id	sid	tid	token	lemma	pos
cord-269150-d1sgnxc0	1	1	key	key	JJ
cord-269150-d1sgnxc0	1	2	:	:	:
cord-269150-d1sgnxc0	1	3	cord-269150-d1sgnxc0	cord-269150-d1sgnxc0	CD
cord-269150-d1sgnxc0	1	4	authors	author	NNS
cord-269150-d1sgnxc0	1	5	:	:	:
cord-269150-d1sgnxc0	1	6	Tan	Tan	NNP
cord-269150-d1sgnxc0	1	7	,	,	,
cord-269150-d1sgnxc0	1	8	Yong	Yong	NNP
cord-269150-d1sgnxc0	1	9	Wah	Wah	NNP
cord-269150-d1sgnxc0	1	10	;	;	:
cord-269150-d1sgnxc0	1	11	Hong	Hong	NNP
cord-269150-d1sgnxc0	1	12	,	,	,
cord-269150-d1sgnxc0	1	13	Wanjin	Wanjin	NNP
cord-269150-d1sgnxc0	1	14	;	;	:
cord-269150-d1sgnxc0	1	15	Liu	Liu	NNP
cord-269150-d1sgnxc0	1	16	,	,	,
cord-269150-d1sgnxc0	1	17	Ding	Ding	NNP
cord-269150-d1sgnxc0	1	18	Xiang	Xiang	NNP
cord-269150-d1sgnxc0	2	1	title	title	NN
cord-269150-d1sgnxc0	2	2	:	:	:
cord-269150-d1sgnxc0	2	3	Binding	binding	NN
cord-269150-d1sgnxc0	2	4	of	of	IN
cord-269150-d1sgnxc0	2	5	the	the	DT
cord-269150-d1sgnxc0	2	6	5′-untranslated	5′-untranslated	CD
cord-269150-d1sgnxc0	2	7	region	region	NN
cord-269150-d1sgnxc0	2	8	of	of	IN
cord-269150-d1sgnxc0	2	9	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	2	10	RNA	RNA	NNP
cord-269150-d1sgnxc0	2	11	to	to	IN
cord-269150-d1sgnxc0	2	12	zinc	zinc	NN
cord-269150-d1sgnxc0	2	13	finger	finger	NN
cord-269150-d1sgnxc0	2	14	CCHC	CCHC	NNP
cord-269150-d1sgnxc0	2	15	-	-	HYPH
cord-269150-d1sgnxc0	2	16	type	type	NN
cord-269150-d1sgnxc0	2	17	and	and	CC
cord-269150-d1sgnxc0	2	18	RNA	rna	NN
cord-269150-d1sgnxc0	2	19	-	-	HYPH
cord-269150-d1sgnxc0	2	20	binding	bind	VBG
cord-269150-d1sgnxc0	2	21	motif	motif	NN
cord-269150-d1sgnxc0	2	22	1	1	CD
cord-269150-d1sgnxc0	2	23	enhances	enhance	VBZ
cord-269150-d1sgnxc0	2	24	viral	viral	JJ
cord-269150-d1sgnxc0	2	25	replication	replication	NN
cord-269150-d1sgnxc0	2	26	and	and	CC
cord-269150-d1sgnxc0	2	27	transcription	transcription	NN
cord-269150-d1sgnxc0	2	28	date	date	NN
cord-269150-d1sgnxc0	3	1	:	:	:
cord-269150-d1sgnxc0	3	2	2012	2012	CD
cord-269150-d1sgnxc0	3	3	-	-	SYM
cord-269150-d1sgnxc0	3	4	02	02	CD
cord-269150-d1sgnxc0	3	5	-	-	SYM
cord-269150-d1sgnxc0	3	6	22	22	CD
cord-269150-d1sgnxc0	3	7	journal	journal	NN
cord-269150-d1sgnxc0	3	8	:	:	:
cord-269150-d1sgnxc0	4	1	Nucleic	nucleic	JJ
cord-269150-d1sgnxc0	4	2	Acids	acid	NNS
cord-269150-d1sgnxc0	4	3	Res	res	NN
cord-269150-d1sgnxc0	4	4	DOI	doi	NN
cord-269150-d1sgnxc0	4	5	:	:	:
cord-269150-d1sgnxc0	5	1	10.1093	10.1093	CD
cord-269150-d1sgnxc0	5	2	/	/	SYM
cord-269150-d1sgnxc0	5	3	nar	nar	NNP
cord-269150-d1sgnxc0	5	4	/	/	SYM
cord-269150-d1sgnxc0	5	5	gks165	gks165	NNP
cord-269150-d1sgnxc0	5	6	sha	sha	NNP
cord-269150-d1sgnxc0	5	7	:	:	:
cord-269150-d1sgnxc0	5	8	9cd8c3706551ab124d7035449350556c72297e2e	9cd8c3706551ab124d7035449350556c72297e2e	CD
cord-269150-d1sgnxc0	5	9	doc_id	doc_id	CD
cord-269150-d1sgnxc0	5	10	:	:	:
cord-269150-d1sgnxc0	5	11	269150	269150	CD
cord-269150-d1sgnxc0	5	12	cord_uid	cord_uid	NNS
cord-269150-d1sgnxc0	5	13	:	:	:
cord-269150-d1sgnxc0	5	14	d1sgnxc0	d1sgnxc0	.
cord-269150-d1sgnxc0	6	1	Coronaviruses	Coronaviruses	NNP
cord-269150-d1sgnxc0	6	2	RNA	RNA	NNP
cord-269150-d1sgnxc0	6	3	synthesis	synthesis	NN
cord-269150-d1sgnxc0	6	4	occurs	occur	VBZ
cord-269150-d1sgnxc0	6	5	in	in	IN
cord-269150-d1sgnxc0	6	6	the	the	DT
cord-269150-d1sgnxc0	6	7	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	6	8	and	and	CC
cord-269150-d1sgnxc0	6	9	is	be	VBZ
cord-269150-d1sgnxc0	6	10	regulated	regulate	VBN
cord-269150-d1sgnxc0	6	11	by	by	IN
cord-269150-d1sgnxc0	6	12	host	host	NN
cord-269150-d1sgnxc0	6	13	cell	cell	NN
cord-269150-d1sgnxc0	6	14	proteins	protein	NNS
cord-269150-d1sgnxc0	6	15	.	.	.
cord-269150-d1sgnxc0	7	1	In	in	IN
cord-269150-d1sgnxc0	7	2	a	a	DT
cord-269150-d1sgnxc0	7	3	screen	screen	NN
cord-269150-d1sgnxc0	7	4	based	base	VBN
cord-269150-d1sgnxc0	7	5	on	on	IN
cord-269150-d1sgnxc0	7	6	a	a	DT
cord-269150-d1sgnxc0	7	7	yeast	yeast	NN
cord-269150-d1sgnxc0	7	8	three	three	CD
cord-269150-d1sgnxc0	7	9	-	-	HYPH
cord-269150-d1sgnxc0	7	10	hybrid	hybrid	NN
cord-269150-d1sgnxc0	7	11	system	system	NN
cord-269150-d1sgnxc0	7	12	using	use	VBG
cord-269150-d1sgnxc0	7	13	the	the	DT
cord-269150-d1sgnxc0	7	14	5′-untranslated	5′-untranslated	CD
cord-269150-d1sgnxc0	7	15	region	region	NN
cord-269150-d1sgnxc0	7	16	(	(	-LRB-
cord-269150-d1sgnxc0	7	17	5′-UTR	5′-utr	NN
cord-269150-d1sgnxc0	7	18	)	)	-RRB-
cord-269150-d1sgnxc0	7	19	of	of	IN
cord-269150-d1sgnxc0	7	20	SARS	SARS	NNP
cord-269150-d1sgnxc0	7	21	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	7	22	(	(	-LRB-
cord-269150-d1sgnxc0	7	23	SARS	SARS	NNP
cord-269150-d1sgnxc0	7	24	-	-	HYPH
cord-269150-d1sgnxc0	7	25	CoV	CoV	NNP
cord-269150-d1sgnxc0	7	26	)	)	-RRB-
cord-269150-d1sgnxc0	7	27	RNA	RNA	NNP
cord-269150-d1sgnxc0	7	28	as	as	IN
cord-269150-d1sgnxc0	7	29	bait	bait	NN
cord-269150-d1sgnxc0	7	30	against	against	IN
cord-269150-d1sgnxc0	7	31	a	a	DT
cord-269150-d1sgnxc0	7	32	human	human	JJ
cord-269150-d1sgnxc0	7	33	cDNA	cdna	NN
cord-269150-d1sgnxc0	7	34	library	library	NN
cord-269150-d1sgnxc0	7	35	derived	derive	VBN
cord-269150-d1sgnxc0	7	36	from	from	IN
cord-269150-d1sgnxc0	7	37	HeLa	HeLa	NNP
cord-269150-d1sgnxc0	7	38	cells	cell	NNS
cord-269150-d1sgnxc0	7	39	,	,	,
cord-269150-d1sgnxc0	7	40	we	-PRON-	PRP
cord-269150-d1sgnxc0	7	41	found	find	VBD
cord-269150-d1sgnxc0	7	42	a	a	DT
cord-269150-d1sgnxc0	7	43	positive	positive	JJ
cord-269150-d1sgnxc0	7	44	candidate	candidate	NN
cord-269150-d1sgnxc0	7	45	cellular	cellular	JJ
cord-269150-d1sgnxc0	7	46	protein	protein	NN
cord-269150-d1sgnxc0	7	47	,	,	,
cord-269150-d1sgnxc0	7	48	zinc	zinc	NN
cord-269150-d1sgnxc0	7	49	finger	finger	NN
cord-269150-d1sgnxc0	7	50	CCHC	CCHC	NNP
cord-269150-d1sgnxc0	7	51	-	-	HYPH
cord-269150-d1sgnxc0	7	52	type	type	NN
cord-269150-d1sgnxc0	7	53	and	and	CC
cord-269150-d1sgnxc0	7	54	RNA	rna	NN
cord-269150-d1sgnxc0	7	55	-	-	HYPH
cord-269150-d1sgnxc0	7	56	binding	bind	VBG
cord-269150-d1sgnxc0	7	57	motif	motif	NN
cord-269150-d1sgnxc0	7	58	1	1	CD
cord-269150-d1sgnxc0	7	59	(	(	-LRB-
cord-269150-d1sgnxc0	7	60	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	7	61	)	)	-RRB-
cord-269150-d1sgnxc0	7	62	,	,	,
cord-269150-d1sgnxc0	7	63	to	to	TO
cord-269150-d1sgnxc0	7	64	be	be	VB
cord-269150-d1sgnxc0	7	65	able	able	JJ
cord-269150-d1sgnxc0	7	66	to	to	TO
cord-269150-d1sgnxc0	7	67	interact	interact	VB
cord-269150-d1sgnxc0	7	68	with	with	IN
cord-269150-d1sgnxc0	7	69	this	this	DT
cord-269150-d1sgnxc0	7	70	region	region	NN
cord-269150-d1sgnxc0	7	71	of	of	IN
cord-269150-d1sgnxc0	7	72	the	the	DT
cord-269150-d1sgnxc0	7	73	SARS	SARS	NNP
cord-269150-d1sgnxc0	7	74	-	-	HYPH
cord-269150-d1sgnxc0	7	75	CoV	CoV	NNP
cord-269150-d1sgnxc0	7	76	genome	genome	NN
cord-269150-d1sgnxc0	7	77	.	.	.
cord-269150-d1sgnxc0	8	1	This	this	DT
cord-269150-d1sgnxc0	8	2	interaction	interaction	NN
cord-269150-d1sgnxc0	8	3	was	be	VBD
cord-269150-d1sgnxc0	8	4	subsequently	subsequently	RB
cord-269150-d1sgnxc0	8	5	confirmed	confirm	VBN
cord-269150-d1sgnxc0	8	6	in	in	IN
cord-269150-d1sgnxc0	8	7	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	8	8	infectious	infectious	JJ
cord-269150-d1sgnxc0	8	9	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	8	10	virus	virus	NN
cord-269150-d1sgnxc0	8	11	(	(	-LRB-
cord-269150-d1sgnxc0	8	12	IBV	IBV	NNP
cord-269150-d1sgnxc0	8	13	)	)	-RRB-
cord-269150-d1sgnxc0	8	14	.	.	.
cord-269150-d1sgnxc0	9	1	The	the	DT
cord-269150-d1sgnxc0	9	2	specificity	specificity	NN
cord-269150-d1sgnxc0	9	3	of	of	IN
cord-269150-d1sgnxc0	9	4	the	the	DT
cord-269150-d1sgnxc0	9	5	interaction	interaction	NN
cord-269150-d1sgnxc0	9	6	between	between	IN
cord-269150-d1sgnxc0	9	7	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	9	8	and	and	CC
cord-269150-d1sgnxc0	9	9	the	the	DT
cord-269150-d1sgnxc0	9	10	5′-UTR	5′-utr	NN
cord-269150-d1sgnxc0	9	11	of	of	IN
cord-269150-d1sgnxc0	9	12	IBV	IBV	NNP
cord-269150-d1sgnxc0	9	13	was	be	VBD
cord-269150-d1sgnxc0	9	14	investigated	investigate	VBN
cord-269150-d1sgnxc0	9	15	and	and	CC
cord-269150-d1sgnxc0	9	16	confirmed	confirm	VBN
cord-269150-d1sgnxc0	9	17	by	by	IN
cord-269150-d1sgnxc0	9	18	using	use	VBG
cord-269150-d1sgnxc0	9	19	an	an	DT
cord-269150-d1sgnxc0	9	20	RNA	RNA	NNP
cord-269150-d1sgnxc0	9	21	pull	pull	VB
cord-269150-d1sgnxc0	9	22	-	-	HYPH
cord-269150-d1sgnxc0	9	23	down	down	RP
cord-269150-d1sgnxc0	9	24	assay	assay	NN
cord-269150-d1sgnxc0	9	25	.	.	.
cord-269150-d1sgnxc0	10	1	The	the	DT
cord-269150-d1sgnxc0	10	2	RNA	RNA	NNP
cord-269150-d1sgnxc0	10	3	-	-	HYPH
cord-269150-d1sgnxc0	10	4	binding	bind	VBG
cord-269150-d1sgnxc0	10	5	domain	domain	NN
cord-269150-d1sgnxc0	10	6	was	be	VBD
cord-269150-d1sgnxc0	10	7	mapped	map	VBN
cord-269150-d1sgnxc0	10	8	to	to	IN
cord-269150-d1sgnxc0	10	9	the	the	DT
cord-269150-d1sgnxc0	10	10	N	n	CD
cord-269150-d1sgnxc0	10	11	-	-	HYPH
cord-269150-d1sgnxc0	10	12	terminal	terminal	JJ
cord-269150-d1sgnxc0	10	13	region	region	NN
cord-269150-d1sgnxc0	10	14	of	of	IN
cord-269150-d1sgnxc0	10	15	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	10	16	and	and	CC
cord-269150-d1sgnxc0	10	17	the	the	DT
cord-269150-d1sgnxc0	10	18	protein	protein	NN
cord-269150-d1sgnxc0	10	19	binding	bind	VBG
cord-269150-d1sgnxc0	10	20	sequence	sequence	NN
cord-269150-d1sgnxc0	10	21	to	to	TO
cord-269150-d1sgnxc0	10	22	stem	stem	VB
cord-269150-d1sgnxc0	10	23	–	–	:
cord-269150-d1sgnxc0	10	24	loop	loop	NN
cord-269150-d1sgnxc0	10	25	I	-PRON-	PRP
cord-269150-d1sgnxc0	10	26	of	of	IN
cord-269150-d1sgnxc0	10	27	IBV	IBV	NNP
cord-269150-d1sgnxc0	10	28	5′-UTR	5′-utr	CD
cord-269150-d1sgnxc0	10	29	.	.	.
cord-269150-d1sgnxc0	11	1	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	11	2	was	be	VBD
cord-269150-d1sgnxc0	11	3	found	find	VBN
cord-269150-d1sgnxc0	11	4	to	to	TO
cord-269150-d1sgnxc0	11	5	be	be	VB
cord-269150-d1sgnxc0	11	6	translocated	translocate	VBN
cord-269150-d1sgnxc0	11	7	to	to	IN
cord-269150-d1sgnxc0	11	8	the	the	DT
cord-269150-d1sgnxc0	11	9	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	11	10	and	and	CC
cord-269150-d1sgnxc0	11	11	partially	partially	RB
cord-269150-d1sgnxc0	11	12	co	co	JJ
cord-269150-d1sgnxc0	11	13	-	-	VBN
cord-269150-d1sgnxc0	11	14	localized	localize	VBN
cord-269150-d1sgnxc0	11	15	with	with	IN
cord-269150-d1sgnxc0	11	16	the	the	DT
cord-269150-d1sgnxc0	11	17	viral	viral	JJ
cord-269150-d1sgnxc0	11	18	replicase	replicase	NN
cord-269150-d1sgnxc0	11	19	/	/	SYM
cord-269150-d1sgnxc0	11	20	transcriptase	transcriptase	NN
cord-269150-d1sgnxc0	11	21	complexes	complex	NNS
cord-269150-d1sgnxc0	11	22	(	(	-LRB-
cord-269150-d1sgnxc0	11	23	RTCs	RTCs	NNP
cord-269150-d1sgnxc0	11	24	)	)	-RRB-
cord-269150-d1sgnxc0	11	25	in	in	IN
cord-269150-d1sgnxc0	11	26	IBV	IBV	NNP
cord-269150-d1sgnxc0	11	27	-	-	HYPH
cord-269150-d1sgnxc0	11	28	infected	infect	VBN
cord-269150-d1sgnxc0	11	29	cells	cell	NNS
cord-269150-d1sgnxc0	11	30	,	,	,
cord-269150-d1sgnxc0	11	31	deviating	deviate	VBG
cord-269150-d1sgnxc0	11	32	from	from	IN
cord-269150-d1sgnxc0	11	33	its	-PRON-	PRP$
cord-269150-d1sgnxc0	11	34	usual	usual	JJ
cord-269150-d1sgnxc0	11	35	nuclear	nuclear	JJ
cord-269150-d1sgnxc0	11	36	localization	localization	NN
cord-269150-d1sgnxc0	11	37	in	in	IN
cord-269150-d1sgnxc0	11	38	a	a	DT
cord-269150-d1sgnxc0	11	39	normal	normal	JJ
cord-269150-d1sgnxc0	11	40	cell	cell	NN
cord-269150-d1sgnxc0	11	41	using	use	VBG
cord-269150-d1sgnxc0	11	42	indirect	indirect	JJ
cord-269150-d1sgnxc0	11	43	immunofluorescence	immunofluorescence	NN
cord-269150-d1sgnxc0	11	44	.	.	.
cord-269150-d1sgnxc0	12	1	Using	use	VBG
cord-269150-d1sgnxc0	12	2	small	small	JJ
cord-269150-d1sgnxc0	12	3	interfering	interfere	VBG
cord-269150-d1sgnxc0	12	4	RNA	RNA	NNP
cord-269150-d1sgnxc0	12	5	(	(	-LRB-
cord-269150-d1sgnxc0	12	6	siRNA	siRNA	NNP
cord-269150-d1sgnxc0	12	7	)	)	-RRB-
cord-269150-d1sgnxc0	12	8	against	against	IN
cord-269150-d1sgnxc0	12	9	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	12	10	,	,	,
cord-269150-d1sgnxc0	12	11	defective	defective	JJ
cord-269150-d1sgnxc0	12	12	viral	viral	JJ
cord-269150-d1sgnxc0	12	13	RNA	RNA	NNP
cord-269150-d1sgnxc0	12	14	synthesis	synthesis	NN
cord-269150-d1sgnxc0	12	15	was	be	VBD
cord-269150-d1sgnxc0	12	16	observed	observe	VBN
cord-269150-d1sgnxc0	12	17	in	in	IN
cord-269150-d1sgnxc0	12	18	the	the	DT
cord-269150-d1sgnxc0	12	19	knockdown	knockdown	NN
cord-269150-d1sgnxc0	12	20	cells	cell	NNS
cord-269150-d1sgnxc0	12	21	,	,	,
cord-269150-d1sgnxc0	12	22	therefore	therefore	RB
cord-269150-d1sgnxc0	12	23	indicating	indicate	VBG
cord-269150-d1sgnxc0	12	24	the	the	DT
cord-269150-d1sgnxc0	12	25	importance	importance	NN
cord-269150-d1sgnxc0	12	26	of	of	IN
cord-269150-d1sgnxc0	12	27	the	the	DT
cord-269150-d1sgnxc0	12	28	protein	protein	NN
cord-269150-d1sgnxc0	12	29	in	in	IN
cord-269150-d1sgnxc0	12	30	coronaviral	coronaviral	NNP
cord-269150-d1sgnxc0	12	31	RNA	RNA	NNP
cord-269150-d1sgnxc0	12	32	synthesis	synthesis	NN
cord-269150-d1sgnxc0	12	33	.	.	.
cord-269150-d1sgnxc0	13	1	During	during	IN
cord-269150-d1sgnxc0	13	2	the	the	DT
cord-269150-d1sgnxc0	13	3	replication	replication	NN
cord-269150-d1sgnxc0	13	4	of	of	IN
cord-269150-d1sgnxc0	13	5	mammalian	mammalian	JJ
cord-269150-d1sgnxc0	13	6	viruses	virus	NNS
cord-269150-d1sgnxc0	13	7	,	,	,
cord-269150-d1sgnxc0	13	8	it	-PRON-	PRP
cord-269150-d1sgnxc0	13	9	is	be	VBZ
cord-269150-d1sgnxc0	13	10	inevitable	inevitable	JJ
cord-269150-d1sgnxc0	13	11	for	for	IN
cord-269150-d1sgnxc0	13	12	host	host	NN
cord-269150-d1sgnxc0	13	13	proteins	protein	NNS
cord-269150-d1sgnxc0	13	14	to	to	TO
cord-269150-d1sgnxc0	13	15	be	be	VB
cord-269150-d1sgnxc0	13	16	involved	involve	VBN
cord-269150-d1sgnxc0	13	17	in	in	IN
cord-269150-d1sgnxc0	13	18	the	the	DT
cord-269150-d1sgnxc0	13	19	viral	viral	JJ
cord-269150-d1sgnxc0	13	20	life	life	NN
cord-269150-d1sgnxc0	13	21	cycles	cycle	NNS
cord-269150-d1sgnxc0	13	22	.	.	.
cord-269150-d1sgnxc0	14	1	In	in	IN
cord-269150-d1sgnxc0	14	2	fact	fact	NN
cord-269150-d1sgnxc0	14	3	,	,	,
cord-269150-d1sgnxc0	14	4	coronaviruses	coronaviruse	NNS
cord-269150-d1sgnxc0	14	5	require	require	VBP
cord-269150-d1sgnxc0	14	6	host	host	NN
cord-269150-d1sgnxc0	14	7	proteins	protein	NNS
cord-269150-d1sgnxc0	14	8	to	to	TO
cord-269150-d1sgnxc0	14	9	aid	aid	VB
cord-269150-d1sgnxc0	14	10	in	in	IN
cord-269150-d1sgnxc0	14	11	the	the	DT
cord-269150-d1sgnxc0	14	12	stages	stage	NNS
cord-269150-d1sgnxc0	14	13	from	from	IN
cord-269150-d1sgnxc0	14	14	virus	virus	NN
cord-269150-d1sgnxc0	14	15	entry	entry	NN
cord-269150-d1sgnxc0	14	16	to	to	IN
cord-269150-d1sgnxc0	14	17	progeny	progeny	JJ
cord-269150-d1sgnxc0	14	18	release	release	NN
cord-269150-d1sgnxc0	14	19	.	.	.
cord-269150-d1sgnxc0	15	1	Entry	entry	NN
cord-269150-d1sgnxc0	15	2	of	of	IN
cord-269150-d1sgnxc0	15	3	the	the	DT
cord-269150-d1sgnxc0	15	4	virus	virus	NN
cord-269150-d1sgnxc0	15	5	particle	particle	NN
cord-269150-d1sgnxc0	15	6	into	into	IN
cord-269150-d1sgnxc0	15	7	a	a	DT
cord-269150-d1sgnxc0	15	8	host	host	NN
cord-269150-d1sgnxc0	15	9	cell	cell	NN
cord-269150-d1sgnxc0	15	10	requires	require	VBZ
cord-269150-d1sgnxc0	15	11	the	the	DT
cord-269150-d1sgnxc0	15	12	recognition	recognition	NN
cord-269150-d1sgnxc0	15	13	of	of	IN
cord-269150-d1sgnxc0	15	14	specific	specific	JJ
cord-269150-d1sgnxc0	15	15	cell	cell	NN
cord-269150-d1sgnxc0	15	16	surface	surface	NN
cord-269150-d1sgnxc0	15	17	proteins	protein	NNS
cord-269150-d1sgnxc0	15	18	,	,	,
cord-269150-d1sgnxc0	15	19	which	which	WDT
cord-269150-d1sgnxc0	15	20	act	act	VBP
cord-269150-d1sgnxc0	15	21	as	as	IN
cord-269150-d1sgnxc0	15	22	receptors	receptor	NNS
cord-269150-d1sgnxc0	15	23	for	for	IN
cord-269150-d1sgnxc0	15	24	the	the	DT
cord-269150-d1sgnxc0	15	25	virus	virus	NN
cord-269150-d1sgnxc0	15	26	spike	spike	NN
cord-269150-d1sgnxc0	15	27	(	(	-LRB-
cord-269150-d1sgnxc0	15	28	S	s	NN
cord-269150-d1sgnxc0	15	29	)	)	-RRB-
cord-269150-d1sgnxc0	15	30	protein	protein	NN
cord-269150-d1sgnxc0	15	31	(	(	-LRB-
cord-269150-d1sgnxc0	15	32	1	1	CD
cord-269150-d1sgnxc0	15	33	)	)	-RRB-
cord-269150-d1sgnxc0	15	34	(	(	-LRB-
cord-269150-d1sgnxc0	15	35	2	2	LS
cord-269150-d1sgnxc0	15	36	)	)	-RRB-
cord-269150-d1sgnxc0	15	37	(	(	-LRB-
cord-269150-d1sgnxc0	15	38	3	3	LS
cord-269150-d1sgnxc0	15	39	)	)	-RRB-
cord-269150-d1sgnxc0	15	40	(	(	-LRB-
cord-269150-d1sgnxc0	15	41	4	4	LS
cord-269150-d1sgnxc0	15	42	)	)	-RRB-
cord-269150-d1sgnxc0	15	43	(	(	-LRB-
cord-269150-d1sgnxc0	15	44	5	5	LS
cord-269150-d1sgnxc0	15	45	)	)	-RRB-
cord-269150-d1sgnxc0	15	46	(	(	-LRB-
cord-269150-d1sgnxc0	15	47	6	6	CD
cord-269150-d1sgnxc0	15	48	)	)	-RRB-
cord-269150-d1sgnxc0	15	49	.	.	.
cord-269150-d1sgnxc0	16	1	Upon	upon	IN
cord-269150-d1sgnxc0	16	2	entry	entry	NN
cord-269150-d1sgnxc0	16	3	into	into	IN
cord-269150-d1sgnxc0	16	4	host	host	NN
cord-269150-d1sgnxc0	16	5	cells	cell	NNS
cord-269150-d1sgnxc0	16	6	,	,	,
cord-269150-d1sgnxc0	16	7	the	the	DT
cord-269150-d1sgnxc0	16	8	ribonucleocapsid	ribonucleocapsid	NNP
cord-269150-d1sgnxc0	16	9	uncoats	uncoats	NNP
cord-269150-d1sgnxc0	16	10	and	and	CC
cord-269150-d1sgnxc0	16	11	releases	release	VBZ
cord-269150-d1sgnxc0	16	12	the	the	DT
cord-269150-d1sgnxc0	16	13	5	5	CD
cord-269150-d1sgnxc0	16	14	0	0	CD
cord-269150-d1sgnxc0	16	15	-capped	-capped	CD
cord-269150-d1sgnxc0	16	16	viral	viral	JJ
cord-269150-d1sgnxc0	16	17	genome	genome	NN
cord-269150-d1sgnxc0	16	18	,	,	,
cord-269150-d1sgnxc0	16	19	a	a	DT
cord-269150-d1sgnxc0	16	20	single	single	RB
cord-269150-d1sgnxc0	16	21	-	-	HYPH
cord-269150-d1sgnxc0	16	22	stranded	strand	VBN
cord-269150-d1sgnxc0	16	23	positive	positive	JJ
cord-269150-d1sgnxc0	16	24	-	-	HYPH
cord-269150-d1sgnxc0	16	25	sense	sense	NN
cord-269150-d1sgnxc0	16	26	RNA	RNA	NNP
cord-269150-d1sgnxc0	16	27	.	.	.
cord-269150-d1sgnxc0	17	1	The	the	DT
cord-269150-d1sgnxc0	17	2	genomic	genomic	JJ
cord-269150-d1sgnxc0	17	3	RNA	rna	NN
cord-269150-d1sgnxc0	17	4	ranges	range	VBZ
cord-269150-d1sgnxc0	17	5	from	from	IN
cord-269150-d1sgnxc0	17	6	27	27	CD
cord-269150-d1sgnxc0	17	7	to	to	TO
cord-269150-d1sgnxc0	17	8	32	32	CD
cord-269150-d1sgnxc0	17	9	kb	kb	NNS
cord-269150-d1sgnxc0	17	10	in	in	IN
cord-269150-d1sgnxc0	17	11	length	length	NN
cord-269150-d1sgnxc0	17	12	,	,	,
cord-269150-d1sgnxc0	17	13	is	be	VBZ
cord-269150-d1sgnxc0	17	14	the	the	DT
cord-269150-d1sgnxc0	17	15	largest	large	JJS
cord-269150-d1sgnxc0	17	16	known	know	VBN
cord-269150-d1sgnxc0	17	17	of	of	IN
cord-269150-d1sgnxc0	17	18	its	-PRON-	PRP$
cord-269150-d1sgnxc0	17	19	kind	kind	NN
cord-269150-d1sgnxc0	17	20	and	and	CC
cord-269150-d1sgnxc0	17	21	is	be	VBZ
cord-269150-d1sgnxc0	17	22	structurally	structurally	RB
cord-269150-d1sgnxc0	17	23	similar	similar	JJ
cord-269150-d1sgnxc0	17	24	to	to	TO
cord-269150-d1sgnxc0	17	25	host	host	VB
cord-269150-d1sgnxc0	17	26	mRNA	mRNA	NNP
cord-269150-d1sgnxc0	17	27	(	(	-LRB-
cord-269150-d1sgnxc0	17	28	7	7	CD
cord-269150-d1sgnxc0	17	29	)	)	-RRB-
cord-269150-d1sgnxc0	17	30	.	.	.
cord-269150-d1sgnxc0	18	1	The	the	DT
cord-269150-d1sgnxc0	18	2	replicase	replicase	NN
cord-269150-d1sgnxc0	18	3	gene	gene	NN
cord-269150-d1sgnxc0	18	4	,	,	,
cord-269150-d1sgnxc0	18	5	which	which	WDT
cord-269150-d1sgnxc0	18	6	spans	span	VBZ
cord-269150-d1sgnxc0	18	7	the	the	DT
cord-269150-d1sgnxc0	18	8	5	5	CD
cord-269150-d1sgnxc0	18	9	0	0	CD
cord-269150-d1sgnxc0	18	10	two	two	CD
cord-269150-d1sgnxc0	18	11	-	-	HYPH
cord-269150-d1sgnxc0	18	12	thirds	third	NNS
cord-269150-d1sgnxc0	18	13	of	of	IN
cord-269150-d1sgnxc0	18	14	the	the	DT
cord-269150-d1sgnxc0	18	15	genome	genome	NN
cord-269150-d1sgnxc0	18	16	,	,	,
cord-269150-d1sgnxc0	18	17	is	be	VBZ
cord-269150-d1sgnxc0	18	18	translated	translate	VBN
cord-269150-d1sgnxc0	18	19	by	by	IN
cord-269150-d1sgnxc0	18	20	host	host	NN
cord-269150-d1sgnxc0	18	21	ribosomes	ribosome	NNS
cord-269150-d1sgnxc0	18	22	into	into	IN
cord-269150-d1sgnxc0	18	23	two	two	CD
cord-269150-d1sgnxc0	18	24	large	large	JJ
cord-269150-d1sgnxc0	18	25	polyproteins	polyprotein	NNS
cord-269150-d1sgnxc0	18	26	,	,	,
cord-269150-d1sgnxc0	18	27	pp1a	pp1a	NNP
cord-269150-d1sgnxc0	18	28	and	and	CC
cord-269150-d1sgnxc0	18	29	pp1ab	pp1ab	NNP
cord-269150-d1sgnxc0	18	30	via	via	IN
cord-269150-d1sgnxc0	18	31	a	a	DT
cord-269150-d1sgnxc0	18	32	frameshift	frameshift	NN
cord-269150-d1sgnxc0	18	33	event	event	NN
cord-269150-d1sgnxc0	18	34	(	(	-LRB-
cord-269150-d1sgnxc0	18	35	8)	8)	NNP
cord-269150-d1sgnxc0	18	36	(	(	-LRB-
cord-269150-d1sgnxc0	18	37	9	9	CD
cord-269150-d1sgnxc0	18	38	)	)	-RRB-
cord-269150-d1sgnxc0	18	39	(	(	-LRB-
cord-269150-d1sgnxc0	18	40	10	10	CD
cord-269150-d1sgnxc0	18	41	)	)	-RRB-
cord-269150-d1sgnxc0	18	42	.	.	.
cord-269150-d1sgnxc0	19	1	The	the	DT
cord-269150-d1sgnxc0	19	2	polyproteins	polyprotein	NNS
cord-269150-d1sgnxc0	19	3	are	be	VBP
cord-269150-d1sgnxc0	19	4	autoproteolytically	autoproteolytically	RB
cord-269150-d1sgnxc0	19	5	processed	process	VBN
cord-269150-d1sgnxc0	19	6	into	into	IN
cord-269150-d1sgnxc0	19	7	a	a	DT
cord-269150-d1sgnxc0	19	8	maximum	maximum	NN
cord-269150-d1sgnxc0	19	9	of	of	IN
cord-269150-d1sgnxc0	19	10	16	16	CD
cord-269150-d1sgnxc0	19	11	nonstructural	nonstructural	JJ
cord-269150-d1sgnxc0	19	12	proteins	protein	NNS
cord-269150-d1sgnxc0	19	13	(	(	-LRB-
cord-269150-d1sgnxc0	19	14	8	8	CD
cord-269150-d1sgnxc0	19	15	,	,	,
cord-269150-d1sgnxc0	19	16	(	(	-LRB-
cord-269150-d1sgnxc0	19	17	11	11	CD
cord-269150-d1sgnxc0	19	18	)	)	-RRB-
cord-269150-d1sgnxc0	19	19	(	(	-LRB-
cord-269150-d1sgnxc0	19	20	12	12	CD
cord-269150-d1sgnxc0	19	21	)	)	-RRB-
cord-269150-d1sgnxc0	19	22	(	(	-LRB-
cord-269150-d1sgnxc0	19	23	13	13	CD
cord-269150-d1sgnxc0	19	24	)	)	-RRB-
cord-269150-d1sgnxc0	19	25	(	(	-LRB-
cord-269150-d1sgnxc0	19	26	14	14	CD
cord-269150-d1sgnxc0	19	27	)	)	-RRB-
cord-269150-d1sgnxc0	19	28	(	(	-LRB-
cord-269150-d1sgnxc0	19	29	15	15	CD
cord-269150-d1sgnxc0	19	30	)	)	-RRB-
cord-269150-d1sgnxc0	19	31	(	(	-LRB-
cord-269150-d1sgnxc0	19	32	16	16	CD
cord-269150-d1sgnxc0	19	33	)	)	-RRB-
cord-269150-d1sgnxc0	19	34	,	,	,
cord-269150-d1sgnxc0	19	35	which	which	WDT
cord-269150-d1sgnxc0	19	36	are	be	VBP
cord-269150-d1sgnxc0	19	37	assembled	assemble	VBN
cord-269150-d1sgnxc0	19	38	into	into	IN
cord-269150-d1sgnxc0	19	39	replicationtranscription	replicationtranscription	NN
cord-269150-d1sgnxc0	19	40	complexes	complex	NNS
cord-269150-d1sgnxc0	19	41	,	,	,
cord-269150-d1sgnxc0	19	42	including	include	VBG
cord-269150-d1sgnxc0	19	43	the	the	DT
cord-269150-d1sgnxc0	19	44	main	main	JJ
cord-269150-d1sgnxc0	19	45	enzyme	enzyme	NN
cord-269150-d1sgnxc0	19	46	RNA	rna	NN
cord-269150-d1sgnxc0	19	47	-	-	HYPH
cord-269150-d1sgnxc0	19	48	dependent	dependent	JJ
cord-269150-d1sgnxc0	19	49	RNA	RNA	NNP
cord-269150-d1sgnxc0	19	50	polymerase	polymerase	NN
cord-269150-d1sgnxc0	19	51	(	(	-LRB-
cord-269150-d1sgnxc0	19	52	nsp12	nsp12	CD
cord-269150-d1sgnxc0	19	53	)	)	-RRB-
cord-269150-d1sgnxc0	19	54	(	(	-LRB-
cord-269150-d1sgnxc0	19	55	17	17	CD
cord-269150-d1sgnxc0	19	56	,	,	,
cord-269150-d1sgnxc0	19	57	18	18	CD
cord-269150-d1sgnxc0	19	58	)	)	-RRB-
cord-269150-d1sgnxc0	19	59	.	.	.
cord-269150-d1sgnxc0	20	1	This	this	DT
cord-269150-d1sgnxc0	20	2	complex	complex	NN
cord-269150-d1sgnxc0	20	3	is	be	VBZ
cord-269150-d1sgnxc0	20	4	required	require	VBN
cord-269150-d1sgnxc0	20	5	for	for	IN
cord-269150-d1sgnxc0	20	6	generating	generate	VBG
cord-269150-d1sgnxc0	20	7	new	new	JJ
cord-269150-d1sgnxc0	20	8	full	full	JJ
cord-269150-d1sgnxc0	20	9	-	-	HYPH
cord-269150-d1sgnxc0	20	10	length	length	NN
cord-269150-d1sgnxc0	20	11	virus	virus	NN
cord-269150-d1sgnxc0	20	12	RNA	rna	NN
cord-269150-d1sgnxc0	20	13	in	in	IN
cord-269150-d1sgnxc0	20	14	replication	replication	NN
cord-269150-d1sgnxc0	20	15	as	as	RB
cord-269150-d1sgnxc0	20	16	well	well	RB
cord-269150-d1sgnxc0	20	17	as	as	IN
cord-269150-d1sgnxc0	20	18	subgenome	subgenome	NN
cord-269150-d1sgnxc0	20	19	-	-	HYPH
cord-269150-d1sgnxc0	20	20	length	length	NN
cord-269150-d1sgnxc0	20	21	RNAs	rna	NNS
cord-269150-d1sgnxc0	20	22	to	to	TO
cord-269150-d1sgnxc0	20	23	be	be	VB
cord-269150-d1sgnxc0	20	24	used	use	VBN
cord-269150-d1sgnxc0	20	25	for	for	IN
cord-269150-d1sgnxc0	20	26	translation	translation	NN
cord-269150-d1sgnxc0	20	27	of	of	IN
cord-269150-d1sgnxc0	20	28	virus	virus	NN
cord-269150-d1sgnxc0	20	29	structural	structural	JJ
cord-269150-d1sgnxc0	20	30	and	and	CC
cord-269150-d1sgnxc0	20	31	accessory	accessory	NN
cord-269150-d1sgnxc0	20	32	proteins	protein	NNS
cord-269150-d1sgnxc0	20	33	.	.	.
cord-269150-d1sgnxc0	21	1	In	in	IN
cord-269150-d1sgnxc0	21	2	addition	addition	NN
cord-269150-d1sgnxc0	21	3	to	to	IN
cord-269150-d1sgnxc0	21	4	their	-PRON-	PRP$
cord-269150-d1sgnxc0	21	5	role	role	NN
cord-269150-d1sgnxc0	21	6	in	in	IN
cord-269150-d1sgnxc0	21	7	RNA	RNA	NNP
cord-269150-d1sgnxc0	21	8	synthesis	synthesis	NN
cord-269150-d1sgnxc0	21	9	,	,	,
cord-269150-d1sgnxc0	21	10	these	these	DT
cord-269150-d1sgnxc0	21	11	nonstructural	nonstructural	JJ
cord-269150-d1sgnxc0	21	12	proteins	protein	NNS
cord-269150-d1sgnxc0	21	13	may	may	MD
cord-269150-d1sgnxc0	21	14	have	have	VB
cord-269150-d1sgnxc0	21	15	multiple	multiple	JJ
cord-269150-d1sgnxc0	21	16	functions	function	NNS
cord-269150-d1sgnxc0	21	17	,	,	,
cord-269150-d1sgnxc0	21	18	such	such	JJ
cord-269150-d1sgnxc0	21	19	as	as	IN
cord-269150-d1sgnxc0	21	20	the	the	DT
cord-269150-d1sgnxc0	21	21	suppression	suppression	NN
cord-269150-d1sgnxc0	21	22	of	of	IN
cord-269150-d1sgnxc0	21	23	host	host	NN
cord-269150-d1sgnxc0	21	24	mRNA	mRNA	NNP
cord-269150-d1sgnxc0	21	25	translation	translation	NN
cord-269150-d1sgnxc0	21	26	as	as	RB
cord-269150-d1sgnxc0	21	27	well	well	RB
cord-269150-d1sgnxc0	21	28	as	as	IN
cord-269150-d1sgnxc0	21	29	mRNA	mrna	NN
cord-269150-d1sgnxc0	21	30	degradation	degradation	NN
cord-269150-d1sgnxc0	21	31	by	by	IN
cord-269150-d1sgnxc0	21	32	nsp1	nsp1	NNS
cord-269150-d1sgnxc0	21	33	of	of	IN
cord-269150-d1sgnxc0	21	34	SARS	SARS	NNP
cord-269150-d1sgnxc0	21	35	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	21	36	(	(	-LRB-
cord-269150-d1sgnxc0	21	37	SARS	SARS	NNP
cord-269150-d1sgnxc0	21	38	-	-	HYPH
cord-269150-d1sgnxc0	21	39	CoV	CoV	NNP
cord-269150-d1sgnxc0	21	40	;	;	:
cord-269150-d1sgnxc0	21	41	[	[	-LRB-
cord-269150-d1sgnxc0	21	42	19	19	CD
cord-269150-d1sgnxc0	21	43	]	]	-RRB-
cord-269150-d1sgnxc0	21	44	[	[	-LRB-
cord-269150-d1sgnxc0	21	45	20	20	CD
cord-269150-d1sgnxc0	21	46	]	]	-RRB-
cord-269150-d1sgnxc0	21	47	[	[	-LRB-
cord-269150-d1sgnxc0	21	48	21	21	CD
cord-269150-d1sgnxc0	21	49	]	]	-RRB-
cord-269150-d1sgnxc0	21	50	,	,	,
cord-269150-d1sgnxc0	21	51	which	which	WDT
cord-269150-d1sgnxc0	21	52	may	may	MD
cord-269150-d1sgnxc0	21	53	play	play	VB
cord-269150-d1sgnxc0	21	54	a	a	DT
cord-269150-d1sgnxc0	21	55	role	role	NN
cord-269150-d1sgnxc0	21	56	in	in	IN
cord-269150-d1sgnxc0	21	57	the	the	DT
cord-269150-d1sgnxc0	21	58	suppression	suppression	NN
cord-269150-d1sgnxc0	21	59	of	of	IN
cord-269150-d1sgnxc0	21	60	immune	immune	JJ
cord-269150-d1sgnxc0	21	61	response	response	NN
cord-269150-d1sgnxc0	21	62	mounted	mount	VBN
cord-269150-d1sgnxc0	21	63	by	by	IN
cord-269150-d1sgnxc0	21	64	the	the	DT
cord-269150-d1sgnxc0	21	65	host	host	NN
cord-269150-d1sgnxc0	21	66	upon	upon	IN
cord-269150-d1sgnxc0	21	67	infection	infection	NN
cord-269150-d1sgnxc0	21	68	.	.	.
cord-269150-d1sgnxc0	22	1	The	the	DT
cord-269150-d1sgnxc0	22	2	replication	replication	NN
cord-269150-d1sgnxc0	22	3	-	-	HYPH
cord-269150-d1sgnxc0	22	4	transcription	transcription	NN
cord-269150-d1sgnxc0	22	5	complex	complex	NN
cord-269150-d1sgnxc0	22	6	(	(	-LRB-
cord-269150-d1sgnxc0	22	7	RTC	RTC	NNP
cord-269150-d1sgnxc0	22	8	)	)	-RRB-
cord-269150-d1sgnxc0	22	9	,	,	,
cord-269150-d1sgnxc0	22	10	which	which	WDT
cord-269150-d1sgnxc0	22	11	is	be	VBZ
cord-269150-d1sgnxc0	22	12	located	locate	VBN
cord-269150-d1sgnxc0	22	13	on	on	IN
cord-269150-d1sgnxc0	22	14	membrane	membrane	NN
cord-269150-d1sgnxc0	22	15	bound	bind	VBN
cord-269150-d1sgnxc0	22	16	vesicles	vesicle	NNS
cord-269150-d1sgnxc0	22	17	in	in	IN
cord-269150-d1sgnxc0	22	18	the	the	DT
cord-269150-d1sgnxc0	22	19	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	22	20	(	(	-LRB-
cord-269150-d1sgnxc0	22	21	22	22	CD
cord-269150-d1sgnxc0	22	22	)	)	-RRB-
cord-269150-d1sgnxc0	22	23	,	,	,
cord-269150-d1sgnxc0	22	24	is	be	VBZ
cord-269150-d1sgnxc0	22	25	required	require	VBN
cord-269150-d1sgnxc0	22	26	for	for	IN
cord-269150-d1sgnxc0	22	27	genome	genome	NN
cord-269150-d1sgnxc0	22	28	replication	replication	NN
cord-269150-d1sgnxc0	22	29	through	through	IN
cord-269150-d1sgnxc0	22	30	continuous	continuous	JJ
cord-269150-d1sgnxc0	22	31	transcription	transcription	NN
cord-269150-d1sgnxc0	22	32	and	and	CC
cord-269150-d1sgnxc0	22	33	subgenomic	subgenomic	NNP
cord-269150-d1sgnxc0	22	34	RNA	RNA	NNP
cord-269150-d1sgnxc0	22	35	synthesis	synthesis	NN
cord-269150-d1sgnxc0	22	36	via	via	IN
cord-269150-d1sgnxc0	22	37	discontinuous	discontinuous	JJ
cord-269150-d1sgnxc0	22	38	transcription	transcription	NN
cord-269150-d1sgnxc0	22	39	(	(	-LRB-
cord-269150-d1sgnxc0	22	40	18	18	CD
cord-269150-d1sgnxc0	22	41	,	,	,
cord-269150-d1sgnxc0	22	42	23	23	CD
cord-269150-d1sgnxc0	22	43	,	,	,
cord-269150-d1sgnxc0	22	44	24	24	CD
cord-269150-d1sgnxc0	22	45	)	)	-RRB-
cord-269150-d1sgnxc0	22	46	.	.	.
cord-269150-d1sgnxc0	23	1	Apart	apart	RB
cord-269150-d1sgnxc0	23	2	from	from	IN
cord-269150-d1sgnxc0	23	3	the	the	DT
cord-269150-d1sgnxc0	23	4	replicase	replicase	NN
cord-269150-d1sgnxc0	23	5	gene	gene	NN
cord-269150-d1sgnxc0	23	6	products	product	NNS
cord-269150-d1sgnxc0	23	7	,	,	,
cord-269150-d1sgnxc0	23	8	a	a	DT
cord-269150-d1sgnxc0	23	9	viral	viral	JJ
cord-269150-d1sgnxc0	23	10	structural	structural	JJ
cord-269150-d1sgnxc0	23	11	protein	protein	NN
cord-269150-d1sgnxc0	23	12	,	,	,
cord-269150-d1sgnxc0	23	13	the	the	DT
cord-269150-d1sgnxc0	23	14	nucleocapsid	nucleocapsid	NN
cord-269150-d1sgnxc0	23	15	(	(	-LRB-
cord-269150-d1sgnxc0	23	16	N	N	NNP
cord-269150-d1sgnxc0	23	17	)	)	-RRB-
cord-269150-d1sgnxc0	23	18	,	,	,
cord-269150-d1sgnxc0	23	19	is	be	VBZ
cord-269150-d1sgnxc0	23	20	also	also	RB
cord-269150-d1sgnxc0	23	21	required	require	VBN
cord-269150-d1sgnxc0	23	22	for	for	IN
cord-269150-d1sgnxc0	23	23	efficient	efficient	JJ
cord-269150-d1sgnxc0	23	24	viral	viral	JJ
cord-269150-d1sgnxc0	23	25	RNA	RNA	NNP
cord-269150-d1sgnxc0	23	26	synthesis	synthesis	NN
cord-269150-d1sgnxc0	23	27	(	(	-LRB-
cord-269150-d1sgnxc0	23	28	25	25	CD
cord-269150-d1sgnxc0	23	29	,	,	,
cord-269150-d1sgnxc0	23	30	26	26	CD
cord-269150-d1sgnxc0	23	31	)	)	-RRB-
cord-269150-d1sgnxc0	23	32	.	.	.
cord-269150-d1sgnxc0	24	1	The	the	DT
cord-269150-d1sgnxc0	24	2	resulting	result	VBG
cord-269150-d1sgnxc0	24	3	genome	genome	NN
cord-269150-d1sgnxc0	24	4	-	-	HYPH
cord-269150-d1sgnxc0	24	5	size	size	NN
cord-269150-d1sgnxc0	24	6	transcripts	transcript	NNS
cord-269150-d1sgnxc0	24	7	are	be	VBP
cord-269150-d1sgnxc0	24	8	destined	destine	VBN
cord-269150-d1sgnxc0	24	9	to	to	TO
cord-269150-d1sgnxc0	24	10	be	be	VB
cord-269150-d1sgnxc0	24	11	packaged	package	VBN
cord-269150-d1sgnxc0	24	12	into	into	IN
cord-269150-d1sgnxc0	24	13	progeny	progeny	JJ
cord-269150-d1sgnxc0	24	14	virions	virion	NNS
cord-269150-d1sgnxc0	24	15	while	while	IN
cord-269150-d1sgnxc0	24	16	the	the	DT
cord-269150-d1sgnxc0	24	17	subgenomic	subgenomic	NNP
cord-269150-d1sgnxc0	24	18	,	,	,
cord-269150-d1sgnxc0	24	19	positive	positive	JJ
cord-269150-d1sgnxc0	24	20	-	-	HYPH
cord-269150-d1sgnxc0	24	21	sense	sense	NN
cord-269150-d1sgnxc0	24	22	transcripts	transcript	NNS
cord-269150-d1sgnxc0	24	23	are	be	VBP
cord-269150-d1sgnxc0	24	24	being	be	VBG
cord-269150-d1sgnxc0	24	25	translated	translate	VBN
cord-269150-d1sgnxc0	24	26	into	into	IN
cord-269150-d1sgnxc0	24	27	four	four	CD
cord-269150-d1sgnxc0	24	28	structural	structural	JJ
cord-269150-d1sgnxc0	24	29	proteins	protein	NNS
cord-269150-d1sgnxc0	24	30	,	,	,
cord-269150-d1sgnxc0	24	31	spike	spike	NN
cord-269150-d1sgnxc0	24	32	(	(	-LRB-
cord-269150-d1sgnxc0	24	33	S	S	NNP
cord-269150-d1sgnxc0	24	34	)	)	-RRB-
cord-269150-d1sgnxc0	24	35	,	,	,
cord-269150-d1sgnxc0	24	36	nucleocapsid	nucleocapsid	NN
cord-269150-d1sgnxc0	24	37	(	(	-LRB-
cord-269150-d1sgnxc0	24	38	N	N	NNP
cord-269150-d1sgnxc0	24	39	)	)	-RRB-
cord-269150-d1sgnxc0	24	40	,	,	,
cord-269150-d1sgnxc0	24	41	membrane	membrane	NN
cord-269150-d1sgnxc0	24	42	(	(	-LRB-
cord-269150-d1sgnxc0	24	43	M	M	NNP
cord-269150-d1sgnxc0	24	44	)	)	-RRB-
cord-269150-d1sgnxc0	24	45	and	and	CC
cord-269150-d1sgnxc0	24	46	envelope	envelope	NN
cord-269150-d1sgnxc0	24	47	(	(	-LRB-
cord-269150-d1sgnxc0	24	48	E	e	NN
cord-269150-d1sgnxc0	24	49	)	)	-RRB-
cord-269150-d1sgnxc0	24	50	proteins	protein	NNS
cord-269150-d1sgnxc0	24	51	,	,	,
cord-269150-d1sgnxc0	24	52	as	as	RB
cord-269150-d1sgnxc0	24	53	well	well	RB
cord-269150-d1sgnxc0	24	54	as	as	IN
cord-269150-d1sgnxc0	24	55	other	other	JJ
cord-269150-d1sgnxc0	24	56	accessory	accessory	NN
cord-269150-d1sgnxc0	24	57	proteins	protein	NNS
cord-269150-d1sgnxc0	24	58	.	.	.
cord-269150-d1sgnxc0	25	1	In	in	IN
cord-269150-d1sgnxc0	25	2	virus	virus	NN
cord-269150-d1sgnxc0	25	3	RNA	RNA	NNP
cord-269150-d1sgnxc0	25	4	synthesis	synthesis	NN
cord-269150-d1sgnxc0	25	5	,	,	,
cord-269150-d1sgnxc0	25	6	the	the	DT
cord-269150-d1sgnxc0	25	7	replicase	replicase	NN
cord-269150-d1sgnxc0	25	8	complex	complex	NN
cord-269150-d1sgnxc0	25	9	is	be	VBZ
cord-269150-d1sgnxc0	25	10	indispensable	indispensable	JJ
cord-269150-d1sgnxc0	25	11	but	but	CC
cord-269150-d1sgnxc0	25	12	not	not	RB
cord-269150-d1sgnxc0	25	13	an	an	DT
cord-269150-d1sgnxc0	25	14	exclusive	exclusive	JJ
cord-269150-d1sgnxc0	25	15	participant	participant	NN
cord-269150-d1sgnxc0	25	16	.	.	.
cord-269150-d1sgnxc0	26	1	Several	several	JJ
cord-269150-d1sgnxc0	26	2	host	host	NN
cord-269150-d1sgnxc0	26	3	proteins	protein	NNS
cord-269150-d1sgnxc0	26	4	have	have	VBP
cord-269150-d1sgnxc0	26	5	been	be	VBN
cord-269150-d1sgnxc0	26	6	identified	identify	VBN
cord-269150-d1sgnxc0	26	7	to	to	TO
cord-269150-d1sgnxc0	26	8	be	be	VB
cord-269150-d1sgnxc0	26	9	able	able	JJ
cord-269150-d1sgnxc0	26	10	to	to	TO
cord-269150-d1sgnxc0	26	11	interact	interact	VB
cord-269150-d1sgnxc0	26	12	with	with	IN
cord-269150-d1sgnxc0	26	13	regulatory	regulatory	JJ
cord-269150-d1sgnxc0	26	14	signals	signal	NNS
cord-269150-d1sgnxc0	26	15	within	within	IN
cord-269150-d1sgnxc0	26	16	the	the	DT
cord-269150-d1sgnxc0	26	17	untranslated	untranslated	JJ
cord-269150-d1sgnxc0	26	18	regions	region	NNS
cord-269150-d1sgnxc0	26	19	in	in	IN
cord-269150-d1sgnxc0	26	20	the	the	DT
cord-269150-d1sgnxc0	26	21	viral	viral	JJ
cord-269150-d1sgnxc0	26	22	genome	genome	NN
cord-269150-d1sgnxc0	26	23	of	of	IN
cord-269150-d1sgnxc0	26	24	betacoronavirus	betacoronavirus	NNP
cord-269150-d1sgnxc0	26	25	MHV	MHV	NNP
cord-269150-d1sgnxc0	26	26	.	.	.
cord-269150-d1sgnxc0	27	1	These	these	DT
cord-269150-d1sgnxc0	27	2	include	include	VBP
cord-269150-d1sgnxc0	27	3	the	the	DT
cord-269150-d1sgnxc0	27	4	polypyrimidine	polypyrimidine	JJ
cord-269150-d1sgnxc0	27	5	tract	tract	NN
cord-269150-d1sgnxc0	27	6	-	-	HYPH
cord-269150-d1sgnxc0	27	7	binding	bind	VBG
cord-269150-d1sgnxc0	27	8	protein	protein	NN
cord-269150-d1sgnxc0	27	9	(	(	-LRB-
cord-269150-d1sgnxc0	27	10	PTB	PTB	NNP
cord-269150-d1sgnxc0	27	11	)	)	-RRB-
cord-269150-d1sgnxc0	27	12	(	(	-LRB-
cord-269150-d1sgnxc0	27	13	27	27	CD
cord-269150-d1sgnxc0	27	14	,	,	,
cord-269150-d1sgnxc0	27	15	28	28	CD
cord-269150-d1sgnxc0	27	16	)	)	-RRB-
cord-269150-d1sgnxc0	27	17	with	with	IN
cord-269150-d1sgnxc0	27	18	the	the	DT
cord-269150-d1sgnxc0	27	19	leader	leader	NN
cord-269150-d1sgnxc0	27	20	sequence	sequence	NN
cord-269150-d1sgnxc0	27	21	,	,	,
cord-269150-d1sgnxc0	27	22	hnRNP	hnrnp	DT
cord-269150-d1sgnxc0	27	23	A1	a1	NN
cord-269150-d1sgnxc0	27	24	(	(	-LRB-
cord-269150-d1sgnxc0	27	25	27	27	CD
cord-269150-d1sgnxc0	27	26	,	,	,
cord-269150-d1sgnxc0	27	27	29	29	CD
cord-269150-d1sgnxc0	27	28	,	,	,
cord-269150-d1sgnxc0	27	29	30	30	CD
cord-269150-d1sgnxc0	27	30	)	)	-RRB-
cord-269150-d1sgnxc0	27	31	and	and	CC
cord-269150-d1sgnxc0	27	32	hnRNP	hnrnp	DT
cord-269150-d1sgnxc0	28	1	Q	Q	NNP
cord-269150-d1sgnxc0	28	2	(	(	-LRB-
cord-269150-d1sgnxc0	28	3	31	31	CD
cord-269150-d1sgnxc0	28	4	)	)	-RRB-
cord-269150-d1sgnxc0	28	5	with	with	IN
cord-269150-d1sgnxc0	28	6	the	the	DT
cord-269150-d1sgnxc0	28	7	3	3	CD
cord-269150-d1sgnxc0	28	8	0	0	CD
cord-269150-d1sgnxc0	28	9	-UTR	-utr	NN
cord-269150-d1sgnxc0	28	10	.	.	.
cord-269150-d1sgnxc0	29	1	More	more	RBR
cord-269150-d1sgnxc0	29	2	recently	recently	RB
cord-269150-d1sgnxc0	29	3	,	,	,
cord-269150-d1sgnxc0	29	4	poly(A)-binding	poly(a)-binde	VBG
cord-269150-d1sgnxc0	29	5	protein	protein	NN
cord-269150-d1sgnxc0	29	6	(	(	-LRB-
cord-269150-d1sgnxc0	29	7	PABP	PABP	NNP
cord-269150-d1sgnxc0	29	8	)	)	-RRB-
cord-269150-d1sgnxc0	29	9	,	,	,
cord-269150-d1sgnxc0	29	10	hnRNP	hnrnp	DT
cord-269150-d1sgnxc0	29	11	Q	q	NN
cord-269150-d1sgnxc0	29	12	and	and	CC
cord-269150-d1sgnxc0	29	13	glutamyl	glutamyl	NN
cord-269150-d1sgnxc0	29	14	-	-	HYPH
cord-269150-d1sgnxc0	29	15	prolyl	prolyl	NNP
cord-269150-d1sgnxc0	29	16	-	-	HYPH
cord-269150-d1sgnxc0	29	17	tRNA	trna	NN
cord-269150-d1sgnxc0	29	18	synthetase	synthetase	NN
cord-269150-d1sgnxc0	29	19	(	(	-LRB-
cord-269150-d1sgnxc0	29	20	EPRS	EPRS	NNP
cord-269150-d1sgnxc0	29	21	)	)	-RRB-
cord-269150-d1sgnxc0	29	22	were	be	VBD
cord-269150-d1sgnxc0	29	23	found	find	VBN
cord-269150-d1sgnxc0	29	24	to	to	TO
cord-269150-d1sgnxc0	29	25	play	play	VB
cord-269150-d1sgnxc0	29	26	a	a	DT
cord-269150-d1sgnxc0	29	27	role	role	NN
cord-269150-d1sgnxc0	29	28	in	in	IN
cord-269150-d1sgnxc0	29	29	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	29	30	RNA	RNA	NNP
cord-269150-d1sgnxc0	29	31	synthesis	synthesis	NN
cord-269150-d1sgnxc0	29	32	through	through	IN
cord-269150-d1sgnxc0	29	33	their	-PRON-	PRP$
cord-269150-d1sgnxc0	29	34	interaction	interaction	NN
cord-269150-d1sgnxc0	29	35	with	with	IN
cord-269150-d1sgnxc0	29	36	the	the	DT
cord-269150-d1sgnxc0	29	37	3	3	CD
cord-269150-d1sgnxc0	29	38	0	0	CD
cord-269150-d1sgnxc0	29	39	-UTR	-utr	NN
cord-269150-d1sgnxc0	29	40	of	of	IN
cord-269150-d1sgnxc0	29	41	alphacoronavirus	alphacoronavirus	NNP
cord-269150-d1sgnxc0	29	42	TGEV	TGEV	NNP
cord-269150-d1sgnxc0	29	43	(	(	-LRB-
cord-269150-d1sgnxc0	29	44	32	32	CD
cord-269150-d1sgnxc0	29	45	)	)	-RRB-
cord-269150-d1sgnxc0	29	46	.	.	.
cord-269150-d1sgnxc0	30	1	In	in	IN
cord-269150-d1sgnxc0	30	2	addition	addition	NN
cord-269150-d1sgnxc0	30	3	,	,	,
cord-269150-d1sgnxc0	30	4	interaction	interaction	NN
cord-269150-d1sgnxc0	30	5	of	of	IN
cord-269150-d1sgnxc0	30	6	viral	viral	JJ
cord-269150-d1sgnxc0	30	7	proteins	protein	NNS
cord-269150-d1sgnxc0	30	8	with	with	IN
cord-269150-d1sgnxc0	30	9	host	host	NN
cord-269150-d1sgnxc0	30	10	proteins	protein	NNS
cord-269150-d1sgnxc0	30	11	,	,	,
cord-269150-d1sgnxc0	30	12	such	such	JJ
cord-269150-d1sgnxc0	30	13	as	as	IN
cord-269150-d1sgnxc0	30	14	the	the	DT
cord-269150-d1sgnxc0	30	15	recently	recently	RB
cord-269150-d1sgnxc0	30	16	identified	identify	VBN
cord-269150-d1sgnxc0	30	17	interaction	interaction	NN
cord-269150-d1sgnxc0	30	18	between	between	IN
cord-269150-d1sgnxc0	30	19	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	30	20	nsp14	nsp14	NN
cord-269150-d1sgnxc0	30	21	and	and	CC
cord-269150-d1sgnxc0	30	22	DDX1	DDX1	NNP
cord-269150-d1sgnxc0	30	23	(	(	-LRB-
cord-269150-d1sgnxc0	30	24	33	33	CD
cord-269150-d1sgnxc0	30	25	)	)	-RRB-
cord-269150-d1sgnxc0	30	26	,	,	,
cord-269150-d1sgnxc0	30	27	may	may	MD
cord-269150-d1sgnxc0	30	28	also	also	RB
cord-269150-d1sgnxc0	30	29	play	play	VB
cord-269150-d1sgnxc0	30	30	important	important	JJ
cord-269150-d1sgnxc0	30	31	enhancement	enhancement	NN
cord-269150-d1sgnxc0	30	32	functions	function	NNS
cord-269150-d1sgnxc0	30	33	in	in	IN
cord-269150-d1sgnxc0	30	34	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	30	35	replication	replication	NN
cord-269150-d1sgnxc0	30	36	and	and	CC
cord-269150-d1sgnxc0	30	37	infection	infection	NN
cord-269150-d1sgnxc0	30	38	cycles	cycle	NNS
cord-269150-d1sgnxc0	30	39	.	.	.
cord-269150-d1sgnxc0	31	1	In	in	IN
cord-269150-d1sgnxc0	31	2	this	this	DT
cord-269150-d1sgnxc0	31	3	study	study	NN
cord-269150-d1sgnxc0	31	4	,	,	,
cord-269150-d1sgnxc0	31	5	we	-PRON-	PRP
cord-269150-d1sgnxc0	31	6	describe	describe	VBP
cord-269150-d1sgnxc0	31	7	the	the	DT
cord-269150-d1sgnxc0	31	8	interaction	interaction	NN
cord-269150-d1sgnxc0	31	9	of	of	IN
cord-269150-d1sgnxc0	31	10	a	a	DT
cord-269150-d1sgnxc0	31	11	cellular	cellular	JJ
cord-269150-d1sgnxc0	31	12	protein	protein	NN
cord-269150-d1sgnxc0	31	13	,	,	,
cord-269150-d1sgnxc0	31	14	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	31	15	(	(	-LRB-
cord-269150-d1sgnxc0	31	16	zinc	zinc	NN
cord-269150-d1sgnxc0	31	17	finger	finger	NN
cord-269150-d1sgnxc0	31	18	CCHC	CCHC	NNP
cord-269150-d1sgnxc0	31	19	-	-	HYPH
cord-269150-d1sgnxc0	31	20	type	type	NN
cord-269150-d1sgnxc0	31	21	and	and	CC
cord-269150-d1sgnxc0	31	22	RNA	RNA	NNP
cord-269150-d1sgnxc0	31	23	binding	bind	VBG
cord-269150-d1sgnxc0	31	24	motif	motif	NN
cord-269150-d1sgnxc0	31	25	1	1	CD
cord-269150-d1sgnxc0	31	26	)	)	-RRB-
cord-269150-d1sgnxc0	31	27	with	with	IN
cord-269150-d1sgnxc0	31	28	the	the	DT
cord-269150-d1sgnxc0	31	29	5	5	CD
cord-269150-d1sgnxc0	31	30	0	0	CD
cord-269150-d1sgnxc0	31	31	-UTR	-utr	NN
cord-269150-d1sgnxc0	31	32	of	of	IN
cord-269150-d1sgnxc0	31	33	IBV	IBV	NNP
cord-269150-d1sgnxc0	31	34	and	and	CC
cord-269150-d1sgnxc0	31	35	SARS	SARS	NNP
cord-269150-d1sgnxc0	31	36	-	-	HYPH
cord-269150-d1sgnxc0	31	37	CoV	CoV	NNP
cord-269150-d1sgnxc0	31	38	,	,	,
cord-269150-d1sgnxc0	31	39	using	use	VBG
cord-269150-d1sgnxc0	31	40	yeast	yeast	NN
cord-269150-d1sgnxc0	31	41	-	-	HYPH
cord-269150-d1sgnxc0	31	42	based	base	VBN
cord-269150-d1sgnxc0	31	43	three	three	CD
cord-269150-d1sgnxc0	31	44	hybrid	hybrid	NN
cord-269150-d1sgnxc0	31	45	screen	screen	NN
cord-269150-d1sgnxc0	31	46	(	(	-LRB-
cord-269150-d1sgnxc0	31	47	34	34	CD
cord-269150-d1sgnxc0	31	48	)	)	-RRB-
cord-269150-d1sgnxc0	31	49	and	and	CC
cord-269150-d1sgnxc0	31	50	RNA	RNA	NNP
cord-269150-d1sgnxc0	31	51	-	-	HYPH
cord-269150-d1sgnxc0	31	52	binding	bind	VBG
cord-269150-d1sgnxc0	31	53	assays	assay	NNS
cord-269150-d1sgnxc0	31	54	.	.	.
