key: cord- - zmvlmk authors: wang, jinshan; wang, fenghua; tan, yusheng; chen, xia; zhao, qi; fu, sheng; li, shuang; chen, cheng; yang, haitao title: crystallization and preliminary crystallographic study of feline infectious peritonitis virus main protease in complex with an inhibitor date: - - journal: acta crystallographica section f structural biology communications doi: . /s x sha: doc_id: cord_uid: zmvlmk feline infectious peritonitis virus (fipv) causes a lethal systemic granulomatous disease in wild and domestic cats around the world. currently, no effective vaccines or drugs have been developed against it. as a member of the genus alphacoronavirus, fipv encodes two polyprotein precursors required for genome replication and transcription. each polyprotein undergoes extensive proteolytic processing, resulting in functional subunits. this process is mainly mediated by its genome-encoded main protease, which is an attractive target for antiviral drug design. in this study, the main protease of fipv in complex with a michael acceptor-type inhibitor was crystallized. the complex crystals diffracted to . Å resolution and belonged to space group i , with unit-cell parameters a = . , b = . , c = . Å. there is one molecule per asymmetric unit. feline coronaviruses (fcovs), which belong to the genus alphacoronavirus of the subfamily coronavirinae, are the leading pathogen of felidae around the world (horzinek & osterhaus, ) . fcovs have two antigenically distinct serotypes: type i and type ii (balint, farsang, szeredi et al., ) . both serotypes occur in two pathotypes: feline enteric coronavirus (fecv) and feline infectious peritonitis virus (fipv). fecv mainly replicates in the lower portion of the intestinal tract, spreads by the faecal-oral route, and presents clinically as mild or inapparent enteritis (pedersen et al., ; herrewegh et al., ; . on the other hand, fipv efficiently replicates in macrophages/monocytes, leading to feline infectious peritonitis (fip), a highly lethal systemic granulomatous disease of wild and domestic cats (addie et al., ; pedersen, ; balint, farsang, szeredi et al., ; kipar & meli, ) . fip, as an immune-mediated disease, features the antibody-dependent enhancement (ade) phenomenon (weiss & scott, ; vennema et al., ; tirado & yoon, ) . the virus-specific antibodies induced upon infection by fipv in cats do not protect them, but enhance the infection by fipv and thus accelerate the disease symptoms (weiss & scott, ; vennema et al., ; tirado & yoon, ; takano et al., ) . hence, there has been little progress in the development of clinical vaccines against fipv, although a variety of methods have been tried, such as avirulent vaccines, attenuated live fipv vaccines and recombinant vaccines (pedersen, ) . like other coronaviruses, fipv contains a single-stranded positivesense polyadenylated rna genome that encodes two large polyproteins (pp a and pp ab) which need to be processed into nonstructural proteins (nsp - ) for genome replication (dye & siddell, ) . this process is mediated by two virus-encoded proteinases. nsp , also named main protease (m pro ), is responsible for out of cleavage sites, thus playing a pivotal role in this digestion process and being indispensable for viral replication (dye & siddell, ) . the critical role of nsp in virus replication makes it an ideal target for anti-fipv drug design (yang et al., ; anand et al., ) . to date, several crystal structures of other coronavirus main proteases have been solved (anand et al., yang et al., yang et al., , hilgenfeld, ) . based on the structural analysis of these main proteases, the idea of designing wide-spectrum inhibitors against covs has been proposed. in this study, we report the crystallization the coding sequence for fipv main protease was synthesized and was cloned into the vector pgex- p- using the bamhi and xhoi restriction sites (table ). the recombinant plasmid was verified by sequencing and then transformed into escherichia coli strain bl (de ) for protein expression. cultures were grown in lb medium containing . mg ml À ampicillin at k until the optical density at nm reached . . isopropyl -d- -thiogalactopyranoside was then added to a final concentration of . mm and the cultures were induced to express fipv main protease at k for h. thereafter, centrifugation was used to harvest the cells and the bacterial pellets were resuspended in pbs ( mm nacl, mm na hpo , . mm kcl, . mm kh po ph . ) supplemented with mm dithiothreitol (dtt) and % glycerol. after sonication at k, the bacterial lysate was centrifuged at g for min at k and the precipitate was discarded. the supernatant was loaded onto a disposable column containing glutathione sepharose b affinity resin (pharmacia) to purify the gst-tagged fipv main protease. the fusion protein was then subjected to on-column cleavage using commercial prescission protease (pharmacia) at k for h. the protease was added to a final concentration of . mg ml À for proteolysis in pbs. five additional residues (gplgs) were left at the n-terminus of fipv main protease. the resulting protein of interest was further purified by anion-exchange chromatography using a hitrap q column (ge healthcare) with a linear gradient from to mm nacl in mm tris-hcl ph . , % glycerol, mm dtt and reached more than % purity by sds-page analysis (fig. a) . the purified protein was immediately supplemented with % dmso and concentrated to mg ml À . the previously reported inhibitor n (yang et al., ) , dissolved in % dmso to a final concentration of mm as a stock, was added to the purified protein to give a molar ratio of between : and : . after mixing at c for h, the protein complex was centrifuged at g for min and exchanged into a buffer consisting of mm hepes ph . , mm nacl, mm dtt using thermo icon concentrators. the final protein was concentrated to mg ml À for crystallization. in the initial stage, commercial screening kits, including crystal screen, crystal screen , peg/ion and index (hampton research, laguna niguel, california, usa), were used to screen for preliminary crystallization conditions for fipv main protease with the inhibitor n . table macromolecule-production information. (fig. b) . the crystallization information is summarized in table . the crystals were cryoprotected in a solution consisting of . m zinc acetate dihydrate, . m sodium cacodylate trihydrate ph . , %(w/v) polyethylene glycol , % glycerol and were then mounted in a nylon loop and flash-cooled in a nitrogen stream at k. data were collected using an adsc q r detector on beamline bl u of the shanghai synchrotron radiation facility (ssrf) at a wavelength of . Å . a complete data set was collected from a single crystal which diffracted to . Å resolution (fig. ) . all intensity data were indexed, integrated and scaled with the hkl- package (otwinowski & minor, ) . the related data-collection and processing statistics are summarized in table . fip, which is mainly caused by fipv, is a lethal systemic granulomatous disease of cats around the world (addie et al., ; pedersen, ; balint, farsang, szeredi et al., ; kipar & meli, ) . however, upon virus infection the induced antibodies further enhance the infection instead of neutralizing the virus. this is the so-called 'antibody-dependent enhancement' (weiss & scott, ; vennema et al., ; tirado & yoon, ) . thus, no clinical vaccines against fipv have been successfully developed to date. for this reason, the fipv main protease, which is indispensable for virus replication, is an alternative target for antiviral therapy and has been subjected to crystallographic studies. fipv main protease was expressed as a gst-tagged protein, digested using commercial prescission protease (pharmacia) and was then purified using anion-exchange chromatography on a hitrap q column. the final protein used for crystallization trials reached greater than % purity as monitored by sds-page. crystals could be obtained from condition no. of crystal screen. the optimized crystals diffracted to a highest resolution of . Å using . m zinc acetate dihydrate, . m sodium cacodylate trihydrate ph . , %(w/v) polyethylene glycol , % glycerol as a cryoprotectant. the crystal belonged to space group i , with unit-cell parameters a = . , b = . , c = . Å . based on the molecular weight of the monomer, the matthews coefficient (matthews, ) was calculated to be . Å da À and the solvent content was . %, assuming the presence of one molecule per asymmetric unit. a typical diffraction pattern of an fipv main protease complex crystal collected on beamline bl u of the shanghai synchrotron radiation facility (ssrf). the edge of the frame is at . Å resolution. the box shows diffraction spots in the outer resolution shell. proc. natl acad. sci. usa antivirals against fip.we would like to thank zuokun lu for his help with data collection on beamline bl u of the shanghai synchrotron radiation facility (ssrf). this work was supported by the national natural science foundation of china ( ), the specialized research fund for the doctoral program of higher education of china ( ) and tianjin municipal natural science foundation (general program: jcybjc ). key: cord- -kllqjn authors: woods, roger d.; wesley, ronald d. title: cultivation techniques for animal coronaviruses: emphasis on feline infectious peritonitis virus, canine coronavirus, transmissible gastroenteritis virus, and porcine hemagglutinating encephalomyelitis virus date: journal: j tissue cult methods doi: . /bf sha: doc_id: cord_uid: kllqjn techniques are described for the growth and characterization of some mammalian coronaviruses. because of the fastidious nature of their growth requirements, most will replicate only in cells derived from the natural host or a closely related species. fetal cat cells are used to grow fipv, and porcine cells are used to grow tgev and hev. however, ccv will replicate in both feline and canine cells. although all four of these viruses prefer to replicate in a cell in the stationary phase of growth, fipv is able to replicate in an actively growing cell. each virus causes a cytopathic effect in monolayer cell cultures under agar or media to h postinfection. primary isolation of each virus from field specimens is difficult, although most can usually be isolated after to blind passages in the cell culture. the coronaviridae family of viruses has a worldwide distribution. these viruses cause economically important diseases in man and in domestic and laboratory animals { ). at the present time the group consists of recognized viruses and or more unclassified isolates. the viruses and their abbreviations are listed in table . these viruses comprise four distinct antigenic groups plus a miscellaneous group ( ) . generally these viruses infect epithelial cells of the respiratory tract [human coronavirus (hcv), infectious bronchitis virus (ibv), rat coronavirus (rcv), porcine respiratory coronavirus (pcv)] and epithelial cells of the gastrointestinal tract [bovine coronavirus (bcv), canine eoronavirus (ccv), transmissible gastroenteritis virus {tgev), turkey coronavirus (tcv), feline enteric coronavirus (fecv), human enteric coronavirus (hecv)]. in addition, feline infectious peritonitis virus tfipv), mouse hepatitis virus (mhv), rabbit coronavirus (rbcv), and hemagglutinating encephalomyelitis virus (hev) exhibit other tissue tropisms and alternate pathogenic mechanisms ( ) . the feline, murine, and avian coronaviruses will usually cause a mild or inapparent infection in adults, hut usually a severe diarrheal disease and often death in neonatal animals ( ) . basic studies on these viruses have been limited because of their fastidious growth in cell culture ( ) . most coronaviruses will grow only in cells derived from the natural host animal or in cells from a closely related species ( , ) . growth of hcv, hecv, and rbcv in cell culture is difficult, whereas (fig. c, d) . after cpe is observed, freeze each flask at -- ° c. when grown under these conditions, tgev will have a plaque titer of approximately x pfu/ml to h after inoculation, and hev will have a plaque titer of approximately x pfu/ml to h after inoculation. to study the pathogenesis and molecular biology of coronaviruses, it is beneficial to identify cell lines in which the viruses will grow to titers greater than x s pfu/ml, thus providing sufficient viral mass for molecular studies. at the present time, most of the animal coronaviruses have been adapted to cell culture ( , , }. the methods presented in this report are easy to reproduce and could be adapted by laboratories worldwide for in vitro growth of fipv, ccv, hev, and tgev. such procedures have been used to grow these viruses to titers ranging from about x pfu/ml for fipv ( ) to x pfu/ml for tgev ~ l although most coronaviruses can now be grown in cell culture, their primary isolation from field specimens is still difficult i }. no one isolation technique or method can be used for the entire group. probably the most successful isolation method is to blindly passage . -pm-filtered fluids to times in a host organ cell line known to support growth of suspected virus, until a cpe is observed. the use of monospecific fluorescent antibodies is recommended to follow in vitro growth of the virus and to confirm virus identity. several techniques have been used to enhance or improve the chances of isolating these viruses. some of these techniques include addition of pancreatin . %}, trypsin ( pg/ml}, or deae-dextran to cell culture media at the time of initial inoculation, maintaining a slightly acidic ph in the culture media, the use of primary cell cultures instead of secondary cultures, and incorporation of high titer hyperimmune antisera in the culture media to suppress the growth of contaminating viruses. coronavirus-induced cpe is dependent on the virus, cell line, and isolate. the cpe ranges from an inap-parent infection in persistently infected cell lines to nearly complete cell disruption with several cell cultureadapted viruses , ). in a typical coronavirusinfected cell culture the first sign of cpe will be the appearance of granular and refractile cells, followed by formation of enlarged rounded cells, ballooned cells, and finally the detachment of infected cells from the culture flask ). when grown under the conditions described, optimal viral titers are usually obtained when approximately % of the cell sheet is observed with cpe. both fipv and ccv induce a similar cpe in crfk ceils. thirty-six to h postinfection (pi), fipvinfected crfk cells are granular and refractile. over the next h small multinucleated ~ to nuclei~ cells are formed by fusion and then they detach from the flask ~. the cpe is focal and under . % agar-mem- % fbs, distinct plaques up to mm in diameter form in the cell sheet in to h. initial cpe in ccv-infected crfk appears within h and consist of granular, refractile, and amorphorus multinucleated tgreater than nuclei) cells. during the next to h the cpe will spread over the entire sheet producing numerous ballooned cells and finally infected cells detaching from the flask. under . % agar-mem, ccv will form distinct plaques . mm diameter within h ~ ). initial cpe produced by attenuated and virulent tgev in st cells is similar to that observed with fipv and ccv in crfk cells, whereas cpe produced by hev in spth cells is slightly different. sixteen to h pi, tgev infected st cells are granular, refractile, and greatly enlarged. over the next to h the infection will spread over the cell sheet, and with advancing infection the round cells become ballooned and detach from the flask. under . % agar-mem, attenuated tgev produces clear uniform plaques up to mm in diameter within h, whereas the virulent virus produces diffuse, irregular plaques approximately . to mm in diameter within h i , ). in to h pi. hev infected spth ceils the cpe will show small areas of syncytia, which are easily visible with an inverted microscope. over the next h the syncytia degenerates, producing syncytial debris in the culture medium and clear holes with an opaque irregular shape in the cell sheet ( ) . after disruption of the syncytia, ballooned structures appear and the formation of new syncytia is seldom observed. a hemadsorption plaque assay has been developed for titration of infectivity of hev t l the crfk cell line has been used for the primary isolation and growth of fipv. isolation of fipv from clinical specimens is very difficult using cell lines. however, virus can frequently be recovered if crfk cells are inoculated and blindly passaged to times in the presence of trypsin ( i. the incorporation of trypsin into the fipv growth medium enhances both the isolation and growth of fipv. the reason for this enhancement is unknown, but a similar observation has been recorded for bcv, ibv, and mhv t , ~. in addition to crfk cells, a fetal cat whole fibroblast (fcwf) cell line will support the growth of fipv, as well as fecv, ccv, and tgev ( , t, and corn-journal of tissue culture methods vol. , no. , parison of antigenic and serologic relatedness of the enteric coronaviruses was done in this cell line ~ ). one to three cell culture passages of virulent fipv in crfk or fcwf cells do not destroy its virulence for susceptible cats. a vaccine produced with a crfk cell culture attenuated strain was unable to protect cats against the original virulent strain, although vaccinated cats do develop a neutralizing antibody response t ). using cdna clones of cell-culture-adapted fipv, the complete nucleotide sequence of the fipv peplomer protein has been determined ( }. the crfk and a- ( ) cell lines can be used for the isolation and propagation of ccv. this virus will grow to a titer of x pfu/ml or higher in either cell line. in addition, ccv can be adapted to grow in fcwf and st cells. however, neither ccv nor fipv will grow on primary isolation in st cells, and this property may allow one to biologically differentiate these antigenically related coronaviruses. a single passage of ccv in crfk cells does not decrease the infectivity for the natural host; however, prolonged serial passage in any cell line may result in an attenuated virus that grows well in cell culture but is avirutent for dogs. a cellculture-adapted ccv vaccine has been prepared and provides dogs vaccinated either i.m. or s.c. with neutralizing antibodies that are protective against a virulent ccv challenge ( ) . the spth cell line can be used for the primaryisolation of virus from clinical specimens and for the in vitro growth of hev ( ~. although virus grown in cell culture is still infective for pigs, it is less virulent than field strains (w. l. mengeling, ames, ia, personal communication). no vaccine is currently available for this virus. the st cell line has been used for more than yr to grow tgev ). this cell line can be used for primary isolation of virus from clinical specimens and in vitro growth of tgev it }. virus from clinically positive animals will usually have a titer near )< s pfu/ml, and after or passages in st cells it may have a titer of to x l pfu/ml. passage of the virus in serum-free media in -d-old st cells at an moi of . produces a maximum virus titer to h postinoculation. subpassage of the virus under the same conditions in st cells that are less than d old or more than d old will produce a lower virus titer t }. cell-culture-adapted tgev is still infective for pigs after passages in st cells, but pig virulence is usually reduced after only l to passages in st cells. three tissue-cnlture-adapted, modified-live tgev vaccine strains are sold for use against virulent tgev in pregnant swine. two of the vaccine viruses are grown in porcine cell lines, and the source of the third vaccine virus is unknown. although the safety and ability of these vaccines to elicit virusneutralizing antibodies in pregnant swine has been proven, their efficacy has been questioned , ) . the complete nucleotide sequence of the three major structural proteins of tgev has been determined on cdna clones of attenuated virus grown in st cell culture ( , , , l o isolation of transmissible enteritis agent of turkeys in avian embryos propagation of hemagglutinating encephalomyelitis virus in porcine cell culture. zbi coronavirus and gastroenteritis in foals characterization of the virus of sialodaeryoadenitis of rats: a member of the coronavirus group establishment of a canine cell line: derivation, characterization and viral spectrum vaccination against transmissible gastroenteritis itge}: pros and cons the complete nueleotide sequence of avian infectious bronchitis virus: analysis of the polymerase-coding region structural polypeptides of coronavirus ibv development, characterization and viral susceptibility of a feline {fells catus~ renal cell line crfk) comparison of the morphology of three coronaviruses evaluating a canine coronavirus vaccine through antigen extinction and challenge studies local and systemic cell mediated immunity against transmissible gastroenteritis; an intestinal infection of swine characterization of a new coronavirus-like agent isolated from parrots replication of coronaviruses the nucleotide sequence of the peplomer gene of porcine transmissible gastroenteritis virus {tgev); comparison with the sequence of the peplomer protein of feline infectious peritonitis virus {fipv) critical epitopes in transmissible gastroenteritis virus neutralization sequence analysis of the porcine transmissible gastroenteritis coronavirus nucleocapsm protein nucleotide sequence of the porcine transmissible gastroenterltis coronavirus matrix protein gene isolation of transmissible gastroenteritis virus from pharyngeal swabs obtained from sows at slaughter overview: molecular biology of coronaviruses the genome of human coronavirus strain e studies on transmissible gastroenteritis of swine. ii. selected characteristics of a cytopathogenic virus common to five isolates from transmissible gastroenteritis neonatal ca[f diarrhoea; propagation, attenuation, and characterization of a coronavirus-like agent hemadsorption plaque assay for hemagglutinating encephalomyelitis virus characteristics of a coronavirus tstrain n} of pigs comparison of tgev vaccines an eight-year study of the viral agents of acute gastroenteritis in humans: ultrastructural observations and seasonal distribution with a major emphasis on coronavirus attempted immunization of cats against feline infectious peritonitis; using avirulent live virus or sublethal amounts of virulent virus infection studies in kittens using feline infectious peritonitis virus propagated in cell culture antigenic relationship of the feline infectious peritonitis virus to eoronaviruses of other species isolation of a porcine respiratory, non-enteric coronavirus related to transmissible gastroenteritis the predicted primary structure o| the peplomer protein e of the porcine coronavirus transmissible gastroenteritis virus comprehensive virology, rot. plaque assay and improved yield of human coronavirus in a human rhabdosarcoma cell line the structure and replication of coronaviruses the biology of coronaviruses relatedness of rabbit coronavirus to other coronaviruses transmissible gastroenteritis {tgei o! swine: effect of age of swine testes cell culture monolayers on plaque assays of tge virus enhancement of plaque formation and cell fusion of an enteric pathogenic coronavirus by trypsin treatment the molecular biology of eoronaviruses the biology and pathogenesis of coronaviruees small plaque variant transmissible gastroenteritis virus studies of enteric coronaviruses in a feline cell line key: cord- -j ywrl authors: barlough, j. e. title: cats, coronaviruses and coronavirus antibody tests date: - - journal: j small anim pract doi: . /j. - . .tb .x sha: doc_id: cord_uid: j ywrl feline infectious peritonitis and other coronavirus infections of cats are briefly reviewed. interpretation and applications of feline coronavirus antibody tests are described, and general recommendations are provided for practitioners. some of the major unresolved questions regarding coronavirus infections of cats are delineated. the coronaviruses are a large and widely distributed family of single-stranded ribonucleic acid viruses, and are important causes of respiratory and enteric disease, vasculitis, serositis, hepatitis, and encephalomyelitis in several avian and mammalian species (siddell et al., ) . feline infectious peritonitis virus (fipv), transmissible gastroenteritis virus (tgev) of swine. canine coronavirus (ccv), and human respiratory-tract coronaviruses of the e group together comprise an antigenic cluster of closely-related viruses within the coronaviridae family (pedersen, ward & mengeling, ) . in fact, the major structural polypeptides of fipv, tgev, and ccv are so similar antigenically that some regard these three agents as host-range mutants rather than as individual viral species (horzinek, lutz & pedersen, ) . in domestic and exotic cats, fipv is the aetiologic agent of a lethal disease-feline infectious peritonitis (fip)-characterized by fibrinous serositis, vasculitis, and formation of disseminated pyogranulomas (wolfe & griesemer. : montali & strandberg, hayashi et al., ) . serosal membranes, liver, kidneys, omentum, lungs, eyes, and central nervous system are commonly affected. the pathology is the result of complex immunologically mediated phenomena involving arthus-like antigen-antibody-complement interactions across vessel walls (jacobse-geels, daha & horzinek, , pedersen & boyle, ; weiss, dodds & scott, ; weiss & scott, a-c; hayashi, lshida & fujiwara, ) . recent studies have shown that some cats with either naturally or experimentally-acquired serum coronavirus antibody experience a more rapid, fulminating disease course following fipv exposure than do coronavirus antibody-negative cats receiving the same challenge dose (pedersen & boyle, ; weiss, dodds & scott, ; weiss & scott, a-c) . a potential state of antibody-mediated hypersensitivity thus exists in certain coronavirus antibodypositive cats challenged with fipv, with this antibody perhaps ( ) accelerating the uptake of fipv (in the form of immune complexes) into reticuloendothelial and polymorphonuclear cells, and ( ) promoting widespread destructive inflammatory reactions in blood vessel walls and tissues through immune complex deposition and complement activation (jacobse-geels, daha & horzinek, pedersen & boyle, ; weiss, dodds & scott, ; weiss & scott, a-c; hayashi et al., a hayashi et al., , . uptake of fipv into macrophages appears to be enhanced by impaired t lymphocyte function (hayashi et al., b) . in addition to fipv, cats are susceptible to natural infection with certain enteric coronaviruses which may or may not be variants of fipv (pedersen et al., ; mckiernan et al., ; dea, roy & elazhary, ) . these feline enteric coronaviruses (fecvs) can produce a range of effects from asymptomatic infection of the gastrointestinal tract to severe enteritis in kittens and adult cats. the nature of the relationship between fecvs and fipv is perhaps illuminated by the observation that certain fipv strains are capable of producing either fip or enteritis, or both (hayashi et al., , a . intestinal lesions can also be produced in newborn pigs by oral inoculation with virulent fipv (woods, cheville & gallagher, ) . it is thus possible that fecvs and fipv represent pathogenetic (rather than host-range) variants of a single coronavirus typevariants possessing, however, a relatively broad spectrum of virulence from asymptomatic infection to enteritis to lethal, disseminated fip (barlough, b) . reports indicate that at least two other coronaviruses in the fipv antigenic cluster can infect cats under experimental conditions: tgev, which produces an asymptomatic infection and is excreted in faeces for as long as three weeks post-exposure (reynolds & garwes, ) , and ccv, which also produces an asymptomatic infection and is excreted from the oropharynx for at least one week stoddart, baldwin & scott, ) . at present the frequency of infection of cats in nature with these two coronaviruses is not known. coronavirus e of human beings does not appear to replicate to any extent in experimentally-inoculated cats (barlough, a) . in fip, hypersensitization by coronavirus antibody is dependent upon the identity of the coronavirus(es) that originally incited the antibody response. thus, antibody arising from exposure to fipv or fecvs can hypersensitize (weiss, dodds & scott, ; pedersen & boyle, ; pedersen et al., ; weiss & scott, a-c) , while antibody resulting from exposure to tgev, ccv, or coronavirus e usually does not (witte et al., ; woods & pedersen, ; barlough, a; barlough et af., b; stoddart, baldwin & scott, ) . however, some sensitization due to a tgev strain apparently occurred in one report (toma et al., ) . it should be emphasized at this point that the mere presence of coronavirus antibody in an animal's serum does not mean that fip will ever develop in that animal in the future, even after repeated fipv exposure. fip is a relatively uncommon disease in nature, even in crowded cattery situations; the vast majority of coronavirus antibody-positive cats will never develop it. the factors that determine whether fip does develop following fipv exposure are multiple, probably including: dose and virulence of infecting virus strain; route of exposure; age and immune status at time of exposure; possibly genetic predisposition; concurrent viral infections (e.g., feline leukaemia virus); and adverse environmental influences, such as stress and overcrowding (scott, weiss & hoshino, ; barlough & weiss, ) . the route by which fipv is spread in nature is still unknown. however, it is most likely that initial infection results from ingestion and/or inhalation of the virus. virus is probably excreted into the environment by a number of routes: in oral and respiratory secretions, faeces, and possibly urine. close contact between cats usually is required for effective transmission of fipv, although the possibility of virus transmission in excreta and by other indirect methods (on clothing, bedding, feeding bowls, etc.) also exists. the potential for transmission by haematophagous arthropods is unknown. transmission across the placenta to the developing foetus, although suggested in the past (flagstad & larsen, ; pastoret & henroteaux, ) , has not yet been conclusively proven to occur. in common with many other enveloped viruses, fipv is quite unstable once outside its host, and is rapidly inactivated by many common detergents and disinfecting agents, such as sodium hypochlorite (bleach) (pedersen, ; barlough & weiss, ) . the clinical diagnosis of fip is made by evaluation of history and presenting signs and the results of supportive laboratory procedures . clinicopathologic and serologic procedures important in diagnosis include: analysis of thoracic and abdominal effusion (viscous, opaque, straw-coloured to yellow, specific gravity . to . , protein to g/dl, variable cell numbers, high fibrin content), haemogram, clinical chemistry profile, serum protein electrophoresis (hypergammaglobulinaemia), serum coronavirus antibody titre, and biopsy (when possible). it is important to remember that a biopsy is the only test procedure that can be used to definitively diagnosis fip in the living animal. explortory laparotomy with organ punch biopsy of affected tissues (especially liver, spleen, omentum, and mesenteric lymph node) is the preferred technique for collection of biopsy samples (percutaneous needle biopsy cannot be recommended owing to the friability of diseased organs and the potential for serious haemorrhage). similarly, complete necropsy examination with histologic evaluation of suitable tissues will provide a reliable diagnosis after death. any diagnosis of fip made in the absence of biopsy or necropsy examination must be considered presumptive. this is because of the large number of potential 'fip look-alike' diseases that can affect cats. these can include: lymphosarcoma and other tumours (especially those involving the liver, biliary tract, kidneys, or lungs), cardiomyopathy, pyothorax, chylothorax, septic peritonitis, hepatitis, internal abscessation, diaphragmatic hernia, pansteatitis, toxoplasmosis, cryptococcosis, and tuberculosis (barlough & weiss, ) . thus, in individual cases, clinicopathologic and serologic procedures will assist in ruling out possible diagnoses, but only biopsy or necropsy examination will definitively identify the fip disease process. laboratory test procedures for detection of coronavirus antibody in feline sera include biological assays such as virus neutralization (vn); non-biological, immunochemical techniques such as indirect immunofluorescence assay (ifa), enzyme-linked immunosorbent assay (elisa), and kinetics-based elisa (kela); and other methods such as agar gel immunodiffusion and passive haemagglutination , though the availability of such tests varies worldwide. either fipv itself or one of the other coronaviruses in the fipv antigenic cluster (usually tgev or ccv) can be used as the target antigen in most of these assays. the use of non-fipv coronaviruses in antibody-testing procedures has become popular in recent years because of long-standing difficulties in routinely propagating fipv in the laboratory. in general, the immunochemical tests (especially the ifa) have gained the greatest popularity among veterinary diagnostic laboratories, in part because of their relative ease of performance and widespread availability of the pertinent immunotechnologies. it has been proposed on the basis of serosurvey data that most fipv infections in nature result only in seroconversion without progression to lethal, disseminated fip ). this is because serum coronavirus antibody can be found not only in cats with fip but also in many healthy cats and in many cats with other diseases, indicating that exposure of cats to coronavirus(es) is much more widespread than was once believed. in the general healthy feline population-excluding cats in catteries and multiple-cat householdsapproximately to per cent of cats will have positive coronavirus antibody titres (note: 'positive' refers only to the presence of antibody, not to the presence of the fip disease process). a special situation is encountered when cats are clustered together in catteries, in which case positive titres are either completely absent (i.e., there has been no coronavirus exposure), or are present in to per cent of the cats within a household (indicating efficient spread of virus once it has been introduced). the occurrence of coronavirus antibody in a cattery does not necessarily correlate with its fip history; e.g., antibody has been found in healthy cats in catteries that have experienced death losses to fip as well as in catteries that have never lost a cat to fip. most cats with histopathologically confirmed fip have serum coronavirus antibody, often of high titre . because many cats with undiagnosed illnesses also have elevated titres (indicating previous coronavirus exposure), interpretation of their titres may be difficult. added complexity has been contributed to interpretation of coronavirus antibody titres in healthy cats and in cats with undiagnosed illnesses by the finding that other coronaviruses (e.g., fecv, and experimentally tegv and ccv) can also infect cats and generate coronavirus antibodv in their sera. because these viruses are all serologically cross-reactive with each other and with fipv, and because several of them are used relatively interchangeably in commercially available coronavirus antibody tests, the non-specificity of these tests is readily apparent. the serodiagnostic potential of these assays (i.e., their ability to identify cats with active fip and/or potential virus carriers/excretors) is thus limited not only by the widespread distribution of serum coronavirus antibody in the feline population, but also by the possibility that non-fipv coronaviruses may be responsible for some of the seroconversions that they detect. the actual distribution of antibodies in the general feline population to each of these coronaviruses is therefore unknown, and will remain unknown until highly specific assays capable of differentiating antibody against one coronavirus (e.g. fipv) from antibody against another (e.g., tgev) are developed. these difficulties are compounded further by the plethora of test procedures (i.e., ifa, vn, elisa, kela) employed by different laboratories, and by the absence of standardization of testing protocols. results are therefore best interpreted in the light of specific information provided by the testing laboratory utilized, on the significance of titre levels generated by the individual test that it performs. effect of recent vaccination. recent research has shown that antibody against bovine serum components can be found in the serum of certain cats-antibody capable of reacting with antigenically similar bovine serum components present in cell cultures used to propagate target viruses for immunochemical assays such as the ifa, elisa, and kela . because such serum components can adhere tightly to both cells and virus (johansson, bergquist & grandien, ; kraaijeveld, madge & macnaughton, ; , reactivity against them can be mistaken for a coronavirus antibody response unless feline serum samples are tested in parallel against uninfected cell culture control preparations . one possible explanation for the presence of this reactivity is routine vaccination. owing to the frequent presence of extraneous cell culture material in many partially purified commercial biologicals, routine parenteral vaccination would seem to provide an ideal opportunity for vaccinees to respond immunologically not only to vaccine virus but also to immunogenic elements of cell culture medium, such as bovine serum proteins (bonin, schmidt & schmidt, ; johansson, bergquist & grandien, ; tizard, ; barlough et al., , a barlough et al., , snyder, eernisse & erickson, ) . kela studies have shown that this reactivity dissipates with time, and that the probability of encountering it can be minimized if serum samples for elective serotesting are drawn no sooner than three to four months following the most recent parenteral vaccination . the presence of serum coronavirus antibody in any cat, whether healthy or diseased, is indicative of only one thing: previous exposure to a coronavirus in the fipv antigenic group. a positive coronavirus antibody titre, while consistent with a clinical diagnosis of fip, does not indicate that a cat actually has fip, because many healthy cats and many cats with other diseases are also coronavirus antibody-positive. neither, however, does a positive titre indicate that a cat is protected against fip, because most cats with fip also are coronavirus antibody-positive. considering that fip occurs only sporadically in the general feline population, and that most cats in fip-problem households are coronavirus antibody-positive and yet do not contract fip, it would appear that many cats (perhaps most cats) with coronavirus antibody are protected against the natural disease. the question remains whether it is coronavirus antibody that actually confers this protection or whether unrecognized cellular immunologic factors are involved. it is especially important to realize that present-day coronavirus antibody tests have absolutely no predictive value; i.e., a positive titre in no way indicates that a cat is doomed to develop fip at some uncertain future date. despite all the problems with current feline coronavirus antibody testing methods, there are still some select situations in which determination of antibody titres can be of benefit to the veterinary surgeon and to the cat owner ): ( i ) as a screening test, to determine the presence or absence of antibody in a previously untested household, and to detect potential virus carriers/excretors when introducing new cats into coronavirus antibody-negative households. based on our current understanding of feline coronaviral serology, screening would appear to be the major use for coronavirus antibody testing today. screening of cats in a household experiencing undiagnosed disease problems may be especially useful. only about to per cent of the cats (a minimum of three) in such a household need to be tested, because antibody will be either totally absent or present in to per cent of the animals (scott, weiss & hoshino, ) . while the discovery of coronavirus antibody-positive cats in such households will not diagnose the problem, knowledge that coronavirus antibody is absent may be helpful in ruling out an fipv-group coronavirus as the aetiologic culprit. ( ) as an aid (and nothing more than an aid) in the clinical diagnosis of a diseased cat with signs suggestive of fip. a coronavirus antibody titre determination should be given no more weight than any of the other routine procedures used in arriving at a clinical diagnosis. a positive titre will not diagnose fip, but a negative titre will usually rule it out. coronavirus antibody-negative fip cases. a very small percentage of cats with fip do not have detectable coronavirus antibody in their sera. several explanations for this phenomenon are possible: ( ) detectable antibody may sometimes disappear from the circulation during the terminal stages of the disease. submission of serum from some moribund cats thus may result in a negative titre determination despite the presence of disseminated fip (barlough, ) . ( ) immune-complexing is an important immunopathologic feature of fip. in certain cases, if extensive immune complexing is present at the time of testing, it is conceivable that there may be little free, unbound coronavirus antibody available to be detected. this 'cloaking effect' may in fact be the explanation, at least in part, for the absence of detectable antibody in the serum of some moribund cats. ( ) the swiftness of the fip disease process is an important factor, especially in animals without previous coronavirus exposure. cats experiencing a peracute disease course (such as some young kittens) may display a rather sluggish antibody response that can be more difficult to detect in the earlier stages, especially if a non-fipv coronavirus (tgev, ccv) is used by the laboratory for antibody detected. although serologically cross-reactive with fipv, these viruses nevertheless are different from fipv and thus are not as sensitive as fipv at detecting lower levels of specific anti-fipv antibody. a test-and-removal programme for coronavirus antibody-positive cats similar to that utilized for feline leukaemia virus-positive cats, based upon current scientific information, cannot be recommended (scott, ; barlough & weiss, ) . because there is no available serodiagnostic .test that can differentiate between antibody-positive cats with fip, antibody-positive cats with diseases other than f p, or 'fip-immune' seropositive cats, that can specifically identify antibodypositive cats that are excreting fipv, or that can even identify the exact coronavirus(es) against which the antibodies in seropositive cats were raised, there is no known medical reason for destroying these animals. there is no recognized environmental reservoir of fipv; the natural reservoir is assumed to be infected cats. how, then, does the virus maintain itself in these animals? for how long do infected cats harbour the virus? for how long do they excrete the virus, and by what route(s)? what route is most important for effective virus transmission to other cats? is excretion continuous or intermittent? is it possibly stress-related? what percentage of cats infected with fipv actually become chronic carriers? to what extent is a coronavirus antibody-positive cat a potential disease threat to other cats with which it may come into contact? can an infected queen infect her kittens in utero? if so, does in utero infection result in disease? clearly, further research will be required before these questions and others can be satisfactorily resolved. importantly, an antigen detection test for identifying carrier animals that are excreting fipv, similar to those currently available for feline leukaemia virus infection, is urgently needed so that rational flpv control procedures can be devised. until then, control must be based on isolation of cats with suspected fip and maintenance of coronavirus antibody-negative catteries, when possible. euthanasia of coronavirus antibody-positive cats to achieve this latter purpose, however, cannot be justijied. this work was supported by unrestricted contributions to the cornell feline health center. the author wishes to thank mr h. e. carter and an anonymous scrutineer for their helpful suggestions. unpublished data experimental studies with four coronaviruses in cats serodiagnostic aids and management practice for feline retrovirus and coronavirus infections feline infectious peritonitis feline coronaviral serology evaluation of a computer-assisted, kinetics-based enzyme-linked immunosorbent assay for detection of coronavirus antibodies in cats experimental inoculation of cats with canine coronavirus and subsequent challenge with feline infectious peritonitis virus effect of recent vaccination on feline coronavirus antibody test results calf serum content of various viral vaccines and possibilities for its reduction coronavirus-like particles in the feces of a cat with diarrhea the occurrence of feline infectious peritonitis in denmark glomerulonephritis associated with feline infectious peritonitis systemic vascular lesions in feline infectious peritonitis enteritis due to feline infectious peritonitis virus role of thymus-dependent lymphocytes and antibodies in feline infectious peritonitis after oral infection role of neutrophils in production of early enteritis after oral infection with feline infectious peritonitis virus in passively sensitized kittens antigenic relationships among homologous structural polypeptides of porcine, feline, and canine coronaviruses isolation and characterization of feline c and evidence for the immune complex pathogenesis of feline infectious peritonitis antibody, immune complexes and complement activity fluctuations in kittens with experimentally induced feline infectious peritonitis antibodies to calf serum as a cause of unwanted reaction in immunofluorescence tests isolation of feline coronaviruses from two cats with diverse disease manifestations ) extraperitoneal lesions in feline infectious peritonitis ) epigenetic transmission of feline infectious peritonitis morphologic and physical characteristics of feline infectious peritonitis virus and its growth in autochthonous peritoneal cell cultures antigenic relationship of the feline infectious peritonitis virus to coronaviruses of other species ( ) virus isolation and serum antibody responses after infection of cats with transmissible gastroenteritis virus fip antibody test-interpretation and recommendations feline infectious peritonitis ) a preliminary report on two sources of nonspecificity in the enzyme-linked immunosorbent assay (elisa) unpublished data an introduction to veterinary immunology echec de l'immunisation contre la peritonite infectieuse feline par injection de virus de la gastro-enterite transmissible du porc laboratory diagnosis of feline infectious peritonitis pathogenesis of feline infectious peritonitis: nature and development of viremia i lb) antibody-mediated enhancement of disease in feline infectious peritonitis: comparisons with dengue hemorrhagic fever pathogenesis of feline infectious peritonitis: pathologic changes and immunofluorescence disseminated intravascular coagulation in experimentally induced feline infectious peritonitis untersuchungen uber die antigenverwandtschaft der wren der felinen infektiosen peritonitis (fip) und der transmissiblen gastroenteritis (tge) des schweines lesions in the small intestine of newborn pigs inoculated with porcine, feline, and canine coronaviruses cross-protection studies between feline infectious peritonitis and porcine transmissible gastroenteritis viruses key: cord- -bv dh eu authors: möstl, karin title: coronaviridae, pathogenetic and clinical aspects: an update date: - - journal: comparative immunology, microbiology and infectious diseases doi: . / - ( ) - sha: doc_id: cord_uid: bv dh eu abstract a review is given about pathogenetic and clinical aspects of the well-known as well as of recently detected members of the family coronaviridae. special attention is paid to coronavirus infections of domestic cattle and pets, whereas avian, murine, rat and human coronaviruses are summarized briefly. coronaviruses represent a large family of mammalian and avian pathogens, first described in [ ] . as several members of this virus group are known to cause economically important diseases, much effort was put into research during the last years. special reviews cover the replication strategy of coronaviruses [ ] , their glycoproteins [ ] and their structure and genome expression [ ] . the recent detection of previously unknown coronaviruses or mutants, like the "porcine epidemic diarrhea"-virus (pedv) and the tge-like "porcine respiratory coronavirus" (prcv) on one hand and new knowledge about pathogenetic mechanisms, for example in fipv-infections, on the other hand are the basis for this review article. coronaviruses are pleomorphic particles with a diameter of - nm, possessing typical club-shaped spikes. their physicochemical and biological properties and antigenic relationships were reviewed by wege et al. [ ] . antigenically they are grouped into classes: however, highly sensitive techniques like immunoblotting revealed some discrepancies. an antigenic relationship was detected between a mhv strain and hcv- e, a mhv strain and ibv and between fipv and hev (see ref. [ ] ). while the antigenic classification of pedv still remains unclear, an antigenic cross-reaction at the nucleocapsid level between pedv and fipv was detected [ ] . there are three known porcine coronaviruses: transmissible gastroenteritis virus (tgev), porcine epidemic diarrhea virus (pedv) and hemagglutinating encephalomyelitis virus (hev). recently, a virus antigenically related to tgev spread through the european swine population. it infects only the respiratory tract and is therefore called "porcine respiratory coronavirus" (prcv) or "respiratory variant of tgev". transmissible gastroenteritis (tge) was first described by doyle and hutchings [ ] . the classical enteric variant of tgev is an enteropathogenic agent causing severe diarrhea. although swine of all ages are susceptible to infection, the most severe clinical symptoms are observed in newborn piglets reaching a mortality rate of about %. with increasing age the mortality rate declines due to age resistance and is very low in pigs over weeks of age. the virus usually enters by the oral route. it is able to resist the low ph of the gastric juices, reaches the small intestine and destroys the villous enterocytes causing atrophy of the villi. the resulting acute malabsorption syndrome is the consequence of a reduced enzymatic activity and cellular transport of nutrients and electrolytes of the damaged villous enterocytes. the replacement of villous epithelium in the small intestine is markedly accelerated in animals of weeks and older compared to newborn pigs. the young villous cells produce less virus resulting in an age-dependent resistance to tge [ ] . furthermore, an impaired lymphocyte cytotoxicity was found in newborn piglets and was accounted for the high susceptibility to tgev during the first weeks of life [ ] . the clinical signs in piglets usually are vomiting, followed by a watery yellowish diarrhea, loss in weight and dehydration. for