key: cord-258595-bk35vxlr
authors: Westhaus, Sandra; Weber, Frank-Andreas; Schiwy, Sabrina; Linnemann, Volker; Brinkmann, Markus; Widera, Marek; Greve, Carola; Janke, Axel; Hollert, Henner; Wintgens, Thomas; Ciesek, Sandra
title: Detection of SARS-CoV-2 in raw and treated wastewater in Germany – Suitability for COVID-19 surveillance and potential transmission risks
date: 2020-08-18
journal: Sci Total Environ
DOI: 10.1016/j.scitotenv.2020.141750
sha: 
doc_id: 258595
cord_uid: bk35vxlr

Abstract Wastewater-based monitoring of the spread of the new SARS-CoV-2 virus, also referred to as wastewater-based epidemiology (WBE), has been suggested as a tool to support epidemiology. An extensive sampling campaign, including nine municipal wastewater treatment plants, has been conducted in different cities of the Federal State of North Rhine-Westphalia (Germany) on the same day in April 2020, close to the first peak of the corona crisis. Samples were processed and analysed for a set of SARS-CoV-2-specific genes, as well as pan-genotypic gene sequences also covering other coronavirus types, using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Additionally, a comprehensive set of chemical reference parameters and bioindicators was analysed to characterize the wastewater quality and composition. Results of the RT-qPCR based gene analysis indicate the presence of SARS-CoV-2 genetic traces in different raw wastewaters. Furthermore, selected samples have been sequenced using Sanger technology to confirm the specificity of the RT-qPCR and the origin of the coronavirus. A comparison of the particle-bound and the dissolved portion of SARS-CoV-2 virus genes shows that quantifications must not neglect the solid-phase reservoir. The infectivity of the raw wastewater has also been assessed by viral outgrowth assay with a potential SARS-CoV2- host cell line in vitro, which were not infected when exposed to the samples. This first evidence suggests that wastewater might be no major route for transmission to humans. Our findings draw attention to the need for further methodological and molecular assay validation for enveloped viruses in wastewater.

The current SARS-CoV-2 pandemic has far-reaching global consequences on public health, economic activities, and societies as a whole, which are unprecedented in many respects and cannot be fully assessed yet (WHO, 2020) . The number and proportion of persons infected with COVID-19 are mainly determined based on individual testing and laboratory-based bio-molecular diagnostics using, e.g., reverse transcription-quantitative polymerase chain reaction (RT-qPCR). COVID-19 cases are reported by regional health authorities and aggregated on the level of, e.g., the Federal States in Germany, as well as on a national level (RKI, 2020) . It is expected that, based on the individual testing that is often triggered by symptoms of test candidates or their respective risk profile, the actual state of infection in a specific region can only be very roughly estimated (Wurtzer et al. 2020) . oral swab samples (Wu et al. 2020a) . Therefore, it must be systematically assessed whether the virus might, in addition to respiratory droplets, also be transmitted via feces in wastewater (Nemudryi et al. 2020 , Wu et al. 2020a . It could be shown that the duration of viral shedding differed among patients between 14 and 21 days past the onset of the infection . Furthermore, the magnitude of shedding varied from 10 2 to 10 8 RNA copies per gram feces (Lescure et al. 2020 , Pan et al. 2020 . Wastewater-based epidemiology (WBE) has been suggested as a potentially useful complementary tool to gain insights into the degree of infection spread in a population , Choi et al. 2018 , Rodriguez-Manzano et al. 2010 .

Recently, various studies detected SARS-CoV-2 RNA in wastewater worldwide (cf. (Medema et al. 2020) , France (Wurtzer et al. 2020) , USA , Australia , and Italy (La Rosa et al. 2020) . Wurtzer et al. (2020) reported the analysis of SARS-CoV-2 genes in the Greater Paris (France) area and were able to correlate trends in gene occurrence in the wastewater of different wastewater treatment plants (WWTP) with the number of infected individuals. Medema et al. (2020) have shown a good correlation between the number of COVID-19 cases and the gene concentration in the wastewater of different Dutch cities.