cord-269150-d1sgnxc0	32	1	Subsequently	subsequently	RB
cord-269150-d1sgnxc0	32	2	,	,	,
cord-269150-d1sgnxc0	32	3	the	the	DT
cord-269150-d1sgnxc0	32	4	RNA	RNA	NNP
cord-269150-d1sgnxc0	32	5	-	-	HYPH
cord-269150-d1sgnxc0	32	6	binding	bind	VBG
cord-269150-d1sgnxc0	32	7	domain	domain	NN
cord-269150-d1sgnxc0	32	8	of	of	IN
cord-269150-d1sgnxc0	32	9	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	32	10	and	and	CC
cord-269150-d1sgnxc0	32	11	the	the	DT
cord-269150-d1sgnxc0	32	12	RNA	RNA	NNP
cord-269150-d1sgnxc0	32	13	secondary	secondary	JJ
cord-269150-d1sgnxc0	32	14	structure	structure	NN
cord-269150-d1sgnxc0	32	15	responsible	responsible	JJ
cord-269150-d1sgnxc0	32	16	for	for	IN
cord-269150-d1sgnxc0	32	17	the	the	DT
cord-269150-d1sgnxc0	32	18	interaction	interaction	NN
cord-269150-d1sgnxc0	32	19	were	be	VBD
cord-269150-d1sgnxc0	32	20	mapped	map	VBN
cord-269150-d1sgnxc0	32	21	and	and	CC
cord-269150-d1sgnxc0	32	22	defined	define	VBN
cord-269150-d1sgnxc0	32	23	.	.	.
cord-269150-d1sgnxc0	33	1	Using	use	VBG
cord-269150-d1sgnxc0	33	2	indirect	indirect	JJ
cord-269150-d1sgnxc0	33	3	immunofluorescence	immunofluorescence	NN
cord-269150-d1sgnxc0	33	4	,	,	,
cord-269150-d1sgnxc0	33	5	we	-PRON-	PRP
cord-269150-d1sgnxc0	33	6	confirmed	confirm	VBD
cord-269150-d1sgnxc0	33	7	that	that	IN
cord-269150-d1sgnxc0	33	8	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	33	9	,	,	,
cord-269150-d1sgnxc0	33	10	despite	despite	IN
cord-269150-d1sgnxc0	33	11	being	be	VBG
cord-269150-d1sgnxc0	33	12	reported	report	VBN
cord-269150-d1sgnxc0	33	13	as	as	IN
cord-269150-d1sgnxc0	33	14	a	a	DT
cord-269150-d1sgnxc0	33	15	nuclear	nuclear	JJ
cord-269150-d1sgnxc0	33	16	protein	protein	NN
cord-269150-d1sgnxc0	33	17	(	(	-LRB-
cord-269150-d1sgnxc0	33	18	35	35	CD
cord-269150-d1sgnxc0	33	19	)	)	-RRB-
cord-269150-d1sgnxc0	33	20	,	,	,
cord-269150-d1sgnxc0	33	21	was	be	VBD
cord-269150-d1sgnxc0	33	22	detected	detect	VBN
cord-269150-d1sgnxc0	33	23	in	in	IN
cord-269150-d1sgnxc0	33	24	the	the	DT
cord-269150-d1sgnxc0	33	25	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	33	26	of	of	IN
cord-269150-d1sgnxc0	33	27	virus	virus	NN
cord-269150-d1sgnxc0	33	28	-	-	HYPH
cord-269150-d1sgnxc0	33	29	infected	infect	VBN
cord-269150-d1sgnxc0	33	30	cells	cell	NNS
cord-269150-d1sgnxc0	33	31	and	and	CC
cord-269150-d1sgnxc0	33	32	partially	partially	RB
cord-269150-d1sgnxc0	33	33	co	co	VBD
cord-269150-d1sgnxc0	33	34	-	-	VBN
cord-269150-d1sgnxc0	33	35	localized	localize	VBN
cord-269150-d1sgnxc0	33	36	with	with	IN
cord-269150-d1sgnxc0	33	37	the	the	DT
cord-269150-d1sgnxc0	33	38	RTCs	rtc	NNS
cord-269150-d1sgnxc0	33	39	.	.	.
cord-269150-d1sgnxc0	34	1	Upon	upon	IN
cord-269150-d1sgnxc0	34	2	silencing	silence	VBG
cord-269150-d1sgnxc0	34	3	of	of	IN
cord-269150-d1sgnxc0	34	4	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	34	5	using	use	VBG
cord-269150-d1sgnxc0	34	6	siRNA	siRNA	NNP
cord-269150-d1sgnxc0	34	7	,	,	,
cord-269150-d1sgnxc0	34	8	viral	viral	JJ
cord-269150-d1sgnxc0	34	9	RNA	RNA	NNP
cord-269150-d1sgnxc0	34	10	synthesis	synthesis	NN
cord-269150-d1sgnxc0	34	11	on	on	IN
cord-269150-d1sgnxc0	34	12	general	general	JJ
cord-269150-d1sgnxc0	34	13	has	have	VBZ
cord-269150-d1sgnxc0	34	14	been	be	VBN
cord-269150-d1sgnxc0	34	15	affected	affect	VBN
cord-269150-d1sgnxc0	34	16	,	,	,
cord-269150-d1sgnxc0	34	17	resulting	result	VBG
cord-269150-d1sgnxc0	34	18	in	in	IN
cord-269150-d1sgnxc0	34	19	a	a	DT
cord-269150-d1sgnxc0	34	20	lower	low	JJR
cord-269150-d1sgnxc0	34	21	replication	replication	NN
cord-269150-d1sgnxc0	34	22	efficiency	efficiency	NN
cord-269150-d1sgnxc0	34	23	and	and	CC
cord-269150-d1sgnxc0	34	24	infectivity	infectivity	NN
cord-269150-d1sgnxc0	34	25	.	.	.
cord-269150-d1sgnxc0	35	1	All	all	DT
cord-269150-d1sgnxc0	35	2	wild	wild	JJ
cord-269150-d1sgnxc0	35	3	-	-	HYPH
cord-269150-d1sgnxc0	35	4	type	type	NN
cord-269150-d1sgnxc0	35	5	and	and	CC
cord-269150-d1sgnxc0	35	6	mutant	mutant	JJ
cord-269150-d1sgnxc0	35	7	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	35	8	expressing	express	VBG
cord-269150-d1sgnxc0	35	9	constructs	construct	NNS
cord-269150-d1sgnxc0	35	10	were	be	VBD
cord-269150-d1sgnxc0	35	11	based	base	VBN
cord-269150-d1sgnxc0	35	12	on	on	IN
cord-269150-d1sgnxc0	35	13	the	the	DT
cord-269150-d1sgnxc0	35	14	vector	vector	NN
cord-269150-d1sgnxc0	35	15	pXJ40Flag	pXJ40Flag	NNP
cord-269150-d1sgnxc0	35	16	which	which	WDT
cord-269150-d1sgnxc0	35	17	contains	contain	VBZ
cord-269150-d1sgnxc0	35	18	both	both	CC
cord-269150-d1sgnxc0	35	19	the	the	DT
cord-269150-d1sgnxc0	35	20	CMV	CMV	NNP
cord-269150-d1sgnxc0	35	21	and	and	CC
cord-269150-d1sgnxc0	35	22	T7	T7	NNP
cord-269150-d1sgnxc0	35	23	promoter	promoter	NN
cord-269150-d1sgnxc0	35	24	and	and	CC
cord-269150-d1sgnxc0	35	25	all	all	DT
cord-269150-d1sgnxc0	35	26	expressed	express	VBN
cord-269150-d1sgnxc0	35	27	proteins	protein	NNS
cord-269150-d1sgnxc0	35	28	were	be	VBD
cord-269150-d1sgnxc0	35	29	N	n	NN
cord-269150-d1sgnxc0	35	30	-	-	HYPH
cord-269150-d1sgnxc0	35	31	terminally	terminally	RB
cord-269150-d1sgnxc0	35	32	tagged	tag	VBN
cord-269150-d1sgnxc0	35	33	with	with	IN
cord-269150-d1sgnxc0	35	34	the	the	DT
cord-269150-d1sgnxc0	35	35	Flag	Flag	NNP
cord-269150-d1sgnxc0	35	36	epitope	epitope	NN
cord-269150-d1sgnxc0	35	37	.	.	.
cord-269150-d1sgnxc0	36	1	For	for	IN
cord-269150-d1sgnxc0	36	2	the	the	DT
cord-269150-d1sgnxc0	36	3	over	over	JJ
cord-269150-d1sgnxc0	36	4	-	-	HYPH
cord-269150-d1sgnxc0	36	5	expression	expression	NN
cord-269150-d1sgnxc0	36	6	of	of	IN
cord-269150-d1sgnxc0	36	7	the	the	DT
cord-269150-d1sgnxc0	36	8	wild	wild	JJ
cord-269150-d1sgnxc0	36	9	-	-	HYPH
cord-269150-d1sgnxc0	36	10	type	type	NN
cord-269150-d1sgnxc0	36	11	and	and	CC
cord-269150-d1sgnxc0	36	12	mutant	mutant	JJ
cord-269150-d1sgnxc0	36	13	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	36	14	proteins	protein	NNS
cord-269150-d1sgnxc0	36	15	,	,	,
cord-269150-d1sgnxc0	36	16	H1299	H1299	NNP
cord-269150-d1sgnxc0	36	17	cells	cell	NNS
cord-269150-d1sgnxc0	36	18	grown	grow	VBN
cord-269150-d1sgnxc0	36	19	to	to	IN
cord-269150-d1sgnxc0	36	20	100	100	CD
cord-269150-d1sgnxc0	36	21	%	%	NN
cord-269150-d1sgnxc0	36	22	confluency	confluency	NN
cord-269150-d1sgnxc0	36	23	were	be	VBD
cord-269150-d1sgnxc0	36	24	infected	infect	VBN
cord-269150-d1sgnxc0	36	25	with	with	IN
cord-269150-d1sgnxc0	36	26	recombinant	recombinant	JJ
cord-269150-d1sgnxc0	36	27	Vaccinia	vaccinia	NN
cord-269150-d1sgnxc0	36	28	-	-	HYPH
cord-269150-d1sgnxc0	36	29	T7	t7	NN
cord-269150-d1sgnxc0	36	30	virus	virus	NN
cord-269150-d1sgnxc0	36	31	for	for	IN
cord-269150-d1sgnxc0	36	32	2	2	CD
cord-269150-d1sgnxc0	36	33	h	h	NN
cord-269150-d1sgnxc0	36	34	(	(	-LRB-
cord-269150-d1sgnxc0	36	35	h	h	NNP
cord-269150-d1sgnxc0	36	36	)	)	-RRB-
cord-269150-d1sgnxc0	36	37	,	,	,
cord-269150-d1sgnxc0	36	38	and	and	CC
cord-269150-d1sgnxc0	36	39	the	the	DT
cord-269150-d1sgnxc0	36	40	constructs	construct	NNS
cord-269150-d1sgnxc0	36	41	were	be	VBD
cord-269150-d1sgnxc0	36	42	transfected	transfecte	VBN
cord-269150-d1sgnxc0	36	43	into	into	IN
cord-269150-d1sgnxc0	36	44	the	the	DT
cord-269150-d1sgnxc0	36	45	infected	infected	JJ
cord-269150-d1sgnxc0	36	46	cells	cell	NNS
cord-269150-d1sgnxc0	36	47	using	use	VBG
cord-269150-d1sgnxc0	36	48	Effectene	Effectene	NNP
cord-269150-d1sgnxc0	36	49	Transfection	Transfection	NNP
cord-269150-d1sgnxc0	36	50	Reagent	Reagent	NNP
cord-269150-d1sgnxc0	36	51	(	(	-LRB-
cord-269150-d1sgnxc0	36	52	Qiagen	Qiagen	NNP
cord-269150-d1sgnxc0	36	53	)	)	-RRB-
cord-269150-d1sgnxc0	36	54	.	.	.
cord-269150-d1sgnxc0	37	1	Cells	cell	NNS
cord-269150-d1sgnxc0	37	2	were	be	VBD
cord-269150-d1sgnxc0	37	3	lysed	lyse	VBN
cord-269150-d1sgnxc0	37	4	with	with	IN
cord-269150-d1sgnxc0	37	5	lysis	lysis	NN
cord-269150-d1sgnxc0	37	6	buffer	buffer	NN
cord-269150-d1sgnxc0	37	7	[	[	-LRB-
cord-269150-d1sgnxc0	37	8	140	140	CD
cord-269150-d1sgnxc0	37	9	mM	mm	CD
cord-269150-d1sgnxc0	37	10	NaCl	nacl	NN
cord-269150-d1sgnxc0	37	11	,	,	,
cord-269150-d1sgnxc0	37	12	10	10	CD
cord-269150-d1sgnxc0	37	13	mM	mm	CD
cord-269150-d1sgnxc0	37	14	Tris	Tris	NNP
cord-269150-d1sgnxc0	37	15	(	(	-LRB-
cord-269150-d1sgnxc0	37	16	pH	pH	NNP
cord-269150-d1sgnxc0	37	17	8.0	8.0	CD
cord-269150-d1sgnxc0	37	18	)	)	-RRB-
cord-269150-d1sgnxc0	37	19	,	,	,
cord-269150-d1sgnxc0	37	20	1	1	CD
cord-269150-d1sgnxc0	37	21	%	%	NN
cord-269150-d1sgnxc0	37	22	NP-40	NP-40	NNP
cord-269150-d1sgnxc0	37	23	]	]	-RRB-
cord-269150-d1sgnxc0	38	1	22	22	CD
cord-269150-d1sgnxc0	38	2	h	h	NN
cord-269150-d1sgnxc0	38	3	post	post	NN
cord-269150-d1sgnxc0	38	4	-	-	NN
cord-269150-d1sgnxc0	38	5	transfection	transfection	NN
cord-269150-d1sgnxc0	38	6	.	.	.
cord-269150-d1sgnxc0	39	1	Template	template	NN
cord-269150-d1sgnxc0	39	2	DNA	DNA	NNP
cord-269150-d1sgnxc0	39	3	was	be	VBD
cord-269150-d1sgnxc0	39	4	amplified	amplify	VBN
cord-269150-d1sgnxc0	39	5	from	from	IN
cord-269150-d1sgnxc0	39	6	plasmid	plasmid	NN
cord-269150-d1sgnxc0	39	7	DNA	dna	NN
cord-269150-d1sgnxc0	39	8	encoding	encode	VBG
cord-269150-d1sgnxc0	39	9	the	the	DT
cord-269150-d1sgnxc0	39	10	5	5	CD
cord-269150-d1sgnxc0	39	11	0	0	CD
cord-269150-d1sgnxc0	39	12	end	end	NN
cord-269150-d1sgnxc0	39	13	of	of	IN
cord-269150-d1sgnxc0	39	14	IBV	IBV	NNP
cord-269150-d1sgnxc0	39	15	genome	genome	NN
cord-269150-d1sgnxc0	39	16	with	with	IN
cord-269150-d1sgnxc0	39	17	various	various	JJ
cord-269150-d1sgnxc0	39	18	sets	set	NNS
cord-269150-d1sgnxc0	39	19	of	of	IN
cord-269150-d1sgnxc0	39	20	primers	primer	NNS
cord-269150-d1sgnxc0	39	21	targeting	target	VBG
cord-269150-d1sgnxc0	39	22	different	different	JJ
cord-269150-d1sgnxc0	39	23	regions	region	NNS
cord-269150-d1sgnxc0	39	24	of	of	IN
cord-269150-d1sgnxc0	39	25	the	the	DT
cord-269150-d1sgnxc0	39	26	5	5	CD
cord-269150-d1sgnxc0	39	27	0	0	CD
cord-269150-d1sgnxc0	39	28	-UTR	-UTR	.
cord-269150-d1sgnxc0	40	1	(	(	-LRB-
cord-269150-d1sgnxc0	40	2	Tables	table	NNS
cord-269150-d1sgnxc0	40	3	1	1	CD
cord-269150-d1sgnxc0	40	4	 	 	_SP
cord-269150-d1sgnxc0	40	5	and	and	CC
cord-269150-d1sgnxc0	40	6	2	2	CD
cord-269150-d1sgnxc0	40	7	)	)	-RRB-
cord-269150-d1sgnxc0	40	8	,	,	,
cord-269150-d1sgnxc0	40	9	with	with	IN
cord-269150-d1sgnxc0	40	10	the	the	DT
cord-269150-d1sgnxc0	40	11	sense	sense	NN
cord-269150-d1sgnxc0	40	12	primers	primer	NNS
cord-269150-d1sgnxc0	40	13	containing	contain	VBG
cord-269150-d1sgnxc0	40	14	the	the	DT
cord-269150-d1sgnxc0	40	15	T7	T7	NNP
cord-269150-d1sgnxc0	40	16	promoter	promoter	NN
cord-269150-d1sgnxc0	40	17	sequence	sequence	NN
cord-269150-d1sgnxc0	40	18	(	(	-LRB-
cord-269150-d1sgnxc0	40	19	36	36	CD
cord-269150-d1sgnxc0	40	20	)	)	-RRB-
cord-269150-d1sgnxc0	40	21	.	.	.
cord-269150-d1sgnxc0	41	1	Biotinylated	Biotinylated	NNP
cord-269150-d1sgnxc0	41	2	RNAs	rna	NNS
cord-269150-d1sgnxc0	41	3	were	be	VBD
cord-269150-d1sgnxc0	41	4	in	in	IN
cord-269150-d1sgnxc0	41	5	vitro	vitro	FW
cord-269150-d1sgnxc0	41	6	transcribed	transcribe	VBN
cord-269150-d1sgnxc0	41	7	with	with	IN
cord-269150-d1sgnxc0	41	8	T7	T7	NNP
cord-269150-d1sgnxc0	41	9	RNA	RNA	NNP
cord-269150-d1sgnxc0	41	10	polymerase	polymerase	NN
cord-269150-d1sgnxc0	41	11	(	(	-LRB-
cord-269150-d1sgnxc0	41	12	Roche	Roche	NNP
cord-269150-d1sgnxc0	41	13	Applied	Applied	NNP
cord-269150-d1sgnxc0	41	14	Science	Science	NNP
cord-269150-d1sgnxc0	41	15	)	)	-RRB-
cord-269150-d1sgnxc0	41	16	in	in	IN
cord-269150-d1sgnxc0	41	17	the	the	DT
cord-269150-d1sgnxc0	41	18	presence	presence	NN
cord-269150-d1sgnxc0	41	19	of	of	IN
cord-269150-d1sgnxc0	41	20	Biotin	Biotin	NNP
cord-269150-d1sgnxc0	41	21	RNA	RNA	NNP
cord-269150-d1sgnxc0	41	22	Labeling	Labeling	NNP
cord-269150-d1sgnxc0	41	23	Mix	Mix	NNP
cord-269150-d1sgnxc0	41	24	(	(	-LRB-
cord-269150-d1sgnxc0	41	25	Roche	Roche	NNP
cord-269150-d1sgnxc0	41	26	Applied	Applied	NNP
cord-269150-d1sgnxc0	41	27	Science	Science	NNP
cord-269150-d1sgnxc0	41	28	)	)	-RRB-
cord-269150-d1sgnxc0	41	29	at	at	IN
cord-269150-d1sgnxc0	41	30	37	37	CD
cord-269150-d1sgnxc0	41	31	C	c	NN
cord-269150-d1sgnxc0	41	32	for	for	IN
cord-269150-d1sgnxc0	41	33	2	2	CD
cord-269150-d1sgnxc0	41	34	h.	h.	NNP
cord-269150-d1sgnxc0	41	35	Template	template	NN
cord-269150-d1sgnxc0	41	36	DNAs	dna	NNS
cord-269150-d1sgnxc0	41	37	were	be	VBD
cord-269150-d1sgnxc0	41	38	removed	remove	VBN
cord-269150-d1sgnxc0	41	39	by	by	IN
cord-269150-d1sgnxc0	41	40	digestion	digestion	NN
cord-269150-d1sgnxc0	41	41	with	with	IN
cord-269150-d1sgnxc0	41	42	RNase	rnase	NN
cord-269150-d1sgnxc0	41	43	-	-	HYPH
cord-269150-d1sgnxc0	41	44	free	free	JJ
cord-269150-d1sgnxc0	42	1	DNase	DNase	NNP
cord-269150-d1sgnxc0	42	2	I	-PRON-	PRP
cord-269150-d1sgnxc0	43	1	(	(	-LRB-
cord-269150-d1sgnxc0	43	2	Roche	Roche	NNP
cord-269150-d1sgnxc0	43	3	Applied	Applied	NNP
cord-269150-d1sgnxc0	43	4	Science	Science	NNP
cord-269150-d1sgnxc0	43	5	)	)	-RRB-
cord-269150-d1sgnxc0	43	6	and	and	CC
cord-269150-d1sgnxc0	43	7	the	the	DT
cord-269150-d1sgnxc0	43	8	labeled	label	VBN
cord-269150-d1sgnxc0	43	9	RNAs	rna	NNS
cord-269150-d1sgnxc0	43	10	purified	purify	VBN
cord-269150-d1sgnxc0	43	11	with	with	IN
cord-269150-d1sgnxc0	43	12	UltraPure	UltraPure	NNP
cord-269150-d1sgnxc0	43	13	Phenol	Phenol	NNP
cord-269150-d1sgnxc0	43	14	:	:	:
cord-269150-d1sgnxc0	43	15	Chloroform	chloroform	NN
cord-269150-d1sgnxc0	43	16	:	:	:
cord-269150-d1sgnxc0	43	17	Isoamyl	Isoamyl	NNP
cord-269150-d1sgnxc0	43	18	Alcohol	Alcohol	NNP
cord-269150-d1sgnxc0	43	19	(	(	-LRB-
cord-269150-d1sgnxc0	43	20	Invitrogen	Invitrogen	NNP
cord-269150-d1sgnxc0	43	21	)	)	-RRB-
cord-269150-d1sgnxc0	44	1	then	then	RB
cord-269150-d1sgnxc0	44	2	solubilized	solubilize	VBN
cord-269150-d1sgnxc0	44	3	in	in	IN
cord-269150-d1sgnxc0	44	4	nuclease	nuclease	NN
cord-269150-d1sgnxc0	44	5	-	-	HYPH
cord-269150-d1sgnxc0	44	6	free	free	JJ
cord-269150-d1sgnxc0	44	7	water	water	NN
cord-269150-d1sgnxc0	44	8	.	.	.
cord-269150-d1sgnxc0	45	1	Biotinylated	Biotinylated	NNP
cord-269150-d1sgnxc0	45	2	RNA	RNA	NNP
cord-269150-d1sgnxc0	45	3	at	at	IN
cord-269150-d1sgnxc0	45	4	0.1	0.1	CD
cord-269150-d1sgnxc0	45	5	mM	mm	CD
cord-269150-d1sgnxc0	45	6	was	be	VBD
cord-269150-d1sgnxc0	45	7	incubated	incubate	VBN
cord-269150-d1sgnxc0	45	8	with	with	IN
cord-269150-d1sgnxc0	45	9	cell	cell	NN
cord-269150-d1sgnxc0	45	10	lysates	lysate	NNS
cord-269150-d1sgnxc0	45	11	over	over	RB
cord-269150-d1sgnxc0	45	12	-	-	HYPH
cord-269150-d1sgnxc0	45	13	expressing	express	VBG
cord-269150-d1sgnxc0	45	14	EGFP	EGFP	NNP
cord-269150-d1sgnxc0	45	15	,	,	,
cord-269150-d1sgnxc0	45	16	Flag	Flag	NNP
cord-269150-d1sgnxc0	45	17	-	-	HYPH
cord-269150-d1sgnxc0	45	18	tagged	tagged	NNP
cord-269150-d1sgnxc0	45	19	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	45	20	or	or	CC
cord-269150-d1sgnxc0	45	21	its	-PRON-	PRP$
cord-269150-d1sgnxc0	45	22	mutant	mutant	JJ
cord-269150-d1sgnxc0	45	23	proteins	protein	NNS
cord-269150-d1sgnxc0	45	24	,	,	,
cord-269150-d1sgnxc0	45	25	respectively	respectively	RB
cord-269150-d1sgnxc0	45	26	,	,	,
cord-269150-d1sgnxc0	45	27	in	in	IN
cord-269150-d1sgnxc0	45	28	the	the	DT
cord-269150-d1sgnxc0	45	29	presence	presence	NN
cord-269150-d1sgnxc0	45	30	of	of	IN
cord-269150-d1sgnxc0	45	31	10	10	CD
cord-269150-d1sgnxc0	45	32	mM	mm	CD
cord-269150-d1sgnxc0	45	33	dithiothreitol	dithiothreitol	NN
cord-269150-d1sgnxc0	45	34	(	(	-LRB-
cord-269150-d1sgnxc0	45	35	DTT	DTT	NNP
cord-269150-d1sgnxc0	45	36	)	)	-RRB-
cord-269150-d1sgnxc0	45	37	,	,	.
cord-269150-d1sgnxc0	46	1	100	100	CD
cord-269150-d1sgnxc0	46	2	mg	mg	NNP
cord-269150-d1sgnxc0	46	3	/	/	SYM
cord-269150-d1sgnxc0	46	4	ml	ml	NNS
cord-269150-d1sgnxc0	46	5	yeast	yeast	NN
cord-269150-d1sgnxc0	46	6	tRNA	tRNA	NNP
cord-269150-d1sgnxc0	46	7	(	(	-LRB-
cord-269150-d1sgnxc0	46	8	Ambion	Ambion	NNP
cord-269150-d1sgnxc0	46	9	)	)	-RRB-
cord-269150-d1sgnxc0	46	10	and	and	CC
cord-269150-d1sgnxc0	46	11	1	1	CD
cord-269150-d1sgnxc0	46	12	U	u	NN
cord-269150-d1sgnxc0	46	13	/	/	SYM
cord-269150-d1sgnxc0	46	14	ml	ml	NN
cord-269150-d1sgnxc0	46	15	Protector	Protector	NNP
cord-269150-d1sgnxc0	46	16	RNase	RNase	NNP
cord-269150-d1sgnxc0	46	17	Inhibitor	Inhibitor	NNP
cord-269150-d1sgnxc0	46	18	(	(	-LRB-
cord-269150-d1sgnxc0	46	19	Roche	Roche	NNP
cord-269150-d1sgnxc0	46	20	Applied	Applied	NNP
cord-269150-d1sgnxc0	46	21	Science	Science	NNP
cord-269150-d1sgnxc0	46	22	)	)	-RRB-
cord-269150-d1sgnxc0	46	23	in	in	IN
cord-269150-d1sgnxc0	46	24	a	a	DT
cord-269150-d1sgnxc0	46	25	final	final	JJ
cord-269150-d1sgnxc0	46	26	volume	volume	NN
cord-269150-d1sgnxc0	46	27	of	of	IN
cord-269150-d1sgnxc0	46	28	200	200	CD
cord-269150-d1sgnxc0	46	29	ml	ml	NNS
cord-269150-d1sgnxc0	46	30	at	at	IN
cord-269150-d1sgnxc0	46	31	room	room	NN
cord-269150-d1sgnxc0	46	32	temperature	temperature	NN
cord-269150-d1sgnxc0	46	33	for	for	IN
cord-269150-d1sgnxc0	46	34	30	30	CD
cord-269150-d1sgnxc0	46	35	min	min	NN
cord-269150-d1sgnxc0	46	36	.	.	.
cord-269150-d1sgnxc0	47	1	The	the	DT
cord-269150-d1sgnxc0	47	2	mixtures	mixture	NNS
cord-269150-d1sgnxc0	47	3	were	be	VBD
cord-269150-d1sgnxc0	47	4	incubated	incubate	VBN
cord-269150-d1sgnxc0	47	5	with	with	IN
cord-269150-d1sgnxc0	47	6	40	40	CD
cord-269150-d1sgnxc0	47	7	ml	ml	NNS
cord-269150-d1sgnxc0	47	8	(	(	-LRB-
cord-269150-d1sgnxc0	47	9	50	50	CD
cord-269150-d1sgnxc0	47	10	%	%	NN
cord-269150-d1sgnxc0	47	11	slurry	slurry	NN
cord-269150-d1sgnxc0	47	12	)	)	-RRB-
cord-269150-d1sgnxc0	47	13	of	of	IN
cord-269150-d1sgnxc0	47	14	streptavidin	streptavidin	NNS
cord-269150-d1sgnxc0	47	15	agarose	agarose	VBD
cord-269150-d1sgnxc0	47	16	beads	bead	NNS
cord-269150-d1sgnxc0	47	17	(	(	-LRB-
cord-269150-d1sgnxc0	47	18	Sigma	Sigma	NNP
cord-269150-d1sgnxc0	47	19	Aldrich	Aldrich	NNP
cord-269150-d1sgnxc0	47	20	)	)	-RRB-
cord-269150-d1sgnxc0	47	21	at	at	IN
cord-269150-d1sgnxc0	47	22	room	room	NN
cord-269150-d1sgnxc0	47	23	temperature	temperature	NN
cord-269150-d1sgnxc0	47	24	for	for	IN
cord-269150-d1sgnxc0	47	25	30	30	CD
cord-269150-d1sgnxc0	47	26	min	min	NN
cord-269150-d1sgnxc0	47	27	.	.	.
cord-269150-d1sgnxc0	48	1	The	the	DT
cord-269150-d1sgnxc0	48	2	beads	bead	NNS
cord-269150-d1sgnxc0	48	3	were	be	VBD
cord-269150-d1sgnxc0	48	4	collected	collect	VBN
cord-269150-d1sgnxc0	48	5	by	by	IN
cord-269150-d1sgnxc0	48	6	centrifugation	centrifugation	NN
cord-269150-d1sgnxc0	48	7	and	and	CC
cord-269150-d1sgnxc0	48	8	washed	wash	VBD
cord-269150-d1sgnxc0	48	9	three	three	CD
cord-269150-d1sgnxc0	48	10	times	time	NNS
cord-269150-d1sgnxc0	48	11	with	with	IN
cord-269150-d1sgnxc0	48	12	RNase	rnase	NN
cord-269150-d1sgnxc0	48	13	P	p	NN
cord-269150-d1sgnxc0	48	14	(	(	-LRB-
cord-269150-d1sgnxc0	48	15	RP	rp	NN
cord-269150-d1sgnxc0	48	16	)	)	-RRB-
cord-269150-d1sgnxc0	48	17	buffer	buffer	NN
cord-269150-d1sgnxc0	48	18	(	(	-LRB-
cord-269150-d1sgnxc0	48	19	50	50	CD
cord-269150-d1sgnxc0	48	20	mM	mm	CD
cord-269150-d1sgnxc0	48	21	KCl	KCl	NNS
cord-269150-d1sgnxc0	48	22	,	,	,
cord-269150-d1sgnxc0	48	23	1	1	CD
cord-269150-d1sgnxc0	48	24	mM	mm	CD
cord-269150-d1sgnxc0	48	25	MgCl	MgCl	NNP
cord-269150-d1sgnxc0	48	26	2	2	CD
cord-269150-d1sgnxc0	48	27	,	,	,
cord-269150-d1sgnxc0	48	28	10	10	CD
cord-269150-d1sgnxc0	48	29	mM	mm	CD
cord-269150-d1sgnxc0	48	30	HEPES	HEPES	NNP
cord-269150-d1sgnxc0	48	31	,	,	,
cord-269150-d1sgnxc0	48	32	pH	pH	NNP
cord-269150-d1sgnxc0	48	33	8.0	8.0	CD
cord-269150-d1sgnxc0	48	34	)	)	-RRB-
cord-269150-d1sgnxc0	48	35	,	,	,
cord-269150-d1sgnxc0	48	36	suspended	suspend	VBN
cord-269150-d1sgnxc0	48	37	in	in	IN
cord-269150-d1sgnxc0	48	38	25	25	CD
cord-269150-d1sgnxc0	48	39	ml	ml	NNS
cord-269150-d1sgnxc0	48	40	of	of	IN
cord-269150-d1sgnxc0	48	41	sodium	sodium	NN
cord-269150-d1sgnxc0	48	42	dodecyl	dodecyl	NNP
cord-269150-d1sgnxc0	48	43	sulfate	sulfate	NNP
cord-269150-d1sgnxc0	48	44	(	(	-LRB-
cord-269150-d1sgnxc0	48	45	SDS	SDS	NNP
cord-269150-d1sgnxc0	48	46	)	)	-RRB-
cord-269150-d1sgnxc0	48	47	sample	sample	NN
cord-269150-d1sgnxc0	48	48	buffer	buffer	NN
cord-269150-d1sgnxc0	48	49	with	with	IN
cord-269150-d1sgnxc0	48	50	100	100	CD
cord-269150-d1sgnxc0	48	51	mM	mm	CD
cord-269150-d1sgnxc0	48	52	DTT	DTT	NNP
cord-269150-d1sgnxc0	48	53	.	.	.
cord-269150-d1sgnxc0	49	1	Bound	bind	VBN
cord-269150-d1sgnxc0	49	2	proteins	protein	NNS
cord-269150-d1sgnxc0	49	3	were	be	VBD
cord-269150-d1sgnxc0	49	4	resolved	resolve	VBN
cord-269150-d1sgnxc0	49	5	by	by	IN
cord-269150-d1sgnxc0	49	6	SDS	SDS	NNP
cord-269150-d1sgnxc0	49	7	-	-	HYPH
cord-269150-d1sgnxc0	49	8	polyacrylamide	polyacrylamide	NN
cord-269150-d1sgnxc0	49	9	gel	gel	NN
cord-269150-d1sgnxc0	49	10	electrophoresis	electrophoresis	NN
cord-269150-d1sgnxc0	49	11	(	(	-LRB-
cord-269150-d1sgnxc0	49	12	SDS	SDS	NNP
cord-269150-d1sgnxc0	49	13	-	-	HYPH
cord-269150-d1sgnxc0	49	14	PAGE	PAGE	NNP
cord-269150-d1sgnxc0	49	15	)	)	-RRB-
cord-269150-d1sgnxc0	49	16	and	and	CC
cord-269150-d1sgnxc0	49	17	detected	detect	VBN
cord-269150-d1sgnxc0	49	18	with	with	IN
cord-269150-d1sgnxc0	49	19	appropriate	appropriate	JJ
cord-269150-d1sgnxc0	49	20	antibodies	antibody	NNS
cord-269150-d1sgnxc0	49	21	.	.	.
cord-269150-d1sgnxc0	50	1	African	african	JJ
cord-269150-d1sgnxc0	50	2	green	green	JJ
cord-269150-d1sgnxc0	50	3	monkey	monkey	NN
cord-269150-d1sgnxc0	50	4	kidney	kidney	NN
cord-269150-d1sgnxc0	50	5	cells	cell	NNS
cord-269150-d1sgnxc0	50	6	(	(	-LRB-
cord-269150-d1sgnxc0	50	7	Vero	Vero	NNP
cord-269150-d1sgnxc0	50	8	)	)	-RRB-
cord-269150-d1sgnxc0	50	9	grown	grow	VBN
cord-269150-d1sgnxc0	50	10	to	to	IN
cord-269150-d1sgnxc0	50	11	50	50	CD
cord-269150-d1sgnxc0	50	12	%	%	NN
cord-269150-d1sgnxc0	50	13	confluency	confluency	NN
cord-269150-d1sgnxc0	50	14	in	in	IN
cord-269150-d1sgnxc0	50	15	four	four	CD
cord-269150-d1sgnxc0	50	16	-	-	HYPH
cord-269150-d1sgnxc0	50	17	chamber	chamber	NN
cord-269150-d1sgnxc0	50	18	glass	glass	NN
cord-269150-d1sgnxc0	50	19	slides	slide	NNS
cord-269150-d1sgnxc0	50	20	were	be	VBD
cord-269150-d1sgnxc0	50	21	transfected	transfecte	VBN
cord-269150-d1sgnxc0	50	22	to	to	IN
cord-269150-d1sgnxc0	50	23	over	over	IN
cord-269150-d1sgnxc0	50	24	-	-	HYPH
cord-269150-d1sgnxc0	50	25	express	express	JJ
cord-269150-d1sgnxc0	50	26	Flag	Flag	NNP
cord-269150-d1sgnxc0	50	27	-	-	HYPH
cord-269150-d1sgnxc0	50	28	tagged	tagged	NNP
cord-269150-d1sgnxc0	50	29	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	50	30	or	or	CC
cord-269150-d1sgnxc0	50	31	vector	vector	NN
cord-269150-d1sgnxc0	50	32	control	control	NN
cord-269150-d1sgnxc0	50	33	using	use	VBG
cord-269150-d1sgnxc0	50	34	Effectene	Effectene	NNP
cord-269150-d1sgnxc0	50	35	for	for	IN
cord-269150-d1sgnxc0	50	36	16	16	CD
cord-269150-d1sgnxc0	50	37	h.	h.	NN
cord-269150-d1sgnxc0	50	38	Transfected	Transfected	NNP
cord-269150-d1sgnxc0	50	39	cells	cell	NNS
cord-269150-d1sgnxc0	50	40	were	be	VBD
cord-269150-d1sgnxc0	50	41	infected	infect	VBN
cord-269150-d1sgnxc0	50	42	with	with	IN
cord-269150-d1sgnxc0	50	43	wild	wild	JJ
cord-269150-d1sgnxc0	50	44	-	-	HYPH
cord-269150-d1sgnxc0	50	45	type	type	NN
cord-269150-d1sgnxc0	50	46	IBV	IBV	NNP
cord-269150-d1sgnxc0	50	47	or	or	CC
cord-269150-d1sgnxc0	50	48	mock	mock	NN
cord-269150-d1sgnxc0	50	49	-	-	HYPH
cord-269150-d1sgnxc0	50	50	infected	infect	VBN
cord-269150-d1sgnxc0	50	51	with	with	IN
cord-269150-d1sgnxc0	50	52	Vero	Vero	NNP
cord-269150-d1sgnxc0	50	53	cell	cell	NN
cord-269150-d1sgnxc0	50	54	lysate	lysate	NN
cord-269150-d1sgnxc0	50	55	(	(	-LRB-
cord-269150-d1sgnxc0	50	56	Vero	Vero	NNP
cord-269150-d1sgnxc0	50	57	cells	cell	NNS
cord-269150-d1sgnxc0	50	58	with	with	IN
cord-269150-d1sgnxc0	50	59	serum	serum	NN
cord-269150-d1sgnxc0	50	60	-	-	HYPH
cord-269150-d1sgnxc0	50	61	free	free	JJ
cord-269150-d1sgnxc0	50	62	medium	medium	NN
cord-269150-d1sgnxc0	50	63	subjected	subject	VBN
cord-269150-d1sgnxc0	50	64	to	to	IN
cord-269150-d1sgnxc0	50	65	three	three	CD
cord-269150-d1sgnxc0	50	66	freeze	freeze	NN
cord-269150-d1sgnxc0	50	67	-	-	HYPH
cord-269150-d1sgnxc0	50	68	thaw	thaw	VB
cord-269150-d1sgnxc0	50	69	cycles	cycle	NNS
cord-269150-d1sgnxc0	50	70	at	at	IN
cord-269150-d1sgnxc0	50	71	minus	minus	NN
cord-269150-d1sgnxc0	50	72	80	80	CD
cord-269150-d1sgnxc0	50	73	C	c	NN
cord-269150-d1sgnxc0	50	74	and	and	CC
cord-269150-d1sgnxc0	50	75	room	room	NN
cord-269150-d1sgnxc0	50	76	temperature	temperature	NN
cord-269150-d1sgnxc0	50	77	,	,	,
cord-269150-d1sgnxc0	50	78	respectively	respectively	RB
cord-269150-d1sgnxc0	50	79	)	)	-RRB-
cord-269150-d1sgnxc0	50	80	for	for	IN
cord-269150-d1sgnxc0	50	81	1	1	CD
cord-269150-d1sgnxc0	50	82	h.	h.	NN
cord-269150-d1sgnxc0	50	83	Infection	infection	NN
cord-269150-d1sgnxc0	50	84	was	be	VBD
cord-269150-d1sgnxc0	50	85	allowed	allow	VBN
cord-269150-d1sgnxc0	50	86	to	to	TO
cord-269150-d1sgnxc0	50	87	progress	progress	VB
cord-269150-d1sgnxc0	50	88	for	for	IN
cord-269150-d1sgnxc0	50	89	2	2	CD
cord-269150-d1sgnxc0	50	90	h	h	NN
cord-269150-d1sgnxc0	50	91	after	after	IN
cord-269150-d1sgnxc0	50	92	virus	virus	NN
cord-269150-d1sgnxc0	50	93	removal	removal	NN
cord-269150-d1sgnxc0	50	94	and	and	CC
cord-269150-d1sgnxc0	50	95	the	the	DT
cord-269150-d1sgnxc0	50	96	cells	cell	NNS
cord-269150-d1sgnxc0	50	97	were	be	VBD
cord-269150-d1sgnxc0	50	98	treated	treat	VBN
cord-269150-d1sgnxc0	50	99	with	with	IN
cord-269150-d1sgnxc0	50	100	actinomycin	actinomycin	NNS
cord-269150-d1sgnxc0	50	101	D	D	NNP
cord-269150-d1sgnxc0	50	102	at	at	IN
cord-269150-d1sgnxc0	50	103	15	15	CD
cord-269150-d1sgnxc0	50	104	mg	mg	NNP
cord-269150-d1sgnxc0	50	105	/	/	SYM
cord-269150-d1sgnxc0	50	106	ml	ml	NNP
cord-269150-d1sgnxc0	50	107	(	(	-LRB-
cord-269150-d1sgnxc0	50	108	Sigma	Sigma	NNP
cord-269150-d1sgnxc0	50	109	Aldrich	Aldrich	NNP
cord-269150-d1sgnxc0	50	110	)	)	-RRB-
cord-269150-d1sgnxc0	50	111	for	for	IN
cord-269150-d1sgnxc0	50	112	4	4	CD
cord-269150-d1sgnxc0	50	113	h	h	NN
cord-269150-d1sgnxc0	50	114	;	;	:
cord-269150-d1sgnxc0	50	115	1	1	CD
cord-269150-d1sgnxc0	50	116	mM	mm	CD
cord-269150-d1sgnxc0	50	117	of	of	IN
cord-269150-d1sgnxc0	50	118	BrUTP	BrUTP	NNP
cord-269150-d1sgnxc0	51	1	(	(	-LRB-
cord-269150-d1sgnxc0	51	2	Sigma	Sigma	NNP
cord-269150-d1sgnxc0	51	3	Aldrich	Aldrich	NNP
cord-269150-d1sgnxc0	51	4	)	)	-RRB-
cord-269150-d1sgnxc0	51	5	was	be	VBD
cord-269150-d1sgnxc0	51	6	transfected	transfecte	VBN
cord-269150-d1sgnxc0	51	7	into	into	IN
cord-269150-d1sgnxc0	51	8	the	the	DT
cord-269150-d1sgnxc0	51	9	cells	cell	NNS
cord-269150-d1sgnxc0	51	10	with	with	IN
cord-269150-d1sgnxc0	51	11	SuperFECT	SuperFECT	NNS
cord-269150-d1sgnxc0	51	12	(	(	-LRB-
cord-269150-d1sgnxc0	51	13	Qiagen	Qiagen	NNP
cord-269150-d1sgnxc0	51	14	)	)	-RRB-
cord-269150-d1sgnxc0	51	15	for	for	IN
cord-269150-d1sgnxc0	51	16	3	3	CD
cord-269150-d1sgnxc0	51	17	h.	h.	NNP
cord-269150-d1sgnxc0	51	18	Cells	cell	NNS
cord-269150-d1sgnxc0	51	19	were	be	VBD
cord-269150-d1sgnxc0	51	20	fixed	fix	VBN
cord-269150-d1sgnxc0	51	21	at	at	IN
cord-269150-d1sgnxc0	51	22	10	10	CD
cord-269150-d1sgnxc0	51	23	h	h	NN
cord-269150-d1sgnxc0	51	24	post	post	NN
cord-269150-d1sgnxc0	51	25	-	-	NN
cord-269150-d1sgnxc0	51	26	infection	infection	NN
cord-269150-d1sgnxc0	51	27	with	with	IN
cord-269150-d1sgnxc0	51	28	4	4	CD
cord-269150-d1sgnxc0	51	29	%	%	NN
cord-269150-d1sgnxc0	51	30	paraformaldehyde	paraformaldehyde	NNP
cord-269150-d1sgnxc0	51	31	for	for	IN
cord-269150-d1sgnxc0	51	32	15	15	CD
cord-269150-d1sgnxc0	51	33	min	min	NN
cord-269150-d1sgnxc0	51	34	and	and	CC
cord-269150-d1sgnxc0	51	35	permeabilized	permeabilize	VBN
cord-269150-d1sgnxc0	51	36	with	with	IN
cord-269150-d1sgnxc0	51	37	0.2	0.2	CD
cord-269150-d1sgnxc0	51	38	%	%	NN
cord-269150-d1sgnxc0	51	39	Triton	Triton	NNP
cord-269150-d1sgnxc0	51	40	-	-	HYPH
cord-269150-d1sgnxc0	51	41	X	X	NNP
cord-269150-d1sgnxc0	51	42	100	100	CD
cord-269150-d1sgnxc0	51	43	for	for	IN
cord-269150-d1sgnxc0	51	44	10	10	CD
cord-269150-d1sgnxc0	51	45	min	min	NN
cord-269150-d1sgnxc0	51	46	.	.	.
cord-269150-d1sgnxc0	52	1	Treated	treat	VBN
cord-269150-d1sgnxc0	52	2	cells	cell	NNS
cord-269150-d1sgnxc0	52	3	were	be	VBD
cord-269150-d1sgnxc0	52	4	blocked	block	VBN
cord-269150-d1sgnxc0	52	5	in	in	IN
cord-269150-d1sgnxc0	52	6	10	10	CD
cord-269150-d1sgnxc0	52	7	%	%	NN
cord-269150-d1sgnxc0	52	8	goat	goat	NN
cord-269150-d1sgnxc0	52	9	serum	serum	NN
cord-269150-d1sgnxc0	52	10	,	,	,
cord-269150-d1sgnxc0	52	11	stained	stain	VBN
cord-269150-d1sgnxc0	52	12	with	with	IN
cord-269150-d1sgnxc0	52	13	primary	primary	JJ
cord-269150-d1sgnxc0	52	14	antibodies	antibody	NNS
cord-269150-d1sgnxc0	52	15	mouse	mouse	NN
cord-269150-d1sgnxc0	52	16	anti	anti	NNP
cord-269150-d1sgnxc0	52	17	-	-	NNP
cord-269150-d1sgnxc0	52	18	BrdU	BrdU	NNP
cord-269150-d1sgnxc0	52	19	and	and	CC
cord-269150-d1sgnxc0	52	20	rabbit	rabbit	NN
cord-269150-d1sgnxc0	52	21	anti	anti	NNP
cord-269150-d1sgnxc0	52	22	-	-	NNP
cord-269150-d1sgnxc0	52	23	Flag	flag	JJ
cord-269150-d1sgnxc0	52	24	(	(	-LRB-
cord-269150-d1sgnxc0	52	25	Sigma	Sigma	NNP
cord-269150-d1sgnxc0	52	26	Aldrich	Aldrich	NNP
cord-269150-d1sgnxc0	52	27	)	)	-RRB-
cord-269150-d1sgnxc0	52	28	and	and	CC
cord-269150-d1sgnxc0	52	29	subsequently	subsequently	RB
cord-269150-d1sgnxc0	52	30	probed	probe	VBD
cord-269150-d1sgnxc0	52	31	with	with	IN
cord-269150-d1sgnxc0	52	32	AlexaFluor	AlexaFluor	NNP
cord-269150-d1sgnxc0	52	33	488	488	CD
cord-269150-d1sgnxc0	52	34	anti	anti	JJ
cord-269150-d1sgnxc0	52	35	-	-	JJ
cord-269150-d1sgnxc0	52	36	rabbit	rabbit	JJ
cord-269150-d1sgnxc0	52	37	and	and	CC
cord-269150-d1sgnxc0	52	38	594	594	CD
cord-269150-d1sgnxc0	52	39	anti	anti	JJ
cord-269150-d1sgnxc0	52	40	-	-	JJ
cord-269150-d1sgnxc0	52	41	mouse	mouse	NN
cord-269150-d1sgnxc0	52	42	(	(	-LRB-
cord-269150-d1sgnxc0	52	43	Invitrogen	Invitrogen	NNP
cord-269150-d1sgnxc0	52	44	)	)	-RRB-
cord-269150-d1sgnxc0	52	45	antibodies	antibody	NNS
cord-269150-d1sgnxc0	52	46	.	.	.
cord-269150-d1sgnxc0	53	1	Images	image	NNS
cord-269150-d1sgnxc0	53	2	were	be	VBD
cord-269150-d1sgnxc0	53	3	captured	capture	VBN
cord-269150-d1sgnxc0	53	4	with	with	IN
cord-269150-d1sgnxc0	53	5	Olympus	Olympus	NNP
cord-269150-d1sgnxc0	53	6	Fluoview	Fluoview	NNP
cord-269150-d1sgnxc0	53	7	Upright	upright	JJ
cord-269150-d1sgnxc0	53	8	Confocal	Confocal	NNP
cord-269150-d1sgnxc0	53	9	microscope	microscope	NN
cord-269150-d1sgnxc0	53	10	using	use	VBG
cord-269150-d1sgnxc0	53	11	a	a	DT
cord-269150-d1sgnxc0	53	12	sequential	sequential	JJ
cord-269150-d1sgnxc0	53	13	laser	laser	NN
cord-269150-d1sgnxc0	53	14	scanning	scanning	NN
cord-269150-d1sgnxc0	53	15	protocol	protocol	NN
cord-269150-d1sgnxc0	53	16	.	.	.
cord-269150-d1sgnxc0	54	1	H1299	H1299	NNP
cord-269150-d1sgnxc0	54	2	cells	cell	NNS
cord-269150-d1sgnxc0	54	3	grown	grow	VBN
cord-269150-d1sgnxc0	54	4	to	to	IN
cord-269150-d1sgnxc0	54	5	30	30	CD
cord-269150-d1sgnxc0	54	6	%	%	NN
cord-269150-d1sgnxc0	54	7	confluency	confluency	NN
cord-269150-d1sgnxc0	54	8	were	be	VBD
cord-269150-d1sgnxc0	54	9	transfected	transfecte	VBN
cord-269150-d1sgnxc0	54	10	with	with	IN
cord-269150-d1sgnxc0	54	11	100	100	CD
cord-269150-d1sgnxc0	54	12	nM	nm	CD
cord-269150-d1sgnxc0	54	13	of	of	IN
cord-269150-d1sgnxc0	54	14	either	either	CC
cord-269150-d1sgnxc0	54	15	siEGFP	siEGFP	NNP
cord-269150-d1sgnxc0	54	16	(	(	-LRB-
cord-269150-d1sgnxc0	54	17	5	5	CD
cord-269150-d1sgnxc0	54	18	0	0	CD
cord-269150-d1sgnxc0	54	19	-GCAACGUGACCC	-GCAACGUGACCC	.
cord-269150-d1sgnxc0	55	1	UGAAGUUCdTdT-3	UGAAGUUCdTdT-3	NNP
cord-269150-d1sgnxc0	55	2	0	0	CD
cord-269150-d1sgnxc0	55	3	)	)	-RRB-
cord-269150-d1sgnxc0	55	4	or	or	CC
cord-269150-d1sgnxc0	55	5	siMadp1	siMadp1	NNP
cord-269150-d1sgnxc0	55	6	(	(	-LRB-
cord-269150-d1sgnxc0	55	7	5	5	CD
cord-269150-d1sgnxc0	55	8	0	0	CD
cord-269150-d1sgnxc0	55	9	-CAAUGACUU	-CAAUGACUU	.
cord-269150-d1sgnxc0	56	1	GUACCGGAUAdTdT-3	GUACCGGAUAdTdT-3	NNP
cord-269150-d1sgnxc0	56	2	0	0	CD
cord-269150-d1sgnxc0	56	3	)	)	-RRB-
cord-269150-d1sgnxc0	57	1	using	use	VBG
cord-269150-d1sgnxc0	57	2	DharmaFECT	DharmaFECT	NNP
cord-269150-d1sgnxc0	57	3	2	2	CD
cord-269150-d1sgnxc0	57	4	siRNA	siRNA	NNP
cord-269150-d1sgnxc0	57	5	Transfection	Transfection	NNP
cord-269150-d1sgnxc0	57	6	Reagent	Reagent	NNP
cord-269150-d1sgnxc0	57	7	(	(	-LRB-
cord-269150-d1sgnxc0	57	8	Dharmacon	Dharmacon	NNP
cord-269150-d1sgnxc0	57	9	)	)	-RRB-
cord-269150-d1sgnxc0	57	10	for	for	IN
cord-269150-d1sgnxc0	57	11	72	72	CD
cord-269150-d1sgnxc0	57	12	h.	h.	NN
cord-269150-d1sgnxc0	57	13	Cells	cell	NNS
cord-269150-d1sgnxc0	57	14	were	be	VBD
cord-269150-d1sgnxc0	57	15	infected	infect	VBN
cord-269150-d1sgnxc0	57	16	with	with	IN
cord-269150-d1sgnxc0	57	17	recombinant	recombinant	JJ
cord-269150-d1sgnxc0	57	18	IBV	IBV	NNP
cord-269150-d1sgnxc0	57	19	-	-	HYPH
cord-269150-d1sgnxc0	57	20	Luc	Luc	NNP
cord-269150-d1sgnxc0	57	21	at	at	IN
cord-269150-d1sgnxc0	57	22	a	a	DT
cord-269150-d1sgnxc0	57	23	multiplicity	multiplicity	NN
cord-269150-d1sgnxc0	57	24	of	of	IN
cord-269150-d1sgnxc0	57	25	infectivity	infectivity	NN
cord-269150-d1sgnxc0	57	26	of	of	IN
cord-269150-d1sgnxc0	57	27	$	$	$
cord-269150-d1sgnxc0	57	28	1	1	CD
cord-269150-d1sgnxc0	57	29	(	(	-LRB-
cord-269150-d1sgnxc0	57	30	MOI	MOI	NNP
cord-269150-d1sgnxc0	57	31	&	&	CC
cord-269150-d1sgnxc0	57	32	1	1	CD
cord-269150-d1sgnxc0	57	33	)	)	-RRB-
cord-269150-d1sgnxc0	57	34	and	and	CC
cord-269150-d1sgnxc0	57	35	incubated	incubate	VBN
cord-269150-d1sgnxc0	57	36	for	for	IN
cord-269150-d1sgnxc0	57	37	2	2	CD
cord-269150-d1sgnxc0	57	38	h	h	NN
cord-269150-d1sgnxc0	57	39	at	at	IN
cord-269150-d1sgnxc0	57	40	37	37	CD
cord-269150-d1sgnxc0	57	41	C	c	NN
cord-269150-d1sgnxc0	57	42	,	,	,
cord-269150-d1sgnxc0	57	43	5	5	CD
cord-269150-d1sgnxc0	57	44	%	%	NN
cord-269150-d1sgnxc0	57	45	CO	co	NN
cord-269150-d1sgnxc0	57	46	2	2	CD
cord-269150-d1sgnxc0	57	47	.	.	.
cord-269150-d1sgnxc0	58	1	The	the	DT
cord-269150-d1sgnxc0	58	2	virus	virus	NN
cord-269150-d1sgnxc0	58	3	-	-	HYPH
cord-269150-d1sgnxc0	58	4	containing	contain	VBG
cord-269150-d1sgnxc0	58	5	medium	medium	NN
cord-269150-d1sgnxc0	58	6	was	be	VBD
cord-269150-d1sgnxc0	58	7	replaced	replace	VBN
cord-269150-d1sgnxc0	58	8	with	with	IN
cord-269150-d1sgnxc0	58	9	fresh	fresh	JJ
cord-269150-d1sgnxc0	58	10	serum	serum	NN
cord-269150-d1sgnxc0	58	11	-	-	HYPH
cord-269150-d1sgnxc0	58	12	free	free	JJ
cord-269150-d1sgnxc0	58	13	medium	medium	NN
cord-269150-d1sgnxc0	58	14	and	and	CC
cord-269150-d1sgnxc0	58	15	the	the	DT
cord-269150-d1sgnxc0	58	16	cells	cell	NNS
cord-269150-d1sgnxc0	58	17	were	be	VBD
cord-269150-d1sgnxc0	58	18	either	either	CC
cord-269150-d1sgnxc0	58	19	harvested	harvest	VBN
cord-269150-d1sgnxc0	58	20	immediately	immediately	RB
cord-269150-d1sgnxc0	58	21	(	(	-LRB-
cord-269150-d1sgnxc0	58	22	0	0	NFP
cord-269150-d1sgnxc0	58	23	h	h	NN
cord-269150-d1sgnxc0	58	24	)	)	-RRB-
cord-269150-d1sgnxc0	58	25	or	or	CC
cord-269150-d1sgnxc0	58	26	continued	continue	VBD
cord-269150-d1sgnxc0	58	27	to	to	TO
cord-269150-d1sgnxc0	58	28	be	be	VB
cord-269150-d1sgnxc0	58	29	incubated	incubate	VBN
cord-269150-d1sgnxc0	58	30	at	at	IN
cord-269150-d1sgnxc0	58	31	37	37	CD
cord-269150-d1sgnxc0	58	32	C	c	NN
cord-269150-d1sgnxc0	58	33	until	until	IN
cord-269150-d1sgnxc0	58	34	specific	specific	JJ
cord-269150-d1sgnxc0	58	35	time	time	NN
cord-269150-d1sgnxc0	58	36	points	point	NNS
cord-269150-d1sgnxc0	58	37	post	post	NN
cord-269150-d1sgnxc0	58	38	infection	infection	NN
cord-269150-d1sgnxc0	58	39	(	(	-LRB-
cord-269150-d1sgnxc0	58	40	4	4	CD
cord-269150-d1sgnxc0	58	41	,	,	,
cord-269150-d1sgnxc0	58	42	8	8	CD
cord-269150-d1sgnxc0	58	43	,	,	,
cord-269150-d1sgnxc0	58	44	12	12	CD
cord-269150-d1sgnxc0	58	45	,	,	,
cord-269150-d1sgnxc0	58	46	16	16	CD
cord-269150-d1sgnxc0	58	47	,	,	,
cord-269150-d1sgnxc0	58	48	20	20	CD
cord-269150-d1sgnxc0	58	49	or	or	CC
cord-269150-d1sgnxc0	58	50	24	24	CD
cord-269150-d1sgnxc0	58	51	h	h	NN
cord-269150-d1sgnxc0	58	52	)	)	-RRB-
cord-269150-d1sgnxc0	58	53	.	.	.
cord-269150-d1sgnxc0	59	1	Infected	infected	JJ
cord-269150-d1sgnxc0	59	2	cells	cell	NNS
cord-269150-d1sgnxc0	59	3	were	be	VBD
cord-269150-d1sgnxc0	59	4	subjected	subject	VBN
cord-269150-d1sgnxc0	59	5	to	to	IN
cord-269150-d1sgnxc0	59	6	lysis	lysis	NN
cord-269150-d1sgnxc0	59	7	,	,	,
cord-269150-d1sgnxc0	59	8	either	either	CC
cord-269150-d1sgnxc0	59	9	through	through	IN
cord-269150-d1sgnxc0	59	10	three	three	CD
cord-269150-d1sgnxc0	59	11	freeze	freeze	NN
cord-269150-d1sgnxc0	59	12	-	-	HYPH
cord-269150-d1sgnxc0	59	13	thaw	thaw	VB
cord-269150-d1sgnxc0	59	14	cycles	cycle	NNS
cord-269150-d1sgnxc0	59	15	(	(	-LRB-
cord-269150-d1sgnxc0	59	16	at	at	IN
cord-269150-d1sgnxc0	59	17	À80	À80	NNP
cord-269150-d1sgnxc0	59	18	C	C	NNP
cord-269150-d1sgnxc0	59	19	and	and	CC
cord-269150-d1sgnxc0	59	20	room	room	NN
cord-269150-d1sgnxc0	59	21	temperature	temperature	NN
cord-269150-d1sgnxc0	59	22	,	,	,
cord-269150-d1sgnxc0	59	23	respectively	respectively	RB
cord-269150-d1sgnxc0	59	24	)	)	-RRB-
cord-269150-d1sgnxc0	59	25	without	without	IN
cord-269150-d1sgnxc0	59	26	removal	removal	NN
cord-269150-d1sgnxc0	59	27	of	of	IN
cord-269150-d1sgnxc0	59	28	media	medium	NNS
cord-269150-d1sgnxc0	59	29	,	,	,
cord-269150-d1sgnxc0	59	30	or	or	CC
cord-269150-d1sgnxc0	59	31	using	use	VBG
cord-269150-d1sgnxc0	59	32	lysis	lysis	NN
cord-269150-d1sgnxc0	59	33	buffer	buffer	NN
cord-269150-d1sgnxc0	59	34	after	after	IN
cord-269150-d1sgnxc0	59	35	removal	removal	NN
cord-269150-d1sgnxc0	59	36	of	of	IN
cord-269150-d1sgnxc0	59	37	media	medium	NNS
cord-269150-d1sgnxc0	59	38	.	.	.
cord-269150-d1sgnxc0	60	1	Firefly	Firefly	NNP
cord-269150-d1sgnxc0	60	2	luciferase	luciferase	NN
cord-269150-d1sgnxc0	60	3	activity	activity	NN
cord-269150-d1sgnxc0	60	4	which	which	WDT
cord-269150-d1sgnxc0	60	5	was	be	VBD
cord-269150-d1sgnxc0	60	6	used	use	VBN
cord-269150-d1sgnxc0	60	7	as	as	IN
cord-269150-d1sgnxc0	60	8	an	an	DT
cord-269150-d1sgnxc0	60	9	indication	indication	NN
cord-269150-d1sgnxc0	60	10	of	of	IN
cord-269150-d1sgnxc0	60	11	viral	viral	JJ
cord-269150-d1sgnxc0	60	12	activity	activity	NN
cord-269150-d1sgnxc0	60	13	for	for	IN
cord-269150-d1sgnxc0	60	14	the	the	DT
cord-269150-d1sgnxc0	60	15	recombinant	recombinant	JJ
cord-269150-d1sgnxc0	60	16	virus	virus	NN
cord-269150-d1sgnxc0	60	17	was	be	VBD
cord-269150-d1sgnxc0	60	18	measured	measure	VBN
cord-269150-d1sgnxc0	60	19	using	use	VBG
cord-269150-d1sgnxc0	60	20	Luciferase	Luciferase	NNP
cord-269150-d1sgnxc0	60	21	Assay	Assay	NNP
cord-269150-d1sgnxc0	60	22	System	System	NNP
cord-269150-d1sgnxc0	60	23	(	(	-LRB-
cord-269150-d1sgnxc0	60	24	Promega	Promega	NNP
cord-269150-d1sgnxc0	60	25	)	)	-RRB-
cord-269150-d1sgnxc0	60	26	according	accord	VBG
cord-269150-d1sgnxc0	60	27	to	to	IN
cord-269150-d1sgnxc0	60	28	manufacturer	manufacturer	NN
cord-269150-d1sgnxc0	60	29	's	's	POS
cord-269150-d1sgnxc0	60	30	instructions	instruction	NNS
cord-269150-d1sgnxc0	60	31	using	use	VBG
cord-269150-d1sgnxc0	60	32	the	the	DT
cord-269150-d1sgnxc0	60	33	cell	cell	NN
cord-269150-d1sgnxc0	60	34	lysates	lysate	NNS
cord-269150-d1sgnxc0	60	35	.	.	.
cord-269150-d1sgnxc0	61	1	An	an	DT
cord-269150-d1sgnxc0	61	2	end	end	NN
cord-269150-d1sgnxc0	61	3	-	-	HYPH
cord-269150-d1sgnxc0	61	4	point	point	NN
cord-269150-d1sgnxc0	61	5	dilution	dilution	NN
cord-269150-d1sgnxc0	61	6	assay	assay	NN
cord-269150-d1sgnxc0	61	7	,	,	,
cord-269150-d1sgnxc0	61	8	the	the	DT
cord-269150-d1sgnxc0	61	9	50	50	CD
cord-269150-d1sgnxc0	61	10	%	%	NN
cord-269150-d1sgnxc0	61	11	tissue	tissue	NN
cord-269150-d1sgnxc0	61	12	culture	culture	NN
cord-269150-d1sgnxc0	61	13	infectious	infectious	JJ
cord-269150-d1sgnxc0	61	14	dose	dose	NN
cord-269150-d1sgnxc0	61	15	(	(	-LRB-
cord-269150-d1sgnxc0	61	16	TCID	TCID	NNP
cord-269150-d1sgnxc0	61	17	50	50	CD
cord-269150-d1sgnxc0	61	18	)	)	-RRB-
cord-269150-d1sgnxc0	61	19	,	,	,
cord-269150-d1sgnxc0	61	20	the	the	DT
cord-269150-d1sgnxc0	61	21	amount	amount	NN
cord-269150-d1sgnxc0	61	22	of	of	IN
cord-269150-d1sgnxc0	61	23	virus	virus	NN
cord-269150-d1sgnxc0	61	24	that	that	WDT
cord-269150-d1sgnxc0	61	25	will	will	MD
cord-269150-d1sgnxc0	61	26	produce	produce	VB
cord-269150-d1sgnxc0	61	27	pathological	pathological	JJ
cord-269150-d1sgnxc0	61	28	change	change	NN
cord-269150-d1sgnxc0	61	29	in	in	IN
cord-269150-d1sgnxc0	61	30	50	50	CD
cord-269150-d1sgnxc0	61	31	%	%	NN
cord-269150-d1sgnxc0	61	32	of	of	IN
cord-269150-d1sgnxc0	61	33	inoculated	inoculate	VBN
cord-269150-d1sgnxc0	61	34	cell	cell	NN
cord-269150-d1sgnxc0	61	35	culture	culture	NN
cord-269150-d1sgnxc0	61	36	,	,	,
cord-269150-d1sgnxc0	61	37	of	of	IN
cord-269150-d1sgnxc0	61	38	the	the	DT
cord-269150-d1sgnxc0	61	39	infected	infected	JJ
cord-269150-d1sgnxc0	61	40	cells	cell	NNS
cord-269150-d1sgnxc0	61	41	was	be	VBD
cord-269150-d1sgnxc0	61	42	used	use	VBN
cord-269150-d1sgnxc0	61	43	as	as	IN
cord-269150-d1sgnxc0	61	44	a	a	DT
cord-269150-d1sgnxc0	61	45	measurement	measurement	NN
cord-269150-d1sgnxc0	61	46	of	of	IN
cord-269150-d1sgnxc0	61	47	virus	virus	NN
cord-269150-d1sgnxc0	61	48	titer	titer	NN
cord-269150-d1sgnxc0	61	49	.	.	.
cord-269150-d1sgnxc0	62	1	The	the	DT
cord-269150-d1sgnxc0	62	2	TCID	TCID	NNP
cord-269150-d1sgnxc0	62	3	50	50	CD
cord-269150-d1sgnxc0	62	4	of	of	IN
cord-269150-d1sgnxc0	62	5	the	the	DT
cord-269150-d1sgnxc0	62	6	infected	infected	JJ
cord-269150-d1sgnxc0	62	7	cells	cell	NNS
cord-269150-d1sgnxc0	62	8	at	at	IN
cord-269150-d1sgnxc0	62	9	each	each	DT
cord-269150-d1sgnxc0	62	10	time	time	NN
cord-269150-d1sgnxc0	62	11	point	point	NN
cord-269150-d1sgnxc0	62	12	was	be	VBD
cord-269150-d1sgnxc0	62	13	determined	determine	VBN
cord-269150-d1sgnxc0	62	14	by	by	IN
cord-269150-d1sgnxc0	62	15	using	use	VBG
cord-269150-d1sgnxc0	62	16	the	the	DT
cord-269150-d1sgnxc0	62	17	freeze	freeze	VB
cord-269150-d1sgnxc0	62	18	-	-	HYPH
cord-269150-d1sgnxc0	62	19	thawed	thaw	VBN
cord-269150-d1sgnxc0	62	20	infected	infected	JJ
cord-269150-d1sgnxc0	62	21	cells	cell	NNS
cord-269150-d1sgnxc0	62	22	.	.	.
cord-269150-d1sgnxc0	63	1	For	for	IN
cord-269150-d1sgnxc0	63	2	each	each	DT
cord-269150-d1sgnxc0	63	3	sample	sample	NN
cord-269150-d1sgnxc0	63	4	,	,	,
cord-269150-d1sgnxc0	63	5	a	a	DT
cord-269150-d1sgnxc0	63	6	10-fold	10-fold	JJ
cord-269150-d1sgnxc0	63	7	serial	serial	JJ
cord-269150-d1sgnxc0	63	8	dilution	dilution	NN
cord-269150-d1sgnxc0	63	9	was	be	VBD
cord-269150-d1sgnxc0	63	10	performed	perform	VBN
cord-269150-d1sgnxc0	63	11	and	and	CC
cord-269150-d1sgnxc0	63	12	five	five	CD
cord-269150-d1sgnxc0	63	13	wells	well	NNS
cord-269150-d1sgnxc0	63	14	of	of	IN
cord-269150-d1sgnxc0	63	15	Vero	Vero	NNP
cord-269150-d1sgnxc0	63	16	cells	cell	NNS
cord-269150-d1sgnxc0	63	17	on	on	IN
cord-269150-d1sgnxc0	63	18	96-well	96-well	CD
cord-269150-d1sgnxc0	63	19	plates	plate	NNS
cord-269150-d1sgnxc0	63	20	were	be	VBD
cord-269150-d1sgnxc0	63	21	infected	infect	VBN
cord-269150-d1sgnxc0	63	22	with	with	IN
cord-269150-d1sgnxc0	63	23	each	each	DT
cord-269150-d1sgnxc0	63	24	dilution	dilution	NN
cord-269150-d1sgnxc0	63	25	.	.	.
