elh6	299	13	transfer	transfer	NN
cord-001824-7c37elh6	299	14	ribonucleic	ribonucleic	NN
cord-001824-7c37elh6	299	15	acids	acid	NNS
cord-001824-7c37elh6	299	16	from	from	IN
cord-001824-7c37elh6	299	17	the	the	DT
cord-001824-7c37elh6	299	18	haploid	haploid	JJ
cord-001824-7c37elh6	299	19	yeast	yeast	NN
cord-001824-7c37elh6	299	20	Saccharomyces	saccharomyce	NNS
cord-001824-7c37elh6	299	21	cerevisiae	cerevisiae	NNS
cord-001824-7c37elh6	299	22	S288C	s288c	NN
cord-001824-7c37elh6	299	23	Modified	modify	VBN
cord-001824-7c37elh6	299	24	nucleoside	nucleoside	NN
cord-001824-7c37elh6	299	25	,	,	,
cord-001824-7c37elh6	299	26	5-carbamoylmethyluridine	5-carbamoylmethyluridine	CD
cord-001824-7c37elh6	299	27	,	,	,
cord-001824-7c37elh6	299	28	located	locate	VBN
cord-001824-7c37elh6	299	29	in	in	IN
cord-001824-7c37elh6	299	30	the	the	DT
cord-001824-7c37elh6	299	31	first	first	JJ
cord-001824-7c37elh6	299	32	position	position	NN
cord-001824-7c37elh6	299	33	of	of	IN
cord-001824-7c37elh6	299	34	the	the	DT
cord-001824-7c37elh6	299	35	anticodon	anticodon	NN
cord-001824-7c37elh6	299	36	of	of	IN
cord-001824-7c37elh6	299	37	yeast	yeast	NN
cord-001824-7c37elh6	299	38	valine	valine	NNP
cord-001824-7c37elh6	299	39	tRNA	tRNA	NNP
cord-001824-7c37elh6	299	40	Elongator	Elongator	NNP
cord-001824-7c37elh6	299	41	,	,	,
cord-001824-7c37elh6	299	42	a	a	DT
cord-001824-7c37elh6	299	43	conserved	conserve	VBN
cord-001824-7c37elh6	299	44	complex	complex	NN
cord-001824-7c37elh6	299	45	required	require	VBN
cord-001824-7c37elh6	299	46	for	for	IN
cord-001824-7c37elh6	299	47	wobble	wobble	NN
cord-001824-7c37elh6	299	48	uridine	uridine	JJ
cord-001824-7c37elh6	299	49	modifications	modification	NNS
cord-001824-7c37elh6	299	50	in	in	IN
cord-001824-7c37elh6	299	51	Eukaryotes	Eukaryotes	NNP
cord-001824-7c37elh6	299	52	Elevated	elevate	VBN
cord-001824-7c37elh6	299	53	Levels	level	NNS
cord-001824-7c37elh6	299	54	of	of	IN
cord-001824-7c37elh6	299	55	Two	two	CD
cord-001824-7c37elh6	299	56	tRNA	trna	NN
cord-001824-7c37elh6	299	57	Species	Species	NNPS
cord-001824-7c37elh6	299	58	Bypass	Bypass	NNP
cord-001824-7c37elh6	299	59	the	the	DT
cord-001824-7c37elh6	299	60	Requirement	Requirement	NNP
cord-001824-7c37elh6	299	61	for	for	IN
cord-001824-7c37elh6	299	62	Elongator	Elongator	NNP
cord-001824-7c37elh6	299	63	Complex	Complex	NNP
cord-001824-7c37elh6	299	64	in	in	IN
cord-001824-7c37elh6	299	65	Transcription	Transcription	NNP
cord-001824-7c37elh6	299	66	and	and	CC
cord-001824-7c37elh6	299	67	Exocytosis	Exocytosis	NNP
cord-001824-7c37elh6	299	68	Elongator	Elongator	NNP
cord-001824-7c37elh6	299	69	complex	complex	JJ
cord-001824-7c37elh6	299	70	influences	influence	NNS
cord-001824-7c37elh6	299	71	telomeric	telomeric	JJ
