key: cord- -dvhkk authors: lee, jae min; choi, sun sil; park, mi hyeon; jang, hyunduk; lee, yo han; khim, keon woo; oh, sei ryang; park, jiyoung; ryu, hyung won; choi, jang hyun title: broussonetia papyrifera root bark extract exhibits anti-inflammatory effects on adipose tissue and improves insulin sensitivity potentially via ampk activation date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: dvhkk the chronic low-grade inflammation in adipose tissue plays a causal role in obesity-induced insulin resistance and its associated pathophysiological consequences. in this study, we investigated the effects of extracts of broussonetia papyrifera root bark (pre) and its bioactive components on inflammation and insulin sensitivity. pre inhibited tnf-α-induced nf-κb transcriptional activity in the nf-κb luciferase assay and pro-inflammatory genes’ expression by blocking phosphorylation of iκb and nf-κb in t -l adipocytes, which were mediated by activating ampk. ten-week-high fat diet (hfd)-fed c bl male mice treated with pre had improved glucose intolerance and decreased inflammation in adipose tissue, as indicated by reductions in nf-κb phosphorylation and pro-inflammatory genes’ expression. furthermore, pre activated amp-activated protein kinase (ampk) and reduced lipogenic genes’ expression in both adipose tissue and liver. finally, we identified broussoflavonol b (bf) and kazinol j (kj) as bioactive constituents to suppress pro-inflammatory responses via activating ampk in t -l adipocytes. taken together, these results indicate the therapeutic potential of pre, especially bf or kj, in metabolic diseases such as obesity and type diabetes. inflammation is a protective response against infection, tissue stress, and injury in any tissue and defends and restores physiological functions. however, dysregulated inflammatory processes result in chronic inflammation, which is increasingly seen as a major driver of numerous diseases such as obesity and type diabetes [ ] . obese adipose tissue produces inflammatory cytokines, including tumor necrosis factor (tnf)-α, monocyte chemokine protein (mcp)- , and interleukin (il)- [ ] . subsequently, the elevated inflammatory stimuli induce the activation of the inhibitor of κb (iκb) kinase (ikk)/nf-κb and c-jun n-terminal kinase (jnk) pathways, which negatively regulate insulin action in not only adipose tissue, but also other peripheral tissues, such as liver [ ] . thus, the accumulation of pro-inflammatory responses in adipose tissue may be one of the causal factors for insulin resistance. a previous study has demonstrated that pro-inflammatory gene expression is elevated in adipose tissue in the early onset of obesity, but in other tissues, such as liver and skeletal muscle, there is no differences in the expression of inflammatory gene expressions [ ] . thus, adipose tissues appear to act as priming tissues that respond to a high-fat diet (hfd) and initiate inflammation in obesity. therefore, understanding the inflammatory responses in adipose tissues of obese individuals is of clinical importance. it has been well demonstrated that amp-activated protein kinase (ampk) is a master regulator for energy sensing, which responds to control energy homeostasis. ampk can be activated by various conditions. starvation, hypoxia, exercise, and oxidative damages are the main cellular stresses for activating ampk [ ] . there are two well-known upstream kinases: liver kinase b (lkb ) and ca + /calmodulin-dependent protein kinase kinase (camkk) can activate ampk via phosphorylation. several reports clearly demonstrated that one of the major roles of ampk is regulating metabolic requirement. for example, ampk stimulates energy production pathways through fatty acid oxidation, mitochondrial biogenesis, and glucose catabolism. on the other hand, it inhibits energy-consuming pathways, including fatty acids' synthesis and amino acids' biogenesis [ ] . thus, dysfunctions of ampk or downstream signaling pathways could result in metabolic diseases, such as obesity and type diabetes [ ] . interestingly, it has been reported that ampk could suppress the nf-κb transcriptional activity [ ] . the activation of ampk by aicar ( -aminoimidazole- -carboxamide- -β-d-ribofuranoside) can inhibit colitis [ ] , autoimmune encephalomyelitis [ ] , and inflammation after lung injury [ ] . in contrast, disrupting ampk-mediated signaling in hematopoietic-derived cells induced the infiltration of adipose tissue macrophages (atms) and hepatic steatosis [ ] . in addition, pro-inflammatory responses inhibited the activation of ampk in adipose tissue and induced the expression of pro-inflammatory genes in vivo [ ] . it has been reported that the infiltration of atms is significantly increased in ampkα −/− mice, and these mice showed increased expression of pro-inflammatory genes, such as il- or tnf-α, in adipose tissue [ ] . together, these observations that ampk can suppress inflammation have a significant impact on obese-mediated inflammation in adipose tissue. paper mulberry (broussonetia papyrifera) is a deciduous tree that is distributed throughout asia, and its barks, roots, and fruits are used in traditional chinese medicine. it has been shown that broussonetia papyrifera has anti-tyrosinase and antioxidant activity [ , ] and anti-inflammatory activities in cells [ ] . constituents of the roots of this plant, broussochalcone a, kazinol a, and kazinol i, have been reported as inhibitors of lipopolysaccharide-induced nitric oxide (no) production by suppressing nf-κb activation in macrophages [ , ] . moreover, kazinol b, a b. papyrifera-derived prenylated flavan, has been shown to inhibit no production [ ] . interestingly, kazinol b enhances glucose uptake via akt (a serine/threonine kinase) and ampk activation in adipocytes [ ] . collectively, these reports suggest that b. papyrifera might ameliorate inflammation, but to what degree it elicits systemic insulin sensitivity, and by what mechanism, remains unclear. in the present study, we aimed to demonstrate that roots of b. papyrifera improve pre-established insulin resistance and identify major bioactive compounds that modulate obese-associated inflammation in adipose tissue. the root bark of b. papyrifera was sampled at mugo-ri, gonyang-myeon, sacheon-si, gyeongsangnam-do, south korea, in june , (by dr. jin-hyub paik). the collected raw materials were deposited in the korea research institute of bioscience and biotechnology (kribb) and the international biological material center (ibmrc) (kribb ) [ ] . of the collected roots, only barks were used for obtaining a better yield. the target compounds were isolated from dried root bark of b. papyrifera as previously described [ ] . briefly, the total b. papyrifera root bark extracts (tpre, yield . %) were separated by spot-ii mplc (medium-pressure liquid chromatography) (gilson, middleton, wi, usa) using reversed-phase silica gel (ymc-pack ods-aq hg, × mm, µm, kyoto, japan) eluted with meoh-h o to give tpre nos. - ( figure s a and figure b) . broussoflavonol b and kazinol j were found to be components of tpre no. (pre) based on the uplc-pda-qtof-ms chromatograms ( figure s c ). among these fractions, tpre no. (pre) was subjected to a gx- (automated liquid handler) semipreparative hplc system (gilson, middleton, wi) using a reversed-phase column (ymc-pack ods-aq-hg, µm) and eluted with the meoh-h o gradient system ( % → % meoh, min) by repeated injections of the samples ( g/ml methanol dilutions) to yield four fractions (pre nos. - ~ - ). a further preparation.-hplc procedure was repeated several times using each condition (see below). the fraction - - ( . mg) enriched with broussoflavonol b was further isolated by prep.-hplc (gilson, middleton, ma, usa). broussoflavonol b ( . mg) and broussonol d ( . mg) were isolated using a ymc-pack pro c column. the fraction - - enriched with kazinol j was further isolated by prep.-hplc (plc ) with a gradient system of meoh-h o, and (-)-( s)-kazinol i ( . mg), kazinol j ( . mg), broussoflavonol c ( . mg), and broussonol g ( . mg) were obtained. the isolated compounds were purified as described previously, and purity the was more than . %, as determined by ultra-performance liquid chromatography [ ] . two compounds were characterized using spectroscopic data, including h, c nmr, and hrms, in comparison with previously published data [ , ] . an acquity uplc™ system (waters corporation, milford, ma, usa) equipped with a binary solvent delivery manager and a photodiode array (pda) was used for uplc (ultra-performance liquid chromatography) analysis. hrms analysis was performed using an ultra-performance liquid chromatography quadrupole time of flight mass spectrometry (uplc-qtof-ms) equipped with an electrospray ionization (esi) interface (waters q-tof premiertm, waters corporation, milford, ma, usa). the nmr analysis was carried out using a fourier transform (ft)-nmr spectrometer (jeol ecz r, jeol ltd., akishima, tokyo, japan) for d spectra ( h nmr and c nmr). the overall processes are described in figure s d . all extracts and single compounds for the experiments were prepared by dissolving in dimethyl sulfoxide (dmso, sigma, st. louis, mo, usa). t -l , raw . , and hek cells were obtained from the american tissue culture collection (atcc, manassas, va, usa) and cultured in dulbecco's modified eagle's medium (dmem, life technologies, ny, usa) with % bovine calf serum (invitrogen, gaithersburg, ca, usa) and % fetal bovine serum (atlas, co, usa), respectively. adipocyte differentiation was induced by treating cells with dmem containing % fbs, . mm isobutylmethylxanthine (ibmx), µm dexamethasone, and nm insulin. after h, the medium was replaced every other day with dmem containing % fbs and nm insulin. all chemicals for cell culture were obtained from sigma-aldrich (st. louis, mo, usa) unless otherwise indicated. after - days from initiation of differentiation ( figure s a ), we treated compounds as indicated concentrations and time. after treating fully differentiated adipocytes with pre, bf, or kj for h, cell morphology was monitored by an inverted microscope (zeiss, oberkochen, germany) ( figure s b ). for oil red o staining, t l preadipocytes or differentiated t l adipocytes treated with/without pre, bf, or kj as indicated concentrations were stained with the oil red o staining kit according to the manufacturer´s recommendations (biovision, inc., milpitas, ca, usa). hek- cells were transfected with nf-κb-responsive luciferase reporter (promega, san luis obispo, wi, usa) and prl-renilla using lipofectamine (invitrogen, gaithersburg, ca, usa). following an overnight transfection, the cells were treated with pre, bf, or kj for h, followed by treatment with tnf-α ( ng/ml) for h. dmso was used as the vehicle. the cells were harvested, and reporter gene assays were carried out using the dual-luciferase kit (promega, san luis obispo, wi, usa). luciferase activity was normalized to renilla activity. raw macrophages were seeded in well plates ( . × cells/ml) and treated with pre, br or kj as the indicated concentration with/without lipopolysaccharide (lps, sigma, st. louis, mo, usa) for h. for no production, the amount of no was calculated by measured nitrate in media using griess reagent according to the manufacturer´s recommendations (sigma, st. louis, mo, usa). for cell viability, cells were determined using the mtt solution ( -( , -dimethylthiazol- -yl)- , -diphenyltetrazolium bromide), sigma, st. louis, mo, usa) at . mg/ml. the purple formazan crystals were dissolved in dmso, and the absorbance was recorded on a microplate reader at a wavelength of nm. all animal experiments were performed according to the procedures approved by ulsan national institute of science and technology's institutional animal care and use committee (unistiacuc- - ). seven-week-old male c bl/ j mice (dbl, samsung, korea) were fed a high fat diet ( % kcal fat, d , research diets inc., new brunswick, nj, usa) for weeks the mice were housed (n = /cage) and granted free access to food and water. food and water were changed once a week. for glucose tolerance tests (gtt), mice were intraperitoneally (i.p.) injected daily with mg/kg of pre or vehicle (saline containing % dmso and % tween (sigma, st. louis, mo, usa) for days and fasted for h ( p.m. to a.m.) prior to i.p. injection of d-glucose ( g/kg body weight). pre solution prepared at mg/ml in saline containing % dmso and % tween was injected in an amount of µl/g of body weight. fasting insulin was determined using the ultrasensitive mouse insulin elisa kit (crystal chem., eik grove village, il, usa). once mice were sacrificed, isolated adipose tissue and liver were weighed and immediately frozen in liquid nitrogen and then used for western blot analysis and gene expression analysis. liver sections were embedded in paraffin and stained with hematoxylin and eosin (h&e) to visualize hepatocytes and lipid droplets in the tissues. sections were analyzed by an inverted microscope (zeiss, oberkochen, germany). each sample (cells or tissues) was lysed with ripa lysis buffer containing protease and phosphatase inhibitor (sigma-aldrich, st. louis, mo, usa). an equal amount of protein was separated on sds-page and transferred onto nitrocellulose membranes (ge healthcare, chigago, il, usa). the membranes were blocked in a % bovine serum albumin (bsa) blocking buffer and incubated with specific primary antibodies for phospho-nf-κb, nf-κb, phospho-iκb, iκb, phospho-ampk, ampk, phospho-acc, and acc (cell signal technology, danver, ma, usa) at • c overnight. the signals were detected using an ecl detection kit (ge healthcare, chigago, il, usa), followed by incubation with horseradish peroxidase-conjugated secondary antibodies (thermofisher, gaithersburg, ca, usa). we quantified the band intensity by using the imagej program (nih, bethesda, md, usa). total rna was isolated from cells or tissues using trizol reagents (invitrogen, city, ca, usa). the rna was reverse-transcribed using the abi reverse transcription kit. quantitative pcr reactions were performed with sybr green fluorescent dye using an abi pcr machine. relative mrna expression was determined by the ∆∆-ct method normalized to tata-binding protein (tbp) levels. data were presented as the means +s.e.m. statistical significance was estimated by an unpaired t-test for comparisons between two conditions. a one-way anova was used for comparisons between more than two conditions. dunnett's post hoc test was used for multiple comparisons. all statistics were performed with graphpad prism . software (graphpad, san diego, ca, usa). to investigate the effects of pre on inflammation, we first tested nf-κb transcriptional activity of tpre because nf-κb is an essential regulator of pro-inflammatory response ( figure s ). as shown in figure a , tpre suppressed nf-κb transcriptional activity induced by tnf-α, and it was dose-dependent. to further evaluate the effect of tpre for inhibiting nf-κb activity, we partitioned tpre using medium-pressure liquid chromatography into eight sub-fractions ( figure s ), which were then used to assay nf-κb transcriptional activity. of the eight sub-fractions, four fractions significantly inhibited nf-κb transcriptional activity induced by tnf-α. sub-fraction (pre) had the most potent activity for inhibiting nf-κb activation and dose-dependently repressed nf-κb transcriptional activity ( figure b ,c). -aminoimidazole- -carboxamide ribonucleotide (aicar), an amp analog, was used as the positive control for ampk activation. nutrients , , of data were presented as the means +s.e.m. statistical significance was estimated by an unpaired t-test for comparisons between two conditions. a one-way anova was used for comparisons between more than two conditions. dunnett's post hoc test was used for multiple comparisons. all statistics were performed with graphpad prism . software (graphpad, san diego, ca, usa). to investigate the effects of pre on inflammation, we first tested nf-κb transcriptional activity of tpre because nf-κb is an essential regulator of pro-inflammatory response ( figure s ). as shown in figure a , tpre suppressed nf-κb transcriptional activity induced by tnf-α, and it was dosedependent. to further evaluate the effect of tpre for inhibiting nf-κb activity, we partitioned tpre using medium-pressure liquid chromatography into eight sub-fractions ( figure s ), which were then used to assay nf-κb transcriptional activity. of the eight sub-fractions, four fractions significantly inhibited nf-κb transcriptional activity induced by tnf-α. sub-fraction (pre) had the most potent activity for inhibiting nf-κb activation and dose-dependently repressed nf-κb transcriptional activity ( figure b and figure c ). -aminoimidazole- -carboxamide ribonucleotide (aicar), an amp analog, was used as the positive control for ampk activation. next, we further tested the effect of pre on inflammatory responses. differentiated adipocytes were treated with tnf-α, and we examined the effects of pre on the expression of pro-inflammatory genes. as shown in figure a , pre repressed the tnf-α-mediated pro-inflammatory gene, and this effect was dose-dependent. furthermore, pre blocked lipopolysaccharide (lps)-induced proinflammatory response in raw . cells, as previously reported ( figure s ) [ ] . ampk is a wellknown, important inflammatory suppressor, and ampk signaling critically regulates inflammation in many cell types [ ] . therefore, to further investigate the molecular mechanism involved in preassociated repression of the nf-κb signaling pathway, we first tested whether pre activated ampk. in t -l adipocytes, pre enhanced the phosphorylation of ampk, while pre did not affect ampk protein level. this phosphorylation was blocked by compound c, a specific inhibitor of ampk ( figure b) . similarly, the phosphorylation of acetyl-coa carboxylase (acc), a substrate of ampk, was enhanced by pre treatment, and its phosphorylation was blocked by compound c treatment. next, we further tested the effect of pre on inflammatory responses. differentiated adipocytes were treated with tnf-α, and we examined the effects of pre on the expression of pro-inflammatory genes. as shown in figure a , pre repressed the tnf-α-mediated pro-inflammatory gene, and this effect was dose-dependent. furthermore, pre blocked lipopolysaccharide (lps)-induced pro-inflammatory response in raw . cells, as previously reported ( figure s ) [ ] . ampk is a well-known, important inflammatory suppressor, and ampk signaling critically regulates inflammation in many cell types [ ] . therefore, to further investigate the molecular mechanism involved in pre-associated repression of the nf-κb signaling pathway, we first tested whether pre activated ampk. in t -l adipocytes, pre enhanced the phosphorylation of ampk, while pre did not affect ampk protein level. this phosphorylation was blocked by compound c, a specific inhibitor of ampk ( figure b) . similarly, the phosphorylation of acetyl-coa carboxylase (acc), a substrate of ampk, was enhanced by pre treatment, and its phosphorylation was blocked by compound c treatment. pre treatment decreased tnf-α-induced phosphorylation of iκb and nf-κb in adipocytes ( figure c ). in addition, pretreatment with aicar specifically inhibited tnf-α-mediated pro-inflammatory signaling. pretreatment with compound c blocked pre-induced suppression of phosphorylation of iκb and nf-κb in t -l adipocytes ( figure c ). together, these results strongly suggest that pre suppresses tnf-α-mediated pro-inflammatory gene expression by activating ampk. nutrients , , of pre treatment decreased tnf-α-induced phosphorylation of iκb and nf-κb in adipocytes ( figure c ). in addition, pretreatment with aicar specifically inhibited tnf-α-mediated pro-inflammatory signaling. pretreatment with compound c blocked pre-induced suppression of phosphorylation of iκb and nf-κb in t -l adipocytes ( figure c ). together, these results strongly suggest that pre suppresses tnf-α-mediated pro-inflammatory gene expression by activating ampk. next, we determined whether pre exhibited anti-diabetic activities in vivo. ten-week-hfd-fed c bl/ mice were used for a glucose tolerance test (gtt). pre and glucose were administrated intraperitoneally, because the components of pre have been reported to inhibit alpha-glucosidase to exclude the possibility that oral glucose and pre administration suppress glucose absorption from the gut [ ] . the pre-treated group showed increased glucose tolerance compared to that in control mice ( figure a ). plasma glucose levels in pre-treated mice, as determined by the area under the curve (auc), were significantly suppressed compared to those of control mice. furthermore, the fasting insulin level showed a tendency to decrease ( figure c ), suggesting that pre ameliorates obesity-induced glucose intolerance. body weight ( figure b ), adipose tissue weight ( figure s a ), and liver weight ( figure s b) were not changed by treatment with pre. after t -l adipocytes were pre-incubation with/without compound c for h, cells were treated with pre or aicar for an additional h. the expression of phospho-ampk, ampk, phospho-acc, and acc was analyzed by western blotting. (c) t -l adipocytes were pretreated with the indicated concentration of pre for h and aicar for h before ng/ml tnf-α treatment for min. compound c (comp. c) was pretreated for h before pre treatment. the expression of phospho-iκb, iκb, phospho-nf-κb, nf-κb, and tubulin was analyzed by western blotting. next, we determined whether pre exhibited anti-diabetic activities in vivo. ten-week-hfd-fed c bl/ mice were used for a glucose tolerance test (gtt). pre and glucose were administrated intraperitoneally, because the components of pre have been reported to inhibit alpha-glucosidase to exclude the possibility that oral glucose and pre administration suppress glucose absorption from the gut [ ] . the pre-treated group showed increased glucose tolerance compared to that in control mice ( figure a ). plasma glucose levels in pre-treated mice, as determined by the area under the curve (auc), were significantly suppressed compared to those of control mice. furthermore, the fasting insulin level showed a tendency to decrease ( figure c ), suggesting that pre ameliorates obesity-induced glucose intolerance. body weight ( figure b ), adipose tissue weight ( figure s a ), and liver weight ( figure s b our initial results showed that pre activated ampk and suppressed pro-inflammatory mediators in vitro. therefore, we tested whether pre activated ampk and nf-κb in obese adipose tissue in vivo. upon treatment with pre, nf-κb phosphorylation was significantly decreased, whereas ampk phosphorylation was increased in epididymal white adipose tissue (ewat) ( figure a ). next, we assessed the effects of pre on inflammation in adipose tissue. as shown in figure b , the expression of pro-inflammatory genes (il- β and inducible nitric oxide synthase (inos)) was significantly reduced in ewat after treatment with pre. however, marker genes of macrophages (f / , cd b, and cd ) or marker genes of the m macrophage, including arginase- (arg- ), mannose receptor c-type (mrc- ), macrophage galactose binding lectin (mgl), and ym- (chitinaselike ) were not changed ( figure s ). interestingly, pre-treated hfd-fed mice showed significantly decreased expression of lipogenic genes (fatty acid synthase (fasn), sterol regulatory element-binding protein (srebp- c), and acc- ) in adipose tissue ( figure c ). these results indicated that pre had anti-inflammatory and anti-lipogenic activities in adipose tissue. our initial results showed that pre activated ampk and suppressed pro-inflammatory mediators in vitro. therefore, we tested whether pre activated ampk and nf-κb in obese adipose tissue in vivo. upon treatment with pre, nf-κb phosphorylation was significantly decreased, whereas ampk phosphorylation was increased in epididymal white adipose tissue (ewat) ( figure a ). next, we assessed the effects of pre on inflammation in adipose tissue. as shown in figure b , the expression of pro-inflammatory genes (il- β and inducible nitric oxide synthase (inos)) was significantly reduced in ewat after treatment with pre. however, marker genes of macrophages (f / , cd b, and cd ) or marker genes of the m macrophage, including arginase- (arg- ), mannose receptor c-type (mrc- ), macrophage galactose binding lectin (mgl), and ym- (chitinase-like ) were not changed ( figure s ). interestingly, pre-treated hfd-fed mice showed significantly decreased expression of lipogenic genes (fatty acid synthase (fasn), sterol regulatory element-binding protein (srebp- c), and acc- ) in adipose tissue ( figure c ). these results indicated that pre had anti-inflammatory and anti-lipogenic activities in adipose tissue. our initial results showed that pre activated ampk and suppressed pro-inflammatory mediators in vitro. therefore, we tested whether pre activated ampk and nf-κb in obese adipose tissue in vivo. upon treatment with pre, nf-κb phosphorylation was significantly decreased, whereas ampk phosphorylation was increased in epididymal white adipose tissue (ewat) ( figure a ). next, we assessed the effects of pre on inflammation in adipose tissue. as shown in figure b , the expression of pro-inflammatory genes (il- β and inducible nitric oxide synthase (inos)) was significantly reduced in ewat after treatment with pre. however, marker genes of macrophages (f / , cd b, and cd ) or marker genes of the m macrophage, including arginase- (arg- ), mannose receptor c-type (mrc- ), macrophage galactose binding lectin (mgl), and ym- (chitinaselike ) were not changed ( figure s ). interestingly, pre-treated hfd-fed mice showed significantly decreased expression of lipogenic genes (fatty acid synthase (fasn), sterol regulatory element-binding protein (srebp- c) , and acc- ) in adipose tissue ( figure c ). these results indicated that pre had anti-inflammatory and anti-lipogenic activities in adipose tissue. next, we examined whether pre prevented hepatic steatosis, which is increased by obesity. histological observations revealed that pre significantly suppressed hepatic steatosis in obese mice induced by hfd ( figure a and figure s ). because ampk plays crucial roles in suppressing hepatic steatosis [ ] and pre activated ampk in adipose tissue, we examined ampk signaling in liver. as shown in figure b , treatment with pre increased ampk phosphorylation in liver. furthermore, pre significantly decreased lipogenic gene expression (srebp- c and stearoyl-coa desaturase- (scd- )) ( figure c ). in addition, pre increased the expression of acyl-coa synthetase long-chain (acsl), very-long-chain acyl-coa dehydrogenase (vlcad), and short-chain acyl-coa dehydrogenase (scad), which are involved in fatty acid oxidation ( figure d ). taken together, these results suggested that pre activated ampk, which improved fatty liver. genes (b) and lipogenic genes (c) were analyzed by quantitative real-time pcr. data are shown as the mean±s.e.m. (n = ) *p < . ; **p < . ; ***p < . vs. hfd-fed vehicle group. next, we examined whether pre prevented hepatic steatosis, which is increased by obesity. histological observations revealed that pre significantly suppressed hepatic steatosis in obese mice induced by hfd ( figure a and figure s ). because ampk plays crucial roles in suppressing hepatic steatosis [ ] and pre activated ampk in adipose tissue, we examined ampk signaling in liver. as shown in figure. b, treatment with pre increased ampk phosphorylation in liver. furthermore, pre significantly decreased lipogenic gene expression (srebp- c and stearoyl-coa desaturase- (scd- )) ( figure. c ). in addition, pre increased the expression of acyl-coa synthetase long-chain (acsl), very-long-chain acyl-coa dehydrogenase (vlcad), and short-chain acyl-coa dehydrogenase (scad), which are involved in fatty acid oxidation (figure. d ). taken together, these results suggested that pre activated ampk, which improved fatty liver. to identify the bioactive compounds in pre that activate ampk, we isolated compounds via methanolic extraction ( figure s ). among them, we found that broussoflavonol b (bf) and kazinol j (kj) dramatically increased ampk phosphorylation in t -l adipocytes ( figure a ). both bf and kj increased ampk and acc phosphorylation, and compound c significantly blocked them ( figure b ). furthermore, bf and kj significantly suppressed tnf-α-induced nf-κb transcriptional activity ( figure c ). consistent with nf-κb activity, treatment with bf and kj downregulated tnf-αstimulated pro-inflammatory gene expression (il- , mcp- , and inos-only in the bf-treated group) in adipocytes ( figure d ). in addition, both bf and kj decreased iκb degradation and nf-κb phosphorylation, and compound c significantly blocked them ( figure e ). they also suppressed lps-mediated no production in raw . ( figure s ). together, these results strongly indicated that bf and kj were bioactive compounds of pre and could block an inflammatory response through blocking the nf-κb signaling pathway via ampk activation. to identify the bioactive compounds in pre that activate ampk, we isolated compounds via methanolic extraction ( figure s ). among them, we found that broussoflavonol b (bf) and kazinol j (kj) dramatically increased ampk phosphorylation in t -l adipocytes ( figure a ). both bf and kj increased ampk and acc phosphorylation, and compound c significantly blocked them ( figure b ). furthermore, bf and kj significantly suppressed tnf-α-induced nf-κb transcriptional activity ( figure c ). consistent with nf-κb activity, treatment with bf and kj downregulated tnf-α-stimulated pro-inflammatory gene expression (il- , mcp- , and inos-only in the bf-treated group) in adipocytes ( figure d ). in addition, both bf and kj decreased iκb degradation and nf-κb phosphorylation, and compound c significantly blocked them ( figure e ). they also suppressed lps-mediated no production in raw . ( figure s ). together, these results strongly indicated that bf and kj were bioactive compounds of pre and could block an inflammatory response through blocking the nf-κb signaling pathway via ampk activation. (b) t -l adipocytes were pre-incubated with/without compound c ( μm) for h, and then, cells were treated with bf or kj for an additional h. the expression of phospho-ampk, ampk, phospho-acc, and acc was analyzed by western blotting. (c) hek- cells were transfected with the nf-κb-responsive luciferase reporter and prl-renilla. the cells were treated with bf and kj as the indicated concentration for h, followed by treatment with tnf-α ( ng/ml) for an additional h. the cells were harvested, and luciferase activity was measured. data are shown as the mean ± s.e.m (n = ) *p < . ; **p < . ; ***p < . vs. the tnf-α-only-treated group. (d) after t -l adipocytes were pretreated with/without compound c, cells were incubated with/without bf or kj for h and stimulated with tnf-α ( ng/ml) for min. the expressions of phospho-iκb, iκb, phospho-nf-κb, nf-κb, and tubulin were analyzed by western blotting. (e) t -l adipocytes were pre-incubated with the indicated concentration of bf or kj for h, followed by treatment with ng/ml tnf-α for h. total rna was isolated, and the mrna expression level of each gene was analyzed by quantitative real-time pcr. data are shown as the mean ± s.e.m (n = ) *p < . ; **p < . ; ***p < . vs. the tnf-αonly-treated group. obesity is very closely related to chronic and low-grade inflammation. many reports have suggested that insulin resistance accompanies chronic inflammation and abnormal mediator secretion in obese adipose tissue [ ] , indicating that reduction of tissue inflammation could be an indispensable target for improving obesity-related metabolic syndromes. it has been reported that the cells were treated with bf and kj as the indicated concentration for h, followed by treatment with tnf-α ( ng/ml) for an additional h. the cells were harvested, and luciferase activity was measured. data are shown as the mean ± s.e.m. (n = ) * p < . ; ** p < . ; *** p < . vs. the tnf-α-only-treated group. (d) after t -l adipocytes were pretreated with/without compound c, cells were incubated with/without bf or kj for h and stimulated with tnf-α ( ng/ml) for min. the expressions of phospho-iκb, iκb, phospho-nf-κb, nf-κb, and tubulin were analyzed by western blotting. (e) t -l adipocytes were pre-incubated with the indicated concentration of bf or kj for h, followed by treatment with ng/ml tnf-α for h. total rna was isolated, and the mrna expression level of each gene was analyzed by quantitative real-time pcr. data are shown as the mean ± s.e.m. (n = ) * p < . ; ** p < . ; *** p < . vs. the tnf-α-only-treated group. obesity is very closely related to chronic and low-grade inflammation. many reports have suggested that insulin resistance accompanies chronic inflammation and abnormal mediator secretion in obese adipose tissue [ ] , indicating that reduction of tissue inflammation could be an indispensable target for improving obesity-related metabolic syndromes. it has been reported that roots of b. papyrifera have been used as a suppressant for edema in traditional chinese medicine [ ] . the core phytochemicals in the roots of b. papyrifera are flavonols, flavans, and chalcones [ ] . there is emerging evidence that these core phytochemicals have anti-inflammatory activities. [ , , ] . in the present study, we focused on the anti-inflammatory effects of pre in adipose tissue and investigated whether it could ameliorate systemic insulin resistance in obese mice. pre potently inhibited tnf-α-induced inflammatory responses by suppressing nf-κb activation in adipocytes. this effect improved not only glucose tolerance, but also hepatic steatosis in hfd-induced obese mice. using the fda guideline to calculate human equivalent doses (hed), the hed of this effective dose of pre ( mg/kg) was mg/day in humans. this dose was lower than that of metformin ( mg~ mg/day) even though pre was a crude extract. furthermore, bf and kj, the isolated phytochemicals from pre, were the bioactive compounds that suppressed inflammatory responses in t -l adipocytes through blocking nf-κb signaling. of significance, these effects were partially dependent on ampk activation in adipocytes ( figure s ) . ampk has been shown to have strong anti-inflammatory activity via inhibiting inflammatory responses in various in vivo models [ ] . various studies have shown that ampk inhibits pro-inflammatory signaling in many tissues and cells, especially adipocytes and macrophages, which are the main cell types of adipose tissue [ , ] . in addition, ampk ameliorates insulin resistance in obesity [ , , , ] . it has been reported that ampk activators specifically suppressed the expression of pro-inflammatory genes and the activation of nf-κb-mediated signaling [ , ] . the molecular mechanism for nf-κb activation is: ( ) the degradation of iκb in a ubiquitin-dependent manner is triggered through its phosphorylation by ikk; ( ) iκb degradation results in nuclear translocation of nf-κb [ ] . based on these results, we proposed the roles of pre and its constituents to inhibit nf-κb transcriptional activity through the blockade of phosphorylation-mediated iκb degradation and nf-κb phosphorylation; this effect was reversed by inhibition of ampk. thus, pre-mediated nf-κb inactivation would likely be accompanied by inhibition of the tnf-α-stimulated ikk/iκb/nf-κb signaling pathway. in addition to the identified signaling pathways, it remains to be elucidated whether other molecular mechanisms for the ampk-mediated anti-inflammatory effect of pre exist. ampk has several phosphorylation targets [ ] , but there are some reports suggesting that ampk could inhibit nf-κb activity and its signaling indirectly via sirtuin (sirt ) [ ] , the forkhead box o (foxo) family [ ] , and peroxisome proliferator-activated receptor γ co-activator (pgc- α) [ ] , which are known as downstream mediators of ampk. these mediators could inactivate the p subunit of nf-κb, and the expression of pro-inflammatory genes is subsequently repressed. thus, further studies related to the underlying mechanism of how pre and its active components regulate ampk activation and its resultant anti-inflammatory effect are needed. obesity-associated adipocyte dysfunction by chronic inflammation in adipose tissue contributes to developing hepatic steatosis: ( ) excessive free fatty acids from adipose tissue, which stimulate inflammation, could be delivered to liver; thus, triglycerides could be accumulated in liver; ( ) adipose tissue secretes pro-inflammatory cytokines including tnf-α, which exacerbate inflammation in liver and induce hepatic steatosis [ ] . here, we demonstrated that pre did not alter ewat mass and adiposity, by it ameliorated adipose tissue inflammation indicated by significant decreases in the pro-inflammatory signaling and pro-inflammatory genes' expression. furthermore, pre enhanced ampk activation, which regulates gene expression related to fatty acid oxidation and lipogenesis. thus, improved adipose tissue inflammation and ampk activation by pre could ameliorate hepatic steatosis. we demonstrated that pre and its active components had potential therapeutic effects on ameliorating inflammation in both adipose tissue and liver. furthermore, pre could reduce hepatic steatosis and improve glucose homeostasis. in addition, we proposed that the activation of ampk by pre and its active components could be the underlying molecular mechanism by which they have anti-inflammatory effects. taken together, these finding demonstrated the beneficial effects of b. papyrifera root and its phytochemicals and indicated their potential as candidates for targeting ampk for the treatment of obesity and/or type diabetes. the following are available online at http://www.mdpi.com/ - / / / /s : figure s : scheme of extract and isolation, figure s : adipogenic induction of t l preadipocytes into adipocytes, figure s : the effect of pre on adipose tissue and liver weight, figure s : the effects of pre on lps-induced pro-inflammatory gene expression in raw . cells, figure s : the effect of pre on adipose tissue and liver weight, figure s : the effect of pre on macrophage infiltration and polarization in hfd-fed obese mice, figure s : the effect of pre in liver steatosis, figure s : the effect of bf and kj on lps-induced no production and cell viability in raw . cells, figure s : pre improves insulin sensitivity via suppressing inflammation by activation of ampk in adipose tissue. chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance inflammation and insulin resistance inflammation is necessary for long-term but not short-term high-fat diet-induced insulin resistance ampk as a therapeutic target for treating metabolic diseases. trends endocrino ampk: mechanisms of cellular energy sensing and restoration of metabolic balance exploiting the anti-inflammatory effects of amp-activated protein kinase activation ampk agonist downregulates innate and adaptive immune responses in tnbs-induced murine acute and relapsing colitis singh, i. -aminoimidazole- -carboxamide ribonucleoside: a novel immunomodulator with therapeutic efficacy in experimental autoimmune encephalomyelitis ampk agonists ameliorate sodium and fluid transport and inflammation in cystic fibrosis airway epithelial cells hematopoietic ampk β reduces mouse adipose tissue macrophage inflammation and insulin resistance in obesity macrophage alpha amp-activated protein kinase (alpha ampk) antagonizes fatty acid-induced inflammation through sirt amp-activated protein kinase α protects against diet-induced insulin resistance and obesity antityrosinase and antioxidant effects of ent-kaurane diterpenes from leaves of broussonetia papyrifera antioxidant lignans from the fruits of broussonetia papyrifera comparison with various parts of broussonetia papyrifera as to the antinociceptive and anti-inflammatory activities in rodents inhibition of nitric oxide production on lps-activated macrophages by kazinol b from broussonetia kazinoki kazinol b from broussonetia kazinoki improves insulin sensitivity via akt and ampk activation in t -l adipocytes anti-inflammatory flavonoids from root bark of broussonetia papyrifera in lps-stimulated raw . cells evaluation of polyphenols from broussonetia papyrifera as coronavirus protease inhibitors polyphenols from broussonetia papyrifera displaying potent alpha-glucosidase inhibition inflammation, stress, and diabetes five new diprenylated flavonols from the leaves of broussonetia kazinoki the genus broussonetia: a review of its phytochemistry and pharmacology prenylated polyphenols from broussonetia kazinoki as inhibitors of nitric oxide production role of amp-activated protein kinase in adipose tissue metabolism and inflammation adenosine -monophosphate-activated protein kinase promotes macrophage polarization to an anti-inflammatory functional phenotype luteolin reduces obesity-associated insulin resistance in mice by activating ampkα signalling in adipose tissue macrophages berberine suppresses proinflammatory responses through ampk activation in macrophages nf -κb, inflammation, immunity and cancer: coming of age amp-activated protein kinase and its downstream transcriptional pathways tnf-α reduces pgc- α expression through nf-κb and p mapk leading to increased glucose oxidation in a human cardiac cell model the authors declare no conflict of interest. key: cord- -qwhaesfk authors: hurley, walter l.; theil, peter k. title: perspectives on immunoglobulins in colostrum and milk date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: qwhaesfk immunoglobulins form an important component of the immunological activity found in milk and colostrum. they are central to the immunological link that occurs when the mother transfers passive immunity to the offspring. the mechanism of transfer varies among mammalian species. cattle provide a readily available immune rich colostrum and milk in large quantities, making those secretions important potential sources of immune products that may benefit humans. immune milk is a term used to describe a range of products of the bovine mammary gland that have been tested against several human diseases. the use of colostrum or milk as a source of immunoglobulins, whether intended for the neonate of the species producing the secretion or for a different species, can be viewed in the context of the types of immunoglobulins in the secretion, the mechanisms by which the immunoglobulins are secreted, and the mechanisms by which the neonate or adult consuming the milk then gains immunological benefit. the stability of immunoglobulins as they undergo processing in the milk, or undergo digestion in the intestine, is an additional consideration for evaluating the value of milk immunoglobulins. this review summarizes the fundamental knowledge of immunoglobulins found in colostrum, milk, and immune milk. the topic of immunoglobulins in milk immediately brings to mind the relationship between mother's milk, transfer of passive immunity from mother to neonate, and the immature immune system of the neonate. research in this field dates back to the late nineteenth century, however for many centuries herdsmen have capitalized on the linkage between maternal immune status and the immunological protection and development of the neonate [ , ] . immunoglobulins in mammary secretions come from several sources and represent a history of the antigen exposure of the mother and the response of her immune system. immunoglobulins are transported through the mammary epithelial cells by receptor-mediated mechanisms and transferred out of the mammary gland by milk ejection during suckling. the immunoglobulins then enter the environment of the gastrointestinal tract of the neonate. although that environment is primarily geared toward digestion to gain nutritional benefit, the immunoglobulins remain sufficiently stable to provide protective benefits for the neonate, either through uptake into the vascular system in the newborn of some species or through immunological function in the gastrointestinal tract. the immunoglobulins found in milk and the transfer of passive immunity from mother to neonate have been reviewed by many authors, with a partial listing referenced here [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . in addition to the importance of homologous transfer of passive immunity between mother and neonate, there is considerable interest in the potential for heterologous transfer of passive immunity, such as immunoglobulins obtained from one species and utilized for passive immunity in another species. the ability to manipulate the immunological status of animals through vaccination against diseases that affect humans and the opportunity to harvest those immunoglobulins in the form of colostrum or milk has long been recognized [ , ] , and continues to be a topic of interest in both animal science and human medicine [ , , , [ ] [ ] [ ] . this review begins with a summary of some of the research on what has been termed -immune milk‖ and then discusses various aspects of immunoglobulins in mammary secretions (structure, function, concentration, sources, transport, species differences, and roles of immunoglobulins). finally, traits related to stability and processing methods for collecting milk immunoglobulins are reviewed. one intriguing application of our knowledge about bovine colostral and milk immunoglobulins comes through the opportunity to provide passive immunity against diseases in other species, especially in humans. the ability to direct the cow's immune system to produce antigen-specific antibodies that are secreted in colostrum and milk and may be used to provide protection against a specific disease continues to be an area of interest. for example, the widespread consumption of immune milk from cows inoculated against diseases such as avian influenza, sars, and other human respiratory diseases, has been suggested as a potential means of slowing outbreaks of the disease before they reach epidemic levels [ ] . a number of reviews have summarized and evaluated early attempts to develop and test the use of immune milk products to provide passive immune protection [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . several immune milk products are available commercially [ , , , , ] . safety issues associated with use of bovine immune milk products for human use have been discussed by others [ , [ ] [ ] [ ] . the discussion below provides some examples of immune milk products and their use against some animal and human diseases (sections . - . ). secretion of antibodies in breast milk from naturally immunized mothers can provide protection against enteric and other diseases in children [ ] . for example, elevated concentrations of antibodies specific for enteric pathogens, such as vibrio cholerae, in the mother's breast milk do not prevent colonization with the bacterium in the nursing child, but do seem to protect the infected child from developing diarrhea [ ] . breast feeding is associated with a reduced incidence of campylobacter diarrhea in young children compared with children that do not breast feed [ ] . in those children that are breast fed and do develop diarrhea, the human milk consumed may not contain iga antibodies specific for the common antigen of campylobacter [ ] , suggesting a degree of antigen specificity contained in the breast milk. the idea of immunizing the pregnant animal with the intent of controlling neonatal morbidity and mortality is well established [ ] . vaccination or natural immunization of the pregnant cow, ewe or sow against enterotoxigenic escherichia coli [ ] [ ] [ ] or intestinal viruses [ , ] , can provide a degree of protection for the newborn. as an example, while only limited protection against viral challenge occurred in calves fed once shortly after birth with a pooled colostrum from cows immunized against bovine rotavirus, a shorter duration of diarrhea was observed [ ] . on the other hand, calves fed milk supplements with low levels of a similar immune colostrum at each feeding for two weeks did have reduced virus sheading and reduced incidence of diarrhea [ ] . in primates, immunization of pregnant baboons with a rhesus rotavirus vaccine increased milk immunoglobulin and virus neutralizing titre [ ] . prenatal immunization of pregnant women with a single dose of meningococcal vaccine not only increased antigen-specific igg antibody in the infant's serum during the initial - months after birth, but antigen-specific iga in milk continued to be elevated at least up to months [ ]. as discussed in section , igg transfer to the offspring in humans occurs during late pregnancy and provides the initial systemic source of that immunoglobulin. infants consuming breast milk will primarily be consuming secretory iga (section ), which has significant protective activity in the intestine, as discussed in section . . the above examples of homologous transfer of passive immunity set the stage for considering the opportunities for heterologous passive transfer. immune milk products generally are some form of protein product derived from the colostrum and/or milk of dairy cattle. the cows typically are hyperimmunized against one or more antigens representing pathogens of bacterial or viral origin. crude preparations of the immunoglobulin from colostrum or milk may range from essentially no alteration of the immunoglobulin concentration in the product to partial immunoglobulin isolation or concentration in a whey protein concentrate. the primary immunoglobulin in cow colostrum and milk is igg, whereas the primary immunoglobulin in human milk is iga [ ] . nevertheless, bovine igg from colostrum or milk can be effective as a means of providing passive immunity to protect animals and humans from disease. the use of bovine colostral immunoglobulin preparations from immunized cows for disease protection of the neonate of other species has been demonstrated in swine [ ] , and experimental animal models such as mice [ , ] . there also are a number of examples of the use of bovine immune milk products in the treatment or prevention of human disease, especially in cases where the pathogen acts by way of the gastrointestinal tract. when considering these studies, it should always be kept in mind that the colostrum or milk preparations potentially contain other immune modulating substances than immunoglobulins, as discussed briefly below (section . ). the concept of using immune milk derived from hyperimmunized cows for treatment of human disease can be traced back to the s and earlier [ , ] . some of the early efforts in this field involved using immune milk products for treatment of rheumatoid arthritis and hay fever [ ] . immune milk preparations produced from milk from cows immunized with a heat-killed, lyophilized mixture of bacteria found to reside in the human gastrointestinal tract has been studied for the prevention and treatment of rheumatoid arthritis, high blood cholesterol, high blood pressure, and oral submucous fibrosis [ ] [ ] [ ] [ ] . on the other hand, most studies on the use of immune milk have examined the potential of immune milk for prevention and treatment of infectious diseases, particularly gastrointestinal disease. even milk that does not come form hyperimmunized cows may in some sense be regarded as immune milk. bovine anti-human rotavirus igg antibodies have been found in raw and pasteurized milk from cows that had not been specifically immunized against that virus [ ] . milk from non-immunized cows also has been found to contain measurable antigen-binding activity against several human pathogenic bacteria [ ] . several authors have tested the efficacy of immunoglobulin preparations with antibody activity against human rotavirus as a means of providing passive immunity to children. for example, children consuming a defatted colostrum preparation from cows immunized against a strain of human rotavirus had no improvement of symptoms when the infection was established (patients admitted to a hospital with rotavirus infection), however the preparation was effective in limiting diarrhea in children when consumed prior to the infection [ , ] . in another study, cessation of excretion of rotavirus in the stool of infants with acute rotavirus gastroenteritis was correlated with the presence of neutralizing activity in the stool after ingestion of a bovine whey protein concentrate from rotavirus-hyperimmunized cows [ ] , although there was not a significant decrease in duration of diarrhea in that study. other studies have found that treatment of children with hyperimmune bovine colostrum from cows immunized with human rotavirus serotypes reduces the duration and severity of diarrhea due to rotavirus [ ] , and can provide significant protection from rotavirus infection [ ] . enteropathogenic bacteria have also been the target for development of immune milk. over % of childrens' stools became negative for the e. coli strains used to hyperimmunize the cows that provided the source of immunoglobulin in a bovine colostrum/milk immunoglobulin concentrate consumed by children for days [ ] . interestingly, only one in nine children treated with the immunoglobulin concentrate, and having diarrhea that was associated with e. coli strains which were not used in the immunization of the cows, developed negative stools, underscoring the importance of the bacterial strain-specificity of the immune product. consumption of a hyperimmune immunoglobulin concentrate with a high antibody titer against a lipopolysaccharide isolated from shigella flexneri a also has been shown to provide protection against a challenge with the same strain [ ] . however, no difference in diarrhea or other symptoms in children with stools positive for s. dysenteriae was found whether treated with bovine colostrum from cows immunized against s. dysenteriae or with colostrum from cows not hyperimmunized [ ] . enterotoxigenic e. coli also is commonly associated with traveler's diarrhea. prophylaxis against this infection may be achieved by providing passive immunity with immune milk. a bovine whey protein concentrate from cows immunized with enterotoxigenic e. coli serotypes and consumed -times daily for seven days protected all of the adult volunteers from developing diarrhea after being challenged with an enterotoxigenic e. coli strain [ ] . in contrast, % of the volunteers who received control immunoglobulin concentrate prior to challenge developed diarrhea after the e. coli challenge. subsequent studies using igg isolated from bovine colostrum from cows hyperimmunized against specific e. coli colonization factor antigens also have shown protective effects in volunteers challenged with colonization factor antigen-bearing enterotoxigenic e. coli [ ] , however other studies by the same group did not demonstrate significant effects of similar milk immunoglobulin products [ ] . bovine colostrum concentrate preparations derived from cows that have not been hyperimmunized against specific antigens also may provide some benefit via passive immunization for some diseases. for example, a commercial product which is made from large standardized pools of colostrum collected from over cows has been used to treat a number of diseases [ , ] , including diarrhea caused by diarrheagenic e. coli [ ] . similar preparations from non-immunized cows may provide protection against bacterial toxins that are the cause of diarrhea in aids patients [ ] . these studies, along with the above mentioned study comparing colostrum preparations from cows immunized against s. dysenteriae or non-immunized cows [ ] , demonstrate that bovine colostrum contains significant antimicrobial properties as a result of natural exposure of the cows to antigens of pathogens that may afflict humans. another example of a potential use for bovine immunoglobulin preparations to control bacterial populations comes from studies on dental caries formation [ ] . the concept of prenatal immunization of the pregnant mother to protect the neonate against dental caries was demonstrated in rats [ ] . in applications to humans, bovine whey preparations of colostrum from cows immunized with caries-inducing bacterial strains (streptococcus mutans and streptococcus sobrinus), and containing over % immunoglobulin of which % was igg , has been used in several studies evaluating its effect on caries-producing bacteria. the colostral whey preparation reduced adherence of streptococcus mutans in vitro and caused aggregation of suspended bacteria [ ] , as well as inhibited glucose uptake by the test organism [ , ] . the whey preparation from hyperimmunized cows opsonized bacteria and enhanced in vitro phagocytosis of bacteria by human leukocytes [ ] . antibodies in the whey preparation remained functional when added to milk that had been treated via ultra-high temperature pasteurization or milk that was fermented to extend shelf-life [ ] . immune milk from cows hyperimmunized against seven streptococcus mutans strains reduced the recoverable bacterium in plaque samples from volunteers within seven days of initiation of mouth rinsing with the whey concentrate product [ ] . mouth rinsing with immune milk collected from cows immunized with a fusion protein representing two of the major factors implicated in oral colonization by streptococcus mutans inhibited recolonization of saliva and plaque by that organism [ , ] . immunodeficiency disorders often are associated with cryptosporidiosis, which can lead to chronic malabsorption and weight loss. in a case study of a child with congenital hypogammaglobulinemia, severe vomiting and diarrhea due to cryptosporidiosis, gastric infusion with hyperimmune bovine colostrum from cows immunized with cryptosporidium oocytes resolved the symptoms within a few days and oocyts were no longer found in stool samples after about eight days [ ] . similarly, in a child with aids who had severe diarrhea caused by cryptosporidiosis, administration of a commercial hyperimmune bovine colostrum preparation with anticryptosporidial activity improved the diarrhea and eliminated the parasite [ ] . in the cases where immune milk is collected from cows immunized against one or more pathogens, the immunization regimen occurs during the prepartum period of the cow. to put this in perspective relative to the lactation cycle of a cow, a brief reminder of that cycle may be helpful. depending on the management system used by a farm, most dairy cattle will have their first calf early in their third year, marking the start of their first lactation. the cow will be re-bred about two to three months into lactation. pregnancy is approximately days. at about months before expected calving date, or approximately months into lactation, milk removal is halted and the cow is given what is called a -dry‖ period. the mammary gland undergoes a process of involution during the early dry period where most residual milk components are broken down and resorbed [ ] . the mammary gland begins a redevelopment phase several weeks prior to calving. colostrum formation occurs in the days leading up to calving, coinciding with the early phase of lactogenesis (initiation of lactation). in the cow, lactogenesis begins shortly prior to calving and extends into the first few days postpartum. colostrum collected at the first milking of the cow after calving represents the accumulation of colostral products during the days leading up to parturition, including immunoglobulins which are at their highest concentration in the first milking. concentrations of immunoglobulins then decline rapidly in the subsequent several milkings [ ] . one application for immunization of pregnant or lactating animals comes from the arena of mastitis control in cattle. mastitis is the major disease in dairy cattle and most often is caused by intramammary infection [ , ] . vaccination of cattle against mastitis-causing pathogens has been an area of study for many years [ , ] . optimization of immunization schedules continues to be investigated [ ] . effective vaccines against mastitis-causing pathogens can increase antigen-specific immunoglobulins in the serum, which in turn can be increased in the mammary secretions. in the case of the j e. coli bacterin vaccine, the immunization also may be causing the mammary gland to become hyper-responsive to bacterial challenge [ ] , reminding us that enhancement of antigen-specific antibodies in the milk is not the only mechanism by which the vaccine may be having its effect. because the peripartum and early lactation periods are times of high susceptibility of the mammary gland to mastitis, many immunization schedules include prepartum immunizations during the dry period when milk is not removed and the mammary gland undergoes involution. it is also important to remember that cattle are generally immunosuppressed during the peripartum period [ , ] , potentially compromising the impact of immunizations administered just before or just after calving. coliform mastitis is one of the major types of mastitis in cattle [ ] . the more successful vaccination protocols for mastitis control have been with the j e. coli bacterin vaccine which is administered initially either just before or at the time of drying off [ , [ ] [ ] [ ] [ ] [ ] [ ] . these typically are followed by additional vaccine doses approximately mid-dry period. some protocols include an additional immunization within several days after calving [ , , , ] , while others also continue immunizations into the first three months of lactation [ , ] . attempts to vaccinate against other mastitis-causing pathogens have been met with more limited success. such vaccination protocols range from immunizations during the dry period [ ] , to peak lactation [ ] , and even late lactation [ ] . although most of the immunization protocols used in mastitis control administer the vaccine either intramuscularly or subcutaneously, intramammary immunization also can result in an increase in antigen-specific immunoglobulin in milk, as well as in the serum [ ] [ ] [ ] [ ] . a look across the immunization protocols used in studies to produce many immune milk products shows considerable variation, especially in the number and timing of immunizations. in those specifically collecting colostrum shortly after calving, multiple immunizations are administered during late pregnancy when the cow would be in the dry period [ ] [ ] [ ] , , , , , , , [ ] [ ] [ ] . mammary secretions then are collected either only at first milking [ ] , pooled from the first to milkings [ , , , ] , pooled from the first to days after calving [ , , , ] , or collected for longer periods into lactation [ ] . other studies have initiated immunizations during the late dry period and then continued vaccinating throughout lactation [ , , ], or only vaccinating during lactation [ ] . many of these studies used intramuscular or subcutaneous immunization, although some also have incorporated intramammary [ , , ] , or intravenous infusion [ ] . newer technologies for vaccine development and delivery may further enhance the production of immune milk products. immunization protocols that expose animals to specific antigens may enhance humoral immune responses in the mammary gland, including peptide-based vaccines [ ] , and dna-based vaccines [ , ] . delivery of antigen to the animal can also be achieved with antigen encapsulated in biodegradable microspheres [ ] , and with antigen-release devices [ ] . transgenic animals also have been used to produce antigens that then may be used to vaccinate animals against viral disease [ ] . the immunoglobulins, or antibodies, found in colostrum or milk are the same as those found in the blood or mucosal secretions. they are a family of proteins with a range of protective bioactivities. immunoglobulins are divided into several classes including igm, iga, igg, ige, and igd [ ] , and igg, iga and igm are the major immunoglobulin classes in mammary secretions. igm is the class that appears initially when an organism is exposed to an antigen for the first time (primary infection). igm has a low specificity and hence a lower potency in defeating the infection. iga is the major immunoglobulin class found in mucosal secretions and prevents mucosal infections by agglutinating microbes, whereas igg is the primary immunoglobulin class found in bovine colostrum and milk. several subclasses of igg exist, with igg and igg being the major immunoglobulins in serum. all monomeric immunoglobulins have the same basic molecular structure, being composed of two identical heavy chains and two identical light chains, with a total molecular mass of approximately kilodaltons (for details on immunoglobulin structure see [ , , ] ). both the heavy and light chains have constant regions and variable regions. heavy and light chains are linked together by disulfide bonds, resulting in the classic y-shape of the immunoglobulin molecule [ ] . the number and location of the disulfide bonds is dependent on the class of immunoglobulin. each immunoglobulin molecule has two antigen binding sites which comprise the antigen-binding fragment (fab). the fab includes the variable amino acid domain. at the other end of the molecule is the constant fragment (fc) which has a constant amino acid sequence among molecules of the same subclass and which confers the identity of an immunoglobulin as a particular subclass. the fc region of the molecule is the region that binds to fc receptors on various cell types. in the case of polymeric immunoglobulins, including the polymeric forms of iga and igm that are found in milk, the monomeric forms of the immunoglobulins are linked together through the covalent interaction with a joining (j) chain [ , ] . the result is a dimeric form of iga and a pentameric form of igm. binding of these immunoglobulins to the j chain also results in them having several special features, including: a high valency of antigen-binding sites, allowing them to agglutinate bacteria; limited complement-activating activity, which allows them to act in a noninflammatory manner; and a high affinity for the polymeric immunoglobulin receptor (pigr) that is responsible for transepithelial transport of iga and igm into mucosal secretions such as milk [ ] . the pigr and its relationship to the secretory component (sc) associated with secretory iga and secretory igm is discussed further below (section . ). the content of immunoglobulins in colostrum and milk is highly dependent on the animal species [ , ] . the same holds for the relative proportion of the immunoglobulin classes. these species differences are adaptations to the reproductive strategies of the animals and the degree of maturation of the offspring at birth. animal species may be divided into three classes [ ] : ( ) species where immunoglobulins are transferred mainly to the fetus via the placenta (humans and rabbits); ( ) species where offspring are born agammaglobulinemic and immunoglobulin transmission occurs via mammary secretions (ungulates such as horses, pigs, cows, and goats); and ( ) species where immunoglobulins are transferred both via placenta and mammary secretions (rats, mice and dogs). these adaptations have several consequences both for the composition of immunoglobulins in colostrum and milk, and for the role of colostrum. indeed, for animals like rats, mice, dogs and ungulates, uptake of colostrum of adequate quality and sufficient quantity is important for the offspring to boost the systemic immune function in the short term, whereas colostrum consumption in the human infant provides more protection for the gastrointestinal tract (see section . ). this is reflected in a lower total immunoglobulin content in human colostrum as compared to colostrum from the other species ( figure ) [ , , ] . human colostrum has a low content of igg ( %), and the igg required to provide systemic immunity is transferred across the placenta before birth. in contrast, colostral igg content in many other species is typically greater than % of the total immunoglobulin content (figure ). an additional consequence of different routes of immunoglobulin transmission relates to the changes in relative contents of immunoglobulins that occur in the transition from colostrum to milk within certain species (figure ). for example, the profile of immunoglobulins in human colostrum is similar to that found in milk, where the iga level is high in both colostrum and milk ( - % of total immunoglobulin). this is in contrast to the bovine mammary secretions where the high concentration of igg in colostrum declines rapidly with successive milkings. for animals like rats, mice, dogs and ungulates, the role of colostrum and milk immunoglobulins is to provide immune protection both systemically and for the gastrointestinal tract, which is reflected in large changes in the profile of immunoglobulins during the transition from colostrum to mature milk ( figure ). thus, for many species the proportion of iga increases between colostrum and milk. [ ] ; human and pig [ ] ; and horse [ ] . immunoglobulins found in mammary secretions arise from systemic and local sources. in the case of igg in milk, the major portion comes from the serum [ ] . while igg producing plasma cells may occur within the mammary tissue, their contribution to the igg in colostrum is minor compared with the igg derived from the serum. although limited paracellular passage of immunoglobulins may occur during inflammation (mastitis), uptake and transport of immunoglobulin across the mammary epithelial barrier is thought to occur primarily through an fc-receptor-mediated process [ , , [ ] [ ] [ ] . immunoglobulins are thought to bind to receptors at the basolateral surfaces of the mammary epithelial cell. these receptors are specific for the fc portion of the immunoglobulin molecule. the receptor-bound immunoglobulin is internalized via an endocytic mechanism [ ] , transported to the apical end of the cell and released into the alveolar lumen. recent studies have shed additional light on the details of this process [ ] . in the case of igg, the receptor responsible for transcytosis of igg into colostrum is referred to as fcrn, or the neonatal fc receptor, because it was initially identified in the neonatal rodent intestine as the receptor responsible for the specific uptake of maternal igg [ , ] . the fcrn also has been implicated in the trans-placental transport of igg in humans and other species [ ] [ ] [ ] , which may involve an endocytic and transcytotic process [ ] . since its initial discovery, fcrn has been described in many tissues [ ] . the receptor is a heterodimer composed of a membrane-bound α-chain similar to mhc class- molecules and a smaller mhc class- protein, β -microglobulin [ ] . binding of igg to fcrn is ph-dependent, with high affinity binding occurring at acidic ph, but only weak binding at neutral or basic ph [ ] . this observation suggests that igg taken up by the epithelial cells may bind to fcrn within an acidic environment in the endosomes. the precise mechanism of transport across the epithelial cell and release into the colostrum or milk remains to be demonstrated. the half life of igg in serum is typically longer ( - weeks) than that for iga or igm ( - days), and the half-life of igg is slightly longer than for igg [ ] . evidence suggests that igg has a higher affinity for fcrn than igg [ ] . in bovine colostrum, igg is many fold greater in concentration than igg [ ] , although they are of approximately equal concentrations in serum. it may be that the majority of the igg taken up by the mammary epithelial cell during colostrum formation is not passed on to the alveolar lumen, but rather is recycled back to the extracellular fluid. the fcrn is thought to have a major role in the recycling of igg in various tissues in the body [ ] [ ] [ ] . that is, igg that potentially may be lost through various tissues is recycled by the respective cells by binding to fcrn and recycled back to the blood or lymph. this is supported by studies of overexpression of fcrn in transgenic mice where there is an extension of the half-life of serum igg [ , ] , as well as a boosting of the overall humoral immune response of the mice [ ] . localization of fcrn in bovine, sheep and water buffalo mammary tissue indicates that the receptor is homogeneously distributed throughout the epithelial cells prior to parturition, but primarily localized at the apical surface of the mammary epithelial cells after parturition [ ] [ ] [ ] [ ] . while this type of observation corroborates the conclusion that fcrn plays an important role in igg transport during colostrum formation, at least in ruminant species, the precise meaning of this redistribution of fcrn staining in mammary cells remains to be determined. it is also interesting to note that the initial report of this distribution pattern in sheep mammary epithelium included the observation that the staining pattern became diffuse within the cells during mammary involution [ , ] . transport of igg also may increase transiently in mammary secretions during involution in cattle [ ] . hormonal and local factors have been implicated in the control of immunoglobulin transport during colostrum formation [ ] . haplotypes of the fcgrt gene, coding for the mhc class i α-chain of fcrn, are associated with serum concentrations of igg in neonatal beef calves [ ] and associated with igg concentrations in colostrum of dairy cows [ ] . haplotypes of the β -microglobulin gene (β m) also are associated with serum igg concentrations in newborn calves [ ] . in estimating mass transfer of igg into colostrum in dairy cattle, % of cows had mass transfer greater than one standard deviation above the mean, perhaps indicating a genetic or hormonal regulation of the variance of transport [ ] . clearly there is opportunity for genetic manipulation of igg transport in the mammary gland to enhance the concentrations of immunoglobulins in colostrum and milk. however, it should be remembered that serum igg concentrations in the periparturient cow are already decreased as a result of the extensive igg transport into the colostrum [ ] , and as indicated above, the cow is in an immunosuppressed state during the peripartum period [ , ] . the other major classes of immunoglobulins transported into colostrum and milk are iga and igm. immunoglobulin a is the major immunoglobulin in human colostrum and milk (figure ), however it is also present in milk of most other species. colostrum and milk iga and igm are found in the form of secretory iga, or siga, and sigm. much of these are produced by plasma cells in the mammary tissue. the plasma cells are part of the gut-associated lymphoid tissue (galt), the largest immune organ of an organism, which includes the peyer's patches, lymphoid and myeloid cells in the lamina propria and intraepithelial lymphocytes [ , ] . lymphocytes from the galt system migrate to the mammary gland and provide a direct link between the antigen exposure response in the mother's mucosal immune system, especially via the enteric mucosal immune system, and the secretory immunoglobulin repertoire of the mammary gland [ ] . this means that maternal colostrum and milk will contain antibodies specific for pathogens that may be encountered by the neonate's intestine and other mucosal tissues [ , , ] , providing a rationale for the observations summarized above that bovine colostrum from nonimmunized cows also may afford passive immune protection against human pathogens [ , ] . the immune connection between the galt and the mammary gland is of particular interest with respect to human milk where the major immunoglobulin is siga, which accounts for one of the key factors underlying the importance of breast feeding [ ] . the immune activation of galt in the human infant is delayed, and the milk siga and sigm provide the neonatal intestine a level of protection through their immune exclusion actions and their anti-inflammatory effects [ , ] . transepithelial transport of iga and igm across the mammary epithelial cells occurs via the polymeric immunoglobulin receptor (pigr) which is responsible for binding dimeric iga and pentameric igm in mucosal tissues [ , ] . the polymeric nature of iga and igm arises from their binding with the j-chain peptide [ ] . only iga or igm that contain the j chain have a high affinity for pigr [ , , ] . in fact, the j chain has been evolutionarily conserved within tetrapods to the point where human polymeric iga can bind to the pigr from the amphibian xenopus laevis [ ] . polymeric iga or igm bound to pigr is internalized and transported to the apical end of the mammary epithelial cell by an endocytic process. the pigr molecule is cleaved to release a receptor fragment, called secretory component (sc), which remains bound to the immunoglobulin molecule [ , ] . in the case of pigr receptor sites that are not occupied by immunoglobulin, the secretory component is still cleaved from the membrane-bound portion of pigr, resulting in release of free secretory component. the secretory component has protective effects of its own, potentially blocking epithelial adhesion of enterotoxigenic e. coli and neutralizing the effects of other pathogens [ ] . expression of pigr in the mammary gland is under control of hormones responsible for initiation of lactation [ ] . elevated transport of iga also may occur during mammary gland involution in cattle and persist longer into the involution process [ ] . part of the transfer of passive immunity story in mammals involves the timing and location of transfer of immunoglobulins from the mother to the offspring, while another part encompasses the fate and function of the immunoglobulins once in the neonate [ , , ] . in humans, intestinal transfer of maternal igg from colostrum is sparse in the neonate and their immune competency is assured by transfer via the placenta. in rats and mice, there is fcrn-mediated uptake of igg from the colostrum and milk in the neonate intestine. in ungulate species such as cattle, sheep, goats and pigs, the young are born essentially agammaglobulinemic and rely entirely on uptake of colostral immunoglobulins, especially igg, for systemic immune protection. the consumption of colostrum by the neonatal calf has significant effects on the gastrointestinal tract [ ] . the intestinal uptake in the immediate period after birth is transient and nonselective in species such as cattle, sheep, goats, swine and others. the intestinal cells become unable to absorb macromolecules within - h after birth probably as a result of developmental processes occurring in the enterocytes [ ] . the process whereby the intestinal cells gradually stop absorbing macromolecules is termed -closure‖. before closure, the enterocytes will nonselectively absorb large molecular weight proteins and other molecules [ ] . macromolecules so transported are released into the lamina propria and then are absorbed into the lymphatic or portal circulation. failure of passive transfer of immunity in these species is defined as occurring when a threshold concentration of igg is not reached before closure occurs, which in the calf corresponds to serum igg levels less than mg/ml [ ] . the maternal igg in the calf's blood gradually declines over the initial month after birth, and has a half-life of approximately days [ ] . milk siga is not taken up by the infant's intestinal mucosa [ , ] . in fact, gut closure in humans occurs before birth and little immunoglobulin is absorbed intact in the intestine after birth [ , ] . however, the presence of siga in the intestinal lumen is part of the protective function of the epithelial barrier in the intestine [ ] . milk siga in the intestine will bind bacteria, toxins and other macromolecules, limiting their ability to bind to intestinal cells and thereby be transported through the mucosa to the lamina propria to cause a systemic immune response [ ] . in adults of a pigr-deficient strain of mice, which do not transport siga into the intestinal lumen, there is an increased serum iga and igg that react with commensal organisms and food antigens [ ] . this may be occurring because siga is not being secreted into the intestinal lumen to participate in its role in immune exclusion (see section . ), and resulting in an increased uptake of food antigens and microbial antigens from the intestinal lumen which pass to the lamina propria and stimulate specific antibody responses [ ] . development of the galt system is dependent on microbial stimulation [ , ] . the microbe binding function of siga then modulates the early microbial colonization of the gastrointestinal tract and the interaction of those microbes with the developing neonatal immune system [ , , ] . from the discussion of immune milk products above it was clear that these products have protective effects on neonatal health, as well as infant and adult human health. the exact mechanisms by which immune milk products have their effects are less clear and deserve further investigation. below are summarized several perspectives to consider when evaluating the effects of immune milk products and the role of immunoglobulins in achieving those effects. it should be remembered that colostrum and milk not only contain immunoglobulins, but also contain a range of antimicrobial factors and factors that may impact the immune system [ , , , [ ] [ ] [ ] [ ] [ ] [ ] [ ] . these include the iron-binding antimicrobial protein lactoferrin, antibacterial enzyme lactoperoxidase, antibacterial and lytic enzyme lysozyme, oligosaccharides that function as analogues of microbial ligands on mucosal surfaces, antimicrobial heat stable peptides (defensins), and soluble cd . in addition, colostrum and milk contain leukocytes, including activated neutrophils, macrophages and lymphocytes. colostrum also contains cytokines and growth factors that may affect neonatal intestinal development, as well as intestinal immune responses to disease in adults [ , ] . the relative concentrations of these factors vary considerably among species. furthermore, colostrum provides a source of energy which may impact igg absorption in the neonate [ ] , and provide additional energy for an effective immune response. another point to consider is that, while most macromolecules are degraded by digestive enzymes, some portion of macromolecules is transported across the intestine intact, including proteins [ , ] . much of the immunoglobulin consumed in an immune milk can be expected to be partially or completely digested (discussed in section . ), however some portion of the immunoglobulin will remain intact or at least partially intact and capable of binding to an antigen. all colostrum and milk will contain some siga, even those collected from cattle. the siga present in these secretions may contribute to the protective effects of immune milk products. secretory iga is considered to be the primary immunoglobulin responsible for immune protection of mucosal surfaces such as the intestine [ ] . secretory iga and sigm, as polymeric forms of the respective immunoglobulins, are stabilized by their binding to sc. they have antimicrobial properties such as agglutination of microbes and neutralization of viruses, and noninflammatory extracellular and intracellular immune exclusion by inhibiting adherence and invasion of mucosal epithelia [ ] . the intracellular immune exclusion occurs when siga is being transcytosed by the enterocytes and comes into contact with viral particles within the endosomic system [ ] . secretory iga also neutralizes pathogens in the intestinal lumen [ ] . bacterial enterotoxins may be neutralized by binding siga and internalization into intestinal epithelial cells [ ] . in addition, iga has a major role in the immunosuppressive mechanisms in the intestine that inhibit proinflammatory responses to oral antigens, which is part of the oral tolerance mechanisms in the intestine [ ] . this suppression of the proinflammatory mechanisms is counterbalanced by systemic immune factors, including systemic igg, which may result in inflammation and tissue damage once an antigen crosses epithelia barrier to the lamina propria [ ] . after closure, any igg localized in the lamina propria, whether from systemic sources or from uptake from the intestinal lumen, could contribute to proinflammatory responses in the intestine [ ] . indeed, post-closure uptake of igg can occur via the fcrn receptor. fcrn has been identified in the human adult intestine [ , ] , consistent with the hypothesis that fcrn is involved in igg recycling (discussed in section . ). however, the transport of igg across the enterocyte seems to be bidirectional, lending support to the concept that igg in the intestine is involved in immune surveillance and defense of the mucosal lining [ ] [ ] [ ] . intestinal fcrn may deliver igg-antigen immune complexes to the lamina propria for immune processing [ , ] , thereby enhancing local mucosal immune response. on the other hand, functionally intact igg that remains in the intestinal lumen might be expected to bind antigens and participate in protection of the tissue through immune exclusion. the intestinal mucus layer does provide an important protective barrier in the interactions of the intestinal tissue with microbes [ ] . interestingly, an igg fc binding site has been identified in association with the intestinal mucus [ ] [ ] [ ] . this igg fc binding protein is distinct from the fcrn receptor. the fc binding protein may block passage of igg-antigen complexes to the enterocyte surface, thereby blocking their uptake and transport to the lamina propria, and perhaps allowing the complexes to be degraded in the intestinal lumen and excreted [ , ] . consumed colostrum also may impact immunological development of the neonate [ ] . these maternal antibodies may then inhibit infant responses to vaccine administration and impact development of the infant's immunity [ ] . in the case of dairy animals producing colostrum or milk immunoglobulins for human consumption, immunoglobulins are harvested at milking and undergo various types of processing whether it is to prolong the shelf-life of the milk, to concentrate or isolate the immunoglobulins from the mammary secretion, or to digest the milk in the intestine. through such processing, immunoglobulins are exposed to a number of conditions that may alter the structure and function of the protein. some of methods used to concentrate or isolate the immunoglobulins include steps that involve exposing the protein to heat, acid or pressure which may affect the conformation of the protein, and ultimately the immunological activity of the antibody. a range of methods have been used for isolation of immunoglobulins from colostrum or milk. these include traditional methods of ammonium sulfate precipitation and column chromatography [ , , , ] . affinity chromatographic methods used to isolate igg include lectins [ ] ; protein a or g chromatography [ , ] , and more recently, isolation with protein a/g immobilized electrospun polyethersulfone membranes [ ] ; metal chelate chromatography [ , ] ; and adsorption with polyanhydride microparticles [ ] . the range of detection and quantification methods for igg, most often analyzed by radial-immunodiffusion [ ] or enzyme-linked immunosorbant methods [ ] , are now expanding to include methods that detect multiple proteins, such as thermally addressed immunosorbant assays [ ] , and rapid methods that may be integrated into milking systems, such as surface plasmon resonance-based immunosensors [ ] . pepsin is a major proteolytic enzyme produced by the stomach. pepsin digestion of igg yields an f(ab') fragment that includes the two antigen-binding (fab) sites of the igg molecule [ , , , ] . intact immunoglobulin, f(ab') and other antibody formats are being exploited in development of antibody therapeutics [ ] . in the small intestine, immunoglobulins are further digested by pancreatic enzymes. one of them, trypsin, preferentially digests bovine igg over igm, whereas another enzyme, chymotrypsin, preferentially hydrolyzes igm over igg [ ] . bovine igg is more susceptible to hydrolysis by pepsin than igg , while igg is more susceptible to trypsin [ ] . immunoglobulins are relatively more resistant to gastrointestinal digestion than other milk or colostral proteins. upon ingestion and entry into the stomach, the caseins form a curd under the influence of the acidic environment and proteolytic activity. as a consequence, casein is retained in the stomach of the neonate longer than the whey proteins, including igg [ ] . in the intestine, the fate for the other major whey proteins is rapid digestion for α-lactalbumin, while β-lactoglobulin is more slowly digested. intestinal digestion of igg is among the slowest of the whey proteins and igg provides the smallest proportion of amino acids to the neonate relative to the other major whey proteins [ ] . in vitro incubations of iga and igg with small intestinal content of young lambs have shown that iga is more resistant towards digestion than is igg [ ] . in adult humans consuming a bovine whey protein concentrate, approximately % of igg and igm was detected by radial immunodiffusion from effluents from the jejunum, while % was detected in the ileum [ ] . these estimates of digestion of immunoglobulin compare with estimates of digestion of milk proteins in adult humans which are approximately % complete at the end of the jejunum and % complete by the end of the ileum [ ] , again underscoring the relative resistance of immunoglobulins to digestion in the gastrointestinal tract. detectable immunoglobulin in stool samples of infants fed the same immune product accounted for % of the ingested immunoglobulin [ ] . in adults fed a bovine immunoglobulin concentrate, fecal igg was typically less than % of ingested dose [ ] . detectable igg in the stool [ ] , or ileal effluent samples of adults [ ] , is not significantly increased by prior treatment with a proton pump inhibitor to reduce stomach acid production. however, encapsulation of the immunoglobulin product can significantly increase the igg detectable in the stool [ ] , although only low levels of igg are detectable in the ileum of adults ingesting encapsulated immunoglobulin [ ] . these studies suggest that degradation of immunoglobulins is occurring throughout the intestinal tract [ ] . the primary structure of the immunoglobulin found in intestinal effluents most likely is the immunoglobulin fab or f(ab') fragments found in their stool [ , ] , which nevertheless maintains its antigen-binding activity, as indicated by the correlation between appearance of the immunoglobulin and the virus-neutralizing activity observed in stool samples [ ] . in adults ingesting bovine anti-clostridium difficile immunoglobulins, toxin-neutralizing activity paralleled the bovine igg content in ileal effluent [ ] , and in stool samples [ ] . a pepsin-resistant form of bovine igg representing approximately % of colostral immunoglobulin has been isolated with a lectin that binds o-linked oligosaccharides [ ] , indicating that some proportion of igg in the gastrointestinal tract may remain intact. the ph of bovine mammary secretions transiently drops at calving (to approximately ph . ), then increases over several days to ph . to . [ ] , which is the ph characteristic of mature milk. therefore, bovine colostrum is slightly more acidic than mature milk. studies of isolated immunoglobulin stability over a ph range indicate that bovine igg isolated from milk is stable for several hours at °c when in ph - , however stability is significantly reduced at ph ≤ and ≥ [ , ] . the negative effect of ph on igg stability, even in the range of . - . , is enhanced under elevated temperature conditions [ , ] . the use of a multiple emulsion to encapsulate milk igg may increase stability of the protein against extreme acidic or alkali conditions, as well as against proteolytic degradation [ ] . however, emulsification by homogenization may reduce the residual igg content of the emulsion product [ ] , probably as a result of high shear forces [ ] . ultrasonic treatment of isolated igg also decreases residual igg content [ ] . immunoglobulins are thermolabile. exposure to temperatures of °c can reduce detectable isolated bovine igg by % in min, and by % at °c for s [ ] . heat exposure causes conformational changes in the igg molecule [ ] . antigen-binding activity of bovine igg also is reduced after heat treatment [ , ] . this is consistent with studies that suggest that the antigen-binding region of the immunoglobulin molecule is more thermolabile than the other regions of the molecule [ , ] . detectable igg in colostrum or colostral whey also are reduced by heat treatment, however at a slower rate than for isolated igg. thermal protectants such as sugars or glycerol can increase the stability of isolated igg to heat treatment [ , ] . many milk processing protocols include heat treatment of the colostrum, milk or whey. of the major immunoglobulin classes in bovine milk, igg is the most thermostable and igm is the least thermostable [ ] . commercial milk samples that have undergone a typical pasteurization process, including skim milk powder, can retain - % of the igg concentration compared with raw milk, while milk undergoing ultra-high temperature (uht) pasteurization contains little detectable igg [ , ] . nevertheless, antigen-specific igg in milk is relatively stable under typical conditions of pasteurization when compared with that in uht milk or cow milk-based infant formulas that undergo high-temperature processing [ , ] . flash-heat treatment of human breast milk, a method recommended by who to reduce vertical transmission of hiv in resource-poor regions, has minimal effects on milk iga and antimicrobial activity of the milk [ , ] . this method involves placing a jar of milk into a water bath, the water bath is heated to boiling, and then the jar of milk is removed and allowed to cool. the milk reaches a maximum temperature of - °c and is above °c for over min [ , ] . alternative methods of achieving microbial inactivation may offer a means of avoiding the impact of heat treatment on igg solutions. for example, high voltage pulsed electric fields have been used as a nonthermal processing method for pasteurization in various foods [ ] [ ] [ ] . pulsed electric field processing also generates heat, however temperature exposure of the fluid is less than °c, and total treatment time exposure is in milliseconds [ ] . that compares with more typical pasteurization process at about °c for min. microbial inactivation in bovine igg solutions as a result of pulsed electric fields did not change the secondary structure or the thermal stability of the secondary structure of the igg [ ] , and antigen-binding activity was unchanged [ ] . another emerging technology that may provide a nonthermal microbial inactivation treatment for milk uses exposure to pulsed ultraviolet light [ ] . high-pressure processing is another non-thermal method with the potential for inactivation of microbial and certain enzymes in food products, thereby extending shelf-life of the product [ ] . while the high-pressure process also generates heat during the treatment of the sample, lowering the initial temperature of the sample allows for control of the maximum temperature reached to be maintained within a desired range [ ] . to be effective in inactivating bacterial spores, high-pressure processing needs to be combined with moderate temperature treatment [ ] . moderate to extensive loss of immunoactivity of igg may occur depending on the conditions used for high-pressure processing of colostrum or other igg-containing fluids [ , ] . high-pressure processing also has been used for human breast milk with minimal effect on the milk iga [ ] . the issue of heating effects on immunoglobulin and colostrum also is important for control of various diseases that occur in cattle. collection and storage of colostrum from dairy cows shortly after calving has long been a common procedure. the stored colostrum then is fed to newborn calves to assure adequate uptake of igg for protection of the calf. several pathogens can be transmitted from cow to calf via colostrum or milk [ ] . colostrum may contain these pathogens as a result of shedding from the mammary gland, contamination of the colostrum after harvesting or improper storage of colostrum prior to feeding calves [ ] . one approach to allowing the neonate the benefits of colostrum from infected cows is collecting colostrum and batch pasteurization of pooled colostrum prior to feeding to the calves [ ] . volume of the batch of pooled colostrum that is pasteurized affects measurable igg concentrations in the colostrum, as well as igg serum concentrations attained in calves after feeding the colostrum [ ] . heat treatment of colostrum at °c for one to two hours does not alter measurable igg concentrations or viscosity of the colostrum, nor does that treatment affect antibody activity [ , ] . in addition, bacteria inoculated into colostrum prior to a heat treatment of °c for one hour are not detectable after the heat treatment [ ] . on-farm heat treatment of colostrum ( °c for one hour) results in higher concentrations of serum igg and greater apparent absorption efficiency of igg in new born calves consuming the treated colostrum than consumption of raw colostrum [ ] [ ] [ ] . colostrum and milk are rich sources of immunoglobulins. these secretions have developed through evolution to ensure homologous transfer of passive immunity from mother to offspring. the immunoglobulins that are passed from mother to her offspring, whether by transplacental transfer or by ingestion of colostrum and milk, can form an important link between the immunological experience of the mother and the immune capacity of the newborn. this immunological link also includes many immune factors that may be present in mammary secretions other than the immunoglobulins. the immunoglobulins in colostrum and milk also provide opportunities to harness their immunological function for the benefit of other animals, including humans. research has demonstrated that bovine colostrum and milk, whether or not they are from cows immunized against specific pathogens, provide a medium for the heterologous transfer of passive immunity, and may offer disease protection in a range of species. new technologies for enhancing efficacy of vaccination, enhancing stability and extending shelf-life of the immunoglobulin preparation while minimizing the impact of the processing, and extending the effectiveness of the immunoglobulin in the intestine, may enhance future use of colostrum and milk based on their potent immunological activity. while the mechanisms by which immunoglobulins are transferred from mother to neonate and their role in the neonate have become well documented, additional research is needed to clarify the mechanisms of action of the immunoglobulins derived from milk or colostrum when used in animals that are developmentally more mature. immunoglobulins and immunocytes in the mammary gland and its secretions immune components of colostrum and milk-a historical perspective immunoglobulins of the mammary secretions antibodies in milk bovine immunoglobulins: an augmented review mucosal immunity of the mammary gland and immunology of mother/newborn interrelation immunoglobulins of the mammary secretions antibodies in milk milk immunoglobulins and complement factors the immunological role of breast feeding the role of colostral antibodies in prevention of microbial infections the protective properties of milk and colostrum in non-human species colostrum and its benefits: a review immunoglobulins of the mammary secretions transfer of antibody via mother's milk. vaccine analysis of bovine immunoglobulin g in milk, colostrum and dietary supplements: a review immune components of bovine colostrum and milk the mucosal immune system and its integration with the mammary glands immune milk-a historical survey a review of the literature on some aspects of immune milk bovine milk antibodies for health bovine colostrum as a biologic in clinical medicine; a review-part i: biotechnological standards, pharmacodynamic and pharmacokinetic characteristics and principles of treatment bovine colostrum as a biologic in clinical medicine; a review-part ii: clinical studies bovine and human-derived passive immunization could help slow a future avian influenza pandemic vaccines and milk immunoglobulin concentrates for prevention of infectious diarrhea potential for immunological supplementation of foods passive protection against diarrhea disease passive and active protection against disorders of the gut passive immunity against human pathogens using bovine antibodies preventing infectious disease with passive immunization maternal antibodies, childhood infections, and autoimmune diseases regulation of immunoglobulin transfer into mammary secretions of ruminants allergenicity of orally administered preparations in food-allergic children effects of a milk-based bioactive micronutrient beverage on pain symptoms and activity of adults with osteoarthritis: a double-blind, placebo-controlled clinical evaluation analytical approach to determination of safety of milk ingredients from hyperimmunized cows protection against cholera in breast-fed children by antibodies in breast milk protection of breast-fed infants against campylobacter diarrhea by antibodies in human milk vaccines for preventing enterotoxigenic escherichia coli infections in farm animals immunity to escherichia coli in pigs: antibody secretion by the mammary gland after intramammary or intramuscular vaccination with e. coli vaccine the effect of oral immunization on the population of lymphocytes migrating to the mammary gland of the sow survey of immunoglobulin g content and antibody specificity in cow's milk from british columbia prevention of rotavirus infection by cow colostrum containing antibody against human rotavirus prevention of rotavirus infection by oral administration of cow colostrum containing antihumanrotavirus antibody use of bovine milk concentrate containing antibody to rotavirus to treat rotavirus gastroenteritis in infants hyperimmune cow colostrum reduces diarrhoea due to rotavirus: a double-blind, controlled clinical trial passive immunization of children with bovine colostrum containing antibodies to human rotavirus treatment of infantile e. coli gastroenteritis with specific bovine anti-e. coli milk immunoglobulins efficacy of bovine milk immunoglobulin concentrate in preventing illness after shigella flexneri challenge hyperimmune bovine colostrum in the treatment of shigellosis in children: a double-blind, randomized, controlled trial protection by milk immunoglobulin concentrate against oral challenge with enterotoxigenic escherichia coli milk immunoglobulin with specific activity against purified colonization factor antigens can protect against oral challenge with enterotoxigenic escherichia coli lack of prophylactic efficacy of an enteric-coated bovine hyperimmune milk product against enterotoxigenic escherichia coli challenge administered during a standard meal bovine colostrum ameliorates diarrhea in infection with diarrheagenic escherichia coli, shiga toxin-producing e. coli, and e. coli expressing intimin and hemolysin antibodies from colostrum in oral immunotherapy immunization against dental caries effective immunity to dental caries: passive transfer to rats of antibodies to streptococcus mutans elicits protection concentrated bovine colostral whey proteins from streptococcus mutans/strep. sorbinus immunized cows inhibit the adherence of strep. mutans and promote the aggregation of mutans streptococci generation of bovine immune colostrum against streptococcus mutans and streptococcus sobrinus and its effect on glucose uptake and extracellular polysaccharide formation by mutans streptococci combined inhibitory effect of bovine immune whey and peroxidase-generated hypothiocyanite against glucose uptake by streptococcus mutans effects of bovine immune and non-immune whey preparations on the composition and ph response of human dental plaque stability and activity of specific antibodies against streptococcus mutans and streptococcus sobrinus in bovine milk fermented with lactobacillus rhamnosus strain gg or treated at ultra-high temperature effect of immune bovine milk on streptococcus mutans in human dental plaque bovine milk antibodies against cell surface protein antigen pac-glucosyltransferase fusion protein suppress cell adhesion and alter glucan synthesis of streptococcus mutans passive immunization with milk produced from an immunized cow prevents oral recolonization by streptococcus mutans remission of diarrhoea due to cryptosporidiosis in an immunodeficient child treated with hyperimmune bovine colostrum bovine colostrum immunoglobulin concentrate for cryptosporidiosis in aids mammary gland function during involution iga, igg , igg , igm and bsa secretion by the bovine mammary gland throughout lactation invited review: the role of contagious disease in udder health mastitis associate transcriptomic disruptions in cattle the immunophysiological basis for vaccinating ruminants against mastitis vaccines against bovine mastitis in the new zealand context: what is the best way forward? effect of changes in number of doses and anatomic location for administration of an escherichia coli bacterin on serum igg and igg concentrations in dairy cows potential mechanism of action of j vaccine in protection against bovine coliform mastitis effects of growth hormone, insulin-like growth factor-i, and cortisol on periparturient antibody response profiles of dairy cattle coliform mastitis effects of an escherichia coli j vaccine on mild clinical coliform mastitis efficacy of an escherichia coli j bacterin administered to primigravid heifers effects of adjuvants on safety and efficacy of an escherichia coli j bacterin effect of hyperimmunization with an escherichia coli j bacterin in adult lactating dairy cows milk and serum j -specific antibody responses, milk production change, and clinical effects following intramammary escherichia coli challenge for j vaccinate and control cows association of escherichia coli j -specific serum antibody responses with clinical mastitis outcome for j vaccinate and control dairy cattle study of the humoral immunological response after vaccination with a staphylococcus aureus biofilm-embedded bacterin in dairy cows: possible role of the exopolysaccharide specific antibody production in the protection from staphylococcus aureus induced mastitis efficacy of vaccination against staphylococcal mastitis: a review and new data immune responses to mycoplasma bovis vaccination and experimental infection in the bovine mammary gland immune response in the bovine mammary gland after intestinal, local, and systemic immunization the effect of intraperitoneal and intramammary immunization of sheep on the numbers of antibody-containing cells in the mammary gland, and antibody titres in blood serum and mammary secretions local vaccination with killed streptococcus uberis protects bovine mammary gland against experimental intramammary challenge with the homologous strain efficacy of immunization with ferric citrate receptor feca from escherichia coli on induced coliform mastitis anti-clostridium difficile bovine immunoglobulin concentrate inhibits cytotoxicity and enterotoxicity of c. difficile toxins bovine milk immunoglobulins for passive immunity to infantile rotavirus gastroenteritis production from dairy cows of semi-industrial quantities of milk-protein concentrate (mpc) containing efficacious anti-candida albicans iga antibodies method for treating inflammation using bovine milk induction of hiv- mpr - -specific iga and igg antibodies in caprine colostrum using a peptide-based vaccine immune responses to a dna/protein vaccination strategy against staphylococcus aureus induced mastitis in dairy cows mucosal genetic immunization against four adhesions protects against staphylococcus aureus-induced mastitis in mice immunization with staphylococcus aureus lysate incorporated into microspheres specific immune milk production of cows implanted with antigen-release devices highly protective e -csfv vaccine candidate produced in the mammary gland of adenoviral transduced goats immunoglobulins-basic considerations the structure of iga role of j chain in secretory immunoglobulin formation the total protein and immunoglobulin profile of equine colostrum and milk the immune system of the ruminant mammary gland and its role in the control of mastitis epithelial transcytosis of immunoglobulins identification and function of neonatal fc receptor in mammary gland of lactating mice fcrn-mediated antibody transport across epithelial cells revealed by electron tomography the neonatal fc receptor plays a crucial role in the metabolism of igg in livestock animals receptor-mediated transport of igg isolation and characterization of an fc receptor from neonatal rat small intestine human placental fc receptors and the transmission of antibodies from mother to fetus placental transport of immunoglobulin g. vaccine an interspecies comparison of placental antibody transfer: new insights into developmental toxicity testing of monoclonal antibodies endocytic and transcytotic processes in villus syncytiotrophoblast: role in nutrient transport to the human fetus an fc receptor structurally related to mhc class i antigens the protection receptor for igg catabolism is the β -microglobulin-containing neonatal intestinal transport receptor finally! the brambell receptor (fcrb) the role of the brambell receptor (fcrb) in liver: protection of endocytosed immunoglobulin g (igg) from catabolism in hepatocytes rather than transport of igg to bile position independent and copy-number-related expression of the neonatal fc receptor -chain in transgenic mice carrying a kb genomic fragment over-expression of the bovine fcrn in the mammary gland results in increased igg levels in both milk and serum of transgenic mice kacskovics, i. neonatal fcr overexpression boosts humoral immune responses in transgenic mice kasckovics, i. redistribution of the sheep neonatal fc receptor in the mammary gland around the time of parturition in ewes and its localization in the small intestine of neonatal lambs kasckovics, i. localization of the sheep fcrn in the mammary gland expression of the neonatal fc receptor (fcrn) in the bovine mammary gland expression and immunohistochemical localization of the neonatal fc receptor (fcrn) in the mammary gland of the egyptian water buffalo immunohistological localization of igg , iga and secretory component in the bovine mammary gland during involution association of bovine neonatal fc receptor -chain gene (fcgrt) haplotypes with serum igg concentration in newborn calves association of fcrn heavy chain encoding gene (fcgrt) polymorphisms with igg content in bovine colostrum beta- -microglobulin haplotypes in u.s. beef cattle and association with failure of passive transfer in newborn calves mass transfer of immunoglobulin g into colostrum production and turnover of igg and igg immunoglobulins in the bovine around parturition development and function of organized gut-associated lymphoid tissues iga plasma cell development mucosal immunity: integration between mother and the breast-fed infant immunoglobulin transport and the polymeric immunoglobulin receptor epithelial transport of iga by the polymeric immunoglobulin receptor the j chain is essential for polymeric ig receptor-mediated epithelial transport of iga secretory antibody formation: conserved binding interactions between j chain and polymeric ig receptor from humans and amphibians developmental expression of pigr gene in sheep mammary gland and hormonal regulation nutritional physiology of neonatal calves receptor mechanisms of the neonatal intestine and their relationship to immunoglobulin absorption and disease colostrum management for dairy calves absorption and endogenous production of immunoglobulins in calves iga and intestinal homeostasis biological functions of iga human milk: its components and their immunobiologic functions secretory antibodies reduce systemic antibody responses against the gastrointestinal commensal flora bovine neonatal immunology dairy products and the immune function in the elderly nutritional and physiological significance of human milk proteins growth factors and antimicrobial factors of bovine colostrum colostrum and milk-derived peptide growth factors for the treatment of gastrointestinal disorders protection of the neonate by the innate immune system of developing gut and of human milk biologically active breast milk proteins in association with very preterm delivery and stage of lactation regulation of intestinal epithelial function: a link between opportunities for macromolecular drug delivery and inflammatory bowel disease absorption of orally supplied immunoglobulins in neonatal piglets intestinal transport of some macromolecules in food macromolecular transport across the rabbit proximal and distal colon polymeric immunoglobulin receptor in intestinal immune defense against the lumen-dwelling protozoan parasite giardia anti-inflammatory role for intracellular dimeric immunoglobulin a by neutralization of lipopolysaccharide in epithelial cells expression of the neonatal fc receptor, fcrn, on human intestinal epithelial cells bidirectional fcrn-dependent igg transport in a polarized human intestinal epithelial cell line immunoglobulin transport across polarized epithelia cells human neonatal fc receptor mediates transport of igg into luminal secretions for delivery of antigens to mucosal dendritic cells gut flora in health and disease identification of a unique igg fc binding site in human intestinal epithelium human iggfc binding protein (fcbp) in colonic epithelial cells exhibits mucin-like structure distribution and partial characterization of igg fc binding protein in various mucin producing cells and body fluids mechanisms by which maternal antibodies influence infant vaccine responses: review of hypotheses and definition of main determinants comparative studies of two types of bovine immunoglobulin g heavy chains isolation of bovine immunoglobulins resistant to peptic digestion: new perspectives in the prevention of failure in passive immunization of neonatal calves protein a/g chromatography purification of antibodies using affinity chromatography electrospun polyethersulfone affinity membrane: membrane preparation and performance evaluation selective concentration of bovine immunoglobulins and α-lactalbumin from acid whey using fecl separation of immunoglobulin and transferring from blood serum and plasma by metal chelate interaction chromatography protein adsorption on biodegradable polyanhydride microparticles immunochemical quantification of antigens by single radial immunodiffusion quantification of bovine igg in milk using enzyme-linked immunosorbant assay thermally addressed immunosorbent assay for multiplexed protein detections using phase change nanoparticles quantification of immunoglobulin g in bovine and caprine milk using a surface plasmon resonance-based immunosensor separation of univalent fragments from the bivalent rabbit antibody molecule by reduction of disulfide bonds physicochemical characteristics of proteolytic cleavage fragments of bovine colostral immunoglobulin g (igg ) potent antibody therapeutics by design the effect of trypsin and chymotrypsin on the bactericidal antibody activity of bovine colostrum proteolysis of bovine immunoglobulins colostrum protein digestion in newborn lambs n-labeled immunoglobulins from bovine colostrum are partially resistant to digestion in human intestine gastroileal nitrogen and electrolyte movements after bovine milk ingestion in humans survival of anti-colostridium difficile bovine immunoglobulin concentrate in the human gastrointestinal tract bovine immunoglobulin concentrate-colostridium difficile retains c. difficile toxin neutralizing activity after passage through the human stomach and small intestine mammary function during the nonlactating period: enzyme, lactose, protein concentrations, and ph of mammary secretions comparative studies in molecular stability of immunoglobulin g from different species effect of thermal protectants on the stability of bovine milk immunoglobulin g effect of ph on antigen-binding activity of igg from bovine colostrum upon heating specific activity against diarrheagenic bacteria in bovine immune milk and effect of ph on its antigen-binding activity upon heating efficiency and protective effect of encapsulation of milk immunoglobulin g in multiple emulsion temperature and ph dependence of immunoglobulin g conformation effect of heat treatment on the antigen-binding activity of anti-peroxidase immunoglobulins in bovine colostrum kinetic and thermodynamic parameters for heat denaturation of bovine milk igg, iga and igm thermal stability of bovine milk immunoglobulin g (igg) and the effect of added thermal protectants on the stability stability of bovine immunoglobulins to thermal treatment and processing effect of heat treatment on anti-rotavirus activity of bovine colostrum effect of flash-heat treatment on immunoglobulins in breastmilk effect of flash-heat treatment on antimicrobial activity of breastmilk pulsed electric field processing of beer: microbial, sensory, and quality analyses inactivation of e. coli in enriched soymilk using pulsed electric fields effects of pulsed electric fields on the activity of enzymes in aqueous solution effects of pulsed electric fields and thermal processing on the stability of bovine immunoglobulin g (igg) in enriched soymilk effects of pulsed electric fields and heat treatment on stability and secondary structure of bovine immunoglobulin g inactivation of staphylococcus aureus in milk using flow-through pulsed uv-light treatment system recommended laboratory practices for conducting high-pressure microbial inactivation experiments comparison of effects of high-pressure processing and heat treatment on immunoactivity of bovine milk immunoglobulin g in enriched soymilk under equivalent microbial inactivation levels compression heating influence of pressure transmitting fluids on bacteria inactivation during high pressure processing effect of heat and high-pressure treatments on microbiological quality and immunoglobulin g stability of caprine colostrum maintenance of breast milk immunoglobulin a after high-pressure processing heat treatment of bovine colostrum. i: effects of temperature on viscosity and immunoglobulin g level effect of on-farm commercial batch pasteurization of colostrum on colostrum and serum immunoglobulin concentrations in dairy calves effect of heat treatment of bovine colostrum on bacterial counts, viscosity, and immunoglobulin g concentration heat-treatment of bovine colostrum. ii: effects of heating duration on pathogen viability and immunoglobulin g effects of feeding heat-treated colostrum on passive transfer of immune and nutritional parameters in neonatal dairy calves feeding heat-treated colostrum or unheated colostrum with two different bacterial concentrations to neonatal dairy calves feeding heat-treated colostrum to neonatal dairy heifers: effects on growth characteristics and blood parameters key: cord- -f jz pt authors: arabi, yaseen m.; tamimi, waleed; jones, gwynne; jawdat, dunia; tamim, hani; al-dorzi, hasan m.; sadat, musharaf; afesh, lara; sakhija, maram; al-dawood, abdulaziz title: free fatty acids’ level and nutrition in critically ill patients and association with outcomes: a prospective sub-study of permit trial date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: f jz pt objectives: the objectives of this study were to evaluate the clinical and nutritional correlates of high free fatty acids (ffas) level in critically ill patients and the association with outcomes, and to study the effect of short-term caloric restriction (permissive underfeeding) on ffas level during critical illness. patients/method: in this pre-planned sub-study of the permit (permissive underfeeding vs. target enteral feeding in adult critically ill patients) trial, we included critically ill patients who were expected to stay for ≥ days in the intensive care unit. we measured ffas level on day , , , , and of enrollment. of enrolled patients, ( . %) patients had high ffas level (baseline ffas level > . mmol/l in females and > . mmol/l in males). results: patients with high ffas level were significantly older and more likely to be females and diabetics and they had lower ratio of partial pressure of oxygen to the fraction of inspired oxygen, higher creatinine, and higher total cholesterol levels than those with normal ffas level. during the study period, patients with high ffas level had higher blood glucose and required more insulin. on multivariable logistic regression analysis, the predictors of high baseline ffas level were diabetes (adjusted odds ratio (aor): . ; % confidence interval (ci): . , . , p = . ) and baseline cholesterol level (aor, . ; % ci: . , . , p = . ). serial levels of ffas did not differ with time between permissive underfeeding and standard feeding groups. ffas level was not associated with -day mortality (aor: . ; % ci: . , . , p = . ). conclusion: we conclude that high ffas level in critically ill patients is associated with features of metabolic syndrome and is not affected by short-term permissive underfeeding. fatty acids are a major source of fuel in the body and play an important role in cell signaling [ , ] . free fatty acids (ffas) are nonesterified fatty acids that are released by the hydrolysis of triglycerides (triglyceride molecule is composed of three fatty acid molecules bound to glycerol) within the adipose tissue by lipoprotein lipase. they circulate in the blood protein-bound, serving as an energy source for tissues [ , ] . chronically elevated ffas level has been observed in obese people and in diabetic patients and is associated with insulin resistance and with sudden death in middle-aged men without known ischemic heart disease [ , , ] . acutely, ffas level is often increased during critical illness and may contribute to organ dysfunction. critical illness is characterized by hypercatabolic state and by a change in the contribution of the endogenous protein, fat, and carbohydrate sources to oxidative fuel [ ] . lipolysis is accelerated by the high catecholamine and other stress hormone milieu leading to increased release of ffas from adipocytes, thus, increasing ffas level [ ] . insulin resistance during critical illness impairs the use of ffas for energy, and, thus, contributes to increased ffas level [ ] . heparin given during critical illness may also increase ffas level by activating lipoprotein lipase [ ] . ffas may have toxic effects by increasing reactive oxygen species leading to cell death and necrosis [ ] and by depressing the immune cell function [ ] . in addition, ffas potentiate insulin resistance and impair glucose metabolism by inhibiting glucose oxidation and by stimulating protein kinase c [ , ] . in an acute setting, elevated ffas level has been associated with the development of acute lung injury in at-risk patients with sepsis, trauma, and pancreatitis and after on-pump coronary artery bypass grafting [ , , ] . can ffas level in critically ill patients be modulated by short-term caloric restriction (permissive underfeeding)? normally, serum ffas level increases during fasting and exercise and after a fatty meal. ffas level goes down postprandially due to the anti-lipolytic effect of insulin that is released after carbohydrate intake [ ] . on the other hand, caloric restriction and weight loss lead to a lowering of ffas level and can attenuate ffas-induced hepatic insulin resistance in obese healthy patients [ ] [ ] [ ] . however, the effect of caloric restriction on serum ffas level has not been investigated in critically ill patients. the aims of this study were ( ) to evaluate the clinical and nutritional correlates of high ffas level in critically ill patients and the association with outcomes, and ( ) study the effect of short-term caloric restriction (permissive underfeeding) on ffas level during critical illness. this is a pre-planned sub-study of the permit [ ] (permissive underfeeding vs. target enteral feeding in adult critically ill patients-isrctn ) trial, in which critically ill patients were randomized to permissive underfeeding ( - % of calculated caloric requirements) or standard feeding ( - %) for up to days while maintaining similar protein intake in both groups. the trial found no difference in the primary endpoint of -day mortality. in this sub-study which was separately funded by king abdulaziz city for science and technology (kacst), riyadh, saudi arabia (grant number-at - kacst), we enrolled consecutive patients from the permit trial at king abdulaziz medical city, riyadh, saudi arabia between september and september who were expected to stay ≥ days in the intensive care unit as judged by their primary team. a separate informed consent was obtained for participation in this sub-study. the study was approved by the institutional board review of the ministry of the national guard health affairs, riyadh, saudi arabia. blood was collected at the time of enrollment (baseline or study day ) within h of icu admission and on days , , , and . serum was prepared from the blood samples by centrifugation at • c at g for min and divided into aliquots. these aliquots were stored immediately in a designated freezing area at − • c to be analyzed once the sample size was completed. the samples were analyzed blindly, and then the sample codes were broken. the measurement of ffas was performed in bioscientia reference laboratory in germany using an in-vitro enzymatic calorimetric assay with wako-nefa-hr ( ) reagent (wako-chemicals, neuss, germany) [ ] . in this method, ffas with the coexistence coenzyme a (coa) and adenosine- '-triphosphate (atp) disodium salt were converted to acyl-coa, adenosine monophosphate (amp) and pyrophosphoric acid by the action of acyl-coa synthetase (acs). the acyl-coa was oxidized yielding , -trans-enoyl-coa and hydrogen peroxide (h o ) by the action of acyl-coa oxidase. in the presence of peroxidase, h o yielded a blue-purple pigment by quantitative oxidation condensation with -methyl-n-ethyl-n-(β-hydroxyethyl)-aniline (meha) and -aminoantipyrine ( aa). ffas level was obtained by measuring absorbance at the blue and purple color at wavelengths of nm and nm. the normal fasting serum ffas level is . to . mmol/l for females and . to . mmol/l for males. however, ffas level in the critically ill is poorly studied. in the current study, patients with ffas more than . mmol/l in females and . mmol/l in males were considered to have high ffas level; otherwise ffas level was considered normal. baseline data included demographics, acute physiology and chronic health evaluation scores (apache) ii [ ] , presence of sepsis upon admission, sequential organ failure assessment (sofa) score [ ] , the ratio of partial pressure of arterial oxygen to the fraction of inspired oxygen (pao :fio ), glasgow coma scale and various laboratory results (baseline blood glucose, hemoglobin, international normalized ratio(inr), platelets, bilirubin, creatinine, c-reactive protein, albumin, pre-albumin, transferrin, -h urinary urea nitrogen excretion, and nitrogen balance). for the intervention period, which lasted for up to days, we collected daily nutritional data (feeding formula and calories from enteral feeds, propofol, intravenous dextrose, and parenteral nutrition), insulin dose for hyperglycemia management, daily blood glucose, and use of certain medications, such as aspirin, beta-blockers and statins. we noted the daily carbohydrate, fat, and protein calories from enteral and parenteral sources and then calculated the total fat-to-carbohydrate ratio by dividing fat calories by carbohydrate calories. the outcomes evaluated in this study were -, -, and -day all-cause mortality. other outcomes included hospital and icu mortality, incident renal replacement therapy, icu-associated infections [ ] , icu and hospital length of stay (los), and mechanical ventilation duration. in addition, icu-free days, renal replacement therapy-free days, and ventilator-free days were also calculated. we reported categorical variables as frequencies with percentages and continuous variables as medians with quartile and (q , q ). we compared categorical variables using chi-square or fisher's exact test and continuous variables using mann-whitney u test. we examined pearson correlation among the following baseline variables ffas level, age, body mass index, total cholesterol, high-density lipoprotein (hdl) cholesterol, low-density lipoprotein (ldl) cholesterol, non-hdl cholesterol, triglycerides, glucose, and hemoglobin a c. in addition, multivariable logistic regression analysis was performed to assess the predictors of high ffas level. we entered in the model a priori decided baseline variables that were of clinical interest and/or had significant association with high ffas level by univariable analysis (p ≤ . ) which included age, gender, body mass index (bmi), apache ii, diabetes, triglycerides, ldl cholesterol, hdl cholesterol, medical admissions (vs. non-medical admissions), and randomization (permissive vs. standard feeding). we also carried out a linear mixed model to test whether ffas level is affected over time with permissive underfeeding compared to standard feeding. we carried out logistic and linear regression models to examine the association between ffas level and outcomes adjusting for age, gender, bmi, apache ii, diabetes, triglycerides, ldl cholesterol, hdl cholesterol, non-hdl cholesterol, and medical admissions (vs. non-medical admissions). a two-tailed p value < . was considered statistically significant. the results were expressed as adjusted odds ratio (aor) or parameter estimate with % confidence intervals ( %ci). all statistical analyses were performed using sas version . (sas institute, cary, nc, usa). of the patients included in the study ( figure s ), ( . %) had high ffas level (median . mmol/l (q , q : . , . ) and ( . %) had normal ffas level ( . mmol/l ( . , . ))). patients with high ffas level were significantly older, more likely to be females and diabetic, had higher hgba c, creatinine and non-hdl and ldl cholesterol levels, and had lower pao :fio ratio compared with patients with normal ffas (table ). there were significant correlations between ffas level and total cholesterol (r = . , p = . ), non-hdl cholesterol (r = . , p = . ), hdl cholesterol (r = . , p = . ) and ldl cholesterol (r = . , p = . ), and age (r = . , p = . ) ( table s ). table shows the nutritional data during the study period and the trial co-interventions. the total daily caloric intake was . ffas level (p = . ). the baseline blood glucose was similar in the two groups; however, during the study period, the glucose level was significantly higher in patients with high ffas level compared to patients with normal ffas level ( . mmol/l (q , q : . , . ) compared to . mmol/l (q , q : . , . ) p= . ) with higher use of insulin ( . units per day (q , q : . , . ) compared to . units per day (q , q : . , . ) p = . ). additionally, more patients in the high ffas level received disease-specific formulae, renal replacement therapy, aspirin and statins during icu stay. on multivariable logistic regression analysis, the independent predictors of high ffas level were diabetes (aor, . ; % ci, . , . ; p = . ), and baseline cholesterol (aor, . ; % ci, . , . ; p = . ). figure , panel a shows the serial levels of ffas for patients with high ffas and normal ffas. figure , panel b shows ffas level in patients who received permissive underfeeding and standard feeding. the ffas level was not different between the two feeding strategies. on multivariable logistic regression analysis, the independent predictors of high ffas level were diabetes (aor, . ; % ci, . , . ; p = . ), and baseline cholesterol (aor, . ; % ci, . , . ; p = . ). figure , panel a shows the serial levels of ffas for patients with high ffas and normal ffas. figure , panel b shows ffas level in patients who received permissive underfeeding and standard feeding. the ffas level was not different between the two feeding strategies. a) and in patients who received permissive underfeeding and standard feeding (panel b). p values for between-group differences and between-group differences over time are provided using mixed linear model. there was no significant difference in crude mortality between patients with high and normal ffas level ( table ) . incident of renal replacement therapy was more frequent in patients with high ffas level ( / ( . %) compared to / ( . %), p = . ). multiple variable analyses adjusting for age, gender, bmi, apache ii, diabetes, triglycerides, ldl cholesterol, hdl cholesterol, non-hdl cholesterol, and medical admissions (vs. non-medical admissions) showed no significant association between high ffas level and -day mortality (aor . , % ci . , . , p = . ) or any other study outcomes (table ) . . p values for between-group differences and between-group differences over time are provided using mixed linear model. there was no significant difference in crude mortality between patients with high and normal ffas level ( table ) . incident of renal replacement therapy was more frequent in patients with high ffas level ( / ( . %) compared to / ( . %), p = . ). multiple variable analyses adjusting for age, gender, bmi, apache ii, diabetes, triglycerides, ldl cholesterol, hdl cholesterol, non-hdl cholesterol, and medical admissions (vs. non-medical admissions) showed no significant association between high ffas level and -day mortality (aor . , % ci . , . , p = . ) or any other study outcomes (table ) . in this study, we evaluated serum ffas level in critically ill patients. we found that ffas level was elevated at baseline in % of patients, and that it was associated with features of the metabolic syndrome. ffas level was not affected by permissive underfeeding versus standard feeding. high ffas level appear to be largely a reflection of the underlying metabolic condition of the patient rather than the critical illness itself. our study provides a characterization of critically ill patients with high ffas level. we found that high ffas level correlated highly with other lipid profile parameters (total, hdl and ldl cholesterol, but not triglycerides) and with age. compared to those with normal ffas level, patients with high ffas level were at baseline significantly older, more likely to be diabetic, had higher hgba c, blood glucose, creatinine and non-hdl and ldl cholesterol concentrations, and had more hypoxemia (as reflected lower po : fio ratio) despite lack of differences in apache ii scores, sofa scores, and vasopressor demands. during icu stay, patients with high ffas level had increased demand for insulin, disease-specific nutrition therapy, rrt, aspirin, and statins. the differences suggest the association of high ffas level with metabolic syndrome. there was no difference in bmi, between the two groups; however, bmi is known to have its limitations in predicting obesity [ ] . because of these differences, we carried out multivariable analyses to account for the confounding effect of some of these variables on clinical outcomes. these analyses show that high ffas level is not associated independently with clinical outcomes. interestingly, patients with high ffas level had less -h urinary nitrogen excretion and less negative nitrogen balance. this may be related to lower muscle mass in this older population and more frequent insulin therapy. normally, ffas are elevated during fasting and exercise, and their level drops postprandially after carbohydrate-rich meals. ffas level are elevated in obesity and diabetes [ , ] . in acute critical illness, where lipolysis increases, serum ffas level increases [ ] . our study demonstrated that one-third of critically ill patients had high ffas level; most ( . %) of these patients were diabetics. we found that baseline cholesterol level and diabetes were independent risk factors for high ffas level on multivariable logistic regression analysis. the effect of propofol on ffas level is uncertain. in an experiment on dogs undergoing general anesthesia, high concentration of propofol ( and mcg/kg/min) were associated with increased ffas level, although a study in humans undergoing general anesthesia for cardiopulmonary bypass showed that propofol ( mcg/kg/min) compared to midazolam did not alter serum ffas level [ , ] . in our study, categorization of patients into high and low ffas level was based on baseline serum specimens, and doses of propofol preceding enrolment were not collected. our study was not designed to specifically address the effect of propofol on ffas level. nevertheless, the doses of propofol that were used during the icu stay were on average much lower than what was used in these studies, and, therefore, the effect of propofol on ffas level in our cohort is likely to be small. the slightly lower dose of propofol given to patients with high-ffas level was likely to be related to being older and more susceptible to sedation. therefore, these patients would normally receive smaller doses of propofol. in addition to being a fuel source, ffas have multiple other physiologic effects. ffas are associated with insulin resistance and impaired glucose metabolism by inhibiting glucose oxidation and by stimulating protein kinase c [ , , ] . they may also stimulate the autophagy of pancreatic beta cells [ ] . in our study, patients with high ffas level had higher blood glucose and required more insulin therapy during the icu stay even though the baseline blood glucose level was similar in patients with high and normal ffas, suggesting an association of ffas and insulin resistance in icu patients. ffas may also affect the course of acute critical illness. ffas were found to exacerbate hyperglycemia-induced toll-like receptor expression and activity in monocytic cells, increase superoxide release, enhance nuclear factor-κb activity, and induce the release of proinflammatory factors in diabetics [ ] . whether ffas affect inflammation in critically ill patients is less clear. in a porcine endotoxemia model, infusing lipids at two different concentrations was associated with no differences in plasma tumor necrosis factor-α, interleukin , and leucocytes between animals with low and high ffas suggesting that ffas does not play a significant pro-inflammatory mediator effect [ ] . however, ffas have been implicated in the pathogenesis of acute respiratory distress syndrome and has been identified as a prognostic factor for this syndrome. in a lipopolysaccharide-induced acute lung injury model, a -fold increase in free oleic acid was observed in bronchoalveolar lavage fluid from mice h after lipopolysaccharide application [ ] . the ffa, oleic acid has been demonstrated to be elevated in patients with ards (acute respiratory distress syndrome) and in patients at-risk for ards [ , ] . patients with sepsis demonstrated a six-fold increase in plasma oleic acid levels compared to healthy volunteers [ ] . in addition, ffas are elevated in the blood of patients with sepsis who are at increased risk for ards [ ] . the exact mechanism of ffas-associated lung injury is unclear; however, ffas have been shown to increase permeability and to impair transepithelial active sodium transport mechanisms in the lung, and could, thus, promote alveolar edema formation and prevent edema resolution [ ] . in our study, where almost all patients were on mechanical ventilation at baseline, hypoxemia was more significant in patients with high ffas compared with patients with normal ffas (median pao : fio ratio was vs. , p = . ), a finding that may be in line with the association of ffas and lung injury. whether ffas are toxic to the kidneys is unclear. in an animal study, ffas led to severe tubulointerstitial damage [ ] . ffas and their metabolites have been implicated in renal cell injury and development of chronic kidney in patients with the metabolic syndrome [ ] . in our study, patients with high ffas had a higher rate of new renal replacement therapy, although this association became not significant in multivariable analysis. this finding suggests that the observed crude association may be related to other confounders that put these patients at a higher risk for acute kidney injury; for example, patients with high ffas level were more likely to be diabetics and had higher baseline creatinine compared to patients with normal ffas level. weight loss leads to a lowering of ffas level in the long run and can attenuate ffas-induced hepatic insulin resistance in obese healthy patients [ ] [ ] [ ] . however, the effects of short-term caloric restriction are different. in one study, subjects were fed for two periods of days with hypo-and eucaloric diet with the same macronutrient composition in random order [ ] . at days, fasting ffas significantly increased with the hypocaloric diet compared with the eucaloric diet [ ] . whether the macronutrient composition affects ffas was investigated in an animal model, and the study found that energy-restricted high-fat versus low-fat diet did not result in different ffa levels [ ] . in the current study, serial levels of ffas did not differ with time between patients receiving permissive underfeeding and standard feeding. the study results should be interpreted taking into considerations its strengths and limitations. strength include that data came from a randomized controlled trial, and that serial measurements of ffas were obtained. the limitations include the sample size, which makes the study underpowered to detect a mortality difference. we measured total ffas but not individual levels of each ffas. in addition, the study included patients who had an expected duration of icu stay ≥ days and, thus, the results may not be generalizable to patients who have a shorter stay. in conclusion, we found that serum ffas level was elevated in almost one-third of critically ill patients. high ffas level was associated with features of the metabolic syndrome and was not affected by short-term moderate caloric restriction. supplementary materials: the following are available online at http://www.mdpi.com/ - / / / /s , table s : pearson correlations among baseline free fatty acids (ffas) level and other related measures of lipid metabolism, figure s : flow diagram for patients enrolled in the sub-study of free fatty acids (ffas) level. obesity, insulin resistance and free fatty acids elevation of free fatty acids induces inflammation and impairs vascular reactivity in healthy subjects lipid metabolism, metabolic diseases, and peroxisome proliferator-activated receptors circulating nonesterified fatty acid level as a predictive risk factor for sudden death in the population metabolic response to the stress of critical illness the acute splanchnic and peripheral tissue metabolic response to endotoxin in humans insulin stimulates lipoprotein lipase activity and synthesis in adipocytes from septic rats elevated free fatty acid level is a risk factor for early postoperative hypoxemia after on-pump coronary artery bypass grafting: association with endothelial activation fatty acids trigger mitochondrion-dependent necrosis short-chain fatty acids produced by anaerobic bacteria alter the physiological responses of human neutrophils to chemotactic peptide an increase in serum c unsaturated free fatty acids as a predictor of the development of acute respiratory distress syndrome serum free fatty acid concentration in patients with acute pancreatitis fatty acids, obesity, and insulin resistance: time for a reevaluation effect of weight loss and ketosis on postprandial cholecystokinin and free fatty acid concentrations effects of exercise training and diet on lipid kinetics during free fatty acid-induced insulin resistance in older obese humans with impaired glucose tolerance free fatty acid-induced hepatic insulin resistance is attenuated following lifestyle intervention in obese individuals with impaired glucose tolerance permissive underfeeding or standard enteral feeding in critically ill adults a severity of disease classification system use of the sofa score to assess the incidence of organ dysfunction/failure in intensive care units: results of a multicenter, prospective study. working group on "sepsis-related problems" of the european society of intensive care medicine middle east respiratory syndrome coronavirus infection: a short note on cases with renal failure problem is bmi the best measure of obesity? effect of propofol continuous-rate infusion on intravenous glucose tolerance test in dogs propofol as a continuous infusion during cardiopulmonary bypass does not affect changes in serum free fatty acids elevated plasma nonesterified fatty acids are associated with deterioration of acute insulin response in igt but not ngt free fatty acids stimulate autophagy in pancreatic β-cells via jnk pathway free fatty acids in the presence of high glucose amplify monocyte inflammation via toll-like receptors circulating free fatty acids do not contribute to the acute systemic inflammatory response. an experimental study in porcine endotoxaemia plasma fatty acid changes and increased lipid peroxidation in patients with adult respiratory distress syndrome parenteral nutrition with fish oil modulates cytokine response in patients with sepsis oleic acid inhibits alveolar fluid reabsorption: a role in acute respiratory distress syndrome? urinary free fatty acids bound to albumin aggravate tubulointerstitial damage mechanisms of tubulointerstitial injury in the kidney: final common pathways to end-stage renal failure the effects of underfeeding on whole-body carbohydrate partitioning, thermogenesis and uncoupling protein expression in human skeletal muscle energy-restricted high-fat diets only partially improve markers of systemic and adipose tissue inflammation we wish to thank the following those who made valuable suggestions or who have otherwise contributed to the preparation of the manuscript: maram sakhija, turki almoammar, muhammad rafique sohail, shihab mundekkadan and aeron toledo. key: cord- -dzm xi authors: filardi, tiziana; varì, rosaria; ferretti, elisabetta; zicari, alessandra; morano, susanna; santangelo, carmela title: curcumin: could this compound be useful in pregnancy and pregnancy-related complications? date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: dzm xi curcumin, the main polyphenol contained in turmeric root (curcuma longa), has played a significant role in medicine for centuries. the growing interest in plant-derived substances has led to increased consumption of them also in pregnancy. the pleiotropic and multi-targeting actions of curcumin have made it very attractive as a health-promoting compound. in spite of the beneficial effects observed in various chronic diseases in humans, limited and fragmentary information is currently available about curcumin’s effects on pregnancy and pregnancy-related complications. it is known that immune-metabolic alterations occurring during pregnancy have consequences on both maternal and fetal tissues, leading to short- and long-term complications. the reported anti-inflammatory, antioxidant, antitoxicant, neuroprotective, immunomodulatory, antiapoptotic, antiangiogenic, anti-hypertensive, and antidiabetic properties of curcumin appear to be encouraging, not only for the management of pregnancy-related disorders, including gestational diabetes mellitus (gdm), preeclampsia (pe), depression, preterm birth, and fetal growth disorders but also to contrast damage induced by natural and chemical toxic agents. the current review summarizes the latest data, mostly obtained from animal models and in vitro studies, on the impact of curcumin on the molecular mechanisms involved in pregnancy pathophysiology, with the aim to shed light on the possible beneficial and/or adverse effects of curcumin on pregnancy outcomes. maternal nutrition is an essential and modifiable environmental factor that deeply influences maternal and offspring health in the short and long-term [ ] [ ] [ ] [ ] [ ] [ ] . genetics, nutrition, and other environmental factors significantly contribute to the physiological immune and metabolic modifications occurring in pregnancy, to favor maternal adaptation to the growing and developing fetus. maternal malnutrition adversely affects these dynamic processes by acting on the mechanisms related to the nutritional programming, including nutrition sensing signals, epigenetic regulation, gut microbiome, as well as on the nutrient-nutrient and nutrient-drug interactions, modulating maternal and fetal genes in a sex-specific manner [ , [ ] [ ] [ ] [ ] . bw/day of curcumin as a food additive [ ] . however, despite its potential therapeutic benefits, curcumin is poorly bioavailable due to its rapid metabolism, and the small portion of substance that is absorbed is extensively bio-transformed into its water-soluble metabolites, glucuronides, and sulfates [ ] . therefore, several strategies have been developed to enhance its bioavailability and efficacy, to increase oral and gastro-intestinal absorption, and to reduce the clearance from the body [ ] [ ] [ ] . for this purpose, taking into consideration that curcumin is fat-soluble, several delivery systems have been developed to obtain a number of formulations by mixing curcumin with different materials, including adjuvants, such as piperine [ , ] . micelles, liposomes, phospholipid complexes, phytosomes, emulsions, microemulsions, nano-emulsions, solid lipid nanoparticles, nanostructured lipid carriers, biopolymer nanoparticles, and microgels represent different and recent technical approaches to encapsulate curcumin [ ] [ ] [ ] , although further studies are needed to evaluate their effectiveness and safety as potential health-promoting compounds in humans. it is well known that dynamic changes in insulin sensitivity take place during healthy pregnancy to allow adequate supply to the growing fetus [ ] . in pregnancy, several players, including hormones, cytokines, and metabolic factors, contribute to the development of insulin resistance through complex mechanisms, not yet completely understood [ , ] . maternal obesity, related to unhealthy diet and lifestyle, can negatively affect insulin sensitivity leading to the development of gdm and type diabetes (t d), with serious short and long-term health consequences for both the mother and the offspring [ , ] . recent evidence emphasized the anti-hyperglycemic activity of curcumin, both in animals and humans [ ] . specifically, this compound had the capability to improve glucose uptake, insulin sensitivity, and pancreatic β-cell function, as well as liver and kidney function, and to reduce glucose and lipid levels, oxidative stress, and inflammation [ ] , by interacting with almost all the players involved in these processes, as demonstrated in in vitro studies [ , ] . as regards human studies, the effects of curcumin supplementation have been evaluated in several randomized controlled trials. a recent intervention study showed that mg/day curcumin supplementation ( mg capsules: mg of curcumin, mg of demethoxycurcumin, and mg of bisdemethoxycurcumin) for weeks reduced triglycerides (tg) and c-reactive protein (crp), and increased adiponectin levels [ ] , whereas mg/day curcumin co-administered with piperine mg/day for three months was able to reduce blood glucose, c-peptide, glycated hemoglobin (hba c), alanine aminotransferase (alt) and aspartate aminotransferase (ast), in patients with t d [ ] . another study showed that the daily ingestion of mg turmeric powder for eight weeks resulted in a reduction in body weight, low density lipoprotein-cholesterol (ldl-c), and tg levels, with no significant effects on glycemia, crp, and hba c, in hyperlipidemic t d patients [ ] . in obese women with polycystic ovary syndrome (pcos), mg/day curcumin supplementation ( mg twice daily: - % curcumin, - % demethoxycurcumin and . - . % bisdemethoxycurcumin) for six weeks improved serum insulin and the quantitative insulin sensitivity check index [ ] . a recent meta-analysis reported that curcumin intake was associated with reduced body mass index (bmi), body weight, body fat, leptin value, and increased adiponectin levels in patients with metabolic syndrome and related disorders [ ] . overall, the dosage and duration of curcumin supplementation appear to differently modulate glucose metabolism in humans. a recent promising approach to treat hyperglycemia consists of combining the effects of curcumin and the ongoing antidiabetic agents, as observed in diabetic rats treated with a combination of curcumin and metformin. specifically, this association improved hyperglycemia, dyslipidemia, and oxidative stress, increasing the activity of the antioxidant enzyme paraoxonase (pon ), in diabetic rats [ ] . dietary bioactive compounds might have beneficial effects on gdm [ , ] . in particular, curcumin appeared to improve gdm and gdm-related complications in a recent study in a mouse model. specifically, c bl/ksjdb/+ diabetic pregnant mice were supplemented with different curcumin dosages: mg/kg and mg/kg/day, from gestational day zero (gd ) to gd . results showed that mg/kg curcumin significantly reduced blood glucose and insulin levels, increased hepatic glycogen content, and improved oxidative stress by reducing thiobarbituric acid reactive substance (tbars) and increasing glutathione (gsh) levels, superoxide dismutase (sod), and catalase (cat) activities in the liver of diabetic pregnant mice at gestational day . the reduced ' adenosine monophosphate-activated protein kinase (ampk) and increased histone deacetylase hdac activities observed in gdm liver were reverted by curcumin treatment. furthermore, curcumin positively influenced the offspring of mothers with gdm, restoring litter size and birth weight, and inducing the reduction of glucose- -phosphatase (g pase) expression and activity in the liver [ ] ( table ) . congenital birth defects, including neural tube defects (ntd), occur more often in the offspring of diabetic mothers. in a recent study, mouse embryos (at e . of development) were cultured for h with mg/dl glucose, in the absence or presence of curcumin ( and µm). remarkably, µm curcumin was able to reduce the rate of embryos with ntd induced by high glucose. curcumin reduced high glucose-induced oxidative and nitrosative stress [i.e., decreased -hydroxynonenal ( -hne), nitrotyrosine levels, and lipid hydroperoxide (lpo)], as well as endoplasmic reticulum (er) stress (i.e., decreased expression of er-markers stress such as phosphorylated protein kinase-like endoplasmic reticulum kinase (p-perk), phosphorylated inositol-requiring protein- α (p-ire α), phosphorylated eukaryotic initiation factor α (p-eif α), c/ebp-homologous protein (chop), binding immunoglobulin protein (bip), and x-box binding protein (xbp ). moreover, µm curcumin inhibited the cleavage of pro-apoptotic caspases (i.e., casp- and - ) [ ] . although the results from preclinical studies are overall promising, further research is needed to better understand the molecular mechanisms underlying diabetic complications, as well as the pharmacodynamics and pharmacokinetics of curcumin in pregnancy, to conceivably employ this compound as a therapeutic agent for human pregnancy complications. critical changes in the cardiovascular system occur in physiological pregnancy, to ensure maternal and fetal adaptation to the increased metabolic demand and to guarantee adequate uteroplacental circulation for fetal growth. a healthy pregnancy is hallmarked by systemic vasodilatation, significantly related to the high levels of estrogen and progesterone. cardiac output and heart rate rise during gestation and the activation of the renin-angiotensin-aldosterone system leads to a significant increase in total blood volume. alterations in these processes are associated with maternal and fetal morbidity and mortality [ ] . obesity, older maternal age, and diabetes mellitus increase the risk of cardiovascular diseases in pregnancy ( - %), with a higher prevalence when including hypertensive disorders-chronic hypertension, pregnancy-induced hypertension, pre-eclampsia, and hellp syndrome (hemolysis, elevated liver enzymes, and low platelet count) [ ] . considering the anti-inflammatory, antioxidant, and antiangiogenic activities observed in several studies, curcumin is a potential therapeutic compound in cardiovascular disorders [ ] . preeclampsia (pe) is a systemic syndrome characterized by hypertension and proteinuria, which begins after weeks of gestation; it occurs in - % of pregnancies, and it is a leading cause of maternal and fetal morbidity and mortality [ ] . although the pathophysiology of pe remains to be elucidated, alterations in maternal vascular physiology have been described, leading to a generalized vasoconstrictive state, systemic oxidative stress, inflammation, and endothelial cell dysfunction, with severe adverse effects on the placenta, one of the major organs that develops after conception [ , ] . strategies to reverse or arrest the pathological processes of pe are aimed at reducing excessive inflammatory response, micro-emboli formation, and vasoconstriction by using specific drugs or natural products [ ] . for this purpose, studies in animal models have been performed. it has been observed that in lipopolysaccharides (lps)-treated pregnant rats to create a pe model (lps . µg/kg on gestational day ), the administration of curcumin ( . mg/kg, from gd to gd ) improved hypertension, proteinuria, and renal damage, and reduced serum levels of il- and monocyte chemoattractant protein- (mcp- ). curcumin treatment ameliorated inadequate trophoblast invasion and spiral artery remodeling, significant histopathological alterations observed in pe. analysis of placental tissue showed that curcumin administration decreased the lps-induced expression of the inflammatory molecules toll-like receptor (tlr)- , il- , and the proinflammatory transcription factor nf-kb. according to the obtained data, the authors hypothesized that curcumin may positively modulate the cascade of different signaling pathways involved in pe development [ ] . similar results were obtained in a mouse model of lps-induced pe. in this study, in addition to blood pressure and proteinuria reduction, curcumin increased the number of live pups, fetal and placental weight, and decreased fetal desorption. these effects were associated with the inhibition of placental expression of tnf-α, il- β, il- cytokines, and mcp- and mip- chemokines, and with a reduction in macrophage infiltration. the reduced inflammatory status was accompanied by increased activation of the serine/threonine-specific protein kinase akt, involved in cellular proliferation [ ] . neo-vascularization is a critical event mediated by several angiogenic factors-including the vascular endothelial growth factor (vegf), fibroblast growth factors (fgfs), matrix metalloproteinases (mmps)-and inflammatory factors such as cyclooxygenase (cox)- and nf-kb, occurring not only in tumor progression but also in early placentation [ , ] . curcumin appears to modulate the above-mentioned factors, influencing vessel formation by acting either as a proangiogenic or as an antiangiogenic molecule, depending on the concentration and the cell type [ ] . a recent study investigated the effect of curcumin in htr /svneo trophoblasts cells, a model of the human first-trimester placenta. incubation with curcumin at low concentration ( - µm for h) stimulated (i) proliferation with concomitant activation of akt, (ii) tube formation of placental trophoblast htr /svneo cells, (iii) and increased the expression of the proangiogenic factors vegf, vegfr , and fabp . in addition, curcumin treatment strongly increased the mrna and protein expression of hla-g, involved in the immune regulation during trophoblast invasion; and mrna expression of a relevant number of genes related to the notch-signaling pathway, which regulates angiogenesis. the authors examined the promoter methylation of genes involved in metabolic and oxidative stress and observed that curcumin induced hypomethylation in genes involved in the protection against oxidative stress and dna damage. altogether these data indicate that curcumin is able to promote angiogenesis and to activate protective pathways in the first trimester of pregnancy, and supports the development of the placental trophoblast [ ] . moreover, htr /svneo trophoblast cells were used to evaluate the protective effects of curcumin against oxidative stress induced by h o ( µm for h). results showed that pretreatment with curcumin ( µm for h) increased cell viability, upregulated the activities of the antioxidant enzymes cat and glutathione peroxidase (gsh-px), reduced the h o -induced ros accumulation and the apoptotic rate. at molecular levels, these data were associated with an increased nuclear translocation of the antioxidant transcription factor nrf , and reduced expression of cleaved-caspase [ ] . the anti-inflammatory activity of curcumin has been also observed in vitro in human gestational tissues treated with lps. specifically, incubation with curcumin ( µm for h) reduced il- release, and il- and il- mrna expression induced by lps, in both placenta and fetal membranes. moreover, curcumin decreased placental cox- mrna expression, prostaglandin pge and pgf a release, and the expression and activity of the matrix-degrading enzyme mmp- , in association with reduced activation of nf-kb [ ] . although several clinical trials emphasized the benefits of curcumin in different pathological contexts [ , , , ] , there are few data on curcumin supplementation in human pregnancy. recently, a double-blind randomized clinical trial involving pregnant women with preeclampsia was conducted to evaluate the possible effect of curcumin on the expression of cox- and il- , thought to have a role in the pathogenesis of pe. the enrolled patients were randomized to receive either curcumin mg/d (n = ) or placebo (n = ) [ ] . the authors analyzed the circulating levels of il- and cox- , at t , min after curcumin ingestion, and h after delivery. results showed that curcumin did not modify the expression of the analyzed molecules at any tested time. the authors hypothesized that the absence of effect might be due to the low dose of curcumin, taking into account that in non-pregnant subjects doses can reach more than g/day [ ] . during the antenatal and postpartum periods, women are particularly prone to develop mental disorders, including depression. postpartum depression (ppd) occurs in - % of women, leading to significant health consequences for both mother and offspring [ ] . this condition has been largely underestimated and understudied so far. hence, its prevalence is supposed to be higher, conceivably reaching % of women. symptoms of depression begin during pregnancy in about % of women and numerous environmental, genetic, biochemical, and epigenetic factors likely contribute to the onset of ppd [ ] [ ] [ ] , although the exact mechanisms responsible for this condition are not yet completely known. several pharmacological and psychological approaches are currently adopted to treat ppd, even though complementary and alternative medicine have also been taken into consideration. increasing data have suggested the neuroprotective roles of a healthy diet, rich in fruit and vegetables, highlighting its positive influence on mental health [ ] . on the contrary, an unhealthy dietary pattern increases the risk of systemic low-grade inflammation and neuroinflammation, known to be associated with ppd [ ] . the neuroprotective and antidepressant benefits of curcumin have been known for a long time [ ] [ ] [ ] . several preclinical studies have suggested potential positive effects of curcumin in treating neurological disorders, such as alzheimer's disease, parkinson's disease, multiple sclerosis, migraine, epilepsy, brain and spinal cord injury, and depression [ , , ] . lopresti and colleagues have investigated the effects of curcumin on depression outcomes in humans. they observed that eight-week curcumin supplementation ( mg twice a day) in subjects with major depressive disorder (mdd) was effective in reducing depressive and anxiety symptoms, as demonstrated by the reduction in total depressive symptoms (total ids score), mood/cognitive depressive symptoms (idsm), arousal-related symptoms (idsa), and trait anxiety (stait) [ ] . this supplementation resulted in an increase in urinary levels of both the arachidonic acid metabolite thromboxane b (tbx-b ) and the neuropeptide substance p (sub-p), potentially involved in depression mechanisms. moreover, although curcumin did not modify plasma levels of endothelin- and leptin, a greater antidepressant benefit was observed in subjects with the highest baseline levels of these molecules. the authors hypothesized that curcumin might act by increasing endothelin and leptin receptor activities [ ] . similarly, in another trial, mg/day curcumin ingestion for six weeks or the administration of the antidepressant drug fluoxetine showed comparable efficacy in subjects with mdd [ ] . a recent meta-analysis provided relevant information about curcumin use in depression. specifically, this analysis revealed that curcumin administration (i) appears to be more effective in reducing depression symptoms at a higher dosage ( g/day) and for six weeks or more; (ii) can enhance the action of antidepressants; and (iii) has more effects on subjects with major depression and without other comorbidities [ ] . these results indicate the need for further study to better comprehend the mechanisms of action of curcumin in depression treatment. data obtained from animal and in vitro studies have indicated that curcumin might exert antidepressant activity by acting on different signaling pathways involved in mental disorders. specifically, this compound is able to ameliorate the hypothalamic-pituitary-adrenal (hpa) axis disturbances [ ] . curcumin can influence the unbalanced release of monoamine neurotransmitterssuch as serotonin ( -ht), dopamine (da), noradrenaline, and glutamate-the expression of monoamine oxidase (mao), the expression of neurotrophic factors such as brain-derived neurotrophic factor (bdnf) and neurogenesis, as well as the dysregulated immune system function and oxidative and nitrosative stress. thus, curcumin appears to promote neurogenesis and inhibit neuronal cell apoptosis [ , , , ] . despite the consistent evidence of efficacy and safety of curcumin treatment in other pathological conditions, to date, data on its effects on depression in pregnancy are completely lacking. however, in the last years, there has been a growing awareness of the possible role of anti-inflammatory micronutrients in improving ppd symptoms [ ] . according to the theory of the fetal origin of adult diseases (foad) hypothesized by david barker, the intrauterine environment has a relevant role in fetal growth and development and influences disease susceptibility in the offspring in the short and long term [ ] . the physiological processes of pregnancy require immune and metabolic modifications to accommodate the growing fetus; maternal malnutrition negatively influences this dynamic equilibrium, leading to tissue-specific impairment, with serious adverse outcomes for both mother and child [ , ] . taking into consideration the importance of nutrition in human development, there is a need for better understanding the nutritional programming and the related mechanisms and players acting during pregnancy. the placenta has the fundamental role of transferring nutrients to the fetus, and alterations in placental function have severe effects on fetal growth. placental insufficiency is the most common cause of fetal growth restriction (fgr), a serious condition that affects - % of all newborns [ ] . although the pathophysiology of fgr is not completely known, excessive oxidative stress and inflammation, as well as the activation of a complex network of several signaling pathways, appear to be involved [ , ] . the antioxidant and anti-inflammatory effects exerted by curcumin on the placenta [ ] were confirmed in a mouse model of fgr fed with a low-protein (lp) diet [ ] . the authors showed that maternal supplementation with curcumin ( mg/kg day, from . to . gd) induced a potent antioxidant response in lp-fed pregnant mice; specifically, curcumin (i) increased gsh-px activity, nfr mrna expression, and the blood sinusoids area; (ii) reduced malondialdehyde (mda) content and apoptosis in the placenta, leading to increased placental efficiency; and (iii) elevated the expression of the antioxidant genes sod , sod , and cat, and protein expression of nrf and eme oxygenase- (ho- ) in the liver. overall, curcumin supplementation during pregnancy was able to revert tissue damage and contrast the decrease in fetal weight induced by a lp diet [ ] . curcumin appeared to improve birth weight, inflammation, and oxidative damage also in fgr newborn rats. indeed, fgr rats supplemented with mg/kg curcumin (at six weeks of age for six weeks) displayed reduced levels of the inflammatory cytokines tnf-α, il- β, and il- , reduced activity of ast, alt, and mda enzymes, and increased gpx and gsh activity in serum. antioxidant defense in the liver was significantly improved as well. the attenuation of the inflammatory status induced by curcumin was associated with (i) reduced activation of nf-kb and jak ; (ii) increased expression of the antioxidant genes (nqo , hmox , gst, gpx , and sod ), and activation of their regulatory transcription factor nfr , in the liver [ ] . successively, the same authors investigated the effects of curcumin on insulin resistance (ir) and hepatic lipid accumulation in fgr newborn rats. specifically, supplementation with mg/kg curcumin (at six weeks of age for six weeks) attenuated ir by reducing serum insulin, glycemia, and homeostasis model assessment of insulin resistance (homa-ir). furthermore, in the liver, curcumin diminished total cholesterol, tg, and non-esterified fatty acids (nefa); increased glycogen concentration and induced the activation of lipolytic enzymes, together with a reduction in irs- and akt phosphorylation, a decrease in cd , srebp- , and fasn expression, and an increase in pparα levels. overall, these data showed that curcumin could improve ir and lipid accumulation in the liver by regulating insulin signaling pathways, and promoting lipolysis and fatty acid oxidation in fgr rats [ ] . of note, curcumin alleviated also jejunum damage in fgr growing pigs. indeed, the addition of mg/kg curcumin to diet improved antioxidant defense (i.e., increased sod and decreased mda activity), immune-related gene expression (reduced mrna of tnfα, il- , and ifnγ, and increased il- ), and decreased apoptotic genes, such as caspase and bax in the jejunum. moreover, curcumin supplementation increased mrna expression of the tight junction-related gene ocln [ ] . preterm birth (ptb) is a pregnancy complication that affects about % of births worldwide and is associated with increased maternal and neonate morbidity and mortality [ ] . an altered inflammatory status appears to be associated with ptb. thus the anti-inflammatory activity of curcumin has been evaluated in a mouse model of ptb, obtained through lps injection in the abdominal cavity [ ] . the injection of mg/kg curcumin into the abdominal cavity, one day before (preventative group) or one day after (treatment group) lps treatment, significantly reduced serum levels of tnf-α, il- , and mda, and increased sod levels, in both the experimental conditions, in pregnant mice. the staining intensity of nf-κb p showed that curcumin was able to reduce the lps-induced expression of this inflammatory transcription factor in placental tissue both in the preventative and in the treatment group [ ] . besides maternal nutrition, many other factors, including exposure to chemical and natural toxic agents, drugs, alcohol, smoking, and maternal stress influence fetal growth and development [ ] . among the myriad of properties, curcumin appears to be able to reduce toxicity induced by several environmental agents in different organs and tissues, including the brain and liver [ ] . bisphenol-a (bpa) is a chemical substance adapted to produce plastic. it has been considered an endocrine disruptor by the european chemicals agency (echa ) [ ] due to its estrogenic activity. bpa exposure in pregnancy is associated with negative outcomes, including impaired fetal growth and childhood adiposity [ ] . remarkably, this synthetic compound affected the processes of neurogenesis in the hippocampus of the developing rat brain, and curcumin treatment showed neuroprotective activity by reverting bpa-induced effects. specifically, pups from a pregnant rat receiving bpa ( µg/kg body weight/day from gd to pnd ) were treated with curcumin ( mg/kg body weight/day from pnd to pnd ). the authors performed accurate experiments on embryo and pup brains and examined the expression of genes and pathways involved in neurogenesis. they observed that curcumin attenuated the bpa-induced reduction in neuronal stem cells (nsc) proliferation and differentiation. at molecular levels, the improvement in neurogenesis was associated with the enhanced expression of the proneural transcription factors neurogenin and neurod , the reduced expression of the proapoptotic molecule bax, the increased expression of the antiapoptotic molecule bcl- , and the activation of wnt/βcatenin signaling that regulates nsc proliferation and differentiation. of note, the benefits of curcumin resulted in improved learning and memory in bpa-treated pups [ ] . mercury (hg) is a widely diffused toxic heavy metal that occurs naturally in three forms, namely metallic hg, organic hg, and inorganic hg. human exposure to hg occurs mainly through the environment (e.g., mercury-contaminated sea fish, dental amalgam). of note, occupation (e.g., mining) is another important source of exposure for humans and is associated with possible multi-organ toxicity [ ] . as for the influence of hg on neurodevelopment, a cross-sectional study, involving healthy saudi mothers and their infants (age - months), showed an association between hg exposure and neurodevelopmental delay, with possible negative effects persisting also in adulthood [ ] . interestingly, curcumin appeared to mitigate hg toxicity in animal models [ ] . specifically, pregnant mice were exposed (from gd to pnd) to ppm mercuric chloride (hgcl ) in the presence or absence of and ppm curcumin. hg exposure induced serious damage to the development of neuromotors, and increased anxiety behavior in pups. curcumin administration improved neurodevelopment and reduced anxiety, by restoring the levels of neurotransmitters da, -ht, and acetylcholinesterase (ache), and of the antioxidant gsh, decreased by hg exposure, in forebrain pups [ ] . moreover, by using the same experimental conditions, the authors analyzed changes in body weight, sexual behavior, and fertility in male and female pups. the obtained data showed that curcumin counteracted the perinatal effects of hg exposure by increasing (i) body weight, liver and brain weight in male and female pups; (ii) epididymis, seminal vesicle, testis weight in males; and (iii) ovary weight in females; also sexual behavior was improved in both sexes. moreover, curcumin increased testosterone and fsh levels, and sperm motility in males, as well as fsh, lh, and progesterone in females, reduced by hg exposure [ ] . lead (pb) is a heavy metal widely spread in the environment. it is extremely dangerous for both animals and humans. lead exposure occurs mainly through food and water contamination, and air pollution. lead can cross the placental and blood-brain barrier, inducing neurotoxicity. curcumin exerted neuroprotective effects contrasting lead-induced damage in rats. the concomitant exposure of rat mothers to pb ( g/l) and curcumin ( g/kg) during pregnancy and lactation resulted in the recovery of the pb-induced altered sensorimotor functions in neonatal rats. pb neurotoxicity produced alterations in locomotor neuronal network development and curcumin treatment reversed these anomalies, allowing normal locomotor behavior. these findings indicate that curcumin has the capability to prevent central nervous system dysfunction induced by lead during the earlier stages of development [ ] . celecoxib is a selective inhibitor of cox- that is able to reduce pain and inflammation caused by several inflammatory conditions [ ] . since recent data have shown that the inhibition of cox- reduced adult neural cell proliferation and differentiation [ ] , wang et al., investigated the neuroprotective action of curcumin on fetal brain development in pregnant mice treated with celecoxib [ ] . specifically, pregnant mice were pretreated with curcumin ( nmol/kg body weight) from embryonic day (e) . to e . , and then with celecoxib ( mg/kg body weight) from e . to e . . results showed that curcumin counteracted the celecoxib-induced inhibition of neurogenesis in the fetal frontal cortex, by increasing proliferation and cyclin d expression in neural progenitor cells, and by activating wnt/βcatenin signaling (i.e., decreased expression of glycogen synthase kinase beta (gsk- β), and increased expression of βcatenin) [ ] . valproic acid (vpa), a branched short-chain fatty acid, is an antiepileptic agent that has been associated with congenital malformations, including alterations in fetal brain development, and consequent intellectual disabilities and autistic spectrum disorders in the offspring [ ] . curcumin appears to attenuate the vpa-induced brain damage, as observed in a rodent model of autism. neonatal rats, born to mothers treated with vpa from . gestational day, received a single dose of curcumin ( g/kg day), and their brains were analyzed days after birth. curcumin was able to ameliorate body and brain weight, and the altered expression of il- , ifn-γ, gsh, cyp , in the brain of vpa-exposed pups [ ] . prenatal alcohol exposure (pae) has dramatic effects on fetal growth and development (fetal alcohol spectrum disorders: fasd) and is responsible for neurodevelopmental disorders (i.e., neurocognitive and behavioral deficits, and increased susceptibility to mental health disorders) and birth defects (growth deficits and physical abnormalities). pae induces chromosomal rearrangements and epigenetic alterations, therefore leading to altered gene-environment interactions that are responsible for alcohol-induced disorders [ ] . curcumin ( mg/kg body weight), administered during the peri-adolescence period (pnd - ), appeared to counteract fetal brain damage induced by prenatal and lactational alcohol exposure (plae; % (v/v) alcohol solution) in mice. the authors showed that curcumin improved anxiety and memory deficits caused by plae, and these improvements were associated with reduced microglia activation and astrogliosis. at molecular levels, curcumin reduced protein expression of il- , tnf-α, and nf-kb. these data showed that curcumin may act against cognitive deficits and neuroinflammation induced by alcohol exposure in pregnancy [ ] . curcumin can counteract the deleterious effects of pae on cardiac development, as demonstrated in a mouse model. pregnant mice were daily exposed to ethanol ( % v/v in saline) between embryonic days . to . ; at embryonic day . , mice were euthanized and embryonic hearts were removed. results showed that pae treatment increased apoptosis in pup hearts; this finding was associated with higher levels of caspase- and - mrna expression, and reduced bcl- mrna expression, due to a different modulation of histone h k acetylation near the promoter regions of caspase- , caspase- (hyperacetylation), and bcl- (hypoacetylation). in vitro, curcumin ( µm for h) treatment abolished apoptosis and reverted the expression of caspases and bcl- , induced by alcohol ( mm), in cardiac progenitor cells. these results highlighted the capability of curcumin to prevent congenital heart diseases induced by pae in pregnancy, by acting as an epigenetic modulator [ ] . embryonic development is a complex process that is finely regulated and highly susceptible to environmental influences. therefore, it is reasonable to hypothesize that the anti-inflammatory, antioxidative, antiproliferative, and antiangiogenic properties of curcumin could interfere with the blastocyst stage, implantation and post-implantation development of embryos [ ] . chen and colleagues evaluated the possible embryotoxicity of curcumin in mouse blastocysts both in vitro and in vivo. they observed that curcumin ( µm for h) induced apoptosis in mouse blastocysts, and reduced implantation rate and development, in vitro. then, embryos treated with curcumin were transferred in vivo; results confirmed a significant reduction in implantation ratio, and, among the implanted embryos, a higher rate of failure to develop normally. the authors evaluated the possible mechanisms responsible for these effects and found that curcumin-induced apoptosis was associated with the modulation of pro-and anti-apoptotic molecules (i.e., increased bax and reduced bcl- expression), ros generation, and caspase- activation [ ] . additionally, the same authors showed that curcumin ( µm) adversely affected oocytes maturation, in vitro. this effect resulted in a reduced ability of oocytes to be fertilized, increased blastocyst apoptosis, and reduced blastocyst implantation ratio and development. these results were confirmed in oocytes collected from female mice after feeding them with curcumin supplementation ( µm) for four days [ ] . another in vitro study highlighted that the degree of damage induced by curcumin ( , , or µm curcumin for h) on mouse blastocyst at the implantation stage and during the early post-implantation stage is dose-dependent. specifically, µm and µm curcumin inhibited cell proliferation of the blastocyst but increased the formation of trophoblastic giant cells, whereas µm curcumin exposure was lethal to all blastocysts, and induced severe damage to the implanted blastocysts [ ] . further evidence on these effects comes from a recent study in zebrafish. the exposure of zebrafish embryos and larvae to different concentrations of curcuma longa extract ( . , . , . , . , . , and . µg/ml) at different hours post fertilization (hpf: , , , , h) showed that a dosage above . µg/ml had toxic effects, and a dosage of . µg/ml increased embryo mortality and induced morphological deformities in larvae [ ] . despite the potential benefits of curcumin described in different pathological conditions, all these data indicate that dosage and time of exposure throughout pregnancy should be carefully evaluated to avoid serious damage to embryo development. the use of the natural product curcumin to treat medical conditions is spreading around the world. there is an increasing public interest in the potential health benefits of this compound, as evidenced by the large number of currently available curcumin formulations, aimed at increasing its bioavailability and efficacy, and by the considerable number of scientific papers published over the last years. this review has drawn attention towards the effects of curcumin on pregnancy and pregnancy complications, considering that during gestation, mother and fetus undergo significant (patho-) physiological changes. almost all data emphasizing the numerous biological activities of curcumin have been obtained from pregnant rodents and in vitro studies. curcumin appeared to ameliorate diabetes in a gdm mouse model, as well as pe in a pe rat model, and was found to be neuroprotective against environmental toxic agents. the antidepressant activity of curcumin has also been tested in humans. however, to date, studies on the possible beneficial effects of curcumin on ppd, a largely underestimated and understudied condition, are completely lacking. as regards fetal growth and development, curcumin counteracted the modifications associated with fgr and ptb in rodent models but negatively affected blastocyst stage, implantation and post-implantation embryo development in healthy animals. altogether, these results indicate that the use of curcumin in pregnancy must be carefully evaluated. the growing use of curcumin as self-medication along with the misleading perception that "natural" is the equivalent of "safe" are additional issues of concern. further studies are needed to clarify whether pregnancy might benefit from curcumin's properties; for this purpose, the collaboration between multidisciplinary scientific teams is essential to provide a holistic view of the complex networks between natural products and human physiology. systems biology and the recently developed network pharmacology represent new strategies to better comprehend the mechanisms underlying curcumin activities in the human body. maternal nutrition and birth outcomes dietary interventions for healthy pregnant women: a systematic review of tools to promote a healthy antenatal dietary intake tain the good, the bad, and the ugly of pregnancy nutrients and developmental programming of adult disease management of reproduction and pregnancy complications in maternal obesity: which role for dietary polyphenols? could gestational diabetes mellitus be managed through dietary bioactive compounds? current knowledge and future perspectives maternal obesity, inflammation, and developmental programming non-coding rna: role in gestational diabetes pathophysiology and complications epigenetics and human reproduction: the primary prevention of the noncommunicable diseases genes and diet in the prevention of chronic diseases in future generations herbs and spices-biomarkers of intake based on human intervention studies-a systematic review curcumin: a review of its effects on human health antidotal or protective effects of curcuma longa (turmeric) and its active ingredient, curcumin, against natural and chemical toxicities: a review cellular and molecular mechanisms of curcumin in prevention and treatment of disease curcumin ameliorates gestational diabetes in mice partly through activating ampk curcumin stimulates angiogenesis through vegf and expression of hla-g in first-trimester human placental trophoblasts maternal curcumin supplementation ameliorates placental function and fetal growth in mice with intrauterine growth retardation curcumin's nanomedicine formulations for therapeutic application in neurological diseases rationale for natural neurosteroid-based interventions for postpartum depression phytochemical evaluation, embryotoxicity, and teratogenic effects of curcuma longa extract on zebrafish (danio rerio). evid.-based complementary altern curcumin as "curecumin": from kitchen to clinic high-performance thin layer chromatographic method for quantitative determination of curcuminoids in curcuma longa germplasm curcumin: a modulator of inflammatory signaling pathways in the immune system pharmacokinetics, pharmacodynamics, and pkpd modeling of curcumin in regulating antioxidant and epigenetic gene expression in healthy human volunteers curcumin as an alternative epigenetic modulator: mechanism of action and potential effects mutual two-way interactions of curcumin and gut microbiota potential effects of curcumin in the treatment of covid- infection food & drug administration. gras notice inventory scientific opinion on the re-evaluation of curcumin (e ) as a food additive formulations of curcumin nanoparticles for brain diseases phytosomal curcumin: a review of pharmacokinetic, experimental and clinical studies highly bioavailable forms of curcumin and promising avenues for curcumin-based research and application: a review curcumin delivery mediated by bio-based nanoparticles: a review determinants of maternal insulin resistance during pregnancy: an updated overview gestational diabetes mellitus: the impact of carbohydrate quality in diet cross-talk between fetal membranes and visceral adipose tissue involves hmgb -rage and vip-vpac pathways in human gestational diabetes mellitus the risk stratification of adverse neonatal outcomes in women with gestational diabetes (strong) study impact of risk factors for gestational diabetes (gdm) on pregnancy outcomes in women with gdm curcumin and type diabetes mellitus: prevention and treatment antidiabetic properties of curcumin ii: evidence from in vivo studies the effects of curcumin supplementation on high-sensitivity c-reactive protein, serum adiponectin, and lipid profile in patients with type diabetes: a randomized, double-blind, placebo-controlled trial effects of curcuminoids plus piperine on glycemic, hepatic and inflammatory biomarkers in patients with type diabetes mellitus: a randomized double-blind placebo-controlled trial effect of turmeric on glycemic status, lipid profile, hs-crp, and total antioxidant capacity in hyperlipidemic type diabetes mellitus patients the effects of curcumin supplementation on glycemic status, lipid profile and hs-crp levels in overweight/obese women with polycystic ovary syndrome: a randomized, double-blind, placebo-controlled clinical trial the effects of curcumin on weight loss among patients with metabolic syndrome and related disorders: a systematic review and meta-analysis of randomized controlled trials curcumin combined with metformin decreases glycemia and dyslipidemia, and increases paraoxonase activity in diabetic rats epigenetics and gestational diabetes: consequences in mother and child curcumin ameliorates high glucose-induced neural tube defects by suppressing cellular stress and apoptosis curcumin improves lps-induced preeclampsia-like phenotype in rat by inhibiting the tlr signaling pathway curcumin inhibits placental inflammation to ameliorate lps-induced adverse pregnancy outcomes in mice via upregulation of phosphorylated akt curcumin protects human trophoblast htr /svneo cells from h o -induced oxidative stress by activating nrf signaling pathway dietary phytophenols curcumin, naringenin and apigenin reduce infection-induced inflammatory and contractile pathways in human placenta curcumin's effect on cox- and il- serum in preeclampsia's patient undergo sectio caesarea with spinal anesthesia. open access maced dietary curcumin supplementation attenuates inflammation, hepatic injury and oxidative damage in a rat model of intra-uterine growth retardation curcumin attenuates insulin resistance and hepatic lipid accumulation in a rat model of intra-uterine growth restriction through insulin signalling pathway and sterol regulatory element binding proteins effect of curcumin on expressions of nf-κbp , tnf-α and il- in placental tissue of premature birth of infected mice. asian pac correction to: bisphenol-a mediated inhibition of hippocampal neurogenesis attenuated by curcumin via canonical wnt pathway neurobehavioral protective properties of curcumin against the mercury chloride treated mice offspring curcumin palliative effects on sexual behavior, fertility and reproductive hormones disorders in mercuric chloride intoxicated mice offspring disturbed sensorimotor and electrophysiological patterns in lead intoxicated rats during development are restored by curcumin i celecoxib-induced inhibition of neurogenesis in fetal frontal cortex is attenuated by curcumin via wnt/β-catenin pathway postnatal treatment using curcumin supplements to amend the damage in vpa-induced rodent models of autism curcumin treatment attenuates alcohol-induced alterations in a mouse model of inhibition of histone acetylation by curcumin reduces alcohol-induced fetal cardiac apoptosis hazardous effects of curcumin on mouse embryonic development through a mitochondria-dependent apoptotic signaling pathway injurious effects of curcumin on maturation of mouse oocytes, fertilization and fetal development via apoptosis effect of curcumin on in vitro early post-implantation stages of mouse embryo development pregnancy and cardiovascular disease a systemic review on the antioxidant and anti-inflammatory effects of resveratrol, curcumin, and dietary nitric oxide supplementation on human cardiovascular health analysis of causes of maternal death: a systematic review disruption of placental homeostasis leads to preeclampsia the hmgb /rage pro-inflammatory axis in the human placenta: modulating effect of low molecular weight heparin preeclampsia: a review of the pathogenesis and possible management strategies based on its pathophysiological derangements extravillous trophoblast invasion in placenta accreta is associated with differential local expression of angiogenic and growth factors: a cross-sectional study effects of curcumin on vessel formation insight into the pro-and antiangiogenesis of curcumin. evid.