cord-269150-d1sgnxc0	64	1	The	the	DT
cord-269150-d1sgnxc0	64	2	numbers	number	NNS
cord-269150-d1sgnxc0	64	3	of	of	IN
cord-269150-d1sgnxc0	64	4	infected	infected	JJ
cord-269150-d1sgnxc0	64	5	wells	well	NNS
cord-269150-d1sgnxc0	64	6	were	be	VBD
cord-269150-d1sgnxc0	64	7	collated	collate	VBN
cord-269150-d1sgnxc0	64	8	and	and	CC
cord-269150-d1sgnxc0	64	9	TCID	TCID	NNP
cord-269150-d1sgnxc0	64	10	50	50	CD
cord-269150-d1sgnxc0	64	11	of	of	IN
cord-269150-d1sgnxc0	64	12	each	each	DT
cord-269150-d1sgnxc0	64	13	sample	sample	NN
cord-269150-d1sgnxc0	64	14	was	be	VBD
cord-269150-d1sgnxc0	64	15	calculated	calculate	VBN
cord-269150-d1sgnxc0	64	16	using	use	VBG
cord-269150-d1sgnxc0	64	17	the	the	DT
cord-269150-d1sgnxc0	64	18	Reed	Reed	NNP
cord-269150-d1sgnxc0	64	19	-	-	HYPH
cord-269150-d1sgnxc0	64	20	Muench	Muench	NNP
cord-269150-d1sgnxc0	64	21	method	method	NN
cord-269150-d1sgnxc0	64	22	(	(	-LRB-
cord-269150-d1sgnxc0	64	23	5	5	CD
cord-269150-d1sgnxc0	64	24	)	)	-RRB-
cord-269150-d1sgnxc0	64	25	.	.	.
cord-269150-d1sgnxc0	65	1	Reverse	reverse	JJ
cord-269150-d1sgnxc0	65	2	transcription	transcription	NN
cord-269150-d1sgnxc0	65	3	-	-	HYPH
cord-269150-d1sgnxc0	65	4	polymerase	polymerase	NN
cord-269150-d1sgnxc0	65	5	chain	chain	NN
cord-269150-d1sgnxc0	65	6	reaction	reaction	NN
cord-269150-d1sgnxc0	65	7	determination	determination	NN
cord-269150-d1sgnxc0	65	8	of	of	IN
cord-269150-d1sgnxc0	65	9	the	the	DT
cord-269150-d1sgnxc0	65	10	replication	replication	NN
cord-269150-d1sgnxc0	65	11	and	and	CC
cord-269150-d1sgnxc0	65	12	sub	sub	JJ
cord-269150-d1sgnxc0	65	13	-	-	JJ
cord-269150-d1sgnxc0	65	14	genomic	genomic	JJ
cord-269150-d1sgnxc0	65	15	transcription	transcription	NN
cord-269150-d1sgnxc0	65	16	efficiency	efficiency	NN
cord-269150-d1sgnxc0	65	17	of	of	IN
cord-269150-d1sgnxc0	65	18	IBV	IBV	NNP
cord-269150-d1sgnxc0	65	19	Total	Total	NNP
cord-269150-d1sgnxc0	65	20	RNAs	rna	NNS
cord-269150-d1sgnxc0	65	21	were	be	VBD
cord-269150-d1sgnxc0	65	22	prepared	prepare	VBN
cord-269150-d1sgnxc0	65	23	from	from	IN
cord-269150-d1sgnxc0	65	24	the	the	DT
cord-269150-d1sgnxc0	65	25	infected	infected	JJ
cord-269150-d1sgnxc0	65	26	cells	cell	NNS
cord-269150-d1sgnxc0	65	27	at	at	IN
cord-269150-d1sgnxc0	65	28	their	-PRON-	PRP$
cord-269150-d1sgnxc0	65	29	specified	specify	VBN
cord-269150-d1sgnxc0	65	30	time	time	NN
cord-269150-d1sgnxc0	65	31	points	point	NNS
cord-269150-d1sgnxc0	65	32	using	use	VBG
cord-269150-d1sgnxc0	65	33	Trizol	Trizol	NNP
cord-269150-d1sgnxc0	65	34	Reagent	Reagent	NNP
cord-269150-d1sgnxc0	65	35	(	(	-LRB-
cord-269150-d1sgnxc0	65	36	Invitrogen	Invitrogen	NNP
cord-269150-d1sgnxc0	65	37	)	)	-RRB-
cord-269150-d1sgnxc0	65	38	Reverse	reverse	NN
cord-269150-d1sgnxc0	65	39	transcription	transcription	NN
cord-269150-d1sgnxc0	65	40	(	(	-LRB-
cord-269150-d1sgnxc0	65	41	RT	RT	NNP
cord-269150-d1sgnxc0	65	42	)	)	-RRB-
cord-269150-d1sgnxc0	65	43	was	be	VBD
cord-269150-d1sgnxc0	65	44	performed	perform	VBN
cord-269150-d1sgnxc0	65	45	with	with	IN
cord-269150-d1sgnxc0	65	46	Expand	expand	VB
cord-269150-d1sgnxc0	65	47	reverse	reverse	NN
cord-269150-d1sgnxc0	65	48	transcriptase	transcriptase	NN
cord-269150-d1sgnxc0	65	49	(	(	-LRB-
cord-269150-d1sgnxc0	65	50	Roche	Roche	NNP
cord-269150-d1sgnxc0	65	51	)	)	-RRB-
cord-269150-d1sgnxc0	65	52	according	accord	VBG
cord-269150-d1sgnxc0	65	53	to	to	IN
cord-269150-d1sgnxc0	65	54	the	the	DT
cord-269150-d1sgnxc0	65	55	manufacturer	manufacturer	NN
cord-269150-d1sgnxc0	65	56	's	's	POS
cord-269150-d1sgnxc0	65	57	instructions	instruction	NNS
cord-269150-d1sgnxc0	65	58	using	use	VBG
cord-269150-d1sgnxc0	65	59	the	the	DT
cord-269150-d1sgnxc0	65	60	sense	sense	NN
cord-269150-d1sgnxc0	65	61	primer	primer	NN
cord-269150-d1sgnxc0	65	62	IBV	IBV	NNP
cord-269150-d1sgnxc0	65	63	leader	leader	NN
cord-269150-d1sgnxc0	65	64	(	(	-LRB-
cord-269150-d1sgnxc0	65	65	5	5	CD
cord-269150-d1sgnxc0	65	66	0	0	CD
cord-269150-d1sgnxc0	65	67	-26CTATTACACTAGCCTTGCGCT46	-26CTATTACACTAGCCTTGCGCT46	:
cord-269150-d1sgnxc0	65	68	-	-	SYM
cord-269150-d1sgnxc0	65	69	3	3	CD
cord-269150-d1sgnxc0	65	70	0	0	CD
cord-269150-d1sgnxc0	65	71	)	)	-RRB-
cord-269150-d1sgnxc0	65	72	for	for	IN
cord-269150-d1sgnxc0	65	73	the	the	DT
cord-269150-d1sgnxc0	65	74	detection	detection	NN
cord-269150-d1sgnxc0	65	75	of	of	IN
cord-269150-d1sgnxc0	65	76	negative	negative	JJ
cord-269150-d1sgnxc0	65	77	-	-	HYPH
cord-269150-d1sgnxc0	65	78	stranded	stranded	JJ
cord-269150-d1sgnxc0	65	79	subgenomic	subgenomic	NNP
cord-269150-d1sgnxc0	65	80	RNA	RNA	NNP
cord-269150-d1sgnxc0	65	81	(	(	-LRB-
cord-269150-d1sgnxc0	65	82	sgRNA	sgRNA	VBG
cord-269150-d1sgnxc0	65	83	)	)	-RRB-
cord-269150-d1sgnxc0	65	84	and	and	CC
cord-269150-d1sgnxc0	65	85	the	the	DT
cord-269150-d1sgnxc0	65	86	antisense	antisense	NN
cord-269150-d1sgnxc0	65	87	primer	primer	NN
cord-269150-d1sgnxc0	65	88	IBV24803-R	IBV24803-R	NNP
cord-269150-d1sgnxc0	65	89	(	(	-LRB-
cord-269150-d1sgnxc0	65	90	5	5	CD
cord-269150-d1sgnxc0	65	91	0	0	CD
cord-269150-d1sgnxc0	65	92	-24803CTCTGG	-24803CTCTGG	HYPH
cord-269150-d1sgnxc0	65	93	ATCCAATAACCTAC24784	ATCCAATAACCTAC24784	NNP
cord-269150-d1sgnxc0	65	94	-	-	HYPH
cord-269150-d1sgnxc0	65	95	3	3	CD
cord-269150-d1sgnxc0	65	96	0	0	CD
cord-269150-d1sgnxc0	65	97	)	)	-RRB-
cord-269150-d1sgnxc0	65	98	for	for	IN
cord-269150-d1sgnxc0	65	99	the	the	DT
cord-269150-d1sgnxc0	65	100	detection	detection	NN
cord-269150-d1sgnxc0	65	101	of	of	IN
cord-269150-d1sgnxc0	65	102	positive	positive	JJ
cord-269150-d1sgnxc0	65	103	-	-	HYPH
cord-269150-d1sgnxc0	65	104	stranded	strand	VBN
cord-269150-d1sgnxc0	65	105	sgRNA	sgrna	NN
cord-269150-d1sgnxc0	65	106	.	.	.
cord-269150-d1sgnxc0	66	1	Both	both	DT
cord-269150-d1sgnxc0	66	2	primers	primer	NNS
cord-269150-d1sgnxc0	66	3	were	be	VBD
cord-269150-d1sgnxc0	66	4	then	then	RB
cord-269150-d1sgnxc0	66	5	used	use	VBN
cord-269150-d1sgnxc0	66	6	for	for	IN
cord-269150-d1sgnxc0	66	7	PCR	PCR	NNP
cord-269150-d1sgnxc0	66	8	.	.	.
cord-269150-d1sgnxc0	67	1	If	if	IN
cord-269150-d1sgnxc0	67	2	transcription	transcription	NN
cord-269150-d1sgnxc0	67	3	of	of	IN
cord-269150-d1sgnxc0	67	4	subgenomic	subgenomic	NNP
cord-269150-d1sgnxc0	67	5	mRNAs	mRNAs	NNPS
cord-269150-d1sgnxc0	67	6	did	do	VBD
cord-269150-d1sgnxc0	67	7	occur	occur	VB
cord-269150-d1sgnxc0	67	8	,	,	,
cord-269150-d1sgnxc0	67	9	a	a	DT
cord-269150-d1sgnxc0	67	10	415-bp	415-bp	CD
cord-269150-d1sgnxc0	67	11	PCR	PCR	NNP
cord-269150-d1sgnxc0	67	12	product	product	NN
cord-269150-d1sgnxc0	67	13	corresponding	correspond	VBG
cord-269150-d1sgnxc0	67	14	to	to	IN
cord-269150-d1sgnxc0	67	15	the	the	DT
cord-269150-d1sgnxc0	67	16	5	5	CD
cord-269150-d1sgnxc0	67	17	0	0	CD
cord-269150-d1sgnxc0	67	18	-terminal	-terminal	JJ
cord-269150-d1sgnxc0	67	19	region	region	NN
cord-269150-d1sgnxc0	67	20	of	of	IN
cord-269150-d1sgnxc0	67	21	subgenomic	subgenomic	NNP
cord-269150-d1sgnxc0	67	22	mRNA	mRNA	NNP
cord-269150-d1sgnxc0	67	23	5	5	CD
cord-269150-d1sgnxc0	67	24	and	and	CC
cord-269150-d1sgnxc0	67	25	a	a	DT
cord-269150-d1sgnxc0	67	26	648-bp	648-bp	CD
cord-269150-d1sgnxc0	67	27	fragment	fragment	NN
cord-269150-d1sgnxc0	67	28	corresponding	correspond	VBG
cord-269150-d1sgnxc0	67	29	to	to	IN
cord-269150-d1sgnxc0	67	30	the	the	DT
cord-269150-d1sgnxc0	67	31	5	5	CD
cord-269150-d1sgnxc0	67	32	0	0	CD
cord-269150-d1sgnxc0	67	33	-terminal	-terminal	JJ
cord-269150-d1sgnxc0	67	34	region	region	NN
cord-269150-d1sgnxc0	67	35	of	of	IN
cord-269150-d1sgnxc0	67	36	subgenomic	subgenomic	NNP
cord-269150-d1sgnxc0	67	37	mRNA	mRNA	NNP
cord-269150-d1sgnxc0	67	38	4	4	CD
cord-269150-d1sgnxc0	67	39	would	would	MD
cord-269150-d1sgnxc0	67	40	be	be	VB
cord-269150-d1sgnxc0	67	41	expected	expect	VBN
cord-269150-d1sgnxc0	67	42	.	.	.
cord-269150-d1sgnxc0	68	1	Similarly	similarly	RB
cord-269150-d1sgnxc0	68	2	,	,	,
cord-269150-d1sgnxc0	68	3	RT	RT	NNP
cord-269150-d1sgnxc0	68	4	was	be	VBD
cord-269150-d1sgnxc0	68	5	carried	carry	VBN
cord-269150-d1sgnxc0	68	6	out	out	RP
cord-269150-d1sgnxc0	68	7	with	with	IN
cord-269150-d1sgnxc0	68	8	the	the	DT
cord-269150-d1sgnxc0	68	9	sense	sense	NN
cord-269150-d1sgnxc0	68	10	primer	primer	NN
cord-269150-d1sgnxc0	68	11	IBV14931-F	IBV14931-F	''
cord-269150-d1sgnxc0	68	12	(	(	-LRB-
cord-269150-d1sgnxc0	68	13	5	5	CD
cord-269150-d1sgnxc0	68	14	0	0	CD
cord-269150-d1sgnxc0	68	15	-14931GCTTATCCACTAGTACATC14949	-14931GCTTATCCACTAGTACATC14949	:
cord-269150-d1sgnxc0	68	16	-	-	HYPH
cord-269150-d1sgnxc0	68	17	3	3	CD
cord-269150-d1sgnxc0	68	18	0	0	CD
cord-269150-d1sgnxc0	68	19	)	)	-RRB-
cord-269150-d1sgnxc0	68	20	for	for	IN
cord-269150-d1sgnxc0	68	21	the	the	DT
cord-269150-d1sgnxc0	68	22	detection	detection	NN
cord-269150-d1sgnxc0	68	23	of	of	IN
cord-269150-d1sgnxc0	68	24	negative	negative	JJ
cord-269150-d1sgnxc0	68	25	-	-	HYPH
cord-269150-d1sgnxc0	68	26	stranded	stranded	JJ
cord-269150-d1sgnxc0	68	27	genomic	genomic	JJ
cord-269150-d1sgnxc0	68	28	RNA	RNA	NNP
cord-269150-d1sgnxc0	68	29	.	.	.
cord-269150-d1sgnxc0	69	1	Sense	sense	NN
cord-269150-d1sgnxc0	69	2	primer	primer	NN
cord-269150-d1sgnxc0	69	3	IBV14931-F	ibv14931-f	PRP
cord-269150-d1sgnxc0	69	4	and	and	CC
cord-269150-d1sgnxc0	69	5	the	the	DT
cord-269150-d1sgnxc0	69	6	antisense	antisense	NN
cord-269150-d1sgnxc0	69	7	primer	primer	VBP
cord-269150-d1sgnxc0	69	8	IBV15600-R	IBV15600-R	NNP
cord-269150-d1sgnxc0	69	9	(	(	-LRB-
cord-269150-d1sgnxc0	69	10	5	5	CD
cord-269150-d1sgnxc0	69	11	0	0	CD
cord-269150-d1sgnxc0	69	12	-15600CTTCTCGCACTTCTGCACTAGCA15578	-15600cttctcgcacttctgcactagca15578	CD
cord-269150-d1sgnxc0	69	13	-	-	SYM
cord-269150-d1sgnxc0	69	14	3	3	CD
cord-269150-d1sgnxc0	69	15	0	0	CD
cord-269150-d1sgnxc0	69	16	)	)	-RRB-
cord-269150-d1sgnxc0	69	17	were	be	VBD
cord-269150-d1sgnxc0	69	18	used	use	VBN
cord-269150-d1sgnxc0	69	19	for	for	IN
cord-269150-d1sgnxc0	69	20	PCR	PCR	NNP
cord-269150-d1sgnxc0	69	21	.	.	.
cord-269150-d1sgnxc0	70	1	If	if	IN
cord-269150-d1sgnxc0	70	2	replication	replication	NN
cord-269150-d1sgnxc0	70	3	of	of	IN
cord-269150-d1sgnxc0	70	4	viral	viral	JJ
cord-269150-d1sgnxc0	70	5	RNA	RNA	NNP
cord-269150-d1sgnxc0	70	6	occurred	occur	VBD
cord-269150-d1sgnxc0	70	7	,	,	,
cord-269150-d1sgnxc0	70	8	a	a	DT
cord-269150-d1sgnxc0	70	9	670-bp	670-bp	CD
cord-269150-d1sgnxc0	70	10	PCR	PCR	NNP
cord-269150-d1sgnxc0	70	11	fragment	fragment	NN
cord-269150-d1sgnxc0	70	12	would	would	MD
cord-269150-d1sgnxc0	70	13	be	be	VB
cord-269150-d1sgnxc0	70	14	expected	expect	VBN
cord-269150-d1sgnxc0	70	15	.	.	.
cord-269150-d1sgnxc0	71	1	Oligonucleotides	oligonucleotide	NNS
cord-269150-d1sgnxc0	71	2	were	be	VBD
cord-269150-d1sgnxc0	71	3	designed	design	VBN
cord-269150-d1sgnxc0	71	4	based	base	VBN
cord-269150-d1sgnxc0	71	5	on	on	IN
cord-269150-d1sgnxc0	71	6	siMadp1	simadp1	JJ
cord-269150-d1sgnxc0	71	7	sequence	sequence	NN
cord-269150-d1sgnxc0	71	8	and	and	CC
cord-269150-d1sgnxc0	71	9	cloned	clone	VBN
cord-269150-d1sgnxc0	71	10	into	into	IN
cord-269150-d1sgnxc0	71	11	pSilencer	pSilencer	NNP
cord-269150-d1sgnxc0	71	12	2.1	2.1	CD
cord-269150-d1sgnxc0	71	13	Neo	Neo	NNP
cord-269150-d1sgnxc0	71	14	(	(	-LRB-
cord-269150-d1sgnxc0	71	15	Ambion	Ambion	NNP
cord-269150-d1sgnxc0	71	16	)	)	-RRB-
cord-269150-d1sgnxc0	71	17	according	accord	VBG
cord-269150-d1sgnxc0	71	18	to	to	IN
cord-269150-d1sgnxc0	71	19	manufacturer	manufacturer	NN
cord-269150-d1sgnxc0	71	20	's	's	POS
cord-269150-d1sgnxc0	71	21	instructions	instruction	NNS
cord-269150-d1sgnxc0	71	22	.	.	.
cord-269150-d1sgnxc0	72	1	Negative	negative	JJ
cord-269150-d1sgnxc0	72	2	control	control	NN
cord-269150-d1sgnxc0	72	3	silencer	silencer	NN
cord-269150-d1sgnxc0	72	4	construct	construct	NN
cord-269150-d1sgnxc0	72	5	was	be	VBD
cord-269150-d1sgnxc0	72	6	supplied	supply	VBN
cord-269150-d1sgnxc0	72	7	with	with	IN
cord-269150-d1sgnxc0	72	8	the	the	DT
cord-269150-d1sgnxc0	72	9	cloning	cloning	NN
cord-269150-d1sgnxc0	72	10	kit	kit	NN
cord-269150-d1sgnxc0	72	11	.	.	.
cord-269150-d1sgnxc0	73	1	Constructs	construct	NNS
cord-269150-d1sgnxc0	73	2	pSilencer	pSilencer	NNP
cord-269150-d1sgnxc0	73	3	-	-	HYPH
cord-269150-d1sgnxc0	73	4	NC	NC	NNP
cord-269150-d1sgnxc0	73	5	(	(	-LRB-
cord-269150-d1sgnxc0	73	6	negative	negative	JJ
cord-269150-d1sgnxc0	73	7	control	control	NN
cord-269150-d1sgnxc0	73	8	)	)	-RRB-
cord-269150-d1sgnxc0	73	9	and	and	CC
cord-269150-d1sgnxc0	73	10	pSilencer	pSilencer	NNP
cord-269150-d1sgnxc0	73	11	-	-	HYPH
cord-269150-d1sgnxc0	73	12	Madp1	Madp1	NNP
cord-269150-d1sgnxc0	73	13	were	be	VBD
cord-269150-d1sgnxc0	73	14	transfected	transfecte	VBN
cord-269150-d1sgnxc0	73	15	into	into	IN
cord-269150-d1sgnxc0	73	16	H1299	H1299	NNP
cord-269150-d1sgnxc0	73	17	cells	cell	NNS
cord-269150-d1sgnxc0	73	18	with	with	IN
cord-269150-d1sgnxc0	73	19	Effectene	Effectene	NNP
cord-269150-d1sgnxc0	73	20	Transfection	Transfection	NNP
cord-269150-d1sgnxc0	73	21	Reagent	Reagent	NNP
cord-269150-d1sgnxc0	73	22	.	.	.
cord-269150-d1sgnxc0	74	1	Transfected	transfected	JJ
cord-269150-d1sgnxc0	74	2	cells	cell	NNS
cord-269150-d1sgnxc0	74	3	were	be	VBD
cord-269150-d1sgnxc0	74	4	selected	select	VBN
cord-269150-d1sgnxc0	74	5	with	with	IN
cord-269150-d1sgnxc0	74	6	500	500	CD
cord-269150-d1sgnxc0	74	7	mg	mg	NNP
cord-269150-d1sgnxc0	74	8	/	/	SYM
cord-269150-d1sgnxc0	74	9	ml	ml	NNP
cord-269150-d1sgnxc0	74	10	G418	G418	NNP
cord-269150-d1sgnxc0	74	11	(	(	-LRB-
cord-269150-d1sgnxc0	74	12	Sigma	Sigma	NNP
cord-269150-d1sgnxc0	74	13	)	)	-RRB-
cord-269150-d1sgnxc0	74	14	and	and	CC
cord-269150-d1sgnxc0	74	15	the	the	DT
cord-269150-d1sgnxc0	74	16	selected	select	VBN
cord-269150-d1sgnxc0	74	17	clones	clone	NNS
cord-269150-d1sgnxc0	74	18	were	be	VBD
cord-269150-d1sgnxc0	74	19	subjected	subject	VBN
cord-269150-d1sgnxc0	74	20	to	to	IN
cord-269150-d1sgnxc0	74	21	screening	screen	VBG
cord-269150-d1sgnxc0	74	22	for	for	IN
cord-269150-d1sgnxc0	74	23	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	74	24	knockdown	knockdown	NN
cord-269150-d1sgnxc0	74	25	efficiency	efficiency	NN
cord-269150-d1sgnxc0	74	26	.	.	.
cord-269150-d1sgnxc0	75	1	Selected	select	VBN
cord-269150-d1sgnxc0	75	2	H1299-shNC	H1299-shNC	NNP
cord-269150-d1sgnxc0	75	3	and	and	CC
cord-269150-d1sgnxc0	75	4	H1299-shMadp1	H1299-shMadp1	NNP
cord-269150-d1sgnxc0	75	5	stable	stable	JJ
cord-269150-d1sgnxc0	75	6	cell	cell	NN
cord-269150-d1sgnxc0	75	7	lines	line	NNS
cord-269150-d1sgnxc0	75	8	were	be	VBD
cord-269150-d1sgnxc0	75	9	maintained	maintain	VBN
cord-269150-d1sgnxc0	75	10	in	in	IN
cord-269150-d1sgnxc0	75	11	media	medium	NNS
cord-269150-d1sgnxc0	75	12	containing	contain	VBG
cord-269150-d1sgnxc0	75	13	500	500	CD
cord-269150-d1sgnxc0	75	14	mg	mg	NNP
cord-269150-d1sgnxc0	75	15	/	/	SYM
cord-269150-d1sgnxc0	75	16	ml	ml	NNS
cord-269150-d1sgnxc0	75	17	of	of	IN
cord-269150-d1sgnxc0	75	18	G418	G418	NNPS
cord-269150-d1sgnxc0	75	19	.	.	.
cord-269150-d1sgnxc0	76	1	In	in	IN
cord-269150-d1sgnxc0	76	2	order	order	NN
cord-269150-d1sgnxc0	76	3	to	to	TO
cord-269150-d1sgnxc0	76	4	find	find	VB
cord-269150-d1sgnxc0	76	5	candidate	candidate	NN
cord-269150-d1sgnxc0	76	6	host	host	NN
cord-269150-d1sgnxc0	76	7	proteins	protein	NNS
cord-269150-d1sgnxc0	76	8	that	that	WDT
cord-269150-d1sgnxc0	76	9	may	may	MD
cord-269150-d1sgnxc0	76	10	be	be	VB
cord-269150-d1sgnxc0	76	11	involved	involve	VBN
cord-269150-d1sgnxc0	76	12	in	in	IN
cord-269150-d1sgnxc0	76	13	the	the	DT
cord-269150-d1sgnxc0	76	14	replication	replication	NN
cord-269150-d1sgnxc0	76	15	and	and	CC
cord-269150-d1sgnxc0	76	16	transcription	transcription	NN
cord-269150-d1sgnxc0	76	17	of	of	IN
cord-269150-d1sgnxc0	76	18	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	76	19	RNA	RNA	NNP
cord-269150-d1sgnxc0	76	20	,	,	,
cord-269150-d1sgnxc0	76	21	a	a	DT
cord-269150-d1sgnxc0	76	22	yeast	yeast	NN
cord-269150-d1sgnxc0	76	23	-	-	HYPH
cord-269150-d1sgnxc0	76	24	based	base	VBN
cord-269150-d1sgnxc0	76	25	three	three	CD
cord-269150-d1sgnxc0	76	26	-	-	HYPH
cord-269150-d1sgnxc0	76	27	hybrid	hybrid	NN
cord-269150-d1sgnxc0	76	28	(	(	-LRB-
cord-269150-d1sgnxc0	76	29	34	34	CD
cord-269150-d1sgnxc0	76	30	)	)	-RRB-
cord-269150-d1sgnxc0	76	31	screen	screen	NN
cord-269150-d1sgnxc0	76	32	against	against	IN
cord-269150-d1sgnxc0	76	33	a	a	DT
cord-269150-d1sgnxc0	76	34	human	human	JJ
cord-269150-d1sgnxc0	76	35	cDNA	cdna	NN
cord-269150-d1sgnxc0	76	36	library	library	NN
cord-269150-d1sgnxc0	76	37	using	use	VBG
cord-269150-d1sgnxc0	76	38	the	the	DT
cord-269150-d1sgnxc0	76	39	5	5	CD
cord-269150-d1sgnxc0	76	40	0	0	CD
cord-269150-d1sgnxc0	76	41	-UTR	-utr	NN
cord-269150-d1sgnxc0	76	42	of	of	IN
cord-269150-d1sgnxc0	76	43	SARS	SARS	NNP
cord-269150-d1sgnxc0	76	44	-	-	HYPH
cord-269150-d1sgnxc0	76	45	CoV	CoV	NNP
cord-269150-d1sgnxc0	76	46	RNA	RNA	NNP
cord-269150-d1sgnxc0	76	47	as	as	IN
cord-269150-d1sgnxc0	76	48	bait	bait	NN
cord-269150-d1sgnxc0	76	49	was	be	VBD
cord-269150-d1sgnxc0	76	50	performed	perform	VBN
cord-269150-d1sgnxc0	76	51	.	.	.
cord-269150-d1sgnxc0	77	1	Screens	screen	NNS
cord-269150-d1sgnxc0	77	2	were	be	VBD
cord-269150-d1sgnxc0	77	3	also	also	RB
cord-269150-d1sgnxc0	77	4	performed	perform	VBN
cord-269150-d1sgnxc0	77	5	using	use	VBG
cord-269150-d1sgnxc0	77	6	the	the	DT
cord-269150-d1sgnxc0	77	7	negative	negative	JJ
cord-269150-d1sgnxc0	77	8	sense	sense	NN
cord-269150-d1sgnxc0	77	9	5	5	CD
cord-269150-d1sgnxc0	77	10	0	0	CD
cord-269150-d1sgnxc0	77	11	-UTR	-utr	NN
cord-269150-d1sgnxc0	77	12	and	and	CC
cord-269150-d1sgnxc0	77	13	3	3	CD
cord-269150-d1sgnxc0	77	14	0	0	CD
cord-269150-d1sgnxc0	77	15	-UTR	-utr	NN
cord-269150-d1sgnxc0	77	16	as	as	IN
cord-269150-d1sgnxc0	77	17	bait	bait	NN
cord-269150-d1sgnxc0	77	18	.	.	.
cord-269150-d1sgnxc0	78	1	Each	each	DT
cord-269150-d1sgnxc0	78	2	screen	screen	NN
cord-269150-d1sgnxc0	78	3	yielded	yield	VBD
cord-269150-d1sgnxc0	78	4	about	about	RB
cord-269150-d1sgnxc0	78	5	six	six	CD
cord-269150-d1sgnxc0	78	6	to	to	TO
cord-269150-d1sgnxc0	78	7	eight	eight	CD
cord-269150-d1sgnxc0	78	8	colonies	colony	NNS
cord-269150-d1sgnxc0	78	9	which	which	WDT
cord-269150-d1sgnxc0	78	10	were	be	VBD
cord-269150-d1sgnxc0	78	11	sequenced	sequence	VBN
cord-269150-d1sgnxc0	78	12	and	and	CC
cord-269150-d1sgnxc0	78	13	non	non	JJ
cord-269150-d1sgnxc0	78	14	-	-	JJ
cord-269150-d1sgnxc0	78	15	sense	sense	JJ
cord-269150-d1sgnxc0	78	16	sequences	sequence	NNS
cord-269150-d1sgnxc0	78	17	of	of	IN
cord-269150-d1sgnxc0	78	18	the	the	DT
cord-269150-d1sgnxc0	78	19	candidates	candidate	NNS
cord-269150-d1sgnxc0	78	20	were	be	VBD
cord-269150-d1sgnxc0	78	21	eliminated	eliminate	VBN
cord-269150-d1sgnxc0	78	22	.	.	.
cord-269150-d1sgnxc0	79	1	In	in	IN
cord-269150-d1sgnxc0	79	2	total	total	NN
cord-269150-d1sgnxc0	79	3	,	,	,
cord-269150-d1sgnxc0	79	4	the	the	DT
cord-269150-d1sgnxc0	79	5	screen	screen	NN
cord-269150-d1sgnxc0	79	6	identified	identify	VBD
cord-269150-d1sgnxc0	79	7	three	three	CD
cord-269150-d1sgnxc0	79	8	candidates	candidate	NNS
cord-269150-d1sgnxc0	79	9	,	,	,
cord-269150-d1sgnxc0	79	10	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	79	11	,	,	,
cord-269150-d1sgnxc0	79	12	HAX1	HAX1	NNP
cord-269150-d1sgnxc0	79	13	and	and	CC
cord-269150-d1sgnxc0	79	14	ribosomal	ribosomal	JJ
cord-269150-d1sgnxc0	79	15	protein	protein	NN
cord-269150-d1sgnxc0	79	16	L27a	l27a	NN
cord-269150-d1sgnxc0	79	17	as	as	IN
cord-269150-d1sgnxc0	79	18	binding	bind	VBG
cord-269150-d1sgnxc0	79	19	partners	partner	NNS
cord-269150-d1sgnxc0	79	20	to	to	IN
cord-269150-d1sgnxc0	79	21	SARS	SARS	NNP
cord-269150-d1sgnxc0	79	22	-	-	HYPH
cord-269150-d1sgnxc0	79	23	CoV	CoV	NNP
cord-269150-d1sgnxc0	79	24	positive	positive	JJ
cord-269150-d1sgnxc0	79	25	sense	sense	NN
cord-269150-d1sgnxc0	79	26	5	5	CD
cord-269150-d1sgnxc0	79	27	0	0	CD
cord-269150-d1sgnxc0	79	28	-UTR	-utr	NN
cord-269150-d1sgnxc0	79	29	,	,	,
cord-269150-d1sgnxc0	79	30	negative	negative	JJ
cord-269150-d1sgnxc0	79	31	sense	sense	NN
cord-269150-d1sgnxc0	79	32	5	5	CD
cord-269150-d1sgnxc0	79	33	0	0	CD
cord-269150-d1sgnxc0	79	34	-UTR	-utr	NN
cord-269150-d1sgnxc0	79	35	and	and	CC
cord-269150-d1sgnxc0	79	36	negative	negative	JJ
cord-269150-d1sgnxc0	79	37	sense	sense	NN
cord-269150-d1sgnxc0	79	38	3	3	CD
cord-269150-d1sgnxc0	79	39	0	0	CD
cord-269150-d1sgnxc0	79	40	-UTR	-utr	NN
cord-269150-d1sgnxc0	79	41	,	,	,
cord-269150-d1sgnxc0	79	42	respectively	respectively	RB
cord-269150-d1sgnxc0	79	43	.	.	.
cord-269150-d1sgnxc0	80	1	Although	although	IN
cord-269150-d1sgnxc0	80	2	it	-PRON-	PRP
cord-269150-d1sgnxc0	80	3	was	be	VBD
cord-269150-d1sgnxc0	80	4	interesting	interesting	JJ
cord-269150-d1sgnxc0	80	5	to	to	TO
cord-269150-d1sgnxc0	80	6	find	find	VB
cord-269150-d1sgnxc0	80	7	ribosomal	ribosomal	JJ
cord-269150-d1sgnxc0	80	8	protein	protein	NN
cord-269150-d1sgnxc0	80	9	L27a	l27a	NN
cord-269150-d1sgnxc0	80	10	interacting	interact	VBG
cord-269150-d1sgnxc0	80	11	with	with	IN
cord-269150-d1sgnxc0	80	12	the	the	DT
cord-269150-d1sgnxc0	80	13	Table	Table	NNP
cord-269150-d1sgnxc0	80	14	1	1	CD
cord-269150-d1sgnxc0	80	15	.	.	.
cord-269150-d1sgnxc0	81	1	Nucleotide	nucleotide	JJ
cord-269150-d1sgnxc0	81	2	sequences	sequence	NNS
cord-269150-d1sgnxc0	81	3	of	of	IN
cord-269150-d1sgnxc0	81	4	primers	primer	NNS
cord-269150-d1sgnxc0	81	5	used	use	VBN
cord-269150-d1sgnxc0	81	6	to	to	TO
cord-269150-d1sgnxc0	81	7	amplify	amplify	VB
cord-269150-d1sgnxc0	81	8	DNA	dna	NN
cord-269150-d1sgnxc0	81	9	templates	template	NNS
cord-269150-d1sgnxc0	81	10	for	for	IN
cord-269150-d1sgnxc0	81	11	in	in	FW
cord-269150-d1sgnxc0	81	12	vitro	vitro	FW
cord-269150-d1sgnxc0	81	13	transcription	transcription	NN
cord-269150-d1sgnxc0	81	14	Primer	Primer	NNP
cord-269150-d1sgnxc0	81	15	name	name	NN
cord-269150-d1sgnxc0	81	16	Sequence	sequence	NN
cord-269150-d1sgnxc0	81	17	 	 	_SP
cord-269150-d1sgnxc0	82	1	T7_EGFP_510	T7_EGFP_510	NNP
cord-269150-d1sgnxc0	82	2	-	-	HYPH
cord-269150-d1sgnxc0	82	3	528R	528r	CD
cord-269150-d1sgnxc0	83	1	pT_EGFP_F	pT_EGFP_F	NNP
cord-269150-d1sgnxc0	83	2	anti	anti	JJ
cord-269150-d1sgnxc0	83	3	-	-	JJ
cord-269150-d1sgnxc0	83	4	sense	sense	JJ
cord-269150-d1sgnxc0	83	5	3	3	CD
cord-269150-d1sgnxc0	83	6	0	0	CD
cord-269150-d1sgnxc0	83	7	-UTR	-utr	NN
cord-269150-d1sgnxc0	83	8	,	,	,
cord-269150-d1sgnxc0	83	9	which	which	WDT
cord-269150-d1sgnxc0	83	10	was	be	VBD
cord-269150-d1sgnxc0	83	11	not	not	RB
cord-269150-d1sgnxc0	83	12	required	require	VBN
cord-269150-d1sgnxc0	83	13	for	for	IN
cord-269150-d1sgnxc0	83	14	viral	viral	JJ
cord-269150-d1sgnxc0	83	15	protein	protein	NN
cord-269150-d1sgnxc0	83	16	translation	translation	NN
cord-269150-d1sgnxc0	84	1	,	,	,
cord-269150-d1sgnxc0	84	2	subsequent	subsequent	JJ
cord-269150-d1sgnxc0	84	3	functional	functional	JJ
cord-269150-d1sgnxc0	84	4	studies	study	NNS
cord-269150-d1sgnxc0	84	5	of	of	IN
cord-269150-d1sgnxc0	84	6	the	the	DT
cord-269150-d1sgnxc0	84	7	protein	protein	NN
cord-269150-d1sgnxc0	84	8	would	would	MD
cord-269150-d1sgnxc0	84	9	prove	prove	VB
cord-269150-d1sgnxc0	84	10	to	to	TO
cord-269150-d1sgnxc0	84	11	be	be	VB
cord-269150-d1sgnxc0	84	12	complicated	complicate	VBN
cord-269150-d1sgnxc0	84	13	as	as	IN
cord-269150-d1sgnxc0	84	14	the	the	DT
cord-269150-d1sgnxc0	84	15	virus	virus	NN
cord-269150-d1sgnxc0	84	16	itself	-PRON-	PRP
cord-269150-d1sgnxc0	84	17	relies	rely	VBZ
cord-269150-d1sgnxc0	84	18	heavily	heavily	RB
cord-269150-d1sgnxc0	84	19	on	on	IN
cord-269150-d1sgnxc0	84	20	the	the	DT
cord-269150-d1sgnxc0	84	21	host	host	NN
cord-269150-d1sgnxc0	84	22	ribosome	ribosome	NN
cord-269150-d1sgnxc0	84	23	to	to	TO
cord-269150-d1sgnxc0	84	24	translate	translate	VB
cord-269150-d1sgnxc0	84	25	viral	viral	JJ
cord-269150-d1sgnxc0	84	26	proteins	protein	NNS
cord-269150-d1sgnxc0	84	27	,	,	,
cord-269150-d1sgnxc0	84	28	necessary	necessary	JJ
cord-269150-d1sgnxc0	84	29	for	for	IN
cord-269150-d1sgnxc0	84	30	the	the	DT
cord-269150-d1sgnxc0	84	31	infection	infection	NN
cord-269150-d1sgnxc0	84	32	to	to	TO
cord-269150-d1sgnxc0	84	33	proceed	proceed	VB
cord-269150-d1sgnxc0	84	34	.	.	.
cord-269150-d1sgnxc0	85	1	Therefore	therefore	RB
cord-269150-d1sgnxc0	85	2	,	,	,
cord-269150-d1sgnxc0	85	3	it	-PRON-	PRP
cord-269150-d1sgnxc0	85	4	was	be	VBD
cord-269150-d1sgnxc0	85	5	not	not	RB
cord-269150-d1sgnxc0	85	6	chosen	choose	VBN
cord-269150-d1sgnxc0	85	7	for	for	IN
cord-269150-d1sgnxc0	85	8	further	further	JJ
cord-269150-d1sgnxc0	85	9	studies	study	NNS
cord-269150-d1sgnxc0	85	10	.	.	.
cord-269150-d1sgnxc0	86	1	HAX1	HAX1	NNP
cord-269150-d1sgnxc0	86	2	was	be	VBD
cord-269150-d1sgnxc0	86	3	reported	report	VBN
cord-269150-d1sgnxc0	86	4	to	to	TO
cord-269150-d1sgnxc0	86	5	function	function	VB
cord-269150-d1sgnxc0	86	6	as	as	IN
cord-269150-d1sgnxc0	86	7	an	an	DT
cord-269150-d1sgnxc0	86	8	anti	anti	JJ
cord-269150-d1sgnxc0	86	9	-	-	JJ
cord-269150-d1sgnxc0	86	10	apoptotic	apoptotic	JJ
cord-269150-d1sgnxc0	86	11	protein	protein	NN
cord-269150-d1sgnxc0	86	12	,	,	,
cord-269150-d1sgnxc0	86	13	which	which	WDT
cord-269150-d1sgnxc0	86	14	was	be	VBD
cord-269150-d1sgnxc0	86	15	not	not	RB
cord-269150-d1sgnxc0	86	16	the	the	DT
cord-269150-d1sgnxc0	86	17	focus	focus	NN
cord-269150-d1sgnxc0	86	18	of	of	IN
cord-269150-d1sgnxc0	86	19	our	-PRON-	PRP$
cord-269150-d1sgnxc0	86	20	screen	screen	NN
cord-269150-d1sgnxc0	86	21	and	and	CC
cord-269150-d1sgnxc0	86	22	was	be	VBD
cord-269150-d1sgnxc0	86	23	therefore	therefore	RB
cord-269150-d1sgnxc0	86	24	not	not	RB
cord-269150-d1sgnxc0	86	25	chosen	choose	VBN
cord-269150-d1sgnxc0	86	26	for	for	IN
cord-269150-d1sgnxc0	86	27	further	further	JJ
cord-269150-d1sgnxc0	86	28	studies	study	NNS
cord-269150-d1sgnxc0	86	29	as	as	RB
cord-269150-d1sgnxc0	86	30	well	well	RB
cord-269150-d1sgnxc0	86	31	.	.	.
cord-269150-d1sgnxc0	87	1	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	87	2	was	be	VBD
cord-269150-d1sgnxc0	87	3	reported	report	VBN
cord-269150-d1sgnxc0	87	4	as	as	IN
cord-269150-d1sgnxc0	87	5	a	a	DT
cord-269150-d1sgnxc0	87	6	member	member	NN
cord-269150-d1sgnxc0	87	7	of	of	IN
cord-269150-d1sgnxc0	87	8	the	the	DT
cord-269150-d1sgnxc0	87	9	alternative	alternative	JJ
cord-269150-d1sgnxc0	87	10	splicing	splicing	NN
cord-269150-d1sgnxc0	87	11	pathway	pathway	NN
cord-269150-d1sgnxc0	87	12	,	,	,
cord-269150-d1sgnxc0	87	13	which	which	WDT
cord-269150-d1sgnxc0	87	14	implied	imply	VBD
cord-269150-d1sgnxc0	87	15	a	a	DT
cord-269150-d1sgnxc0	87	16	possible	possible	JJ
cord-269150-d1sgnxc0	87	17	role	role	NN
cord-269150-d1sgnxc0	87	18	in	in	IN
cord-269150-d1sgnxc0	87	19	facilitating	facilitate	VBG
cord-269150-d1sgnxc0	87	20	distal	distal	JJ
cord-269150-d1sgnxc0	87	21	RNA	RNA	NNP
cord-269150-d1sgnxc0	87	22	sequences	sequence	NNS
cord-269150-d1sgnxc0	87	23	to	to	TO
cord-269150-d1sgnxc0	87	24	be	be	VB
cord-269150-d1sgnxc0	87	25	brought	bring	VBN
cord-269150-d1sgnxc0	87	26	into	into	IN
cord-269150-d1sgnxc0	87	27	close	close	JJ
cord-269150-d1sgnxc0	87	28	proximity	proximity	NN
cord-269150-d1sgnxc0	87	29	,	,	,
cord-269150-d1sgnxc0	87	30	corresponded	correspond	VBD
cord-269150-d1sgnxc0	87	31	well	well	RB
cord-269150-d1sgnxc0	87	32	with	with	IN
cord-269150-d1sgnxc0	87	33	current	current	JJ
cord-269150-d1sgnxc0	87	34	evidence	evidence	NN
cord-269150-d1sgnxc0	87	35	on	on	IN
cord-269150-d1sgnxc0	87	36	the	the	DT
cord-269150-d1sgnxc0	87	37	mechanism	mechanism	NN
cord-269150-d1sgnxc0	87	38	of	of	IN
cord-269150-d1sgnxc0	87	39	discontinuous	discontinuous	JJ
cord-269150-d1sgnxc0	87	40	transcription	transcription	NN
cord-269150-d1sgnxc0	87	41	.	.	.
cord-269150-d1sgnxc0	88	1	Therefore	therefore	RB
cord-269150-d1sgnxc0	88	2	,	,	,
cord-269150-d1sgnxc0	88	3	it	-PRON-	PRP
cord-269150-d1sgnxc0	88	4	was	be	VBD
cord-269150-d1sgnxc0	88	5	chosen	choose	VBN
cord-269150-d1sgnxc0	88	6	as	as	IN
cord-269150-d1sgnxc0	88	7	the	the	DT
cord-269150-d1sgnxc0	88	8	sole	sole	JJ
cord-269150-d1sgnxc0	88	9	target	target	NN
cord-269150-d1sgnxc0	88	10	for	for	IN
cord-269150-d1sgnxc0	88	11	this	this	DT
cord-269150-d1sgnxc0	88	12	study	study	NN
cord-269150-d1sgnxc0	88	13	.	.	.
cord-269150-d1sgnxc0	89	1	The	the	DT
cord-269150-d1sgnxc0	89	2	5	5	CD
cord-269150-d1sgnxc0	89	3	0	0	CD
cord-269150-d1sgnxc0	89	4	-UTR	-utr	NN
cord-269150-d1sgnxc0	89	5	of	of	IN
cord-269150-d1sgnxc0	89	6	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	89	7	genomic	genomic	JJ
cord-269150-d1sgnxc0	89	8	RNA	RNA	NNP
cord-269150-d1sgnxc0	89	9	interacts	interact	VBZ
cord-269150-d1sgnxc0	89	10	specifically	specifically	RB
cord-269150-d1sgnxc0	89	11	with	with	IN
cord-269150-d1sgnxc0	89	12	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	90	1	The	the	DT
cord-269150-d1sgnxc0	90	2	interaction	interaction	NN
cord-269150-d1sgnxc0	90	3	between	between	IN
cord-269150-d1sgnxc0	90	4	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	90	5	and	and	CC
cord-269150-d1sgnxc0	90	6	the	the	DT
cord-269150-d1sgnxc0	90	7	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	90	8	5	5	CD
cord-269150-d1sgnxc0	90	9	0	0	CD
cord-269150-d1sgnxc0	90	10	-UTR	-utr	NN
cord-269150-d1sgnxc0	90	11	was	be	VBD
cord-269150-d1sgnxc0	90	12	confirmed	confirm	VBN
cord-269150-d1sgnxc0	90	13	by	by	IN
cord-269150-d1sgnxc0	90	14	using	use	VBG
cord-269150-d1sgnxc0	90	15	over	over	RB
cord-269150-d1sgnxc0	90	16	-	-	HYPH
cord-269150-d1sgnxc0	90	17	expressed	express	VBN
cord-269150-d1sgnxc0	90	18	Flag	Flag	NNP
cord-269150-d1sgnxc0	90	19	-	-	HYPH
cord-269150-d1sgnxc0	90	20	tagged	tagged	NNP
cord-269150-d1sgnxc0	90	21	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	90	22	in	in	IN
cord-269150-d1sgnxc0	90	23	a	a	DT
cord-269150-d1sgnxc0	90	24	biotin	biotin	NN
cord-269150-d1sgnxc0	90	25	-	-	HYPH
cord-269150-d1sgnxc0	90	26	RNA	rna	NN
cord-269150-d1sgnxc0	90	27	pull	pull	VB
cord-269150-d1sgnxc0	90	28	-	-	HYPH
cord-269150-d1sgnxc0	90	29	down	down	RP
cord-269150-d1sgnxc0	90	30	assay	assay	NN
cord-269150-d1sgnxc0	90	31	.	.	.
cord-269150-d1sgnxc0	91	1	Based	base	VBN
cord-269150-d1sgnxc0	91	2	on	on	IN
cord-269150-d1sgnxc0	91	3	the	the	DT
cord-269150-d1sgnxc0	91	4	efficiency	efficiency	NN
cord-269150-d1sgnxc0	91	5	of	of	IN
cord-269150-d1sgnxc0	91	6	Flag	Flag	NNP
cord-269150-d1sgnxc0	91	7	-	-	HYPH
cord-269150-d1sgnxc0	91	8	tagged	tagged	NNP
cord-269150-d1sgnxc0	91	9	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	91	10	co	co	NN
cord-269150-d1sgnxc0	91	11	-	-	NN
cord-269150-d1sgnxc0	91	12	purification	purification	NN
cord-269150-d1sgnxc0	91	13	with	with	IN
cord-269150-d1sgnxc0	91	14	the	the	DT
cord-269150-d1sgnxc0	91	15	biotinylated	biotinylated	JJ
cord-269150-d1sgnxc0	91	16	RNA	RNA	NNP
cord-269150-d1sgnxc0	91	17	,	,	,
cord-269150-d1sgnxc0	91	18	the	the	DT
cord-269150-d1sgnxc0	91	19	full	full	JJ
cord-269150-d1sgnxc0	91	20	-	-	HYPH
cord-269150-d1sgnxc0	91	21	length	length	NN
cord-269150-d1sgnxc0	91	22	,	,	,
cord-269150-d1sgnxc0	91	23	mammalian	mammalian	NN
cord-269150-d1sgnxc0	91	24	-	-	HYPH
cord-269150-d1sgnxc0	91	25	expressed	express	VBN
cord-269150-d1sgnxc0	91	26	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	91	27	was	be	VBD
cord-269150-d1sgnxc0	91	28	found	find	VBN
cord-269150-d1sgnxc0	91	29	to	to	TO
cord-269150-d1sgnxc0	91	30	be	be	VB
cord-269150-d1sgnxc0	91	31	able	able	JJ
cord-269150-d1sgnxc0	91	32	to	to	TO
cord-269150-d1sgnxc0	91	33	interact	interact	VB
cord-269150-d1sgnxc0	91	34	with	with	IN
cord-269150-d1sgnxc0	91	35	the	the	DT
cord-269150-d1sgnxc0	91	36	5	5	CD
cord-269150-d1sgnxc0	91	37	0	0	CD
cord-269150-d1sgnxc0	91	38	-UTR	-utr	NN
cord-269150-d1sgnxc0	91	39	of	of	IN
cord-269150-d1sgnxc0	91	40	IBV	IBV	NNP
cord-269150-d1sgnxc0	91	41	and	and	CC
cord-269150-d1sgnxc0	91	42	SARS	SARS	NNP
cord-269150-d1sgnxc0	91	43	-	-	HYPH
cord-269150-d1sgnxc0	91	44	CoV	CoV	NNP
cord-269150-d1sgnxc0	91	45	RNA	RNA	NNP
cord-269150-d1sgnxc0	91	46	(	(	-LRB-
cord-269150-d1sgnxc0	91	47	Figure	Figure	NNP
cord-269150-d1sgnxc0	91	48	1A	1a	NN
cord-269150-d1sgnxc0	91	49	)	)	-RRB-
cord-269150-d1sgnxc0	91	50	.	.	.
cord-269150-d1sgnxc0	92	1	Over	over	RB
cord-269150-d1sgnxc0	92	2	-	-	HYPH
cord-269150-d1sgnxc0	92	3	expressed	express	VBN
cord-269150-d1sgnxc0	92	4	Flag	Flag	NNP
cord-269150-d1sgnxc0	92	5	-	-	HYPH
cord-269150-d1sgnxc0	92	6	tagged	tag	VBN
cord-269150-d1sgnxc0	92	7	protein	protein	NN
cord-269150-d1sgnxc0	92	8	was	be	VBD
cord-269150-d1sgnxc0	92	9	used	use	VBN
cord-269150-d1sgnxc0	92	10	to	to	TO
cord-269150-d1sgnxc0	92	11	facilitate	facilitate	VB
cord-269150-d1sgnxc0	92	12	detection	detection	NN
cord-269150-d1sgnxc0	92	13	,	,	,
cord-269150-d1sgnxc0	92	14	as	as	IN
cord-269150-d1sgnxc0	92	15	there	there	EX
cord-269150-d1sgnxc0	92	16	was	be	VBD
cord-269150-d1sgnxc0	92	17	no	no	DT
cord-269150-d1sgnxc0	92	18	commercially	commercially	RB
cord-269150-d1sgnxc0	92	19	available	available	JJ
cord-269150-d1sgnxc0	92	20	antibody	antibody	NN
cord-269150-d1sgnxc0	92	21	to	to	IN
cord-269150-d1sgnxc0	92	22	the	the	DT
cord-269150-d1sgnxc0	92	23	protein	protein	NN
cord-269150-d1sgnxc0	92	24	at	at	IN
cord-269150-d1sgnxc0	92	25	that	that	DT
cord-269150-d1sgnxc0	92	26	time	time	NN
cord-269150-d1sgnxc0	92	27	.	.	.
cord-269150-d1sgnxc0	93	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	93	2	was	be	VBD
cord-269150-d1sgnxc0	93	3	noted	note	VBN
cord-269150-d1sgnxc0	93	4	that	that	IN
cord-269150-d1sgnxc0	93	5	IBV	IBV	NNP
cord-269150-d1sgnxc0	93	6	5	5	CD
cord-269150-d1sgnxc0	93	7	0	0	CD
cord-269150-d1sgnxc0	93	8	-UTR	-utr	NN
cord-269150-d1sgnxc0	93	9	showed	show	VBD
cord-269150-d1sgnxc0	93	10	higher	high	JJR
cord-269150-d1sgnxc0	93	11	binding	bind	VBG
cord-269150-d1sgnxc0	93	12	affinity	affinity	NN
cord-269150-d1sgnxc0	93	13	to	to	IN
cord-269150-d1sgnxc0	93	14	the	the	DT
cord-269150-d1sgnxc0	93	15	Flag	Flag	NNP
cord-269150-d1sgnxc0	93	16	-	-	HYPH
cord-269150-d1sgnxc0	93	17	tagged	tagged	NNP
cord-269150-d1sgnxc0	93	18	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	93	19	than	than	IN
cord-269150-d1sgnxc0	93	20	did	do	VBD
cord-269150-d1sgnxc0	93	21	SARS	SARS	NNP
cord-269150-d1sgnxc0	93	22	-	-	HYPH
cord-269150-d1sgnxc0	93	23	CoV	CoV	NNP
cord-269150-d1sgnxc0	93	24	5	5	CD
cord-269150-d1sgnxc0	93	25	0	0	CD
cord-269150-d1sgnxc0	93	26	-UTR	-UTR	.
cord-269150-d1sgnxc0	94	1	(	(	-LRB-
cord-269150-d1sgnxc0	94	2	Figure	figure	NN
cord-269150-d1sgnxc0	94	3	1A	1a	NN
cord-269150-d1sgnxc0	94	4	)	)	-RRB-
cord-269150-d1sgnxc0	94	5	.	.	.
cord-269150-d1sgnxc0	95	1	The	the	DT
cord-269150-d1sgnxc0	95	2	specific	specific	JJ
cord-269150-d1sgnxc0	95	3	interaction	interaction	NN
cord-269150-d1sgnxc0	95	4	between	between	IN
cord-269150-d1sgnxc0	95	5	IBV	IBV	NNP
cord-269150-d1sgnxc0	95	6	5	5	CD
cord-269150-d1sgnxc0	95	7	0	0	CD
cord-269150-d1sgnxc0	95	8	-UTR	-UTR	.
cord-269150-d1sgnxc0	96	1	and	and	CC
cord-269150-d1sgnxc0	96	2	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	96	3	and	and	CC
cord-269150-d1sgnxc0	96	4	its	-PRON-	PRP$
cord-269150-d1sgnxc0	96	5	functional	functional	JJ
cord-269150-d1sgnxc0	96	6	implication	implication	NN
cord-269150-d1sgnxc0	96	7	in	in	IN
cord-269150-d1sgnxc0	96	8	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	96	9	replication	replication	NN
cord-269150-d1sgnxc0	96	10	were	be	VBD
cord-269150-d1sgnxc0	96	11	therefore	therefore	RB
cord-269150-d1sgnxc0	96	12	chosen	choose	VBN
cord-269150-d1sgnxc0	96	13	for	for	IN
cord-269150-d1sgnxc0	96	14	subsequent	subsequent	JJ
cord-269150-d1sgnxc0	96	15	characterization	characterization	NN
cord-269150-d1sgnxc0	96	16	.	.	.
cord-269150-d1sgnxc0	97	1	To	to	TO
cord-269150-d1sgnxc0	97	2	check	check	VB
cord-269150-d1sgnxc0	97	3	the	the	DT
cord-269150-d1sgnxc0	97	4	specificity	specificity	NN
cord-269150-d1sgnxc0	97	5	of	of	IN
cord-269150-d1sgnxc0	97	6	the	the	DT
cord-269150-d1sgnxc0	97	7	interaction	interaction	NN
cord-269150-d1sgnxc0	97	8	,	,	,
cord-269150-d1sgnxc0	97	9	a	a	DT
cord-269150-d1sgnxc0	97	10	competition	competition	NN
cord-269150-d1sgnxc0	97	11	assay	assay	NN
cord-269150-d1sgnxc0	97	12	based	base	VBN
cord-269150-d1sgnxc0	97	13	on	on	IN
cord-269150-d1sgnxc0	97	14	the	the	DT
cord-269150-d1sgnxc0	97	15	biotin	biotin	NNP
cord-269150-d1sgnxc0	97	16	-	-	HYPH
cord-269150-d1sgnxc0	97	17	RNA	rna	NN
cord-269150-d1sgnxc0	97	18	pull	pull	VB
cord-269150-d1sgnxc0	97	19	-	-	HYPH
cord-269150-d1sgnxc0	97	20	down	down	RP
cord-269150-d1sgnxc0	97	21	assay	assay	NN
cord-269150-d1sgnxc0	97	22	was	be	VBD
cord-269150-d1sgnxc0	97	23	performed	perform	VBN
cord-269150-d1sgnxc0	97	24	.	.	.
cord-269150-d1sgnxc0	98	1	Total	total	JJ
cord-269150-d1sgnxc0	98	2	cell	cell	NN
cord-269150-d1sgnxc0	98	3	lysates	lysate	NNS
cord-269150-d1sgnxc0	98	4	containing	contain	VBG
cord-269150-d1sgnxc0	98	5	Flag	Flag	NNP
cord-269150-d1sgnxc0	98	6	-	-	HYPH
cord-269150-d1sgnxc0	98	7	tagged	tagged	NNP
cord-269150-d1sgnxc0	98	8	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	98	9	were	be	VBD
cord-269150-d1sgnxc0	98	10	incubated	incubate	VBN
cord-269150-d1sgnxc0	98	11	with	with	IN
cord-269150-d1sgnxc0	98	12	0.1	0.1	CD
cord-269150-d1sgnxc0	98	13	mM	mm	CD
cord-269150-d1sgnxc0	98	14	biotinylated	biotinylate	VBN
cord-269150-d1sgnxc0	98	15	IBV	IBV	NNP
cord-269150-d1sgnxc0	98	16	5	5	CD
cord-269150-d1sgnxc0	98	17	0	0	CD
cord-269150-d1sgnxc0	98	18	-UTR	-utr	NN
cord-269150-d1sgnxc0	98	19	in	in	IN
cord-269150-d1sgnxc0	98	20	the	the	DT
cord-269150-d1sgnxc0	98	21	presence	presence	NN
cord-269150-d1sgnxc0	98	22	of	of	IN
cord-269150-d1sgnxc0	98	23	increasing	increase	VBG
cord-269150-d1sgnxc0	98	24	concentrations	concentration	NNS
cord-269150-d1sgnxc0	98	25	of	of	IN
cord-269150-d1sgnxc0	98	26	either	either	DT
cord-269150-d1sgnxc0	98	27	unlabeled	unlabeled	JJ
cord-269150-d1sgnxc0	98	28	specific	specific	JJ
cord-269150-d1sgnxc0	98	29	competitor	competitor	NN
cord-269150-d1sgnxc0	98	30	RNA	RNA	NNP
cord-269150-d1sgnxc0	98	31	probe	probe	NN
cord-269150-d1sgnxc0	98	32	(	(	-LRB-
cord-269150-d1sgnxc0	98	33	IBV	IBV	NNP
cord-269150-d1sgnxc0	98	34	5	5	CD
cord-269150-d1sgnxc0	98	35	0	0	CD
cord-269150-d1sgnxc0	98	36	-UTR	-utr	NN
cord-269150-d1sgnxc0	98	37	)	)	-RRB-
cord-269150-d1sgnxc0	98	38	or	or	CC
cord-269150-d1sgnxc0	98	39	unlabeled	unlabeled	JJ
cord-269150-d1sgnxc0	98	40	non	non	JJ
cord-269150-d1sgnxc0	98	41	-	-	JJ
cord-269150-d1sgnxc0	98	42	specific	specific	JJ
cord-269150-d1sgnxc0	98	43	probe	probe	NN
cord-269150-d1sgnxc0	98	44	(	(	-LRB-
cord-269150-d1sgnxc0	98	45	EGFP	EGFP	NNP
cord-269150-d1sgnxc0	98	46	RNA	RNA	NNP
cord-269150-d1sgnxc0	98	47	)	)	-RRB-
cord-269150-d1sgnxc0	98	48	composed	compose	VBN
cord-269150-d1sgnxc0	98	49	of	of	IN
cord-269150-d1sgnxc0	98	50	nucleotides	nucleotide	NNS
cord-269150-d1sgnxc0	98	51	1	1	CD
cord-269150-d1sgnxc0	98	52	-	-	SYM
cord-269150-d1sgnxc0	98	53	528	528	CD
cord-269150-d1sgnxc0	98	54	of	of	IN
cord-269150-d1sgnxc0	98	55	the	the	DT
cord-269150-d1sgnxc0	98	56	EGFP	EGFP	NNP
cord-269150-d1sgnxc0	98	57	coding	coding	NN
cord-269150-d1sgnxc0	98	58	sequence	sequence	NN
cord-269150-d1sgnxc0	98	59	,	,	,
cord-269150-d1sgnxc0	98	60	from	from	IN
cord-269150-d1sgnxc0	98	61	0	0	CD
cord-269150-d1sgnxc0	98	62	to	to	IN
cord-269150-d1sgnxc0	98	63	0.2	0.2	CD
cord-269150-d1sgnxc0	98	64	mM.	mm.	JJ
cord-269150-d1sgnxc0	98	65	Western	western	JJ
cord-269150-d1sgnxc0	98	66	blot	blot	NN
cord-269150-d1sgnxc0	98	67	analysis	analysis	NN
cord-269150-d1sgnxc0	98	68	of	of	IN
cord-269150-d1sgnxc0	98	69	the	the	DT
cord-269150-d1sgnxc0	98	70	co	co	NN
cord-269150-d1sgnxc0	98	71	-	-	JJ
cord-269150-d1sgnxc0	98	72	purified	purify	VBN
cord-269150-d1sgnxc0	98	73	Flag	Flag	NNP
cord-269150-d1sgnxc0	98	74	-	-	HYPH
cord-269150-d1sgnxc0	98	75	tagged	tag	VBN
cord-269150-d1sgnxc0	98	76	protein	protein	NN
cord-269150-d1sgnxc0	98	77	showed	show	VBD
cord-269150-d1sgnxc0	98	78	that	that	IN
cord-269150-d1sgnxc0	98	79	increasing	increase	VBG
cord-269150-d1sgnxc0	98	80	concentrations	concentration	NNS
cord-269150-d1sgnxc0	98	81	of	of	IN
cord-269150-d1sgnxc0	98	82	unlabeled	unlabeled	JJ
cord-269150-d1sgnxc0	98	83	specific	specific	JJ
cord-269150-d1sgnxc0	98	84	competitor	competitor	NN
cord-269150-d1sgnxc0	98	85	RNA	RNA	NNP
cord-269150-d1sgnxc0	98	86	led	lead	VBD
cord-269150-d1sgnxc0	98	87	to	to	IN
cord-269150-d1sgnxc0	98	88	the	the	DT
cord-269150-d1sgnxc0	98	89	decreasing	decrease	VBG
cord-269150-d1sgnxc0	98	90	co	co	NN
cord-269150-d1sgnxc0	98	91	-	-	NN
cord-269150-d1sgnxc0	98	92	purification	purification	NN
cord-269150-d1sgnxc0	98	93	of	of	IN
cord-269150-d1sgnxc0	98	94	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	98	95	with	with	IN
cord-269150-d1sgnxc0	98	96	the	the	DT
cord-269150-d1sgnxc0	98	97	biotinylated	biotinylate	VBN
cord-269150-d1sgnxc0	98	98	RNA	RNA	NNP
cord-269150-d1sgnxc0	98	99	probe	probe	NN
cord-269150-d1sgnxc0	98	100	(	(	-LRB-
cord-269150-d1sgnxc0	98	101	Figure	figure	NN
cord-269150-d1sgnxc0	98	102	1B	1b	CD
cord-269150-d1sgnxc0	98	103	)	)	-RRB-
cord-269150-d1sgnxc0	98	104	.	.	.
cord-269150-d1sgnxc0	99	1	However	however	RB
cord-269150-d1sgnxc0	99	2	,	,	,
cord-269150-d1sgnxc0	99	3	increasing	increase	VBG
cord-269150-d1sgnxc0	99	4	concentrations	concentration	NNS
cord-269150-d1sgnxc0	99	5	of	of	IN
cord-269150-d1sgnxc0	99	6	unlabeled	unlabeled	JJ
cord-269150-d1sgnxc0	99	7	non	non	JJ
cord-269150-d1sgnxc0	99	8	-	-	JJ
cord-269150-d1sgnxc0	99	9	specific	specific	JJ
cord-269150-d1sgnxc0	99	10	competitor	competitor	NN
cord-269150-d1sgnxc0	99	11	RNA	RNA	NNP
cord-269150-d1sgnxc0	99	12	did	do	VBD
cord-269150-d1sgnxc0	99	13	not	not	RB
cord-269150-d1sgnxc0	99	14	result	result	VB
cord-269150-d1sgnxc0	99	15	in	in	IN
cord-269150-d1sgnxc0	99	16	detectable	detectable	JJ
cord-269150-d1sgnxc0	99	17	change	change	NN
cord-269150-d1sgnxc0	99	18	to	to	IN
cord-269150-d1sgnxc0	99	19	the	the	DT
cord-269150-d1sgnxc0	99	20	efficiency	efficiency	NN
cord-269150-d1sgnxc0	99	21	of	of	IN
cord-269150-d1sgnxc0	99	22	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	99	23	co	co	NN
cord-269150-d1sgnxc0	99	24	-	-	NN
cord-269150-d1sgnxc0	99	25	purification	purification	JJ
cord-269150-d1sgnxc0	99	26	(	(	-LRB-
cord-269150-d1sgnxc0	99	27	Figure	figure	NN
cord-269150-d1sgnxc0	99	28	1B	1b	CD
cord-269150-d1sgnxc0	99	29	)	)	-RRB-
cord-269150-d1sgnxc0	99	30	.	.	.
cord-269150-d1sgnxc0	100	1	Simultaneously	simultaneously	RB
cord-269150-d1sgnxc0	100	2	,	,	,
cord-269150-d1sgnxc0	100	3	a	a	DT
cord-269150-d1sgnxc0	100	4	protein	protein	NN
cord-269150-d1sgnxc0	100	5	exhibiting	exhibit	VBG
cord-269150-d1sgnxc0	100	6	a	a	DT
cord-269150-d1sgnxc0	100	7	non	non	JJ
cord-269150-d1sgnxc0	100	8	-	-	JJ
cord-269150-d1sgnxc0	100	9	specific	specific	JJ
cord-269150-d1sgnxc0	100	10	RNA	rna	NN
cord-269150-d1sgnxc0	100	11	-	-	HYPH
cord-269150-d1sgnxc0	100	12	binding	bind	VBG
cord-269150-d1sgnxc0	100	13	activity	activity	NN
cord-269150-d1sgnxc0	100	14	,	,	,
cord-269150-d1sgnxc0	100	15	the	the	DT
cord-269150-d1sgnxc0	100	16	Flag	Flag	NNP
cord-269150-d1sgnxc0	100	17	-	-	HYPH
cord-269150-d1sgnxc0	100	18	tagged	tagged	NNP
cord-269150-d1sgnxc0	100	19	IBV	IBV	NNP
cord-269150-d1sgnxc0	100	20	-	-	HYPH
cord-269150-d1sgnxc0	100	21	N	N	NNP
cord-269150-d1sgnxc0	100	22	,	,	,
cord-269150-d1sgnxc0	100	23	was	be	VBD
cord-269150-d1sgnxc0	100	24	used	use	VBN
cord-269150-d1sgnxc0	100	25	as	as	IN
cord-269150-d1sgnxc0	100	26	a	a	DT
cord-269150-d1sgnxc0	100	27	control	control	NN
cord-269150-d1sgnxc0	100	28	.	.	.
