id	sid	tid	token	lemma	pos
cord-269720-o81j3d1j	1	1	key	key	JJ
cord-269720-o81j3d1j	1	2	:	:	:
cord-269720-o81j3d1j	1	3	cord-269720-o81j3d1j	cord-269720-o81j3d1j	NN
cord-269720-o81j3d1j	1	4	authors	author	NNS
cord-269720-o81j3d1j	1	5	:	:	:
cord-269720-o81j3d1j	1	6	Page	Page	NNP
cord-269720-o81j3d1j	1	7	,	,	,
cord-269720-o81j3d1j	1	8	Kevin	Kevin	NNP
cord-269720-o81j3d1j	1	9	W.	W.	NNP
cord-269720-o81j3d1j	1	10	;	;	:
cord-269720-o81j3d1j	1	11	Britton	Britton	NNP
cord-269720-o81j3d1j	1	12	,	,	,
cord-269720-o81j3d1j	1	13	Paul	Paul	NNP
cord-269720-o81j3d1j	1	14	;	;	:
cord-269720-o81j3d1j	2	1	Boursnell	Boursnell	NNP
cord-269720-o81j3d1j	2	2	,	,	,
cord-269720-o81j3d1j	2	3	Michael	Michael	NNP
cord-269720-o81j3d1j	2	4	E.	E.	NNP
cord-269720-o81j3d1j	2	5	G.	G.	NNP
cord-269720-o81j3d1j	3	1	title	title	NN
cord-269720-o81j3d1j	3	2	:	:	:
cord-269720-o81j3d1j	3	3	Sequence	sequence	NN
cord-269720-o81j3d1j	3	4	analysis	analysis	NN
cord-269720-o81j3d1j	3	5	of	of	IN
cord-269720-o81j3d1j	3	6	the	the	DT
cord-269720-o81j3d1j	3	7	leader	leader	NN
cord-269720-o81j3d1j	3	8	RNA	RNA	NNP
cord-269720-o81j3d1j	3	9	of	of	IN
cord-269720-o81j3d1j	3	10	two	two	CD
cord-269720-o81j3d1j	3	11	porcine	porcine	JJ
cord-269720-o81j3d1j	3	12	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	3	13	:	:	:
cord-269720-o81j3d1j	3	14	Transmissible	transmissible	JJ
cord-269720-o81j3d1j	3	15	gastroenteritis	gastroenteritis	NN
cord-269720-o81j3d1j	3	16	virus	virus	NN
cord-269720-o81j3d1j	3	17	and	and	CC
cord-269720-o81j3d1j	3	18	porcine	porcine	JJ
cord-269720-o81j3d1j	3	19	respiratory	respiratory	JJ
cord-269720-o81j3d1j	3	20	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	3	21	date	date	NN
cord-269720-o81j3d1j	3	22	:	:	:
cord-269720-o81j3d1j	3	23	1990	1990	CD
cord-269720-o81j3d1j	3	24	journal	journal	NN
cord-269720-o81j3d1j	3	25	:	:	:
cord-269720-o81j3d1j	4	1	Virus	Virus	NNP
cord-269720-o81j3d1j	4	2	Genes	Genes	NNP
cord-269720-o81j3d1j	4	3	DOI	DOI	NNP
cord-269720-o81j3d1j	4	4	:	:	:
cord-269720-o81j3d1j	5	1	10.1007	10.1007	CD
cord-269720-o81j3d1j	5	2	/	/	SYM
cord-269720-o81j3d1j	5	3	bf00570024	bf00570024	NN
cord-269720-o81j3d1j	5	4	sha	sha	NNP
cord-269720-o81j3d1j	5	5	:	:	:
cord-269720-o81j3d1j	5	6	4ef6ca984ee03204c7cfb6206fa85e63fc990507	4ef6ca984ee03204c7cfb6206fa85e63fc990507	CD
cord-269720-o81j3d1j	6	1	doc_id	doc_id	CD
cord-269720-o81j3d1j	6	2	:	:	:
cord-269720-o81j3d1j	6	3	269720	269720	CD
cord-269720-o81j3d1j	6	4	cord_uid	cord_uid	NNS
cord-269720-o81j3d1j	6	5	:	:	:
cord-269720-o81j3d1j	7	1	o81j3d1j	o81j3d1j	VBN
cord-269720-o81j3d1j	8	1	The	the	DT
cord-269720-o81j3d1j	8	2	leader	leader	NN
cord-269720-o81j3d1j	8	3	RNA	RNA	NNP
cord-269720-o81j3d1j	8	4	sequence	sequence	NN
cord-269720-o81j3d1j	8	5	was	be	VBD
cord-269720-o81j3d1j	8	6	determined	determine	VBN
cord-269720-o81j3d1j	8	7	for	for	IN
cord-269720-o81j3d1j	8	8	two	two	CD
cord-269720-o81j3d1j	8	9	pig	pig	NN
cord-269720-o81j3d1j	8	10	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	8	11	,	,	,
cord-269720-o81j3d1j	8	12	tranmissible	tranmissible	JJ
cord-269720-o81j3d1j	8	13	gastroenteritis	gastroenteritis	NN
cord-269720-o81j3d1j	8	14	virus	virus	NN
cord-269720-o81j3d1j	8	15	(	(	-LRB-
cord-269720-o81j3d1j	8	16	TGEV	TGEV	NNP
cord-269720-o81j3d1j	8	17	)	)	-RRB-
cord-269720-o81j3d1j	8	18	,	,	,
cord-269720-o81j3d1j	8	19	and	and	CC
cord-269720-o81j3d1j	8	20	porcine	porcine	JJ
cord-269720-o81j3d1j	8	21	respiratory	respiratory	JJ
cord-269720-o81j3d1j	8	22	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	8	23	(	(	-LRB-
cord-269720-o81j3d1j	8	24	PRCV	PRCV	NNP
cord-269720-o81j3d1j	8	25	)	)	-RRB-
cord-269720-o81j3d1j	8	26	.	.	.
cord-269720-o81j3d1j	9	1	Primer	primer	NN
cord-269720-o81j3d1j	9	2	extension	extension	NN
cord-269720-o81j3d1j	9	3	,	,	,
cord-269720-o81j3d1j	9	4	of	of	IN
cord-269720-o81j3d1j	9	5	a	a	DT
cord-269720-o81j3d1j	9	6	synthetic	synthetic	JJ
cord-269720-o81j3d1j	9	7	oligonucleotide	oligonucleotide	NN
cord-269720-o81j3d1j	9	8	complementary	complementary	JJ
cord-269720-o81j3d1j	9	9	to	to	IN
cord-269720-o81j3d1j	9	10	the	the	DT
cord-269720-o81j3d1j	9	11	5′	5′	CD
cord-269720-o81j3d1j	9	12	end	end	NN
cord-269720-o81j3d1j	9	13	of	of	IN
cord-269720-o81j3d1j	9	14	the	the	DT
cord-269720-o81j3d1j	9	15	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	9	16	gene	gene	NN
cord-269720-o81j3d1j	9	17	of	of	IN
cord-269720-o81j3d1j	9	18	TGEV	TGEV	NNP
cord-269720-o81j3d1j	9	19	was	be	VBD
cord-269720-o81j3d1j	9	20	used	use	VBN
cord-269720-o81j3d1j	9	21	to	to	TO
cord-269720-o81j3d1j	9	22	produce	produce	VB
cord-269720-o81j3d1j	9	23	a	a	DT
cord-269720-o81j3d1j	9	24	single	single	RB
cord-269720-o81j3d1j	9	25	-	-	HYPH
cord-269720-o81j3d1j	9	26	stranded	strand	VBN
cord-269720-o81j3d1j	9	27	DNA	dna	NN
cord-269720-o81j3d1j	9	28	copy	copy	NN
cord-269720-o81j3d1j	9	29	of	of	IN
cord-269720-o81j3d1j	9	30	the	the	DT
cord-269720-o81j3d1j	9	31	leader	leader	NN
cord-269720-o81j3d1j	9	32	RNA	RNA	NNP
cord-269720-o81j3d1j	9	33	from	from	IN
cord-269720-o81j3d1j	9	34	the	the	DT
cord-269720-o81j3d1j	9	35	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	10	1	mRNA	mrna	NN
cord-269720-o81j3d1j	10	2	species	specie	NNS
cord-269720-o81j3d1j	10	3	from	from	IN
cord-269720-o81j3d1j	10	4	TGEV	TGEV	NNP
cord-269720-o81j3d1j	10	5	and	and	CC
cord-269720-o81j3d1j	10	6	PRCV	PRCV	NNP
cord-269720-o81j3d1j	10	7	,	,	,
cord-269720-o81j3d1j	11	1	the	the	DT
cord-269720-o81j3d1j	11	2	sequences	sequence	NNS
cord-269720-o81j3d1j	11	3	of	of	IN
cord-269720-o81j3d1j	11	4	which	which	WDT
cord-269720-o81j3d1j	11	5	were	be	VBD
cord-269720-o81j3d1j	11	6	determined	determine	VBN
cord-269720-o81j3d1j	11	7	by	by	IN
cord-269720-o81j3d1j	11	8	Maxam	Maxam	NNP
cord-269720-o81j3d1j	11	9	and	and	CC
cord-269720-o81j3d1j	11	10	Gilbert	Gilbert	NNP
cord-269720-o81j3d1j	11	11	cleavage	cleavage	NN
cord-269720-o81j3d1j	11	12	.	.	.
cord-269720-o81j3d1j	12	1	Northern	northern	JJ
cord-269720-o81j3d1j	12	2	blot	blot	NN
cord-269720-o81j3d1j	12	3	analysis	analysis	NN
cord-269720-o81j3d1j	12	4	,	,	,
cord-269720-o81j3d1j	12	5	using	use	VBG
cord-269720-o81j3d1j	12	6	a	a	DT
cord-269720-o81j3d1j	12	7	synthetic	synthetic	JJ
cord-269720-o81j3d1j	12	8	oligonucleotide	oligonucleotide	NN
cord-269720-o81j3d1j	12	9	complementary	complementary	JJ
cord-269720-o81j3d1j	12	10	to	to	IN
cord-269720-o81j3d1j	12	11	the	the	DT
cord-269720-o81j3d1j	12	12	leader	leader	NN
cord-269720-o81j3d1j	12	13	RNA	RNA	NNP
cord-269720-o81j3d1j	12	14	,	,	,
cord-269720-o81j3d1j	12	15	showed	show	VBD
cord-269720-o81j3d1j	12	16	that	that	IN
cord-269720-o81j3d1j	12	17	the	the	DT
cord-269720-o81j3d1j	12	18	leader	leader	NN
cord-269720-o81j3d1j	12	19	RNA	RNA	NNP
cord-269720-o81j3d1j	12	20	sequence	sequence	NN
cord-269720-o81j3d1j	12	21	was	be	VBD
cord-269720-o81j3d1j	12	22	present	present	JJ
cord-269720-o81j3d1j	12	23	on	on	IN
cord-269720-o81j3d1j	12	24	all	all	DT
cord-269720-o81j3d1j	12	25	of	of	IN
cord-269720-o81j3d1j	12	26	the	the	DT
cord-269720-o81j3d1j	12	27	subgenomic	subgenomic	NNP
cord-269720-o81j3d1j	12	28	mRNA	mRNA	NNP
cord-269720-o81j3d1j	12	29	species	specie	NNS
cord-269720-o81j3d1j	12	30	.	.	.
cord-269720-o81j3d1j	13	1	The	the	DT
cord-269720-o81j3d1j	13	2	porcine	porcine	JJ
cord-269720-o81j3d1j	13	3	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	13	4	leader	leader	NN
cord-269720-o81j3d1j	13	5	RNA	RNA	NNP
cord-269720-o81j3d1j	13	6	sequences	sequence	NNS
cord-269720-o81j3d1j	13	7	were	be	VBD
cord-269720-o81j3d1j	13	8	compared	compare	VBN
cord-269720-o81j3d1j	13	9	to	to	IN
cord-269720-o81j3d1j	13	10	each	each	DT
cord-269720-o81j3d1j	13	11	other	other	JJ
cord-269720-o81j3d1j	13	12	and	and	CC
cord-269720-o81j3d1j	13	13	to	to	IN
cord-269720-o81j3d1j	13	14	published	publish	VBN
cord-269720-o81j3d1j	13	15	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	13	16	leader	leader	NN
cord-269720-o81j3d1j	13	17	RNA	RNA	NNP
cord-269720-o81j3d1j	13	18	sequences	sequence	NNS
cord-269720-o81j3d1j	13	19	.	.	.
cord-269720-o81j3d1j	14	1	Sequence	sequence	NN
cord-269720-o81j3d1j	14	2	homologies	homology	NNS
cord-269720-o81j3d1j	14	3	and	and	CC
cord-269720-o81j3d1j	14	4	secondary	secondary	JJ
cord-269720-o81j3d1j	14	5	structure	structure	NN
cord-269720-o81j3d1j	14	6	similarities	similarity	NNS
cord-269720-o81j3d1j	14	7	were	be	VBD
cord-269720-o81j3d1j	14	8	identified	identify	VBN
cord-269720-o81j3d1j	14	9	that	that	WDT
cord-269720-o81j3d1j	14	10	may	may	MD
cord-269720-o81j3d1j	14	11	play	play	VB
cord-269720-o81j3d1j	14	12	a	a	DT
cord-269720-o81j3d1j	14	13	role	role	NN
cord-269720-o81j3d1j	14	14	in	in	IN
cord-269720-o81j3d1j	14	15	the	the	DT
cord-269720-o81j3d1j	14	16	biological	biological	JJ
cord-269720-o81j3d1j	14	17	function	function	NN
cord-269720-o81j3d1j	14	18	of	of	IN
cord-269720-o81j3d1j	14	19	these	these	DT
cord-269720-o81j3d1j	14	20	RNA	RNA	NNP
cord-269720-o81j3d1j	14	21	sequences	sequence	NNS
cord-269720-o81j3d1j	14	22	.	.	.
cord-269720-o81j3d1j	15	1	Transmissible	transmissible	JJ
cord-269720-o81j3d1j	15	2	gastroenteritis	gastroenteritis	NN
cord-269720-o81j3d1j	15	3	virus	virus	NN
cord-269720-o81j3d1j	15	4	(	(	-LRB-
cord-269720-o81j3d1j	15	5	TGEV	TGEV	NNP
cord-269720-o81j3d1j	15	6	)	)	-RRB-
cord-269720-o81j3d1j	15	7	and	and	CC
cord-269720-o81j3d1j	15	8	porcine	porcine	JJ
cord-269720-o81j3d1j	15	9	respiratory	respiratory	JJ
cord-269720-o81j3d1j	15	10	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	15	11	(	(	-LRB-
cord-269720-o81j3d1j	15	12	PRCV	PRCV	NNP
cord-269720-o81j3d1j	15	13	)	)	-RRB-
cord-269720-o81j3d1j	15	14	belong	belong	VBP
cord-269720-o81j3d1j	15	15	to	to	IN
cord-269720-o81j3d1j	15	16	the	the	DT
cord-269720-o81j3d1j	15	17	family	family	NN
cord-269720-o81j3d1j	15	18	Coronaviridae	Coronaviridae	NNP
cord-269720-o81j3d1j	15	19	,	,	,
cord-269720-o81j3d1j	15	20	a	a	DT
cord-269720-o81j3d1j	15	21	large	large	JJ
cord-269720-o81j3d1j	15	22	group	group	NN
cord-269720-o81j3d1j	15	23	of	of	IN
cord-269720-o81j3d1j	15	24	pleomorphic	pleomorphic	JJ
cord-269720-o81j3d1j	15	25	enveloped	envelop	VBN
cord-269720-o81j3d1j	15	26	viruses	virus	NNS
cord-269720-o81j3d1j	15	27	with	with	IN
cord-269720-o81j3d1j	15	28	a	a	DT
cord-269720-o81j3d1j	15	29	positive	positive	JJ
cord-269720-o81j3d1j	15	30	-	-	HYPH
cord-269720-o81j3d1j	15	31	stranded	strand	VBN
cord-269720-o81j3d1j	15	32	RNA	RNA	NNP
cord-269720-o81j3d1j	15	33	genome	genome	NN
cord-269720-o81j3d1j	15	34	.	.	.
cord-269720-o81j3d1j	16	1	TGEV	TGEV	NNP
cord-269720-o81j3d1j	16	2	causes	cause	VBZ
cord-269720-o81j3d1j	16	3	gastroenteritis	gastroenteritis	NN
cord-269720-o81j3d1j	16	4	in	in	IN
cord-269720-o81j3d1j	16	5	pigs	pig	NNS
cord-269720-o81j3d1j	16	6	,	,	,
cord-269720-o81j3d1j	16	7	resulting	result	VBG
cord-269720-o81j3d1j	16	8	in	in	IN
cord-269720-o81j3d1j	16	9	a	a	DT
cord-269720-o81j3d1j	16	10	high	high	JJ
cord-269720-o81j3d1j	16	11	mortality	mortality	NN
cord-269720-o81j3d1j	16	12	in	in	IN
cord-269720-o81j3d1j	16	13	neonates	neonate	NNS
cord-269720-o81j3d1j	16	14	(	(	-LRB-
cord-269720-o81j3d1j	16	15	1	1	CD
cord-269720-o81j3d1j	16	16	)	)	-RRB-
cord-269720-o81j3d1j	16	17	.	.	.
cord-269720-o81j3d1j	17	1	PRCV	PRCV	NNP
cord-269720-o81j3d1j	17	2	was	be	VBD
cord-269720-o81j3d1j	17	3	isolated	isolate	VBN
cord-269720-o81j3d1j	17	4	in	in	IN
cord-269720-o81j3d1j	17	5	several	several	JJ
cord-269720-o81j3d1j	17	6	European	european	JJ
cord-269720-o81j3d1j	17	7	countries	country	NNS
cord-269720-o81j3d1j	17	8	between	between	IN
cord-269720-o81j3d1j	17	9	1984	1984	CD
cord-269720-o81j3d1j	17	10	and	and	CC
cord-269720-o81j3d1j	17	11	1986	1986	CD
cord-269720-o81j3d1j	17	12	(	(	-LRB-
cord-269720-o81j3d1j	17	13	2	2	CD
cord-269720-o81j3d1j	17	14	-	-	SYM
cord-269720-o81j3d1j	17	15	4	4	CD
cord-269720-o81j3d1j	17	16	)	)	-RRB-
cord-269720-o81j3d1j	17	17	,	,	,
cord-269720-o81j3d1j	17	18	does	do	VBZ
cord-269720-o81j3d1j	17	19	not	not	RB
cord-269720-o81j3d1j	17	20	cause	cause	VB
cord-269720-o81j3d1j	17	21	diarrhea	diarrhea	NN
cord-269720-o81j3d1j	17	22	,	,	,
cord-269720-o81j3d1j	17	23	and	and	CC
cord-269720-o81j3d1j	17	24	has	have	VBZ
cord-269720-o81j3d1j	17	25	been	be	VBN
cord-269720-o81j3d1j	17	26	shown	show	VBN
cord-269720-o81j3d1j	17	27	to	to	TO
cord-269720-o81j3d1j	17	28	replicate	replicate	VB
cord-269720-o81j3d1j	17	29	in	in	IN
cord-269720-o81j3d1j	17	30	the	the	DT
cord-269720-o81j3d1j	17	31	respiratory	respiratory	JJ
cord-269720-o81j3d1j	17	32	tract	tract	NN
cord-269720-o81j3d1j	17	33	with	with	IN
cord-269720-o81j3d1j	17	34	little	little	JJ
cord-269720-o81j3d1j	17	35	or	or	CC
cord-269720-o81j3d1j	17	36	no	no	DT
cord-269720-o81j3d1j	17	37	clinical	clinical	JJ
cord-269720-o81j3d1j	17	38	signs	sign	NNS
cord-269720-o81j3d1j	17	39	,	,	,
cord-269720-o81j3d1j	17	40	but	but	CC
cord-269720-o81j3d1j	17	41	is	be	VBZ
cord-269720-o81j3d1j	17	42	very	very	RB
cord-269720-o81j3d1j	17	43	similar	similar	JJ
cord-269720-o81j3d1j	17	44	antigenically	antigenically	NN
cord-269720-o81j3d1j	17	45	and	and	CC
cord-269720-o81j3d1j	17	46	serologically	serologically	RB
cord-269720-o81j3d1j	17	47	to	to	IN
cord-269720-o81j3d1j	17	48	TGEV	TGEV	NNP
cord-269720-o81j3d1j	17	49	(	(	-LRB-
cord-269720-o81j3d1j	17	50	2	2	CD
cord-269720-o81j3d1j	17	51	,	,	,
cord-269720-o81j3d1j	17	52	4	4	CD
cord-269720-o81j3d1j	17	53	)	)	-RRB-
cord-269720-o81j3d1j	17	54	.	.	.
cord-269720-o81j3d1j	18	1	Virions	virion	NNS
cord-269720-o81j3d1j	18	2	from	from	IN
cord-269720-o81j3d1j	18	3	both	both	DT
cord-269720-o81j3d1j	18	4	viruses	virus	NNS
cord-269720-o81j3d1j	18	5	contain	contain	VBP
cord-269720-o81j3d1j	18	6	two	two	CD
cord-269720-o81j3d1j	18	7	envelope	envelope	NN
cord-269720-o81j3d1j	18	8	glycoproteins	glycoprotein	NNS
cord-269720-o81j3d1j	18	9	of	of	IN
cord-269720-o81j3d1j	18	10	relative	relative	JJ
cord-269720-o81j3d1j	18	11	molecular	molecular	JJ
cord-269720-o81j3d1j	18	12	mass	mass	NN
cord-269720-o81j3d1j	18	13	(	(	-LRB-
cord-269720-o81j3d1j	18	14	Mr	Mr	NNP
cord-269720-o81j3d1j	18	15	)	)	-RRB-
cord-269720-o81j3d1j	18	16	200,000	200,000	CD
cord-269720-o81j3d1j	18	17	(	(	-LRB-
cord-269720-o81j3d1j	18	18	spike	spike	NN
cord-269720-o81j3d1j	18	19	)	)	-RRB-
cord-269720-o81j3d1j	18	20	and	and	CC
cord-269720-o81j3d1j	18	21	M	M	NNP
cord-269720-o81j3d1j	18	22	r	r	NN
cord-269720-o81j3d1j	18	23	28,000	28,000	CD
cord-269720-o81j3d1j	18	24	-	-	HYPH
cord-269720-o81j3d1j	18	25	31,000	31,000	CD
cord-269720-o81j3d1j	18	26	(	(	-LRB-
cord-269720-o81j3d1j	18	27	membrane	membrane	NN
cord-269720-o81j3d1j	18	28	protein	protein	NN
cord-269720-o81j3d1j	18	29	)	)	-RRB-
cord-269720-o81j3d1j	18	30	and	and	CC
cord-269720-o81j3d1j	18	31	a	a	DT
cord-269720-o81j3d1j	18	32	phosphorylated	phosphorylated	JJ
cord-269720-o81j3d1j	18	33	nucleoprotein	nucleoprotein	NN
cord-269720-o81j3d1j	18	34	of	of	IN
cord-269720-o81j3d1j	18	35	M	M	NNP
cord-269720-o81j3d1j	18	36	r	r	NNP
cord-269720-o81j3d1j	18	37	47,000	47,000	CD
cord-269720-o81j3d1j	18	38	.	.	.
cord-269720-o81j3d1j	18	39	cDNA	cdna	NN
cord-269720-o81j3d1j	18	40	probes	probe	NNS
cord-269720-o81j3d1j	18	41	to	to	IN
cord-269720-o81j3d1j	18	42	the	the	DT
cord-269720-o81j3d1j	18	43	structural	structural	JJ
cord-269720-o81j3d1j	18	44	protein	protein	NN
cord-269720-o81j3d1j	18	45	genes	gene	NNS
cord-269720-o81j3d1j	18	46	of	of	IN
cord-269720-o81j3d1j	18	47	TGEV	TGEV	NNP
cord-269720-o81j3d1j	18	48	hybridized	hybridize	VBN
cord-269720-o81j3d1j	18	49	to	to	IN
cord-269720-o81j3d1j	18	50	the	the	DT
cord-269720-o81j3d1j	18	51	appropriate	appropriate	JJ
cord-269720-o81j3d1j	18	52	mRNA	mRNA	NNP
cord-269720-o81j3d1j	18	53	species	specie	NNS
cord-269720-o81j3d1j	18	54	of	of	IN
cord-269720-o81j3d1j	18	55	PRCV	PRCV	NNP
cord-269720-o81j3d1j	18	56	,	,	,
cord-269720-o81j3d1j	18	57	suggesting	suggest	VBG
cord-269720-o81j3d1j	18	58	a	a	DT
cord-269720-o81j3d1j	18	59	high	high	JJ
cord-269720-o81j3d1j	18	60	degree	degree	NN
cord-269720-o81j3d1j	18	61	of	of	IN
cord-269720-o81j3d1j	18	62	homology	homology	NN
cord-269720-o81j3d1j	18	63	at	at	IN
cord-269720-o81j3d1j	18	64	the	the	DT
cord-269720-o81j3d1j	18	65	RNA	RNA	NNP
cord-269720-o81j3d1j	18	66	level	level	NN
cord-269720-o81j3d1j	18	67	(	(	-LRB-
cord-269720-o81j3d1j	18	68	unpublished	unpublished	JJ
cord-269720-o81j3d1j	18	69	data	datum	NNS
cord-269720-o81j3d1j	18	70	)	)	-RRB-
cord-269720-o81j3d1j	18	71	.	.	.
cord-269720-o81j3d1j	19	1	Coronavirus	Coronavirus	NNP
cord-269720-o81j3d1j	19	2	proteins	protein	NNS
cord-269720-o81j3d1j	19	3	are	be	VBP
cord-269720-o81j3d1j	19	4	expressed	express	VBN
cord-269720-o81j3d1j	19	5	from	from	IN
cord-269720-o81j3d1j	19	6	a	a	DT
cord-269720-o81j3d1j	19	7	"	"	``
cord-269720-o81j3d1j	19	8	nested	nested	JJ
cord-269720-o81j3d1j	19	9	"	"	''
cord-269720-o81j3d1j	19	10	set	set	NN
cord-269720-o81j3d1j	19	11	of	of	IN
cord-269720-o81j3d1j	19	12	subgenomic	subgenomic	NNP
cord-269720-o81j3d1j	19	13	mRNAs	mRNAs	NNPS
cord-269720-o81j3d1j	19	14	with	with	IN
cord-269720-o81j3d1j	19	15	common	common	JJ
cord-269720-o81j3d1j	19	16	3	3	CD
cord-269720-o81j3d1j	19	17	'	'	NN
cord-269720-o81j3d1j	19	18	termini	terminus	NNS
cord-269720-o81j3d1j	19	19	but	but	CC
cord-269720-o81j3d1j	19	20	different	different	JJ
cord-269720-o81j3d1j	19	21	5	5	CD
cord-269720-o81j3d1j	19	22	'	'	POS
cord-269720-o81j3d1j	19	23	extensions	extension	NNS
cord-269720-o81j3d1j	19	24	.	.	.
cord-269720-o81j3d1j	20	1	The	the	DT
cord-269720-o81j3d1j	20	2	sequence	sequence	NN
cord-269720-o81j3d1j	20	3	of	of	IN
cord-269720-o81j3d1j	20	4	each	each	DT
cord-269720-o81j3d1j	20	5	mRNA	mrna	NN
cord-269720-o81j3d1j	20	6	that	that	WDT
cord-269720-o81j3d1j	20	7	is	be	VBZ
cord-269720-o81j3d1j	20	8	translated	translate	VBN
cord-269720-o81j3d1j	20	9	to	to	TO
cord-269720-o81j3d1j	20	10	produce	produce	VB
cord-269720-o81j3d1j	20	11	viral	viral	JJ
cord-269720-o81j3d1j	20	12	proteins	protein	NNS
cord-269720-o81j3d1j	20	13	appears	appear	VBZ
cord-269720-o81j3d1j	20	14	to	to	TO
cord-269720-o81j3d1j	20	15	correspond	correspond	VB
cord-269720-o81j3d1j	20	16	to	to	IN
cord-269720-o81j3d1j	20	17	the	the	DT
cord-269720-o81j3d1j	20	18	5'-terminal	5'-terminal	CD
cord-269720-o81j3d1j	20	19	region	region	NN
cord-269720-o81j3d1j	20	20	that	that	WDT
cord-269720-o81j3d1j	20	21	is	be	VBZ
cord-269720-o81j3d1j	20	22	absent	absent	JJ
cord-269720-o81j3d1j	20	23	on	on	IN
cord-269720-o81j3d1j	20	24	the	the	DT
cord-269720-o81j3d1j	20	25	preceding	precede	VBG
cord-269720-o81j3d1j	20	26	smaller	small	JJR
cord-269720-o81j3d1j	20	27	mRNA	mRNA	NNP
cord-269720-o81j3d1j	20	28	species	specie	NNS
cord-269720-o81j3d1j	20	29	.	.	.
cord-269720-o81j3d1j	21	1	It	-PRON-	PRP
cord-269720-o81j3d1j	21	2	has	have	VBZ
cord-269720-o81j3d1j	21	3	been	be	VBN
cord-269720-o81j3d1j	21	4	shown	show	VBN
cord-269720-o81j3d1j	21	5	for	for	IN
cord-269720-o81j3d1j	21	6	the	the	DT
cord-269720-o81j3d1j	21	7	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	21	8	,	,	,
cord-269720-o81j3d1j	21	9	mouse	mouse	NNP
cord-269720-o81j3d1j	21	10	hepatitis	hepatitis	NN
cord-269720-o81j3d1j	21	11	virus	virus	NN
cord-269720-o81j3d1j	21	12	(	(	-LRB-
cord-269720-o81j3d1j	21	13	MHV	MHV	NNP
cord-269720-o81j3d1j	21	14	)	)	-RRB-
cord-269720-o81j3d1j	21	15	and	and	CC
cord-269720-o81j3d1j	21	16	infectious	infectious	JJ
cord-269720-o81j3d1j	21	17	bronchitis	bronchitis	NN
cord-269720-o81j3d1j	21	18	virus	virus	NN
cord-269720-o81j3d1j	21	19	(	(	-LRB-
cord-269720-o81j3d1j	21	20	IBV	IBV	NNP
cord-269720-o81j3d1j	21	21	)	)	-RRB-
cord-269720-o81j3d1j	21	22	,	,	,
cord-269720-o81j3d1j	21	23	the	the	DT
cord-269720-o81j3d1j	21	24	subgenomic	subgenomic	NNP
cord-269720-o81j3d1j	21	25	mRNA	mRNA	NNP
cord-269720-o81j3d1j	21	26	species	specie	NNS
cord-269720-o81j3d1j	21	27	possess	possess	VBP
cord-269720-o81j3d1j	21	28	short	short	JJ
cord-269720-o81j3d1j	21	29	"	"	``
cord-269720-o81j3d1j	21	30	leader	leader	NN
cord-269720-o81j3d1j	21	31	sequences	sequence	NNS
cord-269720-o81j3d1j	21	32	"	"	''
cord-269720-o81j3d1j	21	33	at	at	IN
cord-269720-o81j3d1j	21	34	their	-PRON-	PRP$
cord-269720-o81j3d1j	21	35	5	5	CD
cord-269720-o81j3d1j	21	36	'	'	''
cord-269720-o81j3d1j	21	37	ends	end	NNS
cord-269720-o81j3d1j	21	38	.	.	.
cord-269720-o81j3d1j	22	1	These	these	DT
cord-269720-o81j3d1j	22	2	sequences	sequence	NNS
cord-269720-o81j3d1j	22	3	are	be	VBP
cord-269720-o81j3d1j	22	4	not	not	RB
cord-269720-o81j3d1j	22	5	transcribed	transcribe	VBN
cord-269720-o81j3d1j	22	6	as	as	IN
cord-269720-o81j3d1j	22	7	a	a	DT
cord-269720-o81j3d1j	22	8	contiguous	contiguous	JJ
cord-269720-o81j3d1j	22	9	mRNA	mRNA	NNP
cord-269720-o81j3d1j	22	10	species	specie	NNS
cord-269720-o81j3d1j	22	11	,	,	,
cord-269720-o81j3d1j	22	12	but	but	CC
cord-269720-o81j3d1j	22	13	are	be	VBP
cord-269720-o81j3d1j	22	14	derived	derive	VBN
cord-269720-o81j3d1j	22	15	from	from	IN
cord-269720-o81j3d1j	22	16	the	the	DT
cord-269720-o81j3d1j	22	17	5	5	CD
cord-269720-o81j3d1j	22	18	'	'	NN
cord-269720-o81j3d1j	22	19	end	end	NN
cord-269720-o81j3d1j	22	20	of	of	IN
cord-269720-o81j3d1j	22	21	the	the	DT
cord-269720-o81j3d1j	22	22	genomic	genomic	JJ
cord-269720-o81j3d1j	22	23	RNA	RNA	NNP
cord-269720-o81j3d1j	22	24	and	and	CC
cord-269720-o81j3d1j	22	25	are	be	VBP
cord-269720-o81j3d1j	22	26	probably	probably	RB
cord-269720-o81j3d1j	22	27	joined	join	VBN
cord-269720-o81j3d1j	22	28	to	to	IN
cord-269720-o81j3d1j	22	29	the	the	DT
cord-269720-o81j3d1j	22	30	5	5	CD
cord-269720-o81j3d1j	22	31	'	'	NN
cord-269720-o81j3d1j	22	32	end	end	NN
cord-269720-o81j3d1j	22	33	of	of	IN
cord-269720-o81j3d1j	22	34	each	each	DT
cord-269720-o81j3d1j	22	35	mRNA	mrna	NN
cord-269720-o81j3d1j	22	36	by	by	IN
cord-269720-o81j3d1j	22	37	a	a	DT
cord-269720-o81j3d1j	22	38	process	process	NN
cord-269720-o81j3d1j	22	39	of	of	IN
cord-269720-o81j3d1j	22	40	discontinuous	discontinuous	JJ
cord-269720-o81j3d1j	22	41	transcription	transcription	NN
cord-269720-o81j3d1j	22	42	(	(	-LRB-
cord-269720-o81j3d1j	22	43	5	5	CD
cord-269720-o81j3d1j	22	44	)	)	-RRB-
cord-269720-o81j3d1j	23	1	(	(	-LRB-
cord-269720-o81j3d1j	23	2	6	6	LS
cord-269720-o81j3d1j	23	3	)	)	-RRB-
cord-269720-o81j3d1j	23	4	(	(	-LRB-
cord-269720-o81j3d1j	23	5	7	7	LS
cord-269720-o81j3d1j	23	6	)	)	-RRB-
cord-269720-o81j3d1j	23	7	(	(	-LRB-
cord-269720-o81j3d1j	23	8	8)	8)	NNP
cord-269720-o81j3d1j	23	9	(	(	-LRB-
cord-269720-o81j3d1j	23	10	9	9	CD
cord-269720-o81j3d1j	23	11	)	)	-RRB-
cord-269720-o81j3d1j	23	12	.	.	.