cord-001824-7c37elh6	299	72	gene	gene	NN
cord-001824-7c37elh6	299	73	silencing	silencing	NN
cord-001824-7c37elh6	299	74	and	and	CC
cord-001824-7c37elh6	299	75	DNA	dna	NN
cord-001824-7c37elh6	299	76	damage	damage	NN
cord-001824-7c37elh6	299	77	response	response	NN
cord-001824-7c37elh6	299	78	by	by	IN
cord-001824-7c37elh6	299	79	its	-PRON-	PRP$
cord-001824-7c37elh6	299	80	role	role	NN
cord-001824-7c37elh6	299	81	in	in	IN
cord-001824-7c37elh6	299	82	wobble	wobble	NN
cord-001824-7c37elh6	299	83	uridine	uridine	NNP
cord-001824-7c37elh6	299	84	tRNA	trna	NN
cord-001824-7c37elh6	299	85	modification	modification	NN
cord-001824-7c37elh6	300	1	The	the	DT
cord-001824-7c37elh6	300	2	modified	modify	VBN
cord-001824-7c37elh6	300	3	wobble	wobble	NN
cord-001824-7c37elh6	301	1	nucleoside	nucleoside	JJ
cord-001824-7c37elh6	301	2	uridine-5-oxyacetic	uridine-5-oxyacetic	JJ
cord-001824-7c37elh6	301	3	acid	acid	NN
cord-001824-7c37elh6	301	4	in	in	IN
cord-001824-7c37elh6	301	5	tRNAPro(cmo5UGG	trnapro(cmo5ugg	NN
cord-001824-7c37elh6	301	6	)	)	-RRB-
cord-001824-7c37elh6	301	7	promotes	promote	VBZ
cord-001824-7c37elh6	301	8	reading	reading	NN
cord-001824-7c37elh6	301	9	of	of	IN
cord-001824-7c37elh6	301	10	all	all	DT
cord-001824-7c37elh6	301	11	four	four	CD
cord-001824-7c37elh6	301	12	proline	proline	NN
cord-001824-7c37elh6	301	13	codons	codon	NNS
cord-001824-7c37elh6	301	14	in	in	IN
cord-001824-7c37elh6	301	15	vivo	vivo	NNP
cord-001824-7c37elh6	301	16	Translational	translational	JJ
cord-001824-7c37elh6	301	17	infidelity	infidelity	NN
cord-001824-7c37elh6	301	18	-	-	HYPH
cord-001824-7c37elh6	301	19	induced	induce	VBN
cord-001824-7c37elh6	301	20	protein	protein	NN
cord-001824-7c37elh6	301	21	stress	stress	NN
cord-001824-7c37elh6	301	22	results	result	VBZ
cord-001824-7c37elh6	301	23	from	from	IN
cord-001824-7c37elh6	301	24	a	a	DT
cord-001824-7c37elh6	301	25	deficiency	deficiency	NN
cord-001824-7c37elh6	301	26	in	in	IN
cord-001824-7c37elh6	301	27	Trm9-catalyzed	Trm9-catalyzed	NNP
cord-001824-7c37elh6	301	28	tRNA	tRNA	NNP
cord-001824-7c37elh6	301	29	modifications	modification	NNS
cord-001824-7c37elh6	301	30	Improved	improve	VBN
cord-001824-7c37elh6	301	31	method	method	NN
cord-001824-7c37elh6	301	32	for	for	IN
cord-001824-7c37elh6	301	33	high	high	JJ
cord-001824-7c37elh6	301	34	efficiency	efficiency	NN
cord-001824-7c37elh6	301	35	transformation	transformation	NN
cord-001824-7c37elh6	301	36	of	of	IN
cord-001824-7c37elh6	301	37	intact	intact	JJ
cord-001824-7c37elh6	301	38	yeast	yeast	NN
cord-001824-7c37elh6	301	39	cells	cell	NNS
cord-001824-7c37elh6	301	40	Methods	method	NNS
cord-001824-7c37elh6	301	41	in	in	IN
cord-001824-7c37elh6	302	1	yeast	yeast	NN