cord-269150-d1sgnxc0	101	1	Total	total	JJ
cord-269150-d1sgnxc0	101	2	cell	cell	NN
cord-269150-d1sgnxc0	101	3	lysates	lysate	NNS
cord-269150-d1sgnxc0	101	4	containing	contain	VBG
cord-269150-d1sgnxc0	101	5	the	the	DT
cord-269150-d1sgnxc0	101	6	Flag	Flag	NNP
cord-269150-d1sgnxc0	101	7	-	-	HYPH
cord-269150-d1sgnxc0	101	8	tagged	tagged	NNP
cord-269150-d1sgnxc0	101	9	IBV	IBV	NNP
cord-269150-d1sgnxc0	101	10	N	N	NNP
cord-269150-d1sgnxc0	101	11	protein	protein	NN
cord-269150-d1sgnxc0	101	12	was	be	VBD
cord-269150-d1sgnxc0	101	13	incubated	incubate	VBN
cord-269150-d1sgnxc0	101	14	with	with	IN
cord-269150-d1sgnxc0	101	15	0.1	0.1	CD
cord-269150-d1sgnxc0	101	16	mM	mm	CD
cord-269150-d1sgnxc0	101	17	of	of	IN
cord-269150-d1sgnxc0	101	18	the	the	DT
cord-269150-d1sgnxc0	101	19	biotinylated	biotinylated	JJ
cord-269150-d1sgnxc0	101	20	IBV	IBV	NNP
cord-269150-d1sgnxc0	101	21	3	3	CD
cord-269150-d1sgnxc0	101	22	0	0	CD
cord-269150-d1sgnxc0	101	23	-UTR	-utr	NN
cord-269150-d1sgnxc0	101	24	,	,	,
cord-269150-d1sgnxc0	101	25	in	in	IN
cord-269150-d1sgnxc0	101	26	the	the	DT
cord-269150-d1sgnxc0	101	27	presence	presence	NN
cord-269150-d1sgnxc0	101	28	of	of	IN
cord-269150-d1sgnxc0	101	29	increasing	increase	VBG
cord-269150-d1sgnxc0	101	30	concentrations	concentration	NNS
cord-269150-d1sgnxc0	101	31	of	of	IN
cord-269150-d1sgnxc0	101	32	either	either	CC
cord-269150-d1sgnxc0	101	33	the	the	DT
cord-269150-d1sgnxc0	101	34	unlabeled	unlabeled	JJ
cord-269150-d1sgnxc0	101	35	specific	specific	JJ
cord-269150-d1sgnxc0	101	36	probe	probe	NN
cord-269150-d1sgnxc0	101	37	or	or	CC
cord-269150-d1sgnxc0	101	38	an	an	DT
cord-269150-d1sgnxc0	101	39	unlabeled	unlabeled	JJ
cord-269150-d1sgnxc0	101	40	non	non	JJ
cord-269150-d1sgnxc0	101	41	-	-	JJ
cord-269150-d1sgnxc0	101	42	specific	specific	JJ
cord-269150-d1sgnxc0	101	43	probe	probe	NN
cord-269150-d1sgnxc0	101	44	,	,	,
cord-269150-d1sgnxc0	101	45	EGFP	EGFP	NNP
cord-269150-d1sgnxc0	101	46	RNA	RNA	NNP
cord-269150-d1sgnxc0	101	47	,	,	,
cord-269150-d1sgnxc0	101	48	of	of	IN
cord-269150-d1sgnxc0	101	49	an	an	DT
cord-269150-d1sgnxc0	101	50	equal	equal	JJ
cord-269150-d1sgnxc0	101	51	length	length	NN
cord-269150-d1sgnxc0	101	52	.	.	.
cord-269150-d1sgnxc0	102	1	Western	western	JJ
cord-269150-d1sgnxc0	102	2	blot	blot	NN
cord-269150-d1sgnxc0	102	3	detection	detection	NN
cord-269150-d1sgnxc0	102	4	of	of	IN
cord-269150-d1sgnxc0	102	5	the	the	DT
cord-269150-d1sgnxc0	102	6	co	co	NN
cord-269150-d1sgnxc0	102	7	-	-	JJ
cord-269150-d1sgnxc0	102	8	purified	purify	VBN
cord-269150-d1sgnxc0	102	9	Flag	Flag	NNP
cord-269150-d1sgnxc0	102	10	-	-	HYPH
cord-269150-d1sgnxc0	102	11	tagged	tagged	NNP
cord-269150-d1sgnxc0	102	12	N	N	NNP
cord-269150-d1sgnxc0	102	13	protein	protein	NN
cord-269150-d1sgnxc0	102	14	revealed	reveal	VBD
cord-269150-d1sgnxc0	102	15	that	that	IN
cord-269150-d1sgnxc0	102	16	increasing	increase	VBG
cord-269150-d1sgnxc0	102	17	concentrations	concentration	NNS
cord-269150-d1sgnxc0	102	18	of	of	IN
cord-269150-d1sgnxc0	102	19	both	both	DT
cord-269150-d1sgnxc0	102	20	unlabeled	unlabeled	JJ
cord-269150-d1sgnxc0	102	21	RNA	RNA	NNP
cord-269150-d1sgnxc0	102	22	probes	probe	NNS
cord-269150-d1sgnxc0	102	23	increasingly	increasingly	RB
cord-269150-d1sgnxc0	102	24	reduced	reduce	VBD
cord-269150-d1sgnxc0	102	25	the	the	DT
cord-269150-d1sgnxc0	102	26	efficiency	efficiency	NN
cord-269150-d1sgnxc0	102	27	of	of	IN
cord-269150-d1sgnxc0	102	28	N	N	NNP
cord-269150-d1sgnxc0	102	29	protein	protein	NN
cord-269150-d1sgnxc0	102	30	co	co	NN
cord-269150-d1sgnxc0	102	31	-	-	NN
cord-269150-d1sgnxc0	102	32	purification	purification	NN
cord-269150-d1sgnxc0	102	33	with	with	IN
cord-269150-d1sgnxc0	102	34	the	the	DT
cord-269150-d1sgnxc0	102	35	biotinylated	biotinylate	VBN
cord-269150-d1sgnxc0	102	36	RNA	RNA	NNP
cord-269150-d1sgnxc0	102	37	probes	probe	NNS
cord-269150-d1sgnxc0	102	38	(	(	-LRB-
cord-269150-d1sgnxc0	102	39	Figure	figure	NN
cord-269150-d1sgnxc0	102	40	1B	1b	CD
cord-269150-d1sgnxc0	102	41	)	)	-RRB-
cord-269150-d1sgnxc0	102	42	.	.	.
cord-269150-d1sgnxc0	103	1	These	these	DT
cord-269150-d1sgnxc0	103	2	results	result	NNS
cord-269150-d1sgnxc0	103	3	confirmed	confirm	VBD
cord-269150-d1sgnxc0	103	4	that	that	IN
cord-269150-d1sgnxc0	103	5	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	103	6	could	could	MD
cord-269150-d1sgnxc0	103	7	interact	interact	VB
cord-269150-d1sgnxc0	103	8	specifically	specifically	RB
cord-269150-d1sgnxc0	103	9	with	with	IN
cord-269150-d1sgnxc0	103	10	the	the	DT
cord-269150-d1sgnxc0	103	11	5	5	CD
cord-269150-d1sgnxc0	103	12	0	0	CD
cord-269150-d1sgnxc0	103	13	-UTR	-utr	NN
cord-269150-d1sgnxc0	103	14	of	of	IN
cord-269150-d1sgnxc0	103	15	IBV	IBV	NNP
cord-269150-d1sgnxc0	103	16	RNA	RNA	NNP
cord-269150-d1sgnxc0	103	17	.	.	.
cord-269150-d1sgnxc0	104	1	Over	over	RB
cord-269150-d1sgnxc0	104	2	-	-	HYPH
cord-269150-d1sgnxc0	104	3	expressed	express	VBN
cord-269150-d1sgnxc0	104	4	Flag	Flag	NNP
cord-269150-d1sgnxc0	104	5	-	-	HYPH
cord-269150-d1sgnxc0	104	6	tagged	tagged	NNP
cord-269150-d1sgnxc0	104	7	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	104	8	translocates	translocate	NNS
cord-269150-d1sgnxc0	104	9	from	from	IN
cord-269150-d1sgnxc0	104	10	the	the	DT
cord-269150-d1sgnxc0	104	11	nucleus	nucleus	NN
cord-269150-d1sgnxc0	104	12	to	to	IN
cord-269150-d1sgnxc0	104	13	the	the	DT
cord-269150-d1sgnxc0	104	14	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	105	1	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	105	2	was	be	VBD
cord-269150-d1sgnxc0	105	3	identified	identify	VBN
cord-269150-d1sgnxc0	105	4	as	as	IN
cord-269150-d1sgnxc0	105	5	a	a	DT
cord-269150-d1sgnxc0	105	6	component	component	NN
cord-269150-d1sgnxc0	105	7	of	of	IN
cord-269150-d1sgnxc0	105	8	the	the	DT
cord-269150-d1sgnxc0	105	9	18	18	CD
cord-269150-d1sgnxc0	105	10	S	S	NNP
cord-269150-d1sgnxc0	105	11	U11/12	u11/12	JJ
cord-269150-d1sgnxc0	105	12	snRNP	snrnp	NN
cord-269150-d1sgnxc0	105	13	(	(	-LRB-
cord-269150-d1sgnxc0	105	14	37	37	CD
cord-269150-d1sgnxc0	105	15	)	)	-RRB-
cord-269150-d1sgnxc0	105	16	and	and	CC
cord-269150-d1sgnxc0	105	17	its	-PRON-	PRP$
cord-269150-d1sgnxc0	105	18	subcellular	subcellular	JJ
cord-269150-d1sgnxc0	105	19	localization	localization	NN
cord-269150-d1sgnxc0	105	20	was	be	VBD
cord-269150-d1sgnxc0	105	21	determined	determine	VBN
cord-269150-d1sgnxc0	105	22	to	to	TO
cord-269150-d1sgnxc0	105	23	be	be	VB
cord-269150-d1sgnxc0	105	24	in	in	IN
cord-269150-d1sgnxc0	105	25	the	the	DT
cord-269150-d1sgnxc0	105	26	nucleoplasm	nucleoplasm	NN
cord-269150-d1sgnxc0	105	27	(	(	-LRB-
cord-269150-d1sgnxc0	105	28	35	35	CD
cord-269150-d1sgnxc0	105	29	)	)	-RRB-
cord-269150-d1sgnxc0	105	30	.	.	.
cord-269150-d1sgnxc0	106	1	IBV	IBV	NNP
cord-269150-d1sgnxc0	106	2	replication	replication	NN
cord-269150-d1sgnxc0	106	3	and	and	CC
cord-269150-d1sgnxc0	106	4	transcription	transcription	NN
cord-269150-d1sgnxc0	106	5	,	,	,
cord-269150-d1sgnxc0	106	6	on	on	IN
cord-269150-d1sgnxc0	106	7	the	the	DT
cord-269150-d1sgnxc0	106	8	other	other	JJ
cord-269150-d1sgnxc0	106	9	hand	hand	NN
cord-269150-d1sgnxc0	106	10	,	,	,
cord-269150-d1sgnxc0	106	11	take	take	VB
cord-269150-d1sgnxc0	106	12	place	place	NN
cord-269150-d1sgnxc0	106	13	in	in	IN
cord-269150-d1sgnxc0	106	14	the	the	DT
cord-269150-d1sgnxc0	106	15	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	106	16	of	of	IN
cord-269150-d1sgnxc0	106	17	the	the	DT
cord-269150-d1sgnxc0	106	18	infected	infected	JJ
cord-269150-d1sgnxc0	106	19	cells	cell	NNS
cord-269150-d1sgnxc0	106	20	.	.	.
cord-269150-d1sgnxc0	107	1	Therefore	therefore	RB
cord-269150-d1sgnxc0	107	2	,	,	,
cord-269150-d1sgnxc0	107	3	to	to	TO
cord-269150-d1sgnxc0	107	4	validate	validate	VB
cord-269150-d1sgnxc0	107	5	the	the	DT
cord-269150-d1sgnxc0	107	6	likelihood	likelihood	NN
cord-269150-d1sgnxc0	107	7	of	of	IN
cord-269150-d1sgnxc0	107	8	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	107	9	interacting	interact	VBG
cord-269150-d1sgnxc0	107	10	with	with	IN
cord-269150-d1sgnxc0	107	11	the	the	DT
cord-269150-d1sgnxc0	107	12	viral	viral	JJ
cord-269150-d1sgnxc0	107	13	5	5	CD
cord-269150-d1sgnxc0	107	14	0	0	CD
cord-269150-d1sgnxc0	107	15	-UTR	-utr	NN
cord-269150-d1sgnxc0	107	16	,	,	,
cord-269150-d1sgnxc0	107	17	immunofluorescence	immunofluorescence	NN
cord-269150-d1sgnxc0	107	18	was	be	VBD
cord-269150-d1sgnxc0	107	19	used	use	VBN
cord-269150-d1sgnxc0	107	20	to	to	TO
cord-269150-d1sgnxc0	107	21	track	track	VB
cord-269150-d1sgnxc0	107	22	the	the	DT
cord-269150-d1sgnxc0	107	23	subcellular	subcellular	JJ
cord-269150-d1sgnxc0	107	24	localization	localization	NN
cord-269150-d1sgnxc0	107	25	of	of	IN
cord-269150-d1sgnxc0	107	26	both	both	CC
cord-269150-d1sgnxc0	107	27	Flag	Flag	NNP
cord-269150-d1sgnxc0	107	28	-	-	HYPH
cord-269150-d1sgnxc0	107	29	tagged	tagged	NNP
cord-269150-d1sgnxc0	107	30	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	107	31	and	and	CC
cord-269150-d1sgnxc0	107	32	de	de	NNP
cord-269150-d1sgnxc0	107	33	novo	novo	NNP
cord-269150-d1sgnxc0	107	34	synthesized	synthesize	VBD
cord-269150-d1sgnxc0	107	35	viral	viral	JJ
cord-269150-d1sgnxc0	107	36	RNA	RNA	NNP
cord-269150-d1sgnxc0	107	37	in	in	IN
cord-269150-d1sgnxc0	107	38	both	both	DT
cord-269150-d1sgnxc0	107	39	mock	mock	NN
cord-269150-d1sgnxc0	107	40	-	-	HYPH
cord-269150-d1sgnxc0	107	41	infected	infected	JJ
cord-269150-d1sgnxc0	107	42	and	and	CC
cord-269150-d1sgnxc0	107	43	IBV	IBV	NNP
cord-269150-d1sgnxc0	107	44	-	-	HYPH
cord-269150-d1sgnxc0	107	45	infected	infect	VBN
cord-269150-d1sgnxc0	107	46	cells	cell	NNS
cord-269150-d1sgnxc0	107	47	.	.	.
cord-269150-d1sgnxc0	108	1	Flag	flag	NN
cord-269150-d1sgnxc0	108	2	-	-	HYPH
cord-269150-d1sgnxc0	108	3	tagged	tagged	NNP
cord-269150-d1sgnxc0	108	4	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	108	5	was	be	VBD
cord-269150-d1sgnxc0	108	6	overexpressed	overexpresse	VBN
cord-269150-d1sgnxc0	108	7	in	in	IN
cord-269150-d1sgnxc0	108	8	cultured	cultured	JJ
cord-269150-d1sgnxc0	108	9	Vero	Vero	NNP
cord-269150-d1sgnxc0	108	10	cells	cell	NNS
cord-269150-d1sgnxc0	108	11	,	,	,
cord-269150-d1sgnxc0	108	12	which	which	WDT
cord-269150-d1sgnxc0	108	13	were	be	VBD
cord-269150-d1sgnxc0	108	14	then	then	RB
cord-269150-d1sgnxc0	108	15	infected	infect	VBN
cord-269150-d1sgnxc0	108	16	with	with	IN
cord-269150-d1sgnxc0	108	17	IBV	IBV	NNP
cord-269150-d1sgnxc0	108	18	and	and	CC
cord-269150-d1sgnxc0	108	19	treated	treat	VBN
cord-269150-d1sgnxc0	108	20	with	with	IN
cord-269150-d1sgnxc0	108	21	actinomycin	actinomycin	NNS
cord-269150-d1sgnxc0	108	22	D	D	NNP
cord-269150-d1sgnxc0	108	23	to	to	TO
cord-269150-d1sgnxc0	108	24	inhibit	inhibit	VB
cord-269150-d1sgnxc0	108	25	host	host	NN
cord-269150-d1sgnxc0	108	26	transcription	transcription	NN
cord-269150-d1sgnxc0	108	27	.	.	.
cord-269150-d1sgnxc0	109	1	The	the	DT
cord-269150-d1sgnxc0	109	2	newly	newly	RB
cord-269150-d1sgnxc0	109	3	synthesized	synthesize	VBN
cord-269150-d1sgnxc0	109	4	viral	viral	JJ
cord-269150-d1sgnxc0	109	5	RNA	RNA	NNP
cord-269150-d1sgnxc0	109	6	,	,	,
cord-269150-d1sgnxc0	109	7	a	a	DT
cord-269150-d1sgnxc0	109	8	marker	marker	NN
cord-269150-d1sgnxc0	109	9	for	for	IN
cord-269150-d1sgnxc0	109	10	the	the	DT
cord-269150-d1sgnxc0	109	11	RTCs	rtc	NNS
cord-269150-d1sgnxc0	109	12	,	,	,
cord-269150-d1sgnxc0	109	13	was	be	VBD
cord-269150-d1sgnxc0	109	14	labeled	label	VBN
cord-269150-d1sgnxc0	109	15	with	with	IN
cord-269150-d1sgnxc0	109	16	BrUTP	BrUTP	NNP
cord-269150-d1sgnxc0	109	17	.	.	.
cord-269150-d1sgnxc0	110	1	The	the	DT
cord-269150-d1sgnxc0	110	2	cells	cell	NNS
cord-269150-d1sgnxc0	110	3	were	be	VBD
cord-269150-d1sgnxc0	110	4	fixed	fix	VBN
cord-269150-d1sgnxc0	110	5	at	at	IN
cord-269150-d1sgnxc0	110	6	10	10	CD
cord-269150-d1sgnxc0	110	7	h	h	NN
cord-269150-d1sgnxc0	110	8	post	post	NN
cord-269150-d1sgnxc0	110	9	-	-	NN
cord-269150-d1sgnxc0	110	10	infection	infection	NN
cord-269150-d1sgnxc0	110	11	to	to	TO
cord-269150-d1sgnxc0	110	12	allow	allow	VB
cord-269150-d1sgnxc0	110	13	sufficient	sufficient	JJ
cord-269150-d1sgnxc0	110	14	labeling	labeling	NN
cord-269150-d1sgnxc0	110	15	of	of	IN
cord-269150-d1sgnxc0	110	16	the	the	DT
cord-269150-d1sgnxc0	110	17	newly	newly	RB
cord-269150-d1sgnxc0	110	18	synthesized	synthesize	VBN
cord-269150-d1sgnxc0	110	19	viral	viral	JJ
cord-269150-d1sgnxc0	110	20	RNA	RNA	NNP
cord-269150-d1sgnxc0	110	21	and	and	CC
cord-269150-d1sgnxc0	110	22	to	to	TO
cord-269150-d1sgnxc0	110	23	minimize	minimize	VB
cord-269150-d1sgnxc0	110	24	the	the	DT
cord-269150-d1sgnxc0	110	25	formation	formation	NN
cord-269150-d1sgnxc0	110	26	of	of	IN
cord-269150-d1sgnxc0	110	27	large	large	JJ
cord-269150-d1sgnxc0	110	28	syncytial	syncytial	JJ
cord-269150-d1sgnxc0	110	29	cells	cell	NNS
cord-269150-d1sgnxc0	110	30	.	.	.
cord-269150-d1sgnxc0	111	1	In	in	IN
cord-269150-d1sgnxc0	111	2	uninfected	uninfected	JJ
cord-269150-d1sgnxc0	111	3	cells	cell	NNS
cord-269150-d1sgnxc0	111	4	,	,	,
cord-269150-d1sgnxc0	111	5	Flag	flag	NN
cord-269150-d1sgnxc0	111	6	-	-	HYPH
cord-269150-d1sgnxc0	111	7	tagged	tagged	NNP
cord-269150-d1sgnxc0	111	8	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	111	9	was	be	VBD
cord-269150-d1sgnxc0	111	10	localized	localize	VBN
cord-269150-d1sgnxc0	111	11	in	in	IN
cord-269150-d1sgnxc0	111	12	the	the	DT
cord-269150-d1sgnxc0	111	13	nucleus	nucleus	NN
cord-269150-d1sgnxc0	111	14	exclusively	exclusively	RB
cord-269150-d1sgnxc0	111	15	(	(	-LRB-
cord-269150-d1sgnxc0	111	16	Figure	figure	NN
cord-269150-d1sgnxc0	111	17	2	2	CD
cord-269150-d1sgnxc0	111	18	)	)	-RRB-
cord-269150-d1sgnxc0	111	19	.	.	.
cord-269150-d1sgnxc0	112	1	Upon	upon	IN
cord-269150-d1sgnxc0	112	2	infection	infection	NN
cord-269150-d1sgnxc0	112	3	by	by	IN
cord-269150-d1sgnxc0	112	4	IBV	IBV	NNP
cord-269150-d1sgnxc0	112	5	,	,	,
cord-269150-d1sgnxc0	112	6	Flag	Flag	NNP
cord-269150-d1sgnxc0	112	7	-	-	HYPH
cord-269150-d1sgnxc0	112	8	tagged	tagged	NNP
cord-269150-d1sgnxc0	112	9	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	112	10	appeared	appear	VBD
cord-269150-d1sgnxc0	112	11	to	to	TO
cord-269150-d1sgnxc0	112	12	be	be	VB
cord-269150-d1sgnxc0	112	13	present	present	JJ
cord-269150-d1sgnxc0	112	14	in	in	IN
cord-269150-d1sgnxc0	112	15	the	the	DT
cord-269150-d1sgnxc0	112	16	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	112	17	as	as	RB
cord-269150-d1sgnxc0	112	18	well	well	RB
cord-269150-d1sgnxc0	112	19	(	(	-LRB-
cord-269150-d1sgnxc0	112	20	Figure	figure	NN
cord-269150-d1sgnxc0	112	21	2	2	CD
cord-269150-d1sgnxc0	112	22	)	)	-RRB-
cord-269150-d1sgnxc0	112	23	.	.	.
cord-269150-d1sgnxc0	113	1	Interestingly	interestingly	RB
cord-269150-d1sgnxc0	113	2	,	,	,
cord-269150-d1sgnxc0	113	3	the	the	DT
cord-269150-d1sgnxc0	113	4	cytoplasmic	cytoplasmic	JJ
cord-269150-d1sgnxc0	113	5	localization	localization	NN
cord-269150-d1sgnxc0	113	6	pattern	pattern	NN
cord-269150-d1sgnxc0	113	7	of	of	IN
cord-269150-d1sgnxc0	113	8	Flag	Flag	NNP
cord-269150-d1sgnxc0	113	9	-	-	HYPH
cord-269150-d1sgnxc0	113	10	tagged	tagged	NNP
cord-269150-d1sgnxc0	113	11	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	113	12	appears	appear	VBZ
cord-269150-d1sgnxc0	113	13	to	to	TO
cord-269150-d1sgnxc0	113	14	be	be	VB
cord-269150-d1sgnxc0	113	15	partially	partially	RB
cord-269150-d1sgnxc0	113	16	overlapped	overlap	VBN
cord-269150-d1sgnxc0	113	17	with	with	IN
cord-269150-d1sgnxc0	113	18	that	that	DT
cord-269150-d1sgnxc0	113	19	for	for	IN
cord-269150-d1sgnxc0	113	20	the	the	DT
cord-269150-d1sgnxc0	113	21	RTCs	rtc	NNS
cord-269150-d1sgnxc0	113	22	,	,	,
cord-269150-d1sgnxc0	113	23	although	although	IN
cord-269150-d1sgnxc0	113	24	further	further	JJ
cord-269150-d1sgnxc0	113	25	studies	study	NNS
cord-269150-d1sgnxc0	113	26	would	would	MD
cord-269150-d1sgnxc0	113	27	be	be	VB
cord-269150-d1sgnxc0	113	28	required	require	VBN
cord-269150-d1sgnxc0	113	29	to	to	TO
cord-269150-d1sgnxc0	113	30	ascertain	ascertain	VB
cord-269150-d1sgnxc0	113	31	if	if	IN
cord-269150-d1sgnxc0	113	32	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	113	33	would	would	MD
cord-269150-d1sgnxc0	113	34	be	be	VB
cord-269150-d1sgnxc0	113	35	a	a	DT
cord-269150-d1sgnxc0	113	36	part	part	NN
cord-269150-d1sgnxc0	113	37	of	of	IN
cord-269150-d1sgnxc0	113	38	the	the	DT
cord-269150-d1sgnxc0	113	39	RTCs	rtc	NNS
cord-269150-d1sgnxc0	113	40	(	(	-LRB-
cord-269150-d1sgnxc0	113	41	Figure	figure	NN
cord-269150-d1sgnxc0	113	42	2	2	CD
cord-269150-d1sgnxc0	113	43	)	)	-RRB-
cord-269150-d1sgnxc0	113	44	.	.	.
cord-269150-d1sgnxc0	114	1	As	as	IN
cord-269150-d1sgnxc0	114	2	a	a	DT
cord-269150-d1sgnxc0	114	3	negative	negative	JJ
cord-269150-d1sgnxc0	114	4	control	control	NN
cord-269150-d1sgnxc0	114	5	for	for	IN
cord-269150-d1sgnxc0	114	6	the	the	DT
cord-269150-d1sgnxc0	114	7	over	over	RB
cord-269150-d1sgnxc0	114	8	-	-	HYPH
cord-269150-d1sgnxc0	114	9	expressed	express	VBN
cord-269150-d1sgnxc0	114	10	protein	protein	NN
cord-269150-d1sgnxc0	114	11	,	,	,
cord-269150-d1sgnxc0	114	12	vector	vector	NN
cord-269150-d1sgnxc0	114	13	transfected	transfecte	VBN
cord-269150-d1sgnxc0	114	14	cells	cell	NNS
cord-269150-d1sgnxc0	114	15	probed	probe	VBN
cord-269150-d1sgnxc0	114	16	with	with	IN
cord-269150-d1sgnxc0	114	17	Flag	Flag	NNP
cord-269150-d1sgnxc0	114	18	antibody	antibody	NN
cord-269150-d1sgnxc0	114	19	showed	show	VBD
cord-269150-d1sgnxc0	114	20	negative	negative	JJ
cord-269150-d1sgnxc0	114	21	staining	staining	NN
cord-269150-d1sgnxc0	114	22	for	for	IN
cord-269150-d1sgnxc0	114	23	the	the	DT
cord-269150-d1sgnxc0	114	24	over	over	RB
cord-269150-d1sgnxc0	114	25	-	-	HYPH
cord-269150-d1sgnxc0	114	26	expressed	express	VBN
cord-269150-d1sgnxc0	114	27	protein	protein	NN
cord-269150-d1sgnxc0	114	28	(	(	-LRB-
cord-269150-d1sgnxc0	114	29	Figure	figure	NN
cord-269150-d1sgnxc0	114	30	2	2	CD
cord-269150-d1sgnxc0	114	31	)	)	-RRB-
cord-269150-d1sgnxc0	114	32	.	.	.
cord-269150-d1sgnxc0	115	1	Similar	similar	JJ
cord-269150-d1sgnxc0	115	2	colocalization	colocalization	NN
cord-269150-d1sgnxc0	115	3	patterns	pattern	NNS
cord-269150-d1sgnxc0	115	4	were	be	VBD
cord-269150-d1sgnxc0	115	5	also	also	RB
cord-269150-d1sgnxc0	115	6	observed	observe	VBN
cord-269150-d1sgnxc0	115	7	in	in	IN
cord-269150-d1sgnxc0	115	8	IBV	IBV	NNP
cord-269150-d1sgnxc0	115	9	-	-	HYPH
cord-269150-d1sgnxc0	115	10	infected	infect	VBN
cord-269150-d1sgnxc0	115	11	H1299	H1299	NNP
cord-269150-d1sgnxc0	115	12	cells	cell	NNS
cord-269150-d1sgnxc0	115	13	(	(	-LRB-
cord-269150-d1sgnxc0	115	14	Figure	figure	NN
cord-269150-d1sgnxc0	115	15	2	2	CD
cord-269150-d1sgnxc0	115	16	)	)	-RRB-
cord-269150-d1sgnxc0	115	17	.	.	.
cord-269150-d1sgnxc0	115	18	 	 	_SP
cord-269150-d1sgnxc0	116	1	To	to	TO
cord-269150-d1sgnxc0	116	2	define	define	VB
cord-269150-d1sgnxc0	116	3	the	the	DT
cord-269150-d1sgnxc0	116	4	segment	segment	NN
cord-269150-d1sgnxc0	116	5	and	and	CC
cord-269150-d1sgnxc0	116	6	structural	structural	JJ
cord-269150-d1sgnxc0	116	7	elements	element	NNS
cord-269150-d1sgnxc0	116	8	of	of	IN
cord-269150-d1sgnxc0	116	9	IBV	IBV	NNP
cord-269150-d1sgnxc0	116	10	5	5	CD
cord-269150-d1sgnxc0	116	11	0	0	CD
cord-269150-d1sgnxc0	116	12	-UTR	-utr	NN
cord-269150-d1sgnxc0	116	13	required	require	VBN
cord-269150-d1sgnxc0	116	14	for	for	IN
cord-269150-d1sgnxc0	116	15	its	-PRON-	PRP$
cord-269150-d1sgnxc0	116	16	interaction	interaction	NN
cord-269150-d1sgnxc0	116	17	with	with	IN
cord-269150-d1sgnxc0	116	18	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	116	19	,	,	,
cord-269150-d1sgnxc0	116	20	four	four	CD
cord-269150-d1sgnxc0	116	21	truncated	truncated	JJ
cord-269150-d1sgnxc0	116	22	mutant	mutant	NN
cord-269150-d1sgnxc0	116	23	RNA	rna	NN
cord-269150-d1sgnxc0	116	24	fragments	fragment	NNS
cord-269150-d1sgnxc0	116	25	were	be	VBD
cord-269150-d1sgnxc0	116	26	synthesized	synthesize	VBN
cord-269150-d1sgnxc0	116	27	,	,	,
cord-269150-d1sgnxc0	116	28	as	as	IN
cord-269150-d1sgnxc0	116	29	shown	show	VBN
cord-269150-d1sgnxc0	116	30	in	in	IN
cord-269150-d1sgnxc0	116	31	Figure	Figure	NNP
cord-269150-d1sgnxc0	116	32	3A	3a	NN
cord-269150-d1sgnxc0	116	33	,	,	,
cord-269150-d1sgnxc0	116	34	by	by	IN
cord-269150-d1sgnxc0	116	35	in	in	IN
cord-269150-d1sgnxc0	116	36	vitro	vitro	FW
cord-269150-d1sgnxc0	116	37	transcription	transcription	NN
cord-269150-d1sgnxc0	116	38	.	.	.
cord-269150-d1sgnxc0	117	1	5	5	LS
cord-269150-d1sgnxc0	117	2	0	0	CD
cord-269150-d1sgnxc0	117	3	-UTRÁ1	-utrá1	NN
cord-269150-d1sgnxc0	117	4	contains	contain	VBZ
cord-269150-d1sgnxc0	117	5	stem	stem	NN
cord-269150-d1sgnxc0	117	6	-	-	HYPH
cord-269150-d1sgnxc0	117	7	loops	loop	NNS
cord-269150-d1sgnxc0	117	8	I	I	NNP
cord-269150-d1sgnxc0	117	9	-	-	HYPH
cord-269150-d1sgnxc0	117	10	IV	IV	NNP
cord-269150-d1sgnxc0	117	11	(	(	-LRB-
cord-269150-d1sgnxc0	117	12	38	38	CD
cord-269150-d1sgnxc0	117	13	)	)	-RRB-
cord-269150-d1sgnxc0	117	14	,	,	,
cord-269150-d1sgnxc0	117	15	5	5	CD
cord-269150-d1sgnxc0	117	16	0	0	CD
cord-269150-d1sgnxc0	117	17	-UTRÁ2	-utrá2	NN
cord-269150-d1sgnxc0	117	18	and	and	CC
cord-269150-d1sgnxc0	117	19	5	5	CD
cord-269150-d1sgnxc0	117	20	0	0	CD
cord-269150-d1sgnxc0	118	1	-UTRÁ3	-UTRÁ3	:
cord-269150-d1sgnxc0	118	2	spans	span	VBZ
cord-269150-d1sgnxc0	118	3	stem	stem	NN
cord-269150-d1sgnxc0	118	4	-	-	HYPH
cord-269150-d1sgnxc0	118	5	loops	loop	NNS
cord-269150-d1sgnxc0	119	1	I	-PRON-	PRP
cord-269150-d1sgnxc0	119	2	to	to	IN
cord-269150-d1sgnxc0	119	3	III	iii	CD
cord-269150-d1sgnxc0	119	4	and	and	CC
cord-269150-d1sgnxc0	119	5	II	II	NNP
cord-269150-d1sgnxc0	119	6	to	to	IN
cord-269150-d1sgnxc0	119	7	IV	IV	NNP
cord-269150-d1sgnxc0	119	8	,	,	,
cord-269150-d1sgnxc0	119	9	respectively	respectively	RB
cord-269150-d1sgnxc0	119	10	,	,	,
cord-269150-d1sgnxc0	120	1	whereas	whereas	IN
cord-269150-d1sgnxc0	120	2	5	5	CD
cord-269150-d1sgnxc0	120	3	0	0	CD
cord-269150-d1sgnxc0	120	4	-UTRÁ4	-utrá4	CC
cord-269150-d1sgnxc0	120	5	spans	span	VBZ
cord-269150-d1sgnxc0	120	6	the	the	DT
cord-269150-d1sgnxc0	120	7	rest	rest	NN
cord-269150-d1sgnxc0	120	8	of	of	IN
cord-269150-d1sgnxc0	120	9	the	the	DT
cord-269150-d1sgnxc0	120	10	388	388	CD
cord-269150-d1sgnxc0	120	11	nucleotides	nucleotide	NNS
cord-269150-d1sgnxc0	120	12	.	.	.
cord-269150-d1sgnxc0	121	1	The	the	DT
cord-269150-d1sgnxc0	121	2	biotin	biotin	NN
cord-269150-d1sgnxc0	121	3	-	-	HYPH
cord-269150-d1sgnxc0	121	4	labeled	label	VBN
cord-269150-d1sgnxc0	121	5	RNA	RNA	NNP
cord-269150-d1sgnxc0	121	6	transcripts	transcript	NNS
cord-269150-d1sgnxc0	121	7	were	be	VBD
cord-269150-d1sgnxc0	121	8	used	use	VBN
cord-269150-d1sgnxc0	121	9	in	in	IN
cord-269150-d1sgnxc0	121	10	the	the	DT
cord-269150-d1sgnxc0	121	11	biotin	biotin	NNP
cord-269150-d1sgnxc0	121	12	-	-	HYPH
cord-269150-d1sgnxc0	121	13	RNA	rna	NN
cord-269150-d1sgnxc0	121	14	pull	pull	VB
cord-269150-d1sgnxc0	121	15	-	-	HYPH
cord-269150-d1sgnxc0	121	16	down	down	RP
cord-269150-d1sgnxc0	121	17	assay	assay	NN
cord-269150-d1sgnxc0	121	18	(	(	-LRB-
cord-269150-d1sgnxc0	121	19	Figure	figure	NN
cord-269150-d1sgnxc0	121	20	3B	3b	CD
cord-269150-d1sgnxc0	121	21	)	)	-RRB-
cord-269150-d1sgnxc0	121	22	to	to	TO
cord-269150-d1sgnxc0	121	23	check	check	VB
cord-269150-d1sgnxc0	121	24	the	the	DT
cord-269150-d1sgnxc0	121	25	efficiency	efficiency	NN
cord-269150-d1sgnxc0	121	26	of	of	IN
cord-269150-d1sgnxc0	121	27	Flag	Flag	NNP
cord-269150-d1sgnxc0	121	28	-	-	HYPH
cord-269150-d1sgnxc0	121	29	tagged	tagged	NNP
cord-269150-d1sgnxc0	121	30	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	121	31	co	co	NN
cord-269150-d1sgnxc0	121	32	-	-	NN
cord-269150-d1sgnxc0	121	33	purification	purification	NN
cord-269150-d1sgnxc0	121	34	with	with	IN
cord-269150-d1sgnxc0	121	35	RNA	RNA	NNP
cord-269150-d1sgnxc0	121	36	.	.	.
cord-269150-d1sgnxc0	122	1	Results	result	NNS
cord-269150-d1sgnxc0	122	2	showed	show	VBD
cord-269150-d1sgnxc0	122	3	that	that	IN
cord-269150-d1sgnxc0	122	4	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	122	5	was	be	VBD
cord-269150-d1sgnxc0	122	6	co	co	JJ
cord-269150-d1sgnxc0	122	7	-	-	JJ
cord-269150-d1sgnxc0	122	8	purified	purify	VBN
cord-269150-d1sgnxc0	122	9	only	only	RB
cord-269150-d1sgnxc0	122	10	with	with	IN
cord-269150-d1sgnxc0	122	11	transcripts	transcript	NNS
cord-269150-d1sgnxc0	122	12	which	which	WDT
cord-269150-d1sgnxc0	122	13	contain	contain	VBP
cord-269150-d1sgnxc0	122	14	stem	stem	NN
cord-269150-d1sgnxc0	122	15	-	-	HYPH
cord-269150-d1sgnxc0	122	16	loops	loop	NNS
cord-269150-d1sgnxc0	122	17	I	I	NNP
cord-269150-d1sgnxc0	122	18	-	-	HYPH
cord-269150-d1sgnxc0	122	19	III	III	NNP
cord-269150-d1sgnxc0	122	20	of	of	IN
cord-269150-d1sgnxc0	122	21	the	the	DT
cord-269150-d1sgnxc0	122	22	5	5	CD
cord-269150-d1sgnxc0	122	23	0	0	CD
cord-269150-d1sgnxc0	122	24	-UTR	-UTR	.
cord-269150-d1sgnxc0	123	1	(	(	-LRB-
cord-269150-d1sgnxc0	123	2	5	5	CD
cord-269150-d1sgnxc0	123	3	0	0	CD
cord-269150-d1sgnxc0	123	4	-UTRÁ1	-UTRÁ1	NNS
cord-269150-d1sgnxc0	123	5	and	and	CC
cord-269150-d1sgnxc0	123	6	5	5	CD
cord-269150-d1sgnxc0	123	7	0	0	CD
cord-269150-d1sgnxc0	123	8	-UTRÁ2	-utrá2	CD
cord-269150-d1sgnxc0	123	9	)	)	-RRB-
cord-269150-d1sgnxc0	123	10	.	.	.
cord-269150-d1sgnxc0	124	1	In	in	IN
cord-269150-d1sgnxc0	124	2	addition	addition	NN
cord-269150-d1sgnxc0	124	3	,	,	,
cord-269150-d1sgnxc0	124	4	stem	stem	NN
cord-269150-d1sgnxc0	124	5	-	-	HYPH
cord-269150-d1sgnxc0	124	6	loop	loop	NN
cord-269150-d1sgnxc0	124	7	I	-PRON-	PRP
cord-269150-d1sgnxc0	124	8	appeared	appear	VBD
cord-269150-d1sgnxc0	124	9	to	to	TO
cord-269150-d1sgnxc0	124	10	be	be	VB
cord-269150-d1sgnxc0	124	11	essential	essential	JJ
cord-269150-d1sgnxc0	124	12	for	for	IN
cord-269150-d1sgnxc0	124	13	interacting	interact	VBG
cord-269150-d1sgnxc0	124	14	with	with	IN
cord-269150-d1sgnxc0	124	15	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	124	16	as	as	IN
cord-269150-d1sgnxc0	124	17	its	-PRON-	PRP$
cord-269150-d1sgnxc0	124	18	absence	absence	NN
cord-269150-d1sgnxc0	124	19	in	in	IN
cord-269150-d1sgnxc0	124	20	5	5	CD
cord-269150-d1sgnxc0	124	21	0	0	CD
cord-269150-d1sgnxc0	124	22	-UTRÁ3	-utrá3	RB
cord-269150-d1sgnxc0	124	23	abolished	abolish	VBD
cord-269150-d1sgnxc0	124	24	the	the	DT
cord-269150-d1sgnxc0	124	25	interaction	interaction	NN
cord-269150-d1sgnxc0	124	26	with	with	IN
cord-269150-d1sgnxc0	124	27	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	124	28	(	(	-LRB-
cord-269150-d1sgnxc0	124	29	Figure	figure	NN
cord-269150-d1sgnxc0	124	30	3B	3b	CD
cord-269150-d1sgnxc0	124	31	)	)	-RRB-
cord-269150-d1sgnxc0	124	32	.	.	.
cord-269150-d1sgnxc0	125	1	The	the	DT
cord-269150-d1sgnxc0	125	2	rest	rest	NN
cord-269150-d1sgnxc0	125	3	region	region	NN
cord-269150-d1sgnxc0	125	4	of	of	IN
cord-269150-d1sgnxc0	125	5	the	the	DT
cord-269150-d1sgnxc0	125	6	5	5	CD
cord-269150-d1sgnxc0	125	7	0	0	CD
cord-269150-d1sgnxc0	125	8	-UTR	-UTR	,
cord-269150-d1sgnxc0	125	9	(	(	-LRB-
cord-269150-d1sgnxc0	125	10	5	5	CD
cord-269150-d1sgnxc0	125	11	0	0	CD
cord-269150-d1sgnxc0	125	12	-UTRÁ4	-utrá4	NN
cord-269150-d1sgnxc0	125	13	)	)	-RRB-
cord-269150-d1sgnxc0	125	14	did	do	VBD
cord-269150-d1sgnxc0	125	15	not	not	RB
cord-269150-d1sgnxc0	125	16	appear	appear	VB
cord-269150-d1sgnxc0	125	17	to	to	TO
cord-269150-d1sgnxc0	125	18	interact	interact	VB
cord-269150-d1sgnxc0	125	19	with	with	IN
cord-269150-d1sgnxc0	125	20	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	125	21	(	(	-LRB-
cord-269150-d1sgnxc0	125	22	Figure	figure	NN
cord-269150-d1sgnxc0	125	23	3B	3b	CD
cord-269150-d1sgnxc0	125	24	)	)	-RRB-
cord-269150-d1sgnxc0	125	25	.	.	.
cord-269150-d1sgnxc0	126	1	To	to	TO
cord-269150-d1sgnxc0	126	2	confirm	confirm	VB
cord-269150-d1sgnxc0	126	3	further	further	RB
cord-269150-d1sgnxc0	126	4	the	the	DT
cord-269150-d1sgnxc0	126	5	role	role	NN
cord-269150-d1sgnxc0	126	6	of	of	IN
cord-269150-d1sgnxc0	126	7	stem	stem	NN
cord-269150-d1sgnxc0	126	8	-	-	HYPH
cord-269150-d1sgnxc0	126	9	loop	loop	NN
cord-269150-d1sgnxc0	126	10	I	-PRON-	PRP
cord-269150-d1sgnxc0	126	11	in	in	IN
cord-269150-d1sgnxc0	126	12	the	the	DT
cord-269150-d1sgnxc0	126	13	interaction	interaction	NN
cord-269150-d1sgnxc0	126	14	between	between	IN
cord-269150-d1sgnxc0	126	15	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	126	16	and	and	CC
cord-269150-d1sgnxc0	126	17	IBV	IBV	NNP
cord-269150-d1sgnxc0	126	18	5	5	CD
cord-269150-d1sgnxc0	126	19	0	0	CD
cord-269150-d1sgnxc0	126	20	-UTR	-utr	NN
cord-269150-d1sgnxc0	126	21	,	,	,
cord-269150-d1sgnxc0	126	22	two	two	CD
cord-269150-d1sgnxc0	126	23	mutants	mutant	NNS
cord-269150-d1sgnxc0	126	24	were	be	VBD
cord-269150-d1sgnxc0	126	25	constructed	construct	VBN
cord-269150-d1sgnxc0	126	26	,	,	,
cord-269150-d1sgnxc0	126	27	based	base	VBN
cord-269150-d1sgnxc0	126	28	on	on	IN
cord-269150-d1sgnxc0	126	29	5	5	CD
cord-269150-d1sgnxc0	126	30	0	0	CD
cord-269150-d1sgnxc0	127	1	-UTRÁ2	-utrá2	UH
cord-269150-d1sgnxc0	127	2	.	.	.
cord-269150-d1sgnxc0	128	1	5	5	LS
cord-269150-d1sgnxc0	128	2	0	0	CD
cord-269150-d1sgnxc0	129	1	-UTRÁ2M1	-UTRÁ2M1	NNP
cord-269150-d1sgnxc0	129	2	carried	carry	VBD
cord-269150-d1sgnxc0	129	3	two	two	CD
cord-269150-d1sgnxc0	129	4	-	-	HYPH
cord-269150-d1sgnxc0	129	5	point	point	NN
cord-269150-d1sgnxc0	129	6	mutations	mutation	NNS
cord-269150-d1sgnxc0	129	7	at	at	IN
cord-269150-d1sgnxc0	129	8	nucleotide	nucleotide	JJ
cord-269150-d1sgnxc0	129	9	residues	residue	NNS
cord-269150-d1sgnxc0	129	10	11	11	CD
cord-269150-d1sgnxc0	129	11	and	and	CC
cord-269150-d1sgnxc0	129	12	12	12	CD
cord-269150-d1sgnxc0	129	13	from	from	IN
cord-269150-d1sgnxc0	129	14	GA	GA	NNP
cord-269150-d1sgnxc0	129	15	to	to	IN
cord-269150-d1sgnxc0	129	16	CU	CU	NNP
cord-269150-d1sgnxc0	129	17	,	,	,
cord-269150-d1sgnxc0	129	18	which	which	WDT
cord-269150-d1sgnxc0	129	19	would	would	MD
cord-269150-d1sgnxc0	129	20	disrupt	disrupt	VB
cord-269150-d1sgnxc0	129	21	the	the	DT
cord-269150-d1sgnxc0	129	22	structure	structure	NN
cord-269150-d1sgnxc0	129	23	of	of	IN
cord-269150-d1sgnxc0	129	24	stem	stem	NN
cord-269150-d1sgnxc0	129	25	-	-	HYPH
cord-269150-d1sgnxc0	129	26	loop	loop	NN
cord-269150-d1sgnxc0	129	27	I	i	NN
cord-269150-d1sgnxc0	129	28	(	(	-LRB-
cord-269150-d1sgnxc0	129	29	Figure	Figure	NNP
cord-269150-d1sgnxc0	129	30	3C	3C	NNP
cord-269150-d1sgnxc0	129	31	)	)	-RRB-
cord-269150-d1sgnxc0	129	32	,	,	,
cord-269150-d1sgnxc0	129	33	and	and	CC
cord-269150-d1sgnxc0	129	34	5	5	CD
cord-269150-d1sgnxc0	129	35	0	0	CD
cord-269150-d1sgnxc0	129	36	-UTRÁ2M2	-UTRÁ2M2	NFP
cord-269150-d1sgnxc0	129	37	carried	carry	VBN
cord-269150-d1sgnxc0	129	38	additional	additional	JJ
cord-269150-d1sgnxc0	129	39	mutations	mutation	NNS
cord-269150-d1sgnxc0	129	40	at	at	IN
cord-269150-d1sgnxc0	129	41	residues	residue	NNS
cord-269150-d1sgnxc0	129	42	25	25	CD
cord-269150-d1sgnxc0	129	43	and	and	CC
cord-269150-d1sgnxc0	129	44	26	26	CD
cord-269150-d1sgnxc0	129	45	from	from	IN
cord-269150-d1sgnxc0	129	46	UC	UC	NNP
cord-269150-d1sgnxc0	129	47	to	to	IN
cord-269150-d1sgnxc0	129	48	AG	AG	NNP
cord-269150-d1sgnxc0	129	49	(	(	-LRB-
cord-269150-d1sgnxc0	129	50	Figure	Figure	NNP
cord-269150-d1sgnxc0	129	51	3C	3C	NNP
cord-269150-d1sgnxc0	129	52	)	)	-RRB-
cord-269150-d1sgnxc0	129	53	,	,	,
cord-269150-d1sgnxc0	129	54	which	which	WDT
cord-269150-d1sgnxc0	129	55	would	would	MD
cord-269150-d1sgnxc0	129	56	restore	restore	VB
cord-269150-d1sgnxc0	129	57	the	the	DT
cord-269150-d1sgnxc0	129	58	secondary	secondary	JJ
cord-269150-d1sgnxc0	129	59	structure	structure	NN
cord-269150-d1sgnxc0	129	60	of	of	IN
cord-269150-d1sgnxc0	129	61	stem	stem	NN
cord-269150-d1sgnxc0	129	62	-	-	HYPH
cord-269150-d1sgnxc0	129	63	loop	loop	NN
cord-269150-d1sgnxc0	129	64	I.	i.	NN
cord-269150-d1sgnxc0	130	1	The	the	DT
cord-269150-d1sgnxc0	130	2	mutant	mutant	JJ
cord-269150-d1sgnxc0	130	3	RNAs	rna	NNS
cord-269150-d1sgnxc0	130	4	spanning	span	VBG
cord-269150-d1sgnxc0	130	5	stemloops	stemloop	NNS
cord-269150-d1sgnxc0	130	6	I	I	NNP
cord-269150-d1sgnxc0	130	7	-	-	HYPH
cord-269150-d1sgnxc0	130	8	III	III	NNP
cord-269150-d1sgnxc0	130	9	were	be	VBD
cord-269150-d1sgnxc0	130	10	assessed	assess	VBN
cord-269150-d1sgnxc0	130	11	for	for	IN
cord-269150-d1sgnxc0	130	12	its	-PRON-	PRP$
cord-269150-d1sgnxc0	130	13	ability	ability	NN
cord-269150-d1sgnxc0	130	14	to	to	TO
cord-269150-d1sgnxc0	130	15	bind	bind	VB
cord-269150-d1sgnxc0	130	16	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	130	17	.	.	.
cord-269150-d1sgnxc0	131	1	The	the	DT
cord-269150-d1sgnxc0	131	2	result	result	NN
cord-269150-d1sgnxc0	131	3	indicated	indicate	VBD
cord-269150-d1sgnxc0	131	4	that	that	IN
cord-269150-d1sgnxc0	131	5	the	the	DT
cord-269150-d1sgnxc0	131	6	integrity	integrity	NN
cord-269150-d1sgnxc0	131	7	of	of	IN
cord-269150-d1sgnxc0	131	8	stem	stem	NN
cord-269150-d1sgnxc0	131	9	-	-	HYPH
cord-269150-d1sgnxc0	131	10	loop	loop	NN
cord-269150-d1sgnxc0	131	11	I	-PRON-	PRP
cord-269150-d1sgnxc0	131	12	may	may	MD
cord-269150-d1sgnxc0	131	13	be	be	VB
cord-269150-d1sgnxc0	131	14	essential	essential	JJ
cord-269150-d1sgnxc0	131	15	for	for	IN
cord-269150-d1sgnxc0	131	16	the	the	DT
cord-269150-d1sgnxc0	131	17	interaction	interaction	NN
cord-269150-d1sgnxc0	131	18	between	between	IN
cord-269150-d1sgnxc0	131	19	the	the	DT
cord-269150-d1sgnxc0	131	20	5	5	CD
cord-269150-d1sgnxc0	131	21	0	0	CD
cord-269150-d1sgnxc0	131	22	-UTR	-utr	NN
cord-269150-d1sgnxc0	131	23	with	with	IN
cord-269150-d1sgnxc0	131	24	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	131	25	(	(	-LRB-
cord-269150-d1sgnxc0	131	26	Figure	Figure	NNP
cord-269150-d1sgnxc0	131	27	3D	3D	NNP
cord-269150-d1sgnxc0	131	28	)	)	-RRB-
cord-269150-d1sgnxc0	131	29	,	,	,
cord-269150-d1sgnxc0	131	30	as	as	IN
cord-269150-d1sgnxc0	131	31	the	the	DT
cord-269150-d1sgnxc0	131	32	stem	stem	NN
cord-269150-d1sgnxc0	131	33	-	-	HYPH
cord-269150-d1sgnxc0	131	34	loop	loop	NN
cord-269150-d1sgnxc0	131	35	disrupting	disrupt	VBG
cord-269150-d1sgnxc0	131	36	mutation	mutation	NN
cord-269150-d1sgnxc0	131	37	(	(	-LRB-
cord-269150-d1sgnxc0	131	38	5	5	CD
cord-269150-d1sgnxc0	131	39	0	0	CD
cord-269150-d1sgnxc0	131	40	-UTRÁ2M1	-utrá2m1	ADD
cord-269150-d1sgnxc0	131	41	)	)	-RRB-
cord-269150-d1sgnxc0	131	42	failed	fail	VBD
cord-269150-d1sgnxc0	131	43	to	to	TO
cord-269150-d1sgnxc0	131	44	interact	interact	VB
cord-269150-d1sgnxc0	131	45	with	with	IN
cord-269150-d1sgnxc0	131	46	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	131	47	.	.	.
cord-269150-d1sgnxc0	132	1	The	the	DT
cord-269150-d1sgnxc0	132	2	stem	stem	NN
cord-269150-d1sgnxc0	132	3	-	-	HYPH
cord-269150-d1sgnxc0	132	4	loop	loop	NN
cord-269150-d1sgnxc0	132	5	restoring	restore	VBG
cord-269150-d1sgnxc0	132	6	mutation	mutation	NN
cord-269150-d1sgnxc0	132	7	at	at	IN
cord-269150-d1sgnxc0	132	8	nucleotide	nucleotide	JJ
cord-269150-d1sgnxc0	132	9	residues	residue	NNS
cord-269150-d1sgnxc0	132	10	25	25	CD
cord-269150-d1sgnxc0	132	11	and	and	CC
cord-269150-d1sgnxc0	132	12	26	26	CD
cord-269150-d1sgnxc0	132	13	from	from	IN
cord-269150-d1sgnxc0	132	14	UC	UC	NNP
cord-269150-d1sgnxc0	132	15	to	to	IN
cord-269150-d1sgnxc0	132	16	AG	AG	NNP
cord-269150-d1sgnxc0	132	17	was	be	VBD
cord-269150-d1sgnxc0	132	18	able	able	JJ
cord-269150-d1sgnxc0	132	19	to	to	TO
cord-269150-d1sgnxc0	132	20	restore	restore	VB
cord-269150-d1sgnxc0	132	21	partially	partially	RB
cord-269150-d1sgnxc0	132	22	the	the	DT
cord-269150-d1sgnxc0	132	23	interaction	interaction	NN
cord-269150-d1sgnxc0	132	24	(	(	-LRB-
cord-269150-d1sgnxc0	132	25	5	5	CD
cord-269150-d1sgnxc0	132	26	0	0	CD
cord-269150-d1sgnxc0	132	27	-UTRÁ2M2	-utrá2m2	ADD
cord-269150-d1sgnxc0	132	28	)	)	-RRB-
cord-269150-d1sgnxc0	133	1	(	(	-LRB-
cord-269150-d1sgnxc0	133	2	Figure	Figure	NNP
cord-269150-d1sgnxc0	133	3	3D	3D	NNP
cord-269150-d1sgnxc0	133	4	)	)	-RRB-
cord-269150-d1sgnxc0	133	5	.	.	.
cord-269150-d1sgnxc0	134	1	This	this	DT
cord-269150-d1sgnxc0	134	2	result	result	NN
cord-269150-d1sgnxc0	134	3	affirmed	affirm	VBD
cord-269150-d1sgnxc0	134	4	the	the	DT
cord-269150-d1sgnxc0	134	5	conclusion	conclusion	NN
cord-269150-d1sgnxc0	134	6	that	that	IN
cord-269150-d1sgnxc0	134	7	the	the	DT
cord-269150-d1sgnxc0	134	8	secondary	secondary	JJ
cord-269150-d1sgnxc0	134	9	structure	structure	NN
cord-269150-d1sgnxc0	134	10	of	of	IN
cord-269150-d1sgnxc0	134	11	stem	stem	NN
cord-269150-d1sgnxc0	134	12	-	-	HYPH
cord-269150-d1sgnxc0	134	13	loop	loop	NN
cord-269150-d1sgnxc0	134	14	I	i	NN
cord-269150-d1sgnxc0	134	15	of	of	IN
cord-269150-d1sgnxc0	134	16	IBV	IBV	NNP
cord-269150-d1sgnxc0	134	17	5	5	CD
cord-269150-d1sgnxc0	134	18	0	0	CD
cord-269150-d1sgnxc0	134	19	-UTR	-utr	NN
cord-269150-d1sgnxc0	134	20	is	be	VBZ
cord-269150-d1sgnxc0	134	21	indispensable	indispensable	JJ
cord-269150-d1sgnxc0	134	22	for	for	IN
cord-269150-d1sgnxc0	134	23	its	-PRON-	PRP$
cord-269150-d1sgnxc0	134	24	interaction	interaction	NN
cord-269150-d1sgnxc0	134	25	with	with	IN
cord-269150-d1sgnxc0	134	26	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	134	27	.	.	.
cord-269150-d1sgnxc0	135	1	The	the	DT
cord-269150-d1sgnxc0	135	2	RNA	RNA	NNP
cord-269150-d1sgnxc0	135	3	recognition	recognition	NN
cord-269150-d1sgnxc0	135	4	motif	motif	NN
cord-269150-d1sgnxc0	135	5	(	(	-LRB-
cord-269150-d1sgnxc0	135	6	RRM	RRM	NNP
cord-269150-d1sgnxc0	135	7	)	)	-RRB-
cord-269150-d1sgnxc0	135	8	of	of	IN
cord-269150-d1sgnxc0	135	9	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	135	10	is	be	VBZ
cord-269150-d1sgnxc0	135	11	responsible	responsible	JJ
cord-269150-d1sgnxc0	135	12	for	for	IN
cord-269150-d1sgnxc0	135	13	its	-PRON-	PRP$
cord-269150-d1sgnxc0	135	14	interaction	interaction	NN
cord-269150-d1sgnxc0	135	15	with	with	IN
cord-269150-d1sgnxc0	135	16	IBV	IBV	NNP
cord-269150-d1sgnxc0	135	17	5	5	CD
cord-269150-d1sgnxc0	135	18	0	0	CD
cord-269150-d1sgnxc0	136	1	-UTR	-UTR	.
cord-269150-d1sgnxc0	137	1	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	137	2	contains	contain	VBZ
cord-269150-d1sgnxc0	137	3	two	two	CD
cord-269150-d1sgnxc0	137	4	nucleic	nucleic	JJ
cord-269150-d1sgnxc0	137	5	acid	acid	NN
cord-269150-d1sgnxc0	137	6	binding	binding	NN
cord-269150-d1sgnxc0	137	7	domains	domain	NNS
cord-269150-d1sgnxc0	137	8	,	,	,
cord-269150-d1sgnxc0	137	9	the	the	DT
cord-269150-d1sgnxc0	137	10	RNA	RNA	NNP
cord-269150-d1sgnxc0	137	11	recognition	recognition	NN
cord-269150-d1sgnxc0	137	12	motif	motif	NN
cord-269150-d1sgnxc0	137	13	(	(	-LRB-
cord-269150-d1sgnxc0	137	14	RRM	RRM	NNP
cord-269150-d1sgnxc0	137	15	)	)	-RRB-
cord-269150-d1sgnxc0	137	16	in	in	IN
cord-269150-d1sgnxc0	137	17	the	the	DT
cord-269150-d1sgnxc0	137	18	N	n	CD
cord-269150-d1sgnxc0	137	19	-	-	HYPH
cord-269150-d1sgnxc0	137	20	terminal	terminal	NN
cord-269150-d1sgnxc0	137	21	region	region	NN
cord-269150-d1sgnxc0	137	22	and	and	CC
cord-269150-d1sgnxc0	137	23	the	the	DT
cord-269150-d1sgnxc0	137	24	universal	universal	JJ
cord-269150-d1sgnxc0	137	25	minicircle	minicircle	NNP
cord-269150-d1sgnxc0	137	26	sequence	sequence	NN
cord-269150-d1sgnxc0	137	27	binding	bind	VBG
cord-269150-d1sgnxc0	137	28	protein	protein	NN
cord-269150-d1sgnxc0	137	29	(	(	-LRB-
cord-269150-d1sgnxc0	137	30	UMSBP	UMSBP	NNP
cord-269150-d1sgnxc0	137	31	)	)	-RRB-
cord-269150-d1sgnxc0	137	32	in	in	IN
cord-269150-d1sgnxc0	137	33	the	the	DT
cord-269150-d1sgnxc0	137	34	central	central	JJ
cord-269150-d1sgnxc0	137	35	region	region	NN
cord-269150-d1sgnxc0	137	36	.	.	.
cord-269150-d1sgnxc0	138	1	In	in	IN
cord-269150-d1sgnxc0	138	2	order	order	NN
cord-269150-d1sgnxc0	138	3	to	to	TO
cord-269150-d1sgnxc0	138	4	identify	identify	VB
cord-269150-d1sgnxc0	138	5	the	the	DT
cord-269150-d1sgnxc0	138	6	domain	domain	NN
cord-269150-d1sgnxc0	138	7	involved	involve	VBN
cord-269150-d1sgnxc0	138	8	in	in	IN
cord-269150-d1sgnxc0	138	9	the	the	DT
cord-269150-d1sgnxc0	138	10	interaction	interaction	NN
cord-269150-d1sgnxc0	138	11	between	between	IN
cord-269150-d1sgnxc0	138	12	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	138	13	and	and	CC
cord-269150-d1sgnxc0	138	14	IBV	IBV	NNP
cord-269150-d1sgnxc0	138	15	5	5	CD
cord-269150-d1sgnxc0	138	16	0	0	CD
cord-269150-d1sgnxc0	138	17	-UTR	-utr	NN
cord-269150-d1sgnxc0	138	18	,	,	,
cord-269150-d1sgnxc0	138	19	a	a	DT
cord-269150-d1sgnxc0	138	20	series	series	NN
cord-269150-d1sgnxc0	138	21	of	of	IN
cord-269150-d1sgnxc0	138	22	truncation	truncation	NN
cord-269150-d1sgnxc0	138	23	mutants	mutant	NNS
cord-269150-d1sgnxc0	138	24	of	of	IN
cord-269150-d1sgnxc0	138	25	the	the	DT
cord-269150-d1sgnxc0	138	26	protein	protein	NN
cord-269150-d1sgnxc0	138	27	were	be	VBD
cord-269150-d1sgnxc0	138	28	created	create	VBN
cord-269150-d1sgnxc0	138	29	(	(	-LRB-
cord-269150-d1sgnxc0	138	30	Figure	figure	NN
cord-269150-d1sgnxc0	138	31	4A	4a	CD
cord-269150-d1sgnxc0	138	32	)	)	-RRB-
cord-269150-d1sgnxc0	138	33	.	.	.
cord-269150-d1sgnxc0	139	1	The	the	DT
cord-269150-d1sgnxc0	139	2	first	first	JJ
cord-269150-d1sgnxc0	139	3	three	three	CD
cord-269150-d1sgnxc0	139	4	mutants	mutant	NNS
cord-269150-d1sgnxc0	139	5	,	,	,
cord-269150-d1sgnxc0	139	6	Madp1n	madp1n	NN
cord-269150-d1sgnxc0	139	7	which	which	WDT
cord-269150-d1sgnxc0	139	8	contains	contain	VBZ
cord-269150-d1sgnxc0	139	9	the	the	DT
cord-269150-d1sgnxc0	139	10	RRM	RRM	NNP
cord-269150-d1sgnxc0	139	11	domain	domain	NN
cord-269150-d1sgnxc0	139	12	,	,	,
cord-269150-d1sgnxc0	139	13	Madp1	Madp1	NNP
cord-269150-d1sgnxc0	139	14	m	m	NNP
cord-269150-d1sgnxc0	139	15	spans	span	VBZ
cord-269150-d1sgnxc0	139	16	the	the	DT
cord-269150-d1sgnxc0	139	17	zinc	zinc	NN
cord-269150-d1sgnxc0	139	18	finger	finger	NN
cord-269150-d1sgnxc0	139	19	domain	domain	NN
cord-269150-d1sgnxc0	140	1	and	and	CC
cord-269150-d1sgnxc0	140	2	Madp1c	madp1c	NN
cord-269150-d1sgnxc0	140	3	contains	contain	VBZ
cord-269150-d1sgnxc0	140	4	mostly	mostly	RB
cord-269150-d1sgnxc0	140	5	phosphorylation	phosphorylation	NN
cord-269150-d1sgnxc0	140	6	sites	site	NNS
cord-269150-d1sgnxc0	140	7	,	,	,
cord-269150-d1sgnxc0	140	8	were	be	VBD
cord-269150-d1sgnxc0	140	9	assessed	assess	VBN
cord-269150-d1sgnxc0	140	10	for	for	IN
cord-269150-d1sgnxc0	140	11	their	-PRON-	PRP$
cord-269150-d1sgnxc0	140	12	ability	ability	NN
cord-269150-d1sgnxc0	140	13	to	to	TO
cord-269150-d1sgnxc0	140	14	interact	interact	VB
cord-269150-d1sgnxc0	140	15	with	with	IN
cord-269150-d1sgnxc0	140	16	IBV	IBV	NNP
cord-269150-d1sgnxc0	140	17	5	5	CD
cord-269150-d1sgnxc0	140	18	0	0	CD
cord-269150-d1sgnxc0	140	19	-UTR	-utr	NN
cord-269150-d1sgnxc0	140	20	.	.	.
cord-269150-d1sgnxc0	141	1	Only	only	RB
cord-269150-d1sgnxc0	141	2	Madp1n	Madp1n	NNP
cord-269150-d1sgnxc0	141	3	retained	retain	VBD
cord-269150-d1sgnxc0	141	4	a	a	DT
cord-269150-d1sgnxc0	141	5	low	low	JJ
cord-269150-d1sgnxc0	141	6	level	level	NN
cord-269150-d1sgnxc0	141	7	of	of	IN
cord-269150-d1sgnxc0	141	8	the	the	DT
cord-269150-d1sgnxc0	141	9	RNA	RNA	NNP
cord-269150-d1sgnxc0	141	10	-	-	HYPH
cord-269150-d1sgnxc0	141	11	binding	bind	VBG
cord-269150-d1sgnxc0	141	12	activity	activity	NN
cord-269150-d1sgnxc0	141	13	(	(	-LRB-
cord-269150-d1sgnxc0	141	14	Figure	figure	NN
cord-269150-d1sgnxc0	141	15	4B	4b	NN
cord-269150-d1sgnxc0	141	16	,	,	,
cord-269150-d1sgnxc0	141	17	1n	1n	LS
cord-269150-d1sgnxc0	141	18	)	)	-RRB-
cord-269150-d1sgnxc0	141	19	and	and	CC
cord-269150-d1sgnxc0	141	20	negligible	negligible	JJ
cord-269150-d1sgnxc0	141	21	activity	activity	NN
cord-269150-d1sgnxc0	141	22	was	be	VBD
cord-269150-d1sgnxc0	141	23	detected	detect	VBN
cord-269150-d1sgnxc0	141	24	for	for	IN
cord-269150-d1sgnxc0	141	25	the	the	DT
cord-269150-d1sgnxc0	141	26	other	other	JJ
cord-269150-d1sgnxc0	141	27	two	two	CD
cord-269150-d1sgnxc0	141	28	truncated	truncated	JJ
cord-269150-d1sgnxc0	141	29	proteins	protein	NNS
cord-269150-d1sgnxc0	141	30	(	(	-LRB-
cord-269150-d1sgnxc0	141	31	Figure	figure	NN
cord-269150-d1sgnxc0	141	32	4B	4b	NN
cord-269150-d1sgnxc0	141	33	,	,	,
cord-269150-d1sgnxc0	141	34	1	1	CD
cord-269150-d1sgnxc0	141	35	m	m	NN
cord-269150-d1sgnxc0	141	36	,	,	,
cord-269150-d1sgnxc0	141	37	1c	1c	CD
cord-269150-d1sgnxc0	141	38	)	)	-RRB-
cord-269150-d1sgnxc0	141	39	.	.	.