cord-269720-o81j3d1j	24	1	The	the	DT
cord-269720-o81j3d1j	24	2	leader	leader	NN
cord-269720-o81j3d1j	24	3	sequence	sequence	NN
cord-269720-o81j3d1j	24	4	appears	appear	VBZ
cord-269720-o81j3d1j	24	5	to	to	TO
cord-269720-o81j3d1j	24	6	be	be	VB
cord-269720-o81j3d1j	24	7	produced	produce	VBN
cord-269720-o81j3d1j	24	8	by	by	IN
cord-269720-o81j3d1j	24	9	a	a	DT
cord-269720-o81j3d1j	24	10	mechanism	mechanism	NN
cord-269720-o81j3d1j	24	11	termed	term	VBN
cord-269720-o81j3d1j	24	12	leader	leader	NN
cord-269720-o81j3d1j	24	13	-	-	HYPH
cord-269720-o81j3d1j	24	14	primed	prime	VBN
cord-269720-o81j3d1j	24	15	transcription	transcription	NN
cord-269720-o81j3d1j	24	16	,	,	,
cord-269720-o81j3d1j	24	17	in	in	IN
cord-269720-o81j3d1j	24	18	which	which	WDT
cord-269720-o81j3d1j	24	19	the	the	DT
cord-269720-o81j3d1j	24	20	leader	leader	NN
cord-269720-o81j3d1j	24	21	RNA	RNA	NNP
cord-269720-o81j3d1j	24	22	is	be	VBZ
cord-269720-o81j3d1j	24	23	transcribed	transcribe	VBN
cord-269720-o81j3d1j	24	24	independently	independently	RB
cord-269720-o81j3d1j	24	25	,	,	,
cord-269720-o81j3d1j	24	26	dissociated	dissociate	VBN
cord-269720-o81j3d1j	24	27	from	from	IN
cord-269720-o81j3d1j	24	28	the	the	DT
cord-269720-o81j3d1j	24	29	template	template	NN
cord-269720-o81j3d1j	24	30	,	,	,
cord-269720-o81j3d1j	24	31	and	and	CC
cord-269720-o81j3d1j	24	32	then	then	RB
cord-269720-o81j3d1j	24	33	binds	bind	VBZ
cord-269720-o81j3d1j	24	34	to	to	IN
cord-269720-o81j3d1j	24	35	the	the	DT
cord-269720-o81j3d1j	24	36	template	template	NN
cord-269720-o81j3d1j	24	37	(	(	-LRB-
cord-269720-o81j3d1j	24	38	negative	negative	JJ
cord-269720-o81j3d1j	24	39	-	-	HYPH
cord-269720-o81j3d1j	24	40	sense	sense	NN
cord-269720-o81j3d1j	24	41	strand	strand	NN
cord-269720-o81j3d1j	24	42	)	)	-RRB-
cord-269720-o81j3d1j	24	43	at	at	IN
cord-269720-o81j3d1j	24	44	specific	specific	JJ
cord-269720-o81j3d1j	24	45	transcriptional	transcriptional	JJ
cord-269720-o81j3d1j	24	46	start	start	NN
cord-269720-o81j3d1j	24	47	sites	site	NNS
cord-269720-o81j3d1j	24	48	(	(	-LRB-
cord-269720-o81j3d1j	24	49	I0	i0	NN
cord-269720-o81j3d1j	24	50	,	,	,
cord-269720-o81j3d1j	24	51	11	11	CD
cord-269720-o81j3d1j	24	52	)	)	-RRB-
cord-269720-o81j3d1j	24	53	.	.	.
cord-269720-o81j3d1j	25	1	The	the	DT
cord-269720-o81j3d1j	25	2	mechanism	mechanism	NN
cord-269720-o81j3d1j	25	3	appears	appear	VBZ
cord-269720-o81j3d1j	25	4	to	to	TO
cord-269720-o81j3d1j	25	5	involve	involve	VB
cord-269720-o81j3d1j	25	6	the	the	DT
cord-269720-o81j3d1j	25	7	recognition	recognition	NN
cord-269720-o81j3d1j	25	8	of	of	IN
cord-269720-o81j3d1j	25	9	consensus	consensus	NN
cord-269720-o81j3d1j	25	10	sequences	sequence	NNS
cord-269720-o81j3d1j	25	11	identified	identify	VBN
cord-269720-o81j3d1j	25	12	on	on	IN
cord-269720-o81j3d1j	25	13	the	the	DT
cord-269720-o81j3d1j	25	14	genomic	genomic	JJ
cord-269720-o81j3d1j	25	15	RNA	rna	NN
cord-269720-o81j3d1j	25	16	at	at	IN
cord-269720-o81j3d1j	25	17	those	those	DT
cord-269720-o81j3d1j	25	18	points	point	NNS
cord-269720-o81j3d1j	25	19	corresponding	correspond	VBG
cord-269720-o81j3d1j	25	20	to	to	IN
cord-269720-o81j3d1j	25	21	the	the	DT
cord-269720-o81j3d1j	25	22	5	5	CD
cord-269720-o81j3d1j	25	23	'	'	''
cord-269720-o81j3d1j	25	24	ends	end	NNS
cord-269720-o81j3d1j	25	25	of	of	IN
cord-269720-o81j3d1j	25	26	the	the	DT
cord-269720-o81j3d1j	25	27	subgenomic	subgenomic	NNP
cord-269720-o81j3d1j	25	28	mRNAs	mRNAs	NNPS
cord-269720-o81j3d1j	25	29	.	.	.
cord-269720-o81j3d1j	26	1	These	these	DT
cord-269720-o81j3d1j	26	2	consensus	consensus	NN
cord-269720-o81j3d1j	26	3	sequences	sequence	NNS
cord-269720-o81j3d1j	26	4	may	may	MD
cord-269720-o81j3d1j	26	5	act	act	VB
cord-269720-o81j3d1j	26	6	as	as	IN
cord-269720-o81j3d1j	26	7	a	a	DT
cord-269720-o81j3d1j	26	8	binding	binding	NN
cord-269720-o81j3d1j	26	9	site	site	NN
cord-269720-o81j3d1j	26	10	for	for	IN
cord-269720-o81j3d1j	26	11	the	the	DT
cord-269720-o81j3d1j	26	12	RNA	RNA	NNP
cord-269720-o81j3d1j	26	13	polymeraseleader	polymeraseleader	NN
cord-269720-o81j3d1j	26	14	complex	complex	NN
cord-269720-o81j3d1j	26	15	(	(	-LRB-
cord-269720-o81j3d1j	26	16	7	7	CD
cord-269720-o81j3d1j	26	17	)	)	-RRB-
cord-269720-o81j3d1j	26	18	(	(	-LRB-
cord-269720-o81j3d1j	26	19	8)	8)	NNP
cord-269720-o81j3d1j	26	20	(	(	-LRB-
cord-269720-o81j3d1j	26	21	9	9	CD
cord-269720-o81j3d1j	26	22	)	)	-RRB-
cord-269720-o81j3d1j	26	23	(	(	-LRB-
cord-269720-o81j3d1j	26	24	12	12	CD
cord-269720-o81j3d1j	26	25	)	)	-RRB-
cord-269720-o81j3d1j	26	26	(	(	-LRB-
cord-269720-o81j3d1j	26	27	13	13	CD
cord-269720-o81j3d1j	26	28	)	)	-RRB-
cord-269720-o81j3d1j	26	29	(	(	-LRB-
cord-269720-o81j3d1j	26	30	14	14	CD
cord-269720-o81j3d1j	26	31	)	)	-RRB-
cord-269720-o81j3d1j	26	32	.	.	.
cord-269720-o81j3d1j	27	1	It	-PRON-	PRP
cord-269720-o81j3d1j	27	2	has	have	VBZ
cord-269720-o81j3d1j	27	3	been	be	VBN
cord-269720-o81j3d1j	27	4	previously	previously	RB
cord-269720-o81j3d1j	27	5	postulated	postulate	VBN
cord-269720-o81j3d1j	27	6	that	that	IN
cord-269720-o81j3d1j	27	7	a	a	DT
cord-269720-o81j3d1j	27	8	heptameric	heptameric	JJ
cord-269720-o81j3d1j	27	9	sequence	sequence	NN
cord-269720-o81j3d1j	27	10	,	,	,
cord-269720-o81j3d1j	27	11	ACTAAAC	ACTAAAC	NNP
cord-269720-o81j3d1j	27	12	(	(	-LRB-
cord-269720-o81j3d1j	27	13	15	15	CD
cord-269720-o81j3d1j	27	14	)	)	-RRB-
cord-269720-o81j3d1j	27	15	(	(	-LRB-
cord-269720-o81j3d1j	27	16	16	16	CD
cord-269720-o81j3d1j	27	17	)	)	-RRB-
cord-269720-o81j3d1j	27	18	(	(	-LRB-
cord-269720-o81j3d1j	27	19	17	17	CD
cord-269720-o81j3d1j	27	20	)	)	-RRB-
cord-269720-o81j3d1j	27	21	,	,	,
cord-269720-o81j3d1j	27	22	or	or	CC
cord-269720-o81j3d1j	27	23	a	a	DT
cord-269720-o81j3d1j	27	24	hexameric	hexameric	JJ
cord-269720-o81j3d1j	27	25	sequence	sequence	NN
cord-269720-o81j3d1j	27	26	,	,	,
cord-269720-o81j3d1j	27	27	CTAAAC	CTAAAC	NNP
cord-269720-o81j3d1j	27	28	(	(	-LRB-
cord-269720-o81j3d1j	27	29	18	18	CD
cord-269720-o81j3d1j	27	30	)	)	-RRB-
cord-269720-o81j3d1j	27	31	(	(	-LRB-
cord-269720-o81j3d1j	27	32	19	19	CD
cord-269720-o81j3d1j	27	33	)	)	-RRB-
cord-269720-o81j3d1j	27	34	(	(	-LRB-
cord-269720-o81j3d1j	27	35	20	20	CD
cord-269720-o81j3d1j	27	36	)	)	-RRB-
cord-269720-o81j3d1j	27	37	,	,	,
cord-269720-o81j3d1j	27	38	may	may	MD
cord-269720-o81j3d1j	27	39	be	be	VB
cord-269720-o81j3d1j	27	40	involved	involve	VBN
cord-269720-o81j3d1j	27	41	in	in	IN
cord-269720-o81j3d1j	27	42	the	the	DT
cord-269720-o81j3d1j	27	43	binding	binding	NN
cord-269720-o81j3d1j	27	44	of	of	IN
cord-269720-o81j3d1j	27	45	the	the	DT
cord-269720-o81j3d1j	27	46	TGEV	TGEV	NNP
cord-269720-o81j3d1j	27	47	RNA	RNA	NNP
cord-269720-o81j3d1j	27	48	polymerase	polymerase	NN
cord-269720-o81j3d1j	27	49	leader	leader	NN
cord-269720-o81j3d1j	27	50	.	.	.
cord-269720-o81j3d1j	28	1	In	in	IN
cord-269720-o81j3d1j	28	2	this	this	DT
cord-269720-o81j3d1j	28	3	paper	paper	NN
cord-269720-o81j3d1j	28	4	we	-PRON-	PRP
cord-269720-o81j3d1j	28	5	describe	describe	VBP
cord-269720-o81j3d1j	28	6	the	the	DT
cord-269720-o81j3d1j	28	7	elucidation	elucidation	NN
cord-269720-o81j3d1j	28	8	of	of	IN
cord-269720-o81j3d1j	28	9	the	the	DT
cord-269720-o81j3d1j	28	10	leader	leader	NN
cord-269720-o81j3d1j	28	11	RNA	RNA	NNP
cord-269720-o81j3d1j	28	12	sequences	sequence	NNS
cord-269720-o81j3d1j	28	13	from	from	IN
cord-269720-o81j3d1j	28	14	the	the	DT
cord-269720-o81j3d1j	28	15	porcine	porcine	JJ
cord-269720-o81j3d1j	28	16	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	28	17	TGEV	TGEV	NNP
cord-269720-o81j3d1j	28	18	and	and	CC
cord-269720-o81j3d1j	28	19	PRCV	PRCV	NNP
cord-269720-o81j3d1j	28	20	,	,	,
cord-269720-o81j3d1j	28	21	the	the	DT
cord-269720-o81j3d1j	28	22	first	first	JJ
cord-269720-o81j3d1j	28	23	leader	leader	NN
cord-269720-o81j3d1j	28	24	sequence	sequence	NN
cord-269720-o81j3d1j	28	25	to	to	TO
cord-269720-o81j3d1j	28	26	be	be	VB
cord-269720-o81j3d1j	28	27	described	describe	VBN
cord-269720-o81j3d1j	28	28	from	from	IN
cord-269720-o81j3d1j	28	29	the	the	DT
cord-269720-o81j3d1j	28	30	TGEV	TGEV	NNP
cord-269720-o81j3d1j	28	31	serogroup	serogroup	NN
cord-269720-o81j3d1j	28	32	of	of	IN
cord-269720-o81j3d1j	28	33	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	28	34	.	.	.
cord-269720-o81j3d1j	29	1	Comparison	comparison	NN
cord-269720-o81j3d1j	29	2	of	of	IN
cord-269720-o81j3d1j	29	3	the	the	DT
cord-269720-o81j3d1j	29	4	leader	leader	NN
cord-269720-o81j3d1j	29	5	RNAs	rna	NNS
cord-269720-o81j3d1j	29	6	of	of	IN
cord-269720-o81j3d1j	29	7	TGEV	TGEV	NNP
cord-269720-o81j3d1j	29	8	and	and	CC
cord-269720-o81j3d1j	29	9	PRCV	PRCV	NNP
cord-269720-o81j3d1j	29	10	with	with	IN
cord-269720-o81j3d1j	29	11	published	publish	VBN
cord-269720-o81j3d1j	29	12	leader	leader	NN
cord-269720-o81j3d1j	29	13	RNAs	rna	NNS
cord-269720-o81j3d1j	29	14	of	of	IN
cord-269720-o81j3d1j	29	15	other	other	JJ
cord-269720-o81j3d1j	29	16	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	29	17	was	be	VBD
cord-269720-o81j3d1j	29	18	used	use	VBN
cord-269720-o81j3d1j	29	19	to	to	TO
cord-269720-o81j3d1j	29	20	identify	identify	VB
cord-269720-o81j3d1j	29	21	areas	area	NNS
cord-269720-o81j3d1j	29	22	of	of	IN
cord-269720-o81j3d1j	29	23	conserved	conserved	JJ
cord-269720-o81j3d1j	29	24	sequence	sequence	NN
cord-269720-o81j3d1j	29	25	and	and	CC
cord-269720-o81j3d1j	29	26	potential	potential	JJ
cord-269720-o81j3d1j	29	27	secondary	secondary	JJ
cord-269720-o81j3d1j	29	28	structure	structure	NN
cord-269720-o81j3d1j	29	29	that	that	WDT
cord-269720-o81j3d1j	29	30	may	may	MD
cord-269720-o81j3d1j	29	31	be	be	VB
cord-269720-o81j3d1j	29	32	involved	involve	VBN
cord-269720-o81j3d1j	29	33	in	in	IN
cord-269720-o81j3d1j	29	34	the	the	DT
cord-269720-o81j3d1j	29	35	transcription	transcription	NN
cord-269720-o81j3d1j	29	36	of	of	IN
cord-269720-o81j3d1j	29	37	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	29	38	subgenomic	subgenomic	NNP
cord-269720-o81j3d1j	29	39	mRNA	mRNA	NNP
cord-269720-o81j3d1j	29	40	species	specie	NNS
cord-269720-o81j3d1j	29	41	.	.	.
cord-269720-o81j3d1j	30	1	Confluent	confluent	NN
cord-269720-o81j3d1j	30	2	cultures	culture	NNS
cord-269720-o81j3d1j	30	3	of	of	IN
cord-269720-o81j3d1j	30	4	a	a	DT
cord-269720-o81j3d1j	30	5	pig	pig	NN
cord-269720-o81j3d1j	30	6	kidney	kidney	NN
cord-269720-o81j3d1j	30	7	cell	cell	NN
cord-269720-o81j3d1j	30	8	line	line	NN
cord-269720-o81j3d1j	30	9	LLC	LLC	NNP
cord-269720-o81j3d1j	30	10	-	-	HYPH
cord-269720-o81j3d1j	30	11	PK1	PK1	NNP
cord-269720-o81j3d1j	30	12	were	be	VBD
cord-269720-o81j3d1j	30	13	infected	infect	VBN
cord-269720-o81j3d1j	30	14	with	with	IN
cord-269720-o81j3d1j	30	15	a	a	DT
cord-269720-o81j3d1j	30	16	virulent	virulent	JJ
cord-269720-o81j3d1j	30	17	British	british	JJ
cord-269720-o81j3d1j	30	18	field	field	NN
cord-269720-o81j3d1j	30	19	isolate	isolate	VBP
cord-269720-o81j3d1j	30	20	of	of	IN
cord-269720-o81j3d1j	30	21	TGEV	TGEV	NNP
cord-269720-o81j3d1j	30	22	strain	strain	NN
cord-269720-o81j3d1j	30	23	FS772/70	FS772/70	NNP
cord-269720-o81j3d1j	30	24	or	or	CC
cord-269720-o81j3d1j	30	25	a	a	DT
cord-269720-o81j3d1j	30	26	British	british	JJ
cord-269720-o81j3d1j	30	27	isolate	isolate	NN
cord-269720-o81j3d1j	30	28	of	of	IN
cord-269720-o81j3d1j	30	29	PRCV	PRCV	NNP
cord-269720-o81j3d1j	31	1	strain	strain	VB
cord-269720-o81j3d1j	31	2	86/137004	86/137004	CD
cord-269720-o81j3d1j	31	3	at	at	IN
cord-269720-o81j3d1j	31	4	a	a	DT
cord-269720-o81j3d1j	31	5	MOI	MOI	NNP
cord-269720-o81j3d1j	31	6	of	of	IN
cord-269720-o81j3d1j	31	7	1	1	CD
cord-269720-o81j3d1j	31	8	-	-	SYM
cord-269720-o81j3d1j	31	9	10	10	CD
cord-269720-o81j3d1j	31	10	PFU	pfu	NN
cord-269720-o81j3d1j	31	11	per	per	IN
cord-269720-o81j3d1j	31	12	cell	cell	NN
cord-269720-o81j3d1j	31	13	.	.	.
cord-269720-o81j3d1j	32	1	After	after	IN
cord-269720-o81j3d1j	32	2	2	2	CD
cord-269720-o81j3d1j	32	3	hr	hr	NN
cord-269720-o81j3d1j	32	4	at	at	IN
cord-269720-o81j3d1j	32	5	37~	37~	CD
cord-269720-o81j3d1j	32	6	the	the	DT
cord-269720-o81j3d1j	32	7	inoculum	inoculum	NN
cord-269720-o81j3d1j	32	8	was	be	VBD
cord-269720-o81j3d1j	32	9	removed	remove	VBN
cord-269720-o81j3d1j	32	10	and	and	CC
cord-269720-o81j3d1j	32	11	replaced	replace	VBN
cord-269720-o81j3d1j	32	12	with	with	IN
cord-269720-o81j3d1j	32	13	medium	medium	NN
cord-269720-o81j3d1j	32	14	containing	contain	VBG
cord-269720-o81j3d1j	32	15	1	1	CD
cord-269720-o81j3d1j	32	16	ixg	ixg	NNP
cord-269720-o81j3d1j	32	17	/	/	SYM
cord-269720-o81j3d1j	32	18	ml	ml	NN
cord-269720-o81j3d1j	32	19	actinomycin	actinomycin	NNS
cord-269720-o81j3d1j	32	20	D	D	NNP
cord-269720-o81j3d1j	32	21	to	to	TO
cord-269720-o81j3d1j	32	22	inhibit	inhibit	VB
cord-269720-o81j3d1j	32	23	host	host	NN
cord-269720-o81j3d1j	32	24	-	-	HYPH
cord-269720-o81j3d1j	32	25	cell	cell	NN
cord-269720-o81j3d1j	32	26	RNA	RNA	NNP
cord-269720-o81j3d1j	32	27	synthesis	synthesis	NN
cord-269720-o81j3d1j	32	28	(	(	-LRB-
cord-269720-o81j3d1j	32	29	21	21	CD
cord-269720-o81j3d1j	32	30	)	)	-RRB-
cord-269720-o81j3d1j	32	31	.	.	.
cord-269720-o81j3d1j	33	1	After	after	IN
cord-269720-o81j3d1j	33	2	a	a	DT
cord-269720-o81j3d1j	33	3	further	further	JJ
cord-269720-o81j3d1j	33	4	2-hr	2-hr	JJ
cord-269720-o81j3d1j	33	5	incubation	incubation	NN
cord-269720-o81j3d1j	33	6	,	,	,
cord-269720-o81j3d1j	33	7	25	25	CD
cord-269720-o81j3d1j	33	8	r	r	CD
cord-269720-o81j3d1j	33	9	of	of	IN
cord-269720-o81j3d1j	33	10	[	[	-LRB-
cord-269720-o81j3d1j	33	11	5,6	5,6	CD
cord-269720-o81j3d1j	33	12	-	-	HYPH
cord-269720-o81j3d1j	33	13	3H]uridine	3h]uridine	CD
cord-269720-o81j3d1j	34	1	(	(	-LRB-
cord-269720-o81j3d1j	34	2	Amersham	Amersham	NNP
cord-269720-o81j3d1j	34	3	International	International	NNP
cord-269720-o81j3d1j	34	4	plc	plc	NNP
cord-269720-o81j3d1j	34	5	,	,	,
cord-269720-o81j3d1j	34	6	TRK.410	TRK.410	NNP
cord-269720-o81j3d1j	34	7	,	,	,
cord-269720-o81j3d1j	34	8	35	35	CD
cord-269720-o81j3d1j	34	9	-	-	SYM
cord-269720-o81j3d1j	34	10	50	50	CD
cord-269720-o81j3d1j	34	11	Ci	ci	NN
cord-269720-o81j3d1j	34	12	/	/	SYM
cord-269720-o81j3d1j	34	13	mM	mm	NN
cord-269720-o81j3d1j	34	14	)	)	-RRB-
cord-269720-o81j3d1j	34	15	was	be	VBD
cord-269720-o81j3d1j	34	16	added	add	VBN
cord-269720-o81j3d1j	34	17	per	per	IN
cord-269720-o81j3d1j	34	18	culture	culture	NN
cord-269720-o81j3d1j	34	19	bottle	bottle	NN
cord-269720-o81j3d1j	34	20	and	and	CC
cord-269720-o81j3d1j	34	21	the	the	DT
cord-269720-o81j3d1j	34	22	cells	cell	NNS
cord-269720-o81j3d1j	34	23	were	be	VBD
cord-269720-o81j3d1j	34	24	incubated	incubate	VBN
cord-269720-o81j3d1j	34	25	for	for	IN
cord-269720-o81j3d1j	34	26	a	a	DT
cord-269720-o81j3d1j	34	27	further	further	JJ
cord-269720-o81j3d1j	34	28	5	5	CD
cord-269720-o81j3d1j	34	29	hr	hr	NN
cord-269720-o81j3d1j	34	30	.	.	.
cord-269720-o81j3d1j	35	1	The	the	DT
cord-269720-o81j3d1j	35	2	cells	cell	NNS
cord-269720-o81j3d1j	35	3	were	be	VBD
cord-269720-o81j3d1j	35	4	lysed	lyse	VBN
cord-269720-o81j3d1j	35	5	with	with	IN
cord-269720-o81j3d1j	35	6	guanidinium	guanidinium	NN
cord-269720-o81j3d1j	35	7	thiocyanate	thiocyanate	NNP
cord-269720-o81j3d1j	35	8	,	,	,
cord-269720-o81j3d1j	35	9	the	the	DT
cord-269720-o81j3d1j	35	10	RNA	RNA	NNP
cord-269720-o81j3d1j	35	11	pelleted	pellete	VBD
cord-269720-o81j3d1j	35	12	through	through	IN
cord-269720-o81j3d1j	35	13	5.7	5.7	CD
cord-269720-o81j3d1j	35	14	M	M	NNP
cord-269720-o81j3d1j	35	15	cesium	cesium	NN
cord-269720-o81j3d1j	35	16	chloride	chloride	NN
cord-269720-o81j3d1j	35	17	and	and	CC
cord-269720-o81j3d1j	35	18	poly(A)-containing	poly(a)-containe	VBG
cord-269720-o81j3d1j	35	19	RNA	RNA	NNP
cord-269720-o81j3d1j	35	20	isolated	isolate	VBN
cord-269720-o81j3d1j	35	21	by	by	IN
cord-269720-o81j3d1j	35	22	poly(U	poly(u	ADD
cord-269720-o81j3d1j	35	23	)	)	-RRB-
cord-269720-o81j3d1j	36	1	Sepharose	sepharose	JJ
cord-269720-o81j3d1j	36	2	affinity	affinity	NN
cord-269720-o81j3d1j	36	3	chromatography	chromatography	NN
cord-269720-o81j3d1j	36	4	,	,	,
cord-269720-o81j3d1j	36	5	as	as	IN
cord-269720-o81j3d1j	36	6	described	describe	VBN
cord-269720-o81j3d1j	36	7	previously	previously	RB
cord-269720-o81j3d1j	36	8	(	(	-LRB-
cord-269720-o81j3d1j	36	9	21	21	CD
cord-269720-o81j3d1j	36	10	)	)	-RRB-
cord-269720-o81j3d1j	36	11	.	.	.
cord-269720-o81j3d1j	37	1	Two	two	CD
cord-269720-o81j3d1j	37	2	oligonucleotides	oligonucleotide	NNS
cord-269720-o81j3d1j	37	3	were	be	VBD
cord-269720-o81j3d1j	37	4	synthesized	synthesize	VBN
cord-269720-o81j3d1j	37	5	by	by	IN
cord-269720-o81j3d1j	37	6	the	the	DT
cord-269720-o81j3d1j	37	7	phosphoramidite	phosphoramidite	JJ
cord-269720-o81j3d1j	37	8	method	method	NN
cord-269720-o81j3d1j	37	9	using	use	VBG
cord-269720-o81j3d1j	37	10	an	an	DT
cord-269720-o81j3d1j	37	11	Applied	Applied	NNP
cord-269720-o81j3d1j	37	12	Biosystem	Biosystem	NNP
cord-269720-o81j3d1j	37	13	381A	381A	NNP
cord-269720-o81j3d1j	37	14	synthesizer	synthesizer	NN
cord-269720-o81j3d1j	37	15	.	.	.
cord-269720-o81j3d1j	38	1	One	one	CD
cord-269720-o81j3d1j	38	2	oligonucleotide	oligonucleotide	NN
cord-269720-o81j3d1j	38	3	,	,	,
cord-269720-o81j3d1j	38	4	oligo	oligo	NNP
cord-269720-o81j3d1j	38	5	38	38	CD
cord-269720-o81j3d1j	38	6	(	(	-LRB-
cord-269720-o81j3d1j	38	7	5'-TGGATT	5'-tggatt	CD
cord-269720-o81j3d1j	38	8	-	-	HYPH
cord-269720-o81j3d1j	38	9	CATCCCCCCAACTA	CATCCCCCCAACTA	NNP
cord-269720-o81j3d1j	38	10	-	-	HYPH
cord-269720-o81j3d1j	38	11	Y	Y	NNP
cord-269720-o81j3d1j	38	12	)	)	-RRB-
cord-269720-o81j3d1j	38	13	,	,	,
cord-269720-o81j3d1j	38	14	was	be	VBD
cord-269720-o81j3d1j	38	15	complementary	complementary	JJ
cord-269720-o81j3d1j	38	16	to	to	IN
cord-269720-o81j3d1j	38	17	the	the	DT
cord-269720-o81j3d1j	38	18	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	38	19	gene	gene	NNP
cord-269720-o81j3d1j	38	20	22	22	CD
cord-269720-o81j3d1j	38	21	bp	bp	NNP
cord-269720-o81j3d1j	38	22	downstream	downstream	RB
cord-269720-o81j3d1j	38	23	from	from	IN
cord-269720-o81j3d1j	38	24	the	the	DT
cord-269720-o81j3d1j	38	25	initiation	initiation	NN
cord-269720-o81j3d1j	38	26	ATG	ATG	NNP
cord-269720-o81j3d1j	38	27	codon	codon	NN
cord-269720-o81j3d1j	38	28	(	(	-LRB-
cord-269720-o81j3d1j	38	29	15	15	CD
cord-269720-o81j3d1j	38	30	)	)	-RRB-
cord-269720-o81j3d1j	38	31	,	,	,
cord-269720-o81j3d1j	38	32	as	as	IN
cord-269720-o81j3d1j	38	33	shown	show	VBN
cord-269720-o81j3d1j	38	34	in	in	IN
cord-269720-o81j3d1j	38	35	Fig	Fig	NNP
cord-269720-o81j3d1j	38	36	.	.	.
cord-269720-o81j3d1j	39	1	1	1	CD
cord-269720-o81j3d1j	39	2	,	,	,
cord-269720-o81j3d1j	39	3	and	and	CC
cord-269720-o81j3d1j	39	4	was	be	VBD
cord-269720-o81j3d1j	39	5	used	use	VBN
cord-269720-o81j3d1j	39	6	for	for	IN
cord-269720-o81j3d1j	39	7	primer	primer	NN
cord-269720-o81j3d1j	39	8	extension	extension	NN
cord-269720-o81j3d1j	39	9	.	.	.
cord-269720-o81j3d1j	40	1	The	the	DT
cord-269720-o81j3d1j	40	2	second	second	JJ
cord-269720-o81j3d1j	40	3	oligonucleotide	oligonucleotide	NN
cord-269720-o81j3d1j	40	4	,	,	,
cord-269720-o81j3d1j	40	5	oligo	oligo	NNP
cord-269720-o81j3d1j	40	6	58	58	CD
cord-269720-o81j3d1j	40	7	(	(	-LRB-
cord-269720-o81j3d1j	40	8	5'-AGAGATA	5'-agagata	CD
cord-269720-o81j3d1j	40	9	-	-	HYPH
cord-269720-o81j3d1j	40	10	TAGCCACGCTACACTCACTTTAC	TAGCCACGCTACACTCACTTTAC	NNP
cord-269720-o81j3d1j	40	11	-	-	HYPH
cord-269720-o81j3d1j	40	12	Y	Y	NNP
cord-269720-o81j3d1j	40	13	)	)	-RRB-
cord-269720-o81j3d1j	40	14	,	,	,
cord-269720-o81j3d1j	40	15	was	be	VBD
cord-269720-o81j3d1j	40	16	complementary	complementary	JJ
cord-269720-o81j3d1j	40	17	to	to	IN
cord-269720-o81j3d1j	40	18	the	the	DT
cord-269720-o81j3d1j	40	19	5	5	CD
cord-269720-o81j3d1j	40	20	'	'	NN
cord-269720-o81j3d1j	40	21	end	end	NN
cord-269720-o81j3d1j	40	22	of	of	IN
cord-269720-o81j3d1j	40	23	the	the	DT
cord-269720-o81j3d1j	40	24	leader	leader	NN
cord-269720-o81j3d1j	40	25	RNA	RNA	NNP
cord-269720-o81j3d1j	40	26	(	(	-LRB-
cord-269720-o81j3d1j	40	27	Fig	Fig	NNP
cord-269720-o81j3d1j	40	28	.	.	.
cord-269720-o81j3d1j	40	29	1	1	CD
cord-269720-o81j3d1j	40	30	)	)	-RRB-
cord-269720-o81j3d1j	40	31	and	and	CC
cord-269720-o81j3d1j	40	32	was	be	VBD
cord-269720-o81j3d1j	40	33	used	use	VBN
cord-269720-o81j3d1j	40	34	for	for	IN
cord-269720-o81j3d1j	40	35	Northern	northern	JJ
cord-269720-o81j3d1j	40	36	blot	blot	NN
cord-269720-o81j3d1j	40	37	analysis	analysis	NN
cord-269720-o81j3d1j	40	38	of	of	IN
cord-269720-o81j3d1j	40	39	viral	viral	JJ
cord-269720-o81j3d1j	40	40	mRNA	mrna	NN
cord-269720-o81j3d1j	40	41	.	.	.