cord-001824-7c37elh6	302	2	genetics	genetics	NN
cord-001824-7c37elh6	302	3	An	An	NNP
cord-001824-7c37elh6	302	4	in	in	IN
cord-001824-7c37elh6	302	5	vivo	vivo	NN
cord-001824-7c37elh6	302	6	dual	dual	JJ
cord-001824-7c37elh6	302	7	-	-	HYPH
cord-001824-7c37elh6	302	8	luciferase	luciferase	NN
cord-001824-7c37elh6	302	9	assay	assay	NN
cord-001824-7c37elh6	302	10	system	system	NN
cord-001824-7c37elh6	302	11	for	for	IN
cord-001824-7c37elh6	302	12	studying	study	VBG
cord-001824-7c37elh6	302	13	translational	translational	JJ
cord-001824-7c37elh6	302	14	recoding	recoding	NN
cord-001824-7c37elh6	302	15	in	in	IN
cord-001824-7c37elh6	302	16	the	the	DT
cord-001824-7c37elh6	302	17	yeast	yeast	NN
cord-001824-7c37elh6	302	18	Saccharomyces	Saccharomyces	NNP
cord-001824-7c37elh6	302	19	cerevisiae	cerevisiae	VBZ
cord-001824-7c37elh6	302	20	Ribosomal	Ribosomal	NNP
cord-001824-7c37elh6	302	21	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	302	22	in	in	IN
cord-001824-7c37elh6	302	23	the	the	DT
cord-001824-7c37elh6	302	24	yeast	yeast	NN
cord-001824-7c37elh6	302	25	retrotransposon	retrotransposon	NN
cord-001824-7c37elh6	302	26	Ty	Ty	NNP
cord-001824-7c37elh6	303	1	:	:	:
cord-001824-7c37elh6	303	2	tRNAs	trna	NNS
cord-001824-7c37elh6	303	3	induce	induce	VBP
cord-001824-7c37elh6	303	4	slippage	slippage	NN
cord-001824-7c37elh6	303	5	on	on	IN
cord-001824-7c37elh6	303	6	a	a	DT
cord-001824-7c37elh6	303	7	7	7	CD
cord-001824-7c37elh6	303	8	nucleotide	nucleotide	NN
cord-001824-7c37elh6	303	9	minimal	minimal	JJ
cord-001824-7c37elh6	303	10	site	site	NN
cord-001824-7c37elh6	303	11	Studies	Studies	NNPS
cord-001824-7c37elh6	303	12	on	on	IN
cord-001824-7c37elh6	303	13	polynucleotides	polynucleotides	NNP
cord-001824-7c37elh6	303	14	,	,	,
cord-001824-7c37elh6	303	15	lxviii	lxviii	VB
cord-001824-7c37elh6	303	16	the	the	DT
cord-001824-7c37elh6	303	17	primary	primary	JJ
cord-001824-7c37elh6	303	18	structure	structure	NN
cord-001824-7c37elh6	303	19	of	of	IN
cord-001824-7c37elh6	303	20	yeast	yeast	NN
cord-001824-7c37elh6	303	21	phenylalanine	phenylalanine	NN
cord-001824-7c37elh6	303	22	transfer	transfer	NN
cord-001824-7c37elh6	303	23	RNA	RNA	NNP
cord-001824-7c37elh6	303	24	2009	2009	CD
cord-001824-7c37elh6	303	25	:	:	:
cord-001824-7c37elh6	304	1	compilation	compilation	NN
cord-001824-7c37elh6	304	2	of	of	IN
cord-001824-7c37elh6	304	3	tRNA	tRNA	NNP
cord-001824-7c37elh6	304	4	sequences	sequence	NNS
cord-001824-7c37elh6	304	5	and	and	CC
cord-001824-7c37elh6	304	6	tRNA	tRNA	NNP
cord-001824-7c37elh6	304	7	genes	gene	NNS
cord-001824-7c37elh6	304	8	Translational	Translational	NNP
cord-001824-7c37elh6	304	9	termination	termination	NN
cord-001824-7c37elh6	304	10	comes	come	VBZ
cord-001824-7c37elh6	304	11	of	of	IN