-based complementary altern curcumin, the golden nutraceutical: multitargeting for multiple chronic diseases pathophysiological mechanisms implicated in postpartum depression antenatal depression and its association with adverse birth outcomes in low and middle-income countries: a systematic review and meta-analysis maternal depression and inflammation during pregnancy fruit and vegetable intake and mental health in adults: a systematic review multiple antidepressant potential modes of action of curcumin: a review of its anti-inflammatory, monoaminergic, antioxidant, immune-modulating and neuroprotective effects linking what we eat to our mood: a review of diet, dietary antioxidants, and depression curcumin for depression: a meta-analysis the role of curcumin administration in patients with major depressive disorder: mini meta-analysis of clinical trials benefits of curcumin in brain disorders curcumin for the treatment of major depression: a randomised, double-blind, placebo controlled study curcumin and major depression: a randomised, double-blind, placebo-controlled trial investigating the potential of peripheral biomarkers to predict treatment response and antidepressant mechanisms of change efficacy and safety of curcumin in major depressive disorder: a randomized controlled trial curcumin reverses the effects of chronic stress on behavior, the hpa axis, bdnf expression and phosphorylation of creb the influence of antidepressants on the immune system curcumin in antidepressant treatments: an overview of potential mechanisms, pre-clinical/ clinical trials and ongoing challenges developmental origins of adult health and disease fetal growth restriction-diagnostic work-up, management and delivery coordinated and highly regulated changes in placental signaling and nutrient transport capacity in iugr curcumin alleviates iugr jejunum damage by increasing antioxidant capacity through nrf /keap pathway in growing pigs global burden of preterm birth developmental programming of fetal growth and development msc unanimously agrees that bisphenol a is an endocrine disruptor bisphenol a and phthalates in diet: an emerging link with pregnancy complications medicinal plants and natural products can play a significant role in mitigation of mercury toxicity mercury (hg) exposure and its effects on saudi breastfed infant's neurodevelopment comparison of pharmacological and genetic inhibition of cyclooxygenase- : effects on adult neurogenesis in the hippocampal dentate gyrus adverse effects of prenatal and early postnatal exposure to antiepileptic drugs: validation from clinical and basic researches fetal alcohol spectrum disorders: genetic and epigenetic mechanisms author contributions: conceptualization, c.s. and s.m.; pubmed search, t.f. and r.v.; writing-draft preparation, t.f. and c.s.; writing-review and editing, s.m., e.f. and a.z.; supervision and critical revision s.m., r.v. and c.s. all authors have read and agreed to the published version of the manuscript.funding: this review received no external funding. the authors declare no conflict of interest. key: cord- - ckuya w authors: ninfali, paolino; antonelli, antonella; magnani, mauro; scarpa, emanuele salvatore title: antiviral properties of flavonoids and delivery strategies date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: ckuya w this review summarizes the latest advancements in phytochemicals as functional antiviral agents. we focused on flavonoids, like apigenin, vitexin, quercetin, rutin and naringenin, which have shown a wide range of biological effects including antiviral activities. the molecular mechanisms of their antiviral effects mainly consist in the inhibition of viral neuraminidase, proteases and dna/rna polymerases, as well as in the modification of various viral proteins. mixtures of different flavonoids or combination of flavonoids with antiviral synthetic drugs provide an enhancement of their antiviral effects. recent strategies in drug delivery significantly contribute to overcoming the low bioavailability of flavonoids. frequent viral infections worldwide have led to the need for new effective antiviral agents, which can be identified among the various phytochemicals. in this light, screening the antiviral activities of a cocktail of flavonoids would be advantageous in order to prevent viral infections and improve current antiviral therapies. in the past two decades, studies conducted in our laboratory focused on the antioxidants present in vegetable foods and on their capacity to reduce the adverse physiological effects of the oxygen free radicals [ , ] . the research was also aimed at the technologies of food transformation in order to preserve, as much as possible, the antioxidants in the final products [ ] . antioxidants are mainly represented in nature by the liposoluble vitamins e and a, β-carotene, hydro-soluble vitamin c and a wide range of amphipathic molecules, broadly termed phenolic compounds [ ] . these compounds are divided into several sub-classes, including phenolic acids and analogues, stilbenes, flavonoids and their analogues. flavonoids possess important health protective effects, including anti-inflammatory, anticancer and antiviral properties [ ] [ ] [ ] [ ] [ ] [ ] [ ] . there are in nature more than flavonoids, which have been structurally identified and divided in classes: flavones (e.g., apigenin), flavanols (e.g., quercetin), flavins (e.g., epigallocatechin- -gallate), isoflavones (e.g., genistein) and anthocyanidins (e.g., cyanidin). flavonoids occur in their free or conjugated form or are often esterified with one or two sugars with o-glycosidic or c-glycosidic bonds [ ] . in the past decade we purified and studied the biological effects of a group of the flavonoid c-glycosides derived from apigenin, namely vitexin, vitexin- -o-rhamnoside and vitexin- -o-xyloside ( figure ). the interest in the antiviral activity of natural flavonoids has increased in the last decade because of the frequency of viral infections, particularly influenza infections, which affect several million patients annually [ ] . while vaccination is the primary strategy for influenza prevention, there are scenarios for which vaccination is not possible and antiviral molecules represent an important sanitary presidium. synthetic antiviral drugs often show limited efficacy and serious adverse effects [ ] , whereas herbal extracts, known for their antiviral properties with no or mild side effects, may be a viable alternative for treating various viral diseases [ ] . viruses consist of nucleic acid (dna or rna) enclosed in a protein structure, called capsid, which can be surrounded by a lipid membrane named the envelope. the infective unit of the virus is called the virion and this parasite can replicate only inside host cells, hijacking the molecular machinery and controlling dna replication, rna transcription and the protein translation processes. viruses attack the host cells through adsorption to receptors specific for each type of target cells, penetrating through the cell membrane, then the genetic material of the virus is liberated to replicate its own genome, produce new viral proteins and obtain new virions [ ] . in , the antiviral effects of various phytochemicals were reviewed by kapoor et al. [ ] , taking into consideration many categories of compounds, ranging from flavonoids to saponins and lignans. in the same year, another group published a review focused specifically on the antiviral effects of the six classes of flavonoids [ ] . in , an interesting review regarding the methods for delivery of phytochemicals to increase their bioavailability in human tissues has been published [ ] . in this review, we first summarize flavonoids along with their class and plant sources, with particular attention to apigenin, vitexin and its derivatives (table ) . we then discuss the antiviral action mechanisms of flavonoids, their combinations with conventional antiviral drugs in multitarget cocktails, and the delivery strategies used to increase their bioavailability and antiviral efficacy. the interest in the antiviral activity of natural flavonoids has increased in the last decade because of the frequency of viral infections, particularly influenza infections, which affect several million patients annually [ ] . while vaccination is the primary strategy for influenza prevention, there are scenarios for which vaccination is not possible and antiviral molecules represent an important sanitary presidium. synthetic antiviral drugs often show limited efficacy and serious adverse effects [ ] , whereas herbal extracts, known for their antiviral properties with no or mild side effects, may be a viable alternative for treating various viral diseases [ ] . viruses consist of nucleic acid (dna or rna) enclosed in a protein structure, called capsid, which can be surrounded by a lipid membrane named the envelope. the infective unit of the virus is called the virion and this parasite can replicate only inside host cells, hijacking the molecular machinery and controlling dna replication, rna transcription and the protein translation processes. viruses attack the host cells through adsorption to receptors specific for each type of target cells, penetrating through the cell membrane, then the genetic material of the virus is liberated to replicate its own genome, produce new viral proteins and obtain new virions [ ] . in , the antiviral effects of various phytochemicals were reviewed by kapoor et al. [ ] , taking into consideration many categories of compounds, ranging from flavonoids to saponins and lignans. in the same year, another group published a review focused specifically on the antiviral effects of the six classes of flavonoids [ ] . in , an interesting review regarding the methods for delivery of phytochemicals to increase their bioavailability in human tissues has been published [ ] . in this review, we first summarize flavonoids along with their class and plant sources, with particular attention to apigenin, vitexin and its derivatives (table ) . we then discuss the antiviral action mechanisms of flavonoids, their combinations with conventional antiviral drugs in multi-target cocktails, and the delivery strategies used to increase their bioavailability and antiviral efficacy. the most common flow chart for studies regarding the antiviral activity of phytochemicals is focused on the immediate testing of the whole natural extract, by dividing the polar from the non-polar constituents. after that, fractions with remarkable activity in in vitro antiviral assays, such as cytophatic effect, neutralization assay, hemagglutination, viral enzyme inhibition, or virion number reduction assay, are further fractionated through chromatographic techniques in order to purify the active phytochemicals. effective compounds are then used on virus-infected animals or in human clinical trials in order to assess their effective antiviral properties [ ] . the complete procedure, when interfaced with chemical libraries, represents the basis for high throughput screening assays [ ] . the parameter used for assessing antiviral efficiency of drugs and phytochemicals is represented by % inhibitory concentrations (ic ) or by % effective concentration (ec ). table shows the main flavonoids studied for antiviral activity along with their investigated mechanisms of action. in the first section, we point out the studies focused on apigenin, vitexin and their derivatives, which were found active against many viruses like human hepatitis c virus (hcv), herpes simplex virus- (hsv- ), human hepatitis a and b viruses (hav; hbv), rhesus rotavirus (rrv) and influenza virus. the natural extract of eclipta alba (asteraceae) was shown to be able to inhibit the hcv replicase in a cell culture system, which resulted in reduced hcv rna titer and translation level of viral proteins [ ] . through bioassay-based fractionations of the natural extract, the authors identified two flavonoid compounds: apigenin and luteolin, which, tested individually, exhibited a dose-dependent inhibition of hcv replicase in vitro [ ] . quercetin, extracted from embelia ribes (mirsinaceae), exhibited antiviral effects against hcv, exerted through activity inhibition of the viral protease non-structural protein (ns ), leading to a decrease in hcv replication [ ] . furthermore, the flavanol quercetagetin was found to inhibit hcv rna-dependent rna polymerase (rdrp) through inhibition of rna binding to the viral polymerase, a mechanism associated with broad genotypic activity against several hcv strains and a high barrier to resistance mechanisms [ ] . luteolin and quercetin showed anti-hcv effects in hepatoma huh- cells transfected with non-structural protein b (ns b) cloned gene vector, that codifies for the ns b polymerase of hcv virus [ ] . naringenin and quercetin possess antiviral activity against hcv, but naringenin showed stronger inhibition of virion assembly, whereas quercetin inhibited viral translation by blocking non-structural protein a (ns a) and internal ribosome entry site (ires)-mediated translation, as well as heat shock protein (hsp ) induction [ ] . bioinformatics tools were also used to study the interaction of various phytochemicals with viral proteins that possess pivotal roles in the production of new virions and in the infection of the host cells. this approach may be a useful premise for deeper investigation regarding flavonoids which have provided interesting evidence of interactions with viral proteins. for instance, naringenin, diosmetin, apigenin and luteolin were all able to bind to the ns b protein of hcv with higher affinity when compared with the antiviral drug sofosbuvir, inhibiting the activity of this viral enzyme [ ] . epigallocatechin- -gallate (egcg), the principal tea derived catechin, efficiently inhibited cell culture-derived hbv entry into hepatocellular cell lines, independent of the hbv genotypes, through a mechanism that involves the clathrin-dependent endocytosis of the hbv receptor sodium taurocholate co-transporting polypeptide (ntcp) from the plasma membrane, followed by its protein degradation [ ] . the extract obtained from erythrina speciosa (fabaceae) exerted antiviral effects against hav-h viruses mainly due to vitexin which, isolated from the extract, exhibited an antiviral activity against this virus with ec = . ± . µm [ ] . the authors showed that the flavone vitexin can interact with the binding pocket of hav c proteinase, inhibiting this enzyme [ ] . hcv virions inhibition of virion assembly vitexin, extracted from the plant flos trollii, (caryophyllaceae), exerted its anti-h n influenza virus effects through partially down-regulating toll-like receptor (tlr ) and toll-like receptor (tlr ) pathways and up-regulating toll-like receptor (tlr ) molecular pathway [ ] . tlrs are transmembrane glycoproteins, which are privileged targets of several viruses and can be activated by endogenous molecules in the context of inflammation. tlr activation produces pro-inflammatory cytokines through nuclear factor kappa-light-chain-enhancer of activated b cells (nf-kb) signaling pathway or through interferon regulatory factor (irf ) and interferon regulatory factor (irf ). some viruses enter the host cells by binding tlr , but after their entrance the viruses are able to inhibit cytokine production, thus impairing the immune response. phytochemicals able to decrease the binding between tlrs and virus particles can slow the infective process. interestingly, virus infection can lead to an induction of the inflammation process, characterized by excessive production of nitric oxide (no), interleukin- (il- ), interleukin- (il- ) and tumor necrosis factor-α (tnf-α). it was shown that various flavonoids enhance the production of interferon-β (ifn-β) in order to counteract the viral infections [ ] . baicalin, baicalein, wogonin, chrysin and oroxylin a, isolated from scutellaria baicalensis, showed anti-h n activities, with ic values of . , . , . , . and . µm, respectively, and were all more potent than the conventional antiviral drug oseltamivir phosphate, which had an ic of . µm [ ] . these flavonoids increased the transcriptional activity of nuclear factor erythroid -related factor (nrf ), the master regulator of the antioxidant responses, whose activation is related to the antiviral effects of scutellaria baicalensis [ ] . the natural extract of tetrastigma hemsleyanum (vitaceae) contains many flavonoids, including vitexin, vitexin- -o-rhamnoside, isorhamnetin, rutin, kaempferol, astragalin, quercitrin, quercetin and iso-quercetin, which were shown to be able to exert anti-influenza virus activity, with different efficiency, through the reduction of the number of plaques induced by the influenza virus in infected madin-darby canine kidney (mdck) cells [ ] . similarly, the flavonoid quercetin- -rhamnoside, extracted from houttuynia cordata (saururaceae), exerted anti-influenza a/ws/ activity reducing virus-mediated cytopathic effects, directly interacting with virus particles [ ] . furthermore, the same authors showed that quercetin- -rhamnoside exerted anti-influenza virus activity in mice, when used at . mg/kg/day for six days after influenza virus infection [ ] . flavonoids sanggenon o, egcg and chamaejasmin were all potentially able to inhibit dengue virus replication by blocking the asn- glycosylation site of the viral protein non structural protein (ns ) [ ] . baicalin, a flavonoid derived from scutellaria baicalensis (lamiaceae), exhibited viricidal activity against dengue virus- (denv- ) extracellular virions with ic = . ± . µm, exerted an anti-adsorption effect with ic = . ± . µm and also inhibited virus replication with ic = . ± . µm [ ] . studies of the antiviral effects of the flavonoids fisetin, quercetagetin, and pinocembrin showed that fisetin can inhibit the replication molecular machineries of dengue virus and enterovirus a [ ] . furthermore, other antiviral mechanisms of the pinocembrin consist in targeting the molecular machinery used by the zika virus to replicate its own genome inside the host cells [ ] . this flavanone acts on the post-entry processes of zika virus replication cycle through the inhibition of both viral rna production and synthesis of envelope proteins [ ] . interestingly, the plant moringa oleifera lam (moringaceae) provides a rich and rare combination of several phytochemicals, including the flavonoids quercetin and kaempferol, and its leaves extract can be applied as a prophylactic or therapeutic anti-hsv- medicine [ ] . the extract obtained from moringa oleifera lam remarkably reduced the plaque formation induced by wt hsv, thymidine kinase-deficient hsv and phosphonoacetate-resistant hsv strains [ ] . furthermore, the extract obtained from erythrina speciosa possessed antiviral properties against the hsv- virus, mainly due to vitexin which exhibited an antiviral activity with ec = . ± . µm, exerted through the interaction of this flavone with the binding pocket of hsv- thymidine kinase [ ] . vitexin and luteolin from aspalathus linearis (fabaceae) showed antiviral activity against rrv with ic of µm and µm , respectively; interestingly, apigenin- -o-glucoside from melissa officinalis (labiateae) inhibited viral growth, with an ic of µm, through the reduction of the number of rrv-induced plaques in infected ma cells [ ] . tangeretin and nobiletin, two polymethoxyflavones extracted from citrus reticulate "chachi", possess anti-rsv properties. tangeretin exhibited a dose-dependent inhibition of rsv-induced plaque formation on hep- cells, through inhibition of rsv entry into host cells and viral replication. furthermore, tangeretin decreased the levels of rsv phosphoprotein (p protein), which is associated with the viral genome to form the holo-nucleocapsid. the extent of the antiviral effect of this phytochemical was comparable to the conventional antiviral drug ribavirin [ ] . the knowledge of the molecular mechanisms of virus infection and phytochemical antiviral actions is fundamental in planning an effective therapeutic approach. the main mechanisms involved in the antiviral effects of phytochemicals are focused on the targeting of viral enzyme activities. many natural molecules target the catalytic activity of the influenza virus neuraminidase, also called sialidase. this enzyme is a glycoside hydrolase that cleaves the glycosidic linkages of sialic acids ( figure ). various phytochemicals inhibit the activity of viral sialidases, hampering the release of new virions from the infected cells and preventing new infections [ ] . another enzyme with a pivotal role in influenza a virus infection is rdrp, which is composed of three subunits: polymerase acidic subunit (pa), protein binding subunit (pb ) and protein binding subunit (pb ). the enzyme synthesizes viral mrnas using short capped primers derived from host cellular mrnas, which are cut by the viral endonuclease. the n-terminal domain of the pa subunit contains a typical endonuclease active site and harbors the rna/dna endonuclease activity, which is essential for viral growth [ ] . the knowledge of the molecular mechanisms of virus infection and phytochemical antiviral actions is fundamental in planning an effective therapeutic approach. the main mechanisms involved in the antiviral effects of phytochemicals are focused on the targeting of viral enzyme activities. many natural molecules target the catalytic activity of the influenza virus neuraminidase, also called sialidase. this enzyme is a glycoside hydrolase that cleaves the glycosidic linkages of sialic acids (figure ). various phytochemicals inhibit the activity of viral sialidases, hampering the release of new virions from the infected cells and preventing new infections [ ] . another enzyme with a pivotal role in influenza a virus infection is rdrp, which is composed of three subunits: polymerase acidic subunit (pa), protein binding subunit (pb ) and protein binding subunit (pb ). the enzyme synthesizes viral mrnas using short capped primers derived from host cellular mrnas, which are cut by the viral endonuclease. the n-terminal domain of the pa subunit contains a typical endonuclease active site and harbors the rna/dna endonuclease activity, which is essential for viral growth [ ] . enzymes involved in the hcv virus replication, like the protease ns and the polymerase ns b can also be efficiently inhibited or modulated by phytochemicals ( figure ). ns is a hcv nonstructural protein, which acts as a serine protease. its n-terminal domain can interact with the viral non structural protein (ns ), while the c-terminal domain acts both as helicase and nucleoside triphosphatase. enzymes involved in the hcv virus replication, like the protease ns and the polymerase ns b can also be efficiently inhibited or modulated by phytochemicals ( figure ). ns is a hcv nonstructural protein, which acts as a serine protease. its n-terminal domain can interact with the viral non structural protein (ns ), while the c-terminal domain acts both as helicase and nucleoside triphosphatase. the ns b protein is rdrp with a pivotal role in replicating hcv's viral rna by using the viral ssrna+ as a template to catalyze the polymerization of ribo-nucleoside triphosphates during replication of the viral genome. interestingly, quercetin, apigenin and luteolin effectively inhibit ns b polymerase activity [ ] . when phytochemicals have been combined among them or with synthetic antiviral drugs, synergistic therapeutic effects were often evidenced. overall, when synergy occurred, it was often justified by the fact that the different molecules target different steps in the the ns b protein is rdrp with a pivotal role in replicating hcv's viral rna by using the viral ssrna+ as a template to catalyze the polymerization of ribo-nucleoside triphosphates during replication of the viral genome. interestingly, quercetin, apigenin and luteolin effectively inhibit ns b polymerase activity [ ] . when phytochemicals have been combined among them or with synthetic antiviral drugs, synergistic therapeutic effects were often evidenced. overall, when synergy occurred, it was often justified by the fact that the different molecules target different steps in the molecular mechanisms of viral infection, and the final antiviral effect results therefore potentiated. naringenin is a flavanone, which exhibits anti-hcv activity by blocking the assembly of hcv particles [ ] . the phytochemical quercetin exerted anti-hcv activity by reducing internal ribosome entry site-(ires-)mediated translation and also inhibiting the viral non-structural protein ns a as well as the protease ns [ ] . when naringenin and quercetin were used together they suppressed hcv rna replication and inhibited viral replication to a higher extent when compared with the phytochemicals used individually, thus demonstrating a synergistic effect [ ] . ladanein, a flavone isolated from marrubium peregrinum l. (lamiaceae), exploited antiviral effects through the inhibition of the post-attachment entry step of hcv virions, with an ic of . µm. ladanein, in combination with cyclosporine, showed a remarkable synergistic antiviral effect against various hcv genotypes [ ] . the natural extracts from nymphaea alba l. (nymphaeaceae), containing iso-quercetin, hyperoside, quercetin, reynoutrin, apigenin and isokaempferide, showed anti-hcv activity, suppressing hcv ns gene expression in the transfected huh- cell line and inhibiting the viral genotype a replication. furthermore, the combination of nymphaea alba l. extract with the conventional drug boceprevir displayed synergistic effects for inhibition of hcv replication in a docking bioinformatics model [ ] . an antiviral role of phytochemicals was also linked to the receptors recognized by viruses for their endocytosis, such as the membrane receptor ntcp. this protein has a mass of kda and is involved in the transport of bile salt molecules, steroid hormones, thyroid hormones and xenobiotics. ntcp is required for the entry in hepatocytes of both hbv and human hepatitis d virus (hdv). in fact, the virus-receptor interaction leads to the clathrin-dependent endocytosis of hbv virions, which can replicate inside the host cells [ ] . egcg, used at the dose of µm, induced clathrin-dependent endocytosis of ntcp from the plasma membrane, leading to its degradation and inhibiting the entry of hbv virus into immortalized human primary hepatocytes (figure ). two hiv enzymes address pivotal roles in virus replication and virion production: hiv reverse transcriptase and the homodimer of hiv protease (figure ). hiv reverse transcriptase is an rna-dependent dna polymerase (rddp) and builds ssdna based on an rna template in its polymerase active site; the enzyme also cleaves the original rna template into pieces through its nuclease active site and finally it polymerizes a second dna strand to form the final dsdna, which is integrated in the host cell genome. interestingly, it was shown that egcg suppressed hiv- infection in hela-cd -ltr-β-gal cells, with a ec of . µm, by acting as a non-nucleoside hiv reverse transcriptase inhibitor [ ] . furthermore, it was demonstrated that the flavonoids myricetin- -rhamnoside and myricetin- -( -rhamnosylgalactoside) possessed antiviral activity in vitro against hiv with ec of µm and µm, respectively [ ] . this antiviral effect was exerted through the inhibition of hiv reverse transcriptase with ic of . µm for myricetin- -rhamnoside and of . µm for myricetin- -( -rhamnosylgalactoside) [ ] . hiv protease is a retroviral aspartyl protease, which cleaves newly synthesized viral polyproteins (namely gag-pol) at nine cleavage sites to create the mature protein components of the virion. mature hiv- protease exists as a kda homodimer, each one containing an asp amino acid, which acts as the catalytic residues are able to hydrolyze peptide bonds on the gag-pol polyproteins into fully functional viral proteins, like reverse transcriptase and integrase. kehinde et al. ( ) [ ] showed that the phytochemicals kaempferol- -o-glucoside and egcg were able to interact with hiv- protease, showing pronounced structural evidence as potential hiv- protease inhibitors ( figure ) . interestingly, phytochemicals can also be used to reduce the extrusion of antiviral drugs from infected cells. in fact, apigenin, fisetin and luteolin were able to slow down the elimination of the antiviral drugs atazanavir, lopinavir, darunavir and saquinavir, which target the viral protease of hiv- [ ] . dependent dna polymerase (rddp) and builds ssdna based on an rna template in its polymerase active site; the enzyme also cleaves the original rna template into pieces through its nuclease active site and finally it polymerizes a second dna strand to form the final dsdna, which is integrated in the host cell genome. interestingly, it was shown that egcg suppressed hiv- infection in hela-cd -ltr-β-gal cells, with a ec of . µm, by acting as a non-nucleoside hiv reverse transcriptase inhibitor [ ] . furthermore, it was demonstrated that the flavonoids myricetin- -rhamnoside and myricetin- -( -rhamnosylgalactoside) possessed antiviral activity in vitro against hiv with ec of µm and µm, respectively [ ] . this antiviral effect was exerted through the inhibition of hiv reverse transcriptase with ic of . µm for myricetin- -rhamnoside and of . µm for myricetin- -( -rhamnosylgalactoside) [ ] . hiv protease is a retroviral aspartyl protease, which cleaves newly synthesized viral polyproteins (namely gag-pol) at nine cleavage sites to create the mature protein components of the antiviral activity of flavonoids may be also due to the modulation of host cell enzymes used by the virus to take advantage for infection, such as the enzymes with a pivotal role in the production of radical oxygen species (ros), utilized to increase the number of virions. regarding hsv- , which persists in the host in sensory neurons in latency, the enzyme nicotinamide adenine dinucleotide phosphate (nadph) oxidase (nox) family is a useful source of ros, which can be used to reactivate the viral infection under oxidative stress conditions [ , ] . interestingly, delphinidin- -rutinoside obtained from extracts of solanum melongena l. (solanaceae), inhibited hsv- replication through the reduction of nox protein levels, when added for h after viral adsorption on vero cells [ ] . the extract obtained from veronica persica poir (plantaginaceae) possessed a dose-dependent inhibitory activity against the herpes simplex virus strains hsv- and hsv- and a prominent synergistic activity in combination with acyclovir in anti-hsv therapy, exerted through a reduction of the percentage of plaque numbers of both hsv- and hsv- in the infected cero cells [ ] . the natural extract of disticella elongata (bignoniaceae) exhibited antiviral effects against denv- virus and this effect was mainly due to pectolinarin and acacetin- -o-rutinoside [ ] . when the two flavonoids pectolinarin and acacetin- -o-rutinoside were used in combination, the antiviral effect was eight times more potent against denv- virus (with ec = . ± . µm) than the flavonoid pectolinarin used alone (with ec = . ± . µm). the selectivity index of the combination (si = ) was remarkably higher than the si of the isolated pectolinarin (si = . ), indicating that the phytochemical mixture specifically inhibited viral growth, with negligible effects on the vitality of the cells infected by denv- virus. the ethanol extract obtained from the leaves of disticella elongata showed antioxidant activities; therefore, it could detoxify cell damaging free radicals present in denv- viral infections [ ] . the low water solubility and low bioavailability of natural flavonoids represent the major limit for their use in the nutraceutical sector. many delivery strategies have been used by researchers for increasing flavonoid bioavailability following oral consumption [ ] , including: micelles, nanoparticles, microspheres, crystals, dendrimers, the self-micro-emulsifying drug delivery system (smdds) and the self-nanoemulsifying drug delivery systems (snedds), as recently reviewed [ , ] . for instance, it was shown that the catechin and egcg-loaded chitosan nanoparticles led to a higher rate of intestinal absorption of the two phytochemicals [ ] . interestingly, in chitosan particles the flavonoids maintain their antioxidant activity and can exploit their antioxidant effects in the blood stream [ ] . the loading of myricetin into a cationic polymeric nanoparticle carrier with a cationic corona and hydrophobic core was investigated in order to improve the clinical relevance of this natural flavonoid by increasing its solubility [ ] . smdds has been used to overcome the problem of low bioavailability of hydrophobic molecules as, in the intestinal lumen, the oil-in-water microemulsions containing phytochemicals may be efficiently formed with a consequent increase of the intestinal absorption of the flavonoid [ ] . interestingly, puerarin, an isoflavone isolated from the root of pueraria lobata, exhibited . fold higher bioavailability when prepared using the smdds technique [ ] . furthermore, the synthesis of silver nanoparticles linked with phytochemicals and their use for antimicrobial and antiviral treatments have been described, highlighting the various molecular mechanisms that lead to the phytochemical-mediated inhibition of viral replication [ ] . poly (d,l-lactide) (pla) nanoparticles and polymeric micelles contributed to a more sustainable and efficient release of flavonoids characterized by a poor bioavailability, like quercetin and apigenin [ , ] . quercetin was successfully encapsulated on the most uniformly distributed type of pla- nanoparticle, synthesized using lonicera japonica leaf extract, showing that these nanoparticles allowed a slow release of quercetin [ ] . this nanoparticle approach paves the way for encapsulating drugs, small molecules, nutraceuticals and other bioactive ingredients to obtain safer cellular uptake, improved biodistribution, specific targeted delivery and enhancement of the therapeutic antiviral efficacy of encapsulated drugs and phytochemicals [ ] . the increase in antiviral efficacy and bioavailability of flavonoids may be attained through their encapsulation into red blood cells (rbcs), as has occurred for other type of antiviral drugs and molecules, such as fludarabine (figure ) [ ] , vincristine and vinblastine [ , ] . the idea of using rbcs as delivery system for flavonoids takes its advantage from the favorable characteristics of these cells. they have a long life-span of about days and have a widespread circulation throughout the body, and hence can be used as drug reservoirs, enabling them to facilitate sustained drug release. moreover, rbcs protect encapsulated drugs and molecules from degradation; they are completely biodegradable and show no or only minor immunogenic responses. interestingly, the rbcs were used to determine cellular antioxidant activity of some flavonoids, specifically vitexin, vitexin- -o-xyloside and vitexin- -o-rhamnoside, with the aim of predicting their bioavailability [ ] . moreover, it was demonstrated that flavonoids could have beneficial effects in preventing oxidative damage of erythrocyte membrane [ , ] . some authors have also evidenced the possibility that human rbcs play a pivotal role in the distribution and bioavailability of circulating flavonoids such as quercetin [ ] . furthermore, it was shown that drug-loaded rbcs can be modified in order to increase their macrophage-mediated phagocytosis by inducing band clustering and opsonization through the complementary and autologous iggs [ ] . in future perspective, this approach could be considered in order to possibly improve the antiviral activity of some flavonoids, like baicalin, that was able, like fludarabine [ ] , to act against hiv- chronic infection of human monocytes and macrophages, inhibiting the fusion of hiv virus envelope proteins with these cells [ ] . although polymeric nanoparticles, liposomes, dendrimers, micelles and inorganic nanoparticles have been widely accepted as drug delivery systems, they show toxicity and a short lifetime, thus making them relatively disadvantageous when compared with natural cell carriers, such as rbcs. for this reason, some authors in recent years have tried to mimic the erythrocyte cell membrane to produce biocompatible nanocarriers in order to decrease their toxicity and to prolong their survival in blood circulation [ ] [ ] [ ] . rbcs, which are biodegradable and non-immunogenic, can be used as a valuable carrier system with a lifespan that is remarkably prolonged and controllable when compared to synthetic carriers. several approaches have been developed to load peptides, drugs and molecules into rbcs or to attach these agents onto rbcs' outer membrane surface by either chemical or physical methods [ ] and the possibility of loading drugs into autologous rbcs prior to their transfusion into patients has been studied in small animal models and primates, as well as in clinical studies of human patients [ ] [ ] [ ] [ ] . the topic of phytochemical encapsulation in rbcs remains open for further studies, but we believe that flavonoid derivatives and nanoparticles able to bind flavonoids could be successfully considered for this application in the near future. diet and life-style play important roles in the defense against the attacks of viruses. the relationship between diet and the immune system involves the microbiota, i.e., the ecological community of commensals and potentially pathogenic microbes and symbionts that live in the gut [ ] . the diet modulates the microbiota composition, leading to an increase or a decrease in immune defenses [ ] . the mediterranean diet (and in general diets rich in fruits, vegetables and herbs) maintains gut microbiota homeostasis and provides protection against microbes and viruses [ ] . the cross-talk between microbiota and immunity is supported by the aryl hydrocarbon receptor (ahr), which is ubiquitous, but mainly present in the cytoplasm of immune cells [ ] . it was demonstrated that ahr binds different ligands, namely metabolites, pollutants and pathogenic molecules, and after this interaction it translocates into the nucleus, where it induces specific transcription programs and modulates the defensive functions of both t and b cells, dendritic cells and monocytes [ ] . interestingly, it was shown that flavonoids can bind ahr [ ] . on this basis, people eating vegetables, all of which contain flavonoids to a different extent, would strengthen their immune system [ ] . this strengthening is a general effect that occurs with many nutrients, but there are more specific antiviral effects attributable to the flavonoids treated in this review. flavonoids, like apigenin, vitexin, quercetin, rutin and naringenin, show a wide range of antiviral effects (table ) , because they are able to target different pathways of viral infections. it is therefore possible to increase the chances of blocking viral replication using mixtures of flavonoids with synergistic antiviral effects, because of the pleiotropic effects of their combination. an important question that arises is focused on the reasonable concentration range of flavonoids that should be used for an effective antiviral therapy, which is hard to be reached by diet alone. recent experiments performed in in vivo studies demonstrated the protective efficacy of various flavonoids, tested in the range - mg/kg body weight per day, in newborn mice challenged with a lethal dose of the enterovirus [ ] . interestingly, apigenin ( mg/kg), luteolin ( mg/kg) and quercetin ( mg/kg) conferred survival protection of . %, . % and . %, respectively, from the lethal enterovirus infection; moreover, isorhamnetin provided the highest survival protection of % at a dose of mg/kg. the authors hypothesized that the differences in concentrations are due to different times of absorption and renal clearance of these flavonoids [ ] . the flavanol isorhamnetin was studied also by dayem et al. [ ] , who showed that oral administration of this flavonoid at mg/kg/day for five days in mice infected with the influenza a virus significantly decreased lung virus titer by two-fold, increased the survival rate (which ranged from % to %) and decreased mice body weight loss by %. these authors hypothesized that the methyl group of the b ring of isorhamnetin may contribute to its strong antiviral potency against influenza a virus [ ] . guo et al. [ ] focused their in vivo studies on the flavone wogonin, showing that, in human hbv-transgenic mice, this flavonoid administered once a day at , and mg/kg reduced plasma hbsag level and immunohistological staining of the liver confirming the hbsag reduction exerted by wogonin [ ] . the potentiality of flavonoid bioactivity in vivo depends on the extent of their absorption after ingestion and their ability for distribution in various target tissues. in this light, liu et al. [ ] developed a quercetin-loaded cationic nanostructure lipid carrier (q-cnlc), which increased the in vivo bioavailability of this flavonoid. this quercetin-nanostructure complex benefits from its strong interactions with negatively charged intestinal mucosa, which could increase its residence in the gastrointestinal tract. moreover, the authors showed an entrapment efficiency of quercetin of . % and a slower release of this flavonoid from the q-clnc, when compared with the release profile of a simple quercetin solution, indicating that q-clnc exhibited a sustained and controlled release of this flavanol, in order to maintain its effective therapeutic concentration [ ] . in addition, the same authors performed in vivo tissue distribution studies in c bl/ j mice, comparing treatment with mg/kg of orally administered quercetin solution with the administration of mg/kg of q-cnlc, showing that the relative quercetin uptake from q-cnlc was . fold higher in lungs, . fold higher in liver and . fold higher in kidneys. on the contrary, the relative quercetin uptake from q-cnlc was lower in spleen, heart and brain, when compared with the quercetin solution [ ] . these results indicate that the most suitable delivery strategy should be chosen in order to target a specific organ with a particular flavonoid-nanostructure complex for future clinical applications. furthermore, the safety of the used phytochemical should also be considered, as has already been done for hydroxytyrosol, which is quickly absorbed and eliminated by the kidneys in either free or conjugated forms. hydroxytyrosol has been considered safe at mg/kg/day by the european food safety authority (efsa) panel [ ] . in this light, we think that, for a kg person, a flavonoid range between . - . g/day should be proposed. these values are close to the daily polyphenol intake in humans, calculated in various diet surveys [ ] , such as the supplementation en vitamines et mineraux antioxydants (su.vi.max) study, which ranked the polyphenol intake at . ± . g/day [ ] . accordingly, in another dietary intervention trial aimed at improving cognition in older adults, a total of . g/day of flavonoids was applied [ ] . indeed, based on these results, we think that . - . g/day of flavonoids could be a reasonable concentration range in order to start preliminary experiments, focused on assessing the in vivo antiviral effects of flavonoids. concerning the combination of flavonoids in an antiviral cocktail, each phytochemical may be used initially at a concentration of about . g/day with the aim of reaching an intake of g/day of antiviral flavonoids. in the case of antiviral synergistic effects [ , ] or increase of the absorption of one specific flavonoid exerted by other phytochemicals [ ] , the individual flavonoid concentrations can be modulated, according to the extent of the effect. it should also be emphasized that a significant antiviral effect is linked to the type of flavonoid mixture, the delivery system used, the pharmacokinetic pattern, the number of targets involved and the number of required daily doses. once these aspects have been defined, the more suitable regimen of administration consists of starting with the lowest effective concentration for a fixed time and proceeding with increasing doses of the antiviral flavonoids. monitoring the markers of antiviral efficacy and any side effects should also be considered in order to evaluate the risks-benefits pattern. overall, our review shows that many flavonoids exhibit antiviral activity and could offer a promising alternative for prevention of and therapy for viral infections. flavonoids are present in many vegetables and the first protection for the immune system resides in the ability to seek foods rich in bioactive nutrients. education programs for a healthy diet should be implemented during the outbreaks of viral infections [ ] . in fact, a diet rich in vegetables activates the ahr in the gut for maintenance of microbiota homeostasis, which in turn regulates the immune system. in the critical periods of viral infections, oral dietary supplementation with nutraceutical preparations based on combinations of flavonoids can be useful in order to inhibit different steps of the viral infective cycle. molecular mechanisms underlying the antiviral effects of flavonoids, herein described, mainly focus on the inhibition of viral enzyme activities: neuraminidases, dna/rna polymerases and proteases. therefore, a cocktail of flavonoids, selected for their efficacy in the inhibition of different viral enzymes, could be associated with elevated immune response and offer a promising option for antiviral therapies. this option acquires great importance considering that the viral genome frequently mutates, due to the lack of proof-reading activity of most of the viral polymerases. these mutations could hamper the efficacy of antiviral synthetic drugs. on the contrary, antiviral flavonoids, as well as the combination of synthetic antiviral drugs with flavonoids, would enhance therapeutic strategies by targeting the multiple signaling pathways involved in the viral infections [ ] . the active concentration of the flavonoids should be investigated, considering the pharmacokinetic studies available in the literature and the synergistic effects of the specific flavonoid combinations [ ] [ ] [ ] . the scarce intestinal absorption and bioavailability of flavonoids, when given through food or in pills, may be enhanced by the use of new drug delivery strategies [ ] . in fact, since flavonoids have some drawbacks after oral administration such as low stability, bioavailability and bio-efficacy, researchers are developing biocompatible nanomaterial synthesis as novel delivery systems (including nanospheres, nano-capsules, micro and nano-emulsions, micelles, solid lipid nanoparticles and capsules), for overcoming the delivery challenges of flavonoids in the biomedical sector. phytochemical-nanomaterial complexes can represent innovative drug delivery strategies (alongside those already known) for new antiviral therapies against the seven baltimore virus classes [ ] . interestingly, three patents regarding the antiviral effects of flavonoids (us , , ; ep ; us , , ) have been already assigned to the korea research institute of bioscience and biotechnology and advanced life sciences inc. [ ] . however, an important step that must be achieved is to obtain the authorization of novel food including flavonoids with antiviral properties, following regulation eu / [ ] . nowadays, this authorization has been given only to hydroxytyrosol [ ] and few other nutrients. if the antiviral efficacy and safety of flavonoids and their mixtures can be clearly demonstrated in vivo, it would be possible to obtain european food safety authority (efsa) authorization of novel foods, in order to provide new natural tools for preventing and facing outbreaks of viral infections. indeed, when flavonoids are administered through nano-sized delivery systems, they show increased stability and bioavailability with an enhanced and prolonged activity. however, the in vivo behavior and the antiviral actions of these nano-delivery systems are still under experimental evaluation. interferon regulatory factor irf interferon polyphenols and antioxidant capacity of vegetables under fresh and frozen conditions antioxidant capacity of extra-virgin olive oils antioxidant capacity of vegetables, spices and dressings relevant to nutrition effect of flavonoids on human health: old subjects but new challenges vitexin -o-xyloside, raphasatin and (-) eepigallocatechin- -gallate synergistically affect cell growth and apoptosis of colon cancer cells betalains increase vitexin- -o-xyloside cytotoxicity in caco- cancer cells antiproliferative activity of vitexin- -o-xyloside and avenanthramides on caco- and hepg cancer cells occurs through apoptosis induction and reduction of pro-survival mechanisms natural and synthetic avenathramides activate caspases , , and downregulate htert, mdr and cox- genes in caco- and hep b cancer cells a combination of moringin and avenanthramide f inhibits the proliferation of hep b liver cancer cells inducing intrinsic and extrinsic apoptosis flavonoids from beta vulgaris cicla and betalains from beta vulgais rubra: antioxidant, anticancer, antiinflammatory activities-a review characterization and biological activity of the main flaonoids from swiss chard (beta vulgaris subspecies cycla) oseltamivir resistance-disabling our influenza defenses twenty years of research into medicinal plants: results and perspectives combination of western medicine and chinese traditional patent medicine in treating a family case of covid- in wuhan. front antiviral phytochemicals: an overview flavonoids: promising natural compounds against viral infections antiviral effects of phytochemicals from medicinal plants: applications and drug delivery strategies antiviral activity of disticella elongata (vahl) urb. (bignoniaceae), a potentially useful source of anti-dengue drugs from the state of minas gerais identification and evaluation of anti hepatitis c virus phytochemicals from eclipta alba an evaluation of the inhibitory effects against rotavirus infection of edible plant extracts qualitative and quantitative analysis for the chemical constituents of tetrastigma hemsleyanum diels et gilg using ultra-high performance liquid chromatography/hybrid quadrupole-orbitrap mass spectrometry and preliminary screening for anti-influenza virus components anti-h n virus, cytotoxic and nrf activation activities of chemical constituents from scutellaria baicalensis molecular docking based screening of plant flavonoids as dengue ns inhibitors a polyphenol rich extract from solanum melongena l. dr peel exhibits antioxidant properties and anti-herpes simplex virus type pharmacoinformatics approach for investigation of alternative potential hepatitis c virus nonstructural protein b inhibitors epigallocatechin- -gallate inhibits entry of hepatitis b virus into hepatocytes the pharmacokinetic properties of hiv- protease inhibitors: a computational perspective on herbal phytochemicals anti-hepatitis c virus activity and synergistic effect of nymphaea alba extracts and bioactive constituents in liver infected cells moringa oleifera: a food plant with multiple medicinal uses a plant-derived flavonoid inhibits entry of all hcv genotypes into human hepatocytes the role of the glycosyl moiety of myricetin derivatives in anti-hiv- activity in vitro antiviral activity of polymethoxylated flavones from guangchenpi, the edible and medicinal pericarps of citrus reticulata "chachi antiviral activity of pinocembrin against zika virus replication characterization and evaluation of self-microemulsifying sustained-release pellet formulation of puerarin for oral delivery phytochemicals as antiviral agents: recent updates suppression of hepatitis c virus by the flavonoid quercetin is mediated by inhibition of ns protease activity inhibitory effects of quercetin -rhamnoside on influenza a virus replication anti-influenza a virus mechanism of three representative compounds from flos trollii via tlrs signaling pathways inhibition of rna binding to hepatitis c virus rna-dependent rna polymerase: a new mechanism for antiviral intervention therapeutic potential of taraxacum officinale against hcv ns b polymerase: in-vitro and in silico study divergent antiviral effects of bioflavonoids on the hepatitis c virus life cycle breaking down the barriers to a natural antiviral agent: antiviral activity and molecular docking of erythrina speciosa extract, fractions, and the major compound epigallocatechin gallate inhibits the hiv reverse transcription step baicalin, a metabolite of baicalein with antiviral activity against dengue virus quercetin- -rhamnoside exerts antiinfluenza a virus activity in mice virology blog: about viruses and viral disease inhibition of sialidase activity as a therapeutic approach anti-influenza activity of marchantins, macrocyclic bisbibenxyls contained in liverworts a sequence data resource for hepatitis b virus corriere nazionale: i virus che spaventano la scienza infectious agents and neurodegeneration influenza virus replication in lung epithelial cells depends on redox-sensitive pathways activated by nox -derived ros antiviral activity of veronica persica poir. on herpes virus infection nanoparticulate delivery systems for antiviral drugs chitosan nanoparticles enhance the intestinal absorption of the green tea catechins (+)-catechin and (-)-epigallocatechin gallate orac of chitosan and its derivatives. food hydrocoll electrostatic interactions enable nanoparticle delivery of the flavonoid myricetin development of self-microemulsifying drug delivery system (smedds) for oral bioavailability enhancement of simvastatin in beagle dogs phytochemical-assisted synthetic approaches for silver nanoparticles antimicrobial applications: a review development of biodegradble nanoparticles for delivery of quercetin preparation and in vitro evaluation of apigenin-loaded polymeric micelles plant extract synthesized pla nanoparticles for controlled and sustained release of quercetin: a green approach domínguez-perles, r. nanoparticles and controlled delivery for bioactive compounds: outlining challenges for new "smart-foods" for health drug-loaded red blood cell-mediated clearance of hiv- macrophage reservoir by selective inhibition of stat expression the terpene-indole alkaloids loaded erythrocytes as a drug carrier: design and assessment study of desorbtion and exemption of terpeno-indole alkaloids of vinkristin and vinblastin from erythrocitary cell carriers the cellular antioxidant activity in red blood cells (caa-rbc): a new approach to bioavailability and synergy of phytochemicals and botanical extracts protective effect of flavonoids against red blood cell hemolysis by free radicals inhibition of free radical initiated peroxidation of human erythrocyte ghosts by flavonols and their glycosides human red blood cell sas a natural flavonoid reservoir drug delivery through phagocytosis of red blood cells flavonoids as antiviral agents for enterovirus a (ev-a ) red blood cell membrane-camouflaged nanoparticles: a novel drug delivery system for antitumor application red blood cell-mimicking synthetic biomaterial particles using mechanobiological mimicry of red blood cells to extend circulation times of hydrogel microparticles engineering erythrocytes for the modulation of drugs' and contrasting agents' pharmacokinetics and biodistribution red blood cell-based delivery of drugs and nanomaterials for therapeutic and diagnostic applications delivery of drugs bound to erythrocytes: new avenues for an old intravascular carrier observation of erythrocyte dynamics in the retinal capillaries and choriocapillaris using icg-loaded erythrocyte ghost cells erythrocytes as carriers for drug delivery in blood transfusion and beyond the potential impact of gut microbiota on your health: current status and future challenges. asian pac effect of fruit and vegetable consumption on immune function in older people: a randomized controlled trial polyphenols and tryptophan metabolites activate the aryl hydrocarbon receptor in an in vitro model of colonic fermentation antiviral efficacy of flavonoids against enterovirus infection in vitro and in newborn mice antiviral effect of methylated flavonol isorhamnetin against influenza anti-hepatitis b virus activity of wogonin in vitro and in vivo characterization and biodistribution in vivo of quercetin-loaded cationic nanostructured lipid carriers ec regulation / . safety of hydroxytyrosol as a novel food pursuant to regulation (ec) no / systematic review on polyphenol intake and health outcomes: is there sufficient evidence to define a health-promoting polyphenol-rich dietary pattern? nutrients dietary intake of polyphenols in french adults enhancing dentate gyrus function with dietary flavanols improves cognition in older adults enhancement of flavonoid ability to cross the blood-brain barrier of rats by co-administration with α-tocopherol the food systems in the era of the coronavirus (covid- ) pandemic crisis. foods viral mutation rates flavonoids loaded in nanocarriers: an opportunity to increase oral bioavailability and bioefficacy nanomaterials designed for antiviral drug delivery transport across biological barriers of the european parliament and of the council and repealing regulation (ec) no / of the european parliament and of the council and commission regulation (ec) no this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license the authors want to thank university of urbino carlo bo for financial support. the authors declare no conflict of interest. the funders had no role in the writing of the manuscript or in the decision to publish this manuscript. key: cord- - s qr e authors: kriaucioniene, vilma; bagdonaviciene, lina; rodríguez-pérez, celia; petkeviciene, janina title: associations between changes in health behaviours and body weight during the covid- quarantine in lithuania: the lithuanian covidiet study date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: s qr e the covid- quarantine has caused significant changes in everyday life. this study aimed to evaluate the effect of the quarantine on dietary, physical activity and alcohol consumption habits of lithuanians and the association between health behaviours and weight changes. an online cross-sectional survey was carried out among individuals older than years in april . the self-administered questionnaire included health behaviour and weight change data. altogether subjects participated in the survey. almost half of the respondents ( . %) ate more than usual, . % increased snacking, and . % cooked at home more often. intake of carbonated or sugary drinks, fast food and commercial pastries decreased, while consumption of homemade pastries and fried food increased. a decrease in physical activity was reported by . % of respondents. every third ( . %) respondent, more often those already with overweight, gained weight. multivariate logistic regression analysis showed that the higher odds of weight gain were associated with females, older age, increased consumption of sugary drinks, homemade pastries and fried food, eating more than usual, increased snacking, decreased physical activity and increased alcohol consumption. our data highlighted the need for dietary and physical activity guidelines to prevent weight gain during the period of self-isolation, especially targeting those with overweight and obesity. the novel severe acute respiratory syndrome coronavirus (sars-cov- ), which causes coronavirus disease (covid- ) , first appeared in december in wuhan, china, and quickly spread worldwide. on january , the director-general of the world health organization (who) declared the outbreak of covid- to be a public health emergency of international concern and a set of recommendations was issued [ ] . in lithuania, the first case of covid- was diagnosed on february . as the number of cases was increasing rapidly, the lithuanian government decided to declare quarantine from to march [ ] . this was extended several times and ended on june. all public indoor and outdoor gatherings were prohibited. educational institutions began to work remotely. shops excluding grocery shops and pharmacies were closed. restaurants and bars were also closed, leaving the option for food takeaway. this situation forced people to cook the study questionnaire included questions regarding various sociodemographic criteria, the mediterranean diet adherence screen (medas) [ , ] , and changes in eating behaviours during the quarantine: snacking and intake of some foods with possible answers: 'higher', 'lower' or 'as usual'; perception of eating more during the quarantine with possible answers 'yes' or 'no'; changes in physical activity with possible answers: 'it has increased', 'it has decreased', 'it remains as usual', 'i do not practice physical activity'; and changes in alcohol consumption with possible answers: 'yes, my intake of alcoholic beverages is higher', 'no, my intake of alcoholic beverages is lower', 'my intake of alcoholic beverages remains as usual'. the question about weight change was: 'have you gained weight during the quarantine' with possible answers: 'yes', 'no', 'i don't know'. by weight change, the respondents were grouped in those who gained weight ('yes') and others ('no' or 'i don't know'). self-reported current weight and height were used to calculate body mass index (bmi) as weight in kilograms divided by height in meters squared. according to who guidelines, overweight was defined as bmi - kg/m and obesity as bmi ≥ kg/m [ ] . the respondents were grouped into three age groups: - years, - years and years and older. by education level, respondents were categorized into two groups: with university education and lower level of education. data analysis was performed using the statistical package ibm spss statistics for windows, version . (ibm corp.: armonk, ny, usa, released ). the categorical variables were presented as percentages and compared using the chi-square test and z test with bonferroni correction. univariate and nutrients , , of multivariate logistic regression analysis was used to evaluate the associations between weight gain during covid- quarantine (dependent variable) and social factors, nutrition, physical activity and alcohol consumption habits. the international covidiet study was approved by the research ethics committee of the university of granada ( /ceih/ ) and was registered in clinicaltrials.gov (https://clinicaltrials. gov/ct /show/nct ). additionally, the lithuanian study was approved by the bioethics centre of the lithuanian university of health sciences. no personal data was collected and participation was voluntary and anonymous. the participants were informed about the objectives of the study. the main characteristics of the study population are presented in table . the majority of the participants were females, - years old and having a university education. prevalence of overweight was . % and obesity . %. every third respondent ( . %) gained weight during the quarantine. a considerable number of participants reported that they changed their eating habits during the quarantine (table ). almost half of the respondents ( . %) answered that they ate more than usual. a similar proportion of participants ( . %) increased snacking. however, . % of respondents replied that they cooked at home more often than before quarantine. every fifth participant ( . %) increased consumption of fried food. fast food became less popular, as . % of respondents decreased its consumption. more than one-third of participants ( . %) reported that they increased consumption of homemade pastries. intake in carbonated and sugary drinks was decreased by . % of respondents and consumption of commercial pastries by %. more people reduced read meat and fish consumption than increased, while a higher proportion of participants increased fruit and vegetable consumption than decreased. most of the participants ( . %) declared that their intake of alcoholic beverages (wine, beer, strong alcoholic drinks) remained the same as before the covid- quarantine. the proportion of those who increased ( . %) and decreased ( . %) consumption of alcohol was similar. a large number of participants ( . %) reported that they reduced physical activity (table ) . the changes in health behaviours differed according to changes in body weight ( table ) . diet of those who gained weight changed in a more negative direction compared to those who reported no changes or did not notice the increase in body weight. more weigh-gaining respondents reduced fruit and vegetable consumption and increased red meat, carbonated or sugary drinks, pastries, fast food and fried food consumption. the majority of participants ( . %) whose weight increased declared that they ate more compared to . % of individuals without changes in body weight. more weigh-gaining people increased snacking and cooked more often than before quarantine. increase in alcohol consumption was reported by every fifth participant ( . %) who gained weight, and every tenth ( . %), who did not. a large proportion of weight-gaining respondents ( . %) decreased their physical activity during quarantine (table ) . table . the proportion of participants who reported changes in health behaviours by changes in weight (%). the weight gain was associated with bmi of participants. those with higher bmi gained weight more often compared to those having normal bmi (figure ). the weight gain was associated with bmi of participants. those with higher bmi gained weight more often compared to those having normal bmi (figure ). the binary univariate logistic regression showed that women were more likely to gain weight compared to men (table ). no associations were found with the age and education of respondents. the odds of weight gain were higher for those who decreased consumption of fresh fruits and vegetables and increased consumption of red meat, carbonated or sugary drinks, pastries, snacks, fast or fried food and ate more than usual. increased alcohol consumption and decreased physical activity were also related to higher odds of weight gain. in multivariate logistic regression analyses, the association of weight gain with increased intake of carbonated or sugary drinks, homemade pastries and fast food, increased snacking, eating more than usual, decreased physical activity and increased alcohol consumption remained statistically significant. the odds of weight gain also increased with age. the binary univariate logistic regression showed that women were more likely to gain weight compared to men (table ). no associations were found with the age and education of respondents. the odds of weight gain were higher for those who decreased consumption of fresh fruits and vegetables and increased consumption of red meat, carbonated or sugary drinks, pastries, snacks, fast or fried food and ate more than usual. increased alcohol consumption and decreased physical activity were also related to higher odds of weight gain. in multivariate logistic regression analyses, the association of weight gain with increased intake of carbonated or sugary drinks, homemade pastries and fast food, increased snacking, eating more than usual, decreased physical activity and increased alcohol consumption remained statistically significant. the odds of weight gain also increased with age. our study demonstrated that lithuanians changed their eating habits during the quarantine. almost half of the respondents reported that they ate more than usual, increased snacking and cooked more often at home. the intake of foods changed in positive and negative directions. more respondents increased than reduced fruit and vegetable consumption. the intake of carbonated and sugary drinks, fast food, and commercial pastries decreased; however, the consumption of homemade pastries and fried food increased. negative changes in eating, physical activity, and alcohol consumption habits were associated with weight gain which was reported by one third of respondents. our data support previous findings showing that restrictions during covid- increased the number of main meals, frequency of cooking, and snacking [ , [ ] [ ] [ ] [ ] . spending more time on cooking offers the possibilities to eat healthier, try new recipes and enjoy food without rushing. to remind people of the most important principles of healthy nutrition, who experts developed recommendations on food and nutrition during self-quarantine [ ] . however, restrictions during covid- pandemic decreased the availability of some foods. people were urged to stay at home, all restaurants and bars were closed, and only some of them offered food takeaway. ordering food online was overloaded [ ] . the variety of food products in grocery stores has declined [ , ] . a spanish study highlighted that people reported difficulties of finding meat in the supermarkets and grocery stores, which could be related to a decrease in consumption of meat during quarantine [ ] . at the beginning of the quarantine, people experienced panic and uncertainty, which led to extra buying of all long-lasting food products and caused a shortage of grain and some other products in grocery stores [ ] . social isolation with or without loneliness and boredom can be associated with a negative impact on nutrition habits, obesity, physical activity, and poor physical and mental health [ , , , , ] . some authors showed that high-level of depression was related to poor diet, increased intake of saturated fat, energy-dense and salty foods [ , ] . women who tended to act impulsively in a stressing environment were more likely to eat more candies [ ] . people with anxiety consumed snacks . times more often [ ] . the studies performed during the covid- pandemic revealed more frequent and increased consumption of sweets, biscuits and cakes, decreased intake of fruits and vegetables and increased consumption of frozen and canned foods, more frequent cooking and eating out of control [ ] [ ] [ ] [ ] , ] . on the other hand, some positive changes such as decreased consumption of processed meat, carbonated or sugary drinks and increased consumption of fresh fruits and vegetables, fish, legumes and white meat were identified [ , ] . our data support the previous findings that both positive and negative changes in dietary habits were observed during the quarantine. it is well documented that physical activity has many positive health effects [ ] . together with the changes in diet, a strong impact of quarantine on physical activity was observed. many studies showed that all levels of physical activity decreased and sitting or screen time increased [ , [ ] [ ] [ ] [ ] , ] . few studies found opposite results, showing an increase of physical activity during covid- crisis [ , ] . these differences may be related to different governmental policy on movement restrictions during this period. the data on alcohol consumption is controversial. some studies reported an increase in alcohol consumption and higher drinking tendency among alcohol addicts [ , ] , while other studies reported decrease in binge drinking and alcohol consumption [ , , , ] . a british study found decreased alcohol consumption only in the younger cohort [ ] . our study demonstrated similar proportions of those who increased and decreased alcohol consumption. evidence suggests that even a small positive energy balance over time is sufficient to cause weight gain in many individuals [ ] . our data showed that those respondents who gained weight were more likely to change their diet in an unhealthy direction, decrease physical activity, and increase alcoholic beverages consumption than those who did not report changes in body weight. furthermore, more respondents with higher bmi at the beginning of quarantine gained weight compare to those having a normal weight. previous studies have also reported weight gain during the quarantine [ ] , providing estimated weight changes from . kg to . kg in different countries [ ] [ ] [ ] , ] . people following an unhealthy diet had . times higher odds of weight increase [ ] . weight gain was associated with higher consumption of most foods: meat, dairy, fast foods, and even fruits, vegetables and legumes [ ] . an italian study found no associations between bmi and healthy food intake, while higher consumption of junk food such as snacks, dressings, sweet beverages and sweets was associated with higher bmi [ ] . lower exercise, consumption of snacks, unhealthy foods, cereals, and sweets were associated with significant weight gain in adults with obesity a month after the beginning of the quarantine [ ] . the latest studies report that patients with obesity are at increased risk of complications of covid- infection and higher mortality rates [ , ] . as there is not yet effective treatment and vaccination against covid- and there may be new virus outbreaks, healthy eating and physical activity promotion should be incorporated in government initiatives to reduce the negative effects of the covid- pandemic [ ] . encouraging people to follow a balanced diet, especially targeting those with obesity, could help to maintain an effective immune system and may provide protection against infections and other diseases. the strengths of our study include the online survey, which allowed us quickly to reach a sufficiently large sample of the population from different municipalities of the whole country during the quarantine. additionally, we used the covidiet questionnaire prepared by researchers from the university of granada for the international study so we will be able to compare our data with other countries in the future. several limitations of our study should be mentioned for the accurate interpretation of its results. first, we used non-random sampling to reach participants. the majority of respondents were women and people with higher education. the higher participation of women was also reported by other researchers [ , ] . however, our study covered all municipalities of lithuania and a large age interval. furthermore, we used self-reported online survey data which may be less reliable and biased. bmi was calculated from self-reported data on weight and height, which could lead to underestimation of overweight and obesity. a question about weight loss was not included in the questionnaire. finally, we did not collect data on employment status and stress during the quarantine. stress could impact eating and alcohol consumption habits. covid- quarantine caused both positive and negative changes in nutrition, physical activity, and alcohol consumption habits in the lithuanian population. weight gain was associated with unhealthy dietary changes, decreased physical activity, and increased alcohol consumption. our data highlighted the need for investigations into which dietary and physical activity guidelines might be appropriate to help counteract potentially negative impacts of covid- on health behaviour and body weight. author contributions: v.k. and j.p. made substantial contributions to conception and design of the manuscript. v.k. and l.b. carried out statistical analysis. v.k., l.b. and j.p. were involved in drafting of the manuscript. c.r.-p. reviewed and edited the manuscript. all authors have read and agreed to the published version of the manuscript. funding: this research received no external funding. world health organization: coronavirus disease (covid- ) advice for the public republic of lithuania: quarantine announced throughout the territory of the republic of lithuania (attached resolution). . available online lifestyle behaviours during the covid- -time to connect enterprise lithuania. covid- news for business: impact on business. . available online stress and eating behaviors do negative emotions predict alcohol consumption, saturated fat intake, and physical activity in older adults? the role of physical activity and exercise in obesity and weight management: time for critical appraisal association of obesity with disease severity among patients with covid- obesity in patients younger than years is a risk factor for covid- hospital admission obesity, inflammation, toll-like receptor and fatty acids who. food and nutrition tips during self-quarantine. . available online: https food-and-nutrition-tips-during-self-quarantine?fbclid=iwar jrtds a b dlqfrjo qvoba x-w_ qs oqctaryugsww n e kx_qqe)#article (accessed on changes in dietary behaviours during the covid- outbreak confinement in the spanish covidiet study a -item mediterranean diet assessment tool and obesity indexes among high-risk subjects: the predimed trial effects of covid- home confinement on eating behaviour and physical activity: results of the eclb-covid international online survey eating habits and lifestyle changes during covid- lockdown: an italian survey results from the french nutrinet-sante cohort study. medrxiv changes in weight and nutritional habits in adults with obesity during the "lockdown" period caused by the covid- virus emergency food access, availability, and affordability in los angeles communities, project cafe an overview of systematic reviews on the public health consequences of social isolation and loneliness social isolation global changes and factors of increase in caloric/salty food, screen, and substance use, during the early covid- containment phase in france: a general population online survey the influence of negative urgency, attentional bias, and emotional dimensions on palatable food consumption poor eating habits and predictors of weight gain during the covid- quarantine measures in kuwait: a cross sectional study dietary choices and habits during covid- lockdown: experience from poland physical activity and healthy ageing: a systematic review and meta-analysis of longitudinal cohort studies changes in the behavioural determinants of health during the coronavirus (covid- ) pandemic: gender, socioeconomic and ethnic inequalities in british cohort studies small changes' to diet and physical activity behaviors for weight management high prevalence of obesity in severe acute respiratory syndrome coronavirus- (sars-cov- ) requiring invasive mechanical ventilation nutrition amid the covid- pandemic: a multi-level framework for action we thank the administrative team of the international covidiet survey-the agr- research group: celia rodríguez-pérez, esther molina-montes, vito verardo, reyes artacho, belén garcía-villanova, eduardo jesús guerra-hernández and maria dolores ruíz-lópez, department of nutrition and food science, university of granada, spain, for sharing covidiet questionnaire. the authors declare no conflict of interest.nutrients , , key: cord- -elyn fdh authors: Żółkiewicz, jakub; marzec, aleksandra; ruszczyński, marek; feleszko, wojciech title: postbiotics—a step beyond pre- and probiotics date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: elyn fdh as an imbalance in the intestinal microbiota can lead to the development of several diseases (e.g., type diabetes, cancer, among others), the use of prebiotics, probiotics, and postbiotics to alter the gut microbiome has attracted recent interest. postbiotics include any substance released by or produced through the metabolic activity of the microorganism, which exerts a beneficial effect on the host, directly or indirectly. as postbiotics do not contain live microorganisms, the risks associated with their intake are minimized. here, we provided a critical review of postbiotics described in the literature, including their mechanisms of action, clinical characteristics, and potential therapeutic applications. we detailed the pleiotropic effects of postbiotics, including their immunomodulatory, anti-inflammatory, antioxidant, and anti-cancer properties. although the use of postbiotics is an attractive strategy for altering the microbiome, further study into its efficacy and safety is warranted. the assemblage of microorganisms that inhabit the human body, their genomes and metabolites, as well as the environment in which they live, is called the microbiota. microorganisms that are part of the microbiome can be isolated from all areas in constant contact with the external environment (e.g., the skin, upper respiratory tract, or urogenital tract). however, they are most abundant in the gastrointestinal tract. our interdependent relationship with the intestinal microbiota is established during the first three years of life [ ] . the human body provides a stable, nutrient-rich environment for the inhabiting microorganisms, and in return, receives a number of benefits. these benefits include stimulation of the immune system, improved digestion and absorption of food, reduced growth of pathogenic flora, and maintenance of intestinal barrier integrity. these beneficial effects of the interaction between the microbiota and the gastrointestinal tract can be observed not only locally, but also in distant organs, due to systemic distribution of substances and cells produced in the intestine. this phenomenon is called the gut-organ axis, according to which we can distinguish the gut-brain, gut-skin, gut-lung axis, and so on. several factors can affect the composition of the microbiota starting from the perinatal period, including the composition of the maternal gut microbiota, the mode of delivery and type of food the mother consumes, antibiotic therapy, and stress [ ] . moreover, many studies have shown that an imbalance in the intestinal microbiota-dysbiosis-can lead to the development of allergic or autoimmune diseases (e.g., inflammatory bowel disease, type diabetes, among others), cancer, and psychiatric disorders [ ] . as such, therapeutic strategies and preparations that affect the composition of the microbiota, and thus, the patient's well-being, have become increasingly popular. as summarized in figure , there are currently three main ways in which the microbiota can be modulated, i.e., through the use of prebiotics, probiotics, synbiotics, or postbiotics. prebiotics are figure . optimal microbiome composition as a token of human wellbeing. microbiome composition and structure is one of the factors determining proper human development and health. the roof that represents microbiome may be impermeable and reliable, only provided structures below are solid. a suitable diet and physical activity form the basis for the construction. metaphorical foundation, which is represented by diet and exercise, underlines principal role of healthy lifestyle in sustaining human health and wellbeing. it is a lifestyle modification one should implement first when commencing the process of building human welfare. the connectors (pillars) between "roof" and "foundation" that cement the construction are pre-, pro-, and postbiotics. a lot of research is currently focused on determining the ideal proportion and shape of each pillar, so all of the construction's elements depicted in this figure would be in the state of harmony. it is important to note that the composition of the microbiome is also affected by other factors that are not found in this figure, e.g., route of labor, use of medicines, or having siblings. the concept of postbiotics is based on the observation that the beneficial effects of the microbiota are mediated by the secretion of various metabolites. however, its precise definition remains under discussion. according to tsilingiri et al., postbiotics include any substance released by or produced through the metabolic activity of the microorganism, which exerts a beneficial effect on the host, directly or indirectly [ ] . for the purposes of this article, we assume that postbiotics optimal microbiome composition as a token of human wellbeing. microbiome composition and structure is one of the factors determining proper human development and health. the roof that represents microbiome may be impermeable and reliable, only provided structures below are solid. a suitable diet and physical activity form the basis for the construction. metaphorical foundation, which is represented by diet and exercise, underlines principal role of healthy lifestyle in sustaining human health and wellbeing. it is a lifestyle modification one should implement first when commencing the process of building human welfare. the connectors (pillars) between "roof" and "foundation" that cement the construction are pre-, pro-, and postbiotics. a lot of research is currently focused on determining the ideal proportion and shape of each pillar, so all of the construction's elements depicted in this figure would be in the state of harmony. it is important to note that the composition of the microbiome is also affected by other factors that are not found in this figure, e.g., route of labor, use of medicines, or having siblings. the concept of postbiotics is based on the observation that the beneficial effects of the microbiota are mediated by the secretion of various metabolites. however, its precise definition remains under discussion. according to tsilingiri et al., postbiotics include any substance released by or produced through the metabolic activity of the microorganism, which exerts a beneficial effect on the host, directly or indirectly [ ] . for the purposes of this article, we assume that postbiotics include all substances of bacterial or fungal origin that confer beneficial effect to the host and do not meet the definition of a probiotic and are not exclusively of a prebiotic nature ( figure ). include all substances of bacterial or fungal origin that confer beneficial effect to the host and do not meet the definition of a probiotic and are not exclusively of a prebiotic nature ( figure acquisition. lysis of bacterial cells may be achieved by chemical and mechanical techniques. these methods include enzymatic extraction, solvent extraction, sonication, and heat. extraction, dialysis, and chromatography are used to isolate and identify desired molecules. scfa, short-chain fatty acids according to the current literature, postbiotics are not considered as synbiotics. synbiotics are a combination of prebiotics and probiotics that are claimed to have a beneficial impact on gut microbiome. however, it is believed that postbiotics may also strengthen the intestinal microbiome [ ] , so we believe that term "synbiotics" should be reviewed and postbiotics should be incorporated in its definition. although postbiotics do not contain live microorganisms, they show a beneficial health effect through similar mechanisms that are characteristic of probiotics while minimizing the risks associated with their intake. therefore, like prebiotics, postbiotics appear to lack serious side effects while maintaining similar effectiveness to probiotics (although currently there are no studies directly comparing substances belonging to both groups). here, we provided a critical review of the postbiotic drugs described in the literature, including their mechanisms of action, clinical characteristics, and potential therapeutic applications. cell-free supernatants containing biologically active metabolites secreted by bacteria and yeast into the surrounding liquid can be obtained directly from cell cultures. after an incubation period, the microbes are centrifuged and then removed. finally, the resulting mixture is filtered to ensure sterility. supernatants produced from cultures of different microorganisms show differing activities. lactobacillus acidophilus and lactobacillus casei supernatants have anti-inflammatory and antioxidant effects on intestinal epithelial cells, macrophages, and neutrophils by reducing the secretion of the pro-inflammatory tumor necrosis factor α (tnf-α) cytokine and increasing secretion of the according to the current literature, postbiotics are not considered as synbiotics. synbiotics are a combination of prebiotics and probiotics that are claimed to have a beneficial impact on gut microbiome. however, it is believed that postbiotics may also strengthen the intestinal microbiome [ ] , so we believe that term "synbiotics" should be reviewed and postbiotics should be incorporated in its definition. although postbiotics do not contain live microorganisms, they show a beneficial health effect through similar mechanisms that are characteristic of probiotics while minimizing the risks associated with their intake. therefore, like prebiotics, postbiotics appear to lack serious side effects while maintaining similar effectiveness to probiotics (although currently there are no studies directly comparing substances belonging to both groups). here, we provided a critical review of the postbiotic drugs described in the literature, including their mechanisms of action, clinical characteristics, and potential therapeutic applications. cell-free supernatants containing biologically active metabolites secreted by bacteria and yeast into the surrounding liquid can be obtained directly from cell cultures. after an incubation period, the microbes are centrifuged and then removed. finally, the resulting mixture is filtered to ensure sterility. supernatants produced from cultures of different microorganisms show differing activities. lactobacillus acidophilus and lactobacillus casei supernatants have anti-inflammatory and antioxidant effects on intestinal epithelial cells, macrophages, and neutrophils by reducing the secretion of the pro-inflammatory tumor necrosis factor α (tnf-α) cytokine and increasing secretion of the anti-inflammatory cytokine interleukin (il- ) [ ] . meanwhile, supernatants derived from l. casei and lactobacillus rhamnosus gg cultures can prevent the invasion of colon cancer cells [ ] . as cell-free supernatants can reduce oxidative stress in vivo [ ] and provide direct antitumor activity, they may be clinically useful in the prevention of cancer. supernatants derived from bacterial cultures of the genera lactobacillus and bifidobacterium were also recently shown to display antibacterial activity by preventing the invasion of enteroinvasive e. coli strains into enterocytes in vitro [ ] . although these antibacterial properties may result from the inhibition of adhesion of the pathogenic bacterial strains (due to competition for receptor sites), the cell supernatants could also have a local effect on the intestinal environment, cell barrier, and expression of protective genes [ ] . therefore, cell-free bacterial supernatants are promising anti-infectious agents, for example, for the treatment of diarrhea. meanwhile, lactobacillus plantarum supernatants were found to have a positive effect on the maturation and morphological structure of the intestinal barrier [ ] . administering these supernatants to lambs early in their life was associated with an increase in the absorption surface of the intestine and a decrease in the population of intestinal pathogens [ ] . the concentration of inflammatory markers (il- β and tnf-α) in the intestinal mucosa also decreased (p < . ) [ ] . there is also evidence of the beneficial effects of supernatants derived from yeast cultures. in particular, supernatants from saccharomyces cerevisiae and saccharomyces boulardii reversed the state of disturbed intestinal peristalsis caused by stress stimuli [ ] . s. boulardii supernatants also show anti-inflammatory and antioxidant activity [ ] , similar to bacterial cell supernatants, and can accelerate wound healing and regeneration of the intestinal barrier [ ] . during their growth, microorganisms produce biopolymers with different chemical properties. these biopolymers can be released outside the bacterial cell wall, forming a heterogeneous group of substances called exopolysaccharides (epss). epss are currently used in the food industry as stabilizing, emulsifying, and water-binding agents [ ] , although their biological function is not entirely clear. nonetheless, the use of epss in pharmaceutical products and functional foods has attracted recent interest. epss may modulate the immune response by interacting with dendritic cells (dcs) and macrophages and enhancing the proliferation of t and nk lymphocytes [ ] . in addition, an eps isolated from tofu, which is a product of l. plantarum, induced nitric oxide (no) secretion and enhanced the phagocytic potential of macrophages in an in vitro model [ ] . this eps also increased iga concentrations in the intestinal mucosa (p < . ) and stimulated lymphocyte proliferation (p < . ) [ ] . meanwhile, using an eps derived from l. casei as an adjuvant increased the effectiveness of the foot-and-mouth disease vaccine [ ] . some epss produced by lactobacillus strains isolated from fermented durian fruit possess antimicrobial and antioxidant properties [ ] . the ability to bind iron ions was shown to account for the antioxidant potential of an eps obtained from lactobacillus helveticus called uronic acid, which, notably, is also responsible for the antioxidant properties of green tea [ ] . epss can also have a positive effect on lipid metabolism by inhibiting cholesterol absorption [ ] . indeed, the consumption of kefiran (an eps produced by lactobacillus kefiranofaciens) delayed the development of atherosclerosis in a preclinical animal (rabbit) model (p < . ) [ ] . kefiran also prevented blood pressure increases and stabilized blood glucose levels in rats who consumed excessive cholesterol [ ] . thus, epss such as kefiran are potential candidates for preventing cardiovascular diseases. β-glucans, another class of epss, can interact with dectin- receptors on the surface of macrophages and activate them [ ] . as a result, β-glucans may enhance the cellular immune response against bacteria, viruses, parasites, and cancer cells [ , ] . β-glucans may also have a positive effect on probiotics' efficacy, for example, by facilitating the adhesion of lactobacilli to the intestinal epithelium [ ] . they can also increase the bioavailability and absorption of carotenoids (compounds with antioxidant and anti-inflammatory properties) in the gastrointestinal tract [ ] . moreover, topically applied β-glucans (in the form of a cream) may help patients suffering from atopic dermatitis, nutrients , , of by reducing the number and severity of exacerbations (p = . ) while maintaining a good safety profile [ ] . microorganisms have evolved defense mechanisms against the harmful effects of reactive oxygen species (ros), which can damage lipids, proteins, carbohydrates, and nucleic acids. in particular, antioxidant enzymes, such as glutathione peroxidase (gpx), peroxide dismutase (sod), catalase, and nadh-oxidase, play key roles in combating ros. indeed, two strains of l. fermentum were found to have a high content of gpx [ ] , and were later documented to possess potent antioxidant properties in vitro [ ] . antioxidant properties of postbiotics derived from lactobacillus plantarum were demonstrated in the study conducted by izuddin et al. [ ] . this effect was observed thanks to increased gpx concentration in serum (p < . ). moreover, genetically modified lactobacillus strains that synthesize sod or catalase showed superiority in relieving symptoms in a mouse model of crohn's disease relative to their unmodified counterparts [ ] . furthermore, lactobacillus strains with increased catalase activity were more effective in relieving inflammation in a mouse model of inflammatory bowel disease than strains of the same bacterium producing sod (both strains decreased the body temperature comparing to the controls with p < . ) [ ] . this trial revealed that anti-inflammatory activity of lactobacillus strains is dependent on the antioxidative enzyme expression profile of each strain. besides, genetically modified lactobacillus lactis expressing catalase was shown to prevent chemically induced colon cancer in mice [ ] . currently, we lack data regarding the use of sole antioxidant enzymes in vivo. many components of the bacterial cell wall are immunogenic (i.e., elicit a specific immune response), including bacterial lipoteichoic acid (lta). lta is found in the cell walls of gram-positive bacteria and can be spontaneously released into the environment [ ] . although lta has been shown to exhibit immunostimulatory effects [ ] , data on its activity are ambiguous. some reports indicate that lta reduces il- production and induces the production of cytokines with immunoregulatory activity (e.g., il- ) [ ] . in contrast, others have shown lta does not alleviate inflammatory processes and actually causes damage to tissues in the intestine [ ] . the use of lta in dermatological diseases is slightly less controversial. the topical application of lta enhances non-specific defense mechanisms, leading to the release of anti-infectious peptides, including human β-defensin and cathelicidin [ ] . in fact, bacteria of the genera lactobacillus and bifidobacteria, which produce significant amounts of lta, stimulate the skin mast cell response against some bacterial and viral infections [ ] . this data suggests lta may be useful for treating a wide range of skin infections. moreover, based on its anti-inflammatory and anti-cancer activity, lta may have broader utility [ , ] . despite these beneficial activities, lta may exert side effects in living organisms and cause an excessive inflammatory response. therefore, further safety evaluation for lta is warranted. short-chain fatty acids (scfas) are a product of fermentation of plant polysaccharides by intestinal microbiota. well-known scfas include acetic, propionic, and butyric acids, which can form the corresponding fatty acid salts (i.e., acetate, propionate, and butyrate). butyrate is one of the most important energy sources for enterocytes, as it helps to renew the intestinal epithelium and can also modulate gene expression by incompetently inhibiting histone deacetylases. butyrate also shows immunosuppressive effects [ ] . for example, butyrate has been shown to induce food tolerance by increasing the expression of immunosuppressive cytokines (e.g., type interferons [ifns], il- , tgf-β) and downregulating several cytokines and proinflammatory receptors (e.g., toll like receptor (tlr) / , caspase- , nlrp , il- β, il- , il- , il- , mapk). these immunosuppressive effects of butyrate result from the inhibition of nf-κb transcription factor activity and its intracellular pathways [ ] . indeed, rectal administration of butyrate caused a significant regression of inflammatory changes in the large intestine of patients with ulcerative colitis relative to patients receiving placebo [ ] . intestinal colonization with roseburia intestinalis, which produces significant amounts of butyrate, was shown to inhibit atherogenesis in a mouse model of atherosclerosis [ ] . the same study also noted a significant reduction in endotoxemia (likely resulting from sealing of the intestinal barrier) and inflammatory markers in the serum and aorta (including lipopolysaccharide and tnf-α) [ ] . it is worth highlighting that intestinal administration of tributyrin results in analogous effects as observed in abovementioned part of the trial, implying the beneficial effect of r. intestinalis is mediated, at least in part, by butyrate. in terms of its potential mechanism, scfas can affect energy management by stimulating g-protein coupled receptors (gpcrs) and secretion of the glucagon-like peptide (glp- ). indeed, an increase in serum and fecal acetate was associated with an increase in insulin sensitivity and a reduction in body fat in vivo, likely through increased glp- levels [ ] . acetate can also directly regulate appetite in the central nervous system [ ] , indicating a potential application in preventing cardiovascular diseases. furthermore, using a diet high in acetate significantly increased resistance to enterohaemorrhagic e. coli o :h infection in a mouse model [ ] . this phenomenon is likely a result of the sealing properties of acetate on the intestinal barrier, which prevents lethal toxins from entering the general circulation [ ] . propionate is another scfa that is one of the main substrates of gluconeogenesis in the liver. in addition to its role in carbohydrate metabolism, propionate has a statin-like effect, inhibiting the cholesterol synthesis pathway [ ] . propionate also shows an anti-inflammatory activity effect in vivo that is comparable to that of butyrate [ ] . indeed, many studies are currently underway regarding the therapeutic use of scfas in medicine. for example, a recent report showed that scfas may provide symptom relief using an animal model of inflammation and demyelination that occurs in the brain during multiple sclerosis [ ] . bacterial lysates (bls) are obtained by the chemical or mechanical degradation of gram-positive and gram-negative bacteria commonly found in the environment. their clinical use is based on the concept of the gut-lung axis, i.e., the functional connection between the immune system of the intestine and the respiratory system [ ] . in particular, studies have shown that orally administered lyophilized bls reach the peyer's patches in the small intestine, where they stimulate dcs, and subsequently activate t and b lymphocytes [ ] . mature lymphocytes then migrate to the mucous membrane of the respiratory tract and initially stimulate the innate immune system and promoting iga secretion [ ] . indeed, the safety of bls use has been confirmed during many clinical studies on various diseases, including recurrent upper respiratory tract infections in children [ ] . a causal relationship between a decrease in the incidence of infections in highly developed countries and an increase in allergic diseases has been proposed, potentially due to the so-called hygiene hypothesis. therefore, using bls, which mimic the presence of bacteria, to stimulate the immune system, is an attractive option in the case of insufficient exposure to microorganisms. indeed, a meta-analysis including over children showed a significantly lower incidence of respiratory infections in those receiving a commercially available bl preparation compared to the control group [ ] . similarly, a systematic review proved the effectiveness of bl add-on therapy in reducing the frequency of wheezing episodes and asthma exacerbations in children (p < . for both endpoints) [ ] . infection prevention is one, though not the only, reason for the positive effects of bls on reducing episodes of exacerbation of asthma in children [ ] and chronic obstructive pulmonary disease in adults [ ] . bls can also reduce the frequency of allergic rhinitis episodes [ ] and alleviate the symptoms of atopic dermatitis [ ] . finally, ingesting heat-killed lactobacillus paracasei may be applicable in reducing the symptoms of dry eye syndrome, which primarily arises from the long-term, repetitive exposure to blue light emitted by led screens [ ] . the gut microbiota produces an array of molecules, including vitamins, phenolic-derived metabolites, and aromatic amino acids. due to high bioavailability, antioxidative features, and signaling properties, these substances are considered to be important contributors in host-microbiome crosstalk. it has been demonstrated that in situ-produced bacterial foliate can be absorbed in the colon and incorporated into host's tissues. folate plays an important role in dna synthesis, reparation, and methylation, and is also considered as an antioxidative agent. therefore, intestinal-produced folate may exert systemic function. citizens of countries with mandatory folate food fortification were reported to have lower risk of stroke compared to the controls (rr, . ; p = . ) [ ] . however, the impact of on colorectal cancer risk takes the form of a u-shaped relationship, and the optimum folate status has not been defined [ ] . nevertheless, the issue of intestinal bacteria producing folate and their potential clinical application in maintaining optimal folate status deserves further consideration. in vitro, both folate-producing lactobacillus helveticus cd and the intracellular cell-free extract of this strain demonstrated antioxidative activity [ ] . several bacterial strains have been shown to synthesize vitamin b de novo [ ] . supplementation of lactobacillus acidophilus in yogurt matrix was associated with elevated vitamin b and folate serum levels (p < . ) and reduced prevalence of anemia (p < . ) [ ] . vitamin k is a cofactor required for the synthesis of clotting factors. whereas the contribution of microbiome-derived to vitamin k resources has been established, locally produced vitamin k appears to have underpinning mechanisms. vitamin k concentration in the human gut has been associated with microbiome structure. however, it did not result in the alteration of inflammation biomarkers (il- and tnf-α; both p > . ) [ ] . gut microbiota is postulated to be actively involved in aromatic amino acids (aaa) metabolism. aaa, as bioactive molecules, may act on distant organs, such as the kidneys, brain, and cardiovascular system [ ] . for example, the genetic modification of gut microbiota metabolism enabled to control indoxyl sulfate plasma levels. indoxyl sulfate contributes to the progression of chronic kidney disease, implying the possible role of targeting aaa metabolism in renal disorders [ ] . the interplay between dietary polyphenols and gut microbiota has drawn a great deal of attention. polyphenols modulate the structure and are concurrently metabolized by gut microbiota. hosts' responses to the dietary interventions may differ and this observation formed the basis for developing term called "metabotype" [ ] . metabotyping investigates the relationship between a metabolic phenotype and gut microbiome-derived metabolites that characterize the metabolism of the parent compound, thus providing a rationale for developing "personalized nutrition" [ ] . postbiotics derived from dietary polyphenols include, i.e., urolithin a (ua), equol, and -prenylnaringenin . mice treated with ua for weeks weighed . % less than controls. apart from anti-obesity effects, ua improved the insulin resistance score (homa-ir) in a statistically significant manner (p < . ) [ ] . the first human trial demonstrated the safety profile of orally administered ua, along with improvement in fatty acid oxidation rate, systemic mitochondrial health, and serum acylcarnitinen concentration (p < . ) [ ] . one year of equol supplementation in middle-aged japanese women resulted in arterial stiffness reduction (p < . ) and elevation of lipid parameters (hdl, ldl, and total cholesterol concentrations-all p < . ) [ ] . moreover, one year of equol intake caused a significant increase in whole body bone mineral density among postmenopausal women ( . g/cm vs. . g/cm ; p = . ) [ ] . due to the high heterogeneity of substances classified as postbiotics and the limited framework of this study, this section summarizes only the most important mechanisms of action that are characteristic of postbiotics (figure ). it should be emphasized that there is currently insufficient data available to understand the complex effects of postbiotics in their entirety. however, postbiotics will likely have pleiotropic effects on the human body. figure . mechanisms of action of postbiotics. postbiotics display pleiotropic properties. due to the induction of differentiation of t regulatory lymphocytes and synthesis of anti-inflammatory cytokines, postbiotics restore the imbalance between two major arms of immune system represented by th and th lymphocytes. the balance between th and th lymphocytes is vital for immunoregulation, and its disturbance causes various immune diseases, including atopic disorders. antibacterial activity is probably mediated by postbiotics' impact on the molecular structure of enterocytes, which results in sealing the intestinal barrier. "statin-like" activity of postbiotics and its future therapeutic application in metabolic and related diseases is highly anticipated. the immunomodulatory effects of the gut microbiome have long been suggested [ ] . for example, butyrate (a scfa) induces the differentiation of regulatory t cells (tregs) in the intestine [ ] . in addition, propionate (another scfa) enhances the formation of peripheral tregs [ ] . various fractions of postbiotics isolated from bacillus coagulans culture (supernatant, cell wall fragments) also induce anti-inflammatory cytokine production and promote t helper (th) -dependent immune responses [ ] . moreover, numerous in vitro experiments have shown that the supernatant from a bifidobacterium breve culture induces the maturation and survival of dcs, and consequently, increases il- secretion and inhibits tnf-α secretion [ ] . these properties may be responsible for limiting the th -mediated responses and enhancing th -mediated responses [ ] , as is often observed in those prone to atopic diseases. in a mice model, postbiotics derived from streptococcus thermophilus were shown to enhance th lymphocyte response in mesenteric lymph nodes compared to controls (p < . ) [ ] . as inflammation is inextricably linked to carcinogenesis, any substance that inhibits inflammation may also have anti-cancer potential. indeed, the scfa propionate (produced by propionibacterium freudenreichii) was shown to selectively induce apoptosis in gastric cancer cells [ ] . scfas also influence the regulation of oncogenes and suppressor genes through epigenetic modifications. l. rhamnosus gg supernatant increased zo- expression (responsible for the correct structure of tight junctions between cells and cell adhesion) and decreased mmp- expression (which helps degrade the intercellular matrix, thus facilitating cancer cell penetration) [ ] . indeed, changes in zo- and mmp- level caused by exposure to the l. rhamnosus gg supernatant helped reduce colorectal tumor cell invasion in an in vitro model (p = . ) [ ] . due to the induction of differentiation of t regulatory lymphocytes and synthesis of anti-inflammatory cytokines, postbiotics restore the imbalance between two major arms of immune system represented by th and th lymphocytes. the balance between th and th lymphocytes is vital for immunoregulation, and its disturbance causes various immune diseases, including atopic disorders. antibacterial activity is probably mediated by postbiotics' impact on the molecular structure of enterocytes, which results in sealing the intestinal barrier. "statin-like" activity of postbiotics and its future therapeutic application in metabolic and related diseases is highly anticipated. the immunomodulatory effects of the gut microbiome have long been suggested [ ] . for example, butyrate (a scfa) induces the differentiation of regulatory t cells (tregs) in the intestine [ ] . in addition, propionate (another scfa) enhances the formation of peripheral tregs [ ] . various fractions of postbiotics isolated from bacillus coagulans culture (supernatant, cell wall fragments) also induce anti-inflammatory cytokine production and promote t helper (th) -dependent immune responses [ ] . moreover, numerous in vitro experiments have shown that the supernatant from a bifidobacterium breve culture induces the maturation and survival of dcs, and consequently, increases il- secretion and inhibits tnf-α secretion [ ] . these properties may be responsible for limiting the th -mediated responses and enhancing th -mediated responses [ ] , as is often observed in those prone to atopic diseases. in a mice model, postbiotics derived from streptococcus thermophilus were shown to enhance th lymphocyte response in mesenteric lymph nodes compared to controls (p < . ) [ ] . as inflammation is inextricably linked to carcinogenesis, any substance that inhibits inflammation may also have anti-cancer potential. indeed, the scfa propionate (produced by propionibacterium freudenreichii) was shown to selectively induce apoptosis in gastric cancer cells [ ] . scfas also influence the regulation of oncogenes and suppressor genes through epigenetic modifications. l. rhamnosus gg supernatant increased zo- expression (responsible for the correct structure of tight junctions between cells and cell adhesion) and decreased mmp- expression (which helps degrade the intercellular matrix, thus facilitating cancer cell penetration) [ ] . indeed, changes in zo- and mmp- level caused by exposure to the l. rhamnosus gg supernatant helped reduce colorectal tumor cell invasion in an in vitro model (p = . ) [ ] . some postbiotics can have direct antimicrobial effects by sealing the intestinal barrier, competitively binding to receptors required by some pathogenic bacteria, changing the expression of host genes, or modulating the local environment [ ] . indeed, combining postbiotics and probiotics effectively prevented rotavirus-associated diarrhea in a preclinical model [ ] . furthermore, randomized clinical trials conducted in a group of children aged - months showed that daily intake of products containing l. paracasei postbiotic led to a reduction in the incidence of diarrhea [ , ] , acute gastroenteritis, pharyngitis, laryngitis, and tracheitis [ , ] . butyrate (a scfa), was found to support the regeneration of the intestinal epithelium [ ] . meanwhile, supernatant obtained from one of the most common probiotic strains, l. rhamnosus gg, helps to protect human intestinal smooth muscle cells from damage [ ] . the use of bacterial lysates in children was associated with significant reduction of respiratory tract infection compared to controls (md = − . ; p < . ) [ ] . postbiotics may also play a role in lipid metabolism and could reduce the risk of cardiovascular incidents. for example, the scfa propionate can inhibit condensation of cholesterol precursors, leading to statin-like effects [ ] . kefiran also has antiatherogenic properties, which may result from the reduction of inflammation, prevention of cholesterol accumulation in macrophages, and reduction of lipid concentration [ ] . moreover, lactobacillus bls were found to reduce the levels of triglycerides and ldl cholesterol while increasing the level of beneficial hdl cholesterol in an obese mouse model [ ] . this beneficial effect of fragmented lactobacillus bacteria on the lipid profile was caused by activation of the peroxisome proliferator-activated receptor (ppar)α, which is also the therapeutic target of the fibrate class of lipid-lowering drugs [ ] . moreover, propionate stimulated the release of peptide yy and glp- in human colonic cells and resulted in a significant reduction of total adipose content (p = . ) and intrahepatocellular lipid content (p = . ) in vivo [ ] . autophagy is a homeostatic mechanism through which damaged organelles and proteins are cleaned out. this self-degradative process can act as a response to various stress stimuli, including nutrient stress. intracellular receptor nod detects bacterial peptidoglycan and promotes autophagy and inflammatory signaling. irving et al. revealed that this effect was mediated by outer membrane vesicles-spherical membrane structures naturally shed by all gram-negative bacteria as part of their normal growth in vitro and in vivo [ ] . postbiotic-obtained lactobacillus fermentum triggers autophagy in hepatic cells hepg . autophagy inductive potential of l. fermentum displayed protective effects in pharmacologically induced liver toxicity [ ] . mitophagy is a specific autophagy elimination of damaged mitochondria. in humans, urolithin a inhibits mitophagy, and may therefore prevent or delay the development of an age-related decline in muscle health [ ] . oxytocin is a multidirectional neuropeptide that plays a dominant role in stimulating uterine contractions during labor, modulating behavior, and creating an emotional bond. in addition, oxytocin can stimulate and accelerate wound healing. the administration of bls obtained by sonication of lactobacillus reuteri increased the number of oxytocin-producing cells in the hypothalamic periventricular nuclei, resulting in an elevated oxytocin concentration in blood serum in animal models (p < . ) [ ] . comparable results were obtained by the administration of l. reuteri probiotics in both animal and human models, suggesting that the use of bls is sufficient to achieve satisfactory results, with a significantly improved safety profile [ ] . bacterial culture and the production of probiotics are somewhat unpredictable in nature. the problem of dose standardization, which is a significant issue in the production of probiotics, does not exist in the case of postbiotics. from an economic standpoint, the benefits of postbiotics include longer shelf life, easier storage, transport, and a reduced need to maintain a low temperature in comparison to probiotics. the use of a repetitive production process and the possibility of more precise quantitative control (except for bls) are additional advantages of postbiotics compared to probiotics. when discussing the therapeutic benefits, attention should be paid to the superiority of postbiotics over postbiotics in the context of safety. the undoubted advantage of postbiotics is bypassing the problem of acquiring antibiotic resistance genes and virulence factors, which may occur in vivo when probiotics are used [ ] . postbiotics eliminate the need for exposure to live microorganisms, which is particularly important in children with an immature immune system and a leaky intestinal barrier. functional foods can be defined as dietary items with additional health benefits besides their nutritional value. physiologic profits of functional foods are provided by adding new (e.g., probiotics or postbiotics) or already present ingredients. the favorable safety profile of postbiotics makes them rational candidates for use in functional foods. when discussing the clinical use of postbiotics, one cannot ignore galactosyllactose ( '-gl), which is formed as a result of fermentation of human milk oligosaccharides (hmos) and can therefore be classified as postbiotic. in addition to immunomodulatory activity, '-gl also has natural anti-inflammatory properties and improves intestinal barrier integrity [ ] . as bacteria, along with their fragments and metabolites, are passed to the baby in the mother's milk, such a complex mixture cannot obviously be replaced by a single substance. however, combining prebiotics, postbiotics, and hmos into one preparation is a tempting concept for mapping the composition and properties of natural human milk. in addition, functional foods could be enriched with postbiotics to increase the host's immune activity. for example, the cell-free fraction of fermented milk prevented salmonella infection in a mouse model [ ] . it is worth mentioning that the effectiveness of the postbiotics used in the abovementioned study was equivalent for preparations produced on both laboratory and industrial scales. postbiotics from b. breve and streptococcus thermophilus are currently used in the production of functional foods (particularly for modified milk), and their efficacy assessed in randomized clinical trials. for example, b. breve and s. thermophilus postbiotics reduced the incidence of symptoms suggestive of food or inhalation allergy in the first months of life in children with a positive history of atopy, and the effect persisted after discontinuation of the preparation [ ] . the use of the above postbiotics was also associated with a milder course of acute diarrhea in infants [ ] . notably, one of the active metabolites of s. thermophilus is the abovementioned '-gl [ ] . postbiotics are considered may be a viable therapeutic option for allergic diseases, as they can restore the balance of th /th -mediated immune responses and support maturation of the immune system. indeed, available data support the use of postbiotics in preventing asthma/wheezing exacerbations in children [ , ] . in addition, the severity of atopic dermatitis symptoms was inversely proportional to the number of butyrate-producing bacteria in the intestine [ ] , and the oral intake of bls was associated with better results of atopic dermatitis treatment in children [ ] . finally, postbiotics may have beneficial effects in food allergies. a clinical study of over children showed that the presence of a rich butyrate-producing bacterial microbiota was associated with an earlier resolution of cow's milk allergy [ ] . postbiotics play a vital role in the maturation of the immune system, affect barrier tightness and the intestinal ecosystem, and indirectly shape the structure of the microbiota. as such, postbiotics may be useful in treating or preventing many disease entities, including those for which effective causal therapy has not yet been found (e.g., alzheimer's disease, inflammatory bowel disease, or multiple sclerosis). indeed, clinical trials aimed at modifying the microbiota of patients suffering from the abovementioned diseases are currently underway, and the first results are promising [ , ] . postbiotics may be particularly useful in infants, as the first months of life are critical for developing the proper structure of the microbiota. as the microbiota "matures" up to about three years of age [ ] , any abnormalities can be associated with short-and long-term consequences (e.g., necrotizing enterocolitis and asthma, respectively) [ ] . creating the appropriate environment for the formation of the correct microbiota appears crucial for the proper development and preservation of the child's future well-being, and postbiotics can provide such conditions. postbiotics may also be useful in the prevention and treatment of sars-cov- infection, as the structure and metabolic activity of the intestinal microbiome may be related to the occurrence of biomarkers predicting the severe coronavirus disease (covid- ) course [ ] . the potential value of postbiotics is not limited to therapeutic applications. indeed, the emergence of biological doping (and its detection) is an area of interest. a recent study in mice showed that the presence of bacteria of the genus veillonella in the gut, which can metabolize lactic acid to propionate, significantly increased the animals' physical performance [ ] . a similar result was obtained by the enteral administration of propionic acid, indicating the possibility of using postbiotics to modify physical fitness and the independence of the observed effect from the presence of bacteria [ ] . the use of metabolites or fragments derived from microorganisms (i.e., "postbiotics") is an attractive therapeutic and preventive strategy in modern medicine. according to current data, such postbiotics have pleiotropic effects, including immunomodulatory, anti-inflammatory, antioxidant, and anti-cancer properties. some of these properties are even in clinical use. the boundary between probiotics and postbiotics is blurred in some trials, as their impact on the results is often not evaluated separately. we expect further research into the biological activities of these metabolites will unveil novel uses for postbiotics in medicine and beyond. funding: the financial support for the language assistance was provided by nutricia poland. the authors thank proper medical writing, warsaw, poland, for the language assistance provided in the preparation of this paper. conflicts of interest: m.r. received speaker's honoraria from nutricia, bayer ag. w.f. received speaker's honoraria from nutricia, bayer ag, vifor, ranbaxy. j.Ż. and a.m. declare no conflict of interest. the funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. the composition of the gut microbiota throughout life, with an emphasis on early life the maternal gut microbiome during pregnancy. mcn am making sense of the microbiome in psychiatry systematic review with meta-analysis: the efficacy of probiotics in inflammatory bowel disease systematic review with meta-analysis: lactobacillus rhamnosus gg for treating acute gastroenteritis in children-a update probiotic supplements might not be universally-effective and safe: a review what else? benef. microbes rational identification of diet-derived postbiotics for improving intestinal microbiota function probiotic cell-free supernatants exhibited anti-inflammatory and antioxidant activity on human gut epithelial cells and macrophages stimulated with lps cell-free supernatants from probiotic lactobacillus casei and lactobacillus rhamnosus gg decrease colon cancer cell invasion in vitro antioxidant properties of potentially probiotic bacteria: in vitro and in vivo activities probiotic bacteria and their supernatants protect enterocyte cell lines from enteroinvasive escherichia coli (eiec) invasion postbiotic l. plantarum rg improves ruminal epithelium growth, immune status and upregulates the intestinal barrier function in post-weaning lambs effects of saccharomyces cerevisiae or boulardii yeasts on acute stress induced intestinal dysmotility saccharomyces boulardii improves intestinal cell restitution through activation of the alpha beta integrin collagen receptor food and health potentials of exopolysaccharides derived from lactobacilli enhanced natural killer cell activation by exopolysaccharides derived from yogurt fermented with lactobacillus delbrueckii ssp. bulgaricus oll r- characterization and immunomodulatory activity of an exopolysaccharide produced by lactobacillus plantarum jlk isolated from fermented dairy tofu immunostimulatory activity of exopolysaccharides from probiotic lactobacillus casei wxd strain as a novel adjuvant in vitro and in vivo probiotic properties of exopolysaccharide-producing lactobacillus strains isolated from tempoyak structural elucidation and antioxidant activities of exopolysaccharides from lactobacillus helveticus mb - kefiran reduces atherosclerosis in rabbits fed a high cholesterol diet effects of an exopolysaccharide (kefiran) on lipids, blood pressure, blood glucose, and constipation dectin- is a major beta-glucan receptor on macrophages orally administered particulate beta-glucan modulates tumor-capturing dendritic cells and improves antitumor t-cell responses in cancer glucan supplementation enhances the immune response against an influenza challenge in mice naturally occurring -substituted ( , )-β-d-glucan producing lactobacillus suebicus and pediococcus parvulus strains with potential utility in the production of functional foods exopolysaccharides from milk fermented by lactic acid bacteria enhance dietary carotenoid bioavailability in humans in a randomized crossover trial and in rats β-glucan-based cream (containing pleuran isolated from pleurotus ostreatus) in supportive treatment of mild-to-moderate atopic dermatitis two antioxidative lactobacilli strains as promising probiotics dietary postbiotic lactobacillus plantarum improves serum and ruminal antioxidant activity and upregulates hepatic antioxidant enzymes and ruminal barrier function in post-weaning lambs use of superoxide dismutase and catalase producing lactic acid bacteria in tnbs induced crohn's disease in mice lactobacilli with superoxide dismutase-like or catalase activity are more effective in alleviating inflammation in an inflammatory bowel disease mouse model. drug des oral administration of a catalase-producing lactococcus lactis can prevent a chemically induced colon cancer in mice antibiotic-induced release of lipoteichoic acid and peptidoglycan from staphylococcus aureus: quantitative measurements and biological reactivities lipoteichoic acid isolated from lactobacillus plantarum inhibits lipopolysaccharide-induced tnf-alpha production in thp- cells and endotoxin shock in mice bacterial teichoic acids reverse predominant il- production induced by certain lactobacillus strains into predominant il- production via tlr -dependent erk activation in macrophages induction of intestinal pro-inflammatory immune responses by lipoteichoic acid antimicrobial peptides and skin immune defense system commensal bacteria lipoteichoic acid increases skin mast cell antimicrobial activity against vaccinia viruses enhancement of anti-cancer immunity by a lipoteichoic-acid-related molecule isolated from a penicillin-killed group a streptococcus anti-inflammatory potential of probiotics: lipoteichoic acid makes a difference sodium butyrate inhibits the nf-kappa b signaling pathway and histone deacetylation, and attenuates experimental colitis in an il- independent manner butyrate inhibits nf-kappa b activation in lamina propria macrophages of patients with ulcerative colitis interactions between roseburia intestinalis and diet modulate atherogenesis in a murine model a proliferative probiotic bifidobacterium strain in the gut ameliorates progression of metabolic disorders via microbiota modulation and acetate elevation the short-chain fatty acid acetate reduces appetite via a central homeostatic mechanism acetate-producing bifidobacteria protect the hose for enteropathogenic infection via carbohydrate transporters study of the mechanism of inhibition of ketogenesis by propionate in bovine liver. can anti-inflammatory properties of the short-chain fatty acids acetate and propionate: a study with relevance to inflammatory bowel disease bang oturai, a. short-chain fatty acids and gut microbiota in multiple sclerosis probiotic-induced suppression of allergic sensitization and airway inflammation is associated with an increase of t regulatory-dependent mechanisms in a murine model of asthma immunoregulatory and immunostimulatory responses of bacterial lysates in respiratory infections and asthma immunostimulation with om- in children with recurrent infections of the upper respiratory tract: a double-blind, placebo-controlled multicenter study broncho-vaxom in pediatric recurrent respiratory tract infections: a systematic review and meta-analysis bacterial lysate add-on therapy for the prevention of wheezing episodes and asthma exacerbations: a systematic review and meta-analysis mechanical bacterial lysate administration prevents exacerbation in allergic asthmatic children-the eolia study bacterial lysates as a potentially effective approach in preventing acute exacerbation of copd clinical and immunological benefits of om- bacterial lysate in patients with allergic rhinitis, asthma, and copd and recurrent respiratory infections adjuvant treatment with the bacterial lysate (om- ) improves management of atopic dermatitis: a randomized study effect of heat-killed lactobacillus paracasei kw ingestion on ocular disorders caused by visual display terminal (vdt) loads: a randomized, double-blind, placebo-controlled parallel-group study folic acid in stroke prevention in countries without mandatory folic acid food fortification: a meta-analysis of randomized controlled trials bacterial folate biosynthesis and colorectal cancer risk: more than just a gut feeling antioxidative potential of folate producing probiotic lactobacillus helveticus cd genomic analysis reveals lactobacillus sanfranciscensis as stable element in traditional sourdoughs plasma cobalamin and folate and their metabolic markers methylmalonic acid and total homocysteine among egyptian children before and after nutritional supplementation with the probiotic bacteria lactobacillus acidophilus in yoghurt matrix fecal concentrations of bacterially derived vitamin k forms are associated with gut microbiota composition but not plasma or fecal cytokine concentrations in healthy adults gut microbial metabolites of aromatic amino acids as signals in host-microbe interplay modulation of a circulating uremic solute via rational genetic manipulation of the gut microbiota where to look into the puzzle of polyphenols and health? the postbiotics and gut microbiota associated with human metabotypes the gut microbiota: a key factor in the therapeutic effects of (poly)phenols urolithin a exerts antiobesity effects through enhancing adipose tissue thermogenesis in mice the mitophagy activator urolithin a is safe and induces a molecular signature of improved mitochondrial and cellular health in humans effects of equol supplement on bone and cardiovascular parameters in middle-aged japanese women: a prospective observational study natural s-equol decreases bone resorption in postmenopausal, non-equol-producing japanese women: a pilot randomized commensal microbe-derived butyrate induces the differentiation of colonic regulatory t cells metabolites produced by commensal bacteria promote peripheral regulatory t-cell generation ganedenbc ™ cell wall and metabolites: anti-inflammatory and immune modulating effects in vitro supernatant from bifidobacterium differentially modulates transduction signaling pathways for biological functions of human dendritic cells bifidobacterium breve and streptococcus thermophilus secretion products enhance t helper immune response and intestinal barrier in mice milk fermented by propionibacterium freudenreichii induces apoptosis of hgt- human gastric cancer cells prevention of rotavirus diarrhea in suckling rats by a specific fermented milk concentrate with prebiotic mixture cow's milk and rice fermented with lactobacillus paracasei cba l prevent infectious diseases in children: a randomized controlled trial postbiotics for preventing and treating common infectious diseases in children: a systematic review preventive effect of cow's milk fermented with lactobacillus paracasei cba l on common infectious diseases in children: a multicenter randomized controlled trial modulation of distal colonic epithelial barrier function by dietary fibre in normal rats protective role of postbiotic mediators secreted by lactobacillus rhamnosus gg versus lipopolysaccharide-induced damage in human colonic smooth muscle cells fragmented lactic acid bacterial cells activate peroxisome proliferator-activated receptors and ameliorate dyslipidemia in obese mice effects of targeted delivery of propionate to the human colon on appetite regulation, body weight maintenance and adiposity in overweight adults the immune receptor nod and kinase rip interact with bacterial peptidoglycan on early endosomes to promote autophagy and inflammatory signaling lactobacillus fermentum postbiotic-induced autophagy as potential approach for treatment of acetaminophen hepatotoxicity microbial lysate upregulates host oxytocin addressing the antibiotic resistance problem with probiotics: reducing the risk of its double-edged sword effect human milk oligosaccharides and synthetic galactosyloligosaccharides contain '-, -, and '-galactosyllactose and attenuate inflammation in human t , ncm- , and h cells and intestinal tissue ex vivo postbiotics produced at laboratory and industrial level as potential functional food ingredients with the capacity to protect mice against salmonella infection a non-hydrolyzed, fermented milk formula reduces digestive and respiratory events in infants at high risk of allergy effects of long-term consumption of a fermented infant formula (with bifidobacterium breve c and streptococcus thermophilus ) on acute diarrhea in healthy infants dung ta, c. identification and synthesis of a trisaccharide produced from lactose by transgalactosylation nonspecific immunomodulators for recurrent respiratory tract infections, wheezing and asthma in children: a systematic review of mechanistic and clinical evidence severity of atopic disease inversely correlates with intestinal microbiota diversity and butyrate-producing bacteria early-life gut microbiome composition and milk allergy resolution alteration of gut microbiota in inflammatory bowel disease (ibd): cause or consequence? ibd treatment targeting the gut microbiome how baby's first microbes could be crucial to future health gut microbiota may underlie the predisposition of healthy individuals to covid- meta-omics analysis of elite athletes identifies a performance-enhancing microbe that functions via lactate metabolism this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license key: cord- -pcp i vb authors: troesch, barbara; eggersdorfer, manfred; laviano, alessandro; rolland, yves; smith, a. david; warnke, ines; weimann, arved; calder, philip c. title: expert opinion on benefits of long-chain omega- fatty acids (dha and epa) in aging and clinical nutrition date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: pcp i vb life expectancy is increasing and so is the prevalence of age-related non-communicable diseases (ncds). consequently, older people and patients present with multi-morbidities and more complex needs, putting significant pressure on healthcare systems. effective nutrition interventions could be an important tool to address patient needs, improve clinical outcomes and reduce healthcare costs. inflammation plays a central role in ncds, so targeting it is relevant to disease prevention and treatment. the long-chain omega- polyunsaturated fatty acids (omega- lcpufas) docosahexaenoic acid (dha) and eicosapentaenoic acid (epa) are known to reduce inflammation and promote its resolution, suggesting a beneficial role in various therapeutic areas. an expert group reviewed the data on omega- lcpufas in specific patient populations and medical conditions. evidence for benefits in cognitive health, age- and disease-related decline in muscle mass, cancer treatment, surgical patients and critical illness was identified. use of dha and epa in some conditions is already included in some relevant guidelines. however, it is important to note that data on the effects of omega- lcpufas are still inconsistent in many areas (e.g., cognitive decline) due to a range of factors that vary amongst the trials performed to date; these factors include dose, timing and duration; baseline omega- lcpufa status; and intake of other nutrients. well-designed intervention studies are required to optimize the effects of dha and epa in specific patient populations and to develop more personalized strategies for their use. life expectancy is increasing globally [ ] and the prevalence of age-and lifestyle-related non-communicable diseases (ncds), such as cancer, heart disease, respiratory disease, type diabetes, obesity, chronic kidney disease and dementia is rising [ , ] . this has led patients to present with multiple co-morbidities [ , ] creating more complex needs (e.g., need for multiple medications), putting significant pressure on healthcare and social systems. undernutrition and overnutrition can both seriously impact an individual's risk for developing an ncd [ , ] . there is therefore a growing demand for appropriate nutrition interventions and targeted medical nutrition supplements or formulas to address patient needs, improve outcomes and help to reduce the costs of healthcare. inflammation is considered to play a central role in age-and lifestyle-related ncds [ ] , in loss of muscle mass and strength (sarcopenia) in frailty and cancer [ ] [ ] [ ] , and in the response to surgery and in critical illness [ ] . hence, targeting inflammation is thought to be appropriate to disease prevention and treatment. the long-chain omega- polyunsaturated fatty acids (lcpufas) docosahexaenoic acid (dha) and eicosapentaenoic acid (epa) are known to have roles in supporting human health [ ] , with one of their primary actions being to reduce inflammation [ ] [ ] [ ] and promote its resolution [ ] [ ] [ ] . this suggests a broad role for dha and epa in prevention and treatment of disease including, but not restricted to, specific therapeutic areas such as age-related decline in muscle mass, oncology, perioperative care and cognitive health. humans, like all mammals, cannot synthesize the essential omega- fatty acid α-linolenic acid. furthermore, endogenous synthesis of epa and dha from α-linolenic acid is described as being poor in most humans [ ] and is influenced by a range of factors such as age, sex, genetics and disease [ ] . therefore, preformed epa and dha must be obtained from the diet or supplements. it is now generally accepted that an intake of at least mg epa and dha per day is required for optimal nutrition [ ] [ ] [ ] [ ] , although the exact intake required for specific populations or health conditions is not known and in many cases is likely to be in excess of this suggested minimum intake. blood levels of epa and dha are highly related to intakes [ ] . global mapping indicated low or even very low blood levels of omega- lcpufas (i.e., dha and epa) in a large proportion of people for whom data were available [ ] , suggesting low intakes in those populations. reliance on endogenous synthesis of epa and dha is challenged by the low activity of this pathway [ ] which is further impaired in conditions such as insulin resistance [ ] . therefore, the benefits of dha and epa might be particularly pronounced in those population groups with insulin resistance or other features that limit endogenous synthesis. the anti-inflammatory and inflammation resolving effects of dha and epa have been shown to be relevant to improved clinical outcomes in a number of specific therapeutic areas [ ] [ ] [ ] [ ] [ ] [ ] ] . furthermore, evidence suggests that dha and epa support independence in the older population, improving quality of life and significantly lowering healthcare costs [ ] . moreover, they appear to be crucial for a well-functioning immune system [ ] and play an essential role in the maintenance of muscle mass and function [ ] , both important considerations for older people. adequate supply with dha and epa should therefore be seen as a critical component of both the prevention and treatment of many, but particularly age-related, conditions. this review aims to summarize the available evidence for dha and epa to promote healthy aging and to improve prognosis in a selection of medical conditions as discussed at an expert group meeting in september . dha and epa appear to act via overlapping, as well as distinct, mechanisms of action, modifying cellular function to benefit overall health and wellbeing, as well as to reduce the risk and severity of disease; these mechanisms are discussed in detail elsewhere [ , , ] . it is their membrane-mediated mechanisms that are most well established and understood [ ] [ ] [ ] [ ] and it is considered that through alterations at the membrane level in different cell and tissue types, dha and epa play an important role in cell signaling, gene expression and lipid mediator production [ ] . these mechanisms are quite well explored in the context of omega- lcpufa regulation of inflammatory processes, as described in detail elsewhere [ ] [ ] [ ] (figure ). for example, increased intake of epa and dha results in enhanced appearance of those fatty acids in the membrane phospholipids of cells involved in inflammation (see [ ] [ ] [ ] for references). this has multiple effects. firstly, cell membranes become more fluid, affecting the behavior of several membrane proteins, including their aggregation into signaling platforms, so-called lipid rafts (see [ ] [ ] [ ] for references). as a result, transmission of inflammatory signals within cells, for example from lipopolysaccharide or saturated fatty acids, becomes blunted, resulting in reduced activation of pro-inflammatory transcription factors like nuclear factor kappa-light-chain-enhancer of activated b cells (nfκb) (see [ ] [ ] [ ] for references). such transcription factors control expression of genes encoding many cytokines, chemokines, adhesion molecules, inflammatory enzymes (e.g., cyclooxygenase- ) and proteases. thus, though these effects are initiated at the cell membrane level, omega- lcpufas can affect multiple inflammatory mediators and their anti-inflammatory actions could be wide-ranging as a result. the second effect of increased epa and dha in the membranes of inflammatory cells is that they partially replace the omega- pufa arachidonic acid (see [ ] [ ] [ ] for references). arachidonic acid is the usual substrate for cyclooxygenase, lipoxygenase and cytochrome p enzymes producing eicosanoids [ , ] ; these eicosanoids (e.g., prostaglandin e , leukotriene b ) are recognized mediators of inflammation [ ] . therefore, through the epa-and dha-mediated decrease in arachidonic acid availability, production of these inflammatory eicosanoids is decreased (see [ ] [ ] [ ] for references). the third effect of increased epa and dha in the membranes of inflammatory cells is that they can be released upon cellular activation. the "free" epa and dha can then have further actions. for example, they can act as ligands and activators for anti-inflammatory transcription factors such as peroxisome proliferator activated receptors (see [ ] [ ] [ ] for references) and they can act as substrates for synthesis of eicosanoid and docosanoid lipid mediators. eicosanoids formed from epa such as prostaglandin e and leukotriene b often have only weak pro-inflammatory activity (see [ ] [ ] [ ] for references). however, probably more importantly, both dha and epa are substrates for the synthesis of highly active lipid mediators important in the resolution of inflammatory processes, including resolvins, protectins and maresins [ , ] . together, these mediators have been termed specialized pro-resolving mediators, and they have been shown in many cell culture and animal-based models to terminate inflammatory processes by decreasing cellular activation and the production of inflammatory cytokines, chemokines, adhesion molecules, proteases and enzymes (see [ , ] for references). nutrients , , x for peer review of inflammatory processes, as described in detail elsewhere [ ] [ ] [ ] (figure ). for example, increased intake of epa and dha results in enhanced appearance of those fatty acids in the membrane phospholipids of cells involved in inflammation (see [ ] [ ] [ ] for references). this has multiple effects. firstly, cell membranes become more fluid, affecting the behavior of several membrane proteins, including their aggregation into signaling platforms, so-called lipid rafts (see [ ] [ ] [ ] for references). as a result, transmission of inflammatory signals within cells, for example from lipopolysaccharide or saturated fatty acids, becomes blunted, resulting in reduced activation of pro-inflammatory transcription factors like nuclear factor kappa-light-chain-enhancer of activated b cells (nfκb) (see [ ] [ ] [ ] for references). such transcription factors control expression of genes encoding many cytokines, chemokines, adhesion molecules, inflammatory enzymes (e.g., cyclooxygenase- ) and proteases. thus, though these effects are initiated at the cell membrane level, omega- lcpufas can affect multiple inflammatory mediators and their anti-inflammatory actions could be wide-ranging as a result. the second effect of increased epa and dha in the membranes of inflammatory cells is that they partially replace the omega- pufa arachidonic acid (see [ ] [ ] [ ] for references). arachidonic acid is the usual substrate for cyclooxygenase, lipoxygenase and cytochrome p enzymes producing eicosanoids [ , ] ; these eicosanoids (e.g., prostaglandin e , leukotriene b ) are recognized mediators of inflammation [ ] . therefore, through the epa-and dha-mediated decrease in arachidonic acid availability, production of these inflammatory eicosanoids is decreased (see [ ] [ ] [ ] for references). the third effect of increased epa and dha in the membranes of inflammatory cells is that they can be released upon cellular activation. the "free" epa and dha can then have further actions. for example, they can act as ligands and activators for anti-inflammatory transcription factors such as peroxisome proliferator activated receptors (see [ ] [ ] [ ] for references) and they can act as substrates for synthesis of eicosanoid and docosanoid lipid mediators. eicosanoids formed from epa such as prostaglandin e and leukotriene b often have only weak proinflammatory activity (see [ ] [ ] [ ] for references). however, probably more importantly, both dha and epa are substrates for the synthesis of highly active lipid mediators important in the resolution of inflammatory processes, including resolvins, protectins and maresins [ , ] . together, these mediators have been termed specialized pro-resolving mediators, and they have been shown in many cell culture and animal-based models to terminate inflammatory processes by decreasing cellular activation and the production of inflammatory cytokines, chemokines, adhesion molecules, proteases and enzymes (see [ , ] for references). the foregoing discussion has emphasized the importance of the incorporation of dha and epa into cell membranes in order to elicit their anti-inflammatory and inflammation resolving actions. in this regard, it is important to recognize that the incorporation of dha and epa into the membrane phospholipids of cells involved in inflammatory responses, and into other cells and tissues such as skeletal muscle, is dose-dependently related to their intake (see [ ] [ ] [ ] for references). it is possible that the membrane changes induced by low intakes of dha and epa are insufficient to significantly alter cell and tissue function and therefore no biological or clinical impact would be observed. thus, the dose of dha and epa used in human studies is likely to be important in terms of determining the effect seen and too low a dose could result in the absence of an effect. with the increasingly aging population, cognitive decline has become a growing public health concern: the number of persons living with dementia is expected to nearly double every years [ ] . increasing evidence indicates that poor status of essential nutrients such as omega- lcpufas is associated with increased risk of cognitive decline and of developing alzheimer's disease [ ] . dha is a major fatty acid in membrane phospholipids in the grey matter of the brain and makes up approximately % of total fatty acids in the human cerebral cortex and % of all polyunsaturated fatty acids in the central nervous system [ , [ ] [ ] [ ] . brain dha levels decrease with adult age [ ] and seem to be particularly low among alzheimer's patients [ ] . it is conceivable that low brain dha contributes to the decrease in cognitive functions observed with advancing age in general and to a greater degree in dementia [ , ] . the link between low omega- lcpufa status and the risk of cognitive decline is supported by the observation that a higher proportion of total omega- lcpufas in the membranes of erythrocytes, considered to be a marker of both intake and status of these fatty acids, was associated with a reduced risk of developing cognitive decline in a french cohort [ ] . assessment of individuals with alzheimer's disease showed lower omega- lcpufa intakes and plasma phosphatidylcholine levels compared to healthy controls, but the study design did not allow to draw conclusions on causality [ ] . higher dha in plasma phosphatidylcholine was also associated with a % reduction in the risk of developing all-cause dementia (rr = . , % ci . - . ; p = . ) and a % reduction in risk of alzheimer's disease (rr = . , % ci . - . ; p = . ) in a cohort from the framingham heart study [ ] . the study also showed that higher dietary dha intake was associated with a non-significantly lower risk of developing dementia in general and alzheimer's disease in particular (upper quartile versus lower three quartiles: rr = . , % ci . a meta-analysis of observational studies showed a positive association of dha intake or plasma levels with memory in adults in general [ ]. the observational studies described above cannot establish a causal link and therefore intervention trials with omega- lcpufas are important to verify that these fatty acids can beneficially modify cognitive decline. findings from such intervention trials with omega- lcpufas are not consistent [ ] . however, there are relatively few trials and these differ in the dose of dha and epa and type of placebo used, the duration of supplementation, sample size, the severity of cognitive decline at baseline as well as the omega- lcpufa status of the participants (where this was even assessed) and the cognitive outcomes/tests used. supplementation with omega- lcpufas had a small effect on memory [ ] and executive function [ ] in non-demented older people. a meta-analysis of three randomized, placebo-controlled trials with omega- lcpufa supplements found no effect on severity of dementia, quality of life or mental health in patients with mild or moderate alzheimer's disease over , and months [ ] . intake of mg epa and mg dha per day for four months showed no effect on cognition or mood in individuals with alzheimer's disease [ , ] . however, this was a very small study and it has also been suggested that olive oil, which was used as a placebo, may have a protective effect for alzheimer's disease [ ] and might therefore have masked the effect of the supplementation with omega- lcpufas. similarly, an intervention comparing mg epa plus mg dha daily for months compared to olive oil did not find an effect on the california verbal learning test in cognitively healthy older adults (mean age years) [ ] . daily supplementation with mg dha and mg epa for six months did not affect the mini-mental state examination (mmse) score in acetylcholine esterase inhibitor treated patients with alzheimer's disease compared to a placebo [ ] . however, the intervention had a significant effect on cognitive functioning measured with the alzheimer's disease assessment scores as well as the sub-items, and a correlation was found with the increase in plasma omega- lcpufas [ ] . this suggests that the effect of omega- lcpufas depends on the specific aspect of cognitive health assessed. moreover, subgroup analysis showed a benefit of omega- lcpufas in the group with very mild cognitive decline (mmse score > ) at baseline [ ] . this is in line with the results from other trials indicating that interventions with dha and epa are less likely to have a beneficial effect on individuals experiencing dementia that has progressed beyond the mild stage [ , [ ] [ ] [ ] [ ] . a recent systematic review also reached the conclusion that the most beneficial effect of epa and dha supplementation in alzheimer's patients can be expected in the early stage of the disease [ ] . while individuals with mild cognitive decline are a promising target group, it might make sense to start the intervention even earlier, in older individuals with subjective cognitive decline [ ] . it has been shown that supplementation in healthy older people has a beneficial effect on white matter microstructural integrity, grey matter volume in specific brain areas and vascular parameters accompanied by improved executive function [ ] . this indicates that there might be a potential for preventive uses of omega- lcpufas to maintain cognitive health in older people. however, such an effect is difficult to show as the decrease over time in the placebo group will likely be too small to show a significant difference between the groups as seen in a supplementation trial in cognitively healthy older people [ ] . therefore, careful selection of the study population is required to find the window of opportunity during which the disease has not progressed too far but is already accelerating at a sufficient speed to be able to detect a difference in the decline between the intervention and the placebo groups. the multidomain alzheimer preventive trial (mapt) assessed whether a multimodal intervention consisting of nutritional counseling, physical exercise and cognitive stimulation, in combination with dha and epa, is effective in slowing cognitive decline in older at-risk adults [ ] . three years supplementation with mg dha and mg epa showed no significant effect on cognitive decline in older people with memory complaints [ ] . however, in a subgroup analysis only including individuals with low omega- lcpufa status at baseline, the supplementation had a beneficial effect on cognition [ ] . this indicates that people with low intakes or status of dha and epa should be targeted with such interventions as they may be more likely to experience the greatest benefit. not surprisingly, the dose of dha and epa provided in the intervention group also plays an important role and doses below mg have not had a major effect on cognitive health in older people with some degree of cognitive decline [ ] . several trials investigating the effect of omega- lcpufas on cognitive outcomes, including decline, have been relatively short, perhaps too short to significantly affect these outcomes. it has even been suggested that the three years of supplementation evaluated in the mapt might have been too short [ ] . as neurodegeneration develops over a considerable time, longer-term intervention might be required for a benefit to manifest. a systematic review and meta-analysis of available data from animal studies suggest > % of average total lifespan interventions had significant effects on cognitive function, neuronal loss and the amount of amyloid-beta deposits in the brain [ ] , but this period is considerably longer than the interventions in humans performed to date. in addition to omega- lcpufa dose, study duration and the rate of cognitive decline, other factors may also be relevant to whether an effect of these fatty acids is seen. these include the status of other nutrients and an individual's genotype. a re-analysis of the patients assessed in the omegad trial [ , ] found that those with low blood homocysteine, indicating good b vitamin status, benefitted cognitively and clinically from the combined dha and epa treatment, whereas those with high homocysteine did not [ ] . similarly, it had been shown that those older people with mild cognitive impairment who had the highest levels of plasma omega- lcpufas benefited most from supplementation with b vitamins [ , ] . in addition, adequate intake and status of antioxidants might be required for an optimal effect of dha and epa on cognitive health [ ] . it has been well established that apolipoprotein e (apoe) is a very important genetic risk factor for age-dependent chronic diseases, including alzheimer's disease [ ] , but not all trials have controlled for this. due to two major polymorphisms on the encoding exon of this gene, three major protein isoforms, apoe ε , apoe ε and apoe ε , exist [ ] . clinical and preclinical evidence suggests that carriers of apoe ε are at a higher risk of low omega- lcpufa status [ ] . moreover, it has been shown that homozygous carriers of the apoe ε allele have a more than -fold increased risk of developing alzheimer's disease, possibly due to increased cholesterol levels, altered brain development early in life [ ] or increased oxidative brain damage [ ] . a meta-regression by zhang et al. [ ] showed that stratification by apoe ε genotype had a significant effect on the association between dha, but not epa, intake and cognitive impairment. another analysis found a beneficial effect of omega- lcpufa supplementation on the progression of cognitive decline at an early stage in those with the apoe ε genotype [ ]. thus, individuals with certain genotypes may benefit more from omega- lcpufas than those with other genotypes. in summary, there is good evidence from observational studies for an association between dha and slower cognitive decline or reduced risk of alzheimer's disease. intervention trials are less clear, but there is some evidence that dha and epa can prevent or slow cognitive decline, particularly in the early stages. the inconsistent findings from trials likely relate to a number of factors including dose, duration and timing of the intervention, stage and rate of cognitive decline, status of other relevant nutrients (e.g., b vitamins) and genotype. with increasing age, achieving adequate intake of energy and essential nutrients becomes challenging due to alterations to appetite (anorexia of aging) and gastrointestinal physiology [ , ] . in addition, aging can affect dentition, gum and mouth health, and swallowing, so reducing food intake. cognitive decline, systemic disease and use of some medications can also impact food intake. reduced mobility, increased isolation and limited finances can restrict access to food in older people. as a consequence of these factors, malnutrition (i.e., undernutrition), frailty and sarcopenia are common and frequently overlapping conditions in older people [ ] [ ] [ ] . malnutrition is defined by espen as "a state resulting from lack of intake or uptake of nutrition that leads to altered body composition (decreased fat free mass) and body cell mass leading to diminished physical and mental function and impaired clinical outcome from disease" [ ] . inflammation is an important contributor to the outcome of malnutrition. espen recognizes disease-related malnutrition with inflammation as "a catabolic condition characterized by an inflammatory response, including anorexia and tissue breakdown, elicited by an underlying disease" [ ] . frailty is a state of vulnerability with limited reserve capacity in major organ systems; it involves weight loss, fatigue, low physical activity, slowness and weakness [ ] . frailty is associated with a higher risk of adverse outcomes such as falls, fractures, hospitalization and disability [ ] [ ] [ ] . in older inpatients, frailty was found to be a risk factor for increased length of hospital stay and mortality [ , ] as well as postoperative complications [ ] . moreover, frail patients were more likely to be discharged into care homes after hospitalization [ ] . a decrease in muscle mass was found to be a strong predictor of prognosis in hospitalized older people [ ] . sarcopenia is characterized by the progressive and generalized loss of skeletal muscle mass, strength and function with a consequent increased risk of adverse outcomes; the european working group on sarcopenia in older people defines sarcopenia as "a progressive and generalized skeletal muscle disorder that involves the accelerated loss of muscle mass and function" [ ] . sarcopenia is often part of the aging process preceding the onset of frailty. age-related chronic low-grade inflammation may be an important contributor to sarcopenia [ , , ] . sarcopenia seems to increase the likelihood of adverse outcomes such as disability, poor quality of life and death [ ] [ ] [ ] . both muscle mass and strength were predictive for difficulties in performing activities of daily living after discharge from the hospital [ ] . sarcopenia and particularly sarcopenic obesity (i.e., low muscle mass in association with greater fat mass), have been linked to poorer prognosis, including survival, for a range of cancers [ ] [ ] [ ] [ ] [ ] . pro-inflammatory cytokines have been linked to muscle wasting [ ] , and consequently, the anti-inflammatory effects of omega- lcpufas may be beneficial to prevent the loss of muscle mass and strength associated with aging, sarcopenia and frailty. furthermore, omega- lcpufas may themselves modulate muscle protein synthesis, promoting muscle strength and function [ , ] , likely as a result of their incorporation into membrane phospholipids of the sarcolemma and intracellular organelles [ ] . maintenance of, or an increase in, muscle mass and function seem to be key for healthy aging [ , ] , and also in recovery after surgery or during an intensive care unit (icu) stay [ ] . long-term supplementation with dha and epa in older people is therefore of increasing interest as the medical community looks for safe and affordable ways to slow physical disability and improve quality of life in older individuals. results from cross-sectional and longitudinal observational studies demonstrate that low plasma dha and epa levels are associated with poorer physical performance in older adults [ ] . daily supplementation with mg/d dha and mg/d epa for six months in healthy older men and women increased thigh muscle volume ( . %, % ci . % to . %, p < . ), handgrip strength ( . kg, % ci . to . kg, p < . ) and one-repetition muscle strength ( . %, % ci . % to . %, p < . ) and showed a trend towards increased average isokinetic power ( . %, % ci . % to . %, p = . ) compared to a control group [ ] . the intervention had no significant effect on body weight, total-body fat mass or the intermuscular fat content and raised no safety concerns [ ] . in post-menopausal women aged > years, supplementation with mg/d epa and mg/d dha for six months showed a positive effect on walking speed compared to the placebo group ( . ± % vs. − . ± %, p = . ) [ ] . supplementation for weeks with mg/d dha and mg/d epa in women aged to years resulted in a significant increase in lean body mass, increased resting metabolic rate and fat oxidation as well as decreasing time-to-get-up-and-go as a functional capacity measure [ ] . however, weeks supplementation with mg/d dha and mg/d epa had no effect on muscle mass or handgrip strength in community-dwelling older people (mean age . ± . years) [ ] . in another study, mg/d dha and mg/d epa in combination with physical exercise, cognitive training and nutritional counseling had no effect on different measures of muscle strength in older people [ ] . based on the evidence from these trials, doses of mg/d of dha plus epa or more (with preferably more than mg/d epa) may be required for positive effects on physical performance in older adults [ , ] as lower doses have not had an effect [ , ] . furthermore, the optimal ratio between dha and epa is not known and may differ between specific indications as different body compartments require distinct levels of omega- lcpufas (e.g., the brain is rich in dha and poor in epa). the scarcity of data from interventional studies [ ] has prevented the development of strong recommendations on the use of omega- lcpufas in the prevention of sarcopenia so far. more randomized controlled trials, with different duration and doses, are needed to establish their effect on maintaining muscle mass in the elderly and to decrease the risk of sarcopenia and the related adverse effects on health and well-being, including the onset of frailty. cancer is a major public health concern and both the disease and its treatment are associated with decreased quality of life and significant economic burden due to high healthcare cost and loss of productivity. increasing cancer incidence is due to several factors, including population growth and aging, as well as lifestyle and socio-economic factors. various dietary behaviors are thought to be involved in the pathogenesis and progression of some cancers and they play a crucial role in tumor growth and spreading [ ] . two ways by which diet could exert effects in patients with cancer are by enhancing anticancer therapies, mitigating their side effects, and by favoring the resolution of paraneoplastic syndromes, which in turn impact outcome. paraneoplastic syndromes are disorders triggered by an altered immune system response to new or abnormal growth of tissue. cancer cachexia is the most frequent paraneoplastic syndrome in individuals with cancer [ ] . cachexia is a form of disease-related malnutrition with inflammation [ , ] , and involves reduced appetite, altered utilization of nutrients, increased mobilization of amino acids and muscle protein turnover, loss of adipose tissue and infiltration of skeletal muscle with adipose tissue [ ] . left untreated, cachexia can progress in severity and contribute to the negative outcomes experienced by cancer patients, including mortality [ ] . an international consensus of clinical experts defined cancer cachexia as "a multifactorial syndrome defined by an ongoing loss of skeletal muscle mass (with or without loss of fat mass) that cannot be fully reversed by conventional nutritional support and leads to progressive functional impairment" [ ] . the importance of systemic inflammatory responses in cachexia is increasingly recognized, and it has been proposed to include this component in the definition of cancer cachexia [ , ] . further supporting the causative role of inflammation in the pathogenesis and clinical features of cancer cachexia, it has been recently demonstrated that an elevation of the neutrophil-to-lymphocyte ratio, a simple and reliable marker of systemic inflammation, associates with greater weight loss and cachexia in patients with advanced cancer [ ] . it has been proposed that current malnutrition rates in cancer patients are comparable to those > years ago, but they are less apparent as body mass index is often normal or even high, despite prevalence rates of cachexia and sarcopenia of % and % to %, respectively [ ] . it is estimated that cancer cachexia affects around % to % of cancer patients and is responsible for approximately % of deaths in cancer patients [ , ] . low muscle mass has a negative effect on treatment prognosis, resulting in reduced likelihood to complete at least three treatment cycles, more side effects and a lower chance of progression-free survival [ , ] . moreover, it has a negative impact on toxicity of cancer treatment [ ] [ ] [ ] [ ] and tumor progression during chemotherapy [ ] and causes marked distress to patients and their families [ ] . still, it remains underdiagnosed and is often not treated properly as pharmacological therapies mostly fail to improve the condition significantly [ ] . a review of available clinical trials showed that weight loss often starts very early in the disease progression, potentially even before the cancer itself is diagnosed [ ] . the precise mechanisms are poorly understood, but chronic systemic inflammation seems to play a crucial role in most patients [ ] . inflammation is recognized as a hallmark feature of cancer development and progression [ ] and targeting cancer-related inflammation at the local tumor microenvironment as well as in systemic circulation has the potential to favorably affect patient outcomes [ ] . optimal therapy should take into account the progression of the condition from pre-cachexia to cachexia and eventually refractory cachexia [ ] and would ideally involve a multimodal approach including nutritional interventions targeting inflammation and reduced food intake as well as decreased physical function [ , , ] . given their ability to mitigate inflammation, dha and epa interventions in cancer patients have received increasing attention and the mechanisms are reviewed elsewhere [ ] [ ] [ ] [ ] . there is evidence that dha and epa modulate the inflammatory response, measured as cytokines or c-reactive protein, and affect resting energy expenditure in cancer patients [ ] [ ] [ ] [ ] [ ] [ ] . these findings are relevant, as increased levels of inflammation in cancer patients induce changes in pharmacokinetics of some anti-cancer drugs, resulting in slower clearance and increased treatment-related toxicities [ ] . it has further been suggested that omega- lcpufas might play a role in mitigating the negative effect of disease as well as its treatment on gut health and microbiota composition [ ] . in addition, observations of decreasing plasma levels indicate a depletion of epa and dha in cancer patients [ ] . however, the effects of omega- lcpufas on nutritional status or meaningful clinical outcomes, such as quality of life, survival rates and treatment toxicity, are less well documented. based on evidence from different systematic reviews [ , [ ] [ ] [ ] [ ] , the espen guidelines for nutrition in cancer patients state "in patients with advanced cancer undergoing chemotherapy and at risk of weight loss or malnourished, we suggest to use supplementation with long-chain omega- fatty acids or fish oil to stabilize or improve appetite, food intake, lean body mass and body weight" but the recommendation is graded as weak and the level of evidence as low [ ] . a sub-group meta-analysis found a significant effect of high-protein, omega- lcpufa-enriched oral nutritional supplements (ons) when compared with isocaloric controls on body weight (+ . kg, % ci . to . , p = . ) in cancer patients undergoing chemotherapy [ ] . two of the included studies reported an effect on muscle mass: supplementation with an omega- lcpufa-enriched ons ( mg/d dha and mg/d epa) resulted in a decrease in the loss of fat-free mass after three and five weeks in patients with non-small cell lung cancer (p = . ) [ ] , while an intervention with the same ons resulted in a mean gain of . kg muscle mass in the intervention group versus a mean loss of kg in controls (p = . ) [ ] . a similar intervention resulted in an increase in skeletal muscle mass and lean body mass in cancer patients with omega- lcpufa-enriched ons (p = . , p < . , respectively), while no change was seen in these parameters in the group that received the standard ons (p = . , p = . , respectively) [ ] . moreover, there are indications that supplementation with omega- lcpufas in combination with high protein might have a beneficial effect on quality of life in cancer patients [ ] . importantly, omega- lcpufas were shown to be safe and well tolerated by cancer patients [ , ] . in addition to their effect on lean mass in cancer patients, omega- lcpufas have potential use as adjuvants to cancer therapy [ ] . they are thought to affect tumor activity through a range of mechanisms [ ] . a review of the evidence of omega- lcpufas as an adjunct to chemotherapy found beneficial effects on tumor response to treatment, protection from therapy-related toxicity and maintenance of quality of life [ ] . further benefits of omega- lcpufa supplementation might include reduction in cancer-related pain as well as a decrease in major depressive disorders, which are a frequent consequence of the stress and anxiety caused by a cancer diagnosis [ ] . the lack of consensus on the definition of cachexia has led to the inclusion of patients at different stages of the condition into studies, which is expected to affect the outcomes significantly [ ] . inconsistent or negative outcomes in clinical trials, including those with omega- lcpufas, are often due to suboptimal study design regarding the selection of endpoint [ , ] or due to lack of randomization or (placebo) control group [ ] . moreover, the duration and size of the trials may have been too low in many cases to detect a relevant impact [ ] . the timing of the intervention will likely also play a role, as a recent study only showed a benefit if nutritional interventions were initiated before chemotherapy started [ ] . considerable heterogeneity also exists in the pharmacological treatment as shown in a recent review that found different combinations of chemotherapy used in seven studies on the effect of omega- lcpufas in cancer patients [ ] . dose selection and compliance also play an important role as shown by fearon et al. [ ] in a post-hoc analysis where there was a dose-response between reported intake of omega- lcpfa-enriched ons and total (r = . , p < . ) and lean body mass (r = . , p = . ), as well as a correlation between plasma phospholipid epa and change in total and lean body weight (r = . , p < . ; r = . , p = . ). this provides evidence that doses of mg/d dha and mg/d epa or even more are required for a significant effect on muscle mass. others suggest the use of at least to mg/d dha+epa based on data from the available clinical trials on their use as adjuvants for chemotherapy [ , ] . it is increasingly recognized that multimodal interventions are most promising for the therapy of cancer cachexia, yet most of the clinical evidence is derived from trials using only a single therapy [ ] . in a small feasibility trial, a combination of an omega- lcpufa-enriched ons (~ mg/d dha and mg/d epa), nutritional advice, mg/d celecoxib and exercise compared to standard of care resulted in a stabilization of body weight compared to weight loss in the control group [ ] . the subsequent phase iii study on this intervention is still ongoing [ ] . therefore, studies are needed that combine nutrition, including dha and epa, physical exercise as well as pharmacological interventions. studies highlighting cost-effectiveness might also be helpful in increasing acceptance of such interventions given the potential benefit and the low cost of omega- lcpufa supplements. due to the limited and inconclusive data available, many oncologists are yet to be convinced of the benefits that dha and epa have for cancer patients. their interest in the mechanisms and possible therapies of cancer cachexia could be increased by the recent understanding that some mechanisms leading to cachexia are also involved in the process of metastasis [ ] . if confirmed in clinical trials, early intervention with omega- lcpufas to prevent the development of cancer cachexia may also help to limit the spread of the tumor to distant organs. epidemiological evidence indicates a benefit from supplementation with omega- lcpufas throughout the clinical journey of a cancer patient as higher intakes of these fatty acids in patients diagnosed with colorectal cancer were found to be associated with reduced specific mortality [ ] [ ] [ ] . surgery leads to the release of stress hormones and inflammatory mediators proportional to the magnitude of the procedure, resulting in a metabolic imbalance towards increased catabolism [ , ] . while this serves to support tissue healing and the immune response, it favors the breakdown of muscle protein. this can be detrimental to the patient, especially when there is pre-existing malnutrition, sarcopenia, cachexia, obesity and myosteatosis [ ] or in the presence of low-grade inflammation due to underlying conditions such as cancer or diabetes [ ] . malnutrition in surgical patients has been proposed as "a nutritional state in which nutrient intake does not match nutrient needs-due to underlying disease(s), the surgical stress response, chronic or acute inflammation, intestinal malabsorption (e.g., diarrhea) and/or patient-related factors (e.g., socio-economic status)-leading to losses in lean tissue and diminished function" [ ] . nutritional intervention can help reduce the stress of surgery, thereby preventing and treating catabolism and malnutrition [ ] . this is thought to reduce the risk of complications, decrease the length of hospital stay and promote better functional recovery [ ] . considering the poor general health conditions of at-risk (e.g., many cancer) patients, nutritional conditioning (e.g., in the context of prehabilitation) may prepare individuals for an enhanced recovery after surgery (eras) protocol [ ] . optimal timing for the introduction of nutritional therapy depends on the type of surgery and the general health status of the patient and needs further investigation [ ] [ ] [ ] [ ] [ ] [ ] [ ] . given their effect on inflammation mitigation, it is reasonable to expect a benefit of adding dha and epa to perioperative immunonutrition therapy. however, the evidence to support this is limited and most studies compared an ons containing dha and epa combined with other immune modulating nutrients (i.e., arginine and nucleotides with or without glutamine) with regular hospital diet rather than with a standard ons. a recent meta-analysis focusing on patients with gastrointestinal cancer included studies with patients, where the control group received either no supplements or an isonitrogenous standard ons [ ] . the preoperative administration of immunonutrition resulted in significantly decreased postoperative infectious complications in the combined studies (or . , % ci . - . , p < . ) as well as the studies with a standard ons as a control (or . , % ci . - . , p = . ). for length of hospital stay, significance was only reached in the combined studies (− . days, % ci − . to − . , p < . ) but there was only a weak trend when compared to ons (− . days, % ci − . to . , p = . ). no significant effect was seen on non-infectious complications or mortality. given their effect on post-operative morbidity and length of stay, the current espen guideline for surgical patients advises that standard ons are given pre-operatively to all malnourished cancer and other high-risk patients undergoing major abdominal surgery [ ] . the evidence is somewhat stronger for benefits of postoperative than for preoperative immunonutrition [ ] , although the optimal timing for its introduction to patient treatment plans still needs further investigation. the espen recommendation is that "peri-or at least postoperative administration of specific formulae enriched with immunonutrients should be given in malnourished patients undergoing major cancer surgery" [ ] . based on the duration of supplementation in the trials with positive outcomes, immunonutrition containing dha and epa as well as arginine and nucleotides should start five to seven days before surgery [ ] . similarly, the recommendations from the north american surgical nutrition summit include five to seven days of pre-operative immunonutrition including omega- lcpufas, which should be continued well into the postoperative period [ ] . it has even been suggested that the ideal period for pre-operative nutritional support is seven to days-or longer for severely malnourished patients-in addition to postoperative nutritional support [ ] . patients who are severely compromised (e.g., due to cancer) should ideally receive preoperative nutrition support for more than days [ ] . moreover, attenuation of the metabolic response to the stress of surgery through a range of measures including immunonutrition in the perioperative period is increasingly being recommended [ , ] as the combination of different elements, rather than a single one of them, is thought to produce the optimal outcome for patients [ ] . while many of the trials in this area did not follow an eras program, adherence to such a protocol might further increase the benefits of immunonutrition. this is supported by evidence from a multicenter study in well-nourished cancer patients undergoing colorectal resection comparing peri-operative use of an ons with immune-nutrients compared to a standard ons as part of a more comprehensive eras protocol [ ] . immunonutrition including omega- lcpufas for seven days pre-and five days post-surgery was compared to a standard high caloric ons and led to a decrease in the total number of complications, primarily due to a reduction in infectious complications ( . % vs. . %, p = . ) [ ] . it is evident that dha and epa play a role in perioperative immunonutrition in cancer patients, but more well-designed trials comparing standard to specialized (immunonutrition) ons could provide clearer evidence for their use and confirm the optimal timing. a recent survey among gastrointestinal and oncologic surgeons in the u.s. showed the use of post-operative nutrition support was more common than pre-operative and the use of immune-nutrients was reported by approximately % of responders (versus approximately % use of protein-containing supplements) and lack of awareness was given as the major hurdle to a more widespread use [ ] . sepsis is a severe clinical syndrome defined as "a life-threatening organ dysfunction due to a dysregulated host response to infection" [ ] . in septic patients, inflammatory cytokines trigger the release of even more cytokines, culminating in a so-called cytokine storm that will in turn cause damage to cells and organs [ ] . the outcome can be multi-organ failure and death. in addition to these hyperinflammatory processes, immune suppression also seems to play a role in sepsis and the balance between the two is thought to vary depending on host-, pathogen-and therapy-related factors [ , ] . the factors leading to sepsis are still incompletely understood and attempts to dampen the cytokine storm activation or consequences have failed in clinical trials [ ] . a recent meta-analysis found a lower risk for mortality in patients with sepsis who received omega- lcpufas, mainly intravenously, compared to control groups (or . , % ci . to . , p = . ), while the reduction in infectious complications was only reported in one study and was not significant (or . , % ci . to . , p = . ) and none of the studies reported cases of new onset of organ failure [ ] . a complete interpretation of the findings of this meta-analysis is limited by the low number of included studies. acute respiratory distress syndrome (ards) and multiple organ failure are important complications in patients with sepsis, resulting in prolonged icu stays [ ] [ ] [ ] [ ] . specialized enteral formulations containing omega- lcpufas as well as other ingredients such as antioxidants are available for critically ill patients with ards or acute lung injury (ali). however, the evidence for their effect is inconsistent. early research demonstrated positive clinical outcomes such as improved oxygenation, fewer new organ failures, more ventilator-and icu-free days as well as lower mortality when comparing these with high omega- pufa or standard formulas [ ] [ ] [ ] [ ] . however, subsequent research could not replicate these findings [ ] [ ] [ ] [ ] [ ] [ ] . consequently, the sccm/aspen guidelines for critically ill patients do not recommend the use of these specialized formulas for ards/ali [ ] . in contrast, the canadian clinical practice guidelines recommend that clinicians consider these specialized formulas with fish or borage oil and supplemental antioxidants for patients with ards/ali [ ] . the disparity between the two guidelines is likely related to differences in the studies included in the evaluation and the methods used for analyzing and interpreting the data to develop recommendations. while a recent meta-analysis of patients with ards or ali showed no effect of enteral nutrition enriched with fish oil [ ] , after the exclusion of two studies using a bolus rather than continuous dose, there was evidence that omega- lcpufa-containing formulas decreased mortality in critically ill patients including those with ards/ali [ ] . moreover, a recent cochrane review of these trials identified a significant improvement in blood oxygenation and significant reductions in ventilation requirement, new organ failures, length of stay in the icu and mortality at days when omega- lcpufas were used in patients with ards or ali, although all-cause mortality was not significantly affected [ ] . these findings are important in the context of the current coronavirus pandemic since severe covid- results in ards and there are suggestions that omega- lcpufas could be a viable treatment that is worth investigating [ , ] . for critically ill surgical patients who require parenteral nutrition, intravenous lipid emulsions containing omega- lcpufas are considered safe, but parenteral nutrition should only be considered in patients who cannot be adequately enterally fed [ ] . international consensus exists that a dose of . to . g/kg/d of fish oil would be appropriate for patients who require parenteral nutrition [ ] [ ] [ ] [ ] . a recent meta-analysis of prospective randomized trials showed significant benefits for the fish oil containing parenteral nutrition compared to a standard lipid emulsion [ ] . the risk for infection was lowered by % ( studies: rr . . % ci . to . ; p < . ). mean length of stay in the icu was significantly shortened ( studies: . days; % ci − . to − . ; p = . ) as was the length of hospital stay ( studies: . days, % ci − . to − . ; p < . ). the risk for developing sepsis was also significantly diminished by % (nine studies: rr . , %ci . to . , p = . ). mortality was lower with %, but the difference did not reach significance ( studies: rr . , % ci . to . ; p = . ) [ ] . moreover, fish oil was found to be more cost-effective than parenteral nutrition with a standard intravenous lipid emulsion [ ] . the evidence to date indicates that the provision of dha and epa through capsules, oral nutrition supplements, or enteral or parenteral formulas can help to regulate the inflammatory environment in a number of medical conditions and that this is linked in many cases to improved function, clinical course and outcomes. as dysregulated inflammation is a component of many acute and chronic diseases [ ] , the potential application of dha and epa is broad in terms of prevention and treatment. there is good evidence that dha and epa are a safe and cost-effective treatment that could benefit multiple patient outcomes. use of dha and epa in some conditions is supported by their inclusion in relevant guidelines [ , , , , ] , although the level of evidence has sometimes been considered to be low. this is because of inconsistent data on the effect of dha and epa on clinical outcomes, especially in some settings. this inconsistency has limited stronger support through guidelines and has hindered the wider acceptance of the benefits of dha and epa in the medical community. if omega- lcpufas are effective in disease prevention and in patient care, it is important to understand the reasons behind the inconsistent findings of studies and use this information to design and conduct better clinical trials to determine if poor results may be due to a real lack of effect or to other factors. undoubtedly the dose of dha and epa used is an important factor, but this is not the sole explanation for inconsistencies. other considerations include the timing and duration of supply of dha and epa, epa to dha ratio, baseline epa and dha status, intake of other nutrients including omega- fatty acids, b vitamins and antioxidants, clinical state, and medication use. more well-designed intervention studies are required to address the relevance of these different variables in order to properly identify the effects of dha and epa in specific target patient populations. such studies may lead to more personalized approaches to the provision of dha and epa to achieve the maximal clinical benefit. a focus on personalized approaches and knowledge of a patient's specific nutritional and medical needs will be important to determine the route to optimal use of omega- lcpufas. this should take into account the interaction between genetics and nutrients [ ] as well as the interaction among the nutrients themselves. overall, the entirety of the evidence supports use of dha and epa in a range of medical conditions. additional and good quality studies building on the experience of existing studies will strengthen the evidence base required to inform relevant guidelines in the future. causes of death collaborators. global, regional, and national age-sex specific mortality for causes of death, - : a systematic analysis for the global burden of disease study dalys and hale collaborators. global, regional, and national disability-adjusted life-years (dalys) for diseases and injuries and healthy life expectancy (hale) for countries and territories, - : a systematic analysis for the global burden of disease study assessing and measuring chronic multimorbidity in the older population: a proposal for its operationalization aging with multimorbidity: a systematic review of the literature health relevance of the modification of low grade inflammation in ageing (inflammageing) and the role of nutrition inflammatory biomarkers of frailty inflammaging as a common ground for the development and maintenance of sarcopenia, obesity, cardiomyopathy and dysbiosis cancer cachexia and related metabolic dysfunction inflammatory biomarkers and prediction for intensive care unit admission in severe community-acquired pneumonia very long-chain n- fatty acids and human health: fact, fiction and the future marine omega- fatty acids and inflammatory processes: effects, mechanisms and clinical relevance omega- fatty acids and inflammatory processes: from molecules to man omega- (n- ) polyunsaturated fatty acids and inflammation: from membrane to nucleus and from bench to bedside activation of resolution pathways to prevent and fight chronic inflammation: lessons from asthma and inflammatory bowel disease resolvins in inflammation: emergence of the pro-resolving superfamily of mediators the specialised pro-resolving mediator network: an update on in vivo production and actions metabolism and functional effects of plant-derived omega- fatty acids in humans fats and fatty acids in human nutrition-report of an expert consultation people's medical publishing house institute of medicine dietary reference intakes. the essential guide to nutrient requirements scientific opinion on dietary reference values for fats, including saturated fatty acids, polyunsaturated fatty acids, monounsaturated fatty acids, trans fatty acids and cholesterol incorporation of eicosapentaenoic and docosahexaenoic acids into lipid pools when given as supplements providing doses equivalent to typical intakes of oily fish global survey of the omega- fatty acids, docosahexaenoic acid and eicosapentaenoic acid in the blood stream of healthy adults hormonal modulation of delta and delta desaturases: case of diabetes omega- polyunsaturated fatty acids in critical illness: anti-inflammatory, proresolving, or both? the role of omega- in the prevention and treatment of sarcopenia optimal. nutritional status for a well-functioning immune system is an important factor to protect against viral infections the influence of omega- fatty acids on skeletal muscle protein turnover in health, disuse, and disease. front. nutr. , , mechanisms of action of (n- ) fatty acids the science behind dietary omega- fatty acids fatty acids: from membrane ingredients to signaling molecule metabolism and functions of docosahexaenoic acid-containing membrane glycerophospholipids docosahexaenoic acid omega- fatty acids epa and dha: health benefits throughout life the various roles of fatty acids oxidation of polyunsaturated fatty acids to produce lipid mediators. essays biochem. , in press essays biochem. , in press alzheimer's disease international. dementia statistics inadequate supply of vitamins and dha in the elderly: implications for brain aging and alzheimer-type dementia the essentiality of long chain n- fatty acids in relation to development and function of the brain and retina polyunsaturated fatty acids in the central nervous system: evolution of concepts and nutritional implications throughout life docosahexaenoic acid signalolipidomics in nutrition: significance in aging, neuroinflammation, macular degeneration age-associated changes in central nervous system glycerolipid composition and metabolism fatty acid composition of brain phospholipids in aging and in alzheimer's disease fish consumption, long-chain omega- fatty acids and risk of cognitive decline or alzheimer disease: a complex association plasma fatty acid profiles in relation to cognition and gender in alzheimer's disease patients during oral omega- fatty acid supplementation: the omegad study combined omega- fatty acids, aerobic exercise and cognitive stimulation prevents decline in gray matter volume of the frontal, parietal and cingulate cortex in patients with mild cognitive impairment the n- polyunsaturated fatty acids supplementation improved the cognitive function in the chinese elderly with mild cognitive impairment: a double-blind randomized controlled trial effects of dha supplementation on hippocampal volume and cognitive function in older adults with mild cognitive impairment: a -month randomized, double-blind, placebo-controlled trial dha supplementation improves cognitive function via enhancing aβ-mediated autophagy in chinese elderly with mild cognitive impairment: a randomised placebo-controlled trial omega- fatty acids' supplementation in alzheimer's disease: a systematic review defining the optimal target population for trials of polyunsaturated fatty acid supplementation using the erythrocyte omega- index: a step towards personalized prevention of cognitive decline? effect of fish oil on cognitive performance in older subjects: a randomized, controlled trial mapt study: a multidomain approach for preventing alzheimer's disease: design and baseline data effect of long-term omega polyunsaturated fatty acid supplementation with or without multidomain intervention on cognitive function in elderly adults with memory complaints (mapt): a randomised, placebo-controlled trial cognitive changes with omega- polyunsaturated fatty acids in non-demented older adults with low omega- index lessons from the multidomain alzheimer preventive trial ritskes-hoitinga, m. the effects of long-term omega- fatty acid supplementation on cognition and alzheimer's pathology in animal models of alzheimer's disease: a systematic review and meta-analysis homocysteine status modifies the treatment effect of omega- fatty acids on cognition in a randomized clinical trial in mild to moderate alzheimer's disease: the omegad study brain atrophy in cognitively impaired elderly: the importance of long-chain ω- fatty acids and b vitamin status in a randomized controlled trial omega- fatty acid status enhances the prevention of cognitive decline by b vitamins in mild cognitive impairment unsaturated fatty acid intakes during midlife are positively associated with later cognitive function in older adults with modulating effects of antioxidant supplementation evolution of the human lifespan and diseases of aging: roles of infection, inflammation, and nutrition apoe genotype: from geographic distribution to function and responsiveness to dietary factors carriers of an apolipoprotein e epsilon allele are more vulnerable to a dietary deficiency in omega- fatty acids and cognitive decline oxidative damage and protection by antioxidants in the frontal cortex of alzheimer's disease is related to the apolipoprotein e genotype. free rad anorexia of aging: risk factors, consequences, and potential treatments understanding the gastrointestinal tract of the elderly to develop dietary solutions that prevent malnutrition prevalence of frailty in middle-aged and older community-dwelling europeans living in countries prevalence of frailty in community-dwelling older persons: a systematic review frailty and multimorbidity: a systematic review and meta-analysis espen guidelines on definitions and terminology of clinical nutrition frailty in elderly people frailty, sarcopenia, and malnutrition frequently (co-)occur in hospitalized older adults: a systematic review and meta-analysis frailty in older adults: evidence for a phenotype prognostic value of physical function tests and muscle mass in elderly hospitalized patients. a prospective observational study frailty is associated with longer hospital stay and increased mortality in hospitalized older patients frailty as a predictor of surgical outcomes in older patients writing group for the european working group on sarcopenia in older people (ewgsop ), and the extended group for ewgsop . sarcopenia: revised european consensus on definition and diagnosis sarcopenia: european consensus on definition and diagnosis: report of the european working group on sarcopenia in older people functional compromise cohort study (fccs): sarcopenia is a strong predictor of mortality in the intensive care unit association of sarcopenia with short-and long-term mortality in older adults admitted to acute care wards: results from the crime study association of handgrip strength and muscle mass with dependency in (instrumental) activities of daily living in hospitalized older adults-the empower study impact of preoperative sarcopenia on postoperative outcomes following pancreatic resection: a systematic review and meta-analysis body composition assessment and sarcopenia in patients with gastric cancer: a systematic review and meta-analysis prognostic significance of sarcopenia and systemic inflammatory response in patients with esophageal cancer preoperative assessment of muscle mass using computerized tomography scans to predict outcomes following orthotopic liver transplantation sarcopenia and sarcopenic obesity are significantly associated with poorer overall survival in patients with pancreatic cancer: systematic review and meta-analysis inflammation and age-associated skeletal muscle deterioration (sarcopaenia) the underappreciated role of muscle in health and disease strength, but not muscle mass, is associated with mortality in the health, aging and body composition study cohort muscle mass and physical recovery in icu: innovations for targeting of nutrition and exercise fish oil-derived n- pufa therapy increases muscle mass and function in healthy older adults the impact of supplemental n- long chain polyunsaturated fatty acids and dietary antioxidants on physical performance in postmenopausal women omega- fatty acid supplementation for weeks increases resting and exercise metabolic rate in healthy community-dwelling older females the effect of a -week omega- supplementation on body composition, muscle strength and physical performance in elderly individuals with decreased muscle mass effect of long-term omega polyunsaturated fatty acid supplementation with or without multidomain lifestyle intervention on muscle strength in older adults: secondary analysis of the multidomain alzheimer preventive trial (mapt) diets for health: goals and guidelines cancer cachexia syndrome: pathogenesis, diagnosis, and new therapeutic options glim criteria for the diagnosis of malnutrition-a consensus report from the global clinical nutrition community cancer-associated malnutrition, cachexia and sarcopenia: the skeleton in the hospital closet years later espen expert group recommendations for action against cancer-related malnutrition definition and classification of cancer cachexia: an international consensus cancer-associated cachexia an elevated neutrophil-to-lymphocyte ratio associates with weight loss and cachexia in cancer cancer cachexia: understanding the molecular basis the immediate cause of death in cancer do patients with weight loss have a worse outcome when undergoing chemotherapy for lung cancers? prevalence and clinical implications of sarcopenic obesity in patients with solid tumours of the respiratory and gastrointestinal tracts: a population-based study low body mass index and sarcopenia associated with dose-limiting toxicity of sorafenib in patients with renal cell carcinoma body composition as an independent determinant of -fluorouracil-based chemotherapy toxicity sarcopenia as a determinant of chemotherapy toxicity and time to tumor progression in metastatic breast cancer patients receiving capecitabine treatment sarcopenia is linked to treatment toxicity in patients with metastatic colorectal cancer the emotional aspects of cancer anorexia pharmacological management of cachexia in adult cancer patients: a systematic review of clinical trials evaluation of the true endpoint of clinical trials for cancer cachexia hallmarks of cancer: the next generation cancer-related inflammation and treatment effectiveness terminology in cancer cachexia: importance and status evidence base for multimodal therapy in cachexia cancer cachexia: developing multimodal therapy for a multidimensional problem omega- supplements for patients in chemotherapy and/or radiotherapy: a systematic review omega- fatty acids in cancer n- polyunsaturated fatty acid supplementation during cancer chemotherapy pithon-curi, t.c.; et al. new insights on the regulation of cancer cachexia by n- polyunsaturated fatty acids down-regulation of the acute-phase response in patients with pancreatic cancer cachexia receiving oral eicosapentaenoic acid is mediated via suppression of interleukin- oral nutritional supplements containing (n- ) polyunsaturated fatty acids affect the nutritional status of patients with stage iii non-small cell lung cancer during multimodality treatment a systematic review and meta-analysis of the n- polyunsaturated fatty acids effects on inflammatory markers in colorectal cancer fish oil supplement alters markers of inflammatory and nutritional status in colorectal cancer patients fish oil-enriched nutrition combined with systemic chemotherapy for gastrointestinal cancer patients with cancer cachexia n- fatty acids during chemotherapy: toward a higher level of evidence for clinical application aberrations in plasma phospholipid fatty acids in lung cancer patients eicosapentaenoic acid (epa, an omega- fatty acid from fish oils) for the treatment of cancer cachexia anorexia-cachexia syndrome: a systematic review of the role of dietary polyunsaturated fatty acids in the management of symptoms, survival, and quality of life a systematic review on the role of fish oil for the treatment of cachexia in advanced cancer: an epcrc cachexia guidelines project n- fatty acids, cancer and cachexia: a systematic review of the literature espen guidelines on nutrition in cancer patients systematic review and meta-analysis of the evidence for oral nutritional intervention on nutritional and clinical outcomes during chemo(radio)therapy: current evidence and guidance for design of future trials effects of an oral nutritional supplement containing eicosapentaenoic acid on nutritional and clinical outcomes in patients with advanced non-small cell lung cancer: randomised trial protective effects of omega- fatty acids in cancer-related complications role of nutritional status and intervention in oesophageal cancer treated with definitive chemoradiotherapy: outcomes from scope effect of a protein and energy dense n- fatty acid enriched oral supplement on loss of weight and lean tissue in cancer cachexia: a randomised double blind trial a randomized phase ii feasibility trial of a multimodal intervention for the management of cachexia in lung and pancreatic cancer cancer cachexia: rationale for the menac (multimodal-exercise, nutrition and anti-inflammatory medication for cachexia) trial understanding cachexia in the context of metastatic progression marine omega- fatty acid intake and survival of stage iii colon cancer according to tumor molecular markers in ncctg phase iii trial n (alliance) marine ω- polyunsaturated fatty acid intake and survival after colorectal cancer diagnosis marine ω- polyunsaturated fatty acid and fish intake after colon cancer diagnosis and survival: calgb (alliance) perioperative nutrition: recommendations from the espen expert group espen guideline: clinical nutrition in surgery advances in understanding and assessing malnutrition pre-operative nutrition and the elective surgical patient: why, how and what? anaesthesia enhanced recovery after surgery: a review immunonutrition in high-risk surgical patients should immunonutrition become routine in critically ill patients? a systematic review of the evidence immunonutrition in the critically ill: a systematic review of clinical outcome a meta-analysis of the effect of combinations of immune modulating nutrients on outcome in patients undergoing major open gastrointestinal surgery enteral nutritional supplementation with key nutrients in patients with critical illness and cancer: a meta-analysis of randomized controlled clinical trials immunonutrition in the intensive care unit. a systematic review and consensus statement postsurgical infections are reduced with specialized nutrition support the impact of preoperative immune modulating nutrition on outcomes in patients undergoing surgery for gastrointestinal cancer: a systematic review and meta-analysis effect of timing of pharmaconutrition (immunonutrition) administration on outcomes of elective surgery for gastrointestinal malignancies summary points and consensus recommendations from the north american surgical nutrition summit nutritional assessment and screening for malnutrition promoting perioperative metabolic and nutritional care patient optimization for gastrointestinal cancer surgery perioperative standard oral nutrition supplements versus immunonutrition in patients undergoing colorectal resection in an enhanced