cord-269720-o81j3d1j	41	1	Gel	gel	NN
cord-269720-o81j3d1j	41	2	-	-	HYPH
cord-269720-o81j3d1j	41	3	purified	purify	VBN
cord-269720-o81j3d1j	41	4	oligo	oligo	NN
cord-269720-o81j3d1j	41	5	38	38	CD
cord-269720-o81j3d1j	41	6	(	(	-LRB-
cord-269720-o81j3d1j	41	7	500	500	CD
cord-269720-o81j3d1j	41	8	ng	ng	NN
cord-269720-o81j3d1j	41	9	)	)	-RRB-
cord-269720-o81j3d1j	41	10	was	be	VBD
cord-269720-o81j3d1j	41	11	5'-end	5'-end	CD
cord-269720-o81j3d1j	41	12	-	-	HYPH
cord-269720-o81j3d1j	41	13	labeled	label	VBN
cord-269720-o81j3d1j	41	14	(	(	-LRB-
cord-269720-o81j3d1j	41	15	22	22	CD
cord-269720-o81j3d1j	41	16	)	)	-RRB-
cord-269720-o81j3d1j	41	17	using	use	VBG
cord-269720-o81j3d1j	41	18	20	20	CD
cord-269720-o81j3d1j	41	19	U	U	NNP
cord-269720-o81j3d1j	41	20	of	of	IN
cord-269720-o81j3d1j	41	21	T	T	NNP
cord-269720-o81j3d1j	41	22	4	4	CD
cord-269720-o81j3d1j	41	23	polynucleotide	polynucleotide	NN
cord-269720-o81j3d1j	41	24	kinase	kinase	NN
cord-269720-o81j3d1j	41	25	(	(	-LRB-
cord-269720-o81j3d1j	41	26	Gibco	Gibco	NNP
cord-269720-o81j3d1j	41	27	-	-	HYPH
cord-269720-o81j3d1j	41	28	BRL	BRL	NNP
cord-269720-o81j3d1j	41	29	,	,	,
cord-269720-o81j3d1j	41	30	Paisley	Paisley	NNP
cord-269720-o81j3d1j	41	31	)	)	-RRB-
cord-269720-o81j3d1j	41	32	and	and	CC
cord-269720-o81j3d1j	41	33	20	20	CD
cord-269720-o81j3d1j	41	34	IxCi	IxCi	NNP
cord-269720-o81j3d1j	41	35	[	[	-LRB-
cord-269720-o81j3d1j	41	36	~/-32p]ATP	~/-32p]ATP	NFP
cord-269720-o81j3d1j	42	1	(	(	-LRB-
cord-269720-o81j3d1j	42	2	Amersham	Amersham	NNP
cord-269720-o81j3d1j	42	3	International	International	NNP
cord-269720-o81j3d1j	42	4	plc	plc	NNP
cord-269720-o81j3d1j	42	5	,	,	,
cord-269720-o81j3d1j	42	6	PB	PB	NNP
cord-269720-o81j3d1j	42	7	10168	10168	CD
cord-269720-o81j3d1j	42	8	,	,	,
cord-269720-o81j3d1j	42	9	3000	3000	CD
cord-269720-o81j3d1j	42	10	ci	ci	NNP
cord-269720-o81j3d1j	42	11	/	/	SYM
cord-269720-o81j3d1j	42	12	mM.	mM.	NNP
cord-269720-o81j3d1j	42	13	Poly(A)-containing	poly(a)-containe	VBG
cord-269720-o81j3d1j	42	14	RNA	RNA	NNP
cord-269720-o81j3d1j	42	15	(	(	-LRB-
cord-269720-o81j3d1j	42	16	1.5	1.5	CD
cord-269720-o81j3d1j	42	17	p	p	NN
cord-269720-o81j3d1j	42	18	~	~	CD
cord-269720-o81j3d1j	42	19	g	g	NN
cord-269720-o81j3d1j	42	20	)	)	-RRB-
cord-269720-o81j3d1j	42	21	isolated	isolate	VBN
cord-269720-o81j3d1j	42	22	from	from	IN
cord-269720-o81j3d1j	42	23	TGEV	TGEV	NNP
cord-269720-o81j3d1j	42	24	-	-	HYPH
cord-269720-o81j3d1j	42	25	and	and	CC
cord-269720-o81j3d1j	42	26	PRCV	PRCV	NNP
cord-269720-o81j3d1j	42	27	-	-	HYPH
cord-269720-o81j3d1j	42	28	infected	infect	VBN
cord-269720-o81j3d1j	42	29	cells	cell	NNS
cord-269720-o81j3d1j	42	30	was	be	VBD
cord-269720-o81j3d1j	42	31	resuspended	resuspend	VBN
cord-269720-o81j3d1j	42	32	in	in	IN
cord-269720-o81j3d1j	42	33	water	water	NN
cord-269720-o81j3d1j	42	34	and	and	CC
cord-269720-o81j3d1j	42	35	heated	heat	VBN
cord-269720-o81j3d1j	42	36	at	at	IN
cord-269720-o81j3d1j	42	37	60~	60~	CD
cord-269720-o81j3d1j	42	38	for	for	IN
cord-269720-o81j3d1j	42	39	3	3	CD
cord-269720-o81j3d1j	42	40	min	min	NN
cord-269720-o81j3d1j	42	41	.	.	.
cord-269720-o81j3d1j	43	1	A	a	DT
cord-269720-o81j3d1j	43	2	further	further	JJ
cord-269720-o81j3d1j	43	3	incubation	incubation	NN
cord-269720-o81j3d1j	43	4	was	be	VBD
cord-269720-o81j3d1j	43	5	carried	carry	VBN
cord-269720-o81j3d1j	43	6	out	out	RP
cord-269720-o81j3d1j	43	7	using	use	VBG
cord-269720-o81j3d1j	43	8	the	the	DT
cord-269720-o81j3d1j	43	9	two	two	CD
cord-269720-o81j3d1j	43	10	mRNA	mRNA	NNP
cord-269720-o81j3d1j	43	11	preparations	preparation	NNS
cord-269720-o81j3d1j	43	12	in	in	IN
cord-269720-o81j3d1j	43	13	27	27	CD
cord-269720-o81j3d1j	43	14	p.l	p.l	JJ
cord-269720-o81j3d1j	43	15	reaction	reaction	NN
cord-269720-o81j3d1j	43	16	volumes	volume	NNS
cord-269720-o81j3d1j	43	17	containing	contain	VBG
cord-269720-o81j3d1j	43	18	40	40	CD
cord-269720-o81j3d1j	43	19	U	U	NNP
cord-269720-o81j3d1j	43	20	of	of	IN
cord-269720-o81j3d1j	43	21	RNasin	RNasin	NNP
cord-269720-o81j3d1j	44	1	(	(	-LRB-
cord-269720-o81j3d1j	44	2	Promega	Promega	NNP
cord-269720-o81j3d1j	44	3	Biotec	Biotec	NNP
cord-269720-o81j3d1j	44	4	,	,	,
cord-269720-o81j3d1j	44	5	Liverpool	Liverpool	NNP
cord-269720-o81j3d1j	44	6	)	)	-RRB-
cord-269720-o81j3d1j	44	7	,	,	,
cord-269720-o81j3d1j	44	8	50	50	CD
cord-269720-o81j3d1j	44	9	mM	mm	CD
cord-269720-o81j3d1j	44	10	Tris	Tris	NNP
cord-269720-o81j3d1j	44	11	-	-	HYPH
cord-269720-o81j3d1j	44	12	HC1	HC1	NNP
cord-269720-o81j3d1j	44	13	(	(	-LRB-
cord-269720-o81j3d1j	44	14	pH	pH	NNP
cord-269720-o81j3d1j	44	15	8.3	8.3	CD
cord-269720-o81j3d1j	44	16	)	)	-RRB-
cord-269720-o81j3d1j	44	17	,	,	.
cord-269720-o81j3d1j	45	1	10	10	CD
cord-269720-o81j3d1j	45	2	mM	mm	CD
cord-269720-o81j3d1j	45	3	MgC12	MgC12	NNP
cord-269720-o81j3d1j	45	4	,	,	,
cord-269720-o81j3d1j	45	5	35	35	CD
cord-269720-o81j3d1j	45	6	mM	mm	CD
cord-269720-o81j3d1j	45	7	KC1	KC1	NNP
cord-269720-o81j3d1j	45	8	,	,	,
cord-269720-o81j3d1j	45	9	30	30	CD
cord-269720-o81j3d1j	45	10	mM	mm	CD
cord-269720-o81j3d1j	45	11	2-mercaptoethanol	2-mercaptoethanol	CD
cord-269720-o81j3d1j	45	12	,	,	,
cord-269720-o81j3d1j	45	13	3	3	CD
cord-269720-o81j3d1j	45	14	mM	mm	NN
cord-269720-o81j3d1j	45	15	dithiothreitol	dithiothreitol	NN
cord-269720-o81j3d1j	45	16	,	,	,
cord-269720-o81j3d1j	45	17	4	4	CD
cord-269720-o81j3d1j	45	18	mM	mm	CD
cord-269720-o81j3d1j	45	19	dNTPs	dntp	NNS
cord-269720-o81j3d1j	45	20	,	,	,
cord-269720-o81j3d1j	45	21	5'-end	5'-end	CD
cord-269720-o81j3d1j	45	22	-	-	HYPH
cord-269720-o81j3d1j	45	23	labeled	label	VBN
cord-269720-o81j3d1j	45	24	oligo	oligo	NN
cord-269720-o81j3d1j	45	25	38	38	CD
cord-269720-o81j3d1j	45	26	(	(	-LRB-
cord-269720-o81j3d1j	45	27	120	120	CD
cord-269720-o81j3d1j	45	28	ng	ng	NN
cord-269720-o81j3d1j	45	29	)	)	-RRB-
cord-269720-o81j3d1j	45	30	,	,	,
cord-269720-o81j3d1j	45	31	and	and	CC
cord-269720-o81j3d1j	45	32	21	21	CD
cord-269720-o81j3d1j	45	33	U	U	NNP
cord-269720-o81j3d1j	45	34	of	of	IN
cord-269720-o81j3d1j	45	35	AMV	AMV	NNP
cord-269720-o81j3d1j	45	36	reverse	reverse	NN
cord-269720-o81j3d1j	45	37	transcriptase	transcriptase	NN
cord-269720-o81j3d1j	45	38	(	(	-LRB-
cord-269720-o81j3d1j	45	39	Super	Super	NNP
cord-269720-o81j3d1j	45	40	-	-	NNP
cord-269720-o81j3d1j	45	41	RT	RT	NNP
cord-269720-o81j3d1j	45	42	,	,	,
cord-269720-o81j3d1j	45	43	Anglian	Anglian	NNP
cord-269720-o81j3d1j	45	44	Biotech	Biotech	NNP
cord-269720-o81j3d1j	45	45	Ltd	Ltd	NNP
cord-269720-o81j3d1j	45	46	,	,	,
cord-269720-o81j3d1j	45	47	Colchester	Colchester	NNP
cord-269720-o81j3d1j	45	48	)	)	-RRB-
cord-269720-o81j3d1j	45	49	for	for	IN
cord-269720-o81j3d1j	45	50	90	90	CD
cord-269720-o81j3d1j	45	51	min	min	NN
cord-269720-o81j3d1j	45	52	at	at	IN
cord-269720-o81j3d1j	45	53	42~	42~	CD
cord-269720-o81j3d1j	45	54	Formamide	Formamide	NNP
cord-269720-o81j3d1j	45	55	dye	dye	NN
cord-269720-o81j3d1j	45	56	(	(	-LRB-
cord-269720-o81j3d1j	45	57	80	80	CD
cord-269720-o81j3d1j	45	58	%	%	NN
cord-269720-o81j3d1j	45	59	formamide	formamide	NN
cord-269720-o81j3d1j	45	60	,	,	,
cord-269720-o81j3d1j	45	61	10	10	CD
cord-269720-o81j3d1j	45	62	mM	mm	CD
cord-269720-o81j3d1j	45	63	NaOH	NaOH	NNP
cord-269720-o81j3d1j	45	64	,	,	,
cord-269720-o81j3d1j	45	65	1	1	CD
cord-269720-o81j3d1j	45	66	mM	mm	CD
cord-269720-o81j3d1j	45	67	EDTA	EDTA	NNP
cord-269720-o81j3d1j	45	68	,	,	,
cord-269720-o81j3d1j	45	69	0.1	0.1	CD
cord-269720-o81j3d1j	45	70	%	%	NN
cord-269720-o81j3d1j	45	71	xylene	xylene	NN
cord-269720-o81j3d1j	45	72	cylanol	cylanol	NN
cord-269720-o81j3d1j	45	73	blue	blue	NN
cord-269720-o81j3d1j	45	74	,	,	,
cord-269720-o81j3d1j	45	75	0.1	0.1	CD
cord-269720-o81j3d1j	45	76	%	%	NN
cord-269720-o81j3d1j	45	77	bromophenol	bromophenol	NN
cord-269720-o81j3d1j	45	78	blue	blue	NNP
cord-269720-o81j3d1j	45	79	)	)	-RRB-
cord-269720-o81j3d1j	45	80	was	be	VBD
cord-269720-o81j3d1j	45	81	added	add	VBN
cord-269720-o81j3d1j	45	82	and	and	CC
cord-269720-o81j3d1j	45	83	the	the	DT
cord-269720-o81j3d1j	45	84	mixture	mixture	NN
cord-269720-o81j3d1j	45	85	boiled	boil	VBD
cord-269720-o81j3d1j	45	86	for	for	IN
cord-269720-o81j3d1j	45	87	3	3	CD
cord-269720-o81j3d1j	45	88	min	min	NN
cord-269720-o81j3d1j	45	89	and	and	CC
cord-269720-o81j3d1j	45	90	electrophoresed	electrophorese	VBD
cord-269720-o81j3d1j	45	91	on	on	IN
cord-269720-o81j3d1j	45	92	a	a	DT
cord-269720-o81j3d1j	45	93	40	40	CD
cord-269720-o81j3d1j	45	94	cm	cm	NN
cord-269720-o81j3d1j	45	95	buffer	buffer	NN
cord-269720-o81j3d1j	45	96	gradient	gradient	NN
cord-269720-o81j3d1j	45	97	sequencing	sequencing	NN
cord-269720-o81j3d1j	45	98	gel	gel	NN
cord-269720-o81j3d1j	45	99	(	(	-LRB-
cord-269720-o81j3d1j	45	100	23	23	CD
cord-269720-o81j3d1j	45	101	)	)	-RRB-
cord-269720-o81j3d1j	45	102	.	.	.
cord-269720-o81j3d1j	46	1	The	the	DT
cord-269720-o81j3d1j	46	2	wet	wet	JJ
cord-269720-o81j3d1j	46	3	gel	gel	NN
cord-269720-o81j3d1j	46	4	was	be	VBD
cord-269720-o81j3d1j	46	5	autoradiographed	autoradiographe	VBN
cord-269720-o81j3d1j	46	6	for	for	IN
cord-269720-o81j3d1j	46	7	1	1	CD
cord-269720-o81j3d1j	46	8	hr	hr	NN
cord-269720-o81j3d1j	46	9	to	to	TO
cord-269720-o81j3d1j	46	10	locate	locate	VB
cord-269720-o81j3d1j	46	11	the	the	DT
cord-269720-o81j3d1j	46	12	primerextended	primerextende	VBN
cord-269720-o81j3d1j	46	13	products	product	NNS
cord-269720-o81j3d1j	46	14	,	,	,
cord-269720-o81j3d1j	46	15	which	which	WDT
cord-269720-o81j3d1j	46	16	were	be	VBD
cord-269720-o81j3d1j	46	17	excised	excise	VBN
cord-269720-o81j3d1j	46	18	from	from	IN
cord-269720-o81j3d1j	46	19	the	the	DT
cord-269720-o81j3d1j	46	20	gel	gel	NN
cord-269720-o81j3d1j	46	21	.	.	.
cord-269720-o81j3d1j	47	1	The	the	DT
cord-269720-o81j3d1j	47	2	labeled	label	VBN
cord-269720-o81j3d1j	47	3	fragments	fragment	NNS
cord-269720-o81j3d1j	47	4	were	be	VBD
cord-269720-o81j3d1j	47	5	eluted	elute	VBN
cord-269720-o81j3d1j	47	6	from	from	IN
cord-269720-o81j3d1j	47	7	the	the	DT
cord-269720-o81j3d1j	47	8	polyacrylamide	polyacrylamide	NN
cord-269720-o81j3d1j	47	9	gel	gel	NN
cord-269720-o81j3d1j	47	10	and	and	CC
cord-269720-o81j3d1j	47	11	chemically	chemically	RB
cord-269720-o81j3d1j	47	12	cleaved	cleave	VBN
cord-269720-o81j3d1j	47	13	(	(	-LRB-
cord-269720-o81j3d1j	47	14	24	24	CD
cord-269720-o81j3d1j	47	15	)	)	-RRB-
cord-269720-o81j3d1j	47	16	.	.	.
cord-269720-o81j3d1j	48	1	Samples	sample	NNS
cord-269720-o81j3d1j	48	2	of	of	IN
cord-269720-o81j3d1j	48	3	the	the	DT
cord-269720-o81j3d1j	48	4	cleaved	cleaved	JJ
cord-269720-o81j3d1j	48	5	products	product	NNS
cord-269720-o81j3d1j	48	6	from	from	IN
cord-269720-o81j3d1j	48	7	each	each	DT
cord-269720-o81j3d1j	48	8	of	of	IN
cord-269720-o81j3d1j	48	9	the	the	DT
cord-269720-o81j3d1j	48	10	primer	primer	NN
cord-269720-o81j3d1j	48	11	extended	extend	VBN
cord-269720-o81j3d1j	48	12	products	product	NNS
cord-269720-o81j3d1j	48	13	were	be	VBD
cord-269720-o81j3d1j	48	14	electrophoresed	electrophorese	VBN
cord-269720-o81j3d1j	48	15	on	on	IN
cord-269720-o81j3d1j	48	16	6	6	CD
cord-269720-o81j3d1j	48	17	%	%	NN
cord-269720-o81j3d1j	48	18	polyacrylamide	polyacrylamide	NN
cord-269720-o81j3d1j	48	19	gels	gel	NNS
cord-269720-o81j3d1j	48	20	at	at	IN
cord-269720-o81j3d1j	48	21	35	35	CD
cord-269720-o81j3d1j	48	22	W	w	NN
cord-269720-o81j3d1j	48	23	constant	constant	JJ
cord-269720-o81j3d1j	48	24	power	power	NN
cord-269720-o81j3d1j	48	25	for	for	IN
cord-269720-o81j3d1j	48	26	two	two	CD
cord-269720-o81j3d1j	48	27	different	different	JJ
cord-269720-o81j3d1j	48	28	lengths	length	NNS
cord-269720-o81j3d1j	48	29	of	of	IN
cord-269720-o81j3d1j	48	30	time	time	NN
cord-269720-o81j3d1j	48	31	.	.	.
cord-269720-o81j3d1j	49	1	TGEV	TGEV	NNP
cord-269720-o81j3d1j	49	2	and	and	CC
cord-269720-o81j3d1j	49	3	PRCV	PRCV	NNP
cord-269720-o81j3d1j	50	1	poly(A)-containing	poly(A)-containing	NNP
cord-269720-o81j3d1j	50	2	RNA	RNA	NNP
cord-269720-o81j3d1j	50	3	was	be	VBD
cord-269720-o81j3d1j	50	4	glyoxylated	glyoxylate	VBN
cord-269720-o81j3d1j	50	5	and	and	CC
cord-269720-o81j3d1j	50	6	separated	separate	VBN
cord-269720-o81j3d1j	50	7	on	on	IN
cord-269720-o81j3d1j	50	8	a	a	DT
cord-269720-o81j3d1j	50	9	1	1	CD
cord-269720-o81j3d1j	50	10	%	%	NN
cord-269720-o81j3d1j	50	11	agarose	agarose	NN
cord-269720-o81j3d1j	50	12	gel	gel	NN
cord-269720-o81j3d1j	50	13	(	(	-LRB-
cord-269720-o81j3d1j	50	14	22	22	CD
cord-269720-o81j3d1j	50	15	)	)	-RRB-
cord-269720-o81j3d1j	50	16	.	.	.
cord-269720-o81j3d1j	51	1	The	the	DT
cord-269720-o81j3d1j	51	2	RNA	RNA	NNP
cord-269720-o81j3d1j	51	3	was	be	VBD
cord-269720-o81j3d1j	51	4	transferred	transfer	VBN
cord-269720-o81j3d1j	51	5	onto	onto	IN
cord-269720-o81j3d1j	51	6	Biodyne	Biodyne	NNP
cord-269720-o81j3d1j	51	7	A	A	NNP
cord-269720-o81j3d1j	51	8	membranes	membrane	NNS
cord-269720-o81j3d1j	52	1	(	(	-LRB-
cord-269720-o81j3d1j	52	2	Pall	Pall	NNP
cord-269720-o81j3d1j	52	3	P	P	NNP
cord-269720-o81j3d1j	52	4	/	/	SYM
cord-269720-o81j3d1j	52	5	N	n	CD
cord-269720-o81j3d1j	53	1	BNNG3R	BNNG3R	NNP
cord-269720-o81j3d1j	53	2	1.2	1.2	CD
cord-269720-o81j3d1j	54	1	~m	~m	JJ
cord-269720-o81j3d1j	54	2	,	,	,
cord-269720-o81j3d1j	54	3	Gallenkamp	Gallenkamp	NNP
cord-269720-o81j3d1j	54	4	)	)	-RRB-
cord-269720-o81j3d1j	54	5	in	in	IN
cord-269720-o81j3d1j	54	6	X20	X20	NNP
cord-269720-o81j3d1j	54	7	SSC	SSC	NNP
cord-269720-o81j3d1j	54	8	(	(	-LRB-
cord-269720-o81j3d1j	54	9	X1	X1	NNP
cord-269720-o81j3d1j	54	10	SSC	SSC	NNP
cord-269720-o81j3d1j	54	11	=	=	SYM
cord-269720-o81j3d1j	54	12	0.15	0.15	CD
cord-269720-o81j3d1j	54	13	M	M	NNP
cord-269720-o81j3d1j	54	14	NaCI	NaCI	NNP
cord-269720-o81j3d1j	54	15	,	,	,
cord-269720-o81j3d1j	54	16	0.015	0.015	CD
cord-269720-o81j3d1j	54	17	M	M	NNP
cord-269720-o81j3d1j	54	18	trisodium	trisodium	NN
cord-269720-o81j3d1j	54	19	citrate	citrate	NN
cord-269720-o81j3d1j	54	20	,	,	,
cord-269720-o81j3d1j	54	21	pH	pH	NNP
cord-269720-o81j3d1j	54	22	7.0	7.0	CD
cord-269720-o81j3d1j	54	23	)	)	-RRB-
cord-269720-o81j3d1j	54	24	for	for	IN
cord-269720-o81j3d1j	54	25	18	18	CD
cord-269720-o81j3d1j	54	26	hr	hr	NN
cord-269720-o81j3d1j	54	27	and	and	CC
cord-269720-o81j3d1j	54	28	baked	bake	VBN
cord-269720-o81j3d1j	54	29	at	at	IN
cord-269720-o81j3d1j	54	30	80~	80~	CD
cord-269720-o81j3d1j	54	31	for	for	IN
cord-269720-o81j3d1j	54	32	2	2	CD
cord-269720-o81j3d1j	54	33	hr	hr	NN
cord-269720-o81j3d1j	54	34	.	.	.
cord-269720-o81j3d1j	55	1	The	the	DT
cord-269720-o81j3d1j	55	2	membrane	membrane	NN
cord-269720-o81j3d1j	55	3	was	be	VBD
cord-269720-o81j3d1j	55	4	boiled	boil	VBN
cord-269720-o81j3d1j	55	5	in	in	IN
cord-269720-o81j3d1j	55	6	50	50	CD
cord-269720-o81j3d1j	55	7	mM	mm	CD
cord-269720-o81j3d1j	55	8	Tris	Tris	NNP
cord-269720-o81j3d1j	55	9	-	-	HYPH
cord-269720-o81j3d1j	55	10	HCl	HCl	NNP
cord-269720-o81j3d1j	55	11	pH	pH	NNP
cord-269720-o81j3d1j	55	12	8.0	8.0	CD
cord-269720-o81j3d1j	55	13	for	for	IN
cord-269720-o81j3d1j	55	14	5	5	CD
cord-269720-o81j3d1j	55	15	min	min	NN
cord-269720-o81j3d1j	55	16	to	to	TO
cord-269720-o81j3d1j	55	17	remove	remove	VB
cord-269720-o81j3d1j	55	18	glyoxal	glyoxal	NN
cord-269720-o81j3d1j	55	19	groups	group	NNS
cord-269720-o81j3d1j	55	20	from	from	IN
cord-269720-o81j3d1j	55	21	the	the	DT
cord-269720-o81j3d1j	55	22	RNA	RNA	NNP
cord-269720-o81j3d1j	55	23	and	and	CC
cord-269720-o81j3d1j	55	24	prehybridized	prehybridize	VBN
cord-269720-o81j3d1j	55	25	in	in	IN
cord-269720-o81j3d1j	55	26	the	the	DT
cord-269720-o81j3d1j	55	27	presence	presence	NN
cord-269720-o81j3d1j	55	28	of	of	IN
cord-269720-o81j3d1j	55	29	50	50	CD
cord-269720-o81j3d1j	55	30	%	%	NN
cord-269720-o81j3d1j	55	31	formamide	formamide	NN
cord-269720-o81j3d1j	55	32	for	for	IN
cord-269720-o81j3d1j	55	33	6	6	CD
cord-269720-o81j3d1j	55	34	hr	hr	NN
cord-269720-o81j3d1j	55	35	at	at	IN
cord-269720-o81j3d1j	55	36	42~	42~	CD
cord-269720-o81j3d1j	55	37	(	(	-LRB-
cord-269720-o81j3d1j	55	38	15	15	CD
cord-269720-o81j3d1j	55	39	)	)	-RRB-
cord-269720-o81j3d1j	55	40	.	.	.
cord-269720-o81j3d1j	56	1	The	the	DT
cord-269720-o81j3d1j	56	2	viral	viral	JJ
cord-269720-o81j3d1j	56	3	mRNA	mrna	NN
cord-269720-o81j3d1j	56	4	species	specie	NNS
cord-269720-o81j3d1j	56	5	were	be	VBD
cord-269720-o81j3d1j	56	6	hydribidized	hydribidize	VBN
cord-269720-o81j3d1j	56	7	with	with	IN
cord-269720-o81j3d1j	56	8	32p	32p	CD
cord-269720-o81j3d1j	56	9	-	-	HYPH
cord-269720-o81j3d1j	56	10	labeled	label	VBN
cord-269720-o81j3d1j	56	11	oligo	oligo	NN
cord-269720-o81j3d1j	56	12	58	58	CD
cord-269720-o81j3d1j	56	13	in	in	IN
cord-269720-o81j3d1j	56	14	the	the	DT
cord-269720-o81j3d1j	56	15	presence	presence	NN
cord-269720-o81j3d1j	56	16	of	of	IN
cord-269720-o81j3d1j	56	17	50	50	CD
cord-269720-o81j3d1j	56	18	%	%	NN
cord-269720-o81j3d1j	56	19	formamide	formamide	NN
cord-269720-o81j3d1j	56	20	for	for	IN
cord-269720-o81j3d1j	56	21	18	18	CD
cord-269720-o81j3d1j	56	22	hr	hr	NN
cord-269720-o81j3d1j	56	23	at	at	IN
cord-269720-o81j3d1j	56	24	42~	42~	CD
cord-269720-o81j3d1j	57	1	The	the	DT
cord-269720-o81j3d1j	57	2	membrane	membrane	NN
cord-269720-o81j3d1j	57	3	was	be	VBD
cord-269720-o81j3d1j	57	4	washed	wash	VBN
cord-269720-o81j3d1j	57	5	four	four	CD
cord-269720-o81j3d1j	57	6	times	time	NNS
cord-269720-o81j3d1j	57	7	in	in	IN
cord-269720-o81j3d1j	57	8	X2	X2	NNP
cord-269720-o81j3d1j	57	9	SSC	SSC	NNP
cord-269720-o81j3d1j	57	10	containing	contain	VBG
cord-269720-o81j3d1j	57	11	0.1	0.1	CD
cord-269720-o81j3d1j	57	12	%	%	NN
cord-269720-o81j3d1j	57	13	NaDodSO	nadodso	NN
cord-269720-o81j3d1j	57	14	4	4	CD
cord-269720-o81j3d1j	57	15	for	for	IN
cord-269720-o81j3d1j	57	16	15	15	CD
cord-269720-o81j3d1j	57	17	rain	rain	NN
cord-269720-o81j3d1j	57	18	at	at	IN
cord-269720-o81j3d1j	57	19	room	room	NN
cord-269720-o81j3d1j	57	20	temperature	temperature	NN
cord-269720-o81j3d1j	57	21	and	and	CC
cord-269720-o81j3d1j	57	22	autoradiographed	autoradiographe	VBN
cord-269720-o81j3d1j	57	23	.	.	.
cord-269720-o81j3d1j	58	1	Following	follow	VBG
cord-269720-o81j3d1j	58	2	primer	primer	NN
cord-269720-o81j3d1j	58	3	extension	extension	NN
cord-269720-o81j3d1j	58	4	,	,	,
cord-269720-o81j3d1j	58	5	using	use	VBG
cord-269720-o81j3d1j	58	6	oligo	oligo	NNP
cord-269720-o81j3d1j	58	7	38	38	CD
cord-269720-o81j3d1j	58	8	at	at	IN
cord-269720-o81j3d1j	58	9	the	the	DT
cord-269720-o81j3d1j	58	10	5	5	CD
cord-269720-o81j3d1j	58	11	'	'	NN
cord-269720-o81j3d1j	58	12	end	end	NN
cord-269720-o81j3d1j	58	13	of	of	IN
cord-269720-o81j3d1j	58	14	the	the	DT
cord-269720-o81j3d1j	58	15	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	58	16	gene	gene	NN
cord-269720-o81j3d1j	58	17	from	from	IN
cord-269720-o81j3d1j	58	18	the	the	DT
cord-269720-o81j3d1j	58	19	porcine	porcine	JJ
cord-269720-o81j3d1j	58	20	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	58	21	TGEV	TGEV	NNP
cord-269720-o81j3d1j	58	22	and	and	CC
cord-269720-o81j3d1j	58	23	PRCV	PRCV	NNP
cord-269720-o81j3d1j	58	24	,	,	,
cord-269720-o81j3d1j	58	25	labelled	label	VBN
cord-269720-o81j3d1j	58	26	fragments	fragment	NNS
cord-269720-o81j3d1j	58	27	of	of	IN
cord-269720-o81j3d1j	58	28	approximately	approximately	RB
cord-269720-o81j3d1j	58	29	140	140	CD
cord-269720-o81j3d1j	58	30	bases	basis	NNS
cord-269720-o81j3d1j	58	31	were	be	VBD
cord-269720-o81j3d1j	58	32	produced	produce	VBN
cord-269720-o81j3d1j	58	33	and	and	CC
cord-269720-o81j3d1j	58	34	purified	purify	VBN
cord-269720-o81j3d1j	58	35	from	from	IN
cord-269720-o81j3d1j	58	36	gels	gel	NNS
cord-269720-o81j3d1j	58	37	.	.	.
cord-269720-o81j3d1j	59	1	Larger	large	JJR
cord-269720-o81j3d1j	59	2	molecular	molecular	JJ
cord-269720-o81j3d1j	59	3	weight	weight	NN
cord-269720-o81j3d1j	59	4	species	specie	NNS
cord-269720-o81j3d1j	59	5	were	be	VBD
cord-269720-o81j3d1j	59	6	also	also	RB
cord-269720-o81j3d1j	59	7	observed	observe	VBN
cord-269720-o81j3d1j	59	8	(	(	-LRB-
cord-269720-o81j3d1j	59	9	data	datum	NNS
cord-269720-o81j3d1j	59	10	not	not	RB
cord-269720-o81j3d1j	59	11	shown	show	VBN
cord-269720-o81j3d1j	59	12	)	)	-RRB-
cord-269720-o81j3d1j	59	13	in	in	IN
cord-269720-o81j3d1j	59	14	minor	minor	JJ
cord-269720-o81j3d1j	59	15	amounts	amount	NNS
cord-269720-o81j3d1j	59	16	,	,	,
cord-269720-o81j3d1j	59	17	presumably	presumably	RB
cord-269720-o81j3d1j	59	18	corresponding	correspond	VBG
cord-269720-o81j3d1j	59	19	to	to	TO
cord-269720-o81j3d1j	59	20	read	read	VB
cord-269720-o81j3d1j	59	21	-	-	HYPH
cord-269720-o81j3d1j	59	22	through	through	RP
cord-269720-o81j3d1j	59	23	sequences	sequence	NNS
cord-269720-o81j3d1j	59	24	upstream	upstream	RB
cord-269720-o81j3d1j	59	25	of	of	IN
cord-269720-o81j3d1j	59	26	the	the	DT
cord-269720-o81j3d1j	59	27	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	59	28	gene	gene	NN
cord-269720-o81j3d1j	59	29	primed	prime	VBN
cord-269720-o81j3d1j	59	30	from	from	IN
cord-269720-o81j3d1j	59	31	the	the	DT
cord-269720-o81j3d1j	59	32	larger	large	JJR
cord-269720-o81j3d1j	59	33	mRNA	mRNA	NNP
cord-269720-o81j3d1j	59	34	species	specie	NNS
cord-269720-o81j3d1j	59	35	.	.	.
cord-269720-o81j3d1j	60	1	The	the	DT
cord-269720-o81j3d1j	60	2	nucleotide	nucleotide	JJ
cord-269720-o81j3d1j	60	3	sequences	sequence	NNS
cord-269720-o81j3d1j	60	4	of	of	IN
cord-269720-o81j3d1j	60	5	the	the	DT
cord-269720-o81j3d1j	60	6	two	two	CD
cord-269720-o81j3d1j	60	7	fragments	fragment	NNS
cord-269720-o81j3d1j	60	8	,	,	,
cord-269720-o81j3d1j	60	9	determined	determine	VBN
cord-269720-o81j3d1j	60	10	by	by	IN
cord-269720-o81j3d1j	60	11	chemical	chemical	NN
cord-269720-o81j3d1j	60	12	cleavage	cleavage	NN
cord-269720-o81j3d1j	60	13	,	,	,
cord-269720-o81j3d1j	60	14	were	be	VBD
cord-269720-o81j3d1j	60	15	identical	identical	JJ
cord-269720-o81j3d1j	60	16	.	.	.