cord-001824-7c37elh6	304	12	age	age	NN
cord-001824-7c37elh6	305	1	An	an	DT
cord-001824-7c37elh6	305	2	early	early	JJ
cord-001824-7c37elh6	305	3	step	step	NN
cord-001824-7c37elh6	305	4	in	in	IN
cord-001824-7c37elh6	305	5	wobble	wobble	NN
cord-001824-7c37elh6	306	1	uridine	uridine	NNP
cord-001824-7c37elh6	306	2	tRNA	tRNA	NNP
cord-001824-7c37elh6	306	3	modification	modification	NN
cord-001824-7c37elh6	306	4	requires	require	VBZ
cord-001824-7c37elh6	306	5	the	the	DT
cord-001824-7c37elh6	306	6	Elongator	Elongator	NNP
cord-001824-7c37elh6	306	7	complex	complex	JJ
cord-001824-7c37elh6	306	8	Novel	novel	NN
cord-001824-7c37elh6	306	9	methyltransferase	methyltransferase	NN
cord-001824-7c37elh6	306	10	for	for	IN
cord-001824-7c37elh6	306	11	modified	modify	VBN
cord-001824-7c37elh6	306	12	uridine	uridine	NN
cord-001824-7c37elh6	306	13	residues	residue	NNS
cord-001824-7c37elh6	306	14	at	at	IN
cord-001824-7c37elh6	306	15	the	the	DT
cord-001824-7c37elh6	306	16	wobble	wobble	NN
cord-001824-7c37elh6	306	17	position	position	NN
cord-001824-7c37elh6	306	18	of	of	IN
cord-001824-7c37elh6	306	19	tRNA	trna	NN
cord-001824-7c37elh6	306	20	is	be	VBZ
cord-001824-7c37elh6	306	21	a	a	DT
cord-001824-7c37elh6	306	22	15-kDa	15-kda	CD
cord-001824-7c37elh6	306	23	zinc	zinc	NN
cord-001824-7c37elh6	306	24	finger	finger	NN
cord-001824-7c37elh6	306	25	protein	protein	NN
cord-001824-7c37elh6	306	26	essential	essential	JJ
cord-001824-7c37elh6	306	27	for	for	IN
cord-001824-7c37elh6	306	28	the	the	DT
cord-001824-7c37elh6	306	29	activity	activity	NN
cord-001824-7c37elh6	306	30	of	of	IN
cord-001824-7c37elh6	306	31	two	two	CD
cord-001824-7c37elh6	306	32	tRNA	tRNA	NNS
cord-001824-7c37elh6	306	33	and	and	CC
cord-001824-7c37elh6	306	34	one	one	CD
cord-001824-7c37elh6	306	35	protein	protein	NN
cord-001824-7c37elh6	306	36	methyltransferases	methyltransferase	NNS
cord-001824-7c37elh6	306	37	in	in	IN
cord-001824-7c37elh6	306	38	yeast	yeast	NN
cord-001824-7c37elh6	307	1	A	a	DT
cord-001824-7c37elh6	307	2	conserved	conserved	JJ
cord-001824-7c37elh6	307	3	modified	modify	VBN
cord-001824-7c37elh6	307	4	wobble	wobble	NN
cord-001824-7c37elh6	307	5	nucleoside	nucleoside	RB
cord-001824-7c37elh6	308	1	(	(	-LRB-
cord-001824-7c37elh6	308	2	mcm5s2U	mcm5s2U	NNP
cord-001824-7c37elh6	308	3	)	)	-RRB-
cord-001824-7c37elh6	308	4	in	in	IN
cord-001824-7c37elh6	308	5	lysyl	lysyl	NNP
cord-001824-7c37elh6	308	6	-	-	HYPH
cord-001824-7c37elh6	308	7	tRNA	tRNA	NNP
cord-001824-7c37elh6	308	8	is	be	VBZ
cord-001824-7c37elh6	308	9	required	require	VBN
cord-001824-7c37elh6	308	10	for	for	IN
cord-001824-7c37elh6	308	11	viability	viability	NN
cord-001824-7c37elh6	308	12	in	in	IN
cord-001824-7c37elh6	308	13	yeast	yeast	NN