recovery (eras) protocol: a multicenter randomized clinical trial (sonvi study) assessment of perioperative nutrition practices and attitudes: a national survey of colorectal and gi surgical oncology programs the third international consensus definitions for sepsis and septic shock (sepsis- ) cytokine storm and sepsis disease pathogenesis nutrition in sepsis: a bench-to-bedside review sepsis and septic shock dutch pancreatitis study group. are omega- fatty acids safe and effective in acute pancreatitis or sepsis? a systematic review and meta-analysis lung repair and regeneration in ards: role of pecam and wnt signaling pathogenic human coronavirus infections: causes and consequences of cytokine storm and immunopathology the cytokine storm and factors determining the sequence and severity of organ dysfunction in multiple organ dysfunction syndrome effect of enteral feeding with eicosapentaenoic acid, gamma-linolenic acid, and antioxidants in patients with acute respiratory distress syndrome. enteral nutrition in ards study group effects of enteral feeding with eicosapentaenoic acid, gamma-linolenic acid, and antioxidants in mechanically ventilated patients with severe sepsis and septic shock the use of an inflammation-modulating diet in patients with acute lung injury or acute respiratory distress syndrome: a meta-analysis of outcome data benefit of an enteral diet enriched with eicosapentaenoic acid and gamma-linolenic acid in ventilated patients with acute lung injury effect of an enteral diet enriched with eicosapentaenoic acid, gamma-linolenic acid and anti-oxidants on the outcome of mechanically ventilated, critically ill, septic patients modulation of dietary lipid composition during acute respiratory distress syndrome: systematic review and meta-analysis enteral immunomodulatory diet (omega- fatty acid, γ-linolenic acid and antioxidant supplementation) for acute lung injury and acute respiratory distress syndrome: an updated systematic review and meta-analysis the role of omega- polyunsaturated fatty acids in the treatment of patients with acute respiratory distress syndrome: a clinical review nih nhlbi acute respiratory distress syndrome network of investigators. enteral omega- fatty acid, gamma-linolenic acid, and antioxidant supplementation in acute lung injury preemptive enteral nutrition enriched with eicosapentaenoic acid, gamma-linolenic acid and antioxidants in severe multiple trauma: a prospective, randomized, double-blind study guidelines for the provision and assessment of nutrition support therapy in the adult critically ill patient: society of critical care medicine (sccm) and american society for parenteral and enteral nutrition canadian clinical practice guidelines: composition of enteral nutrition: fish oils, borage oils and antioxidants enteral omega- fatty acid supplementation in adult patients with acute respiratory distress syndrome: a systematic review of randomized controlled trials with meta-analysis and trial sequential analysis enteral fish oil in critical illness: perspectives and systematic review immunonutrition for acute respiratory distress syndrome (ards) in adults parenteral fish oil: an adjuvant pharmacotherapy for coronavirus disease parenteral fish-oil emulsions in critically ill covid- emulsions summary of proceedings and expert consensus statements from the international summit "lipids in parenteral nutrition lipid use in hospitalized adults requiring parenteral nutrition clinical nutrition in critical care medicine-guideline of the german society for nutritional medicine (dgem) espen guideline on clinical nutrition in the intensive care unit ω- fatty-acid enriched parenteral nutrition in hospitalized patients: systematic review with meta-analysis and trial sequential analysis pharmacoeconomics of parenteral nutrition with ω- fatty acids in hospitalized adults inflammatory responses and inflammation-associated diseases in organs the ability of fish oil to suppress tumor necrosis factor alpha production by peripheral blood mononuclear cells in healthy men is associated with polymorphisms in genes that influence tumor necrosis factor alpha production key: cord- - v o krh authors: gosliner, wendi; chen, wei-ting; johnson, cathryn; esparza, elsa michelle; price, natalie; hecht, ken; ritchie, lorrene title: participants’ experiences of the – government shutdown and subsequent supplemental nutrition assistance program (snap) benefit disruption can inform future policy date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: v o krh the federal government shutdown from december to january created an unprecedented disruption in supplemental nutrition assistance program (snap) benefits. we conducted a cross-sectional qualitative study to begin to capture how the disruption affected food security and wellbeing among a small sample of california snap participants. we collected data from low-income adults in four focus groups in four diverse california counties. we found that participants routinely struggle to secure an adequate and healthy diet in the context of high costs of living, the shutdown and benefit disruption added to participants’ stress and uncertainty and exacerbated food insecurity, and it diminished some participants’ faith in government. participants reported that, while having additional benefits in january felt like a relief from typical end-of-month deprivation, the subsequent extended gap between benefit distributions and a lack of clarity about future benefits caused cascading effects as participants later had to divert money from other expenses to buy food and faced added uncertainty about future economic stability. additionally, the shutdown highlighted challenges related to the availability, timing, and tone of communications between participants and snap agencies. participants recommended that snap adjust benefit and eligibility levels to better address costs of living, improve customer service, and avoid future disruptions. the supplemental nutrition assistance program (snap, formerly known as food stamps), provides critical funds to low-income families to support food purchases, helping to alleviate poverty and food insecurity. in an average month in , more than million americans participated in snap, at a total cost of approximately $ billion dollars annually [ ] . in , snap lifted . million people out of poverty [ ] ; the poverty reducing benefits of snap are so large that, without the program, the child poverty rate in the u.s. would be % instead of % [ ] . more than % of snap participants are families with children, almost % live in households with members who are elderly or have disabilities, and more than % of snap participants are in working families [ ] . while snap reduces operations within days of the cr's expiration [ ] [ ] [ ] . despite the operational challenges of this approach, state and county snap agencies worked to mitigate harm to clients and issue february benefits early (within the -day period of the former cr expiring) to protect february benefit issuance despite the shutdown. although participants ultimately did not miss a month of snap benefits, they did experience an unprecedented disruption in benefit issuance with a longer than normal gap between snap benefit issuance, from a usual maximum of days to up to days. in california, february benefits were issued between january and , and march benefits were issued on march , a gap of - days [ , ] . at the time usda released communications about february snap benefit issuance, they were unable to address what would happen in march if the shutdown continued [ , , ] , leaving participants uncertain about their future food access. the aim of this study was to begin to capture some of the ways in which the snap disruption affected the food security, health, and wellbeing of a small sample of california snap participants. initial questions aimed to capture the baseline (prior to the government shutdown) food security, health, and wellbeing of this convenience sample of snap participants. further questions then explored whether participants' experiences changed as a result of the shutdown and snap benefit disruption. although the monthly cycle of food insecurity among snap participants is well-documented, this study is believed to be the first to capture the short-and potential long-term effects a disruption of snap benefits had on participating low-income households. the nutrition policy institute in partnership with university of california cooperative extension advisors in three california counties received a rapid-response opportunity grant from the university of california, division of agriculture and natural resources, to conduct a cross-sectional qualitative study to capture the experiences of snap (called calfresh in california) participants during the benefit disruption. we collected data in four focus groups, three in english and one in spanish, with low-income adults in four counties in california from february , to march , (table ) during and just after participants experienced a longer than usual gap between snap benefit issuance. counties were selected to include urban (los angeles and san francisco), suburban (san mateo), and rural (tuolumne) areas (table ) . a semi-structured focus group interview guide was developed by the research team and reviewed by three external national snap research and policy experts. the guide asked about participants' usual food routines, the level of support snap provides, how they understood and experienced receiving february's snap benefit in january, whether the disruption in benefits impacted their family's health or stress levels, whether the experience changed the way they think about snap, and what they recommend decision makers could do to better help them (table ) . what did you think about getting a second benefit payment in january? why do you think you got this benefit? can you think of any ways in which getting the february benefits in january changed how you shopped for food or what you ate in january? can you think of any ways that your family's health was different in january because of this change in how you got calfresh/ebt? thinking about stress, how would you say the payment of february calfresh/ebt benefits in january impacted your stress level? have any changes in stress affected how well you feel? what about your family members? did you have any days that you missed work or school due to health issues in january? any hospitalizations? did your children have any changes in their school attendance, behavior, or achievement during january? can you think of any ways in which the longer period between receiving calfresh/ebt benefits has changed how you shopped for or got food or what you ate in february? can you think of any ways that your family's health was different in february? thinking about your stress level, how has increased time between calfresh benefits impacted your stress level? what do you want decision makers to know about your experience with this change in calfresh/ebt payments? has this change in payments led you to think about any ways you'd like to see calfresh/ebt change? has this given you any new ideas about your usual calfresh/ebt benefit levels? how can calfresh/ebt better help you and your family? if your calfresh benefits could be increased, how much more per week do you think it would take for you to be able to feed yourself/your family? participating counties were selected to represent some of california's diversity, including people living in urban and rural areas, speaking primarily english or spanish, and including different age and racial/ethnic groups. county cooperative extension advisors reached out to community partners in their counties that have strong relationships with snap participants and were willing to host focus groups. participating organizations included a homeless shelter, a middle school, and two food banks (one of which secured an alternate location for the focus group meeting). agencies were provided with participant recruitment scripts and eligibility criteria (which focused on snap participation) and were asked to reach out to a convenience sample of clients to invite to attend the groups. whenever possible, agency staff called participants with a reminder the day prior to the focus group meeting. two researchers led focus groups: one conducted three groups in english and the second conducted one group in spanish. three cooperative extension advisors co-facilitated the focus groups conducted in their counties of work. focus group participants completed a demographic survey that included questions about gender, age, race/ethnicity, education, employment, income, marital status, food assistance program participation, and food security. each focus group lasted approximately . hours and was audio recorded. a commercial service was used to transcribe and translate focus group recordings. four researchers, including a lead researcher and the three co-facilitators, reviewed the transcripts. a codebook was developed based upon the main topics in the focus group guide and was agreed upon by the research team. the lead researcher read and coded all four transcripts and created a summary table of coding results. the co-facilitator of each focus group reviewed the transcripts against the coding results to ensure consistency of interpretations. the researchers used memos to capture themes and emergent findings throughout the analysis process. the research team met four times for - h each between march and june , to discuss and reach consensus on the findings. twenty-six adults participated in the study. most participants were female, ages - , white or latinx, and reported experiencing an indicator of food insecurity (table ) . findings emerged across five themes: ( ) the usual struggles participants face in securing an adequate diet; ( ) general challenges participants experience utilizing the snap program; ( ) specific challenges participants experienced with snap during the benefit disruption; ( ) the negative impact the disruption had on participants' food security, stress levels, finances, and perceptions of government support; and ( ) participants' recommendations for snap moving forward. the challenges participants routinely confront in trying to feed themselves and their families were discussed multiple times in all focus groups. participants described using numerous coping skills to ensure they do not go hungry, such as shopping at multiple retailers, coupon clipping, freezing food, and using food pantries. despite their best efforts, most reported routinely running out of money to buy food during the month, and some reported cutting the size of their own and their children's food portions. participants reported that the high costs of living, inadequate or low-wage employment, and/or their limited fixed income from other public programs (social security, disability, and unemployment) meant that they routinely faced food insecurity. as one participant said: you know, with our incomes, and especially with the rent is so high and our bills . . . it gets really stressful trying to be like, 'okay, where's my next meal gonna come from? how am i going to feed my kids' another participant described how food insecurity presented challenges due to her struggles with a health condition: i have to eat healthy with my-my gi problems that i have. i have to eat white plain chicken, you know, fresh vegetables, and they don't bother me so much . . . but . . . you run out of the chicken, or whatever, you run out of vegetables. then you've got a can of raviolis that the food bank gave you. well, that's what you eat. and it tears you up. you know it makes you sick, but you gotta eat. participants in all focus groups repeatedly talked about how expensive food is. they described searching to find lower prices on food items, buying junk foods and other "cheap" foods to get more for their money, and struggling to buy healthy foods, which they reported to be too expensive. as one said: sodas and all that, it's easy to last longer, but it's like trying to do that, they last through the end of the month, and healthy food is hard . . . you're trying to make your kids eat healthy, but it's really expensive at the same time . . . . participants in each focus group expressed gratitude for the snap program; however, the sentiment expressed most frequently was that snap benefit levels are inadequate to meet participants' food needs. additionally, many participants described negative experiences with snap, such as challenges with eligibility requirements or benefit formulas, and difficult communications with caseworkers. the most frequent issue raised about snap was that benefit levels are too low to provide food security and support an adequate, healthy diet. as one said: . . . what they give us is not enough for one month, that they should try to help us a little more . . . . they should think about the children because more than anything else, the food you ask for is for them, they should think about what hurts our children. many participants felt that snap eligibility and benefit calculations did not adequately account for their high costs of living. while this topic arose in all focus groups, it was more prevalent in the three groups conducted in los angeles, san francisco, and san mateo counties. in these areas, the cost of housing was routinely discussed as a major challenge. even in the group conducted in a homeless shelter, a participant talked about trying-and failing-to secure snap benefits when she and her husband both worked full-time at low wages, despite their inability to afford rent and other expenses which caused them to lose their housing: it's really hard out here . . . i'm pretty sure all of us pay our taxes, you know, we pay our dues. we do it, everything that we needed to be doing, but yet still we get slapped in the face like, 'no, you can't qualify for that because of this and that.' and that makes it even more stressful, you know? in the rural county, where housing costs are lower but transportation options are limited and communities are geographically dispersed, participants raised the cost of gas as a major barrier to food security. as one rural participant said: you have to go back and forth and be able to get to different stores and then maybe be able to go back to a different store in order to get the best prices and everything, but then of course, [gasps] 'that costs gas.' participants raised a number of challenges related to snap administration-both with program rules and with customer service and communications. many described these experiences as leaving them feeling undignified, disrespected, or not cared about. for example, some participants referred to the minimum $ snap benefit this way: participant : i think giving $ a month to anyone is ludicrous. it's like an insult. a number of participants reported challenging experiences related to snap customer service when dealing with issues of eligibility, enrollment, and participation. one participant said: there are times when you are disappointed when you go to ask for help, because some workers make you feel that the help you are going to ask for is coming out of their paycheck. but the communications for this welfare office . . . i have called them and called them and called them and you know, they won't return any phone calls . . . they don't want to talk to me. i don't know why, but maybe it's just the way they treat everybody. finally, a number of participants described confusion and lag time related to frequent changes in their household circumstances that impact their benefits. these changes included adding family members, children leaving the household, changes in employment or eligibility for other public programs, and missing a snap administrative deadline, for example a recertification of income eligibility. lag time refers to delays in budget adjustments when participants with hourly jobs, for example, follow stringent rules about reporting income fluctuations and experience a delayed response in adjusting their benefit that does not align with their needs. participants generally reported that these situations were confusing, that they struggled to reach caseworkers to get their questions answered, and that the result was uncertainty about the level of benefit they would be receiving in any given month. one participant said: . . . i applied for unemployment, but i was never granted, but i applied. somewhere in the system . . . it told them that i-i was receiving benefits from unemployment, which i wasn't . . . but calfresh cut it, like majorly, like % . . . participants in two of the four groups discussed challenges related to benefit levels declining when their earned income increases. one said: . . . when you go to work and make your check and then they cut your food stamp down and now, you've got to spend your cash now. it's supposed to be for the bills and you ain't got cash for the bills and it's just a vicious circle. another participant said that the lag time in response to situational changes meant that needs and benefit levels were not always aligned: when it goes down, they decrease it in so many days, or weeks, or months after you make the amount. so then you go down again in the amount that you're making and so then it isn't working out. you don't have crap when you need it and you have more when you don't. these changes in benefit levels due to program administrative policies create further volatility and uncertainty in snap recipients' finances and compromise their food security. in california, snap benefits are distributed by county social services agencies, and each jurisdiction makes its own decision regarding how and what they communicate with snap participants. as such, participants in the four focus group counties reported slightly different experiences with official communications related to the benefit disruption. in every group, participants reported receiving the additional benefits prior to receiving formal communication from the snap administrative agency. in two of the counties, participants said they never received communication from their county agency or caseworker regarding the benefit disruption, but some participants called the agency to find out why they had the extra money. in one of these counties, one participant said that she used a mobile app, available through the county social services agency, and that the app provided information about the disruption. however, another participant in that county had not gotten the information, saying: like, i would have rather have them communicate clearly about what they were doing that month, because i never got the message . . . so i didn't know. in the other two counties, at least some participants reported getting a phone call from the county social services agency. these calls reportedly came at least a day or two after the benefits were distributed, and in some cases participants had spent the benefits before receiving the official notification. in some groups, participants reported learning about the disruption from news stories or from social media or word-of-mouth. one said: i was hearing stuff about government and stuff like that and everything. so i guess that's why it was getting messed with, federal stuff. across all groups, confusion about the benefit disruption was discussed repeatedly. in some cases, the disruption occurred while participants were seeking benefit adjustments for other reasons. as one participant said: . . . i turned in my thing and told them, 'hey, i only got this. i think i should get an increase from my $ .' and . . . so i didn't know about any of this other stuff going on and them doing their added thing for the government. and so i was confused. i was like, 'okay is that my-is that how much they increased it? they just gave me an extra $ . [laughs] what's going on?' and then i called . . . and they explained it, but yeah, that was very confusing to me . . . although it was the exception rather than the rule, in every county, at least one participant reported spending the february benefit before understanding why they had received the additional funds. various reasons were provided to explain this. for example, in two of the groups, at least one participant reported worrying that the extra benefits received in january would disappear if they were not spent before the end of that month. as one group discussed: participant : i have also heard that about the food stamps um, um, if you don't use 'em, you lose 'em . . . . so you be afraid to-and you can't get anybody to answer the question. she's right. they just send you letters threatening you that, but they never do, do it. another participant described the impetus for spending the unexpected benefit quickly this way: i was worried that i needed to spend it because with the wacky, screwy way everything is going, i didn't know if they would take it away with the government shut down, so i had to spend the whole thing. but i got stuff that i could freeze . . . in three of the groups, participants reported thinking that the additional benefits received in january were an administrative mistake. participants expressed various, and sometimes mixed emotional responses to this "mistake." one said, "we thought we had won the lottery." another said: i was scared. i said, 'the government made a mistake . . . i got scared, but i was happy, i thought they were wrong, it scared me but made me happy at the same time. in every focus group, at least one participant thought that the national snap program was ending, and that the extra benefits they received were being provided as a final "bonus" to participants. in one county, this feeling was linked to a message the local social services agency circulated to participants, expressing uncertainty about the march benefit distribution. in other cases, the idea that the program was ending came from word-of-mouth or other sources. as one participant said: the news i heard said maybe there were going to be changes, that they were not going to give benefits anymore, and that was why they paid the month in advance . . . i thought that there was not going to be any help anymore . . . the help is over. another said: i thought that maybe they were going to take it away, because i heard rumors that they were about to take the aid away. so, i said, 'maybe they gave us the last month because they want to say that there is not going to be more money.' . . . i imagined it this way, but many people were saying that they were going to remove the stamps and that they were not giving them anymore. in each group, at least one participant talked about splurging in january or treating themselves or their children to something a little bit extra or special. in three of the four groups, this topic was raised multiple times. in some cases, the extra spending was due to confusion or incorrect information about the reason for the additional money in their account. as one said: we splurged in january, so, um, and not realizing that we were not gonna get benefits in . . . february . . . you know, in february, um, we just ate less. some participants talked about sharing what they thought were extra benefits with family and/or friends. one said: i'm going to eat, i'm going to eat well, healthy and well. first, i bought meat, to make roast meat for my children that day, and i invited my siblings who live opposite my house. i told them, 'let's eat roast meat. help me.' so then when they doubled it, i was like, like i said, we took a bunch of friends to take them to safeway to get them food and we ate good. um, we ate things that we couldn't eat, like a steak. in other cases, participants knew that the extra funds were for february's benefits, but they still changed their behavior in january. one said: i did hear in the news, but i'm like, 'let me go get what we need.' but when you go to the market, you grab more to eat, especially when the kids are there, and you have young kids . . . . and i know it's bad, but sometimes as mothers, you don't know how to say 'no.' . . . especially you grew up with parents that struggled too . . . so, for my kids, i try to give them what i didn't have . . . it was a struggle, that month. across all groups, the overwhelming sentiment was that the disruption in snap benefits had a negative impact. some people referred to this in a general way, saying things like, "i think we pretty much all agree it kind of screwed us" or "it messed people up." one said, "it was a . . . going from having extra to having too little." only a couple of participants, at least one of whom received the minimum $ monthly distribution, reported that the disruption had little or no impact. the most discussed impact was stress, which was raised repeatedly in three of the four groups. for many participants, the stress was related to uncertainty-uncertainty about how to make their benefits last for longer than usual, uncertainty about whether the program was ending, and uncertainty about why they received the additional funds on their cards. as one said: i was stressed because i didn't know what's going on. another said: when we were already in a state of chaos and concern and worry, do not make it worse by doing things that we don't know about, don't understand, don't get information on. although parents of younger children did not indicate that their children were aware of the disruption, one parent of a teen said: in my case, my daughter, the oldest, already notices more or sees things. she said, 'mom, did they advance you the money because they're going to take away your help?' because medical help is also included, she said, 'mommy, are you not going to be able to take me to the doctor, to the dentist anymore?' . . . she was worried. in every group, at least one participant talked about receiving february's benefit in january as an initial relief. receiving the benefit during a time of the month when participants' food budget generally has been exhausted meant some people experienced temporary relief from the usual cycle of scarcity. one participant described the relief this way: you don't even think about it, it's just a big stress relief . . . that's a big burden off your back kinda type of thing, how you gonna survive this month literally by eating is, yeah, that's-that's something you don't have to worry about at that point . . . i was happy because i had a lot of money [laughs] for food. a few participants talked about being able to eat healthier in january. one said: i ate a lot better in january, because i had more. i've been able to go more to get more fresh vegetables . . . . however, the relief quickly turned to stress. one participant described it this way: it's nice to have more benefits, but if you think about it, you're going to spend them, and you still have the whole month of february, and say, 'okay, i spent them. but what about february? what am i going to do? what's going to happen then?' another described the combined relief and concern this way: i was able to get a little bit more with that double benefit. um, i wasn't limited to and trying to make it stretch for that month. i was able to, like, buy stuff to make a complete meal, you know what i mean? and so it was good. you know, it was good and bad . . . across all groups, participants talked about negative food security impacts of the benefit disruption, and some talked about negative financial and health impacts as well. one mother talked about utilizing a new charitable food program in february, after she had run out of money to buy food for her family. she said: the food boxes definitely came in handy, um, um, very appreciative for those. um, different pantries that give out the eggs, rice and things like that because that's what they [the kids] love. well, my daughter [also a snap participant] . . . feeds five people and, um, she said it was really hard for her, because she got all that money in january and . . . she bought a lot of extra stuff, and she just didn't have anything much for february . . . . she stocked up the best she could, but feeding five people and a teenager was very difficult. further, the disruption highlighted the economic uncertainty that snap recipients live with. one participant described the impact this way: i felt the impact and it just took me back to feeling poor. participants described challenges related to financial impacts of the disruption, because most reported spending their snap benefits earlier in the month and running out of money to buy food in february in a way that was different from usual. one said: that's what changed this month. in these last two weeks, i had to take from the money we were saving to pay the rent, which had never happened. for many participants, the disruption to their snap benefits led them to have to adjust their finances in ways that meant they continued to have to deal with the after-effects even after the shutdown itself had passed: she [speaker's daughter] had to use her gas money for food, because she's still kind of playing catch up . . . . she called me several times crying, 'ma, i don't-we don't have enough food. what am i going to do . . . ? you know, i can't afford to this and this and this.' and i can't help her. so there was a lot of times that all she had was like crackers and whatever. so it was very difficult for them. and i can imagine people with families have the same problem. it's a huge domino effect, really. it really, really is, 'cause when you-you're just trying to catch up from . . . february, and here's march and you just have to get extra stuff that you couldn't buy in february, you know, and it's this big old domino effect. a couple of participants talked about going into debt in february in order to have money to buy food. one said: right now, the only difficult decision we have is the stress of paying off what we are borrowing with interest . . . having to use it to pay off the rent. you have to do one thing and fail at another. you get into debt with the cards and then it's a mess. participants reported that the benefit disruption impacted their perceptions of the government and overall feelings of security related to government programs. as one said: you cannot always depend on it [snap] . 'cause, like he said, we didn't expect nothing like this happened. so you can kind of, like, never know. another said: i mean, i'm grateful for the government, you know, for it to help me with the food stamps or whatever. but at the same time, i feel like it's just like they can-all of a sudden within a blink of an eye, they can take it all away. and then what are we going to do? in another group, a pair discussed the new uncertainty: participant : and it's still stressful, because i'm thinking in my head, you know, like, 'okay, this is three months solid now that you've been playing around with the money for these people. what is it going to be? what is-is april going to be nothing?' participant : yeah, that was my major concern. and that-that is very stressful. one participant characterized the increased insecurity of public assistance and the stress it caused this way: additionally, in three of the four focus groups, the sentiment that the benefit disruption shook participants' overall faith in government was raised multiple times. this topic was not discussed in the focus group conducted in spanish in la. it was discussed more frequently and with more emotion in the focus group conducted in rural tuolumne county. one participant said: it's obviously caused a lot of . . . confusion to people and-and the mass hysteria is pointing to, you know, that our government in america can't get your blank [sic] together, to where we're all being in confusion and craziness like this. it's not healthy for us, period. and they just kind of like-like it's nothing on us, like a game or something to them. this isn't a game. this is reality. in another exchange, participants said: participant : participant : it's just disgusting to think that the gover-you know, the government or the powers that be like to have their reason to want that to happen to their people. i mean, i don't understand what the point of doing that to people is. to see if they can take it or not or what, what's the deal here? participant : participant : they don't care, they're getting their paycheck. they don't need food stamps. they get paid whether they work or not . . . participants expressed a number of ways in which they felt the snap program could be improved to better meet their needs and support their families. the recommendations focused on four main issues: improve benefit adequacy by increasing benefit levels. modify eligibility and benefit formulas to better address high costs-of-living as well as the expenses associated with working (e.g., transportation, child care). improve customer service and communications. do not disrupt snap benefits in the future. the most salient recommendation was to increase the snap benefit level. there was strong agreement across participants in all groups that they would benefit from increased snap benefits. when asked what additional benefit amount would meet their needs, responses varied. generally, participants receiving lower benefit levels suggested at least doubling their monthly allotment, such that some participants said an extra $ /month would really help. participants receiving higher benefit levels suggested larger increases, generally ranging $ - /month. in two of the groups, the recommendation that snap benefits be allowed to be spent on hot foods and/or household items, such as cleaning products and toiletries, was raised multiple times. sometimes participants suggested providing this in the context of increasing their unrestricted cash benefits. one participant said: i would, um, actually ask for more cash too, like she was saying. um, if we could, um, be able to use that ebt [snap] money for toiletries, that would, you know, it would just help me a lot. participants recommended that snap could improve both eligibility determinations and benefit calculations by altering the formulas to better account for costs of living and working. in the three groups conducted in urban or suburban settings, changing the eligibility and benefit formulas to better account for high rents was a priority. in the rural setting, participants recommended more effectively considering transportation costs, as they reported high gas expenses for getting to work, school, grocery stores, and charitable food sites. further, participants working in jobs with fluctuating hours recommended that the program develop more responsive mechanisms for adjusting to these changes. participants experiencing changes in family composition, access to public welfare programs, and other changes also recommended that the program become more agile in order to provide the needed support during the timeframe it would be most beneficial. in the rural focus group, participants agreed that they would prefer snap benefits to always be distributed to all participants on the first of the month, as they were in march . participants said that because they receive cash on the first of the month-either through paid employment, disability, or social security-it is challenging not to receive snap benefits at that time. as one said: . . . when i get my [non-snap] money, i go to walmart and buy the stuff i need that i have to pay for and i like to buy some of the food there, but then i have to go back out when i get it [snap benefits] on the sixth and go to grocery outlet and then back to walmart to buy the less expensive stuff. so it's-it's a matter of convenience, but also the cost of gas, time, energy . . . participants in some of the focus groups specifically talked about improving snap customer service, especially improving communications with participants. in one group, participants recommended improved communications if a government shutdown or other disruption were to happen again, saying: i would like to see more literature if that happens again, so that people don't go overspending and they have enough. participants in another group recommended that a wider variety of communication channels be utilized in the event of a future disruption, such as us mail, phone, email, and social media. participants' stories highlighted their experiences of routine deprivation and struggle, experiences that for some were initially relieved by the disruption when they received february benefits in january, but for nearly all were ultimately exacerbated by it. the most salient themes to emerge were related to routine food insecurity, challenges of affording an adequate and healthy diet, and the inadequacy of snap benefits to meet participants' food needs, all of which were intensified by the shutdown. despite sharing multiple stories of acting with human agency to cope with difficult life circumstances, as has been reported in earlier studies [ , ] , many participants described experiences of feeling vulnerable and barely making ends meet. participants repeatedly expressed that the snap benefits they receive are not enough to provide food security or to enable them to eat an adequate healthy diet throughout the month. participants described eating cheap foods, foods they do not necessarily like but can afford, and not eating meats, vegetables, and other foods because they are too expensive. prior qualitative studies also have reported that snap participants routinely are unable to meet their food needs with the resources available to them, and that participants perceive healthy foods to be unaffordable [ , ] . in some cases, participants described feeling relief prior to realizing the additional benefit money was an early payment of february's benefit, amplifying the vulnerabilities inherent in snap and creating incremental stress on an already stressed population. interestingly, some participants said that, even though they knew the additional benefits were for february, having extra money for food at the end of the month in january-when they are accustomed to being unable to buy enough food-provided temporary relief despite knowing it would cause future hardship. some participants said they were able to eat healthier; parents reported feeling that they could treat their children to favorite foods; others invited friends to share a meal. these stories highlight the basic social feeding experiences that snap participants are denied on a regular basis. having what felt like extra money in january enabled participants to do what many americans likely take for granted: treating themselves or their children, sharing food with others, or eating the healthy foods that allow them to feel well. the challenge the government shutdown presented to social services agencies was not within the scope of this study, but must be acknowledged. that participants received snap benefits for february at all can, in many ways, be seen as a tremendous success and social services agencies deserve much credit for scrambling to ensure snap funds were distributed. however, it is critical for decision makers, service providers, and the public to understand that the federal government shutdown and subsequent snap benefit disruption felt devastating to many snap participants. in california, while some social services agencies communicated with participants via mobile apps, email, or phone messages, many of the study participants did not receive any communication about the benefit disruption from their agency. even among those who did report receiving agency communications, many said they came after the benefits were received. while we did not probe in depth about how participants would like to receive communications in the future, we did hear that participants have different levels of access to communications technologies. while some relied on landline telephones or network tv news, others were using cellphones, apps, or reading newspapers. while more work is needed to understand local contexts and optimal communications, our work suggests that using multiple channels of communications is likely to be critical due to the variety in access illustrated in our focus groups. most participants talked about this period being very confusing. participants described knowing it would be difficult not to spend the benefits too early and feeling worried about how they could "stretch" their money to make it last. many participants reported feeling like they are at the mercy of the government support, for some because they are disabled, for others because they are retired or lack access to more stable or higher paying work opportunities. these participants expressed fear and anxiety about having safety net support when they need it in the future. the confusion, stress, and ongoing uncertainty that resulted from the shutdown were discussed in all focus groups, and in some with a lot of emotion. many participants also expressed increased or newfound distrust of the government and lack of confidence in the safety net as a result of the government shutdown and snap benefit disruption, and felt that they were pawns in a political game that did not fully consider the consequences to them and their children. many participants described financial circumstances that change regularly and felt that snap benefits are not able to keep pace with the changes. studies have found that income volatility is widespread, with more than a third of american households facing annual income spikes and dips [ ] . considering fluctuations in income when creating administrative policies related to budget adjustments for snap would help to meet participants' needs. a recurring theme in all four focus groups was the desire for the safety net system to treat snap recipients with more respect and protect their sense of dignity. although there is research suggesting that the relationship between temporary assistance for needy families (tanf) caseworkers and their clients may influence client outcomes, little is known about effects of relationship quality between snap caseworkers and their clients [ , ] . our results emphasize the importance of participants being treated with respect by frontline social services staff and caseworkers when they apply for benefits. another way participants suggested demonstrating respect is by improving communications to recipients and explaining program changes or administrative procedures in a more timely manner. these findings add to what we know about participant frustrations with snap benefits being interrupted, reduced, or cancelled without prior notification [ ] . participants also suggested that respect can be demonstrated by increasing benefit levels. providing a reliable safety net for families who fall on hard times is another way of showing respect and many studies show that snap benefits fall short of what households need to ensure a nutritionally adequate diet [ ] [ ] [ ] [ ] [ ] . while snap is intended to supplement a family's food budget, snap is the only mechanism by which many families are able to receive minimum levels of nutrition and reduce food insecurity [ ] . while most of the findings reported were similar across the four focus groups, a couple of differences were notable. for example, the group in rural northern california reported routine use of charitable organizations and positive experiences with them, while they reported more negative feelings about the government. in contrast, the latina mothers in los angeles did not report accessing the charitable food system, and expressed less mistrust in the government. these differences align with recent studies suggesting that political trust is generally higher among latinx groups [ , ] . similarly, challenges related to high costs of housing were raised routinely in the los angeles, san francisco, and san mateo focus groups, but housing costs were not discussed in the rural tuolumne county group. there, high costs related to vehicle access and buying gas were discussed frequently, yet these costs were not raised in other groups. it is clear that housing costs differ across geographic location and research supports the importance of adjustments on poverty thresholds for geographic variations in housing costs [ , [ ] [ ] [ ] [ ] . while participants report engaging in a variety of coping behaviors to fend off food scarcity, many strategies require tradeoffs that often compromise health and may have long-term negative financial repercussions [ ] . prior research has demonstrated that snap participants do not completely understand the way in which the snap program calculates benefits [ , ] . the benefit disruption and the way in which participants talked about how they budget and spend their benefits also suggests that participants do not understand the household food budget assumptions behind the snap program structure. while participants clearly express-and research supports-the need to increase snap benefits [ , ] , participants deserve to be given information about the program structure. the snap-education program offers food resource management education to a small fraction of snap-eligible people each year [ ] . better access to financial literacy education could help some participants better understand how snap benefits are calculated, and how they can utilize benefits optimally. although financial literacy would not be expected to fix the challenge of benefit inadequacy in the absence of increases, given the known inadequacy of available support, it may help some participants minimize the harms and this knowledge could help to empower participants to advocate for change. this study has several limitations. it was conducted in response to an unexpected disruption in snap benefits caused by a sudden and prolonged government shutdown. as such, the research was conducted quickly in order to capture participants' experiences during the shutdown disruption. we used a convenience sample of counties and participants in california. while we represented different parts of the state and included different population groups, we missed many others. many of the findings were consistent across groups, but some experiences or concerns that were raised in only one group would have benefitted from testing among additional participants. in no way did this study capture the experiences of all california snap participants; more focus groups with diverse participants would be needed to reach saturation. all researchers reviewed at least two transcripts, but not every researcher on the team reviewed all four transcripts. we met regularly to discuss findings, but because all members of the research team work in public health nutrition, it is possible that our shared training and biases have influenced the results. study results reveal the challenges snap participants faced during the government shutdown, even when benefits were issued early in an attempt to mitigate harm, and shed light on routine struggles of snap participants with food insecurity. participants recommended: ( ) improving benefit adequacy by increasing benefit levels; ( ) modifying eligibility and benefit formulas to better address high costs-of-living as well as the expenses associated with working; ( ) improving customer service and communications; and ( ) not disrupting snap benefits in the future. a reliable social safety net system provides citizens with support they can depend upon when they fall on hard times [ ] . given that more than million americans rely on public assistance to meet their basic need for food, with participation currently spiking due to the covid- pandemic that began in early , it is an important time to increase benefit levels, as has been suggested in multiple studies. under the current administration, various regulatory changes have chipped away at the federal antipoverty program support that families rely on [ ] . the recent federal adoption of measures to reduce snap enrollments-such as the public charge rule and the time limit on snap participation of able-bodied adults without dependents-suggest that political concerns about cost and dependency currently outweigh concerns about the nutritional health of the poor [ ] [ ] [ ] [ ] . covid- has stalled implementation of some of those policies and highlighted the importance of safety net programs, particularly the urgency to feed people during a health crisis. while federal nutrition programs have contingencies built into them to support response and recovery efforts, the pandemic has worsened conditions for families who have the most difficulty affording adequate food [ ] [ ] [ ] . provisions included in the families first coronavirus response act are providing additional snap benefits, but, by authorizing usda to provide the maximum benefit allotment to all households, the provision will not help the nearly % of snap households that are already receiving the maximum snap benefit [ , ] . further, policies must be established to protect funding for social safety net programs such as snap if future shutdowns occur. the security and health of the nation's most vulnerable people is too much to risk for political expediency. we are not aware of any other research that captured the experiences of the millions of snap participants who were impacted by the government shutdown and subsequent benefit disruption. their voices and experiences deserve to be heard and known by all stakeholders involved in making snap policy decisions as well as those serving snap participants. this study suggests that the federal government shutdown and subsequent disruption in snap benefit distribution created short-and longer-term negative impacts to snap participants, including exacerbating food insecurity, burdening participants with additional stress and confusion, causing financial challenges, and eroding some participants' faith in government. the disruption highlighted both the importance and the limitations of snap in reducing food insecurity among people facing economic disadvantage. new strategies for supporting individuals and families struggling to make ends meet are needed. snap can be an important part of the solution, but revisiting eligibility criteria, benefit levels, and customer service practices, as well as establishing policies to protect program participants from future shocks are needed. conducting research to test solutions can help ensure fair, equitable, and effective policies are adopted. a closer look at who benefits from snap: state-by-state fact sheets how much does the supplemental nutrition assistance program reduce food insecurity? measuring the effect of supplemental nutrition assistance program (snap) participation on food security; nutrition assistance program report; mathematica policy research household food security in the united states participant voices: examining issue, program and policy priorities of snap-ed eligible adults in california hunger & health: the role of the supplemental nutrition assistance program in improving health and well-being committee on examination of the adequacy of food resources and snap allotments; food and nutrition board; committee on national statistics; institute of medicine how far do snap benefits fall short of covering the cost of a meal? more adequate snap benefits would help millions of participants better afford food modernizing snap benefits; the hamilton project effects of the decline in the real value of snap benefits from do high food prices increase food insecurity in the united states? map the meal gap : highlights of findings for overall and child food insecurity the thrifty food plan is not thrifty when labor cost is considered not enough money or not enough time to satisfy the thrifty food plan? a cost difference approach for estimating a money-time threshold supplemental nutrition assistance program: initiatives to make snap benefits more adequate significantly improve food security, nutrition, and health recommendations from snap participants to improve wages and end stigma multiple barriers to economic opportunity for the "truly" disadvantaged and vulnerable. russell sage found it's about time: how work schedule instability matters for workers, families, and racial inequality income volatility complicates food assistance links of the supplemental nutrition assistance program with food insecurity, poverty, and health: evidence and potential income volatility and food assistance programs exhaustion of food budgets at month's end and hospital admissions for hypoglycemia. health aff food instability and academic achievement: a quasi-experiment using snap benefit timing design issues in usda's supplemental nutrition assistance program: looking ahead by looking back importance of the supplemental nutrition assistance program in rural america revisiting the supplemental nutrition assistance program cycle of food intake: investigating heterogeneity, diet quality, and a large boost in benefit amounts federal government shutdown enters second week with no resolution in sight as government shutdown persists, americans feel the bite food stamps for millions of americans become pawn in shutdown fight announces plan to protect snap participants' access to snap in february, release no. but millions face cuts if shutdown continues continuing snap in a government shutdown federal shutdown and calfresh: plan for early issuance of february benefits by january plan for single day issuance on pain from the government shutdown spreads. this time it's food stamps. kaiser health news because of shutdown, february food stamps disbursed on wednesday. the philadelphia inquirer captive audience? strategies for acquiring food in two detroit neighborhoods income volatility: new research results with implications for income tax filing and liabilities perceived welfare caseworker support and psychological distress among low-income urban women with children in the oxford handbook of social and political trust trends by geography, tenure, and household income measuring poverty: a new approach geographic variation in the cost of living: implications for the poverty guidelines and program eligibility geographic variations in cost of living: associations with family and child well-being food and financial coping strategies during the monthly supplemental nutrition assistance program cycle analysis of supplemental nutrition assistance program education (snap-ed) data for all states study before the human resources subcommittee of the house committee on ways and means behind trump's plan to target the federal safety net the supplemental nutrition assistance program (snap): history, politics, and public health implications new snap rule would cost many of nation's poorest their food aid president's budget would cut food assistance for millions and radically restructure snap administration should reverse anti-immigrant policies that will worsen impacts of health and economic crises snap covid- emergency allotments guidance emergency allotments phase guidance . us department of agriculture this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license acknowledgments: this study was funded by an opportunity grant from the university of california, division of agriculture and natural resources. elsa esparza was supported by a university of california global food initiative fellowship. the authors declare no conflicts of interest. key: cord- - phc wds authors: zhao, ai; li, zhongyu; ke, yalei; huo, shanshan; ma, yidi; zhang, yumei; zhang, jian; ren, zhongxia title: dietary diversity among chinese residents during the covid- outbreak and its associated factors date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: phc wds covid- , a public health emergency of international concern, has imposed enormous challenges on the health system, economy, and food supply and has substantially modified people’s lifestyles. this study aimed to ( ) explore the dietary diversity during the lockdown time in china and ( ) examine factors associated with dietary diversity including socio-economic characteristics, sources for food and food purchases, and specific dietary behaviors responding to covid- and isolation. a cross-sectional questionnaire-based survey was conducted online in march . multi-stage sampling was used to recruit participants living in hubei province and other parts of china. dietary diversity was assessed using the household dietary diversity score (hdds) and clustering analysis was used to categorize people with different propensities of methods for purchasing or obtaining foods. logistic regression was used to model the associations among hdds, participants’ characteristics, approaches to purchase or obtain food, and behaviors adopted to cope with covid- . results: a total of participants were included in the analysis. the overall mean hdds was . ± . , and the median ( th, th) was ( , ). there were relatively low consumptions of fish, legumes, and miscellaneous foods (e.g., processed food like snacks and beverages). after adjusting for age, family income, and geographic regions, people living in places where laboratory confirmed covid- cases were above (or(adjusted) = . , %ci . , . ), or living in hubei province (or(adjusted) = . , %ci . , . ) had a lower hdds. during isolation time, the most common sources for food and food purchases were in-house storage and in person grocery shopping. more than half of the participants ( . %) purchased food at least once via online ordering and delivery services. there was no significant difference in hdds among people with distinct dependences on different ways to obtain or purchase food (i.e., dependence on in-person grocery shopping, dependence on both in-house storage and in-person grocery shopping, or dependence on online food purchasing). we also identified a total of . % participants who consumed certain foods or nutritional supplements to cope with covid- , which included vitamin c, probiotics, other dietary supplements, alcohol, and vinegar. people who reported these specific dietary behaviors had a significantly higher hdds (or(adjusted) = . , %ci . , . ) than those who did not do so. this study revealed an overall good dietary diversity among the studied chinese residents during the covid- pandemic. however, we observed a lower dietary diversity among people living in areas with a high number of confirmed covid- cases. online ordering and delivery services were popular and could serve as a feasible method to obtain and purchase food, contributing to ensure diversified diets during the time of lockdown. certain dietary behaviors associated with covid- were also identified and had significant impacts on hdds. the coronavirus disease ("covid- ") has emerged rapidly as a respiratory disease caused by the severe acute respiratory syndrome coronavirus (sars-cov- ), responsible for an outbreak that took place in december in wuhan, china [ ] . due to the highly contagious nature of this novel coronavirus, hubei and other provinces in china have adopted several unprecedented measures to control the transmission of covid- including the suspension of public transportation, restricted access to communities, closure of public spaces, and management such as hospitalization and isolation of confirmed and suspected cases [ ] . chinese residents living both in and outside hubei had been required to stay at home to self-isolate since january . by april , this virus had reached a total of countries, resulting in more than . million laboratory-confirmed infections and , deaths [ ] . consequently, more than countries and areas including italy and regions in the united states have started implementing similar lockdown and "shelter in place" measures as those in china since april. even though most supermarkets and grocery stores remain open during the isolation period, food supply as well as safe and adequate access to foods have become major concerns regarding the essential needs among the general populations due to the restrictions of transportation, self-reduction of outside activities, and lack of enough labor force, especially in areas severely affected by covid- . on march, the united nations stated that covid- has threatened the food supply chain globally, and it is estimated that this situation may worsen in april and may [ ] . foods contain essential nutrients and important phytochemicals that not only support basic biological functions in living organisms, but also exert protective and complementary effects on preventing and treating diseases including infections [ ] [ ] [ ] . although no nutrients have been scientifically proven to specifically benefit the prevention or treatment for covid- , a balanced and diversified diet is, undoubtedly, crucial in maintaining a properly functional immune system and providing sufficient nutrients for recovery [ , ] . however, as above-mentioned, restriction in social activities and mobility impose potential barriers in people's access to food. on the other hand, when a stressful situation of this magnitude arises, people often experience substantial changes in their emotions, which may subsequently lead to modifications or development of some dietary behaviors such as seeking relief or cure from certain foods [ ] . those alterations in activities and behaviors during a pandemic period collectively influence and potentially impair food diversity. currently, little is known about the dietary diversity during covid- pandemic. china has been experiencing a rapid growth of online food ordering and delivery services in recent years. according to "chinese restaurant super digital time insight ", in , the total value of food delivery service reached . billion chinese yuan [ ] . especially, in the recent self-isolation and "stay at home" time, online food shopping has gained in popularity because of its apparent role in reducing unnecessary person to person contact. in china, delivery services including food delivery have resumed since january, and by early february, most delivery services have gone back to normal and cover most parts of china [ ] . people are able to purchase not only processed foods like fast foods and restaurant takeout, but also fresh produce (i.e., fruits and vegetables), fresh meat, and grains via online food ordering and delivery services, thereby possibly increasing food accessibility. for this reason, proper measurements and evaluations are needed to investigate the potential benefits of this relatively novel and modern approach for food purchasing in maintaining dietary diversity during isolation time. to the best of our knowledge, no study has reported on dietary diversity during isolation time in china and other areas. this study was conducted via a quick online survey to assess dietary diversity among chinese residents during the time of isolation and "staying at home" due to covid- and to explore its associated factors. this cross-sectional study was composed of a questionnaire-based survey conducted in march via chinese e-questionnaires using wenjuan xing (wenjuan xing tech co. ltd., changsha, china), a widely used online platform in china and distributed via the most common social media used in china "wechat" (tencent inc. shenzhen, china). a multistage sampling method was used. we purposefully selected and included people living in hubei province, the hard-hit area by covid- outbreak in early , china and people living in north, south, and central china. then, the "snowball sampling" method was used to recruit more participants. to identify the respondents' attitude in completing the questionnaire, one question "did you seriously look through the questions and answer the questions according to your actual situation" appeared in the middle part of the questionnaire. a total of chinese residents participated in this survey. the inclusion criteria were ( ) living in mainland china, and ( ) aged from - years old. the exclusive criteria were ( ) people infected with covid- , ( ) who have disease which impacts of normal eating, and ( ) who did not seriously respond to the questions in this survey. after all the data had been collected, the final analysis included participants (people who did not seriously respond to the questions (n = ), who were living outside mainland china (n = ), who were aged < y or > y (n = ), who were infected with covid- (n = ), or who had missing data on key questions (n = ) were excluded. one participant self-reported no food intake in the past several days was also excluded). the geographical distribution of participants is displayed in figure . this cross-sectional study was composed of a questionnaire-based survey conducted in march via chinese e-questionnaires using wenjuan xing (wenjuan xing tech co. ltd, changsha, china), a widely used online platform in china and distributed via the most common social media used in china "wechat" (tencent inc. shenzhen, china). a multistage sampling method was used. we purposefully selected and included people living in hubei province, the hard-hit area by covid- outbreak in early , china and people living in north, south, and central china. then, the "snowball sampling" method was used to recruit more participants. to identify the respondents' attitude in completing the questionnaire, one question "did you seriously look through the questions and answer the questions according to your actual situation" appeared in the middle part of the questionnaire. a total of chinese residents participated in this survey. the inclusion criteria were ( ) living in mainland china, and ( ) aged from - years old. the exclusive criteria were ( ) people infected with covid- , ( ) who have disease which impacts of normal eating, and ( ) who did not seriously respond to the questions in this survey. after all the data had been collected, the final analysis included participants (people who did not seriously respond to the questions (n = ), who were living outside mainland china (n = ), who were aged < y or > y (n = ), who were infected with covid- (n = ), or who had missing data on key questions (n = ) were excluded. one participant self-reported no food intake in the past several days was also excluded). the geographical distribution of participants is displayed in figure . [ ] . bubble size in the bubble plot represents the sample size of every investigation point. the questionnaire contained four parts: socio-demographic characteristics, household food diversity, sources of the food (methods for purchasing or obtaining food), and specific dietary behaviors to cope with covid- . the number of confirmed cases by march in each province in china was obtained from the distribution of covid- report that is accessible on the chinese center for disease control and prevention website (imported cases not included) [ ] . the isolation status (still working outside [ ] . bubble size in the bubble plot represents the sample size of every investigation point. the questionnaire contained four parts: socio-demographic characteristics, household food diversity, sources of the food (methods for purchasing or obtaining food), and specific dietary behaviors to cope with covid- . the number of confirmed cases by march in each province in china was obtained from the distribution of covid- report that is accessible on the chinese center for disease control and prevention website (imported cases not included) [ ] . the isolation status (still working outside home, self-isolation at home, close contact isolation, and infected with covid- ) and frequencies of outside activities were also recorded. we evaluated dietary diversity using household dietary diversity score (hdds), a measure that reflects household food accessibility [ ] . in total, the intakes of food groups over the last h (food eaten outside and at home) were investigated including ( ) cereals; ( ) roots and tubers; ( ) vegetables; ( ) fruits; ( ) meat, poultry, and offal; ( ) eggs; ( ) fish and seafood; ( ) pulses, legumes, and nuts; ( ) dairy products; ( ) oils and fats; ( ) sugar and honey; and ( ) miscellaneous such as condiments, snacks, and beverages. values for each food group were assigned as " " or " ", " " for not-consumed and " " for consumed in the last h. proportions of participants who consumed each food group were calculated. also, the total scores of groups were calculated for estimating the dietary diversity, which could range from to . a higher score indicates a higher dietary diversity. to investigate food sources during isolation time, we asked participants to select from four of the most common approaches to obtain or purchase different kinds of foods ( food items in the hdds) based on the ones that they had used. the four approaches were ( ) using food stored in house before self-isolation; ( ) purchasing food from traditional markets and grocery stores in person; ( ) using online food ordering and delivery services (including purchasing both raw ingredients and prepared meals from restaurants); and ( ) dependent on government-or community-based food distribution. we also explored certain dietary strategies that participants adopted to cope with covid- by using several "yes" or "no" questions such as "whether participants increased consumption of vitamin c, probiotics, any other kinds of dietary supplements, chinese herbs, vinegar, and alcoholic beverages or not". in addition, one open question was used to identify any other previously unspecified foods consumed to cope with covid- . participants answered the questionnaire anonymously. informed consent was obtained from participants who confirmed their willingness to participate voluntarily prior to the survey. data were analyzed using the software sas version . (sas institute, cary, nc). hdds were presented as means ± standard deviation (sd) and median ( th, th percentiles) and were tested using the independent t-test and variance analysis. the proportions of participants who consumed each food group in the last h were presented as numbers (percentage). to explore the participants' behaviors in acquiring foods, we first calculated the propensity of choosing different approaches for obtaining or purchasing foods among our participants. for each food group, there were four pre-defined approaches (in-house storage, in-person grocery shopping, online shopping, or government and community-based food distribution programs) to obtain the food. we gave one point when participants purchased or obtained food from each food group with one of the four approaches. the total propensity score of utilizing each approach to obtain or purchase groups of food for individual participants could range from to . based on the total propensity scores of each approach, major patterns of purchasing and obtaining foods were identified with the hierarchical cluster and k-means clustering method. we first randomly selected % of participants that were then used in the hierarchical cluster analysis to determine the proper number of clusters. three clusters were identified by k-means cluster analysis. people in cluster showed dependence on in-person grocery; people in cluster depended on both in-person grocery and in-house storage; and people in cluster showed more dependence on online food ordering and delivery services. hdds was divided into two groups based on its median (high (>=median) and low (<median) hdds). logistic regression was used to model the associations among hdds, participants' characteristics, approaches for food purchasing/sourcing, and certain dietary strategies to cope with covid- . we adjusted for potential socio-demographic confounders (age, household average annual income, and geographic region) in the fully adjusted models. a p-value < . was considered statistically significant in all analyses. the heat map of the geographical distribution of covid- cases in mainland china and the bubble plot of study sample sizes were created using r version . . with the packages "ggplot ", "maptools", "rgdal", and "sp" [ ] . the base map was obtained as a shape file from the national fundamental geographic information system, china. cumulative numbers of confirmed cases of the covid- were calculated at the province (autonomous regions or municipalities directly under the central government included) level and coded with color. the lighter the color, the fewer the cases. bubble sizes in the bubble plot proportionally represent the numbers of participants at each sampling point. a total of participants were included in the analysis. the overall average hdds was . ± . , median ( th to th) is ( to ). proportions of participants who consumed each food group in the last h are shown in table . the cereals group had the highest consumption, whereas the fish, legumes, and miscellaneous had relative low consumptions. compared to people aged above , those aged from - years have a diet with a lower diversity score. living in urban areas was associated with a significantly higher hdds than those living in rural areas. meanwhile, the hdds increased with family income ( table ). during the isolation time, the most common food sources were in-house storage and in-person grocery shopping. the participants' choices of approaches to obtain or purchase foods during isolation are shown in figure . the most frequently purchased foods for in-person grocery shopping were fruits ( . %), vegetables ( . %), and eggs ( . %). a total of . % people used online ordering and delivery services at least once. miscellaneous food (such as condiments, fast food, and snacks) ( . %), fruits ( . %), and dairy products ( . %) were the most commonly purchased foods via online food ordering and delivery services, whereas oil and fats and sugar and honey were the least purchased. during the isolation time, the most common food sources were in-house storage and in-person grocery shopping. the participants' choices of approaches to obtain or purchase foods during isolation are shown in figure . the most frequently purchased foods for in-person grocery shopping were fruits ( . %), vegetables ( . %), and eggs ( . %). a total of . % people used online ordering and delivery services at least once. miscellaneous food (such as condiments, fast food, and snacks) ( . %), fruits ( . %), and dairy products ( . %) were the most commonly purchased foods via online food ordering and delivery services, whereas oil and fats and sugar and honey were the least purchased. there were ( . %) participants intentionally consumed dietary supplements, chinese herbs, or specific foods because of covid- . a total of . % of participants consumed various dietary supplements or chinese herbs ( . % for vitamin c, . % for probiotics, . % for other dietary supplements, and . % for chinese herbs) to cope with covid- . meanwhile, there were . % and . % of participants who once purposely consumed alcohol and vinegar to cope with covid- . hdds was further divided into two groups based on its median value (hdds = ) and used as a binary outcome (< = = low hdds; >= = = high hdds). logistic regression was used to explore the associations among hdds and the factors listed in table . we found that people who lived in the places where laboratory confirmed covid- cases were above or in the hubei province had significant lower odds of high hdds. isolation status, frequencies of outdoor activities, and frequencies of going out to purchase food were not associated with hdds. based on k-means clustering analysis, participants were clustered into three groups. people in cluster showed dependence on in-person grocery shopping for food; people in cluster depended on both in-person grocery and in-house storage; and people in cluster depended mostly on online food shopping. hdds was not associated with dependences on different approaches to purchase food. interestingly, people who reported adoptions of certain dietary behaviors to cope with covid- had higher odds of being in the high hdds group than people who did not report doing so. as a declared public health emergency of international concern, covid- has rapidly spread from wuhan, hubei to other parts of china and countries worldwide. this pandemic imposes enormous challenges on the health system, economy, and food supply globally and locally [ , ] . meanwhile, covid- and subsequent measures to prevent its spread have substantially changed people's lifestyle. there have been several studies reporting on people's behaviors during pandemic such as consciously avoiding crowded places and wearing masks [ ] . on the other hand, psychologically, people may feel anxious during outbreaks of infectious diseases, which impacts their sleep quality and other health related quality of life [ ] . nonetheless, there are not many, if any, studies that have examined dietary diversity during an epidemic or a pandemic. we believe that the current study is the first to report dietary diversity among chinese residents during the covid- pandemic period. our study showed an overall good dietary diversity in the study sample, though there was a reduction in diversity in places where more covid- cases were confirmed. to our best knowledge, this is also the first study to explore potential factors associated with dietary diversity in a pandemic. we found dietary diversity did not vary across different approaches to obtain or purchase foods, which provides evidence supporting that online food ordering and delivery services could achieve a similar dietary diversity as in-person groceries and in-house storage do. in addition, several specific dietary behaviors were identified during the covid- outbreak and they contribute to higher odds of high dietary diversity. to ensure a good nutritional status during lockdown, as early as february, the national health commission of china published the "dietary guidelines for the prevention and treatment of novel coronavirus", which advocates a diverse diet for the general public [ ] . the world health organization (who) recommends that "if you must stay at home, maintain a healthy lifestyle-including proper diet, sleep, exercise and social contacts" [ ] . however, the degree to which people have followed these recommendations is unknown. in this study, we focused on dietary diversity and found an overall relatively high diet diversity (average hdds = . ± . , th to th were to ) when the "shelter in place" was in effect in china (the current study was carried out in march). this number is higher than the hdds reported pre-covid- in indonesia ( . ), south africa ( . ), and rural cambodia ( . ) [ ] [ ] [ ] . the hdds is usually used to reflect food accessibility [ ] . access to food is a critical component of food security and plays a vital role in health and health disparities [ ] . several studies have demonstrated that the hdds is inversely associated with the risk of malnutrition. for instance, one study in south africa showed that children with high hdds (> ) had a significantly lower wasting rate [ ] . in ethiopia, when the hdds drops below four, adolescents are likely to suffer from underweight [ ] . it is encouraging that the hdds reported in the current study suggested an overall good food accessibility and low risk of malnutrition among the chinese residents surveyed during the covid- pandemic. among the food groups assessed in the hdds, fish, legumes, and miscellaneous foods had relatively low consumption during the last h. miscellaneous foods include most seasoning, snacks, beverage, and instant meals that can be highly processed. they tend to be deprived of essential nutrients, are energy dense, and are less healthy compared to freshly home-made meals [ ] . many studies have shown that the high consumption of such foods contributes to excessive weight gain and increased risks of chronic conditions such as cardiovascular diseases and obesity [ , ] . these pre-existing conditions have been reported to increase the severity of covid- infection and potentially worsen the disease outcome [ , ] . noteworthy, in our study, the consumption of miscellaneous food was relatively low ( . % participants), which may lower the total dietary diversity score. however, as discussed above, low consumption of processed food may also bring potential health benefits. further investigations are needed to measure the consumption of processed foods and its effects on health during disease outbreaks. insufficient intake of fish and legumes in the chinese population were also observed in a previous study conducted before the covid- pandemic [ , ] . however, due to cultural preferences in the chinese population for fresh foods that are likely to be negatively affected by the lockdown policy, it is unsurprising that the intake of food like fish and seafood, whose tastes and flavor largely depend on the freshness of the raw materials, may decrease [ ] . to improve the residents' access to fresh fish, wuhan city implemented a working program to promote the consumption of fresh fish in every local community on march [ ] . legumes including fresh beans, soybeans, and pulses provide fiber, protein, vitamins, minerals, and phytochemicals such as phytosterols that have been suggested to modulate immune system and exert protective effects against inflammation and oxidative stress [ , ] . in addition, because legumes and fish are both excellent sources of high-quality protein and low in fats, interventions and policies are needed to encourage the inclusion of these two food groups to achieve more balanced and diversified diets rich in nutrients, in particular, during pandemics like covid- . participants in this study were distributed across provinces and cities in china. we observed a slightly lower hdds among people living in the areas where more covid- cases had been confirmed. similar concerns were raised in the areas hit hardest by ebola in and . in guinea and liberia, where food became unavailable and food insecurity rose rapidly, people shifted toward a less nutritious diet with limited diversity [ , ] . those findings indicate that areas with high incidence of infectious diseases like covid- should pay more attention to dietary diversity, especially in the areas where people are required to self-isolate at home and food supply mostly depends on government or community-based food distribution programs. meanwhile, more novel strategies should be developed to meet the needs of adequate and diverse food supply in this particular time. as reported by the study participants, in-house storage and in-person grocery shopping were still the major sources of food supply during lockdown. meanwhile, online food ordering and delivery services have gradually become an important method to purchase food in the daily lives of chinese residents [ ] . in this study, . % participants used online ordering and delivery services at least once. the clustering analysis grouped study participants into three clusters based on their methods for purchasing or obtaining foods. when comparing the hdds among people with different preferences for purchasing foods, we found that participants who purchased food primarily via online food shopping, or who depended on in-house storage and in-person grocery shopping, or purchased the most food in person from grocery stores had similar hdds. in addition, we observed that fruits and dairy products were the most common food purchased via online services, which are also the food groups recommended in the chinese dietary recommendation responding to covid- [ ] . therefore, online ordering and delivery services may serve as a feasible solution to sustain stable food supply and adequate food access in the covid- pandemic as it can maintain dietary diversity and potentially reduce the spread of virus by limiting person to person contact. on february, the chinese state administration for market regulation promulgated specific regulations corresponding to the online food ordering and delivery services, which requires checking the deliveryman's temperature daily, disinfecting the equipment, requesting staff wear gloves and masks during delivery services, etc. [ ] . these requirements may be helpful in curtailing the covid- pandemic, but further evaluations on their effectiveness in slowing the growth of covid- cases are still needed. furthermore, other potential concerns on food delivery such as the risk of food contamination should also be taken into consideration. disease outbreaks often influentially impact health-related behaviors. joseph et al. reported that comparing health-seeking behaviors in the post-and pre-sars epidemic period in , people were more likely to adopt a healthier diet, especially among those who were worried about contracting the virus [ ] . interestingly, our study found that . % of our participants intentionally consumed vitamin c, probiotics, and other dietary supplements to cope with the novel coronavirus outbreak. meanwhile there were . % and . % of participants once purposely drinking alcohol and vinegar, respectively. these behaviors are likely to be caused by rising concerns in this stressful time of covid- pandemic. intriguingly, we observed higher hdds among participants with those behaviors. we infer that it may be because the people who have these behaviors may also pay more attention to diet. however, it should be noted that none of these behaviors has been officially recommended and they are not supported by rigorously tested scientific evidences. for instance, the idea of drinking high liquor to prevent viral infection emerged soon after several chinese scientists announced that % medical alcohol could inactivate the virus. although the chinese government had already dismissed this rumor since january [ ] , there were still more than % of the studied population purposely drinking more alcohol. this behavior has also been reported in many other countries. according to the report from tasnim news agency on march, there have been at least people poisoned and deaths in iran due to the consumption of toxic alcohol (methanol based beverage) that was believed to prevent covid- by some people [ ] . another interesting phenomenon is that % of the studied participants had drunk more vinegar to fight against the virus, which could also be seen in during the sars pandemic [ ] . unfortunately, no scientific evidence has proven the effectiveness of drinking vinegar in lowering the risks of viral infection or mortality. based on the online survey methodology, hdds was used in this study for its convenience, and to some extent, it could reflect the food accessibility and predict the risk of malnutrition. however, it does not quantify the amount of actual food intake and, therefore, we could not estimate the level of nutrient sufficiency or deficiency. additionally, according to a validation study, the current components of indicators in hdds do not provide a reliable way to reflect the household-level access to food [ ] . no previous chinese study has used this indicator, so the reliability was unknown in the chinese population. in addition, the hdds was designed with an interview methodology and there is no pre-test of its efficiency on self-completion. the e-based questionnaire may also lead to selection bias. the majority of participants in the current survey were young and highly educated. elders and people with relatively low socio-economic status could not be easily reached in this study, however, they are often the more vulnerable groups during the covid- pandemic. further studies should focus on these populations and provide specific strategies to ensure their nutritional status. another unfortunate limitation in current study is that we could not obtain the anthropometric data, hence the direct health outcomes could not be observed. the impacts of dietary intake during pandemic on health such as weight change and immune functions need to be evaluated. this study reported on dietary diversity in mainland china during the covid- pandemic and revealed a generally good dietary diversity among the chinese residents studied. however, people living in areas with a high number of confirmed covid- cases had a lower hdds. several dietary behaviors used to cope with covid- were identified including increased consumption of vitamin c, probiotics, other dietary supplements, alcohol, and vinegar. people with these behaviors had a higher hdds. during lockdown, in-house storage and in-person grocery shopping were the primary ways to obtain food. there was no difference in the hdds among people who depended more on in-person grocery shopping, in-house storage, or online ordering and delivery services to obtain or purchase foods. based on the current study, we have proposed the following recommendations. ( ) evidence based dietary recommendations and health education are needed to encourage a more balanced and diversified diet and to prevent inappropriate eating behaviors, especially in areas severely impacted by covid- and the lockdown policy. ( ) cautiously monitored and regulated online ordering and delivery services could serve as a feasible method for food purchases, which ensures dietary diversity. ( ) more studies are urgently needed to identify potential nutritional concerns for different populations with various health conditions and socio-demographic characteristics during pandemics and provide corresponding strategies. author contributions: a.z. designed the research. a.z., and z.l. wrote the manuscript. a.z., j.z., and z.r. performed the statistical analyses. y.k., s.h., and y.m. collected the data; y.z. participated in the discussion and revised the manuscript. all authors have read and agreed to the published version of the manuscript. funding: this research received no external funding. the novel coronavirus pneumonia emergency response epidemiology team. the epidemiological characteristics of an outbreak of novel coronavirus diseases (covid- ) in china. chin knowledge, attitudes, and practices towards covid- among chinese residents during the rapid rise period of the covid- outbreak: a quick online cross-sectional survey coronavirus disease (covid- ) situation reports shared responsibility, global solidarity: responding to the socio-economic impacts of covid- vitamin c and immune function effects of probiotics, prebiotics, and synbiotics on human health household dietary diversity score (hdds) for measurement of household food access: indicator guide version . academy for educational development nutrition, immune response, and outcome outbreaks can be stressful chinese restaurant super digital time insight the vast majority of express delivery companies across china resumed normal work chinese center for disease control and prevention. the distribution of covid- the r project for statistical computing social capital and sleep quality in individuals who self-isolated for days during the coronavirus disease (covid- ) outbreak in january in china covid- ): emerging and future challenges for dental and oral medicine national health commission of china, dietary guidelines for the prevention and treatment of novel coronavirus coping with stress during the -ncov outbreak household dietary diversity and child stunting in east java, indonesia. asia pac household food insecurity along an agro-ecological gradient influences children's nutritional status in south africa dietary diversity score: a measure of nutritional adequacy or an indicator of healthy diet? food insecurity and chronic disease: addressing food access as a healthcare issue consumption of animal source foods and dietary diversity reduce stunting in children in cambodia characterization of the degree of food processing in relation with its health potential and effects ultra-processed diets cause excess calorie intake and weight gain: an inpatient randomized controlled trial of ad libitum food intake ultra-processed food intake and risk of cardiovascular disease: prospective cohort study (nutrinet-santé) high prevalence of obesity in severe acute respiratory syndrome coronavirus- (sars-cov- ) requiring invasive mechanical ventilation coronavirus disease in elderly patients: characteristics and prognostic factors based on -week follow-up consumption of dried legume and legume products among adults aged - years old in provinces of china in consumption of marine food consumption among adults aged - years old in provinces of china in food, eating behavior, and culture in chinese society wuhan: ensure household has fresh fish phytochemicals for health, the role of pulses nutritional and health benefits of pulses impact on food security and livelihoods. action against hunger uk. . available online ebola to worsen food security conditions in liberia, sierra leone and guinea notice of market regulation on further strengthening food safety supervision during the prevention and control of the covid- impacts of sars on health-seeking behaviors in general population in hong kong alcohol drinking cannot help for preventing the corona virus iran confronts deadly alcohol crisis in midst of dealing with coronavirus help-seeking pattern of college students during the time of severe acute respiratory syndrome. chin verifying validity of the household dietary diversity score: an application of rasch modeling this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license we would like to sincerely thank our friends who helped us forward the questionnaires. the authors declare no conflicts of interest. key: cord- -wllc gl authors: kent, katherine; murray, sandra; penrose, beth; auckland, stuart; visentin, denis; godrich, stephanie; lester, elizabeth title: prevalence and socio-demographic predictors of food insecurity in australia during the covid- pandemic date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: wllc gl the covid- pandemic has exacerbated economic vulnerabilities and disrupted the australian food supply, with potential implications for food insecurity. this study aims to describe the prevalence and socio-demographic associations of food insecurity in tasmania, australia, during the covid- pandemic. a cross-sectional survey (deployed late may to early june ) incorporated the u.s. household food security survey module: six-item short form, and fifteen demographic and covid-related income questions. survey data (n = ) were analyzed using univariate and multivariate binary logistic regression. the prevalence of food insecurity was %. the adjusted odds of food insecurity were higher among respondents with a disability, from a rural area, and living with dependents. increasing age, a university education, and income above $ , /year were protective against food insecurity. food insecurity more than doubled with a loss of household income above % (adjusted odds ratio (aor): . ; % ci: . , . ; p = . ), and the odds further increased with loss of income above % (aor: . ; % ci: . , . ; p = . ). our results suggest that the prevalence of food insecurity may have increased during the covid- pandemic, particularly among economically vulnerable households and people who lost income. policies that support disadvantaged households and ensure adequate employment opportunities are important to support australians throughout and post the covid- pandemic. food security is achieved "when all people, at all times, have physical, social and economic access to sufficient, safe and nutritious food that meets their dietary needs and food preferences for an active and healthy life" [ ] . this broad definition emphasizes four distinct dimensions of food security [ ] which include the availability, accessibility and utilization of food, in addition to the stability of each of these factors, which refers to an ability to withstand shocks to the broader food system. food insecurity occurs when at least one of these domains are not met, where the experience at a household level may be temporary or longer-term [ ] . access to adequate food is a core social determinant of health, and food insecurity is related to poor nutritional intake and higher mortality the survey used the u.s. household food security survey module: six-item short form (hfssm) to determine the prevalence of food insecurity [ ] . this validated screening tool [ ] sought responses to six questions self-reporting of uncertain, insufficient or inadequate food access, availability and utilization, due to limited financial resources, and the compromised food consumption that may result. the hfssm generally applies a reference timeframe of months; however, it was less applicable for this study which was conducted at the beginning of the covid- pandemic. therefore, the acceptable shorter reference period of days was selected to capture the prevalence of food insecurity during the covid- pandemic only [ ] . responses to the six questions were coded and assessed in accordance with the user notes [ ] , where each affirmative response was assigned a score of , and summed raw scores were used to describe food insecurity at the household level. scores were then used to categorize respondents as having high ( ), marginal ( ), low ( ) ( ) ( ) or very low food security ( ) ( ) . in previous australian studies [ ] , scores of and have been grouped together, while international studies have reported these scores separately. our analyses kept these scores separate, due to the short reference period, and the fact that the majority of respondents who scored reported running out of food and could not afford to buy more. an affirmative response to this question would indicate household food insecurity with other scales, including the single-item measure of food insecurity which is commonly used in australian studies of food insecurity [ ] . fifteen socio-demographic variables were collected, including age (in years), gender (male, female, other), local government area of residence, if they identified as from aboriginal and/or torres strait islander descent, whether they have a health condition or disability that limited their activity, citizenship status (born in australia, australian citizen, permanent resident or temporary resident), the highest level of education, relationship status, household composition, employment status, total household income bracket and whether they were the main shopper for their family. additional questions asked respondents about how the covid- pandemic affected their household finances and job status, including whether the covid- pandemic resulted in a change in their employment and/or a decrease in household income, and whether they were receiving covid- related australian nutrients , , of government benefits (jobkeeper or jobseeker). the study was conducted in accordance with the declaration of helsinki, and the protocol was approved by the university of tasmania's social sciences human research ethics committee (ethics project id: ). data sets were exported from the online survey platforms to ibm spss statistics for windows, version . (ibm corp., armonk, ny, usa), cleaned and prepared for statistical analysis which was performed in stata . (statacorp, ) . all available survey data were used in the analyses. the significance level for all analyses was set at p < . . a binary variable of food security status was generated for application in the univariate and multivariate logistic regression, where food secure was determined by a score of , and food insecure was a score of - on the hfssm. in addition, several of the socio-demographic variables were recoded into a smaller number of categories, due to low cell counts and for ease of interpretation. recoded variables included coding thirty local government areas (lga) of residence categories into three regions (north, south, north-west and west) (see figure for graphical representation) and rurality (urban and rural dwelling regions). age categories were developed from the continuous variable ( - years, - years, - years, - years, - years, + years). disability status was recoded from three options (no, yes a little, yes a lot) to two (yes, no) by collapsing the affirmative responses. relationship status was recoded from seven to four groups (married/de facto, never married, previously married, living apart) by combining widowed, divorced, and separated into previously married. household composition was reduced from ten options to five (couple with no dependents, couple with dependents, single adult with dependents, single person house, other (group/share)). highest education status achieved was recoded from eight options into three (university degree, diploma/technical and further education (tafe) qualification, high school qualification). employment status was recoded from eight options to three (employed [including self-employed]), unemployed and other [which included student, volunteer, retired and other]). household income was recoded into three categories (au$ < , , , - , and , +). all socio-demographic variables were either categorical or ordinal and were cross-tabulated and summarized with frequencies and proportions. cross-tabulations with chi-square statistic were employed to generate descriptive statistics related to food security status, including responses to each of the six food security questions, and with each of the socio-demographic variables. univariate logistic regression was performed individually for each socio-demographic characteristic to generate unadjusted odds ratios for food insecurity. correlation coefficients between all variables were calculated to demonstrate the interrelationships and inform the multivariate analysis. a multivariable logistic regression was performed, including all measured variables to yield adjusted odds ratios (aor) for food insecurity. variables were retained in the final model if any level of the variable had p < . . almost three-quarters of the respondents (n = ) were categorized as having high security (n = , . %), with . % reporting marginal food security (n = ), . % low food security (n = ) and . % (n = ) having very low food security. socio-demographic characteristics of the survey respondents according to food security categories and assessments of the impact of the covid- pandemic on employment and income are presented in table . the majority of respondents were female ( %), and a large proportion ( %) were aged over years. most respondents ( %) were in a married or de facto relationship, and % of respondents had dependents living with them. with regards to income, % of respondents had incomes over au$ , per year, and a majority ( %) had a university education (bachelor's degree or higher). main household shoppers were the predominant survey respondents ( %). the prevalence of household food insecurity ranged from % in the south, to % in the north-west and west regions ( figure ). the greatest proportion of respondents with very low food security were in the north ( %), compared with % in the north-west and west and % in the south. despite a lack of statistically significant regional differences, a larger proportion of respondents residing in rural regions (table ) were classified in the marginal, low and very low food security groups ( %) in comparison to their urban-dwelling counterparts ( %). the proportions of respondents in each food security group who provided affirmative responses to each of the six hfssm questions are represented in table . of the six questions, marginally food secure respondents were most likely to respond affirmatively to the first question: "the food that (i/we) bought just didn't last, and (i/we) didn't have money to get more". however, none of the respondents in the marginally food secure group reported eating less than they wanted or being hungry because there was not enough money for food. in comparison, nearly all respondents ( %) in the very low food security category responded affirmatively to the first question, and a further % reported experiencing hunger. in addition, % of respondents in the low food security category reported they cut down on food or skipped meals for least three days in the past days because they could not afford to buy more, but only % in this group reported experiencing hunger. while the majority of respondents in the low food security group ( %) did not cut down on the size of meals, % reported being unable to afford to eat balanced meals. the proportion of respondents in food secure groups rose with increasing age (table ) . a significantly greater proportion of younger respondents aged - years were classified as having low ( %) or very low food security ( %) over the past month in comparison to older age brackets. while there was no significant difference between men and women in the food secure categories (~ %), a greater proportion of female respondents reported very low food security ( %) in comparison to males ( %). a significantly greater proportion of respondents with a disability reported experiencing low and very low food security ( % and %, respectively) in comparison to respondents without a disability ( % and %). a small proportion of respondents identified as aboriginal and/or torres strait islander ( . %), but less than half of these respondents were food secure, and more than in of these respondents reported experiencing low and very low food security, which was statistically significantly greater than those who did not identify as aboriginal and/or torres strait islander (table ) . a significantly greater proportion of university-educated respondents had high food security ( %) in comparison to smaller proportions of those with a diploma/tafe qualification ( %) and those who obtained a high school qualification ( %). a significantly larger proportion of australian citizens born in australia ( %) and overseas ( %) were classified as having high food security in comparison to permanent residents ( %) and temporary residents ( %). of note, are the high proportions of temporary residents in the marginal ( %), low ( %) and very low ( %) food security groups in comparison to other residents. significantly higher proportions of those respondents who were never married ( %) and separated ( %) were in the very low food security group, and only % of respondents in households of single adults with dependents were classified as having high food security. half ( %) of respondents on the lowest income were classified as having high food security, with a further % in the low food security group and % in the very low food security group, which is much higher than other income brackets (table ) . lga-local government areas. tafe-technical and further education. nutrients , , of similar proportions of respondents who indicated that the covid- pandemic had impacted their job were classified as having marginal food security ( %) in comparison to respondents without a job change. however, a significantly higher proportion of those whose job had been impacted by the pandemic were in the low ( %) and very low ( %) food security groups. fewer respondents who had lost income as a result of the covid- pandemic ( %) had high food security table ). of note, % of respondents who had lost over % of their income reported some degree of food insecurity. interestingly, a similar proportion of respondents receiving the jobkeeper government benefit had high food security, in comparison to less than half ( %) of respondents receiving the lower jobseeker payment ( %), with % of these respondents classified as having marginal food security and a further % in the low and very low food security groups. the prevalence of household food insecurity ranged from % in the south, to % in the north-west and west regions ( figure ). the greatest proportion of respondents with very low food security were in the north ( %), compared with % in the north-west and west and % in the south. despite a lack of statistically significant regional differences, a larger proportion of respondents residing in rural regions (table ) were classified in the marginal, low and very low food security groups ( %) in comparison to their urban-dwelling counterparts ( %). the proportions of respondents in each food security group who provided affirmative responses to each of the six hfssm questions are represented in table . of the six questions, marginally food secure respondents were most likely to respond affirmatively to the first question: "the food that (i/we) bought just didn't last, and (i/we) didn't have money to get more". however, none of the respondents in the marginally food secure group reported eating less than they wanted or being hungry because there was not enough money for food. in comparison, nearly all respondents ( %) in the very low food security category responded affirmatively to the first question, and a further % reported experiencing hunger. in addition, % of respondents in the low food security category reported they cut down on food or skipped meals for least three days in the past days because they could not afford to buy more, but only % in this group reported experiencing hunger. while the majority of respondents in the low food security group ( %) did not cut down on the size of meals, % reported being unable to afford to eat balanced meals. table . distribution of responses to the six-item food insecurity screen across food security status. response the food that (i/we) bought just didn't last, and (i/we) didn't have money to get more. in the last days was this: often true ( . ) ( . ) ( . in the last days, how many days did this happen? in the last days, were you ever hungry but didn't eat because there wasn't enough money for food? table presents crude and adjusted odds ratios of household food insecurity for the variables considered. adjustment for socio-demographic characteristics considered in our multivariable model yielded modest decreases in the strength of some effects, highlighting the co-occurrence of factors associated with elevated risk, especially for income variables. in the multivariate analysis, two demographic variables were removed from the final model, which were also not independently significantly associated with higher food insecurity (main shopper, region). the region was also highly colinear with rurality, which was retained (see table for correlations between variables). as the covid variables were assessing different aspects of the effect of covid- on income, only one (income decrease) was retained in the final model, due to collinearity. the adjusted model had pseudo r = . , and likelihood ratio test statistics χ = . , p < . . the adjusted model indicates that increasing age was protective against food insecurity, with the odds of experiencing food insecurity reducing by % with every decade of life. respondents who identified as aboriginal and/or torres strait islander had more than three-fold greater odds of experiencing food insecurity; however, after adjustment for other household characteristics, this difference did not remain significant despite the aor of . , which may reflect the small proportion of respondents who identified as aboriginal and/or torres strait islander. respondents with a disability had more than two-fold increased odds of experiencing food insecurity compared with those without a disability, which was modestly reduced (aor: . ) after adjusting for other characteristics. an % increase in the odds of experiencing food insecurity was evident for respondents in rural areas after adjusting for other characteristics. higher levels of education were protective against food insecurity, with respondents with a diploma/tafe or high-school qualification showing a two-fold increase in the odds of experiencing food insecurity compared to those with a university-level education (bachelor's degree or higher), which remained significant after adjusting for other characteristics. temporary residents had a four-fold increase in the odds of experiencing food insecurity compared to australian citizens, which was modestly reduced after adjusting for other characteristics and did not remain significant. the multivariate model showed that respondents who were previously married had two-fold higher odds of food insecurity than respondents who were currently married or in a de facto relationship. compared to couple families without dependents, all other household types had increased odds of food insecurity. interestingly, the odds ratio for food insecurity associated with being a single parent household fell from . to . with adjustment for other household characteristics, and this group was no longer statistically significantly different from other household types. household income was independently associated with food insecurity, with incomes above au$ , /year seemingly protective against food insecurity, and income below au$ , per year associated with a two-fold increase in the odds of food insecurity. respondents who reported that the covid- pandemic had resulted in a change in their employment had a % increase in the odds of experiencing food insecurity in comparison to those not impacted. in comparison to those who were employed and not receiving government benefits, respondents who were receiving the jobkeeper government support payment had % higher odds of experiencing food insecurity, and those who were receiving jobseeker support payments (a smaller fiscal amount) had a three and a half-fold increase in the odds of experiencing food insecurity. a gradient was apparent for respondents who had lost income as a result of the covid- pandemic, where an income loss of % or more significantly increased the odds of experiencing food insecurity. independently of other factors, including household income, a loss of more than % of income was associated with a seven-fold increase in the risk of food insecurity. in the adjusted model, similar effects for income decrease were observed, demonstrating that income loss is independently associated with higher odds of food insecurity. this study presents results from a survey of adults in tasmania, australia, assessing the prevalence and socio-demographic predictors of household food insecurity during the covid- pandemic. our results demonstrate that between late april and early june , a time when wide-spread social distancing restrictions were in place, more than in ( %) respondents had experienced food insecurity to some degree. concerningly, % of respondents experienced more severe food insecurity, which meant they were regularly going hungry and were unable to afford balanced meals over the previous month. these statistics are substantially higher than the tasmanian food insecurity prevalence of . %, preceding the covid- pandemic [ ] , and higher than the national reported prevalence of % [ ] . comparable to the results of our study, previous research has shown that food insecurity was highest in the north ( . %) of tasmania, and lower in the south ( . %) and north-west ( . %) [ ] . the tasmanian survey used a single item food insecurity question, meaning these results are not directly comparable to the current study. however, given that more than % of respondents to our survey provided an affirmative response to the equivalent question (see table ), this indicates that the burden of food insecurity in tasmania is substantially higher than pre-covid- levels. there are emerging reports of much higher levels of food insecurity being experienced by populations across the world during the covid- pandemic. a cross-sectional study of low-income adults in the us reported that % of respondents were marginally food insecure, and a further % were food insecure [ ] . however, this study was limited by its focus on low-income households, and the results are, therefore, not generalizable to the wider population. our results demonstrate that the experience of food insecurity was not limited to only those on low incomes, and that loss of income at any level above % contributed to substantially higher odds of experiencing food insecurity. results from a survey in the north-eastern us state of vermont, identified a % increase in food insecurity since the beginning of the pandemic, with % of households experiencing food insecurity (up from %) [ ] . a canadian survey [ ] conducted during april-may found that almost one in seven ( . %) canadians experienced food insecurity to some degree in the previous days, and those who had reduced employment due to covid- , were more likely to be food insecure ( . %) than those who were working ( . %) [ ] . a study in the uk reported that . % of adults had experienced food insecurity since the covid- lockdown began [ ] , up from . % in . interestingly, in this study, a lack of food available in the shops contributed to % of food insecurity experienced, highlighting the importance of stability in the food supply as an overarching domain of food security. the proportions of more severe food insecurity were comparable with our study, where it was reported that % of adults skipped meals, and % regularly went without food [ ] . our study was unable to determine the extent to which food shortages, resulting from food hoarding, impacted food insecure responses. however, it is likely that food-insecure households were left at an extreme disadvantage because of food hoarding. in addition to the wide-spread unavailability of some foods, australian retail outlets and supermarkets placed strict limits on the amount of staple food items that could be purchased in one transaction, which further reduced the ability of households to buy adequate food, especially for larger families living far away from their nearest shop, who need to buy in bulk. while an investigation of the coping strategies adopted by food-insecure households was not a focus of our study, the fact that many respondents reported running out of food, but did not report being hungry shows coping strategies being employed to some degree, especially for those in the marginal and low food security groups ( table ) . such strategies could have included accessing emergency food relief, in addition to restaurants and community groups providing no-cost or low-cost meals and food boxes. our analyses demonstrate that the higher probability of household food insecurity was closely associated with many socio-demographic factors, especially financial factors specific to the covid- pandemic. the most substantial factor in our regression analyses was loss of income related to covid- , with respondents who had lost the majority of their income showing up to a seven-fold increase in the odds of food insecurity. similarly, in the uk, adults reported that loss of income above % resulting from the covid- pandemic were found to be at significantly higher risk of food insecurity, even after accounting for background socio-economic status [ ] . prior to the covid- pandemic, % of tasmanian households were reportedly in financial stress, which means they did not have or could not raise au$ in an emergency [ ] , with this factor closely related to food insecurity in the state. food insecurity has worsened within economically vulnerable populations under covid- conditions, with a loss of income in already low-income households putting individuals at even higher risk of food insecurity. additionally, covid- has also created new economic vulnerability for people were previously food secure and who are now experiencing income losses. previous research has shown that loss of an income or large household bills (also known as bill shock), can require temporary reallocation of financial resources away from groceries, which can result in food insecurity [ ] . previous research during global recessions has shown increased household food insecurity, which can take years to return to pre-recession levels [ ] . our study is limited in that we were unable to control for household savings or other assets, which may explain a large variation in a household's ability to adjust to periods of economic shock in comparison to others. however, low-income households are unlikely to ever accrue substantial savings or assets which could cushion against financial shocks. our analyses demonstrate that a substantial proportion ( %) of our respondents' employment status had been impacted by the covid- pandemic, and that these respondents were at higher risk of moderate to severe food insecurity. positively, government financial support payments were being received by % of our respondents and those receiving the higher jobkeeper payment through their employer showed a similar level of food insecurity to those currently employed. however, approximately half of respondents receiving the lower jobseeker payments reported experiencing food insecurity. this finding is somewhat at odds with national reports of how this new government supplement, which is higher than the usual unemployment benefits, has reduced financial and personal distress, and reduced food insecurity for people who normally access unemployment schemes [ ] . however, the majority of respondents to the national survey had been receiving an income support payment for more than two years, and therefore, our results may reflect the experience of individuals newly claiming this scheme [ ] . in published research, low income is the most consistent and often the strongest predictor of food insecurity [ ] . in our study, those who were food insecure are more highly represented among lower-income brackets, especially for those on incomes lower than au$ , per year. incomes above au$ , per year, which is higher than the median household income in tasmania of approximately au$ , [ ] , were associated with lower odds of food insecurity. low-income households may be larger, and therefore, may be unable to purchase sufficient food to meet their needs, or they may be required to purchase smaller quantities of food, which are sold at a higher unit price, further increasing the prevalence of food insecurity in these households. interestingly, food insecurity was still evident in respondents with the highest incomes (>au$ , per year), indicating that income does not always reflect the economic conditions of the household. of note, the increased food insecurity reported in our study and other studies during the covid- pandemic suggests that the financial impact of covid- on food insecurity is far-reaching in the population, and has affected both households with high socio-economic risk of food insecurity and those not typically perceived to be at risk of food insecurity. in addition, our analyses demonstrate that younger age, rurality, disability, lower education levels, and having dependents were also all independently associated with food insecurity, indicating that the socio-demographic and covid-related factors cannot be explained merely in terms of their association with income. other factors which were associated in the univariate analysis, but not the multivariate, included being of aboriginal/torres strait islander decent, temporary residency, and being single (never married or previously married). for these factors, the relationship with food insecurity may be due to lower-incomes and other factors. in our study, increasing age was protective against food insecurity. these results align with published literature, which demonstrates that even after controlling for economic factors, the probability of moderate or severe food insecurity decreased with age [ , ] . studies of older australians have similarly reported a lower prevalence than in the general population, with prevalence rates of % for australians aged over years [ ] and % of australians aged over years [ ] . compounding this effect, the impact of the covid- pandemic has disproportionately affected younger australians [ ] , due to a large reduction in casual and part-time jobs predominantly held by younger people (e.g., hospitality). interestingly, our study showed that gender was not associated with an increased risk of food insecurity. this is somewhat at odds with the results of other studies, which have explained the increased burden of food insecurity experienced by women to be associated with gender-related economic factors, including lower employment opportunities and child-related duties [ ] . additionally, higher educational attainment was independently associated with lower odds of experiencing food insecurity, which is consistent with other australian research [ , ] , and international studies of food insecurity during the covid- pandemic [ ] . in line with our findings, the greater likelihood of food insecurity among australians from aboriginal and/or torres strait islander descent has been documented previously [ ] , with the prevalence of food insecurity ranging from % in remote areas [ ] to % in the state of victoria [ ] . additionally, respondents reporting health conditions and disabilities that limited their daily activities were more likely to be food insecure than those without a disability and were also shown to experience more severe forms of food insecurity. these results are echoed in previous australian [ ] and international studies [ ] from before the covid- pandemic. while our study did not examine the cause of food insecurity in this group, an uk survey during covid- identified that respondents with a disability had between two and four-fold increased risk of experiencing food insecurity as a result of economic hardship, a lack of food available in shops, and social isolation [ ] . respondents living in rural areas experienced a higher burden of food insecurity in comparison to respondents living in urban areas and were % more likely to be food insecure after accounting for other socio-demographic factors. in rural australia, fresh and healthy food is very expensive in some areas, due to transportation and storage costs [ ] . during the covid- pandemic, reduced access to food and fewer shops in these areas was coupled with media reports of price gouging of foods in response to increased demand [ ] , and these factors may have infringed upon the ability of rural residents to buy enough healthy food to meet their needs. pre-covid- evidence has inconsistently linked immigration status to food insecurity [ , ] . in our study, temporary residents were four times more likely to experience food insecurity compared with australian citizens, which did not remain significant after controlling for other variables. this may either reflect the small number of temporary residents who responded to our survey, or reflect the exacerbated economic hardship experienced by temporary residents during the covid- pandemic. in australia, temporary residents were ineligible for government support payments, and were therefore, at a much higher risk of food insecurity due to loss of income. comparable with published research [ , ] , being married or in a de facto relationship was negatively associated with food insecurity. during the covid- pandemic, this may be related to the increased financial buffer of two potential income streams in comparison to those in single adult households, or that our study investigated household income, not income per-person, so the adjustment for income may be less appropriate for single respondents. additionally, we found that households with dependents were more likely to be food insecure compared with those without dependents. interestingly, households headed by a single parent were at three-fold greater risk of food insecurity. however, after adjustment for other variables, this difference was no longer significant, indicating that other variables, such as lower-income or loss of income accounted for this increased risk during the covid- pandemic. this study has a number of strengths. to our knowledge, this may be one of the few studies that have examined the impact of the covid- pandemic on food insecurity in australia. moreover, we were able to assess the prevalence of food insecurity in a large sample size relative to the population of tasmania, using a multiple item food security tool, which has shown to be more comprehensive than the single item food security question applied in many australian studies [ , ] . despite these strengths, these findings must be considered within the context of a number of potential limitations. our study was cross-sectional in nature, and therefore, our analyses are purely descriptive, and inferences are limited by the design of the study [ ] . importantly, despite the wide recruitment methods used, the likelihood of participating in the survey may be associated with food insecurity (participation bias), and the use of an online survey may have excluded some groups, including those with low literacy or people without internet access. further, our sample may not be representative of the wider tasmanian population [ ] , as our sample contained a higher proportion of female respondents ( . %) compared with the demographic profile of the tasmanian population ( . % female). this over-representation may be explained by the food-based theme of the survey and that women have been reported to predominantly manage household meals [ ] . despite this, our results are supported by reports that women provide more reliable estimates of the food insecurity experiences of a household [ ] . our sample shared similar proportions of married and separated respondents with the tasmanian population ( . % married, . % previously married, and . % never married) [ ] . however, our survey had a lower proportion of respondents who identified as aboriginal and/or torres strait islander ( . %) than the wider tasmanian population ( . %), and a lower proportion of unemployed respondents ( . %), compared to the general tasmanian population ( %). our respondents were overall very highly educated, with % having a university education, compared with . % having tertiary qualifications in the wider tasmanian community [ ] , which may be a result of our convenience sampling methods. as higher education has shown to be protective against food insecurity, actual levels of food insecurity may be higher in the general tasmanian population. lastly, the -item hfssm is slightly less reliable than -item measure, does not measure the most severe levels of food insecurity and does not measure the food security of children in the household [ ]. where to next? as the covid- pandemic continues around the world, it is likely that more severe economic vulnerabilities will emerge towards the end of and beyond. further monitoring of food insecurity across australia and internationally is needed to support the ongoing recovery from the covid- pandemic. prior to the pandemic, food-insecure households have reported numerous coping strategies for making ends meet, including seeking resources from within their social network in addition to emergency food relief. however, social distancing restrictions, business closures and other public health measures may infringe upon these coping strategies, and newly food-insecure households may not have appropriate knowledge of support services. therefore, further australian research is urgently needed to examine the coping strategies that food-insecure households are utilizing during the covid- pandemic, including the appropriateness of income support payments for alleviating more severe food insecurity during the covid- pandemic. our results indicate higher levels of food insecurity in australia during the covid- pandemic and could inform responsive policy interventions. while government support measures, including the jobkeeper and jobseeker payments, appear to be assisting vulnerable australian households, significant financial distress will follow once they are removed or reduced. as loss of income was a major factor in our analyses, effective government responses should center around providing opportunities for secure employment that pays a living wage, rather than a minimum wage. additionally, strengthening social protection mechanisms and emergency food relief programs may protect those at risk of food insecurity. lastly, systems that support the physical access to food, and protect the stability of the food supply must be strengthened. this should involve shortening and localizing food supply chains and bolstering local food systems, where food is grown, packaged, and consumed within the same community. food policy coalitions could provide the mechanism to work at the intersection of health, social justice and environmental sustainability to improve local and regional food systems, positively influencing the food environment [ , ] . given the urgent and widely accepted need to transition to a more circular, just, and sustainable economy, the government in partnership with the community should explore setting up appropriately constituted local food councils in each region. these could support community food hubs to enhance market access for farmers, create jobs, build resilience, promote local and sustainable food procurement, and ultimately improve food security by increasing access to local, healthy food [ , ] . author contributions: conceptualization, k.k., s.m., b.p., s.a., s.g. and e.l.; methodology, k.k., s.m., b.p., s.a., s.g. and e.l.; software, e.l.; formal analysis, d.v. and k.k.; writing-original draft preparation, k.k.; writing-review and editing, all authors; funding acquisition, k.k. all authors have read and agreed to the published version of the manuscript. funding: this research received no external funding and the apc was funded by the university of tasmania's centre for rural health. the food and agriculture organization fao. the state of food insecurity in the what are we assessing when we measure food security? a compendium and review of current metrics the food security continuum: a novel tool for understanding food insecurity as a range of experiences. food secur what does increasing severity of food insecurity indicate for food insecure families? relationships between severity of food insecurity and indicators of material hardship and constrained food purchasing household food insufficiency is associated with poorer health australian bureau of statistics abs. . . . -australian health survey: nutrition-state and territory results severe and moderate forms of food insecurity in australia: are they distinguishable? measuring and understanding food insecurity in australia: a systematic review are low-to-middle-income households experiencing food insecurity in victoria, australia? an examination of the victorian population health survey the association between stressful events and food insecurity: cross-sectional evidence from australia an ecological analysis of factors associated with food insecurity in south australia prevalence of u.s. food insecurity is related to changes in unemployment, inflation, and the price of food restrictions and the 'new normal': documenting life in australia during the coronavirus pandemic australian bureau of statistics abs. . . . -weekly payroll jobs and wages in australia, week ending covid- and consumers: from crisis to recovery online sales halted, supermarket shelves stripped bare as shoppers prepare for coronavirus quarantine restaurants and cafes facing mass closures without more coronavirus support, industry group warns. the money abc news food insecurity and chronic disease validation of a self-reported measure of household food insufficiency with nutrient intake data guide to measuring household food security utilising a multi-item questionnaire to assess household food security in australia food insecurity and covid- : disparities in early effects for us adults food access and security during coronavirus: a vermont study food insecurity during the covid- pandemic vulnerability to food insecurity since the covid- lockdown the impact of the recession on food insecurity among households who were low income: findings from the - national health and nutrition examination surveys survey of people receiving the new rate of jobseeker and other allowances household food security in the united states in prevalence and predictors of food insecurity among older people in canada food insecurity among older australians: prevalence, correlates and well-being food insecurity in community-dwelling older australians. public health nutr gender differences in the prevalence of household food insecurity: a systematic review and meta-analysis. public health nutr understanding food security issues in remote western australian indigenous communities traditional food availability and consumption in remote aboriginal communities in the northern territory inequalities in the social determinants of health of aboriginal and torres strait islander people: a cross-sectional population-based study in the australian state of victoria public health nutrition and food policy disability, food insecurity by nativity, citizenship, and duration national rural health alliance: nhra. food security and health in rural and remote australia coronavirus and price gouging-let's put a stop to it food insecurity and public assistance single-item measure of food insecurity used in the national health survey may underestimate prevalence in australia being honest with causal language in writing for publication development of a food security measurement tool for new zealand households food policy development in the australian state of victoria: a case study of the food alliance the role of a food policy coalition in influencing a local food environment: an australian case study. public health nutr tasmanians seeking more circular and sustainable food systems report of the tasmania project community food hubs: an economic and social justice model for regional australia? this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license the authors would like to acknowledge the members of the tasmania project and thank them for their assistance in collecting data for this study, in particular nyree pisanu and ella horton. the authors declare no conflict of interest. key: cord- -w qvsgh authors: chriqui, jamie f.; leider, julien; schermbeck, rebecca m.; sanghera, anmol; pugach, oksana title: changes in child and adult care food program (cacfp) practices at participating childcare and education centers in the united states following updated national standards, – date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: w qvsgh the u.s. department of agriculture’s (usda) child and adult care food program (cacfp) updated meal pattern standards took effect in october . the aim of this quasi-experimental, pre-post study is to identify changes in food and beverage practices of cacfp-participating centers due to implementation of updated cacfp meal patterns over a -month period. eight hundred and fifty-eight centers located in states and the district of columbia completed a survey (primarily electronic) at both time points ( . % follow-up response rate). multivariable logistic regressions with robust standard errors assessed changes over time, accounting for repeated observations within each site. from baseline to follow-up, centers reported the increased familiarity and implementation, albeit with time, money, and staffing-related challenges. significant improvements were seen in not serving sugary cereals or flavored milk, in serving % whole grains, and serving processed meats less than once a week. while cacfp-participating centers reported making significant progress in meeting the updated meal pattern standards and suggested best practices within – months of their effective date, reported compliance and adherence to the standards and best practices was not universal. usda, state agencies, and technical assistance providers should work to provide centers with additional guidance to help them with implementation. the child and adult care food program (cacfp) is predominantly a program for low-income children and adults in the united states; approximately percent of all meals served in cacfp in fiscal year were free or reduced-price meals [ ] . for many children and adults receiving meals through cacfp, the program may provide the only nutritious meals that they receive on a given day. in , the u.s. department of agriculture (usda) updated the meal pattern standards governing cacfp. the updated standards took effect on october , although centers and homes participating in cacfp were provided a -year transition period for those entities making a "good faith effort" to comply with the standards [ , ] . in fiscal year , nearly . million children and adults participated in cacfp [ ] . over billion meals were served in cacfp homes, centers, and adult day care facilities during fiscal year , with over . billion of these specifically being served in over thousand study assessed changes in beverages served in childcare sites following implementation of updated california beverage standards for licensed childcare providers. overall, they found that adherence to the new standards improved over time ( . % vs. . %) and that cacfp sites were more adherent to the standards than non-cacfp sites ( . % vs. . %) [ ] . finally, a study in delaware surveyed cacfp sponsors one year after the implementation of the revised meal patterns. eighty percent of these sponsors reported little to no challenges when implementing the changes to the cacfp program. sponsors reported a high level of support for the changes by parents, and sponsors felt that there had been enough training to implement the changes. sponsors also reported challenges to implementing the changes such as an increased cost to serve healthier foods and communicating with parents the changes to the program [ ] . the current study builds upon the above literature as well as a baseline nationwide study that was conducted in late summer/early fall to assess readiness for early care and education (ece) centers participating in cacfp to implement the updated standards. in the baseline study (n = respondents), the majority of centers reported being "very" familiar with the soon-to-be-implemented meal pattern updates. most centers reported being "very" prepared to make the changes, had "very much" begun implementing the updates, and reported needing at least "some" additional time and funding to implement the standards. the majority of centers reported meeting many of the beverage standards/best practices, including fresh water availability, serving only unflavored milk, limiting juice, and never serving fruit drinks or regular soda. most centers reported meeting the best practice for serving % whole grains ( . %) and the majority of centers met the standards for sugars in cereal ( . %). roughly one third of centers reported serving only plain/unflavored yogurt or no yogurt, a conservative measure of meeting the yogurt standard. with regard to best practices, most centers reported serving snacks with at least one component being a fruit or vegetable (f/v) at least one time a day. most centers also reported providing at least one serving of dark green, red/orange, starchy, and other vegetables at least once a week. nearly % of centers reported serving processed meats less than once a week [ ] . the purpose of the present study was to evaluate the short-term ( - months post the effective date) progress made in implementing the updated cacfp standards by ece centers nationwide and to identify opportunities for continued progress going forward. we hypothesized that, from baseline to follow-up, as implementation of the updated standards took effect, there would be increases in centers' familiarity with and reported implementation of the standards, that reported challenges would weaken over time, and that there would be improvements in the extent to which centers met the standards and best practices. to our knowledge, this is the first study to longitudinally examine changes in readiness and implementation of the updated cacfp standards by ece centers across the united states. the study seeks to provide insight as to which aspects of the updated meal pattern standards have been easier for centers to implement as well as those aspects of the standards that may require further guidance from usda and state agencies to facilitate implementation. this was a longitudinal, pre-post study of cacfp-participating ece centers. a nationwide baseline survey of readiness for implementing the updated cacfp standards was conducted between august and september . detailed methods on the baseline survey are reported elsewhere [ ] . briefly, centers located in states (including alaska and hawaii) and the district of columbia (d.c.) responded to the baseline survey ( % response rate). in january , a follow-up electronic survey was sent to of the baseline respondents ( was determined closed as part of a separate sub-study and one was determined to only serve infants) via electronic mail. the survey was programmed and administered using a research electronic data capture (redcap) database [ ] . both administrations of the survey (baseline and follow-up) were deemed exempt by the university of illinois chicago institutional review board (protocol # - ). the baseline respondents were asked to complete a brief ( - min) follow-up survey and each respondent was offered the opportunity to receive a $ electronic gift card following survey completion. an initial advance email was sent to the providers on january , letting them know that the survey would soon be sent out via electronic mail. the initial electronic survey was emailed on january and follow-up reminders were sent weekly through february , and a final reminder was sent to partial responders on march . from to march , a final mail-based survey was sent out to non-respondents to the web-based survey with a postage-paid return envelope as well as a link to the web survey. (a copy of the mail survey is provided in the supplementary materials.) a final email reminder to non-responders to this mailing was sent on april . all centers were also offered the option of calling and completing the survey by phone. through these attempts, sites ( %) were deemed to have closed or merged or no longer participated in cacfp or only did so in summer (and therefore were ineligible). this left eligible centers. we used the american association of public opinion research's (aapor) outcome rate calculator for calculating the response rates [ ] . in total, centers ( . %) located in states (all except arkansas, louisiana, and maine) and d.c. completed the follow-up survey; of the responders ( %) used the web platform and an additional responders ( %) completed the hard copy mail-back survey. other centers either only partially completed the survey and their responses were not used ( centers; . %), declined ( centers; . %), logged on but did not complete any item ( centers; . %), or neither responded to the survey nor declined to take it ( centers; . %). the only statistically significant differences by response modality were for the updated standards requiring more staff (internet: . % vs. mail: . %, p = . ); not offering sugary cereals (internet: . % vs. mail: . %, p < . ); meeting the dark green vegetable best practice (internet: . % vs. mail: . %, p = . ), and meeting the starchy vegetable best practice (internet: . % vs. mail: . %, p = . ). at the outset, this study was designed to identify changes in food and beverage practices due to implementation of updated cacfp meal patterns. the study hypothesis was that there would be a . change in the types of foods/beverages served due to cacfp standards when comparing baseline (august-september ) to follow-up (january-may ) survey results. the sample size calculation to achieve % power with a two-sided hypothesis test at the . significance level was based on the test for two correlated proportions (mcnemar test) for a pre-post design. conservatively, we assumed . prevalence of each outcome at the baseline measurement and approximated the proportion of discordant pairs (the proportion of sites that changed response after intervention) as . using machin and colleagues' formula [ ] . this indicated a required sample size of sites in the longitudinal panel to detect a . difference in the outcome due to the intervention. thus, with our completed surveys at follow-up, we were able to exceed this threshold. a copy of the follow-up survey is provided in the supplementary materials. the beginning section asked about the center name, zip, and confirming that the center still participated in cacfp as well as about the respondent role and how long they have been in their role. the next section asked about the center ownership, whether they had a food program sponsor, participated in early head start or head start, and additional questions about their participation in cacfp including funding sources. the section also asked about meal and snack provision, preparation, and menus. the third section asked about training for the center and/or staff on cacfp and their staff's perceived familiarity with and extent of implementing the revised meal pattern standards. the final section asked about specific meal and snack practices that were aligned with the cacfp standards and best practices. in total, the baseline survey included questions and the follow-up survey included questions, with questions duplicative over the two time periods. three categories of outcome measures were obtained from the survey: implementation progress and challenges, meeting cacfp standards, and meeting cacfp best practices. specific outcome measures for each category are briefly described herein. specific question wording is provided in the survey included in the supplementary materials. two items measured implementation progress: familiarity with the updated standards (follow-up survey question ) and reported progress in implementing the standards (survey question b). responses to both items were reported using a -item likert-scale ranging from "very much" to "i don't know." for both items, the responses were dichotomized into = "very much" and = "somewhat," "not at all," or "i don't know" responses. four items measured perceived implementation challenges: amount of time needed to implement the standards (survey question c), implementation requires more work and resources than the site has with their current funding (question d), implementation requires more work and resources than the site has with current staffing (question e), and staff opposition to the revised standards (question f). each of these questions was also measured using a -item likert scale and then recoded into separate dichotomous measures as follows: time to implement ( = "a lot of time" or "some time," = "not much time" or "i don't know"), and additional funding needed, staffing needed, and staff opposition used the same dichotomization ( = "very much" or "somewhat" and = "not at all" or "i don't know"). meeting the standards for making clean, fresh water available, never serving flavored milk, and serving % juice less than twice a day, and the best practice for never serving juice drinks and soda, was determined based on follow-up questions , , , and , respectively. meeting the standards and best practices of only serving % or skim milk and no flavored milk was computed based on questions and . flavored milk never being served was identified based on question . serving % juice less than twice a day was identified based on question . whether sugar cereals were served was determined from questions a-f. only serving plain/unflavored yogurt was identified based on question . the best practice of the milk typically served being % or skim was identified based on follow-up question , as was whether whole milk was one of the milks typically served. never serving fruit drinks was identified based on question . best practice measures were computed for serving vegetables at least once a week separately for: dark green (based on spinach, question a , and broccoli, question h ), red/orange (based on yams/sweet potatoes, question g , and carrots, question i ), starchy (based on corn, question b , mashed potatoes, question e , potato wedges, question f , and peas, question c ), and other vegetables (based on lettuce/packaged salads, question d , cauliflower, question j , mixed vegetables, question k , and cucumbers, question l ). serving a fruit or vegetable as a component of a snack at least once a day was identified based on question a. the best practice measure of serving % whole grains was identified based on questions regarding serving % whole wheat/whole grain bread (question a ), pasta (question b ), tortillas (question c ), and brown rice (question d). the cacfp best practice related to cheese encouraged only serving natural cheese or low fat/reduced fat cheese. the survey (question ) only captured information on not serving cheese or serving only low fat/reduced-fat cheese and, as such, we report on the question measure herein. the best practice of serving processed meat less than once a week and whether any processed meat was served were identified based on questions regarding serving packaged lunch meat (follow-up survey question a ), beef or pork hot dogs (question b ), and turkey hot dogs (question c ). analyses controlled for a number of center characteristics. control variables obtained from the survey included whether the center was corporate-owned, participated in head start/early head start, was food program sponsored, the number of staff employed (categorized as - , - , - , and ≥ employees), enrolment capacity (categorized as - , - , - , and - children), length of the center's participation in cacfp (categorized as < and + years), and the weekly rate for - year old children (categorized as free/no cost or state subsidized, $ -$ . , $ -$ . , and ≥$ ). these items were only asked at baseline, except those relating to corporate ownership, head start/early head start participation, and food program sponsorship, which were asked at both timepoints. majority race (categorized as ≥ % non-hispanic white, ≥ % non-hispanic black, ≥ % hispanic, and mixed) and percent urban were obtained at the zip code level from the american community survey and census data, respectively [ , ] . data on whether state nutrition standards were linked to cacfp as of april were obtained from the public health law center [ ] . finally, census division was coded based on the state in which each center was located [ ] . weights adjusting for non-response to both the baseline and follow-up surveys were developed. weights developed for the baseline survey and described elsewhere [ ] were multiplied by attrition weights designed to account for the probability of non-response to the follow-up survey to generate the final weights. the attrition weights were computed using a similar methodology. specifically, the probability of attrition was computed for each center in the follow-up sample using logistic regressions including zip code-level characteristics and center characteristics from the baseline survey, using multiple imputation with chained equations with imputations to impute missing center characteristics. attrition weights were then computed based on the response rate within each decile of attrition probability. final weights were trimmed at the th and th percentiles. using a generalized estimating equations (gee) approach with an unstructured correlation structure, odds ratios and % confidence intervals were computed from multivariable logistic regressions with robust standard errors to assess changes over time accounting for repeated observations within site. both unadjusted models, controlling only for time and division, and adjusted models that controlled for the center characteristics noted above, were estimated. each model was restricted to a balanced sample of centers with data on the outcome and relevant control variables at both baseline and follow-up. statistical significance was defined as a two-tailed p-value of less than . . analyses were conducted in stata/se . . specifically, svy commands were used to account for survey stratification and weighting in computing unadjusted prevalence estimates, while weights alone were included in gee models, which are not supported with svy commands. average adjusted prevalence estimates were computed from the gee models using the margins command, which also took account of the weights [ ] . weighted characteristics of the centers participating at baseline and follow-up are detailed in table . the majority of centers reported not being corporate-owned, head start/early head start affiliated, or having a federal food program sponsor. around three quarters of the centers employed employees or less, while over three quarters of the centers reported having an enrolment capacity of or more children. over percent of the centers had participated in cacfp for years or more, and nearly one half of centers charged a weekly rate of between $ and $ . for children aged - years old; nearly percent of the centers did not charge or were state subsidized. centers were located in zip codes that included predominantly white (> %), predominantly black (nearly %), predominantly hispanic (> %), or a mix of racial/ethnic identities amongst the residents. centers were located in areas that were predominantly urban on average. nearly percent of the centers were located in a state with ece standards that were linked to cacfp and the centers were located in all nine census divisions. appendix a table a provides unweighted characteristics of responders and non-responders for the follow-up survey along with corresponding p-values for whether the responders were statistically different from non-responders. as appendix a table a indicates, the responders and non-responders were not significantly different on any characteristic considered. at the time of the follow-up survey (conducted between and months following the effective date of the updated cacfp meal patterns), percent of centers reported being very much familiar with the standards and percent reported having implemented them (figure ). centers were significantly more likely to report familiarity and implementation between the baseline and follow-up survey periods. at the time of the follow-up survey (conducted between and months following the effective date of the updated cacfp meal patterns), percent of centers reported being very much familiar with the standards and percent reported having implemented them (figure ). centers were significantly more likely to report familiarity and implementation between the baseline and followup survey periods. at the same time, the percentage of centers reporting challenges with needing more time, money, and staff to implement the updated meal patterns increased from baseline to follow-up (all p-values < . ). more than one half of the centers reported these challenges at follow-up (with percent reporting needing more money to implement the standards as compared to only percent at baseline). reported staff opposition to the updated standards was lowest among the other reported challenges; however, significantly more centers did report staff opposition at follow-up as compared to the baseline period ( percent at baseline vs. percent at follow-up). table presents the results of the adjusted regression models predicting compliance with selected standards, with statistically significant differences from baseline to follow-up noted with asterisks. (appendix a table a contains the unadjusted models.) at follow-up, most centers met the beverage overall standards/best practices ( . %) and there was a significant increase in never serving flavored milk (baseline = . %, follow-up = . %). although the percentage of centers reporting serving only % or skim milk and no flavored milk declined over time, this change was not significant. the percentage of centers that did not serve sugary cereals significantly increased by . percentage points (baseline = . %, follow-up = . %). concomitant to the increase in not serving sugary cereals was a statistically significant decrease in centers reporting serving specific sugary cereals: froot loops (decline from . % to . %), lucky charms (decline from . % to . %), and honey nut cheerios (decline from . % to . %). at the same time, the percentage of centers reporting challenges with needing more time, money, and staff to implement the updated meal patterns increased from baseline to follow-up (all p-values < . ). more than one half of the centers reported these challenges at follow-up (with percent reporting needing more money to implement the standards as compared to only percent at baseline). reported staff opposition to the updated standards was lowest among the other reported challenges; however, significantly more centers did report staff opposition at follow-up as compared to the baseline period ( percent at baseline vs. percent at follow-up). table presents the results of the adjusted regression models predicting compliance with selected standards, with statistically significant differences from baseline to follow-up noted with asterisks. (appendix a table a contains the unadjusted models.) at follow-up, most centers met the beverage overall standards/best practices ( . %) and there was a significant increase in never serving flavored milk (baseline = . %, follow-up = . %). although the percentage of centers reporting serving only % or skim milk and no flavored milk declined over time, this change was not significant. the percentage of centers that did not serve sugary cereals significantly increased by . percentage points (baseline = . %, follow-up = . %). concomitant to the increase in not serving sugary cereals was a statistically significant decrease in centers reporting serving specific sugary cereals: froot loops (decline from . % to . %), lucky charms (decline from . % to . %), and honey nut cheerios (decline from . % to . %). models controlled for census division, whether owned by corporate, whether participated in head start/early head start, whether food program was sponsored, number of staff employed, enrolment capacity, length of center's participation in cacfp, weekly rate for - -year-olds, majority race, urbanicity, and whether state nutrition standards were linked to cacfp. average adjusted prevalence estimates were computed from the gee models using the margins command in stata. an additional model sought to examine changes in serving % juice less than twice a day but this model could not be computed (extremely high/low prevalence at both time points; see appendix a for unadjusted model estimates). an additional model examined the extent to which centers were meeting the sugar in yogurt standard; the result was not significant and is not reported in the table for brevity. * p < . ; ** p < . ; *** p < . . results of the analyses examining centers' progress in meeting cacfp best practices are presented in table . (appendix a table a presents the unadjusted models.) there was a statistically significant decline in the prevalence of % or skim milk typically being served (from . % to . %) and a concomitant increase in the prevalence of whole milk being served (from . % to . %) from baseline to follow-up. there were no significant changes from baseline to follow-up in the serving of fruit drinks, any of the vegetable-related best practices, or including a fruit or vegetable as a component of a snack at least once a day. there was a significant increase in the prevalence of serving % whole grains over time ( . % to . %). there also were significant increases in not serving any cheese or only low fat/reduced fat cheeses and in meeting the best practice of serving processed meats (which tend to be high in sodium) less than one time per week. notably, there also was a significant decline over time in centers serving any processed meats ( . % to . %). average adjusted prevalence estimates were computed from the gee models using the margins command in stata. additional models examined the extent to which centers were meeting selected vegetable and fruit best practices; none of the results were significant and, therefore, they are not reported in the table for brevity. * p < . ; ** p < . ; *** p < . . to our knowledge, this was the first pre-post nationwide panel study of implementation of the updated cacfp standards. the purpose of the present study was to evaluate the short-term progress made in implementing the updated cacfp standards by ece centers nationwide and to identify opportunities for continued progress going forward. we hypothesized that, from baseline to follow-up, as implementation of the updated standards took effect, there would be increases in centers' familiarity with and reported implementation of the standards, that challenges would weaken over time, and that there would be improvements in the extent to which centers met the standards and best practices. our hypothesis that centers' familiarity with and reported implementation of the standards would increase was proven accurate. by the time of follow-up, reported implementation was nearly universal ( % vs. % at baseline) and familiarity with the standards increased over time (from % to %). however, and contrary to our hypothesis, we found that centers reported more challenges with needing more time, money, and staff to support implementation of the standards from baseline to follow-up. while these challenges are consistent with reported challenges that ece centers face with cacfp generally [ , , ] , it is possible that, at the time of the baseline survey (which occurred immediately prior to the implementation effective date), centers did not yet have a sense of the resources that would be required for implementation. once they began implementation, however, they may have realized that they needed more resources to support implementation. another explanation may be associated with the timing for implementation. although usda granted a phased-in approach to cacfp providers that were making a "good faith" effort to begin implementation, ece programs generally do not have the benefit of a standard "shutdown" period like schools do where they are typically closed during the school year and have time to train and implement new standards. many childcare centers operate continuously throughout the year, without a clear stop and start date, which could make changes more difficult to implement. finally, while school food service directors have reported similar challenges when implementing revisions to the national school lunch program standards [ , ] , they have also noted that, over time, they have been able to minimize the barriers [ ] and increase participation in the program [ ] . statistically significant improvements were seen in centers meeting some of the standards and best practices, specifically around flavored milk, cereals, and processed meats. it was particularly encouraging to see a significant decline in the proportion of centers reporting that they served flavored milk to children given that flavored milks are a significant source of sugary drinks among young children [ ] . however, we also saw a concomitant decrease in the prevalence of the best practice of serving % or skim milk (decrease from . % at baseline to . % at follow-up) and a concomitant increase in the proportion of centers reporting that they served whole milk (increase from . % to . %). one possible explanation for the increase in whole milk being offered at ece centers is at the request of parents and a reflection of a culture shift in dairy consumption in the united states. the annual milk sales data released by the usda's agriculture marketing service reports an increase in full fat (whole) milk product sales despite a decrease in overall milk sales [ ] . however, this finding warrants further exploration given that national nutrition recommendations and the cacfp meal pattern requirement are for children aged to years to be only served % or nonfat milk [ , , ] . the food category with the lowest rate of reported compliance at baseline was the serving of sugary cereals [ ] . at follow-up, the greatest improvements in compliance were with the reporting of not serving any sugary cereals (increase from . % at baseline to . % at follow-up). the reason for the dramatic increase in adherence to the requirement is unclear and is likely the result of many factors working together. firstly, this was one of the easiest changes to make and likely took an initial period for centers to make the adjustment to their cereal procurement. secondly, state agencies and sponsors likely conducted education for childcare providers during the transition period which contributed to the increased compliance [ , ] . thirdly, throughout the u.s., there have been extensive public health campaigns to decrease the intake of added sugars and limit marketing of foods and beverages of poor nutritional quality, which include sugary cereals, to children [ , ] . more parents and ece directors that understand and value the benefits of reduced added sugar in the diet makes policy changes easier to implement. as with beverages, sugary cereals are a significant contributor to young children's consumption of added sugars [ ] [ ] [ ] ; thus, removing or reducing their availability in the ece environment is key. finally, the updated standards recommended that processed meats, which are typically high in sodium, be limited to less than one time per week. there was significant improvement in meeting this best practice from baseline to follow-up ( . % to . %) but, most notably, there was a significant reduction in the serving of any processed meats over time (from . % to . %). given the sodium content of many processed meats, reducing their availability in ece centers is another strategy for improving young children's overall diet. overall, the finding of improvements in reported compliance with the updated standards is encouraging and similar to previously reported findings in the ece space. in the only other study to assess longitudinal changes in food or beverage offerings among cacfp providers, lee et al. assessed providers' familiarity with and longitudinal implementation of a statewide beverage policy enacted in (that mirrored the usda updated meal pattern standards) for all childcare centers in california [ ] . childcare centers in california reported an overall increased adherence to the four beverage provisions of the state's law from . % in to . % in [ ] . given that our study was the first nationwide study, to our knowledge, to examine changes in compliance with the updated cacfp standards, it is encouraging that many centers are reporting compliance with the standards and best practices; future studies should continue to monitor compliance and examine the extent to which compliance continues to evolve over time. the findings from this study should be considered within the context of the following limitations. firstly, this was a quasi-experimental, pre-post study. without a comparison or control group, such designs are typically considered to have numerous threats to internal and external validity. however, given that, from a federal perspective, the updated cacfp standards only apply to participating program providers and that the purpose of the study was to assess short-term changes in implementation of the updated federal cacfp standards, the use of a control or comparison group would not be appropriate. (we acknowledge that several u.s. states also require ece providers to follow the cacfp standards regardless of cacfp participation status, but that was not the focus of this study.) secondly, this was a study of cacfp-participating centers. although centers serve the largest proportion of young children in ece, fcchs make up a larger proportion of cacfp providers (although the proportion has been declining in recent years) [ ] . ideally, future research will examine longitudinal implementation of the updated meal pattern standards in fcchs. thirdly, the study was based on survey self-report, which inherently is known to have numerous threats to internal validity but, given that the study included a nationwide sample of providers from states and d.c. (including alaska and hawaii), obtaining objective measurements from a sample such as this would have been cost-prohibitive. fourthly, although the baseline response rate was low ( %), it was comparable to the response rates for similar cacfp studies conducted within single states rather than nationally [ , [ ] [ ] [ ] [ ] and, more importantly, our response rate at follow-up was . % of the baseline responders, which provided ample power to detect at least a . change for each outcome associated with the implementation of the standards. finally, this study was conducted between and , prior to the covid- pandemic. given that many ece providers were shut down during the pandemic, the long-term impacts of these shutdowns on participation in cacfp and compliance with the standards will require concerted attention in the months and years to come. in summary, there were improvements in meeting many of the revised cacfp meal pattern requirements and best practices during the first - months of their implementation. however, there continue to be opportunities to improve menus to adhere to the cacfp requirements and best practice recommendations more closely. going forward, usda and state agencies overseeing cacfp enrolment and compliance should focus on providing additional technical assistance and training to cacfp-participating centers to better position them to meet or exceed the standards and best practices so that all young children enrolled in these programs can benefit from the science-based, nutritionally balanced foods and beverages that the program is intended to provide. funding: funding for this study was provided by the robert wood johnson foundation (grant # ) for the policies for action children's healthy weight hub. access to the redcap data system was provided by the university of illinois at chicago center for clinical and translational science (grant #ul tr ). notes: n = - centers. or: odds ratio. odds ratios are from weighted generalized estimating equation (gee) regressions with family binomial and logit link, with robust standard errors, accounting for repeated observations by site. odds ratios correspond to coefficient on time. unadjusted models controlled for time and census division. * p < . ; ** p < . ; *** p < . . child and adult care food program participation, meals, and costs child and adult care food program: meal pattern revisions related to the healthy, hunger-free kids act of . final rule transition period for the updated child and adult care food program meal program and the updated national school lunch program and school breakfast program infants and preschool meal patterns child & adult care food program: participation trends reported adherence to nutrition standards of the child and adult care food program beverage policy implementation by child and adult care food program participation and program type: a statewide examination in georgia provider reported implementation of nutrition-related practices in childcare centers and family childcare homes in rural and urban nebraska compliance with the new child and adult care food program standards for infants and children before implementation child care sites participating in the federal child and adult care food program provide more nutritious foods and beverages status of beverages served to young children in child care after implementation of california policy implementation of revised nutrition standards in us department of agriculture's child and adult care food program early childhood education centers' reported readiness to implement the updated child and adult care food program meal pattern standards in the united states redcap: research electronic data capture response rates-an overview sample size tables for clinical studies - acs -year estimates public health law center census regions and divisions estimating predicted probabilities from logistic regression: different methods correspond to different target populations participation in the child and adult care food program is associated with fewer barriers to serving healthier foods in early care and education successes and challenges in school meal reform: qualitative insights from food service directors food service perspectives on national school lunch program implementation. health behav healthier standards for school meals and snacks: impact on school food revenues and lunch participation rates healthy beverage consumption in early childhood: recommendations from key national health and nutrition organizations consumers more often turn to whole milk choose my plate: all about the dairy group sugary cereals at early childhood education centers participating in the child and adult care food program cacfp halftime webinar: choose breakfast cereals that are lower in added sugars candy: what nickelodeon is peddling to kids department of health and human services department of agriculture. - dietary guidelines for americans nutrition practices and mealtime environments of north carolina child care centers consumption of added sugar among u.s. children and adolescents assessment of mealtime environments and nutrition practices in child care centers in georgia participation in the child and adult care food program is associated with more nutritious foods and beverages in child care policy improves what beverages are served to young children in child care an assessment of nutrition practices and attitudes in family child-care homes: implications for policy implementation participation in the child and adult care food program is associated with healthier nutrition environments at family child care homes in mississippi the authors would like to thank all of the providers that took the time to participate in this project by completing the survey at baseline and follow-up. we also would like to thank doctoral students, yu chen lin and mhinjine kim, for their assistance with recruitment and/or table development. and thanks to the research open access publishing (roaap) fund of the university of illinois at chicago provided financial support towards the open access publishing fee for this article. the authors declare no conflict of interest. the funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. key: cord- - p dmha authors: polzonetti, valeria; pucciarelli, stefania; vincenzetti, silvia; polidori, paolo title: dietary intake of vitamin d from dairy products reduces the risk of osteoporosis date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: p dmha background: vitamin d and calcium are important dietary compounds that affect bone mass, even if other minerals (potassium, zinc, etc.) and vitamins (a, c and k) are also involved. vitamin d and certain minerals, in fact, play an important role in calcium homeostasis and calcium absorption. hip fracture incidence is higher in europe and the united states, where calcium is frequently included in the human diet; while the occurrence of these fractures is lower in developing countries, where diets are often poor in calcium. this condition is named the “calcium paradox”, and may be partially explained by phosphate toxicity, which can negatively affect mineral metabolism. it is important to maintain correct dietary calcium-phosphate balance in order to have a healthy life, reducing the risk of osteoporotic fractures in older people. vitamin d can also act as a hormone; vitamin d (ergocalciferol) is derived from the uv-b radiation of ergosterol, the natural vitamin d precursor detected in plants, fungi, and invertebrates. vitamin d (cholecalciferol) is synthesized by sunlight exposure from -dehydrocholesterol, a precursor of cholesterol that can also act as provitamin d . dietary intake of vitamin d is essential when the skin is exposed for short periods to ultraviolet b light (uv-b), a category of invisible light rays such as uv-a and uv-c. this can be considered the usual situation in northern latitudes during the winter season, or the typical lifestyle for older people and/or for people with very white delicate skin. the actual recommended daily intake of dietary vitamin d is strictly correlated with age, ranging from μg for infants, children, teenagers, and adults—including pregnant and lactating women—to μg for people over years. vitamins are nutrients characterized by low-molecular weight; these compounds are provided by the diet and play a crucial physiological and metabolic role [ ] . vitamins are classified into two categories based on liquid solubility [ ] : water-soluble vitamins (b complex and vitamin c) and fat-soluble vitamins (a, d, e, and k). most vitamins cannot be synthesized by humans; for this reason, they must be provided by food sources or dietary supplements [ ] . vitamins are bioactive nutrients with several health-promoting properties that strongly affect human growth and health [ ] . the term 'vitamin d' was coined in , describing a vitamin able to promote calcium deposition [ ] . vitamin d in nature is available as ergocalciferol (vitamin d ) or cholecalciferol (vitamin d ) [ ] ; vitamin d is mainly present in plants or plant products, while vitamin d is normally detected in animal source foods [ ] . provitamin d ( -dehydrocholesterol) is converted to previtamin d by the action of ultraviolet radiation on the skin, especially ultraviolet b light characterized by wavelength ranging between - nm. [ ] ; previtamin d is converted into -hydroxy vitamin d ( ohd ), which in turn vitamin d, both provided by food or produced by cutaneous synthesis, undergoes hydroxylation in the liver to -hydroxyvitamin d [ (oh)d], which is the most abundant circulating form [ ] . later, in the kidney, (oh)d is converted into , -dihydroxy vitamin d, which is strictly correlated to calcium and phosphate absorption metabolism in the intestine [ ] , also influencing bone cells [ ] . parathyroid hormone has a direct effect on the production of , -dihydroxy vitamin d, with specific control of the physiologic reactions necessary to link active vitamin d to calcium homeostasis [ ] . the best method to determine in human body vitamin d level is represented by determination of serum concentration of (oh)d [ ] ; the optimal level for either skeletal or extra-skeletal health is not the same for everybody, but is correlated with the specific population tested. in the human body, ingested vitamin d and endogenously produced vitamin d are converted to the biologically active form, , -dihydroxyvitamin d [ , (oh) d], named calcitriol. in , the nuclear vitamin d receptor (vdr) for , (oh) d was detected, which has to date been determined in at least human tissues and organs [ ] . in fact, vdr was first detected in the bone, kidney, and gastrointestinal tract; and later found in several other tissues, including those in the brain, breast, colon, and prostate [ ] . phosphoprotein vdr is involved in different biological functions of calcitriol. because of its widespread distribution, vitamin d is not considered just a calcaemic hormone, and lack of vitamin d is actually associated with several other diseases [ ] , such as psoriasis, multiple sclerosis, inflammatory bowel disease, diabetes (both type and ), hypertension, cardiovascular disease, metabolic syndromes, and different kinds of cancer [ ] . severe lack of vitamin d in adults can cause the development of osteomalacia, a disease characterized by the incomplete mineralization of osteoid [ ] , while in children, it is responsible for rickets [ ] . vitamin d has always been named the "antirachitic factor" [ ] . rickets is a disease characterized by decreased mineralization of bone tissue and growth plates, causing weak bones in infants and children [ ] . severe vitamin d deficiency ( ohd < . nmol/l and levels < nmol/l over a long period) in both infants and children can cause rickets, a disease where bones are deformed [ ] . chronic lack of vitamin d dietary intake is the cause of secondary hyperparathyroidism, which is a cause for increased bone turnover, with consequent progressive bone loss and finally an increased risk of bones fracture [ ] . several clinical trials have been performed on older patients to evaluate whether vitamin d supplements can decrease the incidence of fractures [ ] . the results obtained in clinical trials have shown (see table ) a decrease in fracture incidence in patients receiving vitamin d supplementation [ ] . vitamin d supplementation, with or without calcium, can increase bone mineral density (bmd), decrease bone turnover, and decrease fracture incidence [ ] . appropriate doses of vitamin d may differ among patients: different genetic polymorphisms, eventual presence of other diseases, and possible use of drugs can affect vitamin d metabolism [ ] . osteoporosis is a progressive disease caused by the deterioration of the bone structure because of loss in bone mineral density (bmd) [ ] ; its main effect is an increase in the risk of fractures [ ] . in the united states, more than million adults over years of age are at a high risk of developing osteoporosis because of low bmd; the total number of patients affected by osteoporosis in the united states is about million [ ] . in italy, . million women and million men are affected by osteoporosis; each year, , fractures due to osteoporosis are reported, specifically , hip and , femur fractures [ ] . each year, patients with fracture of the proximal femur show a mortality rate of - % [ ] . the occurrence of osteoporosis in african-americans is lower compared to the white population, while small white women, according to epidemiological available data, are the most affected human category [ ] . "calcium paradox" is described by the world health organization as the fact that countries with the highest prevalence of osteoporosis are usually those that have a high intake of calcium [ ] . bovine milk consumed in these countries contains high levels of both calcium and phosphorus; human milk phosphorus content is about % lower [ ] . the high phosphorus content in bovine milk is necessary for proper growth of calves; however, in humans, with poor calcium bioavailability, it affects the serum calcium-phosphorus balance, triggering the parathyroid hormone to release calcium from bones. the higher protein content in bovine milk can also negatively affect the calcium balance; the final result is that the high consumption of dairy products, together with other dietary sources of phosphorus, can increase the risk of osteoporosis [ ] . low bmd characterizes osteoporosis, with consequent deterioration of the microarchitecture with trabeculae smallness, associated with reduced mineralization, and an increase in cortical porosity [ ] . bmd decrease is faster during winter compared to summer [ ] . supplementing with vitamin d ( iu/day) combined with calcium can restrict the fall of bmd during winter [ ] . a clinical trial showed a % lower risk of osteoporotic fracture in postmenopausal women younger than when their diet was supplemented with vitamin d at a dose of . µg/day, compared to women receiving less than . µg/day vitamin d [ ] . furthermore, three other clinical trials showed that a combination of calcium and µg vitamin d reduced fracture risk in adults over years [ ] . vitamin d status is related to bone mineral density (bmd) not only in vitamin d deficient consumers, but also in vitamin d insufficient subjects [ ] . a clinical trial on vitamin d status and bmd in postmenopausal women with osteoporosis showed a significant positive correlation between serum (oh)d and bmd in the trochanteric area of the hip with a threshold below nmol/l [ ] . patients with osteoporosis are usually treated with bisphosphonates, calcium, and vitamin d [ ] . in italy, women with postmenopausal osteoporosis treated with bisphosphonates were classified as vitamin d deficient or vitamin d replete; the mean bmd increase per year in the lumbar spine was . % in vitamin d deficient patients versus . % in vitamin d replete patients; similar differences were determined in the hip [ ] . these results show that the addition of both vitamin d and calcium in anti-osteoporotic treatment is necessary, unless the patient is vitamin d replete (serum (oh)d > nmol/l) and has a dietary calcium intake of mg/d [ ] . the guidelines for the management of postmenopausal osteoporosis describe the importance of satisfying vitamin d requirements in order to obtain the best response for bmd, offering recommendations for its supplementation [ ] , together with calcium [ ] . diet seems to moderately affect osteoporosis, but calcium and vitamin d intake is very important, at least in older patients. diets low in dairy products have been associated with an increased risk of osteoporosis [ ] . a meta-analysis of nine studies reported lower bmd of the spine and hip in vegans compared to consumers who drink milk [ ] . more than studies have been performed to investigate the inverse correlation between vitamin d, its metabolites, and cancer [ ] . women with a higher solar uvb exposure in the third national health and nutrition examination survey (nhanes iii) showed % incidence of breast cancer compared to those with lower solar exposure [ ] . in another survey, men with a higher solar uvb exposure showed only half the incidence rate of fatal prostate cancer [ ] . the ultraviolet-b (uvb)-vitamin d-cancer hypothesis was based on a geographical ecological study of colon cancer mortality rates in the united states in correlation to annual sunlight exposure [ ] . meta-analyses show significant inverse correlations between serum (oh)d concentration and incidence of bladder, breast, colorectal, kidney, and lung cancer [ ] . two studies were reported for colon and rectal cancer. in the first one, an inverse correlation was found between (oh)d concentration and incidence of distal colon cancer and rectal cancer. in the second study, colon cancer cases were directly correlated with (oh)d concentration, while no correlation was determined for rectal cancer [ ] . another method to assess vitamin d's role in cancer is to analyze the different cancer survival rates between black and white americans. in the period of - , black americans older than y had mean (oh)d concentrations between and nmol/l, while white americans had mean concentrations around - nmo/l [ ] . according to these data, black americans would have % higher cancer mortality rates than white americans. in the literature, disparities are evident for cancers: bladder, breast, colon, endometrial, lung, ovarian, pancreatic, prostate, rectal, testicular, and vaginal cancer; hodgkin's lymphoma; and melanoma [ ] . cancer-specific mortality rates are about % higher for black americans compared to white americans. many other health benefits are correlated with higher (oh)d concentrations, including reduced risk of autoimmune diseases [ ] , diabetes mellitus type [ ] , adverse pregnancy and birth outcomes [ ] , respiratory tract infections [ ] , and celiac disease [ ] . recently vitamin d supplementation was tested for its role in preventing coronavirus infections [ ] . thus, the increase in (oh)d concentrations with the aim of decreasing cancer risk will have other additional benefits [ ] . the optimal (oh)d concentration is certainly above nmol/l, probably close to - nmol/l; to obtain those concentrations, - iu/d of vitamin d is necessary, or a moderate amount of sun exposure [ ] . the only way to surely determine that the desired concentration has been obtained is to evaluate serum (oh)d concentration [ ] . the uvb-vitamin d-cancer hypothesis has considerable supporting scientific evidence from several experimental studies [ ] : geographical ecological, observational, laboratory experiments, as well as many clinical trials. lots of sun exposure and use of vitamin d can help prevent and treat many cancers [ ] . vitamin d supplementation can reduce the risk of cancer incidence: this thesis should be further investigated in clinical trials in order to determine the right doses of vitamin d and serum (oh)d concentrations, and the possible involvement of other safety issues. dairy cow breeding started around years ago during the late neolithic and early bronze age in northern and central europe [ ] . "milk" is normally associated with cow milk; however, milk from other animal species is also consumed [ ] . milk is a complete food providing several nutrients, specifically carbohydrates (mainly lactose), proteins, fat, minerals, and vitamins, contributing a mean daily intake of kcal, g of proteins, and . g of fat to the average human diet [ ] . water is the most represented compound in all different milks, ranging from water content lower than % in whale milk to water content of around % in donkey milk [ ] . milk is a natural source of calcium and vitamin d; these nutrients have a synergic interaction in the human body [ ] . if the level of ionized calcium in the blood falls, the parathyroid hormone is secreted by the parathyroid gland, stimulating the conversion of vitamin d to its active form, calcitriol ( , -dihydroxyvitamin d) with a consequent decrease in vitamin d status, determined by measuring the amount of the inactive form. vitamin d, as calcitriol, influences calcium absorption in the intestine, and lack of vitamin d is associated with a reduced absorption of dietary calcium [ ] . dietary intake of vitamin d through dairy products, first of all obviously milk, has been investigated in-depth over the last years [ ] . in the s, vitamin d content in cow milk was determined to be in the range of . - g/l [ ] , while a value of iu per liter was detected in cow milk for vitamin d activity, % of which is water soluble, attributed to vitamin d -sulphate [ ] . vitamin d content can be described using different units: micrograms (µg) or international units (iu); the most common unit used in europe to describe vitamin d content is µg, while to convert µg to iu, the content in µg must be multiplied by [ ] . human milk contains , -dihydroxycholecalciferol and , -dihydroxy vitamin d ; vitamin d content in human milk is considered very low [ ] . a study on children, followed up to years of age, evaluated the effect of maternal vitamin d status during pregnancy on childhood skeletal growth [ ] . results obtained in -year-old children fed by mothers who had vitamin d insufficiency ( ohd levels < nmol/l, %, n = ) or vitamin d deficiency ( ohd levels < nmol/l, %, n = ) during late pregnancy showed lower whole body and lumbar spine bone mineral content (bmc). according to the results of this study, vitamin d supplementation is recommended in pregnant women, especially in the winter months, when sunlight is less. the most important result obtained is the long-lasting positive effect on peak bone mass (pbm) attainment, together with a reduced risk of osteoporotic fracture in older patients [ ] . a recent study [ ] determined total vitamin d content in donkey milk ( mg/l, about iu/l); it was found to be higher compared to the values obtained by analyzing milk produced by several mammalian species, including human milk [ ] . even if donkey milk represents a niche product, its use is recommended for consumers at risk of nutritional deficiencies, such as children and/or elderly; in these patients, donkey milk could help prevent lack of vitamin d [ ] . milk consumption has decreased in recent years, and dietary intake of vitamin d by way of fresh milk has declined [ ] , while cheese consumption has significantly increased (by almost %) since [ ] . the big increase in human population and change in food consumption habits has created the right conditions for production of new fortified foods able to provide the recommended intake of vitamin d in the human diet. milk does not provide the dietary requirements of vitamin d (table ) , while cheese represents the right kind of food for the recommended dietary intake of this nutrient; in the states, the fortification level of vitamin d in cheese is strictly regulated by the u.s. food and drug administration [ ] . in patients with osteoporosis, treatment with drugs is the best approach to decreasing the risk of other fractures. however, even in these patients, the importance of nutrition should be taken into consideration, because inadequate intake of ca, vitamin d, and proteins may reduce the efficacy of anti-osteoporotic drugs [ ] . in one study, elderly women with vitamin d deficiency received fortified soft plain cheese [ ] ; the dairy product provided - % of the recommended dose of vitamin d ( - mg) and % for both ca ( mg) and proteins ( g/kg body weight). with daily consumption of two servings of soft plain cheese for one month, the vitamin d supplement caused a small increase in serum (oh)d. the results obtained in this clinical