cord-269720-o81j3d1j	61	1	The	the	DT
cord-269720-o81j3d1j	61	2	resulting	result	VBG
cord-269720-o81j3d1j	61	3	nucleotide	nucleotide	JJ
cord-269720-o81j3d1j	61	4	sequence	sequence	NN
cord-269720-o81j3d1j	61	5	of	of	IN
cord-269720-o81j3d1j	61	6	the	the	DT
cord-269720-o81j3d1j	61	7	TGEV	TGEV	NNP
cord-269720-o81j3d1j	61	8	leader	leader	NN
cord-269720-o81j3d1j	61	9	RNA	RNA	NNP
cord-269720-o81j3d1j	61	10	sequence	sequence	NN
cord-269720-o81j3d1j	61	11	is	be	VBZ
cord-269720-o81j3d1j	61	12	shown	show	VBN
cord-269720-o81j3d1j	61	13	in	in	IN
cord-269720-o81j3d1j	61	14	relation	relation	NN
cord-269720-o81j3d1j	61	15	to	to	IN
cord-269720-o81j3d1j	61	16	the	the	DT
cord-269720-o81j3d1j	61	17	TGEV	TGEV	NNP
cord-269720-o81j3d1j	61	18	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	61	19	gene	gene	NN
cord-269720-o81j3d1j	61	20	in	in	IN
cord-269720-o81j3d1j	61	21	Fig	Fig	NNP
cord-269720-o81j3d1j	61	22	.	.	.
cord-269720-o81j3d1j	62	1	1	1	LS
cord-269720-o81j3d1j	62	2	.	.	.
cord-269720-o81j3d1j	63	1	The	the	DT
cord-269720-o81j3d1j	63	2	leader	leader	NN
cord-269720-o81j3d1j	63	3	RNA	RNA	NNP
cord-269720-o81j3d1j	63	4	sequence	sequence	NN
cord-269720-o81j3d1j	63	5	diverges	diverge	VBZ
cord-269720-o81j3d1j	63	6	from	from	IN
cord-269720-o81j3d1j	63	7	the	the	DT
cord-269720-o81j3d1j	63	8	genomic	genomic	JJ
cord-269720-o81j3d1j	63	9	sequence	sequence	NN
cord-269720-o81j3d1j	63	10	15	15	CD
cord-269720-o81j3d1j	63	11	bp	bp	NNP
cord-269720-o81j3d1j	63	12	upstream	upstream	RB
cord-269720-o81j3d1j	63	13	of	of	IN
cord-269720-o81j3d1j	63	14	the	the	DT
cord-269720-o81j3d1j	63	15	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	63	16	gene	gene	NN
cord-269720-o81j3d1j	63	17	,	,	,
cord-269720-o81j3d1j	63	18	corresponding	correspond	VBG
cord-269720-o81j3d1j	63	19	to	to	IN
cord-269720-o81j3d1j	63	20	the	the	DT
cord-269720-o81j3d1j	63	21	first	first	JJ
cord-269720-o81j3d1j	63	22	nucleotide	nucleotide	NN
cord-269720-o81j3d1j	63	23	of	of	IN
cord-269720-o81j3d1j	63	24	the	the	DT
cord-269720-o81j3d1j	63	25	membrane	membrane	NN
cord-269720-o81j3d1j	63	26	protein	protein	NN
cord-269720-o81j3d1j	63	27	gene	gene	NN
cord-269720-o81j3d1j	63	28	stop	stop	NN
cord-269720-o81j3d1j	63	29	codon	codon	NNP
cord-269720-o81j3d1j	63	30	(	(	-LRB-
cord-269720-o81j3d1j	63	31	16	16	CD
cord-269720-o81j3d1j	63	32	)	)	-RRB-
cord-269720-o81j3d1j	63	33	,	,	,
cord-269720-o81j3d1j	63	34	indicating	indicate	VBG
cord-269720-o81j3d1j	63	35	a	a	DT
cord-269720-o81j3d1j	63	36	length	length	NN
cord-269720-o81j3d1j	63	37	of	of	IN
cord-269720-o81j3d1j	63	38	91	91	CD
cord-269720-o81j3d1j	63	39	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	63	40	of	of	IN
cord-269720-o81j3d1j	63	41	unique	unique	JJ
cord-269720-o81j3d1j	63	42	sequence	sequence	NN
cord-269720-o81j3d1j	64	1	(	(	-LRB-
cord-269720-o81j3d1j	64	2	Fig	Fig	NNP
cord-269720-o81j3d1j	64	3	.	.	NNP
cord-269720-o81j3d1j	64	4	1	1	CD
cord-269720-o81j3d1j	64	5	)	)	-RRB-
cord-269720-o81j3d1j	64	6	.	.	.
cord-269720-o81j3d1j	65	1	The	the	DT
cord-269720-o81j3d1j	65	2	91	91	CD
cord-269720-o81j3d1j	65	3	nucleotide	nucleotide	JJ
cord-269720-o81j3d1j	65	4	leader	leader	NN
cord-269720-o81j3d1j	65	5	sequence	sequence	NN
cord-269720-o81j3d1j	65	6	of	of	IN
cord-269720-o81j3d1j	65	7	TGEV	TGEV	NNP
cord-269720-o81j3d1j	65	8	and	and	CC
cord-269720-o81j3d1j	65	9	PRCV	PRCV	NNP
cord-269720-o81j3d1j	65	10	has	have	VBZ
cord-269720-o81j3d1j	65	11	a	a	DT
cord-269720-o81j3d1j	65	12	low	low	JJ
cord-269720-o81j3d1j	65	13	content	content	NN
cord-269720-o81j3d1j	65	14	of	of	IN
cord-269720-o81j3d1j	65	15	G	g	NN
cord-269720-o81j3d1j	65	16	(	(	-LRB-
cord-269720-o81j3d1j	65	17	18	18	CD
cord-269720-o81j3d1j	65	18	%	%	NN
cord-269720-o81j3d1j	65	19	)	)	-RRB-
cord-269720-o81j3d1j	65	20	and	and	CC
cord-269720-o81j3d1j	65	21	C	C	NNP
cord-269720-o81j3d1j	65	22	(	(	-LRB-
cord-269720-o81j3d1j	65	23	20	20	CD
cord-269720-o81j3d1j	65	24	%	%	NN
cord-269720-o81j3d1j	65	25	)	)	-RRB-
cord-269720-o81j3d1j	65	26	,	,	,
cord-269720-o81j3d1j	65	27	and	and	CC
cord-269720-o81j3d1j	65	28	a	a	DT
cord-269720-o81j3d1j	65	29	high	high	JJ
cord-269720-o81j3d1j	65	30	A	a	NN
cord-269720-o81j3d1j	65	31	(	(	-LRB-
cord-269720-o81j3d1j	65	32	22	22	CD
cord-269720-o81j3d1j	65	33	%	%	NN
cord-269720-o81j3d1j	65	34	)	)	-RRB-
cord-269720-o81j3d1j	65	35	and	and	CC
cord-269720-o81j3d1j	65	36	T	T	NNP
cord-269720-o81j3d1j	65	37	(	(	-LRB-
cord-269720-o81j3d1j	65	38	40	40	CD
cord-269720-o81j3d1j	65	39	%	%	NN
cord-269720-o81j3d1j	65	40	)	)	-RRB-
cord-269720-o81j3d1j	65	41	content	content	NN
cord-269720-o81j3d1j	65	42	,	,	,
cord-269720-o81j3d1j	65	43	with	with	IN
cord-269720-o81j3d1j	65	44	20	20	CD
cord-269720-o81j3d1j	65	45	%	%	NN
cord-269720-o81j3d1j	65	46	of	of	IN
cord-269720-o81j3d1j	65	47	the	the	DT
cord-269720-o81j3d1j	65	48	T	T	NNP
cord-269720-o81j3d1j	65	49	residues	residue	NNS
cord-269720-o81j3d1j	65	50	grouped	group	VBN
cord-269720-o81j3d1j	65	51	in	in	IN
cord-269720-o81j3d1j	65	52	threeto	threeto	NNP
cord-269720-o81j3d1j	65	53	four	four	CD
cord-269720-o81j3d1j	65	54	-	-	HYPH
cord-269720-o81j3d1j	65	55	nucleotide	nucleotide	JJ
cord-269720-o81j3d1j	65	56	motifs	motif	NNS
cord-269720-o81j3d1j	65	57	(	(	-LRB-
cord-269720-o81j3d1j	65	58	Fig	fig	NN
cord-269720-o81j3d1j	65	59	.	.	.
cord-269720-o81j3d1j	65	60	1	1	CD
cord-269720-o81j3d1j	65	61	)	)	-RRB-
cord-269720-o81j3d1j	65	62	.	.	.
cord-269720-o81j3d1j	66	1	These	these	DT
cord-269720-o81j3d1j	66	2	values	value	NNS
cord-269720-o81j3d1j	66	3	are	be	VBP
cord-269720-o81j3d1j	66	4	similar	similar	JJ
cord-269720-o81j3d1j	66	5	to	to	IN
cord-269720-o81j3d1j	66	6	those	those	DT
cord-269720-o81j3d1j	66	7	observed	observe	VBN
cord-269720-o81j3d1j	66	8	from	from	IN
cord-269720-o81j3d1j	66	9	the	the	DT
cord-269720-o81j3d1j	66	10	TGEV	TGEV	NNP
cord-269720-o81j3d1j	66	11	genome	genome	NN
cord-269720-o81j3d1j	66	12	so	so	RB
cord-269720-o81j3d1j	66	13	far	far	RB
cord-269720-o81j3d1j	66	14	sequenced	sequence	VBN
cord-269720-o81j3d1j	66	15	,	,	,
cord-269720-o81j3d1j	66	16	except	except	IN
cord-269720-o81j3d1j	66	17	that	that	IN
cord-269720-o81j3d1j	66	18	the	the	DT
cord-269720-o81j3d1j	66	19	values	value	NNS
cord-269720-o81j3d1j	66	20	for	for	IN
cord-269720-o81j3d1j	66	21	A	a	NN
cord-269720-o81j3d1j	66	22	(	(	-LRB-
cord-269720-o81j3d1j	66	23	30.5	30.5	CD
cord-269720-o81j3d1j	66	24	%	%	NN
cord-269720-o81j3d1j	66	25	)	)	-RRB-
cord-269720-o81j3d1j	66	26	and	and	CC
cord-269720-o81j3d1j	66	27	T	T	NNP
cord-269720-o81j3d1j	66	28	(	(	-LRB-
cord-269720-o81j3d1j	66	29	32.1	32.1	CD
cord-269720-o81j3d1j	66	30	%	%	NN
cord-269720-o81j3d1j	66	31	)	)	-RRB-
cord-269720-o81j3d1j	66	32	are	be	VBP
cord-269720-o81j3d1j	66	33	more	more	RBR
cord-269720-o81j3d1j	66	34	similar	similar	JJ
cord-269720-o81j3d1j	66	35	on	on	IN
cord-269720-o81j3d1j	66	36	the	the	DT
cord-269720-o81j3d1j	66	37	genome	genome	NN
cord-269720-o81j3d1j	66	38	than	than	IN
cord-269720-o81j3d1j	66	39	on	on	IN
cord-269720-o81j3d1j	66	40	the	the	DT
cord-269720-o81j3d1j	66	41	leader	leader	NN
cord-269720-o81j3d1j	66	42	sequence	sequence	NN
cord-269720-o81j3d1j	66	43	.	.	.
cord-269720-o81j3d1j	67	1	Analysis	analysis	NN
cord-269720-o81j3d1j	67	2	of	of	IN
cord-269720-o81j3d1j	67	3	the	the	DT
cord-269720-o81j3d1j	67	4	TGEV	TGEV	NNP
cord-269720-o81j3d1j	67	5	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	67	6	nucleotide	nucleotide	JJ
cord-269720-o81j3d1j	67	7	sequence	sequence	NN
cord-269720-o81j3d1j	67	8	(	(	-LRB-
cord-269720-o81j3d1j	67	9	15	15	CD
cord-269720-o81j3d1j	67	10	)	)	-RRB-
cord-269720-o81j3d1j	67	11	revealed	reveal	VBD
cord-269720-o81j3d1j	67	12	a	a	DT
cord-269720-o81j3d1j	67	13	potential	potential	JJ
cord-269720-o81j3d1j	67	14	RNA	rna	NN
cord-269720-o81j3d1j	67	15	polymerase	polymerase	NN
cord-269720-o81j3d1j	67	16	-	-	HYPH
cord-269720-o81j3d1j	67	17	leader	leader	NN
cord-269720-o81j3d1j	67	18	complex	complex	JJ
cord-269720-o81j3d1j	67	19	binding	binding	NN
cord-269720-o81j3d1j	67	20	site	site	NN
cord-269720-o81j3d1j	67	21	.	.	.
cord-269720-o81j3d1j	68	1	The	the	DT
cord-269720-o81j3d1j	68	2	site	site	NN
cord-269720-o81j3d1j	68	3	,	,	,
cord-269720-o81j3d1j	68	4	ACTAAAC	ACTAAAC	NNP
cord-269720-o81j3d1j	68	5	,	,	,
cord-269720-o81j3d1j	68	6	is	be	VBZ
cord-269720-o81j3d1j	68	7	seven	seven	CD
cord-269720-o81j3d1j	68	8	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	68	9	upstream	upstream	RB
cord-269720-o81j3d1j	68	10	of	of	IN
cord-269720-o81j3d1j	68	11	the	the	DT
cord-269720-o81j3d1j	68	12	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	68	13	initiation	initiation	NNP
cord-269720-o81j3d1j	68	14	codon	codon	NNP
cord-269720-o81j3d1j	68	15	and	and	CC
cord-269720-o81j3d1j	68	16	has	have	VBZ
cord-269720-o81j3d1j	68	17	also	also	RB
cord-269720-o81j3d1j	68	18	been	be	VBN
cord-269720-o81j3d1j	68	19	found	find	VBN
cord-269720-o81j3d1j	68	20	to	to	TO
cord-269720-o81j3d1j	68	21	precede	precede	VB
cord-269720-o81j3d1j	68	22	all	all	PDT
cord-269720-o81j3d1j	68	23	the	the	DT
cord-269720-o81j3d1j	68	24	TGEV	TGEV	NNP
cord-269720-o81j3d1j	68	25	structural	structural	JJ
cord-269720-o81j3d1j	68	26	protein	protein	NN
cord-269720-o81j3d1j	68	27	genes	gene	NNS
cord-269720-o81j3d1j	68	28	and	and	CC
cord-269720-o81j3d1j	68	29	two	two	CD
cord-269720-o81j3d1j	68	30	of	of	IN
cord-269720-o81j3d1j	68	31	the	the	DT
cord-269720-o81j3d1j	68	32	three	three	CD
cord-269720-o81j3d1j	68	33	potential	potential	JJ
cord-269720-o81j3d1j	68	34	genes	gene	NNS
cord-269720-o81j3d1j	68	35	shown	show	VBN
cord-269720-o81j3d1j	68	36	to	to	TO
cord-269720-o81j3d1j	68	37	be	be	VB
cord-269720-o81j3d1j	68	38	at	at	IN
cord-269720-o81j3d1j	68	39	the	the	DT
cord-269720-o81j3d1j	68	40	5	5	CD
cord-269720-o81j3d1j	68	41	'	'	NN
cord-269720-o81j3d1j	68	42	end	end	NN
cord-269720-o81j3d1j	68	43	of	of	IN
cord-269720-o81j3d1j	68	44	mRNA	mrna	NN
cord-269720-o81j3d1j	68	45	species	specie	NNS
cord-269720-o81j3d1j	68	46	(	(	-LRB-
cord-269720-o81j3d1j	68	47	15	15	CD
cord-269720-o81j3d1j	68	48	)	)	-RRB-
cord-269720-o81j3d1j	68	49	(	(	-LRB-
cord-269720-o81j3d1j	68	50	16	16	CD
cord-269720-o81j3d1j	68	51	)	)	-RRB-
cord-269720-o81j3d1j	68	52	(	(	-LRB-
cord-269720-o81j3d1j	68	53	17	17	CD
cord-269720-o81j3d1j	68	54	)	)	-RRB-
cord-269720-o81j3d1j	68	55	.	.	.
cord-269720-o81j3d1j	69	1	This	this	DT
cord-269720-o81j3d1j	69	2	consensus	consensus	NN
cord-269720-o81j3d1j	69	3	sequence	sequence	NN
cord-269720-o81j3d1j	69	4	is	be	VBZ
cord-269720-o81j3d1j	69	5	found	find	VBN
cord-269720-o81j3d1j	69	6	two	two	CD
cord-269720-o81j3d1j	69	7	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	69	8	downstream	downstream	JJ
cord-269720-o81j3d1j	69	9	of	of	IN
cord-269720-o81j3d1j	69	10	the	the	DT
cord-269720-o81j3d1j	69	11	nucleotide	nucleotide	NN
cord-269720-o81j3d1j	69	12	where	where	WRB
cord-269720-o81j3d1j	69	13	the	the	DT
cord-269720-o81j3d1j	69	14	leader	leader	NN
cord-269720-o81j3d1j	69	15	RNA	RNA	NNP
cord-269720-o81j3d1j	69	16	and	and	CC
cord-269720-o81j3d1j	69	17	TGEV	TGEV	NNP
cord-269720-o81j3d1j	69	18	genomic	genomic	JJ
cord-269720-o81j3d1j	69	19	sequences	sequence	NNS
cord-269720-o81j3d1j	69	20	diverge	diverge	VBP
cord-269720-o81j3d1j	69	21	,	,	,
cord-269720-o81j3d1j	69	22	indicating	indicate	VBG
cord-269720-o81j3d1j	69	23	that	that	IN
cord-269720-o81j3d1j	69	24	this	this	DT
cord-269720-o81j3d1j	69	25	sequence	sequence	NN
cord-269720-o81j3d1j	69	26	is	be	VBZ
cord-269720-o81j3d1j	69	27	involved	involve	VBN
cord-269720-o81j3d1j	69	28	in	in	IN
cord-269720-o81j3d1j	69	29	the	the	DT
cord-269720-o81j3d1j	69	30	leader	leader	NN
cord-269720-o81j3d1j	69	31	-	-	HYPH
cord-269720-o81j3d1j	69	32	primed	prime	VBN
cord-269720-o81j3d1j	69	33	transcription	transcription	NN
cord-269720-o81j3d1j	69	34	ofTGEV	oftgev	NN
cord-269720-o81j3d1j	69	35	mRNA	mrna	NN
cord-269720-o81j3d1j	69	36	molecules	molecule	NNS
cord-269720-o81j3d1j	69	37	.	.	.
cord-269720-o81j3d1j	70	1	As	as	IN
cord-269720-o81j3d1j	70	2	can	can	MD
cord-269720-o81j3d1j	70	3	be	be	VB
cord-269720-o81j3d1j	70	4	seen	see	VBN
cord-269720-o81j3d1j	70	5	from	from	IN
cord-269720-o81j3d1j	70	6	Fig	Fig	NNP
cord-269720-o81j3d1j	70	7	.	.	.
cord-269720-o81j3d1j	71	1	2	2	CD
cord-269720-o81j3d1j	71	2	,	,	,
cord-269720-o81j3d1j	71	3	4	4	CD
cord-269720-o81j3d1j	71	4	of	of	IN
cord-269720-o81j3d1j	71	5	the	the	DT
cord-269720-o81j3d1j	71	6	6	6	CD
cord-269720-o81j3d1j	71	7	mRNA	mrna	NN
cord-269720-o81j3d1j	71	8	species	specie	NNS
cord-269720-o81j3d1j	71	9	from	from	IN
cord-269720-o81j3d1j	71	10	the	the	DT
cord-269720-o81j3d1j	71	11	FS772/70	FS772/70	NNP
cord-269720-o81j3d1j	71	12	strain	strain	NN
cord-269720-o81j3d1j	71	13	of	of	IN
cord-269720-o81j3d1j	71	14	TGEV	TGEV	NNP
cord-269720-o81j3d1j	71	15	have	have	VBP
cord-269720-o81j3d1j	71	16	the	the	DT
cord-269720-o81j3d1j	71	17	sequence	sequence	NN
cord-269720-o81j3d1j	71	18	AACTAAAC	aactaaac	NN
cord-269720-o81j3d1j	71	19	,	,	,
cord-269720-o81j3d1j	71	20	of	of	IN
cord-269720-o81j3d1j	71	21	which	which	WDT
cord-269720-o81j3d1j	71	22	the	the	DT
cord-269720-o81j3d1j	71	23	5'-end	5'-end	CD
cord-269720-o81j3d1j	71	24	adenosine	adenosine	NN
cord-269720-o81j3d1j	71	25	residue	residue	NN
cord-269720-o81j3d1j	71	26	is	be	VBZ
cord-269720-o81j3d1j	71	27	the	the	DT
cord-269720-o81j3d1j	71	28	next	next	JJ
cord-269720-o81j3d1j	71	29	base	base	NN
cord-269720-o81j3d1j	71	30	down	down	RP
cord-269720-o81j3d1j	71	31	from	from	IN
cord-269720-o81j3d1j	71	32	the	the	DT
cord-269720-o81j3d1j	71	33	divergence	divergence	NN
cord-269720-o81j3d1j	71	34	point	point	NN
cord-269720-o81j3d1j	71	35	.	.	.
cord-269720-o81j3d1j	72	1	In	in	IN
cord-269720-o81j3d1j	72	2	fact	fact	NN
cord-269720-o81j3d1j	72	3	,	,	,
cord-269720-o81j3d1j	72	4	the	the	DT
cord-269720-o81j3d1j	72	5	consensus	consensus	NN
cord-269720-o81j3d1j	72	6	sequence	sequence	NN
cord-269720-o81j3d1j	72	7	at	at	IN
cord-269720-o81j3d1j	72	8	the	the	DT
cord-269720-o81j3d1j	72	9	spike	spike	NN
cord-269720-o81j3d1j	72	10	/	/	SYM
cord-269720-o81j3d1j	72	11	ORF1-ORF2	ORF1-ORF2	NNP
cord-269720-o81j3d1j	72	12	gene	gene	NN
cord-269720-o81j3d1j	72	13	junction	junction	NN
cord-269720-o81j3d1j	72	14	has	have	VBZ
cord-269720-o81j3d1j	72	15	the	the	DT
cord-269720-o81j3d1j	72	16	sequence	sequence	NN
cord-269720-o81j3d1j	72	17	GAACTAAAC	GAACTAAAC	NNP
cord-269720-o81j3d1j	72	18	and	and	CC
cord-269720-o81j3d1j	72	19	at	at	IN
cord-269720-o81j3d1j	72	20	the	the	DT
cord-269720-o81j3d1j	72	21	NUC	NUC	NNP
cord-269720-o81j3d1j	72	22	/	/	SYM
cord-269720-o81j3d1j	72	23	ORF4	ORF4	NNP
cord-269720-o81j3d1j	72	24	gene	gene	NN
cord-269720-o81j3d1j	72	25	junction	junction	NN
cord-269720-o81j3d1j	72	26	has	have	VBZ
cord-269720-o81j3d1j	72	27	the	the	DT
cord-269720-o81j3d1j	72	28	sequence	sequence	NN
cord-269720-o81j3d1j	72	29	CGAACTAAAC	CGAACTAAAC	NNP
cord-269720-o81j3d1j	72	30	,	,	,
cord-269720-o81j3d1j	72	31	indicating	indicate	VBG
cord-269720-o81j3d1j	72	32	that	that	IN
cord-269720-o81j3d1j	72	33	the	the	DT
cord-269720-o81j3d1j	72	34	region	region	NN
cord-269720-o81j3d1j	72	35	of	of	IN
cord-269720-o81j3d1j	72	36	the	the	DT
cord-269720-o81j3d1j	72	37	leader	leader	NN
cord-269720-o81j3d1j	72	38	sequence	sequence	NN
cord-269720-o81j3d1j	72	39	5	5	CD
cord-269720-o81j3d1j	72	40	'	'	''
cord-269720-o81j3d1j	72	41	to	to	IN
cord-269720-o81j3d1j	72	42	the	the	DT
cord-269720-o81j3d1j	72	43	homology	homology	NN
cord-269720-o81j3d1j	72	44	motif	motif	NN
cord-269720-o81j3d1j	72	45	,	,	,
cord-269720-o81j3d1j	72	46	ACTAAAC	ACTAAAC	NNP
cord-269720-o81j3d1j	72	47	,	,	,
cord-269720-o81j3d1j	72	48	may	may	MD
cord-269720-o81j3d1j	72	49	vary	vary	VB
cord-269720-o81j3d1j	72	50	between	between	IN
cord-269720-o81j3d1j	72	51	89	89	CD
cord-269720-o81j3d1j	72	52	and	and	CC
cord-269720-o81j3d1j	72	53	91	91	CD
cord-269720-o81j3d1j	72	54	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	72	55	depending	depend	VBG
cord-269720-o81j3d1j	72	56	on	on	IN
cord-269720-o81j3d1j	72	57	the	the	DT
cord-269720-o81j3d1j	72	58	TGEV	TGEV	NNP
cord-269720-o81j3d1j	72	59	gene	gene	NN
cord-269720-o81j3d1j	72	60	.	.	.
cord-269720-o81j3d1j	73	1	Computer	computer	NN
cord-269720-o81j3d1j	73	2	analysis	analysis	NN
cord-269720-o81j3d1j	73	3	has	have	VBZ
cord-269720-o81j3d1j	73	4	also	also	RB
cord-269720-o81j3d1j	73	5	detected	detect	VBN
cord-269720-o81j3d1j	73	6	a	a	DT
cord-269720-o81j3d1j	73	7	homology	homology	NN
cord-269720-o81j3d1j	73	8	between	between	IN
cord-269720-o81j3d1j	73	9	the	the	DT
cord-269720-o81j3d1j	73	10	leader	leader	NN
cord-269720-o81j3d1j	73	11	RNA	RNA	NNP
cord-269720-o81j3d1j	73	12	sequence	sequence	NN
cord-269720-o81j3d1j	73	13	and	and	CC
cord-269720-o81j3d1j	73	14	the	the	DT
cord-269720-o81j3d1j	73	15	5	5	CD
cord-269720-o81j3d1j	73	16	'	'	NN
cord-269720-o81j3d1j	73	17	end	end	NN
cord-269720-o81j3d1j	73	18	of	of	IN
cord-269720-o81j3d1j	73	19	the	the	DT
cord-269720-o81j3d1j	73	20	negative	negative	JJ
cord-269720-o81j3d1j	73	21	strand	strand	NN
cord-269720-o81j3d1j	73	22	(	(	-LRB-
cord-269720-o81j3d1j	73	23	i.e.	i.e.	FW
cord-269720-o81j3d1j	73	24	,	,	,
cord-269720-o81j3d1j	73	25	the	the	DT
cord-269720-o81j3d1j	73	26	reverse	reverse	JJ
cord-269720-o81j3d1j	73	27	complement	complement	NN
cord-269720-o81j3d1j	73	28	of	of	IN
cord-269720-o81j3d1j	73	29	the	the	DT
cord-269720-o81j3d1j	73	30	noncoding	noncoding	JJ
cord-269720-o81j3d1j	73	31	region	region	NN
cord-269720-o81j3d1j	73	32	at	at	IN
cord-269720-o81j3d1j	73	33	the	the	DT
cord-269720-o81j3d1j	73	34	3	3	CD
cord-269720-o81j3d1j	73	35	'	'	NN
cord-269720-o81j3d1j	73	36	end	end	NN
cord-269720-o81j3d1j	73	37	of	of	IN
cord-269720-o81j3d1j	73	38	the	the	DT
cord-269720-o81j3d1j	73	39	positive	positive	JJ
cord-269720-o81j3d1j	73	40	strand	strand	NN
cord-269720-o81j3d1j	73	41	)	)	-RRB-
cord-269720-o81j3d1j	73	42	.	.	.
cord-269720-o81j3d1j	74	1	This	this	DT
cord-269720-o81j3d1j	74	2	is	be	VBZ
cord-269720-o81j3d1j	74	3	shown	show	VBN
cord-269720-o81j3d1j	74	4	in	in	IN
cord-269720-o81j3d1j	74	5	Fig	Fig	NNP
cord-269720-o81j3d1j	74	6	.	.	.
cord-269720-o81j3d1j	74	7	 	 	_SP
cord-269720-o81j3d1j	75	1	3	3	LS
cord-269720-o81j3d1j	75	2	.	.	.
cord-269720-o81j3d1j	76	1	The	the	DT
cord-269720-o81j3d1j	76	2	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	76	3	on	on	IN
cord-269720-o81j3d1j	76	4	the	the	DT
cord-269720-o81j3d1j	76	5	leader	leader	NN
cord-269720-o81j3d1j	76	6	RNA	RNA	NNP
cord-269720-o81j3d1j	76	7	sequence	sequence	NN
cord-269720-o81j3d1j	76	8	,	,	,
cord-269720-o81j3d1j	76	9	bases	basis	NNS
cord-269720-o81j3d1j	76	10	84	84	CD
cord-269720-o81j3d1j	76	11	-	-	SYM
cord-269720-o81j3d1j	76	12	99	99	CD
cord-269720-o81j3d1j	76	13	,	,	,
cord-269720-o81j3d1j	76	14	and	and	CC
cord-269720-o81j3d1j	76	15	on	on	IN
cord-269720-o81j3d1j	76	16	the	the	DT
cord-269720-o81j3d1j	76	17	negative	negative	JJ
cord-269720-o81j3d1j	76	18	strand	strand	NN
cord-269720-o81j3d1j	76	19	,	,	,
cord-269720-o81j3d1j	76	20	bases	basis	NNS
cord-269720-o81j3d1j	76	21	136	136	CD
cord-269720-o81j3d1j	76	22	to	to	TO
cord-269720-o81j3d1j	76	23	152	152	CD
cord-269720-o81j3d1j	76	24	counting	counting	NN
cord-269720-o81j3d1j	76	25	from	from	IN
cord-269720-o81j3d1j	76	26	the	the	DT
cord-269720-o81j3d1j	76	27	first	first	JJ
cord-269720-o81j3d1j	76	28	base	base	NN
cord-269720-o81j3d1j	76	29	after	after	IN
cord-269720-o81j3d1j	76	30	the	the	DT
cord-269720-o81j3d1j	76	31	poly(A	poly(a	JJ
cord-269720-o81j3d1j	76	32	)	)	-RRB-
cord-269720-o81j3d1j	76	33	tail	tail	NN
cord-269720-o81j3d1j	76	34	,	,	,
cord-269720-o81j3d1j	76	35	have	have	VBP
cord-269720-o81j3d1j	76	36	an	an	DT
cord-269720-o81j3d1j	76	37	overall	overall	JJ
cord-269720-o81j3d1j	76	38	homology	homology	NN
cord-269720-o81j3d1j	76	39	of	of	IN
cord-269720-o81j3d1j	76	40	82	82	CD
cord-269720-o81j3d1j	76	41	%	%	NN
cord-269720-o81j3d1j	76	42	and	and	CC
cord-269720-o81j3d1j	76	43	include	include	VBP
cord-269720-o81j3d1j	76	44	the	the	DT
cord-269720-o81j3d1j	76	45	sequenc~	sequenc~	NNP
cord-269720-o81j3d1j	76	46	CTAAAC	CTAAAC	NNP
cord-269720-o81j3d1j	76	47	,	,	,
cord-269720-o81j3d1j	76	48	which	which	WDT
cord-269720-o81j3d1j	76	49	is	be	VBZ
cord-269720-o81j3d1j	76	50	part	part	NN
cord-269720-o81j3d1j	76	51	of	of	IN
cord-269720-o81j3d1j	76	52	the	the	DT
cord-269720-o81j3d1j	76	53	postulated	postulate	VBN
cord-269720-o81j3d1j	76	54	TGEV	TGEV	NNP
cord-269720-o81j3d1j	76	55	RNA	RNA	NNP
cord-269720-o81j3d1j	76	56	polymerase	polymerase	NN
cord-269720-o81j3d1j	76	57	-	-	HYPH
cord-269720-o81j3d1j	76	58	leader	leader	NN
cord-269720-o81j3d1j	76	59	complex	complex	JJ
cord-269720-o81j3d1j	76	60	binding	binding	NN
cord-269720-o81j3d1j	76	61	site	site	NN
cord-269720-o81j3d1j	76	62	.	.	.
cord-269720-o81j3d1j	77	1	This	this	DT
cord-269720-o81j3d1j	77	2	is	be	VBZ
cord-269720-o81j3d1j	77	3	very	very	RB
cord-269720-o81j3d1j	77	4	similar	similar	JJ
cord-269720-o81j3d1j	77	5	to	to	IN
cord-269720-o81j3d1j	77	6	the	the	DT
cord-269720-o81j3d1j	77	7	observation	observation	NN
cord-269720-o81j3d1j	77	8	for	for	IN
cord-269720-o81j3d1j	77	9	IBV	IBV	NNP
cord-269720-o81j3d1j	77	10	(	(	-LRB-
cord-269720-o81j3d1j	77	11	25	25	CD
cord-269720-o81j3d1j	77	12	)	)	-RRB-
cord-269720-o81j3d1j	77	13	involving	involve	VBG
cord-269720-o81j3d1j	77	14	sequences	sequence	NNS
cord-269720-o81j3d1j	77	15	present	present	JJ
cord-269720-o81j3d1j	77	16	at	at	IN
cord-269720-o81j3d1j	77	17	the	the	DT
cord-269720-o81j3d1j	77	18	5	5	CD
cord-269720-o81j3d1j	77	19	'	'	NN
cord-269720-o81j3d1j	77	20	end	end	NN
cord-269720-o81j3d1j	77	21	of	of	IN
cord-269720-o81j3d1j	77	22	the	the	DT
cord-269720-o81j3d1j	77	23	IBV	IBV	NNP
cord-269720-o81j3d1j	77	24	genome	genome	NN
cord-269720-o81j3d1j	77	25	,	,	,
cord-269720-o81j3d1j	77	26	and	and	CC
cord-269720-o81j3d1j	77	27	on	on	IN
cord-269720-o81j3d1j	77	28	the	the	DT
cord-269720-o81j3d1j	77	29	IBV	IBV	NNP
cord-269720-o81j3d1j	77	30	leader	leader	NN
cord-269720-o81j3d1j	77	31	RNA	RNA	NNP
cord-269720-o81j3d1j	77	32	sequences	sequence	NNS
cord-269720-o81j3d1j	77	33	,	,	,
cord-269720-o81j3d1j	77	34	with	with	IN
cord-269720-o81j3d1j	77	35	the	the	DT
cord-269720-o81j3d1j	77	36	5	5	CD
cord-269720-o81j3d1j	77	37	'	'	NN
cord-269720-o81j3d1j	77	38	end	end	NN
cord-269720-o81j3d1j	77	39	of	of	IN
cord-269720-o81j3d1j	77	40	the	the	DT
cord-269720-o81j3d1j	77	41	IBV	IBV	NNP
cord-269720-o81j3d1j	77	42	negative	negative	JJ
cord-269720-o81j3d1j	77	43	strand	strand	NN
cord-269720-o81j3d1j	77	44	.	.	.