cord-001824-7c37elh6	308	14	Uniform	Uniform	NNP
cord-001824-7c37elh6	308	15	binding	binding	NN
cord-001824-7c37elh6	308	16	of	of	IN
cord-001824-7c37elh6	308	17	aminoacylated	aminoacylate	VBN
cord-001824-7c37elh6	308	18	transfer	transfer	NN
cord-001824-7c37elh6	308	19	RNAs	rna	NNS
cord-001824-7c37elh6	308	20	to	to	IN
cord-001824-7c37elh6	308	21	the	the	DT
cord-001824-7c37elh6	308	22	ribosomal	ribosomal	JJ
cord-001824-7c37elh6	308	23	A	a	NN
cord-001824-7c37elh6	308	24	and	and	CC
cord-001824-7c37elh6	308	25	P	p	NN
cord-001824-7c37elh6	308	26	sites	site	NNS
cord-001824-7c37elh6	308	27	Transfer	Transfer	NNP
cord-001824-7c37elh6	308	28	RNA	RNA	NNP
cord-001824-7c37elh6	308	29	gene	gene	NN
cord-001824-7c37elh6	308	30	redundancy	redundancy	NN
cord-001824-7c37elh6	308	31	and	and	CC
cord-001824-7c37elh6	308	32	translational	translational	JJ
cord-001824-7c37elh6	308	33	selection	selection	NN
cord-001824-7c37elh6	308	34	in	in	IN
cord-001824-7c37elh6	308	35	Saccharomyces	Saccharomyces	NNP
cord-001824-7c37elh6	308	36	cerevisiae	cerevisiae	VBZ
cord-001824-7c37elh6	308	37	tRNA	trna	NN
cord-001824-7c37elh6	308	38	tKUUU	tkuuu	NN
cord-001824-7c37elh6	308	39	,	,	,
cord-001824-7c37elh6	308	40	tQUUG	tquug	NN
cord-001824-7c37elh6	308	41	,	,	,
cord-001824-7c37elh6	308	42	and	and	CC
cord-001824-7c37elh6	308	43	tEUUC	teuuc	DT
cord-001824-7c37elh6	308	44	wobble	wobble	VB
cord-001824-7c37elh6	308	45	position	position	NN
cord-001824-7c37elh6	308	46	modifications	modification	NNS
cord-001824-7c37elh6	308	47	fine	fine	JJ
cord-001824-7c37elh6	308	48	-	-	HYPH
cord-001824-7c37elh6	308	49	tune	tune	NN
cord-001824-7c37elh6	308	50	protein	protein	NN
cord-001824-7c37elh6	308	51	translation	translation	NN
cord-001824-7c37elh6	308	52	by	by	IN
cord-001824-7c37elh6	308	53	promoting	promote	VBG
cord-001824-7c37elh6	308	54	ribosome	ribosome	NN
cord-001824-7c37elh6	308	55	A	A	NNP
cord-001824-7c37elh6	308	56	-	-	HYPH
cord-001824-7c37elh6	308	57	site	site	NN
cord-001824-7c37elh6	308	58	binding	bind	VBG
cord-001824-7c37elh6	308	59	Exonuclease	Exonuclease	NNP
cord-001824-7c37elh6	308	60	I	i	NN
cord-001824-7c37elh6	308	61	of	of	IN
cord-001824-7c37elh6	308	62	Saccharomyces	Saccharomyces	NNP
cord-001824-7c37elh6	308	63	cerevisiae	cerevisiae	NN
cord-001824-7c37elh6	308	64	functions	function	NNS
cord-001824-7c37elh6	308	65	in	in	IN
cord-001824-7c37elh6	308	66	mitotic	mitotic	JJ
cord-001824-7c37elh6	308	67	recombination	recombination	NN
cord-001824-7c37elh6	308	68	in	in	IN
cord-001824-7c37elh6	308	69	vivo	vivo	NN
cord-001824-7c37elh6	308	70	and	and	CC
cord-001824-7c37elh6	308	71	in	in	IN
cord-001824-7c37elh6	308	72	vitro	vitro	FW
cord-001824-7c37elh6	308	73	Unexpected	unexpected	JJ