cord-269150-d1sgnxc0	142	1	As	as	IN
cord-269150-d1sgnxc0	142	2	the	the	DT
cord-269150-d1sgnxc0	142	3	RNA	RNA	NNP
cord-269150-d1sgnxc0	142	4	-	-	HYPH
cord-269150-d1sgnxc0	142	5	binding	bind	VBG
cord-269150-d1sgnxc0	142	6	activity	activity	NN
cord-269150-d1sgnxc0	142	7	for	for	IN
cord-269150-d1sgnxc0	142	8	Madp1n	madp1n	NN
cord-269150-d1sgnxc0	142	9	fragment	fragment	NN
cord-269150-d1sgnxc0	142	10	was	be	VBD
cord-269150-d1sgnxc0	142	11	much	much	RB
cord-269150-d1sgnxc0	142	12	lower	low	JJR
cord-269150-d1sgnxc0	142	13	compared	compare	VBN
cord-269150-d1sgnxc0	142	14	to	to	IN
cord-269150-d1sgnxc0	142	15	the	the	DT
cord-269150-d1sgnxc0	142	16	full	full	JJ
cord-269150-d1sgnxc0	142	17	-	-	HYPH
cord-269150-d1sgnxc0	142	18	length	length	NN
cord-269150-d1sgnxc0	142	19	protein	protein	NN
cord-269150-d1sgnxc0	142	20	,	,	,
cord-269150-d1sgnxc0	142	21	three	three	CD
cord-269150-d1sgnxc0	142	22	more	more	JJR
cord-269150-d1sgnxc0	142	23	mutants	mutant	NNS
cord-269150-d1sgnxc0	142	24	were	be	VBD
cord-269150-d1sgnxc0	142	25	created	create	VBN
cord-269150-d1sgnxc0	142	26	to	to	TO
cord-269150-d1sgnxc0	142	27	extend	extend	VB
cord-269150-d1sgnxc0	142	28	the	the	DT
cord-269150-d1sgnxc0	142	29	Madp1n	Madp1n	NNP
cord-269150-d1sgnxc0	142	30	fragment	fragment	NN
cord-269150-d1sgnxc0	142	31	(	(	-LRB-
cord-269150-d1sgnxc0	142	32	Figure	figure	NN
cord-269150-d1sgnxc0	142	33	4A	4a	CD
cord-269150-d1sgnxc0	142	34	)	)	-RRB-
cord-269150-d1sgnxc0	142	35	.	.	.
cord-269150-d1sgnxc0	143	1	An	an	DT
cord-269150-d1sgnxc0	143	2	extension	extension	NN
cord-269150-d1sgnxc0	143	3	of	of	IN
cord-269150-d1sgnxc0	143	4	14	14	CD
cord-269150-d1sgnxc0	143	5	or	or	CC
cord-269150-d1sgnxc0	143	6	31	31	CD
cord-269150-d1sgnxc0	143	7	amino	amino	NN
cord-269150-d1sgnxc0	143	8	acid	acid	NN
cord-269150-d1sgnxc0	143	9	residues	residue	NNS
cord-269150-d1sgnxc0	143	10	was	be	VBD
cord-269150-d1sgnxc0	143	11	made	make	VBN
cord-269150-d1sgnxc0	143	12	for	for	IN
cord-269150-d1sgnxc0	143	13	mutants	mutant	NNS
cord-269150-d1sgnxc0	143	14	Madp1x	Madp1x	NNP
cord-269150-d1sgnxc0	143	15	and	and	CC
cord-269150-d1sgnxc0	143	16	Madp1z	Madp1z	NNP
cord-269150-d1sgnxc0	143	17	,	,	,
cord-269150-d1sgnxc0	143	18	respectively	respectively	RB
cord-269150-d1sgnxc0	143	19	.	.	.
cord-269150-d1sgnxc0	144	1	A	a	DT
cord-269150-d1sgnxc0	144	2	truncation	truncation	NN
cord-269150-d1sgnxc0	144	3	at	at	IN
cord-269150-d1sgnxc0	144	4	the	the	DT
cord-269150-d1sgnxc0	144	5	N	n	CD
cord-269150-d1sgnxc0	144	6	-	-	HYPH
cord-269150-d1sgnxc0	144	7	terminus	terminus	NN
cord-269150-d1sgnxc0	144	8	by	by	IN
cord-269150-d1sgnxc0	144	9	40	40	CD
cord-269150-d1sgnxc0	144	10	residues	residue	NNS
cord-269150-d1sgnxc0	144	11	as	as	RB
cord-269150-d1sgnxc0	144	12	well	well	RB
cord-269150-d1sgnxc0	144	13	as	as	IN
cord-269150-d1sgnxc0	144	14	an	an	DT
cord-269150-d1sgnxc0	144	15	extension	extension	NN
cord-269150-d1sgnxc0	144	16	by	by	IN
cord-269150-d1sgnxc0	144	17	14	14	CD
cord-269150-d1sgnxc0	144	18	amino	amino	NN
cord-269150-d1sgnxc0	144	19	acid	acid	NN
cord-269150-d1sgnxc0	144	20	residues	residue	NNS
cord-269150-d1sgnxc0	144	21	was	be	VBD
cord-269150-d1sgnxc0	144	22	made	make	VBN
cord-269150-d1sgnxc0	144	23	for	for	IN
cord-269150-d1sgnxc0	144	24	Madp1y	Madp1y	NNP
cord-269150-d1sgnxc0	144	25	.	.	.
cord-269150-d1sgnxc0	145	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	145	2	was	be	VBD
cord-269150-d1sgnxc0	145	3	observed	observe	VBN
cord-269150-d1sgnxc0	145	4	that	that	IN
cord-269150-d1sgnxc0	145	5	both	both	CC
cord-269150-d1sgnxc0	145	6	Madp1x	Madp1x	NNP
cord-269150-d1sgnxc0	145	7	and	and	CC
cord-269150-d1sgnxc0	145	8	Madp1z	Madp1z	NNP
cord-269150-d1sgnxc0	145	9	bound	bind	VBN
cord-269150-d1sgnxc0	145	10	to	to	IN
cord-269150-d1sgnxc0	145	11	IBV	IBV	NNP
cord-269150-d1sgnxc0	145	12	5	5	CD
cord-269150-d1sgnxc0	145	13	0	0	NFP
cord-269150-d1sgnxc0	145	14	-UTR	-utr	NN
cord-269150-d1sgnxc0	145	15	more	more	RBR
cord-269150-d1sgnxc0	145	16	strongly	strongly	RB
cord-269150-d1sgnxc0	145	17	than	than	IN
cord-269150-d1sgnxc0	145	18	did	do	VBD
cord-269150-d1sgnxc0	145	19	the	the	DT
cord-269150-d1sgnxc0	145	20	full	full	JJ
cord-269150-d1sgnxc0	145	21	-	-	HYPH
cord-269150-d1sgnxc0	145	22	length	length	NN
cord-269150-d1sgnxc0	145	23	protein	protein	NN
cord-269150-d1sgnxc0	145	24	as	as	RB
cord-269150-d1sgnxc0	145	25	well	well	RB
cord-269150-d1sgnxc0	145	26	as	as	IN
cord-269150-d1sgnxc0	145	27	Madp1n	madp1n	NN
cord-269150-d1sgnxc0	145	28	mutant	mutant	JJ
cord-269150-d1sgnxc0	145	29	protein	protein	NN
cord-269150-d1sgnxc0	145	30	(	(	-LRB-
cord-269150-d1sgnxc0	145	31	Figure	figure	NN
cord-269150-d1sgnxc0	145	32	4B	4b	NN
cord-269150-d1sgnxc0	145	33	,	,	,
cord-269150-d1sgnxc0	145	34	1x	1x	CD
cord-269150-d1sgnxc0	145	35	,	,	,
cord-269150-d1sgnxc0	145	36	1z	1z	CD
cord-269150-d1sgnxc0	145	37	)	)	-RRB-
cord-269150-d1sgnxc0	145	38	.	.	.
cord-269150-d1sgnxc0	146	1	Madp1y	Madp1y	NNP
cord-269150-d1sgnxc0	146	2	,	,	,
cord-269150-d1sgnxc0	146	3	on	on	IN
cord-269150-d1sgnxc0	146	4	the	the	DT
cord-269150-d1sgnxc0	146	5	other	other	JJ
cord-269150-d1sgnxc0	146	6	hand	hand	NN
cord-269150-d1sgnxc0	146	7	,	,	,
cord-269150-d1sgnxc0	146	8	bound	bind	VBN
cord-269150-d1sgnxc0	146	9	weakly	weakly	RB
cord-269150-d1sgnxc0	146	10	to	to	IN
cord-269150-d1sgnxc0	146	11	the	the	DT
cord-269150-d1sgnxc0	146	12	RNA	RNA	NNP
cord-269150-d1sgnxc0	146	13	fragment	fragment	NN
cord-269150-d1sgnxc0	146	14	(	(	-LRB-
cord-269150-d1sgnxc0	146	15	Figure	figure	NN
cord-269150-d1sgnxc0	146	16	4B	4b	NN
cord-269150-d1sgnxc0	146	17	,	,	,
cord-269150-d1sgnxc0	146	18	1y	1y	CD
cord-269150-d1sgnxc0	146	19	)	)	-RRB-
cord-269150-d1sgnxc0	146	20	.	.	.
cord-269150-d1sgnxc0	147	1	Hence	hence	RB
cord-269150-d1sgnxc0	147	2	,	,	,
cord-269150-d1sgnxc0	147	3	the	the	DT
cord-269150-d1sgnxc0	147	4	14	14	CD
cord-269150-d1sgnxc0	147	5	amino	amino	NN
cord-269150-d1sgnxc0	147	6	acid	acid	NN
cord-269150-d1sgnxc0	147	7	extension	extension	NN
cord-269150-d1sgnxc0	147	8	beyond	beyond	IN
cord-269150-d1sgnxc0	147	9	the	the	DT
cord-269150-d1sgnxc0	147	10	RRM	rrm	NN
cord-269150-d1sgnxc0	147	11	(	(	-LRB-
cord-269150-d1sgnxc0	147	12	Madp1x	madp1x	NN
cord-269150-d1sgnxc0	147	13	)	)	-RRB-
cord-269150-d1sgnxc0	147	14	may	may	MD
cord-269150-d1sgnxc0	147	15	have	have	VB
cord-269150-d1sgnxc0	147	16	been	be	VBN
cord-269150-d1sgnxc0	147	17	required	require	VBN
cord-269150-d1sgnxc0	147	18	to	to	TO
cord-269150-d1sgnxc0	147	19	preserve	preserve	VB
cord-269150-d1sgnxc0	147	20	the	the	DT
cord-269150-d1sgnxc0	147	21	integrity	integrity	NN
cord-269150-d1sgnxc0	147	22	of	of	IN
cord-269150-d1sgnxc0	147	23	the	the	DT
cord-269150-d1sgnxc0	147	24	protein	protein	NN
cord-269150-d1sgnxc0	147	25	structure	structure	NN
cord-269150-d1sgnxc0	147	26	and	and	CC
cord-269150-d1sgnxc0	147	27	that	that	IN
cord-269150-d1sgnxc0	147	28	the	the	DT
cord-269150-d1sgnxc0	147	29	40	40	CD
cord-269150-d1sgnxc0	147	30	amino	amino	NN
cord-269150-d1sgnxc0	147	31	acid	acid	NN
cord-269150-d1sgnxc0	147	32	residues	residue	NNS
cord-269150-d1sgnxc0	147	33	at	at	IN
cord-269150-d1sgnxc0	147	34	the	the	DT
cord-269150-d1sgnxc0	147	35	N	n	CD
cord-269150-d1sgnxc0	147	36	-	-	HYPH
cord-269150-d1sgnxc0	147	37	terminus	terminus	NN
cord-269150-d1sgnxc0	147	38	of	of	IN
cord-269150-d1sgnxc0	147	39	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	147	40	are	be	VBP
cord-269150-d1sgnxc0	147	41	required	require	VBN
cord-269150-d1sgnxc0	147	42	for	for	IN
cord-269150-d1sgnxc0	147	43	efficient	efficient	JJ
cord-269150-d1sgnxc0	147	44	RNA	RNA	NNP
cord-269150-d1sgnxc0	147	45	binding	binding	NN
cord-269150-d1sgnxc0	147	46	.	.	.
cord-269150-d1sgnxc0	148	1	As	as	IN
cord-269150-d1sgnxc0	148	2	the	the	DT
cord-269150-d1sgnxc0	148	3	RRM	RRM	NNP
cord-269150-d1sgnxc0	148	4	domain	domain	NN
cord-269150-d1sgnxc0	148	5	was	be	VBD
cord-269150-d1sgnxc0	148	6	determined	determine	VBN
cord-269150-d1sgnxc0	148	7	to	to	TO
cord-269150-d1sgnxc0	148	8	be	be	VB
cord-269150-d1sgnxc0	148	9	responsible	responsible	JJ
cord-269150-d1sgnxc0	148	10	for	for	IN
cord-269150-d1sgnxc0	148	11	the	the	DT
cord-269150-d1sgnxc0	148	12	interaction	interaction	NN
cord-269150-d1sgnxc0	148	13	,	,	,
cord-269150-d1sgnxc0	148	14	information	information	NN
cord-269150-d1sgnxc0	148	15	available	available	JJ
cord-269150-d1sgnxc0	148	16	on	on	IN
cord-269150-d1sgnxc0	148	17	this	this	DT
cord-269150-d1sgnxc0	148	18	domain	domain	NN
cord-269150-d1sgnxc0	148	19	indicated	indicate	VBD
cord-269150-d1sgnxc0	148	20	three	three	CD
cord-269150-d1sgnxc0	148	21	amino	amino	NN
cord-269150-d1sgnxc0	148	22	acids	acid	NNS
cord-269150-d1sgnxc0	148	23	at	at	IN
cord-269150-d1sgnxc0	148	24	its	-PRON-	PRP$
cord-269150-d1sgnxc0	148	25	active	active	JJ
cord-269150-d1sgnxc0	148	26	site	site	NN
cord-269150-d1sgnxc0	148	27	,	,	,
cord-269150-d1sgnxc0	148	28	which	which	WDT
cord-269150-d1sgnxc0	148	29	interact	interact	VBP
cord-269150-d1sgnxc0	148	30	with	with	IN
cord-269150-d1sgnxc0	148	31	nucleic	nucleic	JJ
cord-269150-d1sgnxc0	148	32	acid	acid	NN
cord-269150-d1sgnxc0	148	33	residues	residue	NNS
cord-269150-d1sgnxc0	148	34	via	via	IN
cord-269150-d1sgnxc0	148	35	their	-PRON-	PRP$
cord-269150-d1sgnxc0	148	36	aromatic	aromatic	JJ
cord-269150-d1sgnxc0	148	37	and	and	CC
cord-269150-d1sgnxc0	148	38	hydrophobic	hydrophobic	JJ
cord-269150-d1sgnxc0	148	39	side	side	NN
cord-269150-d1sgnxc0	148	40	chains	chain	NNS
cord-269150-d1sgnxc0	148	41	.	.	.
cord-269150-d1sgnxc0	149	1	For	for	IN
cord-269150-d1sgnxc0	149	2	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	149	3	,	,	,
cord-269150-d1sgnxc0	149	4	the	the	DT
cord-269150-d1sgnxc0	149	5	identified	identify	VBN
cord-269150-d1sgnxc0	149	6	active	active	JJ
cord-269150-d1sgnxc0	149	7	site	site	NN
cord-269150-d1sgnxc0	149	8	was	be	VBD
cord-269150-d1sgnxc0	149	9	composed	compose	VBN
cord-269150-d1sgnxc0	149	10	of	of	IN
cord-269150-d1sgnxc0	149	11	phenylalanine	phenylalanine	NN
cord-269150-d1sgnxc0	149	12	55	55	CD
cord-269150-d1sgnxc0	149	13	and	and	CC
cord-269150-d1sgnxc0	149	14	valine	valine	NN
cord-269150-d1sgnxc0	149	15	53	53	CD
cord-269150-d1sgnxc0	149	16	,	,	,
cord-269150-d1sgnxc0	149	17	respectively	respectively	RB
cord-269150-d1sgnxc0	149	18	,	,	,
cord-269150-d1sgnxc0	149	19	while	while	IN
cord-269150-d1sgnxc0	149	20	tyrosine	tyrosine	NN
cord-269150-d1sgnxc0	149	21	13	13	CD
cord-269150-d1sgnxc0	149	22	may	may	MD
cord-269150-d1sgnxc0	149	23	have	have	VB
cord-269150-d1sgnxc0	149	24	acted	act	VBN
cord-269150-d1sgnxc0	149	25	as	as	IN
cord-269150-d1sgnxc0	149	26	an	an	DT
cord-269150-d1sgnxc0	149	27	anchor	anchor	NN
cord-269150-d1sgnxc0	149	28	for	for	IN
cord-269150-d1sgnxc0	149	29	the	the	DT
cord-269150-d1sgnxc0	149	30	phosphate	phosphate	NN
cord-269150-d1sgnxc0	149	31	backbone	backbone	NN
cord-269150-d1sgnxc0	149	32	via	via	IN
cord-269150-d1sgnxc0	149	33	electrostatic	electrostatic	JJ
cord-269150-d1sgnxc0	149	34	interactions	interaction	NNS
cord-269150-d1sgnxc0	149	35	.	.	.
cord-269150-d1sgnxc0	150	1	Hence	hence	RB
cord-269150-d1sgnxc0	150	2	,	,	,
cord-269150-d1sgnxc0	150	3	three	three	CD
cord-269150-d1sgnxc0	150	4	mutants	mutant	NNS
cord-269150-d1sgnxc0	150	5	with	with	IN
cord-269150-d1sgnxc0	150	6	either	either	CC
cord-269150-d1sgnxc0	150	7	a	a	DT
cord-269150-d1sgnxc0	150	8	single	single	JJ
cord-269150-d1sgnxc0	150	9	alanine	alanine	JJ
cord-269150-d1sgnxc0	150	10	substitution	substitution	NN
cord-269150-d1sgnxc0	150	11	for	for	IN
cord-269150-d1sgnxc0	150	12	tyrosine	tyrosine	NN
cord-269150-d1sgnxc0	150	13	13	13	CD
cord-269150-d1sgnxc0	150	14	(	(	-LRB-
cord-269150-d1sgnxc0	150	15	Y13A	Y13A	NNP
cord-269150-d1sgnxc0	150	16	)	)	-RRB-
cord-269150-d1sgnxc0	150	17	,	,	,
cord-269150-d1sgnxc0	150	18	a	a	DT
cord-269150-d1sgnxc0	150	19	double	double	JJ
cord-269150-d1sgnxc0	150	20	alanine	alanine	JJ
cord-269150-d1sgnxc0	150	21	substitution	substitution	NN
cord-269150-d1sgnxc0	150	22	for	for	IN
cord-269150-d1sgnxc0	150	23	valine	valine	NN
cord-269150-d1sgnxc0	150	24	53	53	CD
cord-269150-d1sgnxc0	150	25	and	and	CC
cord-269150-d1sgnxc0	150	26	phenylalanine	phenylalanine	NN
cord-269150-d1sgnxc0	150	27	55	55	CD
cord-269150-d1sgnxc0	150	28	(	(	-LRB-
cord-269150-d1sgnxc0	150	29	V53F55A	v53f55a	UH
cord-269150-d1sgnxc0	150	30	)	)	-RRB-
cord-269150-d1sgnxc0	150	31	or	or	CC
cord-269150-d1sgnxc0	150	32	triple	triple	JJ
cord-269150-d1sgnxc0	150	33	alanine	alanine	JJ
cord-269150-d1sgnxc0	150	34	substitutions	substitution	NNS
cord-269150-d1sgnxc0	150	35	for	for	IN
cord-269150-d1sgnxc0	150	36	all	all	DT
cord-269150-d1sgnxc0	150	37	three	three	CD
cord-269150-d1sgnxc0	150	38	residues	residue	NNS
cord-269150-d1sgnxc0	150	39	(	(	-LRB-
cord-269150-d1sgnxc0	150	40	YVF	YVF	NNP
cord-269150-d1sgnxc0	150	41	)	)	-RRB-
cord-269150-d1sgnxc0	150	42	,	,	,
cord-269150-d1sgnxc0	150	43	were	be	VBD
cord-269150-d1sgnxc0	150	44	constructed	construct	VBN
cord-269150-d1sgnxc0	150	45	(	(	-LRB-
cord-269150-d1sgnxc0	150	46	Figure	figure	NN
cord-269150-d1sgnxc0	150	47	4A	4a	CD
cord-269150-d1sgnxc0	150	48	)	)	-RRB-
cord-269150-d1sgnxc0	150	49	.	.	.
cord-269150-d1sgnxc0	151	1	These	these	DT
cord-269150-d1sgnxc0	151	2	three	three	CD
cord-269150-d1sgnxc0	151	3	mutants	mutant	NNS
cord-269150-d1sgnxc0	151	4	were	be	VBD
cord-269150-d1sgnxc0	151	5	over	over	RB
cord-269150-d1sgnxc0	151	6	-	-	HYPH
cord-269150-d1sgnxc0	151	7	expressed	express	VBN
cord-269150-d1sgnxc0	151	8	in	in	IN
cord-269150-d1sgnxc0	151	9	H1299	H1299	NNP
cord-269150-d1sgnxc0	151	10	cells	cell	NNS
cord-269150-d1sgnxc0	151	11	as	as	IN
cord-269150-d1sgnxc0	151	12	Flag	flag	NN
cord-269150-d1sgnxc0	151	13	-	-	HYPH
cord-269150-d1sgnxc0	151	14	tagged	tag	VBN
cord-269150-d1sgnxc0	151	15	proteins	protein	NNS
cord-269150-d1sgnxc0	151	16	,	,	,
cord-269150-d1sgnxc0	151	17	and	and	CC
cord-269150-d1sgnxc0	151	18	the	the	DT
cord-269150-d1sgnxc0	151	19	lysates	lysate	NNS
cord-269150-d1sgnxc0	151	20	were	be	VBD
cord-269150-d1sgnxc0	151	21	assessed	assess	VBN
cord-269150-d1sgnxc0	151	22	for	for	IN
cord-269150-d1sgnxc0	151	23	their	-PRON-	PRP$
cord-269150-d1sgnxc0	151	24	respective	respective	JJ
cord-269150-d1sgnxc0	151	25	RNA	rna	NN
cord-269150-d1sgnxc0	151	26	-	-	HYPH
cord-269150-d1sgnxc0	151	27	binding	bind	VBG
cord-269150-d1sgnxc0	151	28	affinities	affinity	NNS
cord-269150-d1sgnxc0	151	29	for	for	IN
cord-269150-d1sgnxc0	151	30	full	full	JJ
cord-269150-d1sgnxc0	151	31	-	-	HYPH
cord-269150-d1sgnxc0	151	32	length	length	NN
cord-269150-d1sgnxc0	151	33	IBV	IBV	NNP
cord-269150-d1sgnxc0	151	34	5	5	CD
cord-269150-d1sgnxc0	151	35	0	0	CD
cord-269150-d1sgnxc0	151	36	-UTR	-UTR	:
cord-269150-d1sgnxc0	151	37	(	(	-LRB-
cord-269150-d1sgnxc0	151	38	Figure	figure	NN
cord-269150-d1sgnxc0	151	39	4C	4c	CD
cord-269150-d1sgnxc0	151	40	)	)	-RRB-
cord-269150-d1sgnxc0	151	41	.	.	.
cord-269150-d1sgnxc0	152	1	Interaction	interaction	NN
cord-269150-d1sgnxc0	152	2	of	of	IN
cord-269150-d1sgnxc0	152	3	deletion	deletion	NN
cord-269150-d1sgnxc0	152	4	mutants	mutant	NNS
cord-269150-d1sgnxc0	152	5	of	of	IN
cord-269150-d1sgnxc0	152	6	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	152	7	with	with	IN
cord-269150-d1sgnxc0	152	8	IBV	IBV	NNP
cord-269150-d1sgnxc0	152	9	5	5	CD
cord-269150-d1sgnxc0	152	10	0	0	CD
cord-269150-d1sgnxc0	152	11	-UTR	-utr	NN
cord-269150-d1sgnxc0	152	12	.	.	.
cord-269150-d1sgnxc0	153	1	Cell	cell	NN
cord-269150-d1sgnxc0	153	2	lysates	lysate	NNS
cord-269150-d1sgnxc0	153	3	prepared	prepare	VBD
cord-269150-d1sgnxc0	153	4	from	from	IN
cord-269150-d1sgnxc0	153	5	H1299	H1299	NNP
cord-269150-d1sgnxc0	153	6	cells	cell	NNS
cord-269150-d1sgnxc0	153	7	over	over	RB
cord-269150-d1sgnxc0	153	8	-	-	HYPH
cord-269150-d1sgnxc0	153	9	expressing	express	VBG
cord-269150-d1sgnxc0	153	10	Flag	Flag	NNP
cord-269150-d1sgnxc0	153	11	-	-	HYPH
cord-269150-d1sgnxc0	153	12	tagged	tag	VBN
cord-269150-d1sgnxc0	153	13	wild	wild	JJ
cord-269150-d1sgnxc0	153	14	-	-	HYPH
cord-269150-d1sgnxc0	153	15	type	type	NN
cord-269150-d1sgnxc0	153	16	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	153	17	or	or	CC
cord-269150-d1sgnxc0	153	18	its	-PRON-	PRP$
cord-269150-d1sgnxc0	153	19	truncation	truncation	NN
cord-269150-d1sgnxc0	153	20	mutants	mutant	NNS
cord-269150-d1sgnxc0	153	21	were	be	VBD
cord-269150-d1sgnxc0	153	22	used	use	VBN
cord-269150-d1sgnxc0	153	23	for	for	IN
cord-269150-d1sgnxc0	153	24	biotin	biotin	NN
cord-269150-d1sgnxc0	153	25	-	-	HYPH
cord-269150-d1sgnxc0	153	26	RNA	rna	NN
cord-269150-d1sgnxc0	153	27	pull	pull	VB
cord-269150-d1sgnxc0	153	28	-	-	HYPH
cord-269150-d1sgnxc0	153	29	down	down	RP
cord-269150-d1sgnxc0	153	30	assay	assay	NN
cord-269150-d1sgnxc0	153	31	using	use	VBG
cord-269150-d1sgnxc0	153	32	the	the	DT
cord-269150-d1sgnxc0	153	33	full	full	JJ
cord-269150-d1sgnxc0	153	34	-	-	HYPH
cord-269150-d1sgnxc0	153	35	length	length	NN
cord-269150-d1sgnxc0	153	36	IBV	IBV	NNP
cord-269150-d1sgnxc0	153	37	5	5	CD
cord-269150-d1sgnxc0	153	38	0	0	CD
cord-269150-d1sgnxc0	153	39	-UTR	-utr	NN
cord-269150-d1sgnxc0	153	40	.	.	.
cord-269150-d1sgnxc0	154	1	Both	both	DT
cord-269150-d1sgnxc0	154	2	the	the	DT
cord-269150-d1sgnxc0	154	3	crude	crude	JJ
cord-269150-d1sgnxc0	154	4	lysates	lysate	NNS
cord-269150-d1sgnxc0	154	5	(	(	-LRB-
cord-269150-d1sgnxc0	154	6	labeled	label	VBN
cord-269150-d1sgnxc0	154	7	C	C	NNP
cord-269150-d1sgnxc0	154	8	)	)	-RRB-
cord-269150-d1sgnxc0	154	9	and	and	CC
cord-269150-d1sgnxc0	154	10	protein	protein	NN
cord-269150-d1sgnxc0	154	11	bound	bind	VBN
cord-269150-d1sgnxc0	154	12	on	on	IN
cord-269150-d1sgnxc0	154	13	the	the	DT
cord-269150-d1sgnxc0	154	14	streptavidin	streptavidin	NNP
cord-269150-d1sgnxc0	154	15	beads	bead	NNS
cord-269150-d1sgnxc0	154	16	(	(	-LRB-
cord-269150-d1sgnxc0	154	17	labeled	label	VBN
cord-269150-d1sgnxc0	154	18	E	e	NN
cord-269150-d1sgnxc0	154	19	)	)	-RRB-
cord-269150-d1sgnxc0	154	20	were	be	VBD
cord-269150-d1sgnxc0	154	21	resolved	resolve	VBN
cord-269150-d1sgnxc0	154	22	by	by	IN
cord-269150-d1sgnxc0	154	23	SDS	SDS	NNP
cord-269150-d1sgnxc0	154	24	-	-	HYPH
cord-269150-d1sgnxc0	154	25	PAGE	PAGE	NNP
cord-269150-d1sgnxc0	154	26	and	and	CC
cord-269150-d1sgnxc0	154	27	detected	detect	VBN
cord-269150-d1sgnxc0	154	28	by	by	IN
cord-269150-d1sgnxc0	154	29	Western	western	JJ
cord-269150-d1sgnxc0	154	30	blot	blot	NN
cord-269150-d1sgnxc0	154	31	with	with	IN
cord-269150-d1sgnxc0	154	32	anti	anti	JJ
cord-269150-d1sgnxc0	154	33	-	-	JJ
cord-269150-d1sgnxc0	154	34	Flag	flag	JJ
cord-269150-d1sgnxc0	154	35	antibody	antibody	NN
cord-269150-d1sgnxc0	154	36	.	.	.
cord-269150-d1sgnxc0	155	1	EGFP	EGFP	NNP
cord-269150-d1sgnxc0	155	2	over	over	RB
cord-269150-d1sgnxc0	155	3	-	-	HYPH
cord-269150-d1sgnxc0	155	4	expressed	express	VBN
cord-269150-d1sgnxc0	155	5	cell	cell	NN
cord-269150-d1sgnxc0	155	6	lysate	lysate	NN
cord-269150-d1sgnxc0	155	7	was	be	VBD
cord-269150-d1sgnxc0	155	8	included	include	VBN
cord-269150-d1sgnxc0	155	9	as	as	IN
cord-269150-d1sgnxc0	155	10	a	a	DT
cord-269150-d1sgnxc0	155	11	negative	negative	JJ
cord-269150-d1sgnxc0	155	12	control	control	NN
cord-269150-d1sgnxc0	155	13	.	.	.
cord-269150-d1sgnxc0	156	1	(	(	-LRB-
cord-269150-d1sgnxc0	156	2	C	C	NNP
cord-269150-d1sgnxc0	156	3	)	)	-RRB-
cord-269150-d1sgnxc0	156	4	Interaction	Interaction	NNP
cord-269150-d1sgnxc0	156	5	of	of	IN
cord-269150-d1sgnxc0	156	6	three	three	CD
cord-269150-d1sgnxc0	156	7	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	156	8	mutant	mutant	JJ
cord-269150-d1sgnxc0	156	9	constructs	construct	NNS
cord-269150-d1sgnxc0	156	10	,	,	,
cord-269150-d1sgnxc0	156	11	Y13A	Y13A	NNP
cord-269150-d1sgnxc0	156	12	,	,	,
cord-269150-d1sgnxc0	156	13	V53F55A	V53F55A	NNP
cord-269150-d1sgnxc0	156	14	and	and	CC
cord-269150-d1sgnxc0	156	15	YVF	YVF	NNP
cord-269150-d1sgnxc0	156	16	,	,	,
cord-269150-d1sgnxc0	156	17	with	with	IN
cord-269150-d1sgnxc0	156	18	IBV	IBV	NNP
cord-269150-d1sgnxc0	156	19	5	5	CD
cord-269150-d1sgnxc0	156	20	0	0	CD
cord-269150-d1sgnxc0	156	21	-UTR	-utr	NN
cord-269150-d1sgnxc0	156	22	.	.	.
cord-269150-d1sgnxc0	157	1	The	the	DT
cord-269150-d1sgnxc0	157	2	three	three	CD
cord-269150-d1sgnxc0	157	3	full	full	JJ
cord-269150-d1sgnxc0	157	4	-	-	HYPH
cord-269150-d1sgnxc0	157	5	length	length	NN
cord-269150-d1sgnxc0	157	6	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	157	7	constructs	construct	NNS
cord-269150-d1sgnxc0	157	8	with	with	IN
cord-269150-d1sgnxc0	157	9	amino	amino	NN
cord-269150-d1sgnxc0	157	10	acid	acid	NN
cord-269150-d1sgnxc0	157	11	mutations	mutation	NNS
cord-269150-d1sgnxc0	157	12	at	at	IN
cord-269150-d1sgnxc0	157	13	the	the	DT
cord-269150-d1sgnxc0	157	14	predicted	predict	VBN
cord-269150-d1sgnxc0	157	15	RNA	RNA	NNP
cord-269150-d1sgnxc0	157	16	-	-	HYPH
cord-269150-d1sgnxc0	157	17	binding	bind	VBG
cord-269150-d1sgnxc0	157	18	sites	site	NNS
cord-269150-d1sgnxc0	157	19	were	be	VBD
cord-269150-d1sgnxc0	157	20	transfected	transfecte	VBN
cord-269150-d1sgnxc0	157	21	into	into	IN
cord-269150-d1sgnxc0	157	22	H1299	H1299	NNP
cord-269150-d1sgnxc0	157	23	cells	cell	NNS
cord-269150-d1sgnxc0	157	24	and	and	CC
cord-269150-d1sgnxc0	157	25	used	use	VBN
cord-269150-d1sgnxc0	157	26	in	in	IN
cord-269150-d1sgnxc0	157	27	a	a	DT
cord-269150-d1sgnxc0	157	28	biotin	biotin	NN
cord-269150-d1sgnxc0	157	29	-	-	HYPH
cord-269150-d1sgnxc0	157	30	RNA	rna	NN
cord-269150-d1sgnxc0	157	31	pull	pull	VB
cord-269150-d1sgnxc0	157	32	-	-	HYPH
cord-269150-d1sgnxc0	157	33	down	down	RP
cord-269150-d1sgnxc0	157	34	assay	assay	NN
cord-269150-d1sgnxc0	157	35	with	with	IN
cord-269150-d1sgnxc0	157	36	the	the	DT
cord-269150-d1sgnxc0	157	37	full	full	JJ
cord-269150-d1sgnxc0	157	38	-	-	HYPH
cord-269150-d1sgnxc0	157	39	length	length	NN
cord-269150-d1sgnxc0	157	40	IBV	IBV	NNP
cord-269150-d1sgnxc0	157	41	5	5	CD
cord-269150-d1sgnxc0	157	42	0	0	CD
cord-269150-d1sgnxc0	157	43	-UTR	-utr	NN
cord-269150-d1sgnxc0	157	44	.	.	.
cord-269150-d1sgnxc0	158	1	All	all	DT
cord-269150-d1sgnxc0	158	2	mutants	mutant	NNS
cord-269150-d1sgnxc0	158	3	resulted	result	VBD
cord-269150-d1sgnxc0	158	4	in	in	IN
cord-269150-d1sgnxc0	158	5	a	a	DT
cord-269150-d1sgnxc0	158	6	reduction	reduction	NN
cord-269150-d1sgnxc0	158	7	in	in	IN
cord-269150-d1sgnxc0	158	8	RNA	rna	NN
cord-269150-d1sgnxc0	158	9	-	-	HYPH
cord-269150-d1sgnxc0	158	10	binding	bind	VBG
cord-269150-d1sgnxc0	158	11	affinity	affinity	NN
cord-269150-d1sgnxc0	158	12	for	for	IN
cord-269150-d1sgnxc0	158	13	the	the	DT
cord-269150-d1sgnxc0	158	14	biotinylated	biotinylate	VBN
cord-269150-d1sgnxc0	158	15	RNA	RNA	NNP
cord-269150-d1sgnxc0	158	16	molecule	molecule	NN
cord-269150-d1sgnxc0	158	17	and	and	CC
cord-269150-d1sgnxc0	158	18	the	the	DT
cord-269150-d1sgnxc0	158	19	reduction	reduction	NN
cord-269150-d1sgnxc0	158	20	was	be	VBD
cord-269150-d1sgnxc0	158	21	most	most	RBS
cord-269150-d1sgnxc0	158	22	dramatic	dramatic	JJ
cord-269150-d1sgnxc0	158	23	for	for	IN
cord-269150-d1sgnxc0	158	24	triple	triple	JJ
cord-269150-d1sgnxc0	158	25	residue	residue	NN
cord-269150-d1sgnxc0	158	26	mutant	mutant	NN
cord-269150-d1sgnxc0	158	27	YVF	YVF	NNP
cord-269150-d1sgnxc0	158	28	(	(	-LRB-
cord-269150-d1sgnxc0	158	29	Figure	figure	NN
cord-269150-d1sgnxc0	158	30	4C	4c	CD
cord-269150-d1sgnxc0	158	31	)	)	-RRB-
cord-269150-d1sgnxc0	158	32	,	,	,
cord-269150-d1sgnxc0	158	33	implying	imply	VBG
cord-269150-d1sgnxc0	158	34	cooperative	cooperative	JJ
cord-269150-d1sgnxc0	158	35	binding	binding	NN
cord-269150-d1sgnxc0	158	36	demonstrated	demonstrate	VBN
cord-269150-d1sgnxc0	158	37	by	by	IN
cord-269150-d1sgnxc0	158	38	the	the	DT
cord-269150-d1sgnxc0	158	39	three	three	CD
cord-269150-d1sgnxc0	158	40	residues	residue	NNS
cord-269150-d1sgnxc0	158	41	.	.	.
cord-269150-d1sgnxc0	159	1	This	this	DT
cord-269150-d1sgnxc0	159	2	finding	finding	NN
cord-269150-d1sgnxc0	159	3	confirms	confirm	VBZ
cord-269150-d1sgnxc0	159	4	that	that	IN
cord-269150-d1sgnxc0	159	5	the	the	DT
cord-269150-d1sgnxc0	159	6	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	159	7	RRM	RRM	NNP
cord-269150-d1sgnxc0	159	8	is	be	VBZ
cord-269150-d1sgnxc0	159	9	involved	involve	VBN
cord-269150-d1sgnxc0	159	10	in	in	IN
cord-269150-d1sgnxc0	159	11	the	the	DT
cord-269150-d1sgnxc0	159	12	interaction	interaction	NN
cord-269150-d1sgnxc0	159	13	with	with	IN
cord-269150-d1sgnxc0	159	14	IBV	IBV	NNP
cord-269150-d1sgnxc0	159	15	5	5	CD
cord-269150-d1sgnxc0	159	16	0	0	CD
cord-269150-d1sgnxc0	159	17	-UTR	-utr	NN
cord-269150-d1sgnxc0	159	18	.	.	.
cord-269150-d1sgnxc0	160	1	To	to	TO
cord-269150-d1sgnxc0	160	2	demonstrate	demonstrate	VB
cord-269150-d1sgnxc0	160	3	the	the	DT
cord-269150-d1sgnxc0	160	4	significance	significance	NN
cord-269150-d1sgnxc0	160	5	of	of	IN
cord-269150-d1sgnxc0	160	6	the	the	DT
cord-269150-d1sgnxc0	160	7	interaction	interaction	NN
cord-269150-d1sgnxc0	160	8	between	between	IN
cord-269150-d1sgnxc0	160	9	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	160	10	and	and	CC
cord-269150-d1sgnxc0	160	11	IBV	IBV	NNP
cord-269150-d1sgnxc0	160	12	5	5	CD
cord-269150-d1sgnxc0	160	13	0	0	CD
cord-269150-d1sgnxc0	160	14	-UTR	-utr	NN
cord-269150-d1sgnxc0	160	15	,	,	,
cord-269150-d1sgnxc0	160	16	an	an	DT
cord-269150-d1sgnxc0	160	17	siRNA	siRNA	NNP
cord-269150-d1sgnxc0	160	18	duplex	duplex	NN
cord-269150-d1sgnxc0	160	19	designed	design	VBN
cord-269150-d1sgnxc0	160	20	to	to	TO
cord-269150-d1sgnxc0	160	21	silence	silence	VB
cord-269150-d1sgnxc0	160	22	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	160	23	expression	expression	NN
cord-269150-d1sgnxc0	160	24	(	(	-LRB-
cord-269150-d1sgnxc0	160	25	siMadp1	siMadp1	NNP
cord-269150-d1sgnxc0	160	26	)	)	-RRB-
cord-269150-d1sgnxc0	160	27	and	and	CC
cord-269150-d1sgnxc0	160	28	a	a	DT
cord-269150-d1sgnxc0	160	29	negative	negative	JJ
cord-269150-d1sgnxc0	160	30	control	control	NN
cord-269150-d1sgnxc0	160	31	siRNA	sirna	NN
cord-269150-d1sgnxc0	160	32	targeting	target	VBG
cord-269150-d1sgnxc0	160	33	EGFP	EGFP	NNP
cord-269150-d1sgnxc0	160	34	protein	protein	NN
cord-269150-d1sgnxc0	160	35	(	(	-LRB-
cord-269150-d1sgnxc0	160	36	siEGFP	siegfp	UH
cord-269150-d1sgnxc0	160	37	)	)	-RRB-
cord-269150-d1sgnxc0	160	38	were	be	VBD
cord-269150-d1sgnxc0	160	39	Figure	figure	NN
cord-269150-d1sgnxc0	160	40	5A	5a	CD
cord-269150-d1sgnxc0	160	41	)	)	-RRB-
cord-269150-d1sgnxc0	160	42	.	.	.
cord-269150-d1sgnxc0	161	1	Densitometric	Densitometric	NNP
cord-269150-d1sgnxc0	161	2	analyses	analysis	NNS
cord-269150-d1sgnxc0	161	3	identified	identify	VBD
cord-269150-d1sgnxc0	161	4	a	a	DT
cord-269150-d1sgnxc0	161	5	reduction	reduction	NN
cord-269150-d1sgnxc0	161	6	between	between	IN
cord-269150-d1sgnxc0	161	7	40	40	CD
cord-269150-d1sgnxc0	161	8	%	%	NN
cord-269150-d1sgnxc0	161	9	and	and	CC
cord-269150-d1sgnxc0	161	10	80	80	CD
cord-269150-d1sgnxc0	161	11	%	%	NN
cord-269150-d1sgnxc0	161	12	of	of	IN
cord-269150-d1sgnxc0	161	13	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	161	14	mRNA	mrna	NN
cord-269150-d1sgnxc0	161	15	was	be	VBD
cord-269150-d1sgnxc0	161	16	achieved	achieve	VBN
cord-269150-d1sgnxc0	161	17	by	by	IN
cord-269150-d1sgnxc0	161	18	this	this	DT
cord-269150-d1sgnxc0	161	19	siRNA	sirna	NN
cord-269150-d1sgnxc0	161	20	which	which	WDT
cord-269150-d1sgnxc0	161	21	resulted	result	VBD
cord-269150-d1sgnxc0	161	22	in	in	IN
cord-269150-d1sgnxc0	161	23	a	a	DT
cord-269150-d1sgnxc0	161	24	reduction	reduction	NN
cord-269150-d1sgnxc0	161	25	between	between	IN
cord-269150-d1sgnxc0	161	26	70	70	CD
cord-269150-d1sgnxc0	161	27	%	%	NN
cord-269150-d1sgnxc0	161	28	and	and	CC
cord-269150-d1sgnxc0	161	29	90	90	CD
cord-269150-d1sgnxc0	161	30	%	%	NN
cord-269150-d1sgnxc0	161	31	of	of	IN
cord-269150-d1sgnxc0	161	32	negative	negative	JJ
cord-269150-d1sgnxc0	161	33	stranded	strand	VBN
cord-269150-d1sgnxc0	161	34	genomic	genomic	JJ
cord-269150-d1sgnxc0	161	35	viral	viral	JJ
cord-269150-d1sgnxc0	161	36	RNA	RNA	NNP
cord-269150-d1sgnxc0	161	37	,	,	,
cord-269150-d1sgnxc0	161	38	40	40	CD
cord-269150-d1sgnxc0	161	39	-	-	SYM
cord-269150-d1sgnxc0	161	40	80	80	CD
cord-269150-d1sgnxc0	161	41	%	%	NN
cord-269150-d1sgnxc0	161	42	of	of	IN
cord-269150-d1sgnxc0	161	43	negative	negative	JJ
cord-269150-d1sgnxc0	161	44	stranded	strand	VBN
cord-269150-d1sgnxc0	161	45	subgenomic	subgenomic	JJ
cord-269150-d1sgnxc0	161	46	viral	viral	NNP
cord-269150-d1sgnxc0	161	47	RNA	RNA	NNP
cord-269150-d1sgnxc0	161	48	and	and	CC
cord-269150-d1sgnxc0	161	49	50	50	CD
cord-269150-d1sgnxc0	161	50	-	-	SYM
cord-269150-d1sgnxc0	161	51	90	90	CD
cord-269150-d1sgnxc0	161	52	%	%	NN
cord-269150-d1sgnxc0	161	53	of	of	IN
cord-269150-d1sgnxc0	161	54	positive	positive	JJ
cord-269150-d1sgnxc0	161	55	stranded	strand	VBN
cord-269150-d1sgnxc0	161	56	subgenomic	subgenomic	JJ
cord-269150-d1sgnxc0	161	57	viral	viral	JJ
cord-269150-d1sgnxc0	161	58	RNA	RNA	NNP
cord-269150-d1sgnxc0	161	59	.	.	.
cord-269150-d1sgnxc0	162	1	Western	western	JJ
cord-269150-d1sgnxc0	162	2	blot	blot	NN
cord-269150-d1sgnxc0	162	3	analysis	analysis	NN
cord-269150-d1sgnxc0	162	4	also	also	RB
cord-269150-d1sgnxc0	162	5	noted	note	VBD
cord-269150-d1sgnxc0	162	6	a	a	DT
cord-269150-d1sgnxc0	162	7	reduction	reduction	NN
cord-269150-d1sgnxc0	162	8	in	in	IN
cord-269150-d1sgnxc0	162	9	the	the	DT
cord-269150-d1sgnxc0	162	10	expression	expression	NN
cord-269150-d1sgnxc0	162	11	of	of	IN
cord-269150-d1sgnxc0	162	12	viral	viral	JJ
cord-269150-d1sgnxc0	162	13	structural	structural	JJ
cord-269150-d1sgnxc0	162	14	genes	gene	NNS
cord-269150-d1sgnxc0	162	15	,	,	,
cord-269150-d1sgnxc0	162	16	between	between	IN
cord-269150-d1sgnxc0	162	17	50	50	CD
cord-269150-d1sgnxc0	162	18	%	%	NN
cord-269150-d1sgnxc0	162	19	and	and	CC
cord-269150-d1sgnxc0	162	20	90	90	CD
cord-269150-d1sgnxc0	162	21	%	%	NN
cord-269150-d1sgnxc0	162	22	reduction	reduction	NN
cord-269150-d1sgnxc0	162	23	for	for	IN
cord-269150-d1sgnxc0	162	24	S	S	NNP
cord-269150-d1sgnxc0	162	25	and	and	CC
cord-269150-d1sgnxc0	162	26	N	n	CD
cord-269150-d1sgnxc0	162	27	proteins	protein	NNS
cord-269150-d1sgnxc0	162	28	,	,	,
cord-269150-d1sgnxc0	162	29	with	with	IN
cord-269150-d1sgnxc0	162	30	a	a	DT
cord-269150-d1sgnxc0	162	31	reduction	reduction	NN
cord-269150-d1sgnxc0	162	32	between	between	IN
cord-269150-d1sgnxc0	162	33	40	40	CD
cord-269150-d1sgnxc0	162	34	%	%	NN
cord-269150-d1sgnxc0	162	35	and	and	CC
cord-269150-d1sgnxc0	162	36	80	80	CD
cord-269150-d1sgnxc0	162	37	%	%	NN
cord-269150-d1sgnxc0	162	38	of	of	IN
cord-269150-d1sgnxc0	162	39	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	162	40	protein	protein	NN
cord-269150-d1sgnxc0	162	41	(	(	-LRB-
cord-269150-d1sgnxc0	162	42	Figure	figure	NN
cord-269150-d1sgnxc0	162	43	5B	5b	NN
cord-269150-d1sgnxc0	162	44	)	)	-RRB-
cord-269150-d1sgnxc0	162	45	.	.	.
cord-269150-d1sgnxc0	163	1	Virus	virus	NN
cord-269150-d1sgnxc0	163	2	titers	titer	NNS
cord-269150-d1sgnxc0	163	3	as	as	IN
cord-269150-d1sgnxc0	163	4	represented	represent	VBN
cord-269150-d1sgnxc0	163	5	by	by	IN
cord-269150-d1sgnxc0	163	6	the	the	DT
cord-269150-d1sgnxc0	163	7	tissue	tissue	NN
cord-269150-d1sgnxc0	163	8	culture	culture	NN
cord-269150-d1sgnxc0	163	9	infectious	infectious	JJ
cord-269150-d1sgnxc0	163	10	dose	dose	NN
cord-269150-d1sgnxc0	163	11	(	(	-LRB-
cord-269150-d1sgnxc0	163	12	Log10	Log10	NNP
cord-269150-d1sgnxc0	163	13	TCID50	TCID50	NNP
cord-269150-d1sgnxc0	163	14	)	)	-RRB-
cord-269150-d1sgnxc0	163	15	at	at	IN
cord-269150-d1sgnxc0	163	16	each	each	DT
cord-269150-d1sgnxc0	163	17	infection	infection	NN
cord-269150-d1sgnxc0	163	18	time	time	NN
cord-269150-d1sgnxc0	163	19	point	point	NN
cord-269150-d1sgnxc0	163	20	was	be	VBD
cord-269150-d1sgnxc0	163	21	reduced	reduce	VBN
cord-269150-d1sgnxc0	163	22	by	by	IN
cord-269150-d1sgnxc0	163	23	a	a	DT
cord-269150-d1sgnxc0	163	24	minimum	minimum	NN
cord-269150-d1sgnxc0	163	25	of	of	IN
cord-269150-d1sgnxc0	163	26	3-fold	3-fold	CD
cord-269150-d1sgnxc0	163	27	and	and	CC
cord-269150-d1sgnxc0	163	28	up	up	IN
cord-269150-d1sgnxc0	163	29	to	to	IN
cord-269150-d1sgnxc0	163	30	10-fold	10-fold	CD
cord-269150-d1sgnxc0	163	31	compared	compare	VBN
cord-269150-d1sgnxc0	163	32	to	to	IN
cord-269150-d1sgnxc0	163	33	siEGFP	siEGFP	NNP
cord-269150-d1sgnxc0	163	34	-	-	HYPH
cord-269150-d1sgnxc0	163	35	transfected	transfecte	VBN
cord-269150-d1sgnxc0	163	36	cells	cell	NNS
cord-269150-d1sgnxc0	163	37	beyond	beyond	IN
cord-269150-d1sgnxc0	163	38	4	4	CD
cord-269150-d1sgnxc0	163	39	h	h	NN
cord-269150-d1sgnxc0	163	40	of	of	IN
cord-269150-d1sgnxc0	163	41	infection	infection	NN
cord-269150-d1sgnxc0	163	42	(	(	-LRB-
cord-269150-d1sgnxc0	163	43	Figure	figure	NN
cord-269150-d1sgnxc0	163	44	5C	5c	CD
cord-269150-d1sgnxc0	163	45	)	)	-RRB-
cord-269150-d1sgnxc0	163	46	.	.	.
cord-269150-d1sgnxc0	164	1	Firefly	firefly	NN
cord-269150-d1sgnxc0	164	2	luciferase	luciferase	NN
cord-269150-d1sgnxc0	164	3	activity	activity	NN
cord-269150-d1sgnxc0	164	4	of	of	IN
cord-269150-d1sgnxc0	164	5	cell	cell	NN
cord-269150-d1sgnxc0	164	6	lysates	lysate	NNS
cord-269150-d1sgnxc0	164	7	harvested	harvest	VBN
cord-269150-d1sgnxc0	164	8	at	at	IN
cord-269150-d1sgnxc0	164	9	different	different	JJ
cord-269150-d1sgnxc0	164	10	time	time	NN
cord-269150-d1sgnxc0	164	11	points	point	NNS
cord-269150-d1sgnxc0	164	12	showed	show	VBD
cord-269150-d1sgnxc0	164	13	a	a	DT
cord-269150-d1sgnxc0	164	14	minimum	minimum	NN
cord-269150-d1sgnxc0	164	15	of	of	IN
cord-269150-d1sgnxc0	164	16	50	50	CD
cord-269150-d1sgnxc0	164	17	%	%	NN
cord-269150-d1sgnxc0	164	18	reduction	reduction	NN
cord-269150-d1sgnxc0	164	19	upon	upon	IN
cord-269150-d1sgnxc0	164	20	the	the	DT
cord-269150-d1sgnxc0	164	21	silencing	silencing	NN
cord-269150-d1sgnxc0	164	22	of	of	IN
cord-269150-d1sgnxc0	164	23	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	164	24	,	,	,
cord-269150-d1sgnxc0	164	25	which	which	WDT
cord-269150-d1sgnxc0	164	26	supports	support	VBZ
cord-269150-d1sgnxc0	164	27	further	further	RB
cord-269150-d1sgnxc0	164	28	the	the	DT
cord-269150-d1sgnxc0	164	29	observation	observation	NN
cord-269150-d1sgnxc0	164	30	that	that	IN
cord-269150-d1sgnxc0	164	31	the	the	DT
cord-269150-d1sgnxc0	164	32	total	total	JJ
cord-269150-d1sgnxc0	164	33	viral	viral	JJ
cord-269150-d1sgnxc0	164	34	protein	protein	NN
cord-269150-d1sgnxc0	164	35	production	production	NN
cord-269150-d1sgnxc0	164	36	was	be	VBD
cord-269150-d1sgnxc0	164	37	much	much	RB
cord-269150-d1sgnxc0	164	38	reduced	reduce	VBN
cord-269150-d1sgnxc0	164	39	(	(	-LRB-
cord-269150-d1sgnxc0	164	40	Figure	figure	NN
cord-269150-d1sgnxc0	164	41	5D	5d	CD
cord-269150-d1sgnxc0	164	42	)	)	-RRB-
cord-269150-d1sgnxc0	164	43	.	.	.
cord-269150-d1sgnxc0	165	1	To	to	TO
cord-269150-d1sgnxc0	165	2	eliminate	eliminate	VB
cord-269150-d1sgnxc0	165	3	the	the	DT
cord-269150-d1sgnxc0	165	4	possibility	possibility	NN
cord-269150-d1sgnxc0	165	5	that	that	IN
cord-269150-d1sgnxc0	165	6	the	the	DT
cord-269150-d1sgnxc0	165	7	phenotype	phenotype	NN
cord-269150-d1sgnxc0	165	8	observed	observe	VBN
cord-269150-d1sgnxc0	165	9	in	in	IN
cord-269150-d1sgnxc0	165	10	MADP1-silenced	MADP1-silenced	NNP
cord-269150-d1sgnxc0	165	11	cells	cell	NNS
cord-269150-d1sgnxc0	165	12	during	during	IN
cord-269150-d1sgnxc0	165	13	IBV	IBV	NNP
cord-269150-d1sgnxc0	165	14	infection	infection	NN
cord-269150-d1sgnxc0	165	15	was	be	VBD
cord-269150-d1sgnxc0	165	16	due	due	JJ
cord-269150-d1sgnxc0	165	17	to	to	IN
cord-269150-d1sgnxc0	165	18	an	an	DT
cord-269150-d1sgnxc0	165	19	off	off	JJ
cord-269150-d1sgnxc0	165	20	-	-	HYPH
cord-269150-d1sgnxc0	165	21	target	target	NN
cord-269150-d1sgnxc0	165	22	effect	effect	NN
cord-269150-d1sgnxc0	165	23	of	of	IN
cord-269150-d1sgnxc0	165	24	the	the	DT
cord-269150-d1sgnxc0	165	25	siRNA	siRNA	NNP
cord-269150-d1sgnxc0	165	26	duplex	duplex	NNP
cord-269150-d1sgnxc0	165	27	used	use	VBN
cord-269150-d1sgnxc0	165	28	,	,	,
cord-269150-d1sgnxc0	165	29	four	four	CD
cord-269150-d1sgnxc0	165	30	additional	additional	JJ
cord-269150-d1sgnxc0	165	31	siRNA	siRNA	NNP
cord-269150-d1sgnxc0	165	32	duplexes	duplex	NNS
cord-269150-d1sgnxc0	165	33	targeting	target	VBG
cord-269150-d1sgnxc0	165	34	different	different	JJ
cord-269150-d1sgnxc0	165	35	regions	region	NNS
cord-269150-d1sgnxc0	165	36	of	of	IN
cord-269150-d1sgnxc0	165	37	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	165	38	were	be	VBD
cord-269150-d1sgnxc0	165	39	used	use	VBN
cord-269150-d1sgnxc0	165	40	in	in	IN
cord-269150-d1sgnxc0	165	41	various	various	JJ
cord-269150-d1sgnxc0	165	42	combinations	combination	NNS
cord-269150-d1sgnxc0	165	43	with	with	IN
cord-269150-d1sgnxc0	165	44	siMadp1	siMadp1	NNP
cord-269150-d1sgnxc0	165	45	(	(	-LRB-
cord-269150-d1sgnxc0	165	46	Figure	figure	NN
cord-269150-d1sgnxc0	165	47	6	6	CD
cord-269150-d1sgnxc0	165	48	)	)	-RRB-
cord-269150-d1sgnxc0	165	49	to	to	TO
cord-269150-d1sgnxc0	165	50	check	check	VB
cord-269150-d1sgnxc0	165	51	their	-PRON-	PRP$
cord-269150-d1sgnxc0	165	52	effect	effect	NN
cord-269150-d1sgnxc0	165	53	on	on	IN
cord-269150-d1sgnxc0	165	54	IBV	IBV	NNP
cord-269150-d1sgnxc0	165	55	infection	infection	NN
cord-269150-d1sgnxc0	165	56	,	,	,
cord-269150-d1sgnxc0	165	57	as	as	IN
cord-269150-d1sgnxc0	165	58	illustrated	illustrate	VBN
cord-269150-d1sgnxc0	165	59	by	by	IN
cord-269150-d1sgnxc0	165	60	the	the	DT
cord-269150-d1sgnxc0	165	61	expression	expression	NN
cord-269150-d1sgnxc0	165	62	of	of	IN
cord-269150-d1sgnxc0	165	63	the	the	DT
cord-269150-d1sgnxc0	165	64	luciferase	luciferase	NN
cord-269150-d1sgnxc0	165	65	gene	gene	NN
cord-269150-d1sgnxc0	165	66	(	(	-LRB-
cord-269150-d1sgnxc0	165	67	Figure	Figure	NNP
cord-269150-d1sgnxc0	165	68	6B	6b	NN
cord-269150-d1sgnxc0	165	69	)	)	-RRB-
cord-269150-d1sgnxc0	165	70	.	.	.
cord-269150-d1sgnxc0	166	1	All	all	DT
cord-269150-d1sgnxc0	166	2	six	six	CD
cord-269150-d1sgnxc0	166	3	combinations	combination	NNS
cord-269150-d1sgnxc0	166	4	of	of	IN
cord-269150-d1sgnxc0	166	5	five	five	CD
cord-269150-d1sgnxc0	166	6	different	different	JJ
cord-269150-d1sgnxc0	166	7	siRNA	siRNA	NNP
cord-269150-d1sgnxc0	166	8	duplexes	duplex	NNS
cord-269150-d1sgnxc0	166	9	resulted	result	VBD
cord-269150-d1sgnxc0	166	10	in	in	IN
cord-269150-d1sgnxc0	166	11	a	a	DT
cord-269150-d1sgnxc0	166	12	reduction	reduction	NN
cord-269150-d1sgnxc0	166	13	in	in	IN
cord-269150-d1sgnxc0	166	14	the	the	DT
cord-269150-d1sgnxc0	166	15	luciferase	luciferase	NN
cord-269150-d1sgnxc0	166	16	activity	activity	NN
cord-269150-d1sgnxc0	166	17	of	of	IN
cord-269150-d1sgnxc0	166	18	the	the	DT
cord-269150-d1sgnxc0	166	19	infected	infected	JJ
cord-269150-d1sgnxc0	166	20	cells	cell	NNS
cord-269150-d1sgnxc0	166	21	by	by	IN
cord-269150-d1sgnxc0	166	22	either	either	CC
cord-269150-d1sgnxc0	166	23	70	70	CD
cord-269150-d1sgnxc0	166	24	%	%	NN
cord-269150-d1sgnxc0	166	25	(	(	-LRB-
cord-269150-d1sgnxc0	166	26	siCombi	siCombi	NNP
cord-269150-d1sgnxc0	166	27	3	3	CD
cord-269150-d1sgnxc0	166	28	and	and	CC
cord-269150-d1sgnxc0	166	29	4	4	CD
cord-269150-d1sgnxc0	166	30	)	)	-RRB-
cord-269150-d1sgnxc0	166	31	,	,	,
cord-269150-d1sgnxc0	166	32	without	without	IN
cord-269150-d1sgnxc0	166	33	siMadp1	siMadp1	NNP
cord-269150-d1sgnxc0	166	34	or	or	CC
cord-269150-d1sgnxc0	166	35	more	more	JJR
cord-269150-d1sgnxc0	166	36	than	than	IN
cord-269150-d1sgnxc0	166	37	90	90	CD
cord-269150-d1sgnxc0	166	38	%	%	NN
cord-269150-d1sgnxc0	166	39	(	(	-LRB-
cord-269150-d1sgnxc0	166	40	siCombi	siCombi	NNP
cord-269150-d1sgnxc0	166	41	1	1	CD
cord-269150-d1sgnxc0	166	42	,	,	,
cord-269150-d1sgnxc0	166	43	2	2	CD
cord-269150-d1sgnxc0	166	44	,	,	,
cord-269150-d1sgnxc0	166	45	5	5	CD
cord-269150-d1sgnxc0	166	46	and	and	CC
cord-269150-d1sgnxc0	166	47	6	6	CD
cord-269150-d1sgnxc0	166	48	)	)	-RRB-
cord-269150-d1sgnxc0	166	49	with	with	IN
cord-269150-d1sgnxc0	166	50	siMadp1	siMadp1	NNP
cord-269150-d1sgnxc0	166	51	,	,	,
cord-269150-d1sgnxc0	166	52	compared	compare	VBN
cord-269150-d1sgnxc0	166	53	to	to	IN
cord-269150-d1sgnxc0	166	54	negative	negative	JJ
cord-269150-d1sgnxc0	166	55	control	control	NN
cord-269150-d1sgnxc0	166	56	,	,	,
cord-269150-d1sgnxc0	166	57	siEGFP	siEGFP	NNP
cord-269150-d1sgnxc0	166	58	-	-	HYPH
cord-269150-d1sgnxc0	166	59	transfected	transfecte	VBN
cord-269150-d1sgnxc0	166	60	cells	cell	NNS
cord-269150-d1sgnxc0	166	61	(	(	-LRB-
cord-269150-d1sgnxc0	166	62	Figure	figure	NN
cord-269150-d1sgnxc0	166	63	6B	6b	NN
cord-269150-d1sgnxc0	166	64	)	)	-RRB-
cord-269150-d1sgnxc0	166	65	.	.	.
cord-269150-d1sgnxc0	167	1	This	this	DT
cord-269150-d1sgnxc0	167	2	implies	imply	VBZ
cord-269150-d1sgnxc0	167	3	that	that	IN
cord-269150-d1sgnxc0	167	4	,	,	,
cord-269150-d1sgnxc0	167	5	in	in	IN
cord-269150-d1sgnxc0	167	6	general	general	JJ
cord-269150-d1sgnxc0	167	7	,	,	,
cord-269150-d1sgnxc0	167	8	knocking	knock	VBG
cord-269150-d1sgnxc0	167	9	down	down	RP
cord-269150-d1sgnxc0	167	10	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	167	11	with	with	IN
cord-269150-d1sgnxc0	167	12	any	any	DT
cord-269150-d1sgnxc0	167	13	siRNA	siRNA	NNP
cord-269150-d1sgnxc0	167	14	results	result	NNS
cord-269150-d1sgnxc0	167	15	in	in	IN
cord-269150-d1sgnxc0	167	16	a	a	DT
cord-269150-d1sgnxc0	167	17	reduction	reduction	NN
cord-269150-d1sgnxc0	167	18	of	of	IN
cord-269150-d1sgnxc0	167	19	virus	virus	NN
cord-269150-d1sgnxc0	167	20	infection	infection	NN
cord-269150-d1sgnxc0	167	21	.	.	.
cord-269150-d1sgnxc0	168	1	A	a	DT
cord-269150-d1sgnxc0	168	2	stable	stable	JJ
cord-269150-d1sgnxc0	168	3	cell	cell	NN
cord-269150-d1sgnxc0	168	4	clone	clone	NN
cord-269150-d1sgnxc0	168	5	expressing	express	VBG
cord-269150-d1sgnxc0	168	6	short	short	JJ
cord-269150-d1sgnxc0	168	7	hairpin	hairpin	NN
cord-269150-d1sgnxc0	168	8	RNA	RNA	NNP
cord-269150-d1sgnxc0	168	9	to	to	IN
cord-269150-d1sgnxc0	168	10	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	168	11	(	(	-LRB-
cord-269150-d1sgnxc0	168	12	shMadp1	shMadp1	NNP
cord-269150-d1sgnxc0	168	13	)	)	-RRB-
cord-269150-d1sgnxc0	168	14	was	be	VBD
cord-269150-d1sgnxc0	168	15	selected	select	VBN
cord-269150-d1sgnxc0	168	16	from	from	IN
cord-269150-d1sgnxc0	168	17	H1299	H1299	NNP
cord-269150-d1sgnxc0	168	18	cells	cell	NNS
cord-269150-d1sgnxc0	168	19	and	and	CC
cord-269150-d1sgnxc0	168	20	the	the	DT
cord-269150-d1sgnxc0	168	21	madp1	madp1	NN
cord-269150-d1sgnxc0	169	1	mRNA	mRNA	NNP
cord-269150-d1sgnxc0	169	2	level	level	NN
cord-269150-d1sgnxc0	169	3	was	be	VBD
cord-269150-d1sgnxc0	169	4	confirmed	confirm	VBN
cord-269150-d1sgnxc0	169	5	using	use	VBG
cord-269150-d1sgnxc0	169	6	northern	northern	JJ
cord-269150-d1sgnxc0	169	7	blot	blot	NN
cord-269150-d1sgnxc0	169	8	(	(	-LRB-
cord-269150-d1sgnxc0	169	9	Figure	figure	NN
cord-269150-d1sgnxc0	169	10	7A	7a	NN
cord-269150-d1sgnxc0	169	11	)	)	-RRB-
cord-269150-d1sgnxc0	169	12	.	.	.
cord-269150-d1sgnxc0	170	1	The	the	DT
cord-269150-d1sgnxc0	170	2	expression	expression	NN
cord-269150-d1sgnxc0	170	3	of	of	IN
cord-269150-d1sgnxc0	170	4	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	170	5	and	and	CC
cord-269150-d1sgnxc0	170	6	the	the	DT
cord-269150-d1sgnxc0	170	7	effect	effect	NN
cord-269150-d1sgnxc0	170	8	of	of	IN
cord-269150-d1sgnxc0	170	9	MADP1-knockdown	MADP1-knockdown	NNP
cord-269150-d1sgnxc0	170	10	on	on	IN
cord-269150-d1sgnxc0	170	11	IBV	IBV	NNP
cord-269150-d1sgnxc0	170	12	infection	infection	NN
cord-269150-d1sgnxc0	170	13	were	be	VBD
cord-269150-d1sgnxc0	170	14	tested	test	VBN
cord-269150-d1sgnxc0	170	15	by	by	IN
cord-269150-d1sgnxc0	170	16	comparing	compare	VBG
cord-269150-d1sgnxc0	170	17	with	with	IN
cord-269150-d1sgnxc0	170	18	a	a	DT
cord-269150-d1sgnxc0	170	19	G418-selected	g418-selected	JJ
cord-269150-d1sgnxc0	170	20	cell	cell	NN
cord-269150-d1sgnxc0	170	21	line	line	NN
cord-269150-d1sgnxc0	170	22	without	without	IN
cord-269150-d1sgnxc0	170	23	expression	expression	NN
cord-269150-d1sgnxc0	170	24	of	of	IN
cord-269150-d1sgnxc0	170	25	shMadp1	shMadp1	NNP
cord-269150-d1sgnxc0	170	26	(	(	-LRB-
cord-269150-d1sgnxc0	170	27	non	non	JJ
cord-269150-d1sgnxc0	170	28	-	-	JJ
cord-269150-d1sgnxc0	170	29	targeting	targeting	JJ
cord-269150-d1sgnxc0	170	30	control	control	NN
cord-269150-d1sgnxc0	170	31	,	,	,
cord-269150-d1sgnxc0	170	32	shNC	shNC	NNP
cord-269150-d1sgnxc0	170	33	)	)	-RRB-
cord-269150-d1sgnxc0	170	34	.	.	.