cord-269720-o81j3d1j	78	1	The	the	DT
cord-269720-o81j3d1j	78	2	homology	homology	NN
cord-269720-o81j3d1j	78	3	observed	observe	VBD
cord-269720-o81j3d1j	78	4	included	include	VBD
cord-269720-o81j3d1j	78	5	the	the	DT
cord-269720-o81j3d1j	78	6	sequence	sequence	NN
cord-269720-o81j3d1j	78	7	CTTAAC	CTTAAC	NNP
cord-269720-o81j3d1j	78	8	,	,	,
cord-269720-o81j3d1j	78	9	which	which	WDT
cord-269720-o81j3d1j	78	10	is	be	VBZ
cord-269720-o81j3d1j	78	11	part	part	NN
cord-269720-o81j3d1j	78	12	of	of	IN
cord-269720-o81j3d1j	78	13	the	the	DT
cord-269720-o81j3d1j	78	14	postulated	postulate	VBN
cord-269720-o81j3d1j	78	15	IBV	IBV	NNP
cord-269720-o81j3d1j	78	16	RNA	RNA	NNP
cord-269720-o81j3d1j	78	17	polymerase	polymerase	NN
cord-269720-o81j3d1j	78	18	-	-	HYPH
cord-269720-o81j3d1j	78	19	leader	leader	NN
cord-269720-o81j3d1j	78	20	complex	complex	JJ
cord-269720-o81j3d1j	78	21	binding	binding	NN
cord-269720-o81j3d1j	78	22	site	site	NN
cord-269720-o81j3d1j	78	23	CT(T	CT(T	NNP
cord-269720-o81j3d1j	78	24	/	/	SYM
cord-269720-o81j3d1j	78	25	G)AACAA	G)AACAA	NNP
cord-269720-o81j3d1j	78	26	.	.	.
cord-269720-o81j3d1j	79	1	An	an	DT
cord-269720-o81j3d1j	79	2	oligonucleotide	oligonucleotide	NN
cord-269720-o81j3d1j	79	3	,	,	,
cord-269720-o81j3d1j	79	4	oligo	oligo	NNP
cord-269720-o81j3d1j	79	5	58	58	CD
cord-269720-o81j3d1j	79	6	,	,	,
cord-269720-o81j3d1j	79	7	was	be	VBD
cord-269720-o81j3d1j	79	8	synthesised	synthesise	VBN
cord-269720-o81j3d1j	79	9	that	that	WDT
cord-269720-o81j3d1j	79	10	was	be	VBD
cord-269720-o81j3d1j	79	11	complementary	complementary	JJ
cord-269720-o81j3d1j	79	12	to	to	IN
cord-269720-o81j3d1j	79	13	the	the	DT
cord-269720-o81j3d1j	79	14	5	5	CD
cord-269720-o81j3d1j	79	15	'	'	NN
cord-269720-o81j3d1j	79	16	end	end	NN
cord-269720-o81j3d1j	79	17	of	of	IN
cord-269720-o81j3d1j	79	18	the	the	DT
cord-269720-o81j3d1j	79	19	TGEV	TGEV	NNP
cord-269720-o81j3d1j	79	20	and	and	CC
cord-269720-o81j3d1j	79	21	PRCV	PRCV	NNP
cord-269720-o81j3d1j	79	22	leader	leader	NN
cord-269720-o81j3d1j	79	23	RNA	RNA	NNP
cord-269720-o81j3d1j	79	24	sequences	sequence	NNS
cord-269720-o81j3d1j	79	25	(	(	-LRB-
cord-269720-o81j3d1j	79	26	Fig	Fig	NNP
cord-269720-o81j3d1j	79	27	.	.	NNP
cord-269720-o81j3d1j	79	28	1	1	CD
cord-269720-o81j3d1j	79	29	)	)	-RRB-
cord-269720-o81j3d1j	79	30	.	.	.
cord-269720-o81j3d1j	80	1	The	the	DT
cord-269720-o81j3d1j	80	2	oligonucleotide	oligonucleotide	NN
cord-269720-o81j3d1j	80	3	was	be	VBD
cord-269720-o81j3d1j	80	4	end	end	NN
cord-269720-o81j3d1j	80	5	-	-	HYPH
cord-269720-o81j3d1j	80	6	labeled	label	VBN
cord-269720-o81j3d1j	80	7	and	and	CC
cord-269720-o81j3d1j	80	8	used	use	VBN
cord-269720-o81j3d1j	80	9	to	to	TO
cord-269720-o81j3d1j	80	10	probe	probe	VB
cord-269720-o81j3d1j	80	11	TGEV	TGEV	NNP
cord-269720-o81j3d1j	80	12	and	and	CC
cord-269720-o81j3d1j	80	13	PRCV	PRCV	NNP
cord-269720-o81j3d1j	80	14	mRNA	mRNA	NNP
cord-269720-o81j3d1j	80	15	species	specie	NNS
cord-269720-o81j3d1j	80	16	that	that	WDT
cord-269720-o81j3d1j	80	17	were	be	VBD
cord-269720-o81j3d1j	80	18	Northern	Northern	NNP
cord-269720-o81j3d1j	80	19	blotted	blot	VBN
cord-269720-o81j3d1j	80	20	onto	onto	IN
cord-269720-o81j3d1j	80	21	Biodyne	Biodyne	NNP
cord-269720-o81j3d1j	80	22	membranes	membrane	NNS
cord-269720-o81j3d1j	80	23	.	.	.
cord-269720-o81j3d1j	81	1	As	as	IN
cord-269720-o81j3d1j	81	2	can	can	MD
cord-269720-o81j3d1j	81	3	be	be	VB
cord-269720-o81j3d1j	81	4	seen	see	VBN
cord-269720-o81j3d1j	81	5	from	from	IN
cord-269720-o81j3d1j	81	6	Fig	Fig	NNP
cord-269720-o81j3d1j	81	7	.	.	.
cord-269720-o81j3d1j	82	1	4	4	LS
cord-269720-o81j3d1j	82	2	,	,	,
cord-269720-o81j3d1j	82	3	the	the	DT
cord-269720-o81j3d1j	82	4	labeled	label	VBN
cord-269720-o81j3d1j	82	5	probe	probe	NN
cord-269720-o81j3d1j	82	6	hybridized	hybridize	VBN
cord-269720-o81j3d1j	82	7	to	to	IN
cord-269720-o81j3d1j	82	8	all	all	DT
cord-269720-o81j3d1j	82	9	of	of	IN
cord-269720-o81j3d1j	82	10	the	the	DT
cord-269720-o81j3d1j	82	11	TGEV	TGEV	NNP
cord-269720-o81j3d1j	82	12	and	and	CC
cord-269720-o81j3d1j	82	13	PRCV	PRCV	NNP
cord-269720-o81j3d1j	82	14	mRNA	mRNA	NNP
cord-269720-o81j3d1j	82	15	species	specie	NNS
cord-269720-o81j3d1j	82	16	.	.	.
cord-269720-o81j3d1j	83	1	The	the	DT
cord-269720-o81j3d1j	83	2	intensity	intensity	NN
cord-269720-o81j3d1j	83	3	of	of	IN
cord-269720-o81j3d1j	83	4	the	the	DT
cord-269720-o81j3d1j	83	5	bands	band	NNS
cord-269720-o81j3d1j	83	6	corresponding	correspond	VBG
cord-269720-o81j3d1j	83	7	to	to	IN
cord-269720-o81j3d1j	83	8	labeled	label	VBN
cord-269720-o81j3d1j	83	9	probe	probe	NN
cord-269720-o81j3d1j	83	10	hybridized	hybridize	VBD
cord-269720-o81j3d1j	83	11	the	the	DT
cord-269720-o81j3d1j	83	12	spike	spike	NN
cord-269720-o81j3d1j	83	13	mRNA	mrna	NN
cord-269720-o81j3d1j	83	14	species	specie	NNS
cord-269720-o81j3d1j	83	15	,	,	,
cord-269720-o81j3d1j	83	16	and	and	CC
cord-269720-o81j3d1j	83	17	genomic	genomic	JJ
cord-269720-o81j3d1j	83	18	RNA	RNA	NNP
cord-269720-o81j3d1j	83	19	was	be	VBD
cord-269720-o81j3d1j	83	20	lower	low	JJR
cord-269720-o81j3d1j	83	21	than	than	IN
cord-269720-o81j3d1j	83	22	that	that	DT
cord-269720-o81j3d1j	83	23	observed	observe	VBD
cord-269720-o81j3d1j	83	24	for	for	IN
cord-269720-o81j3d1j	83	25	the	the	DT
cord-269720-o81j3d1j	83	26	smaller	small	JJR
cord-269720-o81j3d1j	83	27	mRNA	mRNA	NNP
cord-269720-o81j3d1j	83	28	species	specie	NNS
cord-269720-o81j3d1j	83	29	due	due	JJ
cord-269720-o81j3d1j	83	30	to	to	IN
cord-269720-o81j3d1j	83	31	less	less	JJR
cord-269720-o81j3d1j	83	32	of	of	IN
cord-269720-o81j3d1j	83	33	these	these	DT
cord-269720-o81j3d1j	83	34	larger	large	JJR
cord-269720-o81j3d1j	83	35	species	specie	NNS
cord-269720-o81j3d1j	83	36	being	be	VBG
cord-269720-o81j3d1j	83	37	isolated	isolate	VBN
cord-269720-o81j3d1j	83	38	from	from	IN
cord-269720-o81j3d1j	83	39	the	the	DT
cord-269720-o81j3d1j	83	40	poly(U	poly(u	NN
cord-269720-o81j3d1j	83	41	)	)	-RRB-
cord-269720-o81j3d1j	84	1	Sepharose	Sepharose	NNP
cord-269720-o81j3d1j	84	2	column	column	NN
cord-269720-o81j3d1j	84	3	used	use	VBN
cord-269720-o81j3d1j	84	4	in	in	IN
cord-269720-o81j3d1j	84	5	the	the	DT
cord-269720-o81j3d1j	84	6	isolation	isolation	NN
cord-269720-o81j3d1j	84	7	of	of	IN
cord-269720-o81j3d1j	84	8	mRNA	mRNA	NNP
cord-269720-o81j3d1j	84	9	.	.	.
cord-269720-o81j3d1j	85	1	The	the	DT
cord-269720-o81j3d1j	85	2	fact	fact	NN
cord-269720-o81j3d1j	85	3	that	that	IN
cord-269720-o81j3d1j	85	4	the	the	DT
cord-269720-o81j3d1j	85	5	probe	probe	NN
cord-269720-o81j3d1j	85	6	hybridized	hybridize	VBD
cord-269720-o81j3d1j	85	7	to	to	IN
cord-269720-o81j3d1j	85	8	all	all	DT
cord-269720-o81j3d1j	85	9	of	of	IN
cord-269720-o81j3d1j	85	10	the	the	DT
cord-269720-o81j3d1j	85	11	mRNA	mRNA	NNP
cord-269720-o81j3d1j	85	12	species	specie	NNS
cord-269720-o81j3d1j	85	13	showed	show	VBD
cord-269720-o81j3d1j	85	14	that	that	IN
cord-269720-o81j3d1j	85	15	the	the	DT
cord-269720-o81j3d1j	85	16	leader	leader	NN
cord-269720-o81j3d1j	85	17	RNA	RNA	NNP
cord-269720-o81j3d1j	85	18	sequence	sequence	NN
cord-269720-o81j3d1j	85	19	was	be	VBD
cord-269720-o81j3d1j	85	20	present	present	JJ
cord-269720-o81j3d1j	85	21	on	on	IN
cord-269720-o81j3d1j	85	22	the	the	DT
cord-269720-o81j3d1j	85	23	other	other	JJ
cord-269720-o81j3d1j	85	24	RNA	RNA	NNP
cord-269720-o81j3d1j	85	25	molecules	molecule	NNS
cord-269720-o81j3d1j	85	26	of	of	IN
cord-269720-o81j3d1j	85	27	TGEV	TGEV	NNS
cord-269720-o81j3d1j	85	28	and	and	CC
cord-269720-o81j3d1j	85	29	both	both	DT
cord-269720-o81j3d1j	85	30	strains	strain	NNS
cord-269720-o81j3d1j	85	31	of	of	IN
cord-269720-o81j3d1j	85	32	PRCV	PRCV	NNP
cord-269720-o81j3d1j	85	33	was	be	VBD
cord-269720-o81j3d1j	85	34	not	not	RB
cord-269720-o81j3d1j	85	35	unique	unique	JJ
cord-269720-o81j3d1j	85	36	to	to	IN
cord-269720-o81j3d1j	85	37	the	the	DT
cord-269720-o81j3d1j	85	38	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	85	39	mRNA	mRNA	NNP
cord-269720-o81j3d1j	85	40	species	species	NNP
cord-269720-o81j3d1j	85	41	.	.	.
cord-269720-o81j3d1j	86	1	The	the	DT
cord-269720-o81j3d1j	86	2	two	two	CD
cord-269720-o81j3d1j	86	3	porcine	porcine	JJ
cord-269720-o81j3d1j	86	4	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	86	5	leader	leader	NN
cord-269720-o81j3d1j	86	6	sequences	sequence	NNS
cord-269720-o81j3d1j	86	7	were	be	VBD
cord-269720-o81j3d1j	86	8	identical	identical	JJ
cord-269720-o81j3d1j	86	9	,	,	,
cord-269720-o81j3d1j	86	10	indicating	indicate	VBG
cord-269720-o81j3d1j	86	11	that	that	IN
cord-269720-o81j3d1j	86	12	the	the	DT
cord-269720-o81j3d1j	86	13	two	two	CD
cord-269720-o81j3d1j	86	14	viruses	virus	NNS
cord-269720-o81j3d1j	86	15	probably	probably	RB
cord-269720-o81j3d1j	86	16	use	use	VBP
cord-269720-o81j3d1j	86	17	the	the	DT
cord-269720-o81j3d1j	86	18	same	same	JJ
cord-269720-o81j3d1j	86	19	RNA	RNA	NNP
cord-269720-o81j3d1j	86	20	polymerase	polymerase	NN
cord-269720-o81j3d1j	86	21	-	-	HYPH
cord-269720-o81j3d1j	86	22	leader	leader	NN
cord-269720-o81j3d1j	86	23	complex	complex	JJ
cord-269720-o81j3d1j	86	24	binding	binding	NN
cord-269720-o81j3d1j	86	25	site	site	NN
cord-269720-o81j3d1j	86	26	,	,	,
cord-269720-o81j3d1j	86	27	ACTAAAC	ACTAAAC	NNP
cord-269720-o81j3d1j	86	28	,	,	,
cord-269720-o81j3d1j	86	29	for	for	IN
cord-269720-o81j3d1j	86	30	the	the	DT
cord-269720-o81j3d1j	86	31	synthesis	synthesis	NN
cord-269720-o81j3d1j	86	32	of	of	IN
cord-269720-o81j3d1j	86	33	subgenomic	subgenomic	NNP
cord-269720-o81j3d1j	86	34	mRNA	mRNA	NNP
cord-269720-o81j3d1j	86	35	species	species	NNP
cord-269720-o81j3d1j	86	36	.	.	.
cord-269720-o81j3d1j	87	1	The	the	DT
cord-269720-o81j3d1j	87	2	SEQHP	SEQHP	NNP
cord-269720-o81j3d1j	87	3	comparison	comparison	NN
cord-269720-o81j3d1j	87	4	program	program	NN
cord-269720-o81j3d1j	87	5	of	of	IN
cord-269720-o81j3d1j	87	6	the	the	DT
cord-269720-o81j3d1j	87	7	Los	Los	NNP
cord-269720-o81j3d1j	87	8	Alamos	Alamos	NNP
cord-269720-o81j3d1j	87	9	(	(	-LRB-
cord-269720-o81j3d1j	87	10	26	26	CD
cord-269720-o81j3d1j	87	11	)	)	-RRB-
cord-269720-o81j3d1j	87	12	package	package	NN
cord-269720-o81j3d1j	87	13	was	be	VBD
cord-269720-o81j3d1j	87	14	used	use	VBN
cord-269720-o81j3d1j	87	15	to	to	TO
cord-269720-o81j3d1j	87	16	compare	compare	VB
cord-269720-o81j3d1j	87	17	the	the	DT
cord-269720-o81j3d1j	87	18	leader	leader	NN
cord-269720-o81j3d1j	87	19	RNA	RNA	NNP
cord-269720-o81j3d1j	87	20	sequences	sequence	NNS
cord-269720-o81j3d1j	87	21	determined	determine	VBN
cord-269720-o81j3d1j	87	22	in	in	IN
cord-269720-o81j3d1j	87	23	this	this	DT
cord-269720-o81j3d1j	87	24	paper	paper	NN
cord-269720-o81j3d1j	87	25	and	and	CC
cord-269720-o81j3d1j	87	26	those	those	DT
cord-269720-o81j3d1j	87	27	published	publish	VBN
cord-269720-o81j3d1j	87	28	for	for	IN
cord-269720-o81j3d1j	87	29	five	five	CD
cord-269720-o81j3d1j	87	30	other	other	JJ
cord-269720-o81j3d1j	87	31	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	87	32	belonging	belong	VBG
cord-269720-o81j3d1j	87	33	to	to	IN
cord-269720-o81j3d1j	87	34	two	two	CD
cord-269720-o81j3d1j	87	35	different	different	JJ
cord-269720-o81j3d1j	87	36	serogroups	serogroup	NNS
cord-269720-o81j3d1j	87	37	.	.	.
cord-269720-o81j3d1j	88	1	The	the	DT
cord-269720-o81j3d1j	88	2	sequences	sequence	NNS
cord-269720-o81j3d1j	88	3	were	be	VBD
cord-269720-o81j3d1j	88	4	compared	compare	VBN
cord-269720-o81j3d1j	88	5	from	from	IN
cord-269720-o81j3d1j	88	6	the	the	DT
cord-269720-o81j3d1j	88	7	5	5	CD
cord-269720-o81j3d1j	88	8	'	'	''
cord-269720-o81j3d1j	88	9	ends	end	NNS
cord-269720-o81j3d1j	88	10	to	to	IN
cord-269720-o81j3d1j	88	11	the	the	DT
cord-269720-o81j3d1j	88	12	point	point	NN
cord-269720-o81j3d1j	88	13	of	of	IN
cord-269720-o81j3d1j	88	14	divergence	divergence	NN
cord-269720-o81j3d1j	88	15	from	from	IN
cord-269720-o81j3d1j	88	16	the	the	DT
cord-269720-o81j3d1j	88	17	genomic	genomic	JJ
cord-269720-o81j3d1j	88	18	sequences	sequence	NNS
cord-269720-o81j3d1j	88	19	.	.	.
cord-269720-o81j3d1j	89	1	The	the	DT
cord-269720-o81j3d1j	89	2	percentage	percentage	NN
cord-269720-o81j3d1j	89	3	homologies	homology	NNS
cord-269720-o81j3d1j	89	4	,	,	,
cord-269720-o81j3d1j	89	5	Table	table	NN
cord-269720-o81j3d1j	89	6	1	1	CD
cord-269720-o81j3d1j	89	7	,	,	,
cord-269720-o81j3d1j	89	8	were	be	VBD
cord-269720-o81j3d1j	89	9	expressed	express	VBN
cord-269720-o81j3d1j	89	10	as	as	IN
cord-269720-o81j3d1j	89	11	the	the	DT
cord-269720-o81j3d1j	89	12	number	number	NN
cord-269720-o81j3d1j	89	13	of	of	IN
cord-269720-o81j3d1j	89	14	bases	basis	NNS
cord-269720-o81j3d1j	89	15	matched	match	VBN
cord-269720-o81j3d1j	89	16	to	to	IN
cord-269720-o81j3d1j	89	17	the	the	DT
cord-269720-o81j3d1j	89	18	longer	long	JJR
cord-269720-o81j3d1j	89	19	of	of	IN
cord-269720-o81j3d1j	89	20	the	the	DT
cord-269720-o81j3d1j	89	21	two	two	CD
cord-269720-o81j3d1j	89	22	sequences	sequence	NNS
cord-269720-o81j3d1j	89	23	being	be	VBG
cord-269720-o81j3d1j	89	24	compared	compare	VBN
cord-269720-o81j3d1j	89	25	.	.	.
cord-269720-o81j3d1j	90	1	The	the	DT
cord-269720-o81j3d1j	90	2	homology	homology	NN
cord-269720-o81j3d1j	90	3	of	of	IN
cord-269720-o81j3d1j	90	4	the	the	DT
cord-269720-o81j3d1j	90	5	leader	leader	NN
cord-269720-o81j3d1j	90	6	sequences	sequence	NNS
cord-269720-o81j3d1j	90	7	fell	fall	VBD
cord-269720-o81j3d1j	90	8	into	into	IN
cord-269720-o81j3d1j	90	9	three	three	CD
cord-269720-o81j3d1j	90	10	groups	group	NNS
cord-269720-o81j3d1j	90	11	.	.	.
cord-269720-o81j3d1j	91	1	Leader	leader	NN
cord-269720-o81j3d1j	91	2	RNAs	rna	NNS
cord-269720-o81j3d1j	91	3	from	from	IN
cord-269720-o81j3d1j	91	4	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	91	5	belonging	belong	VBG
cord-269720-o81j3d1j	91	6	to	to	IN
cord-269720-o81j3d1j	91	7	different	different	JJ
cord-269720-o81j3d1j	91	8	serological	serological	JJ
cord-269720-o81j3d1j	91	9	groups	group	NNS
cord-269720-o81j3d1j	91	10	had	have	VBD
cord-269720-o81j3d1j	91	11	homologies	homology	NNS
cord-269720-o81j3d1j	91	12	in	in	IN
cord-269720-o81j3d1j	91	13	the	the	DT
cord-269720-o81j3d1j	91	14	region	region	NN
cord-269720-o81j3d1j	91	15	of	of	IN
cord-269720-o81j3d1j	91	16	35	35	CD
cord-269720-o81j3d1j	91	17	-	-	SYM
cord-269720-o81j3d1j	91	18	40	40	CD
cord-269720-o81j3d1j	91	19	%	%	NN
cord-269720-o81j3d1j	91	20	.	.	.
cord-269720-o81j3d1j	92	1	Serologically	serologically	RB
cord-269720-o81j3d1j	92	2	related	related	JJ
cord-269720-o81j3d1j	92	3	viruses	virus	NNS
cord-269720-o81j3d1j	92	4	like	like	IN
cord-269720-o81j3d1j	92	5	human	human	JJ
cord-269720-o81j3d1j	92	6	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	92	7	(	(	-LRB-
cord-269720-o81j3d1j	92	8	HCV	HCV	NNP
cord-269720-o81j3d1j	92	9	)	)	-RRB-
cord-269720-o81j3d1j	92	10	(	(	-LRB-
cord-269720-o81j3d1j	92	11	strain	strain	VBP
cord-269720-o81j3d1j	92	12	OC43	OC43	NNP
cord-269720-o81j3d1j	92	13	)	)	-RRB-
cord-269720-o81j3d1j	92	14	and	and	CC
cord-269720-o81j3d1j	92	15	MHV	MHV	NNP
cord-269720-o81j3d1j	92	16	(	(	-LRB-
cord-269720-o81j3d1j	92	17	strains	strain	NNS
cord-269720-o81j3d1j	92	18	A59	A59	NNP
cord-269720-o81j3d1j	92	19	and	and	CC
cord-269720-o81j3d1j	92	20	JHM	JHM	NNP
cord-269720-o81j3d1j	92	21	)	)	-RRB-
cord-269720-o81j3d1j	92	22	have	have	VBP
cord-269720-o81j3d1j	92	23	about	about	RB
cord-269720-o81j3d1j	92	24	60	60	CD
cord-269720-o81j3d1j	92	25	%	%	NN
cord-269720-o81j3d1j	92	26	homology	homology	NN
cord-269720-o81j3d1j	92	27	.	.	.
cord-269720-o81j3d1j	93	1	The	the	DT
cord-269720-o81j3d1j	93	2	third	third	JJ
cord-269720-o81j3d1j	93	3	group	group	NN
cord-269720-o81j3d1j	93	4	involved	involve	VBD
cord-269720-o81j3d1j	93	5	different	different	JJ
cord-269720-o81j3d1j	93	6	strains	strain	NNS
cord-269720-o81j3d1j	93	7	of	of	IN
cord-269720-o81j3d1j	93	8	MHV	MHV	NNP
cord-269720-o81j3d1j	93	9	,	,	,
cord-269720-o81j3d1j	93	10	A59	A59	NNP
cord-269720-o81j3d1j	93	11	,	,	,
cord-269720-o81j3d1j	93	12	and	and	CC
cord-269720-o81j3d1j	93	13	JHM	JHM	NNP
cord-269720-o81j3d1j	93	14	,	,	,
cord-269720-o81j3d1j	93	15	which	which	WDT
cord-269720-o81j3d1j	93	16	showed	show	VBD
cord-269720-o81j3d1j	93	17	a	a	DT
cord-269720-o81j3d1j	93	18	homology	homology	NN
cord-269720-o81j3d1j	93	19	of	of	IN
cord-269720-o81j3d1j	93	20	91	91	CD
cord-269720-o81j3d1j	93	21	%	%	NN
cord-269720-o81j3d1j	93	22	.	.	.
cord-269720-o81j3d1j	94	1	This	this	DT
cord-269720-o81j3d1j	94	2	observation	observation	NN
cord-269720-o81j3d1j	94	3	indicates	indicate	VBZ
cord-269720-o81j3d1j	94	4	that	that	IN
cord-269720-o81j3d1j	94	5	TGEV	TGEV	NNP
cord-269720-o81j3d1j	94	6	and	and	CC
cord-269720-o81j3d1j	94	7	PRCV	PRCV	NNP
cord-269720-o81j3d1j	94	8	,	,	,
cord-269720-o81j3d1j	94	9	which	which	WDT
cord-269720-o81j3d1j	94	10	have	have	VBP
cord-269720-o81j3d1j	94	11	a	a	DT
cord-269720-o81j3d1j	94	12	homology	homology	NN
cord-269720-o81j3d1j	94	13	of	of	IN
cord-269720-o81j3d1j	94	14	100	100	CD
cord-269720-o81j3d1j	94	15	%	%	NN
cord-269720-o81j3d1j	94	16	,	,	,
cord-269720-o81j3d1j	94	17	are	be	VBP
cord-269720-o81j3d1j	94	18	probably	probably	RB
cord-269720-o81j3d1j	94	19	different	different	JJ
cord-269720-o81j3d1j	94	20	strains	strain	NNS
cord-269720-o81j3d1j	94	21	of	of	IN
cord-269720-o81j3d1j	94	22	the	the	DT
cord-269720-o81j3d1j	94	23	same	same	JJ
cord-269720-o81j3d1j	94	24	virus	virus	NN
cord-269720-o81j3d1j	94	25	or	or	CC
cord-269720-o81j3d1j	94	26	that	that	IN
cord-269720-o81j3d1j	94	27	PRCV	PRCV	NNP
cord-269720-o81j3d1j	94	28	has	have	VBZ
cord-269720-o81j3d1j	94	29	very	very	RB
cord-269720-o81j3d1j	94	30	recently	recently	RB
cord-269720-o81j3d1j	94	31	diverged	diverge	VBN
cord-269720-o81j3d1j	94	32	from	from	IN
cord-269720-o81j3d1j	94	33	TGEV	TGEV	NNP
cord-269720-o81j3d1j	94	34	.	.	.
cord-269720-o81j3d1j	95	1	In	in	IN
cord-269720-o81j3d1j	95	2	order	order	NN
cord-269720-o81j3d1j	95	3	to	to	TO
cord-269720-o81j3d1j	95	4	identify	identify	VB
cord-269720-o81j3d1j	95	5	common	common	JJ
cord-269720-o81j3d1j	95	6	areas	area	NNS
cord-269720-o81j3d1j	95	7	of	of	IN
cord-269720-o81j3d1j	95	8	homology	homology	NN
cord-269720-o81j3d1j	95	9	,	,	,
cord-269720-o81j3d1j	95	10	the	the	DT
cord-269720-o81j3d1j	95	11	leader	leader	NN
cord-269720-o81j3d1j	95	12	RNA	RNA	NNP
cord-269720-o81j3d1j	95	13	sequences	sequence	NNS
cord-269720-o81j3d1j	95	14	from	from	IN
cord-269720-o81j3d1j	95	15	seven	seven	CD
cord-269720-o81j3d1j	95	16	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	95	17	were	be	VBD
cord-269720-o81j3d1j	95	18	aligned	align	VBN
cord-269720-o81j3d1j	95	19	.	.	.
cord-269720-o81j3d1j	96	1	As	as	IN
cord-269720-o81j3d1j	96	2	can	can	MD
cord-269720-o81j3d1j	96	3	be	be	VB
cord-269720-o81j3d1j	96	4	seen	see	VBN
cord-269720-o81j3d1j	96	5	from	from	IN
cord-269720-o81j3d1j	96	6	Fig	Fig	NNP
cord-269720-o81j3d1j	96	7	.	.	.
cord-269720-o81j3d1j	97	1	5	5	LS
cord-269720-o81j3d1j	97	2	,	,	,
cord-269720-o81j3d1j	97	3	these	these	DT
cord-269720-o81j3d1j	97	4	fell	fall	VBD
cord-269720-o81j3d1j	97	5	into	into	IN
cord-269720-o81j3d1j	97	6	two	two	CD
cord-269720-o81j3d1j	97	7	groups	group	NNS
cord-269720-o81j3d1j	97	8	.	.	.
cord-269720-o81j3d1j	98	1	One	one	CD
cord-269720-o81j3d1j	98	2	group	group	NN
cord-269720-o81j3d1j	98	3	consists	consist	VBZ
cord-269720-o81j3d1j	98	4	of	of	IN
cord-269720-o81j3d1j	98	5	MHV	MHV	NNP
cord-269720-o81j3d1j	98	6	(	(	-LRB-
cord-269720-o81j3d1j	98	7	strains	strain	NNS
cord-269720-o81j3d1j	98	8	A59	A59	NNP
cord-269720-o81j3d1j	98	9	and	and	CC
cord-269720-o81j3d1j	98	10	JHM	JHM	NNP
cord-269720-o81j3d1j	98	11	)	)	-RRB-
cord-269720-o81j3d1j	98	12	with	with	IN
cord-269720-o81j3d1j	98	13	HCV	HCV	NNP
cord-269720-o81j3d1j	98	14	(	(	-LRB-
cord-269720-o81j3d1j	98	15	OC43	OC43	NNP
cord-269720-o81j3d1j	98	16	)	)	-RRB-
cord-269720-o81j3d1j	98	17	,	,	,
cord-269720-o81j3d1j	98	18	which	which	WDT
cord-269720-o81j3d1j	98	19	have	have	VBP
cord-269720-o81j3d1j	98	20	a	a	DT
cord-269720-o81j3d1j	98	21	fairly	fairly	RB
cord-269720-o81j3d1j	98	22	high	high	JJ
cord-269720-o81j3d1j	98	23	degree	degree	NN
cord-269720-o81j3d1j	98	24	of	of	IN
cord-269720-o81j3d1j	98	25	homology	homology	NN
cord-269720-o81j3d1j	98	26	along	along	IN
cord-269720-o81j3d1j	98	27	their	-PRON-	PRP$
cord-269720-o81j3d1j	98	28	lengths	length	NNS
cord-269720-o81j3d1j	98	29	.	.	.
cord-269720-o81j3d1j	99	1	The	the	DT
cord-269720-o81j3d1j	99	2	other	other	JJ
cord-269720-o81j3d1j	99	3	group	group	NN
cord-269720-o81j3d1j	99	4	consists	consist	VBZ
cord-269720-o81j3d1j	99	5	of	of	IN
cord-269720-o81j3d1j	99	6	TGEV	TGEV	NNP
cord-269720-o81j3d1j	99	7	and	and	CC
cord-269720-o81j3d1j	99	8	PRCV	PRCV	NNP
cord-269720-o81j3d1j	99	9	(	(	-LRB-
cord-269720-o81j3d1j	99	10	not	not	RB
cord-269720-o81j3d1j	99	11	shown	show	VBN
cord-269720-o81j3d1j	99	12	on	on	IN
cord-269720-o81j3d1j	99	13	the	the	DT
cord-269720-o81j3d1j	99	14	diagram	diagram	NN
cord-269720-o81j3d1j	99	15	)	)	-RRB-
cord-269720-o81j3d1j	99	16	with	with	IN
cord-269720-o81j3d1j	99	17	HCV	HCV	NNP
cord-269720-o81j3d1j	99	18	(	(	-LRB-
cord-269720-o81j3d1j	99	19	229E	229e	CD
cord-269720-o81j3d1j	99	20	)	)	-RRB-
cord-269720-o81j3d1j	99	21	and	and	CC
cord-269720-o81j3d1j	99	22	IBV	IBV	NNP
cord-269720-o81j3d1j	99	23	,	,	,
cord-269720-o81j3d1j	99	24	which	which	WDT
cord-269720-o81j3d1j	99	25	have	have	VBP
cord-269720-o81j3d1j	99	26	high	high	JJ
cord-269720-o81j3d1j	99	27	homologies	homology	NNS
cord-269720-o81j3d1j	99	28	at	at	IN
cord-269720-o81j3d1j	99	29	their	-PRON-	PRP$
cord-269720-o81j3d1j	99	30	3	3	CD
cord-269720-o81j3d1j	99	31	'	'	''
cord-269720-o81j3d1j	99	32	ends	end	NNS
cord-269720-o81j3d1j	99	33	and	and	CC
cord-269720-o81j3d1j	99	34	areas	area	NNS
cord-269720-o81j3d1j	99	35	of	of	IN
cord-269720-o81j3d1j	99	36	homology	homology	NN
cord-269720-o81j3d1j	99	37	at	at	IN
cord-269720-o81j3d1j	99	38	their	-PRON-	PRP$
cord-269720-o81j3d1j	99	39	5	5	CD
cord-269720-o81j3d1j	99	40	'	'	''
cord-269720-o81j3d1j	99	41	ends	end	NNS
cord-269720-o81j3d1j	99	42	.	.	.