details see pedersen [ ] . in animals younger than days death occurs about -- days after the onset of disease. in older pigs inappetence and diarrhea of short duration are observed, but subclinical infections also occur. sometimes lactating sows show severe clinical signs including vomiting, diarrhea, fever and agalactia. the incubation period varies between h and days. in a susceptible herd tgev spreads very rapidly to animals of all ages. this epizootic form usually lasts a few weeks, but may persist in an enzootic form, if susceptible animals are continually present [ ] . most sows of such herds are infected and thereafter provide passive immunity to their suckling piglets, which are protected to a variable degree. under such conditions diarrhea especially occurs after weaning [ ] . colostrum and milk of immune sows contain high titres of antibodies especially of the iga class (see ref. [ ] ), which protect piglets provided that the antibodies are in continual contact with the enterocytes of the gut mucosa. the term "lactogenic immunity" was coined by haelterman [ ] . active immunity is only acquired by gut infection resulting in the production of iga. sensitized lymphocytes migrate from the gut to the mammary gland leading to local iga production in lactating sows (gut-mammary immunologic link). after parenteral inoculation of tgev only antibodies of the igg class are produced, which mediate merely poor protection. in order to induce maternal immunity sows may be infected with virulent tgev at least weeks ante partum (planned infection). gut material of piglets which died in the acute phase of tge is fed to sows. as this procedure includes some disadvantages such as the possible transmission of other pathogenic agents, much effort has been made in order to develop other effective vaccination procedures in pregnant sows. none has proved satisfactory (see ref. [ ] ). however, oral application of live, nonattenuated virus resulted in elevated titres of protective milk-antibodies for days after farrowing [ ] . for diagnosis tgev antigen can be detected by immunofluorescence in the small intestine of piglets at an early stage of disease, by virus isolation in tissue culture or by elisa. for serological investigations the neutralization test is frequently used because of its sensitivity and reliability. in a variant of tgev was isolated in belgium [ ] and great britain [ ] . as it causes a respiratory infection and does not replicate in the enteric tract, it was named "respiratory variant" of tgev [ ] and recently "porcine respiratory coronavirus". it spreads quickly in the swine population, probably by an aerogenic route, replicates in the nasal mucosa, trachea and lungs and usually does not cause clinical signs [ , ] . recent studies, however, demonstrated that the virus can cause pneumonia [ ] . antibodies produced in infected animals cannot be differentiated from antibodies against the classical tgev by serum neutralization test. this fact causes problems in the sectors of import and export certificates. recently, using monoclonal antibodies an antigenic difference was demonstrated between tgev and prcv concerning an alteration of the e protein portion [ ] . it is the basis for an elisa distinguishing between antibodies against the two variants of tgev. according to hooyberghs et al. [ ] prcv-seropositive sows do not mediate protection to their piglets against tgev-field infection, whereas bernard et al. [ ] described such a protection under experimental challenge conditions. diarrhea in pigs very similar to tge was described in great britain [ ] . a "coronavirus-like" agent was identified as causative virus in [ , ] , that was different from the other known porcine coronaviruses. it was named pedv, in germany the name "epizootische virusdiarrhoe" (evd) was proposed [ ] , in france vannier and debouck [ ] called it "diarrh e pid mique porcine" (d.e.p.). the pathogenesis of ped is very similar to that of tge. the epithelial cells both of the small and partly of the large intestine are destroyed resulting in villous shortening. after an incubation period of h the clinical signs consisting of diarrhea, vomiting and dehydration appear and are hard to differentiate from those of tge [ ] . contrarily to tge, weaned and feeder pigs are the most affected groups [ ] . in previously uninfected herds, however, ped may result in severe clinical disease in suckling piglets and mortality rates of up to %. in general, tge spreads more quickly in infected herds causing a more severe syndrome [ ] , but heinritzi et al. [ ] described that during the last years cases of tge, they often showed an altered clinical course, more and more similar to ped. very similar pathogenetic mechanisms of ped and tge cause the same immunological situation. protection against ped is based on intestinal mucosal immunity, which is limited to a short period after infection. lactogenic immunity, but not circulating antibodies are protective for suckling piglets. there are no vaccines available. for diagnosis virus antigen is detected by immunofluorescence (see ref. [ ] ) or by a blocking-elisa [ ] . hev was first isolated from the brain of a suckling piglet with encephalomyelitis [ ] . later a virus was detected in animals with vwd that was antigenically related to hev [ ] . mengeling and cutlip [ ] identified hev as a responsible agent for the encephalomyelitis as well as for vwd. the virus is probably transmitted through nasal secretions [ ] . it first replicates in the upper respiratory tract, in general without inducing clinical symptoms. subsequently it spreads via peripheral nerves to the central nervous system causing either encephalomyelitis or vwd. severe clinical signs are seen almost exclusively in piglets younger than weeks. after an incubation period of - days they show repeated vomiting, are listless and pale and huddle together. andries [ ] postulated that vomiting is caused by viral replication in the vagal sensory ganglion or by infected neurons affecting the vomiting center. in the course of encephalomyelitis generalized muscle tremors and hyperesthesia are commonly observed, sometimes blindness, opisthotonus and nystagmus occur. weakness is followed by coma and death is observed in most of the young animals. the wasting was assumed to be caused by a disturbance of stomach emptying [ ] . although hev is distributed worldwide among pig populations, clinical disease occurs seldom. as most sows are seropositive, their piglets are protected by maternal antibodies till an age-dependent resistance has developed. during the phase of passive immunity subclinical infections occur inducing an active immunity in pigs - weeks of age (see ref. [ ] ). in order to avoid clinical signs in piglets it is favorable to obtain immune sows at the time of farrowing. for diagnosis virus may be isolated from the tonsils, the brain and lungs of diseased piglets by cultivation in several tissue culture systems. for serological investigations the hemagglutination-inhibition-or seroneutralization-test are commonly used. a coronavirus-tike agent was detected in the feces of a calf with diarrhea [ , ] and characterized as coronavirus [ ] . bcv was recognized as an economically important infectious agent producing diarrhea in newborn calves. later it was identified to have a second tropism in being involved in respiratory disease in older calves [ ] . after peroral incorporation bcv infects villous and to some extent crypt enterocytes. following experimental inoculation lesions in the small intestine were observed similar to those described for tge in pigs [ ] . after an incubation period of - h severe, often watery diarrhea is observed [ ] . in some cases an extensive loss of water and ions causes death. in some investigations the highest incidence of coronavirus-induced diarrhea was found during the second and third weeks of life, whereas other authors observed the most severe cases during the first week of life (see ref. [ ] ). as a typical enteric viral infection, bovine coronavirus infection can be prevented by passive local immunity (lactogenic immunity), whereas no or limited protection is mediated by serum antibodies. the mammary secretions of seropositive dams contain specific coronavirus-antibodies, which, contrary to the swine, belong to igg as the major isotype [ ] . for effective protection these antibodies have to be continuously present in the calf's gut lumen. but contrary to monogastric animals in cattle elevated antibody titres are only present in the colostrum and decrease sharply upon transition to milk. in parallel, protection against enteric infections declines. many attempts were made to enhance lactogenic immunity against coronavirus as well as rotavirus, a pathogenetically very similarly acting enteric viral pathogen. in order to prolong the protective effect of colostral antibodies first-day colostrum of seropositive cows was fed to calves, which proved beneficial if originating from vaccinated dams [ ] , but not from field-infected cows [ ] . most efficacious, however, is active vaccination of cows late in pregnancy. as on premises with enzootic infections almost all cows possess antibodies, a booster reaction occurs after parenteral vaccination resulting in a more effective and longerlasting lactogenic immunity. the route and time of immunization, the adjuvant used and the viral dose and form (live or inactivated) are of remarkable influence (reviewed in ref. [ ] ). some authors demonstrated significantly enhanced antibody-titres in mammary secretions of intramuscularly vaccinated cows, whilst other authors did not (see ref. [ ] ). in our investigations significant increases were not found either, although remarkable protective effects were shown by clinical and virological parameters [ ] . attempts to immunize calves actively by the oral route were unsuccessful under field conditions because of interference with maternally-derived antibodies [ , ] . the involvement of bcv in respiratory tract affection was first described by thomas et al. [ ] . coronaviruses were isolated in calves with non-febrile rhinitis and cough [ ] as well as in cases of severe pneumonia [ ] . in the course of two outbreaks of respiratory disease both syndromes occurred in an enzootically infected herd [ ] . remarkably, calves with persisting maternal antibodies were not affected, whereas older calves whose titres had just decreased fell sick. investigations performed by reynolds et al [ ] indicated that enteric as well as respiratory infection was caused by a monotypic bcv. so it was assumed that active vaccination of older calves might prevent clinical disease on premises affected by the respiratory form of bcv [ ] . since enteric viral agents are difficult to propagate in cell cultures, diagnosis first was performed by electron microscopy. the development of an elisa permitted detection of rota-and coronavirus antigen in fecal samples [ ] . a disease syndrome consisting of inflammation of the visceral serosa and exudation into ihe body cavities, called feline infectious peritonitis (fip), was first described by wolfe and griesemer [ ] . montali and strandberg [ ] observed a second form, characterized by granulomatous inflammation in several parenchymatous organs. in order to differentiate the two forms the first one was called "wet" or "effusive", the second one "dry" or "noneffusive". a viral agent morphologically similar to other coronaviruses was demonstrated and later characterized as a member of the family coronaviridae (see ref. [ ] ). many years later a feline coronavirus was isolated from mild enteral infections and was called feline enteric coronavirus (fecv). it was shown to be very closely related to fipv [ ] . fipv is distributed worldwide, but compared to the high percentage of seropositive cats, clinical disease is observed relatively rarely. strains of feline coronaviruses vary greatly in infectivity and virulence and may either induce fip or enteritis. strains causing enteritis are very infectious and therefore widely distributed. they are of low pathogenicity but induce the production of circulating antibodies. fipv strains, however, vary extremely in infectivity and virulence and only some of them cause typical signs of fip [ ] . by using monoclonal antibodies two antigenic types of feline coronaviruses with marked difference in the peplomer (e ) glycoproteins were found [ ] . these two types correlated well with virulent or avirulent isolates. although there are a few cases described with evidence for in utero infection (see ref. [ ] ), the most frequent route of infection is probably the oral ingestion, followed by virus replication in the intestinal epithelium. whereas fecv strains do not spread wider than into the lymph nodes, fip-causing virus strains have a tropism for phagocytic cells. they replicate in macrophages and are disseminated by them. pedersen [ ] assumed that not only the properties of the infecting virus strain were responsible for the outcome of the disease, but that also the immunologic situation of the host and the type and degree of developing immunity may be of great importance. while humoral antibodies were shown to enhance the development of clinical disease (see ref. [ ] ), immunity to fip seems to be cell-mediated. pedersen [ ] proposed a scheme for the pathogenesis of fip: a strong humoral, but lacking cellular immunity is assumed to be responsible for development of effusive fip. strong humoral and weak cellular immunity may lead to noneffusive fip. a strong cellular immunity, however, may inhibit the development of disease. weiss and cox [ ] demonstrated delayed-type hypersensitivity-like reactions to fipv in the skin of cats which had remained asymptomatic after a previous challenge-exposure with fipv. the assumption is supported by the fact that cats having recovered from fipv infections and harboring the virus in a latent form often develop clinical fip after a coinfection with feline leukemia virus (felv), that mainly depresses the cellular immunity. in general a high percentage of cats with naturally occurring fip is coinfected with felv. after an incubation period of some weeks to months the clinical signs of fip-disease start with chronic fever, accompanied by a progressive decline in the general condition. effusive fip is characterized by peritonitis and ascites and/or pleuritis causing pleural effusion and dyspnea. the peritoneal and pleural fluids as well as the blood serum contain very high levels of protein, especially of the beta and gamma globulins (see ref. [ ] ), the visceral serosa of the abdomen and the thorax show pyogranulomatous lesions. in cats with noneffusive fip the clinical signs are variable depending on the affected organ systems, where typical granulomatous lesions have developed. frequently ocular and cns signs are observed. clinical illness lasts for - weeks (in cats with noneffusive form also for a longer period) and usually leads to death. contrary, infection with fecv remains subclinical in most cats or induces only mild diarrhea. pedersen et al. [ ] assumed that many cats are virus carriers shedding fecv in their feces and that often kittens are infected after weaning. after infection with feline coronaviruses antibodies appear in the serum of clinically ill cats as well as of animals remaining healthy. frequently, but not always, there are very high anti-fipv-titres in the diseased cats. these as well as non virus-specific globulines lead to a characteristic hypergammaglobulinemia. antibodies play an important role in the pathogenesis of fip by leading to the development of circulating immune complexes which are deposited in several organs. such immune complexes were shown to consist of viral antigen, igg and complement (see ref. [ ] ). horzinek and osterhaus [ ] justly interpreted fip as an immune-complex disease. the role of humoral antibodies in fip pathogenesis and the unknown mechanism of immunity result in the lack of an effective vaccine. immunization with attenuated as well as inactivated virus strains does not mediate protection but on the contrary enhances clinical disease following virus exposure. heterotypic vaccination with for example tgev was not protective against fipv challenge (see ref. [ ] ). recently, however, christianson et al. [ ] characterized a temperature sensitive fipv, which propagates at °c, but not at 'c. it is avirulent, replicates only in the upper respiratory tract and the authors described that this mutant is able to stimulate protective immune responses without inducing sensitization of the cat. furthermore, consistent vaccination against felv is expected to reduce the occurrence of clinical fip by eliminating the suppression of the cat's immune response towards fip caused by felv infections. although presently most of the cats which have developed clinical signs of fip will die, sometimes spontaneous remission is observed. there is no consistently effective treatment available. in some cats therapeutic success may be achieved by application of glucocorticosteroids because of their immunosuppresive effect, but in most cases the fatal course of the disease is only prolonged [ ] . as a diagnostic aid serological tests are used. a heterologous indirect immunofluorescence assay was developed by osterhaus et al. [ ] using tgev-infected cells as antigen, later elisas became commercially available. however, neither test allows differentiation between cats infected with fipv or fecv and between virus shedders and non-shedders. the test result often is helpful in ascertaining diagnosis in clinically sick cats, as animals with acute fip usually develop very high titres. on the other hand a significant decrease of titre may be observed in preterminal stages. unfortunately, relatively high titres may also occur in healthy cats with subclinical or latent infections. because of these difficulties interpretation of serological tests offers limited value to the clinician. the tests are, however, helpful for screening purposes and epidemiological investigations. recently, walter et al. [ ] reported a modified avidin-biotin-peroxidase-complexmethod in order to demonstrate viral antigens in paraffin sections of tissues of fipvinfected carcasses. epizootics caused by ccv were reported in germany [ ] and in u.s.a. [ ] . in most cases a mild gastroenteritis was the only symptom recorded, but especially in younger pups more severe signs of disease were observed. as indicated by serological investigations ccv is widespread within canine populations. in germany a seroprevalence of % was described [ ] , but only in % of diarrheic feces coronaviruses were detected [ ] . distress and several infectious agents aggravate clinical disease by contributing to the "canine enteritis complex" [ ] . after oral inoculation of ccv the enterocytes of the intestinal villi are infected leading to villous atrophy. as the infection does not spread further than to the mesenteric lymph nodes, no viremia occurs. after an incubation period of days clinical signs consist of diarrhea, vomiting, depression, anorexia and dehydration [ ] . similar to other typical enteric viral infections the local immunity of the gut appears to be responsible for protection [ ] . after infection with ccv low serum antibody titres develop that do not mediate immunity. a killed ccv vaccine is currently under investigation for its effectiveness (see ref. [ ] ). many different murine coronavirus strains have been described, the first one was isolated from a spontaneously paralyzed mouse [ ] . infections with mhv often take a subclinical or inapparent course. depending on the virus strain, the age of the affected animal, its genetic background and immunological situation, disease occurs resulting in acute fatal hepatitis or encephalomyelitis or enteritis. the infection of the nervous system takes place by invasion via the olfactory nerve after an initial replication in the nasal mucosa and is characterized by an acute or chronic demyelinating disease. enteropathogenic strains of mhv cause an acute intestinal disease with a high mortality rate during the first weeks of life. the aspects of infections with mhv were reviewed by wege et al. [ ] . two virus strains have been reported, the first infecting the respiratory tract and causing respiratory disease, especially during the first h of life. in animals older than -- days the course of the disease is mild or clinically inapparent [ ] . the second virus strain affects the salivary and lacrimal glands leading to sialodacryoadenitis with rhinitis [ ] . infectious bronchitis virus (ibv) is an economically important pathogen for the chicken raising industry. it causes respiratory disease, which was already described in [ ] and is distributed worldwide. at least serotypes of ibv have been described. after infection of the respiratory tract, usually by aerogenic spreading, the virus also replicates in the kidneys, the ovaries and oviduct. the clinical signs consist of tracheitis, bronchitis, decrease of egg production and egg quality. sometimes nephritis is observed. the most severe disease occurs in chickens up to an age of weeks with a mortality of - %, whereas in older animals ibv infection takes a milder course. for prophylactic purposes modified live vaccines are applicated by drinking-water. turkey coronavirus (tcv) was identified as the aetiologic agent of the transmissible enteritis of turkeys [ ] . while the infection takes a mild course in older animals, turkeys between and weeks of age develop depression, loss of appetite and weight and watery diarrhea. ensuing circulation disorders mediate the typical syndrome "bluecomb disease". the pathogenetic mechanisms are very similar to other enteric coronavirus infections resulting in villous atrophy. protection is only achieved by local immunity. for a comprehensive review of clinical signs, pathogenesis and immunology of avian coronaviruses see wege et al. [ ] . human coronaviruses are distributed worldwide. they infect the respiratory tract and are responsible for common colds [ ] , in children pneumonia may be observed. additionally, coronavirus-like particles were detected in diarrheal stool specimens from humans [ ] and primates [ ] . in the u.s.a. coronavirus-like particles were demonstrated in the feces of foals suffering from severe diarrhea [ ] . huang et al. [ ] isolated a coronavirus-like agent from horses suffering from acute equine diarrhea syndrome, called "potomac fever". horses of all ages were affected showing fever, inappetence and diarrhea followed by death in about % of the cases. coronaviruses show different organ tropisms, mainly resulting in three disease complexes: gastrointestinal disease, respiratory disease and generalized disease. the different pathogenetic mechanisms implicate distinct immunological situations. the important role of the local immunity in enteric infections has been well documented. in newborn animals protection by lactogenic immunity can be enhanced by vaccination of the dam quite successfully in the bovine and to a lesser extent in the sow. fipv-infections, however, are crucial at present with regard to prognosis as well as immunoprophylaxis. maybe virus mutants with specific tropisms will offer new aspects for vaccination, as for example prcv against tge and the ts-mutant against fip. coronavirus leader-rna-primed transcription: an alternative mechanism to rna splicing the novel glycoproteins ofcoronaviruses coronaviruses: structure and genome expression the biology and pathogenesis ofcoronaviruses porcine epidemic diarrhea virus (cv ) and feline infectious peritonitis virus (fipv) are antigenically related a transmissible gastroenteritis in pigs age-dependent resistance to transmissible gastroenteritis of swine antibody-dependent and spontaneous cell-mediated cytotoxicity against transmissible gastroenteritis virus infected cells by lymphocytes from sows, fetuses and neonatal piglets. ('an transmissible gastroenteritis virus (classical enteric variant) neue aspekte im klinischen verlauf der coronavirusinfektion der schweine lactogenic immunity to transmissible gastroenteritis of swine relationship among transmissible gastroenteritis virus antibody titers in serum, colostrum, and milk from vaccinated sows, and protection in their suckling pigs isolation of a porcine respiratory, non-enteric, coronavirus related to transmissible gastroenteritis new porcine coronavirus? transmissible gastroenteritis virus (respiratory variant) isolement, identification et pouvoir pathogene chez le pore d'un coronavirus apparent~ au virus de la gastro-enterite transmissible antigenic differentiation between transmissible gastroenteritis virus of swine and a related porcine respiratory coronavirus transmissible gastroenteritis: outbreaks in swine herds previously infected with a tgev-like porcine respiratory coronavirus natural infection with the porcine respiratory coronavirus induces protective lactogenic immunity against transmissible gastroenteritis an apparently new syndrome of porcine epidemic diarrhoea virus-like particles associated with porcine epidemic diarrhoea a new coronavirus-like particle associated with diarrhea in swine die epizootische virusdiarrhoe (evd) identification de la diarrh e pid mique porcine porcine epidemic diarrhea virus elisa for the detection of virus and antibodies in pigs with epidemic diarrhea a hemagglutinating virus producing encephalomyelitis in baby pigs vomiting and wasting disease of piglets pathogenicity of field isolants of hemagglutinating encephalomyelitis virus for neonatal pigs hemagglutinating encephalomyelitis virus vomiting and wasting disease" een virale infektie bij her varken. dissertation neonatal calf diarrhea: purification and electron microscopy of a coronavirus-like agent neonatal calf diarrhea: propagation, attenuation, and characteristics of a coronavirus-like agent characterization of a calf diarrheal coronavirus a search for new microorganisms in calf pneumonia by the inoculation of gnotobiotic calves scanning electron, light, and immunofluorescent microscopy of intestine of gnotobiotic calf infected with calf diarrheal coronavirus the nature of the local immune system of the bovine mammary gland diarrhoea in dairy calves reduced by feeding colostrum l¥om cows vaccinated with rotavirus enteric viral infections of calves and passive immunity reduction of rotavirus-, coronavirus-and e. coli-associated calf-diarrheas in a large-size dairy herd by means of dam vaccination with a triple-vaccine rotavirus infections in calves: efficacy of oral vaccination in endemically infected herds coronavirus infection of the bovine respiratory tract intervention du virus corona darts un cas de pneumonie chez des bovins chliche beteiligung boviner coronaviren an respiratorischen krankheitsausbrfichen bei kfilbern und pathogenetisch-immunologische dberlegungen hierzu studies on the relationship between coronaviruses from the intestinal and respiratory tracts of calves enzyme-linked immunosorbent assay for diagnosis of rotavirus infections in calves feline infectious peritonitis extraperitoneal lesions in feline infectious peritonitis feline infectious peritonitis virus an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis antigenic comparison of feline coronavirus isolates: evidence for markedly different peplomer glycoproteins evaluation of immunity to feline infectious peritonitis in cats with cutaneous viral-induced delayed hypersensitivity. vet. lmmun, lmmunpath the virology and pathogenesis of feline infectious peritonitis characterization of a temperature sensitive feline infectious peritonitis coronavirus seroepidemiology of feline infectious peritonitis virus infections using transmissible gastroenteritis virus as antigen eine modifikation der abc-methode (avidin-biotin-peroxidase-complex) ffir den nachweis von viralen antigenen bei der infektion der katze durch ein coronavirus (fip) und der lnfektion des hundes durch das parvovirus-typ recovery and characterization of a coronavirus from military dogs with diarrhea canine viral enteritis. i. status report on corona-and parvo-like viral enteritides elektronenmikroskopische nachweisrate enteraler viren bei durchfallkrankheiten von hund, katze, kalb, schwein und fohlen im jahr --elektronenmikroskopische untersuchungsbefunde update on canine coronavirus infections and interactions with other enteric pathogens of the dog canine coronavirus a murine virus ohm) causing disseminated encephalomyelitis with extensive destruction of myelin. i. isolation and biological properties of the virus rat coronavirus (rcv): a prevalent, naturally occurring pneumotropic virus of rats. arch. ges characterization of the virus of sialodacryoadenitis of rats: a member of the coronavirus group an apparently new respiratory disease of baby chicks electron microscopy of coronavirus-like particles characteristic of turkey bluecomb disease seroepidemiologic studies of coronavirus infection in adults and children coronavirus particles in faeces from patients with gastroenteritis enteric coronaviruses in primates coronavirus and gastroenteritis in foals isolation of coronavirus-like agent from horses suffering from acute equine diarrhoea syndrome key: cord- -fvq hezk authors: hornyák, Ákos; bálint, Ádám; farsang, attila; balka, gyula; hakhverdyan, mikhayil; rasmussen, thomas bruun; blomberg, jonas; belák, sándor title: detection of subgenomic mrna of feline coronavirus by real-time polymerase chain reaction based on primer-probe energy transfer (p-sg-qpcr) date: - - journal: j virol methods doi: . /j.jviromet. . . sha: doc_id: cord_uid: fvq hezk feline infectious peritonitis is one of the most severe devastating diseases of the felidae. upon the appearance of clinical signs, a cure for the infected animal is impossible. therefore rapid and proper diagnosis for both the presence of the causative agent, feline coronavirus (fcov) and the manifestation of feline infectious peritonitis is of paramount importance. in the present work, a novel real-time rt-pcr method is described which is able to detect fcov and to determine simultaneously the quantity of the viral rna. the new assay combines the m gene subgenomic messenger rna (sg-mrna) detection and the quantitation of the genome copies of fcov. in order to detect the broadest spectrum of potential fcov variants and to achieve the most accurate results in the detection ability the new assay is applying the primer-probe energy transfer (priproet) principle. this technology was chosen since priproet is very robust to tolerate the nucleotide substitutions in the target area. therefore, this technology provides a very broad-range system, which is able to detect simultaneously many variants of the virus(es) even if the target genomic regions show large scale of variations. the detection specificity of the new assay was proven by positive amplification from a set of nine different fcov strains and negative from the tested non-coronaviral targets. examination of faecal samples of healthy young cats, organ samples of perished animals, which suffered from feline infectious peritonitis, and cat leukocytes from uncertain clinical cases were also subjected to the assay. the sensitivity of the p-sg-qpcr method was high, since as few as genome copies of fcov were detected. the quantitative sg-mrna detection method revealed more than – , times increase of the m gene sg-mrna in organ materials of feline infectious peritonitis cases, compared to those of the enteric fcov variants present in the faeces of normal, healthy cats. these results indicate the applicability of the new p-sg-qpcr test as a powerful novel tool for the better detection and quantitation of fcov and for the improved diagnosis of feline infectious peritonitis, this important disease of the felidae, causing serious losses in the cat populations at a global scale. feline infectious peritonitis is one of the most severe devastating diseases of the felidae. upon the appearance of clinical signs, a cure for the infected animal is impossible. therefore rapid and proper diagnosis for both the presence of the causative agent, feline coronavirus (fcov) and the manifestation of feline infectious peritonitis is of paramount importance. in the present work, a novel real-time rt-pcr method is described which is able to detect fcov and to determine simultaneously the quantity of the viral rna. the new assay combines the m gene subgenomic messenger rna (sg-mrna) detection and the quantitation of the genome copies of fcov. in order to detect the broadest spectrum of potential fcov variants and to achieve the most accurate results in the detection ability the new assay is applying the primer-probe energy transfer (priproet) principle. this technology was chosen since priproet is very robust to tolerate the nucleotide substitutions in the target area. therefore, this technology provides a very broad-range system, which is able to detect simultaneously many variants of the virus(es) even if the target genomic regions show large scale of variations. the detection specificity of the new assay was proven by positive amplification from a set of nine different fcov strains and negative from the tested non-coronaviral targets. examination of faecal samples of healthy young cats, organ samples of perished animals, which suffered from feline infectious peritonitis, and cat leukocytes from uncertain clinical cases were also subjected to the assay. the sensitivity of the p-sg-qpcr method was high, since as few as genome copies of fcov were detected. the quantitative sg-mrna detection method revealed more than - , times increase of the m gene sg-mrna in organ materials of feline infectious peritonitis cases, compared to those of the enteric fcov variants present in the faeces of normal, healthy cats. these results indicate the applicability of the new p-sg-qpcr test as a powerful novel tool for the better detection and quantitation of fcov and for the improved diagnosis of feline infectious peritonitis, this important disease of the felidae, causing serious losses in the cat populations at a global scale. published by elsevier b.v. feline infectious peritonitis is currently the leading cause of infectious death among young domestic and wild felidae. the disease has a worldwide distribution, especially in cats originated from purebred catteries (pedersen, ; foley et al., ) . the causative agent of feline infectious peritonitis, feline coronavirus (fcov), belongs to the coronaviridae family within the order nidovirales (almeida and tyrell, ; siddell et al., ) . fcov, together with human, porcine, and canine coronaviruses is a member of alpha coronavirus genus (de groot et al., ) . regarding pathogenicity, fcov comprises two biotypes: the feline infectious peritonitis viruses (fipv) and the feline enteric coronaviruses (efcov). the existence of at least two serotypes of fcov (types i and ii) has been shown based on in vitro neutralisation assays using monoclonal antibodies. each serotype includes viruses of both the fipv and efcov biotypes (hohdatsu et al., a,b) . type i and ii viruses differ mainly in their in vitro growth characteristics, as the members of the serotype i can rarely if ever be propagated in cell-cultures. in the field, the prevalence of fcov type i appear to be higher, as approximately - % of feline infectious peritonitis cases are due to infection with type i viruses (hohdatsu et al., ; herrewegh et al., ; addie et al., ; kummrow et al., ) . biotype efcov is not a significant cause of morbidity in cats. it may produce mild enteritis, but most experimental or natural infections remain subclinical. it has been observed that the incidence of feline infectious peritonitis in a cat population is strongly correlated with the efcov → fipv mutation rate (vennema et al., ) . fipv causes a fulminant and fatal disease of cats with manifestations of anorexia, chronic fever, and malaise. in addition, ocular and neurological disorders can occasionally occur. there is a vital need to develop reliable and robust laboratory diagnostic method for the detection and identification of fipv biotype in all doubtful cases, considering the profoundly different biology and clinical consequences caused by the two biotypes of fcov. initially, the determination of antibody titre by indirect immune fluorescence method (burleson et al., ) served for diagnosis followed by the detection of viral rna from blood (kennedy et al., ) . the reliability of these diagnostic approaches were questioned due to the inconsequent correlation of the positive results and the disease outcome. simons et al. ( ) published a more sophisticated method, targeting subgenomic mrna (sg-mrna) production of the virus, detected by conventional rt-pcr. this method was supposed to detect only the intensively replicating viral biotype, since viral sg-mrnas are served to express the viral structural protein genes. however, the suitability of this test to detect fipv was questioned by can-sahna et al. ( ) on the basis of the high ratio of positive results obtained from the samples of clinically healthy cats. these observations indicate that an assay capable of fcov sg-mrna quantitation in the different organs and body fluids would be of very high importance, considering the fact that low-level virus replication occurs even in the case of efcov infection (herrewegh et al., ) , and hopefully the exact determination of the viral replication rate by measuring the viral sg-mrna level would be decisive for the establishment of a correct diagnosis (de groot-mijnes et al., ) . considering this important diagnostic need, a real-time sg-mrna detection and measuring system, termed p-sg-qpcr was developed, as a novel tool identification and quantitation of fcov in order to obtain an improved system for the reliable diagnosis of feline infectious peritonitis. the novel assay is based on the fret principle (förster resonance energy transfer; förster, ) and uses the primer-probe energy transfer (priproet) technology. this robust real-time pcr technology was previously successfully applied to detect a wide variety of viruses comprising vesicular disease viruses, hepatitis e virus, classical swine virus porcine reproductive and respiratory syndrome virus and porcine circovirus (rasmussen et al., ; hakhverdyan et al., ; bálint et al., ) . compared to the most wide-spread real-time pcr system, the taqman method, priproet is providing a higher flexibility in the detection of varying target nucleic acids. priproet is able to overcome multiple mutations located in the targeted region of the viral genome and to amplify a wide range of nucleic acids despite of the variations in the targeted regions (rasmussen et al., ) . this robust feature made the priproet technique suitable for the detection of the fcov, a highly variable rna virus. in this study, the robustness and flexibility of priproet was combined, providing a wide range detection of the virus variants, with the capability to quantitate subgenomic mrna, allowing the quantitative assessment of virus replication, thus the estimation of the development of feline infectious peritonitis. the quantitative realtime pcr (p-sg-qpcr) enabled us to detect and differentiate a wide range of closely related coronaviruses such as fcov, canine coronavirus (ccov) and transmissible gastroenteritis virus (tgev) and to estimate the tendency of virus replication in various organs, by a single method. thus, the p-sg-qpcr assay was found as a powerful novel tool for the improved diagnosis of feline infectious peritonitis. a collection of coronaviruses of human, feline, canine, porcine, bovine, murine and avian origin, summarised in table , was included in the specificity, sensitivity and reproducibility tests of the p-sg-qpcr assay. faecal samples from a total of healthy domesticated cats were collected in sweden in . small intestine, mesenteric lymph node, spleen, liver, lungs and kidney samples of nine diarrhoeic cats, previously diagnosed as fcov infected were also included in the tests. furthermore, a total of organ samples, seven body fluids, and four faecal samples obtained from swedish and five hungarian cats perished with feline infectious peritonitis. a collection of separated leukocyte samples obtained from clinically possible feline infectious peritonitis cases, collected in hungary between and , and was also subjected to molecular examination. diagnoses were achieved on the results of pathological, histopathological examinations and positive findings of immunohistology and gel based conventional rt-pcr for feline infectious peritonitis (kiss et al., ) . the genomic rna from all the above-mentioned samples was tested by the sybr green rt-qpcr described by escutenaire et al. ( ) , while the sg-mrna levels were examined by the p-sg-qpcr assay. approximately g pieces of the faecal samples and organs were homogenised in sterile ceramic mortars using sterile quartz sand. they were diluted in ml sterile phosphate-buffered saline (pbs), and then were centrifuged at × g for min to remove cell debris and bacterial contamination. the supernatant was collected and used for virus isolation and pcr. after homogenisation, samples were stored at − • c. feline leukocytes were purified from whole blood on histopaque- (sigma-aldrich, saint louis, mo, usa) according to the manufacturer's recommendations. the cells were resuspended in pbs to the original volume of the whole blood they originated from. one part of the sybr green positive specimens, including feline faecal samples collected from healthy cats and organ samples of five recently perished cats diagnosed with feline infectious peritonitis in sweden were subjected to standard virus isolation procedure in -well tissue culture plates (greiner bio-one gmbh, frickenhausen, germany), incubated for h at • c in a % co atmosphere. following two blind-passages, cells were scraped off in l supernatant, and examined by the genomic and subgenomic pcr assays described above to detect virus replication. strain fipv df- was grown in felis catus whole foetus cells (fcwf- ) in minimal essential medium (emem) (sigma-aldrich) containing mm l-glutamine, . g/l sodium bicarbonate, . mm non-essential amino acids, and . mm sodium pyruvate, supplemented with % foetal calf serum (fcs). three-day-old cell cultures were split into : ratio; the remaining cells were adjusted to a concentration of × cells/ml and plated into -well plates (greiner), incubated overnight at • c in a % co atmosphere. on the next day cells were infected with serial ten-fold dilutions of fipv df- , in four wells in parallel, incubated for h at • c allowing the virus to adsorb to the cell receptors and then the inoculates were replaced with emem containing % fcs. virus titre was determined on the basis of cytopathic effect (cpe) observed on the third day post inoculation by reed-muench method (reed and muench, ) . the titration was repeated three times under the same conditions. viral rna was isolated from cat and dog faecal samples, homogenised organ samples of perished cats and feline leukocytes with qiaamp viral mini kit (qiagen, hilden, germany) according to the manufacturer's recommendations. l of the % (w/v) suspension of organ and faeces homogenates, as well as the leukocyte suspension were diluted with l pbs before rna extraction. after extraction, the volume of eluted rna was complemented to l. the concentration of the extracted samples' total rna-s was between and ng/l. the highly conserved membrane (m) gene regions of feline, canine and one porcine coronaviruses were aligned with clustal x . program in order to design the reverse primer and probe capable of detecting both serotypes of fipv. the reverse primer was modified with a donor fluorophore ( carboxyfluorescein, fam) at the end. the subgenomic forward primer was designed to bind to the leader sequence of the coronaviral sequences available in the genbank. the probe was designed to bind upstream of the reverse primer without any nucleotide gap, and was labelled with a reporter fluorophore (texas red, txr) on its end, allowing the real-time detection of the bps long pcr product. gc content, stability, primer-dimer and hairpin formation were analysed by the oligo analyzer . (http://www.idtdna.com). primers and probe were synthesised and hplc purified by thermo electron gmbh (http://www.thermohybaid.de). sequences of the primers and probe are summarised in table . for performing the p-sg-qpcr assay the titanium tm one-step rt-pcr kit (clontech laboratories, palo alto, usa) was applied. the amplification reaction parameters (primer and magnesium concentration, annealing temperature and period, number of cycles, melting temperatures of the reference viruses) were optimised by titration of the different variables in order to achieve low cycle threshold (c t ) values and high fluorescence signal. after optimisation, the reaction mix was as follows: × one-step buffer, . mm dntps, nm forward primer, nm reverse primer labelled with fam, nm probe labelled with txr, u of recombinant rnase inhibitor, . rxn × titanium tm taq rt enzyme mix and l template rna in a total reaction volume of l. the themostabilizing reagent, the gc-melt tm , and the oligo (dt) primer were not included in the reaction mix to gain more intensive fluorescence signal. all reactions were run in the corbett research rotor-gene real time amplification system (rg- , corbett research, mortlake, nsw, australia), the thermal profile initiated with reverse transcription at • c for h, followed by initial denaturation at • c for min, and cycles of [ • c for s, • c for s, • c for s]. fluorescence signal data were collected for s after the primer annealing, where the wavelength of the source was - nm and the detector was nm. after cycling, melting point analysis was used to confirm the specificity of amplification at - • c with s holds at each elevation step of • c. the nine reference feline coronavirus strains, the three ccov strains; / , cb/ , / and porcine tge purdue strain were involved in the specificity tests. the melting point analysis reveals grouping of the viruses into four different genotypes in this very conserved region of the m gene. the four colours denote the four melting points of the genotypes. a positions refer to the genome of - fipv strain (ay ). b according to escutenaire et al. ( ) . positions refer to the genome of sars tor (ay ). the sensitivity of the system was determined by using known amounts of recombinant rna prepared from fipv df- as follows: conventional rt-pcr using qiagen one-step rt-pcr kit (qiagen) was carried out with the unlabelled version of the priproet primers. a specific t promoter sequence was added to the end of the forward primer. the pcr product was gel purified using the qiaquick gel extraction kit (qiagen, hilden, germany). the purified dna samples were in vitro transcribed using megascript ® t kit (ambion, austin, tx, usa). the rna concentration was determined with nanodrop nd (nanodrop, wilmington, de, usa). the standard curve was generated from a serial ten-fold dilution ( - copy numbers) of the recombinant rna in rnase free water (ambion, huntingdon, uk). furthermore, in order to assess the detection limit of subgenomic mrnas, sensitivity was evaluated from a serial ten-fold dilution from to of fipv df- grown in fcwf cell culture. inoculation of the cells was followed immediately by rna extraction of the different virus dilutions. virus titre based on cpe in fcwf was compared to the characteristic parameters of the assay: threshold cycle (c t ), fluorescents signal, and melting point. the specificity of the assay targeting the m gene subgenomic mrna was verified by gel electrophoresis, sequencing the amplicons and by melting point analysis. subsequently, the capability of the pcr assay to detect various fcov strains was tested. nine reference feline coronavirus strains representing both serotypes and biotypes were subjected to the specificity tests. on the other hand, non-feline coronaviruses were tested to exclude the crossreactivity of the assay, including human, canine, porcine, avian, bovine and murine coronavirus strains, representing all the three genus of coronavirinae (table ) . the efficiency of the assay was calculated using the equation of e = (− /m) − , where "e" is the amplification efficiency and "m" is the slope of the standard curve. all tests for sensitivity and specificity were performed in triplicate in order to assess the intra-assay variability. inter-assay variability was calculated in two different ways: ( ) comparison of the obtained c t values of the standard samples included in each experiment; ( ) examination the c t values of the same set of rna samples in three distinct runs. no signs of virus induced cpe were found in the case of the efcov positive faecal samples and feline infectious peritonitis positive organ samples after the third passage. neither the sybr green rt-qpcr nor the p-sg-qpcr assay could display fluorescent signals and characteristic melting points during the examination of cell culture supernatants for the detection of their genomic and subgenomic rnas. the mean titre of fipv df- strain reached . tcid / l (/ml) based on the typical cpe, such as cell fusion and rounding of cells at the edges of the cythopathic foci. the sensitivity of p-sg-qpcr was determined by generation of standard curves from a serial ten-fold dilution of both the recombinant rna and fipv df- grown in fcwf cell culture. the detection of the different dilutions of the recombinant rna was linear in the range of . × up to . × copies per reaction (fig. ) . this result indicated a sensitivity of - viral genome copies per pcr assay. the detection limit of the p-sg-qpcr test for subgenomic mrna detection from the fcwf cell cultured df- virus strain was tcid / l. the specificity of amplification was confirmed by gel electrophoresis of the p-sg-qpcr amplicons, followed by sequencing (data not shown). the p-sg-qpcr was able to detect all nine reference strains of fcov as well as tgev and ccov. the melting point analysis revealed four different genetic variants in this very conserved region of the m gene with the following average temperature values: ( ) . • c (ucd , ucd , ucd , black, - , df- ); ( ) . • c (ucd ); ( ) . • c (nor , - , ccov cb/ and / ); ( ) . (tgev purdue) (table ; fig. ). the efficiency of the assay was defined from the standard curve that displayed a linear inversely proportional relationship between the logarithmic amount of copy concentration and the c t of the original samples. reaction efficiency was found to be with an r value of . (fig. ) . the intra assay variability was assessed using different amounts of rnas of the nine feline cov strains. these samples were used in three replicates in the same sg-qpcr run and the intra-assay variability was obtained from two statistical table . parameters: standard deviation was . and the standard error of the mean (sem) was . . the inter assay variability was determined by the same rna set testing it three times and the standard deviation was obtained as . , the standard error of the mean (sem) was . (data not shown). the feline faecal samples from sweden were analysed for the presence of fipv-specific nucleic acid by both sybr-green qpcr and by the new p-sg-qpcr method, in parallel. both assays revealed the presence of fcov in several samples, but to a different extent. the sybr-green method detected positives ( . %), while the p-sg-qpcr assay revealed only ( . %). the c t values of the priproet positive samples varied between . and . (mean: . ; sd: . ) reflected markedly different sg-mrna copy number in the intestines of the cats: × - × copies/ l % (w/v) faeces suspension. all