However, the studies differed in, e.g., the type of samples, processing procedure, and targeted genes (like N1, N2, N3, and ORF1ab) in RT-qPCR analysis. Only a few studies were complemented by infectivity tests of the genes to determine whether the genetic material was present in intact virus particles or as free nucleic acids. Furthermore, only a few studies comprised phylogenetic analyses to better identify the genetic profile of the obtained material. An overview of recent studies conducted and reported in 2020 is given in Table 1 . 

Nine municipal WWTP operated by six different water boards were selected for analysis throughout North-Rhine Westphalia (Germany). The plants differed in their design capacity, treatment processes, and connected catchment area characteristics (Table 2 ). Using installed autosampler devices, the operators of the WWTP collected 24 h flow-dependent composite samples on April 8 th , 2020, during dry-weather conditions, either midnight to midnight or between the morning of April 8 th , and the morning of April 9 th . In addition to raw wastewater (sewage) inflow samples collected after the sand trap, treated sewage was sampled at selected locations ( J o u r n a l P r e -p r o o f 

J o u r n a l P r e -p r o o f

Frozen wastewater samples were thawed at 4°C, and a total of 45 mL were further processed. First, wastewater was centrifuged at 4,700x g for 30 minutes without break, and the clear supernatant was harvested. Purified wastewater was then concentrated using centrifugal ultrafiltration units (Amicon® Ultra-15 Centrifugal Filter Unit, Sigma). Therefore, 15 mL of wastewater was added to the filter unit and centrifuged for 15 minutes at 3,500x g, and the concentrated supernatant was harvested. This was repeated twice until 45 mL of wastewater were completely concentrated (final volume of concentrated supernatant approximately 450 µL). For the solid phaseof the wastewater sample, the pellet of the 45 mL sample was first washed with deionized water to remove aqueous remains from the sample and centrifuged at 4,700x g for five minutes before being resuspended in 150 µL deionized water and centrifuged at 4,700x g for five minutes again. A volume of 150 µL of the supernatant was then harvested for further RNA extraction, and the mass was determined (approx.

150 mg in influent and 5-10 mg in effluent). Contaminated equipment (e.g., reaction tubes, tips, filter units) were collected and autoclaved according to the daily cleaning program in the lab.

RNA was isolated using the NucleoSpin RNA Virus kit (Macherey Nagel) following the manufacturer's instructions. Briefly, 150 µL supernatant was mixed with lysis buffer supplemented with carrier RNA.

After binding on silica membranes, samples were washed several times and eluted in 50 µL RNasefree water. Isolated RNA was stored at -80°C.

probe-based Luna Universal One-Step RT-qPCR kits, 2 µl of RNA were subjected to reverse transcription performed at 55°C for 10 minutes. Initial denaturation was performed for 1 min at 95°C J o u r n a l P r e -p r o o f Table 3 : Sequences of primers and probe established and verified for the detection of SARS-CoV-2 (in patient material) by RT-qPCR.

E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT Figure S1 .

Purified wastewater samples that tested positive for SARS-CoV-2 (P2, P5, P11, P12) were investigated for replication-competent viruses following a recently published procedure (Hoehl et al. J o u r n a l P r e -p r o o f

All physicochemical and chemical parameters were analyzed immediately after sampling following DIN, EN, or ISO standard protocols. If this was not possible, the samples were chemically stabilized and then measured within the approved timeline of the standard protocols. The pH and conductivity were measured using a sensION MM374 Hach Lange instrument (EN ISO 10523 (2012-04), EN 27888 ). For the content of the dry residues, a defined volume of wastewater sample was dried at 105°C for 24 h (DIN 38409-1 (1987-01)), and the residue was weighed by a Sartorius A 120 S balance.

Ready-to-use-cell test kits were used to analyze the chemical oxygen demand (COD) with a

Macherey & Nagel PF12 and Vario 4 (test kits 985022, 985033 and 98029, ISO 15705 (2003-01)).