cord-001824-7c37elh6	308	74	accumulation	accumulation	NN
cord-001824-7c37elh6	308	75	of	of	IN
cord-001824-7c37elh6	308	76	ncm(5)U	ncm(5)u	JJ
cord-001824-7c37elh6	308	77	and	and	CC
cord-001824-7c37elh6	308	78	ncm(5)S(2	ncm(5)S(2	NNP
cord-001824-7c37elh6	308	79	)	)	-RRB-
cord-001824-7c37elh6	309	1	(	(	-LRB-
cord-001824-7c37elh6	309	2	U	U	NNP
cord-001824-7c37elh6	309	3	)	)	-RRB-
cord-001824-7c37elh6	309	4	in	in	IN
cord-001824-7c37elh6	309	5	a	a	DT
cord-001824-7c37elh6	309	6	trm9	trm9	NNP
cord-001824-7c37elh6	309	7	mutant	mutant	NN
cord-001824-7c37elh6	309	8	suggests	suggest	VBZ
cord-001824-7c37elh6	309	9	an	an	DT
cord-001824-7c37elh6	309	10	additional	additional	JJ
cord-001824-7c37elh6	309	11	step	step	NN
cord-001824-7c37elh6	309	12	in	in	IN
cord-001824-7c37elh6	309	13	the	the	DT
cord-001824-7c37elh6	309	14	synthesis	synthesis	NN
cord-001824-7c37elh6	309	15	of	of	IN
cord-001824-7c37elh6	309	16	mcm(5)U	mcm(5)U	NNP
cord-001824-7c37elh6	309	17	and	and	CC
cord-001824-7c37elh6	309	18	mcm(5)S(2)U	mcm(5)S(2)U	``
cord-001824-7c37elh6	309	19	Large	large	JJ
cord-001824-7c37elh6	309	20	oligonucleotides	oligonucleotide	NNS
cord-001824-7c37elh6	309	21	isolated	isolate	VBN
cord-001824-7c37elh6	309	22	from	from	IN
cord-001824-7c37elh6	309	23	yeast	yeast	NN
cord-001824-7c37elh6	309	24	tyrosine	tyrosine	NN
cord-001824-7c37elh6	309	25	transfer	transfer	NN
cord-001824-7c37elh6	309	26	ribonucleic	ribonucleic	NN
cord-001824-7c37elh6	309	27	acid	acid	NN
cord-001824-7c37elh6	309	28	after	after	IN
cord-001824-7c37elh6	309	29	partial	partial	JJ
cord-001824-7c37elh6	309	30	digestion	digestion	NN
cord-001824-7c37elh6	309	31	with	with	IN
cord-001824-7c37elh6	309	32	ribonuclease	ribonuclease	NN
cord-001824-7c37elh6	309	33	T1	T1	NNP
cord-001824-7c37elh6	309	34	Thio	Thio	NNP
cord-001824-7c37elh6	309	35	-	-	HYPH
cord-001824-7c37elh6	309	36	modification	modification	NN
cord-001824-7c37elh6	309	37	of	of	IN
cord-001824-7c37elh6	309	38	yeast	yeast	NN
cord-001824-7c37elh6	309	39	cytosolic	cytosolic	JJ
cord-001824-7c37elh6	309	40	tRNA	tRNA	NNP
cord-001824-7c37elh6	309	41	requires	require	VBZ
cord-001824-7c37elh6	309	42	a	a	DT
cord-001824-7c37elh6	309	43	ubiquitin	ubiquitin	NN
cord-001824-7c37elh6	309	44	-	-	HYPH
cord-001824-7c37elh6	309	45	related	relate	VBN
cord-001824-7c37elh6	309	46	system	system	NN
cord-001824-7c37elh6	309	47	that	that	WDT
cord-001824-7c37elh6	309	48	resembles	resemble	VBZ
cord-001824-7c37elh6	309	49	bacterial	bacterial	JJ
cord-001824-7c37elh6	309	50	sulfur	sulfur	NN
cord-001824-7c37elh6	309	51	transfer	transfer	NN
cord-001824-7c37elh6	309	52	systems	system	NNS
cord-001824-7c37elh6	309	53	Ubiquitin	Ubiquitin	NNP
cord-001824-7c37elh6	309	54	-	-	HYPH