the nine diarrhoeic fcov shedder cats were sybr-green positive, but only five of them proved to be p-sg-qpcr. the c t value of the fcov positive samples varied between . and . (mean: . ; sd: . ), which is equivalent with approximate × - × copies/ l % (w/v) faeces suspension (table ) . table the ct values and the melting points of the nine reference coronavirus strains obtained with the p-sg-mrna qpcr. the representatives of the four genotypes can be seen in the alignment with violet, yellow, green and blue backgrounds. type c t pea k none of spleen, liver, lungs and kidney samples of the nine fcov positive cats showed positive results when tested with the two realtime pcr methods. the feline organ samples representing cats succumbed to feline infectious peritonitis in sweden and hungary were analysed by sybr-green qpcr, while only organ samples by the p-sg-qpcr. a total of ( . %) of samples analysed by both methods were positive by sybr-green qpcr and ( . %) by the p-sg-qpcr. the p-sg-qpcr c t values ranged between . and . (mean: . ; sd: . ), which is equivalent with × - × copies/ l % (w/v) tissue suspension. the detailed analysis of the feline infectious peritonitis positive cat samples by sybr-green qpcr method revealed that the following organs harbour fcov most frequently: lungs / ( %), liver / ( %), kidney / ( . %), mesenteric lymph node / ( %), spleen / ( %) and gut / ( . %). based on the results obtained from the newly developed p-sg-qpcr, the list of organs most frequently harbouring sg-mrna in quantitative order is the following: mesenteric lymph node / ( %), spleen / ( . %), lung / ( . %), liver / ( %), bronchiolar lymph node / ( . %), gut / ( . %), kidney / ( . %). analysis of body fluids and excreta collected from the carcasses gave the following results: heart blood / ( %), ascitic fluid / ( %) and faeces / ( %). interestingly, the three tonsils involved in the examinations consequently remained fcov negative with both two qpcr methods; / ( %). the p-sg-qpcr c t values in the gut, the primary replication site of fcov reflected significantly lower viral replication: the values ranged between . and . (mean: . ; sd: . ), which is equivalent with × - × copies/ l % (w/v) faeces suspension ( table ) . the melting point analysis revealed only . • c difference regarding the organs of the same carcass, but resulted in four different groups regarding the different animals: . • c average temperature (one cat of eight, . %), . • c ( / , %), . • c ( / , %) and . • c ( / , . %). the obtained p-sg-qpcr c t values revealed higher subgenomic m gene mrna transcription levels in the different organs compared to those of the faecal samples. this phenomenon can be explained by the lower cell density of the faecal samples, or the lower replication rate of the virus in the intestinal epithelial cells. furthermore, the c t values of the sg-mrna positive gut samples demonstrated a much smaller deviation compared with those of the organ samples. the leukocyte specimens of clinically sick cats displaying fever, lymphocytopenia, hypergammaglobulinaemia, in a few cases enlargement of the abdomen were subjected initially to the sybr-green qpcr method revealing positive cases ( . %). in contrast to the previous findings, the p-sg-qpcr led to the same result. the obtained c t values ( . , . , . and . respectively) correspond to approximately × - × copies/ l leukocyte suspension (table ) . one sample showed c t value of . . as the c t can be excluded from this series due to its abnormal high value, the mean value of . corresponds to copies/ l leukocyte suspension of sg-mrna in the leukocytes of sick cats suffering with feline infectious peritonitis (confirmed earlier by pathological, histopathological, immunohistological and rt-pcr examinations). the melting points of the five amplicons were . • c, . • c, . • c, . • c and . • c. the follow-up investigations revealed that all five cats perished with fip in days after the p-sg-qpcr examinations (data not shown). the diagnosis of feline infectious peritonitis, this major viral disease of the felidae is extremely difficult, due to several factors in the complicated infection biology of fcov. first, no exact genetic marker(s) has been identified yet in the viral genomes that would allow the differentiation of the two fcov biotypes: fipv and efcov. second, during the viral replication genomic alterations are generated continuously by this virus, leading to the rapid appearance of a variety of viruses in the body of the host. since reliable means for the molecular determination of the differences between the avirulent and virulent variants of fcov are not available, the diagnosis of feline infectious peritonitis should address other biological characteristics of the virus ways today. in the present work, two peculiar features of the infection biology of feline coronaviruses were utilised. on the one hand, the enhanced capability of the fipv biotype to replicate intensively in various organs and tissues of the host animal was exploited (stoddart and scott, ; kipar et al., ; rottier et al., ) . on the other hand, the ability of nidovirales to initiate sg-mrna synthesis during replication phase was addressed. in the past few years, by the use of sg-mrna pcr techniques (gillim-ross et al., ; simmons et al., ) , replicating covs have been detected successfully. for this reason, to facilitate correct feline infectious peritonitis diagnosis and prognosis, the present study aimed at developing a p-based real-time pcr assay to detect the virus and to determine the level of virus replication, in a single diagnostic platform. the flexibility of the p-sg-qpcr technique is indicated by the fact that cov strains even with three mismatches in their genomes at the primer and probe binding sites could simultaneously be detected by this novel method (table ) , without decrease of the fluorescent signal. therefore, the p-sg-qpcr method may be regarded as a real-time amplification system with unique capability for the identification of all previously published fcov m gene sg-mrnas. table alignment of feline, canine and porcine cov strains; viruses even with substitutions could be demonstrated by the sg-mrna detecting qpcr system. sense, unlabeled primer region with grey, m probe (labelled with txr) region with violet, m antisense primer (labelled with -fam) region with green background are depicted. ucd- sequence data on the m gene has not been available in the genbank yet. the representatives of the three other genotypes can be seen in the alignment with yellow, green and blue backgrounds (see table ). cov strains belonging to all three genus of coronavirinae did not give specific fluorescent signals, excluding the cross reactivity of the test. the sensitivity of the assay was determined in two different ways, and the detection limit proved to be as low as copies in each case. the efficiency of the p-sg-qpcr test was calculated by the establishment of two separate calibration curves: one from serial -fold dilution of the recombinant rna, while the other from the serial -fold dilution of fipv df- virus grown on fcwf cell line. both standard curves displayed a linear detection of sg-mrna in the range of - range with a correlation coefficient (r ) of . and efficiency of %, and r of . and efficiency of %, respectively. difference between the two efficiency values may be attributed to the superior purity of the recombinant rna standard. these results revealed a significant difference between rate of positive results on feline faecal samples using the genomic sybr green and the p-sg-qpcr assays. efcov can be detected in a high proportion of intestinal samples of cats by pcr (herrewegh et al., ; foley et al., ) . in contrast, the limited number of psg-qpcr positive results may indicate a relatively low percentage of animals with extensive virus replication level in the intestinal tract. since the p-sg-qpcr assay is demonstrating intensive virus replication, it is tempting to speculate that this test is capable of identifying the persistent virus-shedder cats, which contribute to the maintenance cov infection in the catteries, and their ratio can reach even % (addie et al., ) , and this group includes the cats with the risk of the fatal fipv variant emerging. however, the majority of cats shed efcov intermittently for weeks or months, in table frequency of genomic fcov positive samples by sybr green method and frequency of fcov sg-mrna positive samples by priproet method completed by sg-mrna copy number. the copy number data refer to l of % (w/v) tissue and faeces suspension or l of leukocyte suspension. sybrgreen: priproet sg-mrna load (copies/ l sample) faecal samples from healthy cats / ( . %) / ( . %) × - × faecal samples from feline enteric coronavirus positive diarrhoeic cats / ( %) / ( . %) × - × faecal samples from cats succumbed with feline infectious peritonitis / ( %) / ( %) × - × organ samples from feline enteric coronavirus positive diarrhoeic cats / ( %) / ( %) organ samples from cats succumbed with feline infectious peritonitis / ( . %) / ( . %) × - × leukocytes (heart blood) from cats succumbed with feline infectious peritonitis / ( %) / ( %) × - × leukocytes from possible feline infectious peritonitiscases / ( . %) / ( . %) × - × some cases at very low level (addie and jarrett, ; lutz et al., ) . hence, to avoid false negative diagnosis, negative results of the p-sg-qpcr method should be interpreted with caution, and in these cases this assay is a method of choice complementing the widely used genomic real-time qpcr assays in the determination of fcov status. another explanation for the surprisingly low copy number of the fcov sg-mrna in the gut may be explained with the balanced immune response of the host animals that keeps fcov replication at low level, and as a consequence, the subgenomic rna levels may reach much lower rates then their genomic counterparts. whichever explanation is true, evaluation of quantitative pcr results has to take into consideration the inhibitory compounds of the faecal samples (dye et al., ) . the different melting point values of the faecal samples indicating variable number of nucleotide substitutions at the probe-binding site (rasmussen et al., ; hakhverdyan et al., ) revealed at least four different fcov virus genetic variants in the targeted region of the m gene. comparing these melting points with those of the reference viruses it can be concluded that the most frequent virus types in the swedish collection may be the ucd like, the - -like fcov, the nor and / ccov strains. although recombination cannot be excluded in some of this fcovs the majority of the viruses detected must correspond with these strains, because the m gene is the most conserved structural protein gene. the spleen, liver, lungs and kidney samples of the nine fcov positive cats were all negative with the applied two different real-time pcr methods, reflecting an fcov negative status of these organs. analysis of the organ samples obtained from feline infectious peritonitis cases revealed a high copy number of fcov, which is not surprising, since several earlier publications reported enhanced virus replication in the cats diseased with feline infectious peritonitis. the negative results in the case of a few samples are supposed to be a consequence of the different distribution of fipv in various organs. the most frequently affected organs are the liver, the lungs, the kidneys and mesenteric lymph nodes with - % positive result rate. this is a reflection of their dense vascularisation, rendering them particularly susceptible to the virus that is transported by the infected monocytes and macrophages. a slight difference was observed in the same organs regarding their sg-mrna contents, where the order of frequency was: mesenteric lymph nodes, spleen, lungs and liver ranging from % to % positive result. concluded by their enhanced sg-mrna content these are the main susceptible organs, which the fcov possessing its altered genome can first colonise and then intensively multiply. the high rate sg-mrna positive results observed in the body fluids demonstrate the value of the clinical and pathological samples allowing readily diagnosing feline infectious peritonitis. the p-sg-qpcr c t values revealed an average of times more coronaviral sg-mrna in the feline infectious peritonitis positive samples than in the faecal samples of the clinically healthy fcov young shedder animals, in some organs (liver, spleen) even - , times more, proving the very high virus multiplication rate in the diseased cats. interestingly, the basic organ of fcov replication the gut, displays virus depletion in all examined feline infectious peritonitis cases, the maximal virus replication occurred at a remarkably low level, never even exceeding copy numbers. these data suggest that the mutated fcov variants are prone to abandon this organ after acquiring successful access to other organs via monocytes and macrophages. the interesting phenomenon that the same melting point detected in the different organs within the body may be explained by the absence of concomitant cov infection. compiling these findings, it can be hypothesised that once an fcov variant had colonised the enteric system of a cat, the virus could either be eliminated, or kept under control by the specific immune response of the host animal, or the continuous/ intermittent high level virus replication in the worst case lead to the generation of the highly virulent fatal fipv variant by mutation. the different melting points of the fipv amplicons obtained from different carcasses suggest the same phenomenon that was observed in the case of the fcov faecal sample collection, i.e. at least four different fipv variants existed among cats that have suffered from and succumbed to fip. the swedish fipv cases revealed a melting point between nor , / , - and the tgev purdue strains, and may represent a still non-characterised fipv variant regarding the targeted stretch of the m gene. on the contrary, the five hungarian fipvs can be classified into four different groups based on their melting point values: (i) resembling to the ucd ( %); (ii) two comparable to the nor , / and - ( %); (iii) similar to the swedish strains ( %); and (iv) having a melting point similar to the tgev ( %). this difference is in accordance with the previously described existence of different genetic patterns of fcov isolates in geographically diverse areas. the p-sg-qpcr analysis of the leukocytes revealed a relatively low prevalence of feline infectious peritonitis among the uncertain cases, underlines the limited capability of the exclusive use of clinical and conventional laboratory examinations for the establishment of a correct diagnosis. the consequently high fcov copy numbers of the leukocyte samples demonstrate (with one exception) the feasibility of this diagnostic tool to obtain a correct prognosis from the blood samples of live animals. in contrast to the faecal and organ samples, the same melting point was obtained from the leukocytes, which raised several questions that can be answered only by the examination of a sufficient amount of blood samples. taken together, these results indicate the applicability of the new p-sg-qpcr test as a novel assay for the better detection and quantitation of fcov replication in various organs, and/or in the separated monocyte-macrophage fractions of the diseased cats. in combination with genomic quantitative pcr methods, the assay also provides a practical tool for the identification of persistently infected strong shedder individuals in a closed cat populations e.g., in catteries. furthermore, this method facilitates the early diagnosis of fip, allowing a prompt treatment of the infected cats. considering these practical strengths, this assay provides a practical novel tool for the better understanding of the infection biology as well as for improved control of feline infectious peritonitis, this mysterious viral disease of the felidae. use of a reverse-transcriptase polymerase chain reaction for monitoring the shedding of feline coronavirus by healthy cats persistence and transmission of natural type i feline coronavirus infection the morphology of three previously uncharacterized human respiratory viruses that grow in organ culture virology: a laboratory manual development of primer-probe energy transfer real-time pcr for the detection and quantification of porcine circovirus type the detection of feline coronaviruses in blood samples from cats by mrna rt-pcr revision of the family coronaviridae. taxonomic proposal of the coronavirus study group to the ictv executive committee natural history of a recurrent feline coronavirus infection and the role of cellular immunity in survival and disease evaluation of real-time rt-pcr for the quantification of fcov shedding in the faeces of domestic cats sybr green real-time reverse transcription-polymerase chain reaction assay for the generic detection of coronaviruses patterns of feline coronavirus infection and faecal shedding from cats in multiple-cat environments zwischenmolekulare energiewanderung und fluoreszenz discovery of novel human and animal cells infected by the severe acute respiratory syndrome coronavirus by replication-specific multiplex reverse transcription-pcr development of a real-time pcr assay based on primer-probe energy transfer for the detection of swine vesicular disease virus the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes persistence and evolution of feline coronavirus in a closed cat-breeding colony feline coronavirus type ii strains - and - originate from a double recombination between feline coronavirus type i and canine coronavirus characterization of monoclonal antibodies against feline infectious peritonitis virus type ii and antigenic relationship between feline, porcine, and canine coronaviruses a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies the prevalence of types i and ii feline coronavirus infections in cats morphologic features and development of granulomatous vasculitis in feline infectious peritonitis correlation of genomic detection of feline coronavirus with various diagnostic assays for feline infectious peritonitis prevalence and genetic pattern of feline coronaviruses in urban cat populations feline coronavirus serotypes and : seroprevalence and association with disease in switzerland fcov shedding pattern of privately owned cats under field conditions experimental studies with three new strains of feline infectious peritonitis virus: fipv-ucd , fipv-ucd , and fipv-ucd virologic and immunologic aspects of feline infectious peritonitis virus infection development of a novel quantitative real-time rt-pcr assay for the simultaneous detection of all serotypes of foot-and-mouth disease virus quantitative multiplex assay for simultaneous detection and identification of indiana and new jersey serotypes of vesicular stomatitis virus a simple method of estimating fifty percent endpoints acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein a mrna pcr for the diagnosis of feline infectious peritonitis isolation and identification of feline peritoneal macrophages for in vitro studies of coronavirus-macrophage interactions feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses the work was financially supported by the formas grants , by the award of excellence (excellensbidrag) provided to s.b. by the swedish university of agricultural sciences (slu), by the jános bolyai fellowship of the hungarian academy of sciences and by the tÁmop- . . .b- / "development of a complex educational assistance/support system for talented students and prospective researchers at the szent istván university" project. grateful thanks are due to swedish colleagues stina ekman, bodil ström-holst, peter thorén and to the cat owners from all over sweden for providing us a valuable collection of clinical samples for detailed investigations. cat organ and leukocyte samples were kindly provided in hungary by colleagues béla lakatos and zoltán demeter. moreover, the authors thank colleagues canio buonavoglia, dave cavanagh, lia van der hoek, ali kheyar, istván kiss, matthias niedrig, and peter rottier for supplying several coronavirus reference strains and isolates. key: cord- -tjzlssal authors: de groot, raoul j.; van leen, robert w.; dalderup, mieke j.m.; vennema, harry; horzinek, marian c.; spaan, willy j.m. title: stably expressed fipv peplomer protein induces cell fusion and elicits neutralizing antibodies in mice date: - - journal: virology doi: . / - ( ) - sha: doc_id: cord_uid: tjzlssal abstract we have established bovine papilloma virus (bpv)-transformed mouse c cell lines that synthesize the peplomer protein of the feline infectious peritonitis virus (fipv) strain - . for this purpose, a new cassette expression vector phsl, which carries the drosophila hsp promotor and the polyadenylation signal of the moloney murine leukemia virus long terminal repeat, was constructed. cocultivation of the bpv-transformed cell lines with fipv-permissive feline fcwf-d cells resulted in polykaryocyte formation. since it depended on the presence of fcwf-d cells, binding of e to the cell receptor may be required for membrane fusion. e was synthesized as a core-glycosylated protein of k which was only slowly transported from the endoplasmic reticulum to the medial golgi: of the e -molecules labeled during a -hr pulse about half was still completely sensitive to endoglycosidase h after a -hr chase, while the remaining e had been chased into multiple, partially endoglycosidase h-resistant forms. immunofluorescence studies also indicated that most e was retained intracellularly. mice immunized with whole lysates of the transformed cells produced fipv-neutralizing antibodies as shown by plaque reduction. coronaviruses, a group of positive-stranded, enveloped rna viruses, cause considerable economical losses by infecting livestock and other domestic animals. the molecular biology of these viruses is studied not only because of their unusual replication strategy (for review see siddel et a/., ; spaan et a/., ) but also for the development of effective vaccines by recombinant dna technology. coronaviruses are characterized by large petalshaped peplomers protruding from the viral membrane. these surface projections, which consist of the peplomer protein e , play an important role during the infection process, since they mediate receptor binding and membrane fusion (sturman and holmes, ) . e is a large ( k to k) glycoprotein (sturman and holmes, ) . sequence analyses of the e genes of several coronaviruses revealed that its protein moiety is to amino acid residues in length and contains an n-terminal signal sequence, a c-terminal transmembrane anchor, and to potential nglycosylation sites (binns et al., ; de groot et a/., b,c; jacobs eta/,, ; luytjes eta/., ; niesters eta/., ; rasschaer-t and laude, ; schmidt eta/., ) . besides glycosylation, synthesis of e entails acylation and for some coronaviruses, like mouse ' present address: gist brocades n.v., postbus , o ma delft. *to whom requests for reprints should be addressed. hepatitis virus (mhv) and avian infectious bronchitis virus (ibv), cleavage into two subunits (frana et a/., ; stern and sefton, ; sturman eta/., ) . in the infected cell some e is not incorporated into virions but transported to the plasma membrane where it can induce polykaryocyte formation holmes, , ) . cavanagh ( ) provided evidence that each peplomer is a dimer or trimer of e . the presence of two regions with heptad periodicity in the c-terminal half of the protein suggests that the monomers are held together by a complex interchain coiled coil (de groot et a/., c) . several observations suggest that e is the principal antigen eliciting protective immunity. the n-terminal half of e was required for a protective immune response against ibv in chickens (cavanagh et a/., ) while mice could be protected against a lethal challenge with mhv by vaccination with purified e (hasony and macnaughton, ) or e -derived synthetic peptides (talbot et a/., ; m. koolen, personal communication) . passive immunization with e specific monoclonal antibodies also provided protection against mhv (buchmeier et a/., ; wege et al., ) . however, the situation is much more complex in the case of feline infectious peritonitis virus (fipv), which causes a fatal disease in cats (fip), involving antibody-mediated early death (pedersen and boyle, ; weiss and scott, ) . mammalian cell lines expressing the fipv peplomer gene would provide a convenient source of protein to dissect the role of e in fip. moreover, such cell lines could be used to study virus assembly and membrane fusion. here we report synthesis of fipv e in bovine papilloma virus (bpv)-transformed cl -cells. it is shown that the expression product induces fusion of fipv-permissive feline cells and is immunogenic in mice. in addition, we describe two new bpv "cassette" expression vectors allowing (i) easy cloning of genes between promotor and termination sequences, (ii) easy replacement of promotor and termination sequences, and (iii) both transient and stable expression. plasmid pdbpv-mmtneo( - ) (law et al,, ) was obtained from the american type culture collection. plasmids pa ltr and pbn were kindly provided by dr. a. j. m. berns (dutch cancer institute, amsterdam). the cl cells used for transfection experiments were obtained from dr. p. howley (nih, bethesda). cells were propagated in dmem with % fetal calf serum. transfection was carried out using the calcium phosphate precipitation technique (graham and van der eb, ) . to enhance the transfection efficiency, the cells were treated with % dmso (stow and wilkie, ) or % glycerol (frost and williams, ) hr after transfection. cell lines were established by isolating foci as described by law et al. ( ) . fe/is catus whole fetus (fcwf)-d cells were obtained from dr. n. c. pedersen (school of veterinary medicine, university of california, davis). for northern blot analysis rna was isolated as described by spaan et al. ( ) . glyoxal-denatured rna was fractionated on . % agarose gels in mm sodium phosphate, ph . (mcmaster and carmichael, ) transferred to nylon membranes (genescreen plus; nen, boston), and hybridized according to the manufacturer's recommendations. standard recombinant dna techniques were performed as described . cytoplasmic dot hybridization was performed according to white and bancroft ( ) . the expression vector phsl was derived from the vector pdbpv-mmtneo( - ). in order to facilitate the construction of this new vector (see fig. l) , the large bamhl fragment ( bp) representing the entire bpv- genome was deleted from pdbpv-mmtneo. the remaining fragment, designated pmtn, was recircular-ized. as terminator sequences we chose the long terminal repeat (ltr) of moloney murine leukemia virus (van beveren et a/., ) . the . -kb pvulllhindlll fragment containing the ltr was isolated from plasmid pa ltr. by linker addition the pvull site was converted into a bg/ll site. similarly, the hindill site was changed into a bamhl site. the resulting fragment was ligated to the large fragment of bglliibamhi-digested pmtn, yielding plasmid pmtl. the . -kb ecoril bamhl fragment, carrying the drosophila heat-shock (hsp ) promotor (torok and karch, ) was excised from pbn and, after converting the barnhi site into a bg/ll site by linker addition, ligated to the large ecoriibglli fragment from pmtl. the resulting vector, phsl, was used in our experiments. a full-length cdna copy of the e gene of fipv strain - (see below) was inserted into the g/ll site of phsl, while the bpv- genome was inserted into the bamhl site. the construct containing the bpv genome in the same transcriptional orientation as the fipv e gene was designated phsfilb(+); the construct containing the bpv genome in the opposite orientation was named phsfllb(-). cell lines made with these plasmids were indicated by rm(+) and rm(-), respectively. tailoring of the fipv peplomer gene plasmid pb contains a full-length cdna copy of the e gene of fipv -l (de groot et al., b) . before cloning this gene into the expression vectors redundant noncoding sequences located at the ' and ' ends were removed. for trimming of the 'end (extending nucleotides from the e initiation codon), ng of the synthetic oligonucleotide ytgtgccatgat-tgtgct '(corresponding to position - to +l of the e gene) was annealed in m/l/l tris-hci, ph . , mlvl nacl (total volume ~ ) to pg of single-stranded dna from a recombinant m mp phage containing the (-)sense strand of the ' terminal . -kb pstl fragment of pb . double-stranded dna was synthesized by incubation with . mm dntps and units klenow dna polymerase in a final volume of ~ , for min at room temperature. the dna was precipitated with isopropanol, washed with % ethanol, and resuspended in /*i m/l/l tris-hci, ph , mm edta. subsequently, ~ of sl buffer ( mm potassium acetate, ph . , . n/l naci, mmznso,, % glycerol) containing units sl nuclease (pharmacia) was added; digestion was for min at room temperature (eghterdarzadeh and henikoff, ) . after phenol extraction and ethanol precipitation, the dna was digested with pstl. thus a -bp fragment was generated corresponding to the ' end of the e gene. this dna was cloned into hindill (blunt-ended with klenow)/pstl-digested puc in the presence of barnhi linkers. the ligation mixture was used for transformation of jm according to hanahan ( ) . recombinant clones were selected by colony hybridization. the fipv-specific inserts were sequenced. plasmid pl a contained the ' end sequence of the fipv peplomer gene, starting nucleotides upstream of the aug co-don ( nucleotide was lost probably by nibbling of the sl nuclease), preceded by a barnhi linker. plasmid pl a was digested with pstl and the -bp pstl fragment of b was inserted in the correct orientation. the accl site located nucleotides downstream of the stop codon was used to remove the redundant sequences at the ' end. as a result, the complete fipv e gene was contained in a . -kb barnhi fragment. to monitor e -induced cell fusion, o fcwf-d cells and o bpv-transformed cl cells were seeded into a -mm-diameter petri dish and allowed to adhere and grow for hr at ". for induction of the heat-shock promotor the cells were incubated for hr at " and then reincubated at ". cell fusion was assessed by light microscopy. protein analysis fipv -l -infected cells were labeled with [ s]methionine (amersham) from to . hr after infection as described previously (de groot et a/., a). after hr incubation at ', rm(+) cells were labeled at " by growing in cysteine-free dmem, containing $ci/ml [ s]cysteine (amersham). cells were lysed in pbs, . yotriton x-l . e was immunoprecipitated using ascitic fluid from an fipv-infected cat (de groot et a/., a). digestion with endoglycosidase h was performed as described by rose and bergmann ( ) . proteins were denatured in laemmli sample buffer, containing % -mercaptoethanol, and subsequently analyzed on % sds-polyacrylamide gels. lmmunofluorescence indirect surface immunofluorescence was carried out with rm(+)l cells, fixed in % paraformaldehyde as described by rose and bergmann ( ) . for intracellular immunofluorescence, the cells were fixed for min at - " in % methanol, % acetic acid. sera ( : ) obtained from a cat before and after experimental infection with fipv -l were used as the primary antibodies, followed by fitc-conjugated rabbit anti-cat immunoglobulin g ( : , nordic). immunization rm(+) and am cells were grown to confluence, subjected to heat shock, followed by a -hr incubation at ". the cells were washed three times with pbs and harvested with a cell scraper. they were then suspended in pbs ( ' cells/ml) and disrupted by freezethawing followed by -min sonification (bath sonicator, type rk h, bandelin, west germany). the cell suspensions were stored at - ". the concentration of the cell lysates was adjusted to an equivalent of io' cells/mouse/dose. the first dose, consisting of lysate mixed with an equal volume of complete freund's adjuvant, was applied subcutaneously. the mice were boosted intraperitoneally on days and with lysates suspended in pbs (marchioli et al., ) . twofold serial dilutions of heat-inactivated sera ( ~ ) were mixed with about pfu of fipv -l in an equal volume of dmem, % fetal calf serum. incubation was for hr at ". these samples were used to infect monolayers of fcwf-d cells. after hr absorption at ", the cells were washed twice with pbs and finally maintained for hr under an agar overlay. plaques were counted after staining with . % neutral red in pbs. antibody titers, expressed as the reciprocal serum dilution causing % plaque reduction, were estimated according to the method of reed and munch ( ) . at the time we started this research, no convenient bpv expression vectors were available. therefore, we constructed the expression vector pmtl. this vector carries the mouse metallothioneine (mmt) i promotor (hamer and walling, ) while the moloney murine leukemia ltr (van beveren et al., ) provides a polyadenylation signal. pmtl has been designed with the aim to allow for easy exchange of promotor and termination sequences. to construct vector phsl the mmt promotor was replaced by the drosophila hsp heat-shock promotor (torok and karch, ) (fig. ) . any protein coding sequence can be cloned into the unique bg/ll site downstream of the promotor. vectors for stable expression were constructed by inserting the bpv- genome sarver et al., ) into the unique barnhi site downstream of the ltr. the versatility of these vectors was demonstrated by stable expression of the vesicular stomatitis virus (vsv) membrane glycoprotein and the nucleocapsid protein of mhv (not shown). a bpv-transformed cell line am , which expresses the mhv nucleocapsid protein under the control of the mmt promotor (bredenbeek et a/., unpublished), served as a negative control in the experiments described below. a full-length cdna copy of the fipv e gene was obtained from plasmid pb (de groot et al., b) . to avoid possible interference with transcription and translation, noncoding sequences at the ' and ' end of the gene were removed. to anticipate possible adverse effects related to the transcriptional orientation of the bpv sequences in the vector, we used both phsfilb(+) and phsfilb(-) (fig. ) . (a) screening for e transcripts. cytoplasmic rna was extracted from x o bpv-transformed cells and spotted on nitrocellulose as described by white and bancroft ( ) (rows b-f). about pg of rna isolated from fipv-infected cells and ng of an bp hindill fragment derived from the fipv e gene were spotted as positive controls (a and a , respectively). a duplicate filter was incubated for min at " in x ssc, containing @/ml rnase a. filters were hybridized to a nick-translated fipv e -specific probe. (b) glyoxal-denatured rna extracted from noninduced (lane ) and heat-shock-induced (lane ) rm(-)i cells was separated on . % agarose gels, transferred to a nylon membrane, and hybridized to a nick-translated . -kbbamhl fragment containing the complete fipv e gene. to estimate molecular weights a glyoxal-denatured ecoril hindill digest of phage x dna was induced (lane ). rm(-)] were isolated, established as continuous cell lines, and tested for accumulation of ez-specific rna by cytoplasmic dot hybridization (white and bancroft, ) after a heat shock (fig. a) . about % of the cell lines gave a positive reaction. there was no difference in the percentage of positive cell lines generated by phsfilb(+) or (--). to characterize the e transcripts, cytoplasmic rna was extracted from some of these cell lines and analyzed by northern blotting. the nick-translated . -kb bamhl restriction fragment containing the complete e gene (fig. ) was used as a probe. a prominent rna species of . kb in length was detected. this size is consistent with a full-length transcript initiated at the heat-shock promotor and terminated at the polyadenylation site in the ltr. the . -kb rna species was also observed in noninduced cells, indicating that the heatshock promotor is leaky (fig. b) . transcription was enhanced about two-to fivefold after induction. in one cell line, rm(+) , the . -kb rnawas not present; instead an e -specific rna of about kb was found (not shown). to test for e synthesis and its transport to the cell surface, we used an assay based on e -induced fusion activity. the eight "best hybridizing" cell lines were cocultivated with fcwf-d cells (fipv permissive feline cells) and found to induce cell fusion (fig. ) . syncytia were only formed after addition of fcwf-d cells. fusion did not occur in fcwf-d cells cocultivated with am cells (which express the mhv nucleocapsid protein) or rm(+) cells (which produce an aberrant e transcript; not shown). for most cell lines heat shock was required to induce cell fusion; after hr of cocultivation at " only few syncytia were observed. syncytia appeared and increased in number to hr after heat shock. in contrast, one cell line rm(+) caused widespread cell fusion even without induction. differences in fusion potential were taken to reflect differences in the level of e expression. using this criterium the rm(+) cell line was considered the best producer and therefore selected for further study. the low-producing cell line rm(-) was included for comparison. to analyze e synthesized in these cell lines, [ s]cysteine-labeled cell lysates were subjected to immunoprecipitation with an fipv-specific antiserum. a protein of k was detected in rm(+) cells. this product was also present in rm(-)i cells, although in very low amounts, but it was not detected in lysates of am cells (fig. a) . the k protein comigrated with pulse-labeled e produced in fipv-infected fcwf-d cells (fig. b) . these results indicated that the k product was indeed the e protein. the bands > k were observed in both the lysates of e -producing cell lines and the am cell line indicating that these products are nonspecifically precipitated by the fipv polyclonal antiserum. e could not be detected on the plasma membrane of rm(+)l cells by immunofluorescence microscopy using the serum of an fipv-infected cat (not shown), but in permeabilized rm(+)l cells perinuclear and granular cytoplasmic staining was observed (fig. ) ; staining was not observed in am cells (not shown). these results suggested that most e was retained intracellularly. to study the transport of e in the transformed cells, we analyzed the sensitivity of its oligosaccharide ( ). cells were labeled with [%]cysteine from to hr after heat shock. lysates were subjected to immunoprecipitation using an e -specific serum. samples were analyzed on % sds-polyacrylamide gels. the k product is indicated by an arrow; m: molecular weight marker. (b) pulse-chase labeling of e in rm(+)l cells. cells were labeled from to hr after heat shock with [%]cysteine. subsequently, cells were either lysed immediately ("pulse") or after a -hr chase with dmem containing mniunlabeled cysteine ("chase"). e was immunoprecipitated. half of each sample was digested with endo h (+); the other half was not digested (-). samples were analyzed on /o polyacrylamide gels. e immunoprecipitatedfrom pulse-labeled fipwnfected cells was used as marker. relative amounts of e were estimated by densitometry of the autoradiogram using a scanning densitometer (type dd , kipp and sons, the netherlands). chains to endoglycosidase h (endo h). endo h-sensitive high-mannose oligosaccharides are added to the protein backbone during translocation across the membrane of the endoplasmic reticulum (er). these precursor sugar chains are processed to endo h-resistant "complex" oligosaccharides in the medial golgi (dunphy and rothman, ; hubbard and ivatt, ) . figure b shows that e produced during a lhr pulse-labeling of rm(+)l cells did not contain complex oligosaccharide side chains. digestion with endo h yielded a k product comigrating with pulse-labeled, endo h-treated e from fipv-infected cells. about % of e in rm(+) cells was still fully endo h-sensitive after a -hr chase. the remaining e molecules appeared to be chased into products ranging in length from k to k after endo h-treatment. prolonged chasing did not result in the appearance of a discrete endo h-resistant product. rather, the material accumulated as multiple diffuse bands ranging in length from k to k (not shown). to determine whether the bpv-transformed cell lines synthesize enough e for use as immunogen, mice were immunized on day and boosted on days and with lysates of rm(+) and am ceils. sera collected at days (preserum), , , and were tested for the presence of e -specific antibody in a plaque reduction assay. table shows that mice immunized with rm(+)l cell lysates developed rising titers of fipv neutralizing antibodies. no plaque reduc- fig. . detection of the e protein by indirect immunofluorescence microscopy. rm(+) cells grown on coverslips were fixed with % methanol, % acetic acid and incubated with serum obtained from a cat before (a) and after(b) experimental infection with fipv - . tion was observed with sera from mice immunized with am cell lysates. expression vectors containing either the complete genome or subgenomic fragments of bpv- have been used to establish continuous cell lines producing large quantities of exogenous proteins (hsiung et al., ; pavlakis and hamer, ; reddy et a/., ; sambrook er al., ; sarver et a/., sarver et a/., , zinn et al., ) . in these vectors the bpv sequences carry the functions for plasmid replication and stable mainte-nance in the transformed cells (law eta/., ; sarver eta/., ) . we have set out to establish a number of bpv-transformed mammalian cell lines which express coronavirus structural proteins. such cell lines may provide a continuous source of protein for use as vaccine, but may also aid in the study of protein function and virion assembly. to facilitate plasmid construction we have developed the cassette vectors pmtl and phsl containing the mouse mmt- and drosophila hsp promotor, respectively. both vectors possess the moloney murine leukemia virus ltr to provide a polyadenylation signal. the unique bg/ll site downstream of the promo- a mice were immunized with disrupted rm(+) or am cells (five mice per group). doses of either preparation were given on days (subcutaneously), , and (intraperitoneally). heat-inactivated sera were pooled and tested in a plaque reduction assay. 'the neutralizing titer is indicated as the reciprocal of the serum dilution causing % plaque reduction when incubated with pfu of fipv -l . tor elements can be used to insert any gene of interest. for stable expression, the bpv genome can be introduced into the unique barnhi site. however, the vectors are equally suited for transient expression; e.g., by inserting the sv origin into the barnhi site they can be used for expression in cos cells (subramani and southern, ). here we have used phsl-derived plasmids to establish cell lines synthesizing the peplomer protein of fipv strain -l . southern blot analysis of total cellular dna extracted from our best producing cell line rm(+)l showed the presence of -l integrated copies of phsfilb(-t) dna per equivalent of diploid mouse genome (not shown). the cell lines induced syncytium formation when cocultivated with fipv-permissive feline cells. this effect was concluded to be e specific, since it was not induced by the bpv-transformed cell line am synthesizing the mhv nucleocapsid protein nor by the rm(+) cell line producing truncated e transcripts. in addition, syncytia formation was inhibited in the presence of fipv antiserum; preimmune serum from the same cat did not inhibited cell fusion (data not shown). fusion did not occur between murine cells but depended upon the presence of feline cells, suggesting that for membrane fusion to occur binding of e to the fipv cell receptor is required. a similar observation was made for cell lines expressing the envelope glycoprotein of human immune deficiency virus: polykaryocyte formation was restricted to cells bearing the cd receptor (sodroski et al., ) . in rm(+) ceils e was synthesized as a core-glycosylated protein of k. removal of the oligosaccharide side chains by endo h reduced the size of the expression product to k (about the size of the fipv e apoprotein) (de groot et a/., b). as shown by the fusion assay some of the e was transported to the plasma membrane. however, immunofluorescence studies suggested that most e was retained intracel-lularly. this was confirmed in pulse-chase experiments: of the e molecules labeled during a -hr pulse about half was still completely sensitive to endo h treatment after a -hr chase. the remaining material was chased into immature endo h-resistant products k to k in length, probably representing partially processed medial golgi forms (dunphy and rothman, ) . these results indicate that in rm(+) cells e is only slowly transported from er to golgi. for comparison, the vsv glycoprotein expressed in bpv-transformed cl cells is processed to the mature endo hresistant form in less than min (florkiewicz et a/., ) . the slow maturation of e in rm(+) cells could be host cell determined: the influenza virus hemagglutinin (ha) acquired terminal glycosylation with a half-time of more than hr in bpv-transformed cl cells (sambrook eta/., ) , while in simian cv- cells terminal glycosylation was completed within min (copeland et a/., ) . however, the slow rate of transport was also observed in various cell lines infected with a vaccinia virus recombinant expressing e of fipv (vennema et al., submitted). since coronaviruses bud through pre-golgi membranes (tooze et a/., ) a delayed intracellular transport of free e is likely to be a prerequisite for efficient virus assembly. to explore the potential of our bpv-transformed cell lines as immunogen, we immunized mice with lysates of rm(+) cells. we did not determine the amount of e in these lysates, since quantitative assays are not yet available. however, there was enough e to elicit fipv neutralizing antibodies. although the titers were modest, we trust that higher titers can readily be obtained by using larger amounts of cell lysate and optimized immunization protocols. we would like to use rm(+) cells for immunization experiments in cats to further study the role of e in immunopathology and protection. cloning and sequencing of the gene encoding the spike protein of the coronavirus ibv murine hepatitis virus- (strain jhm)-induced neurologic disease is modulated in vivo by monoclonal antibody coronavirus ibv: structural characterization of the spike protein coronavirus ibv: virus retaining spike glycopolypeptide s but not sl is unable to induce virus-neutralizing or hemagglutinininhibiting antibody, or induce chicken tracheal protection assembly of influenza hemagglutinin trimers and its role in intracellular transport the intracellular rnas of the feline coronavirus fipv strain -l cdna cloning and sequence analysis of the gene encoding the peplomer protein of feline infectious peritonitis virus evidence for a coiled-coil structure in the spike protein of coronaviruses compartmental organization of the golgi stack use of oligonucleotides to generate large deletions isolation of stable mouse cell lines that express cell surface and secreted forms of the vesicular stomatitis virus glycoprotein proteolytic cleavage of the e glycoprotein of murine coronavirus: host-dependent differences in proteolytic cleavage and cell fusion mapping temperature-sensitive and host-range mutations of adenovirus type by marker rescue a new technique for the assay of infectivity of human adenovirus dna regulation in vivo of a cloned mammalian gene: cadmium induces the transcription of a mouse metallothionein gene in sv vectors studies on transformation of escherichia co/i with plasmids antigenicity of mouse hepatitis virus strain subcomponents in c strain mice efficient production of hepatitis b surface antigen using a bovine papilloma virus-metallothionein vector synthesis and processing of asparagine-linked oligosaccharides the nucleotide sequence of the peplomer gene of porcine transmissible gastroenteritis virus (tgev): comparison with the sequence of the peplomer protein of feline infectious peritonitis virus (fipv) a stable bovine papillomavirus hybrid plasmid that expresses a dominant selective trait mouse cells transformed by bovine papillomavirus contain onlyextrachromosomal viral dna sequences primary structure of the glycoprotein e of coronavirus mhv-a and identification of the trypsine cleavage site molecular cloning: a laboratory manual evaluation of pseudorabies virus glycoprotein gp as a vaccine for aujeszky's disease in mice and swine: expression by vaccinia virus and chinese hamster ovary cells analysis of singleand double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange the peplomer protein sequence of the m strain of coronavirus ibv and its comparison with beaudette strains regulation of a metallothionein-growth hormone hybrid gene in bovine papilloma virus immunologic phenomena in the effusive form of feline infectious peritonitis the predicted primary structure of the peplomer protein e of the porcine coronavirus transmissible gastroenteritis virus expression of human uterine tissue-type plasminogen activator in mouse cells using bpv vectors a simple method for estimating fifty percent endpoints altered cytoplasmic domains affect intracellular transport of the vesicular stomatitis virus glycoprotein lines of bpv-transformed murine cells that constitutively express influenza virus hemagglutinin bovine papilloma virus deoxyribonucleic acid: a novel eukaryotic cloning vector sustained high-level expression of recombinant human gamma interferon using a bovine papillomavirus vector stable expression of recombinantfactorvii molecules using a bovine papillomavirus vector nucleotide sequence of the gene encoding the surface projection glycoprotein of coronavirus mhv-jhm the biology of coronaviruses role of the htlv-iii/lav envelope in syncytium formation and cytopathicity coronaviruses: structure and genome expression isolation and identification of virus-specific mrnas in cells infected with mouse hepatitis virus (mhv-a ) coronavirus proteins: biogenesis of avian infectious bronchitis virus virion proteins an improved technique for obtaining enhanced infectivity with herpes simplex virus type dna the molecular biology of coronaviruses the novel glycoproteins of coronaviruses proteolytic cleavage of the e glycoprotein of murine coronavirus: activation of cell fusion activity of virions by ttypsin and separation of two different k cleavage fragments analysis of gene expression using simian virus vectors vaccination against lethal coronavirus-induced encephalitis with a synthetic decapeptide homologous to a domain in the predicted peplomer stalk site of addition of n-acetyl-galactosamine to the el glycoprotein of mouse hepatitis virusa nucleotide sequences of heat shock activated genes in drosophila melanogaster. i. sequences in the regions of the ' and ' ends of the hsp gene in the hybrid plasmid h structure of moloney murine leukemia viral dna: nucleotide sequence of the ' long terminal repeat and adjacent cellular sequences hybridoma antibodies to the murine coronavirus jhm: characterization of epitopes on the peplomer protein (e ) antibody-mediated enhancement of disease in feline infectious peritonitis: comparisons with dengue hemorrhagic fever cytoplasmic dot hybridization regulated expression of an extrachromosomal human b-interferon gene in mouse ceils key: cord- -y xvh hs authors: yamanaka, miles; crisp, tracey; brown, rhonda; dale, beverly title: nucleotide sequence of the inter-structural gene region of