cord-269150-d1sgnxc0	171	1	The	the	DT
cord-269150-d1sgnxc0	171	2	results	result	NNS
cord-269150-d1sgnxc0	171	3	showed	show	VBD
cord-269150-d1sgnxc0	171	4	that	that	IN
cord-269150-d1sgnxc0	171	5	,	,	,
cord-269150-d1sgnxc0	171	6	in	in	IN
cord-269150-d1sgnxc0	171	7	general	general	JJ
cord-269150-d1sgnxc0	171	8	,	,	,
cord-269150-d1sgnxc0	171	9	silencing	silence	VBG
cord-269150-d1sgnxc0	171	10	of	of	IN
cord-269150-d1sgnxc0	171	11	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	171	12	with	with	IN
cord-269150-d1sgnxc0	171	13	shRNA	shrna	NN
cord-269150-d1sgnxc0	171	14	reduced	reduce	VBN
cord-269150-d1sgnxc0	171	15	the	the	DT
cord-269150-d1sgnxc0	171	16	amount	amount	NN
cord-269150-d1sgnxc0	171	17	of	of	IN
cord-269150-d1sgnxc0	171	18	viral	viral	JJ
cord-269150-d1sgnxc0	171	19	mRNA	mrna	NN
cord-269150-d1sgnxc0	171	20	production	production	NN
cord-269150-d1sgnxc0	171	21	before	before	IN
cord-269150-d1sgnxc0	171	22	16	16	CD
cord-269150-d1sgnxc0	171	23	h	h	NN
cord-269150-d1sgnxc0	171	24	post	post	NN
cord-269150-d1sgnxc0	171	25	-	-	NN
cord-269150-d1sgnxc0	171	26	infection	infection	JJ
cord-269150-d1sgnxc0	171	27	(	(	-LRB-
cord-269150-d1sgnxc0	171	28	Figure	figure	NN
cord-269150-d1sgnxc0	171	29	7B	7b	NN
cord-269150-d1sgnxc0	171	30	)	)	-RRB-
cord-269150-d1sgnxc0	171	31	.	.	.
cord-269150-d1sgnxc0	172	1	The	the	DT
cord-269150-d1sgnxc0	172	2	amount	amount	NN
cord-269150-d1sgnxc0	172	3	of	of	IN
cord-269150-d1sgnxc0	172	4	virus	virus	NN
cord-269150-d1sgnxc0	172	5	mRNA	mrna	NN
cord-269150-d1sgnxc0	172	6	is	be	VBZ
cord-269150-d1sgnxc0	172	7	higher	high	JJR
cord-269150-d1sgnxc0	172	8	in	in	IN
cord-269150-d1sgnxc0	172	9	shMadp1	shMadp1	NNP
cord-269150-d1sgnxc0	172	10	cells	cell	NNS
cord-269150-d1sgnxc0	172	11	compared	compare	VBN
cord-269150-d1sgnxc0	172	12	to	to	IN
cord-269150-d1sgnxc0	172	13	shNC	shnc	NN
cord-269150-d1sgnxc0	172	14	cells	cell	NNS
cord-269150-d1sgnxc0	172	15	beyond	beyond	IN
cord-269150-d1sgnxc0	172	16	16	16	CD
cord-269150-d1sgnxc0	172	17	h	h	NN
cord-269150-d1sgnxc0	172	18	of	of	IN
cord-269150-d1sgnxc0	172	19	infection	infection	NN
cord-269150-d1sgnxc0	172	20	as	as	IN
cord-269150-d1sgnxc0	172	21	infection	infection	NN
cord-269150-d1sgnxc0	172	22	in	in	IN
cord-269150-d1sgnxc0	172	23	shNC	shnc	NN
cord-269150-d1sgnxc0	172	24	cells	cell	NNS
cord-269150-d1sgnxc0	172	25	progressed	progress	VBD
cord-269150-d1sgnxc0	172	26	much	much	RB
cord-269150-d1sgnxc0	172	27	faster	fast	RBR
cord-269150-d1sgnxc0	172	28	and	and	CC
cord-269150-d1sgnxc0	172	29	most	most	JJS
cord-269150-d1sgnxc0	172	30	cells	cell	NNS
cord-269150-d1sgnxc0	172	31	died	die	VBD
cord-269150-d1sgnxc0	172	32	and	and	CC
cord-269150-d1sgnxc0	172	33	detached	detach	VBN
cord-269150-d1sgnxc0	172	34	(	(	-LRB-
cord-269150-d1sgnxc0	172	35	Figure	figure	NN
cord-269150-d1sgnxc0	172	36	7B	7b	NN
cord-269150-d1sgnxc0	172	37	)	)	-RRB-
cord-269150-d1sgnxc0	172	38	.	.	.
cord-269150-d1sgnxc0	173	1	The	the	DT
cord-269150-d1sgnxc0	173	2	shMadp1	shMadp1	NNP
cord-269150-d1sgnxc0	173	3	cell	cell	NN
cord-269150-d1sgnxc0	173	4	line	line	NN
cord-269150-d1sgnxc0	173	5	was	be	VBD
cord-269150-d1sgnxc0	173	6	then	then	RB
cord-269150-d1sgnxc0	173	7	transfected	transfecte	VBN
cord-269150-d1sgnxc0	173	8	with	with	IN
cord-269150-d1sgnxc0	173	9	constructs	construct	NNS
cord-269150-d1sgnxc0	173	10	expressing	express	VBG
cord-269150-d1sgnxc0	173	11	Flag	Flag	NNP
cord-269150-d1sgnxc0	173	12	-	-	HYPH
cord-269150-d1sgnxc0	173	13	tagged	tag	VBN
cord-269150-d1sgnxc0	173	14	wild	wild	JJ
cord-269150-d1sgnxc0	173	15	type	type	NN
cord-269150-d1sgnxc0	174	1	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	174	2	(	(	-LRB-
cord-269150-d1sgnxc0	174	3	FM	FM	NNP
cord-269150-d1sgnxc0	174	4	)	)	-RRB-
cord-269150-d1sgnxc0	174	5	,	,	,
cord-269150-d1sgnxc0	174	6	triple	triple	JJ
cord-269150-d1sgnxc0	174	7	residue	residue	NN
cord-269150-d1sgnxc0	174	8	mutant	mutant	NN
cord-269150-d1sgnxc0	174	9	(	(	-LRB-
cord-269150-d1sgnxc0	174	10	FM(YVF	FM(YVF	NNP
cord-269150-d1sgnxc0	174	11	)	)	-RRB-
cord-269150-d1sgnxc0	174	12	)	)	-RRB-
cord-269150-d1sgnxc0	174	13	,	,	,
cord-269150-d1sgnxc0	174	14	two	two	CD
cord-269150-d1sgnxc0	174	15	mRNA	mrna	NN
cord-269150-d1sgnxc0	174	16	mutants	mutant	NNS
cord-269150-d1sgnxc0	174	17	resistant	resistant	JJ
cord-269150-d1sgnxc0	174	18	to	to	IN
cord-269150-d1sgnxc0	174	19	silencing	silence	VBG
cord-269150-d1sgnxc0	174	20	by	by	IN
cord-269150-d1sgnxc0	174	21	siMadp1	siMadp1	NNP
cord-269150-d1sgnxc0	174	22	based	base	VBN
cord-269150-d1sgnxc0	174	23	on	on	IN
cord-269150-d1sgnxc0	174	24	wild	wild	JJ
cord-269150-d1sgnxc0	174	25	-	-	HYPH
cord-269150-d1sgnxc0	174	26	type	type	NN
cord-269150-d1sgnxc0	174	27	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	174	28	(	(	-LRB-
cord-269150-d1sgnxc0	174	29	FMmut	FMmut	NNP
cord-269150-d1sgnxc0	174	30	)	)	-RRB-
cord-269150-d1sgnxc0	174	31	and	and	CC
cord-269150-d1sgnxc0	174	32	the	the	DT
cord-269150-d1sgnxc0	174	33	triple	triple	JJ
cord-269150-d1sgnxc0	174	34	residue	residue	NN
cord-269150-d1sgnxc0	174	35	mutant	mutant	NN
cord-269150-d1sgnxc0	174	36	(	(	-LRB-
cord-269150-d1sgnxc0	174	37	FMmut(YVF	FMmut(YVF	NNP
cord-269150-d1sgnxc0	174	38	)	)	-RRB-
cord-269150-d1sgnxc0	174	39	)	)	-RRB-
cord-269150-d1sgnxc0	174	40	,	,	,
cord-269150-d1sgnxc0	174	41	negative	negative	JJ
cord-269150-d1sgnxc0	174	42	vector	vector	NN
cord-269150-d1sgnxc0	174	43	control	control	NN
cord-269150-d1sgnxc0	174	44	(	(	-LRB-
cord-269150-d1sgnxc0	174	45	F	F	NNP
cord-269150-d1sgnxc0	174	46	)	)	-RRB-
cord-269150-d1sgnxc0	174	47	and	and	CC
cord-269150-d1sgnxc0	174	48	EGFP	EGFP	NNP
cord-269150-d1sgnxc0	174	49	(	(	-LRB-
cord-269150-d1sgnxc0	174	50	E	E	NNP
cord-269150-d1sgnxc0	174	51	)	)	-RRB-
cord-269150-d1sgnxc0	174	52	,	,	,
cord-269150-d1sgnxc0	174	53	respectively	respectively	RB
cord-269150-d1sgnxc0	174	54	.	.	.
cord-269150-d1sgnxc0	175	1	The	the	DT
cord-269150-d1sgnxc0	175	2	two	two	CD
cord-269150-d1sgnxc0	175	3	siRNA	sirna	JJ
cord-269150-d1sgnxc0	175	4	-	-	HYPH
cord-269150-d1sgnxc0	175	5	resistant	resistant	JJ
cord-269150-d1sgnxc0	175	6	mutants	mutant	NNS
cord-269150-d1sgnxc0	175	7	were	be	VBD
cord-269150-d1sgnxc0	175	8	constructed	construct	VBN
cord-269150-d1sgnxc0	175	9	by	by	IN
cord-269150-d1sgnxc0	175	10	mutating	mutate	VBG
cord-269150-d1sgnxc0	175	11	the	the	DT
cord-269150-d1sgnxc0	175	12	siRNA	siRNA	NNP
cord-269150-d1sgnxc0	175	13	-	-	HYPH
cord-269150-d1sgnxc0	175	14	targeting	target	VBG
cord-269150-d1sgnxc0	175	15	sequence	sequence	NN
cord-269150-d1sgnxc0	175	16	with	with	IN
cord-269150-d1sgnxc0	175	17	degenerate	degenerate	JJ
cord-269150-d1sgnxc0	175	18	codons	codon	NNS
cord-269150-d1sgnxc0	175	19	,	,	,
cord-269150-d1sgnxc0	175	20	so	so	IN
cord-269150-d1sgnxc0	175	21	that	that	IN
cord-269150-d1sgnxc0	175	22	the	the	DT
cord-269150-d1sgnxc0	175	23	protein	protein	NN
cord-269150-d1sgnxc0	175	24	sequence	sequence	NN
cord-269150-d1sgnxc0	175	25	of	of	IN
cord-269150-d1sgnxc0	175	26	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	175	27	was	be	VBD
cord-269150-d1sgnxc0	175	28	maintained	maintain	VBN
cord-269150-d1sgnxc0	175	29	.	.	.
cord-269150-d1sgnxc0	176	1	These	these	DT
cord-269150-d1sgnxc0	176	2	transfected	transfecte	VBN
cord-269150-d1sgnxc0	176	3	cells	cell	NNS
cord-269150-d1sgnxc0	176	4	were	be	VBD
cord-269150-d1sgnxc0	176	5	subsequently	subsequently	RB
cord-269150-d1sgnxc0	176	6	infected	infect	VBN
cord-269150-d1sgnxc0	176	7	with	with	IN
cord-269150-d1sgnxc0	176	8	IBV	IBV	NNP
cord-269150-d1sgnxc0	176	9	-	-	HYPH
cord-269150-d1sgnxc0	176	10	Luc	Luc	NNP
cord-269150-d1sgnxc0	176	11	and	and	CC
cord-269150-d1sgnxc0	176	12	harvested	harvest	VBD
cord-269150-d1sgnxc0	176	13	at	at	IN
cord-269150-d1sgnxc0	176	14	19	19	CD
cord-269150-d1sgnxc0	176	15	h	h	NN
cord-269150-d1sgnxc0	176	16	post	post	NN
cord-269150-d1sgnxc0	176	17	-	-	NN
cord-269150-d1sgnxc0	176	18	infection	infection	NN
cord-269150-d1sgnxc0	176	19	.	.	.
cord-269150-d1sgnxc0	177	1	Western	western	JJ
cord-269150-d1sgnxc0	177	2	blotting	blotting	NN
cord-269150-d1sgnxc0	177	3	results	result	NNS
cord-269150-d1sgnxc0	177	4	showed	show	VBD
cord-269150-d1sgnxc0	177	5	an	an	DT
cord-269150-d1sgnxc0	177	6	obvious	obvious	JJ
cord-269150-d1sgnxc0	177	7	increase	increase	NN
cord-269150-d1sgnxc0	177	8	in	in	IN
cord-269150-d1sgnxc0	177	9	the	the	DT
cord-269150-d1sgnxc0	177	10	amount	amount	NN
cord-269150-d1sgnxc0	177	11	of	of	IN
cord-269150-d1sgnxc0	177	12	IBV	IBV	NNP
cord-269150-d1sgnxc0	177	13	N	n	CD
cord-269150-d1sgnxc0	177	14	expression	expression	NN
cord-269150-d1sgnxc0	177	15	in	in	IN
cord-269150-d1sgnxc0	177	16	cells	cell	NNS
cord-269150-d1sgnxc0	177	17	over	over	RB
cord-269150-d1sgnxc0	177	18	-	-	HYPH
cord-269150-d1sgnxc0	177	19	expressing	express	VBG
cord-269150-d1sgnxc0	177	20	silencing	silence	VBG
cord-269150-d1sgnxc0	177	21	-	-	HYPH
cord-269150-d1sgnxc0	177	22	resistant	resistant	JJ
cord-269150-d1sgnxc0	177	23	wild	wild	JJ
cord-269150-d1sgnxc0	177	24	-	-	HYPH
cord-269150-d1sgnxc0	177	25	type	type	NN
cord-269150-d1sgnxc0	177	26	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	178	1	(	(	-LRB-
cord-269150-d1sgnxc0	178	2	FMmut	FMmut	NNP
cord-269150-d1sgnxc0	178	3	)	)	-RRB-
cord-269150-d1sgnxc0	178	4	as	as	RB
cord-269150-d1sgnxc0	178	5	well	well	RB
cord-269150-d1sgnxc0	178	6	as	as	IN
cord-269150-d1sgnxc0	178	7	a	a	DT
cord-269150-d1sgnxc0	178	8	slight	slight	JJ
cord-269150-d1sgnxc0	178	9	increase	increase	NN
cord-269150-d1sgnxc0	178	10	in	in	IN
cord-269150-d1sgnxc0	178	11	cells	cell	NNS
cord-269150-d1sgnxc0	178	12	over	over	RB
cord-269150-d1sgnxc0	178	13	-	-	HYPH
cord-269150-d1sgnxc0	178	14	expressing	express	VBG
cord-269150-d1sgnxc0	178	15	both	both	DT
cord-269150-d1sgnxc0	178	16	normal	normal	JJ
cord-269150-d1sgnxc0	178	17	triple	triple	JJ
cord-269150-d1sgnxc0	178	18	residue	residue	NN
cord-269150-d1sgnxc0	178	19	mutant	mutant	NN
cord-269150-d1sgnxc0	178	20	(	(	-LRB-
cord-269150-d1sgnxc0	178	21	FM(YVF	FM(YVF	NNP
cord-269150-d1sgnxc0	178	22	)	)	-RRB-
cord-269150-d1sgnxc0	178	23	)	)	-RRB-
cord-269150-d1sgnxc0	179	1	and	and	CC
cord-269150-d1sgnxc0	179	2	silencing	silencing	NN
cord-269150-d1sgnxc0	179	3	-	-	HYPH
cord-269150-d1sgnxc0	179	4	resistant	resistant	JJ
cord-269150-d1sgnxc0	179	5	triple	triple	JJ
cord-269150-d1sgnxc0	179	6	residue	residue	NN
cord-269150-d1sgnxc0	179	7	mutant	mutant	NN
cord-269150-d1sgnxc0	179	8	(	(	-LRB-
cord-269150-d1sgnxc0	179	9	FMmut(YVF	FMmut(YVF	NNP
cord-269150-d1sgnxc0	179	10	)	)	-RRB-
cord-269150-d1sgnxc0	179	11	)	)	-RRB-
cord-269150-d1sgnxc0	180	1	(	(	-LRB-
cord-269150-d1sgnxc0	180	2	Figure	Figure	NNP
cord-269150-d1sgnxc0	180	3	7C	7C	NNP
cord-269150-d1sgnxc0	180	4	)	)	-RRB-
cord-269150-d1sgnxc0	180	5	.	.	.
cord-269150-d1sgnxc0	181	1	An	an	DT
cord-269150-d1sgnxc0	181	2	assessment	assessment	NN
cord-269150-d1sgnxc0	181	3	of	of	IN
cord-269150-d1sgnxc0	181	4	the	the	DT
cord-269150-d1sgnxc0	181	5	luciferase	luciferase	NN
cord-269150-d1sgnxc0	181	6	activity	activity	NN
cord-269150-d1sgnxc0	181	7	of	of	IN
cord-269150-d1sgnxc0	181	8	total	total	JJ
cord-269150-d1sgnxc0	181	9	cell	cell	NN
cord-269150-d1sgnxc0	181	10	lysates	lysate	NNS
cord-269150-d1sgnxc0	181	11	showed	show	VBD
cord-269150-d1sgnxc0	181	12	that	that	IN
cord-269150-d1sgnxc0	181	13	over	over	IN
cord-269150-d1sgnxc0	181	14	-	-	HYPH
cord-269150-d1sgnxc0	181	15	expression	expression	NN
cord-269150-d1sgnxc0	181	16	of	of	IN
cord-269150-d1sgnxc0	181	17	triple	triple	JJ
cord-269150-d1sgnxc0	181	18	residue	residue	NN
cord-269150-d1sgnxc0	181	19	mutants	mutant	NNS
cord-269150-d1sgnxc0	181	20	FM(YVF	fm(yvf	CD
cord-269150-d1sgnxc0	181	21	)	)	-RRB-
cord-269150-d1sgnxc0	181	22	and	and	CC
cord-269150-d1sgnxc0	181	23	FMmut(YVF	FMmut(YVF	NNP
cord-269150-d1sgnxc0	181	24	)	)	-RRB-
cord-269150-d1sgnxc0	181	25	resulted	result	VBD
cord-269150-d1sgnxc0	181	26	in	in	IN
cord-269150-d1sgnxc0	181	27	a	a	DT
cord-269150-d1sgnxc0	181	28	slight	slight	JJ
cord-269150-d1sgnxc0	181	29	increase	increase	NN
cord-269150-d1sgnxc0	181	30	of	of	IN
cord-269150-d1sgnxc0	181	31	the	the	DT
cord-269150-d1sgnxc0	181	32	luciferase	luciferase	NN
cord-269150-d1sgnxc0	181	33	activity	activity	NN
cord-269150-d1sgnxc0	181	34	in	in	IN
cord-269150-d1sgnxc0	181	35	shMadp1	shMadp1	NNP
cord-269150-d1sgnxc0	181	36	cells	cell	NNS
cord-269150-d1sgnxc0	181	37	,	,	,
cord-269150-d1sgnxc0	181	38	whereas	whereas	IN
cord-269150-d1sgnxc0	181	39	over	over	IN
cord-269150-d1sgnxc0	181	40	-	-	HYPH
cord-269150-d1sgnxc0	181	41	expression	expression	NN
cord-269150-d1sgnxc0	181	42	of	of	IN
cord-269150-d1sgnxc0	181	43	silencing	silence	VBG
cord-269150-d1sgnxc0	181	44	-	-	HYPH
cord-269150-d1sgnxc0	181	45	resistant	resistant	JJ
cord-269150-d1sgnxc0	181	46	wild	wild	JJ
cord-269150-d1sgnxc0	181	47	-	-	HYPH
cord-269150-d1sgnxc0	181	48	type	type	NN
cord-269150-d1sgnxc0	181	49	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	181	50	(	(	-LRB-
cord-269150-d1sgnxc0	181	51	FMmut	FMmut	NNP
cord-269150-d1sgnxc0	181	52	)	)	-RRB-
cord-269150-d1sgnxc0	181	53	resulted	result	VBD
cord-269150-d1sgnxc0	181	54	in	in	IN
cord-269150-d1sgnxc0	181	55	a	a	DT
cord-269150-d1sgnxc0	181	56	more	more	RBR
cord-269150-d1sgnxc0	181	57	drastic	drastic	JJ
cord-269150-d1sgnxc0	181	58	increase	increase	NN
cord-269150-d1sgnxc0	181	59	of	of	IN
cord-269150-d1sgnxc0	181	60	the	the	DT
cord-269150-d1sgnxc0	181	61	luciferase	luciferase	NN
cord-269150-d1sgnxc0	181	62	activity	activity	NN
cord-269150-d1sgnxc0	181	63	in	in	IN
cord-269150-d1sgnxc0	181	64	shMadp1	shMadp1	NNP
cord-269150-d1sgnxc0	181	65	cells	cell	NNS
cord-269150-d1sgnxc0	181	66	(	(	-LRB-
cord-269150-d1sgnxc0	181	67	Figure	Figure	NNP
cord-269150-d1sgnxc0	181	68	7D	7D	NNP
cord-269150-d1sgnxc0	181	69	)	)	-RRB-
cord-269150-d1sgnxc0	181	70	.	.	.
cord-269150-d1sgnxc0	182	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	182	2	was	be	VBD
cord-269150-d1sgnxc0	182	3	noted	note	VBN
cord-269150-d1sgnxc0	182	4	that	that	IN
cord-269150-d1sgnxc0	182	5	although	although	IN
cord-269150-d1sgnxc0	182	6	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	182	7	interacted	interact	VBD
cord-269150-d1sgnxc0	182	8	with	with	IN
cord-269150-d1sgnxc0	182	9	both	both	DT
cord-269150-d1sgnxc0	182	10	SARS	SARS	NNP
cord-269150-d1sgnxc0	182	11	-	-	HYPH
cord-269150-d1sgnxc0	182	12	CoV	CoV	NNP
cord-269150-d1sgnxc0	182	13	and	and	CC
cord-269150-d1sgnxc0	182	14	IBV	IBV	NNP
cord-269150-d1sgnxc0	182	15	5	5	CD
cord-269150-d1sgnxc0	182	16	0	0	CD
cord-269150-d1sgnxc0	182	17	-UTR	-utr	NN
cord-269150-d1sgnxc0	182	18	,	,	,
cord-269150-d1sgnxc0	182	19	the	the	DT
cord-269150-d1sgnxc0	182	20	interaction	interaction	NN
cord-269150-d1sgnxc0	182	21	was	be	VBD
cord-269150-d1sgnxc0	182	22	rather	rather	RB
cord-269150-d1sgnxc0	182	23	weak	weak	JJ
cord-269150-d1sgnxc0	182	24	for	for	IN
cord-269150-d1sgnxc0	182	25	the	the	DT
cord-269150-d1sgnxc0	182	26	former	former	JJ
cord-269150-d1sgnxc0	182	27	.	.	.
cord-269150-d1sgnxc0	183	1	A	a	DT
cord-269150-d1sgnxc0	183	2	comparison	comparison	NN
cord-269150-d1sgnxc0	183	3	of	of	IN
cord-269150-d1sgnxc0	183	4	the	the	DT
cord-269150-d1sgnxc0	183	5	predicted	predict	VBN
cord-269150-d1sgnxc0	183	6	stemloop	stemloop	NN
cord-269150-d1sgnxc0	183	7	I	-PRON-	PRP
cord-269150-d1sgnxc0	183	8	structures	structure	NNS
cord-269150-d1sgnxc0	183	9	from	from	IN
cord-269150-d1sgnxc0	183	10	both	both	DT
cord-269150-d1sgnxc0	183	11	coronaviruses	coronaviruse	NNS
cord-269150-d1sgnxc0	183	12	indicated	indicate	VBD
cord-269150-d1sgnxc0	183	13	a	a	DT
cord-269150-d1sgnxc0	183	14	marked	marked	JJ
cord-269150-d1sgnxc0	183	15	difference	difference	NN
cord-269150-d1sgnxc0	183	16	in	in	IN
cord-269150-d1sgnxc0	183	17	their	-PRON-	PRP$
cord-269150-d1sgnxc0	183	18	primary	primary	JJ
cord-269150-d1sgnxc0	183	19	sequence	sequence	NN
cord-269150-d1sgnxc0	183	20	as	as	RB
cord-269150-d1sgnxc0	183	21	well	well	RB
cord-269150-d1sgnxc0	183	22	as	as	IN
cord-269150-d1sgnxc0	183	23	the	the	DT
cord-269150-d1sgnxc0	183	24	secondary	secondary	JJ
cord-269150-d1sgnxc0	183	25	structures	structure	NNS
cord-269150-d1sgnxc0	183	26	.	.	.
cord-269150-d1sgnxc0	184	1	Hence	hence	RB
cord-269150-d1sgnxc0	184	2	,	,	,
cord-269150-d1sgnxc0	184	3	a	a	DT
cord-269150-d1sgnxc0	184	4	third	third	JJ
cord-269150-d1sgnxc0	184	5	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	184	6	,	,	,
cord-269150-d1sgnxc0	184	7	HCoV	HCoV	NNP
cord-269150-d1sgnxc0	184	8	-	-	HYPH
cord-269150-d1sgnxc0	184	9	OC43	OC43	NNP
cord-269150-d1sgnxc0	184	10	,	,	,
cord-269150-d1sgnxc0	184	11	whose	whose	WP$
cord-269150-d1sgnxc0	184	12	stem	stem	NN
cord-269150-d1sgnxc0	184	13	-	-	HYPH
cord-269150-d1sgnxc0	184	14	loop	loop	NN
cord-269150-d1sgnxc0	184	15	I	-PRON-	PRP
cord-269150-d1sgnxc0	184	16	which	which	WDT
cord-269150-d1sgnxc0	184	17	deviated	deviate	VBD
cord-269150-d1sgnxc0	184	18	further	further	RB
cord-269150-d1sgnxc0	184	19	from	from	IN
cord-269150-d1sgnxc0	184	20	IBV	IBV	NNP
cord-269150-d1sgnxc0	184	21	than	than	IN
cord-269150-d1sgnxc0	184	22	SARS	SARS	NNP
cord-269150-d1sgnxc0	184	23	-	-	HYPH
cord-269150-d1sgnxc0	184	24	CoV	CoV	NNP
cord-269150-d1sgnxc0	184	25	,	,	,
cord-269150-d1sgnxc0	184	26	was	be	VBD
cord-269150-d1sgnxc0	184	27	assessed	assess	VBN
cord-269150-d1sgnxc0	184	28	for	for	IN
cord-269150-d1sgnxc0	184	29	its	-PRON-	PRP$
cord-269150-d1sgnxc0	184	30	binding	binding	NN
cord-269150-d1sgnxc0	184	31	to	to	IN
cord-269150-d1sgnxc0	184	32	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	185	1	(	(	-LRB-
cord-269150-d1sgnxc0	185	2	Figure	figure	NN
cord-269150-d1sgnxc0	185	3	8A	8a	NN
cord-269150-d1sgnxc0	185	4	)	)	-RRB-
cord-269150-d1sgnxc0	185	5	.	.	.
cord-269150-d1sgnxc0	186	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	186	2	was	be	VBD
cord-269150-d1sgnxc0	186	3	found	find	VBN
cord-269150-d1sgnxc0	186	4	that	that	IN
cord-269150-d1sgnxc0	186	5	the	the	DT
cord-269150-d1sgnxc0	186	6	binding	binding	NN
cord-269150-d1sgnxc0	186	7	of	of	IN
cord-269150-d1sgnxc0	186	8	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	186	9	to	to	IN
cord-269150-d1sgnxc0	186	10	the	the	DT
cord-269150-d1sgnxc0	186	11	5	5	CD
cord-269150-d1sgnxc0	186	12	0	0	CD
cord-269150-d1sgnxc0	186	13	UTR	UTR	NNP
cord-269150-d1sgnxc0	186	14	of	of	IN
cord-269150-d1sgnxc0	186	15	HCoV	HCoV	NNP
cord-269150-d1sgnxc0	186	16	-	-	:
cord-269150-d1sgnxc0	186	17	OC43	OC43	NNP
cord-269150-d1sgnxc0	186	18	was	be	VBD
cord-269150-d1sgnxc0	186	19	as	as	RB
cord-269150-d1sgnxc0	186	20	weak	weak	JJ
cord-269150-d1sgnxc0	186	21	,	,	,
cord-269150-d1sgnxc0	186	22	if	if	IN
cord-269150-d1sgnxc0	186	23	not	not	RB
cord-269150-d1sgnxc0	186	24	weaker	weak	JJR
cord-269150-d1sgnxc0	186	25	than	than	IN
cord-269150-d1sgnxc0	186	26	SARS-	SARS-	NNP
cord-269150-d1sgnxc0	187	1	CoV.	CoV.	NNP
cord-269150-d1sgnxc0	188	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	188	2	was	be	VBD
cord-269150-d1sgnxc0	188	3	also	also	RB
cord-269150-d1sgnxc0	188	4	noted	note	VBN
cord-269150-d1sgnxc0	188	5	that	that	IN
cord-269150-d1sgnxc0	188	6	the	the	DT
cord-269150-d1sgnxc0	188	7	predicted	predict	VBN
cord-269150-d1sgnxc0	188	8	stem	stem	NN
cord-269150-d1sgnxc0	188	9	-	-	HYPH
cord-269150-d1sgnxc0	188	10	loop	loop	NN
cord-269150-d1sgnxc0	188	11	I	I	NNP
cord-269150-d1sgnxc0	188	12	structure	structure	NN
cord-269150-d1sgnxc0	188	13	of	of	IN
cord-269150-d1sgnxc0	188	14	HCoV	HCoV	NNP
cord-269150-d1sgnxc0	188	15	-	-	:
cord-269150-d1sgnxc0	188	16	OC43	OC43	NNP
cord-269150-d1sgnxc0	188	17	contained	contain	VBD
cord-269150-d1sgnxc0	188	18	a	a	DT
cord-269150-d1sgnxc0	188	19	bulge	bulge	NN
cord-269150-d1sgnxc0	188	20	which	which	WDT
cord-269150-d1sgnxc0	188	21	encompassed	encompass	VBD
cord-269150-d1sgnxc0	188	22	a	a	DT
cord-269150-d1sgnxc0	188	23	larger	large	JJR
cord-269150-d1sgnxc0	188	24	area	area	NN
cord-269150-d1sgnxc0	188	25	of	of	IN
cord-269150-d1sgnxc0	188	26	the	the	DT
cord-269150-d1sgnxc0	188	27	stem	stem	NN
cord-269150-d1sgnxc0	188	28	compared	compare	VBN
cord-269150-d1sgnxc0	188	29	to	to	IN
cord-269150-d1sgnxc0	188	30	SARS	SARS	NNP
cord-269150-d1sgnxc0	188	31	-	-	HYPH
cord-269150-d1sgnxc0	188	32	CoV	CoV	NNP
cord-269150-d1sgnxc0	188	33	(	(	-LRB-
cord-269150-d1sgnxc0	188	34	Figure	figure	NN
cord-269150-d1sgnxc0	188	35	8B	8b	NN
cord-269150-d1sgnxc0	188	36	)	)	-RRB-
cord-269150-d1sgnxc0	188	37	.	.	.
cord-269150-d1sgnxc0	189	1	Bulges	bulge	NNS
cord-269150-d1sgnxc0	189	2	were	be	VBD
cord-269150-d1sgnxc0	189	3	conspicuously	conspicuously	RB
cord-269150-d1sgnxc0	189	4	absent	absent	JJ
cord-269150-d1sgnxc0	189	5	from	from	IN
cord-269150-d1sgnxc0	189	6	the	the	DT
cord-269150-d1sgnxc0	189	7	IBV	IBV	NNP
cord-269150-d1sgnxc0	189	8	stem	stem	NN
cord-269150-d1sgnxc0	189	9	-	-	HYPH
cord-269150-d1sgnxc0	189	10	loop	loop	NN
cord-269150-d1sgnxc0	190	1	I	-PRON-	PRP
cord-269150-d1sgnxc0	190	2	(	(	-LRB-
cord-269150-d1sgnxc0	190	3	Figure	figure	NN
cord-269150-d1sgnxc0	190	4	8B	8b	NN
cord-269150-d1sgnxc0	190	5	)	)	-RRB-
cord-269150-d1sgnxc0	190	6	.	.	.
cord-269150-d1sgnxc0	191	1	In	in	IN
cord-269150-d1sgnxc0	191	2	addition	addition	NN
cord-269150-d1sgnxc0	191	3	to	to	IN
cord-269150-d1sgnxc0	191	4	the	the	DT
cord-269150-d1sgnxc0	191	5	differences	difference	NNS
cord-269150-d1sgnxc0	191	6	in	in	IN
cord-269150-d1sgnxc0	191	7	the	the	DT
cord-269150-d1sgnxc0	191	8	secondary	secondary	JJ
cord-269150-d1sgnxc0	191	9	structures	structure	NNS
cord-269150-d1sgnxc0	191	10	between	between	IN
cord-269150-d1sgnxc0	191	11	the	the	DT
cord-269150-d1sgnxc0	191	12	coronaviruses	coronaviruse	NNS
cord-269150-d1sgnxc0	191	13	,	,	,
cord-269150-d1sgnxc0	191	14	there	there	EX
cord-269150-d1sgnxc0	191	15	was	be	VBD
cord-269150-d1sgnxc0	191	16	a	a	DT
cord-269150-d1sgnxc0	191	17	lack	lack	NN
cord-269150-d1sgnxc0	191	18	of	of	IN
cord-269150-d1sgnxc0	191	19	sequence	sequence	NN
cord-269150-d1sgnxc0	191	20	similarity	similarity	NN
cord-269150-d1sgnxc0	191	21	as	as	RB
cord-269150-d1sgnxc0	191	22	well	well	RB
cord-269150-d1sgnxc0	191	23	(	(	-LRB-
cord-269150-d1sgnxc0	191	24	Figure	figure	NN
cord-269150-d1sgnxc0	191	25	8B	8b	NN
cord-269150-d1sgnxc0	191	26	)	)	-RRB-
cord-269150-d1sgnxc0	191	27	.	.	.
cord-269150-d1sgnxc0	192	1	Previous	previous	JJ
cord-269150-d1sgnxc0	192	2	studies	study	NNS
cord-269150-d1sgnxc0	192	3	on	on	IN
cord-269150-d1sgnxc0	192	4	the	the	DT
cord-269150-d1sgnxc0	192	5	involvement	involvement	NN
cord-269150-d1sgnxc0	192	6	of	of	IN
cord-269150-d1sgnxc0	192	7	host	host	NN
cord-269150-d1sgnxc0	192	8	proteins	protein	NNS
cord-269150-d1sgnxc0	192	9	in	in	IN
cord-269150-d1sgnxc0	192	10	viral	viral	JJ
cord-269150-d1sgnxc0	192	11	RNA	RNA	NNP
cord-269150-d1sgnxc0	192	12	synthesis	synthesis	NN
cord-269150-d1sgnxc0	192	13	have	have	VBP
cord-269150-d1sgnxc0	192	14	revealed	reveal	VBN
cord-269150-d1sgnxc0	192	15	a	a	DT
cord-269150-d1sgnxc0	192	16	number	number	NN
cord-269150-d1sgnxc0	192	17	of	of	IN
cord-269150-d1sgnxc0	192	18	proteins	protein	NNS
cord-269150-d1sgnxc0	192	19	which	which	WDT
cord-269150-d1sgnxc0	192	20	are	be	VBP
cord-269150-d1sgnxc0	192	21	able	able	JJ
cord-269150-d1sgnxc0	192	22	to	to	TO
cord-269150-d1sgnxc0	192	23	interact	interact	VB
cord-269150-d1sgnxc0	192	24	with	with	IN
cord-269150-d1sgnxc0	192	25	the	the	DT
cord-269150-d1sgnxc0	192	26	UTRs	utr	NNS
cord-269150-d1sgnxc0	192	27	of	of	IN
cord-269150-d1sgnxc0	192	28	viral	viral	JJ
cord-269150-d1sgnxc0	192	29	genomes	genome	NNS
cord-269150-d1sgnxc0	192	30	(	(	-LRB-
cord-269150-d1sgnxc0	192	31	29	29	CD
cord-269150-d1sgnxc0	192	32	,	,	,
cord-269150-d1sgnxc0	192	33	30	30	CD
cord-269150-d1sgnxc0	192	34	,	,	,
cord-269150-d1sgnxc0	192	35	32	32	CD
cord-269150-d1sgnxc0	192	36	,	,	,
cord-269150-d1sgnxc0	192	37	(	(	-LRB-
cord-269150-d1sgnxc0	192	38	40	40	CD
cord-269150-d1sgnxc0	192	39	)	)	-RRB-
cord-269150-d1sgnxc0	192	40	(	(	-LRB-
cord-269150-d1sgnxc0	192	41	41	41	CD
cord-269150-d1sgnxc0	192	42	)	)	-RRB-
cord-269150-d1sgnxc0	192	43	(	(	-LRB-
cord-269150-d1sgnxc0	192	44	42	42	CD
cord-269150-d1sgnxc0	192	45	)	)	-RRB-
cord-269150-d1sgnxc0	192	46	(	(	-LRB-
cord-269150-d1sgnxc0	192	47	43	43	CD
cord-269150-d1sgnxc0	192	48	)	)	-RRB-
cord-269150-d1sgnxc0	192	49	.	.	.
cord-269150-d1sgnxc0	193	1	Some	some	DT
cord-269150-d1sgnxc0	193	2	of	of	IN
cord-269150-d1sgnxc0	193	3	these	these	DT
cord-269150-d1sgnxc0	193	4	proteins	protein	NNS
cord-269150-d1sgnxc0	193	5	may	may	MD
cord-269150-d1sgnxc0	193	6	also	also	RB
cord-269150-d1sgnxc0	193	7	interact	interact	VB
cord-269150-d1sgnxc0	193	8	with	with	IN
cord-269150-d1sgnxc0	193	9	other	other	JJ
cord-269150-d1sgnxc0	193	10	viral	viral	JJ
cord-269150-d1sgnxc0	193	11	proteins	protein	NNS
cord-269150-d1sgnxc0	193	12	as	as	RB
cord-269150-d1sgnxc0	193	13	well	well	RB
cord-269150-d1sgnxc0	193	14	(	(	-LRB-
cord-269150-d1sgnxc0	193	15	30	30	CD
cord-269150-d1sgnxc0	193	16	,	,	,
cord-269150-d1sgnxc0	193	17	40	40	CD
cord-269150-d1sgnxc0	193	18	)	)	-RRB-
cord-269150-d1sgnxc0	193	19	.	.	.
cord-269150-d1sgnxc0	194	1	Our	-PRON-	PRP$
cord-269150-d1sgnxc0	194	2	attempts	attempt	NNS
cord-269150-d1sgnxc0	194	3	to	to	TO
cord-269150-d1sgnxc0	194	4	identify	identify	VB
cord-269150-d1sgnxc0	194	5	host	host	NN
cord-269150-d1sgnxc0	194	6	proteins	protein	NNS
cord-269150-d1sgnxc0	194	7	involved	involve	VBN
cord-269150-d1sgnxc0	194	8	in	in	IN
cord-269150-d1sgnxc0	194	9	this	this	DT
cord-269150-d1sgnxc0	194	10	early	early	JJ
cord-269150-d1sgnxc0	194	11	process	process	NN
cord-269150-d1sgnxc0	194	12	of	of	IN
cord-269150-d1sgnxc0	194	13	the	the	DT
cord-269150-d1sgnxc0	194	14	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	194	15	life	life	NN
cord-269150-d1sgnxc0	194	16	cycle	cycle	NN
cord-269150-d1sgnxc0	194	17	yielded	yield	VBD
cord-269150-d1sgnxc0	194	18	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	194	19	.	.	.
cord-269150-d1sgnxc0	195	1	This	this	DT
cord-269150-d1sgnxc0	195	2	protein	protein	NN
cord-269150-d1sgnxc0	195	3	was	be	VBD
cord-269150-d1sgnxc0	195	4	shown	show	VBN
cord-269150-d1sgnxc0	195	5	to	to	TO
cord-269150-d1sgnxc0	195	6	be	be	VB
cord-269150-d1sgnxc0	195	7	localized	localize	VBN
cord-269150-d1sgnxc0	195	8	to	to	IN
cord-269150-d1sgnxc0	195	9	the	the	DT
cord-269150-d1sgnxc0	195	10	nucleoplasm	nucleoplasm	NN
cord-269150-d1sgnxc0	195	11	but	but	CC
cord-269150-d1sgnxc0	195	12	excluded	exclude	VBN
cord-269150-d1sgnxc0	195	13	from	from	IN
cord-269150-d1sgnxc0	195	14	the	the	DT
cord-269150-d1sgnxc0	195	15	nucleolus	nucleolus	NN
cord-269150-d1sgnxc0	195	16	,	,	,
cord-269150-d1sgnxc0	195	17	but	but	CC
cord-269150-d1sgnxc0	195	18	its	-PRON-	PRP$
cord-269150-d1sgnxc0	195	19	role	role	NN
cord-269150-d1sgnxc0	195	20	in	in	IN
cord-269150-d1sgnxc0	195	21	RNA	RNA	NNP
cord-269150-d1sgnxc0	195	22	splicing	splicing	NN
cord-269150-d1sgnxc0	195	23	remains	remain	VBZ
cord-269150-d1sgnxc0	195	24	to	to	TO
cord-269150-d1sgnxc0	195	25	be	be	VB
cord-269150-d1sgnxc0	195	26	determined	determine	VBN
cord-269150-d1sgnxc0	195	27	(	(	-LRB-
cord-269150-d1sgnxc0	195	28	37	37	CD
cord-269150-d1sgnxc0	195	29	)	)	-RRB-
cord-269150-d1sgnxc0	195	30	.	.	.
cord-269150-d1sgnxc0	196	1	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	196	2	contains	contain	VBZ
cord-269150-d1sgnxc0	196	3	two	two	CD
cord-269150-d1sgnxc0	196	4	conserved	conserve	VBN
cord-269150-d1sgnxc0	196	5	RNA	rna	NN
cord-269150-d1sgnxc0	196	6	-	-	HYPH
cord-269150-d1sgnxc0	196	7	binding	bind	VBG
cord-269150-d1sgnxc0	196	8	domains	domain	NNS
cord-269150-d1sgnxc0	196	9	,	,	,
cord-269150-d1sgnxc0	196	10	the	the	DT
cord-269150-d1sgnxc0	196	11	RNA	RNA	NNP
cord-269150-d1sgnxc0	196	12	recognition	recognition	NN
cord-269150-d1sgnxc0	196	13	motif	motif	NN
cord-269150-d1sgnxc0	196	14	(	(	-LRB-
cord-269150-d1sgnxc0	196	15	RRM	RRM	NNP
cord-269150-d1sgnxc0	196	16	)	)	-RRB-
cord-269150-d1sgnxc0	196	17	1	1	CD
cord-269150-d1sgnxc0	196	18	and	and	CC
cord-269150-d1sgnxc0	196	19	universal	universal	JJ
cord-269150-d1sgnxc0	196	20	minicircle	minicircle	NNP
cord-269150-d1sgnxc0	196	21	sequence	sequence	NN
cord-269150-d1sgnxc0	196	22	binding	bind	VBG
cord-269150-d1sgnxc0	196	23	protein	protein	NN
cord-269150-d1sgnxc0	196	24	(	(	-LRB-
cord-269150-d1sgnxc0	196	25	UMSBP	UMSBP	NNP
cord-269150-d1sgnxc0	196	26	)	)	-RRB-
cord-269150-d1sgnxc0	196	27	domains	domain	NNS
cord-269150-d1sgnxc0	196	28	(	(	-LRB-
cord-269150-d1sgnxc0	196	29	a	a	DT
cord-269150-d1sgnxc0	196	30	zinc	zinc	NN
cord-269150-d1sgnxc0	196	31	finger	finger	NN
cord-269150-d1sgnxc0	196	32	CCHC	CCHC	NNP
cord-269150-d1sgnxc0	196	33	-	-	HYPH
cord-269150-d1sgnxc0	196	34	type	type	NN
cord-269150-d1sgnxc0	196	35	)	)	-RRB-
cord-269150-d1sgnxc0	196	36	(	(	-LRB-
cord-269150-d1sgnxc0	196	37	35	35	CD
cord-269150-d1sgnxc0	196	38	)	)	-RRB-
cord-269150-d1sgnxc0	196	39	.	.	.
cord-269150-d1sgnxc0	197	1	The	the	DT
cord-269150-d1sgnxc0	197	2	former	former	JJ
cord-269150-d1sgnxc0	197	3	was	be	VBD
cord-269150-d1sgnxc0	197	4	determined	determined	JJ
cord-269150-d1sgnxc0	197	5	to	to	TO
cord-269150-d1sgnxc0	197	6	be	be	VB
cord-269150-d1sgnxc0	197	7	the	the	DT
cord-269150-d1sgnxc0	197	8	domain	domain	NN
cord-269150-d1sgnxc0	197	9	responsible	responsible	JJ
cord-269150-d1sgnxc0	197	10	for	for	IN
cord-269150-d1sgnxc0	197	11	the	the	DT
cord-269150-d1sgnxc0	197	12	interaction	interaction	NN
cord-269150-d1sgnxc0	197	13	between	between	IN
cord-269150-d1sgnxc0	197	14	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	197	15	and	and	CC
cord-269150-d1sgnxc0	197	16	IBV	IBV	NNP
cord-269150-d1sgnxc0	197	17	5	5	CD
cord-269150-d1sgnxc0	197	18	0	0	CD
cord-269150-d1sgnxc0	197	19	-UTR	-utr	NN
cord-269150-d1sgnxc0	197	20	.	.	.
cord-269150-d1sgnxc0	198	1	The	the	DT
cord-269150-d1sgnxc0	198	2	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	198	3	RRM	rrm	NN
cord-269150-d1sgnxc0	198	4	1	1	CD
cord-269150-d1sgnxc0	198	5	domain	domain	NN
cord-269150-d1sgnxc0	198	6	interacts	interact	VBZ
cord-269150-d1sgnxc0	198	7	with	with	IN
cord-269150-d1sgnxc0	198	8	nucleic	nucleic	JJ
cord-269150-d1sgnxc0	198	9	acid	acid	NN
cord-269150-d1sgnxc0	198	10	residues	residue	NNS
cord-269150-d1sgnxc0	198	11	via	via	IN
cord-269150-d1sgnxc0	198	12	aromatic	aromatic	JJ
cord-269150-d1sgnxc0	198	13	and	and	CC
cord-269150-d1sgnxc0	198	14	hydrophobic	hydrophobic	JJ
cord-269150-d1sgnxc0	198	15	side	side	NN
cord-269150-d1sgnxc0	198	16	chains	chain	NNS
cord-269150-d1sgnxc0	198	17	at	at	IN
cord-269150-d1sgnxc0	198	18	its	-PRON-	PRP$
cord-269150-d1sgnxc0	198	19	active	active	JJ
cord-269150-d1sgnxc0	198	20	site	site	NN
cord-269150-d1sgnxc0	198	21	,	,	,
cord-269150-d1sgnxc0	198	22	which	which	WDT
cord-269150-d1sgnxc0	198	23	in	in	IN
cord-269150-d1sgnxc0	198	24	the	the	DT
cord-269150-d1sgnxc0	198	25	case	case	NN
cord-269150-d1sgnxc0	198	26	supplied	supply	VBN
cord-269150-d1sgnxc0	198	27	by	by	IN
cord-269150-d1sgnxc0	198	28	phenylalanine	phenylalanine	NN
cord-269150-d1sgnxc0	198	29	55	55	CD
cord-269150-d1sgnxc0	198	30	and	and	CC
cord-269150-d1sgnxc0	198	31	valine	valine	NN
cord-269150-d1sgnxc0	198	32	53	53	CD
cord-269150-d1sgnxc0	198	33	,	,	,
cord-269150-d1sgnxc0	198	34	respectively	respectively	RB
cord-269150-d1sgnxc0	198	35	.	.	.
cord-269150-d1sgnxc0	199	1	Tyrosine	tyrosine	NN
cord-269150-d1sgnxc0	199	2	13	13	CD
cord-269150-d1sgnxc0	199	3	may	may	MD
cord-269150-d1sgnxc0	199	4	have	have	VB
cord-269150-d1sgnxc0	199	5	acted	act	VBN
cord-269150-d1sgnxc0	199	6	as	as	IN
cord-269150-d1sgnxc0	199	7	an	an	DT
cord-269150-d1sgnxc0	199	8	anchor	anchor	NN
cord-269150-d1sgnxc0	199	9	for	for	IN
cord-269150-d1sgnxc0	199	10	the	the	DT
cord-269150-d1sgnxc0	199	11	phosphate	phosphate	NN
cord-269150-d1sgnxc0	199	12	backbone	backbone	NN
cord-269150-d1sgnxc0	199	13	via	via	IN
cord-269150-d1sgnxc0	199	14	electrostatic	electrostatic	JJ
cord-269150-d1sgnxc0	199	15	interactions	interaction	NNS
cord-269150-d1sgnxc0	199	16	.	.	.
cord-269150-d1sgnxc0	200	1	In	in	IN
cord-269150-d1sgnxc0	200	2	this	this	DT
cord-269150-d1sgnxc0	200	3	study	study	NN
cord-269150-d1sgnxc0	200	4	,	,	,
cord-269150-d1sgnxc0	200	5	interaction	interaction	NN
cord-269150-d1sgnxc0	200	6	between	between	IN
cord-269150-d1sgnxc0	200	7	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	200	8	and	and	CC
cord-269150-d1sgnxc0	200	9	the	the	DT
cord-269150-d1sgnxc0	200	10	SARS	SARS	NNP
cord-269150-d1sgnxc0	200	11	-	-	HYPH
cord-269150-d1sgnxc0	200	12	CoV	CoV	NNP
cord-269150-d1sgnxc0	200	13	and	and	CC
cord-269150-d1sgnxc0	200	14	IBV	IBV	NNP
cord-269150-d1sgnxc0	200	15	5	5	CD
cord-269150-d1sgnxc0	200	16	0	0	CD
cord-269150-d1sgnxc0	200	17	-UTR	-utr	NN
cord-269150-d1sgnxc0	200	18	was	be	VBD
cord-269150-d1sgnxc0	200	19	initially	initially	RB
cord-269150-d1sgnxc0	200	20	identified	identify	VBN
cord-269150-d1sgnxc0	200	21	by	by	IN
cord-269150-d1sgnxc0	200	22	a	a	DT
cord-269150-d1sgnxc0	200	23	yeast	yeast	NN
cord-269150-d1sgnxc0	200	24	-	-	HYPH
cord-269150-d1sgnxc0	200	25	based	base	VBN
cord-269150-d1sgnxc0	200	26	three	three	CD
cord-269150-d1sgnxc0	200	27	hybrid	hybrid	NN
cord-269150-d1sgnxc0	200	28	screen	screen	NN
cord-269150-d1sgnxc0	200	29	and	and	CC
cord-269150-d1sgnxc0	200	30	subsequently	subsequently	RB
cord-269150-d1sgnxc0	200	31	confirmed	confirm	VBD
cord-269150-d1sgnxc0	200	32	using	use	VBG
cord-269150-d1sgnxc0	200	33	an	an	DT
cord-269150-d1sgnxc0	200	34	in	in	FW
cord-269150-d1sgnxc0	200	35	vitro	vitro	FW
cord-269150-d1sgnxc0	200	36	RNA	RNA	NNP
cord-269150-d1sgnxc0	200	37	pull	pull	VB
cord-269150-d1sgnxc0	200	38	-	-	HYPH
cord-269150-d1sgnxc0	200	39	down	down	RP
cord-269150-d1sgnxc0	200	40	assay	assay	NN
cord-269150-d1sgnxc0	200	41	with	with	IN
cord-269150-d1sgnxc0	200	42	IBV	IBV	NNP
cord-269150-d1sgnxc0	200	43	5	5	CD
cord-269150-d1sgnxc0	200	44	0	0	CD
cord-269150-d1sgnxc0	200	45	-UTR	-utr	NN
cord-269150-d1sgnxc0	200	46	.	.	.
cord-269150-d1sgnxc0	201	1	A	a	DT
cord-269150-d1sgnxc0	201	2	deeper	deep	JJR
cord-269150-d1sgnxc0	201	3	look	look	NN
cord-269150-d1sgnxc0	201	4	at	at	IN
cord-269150-d1sgnxc0	201	5	the	the	DT
cord-269150-d1sgnxc0	201	6	details	detail	NNS
cord-269150-d1sgnxc0	201	7	of	of	IN
cord-269150-d1sgnxc0	201	8	this	this	DT
cord-269150-d1sgnxc0	201	9	interaction	interaction	NN
cord-269150-d1sgnxc0	201	10	revealed	reveal	VBD
cord-269150-d1sgnxc0	201	11	that	that	IN
cord-269150-d1sgnxc0	201	12	the	the	DT
cord-269150-d1sgnxc0	201	13	RNA	RNA	NNP
cord-269150-d1sgnxc0	201	14	recognition	recognition	NN
cord-269150-d1sgnxc0	201	15	motif	motif	NN
cord-269150-d1sgnxc0	201	16	,	,	,
cord-269150-d1sgnxc0	201	17	but	but	CC
cord-269150-d1sgnxc0	201	18	not	not	RB
cord-269150-d1sgnxc0	201	19	the	the	DT
cord-269150-d1sgnxc0	201	20	zinc	zinc	NN
cord-269150-d1sgnxc0	201	21	finger	finger	NN
cord-269150-d1sgnxc0	201	22	motif	motif	NN
cord-269150-d1sgnxc0	201	23	,	,	,
cord-269150-d1sgnxc0	201	24	of	of	IN
cord-269150-d1sgnxc0	201	25	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	201	26	,	,	,
cord-269150-d1sgnxc0	201	27	is	be	VBZ
cord-269150-d1sgnxc0	201	28	responsible	responsible	JJ
cord-269150-d1sgnxc0	201	29	for	for	IN
cord-269150-d1sgnxc0	201	30	the	the	DT
cord-269150-d1sgnxc0	201	31	interaction	interaction	NN
cord-269150-d1sgnxc0	201	32	.	.	.
cord-269150-d1sgnxc0	202	1	This	this	DT
cord-269150-d1sgnxc0	202	2	interaction	interaction	NN
cord-269150-d1sgnxc0	202	3	is	be	VBZ
cord-269150-d1sgnxc0	202	4	also	also	RB
cord-269150-d1sgnxc0	202	5	shown	show	VBN
cord-269150-d1sgnxc0	202	6	to	to	TO
cord-269150-d1sgnxc0	202	7	be	be	VB
cord-269150-d1sgnxc0	202	8	specific	specific	JJ
cord-269150-d1sgnxc0	202	9	and	and	CC
cord-269150-d1sgnxc0	202	10	stem	stem	NN
cord-269150-d1sgnxc0	202	11	-	-	HYPH
cord-269150-d1sgnxc0	202	12	loop	loop	NN
cord-269150-d1sgnxc0	202	13	I	i	NN
cord-269150-d1sgnxc0	202	14	of	of	IN
cord-269150-d1sgnxc0	202	15	IBV	IBV	NNP
cord-269150-d1sgnxc0	202	16	5	5	CD
cord-269150-d1sgnxc0	202	17	0	0	CD
cord-269150-d1sgnxc0	202	18	-UTR	-utr	NN
cord-269150-d1sgnxc0	202	19	is	be	VBZ
cord-269150-d1sgnxc0	202	20	essential	essential	JJ
cord-269150-d1sgnxc0	202	21	for	for	IN
cord-269150-d1sgnxc0	202	22	the	the	DT
cord-269150-d1sgnxc0	202	23	interaction	interaction	NN
cord-269150-d1sgnxc0	202	24	to	to	TO
cord-269150-d1sgnxc0	202	25	occur	occur	VB
cord-269150-d1sgnxc0	202	26	.	.	.
cord-269150-d1sgnxc0	203	1	Although	although	IN
cord-269150-d1sgnxc0	203	2	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	203	3	was	be	VBD
cord-269150-d1sgnxc0	203	4	reported	report	VBN
cord-269150-d1sgnxc0	203	5	to	to	TO
cord-269150-d1sgnxc0	203	6	be	be	VB
cord-269150-d1sgnxc0	203	7	a	a	DT
cord-269150-d1sgnxc0	203	8	nuclear	nuclear	JJ
cord-269150-d1sgnxc0	203	9	protein	protein	NN
cord-269150-d1sgnxc0	203	10	(	(	-LRB-
cord-269150-d1sgnxc0	203	11	35	35	CD
cord-269150-d1sgnxc0	203	12	)	)	-RRB-
cord-269150-d1sgnxc0	203	13	,	,	,
cord-269150-d1sgnxc0	203	14	it	-PRON-	PRP
cord-269150-d1sgnxc0	203	15	could	could	MD
cord-269150-d1sgnxc0	203	16	be	be	VB
cord-269150-d1sgnxc0	203	17	detected	detect	VBN
cord-269150-d1sgnxc0	203	18	in	in	IN
cord-269150-d1sgnxc0	203	19	the	the	DT
cord-269150-d1sgnxc0	203	20	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	203	21	of	of	IN
cord-269150-d1sgnxc0	203	22	IBV	IBV	NNP
cord-269150-d1sgnxc0	203	23	-	-	HYPH
cord-269150-d1sgnxc0	203	24	infected	infect	VBN
cord-269150-d1sgnxc0	203	25	cells	cell	NNS
cord-269150-d1sgnxc0	203	26	and	and	CC
cord-269150-d1sgnxc0	203	27	partially	partially	RB
cord-269150-d1sgnxc0	203	28	overlaps	overlap	VBZ
cord-269150-d1sgnxc0	203	29	with	with	IN
cord-269150-d1sgnxc0	203	30	the	the	DT
cord-269150-d1sgnxc0	203	31	de	de	NNP
cord-269150-d1sgnxc0	203	32	novo	novo	NNP
cord-269150-d1sgnxc0	203	33	synthesized	synthesize	VBN
cord-269150-d1sgnxc0	203	34	viral	viral	JJ
cord-269150-d1sgnxc0	203	35	RNA	RNA	NNP
cord-269150-d1sgnxc0	203	36	,	,	,
cord-269150-d1sgnxc0	203	37	which	which	WDT
cord-269150-d1sgnxc0	203	38	marks	mark	VBZ
cord-269150-d1sgnxc0	203	39	the	the	DT
cord-269150-d1sgnxc0	203	40	location	location	NN
cord-269150-d1sgnxc0	203	41	of	of	IN
cord-269150-d1sgnxc0	203	42	the	the	DT
cord-269150-d1sgnxc0	203	43	RTCs	rtc	NNS
cord-269150-d1sgnxc0	203	44	in	in	IN
cord-269150-d1sgnxc0	203	45	infected	infected	JJ
cord-269150-d1sgnxc0	203	46	cells	cell	NNS
cord-269150-d1sgnxc0	203	47	in	in	IN
cord-269150-d1sgnxc0	203	48	the	the	DT
cord-269150-d1sgnxc0	203	49	presence	presence	NN
cord-269150-d1sgnxc0	203	50	of	of	IN
cord-269150-d1sgnxc0	203	51	actinomycin	actinomycin	NNS
cord-269150-d1sgnxc0	203	52	D.	D.	NNP
cord-269150-d1sgnxc0	203	53	Silencing	Silencing	NNP
cord-269150-d1sgnxc0	203	54	of	of	IN
cord-269150-d1sgnxc0	203	55	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	203	56	resulted	result	VBD
cord-269150-d1sgnxc0	203	57	in	in	IN
cord-269150-d1sgnxc0	203	58	a	a	DT
cord-269150-d1sgnxc0	203	59	marked	marked	JJ
cord-269150-d1sgnxc0	203	60	reduction	reduction	NN
cord-269150-d1sgnxc0	203	61	in	in	IN
cord-269150-d1sgnxc0	203	62	syncytium	syncytium	NN
cord-269150-d1sgnxc0	203	63	formation	formation	NN
cord-269150-d1sgnxc0	203	64	upon	upon	IN
cord-269150-d1sgnxc0	203	65	IBV	IBV	NNP
cord-269150-d1sgnxc0	203	66	infection	infection	NN
cord-269150-d1sgnxc0	203	67	.	.	.
cord-269150-d1sgnxc0	204	1	A	a	DT
cord-269150-d1sgnxc0	204	2	closer	close	JJR
cord-269150-d1sgnxc0	204	3	examination	examination	NN
cord-269150-d1sgnxc0	204	4	revealed	reveal	VBD
cord-269150-d1sgnxc0	204	5	that	that	IN
cord-269150-d1sgnxc0	204	6	the	the	DT
cord-269150-d1sgnxc0	204	7	synthesis	synthesis	NN
cord-269150-d1sgnxc0	204	8	of	of	IN
cord-269150-d1sgnxc0	204	9	both	both	DT
cord-269150-d1sgnxc0	204	10	genome-(gRNA	genome-(gRNA	NNPS
cord-269150-d1sgnxc0	204	11	)	)	-RRB-
cord-269150-d1sgnxc0	204	12	and	and	CC
cord-269150-d1sgnxc0	204	13	subgenome	subgenome	NN
cord-269150-d1sgnxc0	204	14	-	-	HYPH
cord-269150-d1sgnxc0	204	15	length	length	NN
cord-269150-d1sgnxc0	204	16	RNAs	rna	NNS
cord-269150-d1sgnxc0	204	17	(	(	-LRB-
cord-269150-d1sgnxc0	204	18	sgRNA	sgRNA	VBG
cord-269150-d1sgnxc0	204	19	)	)	-RRB-
cord-269150-d1sgnxc0	204	20	was	be	VBD
cord-269150-d1sgnxc0	204	21	compromised	compromise	VBN
cord-269150-d1sgnxc0	204	22	,	,	,
cord-269150-d1sgnxc0	204	23	resulting	result	VBG
cord-269150-d1sgnxc0	204	24	in	in	IN
cord-269150-d1sgnxc0	204	25	a	a	DT
cord-269150-d1sgnxc0	204	26	drastic	drastic	JJ
cord-269150-d1sgnxc0	204	27	reduction	reduction	NN
cord-269150-d1sgnxc0	204	28	of	of	IN
cord-269150-d1sgnxc0	204	29	viral	viral	JJ
cord-269150-d1sgnxc0	204	30	structural	structural	JJ
cord-269150-d1sgnxc0	204	31	protein	protein	NN
cord-269150-d1sgnxc0	204	32	expression	expression	NN
cord-269150-d1sgnxc0	204	33	and	and	CC
cord-269150-d1sgnxc0	204	34	release	release	NN
cord-269150-d1sgnxc0	204	35	of	of	IN
cord-269150-d1sgnxc0	204	36	viral	viral	JJ
cord-269150-d1sgnxc0	204	37	progeny	progeny	NN
cord-269150-d1sgnxc0	204	38	(	(	-LRB-
cord-269150-d1sgnxc0	204	39	titers	titer	NNS
cord-269150-d1sgnxc0	204	40	)	)	-RRB-
cord-269150-d1sgnxc0	204	41	,	,	,
cord-269150-d1sgnxc0	204	42	hence	hence	RB
cord-269150-d1sgnxc0	204	43	the	the	DT
cord-269150-d1sgnxc0	204	44	overall	overall	JJ
cord-269150-d1sgnxc0	204	45	reduction	reduction	NN
cord-269150-d1sgnxc0	204	46	of	of	IN
cord-269150-d1sgnxc0	204	47	viral	viral	JJ
cord-269150-d1sgnxc0	204	48	infectivity	infectivity	NN
cord-269150-d1sgnxc0	204	49	in	in	IN
cord-269150-d1sgnxc0	204	50	the	the	DT
cord-269150-d1sgnxc0	204	51	cells	cell	NNS
cord-269150-d1sgnxc0	204	52	.	.	.
cord-269150-d1sgnxc0	205	1	Across	across	IN
cord-269150-d1sgnxc0	205	2	different	different	JJ
cord-269150-d1sgnxc0	205	3	coronaviruses	coronaviruse	NNS
cord-269150-d1sgnxc0	205	4	,	,	,
cord-269150-d1sgnxc0	205	5	the	the	DT
cord-269150-d1sgnxc0	205	6	leader	leader	NN
cord-269150-d1sgnxc0	205	7	sequence	sequence	NN
cord-269150-d1sgnxc0	205	8	situated	situate	VBN
cord-269150-d1sgnxc0	205	9	in	in	IN
cord-269150-d1sgnxc0	205	10	the	the	DT
cord-269150-d1sgnxc0	205	11	extreme	extreme	JJ
cord-269150-d1sgnxc0	205	12	5	5	CD
cord-269150-d1sgnxc0	205	13	0	0	CD
cord-269150-d1sgnxc0	205	14	end	end	NN
cord-269150-d1sgnxc0	205	15	of	of	IN
cord-269150-d1sgnxc0	205	16	the	the	DT
cord-269150-d1sgnxc0	205	17	genome	genome	NN
cord-269150-d1sgnxc0	205	18	,	,	,
cord-269150-d1sgnxc0	205	19	is	be	VBZ
cord-269150-d1sgnxc0	205	20	composed	compose	VBN
cord-269150-d1sgnxc0	205	21	of	of	IN
cord-269150-d1sgnxc0	205	22	stem	stem	NN
cord-269150-d1sgnxc0	205	23	-	-	HYPH
cord-269150-d1sgnxc0	205	24	loops	loop	NNS
cord-269150-d1sgnxc0	205	25	I	-PRON-	PRP
cord-269150-d1sgnxc0	205	26	and	and	CC
cord-269150-d1sgnxc0	205	27	II	II	NNP
cord-269150-d1sgnxc0	205	28	.	.	.
cord-269150-d1sgnxc0	206	1	Mutations	mutation	NNS
cord-269150-d1sgnxc0	206	2	introduced	introduce	VBN
cord-269150-d1sgnxc0	206	3	into	into	IN
cord-269150-d1sgnxc0	206	4	either	either	DT
cord-269150-d1sgnxc0	206	5	stem	stem	NN
cord-269150-d1sgnxc0	206	6	-	-	HYPH
cord-269150-d1sgnxc0	206	7	loop	loop	NN
cord-269150-d1sgnxc0	207	1	I	-PRON-	PRP
cord-269150-d1sgnxc0	207	2	or	or	CC
cord-269150-d1sgnxc0	207	3	II	II	NNP
cord-269150-d1sgnxc0	207	4	resulted	result	VBD
cord-269150-d1sgnxc0	207	5	in	in	IN
cord-269150-d1sgnxc0	207	6	non	non	JJ
cord-269150-d1sgnxc0	207	7	-	-	JJ
cord-269150-d1sgnxc0	207	8	viable	viable	JJ
cord-269150-d1sgnxc0	207	9	viruses	virus	NNS
cord-269150-d1sgnxc0	207	10	,	,	.
cord-269150-d1sgnxc0	208	1	impaired	impaired	JJ
cord-269150-d1sgnxc0	208	2	(	(	-LRB-
cord-269150-d1sgnxc0	208	3	sense	sense	NN
cord-269150-d1sgnxc0	208	4	and	and	CC
cord-269150-d1sgnxc0	208	5	anti	anti	JJ
cord-269150-d1sgnxc0	208	6	-	-	JJ
cord-269150-d1sgnxc0	208	7	sense	sense	JJ
cord-269150-d1sgnxc0	208	8	)	)	-RRB-
cord-269150-d1sgnxc0	208	9	sgRNA	sgrna	NN
cord-269150-d1sgnxc0	208	10	synthesis	synthesis	NN
cord-269150-d1sgnxc0	208	11	,	,	,
cord-269150-d1sgnxc0	208	12	but	but	CC
cord-269150-d1sgnxc0	208	13	not	not	RB
cord-269150-d1sgnxc0	208	14	the	the	DT
cord-269150-d1sgnxc0	208	15	full	full	JJ
cord-269150-d1sgnxc0	208	16	-	-	HYPH
cord-269150-d1sgnxc0	208	17	length	length	NN
cord-269150-d1sgnxc0	208	18	gRNA	grna	NN
cord-269150-d1sgnxc0	208	19	synthesis	synthesis	NN
cord-269150-d1sgnxc0	208	20	(	(	-LRB-
cord-269150-d1sgnxc0	208	21	38	38	CD
cord-269150-d1sgnxc0	208	22	,	,	,
cord-269150-d1sgnxc0	208	23	44	44	CD
cord-269150-d1sgnxc0	208	24	)	)	-RRB-
cord-269150-d1sgnxc0	208	25	.	.	.