cord-001824-7c37elh6	309	55	related	relate	VBN
cord-001824-7c37elh6	309	56	modifier	modifier	NN
cord-001824-7c37elh6	309	57	Urm1	Urm1	NNP
cord-001824-7c37elh6	309	58	acts	act	VBZ
cord-001824-7c37elh6	309	59	as	as	IN
cord-001824-7c37elh6	309	60	a	a	DT
cord-001824-7c37elh6	309	61	sulphur	sulphur	NN
cord-001824-7c37elh6	309	62	carrier	carrier	NN
cord-001824-7c37elh6	309	63	in	in	IN
cord-001824-7c37elh6	309	64	thiolation	thiolation	NN
cord-001824-7c37elh6	309	65	of	of	IN
cord-001824-7c37elh6	309	66	eukaryotic	eukaryotic	JJ
cord-001824-7c37elh6	309	67	transfer	transfer	NN
cord-001824-7c37elh6	310	1	RNA	RNA	NNP
cord-001824-7c37elh6	310	2	Mechanistic	mechanistic	JJ
cord-001824-7c37elh6	310	3	characterization	characterization	NN
cord-001824-7c37elh6	310	4	of	of	IN
cord-001824-7c37elh6	310	5	the	the	DT
cord-001824-7c37elh6	310	6	sulfur	sulfur	NN
cord-001824-7c37elh6	310	7	-	-	HYPH
cord-001824-7c37elh6	310	8	relay	relay	NN
cord-001824-7c37elh6	310	9	system	system	NN
cord-001824-7c37elh6	310	10	for	for	IN
cord-001824-7c37elh6	310	11	eukaryotic	eukaryotic	JJ
cord-001824-7c37elh6	310	12	2-thiouridine	2-thiouridine	CD
cord-001824-7c37elh6	310	13	biogenesis	biogenesis	NN
cord-001824-7c37elh6	310	14	at	at	IN
cord-001824-7c37elh6	310	15	tRNA	trna	NN
cord-001824-7c37elh6	310	16	wobble	wobble	NN
cord-001824-7c37elh6	310	17	positions	position	NNS
cord-001824-7c37elh6	310	18	Enhancer	Enhancer	NNP
cord-001824-7c37elh6	310	19	and	and	CC
cord-001824-7c37elh6	310	20	silencerlike	silencerlike	NN
cord-001824-7c37elh6	310	21	sites	site	NNS
cord-001824-7c37elh6	310	22	within	within	IN
cord-001824-7c37elh6	310	23	the	the	DT
cord-001824-7c37elh6	310	24	transcribed	transcribe	VBN
cord-001824-7c37elh6	310	25	portion	portion	NN
cord-001824-7c37elh6	310	26	of	of	IN
cord-001824-7c37elh6	310	27	a	a	DT
cord-001824-7c37elh6	310	28	Ty2	ty2	CD
cord-001824-7c37elh6	310	29	transposable	transposable	JJ
cord-001824-7c37elh6	310	30	element	element	NN
cord-001824-7c37elh6	310	31	of	of	IN
cord-001824-7c37elh6	310	32	Saccharomyces	saccharomyce	NNS
cord-001824-7c37elh6	310	33	cerevisiae	cerevisiae	NNS
cord-001824-7c37elh6	311	1	We	-PRON-	PRP
cord-001824-7c37elh6	311	2	acknowledge	acknowledge	VBP
cord-001824-7c37elh6	311	3	Prof.	Prof.	NNP
cord-001824-7c37elh6	311	4	G.	G.	NNP
cord-001824-7c37elh6	311	5	R.	R.	NNP
cord-001824-7c37elh6	311	6	Björk	Björk	NNP
cord-001824-7c37elh6	311	7	 	 	_SP
cord-001824-7c37elh6	311	8	Nucleic	Nucleic	NNP
cord-001824-7c37elh6	311	9	Acids	Acids	NNPS
cord-001824-7c37elh6	311	10	Research	Research	NNP
cord-001824-7c37elh6	311	11	,	,	,
cord-001824-7c37elh6	311	12	2015	2015	CD
cord-001824-7c37elh6	311	13	,	,	,
cord-001824-7c37elh6	311	14	Vol	Vol	NNP
cord-001824-7c37elh6	311	15	.	.	.