feline infectious peritonitis virus date: journal: virus genes doi: . /a: sha: doc_id: cord_uid: y xvh hs the sequence of the region located between the s and m glycoprotein genes of the - strain of feline infectious peritonitis virus (fipv) is presented. the inter-structural gene region encodes open reading frames (orfs), termed orfs a, b and , with nucleotide sequences conforming to the minimum conserved transcription signal upstream of each. an additional orf, x, partially overlaps the ′ end of orf a. the fipv interstructural gene region is identical in length when compared to the insavc- strain of canine coronavirus (ccv) but differs from various strains of transmissible gastroenteritis virus (tgev) by the presence of deletions and insertions. the sizes of orf a and are conserved in fipv, tgev and ccv. however, as with ccv, the fipv orf b is truncated in comparison with tgev. feline infectious peritonitis is a disease characterized by immunopathology and caused by a coronavirus. in fipv-infected cells, viral mrnas have been detected ( ) . two of these originate from a region of the fipv genome lying between the genes encoding s and m. this inter-structural gene region has been examined in the related coronaviruses transmissible gastroenteritis virus (tgev) and canine coronavirus (ccv) ( ± ). the arrangement of the open reading frames (orfs) in the inter-structural gene region has been described for the fipv genome ( , ), but detailed sequence has not been presented. here, we report on the sequence of this part of the fipv genome. we screened an fipv - cdna library with oligonucleotide probes derived from the published s sequence ( ) and isolated clones containing the interstructural gene region. the sequence of one of these cdnas (genbank accession number af ) was analyzed in detail. the overall organization of the fipv interstructural gene region is similar to that of ccv and tgev. three orfs encoding polypeptides of , and residues are present in the fipv sequence; these have been designated orf a, b and , respectively, in ccv and tgev (orf is also known as the small membrane gene because it encodes a polypeptide that is similar in sequence to an infectious bronchitis virus membrane protein). an additional orf of residues partially overlaps the h end of fipv orf a. this orf is present in ccv but absent from tgev, and has been called orf x ( ) . upstream of the fipv orf a and orf is the nucleotide sequence ctaaac that is the minimum conserved transcription signal found in other fipv, tgev and ccv genes ( , ) . a related sequence, ctaaat, is present upstream of fipv orf b. for these orfs, the distance between the transcription signal and the start of translation is conserved in the coronaviruses. the inter-structural gene regions of fipv and the insavc- strain of ccv are identical in size. the * corresponding author. sequence identity of the two regions is . % at the nucleotide level. a base deletion, located bases upstream of orf a, and a base insertion, starting bases upstream of orf b, are present in the fipv interstructural gene region relative to the purdue strain of tgev. different strains of tgev also show variation in these same regions, emphasizing the sequencē exibility in this part of the coronavirus genome. the sequence identity between fipv - and the purdue strain of tgev in the inter-structural gene region is . %. the products of fipv orf a and orf are identical in length to the corresponding polypeptides of ccv and tgev (purdue strain), with amino acid similarities of . % and . %, respectively, between fipv and ccv, and . % and . % between fipv and tgev. in contrast, an amber codon limits fipv orf b to only residues while orf b of the purdue strain of tgev extends amino acids ( ) . although the fipv orf b is shorter, the region distal to the amber codon is similar in nucleotide sequence and identical in length to the remaining portion of the tgev orf b sequence. this is consistent with the idea that a base substitution has created a premature stop codon in the fipv orf b coding region. for ccv, orf b is also limited to residues. differences in expression and primary sequence of orf b occur in various tgev strains, and orf b is truncated in fipv and ccv. this indicates that orf b is not absolutely required for virus growth. sequence determination of virus passaged in cats will help to answer questions about the requirement for orf b expression in the virus life cycle ( ) . the coronaviridae we thank our colleagues lloyd chavez and bill acree at fort dodge laboratories for supplying the virus stock and for stimulating discussions. this work was supported by fort dodge laboratories and scios, inc. key: cord- - vi pgvr authors: vennema, h.; rossen, j.w.a.; wesseling, j.; horzinek, m. c.; rottier, p.j.m. title: genomic organization and expression of the ′ end of the canine and feline enteric coronaviruses date: - - journal: virology doi: . / - ( ) -n sha: doc_id: cord_uid: vi pgvr abstract the genomic organization at the ′ end of canine coronavirus (ccv) and feline enteric coronavirus (fecv) was determined by sequence analysis and compared to that of feline infectious peritonitis virus (fipv) and transmissible gastroenteritis virus (tgev) of swine. comparison of the latter two has previously revealed an extra open reading frame (orf) at the ′ end of the fipv genome, lacking in tgev, which is currently designated orf b. both ccv and fecv possess b-related orfs at the ′ ends of their genomes. the presence of orf b in three of four viruses in this antigenic cluster strongly suggests that tgev has lost this orf by deletion. the ccv orf b is collinear with that of fipv, but the predicted amino acid sequences are only % identical. the fecv orf b contains a large deletion compared to that of fipv, reducing the collinear part to %. the sequence homologies were highest between ccv and tgev on the one hand and between fecv and fipv on the other. previously, we showed that the expression product of the fipv orf b can be detected in infected cells by immunoprecipitation (vennema et al., ). in the present study we have performed similar experiments with ccv and fecv. in infected cells both viruses produced proteins related to but different from the fipv b protein. canine coronavirus (ccv), feline enteric coronavirus (fecv), feline infectious peritonitis virus (fipv), and transmissible gastroenteritis virus (tgev) of swine belong to one antigenic cluster within the family coronaviridae (siddel et al., ) . sequence analysis revealed a close genetic relatedness between fipv and tgev (jacobs et al., ; de groot et al., ; vennema et a/., ) . fipv contains an extra open reading frame (orf) in the '-terminal region of its genome (de groot et a/., ) . it is the second orf of mrna which is currently designated orf b, according to the new nomenclature (cavanagh et al., ) . the first orf of mrna , designated orf a, is the counterpart of tgev orf , previously called orf-x (kapke and brian, ; rasschaert et al., ) or orf- (britton et a/., ) . comparison of orfs a and revealed that the fipv genome contained an in frame insertion of nucleotides (de groot et a/., ) . the protein product of tgev orf was identified in tgev-infected cells (garwes et al., ) . recently, the b gene was shown to be expressed in fipv-infected cells (vennema et a/., ) . it is a glycoprotein which is released into the extracellular medium and is not stably associated with virus particles. in cats it induces antibodies during natural and experimental fipv infections. therefore, the b protein provides an antigenic distinction between fipv and tgev. the aim of the ' to whom reprint requests should be addressed. present study was to examine whether this distinction could be extended to ccv and fecv. we determined the genomic organization of the ' end of the viral genomes and investigated whether these viruses produced proteins related to the b protein of fipv. fipv strain -l , fecv strain -l (mckeirnan et a/., ; obtained from dr. j. evermann), ccv strain k (dutch field isolate, obtained from dr. h. flare), and ccv strain l- (binn et a/., ) were grown in fe/is catus whole fetus cells (fcwf-d; obtained from dr. n. c. pedersen) and crandell feline kidney cells (crfk). recombinant vaccinia virus vtf - (fuerst eta/., ; obtained from dr. b. moss) infections were carried out in hela cells. cells were maintained in dulbecco's modified eagle's medium (gibco laboratories) containing % fetal bovine serum. cloning and sequence analysis of the ' end of ccv cdna libraries were prepared of intracellular poly(a)containing rna from ccv-infected fcwf-d cells as described elsewhere (wesseling et al., manuscript in preparation) . clones containing sequences derived from the 'end of the genome were selected by colony hybridization with restriction fragments of fipv cdna clone b (de groot eta/., ) as probes. nucleotide sequencing was performed by the dideoxy chain termi-nation procedure (sanger et a/., ) using doublestranded dna and a bacteriophage t dna polymerase based kit (pharmacia, lkb). sequence data were analyzed using the computer programs of devereux et a/. ( ). cdna synthesis and pcr amplification of the ' end of fecv total intracellular rna was isolated from fecv-infected fcwf-d cells as described (chomczynski and sacchi, ) . synthesis of cdna on total rna was pet-formed as described (kawasaki and wang, ) by priming specifically with synthetic oligonucleotide (y-ccagllltagacatcggg- ', reverse complement of nucleotides -l ; de groot et al., ) which binds to a sequence in the ' noncoding region of fipv, downstream of orf b. oligonucleotide ( '-gatccagacgttagctc- ', reverse complement of nucleotides -l ; de groot et a/., ), was used to prime cdna synthesis from a position closer to the ' end. amplification of cdna was performed by the polymerase chain reaction (pcr) as described (kawasaki and wang, ) , after the addition of synthetic oligonucleotide , '-gatgacacacaggltgag- ', which is identical to the carboxyl-terminus of the nucleocapsid (n) protein gene of fipv (nucleotides -l ; vennema et a/., ) . the positions of the primers are indicated in fig. . pcr-amplified fecv cdna fragments were isolated from agarose gel, oligo-dc tailed with terminal transferase and cloned after annealing with oligo-dg-tailed puc (pharmacia lkb). sequence analysis was performed as described above for ccv cdna clones, with puc/m primers and with the primers used for pcr amplification. the ccv b gene was isolated from cdna clone cl as a /-/pall-pstl fragment and recloned in pbluescript sk-(stratagene) digested with accl and pstl, yielding pbsc b. the b gene fragment was recloned from this construct as a xhol-psrl fragment into the vector part of ptfgb, (vennema et a/., ) digested with the same enzymes. the final construct was designated ptc b. the fecv b gene was recloned from cdna-pcr clone fe as a spel-pstl fragment in the vector part of ptfgb, prepared by digestion with spel and pstl. this construct was designated pte b. all constructs were used in the transient t expression system with recombinant vaccinia virus vtf - producing the t rna polymerase (fuerst et a/., ; obtained from dr. b. moss). lysates from coronavirus-or vaccinia virus-infected cells were prepared after metabolic labeling with l-[ s]cysteine (icn biomedicals, inc.). lysis, ripa with ascites fluid from a field case of fip, and endo-p-nacetylglucosaminidase h (endo h; boehringer-mannheim biochemicals) treatment were carried out as described (vennema et a/., ) . the ascites fluid contains antibodies to all viral proteins of fipv identified so far, which are cross-reactive with proteins from ccv, fecv, and tgev. endo-p-n-acetylglucosaminidase f (endo f; boehringer-mannheim biochemicals) digestions were carried out for hr at " in mm potassium phosphate buffer, ph . , mll/l edta, % triton x-l , . % sodium dodecyl sulphate (sds), % -mercaptoethanol. analysis by sds-polyacrylamide gel electrophoresis (sds-page) was performed as described (laemmli, ) . sequence analysis of the ' end of the ccv genome ccv cdna clones were prepared and selected as described under materials and methods. most clones were derived from ccv strain k , a field isolate from the netherlands (fig. ) . a clone derived from the laboratory strain l- (binn et al., ) was partially analyzed. the nucleotide sequences from these strains were more than % identical. we obtained a contiguous sequence of strain k , extending . kb from the poly(a)-tail in the ' direction ( fig. ) . translation of the nucleotide sequence revealed three orfs corresponding to the n protein and orfs a and b of fipv. the organization of the 'end of the ccv genome was compared to that of fipv and tgev (fig. ). ccv contains an orf b and an orf a with additional nucleotides which are lacking in orf of tgev. the amino acid sequences were aligned with the corresponding sequences of fipv and tgev to determine the percentages of identical amino acid residues (table ). the n and a amino acid sequences have a higher level of identity when compared between ccv and tgev than between ccv and fipv. the same was found when the nucleotide sequences were compared. the b amino acid sequences of ccv and fipv were only % identical and several small insertions in the ccv sequence were found. nevertheless, the hydrophobicity plots of the putative b proteins were remarkably similar (data not shown), including a short hydrophobic amino-terminus, which may function as a signal sequence. in contrast to the fipv orf b, the ccv orf b contains no potential n-glycosylation site. pcr amplification of cdna derived from the ' end of the fecv genome the nucleotide sequences flanking the orfs a and b of fipv and ccv and orf of tgev were aligned to design primers for cdna synthesis and polymerase chain reaction (pcr) amplification. the positions of the primers are indicated in fig. . synthetic oligonucleotide was used to prime cdna synthesis on total rna isolated from fecv and ccv-infected cells. the cdna synthesis was followed by pcr amplification after addition of primer . the ccv product had the expected size of approximately kbp (data not shown). the fecv product was considerably smaller, being approximately bp. the controls with rnafrom mockinfected cells and without rna were both negative. the sequence analysis presented below revealed that the fecv orf b extended into the sequences used to design the pcr primers. therefore, cdna synthesis and pcr amplification were repeated with synthetic oligonucleotides and , resulting in a fragment of approximately bp (data not shown). the pcr products of fecv were cloned and sequenced. several independent clones were analyzed (fig. ) leading to a contiguous sequence of nucleotides which ends approximately nucleotides upstream of the poly(a)-tail (fig. ) . comparison with the corresponding sequence of the fipv genome showed a single deletion of nucleotides and an overall sequence identity of . %. translation of the nucleotide sequence revealed the presence of two orfs similar to the fipv orfs a and b. the a polypeptides are virtually identical, with only one amino acid difference. the deletion is located in orf b. the fecv and fipv b sequences are collinear for the amino-terminal amino acid residues. in this part the identity is %. the deletion results in a shift to the - reading frame which extends codons. the orf specifies a polypeptide with a total length of amino acid residues and a predicted mol wt of , . the protein sequence predicts a short hydrophobic aminoterminus, probably acting as a signal sequence and one n-glycosylation site. the genomic organization of the fecv ' end is similar to fipv and ccv, which all contain an orf b and the extra nucleotides in orf a as compared to tgev orf (fig. ) . paired alignments of the collinear parts of the amino acid sequences with the corresponding sequences of fipv, ccv, and tgev revealed that fecv is more closely related to fipv than to ccv and tgev (table ) . similar homologies were found by comparing the nucleotide sequences (data not shown). the fipv b protein was readily detected in lysates of fipv-infected cells (vennema et a/., ) . it comigrated in sds-page with an expression product of the cloned b gene which was prepared by using the recombinant vaccinia virus t rna polymerase expres- sion system (fuerst et a/., ) . to identify the ccv and fecv b proteins in a similar way, their b orfs were recloned in a t expression vector. the resulting constructs ptc b and ptegb, respectively, and ptf b containing the fipv b gene (vennema et a/., ) were used to transfect hela cells infected with recombinant vaccinia virus vtf - , which produces t rna polymerase (fuerst et a/., ) . the expression products were analyzed by metabolic labeling with [ s]cysteine, ripa, and endo h treatment followed by sds-page (fig. ) . the ccv and fecv b proteins appeared to be slightly smaller than the fipv b protein, the fecv b protein being the smallest. digestion with endo h which cleaves high-mannose n-linked oligosaccharides, resulted in an approximately mol wt reduction of the fecv and fipv b protein. the ccv b protein, however, was not affected and was also insensitive to digestion by endo f, which cleaves complex n-linked sugars (data not shown). these observations indicate that fecv and fipv are glycoproteins while ccv b is not. the shift in molecular weight of the fecv and fipv b proteins is consistent with the removal of one sugar side chain (neuberger et a/., ) . this is in agreement with the predicted numbers of glycosylation sites in the amino acid sequences. the observed molecular weights of the ccv b protein and of the fecv b protein after deglycosylation are also in agreement with those predicted from the amino acid sequences. the recombinant expression products were compared to the proteins produced in ccv-, fecv-, and fipv-infected cells, which were analyzed similarly (fig. ) . all three matched with a protein in the sample from the corresponding coronavirus-infected cell lysate. in the latter samples the three known structural proteins also appeared: the membrane (m), nucleocapsid (n), and spike (s) proteins. in all cases the m protein was partially resistant to endo h digestion. the same was observed for the b protein in fipv-infected cells. the lanes of fecv were overexposed to reveal the b protein band. this indicates that the expression level of the fecv b protein was much lower than that of ccv and fipv. the genomic organization of the ' end of fipv differs from that of tgev in that it contains an additional orf (de groot et a/., ). recently, we identified the expression product of this extra gene, designated b (vennema et al., ) . these observations prompted us to study ccv and fecv of the same antigenie cluster. sequence analysis showed that their genomic organization in the 'terminal region is similar to that of fipv. therefore, the presence rather than the absence of orf b appears to be the common theme, suggesting that tgev has lost the corresponding orf by deletion. the same inference probably holds true for the nucleotides that are present in all a orfs but not in the corresponding orf of tgev. deletions appear to happen frequently during coronavirus evolution. they occur, for example, in the s and he protein genes of murine hepatitis virus (mhv; parker et al., ; la monica et a/., ) in the s protein gene of porcine respiratory coronavirus (prcv; rasschaert et al., ) and in the region between the s and m protein genes of mhv strain s (yokomori and lai, ) of a small plaque variant of tgev (wesley et al., ) and of prcv (rasschaert et a/., ) . among the feline coronaviruses another deletion was found recently in fecv - as compared to fipv in the region between the s and m protein genes (e. lewis and h. vennema, unpublished data) . alignment of nucleotide and amino acid sequences of tgev, ccv, fipv, and fecv revealed a close relationship among the strains of this cluster (table ) . the four strains could be divided into two pairs on the basis of their homologies, tgev and ccv on the one hand and fipv and fecv on the other. both in ccv-and in fecv-infected cells b proteins are produced. their characterization showed that the fecv b protein is glycosylated, like the fipv b protein, while the ccv b protein is not. the observation that fipv, ccv, and fecv induce the synthesis of b proteins appears to compromise their antigenic distinction. however, the differences between the b proteins may allow discrimination using, e.g., monoclonal antibodies. the deletion of nucleotides in fecv -l was revealed bycdna-pcr, allowing discrimination from ccv (fig. ) and fipv -l (data not shown). it remains to be determined whether this is a universal distinguishing property of fipv and fecv. the feline coronaviruses used in this study are almost the same with respect to growth in tissue culture, protein composition, and antigenicity (boyle et a/., ; fiscus and teramoto, ) . small differences were also reported; the n protein of fecv is slightly smaller than that of fipv (tupper et al., ) . recently, a monoclonal antibody specific for the s protein of strain - was characterized (hohdatsu et al., ) . the close resemblance and the low incidence of fip despite the high proportion of feline coronavirus (fcv) seropositive cats have led to the hypothesis that fecv carriers are the source of fipv which is generated de nova from fecv by minor mutations (pedersen et a/., ; pedersen ) . our sequence comparisons show that fipv -l and fecv -l are related more closely to each other than they are to ccv. therefore, fipv -l did not originate from fecv - by insertion of genetic information; it would be too much of a coincidence that an insertion with % identity is present in exactly the same position in ccv. an alternative mechanism for de nova generation of fipv could be recombination, which is an established phenomenon for coronaviruses (lai, ) . avirulent fipv-strains and/or fecv-strains are and sds-page analysis of lysates from ccv-, fecv-, fipv-, and vtf - -infected cells, recombinant vaccinia virus vtf - -infected cells were transfected with the plasmid dnas ptcgb, ptegb, and ptfgb, as indicated above the lanes. one-half of each sample was treated with endo h, the other half was mock treated (indicated with + and -, respectively). structural proteins (s, n, and m) are indicated. in addition, the m protein bands are indicated with arrowheads. the region of the gel in which the b protein bands appear overlaps with that of m protein bands. recovery and characterization of a coronavirus from military dogs with diarrhoea. froc plaque assay, polypeptide composition and immunochemistry of feline infectious peritonitis virus and feline enteric coronavirus sequence of the nucleoprotein gene from a virulent british field isolate of transmissible gastroenteritis virus and its expression in saccharomyces cerevisiae recommendations of the coronavirus study group for the nomenclature of the structural proteins mrnas, and genes of coronaviruses single step method of rna isolation by acid guanidium thiocyanate-phenol-chloroform extraction sequence analysis of the b'end of the feline coronavirus fipv - genome: comparison with the genome of porcine coronavirus tgev reveals large insertions a comprehensive set of sequence analysis programs for the vax antigenic comparison of feline coronavirus isolates: evidence for markedly different peplomer glycoproteins eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage t rna polymerase the polypeptide of m, of porcine transmissible gastroenteritis virus: gene assignment and intracellular location antigenic analysis of feline coronaviruses with monoclonal antibodies (mabs): preparation of mabs which discriminate between fipv strain -l and fecv strain - the nucleotide sequence of the peplomer gene of porcine transmissible gastroenteritis virus (tgev): comparison with the sequence of the peplomer protein of feline infectious peritonitis virus (fipv) sequence analysis of the porcine transmissible gastroenteritis corona virus nucleocapsid protein gene detection of gene expression. ln "pcr technology: principles and applications for dna amplification cleavage of structural proteins during assembly of the head of bacteriophage t rna recombination in animal and plant viruses localization of extensive deletions in the structural genes of two neurotropic variants of murine coronvirus jhm molecular cloning. a laboratory manual isolation of feline coronavirus from two cats with diverse disease manifestations carbohydrate-peptide linkages in glycoproteins and methods for their elucidation sequence analysis reveals extensive polymorphism and evidence of deletions within the e glycoprotein gene of several strains of murine hepatitis virus animal infections that defy vaccination: equine infectious anemia, caprine encephalitis, maedi-visna, and feline infectious peritonitis virus pathogenicity studies of feline coronavirus isolates - and - porcine respiratory coronavirus differs from transmissible gastroenteritis virus by a few genomic deletions enteric coronavirus tgev: partial sequence of the genomic rna, its organization and expression dna sequencing with chain termination inhibitors the biology of coronaviruses antigenic and biological diversity of feline coronaviruses: feline infectious peritonitis and feline enteritis virus a novel glycoprotein of feline infectious peritonitis coronavirus contains a kdel-like endoplasmic reticulum retention signal. f. viral intracellular transport of recombinant coronavirus spike proteins: implications for virus assembly. . viral primary structure of the membrane and nucleocapsid protein genes of feline infectious peritonitis virus and immunogenicity of recombinant vaccinia viruses in kittens genetic basis for the pathogenesis of transmissible gastroenteritis virus mouse hepatitis virus s rna sequence reveals that nonstructural proteins ns and ns a are not essential for murine coronavirus replication. f. viral the authors thank raoul de groot and willy spaan for critical reading of the manuscript. j.w. was supported by a grant from solvay-duphar b.v., weesp, the netherlands. key: cord- -l ugjou authors: yaling, zhou; ederveen, j.; egberink, h.; pensaert, m.; horzinek, m. c. title: porcine epidemic diarrhea virus (cv ) and feline infectious peritonitis virus (fipv) are antigenically related date: journal: arch virol doi: . /bf sha: doc_id: cord_uid: l ugjou using gut sections from pigs infected with porcine epidemic diarrhea virus (strain cv ) and ascitic fluid from cats which had succumbed to feline infectious peritonitis (fip), a weak cross reaction was found by immunofluorescence. its specificity was confirmed when detergent-treated purified cv showed a prominent reaction with fipv antibodies in elisa; no reaction was obtained with intact virions, which indicated common determinants on an internal component of the particle. antigenic cross-reactions at the nucleocapsid level were found in western blot elisa performed both ways (cv /fipv antibodies; fipv/cv antibodies). in immunoprecipitation using [( )s]methionine labelled fipv, anti-cv sera recognized exclusively the nucleocapsid protein. the significance of these findings for the classification of coronaviruses is discussed. porcine epidemic diarrhea is an acute viral disease in swine of all ages. particles of the cv strain of porcine epidemic diarrhea virus possess typical coronavirus morphology [- , ] and morphopoiesis [ ] . however, antigenic relationships between cv and established coronaviruses have hitherto not been detected [ ] . coronaviruses show a characteristic pattern of structural polypeptides: a peplomer protein with apparent molecular weight (mr) of , to , , a nucleocapsid protein of mr , to , and an envelope protein of mr , to , [ , ] . recent studies from our laboratory have demonstrated that cv is similar in this respect: it possesses a glycosylated surface protein of mr , to , , an envelope protein of mr , to , and an unglycosylated rna-binding protein of mr , [ ] . [ ] , c o m p l e m e n t fixation [ , ] , gel diffusion [ ] , immunofluorescence (ift) [ , , ] , enzyme linked imm u n o s o r b e n t assay (elisa) [ ] or, recently, immuno-electron microscopy (iem) [ ] . using i e m and ift, an antigenic relationship between cv and several coronaviruses had not been found in a previous study [ ] . in the present paper, the problem is re-examined with the aid of m o r e sensitive techniques such as immunoblotting and immunoprecipitation. as will be shown, cv is indeed antigenically related to a coronavirus at the nucleocapsid level. for ift, frozen sections gm thick were prepared from the jejunum of a cesarean-derived colostrum-deprived (cdcd) piglet which had been experimentally infected with the cv isolate; frozen sections from the jejunum of a non-infected cdcd piglet were prepared in the same way to serve as a control. the cv antigen for the elisa and immunoblot assay was prepared from faecal material collected from an experimentally infected cdcd piglet. twenty ml of the faecal suspension was clarified by centrifugation at , x g for minutes. the virus was then concentrated by centrifugation at , × g and °c for hours. the supernatant was discarded and the peliet was resuspended in ml of tes buffer ( mm tris-hc , ph . , mm edta, ram nac ). after another centrifugation at , × g for minutes, the virus-containing supernatant was saved and kept frozen until use. feline infectious peritonitis virus (fipv) strain - was grown in cells of the norden laboratories feline kidney (nlfk) line. for immunoblot assays, fipv infected nlfk cell lysate was used, with mock infected lysate serving as a control. monolayers of nlfk cells were inoculated with fipv as described before [- ] . after to hours, the medium was removed from the infected and mock-infected cells, respectively, and the monolayers were washed once with phosphate buffered saline (pbs, . m phosphate buffer ph . , . m nac ). the cells in a cm costar flask were lysed by adding ml of lysis buffer ( . % triton x- , . % naphthalene disulfonic acid-na and . m phenylmethyl sulfonyl fluoride in tes buffer: . m tris. hc ph . , mm edta, . m nac ), and the lysate were clarified by centrifugation at , x g for minutes. anti-cv hyperimmune sera had been prepared in cdcd piglets. the ascitic fluids used as a source of fipv antibody (a , a , a ) had been collected from naturally infected cats. a specified pathogen-free cat serum had been obtained from the centraal proefdierenbedrijf tno, zeist, the netherlands. for direct blot-elisa, the anti cv hyperimmune serum was purified by standard ammonium sulphate precipitation and deae-sephacel (pharmacia fine chemicals ab, uppsala, sweden) chromatography; the purified immunoglobulins were conjugated with horseradish peroxidase (hrp, boehringer mannheim gmbh, federal republic of germany) according to wilson and nakane [ ] . the ift was performed on frozen sections of cv -infected and non-infected jejunum samples. the tissues were fixed onto glass slides with precooled acetone at - °c. after cycles of washing with pbs ( minutes each) the tissues were overlaid with : dilutions of pig antiserum and cat ascitic fluids, respectively, followed by incubation in a moist chamber at °c for minutes. after more washes, the fitc-conjugated rabbit antiswine igg or rabbit anti-cat igg (nordic immunological laboratories, titburg, the netherlands) diluted in pbs were pipetted onto the tissues and the slides were incubated as before and rinsed again. they were mounted with % glycerol in pbs and examined with a fluorescence microscope. the elisa was carried out in -well flat bottom microtiter plates (bioreba f). the wells were coated overnight at °c with gl-volumes of triton x- ( %) pretreated and native cv antigen ( . - . gg), respectively, diluted in coating buffer. after cycles of washing with a . m nac solution containing . % tween , gl-volumes of antiserum diluted in a buffer consisting of . m naci, mm edta, . m tris ph . , . % tween and % foetal calf serum (fcs) were pipetted into the wells, and the plates were incubated for hours at °c. they were then washed as described above and the proteins in the respective antigen preparations were separated by electrophoresis in . % polyacrylamide gels in the presence of sodium dodecyl sulphate (sds-page) and were electrophoretically transferred to nitrocellulose sheets (ba , . lain, schleicher und schuell, dassel, federal republic of germany) using a lkb novablot electrophoretic transfer unit (lkb-produkter ab, bromma, sweden) at . ma/cm for hour in continuous transfer buffer ( mm glycine, mm tris, . % sds and % methanol). after transfer, the nitrocellulose filters were blocked overnight at room temperature using gelaton buffer ( . % pig skin gelatin, . % triton x- in pbs). the filters were incubated at °c for hour on a rocker platform with the antisera diluted in gelatin buffer. after washings with gelatin buffer ( minutes each at room temperature), the filters were incubated with hrp-conjugated anti-species igg at °c for another hour. they were then washed times as above and once with pbs alone. the enzyme reaction was visualized by soaking the filters in freshly prepared substrate solution ( . mg/ml , -diaminobenzidine tetrahydrochloride from sigma, st. louis, mo, u.s.a. and . % h in pbs). the reactions were stopped by submerging the filters in % trichloroacetic acid. mock-and fipv-infected monolayers of nlfk cells in c m costar flasks were labelled with [ s]methionine starting at hours after infection. the medium was removed, the monolayers were rinsed once with pbs and ml of methionine-free eagle's minimum essential medium (gibco) supplemented with % foetal fcs and gci [ s]methionine (specific activity, , ci/mm; amersham international) was added. arer another hour of incubation, cell lysates (in gl) were prepared as described above. label incorporation was determined after precipitation with % tca using a liquid scintillation counter. for rip, ~tl of [ s]methionine-labelled fipv or mock infected cell lysate containing approximately , cpm was diluted with gl lysis buffer and mixed with ~d-volumes of undiluted serum or ascitic fluid. immune complexes were allowed to form at room temperature for hour, and subsequently kc (final concentration . m) and gl of a % suspension of formaldehyde-fixed staphylococcus aureus cells were added. after incubation for minutes at room temperature, the immune complexes were pelleted at , x g, washed times with tes buffer containing . % triton x- and resuspended in laemmli sample buffer ( mm tris-hc ph . , % glycerol, % sds, % -mercaptoethanol). the proteins were analyzed in . % gels by sds-page and fluorography as described previously [ ] . both pig anti cv hyperimmune serum and cat f i p ascitic fluids showed fluorescence in cv infected epithelial cells of the small intestinal villi. with heterologous antibody, the fluorescence was m u c h weaker than with homologous serum; however, distribution of fluorescent cells in the tissue was identical to the positive control (results not shown). n o fluorescence was seen when pig antiserum or fip ascitic fluids were tested on normal gut sections or when a negative pig serum and an spf cat serum were tested on cv -infected sections ( table ) . since these results suggested a cross-reaction between fipv antibodies and cv antigen, we attempted to confirm the reaction by elisa. in order to detect possible cross-reactions also at the level of internal virion proteins, cv was disrupted with triton x- and the results were compared with those obtained with intact virus. the positive/negative (p/n) ratios were calculated by dividing the absorbance readings obtained with the positive sera or ascitic fluids (p) by the values obtained with the negative sera (n). a quotient of . would mean that no specific reaction has occurred. we obtained p / n ratios in the homologous reaction of . - . for disintegrated virus and of . + . for the native cv preparation, respectively. a n average p / n ratio of . - . (p< . ) was found when fip ascitic fluid a had reacted with triton x- treated cv whereas a ratio of . - . obtained with native cv antigen. we concluded from these observations that the heterologous reaction involved internal components of cv . as a next step, immunoblotting experiments were designed to identify the viral subunit responsible lbr the cross reaction. figure shows the western blot-elisa of cv proteins with homologous and heterologous antibodies. when homologous antiserum was used, prominent bands were seen at positions corresponding to mr of , and , ; they probably relate to the rnabinding protein of mr , found in % gels [ ] and its degradation product. at the same positions bands were seen in the lane with fip ascitic fluid was used. at these mr locations, bands were absent in the lanes where a preimmunization pig serum or a spf cat serum had been used. in the second series of experiments, we studied the inverse reaction, i.e. fipv antigen with homologous and cv antibodies (fig. ) . using fip ascitic fluid, a strong band with a calculated mr of , and three additional bands between mr , and , (representing the nucleocapsid and envelope proteins, respectively, of fipv) [ , ] can be seen. when an anti cv hyperimmune serum is used, a band is seen occupying the same place as the fipv nucleocapsid protein. porcine epdidemic diarrhea virus immune sera from belgium and the netherlands gave identical patterns (results not shown). the specificity of the reaction was confirmed by the empty appearance of the lanes where negative cat and pig serum had been used. no reaction was found at the nucleocapsid protein position when blots of a mock infected n l f k cell lysate had been incubated with anti-cv antibodies. immunoblotting would not detect reactions with conformation-dependent antigenic determinants. to show the reaction between homologous or heterologous antibodies and fipv antigens under non-denaturing condition, immunoprecipitation was employed using [ s]methionine labelled infected and non-infected cell lysates. the inverse experiment was not performed since cv virus cannot be grown and labelled in culture. as shown in figure , results of the rip confirmed the cross-reaction between pig anti-cv sera and the , protein of fipv found in western blots; the homologous reaction reveals the typical pattern of fipv structural polypeptides with mr of , (peplomer), , (nucleocapsid) and , to , (envelope). no precipitation was seen in this mr range using a negative pig serum or a mock infected lysate. porcine epidemic diarrhea virus, strain cv has been tentatively classified as a member of the family coronaviridae based on its morphologic, morphogenetic and physico-chemical properties [ , ] . characteristics of the viral structural polypeptides supported this taxonomic proposal [ ] . we now present evidence for an antigenic relatedness between cv and fipv which provides a decisive argument in favor of the classification of cv as a coronavirus: in figs. to , a two-way cross reaction is shown between the nucleocapsid at the present time, coronaviruses are assigned to four antigenic clusters. in , pedersen et al. studied eight mammalian coronaviruses and established two groups on the basis of cross-reactivities by immunofluorescence; the authors found that viruses within one group were antigenically unrelated to members of the second group [ ] . we have confirmed the finding of cross reactions within one group, namely between transmissible gastroenteritis virus (tgev) of swine, fipv and canine enteric coronavirus, and showed that common determinants are present on all three structural polypeptides [ ] . surprisingly, another study at the virion subunit level revealed an antigenic relatedness between mouse hepatitis virus type (mhv) and human coronavirus (hcv) e which had been assigned to different clusters [ - . also, the hcv e nucleocapsid protein can be detected by antisera directed against tge, mhv and hemagglutinating encehalomyelitis virus (hev) of swine [- ]. we have obtained preliminary evidence in immunoblotting assays that mhv strain a and avian infectious bronchitis virus (ibv) strain m cross-react at the nucleoprotein level [niesters , unpublished observations], as do also fipv and hev [yaling , unpublished observations]. these observations, together with the finding that amino acid sequences are conserved between coronaviruses from different antigenic clusters [ ] , indicate that common antigenic determinants may exist which are suitable for the identification of many, if not all, members of the family. zhou yaling et al. we have reported earlier that antigenic cross-reactions between cv and other coronaviruses could not be detected by ift [ ] . using elisa, immunoblotting and rip in the present study, however, we did find a cross reaction of cv with fipv. upon re-examination, a reaction was also seen by ift, which--when assessed by itself--would have appeared too weak to be considered as specific. several explanations can be offered for the discrepancies obtained with the different techniques. the selected polyclonal antiserum may be crucial. it has been demonstrated that, e.g., fip ascitic fluids may lack antibodies against one or two of the three viral proteins [ ] . since a cross reaction may exist at the level of only one of them--as found in this study--the antigenic relationship may thus escape detection. cross-reactivities may vary with different serological variants of the viruses compared (e.g., m h v and hcv); the existence of antigenic differences between fip viruses should also be taken into account [ , ] . due to its low sensitivity, the fluorescent antibody technique is not ideal for the examination of viral cross reactivities and contradictory results have indeed been obtained [ , , , ] . in view of the high frequency of mutation and recombination of coronaviruses, the establishment of antigenic clusters within the family may be of only limited value. antigenic relationships amongst coronaviruses some structural and antigenic properties of a new porcine coronavirus, cv . enterites virales/viral enteritis evidence for a coiled-coil structure in the spike proteins of coronaviruses in vivo morphogenesis of a new porcine enteric coronavirus, cv characterization of the structural proteins of porcine epizootic diarrhea virus (cv ) serological relationships of the subcomponents of human coronavirus strain e and mouse hepatitis virus strain antigenic relationships among homologous structural polypeptides of porcine, feline and canine coronaviruses virion polypeptide specificity of immune complexes and antibodies in cats inoculated with feline infectious peritonitis virus enzyme-linked immunosorbent assay for coronaviruses hcv e and mhv cleavage of structural proteins during the assembly of the head of bacteriophage t classification and nomenclature of viruses antigenic relationships among the coronaviruses of man and between human and animal coronaviruses antigenic relationship of the feline infectious peritonitis virus to coronaviruses of other species a new coronavirus-like particle associated with diarrhea in swine an immuno electron microscopic and immunofluorescent study on the antigenic relationship between the coronavirus-like agent, cv , and several coronaviruses translation of three mouse hepatitis virus strain a subgenomic rnas in xenopus laevis oocytes the structure and replication of coronaviruses the molecular biology of coronaviruses recent development in the periodate method of conjugating horseradish peroxidase (hrpo) to antibodies untersuchungen fiber die antigenverwandtschaft der viren der felinen infekti sen peritonitis und der transmissiblen gastroenteritis des schweines comparative antigenic studies on coronaviruses we wish to thank dr. p. callebaut, ghent, belgium, and dr. van nieuwstadt, cdi, lelystad, the netherlands for providing faecal suspensions and gut material from cv infected piglets, and pig anti cv hyperimnmne sera. we are indebted to norden laboratories, lincoln, nebraska, u.s.a. for providing the nlfk cell line. key: cord- -lq knxgf authors: takano, tomomi; satoh, kumi; doki, tomoyoshi; tanabe, taishi; hohdatsu, tsutomu title: antiviral effects of hydroxychloroquine and type i interferon on in vitro fatal feline coronavirus infection date: - - journal: viruses doi: . /v sha: doc_id: cord_uid: lq knxgf feline infectious peritonitis (fip) is a viral disease with a high morbidity and mortality by the fip virus (fipv, virulent feline coronavirus). several antiviral drugs for fip have been identified, but many of these are expensive and not available in veterinary medicine. hydroxychloroquine (hcq) is a drug approved by several countries to treat malaria and immune-mediated diseases in humans, and its antiviral effects on other viral infections (e.g., sars-cov- , dengue virus) have been confirmed. we investigated whether hcq in association with interferon-ω (ifn-ω) is effective for fipv in vitro. a total of μm of hcq significantly inhibited the replication of types i and ii fipv. interestingly, the combination of μm of hcq and ( ) u/ml of recombinant feline ifn-ω (rfifn-ω, veterinary registered drug) increased its antiviral activity against type i fipv infection. our study suggested that hcq and rfifn-ω are applicable for treatment of fip. further clinical studies are needed to verify the combination of hcq and rifn-ω will be effective and safe treatment for cats with fip. coronaviruses are single-stranded positive-sense rna viruses in the subfamily orthocoronavirinae of the family coronaviridae [ ] . coronaviruses are important pathogens causing life-threatening infectious disease in mammals and birds [ ] . in humans, outbreaks of the novel coronavirus ( -ncov, official name is severe acute respiratory syndrome-related coronavirus : sars-cov- ) occurred worldwide [ ] . feline infectious peritonitis (fip) is a fatal, immune-mediated disease caused by feline coronavirus (fcov) [ ] . fcov is a member of the species alphacoronavirus- , genus alphacoronavirus, in the subfamily orthocoronavirinae. it is divided into two serotypes based on the amino acid sequence of the spike (s) protein, serotype i fcov, and serotype ii fcov [ ] . the majority of fcov infections are subclinical (avirulent fcov is known as feline enteric coronavirus: fecv; type i and type ii fecv) [ ] . however, several mutations occurred in the s protein, leading to development of the virulent type called feline infectious peritonitis virus (fip virus, fipv; type i and type ii fipv) [ , ] . fipv infection typically causes a fatal disease in cats known as fip. the hallmark pathological findings of fip in cats are serous fluid in peritoneal and pleural cavities, and pyogranulomatous lesions in the internal organs and brain [ ] . the absorbance of formazan produced was measured at nm using a -well spectrophotometric plate reader, as described by the manufacturer. percentage cell viability was calculated using the following formula: cell viability (%) = [(od of compound-untreated cells -compound-treated cells)/(od of compound-untreated cells)] × . the % cytotoxicity concentration (cc ) was defined as the cytotoxic concentration of each compound that reduced the absorbance of treated cells to % when compared with that of the untreated cells. confluent fcwf- cell monolayers were cultured in medium with or without compounds at the indicated concentrations in -well multi-plates at • c for h or h. cells were washed and the virus (moi . ) was adsorbed into the cells at • c for h. after washing, cells were cultured in . % carboxymethyl cellulose (cmc)-mem or mem with or without compounds. in the case of cells cultured in cmc-mem, the cell monolayers were incubated at ºc for h, fixed, and stained with % crystal violet solution containing % buffered formalin, and the resulting plaques were then counted. the percentage of the decrease or increase in plaques was calculated using the following formula: percentage of the plaque reduction (%) = [(plaque number of compound-treated cells)/(plaque number of compound-untreated cells)] × . the ec was defined as the effective concentration of compounds that reduced the virus titer in the culture supernatant of infected cells to % when compared with that of the virus control. in the case of cells cultured in mem, the culture supernatants were collected h post-infection, and virus titers were measured by the tcid assay. the nucleocapsid (n) protein levels of fipv-infected fcwf- cells were determined by an immunofluorescence assay (ifa), as described previously [ ] . briefly, fipv-infected cells were washed pbs and fixed with % paraformaldehyde at rt for min. the cells were incubated with mab yn- (fipv n protein-specific mab) at • c for min. after washing, the cells were incubated with goat anti-mouse-igg conjugated to fluorescein (jackson immunoresearch, pa, usa) at • c for min. after washing, the cells were stained with , -diamidino- -phenylindole (dapi; dojindo laboratories, kumamoto, japan) at rt for min. the stained cells were analyzed using leica dm b microscope and las x integrated imaging system (leica microsystems, wetzlar, germany). data from only two groups were analyzed using the student's t-test (welch's t-test) and those of multiple groups were analyzed by one-way anova followed by tukey's test using microsoft excel software and open-source statistical graphpad prism (graphpad software, ca, usa). a p-value of < . was considered statically significant. cytotoxicity assay was performed to clarify the non-toxic concentration of cq and hcq against fcwf- cells (figure ). the cc of cq and hcq was . µm ( figure a ) and . µm ( figure b) , respectively. hcq was less toxic ( . %) than cq in feline cells. the antiviral activity of compounds against both serotypes of fipv was evaluated using plaque inhibition assay. the ec of cq and hcq against fipv-i ku was . µm ( figure a ) and . µm ( figure b ), respectively. the ec of cq and hcq against fipv-ii - was . µm ( figure a ) and . µm ( figure b) , respectively. therefore, the antiviral effects of hcq on fipv were comparable to those of cq. based on these results, hcq was suggested to be a safer anti-fipv drug than cq. the antiviral activity of hcq and rfifn-ω in fcwf- cells for a prolonged time ( h) was investigated. to evaluate and assess the antiviral effects of hcq ( μm) and rfifn-ω ( u/ml), we used strains of serotype i fipv (fipv-i ucd , fipv-i ucd , and fipv-i ku ) and strain of serotype ii fipv (fipv-ii - ). the virus titers of both serotypes of fipv significantly decreased in the culture supernatant of cells pretreated with hcq or rfifn-ω ( figure ). we evaluated the antiviral effects of the combination of hcq and rfifn-ω. the combination of these drugs strongly suppressed the replication of viruses in fcwf- cells. when both μm hcq and u/ml of rfifnω were added, fcwf- cell viability was . ± . %. the antiviral activity of hcq and rfifn-ω in fcwf- cells for a prolonged time ( h) was investigated. to evaluate and assess the antiviral effects of hcq ( µm) and rfifn-ω ( u/ml), we used strains of serotype i fipv (fipv-i ucd , fipv-i ucd , and fipv-i ku ) and strain of serotype ii fipv (fipv-ii - ). the virus titers of both serotypes of fipv significantly decreased in the culture supernatant of cells pretreated with hcq or rfifn-ω ( figure ). we evaluated the antiviral effects of the combination of hcq and rfifn-ω. the combination of these drugs strongly suppressed the replication of viruses in fcwf- cells. when both µm hcq and u/ml of rfifn-ω were added, fcwf- cell viability was . ± . %. the antiviral activity of hcq and rfifn-ω in fcwf- cells for a prolonged time ( h) was investigated. to evaluate and assess the antiviral