Total organic carbon (TOC) and total bounded nitrogen (TN b ) were analyzed via combustion using a Shimadzu carbon/nitrogen analyzer (EN 1484 (EN (1997 , EN 12260 (2003-12)). For the analysis of ammonia, nitrate, nitrite, total organic nitrogen, ortho-phosphate, and other ions such as chloride and sulfate, a Gallery discrete analyzer with photometric and turbidity methods were used after filtration through a 0.45-µm filter (Thermo Fisher Scientific, ISO 15923-1 (2014-07)).

Two different types of population size markers (exogenous and endogenous) were measured by liquid chromatography coupled with mass spectrometric detection (LC-MS) and photometric detection with a discrete analyzer (Choi et al. 2018 J o u r n a l P r e -p r o o f acetic acid were added to the methanol and water. The separation was run after injection of 10 µl sample with a linear gradient starting with 20% up to 90% and ending again with 20% methanol. All data were collected in SRM mode by using mass-labeled internal standards (supplementary table S1) and Xcalibur 2.0.7. SP1 software for data acquisition and quantification. The LOQs are in the range of 10 to 30 ng/L.

As endogenous parameters, creatinine and urea were quantified after filtration via a 0.45µm filter by using a Gallery discrete analyzer (Thermo Fisher Scientific). Creatinine was measured by photometry at 540 nm as quinonimine-chromogen after enzymatic reactions of creatine with creatinase, sarcosine oxidase, and ascorbate oxidase with a modified clinical method using Thermo Fisher Scientific reagent kit (enzyme. colortest PAP 981896) (Dörner 2003) . The Urea-method is based on a standardized bathwater method. In the first step, the contents of urea and ammonium are detected simultaneously. After enzymatic reaction of urea with urease to ammonium, ammonium reacts with nicotinamide adenine dinucleotide phosphate (NADPH) in a buffered solution at pH 8. The loss of NADPH is directly proportional to the ammonium content (Thermo Fisher Scientific test kit 981820).

The urea content is calculated by subtraction of the ammonium content (ISO 15923-1 (2014-07) from the total content of urea + ammonium.

In Germany, local health authorities report the number of COVID-19 cases confirmed by laboratory diagnosis after aggregation from the community to district level to state and federal authorities.

Whenever available, the cumulative prevalence and the cumulative number of COVID-19 patients recovered and deceased were obtained from community-level reports published on the homepages of the responsible local health authorities on April 9 th , 2020. If community-level reports were not available, district-level data published by the state health ministry of North Rhine-Westphalia (MAGS) on April 9 th , 2020, was used. Since the catchment areas of WWTPs rarely correspond to administrative boundaries, the cases were estimated by calculating weighted sums relative to the J o u r n a l P r e -p r o o f residents of each community connected to that sewer network. Acute prevalence was calculated by subtracting reported recovered and deceased patients (Table 4) . Nominal incidences (I nom ) were calculated by dividing the estimated number of cases (N nom ) in a catchment area by the nominal number of connected residents to the sewer (PE nom ). We note that these are estimates with considerable uncertainty since cases might be unevenly distributed between neighbouring districts, and recovered cases are often not based on laboratory diagnosis but the end of ordered quarantine.

In addition, the actual number of persons staying in the catchment area on the day of sampling (PE actual ) may also differ from the nominal number of connected residents (PE nom ). Treating the complete flow of the river Emscher, WWTP KLEM is partly treating water that was treated upstreaming by other treatment plants. Based on the assumption of poor removal of SARS-CoV-2 in conventional WWTP, reported cases for KLEM in Table 4 are upper estimates covering the complete upstream catchment. showed a sequence identity above 90%. The similarity of C2 and C4 amplicons to the SARS-CoV-2 specific sequence was 50% and 47.3%, respectively ( Figure 4) . Therefore, we conclude that the retained samples were negative for SARS-CoV-2. 