trial demonstrated that fortified soft plain cheese consumed by elderly women with vitamin d deficiency can reduce bone resorption, positively affecting ca and protein metabolism, analyzing the decrease in pth and increase in igf-i, respectively [ ] . vitamin d deficiency is a public health issue that affects both men and women, causing huge human and financial costs [ ] . consumers can improve and maintain vitamin d status through increased consumption of natural or fortified food sources or vitamin d-containing dietary supplements [ ] . there are only few foods naturally rich in vitamin d, and most of these show great seasonal variation in vitamin d content [ ] . frequent fish consumption can be a good strategy to maintain the required levels of (oh)d, as determined in elderly japanese women [ ] . frequent fish eaters can maintain required serum (oh)d levels also during winter. mushrooms represent another food that is a natural source of vitamin d; all edible mushrooms are rich of ergosterol, which, when irradiated with sunlight or uvb light, is transformed into vitamin d [ ] . fortification of common foods represents an easy and practical method to avoid micronutrient deficiency [ ] . the first fortified food was created around years bc by the persian physician melampus, who enriched wine with iron filings to increase sailors' resistance and their sexual activity [ ] . around six thousand years later, in , the chemist boussingault in france added iodine to salt to prevent goiter. in the s, in denmark, vitamin a was used to enrich margarine, while in the s dairy companies in the united states began to enrich milk with vitamin d to prevent rickets in children [ ] . in canada, vitamin d fortification is compulsory for milk and margarine, while vitamin d addition to food in the u.s. is optional, with the exception of fortified milk [ ] . milk is the main fortified food in the u.s. and in canada [ ] , but the amount of vitamin d added to milk ( mg/ g fluid milk) is not adequate to produce the desired increase or maintain circulating (oh)d. vitamin d fortification at higher levels ( mg/ g powdered milk) showed significant effects in improving vitamin d status and bone mineralization in older women milk [ ] . milk products are systematically, either mandatorily or voluntarily, fortified with vitamin d only in finland, norway, sweden, canada, and the united states [ ] . in finland, the actual recommended fortification level of all fluid milks, with the exception of some organic products, is µg/ g, but there are also some kinds of milk marketed with a concentration of µg/ g [ ] . the fortification is not compulsory, but all dairy companies are actually following these recommendations. in norway, only one type of milk is recommended to be fortified with vitamin d at a concentration of . µg/ g [ ] . sweden recently doubled the fortification levels of fluid milks to µg/ g and imposed a compulsory fortification for all fluid milks with less than % of fat [ , ] . in other countries, such as united kingdom, ireland, spain, and australia, fortification is not mandatory, but there are several vitamin d-fortified milk products available [ ] . in countries where vitamin d fortification policies are strongly applied (finland, canada, united states), the contribution of milk to total vitamin d intake is higher compared to countries without wide fortification policies, such as ireland, united kingdom, spain, and australia [ ] . the consumption of vitamin d-fortified milk was positively associated with (oh)d status [ ] , without a specific effect of local vitamin d-fortification policies. even when the total amount of milk consumption was quite different, the correlation among milk consumption and (oh)d status was determined at relatively low consumption levels [ ] . vitamin d fortification of foodstuff has been shown to be a valid way to increase vitamin d dietary intake; and vitamin d-fortified fluid milk affect both vitamin d intake and (oh)d status [ ] . however, fortification of fluid milks may not be the only strategy. specific staple foods should be chosen in each different country as the best vitamin d carriers considering the results of simulation studies. in many countries where a fortification policy is not currently applied (see table ), the hypothesis of systematic vitamin d foods fortification has been considered, and simulation studies have been recently performed [ ] . the optimal vitamin d status has not been determined yet; the endocrine society's clinical practice guidelines established a lower serum threshold for (oh)d level as nm or ng/ml [ ] . the institute of medicine (iom) determined these thresholds for s- (oh)d status: < nmol/l is vitamin d deficient, - . nmol/l is insufficient, and > nmol/l is sufficient [ ] . vitamin d , administered through cod liver oil, has been used in infant nutrition in northern europe since the s-at a daily dosage of a small teaspoon [ ] . this experimental dose of cod liver oil was really effective, as discovered in studies performed two centuries later [ ] ; the iu ( µg) of vitamin d in one teaspoon was confirmed as being the most appropriate for children [ ] . vitamin d intake has been better characterized in children nutrition compared to adult requirements [ ] . in the s, a scientific committee determined the requirement for vitamin d in adults and recommended one-half of that was infants [ ] . strategies to improve vitamin d status in the population are based on an increased intake of naturally vitamin d containing foods, production of fortified foods, using vitamin d supplements, increasing solar uv-b exposure, and weight loss [ ] . vitamin d food fortification seems to be the best strategy to improve vitamin d intake and status in human population in order to meet dietary vitamin d recommendations [ ] . considering the lack of natural vitamin d-rich foods, some countries, particularly populations at high latitudes, developed national policies of fortifying certain foods with vitamin d to prevent deficiency of this nutrient [ ] . the most common vitamin d-fortified foods are low-fat milk, fat spreads, breakfast cereals, and certain baby foods [ ] . considering the different food habits among different populations, wider vitamin d fortification of several products rather than concentrating on the limited production of a small amount of staple foods has been suggested [ ] . in general, food can be enriched with vitamin d by simply adding vitamin d to it (i.e., traditional vitamin d food fortification) or practising the so called "bioaddition" [ ] . bioaddition of vitamin d, which has also been called "biofortification," refers to different methods of increasing vitamin d content in food without direct exogenous addition of this compound [ ] . milk fortification with vitamin d started in the usa in the s [ ] . milk was initially fortified using two different methods: by irradiating milk with vitamin d or feeding the cows irradiated yeast [ ] . in the s, a simple and valid method based on direct supplementation of vitamin d concentrate to milk was developed; it is still in use today [ ] . in the united states, several rte (ready-to-eat) breakfast cereals are fortified with vitamin d and also added to yogurt and margarines, while in canada, it is not permitted to fortify rte breakfast cereals. however, in fortified foods, the level of vitamin d must not exceed iu/ calories [ ] . the efficacy of vitamin d food fortification in increasing vitamin d serum level has been tested [ ] . foods fortified with vitamin d normally contain iu per serving; consumption of fortified milk increased vitamin d intake and was responsible for a significant increase of (oh)d levels [ ] . an average daily intake of about µg ( iu/day) using fortified foods (range - iu/day) achieved (oh)d concentrations up to . ng/ml. a daily increase of . ng/ml in (oh)d levels was achieved for each iu ( µg) ingested [ ] . the most common food fortified with vitamin d is fresh milk, contributing % of the total daily vitamin d intake. male teenagers ( to years) [ ] had the highest vitamin d intake among the age/sex categories; however, on evaluating the other consumers involved in the study, dietary intake of iu was not sufficient to reach serum levels of ng/ml [ ] . therefore, considering that the vitamin d dietary requirement can be satisfied when in serum vitamin d level is ≥ ng/ml, actual consumers mean intake of vitamin d can be considered low and not adequate, compared to daily nutritional requirements [ ] . higher levels of vitamin d fortification are required in order to increase the number of consumers with serum levels of (oh)d ≥ ng/ml [ ] . vitamin d fortification strategies have also been evaluated in consumers living in developing countries, adding both vitamin d and vitamin a to fresh milk, cheese, and margarine; however, the results obtained in these trials have not been clearly discussed [ ] . when considering vitamin d food fortification, it is important to evaluate whether such a public health intervention is likely to be cost-effective [ ] . usually, micronutrient fortification is considered the most cost-effective public health intervention [ ] . with reference to vitamin d food fortification, there are only a few reports available on its cost-effectiveness. the available studies have reported that systematic vitamin d fortification may indeed be highly cost-effective [ ] . the following distribution of costs for a typical food fortification programme was determined as follows: % recurrent production costs, % marketing and education costs, % food control and monitoring costs, and % other production costs [ ] . the deposition of bone minerals begins during pregnancy, particularly in the last three months; bone mass can increase about times from birth to adulthood, with a peak close to % occurring around the age ranging between and years [ ] . in fact, the most critical periods for bone minerals deposition are represented by childhood and adolescence [ ] . bone is a living tissue continuously subjected to cycles of bone formation and bone resorption: poor skeletal integrity causes an increased risk of osteoporotic fractures [ ] . clinical trials have shown that mild vitamin d insufficiency can have a negative effect on bone mineral mass in adolescent females [ ] and children [ ] . the effect of vitamin d supplementation ( iu/day or iu/day) on bone mineral deposition has been examined in adolescent girls (mean age . years) who were receiving ca supplementation as well [ ] . the results showed that bone mineral augmentation of the femur was . % and . % higher, respectively, in groups receiving vitamin d supplementations compared to a placebo. furthermore, vitamin d supplementation significantly reduced bone resorption, evaluated by determining urinary deoxy-pyridinoline excretion [ ] in postmenopausal women, several studies based on vitamin d and calcium supplementation have been conducted in order to determine the best nutritional strategies [ ] . a pooled analysis, describing the effect of vitamin d supplementation on fracture reduction, showed that there was a significant reduction in the incidence of hip fractures when doses higher than iu/day were administered [ ] . however, there was no significant decrease in hip fracture risk caused by calcium intake [ ] . circulating (oh)d is generally considered the most reliable marker of vitamin d status [ ] . the serum content of (oh)d necessary to maintain adequate levels of pth is considered to be between and nmol/l [ ] . because of this high variability, vitamin d insufficiency within populations can be differently evaluated depending on the threshold used. in a study performed using postmenopausal, osteoporotic european women, . % were considered to found to have inadequate levels of vitamin d if the serum (oh)d threshold was fixed to the value of nmol/l, while when the threshold was reduced to nmol/l, women with severe lack of vitamin d were a smaller amount, . % [ ] . based on the results obtained in several clinical trials, nmol/l is considered to be an overestimated threshold, while nmol/l is believed to be an acceptable threshold [ ] . the dose used for vitamin d supplementation should be enough to reach the threshold values of serum (oh)d, otherwise the expected target will not be obtained. clinical trials performed with the aim of determining the anti-fracture efficacy of different doses of vitamin d found that iu per day was not enough to achieve a significant effect in reducing fracture rate [ ] . oral daily doses of - iu or a dose of , iu taken quarterly both showed a positive anti-fracture effect, while an annual intramuscular dose of , iu did not show valid efficacy [ ] . the results obtained in these studies show that the most effective vitamin d supplementation in osteoporotic patients is obtained when administered orally either daily or quarterly; in case of a daily supplementation, the dose should be higher than - iu/day [ ] . however, it is important to consider that, according to several clinical trials performed all over the world, the most effective anti-osteoporotic results were achieved with combined treatment with calcium and vitamin d supplementation [ ] . in women over years of age, the risk of osteoporotic fracture can be frequent, particularly if a lack of calcium is associated with vitamin d deficiency [ ] . in these cases, calcium and vitamin d supplementation can be useful, administering doses of - mg of calcium and iu of vitamin d daily, respectively [ ] . the recommended strategy is to combine vitamin d and calcium into a unique supplement in order to increase a patient's healthy status, with a consequent improvement in treatment efficacy. the risk of osteoporotic fracture is increased with vitamin d deficiency [ ] . in fact, biologically active vitamin d enhances calcium intestinal absorption by regulating calcium transport proteins in the small intestine, stimulating osteoclastic maturation and helping bone growth [ ] . vitamin d supplementation is required in order to reach (oh)d concentrations above ng/ml in a large number of people. vitamin d fortification of basic foods such as dairy and flour products can increase serum (oh)d concentrations, reducing the risk of osteoporosis. prevention is absolutely necessary, considering that in , % of the human population will be over years of age. using appropriate feeding strategies in dairy cows, natural vitamin d content in dairy products, especially fresh milk, can be increased; further studies are necessary to optimize the total natural vitamin d content in dairy products, considering that in several countries, fortification of food is not always permitted as a common practice. author contributions: conceptualization, v.p. and p.p.; writing-original draft preparation, p.p., s.p. and s.v.; writing-review and editing p.p. and v.p.; supervision, p.p., s.v. and s.p. all authors have read and agreed to the published version of the manuscript. review: determination of vitamin d in dairy products by high performance liquid chromatography determination of some water-soluble vitamins in donkey milk effects of vitamin d supplementation on musculoskeletal health: a systematic review, meta-analysis, and trial sequential analysis vitamin d: a new anti-infective agent? rickets before the discovery of vitamin d. bonekey rep vitamin d-effects on skeletal and extraskeletal health and the need for supplementation vitamin d metabolism of the bone vitamin d content in human breast milk: a -mo follow-up study analysis of vitamin d status in men highly exposed to sunlight the prevalence of vitamin d inadequacy amongst women with osteoporosis: an international epidemiological investigation national diet and nutrition survey (ndns): adults aged - years; types and quantities of foods consumed vitamin d deficiency and secondary hyperparathyroidism in the elderly: consequences for bone loss and fractures and therapeutic implications nutritional composition of red meat -hydroxyvitamin d affects vitamin d status similar to vitamin d in pigs -but the meat produced has a lower content of vitamin d importance of vitamin d, calcium and exercise to bone health with specific reference to children and adolescents vitamin d and rehabilitation: improving functional outcomes use of vitamin d and its metabolites in broiler chicken feed on performance, bone parameters and meat quality. asian-austral natural vitamin d content in animal products osteoporosis and mineral nutrition. a literature review analysis of vitamin d and vitamin d in fortified milk powders and infant and nutritional formulas by liquid chromatography-tandem mass spectrometry: single-laboratory validation, first action . the potential role of vitamin d enhanced foods in improving vitamin d status vitamin d as a neuroactive substance osteomalacia and vitamin d deficiency annual high-dose oral vitamin d and falls and fractures in older women: a randomized controlled trial crucial role of vitamin d in the musculoskeletal system minimum required vitamin d level for optimal increase in bone mineral density with alendronate treatment in osteoporotic women the effect of vitamin d on bone and osteoporosis effect of calcium supplements on risk of myocardial infarction and cardiovascular events: meta-analysis need for additional calcium to reduce the risk of hip fracture with vitamin d supplementation: evidence from a comparative metaanalysis of randomized controlled trials the role of calcium and vitamin d in the management of osteoporosis calcium and osteoporosis osteoporosis in populations with high calcium intake: does phosphate toxicity explain the paradox? ind composition and characteristics of ass's milk ten years experience with alendronate for osteoporosis in postmenopausal women the pharmacology of vitamin d, including fortification strategies effect of vitamin d supplementation on wintertime and overall bone loss in healthy postmenopausal women calcium, vitamin d, milk consumption, and hip fractures: a prospective study among postmenopausal women vitamin d supplementation reduces both oxidative dna damage and insulin resistance in the elderly with metabolic disorders vitamin d status and response to treatment in post-menopausal osteoporosis ecological studies of the uvb-vitamin d-cancer hypothesis consequences of a plant-based diet with low dairy consumption on intake of bone-relevant nutrients effect of vegetarian diets on bone mineral density: a bayesian meta-analysis a review of the evidence supporting the vitamin d-cancer prevention hypothesis in vitamin d and breast cancer risk: the nhanes i epidemiologic follow-up study sun exposure, vitamin d receptor gene polymorphisms, and risk of advanced prostate cancer vitamin d for cancer prevention: global perspective serum -hydroxyvitamin d and risks of colon and rectal cancer in finnish men differences in vitamin d status may account for unexplained disparities in cancer survival rates between african and white americans vitamin d in autoimmunity: molecular mechanisms and therapeutic potential vitamin d deficiency and diabetes vitamin d administration during pregnancy as prevention for pregnancy, neonatal and postnatal complications vitamin d supplementation to prevent acute respiratory tract infections: systematic review and metaanalysis of individual participant data possible role of vitamin d in celiac disease onset evidence that vitamin d supplementation could reduce risk of influenza and covid- infections and deaths the mechanism of calcitriol in cancer prevention and treatment vitamin d supplement doses and serum -hydroxyvitamin d in the range associated with cancer prevention the milk revolution the therapeutic, nutritional and cosmetic properties of donkey milk use of donkey milk in cases of cow's milk protein allergies role of proteins and of some bioactive peptides on the nutritional quality of donkey milk and their impact on human health the role of dairy products in healthy weight and body composition in children and adolescents use of calcium or calcium in combination with vitamin d supplementation to prevent fractures and bone loss in people aged years and older: a meta-analysis the total content of vitamin d in human milk and cow's milk vitamin d compounds in cow's milk developmental origins of osteoporotic fracture: the role of maternal vitamin d insufficiency donkey and human milk: insights into their compositional similarities short communication: technological and seasonal variations of vitamin d and other nutritional components in donkey milk convenient analysis of vitamin d in cheese and other food matrixes by liquid chromatography/mass spectrometry inhibition of markers of bone resorption by consumption of vitamin d and calcium-fortified soft plain cheese by institutionalised elderly women an updated systematic review and meta-analysis of the efficacy of vitamin d food fortification public health strategies to overcome barriers to optimal vitamin d status in populations with special needs vitamin d intake: a global perspective of current status serum -hydroxyvitamin d concentrations and related dietary factors in peri-and postmenopausal japanese women distribution of ergosterol in different tissues of mushrooms and its effect on the conversion of ergosterol to vitamin d by uv irradiation vitamin d deficiency in india: prevalence, causalities and interventions iron in ayurvedic medicine solar ultraviolet radiation and vitamin d: a historical perspective vitamin d fortification in the us and canada: current status and data needs the effect of milk supplementation on bone mineral density in postmenopausal chinese women in malaysia vitamin d fortification of fluid milk products and their contribution to vitamin d intake and vitamin d status in observational studies-a review the role of fortified foods and nutritional supplements in increasing vitamin d intake in irish preschool children despite mandatory fortification of staple foods, vitamin d intakes of canadian children and adults are inadequate tackling inadequate vitamin d intakes within the population: fortification of dairy products with vitamin d may not be enough a review of vitamin d fortification: implications for nutrition programming in southeast asia guidelines for preventing and treating vitamin d deficiency and insufficiency revisited dietary reference intakes for adequacy: calcium and vitamin d vitamin d supplementation, -hydroxyvitamin d concentrations, and safety subclinical vitamin d deficiency in neonates: definition and response to vitamin d supplements how much vitamin d for neonates? vitamin d deficiency and rickets bespoke or one size fits all-vitamin d fortification, targeted supplementation in risk groups or individual measurement? maturitas food-based solutions for vitamin d deficiency: putting policy into practice and the key role for research vitamin d-a systematic literature review for the th edition of the nordic nutrition recommendations vitamin d: dietary requirements and food fortification as a means of helping achieve adequate vitamin d status survey of current vitamin d food fortification practices in the united states and canada the dietary reference intakes for calcium and vitamin d: what dietetics practitioners need to know vitamin d requirements for the future-lessons learned and charting a path forward new perspectives on vitamin d food fortification based on a modeling of (oh)d concentrations darnton-hill, i.; nalubola, r. fortification strategies to meet micronutrient needs: successes and failures public health impact and cost-effectiveness of dairy products supplemented with vitamin d in prevention of osteoporotic fractures a review of the micronutrient intervention cost literature: program design and policy lessons the projected public health and economic impact of vitamin d fortified dairy products for fracture prevention in france economic evaluation of vitamin d and calcium food fortification for fracture prevention in germany vitamin d and neurological diseases: an endocrine view epidemiology and public health impact of osteoporosis vitamin d status affects serum parathyroid hormone concentrations during winter in female adolescents: associations with forearm bone mineral density association of low -hydroxvitamin d concentrations with elevated parathyroid hormone concentrations and low cortical bone density in early pubertal and prepubertal finnish girls a positive dose-response effect of vitamin d supplementation on site-specific bone mineral augmentation in adolescent girls: a double-blinded randomized placebo-controlled -year intervention combined calcium and vitamin d supplementation in elderly women: confirmation of reversal of secondary hyperparathyroidism and hip fracture risk: the decalyos ii study a pooled analysis of vitamin d dose requirements for fracture prevention randomized trial of physical activity and calcium supplementation on bone mineral content in -to -year-old children estimates of optimal vitamin d status fracture prevention with vitamin d supplementation how to select the doses of vitamin d supplementation in the management of osteoporosis the relationship between vitamin d and parathyroid hormone: calcium homeostasis, bone turnover, and bone mineral density in postmenopausal women with established osteoporosis estimation of total usual calcium and vitamin d intakes in the united states reducing fracture risk with calcium and vitamin d funding: this research received no external funding. the authors declare no conflict of interest. key: cord- -rvgj pvk authors: munday, molly-rose; rodricks, rohan; fitzpatrick, michael; flood, victoria m.; gunton, jenny e. title: a pilot study examining vitamin c levels in periodontal patients date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: rvgj pvk background: periodontal disease is the leading cause of tooth loss worldwide. current periodontal treatment is limited by its dependency on patients learning and maintaining good dental habits, and repeated visits to oral health physicians. vitamin c’s role in collagen synthesis and immune function makes it important in wound healing and possibly periodontal healing. therefore, if some patients are deficient, this may worsen patient outcomes. methods: patients were invited to participate following assessment and treatment at the westmead centre of oral health periodontic clinic, regardless of current disease stage or treatment. adults were eligible if they gave informed consent and had current periodontal disease. study involvement consisted of periodontal assessment and care followed by an interview and measurement of serum vitamin c and c-reactive protein (crp). results: a total of out of patients had vitamin c levels less than the institutional normal range, of whom had levels < . μmol/l and one < μmol/l. low vitamin c was associated with higher periodontal disease stage (p = . ). elevated crp was found in / of people with low vitamin c and crp was negatively correlated with vitamin c (p < . ). vitamin c did not correlate with patient-reported fruit or vegetable consumption, but high processed meat intake was associated with lower vitamin c. conclusion: although a small study, this rate of vitamin c deficiency in the periodontal clinic is clinically important and correlations with disease severity and crp suggests biological importance. this warrants further studies to assess vitamin c and whether supplementation improves periodontal outcomes, particularly in deficient subjects. vitamin c (ascorbic acid) is an essential nutrient involved in a range of bodily processes such as immune function, metabolism and production of structurally sound collagen. unlike other animals, humans, primates, guinea pigs and bats rely on nutritional sources such as citrus fruit, kiwi, tomatoes, broccoli and capsicum (bell peppers) for vitamin c because they lack the enzyme required for its nutrients , , of synthesis, l-gulono-gamma-lactone oxidase (glo) [ ] . historically, low availability of fresh fruits and vegetables led to widespread deficiency. severe vitamin c deficiency manifests as scurvy [ ] . symptoms of scurvy include bleeding gums, tooth loss, nausea, fatigue, eventual wound re-opening, infections, fractures, haemorrhages, delirium and death [ ] . thought to be long eliminated, scurvy has begun to re-emerge in modern populations [ , , ] . clinically, vitamin c status is usually assessed by measuring serum or plasma vitamin c levels. blood levels correlate best with recent vitamin c intake, usually over days, except in the setting of recent supplementation. commonly, serum vitamin c analysis is used in conjunction with questions about dietary intake of fruits and vegetables. periodontal disease is an umbrella term for a range of conditions affecting the periodontium. it is the result of chronic bacterial plaque build-up and inflammation resulting in damage to the underlying gingiva and alveolar bone [ ] [ ] [ ] . periodontitis is "a chronic multi-factorial chronic inflammatory disease associated with dysbiotic plaque biofilms and characterised by progressive destruction of the tooth-supporting apparatus" [ ] . this leads to destruction of the alveolar bone, recession of the gums, and, if untreated, eventual tooth loss which is seen in stage disease [ ] . the american academy of periodontology classification system formally incorporates clinical attachment loss around teeth, radiographical bone loss, tooth loss, probing depth, bleeding on probing, disease progression and presence of systemic diseases. at initial assessment the patient is assigned a stage and grade based on the above consensus guidelines [ ] . in brief, stage is the border between simple gingivitis and periodontitis and is associated with early stages of attachment loss. stage is moderate periodontitis with damage to tooth support. stage is present when there is significant damage to the attachment apparatus of teeth and tooth loss can occur without treatment. stage is considerable damage to tooth support, often accompanied by tooth loss and difficulty with chewing of food. grade relates to "evidence or risk of rapid progression, anticipated treatment response, and effects on systemic health" [ ] and is rated a, b or c, with c the most severe. usual treatment involves removal of plaque and calculus deposits, sometimes in conjunction with systemic or local antibiotics and encouraging the patient to improve their daily oral hygiene practices [ ] . current periodontal treatments are effective but can be limited by their dependency on patients taking up and maintaining good dental habits. periodontal disease is a common chronic dental disorder that presents a large burden on both local and global societies. together, gingivitis and periodontitis are estimated to occur in % of the australian population, [ ] and % of the us population [ ] , and severe periodontal disease is thought to affect more than % of the global population. likely due to its inflammatory involvement, it is more common alongside a range of comorbidities including cardiovascular diseases, rheumatoid arthritis, and type diabetes [ ] . past studies have examined vitamin c in dental patients with mild to severe gingivitis and this has been recently reviewed [ ] . overall, vitamin c levels were lower in people with gingivitis. additionally, patients report decreased bleeding and gingival inflammation when supplemented with vitamin c [ ] . an inverse relationship has also been established between the severity of necrotizing, ulcerative gingivitis and vitamin c plasma levels [ ] . this is thought to be due to impaired collagen synthesis [ , ] . therefore, vitamin c deficiency results in decreased healing capacity [ ] [ ] [ ] . a number of studies such as woelber et al. have also reported the benefits of a high quality diet for reducing gingival and periodontal inflammation [ ] . reduced bleeding was also noted when dental patients were given two grapefruits a day [ ] . vitamin c deficiency is more common in smokers, the elderly and people of lower socio-economic status, potentially putting those groups at increased risk of periodontal diseases [ , ] . this study aimed to examine the prevalence of vitamin c deficiency within an australian periodontal population. we hypothesised that there would be a clinically important prevalence of vitamin c deficiency, and we tested whether simple dietary questions could predict deficiency. the background rate of deficiency in the australian population is unknown, as is the deficiency rate in the periodontal disease population. as such, this study examined vitamin c levels in a periodontal clinic population. this study was approved by the western sydney local health district human research ethics committee. all subjects gave informed, written consent. hrec reference number - /eth . patients were eligible to participate in this study if they were an adult attending the westmead centre of oral health (wcoh) periodontic clinic. additional eligibility criteria included being able to give informed, written consent and the ability to speak and understand english ( patients were excluded for this). further details can be found in the patient recruitment diagram (figure ). patients were approached following their consultation and/or treatment at the periodontal clinic. three patients declined to consent upon learning that a blood test would be required. the rest were given study details and declined consent at this stage. /eth . patients were eligible to participate in this study if they were an adult attending the westmead centre of oral health (wcoh) periodontic clinic. additional eligibility criteria included being able to give informed, written consent and the ability to speak and understand english ( patients were excluded for this). further details can be found in the patient recruitment diagram ( figure ). patients were approached following their consultation and/or treatment at the periodontal clinic. three patients declined to consent upon learning that a blood test would be required. the rest were given study details and declined consent at this stage. consenting patients were asked about their dietary intake using a survey created by vf and jg. they then underwent a venepuncture to measure serum vitamin c and c-reactive protein (crp) levels. blood samples were collected, immediately wrapped in foil and placed on ice. these instructions were written on the collection request forms. as above, dental examination and assigning of stage and grade was conducted prior to study recruitment. using a williams periodontal probe, six-point probing depth measurements as well as gingival recession measurements (both in millimeters) around each existing tooth were carried out for every patient. missing teeth, tooth mobility and presence of furcations were marked. every patient received a panoramic radiograph to assess for current alveolar bone levels around the existing dentition. radiographic bone loss around teeth was assessed as being in the coronal third, extending to the mid third of the root or beyond (up to the apex of the tooth). the amount and distribution of supra-and subgingival plaque and calculus deposits was noted as well as the presence of bleeding and/or suppuration on gingival probing. additional data were collected from the patients' medical records including their age, address, smoking status and other medical disorders which were confirmed during the interview. the strobe checklist for cross-sectional studies was used. hypertension and hyperlipidaemia were assessed as present in patients who were receiving antihypertensives or lipid-lowering agents, respectively. residential addresses were used with the 'socio-economic indexes for australia ' to estimate ses (socioeconomic score) [ ] . consenting patients were asked about their dietary intake using a survey created by vf and jg. they then underwent a venepuncture to measure serum vitamin c and c-reactive protein (crp) levels. blood samples were collected, immediately wrapped in foil and placed on ice. these instructions were written on the collection request forms. as above, dental examination and assigning of stage and grade was conducted prior to study recruitment. using a williams periodontal probe, six-point probing depth measurements as well as gingival recession measurements (both in millimeters) around each existing tooth were carried out for every patient. missing teeth, tooth mobility and presence of furcations were marked. every patient received a panoramic radiograph to assess for current alveolar bone levels around the existing dentition. radiographic bone loss around teeth was assessed as being in the coronal third, extending to the mid third of the root or beyond (up to the apex of the tooth). the amount and distribution of supra-and subgingival plaque and calculus deposits was noted as well as the presence of bleeding and/or suppuration on gingival probing. additional data were collected from the patients' medical records including their age, address, smoking status and other medical disorders which were confirmed during the interview. the strobe checklist for cross-sectional studies was used. hypertension and hyperlipidaemia were assessed as present in patients who were receiving antihypertensives or lipid-lowering agents, respectively. residential addresses were used with the 'socio-economic indexes for australia ' to estimate ses (socioeconomic score) [ ] . serum vitamin c was analysed using hydrophilic interaction chromatography (hilic) conducted at new south wales health pathology, royal prince alfred hospital (rpah). hilic is more suitable for polar molecules such as vitamin c with good retention and separation rates. in order to increase sample stability, µl of each patient sample was diluted with µl of internal standard containing antioxidant tris( -carboxylethyl)phosphine hydrochloride (tcep, sigma-aldrich, sydney, australia). samples were filtered through a kda centrifugal protein removal column then centrifuged for min. next, µl acetonitrile (sigma-aldrich) was added to µl of the supernatant, then the sample was vortexed and transferred into an hplc vial for analysis. analysis used the dionex ultimate uhplc with dad (thermo fisher scientific cat # , waltham, ma, usa). the assay's detection limit was µmol/l, with the normal range being - µmol/l. this was set by testing a normal group and aligns with the normal range at monash health in australia. ascorbic acid measurements were linear over an analytical range of - µmol/l. the within batch imprecision was < % and the between batch imprecision < %. recovery was over % for the analyte and its internal standards. crp was measured using rate nephelometry by nsw health pathology at westmead hospital institute of clinical pathology and medical research (icpmr). crp levels when normal are reported as < µmol/l, so those patients were assigned a result of µmol/l. statistical analysis was undertaken using graphpad prism version (san diego, ca, usa) or spss version (ibm, chicago, il, usa). where the data was not normally distributed (shapiro-wilk p-value < . ), non-parametric testing such as independent sample mann-whitney u hypothesis testing or spearman's correlation tests were undertaken. a p-value of < . was considered statistically significant. data is shown as mean ± standard deviation or where not normally distributed median ( % confidence interval). patient demographics are reported in table . twenty patients were recruited before the dental clinic was shut down due to covid- . a number of comorbid conditions were reported including cardiovascular diseases, diabetes mellitus, crohn's disease and thyroid issues. patients were approached regardless of their progression through treatment, or their severity of periodontal disease. most patients were approached after their initial examination (n = ), or during the early stages of treatment (n = ). information was obtained from patient records and/or dietary survey. * socioeconomic score (ses) was calculated based using the patient's address [ ] . is the australian median. data shows mean±standard deviation or median ( % ci). nutrients , , of the patients were recruited after review by the treating dentist and before collection of diet information or blood tests so scores were not influenced by diet history or blood results. the world workshop consensus guidelines (published in ) were used to grade disease severity [ ] . the patients in this study had clinically important periodontal disease; of patients were stage , grade b or c indicating advanced periodontal deterioration. nine more patients were stage , grade b or c ( table ). five patients had elevated crp levels of > μmol/l. one of these was a patient with known crohn's disease whose level was μmol/l, so their crp result was excluded from further analysis. four people with low vitamin c had elevated crp levels (figures a, b) . vitamin c and crp were significantly inversely correlated producing a r -value of . (spearman's correlation test) and a two tailed p-value of . (figure b ). people consuming the estimated average requirement of dietary vitamin c or more have levels of µmol/l or higher [ ] . however, most other centers use cut-offs of µmol/l for insufficiency and . µmol/l for deficiency. by these criteria, patients are deficient and has insufficiency. three patients below our normal range would be classified as having adequate status with levels of , and respectively. alternately, a recent review paper suggests an adequate vitamin c for periodontal patients is . µmol/l [ ] . if this is examined, people had vitamin c under that level. five patients had elevated crp levels of > µmol/l. one of these was a patient with known crohn's disease whose level was µmol/l, so their crp result was excluded from further analysis. four people with low vitamin c had elevated crp levels (figure a,b) . vitamin c and crp were significantly inversely correlated producing a r -value of . (spearman's correlation test) and a two tailed p-value of . (figure b ). the shaded area indicates results below the assay normal range. one patient returned a serum vitamin c of μmol/l (normal - μmol/l) and was classified as normal. (b) periodontal stage was evaluated by the treating dentist (rr) prior to blood collection for vitamin c. symbol fill colour indicates grade of periodontal disease (a = green, b = yellow, c = red).* = p = . . five patients had elevated crp levels of > μmol/l. one of these was a patient with known crohn's disease whose level was μmol/l, so their crp result was excluded from further analysis. four people with low vitamin c had elevated crp levels (figures a, b) . vitamin c and crp were significantly inversely correlated producing a r -value of . (spearman's correlation test) and a two tailed p-value of . (figure b) . patients each had an interview about their dietary habits around fruit and vegetable intake to see whether this could predict serum vitamin c. people with vitamin c deficiency reported a nonsignificant higher weekly intake of servings of fruits (median ( - ) versus ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) in people without deficiency) and no decrease in vegetable intake (median ( - ) versus ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) in people without deficiency). interestingly, people with vitamin c < μmol/l reported higher weekly servings of processed meat ( versus . , p = . ). patients each had an interview about their dietary habits around fruit and vegetable intake to see whether this could predict serum vitamin c. people with vitamin c deficiency reported a non-significant higher weekly intake of servings of fruits (median ( - ) versus ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) in people without deficiency) and no decrease in vegetable intake (median ( - ) versus ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) in people without deficiency). interestingly, people with vitamin c < µmol/l reported higher weekly servings of processed meat ( versus . , p = . ). using the home address for each subject, socioeconomic status (ses) was estimated as described in methods. median ses did not differ between deficient and non-deficient groups with wide confidence intervals (median in replete group ( - ) and in deficient group ( - )). ses also did not differ between stage and stage / patients (ses medians and , respectively). this study reports that a significant proportion of patients attending the periodontics clinic at the westmead centre of oral health have vitamin c deficiency. although a small sample size, of people having results below the normal range is a startling statistic that warrants further research. patients with low vitamin c were notified of their test results, and mg per day of vitamin c was recommended. when considered in the context of scurvy, periodontal disease shares a number of similarities such as excessive gum bleeding and tooth loss, therefore it is likely that some periodontal patients meet the requirements for scurvy diagnosis. because low vitamin c correlated with more advanced periodontal disease and with increased crp, a measure of systemic inflammation, it is likely that this finding is biologically important. crp is recognised to be elevated in some patients with periodontal disease, and in those people, treatment is associated with lowering of crp [ ]. the next step may be to conduct a randomised placebo-controlled trial, with the hypothesis that vitamin c will assist periodontal healing in people who are deficient. if whole-body vitamin c status is adequate, then it seems unlikely that supplementation would benefit that particular individual. additionally, as our dental service sees tertiary referral cases, the deficiency proportion in our patients is likely to be more severe than seen in normal dental practices. therefore, studies in community-based dental clinics in australia and other countries are also of interest. however, it is worth noting that the in rate of results below the normal range rate in this study is lower than seen in our high-risk foot ulcer clinic patients ( %, unpublished data). although research has been conducted concerning the relationship between vitamin c and periodontal disease, there is a lack of studies examining the prevalence of vitamin c deficiencies within the australian periodontal population and general australian population. this study provides pilot data for the prevalence of such deficiencies. there are a number of limitations to this study, the most obvious being sample size. study recruitment had to be halted when the dental clinic was closed due to covid- . secondly, recruitment was limited to the wcoh periodontic clinic and non-tertiary centres may find lower deficiency rates. thirdly, as this was a cross-sectional study, it was not able to assess whether deficiency affected periodontal healing, or whether treatment improved healing. additionally, the short survey of diet may be an imprecise indicator of vitamin c intake, and a different screen of diet (such as h recalls) may provide further insights into the association of dietary intake and vitamin c status [ ]. in conclusion, vitamin c deficiency was prevalent at an unacceptable rate in our periodontal clinic. deficiency correlated with more severe periodontal disease, and with increased systemic inflammation. we recommend consideration of testing of vitamin c for patients with significant periodontal disease, particularly if other features of scurvy are present such as bruising or corkscrew hairs, or if periodontal healing does not progress as expected. further research should be conducted into the relationships between vitamin c and periodontal disease, and a randomised, controlled trial would be ideal. the authors declare that they have no relevant conflict of interest. inactivation dates of the human and guinea pig vitamin c genes old sailors" illness makes a return. oral surg. oral med. oral pathol. oral radiol. , , e vitamin c and its role in periodontal diseases-the past and the present: a narrative review an unconventional case of scurvy scurvy: a rare case in an adult classification and diagnosis of aggressive periodontitis impact of the global burden of periodontal diseases on health, nutrition and wellbeing of mankind: a call for global action nutrition, inflammation, and periodontal disease consensus report of workgroup of the world workshop on the classification of periodontal and peri-implant diseases and conditions mean annual attachment, bone level, and tooth loss: a systematic review staging and grading of periodontitis: framework and proposal of a new classification and case definition australian research centre for population oral health. periodontal diseases in the australian adult population prevalence of periodontitis in adults in the united states: and comorbidity of periodontal disease: two sides of the same coin? an introduction for the clinician the effect of controlled ascorbic acid depletion and supplementation on periodontal health a case-control study of plasma ascorbate and acute necrotizing ulcerative gingivitis collagen structure and stability regulation of collagen synthesis by ascorbic acid vitamin c: the known and the unknown and goldilocks plasma and urinary ascorbic acid leveles in the postoperative period role in oral tissue: a review an oral health optimized diet can reduce gingival and periodontal inflammation in humans-a randomized controlled pilot study grapefruit consumption improves vitamin c status in periodontitis patients prevalence and risk factors for vitamin c deficiency in north and south india: a two centre population based study in people aged years and over estimated prevalence and predictors of vitamin c deficiency within uk's low-income population socio-economic indexes for areas (seifa) dietary reference intakes for vitamin c, vitamin e, selenium, and carotenoids key: cord- -yeucn x authors: altobelli, emma; angeletti, paolo matteo; profeta, valerio f.; petrocelli, reimondo title: lifestyle risk factors for type diabetes mellitus and national diabetes care systems in european countries date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: yeucn x background. diabetes is increasing by . % per year in males and . % in females. lifestyle risk factors are related to diabetes. the aim of this work is to highlight within eu- countries the distribution percentages of some lifestyle risk factors and some components of diabetes health care. methods. a literature search was conducted to highlight the presence of diabetes registries, which are fundamental tools for disease surveillance and health planning; the presence of a national diabetes plan (ndp); the care setting; and methods used for reimbursement of drugs, devices, and coverage of any comorbidities associated with diabetes. a multiple correspondence analysis (mca) was carried out to evaluate the possible associations between the variables considered. results. the highest percentages of diabetes (> %) are registered in bulgaria, malta, and hungary. concerning the prevalence of overweight, no european country shows overall percentages of less than %. regarding obesity, % of countries show prevalence rates of %. the record for physical inactivity belongs to malta, with % of individuals being inactive. the percentage of physical inactivity for females is higher than for males across europe. in total, % of the countries have an insurance-based health system, while countries have public national health systems. further, % of countries have an ndp, while % of the eu countries have established a prevalence register for diabetes. conclusions. prevalence rates for type dm in the range of – % are noted in % of eu- countries. in total, out of eu countries show a high prevalence rate for overweight, while % of eu- countries have an obesity prevalence rate of %. diabetes treatment is entrusted to general practitioners in most countries. the results of this work highlight the differences between countries, but also between genders. type diabetes mellitus represents the paradigm of chronic diseases in which there is a close association between family and environmental factors. it is now a health problem with enormous global impact, with estimates of continuous growth [ ] . an important universally recognized risk factor is high calorie intake with limited intake of fiber, which results in an increased accumulation of visceral fat, an increase in body mass index (bmi), and increase in abdominal circumference [ ] . table and figures and summarize the information related to the income and distribution percentages of the following risk factors: overweight, obesity, physical inactivity, and type diabetes. data came from eurostat datasets [ ] and we used the map creator software to build the maps (figures and ) . a literature search was conducted to highlight the presence of diabetes registries as fundamental tools for disease surveillance and health planning ( a literature search was conducted to highlight the presence of diabetes registries as fundamental tools for disease surveillance and health planning ( table ). the keywords used were registries or incidence or prevalence and diabetes mellitus; insulin-dependent registries or incidence or population based and diabetes mellitus, insulin-dependent; "prevalence" or "registries" or "population based" and "diabetes mellitus, type " and "epidemiology"; considering publications from the last years, in english, over years of age. the prisma [ ] method was used to select bibliographic entries ( figure ). only references to type diabetes registries were selected. the data covered the type of health system, presence or absence of a national diabetes plan (ndp), presence of a population-based register, care setting, methods for reimbursement of drugs, devices and coverage of any comorbidities associated with diabetes, and the prevalence of and mortality from diabetes, gathered from the institutional sites of individual european countries to investigate the presence of national data and policies for diabetes control. furthermore, to ensure the completeness of the data, the following sources of information were consulted: eurostat [ ] , who diabetes country profiles [ ] , european commission (ec) [ ], international federation of diabetes (ifd) [ ], foundation of european nurses for diabetes (fend) [ ] , and the world bank [ ] . all data are reported in table . full-text articles excluded, with reasons n = type diabetes registries n= paper without studies included in qualitative synthesis (n = ) (n = eu- countries n = outside eu- countries) the data covered the type of health system, presence or absence of a national diabetes plan (ndp), presence of a population-based register, care setting, methods for reimbursement of drugs, devices and coverage of any comorbidities associated with diabetes, and the prevalence of and mortality from diabetes, gathered from the institutional sites of individual european countries to investigate the presence of national data and policies for diabetes control. furthermore, to ensure the completeness of the data, the following sources of information were consulted: eurostat [ ] , who diabetes country profiles [ ] , european commission (ec) [ ], international federation of diabetes (ifd) [ ], foundation of european nurses for diabetes (fend) [ ] , and the world bank [ ] . all data are reported in table . a multiple correspondence analysis (mca) was carried out in order to to evaluate the possible association between the variables taken into consideration, including eurostat data for the countries of the european union, data relating to mortality per , inhabitants and the mortality trend [ ] , the prevalence of diabetes [ ] , the organization of the health system [ , , ] , the presence of a national diabetes plan, the year of approval [ , ] , the general practitioners and diabetic centers involved, and the cost percentage of diabetes of the total health expenditure [ ] . the variables listed above were classified as follows: percentage of diabetes (≤ %, > %), diabetes mortality (≤ per , , greater than > per , ), mortality trend (growth, stable and in reduction), and percentage cost of diabetes of total health expenditure (≤ %, > %). the mca was conducted using sas statistical software. the graphical representation takes into account the variables that contributed most to the variance. countries belonging to the european union show high income rates, except for bulgaria and romania. the highest percentages of diabetes (> %) are registered in bulgaria, malta, and hungary. values for diabetes of between and % are shown for % of the countries, including the czech republic, croatia, estonia, france, italy, greece, lithuania, latvia, poland, portugal, romania, slovakia, slovenia, and spain; while values between and % are shown for austria, belgium, cyprus, denmark, finland, luxembourg, germany, ireland, sweden, the united kingdom, and the netherlands. regarding men, seven countries ( %) have a diabetes percentage rate higher than %: bulgaria, czech republic, estonia, hungary, malta, spain. regarding women, bulgaria shows a rate of %. concerning overweight individuals, no european country shows overall percentages of less than %. in fact, as many as out of countries ( % of european countries) show a high percentage of overweight of %; the remaining countries show percentages of between and %. overweight affects % of men in countries (czech republic, estonia, luxembourg, malta, spain, and uk) and percentages between - % are shown for states. only latvia has a percentage just below %. the figures for women are globally similar, with the exception of austria, where the percentage of overweight is slightly lower ( . %). in out of countries, the percentage of female overweight is between and %, while in countries the percentage exceeds % (czech republic, denmark, estonia, greece, latvia, lithuania, malta, poland, spain, uk). regarding obesity, % of european countries show values of obesity of %: bulgaria, croatia, czech republic, estonia, france, greece, france, hungary, ireland, latvia, lithuania, malta, poland, slovakia, slovenia, spain, uk). percentages in the range of . - . % are shown for cyprus, italy and romania. the remaining countries show obesity percentages ranging between and %. regarding gender, obesity rates are above % for men in countries (czech republic, estonia, luxemburg, uk), while the lowest values are recorded in austria, portugal, and romania. particularly relevant is that in some countries (czech republic, malta, estonia, and uk) the percentage of obese women is greater than %. instead, the percentage exceeds % in countries (bulgaria, cyprus, france, hungary, ireland, lithuania, poland, slovakia, slovenia, and spain). on the other hand, the percentages of physical inactivity are more variable from country to country. the highest value for physical inactivity belongs to malta with %, followed by countries in southern europe (italy, spain, portugal) and northern europe (belgium and the united kingdom). it is important to underline that the percentage of physical inactivity in females is higher than in males across europe. a total of , references were identified through database searching were, while were identified through manual searching. of these, references were excluded because they were duplicates. of the remaining papers, were selected as potentially valid for the systematic review. nutrients , , of a further papers were excluded for not containing the requested information. in total, papers were analyzed, of which covered type dm and covered type dm (figure prisma flow chart). of the latter , were eu- countries and were from outside the eu- . all results are described in table . european health systems vary from country to country, and even within individual countries. however, in most european countries ( %) there are insurance-based health systems, while in countries there are public national health systems. in % of countries, there are national diabetes plans. in total, % of the countries belonging to the european union have established a prevalence register for diabetes. diabetes care is mainly entrusted to the general practitioner in countries, while in the remaining countries it is entrusted to diabetes centers. in health systems where health care is totally managed by the state government, the latter provides coverage for drugs, devices, and associated comorbidities, except for latvia. in insurance systems, on the other hand, only in belgium is there full coverage for expenses relating to drugs, devices, and comorbidities, while in the remaining countries there are shares for different copayments. mortality is extremely variable; the lowest values are found in finland, while the highest values are present in the islands malta and cyprus. there are only two countries with values above / , , which are croatia and czech republic; while mortality values of between and / . are found in austria, portugal. and hungary. seven out of countries show mortality values of between and , including bulgaria, denmark, germany, italy, latvia, poland, and sweden. in total, % of european countries show mortality values of between and / , , including belgium, estonia, france, greece, ireland, lithuania, luxembourg, romania, slovakia, spain, uk, and the netherlands. the country and year of approval of each national diabetes plan represent the first dimension, which account for about % of the variance; the prevalence and mortality trends represent the second dimensions, which account for around % of the variance. all results are represented in figure . nutrients , , x for peer review of trend, and a health expenditure for diabetes < % of the total national health expenditure. the cloud of points represents the presence of an ndp, health expenditure for diabetes < %, and the presence of the national health service. the chronicity control system is represented by the chronic care model (ccm), which was developed in the mid- s by wagner [ , ] . this model covers the needs of health organizations and citizens. the ccm provides six levels of implementation: the organization of care systems with the removal of barriers; self-management with support from a caregiver; support for decisions on prevention or treatment strategies based on medical evidence; delivery of services; a system for recording and monitoring care and community and public health resources [ ] . for diabetes mellitus, this means a combination of programs the first quadrant includes the following countries and variables-finland, the united kingdom, ireland, sweden, belgium, austria, luxembourg, the netherlands, each showing a mortality rate below . , diabetes < %, stable mortality trend, and with diabetes care entrusted to general practitioners. in this quadrant, a cloud of points can be seen, showing mortality < / , diabetes < % for austria and netherlands, with diabetes care entrusted to general practitioners. the following countries and variables represent the second quadrant-estonia, bulgaria, poland, romania, lithuania, latvia, france, and germany, each showing health expenditure for diabetes > % compared to the total health expenditure, an increasing mortality trend, the absence of a national diabetes plan for diabetes, and health insurance. in this quadrant, an aggregation zone can be highlighted, which includes the absence of a national diabetes plan, a rising mortality trend, and health insurance. hungary, the czech republic, slovenia, greece, croatia, cyprus, malta, and the geographical area of eastern europe represent the third quadrant, each having a mortality rate greater than %, the approval after of the ndp, a % of diabetes > %, and the presence of diabetes services. it is important to underline that a point of clouds includes mortality greater than %, percentage of diabetes > %, and approval year of the ndp after . the fourth quadrant includes portugal, italy, spain, slovak republic, denmark, each showing the presence of a ndp, a ndp approved before , a national health system, a decreasing mortality trend, and a health expenditure for diabetes < % of the total national health expenditure. the cloud of points represents the presence of an ndp, health expenditure for diabetes < %, and the presence of the national health service. the chronicity control system is represented by the chronic care model (ccm), which was developed in the mid- s by wagner [ , ] . this model covers the needs of health organizations and citizens. the ccm provides six levels of implementation: the organization of care systems with the removal of barriers; self-management with support from a caregiver; support for decisions on prevention or treatment strategies based on medical evidence; delivery of services; a system for recording and monitoring care and community and public health resources [ ] . for diabetes mellitus, this means a combination of programs aimed at nutrition education, autonomous control of blood glucose with related strategies, psychological support, and personal empowerment [ ] . the growth estimates for diabetes in europe are quite clear-an increase from . million cases in to . million cases in [ ]. these data are even more alarming in light of the recent sars-cov pandemic, posing a problem to healthcare stakeholders. in fact, diabetics are more susceptible to lower respiratory tract infections due to the abnormal neutrophil function induced by hyperglycemia [ ] . data from clinical studies show the increased susceptibility of diabetics affected by atypical pneumonia [ ] . in this context, the enhancement of telemedicine services appears to be a priority in the control of chronic diseases, especially in lockdown periods. a recent meta-analysis has shown that telemedicine for diabetes treatment is cost effective for both retinal screening and telemonitoring [ ] . another work highlights how the control of the diabetic via telematics allows better control of glycated hemoglobin [ ] , which is the main marker of diabetes progression [ ] . an important aspect to consider is the organization of diabetes services. the economic crisis of the period - severely tested the health systems of individual countries, with progressive cuts to some services or increases in copayment quotas. some health systems, by virtue of their organization or recent reform, have been able to cope with these new economic scenarios, while others have found themselves in more difficulty; the effects of the recent economic crisis are still fully visible in terms of mortality trends [ ] . the close associations between the organizational and financial aspects can be deduced from the distribution of the variables obtained from the analysis of the reports. in fact, it is clear that the activation of a national diabetes plan can contribute to the reduction of the prevalence of mortality from dm and the containment of the global costs of diabetes. our results show that in countries where there is a national health system (uk, italy, spain, portugal) or an insurance system with high social protection (the netherlands, france), excellent performance is noted in the control of diabetic disease and its comorbidities. in fact, the guarantee of access to therapies and control and prevention of complications contribute to reducing mortality, while at the same time lead to significant savings. these results are most evident in countries where a national diabetes control plan has been in place for at least years. another aspect that emerges from our analysis is the care setting. in fact, it seems that the management of diabetes by practitioners compared to diabetic centers guarantees better results in terms of the prevalence of and mortality from t dm, as underlined by the aforementioned meta-analysis of gupta et al. [ ] . access to care or better delivery of care represents one of the cornerstones of the ccm model. in our opinion, a similar system should also cover obese individuals by actively involving them in prevention policies, emphasizing self-care by self-management [ ] . our data show that obesity and being overweight are closely related to physical inactivity, especially in females, representing a gender gap. an emphasis on this theme was noted for the women's football world championship [ ] . countries should make greater efforts to guarantee women access to sports activities, promoting the removal of sociocultural barriers and with ad hoc investments; for example, it has been shown that quality public transport and travel infrastructure for pedestrians could reduce the gender gap, allowing women to practice physical activity with greater ease and accessibility [ ] . this is a fundamental aspect, especially in light of the fact that physical inactivity is one of the determinants of non-communicable diseases [ ] and one of the main determinants of the increase in bmi, and therefore of obesity [ ] . in fact, it has been estimated that by , in eu- countries obesity will reduce life expectancy rates from . to . years and that . % of health budgets will be used to treat complications associated with obesity. moreover, the consequent economic effects of obesity directly reduce productive activities [ , ] . in conclusion, % of eu countries show type dm prevalence rates in the range of - %. in addition, of the eu- countries show a high percentage of overweight, while % of eu- countries have an obesity prevalence rate of %. the record for physical inactivity belongs to malta. in general, physical inactivity rates are higher for females than males. regarding care organizations, national public insurance is present in % of countries. diabetes treatment is entrusted to general practitioners in most countries. the results of this work highlight the differences between countries, but also between genders. the patterns identified could indicate cultural and gender trends to which future public health interventions should be addressed. greater attention should be given to the fight against risk factors for non-communicable diseases, particularly diabetes, considering its high prevalence. this must be a priority for citizens at higher risk. the authors declare no conflict of interest. the founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results. international diabetes federation: brussels ectopic fat storage in the pancreas, liver, and abdominal fat depots: impact on β-cell function in individuals with impaired glucose metabolism environmental/lifestyle factors in the pathogenesis and prevention of type diabetes variation and trends in incidence of childhood diabetes in europe genetic and environmental factors affect the onset of type diabetes mellitus age-period-cohort analysis of - incidence time trends of childhood diabetes in italy: the ridi study facts about diabetes in denmark control of glycemia and cardiovascular risk factors in patients with type diabetes in primary care in catalonia (spain) diabetes and risk of cancer incidence: results from a population-based cohort study in northern italy the prevalence and incidence of diabetes in germany annual report diabetes observatory diabetes in finland prevalence and variation in quality of care. finnish diabetes association stakes-national research and development centre for welfare and health the impact of diabetes on prescription drug costs: the population-based turin study il profilo assistenziale della popolazione con diabete rapporto diabetes prevalence in sweden at present and projections for year diabetes mellitus: a major public health challenge in the st century health fact sheets ministry of health. the national diabetes registry the norwegian diabetes register for adults-an overview of the first years centre for disease control and prevention. national diabetes statistics report epidemiology of diabetes mellitus in russian federation: clinical and statistical report according to the federal diabetes registry national diabetes plan in europe. what lessons are there for the prevention and control of chronic diseases in europe effects di pay-for-performance for primary care physicians on diabetes outcomes in single-payer health systems: a systematic review effects di lifestyle changes on adults with pre diabete: a systematic review and meta-analysis targets for body fat, blood pressure, lipids, and glucose-bassaering interventions in healthy older people assessment di epidemiological obesity among adults in eu countries breast cancer screening programmes across the who european region: differences among countries based on national income level preferred reporting items for systematic reviews and meta-analyses: the prisma statement death due to diabetes mellitus, by sex who. diabetes country profiles. available online diabetes in europe policy puzzle: the state we are in. int. diabetes nurs country and lending groups global healthcare expenditure on diabetes for and organizing care for patients with chronic illness organizing care for patients with chronic illness revisited effectiveness of chronic care models for the management of type diabetes mellitus in europe: a systematic review and meta-analysis joint action on chronic diseases and promoting healthy ageing across the life cycle (ja-chrodis). health promotion interventions in type diabetes covid- infection in italian people with diabetes: lessons learned for our future (an experience to be used) diabetes and infection: is there a link?-a mini-review telemedicine cost-effectiveness for diabetes management: a systematic review does telemedicine improve treatment outcomes for diabetes? a meta-analysis of results from randomized controlled trials action to control cardiovascular risk in diabete study group effects di intensive glucose bassaering in type diabetes financial crisis, austerity, and health in europe foucault at the bedside: a critical analysis of empowering a healthy lifestyle time to tackle the physical activity gender gap large-scale physical activity data reveal worldwide activity inequality the role of obesity and lifestyle behaviours in a productive workforce the heavy burden of obesity: the economics of prevention, oecd health policy studies key: cord- -uxuff y authors: wolfson, julia a.; leung, cindy w. title: food insecurity and covid- : disparities in early effects for us adults date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: uxuff y the covid- pandemic has dramatically increased food insecurity in the united states (us). the objective of this study was to understand the early effects of the covid- pandemic among low-income adults in the us as social distancing measures began to be implemented. on – march we fielded a national, web-based survey ( % response rate) among adults with < % of the federal poverty line in the us (n = ). measures included household food security status and covid- -related basic needs challenges. overall, % of low-income adults in the us were food secure, % had marginal food security, and % were food insecure. less than one in five ( . %) of adults with very low food security reported being able to comply with public health recommendations to purchase two weeks of food at a time. for every basic needs challenge, food-insecure adults were significantly more likely to report facing that challenge, with a clear gradient effect based on severity of food security. the short-term effects of the covid- pandemic are magnifying existing disparities and disproportionately affecting low-income, food-insecure households that already struggle to meet basic needs. a robust, comprehensive policy response is needed to mitigate food insecurity as the pandemic progresses. food insecurity, a condition defined by limited or uncertain access to sufficient, nutritious food for an active, healthy life, disproportionately affects low-income communities and communities of color [ ] . food is a core social determinant of health [ ] and food insecurity is associated with numerous poor health outcomes in both the short and long term [ ] [ ] [ ] [ ] [ ] [ ] [ ] . the unprecedented covid- pandemic, and the associated social and economic response [ ] (e.g., school closures, stay at home orders, business closures, and job losses) have the potential to dramatically increase food insecurity and its related health disparities among already at-risk populations. early evidence suggests that food insecurity is indeed rapidly rising above pre-epidemic levels [ ] [ ] [ ] . household food insecurity has risen from % in to % in march ; in april , % of households with a child aged and under were food insecure [ , ] . households already struggling with food insecurity may find their current situations exacerbated by covid- with fewer resources to comply with social distancing recommendations. food insecure individuals also may have less flexibility in their jobs to allow them to earn income while staying home, or may be at higher risk of losing their jobs completely, thereby decreasing (or eliminating) their incomes. these factors may put food insecure households both at higher risk of contracting covid- and of greater food insecurity due to the economic effects of covid- mitigation efforts. in addition to the long-term health and economic effects of the covid- pandemic, it is important to understand the immediate impact of social distancing measures to fight covid- on vulnerable populations who already struggle to meet their basic needs. to do so, we fielded a national survey of low-income adults in the us on [ ] [ ] [ ] [ ] [ ] [ ] march to understand the immediate effects of how covid- was impacting low-income americans and any disparities in its effects based on food security status. we designed a web-based (qualtrics) survey to measure the initial effects of covid- on low-income adults in the united states (us) in mid-march , just as some states were beginning to implement school closures and "stay at home" orders. the web-based survey was formatted to be accessible when access both via smart phones and on a personal computer or laptop. the survey was fielded using turkprime, an online crowdsourcing platform that is designed to be used for academic research [ ] . turkprime allows researchers to use quotas to recruit a sample that matches their specific needs and has been used in numerous academic studies from a variety of disciplines published in the peer-reviewed literature [ ] [ ] [ ] [ ] [ ] . in the present study, we used a census matched panel of us adults (matched on age, gender, and race/ethnicity to the overall population) and limited the sample to low-income adults with household incomes < % of the federal poverty line (fpl). the fpl is calculated based on both household size and annual household income. for example, % of the fpl for a four-person household is $ , , and % of the fpl for a four-person household is $ , per year. the annual income for a two-person household at % fpl is $ , . the survey was open to participants on - march . we invited eligible panel members to participate and participants completed the survey ( % completion rate). additional exclusions included participants who completed the survey in < min (n = ), indicated they did not live in the us (n = ), and were missing food insecurity data (n = ) resulting in a final analytic sample size of . forty-four percent of participants took the survey on a personal computer or laptop and % took the survey on a smart phone or mobile device. this study was determined to be exempt by the institutional review board at the university of michigan. food security: food security status over the past days was measured using the -item us household food security module [ ] . questions are ordered by severity and include three levels of screening for adults, and an additional level of questions only for households with children. affirmative responses to questions were summed to create a total food security score (out of for adults and out of for households with children). food security categories (high, marginal, low, very low) were assigned according to us department of agriculture scoring guidelines [ ] . the term food insecurity refers to the combined categories of low and very low food security. covid- -related basic needs challenges: we inquired about challenges related to meeting basic needs people may have faced in the early weeks of the us covid- epidemic and response. first, we asked about participants' ability to comply with recommendations to purchase two weeks of food (which was recommended by public health efforts to limit grocery shopping trip and facilitate social distancing). we also asked participants whether they had encountered any of the following challenges due to the coronavirus: the ability to feed their family, availability of household items such as toilet paper, access to healthcare, access to medications, the ability to pay bills, ability to rent or pay mortgages, whether they had been unable to work due to lack of childcare, and whether they had been unable to work due to illness. covid- -related workplace reactions: at the time of data collection, some, but not all, states had begun issuing stay at home orders and mandatory business closures. even in states without stay at home mandates, some businesses were making adjustments to operations due to covid- . we asked working adults (i.e., those with full-or part-time work outside the home) what their employer was doing to adjust to the pandemic. specifically, we asked "workplaces in the us are adjusting to the coronavirus situation in different ways. what is your workplace doing to adjust?" participants were given the following response options: nothing, my workplace is proceeding as normal; all employees are encouraged to work at home; all employees must work at home; essential employees must come in to work but others can work from home; hours are being reduced for hourly employees; my place of employment has temporarily closed due to the coronavirus; my place of employment has closed and i have been laid off; work is busier and employees need to work longer hours; other. expected impact of covid- on employment and income: we asked working adults what they expected would happen at their job if they or someone in their family became ill with covid- . response options focused on whether they would be able to stay home, whether they had vacation or sick days they could use, and what they expected would happen if they missed work due to illness. all analyses were conducted in with stata, version (statacorp lp, college station tx, usa). first, we describe the socio-demographic characteristics of the study sample overall and by food security status using cross tabulations and chi-squared tests of significant differences. next, we examine differences in covid- -related basic needs and workplace challenges (among participants working full or part time), by food security status using cross tabulations. missing data was treated using listwise deletion. significant differences by food security status were assessed using chi-squared tests. all tests were two tailed and significance was considered at p < . . the characteristics of the sample of low-income adults are presented in table . overall, % of this sample was food secure, % had marginal food security, and % were food insecure ( % low food security; % very low food security). individuals with low or very low food security were more likely to be non-hispanic black or hispanic, to have children in the home, and have less than a college education. individuals with very low food insecurity were also more likely to rent their homes, not have health insurance or have medicaid, and were more likely to be receiving snap benefits. the distribution of the sample by state of residence is shown in appendix a. table . demographic characteristics of the study sample overall and by food security status (n = ). food security status p-value high marginal low very low marital status single, never married ( ) ( ) ( ) ( ) figure shows the ability of low-income us adults to comply with public health recommendations to stock up on two weeks of food to avoid excess grocery store trips and facilitate social distancing. nearly / ( %) of food-secure, low-income adults reported being able to comply with that recommendation, compared to less than one in five ( . %) of low-income adults with very low food security. adults with very low food security were more likely to report their local stores were sold out of products, and not being able to afford to purchase an extra two weeks of food at one time. nutrients , , x for peer review of question text: "experts have recommended stocking up on two weeks of food for your household to prepare for the coronavirus. have you been able to do this? [please check all that apply. one respondent was missing data for this question and was excluded from analysis. differences within each response option by food security status are significant at p < . based on chi-squared tests. potential basic needs challenges related to covid- are displayed in figure . for every challenge asked about, food-insecure adults were significantly more likely to report dealing with that challenge, with a clear gradient effect based on severity of food security status. strikingly, . % of adults with very low food security reported not having enough food to feed themselves or their family compared to . % of adults with low food security, . % of adults with marginal food security and . % of adults with high food security. half ( . %) of adults with very low food security did not have enough money to pay their bills compared to . % of those with low food security, . % of those with marginal food security and . % of food secure adults. [please check all that apply. one respondent was missing data for this question and was excluded from analysis. differences within each response option by food security status are significant at p < . based on chi-squared tests. potential basic needs challenges related to covid- are displayed in figure . for every challenge asked about, food-insecure adults were significantly more likely to report dealing with that challenge, with a clear gradient effect based on severity of food security status. strikingly, . % of adults with very low food security reported not having enough food to feed themselves or their family compared to . % of adults with low food security, . % of adults with marginal food security and . % of adults with high food security. half ( . %) of adults with very low food security did not have enough money to pay their bills compared to . % of those with low food security, . % of those with marginal food security and . % of food secure adults. food-secure, low-income adults working full or part time ( . % of the overall sample) were more likely than their food-insecure counterparts to work in jobs that were either proceeding as normal, were busier than usual, or had closed and laid off employees. in contrast, working adults with food insecurity were more likely to have their hours reduced ( table ) . when asked what they thought would happen if they or someone in their family got sick with covid- , working adults with very low food security were less likely than their food-secure counterparts to have sick days or food-secure, low-income adults working full or part time ( . % of the overall sample) were more likely than their food-insecure counterparts to work in jobs that were either proceeding as normal, were busier than usual, or had closed and laid off employees. in contrast, working adults with food insecurity were more likely to have their hours reduced ( table ) . when asked what they thought would happen if they or someone in their family got sick with covid- , working adults with very low food security were less likely than their food-secure counterparts to have sick days or vacation days they could use, and were more likely to say they would lose their job if they missed too many days of work ( % very low food security vs. % high food security, p < . ). table . covid- effects on workplaces among low-income adults working full or part time in the us overall and by food security status as of - march (n = ). this study presents results from a national survey of low-income adults in the us in the days immediately following the first major policy steps to enforce covid- -related social distancing measures on a wide scale in the us. though large-scale school and business closures were only beginning to be implemented [ ] , we find that the effects of the covid- pandemic were already impacting low-income adults, with disproportionately negative effects for low-income adults experiencing food insecurity. this initial evidence from a time period before even greater economic effects and job losses took place demonstrate that the covid- pandemic threatens to greatly exacerbate existing health disparities related to food security status. indeed, evidence from later surveys show that food insecurity in the us has dramatically increased well beyond levels seen during the great recession [ , ] . results from this study illuminate the extent to which, very early in the covid- trajectory in the us, individuals with food insecurity were disproportionately vulnerable to the severe economic and health consequences of the crisis. our findings show that as early as mid-march , food-insecure adults currently working outside the home were at greater risk of losing their income or their jobs if they got sick from covid- . regardless of whether they get sick or their employment status, food-insecure individuals were also more likely to report expecting that they will lose income during the pandemic. for already low-income households, loss of income puts them at high risk of severe food insecurity and an inability to meet other basic needs, both of which can lead to future physical and mental health problems [ ] [ ] [ ] [ ] . compared to low-income, food-secure adults, food-insecure adults were more likely to report that they had already been laid off, and that their income would go down substantially. fifty-four percent of food secure adults reported they expected their income would remain the same compared to % of adults with very low food security (results not shown, but available upon request). subsequent massive job losses [ ] and more extensive social distancing measures [ ] after data collection ended have likely exacerbated the trends we document in our results. across the lifespan, food insecurity is associated with a range of negative health outcomes over the short and long term, including poor mental health outcomes such as depression, stress, and anxiety [ , , ] , poor diet quality [ , ] , high rates of chronic diseases such as diabetes and obesity [ , , ] , and lower overall health status [ , , ] . food insecurity is also associated with higher healthcare expenditures, in part due to the higher burden of chronic health conditions among food-insecure patients and the known tradeoffs between food and medicine [ , ] . as the covid- pandemic and the associated economic fallout progress, it will be critical for policymakers, health systems, and the public health community to proactively and comprehensively address access to food and other basic needs, particularly for populations at risk of, and already experiencing, food insecurity. failure to do so will have long-term implications for population health, health disparities, and the health care system as a whole. food-insecure adults are more likely to be people of color, with lower social standing, who have less flexible and secure jobs, and are more vulnerable to chronic stress and other basic needs insecurities [ ] . in , . % of adults in the us were food insecure; among low-income adults (< % fpl), . % were food insecure [ ] . we find that, as of mid-march, , % of adults with an income < % of the fpl were food insecure in the past days, and these individuals were more likely to be non-hispanic black or hispanic. this disparity in food security status based on race/ethnicity is an additional way in which covid- is disproportionately impacting communities of color in the us. since mid-march, adult and child food insecurity rates in the us have dramatically risen [ , ] . in our study, adults currently experiencing food insecurity were not able to buy food in bulk quantities and therefore are at greater risk of exposure to the virus (due to the need for more frequent food shopping trips) as well as being at greater risk of an acute hunger crisis (due to lack of financial resources to purchase sufficient food). in addition, as individuals already at risk for food insecurity are more vulnerable to losing their jobs, rates of food insecurity will climb higher as the pandemic progresses. direct income support, expanded unemployment benefits, and additional support for federal food assistance programs included in the cares act (passed on march ) and the families first coronavirus response act (passed on march ) are important first steps to supporting low-income families in the us [ , ] . however, longer-term support for individuals, as well as institutions and organizations that provide food, is needed. some communities are already experiencing unprecedented demand in the emergency food system [ ] , and the federal government, states, and cities are scrambling to ensure that families with children who depend on free or reduced price meals at school do not go hungry [ ] . given the scale of the pandemic and the likely duration of social distancing measures and the associated economic impacts, more support is urgently needed to mitigate the toll of covid- on the most vulnerable members of society. in particular, in addition to direct economic support to individuals, financial support for the emergency food system, greater flexibility for school systems to provide food to families, and long-term, expanded food assistance support via the supplemental nutrition assistance program (snap) are all urgently needed. expanded snap benefits were critical for providing needed support for low-income families during the great recession, and were effective at reducing food insecurity [ ] . congress and the trump administration should urgently increase snap benefits and expand eligibility for the program to help low-income families afford food during this extraordinary time. results from this study should be considered in light of some limitations. first, the web-based survey panel does not use probability-based sampling and is not nationally representative. however, the turkprime panel is national in scope, and uses census-matched quotas to achieve a sample that closely aligns with the demographics of the population in the us which mitigates some of this concern. however, because we limited our sample to households < % of the fpl (based on income and household size), and because the survey was only available in english, the demographics of our sample may be more similar to the us population overall and undercount some key demographic groups, particularly non-hispanic blacks and hispanics, non-english speakers, and immigrants. relatedly, this data was collected via a web-based survey which by definition required participants to have internet access via a computer or a smart phone. this method of data collection could also have undercounted some groups (e.g., those with very low income, without high school degrees, and those living in rural areas without broadband internet access) [ ] , likely those especially vulnerable to food insecurity. it is important to note, however, that any bias introduced from these factors would have biased results into the direction of undercounting, rather than overcounting, food insecurity and the other outcomes we document here. second, respondents could choose whether or not to participate in the survey which may introduce some selection bias. third, all measures in the study are self-reported and may be subject to a social-desirability bias. however, the fact that the survey was fielded online and was completely anonymous may mitigate this concern. fourth, this survey is cross-sectional and we cannot make any statements about causal relationship between the coronavirus and our measure of food insecurity in the past days. finally, data were collected very quickly after social distancing measures and business and school closures began to be implemented in some (but not all) states. this is a strength as we were able to capture the immediate, real-time impacts on low-income adults. however, some measures also focused on anticipated effects. it is possible that the respondents did not accurately assess the likely effect of the coronavirus pandemic on their employment and income. however, initial evidence in the weeks after our data were collected show clearly that unemployment and rates of food insecurity have skyrocketed. the longer-term effects on low-income adults in the us, and associated disparities based on food insecurity, may be better or worse than those expected by participants in this survey. it will be imperative for future research to examine the long-term effects of the coronavirus pandemic and associated social distancing measures on food insecurity and associated health outcomes, particularly among vulnerable communities that were already struggling at the start of the pandemic. the strengths of our study include the fact that we were able to collect these data so quickly after a national emergency was declared and states began implementing policies to slow the spread of covid- . our large national sample of low-income adults is another key strength as is our use of the gold standard -question usda food security screener module. the social and economic upheaval caused by the covid- pandemic is magnifying existing disparities and disproportionately affecting low-income, food-insecure households that already struggle to meet basic needs. the early effects documented in the present study are likely to continue to worsen as the pandemic continues unless extensive policy and economic supports are swiftly implemented. the authors declare no conflict of interest. the funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. household food security in the united states err- social determinants of health inequalities food insecurity and health outcomes no food for thought: food insecurity is related to poor mental health and lower academic performance among students in california's public university system food insecurity: a key social determinant of health for older adults food insecurity and body mass index: a longitudinal mixed methods study food insecurity is inversely associated with diet quality of lower-income adults trends in food insecurity for adults with cardiometabolic disease in the united states food insecurity and emotional health in the usa: a systematic narrative review of longitudinal research kaiser family foundation. state data and policy actions to address coronavirus food access and security during coronavirus: a vermont study food insecurity in the united states during covid- pandemic the covid- crisis has already left too many children hungry in america com: a versatile crowdsourcing data acquisition platform for the behavioral sciences how should the severity of depression be rated on self-report depression scales? unpacking the construct of emotional attachment to objects and its association with hoarding symptoms food agency in the united states: associations with cooking behavior and dietary intake social discomfort moderates the relationship between drinking in response to negative affect and solitary drinking in underage drinkers behavioral therapy preferences in people with migraine guide to measuring household food security definition of food insecurity closures: how is each us state handling coronavirus? perception of unmet basic needs as a predictor of physical functioning among community-dwelling older adults treat or eat: food insecurity, cost-related medication underuse, and unmet needs material need insecurities, control of diabetes mellitus, and use of health care resources: results of the measuring economic insecurity in diabetes study food insecurity and health care expenditures in the united states america is in a depression, the challenge now is to make it short-lived food insecurity and mental illness: disproportionate impacts in the context of perceived stress and social isolation associations between food security status and diet-related outcomes among students at a large, public midwestern university household food insecurity as a determinant of overweight and obesity among low-income hispanic subgroups: data from the - california health interview survey food insecurity is associated with chronic disease among low-income nhanes participants food insecurity and health across the lifespan families first coronavirus response act never seen anything like it': cars line up for miles at food banks united states department of agriculture food and nutrition service. find meals for kids when schools are closed food security improved following the arra increase in snap benefits; err- % of americans don't use the internet. who are they? pew research center key: cord- -a qr yoo authors: delgado-alarcón, jessica m.; hernández morante, juan josé; aviles, francisco v.; albaladejo-otón, maría d.; morillas-ruíz, juana m. title: effect of the fat eaten at breakfast on lipid metabolism: a crossover trial in women with cardiovascular risk date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: a qr yoo recent studies point out that not only the daily intake of energy and nutrients but the time of day when they are ingested notably regulates lipid metabolism and cardiovascular risk (cvr). therefore, the aim of the study was to assess if the type of fat ingested at breakfast can modify lipid metabolism in women with cvr. a randomized, crossover clinical trial was performed. sixty volunteers were randomly assigned to a (a) polyunsaturated fatty acid (pufa)-rich breakfast, (b) saturated fatty acid (sfa)-rich breakfast, or (c) monounsaturated fatty acid (mufa)-rich breakfast. plasma lipoprotein and apolipoprotein subfractions were determined. our data showed that the pufa-rich breakfast decreased lipoprotein (a) (lp(a)), very low-density lipoproteins (vldl), and intermediate-density lipoproteins (idl), and increased high-density lipoproteins (hdl). a similar trend was observed for the mufa-rich breakfast, whereas the sfa-rich breakfast, although it decreased vldl, also increased idl and reduced hdl. the pufa-rich breakfast also decreased β-lipoproteins and apolipoprotein-b. in summary, varying the type of fat eaten at breakfast is enough to significantly modify the lipid metabolism of women with cvr, which can be of great relevance to establish new therapeutic strategies for the treatment of these subjects. apart from specific situations like the current covid- epidemic, cardiovascular diseases (cvd) continue to be the leading cause of mortality worldwide [ ] . many advances have been made in this regard, and it is now possible to determine the risk of cardiovascular disease. thus, risk prediction scores for cardiovascular disease (cvd) contain information on total cholesterol and high-density lipoprotein cholesterol (hdl), among other conventional risk factors [ ] . considerable interest exists on whether cvd prediction can be improved by assessment of additional lipid-related markers, such as several proatherogenic lipoprotein subfractions (small dense low-density lipoprotein (ldl) cholesterol or apolipoprotein b (apob) [ ] [ ] [ ] . in contrast, other markers, especially hdl and apoprotein apoa-i, have been shown to have anti-inflammatory effects in various clinical studies in which biomarkers can better predict organ failure [ ] . several recent studies have shown independent relationships between levels of ldl and hdl subclasses and risk of both coronary artery and cerebrovascular disease [ , ] . also, there is inconclusive evidence suggesting that ldl and hdl subfractions measurement improves clinical assessment of cvr [ ] . studies suggest that more refined analyses of lipoprotein subspecies may lead to further improvements in cvr evaluation, since the characterization of ldl subclasses, in particular regarding lipoprotein(a) (lp(a)) and small dense ldl, may help to develop more personalized interventions focused on individual characteristics [ , ] . it is well established that diet, or more specifically the fatty acid composition of the diet, is one of the main factors involved in the regulation of plasma lipid profile [ , ] . the relationship between diet and blood cholesterol or lipid markers is complex; many different dietary components can affect cholesterol levels (proteins, carbohydrates, plant sterols, etc.). but the most controversial component is dietary fat, both regarding the quantity and the fatty acid composition [ , ] . recent findings show that not only is the total amount of fat important, but also the time of day when they are ingested [ ] . in this line, several previous reports have shown the importance of adjusting the diet to the subject's biological rhythms. in fact, two common mistakes have been described that can upset the balance of the diet despite adequate nutrient intake. on the one hand, eating too late, and more specifically after pm, reduces the efficacy of a hypocaloric dietary treatment and increases the risk of obesity development [ ] . on the other hand, skipping breakfast can also predispose to developing obesity and other associated disorders [ ] [ ] [ ] , which highlights the importance of this intake, even being considered as the most important intake of the day [ , ] . however, to the best of our knowledge, no work has been conducted that assesses whether the type of fat ingested at breakfast has any effect on lipoprotein parameters related to cvr. therefore, the purpose of the present study was to evaluate whether changing exclusively the fat ingested at breakfast is enough to modify the lipoprotein and apolipoprotein subclasses for women with cvr. in addition, through the present crossover trial, a secondary objective was to determine the best fatty acid composition at breakfast to deliver a better lipoprotein and apolipoprotein profile regarding cardiovascular risk parameters. a longitudinal, crossover trial was designed to evaluate the effect of three types of fats eaten at breakfast on plasma lipoproteins, lipoprotein subfractions, and apoproteins. breakfast compositions were: breakfast- (polyunsaturated fatty acids (pufa) source, containing g of margarine with no trans fat), breakfast- (saturated fatty acids (sfa) source, containing g of butter), and breakfast- (monounsaturated fatty acids (mufa) source, containing g of virgin olive oil). the lipid composition of the three types of fats is available in figure (further information in supplementary table s ). all participants performed each of the three identical experimental procedures for days, with a -day washout period between interventions. the subjects were randomized in alternating sequence by a latin square procedure, which was previously designed. a researcher (j.j.h.m.) carried out the randomization with the assistance of a macro designed in visual basic for the microsoft excel program. the study was carried out after receiving written authorization from the ethics committee of the catholic university of murcia (n# ). participants were informed, either orally or in writing, about the study design. they were also given an explanation of the ethical aspects of the project, informing the patients about the main objective of the study and guaranteeing the confidentiality and anonymity of the data, in accordance with the declaration of helsinki and biomedical research spanish law. all participants provided written informed consent. this trial was registered at australian new zealand clinical trials registry (actrn) (further information available at: http://www.anzctr.org.au/actrn .aspx. code: # ). the study was carried out after receiving written authorization from the ethics committee of the catholic university of murcia (n# ). participants were informed, either orally or in writing, about the study design. they were also given an explanation of the ethical aspects of the project, informing the patients about the main objective of the study and guaranteeing the confidentiality and anonymity of the data, in accordance with the declaration of helsinki and biomedical research spanish law. all participants provided written informed consent. this trial was registered at australian new zealand clinical trials registry (actrn) (further information available at: http://www.anzctr.org.au/actrn .aspx. code: # ). a total of women volunteers gave informed consent to take part in the present study. mean age and body mass index (bmi) were . ± . y and . ± . kg/m , respectively. to increase the treatment adherence and reduce bias, the target population consisted of subjects who lived in the same institution, with similar lifestyle habits and with identical daily meals, as previously recommended [ ] . those subjects with significant cognitive impairment, psychiatric disorders, or chronic pharmacological treatment that may have affected the effectiveness of the dietary intervention (corticosteroids, thyroid hormones, oral antidiabetic agents, or lipid-lowering drugs) were excluded. a chronic disease that may have interfered with dietary therapy (cancer, renal or hepatic impairment, chronic gastrointestinal conditions), or acute disease episodes during the study were also established as exclusion criteria. those subjects who had followed a hypocaloric diet at the allocation time or in the three months prior to the beginning of the study were also excluded. the necessary sample size was estimated with the assistance of the program gpower . (dufsseldorf, germany) [ ] . the sample size was calculated according to our previous report [ ] , taking into account a confidence level ( −α) of % and considering a power (β) of %; we selected a difference of effect between groups or effect size (d) equal to a % reduction in the lipoprotein composition. the standard deviation (σ) selected was %, taking into account our previous study [ ] , resulting in subjects per group. considering an estimated drop-out rate of %, the final minimum sample for the present study was subjects per group. figure shows the flow diagram followed for the patients' recruitment and selection procedures. a total of women volunteers gave informed consent to take part in the present study. mean age and body mass index (bmi) were . ± . y and . ± . kg/m , respectively. to increase the treatment adherence and reduce bias, the target population consisted of subjects who lived in the same institution, with similar lifestyle habits and with identical daily meals, as previously recommended [ ] . those subjects with significant cognitive impairment, psychiatric disorders, or chronic pharmacological treatment that may have affected the effectiveness of the dietary intervention (corticosteroids, thyroid hormones, oral antidiabetic agents, or lipid-lowering drugs) were excluded. a chronic disease that may have interfered with dietary therapy (cancer, renal or hepatic impairment, chronic gastrointestinal conditions), or acute disease episodes during the study were also established as exclusion criteria. those subjects who had followed a hypocaloric diet at the allocation time or in the three months prior to the beginning of the study were also excluded. the necessary sample size was estimated with the assistance of the program gpower . (dufsseldorf, germany) [ ] . the sample size was calculated according to our previous report [ ] , taking into account a confidence level ( −α) of % and considering a power (β) of %; we selected a difference of effect between groups or effect size (d) equal to a % reduction in the lipoprotein composition. the standard deviation (σ) selected was %, taking into account our previous study [ ] , resulting in subjects per group. considering an estimated drop-out rate of %, the final minimum sample for the present study was subjects per group. figure shows the flow diagram followed for the patients' recruitment and selection procedures. in addition to a serving portion of the fat source (margarine, butter, or virgin olive oil), each breakfast consisted of low-fat milk ( ml), instant coffee ( monodose sachet of g), sugar ( monodose sachet of g), and two white bread toasts. during the washout period, breakfast fat was substituted by a pineapple juice ( ml) and peach ham ( g). except the type of fat contributing to the breakfast, the nutritional composition of the other daily meals was identical ( ± kcal/day, ± g proteins/day, ± g carbohydrates/day, ± g fats/day). the diets were designed depending on the volunteers' requirements and based on the volunteers' nutritional habits to enhance adherence. at the beginning of the study, the volunteers were instructed to follow the assigned diet, without modifying their lifestyle (physical activity, sleeping habits, meal schedules, etc.) during the experimental period. the intervention included five phases: three phases of dietary intervention, in which each volunteer was randomly assigned to ingest in a certain order each breakfast type for a -day period, and two washout periods (of days each). the menu consumed by volunteers was designed for consecutive days and was identical during the intervention, the type of fat consumed during breakfast being the only nutritional variable that was modified in the study. although fat content was slightly different within the different breakfasts, the aim of this study was to employ different fats contained in commercialized usual portions of each type of food (margarine, butter, and olive oil) to analyze if a normal fat ration at breakfast could modify the plasma lipoprotein profile, lipoprotein subfractions, and apoproteins. these single-dose formats are commercially available and frequently used, offered daily in hospitals, restaurants, hotels, business coffee, study centers, and so forth, and are consumed by a high percentage of the population at breakfast. weight, arterial blood pressure, and cardiac frequency were measured on the first and last day (pre-/post-treatment) of each of the three breakfast periods in fasting conditions. in addition to a serving portion of the fat source (margarine, butter, or virgin olive oil), each breakfast consisted of low-fat milk ( ml), instant coffee ( monodose sachet of g), sugar ( monodose sachet of g), and two white bread toasts. during the washout period, breakfast fat was substituted by a pineapple juice ( ml) and peach ham ( g). except the type of fat contributing to the breakfast, the nutritional composition of the other daily meals was identical ( ± kcal/day, ± g proteins/day, ± g carbohydrates/day, ± g fats/day). the diets were designed depending on the volunteers' requirements and based on the volunteers' nutritional habits to enhance adherence. at the beginning of the study, the volunteers were instructed to follow the assigned diet, without modifying their lifestyle (physical activity, sleeping habits, meal schedules, etc.) during the experimental period. the intervention included five phases: three phases of dietary intervention, in which each volunteer was randomly assigned to ingest in a certain order each breakfast type for a -day period, and two washout periods (of days each). the menu consumed by volunteers was designed for consecutive days and was identical during the intervention, the type of fat consumed during breakfast being the only nutritional variable that was modified in the study. although fat content was slightly different within the different breakfasts, the aim of this study was to employ different fats contained in commercialized usual portions of each type of food (margarine, butter, and olive oil) to analyze if a normal fat ration at breakfast could modify the plasma lipoprotein profile, lipoprotein subfractions, and apoproteins. these single-dose formats are commercially available and frequently used, offered daily in hospitals, restaurants, hotels, business coffee, study centers, and so forth, and are consumed by a high percentage of the population at breakfast. weight, arterial blood pressure, and cardiac frequency were measured on the first and last day (pre-/post-treatment) of each of the three breakfast periods in fasting conditions. blood samples were obtained, after h fast, from the antecubital vein into ml siliconized tubes. after venipuncture, samples were kept on ice and then centrifuged at rpm (heraus biofugue stratos, thermo scientific, dreieich, germany) for min at • c. the mean time between venipuncture and centrifugation was min (interquartile range: - min). plasma samples were stored at − • c until further analyses. lipoprotein (chylomicrons, beta, pre-beta, alpha lipoproteins) were measured by lipidogram in agarose gel with hydragel liprotein ® kit (sebia, lisses, france), following the manufacturer's instructions. briefly, the analysis was carried out by electrophoresis on buffered agarose gels (ph . ) on the hydrasys semiautomatic instrument. the procedure was based on the migration capacity of lipoproteins: chylomicrons normally remain at the point of application, beta lipoproteins migrate at the position of beta- globulins, the pre-beta lipoproteins migrate between beta and alpha-globulin, and finally, alpha lipoproteins are the fastest and migrate at the position of alpha- globulins. to carry out this procedure, µl of plasma were placed in an agarose gel, and electrophoresis was performed. the resulting gel was placed in a paper film and stained with ml of dye solution (sudan black). the hydroscan system (sebia, lisses, france) was employed to quantify the different lipoprotein subfractions. on each gel, a normal control was used to check the electrophoresis process and the staining procedures [ ] . apolipoproteins (a-i, a-ii, e, b) were measured by immune-nephelometry with the bn prospec ® system (siemens, barcelona, spain), according to the manufacturer's guidelines. this automatic system allows the automatic determination of plasma proteins through the nephelometric system [ ] . [ ] . the lipoprotein particles migrated through the separating gel matrix and were resolved into lipoprotein bands according to their particle sizes from: hdl (migrates the farthest), small dense ldl, larger buoyant ldl, midbands (comprising primarily idl), and vldl. chylomicrons, if present, appear above the stacking gel or remain in the loading gel. a typical lipoprint profile consists of vldl band, idl midbands, and up to ldl bands. after electrophoresis was completed, stained lipoprotein fractions (bands) were identified by their mobility (rf) using vldl as the starting reference point (vldl = ) and hdl as the leading point (hdl = ). statistical analysis was performed with spss software (spss inc., chicago, il, usa). data are presented as mean ± standard deviation unless otherwise stated. data distribution was determined using the kolmogorov-smirnov test. differences between variables were tested with repeated measures analysis of covariance (ancova), considering age, weight, and intervention order as covariates. to compare the effectiveness among the different interventions, the same statistical procedure was carried out considering the change (final-baseline) of the different variables as an estimation of the treatment effect. bonferroni's post hoc test was performed to avoid bias due to multiple comparisons. statistical significance was set at p < . . figure shows the details of participants' allocation. fifty-three women completed the study. their baseline characteristics are shown in table . mean baseline body mass index (bmi) was above the cut-off point considered as normal weight ( . kg/m ) and was therefore used as a covariate in the analyses of the intervention effects. seven women were previously diagnosed with type diabetes, while nine women had personal history of cardiovascular disease. regarding baseline lipoprotein values, both low-density lipoprotein (ldl) and high-density lipoprotein (hdl) were within the normal range. the effects of the different interventions on the lipoprotein subfraction parameters are shown in figure and supplementary figure s . main effects were observed regarding hdl (figure d) , which was significantly increased both with the polyunsaturated fatty acid (pufa)-rich (p < . ) and the monounsaturated fatty acid (mufa)-rich (p = . ) breakfasts; in contrast, the saturated fatty acid (sfa)-rich breakfast induced a % reduction of this lipoprotein (p = . ). the pufa-rich breakfast also showed a statistically significant reduction of lipoprotein(a) (lp(a)), very low-density lipoprotein (vldl), and total intermediate-density lipoprotein (idl), mainly due to the reduction of the idl-c subfraction, as well as ldl ( figure s and table s ). unlike in the previous case, the sfa-rich breakfast induced an increase of idl-b and idl-c, so total idl was also increased, but interestingly, this treatment also induced a significant reduction of vldl (figure a) . meanwhile, the mufa-rich breakfast reduced most of the lipoproteins, but the statistical significance was only reached for hdl, as commented. specific mean values and statistical significance are described in table s . when lipoprotein subfractions were evaluated attending to their electrophoretic mobility (figure ) , our data showed that pufa-rich and mufa-rich breakfasts were able to reduce chylomicrons (p = . and p = . , respectively, figure a ). whereas pufa-rich breakfasts caused a statistically significant reduction of β-lipoprotein (p < . ), both sfa-rich and mufa-rich breakfasts were associated with an increase of this subfraction (p = . and p < . , respectively) ( figure b ). the opposite situation was observed regarding the preβ-lipoprotein, since pufa-rich breakfasts increased this fraction (p = . ) but sfa-rich breakfasts reduced the plasma values of this fraction (p < . ) (figure c ). the lipoproteins that migrate to the α-position were increased with the pufa-rich breakfast (p = . ); in contrast, the mufa-rich intervention was characterized by a reduction of this fraction (p = . ) (figure d ). . data derive from those women who completed the study (n = ). * represents differences within the same group (final-baseline). * p < . , ** p < . , *** p < . . within-group differences are indicated as pgroup. further information is available in table s . when lipoprotein subfractions were evaluated attending to their electrophoretic mobility (figure ) , our data showed that pufa-rich and mufa-rich breakfasts were able to reduce chylomicrons (p = . and p = . , respectively, figure a ). whereas pufa-rich breakfasts caused a statistically significant reduction of β-lipoprotein (p < . ), both sfa-rich and mufa-rich breakfasts were associated with an increase of this subfraction (p = . and p < . , respectively) ( figure b ). the opposite situation was observed regarding the preβ-lipoprotein, since pufa-rich breakfasts increased this fraction (p = . ) but sfa-rich breakfasts reduced the plasma values of this fraction (p < . ) (figure c ). the lipoproteins that migrate to the α-position were increased with the pufa-rich breakfast (p = . ); in contrast, the mufa-rich intervention was characterized by a reduction of this fraction (p = . ) (figure d) . , c) , and high-density lipoproteins (hdl, d) after days of intervention with the different breakfasts. data represent estimated treatment differences (final-baseline) values and the % confidence interval (ci). data derive from those women who completed the study (n = ). * represents differences within the same group (final-baseline). * p < . , ** p < . , *** p < . . within-group differences are indicated as p group . further information is available in table s . . data derive from those women who completed the study (n = ). * represents differences within the same group (final-baseline). * p < . , ** p < . , *** p < . . no statistically significant difference was observed among groups. further information is available at table s . the data derived from apoliproteins (apo) are shown in figure . the pufa-rich breakfast produced an increase of apolipoprotein apoai (p < . ) and apoe (p < . ) (figure a,d) , whereas the sfa-rich breakfast had the opposite effect, as there was a decrease in apoai (p = . ) and apoaii (p < . ) (figure a,b) . moreover, the mufa-rich breakfast produced a drop in apoaii , pre-beta (c), and alfa (d) lipoprotein fractions attending to their mobility after days of intervention with the different breakfasts. data represent estimated treatment differences (final-baseline) values and the % confidence interval (ci). data derive from those women who completed the study (n = ). * represents differences within the same group (final-baseline). * p < . , ** p < . , *** p < . . no statistically significant difference was observed among groups. further information is available at table s . the data derived from apoliproteins (apo) are shown in figure . the pufa-rich breakfast produced an increase of apolipoprotein apoai (p < . ) and apoe (p < . ) (figure a,d) , whereas the sfa-rich breakfast had the opposite effect, as there was a decrease in apoai (p = . ) and apoaii (p < . ) (figure a,b) . moreover, the mufa-rich breakfast produced a drop in apoaii levels (p = . ) (figure b ). specific mean values and statistical significance are described in table s . . data derive from those women who completed the study (n = ). * represents differences within the same group (final-baseline). * p < . , ** p < . , *** p < . . within-group differences are indicated as pgroup. further information is available at table s . the objective of the present work was to evaluate if the modification of fat intake only at breakfast was enough to modify lipid/lipoprotein/apolipoprotein markers of women with cardiovascular disease (cvd) risk. the results obtained at the end of the intervention confirmed our hypothesis, since several changes in these markers were observed as a consequence of the interventions carried out, which may have certain relevance in terms of prevention of cvd. previous observational and cohort studies have highlighted the relevance of fat intake at breakfast on cardiovascular disease. a large prospective study observed that replacing % of daily energy from saturated fatty acids (sfas) with an equivalent intake from polyunsaturated fatty acids (pufas) reduced by % the risk ratio of cvd [ ] . a meta-analysis has revised the effect of the % substitution of sfa by an equivalent amount of pufa, observing a decrease in plasma triglycerides, total cholesterol, and low-density lipoprotein (ldl) [ ] . contrary to what was expected, a review has described that incremental postprandial triglycerides were lower with an sfa-rich meal, suggesting that the postprandial duration is of importance when evaluating the effects of fatty acids in plasma lipoproteins [ ] , which highlights the need for long-term studies like the present one. focusing on the effect of the interventions on the different plasma lipid variables, it is important to comment that pufa and monounsaturated fatty acid (mufa) breakfasts were associated with a significant decrease of chylomicrons, in spite of the fact that the plasma samples were collected in fasting conditions ( h), where its concentration was supposed to be low or nonexistent. as a previous report has shown that age is a key regulator of the chylomicron response to the dietary fat data represent estimated treatment differences (final-baseline) values and the % confidence interval (ci). data derive from those women who completed the study (n = ). * represents differences within the same group (final-baseline). * p < . , ** p < . , *** p < . . within-group differences are indicated as p group . further information is available at table s . the objective of the present work was to evaluate if the modification of fat intake only at breakfast was enough to modify lipid/lipoprotein/apolipoprotein markers of women with cardiovascular disease (cvd) risk. the results obtained at the end of the intervention confirmed our hypothesis, since several changes in these markers were observed as a consequence of the interventions carried out, which may have certain relevance in terms of prevention of cvd. previous observational and cohort studies have highlighted the relevance of fat intake at breakfast on cardiovascular disease. a large prospective study observed that replacing % of daily energy from saturated fatty acids (sfas) with an equivalent intake from polyunsaturated fatty acids (pufas) reduced by % the risk ratio of cvd [ ] . a meta-analysis has revised the effect of the % substitution of sfa by an equivalent amount of pufa, observing a decrease in plasma triglycerides, total cholesterol, and low-density lipoprotein (ldl) [ ] . contrary to what was expected, a review has described that incremental postprandial triglycerides were lower with an sfa-rich meal, suggesting that the postprandial duration is of importance when evaluating the effects of fatty acids in plasma lipoproteins [ ] , which highlights the need for long-term studies like the present one. focusing on the effect of the interventions on the different plasma lipid variables, it is important to comment that pufa and monounsaturated fatty acid (mufa) breakfasts were associated with a significant decrease of chylomicrons, in spite of the fact that the plasma samples were collected in fasting conditions ( h) , where its concentration was supposed to be low or nonexistent. as a previous report has shown that age is a key regulator of the chylomicron response to the dietary fat [ ] , age was considered as a covariate in our analysis, confirming our results. the breakfast containing a pufa-rich source (margarine) was able to decrease many proatherogenic particles, as very low-density lipoproteins (vldl) and intermediate-density lipoproteins (idl), although the effect on ldl was modest. as commented by aneni et al., lipoprotein subfraction analysis may help to further discriminate patients who require more intensive cardiovascular work-up and treatment [ ] . considering the effect of pufa-rich breakfasts on the lipoproteins, it can be speculated that this intervention reduced the cardiovascular risk of the participants. interestingly, the breakfast containing a source of sfa (butter) was also able to decrease vldl lipoproteins, but the effect on the other proatherogenic markers (idl and ldl) was inverse to that observed in the pufa-rich breakfast. a previous study also showed that replacing butter for margarine improved the blood lipoprotein profile and reduced the predicted risk of coronary heart disease [ ] , as in the present work. although the effect of fat on plasma lipoproteins has been studied in depth, the data regarding the effect of the modification of the type of fat ingested at breakfast on the lipoprotein subclasses is quite scarce. recent studies have examined whether ldl size distribution or concentration of small ldl (ldl- , ldl- , ldl- , ldl- , and ldl- ) are strongly related to cardiac event rates (death, myocardial infarction, and revascularization for refractory ischemia) and coronary artery disease (cad) [ , , ] . ldl size seems to be an important predictor of cardiovascular events and progression of coronary artery disease, and a predominance of small dense ldl has been accepted as an emerging cardiovascular risk factor by the national cholesterol education program adult treatment panel iii [ ] . in this study, our data showed that ldl- and ldl- (small dense ldl) levels decreased with pufa-rich and mufa-rich breakfasts, but increased with sfa-rich breakfasts. although the estimated effect may seem modest, it is important to remember that the relative contribution of these subfractions is small, so a reduction of only . mg/ml of ldl- , as observed in the present study in the pufa-rich intervention, is proportional to a % reduction of plasma ldl- levels. previous works have described a similar decrease of small dense ldl particles by pufa supplementation [ ] , but it is also important to remember that other nutrients like carbohydrates modulate their plasma levels [ ] . as all participants followed the same dietary program, we can speculate that our observations were mainly due to the treatment. elevated levels of intermediate density lipoprotein (idl) are also associated with increased cardiovascular risk [ , ] . the results derived from the present study showed that pufa-rich and mufa-rich breakfasts decreased total idl levels, especially the idl-c subclass. as idl-c is the smallest idl subfraction, its decrease in plasma concentration could also be related to a lower cardiovascular risk [ ] . one of the parameters most affected by the different interventions carried out was hdl lipoprotein. pufa-rich and mufa-rich breakfasts increased its plasma values, whereas sfa-rich breakfasts exerted the opposite effect. in fact, the only statistically significant effect of mufa-rich breakfasts on lipoproteins was this increase of hdl, although it is also true that only with this intervention were the total ldl values reduced. the data derived from apolipoproteins (apo) were more controversial. the pufa-rich breakfast was characterized by an increase of apoa-lipoproteins, while both pufa-rich and mufa-rich breakfasts decreased apob levels. apob is the integral protein of chylomicron and their remnants, vldl, idl, ldl, and lp(a). results from recent epidemiological studies suggest that apob is better than ldl to predict coronary events [ ] . in a previous report, gagliardi et al. examined the effects of butter and margarine and found a significant reduction in apob when margarine was used, as in the present work [ ] . apoa-ii is the second most abundant hdl protein but its function remains largely unknown. studies in humans and genetically modified mice have highlighted the stabilizing role of apoa-ii on hdl through inhibition of their remodeling by lipases [ ] and through the modulation of lpl activity [ ] . an interesting theory of these works is related to the functionality of hdl particles. these studies have revealed the presence of dysfunctional hdl in patients with cardiovascular disease [ , ] ; therefore, it can be hypothesized that the determination of apoa-ii is more relevant than that of hdl, especially in patients with cardiovascular disease. therefore, the effect of the pufa-rich breakfast on cardiovascular health could be more advantageous than expected, as previously commented [ ] . as a whole and considering the data obtained, pufa and mufa were associated with a lower coronary risk profile, a situation that has been broadly detailed previously [ , ] . the interest of the present study is, in our opinion, that the lipoprotein profile of a patient can be improved with a simple intervention such as the modification of breakfast fat, and therefore, a sudden change in eating habits, which could hinder adherence to the intervention, is not necessary. nevertheless, several limitations should be commented on at this point. on the one hand, the three interventions were not isocaloric, nor did they provide the same fat quantity. in this regard, we decided to keep the fat intake provided as monodose sachets and envelopes, the most frequently used by the general spanish population, which in our opinion would be more suitable for a regular intake. on the other hand, certain clinical parameters could have increased the relevance of the intervention on the patient's cardiovascular risk, so our observations are limited to the plasma lipoprotein parameters. if we consider the modifications of the plasma lipid profile, our data suggest that simply increasing the pufa or mufa content at breakfast is enough to decrease lp(a), vldl, and idl and to increase hdl levels, so these types of fats improved the atherogenic lipid profile of the participants. the increase of apo ai and decrease of apo b with intake of a pufa-rich breakfast also suggest that this intervention can prevent the risk of cvd. although the effect of the pufa-rich breakfast seems greater, it must be remembered that this breakfast was the one with the least amount of fat, which is undoubtedly also influencing the data obtained. given the high prevalence of cvd, a simple modification such as changing the fat serving at breakfast may serve to promote health status, especially in those patients with an impaired lipoprotein profile. nevertheless, further studies with a similar design to the present work are necessary to evaluate whether these interventions effectively reduce cardiovascular risk and/or increase life expectancy of cvd patients. the following are available online at http://www.mdpi.com/ - / / / /s , figure s . changes in lp(a) and ldl subfractions. table s : fatty acid composition of the different types of breakfast. table s : effect of -day intervention with the different breakfasts on plasma lipoproteins and their subfractions. table s . effect of -day intervention with the different breakfasts on plasma lipoproteins attending to the electrophoretic mobility and plasma apolipoproteins. world health organization. the top causes of death. world health organization non-hdl cholesterol shows improved accuracy for cardiovascular risk score classification compared to direct or calculated ldl cholesterol in a dyslipidemic population non-hdl cholesterol, apolipoproteins a-i and b , standard lipid measures, lipid ratios, and crp as risk factors for cardiovascular disease in women association of ldl cholesterol, non-hdl cholesterol, and apolipoprotein b levels with risk of cardiovascular events among patients treated with statins: a meta-analysis the joint effects of apolipoprotein b, apolipoprotein a , ldl cholesterol, and hdl cholesterol on risk: cases of acute myocardial infarction and controls serum levels of apolipoprotein a-i and high-density lipoprotein can predict organ failure in acute pancreatitis ldl subclass lipidomics in atherogenic dyslipidemia:effect of statin therapy on bioactive lipids and dense ldl relationship of baseline hdl subclasses, small dense ldl and ldl triglyceride to cardiovascular events in the aim-high clinical trial ldl cholesterol consists of different subclasses, more precise diagnostics are required lipoprotein(a) as a cardiovascular risk factor: current status lipoprotein subfractions and cardiovascular disease risk relation between degree of obesity and site-specific adipose tissue fatty acid composition in a mediterranean population relationship between fat cell size and number and fatty acid composition in adipose tissue from different fat depots in overweight/obese humans dietary fat interacts with pcbs to induce changes in lipid metabolism in mice deficient in low-density lipoprotein receptor mechanisms by which dietary fatty acids modulate plasma lipids the association among chronotype, timing of food intake and food preferences depends on body mass status timing of food intake predicts weight loss effectiveness associations among late chronotype, body mass index and dietary behaviors in young adolescents influences of breakfast on clock gene expression and postprandial glycemia in healthy individuals and individuals with diabetes: a randomized clinical trial the relationship of breakfast skipping and type of breakfast consumption with nutrient intake and weight status in children and adolescents: the national health and nutrition examination survey breakfast: the most important meal of the day? breakfast in human nutrition: the international breakfast research initiative effects of different dietary intake of essential fatty acids on c : ω and c : ω serum levels in human adults effect of a chronotype-adjusted diet on weight loss effectiveness: a randomized clinical trial analytical sensitivity and diagnostic performance of serum protein electrophoresis on the hydragel protein(e) β -β sebia hydrasys system determination of apolipoprotein a-i by kinetic nephelometry measurement of plasma lipoproteins by electrophoresis on polyacrylamide gel dairy fat and risk of cardiovascular disease in cohorts of us adults effects of saturated fatty acids on serum lipids and lipoproteins: a systematic review and regression analysis; world health organization: maastrich, the netherlands effects of fatty acids composition in a breakfast meal on the postprandial lipid responses: a systematic review and meta-analysis of randomised controlled trials older adults have an altered chylomicron response to a high-fat meal lipoprotein sub-fractions by ion-mobility analysis and its association with subclinical coronary atherosclerosis in high-risk individuals effects of margarines and butter consumption on lipid profiles, inflammation markers and lipid transfer to hdl particles in free-living subjects with the metabolic syndrome small dense low-density lipoprotein and its role as an independent predictor of cardiovascular disease low-density lipoprotein size and cardiovascular risk assessment third report of the national cholesterol education program (ncep) expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (adult treatment panel iii) final report n- polyunsaturated fatty acids in the treatment of atherogenic dyslipidemia effect of short-term low-and high-fat diets on low-density lipoprotein particle size in normolipidemic subjects compared with saturated fatty acids, dietary monounsaturated fatty acids and carbohydrates increase atherosclerosis and vldl cholesterol levels in ldl receptor-deficient, but not apolipoprotein e-deficient, mice relevance of intermediate-density lipoprotein cholesterol to framingham risk score of coronary heart disease in middle-aged men with increased non-hdl cholesterol high apolipoprotein b, low apolipoprotein a-i, and improvement in the prediction of fatal myocardial infarction (amoris study): a prospective study apolipoprotein a-ii is a key regulatory factor of hdl metabolism as appears from studies with transgenic animals and clinical outcomes human apolipoprotein a-ii determines plasma triglycerides by regulating lipoprotein lipase activity and high-density lipoprotein proteome the type of fat ingested at breakfast influences the plasma lipid profile of postmenopausal women this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license we wanted to thank the residents and the managers of the catholic institutions and the catholic university of murcia for taking part in the present study and especially for their collaboration and faithful adherence to the requirements of the project design. the authors declare no conflict of interest.nutrients , , key: cord- -iv authors: sun, qian; hackler, julian; hilger, julia; gluschke, hans; muric, aldina; simmons, szandor; schomburg, lutz; siegert, elise title: selenium and copper as biomarkers for pulmonary arterial hypertension in systemic sclerosis date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: iv circulating selenoprotein p (selenop) constitutes an established biomarker of se status. selenop concentrations are reduced in inflammation and severe disease. recently, elevated selenop levels have been suggested as diagnostic marker and therapeutic target in pulmonary arterial hypertension (pah). we decided to re-evaluate this hypothesis. a group of healthy controls (n = ) was compared with patients suffering from systemic sclerosis (ssc, n = ), one third with ssc-related pah. serum was analysed for trace elements and protein biomarkers, namely selenop, glutathione peroxidase (gpx ) and ceruloplasmin (cp). compared to controls, patients with ssc-related pah displayed reduced serum se ( ± vs. ± µg/l) and selenop concentrations ( . ± . vs. . ± . mg/l), along with lower gpx activity ( ± vs. ± u/l). all three biomarkers of se status were particularly low in patients with skin involvement. serum cu was not different between the groups, but patients with ssc-related pah showed elevated ratios of cu/se and cp/selenop as compared to controls. our data indicate that patients with ssc-related pah are characterized by reduced se status in combination with elevated cp, in line with other inflammatory diseases. further analyses are needed to verify the diagnostic value of these te-related biomarkers in pah. some trace elements (te) are essential for human health, and deficiencies are associated with disease risk and a more severe disease course. the requirements vary with age [ ] and, especially, the immune system depends on a balanced and sufficiently high te supply [ ] . the essential te selenium (se) is unique within the group of micronutrients, as it is part of the amino acid selenocysteine (sec) and as such becomes directly incorporated into selenoproteins during translation [ ] . selenoproteins are an instructive example for the importance of te supply, as their biosynthesis depends directly on the dietary intake of se that differs strongly across the world [ ] . accordingly, some populations are considered as being sufficiently supplied by their regular diet, e.g., subjects living in north america, whereas se availability in large parts of europe, asia and africa is marginal and even tends to decline [ ] . certain health risks are directly related to se deficiency, e.g., viral infections as well as kashin-beck and keshan disease in the se-poor areas of asia, where targeted se supplementation is a successful preventive measure [ , ] . several biomarkers for detecting se deficiency and monitoring successful supplementation effects have been evaluated [ ] . among the different candidates, three parameters emerged as the most informative ones, i.e., enzymatic activity of the secreted glutathione peroxidase (gpx ) in serum or plasma, concentration of total serum or plasma se, and the expression level of the circulating se transporter selenoprotein p (selenop) [ ] [ ] [ ] . these biomarkers correlate over a wide range of se intakes, since they are not independent from each other and ultimately rely on se availability and selenoprotein biosynthesis. accordingly, supplemental se intake is reflected in a parallel increase in all three biomarkers in clinical studies with marginally supplied subjects [ ] . inversely, genetic defects in selenoprotein biosynthesis or severe disease negatively affect all three se status biomarkers [ ] . as micronutrient, se is taken up by the diet in different forms undergoing a variety of biochemical conversions [ , ] , resulting in compound-specific bio-availabilities and toxicities, respectively [ , ] . besides low se intake and inherited defects, many common diseases are also related to a suboptimal se status in a more complex manner, where sometimes cause and consequences are difficult to disentangle [ ] [ ] [ ] . a se deficit is known to predispose to, e.g., liver or colorectal cancer [ , ] , to thyroid [ , ] and cardiovascular disease [ , ] , or to survival odds in sepsis [ ] , after poly-trauma [ ] , in breast [ ] , lung [ ] or renal cancer [ ] . notably, the stringent interrelation between se deficit and mortality risk may be confined to subjects residing in areas with low baseline se supply, where a declining se status may reach a certain essential minimal threshold more rapidly than under ample se supply. this hypothesis has received support by a recent analysis of cure rates from sars-cov- -related covid- in relation to baseline se status in different areas of china, and is discussed as of potential relevance for covid infection, disease spread and course [ , ] . inflammation, hypoxia, pro-inflammatory cytokines and other stress signals are among the parameters accelerating and aggravating a se status decline [ ] [ ] [ ] . hence, we hypothesized that in a disease such as systemic sclerosis (ssc), which is characterized by inflammation, vasculopathy and fibrosis with resulting hypoxia, patients may present with low se status. furthermore, in view of the fact that ssc-related pulmonary arterial hypertension (ssc-pah) is the final presentation of progressive pulmonary vasculopathy, we assume that this condition may be associated with particularly depleted se status, i.e., depressed values of total se and selenop concentrations. a similar association may also apply to ssc-related skin changes, as they are associated with declining lung function [ ] , hypoxia and mortality risk in ssc [ ] . given the severity of the disease and the urgent need for an improved diagnosis and helpful indicators of disease risk and progression, we decided to re-evaluate different biomarkers of te status in patients with ssc and ssc-pah in comparison to healthy controls. a cross-sectional study of healthy controls and patients with ssc fulfilling the american college of rheumatology (acr)/european league against rheumatism (eular) classification criteria [ ] was conducted. around one third of the ssc patients were suffering from ssc-pah (table ) . diagnosis of ssc-pah was based on the european society of cardiology (esc)/ european respiratory society (ers) guidelines for the diagnosis and treatment of pulmonary hypertension [ ] . all study subjects enrolled into the analysis had provided a written informed consent form and their samples were deposited in a local biobank. the study was conducted in accordance with the declaration of helsinki. approval was granted by the board of ethics of universität zu köln (# - ), and charité medical school berlin (#ea / / and # - ). the samples had been stored at − • c until analysis. all measurements were conducted blinded to any clinical information. nt-probnp ** [ng/l], median (range) * mrss: modified rodnan skin score; ** nt-probnp: n-terminal pro-b-type natriuretic peptide. concentrations of serum te were determined by total reflection x-ray fluorescence (txrf) analysis using a benchtop txrf analyzer (s picofox, bruker nano gmbh, berlin, germany), essentially as described previously [ ] . briefly, µl of serum sample was diluted with an equal volume of a gallium standard ( µg/l), µl of the dilution was applied to a polished quartz glass slide and samples were dried overnight. seronorm serum standard (sero as, billingstad, norway) served as control, and the se concentrations determined were within the specified range of the standard and linear, on dilutions in the range of : , : and : . the inter-and intra-assay cv was determined to be below % in the concentration range of - µg se/l serum. serum selenop concentrations were measured by sandwich elisa using a validated commercial selenop-specific elisa (selenotest tm , selenomed gmbh, berlin, germany), essentially as described [ ] . briefly, serum samples of µl were diluted : and applied to pre-coated -well plates. standards and calibrators were included into each assay run for quality control. serum cp concentrations were determined by a validated non-competitive elisa as described recently [ ] . briefly, serum samples were pre-diluted : in sample buffer, and µl of diluted sample were incubated on pre-coated sandwich elisa plates for min at room temperature. after several wash steps, the plates were incubated with detection antibody conjugated with horseradish peroxidase for min. following further wash steps, the enzymatic detection reaction was started by adding µl of , , -tetramethylbenzidine (tmb) substrate and terminated by adding an equal volume of sulfuric acid. spectrophotometric readout at nm was recorded by a microplate reader (tecan group ag). gpx activity was determined by a coupled enzymatic test procedure monitoring reduced nicotinamide adenine dinucleotide phosphate (nadph) consumption at nm [ ] . briefly, serum samples of µl were applied to -well plates. after adding µl of a test mix including mm nan , . mm reduced glutathione, . u/ml glutathione reductase and . mg/ml nadph, the test was started by µl of . % hydrogen peroxide. the decrease in nadph absorbance per minute measured at nm as readout is proportional to the gpx activity in the sample. a constant serum sample was included into each assay run for quality control. the inter-and intra-assay cv was determined to be below %. statistical analysis was performed with spss statistics ® (version , ibm, chicago, il, usa) and graphpad prism (version , graphpad software inc., san diego, ca, usa), respectively. normal distribution of values was tested by the shapiro-wilk test. comparisons between two groups were conducted by unpaired t test, and for not-normally distributed variables with mann-whitney test. comparisons of the characteristics between more than two groups were conducted with anova and dunn's multiple comparisons test, and for not-normally distributed variables with the kruskal-wallis test. correlations were tested by pearson's correlation analysis and for not-normally distributed variables by spearman's correlation test. all statistical tests were two-sided and p-values < . were considered statistically significant; * p < . , ** p < . , *** p < . , and **** p < . . a total of ssc patients met the acr/eular classification criteria, and healthy controls (hc) were included into the analysis. the study population showed the expected female predominance and a mean age range typical for ssc (table ) . serum se status was evaluated by three complementary biomarkers, i.e., total serum se ( figure a ) and selenop concentrations ( figure b ), we well as gpx activity ( figure c ). the three biomarkers of se status showed significant and linear correlations over the full range of data, indicating a high quality of the samples. cu status was evaluated by two complementary biomarkers, i.e., total serum cu and cp concentrations. the assessment of the full cohort of samples indicates a linear correlation of both cu biomarkers verifying the integrity of the samples and quality of analysis ( figure d ). the ssc patients displayed disease-specific differences in the te status biomarkers in comparison to hc ( figure ). to further subdivide the analyses, the group of ssc patients was differentiated according to presence or absence of pah. a gradual decrease in se status from hc to patients with ssc and then with ssc-pah was observed. the group of ssc-pah patients displayed the lowest se status, i.e., significantly reduced concentrations of se (figure a) , and selenop ( figure b ), as well as reduced gpx activity ( figure c) . notably, the average levels of all three se status biomarkers were consistently lower in patients with ssc-pah than in hc. in comparison to established reference ranges from literature [ , ] , the ssc patients displayed a relative se deficit (table s ); the prevalence of se deficiency (ssc-pah vs. ssc vs. controls) was . % vs. . % vs. % as judged by serum se, . % vs. . % vs. % as judged by serum selenop, and . % vs. . % vs. % as judged by gpx activity, respectively. the ssc patients displayed disease-specific differences in the te status biomarkers in comparison to hc (figure ). to further subdivide the analyses, the group of ssc patients was differentiated according to presence or absence of pah. a gradual decrease in se status from hc to patients with ssc and then with ssc-pah was observed. the group of ssc-pah patients displayed the lowest se status, i.e., significantly reduced concentrations of se (figure a) , and selenop ( figure b ), as well as reduced gpx activity ( figure c) . notably, the average levels of all three se status biomarkers were consistently lower in patients with ssc-pah than in hc. in comparison to established reference ranges from literature [ , ] , the ssc patients displayed a relative se deficit (table s ); the prevalence of se deficiency (ssc-pah vs. ssc vs. controls) was . % vs. . % vs. % as judged by serum se, . % vs. . % vs. % as judged by serum selenop, and . % vs. . % vs. % as judged by gpx activity, respectively. besides se, the biomarkers of cu and zn status were also analyzed. total serum zn concentrations were relatively low in ssc-pah as compared to hc ( figure d ), whereas total serum cu concentrations were not different between the groups ( figure e ). the protein biomarker of cu status, i.e., ceruloplasmin (cp), was elevated in ssc, both in patients with and in patients without pah, as compared to hc ( figure f ). te status was also analysed by composite biomarkers, that may provide more sensitive information. to this end, ratios were built between serum te and the protein biomarkers, respectively. in this analysis, consistently elevated values in the patients are observed for the cu/zn ratio ( figure g ), cu/se ratio ( figure h ) and cp/selenop ratio (figure i ), respectively. the n-terminal pro-b-type natriuretic peptide (ntprobnp) has been shown as valuable biomarker for heart failure, and ntprobnp concentrations are elevated in patients suffering from besides se, the biomarkers of cu and zn status were also analyzed. total serum zn concentrations were relatively low in ssc-pah as compared to hc ( figure d ), whereas total serum cu concentrations were not different between the groups ( figure e ). the protein biomarker of cu status, i.e., ceruloplasmin (cp), was elevated in ssc, both in patients with and in patients without pah, as compared to hc ( figure f ). te status was also analysed by composite biomarkers, that may provide more sensitive information. to this end, ratios were built between serum te and the protein biomarkers, respectively. in this analysis, consistently elevated values in the patients are observed for the cu/zn ratio ( figure g ), cu/se ratio ( figure h ) and cp/selenop ratio ( figure i ), respectively. the n-terminal pro-b-type natriuretic peptide (ntprobnp) has been shown as valuable biomarker for heart failure, and ntprobnp concentrations are elevated in patients suffering from ssc-pah [ ] . a direct comparison of the te concentrations, the protein biomarkers and their ratios with ntprobnp supports the consistency of the data and the potential usefulness of te-based biomarkers for improving ssc-pah diagnosis (figure ). skin involvement in ssc is associated with severity of disease. the cohort of patients was subdivided into two groups according to skin involvement as assessed by the modified rodnan skin score (mrss). the group of ssc patients with skin involvement displayed relatively low values for total serum se ( figure a ), and selenop concentrations ( figure b ), as well as for gpx activity skin involvement in ssc is associated with severity of disease. the cohort of patients was sub-divided into two groups according to skin involvement as assessed by the modified rodnan skin score (mrss). the group of ssc patients with skin involvement displayed relatively low values for total serum se ( figure a ), and selenop concentrations ( figure b ), as well as for gpx activity ( figure c) . notably, all three se status biomarkers were consistently lower in ssc patients with skin involvement as compared to ssc patients without skin involvement. in comparison to serum se status, there were no differences in total serum zn ( figure d ), cu ( figure e ) or cp ( figure f ) concentrations, as well as no differences in the cu/zn (figure g ), cu/se ( figure h ) or cp/selenop ratio ( figure i ). in an analysis according to the three major forms of cutaneous involvement (limited, diffused or sine scleroderma), no significant differences in any of the markers were observed between the groups. comparisons between two groups were conducted by unpaired t test, and for not-normally distributed variables with mann whitney test. all tests were two-sided and p-values < . were considered statistically significant; * indicates p < . . in this manuscript, we report the te status of ssc patients with or without pah in comparison to hc, as assessed by a number of complementary biomarkers. the data indicate several significant differences between the groups that are compatible with the inflammatory nature of ssc, and comparisons between two groups were conducted by unpaired t test, and for not-normally distributed variables with mann whitney test. all tests were two-sided and p-values < . were considered statistically significant; * indicates p < . . in this manuscript, we report the te status of ssc patients with or without pah in comparison to hc, as assessed by a number of complementary biomarkers. the data indicate several significant differences between the groups that are compatible with the inflammatory nature of ssc, and particularly pronounced alterations are recorded in relation to pah. the validity of the data is supported by several findings, e.g., by the tight and linear correlations of all three biomarkers of se status over the full concentration ranges, and by their consistent relation to ssc and pah severity. the latter was assessed by the presence of skin involvement and elevated ntprobnp concentrations, respectively, which both displayed an inverse association with all three biomarkers of se status. the findings are in line with the positive effects of supplemental coenzyme q and se in reducing ntprobnp concentrations in cardiac patients [ ] . collectively, our analysis supports the classification of ssc as a severe inflammatory disease in which the se status declines with disease severity [ ] . this notion supports the initial hypothesis of our study. however, the data are in some disagreement to a recent report on increased selenop concentrations in patients with pah and a potential involvement of selenop in pah disease etiology [ , ] . an underlying inflammatory nature of ssc as a progressive disease is undisputed, and recent data indicate that pro-inflammatory cytokines are involved in the development of pah [ , ] , such as interleukin- (il- ) [ ] . inflammation appears to synergize with chronic hypoxia in the irreversible induction of pulmonary vascular remodeling and pah development [ ] . inflammatory cytokines are also known to negatively affect se status and particularly hepatic selenop biosynthesis [ ] , and molecular studies have highlighted a strong effect of il- and hypoxia on liver se metabolism and the pattern of selenoproteins expressed under inflammatory conditions [ , ] . experimental studies in an avian model of pah indicated that supplemental se may confer some positive health effects by preventing disease incidence and mitigating pah symptoms [ ] . hence, it was unexpected to learn that selenop levels may be elevated in pah [ ] , in view of the ongoing underlying inflammation. this report was also in disagreement with a body of literature describing reduced se status in ssc [ ] [ ] [ ] . moreover, the selenop concentrations reported in the pah patients were outside physiologically reasonable limits, and not compatible with human life [ ] . the data presented in this manuscript accord with the skepticism towards the hypothesis on a causal involvement of selenop in pah progression and its potential role as a pharmacological target. notably, our results not only disagree with an increased expression of selenop in pah, they rather indicate an inverse relation, i.e., decreasing selenop levels with aggravated disease states and a potential loss of selenop-related protection against oxidative stress in ssc that may contribute to pah progression [ ] . this interpretation is supported by the tendency of a more severe se deficit in ssc-pah as compared to ssc, and by the significant relation to skin involvement or the concentrations of ntprobnp, both known to be associated with ssc severity and survival in pah [ ] . this notion is further supported by prior studies reporting a se deficit in ssc [ ] , the inverse relation between se and ntprobnp [ ] and an inverse relation of se-dependent gpx activity with skin involvement and disease severity in ssc [ , ] . the elevated serum cp concentrations observed in ssc are also indicative of increased inflammation and oxidative stress, as cp is an established positive acute phase reactant related to cardiovascular disease [ ] . its potential role in lung disease development has been shown in a murine model of pah [ ] , and elevated concentrations of cp in ssc have been observed as early as [ ] . besides the different markers of se and cu status, our analysis also tested the hypothesis that protein biomarkers and composite te indices may be of particular value and provide higher sensitivity, as recently shown for neonatal infections [ ] . while serum cu concentrations alone were not different between the groups, the cu/zn ratio was discriminating between the groups of hc and ssc-pah. the most pronounced differences between all three groups studied were noted for the ratios of cu/se and cp/selenop, where even within the group of ssc patients clear differences were present in relation to pah or ntprobnp. this finding was not totally unexpected given the inverse regulation of serum se and selenop versus cu and cp under inflammatory conditions, where se status declines and cu status increases in blood. among the particular strengths of our study are the parallel analysis of several biomarkers of se and cu status along with the essential trace element zn, and the consequent usage of validated methods that yield congruent and plausible results. all three biomarkers of se status as well as the two biomarkers of cu status accorded well, indicative of a high quality of the samples analysed and the techniques used. the additional tests for composite biomarkers support their potential value as more sensitive diagnostic readouts, especially when inversely regulated parameters are used, like calculating the ratio of biomarkers of the se and cu status in inflammatory settings. among the limitations of this study are the moderate size of the study groups, and the fact that all of the pah patients analysed suffer from underlying ssc. extrapolations to pah in general are therefore not fully justified, and an analysis of te status in the different clinical pah subtypes still needs to be conducted. on the other hand, ssc is a prototypic disease for states of fibrosis, vasculopathy and hypoxia, i.e., a valuable surrogate for latent or early stages of pah, and the direct comparison between hc, ssc and ssc-related pah can be viewed as a setup to model disease progression. patients suffering from ssc-pah display characteristic alterations in biomarkers of their serum se and cu status, in agreement with other inflammatory diseases. the se deficit in patients with skin involvement merits further research as it indicates a potential shortage of protective selenoenzymes needed for an efficient control of oxidative stress and deceleration of scleroderma pathogenesis. an assessment of the composite te biomarkers cu/se ratio and cp/selenop ratio, respectively, yielded two novel sensitive and promising diagnostic parameters of ssc and ssc-related pah, that may enable an early and reliable identification of disease activity and pah risk. future studies may test whether supplemental se and improved selenoprotein expression diminish oxidative stress and positively decelerate disease progression, as indicated in some model systems and clinical studies. supplementary materials: the following are available online at http://www.mdpi.com/ - / / / /s , table s : prevalence of se status below (<refr) or above reference range (>refr) in ssc patients and hc. immune function and micronutrient requirements change over the life course a review of micronutrients and the immune system-working in harmony to reduce the risk of infection characterization of mammalian selenoproteomes food-chain selenium and human health: emphasis on intake selenium deficiency risk predicted to increase under future climate change prevention and control strategies for children kashin-beck disease in china: a systematic review and meta-analysis. medicine (baltimore) , , e prevention of keshan disease by selenium supplementation: a systematic review and meta-analysis biomarkers of selenium status optimization of selenoprotein p and other plasma selenium biomarkers for the assessment of the selenium nutritional requirement: a placebo-controlled, double-blind study of selenomethionine supplementation in selenium-deficient chinese subjects establishing optimal selenium status: results of a randomized, double-blind, placebo-controlled trial selenoprotein p as biomarker of selenium status in clinical trials with therapeutic dosages of selenite mutations in secisbp result in abnormal thyroid hormone metabolism selenium biochemistry and its role for human health regulation of selenium metabolism and transport comparison of different selenocompounds with respect to nutritional value vs. toxicity using liver cells in culture selenium in plant foods: speciation analysis, bioavailability, and factors affecting composition roles for selenium and selenoprotein p in the development, progression, and prevention of intestinal disease selenium and selenocysteine: roles in cancer, health, and development the other view: the trace element selenium as a micronutrient in thyroid disease, diabetes, and beyond. hormones (athens) prediagnostic selenium status and hepatobiliary cancer risk in the european prospective investigation into cancer and nutrition cohort selenium status is associated with colorectal cancer risk in the european prospective investigation of cancer and nutrition cohort association of selenium with thyroid volume and echostructure in -to -year-old french adults low population selenium status is associated with increased prevalence of thyroid disease selenoprotein-p deficiency predicts cardiovascular disease and death selenium and outcome in heart failure selenium in intensive care (sic): results of a prospective randomized, placebo-controlled, multiple-center study in patients with severe systemic inflammatory response syndrome, sepsis, and septic shock bogner-flatz, v. selenium and selenoprotein p deficiency correlates with complications and adverse outcome after major trauma serum selenium levels predict survival after breast cancer influence of the selenium level on overall survival in lung cancer selenoprotein p status correlates to cancer-specific mortality in renal cancer patients association between regional selenium status and reported outcome of covid- cases in china selenium supplementation in the prevention of coronavirus infections (covid- ) properties, functions, and regulation gene-specific regulation of hepatic selenoprotein expression by interleukin- selenoprotein p as an in vivo redox regulator: disorders related to its deficiency and excess skin improvement is a surrogate for favourable changes in other organ systems in early diffuse cutaneous systemic sclerosis early trajectories of skin thickening are associated with severity and mortality in systemic sclerosis classification criteria for systemic sclerosis: an american college of rheumatology/european league against rheumatism collaborative initiative esc/ers guidelines for the diagnosis and treatment of pulmonary hypertension: the joint task force for the diagnosis and treatment of pulmonary hypertension of the european society of cardiology (esc) and the sex-specific and inter-individual differences in biomarkers of selenium status identified by a calibrated elisa for selenoprotein p copper and selenium status as biomarkers of neonatal infections assays of glutathione-peroxidase. method enzymol selenium and glutathione peroxidase reference values in whole blood and plasma of a reference population living in valencia implication of oxidative stress in the pathogenesis of systemic sclerosis via inflammation, autoimmunity and fibrosis effect of selenium and q on the cardiac biomarker nt-probnp selenoprotein p promotes the development of pulmonary arterial hypertension: a possible novel therapeutic target selenoprotein p promotes the development of pulmonary arterial hypertension: possible novel therapeutic target inflammation in pulmonary arterial hypertension interleukin- overexpression induces pulmonary hypertension pathobiology of pulmonary hypertension down-regulation of the hepatic selenoprotein biosynthesis machinery impairs selenium metabolism during the acute phase response in mice hypoxia reduces and redirects selenoprotein biosynthesis role of selenium from different sources in prevention of pulmonary arterial hypertension syndrome in broiler chickens serum copper and caeruloplasmin in ankylosing spondylitis, systemic sclerosis, and morphea the role of selenium deficiency in the pathogenesis of systemic sclerosis impact of micronutrient deficiency & malnutrition in systemic sclerosis: cohort study and literature review blood glutathione-peroxidase levels in skin diseases: effect of selenium and vitamin e treatment role of n-terminal brain natriuretic peptide (n-tprobnp) in scleroderma-associated pulmonary arterial hypertension clinical and genetic association of serum ceruloplasmin with cardiovascular risk upregulated copper transporters in hypoxia-induced pulmonary hypertension we thank vartitér seher, gabriele boehm and anja fischbach for excellent technical support, and wolfgang m. kübler for constructive discussions.conflicts of interest: l.s. holds shares in selenomed gmbh, a company involved in se status assessment and supplementation. the other authors declare no competing interest with respect to this study. key: cord- -dr ysrwe authors: chew, justin; yeo, audrey; yew, suzanne; tan, cai ning; lim, jun pei; hafizah ismail, noor; lim, wee shiong title: nutrition mediates the relationship between osteosarcopenia and frailty: a pathway analysis date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: dr ysrwe osteosarcopenia is associated with increased risk of adverse outcomes such as falls and fractures. its association with frailty is less well-described, particularly in independent community-dwelling older adults. although nutrition plays a crucial role in maintaining bone and muscle health, the complex relationship between osteosarcopenia and nutrition in the pathogenesis of frailty remains to be elucidated. in this cross-sectional analysis of independent, community-dwelling individuals (mean age . ± . years), we examined the associations between osteosarcopenia with nutritional status and frailty, and the mediating role of nutrition in the association between osteosarcopenia and frailty. osteosarcopenia was defined as fulfilling both the asian working group for sarcopenia consensus definition (low relative appendicular skeletal muscle mass adjusted for height, in the presence of either of either low handgrip strength or slow gait speed) and t-score ≤ − . sd on bone mineral densitometry. we assessed frailty using the modified fried criteria and nutrition using the mini-nutritional assessment. we performed multiple linear regression, followed by pathway analysis to ascertain whether nutrition mediates the relationship between osteosarcopenia and frailty. our study population comprised: ( . %) osteosarcopenic, ( . %) sarcopenic, ( . %) osteoporotic and ( . %) normal (neither osteosarcopenic, sarcopenic nor osteoporotic). osteosarcopenia (β = . , % ci . – . ) and sarcopenia (β = . , % ci . – . ) were significantly associated with frailty, but not osteoporosis. nutrition mediated the association between osteosarcopenia and frailty (indirect effect estimate . , bootstrap % ci . – . ). in conclusion, osteosarcopenia is associated with frailty and poorer nutritional status, with nutrition mediating the association between osteosarcopenia and frailty. our findings support early nutritional assessment and intervention in osteosarcopenia to mitigate the risk of frailty. osteoporosis and sarcopenia are two important musculoskeletal conditions that adversely impact the health of older individuals. while both conditions appear to be distinct, the coexistence of the two conditions, known as osteosarcopenia, may identify a subpopulation of older individuals at greater risk of adverse health outcomes compared to either condition alone. osteosarcopenia is associated with a -to -fold increased odds of falls and fractures in older individuals attending a falls clinic [ ] . osteosarcopenic individuals who suffered a hip fracture also had . times greater hazard for mortality compared to non-osteosarcopenic individuals [ ] . despite some studies demonstrating the deleterious effects of osteosarcopenia, others show inconsistent outcomes. for example, community-dwelling older australian men do not have increased falls, fractures or mortality risk above and beyond either condition alone [ , ] . these discrepant findings may be ascribed to differences in the population under study and the chosen outcomes. in a cohort of independent community-dwelling older individuals, frailty is a particularly salient outcome, representing increased vulnerability to adverse events. however, few studies have examined the association between osteosarcopenia and frailty [ ] [ ] [ ] , relative to osteoporosis and sarcopenia alone. nutrition plays a key role in the pathogenesis of frailty, and it is also important in both bone [ ] and muscle health [ ] . however, the complex relationships between osteosarcopenia, nutrition and frailty remain to be elucidated. specifically, the mediating role of nutrition in the relationship between osteosarcopenia and frailty bears further scrutiny. clarifying this relationship will explicate the role of nutrition as a mechanism through which osteosarcopenia engenders frailty, and establish nutrition as an appropriate target for intervention in preventing the adverse consequences of osteosarcopenia. therefore, we aimed to, firstly, examine the association between osteosarcopenia, osteoporosis and sarcopenia with frailty and markers of nutritional status. secondly, we investigated nutrition as a mediator of the relationship between osteosarcopenia and frailty, relative to osteoporosis and sarcopenia alone, in a cohort of independent community-dwelling older adults. we hypothesize that osteosarcopenia is associated with frailty and markers of poor nutritional status, and that the relationship between osteosarcopenia and frailty is mediated by nutrition. this is a cross-sectional analysis of participants recruited from the "longitudinal assessment of biomarkers for characterization of early sarcopenia and osteosarcopenic obesity in predicting frailty and functional decline in community-dwelling asian older adults study" (gerilabs ), a prospective cohort study involving community-dwelling cognitively intact and functionally independent adults aged years and older [ ] . inclusion criteria were: (i) participants aged to years at study enrollment, (ii) community-dwelling, (iii) independent in both activities of daily living (adls) and instrumental adls, and (iv) non-frail as defined by the frail criteria [ ] . we excluded participants with dementia or evidence of cognitive impairment (modified chinese version of mini-mental state examination (cmmse) score ≤ ) [ ] ; who were unable to walk -m independently; or living in a sheltered or nursing home. all participants provided written informed consent to participate in the study. ethics approval for this study was obtained from the domain specific review board of the national healthcare group (dsrb ref: / ). we collected demographic characteristics (age, gender, ethnicity) and comorbid conditions. cognitive performance was assessed using the modified chinese version of mini-mental state examination (cmmse). functional status was evaluated using barthel's basic activities of daily living (badl) index [ ] and lawton and brody's instrumental adl (iadl) index [ ] . depressive symptoms were evaluated using the geriatric depression scale (gds) [ ] . body composition and bone mineral density (bmd) of lumbar spine, femoral neck and total hip of all participants were obtained with the same dual energy x-ray absorptiometry (dxa) source (discovery tm apex . ; hologic, bedford, ma, usa). osteoporosis was classified by the who (world health organization) criteria based on the bmd t-score of the lumbar spine and/or femoral neck and/or total hip equivalent or lower than − . sd [ ] . sarcopenia was diagnosed with the asian working group for sarcopenia (awgs) consensus criteria [ ] , defined as low relative appendicular skeletal muscle mass (asm) (height-adjusted asm (asm/height )) in the presence of either low handgrip strength or slow gait speed using updated cutoffs [ ] . osteosarcopenia was defined as co-existent osteoporosis and sarcopenia. physical frailty was assessed using the modified fried phenotypic criteria [ ] . the modified fried criteria was operationalized as follows [ ] : ( ) body mass index less than . ; ( ) handgrip strength range < kg for men and < kg for women, measured using a hydraulic hand dynamometer (north coast exacta™ hydraulic hand dynamometer; north coast medical, inc., morgan hill, ca, usa); ( ) usual gait speed < . m/s on the m walk test; ( ) low physical activity defined using the pentile cutoff of ≤ on the frenchay activities index [ ] ; and ( ) fatigue endorsed on either of two questions from the center for epidemiologic studies-depression scale (ces-d) modified to assess fatigue. the five items were added to yield a total score for frailty (range - ). higher scores indicated worsening frailty status. nutritional assessments included anthropometric measurements: standing height and body weight were measured to calculate body mass index (bmi), waist circumference (wc), mid-arm circumference (mac), and calf circumference (cc). wc, mac and cc were measured using a non-elastic tape. wc was measured at . cm above the umbilicus. mac of the dominant arm was obtained with the subject seated, measured at the midpoint between the tip of the shoulder and the tip of the elbow. cc was obtained with the subject in a seated position with both feet on the ground to obtain the maximal reading of the dominant calf [ ] . to evaluate nutritional status, the mini nutritional assessment (mna) [ ] was also used. in accordance with established cut-offs, a total mna score of ≥ (out of a maximum of points) classifies well-nourished/normal nutritional status, to . points classifies individuals at risk of malnutrition, and < points malnourished. lastly, serum -hydroxyvitamin d ( (oh)d) levels were also obtained. continuous variables were expressed as means and standard deviation. categorical variables were expressed as counts and percentages. one-way analysis of variance (anova) followed by bonferroni post hoc analyses were used to analyse the relationships of continuous variables (frailty score and nutritional parameters) with participants classified as osteoporotic, sarcopenic, osteosarcopenic or normal (neither osteoporotic, sarcopenic nor osteosarcopenic) respectively. multiple linear regression was carried out with frailty score and the aforementioned nutritional parameters as dependent variables, unadjusted and adjusted for age, gender and ethnicity. a multicategorical mediation model examined the potential mediating role of nutrition, using total mna score, in the relationship between osteoporosis, sarcopenia and osteosarcopenia with frailty. dummy codes were created for osteoporosis, sarcopenia and osteosarcopenia with normal individuals (neither osteoporotic, sarcopenic nor osteosarcopenic) as the reference group ( figure ). direct and indirect effects for osteoporosis, sarcopenia and osteosarcopenia groups were compared to this reference group. to obtain estimates of the indirect effects, we used bootstrapping procedures based on resamples [ ] . participants' age, gender and ethnicity were included in the model as covariates. two-sided tests with a significance level of p < . were applied. statistical analysis was carried out using stata version (statacorp, college station, tx, usa). multicategorical mediation model for total frailty score (* p < . ). paths a , a , a represent the effect of osteoporosis, sarcopenia and osteosarcopenia on the proposed mediator, malnutrition; path b represents the effect of the proposed mediator, malnutrition on frailty; path c' , c' and c' represent the relative direct effect of osteoporosis, sarcopenia and osteosarcopenia on frailty. all paths are represented by unstandardized regression coefficients. we included individuals (mean age . ± . years) in this study. twenty-seven ( . %) were osteosarcopenic, ( . %) were sarcopenic, ( . %) were osteoporotic and ( . %) were normal (neither osteosarcopenic, sarcopenic nor osteoporotic). a significant difference in age was observed between the four groups (p = . ); post-hoc comparisons with bonferroni correction revealed that osteosarcopenic ( . ± . years, p = . ) and sarcopenic individuals ( . ± . years, p = . ) were significantly older compared to normal individuals ( . ± . years). there were no significant differences observed in gender, comorbidities, adl function, cognitive function, depressive symptoms and vitamin d levels between the groups (table ) . we included individuals (mean age . ± . years) in this study. twenty-seven ( . %) were osteosarcopenic, ( . %) were sarcopenic, ( . %) were osteoporotic and ( . %) were normal (neither osteosarcopenic, sarcopenic nor osteoporotic). a significant difference in age was observed between the four groups (p = . ); post-hoc comparisons with bonferroni correction revealed that osteosarcopenic ( . ± . years, p = . ) and sarcopenic individuals ( . ± . years, p = . ) were significantly older compared to normal individuals ( . ± . years). there were no significant differences observed in gender, comorbidities, adl function, cognitive function, depressive symptoms and vitamin d levels between the groups (table ) . there was a statistically significant difference in frailty score between the four groups (p < . ). post hoc analyses with bonferonni correction revealed that frailty score was significantly higher in participants with osteosarcopenia ( . ± . , p < . ) and sarcopenia ( . ± . , p < . ) compared to those who were normal ( . ± . ). there were no differences in frailty score between osteoporotic-only and normal individuals. there were also no differences in frailty score between osteosarcopenic and sarcopenic individuals (table ) . in a multiple linear regression model adjusted for age, gender and ethnicity, sarcopenia (β = . , % ci . - . , p < . ) and osteosarcopenia (β = . , % ci . - . , p < . ) were associated with frailty, but not osteoporosis (β = − . , % ci − . - . , p = . ) ( table ). there were statistically significant differences in total mna score, bmi, wc, mac and cc between the four groups. mna total score was significantly lower in osteosarcopenic ( . ± . ) compared to normal individuals ( . ± . , p = . ). in the whole cohort, using established cutoffs for mna total score, there were no individuals classified as malnourished, ( . %) were classified as "at risk" of malnutrition, and ( . %) were classified as normal. there were no significant differences in mna categories between the four groups. bmi was significantly lower in osteosarcopenic ( . ± . kg/m , p = . ), sarcopenic ( . ± . kg/m , p = . ) and osteoporotic individuals ( . ± . kg/m , p = . ) compared to normal individuals ( . ± . kg/m ). wc and mac were also lower in osteosarcopenic compared to normal individuals (wc: . ± . cm versus . ± . cm, p = . ; mac: . ± . cm versus . ± . cm, p < . ). cc was also significantly lower in osteosarcopenic ( . ± . cm, p < . ) and sarcopenic individuals ( . ± . cm, p < . ) compared to normal individuals ( . ± . cm) ( table ) . osteosarcopenia was significantly associated with total mna score, bmi, cc, wc and mac in multiple linear regression models, unadjusted and adjusted for age, gender and ethnicity. the coefficients observed were of a greater magnitude for individuals with osteosarcopenia, compared to individuals with osteoporosis or sarcopenia alone (table ) . in the multicategorical mediation model, there were significant relationships between osteoporosis (a coefficient (se) = − . ( . ), p = . ), sarcopenia (a coefficient (se) = − . ( . ), p = . ) and osteosarcopenia (a coefficient (se) = − . ( . ), p = . ) with total mna scores. the mediating variable, total mna score, was significantly related to total frailty score (b coefficient (se) = − . ( . ), p = . ). bootstrapping revealed significant relative indirect effects for osteoporosis (estimate = . , bootstrap % ci . - . ), sarcopenia (estimate = . , bootstrap % ci . - . ) and osteosarcopenia (estimate = . , bootstrap % ci . - . ), indicating that nutrition mediated the association between osteoporosis, sarcopenia and osteosarcopenia, relative to normal individuals. the proportion of the total effect, mediated by nutrition, is % (table ). our study demonstrated that in relatively healthy community-dwelling older adults, osteosarcopenia is present in . % of individuals and is associated with markers of nutrition, including lower mna scores, bmi, calf, mid-arm and waist circumference. in the association between osteosarcopenia, sarcopenia and osteoporosis with frailty, we observed a mediating effect of nutrition, which was stronger in osteosarcopenic individuals compared to individuals with sarcopenia or osteoporosis alone. the prevalence of osteosarcopenia in our study lies within previous estimates in asian populations, which ranges from . % [ ] to . % [ ] . in contrast, in individuals attending falls clinics or with osteoporotic fractures, prevalence estimates are substantially higher, ranging up to % [ ] . these differences in the population studied may account for inconsistent associations between osteosarcopenia and negative outcomes. in our cohort of relatively younger, independent community-dwelling individuals, we found a significant association between sarcopenia and frailty, with and without concomitant osteoporosis. both sarcopenia and osteoporosis contribute to frailty through common pathways, including chronic inflammation, which exacerbates muscle [ ] and bone loss [ ] . mechanisms include the accumulation and altered distribution of body fat into intra-and intermuscular adipose tissue [ ] , altering lipid metabolism and promoting the accumulation of macrophages and other immune cells, and increasing the secretion of proinflammatory cytokines [ ] . together, these contribute to a state of chronic, low-grade inflammation favoring the development and progression of sarcopenia. similarly, in older women, higher levels of inflammatory markers (soluble interleukin- , tumor necrosis factor receptors and ) were associated with increased risk of hip fractures, and this association was mediated by bmd [ ] , further supporting the role of inflammation in both sarcopenia and osteoporosis. metabolic and hormonal pathways, particularly in the growth hormone (gh)/insulin-like growth factor- (igf- ) axis, are essential for metabolic regulation of bone and muscle mass, with the decline in gh and igf- levels associated with both osteoporosis and sarcopenia [ ] . the dysregulation of this pathway with ageing may also play a role in the pathogenesis of frailty [ ] , with a study showing an independent association of low levels of igf- with pre-frailty and frailty [ ] . nevertheless, we did not find any associations between osteoporosis alone and frailty. furthermore, the strength of the association between osteosarcopenia and frailty was also similar to that of sarcopenia and frailty, highlighting the relative importance of interventions to improve muscle health in this cohort to mitigate frailty. the present study reveals an association between osteosarcopenia, sarcopenia and osteoporosis with markers of nutritional status, with poorer nutritional status observed with osteosarcopenia, compared to isolated sarcopenia and osteoporosis. these findings are consistent with a previous study of geriatric inpatients [ ] and individuals attending a falls and fractures clinic [ ] . our finding that nutrition mediates the association between osteosarcopenia and frailty further underscores the crucial role of nutrition in the development of frailty in at-risk individuals with osteosarcopenia. specifically, loss of muscle mass and increased risk of osteoporosis are associated with caloric deficit, protein and vitamin d deficiency, which in turn are modifiable nutritional risk factors for frailty [ ] . thus, our findings further provide the impetus for nutritional assessment and early supplementation in osteosarcopenia to ameliorate the detrimental effects of frailty. however, in this cohort, the proportion of the total effect mediated by nutrition is small, suggesting that other mechanisms, such as physical activity or social factors [ ] , are also important to prevent the development of frailty. in our cohort of relatively healthy, independent, community-dwelling older adults, there were no individuals classified as malnourished using established cutoffs on the mna total score. items in the mna also overlap with components included in definitions of sarcopenia and frailty, although the effect of the potential "circularity" is likely to be limited, as the r values in the unadjusted regression models for bmi, cc and mac are not large. despite these observations, our results still demonstrate the associations between osteosarcopenia, malnutrition and frailty, albeit with malnutrition having only a small mediating effect on this association. a possible explanation is that the mna does not provide accurate quantification of protein, caloric and micronutrient intake relevant to bone and muscle health, but instead provides a global assessment of malnutrition risk. this suggests that in independent community-dwelling older adults presenting upstream of the spectrum of frailty, developing nutritional screening tools which are more sensitive to milder degrees of malnutrition (e.g., detection of anorexia as a forward indicator of malnutrition) [ ] , or with components specific to bone and muscle health may better identify individuals at risk of osteosarcopenia, and subsequent development of frailty. the strengths of this study include the analysis of a reasonably-sized cohort of independent community-dwelling older adults, the use of contemporary consensus definitions for sarcopenia in an asian population, and comprehensive evaluation of nutritional status. to our knowledge, this is the first study to use mediation analysis to explicate nutrition as a mechanism underlying the link between osteosarcopenia and frailty. weaknesses include the cross-sectional nature of this study, which preclude definitive conclusions about causality. the proposed pathway is also exploratory and not exhaustive, and needs to be corroborated in well-designed longitudinal studies. the possibility of residual confounding factors, such as physical activity, which was not measured in this study, also exists. lastly, we are unable to generalize our results to other older, frailer populations. in summary, the present study showed that sarcopenia, with and without osteoporosis, is associated with increased frailty, and that nutrition mediates the association between osteosarcopenia and frailty. these findings are salient to older adults living amidst the covid- pandemic, as the need for physical distancing and social isolation may adversely impact nutritional status [ ] . taken together, our results support the need for early identification and interventions for malnutrition in at-risk older adults with osteosarcopenia to prevent the downstream cascade of frailty and disability. the joint occurrence of osteoporosis and sarcopenia (osteosarcopenia): definitions and characteristics osteosarcopenia in patients with hip fracture is related with high mortality does combined osteopenia/osteoporosis and sarcopenia confer greater risk of falls and fracture than either condition alone in older men? the concord health and ageing in men project prospective associations of osteosarcopenia and osteodynapenia with incident fracture and mortality over years in community-dwelling older adults do sarcopenia and/or osteoporosis increase the risk of frailty? a -year observation of the second and third road study surveys severe osteopenia and osteoporosis, sarcopenia, and frailty status in community-dwelling older women: results from the women's health and aging study (whas) ii osteoporosis and sarcopenia increase frailty syndrome in the elderly malnutrition in the elderly and its effects on bone health-a review dietary strategies for mitigating osteosarcopenia in older adults: a narrative review influence of obesity on diagnostic accuracy and optimal cutoffs for sarcopenia screening in non-frail older adults: a comparison of sarc-f versus sarc-calf a simple frailty questionnaire (frail) predicts outcomes in middle aged african americans diagnostic performance of two mental status tests in the older chinese: influence of education and age on cut-off values functional evaluation: the barthel index assessment of older people: self-maintaining and instrumental activities of daily living development and validation of a geriatric depression screening scale: a preliminary report assessment of fracture risk and its application to screening for postmenopausal osteoporosis: synopsis of a who report asian working group for sarcopenia: consensus update on sarcopenia diagnosis and treatment letter to the editor: normative data of handgrip strength in older adults-a pooled dataset from eight cohorts in asia frailty in older adults: evidence for a phenotype serum myostatin and igf- as gender-specific biomarkers of frailty and low muscle mass in community-dwelling older adults the frenchay activities index. assessment of functional status in stroke patients the mini nutritional assessment (mna) and its use in grading the nutritional state of elderly patients statistical mediation analysis with a multicategorical independent variable is osteoporosis a predictor for future sarcopenia or vice versa? four-year observations between the second and third road study surveys risk factors predicting osteosarcopenia in postmenopausal women with osteoporosis: a retrospective study sarcopenia and osteoporosis in older people: a systematic review and meta-analysis higher inflammatory marker levels in older persons: associations with -year change in muscle mass and muscle strength osteoporosis, inflammation and ageing inter-muscular adipose tissue is associated with adipose tissue inflammation and poorer functional performance in central adiposity sarcopenic obesity or obese sarcopenia: a cross talk between age-associated adipose tissue and skeletal muscle inflammation as a main mechanism of the pathogenesis study of osteoporotic fractures (sof) research group. inflammatory markers and risk of hip fracture in older white women: the study of osteoporotic fractures the gh/igf axis and signaling pathways in the muscle and bone: mechanisms underlying age-related skeletal muscle wasting and osteoporosis association between insulin-like growth factor- and frailty among older adults sarcopenia and osteoporosis are interrelated in geriatric inpatients comprehensive nutritional status in sarco-osteoporotic older fallers the role of nutrition and physical activity in frailty: a review social frailty is independently associated with mood, nutrition, physical performance, and physical activity: insights from a theory-guided approach the simplified nutritional appetite questionnaire (snaq) as a screening tool for risk of malnutrition: optimal cutoff, factor structure, and validation in healthy community-dwelling older adults covid- and older people in asia: asian working group for sarcopenia calls to actions we would like to thank all the participants of this study. the authors declare no conflict of interest. key: cord- -pp q y authors: alkhatib, ahmad title: antiviral functional foods and exercise lifestyle prevention of coronavirus date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: pp q y novel coronavirus (covid- ) is causing global mortality and lockdown burdens. a compromised immune system is a known risk factor for all viral influenza infections. functional foods optimize the immune system capacity to prevent and control pathogenic viral infections, while physical activity augments such protective benefits. exercise enhances innate and adaptive immune systems through acute, transient, and long-term adaptations to physical activity in a dose-response relationship. functional foods prevention of non-communicable disease can be translated into protecting against respiratory