cord-269150-d1sgnxc0	209	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	209	2	was	be	VBD
cord-269150-d1sgnxc0	209	3	,	,	,
cord-269150-d1sgnxc0	209	4	however	however	RB
cord-269150-d1sgnxc0	209	5	,	,	,
cord-269150-d1sgnxc0	209	6	observed	observe	VBD
cord-269150-d1sgnxc0	209	7	in	in	IN
cord-269150-d1sgnxc0	209	8	this	this	DT
cord-269150-d1sgnxc0	209	9	study	study	NN
cord-269150-d1sgnxc0	209	10	that	that	IN
cord-269150-d1sgnxc0	209	11	silencing	silencing	NN
cord-269150-d1sgnxc0	209	12	of	of	IN
cord-269150-d1sgnxc0	209	13	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	209	14	did	do	VBD
cord-269150-d1sgnxc0	209	15	render	render	VB
cord-269150-d1sgnxc0	209	16	an	an	DT
cord-269150-d1sgnxc0	209	17	impact	impact	NN
cord-269150-d1sgnxc0	209	18	on	on	IN
cord-269150-d1sgnxc0	209	19	gRNA	grna	NN
cord-269150-d1sgnxc0	209	20	synthesis	synthesis	NN
cord-269150-d1sgnxc0	209	21	,	,	,
cord-269150-d1sgnxc0	209	22	although	although	IN
cord-269150-d1sgnxc0	209	23	to	to	IN
cord-269150-d1sgnxc0	209	24	a	a	DT
cord-269150-d1sgnxc0	209	25	lesser	less	JJR
cord-269150-d1sgnxc0	209	26	extent	extent	NN
cord-269150-d1sgnxc0	209	27	compared	compare	VBN
cord-269150-d1sgnxc0	209	28	to	to	IN
cord-269150-d1sgnxc0	209	29	sgRNA	sgrna	NN
cord-269150-d1sgnxc0	209	30	synthesis	synthesis	NN
cord-269150-d1sgnxc0	209	31	.	.	.
cord-269150-d1sgnxc0	210	1	This	this	DT
cord-269150-d1sgnxc0	210	2	might	may	MD
cord-269150-d1sgnxc0	210	3	have	have	VB
cord-269150-d1sgnxc0	210	4	been	be	VBN
cord-269150-d1sgnxc0	210	5	due	due	JJ
cord-269150-d1sgnxc0	210	6	to	to	IN
cord-269150-d1sgnxc0	210	7	a	a	DT
cord-269150-d1sgnxc0	210	8	secondary	secondary	JJ
cord-269150-d1sgnxc0	210	9	effect	effect	NN
cord-269150-d1sgnxc0	210	10	of	of	IN
cord-269150-d1sgnxc0	210	11	decreased	decrease	VBN
cord-269150-d1sgnxc0	210	12	sgRNA	sgrna	NN
cord-269150-d1sgnxc0	210	13	synthesis	synthesis	NN
cord-269150-d1sgnxc0	210	14	,	,	,
cord-269150-d1sgnxc0	210	15	as	as	IN
cord-269150-d1sgnxc0	210	16	proteins	protein	NNS
cord-269150-d1sgnxc0	210	17	encoded	encode	VBN
cord-269150-d1sgnxc0	210	18	by	by	IN
cord-269150-d1sgnxc0	210	19	sgRNAs	sgrna	NNS
cord-269150-d1sgnxc0	210	20	may	may	MD
cord-269150-d1sgnxc0	210	21	enhance	enhance	VB
cord-269150-d1sgnxc0	210	22	viral	viral	JJ
cord-269150-d1sgnxc0	210	23	RNA	RNA	NNP
cord-269150-d1sgnxc0	210	24	synthesis	synthesis	NN
cord-269150-d1sgnxc0	210	25	(	(	-LRB-
cord-269150-d1sgnxc0	210	26	45	45	CD
cord-269150-d1sgnxc0	210	27	)	)	-RRB-
cord-269150-d1sgnxc0	210	28	.	.	.
cord-269150-d1sgnxc0	211	1	The	the	DT
cord-269150-d1sgnxc0	211	2	predicted	predict	VBN
cord-269150-d1sgnxc0	211	3	structure	structure	NN
cord-269150-d1sgnxc0	211	4	of	of	IN
cord-269150-d1sgnxc0	211	5	stem	stem	NN
cord-269150-d1sgnxc0	211	6	-	-	HYPH
cord-269150-d1sgnxc0	211	7	loop	loop	NN
cord-269150-d1sgnxc0	211	8	II	II	NNP
cord-269150-d1sgnxc0	211	9	indicated	indicate	VBD
cord-269150-d1sgnxc0	211	10	a	a	DT
cord-269150-d1sgnxc0	211	11	strong	strong	JJ
cord-269150-d1sgnxc0	211	12	secondary	secondary	JJ
cord-269150-d1sgnxc0	211	13	interaction	interaction	NN
cord-269150-d1sgnxc0	211	14	,	,	,
cord-269150-d1sgnxc0	211	15	which	which	WDT
cord-269150-d1sgnxc0	211	16	is	be	VBZ
cord-269150-d1sgnxc0	211	17	highly	highly	RB
cord-269150-d1sgnxc0	211	18	conserved	conserve	VBN
cord-269150-d1sgnxc0	211	19	across	across	IN
cord-269150-d1sgnxc0	211	20	different	different	JJ
cord-269150-d1sgnxc0	211	21	groups	group	NNS
cord-269150-d1sgnxc0	211	22	of	of	IN
cord-269150-d1sgnxc0	211	23	coronaviruses	coronaviruse	NNS
cord-269150-d1sgnxc0	211	24	.	.	.
cord-269150-d1sgnxc0	212	1	The	the	DT
cord-269150-d1sgnxc0	212	2	predicted	predict	VBN
cord-269150-d1sgnxc0	212	3	stem	stem	NN
cord-269150-d1sgnxc0	212	4	-	-	HYPH
cord-269150-d1sgnxc0	212	5	loop	loop	NN
cord-269150-d1sgnxc0	212	6	I	I	NNP
cord-269150-d1sgnxc0	212	7	structure	structure	NN
cord-269150-d1sgnxc0	212	8	,	,	,
cord-269150-d1sgnxc0	212	9	on	on	IN
cord-269150-d1sgnxc0	212	10	the	the	DT
cord-269150-d1sgnxc0	212	11	other	other	JJ
cord-269150-d1sgnxc0	212	12	hand	hand	NN
cord-269150-d1sgnxc0	212	13	,	,	,
cord-269150-d1sgnxc0	212	14	appears	appear	VBZ
cord-269150-d1sgnxc0	212	15	to	to	TO
cord-269150-d1sgnxc0	212	16	fold	fold	VB
cord-269150-d1sgnxc0	212	17	into	into	IN
cord-269150-d1sgnxc0	212	18	a	a	DT
cord-269150-d1sgnxc0	212	19	hairpin	hairpin	NN
cord-269150-d1sgnxc0	212	20	of	of	IN
cord-269150-d1sgnxc0	212	21	low	low	JJ
cord-269150-d1sgnxc0	212	22	thermodynamic	thermodynamic	JJ
cord-269150-d1sgnxc0	212	23	stability	stability	NN
cord-269150-d1sgnxc0	212	24	,	,	,
cord-269150-d1sgnxc0	212	25	shows	show	VBZ
cord-269150-d1sgnxc0	212	26	a	a	DT
cord-269150-d1sgnxc0	212	27	wider	wide	JJR
cord-269150-d1sgnxc0	212	28	sequence	sequence	NN
cord-269150-d1sgnxc0	212	29	variation	variation	NN
cord-269150-d1sgnxc0	212	30	and	and	CC
cord-269150-d1sgnxc0	212	31	is	be	VBZ
cord-269150-d1sgnxc0	212	32	characterized	characterize	VBN
cord-269150-d1sgnxc0	212	33	by	by	IN
cord-269150-d1sgnxc0	212	34	the	the	DT
cord-269150-d1sgnxc0	212	35	presence	presence	NN
cord-269150-d1sgnxc0	212	36	of	of	IN
cord-269150-d1sgnxc0	212	37	bulges	bulge	NNS
cord-269150-d1sgnxc0	212	38	,	,	,
cord-269150-d1sgnxc0	212	39	non	non	JJ
cord-269150-d1sgnxc0	212	40	-	-	JJ
cord-269150-d1sgnxc0	212	41	canonical	canonical	JJ
cord-269150-d1sgnxc0	212	42	base	base	NN
cord-269150-d1sgnxc0	212	43	pairing	pairing	NN
cord-269150-d1sgnxc0	212	44	as	as	RB
cord-269150-d1sgnxc0	212	45	well	well	RB
cord-269150-d1sgnxc0	212	46	as	as	IN
cord-269150-d1sgnxc0	212	47	a	a	DT
cord-269150-d1sgnxc0	212	48	prevalence	prevalence	NN
cord-269150-d1sgnxc0	212	49	of	of	IN
cord-269150-d1sgnxc0	212	50	A	a	NN
cord-269150-d1sgnxc0	212	51	-	-	HYPH
cord-269150-d1sgnxc0	212	52	U	u	NN
cord-269150-d1sgnxc0	212	53	base	base	NN
cord-269150-d1sgnxc0	212	54	pairing	pairing	NN
cord-269150-d1sgnxc0	212	55	(	(	-LRB-
cord-269150-d1sgnxc0	212	56	46	46	CD
cord-269150-d1sgnxc0	212	57	)	)	-RRB-
cord-269150-d1sgnxc0	212	58	.	.	.
cord-269150-d1sgnxc0	213	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	213	2	has	have	VBZ
cord-269150-d1sgnxc0	213	3	been	be	VBN
cord-269150-d1sgnxc0	213	4	shown	show	VBN
cord-269150-d1sgnxc0	213	5	in	in	IN
cord-269150-d1sgnxc0	213	6	MHV	MHV	NNP
cord-269150-d1sgnxc0	213	7	that	that	IN
cord-269150-d1sgnxc0	213	8	the	the	DT
cord-269150-d1sgnxc0	213	9	structural	structural	JJ
cord-269150-d1sgnxc0	213	10	liability	liability	NN
cord-269150-d1sgnxc0	213	11	of	of	IN
cord-269150-d1sgnxc0	213	12	stem	stem	NN
cord-269150-d1sgnxc0	213	13	-	-	HYPH
cord-269150-d1sgnxc0	213	14	loop	loop	NN
cord-269150-d1sgnxc0	214	1	I	-PRON-	PRP
cord-269150-d1sgnxc0	214	2	is	be	VBZ
cord-269150-d1sgnxc0	214	3	a	a	DT
cord-269150-d1sgnxc0	214	4	critical	critical	JJ
cord-269150-d1sgnxc0	214	5	driving	drive	VBG
cord-269150-d1sgnxc0	214	6	force	force	NN
cord-269150-d1sgnxc0	214	7	in	in	IN
cord-269150-d1sgnxc0	214	8	the	the	DT
cord-269150-d1sgnxc0	214	9	5	5	CD
cord-269150-d1sgnxc0	214	10	0	0	CD
cord-269150-d1sgnxc0	214	11	-and	-and	SYM
cord-269150-d1sgnxc0	214	12	3	3	CD
cord-269150-d1sgnxc0	214	13	0	0	CD
cord-269150-d1sgnxc0	214	14	-UTR	-utr	NN
cord-269150-d1sgnxc0	214	15	interaction	interaction	NN
cord-269150-d1sgnxc0	214	16	(	(	-LRB-
cord-269150-d1sgnxc0	214	17	44	44	CD
cord-269150-d1sgnxc0	214	18	)	)	-RRB-
cord-269150-d1sgnxc0	214	19	.	.	.
cord-269150-d1sgnxc0	215	1	Comparing	compare	VBG
cord-269150-d1sgnxc0	215	2	the	the	DT
cord-269150-d1sgnxc0	215	3	predicted	predict	VBN
cord-269150-d1sgnxc0	215	4	stemloop	stemloop	NN
cord-269150-d1sgnxc0	215	5	I	-PRON-	PRP
cord-269150-d1sgnxc0	215	6	structures	structure	NNS
cord-269150-d1sgnxc0	215	7	of	of	IN
cord-269150-d1sgnxc0	215	8	IBV	IBV	NNP
cord-269150-d1sgnxc0	215	9	to	to	IN
cord-269150-d1sgnxc0	215	10	SARS	SARS	NNP
cord-269150-d1sgnxc0	215	11	-	-	HYPH
cord-269150-d1sgnxc0	215	12	CoV	CoV	NNP
cord-269150-d1sgnxc0	215	13	and	and	CC
cord-269150-d1sgnxc0	215	14	HCoV	HCoV	NNP
cord-269150-d1sgnxc0	215	15	-	-	HYPH
cord-269150-d1sgnxc0	215	16	OC43	OC43	NNP
cord-269150-d1sgnxc0	215	17	(	(	-LRB-
cord-269150-d1sgnxc0	215	18	Figure	figure	NN
cord-269150-d1sgnxc0	215	19	8B	8b	NN
cord-269150-d1sgnxc0	215	20	)	)	-RRB-
cord-269150-d1sgnxc0	215	21	,	,	,
cord-269150-d1sgnxc0	215	22	it	-PRON-	PRP
cord-269150-d1sgnxc0	215	23	was	be	VBD
cord-269150-d1sgnxc0	215	24	noted	note	VBN
cord-269150-d1sgnxc0	215	25	that	that	IN
cord-269150-d1sgnxc0	215	26	there	there	EX
cord-269150-d1sgnxc0	215	27	exists	exist	VBZ
cord-269150-d1sgnxc0	215	28	a	a	DT
cord-269150-d1sgnxc0	215	29	difference	difference	NN
cord-269150-d1sgnxc0	215	30	in	in	IN
cord-269150-d1sgnxc0	215	31	the	the	DT
cord-269150-d1sgnxc0	215	32	loop	loop	NN
cord-269150-d1sgnxc0	215	33	sequence	sequence	NN
cord-269150-d1sgnxc0	215	34	.	.	.
cord-269150-d1sgnxc0	216	1	In	in	IN
cord-269150-d1sgnxc0	216	2	addition	addition	NN
cord-269150-d1sgnxc0	216	3	,	,	,
cord-269150-d1sgnxc0	216	4	IBV	IBV	NNP
cord-269150-d1sgnxc0	216	5	stem	stem	NN
cord-269150-d1sgnxc0	216	6	-	-	HYPH
cord-269150-d1sgnxc0	216	7	loop	loop	NN
cord-269150-d1sgnxc0	216	8	I	-PRON-	PRP
cord-269150-d1sgnxc0	216	9	has	have	VBZ
cord-269150-d1sgnxc0	216	10	a	a	DT
cord-269150-d1sgnxc0	216	11	shorter	short	JJR
cord-269150-d1sgnxc0	216	12	stem	stem	NN
cord-269150-d1sgnxc0	216	13	and	and	CC
cord-269150-d1sgnxc0	216	14	the	the	DT
cord-269150-d1sgnxc0	216	15	absence	absence	NN
cord-269150-d1sgnxc0	216	16	of	of	IN
cord-269150-d1sgnxc0	216	17	bulges	bulge	NNS
cord-269150-d1sgnxc0	216	18	,	,	,
cord-269150-d1sgnxc0	216	19	although	although	IN
cord-269150-d1sgnxc0	216	20	the	the	DT
cord-269150-d1sgnxc0	216	21	structure	structure	NN
cord-269150-d1sgnxc0	216	22	may	may	MD
cord-269150-d1sgnxc0	216	23	be	be	VB
cord-269150-d1sgnxc0	216	24	as	as	RB
cord-269150-d1sgnxc0	216	25	unstable	unstable	JJ
cord-269150-d1sgnxc0	216	26	thermodynamically	thermodynamically	RB
cord-269150-d1sgnxc0	216	27	as	as	IN
cord-269150-d1sgnxc0	216	28	that	that	DT
cord-269150-d1sgnxc0	216	29	of	of	IN
cord-269150-d1sgnxc0	216	30	SARS	SARS	NNP
cord-269150-d1sgnxc0	216	31	-	-	HYPH
cord-269150-d1sgnxc0	216	32	CoV	CoV	NNP
cord-269150-d1sgnxc0	216	33	and	and	CC
cord-269150-d1sgnxc0	216	34	HCoV	HCoV	NNP
cord-269150-d1sgnxc0	216	35	-	-	HYPH
cord-269150-d1sgnxc0	216	36	OC43	OC43	NNP
cord-269150-d1sgnxc0	216	37	,	,	,
cord-269150-d1sgnxc0	216	38	due	due	IN
cord-269150-d1sgnxc0	216	39	to	to	IN
cord-269150-d1sgnxc0	216	40	the	the	DT
cord-269150-d1sgnxc0	216	41	extremely	extremely	RB
cord-269150-d1sgnxc0	216	42	high	high	JJ
cord-269150-d1sgnxc0	216	43	prevalence	prevalence	NN
cord-269150-d1sgnxc0	216	44	of	of	IN
cord-269150-d1sgnxc0	216	45	weak	weak	JJ
cord-269150-d1sgnxc0	216	46	base	base	NN
cord-269150-d1sgnxc0	216	47	pairing	pair	VBG
cord-269150-d1sgnxc0	216	48	between	between	IN
cord-269150-d1sgnxc0	216	49	A	a	NN
cord-269150-d1sgnxc0	216	50	and	and	CC
cord-269150-d1sgnxc0	216	51	U	u	NN
cord-269150-d1sgnxc0	216	52	as	as	RB
cord-269150-d1sgnxc0	216	53	well	well	RB
cord-269150-d1sgnxc0	216	54	as	as	IN
cord-269150-d1sgnxc0	216	55	the	the	DT
cord-269150-d1sgnxc0	216	56	presence	presence	NN
cord-269150-d1sgnxc0	216	57	of	of	IN
cord-269150-d1sgnxc0	216	58	a	a	DT
cord-269150-d1sgnxc0	216	59	non	non	JJ
cord-269150-d1sgnxc0	216	60	-	-	JJ
cord-269150-d1sgnxc0	216	61	canonical	canonical	JJ
cord-269150-d1sgnxc0	216	62	base	base	NN
cord-269150-d1sgnxc0	216	63	pair	pair	NN
cord-269150-d1sgnxc0	216	64	at	at	IN
cord-269150-d1sgnxc0	216	65	the	the	DT
cord-269150-d1sgnxc0	216	66	base	base	NN
cord-269150-d1sgnxc0	216	67	of	of	IN
cord-269150-d1sgnxc0	216	68	the	the	DT
cord-269150-d1sgnxc0	216	69	stem	stem	NN
cord-269150-d1sgnxc0	216	70	(	(	-LRB-
cord-269150-d1sgnxc0	216	71	46	46	CD
cord-269150-d1sgnxc0	216	72	)	)	-RRB-
cord-269150-d1sgnxc0	216	73	.	.	.
cord-269150-d1sgnxc0	217	1	Hence	hence	RB
cord-269150-d1sgnxc0	217	2	,	,	,
cord-269150-d1sgnxc0	217	3	sequence	sequence	NN
cord-269150-d1sgnxc0	217	4	and	and	CC
cord-269150-d1sgnxc0	217	5	structural	structural	JJ
cord-269150-d1sgnxc0	217	6	differences	difference	NNS
cord-269150-d1sgnxc0	217	7	may	may	MD
cord-269150-d1sgnxc0	217	8	be	be	VB
cord-269150-d1sgnxc0	217	9	one	one	CD
cord-269150-d1sgnxc0	217	10	of	of	IN
cord-269150-d1sgnxc0	217	11	the	the	DT
cord-269150-d1sgnxc0	217	12	possible	possible	JJ
cord-269150-d1sgnxc0	217	13	explanations	explanation	NNS
cord-269150-d1sgnxc0	217	14	for	for	IN
cord-269150-d1sgnxc0	217	15	the	the	DT
cord-269150-d1sgnxc0	217	16	observation	observation	NN
cord-269150-d1sgnxc0	217	17	of	of	IN
cord-269150-d1sgnxc0	217	18	a	a	DT
cord-269150-d1sgnxc0	217	19	weaker	weak	JJR
cord-269150-d1sgnxc0	217	20	binding	binding	NN
cord-269150-d1sgnxc0	217	21	between	between	IN
cord-269150-d1sgnxc0	217	22	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	217	23	and	and	CC
cord-269150-d1sgnxc0	217	24	SARS	SARS	NNP
cord-269150-d1sgnxc0	217	25	-	-	HYPH
cord-269150-d1sgnxc0	217	26	CoV	CoV	NNP
cord-269150-d1sgnxc0	217	27	or	or	CC
cord-269150-d1sgnxc0	217	28	HCoV	HCoV	NNP
cord-269150-d1sgnxc0	217	29	-	-	HYPH
cord-269150-d1sgnxc0	217	30	OC43	OC43	NNP
cord-269150-d1sgnxc0	217	31	5	5	CD
cord-269150-d1sgnxc0	217	32	0	0	CD
cord-269150-d1sgnxc0	217	33	-UTR	-utr	NN
cord-269150-d1sgnxc0	217	34	than	than	IN
cord-269150-d1sgnxc0	217	35	with	with	IN
cord-269150-d1sgnxc0	217	36	IBV	IBV	NNP
cord-269150-d1sgnxc0	217	37	5	5	CD
cord-269150-d1sgnxc0	217	38	0	0	CD
cord-269150-d1sgnxc0	217	39	-UTR	-utr	NN
cord-269150-d1sgnxc0	217	40	.	.	.
cord-269150-d1sgnxc0	218	1	In	in	IN
cord-269150-d1sgnxc0	218	2	fact	fact	NN
cord-269150-d1sgnxc0	218	3	,	,	,
cord-269150-d1sgnxc0	218	4	the	the	DT
cord-269150-d1sgnxc0	218	5	relatively	relatively	RB
cord-269150-d1sgnxc0	218	6	weaker	weak	JJR
cord-269150-d1sgnxc0	218	7	binding	binding	NN
cord-269150-d1sgnxc0	218	8	of	of	IN
cord-269150-d1sgnxc0	218	9	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	218	10	to	to	IN
cord-269150-d1sgnxc0	218	11	the	the	DT
cord-269150-d1sgnxc0	218	12	stem	stem	NN
cord-269150-d1sgnxc0	218	13	-	-	HYPH
cord-269150-d1sgnxc0	218	14	loop	loop	NN
cord-269150-d1sgnxc0	219	1	I	-PRON-	PRP
cord-269150-d1sgnxc0	219	2	restoring	restore	VBG
cord-269150-d1sgnxc0	219	3	mutant	mutant	JJ
cord-269150-d1sgnxc0	219	4	(	(	-LRB-
cord-269150-d1sgnxc0	219	5	5	5	CD
cord-269150-d1sgnxc0	219	6	0	0	CD
cord-269150-d1sgnxc0	219	7	-UTRÁ2M2	-utrá2m2	ADD
cord-269150-d1sgnxc0	219	8	)	)	-RRB-
cord-269150-d1sgnxc0	220	1	demonstrated	demonstrate	VBN
cord-269150-d1sgnxc0	220	2	in	in	IN
cord-269150-d1sgnxc0	220	3	this	this	DT
cord-269150-d1sgnxc0	220	4	study	study	NN
cord-269150-d1sgnxc0	220	5	supports	support	VBZ
cord-269150-d1sgnxc0	220	6	that	that	IN
cord-269150-d1sgnxc0	220	7	primary	primary	JJ
cord-269150-d1sgnxc0	220	8	sequences	sequence	NNS
cord-269150-d1sgnxc0	220	9	in	in	IN
cord-269150-d1sgnxc0	220	10	the	the	DT
cord-269150-d1sgnxc0	220	11	5	5	CD
cord-269150-d1sgnxc0	220	12	0	0	CD
cord-269150-d1sgnxc0	220	13	-UTR	-utr	NN
cord-269150-d1sgnxc0	220	14	may	may	MD
cord-269150-d1sgnxc0	220	15	play	play	VB
cord-269150-d1sgnxc0	220	16	a	a	DT
cord-269150-d1sgnxc0	220	17	certain	certain	JJ
cord-269150-d1sgnxc0	220	18	role	role	NN
cord-269150-d1sgnxc0	220	19	in	in	IN
cord-269150-d1sgnxc0	220	20	this	this	DT
cord-269150-d1sgnxc0	220	21	interaction	interaction	NN
cord-269150-d1sgnxc0	220	22	.	.	.
cord-269150-d1sgnxc0	221	1	Most	Most	JJS
cord-269150-d1sgnxc0	221	2	studies	study	NNS
cord-269150-d1sgnxc0	221	3	on	on	IN
cord-269150-d1sgnxc0	221	4	host	host	NN
cord-269150-d1sgnxc0	221	5	involvement	involvement	NN
cord-269150-d1sgnxc0	221	6	in	in	IN
cord-269150-d1sgnxc0	221	7	coronaviral	coronaviral	NNP
cord-269150-d1sgnxc0	221	8	RNA	RNA	NNP
cord-269150-d1sgnxc0	221	9	synthesis	synthesis	NN
cord-269150-d1sgnxc0	221	10	were	be	VBD
cord-269150-d1sgnxc0	221	11	so	so	RB
cord-269150-d1sgnxc0	221	12	far	far	RB
cord-269150-d1sgnxc0	221	13	performed	perform	VBN
cord-269150-d1sgnxc0	221	14	using	use	VBG
cord-269150-d1sgnxc0	221	15	MHV	MHV	NNP
cord-269150-d1sgnxc0	221	16	(	(	-LRB-
cord-269150-d1sgnxc0	221	17	29	29	CD
cord-269150-d1sgnxc0	221	18	)	)	-RRB-
cord-269150-d1sgnxc0	221	19	(	(	-LRB-
cord-269150-d1sgnxc0	221	20	30	30	CD
cord-269150-d1sgnxc0	221	21	)	)	-RRB-
cord-269150-d1sgnxc0	221	22	(	(	-LRB-
cord-269150-d1sgnxc0	221	23	31	31	CD
cord-269150-d1sgnxc0	221	24	)	)	-RRB-
cord-269150-d1sgnxc0	221	25	42	42	CD
cord-269150-d1sgnxc0	221	26	,	,	,
cord-269150-d1sgnxc0	221	27	43	43	CD
cord-269150-d1sgnxc0	221	28	)	)	-RRB-
cord-269150-d1sgnxc0	221	29	.	.	.
cord-269150-d1sgnxc0	222	1	Identification	identification	NN
cord-269150-d1sgnxc0	222	2	of	of	IN
cord-269150-d1sgnxc0	222	3	the	the	DT
cord-269150-d1sgnxc0	222	4	interaction	interaction	NN
cord-269150-d1sgnxc0	222	5	between	between	IN
cord-269150-d1sgnxc0	222	6	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	222	7	and	and	CC
cord-269150-d1sgnxc0	222	8	5	5	CD
cord-269150-d1sgnxc0	222	9	0	0	CD
cord-269150-d1sgnxc0	222	10	-UTR	-utr	NN
cord-269150-d1sgnxc0	222	11	as	as	RB
cord-269150-d1sgnxc0	222	12	well	well	RB
cord-269150-d1sgnxc0	222	13	as	as	IN
cord-269150-d1sgnxc0	222	14	its	-PRON-	PRP$
cord-269150-d1sgnxc0	222	15	functional	functional	JJ
cord-269150-d1sgnxc0	222	16	involvement	involvement	NN
cord-269150-d1sgnxc0	222	17	in	in	IN
cord-269150-d1sgnxc0	222	18	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	222	19	replication	replication	NN
cord-269150-d1sgnxc0	222	20	,	,	,
cord-269150-d1sgnxc0	222	21	in	in	IN
cord-269150-d1sgnxc0	222	22	this	this	DT
cord-269150-d1sgnxc0	222	23	study	study	NN
cord-269150-d1sgnxc0	222	24	,	,	,
cord-269150-d1sgnxc0	222	25	therefore	therefore	RB
cord-269150-d1sgnxc0	222	26	may	may	MD
cord-269150-d1sgnxc0	222	27	represent	represent	VB
cord-269150-d1sgnxc0	222	28	the	the	DT
cord-269150-d1sgnxc0	222	29	first	first	JJ
cord-269150-d1sgnxc0	222	30	host	host	NN
cord-269150-d1sgnxc0	222	31	protein	protein	NN
cord-269150-d1sgnxc0	222	32	identified	identify	VBN
cord-269150-d1sgnxc0	222	33	to	to	TO
cord-269150-d1sgnxc0	222	34	play	play	VB
cord-269150-d1sgnxc0	222	35	a	a	DT
cord-269150-d1sgnxc0	222	36	role	role	NN
cord-269150-d1sgnxc0	222	37	in	in	IN
cord-269150-d1sgnxc0	222	38	viral	viral	JJ
cord-269150-d1sgnxc0	222	39	RNA	RNA	NNP
cord-269150-d1sgnxc0	222	40	synthesis	synthesis	NN
cord-269150-d1sgnxc0	222	41	by	by	IN
cord-269150-d1sgnxc0	222	42	interacting	interact	VBG
cord-269150-d1sgnxc0	222	43	with	with	IN
cord-269150-d1sgnxc0	222	44	the	the	DT
cord-269150-d1sgnxc0	222	45	5	5	CD
cord-269150-d1sgnxc0	222	46	0	0	CD
cord-269150-d1sgnxc0	222	47	-UTR	-utr	NN
cord-269150-d1sgnxc0	222	48	of	of	IN
cord-269150-d1sgnxc0	222	49	the	the	DT
cord-269150-d1sgnxc0	222	50	viral	viral	JJ
cord-269150-d1sgnxc0	222	51	RNA	RNA	NNP
cord-269150-d1sgnxc0	222	52	in	in	IN
cord-269150-d1sgnxc0	222	53	a	a	DT
cord-269150-d1sgnxc0	222	54	gammacoronavirus	gammacoronavirus	NN
cord-269150-d1sgnxc0	222	55	.	.	.
cord-269150-d1sgnxc0	223	1	The	the	DT
cord-269150-d1sgnxc0	223	2	functional	functional	JJ
cord-269150-d1sgnxc0	223	3	implication	implication	NN
cord-269150-d1sgnxc0	223	4	of	of	IN
cord-269150-d1sgnxc0	223	5	the	the	DT
cord-269150-d1sgnxc0	223	6	interaction	interaction	NN
cord-269150-d1sgnxc0	223	7	between	between	IN
cord-269150-d1sgnxc0	223	8	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	223	9	and	and	CC
cord-269150-d1sgnxc0	223	10	IBV	IBV	NNP
cord-269150-d1sgnxc0	223	11	5	5	CD
cord-269150-d1sgnxc0	223	12	0	0	CD
cord-269150-d1sgnxc0	223	13	-UTR	-utr	NN
cord-269150-d1sgnxc0	223	14	may	may	MD
cord-269150-d1sgnxc0	223	15	be	be	VB
cord-269150-d1sgnxc0	223	16	extended	extend	VBN
cord-269150-d1sgnxc0	223	17	to	to	IN
cord-269150-d1sgnxc0	223	18	the	the	DT
cord-269150-d1sgnxc0	223	19	rest	rest	NN
cord-269150-d1sgnxc0	223	20	of	of	IN
cord-269150-d1sgnxc0	223	21	the	the	DT
cord-269150-d1sgnxc0	223	22	members	member	NNS
cord-269150-d1sgnxc0	223	23	of	of	IN
cord-269150-d1sgnxc0	223	24	the	the	DT
cord-269150-d1sgnxc0	223	25	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	223	26	family	family	NN
cord-269150-d1sgnxc0	223	27	.	.	.
cord-269150-d1sgnxc0	224	1	In	in	IN
cord-269150-d1sgnxc0	224	2	the	the	DT
cord-269150-d1sgnxc0	224	3	case	case	NN
cord-269150-d1sgnxc0	224	4	of	of	IN
cord-269150-d1sgnxc0	224	5	hnRNP	hnrnp	DT
cord-269150-d1sgnxc0	224	6	A1	A1	NNP
cord-269150-d1sgnxc0	224	7	,	,	,
cord-269150-d1sgnxc0	224	8	it	-PRON-	PRP
cord-269150-d1sgnxc0	224	9	was	be	VBD
cord-269150-d1sgnxc0	224	10	initially	initially	RB
cord-269150-d1sgnxc0	224	11	reported	report	VBN
cord-269150-d1sgnxc0	224	12	to	to	TO
cord-269150-d1sgnxc0	224	13	be	be	VB
cord-269150-d1sgnxc0	224	14	functionally	functionally	RB
cord-269150-d1sgnxc0	224	15	important	important	JJ
cord-269150-d1sgnxc0	224	16	for	for	IN
cord-269150-d1sgnxc0	224	17	viral	viral	JJ
cord-269150-d1sgnxc0	224	18	RNA	RNA	NNP
cord-269150-d1sgnxc0	224	19	synthesis	synthesis	NN
cord-269150-d1sgnxc0	224	20	for	for	IN
cord-269150-d1sgnxc0	224	21	group	group	NN
cord-269150-d1sgnxc0	224	22	II	II	NNP
cord-269150-d1sgnxc0	224	23	virus	virus	NN
cord-269150-d1sgnxc0	224	24	MHV	MHV	NNP
cord-269150-d1sgnxc0	224	25	(	(	-LRB-
cord-269150-d1sgnxc0	224	26	29	29	CD
cord-269150-d1sgnxc0	224	27	,	,	,
cord-269150-d1sgnxc0	224	28	30	30	CD
cord-269150-d1sgnxc0	224	29	)	)	-RRB-
cord-269150-d1sgnxc0	224	30	.	.	.
cord-269150-d1sgnxc0	225	1	Subsequently	subsequently	RB
cord-269150-d1sgnxc0	225	2	,	,	,
cord-269150-d1sgnxc0	225	3	its	-PRON-	PRP$
cord-269150-d1sgnxc0	225	4	involvement	involvement	NN
cord-269150-d1sgnxc0	225	5	in	in	IN
cord-269150-d1sgnxc0	225	6	viral	viral	JJ
cord-269150-d1sgnxc0	225	7	RNA	RNA	NNP
cord-269150-d1sgnxc0	225	8	synthesis	synthesis	NN
cord-269150-d1sgnxc0	225	9	was	be	VBD
cord-269150-d1sgnxc0	225	10	also	also	RB
cord-269150-d1sgnxc0	225	11	confirmed	confirm	VBN
cord-269150-d1sgnxc0	225	12	in	in	IN
cord-269150-d1sgnxc0	225	13	TGEV	TGEV	NNP
cord-269150-d1sgnxc0	225	14	,	,	,
cord-269150-d1sgnxc0	225	15	a	a	DT
cord-269150-d1sgnxc0	225	16	group	group	NN
cord-269150-d1sgnxc0	225	17	I	-PRON-	PRP
cord-269150-d1sgnxc0	225	18	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	225	19	(	(	-LRB-
cord-269150-d1sgnxc0	225	20	32	32	CD
cord-269150-d1sgnxc0	225	21	)	)	-RRB-
cord-269150-d1sgnxc0	225	22	.	.	.
cord-269150-d1sgnxc0	226	1	In	in	IN
cord-269150-d1sgnxc0	226	2	this	this	DT
cord-269150-d1sgnxc0	226	3	study	study	NN
cord-269150-d1sgnxc0	226	4	,	,	,
cord-269150-d1sgnxc0	226	5	we	-PRON-	PRP
cord-269150-d1sgnxc0	226	6	have	have	VBP
cord-269150-d1sgnxc0	226	7	shown	show	VBN
cord-269150-d1sgnxc0	226	8	that	that	IN
cord-269150-d1sgnxc0	226	9	betacoronaviruses	betacoronaviruses	NNP
cord-269150-d1sgnxc0	226	10	HCoV	HCoV	NNP
cord-269150-d1sgnxc0	226	11	-	-	HYPH
cord-269150-d1sgnxc0	226	12	OC43	OC43	NNP
cord-269150-d1sgnxc0	226	13	,	,	,
cord-269150-d1sgnxc0	226	14	SARS	SARS	NNP
cord-269150-d1sgnxc0	226	15	-	-	HYPH
cord-269150-d1sgnxc0	226	16	CoV	CoV	NNP
cord-269150-d1sgnxc0	226	17	and	and	CC
cord-269150-d1sgnxc0	226	18	gammacoronavirus	gammacoronavirus	NNP
cord-269150-d1sgnxc0	226	19	IBV	IBV	NNP
cord-269150-d1sgnxc0	226	20	can	can	MD
cord-269150-d1sgnxc0	226	21	bind	bind	VB
cord-269150-d1sgnxc0	226	22	to	to	IN
cord-269150-d1sgnxc0	226	23	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	226	24	,	,	,
cord-269150-d1sgnxc0	226	25	albeit	albeit	IN
cord-269150-d1sgnxc0	226	26	with	with	IN
cord-269150-d1sgnxc0	226	27	different	different	JJ
cord-269150-d1sgnxc0	226	28	affinities	affinity	NNS
cord-269150-d1sgnxc0	226	29	.	.	.
cord-269150-d1sgnxc0	227	1	Due	due	IN
cord-269150-d1sgnxc0	227	2	to	to	IN
cord-269150-d1sgnxc0	227	3	the	the	DT
cord-269150-d1sgnxc0	227	4	lack	lack	NN
cord-269150-d1sgnxc0	227	5	of	of	IN
cord-269150-d1sgnxc0	227	6	a	a	DT
cord-269150-d1sgnxc0	227	7	high	high	JJ
cord-269150-d1sgnxc0	227	8	containment	containment	NN
cord-269150-d1sgnxc0	227	9	facility	facility	NN
cord-269150-d1sgnxc0	227	10	,	,	,
cord-269150-d1sgnxc0	227	11	the	the	DT
cord-269150-d1sgnxc0	227	12	functional	functional	JJ
cord-269150-d1sgnxc0	227	13	implication	implication	NN
cord-269150-d1sgnxc0	227	14	of	of	IN
cord-269150-d1sgnxc0	227	15	the	the	DT
cord-269150-d1sgnxc0	227	16	relatively	relatively	RB
cord-269150-d1sgnxc0	227	17	weaker	weak	JJR
cord-269150-d1sgnxc0	227	18	interaction	interaction	NN
cord-269150-d1sgnxc0	227	19	between	between	IN
cord-269150-d1sgnxc0	227	20	SARS	SARS	NNP
cord-269150-d1sgnxc0	227	21	-	-	HYPH
cord-269150-d1sgnxc0	227	22	CoV	CoV	NNP
cord-269150-d1sgnxc0	227	23	5	5	CD
cord-269150-d1sgnxc0	227	24	0	0	CD
cord-269150-d1sgnxc0	227	25	-UTR	-utr	NN
cord-269150-d1sgnxc0	227	26	and	and	CC
cord-269150-d1sgnxc0	227	27	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	227	28	was	be	VBD
cord-269150-d1sgnxc0	227	29	not	not	RB
cord-269150-d1sgnxc0	227	30	further	further	RB
cord-269150-d1sgnxc0	227	31	studied	study	VBN
cord-269150-d1sgnxc0	227	32	.	.	.
cord-269150-d1sgnxc0	228	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	228	2	is	be	VBZ
cord-269150-d1sgnxc0	228	3	,	,	,
cord-269150-d1sgnxc0	228	4	therefore	therefore	RB
cord-269150-d1sgnxc0	228	5	,	,	,
cord-269150-d1sgnxc0	228	6	yet	yet	RB
cord-269150-d1sgnxc0	228	7	to	to	TO
cord-269150-d1sgnxc0	228	8	be	be	VB
cord-269150-d1sgnxc0	228	9	demonstrated	demonstrate	VBN
cord-269150-d1sgnxc0	228	10	if	if	IN
cord-269150-d1sgnxc0	228	11	this	this	DT
cord-269150-d1sgnxc0	228	12	weaker	weak	JJR
cord-269150-d1sgnxc0	228	13	binding	bind	VBG
cord-269150-d1sgnxc0	228	14	dictates	dictate	VBZ
cord-269150-d1sgnxc0	228	15	less	less	JJR
cord-269150-d1sgnxc0	228	16	dependency	dependency	NN
cord-269150-d1sgnxc0	228	17	on	on	IN
cord-269150-d1sgnxc0	228	18	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	228	19	in	in	IN
cord-269150-d1sgnxc0	228	20	SARS	SARS	NNP
cord-269150-d1sgnxc0	228	21	-	-	HYPH
cord-269150-d1sgnxc0	228	22	CoV	CoV	NNP
cord-269150-d1sgnxc0	228	23	RNA	RNA	NNP
cord-269150-d1sgnxc0	228	24	replication	replication	NN
cord-269150-d1sgnxc0	228	25	and	and	CC
cord-269150-d1sgnxc0	228	26	infectivity	infectivity	NN
cord-269150-d1sgnxc0	228	27	.	.	.
cord-269150-d1sgnxc0	229	1	Current	current	JJ
cord-269150-d1sgnxc0	229	2	evidence	evidence	NN
cord-269150-d1sgnxc0	229	3	indicates	indicate	VBZ
cord-269150-d1sgnxc0	229	4	that	that	IN
cord-269150-d1sgnxc0	229	5	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	229	6	is	be	VBZ
cord-269150-d1sgnxc0	229	7	compartmentalized	compartmentalize	VBN
cord-269150-d1sgnxc0	229	8	in	in	IN
cord-269150-d1sgnxc0	229	9	the	the	DT
cord-269150-d1sgnxc0	229	10	nuclei	nucleus	NNS
cord-269150-d1sgnxc0	229	11	of	of	IN
cord-269150-d1sgnxc0	229	12	cultured	cultured	JJ
cord-269150-d1sgnxc0	229	13	cells	cell	NNS
cord-269150-d1sgnxc0	229	14	(	(	-LRB-
cord-269150-d1sgnxc0	229	15	35	35	CD
cord-269150-d1sgnxc0	229	16	)	)	-RRB-
cord-269150-d1sgnxc0	229	17	,	,	,
cord-269150-d1sgnxc0	229	18	markedly	markedly	RB
cord-269150-d1sgnxc0	229	19	differing	differ	VBG
cord-269150-d1sgnxc0	229	20	from	from	IN
cord-269150-d1sgnxc0	229	21	the	the	DT
cord-269150-d1sgnxc0	229	22	cytoplasmic	cytoplasmic	JJ
cord-269150-d1sgnxc0	229	23	,	,	,
cord-269150-d1sgnxc0	229	24	perinuclear	perinuclear	NNP
cord-269150-d1sgnxc0	229	25	localization	localization	NN
cord-269150-d1sgnxc0	229	26	of	of	IN
cord-269150-d1sgnxc0	229	27	the	the	DT
cord-269150-d1sgnxc0	229	28	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	229	29	RTCs	rtc	NNS
cord-269150-d1sgnxc0	229	30	(	(	-LRB-
cord-269150-d1sgnxc0	229	31	47	47	CD
cord-269150-d1sgnxc0	229	32	)	)	-RRB-
cord-269150-d1sgnxc0	229	33	(	(	-LRB-
cord-269150-d1sgnxc0	229	34	48	48	CD
cord-269150-d1sgnxc0	229	35	)	)	-RRB-
cord-269150-d1sgnxc0	229	36	(	(	-LRB-
cord-269150-d1sgnxc0	229	37	49	49	CD
cord-269150-d1sgnxc0	229	38	)	)	-RRB-
cord-269150-d1sgnxc0	229	39	.	.	.
cord-269150-d1sgnxc0	230	1	As	as	IN
cord-269150-d1sgnxc0	230	2	there	there	EX
cord-269150-d1sgnxc0	230	3	was	be	VBD
cord-269150-d1sgnxc0	230	4	no	no	DT
cord-269150-d1sgnxc0	230	5	report	report	NN
cord-269150-d1sgnxc0	230	6	on	on	IN
cord-269150-d1sgnxc0	230	7	the	the	DT
cord-269150-d1sgnxc0	230	8	possibility	possibility	NN
cord-269150-d1sgnxc0	230	9	of	of	IN
cord-269150-d1sgnxc0	230	10	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	230	11	shuttling	shuttle	VBG
cord-269150-d1sgnxc0	230	12	between	between	IN
cord-269150-d1sgnxc0	230	13	the	the	DT
cord-269150-d1sgnxc0	230	14	nucleus	nucleus	NN
cord-269150-d1sgnxc0	230	15	and	and	CC
cord-269150-d1sgnxc0	230	16	cytoplasm	cytoplasm	JJ
cord-269150-d1sgnxc0	230	17	,	,	,
cord-269150-d1sgnxc0	230	18	our	-PRON-	PRP$
cord-269150-d1sgnxc0	230	19	observation	observation	NN
cord-269150-d1sgnxc0	230	20	using	use	VBG
cord-269150-d1sgnxc0	230	21	indirect	indirect	JJ
cord-269150-d1sgnxc0	230	22	immunofluorescence	immunofluorescence	NN
cord-269150-d1sgnxc0	230	23	that	that	IN
cord-269150-d1sgnxc0	230	24	over	over	RB
cord-269150-d1sgnxc0	230	25	-	-	HYPH
cord-269150-d1sgnxc0	230	26	expressed	express	VBN
cord-269150-d1sgnxc0	230	27	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	230	28	upon	upon	IN
cord-269150-d1sgnxc0	230	29	IBV	IBV	NNP
cord-269150-d1sgnxc0	230	30	infection	infection	NN
cord-269150-d1sgnxc0	230	31	became	become	VBD
cord-269150-d1sgnxc0	230	32	partially	partially	RB
cord-269150-d1sgnxc0	230	33	localized	localize	VBN
cord-269150-d1sgnxc0	230	34	in	in	IN
cord-269150-d1sgnxc0	230	35	the	the	DT
cord-269150-d1sgnxc0	230	36	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	230	37	may	may	MD
cord-269150-d1sgnxc0	230	38	represent	represent	VB
cord-269150-d1sgnxc0	230	39	a	a	DT
cord-269150-d1sgnxc0	230	40	first	first	JJ
cord-269150-d1sgnxc0	230	41	report	report	NN
cord-269150-d1sgnxc0	230	42	that	that	IN
cord-269150-d1sgnxc0	230	43	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	230	44	could	could	MD
cord-269150-d1sgnxc0	230	45	be	be	VB
cord-269150-d1sgnxc0	230	46	localized	localize	VBN
cord-269150-d1sgnxc0	230	47	outside	outside	IN
cord-269150-d1sgnxc0	230	48	the	the	DT
cord-269150-d1sgnxc0	230	49	nucleus	nucleus	NN
cord-269150-d1sgnxc0	230	50	.	.	.
cord-269150-d1sgnxc0	231	1	This	this	DT
cord-269150-d1sgnxc0	231	2	could	could	MD
cord-269150-d1sgnxc0	231	3	have	have	VB
cord-269150-d1sgnxc0	231	4	been	be	VBN
cord-269150-d1sgnxc0	231	5	achieved	achieve	VBN
cord-269150-d1sgnxc0	231	6	with	with	IN
cord-269150-d1sgnxc0	231	7	either	either	CC
cord-269150-d1sgnxc0	231	8	an	an	DT
cord-269150-d1sgnxc0	231	9	existing	exist	VBG
cord-269150-d1sgnxc0	231	10	shuttling	shuttle	VBG
cord-269150-d1sgnxc0	231	11	mechanism	mechanism	NN
cord-269150-d1sgnxc0	231	12	used	use	VBN
cord-269150-d1sgnxc0	231	13	by	by	IN
cord-269150-d1sgnxc0	231	14	a	a	DT
cord-269150-d1sgnxc0	231	15	nuclear	nuclear	JJ
cord-269150-d1sgnxc0	231	16	protein	protein	NN
cord-269150-d1sgnxc0	231	17	or	or	CC
cord-269150-d1sgnxc0	231	18	the	the	DT
cord-269150-d1sgnxc0	231	19	assistance	assistance	NN
cord-269150-d1sgnxc0	231	20	of	of	IN
cord-269150-d1sgnxc0	231	21	viral	viral	JJ
cord-269150-d1sgnxc0	231	22	factors	factor	NNS
cord-269150-d1sgnxc0	231	23	.	.	.
cord-269150-d1sgnxc0	232	1	For	for	IN
cord-269150-d1sgnxc0	232	2	example	example	NN
cord-269150-d1sgnxc0	232	3	,	,	,
cord-269150-d1sgnxc0	232	4	IBV	IBV	NNP
cord-269150-d1sgnxc0	232	5	N	N	NNP
cord-269150-d1sgnxc0	232	6	protein	protein	NN
cord-269150-d1sgnxc0	232	7	is	be	VBZ
cord-269150-d1sgnxc0	232	8	known	know	VBN
cord-269150-d1sgnxc0	232	9	to	to	TO
cord-269150-d1sgnxc0	232	10	enter	enter	VB
cord-269150-d1sgnxc0	232	11	the	the	DT
cord-269150-d1sgnxc0	232	12	nucleus	nucleus	NN
cord-269150-d1sgnxc0	232	13	while	while	IN
cord-269150-d1sgnxc0	232	14	maintaining	maintain	VBG
cord-269150-d1sgnxc0	232	15	a	a	DT
cord-269150-d1sgnxc0	232	16	predominantly	predominantly	RB
cord-269150-d1sgnxc0	232	17	cytoplasmic	cytoplasmic	JJ
cord-269150-d1sgnxc0	232	18	localization	localization	NN
cord-269150-d1sgnxc0	232	19	(	(	-LRB-
cord-269150-d1sgnxc0	232	20	50	50	CD
cord-269150-d1sgnxc0	232	21	,	,	,
cord-269150-d1sgnxc0	232	22	51	51	CD
cord-269150-d1sgnxc0	232	23	)	)	-RRB-
cord-269150-d1sgnxc0	232	24	.	.	.
cord-269150-d1sgnxc0	233	1	Alternatively	alternatively	RB
cord-269150-d1sgnxc0	233	2	,	,	,
cord-269150-d1sgnxc0	233	3	binding	bind	VBG
cord-269150-d1sgnxc0	233	4	of	of	IN
cord-269150-d1sgnxc0	233	5	viral	viral	JJ
cord-269150-d1sgnxc0	233	6	RNA	RNA	NNP
cord-269150-d1sgnxc0	233	7	may	may	MD
cord-269150-d1sgnxc0	233	8	partially	partially	RB
cord-269150-d1sgnxc0	233	9	retain	retain	VB
cord-269150-d1sgnxc0	233	10	the	the	DT
cord-269150-d1sgnxc0	233	11	newly	newly	RB
cord-269150-d1sgnxc0	233	12	synthesized	synthesize	VBN
cord-269150-d1sgnxc0	233	13	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	233	14	in	in	IN
cord-269150-d1sgnxc0	233	15	the	the	DT
cord-269150-d1sgnxc0	233	16	cytoplasm	cytoplasm	NN
cord-269150-d1sgnxc0	233	17	,	,	,
cord-269150-d1sgnxc0	233	18	as	as	IN
cord-269150-d1sgnxc0	233	19	observed	observe	VBN
cord-269150-d1sgnxc0	233	20	in	in	IN
cord-269150-d1sgnxc0	233	21	this	this	DT
cord-269150-d1sgnxc0	233	22	study	study	NN
cord-269150-d1sgnxc0	233	23	.	.	.
cord-269150-d1sgnxc0	234	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	234	2	was	be	VBD
cord-269150-d1sgnxc0	234	3	observed	observe	VBN
cord-269150-d1sgnxc0	234	4	that	that	IN
cord-269150-d1sgnxc0	234	5	over	over	IN
cord-269150-d1sgnxc0	234	6	-	-	HYPH
cord-269150-d1sgnxc0	234	7	expression	expression	NN
cord-269150-d1sgnxc0	234	8	of	of	IN
cord-269150-d1sgnxc0	234	9	Flag	Flag	NNP
cord-269150-d1sgnxc0	234	10	-	-	HYPH
cord-269150-d1sgnxc0	234	11	tagged	tagged	NNP
cord-269150-d1sgnxc0	234	12	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	234	13	was	be	VBD
cord-269150-d1sgnxc0	234	14	unable	unable	JJ
cord-269150-d1sgnxc0	234	15	to	to	TO
cord-269150-d1sgnxc0	234	16	fully	fully	RB
cord-269150-d1sgnxc0	234	17	restore	restore	VB
cord-269150-d1sgnxc0	234	18	IBV	IBV	NNP
cord-269150-d1sgnxc0	234	19	infection	infection	NN
cord-269150-d1sgnxc0	234	20	in	in	IN
cord-269150-d1sgnxc0	234	21	MADP1-knockdown	MADP1-knockdown	NNP
cord-269150-d1sgnxc0	234	22	cells	cell	NNS
cord-269150-d1sgnxc0	234	23	,	,	,
cord-269150-d1sgnxc0	234	24	even	even	RB
cord-269150-d1sgnxc0	234	25	though	though	IN
cord-269150-d1sgnxc0	234	26	the	the	DT
cord-269150-d1sgnxc0	234	27	expression	expression	NN
cord-269150-d1sgnxc0	234	28	level	level	NN
cord-269150-d1sgnxc0	234	29	of	of	IN
cord-269150-d1sgnxc0	234	30	the	the	DT
cord-269150-d1sgnxc0	234	31	introduced	introduce	VBN
cord-269150-d1sgnxc0	234	32	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	234	33	construct	construct	NN
cord-269150-d1sgnxc0	234	34	far	far	RB
cord-269150-d1sgnxc0	234	35	surpassed	surpass	VBN
cord-269150-d1sgnxc0	234	36	the	the	DT
cord-269150-d1sgnxc0	234	37	endogenous	endogenous	JJ
cord-269150-d1sgnxc0	234	38	level	level	NN
cord-269150-d1sgnxc0	234	39	,	,	,
cord-269150-d1sgnxc0	234	40	as	as	IN
cord-269150-d1sgnxc0	234	41	observed	observe	VBN
cord-269150-d1sgnxc0	234	42	by	by	IN
cord-269150-d1sgnxc0	234	43	western	western	JJ
cord-269150-d1sgnxc0	234	44	blot	blot	NN
cord-269150-d1sgnxc0	234	45	analysis	analysis	NN
cord-269150-d1sgnxc0	234	46	.	.	.
cord-269150-d1sgnxc0	235	1	Considering	consider	VBG
cord-269150-d1sgnxc0	235	2	the	the	DT
cord-269150-d1sgnxc0	235	3	fact	fact	NN
cord-269150-d1sgnxc0	235	4	that	that	IN
cord-269150-d1sgnxc0	235	5	only	only	RB
cord-269150-d1sgnxc0	235	6	30	30	CD
cord-269150-d1sgnxc0	235	7	%	%	NN
cord-269150-d1sgnxc0	235	8	of	of	IN
cord-269150-d1sgnxc0	235	9	cells	cell	NNS
cord-269150-d1sgnxc0	235	10	were	be	VBD
cord-269150-d1sgnxc0	235	11	transfected	transfecte	VBN
cord-269150-d1sgnxc0	235	12	and	and	CC
cord-269150-d1sgnxc0	235	13	over	over	RB
cord-269150-d1sgnxc0	235	14	-	-	HYPH
cord-269150-d1sgnxc0	235	15	expressed	express	VBN
cord-269150-d1sgnxc0	235	16	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	235	17	protein	protein	NN
cord-269150-d1sgnxc0	235	18	despite	despite	IN
cord-269150-d1sgnxc0	235	19	the	the	DT
cord-269150-d1sgnxc0	235	20	presence	presence	NN
cord-269150-d1sgnxc0	235	21	of	of	IN
cord-269150-d1sgnxc0	235	22	a	a	DT
cord-269150-d1sgnxc0	235	23	higher	high	JJR
cord-269150-d1sgnxc0	235	24	level	level	NN
cord-269150-d1sgnxc0	235	25	of	of	IN
cord-269150-d1sgnxc0	235	26	the	the	DT
cord-269150-d1sgnxc0	235	27	protein	protein	NN
cord-269150-d1sgnxc0	235	28	in	in	IN
cord-269150-d1sgnxc0	235	29	the	the	DT
cord-269150-d1sgnxc0	235	30	transfected	transfecte	VBN
cord-269150-d1sgnxc0	235	31	cells	cell	NNS
cord-269150-d1sgnxc0	235	32	,	,	,
cord-269150-d1sgnxc0	235	33	it	-PRON-	PRP
cord-269150-d1sgnxc0	235	34	is	be	VBZ
cord-269150-d1sgnxc0	235	35	understandable	understandable	JJ
cord-269150-d1sgnxc0	235	36	that	that	IN
cord-269150-d1sgnxc0	235	37	the	the	DT
cord-269150-d1sgnxc0	235	38	expression	expression	NN
cord-269150-d1sgnxc0	235	39	of	of	IN
cord-269150-d1sgnxc0	235	40	viral	viral	JJ
cord-269150-d1sgnxc0	235	41	proteins	protein	NNS
cord-269150-d1sgnxc0	235	42	could	could	MD
cord-269150-d1sgnxc0	235	43	not	not	RB
cord-269150-d1sgnxc0	235	44	be	be	VB
cord-269150-d1sgnxc0	235	45	restored	restore	VBN
cord-269150-d1sgnxc0	235	46	after	after	IN
cord-269150-d1sgnxc0	235	47	combining	combine	VBG
cord-269150-d1sgnxc0	235	48	both	both	CC
cord-269150-d1sgnxc0	235	49	transfected	transfecte	VBN
cord-269150-d1sgnxc0	235	50	and	and	CC
cord-269150-d1sgnxc0	235	51	untransfected	untransfected	JJ
cord-269150-d1sgnxc0	235	52	cells	cell	NNS
cord-269150-d1sgnxc0	235	53	.	.	.
cord-269150-d1sgnxc0	236	1	Interestingly	interestingly	RB
cord-269150-d1sgnxc0	236	2	,	,	,
cord-269150-d1sgnxc0	236	3	over	over	IN
cord-269150-d1sgnxc0	236	4	-	-	HYPH
cord-269150-d1sgnxc0	236	5	expression	expression	NN
cord-269150-d1sgnxc0	236	6	of	of	IN
cord-269150-d1sgnxc0	236	7	silencing	silencing	NN
cord-269150-d1sgnxc0	236	8	-	-	HYPH
cord-269150-d1sgnxc0	236	9	sensitive	sensitive	JJ
cord-269150-d1sgnxc0	236	10	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	236	11	was	be	VBD
cord-269150-d1sgnxc0	236	12	unable	unable	JJ
cord-269150-d1sgnxc0	236	13	to	to	TO
cord-269150-d1sgnxc0	236	14	cause	cause	VB
cord-269150-d1sgnxc0	236	15	an	an	DT
cord-269150-d1sgnxc0	236	16	increase	increase	NN
cord-269150-d1sgnxc0	236	17	in	in	IN
cord-269150-d1sgnxc0	236	18	virus	virus	NN
cord-269150-d1sgnxc0	236	19	infection	infection	NN
cord-269150-d1sgnxc0	236	20	,	,	,
cord-269150-d1sgnxc0	236	21	comparing	compare	VBG
cord-269150-d1sgnxc0	236	22	to	to	IN
cord-269150-d1sgnxc0	236	23	that	that	DT
cord-269150-d1sgnxc0	236	24	was	be	VBD
cord-269150-d1sgnxc0	236	25	observed	observe	VBN
cord-269150-d1sgnxc0	236	26	for	for	IN
cord-269150-d1sgnxc0	236	27	silencingresistant	silencingresistant	NNP
cord-269150-d1sgnxc0	237	1	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	238	1	(	(	-LRB-
cord-269150-d1sgnxc0	238	2	FMmut	FMmut	NNP
cord-269150-d1sgnxc0	238	3	)	)	-RRB-
cord-269150-d1sgnxc0	238	4	in	in	IN
cord-269150-d1sgnxc0	238	5	shMadp1	shMadp1	NNP
cord-269150-d1sgnxc0	238	6	cells	cell	NNS
cord-269150-d1sgnxc0	238	7	,	,	,
cord-269150-d1sgnxc0	238	8	even	even	RB
cord-269150-d1sgnxc0	238	9	though	though	IN
cord-269150-d1sgnxc0	238	10	their	-PRON-	PRP$
cord-269150-d1sgnxc0	238	11	expression	expression	NN
cord-269150-d1sgnxc0	238	12	levels	level	NNS
cord-269150-d1sgnxc0	238	13	were	be	VBD
cord-269150-d1sgnxc0	238	14	comparable	comparable	JJ
cord-269150-d1sgnxc0	238	15	.	.	.
cord-269150-d1sgnxc0	239	1	This	this	DT
cord-269150-d1sgnxc0	239	2	lends	lend	VBZ
cord-269150-d1sgnxc0	239	3	further	further	JJ
cord-269150-d1sgnxc0	239	4	support	support	NN
cord-269150-d1sgnxc0	239	5	to	to	IN
cord-269150-d1sgnxc0	239	6	the	the	DT
cord-269150-d1sgnxc0	239	7	conclusion	conclusion	NN
cord-269150-d1sgnxc0	239	8	that	that	IN
cord-269150-d1sgnxc0	239	9	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	239	10	is	be	VBZ
cord-269150-d1sgnxc0	239	11	actively	actively	RB
cord-269150-d1sgnxc0	239	12	involved	involve	VBN
cord-269150-d1sgnxc0	239	13	in	in	IN
cord-269150-d1sgnxc0	239	14	the	the	DT
cord-269150-d1sgnxc0	239	15	replication	replication	NN
cord-269150-d1sgnxc0	239	16	and	and	CC
cord-269150-d1sgnxc0	239	17	infectivity	infectivity	NN
cord-269150-d1sgnxc0	239	18	of	of	IN
cord-269150-d1sgnxc0	239	19	IBV	IBV	NNP
cord-269150-d1sgnxc0	239	20	.	.	.
cord-269150-d1sgnxc0	240	1	Although	although	IN
cord-269150-d1sgnxc0	240	2	the	the	DT
cord-269150-d1sgnxc0	240	3	functional	functional	JJ
cord-269150-d1sgnxc0	240	4	studies	study	NNS
cord-269150-d1sgnxc0	240	5	involving	involve	VBG
cord-269150-d1sgnxc0	240	6	IBV	IBV	NNP
cord-269150-d1sgnxc0	240	7	,	,	,
cord-269150-d1sgnxc0	240	8	a	a	DT
cord-269150-d1sgnxc0	240	9	chicken	chicken	NN
cord-269150-d1sgnxc0	240	10	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	240	11	,	,	,
cord-269150-d1sgnxc0	240	12	and	and	CC
cord-269150-d1sgnxc0	240	13	a	a	DT
cord-269150-d1sgnxc0	240	14	human	human	JJ
cord-269150-d1sgnxc0	240	15	protein	protein	NN
cord-269150-d1sgnxc0	240	16	,	,	,
cord-269150-d1sgnxc0	240	17	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	240	18	,	,	,
cord-269150-d1sgnxc0	240	19	were	be	VBD
cord-269150-d1sgnxc0	240	20	conducted	conduct	VBN
cord-269150-d1sgnxc0	240	21	using	use	VBG
cord-269150-d1sgnxc0	240	22	human	human	JJ
cord-269150-d1sgnxc0	240	23	and	and	CC
cord-269150-d1sgnxc0	240	24	African	african	JJ
cord-269150-d1sgnxc0	240	25	green	green	JJ
cord-269150-d1sgnxc0	240	26	monkey	monkey	NN
cord-269150-d1sgnxc0	240	27	cells	cell	NNS
cord-269150-d1sgnxc0	240	28	,	,	,
cord-269150-d1sgnxc0	240	29	which	which	WDT
cord-269150-d1sgnxc0	240	30	were	be	VBD
cord-269150-d1sgnxc0	240	31	non	non	JJ
cord-269150-d1sgnxc0	240	32	-	-	JJ
cord-269150-d1sgnxc0	240	33	native	native	JJ
cord-269150-d1sgnxc0	240	34	.	.	.
cord-269150-d1sgnxc0	241	1	It	-PRON-	PRP
cord-269150-d1sgnxc0	241	2	is	be	VBZ
cord-269150-d1sgnxc0	241	3	noteworthy	noteworthy	JJ
cord-269150-d1sgnxc0	241	4	that	that	IN
cord-269150-d1sgnxc0	241	5	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	242	1	(	(	-LRB-
cord-269150-d1sgnxc0	242	2	HomoloGene	HomoloGene	NNP
cord-269150-d1sgnxc0	242	3	12095	12095	CD
cord-269150-d1sgnxc0	242	4	)	)	-RRB-
cord-269150-d1sgnxc0	242	5	is	be	VBZ
cord-269150-d1sgnxc0	242	6	conserved	conserve	VBN
cord-269150-d1sgnxc0	242	7	in	in	IN
cord-269150-d1sgnxc0	242	8	humans	human	NNS
cord-269150-d1sgnxc0	242	9	(	(	-LRB-
cord-269150-d1sgnxc0	242	10	Homo	Homo	NNP
cord-269150-d1sgnxc0	242	11	sapiens	sapiens	JJ
cord-269150-d1sgnxc0	242	12	)	)	-RRB-
cord-269150-d1sgnxc0	242	13	,	,	,
cord-269150-d1sgnxc0	242	14	chimpanzees	chimpanzee	NNS
cord-269150-d1sgnxc0	242	15	(	(	-LRB-
cord-269150-d1sgnxc0	242	16	Pan	Pan	NNP
cord-269150-d1sgnxc0	242	17	troglodytes	troglodyte	NNS
cord-269150-d1sgnxc0	242	18	)	)	-RRB-
cord-269150-d1sgnxc0	242	19	,	,	,
cord-269150-d1sgnxc0	242	20	wolves	wolf	NNS
cord-269150-d1sgnxc0	242	21	(	(	-LRB-
cord-269150-d1sgnxc0	242	22	Canis	Canis	NNP
cord-269150-d1sgnxc0	242	23	lupus	lupus	NN
cord-269150-d1sgnxc0	242	24	)	)	-RRB-
cord-269150-d1sgnxc0	242	25	,	,	,
cord-269150-d1sgnxc0	242	26	cattle	cattle	NNS
cord-269150-d1sgnxc0	242	27	(	(	-LRB-
cord-269150-d1sgnxc0	242	28	Bos	Bos	NNP
cord-269150-d1sgnxc0	242	29	Taurus	Taurus	NNP
cord-269150-d1sgnxc0	242	30	)	)	-RRB-
cord-269150-d1sgnxc0	242	31	,	,	,
cord-269150-d1sgnxc0	242	32	mice	mouse	NNS
cord-269150-d1sgnxc0	242	33	(	(	-LRB-
cord-269150-d1sgnxc0	242	34	Mus	Mus	NNP
cord-269150-d1sgnxc0	242	35	musculus	musculus	NN
cord-269150-d1sgnxc0	242	36	)	)	-RRB-
cord-269150-d1sgnxc0	242	37	,	,	,
cord-269150-d1sgnxc0	242	38	rats	rat	NNS
cord-269150-d1sgnxc0	242	39	(	(	-LRB-
cord-269150-d1sgnxc0	242	40	Rattus	Rattus	NNP
cord-269150-d1sgnxc0	242	41	norvegicus	norvegicus	NN
cord-269150-d1sgnxc0	242	42	)	)	-RRB-
cord-269150-d1sgnxc0	242	43	and	and	CC
cord-269150-d1sgnxc0	242	44	chickens	chicken	NNS
cord-269150-d1sgnxc0	242	45	(	(	-LRB-
cord-269150-d1sgnxc0	242	46	Gallus	Gallus	NNP
cord-269150-d1sgnxc0	242	47	gallus	gallus	NN
cord-269150-d1sgnxc0	242	48	)	)	-RRB-
cord-269150-d1sgnxc0	242	49	.	.	.