In wastewater treatment, solid residues are largely removed. We thus compared the amount of viral RNA in the aqueous and solid-phase of both inflow and effluent samples. During centrifugation in J o u r n a l P r e -p r o o f the processing of the wastewater samples, solid and aqueous phases are separated. To our understanding and as shown in other studies (Kocamemi et al. 2020 ), viral RNA of solid and liquid phase needs to be considered in wastewater surveillance. When comparing the aqueous and solid phase of the samples, we found a one log unit higher SARS-CoV-2 RNA copy number per mL in the solid phase (25 copies/mL) compared to the aqueous phase of the inflow sample (1.8 copies/mL), respectively ( Figure 5A ). The difference between the aqueous and solid phase was less evident in the effluent sample, with 8.8 and 13 gene equivalents per mL, respectively ( Figure 5B ). When comparing the aqueous phase only, the effluent exhibited a higher gene equivalent concentrations than the influent, which we attribute to repartitioning of gene material from the solid-to the liquid phase during wastewater treatment. In contrast, a difference of total viral copy numbers per mL between untreated and treated wastewater was not detectable ( Figure 5A and B). This might be explained by the sample conditions. While the residence time of the wastewater is about one day at the WWTP, sludge is continuously exchanged with an average sludge age of 10 to 14 days. We assume that solidphase concentrations are lower-estimates since we did not test whether further extraction steps could mobilize additional SARS-CoV-2 RNA from the solid phase. Results are shown as mean + SD of two independent PCR measurements from same sample material. RdRP RT-qPCR C T values for standard range between 18 (Standard 1 = 10 8 ) and 37 (Standard 6 = 10 2 ). Values of tested wastewater above C T 38 were considered negative for SARS-CoV-2. Standard curve was calculated using Bio-Rad CFX Manager software with E = 96.5 %, R 2 = 0.990 and slope = -3.408.

Although the wastewater in the investigated plants was treated by different processes, viral RNA is not eliminated, as shown above. To test the infectious potential of untreated and treated wastewater, a cell culture model was used to analyse that impact ( Figure 6 ). Infection of differentiated Caco-2 cells with cell culture grown, replication-competent SARS-CoV-2 (MOI 0.01) led to the induction of a cytopathic effect (CPE after 48-72 hours). The CPE is characterized by round and shrinking cells that detach from the culture surface. Observation of CPE after two to three days at a low MOI indicated rapid to moderate replication of the virus. Inoculation of differentiated Caco-2 cells for ten days with purified and concentrated wastewater (P2, P5, P11, and P12) did not result in the production of infectious SARS-CoV-2 particles (data not shown), which suggests that treated sewage appears to be non-infectious even though viral RNA fragments can be detected. Due to the lack of CPE, quantification and verification by RT-qPCR was not performed. 

The wastewater samples analysed showed typical wastewater characteristics for the different types of WWTPs studied (Brückner et al. 2018; Metcalf and Eddy 2012; supplementary J o u r n a l P r e -p r o o f 4. Discussion

During the SARS-CoV-2 pandemic, testing different sample material (e.g., throat swabs) was a crucial step in the detection of hotspots and limiting transmission. . The first SARS-CoV-2 PCR assays were developed against the E-gene and the N-gene to detect the virus in patient samples, and numerous studies analysing wastewater for SARS-CoV-2 surveillance used E-gene or N-gene specific PCRs (Medema et al., Ahmed et al., Wu et al., 2020) . To a minor proportion, also PCR targeting SARS-CoV-2 RdRP was used (Wurtzer et al., 2020) . In this study, wastewater samples were analysed with two different PCRs targeting SARS-CoV-2 RdRP and M-gene. In an initial analysis, a control sample When sequencing the different PCR amplicons obtained using wastewater samples taken during the SARS-CoV-2 pandemic and long before the outbreak (retained samples), distinct results for the test sample (P12) which fits SARS-CoV-2/human/USA/CA-CZB-1525/2020 isolate from NCBI database was found, but not for the retained samples suggesting an unspecific signal in RT-qPCR, respectively.