viral infections and covid- . functional foods and nutraceuticals within popular diets contain immune-boosting nutraceuticals, polyphenols, terpenoids, flavonoids, alkaloids, sterols, pigments, unsaturated fatty-acids, micronutrient vitamins and minerals, including vitamin a, b , b , c, d, e, and folate, and trace elements, including zinc, iron, selenium, magnesium, and copper. foods with antiviral properties include fruits, vegetables, fermented foods and probiotics, olive oil, fish, nuts and seeds, herbs, roots, fungi, amino acids, peptides, and cyclotides. regular moderate exercise may contribute to reduce viral risk and enhance sleep quality during quarantine, in combination with appropriate dietary habits and functional foods. lifestyle and appropriate nutrition with functional compounds may offer further antiviral approaches for public health. viral infections are responsible for significant global morbidity and mortality rates across the world, and viral outbreaks such as novel coronavirus (covid- ) [ ] . reports from the world health organization (who) estimate - million hospitalized cases of seasonal influenza severe illness, resulting in , - , annual deaths [ ] . currently, covid- is causing a health crisis across the world. limiting the spread of infections in the short and medium terms involves a number of preventative public health practices including regular hand washing, covering coughs, lockdown, and social distancing measures. vaccines have been implemented for preventing and controlling several viruses over the past century and have also been used for preventing common influenza [ , ] . however, influenza vaccine development takes a significant amount of time [ ] , which necessitates alternative complementary remedies for covid- . furthermore, antiviral medication treatments face continuous challenges in terms of drug dose and selection and intervention phase, especially during acute respiratory infections [ ] . lifestyle approaches could play an essential antiviral long-term preventative role. the antiviral role of nutrition and exercise as the two lifestyle prevention pillars has received little research attention. in particular, how the antiviral immunological defence capacity could be enhanced using functional foods, nutraceuticals, and physical activity behaviors, whether such behaviors are alone or combined. functional foods and nutraceuticals can be safe and cost-effective strategies to enhance the immune system and provide protection from pathogenic viral infections. for example, optimal intake of selected micronutrients has been highlighted in controlling the impact of virulent strain infections, including lower and upper respiratory tract infections, through optimizing a well-functioning immune system [ ] . on the other hand, the role of physical activity and exercise in enhancing the immune system is well established [ ] . nutrition and lifestyle modifications may not be definitive measures to absolutely prevent persons from contracting covid- when exposed. however, they could help as an adjuvant therapy to reduce the risk through enhanced immunity. this review presents key evidence on how functional foods and lifestyle approaches, including physical activity, effective for cardiometabolic disease prevention outcomes [ ] , can also optimize the immune system response to viral infection, especially respiratory tract infections and covid- . the review also makes specific and practical evidence-based recommendations for the use of antiviral functional foods and lifestyle approaches. in terms of physical activity prevention of chronic disease morbidity and mortality risks, a dose response relationship is well established for non-communicable disease (ncd) prevention [ ] . exercise induces cardiovascular, respiratory, and metabolic adaptations, which result in higher maximal oxygen uptake ( . v o max ), carbon dioxide production, minute ventilation, breathing frequency, stroke volume, and cardiac output [ ] . improvement in whole-body cardiometabolic and respiratory functions boosts the immune system defence through several acute and long-term mechanisms, which have been well highlighted recently [ , ] . however, less is reported about how such exercise-dependent mechanisms protect against communicable diseases (cds), especially viral infections such as influenza and the recent covid- outbreak. exercise impacts all immune cells within both innate and adaptive immune systems, particularly elevating the activity of natural killer (nk) cells, neutrophils, and macrophages following moderate exercise (less than % of . v o max ) [ ] . for example, acute aerobic exercise (running, cycling) have been shown to increase monocyte number [ ] . monocytes play an integral antiviral role, and it has been shown that in a variety of influenza a viruses (including the circulating swine-origin virus, similar to covid-type viruses), exercise induces monocytes to differentiate within hours into cd (-)cd (+) mature dendritic cells with enhanced capacity to activate t-cells [ ] . long-term moderate exercise training increases the expression of t-helper (th) cells and associated th balances [ ] . enhanced t-cell proliferation was particularly found following prolonged moderate exercise training in high-risk populations such as postmenopausal women cancer survivors and the very old. an increase in t-cell proliferation (by per dpm × cells) has been found in post-menopausal breast cancer survivors who exercised for - min for weeks at % and % of . v o max [ ] , while increased cd + t-cells were also found in older adults aged years, walking km per day [ ] . those high-risk groups have been found to be particularly vulnerable to viral infections and more serious symptoms as reflected by recent governmental advice regarding covid- [ , ] . exploring the exercise role in protecting and controlling covid- and other novel viral infections is essential. severe exercise intensity, whether acute or chronic, can be counter-productive in terms of the susceptibility to infections, since it is linked with higher upper respiratory tract infection rates among elite endurance athletes [ , ] . mucosal immunology antibodies such as salivary immunoglobulin a (iga), and immunoglobin m (igm) concentrations have been shown to decline immediately after a bout of intense exercise in elite swimmers, but usually recover within h [ ] . however, modulating the intensity and duration of exercise can optimize the immune system response outcomes acutely and chronically [ , ] . higher exercise intensities (above % . v o max ) and supramaximal exercise ( % or above) induce a transient oxidative stress and muscle damage response of oxidative stress, cell integrity, and homeostasis biomarkers, especially during the first hour post exercise [ , ] . both young and older adults have shown an increase in recombinant interleukin- (ril- ) stimulation of nk cells immediately ( min) following an acute intense bout of maximal cycling exercise [ ] . when followed for days, it was found that neutrophil mobilization was concurrent with enzyme efflux, particularly those related to cell damage such as creatine kinase (ck) and antioxidative capacity such as superoxide dismutase (sod) [ ] . acute repeated exercise bouts have also been implicated in the removal and regeneration of aged immune cells, especially cell senescent naïve, memory cd + and cd + t-lymphocytes, and an elevated apoptotic lymphocyte in peripheral blood [ ] . the immunological transient response includes a temporal stress (e.g., disturbance of cell homeostasis and oxidative stress) induced by an acute exercise challenge, and may play a role in long-term enhanced immune system, especially when exercise is repeated chronically (i.e., exercise training). these entropic exercise-induced effects on the immune system may act as a natural vaccine against viral infections such as covid- . in fact, eccentric exercise has already been demonstrated to act as an adjuvant to influenza vaccination in humans [ ] . the trial randomized healthy men and women who performed upper body eccentric exercise (deltoid and biceps brachii muscles) hours prior to receiving influenza vaccination, and were monitored for antibody titers up to weeks. the results showed that interferon-gamma responses were enhanced by exercise in men, whereas antibody titres were enhanced in women, which were concurrent with improved arm circumference (i.e., physical outcome benefit). the interferon-gamma response was positively associated with the percentage increase in arm circumference. the study suggested that eccentric exercise of the muscle at the site of vaccine administration could act as a behavioral adjuvant to vaccination. therefore, exercise immunological benefits alone or as an adjuvant antiviral treatment should be further investigated for preventing and controlling covid- . the immune function response to exercise is influenced by several factors including nutritional status, body weight, hygiene, and mental health. the immune function is known to be superior in highly conditioned versus sedentary individuals. sedentary lifestyle and insufficient physical activity levels induce several physiological impairments, which reflect reduced cardiovascular and respiratory capacity, obesity, and associated cardiometabolic chronic diseases [ , ] . consequences of sedentary lifestyle and physical inactivity include a compromised immune system due to manifestation of systemic inflammation, oxidative stress, and associated immunosuppressive mechanisms [ , ] . prevalence of sedentary behavior and low physical activity levels have been reported in those with obesity, diabetes, and underlying insulin resistance and oxidative stress, and have been linked with increased susceptibility to contracting viral infections, including pandemic influenzas such as h n and covid- [ ] . conversely, higher physical activity and fitness levels in adults are associated with an optimized immunity indicated by reduced white blood cell count, c-reactive protein (crp), interleukins (il- , and il- ), tumor necrosis factor alpha (tnf-α), and other inflammatory biomarkers [ ] . therefore, any physical activity or exercise dose is considered beneficial compared to being sedentary, especially during and after covid- -related lockdown, social distancing, or quarantine measures introduced in several countries. moderate exercise intensity is recommended, especially during and after a social distancing lockdown, which requires an avoidance of severe intensities. a practical method of achieving moderate exercise intensity is using - % of maximum heart rate (hr max = -age). exercising at home, especially to perform resistance type activities using own body weight, and to interrupt sedentary behavior by reducing sitting times are particularly recommended for older and high-risk individuals with chronic conditions such as diabetes [ , ] . exercise at home is also suited for the avoidance of the airborne coronavirus, especially during quarantine, and may include strengthening, balance and control, stretching, or a combination of these (walking, lifting and carrying, lunges, stair climbing, stand-to-sit and sit-to-stand using house items, squats, sit-ups, yoga) [ ] . a volume increase in weekly exercise is recommended under the covid- quarantine from min to - min aerobic exercise distributed across - days, with at least - resistance sessions, to compensate for the decreased mobility during lockdown [ ] . this results in achieving an increase in . v o max as a practical aim. enhanced . v o max is particularly important for those who are considered at high-risk of covid- such as those who are overweight or those with obesity, insulin resistance, and diabetes, who typically have chronic low-grade inflammation characterized by increased levels of several pro-inflammatory cytokines and the inflammasome, and who are predisposed to greater risks for infection along with more adverse outcomes [ ] . it is recommended that exercise is performed as part of a multicomponent personalized lifestyle approach (personalized nutrition, exercise intensities, technology, behavior, mental wellbeing) especially for high-risk individuals such as those with diabetes [ ] . functional foods naturally possess active ingredients or "nutraceuticals" that are associated with disease preventative health benefits are now widely accepted for the prevention and management of major ncds, especially those characterized by inflammatory and oxidative stress disorders such as diabetes and cardiovascular disease [ , ] . however, less is known about the role of functional foods in communicable diseases (cds), especially on the immune system defence against viral infections such as covid- . a variety of fruits, vegetables, oily fish, olive oil, nuts, legumes are all considered functional foods based on their natural contents of nutraceuticals, including polyphenols, terpenoids, flavonoids, alkaloids, sterols, pigments, and unsaturated fatty acids [ , ] . polyphenol-rich herbs, especially coffee, differently fermented teas (green, black)and yerba maté, have also shown to have various effectiveness on metabolic and microvascular activities, cholesterol and fasting glucose lowering, anti-inflammation and anti-oxidation in high-risk populations [ , ] . bioactive peptides, naturally present in food proteins or formulated as nutraceuticals based on their molecular weight, amino acid chain length, or peptide composition, have also been postulated to elicit versatile physiological responses associated with immunological, antimicrobial, cardiovascular, gastrointestinal, neurological, and other hormonal activities of the human system [ ] . such functional food benefits can be translated to protect against viral infections and covid- . viral infections are characterized by a compromised immune function and deficient micronutrient stores, particularly vitamins, including vitamins a, b , b , c, d, e, and folate, and trace elements, including zinc, iron, selenium, magnesium, and copper [ ] . evidence already supports an efficient function of the immune system through consuming those various nutraceuticals within a variety of functional foods including essential fatty acids, linoleic acids, essential amino acids, and the aforementioned vitamins and minerals, especially where forms of immunity may be affected by deficiencies in one or more of these nutraceuticals [ , ] . adequate dietary intake, and supplementation of such functional foods, contribute to maintaining optimal levels in the human body, which enhances several aspects of the immune system [ , ] , and provides an important antiviral prevention of covid- [ ] . conversely, less robust immune responses have been shown to be the primary risk factor for covid- [ ] , which makes it timely to describe the protective role of functional food component benefits in the context of preventing covid- and seasonal infections. in terms of jointly addressing ncd and cd prevention within high-risk populations, investigating the functional foods effects on cds including covid- is particularly important. higher infection and mortality rates related to covid- have been documented among older adults and patients with obesity, cardiac diseases, hypertension, or diabetes [ ] . for example, covid- statistics in england showed that almost a third ( . %) of covid- -related mortalities had type- diabetes [ ] , while there was a two-fold increase ( %) in requiring mechanical ventilation among covid- infected obese individuals compared with ( %) of infected healthy weight individuals [ ] . the prevalence of ncds, especially diabetes amongst high-risk groups, is becoming a matter of emerging importance, and diabetes is now considered a risk factor for the progression and prognosis of covid- [ , ] . therefore, optimal "immune-enhancing" functional foods combined with behavioral lifestyle approaches (especially exercise) could provide an optimal prevention of the double burdens of ncd and cd multimorbidity. various dietary patterns contain functional food components that have been promoted in the past for ncd prevention, especially the vegetarian diet, the nordic diet, or the mediterranean diet (md), and its combination with other lifestyle approaches [ , , , ] . common functional foods within those diets include plant-based fruit and vegetables such as olive oil and tree nuts, seeds, fish, dairy products, and herbs, teas, and fermented products, which contain key nutraceuticals with disease protective anti-inflammatory and anti-oxidation properties [ , , ] . established health protective functional components include monounsaturated fatty acids (mufa) such as oleic acid in olive oil, omega- polyunsaturated fatty acids (e.g., alpha-linolenic acid) found in tree nuts such as walnuts, eicosapentaenoic acid (epa), and docosahexaenoic acid (dha) found in oily fish, high amounts of polyphenol flavonoids and antioxidants found in fruit and vegetables, and high amounts of fiber found mainly in cereal and whole-grain foods [ ] . consuming those functional foods, and their components vary across geographical global regions [ , , , [ ] [ ] [ ] , but what is agreed on is their cardiometabolic protective benefits of reducing major ncds and mortality risks [ , , ] . the challenge is to translate such functional effects towards enhancing and protecting the immune system and its antiviral defence response into the prevention of emerging cds such as covid- . enhancing the antiviral immune defence can benefit from the functional food intake of a considerable variety of plant, animal, and fungi species, consumed across different diets and cultural practices including traditional herbal medicine such as teas, roots, mushrooms, and fermented plants and leaves; md components such as olive-based products, oily fish, seeds, fruits, and vegetables; popular beverages such as coffee; and protein-rich foods such as chicken extract and soybean peptides. the majority of such foods contain naturally occurring vitamins and minerals (e.g., vitamins c, d, b , b , a, e, and minerals of zinc, copper, iron, and selenium), and other phenolic compounds that are immunoprotective particularly through antioxidation and anti-inflammation properties [ , ] . other foods such as oily fish omega- fatty acids contain monounsaturated fatty acids such as omega- fatty acids (epa and dha) in oily fish, which can be enzymatically converted to specialized pro-resolving mediators (spms) known as resolvins, protectins, and maresins, which are molecules that support inflammatory resolution and healing of infected sites including the respiratory tract, which could prevent acute lung injury [ ] . fermented food products (e.g., yoghurt, pickles, fermented fruits, vegetables, plant, and drinks) contain probiotics, and have also been shown to enhance gut bacteria profile and gut-lung axis-related respiratory fitness [ , ] . a summary of systematic reviews and randomized controlled trials reported reduced incidence and severity of upper and lower respiratory tract infections (odds ratio ∼ . - . ) by using different probiotics, especially lactobacilli and bifidobacteria [ ] . the efficacy of probiotics in reducing covid- infected patients has not yet been established, but the prophylactic benefits for enhancing the immune system are supportive of their long term use [ ] , especially considering that improving gut microbiota profile has been recently implicated in preventing covid- in older and high-risk individuals with compromised immune systems [ ] . selected food supplements and micronutrient vitamins and trace elements have been reviewed elsewhere in terms of optimizing the immune responses [ , , ] . other reviews have highlighted the importance of key vitamins (e.g., vitamin d) for regulating sleep patterns during quarantine or lockdown measures [ ] [ ] [ ] . given the promising role of popular functional foods, such as those within the md including olive oil, and asian and african herbal teas and fermented foods and popular beverages as part of lifestyle disease prevention [ , ] , it is important to contextualize the antiviral mechanisms of such functional foods. below is a review of popular foods within various dietary patterns, including olive oil nutraceuticals, popular vitamins such as vitamin d, traditional medicinal herbs and roots, and protein peptides for preventing viral infections including covid- , especially when they are adopted as part of an active lifestyle. olive oil (oo), and its constituents (leaves and bark), form an important immune-enhancing functional food due to the significant ncd preventative benefits, especially of cardiovascular disease, diabetes, and cancer, which have been reviewed elsewhere [ , ] . oo, especially extra-virgin oo (evoo) contains monounsaturated fatty acids, and several polyphenols including oleuropein and hydroxytyrosol, which have several antioxidative and anti-inflammatory properties, which can be linked with significant antiviral and antibacterial potential. oleuropein has shown a potential antiviral activity against respiratory syncytial virus (rsv), a common upper respiratory infection (uri) virus [ ] . this effect has been attributed to the antioxidative property of elenolic acid as a main fragment in oleuropein, which has long been shown to have potent antiviral activities against herpes, influenza a and b, and parainfluenza , , and viruses [ ] . antioxidant capacity of oo was later shown to be independent of the size of the antiviral effect, with oleuropein showing superior antiviral effects compared with other secoiridoid glucosides isolated from ligustrum lucidum [ ] . however, antioxidant properties can vary among oo phenolics. a more recent study by paiva-martins et al. ( ) [ ] compared the capacity of four important oo phenolic compounds, oleuropein, hydroxytyrosol, and the oleuropein aglycones , -dihydroxyphenylethanol-elenolic acid ( , -dhpea-ea) and , -ihydroxyphenylethanol-elenolic acid dialdehyde ( , -dhpea-eda) for their protection of red blood cells (rbcs) from oxidative haemolysis induced by the physiological initiator h o . the study tested the amount of haemolysis by spectrophotometry, and the compounds were also tested in the presence and absence of the naturally occurring antioxidant ascorbic acid. all compounds were revealed to significantly protect rbcs from oxidative haemolysis induced by h o at and µm, with the order of activity being , -dhpea-eda> , -dhpea-ea>hydroxytyrosol=oleuropein. however, at , , and µm, only , -dhpea-eda showed a significant protection against the oxidative injury, suggesting that , -dhpea-eda plays an important protective role against reactive oxygen species-induced oxidative injury in rbcs, and this effect is more potent than the one evidenced by hydroxytyrosol or oleuropein. the antioxidation protective benefits of oo, especially evoo, which has a higher phenolic content [ ] promotes its role for enhancing the immune system defence against viruses. hydroxytyrosol antiviral mechanisms were showed through its inactivation effects on influenza a viruses, especially during the virus morphological changes, such as the presence of a viral envelope which is an integral membrane protein involved in several aspects of the virus life cycle including its assembly, budding, and pathogenesis [ ] . the mechanisms of which oo nutraceuticals protect against viral infections have often focused on the hydroxytyrosol preventative effects on hiv from entering the host cell and binding the catalytic site of the hiv- , and its inhibitory effect on both viral entry and integration [ ] . regular intake of olive leaf extracts, rich in polyphenol flavonoids, have been shown to be responsible for a % reduction in uri [ ] . such promising antiviral potential was attributed to the following antioxidation actions of oleuropein with dose-dependent inhibition of the copper sulphate-induced oxidation of low-density lipoproteins (ldls), and induced increase in nitric oxide production in macrophages and functional activity. in another study among high-school athletes who were prone to uri, olive leaf extract supplementation ( g, containing mg oleuropein) was shown to reduce the duration of infection ( % reduction in sick days) but not the incidence rate [ ] . thus, olive polyphenols (both in oo and leaf), especially oleuropein and hydroxytyrosol, seem to promote antiviral defence and can be an adjacent prevention to control uris. exploring oo mechanisms for protecting against novel viruses such as covid- , especially its protein viral envelop function and interaction with host cells would also be important. the benefits of oo intake, especially as part of a balanced diet such as the md can be further augmented via physical activity, especially strength and resistance type exercise [ ] . such an approach is likely to be an effective prevention of viral infections. in terms of the recommended oo dose, a moderate dose of - g/day (especially polyphenol-rich evoo) in combination with other dietary functional foods can be recommended for enhancing the immune system, which is in line with recent ncd prevention recommendations [ ] . the role of vitamin d in ameliorating the effects of both ncds and cds is now well accepted. vitamin d reduces acute respiratory tract infection, and its deficiency is linked with susceptibility to viral infections, and also with various cancers, diabetes, and cvd [ , ] . research into the role of vitamin d in preventing covid- and influenza viral infections has gained recent momentum through various reviews and meta-analyses, especially given that individuals who are susceptible to covid- infections are mainly high-risk individuals with various ncds such as diabetes and cvd, suggesting that vitamin d could be the missing link between ncds and viral cds [ , ] . based on the latter [ ] , several mechanisms of how adequate vitamin d availability can reduce the risk of viral infections and covid- through the following mechanisms: (a) lowering viral replication rates through cathelicidins and defensins, and preventing lung injures that lead to pneumonia through its anti-inflammatory cytokines; (b) potential for vitamin d supplementation effectiveness in reducing the risk of influenza especially in deficient individuals; (c) documented reduced risk of covid- during the summer indicated by a lower number of cases in the southern hemisphere, compared with higher number of cases in the winter months when -hydroxyvitamin d ( (oh)d) concentrations are lowest; (d) vitamin d deficiency has been found to contribute to acute respiratory distress syndrome; and that case-fatality rates increase with age and with chronic disease comorbidity, both of which are associated with lower (oh)d concentration. sleep disorders during covid- quarantine could also be ameliorated through maintaining adequate vitamin d levels within the body. this could mainly be done through sun exposure [ ] , and to a smaller extent from dietary intake or supplementation [ ] . vitamin d plays an important role in regulating sleep patterns, circadian rhythm, enhancing sleep quality, and indirectly ameliorating sleep apnea [ ] . for example, vitamin d receptors and the enzymes that control its activation and degradation have been found in brain regions involved in sleep regulation; and vitamin d is also involved in melatonine production pathways, and can affect restless legs syndrome and obstructive sleep apnea syndrome [ ] . the best source of vitamin d is sunshine exposure, but it is abundant in several foods including oily fish, tuna, dairy, and egg yolk. grant et al. ( ) [ ] recommended supplementation in individuals with highest risk of covid- infection or vitamin d deficiency ( , iu/d of vitamin d ) to raise (oh)d concentrations above - ng/ml ( - nmol/l). for treatment of people who become infected with covid- , higher vitamin d doses are recommended. traditional antiviral medicinal therapies across different cultures are essentially based on a combination of several functional foods and nutraceuticals with active immunomodulators, polyphenols, anti-inflammatory, and anti-oxidation components. armeniacae semen (apricot seeds), cinnamomi cortex (chinese cinnamon), glycyrrhizae radix (liquorice root), and ephedrae herba form a japanese traditional medicine called "maoto", which is often administered orally as granules to adults with seasonal influenza [ ] . it has been shown to be well tolerated and associated with equivalent clinical and virological efficacy to neuraminidase inhibitors in helping progeny influenza viruses to leave without re-infecting the host cell [ ] . licorice roots which contain the active component glycyrrhizin, have been shown to inhibit influenza a virus uptake into the cell, and reduced ccid by % [ ] . licorice and curcumin have recently been reviewed for their postulated antiviral potential [ ] . other common traditional herbal remedies for respiratory viruses that have been supported by scientific evidence include berries' extracts, echinacea, clinacanthus siamensis, punica granatum (pomegranate), psidium guajava linn. (guava tea), epimedium koreanum nakai; scutellaria baicalensis georgi (baicalin), and paeonia lactiflora pall. (bai shao) [ ] . examples of their antiviral role include reduction in viral replication, enhancement of anti-influenza virus igg and iga antibody production, improvement of t-cell function (e.g., stimulation of interferon-gamma production by t-cells), neuraminidase inhibitor, virus budding prevention, inhibition of viral rna and viral protein synthesis, viral haemagglutination, viral binding to and penetration into host cells [ ] . fungi are also commonly used in asian and chinese medicine to enhance the immune system. for example, cordyceps militaris is a mushroom traditionally used for diverse pharmaceutical purposes in east asia, including china, for enhancing immunity. in a human study . g/day of cordyceps militaris for weeks enhanced the nk cell activity and lymphocyte proliferation and partially increased th cytokine secretion [ ] . immune enhancing antiviral mechanisms of traditional medicine especially roots and fungi are important preventing and controlling novel influenza viruses, including covid- . promising evidence has been shown about the restorative and antioxidative role of traditional medicinal herbs and peptides post trauma or physical challenges, which may be important in lung injury pathology. for example, the chinese ginseng rg herb has been shown to restore satellite cell depletion following an exercise challenge, through enhancing glutathione (gsh), and gssg [ ] . gsh is considered important in immune modulation, remodeling of the extracellular matrix, apoptosis, and mitochondrial respiration through its gamma-glutamylcysteine synthetase heavy and light subunits oxidant/antioxidant response to phenolic antioxidants, and is considered key to the development of an oxidant/antioxidant imbalance in lung inflammation [ ] . in another study it was shown that anserine, beta-alanyl- -methyl-l-histidine, a dipeptide, replenished the free radical scavenging enzymes sod (superoxide dismutase) and preserved catalase and gsh cofactors, while preserving cell integrity and homeostasis, together with a haematological increase in red blood cell volume-to-concentration and an attenuated white blood cellelevation following muscular challenge in healthy men [ ] . dietary intake of anserine, carnosine dipeptides, and other animal-based amino acids including taurine, creatine, and -hydroxyproline promote the immunological defence of humans against infections by bacteria, fungi, parasites, and viruses (including coronavirus) through enhancing the metabolism and functions of monocytes, macrophages, and other cells of the immune system [ , ] . plant-based peptides from soybean have also been shown to modulate cellular immune systems (increased lymphocytes and granulocytes number, increased cd b(+) cells and cd (+) natural killer cells), regulate neurotransmitters (decreased adrenaline and increased dopamine), and boost brain function [ ] . however, fish, meat, and poultry are the primary sources of immunomodulatory peptides and amino acids, and hence they have long been considered functional foods taken to alleviate fatigue, respiratory, and cold symptoms in older individuals, especially in asia [ , , ] . plant cyclotides are well-studied antivirals, since they can be mimicked for antiviral drug development, given their stable chemical structure [ ] . they have been originally extracted from african tea used in traditional african medicine to accelerate childbirth because of their postulated uteroactive antiviral hiv properties [ ] . the protective mechanisms of plant cyclotides against infections and pathogens are postulated through preventing malfunctioning of the immune cells by growth-inhibiting growth effects on the human immune system especially on lymphocytes (e.g., t-cells), which can cause an over-reactivity of this defence machinery during infections [ ] . cyclotides can be obtained from various plants including violaceae and rubiaceae, but are abundant in several other plant families, especially cucurbitaceae (e.g., squash, pumpkin, zucchini), fabaceae (legumes, peas, beans), and solanaceae (eggplant, tomato, potato, pepper). therefore, it is likely that consumption of such foods, especially seasonal intake plays a protective role in enhancing the immune system and enhances antiviral defence mechanisms. coffee, caffeine, and naturally caffeinated beverages are well known to induce various health benefits and prevention of disease. all forms of coffee consumption (differently roast beans, fermented or non-fermented leaves) are common across various cultures across the world for centuries [ , ] . epidemiological evidence suggests that consuming - cups of coffee daily is associated with reduced incidence of metabolic diseases which are often concurrent with a compromised immune system such as diabetes [ , ] . therefore, it is plausible to imply a positive role for caffeine as a useful immunomodulator. nutraceuticals within coffee have shown different antiviral outcomes, with caffeic acid inhibiting the multiplication of influenza a virus in vitro, whereas caffeine, quinic acid, and chlorogenic acid do not [ ] . caffeic acid has also been shown to have antiviral activity against herpes simplex virus (dna virus) and polio virus (rna virus), and to decrease the progeny virus yield (especially within h post-infection) and suppresses the degeneration of the virus-infected cells [ , ] . however, caffeine reported immuno-protective mechanisms from laboratory in vivo and in vitro trials have been equivocal [ , ] . positive caffeine effects on innate immunity involve suppression of neutrophil and monocyte chemotaxis, and pro-inflammatory cytokines (such as tnf-α) from human blood, but caffeine has also been reported to suppress antibody production and human lymphocyte function as indicated by reduced t-cell proliferation and impaired production of th (il- and interferon-gamma), th (il- , il- ), and th (il- ) cytokines [ ] . some of the immunomodulatory actions of caffeine have been explained by its inhibitions of cyclic adenosine monophosphate (camp)-phosphodiesterase, and consequential increase in intracellular camp concentrations [ ] . however, recent in vitro evidence suggests that caffeine may suppress endotoxins lipopolysaccharide (lps)-induced inflammatory responses by regulating nuclear factor nf-κb activation and mapk phosphorylation [ ] . lps activation of nf-κb triggers mucin transcriptors (e.g., muc gene) and respiratory tract mucus in response to respiratory pathogens including influenza viruses [ ] . caffeine suppression of lps has also been reported in a recent human study in females with obesity [ ] . the latter study also found that caffeine ameliorates the obesity-induced metabolic side-effects following intense exercise lifestyle intervention including elevated lps, insulin action, glucose homeostasis, and androgen levels. this suggests that caffeine optimizes the metabolic and immunoprotective benefits when combined with other lifestyle components, especially exercise. future research is needed to determine caffeine antiviral effects for the prevention and management of covid- . exercise and physical activity enhance the immune system and reduce susceptibility to infections, especially respiratory infections including covid- . moderate intensity exercise can be adopted by the large population including high-risk groups with ncds such as those with diabetes and cardiovascular disease. functional foods may provide a further effective diverse antiviral approach and could have a joint prevention of both ncds and cds among diverse populations. dietary intake of foods rich in vitamins and minerals can be increased to provide an immune boost, especially in individuals with deficiency in these micronutrients. increased intake of probiotics, omega- from fish, protein peptides from chicken and fish, and olive-based products are also recommended (table , figure ). there is no specific model to follow to enhance the immune system against covid- . however, the more varied the dietary sources, the better the protection is against all viral infections. adopting exercise together with an enhanced dietary intake of functional compounds may contribute as a preventative medicine against emerging viral infections. promote antioxidation and anti-inflammation properties, protect the respiratory system, and reduce risks of infection and re-infection [ ] . cyclotides protect against infections and pathogens by preventing malfunctioning of the immune cells (t-cell lymphocytes), which reduces over-reactivity of this defence machinery during infections [ ] . intake is highly recommended as part of a balanced diet. complements an active lifestyle, supports circadian rhythm, and sleep quality dairy products vitamins d, a, & e vitamin d reduces the risk of contracting respiratory infections and covid- [ , ] . lowers viral replication rates through cathelicidins and defensins, and prevents lung injures that lead to pneumonia through anti-inflammatory cytokines [ ] . dietary intake is preferred. supplements (zinc, selenium, and vitamin d) are recommended in older adults and the most deficient. enhances sleep quality. seeds and nuts zinc, selenium, copper, trace minerals contain phenolic compounds that are immunoprotective particularly through antioxidative and anti-inflammatory properties in high-risk adults [ ] . supplementation is recommended when dietary intake is low, especially in older and high-risk individuals support inflammatory resolution and healing of infected sites including the respiratory tract, which could prevent acute lung injury, mainly through pro-resolving mediators (spms) such as resolvins, protectins, and maresins [ ] . increased intake is recommended in high-risk individuals protein rich foods (e.g., red meat, chicken, seafood) amino acids and peptides: anserine, carnosine, taurine, creatine, and -hydroxyproline, vitamins, iron, copper dietary intake of anserine and carnosine promote immunological defence against infections by bacteria, fungi, parasites, and viruses (and coronavirus) through enhanced immune cell functions of monocytes and macrophages [ , ] . plant peptides (e.g., soybean) increase lymphocytes and granulocytes; enhance natural killer activity [ ] . dietary intake is sufficient, but an increased intake is recommended in high-risk individuals and infected patients. can be obtained from both animal and plant sources. olive based products (olive oil, olive leaves) oleuropein, hydroxytyrosol, elenolic acid, vitamin e reduced upper respiratory infection attributed to antioxidative property of oleanolic acid in oleuropein, especially influenza a and b, parainfluenza , , and viruses, and herpes [ ] . dietary intake ( - g/day), especially from extra-virgin olive oil, which is high in polyphenol content. increase benefits with physical activity. coffee (coffee leaves, differently fermented) caffeic acid, caffeine, polyphenols, chlorogenic acid caffeic acid decreases the progeny virus yield (especially within h post-infection) and suppresses the degeneration of the virus-infected cells; caffeine can suppress of neutrophil and monocyte chemotaxis, and pro-inflammatory cytokines (e.g., tnf-α) [ ] . it suppresses endotoxins lps-induced inflammatory responses (regulates nf-κb activation and mapk phosphorylation) [ ] , and prevents mucosal response to pathogens infecting the respiratory tract and influenza viruses [ ] . coffee intake ( - cups/daily) is recommended and has superior immunological benefit to caffeine supplementation since it is more wholesome (contains both caffeic acid and caffeine). roots & fungi, traditional herbs, and medicinal plants maoto, licorice roots, cordyceps mushrooms, chinese mushrooms, ginseng herbs and roots prevent viral replication, enhance anti-influenza virus igg and iga antibodies production, and improve t-cell function [ ] . glycyrrhizin (in maoto) helps progeny influenza viruses to leave without re-infecting, inhibits influenza a virus uptake into the cell and reduces ccid by % [ ] . ginseng and cordyceps have antioxidative (gsh, sod) and cell senescence angiogenesis properties [ ] . dietary intake is highly recommended. supplement when dietary intake is low (e.g., cordyceps, . g/day). microbiota especially lactobacilli and bifidobacterial enhance gut bacteria profile and gut-lung axis-related respiratory fitness [ , ] . dietary intake of fermented foods is recommended covid- , novel corona virus- ; epa, eicosapentaenoic acid; dha, docosahexaenoic acid; gsh, glutathione; sod, superoxide dismutase; igg, immunoglobulin g; iga immunoglobulin a; lps, lipopolysaccharides; tnf-α, tumor necrosis factor-alpha; nf-κb, nuclear factor-κb; mapk, mitogen-activated protein kinase. world health organization (who). fact sheets. influenza (seasonal) editors of the journal of virology. virology in the st century new vaccines: challenges of discovery a clinical approach to the threat of emerging influenza viruses in the asia-pacific region optimal nutritional status for a well-functioning immune system is an important factor to protect against viral infections exercise immunology: practical applications functional foods and lifestyle approaches for diabetes prevention and management role of inactivity in chronic diseases: evolutionary insight and pathophysiological mechanisms carbohydrate, and fat utilisation during exercise: interrelationship, and applications in exercise testing the compelling link between physical activity and the body's defense system effects of acute and chronic exercise on immunological parameters in the elderly aged: can physical activity counteract the effects of aging? an acute bout of exercise modulate the inflammatory response in peripheral blood mononuclear cells in healthy young men viral infection triggers rapid differentiation of human blood monocytes into dendritic cells effect of moderate exercise training on t-helper cell subpopulations in elderly people randomized controlled trial of exercise and blood immune function in postmenopausal breast cancer survivors changes in peripheral immune cell numbers and functions in octogenarian walkers-an acute exercise study who's at higher risk from coronavirus department of health & human services; centre for disease control and prevention. people who are at increased risk for severe illness cytokine production by monocytes, neutrophils, and dendritic cells is hampered by long-term intensive training in elite swimmers salivary iga levels and infection risk in elite swimmers natural killer cells: modulation by intensity and duration of exercise anserine reverses exercise-induced oxidative stress and preserves cellular homeostasis in healthy men early recovery of exercise-related muscular injury by hbot the effect of exercise on natural killer cell activity in young and old subjects acute phase response in exercise: interaction of age and vitamin e on neutrophils and muscle enzyme release bautmans, i. effects of physical exercise on markers of cellular immunosenescence: a systematic review eccentric exercise as an adjuvant to influenza vaccination in humans sedentary behavior, exercise, and cardiovascular health predictive factors, health risks and physiological implications influenza and obesity: its odd relationship and the lessons for covid- pandemic cardiorespiratory fitness and the metabolic syndrome: roles of inflammation and abdominal obesity physical inactivity in diabetes: a case for home-based exercise prescription coronavirus disease (covid- ): the need to maintain regular physical activity while taking precautions physical exercise as therapy to fight against the mental and physical consequences of covid- quarantine: special focus in older people does high cardiorespiratory fitness confer some protection against pro-inflammatory responses after infection by sars-cov- ? obesity (silver spring) personalising exercise and nutrition behaviours in diabetes lifestyle prevention functional foods as modifiers of cardiovascular disease olive oil nutraceuticals in the prevention and management of diabetes: from molecules to lifestyle lifestyle diabetes prevention aptamers: an emerging class of bioaffinity ligands in bioactive peptide applications functional foods and the immune system: a review the immune system: a target for functional foods? a review of micronutrients and the immune system-working in harmony to reduce the risk of infection evidence that vitamin d supplementation could reduce risk of influenza and covid- infections and deaths risk factors associated with acute respiratory distress syndrome and death in patients with coronavirus disease are patients with hypertension and diabetes mellitus at increased risk for covid- infection? latest statistics on coronavirus deaths in people with diabetes licorn and the lille covid- and obesity study group. high prevalence of obesity in severe acute respiratory syndrome coronavirus- (sars-cov- ) requiring invasive mechanical ventilation do vale moreira, n.c. covid- and diabetes: knowledge in progress diabetes is a risk factor for the progression and prognosis of covid- primary prevention of cardiovascular disease with a mediterranean diet effective intervention strategies combining mediterranean diet and exercise for reducing obesity, metabolic and cardiovascular risks in high-risk populations: mini review a -item mediterranean diet assessment tool and obesity indexes among high-risk subjects: the predimed trial brief report: implementing a mediterranean diet intervention into a rct: lessons learned from a non-mediterranean based country benefits of the mediterranean diet beyond the mediterranean sea and beyond food patterns implementing a mediterranean-style diet outside the mediterranean region effects of exercise training and mediterranean diet on reducing post-menopausal vascular risk lópez-aliaga, i. new perspectives in fermented dairy products and their health relevance nutrition, immunity and covid- gut microbiota and covid- -possible link and implications effect of vitamin and trace-element supplementation on immune responses and infection in elderly subjects vitamin d supplementation to prevent acute respiratory tract infections: systematic review and meta-analysis of individual participant data nutritional recommendations for covid- quarantine vitamin d supplementation to prevent acute respiratory infections: individual participant data meta-analysis vitamin d and sleep regulation: is there a role for vitamin d? olive oil nutraceuticals: more than an offshoot of the mediterranean diet in vitro evaluation of secoiridoid glucosides from the fruits of ligustrum lucidum as antiviral agents antiviral activity of calcium elenolate on parainfluenza infection of hamsters powerful protective role of , -dihydroxyphenylethanol-elenolic acid dialdehyde against erythrocyte oxidative-induced hemolysis mechanism of the antiviral effect of hydroxytyrosol on influenza virus appears to involve morphological change of the virus a new class of microbicide displaying broad anti-hiv- activity effect of flavonoids on upper respiratory tract infections and immune function: a systematic review and meta-analysis the effect of olive leaf extract on upper respiratory illness in high school athletes: a randomised control trial colorectal cancer, sun exposure and dietary vitamin d and calcium intake in the mcc-spain study the effect of vitamin d supplement on the score and quality of sleep in - year-old people with sleep disorders compared with control group obstructive sleep apnea and objective short sleep duration are independently associated with the risk of serum vitamin d deficiency prevention and treatment of influenza, influenza-like illness, and common cold by herbal, complementary, and natural therapies a randomized, controlled trial comparing traditional herbal medicine and neuraminidase inhibitors in the treatment of seasonal influenza glycyrrhizin inhibits influenza a virus uptake into the cell food as medicine: a possible preventive measure against coronavirus disease (covid- ) cordyceps militaris enhances cell-mediated immunity in healthy korean men satellite cells depletion in exercising human skeletal muscle is restored by ginseng component rg supplementation oxidative stress and regulation of glutathione in lung inflammation important roles of dietary taurine, creatine, carnosine, anserine and -hydroxyproline in human nutrition and health antioxidant activities of carnosine, anserine, some free amino acids and their combination effects of soybean peptide on immune function, brain function, and neurochemistry in healthy volunteers bioactivities of chicken essence antiviral peptides as promising therapeutic drugs do plant cyclotides have potential as immunosuppressant peptides? effects of processing method and age of leaves on phytochemical profiles and bioactivity of coffee leaves a historical study of coffee in japanese and asian countries: focusing the medicinal uses in asian traditional medicines coffee consumption and risk of type diabetes mellitus among middle-aged finnish men and women antiviral activities of coffee extracts in vitro inhibition by caffeic acid of the influenza a virus multiplication in vitro coffee and the immune system caffeine: well-known as psychotropic substance, but little as immunomodulator immunomodulatory effects of caffeine: friend or foe? caffeine prevents lps-induced inflammatory responses in raw . cells and zebrafish the interaction between respiratory pathogens and mucus this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license author contributions: a.a. performed all parts of this work including concept, design, literature scoping and synthesis, and writing all parts of the manuscript. the author have read and agreed to the published version of the manuscript. the authors declare no conflict of interest. key: cord- -aizquh authors: brenner, hermann; holleczek, bernd; schöttker, ben title: vitamin d insufficiency and deficiency and mortality from respiratory diseases in a cohort of older adults: potential for limiting the death toll during and beyond the covid- pandemic? date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: aizquh the covid- pandemic goes along with increased mortality from acute respiratory disease. it has been suggested that vitamin d( ) supplementation might help to reduce respiratory disease mortality. we assessed the prevalence of vitamin d insufficiency and deficiency, defined by -hydroxyvitamin d ( (oh)d) blood levels of – and < nmol/l, respectively, and their association with mortality from respiratory diseases during years of follow-up in a cohort of adults aged – years from saarland, germany. vitamin d insufficiency and deficiency were common ( % and %, respectively). compared to those with sufficient vitamin d status, participants with vitamin d insufficiency and deficiency had strongly increased respiratory mortality, with adjusted hazard ratios ( % confidence intervals) of . ( . – . ) and . ( . – . ) overall, . ( . – . ) and . ( . – . ) among women, and . ( . – . ) and . ( . – . ) among men. overall, % ( % confidence interval: – %) of respiratory disease mortality was statistically attributable to vitamin d insufficiency or deficiency. vitamin d insufficiency and deficiency are common and account for a large proportion of respiratory disease mortality in older adults, supporting the hypothesis that vitamin d( ) supplementation could be helpful to limit the burden of the covid- pandemic, particularly among women. the corona virus disease (covid- ) pandemic goes along with strongly increased respiratory disease mortality. it has been suggested that vitamin d supplementation could be a potentially promising and safe approach to reduce risk of covid- infections and deaths [ ] . meta-analyses of randomized clinical trials (rcts) have shown that vitamin d supplementation reduces the risk of acute respiratory tract infections [ ] . risk reduction with regular (daily or weekly) supplementation of physiological doses of vitamin d was especially strong (by %) among people with vitamin d deficiency, but significant risk reduction (by %) was also found among people with higher vitamin d levels. meta-analyses of clinical trials have demonstrated that vitamin d supplementation has the potential to also reduce cancer mortality by approximately % [ ] . people with pre-existing major diseases, such as diabetes or cancer, are at increased risk of dying from severe acute respiratory syndrome coronavirus (sars-cov- ) infections. at the same time, prevention of and care for these diseases have been and keep being strongly compromised by current measures to limit the covid- pandemic. we previously assessed the prevalence of vitamin d insufficiency and deficiency and their association with all-cause mortality and mortality from cardiovascular, cancer and respiratory diseases during a mean follow-up of . years in a cohort of adults aged - years from saarland, germany [ ] [ ] [ ] [ ] [ ] . in our previous analysis, the number of deaths from respiratory disease had still been rather small (n = ). we aim to present considerably updated and sex-specific follow-up data of years here and to calculate the proportion of respiratory disease mortality that is attributable to vitamin d insufficiency and deficiency. furthermore, we discuss potential implications for prevention in the context of the ongoing covid- pandemic. this investigation is based on the esther study (german name: epidemiologische studie der verhütung, früherkennung und optimierten therapie chronischer erkrankungen in der älteren bevölkerung), an ongoing statewide cohort study from saarland, germany, details of which have been reported elsewhere [ ] [ ] [ ] [ ] [ ] [ ] . briefly, men and women, aged - years at baseline, were recruited by their general practitioners during a routine health check-up between and . blood samples were taken at baseline at the general practitioners' offices. information on socio-demographic and lifestyle characteristics and medical history were obtained by questionnaires from participants and their general practitioners, and the distribution of those characteristics was similar to the distribution in the respective age categories in the german national health survey conducted in a representative sample of the german population in [ ] . the esther study was approved by the ethics committees of the university of heidelberg and the state medical board of saarland, germany. written informed consent was issued by all participants. information on socio-demographic characteristics, lifestyle and diet were obtained by a comprehensive self-administered questionnaire from the study participants at baseline. skin colour, race or ethnicity were not individually recorded. however, we assume that close to % of this german cohort of adults aged years and older has white skin colour since % gave the information that they were born in germany ( %) or another european country ( %). height and weight were assessed and documented on a standardized form by the general practitioners during the health check-up. furthermore, blood and urine samples were taken during the health check-up, centrifuged, sent to the study center and stored at − • c until analysis. the most abundant and stable vitamin d metabolite in blood samples, -hydroxyvitamin d ( (oh)d) levels, was measured from stored serum samples taken at recruitment. the laboratory methods used are described in detail elsewhere [ ] . in brief, (oh)d levels in women were measured with the diasorin-liaison analyzer (diasorin inc., stillwater, ok, usa). analyses in men were conducted in the context of a separate research project several years later (when the diasorin measurements were no longer offered) with ids-isys (immunodiagnostic systems gmbh, frankfurt main, germany). both immunoassays were standardized retrospectively to the gold standard method liquid chromatography tandem-mass-spectrometry. deaths until end of were identified by inquiry at the residents' registration offices and death certificates of deceased study participants were provided by local health authorities. the leading cause of death with an icd- code was available for . % of deceased study participants and was coded with icd- codes r -r "unknown cause of death" for . % of deceased participants. these individuals were not excluded and censored at the time of death for cause-specific mortality outcomes. participants of the esther baseline examination (n = ) were excluded from this investigation if no blood sample was available or (oh)d could not be measured (n = ) or if they could not be followed-up for mortality (n = ), which resulted in a total sample size of n = subjects for this analysis. we used the institute of medicine's cut-offs to define adequate vitamin d status (> nmol/l), vitamin d insufficiency ( - nmol/l) and vitamin d deficiency (< nmol/l) [ ] . we assessed prevalence of vitamin d insufficiency and deficiency and the distribution (median, interquartile range) of (oh)d values in the total study population and according to age, sex, lifestyle factors and major diseases. we provide kaplan-meier curves for mortality from respiratory diseases among participants with sufficient vitamin d status, vitamin d insufficiency and deficiency and conducted log-rank tests with comparison to the reference group "sufficient vitamin d status." in addition, dose-response relationships between (oh)d levels and respiratory disease mortality were estimated by restricted cubic splines [ ] . furthermore, we compared all-cause, cardiovascular disease, cancer, and respiratory disease mortality between subjects with vitamin d insufficiency or deficiency and subjects with adequate (oh)d levels and estimated hazard ratios (hr) with % confidence intervals ( % ci) by multivariable cox proportional hazards models. missing values for covariates ranged from % to . % (for fish consumption). missing covariate values were imputed with multiple imputation using the markov chain monte carlo (mcmc) method with burn-in iterations. twenty data sets were generated. the imputation model consisted of all variables of the full model (modelled as used in the full model) but not the outcome data, and the imputation was carried out stratified by sex. we used an age, sex and season adjusted model and a full model that was adjusted for potential confounders, which are listed in table . additional adjustment for potential intermediates (cardiovascular disease, history of cancer, diabetes mellitus, hypertension, asthma, total serum cholesterol and serum c-reactive protein levels) did not lead to substantially different results (data not shown). age and body mass index (bmi) were modelled as continuous variables and all other variables were modelled with the categories shown in table . furthermore, sex-specific analyses were performed and statistical tests on interaction were carried out. finally, we estimated the population attributable fraction (paf) of respiratory disease mortality from the prevalence of vitamin d insufficiency and deficiency and their associations with respiratory disease mortality, as derived from the full model. the paf of mortality is the share of mortality in a population that is statistically attributable to a risk factor and that could be avoided by entirely eliminating that risk factor (here: vitamin d insufficiency or deficiency) [ ] . all statistical tests were two-sided, and the alpha level of significance was set to . , with no adjustment for multiple testing. all statistical analyses were conducted with the software package sas, version . (cary, nc, usa). the study population included . % men, mean age was . the study population included . % men, mean age was . years. among the participants included in the study, ( . %) had vitamin d insufficiency ( (oh)d levels of -< nmol/l) and ( . %) had vitamin d deficiency ( (oh)d levels < nmol/l) ( figure ). furthermore, ( . %) had too high (oh)d levels > nmol/l. table provides a description of the characteristics of the study population at baseline as well as prevalence of vitamin d insufficiency and deficiency and median (oh)d levels according to those characteristics. both vitamin d insufficiency and deficiency were more frequent among females with higher age and bmi. in subjects with low physical activity and those who consumed fish less than once per week, median (oh)d levels were correspondingly lower. a seasonal variation with lower (oh)d levels in winter than in summer months was also observed. moreover, (oh)d levels were particularly low among subjects with low education and current smokers. table provides a description of the characteristics of the study population at baseline as well as prevalence of vitamin d insufficiency and deficiency and median (oh)d levels according to those characteristics. both vitamin d insufficiency and deficiency were more frequent among females with higher age and bmi. in subjects with low physical activity and those who consumed fish less than once per week, median (oh)d levels were correspondingly lower. a seasonal variation with lower (oh)d levels in winter than in summer months was also observed. moreover, (oh)d levels were particularly low among subjects with low education and current smokers. overall, ( . %) study participants died during a median of . years of follow-up, of whom , and died from cardiovascular disease (cvd), cancer and respiratory disease, respectively. figure shows the kaplan-meier curves for deaths from respiratory disease according to vitamin d status. mortality from respiratory diseases was consistently highest among participants with vitamin d deficiency and consistently lowest among those with sufficient vitamin d levels throughout up to . years of follow-up. the log-rank test indicated statistically significant survival differences with respect to respiratory disease mortality between the groups with vitamin d deficiency and sufficient vitamin d (p < . ), as well as for the comparison of subjects with vitamin d insufficiency and sufficient vitamin d (p = . ). it is not statistically significant that (oh)d levels > nmol/l are associated with further decreasing respiratory disease mortality because the confidence interval is large and includes the null effect value of hr = . curves were assessed by using restricted cubic splines with knots at -hydroxyvitamin d concentrations of , , and nmol/l, and a -hydroxyvitamin d concentration of nmol/l was used as the reference. the cox proportional hazards regression model was adjusted for sex, age, season of blood draw, school education, smoking, bmi, physical activity, and fish consumption. table shows the associations of vitamin d status with all-cause, cvd, cancer and respiratory disease mortality after adjustment for multiple potential confounders. vitamin d insufficiency and nutrients , , of deficiency were associated with significantly increased all-cause mortality compared to sufficient vitamin d status (full model hrs ( %ci): . ( . - . ) and . ( . - . ), respectively) ( table ) . vitamin d deficiency was also associated with significant increases in cvd and cancer mortality by % and %, respectively (full model results). however, vitamin d insufficiency and deficiency were particularly strongly associated with respiratory disease mortality with full model hrs of . ( %ci: . - . ) and . ( %ci: . - . ), respectively. overall, % ( %ci: - %]) of all deaths from respiratory diseases were statistically attributable to (oh)d levels < nmol/l. figure presents results on the adjusted dose-response relationship between (oh)d levels and respiratory disease mortality. mortality strongly increased with decreasing (oh)d levels below nmol/l and even more so below nmol/l, i.e., in the vitamin d insufficiency and deficiency range. it is not statistically significant that (oh)d levels > nmol/l are associated with further decreasing respiratory disease mortality because the confidence interval is large and includes the null effect value of hr = . table shows the results of the sex-specific analyses. for all-cause, cardiovascular disease and cancer mortality, only modest, statistically non-significant differences were seen between women and men. although significant increases were seen for respiratory disease mortality in both women and men, they were much stronger among women, with . ( % ci . - . ) and . ( % ci . - . )-fold increase of respiratory disease mortality in the case of vitamin d deficiency among women and men, respectively. however, the number of respiratory deaths among women was small (n = overall), especially in the reference groups of those with (oh)d > nmol/l (n = ), which resulted in very wide confidence intervals of the estimated hazard ratios. in this large population-based cohort study from saarland, germany, the majority of participants aged - years at baseline had vitamin d insufficiency or deficiency, and these conditions were associated with increased mortality. in particular, mortality from respiratory diseases was increased by . -and . -fold in subjects with vitamin d insufficiency or deficiency, respectively, compared to participants with sufficient vitamin d status. significant associations with respiratory disease mortality were seen among both women and men, but they were particularly strong for women. overall, % of deaths from respiratory diseases were statistically attributable to vitamin d insufficiency or deficiency and could possibly be avoided by overcoming these conditions, assuming causality of the association. the assumption of causality of vitamin d effects on mortality obviously requires most careful discussion. although we made the best attempts to adjust potential confounding factors, we cannot exclude the possibility of residual confounding by imperfect measurement of confounding variables, such as smoking or physical activity, or omission of unknown confounders. as addressed in detail elsewhere [ ] , interpretation of the evidence is further complicated by the fact that vitamin d deficiency could be considered both a consequence of poor health as well as a risk factor for increased vulnerability to acute disease and poor outcomes of chronic diseases among people with poor health. our findings therefore require critical discussion in the light of additional criteria and evidence, such as biological mechanisms and plausibility, and, in particular, in the light of data from rcts providing vitamin d supplementation. deaths from respiratory disease are mostly deaths from lower respiratory infections [ ] . vitamin d is thought to protect from occurrence and poor outcomes of respiratory infections by several mechanisms, including enhanced physical barriers (maintenance of junction integrity), cellular innate immunity, and adaptive immunity [ ] . innate and adaptive immunity are being influenced by sex hormones [ ] , which may explain the observed interaction of sex and (oh)d levels with respiratory disease mortality. according to data from the us-american national health and nutrition survey, women have a higher inflammation burden than men (the age range was - + years [ ] ). especially postmenopausal women, like those included in the esther study, have a high inflammatory burden because a decline in estrogen levels during menopause is associated with an increased expression of pro-inflammatory cytokines, including interleukin and tumor necrosis factor (tnf) α [ , , ] . a cytokine storm as an adverse immune response to a sars-cov- infection is currently a major hypothesis for the underlying cause of a large proportion of covid- deaths [ ] . sufficient (oh)d levels are suggested to contribute to prevention of the cytokine storm [ , , ] . vitamin d is known to interact with the angiotensin-converting enzyme (ace ), which is both used by sars-cov- as an entry receptor and is an important protein on an anti-inflammatory pathway [ ] . while sars-cov- downregulates the expression of ace , vitamin d upregulates it. in a meta-analysis of individual participant data of rcts that included , participants aged - years, vitamin d supplementation was shown to reduce the risk of acute respiratory tract infection (or . , % ci . - . ) [ ] . the best effects were shown for daily or weekly vitamin d supplementation without additional bolus doses (or . , % ci . to . ). the protective effects were particularly strong in those with baseline -hydroxyvitamin d levels < nmol/l (or . , % ci . - . ). in a recent meta-analysis of rcts on vitamin d supplementation for patients with chronic obstructive pulmonary disease (copd), the risk of acute exacerbations was estimated to be reduced by % ( % ci - %) [ ] . in remarkable consistency with our results, these meta-analyses of rcts provide strong evidence for the preventive potential of vitamin d supplementation against acute respiratory infections and copd exacerbations in particular. it appears plausible to assume that the anti-inflammatory mechanisms of vitamin d would be relevant for sars-cov- infections in a similar manner as for other severe viral respiratory diseases, such as influenza. a first study posted on a pre-print server on may suggests that the protective effects of vitamin d on other acute respiratory tract infections may be translated to covid- infections [ ] . vitamin d deficiency and vitamin d treatment data were available for covid- patients from chicago for the year prior covid- testing. being likely vitamin d deficient (defined as being vitamin d deficient at last available time point without increase of vitamin d treatment) at the time of covid- testing was associated with a . -fold increased risk of being tested positive for covid- (p < . ) as compared to likely vitamin d sufficient. it is worth noting that beneficial effects of vitamin d supplementation against manifestation or exacerbation of acute respiratory infection during an epidemic would be expected to go beyond individual protection of those using supplementation, as limiting such manifestation and exacerbation would also be expected to reduce the potential of spread of the disease to other persons and relieve the overload of the medical system by the epidemic. to our knowledge, no previous vitamin d supplementation rcts have addressed mortality from respiratory disease as the primary endpoint, and no meta-analysis of results for this specific endpoint have been reported, which most likely reflects the relatively small share of deaths from respiratory diseases among all deaths. in our cohort of older adults, these deaths accounted for . % of all deaths. even though this proportion is expected to be higher during the covid- pandemic, the majority of deaths still occur from other diseases, and the summary effect, benefit-harm ratio and cost-effectiveness with respect to all relevant outcomes therefore deserve most careful attention for any general prevention efforts. in that respect, vitamin d supplementation appears to be a particularly promising approach, especially for population groups with high prevalence of vitamin d insufficiency or deficiency, such as the elderly and those with severe comorbidities (which essentially coincide with population groups at highest risk of severe course and death from sars-cov- infection [ ] ). the personal, health care and societal costs of the vitamin d intervention are negligibly low compared to the very high costs of currently employed "general population measures," such as extensive testing for the infection and the lockdown of large proportions of economic and social life, including the delay or omission of much of routine medical care for other relevant diseases. in fact, some of these measures are expected to severely aggravate vitamin d insufficiency or deficiency, especially in high risk groups, such as restrictions of spending time outdoors for the total population (as practiced, for example, in france and spain) or certain high risk groups, such as nursing home residents (as practiced in many countries, including germany). such restrictions dramatically reduce opportunities to maintain adequate vitamin d levels through endogenous synthesis by relevant sun exposure. avoidance of sun exposure has been shown to be associated with increased mortality in epidemiological studies [ ] . vitamin d supplementation has been demonstrated to be safe in numerous large-scale studies, and the risk of harm seems to be negligible compared to the risk of harmful side effects of the aforementioned and other general population measures, such as delayed diagnosis and treatment of cancer, myocardial infarction or stroke, withheld or deferred delivery of surgical or other medical services, or health risks related to unemployment and loneliness [ ] [ ] [ ] [ ] . on the contrary, one expected "side effect" would be reducing total cancer mortality by %, as suggested by a recent meta-analysis of rcts [ ] . for germany, with currently approximately , deaths from cancer per year [ ] , this would translate in prevention of approximately , cancer deaths each year, suggesting substantial additional benefit besides lowering the covid- burden during the covid- pandemic and beyond. in conclusion, our results, along with evidence from meta-analyses from rcts regarding results of vitamin d supplementation on various outcomes, suggest that vitamin d supplementation could contribute to lowering mortality from respiratory and other diseases during and beyond the covid- pandemic, in particular among women. the endocrine society recommends - iu vitamin d /day for adults of any age at high risk for vitamin d deficiency [ ] . the costs for such supplementation are in the order of € per person per year, or even half that amount when sufficient vitamin d supply is ensured by carefully dosed sun exposure during the summer months. along with expected savings from prevented respiratory and other diseases, this would make vitamin d supplementation a particularly cost-effective and most likely cost-saving measure, whose currently still widely neglected potential should receive increased attention in the debate on how to fight against the covid- pandemic. author contributions: h.b. designed the research and drafted the manuscript, b.s. conducted statistical analyses, and b.h. critically read and commented the manuscript and added aspects to the discussion. all authors contributed to the data collection for this project. all authors have read and agreed to the published version of the manuscript. evidence that vitamin d supplementation could reduce risk of influenza and covid- infections and deaths vitamin d supplementation to prevent acute respiratory tract infections: systematic review and meta-analysis of individual participant data vitamin d supplements and total cancer incidence and mortality: a meta-analysis of randomized controlled trials strong associations of -hydroxyvitamin d levels with all-cause, cardiovascular, cancer and respiratory disease mortality in a large cohort study consortium on health and ageing: network of cohorts in europe and the united states. vitamin d and mortality: meta-analysis of individual participant data from a large consortium of cohort studies from europe and the united states vitamin d as a resilience factor, helpful for survival of potentially fatal conditions: a hypothesis emerging from recent findings of the esther cohort study and the chances consortium vitamin d supplementation trials aimed at reducing mortality have much higher power when focusing on people with low serum -hydroxyvitamin d concentrations serum -hydroxyvitamin d levels as an aging marker: strong associations with age and all-cause mortality independent from telomere length, epigenetic age acceleration, and -isoprostane levels epidemiological investigations of the chances of preventing, recognizing early and optimally treating chronic diseases in an elderly population (esther study) dietary reference intakes for calcium and vitamin d dose-response analyses using restricted cubic spline functions in public health research world health organization health statistics and information systems global, regional, and national age-sex-specific mortality for causes of death in countries and territories, - : a systematic analysis for the global burden of disease study the confluence of sex hormones and aging on immunity sex differences in age trajectories of physiological dysregulation: inflammation, metabolic syndrome, and allostatic load the complex role of estrogens in inflammation transitions in metabolic and immune systems from pre-menopause to post-menopause: implications for age-associated neurodegenerative diseases the possible pathophysiology mechanism of cytokine storm in elderly adults with covid- infection: the contribution of "inflame-aging" the possible role of vitamin d in suppressing cytokine storm and associated mortality in covid- patients vitamin d receptor stimulation to reduce acute respiratory distress syndrome (ards) in patients with coronavirus sars-cov- infections vitamin-d and covid- : do deficient risk a poorer outcome? the efficacy of vitamin d therapy for patients with copd: a meta-analysis of randomized controlled trials association of vitamin d deficiency and treatment with covid- incidence risk factors of critical & mortal covid- cases: a systematic literature review and meta-analysis avoidance of sun exposure is a risk factor for all-cause mortality: results from the melanoma in southern sweden cohort decline of acute coronary syndrome admissions in austria since the outbreak of covid- : the pandemic response causes cardiac collateral damage covid- pandemic will have a long-lasting impact on the quality of cirrhosis care potential impact of the covid- pandemic on financial toxicity in cancer survivors immediate and long-term impact of the covid- pandemic on delivery of surgical services krebs in deutschland für evaluation, treatment, and prevention of vitamin d deficiency: an endocrine society clinical practice guideline the esther study was funded by grants from the saarland state ministry for social affairs, health, women and family affairs (saarbrücken, germany), the baden-württemberg state ministry of science, research and arts (stuttgart, germany), the federal ministry of education and research (berlin, germany) and the federal ministry of family affairs, senior citizens, women and youth (berlin, germany). the authors declare no conflict of interest. key: cord- -o nblj i authors: pizzini, alex; aichner, magdalena; sahanic, sabina; böhm, anna; egger, alexander; hoermann, gregor; kurz, katharina; widmann, gerlig; bellmann-weiler, rosa; weiss, günter; tancevski, ivan; sonnweber, thomas; löffler-ragg, judith title: impact of vitamin d deficiency on covid- —a prospective analysis from the covild registry date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: o nblj i the novel coronavirus disease (covid- ) caused by severe acute respiratory syndrome coronavirus type (sars-cov- ) is a global health concern. vitamin d (vitd) deficiency has been suggested to alter sars-cov- susceptibility and the course of disease. thus, we aimed to investigate associations of vitd status to disease presentation within the covild registry. this prospective, multicenter, observational study on long-term sequelae includes patients with covid- after hospitalization or outpatients with persistent symptoms. eight weeks after pcr confirmed diagnosis, a detailed questionnaire, a clinical examination, and laboratory testing, including vitd status, were evaluated. furthermore, available laboratory specimens close to hospital admission were used to retrospectively analyze -hydroxyvitamin d levels at disease onset. a total of patients were included in the analysis ( % males, % females), aged ± years. eight weeks after the onset of covid- , a high proportion of patients presented with impaired vitd metabolism and elevated parathyroid hormone (pth) levels. pth concentrations were increased in patients who needed intensive care unit (icu) treatment, while vitd levels were not significantly different between disease severity groups. low vitd levels at disease onset or at eight-week follow-up were not related to persistent symptom burden, lung function impairment, ongoing inflammation, or more severe ct abnormalities. vitd deficiency is frequent among covid- patients but not associated with disease outcomes. however, individuals with severe disease display a disturbed parathyroid-vitamin-d axis within their recovery phase. the proposed significance of vitd supplementation in the clinical management of covid- remains elusive. the novel coronavirus disease caused by severe acute respiratory syndrome coronavirus type (sars-cov- ) is a global health concern leading to a substantial need for patient hospitalization, treatment at intensive care units (icus), and invasive ventilation [ ] [ ] [ ] . there is a risk of morbidity and mortality from covid- as a consequence of severe pulmonary involvement and multi-organ failure varies across the general population. several risk factors impacting the clinical course of covid- have been described in the literature [ ] [ ] [ ] [ ] [ ] , and in most of these conditions, vitamin d (vitd) deficiency occurs frequently, especially in advanced age [ ] . vitd, traditionally known as a crucial regulator of bone metabolism, is obtained either from nutritional sources or endogenous production. the endogenous generation of -hydroxyvitamin d ( (oh)d), the major circulating form of vitd, includes various enzymatic steps. one crucial step in (oh)d production, the transformation of -dehydrocholesterol to previtamin d , takes place in the skin and depends on the action of uv light intensity and duration [ ] . thus, vitd deficiency is related to seasonal changes, being most prevalent during winter season, and is very common in general, especially in developed countries. ultimately, the fully active hormone is generated by hydroxylation at position in the kidney to form , -dihydroxyvitamin d ( , (oh)d) [ ] . this final step is catalyzed by cyp b , an enzyme also found in many extrarenal tissues, which are able to produce , (oh)d in a para-or autocrine manner [ ] . as suggested by the task force of the endocrine society, vitd deficiency is determined by measurement of serum (oh)d, which represents the most robust indicator to monitor the vitd status [ ] . accordingly, vitd deficiency is defined by a serum (oh)d concentration below nmol/l, whereas serum (oh)d concentration below nmol/l indicates insufficient vitd supply. based on these definitions, up to percent of european individuals suffer from vitd deficiency [ , ] . besides, various non-skeletal functions have been associated with vitd metabolism [ ] . for instance, vitd interacts with the raas system, thus altering vascular wall tension and blood pressure, and may prevent the establishment and progression of atherosclerosis [ , ] . additionally, vitd is related to immune surveillance and contributes to defense against bacterial and viral infections [ , ] . in this context, previous studies revealed a higher susceptibility to seasonal influenza and respiratory syncytial virus infections in vitd-deficient subjects [ , ] . vitd deficiency was further related to cases of severe pneumonia and the development of acute lung injury [ ] . since these conditions may occur as clinical features of a sars-cov- infection, we scrutinized the impact of vitd metabolism on the clinical course of covid- . the potential benefits of normal-ranged vitd levels in covid- have previously been suggested; however, published studies on the impact of vitd status on the course of covid- are lacking [ ] . moreover, public interest in vitd seems to be even more significant since the sars-cov- outbreak. google trends revealed a significant boost in the frequency of "vitamin d" being looked up during the sars-cov- pandemic [ ] . thus, we aimed to analyze vitd status and its associations with clinical presentation and course of disease in covid- . herein, we report results of the ongoing prospective multicenter observational covild study (clinicaltrials.gov number, nct ), aiming to evaluate the persistent cardio-pulmonary damage of covid- patients. this prospective, multicentre, observational study includes patients with a confirmed diagnosis of covid- , based on typical clinical presentation and a positive sars-cov- real-time pcr test. the target population included hospitalized patients as well as outpatients with persistent symptoms. inclusion criteria were female and male patients ≥ years with a confirmed infection with sars-cov- according to the definition of the austrian federal ministry of social affairs, health, care, and consumer protection, and signed and dated declaration of consent by the patient according to ich-gcp guidelines [ ] . exclusion criteria were pregnancy, dementia, or declaration of consent by the patient according to ich-gcp guidelines not signed. enrollment of patients with confirmed sars-cov- infection began on april . the trial site was located in innsbruck, with two additional participating centers in zams and münster, all care centers in tyrol, the first major covid- hotspot in austria. due to the sudden rise in infections, patients had to be treated in wards from different medical disciplines. in total, the study cohort included outward and hospitalized patients, of whom patients needed treatment at the icu. eight weeks after the confirmed diagnosis, a detailed questionnaire, clinical examination; and lung function testing including spirometry, body plethysmography, exhaled nitric oxide (feno), diffusion capacity for carbon monoxide adjusted for haemoglobin (dlcoc), capillary blood gas analysis, trans-thoracic echocardiography, standard laboratory examinations, a low-dose computed tomography (ct) scan of the chest, and laboratory testing, were evaluated. laboratory parameters relevant for this analysis included (oh)d (nmol/l), parathyroid hormone (pth) (ng/l), calcium (total and ionized, nmol/l), phosphate (mmol/l), creatinine (mg/dl), urea (mg/dl), c-reactive-protein (crp), interleukin- (il- ), serum ferritin, and d-dimer. additionally, specimens of patients acquired during the first days of hospital admission were used to retrospectively determine (oh) levels at disease onset. according to current guidelines, vitd deficiency was defined as (oh)d levels below nmol/l. serum concentrations of (oh)d between and nmol/l were categorized as insufficient vitd supply, whereas (oh)d above nmol/l were considered normal [ ] . disease severity was categorized as mild for patients in outward treatment; moderate for patients in inward treatment; and severe for patients requiring oxygen supply, respiratory support, or intensive care treatment. ct images were evaluated for the presence of ground-glass opacities (ggo), consolidations, bronchiectasis, and reticulations, as defined by the glossary of terms of the fleischner society, and the intensity of the findings was graded according to their distribution (unilateral/bilateral, involved lobes) by assigning a score ranging from - per lobe [ ] . mean comparison of normally distributed numeric data was performed using student's t-test. if gaussian distribution was not given, the mann-whitney-u-test and kruskal-wallis-test were applied. spearman rank correlation coefficient was used for the analysis of monotonic associations in non-normally distributed data. if gaussian distribution was given, pearson correlation coefficient was calculated to assess the degree of linear associations. all tests were calculated two-tailed, and a p-value of . indicated statistical significance. statistical analyses were performed with spss . statistical package (ibm corp., armonk, ny, usa). all procedures performed in the present study involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the helsinki declaration and its later amendments, and were performed after approval of the ethics committee of the medical university of innsbruck (ek nr: / ). the study cohort consisted of predominantly male individuals ( %), aged ± years. sixty-five percent of covid- patients were overweight or obese, and most individuals had pre-existing comorbidities, with cardiovascular and endocrine diseases being the most frequent ones. during hospitalization, most patients needed oxygen supply ( %), and percent were admitted to the icu due to the necessity of non-invasive or invasive mechanical ventilation as determined by the treating physicians. detailed demographics and clinical characteristics of the study cohort are shown in table . eight weeks after onset of covid- , mean (oh)d concentrations were ± nmol/l, demonstrating a high proportion of patients with impaired vitd metabolism, and highlighting male patients, who displayed significantly lower (oh)d levels ( nmol/l ± vs. ± nmol/l, p = . ) than females. overall, % of patients presented with vitd deficiency and % with vitd insufficiency. accordingly, pth was significantly increased (> ng/l) in percent of patients. oxygen supply-no. pth concentrations were more significantly elevated in subjects who needed icu or prolonged oxygen treatment (p < . ) than in mild cases. similar differences were noted when comparing (oh)d levels among mild, moderate, and severe groups, although they did not reach statistical significance. still, when comparing (oh)d levels of the severe subgroup to pooled data of mild and moderate cases, they were significantly lower ( ± vs. ± nmol/l, p < . ) at follow-up. in contrast, (oh)d concentrations at disease onset did not differ significantly between these groups. (p = . ). (p = . ; figure , table ). pth concentrations were more significantly elevated in subjects who needed icu or prolonged oxygen treatment (p < . ) than in mild cases. similar differences were noted when comparing (oh)d levels among mild, moderate, and severe groups, although they did not reach statistical significance. still, when comparing (oh)d levels of the severe subgroup to pooled data of mild and moderate cases, they were significantly lower ( ± vs. ± nmol/l, p < . ) at follow-up. in contrast, (oh)d concentrations at disease onset did not differ significantly between these groups. (p = . ). (p = . ; figure , table ). the bmi is the weight kilograms divided by the square of the height in meters. * patients received oxygen supply only, two patients were treated with non-invasive ventilation, and with invasive ventilation. disease severity was graded according to intensity of treatment: mild = ambulatory treatment; moderate = hospital treatment; severe = inward treatment with respiratory (oxygen) supply or treatment at the intensive care unit (icu) with non-invasive or invasive ventilation; pth = parathyroid hormone; crp = c-reactive protein; il- = interleukin ; data are depicted as mean ± sd, p-values were calculated with kruskal-wallis test. nutrients , , x for peer review of . † bmi, body-mass index; the bmi is the weight kilograms divided by the square of the height in meters. * patients received oxygen supply only, two patients were treated with non-invasive ventilation, and with invasive ventilation. disease severity was graded according to intensity of treatment: mild = ambulatory treatment; moderate = hospital treatment; severe = inward treatment with respiratory (oxygen) supply or treatment at the intensive care unit (icu) with non-invasive or invasive ventilation; pth = parathyroid hormone; crp = c-reactive protein; il- = interleukin ; data are depicted as mean ± sd, p-values were calculated with kruskal-wallis test. ten ( . %) of patients received vitd supplementation during hospitalization, but the initiation of vitd supplementation was not related to disease severity. the herein-presented analysis of the covild study cohort shows that (oh)d deficiency is common among covid- patients, whereas a causal implication of vitd metabolism on its disease course remains uncertain. evidence from a study by hastie et al., who retrospectively analyzed the influence of vitamin d status on covid- infection risk, supports the here presented results. comparison of (oh)d levels of covid- patients with uk biobank data did not support a potential role for vitd metabolism for the susceptibility to covid- infection nor for the differences between ethnic groups [ ] . as pointed out in the response by roy et al., the study focused on the association of vitd to the risk of incidence of covid- rather than the risk of severity [ ] . contrasting results are reported from an israeli population-based study, which, similar to this study, identified a high frequency of (oh)d deficiency in covid- patients. multivariate analysis, after controlling for demographic characteristics and medical conditions, confirmed an independent and significant association between a low (oh)d level and an increased likelihood of covid- infection [ ] . this prospective observational cohort study reveals first evidence of a disturbed pth-vitd axis in patients with a more severe course of covid- . low levels of (oh)d, however, did not predict the severity of the disease and did not associate with persistent symptoms, ct-abnormalities, or impaired pulmonary function testing, either at the moment of covid- diagnosis or at the -week follow-up. nevertheless, the high proportion of patients with elevated pth concentrations, especially in severe covid- cases during the recovery phase, is remarkable. this might simply reflect the result of less sunlight exposure as a consequence of prolonged quarantine periods and hospitalization, leading to secondary hyperparathyroidism, or represent a residual dysregulation after the infectious disease [ ] . patients' reduced mobility due to persistent covid- related symptoms such as fatigue and dyspnoea may also contribute to the described alterations. the recently observed peaks in new sars-cov- infections in regions with high sunlight exposure and consequently expected abundant endogenous vitd synthesis, like florida and california, further questions the significance of vitd on covid- susceptibility and disease course, contrasting with the so-called latitude hypothesis [ ] . results from a small italian study including covid- patients with respiratory failure treated at the icu identified % of the patients having (oh)d deficiency. severe deficiency, defined as (oh)d below ng/ml, was identified in patients and associated with a significant elevation in mortality, despite being by far the oldest study-subgroup with comorbidities in every patient. a direct comparison with our study is inappropriate as study-design and outcome-measurements distinctly differ; however, a proper validation in a larger cohort of icu patients is warranted in order to draw robust conclusions related to the prognostic impact of vitd deficiency in critically ill covid- patients. the absolute increase in serum (oh)d levels from the time of covid- diagnosis to follow-up is subject for discussion. as (oh)d levels were not routinely analyzed in covid- patients during hospitalization, we used laboratory specimens close to hospital admission to retrospectively determine (oh)d levels. still, laboratory specimens were only available from a subgroup of the cohort (n = ), thus results of this analysis have to be interpreted with caution. additionally, patients with a severe lack of (oh)d received vitd supplementation as part of the clinical management. the immunomodulatory effects of vitd described in the context of pneumonia, acute lung injury, and systemic inflammatory response syndrome would sustain a potential link to covid- and imply a possibility for intervention [ ] . the known interaction of vitd with the renin-angiotensin system, including ace , whose receptor sars-cov- binds to, further recommends it as a potential therapeutic option [ ] . accordingly, in a rat model, vitd has already been shown to alleviate acute lung injury by modulating the renin-angiotensin system [ ] . however, previous reports also question the causal implication of vitd deficiency, especially low (oh)d levels, in extra-skeletal health [ , ] by discussing the potential ability of infections and chronic inflammatory processes in reducing serum (oh)d levels. such causal association would also explain why vitd insufficiency/deficiency is reported in a wide range of disorders, although results of randomized controlled trials using vitamin d supplementation in preventing or ameliorating extra-skeletal diseases are mostly inconsistent or even disappointing [ , ] . although the abovementioned studies justify further analyses, including (oh)d interventional studies, in covid- , our results do not support vitd deficiency as a strong indicator of severe disease course. however, as the covild study was not designed to evaluate the effects of (oh)d in covid- , we have to acknowledge some limitations. first, the covild trial was designed as an observational study to detect the rate of persistent lung injury after a severe course of covid- , therefore the here presented results must be interpreted carefully in the context of vitd deficiency, especially because predominantly patients with severe disease course were included. second, (oh)d levels were prospectively assessed eight weeks after the positive sars-cov- pcr test, while only a third of the study population (oh)d levels at disease onset were retrospectively available. thus, further prospective clinical studies are needed to clarify the significance of vitd in the clinical management of covid- patients. vitd deficiency is frequently found in patients with severe covid- , but (oh)d concentrations do not associate with persistent inflammation, impairment in pulmonary function tests, pathological findings in ct-scans, or the persistence of symptoms. however, individuals with severe disease display a disturbed parathyroid-vitamin-d axis within their recovery phase, most likely due to prolonged hospitalization, although the question about causality or consequence cannot be answered through our data, and more evidence from interventional rcts is warranted to properly understand the role of vitd in covid- . conclusively, the proposed significance of vitd in the clinical management of covid- remains elusive. covid- ) epidemiology, clinical course, and outcomes of critically ill adults with covid- in new york city: a prospective cohort study predictors of mortality for patients with covid- pneumonia caused by sars-cov- : a prospective cohort study genomewide association study of severe covid- with respiratory failure clinical course and risk factors for mortality of adult inpatients with covid- in wuhan, china: a retrospective cohort study factors associated with covid- death in million patients extra-skeletal effects of vitamin d vitamin d metabolism, mechanism of action, and clinical applications vitamin d supplementation guidelines controversies in vitamin d: summary statement from an international conference evaluation, treatment, and prevention of vitamin d deficiency: an endocrine society clinical practice guideline vitamin d deficiency in europe: pandemic? am vitamin d deficiency and insufficiency among us adults: prevalence, predictors and clinical implications vitamin d and cardiovascular disease: from atherosclerosis to myocardial infarction and stroke the impact of vitamin d in the treatment of essential hypertension vitamin d and immune function: understanding common pathways evidence that vitamin d supplementation could reduce risk of influenza and covid- infections and deaths vitamin d and influenza-prevention or therapy? vitamin d deficiency and acute lung injury r ) good clinical practice (gcp) guideline fleischner society: glossary of terms for thoracic imaging vitamin d concentrations and covid- infection in uk biobank response to 'vitamin d concentrations and covid- infection in uk biobank low plasma (oh) vitamin d level is associated with increased risk of covid- infection: an israeli population-based study inflammation and vitamin d: the infection connection the latitude hypothesis, vitamin d, and sars-co-v covid- and vitamin d-is there a link and an opportunity for intervention? a brief review of interplay between vitamin d and angiotensin-converting enzyme : implications for a potential treatment for covid- vitamin d alleviates lipopolysaccharide-induced acute lung injury via regulation of the renin-angiotensin system vitamin d and extra-skeletal health: causality or consequence vitamin d and multiple health outcomes: umbrella review of systematic reviews and meta-analyses of observational studies and randomised trials this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license we acknowledge doris hüttenberger and graziella plank for supporting this project. support by the "verein zur förderung von forschung und weiterbildung in infektiologie und immunologie an der medizinischen universität innsbruck" (zvr-zahl , gz: lvr ) is gratefully acknowledged. the authors declare no conflict of interest. key: cord- -jg szw authors: sánchez-sánchez, eduardo; ramírez-vargas, guillermo; avellaneda-lópez, ylenia; orellana-pecino, j. ignacio; garcía-marín, esperanza; díaz-jimenez, jara title: eating habits and physical activity of the spanish population during the covid- pandemic period date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: jg szw due to the pandemic situation caused by the covid- infection, some governments have implemented house confinement measures. the objective of our study is to learn the dietary patterns, consumption, and physical activity of the spanish population before and during the period of confinement by covid- . a cross-sectional descriptive study based on a questionnaire during may , coinciding with the period of confinement and the step forward into phase , is carried out. during confinement, the adherence to the mediterranean diet increases ( . % versus . %; p < . ). no socio-demographic variables show statistical significance (p < . ) regarding good adherence to the mediterranean diet (md) before and during confinement. during confinement, consumption of homemade baking shows a higher increase ( . % versus . %; p = . ). during confinement, the number of subjects that practice exercise decreases ( . % versus . %; p = . ), as well as the time spent exercising (more than an hour, . % versus . %, p = . ). mediterranean diet adherence slightly increases during confinement, although consumption of ‘unhealthy’ food also increases. moreover, the number of subjects that practice physical activity, as well as the time spent on it weekly, decreases. a number of cases of atypical pneumonia caused by a new virus with a rapid spread, infectivity, and mortality in human beings are noticed in wuhan, china, in december . subsequently, the world health organisation (who) temporarily names this new virus as the new coronavirus ( -ncov), and its disease as covid- . the who has defined this situation as a world public health emergency. regarding clinical manifestations, the most severe is the severe acute respiratory syndrome (sars), which is why the virus has been renamed as sars cov- [ ] [ ] [ ] . this pandemic has led to restrictive measures and house confinement by governments of multiple countries, with the aim of reducing the number of cases and its spread within the population [ ] . confinement periods imply daily routine and lifestyle changes for the population. some studies have linked the period of confinement with an increase in negative psychological effects, such as stress and anxiety [ ] . the confinement itself, and its negative psychological effects, may lead to inappropriate conduct like physical inactivity, increases in a sedentary lifestyle, and changes in dietary patterns toward the consumption of 'unhealthy' food and beverages. this conduct might increase the risk of developing diseases such as obesity, diabetes, cardiovascular disease, cancer and more [ , ] , and these diseases are mortality risk factors for covid- [ ] . a cross-sectional descriptive study based on a self-administered questionnaire was carried out. this was a non-probabilistic sample used for convenience as this questionnaire was directed to the whole spanish population above sixteen years old. to calculate the sample size, the data published by the national statistical institute (ine) on the st of july, were taken as reference, where it reflected that the spanish population was composed of , , inhabitants. the calculation of the sample size was carried out with a % confidence level and a % of precision, since the expected proportion of the change in population was unknown, a . proportion was selected. the sample size was subjects. the study followed the international ethical recommendations contained in the declaration of helsinki. participation in the study was completely free and voluntary. all of the questionnaires were anonymous, and any personal identification data that was requested (name, id) complied with the provisions of the organic law / , of december , protection of character data personal and organic law / , of december , for the protection of personal data and guarantee of digital rights. the questionnaire was divided into sections. the first one included socio-demographic variables such as gender, age, autonomous region and place of residence, and professional situation. anthropometric variables were taken in the second section, such as weight, height and body mass index (bmi), as well as variables regarding food and nutrition, like adherence to the mediterranean diet, higher food consumption and participation in food preparation. the third, and last section, collected variables related to physical activity such as physical exercise, dedicated time, type of exercise, and information research to perform the exercise. regarding the mediterranean diet, adherence evaluation used the questionnaire from the prevention with mediterranean diet group (predimed) [ ] . this questionnaire was validated for the spanish population and consisted of items. when the answer to the item followed the pattern of the mediterranean diet (md) it scored point. when the result obtained from the sum of the items was < , subjects were classified as low adherence and if it was ≥ , subjects were considered to maintain a high adherence. there existed few validated questionnaires for the physical activity assessment in the context of the investigation, but none of them were reproducible and, therefore, applicable during the confinement, consequently questions related to physical activity were designed based on opinions of physical activity experts. a pilot study was carried out among subjects to verify the effectiveness of the questionnaire, to learn whether it provided the necessary information, and if we needed to modify any of the questions. after this pilot study some questions were modified due to a lack of understanding which could lead to an interpretation error. concerning the dissemination of the questionnaire, new communication technology using the google questionnaire platform was employed, and dissemination used social platforms on twitter, facebook, whatsapp, and instagram. the questionnaire was administered during may , coinciding with the confinement period and the step forward into phase . the data obtained from the variables were represented in a descriptive way. the qualitative variables were represented by frequency and percentage, and the quantitative variables were expressed by the mean and standard deviation or dispersion. subsequently, and using the mcnemar test, it was studied whether there were significant differences between gender and diet adherence, as well as the answers to each questionnaire item and the adherence to the md during each period (before and after the confinement), accepting a confidence level of %. furthermore, a generalised linear regression model with all the variables and the adherence to md during both periods of the study was conducted. a total of answers to the questionnaire were obtained, of which eight were eliminated due to discrepancies within the responses related to age, weight and/or height. considering the total of the sample, . % were females and . % were males. the average age of the sample was . ± . years, although, if we present the data by age ranges, the most prevalent were the subjects with ages between and years; being ≥ years old was the least represented group in the sample. bmi was calculated before confinement with . % of those surveyed presenting values indicating normal weight. any level of overweight or obesity was . %. there were statistically significant differences within gender (p < . ) as the percentage of men with any level of overweight was higher than women ( . % versus . %). the next question related to weight regarded a lack of weight gain during confinement, which was reported at . %. concerning the subjects that confirmed a weight gain, . % gained between and kg. there were not any statistical differences. among other evaluated aspects was professional situation, concerning on-site work, but not during the state of the initial pandemic, and telework, which were the most prevalent ( . and . %, respectively). considering gender, the number of unemployed women was higher than men ( . % versus . %). eighty-four point three percent of subjects lived in an urban area, . % lived with their partners and children, and the percentage that lived with their parents and children was . %. additionally, . % responded that they always cooked, this percentage being higher in women than men ( . % versus . ) ( table ) . after analysing the answers obtained in the predimed questionnaire, previous to confinement, . % of the subjects presented a low adherence to the md and . % a high adherence. however, during confinement, . % of subjects surveyed presented a low adherence compared to . % that presented a high adherence. there were no statistically significant differences between genders during either period of time, although there were significant differences before and after confinement (p < . ), as subjects with a low adherence decreased ( table ) . after the calculation of the odds ratio, any socio-demographic variable showing a statistical significance (p > . ) related to a good adherence to the md before confinement. following the confinement, those respondents living in aragón were more likely to have a good adherence to the md (odds ratio (or) = . ; confidence interval (ci): . - . ; p = . ). there were no differences between the different socio-demographic variables and improved observance of the md during confinement. aside from evaluating md adherence, each answer to each item of the predimed questionnaire was studied. answers providing point per item were noted as it indicated a higher adherence to the md. the items that presented a higher percentage, before confinement, were the use of olive oil for cooking, the consumption of butter, margarine, or cream, and the consumption of red meat, hamburgers, sausages, or cold meats, and the intake of carbonated beverages, at . %, . %, . % and . %, respectively. these were the same items that had a higher adherence, during confinement, although values were lower than those previously mentioned ( . %, . %, . %, and . %, respectively). items with less adherence, before confinement, were the consumption of wine, fish or seafood, and legumes, at . %, . % and . %, respectively. during confinement, the adherence to these items increased ( . %, . %, and . %, respectively). there were significant statistical differences, between both periods, in all the items except for the usage of olive oil for cooking (p = . ) ( table ) . prior to the confinement the most consumed food and beverages by the studied subjects were chicken meat, turkey, or rabbit ( . %), vegetables ( . %) and pasta or rice ( . %). the food less consumed, in this period, were homemade desserts and pastries ( . %) and alcoholic drinks ( . %). during confinement, the consumption of homemade desserts and pastries increased to . %, the only one that presented a further increase (table ). when asking the subjects whether they practiced exercise before confinement, . % answered that they did exercise - times per week, with a lower percentage during confinement ( . %). the number of those surveyed that practiced exercise six or more times per week increased during confinement ( . % versus . %). statistically significant differences existed in both genders and periods of time evaluated. regarding the time spent for exercise, . % dedicated between and min before confinement, increasing this percentage after confinement ( . %). the number of surveyed subjects that responded who did more than an hour exercise per session decreased after confinement ( . % versus . %). there were statistically significant differences between gender and periods of time (table ). additionally, results showed that of the subjects that practiced physical activity during confinement, . % searched for information to carry out physical activity using youtube, while other social networks were less prevalent ( . %) (p < . ) (figure ). additionally, results showed that of the subjects that practiced physical activity during confinement, . % searched for information to carry out physical activity using youtube, while other social networks were less prevalent ( . %) (p < . ) (figure ). following a balanced and healthy diet, along with physical activity, plays an essential role in the maintenance of health in a population. these habits have gained a special relevance during the period of confinement caused by covid- , as the alteration of the diet and physical activity can yield diseases like obesity, diabetes; which are risk mortality factors in patients with covid- [ ] . according to reported data from the spanish agency of food security and nutrition, % of the spanish adult population present some level of overweight or obesity [ ] . prior to the confinement, in our sample, the prevalence of men that were overweight or obese was %, while this was less prevalent in women ( . %). the number of obese subjects decreased during confinement, increasing the number of subjects who were overweight, which indicates a weight loss as height remained constant. this result is opposite to the results obtained by pellegrini and colleagues in , as those authors found a significant weight gain in the obese population. consequently, it might be concluded that the percentage of obese subjects remained constant or increased [ ] . considering our subjects, . % gained weight during confinement, which is a bigger percentage than the one reported by sidor and rzymski in poland ( . %) [ ] .the difference might be due to poland having a confinement of - days (the th- st of march to april the th), while in spain it was days (march th to may nd, first phase). home cooking makes a population have an active role in their dietary habits and it could influence a healthy diet follow-up [ ] . this is not strictly correct, as cooking is the action of preparing food, but not the election of the food or the cooking process (roast, boiled, fried, ...). considering our sample, . % of respondents always cooked, which was more prevalent in women ( . %) than in men ( . %). taking subjects that cook as a reference, without measuring the frequency of this action, . % of the subjects cooked, with this value much more superior to the % shown in the covidiet study [ ] . our data show that md adherence increased during confinement compared to prior to confinement. this increase is higher in women than men ( . % versus . %, respectively). prior to confinement, . out of surveyed subjects had a low adherence to the md. these data are better in comparison to those reported in the study by zaragoza following a balanced and healthy diet, along with physical activity, plays an essential role in the maintenance of health in a population. these habits have gained a special relevance during the period of confinement caused by covid- , as the alteration of the diet and physical activity can yield diseases like obesity, diabetes; which are risk mortality factors in patients with covid- [ ] . according to reported data from the spanish agency of food security and nutrition, % of the spanish adult population present some level of overweight or obesity [ ] . prior to the confinement, in our sample, the prevalence of men that were overweight or obese was %, while this was less prevalent in women ( . %). the number of obese subjects decreased during confinement, increasing the number of subjects who were overweight, which indicates a weight loss as height remained constant. this result is opposite to the results obtained by pellegrini and colleagues in , as those authors found a significant weight gain in the obese population. consequently, it might be concluded that the percentage of obese subjects remained constant or increased [ ] . considering our subjects, . % gained weight during confinement, which is a bigger percentage than the one reported by sidor and rzymski in poland ( . %) [ ] .the difference might be due to poland having a confinement of - days (the th- st of march to april the th), while in spain it was days (march th to may nd, first phase). home cooking makes a population have an active role in their dietary habits and it could influence a healthy diet follow-up [ ] . this is not strictly correct, as cooking is the action of preparing food, but not the election of the food or the cooking process (roast, boiled, fried, ...). considering our sample, . % of respondents always cooked, which was more prevalent in women ( . %) than in men ( . %). taking subjects that cook as a reference, without measuring the frequency of this action, . % of the subjects cooked, with this value much more superior to the % shown in the covidiet study [ ] . our data show that md adherence increased during confinement compared to prior to confinement. this increase is higher in women than men ( . % versus . %, respectively). prior to confinement, . out of surveyed subjects had a low adherence to the md. these data are better in comparison to those reported in the study by zaragoza-martí et al., in for the spanish population ( . %) [ ] . during a study performed in italy, during confinement, . % of people had a low adherence (numeric value - ), and . % of people had a medium adherence (numeric value [ ] [ ] [ ] [ ] to the md. although the cutting values are different from those taken as reference in our study, we can conclude that the majority of the spanish population did not present a high adherence to the md, similar data as that found in our study [ ] . our results show that none of the studied variables (age, gender, bmi, place of residence, professional situation, family members, cooking) had a relation to a high adherence to the md before confinement, and only the place of residence (aragon) was related with a greater probability of presenting a higher adherence to md during confinement. during the covidiet study published in , age, educational level, and region were connected to md adherence before and after confinement, regarding subjects with an age range between - years old, or with a superior level of education, or who lived in the north, all of which presented a higher adherence to the md [ ] . also, other studies showed that adults over years old, living with children, and unemployed had a higher risk for unhealthy food consumption [ ] . those differences might be due to the number of participants and the study's chosen questionnaire (predimed versus metdiet). prior to and during confinement, the predimed questionnaire items which presented a higher adherence in our population were: consumption of olive oil for cooking ( . % versus . %); use of butter, margarine, or cream ( . % versus . %); consumption of red meat, hamburgers, sausages, or cold meats ( . % versus . %); and consumption of carbonated beverages and/or sweetened drinks ( . % versus . %). those which presented a lower adherence were: consumption of wine ( . % versus . %); consumption of fish and/or seafood ( . % versus . %), legumes ( . % versus . %), and fruits ( . % versus . %). there were statistical differences within all the items before and during confinement except for olive oil for cooking and vegetable consumption. these data are different than those reported by di renzo et al., [ ] , with the exception of the consumption of olive oil for cooking ( . %). regarding the previously mentioned study, adherence to the md is associated with a higher intake of fruits, vegetables, nuts, legumes, and fish. regarding food consumption changes, data show that the consumption of alcoholic drinks, confectionaries, nuts, homemade desserts and snacks, and jelly beans increased during confinement, although this increase was lower than that reported in other studies such as the one by scamozzino and visioli in , which obtained a . % increase in the consumption of alcohol drinks versus . % in our study. furthermore, in the previously mentioned study, . % of respondents increased fruit and vegetable consumption, being this increase lower than in our sample ( . % fruits and . % vegetables). this might be due to the difference between samples or to the initial consumption of these products [ ] . moreover, in spain, the purchase of snacks, baking flour, and bread suffered a substantial increase. during confinement, chicken, turkey and/or rabbit meat, and pasta and rice consumption decreased. physical activity plays an essential role in the achievement of the beneficial effects of the food in health, as they are like a tandem that always must be together: healthy diet and physical exercise. concerning our studied sample, . % did not practice any physical activity before confinement, which slightly increased to . % during confinement. this lack of physical activity is more remarkable in women than men ( . % versus . % prior to confinement and . % versus . % during confinement). our data are closer to those reported by zaragoza-martí et al., in [ ] where . % and . % of the subjects did not exercise before and during confinement, respectively. the increase in subjects that did not practice any physical exercise was lower in our study. our outcomes were higher than those reported by other studies, regarding the number of subjects that practiced physical activity during confinement ( . % versus . %) [ ] . regarding weekly sessions of physical activity, subjects who practiced between - sessions per week were the most prevalent in our sample, slightly decreasing during confinement, as well as subjects that practiced - times per week. subjects that practiced ≥ sessions per week increased. this rise in the number of sessions during confinement also was reflected in other studies [ ] . furthermore, the number of participants that spent - min in physical practice during confinement increased ( . % versus . %), while decreasing the number of those who dedicated more than an hour ( . % versus . %). the increase in the number of sessions offset the time reduction, as the suggested objective for people who remained at home due to covid- confinement could be achieved ( min per week) [ ] . seen in a recent study, it was proved that confinement led to a greater usage of icts ( %) [ ] . our results show that . % of the subjects used icts for exercise research, videos and/or advice about physical activity. videos about yoga, pilates, or zumba were the most searched online. considering the strengths or contributions of our study, the main one is the examination of dietary patterns, consumption, and physical activity, all together, during an atypical period such as the domiciliary confinement. dietary habits and physical activity can be protective factors against weight gain during confinement, which would avoid the increase in obesity, diabetes, cardiovascular diseases, etc. [ ] . recent figures make us think how we could get back to this situation again, due to the number of people who become infected by the sars cov- virus, and the knowledge of these patterns may help us to propose strategies to fight physical inactivity and unbalanced diets, thus reducing the risk of disease as a result of them. it should not be forgotten, the promotion of teleworking and the follow-up of online lessons from students is attached to the increase in time sitting. one of the limitations found in our study, that could give rise to a selection bias, is a lack of similarity in the representation of each geographical area. additionally, there exists a larger percentage of women than men. the usage of a prepared questionnaire by a research team, due to the lack of a validated questionnaire, may prompt a bias, as questions might be directed and relevant information about other physical exercise factors may be lost. due to covid- restriction, there were difficulties in performing person-to-person questionnaires or interviews, requiring use of an online questionnaire where those subjects who do not receive that kind of information or who do not have internet access are excluded. mediterranean diet adherence slightly increased during confinement, however the consumption of 'unhealthy' food such as alcoholic beverages, snacks and sweets, confectionaries, also increased. additionally, the number of subjects that practiced physical activity decreased, as well as the time spent active weekly, although there was an increase in the number of sessions/week. the knowledge of eating habits and the practice of physical activity in the spanish population during confinement should guide government and/or academic agencies to propose strategies that could encourage a balanced and healthy diet (md) and physical activity practice during a new period of confinement or restrictions caused by covid- . funding: the authors received funding from danone nutricia to cover the costs for the publication of the article. there was no other funding received for the completion of the study. understanding of covid- based on current evidence current status of epidemiology, diagnosis, therapeutics, and vaccines for novel coronavirus disease review of the clinical characteristics of coronavirus disease (covid- ) impact of sedentarism due to the covid- home confinement on neuromuscular, cardiovascular and metabolic health: physiological and pathophysiological implications and recommendations for physical and nutritional countermeasures the psychological impact of quarantine and how to reduce it: rapid review of the evidence covid- confinement and health risk behaviors in spain cambios en el comportamiento alimentario en la era del covid- clinical features of patients infected with novel coronavirus in wuhan adherence to the mediterranean diet in spanish population and its relationship with early vascular aging according to sex and age: eva study cancer and mediterranean diet: a review adherence to the mediterranean diet and risk of stroke and stroke subtypes a -item mediterranean diet assessment tool and obesity indexes among high-risk subjects: the predimed trial is diet partly responsible for differences in covid- death rates between and within countries? prevalencia de sobrepeso y obesidad en españa en el informe "the heavy burden of obesity changes in weight and nutritional habits in adults with obesity during the "lockdown" period caused by the covid- virus emergency dietary choices and habits during covid- lockdown: experience from poland covid- confinement and changes of adolescent's dietary trends in italy changes in dietary behaviours during the covid- outbreak confinement in the spanish covidiet study adherencia a la dieta mediterránea y su relación con el estado nutricional en personas mayores eating habits and lifestyle changes during covid- lockdown: an italian survey dietary and lifestyle changes during covid- and the subsequent lockdowns among polish adults: a cross-sectional online survey plifecovid- study covid- and the subsequent lockdown modified dietary habits of almost half the population in an italian sample traininginhome-home-based training during covid- (sars-cov ) pandemic: physical exercise and behavior-based approach effects of covid- home confinement on eating behaviour and physical activity: results of the eclb-covid international online survey positive and negative changes in food habits, physical activity patterns, and weight status during covid- confinement: associated factors in the chilean population we appreciate all the people that has collaborated in this project through their participation and the dissemination of the questionnaire. the authors declare no conflict of interest. key: cord- - eegeu authors: pellegrini, marianna; ponzo, valentina; rosato, rosalba; scumaci, elena; goitre, ilaria; benso, andrea; belcastro, sara; crespi, chiara; de michieli, franco; ghigo, ezio; broglio, fabio; bo, simona title: changes in weight and nutritional habits in adults with obesity during the “lockdown” period caused by the covid- virus emergency date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: eegeu our aim is evaluating the changes in weight and dietary habits in a sample of outpatients with obesity after month of enforced lockdown during the covid- pandemic in northern italy. in this observational retrospective study, the patients of our obesity unit were invited to answer to a -question multiple-choice questionnaire relative to weight changes, working activity, exercise, dietary habits, and conditions potentially impacting on nutritional choices. a multivariate regression analysis was performed to evaluate the associations among weight/bmi changes and the analyzed variables. a total of subjects ( . %) completed the questionnaire. mean self-reported weight gain was ≈ . kg (p < . ). lower exercise, self-reported boredom/solitude, anxiety/depression, enhanced eating, consumption of snacks, unhealthy foods, cereals, and sweets were correlated with a significantly higher weight gain. multiple regression analyses showed that increased education (inversely, β = − . ; %ci − . , − . , p = . ), self-reported anxiety/depression (β = . ; . , . , p = . ), and not consuming healthy foods (β = . ; . , . , p = . ) were significantly associated with increased weight gain. the estimated direct effect of self-reported anxiety/depression on weight was . kg ( . , . , p < . ). individuals with obesity significantly gained weight month after the beginning of the quarantine. the adverse mental burden linked to the covid- pandemic was greatly associated with increased weight gain. the pandemic of the coronavirus sars-cov- (covid- ) has caused significant disruption in everyday lifestyle. in italy, at the beginning of march, an important growth in infections and deaths was observed [ ] ; the whole country became a protected zone, with severe restrictive national measures, such as the closure of all activities not considered essential, including schools/university, sport activities, shops, and factories [ , ] . people had to stay at home and were only allowed to go out to buy food or for health reasons; all working activities were suspended or turned into smart working at home, except for essential activities (health workers, food supply and sale, cleaning of cities, and police, etc.). therefore, since the th of march, , the month of the start of the "lockdown", millions of italians were forced to remain at home. this enforced quarantine can have a heavy psychological impact, above all among persons with obesity who are already at risk of social isolation and experiencing higher rates of depression [ ] . the mental health burden during the covid- outbreak has been evaluated by a few studies, and an increased rate of anxiety disorder, depressive symptoms, perceived stress, post-traumatic stress disorder, and poor sleep quality has been reported [ ] [ ] [ ] [ ] [ ] [ ] . usual lifestyle habits have been heavily disrupted by the mandatory stay-at-home orders, which may result in important behavior changes, particularly dietary habits, in this kind of natural experiment, "forced" by an unpredictable emergency [ ] . the rise in unstructured time might induce overeating and increase screen time. furthermore, social isolation might worse lifestyle behaviors with enhanced sedentarism, as well as decreased outdoor time and increased weight gain [ ] . it has been hypothesized that the increased out-of-school time may exacerbate the weight gain of children in a similar way to summer recess [ ] . no other data about the effects of quarantine in adult individuals with obesity are currently available. the objective of the present observational study was to evaluate the changes in weight and dietary habits in a sample of individuals with obesity attending our obesity unit after month of enforced lockdown. this was an observational retrospective study. all the patients of the obesity unit of the diabetes and metabolic diseases clinic of the città della salute e della scienza hospital of torino were enrolled. we included in the study all the patients who currently attend the weight loss program. in our unit, we take care of patients with bmi > kg/m and < kg/m , aged - years. dropouts (i.e., those who do not attend the scheduled appointment and either do not answer a call or declare that they no longer want to participate in the program) were excluded from the study. our patients followed a -month multidisciplinary weight loss program that included at least six meetings. supplementary visits could be scheduled in specific cases, such as the prescription of drugs or a very-low-calorie diet. during the first appointment, the patients received two group sessions (one by trained nurses who welcomed participants, evaluated the motivation, and discussed their strengths, weaknesses, opportunities, and one of nutritional education by dieticians) and individual visits with the endocrinologists, the psychologists and the dieticians. during follow-up, participants were initially visited by dieticians and endocrinologists every month and, after the first days, every months, with supplementary visits in case of specific needs. all patients received verbal and written dietary, exercise, and behavior recommendations. a personalized diet was prescribed according to the mediterranean diet ( - % carbohydrates, < % sugars, % fats, < % saturated fats, - % proteins, and - g fiber) with a - kcal energy restriction, based on the individual usual assumption and caloric needs. patients were asked to weigh themselves every day. a moderate exercise, such as at least min/week of brisk walking plus min/week of exercise against resistance, was prescribed and a leaflet on examples of home exercises was given to all patients. psychologists specialized in obesity treatment screened all attenders during the first visit to evaluate the need for further individual sessions for selected patients during the weight-loss program; a group session about motivation, how to recognize and manage emotional eating, relapse prevention, and self-manage social gatherings was delivered by the psychologists during the second visit. the research team developed a series of items which were then grouped and prioritized, based on a review of the literature, the feedbacks obtained during our group sessions about patients' difficulties in diet maintenance, and a consultation with clinical experts. a -question multiple-choice questionnaire was prepared. a cognitive debriefing of the questionnaire was performed with patients selected using the method of purposive sampling. interview content was analyzed informally. after providing informed consent, patients completed the questionnaire; a psychologist (es), experienced at interviewing, conducted individual telephone interviews with patients with the aim to assess the readability of the questions and the acceptability of the questionnaire. two questions, which were deemed unclear, were then reformulated. the questions were relative to the weight before and after month of lockdown and working activity and exercise during quarantine, with many items related to the changes in dietary habits and the conditions potentially impacting on nutritional choices. exercise during the lockdown was considered as practicing at home (indoor exercise bike, treadmill, and resistance training) or jogging/running around the house, given that it was not possible either to participate in organized sports or perform other outdoor activities. a snack was considered as every eating occasion between main meals. according to our weight loss program, patients should weigh themselves every day with the same scale. they were asked to report their weight on the th of march and at the date of the questionnaire compilation (see below). night eating syndrome was diagnosed in the presence of recurrent episodes of night eating, as manifested by eating after awakening from sleep or by excessive food consumption after the evening meal, with awareness and recall of the eating, without association with effects of medications, another medical or mental disorder, or external influences (such as changes in the individual s sleep-wake cycle or local social norms), in line with the dsm- criteria [ ] . weight cycling was defined in the presence of > weight-loss cycles followed by weight regain. a dedicated researcher contacted the patients by phone and explained to the patients how to fill out the questionnaire. the questionnaire was sent by e-mail on the th of april, . the patients completed it in autonomy and returned it between the th of april and the st of april. patients were strongly requested to be truthful and to answer carefully in order to ensure the quality of the survey. in cases, patients were unable to fill in the questionnaire by email and completed it by telephone interview with the same researcher. clinical and sociodemographic data referring to the first ambulatory visit were extracted from the clinical records. at the first visit, the following anthropometric measurements were assessed: weight (measured with the participant wearing light clothes and no shoes to the nearest . kg by a mechanical column scale, seca model , hamburg, germany), height (measured to the nearest . cm with a stadiometer, seca measuring rod, hamburg, germany), waist and neck circumferences (measured by a plastic tape meter respectively at the umbilicus level or under the cricoid cartilage). each patient gave his/her verbal informed consent to participate to the study. the study protocol was approved by the ethics committee of the città della salute e della scienza hospital of turin. within-group weight and bmi variations were analyzed by t-test for paired samples. the changes in weight and bmi (values after -month of lockdown minus values before quarantine) did not show a normal distribution. differences in weight/bmi changes were analyzed by mann-whitney test (two groups) or by kruskal-wallis test (three groups). a multiple regression model was performed to evaluate the association among weight/bmi changes and the variables which resulted significantly different between the various categories. a regression path model was applied to test the hypothesis that not healthy food choice could mediate the effects of self-perceived anxiety/depression on weight gain. a total of patients were invited to participate in the survey; participants completed the questionnaires and were included in the analysis, while ( . %) either refused to participate, were not reachable, or provided incomplete answers to the questionnaire. the baseline characteristics of the participants are described in table and did not significantly differ from those of non-participants (data not shown). the mean duration of the attendance at our obesity unit was . months (table ) . on average, during the lockdown period, self-reported weight and bmi significantly increased by . kg (p < . by t-test for paired samples) and . kg/m (p < . ), respectively. the answers to the questionnaire are shown in table . most individuals either did not exercise or reduced their level of physical activity, and a great number of unhealthy nutritional behaviors were evident. the changes in weight and bmi according to those answers are shown in table . a significantly higher weight and bmi increase was evident in individuals with lower education, who reported lower exercise, self-reported boredom/solitude, anxiety/depression, enhanced eating, and consumption of unhealthy foods, snacks, cereals, and sweets. is the same as before quarantine is more than before quarantine . i buy/consume more fresh food than before quarantine (including fruit and vegetables) the increased consumption of snacks, cereals, and sweets were all highly correlated (p < . by the chi-square test). by assessing their individual association with both weight and bmi changes in a multiple regression model, after adding education and exercise level, self-reported boredom/solitude, and anxiety/depression, only sweets consumption was significantly associated with weight/bmi changes. then, a multiple regression analysis was run, with the inclusion of all the variables significantly associated with increased weight and bmi, except cereals and snacks consumption (table ) . no multicollinearity between variables included in the multivariate analysis was found, since all variables showed a variance inflation factor lower than . . lower education level, self-reported anxiety/depression, and not consuming healthy foods were significantly associated with increased weight and bmi gain during the lockdown period. to evaluate whether not-healthy food choices could mediate the effects of self-reported anxiety/depression on weight gain, a regression path model was applied. in the presence of self-reported anxiety/depression, the estimated weight gain was . kg ( %ci . - . ; p < . ); the estimated direct effect of anxiety/depression was . kg ( %ci . - . ; p < . ), while the indirect effect linked to unhealthy choices accounted for . kg ( %ci . - . ; p = . ). we found that patients with obesity attending an obesity unit in northern italy showed a ≈ . kg self-reported weight gain after the first month of lockdown. lower education level, self-reported anxiety/depression, and not paying attention to the healthiness of food choices were significantly associated with weight and bmi increase. italy was the first european country to be deeply affected by the covid− pandemic and to undertake severe restrictive measures at a national level. this implied a greater risk of sedentarism and exercise reduction on one side, but on the other, an increased possibility to eat almost every meal at home, the impossibility to consume restaurant/cafeteria meals, and the availability of more time to cook, with lower need for ready meals, usually rich in fats, sugars, and salt. accordingly, most of our patients showed a reduction both in their exercise level and, likely, in physical activity during work, as only % continued to go to the workplace during quarantine. indeed, even though all our patients received personalized nutritional advice and on average have been attending our unit for six months, they reported many unhealthy dietary habits, such eating more ( %), not paying attention to the healthiness of the consumed food ( %), consuming more sweets ( %), more snacks ( %), more frozen/canned foods ( %), and less fruit and vegetables than before ( %). among those, not paying attention to the healthiness of food was the behavior most strongly associated with weight gain, with a more than % increased risk. in italian children and adolescents with obesity, unfavorable changes in eating, sleep, and activity behaviors occurred during the lockdown period with the school closure [ ] . no data about their weight changes were available. thus, these were the first available data about changes in nutritional habits and weight during the current quarantine. low education might be a proxy for low socioeconomic level, a condition potentially impacting on food choice (greater purchase of more shelf-stable, highly processed foods at the expense of less processed, less energy-dense, fresh, perishable foods which are usually more expensive). indeed, the increased social isolation, loneliness, boredom, anxiety, and depression generated by the pandemic might have played major roles in the lifestyle changes. in particular, self-reported anxiety/depression was the strongest predictor of weight gain in our patients. it is well known that emotional changes and mood disorders influence food choices, with the search for comfort foods, such as processed snacks and sweets [ ] [ ] [ ] . an increased rate of depression and anxiety disorders has been described during the covid- pandemic [ ] [ ] [ ] [ ] [ ] [ ] . the anxiety/depression reported by our patients was strongly associated with weight gain and resulted in being the more relevant factor in predicting increase in body weight, after adjusting for consuming unhealthy foods. these data suggest the pressing need to provide individuals with obesity-particularly those more vulnerable individuals-with tools, such as telemedicine instruments, to offer lifestyle information and interventions, and psychological support and guidance to maintain healthy choices, also in consideration of the uncertainty of the quarantine duration. furthermore, individuals with obesity are at increased risk of either chronic or acute diseases, including covid- infection and complications, as suggested by growing evidence [ ] [ ] [ ] . the increased risk is due to multiple factors [ ] ; in particular, excess ectopic fat might reduce both protective cardiorespiratory reserves, as well as potentiate the immune dysregulation and pro-inflammatory response, and have detrimental effects on lung function [ , ] . finally, the consumption of unhealthy diets has been proposed to adversely impact on susceptibility to covid- and recovery [ , ] . increasing weight might be a vicious circle leading to increased infection risk so that, now, obesity and covid- infection can be considered two public healthy pandemics colliding [ ] . the present study had several limitations. the retrospective design of the study allowed us to estimate associations only and the sample size was small. weight was self-reported and not measured; similarly, self-reported questionnaires were used. those data may have been affected by bias and low reliability. ad-hoc psychometric questionnaires were not employed. anxiety and depression were combined in the same item. other potential confounders have not been examined. the majority of our patients were women; however, the same gender distribution was reported by most published studies on outpatients as well [ ] [ ] [ ] . indeed, our results were consistent; our sample size (n = ) achieved a % power with a significance level (alpha) of . to evaluate the associations with weight changes. this was the first study analyzing weight and dietary changes in adults during the lockdown period. a small cohort of individuals with obesity significantly gained weight month after the beginning of the lockdown period. the adverse mental burden linked to the covid- pandemic might be associated with their increased weight. further larger studies on this topic are needed to confirm these preliminary results obtained in a limited number of patients. epidemiological trends of covid- epidemic in italy during spread and dynamics of the covid- epidemic in italy: effects of emergency containment measures covid and the patient with obesity-the editors speak out generalized anxiety disorder, depressive symptoms and sleep quality during covid- outbreak in china: a web-based cross-sectional survey the depressive state of denmark during the covid- pandemic immediate psychological responses and associated factors during the initial stage of the coronavirus disease (covid- ) epidemic among the general population in china the effect of covid- on youth mental health affective temperament, attachment style, and the psychological impact of the covid- outbreak: an early report on the italian general population covid- and mental health: a review of the existing literature the covid- pandemic: a global natural experiment. circulation lifestyle behaviours during the covid- -time to connect covid- -related school closings and risk of weight gain among children american psychiatric association. diagnostic and statistical manual of mental disorders (dsm- ) effects of covid- lockdown on lifestyle behaviors in children with obesity living in verona, italy: a longitudinal study characteristics of eating in anger, fear, sadness and joy do negative emotions predict alcohol consumption, saturated fat intake, and physical activity in older adults? how emotions affect eating: a five-way model obesity: the "achilles heel" for covid- ? metabolism association of obesity with disease severity among patients with covid- is adipose tissue a reservoir for viral spread, immune activation and cytokine amplification in covid- obesity a risk factor for severe covid- infection: multiple potential mechanisms targeting the adipose tissue in covid- the impact of nutrition on covid- susceptibility and long-term consequences nutrition amid the covid- pandemic: a multi-level framework for action adherence to a mediterranean diet and long-term changes in weight and waist circumference in the epic-italy cohort adherence to the mediterranean diet is inversely associated with visceral abdominal tissue in caucasian subjects expected benefits and motivation to weight loss in relation to treatment outcomes in group-based cognitive-behavior therapy of obesity we are grateful to paola scuntero, patrizia la perna, stefania piccirillo, nadia lobina for their precious work at our obesity unit. the authors declare no conflict of interest. key: cord- -sis k authors: mehmel, mario; jovanović, nina; spitz, urs title: nicotinamide riboside—the current state of research and therapeutic uses date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: sis k nicotinamide riboside (nr) has recently become one of the most studied nicotinamide adenine dinucleotide (nad(+)) precursors, due to its numerous potential health benefits mediated via elevated nad(+) content in the body. nad(+) is an essential coenzyme that plays important roles in various metabolic pathways and increasing its overall content has been confirmed as a valuable strategy for treating a wide variety of pathophysiological conditions. accumulating evidence on nrs’ health benefits has validated its efficiency across numerous animal and human studies for the treatment of a number of cardiovascular, neurodegenerative, and metabolic disorders. as the prevalence and morbidity of these conditions increases in modern society, the great necessity has arisen for a rapid translation of nr to therapeutic use and further establishment of its availability as a nutritional supplement. here, we summarize currently available data on nr effects on metabolism, and several neurodegenerative and cardiovascular disorders, through to its application as a treatment for specific pathophysiological conditions. in addition, we have reviewed newly published research on the application of nr as a potential therapy against infections with several pathogens, including sars-cov- . additionally, to support rapid nr translation to therapeutics, the challenges related to its bioavailability and safety are addressed, together with the advantages of nr to other nad(+) precursors. in recent years, interest in nad + biology has been gaining momentum, revealing critical insights into its roles in numerous physiological processes and underlining the beneficial effects of supplementation with its precursors. moreover, accumulating evidence indicates that a decrease in nad + levels contributes to the development of age-associated pathophysiology [ ] [ ] [ ] . the systemic nad + decrease is caused by both lowered rates of biosynthesis and increased use of nad + . the immense demand for nad + is caused by its importance in cellular oxidation-reduction reactions, including the majority of catabolic and anabolic reactions, such as glycolysis, fatty acid β-oxidation, tricarboxylic acid cycle, synthesis of fatty acids, cholesterol, steroids, etc. [ ] [ ] [ ] . additionally, nad + -consuming enzymes, such as sirtuins, poly-adp-ribose polymerases (parps), cadp-ribose synthases (cd / ectoenzymes) [ ] [ ] [ ] and mono-adp-ribose transferases (arts) contribute to an overall depletion of nad + . biosynthesis can compensate somewhat to the depleted levels of nad + via de novo synthesis from tryptophan (trp) or in the salvage pathways from four other precursors, figure . nad + synthesis pathways. the figure depicts nad + de novo pathway from tryptophan (trp) through quinolinic acid (qa), preiss-handler pathway from nicotinic acid (na) via nicotinic acid adenine dinucleotide (naad) and nad synthetase (nads), and "salvage pathways" from nicotinamide riboside (nr) and nicotinamide mononucleotide (nmn) via purine nucleoside phosphorylase (np) and nicotinamide phosphoribosyltransferase (nampt) enzymes or nicotinamide ribose kinases (nrk) and nmn/namn adenylyltransferases (nmnat), respectively. figure . nad + synthesis pathways. the figure depicts nad + de novo pathway from tryptophan (trp) through quinolinic acid (qa), preiss-handler pathway from nicotinic acid (na) via nicotinic acid adenine dinucleotide (naad) and nad synthetase (nads), and "salvage pathways" from nicotinamide riboside (nr) and nicotinamide mononucleotide (nmn) via purine nucleoside phosphorylase (np) and nicotinamide phosphoribosyltransferase (nampt) enzymes or nicotinamide ribose kinases (nrk) and nmn/namn adenylyltransferases (nmnat), respectively. the importance of nad + is reflected through the activity of nad + -depleting enzymes, the mediators of aging, which are mostly induced by stress factors, such as dna damage, oxidative stress, and inflammation. the major downstream mediators are sirtuins, the nad + -dependent deacetylases/deacylases. sirtuins are conserved regulators of aging and longevity in diverse organisms, and regarded as the master switches of metabolism [ ] due to their numerous regulatory functions in metabolism, dna repair, stress response, chromatin remodeling and circadian rhythm. (table ) [ , ] . together with sirtuins, parps use nad + to produce a chain of adp-ribose (adpr) molecules. parp and parp respond to dna breaks in the nucleus and facilitate the process of dna repair [ ] . as dna damage accumulates over time, the activation of parps increase, which in turn, lowers the activity of sirt due to both substrate competition and parp s ability to bind to the promoter of sirt and repress its expression [ ] . furthermore, the content of the primary nadase in mammals, cd , increases with age. this enzyme uses nad + to produce and hydrolyze the ca + -mobilizing second messenger, cadp-ribose [ ] [ ] [ ] . cd can also degrade the nad + intermediates, nr and nmn [ , ] , which further decreases the content of nad + [ ] . the effect of cd on nad + content was demonstrated in cd -deficient mice, whose nad + levels remain high. this preserves mitochondrial respiration and metabolic function with age [ ] . moreover, the inhibition of cd can increase nad + levels and improve glucose and lipid metabolism [ ] . apart from the ectoenzymes cd and cd , sarm (sterile alpha and toll/interleukin- receptor motif-containing ) is an additional nad + -depleting enzyme that uses nad + to promote axonal degeneration after injury and thereby decreases its overall content [ ] . nutrients , , x for peer review of figure . activation of the nmrk pathway represent a common adaptive mechanism in the failing heart where nad + levels are low. nad + synthesis from nr through the nmrk pathway may be favored, as the nmn synthesis from nr by nmrk enzymes requires only one atp molecule while synthesis from nam by nampt requires at least three atp equivalents. the importance of nad + is reflected through the activity of nad + -depleting enzymes, the mediators of aging, which are mostly induced by stress factors, such as dna damage, oxidative stress, and inflammation. the major downstream mediators are sirtuins, the nad + -dependent deacetylases/deacylases. sirtuins are conserved regulators of aging and longevity in diverse organisms, and regarded as the master switches of metabolism [ ] due to their numerous regulatory functions in metabolism, dna repair, stress response, chromatin remodeling and circadian rhythm. (table ) [ , ] . together with sirtuins, parps use nad + to produce a chain of adp-ribose (adpr) molecules. parp and parp respond to dna breaks in the nucleus and facilitate the process of dna repair [ ] . as dna damage accumulates over time, the activation of parps increase, which in turn, lowers the activity of sirt due to both substrate competition and parp ′s ability to bind to the promoter of sirt and repress its expression [ ] . furthermore, the content of the primary nadase in mammals, cd , increases with age. this enzyme uses nad + to produce and hydrolyze the ca + -mobilizing second messenger, cadp-ribose [ ] [ ] [ ] . cd can also degrade the nad + intermediates, nr and nmn [ , ] , which further decreases the content of nad + [ ] . the effect of cd on nad + content was demonstrated in cd -deficient mice, whose nad + levels remain high. this preserves mitochondrial respiration and metabolic function with age [ ] . moreover, the inhibition of cd can increase nad + levels and improve glucose and lipid metabolism [ ] . apart from the ectoenzymes cd and cd , sarm (sterile alpha and toll/interleukin- receptor motif-containing ) is an additional nad + -depleting enzyme that uses nad + to promote axonal degeneration after injury and thereby decreases its overall content [ ] . activation of the nmrk pathway represent a common adaptive mechanism in the failing heart where nad + levels are low. nad + synthesis from nr through the nmrk pathway may be favored, as the nmn synthesis from nr by nmrk enzymes requires only one atp molecule while synthesis from nam by nampt requires at least three atp equivalents. the immense involvement of nad + in all these processes suggests a significant potential for the treatment of various pathophysiological conditions with supplementation of nad + precursors. however, multiple options exist for supplementation, and the optimal precursor and dosage are still unclear with regard to the specific condition. for the baseline requirements of nad + synthesis, dietary tryptophan or less than mg of niacin (na, nam) daily are sufficient. however, growing evidence demonstrates that substantially greater rates of nad + synthesis exhibit numerous beneficial or even therapeutic effects, which can be achieved by supplementation of its intermediates. these intermediates are found in a wide variety of foods, including meat, eggs, dairy, certain vegetables and whole wheat [ , ] . specifically, nr is the third discovered nad + precursor that naturally occurs in milk and is already available as a nutraceutical. oral supplementation with nr has been shown to increase nad + levels in multiple tissues, along with increased sirt activity [ , ] , improved mitochondrial function [ ] , and regenerative potential of stem cells [ ] . furthermore, nr is currently regarded as a favorable precursor since it has not been implicated to have serious side effects or flushing as opposed to other nad + precursors [ , ] . nr chloride has been given gras status (generally regarded as safe) which further supports its rapid implementation as a drug-like therapy. however, to adapt nr technologies for therapeutic use, it is necessary to determine oral availability, therapeutic dosage, and utilization in different tissues. human digestion and the microbiome [ ] additionally play important roles in nr metabolism, which has yet to be characterized in detail. in this regard, we have summarized the available data from human and animal studies on nr effects on metabolic, neurodegenerative, and cardiovascular disorders, along with the advantages of nr over other available nad + precursors. we also considered immunomodulatory effects in this review, as recent data indicates that nr can support the treatment of infections, including those caused by sars-cov- that has resulted in the recent coronavirus pandemic. the current state of nr research including its bioavailability, safety, and effects on oxidative stress and longevity is described in this paper. we searched mostly the pubmed database for papers published in open-access peer-reviewed journals. in addition, we used available abstracts of papers or entire articles on researchgate without open access. we used publication date as a priority to select the papers, and most of the reviewed papers have been published within the last - years. older papers were considered more as a source of fundamental discoveries. additional databases were also searched via google using the following keywords: nicotinamide riboside (nr) bioavailability, nr safety, nr supplementation, nr effects on metabolism and insulin, nr effects on neurodegenerative disorders, nr effects on longevity, nr effects on liver health, and similar. along with its intermediates, nad + plays an essential role in metabolism, and evidence suggests that an increase in nad + levels can exhibit ameliorating effects on metabolic disorders, such as type diabetes (t d), metabolic syndrome, and nonalcoholic fatty liver disease (nafld) [ , , ] . furthermore, nr is one of the nad + intermediates that also serves as a precursor of nadh, as well as hepatic nadp + and nadph [ ] . since the hepatic nad + metabolome is regarded as a function of prediabetic (pd) and t d mouse models, nadp + and nadph can be used to assess the progression of the disease. namely, both nadp + and nadph are important for resistance to oxidative stress, while nadph is thought to be the major contributor to insulin resistance [ ] . the significantly decreased levels of hepatic nadp + and nadph in pd and t d mice are restored with supplementation of nr [ ] . in mice models, nr can increase nad + metabolism and thereby improve glucose tolerance, reduce weight gain, and exhibit neuroprotective effects against diabetic neuropathy and liver steatosis [ ] . similarly, in mice models of high-fat-induced obesity, a dose of dietary nr as small as mg/kg/day was shown to improve insulin sensitivity and protect mice from weight gain [ ] . however, these results have not yet been replicated in humans, as -week supplementation of nr with a dose of mg/day was not able to improve insulin sensitivity and other metabolic parameters in insulin-resistant, obese men [ ] . additional research is required to determine the long-term effects of nr on insulin sensitivity [ ] . on the other hand, there is evidence that nr administration in mice models increases the activity of sirt , an important factor in the prevention of t d and preservation of insulin sensitivity [ , ] . moreover, sirt inhibits effects of oxidative stress in t d mice [ ] , promotes glucose-stimulated insulin secretion from pancreatic β-cells [ , ] , and protects against insulin resistance in peripheral tissues [ ] , whilst sirt overexpression promotes fatty acid oxidation and inhibits lipogenesis, protecting the liver from steatosis. in addition, sirtuins are downregulated in nafld patients, a state characterized by liver steatosis [ ] . nafld is widely considered a hepatic manifestation of metabolic syndrome as it is found to be associated with t d, obesity, and insulin resistance [ ] . via activation of sirt and additional factors associated with cholesterol homeostasis, nr could potentially reduce cholesterol levels and improve liver health [ ] [ ] [ ] [ ] . fat accumulation is also potentially reduced through a mechanism that involves the induction of the mitochondrial unfolded protein response [ ] . in regenerating liver, nr reduces lipid accumulation, promotes hepatocyte replication, and increases hepatic atp content leading to a faster regaining of liver weight in mice [ ] . moreover, dietary supplementation of nr was able to restore nad + levels caused by impaired biosynthesis in a mouse model of hepatocellular carcinoma, and thereby prevent both dna damage and tumorigenesis [ ] . altogether, there is sufficient evidence indicating that increasing nad + content with nr supplementation can be considered a promising therapeutic strategy for metabolic dysfunctions, including t d and nafld. disruption of nad + homeostasis due to mitochondrial dysfunction is central in the development of cardiac hypertrophy and heart failure (hf) and has been reported in several models of hf including pressure overload, myocardial infarction, and angiotensin ii infusion [ ] [ ] [ ] [ ] [ ] [ ] . furthermore, a shift from fatty acid oxidation and oxidative phosphorylation to other forms of substrate metabolism (glycolysis and ketone oxidation) often occurs in the development of hf [ , ] , while the nad + /nadh ratio also decreases [ ] . the change in oxidative-reductive capacity further increases cardiac susceptibility to stress. the level of protein hyperacetylation also increases, driven by decreasing nad + -dependent deacetylation both in mouse models of hypertrophy and in human patients with ischemic hf or dilated cardiomyopathy (dcm) [ , ] . nr supplementation normalizes the myocardial nad + /nadh ratio and exhibits protective effects in adverse cardiac remodeling, while long-term supplementation increases nucleocytoplasmic protein acetylation by stimulating citrate and acetyl-coa metabolism and antioxidant gene expression [ ] . by improving nad + homeostasis and activating nmrk , nr can further prevent the deterioration of cardiac function and adverse remodeling, which are both early and persistent events in a mouse model of dcm leading to hf. in several models of cardiac injuries, the nampt enzyme is repressed [ ] , while nmrk expression is robustly upregulated [ ] . a similar shift was observed in human failing heart in models of cardiomyopathy [ ] . hence, it was proposed that the activation of the nmrk pathway represents a common adaptive mechanism in the failing heart, while the nmrk gene can be activated in response to nampt inhibition. furthermore, the shift from nampt to nmrk for nad + synthesis is an energy-sparing mechanism that may be favored, since nmn synthesis from nr by nmrk enzymes requires a single atp, while synthesis from nam by nampt requires more than three atp equivalents ( figure ). although the nmrk pathway is activated in the hf mice, the myocardial nad + level is depressed, which suggests that circulating and tissue levels of nad + precursors are insufficient to sustain cardiac nad + synthesis on a regular rodent diet. this supports the interest in nr supplementation to improve this condition. moreover, a strong beneficial effect of nr was discovered in mouse models of hf with the preservation of cardiac function and a limitation of cardiac remodeling, that was associated with maintained nad + levels in the heart. this further suggests that oral nr supplementation is a powerful approach to preserve cardiac function and limit remodeling in dcm. nad + precursor supplementation also has the potential to protect against adverse cardiac remodeling by additional mechanisms of activating sirts (table ) and maintaining ca + homeostasis [ ] . namely, in vivo activation of sirt protects against cardiac hypertrophy, metabolic dysregulation, and cardiac inflammation in a mouse model of cardiac hypertrophy, and exhibits protective effects in other models of cardiac dysfunction [ ] [ ] [ ] [ ] . in addition, sirt and sirt have emerged as prominent cardioprotective sirts [ , ] , as deficiency of sirt intensified cardiac hypertrophy in aged mice and mice stressed with angiotensin ii [ ] , while a loss of sirt in mice resulted in the development of cardiac hypertrophy and hf [ ] . the activity of mitochondrial sirts is implicated in cardiac remodeling and the development of hf, including sirt which appears to be required for maintaining cardiac function [ ] . data further suggests nr as a favored nad + precursor in mitochondria [ ] , while in vivo nr effects have been interpreted as dependent on mitochondrial sirtuin activities [ , ] . however, the importance of nucleocytosolic targets should not be excluded [ , ] . nr-induced reduction of systolic blood pressure (sbp) and aortic stiffness [ ] , two clinically important risk indicators of cardiovascular function and health [ , ] , may occur due to nuclear and cytosolic sirt activation (table ) . namely, nad + is an obligate substrate for the deacetylase sirt , which has been implicated in the maintenance of healthy vascular function [ ] [ ] [ ] . although nad + involvement in numerous physiological responses is not yet fully understood, documented health benefits in mice models validate the increasing interest in the translation of nr to therapy for cardiovascular diseases, especially in hf and cardiac hypertrophy. table . the roles of sirtuins in heart failure development acquired from experiments on knock-out and transgenic mice (adapted from pillai et al., [ ] ). heart cell growth and development, mediation of cardiac hypertrophy, protection from ischemic injury; partial deficiency protects from pressure overload-induced hypertrophy and failure sirt mediating ischemic injury due to attenuated programmed apoptosis sirt protection from age-induced hypertrophy, fibrosis and contractile dysfunction, prevents susceptibility to cardiac hypertrophic stimuli sirt protection from cardiac hypertrophy and heart failure sirt protection from spontaneous cardiac hypertrophy and inflammatory cardiomyopathy sirt low to moderate overexpression attenuates age-dependent decline in cardiac functions in mice, while high overexpression induces cardiac hypertrophy and heart failure sirt cardiac-specific overexpression protects the heart from hypertrophic stimuli by preserving mitochondrial function sirt cardiac-specific overexpression protects the heart from hypertrophic stimuli by blocking activation of akt signaling at the level of chromatin neurodegenerative disorders are associated with dna damage and oxidative stress, which accumulate with age [ ] leading to impaired mitochondrial function [ ] . in addition, nad + depletion was observed during the aging process in multiple animals, including humans, and is considered the major risk factor for alzheimer's disease (ad) [ ] . when administered in ad mouse models, nr displays beneficial effects on both oxidative stress and dna repair by increasing nad + levels [ ] . additionally, nr can improve other aspects of ad neuropathology including ptau, amyloid-β, neurogenesis, neuroinflammation, hippocampal synaptic plasticity, and cognition [ , ] . specifically, nr treatment reduce neuroinflammation and amyloidogenesis in the whole brain of high-fat diet (hfd)-fed mice, by decreasing amyloid-β levels and several inflammatory markers (nlrp , casp , il- , tnf-α, and il- ) [ ] . since brain inflammation is closely related to cognitive impairment [ ] [ ] [ ] , cognitive function and recognition memory could be attenuated by nr treatment in only weeks [ ] . furthermore, increased parylation, another hallmark of ad, could be decreased in ad mice with nr supplementation [ ] . increased parylation has also been detected in several other neurodegenerative disorders that involve dna repair defects, including cockayne syndrome, xeroderma pigmentosum and ataxia-telangiectasia. nevertheless, parp-mediated nad + depletion was recently confirmed to play a major role in the pathogenesis of these disorders. despite the underlying dna repair deficiencies, nr could dramatically improve the phenotype of each of these conditions in mouse models, while prolonging survival by more than three times in ataxic mice [ , ] . another early event that occurs in acute cerebral injury and in chronic neurodegenerative diseases, including alzheimer's and parkinson's diseases, is axonal degeneration [ ] [ ] [ ] [ ] . in such cases, axonal degeneration is caused by excitotoxicity, which is another feature implicated in most neurodegenerative disorders that affect the central nervous system. interestingly, a strong nad + depletion in neurons has been revealed during excitotoxicity [ ] [ ] [ ] [ ] , whereas mice injected with nr were protected from excitotoxicity-induced axonal degeneration [ ] . among three tested nad + precursors (na, nam, and nr) including nad + , only nr could prevent axonal degeneration by altering the local nr metabolism within the axon [ , ] . namely, nr prevented nuclear condensation and axonal degeneration in neurons of nmrk -ko mice, by inducing nmrk [ ] , which suggests that nmrk might be the key mediator of the neuroprotective activity of nr. this neuroprotective effect depends on both mitochondrial and axonal nad + content [ ] . at present, two possible mechanisms of neuroprotection have been proposed: increasing mitochondrial nad + to support sirt [ ] and preserving axonal nad + to supply damage-induced sarm activation [ ] . via sirt activation, a nr-induced increase in nad + levels can have additional beneficial and possible therapeutic effects. specifically, nr has been shown to prevent noise-induced hearing loss and neurite retraction from hair cells in the inner ear through a sirt -dependent mechanism [ ] . moreover, sirt and are both critical for the health of retinal photoreceptors [ ] . sirt activity is sensitive to the reduction of nad + content that has been detected in multiple disorders with retinal degeneration, including age-associated dysfunction, diabetic retinopathy, and light-induced degeneration in mice [ ] . this suggests a potential therapeutic treatment with nr for a variety of disorders that include photoreceptor degeneration. furthermore, a general decrease in nad + levels has been observed in neuromuscular diseases which are often caused by inherited mutations that lead to progressive skeletal muscle weakness and degeneration [ ] . increasing nad + content with nr can stimulate energy production and improve mitochondria function.nr has been shown to have therapeutic effects in several muscle disorders in mouse models. although supplementation with nr could not correct the underlying genetic defects, it could improve mitochondrial abundance and function in two different mitochondrial myopathies [ , ] . furthermore, nr could reverse the progressive wasting syndrome in skeletal muscle in mice lacking nampt whilst restoring endurance, in as little as week of treatment [ ] . accordingly, nr was found to confer increased endurance and improved cold tolerance in the hfd-fed mice. however, whether nr has significant benefits in lean, healthy muscle is less clear, as only a nonsignificant trend toward increased endurance was observed in regular chow-fed mice [ ] . interestingly, decreased nad + levels and nampt expression were also observed in duchenne's muscular dystrophy (dmd), a condition histologically and transcriptionally similar to progressive wasting syndrome [ , ] . dmd is also characterized by increased parp activity, fibrosis, and muscular degeneration. nr was found to improve muscular function and heart pathology in mdx mice models of dmd and decrease parylation, inflammation, and fibrosis [ ] . moreover, nr treatment has been shown to improve stem cell function and thereby ameliorate the muscle wasting phenotype in mdx mice, supporting the use of nr for the human condition [ , ] . improvement in stem cell function appears to be a general phenomenon during nr treatment and has been suggested to underlie a small, but significant extension of lifespan in mice [ ] . altogether, these findings support that nr could be effective in managing the progression of muscular dystrophy and degeneration, by improving muscular strength, rejuvenating senescent muscle stem cells, and reducing levels of inflammation and fibrosis. calorie restriction (cr) is considered the most effective approach to extend lifespan in eukaryotes since the first report of lifespan extension in wild-type yeast cells via regulation of sir and nad + [ ] . cr life-prolonging effects may partly be mediated via increased sirtuin function, while the requirement of nad + for their activity suggests a possible connection between aging and metabolism. however, the nutritional approach for increasing sir activity and longevity has been accomplished by engineered gene overexpression in yeast [ ] , while na failed to extend lifespan, and nam shortened it [ , ] . on the other hand, as with cr, nr can increase nad + levels and sir function, while exogenous nr promotes sir -dependent repression of recombination, improves gene silencing, and extends lifespan without calorie restriction [ ] . moreover, the mechanism of action of nr is completely dependent on increased net nad + synthesis through the nrk and the urh /pnp / pathways. the latter is nrk independent and represents a newly discovered nr salvage pathway [ ] . furthermore, a study in mouse models documented that a one-day fast increases nad + in the liver [ ] whereas cr elevates nad + and reduces nam in the brain [ ] . this implies that the increased levels of nad + appear to mediate several beneficial effects of cr, supporting the life-prolonging effects of nr supplementation. these effects are mediated via improvement of metabolism and decrease in chronic inflammation, a hallmark of aging [ ] . preclinical studies have reported that nr reduces macrophage infiltration in damaged muscles [ , ] and attenuates plasma tnf-α in models of fatty liver disease [ ] . nevertheless, a recent clinical study confirmed nr availability in muscular tissue in aged human subjects [ ] and its anti-inflammatory effects. namely, a -day supplementation of nr decreased numerous circulating inflammatory cytokines [ ] , implying additional mechanisms through which nr can potentially modulate the aging process and thereby exhibit life-prolonging effects. while the exact mechanisms through which nr exerts these effects remain unclear, the apparent health benefits described indicate positive effects of nr on longevity. nad + intermediates have been recognized for their beneficial health effects during infection with several pathogens. studies have confirmed antimycobacterial effect of nam in patients infected with mycobacterium tuberculosis [ , ] , while immune-mediated elimination was reported for staphylococcus aureus, including mrsa and other major human pathogens such as klebsiella pneumoniae and pseudomonas aeruginosa [ ] . in addition, nam and its analogues exhibited antiviral effect in patients with hiv [ ] and hepatitis b [ ] . the potential treatment with nad + intermediates has been recognized recently for combating covid- infection that currently lacks efficient therapeutic or preventive agents and represents a global concern for public health. sars-cov- infection triggers a maladaptive immune response. notably an exaggerated proinflammatory response leading to a "cytokine storm" in the lung tissue, and lymphopenia with a drastic decline of cd + and cd + t cells [ ] . on the molecular level, as the innate immune response activates to fight the infection, the activation of parps increases due to extensive dna damage and ifn-induced marylation (mono-adp-ribosylation) of the target sars-cov- proteins [ , ] . parps response is required for inhibition of viral replication [ ] ; however, this antiviral effect is reversed by the adp-ribosylhydrolase macrodomain of the viral nonstructural protein, nsp , whose activity is required for virulence [ , , ] . in addition, nsp of sars-cov was found to inhibit electron transport at the nadh site of complex i in the mitochondrial electron transport chain [ ] , suggesting that key events in the innate immune response to viral infections are occurring within the infected cell's nad + metabolome [ ] . recent study investigated parps expression and nad + metabolome dysregulation due to coronavirus infection. the examined sars-cov- infected cell lines of a ferret and deceased patients' lungs showed disturbed nad + metabolism and gene expression with respect to synthesis and utilization of nad + [ ] . furthermore, the expression of the nmrk pathway was upregulated together with the expression of the concentrative nucleoside transporter cnt , indicating a higher capacity for nr conversion to nad + and nadp + during the infection [ ] . an upregulation of the nmrk gene was previously associated with therapeutic efficacy of nr [ , ] . in addition, the expression of nnmt (nicotinamide n-methyltransferase) was decreased [ ] due to lower nam methylation, suggesting a promotion of the nam salvage pathway [ ] and increased efficiency of nr treatment to replenish nad + [ ] . these data indicate that boosting nad + content through nam and nr kinase pathways may restore antiviral parps functions to support innate immunity to sars-cov- [ ] . upon activation of the adaptive immune response, the overexpression of cd in both cd + and cd + lymphocytes further exaggerates nad + depletion [ , ] leading to increased production and release of proinflammatory cytokines, reactive oxygen species, and macrophage infiltration [ , ] . furthermore, drastic nad + depletion impairs the function of sirtuins, the regulators of cell death and viability [ ] . specifically, sirt regulates the expression of genes including tumor suppressors, cytokines and proto-oncogenes and ultimately modulates inflammation, cell survival, and apoptosis mechanisms [ ] . loss of sirtuin function along with increased oxidative damage and an overall energy decrease finally culminates in cell death. replenishment of nad + body content could restore energy levels and impaired sirtuin function and possibly rebalance the maladaptive immune response to sars-cov- infection. namely, both sars-cov and sars-cov- induce maladaptive hyperinflammation followed by increased leucocyte infiltration into the lungs resulting in extensive tissue damage and subsequent organ failure with reduced lung capacity [ ] [ ] [ ] . emerging evidence has demonstrated that nad + is released during the early phase of inflammation and has an immunoregulatory role in vivo [ , ] . moreover, niacin was previously suggested as an anti-inflammatory therapy in one preclinical study as a potent agent to decrease proinflammatory cytokines, including il- , il- , and tnfα [ ] . nr can similarly decrease il- , il- , il- , and tnfα [ ] . targeting il- has been recently proposed as a promising treatment to block the inflammatory storm, especially in severe covid- patients [ ] . furthermore, niacin might also decrease neutrophil infiltration, while exhibiting a prolonged anti-inflammatory effect during ventilator-induced lung injury. however, niacin exacerbated hypoxemia regardless of the neutrophil infiltration decrease, suggesting a different cause of hypoxemia, independent of neutrophil decline [ , ] , which requires further investigation. in addition, high efficiency of vitamin b (niacin or nicotinamide) in preventing lung tissue damage was confirmed in several animal models with bleomycin-and lps-induced lung injury [ ] [ ] [ ] . considering vitamin b s strong lung-protective effects, it has been proposed as an early treatment-supporting agent against covid- [ ] . this implies that nr should be considered as a potential therapeutic or supporting agent to reduce hyperinflammation and regenerate damaged lung tissue. the bioavailability of nr can be tested by measuring nad + levels or other relevant biomarkers such as nicotinic acid adenine dinucleotide (naad) in the cells of the target tissue or in the blood. throughout numerous observations in a wide variety of mammalian cell lines including liver, skeletal muscles, and brown adipose tissue, nr was documented to enhance nad + levels [ ] . conversely, the nad + levels did not significantly increase in the brain or white adipose tissue [ ] . it was suggested that the observed differences are caused due to differential nmrk expression in the specific tissues. while nmrk is expressed ubiquitously, nmrk is mainly expressed in cardiac and skeletal muscles, but also detectable in the liver and brown adipose tissue which might explain the better ability of these tissues to respond to nr. on the other hand, nr is very unstable in the blood, which makes it difficult to measure and detect. despite its instability, the development of reliable methods for collection, processing, and measuring has enabled the determination of the pharmacokinetic profile of orally administered nr. the study conducted in both healthy human volunteers and mice reported that an nr dose of mg twice daily ( mg in total) can significantly increase steady-state, whole-blood levels of nad + (up to . fold after one dose) [ ] and effectively stimulate nad + metabolism [ , , ] . the studies also confirmed that measurable, biological effects on nad + levels can be achieved by chronic oral nr supplementation with no serious adverse effects [ , ] . specifically, there were no severe side effects reported such as flushing, pruritus, hyperglycemia, hyperuricemia, or increased enzyme activity in the liver or muscle [ ] [ ] [ ] [ ] . however, the blood nad + response did not appear to correlate with the absorption pattern of nr and the peak in nad + increase was reached after days [ ] . furthermore, it was suggested that repeated dosing would be required to prevent wide fluctuations in body levels of nr due to a relatively short elimination half-life of nr observed in several subjects; however, continuous blood levels of nad + suggest that twice-daily or even once-daily dosing of nr may be sufficient to achieve a desired clinical outcome [ ] . on the other hand, the apparent oral bioavailability of a mg dose of nr was highly variable among individuals [ ] . the instability of nr in blood samples observed across several studies [ , ] could be one contributing factor, although it cannot completely explain the observed variability. another proposed explanation was the nr hydrophilicity [ ] since nr is expected to exhibit low passive permeability across the human intestinal mucosa [ ] . additionally, the interindividual variation in the transport mechanism of nr in the intestinal system might also affect the oral absorption of nr. furthermore, it was proposed that nr can be degraded to nam in the gut, whereas, another study showed that nr is metabolized to nam in the liver and might explain low bioavailability in other tissues [ ] . subsequently, nam can be absorbed and converted to nmn, and further metabolized to nad + or dephosphorylated to nr. in this case, the degradation of nr to nam in the gut, which presumably involves purine nucleoside phosphorylase in mammalian and bacterial cells, may be the variable step involved in the oral intake of nr [ ] . furthermore, multiple pathways for the conversion of nr to nad + were identified in a study with male human subjects and c bl /j mice [ ] . interestingly, as a response to nr, a remarkable increase ( -fold) in naad was reported [ ] indicating another possible conversion pathway of the nr to nad + . these studies suggest that causes in the variable oral bioavailability might be revealed with further investigation of nr metabolism and transport. at the current time, nr is emerging as a leading candidate due to its bioavailability, safety, and strong ability to raise nad + content compared to other precursors [ ] . among diverse nad + precursors, nmn and nr presented better pharmacokinetic and pharmacological properties [ ] . the bioavailability between the nad + precursors (nmn, nr, nam, and na) was assessed in preclinical studies as the ability to elevate intracellular nad + . nr was able to increase nad + levels in the liver of mice, exhibiting greater oral bioavailability than nam, which was, in turn, more orally bioavailable than na [ ] . in addition, animal studies have reported that equimolar oral nr is superior to na and nam in elevating nad + content in the liver [ ] . similarly, the nad + content in muscles could be significantly increased with nr and na, but not with nmn [ ] . the three precursors (na, nmn, and nr) differed in the degree to which they promote the accumulation of adpr, the measure of sirtuins activity, and other nad + -consuming activities [ ] . namely, nr was found to increase adpr~ more than nam, which supports nr as a favored nad + precursor to increase nad + and nad + -consuming activities in the liver [ ] . moreover, the activity of sirtuins was stimulated after nr-induced nad + levels increased [ ] . both sirt and sirt activities increased in vitro and in vivo [ ] , which favors the hypothesis that nr can increase nad + levels in at least mitochondrial and nuclear compartments. nr's ability to increase nad + in different subcellular compartments represents the crucial difference compared to other approaches of increasing intracellular nad + levels. although all three precursors, na, nam, and nr can raise both nad + and nadp + levels [ , , ] , they all exhibit distinct physiological responses. for example, na shows lowering effects on blood lipid levels, and it is used to treat dyslipidemia [ ] . however, na is implicated with flushing at doses higher than mg/day [ ] . on the contrary, nam does not affect lipid blood levels, yet it can exhibit sirtuin-inhibiting effects at higher doses [ , ] . among the three mentioned precursors, only nr could prolong survival and induce hematopoietic stem cell regeneration, as documented in a study with mice treated with irradiation [ ] . furthermore, orally administered nr was found to improve resistance to and reversal of chemotherapeutic neuropathy [ ] . this implies advantages of the nr precursor for potential use in cancer patients undergoing chemo-or radiotherapy. the bioavailability of nad + precursors can be assessed by measuring naad levels. namely, naad represents the most sensitive biomarker of effective nad + supplementation since it is undetectable in the blood prior to supplementation, and the increase of its levels has been observed in the liver after orally administered nad + precursors. nr was found to increase naad by at least -fold compared to baseline [ ] . in addition, nr could significantly elevate naad heart content, where the increase of nad + occurs in the absence of a steady-state nad + increase [ ] . surprisingly na, the only precursor expected to convert to nad + through a naad intermediate, produced the least naad, while nam and nr both produced peaks of hepatic naad [ ] . high availability of nr has been observed in the normal human diet. nr does not require conversion to enter the cell, which could partially explain the high level of availability. on the contrary, nad + and its precursors have to be converted to either nr or nam before entering the cell [ ] . while nad + and nmn are being converted to nr extracellularly by cd [ ] , their cellular conversion depends on the nmrk pathway [ , ] . however, a nmn specific transporter in the gut encoded by slc a gene, has recently been identified by grozio et al. [ ] . hence, the utilization of nr and extracellular nad + are limited by the activity of the nmrk pathway [ ] . conversely, another candidate has recently emerged that can increase nad + levels through nmrk independent pathway. namely, one study reported that nr reduced form (nrh) is bioavailable in mice and indicated its great potential for therapeutic application [ ] . since nr is unstable in blood circulation, partially due to degradation to nam [ ] , its ability to reach the peripheral tissues after oral administration has been compromised [ ] . this limitation could be overcome by the administration of nrh as it appears to be more stable than nr and does not undergo direct degradation in plasma [ ] . nrh is detectable in circulation after oral intake or intraperitoneal injection, and it was found to increase nad + in both cultured cells ( - -fold above the baseline) [ , ] and mice, in a more potent and faster manner than nr. moreover, a nmrk-independent pathway for the nrh-induced nad + increase has been demonstrated [ ] , which is consistent with a recent discovery of a novel biosynthetic route of nad + from nrh through the nmnh intermediate, where adenosine kinase (adk) acts as a nrh kinase [ ] . this study also confirmed the presence of endogenous nrh in the liver of mouse models establishing nrh as a valid natural precursor of nad + . on the other hand, nr may be a more suitable nad + precursor regarding the side effects. although na and nam can enter the nad + salvage pathway, several preclinical studies have confirmed that both na and nam can cause painful flushing sensations at therapeutic doses or other toxic effects [ , , ] . although nmn exhibits significant beneficial pharmacological activities in preclinical studies, there is still a lack of sufficient clinical and toxicological data. to date, there are no available tests of nmn safety and human oral availability although recently, one clinical study with ten healthy men confirmed that a single oral dose ranging from - mg is safe and effective, with no significant deleterious effects [ ] . on the other hand, nr was confirmed across a number of studies as well-tolerated, up to g of a daily dose, and it was not found to be associated with flushing or any severe side-effects [ ] . specifically, nr administration can elevate nad + levels in mammalian cells and tissues without activating gpr a that mediates nicotinic acid-induced flushing [ ] . during the state of physiological equilibrium, biosynthetic pathways rely on dietary sources of tryptophan (trp), while nad + precursor vitamins are compensating during periods of nad + depletion. however, dietary precursors may become insufficient to maintain the nad + levels in pathological conditions [ , , ] , thereby emphasizing the necessity of nad + precursor supplementation. besides the well-known vitamin b supplements (na and nam), nr and its phosphorylated form (nmn) have only recently become orally available as precursors of nad + [ , , , ] . on the other hand, the synthesis and manipulation of nr remain challenging, especially regarding its relatively labile glycosidic bond and the instability of nr salts [ ] . however, great potential for the development of novel drugs and structural analogs of existing drugs can be achieved with the introduction of various chemical groups on the backbone of the molecule [ ] . in general, there are two reported categories of synthetic pathway for nicotinamide riboside salts (nr + x − ). since only the β-form of nr + has biochemical and medical relevance, a valuable method of nr + synthesis should provide high levels of β-stereoselectivity. from two main synthetic pathways of nr, only one is predominately exploited and developed in terms of synthetic efficiency, stereoselectivity, and overall yield [ ] . this method embodies the reaction between nam or its analogs or derivatives and a peracylated (halo)-d-ribofuranose, resulting in the acylated intermediate that is subsequently converted into the desired nr + x − [ , ] . the synthetic glycosylation conditions depend on the nature of the sugar component [ ] . these conditions differ whether -halo- , , -tri-o-acylor , , , -tetra-o-acyl-d-ribofuranose is used since fully acylated ribofuranoses require the use of friedel-crafts catalysts that need to be activated as glycosylation reagents [ ] . furthermore, the x-ray structures of nr salts have already been determined. the nr derivatives nicotinamide-β-d-riboside chloride, nicotinamide-β-d-riboside bromide, thionicotinamide-β-d-riboside bromide, nicotinamide-β-d-riboside triacetate bromide, and thionicotinamide-β-d-riboside triacetate bromide were successfully crystallized by the vapor diffusion method [ ] . moreover, it was found that a crystalline form of nicotinamide ribose chloride has advantageous properties compared to amorphous forms, considering the possibilities for better purification [ ] . however, further development of nr chemical synthesis along with a better understanding of the chemical versatility and reactivity of the ribosylated forms on the nicotinoyl moiety would offer more reliable, more scalable, and more reproducible preparations of nr + x − salts [ ] . in addition, effective modifications of the riboside residue of nr + at the -hydroxy position could ensure higher yields, better recovery, and improved purification strategies [ ] . this will enable the improved preparation of new pharmaceutically acceptable forms and potentially therapeutically useful forms of nr + in addition to the atom-efficient syntheses of isotopically labeled nr + analogs and derivatives [ ] . regarding a high demand for nr use in studies and for supplementation, new and reliable synthetic methods for nr production have been developed [ ] during the past few years, enabling larger quantities available for cell-based studies and animal feeding experiments [ , ] . nr has become available as a supplement in a form of crystalline chloride salt, in july , with the brand name niagen (chromadex inc., irvine, ca, usa). in a -day toxicology rat study, the crystalline form of nr chloride was tested and the lowest observed adverse effect level (loael) was mg/kg/day, whereas the no observed adverse effect level (noael) was mg/kg/day [ ] . nr has also been tested in six clinical trials [ , , , , , ] , where nr was established as safe for short ( days) [ ] and long-term ( weeks) [ , ] use along with confirmed oral availability [ ] . furthermore, a randomized -week placebo-controlled trial with three different doses (up to g) of nr, tested in overweight and healthy adults, reported that nr chloride is safe and orally available [ ] . remarkable discoveries regarding numerous beneficial health effects of nr in preclinical studies might finally culminate in a breakthrough, and enable treatment of a large number of metabolic and neurodegenerative disorders. nr effects are currently being investigated in a significant number of clinical trials [ ] , including research into diverse cardiovascular diseases, neural and cognitive functions, metabolic disturbances, muscular and kidney injuries, aging, chemotherapy. in addition, fundamental research on nr transport and metabolic pathways will further support a rapid translation to effective therapeutic use. the advantages of using nr over alternative nad + precursors, including its safety and efficiency, suggest the possible replacement of niacin as a general supplement in the near future. however, the use of nr as a nutritional supplement still has certain limitations with respect to its production methods, including low yield, the use of expensive or hazardous reagents, and pharmaceutically unacceptable species that may be toxic or biologically intolerable by other means. with the rising number of patents, these limitations are being overcome with the development of new or improved methods for chemical synthesis of nr and its derivatives. this will enable robust, cost-effective production with higher purity and stereoselectivity. extensive research into nr might also lead to its global availability in supplementation use and novel therapeutic strategies, most importantly for pathophysiological conditions that currently lack efficient