cord-001824-7c37elh6	312	1	43	43	CD
cord-001824-7c37elh6	312	2	,	,	,
cord-001824-7c37elh6	312	3	No	no	NN
cord-001824-7c37elh6	312	4	.	.	NN
cord-001824-7c37elh6	312	5	19	19	CD
cord-001824-7c37elh6	312	6	9497	9497	CD
cord-001824-7c37elh6	312	7	(	(	-LRB-
cord-001824-7c37elh6	312	8	41	41	CD
cord-001824-7c37elh6	312	9	,	,	,
cord-001824-7c37elh6	312	10	58	58	CD
cord-001824-7c37elh6	312	11	)	)	-RRB-
cord-001824-7c37elh6	312	12	.	.	.
cord-001824-7c37elh6	313	1	c	c	LS
cord-001824-7c37elh6	313	2	Difference	Difference	NNP
cord-001824-7c37elh6	313	3	in	in	IN
cord-001824-7c37elh6	313	4	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	313	5	between	between	IN
cord-001824-7c37elh6	313	6	elp3	elp3	CD
cord-001824-7c37elh6	313	7	mutant	mutant	JJ
cord-001824-7c37elh6	313	8	and	and	CC
cord-001824-7c37elh6	313	9	wild	wild	JJ
cord-001824-7c37elh6	313	10	type	type	NN
cord-001824-7c37elh6	313	11	was	be	VBD
cord-001824-7c37elh6	313	12	significant	significant	JJ
cord-001824-7c37elh6	313	13	as	as	IN
cord-001824-7c37elh6	313	14	determined	determine	VBN
cord-001824-7c37elh6	313	15	by	by	IN
cord-001824-7c37elh6	313	16	two	two	CD
cord-001824-7c37elh6	313	17	-	-	HYPH
cord-001824-7c37elh6	313	18	tail	tail	NN
cord-001824-7c37elh6	313	19	t	t	NN
cord-001824-7c37elh6	313	20	-	-	HYPH
cord-001824-7c37elh6	313	21	test	test	NN
cord-001824-7c37elh6	313	22	(	(	-LRB-
cord-001824-7c37elh6	313	23	P	p	NN
cord-001824-7c37elh6	313	24	<	<	XX
cord-001824-7c37elh6	313	25	0.02	0.02	CD
cord-001824-7c37elh6	313	26	)	)	-RRB-
cord-001824-7c37elh6	313	27	.	.	.
cord-001824-7c37elh6	314	1	d	d	NNP
cord-001824-7c37elh6	314	2	Difference	Difference	NNP
cord-001824-7c37elh6	314	3	in	in	IN
cord-001824-7c37elh6	314	4	frameshifting	frameshifte	VBG
cord-001824-7c37elh6	314	5	between	between	IN
cord-001824-7c37elh6	314	6	elp3	elp3	CD
cord-001824-7c37elh6	314	7	mutant	mutant	JJ
cord-001824-7c37elh6	314	8	and	and	CC
cord-001824-7c37elh6	314	9	wild	wild	JJ
cord-001824-7c37elh6	314	10	type	type	NN
cord-001824-7c37elh6	314	11	was	be	VBD
cord-001824-7c37elh6	314	12	not	not	RB
cord-001824-7c37elh6	314	13	significant	significant	JJ
cord-001824-7c37elh6	314	14	as	as	IN
cord-001824-7c37elh6	314	15	determined	determine	VBN
cord-001824-7c37elh6	314	16	by	by	IN
cord-001824-7c37elh6	314	17	two	two	CD
cord-001824-7c37elh6	314	18	-	-	HYPH
cord-001824-7c37elh6	314	19	tail	tail	NN
cord-001824-7c37elh6	314	20	t	t	NN
cord-001824-7c37elh6	314	21	-	-	HYPH
cord-001824-7c37elh6	314	22	test	test	NN
cord-001824-7c37elh6	314	23	(	(	-LRB-
cord-001824-7c37elh6	314	24	P	p	NN
cord-001824-7c37elh6	314	25	>	>	XX
cord-001824-7c37elh6	314	26	0.05	0.05	CD
cord-001824-7c37elh6	314	27	)	)	-RRB-
cord-001824-7c37elh6	314	28	.	.	.