Although RNA samples used for PCR are highly purified, there might have been environmental contaminants affecting PCR. PCR is a highly sensitive method to detect nucleic acid and is strongly affected by pH, salt concentration, and contamination with extraneous nucleic acids that lead to false-negative or false-positive results, respectively (Schrader et al. 2012; Paul et al. 1991 which are complicated to sequence. Establishing qualitative nested PCR could be an option to improve sequencing results. Furthermore, extraneous nucleic acids can be accumulated during the concentration process of the wastewater sample. While single studies may avoid the accumulation of extraneous nucleic acids using filter units with 10 kDa cut-off and therefore also could limit detection of SARS-CoV-2, most studies used filter units with 100 kDa cut-off or other methods for concentrating wastewater samples Medema et al. 2020; Nemudryi et al. 2020; La Rosa et al. 2020a) . Although no false-positive results are described in these analyses, these studies did not use retained wastewater samples before the SARS-CoV-2 pandemic as control.

Nevertheless 

To establish SARS-CoV-2 wastewater-based epidemiology as a reliable tool for early-warning and surveillance of the current or future COVID-19 outbreaks, the method´s detection limit, precision, accuracy, and reliability must meet certain criteria to be useful for public surveillance. For example, early-warning requires a low detection limit to detect the very first cases, while in later phases of the epidemics, high precision and accuracy are needed to survey whether certain thresholds are exceeded, for example, the threshold currently set in Germany of 50 active cases per 100,000

residents.

On the day of our sampling campaign, we estimate the nominal acute incidence of COVID-19 to range between 30 and 174 cases per 100,000 residents in the nine catchment areas studied (Table 4 ).

Based on surveillance results (Figure 4 ), our findings indicate that the RT-qPCR employed is capable of resolving acute incidences of 50 cases per 100,000 residents in dry-weather conditions, although the method has not yet been optimized in terms of sensitivity and precision to detect even lower incidence.

The nine catchment areas studied differ considerably in size, wastewater flow (Table 2) , and nominal numbers of COVID-19 cases at the day of sampling ranging from 36 to 1,037 acute cases and from 85 to 1924 cumulative cases (Table 4) . Inter-comparing these nine catchment areas, we plotted the estimated cumulative and the acute prevalence against the measured SARS-CoV-2 load (Figure 8 ), the latter calculated from RT-qPCR measured M-gene copy concentration ( Figure 4 ) and the actual wastewater flow Q actual on the day of sampling (Table 2) . Clearly, the estimated nominal number of J o u r n a l P r e -p r o o f COVID-19 cases increases with increasing measured SARS-CoV-2 load, resulting in correlations both for cumulative and acute prevalence ( Figure 8A and B). Scatter in the correlations might be attributed to various reasons, including variations in virus RNA recovery and uncertainty in the estimated prevalence data. In contrast, plotting the incidence against SARS-CoV-2 concentration did not yield a conclusive correlation (not shown), likely because the precision of the qPCR employed was not sufficient to discriminate relatively minor differences in the incidence prevailing in the studied catchment areas at the time of sampling, ranging from 30 to 174 cases per 100,000 residents (less than an order of magnitude, Figure 8C and D). Although it cannot be evaluated based on the available data, if this correction is superior, it illustrates the potential of bioindicators to account for differences in wastewater composition.

In contrast to our approach, Medema et al. (2020) reported catchment-specific correlations plotting the increase in concentration (not load) of the N gene assays (and cycles of the E gene assays) against the increase in cumulative incidence from 0.1 to 100 cases per 100,000 residents (3 log 10 units) over a 7-weeks outbreak of the pandemics. While catchment-specific temporal correlations may be less susceptible to interference with other factors, we consider RNA load-based evaluations more reliable to cope with variations in wastewater flow, for example, stormwater events in combined sewer systems or variations in industrial wastewater production during a lockdown of industry and businesses. Table S5 .