treatment. funding: this research received no external funding. the authors declare the following competing financial interest(s): m.m and u.s. are employees of the biosynth carbosynth group, a corporation that sells various nicotinamide riboside derivatives. u.s. acknowledges that he has intellectual property related to methods to produce nr salts and possible uses thereof. royalties on sales of nr are expected to accrue to u.s. as inventor. no further conflicts of interest are declared. nad+ metabolism and the control of energy homeostasis: a balancing act between mitochondria and the nucleus nad+ and sirtuins in aging and disease nad+ in aging, metabolism, and neurodegeneration the importance of nampt/nad/sirt in the systemic regulation of metabolism and ageing the many faces of sirtuins: coupling of nad metabolism, sirtuins and lifespan mammalian sirtuins: biological insights and disease relevance nicotinamide mononucleotide activation of new dna-dependent polyadenylic acid synthesizing nuclear enzyme autocrine and paracrine calcium signaling by the cd /nad+/cyclic adp-ribose system transcriptional silencing and longevity protein sir is an nad+-dependent histone deacetylase discoveries of nicotinamide riboside as a nutrient and conserved nrkgenes establish a preiss-handler independent route to nad+ in fungi and humans nicotinamide riboside promotes sir silencing and extends lifespan via nrk and urh /pnp /meu pathways to nad+ the nad+ biosynthesis pathway mediated by nicotinamide phosphoribosyltransferase regulates sir activity in mammalian cells structure of nampt/pbef/visfatin, a mammalian nad+ biosynthetic enzyme nicotinic acid, nicotinamide, and nicotinamide riboside: a molecular evaluation of nad+ precursor vitamins in human nutrition nicotinamide mononucleotide, a key nad+ intermediate, treats the pathophysiology of diet-and age-induced diabetes in mice declining nad+ induces a pseudohypoxic state disrupting nuclear-mitochondrial communication during mapping nad+ metabolism in the brain of ageing wistar rats: potential targets for influencing brain senescence novel assay for simultaneous measurement of pyridine mononucleotides synthesizing activities allows dissection of the nad+biosynthetic machinery in mammalian cells metabolic profiling of alternative nad biosynthetic routes in mouse tissues specific ablation of nampt in adult neural stem cells recapitulates their functional defects during aging nad synthesis in animal tissues sirtuins: the "magnificent seven," function, metabolism and longevity it takes two to tango: nad+ and sirtuins in aging/longevity control parp- inhibition increases mitochondrial metabolism through sirt activation adp ribosyl cyclase activity of a novel bone marrow stromal cell surface molecule, bst- formation and hydrolysis of cyclic adp-ribose catalyzed by lymphocyte antigen cd synthesis and degradation of cyclic adp-ribose by nad glycohydrolases cd protein as a source of extracellular precursors for sustained nad+ biosynthesis in fk -treated tumor cells a pre-steady state and steady state kinetic analysis of the n-ribosyl hydrolase activity of hcd cd dictates age-related nad decline and mitochondrial dysfunction through an sirt -dependent mechanism regulation of intracellular levels of nad: a novel role for cd flavonoid apigenin is an inhibitor of the nad+ ase cd : implications for cellular nad+ metabolism, protein acetylation, and treatment of metabolic syndrome the sarm toll/interleukin- receptor domain possesses intrinsic nad+ cleavage activity that promotes pathological axonal degeneration sirt regulation of mitochondrial quality control in neurodegenerative diseases long-term administration of nicotinamide mononucleotide mitigates age-associated physiological decline in mice the biology and therapeutic potential of nmn and nr the nad(+) precursor nicotinamide riboside enhances oxidative metabolism and protects against high-fat diet-induced obesity nad + repletion improves mitochondrial and stem cell function and enhances life span in mice chronic nicotinamide riboside supplementation is well-tolerated and elevates nad+ in healthy middle-aged and older adults nicotinamide riboside opposes type diabetes and neuropathy in mice reactive oxygen species have a causal role in multiple forms of insulin resistance a randomized placebo-controlled clinical trial of nicotinamide riboside in obese men: safety, insulin-sensitivity, and lipid-mobilizing effects eliciting the mitochondrial unfolded protein response by nicotinamide adenine dinucleotide repletion reverses fatty liver disease in mice sirt activation protects the mouse renal medulla from oxidative injury sirt regulates insulin secretion by repressing ucp in pancreatic beta cells increased dosage of mammalian sir in pancreatic beta cells enhances glucose-stimulated insulin secretion in mice sirt protects against high-fat diet-induced metabolic damage direct evidence of sirtuin downregulation in the liver of non-alcoholic fatty liver disease patients uric acid regulates hepatic steatosis and insulin resistance through the nlrp inflammasome-dependent mechanism fxr acetylation is normally dynamically regulated by p and sirt but constitutively elevated in metabolic disease states sirt deacetylates and positively regulates the nuclear receptor lxr pgc- alpha activates cyp a and bile acid biosynthesis conserved role of sirt orthologs in fasting-dependent inhibition of the lipid/cholesterol regulator srebp nicotinamide adenine dinucleotide biosynthesis promotes liver regeneration inhibition of de novo nad(+) synthesis by oncogenic uri causes liver tumorigenesis through dna damage cardiac metabolism and its interactions with contraction, growth, and survival of cardiomyocytes mitochondrial centrality in heart failure the failing heart-an engine out of fuel nicotinamide adenine dinucleotide homeostasis and signalling in heart disease: pathophysiological implications and therapeutic potential exogenous nad blocks cardiac hypertrophic response via activation of the sirt -lkb -amp-activated kinase pathway the function of nicotinamide phosphoribosyltransferase in the heart the failing heart relies on ketone bodies as a fuel mitochondrion as a target for heart failure therapy-role of protein lysine acetylation mitochondrial complex i deficiency increases protein acetylation and accelerates heart failure nicotinamide riboside preserves cardiac function in a mouse model of dilated cardiomyopathy mechanisms of altered ca + handling in heart failure sirt regulates aging and resistance to oxidative stress in the heart de angelis, a.; urbanek, k. sirt activation attenuates diastolic dysfunction by reducing cardiac fibrosis in a model of anthracycline cardiomyopathy sirt functions as an important regulator of estrogen-mediated cardiomyocyte protection in angiotensin ii-induced heart hypertrophy protective effects of sirtuins in cardiovascular diseases: from bench to bedside sirt and sirt signaling pathways in cardiovascular disease protection sirt acts as a cardioprotective deacetylase in pathological cardiac hypertrophy the sirtuin sirt blocks igf-akt signaling and development of cardiac hypertrophy by targeting c-jun roles of sirt in heart failure: from bench to bedside pathways and subcellular compartmentation of nad biosynthesis in human cells activation of sirt by the nad+ precursor nicotinamide riboside protects from noise-induced hearing loss boosting nad to spare hearing arterial and cardiac aging: major shareholders in cardiovascular disease enterprises seventh report of the joint national committee on prevention, detection, evaluation, and treatment of high blood pressure and evidence from new hypertension trials life-long caloric restriction reduces oxidative stress and preserves nitric oxide bioavailability and function in arteries of old mice sirt- and vascular endothelial dysfunction with ageing in mice and humans sirt promotes endothelium-dependent vascular relaxation by activating endothelial nitric oxide synthase regulation of akt signaling by sirtuins genome instability in alzheimer disease genomic integrity and the ageing brain mitophagy and alzheimer's disease: cellular and molecular mechanisms nicotinamide riboside restores cognition through an upregulation of proliferator-activated receptor-γ coactivator α regulated β-secretase degradation and mitochondrial gene expression in alzheimer's mouse models increased poly(adp-ribosyl)ation of nuclear proteins in alzheimer's disease nad+ supplementation normalizes key alzheimer's features and dna damage responses in a new ad mouse model with introduced dna repair deficiency supplementation with nicotinamide riboside reduces brain inflammation and improves cognitive function in diabetic mice inflammation and alzheimer's disease association between raised inflammatory markers and cognitive decline in elderly people with type diabetes: the edinburgh type diabetes study activation of hippocampal creb by rolipram partially recovers balance between tnf-alpha and il- levels and improves cognitive deficits in diabetic rats nad + replenishment improves lifespan and healthspan in ataxia telangiectasia models via mitophagy and dna repair a high-fat diet and nad + activate sirt to rescue premature aging in cockayne syndrome acquired axonal degeneration and regeneration: recent insights and clinical correlations axon degeneration in parkinson's disease axonal degeneration in alzheimer's disease: when signaling abnormalities meet the axonal transport system alzheimer's disease is a synaptic failure neuronal sirt protects against excitotoxic injury in mouse cortical neuron culture preventing nad+ depletion protects neurons against excitotoxicity nicotinamide prevents nad+ depletion and protects neurons against excitotoxicity and cerebral ischemia: nad+ consumption by sirt may endanger energetically compromised neurons neuronal protective role of pbef in a mouse model of cerebral ischemia nicotinamide riboside, a form of vitamin b , protects against excitotoxicity-induced axonal degeneration stimulation of nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy sarm activation triggers axon degeneration locally via nad+ destruction nampt-mediated nad+ biosynthesis is essential for vision in mice nad+-dependent activation of sirt corrects the phenotype in a mouse model of mitochondrial disease effective treatment of mitochondrial myopathy by nicotinamide riboside, a vitamin b loss of nad homeostasis leads to progressive and reversible degeneration of skeletal muscle nad+ repletion improves muscle function in muscular dystrophy and counters global parylation muscle-specific sirt gain-of-function increases slow-twitch fibers and ameliorates pathophysiology in a mouse model of duchenne muscular dystrophy requirement of nad+ and sir for life-span extension by calorie restriction in saccharomyces cerevisiae manipulation of a nuclear nad+ salvage pathway delays aging without altering steady-state nad+ levels inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of yeast sir and human sirt nicotinamide clearance by pnc directly regulates sir -mediated silencing and longevity nutrient control of glucose homeostasis through a complex of pgc- alpha and sirt neuronal sirt activation as a novel mechanism underlying the prevention of alzheimer disease amyloid neuropathology by calorie restriction nicotinamide riboside augments the aged human skeletal muscle nad+ metabolome and induces transcriptomic and anti-inflammatory signatures nicotinamide: an oral antimicrobial agent with activity against both mycobacterium tuberculosis and human immunodeficiency virus host nad+ metabolism and infections: therapeutic implications c/ebpε mediates nicotinamide-enhanced clearance of staphylococcus aureus in mice niacin analogue, -aminonicotinamide, a novel inhibitor of hepatitis b virus replication and hbsag production reduction and functional exhaustion of t cells in patients with coronavirus disease (covid- ) the conserved coronavirus macrodomain promotes virulence and suppresses the innate immune response during severe acute respiratory syndrome coronavirus infection the impact of parps and adp-ribosylation on inflammation and host-pathogen interactions the coronavirus macrodomain is required to prevent parp-mediated inhibition of virus replication and enhancement of ifn expression the nsp macrodomain promotes virulence in mice with coronavirus-induced encephalitis the interaction of the sars coronavirus non-structural protein with the cellular oxido-reductase system causes an extensive cytopathic effect coronavirus infection and parp expression dysregulate the nad metabolome: a potentially actionable component of innate immunity small molecule nicotinamide n-methyltransferase inhibitor activates senescent muscle stem cells and improves regenerative capacity of aged skeletal muscle the conceptual framework for sars-cov- related lymphopenia pathogenic t cells and inflammatory monocytes incite inflammatory storm in severe covid- patients mechanism of cyclizing nad to cyclic adp-ribose by adp-ribosyl cyclase and cd crosstalk between poly(adp-ribose) polymerase and sirtuin enzymes sirt inhibits transforming growth factor beta-induced apoptosis in glomerular mesangial cells via smad deacetylation cellular immune responsesto severe acute respiratory syndrome coronavirus (sars-cov) infection in senescent balb/c mice: cd + t cells are important in control of sars-cov infection exploring the pathogenesis of severe acute respiratory syndrome (sars): the tissue distribution of the coronavirus (sars-cov) and its putative receptor, angiotensin-converting enzyme (ace ) dysregulation of immune response in patients with coronavirus nad and the aging process: role in life, death and everything in between nad+ biosynthesis, aging, and disease niacin modulates pro-inflammatory cytokine secretion. a potential mechanism involved in its anti-atherosclerotic effect nicotinamide exacerbates hypoxemia in ventilator-induced lung injury independent of neutrophil infiltration role of poly (adp) ribose polymerase- inhibition by nicotinamide as a possible additive treatment to modulate host immune response and prevention of cytokine storm in covid- covid- infection: the perspectives on immune responses effects of nicotinamide and niacin on bleomycin-induced acute injury and subsequent fibrosis in hamster lungs niacin attenuates acute lung injury induced by lipopolysaccharide in the hamster nicotinamide riboside is uniquely and orally bioavailable in mice and humans an open-label, non-randomized study of the pharmacokinetics of the nutritional supplement nicotinamide riboside (nr) and its effects on blood nad+ levels in healthy volunteers safety considerations with niacin therapy acc/aha guideline on the treatment of blood cholesterol to reduce atherosclerotic cardiovascular risk in adults nrk controls nicotinamide mononucleotide and nicotinamide riboside metabolism in mammalian cells quantitative analysis of nad synthesis-breakdown fluxes nicotinamide riboside, an unusual, non-typical, substrate of purified purine-nucleoside phosphorylases nicotinamide mononucleotide: exploration of diverse therapeutic applications of a potential molecule niacin-tryptophan relationships in the development of pellagra the nad-booster nicotinamide riboside potently stimulates hematopoiesis through increased mitochondrial clearance nicotinamide riboside, a form of vitamin b and nad+ precursor, relieves the nociceptive and aversive dimensions of paclitaxel-induced peripheral neuropathy in female rats nicotinamide riboside kinases display redundancy in mediating nicotinamide mononucleotide and nicotinamide riboside metabolism in skeletal muscle cells slc a is a nicotinamide mononucleotide transporter a reduced form of nicotinamide riboside defines a new path for nad+ biosynthesis and acts as an orally bioavailable nad+ precursor dihydronicotinamide riboside is a potent nad+ concentration enhancer in vitro and in vivo nrh salvage and conversion to nad+ requires nrh kinase activity by adenosine kinase niacin: chemical forms, bioavailability, and health effects a rise in nad precursor nicotinamide mononucleotide (nmn) after injury promotes axon degeneration effect of oral administration of nicotinamide mononucleotide on clinical parameters and nicotinamide metabolite levels in healthy japanese men puma-g/hm a) mediates nicotinic acid-induced flushing nad+ metabolism in health and disease generation, release, and uptake of the nad precursor nicotinic acid riboside by human cells nicotinamide riboside kinase structures reveal new pathways to nad+ syntheses and chemical properties of β-nicotinamide riboside and its analogues and derivatives simple methods of preparing nicotinamide mononucleotide simple methods for preparing nicotinamide mononucleotide and related analogs nicotinamide riboside derivatives: single crystal growth and determination of x-ray structures crystalline form of nicotinamide riboside syntheses of nicotinamide riboside and derivatives: effective agents for increasing nicotinamide adenine dinucleotide concentrations in mammalian cells safety and metabolism of long-term administration of niagen (nicotinamide riboside chloride) in a randomized, double-blind, placebo-controlled clinical trial of healthy overweight adults repeat dose nrpt (nicotinamide riboside and pterostilbene) increases nad+ levels in humans safely and sustainably: a randomized, double-blind, placebo-controlled study acute nicotinamide riboside supplementation improves redox homeostasis and exercise performance in old individuals: a double-blind cross-over study key: cord- - x tjzhi authors: alexander, jan; tinkov, alexey; strand, tor a.; alehagen, urban; skalny, anatoly; aaseth, jan title: early nutritional interventions with zinc, selenium and vitamin d for raising anti-viral resistance against progressive covid- date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: x tjzhi objectives: the novel coronavirus infection (covid- ) conveys a serious threat globally to health and economy because of a lack of vaccines and specific treatments. a common factor for conditions that predispose for serious progress is a low-grade inflammation, e.g., as seen in metabolic syndrome, diabetes, and heart failure, to which micronutrient deficiencies may contribute. the aim of the present article was to explore the usefulness of early micronutrient intervention, with focus on zinc, selenium, and vitamin d, to relieve escalation of covid- . methods: we conducted an online search for articles published in the period – on zinc, selenium, and vitamin d, and corona and related virus infections. results: there were a few studies providing direct evidence on associations between zinc, selenium, and vitamin d, and covid- . adequate supply of zinc, selenium, and vitamin d is essential for resistance to other viral infections, immune function, and reduced inflammation. hence, it is suggested that nutrition intervention securing an adequate status might protect against the novel coronavirus sars-cov- (severe acute respiratory syndrome - coronavirus- ) and mitigate the course of covid- . conclusion: we recommended initiation of adequate supplementation in high-risk areas and/or soon after the time of suspected infection with sars-cov- . subjects in high-risk groups should have high priority as regards this nutritive adjuvant therapy, which should be started prior to administration of specific and supportive medical measures. the novel coronavirus sars-cov- (severe acute respiratory syndrome-coronavirus- ), causing covid- , is by far the most dangerous coronavirus ever identified, capable of infecting not only animals, but also humans across the globe. the severity of the covid- pandemic has dramatically surpassed the prevalence of acute respiratory syndrome coronavirus (sars-cov) and middle east respiratory syndrome coronavirus (mers-cov), which were distributed to more limited regions in and , respectively. a single-stranded rna comprises the genomic structure of sars-cov- [ ] . in severe cases, covid- is accompanied by excessive activation of the innate immune system with progressive inflammation and a cytokine storm from activated cells, particularly in the airways [ ] , leading to the cytokine release syndrome [ , ] . unfortunately, in spite of their anti-inflammatory effects, corticosteroids have been observed to worsen the clinical status of patients with sars or related virus infections [ , ] . use of convalescent plasma has been tried as a possible approach, but the experiences with this strategy are limited [ ] . except for the use of convalescent plasma, there is at present no approved treatment or vaccine for covid- . therefore, it is an urgent need for public health measures, not only to limit the spread of the virus, but also to implement preventive approaches to alleviate severe covid- , e.g., by reduction of the excessive inflammation. the metabolic status of the host, as influenced by advanced age, current medical condition, and lifestyle, appears to determine the clinical severity of covid- [ ] . in critically ill patients, coexisting diseases include type diabetes, hypertension, and heart disease [ ] . the elderly are more prone to severe respiratory infection than young people, apparently due to connections between old age and deficient nutrition and immunity [ ] . clinical and subclinical micronutrient deficiencies common in older adults are known to contribute to decreased immune function and age-related diseases [ ] , implying that nutritional management is essential to reduce the risk of severe infection [ ] . in view of a lack of clinical data on preventive and/or therapeutic efficiency of the nutritive adequacy of selenium, zinc, and vitamin d in covid- , we, in the present narrative review, discussed recent clinical data on the role of these micronutrients in the protection against bronchopulmonary infections, as well as the existing indications of their impact on covid- . although the status of other nutrients, such as vitamins c and a, may also play a role, they were not focused upon in the present article. we did a literature search for the period - on pubmed, medline, and google scholar with the keywords of sars, sars-cov- , covid , coronavirus, micronutrients (zinc, selenium, vitamin d), immune system, inflammation, prevention, and treatment. based on the information retrieved, we here discussed the role of the nutritional status of certain trace elements and vitamin d in the perspective of principles for implementing preventive measures against rna viruses. clinical or subclinical micronutrient deficiencies, such as deficiencies of zinc, selenium, and vitamin d, which frequently occur in old age groups, contribute to age-related diseases including diabetes, hypertension, and coronary heart disease [ ] [ ] [ ] . these diseases, which in a substantial fraction of the cases are related to the metabolic syndrome [ ] , are characterized by signs of low-grade inflammation, which may also result from ageing [ ] . pre-infectious signs of inflammation, such as elevated values for crp (c-reactive protein), represent a common aggravating factor in covid- [ ] . adequacy of zinc, selenium, and vitamin d is essential for adequate immunocompetence, which to some extent may counteract an inflammatory aggravation. dietary advice alone may not be sufficient to secure adequacy for these nutrients in certain conditions, including in elderly subjects [ ] , involving the need for supplements in susceptible segments of populations. being an essential component of numerous enzymes, such as superoxide dismutase and [ ] , the trace metal zinc is important for the development and maintenance of immune and other cells [ ] . zinc deficiency is known to result in dysfunctional humoral and cell-mediated immunity [ ] . in the elderly, low zn status (serum zn values < . mg/l) has been found to represent a risk factor for pneumonia [ ] . long-term zinc deficiency is known to increase inflammations and inflammatory biomarkers [ ] . most facets of the immune system are affected by zinc deficiency, particularly the t-cell function. zinc deficiency also drives a th response, which is associated with increased inflammation [ ] . in elderly subjects, reduced concentrations of circulating zinc correlated with increased levels of the cytokines il- (interleukine- ), il- , and tnf-α (tumour necrosis factor-α) [ ] . in a case report, four covid- outpatients - years of age were treated with lozenges of zinc salts [ ] . they took the lozenges several times each day, up to doses between to mg zn/day for to days, and all of these patients recovered. in another case report, three covid- patients - years of age with additional gut manifestations received zinc sulphate ( mg zn daily for days), together with hydroxychloroquine and azithromycine [ ] . the latter patients recovered. being case reports, it was not possible to conclude on the efficacy of zinc. with regard to other infectious diseases, many studies show that zinc status may impact the outcome. several randomized control trials (rcts) showed that zinc given during an acute episode of diarrhea reduces the duration and risk of persistent disease [ ] . the world health organization therefore changed their recommendations for the treatment of childhood diarrhea to include oral zinc medication. zinc also plays a role in acute respiratory infections [ ] . routine zinc supplementation reduces the incidence of acute lower respiratory infections in young children in low-and middle-income countries [ ] . several recent studies used zinc as an adjunct treatment for lower respiratory infections, although with mixed results [ ] . in one large rct from india enrolling young infants with signs of severe bacterial illness, it was investigated whether zinc could reduce the risk of treatment failure [ ] . the authors found that children assigned to the zinc group had a % reduction in treatment failure and mortality compared with the placebo group. many rcts examined the role of zinc supplementation in common colds, the results from these showing that, when given early in the illness, zinc had the potential to reduce the duration by to days [ ] [ ] [ ] . furthermore, a positive effect of zinc supplementation was observed in several studies on hepatitis c, which is induced by infection with a single-stranded rna virus [ ] . in this context, it is of interest that raising the intracellular concentration of zinc with zinc-ionophores like pyrithione or chloroquin could directly reduce the replication of a variety of rna viruses in cells in vitro through inhibition of their rna polymerase activity [ ] . combined administration of zinc and pyrithione, even at low concentrations, inhibited the replication of sars coronavirus (sars-cov) in vitro [ ] . consequently, zinc supplement may have effects, not only on the covid- -associated over-active inflammation, but presumably also on the sars-cov- agent itself [ ] . as for the preventive doses used, it was noted that, on a long-term basis, an intake ≤ mg/day was recommended, as a high intake of zinc may disturb copper balance [ ] . selenium is an essential trace element for mammalian redox biology by occurring as selenocysteine in catalytical centers of many selenoproteins [ , ] . an adequate supply of the amino acid serine is required for the synthesis of selenocysteine, which is incorporated into selenoproteins [ ] . nutritional deficiencies of selenium may impact, not only the immune response, but also the pathogenicity of a virus [ ] [ ] [ ] . of note, a recent study from china reported an association between the cure rate of cov- -infected patients and selenium status, as deduced from city population hair selenium from cities outside hubei, reflecting regions with poor and adequate selenium intakes [ ] . in a study, selenium status (selenium and selenop) were significantly higher in surviving covid- inpatients (n = ) compared with non-survivors (n = ) [ ] . further studies with control of confounding and clinical trials are necessary to confirm this association. of particular interest is the finding that a main protease of sars-cov- responsible for the viral replication, interacts with the essential seleno-enzyme glutathione peroxidase (gpx ) [ , ] , which is strongly dependent on adequate selenium supply. it is notable that the gpx mimic ebselen (a synthetic selenium compound) is a potent inhibitor of the sars-cov- main protease [ ] . bioinformatic screening of the sars-cov- gene signatures provided further evidence of protein interactions and antisense transcript mrna-mrna interactions occurring at selenocysteine-related insertions in rna viruses [ ] . dietary selenium deficiency, together with increased oxidative stress in the host, can alter a viral genome from a normally mildly pathogenic virus into a highly virulent agent after its entrance into the host, which occurred with the coxsackie b virus in keshan disease in a selenium-deficient area in china [ ] . it was proposed that se deficiency could play a substantial role in the genesis of sars-cov [ ] . the potential protective effect of selenium is explained by its role as an essential cofactor in a group of enzymes that, in concert with vitamin e, works to reduce the formation of reactive oxygen species (ros). ros in excess may trigger oxidative changes both in invading microorganisms and in the cells in the host [ ] . a failing antioxidant defense might also be accompanied by an exaggerated inflammatory response in the host, even in the absence of an active infection [ ] . among the most potent antioxidative selenoenzymes are the glutathione peroxidases (gpxs) and the thioredoxin reductases (txnrds), which need an intake of at least µg se/day to function optimally. other selenoproteins, i.a., selenoprotein k (selenok) and selenoprotein s (selenos), also appear to play a role in the regulation of immune responses [ ] . in a variety of infectious diseases selenium appears to play a significant role in protecting the respiratory system, in particular toward viral infections [ ] . beck et al. found that se deficiency significantly increased the susceptibility to influenza-induced lung pathology associated with the overexpression of pro-inflammatory cytokines [ ] . an analogous effect was observed in benign coxsackie virus infection, which resulted in the development of myocarditis in se-deficient mice [ ] . these findings corresponded to the observation of lower interferon-γ (ifn-γ) and tnf-α levels, as well as reduced survival rate in se-deficient mice infected with the influenza virus as compared to se-adequate controls [ ] . in turn, selenium treatment was shown to up-regulate the expression of genes for interferons (ifn-α, ifn-β, and ifn-γ) in response to the avian influenza (h n ) virus [ ] . in older adult humans, se treatment was shown to modulate response to the influenza vaccination, being accompanied by increased ifn-γ levels after vaccination [ ] . therefore, selenium supplementation to populations with suboptimal status has been considered a safe adjuvant therapy in preventive measures against viral infections [ ] . the selenium status varies widely between different areas in the world. compared with levels in northern america [ ] , selenium levels in populations in large parts of europe are well below a threshold of about µg/l required for adequate expression of selenoproteins. the insufficient selenium intake is caused by low selenium content in soil and, consequently, in cereals and other food plants, as well as in fodder for grazing farm animals [ , ] . the optimal function of the gpxs also depends upon adequate intracellular levels of the cofactor glutathione (gsh), explaining the importance of adequate intakes of proteins containing the sulfur component of this tripeptide, viz. cysteine or methionine. reduced gsh is associated with senescence in several species, including humans [ ] . apparently healthy elderly people in the age group - had significantly lower erythrocyte gsh than younger individuals [ ] . moreover, individuals with chronic diseases, including hypertension, have a deficit of the active form of gsh [ , ] . in cases of marginal intakes of sulfur amino acids, supplementation with acetylcysteine will restore intracellular gsh levels, which is of crucial importance in bronchial and pulmonary cells [ ] . n-acetylcysteine is already an approved and extensively used drug in obstructive bronchitis [ ] , and it has proven beneficial against severe influenza infection [ ] . administration of glutathione has been shown to relieve dyspnea associated with covid- pneumonia [ ] . another factor co-operating with selenoenzymes appears to be coenzyme q (coq ). in a swedish randomized placebo-controlled study, healthy elderly subjects low in selenium were given selenium supplementation combined with coenzyme q . this supplementation was shown to reduce the non-specific inflammatory response as measured by plasma crp [ ] and other biomarkers of inflammation [ ] , and also cardiovascular mortality [ ] . as severe coronavirus infections are characterized by an overactive inflammation, this relief in inflammatory response by optimizing the selenium status is of considerable interest [ ] . it is also relevant that coq supplements, even when given alone, can exert an anti-inflammatory effect [ ] . an anti-inflammatory effect of exogenous coq may appear clearer in old age when its endogenous production is significantly reduced [ ] . selenium treatment given alone, without combination with acetylcysteine or coq , in critical ill patients admitted to the intensive care unit (non-septic and septic patients) has been used [ ] . in patients with advanced infections, manzanares and coworkers [ ] , in a meta-analysis, did not find a consistent beneficial effect on mortality, but, in a subgroup analysis, they found a reduction in the infections in non-septic patients. when considering the positive effects of selenium on immune regulation and inflammation in populations low in selenium, it appears justified to conclude that an adequate pre-infectious status of selenium would represent a protective measure against the hyperinflammation characterizing corona viral infections. thus, in subjects with suboptimal status (plasma selenium < µg/l), supplementation at a dose of - µg se/day, with or without cofactors, to achieve rapid saturation of vital selenoproteins, should represent an adjuvant approach to prevent aggressive sars-cov- infection. however, a total long-term intake of selenium from food and supplements ≤ µg se/day is recommended, as higher intakes may be associated with toxicity [ ] . it is well-known that cholecalciferol (vitamin d ) can be synthesized from cholesterol in the body skin upon exposure to sunlight. its biological activity is dependent on successive hydroxylations by the liver and the kidneys to , -(oh) -d , which binds to vitamin d receptors. beyond its roles in calcium homeostasis and the maintenance of bone integrity, it also stimulates the maturation of immune cells. epidemiological studies suggested an inverse association between circulating levels of (oh)-d , a biomarker of vitamin d status, and inflammatory biomarkers, including crp and il- [ ] . suboptimal levels of vitamin d, particularly at the end of the winter season, have been reported in a substantial number of otherwise healthy adults [ ] . people with limited access to sunlight, and elderly with reduced synthesizing capacity, may have vitamin d deficiency [ ] . vitamin d has been suggested to play a role in covid- , as two ecological studies indicated that the rate of infection was higher in countries at higher latitudes and/or lower vitamin d status [ , ] . in a non-peer-reviewed study from los angeles, vitamin d deficiency was identified as a risk factor for positive covid- tests [ ] . a recent study on covid- inpatients (n = ) found that a significantly smaller fraction of patients in intensive care units had -oh-d above nmol/l ( %) compared with those in conventional medical wards ( . %) [ ] . in a non-peer-reviewed study from cincinnati, the authors found associations between vitamin d deficiency and hospital admission, disease severity, and also with death, among patients from primary care and specialized clinics (n = ) [ ] . vitamin d was shown to be an essential factor for protection against respiratory infectious diseases [ ] . severe vitamin d deficiency is frequently seen in critically ill patients and appears to be related to poor prognosis [ ] . in older patients, severe vitamin d deficiency has been considered an independent predictor for community-acquired pneumonia [ ] , being also associated with increased risk of admission to an intensive care unit [ ] , and associated with mortality [ ] . moreover, vitamin d deficiency is shown to be associated with aggravation of lung inflammation, leading to acute respiratory distress syndrome (ards) with respiratory epithelium damage and hypoxia [ ] . an inverse association between -oh-cholecalciferol levels and risk of acute respiratory failure in critically ill patients has been observed, being most convincingly significant for subjects with -oh-cholecalciferol < nmol//l [ ] . increasing experimental data on cells in vitro demonstrated beneficial effects of vitamin d as to pathogenetic mechanisms of respiratory viral infections. thus, vitamin d treatment was shown to reduce respiratory syncytial virus (rsv) and rhinovirus (rv) replication in epithelial cells through enhancement of virus-induced interferon-stimulated genes [ ] and synthesis of the antiviral protein ll- [ ] . treatment with , (oh)-d improved respiratory-induced antiviral immune response to rv infections characterized by up-regulation of il- and cxcl- (c-x-c motif chemokine ligand also known as interferon gamma-induced protein ) production [ ] . in addition, it was demonstrated that vitamin d is capable of reducing inflammatory response without alteration of antiviral activity and viral clearance in airway epithelial cells infected with rsv [ ] . furthermore, in view of high incidence of lung fibrosis as a characteristic sequela of covid- [ ] , it is important to note that vitamin d prevented a tgf-β -induced profibrotic phenotype of lung cells [ ] . however, no preventive effect of vitamin d supplementation on pneumonia was observed in three independent case-control studies [ ] , but the interpretation of these results should take into account the apparent lack of pre-existing vitamin d deficiency. furthermore, the benefit of vitamin d replacement in an advanced stage of critical illness is controversial, as some studies do not show a benefit when it is administered late in the critical disease [ ] . vitamin d status can easily be determined as -oh-cholecalciferol in plasma. it follows that, in case of low status, < nmol/l in plasma, vitamin d supplementation ( µg d /day) could work as an approach for prevention of an aggressive course of the inflammation induced by this novel coronavirus. as for the preventive doses used, it is recommended that, on a long-term basis, the intake of vitamin d should be ≤ µg d /day to avoid hypercalcuria with risk of renal stones, and also hypercalcemia [ ] . the direct evidence that the micronutrients zinc, selenium, and vitamin d might be involved in the course and outcome of the covid- disease is observational and weak. however, based on experiences from treatments of sars and other viral infections, we here underscored observations showing that nutritive supplements administered at an early stage of the infection were important for enhancing host resistance against rna viral infections, which might also include severe covid- . we hypothesized that, in particular, increased resistance toward escalation of covid- into the life-threatening cytokine release syndrome might be obtained (figure ). the nutritional status of the host has yet not been considered a crucial factor in severe viral infections, because the efficacy of nutrient supplementation when administered at the stage of advanced illness has been disappointing. nevertheless, it is conceivable that a good nutritional status, if achieved in vulnerable population segments before escalation of the disease, would have immuno-enhancing and anti-inflammatory effects [ ] . we are aware of the alleged therapeutic role of megadoses of vitamin c ( - g/day) in viral infections [ , ] , but, as this would be a pharmacological approach, we did not further discuss this in the present article. we considered the proposed intervention with, i.a., proteins and multivitamin solutions, given immediately after hospital admission to relieve the covid- infection [ ] to represent an interesting modification of our approach. however, further research and clinical trials are requested both on therapeutic and preventive roles of nutritive supplements. based on the available literature, a reasonable presumption is that the pre-infectious status of zinc, selenium, and vitamin d might be of especial importance for the resistance against a progressive course of covid- . our recommendations are early outpatient nutritional intervention in sars-cov- exposed or high-risk subjects, preferably before specific and supportive treatment. it is tempting to suggest that that early nutritional interventions will be of particular significance for vulnerable segments of populations in developing countries. such an approach is simple, cheap, and harmless. while high doses of the micronutrients might be needed to restore deficiencies, it is advisable to follow recommended upper tolerable intake levels for long-term intakes of the micronutrients. parallel to any of the nutritional approaches, controlled studies on the efficacy of anti-viral and anti-inflammatory measures are of importance. to obtain general immunity, a covid- -related vaccine is highly warranted. emerging coronaviruses: genome structure, replication, and pathogenesis extraordinary gu-rich single-strand rna identified from sars coronavirus contributes an excessive innate immune response. microbes infect cytokine release syndrome induction of proinflammatory cytokines (il- and il- ) and lung inflammation by coronavirus- (covi- or sars-cov- ): anti-inflammatory strategies critical care management of adults with community-acquired severe respiratory viral infection clinical evidence does not support corticosteroid treatment for -ncov lung injury emerging coronaviruses: genome structure, replication, and pathogenesis extraordinary gu-rich single-strand rna identified from sars coronavirus contributes an excessive innate immune response. microbes infect cytokine release syndrome induction of pro-inflammatory cytokines (il- and il- ) and lung inflammation by coronavirus- (covi- or sars-cov- ): anti-inflammatory strategies critical care management of adults with community-acquired severe respiratory viral infection clinical evidence does not support corticosteroid treatment for -ncov lung injury acute respiratory distress syndrome in critically ill patients with severe acute respiratory syndrome clinical course and mortality risk of severe covid- covid- and the cardiovascular system mental health services for older adults in china during the covid- outbreak micronutrient deficiencies in the elderly-could ready meals be part of the solution? defining the epidemiology of covid- -studies needed the role of zinc and copper in insulin resistance and diabetes mellitus selenium supplementation affects insulin resistance and serum hs-crp in patients with type diabetes and coronary heart disease high levels of vitamin d associated with less ischemic heart disease-a nested case-control study among rural men in sweden metabolic syndrome: connecting and reconciling cardiovascular and diabetes worlds immune function and micronutrient requirements change over the life course structure and mechanism of copper, zinc superoxide dismutase zinc and immunity: an essential interrelation zinc deficiency low zinc status: a new risk factor for pneumonia in the elderly? zinc and its role in immunity and inflammation zinc deficiency drives th polarization and promotes loss of treg cell function simultaneous evaluation of circulating chemokine and cytokine profiles in elderly subjects by multiplex technology: relationship with zinc status treatment of sars-cov- with high dose oral zinc salts: a report on four patients three cases of covid- disease with colonic manifestations oral zinc for treating diarrhoea in children. cochrane database syst rev zinc and respiratory tract infections: perspectives for covid (review) zinc supplementation for the prevention of pneumonia in children aged months to months zinc supplementation as an adjunct to antibiotics in the treatment of pneumonia in children to months of age. cochrane database syst rev zinc as adjunct treatment in infants aged between and days with probable serious bacterial infection: a randomised, double-blind, placebo-controlled trial zinc for the treatment of the common cold: a systematic review and meta-analysis of randomized controlled trials zinc lozenges may shorten the duration of colds: a systematic review oral zinc and common childhood infections-an update the effect of zinc supplementation on the treatment of chronic hepatitis c patients with interferon and ribavirin +) inhibits coronavirus and arterivirus rna polymerase activity in vitro and zinc ionophores block the replication of these viruses in cell culture developing novel antimicrobial and antiviral textile products potential interventions for novel coronavirus in china: a systematic review opinion of the scientific committee on food on the tolerable upper intake level of zinc selenium in human health and disease micronutrients and host resistance to viral infection dietary serine supplementation regulates selenoprotein transcription and selenoenzyme activity in pigs association between regional selenium status and reported outcome of covid- cases in china selenium deficiency is associated with mortality risk from covid- a sars-cov- protein interaction map reveals targets for drug repurposing a role for selenium-dependent gpx in sars-cov- virulence potential therapeutic use of ebselen for covid- and other respiratory viral infections. free radic selenium-associated gene signatures within the sars-cov- -host genomic interaction interface. free radic selenoproteins and viral infection sars: what have we learned? review: micronutrient selenium deficiency influences evolution of some viral infectious diseases decrease in inflammatory biomarker concentration by intervention with selenium and coenzyme q : a subanalysis of osteopontin, osteoprotergerin, tnfr , tnfr and tweak selenium deficiency increases the pathology of an influenza virus infection selenium as an antiviral agent protection from h n influenza virus infections in mice by supplementation with selenium: a comparison with selenium-deficient mice dietary selenium supplementation enhances antiviral immunity in chickens challenged with low pathogenic avian influenza virus subtype h n selenium supplementation has beneficial and detrimental effects on immunity to influenza vaccine in older adults dietary selenium in adjuvant therapy of viral and bacterial infections sex, age, geographical location, smoking, and alcohol consumption influence serum selenium concentrations in the usa: third national health and nutrition examination survey, - relatively high mortality risk in elderly swedish subjects with low selenium status glutathione depletion and recovery after acute ethanol administration in the aging mouse low blood glutathione levels in healthy aging adults blood glutathione decreases in chronic diseases inadequate cytoplasmic antioxidant enzymes response contributes to the oxidative stress in human hypertension mechanisms and therapeutics of n-acetylcysteine: a recent update. res high-dose n-acetylcysteine therapy for novel h n influenza pneumonia efficacy of glutathione therapy in relieving dyspnea associated with covid- pneumonia: a report of cases levels of sp-selectin and hs-crp decrease with dietary intervention with selenium and coenzyme q combined: a secondary analysis of a randomized clinical trial supplementation with selenium and coenzyme q reduces cardiovascular mortality in elderly with low selenium status. a secondary analysis of a randomised clinical trial effects of coenzyme q on markers of inflammation: a systematic review and meta-analysis age-related changes in the lipid compositions of rat and human tissues serum selenium in critically ill patients: profile and supplementation in a depleted region high-dose intravenous selenium does not improve clinical outcomes in the critically ill: a systematic review and meta-analysis opinion of the scientific committee on food on the tolerable upper intake level of selenium vitamin d status and outcomes in heart failure patients vitamin d insufficiency among free-living healthy young adults the vitamin d deficiency pandemic: approaches for diagnosis, treatment and prevention the role of vitamin d in the prevention of coronavirus disease infection and mortality editorial: low population mortality from covid- in countries south of latitude degrees north supports vitamin d as a factor determining severity prior diagnoses and medications as risk factors for covid- in a los angeles health system low serum -hydroxyvitamin d ( [oh]d) levels in patients hospitalised with covid- are associated with greater disease severity factors associated with hospitalization and disease severity in a racially and ethnically diverse population of covid- patients vitamin d and respiratory health vitamin d deficiency as a risk factor for infection, sepsis and mortality in the critically ill: systematic review and meta-analysis link between community-acquired pneumonia and vitamin d levels in older patients addition of vitamin d status to prognostic scores improves the prediction of outcome in community-acquired pneumonia vitamin d status and long-term mortality in community-acquired pneumonia: secondary data analysis from a prospective cohort association between prehospital vitamin d status and incident acute respiratory failure in critically ill patients: a retrospective cohort study vitamin d increases the antiviral activity of bronchial epithelial cells in vitro vitamin d represses rhinovirus replication in cystic fibrosis cells by inducing ll- effects of vitamin d on airway epithelial cell morphology and rhinovirus replication vitamin d decreases respiratory syncytial virus induction of nf-kappab-linked chemokines and cytokines in airway epithelium while maintaining the antiviral state relationship to duration of infection vitamin d inhibition of pro-fibrotic effects of transforming growth factor beta in lung fibroblasts and epithelial cells the role of vitamin d supplementation in the risk of developing pneumonia: three independent case-control studies effect of intravenous ohd supplementation on bone turnover and inflammation in prolonged critically ill patients scientific opinion on the tolerable upper intake level of vitamin d optimal nutritional status for a well-functioning immune system is an important factor to protect against viral infections vitamin c as a possible therapy for covid- early nutritional supplementation in non-critically ill patients hospitalized for the novel coronavirus disease (covid- ): rationale and feasibility of a shared pragmatic protocol this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license acknowledgments: innlandet hospital trust, norway, is acknowledged for support. key: cord- -oai igl authors: efremova, agrafena; colleluori, georgia; thomsky, mikhail; perugini, jessica; protasoni, marina; reguzzoni, marcella; faragalli, andrea; carle, flavia; giordano, antonio; cinti, saverio title: biomarkers of browning in cold exposed siberian adults date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: oai igl cold-exposure promotes energy expenditure by inducing brown adipose tissue (bat) thermogenesis, which over time, is also sustained by browning, the appearance, or increase, of brown-like cells into white fat depots. identification of circulating markers reflecting bat activity and browning is crucial to study this phenomenon and its triggers, also holding possible implications for the therapy of obesity and metabolic diseases. using rt-qpcr, we evaluated the peripheral blood mononuclear cells (pbmc) expression profile of regulators of bat activity (cidea, prdm ), white adipocytes browning (hoxc and slc a ), and fatty acid β-oxidation (cpt a) in siberian healthy miners living at extremely cold temperatures compared to healthy subjects living in thermoneutral conditions. anthropometric parameters, glucose, and lipid profiles were also assessed. the cold-exposed group showed significantly lower weight, bmi, hip circumference, and pbmc expression of cidea, but higher expression of hoxc and higher circulating glucose compared to controls. within the cold-exposed group, bmi, total cholesterol, and the atherogenic coefficient were lower in individuals exposed to low temperatures for a longer time. in conclusion, human pbmc expresses the brown adipocytes marker cidea and the browning marker hoxc , which, varying according to cold-exposure, possibly reflect changes in bat activation and white fat browning. obesity is a multifactorial chronic disease whose prevalence is~ % and~ % in europe [ ] and united states [ ] , respectively. during the last decades, the worldwide increase in obesity incidence made the need for effective therapeutic strategies extremely urgent, especially in consideration of its comorbidities and associated mortality [ ] [ ] [ ] [ ] . obesity is characterized by an aberrantly elevated amount of white adipose tissue (wat) resulting from a dysfunctional regulation of the energy balance [ ] . the modulation of energy intake and expenditure is extremely complex and results from the integration of numerous neuroendocrine and environmental signals [ , ] . cold-exposure is one of the environmental stimuli promoting energy expenditure through the activation of thermogenic pathways, a crucial response to ensure survival to hostile temperature conditions [ , ] . specifically, cold promotes β-adrenergic stimulation via the sympathetic nervous system (sns), which in turn induces thermogenesis by activating brown adipose tissue (bat) [ ] [ ] [ ] . bat burns fat to produce heat given the expression of ucp [ ] . interestingly, upon cold stimulation, white adipocytes can transdifferentiate into beige (also known as "brite") adipocytes (brown-like phenotype with elevated expression of ucp ) in a process known as "browning," leading to heat production [ , ] . importantly, during the phenomenon of browning, proliferation and differentiation of brown adipocyte precursors also occurs, contributing to the expansion of the heat-producing cell population [ , ] . in mice, bat activation was shown to protect against obesity, type diabetes and atherosclerosis [ , ] . hence, the study of bat regulation has been particularly attractive as a potential target for obesity treatment [ , ] . human adults have varying amounts of bat which decreases with advancing age and bmi [ , ] . the study of bat activation and browning in humans is not simple due to several limitations. the most used procedure available for this purpose is the study of ( )f-fdg ( -deoxy- -[ f]fluoro-d-glucose) uptake by positron-emission tomography-computed tomography (pet-ct) which, besides different technical limitations, is costly and complex [ , , ] . alternative techniques to assess bat activation and wat browning are needed. studies by palou and colleagues conducted on female rats demonstrated that the expression of regulators of bat activity (cidea, prdm ), wat browning (hoxc and slc a ), and fatty acid β-oxidation (cpt a) in both tissues, correlates with the expression of the same modulators in the peripheral blood mononuclear cells (pbmc) upon cold stimulation [ ] . the authors concluded that these genes could be considered suitable brown/beige markers to be assessed in pbmc, avoiding the use of invasive procedures [ ] . however, it is unknown whether brown/beige markers' expression in human pbmc is detectable and whether it varies depending on cold-exposure. we recently showed that cold-exposed siberian adults (living outdoor) display greater β-adrenergic activation and browning of visceral adipose depots compared to individuals living in thermoneutral conditions [ ] . the main objective of our study was to evaluate whether pbmc of cold-exposed siberian miners expresses different levels of the brown/beige and fatty acid utilization markers compared to the pbmc of siberian adults living in thermoneutral conditions. our secondary aim was to evaluate differences in the metabolic status between our groups under investigation. this was an observational, cross-sectional study. the study was conducted in in the verkhoyansky and anabrasky districts of yakutia, following the guidelines in the declaration of helsinki for the ethical treatment of human subjects. the protocol was approved by the local committee review board (supplemental file s ). in this study, we recruited healthy male diamond miners engaged in open-pit diamond mining at anabrasky district of yakutia (polar zone, cold-exposed group) and healthy control subjects living in the town-center of verkhoyansky, district of yakutia (urban area) in thermoneutral conditions. subjects enrolled in the cold-exposed group spent an average time of h per day working in the mine for months (december to february) when the average temperature is − /− • c [ ] . cold-exposed individuals lived close to the mining camp in dedicated accommodations in the countryside. at the time of recruitment, the study coordinator conducted a questionnaire-based interview to estimate the amount of time spent in cold conditions based on professional responsibilities. for the cold-exposed group, all blood sampling and anthropometric evaluations were performed in the camp or miners' dwellings. twenty-nine healthy male subjects from the same region were enrolled in the control group during summer (months of august) when the average temperature is + • c to + • c. similarly, at the time of recruitment, the study coordinator conducted a questionnaire-based interview to make sure that none of the individuals belonging to the control group was exposed to cold during the last three months before enrollment. for this purpose, a questionnaire formulated ad hoc by the research team was used. control subjects were living in the urban area, where the impact of cold during the winter months is minimal due to the presence of heating systems in houses and in means of transportation (+ - • c). based on the data collected during the interview, winter months cold exposure for the control group was estimated to be - min per day maximum and was mainly due to brief walks in open areas. the study coordinator contacted the manager of the miners' company "anabar diamonds" and got permission to access the mining camp for cold-exposed subjects' recruitment. healthy control subjects were recruited through the walk-in clinic of the scientific center for complex medical problem of yakut. subjects were eligible to be enrolled in the control group if they did not suffer from any chronic disease and if they were not taking any medication or undergoing any kind of medical treatment. medical information of study subjects belonging to the cold-exposed group was provided by the medical doctor of the working camp, whose role was to take care of workers' health. individuals with a documented diagnosis of any chronic or metabolic disease such as metabolic syndrome, type diabetes, dyslipidemia or taking any medication that could affect glucose or lipid metabolism were excluded from this study. before enrollment in the study, all participants signed a written consent form. at the time of recruitment, body weight and height were measured by the standard weighing scale and stadiometer, respectively. bmi (kg/m ) was calculated by dividing the weight (in kilograms) by height (in meters) squared. waist circumference (cm) was measured in a standing position midway from the lower edge of the costal arch to the iliac crest of the ilium bone. hip circumference (cm) was measured in the standing position at the level of the greater trochanters of the femurs. blood samples were collected in the morning between : and : am from study subjects who were asked to fast overnight. samples collection was performed during february for the cold-exposed group and in august for the control group, after months of exposure to cold and thermoneutral conditions, respectively. after collection, samples were immediately frozen at − • c and transported to the laboratory of the yakut scientific center of complex medical problems, yakutsk russian federation. samples collection for the control group was performed at the clinical laboratories of the scientific center for complex medical problem of yakut. control glucose, triglycerides, total cholesterol and high-density lipoprotein (hdl) cholesterol measurements were determined using an automated biochemical analyzer labio (mindray medical international limited, nanshan, shenzhen , china) using biocon kits (biocon, electronic city, bangalore india). low-density lipoprotein (ldl) and very-low-density lipoprotein (vldl) cholesterols were assessed using the following formulas: ldl = total cholesterol-vldl-hdl; vldl = (tg)/ , . the atherogenic coefficient ka was calculated using the formula ka = (total cholesterol-hdl)/hdl [ ] . the optimal coefficient of atherogenity is considered to be between the value and ; where values higher than , predispose individuals to elevated risk for atherosclerosis and cardiovascular events. whole blood samples were collected into edta coated vacutainers and immediately transported to the laboratory for further processing. pbmcs were isolated by gradient separation using optiprep™ medium (d , sigma-aldrich, st. louis, mo, usa), according to manufacturer's instructions, with modifications previously described by paolu and colleagues [ ] . briefly, blood was filled up to ml with solution c ( mm nacl and mm hepes). blood was then layered to form a density barrier by mixing . ml of optiprep medium with . ml of optiprep diluent without intermixing ( ml of density barrier per ml of blood-solution c mixture) in a centrifuge tube. afterward, the tube was centrifuged at × g for min at • c with acceleration and deceleration adjusted at zero. the layer containing pbmcs and platelets was collected from the interface between plasma layer and optiprep medium. to wash pbmcs and to remove the platelets, the collected material was centrifuged in solution c at × g for min at • c. samples were kept at − • c before rna isolation. total rna extraction was performed using the rneasy plus minikit (qiagen, hilden, germany, cat.# ) following the manufacturer instructions. in brief, ml of human peripheral blood were added with rbc lysis buffer to a final volume of ml and incubated at room temperature for min. cells were pelleted by centrifugation at × g for min. the supernatant was removed, and the pellet was resuspended in ml of rbc lysis buffer. afterward, cells were pelleted and subsequently resuspended in ml dpbs and pelleted again by centrifugation. the pellet was resuspended in µl of trizol and . ml of chloroform and vortexed for s. samples were centrifuged at , rpm for min at • c. the upper phase was transferred to clean microcentrifuge tubes and an equal volume of cold isopropanol was added to the mixture. the tubes were inverted several times and placed in a − • c freezer for precipitation. samples were centrifuged at , rpm for min at • c. the supernatant was then carefully removed, and the pellet was rinsed with . ml of ice-cold ethanol ( %). samples were then centrifuged at , rpm for min at • c, the supernatant was removed, and samples were let dry at room temperature for min. the rna pellet was dissolved in µl of rnase-free water. rna quality was assessed with an implen p- nanophotometer. after quantitation, the rna samples were stored at − • c before proceeding with retrotranscription. fifty nanograms of total rna from pbmcs were reverse transcribed into cdna using the iscript cdna synthesis kit (bio-rad laboratories, hercules, ca, usa, cat.# ) following the manufacturer's instructions. the reaction was performed using a t- thermal cycler (bio-rad), and the conditions were: • c for min, • c for min, and • c for min. gene expression was assessed by rt-qpcr using the sfx real-time system. target genes were chosen based on the study by palou et al., who identified markers detectable in rats pbmc [ ] . gene functions and selected primers are described in table . each pcr reaction mix included diluted ( : ) cdna template, forward and reverse primers ( µm), sybr green pcr master mix (bio-rad, cat.# ) and nuclease-free water to a total volume of µl. pcr reaction conditions were as follows: s at • c, min at • c, and s at • c. gene expression data for each target are expressed as relative quantification (∆∆ct) adjusted for the housekeeping gene gapdh (forward primer gtcggagtcaacggatttggt; reverse primer agtgatggca tggactgt). the normality of the variables was assessed through the kolmogorov-smirnov test. a nonparametric approach was followed due to the small sample size. median and interquartile ranges (iqr) were used to summarize the variables. the wilcoxon sum-rank test was used to evaluate differences between the two groups. in order to investigate differences between groups, the non-parametric ancova with smoothed regression and young and bowman test was applied. markers and biochemical variables were the dependent variables, and age and bmi were the covariates. one model for each dependent variable was performed. the non-parametric ancova was also applied to evaluate the effect of the number of cold-exposure hours on the distribution of each marker and biochemical variables in cold exposed subjects, using bmi as covariate. based on the cold-exposure time distribution, four classes were considered: or h, or . h, or , h. benjamini-hochberg p-value adjustment method was applied. for the biochemical variables, the interaction between classes of cold exposure and bmi was also considered. a total of subjects were enrolled in this study: of them belonged to the control group, while were miners belonging to the cold-exposed group. the distributions of each variable were asymmetric; hence, a non-parametric statistical approach was chosen. all subjects were male with median age equal to years (iqr: ; ). among the cold-exposed individuals, % were exposed for less than h, with % of subjects exposed for less than h; % were exposed to cold for more than h, with % exposed for h. table shows the characteristics of the enrolled subjects. in brief, no significant differences were found for age, waist circumference (wc), and waist to hip circumferences ratio (w/h) between the two groups. meanwhile, weight, height, bmi, and hip circumference were significantly lower in the cold-exposed group compared to the controls ( table ). the pbmc gene expression study revealed significantly lower cidea and higher hoxc expression levels in the cold-exposed group compared to the control group, while no significant differences in other markers' expression were detected (table ) . after adjustment for age (and with and without adjustment for bmi), circulating total cholesterol, ldl, hdl, vldl, and triglycerides, as well as the atherogenic coefficient were comparable between the two groups in analyses. however, the cold-exposed group had significantly higher circulating glucose levels compared to the control group (table ) . table shows the result of the analysis conducted on the cold exposed group, and due to the number of markers' missing values, we compared the subjects exposed to cold for less than h and the subjects exposed to cold for h. no clear trend in the adjusted medians and no statistically significant differences in the distribution of markers were observed. this could be attributed to the high variability of markers distribution in each cold-exposure group. a statistically significant difference among cold-exposure groups was observed for bmi, total cholesterol, and the atherogenic coefficient, for which the adjusted medians decreased when the number of cold-exposure hours increased. table . pbmc markers and biochemical variables comparison within the cold exposed group based on time of exposure to cold. ci % refers to % confidence interval; p refers to non-parametric ancova test via smoothing regression with benjamini-hochberg's p-value adjustment; each model was adjusted for and bmi. ka: atherogenic coefficient. no adjusted median and ci % were reported because only subject was in the subgroup. † comparison between group of subjects exposed to cold for less than h and subject exposed to cold for h. this is the first study investigating the expression of browning, beige, and fatty acids utilization regulators in the pbmc of human subjects chronically exposed to extremely cold temperatures compared to controls living in thermoneutral conditions. cold-exposed subjects expressed lower levels of the brown adipocytes' marker cidea and higher levels of the beige adipocytes' marker hoxc compared to controls, while the expression of the other investigated genes did not differ significantly between groups. interestingly, cold-exposed individuals from this study had higher circulating glucose, but lower body weight, bmi and hip circumference compared to controls, possibly reflecting a healthier metabolic status. our data proved that certain brown and beige adipocytes markers are detectable in human pbmc and vary according to cold exposure, potentially reflecting changes in bat activation, wat browning, and related metabolic status. the increased energy expenditure associated with cold-induced bat activation and wat browning has attracted enormous interests for its potentials in the treatment of obesity and metabolic diseases [ , , , ] . during the last decades, in fact, numerous efforts have been made to identify browning regulators and alternative stimuli responsible for bat activation [ , , , , [ ] [ ] [ ] . however, since only invasive techniques are available for the assessment of browning [ ] , the study of this phenomenon in humans presents important limitations. hence, the identification of circulating markers of browning or of browning-induced metabolic changes would be extremely useful. several circulating "batokines" have been discovered [ ] , although none of them has been recognized as a valid marker of bat activation. interestingly, paolu et al. demonstrated that cold-induced changes in the expression of few genes regulating browning, beiging, and fatty acid oxidation in rats' bat and wat are reflected by changes in the expression of the same regulators in the pbmc, pointing the attention to new potential analytical candidates [ ] . nevertheless, this finding has never been explored and validated in humans. we recently demonstrated that cold-exposed siberian adults (living outdoor) display higher browning of visceral adipose depots compared to individuals living in thermoneutral conditions [ ] . the aim of this study was to explore whether siberian subjects belonging to the same population also exhibit a differential pbmc expression of the markers identified by palou and colleagues. cold-exposed subjects enrolled in our study expressed higher levels of the beiging's marker hoxc and lower amounts of the brown adipocytes' marker cidea compared to controls. this finding is in some ways consistent with the ones of palou and colleagues whose study was conducted on female rats of different ages ( , , , and months) exposed to cold for one week [ ] . consistently to our results, in fact, cold exposure lead to a significant increase in the pbmc hoxc expression of adult rats ( and months) [ ] . this marker is considered to be specific to the beige adipose depots, and its expression is known to increase upon browning stimulation (rosiglitazone administration) [ ] . the increase of hoxc in the pbmc of our cold-exposed human subjects could thereby reflect the expression changes in their adipose depots, making it a potential circulating candidate to be used as a browning marker. our data are consistent with the findings from rna sequencing studies showing that human bat has a gene expression signature resembling the one of beige adipocytes [ ] . on the other hand, palou and colleagues did not detect significant changes in adult rats pbmc expression of cidea exposed to cold, but they only revealed an evident reduction in the mrna levels of the marker in the bat [ ] . cidea is widely expressed on the surface of lipid droplets of brown adipocytes and is responsible for the formation of large lipid droplets through the promotion of lipid exchange between them [ , ] . adipocytes' cidea expression increases in conditions that favor triglycerides deposition [ ] , an opposite phenomenon compared to what happens during bat activation. according to some studies, in fact, it antagonizes ucp expression [ ] . cidea lower expression in the pbmc of our cold-exposed group compared to controls could reflect similar differences in this marker's bat expression, whose levels reduced following exposure to low temperatures in animal models [ , ] . the evaluation of pbmc expression of cidea has the potential of great clinical relevance in the study of human bat activation that needs further exploration. in our study, we could not detect differences in the pbmc expression of cpt a , scl , and prdm comparing cold exposed individuals to controls. this finding is in contrast with the study of palou and colleagues who observed an increased expression in cpt a and scl in female adult rats pbmc upon cold exposure [ ] . the differences in our findings and the one of palou could be attributed to several elements, for example, the diverse experimental models, gender, age, conditions under investigation, and the variability of these markers in the studied groups. the cold-exposed group of the present study also had lower body weight, bmi, and hip circumference, possibly reflecting a healthier metabolic status [ ] . although we did not detect significant differences in cholesterol levels between our two groups, our data revealed lower levels of bmi, total cholesterol, and atherogenic coefficient with increasing daily time of exposure to cold. this finding is consistent with evidence reporting increased lipid utilization and improved lipid profile induced by bat activation produced by cold stimulation [ , [ ] [ ] [ ] . on the other side, other reports revealed a u-shaped relationship between environmental temperature and cardiovascular risk, with the last one increasing for temperatures lower than − • c and higher than • c [ ] . however, most of these studies analyzed temperatures ranging from~− to • c, different from our study, in which cold exposed individuals were exposed to temperatures lower than − • c. furthermore, our cold-exposed group had higher fasting glucose levels compared to controls. although this finding may seem counterintuitive, considering that acute bat activation increases glucose uptake [ , ] , plasma glucose levels do not change upon acute cold-exposure in humans [ , ] . thus, it is possible that in individuals with normal glycemia, bat chronic stimulation requires higher basal glucose levels for its usage, without leading to metabolic abnormalities (impaired fasting glucose or insulin resistance). importantly, the fasting glucose levels of both of our groups were within the range of normality. our study has several limitations. although we studied a unique population exposed to extremely cold temperature, the cross-sectional nature of our investigation does not allow us to establish a cause-effect relationship between the variables under analysis. furthermore, since we investigated siberian, male adults adapted to live in very cold temperatures, we do not know if our findings can be extended to different ethnicities, gender, or ages. our data need to be validated by additional long-term studies with a larger sample size, evaluating in parallel bat and pbmc gene expression and bat activation through multiple techniques. furthermore, data regarding the metabolic status of this population, such as insulin sensitivity and the existing correlation with the metabolic profile, should be investigated more in-depth. in conclusion, this is the first study demonstrating that human pbmc expresses markers of brown adipocytes and browning and that cidea and hoxc mrna levels vary according to cold-exposure. based on our results, we believe that cidea expression in human pbmc could mirror its expression in bat in a condition of chronic activation, while hoxc expression could mirror the one of white adipocytes undergoing white-to brown transdifferentiation, making both markers potentially useful circulating indexes of bat and browning activation deserving further investigation and validation. supplementary materials: the following are available online at http://www.mdpi.com/ - / / / /s , file s : protocol. author contributions: conceptualization: a.e., m.t., and s.c.; methodology and investigation: a.e., g.c., m.t., j.p., m.p., m.r., g.c., a.g., and s.c.; data analyses and interpretation: g.c., a.f., f.c., a.g., and s.c.; writing, original draft: g.c., a.g., and s.c.; revising manuscript content and approving final version, all take responsibility for the manuscript content, the integrity of the data analysis and approval of the final version of the manuscript: a.e., g.c., m.t., j.p., m.p., m.r., a.f., f.c., a.g., and s.c.; a.e. and g.c. contributed equally to this manuscript and are considered as co-first authors. all authors have read and agreed to the published version of the manuscript. funding: this work was supported by grants from the italian ministry of university (prin , # l z em) . the authors declare no conflict of interest. european society of endocrinology clinical practice guideline: endocrine work-up in obesity prevalence of obesity among adults and youth: united states obesity report; world health organization website covid- and fat embolism: a hypothesis to explain the severe clinical outcome in people with obesity convertible visceral fat as a therapeutic target to curb obesity anatomy and physiology of the nutritional system brown adipose tissue: function and physiological significance the emergence of cold-induced brown adipocytes in mouse white fat depots is determined predominantly by white to brown adipocyte transdifferentiation bi-directional interconversion of brite and white adipocytes tracking adipogenesis during white adipose tissue development, expansion and regeneration betaar signaling required for diet-induced thermogenesis and obesity resistance brown fat activation reduces hypercholesterolaemia and protects from atherosclerosis development transcriptional and epigenetic control of brown and beige adipose cell fate and function the presence of ucp demonstrates that metabolically active adipose tissue in the neck of adult humans truly represents brown adipose tissue identification and importance of brown adipose tissue in adult humans brown adipose tissue development and metabolism cold-activated brown adipose tissue in healthy men gene expression of peripheral blood mononuclear cells is affected by cold exposure a large proportion of mediastinal and perirenal visceral fat of siberian adult people is formed by ucp immunoreactive multilocular and paucilocular adipocytes russian federation, jakutsk alteration of plasma lipid profiles and atherogenic indices by stachytarpheta jamaicensis l. (vahl) a prdm -driven metabolic signal from adipocytes regulates precursor cell fate the changed metabolic world with human brown adipose tissue: therapeutic visions dietary proteins, brown fat, and adiposity recruited brown adipose tissue as an antiobesity agent in humans micrornas in brown and beige fat brown adipose tissue as a secretory organ recruited vs. nonrecruited molecular signatures of brown, "brite," and white adipose tissues genetic and functional characterization of clonally derived adult human brown adipocytes the brown adipocyte protein cidea promotes lipid droplet fusion via a phosphatidic acid-binding amphipathic helix cidea is associated with lipid droplets and insulin sensitivity in humans acute cold exposure-induced down-regulation of cidea, cell death-inducing dna fragmentation factor-alpha-like effector a, in rat interscapular brown adipose tissue by sympathetically activated beta -adrenoreceptors the fto gene is associated with a paradoxically favorable cardiometabolic risk profile in frail, obese older adults brown adipose tissue activity controls triglyceride clearance brown adipose tissue improves whole-body glucose homeostasis and insulin sensitivity in humans brown adipose tissue oxidative metabolism contributes to energy expenditure during acute cold exposure in humans the nonlinear association between outdoor temperature and cholesterol levels, with modifying effect of individual characteristics and behaviors this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license key: cord- -n se ajb authors: stańdo, mirella; piatek, paweł; namiecinska, magdalena; lewkowicz, przemysław; lewkowicz, natalia title: omega- polyunsaturated fatty acids epa and dha as an adjunct to non-surgical treatment of periodontitis: a randomized clinical trial date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: n se ajb periodontitis is a chronic multifactorial inflammatory disease that leads to the loss of supportive tissues around the teeth with gradual deterioration of masticatory function and esthetics, resulting eventually in the decrease of the life quality. host immune response triggered by bacterial biofilm is responsible for the chronic periodontal inflammation and ongoing tissue loss. omega- polyunsaturated fatty acids (pufa) such as eicosapentaenoic acid (epa) and docosahexaenoic acid (dha) have anti-inflammatory properties, thus may be used for the treatment of chronic inflammatory diseases. in this study, we aimed to evaluate the effect of dietary supplementation with omega- pufa in the patients with stage iii and iv periodontitis. thirty otherwise healthy patients were treated with scaling and root planning (srp). in the test group (n = ), patients were additionally supplemented with . g of epa and . g of dha. in the control group (n = ), patients received only srp. periodontal examination was performed at baseline and three months following initial therapy. salivary samples were taken twice at baseline and at the end of the experiment. we found that there was a statistically significant reduction in the bleeding on probing (bop) and improvement of clinical attachment loss (cal) at three months in the test group compared to the control group. moreover, a statistically significant higher percentage of closed pockets (probing depth ≤ mm without bop) was achieved in the test group vs. control group after three months of treatment. accordingly, the levels of pro-inflammatory cytokines/chemokines interleukin (il)- and il- were markedly lower, while the level of anti-inflammatory il- was significantly higher in the salivary samples of the patients supplemented with omega- pufa at three months in comparison to the patients treated with srp alone. our findings demonstrate that dietary intervention with high-dose of omega- pufa during non-surgical therapy may have potential benefits in the management of periodontitis. periodontitis is a highly prevalent oral disease in humans, affecting nearly % of the population worldwide [ ] . the global burden of disease study conducted by kassebaum et al. revealed that the severe form of periodontitis affects . % of the world's population and it is the sixth most common human disease [ ] . periodontitis is a multifactorial disease individually accelerated or decelerated by different factors. one of them, a bacterial biofilm, leads to dysbiosis and an increase periodontology and oral diseases, medical university of lodz. after the nature of the study was clearly explained to participants, they signed the consent form for participation. forty patients aged - years ( females, males, mean age . ± . ) with generalized stage iii and iv periodontitis were selected for this study. the criteria of the classification of periodontal and peri-implant diseases and conditions [ ] were used for periodontitis staging. stage iii periodontitis was diagnosed when the following criteria were met: interproximal clinical attachment level (cal) ≥ mm in at least two non-adjacent teeth, probing depth (pd) ≥ mm and radiographic bone loss beyond one-third coronal part of the root. stage iv periodontitis was diagnosed when, in addition to the clinical parameters of stage iii, tooth loss ≥ teeth with an impairment of occlusion and masticatory function were found. the inclusion criteria were the following: at least scorable teeth (not including third molars), ≥ teeth with pd ≥ mm, cal ≥ mm, radiographic evidence of bone loss more than one-third of the root length and no periodontal treatment performed within last six months. the exclusion criteria were the following: smoking, history of diabetes or chronic inflammatory disease, any diseases that compromise wound healing, history of radio-or chemotherapy, history of nonsteroidal anti-inflammatory drug (nsaids) intake > days and use of antibiotics or corticosteroids three months prior to the study. all assessments and treatments were carried out at the department of periodontology and oral diseases, medical university of lodz over a two-year period (from october to june ). at the beginning, patients filled in the questionnaire about their general health and diet, followed by the assessment of clinical and radiological periodontal status. following screening, patients were invited to participate in the study. all subjects were randomly assigned to one of the two treatment groups by using a website (www.randomization.com). the test group consisted of patients ( males, females, mean age . ± . ) and the control group consisted of patients ( males, females, mean age . ± . ). all participants received non-surgical periodontal therapy. srp was performed using ultrasonic (piezon master , ems) and hand (mini five gracey curette, hu-friedy) instrumentation under a local anesthesia if necessary. the number of srp sessions varied from to depending on the extent and severity of periodontitis. all patients were instructed about etiology and consequences of periodontal disease and received individual oral hygiene instructions. srp was repeated at the follow-up visit at three months only at the sites with pd ≥ mm positive for bleeding on probing (bop). furthermore, to ensure adequate oral hygiene performance, patients appeared to the recall visit at week after completion of initial srp sessions. oral hygiene was reevaluated by dental plaque disclosing (hurriview ii, beutlich lp, bunnell, fl, usa), and toothbrushing technique and the use of interdental cleaning devices (interdental toothbrushes or dental floss) were checked and reinforced. in the control group, patients received srp only. in the test group, srp was supplemented with the dietary fish oil (fo) rich in omega- pufa epa and dha for three months. fish oil (biomarine medical, liquid, uprp patent # p. ), derived from centroscymnus crepitater, etmopterus granulosus, deania colceai, centrophorus scalpratus, sardinops sagax, scomber scombrus and gadus morhua species, was administered twice a day at a dose of ml. daily dose of ml provided . g of epa, . g of dha, . g of alkylglycerols, . g of squalene, µg of vitamin a and µg of vitamin d . patients were required to fill in a diet diary documenting the daily consumption of fish oil and complaints about its consumption. the compliance with fish oil intake was monitored by calling the patients every four weeks during the medication period to check the bottles back for any possible remaining oil. then, patients received required bottles of the fish oil for subsequent four weeks. periodontal charting was performed by a periodontist (n.l.) blinded to the study allocation of participants. all treatments were performed by m.s. who knows the study allocation of the patients. both charting and treatments were done under magnification (perioptix ttl ready-made . × or . × loups). clinical parameters were evaluated at two time points: at baseline and three months. the following clinical parameters were assessed: full mouth plaque index (fmpi), bop, pd and gingival recession (rec). cal was calculated as a sum of pd and rec at respective sites. all measurements were carried out using an unc- periodontal probe (hu-friedy) and recorded at six sites (buccal, lingual, mesio-lingual, mesio-buccal, disto-lingual and disto-buccal) for each tooth with exclusion of the third molars. a trained and calibrated examiner (n.l.) performed all assessments at baseline and at follow-up. the study examiner (n.l.) participated in a calibration exercise and the standard error of measurement was calculated. the examiner reliability was high with agreement in assessment on all clinical parameters of above % (icc > . ). saliva collection was completed before clinical periodontal measurements and any periodontal intervention. patients were advised not to chew gum, eat or drink anything except water h before sampling. salivary samples were taken from all individuals at baseline and after three months. a total of ml of unstimulated saliva was collected in an empty -ml falcon tube before clinical measurements. patients were asked to lean their heads forward and kept their mouths slightly open with minimal head movement to allow passive drainage of saliva into the test tube. the samples were centrifuged at rpm ( , g) for min at • c degrees. subsequently, the supernatants were collected at . ml eppendorf tubes and frozen at − • c. concentrations of fifty-four cytokines, chemokines and growth factors in saliva supernatants were measured using bio-plex pro™ human chemokine assays (bio-rad laboratories) and bio-plex pro tm human cytokine -plex assay. standards and samples were diluted ( : ) in sample diluent and transferred to the plate containing magnetic beads for h at rt. next, the plate was washed ( ×) and detection antibody was added for min on a shaker ( rpm) at rt. after that, the plate was washed ( ×) and streptavidin-pe solution was added for min. subsequently, the plate was washed ( ×) and samples were re-suspended in µl of assay buffer and analyzed within min. all samples were analyzed at the same time in duplicates. all reagents and technology were provided by bio-rad laboratories (bio-plex ). sample size was estimated based on the primary outcome parameter (mean pd) from a study employing mg of n- pufa during non-surgical periodontal treatment [ ] . the study was powered at % to detect a mean pd difference of . mm (sd ± . ) between test and control groups at three months. the minimum required sample size was calculated to be patients for each group; to compensate for potential dropouts, patients were recruited for each group. the statistical unit was the patient, and all sites with pd ≥ mm at baseline were considered for the statistical analyses. the primary outcome variable was the percent of closed pockets (pd ≤ mm and bop) at three months in relation to baseline. secondary variables were average changes in pd, cal, rec, bop, fmpi, number of sites with pd ≥ mm and concentrations of cytokines/chemokines/growth factors. additionally, for clinical parameters, changes (∆) from baseline to three months were calculated at subject level. following calculation of the mean ± sd of each parameter for both groups, statistical comparison of differences within the groups at two time points were determined by the paired t-test, and the comparisons between the test and control groups were performed using the unpaired students t-test. the verification of normal distribution and analysis of variances were made using the kolmogorov-smirnov test and the fisher's test. changes (∆) from baseline to three months between the groups were analyzed using mann-whitney u test. p < . was considered as the significant difference. forty patients meeting inclusion criteria were included in the study. ten subjects were lost during follow-up because of the following reasons: antibiotic or nsaids intake for other medical reasons (n = ), severe acute respiratory syndrome coronavirus (sars-cov- ) pandemic-related lockdown (n = ) and moving to another country (n = ). thus, per protocol, analyses included only thirty patients aged - years (mean age: . ± . years old) ( figure ). between the groups were analyzed using mann-whitney u test. p < . was considered as the significant difference. forty patients meeting inclusion criteria were included in the study. ten subjects were lost during follow-up because of the following reasons: antibiotic or nsaids intake for other medical reasons (n = ), severe acute respiratory syndrome coronavirus (sars-cov- ) pandemic-related lockdown (n = ) and moving to another country (n = ). thus, per protocol, analyses included only thirty patients aged - years (mean age: . ± . years old) ( figure ). according to the new classification of periodontal diseases [ ] , all the patients presented generalized periodontitis stage iii or iv. the demographic distribution revealed statistical difference regarding age between the test and control groups (table ). according to the new classification of periodontal diseases [ ] , all the patients presented generalized periodontitis stage iii or iv. the demographic distribution revealed statistical difference regarding age between the test and control groups (table ) . no adverse events or anomalies were observed in oral soft and hard tissue examinations. in the intervention group, six subjects reported nausea and irritating fish-scented halitosis as adverse effects that were not strong enough to stop the treatment regimen. no other adverse events were reported. baseline periodontal parameters did not differ between the groups, except for fmpi (table ) . throughout the study, plaque accumulation was markedly reduced in both groups; however, fmpi remained significantly higher in the control group at three months. bop scores showed higher reduction at three months in the patients receiving omega- pufa compared to the control group (p < . ). in both groups, the number of pockets and pd reduced after three months compared to the baseline but there were no statistically significant differences between the groups (p > . ). there was a statistically significant improvement of cal and rec mean values in the test group vs. control group after three months following treatment. moreover, a statistically significant higher percentage of closed pockets (pd ≤ mm without bop) was achieved in the test group vs. control group at three months ( table ). taken together, the patients receiving omega- pufa demonstrated better improvement in resolution of inflammation (greater reduction of bop) and higher gain of cal compared to the patients treated with srp alone. to address whether clinical improvement in the test group in comparison with the control group was accompanied by the appropriate changes in the pro-and anti-inflammatory mediators, we compared salivary levels of fifty-four cytokines/chemokines/growth factors using multielisa. at baseline, no differences in the mean concentrations of cytokines/chemokines/growth factors between the test and control groups were detected. conversely, at three months, we found that mean concentrations of pro-inflammatory il- and il- were markedly lower, and the concentration of anti-inflammatory il- was significantly higher in the salivary samples of the patients who received omega- pufa in comparison to the patients treated with srp alone (table ) . moreover, il- level was increased at three months in both tested groups in comparison to the baseline, suggesting reestablishing the balance between t helper (th) -and th -type immune response towards th . this increase was significantly higher in the test group (p = . ). we also detected different pattern of chemokine release in the patients receiving fo in comparison to the control group. at three months, we detected significant increase of chemokine (c-c motif) ligand (ccl) , ccl , ccl , ccl and chemokine (c-x -c motif) ligand (cx cl) and decrease of ccl , ccl , ccl , chemokine (c-x-c motif) ligand (cxcl) , cxcl and cxcl in the test group (table ) . these changes may reflect cell signaling during tissue healing and repair [ ] . further, we found a significantly higher concentration of fibroblast growth factor (fgf) in saliva in the test group vs. control group at three months. this was a result of a statistically insignificant increase of fgf in the test group (p = . ) and its unchanged level in the control group (p = . ) after treatment (table ) . fgf is a multipotent factor responsible for angiogenesis, keratinocyte organization and wound healing processes. finally, we detected different tendency in granulocyte-colony stimulating factor (g-csf) concentrations between the groups. in the test group, g-csf decreased at three months (p = . ), whereas, in the control group, it increased, but the change was statistically insignificant (p = . ) ( table ) . collectively, we demonstrated regulatory effects of high-dose omega- pufa on mediators of periodontal inflammation and healing. this shift of immune response promoted better resolution of inflammation detected clinically as reduced rates of bop and improved healing detected clinically as cal improvement and better rates of closed periodontal pockets. * statistically significant differences to srp alone; † statistically significant differences between baseline and three months; nd, non detectable; green font-proinflammatory cytokines; pink font-anti-inflammatory cytokines; red font-cxc type chemokines (associated with recruitment of neutrophils and lymphocytes); blue font-cc type chemokines (associated with recruitment of lymphocytes, monocytes, mast cells and eosinophils); black font-growth factors. abbreviations: interleukin- receptor antagonist (il- ra), interferon (ifn), macrophage migration inhibitory factor (mif), granulocyte-macrophage colony-stimulating factor (gm-csf), platelet-derived growth factor bb (pdgf-bb), vascular endothelial growth factor (vegf). the present study showed that supplementation with high-dose omega- pufa as an adjunct to non-surgical treatment of periodontitis can be helpful in management of periodontal disease. it is well recognized that mechanical debridement is a key element in the treatment of periodontal inflammation, with srp being a gold standard of non-surgical treatment. as expected, the improvement of clinical parameters was demonstrated at three months in comparison with baseline in both the study and control groups. we found, however, a statistically significant better improvement in bop and cal at three months in the patients receiving omega- pufa in comparison with srp alone. these parameters are sensitive indicators of resolution of inflammation and tissue healing that both are crucial in preserving healthy and stable dentition for a long period of time in patients with periodontitis. we confirmed that epa and dha can soothe the ongoing inflammation in periodontitis and can be used as hmt non-surgical treatment. our results are in accordance with the study of deore et al. demonstrating that dietary supplementation of omega- pufa with non-surgical periodontal treatment had significant effect on clinical parameters such as gingival index (gi), bop, pd and cal, but no effect on serum c-reactive protein (crp) level [ ] . in contrast, other studies showed that using omega- pufa during non-surgical periodontal treatment had no effect on clinical parameters [ , ] . these differences can result from much lower doses of omega- pufa than used in our study. keskiner et al. showed that daily dietary supplementation with low-dose omega- pufa ( . mg epa and . mg dha) for six months may reduce salivary tnf-α, however no significant impact on clinical parameters was gained [ ] . it was concluded that the effect of omega- pufa could be cumulative and time-dependent. in another study, the effect of daily consumption of mg epa and mg dha for months was analyzed. a significant increase of epa level and decrease of the arachidonic acid/epa serum ratio (mean levels of : ) was achieved [ ] . earlier studies suggested that optimal omega- /omega- ratio should be approximately : - : , and not exceeding : , to maintain health [ ] [ ] [ ] . this suggests that higher intake of omega- pufa for a longer period can result in better outcome. therefore, in our study, we decided to use high-dose omega- pufa ( . g of epa and . g of dha). this is in line with the studies demonstrating beneficial effects of omega- pufa supplementation in other chronic inflammatory diseases such as rheumatoid arthritis ( . g of omega- pufa per day) or crohn's disease ( . g of omega- pufa per day) [ ] . to our surprise, the clinical effects of . g of epa and . g of dha in our study were clearly detectable at three months, thus dietary intervention with high-dose omega- pufa seems to provide rapid anti-inflammatory effect detectable at the clinical level. moreover, omega- and omega- pufa are essential because of the inability of humans, and all mammals alike, to synthesize them. therefore, they must be obtained from properly balanced diet. it has been estimated that current western diet is deficient in omega- pufa with a ratio of omega- to omega- of - / . today, industrialized societies can be characterized by an increased intake of saturated fat, omega- fatty acids and trans fatty acids and a decreased consumption of omega- fatty acids [ , ] . the effects of omega- pufa were also tested in the patients with gingivitis. similar to the results of our study, the decrease of bop was demonstrated in the patients that received omega- pufa in addition to the scaling and oral hygiene instructions versus control group, thus anti-inflammatory properties of epa and dha were also clinically detectable at the less advanced stages of periodontal inflammation [ , ] . some studies employed acetylsalicylic acid together with omega- pufa [ , , , ] . simultaneous administration of omega- pufa and low-dose aspirin resulted in a synergistic interaction of both compounds in resolution of inflammation. elwakeel and hazaa revealed in the patients with diabetes mellitus a significant improvement in clinical parameters plaque index (pi), gi, pd and cal in the test group versus control group, and a highly significant reduction in the il- β level in the gingivocrevicular fluid (gcf) in the experimental group [ ] . another study demonstrated a significant reduction in pd and cal in the group receiving omega- pufa plus aspirin during non-surgical periodontal treatment compared to the control group, with significantly reduced levels of salivary rankl and matrix metalloproteinase (mmp) in the test group [ ] . one study tried to determine whether low-dose of mg of acetylsalicylic acid in combination with a total daily dose of approximately g of dha without mechanical debridement would be beneficial in the treatment of periodontitis versus control group where only mg of aspirin + corn/soy oil capsules was administered. in the intervention group with dha, decreases in pd and gi and no changes in pi and bop were demonstrated with the reduced levels of crp and il -β in gcf. moreover, when acetylsalicylic acid was used alone, no beneficial effect on periodontal inflammation was noted [ ] . although the results of the above-mentioned studies are favorable, it should be kept in mind that providing patients with low-dose aspirin as an adjunct to non-surgical treatment might be questionable. firstly, long-term intake of aspirin is mainly recommended in patients as a primary and secondary prevention of cardiovascular events, where possible adverse effects are less dangerous than the progression of cardiovascular disease [ ] . secondly, acetylsalicylic acid taken for a long period of time inhibits constitutive cyclooxygenase- , which is involved in maintaining physiological homeostasis [ ] . another goal of our study was to determine the effect of omega- pufa on the inflammatory mediators released during periodontal inflammation. the levels of cytokines/chemokines/growth factors were analyzed in the salivary samples at three months. saliva is a good medium for detection of soluble mediators released during periodontal inflammation into gingivocrevicular fluid and subsequently to the saliva. we decided to investigate salivary samples because of the simplicity of the methodology in comparison with gcf collection and analysis [ , ] . saliva as a non-invasive diagnostic fluid was previously used for determining the inflammatory status of periodontal patients with good results [ , ] . it is generally agreed that non-surgical periodontal treatment can result in downregulation of pro-inflammatory cytokines associated with bone connective tissue and bone metabolism. the majority of studies demonstrated significant reduction of salivary concentrations of il- β, il- , il- , tnf-α and gm-csf, as well as increases in il- and il- [ ] [ ] [ ] [ ] [ ] . however, some studies failed to show the same pattern pointing to quite high variability of salivary cytokine levels in the patients with periodontitis [ , ] . in our study at three months after srp, the reduction of il- β was statistically significant in the control group, while the reductions of il- , il- , il- , tnf, ccl , ccl , ccl , cxcl , cxcl , cxcl and g-csf were significant in the test group. when comparing the effect of fish oil on the inflammatory mediators, we found that the levels of proinflammatory il- and il- were markedly lower, and the level of anti-inflammatory il- was significantly higher in the salivary samples of the patients that received omega- pufa in comparison with the patients treated srp alone. both il- and il- are known for neutrophil recruitment, and an important role of il- signaling in tissue damage during periodontal inflammation was recently described [ ] . resolvin d (rvd ), a product of dha metabolism, was shown to prevent alveolar bone loss in porphyromonas gingivalis-induced experimental periodontitis by inhibiting th /th polarization [ ] . moreover, in the mouse model of periodontitis, it was demonstrated that il- plays a protective role by dampening an excessive il- -mediated inflammatory response majorly through innate immune cells [ ] . in line with these findings, we previously reported that il- may induce a population of il- -producing neutrophils in periodontitis [ ] . we also detected an increased salivary concentration of il- in the test group after treatment. il- induces th cell differentiation from naive t cells and their subsequent ifn-γ production. previous studies showed that il- and ifn-γ did not have a major effect on the pathogenesis of infection-stimulated bone resorption in vivo [ ] , and short-term non-surgical therapy resulted in a significant improvement in periodontal indices and a marked increase in the salivary il- levels [ ] . however, an osteolytic role of il- in the pathogenesis of periodontitis was also suggested [ ] . interestingly, ifn-γ, a th -type cytokine that was increased in the saliva of the test group seems to act antagonistically on th differentiation [ ] and osteoclastogenesis [ ] . in this study, we also found that an intake of fish oil rich in omega- pufa slightly promoted an increase of salivary concentrations of fgf that was previously shown to promote bone formation through accelerating the differentiation of osteoprogenitor cells and to stimulate proliferation and migration of periodontal ligament cells [ ] . host modulatory therapy is one of the main focuses of interest for many of the investigators and currently considered a promising treatment approach. many medications were proposed in this context such as non-steroidal anti-inflammatory drugs, tetracyclines or bisphosphonates which may be delivered locally or systemically [ , , ] . however, those pharmacological substances can be used only to a limited extent and have undesirable effects. thereby, our attention was focused on safer, naturally derived pufa epa and dha. although the studies analyzing omega- pufa in the treatment of periodontitis are limited, and the study design differed in the aspects such as epa and dha dose, duration of study, number of participants and inclusion criteria, a general conclusion can be drawn that this approach provides favorable clinical outcomes. we need to emphasize that non-surgical periodontal treatment is required for the patients in terms of cooperation and proper regimen. in particular, adequate daily oral hygiene and controlling the risk factors, such as smoking habit or diabetes, may be crucial in the long-term maintenance of disease remission. keeping in mind the systemic effects of untreated periodontal inflammation on general health, introduction of the natural and safe dietary supplementation during treatment of periodontitis may have additional beneficial effects. in this context, omega- pufa seem to be particularly beneficial in the patients with hypercholesterolemia/cardiovascular diseases and periodontitis [ ] . our study has a few limitations. one of them is the baseline difference between the test and control groups in terms of age and fmpi. this was a result of a relatively high dropout rate, mainly due to sars-cov- epidemic-related lockdown. when we took into account the baseline data of all forty patients that were recruited, no differences between the groups in the age and fmpi were noted. although both groups at baseline have comparable advancement of periodontitis, we need to bear in mind that age and plaque accumulation are the risk factors of periodontitis and may lead to the worse treatment response [ ] . however, it has been suggested that the increased level of periodontal destruction observed with aging is the result of cumulative damage rather than a result of its increased rates [ ] . thus, aging is not a risk factor per se. there are very limited data on periodontal healing in older individuals showing both delayed [ ] and normal healing after periodontal treatment of people with moderate-to-advanced forms of periodontitis [ ] . in general, aging is not perceived as a negative predictor for unfavorable treatment response and risk factor for disease progression [ ] . another limitation of the study is the use of fish-derived oil mixture instead of isolated epa and dha. natural fish oil was chosen to mimic dietary conditions where a range of essential oils is consumed. however, we cannot rule out that other components of the fish oil affected the outcome of our study. specifically, squalene and alkylglycerols present in the fish oil may affect inflammatory immune response activating th -type il- and ifn-γ cytokine production and increasing total antioxidant status of serum [ , ] . because of the choice of fish oil as a source of epa and dha, no placebo was employed in our study and patients were aware of the treatment allocation. in our experience, the taste of fish oil cannot be masked, even when it is taken in capsules (as a result of belching). future research with a larger sample size and long-term observation are warranted to validate the usage of omega- pufa as an adjunctive dietary therapy option to treat periodontitis. in conclusion, the results obtained in this study suggest that daily dietary supplementation with high-dose omega- pufa can be used as an adjunct to non-surgical treatment of periodontist as host modulatory therapy. no adverse events were recorded during omega- pufa treatment. omega- pufa had favorable effects on resolution of inflammation and tissue regeneration in the patients with periodontitis. our research showed significant improvement of clinical parameters accompanied by the reduction of salivary levels of pro-inflammatory cytokines/chemokines in favor of higher level of anti-inflammatory il- and pro-regenerative fgf . biomarine medical fish oil composition is restricted by patent no. uprp p. . assessing the role of porphyromonas gingivalis in periodontitis to determine a causative relationship with alzheimer's disease global, regional, and national prevalence, incidence, and disability-adjusted life years for oral conditions for countries, - : a systematic analysis for the global burden of diseases, injuries, and risk factors clinical study laser supported reduction of specific microorganisms in the periodontal pocket with the aid of an er clinical improvement following therapy for periodontitis: association with a decrease in il- and il- bone versus immune system modulation of host pge secretion as a determinant of periodontal disease expression periodontal host modulation with antiproteinase, anti-inflammatory, and bone-sparing agents. a systematic review new directions in host modulation for the management of periodontal disease: commentary host response modulation in the management of periodontal diseases dietary supplementation with low-dose omega- fatty acids reduces salivary tumor necrosis factor-α levels in patients with chronic periodontitis: a randomized controlled clinical study effect of omega fatty acids plus low-dose aspirin on both clinical and biochemical profiles of patients with chronic periodontitis and type diabetes: a randomized double blind placebo-controlled study omega fatty acids as a host modulator in chronic periodontitis patients: a randomised, double-blind, palcebo-controlled, clinical trial serum level changes of long chain-polyunsaturated fatty acids in patients undergoing periodontal therapy combined with one year of omega- supplementation: a pilot randomized clinical trial the efficacy of host response modulation therapy (omega- plus low-dose aspirin) as an adjunctive treatment of chronic periodontitis (clinical and biochemical study) docosahexaenoic acid and periodontitis in adults: a randomized controlled trial fatty acids from fish: the anti-inflammatory potential of long-chain omega- fatty acids omega- polyunsaturated fatty acids as an adjunct to non-surgical treatment of periodontitis resolving inflammation: dual anti-inflammatory and pro-resolution lipid mediators staging and grading of periodontitis: framework and proposal of a new classification and case definition chemokine changes during oral wound healing omega- /omega- essential fatty acids: biological effects dietary n- and n- polyunsaturated fatty acids: from biochemistry to clinical implications in cardiovascular prevention importance of a balanced omega /omega ratio for the maintenance of health. nutritional recommendations therapeutic potential of n- polyunsaturated fatty acids in disease the importance of the omega- /omega- fatty acid ratio in cardiovascular disease and other chronic diseases omega- fatty acids in inflammation and autoimmune diseases mechanism of action of aspirin-like drugs effect of periodontal surgery on osteoprotegerin levels in gingival crevicular fluid, saliva, and gingival tissues of chronic periodontitis patients adjunctive treatment of chronic periodontitis with daily dietary supplementation with omega- fatty acids and low-dose aspirin recent trends in the prevalence of low-dose aspirin use for primary and secondary prevention of cardiovascular disease in the united states human saliva as a diagnostic material the clinical value of salivary biomarkers for periodontal disease the influence of vitamin d supplementation on local and systemic inflammatory markers in periodontitis patients: a pilot study non-surgical periodontal therapy reduces saliva adipokine and matrix metalloproteinase levels in periodontitis impact of non-surgical periodontal treatment on salivary expression of cytokines related to bone metabolism interleukin- levels in gingival crevicular fluid and saliva of patients with chronic periodontitis after periodontal treatment comparative evaluation of cytokines in gingival crevicular fluid and saliva of patients with aggressive periodontitis the effect of scaling and root planning on salivary tnf-α and il- α concentrations in patients with chronic periodontitis. open dent evaluation of salivary biomarker profiles following non-surgical management of chronic periodontitis antagonistic effects of il- and d-resolvins on endothelial del- expression through a gsk- β-cebpβ pathway resolvin d restrains th immunity and prevents alveolar bone loss in murine periodontitis il- dampens an il- -mediated periodontitis-associated inflammatory network induction of human il- -producing neutrophils by lps-stimulated treg cells and il- gamma interferon (ifn-γ) and ifn-γ-inducing cytokines interleukin- (il- ) and il- do not augment infection-stimulated bone resorption in vivo effect of periodontal therapy on salivary interleukin- levels in chronic periodontitis interleukin- induces receptor activator of nuclear factor-kappa b ligand expression by human periodontal ligament cells th cells in human disease t-cell-mediated regulation of osteoclastogenesis by signalling cross-talk between rankl and ifn-γ evaluation of recombinant human fgf- and pdgf-bb in periodontal regeneration: a systematic review and meta pharmacotherapy for host modulation in periodontal disease: a review fitoterapia marine omega- fatty acids in the prevention of cardiovascular disease risk factors for periodontitis current view of risk factors for periodontal diseases wound healing in the gingiva of young and old individuals effect of age on healing following periodontal therapy effect of high doses of shark liver oil supplementation on t cell polarization and peripheral blood polymorphonuclear cell function an update on the therapeutic role of alkylglycerols key: cord- - rczh hu authors: calder, philip c.; carr, anitra c.; gombart, adrian f.; eggersdorfer, manfred title: reply to “overstated claims of efficacy and safety. comment on: optimal nutritional status for a well-functioning immune system is an important factor to protect against viral infections. nutrients , , ” date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: rczh hu we thank vorland et al [...]. we thank vorland et al. [ ] for their interest in our recent publication [ ] . they provide comments in relation to our interpretation of systematic reviews of omega- (n- ) fatty acids [ ] and vitamin c [ ] [ ] [ ] . the systematic review of n- fatty acids, sometimes in combination with other nutrients, in acute respiratory distress syndrome (ards) was cited in the context of a so-called "cytokine storm" rather than protection from viral, or any other, infection per se. the findings from that systematic review are shown in table . table . summary of the findings of the systematic review and meta-analysis of the effects of n- fatty acid rich formulas in patients with acute respiratory distress syndrome [ ] . in our view, these data support our statement that the systematic review identifies "a significant improvement in blood oxygenation and significant reductions in ventilation requirement, new organ failures, length of stay in the intensive care unit and mortality at days". in our publication [ ] we made a recommendation for intake of eicosapentaenoic acid plus docosahexaenoic acid of mg/day, which is in keeping with many recommendations made by regulatory authorities for these fatty acids [ ] [ ] [ ] and can be easily achieved through diet (i.e., consumption of fatty fish) [ ] . it is important to emphasise that the amount of n- fatty acids delivered in formulas used in the trials in ards is greatly in excess of mg/day, typically several g per day. our statements in relation to the systematic review on vitamin c and pneumonia [ ] were that there was "a significant reduction in the risk of pneumonia with vitamin c supplementation, particularly in individuals with low dietary intakes" and that "in older patients, disease severity and risk of death were reduced with supplementation, particularly in the case where initial plasma levels of vitamin c were low". thus, we stress the likely role of vitamin c in those individuals with low intake or status. this is consistent with the findings reported in the systematic review, the abstract of which makes the final conclusion "therapeutic vitamin c supplementation may be reasonable for pneumonia patients who have low vitamin c plasma levels because its cost and risks are low". in relation to the systematic review on vitamin c and the common cold [ ] we stated that "vitamin c supplementation has also been shown to decrease the duration and severity of upper respiratory tract infections, such as the common cold, and significantly decrease the risk of infection when given prophylactically in people under enhanced physical stress". the results section of the abstract of the systematic review states "in adults the duration of colds was reduced by % ( % to %) and in children by % ( % to %). in children, to g/day vitamin c shortened colds by %. the severity of colds was also reduced by regular vitamin c administration". furthermore, the conclusions section of the abstract of the systematic review states "vitamin c may be useful for people exposed to brief periods of severe physical exercise. regular supplementation trials have shown that vitamin c reduces the duration of colds, but this was not replicated in the few therapeutic trials that have been carried out. nevertheless, given the consistent effect of vitamin c on the duration and severity of colds in the regular supplementation studies, and the low cost and safety, it may be worthwhile for common cold patients to test on an individual basis whether therapeutic vitamin c is beneficial for them". we note that risk ratio for the incidence of common colds in those undertaking heavy acute physical activity was . ( % confidence interval . - . ). we consider that our statements are consistent with the findings of these two systematic reviews. vorland et al. [ ] raise the important question of safety. we do not dispute that safety is of utmost importance, and in accordance with this, we state that "intakes should follow recommended upper safety limits set by expert authorities, such as the european food safety authority and, in the united states, the iom" and we go on to discuss intakes of vitamins c and d in relation to stated tolerable upper limits and where these vary in children. our review deals with micronutrients (and n- fatty acids), viral infection and related respiratory disease; it is not restricted solely to covid- . there are not yet any published trials of supplementation with individual or mixed micronutrients and either prevention or treatment of covid- ; we wish to emphasise that we did not give any impression that such evidence currently exists. however, given that there is a substantial body of evidence that micronutrients support the function of many components of the immune system [ ] and may reduce risk of incidence or severity of respiratory illness [ , ] , we consider that such trials are warranted. optimal nutrient status for a well-functioning immune system is an important factor to protect against viral infections optimal nutritional status for a well-functioning immune system is an important factor to protect against viral infections immunonutrition for acute respiratory distress syndrome (ards) in adults vitamin c for preventing and treating pneumonia vitamin c for preventing and treating the common cold extra dose of vitamin c based on a daily supplementation shortens the common cold: a meta-analysis of randomized controlled trials fats and fatty acids in human nutrition-report of an expert consultation chinese dietary reference intakes summary; people's medical publishing house scientific opinion on dietary reference values for fats, including saturated fatty acids, polyunsaturated fatty acids, monounsaturated fatty acids, trans fatty acids and cholesterol very long-chain n- fatty acids and human health: fact, fiction and the future a review of micronutrients and the immune system-working in harmony to reduce the risk of infection key: cord- -hn pmcto authors: li, yao; yao, jiaying; han, chunyan; yang, jiaxin; chaudhry, maria tabassum; wang, shengnan; liu, hongnan; yin, yulong title: quercetin, inflammation and immunity date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: hn pmcto in vitro and some animal models have shown that quercetin, a polyphenol derived from plants, has a wide range of biological actions including anti-carcinogenic, anti-inflammatory and antiviral activities; as well as attenuating lipid peroxidation, platelet aggregation and capillary permeability. this review focuses on the physicochemical properties, dietary sources, absorption, bioavailability and metabolism of quercetin, especially main effects of quercetin on inflammation and immune function. according to the results obtained both in vitro and in vivo, good perspectives have been opened for quercetin. nevertheless, further studies are needed to better characterize the mechanisms of action underlying the beneficial effects of quercetin on inflammation and immunity. quercetin, a flavonoid found in fruits and vegetables, has unique biological properties that may improve mental/physical performance and reduce infection risk [ ] . these properties form the basis for potential benefits to overall health and disease resistance, including anti-carcinogenic, anti-inflammatory, antiviral, antioxidant, and psychostimulant activities, as well as the ability to inhibit lipid peroxidation, platelet aggregation and capillary permeability, and to stimulate mitochondrial biogenesis [ ] . therefore, there is a pressing need for well-designed clinical trials to evaluate this novel dietary supplement further. this article reviews effects of quercetin on inflammation and immunity in mental and physical performance and health. quercetin is categorized as a flavonol, one of the six subclasses of flavonoid compounds. the name has been used since , and is derived from quercetum (oak forest), after quercus. it is a naturally occurring polar auxin transport inhibitor [ ] . the international union of pure and applied chemistry (iupac) nomenclature for quercetin is , , , , -pentahydroxyflvanone (or its synonym , , , , -pentahydroxy- -phenylchromen- -one). this means that quercetin has an oh group attached at positions , , , , and . common forms of quercetin were shown in figure . quercetin (c h o ) is an aglycone, lacking an attached sugar. it is a brilliant citron yellow needle crystal and entirely insoluble in cold water, poorly soluble in hot water, but quite soluble in alcohol and lipids. a quercetin glycoside is formed by attaching a glycosyl group (a sugar such as glucose, rhamnose, or rutinose) as a replacement for one of the oh groups (commonly at position ). the attached glycosyl group can change the solubility, absorption, and in vivo effects. as a general rule of thumb, the presence of a glycosyl group (quercetin glycoside) results in increased water solubility compared to quercetin aglycone [ , ] . a quercetin glycoside is unique by the attached glycosyl group. generally, the term quercetin should be used to describe the aglycone only; however, the name is occasionally used to refer to quercetin-type molecules, including its glycosides in research and the supplement industry. quercetin-type flavonols (primarily as quercetin glycosides), the most abundant of the flavonoid molecules, are widely distributed in plants. they are found in a variety of foods including apples, berries, brassica vegetables, capers, grapes, onions, shallots, tea, and tomatoes, as well as many seeds, nuts, flowers, barks, and leaves. quercetin is also found in medicinal botanicals, including ginkgo biloba, hypericum perforatum, and sambucus canadensis [ ] [ ] [ ] . in red onions, higher concentrations of quercetin occur in the outermost rings and in the part closest to the root, the latter being the part of the plant with the highest concentration [ ] . one study found that organically grown tomatoes had % more quercetin than chemically grown fruit [ ] . quercetin is present in various kinds of honey from different plant sources [ ] . food-based sources of quercetin include vegetables, fruits, berries, nuts, beverages and other products of plant origin [ ] . in the determined food, the highest concentration is mg/ g of edible portion in capers (raw), the lowest concentration is mg/ g of edible portion in black or green tea (camellia sinensis) [ ] . dietary intake of quercetin was different in several countries. the estimated flavonoid intake ranges from to mg/day (quercetin accounts for %), mostly depending on the consumption of fruits and vegetables and the intake of tea [ ] . in the suihua area of northern china, quercetin intake was reported to be . mg/day, where the main food sources of flavonol was apples ( . %), quercetin (c h o ) is an aglycone, lacking an attached sugar. it is a brilliant citron yellow needle crystal and entirely insoluble in cold water, poorly soluble in hot water, but quite soluble in alcohol and lipids. a quercetin glycoside is formed by attaching a glycosyl group (a sugar such as glucose, rhamnose, or rutinose) as a replacement for one of the oh groups (commonly at position ). the attached glycosyl group can change the solubility, absorption, and in vivo effects. as a general rule of thumb, the presence of a glycosyl group (quercetin glycoside) results in increased water solubility compared to quercetin aglycone [ , ] . a quercetin glycoside is unique by the attached glycosyl group. generally, the term quercetin should be used to describe the aglycone only; however, the name is occasionally used to refer to quercetin-type molecules, including its glycosides in research and the supplement industry. quercetin-type flavonols (primarily as quercetin glycosides), the most abundant of the flavonoid molecules, are widely distributed in plants. they are found in a variety of foods including apples, berries, brassica vegetables, capers, grapes, onions, shallots, tea, and tomatoes, as well as many seeds, nuts, flowers, barks, and leaves. quercetin is also found in medicinal botanicals, including ginkgo biloba, hypericum perforatum, and sambucus canadensis [ ] [ ] [ ] . in red onions, higher concentrations of quercetin occur in the outermost rings and in the part closest to the root, the latter being the part of the plant with the highest concentration [ ] . one study found that organically grown tomatoes had % more quercetin than chemically grown fruit [ ] . quercetin is present in various kinds of honey from different plant sources [ ] . food-based sources of quercetin include vegetables, fruits, berries, nuts, beverages and other products of plant origin [ ] . in the determined food, the highest concentration is mg/ g of edible portion in capers (raw), the lowest concentration is mg/ g of edible portion in black or green tea (camellia sinensis) [ ] . dietary intake of quercetin was different in several countries. the estimated flavonoid intake ranges from to mg/day (quercetin accounts for %), mostly depending on the consumption of fruits and vegetables and the intake of tea [ ] . in the suihua area of northern china, quercetin intake was reported to be . mg/day, where the main food sources of flavonol was apples ( . %), followed by potatoes ( . %), lettuce ( . %) and oranges ( . %) [ ] , whereas the average quercetin intake was . mg/day, with apple ( . %), potato ( . %), celery ( . %), eggplant ( . %), and actinidia ( . %) being the main food sources of quercetin in harbin, china [ ] . the most recent study showed that quercetin intake is about mg/day for chinese healthy young males. in the usa, flavonol intake is about mg/day for u.s. adults, while quercetin represents three-quarters of this amount. the mean quercetin intake was approximately . to . mg per day. onions, tea, and apples contained high amounts of quercetin [ ] . in japan, the average and median quercetin intakes were . and . mg/day, respectively; the quercetin intake by men was lower than that by women; and the quercetin intakes showed a low correlation with age in both men and women. the estimated quercetin intake was similar during summer and winter. quercetin was mainly ingested from onions and green tea, both in summer and in winter. vegetables, such as asparagus, green pepper, tomatoes, and red leaf lettuce, were good sources of quercetin in summer [ ] . in australia, black and green teas were the dominant sources of quercetin. other sources included onion, broccoli, apple, grape, and beans [ ] . analysis of the -h recall data indicated an average adult intake of total flavonoids (> years) of mg/day. apple was the most important source of quercetin until age - years, after which onion became an increasingly important prominent source [ ] . in spain, the average daily intake of quercetin is . mg/day, which is significantly higher than that in the united states ( . mg/day), based on sources like tea, citrus fruits and juice, beers and ales, wines, melon, apples, onions, berries and bananas [ ] . the first investigation on the pharmacokinetics of quercetin in humans suggested very poor oral bioavailability after a single oral dose (~ %). the estimated absorption of quercetin glucoside, the naturally occurring form of quercetin, ranges from % to % in healthy individuals receiving mg. the relatively low bioavailability of quercetin may be attributed to its low absorption, extensive metabolism and/or rapid elimination. quercetin glycosides might be differently absorbed based on the type of sugar attached [ ] . available evidence indicates that quercetin glucosides (like those found predominantly in onion or shallot flesh) are far better absorbed than its rutinosides (the major quercetin glycoside in tea). the glucosides are efficiently hydrolyzed in the small intestine by beta-glucosidases to the aglycone form, much of which is then absorbed [ ] . quercetin glucuronic acid and its sulfuric acid derivatives were more easily absorbed than quercetin [ ] . thereafter, its absorption is affected by differences in its glycosylation, the food matrix from which it is consumed, and the co-administration of dietary components such as fiber and fat [ ] . thus different sugar types and sugar group conjugation sites will result in absorption variation. quercetin and derivatives are stable in gastric acid; however, there were no reports whether they can be absorbed in stomach. studies suggest that quercetin is absorbed in the upper segment of small intestinal [ , ] . among quercetin's derivatives, conjugated forms of its glycosides are better absorbed than quercetin. purified quercetin glucosides are capable of interacting with the sodium dependent glucose transport receptors in the mucosal epithelium and may therefore be absorbed by the small intestine in vivo [ ] . after absorption, quercetin becomes metabolized in various organs including the small intestine, colon, liver and kidney. metabolites formed in the small intestine and liver by biotransformation enzymes include the methylated, sulfo-substituted and glucuronidated forms [ , ] . a study regarding the tissue distribution in rats and pigs has shown that the highest accumulation of quercetin and its metabolites are found in (rat) lung and (pig) liver and kidney [ ] . quercetin and derivatives are transformed into various metabolites (phenolic acid) by enteric bacteria and enzymes in intestinal mucosal epithelial cells. these metabolites are absorbed, transformed or excreted later. moreover, bacteria ring fission of the aglycon occurs in both the small intestine and colon, resulting in the breakdown of the backbone structure of quercetin and the subsequent formation of smaller phenolics [ ] . quercetin metabolites analyzed in plasma and liver samples have shown that the concentrations of its derivatives in the liver were lower than those in plasma, and the hepatic metabolites were intensively methylated ( %- %) [ ] . limited studies suggest that quercetin was methylated, vulcanized and glucuronidated in liver [ ] . continuous intake of diet containing quercetin accumulated in blood and significantly increased quercetin concentration in plasma, which was significantly correlated to its dietary content [ ] . quercetin is present in a conjugated form in human blood whose major form is glycoside [ ] . while isorhamnetin and glucoside acid-sulfated derivatives of quercetin account for . % of its metabolites, other metabolites include its glucuronoside and methylated form [ ] . boulton also found that quercetin conjugated plasma protein (albumin account for . %), thus decreased its bioavailability in cells [ ] . the limited research suggests that quercetin and its metabolites tend to accumulate in the organs involved in its metabolism and excretion, and that perhaps mitochondria might be an area of quercetin concentration within cells [ ] [ ] [ ] [ ] [ ] [ ] [ ] . kidney is a major organ of excretion. quercetin concentration in urine increased with the increasing dose and time after intake of fruit juice was ingested in human [ ] , perhaps benzoic acid derivatives are common metabolite of quercetin [ ] . human subjects can absorb significant amounts of quercetin from food or supplements, and elimination is quite slow, with a reported half-life ranging from to h [ ] . the average terminal half-life of quercetin is . h [ ] . the total recovery of c-quercetin in urine, feces and exhaled air is highly variable, depending on the individual [ ] . a high amount of absorbed quercetin is extensively metabolized and eventually eliminated by the lungs [ ] . additional literature suggests that isoquercetin (glycosylated quercetin) is more completely absorbed than quercetin in the aglycone form, and that the simultaneous ingestion of quercetin with vitamin c, folate and additional flavonoids improves bioavailability [ , ] . all of these studies indicate that quercetin glucosides is absorbed in the upper segment of small intestinal, then is methylated, sulfo-substituted and glucuronidated by biotransformation enzymes in the small intestine and liver, and is finally excreted by kidney in urine. quercetin was reported as a long lasting anti-inflammatory substance that possesses strong anti-inflammatory capacities [ , ] . it possesses anti-inflammatory potential that can be expressed on different cell types, both in animal and human models [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . it is known to possess both mast cell stabilizing and gastrointestinal cytoprotective activity [ ] . it can also play a modulating, biphasic and regulatory action on inflammation and immunity [ ] . additionally, quercetin has an immunosuppressive effect on dendritic cells function [ ] . several studies in vitro using different cell lines have shown that quercetin inhibits lipopolysaccharide (lps)-induced tumor necrosis factor α (tnf-α) production in macrophages [ ] and lps-induced il- production in lung a cells [ ] . moreover, in glial cells it was even shown that quercetin can inhibit lps-induced mrna levels of tnf-α and interleukin (il)- α, this effect of quercetin resulted in a diminished apoptotic neuronal cell death induced by microglial activation [ ] . quercetin inhibits production of inflammation-producing enzymes (cyclooxygenase (cox) and lipoxygenase (lox)) [ , ] . it limits lps-induced inflammation via inhibition of src-and syk-mediated phosphatidylinositol- -kinase (pi k)-(p ) tyrosine phosphorylation and subsequent toll like receptor (tlr )/myd /pi k complex formation that limits activation of downstream signaling pathways in raw . cells [ ] . it can also inhibit fcεri-mediated release of pro-inflammatory cytokines, tryptase and histamine from human umbilical cord blood-derived cultured mast cells (hcbmcs); this inhibition appears to involve in inhibition of calcium influx, as well as phospho-protein kinase c (pkc) [ ] . the study of quercetin against h o -induced inflammation showed the protective effects of quercetin against inflammation in human umbilical vein endothelial cells (huvecs) and indicated that the effect was mediated via the downregulation of vascular cell adhesion molecule (vcam- ) and cd expression [ ] . quercetin significantly induces the gene expression as well as the production of th- derived interferon-γ (ifn-γ) and down-regulates th- derived interleukin (il- ) by normal peripheral blood mononuclear cells (pbmc). furthermore, quercetin treatment increased the phenotypic expression of ifn-γ cells and decreased il- positive cells by flow cytometry analysis, which corroborate with protein secretion and gene expression studies. these results suggest that the beneficial immuno-stimulatory effects of quercetin may be mediated through the induction of th- derived cytokine, ifn-γ, and inhibition of th- derived cytokine, il- [ ] . quercetin is able to inhibit matrix metalloproteinases, which are normally inhibited by plasminogen activator inhibitor (pai- ) in human dermal fibroblasts [ ] . il- -stimulated il- production from human mast cells is regulated by biochemical pathways distinct from ige-induced degranulation, and quercetin can block both il- secretion and two key signal transduction steps involved [ ] . quercetin is known to possess both mast cell stabilizing and gastrointestinal cytoprotective activity. a study demonstrates that quercetin has a direct regulatory effect on basic functional properties of immune cells which may be mediated by the extracellular regulated kinase (erk ) mitogen-activated protein (map) kinase signal pathway in human mitogen-activated pbmc and purified t lymphocytes [ ] . the property proves inhibitory to a huge panoply of molecular targets in the micromolar concentration range, either by down-regulating or suppressing many inflammatory pathways and functions. quercetin has shown a biphasic behavior in basophils at nanomolar doses and hence its action on cells involved in allergic inflammation. quercetin affects immunity and inflammation by acting mainly on leukocytes and targeting many intracellular signaling kinases and phosphatases, enzymes and membrane proteins are often crucial for a cellular specific function. however, the wide group of intracellular targets and the elevated number of natural compounds potentially effective as anti-inflammatory therapeutic agents, asks for further insights and evidence to comprehend the role of these substances in animal cell biology [ ] . in vitro treatment of activated t cells with quercetin blocks il- -induced tyrosine phosphorylation of jak , tyk , stat , and stat , resulting in a decrease in il- -induced t cell proliferation and th differentiation [ ] . taken as in vitro together, the possible pathway of quercetin on inflammation and immune function is as follows (figure ) . the main action of quercetin on inflammation and immune function in vitro is summarized in the table . the main action of quercetin on inflammation and immune function in vitro is summarized in the table . - mmol/l human umbilical cord blood-derived cultured mast cells (hcbmcs) inhibition of il- -induced il- secretion, p and pkc-theta phosphorylation [ ] ě mmol/l or ď mmol/l inhibition of dc activation; dc apoptosis; downregulation of the cytokines and chemokines, disturbance of immunoregulation; attenuation of lps-induced dc maturation and limitation of immunostimulatory activity; downregulate of endocytosis and impairment of ag loading; suppression of dc migration and disconnection of the induction of adaptive immune responses [ ] . . in vivo quercetin exerts inflammation and immune modulating activity in several murine models of autoimmunity. in vivo, animal experiments also support an anti-inflammatory effect. quercetin ameliorates the inflammatory response induced by carrageenan [ ] and a high-fat diet [ ] . quercetin reduced visceral adipose tissue tnf-α and nitric oxide production and downregulated nitric oxide synthase (nos) expression in obese zucker rats [ ] . in chronic rat adjuvant induced arthritis, quercetin decreased clinical signs of arthritis compared to untreated controls [ ] . in rats, post-trauma administration of quercetin improves recovery of motor function after acute traumatic spinal cord injury. intraperitoneal (ip) doses of - micromoles quercetin/kg body weight resulted in half or more of the animals walking, although with deficit [ ] . this ability to promote recovery from spinal cord injury appears to be highly dependent on the dose and frequency of dosing. in this study a lower ip dose was ineffective. in another study, compared to an untreated control group of animals (none of which recovered motor function sufficient to walk), quercetin administration twice daily for three or days resulted in about percent of the animals recovering sufficient motor function to walk. however, when quercetin was injected three times daily, none of the nine animals recovered the ability to walk [ ] . study has shown that quercetin exerted protective effect against irradiation-induced inflammation in mice through increasing cytokine secretion [ ] . quercetin possesses activity against isoproterenol-induced myocardial oxidative injury and immunity function impairment, and that the mechanism of pharmacological action was related at least in part to the antioxidant activity of quercetin [ ] . quercetin decreased histological signs of acute inflammation in the treated animals in a dose-dependent manner via suppressing leucocyte recruitment, decreasing chemokine levels and levels of the lipid peroxidation end-product malondialdehyde, and increasing antioxidant enzyme activity in experimental rat model [ ] . quercetin ameliorated experimental allergic encephalomyelitis (eae) by blocking il- signaling and th differentiation [ ] and experimental autoimmune myocarditis (eam) in dark agouti rats by interfering with production of pro-inflammatory (tnf-α and il- ) and/or anti-inflammatory (il- ) cytokines [ ] . quercetin most likely universally suppresses the accumulation and activation of immune cells, including anti-inflammatory cells, whereas it specifically increased gene expression associated with mitochondrial oxidative phosphorylation in western diet-induced obese mice. suppression of oxidative stress and nf-κb activity likely contributed to the prevention of the accumulation and activation of immune cells and resulting chronic inflammation of epididymal adipose tissue in western diet-induced obese mice [ ] . diet supplementation with combinations of resveratrol, pterostilbene, morin hydrate, quercetin, δ-tocotrienol, riboflavin, and nicotinic acid reduces cardiovascular risk factors in humans when used as nutritional supplements with, or without, other dietary changes in healthy seniors and hypercholesterolemic subjects [ ] . in a randomized, double-blinded, placebo-controlled trial, subjects took or mg/day quercetin or a placebo for weeks. for the group as a whole, quercetin supplementation had no significant influence on rates of upper respiratory tract infections (urti) compared to placebo. in a subgroup of subjects age or older who self-rated themselves as physically fit, mg/day quercetin resulted in a statistically significant reduction in total sick days and symptom severity associated with urti [ ] . female subjects were supplemented with or mg/day quercetin or placebo for weeks. while quercetin supplementation significantly increased plasma quercetin levels, it had no influence on measure of immune function [ ] . quercetin ( mg/day) did not alter exercise-induced changes in several measures of immune function following three days of intense exercise in trained athletes, but it significantly reduced urti incidence ( of subjects in active versus of in placebo group) during the two-week post-exercise period [ ] . a similar lack of effect on strenuous exercise-induced immune system perturbation was found in subjects who took mg/day of quercetin for three weeks before, during, and continuing for two weeks after the -km western states endurance run. in this study, however, there were no differences in the post-race illness rates between quercetin and placebo groups [ ] . there are several studies in humans investigating the correlation of quercetin and its immunomodulatory effects. quercetin does indeed reduce illness after intensive exercise. again, under double-blind conditions, nieman et al. showed that a supplement of mg of quercetin alone three weeks before, during and two weeks after a three-day period of h of cycling in the winter resulted in a markedly lower incidence of urti in well-trained subjects in the two weeks after the intensified training, but had no effect on exercise-induced immune dysfunction, inflammation and oxidative stress [ ] . the literature is supportive of the anti-pathogenic capacities of quercetin when it is cultured with target cells and a broad spectrum of pathogens including urti-related rhinoviruses, adenoviruses and coronaviruses. the impact of the co-ingestion of two or more flavonoids increases their bioavailability and the outcomes on immunity. nieman et al. determined the influence of two weeks of mg/day quercetin compared with placebo supplementation on exercise performance and skeletal muscle mitochondrial biogenesis in untrained, young adult males. it resulted in significantly reduced post-exercise measures for both inflammation and oxidative stress, with a chronic augmentation of granulocyte oxidative burst activity [ ] . when taken together, quercetin showed a successful reduction in the illness rates of exercise-stressed athletes as well as a chronic augmentation of their innate immune function. most in vitro research suggests that quercetin possesses anti-inflammation and immunological improvement. however, the results from a double-blinded, placebo-controlled, randomized trial indicated that quercetin supplementation at and mg/day for weeks significantly increased plasma quercetin levels but had no influence on measures of innate immune function or inflammation in community-dwelling adult females [ ] . the main action of quercetin on inflammation and immune function in vivo is summarized in the table . increase of activity of endogenous antioxidant enzymes and inhibition of free radical generation [ ] or µg sjl/j mice blockage of interleukin- signaling and th differentiation [ ] or mg/kg (oral administration) dark agouti rat interference of pro-inflammatory (tnf-α and il- ) and/or anti-inflammatory (il- ) cytokines production [ ] human and mg/person elderly human subject inhibition of proteasome (nitric oxide, c-reactive protein, γ-glutamyltransferase) activity [ ] and mg/day human subject reduction of upper respiratory tract infection and total sick days; improvement in -min treadmill time trial performance no effect [ ] mg/day human in treadmill no effect [ ] and mg/day human subject no effect on innate immune function or inflammation, illness rates no effect [ ] mg/day human cyclist no effect [ ] mg/day human runner no effect [ ] mg/day human cyclist no effect [ ] these results suggest that quercetin exhibited anti-inflammation and immune-enhancement in vitro (cells) and in vivo (animals), however, studies in human did not totally support these results from cells and animals. the effect, in which quercetin acts as an immune booster in humans, needs to be further verified for future broad application. as a widespread flavonoid, quercetin is a safe and dietary supplement based on its broad range of biological effects in animal. the results of these effects are not consistent, however, and the outcomes need to be carefully evaluated, as they are dependent on the type of subject and their level of health. taken together, we know definitively that a quercetin glycoside is much more efficient than other forms of quercetin. in the majority of the literature, we find references to the benefits of prolonged supplementation with quercetin. the future challenge is to investigate optimal benefits of quercetin, especially to the recommendation for the protracted intake. for example, a carbohydrate drink may have a better effect than pure quercetin preparation. the research in this area continues to determine the proper outcomes, dosing regimen and adjuvants that may amplify any perceived bioactive effects of quercetin in vivo. effects of the dietary flavonoid quercetin upon performance and health beneficial effects of quercetin on obesity and diabetes induction of zygotic polyembryos in wheat: influence of auxin polar transport dietary flavonoids: bioavailability, metabolic effects, and safety the sugar moiety is a major determinant of the absorption of dietary flavonoid glycosides in man content of the flavonols quercetin, myricetin, and kaempferol in edible berries bioavailability and bioefficacy of polyphenols in humans. ii. review of intervention studies quercetin from shallots (allium cepa l. var. aggregatum) is more bioavailable than its glucosides genetic analysis of quercetin in onion (allium cepa l.) lady raider ten-year comparison of the influence of organic and conventional crop management practices on the content of flavonoids in tomatoes analysis of flavonoids in honey by hplc coupled with coulometric electrode array detection and electrospray ionization mass spectrometry biologically active substances of plant origin. flavonols and flavones: prevalence, dietary sources and consumption usda database for the flavonoid content of selected foods estimated dietary flavonoid intake and major food sources of u.s. adults using an ffq to assess intakes of dietary flavonols and flavones among female adolescents in the suihua area of northern china. public health nutr dietary flavonol and flavone intakes and their major food sources in chinese adults flavonol and flavone intakes in us health professionals estimated daily intake and seasonal food sources of quercetin in japan dietary flavonoid sources in australian adults estimation of dietary sources and flavonoid intake in a spanish adult population (epic-spain) interactions affecting the bioavailability of dietary polyphenols in vivo bioavailability and metabolism of the flavonol quercetin in the pig. free radic dietary fat increases quercetin bioavailability in overweight adults part of quercetin absorbed in the small intestine is conjugated and further secreted in the intestinal l: umen quercetin metabolites in plasma of rats fed diets containing rutin or quercetin absorption, metabolism and bioavailability of flavonoids. in flavonoids in health and disease conjugation position of quercetin glucuronides and effect on biological activity. free radic tissue distribution of quercetin in rats and pigs metabolism of quercetin by human intestinal bacteria and its relation to some biological activities comparison of the bioavailability of quercetin and catechin in rats. free radic in vitro glucuronidation of kaempferol and quercetin by human ugt- a microsomes bioavailability of various polyphenols from a diet containing moderate amounts of berries absorption and excretion of conjugated flavonols, including quercetin- -o-beta-glucoside and isorhamnetin- -o-beta-glucoside by human volunteers after the consumption of onions plasma metabolites of quercetin and their antioxidant properties extensive binding of the bioflavonoid quercetin to human plasma proteins effect of fruit juice intake on urinary quercetin excretion and biomarkers of antioxidative status pharmacokinetics and bioavailability of the flavonol quercetin in humans polyphenols and prevention of cardiovascular diseases evaluation of quercetin as a countermeasure to exercise-induced physiological stress quercetin pharmacokinetics in humans carbon dioxide is the major metabolite of quercetin in humans a critical review of the data related to the safety of quercetin and lack of evidence of in vivo toxicity, including lack of genotoxic/carcinogenic properties naturally occurring anti-inflammatory agents basic, i. immunomodulatory and antimetastatic action of propolis and related polyphenolic compounds quercetin inhibits lps-induced nitric oxide and tumor necrosis factor-alpha production in murine macrophages dietary flavones and flavonols are inhibitor of poly (adp-ribose) polymerase- in pulmonary epithelial cells resveratrol and quercetin, two natural polyphenols, reduce apoptotic neuronal cell death induced by neuroinflammation effects of naturally-occurring flavonoids and bioflavonoids on epidermal cyclooxygenase and lipoxygenase from guinea-pigs protective effect of quercetin against arsenite-induced cox- expression by targeting pi k in rat liver epithelial cells quercetin disrupts tyrosine-phosphorylated phosphatidylinositol -kinase and myeloid differentiation factor- association, and inhibits mapk/ap- and ikk/nf-κb-induced inflammatory mediators production in raw . cells flavonols inhibit proinflammatory mediator release, intracellular calcium ion levels and protein kinase c theta phosphorylation in human mast cells protective effects of quercetin and taraxasterol against h o -induced human umbilical vein endothelial cell injury in vitro the role of quercetin, flavonols and flavones in modulating inflammatory cell function role of mast cells in gastrointestinal mucosal defense immunosuppressive effect of quercetin on dendritic cell activiation and function the flavonoid, quercetin, differentially regulates th- (ifng) and th- (il ) cytokine gene expression by normal peripheral blood mononuclear cells inhibition of mammalian collagenase, matrix metalloproteinase- , by naturally-occurring flavonoids regulation of il- -induced selective il- release from human mast cells and inhibition by quercetin quercetin, a flavonoid phytoestrogen, ameliorates experimental allergic encephalomyelitis by blocking il- signaling through jak-stat pathway in t lymphocyte inhibitory effect of quercetin on carrageenan-induced inflammation in rats quercetin transiently increases energy expenditure but persistently decreases circulating markers of inflammation in c bl/ j mice fed a high-fat diet quercetin ameliorates metabolic syndrome and improves the inflammatory status in obese zucker rats therapeutic and preventive properties of quercetin in experimental arthritis correlate with decreased macrophage inflammatory mediators quercetin promotes functional recovery following acute spinal cord injury quercetin in an animal model of spinal cord compression injury: correlation of treatment duration with recovery of motor function effect of quercetin on impaired immune function in mice exposed to irradiation evaluation of antioxidant and immunity activities of quercetin in isoproterenol-treated rats protective effect of quercetin against oxidative stress and brain edema in an experimental rat model of subarachnoid hemorrhage quercetin ameliorates experimental autoimmune myocarditis in rats quercetin suppresses immune cell accumulation and improves mitochondrial gene expression in adipose tissue of diet-induced obese mice suppression of nitric oxide production and cardiovascular risk factors in healthy seniors and hypercholesterolemic subjects by a combination of polyphenols and vitamins quercetin supplementation and upper respiratory tract infection: a randomized community clinical trial a -week supplementation with quercetin does not affect natural killer cell activity, granulocyte oxidative burst activity or granulocyte phagocytosis in female human subjects quercetin reduces illness but not immune perturbations after intensive exercise post- -km race illness rates and decreases in granulocyte respiratory burst and salivary iga output are not countered by quercetin ingestion effects of quercetin and egcg on mitochondrial biogenesis and immunity quercetin's influence on exercise performance and muscle mitochondrial biogenesis the authors declare no conflict of interest. key: cord- -j qlvm authors: rodríguez-pérez, celia; molina-montes, esther; verardo, vito; artacho, reyes; garcía-villanova, belén; guerra-hernández, eduardo jesús; ruíz-lópez, maría dolores title: changes in dietary behaviours during the covid- outbreak confinement in the spanish covidiet study date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: j qlvm the aim of this study was to evaluate whether dietary behaviours of the spanish adult population were changed during the covid- outbreak confinement. for that purpose, an online questionnaire, based on items including socio-demographic data, mediterranean diet (meddiet) adherence screener (medas) as a reference of a healthy diet, processed foods intake, changes in their usual food choices and weight gain was distributed using social media and snowball sampling. a total of participants ( % aged below years, . % female, . % university-level education or higher) from all the spanish territory completed the questionnaire. results outlined healthier dietary behaviours during the confinement when compared to previous habits. overall, the medas score (ranging from to , whereby higher a scoring reflects greater adherence to the meddiet) increased significantly from . ± to . ± . during the confinement. multivariate logistic regression models, adjusted for age, gender, region and other variables, showed a statistically significant higher likelihood of changing the adherence to the meddiet (towards an increase in adherence) in those persons who decreased the intake of fried foods, snacks, fast foods, red meat, pastries or sweet beverages, but increased meddiet-related foods such as olive oil, vegetables, fruits or legumes during the confinement. covid- confinement in spain has led to the adoption of healthier dietary habits/behaviours in the studied population, as reflected by a higher adherence to the meddiet. this improvement, if sustained in the long-term, could have a positive impact on the prevention of chronic diseases and covid- -related complications. the coronavirus pandemic, caused by sars-cov- , has expanded from wuhan, the capital city of hubei province in china to a growing number of countries [ ] . to date, more than , , cases of coronavirus have been reported in europe and concretely, , cases came from spain, according to the latest coronavirus disease situation report [ ] . due to the gravity of circumstances, the 'state of alarm' was declared in spain on th march [ ] . since then, the spanish population was firstly ordered to stay at home for two weeks that were later extended by another two weeks to halt the spread of coronavirus, paying more attention to vulnerable populations including persons with underlying medical conditions or with a compromised immune system from a medical condition or treatment, health care providers, or older adults [ ] . under that situation, people were allowed to leave home to buy essentials from supermarkets and pharmacies, go to work in those cases in which work in-person was essential (pharmacies, healthcare, supermarkets, etc.) while maintaining social distance. this implementation firstly caused panic buying and disruptions to food supply leading to shortages of some staple foods in most supermarkets and grocery stores. however, after the first four days, most companies ensured sufficient food supply during this period of confinement in view of . despite that the situation seemed to be normalized, not all food and food products were easily available at the supermarkets, making senior citizens even more vulnerable. against this emerging and rapidly evolving situation, and independently of the availability/non-availability of food products, people should have had more time for cooking and for organizing their meals. but also, people had more time for watching television (tv) and even to get bored. watching tv has been associated with snacking frequency, especially energy-dense snacks, fast foods or soda beverages [ , ] . mittal et al. [ ] concluded that snacking while watching television is associated with a promotion of over-consumption on a later meal. on its behalf, boredom has been suggested to be a predictor of eating behaviours [ ] . the restriction to stay at home with children in some cases, teleworking and avoiding to be in close contact with other people could also cause stress and anxiety throughout the population [ ] . in this regard, further than considering emotional eating, some studies have associated the food choice with psychological parameters, such as anxiety [ , ] . additionally, the confinement considerably limits physical activity, which could increase the emotional imbalance due to the 'alarm situation'. referring to the elderly, social isolation could lead to depression, cognitive dysfunction, disability, higher cardiovascular disease (cvd) risk and even increased mortality, as recently reported by morley and vellas [ ] . thus, changes in dietary and physical activity habits as a consequence of covid- confinement were expected. in fact, the spanish ministry of agriculture, fisheries and food reported an about % increment in food purchases during the week before the confinement started with respect to the same date last year [ ] . to support the immune system under situations like this, the establishment of healthy dietary habits is crucial. in this regard, the european federation of the association of dietitians (efad) published covid- information for nutritional support [ ] . furthermore, the world health organization (who) also offered several food and nutritional tips during self-quarantine [ ] , while the mediterranean diet (meddiet) as a healthy nutritional pattern to be followed in quarantine has been recommended [ ] . however, so far, no data with respect to the real dietary habits of the population are available. therefore, the main objective of this study was to examine whether the covid- outbreak confinement has influenced dietary habits among the spanish adult population. for that purpose, a self-administered web-based questionnaire with questions aimed at assessing the dietary behaviours of the adult spanish population during the covid- confinement and before it started, was distributed using social media and snowball sampling. a cross-sectional study (covidiet) was carried out among spanish adults who were encouraged to participate in the present study without any exclusion criteria further than the age (> years old). participation in the online questionnaire was entirely voluntary and anonymous. the study was conducted in agreement with the declaration of helsinki, and all data were collected anonymously and recorded according to the spanish organic law of personal data protection (lopd) / . since the questionnaire is anonymous and no personal data are collected, no informed written consent was requested. however, participants were informed about the objective of the research and they were asked for permission to use and publish the data from the study before starting the questionnaire. this study was approved by the research ethics committee of the university of granada ( /ceih/ ). the questionnaire was open from march , concretely one week after the spanish covid- outbreak confinement started. data from the first weeks of confinement were collected. a questionnaire containing items (supplementary table s ) was designed for the assessment of data about consumption frequency of selected foods (mainly related with the meddiet), general food habits and socio-demographic characteristics. in particular, the questionnaire was self-administered and divided into three main sections distributed as follows. socio-demographic information items i.e., sex, age, place of residence, country, dependent children, and level of studies were included. furthermore, the weight was requested. fourteen items with reference to the meddiet pattern based on the validated predimed meddiet adherence screener (medas) [ ] , were incorporated in the second section. those first items were based on a multiple choice close ended question that, together with the way of evaluation, have been described elsewhere [ ] . briefly, one point was scored when participants selected olive oil for cooking, daily consumption of four or more tablespoons of olive oil, white meat vs. red meat, two or more servings of vegetables, three or more pieces of fruit, less than one serving of red meat, hamburgers, sausages or deli meats, less than one serving of carbonated or sugary drinks, weekly intake of seven or more glasses of wine, three or more servings of legumes, three or more servings of fish/seafood, three or more servings of nuts, less than two servings of non-homemade pastries, white meat such as turkey or chicken preference instead red meat and two or more dishes seasoned with tomato, garlic, onion or leeks and sautéed with olive oil (sofrito). hereby, participants provided information on compliance with every item and the overall meddiet pattern, both during the covid- confinement and before its entry into force. for the latter, participants were asked in every item whether they had made any actual change due to the current situation. using this information, the adherence to the meddiet before the covid- confinement was assessed assuming the following: one point was assigned if consumption was maintained as usual in those participants who selected the highest intake for foods that are characteristic of the meddiet such as olive oil, fruits, vegetables, fruits, pulses or fish/seafood. on the contrary, points were assigned to those participants that maintained their intake as usual (highest intake) non-characteristic meddiet foods i.e., red meats, hamburgers, sausages or deli meats, sugary beverages or commercial (non-homemade) pastries. higher scores indicate greater adherence to the meddiet with a total score ranging from to . for both meddiet assessments, before and during the confinement, the final score ranged from to , with < , to and > points indicating low, medium or high adherence to the meddiet, respectively. participants were also asked to answer in-house items aimed at investigating changes in their usual dietary habits during the confinement, i.e., way and frequency of cooking, snacking, alcohol intake or type of oil employed for frying, among others. in this case, all questions were also designed to know if participants increased, decreased or maintained their habits during the covid- outbreak confinement. additionally, participants were also asked whether they perceived that their physical activity and body weight had changed since the confinement started by means of two questions. duration of confinement was accounted for, both, days and weeks since the study started (in the second week of confinement) until the end of the survey. to try to cover the whole spanish territory and to reach the greatest number of persons through mobile phones, tablets and computers, the questionnaire was created using the google forms tool and was distributed using instant messaging apps e.g., whatsapp, social media such as facebook and twitter, social networking sites such as linkedin and researchgate and emails through snowball sampling. descriptive statistics for all the collected variables were derived by levels of adherence to the meddiet and by sex, age, level of education and region. student's t-test or kruskal-wallis test (for continuous normal or non-normal distributed data, respectively), and chi-squared tests (for categorical data) were used to evaluate differences in means or proportions by these variables across the strata. box-plots were also used to evaluate further the distribution of the variable on adherence to the meddiet by the aforementioned subgroups. adherence to the meddiet during the confinement adherence to the meddiet was assessed on the continuous scale (range: - ) and on the categorical scale by classifying participants into low, medium and high adherence levels (< , to and > points, respectively) to the meddiet at the two time points: before and during the covid- spanish confinement. a binary variable to assess the change in adherence to the meddiet was built to distinguish between those who kept adherence to the meddiet alike (reference category, set to zero) and those who changed their adherence towards a greater adherence (set to one). logistic regression models were used to explore variables associated with the change in adherence (change versus non-change, as reference) to the meddiet. odds ratios (ors) and corresponding % confidence intervals (cis) were estimated in univariate regression models (model ), as well as in multivariate-adjusted models (model : age, sex and center-adjusted; model : model and physical activity, educational level and residence; to remove their influence on the dietary-meddiet associations). to evaluate the effect of meddiet-related variables on the change in adherence, mutual adjustment for all other meddiet food items was performed in an additional model. the association between lifestyle and dietary variables with adherence to the meddiet score (high versus medium-low, as reference) during confinement was also explored in logistic regression models. model fit assumptions (hosmer-lemeshow test p-value > . ) were met. we tested potential effect modification by duration of confinement in days or weeks on the associations (between every variable and the change in adherence to the meddiet) by adding interaction terms (combining variables with days/weeks) in the regression models. linearity of the association between days and change in adherence to the meddiet was evaluated using restricted cubic splines with three knots (percentiles , , and ). the association with adherence to meddiet over time was also explored through splines. models with and without the interaction terms or splines were compared by means of the likelihood ratio test. effect modification by sex and center was likewise tested. several sensitivity analyses were performed to check the robustness of the results: (i) by removing survey respondents of the first week to minimize the effect of short-term changes in dietary habits on the associations; (ii) by evaluating the relative change in adherence to the meddiet due to the covid- confinement as "current-previous/current" adherence to the meddiet. duration of confinement and other variables associated with this relative change in adherence to the meddiet (high versus low, as reference) were explored through logistic regression models considering the same multivariate adjusted models; (iii) by considering a modified scoring for assessing adherence to the meddiet before the confinement, by incorporating information on intake of fried food and snacking. the threshold for statistical significance in two-sided tests was set at p-value = . . data were analyzed with r-project (version . . ). a total of spanish adults completed the questionnaire. the main socio-demographic characteristics of questionnaire respondents by levels of adherence (low, medium and high) to the meddiet during the covid- spanish confinement are described in table . about % of the participants were females, . % were from the south of spain and the majority attained a graduate ( . %) or postgraduate education ( . %). there were few participants in the youngest ( %) and oldest age groups ( %), whereas % of them were aged - years. participants with higher adherence to the meddiet (table and figure ) were more likely females, those living in family homes, in the mid-age groups ( - y) and with higher educational level i.e., university or postgraduate students. no differences by regions across meddiet adherence levels were noted. overall, mean adherence to meddiet during the confinement was . (median = . , range = - ). dietary and lifestyle adaptations by level of adherence to the meddiet during the spanish confinement are shown in table . overall, most participants decreased their intake of alcohol ( . %) and their physical activity level ( . %) during the confinement. furthermore, the majority cooked in a similar way than before the confinement and used the griddle as the main technique for cooking ( . %). eating small amounts of food between meals (snaking), the intake of fried foods and fast-food were also similar than before the covid- confinement, and . % of participant declared not to have been eating more during the confinement. around % of participants kept their intake of fried foods as before the covid- confinement, which meant that nearly % of them continued consuming fried foods - days a week and around % less than time per week. the majority of the participants ( . %) used olive oil for frying. interestingly, among total participants, around % had difficulties finding some types of foods, especially meat ( . %), vegetables ( . %) and fish ( . %) during the covid- confinement. a higher adherence to meddiet was observed among those who used not to eat out of home and among those who reduced or kept their intake of fried food, fast food and snacking frequency, as well as those who kept being active and maintained the same weight. meddiet medas-derived food items were consistently related to high meddiet adherence levels during the confinement (supplementary table s ). these variables were also significantly associated with adherence to the meddiet during confinement in regression models comparing high versus medium-low adherence (supplementary table s ). differences between meddiet-related dietary behaviours during the covid- spanish confinement were found (table ). since the beginning of confinement, participants with higher adherence to the meddiet decreased the intake of sweet/carbonated beverages, red meat and pastries by - %. by contrast, the intake of fruits and vegetables increased by around % in the high meddiet adherence group. mean adherence to the meddiet before the confinement was . (median = . , range= - ). thus, adherence to the meddiet increased from the pre to post-confinement period, with this increase being statistically significant (p-value = < . ). the relation between meddiet medas-derived food items meddiet adherence levels before the confinement was also consistent (supplementary table s ) . age, educational level and region were related to significant differences in adherence before and during confinement ( figure b,d,f) . concretely, participants with ages between to years old showed a significantly lower adherence (p < . ) to the meddiet compared to participants of age > years. questionnaire respondents with higher educational levels (post-graduate diploma or doctorate) also showed a higher adherence to the meddiet (p < . ) before the confinement. participants from the north of spain seemed to have a higher adherence to the meddiet compared to the other geographical regions. (a and b) , region (c and d) and educational level (e and f). in the box plots, the boundary of the box closest to zero indicates the th percentile, a colour line within the box marks the median, and the boundary of the box farthest from zero indicates the th percentile. points above and below the box indicate the th and th percentiles; those above and below the whiskers indicate outliers. numbers of included participants per group are shown in tables and . differences in mean adherence by groups were evaluated by means of the kruskal-wallis test. differences between the two meddiet adherence groups (low and high) were evaluated by the chi-squared test. differences between meddiet adherence levels, before and during the confinement, were all statistically significant at p < . level. there were survey respondents who changed their adherence to the mediet. in all of them, this change was related to an increase in adherence to meddiet. socio-demographic factors associated with the change in the adherence to the meddiet are presented in supplementary table s . multivariate adjusted models revealed that participants who lived in the north of spain (or: . ), with children in care and with ages ranging from to higher than years old (or < . ) presented a lower odd of change to adhere to the meddiet during the spanish confinement. on the contrary postgraduate respondents (or: . , % ic: . - . ) and those who lived alone (or: . , % ic: . - . ) had a greater likelihood of increasing their adherence to the meddiet due to the confinement. by dietary and lifestyle habits (table ) , several food choices were associated with the change in adherence to the meddiet during the confinement. multivariate-adjusted models showed that those participants who reported a lower intake of fried foods, alcohol, fast-food, and snacks during the covid- spanish confinement had a statistically significant higher likelihood of turning into a higher adherence to the meddiet compared to those who kept their usual intake as before the confinement (or: . ; . ; . ; . , respectively). compared to respondents who used not have any daily meal out of home, the or associated with change in adherence to meddiet increased significantly in respondents who had one or more daily meals out of home. also, compared to those who kept being active, inactive respondents showed a significantly lower odds (or: . ; % ci: . - . ) of changing the adherence to the meddiet. interestingly, these variables were associated with a lower adherence to the meddiet during confinement (supplementary table s ). among those who changed their adherence to meddiet, there were . % respondents who did not gain weight since confinement, compared to % who gained weight (or: . , p-value > . ) and . % who were unsure about weight changes (or: . ; p-value < . ). no association was observed between the change in meddiet adherence and the type of cooking or eating more behaviour (data not shown), or by week of confinement. lower. never), * this category included non-consumers of fried foods, but also includes users of other types of oil or fats for frying and "pan frying". statistically significant ors are highlighted in bold. table displays multivariate-adjusted ors associated with the change in adherence to meddiet in relation to the medas-derived foods, considering mutual adjustment by each other food item. results showed that higher intake of meddiet typical foods such as vegetables (or: . , % ci: . - . ), fish (or: . , % ci: . - . ), olive oil (or: . , % ci: . - . ), and legumes (or: . , % ci: . - . ) during the covid- confinement, were associated with a higher likelihood of changing the adherence to the meddiet. lower intake of non-typical meddiet foods such as red meat, sweetened beverages or non-homemade pastries were also significantly associated with the change in meddiet adherence. the association could not be evaluated for other food items, for which information on changes in intake was not collected (sofrito, wine, fats, nuts and white meat preference). there was no evidence for effect modification by duration of confinement on the associations (data not shown). the geographical region was also not found to modify the associations (data not shown). however, a statistically significant interaction by gender was observed between change in adherence to the meddiet and the intakes of fruits, vegetables and olive oil (p-value for interaction = . , . and . , respectively). indeed, men showed a stronger association between the change in adherence to meddiet and these variables than women (e.g., or for the association between increase of olive oil intake and meddiet adherence change = . in men and . in women) (supplemental table s ). given the linearity of the association between meddiet adherence change and duration of confinement (supplementary figure s a) , it was estimated that the odds of change in the adherence increased by % per days increase of confinement ( % ci: . - . ). no significant difference was seen in either adherence to the meddiet score or change in the adherence to the meddiet by weeks of confinement (supplementary figure s b ). yet a non-linear association between adherence to the meddiet during confinement and days of confinement was apparent (supplementary figure s c) , supporting that the adherence to this dietary pattern during confinement increased up to days of confinement and tended to decrease thereafter. this trend might lack consistency as there were fewer respondents in the last week. results on the association between change in adherence to the meddiet and dietary/lifestyle variables remained unchanged in sensitivity analyses (supplementary table s ). the current study is the first reporting that dietary changes towards a healthier diet have taken place during the covid- confinement. our findings illustrate how the spanish adult population have adopted healthier dietary behaviours during the covid- confinement by means of a closer approach to the meddiet-style eating patterns. the adherence to the meddiet, measured by the -points medas, increased by . points during the three first weeks of the spanish confinement period, but seemed to decrease slightly at a later stage. the meddiet, considered as a reference of a healthy eating approach, is dominated by the intake of olive oil and by high consumption of vegetables and fruits. it has traditionally been highlighted to contribute to the good health of the mediterranean people, and nowadays there is consistent evidence supporting its association with lower all-cause mortality and reduced risk of cvd [ , ] . furthermore, the meddiet-related foods have been recently recommended to be included in our diet during the covid- confinement due their capacity to strengthen the immune system [ ] . overall, data from this study showed medium adherence to the meddiet (mean of medas score . ± ) in the studied population before the covid- outbreak that significantly increased (mean of medas score . ± . ) during the confinement. it could be argued that spain, a mediterranean country, should have a higher adherence to the meddiet. however, data from this study are consistent with those recently published by santi-cano et al. [ ] who reported a meddiet average score of . ± . points in young adults, i.e., university students from the south of spain with mean age of . ± . years old. in fact, an abandonment by the meddiet by the spanish adults was earlier documented by león-muñoz et al. in [ ] . our results also agreed with those found by the same author, i.e., mean of medas score . ± . in a cross-sectional study that included , adults, representative of the spanish population [ ] . adherence to the meddiet before and during the covid- confinement was also significantly influenced by regions, place of residence and educational level. in this regard, the adherence to the meddiet was significantly higher in northern spanish countries than in southern or central ones before the covid- confinement. the dimerica study observed lower adherence to the meddiet of participants from southeastern spain in a descriptive cross-sectional study including subjects from different spanish regions [ ] . nevertheless, the different areas that they included according to geographical region, are not comparable with ours. those significant differences, however, were not observed during the covid- confinement. as expected, higher adherence to the meddiet was also found in participants lived in the family home compared to those who lived alone at the time of being surveyed, respectively. living in the family home has been associated with a higher quality of diet [ ] . additionally, higher educational level has been commonly associated with higher socioeconomic status which, at the same time, has been related to a better diet quality [ ] . in agreement with our results, cavaliere et al. [ ] found a positive link between education (and income) and the adherence to the meddiet, which has been highlighted to be more expensive than the traditional western diet [ ] . it was not surprising that participants from our study aged from years and older presented higher adherence to the meddiet before the covid- pandemic started, compared to the other age groups. in agreement with our results, higher adherence to the meddiet in spanish adults from years and older was previously found, compared to the youngest ones [ ] . the adherence to the meddiet in the group of age from years and older was slightly but significantly increased during the confinement in our study. interestingly, the highest change was found in the youngest survey respondents who also significantly increased the adherence to the meddiet during the confinement. the mean medas score raised by . points up to . ± . . when we looked at the meddiet related-foods contributing most to the change in the meddiet adherence during the covid- confinement, a lower intake of pastries, red meat and sweetened/carbonated beverages followed by a higher intake of vegetables, fruits and olive oil were the most important contributors to this association. the lower consumption of meat could be related with the lack of stock in the spanish supermarkets and grocery stores after the state of alarm was declared. in fact, nearly % of participants who had any difficulty finding any food in their usual supermarket highlighted meat as the main one. covid- related changes in consumer behaviours have been noticed in spain. as an example, online grocery sales have skyrocketed by % during the last weeks after the state of alarm was declared, according to data from the european foundation for innovation (intec). in the same report, the demand for confectionery products and butter also increased in more than % [ ] . this is in agreement with the latest data from the google trends tool which shows how the spanish population has considerably increased their search about the term "homemade cake" coinciding with the first week of confinement in march (when the 'state of alarm' began) and compared to the last five years ( figure s a ). however, it does not explain that most people in our study decreased the intake of pastries (both, commercial and homemade pastries) during the confinement. it could be assumed that during the confinement people could have more time for cooking. in spite of according to google trends the term "traditional recipes" also increased exponentially ( figure s b ), data about the influence of cooking in the increase of adherence to the meddiet during the confinement were somehow contradictory. particularly, participants who increased or decreased cooking during the confinement, were more likely to change their adherence to the meddiet (or: . ; % ci: . - . and or: . ; % ci: . - . ) compared to those who kept cooking as before the confinement starts. for those who cooked less during that period, the explanation of a higher association with the adherence to the meddiet could reside in the choice of fresh foods typical from the meddiet which can be eaten raw such as vegetables and preserved and cooked legumes. for those participants who cooked more during the confinement than they used to do, it can be assumed that they were adopting healthier cooking habits than they had before the confinement. the intake of wine was not associated with a higher adherence to the meddiet before or during the confinement. wine is a well-known component of the mediterranean diet and its moderate intake has been traditionally associated with cvd risk reduction. however, the latest evidence suggests that its association is not clear enough yet [ ] . data from the disa-umh prospective cohort which includes university students aged to years concluded that low to moderate wine/beer consumers had higher adherence to the meddiet compared to non-drinkers or drinkers of all alcoholic beverages further than beer and wine [ ] . on the contrary, the sun cohort failed to find a relationship between wine or other alcoholic beverages and higher adherence to the meddiet in spanish university graduates with ages from - years [ ] . data from our study showed that lower alcohol intake during the confinement, including not only wine but also beer and high-grade drinks, was associated with a higher adherence to the meddiet. however, the lack of quantitative data about alcohol intake before and during the covid- confinement, prevent us from making direct comparisons with them. a higher likelihood of having an increased adherence to the meddiet was found among those participants who used to have or more meals out of home daily compared to participants who had any or just one of the main meals (breakfast, lunch or dinner) out of home daily before the confinement. eating out of home increased rapidly in the mediterranean countries due to changes in the socio-economic systems [ ] and even today is a common practice among the spanish population, according to the last report from the spanish ministry of agriculture, fisheries and food [ ] . a systematic review aimed to study the association with dietary intake eating out of home, concluded that eating out of home contributes to a higher intake of fats, particularly saturated fats in the daily diet especially in adults [ ] . llanaj et al. [ ] reported a higher intake of foods that do not fit the traditional meddiet such as sweets, soft drinks and meat products and a low consumption of fruits and vegetables among undergraduate students who used to eat out of home. finally, a moderate intake of fried foods was maintained by the majority of participants during the confinement. we observed that participants who reported lower intake of fried foods and those with lower frequency of intake (< time/week or never) during the covid- confinement were more prone to increase their adherence to the meddiet. in this regard, higher frequency of meddiet-related foods such as vegetables or fruits were found in participants who consumed fried foods - times/week compared to those with higher intakes in the sun cohort in which , participants were included [ ] . as expected, the main oil employed for frying was olive which agrees with three of the main studies based on the spanish population i.e., the sun cohort study [ ] , pizarra study [ ] and epic study [ ] . it should be mention that the sun study reported a higher frequency of intake of fried foods compared to our results. however, the mean age of the sun project population was lower than the covidiet population is and the survey is from about years ago [ ] . strengths of our study are many. to the best of our knowledge, this study is the first in examining dietary behaviours and changes in the adherence to the meddiet under a new situation such as the lockdown caused by the covid- pandemic. the online questionnaire allowed for rapid and cost-efficient assembly of self-reported information about dietary behaviours. it was useful to achieve a relatively large number of participants which had been impossible to obtain employing face-to-face interviews due to the covid- confinement. additionally, the covidiet questionnaire allowed us to collect a high amount of information referred to eating and healthy lifestyle behaviours, including the meddiet dietary pattern, before and during the confinement. some limitations should also be acknowledged. among them, the oversampling of a particular network due to the non-random snowball sampling method could be highlighted. for example, respondents were predominantly from andalusia and . % of participants were women. the same selection bias could be found with the level of education and income. however, with this respect, ekman et al. [ ] affirmed that the bias associated with collecting information using online questionnaires was not greater than that caused by paper questionnaires. the low representation of people with primary studies in the covidiet study ( . %) in relation with the whole population could be due to the fact that this population is less likely to use smart technologies could have been an obstacle to participate in the survey. nevertheless, it should be pointed out that, despite the current research could not be representative of all the spanish adult population, coverage of all age groups, spanish territories and educational levels has been achieved. since non-personal data were included in the questionnaire, no questions regarding job titles/categorizations were included. for that reason, it cannot be excluded that some of the survey respondents (e.g., pharmacists, health care providers, people who work in supermarkets or grocery stores, drivers, shippers, etc.) were not completely locked down. however, it should be mentioned that those persons had to eat at home due to the impossibility to have lunch outside because all restaurants were closed. since the participants were untrained, the perception that they could had about the food portions could underestimate/overestimate their real intake. additionally, since we performed a web-based study, in which a questionnaire was self-administered and online, participants did not have the opportunity to ask about any doubts that could be presented. however, the medas is a validated and widely used instrument for rapid estimation to the meddiet adherence [ ] which allows further comparisons to other research studies. the participation of non-healthy persons who require to follow a special diet cannot be discarded; this information was, however, not collected. finally, while we conducted several statistical tests, all were hypothesis-driven as we analyzed a predetermined number of variables assumed to be associated with dietary habits in the population. multiple testing issues in our study are therefore unlikely. this is the first study focused on evaluating changes in food consumption habits in a spanish adult population during the covid- outbreak confinement, based on a web-based survey targeted to the adult general population. from this study, we can conclude that the studied spanish adult population is still far away from having good healthy dietary habits considering the meddiet as reference of healthy eating. however, an improvement of their dietary behaviours during the covid- confinement has been observed. health-related food choices included higher intake of fruits, vegetables or legumes and lower intake of red meat, alcohol, fried foods or pastries compared to their usual habits. in spite of the observed change towards a healthier dietary pattern, permanent dietary habits are difficult to maintain. this improvement, if sustained in the long-term, could have a positive impact on the prevention of chronic diseases and covid- -related complications, and should be therefore promoted. supplementary materials: the following are available online at http://www.mdpi.com/ - / / / /s , table s . covidiet questionnaire used to collect information on dietary habits/behaviours and lifestyle factors during the covid- spanish confinement; table s . medas-derived foods items by level of adherence to the meddiet during the covid- spanish confinement; table s . factors associated with adherence to the meddiet during the spanish confinement; table s . medas-derived foods items by level of adherence to the meddiet before the covid- spanish confinement; table s . socio-demographic factors associated with the change in the adherence to the meddiet during the spanish confinement; table s . subgroup analysis by gender on the association between fruits, vegetables and olive oil intake and the change in the adherence to the meddiet during the covid- spanish confinement; table s . sensitivity analyses performed on variables associated with the change in the adherence to the meddiet during the spanish confinement; figure s . relationship between weeks and days of confinement with adherence to the meddiet and the relative change of adherence to meddiet; figure s . google trends output for web search queries for different terms. defining the epidemiology of covid- -studies needed world health organization (who) coronavirus (covid- ) boe) real decreto / , de de marzo, por el que se declara el estado de alarma para la gestión de la situación de crisis sanitaria ocasionada por el covid- the epidemiology and pathogenesis of coronavirus disease (covid- ) outbreak obesitv: how television is influencing the obesity epidemic the association of television viewing with snacking behavior and body weight of young adults snacking while watching tv impairs food recall and promotes food intake on a later tv free test meal eaten up by boredom: consuming food to escape awareness of the bored self the emotional impact of coronavirus -ncov (new coronavirus disease) eating when bored: revision of the emotional eating scale with a focus on boredom eating habits in relations to anxiety symptoms among apparently healthy adults. a pattern analysis from the attica study covid- and older adult spanish ministry of agriculture, fisheries and food european federation of the association of dietitians (efad) world health organization (who) food and nutrition tips during self-quarantine nutritional recommendations for covid- quarantine a short screener is valid for assessing mediterranean diet adherence among older spanish men and women a -item mediterranean diet assessment tool and obesity indexes among high-risk subjects: the predimed trial traditional mediterranean diet and longevity in the elderly: a review. public health nutr mediterranean diet and changes in sleep duration and indicators of sleep quality in older adults association of adherence to specific mediterranean diet components and cardiorespiratory fitness in young adults adherence to the mediterranean diet pattern has declined in spanish adults adherence to the "mediterranean diet" in spain and its relationship with cardiovascular risk (dimerica study) adherence to the mediterranean diet is associated with physical activity, self-concept and sociodemographic factors in university student contribution of food prices and diet cost to socioeconomic disparities in diet quality and health: a systematic review and analysis exploring the adherence to the mediterranean diet and its relationship with individual lifestyle: the role of healthy behaviours, pro-environmental behaviours, income, and education greater adherence to a mediterranean dietary pattern is associated with improved plasma lipid profile: the aragon health workers study cohort european foundation for innovation (intec) los supermercados y el sector retail se alinean para mejorar la respuesta ante el covid- the mediterranean diet and cardiovascular disease: gaps in the evidence and research challenges alcohol consumption and mediterranean diet adherence among health science students in spain: the disa-umh study alcoholic beverage preference and dietary pattern in spanish university graduates: the sun cohort study a prospective study of eating away-from-home meals and weight gain in a mediterranean population: the sun (seguimiento universidad de navarra) cohort. public health nut eating out of home and its association with dietary intake: a systematic review of the evidence examining food intake and eating out of home patterns among university students reported fried food consumption and the incidence of hypertension in a mediterranean cohort: the sun (seguimiento universidad de navarra) project consumption of fried foods and weight gain in a mediterranean cohort: the sun project intake and home use of olive oil or mixed oils in relation to healthy lifestyles in a mediterranean population. findings from the prospective pizarra study intake of fried foods is associated with obesity in the cohort of spanish adults from the european prospective investigation into cancer and nutrition feasibility of using web-based questionnaires in large population-based epidemiological studies the authors declare no conflict of interest. key: cord- -d aga authors: méplan, catherine; hughes, david j. title: the role of selenium in health and disease: emerging and recurring trends date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: d aga in this special issue of nutrients, "the role of selenium in health and disease" covers diverse diseases in the original research articles and reviews, such as cardiovascular disorders (cvd), metabolic syndrome, obesity, cancer, and viral infection, and highlights novel potential biomarkers of disease risk and prognosis [...]