cord-269720-o81j3d1j	100	1	There	there	EX
cord-269720-o81j3d1j	100	2	are	be	VBP
cord-269720-o81j3d1j	100	3	good	good	JJ
cord-269720-o81j3d1j	100	4	homologies	homology	NNS
cord-269720-o81j3d1j	100	5	towards	towards	IN
cord-269720-o81j3d1j	100	6	the	the	DT
cord-269720-o81j3d1j	100	7	3	3	CD
cord-269720-o81j3d1j	100	8	'	'	''
cord-269720-o81j3d1j	100	9	ends	end	NNS
cord-269720-o81j3d1j	100	10	,	,	,
cord-269720-o81j3d1j	100	11	involving	involve	VBG
cord-269720-o81j3d1j	100	12	the	the	DT
cord-269720-o81j3d1j	100	13	postulated	postulate	VBN
cord-269720-o81j3d1j	100	14	RNA	RNA	NNP
cord-269720-o81j3d1j	100	15	polymerase	polymerase	NN
cord-269720-o81j3d1j	100	16	-	-	HYPH
cord-269720-o81j3d1j	100	17	leader	leader	NN
cord-269720-o81j3d1j	100	18	complex	complex	JJ
cord-269720-o81j3d1j	100	19	binding	binding	NN
cord-269720-o81j3d1j	100	20	sites	site	NNS
cord-269720-o81j3d1j	100	21	and	and	CC
cord-269720-o81j3d1j	100	22	sequences	sequence	NNS
cord-269720-o81j3d1j	100	23	upstream	upstream	RB
cord-269720-o81j3d1j	100	24	of	of	IN
cord-269720-o81j3d1j	100	25	these	these	DT
cord-269720-o81j3d1j	100	26	sites	site	NNS
cord-269720-o81j3d1j	100	27	,	,	,
cord-269720-o81j3d1j	100	28	between	between	IN
cord-269720-o81j3d1j	100	29	the	the	DT
cord-269720-o81j3d1j	100	30	groups	group	NNS
cord-269720-o81j3d1j	100	31	,	,	,
cord-269720-o81j3d1j	100	32	but	but	CC
cord-269720-o81j3d1j	100	33	very	very	RB
cord-269720-o81j3d1j	100	34	little	little	JJ
cord-269720-o81j3d1j	100	35	if	if	IN
cord-269720-o81j3d1j	100	36	any	any	DT
cord-269720-o81j3d1j	100	37	homology	homology	NN
cord-269720-o81j3d1j	100	38	between	between	IN
cord-269720-o81j3d1j	100	39	the	the	DT
cord-269720-o81j3d1j	100	40	5	5	CD
cord-269720-o81j3d1j	100	41	'	'	''
cord-269720-o81j3d1j	100	42	ends	end	NNS
cord-269720-o81j3d1j	100	43	.	.	.
cord-269720-o81j3d1j	101	1	(	(	-LRB-
cord-269720-o81j3d1j	101	2	7	7	CD
cord-269720-o81j3d1j	101	3	)	)	-RRB-
cord-269720-o81j3d1j	101	4	and	and	CC
cord-269720-o81j3d1j	101	5	strain	strain	VB
cord-269720-o81j3d1j	101	6	JHM	JHM	NNP
cord-269720-o81j3d1j	101	7	(	(	-LRB-
cord-269720-o81j3d1j	101	8	13	13	CD
cord-269720-o81j3d1j	101	9	)	)	-RRB-
cord-269720-o81j3d1j	102	1	;	;	:
cord-269720-o81j3d1j	102	2	avian	avian	JJ
cord-269720-o81j3d1j	102	3	,	,	,
cord-269720-o81j3d1j	102	4	IBV	IBV	NNP
cord-269720-o81j3d1j	102	5	strain	strain	VBP
cord-269720-o81j3d1j	102	6	Beaudette	Beaudette	NNP
cord-269720-o81j3d1j	102	7	(	(	-LRB-
cord-269720-o81j3d1j	102	8	9,25	9,25	CD
cord-269720-o81j3d1j	102	9	)	)	-RRB-
cord-269720-o81j3d1j	102	10	.	.	.
cord-269720-o81j3d1j	103	1	As	as	IN
cord-269720-o81j3d1j	103	2	seen	see	VBN
cord-269720-o81j3d1j	103	3	from	from	IN
cord-269720-o81j3d1j	103	4	Fig	Fig	NNP
cord-269720-o81j3d1j	103	5	.	.	.
cord-269720-o81j3d1j	104	1	5	5	LS
cord-269720-o81j3d1j	105	1	simple	simple	JJ
cord-269720-o81j3d1j	105	2	alignment	alignment	NN
cord-269720-o81j3d1j	105	3	did	do	VBD
cord-269720-o81j3d1j	105	4	not	not	RB
cord-269720-o81j3d1j	105	5	reveal	reveal	VB
cord-269720-o81j3d1j	105	6	very	very	RB
cord-269720-o81j3d1j	105	7	much	much	JJ
cord-269720-o81j3d1j	105	8	information	information	NN
cord-269720-o81j3d1j	105	9	about	about	IN
cord-269720-o81j3d1j	105	10	the	the	DT
cord-269720-o81j3d1j	105	11	homologies	homology	NNS
cord-269720-o81j3d1j	105	12	of	of	IN
cord-269720-o81j3d1j	105	13	the	the	DT
cord-269720-o81j3d1j	105	14	leader	leader	NN
cord-269720-o81j3d1j	105	15	RNA	RNA	NNP
cord-269720-o81j3d1j	105	16	sequences	sequence	NNS
cord-269720-o81j3d1j	105	17	from	from	IN
cord-269720-o81j3d1j	105	18	the	the	DT
cord-269720-o81j3d1j	105	19	different	different	JJ
cord-269720-o81j3d1j	105	20	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	105	21	,	,	,
cord-269720-o81j3d1j	105	22	except	except	IN
cord-269720-o81j3d1j	105	23	at	at	IN
cord-269720-o81j3d1j	105	24	the	the	DT
cord-269720-o81j3d1j	105	25	3	3	CD
cord-269720-o81j3d1j	105	26	'	'	''
cord-269720-o81j3d1j	105	27	ends	end	NNS
cord-269720-o81j3d1j	105	28	involving	involve	VBG
cord-269720-o81j3d1j	105	29	the	the	DT
cord-269720-o81j3d1j	105	30	consensus	consensus	NN
cord-269720-o81j3d1j	105	31	sequences	sequence	NNS
cord-269720-o81j3d1j	105	32	.	.	.
cord-269720-o81j3d1j	106	1	In	in	IN
cord-269720-o81j3d1j	106	2	order	order	NN
cord-269720-o81j3d1j	106	3	to	to	TO
cord-269720-o81j3d1j	106	4	identify	identify	VB
cord-269720-o81j3d1j	106	5	any	any	DT
cord-269720-o81j3d1j	106	6	potential	potential	JJ
cord-269720-o81j3d1j	106	7	similarities	similarity	NNS
cord-269720-o81j3d1j	106	8	in	in	IN
cord-269720-o81j3d1j	106	9	these	these	DT
cord-269720-o81j3d1j	106	10	sequences	sequence	NNS
cord-269720-o81j3d1j	106	11	,	,	,
cord-269720-o81j3d1j	106	12	the	the	DT
cord-269720-o81j3d1j	106	13	secondary	secondary	JJ
cord-269720-o81j3d1j	106	14	structure	structure	NN
cord-269720-o81j3d1j	106	15	of	of	IN
cord-269720-o81j3d1j	106	16	the	the	DT
cord-269720-o81j3d1j	106	17	RNA	RNA	NNP
cord-269720-o81j3d1j	106	18	sequences	sequence	NNS
cord-269720-o81j3d1j	106	19	in	in	IN
cord-269720-o81j3d1j	106	20	Fig	Fig	NNP
cord-269720-o81j3d1j	106	21	.	.	.
cord-269720-o81j3d1j	107	1	5	5	CD
cord-269720-o81j3d1j	107	2	were	be	VBD
cord-269720-o81j3d1j	107	3	analyzed	analyze	VBN
cord-269720-o81j3d1j	107	4	.	.	.
cord-269720-o81j3d1j	108	1	Potential	potential	JJ
cord-269720-o81j3d1j	108	2	secondary	secondary	JJ
cord-269720-o81j3d1j	108	3	structures	structure	NNS
cord-269720-o81j3d1j	108	4	of	of	IN
cord-269720-o81j3d1j	108	5	the	the	DT
cord-269720-o81j3d1j	108	6	leader	leader	NN
cord-269720-o81j3d1j	108	7	RNA	RNA	NNP
cord-269720-o81j3d1j	108	8	sequences	sequence	NNS
cord-269720-o81j3d1j	108	9	were	be	VBD
cord-269720-o81j3d1j	108	10	determined	determine	VBN
cord-269720-o81j3d1j	108	11	using	use	VBG
cord-269720-o81j3d1j	108	12	the	the	DT
cord-269720-o81j3d1j	108	13	computer	computer	NN
cord-269720-o81j3d1j	108	14	program	program	NN
cord-269720-o81j3d1j	108	15	FOLD	fold	VB
cord-269720-o81j3d1j	108	16	(	(	-LRB-
cord-269720-o81j3d1j	108	17	27	27	CD
cord-269720-o81j3d1j	108	18	)	)	-RRB-
cord-269720-o81j3d1j	108	19	from	from	IN
cord-269720-o81j3d1j	108	20	the	the	DT
cord-269720-o81j3d1j	108	21	UWGCG	UWGCG	NNP
cord-269720-o81j3d1j	108	22	DNA	dna	NN
cord-269720-o81j3d1j	108	23	analysis	analysis	NN
cord-269720-o81j3d1j	108	24	programs	program	NNS
cord-269720-o81j3d1j	108	25	(	(	-LRB-
cord-269720-o81j3d1j	108	26	28	28	CD
cord-269720-o81j3d1j	108	27	)	)	-RRB-
cord-269720-o81j3d1j	108	28	.	.	.
cord-269720-o81j3d1j	109	1	The	the	DT
cord-269720-o81j3d1j	109	2	coordinates	coordinate	NNS
cord-269720-o81j3d1j	109	3	determined	determine	VBN
cord-269720-o81j3d1j	109	4	by	by	IN
cord-269720-o81j3d1j	109	5	the	the	DT
cord-269720-o81j3d1j	109	6	FOLD	FOLD	NNP
cord-269720-o81j3d1j	109	7	program	program	NN
cord-269720-o81j3d1j	109	8	were	be	VBD
cord-269720-o81j3d1j	109	9	displayed	display	VBN
cord-269720-o81j3d1j	109	10	graphically	graphically	RB
cord-269720-o81j3d1j	109	11	using	use	VBG
cord-269720-o81j3d1j	109	12	the	the	DT
cord-269720-o81j3d1j	109	13	UWGCG	UWGCG	NNP
cord-269720-o81j3d1j	109	14	program	program	NN
cord-269720-o81j3d1j	109	15	SQUIG	SQUIG	NNP
cord-269720-o81j3d1j	109	16	-	-	HYPH
cord-269720-o81j3d1j	109	17	GLES	GLES	NNP
cord-269720-o81j3d1j	109	18	.	.	.
cord-269720-o81j3d1j	110	1	The	the	DT
cord-269720-o81j3d1j	110	2	potential	potential	JJ
cord-269720-o81j3d1j	110	3	secondary	secondary	JJ
cord-269720-o81j3d1j	110	4	structures	structure	NNS
cord-269720-o81j3d1j	110	5	obtained	obtain	VBN
cord-269720-o81j3d1j	110	6	were	be	VBD
cord-269720-o81j3d1j	110	7	compared	compare	VBN
cord-269720-o81j3d1j	110	8	and	and	CC
cord-269720-o81j3d1j	110	9	,	,	,
cord-269720-o81j3d1j	110	10	as	as	IN
cord-269720-o81j3d1j	110	11	can	can	MD
cord-269720-o81j3d1j	110	12	be	be	VB
cord-269720-o81j3d1j	110	13	seen	see	VBN
cord-269720-o81j3d1j	110	14	from	from	IN
cord-269720-o81j3d1j	110	15	Fig	Fig	NNP
cord-269720-o81j3d1j	110	16	.	.	.
cord-269720-o81j3d1j	111	1	6	6	CD
cord-269720-o81j3d1j	111	2	,	,	,
cord-269720-o81j3d1j	111	3	the	the	DT
cord-269720-o81j3d1j	111	4	overall	overall	JJ
cord-269720-o81j3d1j	111	5	shape	shape	NN
cord-269720-o81j3d1j	111	6	of	of	IN
cord-269720-o81j3d1j	111	7	these	these	DT
cord-269720-o81j3d1j	111	8	sequences	sequence	NNS
cord-269720-o81j3d1j	111	9	are	be	VBP
cord-269720-o81j3d1j	111	10	very	very	RB
cord-269720-o81j3d1j	111	11	similar	similar	JJ
cord-269720-o81j3d1j	111	12	,	,	,
cord-269720-o81j3d1j	111	13	except	except	IN
cord-269720-o81j3d1j	111	14	for	for	IN
cord-269720-o81j3d1j	111	15	the	the	DT
cord-269720-o81j3d1j	111	16	avian	avian	JJ
cord-269720-o81j3d1j	111	17	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	111	18	IBV	IBV	NNP
cord-269720-o81j3d1j	111	19	.	.	.
cord-269720-o81j3d1j	112	1	All	all	PDT
cord-269720-o81j3d1j	112	2	the	the	DT
cord-269720-o81j3d1j	112	3	molecules	molecule	NNS
cord-269720-o81j3d1j	112	4	appear	appear	VBP
cord-269720-o81j3d1j	112	5	to	to	TO
cord-269720-o81j3d1j	112	6	be	be	VB
cord-269720-o81j3d1j	112	7	composed	compose	VBN
cord-269720-o81j3d1j	112	8	of	of	IN
cord-269720-o81j3d1j	112	9	two	two	CD
cord-269720-o81j3d1j	112	10	stem	stem	NN
cord-269720-o81j3d1j	112	11	-	-	HYPH
cord-269720-o81j3d1j	112	12	loop	loop	NN
cord-269720-o81j3d1j	112	13	structures	structure	NNS
cord-269720-o81j3d1j	112	14	.	.	.
cord-269720-o81j3d1j	113	1	The	the	DT
cord-269720-o81j3d1j	113	2	two	two	CD
cord-269720-o81j3d1j	113	3	MHV	MHV	NNP
cord-269720-o81j3d1j	113	4	molecules	molecule	NNS
cord-269720-o81j3d1j	113	5	are	be	VBP
cord-269720-o81j3d1j	113	6	very	very	RB
cord-269720-o81j3d1j	113	7	similar	similar	JJ
cord-269720-o81j3d1j	113	8	in	in	IN
cord-269720-o81j3d1j	113	9	shape	shape	NN
cord-269720-o81j3d1j	113	10	and	and	CC
cord-269720-o81j3d1j	113	11	,	,	,
cord-269720-o81j3d1j	113	12	as	as	IN
cord-269720-o81j3d1j	113	13	seen	see	VBN
cord-269720-o81j3d1j	113	14	from	from	IN
cord-269720-o81j3d1j	113	15	Fig	Fig	NNP
cord-269720-o81j3d1j	113	16	.	.	.
cord-269720-o81j3d1j	114	1	5	5	CD
cord-269720-o81j3d1j	114	2	and	and	CC
cord-269720-o81j3d1j	114	3	Table	Table	NNP
cord-269720-o81j3d1j	114	4	1	1	CD
cord-269720-o81j3d1j	114	5	,	,	,
cord-269720-o81j3d1j	114	6	are	be	VBP
cord-269720-o81j3d1j	114	7	very	very	RB
cord-269720-o81j3d1j	114	8	homologous	homologous	JJ
cord-269720-o81j3d1j	114	9	,	,	,
cord-269720-o81j3d1j	114	10	91	91	CD
cord-269720-o81j3d1j	114	11	%	%	NN
cord-269720-o81j3d1j	114	12	,	,	,
cord-269720-o81j3d1j	114	13	at	at	IN
cord-269720-o81j3d1j	114	14	base	base	NN
cord-269720-o81j3d1j	114	15	sequence	sequence	NN
cord-269720-o81j3d1j	114	16	.	.	.
cord-269720-o81j3d1j	115	1	The	the	DT
cord-269720-o81j3d1j	115	2	secondary	secondary	JJ
cord-269720-o81j3d1j	115	3	structures	structure	NNS
cord-269720-o81j3d1j	115	4	of	of	IN
cord-269720-o81j3d1j	115	5	the	the	DT
cord-269720-o81j3d1j	115	6	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	115	7	leader	leader	NN
cord-269720-o81j3d1j	115	8	RNA	RNA	NNP
cord-269720-o81j3d1j	115	9	sequences	sequence	NNS
cord-269720-o81j3d1j	115	10	are	be	VBP
cord-269720-o81j3d1j	115	11	probably	probably	RB
cord-269720-o81j3d1j	115	12	influenced	influence	VBN
cord-269720-o81j3d1j	115	13	by	by	IN
cord-269720-o81j3d1j	115	14	their	-PRON-	PRP$
cord-269720-o81j3d1j	115	15	biological	biological	JJ
cord-269720-o81j3d1j	115	16	function	function	NN
cord-269720-o81j3d1j	115	17	,	,	,
cord-269720-o81j3d1j	115	18	which	which	WDT
cord-269720-o81j3d1j	115	19	results	result	VBZ
cord-269720-o81j3d1j	115	20	in	in	IN
cord-269720-o81j3d1j	115	21	the	the	DT
cord-269720-o81j3d1j	115	22	similarity	similarity	NN
cord-269720-o81j3d1j	115	23	of	of	IN
cord-269720-o81j3d1j	115	24	these	these	DT
cord-269720-o81j3d1j	115	25	potential	potential	JJ
cord-269720-o81j3d1j	115	26	structures	structure	NNS
cord-269720-o81j3d1j	115	27	.	.	.
cord-269720-o81j3d1j	116	1	This	this	DT
cord-269720-o81j3d1j	116	2	paper	paper	NN
cord-269720-o81j3d1j	116	3	presents	present	VBZ
cord-269720-o81j3d1j	116	4	evidence	evidence	NN
cord-269720-o81j3d1j	116	5	that	that	IN
cord-269720-o81j3d1j	116	6	the	the	DT
cord-269720-o81j3d1j	116	7	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	116	8	mRNA	mRNA	NNP
cord-269720-o81j3d1j	116	9	species	specie	NNS
cord-269720-o81j3d1j	116	10	of	of	IN
cord-269720-o81j3d1j	116	11	TGEV	TGEV	NNS
cord-269720-o81j3d1j	116	12	and	and	CC
cord-269720-o81j3d1j	116	13	the	the	DT
cord-269720-o81j3d1j	116	14	closely	closely	RB
cord-269720-o81j3d1j	116	15	related	related	JJ
cord-269720-o81j3d1j	116	16	porcine	porcine	JJ
cord-269720-o81j3d1j	116	17	respiratory	respiratory	JJ
cord-269720-o81j3d1j	116	18	variant	variant	NN
cord-269720-o81j3d1j	116	19	of	of	IN
cord-269720-o81j3d1j	116	20	TGEV	TGEV	NNP
cord-269720-o81j3d1j	116	21	,	,	,
cord-269720-o81j3d1j	116	22	PRCV	PRCV	NNP
cord-269720-o81j3d1j	116	23	,	,	,
cord-269720-o81j3d1j	116	24	contain	contain	VBP
cord-269720-o81j3d1j	116	25	an	an	DT
cord-269720-o81j3d1j	116	26	identical	identical	JJ
cord-269720-o81j3d1j	116	27	leader	leader	NN
cord-269720-o81j3d1j	116	28	RNA	RNA	NNP
cord-269720-o81j3d1j	116	29	sequence	sequence	NN
cord-269720-o81j3d1j	116	30	of	of	IN
cord-269720-o81j3d1j	116	31	about	about	RB
cord-269720-o81j3d1j	116	32	91	91	CD
cord-269720-o81j3d1j	116	33	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	116	34	.	.	.
cord-269720-o81j3d1j	117	1	Sequencing	sequencing	NN
cord-269720-o81j3d1j	117	2	studies	study	NNS
cord-269720-o81j3d1j	117	3	on	on	IN
cord-269720-o81j3d1j	117	4	TGEV	TGEV	NNP
cord-269720-o81j3d1j	117	5	have	have	VBP
cord-269720-o81j3d1j	117	6	shown	show	VBN
cord-269720-o81j3d1j	117	7	that	that	IN
cord-269720-o81j3d1j	117	8	the	the	DT
cord-269720-o81j3d1j	117	9	heptameric	heptameric	NN
cord-269720-o81j3d1j	117	10	sequence	sequence	NN
cord-269720-o81j3d1j	117	11	ACTAAAC	ACTAAAC	NNP
cord-269720-o81j3d1j	117	12	occurs	occur	VBZ
cord-269720-o81j3d1j	117	13	on	on	IN
cord-269720-o81j3d1j	117	14	the	the	DT
cord-269720-o81j3d1j	117	15	genome	genome	NN
cord-269720-o81j3d1j	117	16	upstream	upstream	RB
cord-269720-o81j3d1j	117	17	of	of	IN
cord-269720-o81j3d1j	117	18	the	the	DT
cord-269720-o81j3d1j	117	19	genes	gene	NNS
cord-269720-o81j3d1j	117	20	and	and	CC
cord-269720-o81j3d1j	117	21	is	be	VBZ
cord-269720-o81j3d1j	117	22	believed	believe	VBN
cord-269720-o81j3d1j	117	23	to	to	TO
cord-269720-o81j3d1j	117	24	be	be	VB
cord-269720-o81j3d1j	117	25	the	the	DT
cord-269720-o81j3d1j	117	26	binding	binding	NN
cord-269720-o81j3d1j	117	27	site	site	NN
cord-269720-o81j3d1j	117	28	for	for	IN
cord-269720-o81j3d1j	117	29	the	the	DT
cord-269720-o81j3d1j	117	30	leader	leader	NN
cord-269720-o81j3d1j	117	31	of	of	IN
cord-269720-o81j3d1j	117	32	the	the	DT
cord-269720-o81j3d1j	117	33	genomic	genomic	JJ
cord-269720-o81j3d1j	117	34	RNA	RNA	NNP
cord-269720-o81j3d1j	117	35	.	.	.
cord-269720-o81j3d1j	118	1	This	this	DT
cord-269720-o81j3d1j	118	2	mechanism	mechanism	NN
cord-269720-o81j3d1j	118	3	has	have	VBZ
cord-269720-o81j3d1j	118	4	been	be	VBN
cord-269720-o81j3d1j	118	5	termed	term	VBN
cord-269720-o81j3d1j	118	6	leader	leader	NN
cord-269720-o81j3d1j	118	7	-	-	HYPH
cord-269720-o81j3d1j	118	8	primed	prime	VBN
cord-269720-o81j3d1j	118	9	transcription	transcription	NN
cord-269720-o81j3d1j	118	10	and	and	CC
cord-269720-o81j3d1j	118	11	involves	involve	VBZ
cord-269720-o81j3d1j	118	12	not	not	RB
cord-269720-o81j3d1j	118	13	only	only	RB
cord-269720-o81j3d1j	118	14	the	the	DT
cord-269720-o81j3d1j	118	15	leader	leader	NN
cord-269720-o81j3d1j	118	16	RNA	RNA	NNP
cord-269720-o81j3d1j	118	17	primer	primer	NN
cord-269720-o81j3d1j	118	18	,	,	,
cord-269720-o81j3d1j	118	19	but	but	CC
cord-269720-o81j3d1j	118	20	also	also	RB
cord-269720-o81j3d1j	118	21	consensus	consensus	NN
cord-269720-o81j3d1j	118	22	sequences	sequence	NNS
cord-269720-o81j3d1j	118	23	along	along	IN
cord-269720-o81j3d1j	118	24	the	the	DT
cord-269720-o81j3d1j	118	25	genome	genome	NN
cord-269720-o81j3d1j	118	26	found	find	VBN
cord-269720-o81j3d1j	118	27	upstream	upstream	RB
cord-269720-o81j3d1j	118	28	of	of	IN
cord-269720-o81j3d1j	118	29	the	the	DT
cord-269720-o81j3d1j	118	30	genes	gene	NNS
cord-269720-o81j3d1j	118	31	,	,	,
cord-269720-o81j3d1j	118	32	which	which	WDT
cord-269720-o81j3d1j	118	33	act	act	VBP
cord-269720-o81j3d1j	118	34	as	as	IN
cord-269720-o81j3d1j	118	35	binding	bind	VBG
cord-269720-o81j3d1j	118	36	sites	site	NNS
cord-269720-o81j3d1j	118	37	for	for	IN
cord-269720-o81j3d1j	118	38	the	the	DT
cord-269720-o81j3d1j	118	39	leader	leader	NN
cord-269720-o81j3d1j	118	40	RNA	RNA	NNP
cord-269720-o81j3d1j	118	41	primer	primer	NN
cord-269720-o81j3d1j	118	42	.	.	.
cord-269720-o81j3d1j	119	1	Comparison	comparison	NN
cord-269720-o81j3d1j	119	2	of	of	IN
cord-269720-o81j3d1j	119	3	TGEV	TGEV	NNP
cord-269720-o81j3d1j	119	4	and	and	CC
cord-269720-o81j3d1j	119	5	PRCV	PRCV	NNP
cord-269720-o81j3d1j	119	6	viral	viral	JJ
cord-269720-o81j3d1j	119	7	products	product	NNS
cord-269720-o81j3d1j	119	8	has	have	VBZ
cord-269720-o81j3d1j	119	9	shown	show	VBN
cord-269720-o81j3d1j	119	10	very	very	RB
cord-269720-o81j3d1j	119	11	little	little	JJ
cord-269720-o81j3d1j	119	12	difference	difference	NN
cord-269720-o81j3d1j	119	13	between	between	IN
cord-269720-o81j3d1j	119	14	the	the	DT
cord-269720-o81j3d1j	119	15	two	two	CD
cord-269720-o81j3d1j	119	16	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	119	17	,	,	,
cord-269720-o81j3d1j	119	18	and	and	CC
cord-269720-o81j3d1j	119	19	until	until	IN
cord-269720-o81j3d1j	119	20	recently	recently	RB
cord-269720-o81j3d1j	119	21	is	be	VBZ
cord-269720-o81j3d1j	119	22	was	be	VBD
cord-269720-o81j3d1j	119	23	impossible	impossible	JJ
cord-269720-o81j3d1j	119	24	to	to	TO
cord-269720-o81j3d1j	119	25	differentiate	differentiate	VB
cord-269720-o81j3d1j	119	26	between	between	IN
cord-269720-o81j3d1j	119	27	the	the	DT
cord-269720-o81j3d1j	119	28	two	two	CD
cord-269720-o81j3d1j	119	29	viruses	virus	NNS
cord-269720-o81j3d1j	119	30	using	use	VBG
cord-269720-o81j3d1j	119	31	antisera	antisera	NN
cord-269720-o81j3d1j	119	32	.	.	.
cord-269720-o81j3d1j	120	1	PRCV	PRCV	NNP
cord-269720-o81j3d1j	120	2	is	be	VBZ
cord-269720-o81j3d1j	120	3	fully	fully	RB
cord-269720-o81j3d1j	120	4	neutralized	neutralize	VBN
cord-269720-o81j3d1j	120	5	by	by	IN
cord-269720-o81j3d1j	120	6	antisera	antisera	NN
cord-269720-o81j3d1j	120	7	prepared	prepare	VBN
cord-269720-o81j3d1j	120	8	against	against	IN
cord-269720-o81j3d1j	120	9	TGEV	TGEV	NNP
cord-269720-o81j3d1j	120	10	,	,	,
cord-269720-o81j3d1j	120	11	and	and	CC
cord-269720-o81j3d1j	120	12	the	the	DT
cord-269720-o81j3d1j	120	13	majority	majority	NN
cord-269720-o81j3d1j	120	14	of	of	IN
cord-269720-o81j3d1j	120	15	monoclonal	monoclonal	JJ
cord-269720-o81j3d1j	120	16	antibodies	antibody	NNS
cord-269720-o81j3d1j	120	17	(	(	-LRB-
cord-269720-o81j3d1j	120	18	MAbs	MAbs	NNP
cord-269720-o81j3d1j	120	19	)	)	-RRB-
cord-269720-o81j3d1j	120	20	raised	raise	VBD
cord-269720-o81j3d1j	120	21	against	against	IN
cord-269720-o81j3d1j	120	22	TGEV	TGEV	NNP
cord-269720-o81j3d1j	120	23	virion	virion	NN
cord-269720-o81j3d1j	120	24	proteins	protein	NNS
cord-269720-o81j3d1j	120	25	cross	cross	VBP
cord-269720-o81j3d1j	120	26	-	-	VBP
cord-269720-o81j3d1j	120	27	react	react	VBP
cord-269720-o81j3d1j	120	28	with	with	IN
cord-269720-o81j3d1j	120	29	PRCV	PRCV	NNP
cord-269720-o81j3d1j	120	30	.	.	.
cord-269720-o81j3d1j	121	1	However	however	RB
cord-269720-o81j3d1j	121	2	,	,	,
cord-269720-o81j3d1j	121	3	MAbs	MAbs	NNP
cord-269720-o81j3d1j	121	4	,	,	,
cord-269720-o81j3d1j	121	5	raised	raise	VBN
cord-269720-o81j3d1j	121	6	against	against	IN
cord-269720-o81j3d1j	121	7	antigenic	antigenic	JJ
cord-269720-o81j3d1j	121	8	determinants	determinant	NNS
cord-269720-o81j3d1j	121	9	of	of	IN
cord-269720-o81j3d1j	121	10	the	the	DT
cord-269720-o81j3d1j	121	11	spike	spike	NN
cord-269720-o81j3d1j	121	12	protein	protein	NN
cord-269720-o81j3d1j	121	13	from	from	IN
cord-269720-o81j3d1j	121	14	either	either	CC
cord-269720-o81j3d1j	121	15	the	the	DT
cord-269720-o81j3d1j	121	16	virulent	virulent	JJ
cord-269720-o81j3d1j	121	17	British	british	JJ
cord-269720-o81j3d1j	121	18	isolate	isolate	VBP
cord-269720-o81j3d1j	121	19	FS772/70	FS772/70	NNP
cord-269720-o81j3d1j	121	20	(	(	-LRB-
cord-269720-o81j3d1j	121	21	29	29	CD
cord-269720-o81j3d1j	121	22	)	)	-RRB-
cord-269720-o81j3d1j	121	23	or	or	CC
cord-269720-o81j3d1j	121	24	the	the	DT
cord-269720-o81j3d1j	121	25	avirulent	avirulent	NN
cord-269720-o81j3d1j	121	26	Purdue	Purdue	NNP
cord-269720-o81j3d1j	121	27	strain	strain	NN
cord-269720-o81j3d1j	121	28	of	of	IN
cord-269720-o81j3d1j	121	29	TGEV	TGEV	NNP
cord-269720-o81j3d1j	121	30	(	(	-LRB-
cord-269720-o81j3d1j	121	31	30	30	CD
cord-269720-o81j3d1j	121	32	)	)	-RRB-
cord-269720-o81j3d1j	121	33	have	have	VBP
cord-269720-o81j3d1j	121	34	been	be	VBN
cord-269720-o81j3d1j	121	35	identified	identify	VBN
cord-269720-o81j3d1j	121	36	that	that	WDT
cord-269720-o81j3d1j	121	37	do	do	VBP
cord-269720-o81j3d1j	121	38	not	not	RB
cord-269720-o81j3d1j	121	39	recognize	recognize	VB
cord-269720-o81j3d1j	121	40	PRCV	PRCV	NNP
cord-269720-o81j3d1j	121	41	.	.	.
cord-269720-o81j3d1j	122	1	These	these	DT
cord-269720-o81j3d1j	122	2	observations	observation	NNS
cord-269720-o81j3d1j	122	3	and	and	CC
cord-269720-o81j3d1j	122	4	the	the	DT
cord-269720-o81j3d1j	122	5	fact	fact	NN
cord-269720-o81j3d1j	122	6	that	that	IN
cord-269720-o81j3d1j	122	7	the	the	DT
cord-269720-o81j3d1j	122	8	leader	leader	NN
cord-269720-o81j3d1j	122	9	RNA	RNA	NNP
cord-269720-o81j3d1j	122	10	sequences	sequence	NNS
cord-269720-o81j3d1j	122	11	from	from	IN
cord-269720-o81j3d1j	122	12	TGEV	TGEV	NNP
cord-269720-o81j3d1j	122	13	and	and	CC
cord-269720-o81j3d1j	122	14	PRCV	PRCV	NNPS
cord-269720-o81j3d1j	122	15	are	be	VBP
cord-269720-o81j3d1j	122	16	identical	identical	JJ
cord-269720-o81j3d1j	122	17	supports	support	NNS
cord-269720-o81j3d1j	122	18	the	the	DT
cord-269720-o81j3d1j	122	19	evidence	evidence	NN
cord-269720-o81j3d1j	122	20	that	that	IN
cord-269720-o81j3d1j	122	21	the	the	DT
cord-269720-o81j3d1j	122	22	two	two	CD
cord-269720-o81j3d1j	122	23	viruses	virus	NNS
cord-269720-o81j3d1j	122	24	are	be	VBP
cord-269720-o81j3d1j	122	25	very	very	RB
cord-269720-o81j3d1j	122	26	similar	similar	JJ
cord-269720-o81j3d1j	122	27	and	and	CC
cord-269720-o81j3d1j	122	28	that	that	IN
cord-269720-o81j3d1j	122	29	PRCV	PRCV	NNP
cord-269720-o81j3d1j	122	30	may	may	MD
cord-269720-o81j3d1j	122	31	have	have	VB
cord-269720-o81j3d1j	122	32	evolved	evolve	VBN
cord-269720-o81j3d1j	122	33	as	as	IN
cord-269720-o81j3d1j	122	34	a	a	DT
cord-269720-o81j3d1j	122	35	TGEV	TGEV	NNP
cord-269720-o81j3d1j	122	36	variant	variant	NN
cord-269720-o81j3d1j	122	37	.	.	.