effects of hcq ( μm) and rfifn-ω ( u/ml), we used strains of serotype i fipv (fipv-i ucd , fipv-i ucd , and fipv-i ku ) and strain of serotype ii fipv (fipv-ii - ). the virus titers of both serotypes of fipv significantly decreased in the culture supernatant of cells pretreated with hcq or rfifn-ω ( figure ). we evaluated the antiviral effects of the combination of hcq and rfifn-ω. the combination of these drugs strongly suppressed the replication of viruses in fcwf- cells. when both μm hcq and u/ml of rfifnω were added, fcwf- cell viability was . ± . %. we investigated whether hcq and rfifn-ω, which acted on fipv in fcwf- cells for a short time ( h), exhibit antiviral activity. as shown in figure , type i fipv and type ii fipv replication was significantly inhibited by hcq and rfifn-ω. interestingly, the combination of these drugs strongly decreased the replication of type i fipvs in fcwf- cells, but not type ii fipv. viruses , , x for peer review of we investigated whether hcq and rfifn-ω, which acted on fipv in fcwf- cells for a short time ( h), exhibit antiviral activity. as shown in figure , type i fipv and type ii fipv replication was significantly inhibited by hcq and rfifn-ω. interestingly, the combination of these drugs strongly decreased the replication of type i fipvs in fcwf- cells, but not type ii fipv. we evaluated the antiviral activity of hcq and rfifn-ω against type i fipv after viral infection. hcq and rfifn-ω were added to the cells h after inoculation. as shown in figure , type i fipv replication was significantly inhibited by hcq and rfifn-ω, and the combination of these drugs strongly decreased the replication of virus. we investigated the expression of viral proteins in order to evaluate the antiviral effects of the combination of hcq and rfifn-ω on fipv. the n protein levels of fipv-i ku- were specifically decreased in fcwf- cells pre-treated (short-time exposure) and post-treated with hcq and rfifn-ω we evaluated the antiviral activity of hcq and rfifn-ω against type i fipv after viral infection. hcq and rfifn-ω were added to the cells h after inoculation. as shown in figure , type i fipv replication was significantly inhibited by hcq and rfifn-ω, and the combination of these drugs strongly decreased the replication of virus. viruses , , x for peer review of we investigated whether hcq and rfifn-ω, which acted on fipv in fcwf- cells for a short time ( h), exhibit antiviral activity. as shown in figure , type i fipv and type ii fipv replication was significantly inhibited by hcq and rfifn-ω. interestingly, the combination of these drugs strongly decreased the replication of type i fipvs in fcwf- cells, but not type ii fipv. we evaluated the antiviral activity of hcq and rfifn-ω against type i fipv after viral infection. hcq and rfifn-ω were added to the cells h after inoculation. as shown in figure , type i fipv replication was significantly inhibited by hcq and rfifn-ω, and the combination of these drugs strongly decreased the replication of virus. we investigated the expression of viral proteins in order to evaluate the antiviral effects of the combination of hcq and rfifn-ω on fipv. the n protein levels of fipv-i ku- were specifically decreased in fcwf- cells pre-treated (short-time exposure) and post-treated with hcq and rfifn-ω we investigated the expression of viral proteins in order to evaluate the antiviral effects of the combination of hcq and rfifn-ω on fipv. the n protein levels of fipv-i ku- were specifically decreased in fcwf- cells pre-treated (short-time exposure) and post-treated with hcq and rfifn-ω ( figure ). in contrast, post-treatment with hcq and rfifn-ω slightly affected the protein levels of fipv-ii - in fcwf- cells. viruses , , x for peer review of ( figure ). in contrast, post-treatment with hcq and rfifn-ω slightly affected the protein levels of fipv-ii - in fcwf- cells. fip is a fatal coronaviral infection of cats. several drugs have been identified aiming at the treatment of fip, but no commercial drugs can be used to treat fip by veterinarians. we have searched for a drug applicable to treat fip among commercial drugs [ , ] . cq is an antimalarial drug and improved symptoms of cats with fip [ ] . however, increased liver enzymes were observed in some cats treated with cq. increased liver enzymes are observed in cats with fip, but the possibility of cq-induced liver disorder was also suggested. if there is a drug with cytotoxicity weaker than that of cq that exhibits comparable antiviral effects, it may be applicable as a therapeutic drug for fip. we focused on hcq, which is -aminoquinoline similar to cq [ ] . the cytotoxicity of hcq has been reported to be lower than that of cq in mouse, rat, and dog [ ] . in addition, hcq has been demonstrated to have antiviral effects on sars-cov- infection equivalent to those of cq in vitro [ ] . we confirmed that hcq has anti-fipv activity equivalent to that of cq. moreover, cytotoxicity of hcq setting the criterion to cc was one-third or lower than that of cq. accordingly, hcq is applicable to fip treatment as a substitute for cq. hcq at μm significantly inhibited the replication of both serotypes of fipv. to our knowledge, the pharmacokinetics of hcq in cats have not been analyzed. thus, it is necessary to refer to pharmacokinetic data of hcq in dogs. the tolerated dose of intramuscular injection of hcq is mg/kg [ ] . in dogs treated with mg/kg of hcq, the plasma hcq level reaches . μm ( μg/l) [ ] , i.e., it is difficult to make the plasma hcq level reach μm in dogs. however, it has been reported that the tissue hcq levels in the liver, spleen, kidney, and lung increased to a level several hundred-times higher than the plasma level [ ] . therefore, hcq administration to cats with fip within the low dosage may be expected to yield sufficient therapeutic effects. on the other hand, it is unclear whether the pharmacokinetics described above can apply to cats. cytochrome p (cyps) are involved in the metabolism of hcq [ ] . generally, cyp activities could be lower in cats than in dogs [ ] . on the basis of this fact, the blood concentrations of hcq in cats will be higher than those in dogs. therefore, pharmacokinetic studies are still needed to use hcq in cats. the antiviral agent rfifn-ω has a wide safety range and is practically used to treat feline viral infection in veterinary practice. many points are unclear as to whether rfifn-ω is effective as a therapeutic drug for fip. fip is a fatal coronaviral infection of cats. several drugs have been identified aiming at the treatment of fip, but no commercial drugs can be used to treat fip by veterinarians. we have searched for a drug applicable to treat fip among commercial drugs [ , ] . cq is an antimalarial drug and improved symptoms of cats with fip [ ] . however, increased liver enzymes were observed in some cats treated with cq. increased liver enzymes are observed in cats with fip, but the possibility of cq-induced liver disorder was also suggested. if there is a drug with cytotoxicity weaker than that of cq that exhibits comparable antiviral effects, it may be applicable as a therapeutic drug for fip. we focused on hcq, which is -aminoquinoline similar to cq [ ] . the cytotoxicity of hcq has been reported to be lower than that of cq in mouse, rat, and dog [ ] . in addition, hcq has been demonstrated to have antiviral effects on sars-cov- infection equivalent to those of cq in vitro [ ] . we confirmed that hcq has anti-fipv activity equivalent to that of cq. moreover, cytotoxicity of hcq setting the criterion to cc was one-third or lower than that of cq. accordingly, hcq is applicable to fip treatment as a substitute for cq. hcq at µm significantly inhibited the replication of both serotypes of fipv. to our knowledge, the pharmacokinetics of hcq in cats have not been analyzed. thus, it is necessary to refer to pharmacokinetic data of hcq in dogs. the tolerated dose of intramuscular injection of hcq is mg/kg [ ] . in dogs treated with mg/kg of hcq, the plasma hcq level reaches . µm ( µg/l) [ ] , i.e., it is difficult to make the plasma hcq level reach µm in dogs. however, it has been reported that the tissue hcq levels in the liver, spleen, kidney, and lung increased to a level several hundred-times higher than the plasma level [ ] . therefore, hcq administration to cats with fip within the low dosage may be expected to yield sufficient therapeutic effects. on the other hand, it is unclear whether the pharmacokinetics described above can apply to cats. cytochrome p (cyps) are involved in the metabolism of hcq [ ] . generally, cyp activities could be lower in cats than in dogs [ ] . on the basis of this fact, the blood concentrations of hcq in cats will be higher than those in dogs. therefore, pharmacokinetic studies are still needed to use hcq in cats. the antiviral agent rfifn-ω has a wide safety range and is practically used to treat feline viral infection in veterinary practice. many points are unclear as to whether rfifn-ω is effective as a therapeutic drug for fip. the combination of hcq and rfifn-ω blocked virus production in type i fipv-infected cells, but although the duration of activity was only h, the antiviral activity of these drugs decreased in type ii fipv-infected cells. we previously demonstrated that types i and ii fipv enter the cytosol through late and early endosomes, respectively [ ] . we also reported that type ii fipv strongly inhibited type i ifn expression [ ] . based on this knowledge and our current study, type ii fipv may show less effect on the antiviral activity of hcq and type i ifn, compared to type i fipv. there are some reports about the relationship between hcq and type i ifn. wang et al. reported that hcq inhibited dengue virus infection in all serotypes in vitro [ ] . they suggested that the induction of interferon or related protein is an antiviral activity mechanism of hcq. on the other hand, inhibition of type i ifn production in hcq-treated cells has been reported [ ] , being contradictory to other findings. we confirmed that potent antiviral activity was induced by the combination of hcq and rfifn-ω (type i ifn). although negative action on type i ifn may have been induced by hcq, type i ifn added at the same time may have canceled this. to demonstrate this, further investigation is necessary. in this study, we confirmed that hcq is a safer anti-fipv drug than cq. in addition, we demonstrated that the combination of hcq and rfifn-ω increases the antiviral activity. our study revealed that these fip therapeutic drugs are applicable to veterinary practice. it should be noted that in vitro data do not always translate into in vivo efficacy. therefore, a deeper understanding of pharmacokinetics of the combination between hcq and rfifn-ω will be needed in cats. an overview of their replication and pathogenesis the species severe acute respiratory syndrome-related coronavirus: classifying -ncov and naming it sars-cov- feline coronaviruses: pathogenesis of feline infectious peritonitis molecular cloning and sequence determination of the peplomer protein gene of feline infectious peritonitis virus type i natural feline coronavirus infection: differences in cytokine patterns in association with the outcome of infection spike protein fusion peptide and feline coronavirus virulence mutation in spike protein cleavage site and pathogenesis of feline coronavirus efficacy and safety of the nucleoside analog gs- for treatment of cats with naturally occurring feline infectious peritonitis efficacy of a c-like protease inhibitor in treating various forms of acquired feline infectious peritonitis effect of chloroquine on feline infectious peritonitis virus infection in vitro and in vivo animal toxicity and pharmacokinetics of hydroxychloroquine sulfate hydroxychloroquine, a less toxic derivative of chloroquine, is effective in inhibiting sars-cov- infection in vitro hydroxychloroquine-inhibited dengue virus is associated with host defense machinery regulation of type i interferon responses homogeneous production of feline interferon in silkworm by replacing single amino acid code in signal peptide region in recombinant baculovirus and characterization of the product treatment of canine parvoviral enteritis with interferon-omega in a placebo-controlled challenge trial feline calicivirus infection: abcd guidelines on prevention and management the use of recombinant feline interferon omega therapy as an immune-modulator in cats naturally infected with feline immunodeficiency virus: new perspectives use of recombinant feline interferon and glucocorticoid in the treatment of feline infectious peritonitis effect of feline interferon-omega on the survival time and quality of life of cats with feline infectious peritonitis orf -encoded accessory protein a of feline infectious peritonitis virus as a counteragent against ifn-α-induced antiviral response a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies antiviral activity of itraconazole against type i feline coronavirus infection therapeutic effect of an anti-human-tnf-alpha antibody and itraconazole on feline infectious peritonitis pharmacologic actions of -aminoquinoline compounds mechanisms of action of hydroxychloroquine and chloroquine: implications for rheumatology cytochrome p -mediated hepatic metabolism of new fluorescent substrates in cats and dogs endocytic pathway of feline coronavirus for cell entry: differences in serotype-dependent viral entry pathway differential induction of type i interferon by type i and type ii feline coronaviruses in vitro hydroxychloroquine is associated with impaired interferon-alpha and tumor necrosis factor-alpha production by plasmacytoid dendritic cells in systemic lupus erythematosus this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license the authors are grateful to their colleagues. the authors declare no conflict of interest. key: cord- -tph n ak authors: kim, yunjeong; liu, hongwei; galasiti kankanamalage, anushka c.; weerasekara, sahani; hua, duy h.; groutas, william c.; chang, kyeong-ok; pedersen, niels c. title: reversal of the progression of fatal coronavirus infection in cats by a broad-spectrum coronavirus protease inhibitor date: - - journal: plos pathog doi: . /journal.ppat. sha: doc_id: cord_uid: tph n ak coronaviruses infect animals and humans causing a wide range of diseases. the diversity of coronaviruses in many mammalian species is contributed by relatively high mutation and recombination rates during replication. this dynamic nature of coronaviruses may facilitate cross-species transmission and shifts in tissue or cell tropism in a host, resulting in substantial change in virulence. feline enteric coronavirus (fecv) causes inapparent or mild enteritis in cats, but a highly fatal disease, called feline infectious peritonitis (fip), can arise through mutation of fecv to fip virus (fipv). the pathogenesis of fip is intimately associated with immune responses and involves depletion of t cells, features shared by some other coronaviruses like severe acute respiratory syndrome coronavirus. the increasing risks of highly virulent coronavirus infections in humans or animals call for effective antiviral drugs, but no such measures are yet available. previously, we have reported the inhibitors that target c-like protease ( clpro) with broad-spectrum activity against important human and animal coronaviruses. here, we evaluated the therapeutic efficacy of our clpro inhibitor in laboratory cats with fip. experimental fip is % fatal once certain clinical and laboratory signs become apparent. we found that antiviral treatment led to full recovery of cats when treatment was started at a stage of disease that would be otherwise fatal if left untreated. antiviral treatment was associated with a rapid improvement in fever, ascites, lymphopenia and gross signs of illness and cats returned to normal health within days or less of treatment. significant reduction in viral titers was also observed in cats. these results indicate that continuous virus replication is required for progression of immune-mediated inflammatory disease of fip. these findings may provide important insights into devising therapeutic strategies and selection of antiviral compounds for further development for important coronaviruses in animals and humans. coronaviruses comprise a large family of rna viruses that infect a wide variety of mammalian and avian hosts causing a broad spectrum of diseases. coronaviruses have a single-stranded, positive-sense rna genome and are classified into four genera of alpha-, beta-, gamma-, and deltacoronaviruses [ ] . coronaviruses are prone to mutation and recombination during replication and this propensity has contributed to the existing diversity of coronaviruses [ , ] . sudden emergence of new coronaviruses transmitted from animal hosts, severe acute respiratory syndrome coronavirus (sars-cov) and, more recently, middle east respiratory syndrome coronavirus (mers-cov), has raised awareness about the potential risks of highly virulent coronavirus infections in humans with increasing close contact between humans and animals harboring coronaviruses. however, effective therapeutic measures for coronavirus infections have been elusive so far despite the extensive efforts in the development of anti-coronavirus agents [ ] [ ] [ ] [ ] [ ] . shifts in tissue or cell tropism and resulting changes in virulence have also been reported for coronaviruses; porcine respiratory coronavirus causes mild respiratory infection in pigs and presumably arose from transmissible gastroenteritis virus (tgev), the etiologic agent of gastroenteritis in young pigs with a high fatality, by spontaneous mutations and/or deletions in its genome [ ] . seemingly innocuous coronavirus infection can also be turned deadly by changing its tropism, exemplified by mutation of feline enteric coronavirus (fecv) to feline infectious peritonitis virus (fipv) [ , ] . feline infectious peritonitis (fip) has intrigued researchers for half a century since its first description in the s [ ] . infection with fecv which causes inapparent or mild enteritis is widespread among cats, especially in high-density environments, and has little clinical consequence. however, a small portion of cats develop fip during the course of fecv infection and succumb to the disease. published studies support that fip arises in individual cats through mutation of the virus to gain tropism for macrophages [ ] [ ] [ ] [ ] [ ] and that the immune system of the infected cats plays an important role in the pathogenesis of fip [ ] . fip occurs in two major forms, effusive (wet) form or non-effusive (dry) form. the wet form is more common ( - % of fip cases) and characterized by accumulation of fluids in the abdominal and/or, to a lesser degree, chest cavities [ ] . granulomatous vasculitis is frequently found in the omentum, mesenteric lymph nodes, and serosal surface of the large intestine, resulting in the characteristic exudates rich in protein and inflammatory cells in the body cavities in wet fip [ ] . the majority of exudate cells are virusinfected macrophages and high virus load is detected in these cells [ ] . multiple granulomatous lesions composed of macrophages laden with viruses and other inflammatory cells typically form in various tissues and organs, such as the omentum, mesenteric lymph nodes, spleen and liver, in both forms of fip [ ] . clinical symptoms of fip reflect the organs involved and include fever, jaundice, bodily effusions and weight loss and may also affect the central nervous system and the eyes [ ] . virus-induced immunopathogenesis and lymphopenia in cats with fip are features also frequently associated with other coronavirus infections, such as sars and mers in humans. the causes for lymphopenia observed in these coronavirus infections are not fully elucidated but the published reports support that lymphopenia is related to the indirect effects of virus infection [ ] [ ] [ ] . lymphopenia associated with massive apoptosis of uninfected t-cells is a prominent feature of both experimental and natural fip [ , , , ] and implicated with cytokines secreted by the virus-infected macrophages and other immune cells [ , ] . lymphopenia precedes the onset of clinical signs and is associated with disease progression and death in experimental fip, which indicates that impaired cellular immune responses associated with lymphocyte depletion is important in fip pathogenesis [ , ] . once cats develop classic clinical signs, fatality to fip is virtually % [ , [ ] [ ] [ ] and the median survival time from the time of diagnosis to death or euthanasia is about - days [ , ] . fip is a leading cause of death among young cats under years of age and estimated to kill in to cats worldwide [ , ] . fip also affects endangered exotic cats in zoos, such as jaguars and cheetahs [ ] . however, vaccines have proven ineffective and treatment is only palliative [ ] . studies of anti-coronavirus drugs have mainly focused on the discovery of anti-sars-cov agents. effective treatment intervention for coronavirus infections with an immunopathological component, such as sars, mers and fip, is speculated to involve the judicious use of immunomodulatory agents to enhance protective host immunity and decrease pathological immune responses and antiviral drugs to directly inhibit viral replication. we have previously reported several series of small synthetic peptidyl compounds that target a virally-encoded protease, c-like protease ( clpro) [ ] [ ] [ ] . coronavirus clpro and papain-like protease (plp) process viral polyproteins into functional individual proteins and their structures are highly conserved among coronaviruses. since viral proteases are indispensable for virus replication, many synthetic small molecules or natural compounds targeting clpro or plp of coronaviruses have been investigated using the in vitro systems [ ] [ ] [ ] [ ] [ ] . however, only few studies tested the in vivo efficacy of protease inhibitors in experimental animals [ , ] . deng et at [ ] reported that a plp inhibitor failed to reduce virus titers in the lung or increase the survival of mice infected with a mouse-adapted sars-cov, presumably due to low bioavailability or stability of the inhibitor. recently, we demonstrated that our clpro inhibitors significantly decreased the virus titers and pathology in the liver of mice infected with murine hepatitis virus (mhv), a murine coronavirus [ ] . in those studies, treatment was started shortly before or after virus infection in asymptomatic mice. here we extended our previous work on coronavirus clpro inhibitors and investigated the pharmacokinetics (pk), safety and efficacy of a clpro inhibitor in cats. gc is a clpro inhibitor which is previously reported to be active against the clpro of multiple coronaviruses, including sars-cov [ ] , but with highest potency against fipv in cell culture. in this study, we determined that gc exhibited favorable bioavailability and safety in cats. in the in vivo efficacy study using gc in cats experimentally infected with fipv, antiviral treatment was started after the cats reached a clinical stage that would ultimately lead to death, if untreated. antiviral treatment caused a rapid reversal of clinical signs and lymphopenia and reduction in viral titers in the macrophages from the ascites. active infection was no longer apparent after - days of antiviral treatment and the treated cats have remained normal under observation for as long as eight months. these results provide important first evidence that a clpro inhibitor is effective at reversing disease progression when administered to cats in an advanced and invariably fatal stage of experimentally induced fip. pharmacokinetics study of gc in cats gc (fig ) is a representative compound of the dipeptidyl transition state clpro inhibitors [ ] [ ] [ ] ] whose synthesis was described previously [ ] . npi shares homologous structural elements with gc , except that npi has an additional residue of -naththylalanine compared to gc in a position that corresponds to the p position [ ] , using the nomenclature of schechter and berger [ ] (fig ) . the comparable antiviral activity of gc and npi against the replication of feline coronavirus in a cell culture system was previously reported (fig ) [ , ] . however, their pk properties have not been reported. in this study, we investigated the drug plasma concentration changes in healthy specific pathogen free (spf) [ , ] and the % cytotoxic concentration (cc ) values of gc or npi determined in various cell lines were previously reported [ , ] and summarized in a table. cats of - month age (n = for each compound) following single subcutaneous (s.c.) dose of mg/kg gc or mg/kg npi . serial blood samples were then collected and the plasma drug concentrations were measured. previously, we reported that gc is converted into an aldehyde form by the removal of the bisulfite group, and the aldehyde form forms a reversible covalent bond with the nucleophilic cysteine residue of clpro in the x-ray crystallography studies [ ] . we also observed the conversion of npi into its aldehyde form in the blood. therefore the aldehyde forms of gc or npi were measured in the plasma samples. fig a shows the plasma drug concentrations over time following single-dose administration of gc (red triangles) or npi (black circles). the pk study results indicate that gc is rapidly absorbed after s.c. administration and the peak plasma level was reached within hr after injection. the mean plasma drug concentrations remained above the % effective concentration (ec ) value of the aldehyde form of gc ( ng/ml) for hrs post injection (fig a, red triangles) . the plasma drug concentrations following injection of mg/kg npi stayed above the ec value of the aldehyde form of npi ( ng/ml) for hrs post injection (fig a, black circles) . the maximum detected plasma drug concentration following npi administration was substantially lower than that of gc by . -fold. this result indicate that gc was more easily absorbed than npi via the tested route, even when the lower dose of npi ( mg/kg), compared to gc ( mg/kg), was taken into account. after the dosage regimen of gc was determined in the pk study, safety of gc was evaluated in four healthy spf cats of - months of age. the cats were administered with mg/kg gc by s.c. injection twice daily at am and pm for weeks. for the duration of the study, they were observed daily for adverse effects. blood samples were taken weekly and the complete blood counts and blood chemistry panels were conducted. during the study period, in the single-dose pharmacokinetics study, two healthy specific pathogen free (spf) cats were subcutaneously injected with gc at mg/kg/dose or npi at mg/kg for the determination of serial plasma drug concentrations. gc and npi are readily converted into aldehyde forms in the blood [ ] . the red triangles and black circles indicate the plasma concentrations of the aldehyde forms of gc and npi , respectively (means and standard error of the means are shown). (b) in the safety study, four healthy spf cats were subcutaneously given gc at mg/kg/dose daily at am and pm for weeks. during that time, plasma drug concentrations were measured at and hr post-injection for the first three days and weekly thereafter (red and black triangles, respectively, means are shown). the dotted red line indicates the ec value of gc . the % cytotoxic concentration (cc ) value of gc (> μm) is greater than the dotted blue line. there were no clinically significant changes in vital signs and clinical lab parameters (s a-s d fig) , indicating that the dosage and the route of administration of gc was well-tolerated in cats for the duration of the safety study. during the safety study, additional blood samples were taken at and hr post drug administration for the first three days and then weekly for weeks. the plasma drug concentrations at hr post administration were determined from the blood collected immediately before next drug administration and thus represent the minimum drug levels in the plasma. the results show that the lowest plasma drug concentrations remained above the ec value (fig b black triangles) and that the highest determined drug concentrations were well below the cc value which is greater than μm in cell culture [ ] (fig b red triangles) . based on the results from the safety and the pk studies, the dose and administration route of gc was determined to be suitable for the in vivo efficacy study. the experimental infection of cats with serotype i fipv that induces wet fip has been reported previously [ , , ] . fipv is classified into serotypes i and ii based on virus neutralization tests. serotype i fipv is responsible for the majority ( - %) of naturally-occurring fip [ , [ ] [ ] [ ] [ ] . in this experimental infection, an absolute lymphopenia, fever, weight loss, jaundice and inapparent to mild ascites appear within - weeks after infection. increasing jaundice and ascites occur during the next - weeks. all the cats that develop lymphopenia and clinical signs following experimental infection do not spontaneously recover but succumb to the disease [ , , ] . to investigate the efficacy of gc , we conducted two independent studies. in these studies, antiviral treatment was started after the infected cats developed the typical laboratory finding of absolute lymphopenia and clinical symptoms to determine whether treatment with gc is effective in reducing the severity of symptoms or fatality. in both studies, the infected cats were monitored daily for fever, body weight, and outward disease signs and weekly for lymphocyte counts. in the first efficacy study, four spf cats of - months of age (p , p , p and p ) were intraperitoneally administrated with a cat-passaged serotype i fipv (fipv-m c- ) [ , , ] . following infection, they developed lymphopenia and clinical symptoms including inapparent or mild ascites within - days post infection (dpi) ( table ). in the second study, the ascites of four spf cats of - months of age inoculated with the same virus (p , p , p and p ) were allowed to progress to more profound, classical abdominal effusions, which closely resemble those of cats with naturally-occurring fip frequently presented at the clinics (table ) . however, in order to alleviate suffering, the latter four cats were given meloxicam, a non-steroidal anti-inflammatory drug, and subcutaneous fluids prior to antiviral treatment. this supportive treatment was discontinued before antiviral drug treatment commenced. the eight cats from both studies developed jaundice, inapparent to profound ascites, absolute lymphopenia ( ~ /μl, reference range , to , /μl) and high fever (up to . °c) (fig b and d , table ) before antiviral treatment was started. they also lost body weight up to . % of their pre-infection weight during this same period (fig c) . when they reached this stage, twice daily s.c. administration of gc at - mg/kg/dose was started. these cats were treated for - days, except for p and p that were euthanized after and days after starting antiviral treatment based on the severe nature of their clinical signs ( fig a) . all six remaining cats showed rapid improvement in attitude and resolution of fever ( fig b) . the profound absolute lymphopenia observed in all cats prior to antiviral treatment also returned to normal before the next blood testing one week later ( fig d) and weight losses were reversed and normal growth resumed ( fig c) . ascites and scrotal swelling indicative of peritonitis also gradually resolved after a week of antiviral treatment. all cats that received antiviral treatment for - days appeared normal by clinical observation and laboratory testing. the six recovered cats from both studies have remained healthy showing no signs of relapse during an observation period up to months. these experiments demonstrate that the protease inhibitor was able to reverse disease progression when treatment was initiated at advanced clinical stages of fip. since fipv is highly associated with tissues and is not reliably detected in blood at high levels in cats with fip [ ] , assessment of the efficacy of antiviral drugs in reducing the viral load poses a difficulty in live animals. although measuring virus titers of the exudate macrophages from the ascites allows to determine the effects of antiviral drug against the replication of fipv, ascites rapidly decreased with antiviral treatment and we were not able to collect ascites in the recovered cats. however, we determined the viral load in two cats from the second study (p and p ) prior to and during antiviral treatment. these cats were euthanized after and days of antiviral treatment. on necropsy, both cats had severe pancreatitis, a possible complication of meloxicam treatment, but no lesions (p ) or mild lesions (p ) typical of fip were found. virus titers in the macrophages from the ascites were determined by real-time quantitative rt-pcr and the ct values were analyzed by the comparative ct method using the β-actin as a reference gene [ ] . the results showed that viral rna level in the macrophages from the ascites decreased commensurately with the duration of antiviral treatment in these cats. the fold reduction of viral rna level determined using the delta delta ct method was , . in p that received day-antiviral treatment ( fig a) and , . in p that received dayantiviral treatment (fig b) , compared to the pre-treatment viral rna level in the macrophages of each cat. the viral rna levels ( -Δct ) in the macrophages from the ascites are summarized in fig d. the viral rna level in the omentum of p and p is also shown in fig c. based on these results, the reduction in virus titers in p and p seems to correlate with the necropsy findings of mild or no fip lesions in those cats. these results on viral titers show that fipv clpro is a valid target for fipv antiviral drugs and gc can effectively reduce the virus load in the macrophages from the ascites and the omentum of cats with fip. serial passages of fipv- in crandell rees feline kidney (crfk) cells in the presence of gc or npi (an aldehyde form of npi ) were conducted to compare the emergence of viral resistance under drug pressure. at passage number , the ec value of npi against fipv increased by -fold, compared to wild-type virus at the same passage number. however, a decrease in antiviral activity of gc against fipv was not observed at up to passages. the sequence analysis of the clpro gene of npi -resistant fipv viruses collected from passage revealed a single mutation of serine to cysteine at the position of , which is located between the β-strands cii and dii in the domain ii (s a fig). since these compounds share similar structure, we also investigated whether npi -resistant viruses retain susceptibility to [ ] and fipv (red) modelled based on tgev clpro (pdb id: f ) [ ] . the clpro of tgev and fipv are highly conserved with the amino acid sequence identity of > %. however, clpro of tgev, mers-cov and sars-cov have low amino acid sequence identity of about %. nonetheless, they share well conserved overall structure (s a fig). the activity of gc was previously reported against the clpro of sars-cov using a fret assay [ ] . however, its activity against the clpro of mers-cov and fipv is unknown. therefore, we cloned and expressed the full-length clpro of fipv and mers-cov following the procedures described previously [ ] . the results are summarized in fig . the data show that gc was most effective against fipv clpro by a fret assay but it also substantially inhibited the activity of mers-cov and sars-cov clpro. since fip disease progression is quite rapid and the pathogenesis of fip is primarily immunemediated, an important question has remained unanswered as to whether antiviral drug treatment can effectively reverse disease progression in symptomatic hosts. it was previously shown that anti-inflammatory agent or antiviral immunity enhancing agents increased survival of mice infected with mouse-adapted sars-cov and treated with a nf-kb inhibitor [ ] or various toll-like receptor agonists [ , [ ] [ ] [ ] , which was started shortly before or after virus infection. these reports indicate that controlling immune responses may prove an effective therapeutic strategy for coronavirus infections where inflammation plays an important role in pathogenesis. however, the available data on the efficacy of antiviral compounds failed to show sufficient effectiveness in mice infected with mouse-adapted sars-cov, even when treatment was started at the same time or shortly after virus infection [ , ] . the observed low effectiveness of antiviral treatment is largely thought to be due to the use of compounds with weak anticoronavirus activity and/or bioavailability. however, the lack of available potent antiviral compounds against coronaviruses has made it difficult to investigate the effects of antiviral treatment in animals with lethal coronavirus infection. our clpro inhibitors were previously reported to be potent against fipv in the in vitro assays [ , ] and effective at significantly reducing viral titers and tissue pathology in mice infected with mhv [ ] . however, these clpro inhibitors have not been tested in cats. in this study, a clpro inhibitor, gc , was determined to be safe with good bioavailability in cats. in the in vivo efficacy study using cats with fip, the antiviral treatment started for cats at clinically advanced stages led to rapid normalization of the numbers of lymphocytes, during which time, fever, jaundice and ascites also resolved. the granulomatous lesions typically found in various organs in the cats infected with fipv were not found or greatly reduced in the two cats that were euthanized after only and days of antiviral treatment. these results demonstrate that continuous virus replication is important in the progression of the immune-mediated pathogenesis of fip and that controlling virus replication by a directly-acting antiviral compound targeting coronavirus clpro is effective at reversing fip disease. our results provide the first evidence, to our best knowledge, that a direct-acting antiviral agent is effective at reversing the immune-mediated disease progression caused by coronavirus infection, even when antiviral treatment was started at clinically advanced stages. this finding may have important implication in devising effective therapeutic strategies for other coronavirus infections. the conserved active site of coronavirus clpro has been considered as a promising target for the design of broad-spectrum inhibitors for coronavirus infections [ , ] and our group [ ] and others [ , , ] have previously reported the synthesis of clpro inhibitors with antiviral activity against multiple coronaviruses. gc was previously shown to be active against fipv in cell culture [ , ] and sars-cov clpro in a fret assay [ ] . in this study, we compared the activity of gc against the clpro of fipv, mers-cov and sars--cov by a fret assay and determined that gc has most potent activity against the clpro of fipv. the ic values of gc against mers-cov and sars-cov were . and . -fold, respectively, higher than that against fipv in a fret assay. these results indicate that gc is active against the clpro of coronaviruses belonging to alphacoronavirus (fipv) or the multiple clades in betacoronavirus (mers-cov and sars-cov), despite the low sequence identity of clpro among fipv, sars-cov, and mers-cov. the varying degree of effectiveness of gc against clpro of different coronaviruses may reflect a subtle difference in spatial structure fit of the compound in the active site of coronavirus clpro (s b and s c fig) . however, the antiviral activity of gc against the replication of these human coronaviruses has not yet been determined in cell culture or in the animal models. a majority of reported protease inhibitors that are shown to have inhibitory effects against various coronaviruses in the enzyme assay are tripeptidyl or bulkier compounds [ , [ ] [ ] [ ] [ ] and their antiviral activities in cell culture or in vivo properties are often not available. in this study, we compared the subcutaneous absorption of dipeptidyl and tripeptidyl clpro inhibitors. gc , a dipeptidyl compound, consists of a warhead, a gln surrogate structure in a position that corresponds to the p position, leu in the p position and a cap structure [ ] (fig ) . npi , a tripeptidyl compound, has homologous structural elements with gc , except that npi has an additional residue of -naththylalanine (fig ) . these two compounds have comparable antiviral activity against fipv in cell culture (fig ) [ ] . however, the peak plasma concentration following a subcutaneous injection of npi was considerably lower than that of gc , which indicates that gc is absorbed better than npi via the subcutaneous route. our results on these closely related compounds indicate that relatively small structural change (addition of a residue) can have profound effects in absorption, and therefore the bioavailability of compounds needs to be taken into consideration early during drug selection process. gc was also found to be well-tolerated in cats during the -week duration of twice daily administration, with plasma drug concentrations remaining above the ec value but well below the cc value. emergence of viral resistance is a major concern in antiviral therapy. the only available literature on protease inhibitor-resistant coronavirus [ ] reported that a clpro inhibitor (grl- ) has a low genetic barrier to mhv. in that study, resistant viruses were selected in passage numbers in the presence of the inhibitor in cell culture, but the resistant viruses were highly attenuated in mice. to study the development of viral resistance against our clpro inhibitors, we serially passaged fipv in the presence of mock (vehicle), gc or the aldehyde form (npi ) of npi . at passage , the ec value of npi increased by -fold, compared to wild-type viruses passaged without npi , indicating the emergence of npi -resistant viruses. the clpro gene of npi -resistant virus has a single mutation of s c which located between the cii and dii strands in the domain ii (s a fig). the role of this mutation in the clpro in conferring resistance to npi is currently not clear. however, the fact that serine at this position is conserved among all feline coronaviruses whose sequences are available and that c , the active site residue that forms a covalent bond with the warhead of the inhibitor, is on the same loop as s between the cii and dii strands (s a fig) suggest that this mutation may influence the conformation of the loop and positioning of the activesite residue for proteolysis. interestingly, deng et al [ ] also reported that one of the mutations on clpro of mhv which is partially resistant to grl- is located away from the catalytic site but in a position that may influence the conformation of the catalytic site. in contrast to npi , resistant viruses against gc have not been selected at up to passages. these results indicate that similarly structured compounds may have different levels of resistance barrier against coronavirus clpro. interestingly, npi -resistant viruses did not lose susceptibility to gc in cell culture, indicating that this mutation did not confer cross-resistance. the mechanisms underlying differences in resistance development to these inhibitors need to be defined, but it may be speculated that the small size of gc , compared to npi , makes it difficult for the virus to evade drug binding while retaining substrate cleavage capability. we are currently investigating the relative viral fitness of the resistant viruses and the role of the mutation in conferring resistance to npi . in summary, a representative compound, gc , of our dipeptidyl clpro inhibitor series was shown to be safe by the dosage regimen used in cats and effective at reversing the progression of fip even when the treatment was started at advanced clinical stages. based on these results, this compound may have the potential to be developed into a safe and effective drug for fip. furthermore, broad activity of this compound against important human coronaviruses, including mers-cov and sars-cov, suggest that our inhibitor series may serve as a platform for further optimization for those important viruses. the results of this study also suggest that similar intervention approaches targeting virally-encoded clpro warrant investigation for other existing and emerging coronavirus infections. random bred cats free of most common feline pathogens, including feline enteric coronavirus, were obtained from the feline nutrition breeding colony, school of veterinary medicine, uc davis. all animal experiments were conducted in strict compliance with the animal welfare act, phs policy and other federal statutes and regulations relating to animals and approved by the institutional animal care and use committee at university of california, davis (protocol number: ). the syntheses of gc and npi were previously described by our group [ , ] . in the single-dose pk study, two healthy spf cats of - months of age (n = for each compound) were subcutaneously injected with mg/kg gc or mg/kg npi dissolved in % etoh and % peg . blood samples were collected from each cat at , , , , , , and hrs following injection and plasma samples were prepared. the plasma drug concentrations were measured using routine high pressure liquid chromatography by frontage laboratories, inc (exton, pa). in the safety (multiple-dose) study, four healthy spf cats of - months of age were injected s.c. with a daily dose of gc ( mg/kg/dose dissolved in % etoh, % peg and % pbs) at am and pm for weeks. plasma samples were prepared for determination of drug concentrations at or hrs (immediately before the next dose) after drug administration for the first three days and weekly thereafter for weeks. measurement of plasma drug concentrations from the safety study was also performed by frontage laboratories, inc. during the safety study, cats were monitored twice daily for adverse effects and body weight was measured daily. prior to the first dose of gc and thereafter weekly, blood samples were collected from each cat for complete blood count and blood chemistry tests. a total of eight female or male spf cats of - months of age in two independently conducted studies were originally part of another published experiment concerning the role of genetics in susceptibility/resistance to fipv infection [ ] . in that study, cats were inoculated with catpassaged serotype i field strain fipv-m c- . among the cats that developed clinical and laboratory signs consistent with the abdominal effusive (wet) form of fip and progressed to the point where they would be inevitably fatal, eight cats were transferred to the drug efficacy study. four cats (p , p , p and p ) in the first study did not receive any medication other than gc . five doses of oral or subcutaneous meloxicam at . mg/kg/dose (once a day) as well as fluids were given to four cats (p , p , p and p ) in the second study for alleviation of pain and dehydration and discontinued before antiviral treatment was started. gc dissolved in % etoh, % peg and % pbs was given s.c. at am and pm for - days. p and p were given gc at mg/kg/dose for or days, respectively, and the dose was increased to mg/kg/dose until the end of antiviral treatment. p and p were euthanized following antiviral treatment of and days, respectively. all other cats received gc at mg/kg/dose during antiviral treatment. animals were observed daily for clinical signs and body weight and blood was collected weekly for lymphocyte counts. ascites were collected at multiple times before and during antiviral treatment from p and p for virus titration by real-time quantitative rt-pcr (qrt-pcr). the omentum samples were collected from p and p on necropsy. virus titers in the macrophages from the ascites and the omentum were determined by realtime qrt-pcr. ascites ( ml) collected from p and p were diluted at : in pbs containing units/ml heparin. after centrifugation, the cell pellets were incubated with μl rnalater (life technologies, ny, usa) for overnight at °c. cell pellets were then collected by centrifugation and stored at - °c until analysis. prior to total rna extraction, μl of pbs was added to the cell pellets. omentum was cut into a size of less than . cm and placed in volumes of rnalater. following overnight incubation at °c, samples were centrifuged for min at , rpm to remove supernatant and tissues were stored at - °c until analysis. total rna was extracted from the macrophages from the ascites and the omentum using rneasy mini kit (life technologies) and real-time qrt-pcr was conducted. the primers and a probe targeting the '-utr region of fipv are '-ggaggtacaagcaaccctatt- ' (a forward primer), '-gatccagacgttagct cttcc- ' (a reverse primer) and fam-agatccgc tatgacgagccaacaa-iowa black (a probe). the relative levels of viral rna in the samples were calculated by the comparative ct method [ ] using beta actin as a reference gene. the fold changes in viral rna level in the macrophages in the ascites collected during antiviral treatment were calculated using the viral rna level in the macrophage samples collected prior to the antiviral treatment. serial passages of fipv to generate viruses resistant to gc and npi sequential in vitro passage experiments using wild-type fipv- in the presence of gc or npi were performed to select resistant viruses. briefly, crfk cells were infected with fipv at an moi of . - in the presence of gc or npi ranging from . ~ μm. at each passage, supernatants containing viruses were passed on to fresh cells in the presence of gc or npi . control mock virus was passaged in the absence of drug following the same procedure. virus titers at certain passage numbers were determined by the % tissue culture infective dose assay and the fold changes in ec values relative to the wild-type virus were determined. after passages in the presence or absence of npi , total viral rna was isolated using the rneasy mini kit (invitrogen) and the clpro gene was sequenced following amplification by rt-pcr and analyzed for the presence of mutations. the viruses grown without the drug (mock) or npi -resistant viruses at passage number were purified three times by limiting dilution [ ] . to investigate if npi -resistant viruses are susceptible to gc , serial dilutions of gc or npi were added to confluent monolayers of crfk cells in -well plates or cells were mock-treated, and the cells were immediately infected with npi -resistant virus at an moi of . - . following incubation at °c until an extensive cytopathic effect was observed in the mock-treated well (up to hrs), cells were freeze-thawed for virus titration. the ec values were determined using graphpad prism software version (graphpad software, san diego, ca) following the procedures described previously [ , ] . the codon-optimized cdna encoding the full length clpro of fipv-m c- was amplified by rt-pcr using the omentum tissue from the cats infected with fipv-m c- . those of sars--cov (genbank: gu . ) and mers-cov (genbank: km ) were synthesized by genscript (piscataway, nj). the expression and purification of each clpro were conducted following a standard method described previously by our group [ ] . primers for mers clpro are; forward primer (attctagaaaggagatataccatgcat catcatcat catcatagcggtctggttaaaatgagcc) and reverse primer (atctcgagtcactg catcacaacacccataatc). primers for fipv clpro are; forward primer (attcta gaaaggagatataccatgcatcatcatcatcatcattctg gattgc gaaaaatggc) and reverse primer (atctcgaggcggccgctcactgact). fret assay was performed using a fluorogenic substrate (dabcyl-ktsavlq/sgfrkmeedans) derived from the cleavage sites on viral polyproteins of sars-cov [ ] and was synthesized by genscript. methods for fret assay were described previously by our group [ , ] . briefly, in the fret assay, clpro of fipv, mers-cov, or sars-cov were incubated with gc for min and the edans/dabcyl fret substrate derived from the cleavage sites on sars-cov polyprotein was added to the mixture. following incubation for min, the florescence signals were measured and the ic was calculated for each clpro [ ] [ ] [ ] . three-dimensional structural model of clpro the structural model of fipv clpro was built based on tgev clpro (pdb id: f ) [ ] using the easymodeller program (version . ) [ ] and superimposed on the clpro structure of mers-cov (pdb id: wme, teal) [ ] . the surface representation of the active sites of tgev (pdb id: f ) and mers-cov (pdb id: wme) were created with pymol (delano scientific) [ ] . [ ] and fipv clpro (red) modeled using modeller [ ] based on tgev clpro as a template (pdb id: f ) [ ] . the clpro of tgev and fipv are highly conserved with the amino acid sequence identity of > %. coronavirus clpro forms a dimer for function but only the monomer form is shown here. the tan rectangle contains the active site located in the cleft between the domains i and ii. the active site residues of clpro of mers-cov and fipv, cys and his, are shown in orange and blue colors, respectively. the residue (s ) mutated in the clpro of fipv resistant to npi , an aldehyde form of npi , is shown in purple. (b and c) surface representation of the active sites of clpro of tgev (pdb id: f ) [ ] (c) and mers-cov (pdb id: wme) [ ] (d). (b) the crystal structure of tgev clpro bound with gc (gray) in the s and s pockets of the active site of clpro was previously published by our group [ ] . the residues in the s and s pockets that form hydrogen bonds with gc are shown in yellow. (c) the s and s pockets of mers-cov clpro are shown in pink. the residues that can potentially form hydrogen bonds with gc are indicated. all images were newly prepared using pymol. (tif) virus taxonomy: ninth report of the international committee on taxonomy of viruses ed the molecular biology of coronaviruses discovery of seven novel mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the gene source of alphacoronavirus and betacoronavirus and avian coronaviruses as the gene source of gammacoronavirus and deltacoronavirus antiviral drugs specific for coronaviruses in preclinical development anti-sars coronavirus agents: a patent review ( -present) potential antivirals and antiviral strategies against sars coronavirus infections from sars to mers: crystallographic studies on coronaviral proteases enable antiviral drug design design of wide-spectrum inhibitors targeting coronavirus main proteases porcine respiratory coronavirus differs from transmissible gastroenteritis virus by a few genomic deletions a review of feline infectious peritonitis virus infection: - an update on feline infectious peritonitis: virology and immunopathogenesis feline infectious peritonitis: role of the feline coronavirus c gene in intestinal tropism and pathogenicity based upon isolates from resident and adopted shelter cats significance of coronavirus mutants in feces and diseased tissues of cats suffering from feline infectious peritonitis spike protein fusion peptide and feline coronavirus virulence phylogenetic analysis of feline coronavirus strains in an epizootic outbreak of feline infectious peritonitis mutation in spike protein cleavage site and pathogenesis of feline coronavirus levels of feline infectious peritonitis virus in blood, effusions, and various tissues and the role of lymphopenia in disease outcome following experimental infection mechanisms of lymphocyte loss in sars coronavirus infection a "possible" involvement of tnfalpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis tnf-alpha, produced by feline infectious peritonitis virus (fipv)-infected macrophages, upregulates expression of type ii fipv receptor feline aminopeptidase n in feline macrophages in vivo cytokine response to experimental feline infectious peritonitis virus infection natural history of a recurrent feline coronavirus infection and the role of cellular immunity in survival and disease effect of feline interferon-omega on the survival time and quality of life of cats with feline infectious peritonitis randomized, placebo controlled study of the effect of propentofylline on survival time and quality of life of cats with feline infectious peritonitis an update on feline infectious peritonitis: diagnostics and therapeutics. veterinary journal epidemiology of feline infectious peritonitis among cats examined at veterinary medical teaching hospitals prevalence and implications of feline coronavirus infections of captive and free-ranging cheetahs (acinonyx jubatus) broad-spectrum antivirals against c or c-like proteases of picornaviruses, noroviruses, and coronaviruses potent inhibition of feline coronaviruses with peptidyl compounds targeting coronavirus c-like protease broad-spectrum inhibitors against c-like proteases of feline coronaviruses and feline caliciviruses a chimeric virusmouse model system for evaluating the function and inhibition of papain-like proteases of emerging coronaviruses characterization and inhibition of norovirus proteases of genogroups i and ii using a fluorescence resonance energy transfer assay on the size of the active site in proteases. i. papain the influence of age and genetics on natural resistance to experimentally induced feline infectious peritonitis an eight-year epidemiologic study based on baculovirus-expressed type-specific spike proteins for the differentiation of type i and ii feline coronavirus infections feline coronavirus serotypes and : seroprevalence and association with disease in switzerland prevalence of feline coronavirus types i and ii in cats with histopathologically verified feline infectious peritonitis the prevalence of types i and ii feline coronavirus infections in cats analyzing real-time pcr data by the comparative c(t) method structures of the middle east respiratory syndrome coronavirus c-like protease reveal insights into substrate specificity fused-ring structure of decahydroisoquinolin as a novel scaffold for sars cl protease inhibitors inhibition of nf-kappab-mediated inflammation in severe acute respiratory syndrome coronavirus-infected mice increases survival a new mouse-adapted strain of sars-cov as a lethal model for evaluating antiviral agents in vitro and in vivo intranasal treatment with poly(i*c) protects aged mice from lethal respiratory virus infections coronavirus main proteinase ( clpro) structure: basis for design of anti-sars drugs design, synthesis and antiviral efficacy of a series of potent chloropyridyl ester-derived sars-cov clpro inhibitors structural basis of inhibition specificities of c and c-like proteases by zinc-coordinating and peptidomimetic compounds the crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor characterization and inhibition of sars-coronavirus main protease individual and common inhibitors of coronavirus and picornavirus main proteases synthesis, crystal structure, structureactivity relationships, and antiviral activity of a potent sars coronavirus cl protease inhibitor coronaviruses resistant to a c-like protease inhibitor are attenuated for replication and pathogenesis, revealing a low genetic barrier but high fitness cost of resistance design, synthesis, and bioevaluation of viral c and c-like protease inhibitors natural resistance to experimental feline infectious peritonitis virus infection is decreased rather than increased by positive genetic selection. veterinary immunology and immunopathology isolation of fidelity variants of rna viruses and characterization of virus mutation frequency easymodeller: a graphical interface to modeller the pymol molecular graphics system vs, llc we thank monica durden for care of cats and david george for technical assistance. key: cord- -vekok k authors: dewerchin, h. l.; cornelissen, e.; nauwynck, h. j. title: replication of feline coronaviruses in peripheral blood monocytes date: - - journal: arch virol doi: . /s - - - sha: doc_id: cord_uid: vekok k feline infectious peritonitis virus (fipv) (coronaviridae) causes the most lethal viral infection in cats: fip. the related feline enteric coronavirus (fecv) causes mild enteritis. why these feline coronaviruses manifest so differently in vivo is not known. in this study, infection kinetics (titres and antigen expression) of fipv - , and fecv - , were determined in peripheral blood monocytes from donor cats and compared to those in crandell feline kidney (crfk) cells. the infection kinetics in monocytes were host dependent. monocytes from cat were resistant to both fipv- and fecv-infection. monocytes from the other cats could initially be infected by both fipv and fecv but fipv infection was sustained in monocytes of only one cat. fecv-infection was never sustained and viral production was up to times lower than in fipv-infected monocytes. in crfk cells, fipv and fecv infection kinetics did not differ. in monocytes of a larger cat population (n = ) the infection patterns were also found. considering all investigated cats, / were not susceptible for fipv and fecv. the rest could be infected with fecv and fipv but / cats had monocytes that only sustained fipv infection and / sustained neither fipv nor fecv infection. two coronaviruses are described in cats: feline infectious peritonitis virus (fipv) and feline enteric coronavirus (fecv). these feline coronaviruses are spread world-wide and infect cats and other members of the family felidae. an infection with fecv is usually subclinical, except in young kittens where it may cause mild to severe diarrhoea [ ] . in contrast, fipv infection causes a chronic and very often fatal pleuritis/peritonitis. it is the most important cause of death of infectious origin in cats. two forms of fip exist: the effusive or wet form with the typical effusions in body cavities and the less common non-effusive or dry form [ ] . characteristic lesions of both forms are granulomas on the surface of target tissues. despite the large biological differences, more than % of the genome is identical in fipv and fecv isolates from the same environment [ ] . therefore, it has been proposed that fipv arises from fecv by mutation but the exact mutation and the inducing factors have not yet been clarified [ , ] . the main difference between fecv and fipv is the invasive nature of fipv. fecv replicates mainly locally, in enterocytes of the intestine, whereas fipv also infects blood monocytes and spreads systemically [ , ] . the reason for this pathogenic difference is not understood. after infiltration of infected monocytes in the perivascular tissue, the infected monocytes and surrounding cells release numerous chemotactic and vasoactive factors [ , , ] . this leads to vasodilatation and increased vascular permeability and attraction of new monocytes to the area, which can be infected in turn. the outcome of the inflammatory reaction is a characteristic vasculitis which causes the venules to leak large amounts of protein rich plasma into the body cavity. the release of progeny virus also leads to the formation of virus-antibody-complement complexes which are concentrated around the small venules in the target organs [ ] . these complexes further activate inflammation. although the difference between fipv and fecv is very clear in vivo, it is not in vitro. the first in vitro characterisation of fipv strain - and fecv strain - was done by mckeirnan et al. [ ] in crandell feline kidney (crfk) cells. they found similar growth curves for fipv and fecv. the replication of fipv and fecv was also studied in peritoneal macrophages [ ] . it was reported that fecv infected fewer macrophages and reached lower production titres than fipv. the in vivo relevance of these infection studies is most likely higher than those performed in a continuous cell line. but, until now, the fipv and fecv replication cycles have never been studied in the in vivo target/carrier cell of fipv: the feline blood monocyte. in the present study, we present the in vitro replication kinetics of fipv and fecv in the target cell of fipv, the blood monocyte. it was found that the replication kinetics were dependent on the origin of the cells. no differences between fipv and fecv were found in crfk cells. viruses a third passage of fipv strain - and fecv strain - on crfk cells was used [ ] . fecv strain - was obtained from the american type culture collection (atcc) and fipv strain - was kindly provided by dr. egberink (utrecht university, the netherlands). polyclonal antibodies originating from cats infected with fipv - were kindly provided by dr. egberink (utrecht university, the netherlands). these antibodies were purified and biotinylated according to manufacturer's instructions (amersham bioscience, buckinghamshire, uk). the monoclonal antibodies (mab) - - , f - , e - , recognising respectively the s-, m-and n-protein, were kindly provided by dr. hohdatsu (kitasato university, japan). a monocyte marker, dh b, recognising cd a was purchased from veterinary medical research and development (pullman, washington, usa). three cats of a non-specific breed from a fcov free closed household were used as blood donors for the extensive infection kinetics study. seventeen stray cats brought to the clinic of small animals in the faculty of veterinary medicine (ghent university) and spf cats were used for a study on the distribution of the infection kinetics patterns. the sex and felv, fiv and fcov status of the cats are listed in table . six ml blood was collected on heparin ( u/ml) (leo, zaventem, belgium) from the vena jugularis and blood mononuclear cells were separated on ficoll-paque (pharmacia biotech ab, uppsala, sweden) following manufacturer's instructions. mononuclear cells were resuspended in rpmi- (gibco brl, merelbeke, belgium) medium containing % fetal bovine serum (fbs), . mg/ml glutamine, u/ml penicillin, . mg/ml streptomycin, . mg/ml kanamycin, u/ml heparin, mm sodium pyruvate, and % non-essential aminoacids × (gibco brl). afterwards, cells were seeded in a -well dish with cell culture coating (nunc a/s, roskilde, denmark) at a concentration of × cells/ml and cultivated at • c with % co . non-adherent cells were removed by washing the dishes two times with rpmi- at and h after seeding. the adherent cells consisted for ± % of monocytes (as assessed by fluorescent staining with the monocyte marker dh b). crfk cells and monocytes were inoculated with fipv strain - or fecv strain - at a multiplicity of infection (m.o.i.) of . after h incubation at • c with % co , cells were washed times with rpmi- and further incubated in medium. at different time points post inoculation, culture medium was harvested and centrifuged at × g for min. the supernatants were used for determination of extracellular virus titres. the cells were removed from the well by scraping and added to the pellet for determination of intracellular virus titre. virus was released from the cells by freeze-thaw cycles. the samples were stored at − • c until titration. both intra-and extracellular virus titres were assessed by a % tissue culture infective dose assay using crfk cells. the fifty percent end-point was calculated according to the method of reed and muench [ ] . a virus inactivation curve was determined by keeping cell free virus in medium at • c with % co . samples were taken at different time points and stored at − • c until titration. a m: male, f: female b tested on plasma samples with snap ® fiv antibody/felv antigen combo test (idexx) c ipma antibody titer three independent assays were carried out and the inactivation curve was calculated by linear regression. at different time points post inoculation, cells seeded on glass coverslips, were fixed with % formaldehyde. surface-expressed viral proteins were labelled with biotinylated anti-fipv polyclonal cat antibodies and streptavidin-fitc (molecular probes, eugene, oregon, usa). after permeabilisation with . % triton x- (sigma-aldrich gmbh, steinheim, germany), cytoplasmic viral proteins were stained with a mixture of monoclonal antibodies ( - - , f - and e - ) and with goat anti-mouse-texas red (molecular probes). finally, the glass coverslips were mounted on microscope slides using glycerin-pbs solution ( . : . , vol/vol) with . % , -diazabicyclo( , , )octane (janssen chimica, beerse, belgium) and analysed by fluorescence microscopy. for the stray cats and spf cats, only cytoplasmic viral proteins were stained with fitc labelled anti-fipv antibodies (vmrd inc, pullman, washington, usa). the samples were stained to visualise the cytoplasmic and the surface-expressed viral proteins as described above and examined with a leica tcs sp laser scanning spectral confocal system (leica microsystems gmbh, wetzlar, germany) linked to a dm irb inverted microscope (leica microsystems). argon and helium/neon laser lights were used to excite fitc ( nm line) and texas-red ( nm line) fluorochromes. the images were obtained and processed with leica confocal software. all experiments were repeated or more times. the "area under the curve" was calculated for each experiment. triplicate assays were compared using a mann-withney u test. statistical analysis were performed with spss . (spss inc. chicago, illinois, usa). the growth curves of fipv and fecv in crfk cells are given in fig. . production of progeny virus started between and hpi and increased strongly until hpi. between and hpi there was only a slight increase of virus titres to reach a maximum of . log tcid / cells at hpi. there was no significant difference between the growth curves of fipv and fecv. the growth curves of fipv and fecv in monocytes varied between the different donor cats. figures a and a show that the production of fipv started between and h post inoculation for both cat and . between and h post inoculation there was a slight increase in virus titre for cat whereas the curve from cat (figs. c and c) . the growth curves of cat for fecv showed a low-level production ( fig. b and d) . the growth curves of cat for fecv began with a slight titre increase, similar to the fipv growth curve, but then the virus titre decreased with a slope comparable to the inactivation curve ( fig. b and d) . these findings suggest that monocytes could be infected by fecv but that the cells did not sustain a productive infection. figure shows that the growth curves for cat followed the inactivation curve, suggesting that there was no progeny virus produced. (fig. , lane ) . some showed a larger amount of surface-expressed viral proteins (fig. , lane ) . the antigen expression kinetics varied between the donor cats. figure e and f show the fipv and fecv cytoplasmic expression kinetics for cat . the percentage of fipv infected cells with cytoplasmic expression increased till hpi. the infection of monocytes with fecv initiated in the same manner but at hpi the curve started to decline. the cytoplasmic expression in monocytes of cat is shown in fig. e and f. infection with fipv or fecv led to the same expression kinetics. after an increase till or h post inoculation the percentage of cells with viral expression decreased rapidly. the number of fecv infected monocytes was lower than the fipv-infected monocytes. the fipv and fecv surface expression, for both cat and , followed the same curve as the cytoplasmic (fig. g and h; fig. g and h) . the results of cat were quite different from cat and . here, viral antigen positive monocytes were not found. knowing the total production of infectious progeny virus and the number of infected cells, it can be calculated that fipv-infected monocytes from both cat and have produced approximately infectious viruses per infected cell at h post inoculation. fecv-infected monocytes from cat produced times less progeny virus at h post inoculation whereas the fecv-infected monocytes from cat produced the same amount of progeny virus as the fip-infected monocytes. in order to clarify the prevalence of the patterns of viral replication observed in this study in a bigger cat population, the antigen expression kinetics were studied in stray cats and spf cats for both fipv and fecv. the antigen expression was visualised at , and hours post inoculation. the results are presented in fig. . the different expression kinetics that were found in monocytes from the closed household cats were also seen in monocytes from the stray cats and the spf cats. within this population of cats, the monocytes isolated from cats showed a continuous increase in viral antigen positive cells during a hour time span after inoculation with fipv. when these monocytes were inoculated with fecv, the number of viral antigen positive cells increased until hours post inoculation and then diminished. in monocytes from cats, the percentages of both fipv-and fecv-infected cells increased until hpi and then decreased. the monocytes from cats were resistant to infection. in this study, in vitro infection kinetics of fipv (strain - ) and fecv (strain - ) were established in peripheral blood monocytes from cats ( cats of a closed household, stray cats and spf cats). it is the first time that infection studies were performed in peripheral blood monocytes, the host/carrier cell of fipv. three distinct patterns were found in the infection studies. monocytes from cats were not infected by either strain (first pattern). the reason for the insusceptibility of these cells is not yet clear. virus particles were detected in the cells shortly after inoculation of the cells but no production of viral antigens was observed using polyclonal antibodies (data not shown). thus, it seems that new viral proteins were not formed. this suggests that the block of infection is located after entry of the virus but before (or at) the translation step. in vivo, resistance to fipv infection has been observed in experimental inoculations. after inoculation with a lethal dose of fipv, a varying part of the cats (depending on experiment - %) showed no clinical signs and some of them remained seronegative [ , ] . this was also seen in control groups of vaccination trials (no vaccination, only fipv challenged) [ , ] . resistance to fcov infection has also been suggested to occur in natural infections in the field [ ] . a small percentage of cats in fcov endemic households had no shedding, remained seronegative or had a low antibody titre over a time period of years. it would be most interesting to investigate the correlation between in vitro and in vivo resistance to fcov. this might give perspectives for selection of cats insusceptible for fip. monocytes from cats showed an increase of fipv antigen positive cells till hpi whereas the amount of fecv antigen positive cells dropped after hpi. this shows that the fipv infection was sustained whereas the fecv infection was not sustained (second pattern). monocytes from cats did not sustain both fipv and fecv infection since the number of viral antigen positive cells dropped after or hpi (third pattern). the drop in antigen positive cells after or hours post inoculation may be explained by the fact that the infected cells died due to infection and were washed away during the staining. however, the same kinetics were found with staining in suspension, a technique which prevents cell loss (data not shown). another explanation is that monocytes stopped producing viral proteins and assembling new virions. the extracellular virus titres showed indeed that (almost) no new progeny virus was produced between and hours post inoculation. some graphs show differences in virus titres between experiments (with the same virus and with monocytes from the same donor cat) of up to log units. these differences are intrinsic to working with primary cells and are reported in viral infection studies with porcine and equine monocytes as well [ , ] . although fecv initially infects monocytes, the infection is never sustained. this implicates that fecv might reach the blood circulation in vivo. in several studies, healthy cats from fcov endemic households were investigated [ , , , , , ] . in such households, where the fcov was most likely fecv, a part of these healthy cats were viraemic for fcov. fcov was detected both in plasma and in monocytes. therefore, it may be hypothesised that when fecv reaches the blood circulation, the lack of sustainability and long-term production of progeny virus (the total virus production was up to times lower in fecvinfected monocytes) may be the reason for the lack of disease progress. this might form the basis for the difference with fipv since fipv infection is sustained and reaches higher titres. however, the non-sustained fecv infection, might also be attributed to the virus strain that was used. although fecv - is a reference strain, it may act differently from other fecv strains due to its deletion in the b orf [ ] . it has been described that loss of the ab orfs results in loss in virulence [ ] . it could be that this loss in virulence is translated in loss of the ability to replicate efficiently in monocytes. thus, whether the hampered replication of strain - in monocytes is a universal property of fecv strains or only of b deleted/mutated strains, remains to be determined. the different fipv infection kinetics depending on the cat from which the monocytes were isolated suggests that cellular factors, influenced by genetic background and/or differentiation/activation status, are very important in determining the outcome of a fipv infection. in an infection kinetics study where another cell type, feline peritoneal macrophages, was used, different results in the antigen expression kinetics were obtained [ ] . the number of fecv infected peritoneal macrophages was lower than the number of fipv infected peritoneal macrophages throughout the infection kinetics. since the viral antigen kinetics was only performed till hours post inoculation, a possible drop in antigen expression, like reported here, could not be evaluated. in contrast, our results suggest that fipv and fecv can initially infect the same amount of cells but at h post inoculation, differences in sustainability of the infection are prominent. since the same viruses were used as in our study, the different results are most probably due to cellular factors and/or a different differentiation status of the cells. differences in susceptibility depending on the differentiation and/or activation status of the monocytes/macrophages has been reported for different viruses such as porcine reproductive and respiratory syndrome virus, caprine arthritis-encephalitis virus, suid herpes virus , herpes simplex virus, human immunodeficiency virus type and maedi-visna virus [ , , ] . the differences in activation status might explain the discrepancy between our results and those of stoddart and scott [ ] . what this variation in susceptibility and sustainability means for the pathogenesis of fecv and fipv in vivo, remains to be elucidated. in an inoculation study using fipv - , different patterns of disease progression were detected, based upon survival time: progressors (rapid, intermediate and delayed) and survivors (prolonged and long-term) [ ] . with natural in vivo fcov infection, different clinical outcomes (besides resistance to fcov) have been described: persistent carrier, transiently infection and development of fip [ ] . it is not clear what the viral and host factors are that determine the different clinical outcomes. since in the inoculation study the same strain (fipv- - ) was used and considering the fact that in the field cats are often infected with the same strain of fcov, it is likely that genomic variation between cats contributes to a different clinical outcome. a genetic background was also suggested during a field study with pure-bred cats, in which it was shown that susceptibility to fip is indeed inheritable [ ] . a possible explanation for the different disease progression is the possibility of the cats to develop an efficient t-cell response [ ] . however, it could also be that the susceptibility of the monocytes to fipv plays a role, considering the results presented here. it would be interesting to investigate if cats that show a different outcome to an experimental or natural infection also show different infection kinetics in vitro. this might be important since a correlation between in vitro and in vivo infection kinetics would allow easy screening and selection. in this study, it was shown that viral proteins can be expressed on the surface of fcov infected cells. however, only a part of the infected cells showed surfaceexpressed viral antigens. on hpi, % of the infected crfk cells and % of the infected monocytes showed surface-expressed viral antigens. s-and mproteins, but no n-proteins were found on the cell surface of both crfk cells and monocytes using specific monoclonal antibodies (data not shown). this indicates that the observed surface expression does not represent virus particles. possible explanations for the observed differences in amount of surface-expressed viral antigens could be the retention of a part of the viral proteins or spontaneous internalisation of the surface-expressed viral antigens. retention of viral proteins has been described for porcine coronavirus [ ] . spontaneous internalisation of viral proteins has been described for suid herpes virus [ ] . the presence of viral antigens on the cell surface can be of importance for the recognition and elimination of infected cells by the immune system. binding of virus-specific antibodies to viral proteins present on the surface, makes infected cells recognisable for the classical complement pathway, phagocytes and natural killer cells, which will lead to lysis of the infected cell [ ] . interestingly, not all fipv-and fecv-infected monocytes/macrophages showed surface expression. absence of viral proteins on the cell surface has been described for other viruses, such as human cytomegalovirus and equine herpesvirus as a strategy to avoid recognition by the antibody-dependent immune responses [ , ] . why only half of the infected cells showed surface expression and whether the cells without surface expression are indeed less susceptible towards antibody-dependent complement mediated lysis, remains to be elucidated. in fip research, the crfk cell line is often used to perform in vitro experiments. the results of this study reveal that the crfk cell line is not the best suitable in vitro model for the study of fipv and fecv replication at a cellular level. firstly, the course of infection of fipv and fecv is similar in crfk cells, whereas in monocytes there is a clear difference (as there is in vivo). secondly, a high percentage of infected cells can be reached in crfk cells (up to % of the inoculated cells) with each cell producing and releasing a relatively small amount of infectious virus (< viruses/cell). in monocytes on the other hand, less than % of the cells can be infected, but a single fipv-infected monocyte releases up to new infectious viruses. thirdly, crfk cells showed surface expression in almost all infected cells, in contrast to monocytes, which showed surface expression in only half of the infected cells. in conclusion, it can be stated that fcov infection kinetics in vitro are strongly dependent on cellular factors. monocytes from some cats cannot be infected. if monocytes are susceptible to fcov infection, then both fipv and fecv can infect them. however, fecv infections are never sustained and production of viral antigens and progeny virus ceases at h post inoculation. sustainability of a fipv infection depends on the origin of the host cells. fipv production in susceptible monocytes was always to times higher than fecv production. what this variation in susceptibility and sustainability implicates for the development and pathogenesis of fip and/or fecv in vivo, remains to be elucidated. use of a reverse-transcriptase polymerase chain reaction for monitoring the shedding of feline coronavirus by healthy cats persistence and transmission of natural type i feline coronavirus infection natural history of a recurrent feline coronavirus infection and the role of cellular immunity in survival and disease effects of origin and state of differentiation of monocytes/macrophages on their susceptibility to porcine reproductive and respiratory syndrome virus (prrsv) fip, easy to diagnose? vet q a novel mechanism for persistence of human cytomegalovirus in macrophages the inheritance of susceptibility to feline infectious peritonitis in purebred catteries il- activity in feline infectious peritonitis detection of interleukin in ascites from cats with feline infectious peritonitis detection of feline coronaviruses by culture and reverse transcriptase-polymerase chain reaction of blood samples from healthy cats and cats with clinical feline infectious peritonitis live, attenuated coronavirus vaccines through the directed deletion of group-specific genes provide protection against feline infectious peritonitis viral interactions with the immune system detection of feline coronavirus rna in feces, tissues, and body fluids of naturally infected cats by reverse transcriptase pcr persistence and evolution of feline coronavirus in a closed cat-breeding colony isolation and characterization of feline c and evidence for the immune complex pathogenesis of feline infectious peritonitis virus independent evaluation of a modified live fipv vaccine under experimental conditions (university of liverpool experience) isolation of feline coronaviruses from two cats with divers disease manifestations comparative properties of feline coronaviruses in vitro high viral loads despite absence of clinical and pathological findings in cats experimentally infected with feline coronavirus (fcov) type i and in naturally fcov-infected cats effect of aging, activation by phorbol myristate acetate and treatment with interferon-γ on the susceptibility of blood monocytes toaujeszky's disease virus virus production and viral antigen expression in porcine blood monocytes inoculated with pseudorabies virus feline infectious peritonitis and feline enteric coronavirus infections. part an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus a simple method of estimating fifty percent endpoints a novel sorting signal for intracellular localization is present in the s protein of a porcine coronavirus but absent from severe acute respiratory syndrome-associated coronavirus independent evaluation of a modified live fipv vaccine under experimental conditions (cornell experience) a mrna pcr for the diagnosis of feline infectious peritonitis intrinsic resistance of feline infectious peritoneal macrophages to coronavirus infection correlates with in vivo virulence replication of equine herpesvirus type in freshly isolated equine peripheral blood mononuclear cells and changes in susceptibility following mitogen stimulation absence of viral antigens on the surface of equine herpesvirus- -infected peripheral blood mononuclear cells: a strategy to avoid complement-mediated lysis internalization of pseudorabies virus glycoprotein b is mediated by an interaction between the yqrl motif in its cytoplasmic domain and the clathrin-associated ap- adaptor complex a comparison of the genomes of fecvs and fipvs: what they tell us about the relationships between feline coronaviruses and their evolution feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses genomic organization and expression of the end of the canine and feline enteric coronaviruses fcov replication in monocytes evaluation of immunity to feline infectious peritonitis in cats with cutaneous viral-induced delayed hypersensitivity pathogenesis of feline infectious peritonitis: nature and development of viraemia pathogenesis of feline infectious peritonitis: pathologic changes and immunofluorescence increased plasma levels of leukotriene b and prostaglandin e in cats experimentally inoculated with feline infectious peritonitis virus macrophage-virus interactions author's address we are grateful to dr. hohdatsu and dr. egberinck for supplying antibodies. we thank chantal vanmaercke for excellent technical assistance, myriam hesta and kris gommeren for their help with handling the cats, h. favoreel, s. van gucht and p. delputte for critical reading of this manuscript. we also thank the clinic of small animals of the faculty of veterinary science for their co-operation. h. l. dewerchin was supported by the institute for the promotion of key: cord- -jdcw r authors: regan, andrew d.; cohen, rebecca d.; whittaker, gary r. title: activation of p mapk by feline infectious peritonitis virus regulates pro-inflammatory cytokine production in primary blood-derived feline mononuclear cells date: - - journal: virology doi: . /j.virol. . . sha: doc_id: cord_uid: jdcw r feline infectious peritonitis (fip) is an invariably fatal disease of cats caused by systemic infection with a feline coronavirus (fcov) termed feline infectious peritonitis virus (fipv). the lethal pathology associated with fip (granulomatous inflammation and t-cell lymphopenia) is thought to be mediated by aberrant modulation of the immune system due to infection of cells such as monocytes and macrophages. overproduction of pro-inflammatory cytokines occurs in cats with fip, and has been suggested to play a significant role in the disease process. however, the mechanism underlying this process remains unknown. here we show that infection of primary blood-derived feline mononuclear cells by fipv wsu - and fipv-df leads to rapid activation of the p mapk pathway and that this activation regulates production of the pro-inflammatory cytokine tumor necrosis factor alpha (tnf-alpha) and interleukin- beta (il- beta). fipv-induced p mapk activation and pro-inflammatory cytokine production was inhibited by the pyridinyl imidazole inhibitors sb and sc in a dose-dependent manner. fipv-induced p mapk activation was observed in primary feline blood-derived mononuclear cells individually purified from multiple spf cats, as was the inhibition of tnf-alpha production by pyridinyl imidazole inhibitors. coronaviruses are a diverse family of enveloped positive-stranded rna viruses that infect a wide range of species including humans. coronaviruses are divided into three groups in which group and infect mammals and group infects birds (perlman et al., ) . feline coronaviruses (fcovs) belongs to group and are classified as either serotype i or ii depending on the sequence of their spike (s) protein (rottier, ) . in addition, each serotype is divided into two biotypes designated as either feline enteric coronavirus (fecv) or feline infectious peritonitis virus (fipv) based on their pathological outcome in cats (vennema et al., ) . fecv is ubiquitous amongst felines and causes mild to often unapparent enteritis, while fipv leads to a lethal systemic infection marked by severe granulomatous inflammation (pedersen et al., a (pedersen et al., , b weiss and scott, ) . the mechanism underlying this drastic difference in disease between the two biotypes remains elusive, namely because fecv and fipv isolates from the same serotype are virtually indistinguishable on the genetic and antigenic level. however it has been shown that the two biotypes possess markedly different abilities to infect cells of the immune system, with fipv isolates possessing an extended tropism that allows for the infection of macrophages and monocytes (stoddart and scott, ) . recent studies have suggested that this alteration in tropism may be due to mutations in the s protein that affect protein cleavage and fusion activation during entry (regan et al., ; rottier et al., ) . viral pathogens that infect immune cells (e.g. human immunodeficiency virus (hiv) and dengue virus) are known to induce aberrant cytokine production, a process which is proposed to play a role in the pathological outcome of their respective diseases (fantuzzi et al., ; kedzierska and crowe, ; leong et al., ) . studies of cats with fip have shown that cytokine expressions are altered as compared to healthy animals (dean et al., ; kiss et al., ) . specifically it has been noted that expression of the pro-inflammatory cytokine tumor necrosis factor alpha (tnf-alpha), interleukin- beta (il- beta) and interleukin- (il- ) are significantly increased in cats with fip, and are likely produced by infected macrophages and monocytes (kiss et al., ; takano et al., a takano et al., , b . it has been shown that tnf-alpha is able to induce feline t-cell apoptosis, making it the most likely causative agent of t-cell lymphopenia in fipvinfected cats (dean et al., ; takano et al., a) . in addition tnfalpha has been shown to increase expression of the fcov receptor aminopeptidase n (apn) causing target cells to be more susceptible to viral infection and further exacerbate the disease (takano et al., b) . however despite their critical role in the pathological outcome of fip, the mechanism regulating fipv-induced upregulation of pro-inflammatory cytokines remains undescribed. mitogen-activated protein kinases (mapks) are a family of proteins that serve as components of signaling pathways within cells in order to process and respond to extracellular stimuli (raman et al., ) . typically, receptors on the cell surface initiate signaling cascades, which lead to phosphorylation and translocation of mapks to the nucleus where they regulate transcriptional activators (whitmarsh, ) . in recent years, it has become clear that mapks also regulate processes outside of the nucleus such as mrna translation and cytoskeletal remodeling (frevel et al., ; huang et al., ) . three major mapk pathways have been identified which are conserved in all eukaryotic cells ranging from yeast to mammals. these pathways are designated as extracellular signal-regulated kinases and (erk / ), c-jun n-terminal kinases (jnk ) and p mapk (pearson et al., ) . in general the erk pathway is activated by proliferative stimuli, while the jnk and p mapk pathways are activated by extracellular stresses such as ultraviolet light, heat and osmotic shock (pearson et al., ) . p mapk was originally identified as the target of pyridinyl imidazole compounds that were shown to inhibit the production of il- and tnf-alpha in lipopolysaccharide (lps)-stimulated human monocytes (lee et al., ) . subsequent studies have shown that the p mapk pathway is responsible for the phosphorylation of a large group of transcriptional and translational response elements which directly regulate the expression of a wide variety of proinflammatory cytokines (kumar et al., ) . due to its involvement in cytokine regulation, we reasoned that the p mapk pathway might play a role in the increased production of pro-inflammatory cytokines observed in cats with fip. in this study we examined the activation of the p mapk pathway in response to infection by fipv in primary feline blood-derived mononuclear cells. we also investigated the role of p mapk in tnf-alpha, il- beta and il- production, and the effect of p mapk inhibitors on these processes. the p mapk pathway has been shown to be activated by multiple viral pathogens during infection (adamson et al., ; banerjee et al., ; dumitru et al., ; erhardt et al., ; holloway and coulson, ; zachos et al., ) . to determine whether the p mapk pathway is activated during the infectious lifecycle of fipv, primary feline blood-derived mononuclear (pfbm) cells were inoculated with either fipv- or fipv-df at an moi of . untreated cells and infected cells ranging from min to h p.i. were lysed and analyzed by western blot with the anti-phospho-p mapk mab ( d ). untreated cells showed a minimal level of p mapk phosphorylation, however addition of either virus isolate caused rapid phosphorylation of p mapk (n % increase) within min p.i. (figs. a and c) . p mapk underwent dephosphorylation by min and then showed a second phase of phosphorylation later in infection between and h p.i., which was less pronounced (fig. a) . to determine whether viral replication was required for fipv-induced p mapk activation, uv-inactivated virus was added to pfbm cells and analyzed by western blot as described above (fig. b) . uv-treated fipv also induced p mapk phosphorylation, however the activation was not biphasic, and instead remain sustained throughout the h time-course (fig. b) . membranes were re-probed with anti-p mapk (n- ) pab to show that an equal amount of p mapk was present in each sample (figs. a and b) . to further confirm that the p mapk pathway is activated by fipv, pfbm cells were inoculated with fipv- at an moi of before fixing the cells for immunofluorescent microscopy. p mapk again showed a rapid phosphorylation by min p.i. while the total amount of p mapk remained unchanged (fig. ) . in addition the p mapk in infected cells showed increased nuclear localization as compared to untreated cells, a phenomenon highly associated with the regulation of transcriptional activators (fig. ) . these data indicate that the p mapk pathway is activated during infection of pfbm cells by fipv, and that viral replication is dispensable for this activation to occur. the p mapk pathway was first discovered by investigating the target of pyridinyl imidazole compounds which blocked lps-induced cytokine induction in human monocytes (lee et al., ) . to test the effect of pyridinyl imidazole inhibitors on fipv-induced p mapk phosphorylation, pfbm cells were treated with μm of either sb or sc (or . % dmso as a control) for h before inoculating with fipv- or fipv-df at an moi of . min p.i. cells were lysed and analyzed by western blot with the anti-phospho-p mapk mab ( d ). cells which were pretreated with dmso alone showed rapid fipv-induced phosphorylation of p mapk, however those which were pretreated with either sb or sc showed no activation as compared to uninfected cells (fig. ) . these data demonstrate that fipv-induced p mapk activation is blocked by pyridinyl imidazole inhibitors. activation of the p mapk pathway has been shown to be required for replication of some viruses including the murine coronavirus mouse hepatitis virus (mhv) (banerjee et al., ) . to investigate whether activation of the p mapk pathway is required for replication of fipv, pfbm cells were treated with μm of either sb or sc (or . % dmso as a control) for h before inoculating with fipv- or fipv-df . h p.i. cells were fixed and stained for with the anti-fipv n protein mab ( b . ). as shown in fig. , pretreatment with p mapk inhibitors has no significant effect on fipv replication in pfbm cells. activation of p mapk by viral pathogens has been shown to induce the production of pro-inflammatory cytokines such as tnfalpha, il- beta and il- (banerjee et al., ; griego et al., ; lee et al., a lee et al., , b sloan and jerome, ; wang et al., ; yurochko and huang, ) . to investigate whether tnfalpha production in fipv-infected pfbm cells is regulated by p mapk activation, pfbm cells were treated with μm of either sb , sc or . % dmso for h before inoculating with fipv- or fipv-df at an moi of . h p.i. supernatants were collected, concentrated and analyzed by western blot with the anti-tnf-alpha (n- ) pab. cells which were pretreated with dmso alone showed significant production of tnf-alpha, however those which were pretreated with either sb or sc showed no detectable production of tnf-alpha as compared to uninfected cells (fig. a ). to quantify the production of tnf-alpha, infections were performed as described above, except at h p.i. supernatants were collected and analyzed by anti-tnf-alpha capture elisa. infected cells which were pretreated with dmso alone showed significant production of tnf-alpha (n pg/ml) however pretreatment with μm sb and μm sc resulted in a -fold and -fold reduction in tnf-alpha production respectively (fig. b) . uninfected cells produced no tnf-alpha, or were below the detection level of the assay (data not shown). overall these data indicate that production of the pro-inflammatory cytokine tnf-alpha in fipvinfected pfbm cells is regulated by activation of the p mapk pathway. to show that the reduction of fipv-induced tnf-alpha production by sb and sc was specific to the pyridinyl imidazole inhibitors, pfbm cells were treated with either sb or sc at a range of concentrations ( μm, μm or . μm) or . % dmso for h before inoculating with fipv- or fipv-df at an moi of . as seen in our previous data, pfbm cells which were pretreated with dmso alone produced significant amounts of tnfalpha however pretreatment with sb and sc resulted in a significant reduction in tnf-alpha production in a dose-dependent manner (fig. ) . it is known that individual animals can vary in their reaction to infection by fipv (kiss et al., ) . to determine whether or not fipvinduced p mapk activation was specific to a single animal, pfbm cells were individually prepared from six additional spf cats ( pgp , pgv , pgv , fgr , fgv , fjm ). pfbm cells individually purified from each animal were inoculated with fipv- at an moi of . untreated cells and infected cells ( min p.i.) were lysed and . h p.i. supernatants were collected and tnfalpha production was quantified by anti-tnf-alpha capture elisa (b). tnf-alpha produced from untreated cells was below the detection limit of the assay (b pg/ml). fig. . fipv-induced tnf-alpha production is inhibited in a dose-dependent manner by sb and sc . pfbm cells were pretreated with either sb or sc at a range of concentrations ( μm, μm or . μm) or . % dmso for h before inoculating with fipv- at an moi of . h p.i. supernatants were collected and tnf-alpha production was quantified by anti-tnf-alpha capture elisa. tnf-alpha from untreated cells was below the detection limit of the assay (b pg/ml). analyzed by western blot with the anti-phospho-p mapk mab ( d ). consistent with our previous data, untreated cells showed a minimal level of p mapk phosphorylation while addition of fipv caused a rapid phosphorylation of p mapk in pfbm cells from all six cats (fig. ) . membranes were re-probed with anti-p mapk (n- ) pab to show that an equal amount of p mapk was present in each sample (fig. ) . in addition, the regulation of tnf-alpha production by p mapk was analyzed in pfbm cells from all six spf cats. pfbm cells from each animal were treated with μm sc or . % dmso for h before inoculating with fipv- at an moi of . h p.i. supernatants were collected and analyzed by anti-tnf-alpha capture elisa. while the baseline level of tnf-alpha production differed slightly amongst all of the cats tested, treatment with the p inhibitor sc resulted in the same trend observed in our previous experiments: a significant reduction in tnf-alpha levels (between fold to -fold) (fig. ) . these data taken together suggest that fipvinduced activation of the p mapk pathway in pfbm cells represents a common mechanism by which this virus promotes tnf-alpha production in cats. cats with fip have also been reported to show increased levels of the pro-inflammatory cytokines il- beta and il- . to investigate whether il- beta and il- production in fipv-infected pfbm cells is regulated by p mapk activation, pfbm cells were treated with μm of either sb , sc or . % dmso for h before inoculating with fipv- at an moi of . h p.i. supernatants were collected and analyzed by anti-il- beta and anti-il- capture elisa. infected cells which were pretreated with dmso alone showed significant production of il- beta (n pg/ml) however pretreatment with μm sb and μm sc resulted in a -fold and -fold reduction in il- beta production respectively (fig. ) . neither infected