. although links between se levels, selenoprotein expression, and cvd or lipid metabolism are well established [ , ] , the mechanisms supporting these associations remain unclear. two of the manuscripts presented in this issue established, in distinct northern european populations, two novel se-related biomarkers of risk and prognosis for cvd. schomburg et al. identified, in a swedish human perspective cohort, a strong correlation between low baseline plasma levels of selenoprotein p (selenop; the major se-transporter) and risk for all-cause mortality, cvd mortality, and a first cvd event during the follow-up period of . ( . - ) years [ ] . based on the known high prevalence ( %) of low selenop levels in the northern european population [ , ] , these data suggest that plasma selenop concentrations may be used as an early biomarker of cvd risk and, therefore, that targeted se supplementation could be used as a preventative measure. however, further studies are required to determine the causal link between selenop levels and cardiovascular events and to assess whether genetic variants in the selenop gene, known to influence se bioavailability, affects this correlation. non-selenoprotein se-binding proteins, such as selenium-binding protein (selenbp ), have been underappreciated in se-related research, considering their significant relevance for major physiological processes and that selenbp has been previously implicated in myocardial infarction and poor clinical outcomes from various tumour types [ ] . in a distinct cohort of german patients undergoing elective cardiac surgery, a marked but transient increase in circulating selenbp concentrations during the surgical process was correlated, in most patients, with the duration of ischemia and myocardial damage. this suggests that serum concentrations of selenbp could constitute a quantitative marker for myocardial hypoxia [ ] . on the contrary, high serum se levels were associated with metabolic syndrome and insulin resistance markers in a large taiwanese cohort, although markers of adiposity and lipid functions varied by sex [ ] . further evidence of the importance of se in lipid and energy metabolism is supported by the observation that the enzyme selenocysteine lyase (scly) is involved in weight gain, resistance to anorexigenic hormone leptin, and thermogenesis [ ] . scly is responsible for the breakdown of intracellular selenocysteine to alanine and selenide, which is in turn recycled for the synthesis of new selenoproteins. the conditional scly knockout (ko) model affecting agouti-related peptide-positive neurons in the hypothalamus (scly-agrp ko mice) displayed a reduction in high fat diet-induced weight gain and protection against development of leptin resistance compared with controls (mice expressing scly). this was linked to progressive degeneration of some agrp neurons and in brown adipose tissue pattern [ ] . taken together, these data provide some novel potential targets for understanding the mechanisms by which se affects cvd or lipid metabolism and for further investigating the potential of selenop and selenbp as cvd biomarkers. accumulating experimental and observational evidence suggests that insufficient se intake and/or selenoprotein genetic variations may contribute to the development of several tumours including colorectal cancer (crc), mediated by oxidative and inflammatory stress response selenoproteins [ ] . higher se status levels (total serum se levels and selenop concentrations) were previously reported in a multi-centre, european prospective cohort study (epic) to be associated with a decreased crc risk. the manuscript in this issue by fedirko et al. extends this work by describing the largest association with crc risk for common genetic variations related to se metabolism in approximately cases and controls within this epic cohort. the study examined over single nucleotide polymorphisms (snps) in genes within the se biological pathway (including all selenoprotein genes and se metabolic pathway genes) and interactions with serum se status biomarkers from the previous study. the findings provide the most comprehensive evidence to date that individual genotypes relevant for selenoprotein expression, metabolism, and function and interaction with se status may affect crc risk in a population of marginally low se status, such as in europe. pathway analyses indicated that, for genes in antioxidant/redox and apoptotic pathways, the influence of snps on the disease risk is also dependent on interaction with se status [ ] . addressing the sparse data on selenoprotein expression in crc, hughes and colleagues assessed selenoprotein gene transcript levels in the neoplastic and matched mucosal tissue from irish and czech colorectal adenoma (cra) and crc patients and examined the interaction with se status levels [ ] . several selenoproteins (including biological stress response and se biosynthesis genes) were differentially expressed in the disease tissue compared to the normal tissue of both cra and crc patients, and that also showed tumour gene expression changes correlated to levels of se or selenop. across the disease tissues from the adenoma and both cancer groups, gpx and txnrd exhibited higher expression while gpx , selenop, selenos, and sephs showed lower expression. the authors concluded that selenoprotein expression changes could be used as biomarkers of functional se status and the colorectal adenoma to cancer transition. in survival analyses, only a higher selenof expression was associated with poorer survival outcomes after cancer diagnosis. although this did not retain significance after multiple testing correction, there is possible biological validity to this observation as selenof has been previously linked with oncogenesis [ ] . moving to innovative se metabolism cell-line experiments, sonet et al. suggest that selenized lipids from plant oils (selenitriglycerides; selol), proposed to have antineoplastic effects, may provide natural se supplementation as a bioavailable selenocompound with lower toxicity than chemical forms like selenite [ ] . the authors showed that selol could be an efficient source of se for selenoprotein biosynthesis in immortalized kidney (hek ) and prostate cancer (lncap) cell lines but not in immortalized prostate cells (pnt a,) possibly due to variance in lipid metabolism between the different cell lines [ ] . as transformation of various chemical species into selenide is the gateway step for further incorporation into selenoproteins, cell-specific se metabolism to selenide via selenized triglycerides requires further study. the importance of se status in modifying the ability of an individual to respond to stress has been linked to the development of many diseases including cvd [ , ] , cancers [ , ] , and neurodegeneration [ ] . as a number of selenoproteins play a crucial prevalent role in the response to oxidative stress and the control of redox status [ , ] as well as in the maintenance of endoplasmic reticulum (er) stress response [ ] , mechanisms that alter the expression of these selenoproteins have the potential to lead to an increased risk of disease. in a currently highly pertinent review, considering the current pandemic of the sars-cov- virus mediated covid- disease as we write, guillin et al. discuss the role of se in protection from viral contagion [ ] . during viral infection, the pathogens induce oxidative stress by generating reactive oxygen species and by altering the cellular antioxidant defences, including selenoproteins such as glutathione peroxidases (gpx) and thioredoxin reductases. consequently, the host's se requirements increase and, in hosts deficient in se, the oxidative stress can induce viral genome mutations, leading to increased microbial virulence (e.g., coxsackie and influenza viruses). other mechanisms by which the host's nutritional status can affect viral infection progression include reducing the ability of the immune system to respond to the virus (e.g., human immunodeficiency virus (hiv) and hepatitis c and b viruses). in silico data have also revealed the presence of selenoprotein genes in the genomes of several common viruses (e.g., hiv) that resemble mammalian gpx. the function and regulation of such viral selenoproteins remains unclear but could afford viruses protection from oxidative damage [ ] . due to the crucial role of er stress in many cellular processes, understanding the consequences of alteration of components of the er stress response has the potential to lead to the discovery of new therapeutic/nutritional targets. seven selenoproteins are known to be present in the er, but not all have been well characterised. in a timely review, ren et al. discuss the current knowledge on er-resident selenof, including its function and role in er stress response and the regulation of its expression [ ] . the review also summarises results from genetic association studies linking genotypes for snps in the selenof gene to risk for various cancers, kashin-beck disease, and aids progression, with a particular focus on two well-characterised functional snps (rs and rs ) affecting selenof protein expression. furthermore, the authors discuss the dysregulation of selenof expression in several tissue and pathologies, from cancer to neurodegeneration and immune system diseases [ ] . future studies investigating the role of other er-resident selenoproteins could lead to a better understanding of mechanisms that contribute to the development of a wide range of common complex diseases. overall, the studies in this special issue strengthen and broaden the evidence base that the risk of several chronic diseases and viral infections may be modified by se status, genotype, sex, and gene variation interactions within biological pathways. detailed investigation of se intake levels and metabolism is needed to more fully elucidate the relevance for disease etiopathogenesis, especially for populations with diverse se status levels and/or individuals with potentially at-risk disease or protective se pathway genotypes. the authors declare no conflict of interest. though, combined, they are co-authors on two of the papers in this special review [ , ] , all submissions were considered impartially in this editorial commentary. selenium-binding protein indicates myocardial stress and risk for adverse outcome in cardiac surgery selenoprotein-p deficiency predicts cardiovascular disease and death association of selenoprotein and selenium pathway genotypes with risk of colorectal cancer and interaction with selenium status selenium and health: an update on the situation in the middle east and north africa gender differences with dose-response relationship between serum selenium levels and metabolic syndrome-a case-control study expression of selenoprotein genes and association with selenium status in colorectal adenoma and colorectal cancer agrp-specific ablation of scly protects against diet-induced obesity and leptin resistance selenized plant oil is an efficient source of selenium for selenoprotein biosynthesis in human cell lines role of selenoprotein f in protein folding and secretion: potential involvement in human disease selenoproteins and viral infection this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license key: cord- -lr e w authors: lehtoranta, liisa; latvala, sinikka; lehtinen, markus j. title: role of probiotics in stimulating the immune system in viral respiratory tract infections: a narrative review date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: lr e w viral respiratory tract infection (rti) is the most frequent cause of infectious illnesses including the common cold. pharmacological solutions for treating or preventing viral rtis are so far limited and thus several self-care products are available in the market. some dietary supplements such as probiotics have been shown to modulate immune system function and their role in reducing the risk and the course of rtis has been investigated extensively within the past decade. however, the mechanism of action and the efficacy of probiotics against viral rtis remains unclear. we searched pubmed, google scholar, and web of knowledge for pre-clinical and clinical studies investigating the effect of probiotics on respiratory virus infections, immune response, and the course of upper and lower respiratory tract illness. the literature summarized in this narrative review points out that specific probiotic strains seem effective in pre-clinical models, through stimulating the immune system and inhibiting viral replication. clinical studies indicate variable efficacy on upper respiratory illnesses and lack proof of diagnosed viral infections. however, meta-analyses of clinical studies indicate that probiotics could be beneficial in upper respiratory illnesses without specific etiology. further studies aiming at discovering the mechanisms of action of probiotics and clinical efficacy are warranted. respiratory viruses cause the most common infectious illnesses in humans-acute rtis that can be divided into upper rtis (urti), e.g., the common cold, and lower rtis (lrti), e.g., bronchitis and pneumonia. these illnesses affect all age groups annually and cause a high burden on health care systems and global economics due to absenteeism from daycares, school, and work. over virus types have been identified as causative agents for respiratory illnesses [ , ] . in most cases, especially illnesses of the upper respiratory tract are mild to moderate and often self-limiting. on the other hand, lrtis leading to pneumonia can be especially fatal among children and the elderly, or immunocompromised subjects [ ] . in the past decade, studies linking the microbiota and immune system function have laid the foundation for the opportunities in microbiota modulation and bacterial therapeutics in health and disease. further, studies have associated the gut and airway microbiota with upper and lower respiratory tract health and immunity [ , ] . thus, modulation of the gut microbiota and immunity by dietary supplements or pharmaceuticals is of increasing interest in finding novel solutions to manage rtis. among the promising candidates are probiotics that have been studied for immune function modulation and viral infections. meta-analyses suggest that probiotics could be beneficial in the context of acute urti typically caused by viruses [ , ] . viruses that cause rtis are found in various virus families, which differ in virulence and utilize variable strategies to infect the host cells and to evade the host immune system [ , ] . respiratory viruses spread via nasal secretions that can be transmitted through the air or by hand-to hand and surface-to-hand contact [ ] . infection requires penetration of the virus through the host mucus layer, including the microbiota, and antiviral molecules in the mucus, such as antibodies and collectins. once on the mucosal epithelial cells, respiratory viruses attach to specific receptors, such as intercellular adhesion molecule (icam)- (rhinoviruses), peptidases (coronaviruses), or sialic acids (influenza viruses), that mediate the internalization of the virus by endocytosis [ , ] . the viral receptors are differentially expressed on host cells resulting in virus-specific host cell tropism that is one key factor in viral pathogenesis. for example, influenza viruses typically infect bronchial cells, whereas rhinoviruses infect the epithelial cells of the upper airways, resulting in differences in illness presentation. viral genomic structure can be, for example, positive-or negative-sense single-stranded (ss) or double-stranded (ds) rna or dna [ ] . most rti causing viruses, picornaviruses, influenza viruses, and coronaviruses are ssrna viruses, whereas adenoviruses are dsdna viruses. the genomic structures are recognized by different receptors in the host and activate different types of immune responses. some respiratory viruses, e.g., coronaviruses, are surrounded by a viral envelope which confers additional protection from the host immune system. respiratory viruses have further developed molecules that help in evading the immune response, for example, by disrupting the interferon (ifn) response and hijacking the host's cellular machinery for the production of virus copies [ ] . once the viruses have penetrated into the host cells, the epithelial and immune cells detect the viral structures by pattern recognition receptors (prr) of which toll-like receptors (tlrs) and retinoic acid-inducible gene i (rig-i)-like receptors (rlrs) play a central role. tlr , tlr , tlr , and tlr are located in the endosomes and can identify viral ss (tlr and ) and ds (tlr ) rna structures, and dna (tlr ) [ ] . the recognition by tlrs leads to activation of transcription factor nuclear factor kappa-light-chain-enhancer of activated b cells (nf-κb) and ifn regulatory factors (irf) , , and [ , , ] , resulting in expression of pro-inflammatory cytokines and type i ifns, ifn-α and ifn-β. type i ifns are broadly secreted by cells, but epithelial cells further secrete type iii lambda ifns in response to viral infections. cytoplasmic rnas, on the other hand, are recognized by rlrs, of which rig-i recognizes ssrna and melanoma differentiation associated (mda- ) dsrna. the activation of rlrs leads to type i (and type iii in epithelial cells) ifn production via mitochondrial antiviral signaling protein (mavs). type i and iii ifns induce an antiviral state in the surrounding cells which is not, however, necessarily sufficient to resist the infection, but delays the spreading of the infection [ , ] . the activation of rlrs, and tlrs by viral infection and cellular stress, leads to formation of nucleotide-binding oligomerization domain (nod)-, leucine-rich repeat (lrr)-, and pyrin domain-containing protein (nlrp ) inflammasome [ ] . although the role of nlrp is still somewhat unclear in viral rtis, it seems to play a role at least in rhinovirus, influenza, adenovirus, and rsv infections. nlrp inflammasome activation drives caspase -dependent il- β and il- cytokine response and inflammatory programmed cell death (pyroptosis) [ ] . epithelium-derived pro-inflammatory cytokines tumor necrosis factor (tnf)-α, interleukin (il)- β, il- , chemokine (c-c motif) ligand (ccl) , ccl , chemokine (c-x-c motif) ligand (cxcl) , and cxcl induce innate cellular responses by attracting and activating natural killer (nk) cells, macrophages, and neutrophils that further amplify the innate cytokine and chemokine response [ ] . the role of other innate cells like, for example, intraepithelial lymphocytes, γδt cells, mucosa associated invariant t cells (mait), and innate lymphoid cells (ilc) is less well described in viral infections, however, they are likely to contribute to innate and adaptive responses against viral infections, as exemplified by the nk cells [ , ] and by the role of ilc cells in overcoming an influenza infection [ ] . if the innate immune or memory responses cannot clear the pathogen effectively and the adaptive immune system is unexperienced with the virus, an adaptive immune response is initiated and required. key are dendritic cells (dcs) that present the viral antigens and induce b and t cell responses against the pathogen in the secondary lymph nodes. b and t cell responses initiate within four-six days post-infection and peak later at days - depending on the respiratory virus [ ] [ ] [ ] . typically, common respiratory viruses, such as rhinovirus and influenza virus, are cleared before adaptive immune responses are activated [ , ] indicating that memory responses and innate immunity are essential in viral eradication. however, the induction of cytotoxic cd t cells, cd t cells, and antibody responses is key for virus eradication by adaptive immunity and for establishing protective immunity for secondary infections. the activation of the epithelium, innate immune cells, and adaptive responses is important for defense against respiratory viruses, but on the other hand, the host inflammatory response is the major cause of symptoms and more severe pathologies [ , , ] . chronic activation of cd t cell responses and adaptive immunity may lead to pulmonary damage and acute respiratory distress syndrome, like in severe cases of coronavirus infections (e.g., sars-cov or sars cov- ) and pandemic influenza virus infections [ , , ] . in milder colds, rhinoviruses are not cytolytic and do not actually cause considerable damage to host cells and may pass asymptomatically. presentation of cold symptom severity seems to correlate with host inflammatory response. specifically, the early expression of pro-inflammatory il- [ ] and high levels of neutrophils in nasal aspirates [ ] have been shown to correlate with symptom severity of rhinovirus and influenza infection [ , ] . production of anti-inflammatory il- , resolvins, and regulatory t cell responses acts as a natural mechanism to control lung inflammation during acute influenza virus (and others) infection [ ] [ ] [ ] . virus-host immune interactions are key to viral pathogenesis and to ultimately determine the outcome of the infection. probiotics, by definition, are live microorganisms that, when administered in adequate amounts, confer a health benefit on the host [ ] . most probiotics are lactic acid bacteria, belonging to lactobacillus spp., (now with new taxonomy including lacticaseibacillus spp., lactiplantibacillus spp., levilactobacillus spp., ligilactobacillus spp., limosilactibacillus spp. [ ] ) or bifidobacterium spp. furthermore, some strains of other microbial genera, such as propionibacterium spp., and bacillus spp., have been reported to have probiotic properties. traditional lactic acid bacteria have long been considered safe and suitable for human consumption as very few instances of infection have been associated with these bacteria, and several published studies have specifically addressed their safety (reviewed, e.g., by [ ] [ ] [ ] ). regarding probiotics safety in rtis, meta-analyses conclude that the reported side effects related to the consumption of probiotics were minor [ , , ] . probiotics are mostly consumed orally in the form of dietary supplements and food (e.g., yoghurt). therefore, their primary site of action is in the gastrointestinal (gi) tract [ ] . however, probiotics have been detected with pcr-based methods from nasopharyngeal mucosa, adenoids, and tonsils after oral consumption [ , , ] , but it is unclear what the contribution to upper respiratory tract immune stimulation against viral rti by probiotics is, as oral ingestion results in the stimulation of the intestinal immune system as well. the small intestine, that is naturally exposed to microbes and nutrients due to the thin mucosal layer, seems to play an important role in immune stimulation by probiotics [ , ] . however, dissecting the relative contributions of the small and large intestine and upper gi tract on immune stimulation against rti is challenging with available research data. independent of the actual mucosal inductor site of the probiotic, it has been shown that lymphocytes circulate between mucosal tissues [ ] . thus, local mucosal stimulatory effects may influence immune responses at other mucosal tissues and contribute to antiviral immunity. even very closely related bacteria have differences in their antigenic structures and thus influence the immune system uniquely. probiotics are thought to influence immune function primarily in a strain-specific manner [ ] . although these effects in general are strain-specific, probiotics also share common mechanisms of immune stimulation, such as the secretion of metabolites. for instance, short chain fatty acids are known to have immunomodulatory effects [ ] . direct effects of the probiotics on immune function are driven by interactions of bacterial structures or metabolites with receptors, like tlrs, on the host epithelial and immune cells. on the other hand, probiotics may influence immune function indirectly by changing the composition and/or activity of the host microbiota [ ] . for example, in the small intestine where the number of endogenous bacteria is lower than in the large intestine, ingestion of probiotics temporally changes the microbiota composition and influences the host immune response [ , ] . in rtis, orally consumed probiotics may elicit systemic effects from the gi tract via the "gut-lung axis" by modulating mucosal immune function [ , ] . probiotics are taken up by m cells or by cx c chemokine receptor (cx cr )+ macrophages located in the gut epithelium and then transferred to dcs in the subepithelial tissue. probiotics are able to modulate dc polarization and function [ ] that influence the subsequent t and b cell responses [ ] in the inductive sites (peyer's patch, and mesenteric lymph nodes). t and b cells can also enter the circulation and migrate to extraintestinal sites, such as the respiratory tract [ , ] . however, the exact mechanisms of probiotics (and their metabolites) in respiratory infections has not been clearly established and may be influenced by the investigated probiotic strain, microbiota composition, and immunological status of an individual. in the following chapters, we review the current pre-clinical evidence of immunomodulatory and antiviral mechanisms of probiotics against respiratory virus infections with a focus on the direct stimulatory effects of probiotics on virus-infected immune cells and animal models. probiotic bacteria can engage and activate tlrs leading to the activation of nf-κb and irfs in immune cells that are essential in antiviral defense. for example, it has been demonstrated in murine bone marrow-derived dcs that lactobacillus acidophilus ncfm and l. acidophilus x induce the upregulation of tlr , il- , and ifn-β in a tlr -dependent manner [ ] . in macrophage-derived raw . cells, lactobacillus gasseri sbt upregulated ifn-β and myxovirus resistance (mx) mrna expression [ ] and in human monocyte-derived macrophages, two lacticaseibacillus rhamnosus strains, gg and lc , induced type i ifn-dependent gene activation [ ] . pro-inflammatory and ifn-regulated genes including il- , il- , il- β, il- , ccl , cxcl , mx , and mx were induced by both lacticaseibacillus strains. in addition, the gene expression of tlr and tlr , receptors recognizing viral dsrna and ssrna, respectively, was upregulated by these strains. tlr gene expression was upregulated only by l. rhamnosus lc , the strain with higher antiviral potential, while tlr was moderately upregulated by both strains. in vitro studies with immune cells have also shown the ability of probiotics and their components to restrict viral replication. in human monocyte-derived macrophages, lacticaseibacillus strains showed the ability to prevent influenza a virus replication which correlated with the ability to activate type i ifn-dependent antiviral genes [ ] . similarly, mouse adapted influenza a virus (pr ) titer was reduced in raw . cells by l. gasseri sbt [ ] . in mouse bone marrow dcs, the inhibition of viral replication by l. acidophilus atcc s-layer protein was demonstrated [ , ] . priming of cells with s-layer protein prior to h n avian influenza virus infection inhibited the invasion and replication of the virus, stimulated the type i ifn signaling pathway, increased il- mrna, and decreased tnf-α mrna expression [ ] . polyinosinic/polycytidylic acid (poly i/c), a synthetic mimic of dsrna, is widely used in in vitro studies to stimulate tlr . it induces characteristic inflammatory responses associated with virus infections such as increased production of inflammatory cytokines. stimulation of airway epithelial cells with poly i/c has been found to closely mimic inflammatory responses associated with respiratory virus infections [ ] . poly i/c challenge in peripheral blood mononuclear cells (pbmcs) induced changes in the gene expression of tlr , ifn, and nf-kb-dependent pathways similar to acute viral infections [ ] . moreover, poly i/c was able to induce a pulmonary dysfunction similar to rsv in a mouse model [ ] . probiotic bacteria have shown the ability to modulate poly i/c-induced responses. studies with heat-killed lacticaseibacillus casei crl showed that the strain reduced tnf-α, ifn-γ, and il- levels when it was introduced before or simultaneously with poly i/c challenge in pbmcs alone and in a co-culture system with alveolar epithelial cell line a [ ] . il- and il- (also known as ifn-λ ) were induced in response to poly i/c together with heat-killed l. casei crl , indicating a boost in pro-inflammatory responses and the activation of anti-inflammatory and antiviral mechanisms. in the intestinal human colon cell line (hct ), regulation of poly i/c response by lactiplantibacillus plantarum subsp. plantarum du , latilactobacillus sakei du , and weissella cibaria du was examined [ ] . these strains modified poly i/c-induced expression of cytokines and antiviral genes by upregulating ifn-β, tlr , and rig-i while dampening the inflammatory response. moreover, the probiotic strains induced ifn-α, ifn-β, and il- and reduced the expression of inflammatory cytokines il- β and tnf-α in human monocytic thp- macrophages [ ] . in addition to the pro-inflammatory and antiviral gene activation described above, also direct interactions of viruses and probiotic bacteria have been demonstrated between porcine influenza a virus and enterococcus faecium in vitro [ ] . similar upregulation of ifn response by probiotics has been shown in several studies in intestinal epithelial cells [ ] [ ] [ ] and macrophages [ , ] . overall, the in vitro studies indicate that probiotics may stimulate similar innate immune pathways to respiratory viruses and potentially modulate virus-induced immune responses. several mouse studies have shown that the administration of probiotics can help to fight against viral rtis. the beneficial effects of oral probiotic supplementation on mouse survival and health status is well demonstrated [ , [ ] [ ] [ ] [ ] [ ] . for example, oral administration of lacticaseibacillus paracasei subsp. paracasei cncm-i- [ ] , l. gasseri lg [ ] , and bifidobacterium longum mm- [ ] reduced mortality and improved immune control in influenza-infected mice. probiotic administration resulted in better health status of the mice and lower virus loads in the lungs after influenza infection. in addition, the immune response to viruses was modulated by probiotic administration. for instance, l. paracasei cncm-i- modified the pro-and anti-inflammatory cytokine release in the lungs before and after influenza infection and affected total cell counts in the lungs after probiotic treatment [ ] . similarly, b. longum mm- suppressed inflammation in the lower respiratory tract through the decrease in influenza virus proliferation and pulmonary il- and tnf-α cytokine production [ ] . activation of host defense systems by increased ifn-γ, il- , il- , and il- gene expression and nk cell activation in lungs was also demonstrated. in non-infected mice, b. longum mm- significantly enhanced ifn-γ production by peyer's patch cells and splenic nk cell activity. in the infected mice, nk cell activity was significantly enhanced both in the spleen and lungs by the probiotic strain. another bifidobacterium (b. bifidum) improved anti-influenza immune responses by inducing both humoral and cellular immunities [ ] . decreased il- levels were detected in the lung and higher igg and igg levels in the sera of probiotic-treated mice compared with control mice. furthermore, l. gasseri sbt has been found effective in preventing both influenza a virus [ ] and rsv [ ] infections in mice. pre-treatment with l. gasseri sbt induced the expression of antiviral genes mx and - oligoadenylate synthase (oas) a in lung tissues before viral infection and reduced lung inflammatory responses after viral infection [ ] . the same l. gasseri strain was found effective in preventing rsv infection in mice by reducing lung viral loads and pro-inflammatory cytokines and by stimulating ifns and ifn responsive gene expression such as ifn-β , ifn-γ, interferon-inducible transmembrane protein (ifitm) , oas a, and interferon-stimulated gene (isg) [ ] . in addition to live probiotics, also orally administered heat-killed bacteria seem to confer protection against viral rtis in mice [ ] . heat-killed l. paracasei mcc reduced symptom scores and lung virus titers in influenza-infected mice and induced antigen-specific iga production in the small intestine, serum, and lungs. the proportion of iga+ b cells and follicular helper t cells (tfh) in peyer's patches was increased as was the gene expression of il- p , il- , il- , signal transducer and activator of transcription (stat) , and b cell lymphoma protein (bcl)- , which are associated with tfh cell differentiation. to conclude, different probiotic strains have been shown effective in inhibiting the replication of various respiratory viruses including influenza viruses and rsv in vitro. similar effects have been demonstrated in several mouse studies with the ability to reduce virus titers in lung tissues and modulation of antiviral and pro-inflammatory gene expression before and after viral infection. accumulating clinical evidence suggests that probiotics in general may have favorable effects against rtis. for instance, several systematic reviews and/or meta-analyses have evaluated the effects of prophylactic ingestion of probiotics on the rti-associated outcomes, e.g., either only in children [ , ] , or both in children and adults [ , , ] (table ) . of note, the majority of the outcomes in these analyses are related to urti, and data on lrti outcomes are either not available or are very limited. therefore, in the below chapter, we primarily focus on clinical trials on probiotics' effects on urti symptoms/episodes/duration. probiotic consumption had no effect on the duration of rtis ( rcts, n = , md - . in children (below years), the meta-analysis by wang et al., , reported that probiotic use compared with placebo significantly decreased the number of subjects having at least one rti episode, had fewer numbers of days of rtis per person, and had fewer numbers of days absent from daycare or school [ ] . however, the meta-analysis did not find a statistically significant difference on the illness episode duration between the probiotic and the placebo. laursen and hojsak [ ] limited the analysis to children up to years old and reported that probiotic use was associated with reduced risk of at least one urti and reduced the risk of antibiotic use, but the use was not associated with a reduction in rti duration or missed days of daycare due to rti [ ] . this meta-analysis also discussed the effects of the individual probiotic strains on rti outcomes. the results of the analysis showed that the most effective probiotic strains on rti-related outcomes were l. rhamnosus gg (rti duration) and l. acidophilus ncfm as a single supplement and in combination with b. lactis bi- (rti duration and antibiotic use). interestingly, these strains have shown in vitro the ability to induce antiviral ifn signaling pathways (see section . ) which may potentially explain their beneficial effects observed in rtis. however, as multiple studies with probiotic strains other than l. rhamnosus gg are limited or lacking, comparison and interpretation of the strain specific results should be made carefully. meta-analyses that pool data from clinical trials conducted with children, adults, and the elderly show that probiotic use is more beneficial over placebo in reducing the number of participants experiencing episodes of acute urti [ , ] , reducing antibiotic prescription rates for acute urtis [ , ] , and reducing the mean duration of an episode of an acute urti as well as cold-related school absences [ , ] . when the literature search was conducted, meta-analyses were not found in the databases searched on probiotic effects on respiratory infections restricted to the elderly population, potentially due to the fact that data are fairly limited regarding this age group. while there is consensus that probiotics could have potential in reducing the risk for rtis, it should be noted that clinical trials in the meta-analyses have been conducted in populations of different ages and genetic backgrounds, with various strains and/or their combinations, supplementation matrices, and doses. moreover, the measured outcomes and data collection procedures between the trials (i.e., infection episode definition) are not harmonized and therefore may vary considerably. consequently, pooling all the data creates a bias, as the probiotic effect is generally dependent on the dose, population, and strain. moreover, as discussed above, the probiotics effects on the immune system are strain-specific which affects the interpretation of the results. with regard to probiotics effects to specific respiratory viruses in clinical settings, several trials have characterized the respiratory infection etiology in infants [ ] , in children [ ] [ ] [ ] , in adults [ ] , and in the elderly [ ] . in addition, two clinical trials have investigated the efficacy of probiotics in an experimental rhinovirus challenge model [ ] [ ] [ ] (table ) . children had less days with respiratory symptoms per month ( . vs. . , p < . ). no effect on the occurrence of respiratory viruses during the study or respiratory symptoms associated with viral findings. l. rhamnosus gg cfu of live or heat-inactivated (by spray-drying) in ml of fruit juice or control juice daily for weeks. in the clinical trials conducted in free-living subjects in the community, no consistent data exist that show that specific probiotics would reduce the incidence of laboratory-confirmed respiratory virus infections as such. in preterm infants, the use of l. rhamnosus gg for days was associated with lower incidence of rhinovirus-induced episodes (comprising % of all rti episodes) compared with the placebo. however, l. rhamnosus gg had no effect on rhinovirus rna load during infections, duration of rhinovirus rna shedding, duration or severity of rhinovirus infection, or the occurrence of rhinovirus rna in asymptomatic infants. in children attending daycare, l. rhamnosus gg [ ] consumption for weeks did not reduce the occurrence of any of the common respiratory viruses either. in otitis-prone children, supplementation of a combination of l. rhamnosus gg, l. rhamnosus lc , b. breve , and propionibacterium jensenii js, for six months, reduced the number of human bocavirus-positive nasopharyngeal samples when compared with placebo, but not the number of rhino/enterovirus-positive samples [ ] . furthermore, in schoolchildren, the consumption of levilactobacillus brevis kb during influenza season was associated with lower incidence of physician-diagnosed influenza virus cases [ ] . in adults attending military service, the use of a combination of l. rhamnosus gg and b. lactis bb- for either or days was not overall associated with lower occurrence of common respiratory viruses upon presentation of cold symptoms [ ] . however, in a subgroup, there was a lower occurrence of rhino/enteroviruses after three months in the probiotic group when compared with the placebo. in nursing home residents, wang et al., , reported that the use of l. rhamnosus gg for six months was not associated with the reduction in occurrence of confirmed viral respiratory infections [ ] . the differences between the findings in these trials may be explained by the fact that these studies were conducted in various age groups with different immune system statuses (infants vs. children vs. healthy adults vs. the elderly), different seasons, as well as variable probiotic strains, strain combinations, doses, and variable lengths of intervention. furthermore, most of the studies were not designed for analyzing the viral infection etiology as the primary outcome and the diagnosis for the identification of the viral agent was not applied. since over respiratory virus types can cause respiratory infections and, in many cases, the infections and symptoms overlap, or the etiology is undiagnosed, the potential antiviral effects of probiotics against specific viruses can be difficult to determine in clinical trials targeting free-living subjects within the community. to overcome this caveat, two probiotics have been investigated in an experimental rhinovirus challenge model that allows investigation of the effect of a probiotic strain to a specific viral pathogen. in a rhinovirus (type ) challenge model, b. lactis bl- was administered for days prior and during five days of experimental rhinovirus infection to healthy volunteers [ ] . b. lactis bl- supplementation resulted in significantly lower rhinovirus titers in nasal washes during the infection as well as in a lower number of infected participants shedding the virus compared with the placebo. moreover, b. lactis bl- induced a significantly higher concentration of il- in nasal washes after days of supplementation and prior to infection. given the reduced viral titer, an increase in il- could indicate priming of the mucosal immune system prior to infection. this hypothesis is in line with a clinical study conducted in healthy active adults, where supplementation of b. lactis bl- reduced the risk of urti episodes compared with placebo [ ] . in another similar experimental rhinovirus type challenge pilot trial, no significant antiviral effect was seen with live or inactivated l. rhamnosus gg supplementation compared with placebo [ , ] , suggesting potential strain-specific differences on the efficacy of probiotics in respiratory virus infections. nevertheless, further adequately powered trials with harmonized study designs are necessary to draw conclusions on the efficacy of probiotics against specific respiratory viruses. viral rtis are the most common infections of mankind and the health and financial impact of seasonal epidemics and global pandemics on society is high. due to the large number of various respiratory viruses, the development of efficient therapies, such as vaccines, is challenging. when preventative measures are scarce or lacking, the role of a well-functioning immune system becomes crucial for providing resistance to an infection. within the past decade, research highlighting the importance of the microbiota on immune system function has raised interest in understanding the role of microbiota modulation and bacterial therapeutics by dietary and pharmaceutical solutions in health and disease. of the available solutions, probiotic bacteria have been studied for immune function modulation in the context of respiratory viral infections. in this review, we have summarized the current evidence on the effects of probiotics on antiviral immune function in vitro and in vivo, and clinical evidence on the effect of probiotics on viral rtis and on the course of rti (figure ). importance of the microbiota on immune system function has raised interest in understanding the role of microbiota modulation and bacterial therapeutics by dietary and pharmaceutical solutions in health and disease. of the available solutions, probiotic bacteria have been studied for immune function modulation in the context of respiratory viral infections. in this review, we have summarized the current evidence on the effects of probiotics on antiviral immune function in vitro and in vivo, and clinical evidence on the effect of probiotics on viral rtis and on the course of rti (figure ). in vitro data indicate that probiotics have strain-specific immunomodulatory effects on the host and immune cells by engaging tlrs that stimulate ifn pathways. the upregulation of ifn response seems to prime cells for better resistance against virus infection as probiotics were shown effective in inhibiting the replication of various respiratory viruses, including influenza viruses and rsv. similar effects have been demonstrated in mice with the ability of the probiotics to reduce virus titers in lung tissues and to modulate antiviral and pro-inflammatory gene expression before and after viral infection. interestingly, some studies in mice show an increase in il- response, suggesting control of the pro-inflammatory response that typically drives lung pathology in severe infections. most likely probiotics' effects in the gut are transferred into the respiratory tract via the gut-respiratory tract axis, however, this mechanism of action remains to be studied in more detail. the pre-clinical studies further show improvement in the symptom scores of mice, suggesting potential clinical benefits. indeed, some evidence exists for specific probiotic strains, e.g., from the species of l. rhamnosus, l. acidophilus, and b. lactis for their ability to induce antiviral immune responses in preclinical models, which is in agreement with their effects observed in clinical trials in reducing the risk of rti-associated outcomes. however, translation of probiotic effects from cell culture and animal studies to humans can be challenging and variable confounding factors, e.g., age, diet, microbiome, genetic and epigenetic immune status of an individual, study season, and variable viral epidemiology, all have an impact on the study outcome and are difficult to standardize. the clinical studies that have diagnosed and characterized viral etiology are limited, nevertheless, the metaanalyses investigating probiotic clinical interventions on rtis show that probiotic use is associated with lower incidence and duration of mild rtis, both in children and in adults. further studies aiming at discovering the mechanism of action of probiotics and establishing the association of immune system function stimulation and clinical efficacy are warranted. in vitro data indicate that probiotics have strain-specific immunomodulatory effects on the host and immune cells by engaging tlrs that stimulate ifn pathways. the upregulation of ifn response seems to prime cells for better resistance against virus infection as probiotics were shown effective in inhibiting the replication of various respiratory viruses, including influenza viruses and rsv. similar effects have been demonstrated in mice with the ability of the probiotics to reduce virus titers in lung tissues and to modulate antiviral and pro-inflammatory gene expression before and after viral infection. interestingly, some studies in mice show an increase in il- response, suggesting control of the pro-inflammatory response that typically drives lung pathology in severe infections. most likely probiotics' effects in the gut are transferred into the respiratory tract via the gut-respiratory tract axis, however, this mechanism of action remains to be studied in more detail. the pre-clinical studies further show improvement in the symptom scores of mice, suggesting potential clinical benefits. indeed, some evidence exists for specific probiotic strains, e.g., from the species of l. rhamnosus, l. acidophilus, and b. lactis for their ability to induce antiviral immune responses in pre-clinical models, which is in agreement with their effects observed in clinical trials in reducing the risk of rti-associated outcomes. however, translation of probiotic effects from cell culture and animal studies to humans can be challenging and variable confounding factors, e.g., age, diet, microbiome, genetic and epigenetic immune status of an individual, study season, and variable viral epidemiology, all have an impact on the study outcome and are difficult to standardize. the clinical studies that have diagnosed and characterized viral etiology are limited, nevertheless, the meta-analyses investigating probiotic clinical interventions on rtis show that probiotic use is associated with lower incidence and duration of mild rtis, both in children and in adults. further studies aiming at discovering the mechanism of action of probiotics and establishing the association of immune system function stimulation and clinical efficacy are warranted. the common cold epidemiology of viral pneumonia. clin microbiome and disease in the upper airway the influence of the microbiome on respiratory health probiotics for preventing acute upper respiratory tract infections probiotics for preventing acute upper respiratory tract infections respiratory virus infections emerging respiratory viruses other than influenza sars-cov- viral load in upper respiratory specimens of infected patients epidemiology of viral respiratory infections epidemiologic, clinical, and virologic characteristics of human rhinovirus infection among otherwise healthy children and adults: rhinovirus among adults and children pathogenesis of rhinovirus infection nasal microbiota clusters associate with inflammatory response, viral load, and symptom severity in experimental rhinovirus challenge mechanisms of viral mutation viral manipulation of the host immune response transmission routes of respiratory viruses among humans epithelial cells and airway diseases the host immune response in respiratory virus infection: balancing virus clearance and immunopathology the morphology of virus particles. classification of viruses immune responses to influenza virus infection sars coronavirus pathogenesis: host innate immune responses and viral antagonism of interferon pathogenesis of influenza virus infections: the good, the bad and the ugly inflammasome control of viral infection the nlrp inflammasome: molecular activation and regulation to therapeutics cytokine networks between innate lymphoid cells and myeloid cells early local immune defences in the respiratory tract group innate lymphoid cell production of il- is regulated by nkt cells during influenza virus infection protective and harmful immunity to rsv infection the cd t cell response to respiratory virus infections host defense function of the airway epithelium in health and disease: clinical background immunopathology in influenza virus infection: uncoupling the friend from foe the trinity of covid- : immunity, inflammation and intervention relationship of upper and lower airway cytokines to outcome of experimental rhinovirus infection role of nasal interleukin- in neutrophil recruitment and activation in children with virus-induced asthma elevated levels of interleukins il- beta, il- and il- in naturally acquired viral rhinitis symptom pathogenesis during acute influenza: interleukin- and other cytokine responses a distinct function of regulatory t cells in tissue protection effector t cells control lung inflammation during acute influenza virus infection by producing il- the role of pro-resolution lipid mediators in infectious disease expert consensus document. the international scientific association for probiotics and prebiotics consensus statement on the scope and appropriate use of the term probiotic a taxonomic note on the genus lactobacillus: description of novel genera, emended description of the genus lactobacillus beijerinck , and union of lactobacillaceae and leuconostocaceae absence of adverse events in healthy individuals using probiotics-analysis of six randomised studies by one study group a systematic review of the safety of probiotics safety assessment of probiotics for human use effectiveness of probiotics on the duration of illness in healthy children and adults who develop common acute respiratory infectious conditions: a systematic review and meta-analysis understanding immunomodulatory effects of probiotics recovery of probiotic lactobacillus rhamnosus gg in tonsil tissue after oral administration: randomised, placebo-controlled, double-blind clinical trial lactobacillus rhamnosus gg in adenoid tissue: double-blind, placebo-controlled, randomized clinical trial identification of the transcriptional response of human intestinal mucosa to lactobacillus plantarum wcfs in vivo regulation of intestinal homeostasis and immunity with probiotic lactobacilli mucosal immunity: induction, dissemination, and effector functions short chain fatty acids (scfas)-mediated gut epithelial and immune regulation and its relevance for probiotic mechanisms of action the gut-lung axis in health and respiratory diseases: a place for inter-organ and inter-kingdom crosstalks microbiota and gut-lung connection lactobacilli differentially modulate expression of cytokines and maturation surface markers in murine dendritic cells human antigen-presenting cells respond differently to gut-derived probiotic bacteria but mediate similar strain-dependent nk and t cell activation location, location, location: the impact of migratory heterogeneity on t cell function lactobacillus acidophilus induces virus immune defence genes in murine dendritic cells by a toll-like receptor- -dependent mechanism oral administration of lactobacillus gasseri sbt is effective for preventing influenza in mice nonpathogenic lactobacillus rhamnosus activates the inflammasome and antiviral responses in human macrophages inhibition of h n virus invasion into dendritic cells by the s-layer protein from l. acidophilus atcc a pathway analysis of poly(i:c)-induced global gene expression change in human peripheral blood mononuclear cells the airway epithelium: soldier in the fight against respiratory viruses double-stranded rna induces similar pulmonary dysfunction to respiratory syncytial virus in balb/c mice non-viable lactobacillus casei beneficially modulates poly i: c immune response in co-cultures of human cells immunobiotic strains modulate toll-like receptor agonist induced innate antiviral immune response in human intestinal epithelial cells by modulating ifn regulatory factor and nf-κb signaling lactobacillus casei zhang modulate cytokine and toll-like receptor expression and beneficially regulate poly i: c-induced immune responses in raw . macrophages immunobiotic lactic acid bacteria beneficially regulate immune response triggered by poly (i: c) in porcine intestinal epithelial cells immunobiotic bifidobacteria strains modulate rotavirus immune response in porcine intestinal epitheliocytes via pattern recognition receptor signaling exopolysaccharides from lactobacillus delbrueckii oll r- modulate innate antiviral immune response in porcine intestinal epithelial cells immunobiotic lactobacillus rhamnosus strains differentially modulate antiviral immune response in porcine intestinal epithelial and antigen presenting cells orally administered heat-killed lactobacillus paracasei mcc enhances antigen-specific iga secretion and induces follicular helper t cells in mice lactobacillus paracasei feeding improves immune control of influenza infection in mice consecutive oral administration of bifidobacterium longum mm- improves the defense system against influenza virus infection by enhancing natural killer cell activity in a murine model immunomodulatory and prophylactic effects of bifidobacterium bifidum probiotic strain on influenza infection in mice oral intake of lactobacillus rhamnosus m enhances the survival rate of mice lethally infected with influenza virus prevention of respiratory syncytial virus infection with probiotic lactic acid bacterium lactobacillus gasseri sbt probiotics for respiratory tract infections in children attending day care centers-a systematic review probiotics for prevention and treatment of respiratory tract infections in children: a systematic review and meta-analysis of randomized controlled trials prebiotic and probiotic supplementation prevents rhinovirus infections in preterm infants: a randomized, placebo-controlled trial effects of probiotic lactobacillus brevis kb on incidence of influenza infection among schoolchildren: an open-label pilot study the use of the probiotic lactobacillus rhamnosus gg and viral findings in the nasopharynx of children attending day care human bocavirus in the nasopharynx of otitis-prone children specific probiotics and virological findings in symptomatic conscripts attending military service in finland probiotics to prevent respiratory infections in nursing homes: a pilot randomized controlled trial effect of live and inactivated lactobacillus rhamnosus gg on experimentally induced rhinovirus colds: randomised, double blind, placebo-controlled pilot trial human rhinovirus in experimental infection after peroral lactobacillus rhamnosus gg consumption, a pilot study effect of probiotic on innate inflammatory response and viral shedding in experimental rhinovirus infection-a randomized controlled trial probiotic supplementation for respiratory and gastrointestinal illness symptoms in healthy physically active individuals key: cord- -g i b authors: niles, meredith t.; bertmann, farryl; belarmino, emily h.; wentworth, thomas; biehl, erin; neff, roni title: the early food insecurity impacts of covid- date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: g i b covid- has disrupted food access and impacted food insecurity, which is associated with numerous adverse individual and public health outcomes. to assess these challenges and understand their impact on food security, we conducted a statewide population-level survey using a convenience sample in vermont from march to april , during the beginning of a statewide stay-at-home order. we utilized the united states department of agriculture six-item validated food security module to measure food insecurity before covid- and since covid- . we assessed food insecurity prevalence and reported food access challenges, coping strategies, and perceived helpful interventions among food secure, consistently food insecure (pre-and post-covid- ), and newly food insecure (post covid- ) respondents. among respondents, there was nearly a one-third increase ( . %) in household food insecurity since covid- (p < . ), with . % of food insecure households classified as newly food insecure. respondents experiencing a job loss were at higher odds of experiencing food insecurity (or . ; % ci, . – . ). we report multiple physical and economic barriers, as well as concerns related to food access during covid- . respondents experiencing household food insecurity had higher odds of facing access challenges and utilizing coping strategies, including two-thirds of households eating less since covid- (p < . ). significant differences in coping strategies were documented between respondents in newly food insecure vs. consistently insecure households. these findings have important potential impacts on individual health, including mental health and malnutrition, as well as on future healthcare costs. we suggest proactive strategies to address food insecurity during this crisis. the global covid- pandemic, and social distancing efforts implemented to slow its spread [ ] , have disrupted economies and food systems globally and locally, with extensive food security ramifications. food insecurity-the lack of consistent physical, social, and economic access to adequate and nutritious food that meets dietary needs and food preferences [ ]-can lead to serious public health consequences. in , . % of american households were considered food insecure at some very low food security ( to affirmative answers) can be combined and referred to as having food insecurity [ ] . in addition to measuring food security status, the survey also included additional questions related to food access challenges, use of food assistance programs, food purchasing behaviors, concerns about food access and availability, covid- perceptions, and behaviors and demographics. table a details the specific questions utilized in this analysis, which are primarily focused on understanding the relationship of food security status to food access challenges, use of food assistance programs, and concerns about food access and availability. future analyses will explore other questions in the survey. to examine differences in household food insecurity during the first weeks of the covid- pandemic, we created three categories of respondents: ( ) households with food security (n = , including households food secure before and since covid- and households who were food insecure at some point in the year before covid- , but were no longer food insecure during covid- ); ( ) households with consistent food insecurity (n = , both food insecure before covid- and remaining food insecure since covid- ); ( ) households with new food insecurity (n = , categorized as food secure before covid- , but food insecure since . in some cases, we refer to food insecure households, which encompass both consistently food insecure households and newly food insecure households. to determine statistically significant differences between groups we utilized stata [ ] , to run kruskal-wallis tests, wilcoxon rank sum tests, t-tests, and one-way analysis of variance (anova) tests, depending on the distribution of the dependent variable. we used a logistical regression model to determine the factors correlated with food insecurity during the covid- pandemic, with coefficients reported in odds ratios. in this model, we estimate food insecurity outcomes during covid- , including respondents who were classified as either consistently food insecure or newly food insecure. we used all available data to estimate effect sizes and interactions and assumed any missing data were missing at random. reflecting the demographic composition of vermont [ , , ] , the majority of respondents identified as non-hispanic white, lived in rural areas, and had a household income below $ , ( table , table a ). women encompassed % of our sample, which may be reflective of the fact that women are the dominant food shoppers in households [ ] . we found a nearly one-third increase ( . %) in food insecurity prevalence (p < . ) between the year preceding the covid- outbreak, when . % of households ( % ci . - . %) reported experiencing food insecurity at some point, and since the covid- outbreak when the percentage rose to . % ( % ci . - . %) (table a ). among those experiencing food insecurity since the outbreak, . % also experienced food insecurity at some point in the year prior to covid- , and were also food insecure since covid- ; in comparison, . % were newly food insecure. in consistently food insecure households, . % exhibited very low food security since covid- (marked by disrupted eating patterns and reduced intake), while . % had low food security. in newly food insecure households . % exhibited very low food security, while . % had low food security (table a ) since covid- (p < . ). multivariable logit models predicted the factors contributing to higher odds of food insecurity during covid- (e.g., both consistently food insecure respondents and newly food insecure respondents) ( table ). note that we also ran a multinomial logit model to examine whether there were statistically significant differences in newly versus consistently food insecure respondents, which there were not (table a ) . respondents experiencing a job loss had three times greater odds of living in a household experiencing food insecurity (or . ; % ci, . - . ), and those experiencing a furlough (or . ; %ci, . - . ), or a loss of hours (or . ; % ci, . - . ) also had significantly greater odds of being in a household experiencing food insecurity (p < . ). the odds of experiencing food insecurity since the covid- outbreak were higher among households with children (or . ; % ci, . - . ), while households with higher incomes had reduced odds (or . ; % ci, . -. ) (p < . ). finally, women were % more likely to experience household food insecurity during covid- , compared to men (p < . ) (or . ; % ci . - . ), while a college degree (or . , % ci . - . ) was associated with reduced odds of household food insecurity (p < . ). respondents indicated multiple physical and economic barriers to food access during covid- , with respondents experiencing household food insecurity significantly more likely to express greater access, availability, and utilization challenges than respondents in food secure households (p < . ) ( figure , table a ). these challenges included not finding as much or the kinds of food that someone wanted, going to more places than usual to find food, and not being able to afford the food a household wanted. challenges also included those related to food assistance, including at food pantries and through school food programs. consistently food insecure households had a higher average prevalence of food access challenges, as compared to those in newly food insecure households including trouble affording food (p < . ), getting food through a food pantry (p = . ), and knowing where to find help for getting food (p < . ). households with children (or . ; % ci, . - . ), while households with higher incomes had reduced odds (or . ; % ci, . -. ) (p < . ). finally, women were % more likely to experience household food insecurity during covid- , compared to men (p < . ) (or . ; % ci . - . ), while a college degree (or . , % ci . - . ) was associated with reduced odds of household food insecurity (p < . ). respondents indicated multiple physical and economic barriers to food access during covid- , with respondents experiencing household food insecurity significantly more likely to express greater access, availability, and utilization challenges than respondents in food secure households (p < . ) ( figure , table a ). these challenges included not finding as much or the kinds of food that someone wanted, going to more places than usual to find food, and not being able to afford the food a household wanted. challenges also included those related to food assistance, including at food pantries and through school food programs. consistently food insecure households had a higher average prevalence of food access challenges, as compared to those in newly food insecure households including trouble affording food (p < . ), getting food through a food pantry (p = . ), and knowing where to find help for getting food (p < . ). average frequency of challenging food access situations since covid- among respondents with household food security and food insecurity in a survey of vermont households, march-april, (p < . for comparison among all groups). standard errors shown with brackets. differences between newly and consistently food insecure shown through stars (*** p < . ), ** p < . ) and in table a . respondents experiencing household food insecurity during covid- (both newly and consistently food insecure) were significantly more likely (p < . comparison across all groups) to express higher levels of concern and worry about a variety of potential situations related to food access and covid- ( figure , table a ). these situations included potential for food to become more expensive and for households to have a decrease in income, not enough food, loss of access to food programs, and food availability and safety. as compared to newly food insecure households, consistently food insecure households were also significantly more likely to have higher levels of concern and worry about food access for all situations except for food becoming unsafe (p < . , table a ). nutrients , , x for peer review of march-april, (p < . for comparison among all groups). standard errors shown with brackets. differences between newly and consistently food insecure shown through stars (*** p < . ), ** p < . ) and in table a . respondents experiencing household food insecurity during covid- (both newly and consistently food insecure) were significantly more likely (p < . comparison across all groups) to express higher levels of concern and worry about a variety of potential situations related to food access and covid- ( figure , table a ). these situations included potential for food to become more expensive and for households to have a decrease in income, not enough food, loss of access to food programs, and food availability and safety. as compared to newly food insecure households, consistently food insecure households were also significantly more likely to have higher levels of concern and worry about food access for all situations except for food becoming unsafe (p < . , table a ). average level of concern for potential food access situations during covid- among respondents with household food security and food insecurity in a survey of vermont households, march-april, (p < . for comparison among all groups). standard errors shown with brackets. statistically significant differences were also found between newly and consistently food insecure in all cases except for "food will become unsafe" (shown through stars, *** p < . ), ** p < . , * p < . ) and in table a . households newly and consistently experiencing food insecurity were significantly more likely (p < . ) to be implementing coping strategies related to obtaining food as compared to respondents in food secure households. these strategies included those related to disrupted eating patterns (i.e., eating less), buying different, cheaper foods, accepting food from friends and family, and utilizing government programs, credit or food pantries ( figure , table a ). consistently food insecure households, as compared to those newly experiencing food insecurity, were also significantly more likely to currently accept food (p = . ) or borrow money from friends or family (p = . ), use a food pantry (p < . ) and use government assistance programs (p = . ), especially the supplemental nutrition assistance program (snap) (p < . ) (tables a and a ). average level of concern for potential food access situations during covid- among respondents with household food security and food insecurity in a survey of vermont households, march-april, (p < . for comparison among all groups). standard errors shown with brackets. statistically significant differences were also found between newly and consistently food insecure in all cases except for "food will become unsafe" (shown through stars, *** p < . ), ** p < . , * p < . ) and in table a . households newly and consistently experiencing food insecurity were significantly more likely (p < . ) to be implementing coping strategies related to obtaining food as compared to respondents in food secure households. these strategies included those related to disrupted eating patterns (i.e., eating less), buying different, cheaper foods, accepting food from friends and family, and utilizing government programs, credit or food pantries ( figure , table a ). consistently food insecure households, as compared to those newly experiencing food insecurity, were also significantly more likely to currently accept food (p = . ) or borrow money from friends or family (p = . ), use a food pantry (p < . ) and use government assistance programs (p = . ), especially the supplemental nutrition assistance program (snap) (p < . ) (tables a and a ) . households newly and consistently experiencing food insecurity were also significantly more likely (p < . across all group comparisons) to report an intention to implement these same coping strategies in the future for assistance with obtaining food during covid- . among food insecure households, those with consistent food insecurity were more likely to indicate that in the future they would accept food from friends or family (p = . ), use food pantries (p < . ), government assistance programs (p < . ), and to stretch the food they have by eating less (p = . ), as compared to newly food insecure households (table a ) . compared to food secure households, new and consistently food insecure households were significantly more likely (p < . ) to find strategies to address physical or economic food access challenges helpful during covid- (table a ) . these helpful strategies included extra money to help pay for food or bills, an increase in benefits of existing food assistance programs, greater trust in the safety of going to stores and food delivery, support for food delivery costs, more or different food in stores, and information about and help with food assistance programs, among others. consistently food insecure households were also significantly more likely than those in newly food insecure households to find access to public transit, extra money for food or bills, increased benefits of food assistance programs, information about food assistance programs (all p < . ), help with administrative food assistance problems (p = . ), and support for food delivery costs (p = . ) more helpful (table a ) . nutrients , , x for peer review of figure . prevalence of current coping strategies utilized by households with food security and with food insecurity during covid- in a survey of vermont households, march-april, (statistical differences among all groups p < . ). statistical differences between newly and consistently food insecure shown through stars (*** p < . ); ** p < . , * p < . ) and in table a . households newly and consistently experiencing food insecurity were also significantly more likely (p < . across all group comparisons) to report an intention to implement these same coping strategies in the future for assistance with obtaining food during covid- . among food insecure households, those with consistent food insecurity were more likely to indicate that in the future they would accept food from friends or family (p = . ), use food pantries (p < . ), government assistance programs (p < . ), and to stretch the food they have by eating less (p = . ), as compared to newly food insecure households (table a ) . compared to food secure households, new and consistently food insecure households were significantly more likely (p < . ) to find strategies to address physical or economic food access challenges helpful during covid- (table a ) . these helpful strategies included extra money to help pay for food or bills, an increase in benefits of existing food assistance programs, greater trust in the safety of going to stores and food delivery, support for food delivery costs, more or different food in stores, and information about and help with food assistance programs, among others. consistently food insecure households were also significantly more likely than those in newly food insecure households to find access to public transit, extra money for food or bills, increased benefits of food assistance programs, information about food assistance programs (all p < . ), help with administrative food assistance problems (p = . ), and support for food delivery costs (p = . ) more helpful (table a ). this statewide survey in vermont documented a statistically significant increase in food insecurity since the state's first reported case of covid- and the stay-at-home executive order (which began march , ). we demonstrate a nearly one-third increase in household food figure . prevalence of current coping strategies utilized by households with food security and with food insecurity during covid- in a survey of vermont households, march-april, (statistical differences among all groups p < . ). statistical differences between newly and consistently food insecure shown through stars (*** p < . ); ** p < . , * p < . ) and in table a . this statewide survey in vermont documented a statistically significant increase in food insecurity since the state's first reported case of covid- and the stay-at-home executive order (which began march , ). we demonstrate a nearly one-third increase in household food insecurity among respondents, with individuals experiencing job loss or disruption at significantly greater odds of experiencing household food insecurity since covid- , as compared to other demographic controls. further, we find that the majority of consistently food insecure households and nearly one-third of newly food insecure households were classified as having very low food security, marked by disrupted eating and cutting meals or going hungry. fully, two-thirds of vermont respondent households with food insecurity during covid- are already eating less to stretch their food. the findings indicate challenges to all food security dimensions, including economic and physical access, availability, utilization, and stability, and may have profound potential health impacts. we further demonstrate physical and economic barriers to food access during covid- and the respondents' coping strategies in food insecure households. previous research [ , ] suggests links between job loss and food insecurity, indicating that the profound increase in americans experiencing job loss and disruption [ ] will present acute and large-scale impacts across the population. since vermont unemployment claims reflect the national trend, these results likely reflect a broader u.s. phenomenon of rising food insecurity rates, evidenced by early non-peer reviewed studies [ , ] . in addition to these new economic barriers, the pandemic presents many new physical barriers for food access, reductions in public transportation, and new distribution models, and in a rural state like vermont, a lack of income for transportation costs including fuel. in rural areas where food assistance programs, such as food pantries, are limited, closures due to illness, social distancing, or lack of volunteers may be particularly challenging. this presents opportunities to expand food pantries and support mobile pantry units, as well as encourage the expansion of programs such as fruit and vegetable prescription programs, shown to positively affect food security [ ] and improve health outcomes [ ] . ultimately, this research demonstrates a need to increase food assistance programs and provide resources to remove food access barriers now, and likely in the future, during state and national economic and health emergencies. this rise in food insecurity presents many potential health impacts. food insecurity is negatively associated with health outcomes [ , ] and some evidence indicates it is positively associated with poor diet quality [ , ] . further, higher rates of anxiety and mental health disorders among children and adults have been documented in food insecure households [ , ] . indeed, survey respondents in this study experiencing household food insecurity demonstrated significantly higher rates of concern and worry about food. disrupted eating, found in two-thirds of respondent households with food insecurity, is associated with decreased immune function and can negatively impact mental and emotional health [ ] . further research is needed to understand how food insecurity during the covid- pandemic relates to diet quality, particularly if disrupted eating patterns persist and increase. healthcare providers can address food insecurity through simple interventions. screening for food insecurity and providing resources now may reduce short-and long-term consequences, including the potential long-term impacts on child health outcomes associated with the duration of household food insecurity [ ] and higher health care expenditures associated with food insecurity [ ] . the hunger vital sign, a validated two-question food insecurity screening tool based on the usda household food security survey module [ ] , can quickly determine risk for food insecurity in clinical and community settings. this tool is widely utilized, especially in pediatrics [ , ] , and could be made standard in health care and other service settings during covid- and beyond. providers could refer families in need to locally available resources or to united way, which aggregates these resources locally. however, during this heightened time of unemployment, there is also potential for government agencies, particularly those distributing unemployment benefits, to help connect families in need to available resources as well. importantly, this research demonstrates there are still a significant number of food insecure households which, even if aware of food assistance programs, may not use them. low rates of seeking assistance in our results, especially among newly food insecure households, may be partly related to the stigma associated with assistance programs [ , ] . prior research suggests that populations living outside major metropolitan areas may be more likely to use friends and family for support [ ] and to see government assistance programs as a "last resort" [ ] . however, with social distancing and widespread financial challenges, such personal safety nets may be eroded, and these households may be particularly vulnerable. additional research is needed to understand the barriers to using food assistance programs, especially among those that may be newly food insecure since covid- . this study suggests some of the first population-level impacts of covid- and social distancing policies on food insecurity. the limitations are partly rooted in the need to rapidly administer this survey in the early days of the pandemic, to provide data that can be tracked over time. though our respondent population matches statewide census statistics closely on many metrics, this was a convenience sample; further research is expanding these results using similar questions with representative samples across states and populations. it is worth noting that our observed overall rate of food insecurity prior to covid- ( . %) is above the most recently available state figure ( . %) in . there are potentially multiple reasons for this. first, this is likely to be due, in part, to a higher than average number of female respondents and respondents in households with children; both groups have been documented, in vermont and elsewhere, to have elevated rates of food insecurity [ ] . second, our measurement instrument for documenting food security, the usda -item food security module, includes a subjective experience domain that measures concern about household food supplies. according to the local media [ ] , anxiety about household food supplies nutrients , , of preceded the stay home/stay safe order and may explain the higher than expected level of food insecurity prior to covid- . further, we used an internet-based survey, given the necessity of social distancing during covid- and the need for a rapid response, which may limit the capacity of some people to participate, although % of vermonters do have internet plans [ ] . the study's strengths include its large sample size, early administration, population-based assessment, and survey instrument addressing the multiple dimensions of food security. we implemented this survey in the beginning of a stay at home order and covid- economic impacts. as such, it is likely that many respondents experiencing job loss or disruption had not yet received unemployment benefits and federal stimulus checks were not distributed. future research will examine the evolution of food security impacts, and how various interventions, including the care act and unemployment benefits, as well as food assistance expansion and health care screenings, may affect food insecurity outcomes as covid- unfolds. since the coronavirus outbreak (march th), how often did these happen to your household? = never, = sometimes, = usually, = always, not applicable could not afford the amount or kind of food my household wanted to buy could not find as much food as i wanted to buy (e.g., food not in store) could not find the kinds of food my household prefers to eat delivered food to a friend, neighbor, or family member had challenges getting food through a food pantry had challenges getting food through a school food program had challenges knowing where to find help for getting food had to go to more places than usual in order to find the food my household wanted had to stand "too close for safety" to other people, when getting food (less than six feet) table a . cont. on a scale from (not at all worried) to (extremely worried), what is your level of worry for your household about the following as it relates to coronavirus. = not at all worried, = extremely worried, not applicable there will not be enough food in the store food will become more expensive for my household food will become unsafe my household will lose access to programs that provide free food or money for food my household will have a decrease in income and won't be able to afford enough food my household won't have enough food if we have to stay at home and can't go out at all what, if anything, would make it easier for your household to meet its food needs during the coronavirus pandemic? = not helpful, = somewhat helpful, = helpful, = very helpful, not applicable access to public transit or rides different hours in meal programs or stores extra money to help pay for food or bills help with administrative problems (like applying for food assistance) increase benefits of existing food assistance programs (like snap or wic) information about food assistance programs or food pantries more (or different) food in stores more trust in safety of food delivery more trust in safety of going to stores support for the cost of food delivery the base outcome comparison is food secure households. we find no significantly differences between the factors predicting food insecurity since covid- for newly or consistently food insecure households, so report the combined results of a multivariable logit model in the main results of both newly and consistently food insecure households together. interventions to mitigate early spread of sars-cov- in singapore: a modelling study. lancet infect. dis. . [crossref] . united nations food and agriculture organization united nations food and agriculture organization household food security in the united states incremental health care costs associated with food insecurity and chronic conditions among older adults food insecurity and health care expenditures in the united states food insecurity and health outcomes food insecurity status and mortality among adults in ontario association between household food insecurity and annual health care costs food insecurity, healthcare utilization, and high cost: a longitudinal cohort study prevalence of us food insecurity is related to changes in unemployment, inflation, and the price of food unemployment and household food hardship in the economic recession united states department of labor. the employment situation the impact of the coronavirus on child food insecurity covid- forces recalibration of priorities as world embraces new habits pantries padded with produce as north americans prepare for the covid- long haul food insecurity and covid- : disparities in early effects for us adults food access and security during coronavirus survey-version . . harvard dataverse v a meta-analysis of cronbach's coefficient alpha front porch forum paid campaign posting united states census bureau. cp : comparative demographic estimates. available online: data.census.gov household food security survey module: six-item short form statacorp llc: college station united states census bureau. cp : comparative economic characteristics cp : comparative social characteristics in the united states private label manufacturer's association. today's primary shopper about half of lower-income americans report household job or wage loss due to covid- the covid- crisis has already left too many children hungry in america food insecurity in the united states during covid- pandemic a pediatric fruit and vegetable prescription program increases food security in low-income households participation in a farmers' market fruit and vegetable prescription program at a federally qualified health center improves hemoglobin a c in low income uncontrolled diabetics the role of food insecurity in developmental psychopathology food insecurity and dietary quality in us adults and children: a systematic review household food insecurity during childhood and subsequent health status: the early childhood longitudinal study-kindergarten cohort development and validity of a -item screen to identify families at risk for food insecurity implementation of a food insecurity screening and referral program in student-run free clinics food insecurity screening in pediatric primary care: can offering referrals help identify families in need? acad what factors influence snap participation? literature reflecting enrollment in food assistance programs from a social and behavioral science perspective why do low-income women not use food stamps? findings from the california women's health survey. public health nutr accessing food resources: rural and urban patterns of giving and getting food understanding persistent food insecurity: a paradox of place and circumstance map the meal gap people stocking up on toilet paper; shelves empty we would like to thank those who assisted in the dissemination of the survey including key: cord- - xss bzv authors: głąbska, dominika; skolmowska, dominika; guzek, dominika title: population-based study of the changes in the food choice determinants of secondary school students: polish adolescents’ covid- experience (place- ) study date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: xss bzv during the outbreak of coronavirus disease (covid- ) pandemic and the lockdown, various changes of dietary habits are observed, including both positive and negative ones. however, the food choice determinants in this period were not studied so far for children and adolescents. the study aimed to analyze the changes in the food choice determinants of secondary school students in a national sample of polish adolescents within the polish adolescents’ covid- experience (place- ) study population. the study was conducted in may , based on the random quota sampling of schools (for voivodeships and counties) and a number of students from all the regions of poland participated. the food choice questionnaire (fcq) ( items) was applied twice—to analyze separately current choices (during the period of covid- pandemic) and general choices (when there was no covid- pandemic). for both the period before and during the covid- pandemic, sensory appeal and price were indicated as the most important factors (with the highest scores). however, differences were observed between the scores of specific factors, while health (p < . ) and weight control (p < . ) were declared as more important during the period of covid- pandemic, compared with the period before, but mood (p < . ) and sensory appeal (p < . ) as less important. the observations were confirmed for sub-groups, while female and male respondents were analyzed separately. it can be concluded that the covid- pandemic may have changed the food choice determinants of polish adolescents, as it may have increased the importance of health and weight control, but reduced the role of mood and sensory appeal. this may be interpreted as positive changes promoting the uptake of a better diet than in the period before the pandemic. during the outbreak of coronavirus disease caused by the spread of sars-cov- virus, which was announced by the world health organization (who) as a pandemic on march [ ] , there are novel problems arising in the globe which must be addressed in public health policy, including those associated with food and nutrition. recent studies indicate that nutrition is becoming a more important issue than before because malnutrition [ ] as well as obesity [ ] may influence the outcomes of covid- patients, and hence, high nutritional status should be maintained by following a properly balanced diet. at the same time, weight control is commonly stated as a problem during the covid- lockdown, due to reduced physical activity and following an improperly balanced diet [ ] . taking this into account, the importance of following a properly balanced healthy diet is emphasized by major authorities, including the who [ ] , as it is indicated to potentially be significant not only for prevention but also for therapy, while the need for dedicated nutritional recommendations is considered as a priority [ ] . a number of studies showed that the period of covid- lockdown influenced the nutritional behaviors of the studied populations, while a lot of them analyzed the quality of diet of the subjects. they commonly indicated that, depending on the studied group, the influence of covid- differed. for instance, such findings were reported in the study by deschasaux-tanguy et al. [ ] , which was conducted on a population of , french adults from the nutrinet-sante cohort. the authors showed that in various groups of subjects, dietary behaviors were either improved or worsened. on the other hand, the study by scarmozzino and visioli [ ] indicated that nearly half of the respondents did not substantially modify their dietary habits during the lockdown. in the study by sidor and rzymski [ ] , it was stated that in poland, the body mass of adults was affected by their dietary habits, namely less frequent consumption of vegetables, fruits, and legumes during the covid- quarantine. similarly, the study conducted by pietrobelli et al. [ ] in a group of obese children showed that during the lockdown, the intake of unhealthy food such as potato chips, red meat, and sugary drink was increased. food choices made by a person during adolescence are especially important because the intake of food in this period may determine both the current health status and the health status in adult life [ ] . food choice determinants of adolescents have been shown to be complex and multicausal. the study of share and stewart-knox [ ] conducted in a group of irish adolescents distinguished motivation factors-health, price/convenience, mood, religion, and animal rights. in an american study by neumark-sztainer et al. [ ] , both internal and external factors influencing the food choices of adolescents were discerned, which included the appeal of food, food availability, mood, body image, parental influences, and media. while some of the factors perceived as important in choosing certain types of food are permanent and influence food choices for the whole life, others are specifically associated with being an adolescent [ ] . although a number of studies have revealed that the period of covid- pandemic influenced the dietary behaviors of respondents [ ] [ ] [ ] [ ] , their food choice motivations still remain poorly understood. some studies have also evaluated specific food product choices. for example, in the study by jribi et al. [ ] , a majority of respondents stated that covid- lockdown modified their grocery shopping habits and improved their shopping performance. similarly, in the study by di renzo et al. [ ] , several respondents declared buying organic food or directly from farmers, as well as purchasing more fruits and vegetables. additionally, the study of bracale and vaccaro [ ] showed changes in the food choices of people in the period of covid- , with an increase in the consumption of flour, pasta, eggs, and frozen food and a decrease in the consumption of fresh food. however, no studies published so far analyzed the factors that determined food choice determinants during the covid- pandemic. for both adults [ ] and children [ ] , numerous determinants of food choices and eating behaviors have been identified. the period of covid- pandemic may have modified the existing determinants, as during this period people experienced a number of stressors, such as prolonged duration of lockdown, fears of infection, frustration, and boredom, inadequate information, lack of personal space at home, and family financial loss, as well as lack of in-person contact with classmates, friends, and teachers, which in the case of children and adolescents may influence the dietary habits [ ] . therefore, there is a need to analyze in detail the food choice determinants of adolescents, as this knowledge will be particularly relevant to nutritionists, educators, policymakers, and manufacturers who are interested in the nutritional status and well-being of adolescents. taking this into account, the present study aimed to analyze the changes in the food choice determinants of secondary school students in a national sample of polish adolescents within the polish adolescents' covid- experience (place- ) study population. the presented study was conducted in a sample of polish secondary school students within the second phase of the place- study. the first phase was conducted in april and was associated with the hand hygiene behaviors and other protective measures that were applied in this period [ , ] . the second phase was associated with nutritional behaviors and was conducted in the period of may ( st stage-from april to may and nd stage-from may to may ). the study was conducted on a national sample of polish respondents according to the guidelines laid down in the declaration of helsinki, and all procedures involving human subjects were approved by the ethics committee of the institute of human nutrition sciences of the warsaw university of life sciences (no. / ). all participants provided their informed consent to participate in the study. the study was based on the random quota sampling of secondary schools that was conducted to invite the representative population of schools from each region of country. poland is divided into main geographic regions with administrative units (voivodeships), depending on historic, cultural, economic, and geographic factors, and each voivodeship is further divided into counties. the stratified sampling of secondary schools was conducted and they were randomly chosen to be invited to participate in the study, based on ( ) the sampling of counties within voivodeships ( counties for each of voivodeships of poland-total number of counties), followed by ( ) sampling of secondary schools within counties ( schools for each of counties-total number of schools), within st stage. the identical supplementary sampling was conducted for those voivodeships for which there was insufficient number of respondents after days of data gathering, based on ( ) the sampling of counties within voivodeships ( counties for each of voivodeships of poland-total number of counties), followed by ( ) sampling of secondary schools within counties ( schools for each of counties-total number of schools), within nd stage. the total number of schools that were invited to participate in the study was , while the schools that were included to the first phase of the study (conducted in april ), were excluded from the sampling to the second phase. the local boards of education were engaged, if needed, to arrange the study. the head of each secondary school, that was sampled within the procedure, was invited for the participation of school in the study, while the participation was voluntary. if they expressed the will for the school to participate in the study, they informed students that they are invited to participate, while their participation was also voluntary. the students were included only if they, as well as their parents/legal guardians, provided informed consent to participate. if so, they were provided an electronic link to the dedicated questionnaire. the questionnaire form was anonymized and did not allow to gather any data that would allow to identify the respondent. additionally, the questionnaire form did not include any questions about such issues that may be perceived as personal or sensitive ones. due to the fact that some heads of secondary schools did not provide information if they would like to participate or not, after one week of the st stage and of the nd stage, they received a reminder. the students of each secondary school were informed that a link to the questionnaire is dedicated only for them, as the study was conducted only in a specific sample of students from the randomly chosen schools, who provided their informed consent to participate and those aged - years (being a typical age for this level of education in poland) (inclusion criteria). the respondents of the study were excluded if they provided their questionnaires with any missing/unreliable data. the number of included participants was . as in poland the vast majority of adolescents aged - years are the secondary school students (the current net enrollment rate (ner) is calculated as . %, based on the statistics of the central statistical office (cso) in poland based on data for december [ ] ), the included sample was considered population-based. the procedure of secondary school sampling and students including to the place- study is presented in figure . the procedure of secondary school sampling and students including to the place- study is presented in figure . [ , ] ;** statistics of the polish ministry of national education [ ] ;*** calculated on the basis of the statistics of cso. the study was conducted based on the data collected from a group of secondary school students within the place- study. information about food choice determinants and changes was obtained from the subjects by using the food choice questionnaire (fcq), developed by steptoe et al. [ ] . this questionnaire is commonly applied in various populations [ , ] , including adolescents [ , ] . the fcq was designed to assess a wide range of considerations that individuals might have when choosing what to eat, in order to evaluate the motives underlying people's selection of food products and dishes divided into categories as health, mood, convenience, sensory appeal, natural content, price, weight control, familiarity, and ethical concern [ ] . within each category, specific items are defined, and respondents were asked how important they considered an item while choosing the food they eat on a typical day. in the study, the respondents were asked using the same fcq to indicate their food product choices twice, but focusing separately on their current choices (during the period of covid- pandemic) and on their general choices (when there was no covid- pandemic). as it may have been hard for them to discriminate the before and current period of covid- pandemic, they were asked about the current period of their remote education and separately about the period before their the study was conducted based on the data collected from a group of secondary school students within the place- study. information about food choice determinants and changes was obtained from the subjects by using the food choice questionnaire (fcq), developed by steptoe et al. [ ] . this questionnaire is commonly applied in various populations [ , ] , including adolescents [ , ] . the fcq was designed to assess a wide range of considerations that individuals might have when choosing what to eat, in order to evaluate the motives underlying people's selection of food products and dishes divided into categories as health, mood, convenience, sensory appeal, natural content, price, weight control, familiarity, and ethical concern [ ] . within each category, specific items are defined, and respondents were asked how important they considered an item while choosing the food they eat on a typical day. in the study, the respondents were asked using the same fcq to indicate their food product choices twice, but focusing separately on their current choices (during the period of covid- pandemic) and on their general choices (when there was no covid- pandemic). as it may have been hard for them to discriminate the before and current period of covid- pandemic, they were asked about the current period of their remote education and separately about the period before their remote education. this is because, in the period of the study, students were receiving remote education (since march , as decided by the polish ministry of national education [ ] ), after the first covid- case was diagnosed ( march [ ] ). as fcq is a tool with proven reproducibility ( -to -week period) [ ] , the differences observed while comparing the period before and during the covid- pandemic may be attributed to differences in the food choice determinants caused by the pandemic. the fcq applied in the study, which was developed by steptoe et al. [ ] , was based on items. for each item, the respondents were asked to endorse the statement, "it is important to me that the food i eat on a typical day . . . ", by choosing between one of the following responses (close-ended question): not at all important (scored as ), a little important (scored as ), moderately important (scored as ), and very important (scored as ). afterward, the items were clustered within factors, as described by steptoe et al. [ ] : health ( items included), mood ( items included), convenience ( items included), sensory appeal ( items included), natural content ( items included), price ( items included), weight control ( items included), familiarity ( items included), and ethical concern ( items included). finally, for each respondent, each factor, as a determinant of food choices, was scored with the mean score of the items included. the results obtained for each factor ( factors), as well as for each item within a factor ( items), were compared for the period before and during the covid- pandemic, in order to perform an in-depth analysis, as applied by other authors [ , ] . to verify the internal reliability of data within assessed factors, the cronbach's alpha coefficient was applied [ ] . the shapiro-wilk test was applied to verify the normality of distribution of data. the principal component analysis (pca), based on the analysis of correlations, was applied to define the loadings for the items included within the factors. the results obtained for the period before the covid- pandemic and during the covid- pandemic were compared while using wilcoxon matched pair t-test (due to nonparametric distributions), accompanied by effect size verification (only the results with r ≥ . were discussed, as according to cohen's classification of effect sizes r < . represents no effect [ ] ). the p ≤ . level was interpreted as statistically significant. the statistical analysis was conducted while using statistica version . (statsoft inc., tulsa, ok, usa). the general characteristics of the sample of adolescents studied within the place- study is presented in table . the study was conducted in a homogenic sample of polish adolescents, while mainly female students participated. the results of the loading and cronbach's alpha coefficient for the applied fcq for the period before and during the covid- pandemic for the sample of adolescents studied within the place- study are presented in table . both for the period before and during the covid- pandemic, the cronbach's alpha coefficients for the analyzed factors indicated a good internal reliability of the data. the loading of the specific items was similar in the period before and during the covid- pandemic. the results of the loading and cronbach's alpha coefficient for the applied fcq for the period before and during the covid- pandemic for the sample of female adolescents studied within the place- study are presented in table . both for the period before and during the covid- pandemic, the cronbach's alpha coefficients for the analyzed factors indicated a good internal reliability of the data. the loading of the specific items was similar in the period before and during the covid- pandemic. moreover, the results were similar as for the general studied population. the results of the loading and cronbach's alpha coefficient for the applied fcq for the period before and during the covid- pandemic for the sample of male adolescents studied within the place- study are presented in table . both for the period before and during the covid- pandemic, the cronbach's alpha coefficients for the analyzed factors indicated a good internal reliability of the data. the loading of the specific items was similar in the period before and during the covid- pandemic. moreover, the results were similar as for the general studied population. the factors influencing food choices determined based on the applied fcq for the period before and during the covid- pandemic in the sample of adolescents studied within the place- study are presented in table . the additional analyses of the results for all the items included within the factors of the applied fcq are presented in supplementary tables (tables s -s ). for both the period before and during the covid- pandemic, sensory appeal and price were indicated as the most important factors (with the highest scores) by the respondents. however, differences were observed between the scores of specific factors, while health (p < . ) and weight control (p < . ) were declared as more important during the period of covid- pandemic, compared with the period before, but mood (p < . ) and sensory appeal (p < . ) as less important. the factors influencing food choice based on the applied fcq for the period before and during the covid- pandemic for the sample of female adolescents studied within the place- study are presented in table . both for the period before and during the covid- pandemic, the sensory appeal and price were indicated as the most important factors (with the highest scores). however, there were differences between the scores of specific factors, while the results were similar as for the general studied population. the health (p < . ) and weight control (p < . ) in the period of covid- pandemic were assessed as more important, while compared with the period before, but mood (p = . ), and sensory appeal (p < . ) as less important. the factors influencing food choice based on the applied fcq for the period before and during the covid- pandemic for the sample of male adolescents studied within the place- study are presented in table . both for the period before and during the covid- pandemic, the sensory appeal and price were indicated as the most important factors (with the highest scores). however, there were differences between the scores of specific factors, while the results were similar as for the general studied population. the weight control (p < . ) in the period of covid- pandemic was assessed as more important, while compared with the period before, but mood (p < . ), and sensory appeal (p < . ) as less important. the conducted study revealed some important differences in the food choice determinants (described in the fcq as factors) for the period before and during the covid- global pandemic, as the importance given to health and weight control increased, while that of mood and sensory appeal decreased during the covid- pandemic. the observations were confirmed for sub-groups, while female and male respondents were analyzed separately. taking into account the significance of following a properly balanced diet during the covid- pandemic, prioritizing the food choice determinants associated with health and weight control should be perceived as beneficial. however, it should be mentioned that among the items associated with health, the change considered as the most significant was the fiber content, but not the content of vitamins or minerals, or keeping healthy. it may be explained by the general connotation that food products high in fiber are low in calories [ ] . at the same time, the reason may be associated with the sedentary lifestyle and resulting constipation or problems in bowel movements [ ] , which may be reduced by increased fiber intake [ ] . simultaneously, for weight control as a determinant of food choices in the period of covid- pandemic, all the assessed items were declared as more important than before, including those associated with energy value, fat content, and weight control potential. this indicated the major role of all the described aspects in managing the individual diet of respondents, which is in agreement with the priorities of the european association for the study of obesity [ ] . analysis of the global results on the problems with maintaining a stable body mass during covid- lockdown [ ] showed that these may be associated with the gain of body mass during the initial period of lockdown and the resultant need to reduce the weight. for the food choice determinants perceived as less important during the covid- pandemic than before, including mood and sensory appeal, it should be emphasized that not considering them when choosing food may be interpreted as beneficial in terms of following a properly balanced diet. moreover, among the items associated with mood, only the importance of helping to cope with life increased, while it cannot be unambiguously interpreted as having any dietary restrictions and as resulting from the temporary urge. at the same time, as mood is a determinant that mainly influences the increased consumption of sweets and fatty food of high energy density, which may mitigate the effects of stress on opioidergic and dopaminergic neurotransmission in the brain [ ] , its decreased role may promote the intake of a diet of higher nutritional value. to our knowledge, this is the first study conducted during the covid- pandemic to determine the food choice determinants of the adolescents in this unusual period using fcq. however, fcq is a reliable tool which was already applied in various populations, including adolescents. therefore, the observations of the present study may be compared to those from other studies that were conducted while there was no covid- pandemic. in the study of canales et al. [ ] , which was conducted in a group of spanish high school students, it was indicated that adolescents chose their food based on sensory appeal and price, while ethical concern was the least important for them. the study of maulida et al. [ ] conducted in a group of junior high school students from indonesia showed that students from less affluent families put more emphasis on price and convenience in terms of food choices, while those from more affluent families did not make healthier food choices. similar determinants have been declared by adult populations in different studies; for example, manufacturing workers in brazil indicated sensory appeal and price as the most important determinants [ ] ; relatives of secondary and high school students in spain indicated sensory appeal, price, and weight control [ ] ; adults from western balkan countries indicated sensory appeal, convenience, health, and natural content [ ] ; individuals from belgium, hungary, and romania indicated sensory appeal, health, convenience, and price; and individuals from the philippines indicated health, price, mood, and sensory appeal [ ] . in the comprehensive study of markovina conducted in european countries, price was found to be the most important determinant of food choices in spain, greece, ireland, portugal, and the netherlands, sensory appeal in norway, germany, and the united kingdom, and natural content in poland, while familiarity and ethical concern were consistently ranked as the least important by the populations of all the studied countries [ ] . at the same time, the systematic review of cross-cultural and single-country studies by cunha et al. [ ] showed that sensory appeal was considered as the most important determinant by consumers from bosnia-herzegovina, belgium, canada, germany, croatia, hungary, montenegro, republic of macedonia, norway, new zealand, romania, serbia, slovenia, and the united kingdom, followed by health and price, while ethical concern and familiarity were ranked as the least important determinants. comparing the results of our study with those presented above, it can be stated that sensory appeal and price are important determinants of food choices, independent of the studied group, and that the subjects considered them as the most important factors both before and during the covid- pandemic. as the presented results were obtained by using the commonly applied and valid questionnaire [ ] , in a national sample of adolescents, gathered by sampling in all the regions, the findings of our study may be significant for further public health policy. moreover, as no such studies were conducted so far in other countries, in this specific period of covid- pandemic, the results may be extrapolated to other countries. however, it must be pointed out that the results described for the period before the covid- global pandemic were based on reporting at the time of the pandemic, so there may be a possibility of recall bias which cannot be excluded. the broad implications from the present study should be listed, as well as highlighting the possibilities of using the obtained results is needed. it must be specified that the food choice determinants, while changing during any long-term crisis (as a prolonged pandemic), may also interfere with other areas, including social, economic, and environmental. the social practices and social norms include nutritional aspects, so while health and weight control were considered as more important during the pandemic than before, they may influence the general social interactions, including social stigmatization and prejudice and thus result in marginalization and inequities against individuals with other food choice priorities. changes in food choice determinants may influence the demand for food products, as products that have health-promoting properties, are low in calories, or are low in fat may be expected to be perceived as more valuable, increasing the market pressure on producers. last but not least, the general situation may change the structure of consumption, influencing the national and international markets, the environmental impact of production, and the necessary actions that should be taken by governments. it must be indicated that evolving food choice determinants, which were observed in the case of polish adolescents, while being associated with positive effects during the covid- pandemic, may also be perceived as an opportunity to improve the eating behaviors of people and create more beneficial dietary habits. taking this into account, governments within their public health policy should specify the positive behaviors that may be adopted by consumers to improve their general well-being, mood, and health. it is well known that various factors influence the food choices of consumers, including sensory appeal, price, and health concerns [ ] . understanding these factors may contribute to promoting the consumption of healthy food products and limitation of those not having health benefits [ ] . knowledge about food choice determinants, their changes, and association with the current global situation will allow designing appropriate and effective dietary policies aimed at specific populations, bearing in mind the food-related customs, which are particularly associated with the cultural background [ ] . this is especially important, as the covid- pandemic has been indicated to be associated with changes in eating habits, including increased consumption of homemade dishes, such as pizza, bread, and sweets, and decreased intake of fresh fish and packed sweets [ ] . therefore, identifying the motives for choosing certain types of food among adolescents will be helpful to establish successful educational campaigns which will be needed soon. the other issue that must be addressed, especially in terms of necessary national and international policies, is the fact that changes observed in food choice determinants may be either sustained in the future or only temporary. without further observation after the covid- pandemic, we will not understand if this global crisis will change the general approach, as well as the individual values and priorities of populations once and for all. although the present study provided novel information about food choice determinants in the population of adolescents during the covid- pandemic, it has some limitations that must be highlighted. the most important is that the study may be associated with general recall bias, resulting from chances of inaccurate and incomplete recollection of events by the respondents. however, as the covid- pandemic was an unexpected event, it was impossible to conduct a prospective study to verify its influence, which would be the only way to overcome this bias. taking this into account, as well as considering that no studies have been published so far analyzing the food choice determinants during the covid- pandemic, it may be stated that the presented study showed some valuable results. the other limitations are associated with the fact that the study was conducted only in the population of one country, and although it provided detailed information about this specific population, it should be reproduced in other countries as well. at the same time, it is crucial to analyze the food choice determinants in representative groups, and while in the present study a higher share of female than male individuals participated, it may be supposed to have influenced the representativeness of the studied group. moreover, the study was based on anonymous and voluntary declarations, as it was conducted using an online survey; therefore, it presents only declarative determinants of food choices not verified in real market conditions. however, this limitation would be impossible to overcome, as many restrictions were implemented in poland during the covid- pandemic, including the lockdown. last but not least, it must be emphasized that in poland, adolescents rarely do household grocery shopping, so the analysis of their food choice determinants does not reveal the full picture of the situation. in the study, it was observed that both before and during the covid- pandemic, sensory appeal and price were considered as the most important factors determining food choices by polish adolescents. however, the study also showed differences between the scores of specific factors, while health and weight control were declared as more important during the covid- pandemic compared with the period before, but mood and sensory appeal as less important. taking into account the period of covid- pandemic, prioritizing the food choice determinants based on health and weight control should be perceived as beneficial and may be considered as a conscious decision needed for this period. it can be concluded that the covid- pandemic may have changed the food choice determinants of polish adolescents, as it may have increased the importance of health and weight control but reduced the role of mood and sensory appeal. this may be interpreted as positive changes promoting the uptake of a better diet than in the period before the pandemic. these findings, if confirmed by other studies, may be valuable while developing local and national nutritional strategies for poland and other countries. it should be kept in mind that changes in food choice determinants may also influence the nutritional behaviors of people, so while promoting a healthy diet, the general situation must be reconsidered. therefore, educational strategies addressed for children and adolescents, as well as for parents, to influence their nutritional behaviors, should consider the novel and unusual situation of the pandemic. such education is necessary and required actions should be appropriately planned, as consumers seem to be more focused on their food choices and may thus seek nutritional knowledge to make more informed decisions. especially in the period of covid- global pandemic, general well-being should be the focus of all measures, and hence including nutritional education may be valuable for public health interventions. supplementary materials: the following are available online at http://www.mdpi.com/ - / / / /s : table s . the results for the items included within the factor-health of the applied food choice questionnaire (fcq) for the period before and during the covid- pandemic for the sample of adolescents studied within the who director-general's opening remarks at the media briefing on covid- - nutritional status and covid- : an opportunity for lasting change? the mutual effects of covid- and obesity sanchis-gomar, f. health risks and potential remedies during prolonged lockdowns for coronavirus disease (covid- ) food and nutrition tips during self-quarantine nutritional recommendations for covid- quarantine diet and physical activity during the covid- lockdown period covid- and the subsequent lockdown modified dietary habits of almost half the population in an italian sample dietary choices and habits during covid- lockdown: experience from poland effects of covid- lockdown on lifestyle behaviors in children with obesity living in verona, italy: a longitudinal study understanding the food choice process of adolescents in the context of family and friends determinants of food choice in irish adolescents factors influencing food choices of adolescents: findings from focus-group discussions with adolescents factors influencing the food choices of irish children and adolescents: a qualitative investigation covid- virus outbreak lockdown: what impacts on household food wastage? environ eating habits and lifestyle changes during covid- lockdown: an italian survey changes in food choice following restrictive measures due to covid- an umbrella review of systematic reviews on factors influencing children's eating behaviours mitigate the effects of home confinement on children during the covid- outbreak population-based study of the influence of the covid- pandemic on hand hygiene behaviors-polish adolescents' covid- experience (place- ) study analysis of gender-dependent personal protective behaviors in a national sample: polish adolescents' covid- experience (place- ) study the central statistical office in poland the central statistical office in poland polish ministry of national education development of a measure of the motives underlying the selection of food: the food choice questionnaire food choice questionnaire revisited in four countries: does it still measure the same? appetite food choice motives, attitude towards and intention to adopt personalised nutrition nutrition among adolescent spaniards: healthy and non-healthy motives of food choice food-choice motives of adolescents in jakarta, indonesia: the roles of gender and family income polish ministry of national education. suspension of classes in schools epidemiological analysis of the first cases of covid- in poland: a preliminary report novel food-based product communication: a neurophysiological study the creation of a healthy eating motivation score and its association with food choice and physical activity in a cross sectional sample of irish adults statistics notes: cronbach's alpha statistical power analysis for the behavioral sciences the role of fiber in energy balance effects of regular physical activity on defecation pattern in middle-aged patients complaining of chronic constipation association between physical activity, fiber intake, and other lifestyle variables and constipation in a study of women european association for the study of obesity position statement on the global covid- pandemic obesity risk during collective quarantine for the covid- epidemic emotional influences on food choice: sensory, physiological and psychological pathways relationships between motivations for food choices and consumption of food groups: a prospective cross-sectional survey in manufacturing workers in brazil what motivates the consumer's food choice? understanding the motives for food choice in western balkan countries food me study: validity and reliability of food choice questionnaire in european countries application of the food choice questionnaire across cultures: systematic review of cross-cultural and single country studies main factors underlying consumers' food choice: a first step for the understanding of attitudes toward "healthy eating motives for food choice: a comparison of consumers from japan, taiwan, malaysia and new zealand. food qual. pref key: cord- -iqe sdq authors: grant, william b.; lahore, henry; mcdonnell, sharon l.; baggerly, carole a.; french, christine b.; aliano, jennifer l.; bhattoa, harjit p. title: evidence that vitamin d supplementation could reduce risk of influenza and covid- infections and deaths date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: iqe sdq the world is in the grip of the covid- pandemic. public health measures that can reduce the risk of infection and death in addition to quarantines are desperately needed. this article reviews the roles of vitamin d in reducing the risk of respiratory tract infections, knowledge about the epidemiology of influenza and covid- , and how vitamin d supplementation might be a useful measure to reduce risk. through several mechanisms, vitamin d can reduce risk of infections. those mechanisms include inducing cathelicidins and defensins that can lower viral replication rates and reducing concentrations of pro-inflammatory cytokines that produce the inflammation that injures the lining of the lungs, leading to pneumonia, as well as increasing concentrations of anti-inflammatory cytokines. several observational studies and clinical trials reported that vitamin d supplementation reduced the risk of influenza, whereas others did not. evidence supporting the role of vitamin d in reducing risk of covid- includes that the outbreak occurred in winter, a time when -hydroxyvitamin d ( (oh)d) concentrations are lowest; that the number of cases in the southern hemisphere near the end of summer are low; that vitamin d deficiency has been found to contribute to acute respiratory distress syndrome; and that case-fatality rates increase with age and with chronic disease comorbidity, both of which are associated with lower (oh)d concentration. to reduce the risk of infection, it is recommended that people at risk of influenza and/or covid- consider taking , iu/d of vitamin d( ) for a few weeks to rapidly raise (oh)d concentrations, followed by iu/d. the goal should be to raise (oh)d concentrations above – ng/ml ( – nmol/l). for treatment of people who become infected with covid- , higher vitamin d( ) doses might be useful. randomized controlled trials and large population studies should be conducted to evaluate these recommendations. the world is now experiencing its third major epidemic of coronavirus (cov) infections. a new cov infection epidemic began in wuhan, hubei, china, in late , originally called -ncov [ ] the general metabolism and actions of vitamin d are well known [ ] . vitamin d is produced in the skin through the action of uvb radiation reaching -dehydrocholesterol in the skin, followed by a thermal reaction. that vitamin d or oral vitamin d is converted to (oh)d in the liver and then to the hormonal metabolite, , (oh) d (calcitriol), in the kidneys or other organs as needed. most of vitamin d's effect arises from calcitriol entering the nuclear vitamin d receptor, a dna binding protein that interacts directly with regulatory sequences near target genes and that recruits chromatin active complexes that participate genetically and epigenetically in modifying transcriptional output [ ] . a well-known function of calcitriol is to help regulate serum calcium concentrations, which it does in a feedback loop with parathyroid hormone (pth), which itself has many important functions in the body [ ] . several reviews consider the ways in which vitamin d reduces the risk of viral infections [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . vitamin d has many mechanisms by which it reduces the risk of microbial infection and death. a recent review regarding the role of vitamin d in reducing the risk of the common cold grouped those mechanisms into three categories: physical barrier, cellular natural immunity, and adaptive immunity [ ] . vitamin d helps maintain tight junctions, gap junctions, and adherens junctions (e.g., by e-cadherin) [ ] . several articles discussed how viruses disturb junction integrity, increasing infection by the virus and other microorganisms [ ] [ ] [ ] . vitamin d enhances cellular innate immunity partly through the induction of antimicrobial peptides, including human cathelicidin, ll- , by , -dihdroxyvitamin d [ , ] , and defensins [ ] . cathelicidins exhibit direct antimicrobial activities against a spectrum of microbes, including gram-positive and gram-negative bacteria, enveloped and nonenveloped viruses, and fungi [ ] . those host-derived peptides kill the invading pathogens by perturbing their cell membranes and can neutralize the biological activities of endotoxins [ ] . they have many more important functions, as described therein. in a mouse model, ll- reduced influenza a virus replication [ ] . in another laboratory study, , (oh) d reduced the replication of rotavirus both in vitro and in vivo by another process [ ] . a clinical trial reported that supplementation with iu/d of vitamin d decreased dengue virus infection [ ] . vitamin d also enhances cellular immunity, in part by reducing the cytokine storm induced by the innate immune system. the innate immune system generates both pro-inflammatory and anti-inflammatory cytokines in response to viral and bacterial infections, as observed in covid- patients [ ] . vitamin d can reduce the production of pro-inflammatory th cytokines, such as tumor necrosis factor α and interferon γ [ ] . administering vitamin d reduces the expression of pro-inflammatory cytokines and increases the expression of anti-inflammatory cytokines by macrophages ( [ ] and references therein). vitamin d is a modulator of adaptive immunity [ , ] ; , (oh) d suppresses responses mediated by the t helper cell type (th ), by primarily repressing production of inflammatory cytokines il- and interferon gamma (infγ) [ ] . additionally, , (oh) d promotes cytokine production by the t helper type (th ) cells, which helps enhance the indirect suppression of th cells by complementing this with actions mediated by a multitude of cell types [ ] . furthermore, , (oh) d promotes induction of the t regulatory cells, thereby inhibiting inflammatory processes [ ] . serum (oh)d concentrations tend to decrease with age [ ] , which may be important for covid- because case-fatality rates (cfrs) increase with age [ ] . reasons include less time spent in the sun and reduced production of vitamin d as a result of lower levels of -dehydrocholesterol in the skin [ ] . in addition, some pharmaceutical drugs reduce serum (oh)d concentrations by activating the pregnane-x receptor [ ] . such drugs include antiepileptics, antineoplastics, antibiotics, anti-inflammatory agents, antihypertensives, antiretrovirals, endocrine drugs, and some herbal medicines. pharmaceutical drug use typically increases with age. vitamin d supplementation also enhances the expression of genes related to antioxidation (glutathione reductase and glutamate-cysteine ligase modifier subunit) [ ] . the increased glutathione production spares the use of ascorbic acid (vitamin c), which has antimicrobial activities [ , ] , and has been proposed to prevent and treat covid- [ ] . moreover, a former director of the center for disease control and prevention, dr. tom frieden, proposed using vitamin d to combat the covid- pandemic on march (https://www.foxnews.com/opinion/former-cdc-chief-tomfrieden-coronavirus-risk-may-be-reduced-with-vitamin-d). influenza virus affects the respiratory tract by direct viral infection or by damage to the immune system response. the proximate cause of death is usually from the ensuing pneumonia. patients who develop pneumonia are more likely to be < years old, > years old, white, and nursing home residents, to have chronic lung or heart disease and a history of smoking, and to be immunocompromised [ ] . seasonal influenza infections generally peak in winter [ ] . cannell et al. hypothesized that the winter peak was due in part to the conjunction with the season when solar uvb doses, and thus (oh)d concentrations, are lowest in most mid-and high-latitude countries [ ] , extended in [ ] . mean serum (oh)d concentrations in north and central regions of the united states are near ng/ml in winter and ng/ml in summer, whereas in the south region, they are near ng/ml in winter and ng/ml in summer [ ] . in addition, the winter peak of influenza also coincides with weather conditions of low temperature and relative humidity that allow the influenza virus to survive longer outside the body than under warmer conditions [ ] [ ] [ ] . ecological studies suggest that raising (oh)d concentrations through vitamin d supplementation in winter would reduce the risk of developing influenza. table presents results from randomized controlled trials (rcts) investigating how vitamin d supplementation affects risk of influenza. the rcts included confirmed that the respiratory tract infection was indeed derived from influenza. only two rcts reported beneficial effects: one among schoolchildren in japan [ ] , the other among infants in china [ ] . an rct in japan that reported no beneficial effect did not measure baseline (oh)d concentration [ ] and included many participants who had been vaccinated against influenza (m. urashima; private communication). the two most recent rcts included participants with above average mean baseline (oh)d concentrations [ , ] . a comprehensive review of the role of vitamin d and influenza was published in [ ] . it concluded that the evidence of vitamin d's effects on the immune system suggest that vitamin d should reduce the risk of influenza, but that more studies are required to evaluate that possibility. large population studies would also be useful, in which vitamin d supplementation is also related to changes in serum (oh)d concentration. note: % confidence interval ( % ci); day (d); hazard ratio (hr); inflammatory bowel disease (ibd); months (mos); not available (n/a); relative risk (rr); upper respiratory tract infection (urti); week (wk); years (yrs). an observational study conducted in connecticut on healthy adults in the fall and winter of - examined the relationship between serum (oh)d concentration and incidence of acute rtis (artis) [ ] . only % of people who maintained (oh)d > ng/ml throughout the study developed artis, whereas % of those with (oh)d < ng/ml did. concentrations of ng/ml or more were associated with a significant (p < . ) twofold reduction in risk of developing artis and with a marked reduction in the percentage of days ill. eight influenza-like illnesses (ilis) occurred, seven of which were the h n influenza. the first step in developing a hypothesis is to outline the epidemiological and clinical findings regarding the disease of interest and their relationship with (oh)d concentrations. from the recent journal literature, it is known that covid- infection is associated with the increased production of pro-inflammatory cytokines [ ] , c-reactive protein [ ] , increased risk of pneumonia [ ] , sepsis [ ] , acute respiratory distress syndrome [ ] , and heart failure [ ] . cfrs in china were %- % for those with cardiovascular disease, chronic respiratory tract disease, diabetes, and hypertension [ ] . two regions hard hit by covid- are regions of high air pollution in china [ ] and northern italy [ ] . the possible roles of vitamin d for the clinical and epidemiological characteristics of diseases associated with the increased risk of covid- cfr are given in table . most of the beneficial effects of vitamin d given in table are from observational studies of disease incidence or prevalence with respect to serum (oh)d concentrations. rcts comparing outcomes for participants treated or given a placebo are preferred to establish causality related to health outcomes. however, most vitamin d rcts have not reported that vitamin d supplementation reduced the risk of disease [ , ] . reasons for the lack of agreement between observational studies and rcts seems to be due to several factors, including enrolling participants with relatively high (oh)d concentrations and using low vitamin d doses and not measuring baseline and achieved (oh)d concentrations. previous studies proposed that rcts of nutrients such as vitamin d be based on nutrient status, such as (oh)d concentration, seeking to enroll participants with low values, supplementing them with enough agent to raise the concentration to values associated with good health, and measuring achieved concentrations as well as cofactors such as vitamin c, omega- fatty acids, and magnesium [ , ] ,. two recently completed rcts reported significantly reduced incidence in the secondary analyses for cancer [ ] and diabetes mellitus [ ] . table . how vitamin d is related to the clinical and epidemiological findings for incidence and case-fatality rates. clinical severe cases associated with pneumonia inverse correlation for cap [ , ] increased production of pro-inflammatory cytokines such as il- inverse correlation [ , ] increased crp inverse correlation [ , ] increased risk of sepsis inverse correlation [ , ] risk of ards inverse correlation [ , ] risk of heart failure inverse correlation [ , ] risk of diabetes mellitus inverse correlation [ , ] epidemiological began in december in china, spread mainly to northern midlatitude countries low (oh)d values in winter [ , ] males have higher incidence and much higher cfrs than females smoking reduces (oh)d [ ] cfr increases with age chronic disease rates increase with age; vitamin d plays a role in reducing risk of chronic diseases [ ] higher cfr for diabetics diabetics may have lower (oh)d [ ] higher cfr for diabetics lower (oh)d associated with increased risk of incidence [ ] higher cfr for hypertension lower (oh)d may be associated with increased risk of incidence [ ] higher cfr for cardiovascular disease lower (oh)d associated with increased risk of incidence and death [ ] higher cfr for chronic respiratory disease for copd patients, (oh)d inversely correlated with risk, severity, and exacerbation [ ] found at higher rates in regions with elevated air pollution air pollution associated with lower (oh)d concentrations [ ] note: -hydroxyvitamin d (( (oh)d); acute respiratory distress syndrome (ards); community-acquired pneumonia (cap); case-fatality rate (cfr); interleukin (il- ); chronic obstructive pulmonary disease (copd); c-reactive protein (crp); vitamin d deficiency (vdd). table lists some findings for vitamin d supplementation in reducing the clinical effects of covid- infection found from treating other diseases. treatment of cap with vitamin d did not significantly result in complete resolution. baseline (oh)d was ng/ml. achieved (oh)d in the treatment arm was ng/ml. [ ] increased production of pro-inflammatory cytokines such as il- reduces concentration of il- [ ] increased crp reduces crp in diabetic patients [ ] increased risk of sepsis no reduction in mortality rate found for adults with sepsis supplemented with vitamin d. most trials included participants with (oh)d < ng/ml; vitamin d doses between and thousand iu. [ ] risk of ards vitamin d deficiency contributes to development of ards [ , ] acute respiratory distress syndrome (ards); community-acquired pneumonia (cap); case-fatality rate (cfr); interleukin (il- ); chronic obstructive pulmonary disease (copd); c-reactive protein (crp); vitamin d deficiency (vdd). a possible reason for the monotonic increase in cfr with increasing age could be that the presence of chronic diseases increases with age. for example, the global prevalence of diabetes mellitus increases from about % below the age of years, to~ % at years and to % at years, decreasing to % by years [ ] . invasive lung cancer incidence rates for females in the united states in increased from . / , for those aged - years, to . / , for those aged - years, . / , for those aged - years, and . for those aged - years [ ] . several studies report that people with chronic diseases have lower (oh)d concentrations than healthy people. a study in italy reported that male chronic obstructive pulmonary disease patients had mean (oh)d concentrations of ( % ci, - ) ng/ml, whereas female patients had concentrations of ( % ci, - ) ng/ml [ ] . a study in south korea reported that community-acquired pneumonia (cap) patients had a mean (oh)d concentration at admission of ± ng/ml [ ] . a study in iran reported that hypertensive patients had lower (oh)d concentrations than control subjects: males, ± vs. ± ng/ml; females, ± vs. ± ng/ml [ ] . another factor that affects immune response with age is reduced , -dihydroxyvitamin d ( , (oh) d, or calcitriol), the active vitamin d metabolite, with increased age. parathyroid hormone (pth) concentration increases with age. a u.s. study was based on , paired serum pth and (oh)d concentration measurements from july to june . for participants with -ng/ml (oh)d concentration, pth increased from pg/ml for those < years to pg/ml for those > years [ ] . serum calcitriol concentrations are inversely related to pth concentrations. in a study conducted in norway on patients with a mean age of (sd, ) years, calcitriol decreased from pmol/l for those aged - years to pmol/l for those > years despite an increase in serum (oh)d from ng/ml for those - years to ng/ml for those > years [ ] . the seasonality of many viral infections is associated with low (oh)d concentrations, as a result of low uvb doses owing to the winter in temperate climates and the rainy season in tropical climates-such as respiratory syncytial virus (rsv) infection [ , ] ,. this is the case for influenza [ , ] , and sars-cov [ ] . however, mers showed a peak in the april-june quarter [ ] , probably affected by both hajj pilgrims gathering and the fact that (oh)d concentrations show little seasonal variation in the middle east [ ] . in the tropics, seasonality is related more to rainy periods (low uvb doses), for example, for influenza [ ] . considerable indirect evidence is inferred from effects found for other enveloped viruses. table presents the findings from various studies. table . findings regarding the associations and effects of vitamin d on enveloped viral infections. dengue vitamin d mechanisms discussed [ ] dengue inverse association between (oh)d concentration and progression of disease state [ ] dengue vitamin d supplementation trial with and iu/d. iu/d resulted in higher resistance to denv- infection. mddcs from those supplemented with iu/d showed decreased mrna expression of tlr , , and ; downregulation of il- /il- production; and increased il- secretion in response to denv- infection [ ] hepatitis c , -hydroxyvitamin-d - -hydroxylase, encoded by cyp a gene, is a key enzyme that neutralizes , (oh) d. this study found that alleles of cyp a had different effects on risk of chronic hepatitis c infection. [ ] chb (oh)d concentrations were lower in chb patients than that of healthy controls and inversely correlated with hbv viral loads [ ] kshv found that cathelicidin significantly reduced ksvh by disrupting the viral envelope. [ ] hiv- review of clinical studies of vitamin d supplementation showed there was a decrease in inflammation. in of studies, cd + t cell count increased, but effect on viral load was inconclusive since most patients were on cart. [ ] in a lung epithelial cell study, calcitriol treatment prior to and post infection with h n influenza significantly decreased expression of the influenza m gene, il- , and ifn-β in a cells, but did not affect virus replication. [ ] rsv demonstrated that the human cathelicidin ll- has effective antiviral activity against rsv in vitro and prevented virus-induced cell death in epithelial cultures, [ ] rsv performed a laboratory study that identified the mechanism by which vitamin d reduced risk of rsv. [ ] rsv found that the t-allele of the vitamin d receptor has a lower prevalence in african populations and runs parallel to the lower incidence of rsv-associated severe alri in african children, year. [ ] rotaviral diarrhea found serum (oh)d < ng/ml associated with an odds ratio of . ( % ci, . to . ) for rotaviral diarrhea [ ] note: acute respiratory tract infection (alri); combination antiretroviral therapy (cart); chronic hepatitis b (chb); dengue virus- (denv- ). human immunodeficiency virus (hiv- ); kaposi's sarcoma-associated herpesvirus (kshv); monocyte-derived dendritic cells (mddcs); respiratory syncytial virus (rsv). one way that covs injure the lung epithelial cells and facilitate pneumonia is through increased production of th -type cytokines as part of the innate immune response to viral infections, giving rise to the cytokine storm. a laboratory cell study reported that interferon γ is responsible for acute lung injury during the late phase of the sars-cov pathology [ ] . pro-inflammatory cytokine storms from cov infections have resulted in the most severe cases for sars-cov [ ] and mers-cov [ ] . however, covid- infection also initiated increased secretion of the th cytokines (e.g., interleukins and ) that suppress inflammation, which differs from sars-cov infection [ ] . an example of the role of vitamin d in reducing the risk of death from pandemic respiratory tract infections is found in a study of cfrs resulting from the - influenza pandemic in the united states [ ] . the u.s. public health service conducted door-to-door surveys of communities from new haven, connecticut, to san francisco, california, to ascertain incidence and cfrs. the canvasses were made as soon as possible after the autumn wave of the epidemic subsided in each locality. a total of , people, , cases, and deaths were found. as shown in their table , fatality rates averaged . per influenza cases but averaged . per cases of pneumonia. the percentage of influenza complicated by pneumonia was . %. the pneumonia cfr (excluding charles county, md, because of inconsistencies in recording cause of death) was . per for whites and . per for "coloreds". as shown in table , "coloreds" in the southeastern states had between a % and % higher rate of pneumonia compared to whites. as discussed in an ecological study using those cfr data, communities in the southwest had lower cfr than those in the northeast because of higher summertime and wintertime solar uvb doses [ ] . previous work suggested that higher uvb doses were associated with higher (oh)d concentrations, leading to reductions in the cytokine storm and the killing of bacteria and viruses that participate in pneumonia. african americans had much higher mortality rates than white americans for the period - [ ] . the reasons cfrs were higher for "coloreds" than whites may include that they have higher rates of chronic diseases, are more likely to live in regions impacted by air pollution, and that with darker skin pigmentation, blacks have lower (oh)d concentrations. a clinical trial involving postmenopausal women living on long island, ny with mean baseline (oh)d concentration ± ng/ml found that supplementation with iu/d resulted in significantly fewer upper respiratory tract infections, including influenza, than a placebo or supplementation with iu/d [ ] . see, also, references in [ ] . an analysis of serum (oh)d concentrations by race for - indicated mean (oh)d concentrations for people over years: non-hispanic whites,~ - ng/ml; non-hispanic blacks, - ng/ml; mexican-americans, - ng/ml [ ] . a reason proposed for the higher mortality rates in some communities during the - influenza pandemic was that they were near to coal-fired electricity generating plants [ ] . recent studies have confirmed that air pollution, from combustion sources, increases the risk of influenza [ , ] . the highest concentration of these plants is in the northeast, where solar uvb doses are lowest. [ ] . in a follow-on pilot trial involving mechanically ventilated critically ill patients, , iu of vitamin d supplementation significantly increased hemoglobin concentrations and lowered hepcidin concentrations, improving iron metabolism and the blood's ability to transport oxygen [ ] . hospitals are a source of rtis for both patients and medical personnel. for example, during the sars-cov epidemic, a woman returned to toronto from hong kong with sars-cov in and went to a hospital. the disease was transmitted to other people, leading to an outbreak among people in several greater toronto area hospitals [ ] . during the - influenza season, % of health care workers in a german hospital developed influenza infection [ ] . working in a hospital dealing with covid- patients is associated with increased risk of covid- infection. for example, of hospitalized covid- patients in wuhan in the zhongnan hospital from to january were medical staff, and more were infected while in the hospital [ ] . it was announced on february , , that more than chinese health workers were infected by covid- and six had died (https://www.huffpost.com/entry/chinese-health-workers-infected-by virus_n_ e a fec b d fc c b). vitamin d supplementation to raise serum (oh)d concentrations can help reduce hospitalassociated infections [ ] . concentrations of at least - ng/ml ( - nmol/l) are indicated on the basis of observational studies [ , ] . during the covid- epidemic, all people in the hospital, including patients and staff, should take vitamin d supplements to raise (oh)d concentrations as an important step in preventing infection and spread. trials on that hypothesis would be worth conducting. the data reviewed here supports the role of higher (oh)d concentrations in reducing risk of infection and death from artis, including those from influenza, cov, and pneumonia. the peak season for artis is generally when (oh)d concentrations are lowest. thus, vitamin d supplementation should be started or increased several months before winter to raise (oh)d concentrations to the range necessary to prevent artis. studies reviewed here generally reported that (oh)d concentrations of - ng/ml reduced the risk of artis [ ] . one reason for that result may be that the studies included few participants with higher (oh)d concentrations. however, one observational study reported that ng/ml was the appropriate concentration to reduce the risk of cap [ ] . although the degree of protection generally increases as (oh)d concentration increases, the optimal range appears to be in the range of - ng/ml ( - nmol/l). to achieve those levels, approximately half the population could take at least - iu/d of vitamin d [ ] . various loading doses have been studied for achieving a (oh)d concentration of ng/ml. for example, one study used a weekly or fortnightly dose totaling , - , iu over weeks ( or iu/d) [ ] . however, to achieve - ng/ml would take higher loading doses. a trial involving canadian breast cancer patients with bone metastases treated with bisphosphonates but without comorbid conditions reported that doses of , iu/d of vitamin d over a four-month period showed no adverse effects, but did unmask two cases of primary hyperparathyroidism [ ] . a study involving participants, including seven taking iu/d of vitamin d and six who took , iu/d of vitamin d for weeks, reported that (oh)d concentrations increased from ± to ± for iu/d and from ± to ± for , iu/d and improved gut microbiota with no adverse effects [ ] . thus, from the literature, it is reasonable to suggest taking , iu/d for a month, which is effective in rapidly increasing circulating levels of (oh)d into the preferred range of - ng/ml. to maintain that level after that first month, the dose can be decreased to iu/d [ , , ] . when high doses of vitamin d are taken, calcium supplementation should not be high to reduce risk of hypercalcemia. a recent review suggested using vitamin d loading doses of , - , iu in , -iu capsules to reduce the risk and severity of covid- [ ] . the efficacy and safety of high-dose vitamin d supplementation has been demonstrated in a psychiatric hospital in cincinnati, ohio [ ] . the age range was from to years. half of the patients were black, and nearly half were white. all patients entering since were offered supplementation of or , iu/d vitamin d . for patients who received iu/d for months or longer, mean serum (oh)d concentration rose from to ng/ml, whereas for the patients who received , iu/d, mean concentrations increased from to ng/ml. no cases of vitamin d-induced hypercalcemia were reported. this article includes a brief review of other high-dose vitamin d studies, including the fact that vitamin d doses of , - , iu/d were found to treat and control such diseases as asthma, rheumatoid arthritis, rickets, and tuberculosis in the s and s. those doses are much higher than the , - , iu/d of vitamin d that can be made from solar uvb exposure [ ] . however, after reports of hypercalcemia associated with use of supra-physiological doses of vitamin d surfaced, e.g., [ ] , high-dose vitamin d supplementation fell out of favor. a recent article on a high-dose vitamin d supplementation trial in new zealand involving participants reported that, over a median of . years, monthly supplementation with , iu of vitamin d did not affect the incidence rate of kidney stone events or hypercalcemia [ ] . unfortunately, most countries do not have guidelines supporting vitamin d supplementation doses and desirable serum (oh)d concentrations that would deal with wintertime rtis. guidelines for many countries consider ng/ml ( nmol/l) adequate. according to the statement from the european society for clinical and economic aspects of osteoporosis, osteoarthritis, and musculoskeletal diseases, "attainment of serum -hydroxyvitamin d levels well above the threshold desired for bone health cannot be recommended based on current evidence, since safety has yet to be confirmed" [ ] . this statement, published in , is no longer correct since a number of vitamin d supplementation studies have reported that long-term vitamin d supplementation has health benefits without adverse health effects, e.g., iu/d for cancer risk reduction [ , ] and iu/d for reduced progression from prediabetes to diabetes [ ] . a recent review on the status of vitamin d deficiency worldwide stated that because of inadequate evidence from clinical trials, "a (oh)d level of > nmol/l or ng/ml is, therefore, the primary treatment goal, although some data suggest a benefit for a higher threshold" [ ] . a companion article in the same issue of the journal stated, "although ng/ml seems adequate to reduce risk of skeletal problems and artis, concentrations above ng/ml have been associated with reduced risk of cancer, type diabetes mellitus, and adverse pregnancy and birth outcomes" [ ] . however, on the basis of the findings in several studies discussed here, as well as recommendations for breast and colorectal cancer prevention [ ] , the desirable concentration should be at least - ng/ml. the u.s. institute of medicine issued vitamin d and calcium guidelines in [ ] . the institute recommended vitamin d supplementation of iu/d for people younger than years, iu/d for those older than years, and a serum (oh)d concentration of ng/ml ( nmol/l) or higher. that recommendation was based on the effects of vitamin d for bone health. the institute recognized that no studies had reported adverse effects of supplementation with less than , iu/d of vitamin d, but set the upper intake level at iu/d, partly out of concerns stemming from observational studies that found u-shaped (oh)d concentration-health outcome relationships. however, later investigation determined that most reports of j-or u-shaped relationships were from observational studies that did not measure serum (oh)d concentrations and that the likely reason for those relationships was a result of enrolling some participants who had started taking vitamin d supplements shortly before enrolling [ ] . moreover, in , the endocrine society recommended supplementation of - iu/d of vitamin d and a serum (oh)d concentration of ng/ml or higher [ ] . those guidelines were for patients. it appears that anyone with chronic disease should be considered in that category. the u.s. institute of medicine noted that no adverse effects of vitamin d supplementation had been reported for daily doses < , iu/d [ ] . measuring serum (oh)d concentration would be useful to determine baseline and achieved (oh)d concentrations. a recent article recommended testing for groups of people who were likely to have low concentrations and could benefit from higher concentrations, such as pregnant women, the obese, people with chronic diseases, and the elderly [ ] . part of the rationale for testing was to increase awareness of actual (oh)d concentrations and the benefits of higher concentrations. in addition, increases in (oh)d concentration with respect to vitamin d supplementation depend on various personal factors, including genetics, digestive system health, weight, and baseline (oh)d concentration. for about half the population, taking iu/d of vitamin d or , - , iu/wk would raise (oh)d concentration to ng/ml. taking - iu/d as proposed to ensure that . % of the population has concentrations > ng/ml [ ] would not exceed the , -iu/d threshold. vitamin d supplementation is required for many individuals to reach (oh)d concentrations above ng/ml, especially in winter [ ] . however, vitamin d fortification of basic foods such as dairy and flour products [ , ] can raise serum (oh)d concentrations of those members of various populations with the lowest concentrations by a few ng/ml. doing so can result in reduced risk of artis for individuals with extreme vitamin d deficiency [ , ] . however, for greater benefits, daily or weekly vitamin d supplementation is recommended [ ] , as is the annual determination of serum (oh)d concentration for those with health risks [ ] . magnesium supplementation is recommended when taking vitamin d supplements. magnesium helps activate vitamin d, which in turn helps regulate calcium and phosphate homeostasis to influence the growth and maintenance of bones. all the enzymes that metabolize vitamin d seem to require magnesium, which acts as a cofactor in the enzymatic reactions in the liver and kidneys [ ] . the dose of magnesium should be in the range of - mg/d, along with twice that dose of calcium. the hypothesis that vitamin d supplementation can reduce the risk of influenza and covid- incidence and death should be investigated in trials to determine the appropriate doses, serum (oh)d concentrations, and the presence of any safety issues. the rct on vitamin d supplementation for ventilated icu patients conducted in atlanta, georgia, is a good model [ ] . a recent review stated: "although contradictory data exist, available evidence indicates that supplementation with multiple micronutrients with immune-supporting roles may modulate immune function and reduce the risk of infection. micronutrients with the strongest evidence for immune support are vitamins c and d and zinc. better design of human clinical studies addressing dosage and combinations of micronutrients in different populations are required to substantiate the benefits of micronutrient supplementation against infection." [ ] . a novel coronavirus from patients with pneumonia in china epidemiology and cause of severe acute respiratory syndrome (sars) in guangdong, people's republic of china hospital outbreak of middle east respiratory syndrome coronavirus from sars to mers, thrusting coronaviruses into the spotlight sars and other coronaviruses as causes of pneumonia global mortality associated with seasonal influenza epidemics: new burden estimates and predictors from the glamor project vitamin d deficiency biology and mechanisms of action of the vitamin d hormone vitamin d and the anti-viral state an update on vitamin d and human immunity modulation of the immune response to respiratory viruses by vitamin d mechanisms underlying the regulation of innate and adaptive immunity by vitamin d the role of uv radiation and vitamin d in the seasonality and outcomes of infectious disease vitamin d status and the host resistance to infections: what it is currently (not) understood vitamin d and influenza-prevention or therapy? self-care for common colds: the pivotal role of vitamin d, vitamin c, zinc, and echinacea in three main immune interactive clusters (physical barriers, innate and adaptive immunity) involved during an episode of common colds-practical advice on dosages and on the time to take these nutrients/botanicals in order to prevent or treat common colds a review of micronutrients and the immune system-working in harmony to reduce the risk of infection a review of the critical role of vitamin d in the functioning of the immune system and the clinical implications of vitamin d deficiency respiratory syncytial virus infection influences tight junction integrity epidemiological features and time-series analysis of influenza incidence in urban and rural areas of shenyang viral strategies predisposing to respiratory bacterial superinfections toll-like receptor triggering of a vitamin d-mediated human antimicrobial response vitamin d-directed rheostatic regulation of monocyte antibacterial responses vitamin d and respiratory infection in adults the role of cathelicidin and defensins in pulmonary inflammatory diseases cathelicidin impact on inflammatory cells. cent antiviral activity and increased host defense against influenza infection elicited by the human cathelicidin ll- vitamin d alleviates rotavirus infection through a microrna- - p mediated regulation of the tbk /irf signaling pathway in vivo and in vitro effect of high doses of vitamin d supplementation on dengue virus replication, toll-like receptor expression, and cytokine profiles on dendritic cells clinical features of patients infected with novel coronavirus in wuhan, china. lancet effect of single-dose injection of vitamin d on immune cytokines in ulcerative colitis patients: a randomized placebo-controlled trial mechanisms underlying the effect of vitamin d on the immune system , -dihydroxyvitamin d suppresses human t helper/inducer lymphocyte activity in vitro vitamin d and , (oh) d regulation of t cells , -dihydroxyvitamin d and il- combine to inhibit t cell production of inflammatory cytokines and promote development of regulatory t cells expressing ctla- and foxp low vitamin d levels among patients at semmelweis university: retrospective analysis during a one-year period the epidemiological characteristics of an outbreak of novel coronavirus diseases (covid- ) in china aging decreases the capacity of human skin to produce vitamin d influence of drugs on vitamin d and calcium metabolism mechanisms of action of vitamin d as supplemental therapy for pneumocystis pneumonia immunomodulatory and antimicrobial effects of vitamin c the antiviral properties of vitamin c global epidemic of coronavirus-covid- : what we can do to minimze risksl influenza virus-related critical illness: pathophysiology and epidemiology the role of season in the epidemiology of influenza epidemic influenza and vitamin d on the epidemiology of influenza temporal relationship between vitamin d status and parathyroid hormone in the united states influenza virus transmission is dependent on relative humidity and temperature absolute humidity modulates influenza survival, transmission, and seasonality absolute humidity and the seasonal onset of influenza in the continental united states randomized trial of vitamin d supplementation to prevent seasonal influenza a in schoolchildren preventive effects of vitamin d on seasonal influenza a in infants: a multicenter, randomized, open, controlled clinical trial effects of vitamin d supplements on influenza a illness during the h n pandemic: a randomized controlled trial randomized trial of vitamin d supplementation to prevent seasonal influenza and upper respiratory infection in patients with inflammatory bowel disease effect of vitamin d supplementation to reduce respiratory infections in children and adolescents in vietnam: a randomized controlled trial. influenza other respir serum -hydroxyvitamin d and the incidence of acute viral respiratory tract infections in healthy adults clinical characteristics of hospitalized patients with novel coronavirus-infected pneumonia in clinical course and risk factors for mortality of adult inpatients with covid- in wuhan, china: a retrospective cohort study spatiotemporal trends of pm . concentrations in central china from to based on maiac-derived high-resolution data milan winter fine particulate matter (wpm . ) induces il- and il- synthesis in human bronchial beas- b cells, but specifically impairs il- release effect of vitamin d supplementation on non-skeletal disorders: a systematic review of meta-analyses and randomised trials non-skeletal health effects of vitamin d supplementation: a systematic review on findings from meta-analyses summarizing trial data guidelines for optimizing design and analysis of clinical studies of nutrient effects why vitamin d clinical trials should be based on -hydroxyvitamin d concentrations vitamin d supplements and prevention of cancer and cardiovascular disease vitamin d supplementation and prevention of type diabetes link between community-acquired pneumonia and vitamin d levels in older patients the association between vitamin d deficiency and community-acquired pneumonia: a meta-analysis of observational studies vitamin d deficiency is associated with il- levels and monocyte activation in hiv-infected persons study of il- and vitamin d in patients of pulmonary tuberculosis serum -hydroxyvitamin d levels and c-reactive protein in persons with human immunodeficiency virus infection association of serum -hydroxyvitamin d with adipokines and inflammatory marker in persons with prediabetes mellitus association between vitamin d status and sepsis serum -hydroxyvitamin d and the risk of mortality in adult patients with sepsis: a meta-analysis association between prehospital vitamin d status and incident acute respiratory failure in critically ill patients: a retrospective cohort study impact of serum -hydroxyvitamin d on cardiac prognosis in chinese patients with heart failure is vitamin d deficiency related to a higher risk of hospitalization and mortality in veterans with heart failure? maturitas incidence rate of type diabetes is > % lower in grassrootshealth cohort with median serum -hydroxyvitamin d of ng/ml than in nhanes cohort with median of ng/ml prevalence of vitamin d inadequacy among chinese postmenopausal women: a nationwide, multicenter the influence of smoking on vitamin d status and calcium metabolism rationale and plan for vitamin d food fortification: a review and guidance paper association between -hydroxyvitamin d and epicardial adipose tissue in chinese non-obese patients with type diabetes low vitamin d levels increase the risk of type diabetes in older adults: a systematic review and meta-analysis vitamin d and hypertension: prospective study and meta-analysis the association between circulating -hydroxyvitamin d and cardiovascular diseases: a meta-analysis of prospective cohort studies the association between vitamin d and copd risk, severity, and exacerbation: an updated systematic review and meta-analysis the impact of air pollutants, uv exposure and geographic location on vitamin d deficiency effect of adjunctive single high-dose vitamin d on outcome of community-acquired pneumonia in hospitalised adults: the vidcaps randomised controlled trial the effect of intramuscular megadose of vitamin d injections on e-selectin, crp and biochemical parameters in vitamin d-deficient patients with type- diabetes mellitus: a randomized controlled trial vitamin d and critical illness: what endocrinology can learn from intensive care and vice versa high dose vitamin d administration in ventilated intensive care unit patients: a pilot double blind randomized controlled trial idf diabetes atlas: global estimates of diabetes prevalence for and projections for lung cancer among women in the united states severe vitamin d deficiency is associated with frequent exacerbations and hospitalization in copd patients relationship between serum vitamin d concentrations and clinical outcome of community-acquired pneumonia evaluation of the relationship between serum -hydroxy vitamin d and hypertension in hamadan, iran-a case control study effects of age and serum -oh-vitamin d on serum parathyroid hormone levels seasonal and age-related differences in serum -hydroxyvitamin d, , -dihydroxyvitamin d and parathyroid hormone in patients from western norway. scand respiratory syncytial virus infection in adults respiratory syncytial virus seasonality in tropical australia the vitamin d status and its effects on life quality among the elderly in jinan global seasonal occurrence of middle east respiratory syndrome coronavirus (mers-cov) infection variations in -hydroxyvitamin d in countries from the middle east and europe: the roles of uvb exposure and diet seasonality of influenza in the tropics: a distinct pattern in northeastern brazil urcuqui-inchima, s. vitamin d-regulated micrornas: are they protective factors against dengue virus infection? vitamin d serostatus and dengue fever progression to dengue hemorrhagic fever/dengue shock syndrome cyp a genetic variants in the vitamin d metabolic pathway are involved in the outcomes of hepatitis c virus infection among high-risk chinese population low vitamin d levels are associated with high viral loads in patients with chronic hepatitis b: a systematic review and meta-analysis ll- disrupts the kaposi's sarcoma-associated herpesvirus envelope and inhibits infection in oral epithelial cells the potential protective role of vitamin d supplementation on hiv- infection effects of calcitriol ( , -dihydroxy-vitamin d ) on the inflammatory response induced by h n influenza virus infection in human lung a epithelial cells and in mice the human cathelicidin ll- has antiviral activity against respiratory syncytial virus vitamin d receptor polymorphisms and risk of enveloped virus infection: a meta-analysis is there a relationship between low vitamin d and rotaviral diarrhea? a probable role for ifn-gamma in the development of a lung immunopathology in sars plasma inflammatory cytokines and chemokines in severe acute respiratory syndrome mers-cov infection in humans is associated with a pro-inflammatory th and th cytokine profile the incidence of epidemic influenza the possible roles of solar ultraviolet-b radiation and vitamin d in reducing case-fatality rates from the - influenza pandemic in the united states regional and racial inequality in infectious disease mortality re: epidemic influenza and vitamin d demographic differences and trends of vitamin d insufficiency in the us population what explains cross-city variation in mortality during the influenza pandemic? evidence from u.s. cities effects of air pollutants on occurrences of influenza-like illness and laboratory-confirmed influenza in hefei associations between source-specific particulate matter and respiratory infections in new york state adults high-dose vitamin d administration is associated with increases in hemoglobin concentrations in mechanically ventilated critically ill adults: a pilot double-blind, randomized, placebo-controlled trial update: severe acute respiratory syndrome-toronto, canada characteristics and management of patients with influenza in a german hospital during the / influenza season vitamin d's potential to reduce the risk of hospital-acquired infections association between preoperative -hydroxyvitamin d level and hospital-acquired infections following roux-en-y gastric bypass surgery association between preoperative levels of -hydroxyvitamin d and hospital-acquired infections after hepatobiliary surgery: a prospective study in a third-level hospital vitamin d supplementation to prevent acute respiratory tract infections: systematic review and meta-analysis of individual participant data human serum -hydroxycholecalciferol response to extended oral dosing with cholecalciferol cholecalciferol loading dose guideline for vitamin d-deficient adults a phase trial exploring the effects of high-dose ( , iu/day) vitamin d( ) in breast cancer patients with bone metastases the effect of various doses of oral vitamin d supplementation on gut microbiota in healthy adults: a randomized, double-blinded, dose-response study the importance of body weight for the dose response relationship of oral vitamin d supplementation and serum -hydroxyvitamin d in healthy volunteers disassociation of vitamin d's calcemic activity and non-calcemic genomic activity and individual responsiveness: a randomized controlled double-blind clinical daily oral dosing of vitamin d using to , international units a day in long-term hospitalized patients: insights from a seven year experience environmental factors that influence the cutaneous production of vitamin d intoxication with vitamin d monthly high-dose vitamin d supplementation does not increase kidney stone risk or serum calcium: results from a randomized controlled trial vitamin d supplementation in the prevention and management of major chronic diseases not related to mineral homeostasis in adults: research for evidence and a scientific statement from the european society for clinical and economic aspects of osteoporosis and osteoarthritis (esceo) effect of vitamin d and calcium supplementation on cancer incidence in older women: a randomized clinical trial vitamin d deficiency . : an update on the current status worldwide targeted -hydroxyvitamin d concentration measurements and vitamin d supplementation can have important patient and public health benefits vitamin d for cancer prevention: global perspective the report on dietary reference intakes for calcium and vitamin d from the institute of medicine: what clinicians need to know do studies reporting 'u'-shaped serum -hydroxyvitamin d-health outcome relationships reflect adverse effects? derm evaluation, treatment, and prevention of vitamin d deficiency: an endocrine society clinical practice guideline optimal vitamin d supplementation doses that minimize the risk for both low and high serum -hydroxyvitamin d concentrations in the general population vitamin d supplementation guidelines a review of the potential benefits of increasing vitamin d status in mongolian adults through food fortification and vitamin d supplementation randomized trial of vitamin d supplementation and risk of acute respiratory infection in mongolia role of magnesium in vitamin d activation and function this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license key: cord- -svc xeh authors: kow, chia siang; hadi, muhammad abdul; hasan, syed shahzad title: vitamin d supplementation in influenza and covid- infections comment on: “evidence that vitamin d supplementation could reduce risk of influenza and covid- infections and deaths” nutrients , ( ), date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: svc xeh there is an ongoing debate on the use of vitamin d supplementation in reducing the risk of influenza and covid- infections and deaths. a recently published article highlights a relationship between vitamin d supplementation and reduced risk of covid- and influenza. this comment aims to discuss the evidence on the use of vitamin d in people who are at risk of developing covid- , focusing on safety issues of the vitamin d supplementation. there is an ongoing debate on the use of vitamin d supplementation in reducing the risk of influenza and covid- infections and deaths. a recently published article highlights a relationship between vitamin d supplementation and reduced risk of covid- and influenza. this comment aims to discuss the evidence on the use of vitamin d in people who are at risk of developing covid- , focusing on safety issues of the vitamin d supplementation. we read with interest the review article entitled "evidence that vitamin d supplementation could reduce risk of influenza and covid- infections and deaths" by grant et al., recently published in nutrients [ ] . the authors' work on reviewing possible mechanisms through which vitamin d supplementation could reduce risk of various respiratory infections, including the covid- , must be applauded as it has provided a rationale for conducting well-designed clinical studies to evaluate the effectiveness of vitamin d in reducing the risk of covid- infection. however, we are rather concerned with the authors' recommendation that people at risk of covid- should consider "taking , iu/d of vitamin d for a few weeks to rapidly raise (oh)d concentrations, followed by iu/d to reduce the risk of infection". we believe that the authors' recommendation of using a high dose of vitamin d supplementation is inappropriate as there is no robust clinical evidence to support such claims. the authors have conveniently ignored the results of some key clinical studies evaluating the effectiveness of vitamin d supplementation in reducing the risk of developing respiratory tract infections (rtis). a meta-analysis of randomized controlled trials investigating the effectiveness of vitamin d supplementation in reducing the risk of developing rtis among healthy individuals found no significant risk reduction [ ] . however, some may argue that heterogeneity among included studies was high and, therefore, should not be used to deny the potential benefits of vitamin d supplementation. using individual patient data (ipd), when available for meta-analysis, may be a better approach to overcome inconsistencies at the trial level. however, the authors did include results of an ipd-based meta-analysis (including of randomized, double-blind, placebo-controlled trials) evaluating the effectiveness of supplementation with vitamin d or vitamin d with prespecified acute rtis as an outcome. the ipd-based meta-analysis did find % reduction in the odds of acquiring acute respiratory tract infection, however, further analysis reported no significant benefit of vitamin d supplementation in population with levels of vitamin d ≥ ng/ml [ ] . a significant benefit was also absent in population receiving a daily dose equivalent of ≥ iu ( µg) vitamin d supplementation. although high-dose vitamin d was not found to increase the risk of kidney stone or hypercalcemia [ ] , it is not devoid of side effects, as a randomized clinical trial observed significant lower radial bone and tibial bone mineral density with year treatment of vitamin d at a dose of , iu/d [ ] . in conclusion, the efficacy of high-dose supplementation of vitamin d in reducing risk of covid- infection is mere extrapolation of currently available evidence, which is often conflicting, on the effectiveness of vitamin d in reducing risk of other respiratory tract infections. given the possible negative impact on bone mineral density with high-dose vitamin d , it is probably wise to wait for the results of ongoing clinical trials that are registered to explore the relationship between vitamin d and covid- [ , ] . evidence that vitamin d supplementation could reduce risk of influenza and covid- infections and deaths effect of vitamin d supplementation on respiratory tract infections in healthy individuals: a systematic review and meta-analysis of randomized controlled trials vitamin d supplementation to prevent acute respiratory tract infections: systematic review and meta-analysis of individual participant data monthly high-dose vitamin d supplementation does not increase kidney stone risk or serum calcium: results from a randomized controlled trial effect of high-dose vitamin d supplementation on volumetric bone density and bone strength: a randomized clinical trial key: cord- -upyhirb authors: miller, melissa farmer; li, zhongyu; habedank, melissa title: a randomized controlled trial testing the effectiveness of coping with cancer in the kitchen, a nutrition education program for cancer survivors date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: upyhirb following a diet rich in whole grains, vegetables, fruit, and beans may reduce cancer incidence and mortality. the aim of this study was to investigate the effect of coping with cancer in the kitchen (cck), an week in-person program offering education, culinary demonstrations and food tasting, and psychosocial group support, compared to receiving cck printed materials by mail on knowledge, confidence, and skills in implementing a plant-based diet. a total of adult cancer survivors were randomly assigned to intervention (n = ) and control groups (n = ) with assessments at baseline, , and weeks via self-administered survey. the response rate was % at weeks and % at weeks. the majority of our study participants were female breast cancer survivors ( %) who had overweight or obesity ( %). compared with the control, there were significant (p < . ) increases in intervention participants’ knowledge about a plant-based diet at weeks and , reductions in perceived barriers to eating more fruits and vegetables at week , and enhanced confidence and skills in preparing a plant-based diet at week . there was a significant reduction in processed meat intake but changes in other food groups and psychosocial measures were modest. participation in cck in person increased knowledge, skills, and confidence and reduced barriers to adopting a plant-based diet. positive trends in intake of plant-based foods and quality of life warrant further investigation in larger-scale studies and diverse populations. the overall aging of the united states population and changing prevalence of risk factors, including obesity, have increased the incidence of many types of cancer while advances in the early detection and treatment of cancer have led to reduced cancer mortality. these factors have combined to dramatically increase the number of cancer survivors [ , ] . nearly million people in the us were living with a history of a cancer diagnosis as of january . this number is projected to grow to more than million by and to more than million by [ , ] . the importance of diet for cancer survivors is indicated by the accumulating evidence that a healthier diet after a cancer diagnosis can lead to improved treatment response, recovery, side-effect management, and disease outcomes [ ] [ ] [ ] [ ] [ ] . the world cancer research fund/american institute for cancer research's (aicr's) third expert report, diet, nutrition, physical activity and cancer: a global perspective, states ten cancer prevention recommendations [ ] . six of these recommendations focus on aspects of diet, including following a dietary pattern rich in whole grains, vegetables, fruit and beans, and limiting consumption of red meat and processed food, to reduce cancer incidence and mortality. a substantial body of research has demonstrated the benefits of adherence to the aicr's cancer prevention recommendations, including a lower risk of cancer incidence, recurrence, and death [ ] [ ] [ ] [ ] [ ] . despite the growing evidence supporting positive changes in diet to prevent cancer-related morbidity and mortality, most cancer survivors' adherence to the aicr's dietary recommendations is low. a recent systematic review and meta-analysis concluded that only % of cancer survivors met the recommendations for fruit and vegetable (f&v) intake and only % and % for fiber and red meat intake, respectively, while % of cancer survivors met the recommendations for smoking and % for alcohol intake [ ] , which suggests potential opportunities for interventions to improve the dietary patterns and decisions among cancer survivors. diet/nutrition was recognized as a common concern in an observational survey research study of cancer patients and survivors in the community across the us [ ] and among members of a community-based cancer care organization [ ] . further, cancer survivors frequently experience low quality of life partly attributed to nutritional problems and thus report high demand for nutritional support [ , ] . in fact, diagnoses of cancer often motivate individuals to make lifestyle changes [ ] [ ] [ ] . nonetheless, cancer survivors may find it difficult to act on their intentions and can struggle to achieve their goals when they are not given necessary tools such as specific action plans and evidence-based information for making and sustaining behavioral changes [ , , ] . coping with cancer in the kitchen (cck) was initiated to help fill this gap between lifestyle recommendations and the sustained adoption of improved lifestyle behaviors among post-diagnosis and post-treatment cancer survivors. cck is an week in-person program offering multidisciplinary support for cancer survivors that includes nutrition education, culinary demonstrations and food tasting. it also offers facilitated group discussions with structured goal setting to address psychosocial health, and it introduces simple and effective techniques for coping with cancer-related stress. the first phase of research was conducted in to test the feasibility and acceptability and to determine the preliminary effect sizes of the cck program. these promising results were used to inform refinements in both the cck curriculum and the training [ ] . in , the next phase of research was conducted as a randomized controlled trial to rigorously evaluate the efficacy of the in-person cck program versus receiving printed cck materials. the objectives of this paper are to describe the randomized controlled trial, report the results, and examine whether the in-person cck program (the intervention group) increased knowledge, skills, and confidence in adopting a plant-based diet as well as made positive changes in dietary intake and quality of life compared to the delivery of the cck program through printed materials (the control group). cck was developed according to evidence-based concepts, including aicr's cancer prevention recommendations, aicr's foods that fight cancer™, and aicr's new american plate ® . cck is a response to the needs of cancer survivors, registered dietitians, and other health professionals who lamented the lack of an evidence-based, standardized curriculum specifically for cancer survivors. a core principle guiding the design and development of cck was to ensure that it benefitted communities in which it would be implemented. to achieve this goal, the design and development of cck's evidence-based curriculum involved multiple partners across its first and second phases of research, including aicr, living plate (far hills, nj, usa), cancer support community (csc; washington, dc, usa), csc of central new jersey (bedminster, nj, usa), registered dietitians and mental health practitioners. the cck intervention was primarily guided by the social cognitive theory (i.e., knowledge and skills development, self-efficacy, and observational learning mediate behavior change) [ ] and the transtheoretical model (i.e., stages of change) [ , ] . its psychosocial components were guided by csc's affiliate model, which empowers individuals impacted by cancer to improve their health and well-being through active participation in community-based programs and active engagement with their health care team [ , ] . furthermore, it is indicated that enhanced learning occurs in a small group defined by a shared cancer experience with professional and peer support to motivate behavior change [ , ] . often the cost of food can be a barrier to trying new foods and purchasing perishable food items, both of which are important to adopting a plant-based diet. with this in mind, the cck program's recipes were designed to include relatively basic, whole foods that can be found at standard grocery stores; the serving sizes are small to limit the quantity of ingredients needed and the potential for spoilage; and no name brands are explicitly recommended. as well, a variety of recipes at various price points are provided so that facilitators can choose to demonstrate the recipes that are most appropriate for their participants and communities, and the curriculum includes time for the facilitators and participants to discuss possible recipe variations and ingredient substitutions. finally, each week, the facilitators probe for perceived barriers to adopting a plant-based diet related to each module topic (e.g., veggies, snacks, whole grains, and breakfasts) and addresses financial concerns. the first cck pilot study assessed the feasibility, acceptability, and pre-post-impact of the program by a single-arm intervention among adult cancer survivors in [ ] . participants reported increased confidence preparing a variety of plant-based foods (p = . ), perceived control over cancer (p = . ), perception of dietary quality (p = . ), and weekly behavioral capability, including food and nutrition knowledge (p < . ). there was a non-significant (ns) trend towards increased f&v and whole grain intake with moderate effect sizes ( . - . ) for intake of beans and legumes, vegetables, and cooked whole grains like brown rice and quinoa. this single-arm pilot study achieved enrollment of % of the accrual target; program attendance at each session ranged from % to %. participant satisfaction was positive with % of participants very satisfied ( or on -point likert scale) with the cooking demonstrations, % very satisfied with the facilitated group discussions, and % very satisfied with the nutrition education. we conducted a two-arm, randomized controlled trial; cancer survivors were randomized to receive the -week cck in-person multidisciplinary program immediately (intervention arm) or to receive cck printed materials (control arm). data was collected through self-administered patient surveys completed at baseline, post-intervention, and follow-up. a maximum total sample size of ( in each group) with % loss to follow-up and type i error of % provides > % power to detect a difference (effect size) of at least . standard deviations between intervention and control groups (two-sample means test). this study was conducted according to the guidelines laid down in the declaration of helsinki, and all procedures involving research study participants were approved by ethical and independent review services (e&i) institutional review board (lee's summit, mo, usa; approval code: - ). written informed consent was obtained from all subjects/patients during enrollment. the trial was retrospectively registered with clinicaltrials.gov (identifier: nct ). cancer survivors were recruited from community members served by csc-los angeles (la, ca, usa) and fanwood-scotch plains ymca (scotch plains, nj, usa) from april to june , largely by social media, emailed letters of invitation to affiliate members, community-based presentations at cancer support groups, and fliers. the research sites in los angeles, ca, and scotch plains, nj, were selected to represent a diversity of cancer survivors-from the west and east coasts of the us, respectively; from urban and small township/suburban regions, respectively; and from sites that provide programming specific to cancer or with a general community-based focus, respectively. eligibility criteria included: ( ) years of age or older; ( ) ever been diagnosed with cancer; ( ) able to attend at least seven of the eight total sessions with mandatory first and last sessions; ( ) willingness to be randomized and adhere to study protocol; ( ) completed active cancer treatment (not including hormonal or other similar agents, e.g., tamoxifen). if potential candidates had not completed active cancer treatment, research staff determined eligibility if side effects of the current treatment had not affected sense of taste causing difficulty eating healthy foods, like f&v or whole grains, and had not caused a level of fatigue that would impede ability to attend an -week program, shop for healthy foods, and prepare recipes. consenting participants were randomly assigned to of treatment groups: cck intervention or printed materials control. a unique computer-generated list for each of the two research sites randomly sequenced intervention and control assignments. allocation to the intervention or control groups was concealed until all participants had been enrolled at a site. once the final participant was enrolled, research staff broke the treatment code and assigned participants in order of enrollment to either the intervention group or the control group by adding them to the randomized list of intervention and control assignments. the local research staff notified participants in the intervention group of the start date for the cck program. participants in the control group were notified of their group assignment and mailed a baseline survey with a postage paid return envelope approximately one week before the start of the in-person cck program with instructions to complete the survey within two weeks. cck was facilitated by a multidisciplinary team. registered dietitians were trained to educate participants about aicr's cancer prevention recommendations and two evidence-based programs: aicr's new american plate ® and aicr's foods that fight cancer™. licensed social workers were trained to facilitate group support and discussions that strategized how participants could overcome psychosocial barriers to nutrition behavior change in the context of cancer survivorship, equip them with strategies to help with cancer-related stress, and encourage goal setting. in addition, the registered dietitian or a culinary assistant demonstrated convenient, easy, and tasty ways to prepare and cook plant-based foods and offered tastings. prior to facilitating cck, facilitators completed a required two-part live virtual training about how to implement the cck program with intervention fidelity, and they met weekly by phone with researchers using a semi-structured moderator guide to address any questions or problems that arose during program implementation. an evaluation of the training program indicated a high level of knowledge about cck research procedures and preparedness to deliver program content. components of the cck intervention are summarized in table . cck participants attended eight, in-person, -min classes convened weekly at their community-based organizational facility. the schedule at each site included a -week midterm break for a national holiday and staff travel, so the complete program extended to weeks. weekly themes included beans and whole grains, one-pot meals, breakfast and snacks, comfort foods, veggies, and building a foods that fight cancer kitchen. to encourage attendance, some participants were sent email reminders before some classes and some absentees were contacted by phone. licensed social workers provided support through a structured and empowering group learning environment to address the complex, important (and, unfortunately, often rarely openly discussed) psychosocial barriers to nutrition behavior change in the context of cancer prevention, treatment, and survivorship. ( ) cooking demonstration culinary experts demonstrated convenient, easy, and tasty ways to prepare and cook ftfc and invited recipe tasting. the last in-person meeting of the program included a time to review the overall experience and engage in discussion. it was intended to explore milestones achieved, recognize precipitous moments of comprehension, connect to feelings related to the program ending, identify ongoing obstacles and/or challenges, identify changes and successes along the way, share ideas and hopes for continued success, and discuss take-aways from the group experience. each week participants completed a one-page worksheet that prompted them to identify one to three specific, measurable, actionable, relevant and time-bound goals that were revisited at the next session. participants in the control group received seven comprehensive summaries from coping with cancer in the kitchen weekly module content and recipe cards (two from each of the weeks of culinary demonstrations). these were mailed to participants in one package upon completion of the baseline survey. knowledge about a plant-based diet participants rated their agreement ( = strongly disagree; = strongly agree) with six custom items developed by the research team, e.g., "i understand the benefits of consuming whole grains versus processed grains". a composite score was calculated as the average of the ratings (range - ; cronbach's alpha = . ). participants indicated "how sure are you that you could prepare the foods listed below in a tasty way?" ( = very unsure; = very sure). the -item scale included whole grains; beans, seeds and legumes; green leafy vegetables; and mixed foods, e.g., healthy one-pot meals. a composite score was calculated as the average of the items (range - ; cronbach's alpha = . ). participants rated their agreement ( = strongly disagree; = strongly agree) with five custom items developed by the research team, e.g., "i am confident that i can create a kitchen environment that makes it easier to store, prepare, and consume fruits, vegetables, whole grains, and beans."; the average of the five ratings was calculated to create a skills composite score (range - ; cronbach's alpha = . ). we adapted items from an existing barriers instrument [ , ] to measure perceived barriers to eating more fruits and vegetables (f&v) (average score of items; cronbach's alpha = . ) and whole grains (average score of items; cronbach's alpha = . ). participants were asked the general question, "listed below are some common reasons why people don't eat more servings of vegetables and fruits each day. indicate whether or not this is a reason for you by marking how much you agree or disagree." ( = strongly disagree; = strongly agree). in addition, using the same list of possible reasons (excluding spoil too quickly), participants indicated whether it was a common reason they did not eat more servings of whole grains. example reasons included take too much time to prepare; my family doesn't like them; hard to find a variety of good ones. the functional assessment of cancer therapy-general (fact-g) questionnaire is a general quality of life instrument that can be used to assess top-rated symptoms and concerns in cancer patients [ ] . the fact-g is a brief -item adaptation [ ] . internal consistency and reliability in the present study was good (cronbach's alpha = . ). the phq- is a brief -item validated screening scale for measuring core symptoms and signs of depression and anxiety [ ] . participants were asked to rate their level of fatigue on the average in the last week [ = not at all fatigued; = fatigued as i could be]. this item comes from the fatigue symptom inventory that assesses the frequency and severity of fatigue and its perceived interference [ ] . participants completed the soc which measures emotional support, or the perceived availability of someone to provide empathy or advice in times of need [ ] . higher scores represent more emotional support. scores are converted to standardized t scores (mean = , standard deviation = ); normative reference groups are the us general population. participants were asked, "to what extent do you feel you have control over the course of your cancer (that is, whether your cancer will come back, get worse, or you will develop a different type of cancer)?" ( = no control at all; = complete control). the control group received printed cck educational materials including written summaries of weekly nutrition content and recipes that emphasized the weekly nutrition themes (see table ). (only written summaries were provided because the eighth session was a reflection and review session with no new nutrition information introduced.) research staff mailed the materials to control participants upon completion of the baseline survey. the control group was not contacted again except for follow-up surveys at and weeks. upon completion of the -week survey, control participants were emailed a $ gift card. all data was collected through self-administered participant survey at baseline (pre-test, week), post-intervention ( week), and at follow-up ( week) . for participants in the cck intervention group, the baseline and post-intervention surveys were completed in person at the beginning of the first and last cck classes, respectively. the baseline and post-intervention surveys (with a postage-paid return envelope) were mailed to the control participants at their home within approximately one week of in-person cck program commencement and conclusion. the -week online follow-up survey was completed by participants in both the intervention and control groups. a link to the online survey was emailed weeks from the last session, or weeks from baseline, with a window to complete the follow-up survey of to weeks. participants were contacted by email or phone as a reminder to complete the questionnaires, as needed. the primary outcomes included knowledge about a plant-based diet (average score of items; cronbach's alpha = . ), confidence preparing a variety of plant-based foods (average score of items; cronbach's alpha = . ), and skills to practice a plant-based diet (average score of items; cronbach's alpha = . ) (see table ). secondary outcomes were measured using validated instruments for dietary intake (national cancer institute dietary screener questionnaire) [ ] ; general quality of life (fact-g ) [ ] ; psychological distress (phq- ) [ ] ; fatigue (single item from the fatigue symptom inventory [ ] ); and emotional support (soc ) [ ] . we modified an existing scale [ , ] to measure perceived barriers to eating more f&v (average score of items; cronbach's alpha = . ) and whole grains (average score of items; cronbach's alpha = . ). 