cord-269720-o81j3d1j	123	1	Comparison	comparison	NN
cord-269720-o81j3d1j	123	2	of	of	IN
cord-269720-o81j3d1j	123	3	the	the	DT
cord-269720-o81j3d1j	123	4	TGEV	TGEV	NNP
cord-269720-o81j3d1j	123	5	leader	leader	NN
cord-269720-o81j3d1j	123	6	RNA	RNA	NNP
cord-269720-o81j3d1j	123	7	sequence	sequence	NN
cord-269720-o81j3d1j	123	8	with	with	IN
cord-269720-o81j3d1j	123	9	the	the	DT
cord-269720-o81j3d1j	123	10	genomic	genomic	JJ
cord-269720-o81j3d1j	123	11	sequence	sequence	NN
cord-269720-o81j3d1j	123	12	upstream	upstream	RB
cord-269720-o81j3d1j	123	13	of	of	IN
cord-269720-o81j3d1j	123	14	the	the	DT
cord-269720-o81j3d1j	123	15	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	123	16	indicates	indicate	VBZ
cord-269720-o81j3d1j	123	17	that	that	IN
cord-269720-o81j3d1j	123	18	the	the	DT
cord-269720-o81j3d1j	123	19	length	length	NN
cord-269720-o81j3d1j	123	20	of	of	IN
cord-269720-o81j3d1j	123	21	the	the	DT
cord-269720-o81j3d1j	123	22	unique	unique	JJ
cord-269720-o81j3d1j	123	23	sequence	sequence	NN
cord-269720-o81j3d1j	123	24	of	of	IN
cord-269720-o81j3d1j	123	25	the	the	DT
cord-269720-o81j3d1j	123	26	leader	leader	NN
cord-269720-o81j3d1j	123	27	sequence	sequence	NN
cord-269720-o81j3d1j	123	28	is	be	VBZ
cord-269720-o81j3d1j	123	29	91	91	CD
cord-269720-o81j3d1j	123	30	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	123	31	.	.	.
cord-269720-o81j3d1j	124	1	The	the	DT
cord-269720-o81j3d1j	124	2	point	point	NN
cord-269720-o81j3d1j	124	3	of	of	IN
cord-269720-o81j3d1j	124	4	divergence	divergence	NN
cord-269720-o81j3d1j	124	5	is	be	VBZ
cord-269720-o81j3d1j	124	6	two	two	CD
cord-269720-o81j3d1j	124	7	bases	basis	NNS
cord-269720-o81j3d1j	124	8	upstream	upstream	RB
cord-269720-o81j3d1j	124	9	of	of	IN
cord-269720-o81j3d1j	124	10	the	the	DT
cord-269720-o81j3d1j	124	11	ACTAAAC	ACTAAAC	NNP
cord-269720-o81j3d1j	124	12	sequence	sequence	NN
cord-269720-o81j3d1j	124	13	,	,	,
cord-269720-o81j3d1j	124	14	supporting	support	VBG
cord-269720-o81j3d1j	124	15	the	the	DT
cord-269720-o81j3d1j	124	16	evidence	evidence	NN
cord-269720-o81j3d1j	124	17	that	that	IN
cord-269720-o81j3d1j	124	18	the	the	DT
cord-269720-o81j3d1j	124	19	TGEV	TGEV	NNP
cord-269720-o81j3d1j	124	20	RNA	RNA	NNP
cord-269720-o81j3d1j	124	21	polymerase	polymerase	NN
cord-269720-o81j3d1j	124	22	-	-	HYPH
cord-269720-o81j3d1j	124	23	leader	leader	NN
cord-269720-o81j3d1j	124	24	complex	complex	JJ
cord-269720-o81j3d1j	124	25	binding	binding	NN
cord-269720-o81j3d1j	124	26	site	site	NN
cord-269720-o81j3d1j	124	27	is	be	VBZ
cord-269720-o81j3d1j	124	28	ACTAAAC	ACTAAAC	NNP
cord-269720-o81j3d1j	124	29	.	.	.
cord-269720-o81j3d1j	125	1	Four	four	CD
cord-269720-o81j3d1j	125	2	out	out	IN
cord-269720-o81j3d1j	125	3	of	of	IN
cord-269720-o81j3d1j	125	4	the	the	DT
cord-269720-o81j3d1j	125	5	six	six	CD
cord-269720-o81j3d1j	125	6	mRNA	mrna	NN
cord-269720-o81j3d1j	125	7	species	specie	NNS
cord-269720-o81j3d1j	125	8	from	from	IN
cord-269720-o81j3d1j	125	9	the	the	DT
cord-269720-o81j3d1j	125	10	FS772/70	FS772/70	NNP
cord-269720-o81j3d1j	125	11	strain	strain	NN
cord-269720-o81j3d1j	125	12	of	of	IN
cord-269720-o81j3d1j	125	13	TGEV	TGEV	NNP
cord-269720-o81j3d1j	125	14	have	have	VBP
cord-269720-o81j3d1j	125	15	the	the	DT
cord-269720-o81j3d1j	125	16	sequence	sequence	NN
cord-269720-o81j3d1j	125	17	AACTAAAC	AACTAAAC	NNP
cord-269720-o81j3d1j	125	18	,	,	,
cord-269720-o81j3d1j	125	19	and	and	CC
cord-269720-o81j3d1j	125	20	the	the	DT
cord-269720-o81j3d1j	125	21	5'-end	5'-end	CD
cord-269720-o81j3d1j	125	22	adenosine	adenosine	NN
cord-269720-o81j3d1j	125	23	residue	residue	NN
cord-269720-o81j3d1j	125	24	is	be	VBZ
cord-269720-o81j3d1j	125	25	the	the	DT
cord-269720-o81j3d1j	125	26	next	next	JJ
cord-269720-o81j3d1j	125	27	base	base	NN
cord-269720-o81j3d1j	125	28	down	down	RP
cord-269720-o81j3d1j	125	29	from	from	IN
cord-269720-o81j3d1j	125	30	the	the	DT
cord-269720-o81j3d1j	125	31	divergence	divergence	NN
cord-269720-o81j3d1j	125	32	point	point	NN
cord-269720-o81j3d1j	125	33	in	in	IN
cord-269720-o81j3d1j	125	34	the	the	DT
cord-269720-o81j3d1j	125	35	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	126	1	mRNA	mRNA	NNP
cord-269720-o81j3d1j	127	1	(	(	-LRB-
cord-269720-o81j3d1j	127	2	Fig	Fig	NNP
cord-269720-o81j3d1j	127	3	.	.	NNP
cord-269720-o81j3d1j	127	4	2	2	CD
cord-269720-o81j3d1j	127	5	)	)	-RRB-
cord-269720-o81j3d1j	127	6	.	.	.
cord-269720-o81j3d1j	128	1	The	the	DT
cord-269720-o81j3d1j	128	2	differences	difference	NNS
cord-269720-o81j3d1j	128	3	in	in	IN
cord-269720-o81j3d1j	128	4	the	the	DT
cord-269720-o81j3d1j	128	5	homologies	homology	NNS
cord-269720-o81j3d1j	128	6	between	between	IN
cord-269720-o81j3d1j	128	7	the	the	DT
cord-269720-o81j3d1j	128	8	leader	leader	NN
cord-269720-o81j3d1j	128	9	RNA	RNA	NNP
cord-269720-o81j3d1j	128	10	and	and	CC
cord-269720-o81j3d1j	128	11	sequences	sequence	NNS
cord-269720-o81j3d1j	128	12	upstream	upstream	RB
cord-269720-o81j3d1j	128	13	of	of	IN
cord-269720-o81j3d1j	128	14	the	the	DT
cord-269720-o81j3d1j	128	15	consensus	consensus	NN
cord-269720-o81j3d1j	128	16	sequence	sequence	NN
cord-269720-o81j3d1j	128	17	on	on	IN
cord-269720-o81j3d1j	128	18	the	the	DT
cord-269720-o81j3d1j	128	19	genomic	genomic	JJ
cord-269720-o81j3d1j	128	20	RNA	RNA	NNP
cord-269720-o81j3d1j	128	21	may	may	MD
cord-269720-o81j3d1j	128	22	play	play	VB
cord-269720-o81j3d1j	128	23	a	a	DT
cord-269720-o81j3d1j	128	24	role	role	NN
cord-269720-o81j3d1j	128	25	in	in	IN
cord-269720-o81j3d1j	128	26	the	the	DT
cord-269720-o81j3d1j	128	27	levels	level	NNS
cord-269720-o81j3d1j	128	28	of	of	IN
cord-269720-o81j3d1j	128	29	transcription	transcription	NN
cord-269720-o81j3d1j	128	30	of	of	IN
cord-269720-o81j3d1j	128	31	a	a	DT
cord-269720-o81j3d1j	128	32	particular	particular	JJ
cord-269720-o81j3d1j	128	33	mRNA	mRNA	NNP
cord-269720-o81j3d1j	128	34	species	specie	NNS
cord-269720-o81j3d1j	128	35	.	.	.
cord-269720-o81j3d1j	129	1	The	the	DT
cord-269720-o81j3d1j	129	2	mRNA	mRNA	NNP
cord-269720-o81j3d1j	129	3	species	specie	NNS
cord-269720-o81j3d1j	129	4	of	of	IN
cord-269720-o81j3d1j	129	5	3.0	3.0	CD
cord-269720-o81j3d1j	129	6	kb	kb	NNP
cord-269720-o81j3d1j	129	7	has	have	VBZ
cord-269720-o81j3d1j	129	8	been	be	VBN
cord-269720-o81j3d1j	129	9	shown	show	VBN
cord-269720-o81j3d1j	129	10	to	to	TO
cord-269720-o81j3d1j	129	11	have	have	VB
cord-269720-o81j3d1j	129	12	an	an	DT
cord-269720-o81j3d1j	129	13	open	open	JJ
cord-269720-o81j3d1j	129	14	reading	reading	NN
cord-269720-o81j3d1j	129	15	frame	frame	NN
cord-269720-o81j3d1j	129	16	at	at	IN
cord-269720-o81j3d1j	129	17	the	the	DT
cord-269720-o81j3d1j	129	18	5	5	CD
cord-269720-o81j3d1j	129	19	'	'	NN
cord-269720-o81j3d1j	129	20	end	end	NN
cord-269720-o81j3d1j	129	21	encoding	encode	VBG
cord-269720-o81j3d1j	129	22	a	a	DT
cord-269720-o81j3d1j	129	23	potential	potential	JJ
cord-269720-o81j3d1j	129	24	polypeptide	polypeptide	NN
cord-269720-o81j3d1j	129	25	of	of	IN
cord-269720-o81j3d1j	129	26	M	M	NNP
cord-269720-o81j3d1j	129	27	r	r	NN
cord-269720-o81j3d1j	129	28	9200	9200	CD
cord-269720-o81j3d1j	129	29	(	(	-LRB-
cord-269720-o81j3d1j	129	30	17	17	CD
cord-269720-o81j3d1j	129	31	)	)	-RRB-
cord-269720-o81j3d1j	129	32	.	.	.
cord-269720-o81j3d1j	130	1	This	this	DT
cord-269720-o81j3d1j	130	2	particular	particular	JJ
cord-269720-o81j3d1j	130	3	mRNA	mrna	NN
cord-269720-o81j3d1j	130	4	does	do	VBZ
cord-269720-o81j3d1j	130	5	not	not	RB
cord-269720-o81j3d1j	130	6	have	have	VB
cord-269720-o81j3d1j	130	7	the	the	DT
cord-269720-o81j3d1j	130	8	heptameric	heptameric	JJ
cord-269720-o81j3d1j	130	9	consensus	consensus	NN
cord-269720-o81j3d1j	130	10	sequence	sequence	NN
cord-269720-o81j3d1j	130	11	but	but	CC
cord-269720-o81j3d1j	130	12	has	have	VBZ
cord-269720-o81j3d1j	130	13	the	the	DT
cord-269720-o81j3d1j	130	14	hexameric	hexameric	JJ
cord-269720-o81j3d1j	130	15	CTAAAC	ctaaac	NN
cord-269720-o81j3d1j	130	16	sequence	sequence	NN
cord-269720-o81j3d1j	130	17	,	,	,
cord-269720-o81j3d1j	130	18	and	and	CC
cord-269720-o81j3d1j	130	19	it	-PRON-	PRP
cord-269720-o81j3d1j	130	20	is	be	VBZ
cord-269720-o81j3d1j	130	21	interesting	interesting	JJ
cord-269720-o81j3d1j	130	22	to	to	TO
cord-269720-o81j3d1j	130	23	note	note	VB
cord-269720-o81j3d1j	130	24	that	that	IN
cord-269720-o81j3d1j	130	25	it	-PRON-	PRP
cord-269720-o81j3d1j	130	26	is	be	VBZ
cord-269720-o81j3d1j	130	27	the	the	DT
cord-269720-o81j3d1j	130	28	least	least	JJS
cord-269720-o81j3d1j	130	29	abundant	abundant	JJ
cord-269720-o81j3d1j	130	30	TGEV	TGEV	NNP
cord-269720-o81j3d1j	130	31	mRNA	mrna	NN
cord-269720-o81j3d1j	130	32	species	specie	NNS
cord-269720-o81j3d1j	130	33	(	(	-LRB-
cord-269720-o81j3d1j	130	34	observed	observe	VBN
cord-269720-o81j3d1j	130	35	from	from	IN
cord-269720-o81j3d1j	130	36	TGEV	TGEV	NNP
cord-269720-o81j3d1j	130	37	mRNA	mRNA	NNP
cord-269720-o81j3d1j	130	38	in	in	IN
cord-269720-o81j3d1j	130	39	total	total	JJ
cord-269720-o81j3d1j	130	40	cell	cell	NN
cord-269720-o81j3d1j	130	41	lysates	lysate	NNS
cord-269720-o81j3d1j	130	42	)	)	-RRB-
cord-269720-o81j3d1j	130	43	.	.	.
cord-269720-o81j3d1j	131	1	Hybridization	hybridization	NN
cord-269720-o81j3d1j	131	2	of	of	IN
cord-269720-o81j3d1j	131	3	oligo	oligo	NN
cord-269720-o81j3d1j	131	4	58	58	CD
cord-269720-o81j3d1j	131	5	to	to	IN
cord-269720-o81j3d1j	131	6	the	the	DT
cord-269720-o81j3d1j	131	7	3.0-kb	3.0-kb	CD
cord-269720-o81j3d1j	131	8	mRNA	mrna	NN
cord-269720-o81j3d1j	131	9	species	specie	NNS
cord-269720-o81j3d1j	131	10	showed	show	VBD
cord-269720-o81j3d1j	131	11	that	that	IN
cord-269720-o81j3d1j	131	12	this	this	DT
cord-269720-o81j3d1j	131	13	species	species	NN
cord-269720-o81j3d1j	131	14	does	do	VBZ
cord-269720-o81j3d1j	131	15	contain	contain	VB
cord-269720-o81j3d1j	131	16	the	the	DT
cord-269720-o81j3d1j	131	17	TGEV	TGEV	NNP
cord-269720-o81j3d1j	131	18	leader	leader	NN
cord-269720-o81j3d1j	131	19	RNA	RNA	NNP
cord-269720-o81j3d1j	131	20	,	,	,
cord-269720-o81j3d1j	131	21	confirming	confirm	VBG
cord-269720-o81j3d1j	131	22	that	that	IN
cord-269720-o81j3d1j	131	23	it	-PRON-	PRP
cord-269720-o81j3d1j	131	24	is	be	VBZ
cord-269720-o81j3d1j	131	25	a	a	DT
cord-269720-o81j3d1j	131	26	true	true	JJ
cord-269720-o81j3d1j	131	27	mRNA	mRNA	NNP
cord-269720-o81j3d1j	131	28	species	specie	NNS
cord-269720-o81j3d1j	131	29	,	,	,
cord-269720-o81j3d1j	131	30	even	even	RB
cord-269720-o81j3d1j	131	31	though	though	IN
cord-269720-o81j3d1j	131	32	it	-PRON-	PRP
cord-269720-o81j3d1j	131	33	is	be	VBZ
cord-269720-o81j3d1j	131	34	the	the	DT
cord-269720-o81j3d1j	131	35	only	only	JJ
cord-269720-o81j3d1j	131	36	TGEV	TGEV	NNP
cord-269720-o81j3d1j	131	37	species	specie	NNS
cord-269720-o81j3d1j	131	38	not	not	RB
cord-269720-o81j3d1j	131	39	to	to	TO
cord-269720-o81j3d1j	131	40	have	have	VB
cord-269720-o81j3d1j	131	41	the	the	DT
cord-269720-o81j3d1j	131	42	heptameric	heptameric	JJ
cord-269720-o81j3d1j	131	43	consensus	consensus	NN
cord-269720-o81j3d1j	131	44	sequence	sequence	NN
cord-269720-o81j3d1j	131	45	.	.	.
cord-269720-o81j3d1j	132	1	Comparison	comparison	NN
cord-269720-o81j3d1j	132	2	of	of	IN
cord-269720-o81j3d1j	132	3	the	the	DT
cord-269720-o81j3d1j	132	4	seven	seven	CD
cord-269720-o81j3d1j	132	5	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	132	6	leader	leader	NN
cord-269720-o81j3d1j	132	7	RNA	RNA	NNP
cord-269720-o81j3d1j	132	8	sequences	sequence	NNS
cord-269720-o81j3d1j	132	9	against	against	IN
cord-269720-o81j3d1j	132	10	each	each	DT
cord-269720-o81j3d1j	132	11	other	other	JJ
cord-269720-o81j3d1j	132	12	identified	identify	VBD
cord-269720-o81j3d1j	132	13	three	three	CD
cord-269720-o81j3d1j	132	14	groups	group	NNS
cord-269720-o81j3d1j	132	15	(	(	-LRB-
cord-269720-o81j3d1j	132	16	Table	table	NN
cord-269720-o81j3d1j	132	17	1	1	CD
cord-269720-o81j3d1j	132	18	)	)	-RRB-
cord-269720-o81j3d1j	132	19	:	:	:
cord-269720-o81j3d1j	133	1	non	non	JJ
cord-269720-o81j3d1j	133	2	-	-	JJ
cord-269720-o81j3d1j	133	3	serologically	serologically	RB
cord-269720-o81j3d1j	133	4	related	relate	VBN
cord-269720-o81j3d1j	133	5	viruses	virus	NNS
cord-269720-o81j3d1j	133	6	had	have	VBD
cord-269720-o81j3d1j	133	7	about	about	RB
cord-269720-o81j3d1j	133	8	35	35	CD
cord-269720-o81j3d1j	133	9	-	-	SYM
cord-269720-o81j3d1j	133	10	40	40	CD
cord-269720-o81j3d1j	133	11	%	%	NN
cord-269720-o81j3d1j	133	12	homology	homology	NN
cord-269720-o81j3d1j	133	13	;	;	:
cord-269720-o81j3d1j	133	14	serologically	serologically	RB
cord-269720-o81j3d1j	133	15	related	relate	VBN
cord-269720-o81j3d1j	133	16	viruses	virus	NNS
cord-269720-o81j3d1j	133	17	had	have	VBD
cord-269720-o81j3d1j	133	18	about	about	RB
cord-269720-o81j3d1j	133	19	60	60	CD
cord-269720-o81j3d1j	133	20	%	%	NN
cord-269720-o81j3d1j	133	21	homology	homology	NN
cord-269720-o81j3d1j	133	22	;	;	,
cord-269720-o81j3d1j	133	23	viral	viral	JJ
cord-269720-o81j3d1j	133	24	strains	strain	NNS
cord-269720-o81j3d1j	133	25	had	have	VBD
cord-269720-o81j3d1j	133	26	about	about	RB
cord-269720-o81j3d1j	133	27	90	90	CD
cord-269720-o81j3d1j	133	28	-	-	SYM
cord-269720-o81j3d1j	133	29	100	100	CD
cord-269720-o81j3d1j	133	30	%	%	NN
cord-269720-o81j3d1j	133	31	homology	homology	NN
cord-269720-o81j3d1j	133	32	.	.	.
cord-269720-o81j3d1j	134	1	However	however	RB
cord-269720-o81j3d1j	134	2	,	,	,
cord-269720-o81j3d1j	134	3	TGEV	TGEV	NNP
cord-269720-o81j3d1j	134	4	and	and	CC
cord-269720-o81j3d1j	134	5	HCV	HCV	NNP
cord-269720-o81j3d1j	134	6	(	(	-LRB-
cord-269720-o81j3d1j	134	7	229E	229e	CD
cord-269720-o81j3d1j	134	8	)	)	-RRB-
cord-269720-o81j3d1j	134	9	have	have	VBP
cord-269720-o81j3d1j	134	10	been	be	VBN
cord-269720-o81j3d1j	134	11	placed	place	VBN
cord-269720-o81j3d1j	134	12	in	in	IN
cord-269720-o81j3d1j	134	13	the	the	DT
cord-269720-o81j3d1j	134	14	same	same	JJ
cord-269720-o81j3d1j	134	15	serological	serological	JJ
cord-269720-o81j3d1j	134	16	group	group	NN
cord-269720-o81j3d1j	134	17	,	,	,
cord-269720-o81j3d1j	134	18	but	but	CC
cord-269720-o81j3d1j	134	19	have	have	VBP
cord-269720-o81j3d1j	134	20	only	only	RB
cord-269720-o81j3d1j	134	21	36	36	CD
cord-269720-o81j3d1j	134	22	%	%	NN
cord-269720-o81j3d1j	134	23	homology	homology	NN
cord-269720-o81j3d1j	134	24	within	within	IN
cord-269720-o81j3d1j	134	25	their	-PRON-	PRP$
cord-269720-o81j3d1j	134	26	leader	leader	NN
cord-269720-o81j3d1j	134	27	RNA	RNA	NNP
cord-269720-o81j3d1j	134	28	sequences	sequence	NNS
cord-269720-o81j3d1j	134	29	,	,	,
cord-269720-o81j3d1j	134	30	suggesting	suggest	VBG
cord-269720-o81j3d1j	134	31	that	that	IN
cord-269720-o81j3d1j	134	32	the	the	DT
cord-269720-o81j3d1j	134	33	two	two	CD
cord-269720-o81j3d1j	134	34	viruses	virus	NNS
cord-269720-o81j3d1j	134	35	are	be	VBP
cord-269720-o81j3d1j	134	36	not	not	RB
cord-269720-o81j3d1j	134	37	particularly	particularly	RB
cord-269720-o81j3d1j	134	38	related	relate	VBN
cord-269720-o81j3d1j	134	39	.	.	.
cord-269720-o81j3d1j	135	1	TGEV	TGEV	NNP
cord-269720-o81j3d1j	135	2	and	and	CC
cord-269720-o81j3d1j	135	3	HCV	HCV	NNP
cord-269720-o81j3d1j	135	4	(	(	-LRB-
cord-269720-o81j3d1j	135	5	229E	229e	CD
cord-269720-o81j3d1j	135	6	)	)	-RRB-
cord-269720-o81j3d1j	135	7	have	have	VBP
cord-269720-o81j3d1j	135	8	been	be	VBN
cord-269720-o81j3d1j	135	9	shown	show	VBN
cord-269720-o81j3d1j	135	10	to	to	TO
cord-269720-o81j3d1j	135	11	have	have	VB
cord-269720-o81j3d1j	135	12	46	46	CD
cord-269720-o81j3d1j	135	13	%	%	NN
cord-269720-o81j3d1j	135	14	homology	homology	NN
cord-269720-o81j3d1j	135	15	at	at	IN
cord-269720-o81j3d1j	135	16	the	the	DT
cord-269720-o81j3d1j	135	17	amino	amino	NN
cord-269720-o81j3d1j	135	18	acid	acid	NN
cord-269720-o81j3d1j	135	19	level	level	NN
cord-269720-o81j3d1j	135	20	within	within	IN
cord-269720-o81j3d1j	135	21	their	-PRON-	PRP$
cord-269720-o81j3d1j	135	22	derived	derive	VBN
cord-269720-o81j3d1j	135	23	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	135	24	sequences	sequence	NNS
cord-269720-o81j3d1j	135	25	(	(	-LRB-
cord-269720-o81j3d1j	135	26	31	31	CD
cord-269720-o81j3d1j	135	27	)	)	-RRB-
cord-269720-o81j3d1j	135	28	,	,	,
cord-269720-o81j3d1j	135	29	whereas	whereas	IN
cord-269720-o81j3d1j	135	30	the	the	DT
cord-269720-o81j3d1j	135	31	homology	homology	NN
cord-269720-o81j3d1j	135	32	between	between	IN
cord-269720-o81j3d1j	135	33	the	the	DT
cord-269720-o81j3d1j	135	34	derived	derive	VBN
cord-269720-o81j3d1j	135	35	nucleoprotein	nucleoprotein	JJ
cord-269720-o81j3d1j	135	36	amino	amino	NN
cord-269720-o81j3d1j	135	37	acid	acid	NN
cord-269720-o81j3d1j	135	38	sequences	sequence	NNS
cord-269720-o81j3d1j	135	39	for	for	IN
cord-269720-o81j3d1j	135	40	different	different	JJ
cord-269720-o81j3d1j	135	41	viruses	virus	NNS
cord-269720-o81j3d1j	135	42	within	within	IN
cord-269720-o81j3d1j	135	43	the	the	DT
cord-269720-o81j3d1j	135	44	MHV	MHV	NNP
cord-269720-o81j3d1j	135	45	serological	serological	JJ
cord-269720-o81j3d1j	135	46	group	group	NN
cord-269720-o81j3d1j	135	47	are	be	VBP
cord-269720-o81j3d1j	135	48	between	between	IN
cord-269720-o81j3d1j	135	49	80	80	CD
cord-269720-o81j3d1j	135	50	%	%	NN
cord-269720-o81j3d1j	135	51	and	and	CC
cord-269720-o81j3d1j	135	52	98	98	CD
cord-269720-o81j3d1j	135	53	%	%	NN
cord-269720-o81j3d1j	135	54	homology	homology	NN
cord-269720-o81j3d1j	135	55	.	.	.
cord-269720-o81j3d1j	136	1	This	this	DT
cord-269720-o81j3d1j	136	2	indicates	indicate	VBZ
cord-269720-o81j3d1j	136	3	that	that	IN
cord-269720-o81j3d1j	136	4	the	the	DT
cord-269720-o81j3d1j	136	5	serological	serological	JJ
cord-269720-o81j3d1j	136	6	grouping	grouping	NN
cord-269720-o81j3d1j	136	7	of	of	IN
cord-269720-o81j3d1j	136	8	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	136	9	is	be	VBZ
cord-269720-o81j3d1j	136	10	not	not	RB
cord-269720-o81j3d1j	136	11	a	a	DT
cord-269720-o81j3d1j	136	12	particularly	particularly	RB
cord-269720-o81j3d1j	136	13	useful	useful	JJ
cord-269720-o81j3d1j	136	14	test	test	NN
cord-269720-o81j3d1j	136	15	,	,	,
cord-269720-o81j3d1j	136	16	as	as	IN
cord-269720-o81j3d1j	136	17	similar	similar	JJ
cord-269720-o81j3d1j	136	18	epitopes	epitope	NNS
cord-269720-o81j3d1j	136	19	may	may	MD
cord-269720-o81j3d1j	136	20	exist	exist	VB
cord-269720-o81j3d1j	136	21	on	on	IN
cord-269720-o81j3d1j	136	22	the	the	DT
cord-269720-o81j3d1j	136	23	viral	viral	JJ
cord-269720-o81j3d1j	136	24	structural	structural	JJ
cord-269720-o81j3d1j	136	25	proteins	protein	NNS
cord-269720-o81j3d1j	136	26	.	.	.
cord-269720-o81j3d1j	137	1	Comparisons	comparison	NNS
cord-269720-o81j3d1j	137	2	of	of	IN
cord-269720-o81j3d1j	137	3	nucleic	nucleic	NNS
cord-269720-o81j3d1j	137	4	and	and	CC
cord-269720-o81j3d1j	137	5	amino	amino	NN
cord-269720-o81j3d1j	137	6	acid	acid	NN
cord-269720-o81j3d1j	137	7	sequences	sequence	NNS
cord-269720-o81j3d1j	137	8	from	from	IN
cord-269720-o81j3d1j	137	9	the	the	DT
cord-269720-o81j3d1j	137	10	viruses	virus	NNS
cord-269720-o81j3d1j	137	11	will	will	MD
cord-269720-o81j3d1j	137	12	provide	provide	VB
cord-269720-o81j3d1j	137	13	a	a	DT
cord-269720-o81j3d1j	137	14	more	more	RBR
cord-269720-o81j3d1j	137	15	accurate	accurate	JJ
cord-269720-o81j3d1j	137	16	method	method	NN
cord-269720-o81j3d1j	137	17	for	for	IN
cord-269720-o81j3d1j	137	18	grouping	group	VBG
cord-269720-o81j3d1j	137	19	the	the	DT
cord-269720-o81j3d1j	137	20	viruses	virus	NNS
cord-269720-o81j3d1j	137	21	.	.	.
cord-269720-o81j3d1j	138	1	It	-PRON-	PRP
cord-269720-o81j3d1j	138	2	will	will	MD
cord-269720-o81j3d1j	138	3	be	be	VB
cord-269720-o81j3d1j	138	4	interesting	interesting	JJ
cord-269720-o81j3d1j	138	5	to	to	TO
cord-269720-o81j3d1j	138	6	compare	compare	VB
cord-269720-o81j3d1j	138	7	the	the	DT
cord-269720-o81j3d1j	138	8	leader	leader	NN
cord-269720-o81j3d1j	138	9	sequences	sequence	NNS
cord-269720-o81j3d1j	138	10	of	of	IN
cord-269720-o81j3d1j	138	11	bovine	bovine	JJ
cord-269720-o81j3d1j	138	12	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	138	13	(	(	-LRB-
cord-269720-o81j3d1j	138	14	BCV	BCV	NNP
cord-269720-o81j3d1j	138	15	)	)	-RRB-
cord-269720-o81j3d1j	138	16	,	,	,
cord-269720-o81j3d1j	138	17	which	which	WDT
cord-269720-o81j3d1j	138	18	is	be	VBZ
cord-269720-o81j3d1j	138	19	serologically	serologically	RB
cord-269720-o81j3d1j	138	20	related	relate	VBN
cord-269720-o81j3d1j	138	21	to	to	IN
cord-269720-o81j3d1j	138	22	HCV	HCV	NNP
cord-269720-o81j3d1j	138	23	(	(	-LRB-
cord-269720-o81j3d1j	138	24	OC43	OC43	NNP
cord-269720-o81j3d1j	138	25	)	)	-RRB-
cord-269720-o81j3d1j	138	26	and	and	CC
cord-269720-o81j3d1j	138	27	MHV	MHV	NNP
cord-269720-o81j3d1j	138	28	(	(	-LRB-
cord-269720-o81j3d1j	138	29	A59	A59	NNP
cord-269720-o81j3d1j	138	30	and	and	CC
cord-269720-o81j3d1j	138	31	JHM	JHM	NNP
cord-269720-o81j3d1j	138	32	)	)	-RRB-
cord-269720-o81j3d1j	138	33	,	,	,
cord-269720-o81j3d1j	138	34	with	with	IN
cord-269720-o81j3d1j	138	35	feline	feline	JJ
cord-269720-o81j3d1j	138	36	infectious	infectious	JJ
cord-269720-o81j3d1j	138	37	peritonitis	peritonitis	NN
cord-269720-o81j3d1j	138	38	virus	virus	NN
cord-269720-o81j3d1j	138	39	(	(	-LRB-
cord-269720-o81j3d1j	138	40	FIPV	FIPV	NNP
cord-269720-o81j3d1j	138	41	)	)	-RRB-
cord-269720-o81j3d1j	138	42	and	and	CC
cord-269720-o81j3d1j	138	43	canine	canine	JJ
cord-269720-o81j3d1j	138	44	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	138	45	(	(	-LRB-
cord-269720-o81j3d1j	138	46	CCV	CCV	NNP
cord-269720-o81j3d1j	138	47	)	)	-RRB-
cord-269720-o81j3d1j	138	48	,	,	,
cord-269720-o81j3d1j	138	49	which	which	WDT
cord-269720-o81j3d1j	138	50	are	be	VBP
cord-269720-o81j3d1j	138	51	serologically	serologically	RB
cord-269720-o81j3d1j	138	52	related	relate	VBN
cord-269720-o81j3d1j	138	53	to	to	IN
cord-269720-o81j3d1j	138	54	TGEV	TGEV	NNP
cord-269720-o81j3d1j	138	55	,	,	,
cord-269720-o81j3d1j	138	56	once	once	IN
cord-269720-o81j3d1j	138	57	their	-PRON-	PRP$
cord-269720-o81j3d1j	138	58	sequences	sequence	NNS
cord-269720-o81j3d1j	138	59	have	have	VBP
cord-269720-o81j3d1j	138	60	been	be	VBN
cord-269720-o81j3d1j	138	61	determined	determine	VBN
cord-269720-o81j3d1j	138	62	.	.	.
cord-269720-o81j3d1j	139	1	The	the	DT
cord-269720-o81j3d1j	139	2	large	large	JJ
cord-269720-o81j3d1j	139	3	variation	variation	NN
cord-269720-o81j3d1j	139	4	in	in	IN
cord-269720-o81j3d1j	139	5	sequence	sequence	NN
cord-269720-o81j3d1j	139	6	length	length	NN
cord-269720-o81j3d1j	139	7	and	and	CC
cord-269720-o81j3d1j	139	8	content	content	NN
cord-269720-o81j3d1j	139	9	made	make	VBD
cord-269720-o81j3d1j	139	10	the	the	DT
cord-269720-o81j3d1j	139	11	alignment	alignment	NN
cord-269720-o81j3d1j	139	12	of	of	IN
cord-269720-o81j3d1j	139	13	the	the	DT
cord-269720-o81j3d1j	139	14	different	different	JJ
cord-269720-o81j3d1j	139	15	leader	leader	NN
cord-269720-o81j3d1j	139	16	sequences	sequence	NNS
cord-269720-o81j3d1j	139	17	difficult	difficult	JJ
cord-269720-o81j3d1j	139	18	.	.	.