nor uninfected pfbm cells produced significant levels of il- ( fig. ) . overall, these data indicate that both tnf-alpha and il- beta production in fipv-infected pfbm cells is regulated by p mapk activation, a situation that does not apply to il- . modulation of signaling pathways by viruses is becoming recognized as a key pathogenic determinant in viral diseases mediated by aberrant host immunological responses. in the case of fip, cytokine production is markedly altered between animals with disease as compared to healthy animals, with overproduction of the proinflammatory cytokine tnf-alpha in particular being indicative of a poor outcome (kiss et al., ) . feline tnf-alpha causes apoptosis in feline t-cells (implicating it as the causative agent of t-cell lymphopenia), and upregulates the fipv receptor apn making target cells more susceptible to infection in vitro (dean et al., ; kiss et al., ; takano et al., a takano et al., , b . it has been shown previously that fipv-infected monocytes upregulate the expression of tnf-alpha, however the mechanism regulating this process remains undescribed. in this study we show that infection by fipv causes a rapid activation the p mapk pathway in pfbm cells, and that this process directly regulates production of the pro-inflammatory cytokines tnf-alpha and il- beta. as shown in fig. , fipv-induced p mapk activation in pfbm cells occurs in a biphasic temporal pattern which mimics that observed with other viral pathogens that activate mapk pathways during infection such as influenza virus (pleschka et al., ) . at present we are unable to define the mechanism by which fipv particles are able to activate the p mapk pathway, however the rapid nature of the initial activation suggests that it occurs early during entry; likely due to interactions between the s protein and its receptor. this model is further supported by the observation that uv-inactivated virus also induce rapid activation of the p mapk pathway. this activation is markedly different than that reported in mhv infected cells, where activation did not occur until - h p.i., and uv-treated viral particles did not induce phosphorylation of p mapk (banerjee et al., ) . it notable that the fipv receptor apn localizes to lipid rafts (navarrete santos et al., ; nomura et al., ) which are known to be a signaling portal for the p mapk pathway (calzolari et al., ; head et al., ; olsson and sundler, ; sugawara et al., ; wang et al., ; zeidan et al., ) . in fact it has recently been shown that rhinovirus activates the p mapk pathway through the actions of lipid rafts and rhoa (dumitru et al., ) . further investigation will be necessary to determine the role of apn and lipid rafts in the initial phase of fipv-induced p mapk activation and tnf-alpha/il- beta production. interestingly, uv-inactivated fipv induced prolonged p mapk activation, rather than the biphasic activation induced by untreated viral particles. this suggests that fipv may activate p mapk during entry, but then suppresses p mapk during the early phase of replication. the second phase of fipv-induced p mapk activation induced by untreated viral particles ( h p.i.) may be caused by the production of pro-inflammatory cytokines. it has been shown that tnf-alpha can itself activate the p mapk through signaling associated with the cytoplasmic domain of its receptors tnf receptor (tnfr )-associated death domain protein (tradd) and tnf receptor-associated factor (traf ) (carpentier et al., ; hsu et al., hsu et al., , . therefore tnf-alpha produced during the initial phase of fipv-induced p mapk activation, may be the cause of the latter phase of activation. pretreatment with the pyridinyl imidazole inhibitors sb and sc blocked production of tnf-alpha and il- beta suggesting that p mapk directly regulates production of the cytokines in fipvinfected pfbm cells. the upregulation of il- production was not fig. . fipv-induced tnf-alpha production by pfbm cells from six spf cats is inhibited by sc . pfbm cells were individually prepared from three male ( pgp , pgv , pgv ) and three female ( fgr , fgv , fjm ) spf cats. cells from each animal were inoculated with fipv- at an moi of . h p.i. supernatants were collected and tnf-alpha production was quantified by anti-tnf-alpha capture elisa. tnf-alpha from untreated cells was below the detection limit of the assay (b pg/ml). observed in fipv-infected pfbm cells, suggesting that another cell type may be responsible for its production in cats with fip. at this time the mechanism by which p mapk regulates pro-inflammatory cytokine production in fipv-infected pfbm cells is unknown, however regulation of cytokines by mapks in analogous systems occurs by affecting either transcriptional regulation, translational regulation, or both (kumar et al., ) . for example the recently emerged severe acute respiratory syndrome coronavirus (sars-cov) is also known to infiltrate immune cells such as monocytes and macrophages and activate the p mapk pathway (belyavsky et al., ; franks et al., ; gu et al., ; nicholls et al., ) . sars-cov infection causes a p mapk-dependent phosphorylation of downstream transcriptional regulators such as activating transcription factor (atf- ) and signal transducer and activator of transcription (stat- ), as well as translational regulators such as mapk activate protein kinase (mapkapk ) and the eukaryotic initiation factor e (eif e) (mizutani, ; mizutani et al., a mizutani et al., , b . as seen in fig. it appears that fipv causes increased p mapk nuclear localization suggesting that the activation of transcription factors likely play a role in proinflammatory production in pfbm cells, however this also does not exclude a role for translational regulation. future studies examining the role of downstream transcriptional and translational regulators in fipv-infected pfbm cells should clarify the mechanism regulating this process. another aspect complicating the treatment of fip is the diverse reactions to infection displayed by cats with the disease (kiss et al., ) . our results suggest that activation of the p mapk pathway and its regulation of tnf-alpha production is common to pfbm cells of all cats, however further sampling of animals throughout different geographic regions will be required to confirm this conclusion. pyridinyl imidazole compounds have been shown to be efficacious therapeutic agents for blocking the mediators of chronic inflammatory diseases such as rheumatoid arthritis (kumar et al., ) . in fact, several p mapk inhibitors have shown promise in animal models of inflammatory diseases and some have even reached human clinical trials (kumar et al., ) . our results show a clear activation of p mapk by fipv during infection, and that this activation is responsible for pro-inflammatory cytokine production which is a key contributor to the pathological changes observed in cats with fip. this raises this possibility that p mapk inhibitors, alone or in conjunction with other therapies, may possess therapeutic benefits in the treatment of cats with fip. primary feline blood-derived mononuclear (pfbm) cells were individually purified from four male spf cats (animal id# pjo , pgp , pgv , pgv ) and three female spf cats (animal id# fgr , fgv , fjm ) (liberty research, waverly, ny) using a standard ficoll-paque gradient (ge healthcare) as specified by the manufacturer. cells were seeded in -well plates with tissue culturetreated glass coverslips and allowed to attach overnight. after washing, cells were incubated in the presence of % co at °c in rpmi- media ph . supplemented with % fetal bovine serum (fbs), mm glutamine, u/ml penicillin and μg/ml streptomycin. the purity of pfbm preparations were routinely checked by immunofluorescence microscopy using the marker dh b (veterinary medical research & development inc., pullman, wa). crandell-reese feline kidney cells were obtained from the american type culture collection (atcc) and cultured and maintained according to atcc guidelines. fipv wsu - (fipv- ) was obtained from the atcc. fipv-df was provided by dr. ed dubovi (animal health diagnostic center, new york state college of veterinary medicine, cornell university). both viruses were grown by inoculating crfk cells at a moi of . and collecting supernatant after cpe was observed in % of cells which typically occurred between and h. supernatant was fig. . production of il-l beta and il- by fipv-infected pfbm cells. pfbm cells were pretreated with μm of either sb or sc (or . % dmso as a control) for h before inoculating with fipv- at an moi of . h p.i. supernatants were collected and il- beta and il- production was quantified by anti-il- beta or anti-il- capture elisa. clarified by a low speed centrifugation step ( × g for min) and viral particles were then pelleted by centrifugation at , rpm in a sw rotor (sorvall) for min. pellets were resuspended in phosphate-buffered saline (pbs). virus titers were determined by plaque assays on crfk cells using standard techniques. for uvinactivation, a thin layer of viral suspension was exposed to uv light ( w) at a distance of cm for min. inactivation was verified by performing infection assays in crfk and pfbm cells as described. the anti-phospho-p mapk (thr /tyr ) ( d ) rabbit monoclonal antibody (mab) was obtained from cell signaling technologies (danvers, ma). the anti-p mapk (n- ) goat polyclonal antibody (pab) and anti-tnf-alpha (n- ) goat pab were obtained from santa cruz biotechnology (santa cruz, ca). the anti-fipv nucleocapsid (n) protein mab ( b . ) was provided by dr. ed dubovi (animal health diagnostic center, new york state college of veterinary medicine, cornell university). anti-cd a mab dh b was obtained from veterinary medical research and development, inc. (pullman, wa). the feline tnf-alpha elisa kit (tnf-alpha/tnfsf a), feline il- beta elisa kit (il- beta/il- f ), feline il- elisa kit, and associated antibodies and detection reagents were obtained from r&d systems (minneapolis, mn). the p mapk inhibitors -( -fluorophenyl)- -( -methylsulfinylphenyl)- -( -pyridyl) h-imidazole (sb ) and -( -( -chlorophenyl)- -( -methylpiperidin- -yl)- h-pyrazol- -yl) pyrimidine (sc ) were obtained from calbiochem (san diego, ca). pfbm cells were incubated in low-serum media ( % fbs) for h before inoculation with the specified virus at an moi of , or pretreatment with the specified inhibitor for h followed by infection. for p mapk activation experiments, cells were lysed at the specified time-points in lysis buffer ( % triton x- , mm tris-hcl, mm nacl, mm edta, mm dtt, mm beta-glycerophosphate, mm sodium vanadate, ph . ) supplemented with × complete protease inhibitor cocktail (roche). lysates were clarified by centrifugation at , rpm in a table-top centrifuge at °c for min before freezing at − °c for later analysis. for immunofluorescence assays, cells were fixed at the specified time-points with % paraformaldehyde. for analysis of cytokine production, supernatant was collected h postinoculation (p.i.) before freezing at − °c for later analysis. fixed cells were labeled with the specified antibodies as described previously (chu et al., ) . cells were viewed on a nikon eclipse e fluorescence microscope, and images were captured with a sensicam em camera and analyzed with iplab software. sds sample buffer was added to lysates and the reaction was heated at °c for min before separation using a - % sds-page gel at v for h. gels were electroblotted to pvdf membrane at a for h, blocked with % bovine serum albumin and probed with the specified antibody at °c for h. membranes were developed using either anti-rabbit antibody (southern biotech, birmingham al) or anti-goat antibody (santa cruz biotechnology, santa cruz ca) linked to horseradish peroxidase and ecl substrate (pierce, rockford il) and images captured using a fujifilm las- ccd camera. for western blot analysis of tnf-alpha production, supernatants were concentrated × using icon kda molecular weight cut-off spin columns (pierce, rockford il) and analyzed by western blot as described above. western blot densitometry analysis of signal intensity was performed using imagej software. for quantification of cytokine production, supernatants were processed with the specified elisa kits (r&d systems) using standard capture elisa techniques as specified by the manufacturer. epstein-barr virus immediate-early proteins bzlf and brlf activate the atf transcription factor by increasing the levels of phosphorylated p and c-jun n-terminal kinases murine coronavirus replication-induced p mitogen-activated protein kinase activation promotes interleukin- production and virus replication in cultured cells coronavirus mhv- -induced apoptosis in macrophages tfr localizes in lipid raft domains and is released in exosomes to activate signal transduction along the mapk pathway traf plays a dual role in nf-kappab-dependent gene activation by mediating the tnfinduced activation of p mapk and ikappab kinase pathways the avian coronavirus infectious bronchitis virus undergoes direct low-ph-dependent fusion activation during entry into host cells in vivo cytokine response to experimental feline infectious peritonitis virus infection rhinoviral infections activate p map-kinases via membrane rafts and rhoa hepatitis c virus core protein induces cell proliferation and activates erk, jnk, and p map kinases together with the map kinase phosphatase mkp- in a hepg tet-off cell line monocyte/macrophage-derived cc chemokines and their modulation by hiv- and cytokines: a complex network of interactions influencing viral replication and aids pathogenesis lung pathology of severe acute respiratory syndrome (sars): a study of autopsy cases from singapore p mitogen-activated protein kinase-dependent and -independent signaling of mrna stability of au-rich element-containing transcripts role of p mitogen-activated protein kinase in rhinovirus-induced cytokine production by bronchial epithelial cells multiple organ infection and the pathogenesis of sars microtubules and actin microfilaments regulate lipid raft/caveolae localization of adenylyl cyclase signaling components rotavirus activates jnk and p signaling pathways in intestinal cells, leading to ap- -driven transcriptional responses and enhanced virus replication the tnf receptor -associated protein tradd signals cell death and nf-kappa b activation tradd-traf and tradd-fadd interactions define two distinct tnf receptor signal transduction pathways map kinases and cell migration the role of monocytes and macrophages in the pathogenesis of hiv- infection disease outcome and cytokine responses in cats immunized with an avirulent feline infectious peritonitis virus (fipv)-ucd and challenge-exposed with virulent fipv-ucd p map kinases: key signalling molecules as therapeutic targets for inflammatory diseases a protein kinase involved in the regulation of inflammatory cytokine biosynthesis hiv- gp -induced tnf-{alpha} production by primary human macrophages is mediated by phosphatidylinositol- (pi- ) kinase and mitogen-activated protein (map) kinase pathways p mitogenactivated protein kinase-dependent hyperinduction of tumor necrosis factor alpha expression in response to avian influenza virus h n the pathology of dengue hemorrhagic fever signal transduction in sars-cov-infected cells tyrosine dephosphorylation of stat in sars coronavirus-infected vero e cells phosphorylation of p mapk and its downstream targets in sars coronavirus-infected cells aminopeptidase n/cd is associated with raft membrane microdomains in monocytes lung pathology of fatal severe acute respiratory syndrome human coronavirus e binds to cd in rafts and enters the cell through caveolae the role of lipid rafts in lps-induced signaling in a macrophage cell line mitogen-activated protein (map) kinase pathways: regulation and physiological functions pathogenic differences between various feline coronavirus isolates pathogenicity studies of feline coronavirus isolates - and - influenza virus propagation is impaired by inhibition of the raf/mek/erk signalling cascade differential regulation and properties of mapks differential role for low ph and cathepsin-mediated cleavage of the viral spike protein during entry of serotype ii feline coronaviruses the molecular dynamics of feline coronaviruses acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein herpes simplex virus remodels t-cell receptor signaling, resulting in p -dependent selective synthesis of interleukin- intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence the lipid raft proteins flotillins/reggies interact with galphaq and are involved in gq-mediated p mitogen-activated protein kinase activation through tyrosine kinase a "possible" involvement of tnf-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis tnf-alpha, produced by feline infectious peritonitis virus (fipv)-infected macrophages, upregulates expression of type ii fipv receptor feline aminopeptidase n in feline macrophages feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses sustained activation of p mitogen-activated protein kinase and c-jun n-terminal kinase pathways by hepatitis b virus x protein mediates apoptosis via induction of fas/fasl and tumor necrosis factor (tnf) receptor /tnf-alpha expression hsp enhances macrophage phagocytosis by interaction with lipid raft-associated tlr- and upregulating p mapk and pi k pathways pathogenesis of feline infectious peritonitis: pathologic changes and immunofluorescence regulation of gene transcription by mitogen-activated protein kinase signaling pathways human cytomegalovirus binding to human monocytes induces immunoregulatory gene expression herpes simplex virus type infection stimulates p /c-jun n-terminal mitogen-activated protein kinase pathways and activates transcription factor ap- leptin-induced cardiomyocyte hypertrophy involves selective caveolae and rhoa/rock-dependent p mapk translocation to nuclei we thank marc antoniak for helpful advice and discussions during the course of this work, and ed dubovi for kind provision of reagents. we also thank a damon ferguson for technical assistance. adr was supported grant t ai (training in molecular virology and pathogenesis) from the national institutes of health. work in the author's lab was supported by the winn feline foundation and the george sydney and phyllis redmond miller trust. key: cord- -gzcb uqw authors: martinez, mitzi l.; weiss, richard c. title: detection of feline infectious peritonitis virus infection in cell cultures and peripheral blood mononuclear leukocytes of experimentally infected cats using a biotinylated cdna probe date: - - journal: veterinary microbiology doi: . / - ( ) -z sha: doc_id: cord_uid: gzcb uqw abstract a dot blot hybridization assay, using a biotinylated cdna probe, was able to detect feline infectious peritonitis virus (fipv) rna in felis catus whole fetus (fcwf- ) cells infected with the fipv isolates df , - , ucdi, and ucd . the probe cross-hybridized in the dot blot assay with nucleic acid of a closely related feline coronavirus, feline enteric coronavirus (fecv)- - . to construct the probe, a . kilobase cdna, prepared from fipv-df genomic rna, was molecularly cloned. the recombinant cdna clone was digested with the restriction endonuclease rsa i, and an basepair rsa i fragment was isolated from vector dna by agarose electrophoresis and glassmilk purification. this fragment was complementary to the ′ three fourths of the nucleocapsid gene. the hybridization probe was prepared by random primed labeling in the presence of biotin- -dutp. using an avidin-alkaline phosphatase conjugate and chemiluminescent substrate detection system, virus could be detected in as few as infected cells. in an in vivo study, the probe was used to detect fipv rna in peripheral blood mononuclear leukocytes (pbml) isolated at various post-infection days (pid) from cats experimentally infected with the fip-producing coronavirus isolate fipv- - or fipv-df . viral rna could be detected in as few as pbml isolated from cats at pid and in pbml at pid . there was no consistent pattern, however, between hybridization results and prognosis or severity of disease at the time of sampling. despite some cross-hybridization with fecv rna, this probe should be useful for diagnosis of fip, because cats infected with fecv most likely do not become viremic. worldwide (horzinek et al., ; horzinek and osterhous, ) . fip in cats occurs in two clinically distinct forms, effusive or noneffusive. the effusive form is characterized by the accumulation of fluid in one or more of the body cavities, while the noneffusive form is characterized instead by development of granulomatous lesions in various organs (pedersen, b) . the noneffusive form of fip can be difficult to diagnose clinically, because many feline diseases present in a similar manner (august, ) . the fipv is related antigenically to and crossreacts serologically with feline enteric coronavirus (fecv), porcine transmissible gastroenteritis virus (tgev), canine coronavirus (ccv), and the human coronavirus e ( pedersen et al., ; horzinek et al., ; pedersen and black, ) . because cats become infected subclinically with various coronaviruses, serological crossreactions between fipv and other coronaviruses complicate diagnosis of fip using standard antibody tests (barlough, ; ) . homologous reactions after subclinical infections by fipv may also complicate the interpretation of serological assays. the fipv genome consists of a positive-sense, single-stranded, infectious rna of at least kilobases (kb) (siddeu et al., ; degroot et al., b) . the . kb at the ' end of the genome encode for three structural proteins: a kilodalton (kda) peplomer glycoprotein (s), a - kda nucleocapsid protein (n), and a - kda integral membrane protein (m) (degroot et al., a; tupper et al., ; spaan et al., ) . the remainder of the genome is believed to encode rna polymerase and other non-structural proteins . virulent fipv isolates preferentially infect and replicate within monocytes and macrophages, while avirulent coronaviruses are considerably less able to infect mononuclear phagocytes (pedersen, ; stoddart and scott, ). weiss and scott ( la) demonstrated by animal inoculation studies that either whole blood or peripheral blood mononuclear leukocytes (pbml) from cats with fip are infectious to other cats and can transmit fip. experimental infection of spf cats with the non-fip producing enteric virus, fecv, results in a limited distribution of virus from the primary site of infection, the mature columnar epithelial cells in the upper third of the villi in the small intestinal mucosa. virus is demonstrated occasionally in monocytic cells within the medullary sinuses of the mesenteric lymph nodes (pedersen et al., ; pedersen, ; evermann et al., ) ; in contrast to fip, there is no evidence that fecv can induce a systemic disease (pedersen et al., ) . apart from laparotomy and biopsy in noneffusive fip, or clinical diagnosis of effusive fip in the terminal stage, there are presently no specific antemortem diagnostic tests for fip. a test which can detect fipv directly in the blood or other clinical sample would be a valuable diagnostic tool. direct detection of fipv antigen in blood components with antibodies generally has not been successful, possibly because of low levels of viremia. virus isolation is not useful for diagnosis because field isolates grow poorly in cell culture (pedersen and floyd, ) . in this study, we describe a dot blot hybridization procedure, using a biotinylated recombinant cdna probe complementary to a major portion of the n protein gene, to detect fipv in feline cell cultures and pbml isolated from cats infected experimentally with the virulent fip virus isolate - or df . seven of the cats used in these studies were healthy, - month-old specific-pathogen-free (spf) males and females. the cats were purchased from a commercial breeder (liberty laboratories, liberty corners, n j) and were felv test-negative (by elisa) and feline coronavirus antibody-negative prior to the studies. two other cats (z , z ) were month-old males and were healthy and feline coronavirus antibody-positive prior to the studies. these cats originally were spf kittens that had survived a previous experimental challenge exposure with fipv. the cats were housed separately in cages located in an isolation facility of the scott-ritchey research center and were tested and cared for according to humane standards as set forth in the "guide for the care and use of laboratory animals" (publication no. - , national institutes of health, bethesda, md). all experimental protocols were approved by a university animal welfare committee prior to the studies. feline coronaviruses used in this study included three virulent (i.e., fipproducing) isolates (fipv-df , fipv- - , fipv-ucd ) and two avirulent strains (fipv-ucd , fecv- - ,) . the fipv- - , fipv-ucd , fipv-ucd and fecv- - strains (mckeirnan et al., ; pedersen and floyd, ) were supplied by dr. n.c. pedersen, university of california, davis. the fipv-df strain was obtained from the american type culture collection, rockville, md.; no. vr- . felis catus whole fetus (fcwf- ) cells were supplied by dr. n.c. pedersen and were used to propagate all the viruses. the fcwf- cells were grown in eagle's minimal essential media supplemented with % heat-inactivated fetal bovine serum, u of penicillin/ml, /tg of streptomycin/ml, and . /tg of amphotericin/ml, along with mm l-glutamine and % nonessential amino acids. cultures were maintained in a humidified incubator at °c in an atmosphere of air with % coz. the fipv-df polyadenylated rna was isolated from virus-infected fcwf- cell pellets ( cells) using the fast track system (invitrogen, san diego, ca) following the manufacturer's protocol. four micrograms of fipv-df rna were converted into rna-cdna hybrids by reverse transcriptase, using oligodeoxythymidine for priming. resulting hybrids were converted into double-stranded dna by rnase h together with dna polymerase i and escherichia coli dna ligase and blunt-ended by t dna polymerase. the double-stranded cdna was ligated to bstx i linkers, inserted into the bstx i site of the pcdnaii phagemid (invitrogen), and propagated in e. coli inv alpha f'cells (invitrogen). one recombinant cdna clone, h a , was characterized by restriction enzyme analysis and partial dna sequencing. this clone represents bases near the ' end of the fipv-df genomic rna (fig. ). the recombinant phagemid containing h a was digested with rsa i and the fragments separated by agarose gel electrophoresis. an bp fragment complementary to the ' three fourths of the n protein gene ( fig. ) was excised and purified from the gel using glassmilk (geneclean ii, bio , la jolla, ca). this fragment was labeled with biotin by random primer extension using hexanucleotide primers and klenow enzyme in the presence of biotin- i-dutp (tropix, bedford, ma) to make the hybridization probe, fipv-rsa i. confluent monolayers of day-old fcwf- cell cultures ( cm ) were infected with virus at a multiplicity of infection of . at hours post-infection (pi), cells were harvested by trypsinization. the cells were pelleted, washed once with phosphate-buffered saline (pbs) and then re-pelleted. the cell pellets were frozen and stored at - °c until use. an uninfected fcwf- culture was harvested as described and served as a negative control (uninfected fcwf- cellular rna). before use, the cells were thawed quickly, resuspended in pbs, and counted on a neubauer hemocytometer. the cell concentration was adjusted to cells/ml in pbs. whole blood was collected at various intervals by jugular venipuncture from spf cats that had been injected intraperitoneally previously with either fipv- - or fipv-df (table ) . heparinized whole blood was diluted : . preparation of cell dot blots was done as described by paeratakul et al. ( ) . two-fold serial dilutions of each cell suspension, ranging from either to × l cells/ml for infected fcwf- cells or from × to . x cells/ml for pbml, were made in pbs. a total of /tl of each cell dilution was applied to a . micron nylon membrane filter (tropilon, tropix), using a dot blot apparatus (biodot, bio rad, richmond, ca). the filters were fixed for h at °c in % glutaraldehyde in a solution of % nac , mm nah po , and mm na hpo (ph . ). the filters were washed times in proteolytic buffer ( mm edta, . m tris-hcl, ph . ) and were incubated for min at °c in ml ofproteolytic buffer containing #g/ ml proteinase k (promega, madison, wi ). after washing once in proteolytic buffer, the filters were air-dried and stored at room temperature until use. the membrane filters were prehybridized for h at °c in hybridization buffer ( . % polyvinyl pyrrolidone, mm edta, m nac , mm tris, ph . , % dextran sulphate and . % sodium dodecyl sulphate) and were then hybridized for h at °c in fresh hybridization buffer containing ng of heat-denatured fipv-rsa i probe. for chemiluminescent detection, posthybridization washing and visualization were performed according to the manufacturer's instructions, using a commercial kit (southern-light chemiluminescent detection system; tropix, bedford, ma). following application of the chemiluminescent substrate, amppd, the filters were wrapped in plastic wrap and kept at room temperature for h. kodak xar- x-ray film was exposed to the wrapped filter for to rain and then developed in an automatic processor. in some experiments, colorimetric detection was performed on the hybridized membrane after chemiluminescent detection. for colorimetric detection, post-hybridization washing and visualization were performed according to the manufacturer's instructions, using a commercial kit (blugene nonradioactive nucleic acid detection system; bethesda research labs, gaithersburg, md). to minimize contamination by ribonucleases, all solutions were treated initially with diethyl pyrocarbonate (sigma, st. louis, mo.) and all glassware was autoclaved and then baked at °c for at least hr prior to use. the . kb fipv cdna clone, h a , was oriented by restriction enzyme analysis (fig. ) and partial sequencing, using the sequence of the . kb at the ' end of genomic rna of fipv- - (degroot et al., vennema et al., ) as a reference. the position of the bp rsa i probe is indicated by the bold line in the lower diagram of fig. . complementarity of the bp rsa i probe to the . kb fipv cdna insert was confirmed by southern blotting (data not shown). the fipv-rsa i probe hybridized to rna in cells infected with each of the feline coronaviruses tested (fig. ) . viral rna was detected in as few as cells for fipv-df , fipv- - and fecv- - . viral rna was detected in cells for fipv-ucd and in cells for fipv-ucd . the probe did not hybridize above background levels to rna isolated from normal uninfected feline cells. the fipv-rsa i probe hybridized to rna in pbml isolated from cats that had been infected with either fipv- - or fipv-df . cats el, e , and e were infected with fipv- - . the strongest hybridization signal occurred in cat e at pid (fig. ) . the signal was detectable in as few as pbml. at pid , pbml were required to produce a similar signal table .) pbml from an uninfected cat, z , are included as a negative control. signal was detected using a colorimetric detection system as described in materials and methods. the pbml from cats infected with fipv-df were tested at pid and . two (di, b ) of cats tested at pid showed a positive hybridization signal (fig. ) . at the time of testing, cat d had symptoms consistent with noneffusive fip, and this cat died at pid . cat b , however, was only mildly anemic at the time of testing and presently is clinically normal ( months post-infection). cat d , which tested negative at pid , had symptoms of noneffusive fip and later died at pid (table ) . a hybridization signal above the negative control was not detected in cat z or z ; both cats had been infected with fipv-df for at least a year prior to testing and were clinically healthy. a ( / ) of the fipv-df -infected cats, including zl and z , had virus neutralizing (vn) antibody titers against fipv-df . four of these cats (di, b , d , c ) were tested for serum fipv antibody titers by indirect fluorescent antibody (ifa) assay, and all were positive (table ) . the fipv-rsa i recombinant cdna probe hybridized to fcwf- cells infected with each of several different feline coronavirus isolates. these isolates represented diverse pathotypes: the fip-producing df , - and ucd , and the avirulent ucd and fecv- - . as shown in fig. , the probe hybridized with equal intensity to both fipv-df and fipv- - . this finding was not unexpected, because the rna sequence near the ' end of the genome of these isolates is very similar, if not identical (unpublished data). the decreasing intensity of signals seen for fecv- - , fipv-ucd and fipv-ucd , compared to fipv-df or - , may have been due either to less homology between nucleotide sequences or possibly to a lower number of viral copies per cell, particularly with virus strains, such as ucdi, that replicate more slowly in cell culture (data not shown). experiments performed using less stringent hybridization conditions (hybridization and post-hybridization washes at °c) did not show significantly altered signal intensities. due to functional constraints, there are other areas of the viral genome that may show greater sequence homology among isolates. conceivably, the putative rna polymerase gene at the '-end of the genome contains sequences that are widely conserved among coronaviruses. comparison of amino acid sequences derived from the rna polymerase gene of tgev to amino acid sequences derived from the rna polymerase gene of infectious bronchitis virus (ibv) revealed a high level of homology; this is in contrast to the low levels of homology between tgev and ibv structural proteins (britton, et al., ; wesley, ) . possibly, a probe constructed from the rna polymerase gene can hybridize with more consistent intensity to the different coronavirus isolates tested. additionally, we wanted to determine if the probe would detect viral rna in pbml isolated from cats experimentally infected with the fip-producing isolates, fipv- - or fipv-df . as shown in fig. , the probe did hybridize to pbml isolated at various intervals from cats infected previously with either of the two isolates. although the hybridization signal was stronger in cats infected with fipv- - , the samples were obtained at an earlier pid than were samples from cats infected with fipv-df . all cats infected with fipv- - were positive at pid , which was during the incubation period for the experimental disease (pedersen et al., ) . in general, the signal intensity decreased with time. in the fipv-df -infected animals, results were variable at pid and were negative in the single cat (c ) tested at pid . overall, hybridization results were not correlated with prognosis or severity of disease at the time of sampling. cats z and z were included to determine if the probe would detect viral rna in pbml from cats that had recovered from clinical fip and possibly were latent carriers of the disease (pedersen, a) . a signal was not detected in pbml from these animals. if indeed they were latent carriers, then either the cdna probe hybridization assay system was too insensitive, or the virus was not actually circulating in leukocytes but was instead sequestered within macrophages in lymph nodes or bone-marrow, as suggested previously by pedersen and floyd ( ) . the results obtained with cats d and c suggest that the dot blot hybridization format is not sensitive enough to detect the very low levels of viremia which may occur in this disease. viremia in fip is primarily cell-associated (weiss and scott, la) . conceivably, only very few circulating leukocytes may be infected, whereas macrophages may replicate fipv very efficiently (weiss and scott, b) . to increase test sensitivity, we are currently evaluating two different methods to detect fipv rna in pbml: ( ) a fluorescent in situ hybridization (fish) of pbml cytospun onto glass slides and tested with biotinylated probes, and ( ) reverse transcription of viral rna isolated from pbml, followed by a polymerase chain reaction (pcr) technique, using oligonucleotide primers specific for fipv to amplify the virus. preliminary results obtained with fish showed greater sensitivity than dot blot hybridization; pbml from d and ci, which were previously evaluated to be virus-negative, tested positive (data not shown). in addition to studying fip viremia, we are evaluating pbml isolated from cats infected with the non-fip-producing coronaviruses, fecv- - , fipv-ucd and ccv. previous studies indicate that cats infected with these viruses most likely have only a localized enteric infection and do not have a viremia (pedersen et al., ; barlough et al., ; pedersen and floyd, ) . pbml will be probed by fish using our fipv-cdna probes to determine whether or not coronaviral rna is present. if it can be shown that viral nucleic acids are in pbml of cats with fip and are not in pbml from cats infected with non-fip-producing coronaviruses, cdna probes which crosshybridize between fipv and fecv may still be valuable diagnostic tools. based on hybridization of a recombinant biotinylated fipv-cdna probe to pbml from fipv-infected cats, an assay has been developed which can detect virus infection directly in blood samples. it is our opinion that this assay can be used to diagnose acute fipv infections, particularly in viremic cats. tests that can detect virus or virus-associated components (e.g., proteins or nucleic acids) are preferable to diagnostic tests based on serological reactions. this is particularly true in disease states such as fip, where anticoronavirus antibody crossreactivity or homologous reactions after subclinical infections by fipv complicate the interpretation of serological assays. further refinements in sensitivity and specificity of the in situ hybridization assay should facilitate specific detection of fipv rna and result in a clinically useful diagnostic test for fip. feline infectious peritonitis: an immune-mediated coronavirus vasculitis serodiagnostic aids and management practice for feline retrovirus and coronavirus infections cats, coronaviruses and coronavirus antibody tests experimental inoculation of cats with canine coronavirus and subsequent challenge with feline infectious peritonitis virus genomic organization of a virulent isolate of porcine transmissible gastroenteritis virus cdna cloning and sequence analysis of the gene encoding the peplomer protein of feline infectious peritonitis virus lntracellular rnas of the feline infectious peritonitis coronavirus strain - sequence analysis of the ' end of the feline coronavirus fipv - genome: comparison with the genome of porcine coronavirus tgev reveals large insertion characterization of a feline infectious peritonitis virus isolate biological and pathological consequences of feline infectious peritonitis virus infection in the cheetah feline infectious peritonitis: a worldwide serosurvey feline infectious peritonitis virus antigenic relationships among homologous stluclural polypeptides of porcine, feline and canine coronaviruses isolation of feline coronaviruses from two cats with diverse disease manifestations a fast and sensitive method for detecting specific viral rna in mammalian cells morphologic and physical characteristics of feline infectious peritonitis virus and its growth in autochthonous peritoneal cell cultures virologic and immunologic aspects of feline infectious peritonitis virus infection coronavirus diseases (coronavirus enteritis, feline infectious peritonitis) attempted immunization of cats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus experimental studies with three new strains of feline infectious peritonitis virus: fipv-ucd , fipv-ucd and fipv-ucd antigenic relationship of the feline infectious peritonitis virus to coronaviruses of other species an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis pathogenicity studies of feline coronavirus isolates - and - the biology of coronaviruses immunoehemistry of viruses, i. the basis for serodiagnosis and vaccines intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence antigenic and biological diversity of feline coronaviruses: feline infectious peritonitis and feline enteritis virus primary structure of the membrane and nucleocapsid protein genes of feline infectious peritonitis virus and immunogenicity of recombinant vaccinia viruses in kittens pathogenesis of feline infectious peritonitis: nature and development ofviremia pathogenesis of feline infectious peritonitis: pathologic changes and immunofluorescence nucleotide sequence of the e -peplomer protein gene and partial nucleotide sequence of the upstream polymerase gene of transmissible gaslroenteritis virus (miller strain) key: cord- -e s o r authors: tekes, g.; thiel, h.-j. title: feline coronaviruses: pathogenesis of feline infectious peritonitis date: - - journal: adv virus res doi: . /bs.aivir. . . sha: doc_id: cord_uid: e s o r feline infectious peritonitis (fip) belongs to the few animal virus diseases in which, in the course of a generally harmless persistent infection, a virus acquires a small number of mutations that fundamentally change its pathogenicity, invariably resulting in a fatal outcome. the causative agent of this deadly disease, feline infectious peritonitis virus (fipv), arises from feline enteric coronavirus (fecv). the review summarizes our current knowledge of the genome and proteome of feline coronaviruses (fcovs), focusing on the viral surface (spike) protein s and the five accessory proteins. we also review the current classification of fcovs into distinct serotypes and biotypes, cellular receptors of fcovs and their presumed role in viral virulence, and discuss other aspects of fipv-induced pathogenesis. our current knowledge of genetic differences between fecvs and fipvs has been mainly based on comparative sequence analyses that revealed “discriminatory” mutations that are present in fipvs but not in fecvs. most of these mutations result in amino acid substitutions in the s protein and these may have a critical role in the switch from fecv to fipv. in most cases, the precise roles of these mutations in the molecular pathogenesis of fip have not been tested experimentally in the natural host, mainly due to the lack of suitable experimental tools including genetically engineered virus mutants. we discuss the recent progress in the development of fcov reverse genetics systems suitable to generate recombinant field viruses containing appropriate mutations for in vivo studies. mutations in the molecular pathogenesis of fip have not been tested experimentally in the natural host, mainly due to the lack of suitable experimental tools including genetically engineered virus mutants. we discuss the recent progress in the development of fcov reverse genetics systems suitable to generate recombinant field viruses containing appropriate mutations for in vivo studies. together with the arteriviridae, mesoniviridae, and roniviridae, the family coronaviridae (subfamilies coronavirinae and torovirinae) make up the order nidovirales. coronaviruses belong to the subfamily coronavirinae which has been divided into four genera: alpha-, beta-, gamma-, and deltacoronavirus. within the genus alphacoronavirus, feline coronaviruses (fcovs) are part of the species alphacoronavirus , the latter also containing a few other closely related viruses, such as canine coronaviruses (ccovs) and the porcine transmissible gastroenteritis virus (tgev). other more distantly related species in the genus alphacoronavirus include porcine epidemic diarrhea virus (pedv), human coronavirus e (hcov- e), and human coronavirus nl (hcov-nl ) (de groot et al., ) . the positive-strand rna genome of fcovs has a size of approximately kb and shows the typical genome organization of coronaviruses (fig. ) . the untranslated region (utr) comprises about nucleotides (nts) and contains the leader sequence as well as the transcription regulatory sequence (trs) with the core-trs motif. this -cuaaac- core-trs motif is conserved in all fcovs (de groot et al., ; dye and siddell, ; tekes et al., ) . the utr consists of around nts and is followed by a poly(a) tail. the replicase gene covers around twothirds of the genome and comprises open reading frames (orfs) a and b. the translation of the fcov replicase gene leads to the production of polyproteins (pp) a and pp ab, which are processed by virus-encoded proteinases (dye and siddell, ; ziebuhr et al., ) . by analogy with other alphacoronaviruses, fcov pp a/pp ab is thought to be cleaved by virusencoded papain-and c-like proteases at and sites, respectively (ziebuhr, ) . accordingly, proteolytic processing of the fcov pp a/ ab gives rise to nonstructural proteins (nsps) that form the replication/transcription complex and, in some cases, are involved in interactions with host cell factors and functions. the -terminal one-third of the fcov genome contains (i) four genes encoding the four structural proteins called spike (s), envelope (e), membrane (m), nucleocapsid (n) protein, respectively, and (ii) several accessory genes. fcovs possess five accessory genes called a, b, c, a, and b. like in other alphacoronaviruses, these genes are located at two different genome positions (dye and siddell, ; haijema et al., ; tekes et al., ) . between the s and e genes, fcovs and ccovs possess three orfs ( a, b, and c), while tgev contains only two orfs ( a and b). recently, an additional orf named orf was described in this region for ccov (lorusso et al., ) . other members of the alphacoronavirus genus possess only one orf . sequence analyses suggest that fcov orf a is homologous to ccov orf a and tgev orf a, while the fcov orf c is a homolog of ccov orf c, tgev orf b, and orf of all other alphacoronaviruses (narayanan et al., ) . ccov orf b represents the only known homolog of fcov orf b. furthermore, all members of the species alphacoronavirus harbor various numbers of additional accessory genes downstream of the n gene. tgev has only one orf (called orf ), which is homologous to orf a of fcovs and ccovs. the latter two contain yet another orf, called b, which precedes the utr. deletions of the entire fcov orf and genome regions showed that the accessory genes are dispensable for viral growth in vitro; they were suggested to be important for virus replication and virulence in vivo (haijema et al., ) . however, the functions of the accessory proteins remain still to be investigated. fcov orf a is predicted to encode a -amino acid(aa)-long protein without any known or predicted function. this protein is thought to be expressed from the subgenomic (sg) rna , which has been detected in infected cells (dye and siddell, ; tekes et al., ) and the synthesis of which involves the canonical core-trs motif upstream of the translational start signal of a. however, until now, the expression of this protein in infected cells has not been demonstrated. orf b overlaps with orf a and is supposed to encode an approximately -kda protein with currently unknown functions. similar to a, expression of b protein has not been demonstrated in infected cells. it is generally thought that the b protein is translated by a noncanonical mechanism from the second orf present in the -unique region of sgrna . orf c is predicted to code for a protein of amino acids which likely represents a membrane protein with three transmembrane regions. the predicted topology of the c protein transmembrane domains is similar to that of the viral m protein (oostra et al., ) . thus far, the expression of c protein in infected cells could not be shown. also, it is unclear whether the c protein is expressed from the same sgrna (as predicted for the a and b proteins) or from a separate sgrna that, however, has not been identified to date. the existence of an additional sgrna from which c could be expressed receives some support by the observation that the genomes of most fcov isolates contain a core-trs motif or a very similar sequence immediately upstream of the orf c translational start codon. the transient expression of c in a cat cell line revealed a perinuclear localization . based on the sequence analyses of fcov field isolates, it has been proposed that c is essential for viral replication in the gut but dispensable for systemic infection (chang et al., ) . furthermore, the fcov c protein homologs conserved in pedv and hcov- e were suggested to be incorporated into virus particles, to function as ion channels and to enhance virus production (wang et al., ; zhang et al., ) . it remains to be determined whether fcov c protein has similar functions. although the synthesis of the fcov a protein in infected cells has not been confirmed experimentally, the protein is expected to be expressed from sgrna as was shown previously for its tgev homolog. fcov orf a is predicted to encode a -amino acid ( kda) protein with an n-terminal signal sequence and a c-terminal transmembrane domain (haijema et al., ) . using a plasmid construct expressing a with a c-terminal gfp tag, the a protein was shown to colocalize primarily with the endoplasmic reticulum (er) and golgi apparatus. using the same plasmid construct and a recombinant virus lacking the entire orf , a specific function of the a protein in counteracting ifn-α-induced antiviral responses was suggested (dedeurwaerder et al., ) . in contrast to all other fcov accessory proteins, the expression of b in infected cells has been confirmed experimentally and the detection of fcov b-specific antibodies in sera obtained from infected cats indicates that the protein is produced in vivo (herrewegh et al., b; kennedy et al., ; vennema et al., vennema et al., , . together with a, the b protein is expected to be expressed from sgrna ; however, the translation mechanism used to initiate translation from this second orf remains to be determined. the b protein has a molecular mass of kda, it is secreted from the cell, and contains (i) an n-terminal signal sequence, (ii) a potential n-glycosylation site at aa position , and (iii) a c-terminal kdel-like er retention signal (vennema et al., ) . the presence of an internal stop codon or a deletion in the b gene has been suggested to indicate cell culture adaptation and a possible (partial) loss of virulence in vivo (herrewegh et al., b) . the precise function of the b protein in the fcov life cycle remains to be elucidated in further studies. based on serological properties, fcovs are classified into two serotypes. the vast majority of the natural infections ( - %) in europe and america are caused by serotype i fcovs, while serotype ii fcovs are less common in the field (benetka et al., ; kummrow et al., ) . furthermore, serotype ii fcovs have predominantly been observed in asia and they were reported to be responsible for up to % of the natural infections in those countries (amer et al., ; an et al., ; sharif et al., ) . there is consistent evidence from independent studies that serotype ii viruses emerge via double homologous recombination between serotype i fcov and ccov haijema et al., ; herrewegh et al., ; lin et al., ; lorusso et al., ; terada et al., ) . as a consequence of the recombination, approximately one-third ( kb) of the serotype i fcov genome including the s gene and the neighboring regions are replaced with the equivalent parts of the ccov genome haijema et al., ; herrewegh et al., ; lin et al., ; lorusso et al., ; terada et al., ) . detailed sequence analyses of numerous serotype ii fcovs revealed that the -recombination event occurs in the polymerase gene while the -recombination