Our results suggest that detected RNA fragments appear to be non-infectious based on smallvolume laboratory studies testing about 1 to 10 gene copies in one reaction. However, given the large capacity and flow rate of WWTPs (Table 2) , we calculate that each of the studied WWTP emits 6*10 10 to 6*10 12 SARS-CoV-2 gene equivalents per day to the receiving water bodies, some of which serve as crucial water resources for drinking water production, cooling water abstraction, public swimming, irrigation, recreation, and natural habitats. This viral load can be very roughly compared to the potential viral shedding by infected persons in the catchment area, although many uncertainties come with such an appraisal: Rose et al. (2015) report a mean amount of feces probably depending on factors such as the stage of infection, and are given in the range of 10 2 -10 8 gene copies per g feces . Wölfel et al. (2020) showed the development of gene copy findings on the time course of the infection. With, e.g., 100 infected persons in a sampled catchment, these assumptions would yield a viral load in a range as broad as 10 6 -10 12 gene copies per d in the wastewater. The findings, as shown in Figure 8 , are within but on the upper end of this broad range. Few studies have evaluated the fate of coronaviruses and other enveloped viruses in wastewater treatment and surface water (Gundy et al. 2009 , Ye et al. 2016 . In a recent review by Kitajima et al. (2020) , it is stated that currently no applicable dose-response models exist for SARS-CoV-2, which would allow for a better risk assessment. In a recent review by Foladori et al. (2020) , the current knowledge about the fate of SARS-CoV-2 in wastewater treatment systems was summarized, and the few studies undertaken indicate that there is a significant reduction in viral load through the treatment process, but still, gene fragments are detectable in effluents. Although it cannot be excluded with the current testing system of RT-qPCR targeting SARS-CoV-2 genes that virus emitted in large quantities is still infectious, studies analyzing SARS-CoV-2 environmental stability support the suggestion that infectivity and replication-competence of released viral particles are very unlikely , van Doremalen et al. 2020 .

Based on our findings, we conclude the following:

 SARS-CoV-2 RNA was detected in the inflow of all 9 studied WWTP at concentrations similar to those reported in other studies. Our screening of different target genes points to shortcomings in the selectivity of gene primers used in studies previously published by other authors that might also detect genes non-specific to SARS-CoV-2 viruses.

 Using Sanger sequencing, we confirmed human SARS-CoV-2 for the investigated sample taken during the SARS-CoV-2 pandemic outbreak. In contrast, positive signals in RT-qPCR were not  Quantification of SARS-CoV-2 gene concentrations and loads in wastewater needs to consider both aqueous and solid-phase SARS-CoV-2 detection methods and establish robust standard protocols for clean-up and RT-qPCR measurements.

 We observed poor removal of SARS-CoV-2 in all three of the studied conventional activatedsludge WWTP. Full-scale ozonation at one plant seemed to reduce SARS-CoV-2 fragments in the effluent. Membrane-based WWTP planned to be included in future studies.

 We found that the total load of gene equivalents in wastewater correlated with the cumulative and the acute number of COVID-19 cases reported in the respective catchment areas. We consider load-based correlations superior to gene copy concentration-based approaches.

Analysis of suitable bioindicators in the wastewater may improve the assessment of SARS-CoV-2 loads data in catchment areas.

 While our results indicate that RNA fragments are not infectious to Caco-2 cells in cell culturebased assays, further studies are needed to evaluate the risk SARS-CoV-2 may pose in the water cycle.

It is recommended to further develop and implement the concept of wastewater-based epidemiology as a complementary measure to survey the outbreak of the SARS-CoV-2 pandemic and impose catchment-specific measures if necessary.

J o u r n a l P r e -p r o o f Highlights:

 The first study that reports the detection of SARS-CoV-2 in wastewater in Germany using RT-qPCR.  The presence of SARS-CoV-2 was confirmed by sequencing, but also the risk of false-positive results has been elucidated.  In raw wastewater, 3.0 to 20 gene equivalents per mL were found in raw wastewater.  The replication potential tests were negative for wastewater samples.  Sanger sequencing was required to differentiate the genetic pattern clearly. 