cord-269150-d1sgnxc0	243	1	The	the	DT
cord-269150-d1sgnxc0	243	2	African	african	JJ
cord-269150-d1sgnxc0	243	3	green	green	JJ
cord-269150-d1sgnxc0	243	4	monkey	monkey	NN
cord-269150-d1sgnxc0	243	5	genome	genome	NN
cord-269150-d1sgnxc0	243	6	is	be	VBZ
cord-269150-d1sgnxc0	243	7	not	not	RB
cord-269150-d1sgnxc0	243	8	available	available	JJ
cord-269150-d1sgnxc0	243	9	at	at	IN
cord-269150-d1sgnxc0	243	10	NCBI	NCBI	NNP
cord-269150-d1sgnxc0	243	11	,	,	,
cord-269150-d1sgnxc0	243	12	but	but	CC
cord-269150-d1sgnxc0	243	13	an	an	DT
cord-269150-d1sgnxc0	243	14	alignment	alignment	NN
cord-269150-d1sgnxc0	243	15	search	search	NN
cord-269150-d1sgnxc0	243	16	using	use	VBG
cord-269150-d1sgnxc0	243	17	basic	basic	JJ
cord-269150-d1sgnxc0	243	18	local	local	JJ
cord-269150-d1sgnxc0	243	19	alignment	alignment	NN
cord-269150-d1sgnxc0	243	20	search	search	NN
cord-269150-d1sgnxc0	243	21	tool	tool	NN
cord-269150-d1sgnxc0	243	22	(	(	-LRB-
cord-269150-d1sgnxc0	243	23	BLAST	blast	NN
cord-269150-d1sgnxc0	243	24	)	)	-RRB-
cord-269150-d1sgnxc0	243	25	of	of	IN
cord-269150-d1sgnxc0	243	26	the	the	DT
cord-269150-d1sgnxc0	243	27	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	243	28	amino	amino	NN
cord-269150-d1sgnxc0	243	29	acid	acid	NN
cord-269150-d1sgnxc0	243	30	sequence	sequence	NN
cord-269150-d1sgnxc0	243	31	against	against	IN
cord-269150-d1sgnxc0	243	32	the	the	DT
cord-269150-d1sgnxc0	243	33	rhesus	rhesus	NN
cord-269150-d1sgnxc0	243	34	macaque	macaque	NN
cord-269150-d1sgnxc0	243	35	(	(	-LRB-
cord-269150-d1sgnxc0	243	36	Macaca	Macaca	NNP
cord-269150-d1sgnxc0	243	37	mulatta	mulatta	NN
cord-269150-d1sgnxc0	243	38	)	)	-RRB-
cord-269150-d1sgnxc0	244	1	RefSeq	RefSeq	NNP
cord-269150-d1sgnxc0	244	2	Protein	Protein	NNP
cord-269150-d1sgnxc0	244	3	library	library	NN
cord-269150-d1sgnxc0	244	4	yields	yield	VBZ
cord-269150-d1sgnxc0	244	5	a	a	DT
cord-269150-d1sgnxc0	244	6	99	99	CD
cord-269150-d1sgnxc0	244	7	%	%	NN
cord-269150-d1sgnxc0	244	8	sequence	sequence	NN
cord-269150-d1sgnxc0	244	9	similarity	similarity	NN
cord-269150-d1sgnxc0	244	10	between	between	IN
cord-269150-d1sgnxc0	244	11	the	the	DT
cord-269150-d1sgnxc0	244	12	two	two	CD
cord-269150-d1sgnxc0	244	13	species	specie	NNS
cord-269150-d1sgnxc0	244	14	.	.	.
cord-269150-d1sgnxc0	245	1	The	the	DT
cord-269150-d1sgnxc0	245	2	chicken	chicken	NN
cord-269150-d1sgnxc0	245	3	homolog	homolog	NN
cord-269150-d1sgnxc0	245	4	,	,	,
cord-269150-d1sgnxc0	245	5	on	on	IN
cord-269150-d1sgnxc0	245	6	the	the	DT
cord-269150-d1sgnxc0	245	7	other	other	JJ
cord-269150-d1sgnxc0	245	8	hand	hand	NN
cord-269150-d1sgnxc0	245	9	,	,	,
cord-269150-d1sgnxc0	245	10	bears	bear	VBZ
cord-269150-d1sgnxc0	245	11	85	85	CD
cord-269150-d1sgnxc0	245	12	%	%	NN
cord-269150-d1sgnxc0	245	13	amino	amino	NN
cord-269150-d1sgnxc0	245	14	acid	acid	NN
cord-269150-d1sgnxc0	245	15	sequence	sequence	NN
cord-269150-d1sgnxc0	245	16	similarity	similarity	NN
cord-269150-d1sgnxc0	245	17	,	,	,
cord-269150-d1sgnxc0	245	18	but	but	CC
cord-269150-d1sgnxc0	245	19	with	with	IN
cord-269150-d1sgnxc0	245	20	an	an	DT
cord-269150-d1sgnxc0	245	21	almost	almost	RB
cord-269150-d1sgnxc0	245	22	identical	identical	JJ
cord-269150-d1sgnxc0	245	23	match	match	NN
cord-269150-d1sgnxc0	245	24	in	in	IN
cord-269150-d1sgnxc0	245	25	the	the	DT
cord-269150-d1sgnxc0	245	26	N	n	CD
cord-269150-d1sgnxc0	245	27	-	-	HYPH
cord-269150-d1sgnxc0	245	28	terminal	terminal	NN
cord-269150-d1sgnxc0	245	29	120	120	CD
cord-269150-d1sgnxc0	245	30	amino	amino	NN
cord-269150-d1sgnxc0	245	31	acids	acid	NNS
cord-269150-d1sgnxc0	245	32	,	,	,
cord-269150-d1sgnxc0	245	33	to	to	IN
cord-269150-d1sgnxc0	245	34	the	the	DT
cord-269150-d1sgnxc0	245	35	human	human	JJ
cord-269150-d1sgnxc0	245	36	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	245	37	protein	protein	NN
cord-269150-d1sgnxc0	245	38	.	.	.
cord-269150-d1sgnxc0	246	1	As	as	IN
cord-269150-d1sgnxc0	246	2	the	the	DT
cord-269150-d1sgnxc0	246	3	predicted	predict	VBN
cord-269150-d1sgnxc0	246	4	interaction	interaction	NN
cord-269150-d1sgnxc0	246	5	domain	domain	NN
cord-269150-d1sgnxc0	246	6	lies	lie	VBZ
cord-269150-d1sgnxc0	246	7	in	in	IN
cord-269150-d1sgnxc0	246	8	the	the	DT
cord-269150-d1sgnxc0	246	9	N	N	NNP
cord-269150-d1sgnxc0	246	10	-	-	HYPH
cord-269150-d1sgnxc0	246	11	terminus	terminus	NN
cord-269150-d1sgnxc0	246	12	,	,	,
cord-269150-d1sgnxc0	246	13	it	-PRON-	PRP
cord-269150-d1sgnxc0	246	14	is	be	VBZ
cord-269150-d1sgnxc0	246	15	highly	highly	RB
cord-269150-d1sgnxc0	246	16	likely	likely	JJ
cord-269150-d1sgnxc0	246	17	that	that	IN
cord-269150-d1sgnxc0	246	18	the	the	DT
cord-269150-d1sgnxc0	246	19	homologs	homolog	NNS
cord-269150-d1sgnxc0	246	20	from	from	IN
cord-269150-d1sgnxc0	246	21	other	other	JJ
cord-269150-d1sgnxc0	246	22	species	specie	NNS
cord-269150-d1sgnxc0	246	23	could	could	MD
cord-269150-d1sgnxc0	246	24	replace	replace	VB
cord-269150-d1sgnxc0	246	25	human	human	JJ
cord-269150-d1sgnxc0	246	26	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	246	27	in	in	IN
cord-269150-d1sgnxc0	246	28	the	the	DT
cord-269150-d1sgnxc0	246	29	interaction	interaction	NN
cord-269150-d1sgnxc0	246	30	studies	study	NNS
cord-269150-d1sgnxc0	246	31	.	.	.
cord-269150-d1sgnxc0	247	1	In	in	IN
cord-269150-d1sgnxc0	247	2	conclusion	conclusion	NN
cord-269150-d1sgnxc0	247	3	,	,	,
cord-269150-d1sgnxc0	247	4	the	the	DT
cord-269150-d1sgnxc0	247	5	involvement	involvement	NN
cord-269150-d1sgnxc0	247	6	of	of	IN
cord-269150-d1sgnxc0	247	7	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	247	8	in	in	IN
cord-269150-d1sgnxc0	247	9	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	247	10	RNA	RNA	NNP
cord-269150-d1sgnxc0	247	11	synthesis	synthesis	NN
cord-269150-d1sgnxc0	247	12	and	and	CC
cord-269150-d1sgnxc0	247	13	its	-PRON-	PRP$
cord-269150-d1sgnxc0	247	14	significance	significance	NN
cord-269150-d1sgnxc0	247	15	are	be	VBP
cord-269150-d1sgnxc0	247	16	demonstrated	demonstrate	VBN
cord-269150-d1sgnxc0	247	17	in	in	IN
cord-269150-d1sgnxc0	247	18	this	this	DT
cord-269150-d1sgnxc0	247	19	study	study	NN
cord-269150-d1sgnxc0	247	20	in	in	IN
cord-269150-d1sgnxc0	247	21	the	the	DT
cord-269150-d1sgnxc0	247	22	tissue	tissue	NN
cord-269150-d1sgnxc0	247	23	culture	culture	NN
cord-269150-d1sgnxc0	247	24	system	system	NN
cord-269150-d1sgnxc0	247	25	.	.	.
cord-269150-d1sgnxc0	248	1	Further	further	JJ
cord-269150-d1sgnxc0	248	2	studies	study	NNS
cord-269150-d1sgnxc0	248	3	with	with	IN
cord-269150-d1sgnxc0	248	4	an	an	DT
cord-269150-d1sgnxc0	248	5	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	248	6	knock	knock	VB
cord-269150-d1sgnxc0	248	7	-	-	HYPH
cord-269150-d1sgnxc0	248	8	out	out	RP
cord-269150-d1sgnxc0	248	9	animal	animal	NN
cord-269150-d1sgnxc0	248	10	system	system	NN
cord-269150-d1sgnxc0	248	11	,	,	,
cord-269150-d1sgnxc0	248	12	which	which	WDT
cord-269150-d1sgnxc0	248	13	is	be	VBZ
cord-269150-d1sgnxc0	248	14	currently	currently	RB
cord-269150-d1sgnxc0	248	15	not	not	RB
cord-269150-d1sgnxc0	248	16	available	available	JJ
cord-269150-d1sgnxc0	248	17	,	,	,
cord-269150-d1sgnxc0	248	18	would	would	MD
cord-269150-d1sgnxc0	248	19	be	be	VB
cord-269150-d1sgnxc0	248	20	required	require	VBN
cord-269150-d1sgnxc0	248	21	to	to	TO
cord-269150-d1sgnxc0	248	22	confirm	confirm	VB
cord-269150-d1sgnxc0	248	23	further	further	RB
cord-269150-d1sgnxc0	248	24	the	the	DT
cord-269150-d1sgnxc0	248	25	involvement	involvement	NN
cord-269150-d1sgnxc0	248	26	of	of	IN
cord-269150-d1sgnxc0	248	27	MADP1	MADP1	NNP
cord-269150-d1sgnxc0	248	28	in	in	IN
cord-269150-d1sgnxc0	248	29	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	248	30	RNA	RNA	NNP
cord-269150-d1sgnxc0	248	31	synthesis	synthesis	NN
cord-269150-d1sgnxc0	248	32	.	.	.
cord-269150-d1sgnxc0	248	33	 	 	_SP
cord-269150-d1sgnxc0	249	1	Human	human	JJ
cord-269150-d1sgnxc0	249	2	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	250	1	NL63	NL63	NNP
cord-269150-d1sgnxc0	250	2	employs	employ	VBZ
cord-269150-d1sgnxc0	250	3	the	the	DT
cord-269150-d1sgnxc0	250	4	severe	severe	JJ
cord-269150-d1sgnxc0	250	5	acute	acute	JJ
cord-269150-d1sgnxc0	250	6	respiratory	respiratory	JJ
cord-269150-d1sgnxc0	250	7	syndrome	syndrome	NN
cord-269150-d1sgnxc0	250	8	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	250	9	receptor	receptor	NN
cord-269150-d1sgnxc0	250	10	for	for	IN
cord-269150-d1sgnxc0	250	11	cellular	cellular	JJ
cord-269150-d1sgnxc0	250	12	entry	entry	NN
cord-269150-d1sgnxc0	251	1	Angiotensin	angiotensin	NN
cord-269150-d1sgnxc0	251	2	-	-	HYPH
cord-269150-d1sgnxc0	251	3	converting	convert	VBG
cord-269150-d1sgnxc0	251	4	enzyme	enzyme	NN
cord-269150-d1sgnxc0	251	5	2	2	CD
cord-269150-d1sgnxc0	251	6	is	be	VBZ
cord-269150-d1sgnxc0	251	7	a	a	DT
cord-269150-d1sgnxc0	251	8	functional	functional	JJ
cord-269150-d1sgnxc0	251	9	receptor	receptor	NN
cord-269150-d1sgnxc0	251	10	for	for	IN
cord-269150-d1sgnxc0	251	11	the	the	DT
cord-269150-d1sgnxc0	251	12	SARS	SARS	NNP
cord-269150-d1sgnxc0	251	13	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	252	1	A	a	DT
cord-269150-d1sgnxc0	252	2	transmembrane	transmembrane	NN
cord-269150-d1sgnxc0	252	3	serine	serine	NN
cord-269150-d1sgnxc0	252	4	protease	protease	NN
cord-269150-d1sgnxc0	252	5	is	be	VBZ
cord-269150-d1sgnxc0	252	6	linked	link	VBN
cord-269150-d1sgnxc0	252	7	to	to	IN
cord-269150-d1sgnxc0	252	8	the	the	DT
cord-269150-d1sgnxc0	252	9	severe	severe	JJ
cord-269150-d1sgnxc0	252	10	acute	acute	JJ
cord-269150-d1sgnxc0	252	11	respiratory	respiratory	JJ
cord-269150-d1sgnxc0	252	12	syndrome	syndrome	NN
cord-269150-d1sgnxc0	252	13	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	252	14	receptor	receptor	NN
cord-269150-d1sgnxc0	252	15	and	and	CC
cord-269150-d1sgnxc0	252	16	activates	activate	VBZ
cord-269150-d1sgnxc0	252	17	virus	virus	NN
cord-269150-d1sgnxc0	252	18	entry	entry	NN
cord-269150-d1sgnxc0	252	19	Crystal	Crystal	NNP
cord-269150-d1sgnxc0	252	20	structure	structure	NN
cord-269150-d1sgnxc0	252	21	of	of	IN
cord-269150-d1sgnxc0	252	22	NL63	NL63	NNP
cord-269150-d1sgnxc0	252	23	respiratory	respiratory	JJ
cord-269150-d1sgnxc0	252	24	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	252	25	receptor	receptor	NN
cord-269150-d1sgnxc0	252	26	-	-	HYPH
cord-269150-d1sgnxc0	252	27	binding	bind	VBG
cord-269150-d1sgnxc0	252	28	domain	domain	NN
cord-269150-d1sgnxc0	252	29	complexed	complexe	VBN
cord-269150-d1sgnxc0	252	30	with	with	IN
cord-269150-d1sgnxc0	252	31	its	-PRON-	PRP$
cord-269150-d1sgnxc0	252	32	human	human	JJ
cord-269150-d1sgnxc0	252	33	receptor	receptor	NN
cord-269150-d1sgnxc0	252	34	Proteolytic	Proteolytic	NNP
cord-269150-d1sgnxc0	252	35	activation	activation	NN
cord-269150-d1sgnxc0	252	36	of	of	IN
cord-269150-d1sgnxc0	252	37	the	the	DT
cord-269150-d1sgnxc0	252	38	spike	spike	NN
cord-269150-d1sgnxc0	252	39	protein	protein	NN
cord-269150-d1sgnxc0	252	40	at	at	IN
cord-269150-d1sgnxc0	252	41	a	a	DT
cord-269150-d1sgnxc0	252	42	novel	novel	NN
cord-269150-d1sgnxc0	252	43	RRRR	RRRR	NNP
cord-269150-d1sgnxc0	252	44	/	/	SYM
cord-269150-d1sgnxc0	252	45	S	s	NN
cord-269150-d1sgnxc0	252	46	motif	motif	NN
cord-269150-d1sgnxc0	252	47	is	be	VBZ
cord-269150-d1sgnxc0	252	48	implicated	implicate	VBN
cord-269150-d1sgnxc0	252	49	in	in	IN
cord-269150-d1sgnxc0	252	50	furin	furin	NN
cord-269150-d1sgnxc0	252	51	-	-	HYPH
cord-269150-d1sgnxc0	252	52	dependent	dependent	JJ
cord-269150-d1sgnxc0	252	53	entry	entry	NN
cord-269150-d1sgnxc0	252	54	,	,	,
cord-269150-d1sgnxc0	252	55	syncytium	syncytium	NN
cord-269150-d1sgnxc0	252	56	formation	formation	NN
cord-269150-d1sgnxc0	252	57	,	,	,
cord-269150-d1sgnxc0	252	58	and	and	CC
cord-269150-d1sgnxc0	252	59	infectivity	infectivity	NN
cord-269150-d1sgnxc0	252	60	of	of	IN
cord-269150-d1sgnxc0	252	61	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	252	62	infectious	infectious	JJ
cord-269150-d1sgnxc0	252	63	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	252	64	virus	virus	NN
cord-269150-d1sgnxc0	252	65	in	in	IN
cord-269150-d1sgnxc0	252	66	cultured	cultured	JJ
cord-269150-d1sgnxc0	252	67	cells	cell	NNS
cord-269150-d1sgnxc0	252	68	Acquisition	Acquisition	NNP
cord-269150-d1sgnxc0	252	69	of	of	IN
cord-269150-d1sgnxc0	252	70	cell	cell	NN
cord-269150-d1sgnxc0	252	71	-	-	HYPH
cord-269150-d1sgnxc0	252	72	cell	cell	NN
cord-269150-d1sgnxc0	252	73	fusion	fusion	NN
cord-269150-d1sgnxc0	252	74	activity	activity	NN
cord-269150-d1sgnxc0	252	75	by	by	IN
cord-269150-d1sgnxc0	252	76	amino	amino	NN
cord-269150-d1sgnxc0	252	77	acid	acid	NN
cord-269150-d1sgnxc0	252	78	substitutions	substitution	NNS
cord-269150-d1sgnxc0	252	79	in	in	IN
cord-269150-d1sgnxc0	252	80	spike	spike	NN
cord-269150-d1sgnxc0	252	81	protein	protein	NN
cord-269150-d1sgnxc0	252	82	determines	determine	VBZ
cord-269150-d1sgnxc0	252	83	the	the	DT
cord-269150-d1sgnxc0	252	84	infectivity	infectivity	NN
cord-269150-d1sgnxc0	252	85	of	of	IN
cord-269150-d1sgnxc0	252	86	a	a	DT
cord-269150-d1sgnxc0	252	87	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	252	88	in	in	IN
cord-269150-d1sgnxc0	252	89	cultured	cultured	JJ
cord-269150-d1sgnxc0	252	90	cells	cell	NNS
cord-269150-d1sgnxc0	252	91	Coronavirus	Coronavirus	NNP
cord-269150-d1sgnxc0	252	92	genome	genome	NN
cord-269150-d1sgnxc0	252	93	structure	structure	NN
cord-269150-d1sgnxc0	252	94	and	and	CC
cord-269150-d1sgnxc0	252	95	replication	replication	NN
cord-269150-d1sgnxc0	253	1	The	the	DT
cord-269150-d1sgnxc0	253	2	role	role	NN
cord-269150-d1sgnxc0	253	3	of	of	IN
cord-269150-d1sgnxc0	253	4	programmed-1	programmed-1	NNP
cord-269150-d1sgnxc0	253	5	ribosomal	ribosomal	JJ
cord-269150-d1sgnxc0	253	6	frameshifting	frameshifte	VBG
cord-269150-d1sgnxc0	253	7	in	in	IN
cord-269150-d1sgnxc0	253	8	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	253	9	propagation	propagation	NN
cord-269150-d1sgnxc0	253	10	Identification	Identification	NNP
cord-269150-d1sgnxc0	253	11	of	of	IN
cord-269150-d1sgnxc0	253	12	heptaand	heptaand	NN
cord-269150-d1sgnxc0	253	13	octo	octo	NN
cord-269150-d1sgnxc0	253	14	-	-	HYPH
cord-269150-d1sgnxc0	253	15	uridine	uridine	NNP
cord-269150-d1sgnxc0	253	16	stretches	stretch	VBZ
cord-269150-d1sgnxc0	253	17	as	as	IN
cord-269150-d1sgnxc0	253	18	sole	sole	JJ
cord-269150-d1sgnxc0	253	19	signals	signal	NNS
cord-269150-d1sgnxc0	253	20	for	for	IN
cord-269150-d1sgnxc0	253	21	programmed	program	VBN
cord-269150-d1sgnxc0	253	22	+1	+1	NNS
cord-269150-d1sgnxc0	253	23	and	and	CC
cord-269150-d1sgnxc0	253	24	-1	-1	NN
cord-269150-d1sgnxc0	253	25	ribosomal	ribosomal	JJ
cord-269150-d1sgnxc0	253	26	frameshifting	frameshifte	VBG
cord-269150-d1sgnxc0	253	27	during	during	IN
cord-269150-d1sgnxc0	253	28	translation	translation	NN
cord-269150-d1sgnxc0	253	29	of	of	IN
cord-269150-d1sgnxc0	253	30	SARS	SARS	NNP
cord-269150-d1sgnxc0	253	31	-	-	HYPH
cord-269150-d1sgnxc0	253	32	CoV	CoV	NNP
cord-269150-d1sgnxc0	253	33	ORF	ORF	NNP
cord-269150-d1sgnxc0	253	34	3a	3a	CD
cord-269150-d1sgnxc0	253	35	variants	variant	NNS
cord-269150-d1sgnxc0	254	1	A	a	DT
cord-269150-d1sgnxc0	254	2	mechanical	mechanical	JJ
cord-269150-d1sgnxc0	254	3	explanation	explanation	NN
cord-269150-d1sgnxc0	254	4	of	of	IN
cord-269150-d1sgnxc0	254	5	RNA	RNA	NNP
cord-269150-d1sgnxc0	254	6	pseudoknot	pseudoknot	NNP
cord-269150-d1sgnxc0	254	7	function	function	VB
cord-269150-d1sgnxc0	254	8	in	in	IN
cord-269150-d1sgnxc0	254	9	programmed	program	VBN
cord-269150-d1sgnxc0	254	10	ribosomal	ribosomal	JJ
cord-269150-d1sgnxc0	254	11	frameshifting	frameshifte	VBG
cord-269150-d1sgnxc0	254	12	Virus	virus	NN
cord-269150-d1sgnxc0	254	13	-	-	HYPH
cord-269150-d1sgnxc0	254	14	encoded	encode	VBN
cord-269150-d1sgnxc0	254	15	proteinases	proteinase	NNS
cord-269150-d1sgnxc0	254	16	and	and	CC
cord-269150-d1sgnxc0	254	17	proteolytic	proteolytic	JJ
cord-269150-d1sgnxc0	254	18	processing	processing	NN
cord-269150-d1sgnxc0	254	19	in	in	IN
cord-269150-d1sgnxc0	254	20	the	the	DT
cord-269150-d1sgnxc0	254	21	Nidovirales	Nidovirales	NNP
cord-269150-d1sgnxc0	255	1	An	an	DT
cord-269150-d1sgnxc0	255	2	arginine	arginine	NN
cord-269150-d1sgnxc0	255	3	-	-	HYPH
cord-269150-d1sgnxc0	255	4	to	to	IN
cord-269150-d1sgnxc0	255	5	-	-	HYPH
cord-269150-d1sgnxc0	255	6	proline	proline	NN
cord-269150-d1sgnxc0	255	7	mutation	mutation	NN
cord-269150-d1sgnxc0	255	8	in	in	IN
cord-269150-d1sgnxc0	255	9	a	a	DT
cord-269150-d1sgnxc0	255	10	domain	domain	NN
cord-269150-d1sgnxc0	255	11	with	with	IN
cord-269150-d1sgnxc0	255	12	undefined	undefined	JJ
cord-269150-d1sgnxc0	255	13	functions	function	NNS
cord-269150-d1sgnxc0	255	14	within	within	IN
cord-269150-d1sgnxc0	255	15	the	the	DT
cord-269150-d1sgnxc0	255	16	helicase	helicase	NN
cord-269150-d1sgnxc0	255	17	protein	protein	NN
cord-269150-d1sgnxc0	255	18	(	(	-LRB-
cord-269150-d1sgnxc0	255	19	Nsp13	Nsp13	NNP
cord-269150-d1sgnxc0	255	20	)	)	-RRB-
cord-269150-d1sgnxc0	255	21	is	be	VBZ
cord-269150-d1sgnxc0	255	22	lethal	lethal	JJ
cord-269150-d1sgnxc0	255	23	to	to	IN
cord-269150-d1sgnxc0	255	24	the	the	DT
cord-269150-d1sgnxc0	255	25	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	255	26	infectious	infectious	JJ
cord-269150-d1sgnxc0	255	27	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	255	28	virus	virus	NN
cord-269150-d1sgnxc0	255	29	in	in	IN
cord-269150-d1sgnxc0	255	30	cultured	cultured	JJ
cord-269150-d1sgnxc0	255	31	cells	cell	NNS
cord-269150-d1sgnxc0	255	32	Proteolytic	proteolytic	JJ
cord-269150-d1sgnxc0	255	33	processing	processing	NN
cord-269150-d1sgnxc0	255	34	of	of	IN
cord-269150-d1sgnxc0	255	35	polyproteins	polyproteins	NNP
cord-269150-d1sgnxc0	255	36	1a	1a	NNP
cord-269150-d1sgnxc0	255	37	and	and	CC
cord-269150-d1sgnxc0	255	38	1ab	1ab	CD
cord-269150-d1sgnxc0	255	39	between	between	IN
cord-269150-d1sgnxc0	255	40	non	non	JJ
cord-269150-d1sgnxc0	255	41	-	-	JJ
cord-269150-d1sgnxc0	255	42	structural	structural	JJ
cord-269150-d1sgnxc0	255	43	proteins	protein	NNS
cord-269150-d1sgnxc0	255	44	10	10	CD
cord-269150-d1sgnxc0	255	45	and	and	CC
cord-269150-d1sgnxc0	255	46	11/12	11/12	CD
cord-269150-d1sgnxc0	255	47	of	of	IN
cord-269150-d1sgnxc0	255	48	Coronavirus	Coronavirus	NNP
cord-269150-d1sgnxc0	255	49	infectious	infectious	JJ
cord-269150-d1sgnxc0	255	50	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	255	51	virus	virus	NN
cord-269150-d1sgnxc0	255	52	is	be	VBZ
cord-269150-d1sgnxc0	255	53	dispensable	dispensable	JJ
cord-269150-d1sgnxc0	255	54	for	for	IN
cord-269150-d1sgnxc0	255	55	viral	viral	JJ
cord-269150-d1sgnxc0	255	56	replication	replication	NN
cord-269150-d1sgnxc0	255	57	in	in	IN
cord-269150-d1sgnxc0	255	58	cultured	cultured	JJ
cord-269150-d1sgnxc0	255	59	cells	cell	NNS
cord-269150-d1sgnxc0	255	60	Functional	functional	JJ
cord-269150-d1sgnxc0	255	61	and	and	CC
cord-269150-d1sgnxc0	255	62	genetic	genetic	JJ
cord-269150-d1sgnxc0	255	63	studies	study	NNS
cord-269150-d1sgnxc0	255	64	of	of	IN
cord-269150-d1sgnxc0	255	65	the	the	DT
cord-269150-d1sgnxc0	255	66	substrate	substrate	JJ
cord-269150-d1sgnxc0	255	67	specificity	specificity	NN
cord-269150-d1sgnxc0	255	68	of	of	IN
cord-269150-d1sgnxc0	255	69	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	255	70	infectious	infectious	JJ
cord-269150-d1sgnxc0	255	71	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	255	72	virus	virus	NN
cord-269150-d1sgnxc0	255	73	3C	3c	NN
cord-269150-d1sgnxc0	255	74	-	-	HYPH
cord-269150-d1sgnxc0	255	75	like	like	JJ
cord-269150-d1sgnxc0	255	76	proteinase	proteinase	NN
cord-269150-d1sgnxc0	255	77	Functional	functional	JJ
cord-269150-d1sgnxc0	255	78	screen	screen	NN
cord-269150-d1sgnxc0	255	79	reveals	reveal	VBZ
cord-269150-d1sgnxc0	255	80	SARS	SARS	NNP
cord-269150-d1sgnxc0	255	81	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	255	82	nonstructural	nonstructural	JJ
cord-269150-d1sgnxc0	255	83	protein	protein	NN
cord-269150-d1sgnxc0	256	1	nsp14	nsp14	NFP
cord-269150-d1sgnxc0	256	2	as	as	IN
cord-269150-d1sgnxc0	256	3	a	a	DT
cord-269150-d1sgnxc0	256	4	novel	novel	NN
cord-269150-d1sgnxc0	256	5	cap	cap	NN
cord-269150-d1sgnxc0	256	6	N7	N7	NNP
cord-269150-d1sgnxc0	256	7	methyltransferase	methyltransferase	NN
cord-269150-d1sgnxc0	256	8	Identification	identification	NN
cord-269150-d1sgnxc0	256	9	of	of	IN
cord-269150-d1sgnxc0	256	10	a	a	DT
cord-269150-d1sgnxc0	256	11	novel	novel	JJ
cord-269150-d1sgnxc0	256	12	cleavage	cleavage	NN
cord-269150-d1sgnxc0	256	13	activity	activity	NN
cord-269150-d1sgnxc0	256	14	of	of	IN
cord-269150-d1sgnxc0	256	15	the	the	DT
cord-269150-d1sgnxc0	256	16	first	first	JJ
cord-269150-d1sgnxc0	256	17	papain	papain	NN
cord-269150-d1sgnxc0	256	18	-	-	HYPH
cord-269150-d1sgnxc0	256	19	like	like	JJ
cord-269150-d1sgnxc0	256	20	proteinase	proteinase	NN
cord-269150-d1sgnxc0	256	21	domain	domain	NN
cord-269150-d1sgnxc0	256	22	encoded	encode	VBN
cord-269150-d1sgnxc0	256	23	by	by	IN
cord-269150-d1sgnxc0	256	24	open	open	JJ
cord-269150-d1sgnxc0	256	25	reading	reading	NN
cord-269150-d1sgnxc0	256	26	frame	frame	NN
cord-269150-d1sgnxc0	256	27	1a	1a	CD
cord-269150-d1sgnxc0	256	28	of	of	IN
cord-269150-d1sgnxc0	256	29	the	the	DT
cord-269150-d1sgnxc0	256	30	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	257	1	Avian	avian	JJ
cord-269150-d1sgnxc0	257	2	infectious	infectious	JJ
cord-269150-d1sgnxc0	257	3	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	257	4	virus	virus	NN
cord-269150-d1sgnxc0	257	5	and	and	CC
cord-269150-d1sgnxc0	257	6	characterization	characterization	NN
cord-269150-d1sgnxc0	257	7	of	of	IN
cord-269150-d1sgnxc0	257	8	the	the	DT
cord-269150-d1sgnxc0	257	9	cleavage	cleavage	NN
cord-269150-d1sgnxc0	257	10	products	product	NNS
cord-269150-d1sgnxc0	257	11	Characterization	characterization	NN
cord-269150-d1sgnxc0	257	12	of	of	IN
cord-269150-d1sgnxc0	257	13	viral	viral	JJ
cord-269150-d1sgnxc0	257	14	proteins	protein	NNS
cord-269150-d1sgnxc0	257	15	encoded	encode	VBN
cord-269150-d1sgnxc0	257	16	by	by	IN
cord-269150-d1sgnxc0	257	17	the	the	DT
cord-269150-d1sgnxc0	257	18	SARS	SARS	NNP
cord-269150-d1sgnxc0	257	19	-	-	HYPH
cord-269150-d1sgnxc0	257	20	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	257	21	genome	genome	NN
cord-269150-d1sgnxc0	258	1	The	the	DT
cord-269150-d1sgnxc0	258	2	molecular	molecular	JJ
cord-269150-d1sgnxc0	258	3	biology	biology	NN
cord-269150-d1sgnxc0	258	4	of	of	IN
cord-269150-d1sgnxc0	258	5	coronaviruses	coronaviruse	NNS
cord-269150-d1sgnxc0	259	1	A	a	DT
cord-269150-d1sgnxc0	259	2	two	two	CD
cord-269150-d1sgnxc0	259	3	-	-	HYPH
cord-269150-d1sgnxc0	259	4	pronged	pronged	JJ
cord-269150-d1sgnxc0	259	5	strategy	strategy	NN
cord-269150-d1sgnxc0	259	6	to	to	TO
cord-269150-d1sgnxc0	259	7	suppress	suppress	VB
cord-269150-d1sgnxc0	259	8	host	host	NN
cord-269150-d1sgnxc0	259	9	protein	protein	NN
cord-269150-d1sgnxc0	259	10	synthesis	synthesis	NN
cord-269150-d1sgnxc0	259	11	by	by	IN
cord-269150-d1sgnxc0	259	12	SARS	SARS	NNP
cord-269150-d1sgnxc0	259	13	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	260	1	Nsp1	nsp1	NN
cord-269150-d1sgnxc0	260	2	protein	protein	NN
cord-269150-d1sgnxc0	260	3	Severe	severe	JJ
cord-269150-d1sgnxc0	261	1	acute	acute	JJ
cord-269150-d1sgnxc0	261	2	respiratory	respiratory	JJ
cord-269150-d1sgnxc0	261	3	syndrome	syndrome	NN
cord-269150-d1sgnxc0	261	4	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	261	5	nsp1	nsp1	CD
cord-269150-d1sgnxc0	261	6	suppresses	suppress	VBZ
cord-269150-d1sgnxc0	261	7	host	host	NN
cord-269150-d1sgnxc0	261	8	gene	gene	NN
cord-269150-d1sgnxc0	261	9	expression	expression	NN
cord-269150-d1sgnxc0	261	10	,	,	,
cord-269150-d1sgnxc0	261	11	including	include	VBG
cord-269150-d1sgnxc0	261	12	that	that	DT
cord-269150-d1sgnxc0	261	13	of	of	IN
cord-269150-d1sgnxc0	261	14	type	type	NN
cord-269150-d1sgnxc0	262	1	I	-PRON-	PRP
cord-269150-d1sgnxc0	262	2	interferon	interferon	RB
cord-269150-d1sgnxc0	263	1	,	,	,
cord-269150-d1sgnxc0	263	2	in	in	IN
cord-269150-d1sgnxc0	263	3	infected	infected	JJ
cord-269150-d1sgnxc0	263	4	cells	cell	NNS
cord-269150-d1sgnxc0	263	5	Severe	severe	JJ
cord-269150-d1sgnxc0	264	1	acute	acute	JJ
cord-269150-d1sgnxc0	264	2	respiratory	respiratory	JJ
cord-269150-d1sgnxc0	264	3	syndrome	syndrome	NN
cord-269150-d1sgnxc0	264	4	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	265	1	nsp1	nsp1	NNS
cord-269150-d1sgnxc0	265	2	protein	protein	NN
cord-269150-d1sgnxc0	265	3	suppresses	suppress	VBZ
cord-269150-d1sgnxc0	265	4	host	host	NN
cord-269150-d1sgnxc0	265	5	gene	gene	NN
cord-269150-d1sgnxc0	265	6	expression	expression	NN
cord-269150-d1sgnxc0	265	7	by	by	IN
cord-269150-d1sgnxc0	265	8	promoting	promote	VBG
cord-269150-d1sgnxc0	265	9	host	host	NN
cord-269150-d1sgnxc0	265	10	mRNA	mrna	NN
cord-269150-d1sgnxc0	265	11	degradation	degradation	NN
cord-269150-d1sgnxc0	265	12	Characterization	characterization	NN
cord-269150-d1sgnxc0	265	13	of	of	IN
cord-269150-d1sgnxc0	265	14	the	the	DT
cord-269150-d1sgnxc0	265	15	expression	expression	NN
cord-269150-d1sgnxc0	265	16	,	,	,
cord-269150-d1sgnxc0	265	17	intracellular	intracellular	JJ
cord-269150-d1sgnxc0	265	18	localization	localization	NN
cord-269150-d1sgnxc0	265	19	,	,	,
cord-269150-d1sgnxc0	265	20	and	and	CC
cord-269150-d1sgnxc0	265	21	replication	replication	NN
cord-269150-d1sgnxc0	265	22	complex	complex	NNP
cord-269150-d1sgnxc0	265	23	association	association	NNP
cord-269150-d1sgnxc0	265	24	of	of	IN
cord-269150-d1sgnxc0	265	25	the	the	DT
cord-269150-d1sgnxc0	265	26	putative	putative	JJ
cord-269150-d1sgnxc0	265	27	mouse	mouse	NN
cord-269150-d1sgnxc0	265	28	hepatitis	hepatitis	NNP
cord-269150-d1sgnxc0	265	29	virus	virus	NN
cord-269150-d1sgnxc0	265	30	RNA	RNA	NNP
cord-269150-d1sgnxc0	265	31	-	-	HYPH
cord-269150-d1sgnxc0	265	32	dependent	dependent	JJ
cord-269150-d1sgnxc0	265	33	RNA	RNA	NNP
cord-269150-d1sgnxc0	265	34	polymerase	polymerase	NN
cord-269150-d1sgnxc0	265	35	Nidovirus	Nidovirus	NNP
cord-269150-d1sgnxc0	265	36	transcription	transcription	NN
cord-269150-d1sgnxc0	265	37	:	:	:
cord-269150-d1sgnxc0	265	38	how	how	WRB
cord-269150-d1sgnxc0	265	39	to	to	TO
cord-269150-d1sgnxc0	265	40	make	make	VB
cord-269150-d1sgnxc0	265	41	sense	sense	NN
cord-269150-d1sgnxc0	265	42	Coronavirus	Coronavirus	NNP
cord-269150-d1sgnxc0	265	43	transcription	transcription	NN
cord-269150-d1sgnxc0	265	44	:	:	:
cord-269150-d1sgnxc0	265	45	a	a	DT
cord-269150-d1sgnxc0	265	46	perspective	perspective	NN
cord-269150-d1sgnxc0	265	47	The	the	DT
cord-269150-d1sgnxc0	265	48	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	265	49	nucleocapsid	nucleocapsid	NN
cord-269150-d1sgnxc0	265	50	protein	protein	NN
cord-269150-d1sgnxc0	265	51	is	be	VBZ
cord-269150-d1sgnxc0	265	52	dynamically	dynamically	RB
cord-269150-d1sgnxc0	265	53	associated	associate	VBN
cord-269150-d1sgnxc0	265	54	with	with	IN
cord-269150-d1sgnxc0	265	55	the	the	DT
cord-269150-d1sgnxc0	265	56	replication	replication	NN
cord-269150-d1sgnxc0	265	57	-	-	HYPH
cord-269150-d1sgnxc0	265	58	transcription	transcription	NN
cord-269150-d1sgnxc0	265	59	complexes	complex	NNS
cord-269150-d1sgnxc0	266	1	Coronavirus	Coronavirus	NNP
cord-269150-d1sgnxc0	266	2	nucleocapsid	nucleocapsid	NN
cord-269150-d1sgnxc0	266	3	protein	protein	NN
cord-269150-d1sgnxc0	266	4	facilitates	facilitate	VBZ
cord-269150-d1sgnxc0	266	5	template	template	NN
cord-269150-d1sgnxc0	266	6	switching	switching	NN
cord-269150-d1sgnxc0	266	7	and	and	CC
cord-269150-d1sgnxc0	266	8	is	be	VBZ
cord-269150-d1sgnxc0	266	9	required	require	VBN
cord-269150-d1sgnxc0	266	10	for	for	IN
cord-269150-d1sgnxc0	266	11	efficient	efficient	JJ
cord-269150-d1sgnxc0	266	12	transcription	transcription	NN
cord-269150-d1sgnxc0	266	13	Viral	viral	JJ
cord-269150-d1sgnxc0	266	14	and	and	CC
cord-269150-d1sgnxc0	266	15	cellular	cellular	JJ
cord-269150-d1sgnxc0	266	16	proteins	protein	NNS
cord-269150-d1sgnxc0	266	17	involved	involve	VBN
cord-269150-d1sgnxc0	266	18	in	in	IN
cord-269150-d1sgnxc0	266	19	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	266	20	replication	replication	NN
cord-269150-d1sgnxc0	267	1	Polypyrimidine	Polypyrimidine	NNP
cord-269150-d1sgnxc0	267	2	-	-	HYPH
cord-269150-d1sgnxc0	267	3	tractbinding	tractbinde	VBG
cord-269150-d1sgnxc0	267	4	protein	protein	NN
cord-269150-d1sgnxc0	267	5	affects	affect	VBZ
cord-269150-d1sgnxc0	267	6	transcription	transcription	NN
cord-269150-d1sgnxc0	267	7	but	but	CC
cord-269150-d1sgnxc0	267	8	not	not	RB
cord-269150-d1sgnxc0	267	9	translation	translation	NN
cord-269150-d1sgnxc0	267	10	of	of	IN
cord-269150-d1sgnxc0	267	11	mouse	mouse	NNP
cord-269150-d1sgnxc0	267	12	hepatitis	hepatitis	NNP
cord-269150-d1sgnxc0	267	13	virus	virus	NN
cord-269150-d1sgnxc0	267	14	RNA	RNA	NNP
cord-269150-d1sgnxc0	267	15	Heterogeneous	Heterogeneous	NNP
cord-269150-d1sgnxc0	267	16	nuclear	nuclear	JJ
cord-269150-d1sgnxc0	267	17	ribonucleoprotein	ribonucleoprotein	NN
cord-269150-d1sgnxc0	267	18	a1	a1	NNP
cord-269150-d1sgnxc0	267	19	binds	bind	VBZ
cord-269150-d1sgnxc0	267	20	to	to	IN
cord-269150-d1sgnxc0	267	21	the	the	DT
cord-269150-d1sgnxc0	267	22	3	3	CD
cord-269150-d1sgnxc0	267	23	0	0	CD
cord-269150-d1sgnxc0	267	24	-untranslated	-untranslated	JJ
cord-269150-d1sgnxc0	267	25	region	region	NN
cord-269150-d1sgnxc0	267	26	and	and	CC
cord-269150-d1sgnxc0	267	27	mediates	mediate	VBZ
cord-269150-d1sgnxc0	267	28	potential	potential	JJ
cord-269150-d1sgnxc0	267	29	5'-3	5'-3	CD
cord-269150-d1sgnxc0	267	30	0	0	CD
cord-269150-d1sgnxc0	268	1	-end	-end	:
cord-269150-d1sgnxc0	268	2	cross	cross	NN
cord-269150-d1sgnxc0	268	3	talks	talk	NNS
cord-269150-d1sgnxc0	268	4	of	of	IN
cord-269150-d1sgnxc0	268	5	mouse	mouse	NNP
cord-269150-d1sgnxc0	268	6	hepatitis	hepatitis	NNP
cord-269150-d1sgnxc0	268	7	virus	virus	NN
cord-269150-d1sgnxc0	268	8	RNA	RNA	NNP
cord-269150-d1sgnxc0	268	9	Heterogeneous	Heterogeneous	NNP
cord-269150-d1sgnxc0	268	10	nuclear	nuclear	JJ
cord-269150-d1sgnxc0	268	11	ribonucleoprotein	ribonucleoprotein	NN
cord-269150-d1sgnxc0	268	12	A1	A1	NNP
cord-269150-d1sgnxc0	268	13	regulates	regulate	VBZ
cord-269150-d1sgnxc0	268	14	RNA	RNA	NNP
cord-269150-d1sgnxc0	268	15	synthesis	synthesis	NN
cord-269150-d1sgnxc0	268	16	of	of	IN
cord-269150-d1sgnxc0	268	17	a	a	DT
cord-269150-d1sgnxc0	268	18	cytoplasmic	cytoplasmic	JJ
cord-269150-d1sgnxc0	268	19	virus	virus	NN
cord-269150-d1sgnxc0	268	20	SYNCRIP	SYNCRIP	NNP
cord-269150-d1sgnxc0	268	21	,	,	,
cord-269150-d1sgnxc0	268	22	a	a	DT
cord-269150-d1sgnxc0	268	23	member	member	NN
cord-269150-d1sgnxc0	268	24	of	of	IN
cord-269150-d1sgnxc0	268	25	the	the	DT
cord-269150-d1sgnxc0	268	26	heterogeneous	heterogeneous	JJ
cord-269150-d1sgnxc0	268	27	nuclear	nuclear	JJ
cord-269150-d1sgnxc0	268	28	ribonucleoprotein	ribonucleoprotein	NN
cord-269150-d1sgnxc0	268	29	family	family	NN
cord-269150-d1sgnxc0	268	30	,	,	,
cord-269150-d1sgnxc0	268	31	is	be	VBZ
cord-269150-d1sgnxc0	268	32	involved	involve	VBN
cord-269150-d1sgnxc0	268	33	in	in	IN
cord-269150-d1sgnxc0	268	34	mouse	mouse	NN
cord-269150-d1sgnxc0	268	35	hepatitis	hepatitis	NNP
cord-269150-d1sgnxc0	268	36	virus	virus	NN
cord-269150-d1sgnxc0	268	37	RNA	RNA	NNP
cord-269150-d1sgnxc0	268	38	synthesis	synthesis	NN
cord-269150-d1sgnxc0	268	39	Host	Host	NNP
cord-269150-d1sgnxc0	268	40	cell	cell	NN
cord-269150-d1sgnxc0	268	41	proteins	protein	NNS
cord-269150-d1sgnxc0	268	42	interacting	interact	VBG
cord-269150-d1sgnxc0	268	43	with	with	IN
cord-269150-d1sgnxc0	268	44	the	the	DT
cord-269150-d1sgnxc0	268	45	3	3	CD
cord-269150-d1sgnxc0	268	46	0	0	CD
cord-269150-d1sgnxc0	268	47	end	end	NN
cord-269150-d1sgnxc0	268	48	of	of	IN
cord-269150-d1sgnxc0	268	49	TGEV	TGEV	NNP
cord-269150-d1sgnxc0	268	50	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	268	51	genome	genome	NN
cord-269150-d1sgnxc0	268	52	influence	influence	NN
cord-269150-d1sgnxc0	268	53	virus	virus	NN
cord-269150-d1sgnxc0	268	54	replication	replication	NN
cord-269150-d1sgnxc0	269	1	The	the	DT
cord-269150-d1sgnxc0	269	2	cellular	cellular	JJ
cord-269150-d1sgnxc0	269	3	RNA	rna	NN
cord-269150-d1sgnxc0	269	4	helicase	helicase	NN
cord-269150-d1sgnxc0	269	5	DDX1	DDX1	NNP
cord-269150-d1sgnxc0	269	6	interacts	interact	VBZ
cord-269150-d1sgnxc0	269	7	with	with	IN
cord-269150-d1sgnxc0	269	8	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	269	9	nonstructural	nonstructural	JJ
cord-269150-d1sgnxc0	269	10	protein	protein	NN
cord-269150-d1sgnxc0	269	11	14	14	CD
cord-269150-d1sgnxc0	269	12	and	and	CC
cord-269150-d1sgnxc0	269	13	enhances	enhance	VBZ
cord-269150-d1sgnxc0	269	14	viral	viral	JJ
cord-269150-d1sgnxc0	269	15	replication	replication	NN
cord-269150-d1sgnxc0	270	1	A	a	DT
cord-269150-d1sgnxc0	270	2	three	three	CD
cord-269150-d1sgnxc0	270	3	-	-	HYPH
cord-269150-d1sgnxc0	270	4	hybrid	hybrid	NN
cord-269150-d1sgnxc0	270	5	screen	screen	NN
cord-269150-d1sgnxc0	270	6	identifies	identify	VBZ
cord-269150-d1sgnxc0	270	7	mRNAs	mRNAs	NNPS
cord-269150-d1sgnxc0	270	8	controlled	control	VBN
cord-269150-d1sgnxc0	270	9	by	by	IN
cord-269150-d1sgnxc0	270	10	a	a	DT
cord-269150-d1sgnxc0	270	11	regulatory	regulatory	JJ
cord-269150-d1sgnxc0	270	12	protein	protein	NN
cord-269150-d1sgnxc0	270	13	Isolation	isolation	NN
cord-269150-d1sgnxc0	270	14	,	,	,
cord-269150-d1sgnxc0	270	15	expression	expression	NN
cord-269150-d1sgnxc0	270	16	,	,	,
cord-269150-d1sgnxc0	270	17	and	and	CC
cord-269150-d1sgnxc0	270	18	characterization	characterization	NN
cord-269150-d1sgnxc0	270	19	of	of	IN
cord-269150-d1sgnxc0	270	20	the	the	DT
cord-269150-d1sgnxc0	270	21	human	human	JJ
cord-269150-d1sgnxc0	270	22	ZCRB1	ZCRB1	``
cord-269150-d1sgnxc0	270	23	gene	gene	NN
cord-269150-d1sgnxc0	270	24	mapped	map	VBN
cord-269150-d1sgnxc0	270	25	to	to	IN
cord-269150-d1sgnxc0	270	26	12q12	12q12	CD
cord-269150-d1sgnxc0	270	27	Amino	amino	NN
cord-269150-d1sgnxc0	270	28	acid	acid	NN
cord-269150-d1sgnxc0	270	29	residues	residue	NNS
cord-269150-d1sgnxc0	270	30	critical	critical	JJ
cord-269150-d1sgnxc0	270	31	for	for	IN
cord-269150-d1sgnxc0	270	32	RNA	rna	NN
cord-269150-d1sgnxc0	270	33	-	-	HYPH
cord-269150-d1sgnxc0	270	34	binding	bind	VBG
cord-269150-d1sgnxc0	270	35	in	in	IN
cord-269150-d1sgnxc0	270	36	the	the	DT
cord-269150-d1sgnxc0	270	37	N	n	CD
cord-269150-d1sgnxc0	270	38	-	-	HYPH
cord-269150-d1sgnxc0	270	39	terminal	terminal	NN
cord-269150-d1sgnxc0	270	40	domain	domain	NN
cord-269150-d1sgnxc0	270	41	of	of	IN
cord-269150-d1sgnxc0	270	42	the	the	DT
cord-269150-d1sgnxc0	270	43	nucleocapsid	nucleocapsid	NNP
cord-269150-d1sgnxc0	270	44	protein	protein	NN
cord-269150-d1sgnxc0	270	45	are	be	VBP
cord-269150-d1sgnxc0	270	46	essential	essential	JJ
cord-269150-d1sgnxc0	270	47	determinants	determinant	NNS
cord-269150-d1sgnxc0	270	48	for	for	IN
cord-269150-d1sgnxc0	270	49	the	the	DT
cord-269150-d1sgnxc0	270	50	infectivity	infectivity	NN
cord-269150-d1sgnxc0	270	51	of	of	IN
cord-269150-d1sgnxc0	270	52	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	270	53	in	in	IN
cord-269150-d1sgnxc0	270	54	cultured	cultured	JJ
cord-269150-d1sgnxc0	270	55	cells	cell	NNS
cord-269150-d1sgnxc0	271	1	The	the	DT
cord-269150-d1sgnxc0	271	2	human	human	JJ
cord-269150-d1sgnxc0	271	3	18S	18S	NNP
cord-269150-d1sgnxc0	271	4	U11	U11	NNP
cord-269150-d1sgnxc0	271	5	/	/	SYM
cord-269150-d1sgnxc0	271	6	U12	U12	NNP
cord-269150-d1sgnxc0	271	7	snRNP	snrnp	NN
cord-269150-d1sgnxc0	271	8	contains	contain	VBZ
cord-269150-d1sgnxc0	271	9	a	a	DT
cord-269150-d1sgnxc0	271	10	set	set	NN
cord-269150-d1sgnxc0	271	11	of	of	IN
cord-269150-d1sgnxc0	271	12	novel	novel	NN
cord-269150-d1sgnxc0	271	13	proteins	protein	NNS
cord-269150-d1sgnxc0	271	14	not	not	RB
cord-269150-d1sgnxc0	271	15	found	find	VBN
cord-269150-d1sgnxc0	271	16	in	in	IN
cord-269150-d1sgnxc0	271	17	the	the	DT
cord-269150-d1sgnxc0	271	18	U2-dependent	U2-dependent	NNP
cord-269150-d1sgnxc0	271	19	spliceosome	spliceosome	NNP
cord-269150-d1sgnxc0	272	1	A	a	DT
cord-269150-d1sgnxc0	272	2	U	u	NN
cord-269150-d1sgnxc0	272	3	-	-	HYPH
cord-269150-d1sgnxc0	272	4	turn	turn	NN
cord-269150-d1sgnxc0	272	5	motif	motif	NN
cord-269150-d1sgnxc0	272	6	-	-	HYPH
cord-269150-d1sgnxc0	272	7	containing	contain	VBG
cord-269150-d1sgnxc0	272	8	stem	stem	NN
cord-269150-d1sgnxc0	272	9	-	-	HYPH
cord-269150-d1sgnxc0	272	10	loop	loop	NN
cord-269150-d1sgnxc0	272	11	in	in	IN
cord-269150-d1sgnxc0	272	12	the	the	DT
cord-269150-d1sgnxc0	272	13	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	272	14	5	5	CD
cord-269150-d1sgnxc0	272	15	'	'	POS
cord-269150-d1sgnxc0	272	16	untranslated	untranslated	JJ
cord-269150-d1sgnxc0	272	17	region	region	NN
cord-269150-d1sgnxc0	272	18	plays	play	VBZ
cord-269150-d1sgnxc0	272	19	a	a	DT
cord-269150-d1sgnxc0	272	20	functional	functional	JJ
cord-269150-d1sgnxc0	272	21	role	role	NN
cord-269150-d1sgnxc0	272	22	in	in	IN
cord-269150-d1sgnxc0	272	23	replication	replication	NN
cord-269150-d1sgnxc0	272	24	Towards	towards	IN
cord-269150-d1sgnxc0	272	25	construction	construction	NN
cord-269150-d1sgnxc0	272	26	of	of	IN
cord-269150-d1sgnxc0	272	27	viral	viral	JJ
cord-269150-d1sgnxc0	272	28	vectors	vector	NNS
cord-269150-d1sgnxc0	272	29	based	base	VBN
cord-269150-d1sgnxc0	272	30	on	on	IN
cord-269150-d1sgnxc0	272	31	avian	avian	JJ
cord-269150-d1sgnxc0	272	32	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	272	33	infectious	infectious	JJ
cord-269150-d1sgnxc0	272	34	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	272	35	virus	virus	NN
cord-269150-d1sgnxc0	272	36	for	for	IN
cord-269150-d1sgnxc0	272	37	gene	gene	NN
cord-269150-d1sgnxc0	272	38	delivery	delivery	NN
cord-269150-d1sgnxc0	272	39	and	and	CC
cord-269150-d1sgnxc0	272	40	vaccine	vaccine	NN
cord-269150-d1sgnxc0	272	41	development	development	NN
cord-269150-d1sgnxc0	272	42	The	the	DT
cord-269150-d1sgnxc0	272	43	nucleocapsid	nucleocapsid	NN
cord-269150-d1sgnxc0	272	44	protein	protein	NN
cord-269150-d1sgnxc0	272	45	of	of	IN
cord-269150-d1sgnxc0	272	46	SARS	SARS	NNP
cord-269150-d1sgnxc0	272	47	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	272	48	has	have	VBZ
cord-269150-d1sgnxc0	272	49	a	a	DT
cord-269150-d1sgnxc0	272	50	high	high	JJ
cord-269150-d1sgnxc0	272	51	binding	bind	VBG
cord-269150-d1sgnxc0	272	52	affinity	affinity	NN
cord-269150-d1sgnxc0	272	53	to	to	IN
cord-269150-d1sgnxc0	272	54	the	the	DT
cord-269150-d1sgnxc0	272	55	human	human	JJ
cord-269150-d1sgnxc0	272	56	cellular	cellular	JJ
cord-269150-d1sgnxc0	272	57	heterogeneous	heterogeneous	JJ
cord-269150-d1sgnxc0	272	58	nuclear	nuclear	JJ
cord-269150-d1sgnxc0	272	59	ribonucleoprotein	ribonucleoprotein	NN
cord-269150-d1sgnxc0	272	60	A1	A1	NNP
cord-269150-d1sgnxc0	272	61	Host	Host	NNP
cord-269150-d1sgnxc0	272	62	protein	protein	NN
cord-269150-d1sgnxc0	272	63	interactions	interaction	NNS
cord-269150-d1sgnxc0	272	64	with	with	IN
cord-269150-d1sgnxc0	272	65	the	the	DT
cord-269150-d1sgnxc0	272	66	3	3	CD
cord-269150-d1sgnxc0	272	67	0	0	CD
cord-269150-d1sgnxc0	272	68	end	end	NN
cord-269150-d1sgnxc0	272	69	of	of	IN
cord-269150-d1sgnxc0	272	70	bovine	bovine	JJ
cord-269150-d1sgnxc0	272	71	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	272	72	RNA	RNA	NNP
cord-269150-d1sgnxc0	272	73	and	and	CC
cord-269150-d1sgnxc0	272	74	the	the	DT
cord-269150-d1sgnxc0	272	75	requirement	requirement	NN
cord-269150-d1sgnxc0	272	76	of	of	IN
cord-269150-d1sgnxc0	272	77	the	the	DT
cord-269150-d1sgnxc0	272	78	poly(A	poly(a	JJ
cord-269150-d1sgnxc0	272	79	)	)	-RRB-
cord-269150-d1sgnxc0	272	80	tail	tail	NN
cord-269150-d1sgnxc0	272	81	for	for	IN
cord-269150-d1sgnxc0	272	82	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	272	83	defective	defective	JJ
cord-269150-d1sgnxc0	272	84	genome	genome	NN
cord-269150-d1sgnxc0	272	85	replication	replication	NN
cord-269150-d1sgnxc0	272	86	Mitochondrial	mitochondrial	JJ
cord-269150-d1sgnxc0	272	87	HSP70	HSP70	NNP
cord-269150-d1sgnxc0	272	88	,	,	,
cord-269150-d1sgnxc0	272	89	HSP40	HSP40	NNP
cord-269150-d1sgnxc0	272	90	,	,	,
cord-269150-d1sgnxc0	272	91	and	and	CC
cord-269150-d1sgnxc0	272	92	HSP60	hsp60	PRP
cord-269150-d1sgnxc0	272	93	bind	bind	VB
cord-269150-d1sgnxc0	272	94	to	to	IN
cord-269150-d1sgnxc0	272	95	the	the	DT
cord-269150-d1sgnxc0	272	96	3	3	CD
cord-269150-d1sgnxc0	272	97	0	0	CD
cord-269150-d1sgnxc0	272	98	untranslated	untranslated	JJ
cord-269150-d1sgnxc0	272	99	region	region	NN
cord-269150-d1sgnxc0	272	100	of	of	IN
cord-269150-d1sgnxc0	272	101	the	the	DT
cord-269150-d1sgnxc0	272	102	Murine	Murine	NNP
cord-269150-d1sgnxc0	272	103	hepatitis	hepatitis	NN
cord-269150-d1sgnxc0	272	104	virus	virus	NN
cord-269150-d1sgnxc0	272	105	genome	genome	NN
cord-269150-d1sgnxc0	272	106	Mitochondrial	mitochondrial	JJ
cord-269150-d1sgnxc0	272	107	aconitase	aconitase	NN
cord-269150-d1sgnxc0	272	108	binds	bind	VBZ
cord-269150-d1sgnxc0	272	109	to	to	IN
cord-269150-d1sgnxc0	272	110	the	the	DT
cord-269150-d1sgnxc0	272	111	3	3	CD
cord-269150-d1sgnxc0	272	112	0	0	CD
cord-269150-d1sgnxc0	272	113	untranslated	untranslated	JJ
cord-269150-d1sgnxc0	272	114	region	region	NN
cord-269150-d1sgnxc0	272	115	of	of	IN
cord-269150-d1sgnxc0	272	116	the	the	DT
cord-269150-d1sgnxc0	272	117	mouse	mouse	NN
cord-269150-d1sgnxc0	272	118	hepatitis	hepatitis	NNP
cord-269150-d1sgnxc0	272	119	virus	virus	NN
cord-269150-d1sgnxc0	272	120	genome	genome	NN
cord-269150-d1sgnxc0	272	121	Structural	structural	JJ
cord-269150-d1sgnxc0	272	122	lability	lability	NN
cord-269150-d1sgnxc0	272	123	in	in	IN
cord-269150-d1sgnxc0	272	124	stem	stem	NN
cord-269150-d1sgnxc0	272	125	-	-	HYPH
cord-269150-d1sgnxc0	272	126	loop	loop	NN
cord-269150-d1sgnxc0	272	127	1	1	CD
cord-269150-d1sgnxc0	272	128	drives	drive	NNS
cord-269150-d1sgnxc0	272	129	a	a	DT
cord-269150-d1sgnxc0	272	130	5	5	CD
cord-269150-d1sgnxc0	272	131	0	0	CD
cord-269150-d1sgnxc0	272	132	UTR-3	UTR-3	NNP
cord-269150-d1sgnxc0	272	133	'	'	''
cord-269150-d1sgnxc0	272	134	UTR	UTR	NNP
cord-269150-d1sgnxc0	272	135	interaction	interaction	NN
cord-269150-d1sgnxc0	272	136	in	in	IN
cord-269150-d1sgnxc0	272	137	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	272	138	replication	replication	NN
cord-269150-d1sgnxc0	272	139	Selective	selective	JJ
cord-269150-d1sgnxc0	272	140	replication	replication	NN
cord-269150-d1sgnxc0	272	141	of	of	IN
cord-269150-d1sgnxc0	272	142	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	272	143	genomes	genome	NNS
cord-269150-d1sgnxc0	272	144	that	that	WDT
cord-269150-d1sgnxc0	272	145	express	express	VBP
cord-269150-d1sgnxc0	272	146	nucleocapsid	nucleocapsid	NNP
cord-269150-d1sgnxc0	272	147	protein	protein	NN
cord-269150-d1sgnxc0	272	148	Group	Group	NNP
cord-269150-d1sgnxc0	272	149	-	-	HYPH
cord-269150-d1sgnxc0	272	150	specific	specific	JJ
cord-269150-d1sgnxc0	272	151	structural	structural	JJ
cord-269150-d1sgnxc0	272	152	features	feature	NNS
cord-269150-d1sgnxc0	272	153	of	of	IN
cord-269150-d1sgnxc0	272	154	the	the	DT
cord-269150-d1sgnxc0	272	155	5	5	CD
cord-269150-d1sgnxc0	272	156	0	0	CD
cord-269150-d1sgnxc0	272	157	-proximal	-proximal	JJS
cord-269150-d1sgnxc0	272	158	sequences	sequence	NNS
cord-269150-d1sgnxc0	272	159	of	of	IN
cord-269150-d1sgnxc0	272	160	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	272	161	genomic	genomic	JJ
cord-269150-d1sgnxc0	272	162	RNAs	rna	NNS
cord-269150-d1sgnxc0	272	163	Membrane	Membrane	NNP
cord-269150-d1sgnxc0	272	164	association	association	NN
cord-269150-d1sgnxc0	272	165	and	and	CC
cord-269150-d1sgnxc0	272	166	dimerization	dimerization	NN
cord-269150-d1sgnxc0	272	167	of	of	IN
cord-269150-d1sgnxc0	272	168	a	a	DT
cord-269150-d1sgnxc0	272	169	cysteine	cysteine	NN
cord-269150-d1sgnxc0	272	170	-	-	HYPH
cord-269150-d1sgnxc0	272	171	rich	rich	JJ
cord-269150-d1sgnxc0	272	172	,	,	,
cord-269150-d1sgnxc0	272	173	16-kilodalton	16-kilodalton	CD
cord-269150-d1sgnxc0	272	174	polypeptide	polypeptide	NN
cord-269150-d1sgnxc0	272	175	released	release	VBN
cord-269150-d1sgnxc0	272	176	from	from	IN
cord-269150-d1sgnxc0	272	177	the	the	DT
cord-269150-d1sgnxc0	272	178	C	C	NNP
cord-269150-d1sgnxc0	272	179	-	-	HYPH
cord-269150-d1sgnxc0	272	180	terminal	terminal	NN
cord-269150-d1sgnxc0	272	181	region	region	NN
cord-269150-d1sgnxc0	272	182	of	of	IN
cord-269150-d1sgnxc0	272	183	the	the	DT
cord-269150-d1sgnxc0	272	184	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	272	185	infectious	infectious	JJ
cord-269150-d1sgnxc0	272	186	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	272	187	virus	virus	NN
cord-269150-d1sgnxc0	272	188	1a	1a	CD
cord-269150-d1sgnxc0	273	1	polyprotein	polyprotein	NNP
cord-269150-d1sgnxc0	274	1	Further	further	JJ
cord-269150-d1sgnxc0	274	2	identification	identification	NN
cord-269150-d1sgnxc0	274	3	and	and	CC
cord-269150-d1sgnxc0	274	4	characterization	characterization	NN
cord-269150-d1sgnxc0	274	5	of	of	IN
cord-269150-d1sgnxc0	274	6	novel	novel	NN
cord-269150-d1sgnxc0	274	7	intermediate	intermediate	JJ
cord-269150-d1sgnxc0	274	8	and	and	CC
cord-269150-d1sgnxc0	274	9	mature	mature	JJ
cord-269150-d1sgnxc0	274	10	cleavage	cleavage	NN
cord-269150-d1sgnxc0	274	11	products	product	NNS
cord-269150-d1sgnxc0	274	12	released	release	VBN
cord-269150-d1sgnxc0	274	13	from	from	IN
cord-269150-d1sgnxc0	274	14	the	the	DT
cord-269150-d1sgnxc0	274	15	ORF	ORF	NNP
cord-269150-d1sgnxc0	274	16	1b	1b	CD
cord-269150-d1sgnxc0	274	17	region	region	NN
cord-269150-d1sgnxc0	274	18	of	of	IN
cord-269150-d1sgnxc0	274	19	the	the	DT
cord-269150-d1sgnxc0	274	20	avian	avian	JJ
cord-269150-d1sgnxc0	274	21	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	274	22	infectious	infectious	JJ
cord-269150-d1sgnxc0	274	23	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	274	24	virus	virus	NN
cord-269150-d1sgnxc0	275	1	1a/1b	1a/1b	CD
cord-269150-d1sgnxc0	275	2	polyprotein	polyprotein	NNP
cord-269150-d1sgnxc0	276	1	Further	further	JJ
cord-269150-d1sgnxc0	276	2	characterization	characterization	NN
cord-269150-d1sgnxc0	276	3	of	of	IN
cord-269150-d1sgnxc0	276	4	the	the	DT
cord-269150-d1sgnxc0	276	5	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	276	6	infectious	infectious	JJ
cord-269150-d1sgnxc0	276	7	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	276	8	virus	virus	NN
cord-269150-d1sgnxc0	276	9	3C	3c	NN
cord-269150-d1sgnxc0	276	10	-	-	HYPH
cord-269150-d1sgnxc0	276	11	like	like	JJ
cord-269150-d1sgnxc0	276	12	proteinase	proteinase	NN
cord-269150-d1sgnxc0	276	13	and	and	CC
cord-269150-d1sgnxc0	276	14	determination	determination	NN
cord-269150-d1sgnxc0	276	15	of	of	IN
cord-269150-d1sgnxc0	276	16	a	a	DT
cord-269150-d1sgnxc0	276	17	new	new	JJ
cord-269150-d1sgnxc0	276	18	cleavage	cleavage	NN
cord-269150-d1sgnxc0	276	19	site	site	NN
cord-269150-d1sgnxc0	276	20	Sumoylation	Sumoylation	NNP
cord-269150-d1sgnxc0	276	21	of	of	IN
cord-269150-d1sgnxc0	276	22	the	the	DT
cord-269150-d1sgnxc0	276	23	nucleocapsid	nucleocapsid	NNP
cord-269150-d1sgnxc0	276	24	protein	protein	NN
cord-269150-d1sgnxc0	276	25	of	of	IN
cord-269150-d1sgnxc0	276	26	severe	severe	JJ
cord-269150-d1sgnxc0	276	27	acute	acute	JJ
cord-269150-d1sgnxc0	276	28	respiratory	respiratory	JJ
cord-269150-d1sgnxc0	276	29	syndrome	syndrome	NN
cord-269150-d1sgnxc0	276	30	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	277	1	The	the	DT
cord-269150-d1sgnxc0	277	2	coronavirus	coronavirus	NN
cord-269150-d1sgnxc0	277	3	infectious	infectious	JJ
cord-269150-d1sgnxc0	277	4	bronchitis	bronchitis	NN
cord-269150-d1sgnxc0	277	5	virus	virus	NN
cord-269150-d1sgnxc0	277	6	nucleoprotein	nucleoprotein	NNP
cord-269150-d1sgnxc0	277	7	localizes	localize	VBZ
cord-269150-d1sgnxc0	277	8	to	to	IN
cord-269150-d1sgnxc0	277	9	the	the	DT
cord-269150-d1sgnxc0	277	10	nucleolus	nucleolus	NN
cord-269150-d1sgnxc0	277	11	Conflict	conflict	NN
cord-269150-d1sgnxc0	277	12	of	of	IN
cord-269150-d1sgnxc0	277	13	interest	interest	NN
cord-269150-d1sgnxc0	277	14	statement	statement	NN
cord-269150-d1sgnxc0	277	15	.	.	.
cord-269150-d1sgnxc0	278	1	None	none	NN
cord-269150-d1sgnxc0	278	2	declared	declare	VBD
cord-269150-d1sgnxc0	278	3	.	.	.