cord-269720-o81j3d1j	140	1	However	however	RB
cord-269720-o81j3d1j	140	2	,	,	,
cord-269720-o81j3d1j	140	3	alignment	alignment	NN
cord-269720-o81j3d1j	140	4	of	of	IN
cord-269720-o81j3d1j	140	5	the	the	DT
cord-269720-o81j3d1j	140	6	six	six	CD
cord-269720-o81j3d1j	140	7	different	different	JJ
cord-269720-o81j3d1j	140	8	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	140	9	revealed	reveal	VBD
cord-269720-o81j3d1j	140	10	that	that	IN
cord-269720-o81j3d1j	140	11	they	-PRON-	PRP
cord-269720-o81j3d1j	140	12	fell	fall	VBD
cord-269720-o81j3d1j	140	13	into	into	IN
cord-269720-o81j3d1j	140	14	two	two	CD
cord-269720-o81j3d1j	140	15	groups	group	NNS
cord-269720-o81j3d1j	140	16	.	.	.
cord-269720-o81j3d1j	141	1	There	there	EX
cord-269720-o81j3d1j	141	2	appears	appear	VBZ
cord-269720-o81j3d1j	141	3	to	to	TO
cord-269720-o81j3d1j	141	4	be	be	VB
cord-269720-o81j3d1j	141	5	some	some	DT
cord-269720-o81j3d1j	141	6	conservation	conservation	NN
cord-269720-o81j3d1j	141	7	of	of	IN
cord-269720-o81j3d1j	141	8	short	short	JJ
cord-269720-o81j3d1j	141	9	sequence	sequence	NN
cord-269720-o81j3d1j	141	10	motifs	motif	NNS
cord-269720-o81j3d1j	141	11	between	between	IN
cord-269720-o81j3d1j	141	12	the	the	DT
cord-269720-o81j3d1j	141	13	seven	seven	CD
cord-269720-o81j3d1j	141	14	leader	leader	NN
cord-269720-o81j3d1j	141	15	sequences	sequence	NNS
cord-269720-o81j3d1j	141	16	.	.	.
cord-269720-o81j3d1j	142	1	Toward	toward	IN
cord-269720-o81j3d1j	142	2	the	the	DT
cord-269720-o81j3d1j	142	3	3	3	CD
cord-269720-o81j3d1j	142	4	'	'	NN
cord-269720-o81j3d1j	142	5	end	end	NN
cord-269720-o81j3d1j	142	6	of	of	IN
cord-269720-o81j3d1j	142	7	the	the	DT
cord-269720-o81j3d1j	142	8	sequences	sequence	NNS
cord-269720-o81j3d1j	142	9	,	,	,
cord-269720-o81j3d1j	142	10	a	a	DT
cord-269720-o81j3d1j	142	11	TAG	tag	NN
cord-269720-o81j3d1j	142	12	motif	motif	NN
cord-269720-o81j3d1j	142	13	is	be	VBZ
cord-269720-o81j3d1j	142	14	conserved	conserve	VBN
cord-269720-o81j3d1j	142	15	in	in	IN
cord-269720-o81j3d1j	142	16	all	all	PDT
cord-269720-o81j3d1j	142	17	the	the	DT
cord-269720-o81j3d1j	142	18	leaders	leader	NNS
cord-269720-o81j3d1j	142	19	,	,	,
cord-269720-o81j3d1j	142	20	followed	follow	VBN
cord-269720-o81j3d1j	142	21	by	by	IN
cord-269720-o81j3d1j	142	22	a	a	DT
cord-269720-o81j3d1j	142	23	string	string	NN
cord-269720-o81j3d1j	142	24	of	of	IN
cord-269720-o81j3d1j	142	25	Ts	Ts	NNP
cord-269720-o81j3d1j	142	26	.	.	.
cord-269720-o81j3d1j	143	1	In	in	IN
cord-269720-o81j3d1j	143	2	five	five	CD
cord-269720-o81j3d1j	143	3	out	out	IN
cord-269720-o81j3d1j	143	4	of	of	IN
cord-269720-o81j3d1j	143	5	seven	seven	CD
cord-269720-o81j3d1j	143	6	of	of	IN
cord-269720-o81j3d1j	143	7	the	the	DT
cord-269720-o81j3d1j	143	8	sequences	sequence	NNS
cord-269720-o81j3d1j	143	9	,	,	,
cord-269720-o81j3d1j	143	10	this	this	DT
cord-269720-o81j3d1j	143	11	motif	motif	NN
cord-269720-o81j3d1j	143	12	is	be	VBZ
cord-269720-o81j3d1j	143	13	TAGANNTT	TAGANNTT	NNP
cord-269720-o81j3d1j	143	14	.	.	.
cord-269720-o81j3d1j	144	1	About	about	RB
cord-269720-o81j3d1j	144	2	ten	ten	CD
cord-269720-o81j3d1j	144	3	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	144	4	downstream	downstream	RB
cord-269720-o81j3d1j	144	5	of	of	IN
cord-269720-o81j3d1j	144	6	this	this	DT
cord-269720-o81j3d1j	144	7	region	region	NN
cord-269720-o81j3d1j	144	8	is	be	VBZ
cord-269720-o81j3d1j	144	9	a	a	DT
cord-269720-o81j3d1j	144	10	conserved	conserve	VBN
cord-269720-o81j3d1j	144	11	CT	CT	NNP
cord-269720-o81j3d1j	144	12	motif	motif	NN
cord-269720-o81j3d1j	144	13	,	,	,
cord-269720-o81j3d1j	144	14	which	which	WDT
cord-269720-o81j3d1j	144	15	is	be	VBZ
cord-269720-o81j3d1j	144	16	followed	follow	VBN
cord-269720-o81j3d1j	144	17	by	by	IN
cord-269720-o81j3d1j	144	18	a	a	DT
cord-269720-o81j3d1j	144	19	series	series	NN
cord-269720-o81j3d1j	144	20	of	of	IN
cord-269720-o81j3d1j	144	21	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	144	22	differing	differ	VBG
cord-269720-o81j3d1j	144	23	in	in	IN
cord-269720-o81j3d1j	144	24	number	number	NN
cord-269720-o81j3d1j	144	25	,	,	,
cord-269720-o81j3d1j	144	26	depending	depend	VBG
cord-269720-o81j3d1j	144	27	on	on	IN
cord-269720-o81j3d1j	144	28	the	the	DT
cord-269720-o81j3d1j	144	29	coronavirus	coronavirus	NN
cord-269720-o81j3d1j	144	30	,	,	,
cord-269720-o81j3d1j	144	31	followed	follow	VBN
cord-269720-o81j3d1j	144	32	by	by	IN
cord-269720-o81j3d1j	144	33	the	the	DT
cord-269720-o81j3d1j	144	34	postulated	postulate	VBN
cord-269720-o81j3d1j	144	35	RNA	RNA	NNP
cord-269720-o81j3d1j	144	36	polymerase	polymerase	NN
cord-269720-o81j3d1j	144	37	-	-	HYPH
cord-269720-o81j3d1j	144	38	leader	leader	NN
cord-269720-o81j3d1j	144	39	complex	complex	JJ
cord-269720-o81j3d1j	144	40	binding	binding	NN
cord-269720-o81j3d1j	144	41	site	site	NN
cord-269720-o81j3d1j	144	42	.	.	.
cord-269720-o81j3d1j	145	1	The	the	DT
cord-269720-o81j3d1j	145	2	largest	large	JJS
cord-269720-o81j3d1j	145	3	number	number	NN
cord-269720-o81j3d1j	145	4	of	of	IN
cord-269720-o81j3d1j	145	5	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	145	6	between	between	IN
cord-269720-o81j3d1j	145	7	the	the	DT
cord-269720-o81j3d1j	145	8	CT	CT	NNP
cord-269720-o81j3d1j	145	9	motif	motif	NN
cord-269720-o81j3d1j	145	10	and	and	CC
cord-269720-o81j3d1j	145	11	the	the	DT
cord-269720-o81j3d1j	145	12	consensus	consensus	NN
cord-269720-o81j3d1j	145	13	sequence	sequence	NN
cord-269720-o81j3d1j	145	14	are	be	VBP
cord-269720-o81j3d1j	145	15	found	find	VBN
cord-269720-o81j3d1j	145	16	on	on	IN
cord-269720-o81j3d1j	145	17	TGEV	TGEV	NNP
cord-269720-o81j3d1j	145	18	and	and	CC
cord-269720-o81j3d1j	145	19	PRCV	PRCV	NNP
cord-269720-o81j3d1j	145	20	,	,	,
cord-269720-o81j3d1j	145	21	the	the	DT
cord-269720-o81j3d1j	145	22	shortest	short	JJS
cord-269720-o81j3d1j	145	23	is	be	VBZ
cord-269720-o81j3d1j	145	24	found	find	VBN
cord-269720-o81j3d1j	145	25	on	on	IN
cord-269720-o81j3d1j	145	26	HCV	HCV	NNP
cord-269720-o81j3d1j	145	27	(	(	-LRB-
cord-269720-o81j3d1j	145	28	229E	229e	CD
cord-269720-o81j3d1j	145	29	)	)	-RRB-
cord-269720-o81j3d1j	145	30	and	and	CC
cord-269720-o81j3d1j	145	31	IBV	IBV	NNP
cord-269720-o81j3d1j	145	32	.	.	.
cord-269720-o81j3d1j	146	1	It	-PRON-	PRP
cord-269720-o81j3d1j	146	2	is	be	VBZ
cord-269720-o81j3d1j	146	3	interesting	interesting	JJ
cord-269720-o81j3d1j	146	4	to	to	TO
cord-269720-o81j3d1j	146	5	note	note	VB
cord-269720-o81j3d1j	146	6	that	that	IN
cord-269720-o81j3d1j	146	7	there	there	EX
cord-269720-o81j3d1j	146	8	is	be	VBZ
cord-269720-o81j3d1j	146	9	a	a	DT
cord-269720-o81j3d1j	146	10	five	five	CD
cord-269720-o81j3d1j	146	11	-	-	HYPH
cord-269720-o81j3d1j	146	12	base	base	NN
cord-269720-o81j3d1j	146	13	insert	insert	NN
cord-269720-o81j3d1j	146	14	in	in	IN
cord-269720-o81j3d1j	146	15	MHV	MHV	NNP
cord-269720-o81j3d1j	146	16	strain	strain	NN
cord-269720-o81j3d1j	146	17	JHM	JHM	NNP
cord-269720-o81j3d1j	146	18	when	when	WRB
cord-269720-o81j3d1j	146	19	compared	compare	VBN
cord-269720-o81j3d1j	146	20	to	to	IN
cord-269720-o81j3d1j	146	21	MHV	MHV	NNP
cord-269720-o81j3d1j	146	22	strain	strain	NN
cord-269720-o81j3d1j	146	23	A59	A59	NNP
cord-269720-o81j3d1j	146	24	,	,	,
cord-269720-o81j3d1j	146	25	which	which	WDT
cord-269720-o81j3d1j	146	26	is	be	VBZ
cord-269720-o81j3d1j	146	27	also	also	RB
cord-269720-o81j3d1j	146	28	present	present	JJ
cord-269720-o81j3d1j	146	29	in	in	IN
cord-269720-o81j3d1j	146	30	HCV	HCV	NNP
cord-269720-o81j3d1j	146	31	(	(	-LRB-
cord-269720-o81j3d1j	146	32	OC43	OC43	NNP
cord-269720-o81j3d1j	146	33	)	)	-RRB-
cord-269720-o81j3d1j	146	34	within	within	IN
cord-269720-o81j3d1j	146	35	this	this	DT
cord-269720-o81j3d1j	146	36	region	region	NN
cord-269720-o81j3d1j	146	37	.	.	.
cord-269720-o81j3d1j	147	1	All	all	PDT
cord-269720-o81j3d1j	147	2	the	the	DT
cord-269720-o81j3d1j	147	3	mammalian	mammalian	JJ
cord-269720-o81j3d1j	147	4	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	147	5	appear	appear	VBP
cord-269720-o81j3d1j	147	6	to	to	TO
cord-269720-o81j3d1j	147	7	have	have	VB
cord-269720-o81j3d1j	147	8	the	the	DT
cord-269720-o81j3d1j	147	9	motive	motive	NN
cord-269720-o81j3d1j	147	10	CTAAAC	ctaaac	NN
cord-269720-o81j3d1j	147	11	,	,	,
cord-269720-o81j3d1j	147	12	except	except	IN
cord-269720-o81j3d1j	147	13	HCV	HCV	NNP
cord-269720-o81j3d1j	147	14	(	(	-LRB-
cord-269720-o81j3d1j	147	15	OC43	OC43	NNP
cord-269720-o81j3d1j	147	16	)	)	-RRB-
cord-269720-o81j3d1j	147	17	,	,	,
cord-269720-o81j3d1j	147	18	which	which	WDT
cord-269720-o81j3d1j	147	19	has	have	VBZ
cord-269720-o81j3d1j	147	20	CTAAAT	CTAAAT	NNP
cord-269720-o81j3d1j	147	21	.	.	.
cord-269720-o81j3d1j	148	1	Recent	recent	JJ
cord-269720-o81j3d1j	148	2	sequence	sequence	NN
cord-269720-o81j3d1j	148	3	data	datum	NNS
cord-269720-o81j3d1j	148	4	suggest	suggest	VBP
cord-269720-o81j3d1j	148	5	that	that	IN
cord-269720-o81j3d1j	148	6	coronaviruses	coronaviruse	VBZ
cord-269720-o81j3d1j	148	7	FIPV	FIPV	NNP
cord-269720-o81j3d1j	148	8	and	and	CC
cord-269720-o81j3d1j	148	9	BCV	BCV	NNP
cord-269720-o81j3d1j	148	10	have	have	VBP
cord-269720-o81j3d1j	148	11	ACTAAAC	ACTAAAC	NNP
cord-269720-o81j3d1j	148	12	as	as	IN
cord-269720-o81j3d1j	148	13	their	-PRON-	PRP$
cord-269720-o81j3d1j	148	14	mRNA	mRNA	NNP
cord-269720-o81j3d1j	148	15	consensus	consensus	NN
cord-269720-o81j3d1j	148	16	sequence	sequence	NN
cord-269720-o81j3d1j	148	17	.	.	.
cord-269720-o81j3d1j	149	1	Upstream	upstream	RB
cord-269720-o81j3d1j	149	2	of	of	IN
cord-269720-o81j3d1j	149	3	the	the	DT
cord-269720-o81j3d1j	149	4	TAG	tag	NN
cord-269720-o81j3d1j	149	5	motif	motif	NN
cord-269720-o81j3d1j	149	6	there	there	EX
cord-269720-o81j3d1j	149	7	is	be	VBZ
cord-269720-o81j3d1j	149	8	an	an	DT
cord-269720-o81j3d1j	149	9	ACT	act	NN
cord-269720-o81j3d1j	149	10	motif	motif	NN
cord-269720-o81j3d1j	149	11	occurring	occur	VBG
cord-269720-o81j3d1j	149	12	in	in	IN
cord-269720-o81j3d1j	149	13	six	six	CD
cord-269720-o81j3d1j	149	14	out	out	IN
cord-269720-o81j3d1j	149	15	of	of	IN
cord-269720-o81j3d1j	149	16	seven	seven	CD
cord-269720-o81j3d1j	149	17	sequences	sequence	NNS
cord-269720-o81j3d1j	149	18	.	.	.
cord-269720-o81j3d1j	150	1	Toward	toward	IN
cord-269720-o81j3d1j	150	2	the	the	DT
cord-269720-o81j3d1j	150	3	5	5	CD
cord-269720-o81j3d1j	150	4	'	'	NN
cord-269720-o81j3d1j	150	5	end	end	NN
cord-269720-o81j3d1j	150	6	of	of	IN
cord-269720-o81j3d1j	150	7	the	the	DT
cord-269720-o81j3d1j	150	8	leader	leader	NN
cord-269720-o81j3d1j	150	9	RNA	RNA	NNP
cord-269720-o81j3d1j	150	10	sequences	sequence	NNS
cord-269720-o81j3d1j	150	11	,	,	,
cord-269720-o81j3d1j	150	12	the	the	DT
cord-269720-o81j3d1j	150	13	homologies	homology	NNS
cord-269720-o81j3d1j	150	14	are	be	VBP
cord-269720-o81j3d1j	150	15	patchy	patchy	JJ
cord-269720-o81j3d1j	150	16	and	and	CC
cord-269720-o81j3d1j	150	17	limited	limited	JJ
cord-269720-o81j3d1j	150	18	to	to	IN
cord-269720-o81j3d1j	150	19	short	short	JJ
cord-269720-o81j3d1j	150	20	matches	match	NNS
cord-269720-o81j3d1j	150	21	,	,	,
cord-269720-o81j3d1j	150	22	occurring	occur	VBG
cord-269720-o81j3d1j	150	23	only	only	RB
cord-269720-o81j3d1j	150	24	between	between	IN
cord-269720-o81j3d1j	150	25	pairs	pair	NNS
cord-269720-o81j3d1j	150	26	of	of	IN
cord-269720-o81j3d1j	150	27	sequences	sequence	NNS
cord-269720-o81j3d1j	150	28	.	.	.
cord-269720-o81j3d1j	151	1	The	the	DT
cord-269720-o81j3d1j	151	2	area	area	NN
cord-269720-o81j3d1j	151	3	upstream	upstream	RB
cord-269720-o81j3d1j	151	4	of	of	IN
cord-269720-o81j3d1j	151	5	the	the	DT
cord-269720-o81j3d1j	151	6	consensus	consensus	NN
cord-269720-o81j3d1j	151	7	sequence	sequence	NN
cord-269720-o81j3d1j	151	8	has	have	VBZ
cord-269720-o81j3d1j	151	9	been	be	VBN
cord-269720-o81j3d1j	151	10	suggested	suggest	VBN
cord-269720-o81j3d1j	151	11	to	to	TO
cord-269720-o81j3d1j	151	12	be	be	VB
cord-269720-o81j3d1j	151	13	involved	involve	VBN
cord-269720-o81j3d1j	151	14	in	in	IN
cord-269720-o81j3d1j	151	15	the	the	DT
cord-269720-o81j3d1j	151	16	binding	binding	NN
cord-269720-o81j3d1j	151	17	of	of	IN
cord-269720-o81j3d1j	151	18	nucleoprotein	nucleoprotein	NN
cord-269720-o81j3d1j	151	19	to	to	IN
cord-269720-o81j3d1j	151	20	the	the	DT
cord-269720-o81j3d1j	151	21	leader	leader	NN
cord-269720-o81j3d1j	151	22	RNA	RNA	NNP
cord-269720-o81j3d1j	151	23	sequence	sequence	NN
cord-269720-o81j3d1j	151	24	at	at	IN
cord-269720-o81j3d1j	151	25	nucleotides	nucleotide	NNS
cord-269720-o81j3d1j	151	26	56	56	CD
cord-269720-o81j3d1j	151	27	-	-	SYM
cord-269720-o81j3d1j	151	28	65	65	CD
cord-269720-o81j3d1j	151	29	in	in	IN
cord-269720-o81j3d1j	151	30	MHV	MHV	NNP
cord-269720-o81j3d1j	151	31	(	(	-LRB-
cord-269720-o81j3d1j	151	32	32	32	CD
cord-269720-o81j3d1j	151	33	)	)	-RRB-
cord-269720-o81j3d1j	151	34	.	.	.
cord-269720-o81j3d1j	152	1	It	-PRON-	PRP
cord-269720-o81j3d1j	152	2	was	be	VBD
cord-269720-o81j3d1j	152	3	suggested	suggest	VBN
cord-269720-o81j3d1j	152	4	that	that	IN
cord-269720-o81j3d1j	152	5	mRNA	mRNA	NNP
cord-269720-o81j3d1j	152	6	species	specie	NNS
cord-269720-o81j3d1j	152	7	and	and	CC
cord-269720-o81j3d1j	152	8	genomic	genomic	JJ
cord-269720-o81j3d1j	152	9	RNA	RNA	NNP
cord-269720-o81j3d1j	152	10	form	form	VBP
cord-269720-o81j3d1j	152	11	a	a	DT
cord-269720-o81j3d1j	152	12	complex	complex	NN
cord-269720-o81j3d1j	152	13	with	with	IN
cord-269720-o81j3d1j	152	14	the	the	DT
cord-269720-o81j3d1j	152	15	nucleoprotein	nucleoprotein	NNP
cord-269720-o81j3d1j	152	16	by	by	IN
cord-269720-o81j3d1j	152	17	the	the	DT
cord-269720-o81j3d1j	152	18	protein	protein	NN
cord-269720-o81j3d1j	152	19	binding	bind	VBG
cord-269720-o81j3d1j	152	20	to	to	IN
cord-269720-o81j3d1j	152	21	or	or	CC
cord-269720-o81j3d1j	152	22	near	near	IN
cord-269720-o81j3d1j	152	23	the	the	DT
cord-269720-o81j3d1j	152	24	leader	leader	NN
cord-269720-o81j3d1j	152	25	sequence	sequence	NN
cord-269720-o81j3d1j	152	26	attached	attach	VBN
cord-269720-o81j3d1j	152	27	to	to	IN
cord-269720-o81j3d1j	152	28	the	the	DT
cord-269720-o81j3d1j	152	29	RNA	RNA	NNP
cord-269720-o81j3d1j	152	30	molecules	molecule	NNS
cord-269720-o81j3d1j	152	31	(	(	-LRB-
cord-269720-o81j3d1j	152	32	33	33	CD
cord-269720-o81j3d1j	152	33	)	)	-RRB-
cord-269720-o81j3d1j	152	34	.	.	.
cord-269720-o81j3d1j	153	1	Secondary	secondary	JJ
cord-269720-o81j3d1j	153	2	structure	structure	NN
cord-269720-o81j3d1j	153	3	analysis	analysis	NN
cord-269720-o81j3d1j	153	4	of	of	IN
cord-269720-o81j3d1j	153	5	the	the	DT
cord-269720-o81j3d1j	153	6	leader	leader	NN
cord-269720-o81j3d1j	153	7	RNA	RNA	NNP
cord-269720-o81j3d1j	153	8	sequences	sequence	NNS
cord-269720-o81j3d1j	153	9	showed	show	VBD
cord-269720-o81j3d1j	153	10	that	that	IN
cord-269720-o81j3d1j	153	11	all	all	PDT
cord-269720-o81j3d1j	153	12	the	the	DT
cord-269720-o81j3d1j	153	13	sequences	sequence	NNS
cord-269720-o81j3d1j	153	14	except	except	IN
cord-269720-o81j3d1j	153	15	for	for	IN
cord-269720-o81j3d1j	153	16	IBV	IBV	NNP
cord-269720-o81j3d1j	153	17	possess	possess	VBP
cord-269720-o81j3d1j	153	18	a	a	DT
cord-269720-o81j3d1j	153	19	putative	putative	JJ
cord-269720-o81j3d1j	153	20	double	double	JJ
cord-269720-o81j3d1j	153	21	stem	stem	NN
cord-269720-o81j3d1j	153	22	-	-	HYPH
cord-269720-o81j3d1j	153	23	loop	loop	NN
cord-269720-o81j3d1j	153	24	structure	structure	NN
cord-269720-o81j3d1j	153	25	(	(	-LRB-
cord-269720-o81j3d1j	153	26	Fig	Fig	NNP
cord-269720-o81j3d1j	153	27	.	.	.
cord-269720-o81j3d1j	153	28	6	6	CD
cord-269720-o81j3d1j	153	29	)	)	-RRB-
cord-269720-o81j3d1j	153	30	.	.	.
cord-269720-o81j3d1j	154	1	In	in	IN
cord-269720-o81j3d1j	154	2	the	the	DT
cord-269720-o81j3d1j	154	3	case	case	NN
cord-269720-o81j3d1j	154	4	of	of	IN
cord-269720-o81j3d1j	154	5	the	the	DT
cord-269720-o81j3d1j	154	6	mammalian	mammalian	JJ
cord-269720-o81j3d1j	154	7	coronaviruses	coronaviruse	NNS
cord-269720-o81j3d1j	154	8	,	,	,
cord-269720-o81j3d1j	154	9	the	the	DT
cord-269720-o81j3d1j	154	10	consensus	consensus	NN
cord-269720-o81j3d1j	154	11	sequences	sequence	NNS
cord-269720-o81j3d1j	154	12	and	and	CC
cord-269720-o81j3d1j	154	13	upstream	upstream	JJ
cord-269720-o81j3d1j	154	14	regions	region	NNS
cord-269720-o81j3d1j	154	15	of	of	IN
cord-269720-o81j3d1j	154	16	homology	homology	NN
cord-269720-o81j3d1j	154	17	are	be	VBP
cord-269720-o81j3d1j	154	18	on	on	IN
cord-269720-o81j3d1j	154	19	the	the	DT
cord-269720-o81j3d1j	154	20	second	second	JJ
cord-269720-o81j3d1j	154	21	stem	stem	NN
cord-269720-o81j3d1j	154	22	-	-	HYPH
cord-269720-o81j3d1j	154	23	loop	loop	NN
cord-269720-o81j3d1j	154	24	structure	structure	NN
cord-269720-o81j3d1j	154	25	,	,	,
cord-269720-o81j3d1j	154	26	leaving	leave	VBG
cord-269720-o81j3d1j	154	27	the	the	DT
cord-269720-o81j3d1j	154	28	possibility	possibility	NN
cord-269720-o81j3d1j	154	29	that	that	IN
cord-269720-o81j3d1j	154	30	the	the	DT
cord-269720-o81j3d1j	154	31	RNA	RNA	NNP
cord-269720-o81j3d1j	154	32	-	-	HYPH
cord-269720-o81j3d1j	154	33	dependent	dependent	JJ
cord-269720-o81j3d1j	154	34	RNA	RNA	NNP
cord-269720-o81j3d1j	154	35	polymerase	polymerase	NN
cord-269720-o81j3d1j	154	36	could	could	MD
cord-269720-o81j3d1j	154	37	interact	interact	VB
cord-269720-o81j3d1j	154	38	with	with	IN
cord-269720-o81j3d1j	154	39	the	the	DT
cord-269720-o81j3d1j	154	40	first	first	JJ
cord-269720-o81j3d1j	154	41	stem	stem	NN
cord-269720-o81j3d1j	154	42	-	-	HYPH
cord-269720-o81j3d1j	154	43	loop	loop	NN
cord-269720-o81j3d1j	154	44	structure	structure	NN
cord-269720-o81j3d1j	154	45	.	.	.
cord-269720-o81j3d1j	155	1	The	the	DT
cord-269720-o81j3d1j	155	2	IBV	IBV	NNP
cord-269720-o81j3d1j	155	3	consensus	consensus	NN
cord-269720-o81j3d1j	155	4	sequence	sequence	NN
cord-269720-o81j3d1j	155	5	is	be	VBZ
cord-269720-o81j3d1j	155	6	present	present	JJ
cord-269720-o81j3d1j	155	7	on	on	IN
cord-269720-o81j3d1j	155	8	the	the	DT
cord-269720-o81j3d1j	155	9	free	free	JJ
cord-269720-o81j3d1j	155	10	3	3	CD
cord-269720-o81j3d1j	155	11	'	'	NN
cord-269720-o81j3d1j	155	12	end	end	NN
cord-269720-o81j3d1j	155	13	of	of	IN
cord-269720-o81j3d1j	155	14	the	the	DT
cord-269720-o81j3d1j	155	15	single	single	JJ
cord-269720-o81j3d1j	155	16	stem	stem	NN
cord-269720-o81j3d1j	155	17	-	-	HYPH
cord-269720-o81j3d1j	155	18	loop	loop	NN
cord-269720-o81j3d1j	155	19	structure	structure	NN
cord-269720-o81j3d1j	155	20	,	,	,
cord-269720-o81j3d1j	155	21	possibly	possibly	RB
cord-269720-o81j3d1j	155	22	leaving	leave	VBG
cord-269720-o81j3d1j	155	23	the	the	DT
cord-269720-o81j3d1j	155	24	single	single	JJ
cord-269720-o81j3d1j	155	25	stem	stem	NN
cord-269720-o81j3d1j	155	26	-	-	HYPH
cord-269720-o81j3d1j	155	27	loop	loop	NN
cord-269720-o81j3d1j	155	28	structure	structure	NN
cord-269720-o81j3d1j	155	29	to	to	TO
cord-269720-o81j3d1j	155	30	interact	interact	VB
cord-269720-o81j3d1j	155	31	with	with	IN
cord-269720-o81j3d1j	155	32	the	the	DT
cord-269720-o81j3d1j	155	33	polymerase	polymerase	NN
cord-269720-o81j3d1j	155	34	.	.	.
cord-269720-o81j3d1j	156	1	Virus	virus	NN
cord-269720-o81j3d1j	156	2	Infections	infection	NNS
cord-269720-o81j3d1j	156	3	of	of	IN
cord-269720-o81j3d1j	156	4	Vertebrates	Vertebrates	NNPS
cord-269720-o81j3d1j	156	5	(	(	-LRB-
cord-269720-o81j3d1j	156	6	eds	eds	NNP
cord-269720-o81j3d1j	156	7	)	)	-RRB-
cord-269720-o81j3d1j	156	8	Coronaviruses	Coronaviruses	NNP
cord-269720-o81j3d1j	156	9	Molecular	Molecular	NNP
cord-269720-o81j3d1j	156	10	Cloning	cloning	NN
cord-269720-o81j3d1j	156	11	:	:	:
cord-269720-o81j3d1j	157	1	A	a	DT
cord-269720-o81j3d1j	157	2	Laboratory	Laboratory	NNP
cord-269720-o81j3d1j	157	3	Manual	Manual	NNP
cord-269720-o81j3d1j	158	1	We	-PRON-	PRP
cord-269720-o81j3d1j	158	2	thank	thank	VBP
cord-269720-o81j3d1j	158	3	Miss	Miss	NNP
cord-269720-o81j3d1j	158	4	K.	K.	NNP
cord-269720-o81j3d1j	158	5	Mawditt	Mawditt	NNP
cord-269720-o81j3d1j	158	6	,	,	,
cord-269720-o81j3d1j	158	7	of	of	IN
cord-269720-o81j3d1j	158	8	this	this	DT
cord-269720-o81j3d1j	158	9	laboratory	laboratory	NN
cord-269720-o81j3d1j	158	10	,	,	,
cord-269720-o81j3d1j	158	11	for	for	IN
cord-269720-o81j3d1j	158	12	synthesizing	synthesize	VBG
cord-269720-o81j3d1j	158	13	oligos	oligo	NNS
cord-269720-o81j3d1j	158	14	38	38	CD
cord-269720-o81j3d1j	158	15	and	and	CC
cord-269720-o81j3d1j	158	16	58	58	CD
cord-269720-o81j3d1j	158	17	and	and	CC
cord-269720-o81j3d1j	158	18	Dr.	Dr.	NNP
cord-269720-o81j3d1j	158	19	S.	S.	NNP
cord-269720-o81j3d1j	158	20	F.	F.	NNP
cord-269720-o81j3d1j	158	21	Cartwright	Cartwright	NNP
cord-269720-o81j3d1j	158	22	,	,	,
cord-269720-o81j3d1j	158	23	Central	Central	NNP
cord-269720-o81j3d1j	158	24	Veterinary	Veterinary	NNP
cord-269720-o81j3d1j	158	25	Laboratory	Laboratory	NNP
cord-269720-o81j3d1j	158	26	,	,	,
cord-269720-o81j3d1j	158	27	Weybridge	Weybridge	NNP
cord-269720-o81j3d1j	158	28	for	for	IN
cord-269720-o81j3d1j	158	29	PRCV	PRCV	NNP
cord-269720-o81j3d1j	158	30	strains	strain	VBZ
cord-269720-o81j3d1j	158	31	86/137004	86/137004	CD
cord-269720-o81j3d1j	158	32	and	and	CC
cord-269720-o81j3d1j	158	33	86/135308	86/135308	CD
cord-269720-o81j3d1j	158	34	.	.	.
cord-269720-o81j3d1j	159	1	This	this	DT
cord-269720-o81j3d1j	159	2	work	work	NN
cord-269720-o81j3d1j	159	3	was	be	VBD
cord-269720-o81j3d1j	159	4	supported	support	VBN
cord-269720-o81j3d1j	159	5	by	by	IN
cord-269720-o81j3d1j	159	6	a	a	DT
cord-269720-o81j3d1j	159	7	research	research	NN
cord-269720-o81j3d1j	159	8	contract	contract	NN
cord-269720-o81j3d1j	159	9	from	from	IN
cord-269720-o81j3d1j	159	10	the	the	DT
cord-269720-o81j3d1j	159	11	Biomolecular	Biomolecular	NNP
cord-269720-o81j3d1j	159	12	Engineering	Engineering	NNP
cord-269720-o81j3d1j	159	13	Programme	Programme	NNP
cord-269720-o81j3d1j	159	14	of	of	IN
cord-269720-o81j3d1j	159	15	the	the	DT
cord-269720-o81j3d1j	159	16	Commission	Commission	NNP
cord-269720-o81j3d1j	159	17	of	of	IN
cord-269720-o81j3d1j	159	18	the	the	DT
cord-269720-o81j3d1j	159	19	European	European	NNP
cord-269720-o81j3d1j	159	20	Communities	Communities	NNPS
cord-269720-o81j3d1j	159	21	,	,	,
cord-269720-o81j3d1j	159	22	contract	contract	NN
cord-269720-o81j3d1j	160	1	No	no	UH
cord-269720-o81j3d1j	160	2	.	.	.
cord-269720-o81j3d1j	160	3	BAP-0235-UK(HI	BAP-0235-UK(HI	NNP
cord-269720-o81j3d1j	160	4	)	)	-RRB-
cord-269720-o81j3d1j	160	5	.	.	.