First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: A proof of concept for the wastewater surveillance of COVID-19 in the community

Potential fecal transmission of SARS-CoV-2: Current evidence and implications for public health

Regressing SARS-CoV-2 sewage measurements onto COVID-19 burden in the population: a proof-of-concept for quantitative environmental surveillance

Status quo report on wastewater treatment plant, receiving water's biocoenosis and quality as basis for evaluation of large-scale ozonation process

Making Waves: Coronavirus detection, presence and persistence in the water environment: State of the art and knowledge needs for public health

Sentinel surveillance of SARS-CoV-2 in wastewater anticipates the occurence of COVID-19 cases

Wastewater-based epidemiology biomarkers: Past, present and future

Klinische Chemie und Hämatologie

Identification of a novel coronavirus in patients with severe acute respiratory syndrome

ELWAS, 2020. Elektronisches wasserwirtschaftliches Verbundsystem für die Wasserwirtschaftsverwaltung in NRW. Ministerium für Umwelt

SARS-CoV-2 from faeces to wastewater treatment: What do we know? A review

SARS-CoV-2 in river water : Implications in low sanitation countries

Evidence of SARS-CoV-2 Infection in Returning Travelers from Wuhan

First environmental surveillance for the presence of SARS-CoV-2 RNA in wastewater and river water in Japan

SARS-CoV-2 in wastewater: State of the knowledge and research needs

SARS-CoV-2 Detection in Istanbul Wastewater Treatment Plant Sludges

First proof of the capability of wastewater surveillance for COVID-19 in India through detection of genetic material of SARS-CoV-2-Sci Total Environ 746

Clinical and virological data of the first cases of COVID-19 in Europe: a case series

Early Transmission Dynamics in Wuhan, China, of Novel Coronavirus-Infected Pneumonia

Stability of SARS-CoV-2 on environmental surfaces and in human excreta

SARS-CoV-2 in wastewater: potential health risk, but also data source

Presence of SARS-Coronavirus-2 RNA in Sewage and Correlation with Reported COVID-19 Prevalence in the Early Stage of the Epidemic in The Netherlands

Wastewater Engineering : Treatment and Reuse

Editorial Perspectives: 2019 novel coronavirus (SARS-CoV-2): what is its fate in urban water cycle and how can the water research community respond

Temporal detection and phylogenetic assessment of SARS-CoV-2 in municipal wastewater. Preprint not yet peer reviewed

Asymptomatic cases in a family cluster with SARS CoV-2 infection

Concentration of viruses and dissolved DNA from aquatic environments by vortex flow filtration

SARS-CoV-2 RNA titers in wastewater anticipated COVID-19 occurrence in a low prevalence area

Presence and vitality of SARS-CoV-2 virus in wastewaters and rivers

Analysis of the evolution in the circulation of HAV and HEV in eastern Spain by testing urban sewage samples

The Characterization of Feces and Urine: A Review of the Literature to Inform Advanced Treatment Technology

PCR inhibitors-occurrence, properties and removal

First detection of SARS-CoV-2 RNA in wastewater in North America: A study in Louisiana

On the origin and continuing evolution of SARS-CoV-2

Optimized RT-qPCR Approach for the Detection of Intra-and Extra-Cellular SARS-CoV-2 RNAs

Aerosol and Surface Stability of SARS-CoV-2 as Compared with SARS-CoV-1

Water, sanitation, hygiene, and waste management for the COVID-19 virus. Interim guidance

Virological assessment of hospitalized patients with COVID-2019

Prolonged presence of SARS-CoV-2 viral RNA in faecal samples

SARS-CoV-2 titers in wastewater are higher than expected from clinically confirmed cases

Evaluation o flockdown impact on SARS-CoV-2 dynamics through viral genome quantification in Paris wastewaters

Clinical findings in a group of patients infected with the 2019 novel coronavirus (SARS-Cov-2) outside of Wuhan, China: retrospective case series

Survivability, Partitioning, and Recovery of Enveloped Viruses in Untreated Municipal Wastewater

We thank the water boards Emschergenossenschaft und Lippeverband (EGLV), Erftverband, Linksniederrheinische Entwässerungs-Genossenschaft (LINEG), Niersverband, Ruhrverband, and Wasserverband Eifel-Rur (WVER) for their participation in the sampling campaign on short notice and for ongoing support to FiW e.V. in difficult times. We acknowledge the work of all water-sector and health-care personnel for their continued service to society throughout the pandemics. M.B. was supported through the Global Water Futures (GWF) program that is funded through the Canada First Research Excellence Fund (CFREF).