'perceived barriers' was originally conceptualized as a moderating variable (those with fewer perceived barriers might experience a greater benefit from the cck intervention) rather than an outcome variable and, for that reason, was not measured at weeks follow-up. however, the findings indicate a reduction in barriers in the cck intervention group, so we included 'perceived barriers' as an outcome. additional survey items included sociodemographic characteristics, disease characteristics, and health status. descriptive statistics were calculated overall and by study group. means and standard deviations are presented for continuous variables and frequencies and percentages are presented for categorical variables. we assessed the comparability between study groups using two-sample t-tests for continuous variables and fisher's exact test for categorical variables and pre-post differences within study groups using paired t-tests. we used multiple regression analysis to estimate the difference between the cck intervention and control groups at weeks (post-intervention) and at weeks (follow-up) adjusting for baseline (pre-test) levels of the dependent variable and research site (stratification variable). we considered a p-value < . statistically significant. effect-size calculations were also used as a standard for determining a meaningful treatment effect using cohen's criteria for small, medium, and large effect sizes of . , . , and . , respectively [ ] . standardizing the observed changes by the standard deviation (sd) allows for the comparison of the effect size magnitude across outcomes and can provide a meaningful reference for the future evaluation of the program in its implementation and dissemination. we calculated the es statistic for the effect size, a form of cohen's effect size index, as the mean of the changes in outcome scores for each study group at baseline and post-intervention ( week) divided by the baseline sd [ ] . thus, the consolidated standards of reporting trials (consort) flowchart for the trial is shown in figure . a total of adult cancer survivors were randomly assigned to intervention (n = ) and control groups (n = ). the majority ( %) of study participants learned about cck from csc-los angeles and ymca staff; % from their oncologist; and % from other care providers. there was only drop-out in the intervention arm ( %) who declined participation after randomization but before the cck program commenced, indicating they could no longer commit to the duration of the program. the retention rate was % at weeks and % at weeks. there were no statistically significant differences between those who completed the online -week follow-up survey and those who did not with respect to sociodemographic variables, disease characteristics, and baseline levels of primary and secondary dependent variables. one participant in the intervention arm was excluded from the analysis due to an ineligibility discovered after completion of the program. attendance rates ranged from % for the first session to % for sessions and . characteristics for the total sample and by treatment group are shown in table . study participants were, on average, years of age and primarily female breast cancer survivors with a college degree. the sample was % non-hispanic white and % hispanic or non-white race. approximately half of the participants were married or living as married; % resided in suburban regions and % in urban areas. most study subjects had overweight or obesity ( %), and less than half ( %) indicated they ate enough plant-based foods like fruits, vegetables, whole grains and beans in the past month ("most of the time" or "all of the time"). the cck intervention group and printed materials control group were similar with respect to sociodemographic and disease characteristics. despite the randomization of participants, there were notable imbalances, though not statistically significant mean differences, between study groups in baseline levels of primary and secondary outcome measures (table ) . participants in the control group, on average, entered the study with higher confidence preparing a variety of plant-based foods and skills to practice a plant-based diet, and they also reported better quality of life, lower psychological distress, and less fatigue. thus, we adjusted for baseline levels in regression analyses. knowledge about a plant-based diet significantly increased in the intervention arm (in-person cck program) compared to the control arm (printed materials); this increase was sustained at weeks post-intervention (figure a) . confidence in preparing plant-based foods significantly increased at weeks ( figure b ) as did level of skills to practice a plant-based diet (figure c) . perceived barriers to eating f&v decreased in the cck intervention group and increased in the control group, and the adjusted difference between intervention and control groups was statistically significant (− . ; % confidence interval (ci) − . , − . ; see table ). in addition, there was a larger decrease in perceived barriers to consuming whole grains in the intervention group compared to the control group (− . v − . ), but the treatment effect did not reach statistical significance (− . ; % ci − . , . ). participants began the study consuming, on average, . and . cup equivalents ( . and . servings) for f&v per day in the intervention and control groups, respectively. intake of whole grains was approximately . and . servings per day, respectively. the between-arm differences in intake of f&v or whole grains consumption were not statistically significant. further, intake increased in both groups over time with adjusted differences between groups post-intervention of . cup equivalents ( % ci − . , . ), or . servings, per day for f&v among participants in the intervention group compared with those in the control group, and . ounce equivalents ( % ci − . , . ), or . servings, in whole grains. the cck intervention group also had significantly lower daily servings of processed meat in comparison to the control group at and weeks. in the intervention group, intake of processed meat was . times per day at baseline, which is equivalent to approximately one ( . × = . ) time per week, and it decreased to approximately one ( . × = . ) time in the past month. no statistically significant differences between cck intervention and control groups were observed in self-reported assessments of quality of life. nonetheless, the baseline to -week change trended in a positive direction for general quality of life (+ . v + . ; fact-g ), psychological distress (− . v + . ; phq- ), and fatigue (− . v − . ; -point likert). similarly, the level of social support and perceived control over the course of cancer were relatively stable in both arms, and the results suggested a trend for increase at weeks in the cck intervention group. the magnitude of effect sizes for the changes between baseline and weeks (post-intervention) in the cck intervention group, as measured by the es statistic, are graphically presented in figure . the effect sizes varied across categories of outcomes with large or nearly large effect sizes for outcomes measuring knowledge, confidence and skills. barriers to consuming f&v and whole grains showed medium reductions. the effect sizes were in the range of small to medium for total f&v, whole grain and processed meat intake but were greater (with medium to large changes) for specific components of those dietary factors including beans and legumes, whole grain bread, and cooked whole grains (like quinoa). we detected small changes in quality of life measures. the decrease in fatigue was nonetheless large. we also considered using cohen's d as a measure of effect size, which is the -week difference between the cck intervention and control groups divided by the pooled standard deviation, which is common when comparing two independent groups. however, baseline differences between the cck intervention and control groups were large relative to the variability, or standard deviation, of the factor of interest, and, therefore, may have underestimated the true treatment effect. this trial investigated the effectiveness of cck, a multidisciplinary behavioral intervention incorporating both nutrition education and psychosocial support, in modulating several motivational, action, and environmental mediators for implementing a healthy plant-based diet and for improving quality of life among cancer survivors. previously published interventions have shown that motivation, goal setting, action planning, social support, and instruction regarding how to perform desired behaviors are key elements in successfully promoting behavioral changes whereas self-monitoring is often less effective in doing so [ ] . cck reflects those concepts in its curriculum, and the results from this randomized controlled trial favored in-person delivery of cck over receipt of cck printed material only. in-person delivery of the cck program resulted in significant increases in knowledge, cooking confidence, and skills in adopting a plant-based diet over and weeks compared to the control group that received written cck materials. participants who attended cck in person also reported a greater reduction in perceived barriers to the consumption of f&v and whole grains compared to the control group. as the literature indicates, people with higher perceived barriers tend to have poorer diets and are less likely to engage in behavioral changes, even when they are aware of the benefits of lifestyle changes [ , , ] . lack of access to accurate nutrition information, disbelief in diets and their relationship to cancer outcomes, low reinforcement from friends and family, and unfamiliarity with certain plant-based foods are commonly cited reasons for people not taking actions [ , ] . in particular, limited knowledge and skills in selecting and cooking healthy foods often demotivate cancer survivors from making dietary or lifestyle changes [ , ] . cck addresses those concerns and obstacles by providing evidence-based nutrition education tailored to cancer survivors and delivered by registered dietitians. moreover, cck sessions included facilitator-led group discussions to enquire and consider approaches to reduce barriers to preparing and consuming a plant-based diet specifically for cancer survivors, and they contained weekly thematic cooking demonstrations using evidence-based aicr's dietary recommendations and inviting participants for recipe tastings. facilitated group discussion, access to trained facilitators, and experiential culinary support may contribute substantially to the observed difference between the intervention and control arms. participants in the cck intervention group were able to observe thematic, plant-based foods and recipes being prepared, ask questions, receive verbal information in real time about the health benefits of the ingredients in cck recipes, interact with group members during the recipe demonstrations, and were encouraged to taste new foods. fredericks et al. state that nutritional education with experiential features provides further drivers for behavioral change including collaboration, peer support, and palate development [ ] . though telephone and web/app-based interventions can be more accessible to a wider audience, especially in remote areas, they rely heavily on self-monitoring and often face challenges in retaining participants [ ] . conversely, cck's in-person classes achieved high attendance (≥ %), which is comparable to other effective nutrition education programs targeting cancer survivors, such as cocinar para tu salud, a -week nutrition education program, and the home vegetable gardening interventions [ ] [ ] [ ] . the study showed the benefit of in-person implementation over provision of printed materials only. however, given the current covid- pandemic, future research could investigate virtual implementation of cck using an online platform when in-person gatherings are prohibited, not possible or not preferred. the cck program is available to survivors of all types of cancer. its broad relevance increases the efficiency of delivery, the adaptability to local communities, and the scalability regionally and nationally. the demonstrated enhancements in knowledge, skills, and confidence in practicing a plant-based diet at the end of the program, which continued their upward trend even at weeks follow-up, implied, though not directly measured, the cck effect on improving self-efficacy, which likely led to a higher level of patient empowerment [ , ] . self-efficacy is a critical indicator of patient empowerment and a key construct of the social cognitive theory and transtheoretical model used to guide the design and implementation of the cck program for health behavior change [ , , ] . low self-efficacy (i.e., low confidence in one's ability to execute a course of action) is an important barrier impeding behavioral change among cancer survivors [ , ] . further, practicing and experiencing are among the most important sources of self-efficacy [ ] . we indeed observed that cck's positive effect on self-efficacy was larger in the th week follow-up survey than immediately post-intervention ( weeks) as participants had had more time to practice a plant-based diet by the th week. higher self-efficacy has been indicated in studies to associate with higher probability of achieving and maintaining healthy behavioral goals and overall higher quality of life [ ] [ ] [ ] . further, empowerment also positively correlates with healthier behaviors and better decisions as well as health and clinical outcomes including improved disease management behaviors, use of health services, and health status [ , ] . the effects of cck on total f&v and total whole grain intake were not statistically significant, but the observed net gain of . cup equivalents, or . servings, in daily f&v intake was similar to other studies of nutrition interventions designed to increase adult f&v intake [ , ] . a systematic review of the literature documented increases of . to . servings of f&v, and when targeting smaller focused communities, increases of . to . were observed [ ] . the cck participants had high baseline dietary intake of f&v at nearly cups per day (exceeding the minimum intake recommended by aicr guidelines). increasing people's intake of nutrients or foods when the baseline intake is already sufficient is expected to be challenging [ ] and might have contributed to our study not observing significant post-interventional dietary changes. as hypothesized, we demonstrated a significant reduction in the consumption of processed meats in the cck intervention group and observed medium to large effect sizes in specific components of total whole grain intake (e.g., cooked grains and bread). these changes, coupled with significant increases in mediators of behavior change (knowledge, confidence and skills) suggests that with longer follow-up, participants are likely to continue making important changes in adopting a plant-based diet. additional investigation in diverse populations and communities whose adherence to the recommended dietary guidelines is low is warranted. there was modest impact on measurements of quality of life (qol) in the current study, and effect sizes were generally small. though not statistically significant, findings were within the range of effect sizes reported in prior research of interventions for cancer patients [ , ] . the data suggested positive trends in qol, reduced fatigue and lower psychological distress at weeks, though these trends did not reach statistical significance and were not sustained by the th week. our limited sample size could be one of the major reasons for not finding statistical significance despite the observed positive trends. likewise, a randomized controlled trial conducted by uster and colleagues reported similar non-significant improvements in qol among palliative cancer patients after nutrition and physical exercise interventions [ ] . living with cancer is undoubtedly stressful and associated with reduced qol. previous research demonstrated as many as % of cancer patients have clinically significant psychiatric comorbidities [ ] [ ] [ ] and one in two reported significant distress [ ] . chronic stress is linked to several biobehavioral mechanisms related to the development of depressive symptoms and poorer cancer prognosis that may discourage people from making positive changes in their lifestyle; these factors may contribute to a vicious cycle of persistent emotional distress and accelerated physical deterioration [ ] . furthermore, it has been indicated that up to % of cancer survivors have never received psychosocial support due to limited access to such programs, suggesting the existence of unaddressed needs in this population [ ] . we chose to measure health-related qol using the fact-g due to its brevity, validity, and reliability for use in cancer patients [ ] . the yanez ( ) study reported a mean score for the fact-g of . among cancer patients and . in a general population sample [ ] . in the current study, we reported an average baseline score of . among participants in the cck intervention group with a one-point increase at weeks post-intervention. the cck intervention has the potential to close the gap between cancer survivors and the general population in health-related quality of life and mental health directly through learning coping strategies to reduce stress and indirectly through improving diet quality [ ] . furthermore, in a naturalistic study, giese-davis et al. showed that csc therapist-led support groups provided an experience in which the development of a new attitude was valued [ ] . this trial was small, and a substantial proportion of participants did not complete the online follow-up survey at weeks. the low rate of response to completing the -week survey may in part be attributed to the online platform, which was a departure from the pen-and-paper format of the previous surveys. retention rates may have been higher if we had disseminated the questionnaire in the same format as the previous and additionally provided an incentive upon completion of the survey, either financial or educational by disseminating preliminary study findings to interested participants. limitations in our dietary measurement methods may also have prevented us from fully uncovering the true effects of cck on dietary intake. the use of -h recall, food records, and objective biomarkers may be more sensitive to changes and warranted in future evaluations of cck, which would allow us to quantify more nuanced changes in dietary intakes, such as replacing processed grains with whole grains rather than an overall increase in whole grains. furthermore, follow-up was short. we recognize that behavioral change and changes in quality of life may take longer than - weeks. we hypothesized that participation in the cck intervention would indirectly influence health-related behaviors through self-efficacy mediators. with more time to practice acquired skills, intake of plant-based foods may continue to increase in the cck intervention arm with longer follow-up. another limitation of the study was that clinical outcomes were only measured through patient-report. we did not include body mass index or percent body fat as outcomes since the cck program was not specifically designed to be a weight loss program. while adopting a healthier diet can result in weight loss or changes to body composition, the goals of cancer survivors can be varied with some aiming to increase body weight and others to lose or maintain weight. as the program is more widely disseminated and administered in academic and clinical settings, there may be increased feasibility and interest in measuring pro-and anti-inflammatory biomarkers (e.g., c-reactive protein, interleukins , , , and , and tumor necrosis factor-α) and plasma concentration of antioxidants. other limitations included self-selected samples of participants who are predominantly female, white, fairly educated, and a substantial proportion of individuals with breast cancer. these limitations impact the study results' generalizability to a more diverse population. however, while this sample is not representative of all cancer patients and survivors across the us [ ] , it is representative of those who tend to seek nutrition education as well as social and emotional support in their community. future work is required to understand the impact that cck has on participants' long-term behavior changes, and to evaluate its applicability and cultural sensitivity among other diverse samples and settings. participation in the in-person cck intervention led to improvements in nutrition and food-related knowledge and skills as well as confidence in adopting a plant-based diet among cancer survivors. as an evidence-based, experiential nutrition education program that embeds psychosocial health elements, cck can serve as the standard for a high-quality community-based survivorship program. further studies and larger-scale implementation of cck in more diverse populations are needed to further understand its effect on health-related behaviors and wellbeing. promoting lifestyle behavioral change through programs like cck has potential and value to improve cancer survivors' nutritional status and quality of life. silver tsunami": prevalence trajectories and comorbidity burden among older cancer survivors in the united states obesity and diabetes: the increased risk of cancer and cancer-related mortality colorectal cancer survivors only marginally change their overall lifestyle in the first years following diagnosis changes in prostate gene expression in men undergoing an intensive nutrition and lifestyle intervention telomerase activity and comprehensive lifestyle changes: a pilot study breast cancer survivorship: a comprehensive review of long-term medical issues and lifestyle recommendations effect of diet on mortality and cancer recurrence among cancer survivors: a systematic review and meta-analysis of cohort studies world cancer research fund/american institute for cancer research. diet, nutrition, physical activity and cancer: a global perspective nutrition and breast cancer: facts and presumptions for consideration adherence to the wcrf/aicr guidelines for cancer prevention is associated with lower mortality among older female cancer survivors adherence to the wcrf/aicr dietary recommendations for cancer prevention and risk of cancer in elderly from europe and the united states: a meta-analysis within the chances project a systematic review and meta-analysis of the wcrf/aicr score in relation to cancer-related health outcomes pre-diagnostic concordance with the wcrf/aicr guidelines and survival in european colorectal cancer patients: a cohort study adherence to multiple health behaviours in cancer survivors: a systematic review and meta-analysis cancer support source (r): validation of a revised multi-dimensional distress screening program for cancer patients and survivors. supportive care cancer discriminatory power of a -item distress screening tool: a cross-sectional survey of cancer survivors. qual need and demand for nutritional counselling and their association with quality of life, nutritional status and eating-related distress among patients with cancer receiving outpatient chemotherapy: a cross-sectional study. supportive care cancer a systematic review of the supportive care needs of people living with and beyond cancer of the colon and/or rectum a qualitative study of cancer survivors' views on diet and cancer and their sources of information a randomized trial of tailoring and motivational interviewing to promote fruit and vegetable consumption for cancer prevention and control riding the crest of the teachable moment: promoting long-term health after the diagnosis of cancer nutrition education: linking research, theory, and practice. asia pac capitalizing on the "teachable moment" to promote healthy dietary changes among cancer survivors: the perspectives of health care providers. supportive care cancer evaluation of a community-based experiential nutrition and cooking education program for cancer survivors self-efficacy: toward a unifying theory of behavioral change the transtheoretical model of health behavior change spotlight on the patient health engagement model (phe model): a psychosocial theory to understand people's meaningful engagement in their own health care the wellness community's integrative model of evidence-based psychosocial programs, services, and interventions the engaged patient: the cancer support community's comprehensive model of psychosocial programs, services and research the rationale and foundations of group psychotherapy for women with metastatic breast cancer how do small groups promote behaviour change? an integrative conceptual review of explanatory mechanisms design of fresh start: a randomized trial of exercise and diet among cancer survivors barriers to following dietary recommendations in type diabetes development and evaluation of the national cancer institute's dietary screener questionnaire scoring algorithms the functional assessment of cancer therapy scale: development and validation of the general measure the fact-g : a rapid version of the functional assessment of cancer therapy-general (fact-g) for monitoring symptoms and concerns in oncology practice and research an ultra-brief screening scale for anxiety and depression: the phq- measurement of fatigue in cancer patients: development and validation of the fatigue symptom inventory assessing social support, companionship, and distress: national institute of health (nih) toolbox adult social relationship scales statistical power analysis for the behavioral sciences quality of life: the assessment, analysis and interpretation of patient helping patients eat better during and beyond cancer treatment facilitators and barriers to adoption of a healthy diet in survivors of colorectal cancer exploring cancer survivors' views of health behaviour change experiential features of culinary nutrition education that drive behavior change: frameworks for research and practice evaluation of a web-based weight loss intervention in overweight cancer survivors aged years and younger long-term diet and biomarker changes after a short-term intervention among hispanic breast cancer survivors: the cocinar para su salud! randomized controlled trial cocinar para su salud! development of a culturally based nutrition education curriculum for hispanic breast cancer survivors using a theory-driven procedural model pilot randomized controlled trial of a home vegetable gardening intervention among older cancer survivors shows feasibility, satisfaction, and promise in improving vegetable and fruit consumption, reassurance of worth, and the trajectory of central adiposity empowerment: an idea whose time has come in diabetes education conceptualising patient empowerment: a mixed methods study agenda for translating physical activity, nutrition, and weight management interventions for cancer survivors into clinical and community practice a meta-analytic review of the relationship of cancer coping selfefficacy with distress and quality of life implementation of a psychoeducational program for cancer survivors and family caregivers at a cancer support community affiliate: a pilot effectiveness study long-term outcomes of the fresh start trial: exploring the role of self-efficacy in cancer survivors' maintenance of dietary practices and physical activity psychometric properties and performance of existing self-efficacy instruments in cancer populations: a systematic review is patient empowerment the key to promote adherence? a systematic review of the relationship between self-efficacy, health locus of control and medication adherence empowering patients through ehealth: a case report of a pan-european poject health policy, reform, governance and law interventions designed to increase adult fruit and vegetable intake can be effective: a systematic review of the literature interpretation of changes in health-related quality of life: the remarkable universality of half a standard deviation the effect of nutrition therapy and exercise on cancer-related fatigue and quality of life in men with prostate cancer: a systematic review effects of nutrition and physical exercise intervention in palliative cancer patients: a randomized controlled trial screening for emotional disorders in patients with cancer using the brief symptom inventory (bsi) and the bsi- versus a standardized psychiatric interview (the world health organization composite international diagnostic interview) twelve-month and lifetime prevalence of mental disorders in cancer patients prevalence of depression, anxiety, and adjustment disorder in oncological, haematological, and palliative-care settings: a meta-analysis of interview-based studies one in two cancer patients is significantly distressed: prevalence and indicators of distress depression in cancer: the many biobehavioral pathways driving tumor progression the cessation of cancer treatment as a crisis. soc work health care a randomised controlled trial of dietary improvement for adults with major depression (the "smiles" trial) illustrating the multi-faceted dimensions of group therapy and support for cancer patients cancer treatment & survivorship: facts & figures key: cord- -ulsz d authors: grabia, monika; markiewicz-Żukowska, renata; puścion-jakubik, anna; bielecka, joanna; nowakowski, patryk; gromkowska-kępka, krystyna; mielcarek, konrad; socha, katarzyna title: the nutritional and health effects of the covid- pandemic on patients with diabetes mellitus date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: ulsz d covid- related restrictions aimed at curbing the spread of the coronavirus result in changes in daily routines and physical activity which can have a negative effect on eating and health habits. the aim of the study was to assess the impact of the covid- pandemic on patients with diabetes and their nutrition and health behaviours. a survey conducted in july included individuals with type (n = ) and (n = ) diabetes mellitus from poland. to assess nutritional and health behaviours, an online questionnaire covering basic information, anthropometric data, and details regarding physical activity, eating, and hygiene habits was used. almost % of all respondents with type and diabetes mellitus (dm) stated that their disease self-management had significantly improved. over % of all participants declared that they had started eating more nutritious and regular meals during the covid- pandemic. enhanced hygiene, in particular, during the period, a statistically significant increase in hand sanitiser use was reported by respondents ( % vs. %, p < . ). the study demonstrated that the pandemic had a significant impact on the behaviour of patients with dm. improved disease self-management and making healthy, informed food and hygiene choices were observed. since the emergence of sars cov- , a new coronavirus known as severe acute respiratory syndrome coronavirus- , at the end of , the related disease called covid- has spread rapidly around the world [ ]. from march , a "cordon sanitaire" was formed around poland and on march the state of epidemic including home confinement was introduced in the country. at the time of writing, the peak number ( ) of daily cases in poland occurred on june . at the time of commencing the study, there had already been , infections and deaths in poland [ ] . from july to july , the period when the survey was conducted, the following regulations were in force in the country: nose-and-mouth coverings in confined public areas; closure of primary and secondary schools, and institutions of higher education; food and drink establishments were operational with enhanced sanitary measures in place (nose-and-mouth coverings required when not at the table, disinfecting tables, keeping a minimum distance of . m between patrons); gyms and swimming pools were reopened on june ; individuals were allowed to socialise indoors in small groups; in most places, access to specialist medical care was provided at outpatient clinics [ ] . diabetes mellitus (dm), a metabolic disorder of various etiologies, is characterised by chronic hyperglycaemia and disturbances in insulin secretion or its activity, or both. type diabetes mellitus (t dm) is an insulin-dependent, multifactorial autoimmune disease which results in degradation of the beta cells of islets of langerhans, which causes impaired insulin production and secretion [ ] . patients with t dm require intensive treatment involving administration of exogenous insulin in the form of multiple daily injections or as continuous subcutaneous infusion of insulin using personal insulin pumps [ ] . type diabetes mellitus (t dm) is described as a condition of insulin resistance with relative insulin deficiency, commonly caused by qualitative and quantitative secretory defects [ ] . initial treatment of this type of diabetes involves administration of medication to achieve glycaemic stability. ultimately, many patients require insulin therapy because of progressive failure of the beta cells and development of complications [ ] . regulations imposed to curb the transmission of covid- are likely to have an impact on daily routines, including exercise and eating habits. for people with diabetes mellitus, exercise is an integral part of their disease management [ , ] . patients may also experience increased mental stress caused by the unpredictability of the situation and as a result of social isolation [ ] . this may lead to excessive consumption of products rich in simple carbohydrates which can alleviate stress, since their ingestion stimulates the production of serotonin and enhances the mood. consuming such products is associated with an increased risk of obesity and complications of covid- [ ] . a lack of physical activity, poor food choices, and heightened psychological stress may have a detrimental effect on the immune system, which may not produce a proper response when exposed to the new virus [ ] . according to a report by the centers for disease control and prevention, individuals with t dm and t dm may be at an increased risk for severe illness from covid- due to susceptibility to lung infection, which is a consequence of dm-related metabolic disturbances and immunosuppression [ , ] . an in vitro study demonstrated that chronic hyperglycaemia changed the innate immune system, thereby acting on chemotaxis, phagocytosis, but also on bactericidal activity of neutrophils and macrophages [ ] . according to the american diabetes association (ada), currently available data regarding covid- is not comprehensive enough to show whether individuals with dm, particularly well-controlled dm, are more prone to developing the disease as compared with the general population. however, if patients are not metabolically balanced, they may experience more considerable blood glucose fluctuations which can cause a number of diabetes-related complications. these complications may make patients with dm more susceptible to contracting covid- and other viral infections due to the body's limited ability to fight them [ ] . the aim of the present study was to assess the impact of the covid- pandemic on the nutritional and health behaviours of patients with dm. the study, which collected data via an online survey, was conducted among polish patients with dm, with a median age of years (lower to upper quartile, - years old) between july and july via private facebook groups of polish diabetes societies. the main study inclusion criterion was completion of the survey section regarding diabetes, which was a prerequisite for completing the remaining sections. responses from individuals residing abroad, women with gestational diabetes, and individuals in quarantine were rejected. each participant was informed of the anonymity and confidentiality of the survey and its purpose. each respondent was allowed to complete the survey only once and exit it at any time, which would result in unsaved responses. participants confirmed their voluntary consent for study participation by completing the survey. they could not provide names and personal data. parents of young children completed the questionnaire on their behalf. the study was conducted in full compliance with national regulations (consent of bioethical commission of the medical university of bialystok no. r-i- / / ) and the declaration of helsinki. the questionnaire (see appendix a) consisted of three sections. the first section contained questions regarding type of diabetes mellitus the participant suffered from, their gender, age, body height and weight, level of education and place of residence. anthropometric measurements were self-reported. the body mass index (bmi) is a measure used to determine nutritional status. it was calculated using the following formula: body weight in kg divided by height in meters squared. in paediatric patients (under years of age), bmi was interpreted in relation to norms contained in clinical growth charts. the th, th, and th centiles correspond to the limits of underweight, overweight, and obesity, respectively [ ] . for adults, the following who approved standards were applied: underweight (below . kg/m ), normal ( . - . kg/m ), overweight ( . - . kg/m ) and obese (above . kg/m ) [ ] . the second section contained questions relating to disease duration, type of treatment received, and result of the hba c test performed within three months of questionnaire completion. the last section contained questions regarding physical activity, eating behaviours, and hygiene habits such as stress level, daily screen time, and sleep routine. as for physical activity, respondents could indicate whether and how the type of activity they participated in had changed. the activities included dancing, fitness, swimming, running, gym, cycling, gymnastics, and walking. the frequency of exercise sessions could be described by respondents as "i don't exercise", " - times per week", " - times per week", " and more times per week". assessment of changes in eating habits was based on the consumption of the following products: coffee, convenience food, dairy products, delivery meals, eggs, energy drinks, fresh bread, fresh fish, fresh vegetables, frozen fish, grain products, homemade bread, nuts, red meat, salty snacks, sweet beverages, sweet snacks, water, and white meat. as for hand washing and sanitiser use, the respondents could indicate the following situations: "after coming home", "after using the toilet", "before cooking", "after contact with animals", "after leaving public transport", and "after leaving shops". the number of hours the respondents spent sleeping fell into the following categories: "under - h", " - h", or "over h". as for time spent in front of the computer or tv, the respondents could select from the following: "less than h a day", " - h a day", " - h a day", or " or more hours a day". stress levels could be classified as follows: "low", "medium", "high", and "very high". the questionnaire was based on previously published work of other authors with modifications reflecting the situation under investigation and study cohort [ , ] . furthermore, questionnaires originally published in foreign languages were translated into polish and assessed by a polish native speaker to exclude bias in interpretation. the questionnaire was pretested on a small sample of respondents from the target population to allow for subsequent eradication of formal and substantive errors. statistical analysis was performed using statistica software (version ; statsoft inc., krakow, poland). normal distribution of the studied variables was checked using the shapiro-wilk test. the mann-whitney u test was used when data was not symmetrically distributed. relationships between qualitative features (e.g., periods before and during the covid- pandemic) were evaluated using the chi-square independence test. in justified cases, yates' correction was used. prior to conducting the survey, a minimum sample size was calculated, which was used for estimating of the number of people who should be tested in order for intended results to be obtained with a specified confidence level (α = . ) and a maximum error ( %). the p-value < . was considered to be statistically significant. due to the possibility of confounding between variables, additional characteristics of the results for all items in which it occurred were included in the supplementary material. the results section contains outcomes relating to all study participants (adults and children together). due to the fact that / of respondents with t dm were children, we presented the results obtained in this group of patients in a separate subsection. the outcomes obtained, after the exclusion of children under years of age from the study group, were consistent with the results for the entire study cohort. characteristics of the study cohort are presented in table . the majority of respondents were individuals with type diabetes mellitus ( %) and women ( %). among survey participants, % of patients with t dm used personal insulin pumps, while % used insulin pens. as for patients with t dm, % used insulin pens and % oral drugs. none of the participants reported simultaneous use of insulin injections and oral medication. among the completed questionnaires, % were filled in by parents of children with t dm. a normal bmi was observed in % of the study cohort, overweight in %, obesity in %, and underweight in %. the majority of study participants ( %) had a university degree, % of respondents were unemployed, % worked in the office, % worked from home, and the remainder were students ( %). there were no participants who were quarantined prior to questionnaire completion. over half ( %) of the respondents lived with their parents, % lived with a partner, and the remaining % resided alone. the study participants were asked if their disease self-management had improved during the covid- pandemic. among the participants, % individuals with t dm declared that their disease control had deteriorated, % stated that it had improved, while % did not report any changes. as for body weight, % of study participants reported an increase in body weight during the pandemic, % reported an increase of ≤ kg, and % reported > kg. only % of patients with dm stated that their body weight did not change. the remaining % of patients reduced their body weight, % by ≤ kg and % by > kg. prior to the covid- pandemic, % of study participants did not engage in any physical activity, % participated in physical activity - times a week, % - times a week, and % over times a week as compared with the period during the pandemic ( %, %, %, and %, respectively). there were statistically (p < . ) significant differences among the above variables (see table ). figure shows the type of physical activity chosen before and during the covid- pandemic. a statistically significant increase in walking was demonstrated ( % vs. %, p < . ) while a statistically significant decrease in participation in gymnastics, swimming, and dancing (p < . each), gym and fitness classes (p < . each) was observed. additional characteristics between type of disease and gender are presented in supplementary table s ). nutrients , , x for peer review of abbreviations: type diabetes mellitus (t dm), type diabetes mellitus (t dm). differences between "before" and "during" the covid- period were evaluated by the chi-square test (* p < . ). differences between the type of physical activity "before" and "during" the covid- pandemic. differences between "before" and "during" the covid- pandemic were evaluated by the chi-square test (* p < . and ** p < . ). when asked if they started eating more healthily during the pandemic, % of respondents declared improvements in their dietary habits. survey results demonstrated that % of respondents had started eating more regular meals, in particular main meals. the same total percentage of the study cohort declared that they had started preparing their own meals (see supplementary table s ). differences between the type of physical activity "before" and "during" the covid- pandemic. differences between "before" and "during" the covid- pandemic were evaluated by the chi-square test (* p < . and ** p < . ). ( ) % ( ) % ( ) % ( ) city (≥ k inhabitants) % ( ) % ( ) % ( ) % ( ) % ( ) % ( ) up to years % ( ) % ( ) % ( ) % ( ) % ( ) % ( ) hba c (%) d . ( . - . ) . ( . - . ) . ( . - . ) values are expressed as median, lower, and upper quartile (me (q -q )) or percentage and number of respondents (% (n)). abbreviations: type diabetes mellitus (t dm), type diabetes mellitus (t dm). differences between "before" and "during" the covid- period were evaluated by the chi-square test (* p < . ). when asked if they started eating more healthily during the pandemic, % of respondents declared improvements in their dietary habits. survey results demonstrated that % of respondents had started eating more regular meals, in particular main meals. the same total percentage of the study cohort declared that they had started preparing their own meals (see supplementary table s ). the results revealed that % of respondents consumed one to two meals per day before the pandemic as compared with % during the pandemic, % vs. % consumed three to four meals a day, and % vs. % had more than five meals a day. no statistical significance was demonstrated between the pre-covid- period and the period during the pandemic for any of the above variables, in any of the study participants. more than % of respondents admitted that frequency of snacking between meals increased during the pandemic. consumption of selected food products during the covid- pandemic is presented in figure and the breakdown by the type of diabetes and gender is included in supplementary table s . the most marked increase in intake was revealed for the following products: water ( %), fresh fruit ( %), vegetables ( %), and grain products ( %). the most substantial decrease in consumption was recorded for the following products: fast food ( %), convenience food ( %), salty snacks ( %), delivery meals ( %), red meat ( %), and sweet snacks ( %). nutrients , , x for peer review of ( %), vegetables ( %), and grain products ( %). the most substantial decrease in consumption was recorded for the following products: fast food ( %), convenience food ( %), salty snacks ( %), delivery meals ( %), red meat ( %), and sweet snacks ( %). the study revealed a statistically significant increase in hand sanitiser use during the covid- pandemic (p < . ). prior to the pandemic, % of study participants never used hand sanitisers, % used them sometimes, while % used them very often. use of sanitising solutions increased during the study revealed a statistically significant increase in hand sanitiser use during the covid- pandemic (p < . ). prior to the pandemic, % of study participants never used hand sanitisers, % used them sometimes, while % used them very often. use of sanitising solutions increased during the pandemic, i.e., % of respondents declared that they used them very often, while % reported using them sometimes. a statistically significant relationship between frequent hand washing/antibacterial agent use before and during the covid- pandemic was found (figure ). the biggest, statistically significant differences were observed in hand washing after leaving shops ( % vs. %, p < . ), public transport ( % vs. %, p < . ), and after returning home ( % vs. %, p < . ). additional characteristics regarding the type of disease and gender are presented in supplementary table s ). nutrients , , x for peer review of figure . frequency of hand washing/antibacterial agent use before and during the covid- pandemic. differences between "before" and "during" the covid- period were evaluated by the chi-square test (* p < . ). a statistically (p < . ) significant dependence between the period before the start of the covid- pandemic and the time during the pandemic was demonstrated in the number of hours spent in front of the tv or computer. prior to home confinement caused by covid- , only % of study participants spent more than h per day in front of the tv or computer, while % spent - h, % spent - h, and the remainder ( %) had less than h of screen time (during the pandemic it was %, %, %, and %, respectively). the dependence between the period before the covid- pandemic and that during the pandemic, and the number of hours of sleep was also statistically significant (p < . ), i.e., % of respondents declared sleeping more than h per day prior to the pandemic, with the figure reaching % during the pandemic. the percentage of study participants sleeping less than the recommended number of hours decreased, i.e., % vs. % of respondents slept between and h per day, and % vs. % slept less than h per day. statistically significant (p < . ) differences were observed in stress levels before, at the beginning of the covid- pandemic, and at the time of completing the questionnaire. average stress levels increased at the start of the pandemic and returned to nearly pre-pandemic levels at the time of survey completion, as shown in figure . detailed characteristics of the above variables (screen time, sleep routine, and stress levels) in relation to the type of diabetes and gender are presented in supplementary tables s -s . differences between "before" and "during" the covid- period were evaluated by the chi-square test (* p < . ). a statistically (p < . ) significant dependence between the period before the start of the covid- pandemic and the time during the pandemic was demonstrated in the number of hours spent in front of the tv or computer. prior to home confinement caused by covid- , only % of study participants spent more than h per day in front of the tv or computer, while % spent - h, % spent - h, and the remainder ( %) had less than h of screen time (during the pandemic it was %, %, %, and %, respectively). the dependence between the period before the covid- pandemic and that during the pandemic, and the number of hours of sleep was also statistically significant (p < . ), i.e., % of respondents declared sleeping more than h per day prior to the pandemic, with the figure reaching % during the pandemic. the percentage of study participants sleeping less than the recommended number of hours decreased, i.e., % vs. % of respondents slept between and h per day, and % vs. % slept less than h per day. statistically significant (p < . ) differences were observed in stress levels before, at the beginning of the covid- pandemic, and at the time of completing the questionnaire. average stress levels increased at the start of the pandemic and returned to nearly pre-pandemic levels at the time of survey completion, as shown in figure . detailed characteristics of the above variables (screen time, sleep routine, and stress levels) in relation to the type of diabetes and gender are presented in supplementary tables s -s . in children under years of age (n = ), statistically significant (p < . ) differences were found between the frequency of physical activity before and during the pandemic (see supplementary table s ). the percentage of young respondents who practiced gymnastics ( % vs. %, p < . ), swimming ( % vs. %, p < . ), and running ( % vs. %, p > . ) decreased. however, participation in walking ( % vs. %, p < . ) and cycling ( % vs. %, p > . ) increased. prior to the pandemic, over % of surveyed children consumed one to two meals per day while the remainder had five or more meals. during the covid- pandemic, more than % of respondents consumed three to four meals, % had five or more meals while fewer than % reported having one to two meals per day. survey results demonstrated a statistically significant relationship between the number of meals consumed per day before the pandemic and the number of meals eaten during the pandemic (p < . ) (see supplementary table s ) . study results revealed several improvements in dietary habits of the youngest respondents during the pandemic (see supplementary table s ). over % of children reported drinking increased amounts of water during the pandemic, whereas % declared that their intake of grain products, fresh bread, fruit, and vegetables had increased. additionally, % of all respondents reported a higher intake of dairy products, while % declared increased consumption of eggs. it is worth noting that the intake of fresh fish also grew, i.e., % of children reported increased consumption. additionally, decreased consumption of red meat, fast food, and snacks (both salty and sweet) was observed. a statistically significant increase in hand sanitiser use by the youngest respondents during the covid- pandemic (p < . ) was observed. prior to the pandemic, % of all study participants never used hand sanitisers, % used them sometimes, while % used them very often. use of sanitising solutions increased during the pandemic, i.e., % of all respondents declared that they used them very often while % reported using them sometimes. a statistically significant relationship between frequent hand washing/antibacterial agent use before and during the covid- pandemic was found (see supplementary table s ). the biggest statistically significant differences were observed in hand washing after leaving shops ( % vs. %, p < . ) and public transport ( % vs. %, p < . ). statistically significant differences were found when screen time of the youngest respondents was analysed (p < . . survey results demonstrated that prior to the pandemic, the majority of in children under years of age (n = ), statistically significant (p < . ) differences were found between the frequency of physical activity before and during the pandemic (see supplementary table s ). the percentage of young respondents who practiced gymnastics ( % vs. %, p < . ), swimming ( % vs. %, p < . ), and running ( % vs. %, p > . ) decreased. however, participation in walking ( % vs. %, p < . ) and cycling ( % vs. %, p > . ) increased. prior to the pandemic, over % of surveyed children consumed one to two meals per day while the remainder had five or more meals. during the covid- pandemic, more than % of respondents consumed three to four meals, % had five or more meals while fewer than % reported having one to two meals per day. survey results demonstrated a statistically significant relationship between the number of meals consumed per day before the pandemic and the number of meals eaten during the pandemic (p < . ) (see supplementary table s ) . study results revealed several improvements in dietary habits of the youngest respondents during the pandemic (see supplementary table s ). over % of children reported drinking increased amounts of water during the pandemic, whereas % declared that their intake of grain products, fresh bread, fruit, and vegetables had increased. additionally, % of all respondents reported a higher intake of dairy products, while % declared increased consumption of eggs. it is worth noting that the intake of fresh fish also grew, i.e., % of children reported increased consumption. additionally, decreased consumption of red meat, fast food, and snacks (both salty and sweet) was observed. a statistically significant increase in hand sanitiser use by the youngest respondents during the covid- pandemic (p < . ) was observed. prior to the pandemic, % of all study participants never used hand sanitisers, % used them sometimes, while % used them very often. use of sanitising solutions increased during the pandemic, i.e., % of all respondents declared that they used them very often while % reported using them sometimes. a statistically significant relationship between frequent hand washing/antibacterial agent use before and during the covid- pandemic was found (see supplementary table s ). the biggest statistically significant differences were observed in hand washing after leaving shops ( % vs. %, p < . ) and public transport ( % vs. %, p < . ). statistically significant differences were found when screen time of the youngest respondents was analysed (p < . . survey results demonstrated that prior to the pandemic, the majority of young respondents ( %) spent - h a day in front of the tv or computer, almost one fifth had less than h of screen time a day, whereas only % spent or more hours watching tv or using electronic devices. during the covid- pandemic, all respondents declared spending more than h a day in front of the tv or computer, % - h, % - h, and % more than h. there was a statistically significant (p < . ) increase in the number of hours devoted to sleep, i.e., % of children slept for up to h and % for more than h per day before the covid- pandemic as opposed to % and %, respectively, during the pandemic. survey results revealed that prior to the pandemic, more than one third of the youngest respondents suffered moderate or high levels of stress. at the start of the pandemic, the majority of participants experienced moderate levels of stress, while over % suffered high stress levels. at the time of questionnaire completion, fewer than % of all respondents declared suffering very high levels of stress and over % of all children evaluated their stress levels as low. comparison of periods before, at the beginning of the covid- pandemic, and the time of completing the questionnaire revealed statistically significant (p < . ) relationships (see supplementary table s ). the present study demonstrated that the pandemic had a significant impact on the nutritional and health behaviour of patients with dm. frequency of the consumption of both recommended and non-recommended products changed. the covid- pandemic also contributed to more frequent hand washing and increased use of antibacterial agents. due to limited access to medical care, some patients with dm may have experienced difficulty managing their disease. however, the study showed that the majority of respondents were metabolically balanced (median of hba c . % to . %). only % felt that they were less able to control their disease. it is worth noting that % of all surveyed patients started to monitor their disease more rigorously and over % improved their diet by eating more regular, nutrient-dense meals. a negative effect of the covid- pandemic and related government-imposed restrictions on movement was limited outdoor activity. as compared with the pre-covid- period, the study demonstrated an increase in the percentage of individuals not practicing any physical activity ( % vs. %) and those exercising one to two times per week ( % vs. %). the number of people who took up walking increased one and a half times ( % vs. %). this can probably be explained by the fact that from april , residents of poland were allowed to leave home only in the following circumstances: commuting to and from work, voluntary involvement in the fight against the covid- pandemic, and to address matters necessary for everyday living. outdoor activity was to be kept to a minimum with only walks allowed, as public parks, boulevards and playgrounds were closed. at the time the survey was conducted, the gradual process of relaxing restrictions started. swimming pools and gyms re-opened a month before the commencement of the study but were not extensively patronised [ ] . when the results of our investigation were compared with those of an italian study by renzo et al., a similar decrease in the frequency (three to four times per week) of physical activity before and during the lockdown in italy was noted ( . % vs. . %, our study % vs. %). the authors also observed a decline in interest in sports such as fitness classes, running, and gym workout [ ] . nachimuthu et al. published a brief survey conducted among indian patients with dm which revealed that % of respondents monitored their diet regularly and engaged in physical activity at home [ ] . the present study revealed that the percentage of individuals consuming five or more meals increased during the covid- pandemic ( % vs. %). an increase in the number of meals consumed ( % vs. %) was also observed by ammar et al. who investigated eating habits of healthy people in different countries [ ] . the results obtained by scarmozzino also confirmed that home confinement caused by covid- resulted in increased food consumption for around % of respondents [ ] . the problem with body weight management experienced by almost % of participants of our study may have been caused by a higher number of meals consumed per day, and thus increased calorie intake. a polish study, conducted during the lockdown, found that individuals with a higher bmi, particularly obese people, were at a heightened risk of adverse dietary changes (increased food consumption and snacking) [ ] . a study by renzo et al. investigated whether there were differences in the consumption of selected products among italians. as in our study, they observed an increase in the consumption of certain foods such as grain products, hot beverages, eggs, dairy products, fresh bread, white meat, and fresh vegetables [ ] . scarmozzino also observed an increase in consumption of fresh vegetables [ ] . several eating patterns emerged among the youngest participants of our study. on the one hand, over % of the surveyed children declared drinking increased amounts of water and nearly half reported that their consumption of grain products, dairy products, fruit, and vegetables had increased. almost a third of the surveyed children declared a higher consumption of fresh fish. on the other hand, decreased consumption of red meat, fast food, as well as snacks (both salty and sweet) was also reported. white meat and dairy products are beneficial foods which contribute to the prevention of t dm [ , ] . increased consumption of fruits and vegetables is associated with a reduced risk of t dm not only because they contain dietary fibre, essential vitamins and minerals, but also due to the antioxidant and anti-inflammatory effects of their components which include vitamins b and c, carotenoids, and polyphenols [ , ] . similar to the results of our study, a decrease in the consumption of salty snacks, sweet beverages, and delivery food was observed in an italian survey [ ] . a high intake of such products may contribute to unstable diabetes. in patients with dm, a high salt intake may carry a risk of microalbuminuria, particularly in overweight individuals. sodium retention and blood volume in dm can cause the progression of diabetic microangiopathy [ , ] . excessive sugar consumption may accelerate the development of t dm and sugar-sweetened drinks (ssbs) can be particularly harmful to children genetically predisposed to t dm [ ] . high consumption of fructose, ssbs, and high-fructose corn syrup contributes to an epidemic of insulin resistance, visceral obesity, and t dm [ , ] . bleich and wang studied consumption patterns of sugar-sweetened beverages among adult americans with t dm. they observed high consumption of these products in young adults and in low-income individuals [ ] . the glycated haemoglobin (hba c) reflects mean glycaemia over the period of approximately three months and is a useful retrospective marker of blood glucose levels as there is an association between blood glucose levels and mean glycaemia, and the risk of developing chronic diabetic complications [ ] . a healthy lifestyle involving consumption of regular, nutrient-dense meals prepared at home with quality ingredients brings many beneficial effects, in particular a reduction in hba c level. poor metabolic control is associated with frequent dining out, particularly in fast food establishments, and consumption of high-fat products and snacks between meals [ , ] . our study demonstrated a statistically significant increase in the use of sanitising agents and frequency of hand washing, particularly after coming home and leaving shops or public transport. however, a surprising finding of the study was that the percentage of people sanitising their hands before preparing food decreased. this can be explained by the fact that sanitising solutions are provided at shop entrances and their use is monitored, whereas being home gave individuals a sense of security, and therefore the need for using an antibacterial agent was removed. mental stress activates neuroendocrine processes that affect blood glucose levels by releasing cortisol, endorphins, and growth hormone [ ] . this is of adaptive importance for a healthy body but in patients with dm, post-stress hyperglycaemia can exacerbate the disease. moreover, negative emotions can reduce motivation to adhere to the prescribed treatment and to follow dietary recommendations, which can contribute to poor glycaemic control and increase susceptibility to infections [ ] [ ] [ ] . the results of our study revealed that at the beginning of the covid- pandemic, stress levels in patients with dm increased sharply (high % vs. %, very high % vs. %). at the time the survey was conducted, stress levels were starting to return to pre-pandemic levels. this may have been related to an increase in respondents' awareness that taking care of their health helps to strengthen the immune system through proper nutrition and compliance with hygiene rules. our study has several limitations. the study was retrospective and allowed us to only estimate the impact of the covid- pandemic, some respondents could not fully or accurately recall information they were required to provide. body weight and height were not measured by a qualified individual, they were self-reported and may not have been accurate. the male subgroup was not sufficiently representative, although it is a common problem in voluntary research. this study was conducted among the inhabitants of one country (poland). performing such a study on populations of other countries would allow for a more comprehensive understanding of eating habits and hygiene behaviours of patients with dm. another limitation was the fact that changes in eating habits were estimated and not correlated with data regarding the sale of particular product groups. the study could only collect data via an online questionnaire since no unauthorised persons were allowed to enter healthcare facilities due to pandemic-related restrictions. the aim of the investigation was to describe eating and health habits that occurred during the covid- pandemic, and therefore these results should not be interpreted in the context of long-term effects. despite the fact that the sample size was small (n = ), the power of the test reached %, with a confidence level (α = . ). to our knowledge, this is the first nutritional behaviour study conducted among patients with dm during the covid- pandemic. a significant effect of the pandemic on the behaviour of patients with dm was observed. the surveyed patients reported improved disease self-management and making healthy, informed food choices and hygiene habits. the success of nutritional therapy in patients with dm depends on the selection of appropriate food products by individuals, and therefore short reports in the form of questionnaires regarding patients' nutritional behaviours and their adherence to the recommended dietary regimen should be part of routine nutritional assessment performed by healthcare providers. the results reported in the present study should be used to promote public health during the covid- pandemic. supplementary materials: the following are available online at http://www.mdpi.com/ - / / / /s , table s : characteristics of the subgroups, type of physical activity before and during the covid- pandemic, table s : characteristics of the subgroups, healthy/regularity of meal consumption during the covid- pandemic, table s : characteristics of the subgroups, variation in food intake during the covid- pandemic, table s : characteristics of the subgroups, frequency of hand washing/antibacterial agent use before and during the covid- pandemic, table s : characteristics of the subgroups, duration of screen time before and during the covid- pandemic, table s : table s . characteristics of the subgroups, sleep length before and during the covid- pandemic, table s : characteristics of the subgroups, stress level distribution before, at the beginning of the pandemic and at the time of survey completion, table s : frequency of physical activity before and during the covid- pandemic in children population, table s : number of meals per day in children before and during the covid- pandemic, table s : variation in food intake during the covid- pandemic in children population, table s : frequency of hand washing/antibacterial agent use before and during the covid- pandemic in children population, table s : stress level distribution before, at the beginning of the pandemic and at the time of survey completion in children population. main meals/yes, most meals q have you started cooking more meals yourself? no/yes q has the frequency of eating certain foods changed during the pandemic? i eat more often/ i eat less often/ no change/ i don'tever eatthese products • salty snacks (crisps, crackers, bread sticks, etc.) • sweet snacks (cakes, cookies, chocolate bars) meat (beef, pork) • white meat (chicken, turkey) • fresh fish • frozen fish • eggs • dairy products (milk, yoghurt, cottage cheese) products (rice, pasta etc epidemiological and clinical characteristics of cases of novel coronavirus pneumonia in wuhan, china: a descriptive study coronavirus outbreak map (sars-cov- ) polish ministry of health. current rules and restrictions definition, diagnosis and classification of diabetes mellitus and its complications. part : diagnosis and classification of diabetes mellitus. provisional report of a who consultation natural history, and prognosis diabetes in covid- : prevalence, pathophysiology, prognosis and practical considerations physical activity/exercise and diabetes: a position statement of the american diabetes association eating habits and lifestyle changes during covid- lockdown: an italian survey relationship between diabetes and respiratory diseases-clinical and therapeutic aspects neutrophil and lymphocyte function in patients with diabetes mellitus how covid- impacts people with diabetes the height-, weight-, and bmi-for-age of polish school-aged children and adolescents relative to international and local growth references obesity: preventing and managing the global epidemic effects of covid- home confinement on eating behaviour and physical activity: results of the eclb-covid international online survey coping with diabetes during the covid - lockdown in india: results of an online pilot survey covid- and the subsequent lockdown modified dietary habits of almost half the population in an italian sample dietary choices and habits during covid- lockdown: experience from poland dietary protein consumption and the risk of type diabetes: a dose-response meta-analysis of prospective studies meat consumption, diabetes, and its complications effect of increasing fruit and vegetable intake by dietary intervention on nutritional biomarkers and attitudes to dietary change: a randomised trial fruit and vegetable intake and type diabetes: epic-interact prospective study and meta-analysis the twin white herrings: salt and sugar +sugar intake is associated with progression from islet autoimmunity to type diabetes: the diabetes autoimmunity study in the young consumption of sugar-sweetened beverages is associated with components of the metabolic syndrome in adolescents consumption of sugar-sweetened beverages among adults with type diabetes use of glycated haemoglobin (hba c) in the diagnosis of diabetes mellitus: abbreviated report of a who consultation eating behavior among type diabetic patients: a poorly recognized aspect in a poorly controlled disease food habits are related to glycemic control among people with type diabetes mellitus the relationship between stress and diabetes mellitus empirically derived patterns of perceived stress among youth with type diabetes and relationships to metabolic control disease-related distress, self-care and clinical outcomes among low-income patients with diabetes this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license the authors thank the participants of the study. the authors declare no conflict of interest. key: cord- -tyabf r authors: greiller, claire l.; martineau, adrian r. title: modulation of the immune response to respiratory viruses by vitamin d date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: tyabf r background: vitamin d deficiency has been shown to be independently associated with increased risk of viral acute respiratory infection (ari) in a number of observational studies, and meta-analysis of clinical trials of vitamin d supplementation for prevention of ari has demonstrated protective effects. several cellular studies have investigated the effects of vitamin d metabolites on immune responses to respiratory viruses, but syntheses of these reports are lacking. scope: in this article, we review the literature reporting results of in vitro experiments investigating immunomodulatory actions of vitamin d metabolites in human respiratory epithelial cells infected with respiratory viruses. key findings: vitamin d metabolites do not consistently influence replication or clearance of rhinovirus, respiratory syncytial virus (rsv) or influenza a virus in human respiratory epithelial cell culture, although they do modulate expression and secretion of type interferon, chemokines including cxcl and cxcl and pro-inflammatory cytokines, such as tnf and il- . future research: more studies are needed to clarify the effects of vitamin d metabolites on respiratory virus-induced expression of cell surface markers mediating viral entry and bacterial adhesion to respiratory epithelial cells. viral acute respiratory infections (ari) are a leading cause of morbidity and mortality worldwide, and, as such, are a major global health problem. they are also responsible for a huge economic burden, precipitating considerable absence from work and school, and large numbers of visits to clinicians. the viral pathogens most commonly associated with acute respiratory infections are picornaviruses (including the species rhinovirus (rv) a, rvb, rvc and the enteroviruses a-d), orthomyxoviruses (influenza a, influenza b and influenza c), paramyxoviruses (including the parainfluenza viruses (piv) - , respiratory syncytial virus (rsv) and human metapneumovirus (hmpv)), coronaviruses, adenoviruses and human bocavirus (hbov) [ ] [ ] [ ] [ ] [ ] . the only routinely administered vaccine for a viral respiratory pathogen in the uk is against seasonal influenza: this is not % effective and may offer varying levels of protection against influenza infection in different seasons and different age groups [ ] . the availability of effective antiviral drugs is also limited, with the effectiveness of approved influenza treatments, such as oseltamivir (tamiflu), debated [ ] [ ] [ ] , and no clinical treatments for common respiratory viruses such as rhinoviruses. new agents to prevent and treat viral respiratory infection are needed: the who initiative brave (battle against respiratory viruses) has recently been established to aid in the goal of developing new pharmacologic interventions to prevent and treat respiratory viruses [ ] . vitamin d is an immunomodulatory micronutrient [ , ] . as reviewed elsewhere [ ] , a number of observational studies have been carried out to determine the relationship between vitamin d status and acute respiratory viral infections, with the majority demonstrating independent associations between low vitamin d status and increased risk of acute viral respiratory infections. clinical trials of vitamin d supplementation for the prevention of ari have yielded heterogeneous results [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] , with meta-analysis reporting moderate protective effects overall [ ] . a number of in vitro studies have investigated the effects of vitamin d metabolites on host immune responses to respiratory viruses, but recent syntheses of this literature are lacking. in order to review these studies the pubmed database was searched using the terms "vitamin d" with the following respiratory viruses (rhinovirus, rsv, influenza, parainfluenza, human metapneumovirus, coronavirus, adenovirus, enterovirus and human bocavirus) to ensure a systematic review of the available literature. inclusion criteria were studies which provided in vitro evidence as opposed to solely clinical studies, the availability of the full text, and for virus genera, such as enterovirus, which can infect multiple sites, the use of species or serotypes specifically associated with respiratory disease. when a respiratory virus is inhaled it first binds to non-specific receptors on the respiratory epithelium, usually glycolipids or glycoproteins such as intercellular adhesion molecule (icam)- . membrane fusion or endocytosis follows, thus internalizing the virus and enabling subsequent replication, transcription and translation of new viruses which can then be released to infect new cells. however, once a cell has been infected, pathogen-associated molecular patterns (pamps) on the virus can be recognised by various intracellular innate pathogen recognition receptors (prrs) such as the toll-like receptors (tlrs), retinoic-acid-inducible gene-i (rig-i)-like receptors (rlrs) and nucleotide binding-oligomerisation domain (nod)-like receptors (nlrs). pulmonary epithelial cells have been shown to express all of the known human tlrs and rlrs which detect viruses, and ligands for these prrs activate epithelial cells in order to initiate a rapid immune response against viral invasion [ ] . in addition to direct infection of epithelial cells, intraepithelial dendritic cells (dcs), dcs residing just below the respiratory epithelium, and tissue-resident macrophages continually sample particles in the airway lumen and can internalize them by phagocytosis and macropinocytosis, thus activating prrs and initiating an immune response [ , ] . the intracellular tlrs , , and are mainly located on the endoplasmic reticulum (er) membrane before unc b -dependent (an er multi-transmembrane-domain-containing protein) trafficking to the endolysosome following viral infection [ , ] . these nucleic acid-sensing tlrs recognise single-stranded rna (tlr / ) or unmethylated cpg double-stranded dna motifs (tlr ) of the viral genome, or the intermediary double-stranded rna (tlr ) produced during viral replication [ ] [ ] [ ] [ ] . additionally, tlr and tlr receptor complexes are able to traffic to the endolysosome and may play a role in viral recognition [ ] [ ] [ ] [ ] [ ] . viruses which avoid recognition by tlrs, can be recognised by rlrs which are present throughout the cytosol, with rig-i important in the immune response to many rna viruses [ ] , and melanoma differentiation-associated gene (mda ) crucial in the recognition of picornaviruses [ ] . additionally, the cytosolic nlr nod , whilst normally associated with the recognition of bacterial muramyl dipeptide, has also been demonstrated to be involved in the recognition of the ssrna genome of rsv [ ] . despite differences in viral genomes, replication strategies, and the types of prrs activated, common signalling pathways are utilized. thus recognition of viral pathogens elicit conserved outcomes, with the interferon regulatory factor (irf)-mediated production of type i ifns a central feature, along with nuclear factor kappa b (nf-κb)-and mitogen-activated protein kinase (mapk)-mediated regulation of various inflammatory cytokines [ , ] (figure ). upon pamp-prr interaction and the activation of signalling transduction pathways, the type i ifns (ifn-α and ifn-β) are some of the earliest cytokines to be produced. their transcription and subsequent binding to the ifn receptor induces expression of a variety of interferon-stimulated genes (isgs), with their products altering antiviral and immunomodulatory actions to limit and clear infection [ ] . features of the induced anti-viral state include resistance to viral replication in all cells, induction of apoptotic cell death in infected cells, increased major histocompatibility complex (mhc) class i expression to enhance antigen presentation, activation of dendritic cells (dcs) and macrophages, and stimulation of natural killer (nk) cells to enhance their cytolytic activity [ ] . the inflammatory cytokines tnf-α, il- β, il- and il- are also produced at an early stage of the innate immune response. these cytokines promote leukocyte extravasation by increasing endothelial expression of adhesion molecules, such as icam- and vcam- , increase vascular permeability, induce synthesis of acute phase proteins, and contribute to recruitment and activation of cells of the adaptive immune response. additionally, il- β and tnf-α amplify the inflammatory response by triggering further nf-κb and mapk activation [ ] . pathogen recognition receptor signalling following viral infection. ligand-induced dimerisation occurs following pamp recognition by endosomal tlrs, which engages the toll-il- receptor (tir) domains to initiate adaptor molecule recruitment and signal transduction. myd -dependent signalling results in the formation of an irak/traf complex, which phosphorylates irf to initiate transcription of type i ifn genes, and activates a tak /tab / complex to drive transcription of pro-inflammatory cytokine genes via activation of nf-κb, ap and creb. trif-dependent signalling can also activate nf-κb, ap- and creb via recruitment of traf and rip . alternatively, traf is recruited, resulting in phosphorylation of irf which translocates into the nucleus to induce expression of type i ifns. rig-i and mda are also able to activate nf-κb and irf via interaction with ips- localized on the mitochondrial membrane through homophilic interactions between their card domains. similarly, card domains of nod also interact with ips- resulting in transcription of type i ifn genes. the type i ifns produced bind to their receptor, and, via stat-mediating signalling, initiate gene transcription. innate prr signalling also results in the production of the chemokines cxcl , cxcl , cxcl and il- which facilitate recruitment of neutrophils and nk cells, respectively [ , ] . while neutrophils and macrophages have well-defined roles in bacterial innate immunity, their function in antiviral immunity is less clear and is likely to be minimal, with inhibition of neutrophil recruitment to the lung demonstrated to have no effect on the course of influenza infection [ ] , and the antigen presenting capacity of macrophages in the respiratory tract demonstrated to be limited [ , ] . the antimicrobial peptide ll- , which is produced by both neutrophils and macrophages, is traditionally viewed as a component of the immune response to bacteria. however, anti-viral activity of ll- has also been demonstrated against both enveloped and non-enveloped viruses, including influenza virus and rsv [ ] . it has been shown to disrupt the membrane of influenza virus [ ] , modify cytokine production [ ] , enhance tlr signalling [ ] , and have direct effects on rsv viral particles and infected epithelial cells, with diminished spread of infection and inhibited production of new virus particles [ ] . macrophages may also have a critical role in the resolution of inflammation and clearance of infection to prevent immunopathology. they are able to phagocytose infected cells and apoptotic cellular debris, which, if left in the lumen, can release chemokines, such as cxcl and cxcl , resulting in recruitment of inflammatory cells and increased bystander tissue damage. in the absence of alveolar macrophages, or when macrophages have impaired function, airway occlusion can occur following rsv infection due to the accumulation of inflammatory cells, virus-infected cells, apoptotic debris and serum proteins, resulting in severe and potentially fatal bronchiolitis [ ] . similarly, following influenza infection in mice devoid of alveolar macrophages, pulmonary alveolar proteinosis (pap) was demonstrated owing to the accumulation of surfactant material and a failure in efferocytosis, causing impaired gas exchange and fatal hypoxia [ ] . therefore, macrophages appear to have a vital role in the antiviral immune response, by producing antimicrobial peptides during the innate response, and phagocytosing dead cells and cellular debris to prevent immunopathology. prr signalling facilitates the maturation and trafficking of dendritic cells, with the release of the chemokines ccl and ccl , and increased expression of ccr [ , ] . thus, around h after infection, dcs with antigen-mhc complexes migrate through the afferent lymph vessels to secondary lymph nodes where they form interactions with naive cd + and cd + t lymphocytes. these t-lymphocytes are activated, proliferate, differentiate into effector t-cells and migrate via efferent lymph vessels into the circulation. multiple chemokines, such as ccl , cxcl and cxcl , are expressed in the respiratory epithelium and result in changes in integrin affinity, allowing effector t-cells to bind to the endothelium and migrate into the infected tissue [ , [ ] [ ] [ ] [ ] . for efficient and effective viral clearance th effector t-cells are required, which produce il- , tnf-α and ifn-γ to activate nk cells and induce generation of cytolytic molecules. cd + effector t-cells and nk cells can then induce apoptosis of infected cells via the release of cytolytic granules or by direct interaction between surface fas receptor and fas ligand (fasl) [ ] . b-cells have also been demonstrated to play an important role in the immune response to highly pathogenic viral infections. contact between cd + t-cells and naive b-cells in secondary lymphoid tissues results in their proliferation and antibody class-switching, with neutralizing virus-specific antibodies crucial for optimal viral clearance. additionally, viral components expressed on infected cells allow antibodies to bind, thus initiating antibody-dependent cell-mediated cytotoxicity (adcc), whereby cd on nk cells recognises the fc portion of antibodies bound to the surface and kills the target cell [ , [ ] [ ] [ ] . complement is also increasingly being recognised as an important component of anti-viral immunity, as reviewed elsewhere [ ] . the evolution of evasion mechanisms by viruses emphasises the importance of complement in anti-viral immunity, with, for example, the matrix protein m of influenza a able to bind to c q to prevent interaction with antibodies on the surface of infected cells [ , ] . therefore, combined, these effector mechanisms of the adaptive immune response rapidly clear the viral infection. vitamin d (cholecalciferol) is acquired from dietary sources, primarily oily fish, or from uv-mediated synthesis in the skin, before it is metabolised in the liver to form (oh)d . this (oh)d is the circulating form of vitamin d, with a half-life estimated to range from two weeks to two months [ ] [ ] [ ] , and its serum concentration is used to define vitamin d status. further hydroxylation results in the synthesis of α, (oh) d and ligation of nuclear vitamin d receptors (vdrs), allowing subsequent binding to vitamin d responsive elements (vdres) in promoter regions of specific genes, resulting in the repression or induction of gene transcription [ ] (figure ). vdrs have also been shown to be located within the plasma membrane or its caveolae components [ ] [ ] [ ] , with ligation resulting in α, (oh) d -mediated non-genomic rapid responses via the activation of second messenger systems, such as phospholipase c, protein kinase c and phosphatidylinositol- ′kinase (pi k), thus initiating various intracellular effects, such as the opening of voltage-gated calcium channels and ras/mapk signal transduction [ , ] . the detection of vdr abundance throughout the immune system, the observation that vdr expression is regulated by immune signalling, and the detection of cyp b expression by immune cells has directed vitamin d research into the area of immunology [ ] [ ] [ ] [ ] [ ] , with associations of low serum (oh)d levels seen with autoimmune diseases, cancer, cardiovascular disease and respiratory infections [ ] [ ] [ ] [ ] . significantly, a link has been made between tlr ligation and cytokine secretion, the expression of cyp b and the expression of the vdr. in the absence of any influence by calcium homeostatic agents [ ] [ ] [ ] , and with a defective negative feedback mechanism [ , ] , extra-renal α-hydroxylation in cells such as monocytes and macrophages is regulated primarily by immune inputs. therefore, this renders the immune system responsive to circulating levels of (oh)d and allows the sustained and potentially beneficial production of , (oh) d during an immune response [ ] . vitamin d metabolism in macrophages is linked to pathogen recognition, thus making it an integral part of the innate immune response [ ] . ligation of the tlr / heterodimer in macrophages has been demonstrated to up-regulate cyp b , and the tlr ligands cl and ssrna have also both been demonstrated to induce a dose-dependent increase in cyp b mrna and protein expression in macrophages [ ] . similarly, ligation of tlr by lps up-regulated cyp b expression in monocytes [ , ] . in dendritic cells, ligation of tlr by lps or monophosphoryl lipid a (mpla), and ligation of tlr by polyi:c induced expression of cyp b , altering dc migratory properties to allow their localisation into non-draining secondary lymphoid organs to present antigen peptides to cd + t-cells [ , [ ] [ ] [ ] . similarly, in human tracheobronchial epithelial (htbe) cells, polyi:c stimulation and addition of live rsv were demonstrated to increase cyp b expression, enhance (oh)d conversion to , (oh) d, and amplify cathelicidin mrna [ ] . with the expression of tlrs in multiple cell types, and the ability to respond to a variety of pathogens, it is also possible that other tlrs or alternate prrs may promote extra-renal expression of cyp b , allowing locally generated , (oh) d to have even more extensive effects on the immune response. the exact mechanism by which tlr ligation enhances cyp b production has not been fully defined, although the jak-stat, nf-κb and p mapk pathways, and phosphorylation of the transcription factor c/ebpβ by p mapk have been implicated [ ] . additionally, il- has been demonstrated to act as an intermediary in promoting localized activity of cyp b and synthesis of , (oh) d. tlr / ligation by a triacylated lipopeptide of the m.tuberculosis kda antigen in human monocytes induced il- secretion, which was required for the upregulation of cyp b and the vdr, and subsequent downstream production of ll- [ ] . other cytokines, such as il- , ifnγ, il- , il- , il- and tnf-α, have also been implicated as regulators of cyp b expression and vitamin d metabolism [ , , [ ] [ ] [ ] [ ] . the pathways involved in cytokine-regulated transcription of cyp b are likely the same ones as utilized by tlr ligation-induced regulation, as described above [ ] . therefore, extra-renal , (oh) d synthesis has been shown to be regulated by tlr ligation and cytokine secretion, utilizing an intricate cross-talk between various signalling pathways. as such, in the presence of sufficient circulating levels of (oh)d, infection by respiratory viruses resulting in recognition by tlrs and cytokine production is able to increase levels of , (oh) d, hypothetically altering the immune response to better respond to these pathogens. [ ] , and parton and simons [ ] ). vitamin d has diverse and extensive effects on the immune system, due to the expression of the vdr and the enzyme cyp b by most immune cells [ , , , ] . the most frequently demonstrated effect of vitamin d is that on ll- , and, as such, its expression is commonly used to demonstrate increased cyp b expression and , (oh) d activity. cathelicidins are multifunctional antimicrobial peptides, and the sole form in humans is human cationic antimicrobial peptide of kda (hcap- ). from this precursor, the active form of ll- is cleaved by serine protease in neutrophils [ ] . while the method of cleavage has not been demonstrated in other cells types, ll- has been shown to be present in epithelial cells, monocytes, nk cells, b-cells and γδ t-cells [ , ] , and can be secreted by respiratory epithelial cells onto the airway surface to form a first line of defence against invading pathogens [ ] . it has many functions, as described elsewhere [ ] [ ] [ ] [ ] [ ] [ ] , such as direct facilitation of chemotaxis of immune cells and modification of dc differentiation, and, while traditionally viewed as a component of only the immune response to bacteria, has also been shown to act directly against viruses [ , , ] . numerous studies have demonstrated the role the , (oh) d-ligated vdr plays in binding to a vdre in the promoter of the cathelicidin gene to enhance hcap- production [ ] [ ] [ ] [ ] , thus suggesting a potential mechanism by which vitamin d may enhance innate immunity to respiratory infections. the proximal promoter region of defb gene also contains a vdre, allowing , (oh) d to upregulate expression of β-defensin [ ] . this is another antimicrobial peptide, which, similarly to ll- , is able to induce chemotaxis of immune cells and has been shown to inhibit rsv infection [ , ] . in addition to antimicrobial peptide induction, vitamin d has been demonstrated to modulate the innate immune system in a variety of other ways. monocyte differentiation into macrophages is induced [ ] , with enhancement of the phagocytic and chemotactic capacity of macrophages [ , ] , thus facilitating efferocytosis and preventing immunopathology. one of the signalling pathways regulated by vitamin d is the class iii phosphatidylinositol -kinase complex (pi kc ), with pi k signalling associated with monocyte and macrophage generation of ros and inos [ , ] . the oxidative burst has been demonstrated to have beneficial antiviral effects [ ] [ ] [ ] [ ] , although aberrant induction is associated with pathophysiology and tissue damage [ ] [ ] [ ] . as such, vitamin d may have an important role in redox homeostasis, with evidence of both pro-oxidative induction of ros and inos to boost the antiviral response [ , ] , and antioxidative inhibition of inos and induction of ros scavenging pathways to prevent immunopathology [ ] [ ] [ ] . the ability of , (oh) d to induce monocyte autophagy has also been demonstrated. autophagy acts as part of the immune system to remove damaged proteins and organelles, and is an important host defence mechanism against viral infections [ ] . vitamin d has been shown to induce autophagy by regulating multiple associated pathways, such as bcl- , mammalian target of rapamycin (mtor), class iii phosphatidylinositol -kinase complex, and cathelicidin production, thus potentially enhancing clearance of viruses and viral components [ , , ] . pattern recognition receptors have also been demonstrated to be regulated by vitamin d. expression of tlr and tlr is inhibited in monocytes, resulting in impaired downstream signalling and hyporesponsiveness to pamps. with the observation that this effect is most prominent after h, a negative feedback mechanism has been suggested, whereby excessive tlr activation is prevented at later stages of infection to dampen inflammation [ , ] . conversely, cd , an accessory protein to tlr which has also been linked to tlr [ ] , was up-regulated by , (oh) d [ , , ] , but this effect was not sufficient to restore downstream tlr signalling [ ] . additionally, as opposed to its effects in monocytes, , (oh) d has been demonstrated to induce up-regulation of tlr in keratinocytes, allowing a mechanism by which vitamin d may prevent infection of wounds [ ] . finally, the intracellular receptor nod is induced by , (oh) d in myeloid and epithelial cells, via two distal vdres in the nod gene. addition of mdp (a lysosomal breakdown product of bacterial peptidoglycan [ ] ) to , (oh) d-induced nod enhanced nf-κb signalling and subsequent β-defensin expression [ ] . vitamin d also modulates the adaptive immune response, and acts as a key intermediary between innate and adaptive immunity due to its influence on antigen presentation. dendritic cells are the most potent antigen-presenting cells, and, as such, have a direct effect on lymphocyte activation and induction of the adaptive immune response. they reside in peripheral tissues in an immature state, sampling the environment and mediating antigen uptake, until a maturation signal induces migration to local lymph nodes and subsequent t-cell activation. addition of , (oh) d has been demonstrated to inhibit dc differentiation, maturation and antigen presentation, with an associated decrease in markers such as cd a, mhc class ii, and the co-stimulatory molecules cd , cd and cd [ ] [ ] [ ] , as well as abrogating the chemotactic response to ccl and ccl [ ] . already differentiated dendritic cells can also be redirected back towards a monocytic phenotype by the restoration of the monocytic marker cd [ , ] . the antigen-presenting and t-cell stimulatory capacity of monocytes and macrophages is also impaired by , (oh) d, with a decrease in mhc class ii, cd , cd and cd . il- production is suppressed in both activated dcs and macrophages, due to the , (oh) d-mediated down-regulation of nf-κb activation [ ] , while influence on the expression of tnf-α is dependent on the differentiation state of the cells, with a reduction observed following , (oh) d administration in lps-stimulated monocytes and pbmcs [ , ] . the main function of dcs is to initiate t-cell responses, and thus the effect of , (oh) d on dcs has a major impact on t-cells. the decreased surface expression on dcs of co-stimulatory molecules and mhc class ii results in a tolerogenic phenotype, with dc production of il- (which is involved in driving th differentiation) and il- (which is involved in driving th differentiation) inhibited by , (oh) d [ , ] . even when cultured with committed t-cells, these tolerogenic dcs caused hyporesponsiveness, decreased t-cell proliferation and reduced ifn-γ secretion [ , ] . il- , as well as stimulating the development of th t-cells, also inhibits the development of th cells, thus resulting in vitamin d shifting the balance of t-cells from a th to a th phenotype [ ] . concomitantly, dc production of il- is increased. il- is a cytokine with pleiotropic effects in immunoregulation, and levels in bal fluid have been shown to be inversely correlated with severity/incidence of asthma [ , ] . this il- production drives development of regulatory t-cells (tregs), and these tregs are able to secrete more il- as well as the immunomodulatory cytokine tgf-β, while release of the treg cytokine ccl is also increased [ ] . th cells and il- , have also been shown to be decreased, with calcitriol ( , (oh) d) reducing il- production in a mouse colitis model and impairing commitment to the th lineage in mice with experimental autoimmune uveitis [ , ] , although these effects may not translate to the human respiratory system. th cells, by releasing il- , initiate an inflammatory response dominated by neutrophils. while high levels of il- production are associated with chronic inflammation and severe immunopathology [ ] , deficient levels, as seen in hyper-immunoglobulin e syndrome (hies), result in recurrent fungal and bacterial infections [ ] . therefore, vitamin d may have a beneficial role in attenuating immunopathology caused by some infections, but be detrimental in other fungal and bacterial infections. , (oh) d has also been demonstrated to have direct effects on t-cells, independent of dc activity. while the role of dcs in the induction of tregs has been described, it has also been shown that , (oh) d in combination with dexamethasone can induce a treg population in the absence of apcs [ ] . the proliferation and cytokine profiles of t-cells are also directly altered by , (oh) d. production of il- , ifn-γ, tnf-α, il- and il- are all inhibited [ , , ] , with inhibition of ifn-γ further precluding macrophage activation, thus attenuating antigen presentation and the recruitment of other t-cells [ ] . this direct inhibition of th -priming cytokines further skews t-cell differentiation towards a th phenotype. , (oh) d is also able to upregulate the th -specific transcription factors gata- and c-maf, resulting in increased production of il- , il- and il- [ ] . b-cells are also affected by vitamin d, with modulation of t-cell responses altering the b-cell compartment, as well as having direct effects on b-cells themselves [ ] . , (oh) d is able to inhibit proliferation, plasma-cell differentiation, immunoglobulin secretion and memory b-cell generation, while inducing b-cell apoptosis [ ] . as such, vitamin d supplementation has been used in the treatment of b-cell-associated autoimmune diseases such as systemic lupus erythematous [ , ] . finally, it has been suggested that vitamin d may affect other lymphocyte subsets, with vdr-ko mice presenting with fewer invariant natural killer (inkt) cells [ ] , and cd + t-cells from ms patients secreting less ifn-γ and tnf-α and more il- and tgf-β following , (oh) d treatment [ ] . however, the mechanisms behind any potential beneficial role of vitamin d are unclear, with conflicting cellular studies on the effects of vitamin d on th cells [ , ] , with both enhancement [ ] and inhibition [ ] of il- synthesis demonstrated. , (oh) d has also been shown to down-regulate dc-derived ox l, which is required for th priming, thus, resulting in a reduced th cytokine response in cd + t-cells from patients with allergic bronchopulmonary aspergillosis [ ] , thus contradicting evidence that vitamin d skews the t-cell phenotype towards a th one. additionally, the decrease in th immunity which has been observed [ ] would suggest a diminished immune response to pathogens, contrasting to the evidence suggesting an improved response to respiratory tract infections after vitamin d supplementation. finally, while studies have demonstrated direct effects of , (oh) d administration on lymphocytes, others have shown that when using the inactive metabolite (oh)d, dcs are required to convert this precursor to the active , (oh) d to exert its immunomodulatory effects [ ] . this indicates that administration of different vitamin d metabolites may result in a different response. therefore, while vitamin d clearly acts as an immunomodulatory molecule with a wide range of effects demonstrated, the precise mechanisms are currently unclear, with the conflicting results reported also adding to the uncertainty of its actions. the main immunomodulatory effects of vitamin d are summarised in figure . the innate immune response is affected, with monocytes producing more ll- and β-defensin, with increased nod expression and autophagy, while also producing diminished amounts of inflammatory cytokines, with decreased expression of tlr and tlr . differentiation into macrophages is increased, with macrophages having an increased capacity for phagocytosis and chemotaxis. however, their apc and t-cell stimulatory capacity is decreased. monocyte and macrophage production of ros and inos is able to both be induced and inhibited, thus regulating their balance. differentiation into dcs is inhibited, with dcs expressing decreased levels of maturation surface markers. dc production of il- and il- is decreased, while mannose receptor expression and production of il- and ccl are increased. when these tolerogenic dcs interact with t-cells, development of tregs and th cells is increased, with increased production of il- , tgf-β, il- and il- . the development of th and th cells is inhibited, with decreased production of il- , ifn-γ and tnf-α, and attenuation of macrophage activation. b-cells are also affected by , (oh) d, demonstrating decreased immunoglobulin production, proliferation and differentiation, but increased apoptosis. while a number of in vitro studies have described the general effects of vitamin d metabolites on the function of immune cells and secretion of inflammatory molecules, as described above, experiments investigating the specific antiviral effects of vitamin d on each respiratory virus are limited. the available literature is summarised below, and presented in figure . rhinovirus infection of epithelial cells results in increased production and secretion of pro-inflammatory cytokines and chemokines, with the secretion of cxcl and cxcl further enhanced following treatment with , (oh) d. during rsv infection, iκbα expression is reduced, resulting in increased transcription of nf-κb-driven genes. stat is also phosphorylated and able to translocate into the nucleus resulting in increased expression of irf and irf . pre-treatment with , (oh) d increases iκbα expression and decreases stat phosphorylation, resulting in decreased production of cxcl , ifn-β, mxa, isg , irf and irf . similarly, influenza a infection causes increased expression of pro-inflammatory cytokines and chemokines, with , (oh) d treatment causing decreased expression of tnf-α, ifn-β, isg , cxcl , il- and ccl . finally, , (oh) d is also able to increase ll- and hbd production, which have been shown to have antiviral effects against both rsv and influenza. rhinovirus is the most common aetiologic agent of the common cold, which in turn is the most frequent acute infection in the industrialised world, associated with two to three episodes per year in adults, and five to seven per year in children [ ] [ ] [ ] . however, only one study has been carried out to determine the effect of vitamin d on rhinovirus infection [ ] . experiments were carried out in which primary human bronchial epithelial cells (hbecs) were treated with (oh)d or , (oh) d and subsequently infected with rv- . incubation with vitamin d metabolites had no effect on viral replication, and, whilst rv- infection induced hbec secretion of ccl , il- and il- , incubation with vitamin d metabolites did not alter this effect. treatment with vitamin d did, however, enhance secretion of cxcl and cxcl , both in the presence and absence of rhinovirus infection. these molecules are pro-inflammatory chemokines, responsible for the recruitment of immune cells such as neutrophils, macrophages and t-cells to the site of infection, and could thus act as an effector mechanism as to how vitamin d alters the antiviral response to rhinovirus infection. rsv is usually associated with illness in young children, with most infants having been infected by the age of three, causing a mild uri for the majority, but severe bronchiolitis in some [ , ] . it has also been associated with a higher risk of developing asthma in later life [ ] . vitamin d deficiency has been linked to rsv susceptibility, with low cord blood plasma concentrations of (oh)d related to rsv incidence in the first year of life [ ] , and single nucleotide polymorphisms (snps) in the vdr (rs and the fokl snp) and vitamin d binding protein (the gc s variant) associated with a genetic predisposition to rsv bronchiolitis [ ] [ ] [ ] [ ] . however, as with rhinovirus, in vitro work investigating the specific effects of vitamin d on the immune response to rsv is limited. in a study using primary human tracheobronchial epithelial (htbe) cells treated with , (oh) d, expression of the nf-κb inhibitor iκbα was upregulated [ ] . cells infected with rsv for h had decreased protein levels of iκbα, due to rsv-induced degradation, but in cells pre-treated with , (oh) d prior to rsv infection iκbα levels were increased due to augmented mrna transcription and protein synthesis. an increase in iκbα results in nf-κb remaining inactive in the cytoplasm, preventing its translocation into the nucleus and subsequent binding to dna promoter regions. thus, vitamin d inhibits rsv induction of nf-κb-driven ifn-β and cxcl secretion, as also demonstrated in this study. additionally, interferon stimulated genes (isgs) without functional nf-κb sites in their promoters were also measured, with , (oh) d treatment resulting in decreased levels of human myxovirus resistance protein (mxa) and isg . this was demonstrated to be a consequence of the suppression of nf-κb-driven ifn-β production. similarly, pre-treatment with , (oh) d before inoculation with rsv resulted in decreased levels of stat protein and inhibition of stat- translocation to the nucleus, also as a consequence of suppression of nf-κb-driven ifn-β production. however, even though production of important components in the antiviral response to rsv infection (ifn-β, cxcl , stat , mxa and isg ) were reduced by treatment with , (oh) d, viral replication and viral load was not increased. thus, via increasing iκbα levels, , (oh) d is able to dampen the inflammatory response to rsv infection whilst maintaining the antiviral state and without having adverse effects on viral load, suggesting a potential role in reducing immunopathology. a similar study using alveolar a cells infected with rsv has also demonstrated that , (oh) d is able to decrease levels of phosphorylated stat- (pstat- ) and increase iκbα protein levels, with subsequent diminished expression of interferon regulatory factor (irf ), irf , ifn-β and cxcl mrna [ ] . this study also used retroviral transduction to overexpress the common m vdr variant, or the m foki vdr variant, which has been associated with severe rsv bronchiolitis. no differences were observed between the two variants in viral replication, or the vitamin d-induced increase in iκbα and repression of nf-κb-regulated genes. however, in m foki vdr-expressing cells, vitamin d was not able to repress expression of the stat- regulated genes irf and irf , due to decreased regulation of stat- phosphorylation. therefore, together these studies indicate that vitamin d is able to dampen nf-κb and stat- mediated inflammation to reduce rsv immunopathology, with an impairment in the regulation of stat- phosphorylation resulting in more severe disease. it has also been demonstrated that the antimicrobial peptides ll- and β-defensin have anti-viral activity against rsv, blocking viral cellular entry, preventing virus-induced epithelial cell death, inhibiting production of new infectious particles and diminishing the spread of infection [ , ] . since vitamin d has been demonstrated to be able to induce secretion of both of these molecules [ ] [ ] [ ] , this provides a potential mechanism by which vitamin d may exert antiviral effects against rsv infection. finally, a number of studies have been carried out in calves, looking at the association between vitamin d and bovine rsv (brsv). naturally occurring brsv infection in young ruminants has been demonstrated to mimic the pathogenesis and lesions observed in rsv infection of infants, thus providing a useful model for studying rsv infection. conversely to the effects described above, whereby production of nf-κb-linked pro-inflammatory cytokines was inhibited, vitamin d treatment has been shown to elevate secretion of the pro-inflammatory cytokine il- p following brsv infection [ ] . no effect was observed on γδ t-cell cytokine production [ ] , or ifn-γ, cxcl , tnf-α, il- β or il- secretion [ ] . the influenza virus is associated with seasonal epidemics, severe pandemics, pneumonia and secondary bacterial infections. as such, a simple and cost-effective prevention strategy is desirable, with clinical trial results showing promising effects of vitamin d supplementation in the prevention of seasonal influenza a infection in japanese schoolchildren [ ] . however, as with rsv and rhinovirus, in vitro work investigating the specific effects of vitamin d on the immune response to influenza viruses is lacking. in a study using alveolar a cells, the effect of pre-or post-treatment with , (oh) d on infection with influenza a h n was assessed [ ] . it was demonstrated that vitamin d had no effect on a cell viability following infection with influenza virus, viral clearance or the anti-viral state. whilst influenza infection increased the production of pro-inflammatory cytokines and chemokines, as with rsv infection [ , ] , treatment with vitamin d either before or after influenza infection decreased gene expression of tnf-α, ifn-β, isg , cxcl , il- and rantes (ccl ). since an uncontrolled inflammatory response to influenza infection can cause complications such as pulmonary oedema, and the cytokine storm has been associated with more severe disease and higher mortality [ ] ), this suppression of the hyper-inflammatory response may be beneficial in preventing immunopathology. the antimicrobial peptides ll- and human β-defensin have also been shown to have anti-viral properties against influenza virus, reducing disease severity and viral replication, inhibiting infectivity, and demonstrating neutralising activity [ , ] . as described above, since vitamin d has been shown to induce production of these amps, this may be another mechanism by which vitamin d is able to exert antiviral effects on influenza virus infection. finally, the majority of work into vitamin d and influenza infection has been investigating the potential use of vitamin d as an adjuvant in influenza vaccines. however, vitamin d has not been shown to be able to modulate the humoral response to inactivated influenza virus in this setting [ ] [ ] [ ] [ ] [ ] . in the case of other common viral causes of ari in humans, no in vitro studies have been carried out to determine effects of vitamin d on the immune response to these pathogens. this is the case for human metapneumovirus, parainfluenza, adenovirus, coronaviruses, enterovirus and human bocavirus. this review has identified a modest number of laboratory studies investigating immunomodulatory effects of vitamin d metabolites in respiratory epithelial cells infected with respiratory viruses. despite clinical evidence that vitamin d supplementation may reduce susceptibility to such infections in vivo [ ] , in vitro studies performed to date have not shown that vitamin d metabolites inhibit viral replication in epithelial cells. however, all the studies reviewed demonstrated effects of vitamin d metabolites on expression and secretion of pro-inflammatory cytokines and chemokines. interestingly, the effects of , (oh) d on chemokine expression and secretion varied between pathogens; this finding complements those of clinical trials suggesting that vitamin d-inducible responses may be more effective against some pathogens than others [ ] . more studies are needed to characterize the in vitro actions of vitamin d in viral respiratory infection (particularly to investigate why suppression of type interferon responses is not associated with increased viral replication), and to clarify the effects of vitamin d metabolites on respiratory virus-induced expression of cell surface markers mediating viral entry and bacterial adhesion to respiratory epithelial cells. the manuscript was conceived by both authors. clg wrote the draft manuscript which was subsequently edited by arm. the authors declare no conflict of interest. picornavirus, the most common respiratory virus causing infection among patients of all ages hospitalized with acute respiratory illness epidemiology of human respiratory viruses in children with acute respiratory tract infections in virological and clinical characterizations of respiratory infections in hospitalized children incidence of respiratory viruses in peruvian children with acute respiratory infections human bocavirus-infection (hbov): an important cause of severe viral obstructive bronchitis in children efficacy and effectiveness of influenza vaccines: a systemic review and meta-analysis antivirals for treatment of influenza: a systematic review and metaanalysis of observational studies oseltamivir treatment for influenza in adults: a meta-analysis of randomised controlled trials oseltamivir for influenza in adults and children: systematic review of clinical study reports and summary of regulatory comments addressing the public health burden of respiratory viruses: the battle against respiratory viruses (brave) initiative vitamin d: modulator of the immune system vitamin d and innate and adaptive immunity vitamin d in the prevention of acute respiratory infection: systematic review of clinical studies a randomized controlled trial of vitamin d supplementation in african american women re: epidemic influenza and vitamin d vitamin d supplementation for the prevention of acute respiratory tract infection: a randomized, double-blinded trial among young finnish men randomized trial of vitamin d supplementation to prevent seasonal influenza a in schoolchildren randomized trial of vitamin d supplementation and risk of acute respiratory infection in mongolia stelmach, i. vitamin d supplementation in children may prevent asthma exacerbation triggered by acute respiratory infection a randomized controlled trial of vitamin d supplementation for the prevention of symptomatic upper respiratory tract infections effect of vitamin d supplementation on upper respiratory tract infections in healthy adults: the vidaris randomized controlled trial effect of weekly vitamin d supplements on mortality, morbidity, and growth of low birthweight term infants in india up to age months: randomised controlled trial effect on the incidence of pneumonia of vitamin d supplementation by quarterly bolus dose to infants in kabul: a randomised controlled superiority trial vitamin d supplementation did not prevent influenza-like illness as diagnosed retrospectively by questionnaires in subjects participating in randomized clinical trials. scand effect of vitamin d on asthma treatment failures in adults with symptomatic asthma and lower vitamin d levels: the vidi randomized clinical trial double-blind randomised placebo-controlled trial of bolus-dose vitamin d supplementation in adults with asthma (vidias) vitamin d supplementation in patients with chronic obstructive pulmonary disease (vidico): a multicentre, double-blind, randomised controlled trial vitamin d and respiratory tract infections: a systematic review and meta-analysis of randomized controlled trials activation of airway epithelial cells by toll-like receptor agonists regulation of immunological homeostasis in the respiratory tract viral activation of macrophages through tlr-dependent and -independent pathways pattern recognition receptors and inflammation unc b delivers nucleotide-sensing toll-like receptors to endolysosomes recognition of single-stranded rna viruses by toll-like receptor toll-like receptor -mediated recognition of herpes simplex virus- by plasmacytoid dendritic cells recognition of double-stranded rna and activation of nf-kappab by toll-like receptor immunity to respiratory viruses pattern recognition receptors tlr and cd mediate response to respiratory syncytial virus intracellular tlr -md- in macrophages senses gram-negative bacteria and induces a unique set of lps-dependent genes murine toll-like receptor activation induces type i interferon responses from endolysosomal compartments respiratory syncytial virus activates innate immunity through toll-like receptor reis e sousa, c. rig-i-mediated antiviral responses to single-stranded rna bearing ′-phosphates mda detects the double-stranded rna replicative form in picornavirus-infected cells activation of innate immune antiviral responses by nod distinct rig-i and mda signaling by rna viruses in innate immunity viral evasion and subversion of pattern-recognition receptor signalling signaling in innate immunity and inflammation neutrophil recruitment, chemokine receptors, and resistance to mucosal infection il- participates in the respiratory innate immune response to influenza virus infection cxcr is required for neutrophil recruitment to the lung during influenza virus infection, but is not essential for viral clearance cd c+ antigen presenting cells from the alveolar space, lung parenchyma and spleen differ in their phenotype and capabilities to activate naive and antigen-primed t cells macrophage defences against respiratory tract infections cationic host defence peptides: potential as antiviral therapeutics antiviral activity and increased host defense against influenza infection elicited by the human cathelicidin ll- ll and cationic peptides enhance tlr signaling by viral double-stranded rnas the human cathelicidin ll- has antiviral activity against respiratory syncytial virus macrophage impairment underlies airway occlusion in primary respiratory syncytial virus bronchiolitis alveolar macrophages are essential for protection from respiratory failure and associated morbidity following influenza virus infection regulating the adaptive immune response to repiratory virus infection balancing immunity and tolerance cc chemokine ligand (ccl ) regulates cd (+)-t-cells effector function and migration following viral infection cc chemokine receptor and cxc chemokine receptor expression by lung cd + cells correlates with chronic obstructive pulmonary disease severity cxc chemokines ip- and mig expression and direct migration of pulmonary cd +/cxcr + t cells in the lungs of patients with hiv infection and t-cell alveolitis orchestrating the orchestrators: chemokines in control of t cell traffic the role of the antibody response in influenza virus infection virus-neutralizing antibodies of immunoglobulin g (igg) but not of igm or iga isotypes can cure influenza virus pneumonia in scid mice antibody-dependent cellular cytotoxicity is associated with control of pandemic h n influenza virus infection of macaques complement and viral pathogenesis influenza a virus m blocks the classical complement pathway through interacting with c qa pharmacokinetics of vitamin d toxicity serum -hydroxyvitamin d is a reliable indicator of vitamin d status vitamin d supplementation, -hydroxyvitamin d concentrations, and safety steroid-hormone rapid actions, membrane receptors and a conformational ensemble model the vitamin d receptor is present in caveolae-enriched plamsa membranes and binds alpha, (oh) -vitamin d in vivo and in vitro vitamin d receptor: new assignments for an already busy receptor the yin and yang of vitamin d receptor (vdr) signaling in neoplastic progression: operational networks and tissue-specific growth control manolagas, s. , -dihydroxyvitamin d receptors in human leukocytes human t lymphocytes are direct targets of , -dihydroxyvitamin d in the immune system differential regulation of vitamin d receptor and its ligand in human monocyte-derived dendritic cells modulatory effects of , -dihydroxyvitamin d on human b cell differentiation dcs metabolize sunlight-induced vitamin d to 'program' t cell attraction to the epidermal chemokine ccl does vitamin d affect risk of developing autoimmune disease?: a systematic review the role of vitamin d in cancer prevention and treatment vitamin d deficiency and risk of cardiovascular disease association between serum -hydroxyvitamin d level and upper respiratory tract infection in the third national health and nutrition examination survey regulated production and intracrine action of , -dihydroxyvitamin d in the chick myelomonocytic cell line hd- regulation of , -dihydroxyvitamin d production by cultured alveolar macrophages from normal human donors and from patients with pulmonary sarcoidosis regulation of alpha, -dihydroxyvitamin d synthesis in macrophages from arthritic joints by phorbol ester, dibutyryl-camp and calcium ionophore (a ) alternative splicing of vitamin d- -hydroxylase: a novel mechanism for the regulation of extrarenal , -dihydroxyvitamin d synthesis vitamin d signaling, infectious diseases, and regulation of innate immunity regulation of intracrine production of , -dihydroxyvitamin d and its role in innate immune defense against infection toll-like receptor ligands activate a vitamin d mediated autophagic response that inhibits human immunodeficiency virus type increased expression of -hydroxyvitamin d- alpha-hydroxylase in dysgerminomas: a novel form of humoral hypercalcemia of malignancy immune regulation of -hydroxyvitamin-d - alpha-hydroxylase in human monocytes regulation of -hydroxyvitamin d - alpha-hydroxylase and production of alpha, -dihydroxyvitamin d by human dendritic cells tlr-induced local metabolism of vitamin d plays an important role in the diversification of adaptive immune responses tlr ligands that stimulate the metabolism of vitamin d in activated murine dendritic cells can function as effective mucosal adjuvants to subcutaneously administered vaccines respiratory epithelial cells convert inactive vitamin d to its active form: potential effects on host defense modlin, r. il- links tlr / -induced macrophage differentiaition to the vitamin d-dependent antimicrobial pathway interleukin exposure enhances vitamin d-mediated expression of the human cathelicidin antimicrobial peptide /ll- in bronchial epithelial cells immune regulation of -hydroxyvitamin d- alpha-hydroxylase in human monocytic thp cells: mechanisms of interferon-gamma-mediated induction t-cell cytokines differentially control human monocyte antimicrobial responses by regulating vitamin d metabolism monocyte alpha-hydroxylase regulation: induction by inflammatory cytokines and suppression by dexamethasone and uremia toxin new analogs of vitamin d the multiple faces of caveolae identification of -hydroxyvitamin d alpha-hydroxylase gene expression in macrophages human cathelicidin, hcap- , is processed to the antimicrobial peptide ll- by extracellular cleavage with proteinase the human antimicrobial and chemotactic peptides ll- and alpha-defensins are expressed by specific lymphocyte and monocyte populations the peptide antibiotic ll- /hcap- is expressed in epithelia of the human lung where it has broad antimicrobial activity at the airway surface ll- , the neutrophil granule-and epithelial cell-derived cathelicidin, utilizes formyl peptide receptor-like (fprl ) as a receptor to chemoattract human peripheral blood neutrophils, monocytes, and t cells human cathelicidin ll- is a chemoattractant for eosinophils and neutrophils that acts via formyl-peptide receptors the human antimicrobial peptide ll- is a multifunctional modulator of innate immune responses an antimicrobial cathelicidin peptide, human cap /ll- , suppresses neutrophil apoptosis via the activation of formyl-peptide receptor-like and p x the cationic antimicrobial peptide ll- modulates dendritic cell differentiation and dendritic cell-induced t cell polarization cationic host defence peptides: multifaceted role in immune modulation and inflammation cutting edge: , -dihydroxyvitamin d is a direct inducer of antimicrobial peptide gene expression human cathelicidin antimicrobial peptide (camp) gene is a direct target of the vitamin d receptor and is strongly up-regulated in myeloid cells by , -dihydroxyvitamin d induction of cathelicidin in normal and cf bronchial epithelial cells by , -dihydroxyvitamin d( ) vitamin d induces the antimicrobial protein hcap in human skin defensins: antimicrobial peptides of innate immunity role of human beta-defensin- during tumor necrosis factor-alpha/nf-kappab-mediated innate antiviral response against human respiratory syncytial virus differentiation of a human monocytic cell line by , -dihydroxyvitamin d (calcitriol): a morphologic, phenotypic, and functional analysis -dihydroxyvitamin d exerts opposing effects to il- on mhc class-ii antigen expression, accessory activity, and phagocytosis of human monocytes vitamin d, vitamin d receptor, and macroautophagy in inflammation and infection reiner, n. alpha, -dihydroxyvitamin d -induced monocyte antimycobacterial activity is regulated by phosphatidylinositol -kinase and mediated by the nadph-dependent phagocyte oxidase reactive oxygen species induce antiviral innate immune response through ifn-λ regulation in human nasal epithelial cells mucosal reactive oxygen species are required for antiviral response: role of duox in influenza a virus infection requirement of nox and reactive oxygen species for efficient rig-i-mediated antiviral response through regulation of mavs expression il- induces ifn-beta and inos gene expression, and antiviral activity of murine macrophage raw . cells regulation of the expression of inducible nitric oxide synthase influenza a virus induction of oxidative stress and mmp- is associated with severe lung pathology in a mouse model downregulation of inducible nitric oxide synthase (inos) expression is implicated in the antiviral activity of acetylsalicylic acid in hcv-expressing cells , -dihydroxyvitamin d induces nitric oxide synthase and suppresses growth of mycobacterium tuberculosis in a human macrophage-like cell line protective role of alpha, -dihydroxyvitamin d against oxidative stress in nonmalignant human prostate epithelial cells -alpha, -dihydroxyvitamin d regulates inducible nitric oxide synthase messenger rna expression and nitric oxide release in macrophage-like raw . cells vitamin d: oxidative stress, immunity, and aging autophagy in antiviral innate immunity vitamin d induces autophagy in human monocytes/macrophages via cathelicidin autophagy as a basis for the health-promoting effects of vitamin d vitamin d down-regulates monocyte tlr expression and triggers hyporesponsiveness to pathogen-associated molecular patterns binding of lipopeptide to cd induces physical proximity of cd , tlr and tlr functional antagonism between vitamin d and retinoic acid in the regulation of cd and cd expression during monocytic differentiation of u- cells regulation of cd expression during monocytic differentiation induced with alpha, -dihydroxyvitamin d injury enhances tlr function and antimicrobial peptide expression through a vitamin d-dependent mechanism direct and indirect induction by , -dihydroxyvitamin d of the nod /card -defensin beta innate immune pathway defective in crohn disease alpha, -dihydroxyvitamin d inhibits differentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive t cell activation , -dihydroxyvitamin d( ) inhibits dendritic cell differentiation and maturation in vitro the vitamin d analog calcipotriol suppresses the number and antigen-presenting function of langerhans cells in normal human skin suppressive effect of alpha, -dihydroxyvitamin d on type i ifn-mediated monocyte differentiation into dendritic cells: impairment of functional activities and chemotaxis vitamin d and the immune system: maintaining the balance in health and disease panina-bordignon, p. inhibition of il- production by , -dihydroxyvitamin d . involvement of nf-kappab downregulation in transcriptional repression of the p gene ) dose-dependently inhibits lps-induced cytokines production in pbmc modulating intracellular calcium redirection of human autoreactive t-cells upon interaction with dendritic cells modulated by tx , an analog of immunosuppressive actions of , -dihydroxyvitamin d : preferential inhibition of th functions reversing the defective induction of il- -secreting regulatory t cells in glucocorticoid-resistant asthma patients interleukin- regulation in normal subjects and patients with asthma calcitriol suppresses antiretinal autoimmunity through inhibitory effects on the th effector response immune modulatory treatment of trinitrobenzene sulfonic acid colitis with calcitriol is associated with a change of a t helper th to a th and regulatory t cell profile interleukin- and type helper t cells deficiency of th cells in hyper ige syndrome due to mutations in stat in vitro generation of interleukin -producing regulatory cd (+) t cells is induced by immunosuppressive drugs and inhibited by t helper type (th )-and th -inducing cytokines , -dihydroxyvitamin d and il- combine to inhibit t cell production of inflammatory cytokines and promote development of regulatory t cells expressing ctla- and foxp regulation of lymphokine production and human t lymphocyte activation by , -dihydroxyvitamin d . specific inhibition at the level of messenger rna vitamin d : a transcriptional modulator of the interferon-gamma gene -dihydroxyvitamin d has a direct effect on naive cd (+) t cells to enhance the development of th cells regulatory b cells in autoimmune diseases restoration of regulatory and effector t cell balance and b cell homeostasis in systemic lupus erythematosus patients through vitamin d supplementation vitamin d, invariant natural killer t-cells and experimental autoimmune disease vitamin d has a direct immunomodulatory effect on cd + t cells of patients with early multiple sclerosis and healthy control subjects the anti-inflammatory effects of , -dihydroxyvitamin d on th cells in vivo are due in part to the control of integrin-mediated t lymphocyte homing issazadeh-navikas, s. dual effects of vitamin d-induced alteration of th /th cytokine expression: enhancing ige production and decreasing airway eosinophilia in murine allergic airway disease , -dihydroxyvitamin d inhibits ifn-gamma and il- levels in vitro polaization of primary murine cd + t cells vitamin d attenuates th responses to aspergillus fumigatus mounted by cd + t cells from cystic fibrosis patients with allergic bronchopulmonary aspergillosis availability of -hydroxyvitamin d( ) to apcs controls the balance between regulatory and inflammatory t cell responses frequency and natural history of rhinovirus infections in adults during autumn the common cold studies of the community and family: acute respiratory illness and infection effects of vitamin d on airway epithelial cell morphology and rhinovirus replication respiratory syncytial virus: current and emerging treatment options respiratory syncytial virus--a comprehensive review severe respiratory syncytial virus bronchiolitis in infancy and asthma and allergy at age cord blood vitamin d deficiency is associated with respiratory syncytial virus bronchiolitis genetic predisposition of rsv infection-related respiratory morbidity in preterm infants vitamin d receptor (vdr) polymorphisms and severe rsv bronchiolitis: a systematic review and meta-analysis confirmation of an association between single nucleotide polymorphisms in the vdr gene with respiratory syncytial virus related disease in south african children vitamin d-binding protein haplotype is associated with hospitalization for rsv bronchiolitis vitamin d decreases respiratory syncytial virus induction of nf-kappab-linked chemokines and cytokines in airway epithelium while maintaining the antiviral state defective control of vitamin d receptor-mediated epithelial stat signaling predisposes to severe respiratory syncytial virus bronchiolitis differential expression of cytokines in response to respiratory syncytial virus infection of calves with high or low circulating -hydroxyvitamin d differential chemokine and cytokine production by neonatal bovine γδ t-cell subsets in response to viral toll-like receptor agonists and in vivo respiratory syncytial virus infection calcitriol [ , [oh] d ] pre-and post-treatment suppresses inflammatory response to influenza a (h n ) infection in human lung a epithelial cells th and th hypercytokinemia as early host response signature in severe pandemic influenza interactions of alpha-, beta-, and theta-defensins with influenza a virus and surfactant protein d calcitriol ( , -dihydroxy-vitamin d ) coadministered with influenza vaccine does not enhance humoral immunity in human volunteers vitamin d is not associated with serologic response to influenza vaccine in adults over years old impact of vitamin d administration on immunogenicity of trivalent inactivated influenza vaccine in previously unvaccinated children vitamin d supplementation does not increase immunogenicity of seasonal influenza vaccine in hiv-infected adults serum -hydroxyvitamin d level and influenza vaccine immunogenicity in children and adolescents key: cord- -awu iev authors: carr, anitra c.; rowe, sam title: factors affecting vitamin c status and prevalence of deficiency: a global health perspective date: - - journal: nutrients doi: . /nu sha: doc_id: cord_uid: awu iev a recent review of global vitamin c status has indicated a high prevalence of deficiency, particularly in low- and middle-income countries, as well as in specific subgroups within high-income countries. here, we provide a narrative review of potential factors influencing vitamin c status globally. the in vivo status of vitamin c is primarily affected by dietary intake and supplement use, with those who supplement having a higher mean status and a lower prevalence of deficiency. dietary intake can be influenced by cultural aspects such as traditional cooking practices and staple foods, with many staple foods, such as grains, contributing negligible vitamin c to the diet. environmental factors can also affect vitamin c intake and status; these include geographic region, season, and climate, as well as pollution, the latter partly due to enhanced oxidative stress. demographic factors such as sex, age, and race are known to affect vitamin c status, as do socioeconomic factors such as deprivation, education and social class, and institutionalization. various health aspects can affect vitamin c status; these include body weight, pregnancy and lactation, genetic variants, smoking, and disease states, including severe infections as well as various noncommunicable diseases such as cardiovascular disease and cancer. some of these factors have changed over time; therefore, we also explore if vitamin c status has shown temporal changes. overall, there are numerous factors that can affect vitamin c status to different extents in various regions of the world. many of these factors are not taken into consideration during the setting of global dietary intake recommendations for vitamin c. due to random genetic mutations that have occurred during our evolution, humans have lost the ability to synthesize ascorbate in our livers [ ] . therefore, instead of being a normal liver metabolite, as is the case for most other animal species, ascorbate has instead become a vitamin and must be obtained through the diet to prevent hypovitaminosis c and outright deficiency [ ] . in a recent review, we described the global status of vitamin c and the prevalence of deficiency as assessed by plasma concentrations [ ] . whilst vitamin c concentrations are normally tightly controlled in humans with adequate intake, a number of studies suggest that hypovitaminosis c and deficiency are not uncommon worldwide and may be very common in some settings. vitamin c is well absorbed in small quantities. uptake occurs primarily through the sodium-dependent vitamin c transporter- (svct- ), which is rapidly saturated, allowing relatively limited absorption of vitamin c per serving [ ] . vitamin c is then accumulated at varying concentrations in different body tissues [ ] . the vitamin is excreted unchanged in the urine, but reuptake occurs in the renal tubules [ ] . further loss of vitamin c occurs through the oxidation of ascorbic acid to dehydroascorbic acid which may then be recycled to ascorbic acid or undergo further oxidative decomposition [ ] . thus, in vivo, vitamin c concentrations are affected by a range of factors that include dietary intake, absorption, distribution, oxidative decomposition, and elimination. vitamin c acts as an important antioxidant and plays a myriad of functions in optimal health and prevention of disease [ , ] . even mild insufficiency or hypovitaminosis c can be associated with symptoms such as low mood [ ] . more severe deficiency can be associated with a range of clinical presentations [ ] . prolonged severe deficiency results in the clinical syndrome of scurvy, a condition that continues to be diagnosed in individuals and occasionally in public health outbreaks to this day [ ] ; if left untreated, scurvy is a fatal disease. the optimum intake and concentrations of vitamin c, however, have been subject to debate and recommended values are not universal [ ] . due to a range of benefits, a number of international authorities have increased their dietary recommendations for vitamin c from those previously recommended on the basis of preventing scurvy [ ] . although these recommendations generally take into account variations in requirements based on age, sex, pregnancy and lactation, and sometimes smoking status, there are many other factors that affect vitamin c status that are not taken into consideration by these global authorities. in this review, we highlight the numerous factors that impact on vitamin c status and prevalence of deficiency globally. dietary intake of vitamin c is a key determinant of body status, with the amount consumed and the frequency of consumption correlating with plasma status and prevalence of deficiency (table ) [ , ] . fresh fruit and vegetables are the major dietary source of vitamin c, with fruit intake correlating more strongly with plasma vitamin c status [ , ] . foods rich in vitamin c include oranges and other citrus fruit, guavas, kiwifruit, cranberries, strawberries, papayas, mangoes, melons, cantaloupe, spinach, swiss chard, tomatoes, asparagus, and brussels sprouts ( figure ) [ ] . in contrast, grains (e.g., rice, millet, wheat/couscous, corn), some starchy roots and tubers, meat (other than liver), eggs, and dairy contain very little vitamin c. dietary intake dietary intake, particularly fruit intake, correlates with improved vitamin c status and decreased prevalence of deficiency; is dependent on the amount consumed, frequency of consumption, and type of food consumed as the vitamin c content of food varies. high dietary fat and sugar intake are associated with decreased vitamin c intake and status. [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] staple foods staple foods such as grains (e.g., rice, millet, wheat/couscous, corn) and some starchy roots and tubers are low in vitamin c; populations who consume these staples can have lower overall vitamin c intake. [ , ] traditional cooking practices suboptimal diet is an important preventable risk factor for noncommunicable diseases, and a low intake of fruit was found to be the third leading dietary risk for deaths (two million deaths) and disability-adjusted life-years ( million dalys) globally [ ] . the world health organization recommends at least g (i.e., five portions) of fruit and vegetables per day, excluding potatoes, sweet potatoes, cassava, and other starchy roots [ ] . historically, scurvy has been reported in refugee camps in ethiopia; the relief food distributed to the refugees was almost completely deficient in vitamin c, and the environment where the camps were located precluded an adequate supply of fresh food [ ] . however, vitamin c deficiency may even be common in fertile areas of africa, such as uganda [ ] . there have been a number of outbreaks of clinical scurvy in recent years, including figure . estimated vitamin c content of selected fruit and vegetables. data derived from the united states department of agriculture (https://fdc.nal.usda.gov/). note that vitamin c content can vary depending on the plant variety, and cooking may decrease the vitamin c content to variable extents. pulses include kidney beans, chickpeas, mung beans, pinto beans, soybeans, lentils, peanuts, split peas; nuts include hazelnuts, pistachios, macadamia nuts, pecans, walnuts, brazil nuts, cashew nuts; seeds include chia, flax seeds, pumpkin seeds, sunflower seeds, sesame seeds; grains include rice, millet, wheat/couscous, cornmeal. animal products, such as meat (other than liver), eggs, and milk contain negligible vitamin c. dotted lines: lower line indicates daily intake to prevent scurvy ( mg/d); upper line indicates daily intake for optimal health ( mg/d). suboptimal diet is an important preventable risk factor for noncommunicable diseases, and a low intake of fruit was found to be the third leading dietary risk for deaths (two million deaths) and disability-adjusted life-years ( million dalys) globally [ ] . the world health organization recommends at least g (i.e., five portions) of fruit and vegetables per day, excluding potatoes, sweet potatoes, cassava, and other starchy roots [ ] . historically, scurvy has been reported in refugee camps in ethiopia; the relief food distributed to the refugees was almost completely deficient in vitamin c, and the environment where the camps were located precluded an adequate supply of fresh food [ ] . however, vitamin c deficiency may even be common in fertile areas of africa, such as uganda [ ] . there have been a number of outbreaks of clinical scurvy in recent years, including in tribesmen in kenya and during the afghanistan winter [ , ] , and cases of clinical scurvy continue to be diagnosed related to poor intake even in high-income countries [ , ] . food consumption is influenced by a number of factors, such as geographical, economic, social, and cultural [ ] . it is well known that economic factors, such as poverty, can limit the consumption of healthy foods. furthermore, tradition and social customs may influence the consumption of a variety of foods. for example, a study in nepal highlighted cultural beliefs around menstruation, pregnancy, and lactation that decreased micronutrient intake and intrahousehold disfavouritism towards women in the distribution of micronutrient-rich foods [ ] . in low-and middle-income countries (lmics), geographic considerations and agricultural practices influence the production and consumption of staple foods, which can greatly influence vitamin c intake. for example, countries whose populations consume grains such as rice and millet as staple foods (e.g., in asia and parts of africa) tend to have lower intakes of vitamin c [ , ] . in contrast, some areas of africa and latin america where yams and sweet potato are staple foods, vitamin c intakes may be higher. however, the vitamin c content of food can also vary depending on the time of harvest, transportation and storage conditions, and food preparation conditions. for example, the vitamin c content of some staple foods, e.g., cassava, is significantly depleted by different processing methods, which could lead to inaccuracies in estimated vitamin c intake [ ] . vitamin c is heat-labile and can be destroyed by cooking; the lower vitamin c status of indians and malays living in singapore is thought to be partly due to its destruction by more prolonged cooking [ ] . an optimal vitamin c intake (i.e., mg/d) can be obtained from five-plus daily servings of fresh fruit and vegetables, providing that at least one or two servings are high vitamin c foods, however, this is not always possible for many people around the world. therefore, taking supplements in addition to dietary intake can help to maintain optimal vitamin c status. there are many different forms of vitamin c supplements; however, research indicates that these generally have the same bioavailability as food-derived vitamin c [ ] . numerous studies have found that even in developed countries, where there is no shortage of fresh fruit and vegetables, those who consume supplements have significantly higher vitamin c status and/or lower prevalence of deficiency (table ) . two large health surveys carried out in canada (chms) and the usa (nhanes iv) reported % supplement use in canada and to % supplement use, for men and women, respectively, in the usa [ , ] . it should be noted, however, that in these surveys, supplement use was considered to be as little as once in the previous month. nevertheless, both studies found vitamin c status was at least µmol/l higher in supplement users, with a low prevalence of deficiency ( - %) in those who supplemented [ , ] . two studies in the uk indicated that people who did not supplement had a two-fold odds ratio of having a vitamin c status of < µmol/l and a three-fold odds ratio of their vitamin c status being < µmol/l, relative to concentrations > µmol/l [ , ] . table . effect of socioeconomic factors on vitamin c status. socioeconomic status/deprivation individuals with lower socioeconomic status or higher deprivation have lower vitamin c status and a higher prevalence of deficiency; this is partly due to the higher cost of good quality, nutrient-dense food. [ , , , , , [ ] [ ] [ ] [ ] [ ] [ ] education and social class similarly, individuals with lower education and manual occupations have lower vitamin c status. [ , , , , ] institutionalized institutionalized elderly, and other institutionalized individuals (e.g., priests, prisoners, boarding school children) have lower vitamin c status and a higher prevalence of deficiency; this is partly due to a lower dietary intake. [ , [ ] [ ] [ ] geographic differences in vitamin c status have been reported (table ) ; there are likely many factors that contribute to the observed differences. for example, significant differences in vitamin c status and prevalence of deficiency were observed between finland and neighboring russia (where strikingly low plasma concentrations were observed) [ ] . geographical differences in the consumption of fresh fruit and vegetables were apparent, which were associated with deficiency. low educational status was also noted to be associated with deficiency on the russian side of the border [ ] . another study carried out in five countries across europe indicated a difference in the vitamin c status of women, with the biggest differences being observed between northern ireland and the republic of ireland [ ] . no differences in vitamin c status were observed for men from these different countries, whilst women had higher vitamin c status than the men in three of the five countries. mosdol et al. [ ] reported that low-income participants living in scotland and northern island had a lower prevalence of deficiency than those living in england, whilst those living in wales had a higher prevalence of deficiency. as part of the su.vi.max trial, france was divided into seven regions, and vitamin c status was found to be significantly lower in the northern region [ ] . the reasons for these regional differences are unknown. in a large study of elderly people in india, a higher prevalence of deficiency was observed in the north ( % deficiency) compared with the south ( % deficiency) [ ] . similarly, in mexico, a higher prevalence of deficiency was observed in children in the north and south regions (~ % deficiency) compared with those living in mexico city ( % deficiency) [ ] . this could reflect differences in the socioeconomic status between urban and rural environments. table . environmental factors affecting vitamin c status. geographical region vitamin c status varies by geographical region, both within and between countries; this could partly reflect differences in socioeconomic status and available foods. [ , , , , , [ ] [ ] [ ] season vitamin c status varies seasonally between countries, likely reflecting different crops and thus the types and/or amounts of vitamin c-rich foods consumed. [ , , , ] climate drought and harsh winter climates have been associated with outbreaks of clinical scurvy. [ ] pollution exposure to environmental pollutants, e.g., smoke, can deplete vitamin c status; this is partly due to enhanced oxidative stress. [ , , [ ] [ ] [ ] [ ] [ ] since fresh fruit and vegetables are the major source of vitamin c for most people, it is perhaps not surprising that there have been reports of seasonal differences in vitamin c status (table ) . surprisingly, however, studies carried out in england and china have indicated that vitamin c status tends to be highest in winter and lowest in autumn, with up to µmol/l difference between these seasons [ , ] . another study in china indicated a much higher vitamin c status in winter relative to spring [ ] . this likely reflects the types or amounts of vitamin c-rich foods being consumed in winter. similar trends were observed in northern india, with less deficiency being observed in the winter months; however, in southern india, the winter months were associated with a higher prevalence of deficiency [ ] . this likely reflects the different climatic and agricultural patterns across the subcontinent. it is possible that seasonal variances in plasma vitamin c concentrations are affected by baseline vitamin c status, i.e., whether the individual is already saturated or not. bates et al. [ ] reported seasonal variations in participants with higher intakes and blood status at baseline compared with little variation in those with low intakes and status, the latter likely due to a depleted body pool and preferential uptake of the vitamin by tissues. changes in climate, such as drought, are also likely to impact on the vitamin c status of the populations reliant on local foods in the affected region [ ] . this also leads to increased reliance on staple crops like cassava that lose their vitamin content prior to consumption [ ] . currently, over half of the world's population lives in urban areas, and who data indicate that more than % of people living in urban areas are exposed to air quality levels that exceed who guideline limits, with lmics suffering from the highest exposures [ , ] . air pollution causes an estimated seven million premature deaths worldwide every year, primarily resulting from increased mortality from strokes, heart disease, chronic obstructive pulmonary disease, lung cancer, and acute respiratory infections [ ] . environmental air pollution, such as smoke derived from burning biomass, can comprise reactive species that potentially affect in vivo antioxidant status [ ] . another example is environmental tobacco smoke, which is an underestimated pollutant in many parts of the world. exposure to environmental tobacco smoke is associated with depleted vitamin c status in both nonsmoking adults and children [ , [ ] [ ] [ ] [ ] [ ] . tribble et al. [ ] found that the vitamin c status of passive smokers was significantly lower than that of nonexposed nonsmokers, despite comparable dietary intakes of the vitamin. hypovitaminosis c was observed in % of passive smokers, but not in nonexposed nonsmokers. analysis of the data of children from the nhanes iii and iv surveys revealed a dose-response relationship between levels of tobacco exposure and serum vitamin c concentrations [ , ] . not all studies in adults, however, have shown effects of passive smoking on vitamin c status [ ] [ ] [ ] [ ] . nevertheless, supplementation with vitamin c and other antioxidants was found to decrease oxidative biomarkers in participants exposed to environmental tobacco smoke [ , ] . in high-income settings, females appear to have higher vitamin c status and a lower prevalence of deficiency than males [ ] . according to mccall et al. [ ] , uk males have a four-fold odds ratio of deficiency compared with females ( table ). the difference in vitamin c status between males and females is thought to be partly a result of a volumetric dilution effect due to the higher fat-free mass of males [ ] . there are also differences in dietary intakes between men and women, with women generally having comparable or higher intakes than men in high-income countries, although this difference is less apparent in some low-income settings [ ] . it should also be noted that pregnancy and lactation typically lower women's vitamin c status due to hemodilution and the needs of the developing fetus and growing infant (see below). many countries have higher dietary recommendations for men (to take into account the differences in body mass) and for pregnant and lactating women [ ] . table . effect of demographic factors on vitamin c status. males generally have lower vitamin c status, and a higher prevalence of deficiency, than females; this is partly a result of a volumetric dilution effect due to the higher fat-free mass of males. this difference is less apparent in some low-and middle-income countries. [ , , , , , , , [ ] [ ] [ ] , , , , , [ ] [ ] [ ] [ ] age both children and elderly tend to have higher vitamin c status in high-income settings; this could partly be due to lower body weight. elderly can have a higher prevalence of vitamin c deficiency in some settings; this could be due to lower intake and/or comorbidities. [ , , , , , , , , , ] race in the us and uk, african-caribbean and south asian people had a lower status than caucasians. in south asia, malays and indians had a lower status than chinese; this is thought to be partly due to differences in culinary practices. differences are more apparent between women of different races. [ , , , , ] some studies carried out in people aged > years (e.g., the french pola study and the british national diet and nutrition survey) have shown lower vitamin c status than other studies carried out in the same countries with younger age groups (e.g., the french su.vi.max study and the european epic-norfolk study); however, it is not ideal to compare values between different studies due to potential methodological differences. a number of studies have indicated that older age within the same study population is associated with an increased prevalence of vitamin c deficiency, particularly in men, and older men also tend to have a lower vitamin c intake than older women [ , , , ] . however, a counterpoint to this is that overall vitamin c status can be higher in older people [ , , ] , although not in all cases, as was found in men in finland who had lower vitamin c status with older age [ ] . schleicher et al. found a u-shaped curve for vitamin c status over the age range of to + years [ ] . it is possible that the lower body mass of children and elderly, due to age-related frailty, could contribute to their higher vitamin c status. however, there are, clearly, subpopulations within the aging population who have increased deficiency, likely due to lower intake and/or comorbidities. a number of studies have indicated that vitamin c status varies by race (table ; reviewed in [ ] ). the prevalence of vitamin c deficiency appeared to be highest amongst south asians and was thought to be partly due to traditional cooking practices. it was also suggested that the high proportion of individuals with low vitamin c concentrations in south asian populations might contribute to their higher rates of cardiovascular disease. only a few studies have assessed different ethnic groups within the same study [ , , , ] . in , koh et al. [ ] assessed vitamin c status in a cohort of black and white participants in mississippi, usa. black males and females had significantly lower vitamin c status than white males and females (up to µmol/l difference for females). the more recent us nhanes iv survey also found significantly lower vitamin c status in black females compared with white females [ ] . in london, the vitamin c status of black and south asians was significantly lower than white participants (up to µmol/l lower for south asian females) [ ] . similarly, in singapore, malays and asian indians were found to have significantly lower vitamin c status than chinese (up to µmol/l for females) [ ] . studies in uganda, south africa, and nigeria all showed high rates of deficiency in predominately black africans [ ] . socioeconomic status affects diet quality as foods of higher quality and higher nutritional value generally cost more [ ] . therefore, it is not surprising that numerous studies have shown that lower socioeconomic status and deprivation negatively impact on vitamin c status ( table ). in a uk study, mccall et al. [ ] reported that those who were most deprived (based on the townsend deprivation index) had a two-fold odds ratio of vitamin c deficiency relative to those with plasma values above µmol/l. this finding was supported by mosdol et al. [ ] , who specifically focused on the low-income population within the uk, and showed a higher prevalence of deficiency and insufficiency than has been reported for the general uk population. bates et al. [ ] reported a three-fold difference in plasma vitamin c status for people of low socioeconomic status in the uk relative to those of higher status. a two-fold difference in vitamin c intake between the two socioeconomic groups likely contributed to the observed differences in vitamin c status. other more recent surveys have confirmed the association of low vitamin c status with low socioeconomic status [ , ] . the british national diet and nutrition survey indicated a µmol/l increase in vitamin c status in adults for every additional £ , of income [ ] . similar findings have been reported for the level of education, with the lowest level of education associated with the lowest vitamin c status [ , ] . mccall et al. [ ] reported that those with the lowest level of education in the uk had a . -fold odds ratio of deficiency relative to a vitamin c status of > µmol/l. the same authors investigated social class and found that those having manual occupations had a three-fold odds ratio of deficiency compared with those having nonmanual occupations [ ] . similar findings were reported by wreiden et al. [ ] , with two-to three-fold higher prevalence of vitamin c deficiency for females and males, respectively, with manual occupations. one survey of elderly people assessed institutionalized individuals relative to free-living individuals [ ] . the authors found significantly lower vitamin c status ( vs. µmol/l) and a higher prevalence of deficiency ( % vs. %) in institutionalized elderly compared with free-living elderly, respectively. much of this is likely due to a higher proportion of individuals consuming less than the recommended nutrient intake for vitamin c in institutional settings [ ] . this will become a growing concern with an increasingly aging population. other institutionalized individuals, e.g., priests, prisoners, and boarding school children, have also been found to have lower vitamin c status, and higher hypovitaminosis c and severe deficiency, compared to control groups [ ] [ ] [ ] . bodyweight and the related bmi, waist circumference, or waist-to-hip ratio are well known to have a significant association with vitamin c status (table ) . numerous studies have shown an inverse association between body weight or bmi and vitamin c status, with obese individuals having the lowest vitamin c status [ ] [ ] [ ] , , , ] . schleicher et al. [ ] reported up to a µmol/l difference in the vitamin c status of obese women compared with women of healthy weight (i.e., versus µmol/l, respectively). pearson et al. [ ] found that individuals with hypovitaminosis c (i.e., < µmol/l) had significantly higher weight, bmi, and waist circumference. lower vitamin c status in those of the highest weight could be partly due to lower dietary intake of the vitamin [ , ] . in support of this, lower vitamin c status was found in those with the highest fat intake [ ] . it has also been suggested that the observed differences in vitamin c status could be a result of volumetric dilution due to differences in fat-free mass [ ] . this premise is supported by supplementation studies that have indicated that individuals with higher body weight do not replete as readily as those of normal body weight [ , ] . based on these observations, block et al. [ ] proposed that recommended vitamin c intakes should be based on a dose per kg body weight or in terms of an ideal plasma concentration. this is a prudent recommendation considering the ongoing increase in body weight globally, with the prevalence of obesity exceeding % in some countries [ , ] . obesity is a risk factor for numerous diseases, particularly cardiometabolic diseases, such as diabetes and cardiovascular disease, which are also associated with lower vitamin c status and a higher prevalence of deficiency [ ] . enhanced dietary fat and sugar, which are risk factors for cardiometabolic diseases, are also associated with decreased vitamin c intake and status [ , ] . table . health aspects that affect vitamin c status. bodyweight, bmi individuals with higher body weight or bmi have lower vitamin c status; this is likely partly due to a volumetric dilution effect. [ ] [ ] [ ] , , , , , , , , ] physical activity physical activity level positively correlates with vitamin c status, with inactive individuals having a -fold odds ratio of deficiency; this is likely partly due to associated lifestyle factors such as diet and body weight. [ , ] pregnancy and lactation pregnancy is associated with lower vitamin c status; this is partly due to hemodilution and active transfer of vitamin c to the developing fetus and growing infant via breastmilk. [ ] polymorphisms in the genes for the vitamin c transporter (svct ) and haptoglobin (hp - ) are associated with lower vitamin c status; the latter is thought to be due to enhanced oxidative stress. [ , , [ ] [ ] [ ] [ ] smoking smokers have lower vitamin c status and a higher prevalence of deficiency than nonsmokers; this is partly due to enhanced oxidative stress. [ ] [ ] [ ] , , , [ ] [ ] [ ] , , , , , , , [ ] [ ] [ ] [ ] disease states various communicable and noncommunicable diseases are associated with lower vitamin c status; this is partly due to inflammatory processes and enhanced oxidative stress. [ , - ] pregnant women typically have lower vitamin c status compared with nonpregnant women [ ] . this is most likely due to hemodilution, as well as active transfer of the vitamin to the developing fetus [ ] . women with complications of pregnancy can have even lower vitamin c status [ , ] . supplementation of pregnant women with vitamin c can potentially decrease the risk of some pregnancy-related complications [ ] . studies in high-income countries, which included women with normal vitamin c status, have failed to show benefit from supplementation [ ] . however, studies in low-income settings with high rates of vitamin deficiency show potential benefits, including decreased rates of low birth weight, decreased hospital admissions, and possible decreased rates of pre-eclampsia [ ] . it is noteworthy that the recently discovered epigenetic regulatory activities of vitamin c could have important roles to play in fetal development [ ] . an animal model has indicated that maternal vitamin c can regulate the reprogramming of dna methylation and germline development [ ] . it is likely that lactating women also have lower vitamin c status due to the transfer of vitamin c to the growing infant via breastmilk. many global authorities have taken the enhanced requirements of pregnant and lactating women into consideration, with recommendations above their standard dietary recommendations of + - mg/d for pregnant women and + - mg/d for lactating women [ ] . vitamin c status can potentially be influenced by genetic variants. the slc a gene encodes the sodium-dependent vitamin c transporter- (svct ), which is responsible for active uptake of dietary vitamin c through the intestinal epithelium and reuptake of filtered vitamin c via the kidney tubules and is essential in vitamin c-requiring animals [ , ] . a number of single nucleotide variants have been identified in the slc a gene, and modeling of in vitro data for four of these variants indicates % to % decreases in vitamin c uptake [ , ] . these variants are relatively common in those of african descent ( - %), and the variant with the largest decrease in vitamin c transport has a high prevalence in african americans [ ] . meta-analysis has indicated a strong association of another of these variants with decreased vitamin c status in five cohorts in the uk (frequency of~ %) [ ] . in the british women's heart and health study, a further two variants, with relatively common frequencies of~ %, were also found to be associated with vitamin c status [ ] . cahill et al. [ ] reported that variants of svct can also modify the strength of the correlation between dietary vitamin c and serum vitamin c. vitamin c status could be further influenced by genetic variants affecting the metabolism of the vitamin [ ] . a common variant of the hemoglobin-binding protein haptoglobin (hp - ) has a decreased ability to bind hemoglobin and results in increased oxidation of vitamin c in vitro [ ] . several studies have shown that this variant is associated with lower circulating vitamin c concentrations [ ] [ ] [ ] . the hp - variant appeared to have a greater effect on individuals with dietary vitamin c intakes < mg/day [ ] . it is noteworthy that genetic variants can show marked geographical differences; e.g., hp - is present in~ % northwest europeans, % iranians, % thais and chinese, and % indians (where it is thought to have originated) [ ] . other genetic variants, such as those of the detoxifying enzyme glutathione s-transferase, may also have associations with vitamin c status, particularly in individuals with lower intakes, thereby resulting in an increased risk of deficiency [ ] . high-dose vitamin supplementation has been shown to ameliorate certain gene variant defects [ ] and is hypothesized to occur with vitamin c-related variants [ ] . therefore, individuals with genetic variants affecting vitamin c status may require higher dietary intakes. smoking is a well-known source of oxidants and in vivo oxidative stress [ ] . multiple studies have shown depleted vitamin c status and a higher prevalence of deficiency in smokers compared with nonsmokers (table ) . mccall et al. [ ] reported that current smokers had over a seven-fold odds ratio of deficiency compared with nonsmokers, and wrieden et al. [ ] showed two-to three-fold more deficiency in male and female smokers, respectively. smokers tended to have dietary intakes that were lower in vitamin c, e.g., lower fruit and vegetable intake and higher fat intake [ , , , ] . however, when differences in dietary intake were taken into account, smokers still exhibited lower vitamin c status and higher requirements than nonsmokers [ , , , ] . kallner et al. [ ] demonstrated over a % increase in vitamin c turnover in smokers compared with nonsmokers. a few international regulatory authorities have taken the enhanced requirements of smokers into consideration with additional intake recommendations of to mg/d above their normal adult recommendations [ ] . however, it is likely that these additional intakes are insufficient to compensate for the enhanced requirements of smokers [ ] . furthermore, some countries continue to show an increasing trend in smoking rates, which could potentially impact their population's vitamin c status and requirements [ ] . of note, smoking cessation results in an increase in vitamin c status [ ] . vitamin c status can be depleted by various disease states due to inflammatory processes and enhanced oxidative stress (reviewed in [ , , ] ). a number of studies of hospitalized patients showed a high prevalence of depleted plasma vitamin c status, and concentrations were inversely correlated with inflammatory markers [ ] [ ] [ ] [ ] . a wide range of medical conditions are associated with vitamin c insufficiency; these include noncommunicable diseases such as cardiovascular diseases (e.g., strokes, coronary artery disease and hypertension), congestive heart failure, malignancy, chronic inflammatory states (e.g., rheumatoid arthritis), metabolic disorders (e.g., diabetes), and cataracts [ , , ] . acute infectious diseases leading to enhanced inflammation are also associated with depleted plasma vitamin c concentrations in plasma and immune cells, as are a range of chronic infections such as hiv, helicobacter pylori, and tuberculosis, which are prevalent in many lmics [ , ] . it should also be noted that requirements for vitamin c during infections increase with the severity of the infection, requiring significantly enhanced intakes to reach normal plasma status [ ] . this is particularly pertinent to the current global coronavirus (sars-cov- ) pandemic, which causes severe pneumonia and sepsis, conditions known to be associated with significantly depleted vitamin c status [ , ] . it should also be noted that individuals with marginal vitamin c status are at higher risk of developing vitamin c deficiency [ ] , and once depleted, higher than recommended intakes of the vitamin are required to fully replete them again [ , ] . various factors have changed over time that could potentially affect vitamin c status. these include population demographics and health status, e.g., obesity and smoking rates. public health policies, such as recommended dietary intakes for vitamin c, have changed in many countries [ ] . therefore, have these temporal changes been reflected in changing vitamin c status over time? there have been relatively few studies that have assessed vitamin c status in the same populations or regions over time. the findings can also be complicated by changes in analytical methodologies over time. two surveys have been carried out years apart on elderly people in britain: one in by the department of health and social security, and the national diet and nutrition survey in [ ] . there was an increase in vitamin c status from to µmol/l between the two surveys. however, it should be noted that participants in the first survey were older and analytical methodologies may have varied between the two surveys. in contrast, the more recent national diet and nutrition surveys ( - ) have shown a significant % increase in vitamin c deficiency over the nine-year period in women aged - [ ] . schleicher et al. [ ] carried out an indepth comparison of us vitamin c status in nhanes iv ( ) ( ) relative to nhanes iii that was undertaken - years earlier (i.e., - ) [ ] . for those aged ≥ years, overall vitamin c deficiency decreased by about % (from % to %) between the two surveys. of note, there was an increase in the recommended dietary intake for vitamin c in the us in , from to mg/d for men and to mg/d for women [ ] . however, it is unlikely that this increase in dietary recommendations fully accounts for the decrease in vitamin c deficiency over time as there were also some differences in methodology between the two surveys, with the more recent survey likely being more accurate [ ] . looking back even earlier to the nhanes ii survey (carried out between and ), vitamin c status was reported to be higher for both men and women (i.e., ≥ µmol/l for men and ≥ µmol/l for women), with % deficiency reported, despite lower dietary intakes compared to the later nhanes iii survey [ ] . it should be noted, however, that vitamin c in the nhanes ii samples was analyzed using the , -dinitrophenylhydrazine method, which can be prone to interference by other components in plasma and thus potentially overestimate vitamin c concentrations [ ] . other time course data is available from studies carried out in finland and neighboring russia between and [ , ] . in north karelia, finland, the vitamin c status of men decreased from to µmol/l over years, then rose slightly to µmol/l over the next year period [ ] . nyyssonen et al. reported a small increase in baseline vitamin c values in finish men over years [ ] . in pitkäranta, russia, the vitamin c status of women decreased from to µmol/l over a -year period, while the vitamin c status of russian men remained in the deficiency range over a -year period [ ] . the blood samples from the more recent survey ( ) were from fasting participants; however, it is not clear whether they were fasting in the earlier surveys ( and ). another set of studies was carried out in java, indonesia, between and [ , ] . mean vitamin c status decreased in the subjects from to µmol/l over years, although the percentage of deficiency decreased from % to % over this time. the decrease in mean vitamin c status could partly be explained by the earlier study assessing nonfasting plasma (as demonstrated by a higher percentage of vitamin c status > µmol/l, i.e., % versus %). however, there are possibly other environmental, lifestyle, or health-related issues that could be responsible for the changes in vitamin c status over time in indonesia, finland, and russia. not all studies have shown changes in vitamin c status over time. a survey carried out in shanghai, china, over a five-year period (between and ) showed no change in vitamin c status over this time period, although there was a dip in status at the midpoint (from to µmol/l) [ ] . thus, there is currently no clear trend in vitamin c status over time. however, much of the vitamin c data is very dated, and thus may not accurately reflect the current situation, particularly in countries where there have been changes over time in specific factors that can affect vitamin c status. this narrative review describes the findings of numerous studies which highlight the various factors that can impact on vitamin c status and prevalence of deficiency. the studies were of variable quality; ideally, multivariate analysis of the various factors highlighted in these studies would be performed to further examine the relationships discussed. another limitation is the variable quality of the processes and methodologies used to assess vitamin c status in the studies; this has been addressed in detail in our review on global vitamin c status [ ] . global vitamin c status appears to be a cause for concern, and we believe this is primarily due to poor diet, particularly in lmics, although also apparent in subgroups within high-income settings [ ] . vitamin c concentrations provide a useful biomarker for a healthy diet; unfortunately, accurate analysis is costly, technically challenging, and time-consuming [ ] . thus, there is a need for low cost, accurate, and commercially available methods to assess plasma concentrations. equally, the current assessment of intake is also limited and fails to take into account that the vitamin may be almost entirely eliminated prior to consumption in some globally important crops, such as cassava [ ] . future amendments to nutrient reference tables should take into this aspect into account. clearly, there is a global need for increased consumption of vitamin-c-rich fresh fruit and vegetables. from our earlier review, this appears to be most notable in lmic's; however, it is also a concern in other at-risk groups [ ] . further education is required globally in how to meet the daily vitamin c requirements with locally available crops year-round. some staple foods such as cassava require prolonged cooking to remove toxins (in this case, cyanide); efforts have been made to reduce this content in genetically modified cassava, which could allow higher vitamin c content from this vitamin-rich plant at the time of consumption [ ] . given the high rates of deficiency in some diets, cooking practices may also require modification to help increase intake. a number of studies have assessed the potential for vitamin c supplements to reduce a range of noncommunicable diseases and infections [ , ] . however, there remains much controversy as to the efficacy of supplementation, primarily due to badly designed studies that do not take into account the baseline vitamin c status of the participants [ ] . therefore, knowledge of the high-risk groups for deficiency should be utilized for future studies as these groups are more likely to benefit from supplementation. in the meantime, global and local policymakers should consider the local data available on deficiency in an attempt to modify dietary intake and other modifiable risk factors. more of these risk factors should be taken into account during the review and update of global recommended dietary intakes for the vitamin. clinicians worldwide should also remain vigilant to detect and correct hypovitaminosis c and deficiency in the at-risk groups highlighted. the authors declare no conflict of interest. molecular basis for the deficiency in humans of gulonolactone oxidase, a key enzyme for ascorbic acid biosynthesis homo sapiens ascorbicus, a biochemically corrected robust human mutant global vitamin c status and prevalence of deficiency: a cause for concern? preprints key proteins for vitamin c uptake distribution of ascorbic acid, metabolites and analogues in man and animals vitamin c transporter slc a links renal reabsorption, vitamin c tissue accumulation, and perinatal survival in mice ascorbic acid recycling in human neutrophils does vitamin c act as a pro-oxidant under physiological conditions? toward a new recommended dietary allowance for vitamin c based on antioxidant and health effects in humans vitamin c pharmacokinetics in healthy volunteers: evidence for a recommended dietary allowance revisiting the pathobiology of scurvy: a review of the literature in the context of a challenging case scurvy: still a threat in the well-fed first world? discrepancies in global vitamin c recommendations: a review of rda criteria and underlying health perspectives vitamin c status of canadian adults: findings from the serum vitamin c and the prevalence of vitamin c deficiency in the united states serum beta-carotene and vitamin c as biomarkers of vegetable and fruit intakes in a community-based sample of french adults vegetable and fruit consumption, education and plasma vitamin c concentration in russian and finnish karelia human vitamin and mineral. requirements; food and agriculture organization estimated prevalence and predictors of vitamin c deficiency within uk's low-income population tunstall-pedoe, h. plasma vitamin c and food choice in the third glasgow monica population survey plasma concentrations of ascorbic acid in parturients from a hospital in southeast brazil micronutrient dilution associated with added sugar intake in elderly black south african women absorption of folic acid and ascorbic acid from nutrient comparable beverages prevalence and risk factors for vitamin c deficiency in north and south india: a two centre population based study in people aged years and over requirements of ascorbic acid, vitamin d, vitamin b , folate, and iron vitamins, selenium, iron, and coronary heart disease risk in indians, malays, and chinese in singapore cultural factors, caloric intake and micronutrient sufficiency in rural nepali households plasma vitamin c levels: risk factors for deficiency and association with self-reported functional health in the european prospective investigation into cancer-norfolk the lower vitamin c plasma concentrations in elderly men compared with elderly women can partly be attributed to a volumetric dilution effect due to differences in fat-free mass plasma vitamin c levels in men and women from different ethnic backgrounds living in england health effects of dietary risks in countries, - : a systematic analysis for the global burden of disease study world health organization. diet, nutrition and the prevention of chronic diseases: report of a joint who/fao expert consultation epidemiological patterns of scurvy among ethiopian refugees plasma vitamin c assay in women of reproductive age in kampala, uganda, using a colorimetric method outbreak of scurvy in tana river county, kenya: a case report an epidemic of scurvy in afghanistan: assessment and response scurvy, an old story in a new time: the hematologist's experience nutritional value of cassava for use as a staple food and recent advances for improvement synthetic or food-derived vitamin c-are they equally bioavailable? nutrients vitamins a, and c and folate status in mexican children under years and women - years: a probabilistic national survey highlights and research challenges from the - national diet and nutrition survey of people aged years and over are lifestyle factors good predictors of retinol and vitamin c deficiency in apparently healthy adults? vitamin c status correlates with markers of metabolic and cognitive health in -year-olds: findings of the chalice cohort study national diet and nutrition survey years to of the rolling programme genetic variation at the slc a locus is associated with circulating concentrations of l-ascorbic acid (vitamin c): evidence from independent studies with > , participants relationship between serum antioxidant vitamins a, e, and c and lipid profiles in priest subjects at the priest hospital cross-sectional dietary deficiencies among a prison population in papua new guinea plasma vitamin a and c status of in-school adolescents and associated factors in enugu state serum concentrations of carotenoids and vitamins a, e, and c in control subjects from five european countries factors influencing blood concentration of retinol, alpha-tocopherol, vitamin c, and beta-carotene in the french participants of the su.vi.max trial plasma ascorbic acid concentrations in the republic of karelia, russia and in north karelia, finland. eur fruit and vegetable intakes in relation to plasma nutrient concentrations in women in shanghai prediagnostic plasma vitamin c and risk of gastric adenocarcinoma and esophageal squamous cell carcinoma in a chinese population reduced plasma ascorbic acid concentrations in nonsmokers regularly exposed to environmental tobacco smoke environmental tobacco smoke and serum vitamin c levels in children micronutrient levels in children exposed to secondhand tobacco smoke plasma ascorbate in a population of children: influence of age, gender, vitamin c intake, bmi and smoke exposure influence of environmental tobacco smoke on vitamin c status in children long-term vitamin status and dietary intake of healthy elderly subjects. . vitamin, c vitamin c supplementation decreases oxidative stress biomarker f -isoprostanes in plasma of nonsmokers exposed to environmental tobacco smoke exposure to environmental tobacco smoke is associated with lower plasma beta-carotene levels among nonsmoking women married to a smoker characteristics of nonsmoking women exposed to spouses who smoke: epidemiologic study on environment and health in women from four italian areas plasma levels and redox status of ascorbic acid and levels of lipid peroxidation products in active and passive smokers oxidative stress induced by environmental tobacco smoke in the workplace is mitigated by antioxidant supplementation serum concentrations of beta-carotene, vitamins c and e, zinc and selenium are influenced by sex, age, diet, smoking status, alcohol consumption and corpulence in a general french adult population sex as a factor in levels of serum ascorbic acid in a healthy elderly population plasma vitamins a, c and e in the general population of singapore blood levels of vitamin c, carotenoids and retinol are inversely associated with cataract in a north indian population associations of age, smoking habits and diabetes with plasma vitamin c of elderly of the pola study vitamin c deficiency and risk of myocardial infarction: prospective population study of men from eastern finland comparison of selected blood components by race, sex, and age deficiency of vitamin c in south asia contribution of food prices and diet cost to socioeconomic disparities in diet quality and health: a systematic review and analysis plasma ascorbic acid concentrations and fat distribution in , british men and women in the european prospective investigation into cancer and nutrition norfolk cohort study zinc, vitamin a, and vitamin c status are associated with leptin concentrations and obesity in mexican women: results from a cross-sectional study body weight and prior depletion affect plasma ascorbate levels attained on identical vitamin c intake: a controlled-diet study marginal ascorbate status (hypovitaminosis c) results in an attenuated response to vitamin c supplementation global, regional, and national prevalence of overweight and obesity in children and adults during - : a systematic analysis for the global burden of disease study global trend in overweight and obesity and its association with cardiovascular disease incidence a significant relationship between plasma vitamin c concentration and physical performance among japanese elderly women el-sohemy, a. vitamin c deficiency in a population of young canadian adults vitamin c transporter gene polymorphisms, dietary vitamin c and serum ascorbic acid effect of haptoglobin on the metabolism of vitamin serum vitamin c concentration is influenced by haptoglobin polymorphism and iron status in chinese haptoglobin genotype modifies the association between dietary vitamin c and serum ascorbic acid deficiency diet, antioxidant status, and smoking habits in french men the influence of smoking on vitamin c status in adults ascorbic acid requirements for smokers: analysis of a population survey lifestyle behaviors and serum vitamin c in the thai population in bangkok metropolitan rationale and impact of vitamin c in clinical nutrition intravenous vitamin c for cancer therapy-identifying the current gaps in our knowledge vitamin c in pneumonia and sepsis is diabetes associated with lower vitamin c status in pregnant women? a prospective study poor vitamin c status late in pregnancy is associated with increased risk of complications in type diabetic women: a cross-sectional study vitamin c supplementation in pregnancy is vitamin c supplementation beneficial? lessons learned from randomised controlled trials vitamin c supplementation in pregnancy: a review of current literature the epigenetic role of vitamin c in health and disease maternal vitamin c regulates reprogramming of dna methylation and germline development human genetic variation influences vitamin c homeostasis by altering vitamin c transport and antioxidant enzyme function vitamin c deficiency and scurvy are not only a dietary problem but are codetermined by the haptoglobin polymorphism biological and clinical significance of haptoglobin polymorphism in humans el-sohemy, a. functional genetic variants of glutathione s-transferase protect against serum ascorbic acid deficiency high-dose vitamin therapy stimulates variant enzymes with decreased coenzyme binding affinity (increased k(m)). am vitamin c: working on the x-axis plasma malondialdehyde is induced by smoking: a study with balanced antioxidant profiles do dietary and supplementary intakes of antioxidants differ with smoking status? dietary patterns of women smokers and non-smokers smoking and exposure to environmental tobacco smoke decrease some plasma antioxidants and increase gamma-tocopherol in vivo after adjustment for dietary antioxidant intakes ascorbate is depleted by smoking and repleted by moderate supplementation: a study in male smokers and nonsmokers with matched dietary antioxidant intakes on the requirements of ascorbic acid in man: steady-state turnover and body pool in smokers a systematic analysis from the global burden of disease study effect of smoking cessation on plasma ascorbic acid concentration vitamin c deficiency in australian hospitalized patients: an observational study vitamin c deficiency in a university teaching hospital effects of acute-phase response on nutritional status and clinical outcome of hospitalized patients hypovitaminosis c in hospitalized patients vitamin c and infections patients with community acquired pneumonia exhibit depleted vitamin c status and elevated oxidative stress hypovitaminosis c and vitamin c deficiency in critically ill patients despite recommended enteral and parenteral intakes people with marginal vitamin c status are at high risk of developing vitamin c deficiency vitamin c deficiency and depletion in the united states: the third national health and nutrition examination survey, to institute of medicine panel on dietary antioxidants and related compounds. dietary reference intakes for vitamin, c.; vitamin, e.; selenium, and carotenoids agreement among indicators of vitamin c status ascorbic acid and dehydroascorbic acid analyses in biological samples van der velden, u. java project on periodontal diseases: the relationship between vitamin c and the severity of periodontitis van der velden, u. java project on periodontal diseases: periodontal bone loss in relation to environmental and systemic conditions appropriate handling, processing and analysis of blood samples is essential to avoid oxidation of vitamin c to dehydroascorbic acid