site is located in the e or m genes. however, the exact locations of these recombination sites vary in the different isolates, indicating that serotype ii fcovs continuously arise through independent recombination events (haijema et al., ; herrewegh et al., ; lin et al., ; terada et al., ) . it is considered likely that the described recombination occurs in cats that are coinfected with serotype i fcov and ccov. however, the exact source of serotype ii fcovs is unclear. it is believed that serotype ii fcovs are more virulent (lin et al., ; wang et al., ) . the most important biological consequence of the recombination is the integration of the ccov s gene into serotype i fcov. the coronaviral s protein is the major determinant for viral attachment and host cell type specificity. while the s domain of the s protein is responsible for receptor binding, the s domain is required for fusion of the viral and cellular membranes (bosch et al., ; kubo et al., ; yoo et al., ) . the poor sequence identity ( %) of the s domains of fcovs serotype i and ii strongly suggests that the two serotypes use different receptors for cell entry. early studies showed that serotype ii fcovs employ as a cellular receptor the feline aminopeptidase n (fapn) (tresnan and holmes, ; tresnan et al., ) , a -kda glycoprotein with metalloprotease activity that is expressed in many host tissues, including epithelial cells from the intestinal brush border (kenny and maroux, ; look et al., ; semenza, ) . these early studies suggested that fapn may also facilitate the entry of serotype i fcovs, albeit less efficiently. subsequent experiments showed that an fapn-specific monoclonal antibody is able to block infection by serotype ii fcovs (as well as ccov and tgev), but not by serotype i fcovs (hohdatsu et al., ) , suggesting that the two serotypes use different receptors for cell entry. this hypothesis was supported by experiments using pseudotyped retroviruses containing the spike protein of fcov serotypes i and ii, respectively, to transduce different continuous cat cell lines. the data obtained in this study provided evidence that serotype i spike fails to recognize fapn as a receptor for attachment and entry, suggesting that fapn is not a functional receptor for serotype i fcovs (dye et al., ) . in line with this, recombinant serotype i fcovs generated by reverse genetics and expressing serotype i and serotype ii s proteins, respectively, were used to demonstrate that the s protein alone is responsible for the different receptor usage of serotype i and serotype ii fcovs (tekes et al., ) . it is now generally accepted that serotype i fcovs employ another cellular receptor. other studies suggest that feline c-type lectin dendritic cell-specific intercellular adhesion molecule- -grabbing nonintegrin (fdc-sign) has a role in cellular attachment and may serve as a coreceptor for both fcov serotypes in vitro (regan and whittaker, ; regan et al., ; van hamme et al., ) . the identification of the cellular receptor for serotype i fcovs remains an important topic in fcov research. the usage of different cellular receptors by the fcov serotypes is reflected in the characteristics of these viruses in vitro. whereas serotype ii fcovs replicate well in feline tissue culture cells in vitro, serotype i fcovs grow poorly, if at all, in cell culture, except for a few cell cultureadapted isolates. accordingly, in the last decade, most studies on fcovs were based on serotype ii viruses, while the more prevalent serotype i fcovs were largely neglected (de haan et al., ; dye and siddell, ; haijema et al., haijema et al., , rottier et al., ; tekes et al., ) . fcovs can cause infections in domestic and wild felidae worldwide (hofmann-lehmann et al., ; leutenegger et al., ; munson et al., ; paul-murphy et al., ) . approximately - % of domestic cats are seropositive, with seropositivity rates approaching % in animal shelters or multi-cat households (hohdatsu et al., ; pedersen, pedersen, , . as pointed out earlier, most of the natural infections are caused by serotype i fcovs (addie et al., ; hohdatsu et al., ; kennedy et al., ; kummrow et al., ) . according to pathogenicity, fcovs are separated into two biotypes that are generally referred to as feline enteric coronavirus (fecv) and feline infectious peritonitis virus (fipv). these two biotypes exist in both serotypes i and ii. the vast majority of fecv infections are benign and they either remain undetected or cause a mild diarrhea. however, fecvs can occasionally induce severe enteritis (kipar et al., b) . convincing evidence for persistent infections caused by fecvs was first provided in the late s (herrewegh et al., ) . in these experiments, naturally infected cats were isolated and monitored for virus shedding in the feces. in several cases, fecvs remained detectable in the feces of the cats for more than weeks, although with decreasing viral loads. to investigate the course of infection in more detail, fecv infection experiments have also been performed under controlled conditions (desmarets et al., ; kipar et al., ; pedersen et al., ; vogel et al., ) . these studies showed that fecvs induce symptomless persistent infections similar to natural infections. the virus could be detected a few days after infection in the feces, and virus shedding was confirmed to last for several months (pedersen et al., b; vogel et al., ) . furthermore, similar to natural infections viral rna was also found in the blood (gunn-moore et al., ; herrewegh et al., a herrewegh et al., , kipar et al., a,b; meli et al., ; simons et al., ; vogel et al., ) . seroconversion of the animals started approximately days postinfection and the antibody titers remained at a relatively low level. postmortem analyses showed that, in acute infections, fecvs have a tropism to the apical epithelium of the intestinal villi from the lower part of the small intestines to the caecum (pedersen et al., b) . although coronaviral rna can be detected in persistently infected cats in the entire gastrointestinal tract, blood, and different tissues, experimental infections revealed that the lower part of the gastrointestinal tract is the major site for viral replication and fecv persistence (herrewegh et al., ; kipar et al., ; vogel et al., ) . these observations confirm that fecvs are primarily associated with the gastrointestinal tract but they are also capable of infecting monocytes, albeit less efficiently, and thereby spread throughout the body (dewerchin et al., ; kipar et al., a kipar et al., , meli et al., ; porter et al., ) . fecvs are highly contagious and are transmitted horizontally via the fecal-oral route (pedersen, (pedersen, , pedersen et al., b) . usually, kittens become infected with fecvs at a young age in the litter, most probably through viruses in the feces of the mother jarrett, , ; pedersen et al., b) . since persistently infected cats shed the virus in their feces for extended periods of time, they play a central role in spreading and maintaining fecvs in cat populations and therefore represent a threat to other animals. in sharp contrast to fecvs, fipv causes a lethal disease called feline infectious peritonitis (fip). the disease is characterized by fibrinous and granulomatous serositis, protein-rich serous effusion in body cavities, and/or granulomatous lesions (pyogranulomas) (hayashi et al., ; kipar and meli, ; kipar et al., a kipar et al., , pedersen, pedersen, , weiss and scott, a,b) . the cellular composition, the level of viral antigen expression and the distribution of the fip-characteristic lesions in different organs can vary in individual cases (kipar and meli, ) . for the development of these lesions, fipv-infected monocytes and macrophages have been identified as major target cells of fipvs and are assumed to play a pivotal role (haijema et al., ) . fipvs are able to efficiently infect and replicate in monocytes/macrophages (dewerchin et al., ; rottier et al., ; stoddart and scott, ) and to trigger an activation of these cells (regan et al., ) . circulating activated monocytes heavily express cytokines such as tumor necrosis factor -α, il- β, and adhesion molecules (e.g., cd b and cd ) (kipar et al., b; kiss et al., ; regan et al., ; takano et al., takano et al., , a ; the latter facilitate the interaction of monocytes with activated endothelial cells in the small-and medium-sized veins. moreover, it has been suggested that the increased expression of enzymes such as matrix metalloproteinase- by the activated monocytes contributes to endothelial barrier dysfunction and subsequent extravasation of monocytes (kipar and meli, ; kipar et al., ) . furthermore, the production of vascular endothelial growth factor produced in fipv-infected monocytes and macrophages was proposed to induce increased vascular permeability and hence effusion in body cavities (takano et al., ) . although leukocytes are not susceptible to fipv infection, they appear to become activated during fipv infection by as-yet-unknown mechanisms, thereby probably contributing to endothelial cell damage and the development of fip lesions . based on the presence or absence of protein-rich effusions in the abdominal and pleural cavities, wet (effusive), dry (noneffusive), and a combination of these two clinical forms (mixed form) of fip can be distinguished (drechsler et al., ; hartmann, ; kipar and meli, ; pedersen, ). in natural infections, the wet form seems to be more prevalent than the dry and mixed form, respectively (pedersen, ) . the development of the various clinical forms is believed to be dependent on the host immune response. although the underlying mechanisms are not completely understood, it is generally accepted that the balance between cellular and humoral immune responses in infected animals critically determines the clinical progression of the disease. while strong cellular immune responses may control the disease (pedersen, (pedersen, , , weak cellular but vigorous b cell responses have been associated with the wet form and somewhat stronger t cell immune responses are thought to cause the dry form of fip (pedersen, (pedersen, , . it has been observed in field cases of fip that the wet form often develops during the terminal stage of dry fip, probably reflecting a collapse of the immune system (pedersen, (pedersen, , . factors that may trigger the progression of the disease have been described for both naturally and experimentally infected cats. it was shown that stress or superinfections with feline leukemia virus and feline immunodeficiency virus, respectively, increase the risk for fip development (poland et al., ) . the underlying mechanism for this phenomenon is not completely understood, but it is assumed that immunosuppression favors the generation of escape mutants and thereby, the probability of clinical manifestation of fip. furthermore, genetic predisposition to fip was suggested (golovko et al., ; hsieh and chueh, ; pedersen, ; pesteanu-somogyi et al., ; wang et al., ; worthing et al., ) . despite the existence of serotype i and ii fipvs, the characteristics of the disease caused by these serotypes appear to be very similar. the incubation time for naturally occurring fip cases is difficult to assess, but a number of studies using experimentally infected specific pathogen-free (spf) cats revealed incubation times of - days for the wet form and several weeks for the dry form (kiss et al., ; pedersen and black, ; pedersen et al., a pedersen et al., , tekes et al., ) . following experimental infections with the prototype serotype ii fipv - strain or a recombinant form of this virus, respectively, cats were shown to develop fever after a few days and lost weight rapidly. shortly after infection, viral rna became detectable in the feces and blood; serum antibody titers increased rapidly and remained at a high level during the entire course of infection. in some cases, infected animals seemed to recover after the first week of clinical signs, but subsequently developed pronounced clinical signs of the disease including fever, lack of appetite, weight loss and a progressively worsening condition. although most of the cats died within - weeks after experimental exposure to serotype ii fipv strain - , a low number of animals survived for a few months and succumbed to the disease at a later time point (de groot-mijnes et al., ) . the overall survival time of cats can vary significantly, depending on the amount and virulence of the virus used for the experimental infection (kiss et al., ; pedersen and black, ; pedersen et al., a; tekes et al., ) . it should also be noted that experimental infections of cats with fipvs always lead to clinical signs, but approximately % of the animals can survive and recover (de groot-mijnes et al., ; dean et al., ; kipar and meli, ; tekes et al., ) . naturally occurring fip usually affects cats at a young age of less than years; the incidence of fip dramatically decreases with increasing age (foley et al., ; pedersen, ) . it is generally accepted that fip occurs sporadically. unlike fcovs, fipvs are usually not transmitted horizontally from cat to cat, even though fipv shedding into feces has been detected under experimental infection conditions (bank-wolf et al., ; pedersen, ; pedersen et al., ; tekes et al., ; thiel et al., ) . however, fipv shedding in the feces does not lead to fip in contact animals (pedersen et al., ) and horizontal transmission of fipv resulting in fip is thought to have no epidemiological role. fip develops in approximately % of cats that are persistently infected with fecv (chang et al., ; haijema et al., ; pedersen, ). over many years, the origin of fipvs was unclear and discussed quite controversially. in early investigations, fecvs and fipvs were considered different virus species. in subsequent studies, fecvs and fipvs were proposed to be closely related viruses with distinct virulence properties. sequence analyses of both biotypes revealed much higher sequence similarity of fipv and fecv isolates collected in the same cattery compared to fcov sequences from distinct catteries/geographical regions (herrewegh et al., b; pedersen et al., b; poland et al., ; vennema et al., ) . these observations led to the hypothesis that fipv evolves from fecv by specific mutations occurring in the viral genomes in individually infected cats. this "internal mutation" hypothesis received further support from a series of animal experiments (poland et al., ; vennema et al., ) . based on other data, an alternative "circulating virulent-avirulent fcov" hypothesis that contradicted the widely accepted theory was also proposed (brown et al., ) . the study suggested the independent coexistence of virulent and avirulent fcovs in a cat population. the authors claimed that cats develop fip only upon infection with the virulent fcov type. however, this hypothesis has failed to receive any backing, and since then additional experiments and further analyses have strengthened the "internal mutation" theory (bank-wolf et al., ; barker et al., ; chang et al., chang et al., , chang et al., , lewis et al., ; licitra et al., ; pedersen et al., ; porter et al., ) . it is now widely accepted that fipv emerges during persistent infection through mutations from the harmless fecv. however, it is not understood which mutation(s) occur(s) at which stage during the development of fip. as mentioned earlier, fecvs show a pronounced tropism toward epithelial cells in the gut, but they are also able to infect monocytes, albeit inefficiently. it was suggested that in monocytes-rather than in intestinal epithelial cells-fecvs acquire mutations that can convert them into fipvs (pedersen et al., ) . the resulting fipvs display an altered cell tropism; they infect and replicate efficiently in monocytes and macrophages. this property is considered a key step in the development of fip. in the past decades, many studies were aimed at identifying mutations responsible for the biotype switch. mutations in accessory genes and the s gene of fcovs have been associated with fip development. in this regard, accessory gene c was one major focus. early studies showed that fecvs always contain an intact c gene, while more than two-thirds of fipvderived c sequences were found to contain mutations (e.g., deletion or point mutation) that prevented translation of an intact full-length protein. therefore, mutations in c were initially thought to be a general virulence marker indicative of fip vennema et al., ) . more recent studies confirmed these earlier observations, with c being heavily mutated in the majority of fipv isolates and possibly involved in fip development. comprehensive sequence analyses of fecvs isolated from the gut and fipvs isolated from the gut, organ lesions, and effusions, respectively, suggested that an intact c gene is required for viral replication in the gut but nonessential for systemic replication of fipvs (bank-wolf et al., ; chang et al., chang et al., , chang et al., , pedersen et al., ) . it is currently considered likely that the mutations in c are no virulence markers for fip, but rather a consequence of systemic spread and enhanced replication of fipvs. nevertheless, it cannot be excluded that (frameshift and other) mutations that affect c protein expression contribute to an increased viral fitness in monocytes/macrophages and, thereby, to the development of fip. based on sequence analyses of the a gene of fecv/fipvs obtained from persian cats, one study proposed that deletions in the a gene are associated with the development of fip (kennedy et al., ) . however, these data did not receive support from others. mutations in the a gene are not currently considered to be crucial for the biotype switch. deletions in the b gene have also been proposed to play an important role in fip development. however, consecutive analyses revealed that deletions in b primarily evolve during cell culture adaptation and are associated with loss of virulence (herrewegh et al., b (herrewegh et al., , takano et al., ) . the existence of deletions in the b gene in naturally occurring fecvs argues against a major involvement of mutations in b in fip development (lin et al., ) . lately, the focus of research on fip pathogenesis shifted toward the investigation of the s gene. the coronaviral s protein is crucial for receptor binding and virus entry. since the fecv-fipv transition involves a switch of target cell tropism, mutations in the s gene alone or in combination with changes in other genes may contribute to the biotype switch. to address this possibility, recent studies investigated the involvement of s gene mutations in fip pathogenesis. an analysis of fecv and fipv full-length genome sequences identified two point mutations in the s gene that can distinguish the vast majority of fipvs from fecvs (chang et al., ) . to confirm this observation, the same research group investigated additional fecv and fipv s gene sequences; the outcome was basically identical. the analyses showed that either one or both mutations were present in approximately % of the fipv sequences while they were absent in all examined fecvs, providing strong evidence to suggest that these mutations correlate with the occurrence of fip. one of the mutations leads to a metto-leu substitution at amino acid position in the s protein (m l) and the other causes a ser-to-ala substitution (s a) (chang et al., ) . since the affected residues are located in the putative fusion peptide of the s protein, it is tempting to speculate that amino acid changes in this region affect the cellular tropism of the virus, resulting in enhanced monocyte/ macrophage tropism, a hypothesis that remains to be confirmed in additional experiments. based on the observed sequence differences between the s genes of fecvs and fipvs, a diagnostic assay for fip diagnosis has been developed. porter et al. sequenced a short fragment of the s gene derived from fecal and tissue samples of both fecvs and fipvs. in the majority of the fecal samples, the authors found methionine at position and in the majority of tissue samples leucine at position , regardless of whether the cats were infected with fecv or fipv. they concluded that the m l substitution represents a marker for systemic fcov infection rather than a marker for fip (porter et al., ) . another study investigating fecv-fipv discriminatory mutations determined fecv and fipv full-length genome sequences (lewis et al., ) . similar to the observations described earlier (chang et al., ) , m l was identified as a fully discriminatory mutation between fecvs and fipvs because it was exclusively present in the analyzed fipv but not in any of the fecv samples. interestingly, this work identified one more substitution suitable to discriminate between fecvs and fipvs, an ile-to-thr substitution at position (i t) in the heptad repeat (hr ) region, which was exclusively found in fipvs. amino acid substitutions in the hr region of fipvs (but not of fecvs) have also been described by others (bank-wolf et al., ) . as discussed by lewis et al., it seems plausible that changes in the hr region result in an altered fusogenic activity of the s protein which may affect the cellular tropism of the virus. however, it remains unclear whether the described mutations are relevant to fip development. in a recent study, the furin cleavage site located between the s and s domains of the s protein was investigated in fecv and fipv samples (licitra et al., ) . while all fecvs were found to contain an intact and functional furin cleavage motif, as many as out of fipvs contained amino acid substitutions at the cleavage site itself or in close proximity to the furin cleavage site. fluorogenic peptide assays showed that the mutations identified in fipvs affect the efficiency of furin-mediated s protein cleavage. because the fusion activity of the coronaviral s protein generally requires activation by cellular proteases, substitutions at the protease cleavage site may indirectly affect viral spread and, thus, disease progression and the development of fip (bosch and rottier, ) . the point mutations described earlier were detected in different regions of the s gene. obviously, there is a strong correlation between the genetic changes and the occurrence of fipv. however, it is important to emphasize that the fecv-fipv substitutions were identified only via comparative sequence analyses and, so far, none of the assumed functional changes concerning cell tropism and biotype switch for fip pathogenesis have been proved experimentally. reverse genetics approaches are extremely valuable tools to produce recombinant fcovs containing genetic changes suitable to investigate the role of specific viral proteins in the molecular pathogenesis of fip. so far, three different reverse genetics systems have been described for fcovs. the very first system is based on targeted rna recombination and was established for the highly virulent serotype ii fipv strain - (haijema et al., ) . this system proved to be a very useful tool for modifying the fcov genome but, for technical reasons, only the -terminal third of the genome is amenable to mutagenesis via this approach. by deleting the entire orf (fipv-△ ), the entire orf (fipv-△ ), or both (fipv-△ △ ), recombinant viruses were generated that displayed similar properties in cell culture to the parental virus. however, all of these recombinant viruses were attenuated in vivo and did not induce fip. furthermore, cats inoculated with fipv-△ or fipv-△ mutants were protected against a challenge with the parental virus, demonstrating that the accessory genes are dispensable for viral growth in vitro but contribute to virulence in vivo (haijema et al., ) . the same group investigated the genetic determinants for macrophage tropism of fipv strain - . parts of the s gene or the entire s gene of the fipv strain - were replaced with the corresponding s gene sequences derived from a cell culture-adapted serotype ii fecv. infection of macrophages with the recombinant viruses and the parental virus, respectively, revealed that the s protein alone was responsible for efficient macrophage infection and replication. moreover, the c-terminal domain of the s protein was suggested as a key determinant for target cell tropism . others have also used the recombinant viruses fipv-△ , fipv-△ , and fipv-△ △ to study certain aspects of fcov biology. dedeurwaerder et al. investigated the role of orf and orf for replication of fipv in peripheral blood monocytes . they were able to show that only the fipv-△ and the parental virus but not fipv-△ △ and fipv-△ were able to maintain replication in monocytes. accordingly, it was suggested that orf is crucial for fipv replication in monocytes and macrophages. in another study, this group addressed the question of whether a and b proteins interfere with the cellular innate immune system. using the recombinant fipv-△ virus and a a-expressing plasmid construct, data were obtained to suggest a function of the a protein in counteracting ifn-α-induced antiviral responses (dedeurwaerder et al., ) . balint et al. established a bacterial artificial chromosome (bac)-based reverse genetic system for serotype ii fipv strain df (balint et al., ) . in contrast to the targeted rna recombination system, the bac system is suitable to mutagenize the entire fcov genome. however, instability of the cloned fcov cdna in bac may hinder the efficient generation of recombinant fcovs. strain df is the cell culture-adapted variant of strain - , which is used in the only available vaccine against fip (kipar and meli, ; pedersen, ). the strain df contains a -nt-long deletion in orf , resulting in truncated orf a and orf c proteins and deletion of the entire orf b. using the bac-based reverse genetic system, the authors generated a recombinant df identical to the parental virus and a virus with fully restored orf derived from ccov. all recombinant viruses showed similar characteristics in established cell lines. however, after infection of peripheral blood monocytes, the virus with the fully restored orf showed significantly lower replication compared to the virus in which orf was deleted, suggesting that the orf deletion may promote efficient virus replication in monocytes. in follow-up studies, the virulence of the recombinant viruses and the role of a fully restored orf were assessed in experimental infections (balint et al., a,b) . only the recombinant virus containing an intact orf was associated mainly with the gut and did not cause systemic infection. accordingly, a pivotal role of orf in establishing efficient infection of the intestine in vivo was suggested. the third type of reverse genetic system relies on the integration of the entire coronaviral genome as a cdna into the vaccinia virus genome, with the resulting recombinant vaccinia viruses serving as vectors to clone and manipulate the coronavirus cdna insert (casais et al., ; coley et al., ; thiel et al., ) . the advantages of this system are that desired changes can be introduced at any position of the viral genome and, in contrast to escherichia coli-based cloning systems, genetic instabilities of the fulllength fcov cdna insert in the vaccinia virus genome have never been observed. however, complex and time-consuming procedures are required to manipulate the fcov cdna by vaccinia virus-mediated recombination and to produce (wild-type or mutant) genome-length fcov rna to be transfected into susceptible cells. such a vaccinia virus-based system was reported for the serotype i fcov strain black (tekes et al., ) . this virus was isolated from a cat with fip (black, ) . interestingly, the recombinant serotype i fcov strain black and the virus isolate that was used to assemble the fcov black sequence did not induce fip in spf cats. most likely, the propagation of the virus in tissue culture led to adaptive mutations that resulted in a nonpathogenic virus. the serotype i fcov strain black contains a stop codon in the accessory gene b that was thought to be an adaptive mutation responsible for the nonvirulent phenotype of this virus. accordingly, a recombinant virus with a fully restored orf b was generated and used for animal experiments; however, fip was still not induced. in an attempt to generate a recombinant fcov that reproducibly induces fip, increasing portions of the recombinant fcov black genome were replaced with the homologous genome regions derived from the highly virulent serotype ii fipv strain - (tekes et al., ; thiel et al., ) . one of the chimeric viruses contained the s- abc region, and another additionally possessed most of the orf b of the serotype ii fipv in the serotype i virus backbone. both viruses led to a systemic infection and induced high serum antibody titers, but fip was not induced. accordingly, the introduced parts of the serotype ii genome were not sufficient to convert the nonpathogenic virus into a fip-inducing virus, possibly because the virus contained additional attenuating mutations elsewhere in the serotype i backbone. another explanation is an "incompatibility" of specific genome regions derived from serotype i fcov strain black and serotype ii fipv strain - , respectively, in inducing fip. finally, in order to generate a fulllength recombinant serotype ii fipv strain - , the remaining parts of the serotype i backbone were replaced with the homologous regions of the serotype ii fipv. as expected, the recombinant serotype ii fipv and its parental virus induced fip in experimentally infected spf cats. in both the recombinant and the parental serotype ii fipv strain - , the orf c contained a mutation causing a premature translational termination of this protein. remarkably, sequence analyses of viral rna originating from tissues of diseased cats revealed the restoration of orf c. at first glance, this finding contradicts previous reports since an intact c is thought to be required for replication in the gut but dispensable for systemic infection (chang et al., ; pedersen et al., ) . interestingly, fipv rna with intact orf c was detected in the fecal samples shortly before the cats succumbed to the disease, suggesting that fipv replication also took place in the gut prior to death. it remains to be determined whether the restoration of orf c is required to induce fip after experimental infection with fipv strain - . over the past few years, many aspects of fcov biology have been studied, providing interesting new insight into fip pathogenesis; however, a number of important questions remain to be addressed. this also applies to the emergence of fipvs. it is now generally accepted that fipv evolves from fecv through mutations being acquired in persistently infected animals. however, mutations that can convert a nonpathogenic fecv into a deadly virus have not been determined unambiguously, for example, by using reverse genetics approaches to produce and characterize mutants containing specific genetic changes predicted (by previous sequence analyses of fcev/fipv pairs) to convey a fip-inducing phenotype. in the past, various reverse genetic systems have been developed, but all of them are based either on cell culture-adapted serotype i or serotype ii fcovs that are not suitable for detecting mutations responsible for the biotype switch. accordingly, there is an urgent need for a robust reverse genetic system that allows the production, characterization, and manipulation of serotype i field isolates. there are two promising strategies for identifying mutations that can turn a nonpathogenic fecv into a fip-inducing virus. one possibility is to introduce the described fecv-fipv discriminatory mutations into a fecv field isolate using reverse genetics. so far, the most relevant data concerning fecv-fipv discriminatory mutations originate from extensive comparative sequence analyses of serotype i fecv and fipv field isolates. the identified mutations correlate with the switch of biotype and primarily concern the s gene. accordingly, these discriminatory mutations should be introduced into the s gene of a serotype i fecv field isolate using reverse genetics and the virulence of the resulting viruses should be assessed in animal experiments. we hypothesize that mutations in one gene or a combination of changes in different parts of the fcov genome can lead to the emergence of fipv. this assumption is supported by published data, which locate the mutations in four different regions of the s protein (predicted fusion peptide, hr region, furin cleavage site, and c-terminal region). all of these s gene mutations may lead to an altered cell tropism and finally to the development of fip. however, sequence analyses also revealed substitutions located at many positions throughout the genomes of the corresponding fecv and fipv pairs. accordingly, it should be possible to identify mutations responsible for the biotype switch by generating and studying chimeric fcovs. the starting materials for these viruses are "infectious clones" of genetically defined fecv-fipv pairs. by replacing increasing parts of the fecv genome with the corresponding fipv genome segments, the region of the fipv genome that is able to convert the nonvirulent fecv into a fip-inducing virus will be localized. however, this approach requires the growth of field viruses in standard cell culture systems, which has not been achieved so far. there is only one recently described feline enterocyte cell line that apparently allows propagation of serotype i fcovs . it remains to be seen whether such a cell line can be used to grow fcov field isolates to high titers or even for the identification of the cellular receptor(s) of serotype i fcovs. another intriguing question relates to the role of accessory proteins in the fcov life cycle. due to the lack of appropriate tools, our knowledge about these proteins remains limited. so far, only the expression of b gene could be demonstrated in infected cells (herrewegh et al., b; vennema et al., vennema et al., , . furthermore, one publication suggested a role for the a protein as an interferon antagonist (dedeurwaerder et al., ) . there is increasing evidence that the accessory proteins are important for virulence in vivo, but the underlying molecular mechanisms are not understood. also, fcov accessory proteins may be required for viral persistence in specific cell types. future studies are required to elucidate the functions of the accessory proteins and are expected to provide interesting insight into the molecular mechanisms that determine the pathogenesis, progression, and outcome of fcov-induced diseases. control of feline coronavirus infection in kittens a study of naturally occurring feline coronavirus infections in kittens persistence and transmission of natural type i feline coronavirus infection isolation and molecular characterization of type i and type ii feline coronavirus in malaysia prevalence of korean cats with natural feline coronavirus infections molecular characterization of feline infectious peritonitis virus strain df- and studies of the role of orf abc in viral cell tropism recombinant feline coronaviruses as vaccine candidates confer protection in spf but not in conventional cats comparative in vivo analysis of recombinant type ii feline coronaviruses with truncated and completed orf region phylogenetic analysis of feline coronavirus strains in an epizootic outbreak of feline infectious peritonitis prevalence of feline coronavirus types i and ii in cats with histopathologically verified feline infectious peritonitis recovery and in vitro cultivation of a coronavirus from laboratoryinduced cases of feline infectious peritonitis (fip) nidovirus entry into cells the coronavirus spike protein is a class i virus fusion protein: structural and functional characterization of the fusion core complex genetics and pathogenesis of feline infectious peritonitis virus reverse genetics system for the avian coronavirus infectious bronchitis virus feline infectious peritonitis: insights into feline coronavirus pathobiogenesis and epidemiology based on genetic analysis of the viral c gene sequence analysis of feline coronaviruses and the circulating virulent/avirulent theory spike protein fusion peptide and feline coronavirus virulence recombinant mouse hepatitis virus strain a from cloned, full-length cdna replicates to high titers in vitro and is fully pathogenic in vivo sequence analysis of the -end of the feline coronavirus fipv - genome: comparison with the genome of porcine coronavirus tgev reveals large insertions family coronaviridae natural history of a recurrent feline coronavirus infection and the role of cellular immunity in survival and disease coronaviruses as vectors: stability of foreign gene expression in vivo cytokine response to experimental feline infectious peritonitis virus infection an update on canine coronaviruses: viral evolution and pathobiology the role of accessory proteins in the replication of feline infectious peritonitis virus in peripheral blood monocytes orf -encoded accessory protein a of feline infectious peritonitis virus as a counteragent against ifn-alpha-induced antiviral response experimental feline enteric coronavirus infection reveals an aberrant infection pattern and shedding of mutants with impaired infectivity in enterocyte cultures replication of feline coronaviruses in peripheral blood monocytes feline coronavirus in multicat environments genomic rna sequence of feline coronavirus strain fipv wsu- / type i feline coronavirus spike glycoprotein fails to recognize aminopeptidase n as a functional receptor on feline cell lines risk factors for feline infectious peritonitis among cats in multiple-cat environments with endemic feline enteric coronavirus genetic susceptibility to feline infectious peritonitis in birman cats detection of feline coronaviruses by culture and reverse transcriptase-polymerase chain reaction of blood samples from healthy cats and cats with clinical feline infectious peritonitis switching species tropism: an effective way to manipulate the feline coronavirus genome live, attenuated coronavirus vaccines through the directed deletion of group-specific genes provide protection against feline infectious peritonitis feline coronaviruses: a tale of twofaced types feline infectious peritonitis systemic vascular lesions in feline infectious peritonitis detection of feline coronavirus rna in feces, tissues, and body fluids of naturally infected cats by reverse transcriptase pcr the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes persistence and evolution of feline coronavirus in a closed cat-breeding colony feline coronavirus type ii strains - and - originate from a double recombination between feline coronavirus type i and canine coronavirus prevalence of antibodies to feline parvovirus, calicivirus, herpesvirus, coronavirus, and immunodeficiency virus and of feline leukemia virus antigen and the interrelationship of these viral infections in free-ranging lions in east africa the prevalence of types i and ii feline coronavirus infections in cats differences in virus receptor for type i and type ii feline infectious peritonitis virus identification and genotyping of feline infectious peritonitisassociated single nucleotide polymorphisms in the feline interferon-gamma gene c protein of feline coronavirus inhibits viral replication independently of the autophagy pathway deletions in the a orf of feline coronavirus associated with an epidemic of feline infectious peritonitis detection of feline coronavirus in captive felidae in the usa evaluation of antibodies against feline coronavirus b protein for diagnosis of feline infectious peritonitis in cats topology of microvillar membrance hydrolases of kidney and intestine feline infectious peritonitis: still an enigma? cellular composition, coronavirus antigen expression and production of specific antibodies in lesions in feline infectious peritonitis fatal enteritis associated with coronavirus infection in cats morphologic features and development of granulomatous vasculitis in feline infectious peritonitis natural fcov infection: cats with fip exhibit significantly higher viral loads than healthy infected cats natural feline coronavirus infection: differences in cytokine patterns in association with the outcome of infection sites of feline coronavirus persistence in healthy cats disease outcome and cytokine responses in cats immunized with an avirulent feline infectious peritonitis virus (fipv)-ucd and challenge-exposed with virulent fipv-ucd localization of neutralizing epitopes and the receptor-binding site within the amino-terminal amino acids of the murine coronavirus spike protein feline coronavirus serotypes and : seroprevalence and association with disease in switzerland viral infections in free-living populations of the european wildcat genotyping coronaviruses associated with feline infectious peritonitis mutation in spike protein cleavage site and pathogenesis of feline coronavirus field strain feline coronaviruses with small deletions in orf b associated with both enteric infection and feline infectious peritonitis full genome analysis of a novel type ii feline coronavirus ntu human myeloid plasma membrane glycoprotein cd (gp ) is identical to aminopeptidase n gain, preservation, and loss of a group a coronavirus accessory glycoprotein high viral loads despite absence of clinical and pathological findings in cats experimentally infected with feline coronavirus (fcov) type i and in naturally fcov-infected cats serosurvey of viral infections in free-ranging namibian cheetahs coronavirus accessory proteins altered expression of adhesion molecules on peripheral blood leukocytes in feline infectious peritonitis glycosylation of the severe acute respiratory syndrome coronavirus triple-spanning membrane proteins a and m serologic survey and serum biochemical reference ranges of the free-ranging mountain lion (felis concolor) in california virologic and immunologic aspects of feline infectious peritonitis virus infection a review of feline infectious peritonitis virus infection: - an update on feline infectious peritonitis: virology and immunopathogenesis attempted immunization of cats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus infection studies in kittens, using feline infectious peritonitis virus propagated in cell culture an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis pathogenicity studies of feline coronavirus isolates - and - pathogenesis of feline enteric coronavirus infection significance of coronavirus mutants in feces and diseased tissues of cats suffering from feline infectious peritonitis feline infectious peritonitis: role of the feline coronavirus c gene in intestinal tropism and pathogenicity based upon isolates from resident and adopted shelter cats prevalence of feline infectious peritonitis in specific cat breeds two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus amino acid changes in the spike protein of feline coronavirus correlate with systemic spread of virus from the intestine and not with feline infectious peritonitis utilization of dc-sign for entry of feline coronaviruses into host cells activation of p mapk by feline infectious peritonitis virus regulates pro-inflammatory cytokine production in primary blood-derived feline mononuclear cells feline lectin activity is critical for the cellular entry of feline infectious peritonitis virus acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein anchoring and biosynthesis of stalked brush border membrane proteins: glycosidases and peptidases of enterocytes and renal tubuli descriptive distribution and phylogenetic analysis of feline infectious peritonitis virus isolates of malaysia a mrna pcr for the diagnosis of feline infectious peritonitis intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence a "possible" involvement of tnf-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis tnf-alpha, produced by feline infectious peritonitis virus (fipv)-infected macrophages, upregulates expression of type ii fipv receptor feline aminopeptidase n in feline macrophages neutrophil survival factors (tnf-alpha, gm-csf, and g-csf) produced by macrophages in cats infected with feline infectious peritonitis virus contribute to the pathogenesis of granulomatous lesions vascular endothelial growth factor (vegf), produced by feline infectious peritonitis (fip) virus-infected monocytes and macrophages, induces vascular permeability and effusion in cats with fip genome organization and reverse genetic analysis of a type i feline coronavirus chimeric feline coronaviruses that encode type ii spike protein on type i genetic background display accelerated viral growth and altered receptor usage a reverse genetics approach to study feline infectious peritonitis emergence of pathogenic coronaviruses in cats by homologous recombination between feline and canine coronaviruses infectious rna transcribed in vitro from a cdna copy of the human coronavirus genome cloned in vaccinia virus tackling feline infectious peritonitis via reverse genetics feline aminopeptidase n is a receptor for all group i coronaviruses feline aminopeptidase n serves as a receptor for feline, canine, porcine, and human coronaviruses in serogroup i intriguing interplay between feline infectious peritonitis virus and its receptors during entry in primary feline monocytes genomic organization and expression of the ' end of the canine and feline enteric coronaviruses a novel glycoprotein of feline infectious peritonitis coronavirus contains a kdel-like endoplasmic reticulum retention signal feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses pathogenic characteristics of persistent feline enteric coronavirus infection in cats pedv orf encodes an ion channel protein and regulates virus production an outbreak of feline infectious peritonitis in a taiwanese shelter: epidemiologic and molecular evidence for horizontal transmission of a novel type ii feline coronavirus polymorphisms in the feline tnfa and cd genes are associated with the outcome of feline coronavirus infection antibody-mediated enhancement of disease in feline infectious peritonitis: comparisons with dengue hemorrhagic fever pathogenesis of feline infetious peritonitis: pathologic changes and immunofluorescence risk factors for feline infectious peritonitis in australian cats the s subunit of the spike glycoprotein of bovine coronavirus mediates membrane fusion in insect cells the orf a protein of human coronavirus e functions as a viroporin that regulates viral production the coronavirus replicase virus-encoded proteinases and proteolytic processing in the nidovirales key: cord- -r d oaez authors: rottier, peter j.m. title: the molecular dynamics of feline coronaviruses date: - - journal: vet microbiol doi: . /s - ( ) - sha: doc_id: cord_uid: r d oaez feline coronaviruses are widespread and come in different flavors. there are two main serotypes both of which occur in two pathotypes, the avirulent enteric viruses and the virulent, usually fatal peritonitis viruses, the latter in turn occurring either in a ‘wet’ or exudative form or in a ‘dry’ or proliferative form. in this paper a concise overview is given of the molecular features of these viruses. special attention is given to the genetic dynamics of the viruses as these now allow us to begin to understand the origin of the different phenotypes, in particular the genesis of virulence during persistent infection. as discussed, the surprising new insights obtained over the last few years call for a critical reevaluation of strategies for protection. the utrecht group has been accumulating data on feline coronaviruses for more than two decades; marian c. horzinek started the work on feline infectious peritonitis in , and with raoul de groot, harry vennema, herman egberink and bart haagmans our group has made major contributions on this topic. arnold herrewegh's dissertation, based on five papers, is the last coherent addition to the subject (herrewegh, ) . coronaviruses are positive-stranded rna viruses, recently accommodated in the order nidovirales. the family coronaviridae includes the genera coronavirus and torovirus, whereas the arteriviridae contains but a single genus (arterivirus) so far. the viruses have been classified in the order nidovirales mainly on the basis of two features: their genome organization and their replication strategy (for review, see de vries et al., ) . the organization of the genomes of the corona-, toro-, and arteriviruses is quite similar: they have a large open reading frame at the '-end of their genome, which encodes the polymerase (fig. ). it is synthesized as a precursor protein, which is in part generated by ribosomal frameshifting and which is processed by proteolytic cleavages to generate the functional proteins. further downstream from the polymerase gene there is a collection of open reading frames, amongst which the genes for the structural proteins are located, as well as genes of largely unknown function. there is some variation in the genetic makeup of coronaviruses, e.g., with respect to the hemagglutinin/esterase (he) gene, which is lacking in feline viruses. the genes for the structural proteins are obviously present in all viruses, but again there are differences: thus toroviruses lack an e protein, which for coronaviruses is essential in the assembly process. the other common feature is the replication strategy, more specifically: the way these viruses make their proteins. the polymerase protein is translated from the genome, the incoming viral rna. the other open reading frames are translated from subgenomic messenger rnas that are generated by a specific mechanism of discontinuous transcription. each mrna of this collection is responsible for one protein by translation of the '-most open reading frame. coronaviruses can be grouped into three clusters on the basis of genetic comparisons (table ) . we find the feline coronaviruses in group , together with e.g., porcine transmissible gastroenteritis virus and canine coronavirus. the most prominent member of group is mouse hepatitis virus, also the coronavirus type species. infectious bronchitis virus and its many variants constitute group . electron microscopically these viruses present a characteristic picture, with a`corona' surrounding the enveloped particle, a halo of very typical surface projections. within the envelope resides the nucleocapsid, which harbors the plus-stranded huge rna molecule of some kb, the longest mature mrna known to occur in nature. the rna is packaged by one type of protein, the nucleocapsid (n) protein, which is surrounded in turn by an envelope containing three membrane proteins. the spike (s) protein, is the most obvious protein in that it forms the above-mentioned`corona'. another envelope constituent is the membrane protein (m), which is most abundant. finally there is the small envelope protein (e), which has been discovered only recently and which occurs only in very low numbers in virions. in feline coronaviruses the number has not yet been determined but in the related tgev it was estimated to occur at a rate of about molecules per particle (godet et al., ) coronaviruses do not bud from the plasma membrane but are assembled within the cell, at intracellular membranes. these have been identified as the membranes from the intermediate compartment, a complex situated between the endoplasmic reticulum and the golgi apparatus. this is how it happens: the nucleocapsid, the ribonucleoprotein structure composed of the rna and the nucleocapsid protein is synthesized in the cytoplasm. it subsequently encounters the membrane proteins which after their synthesis in the endoplasmic reticulum have traveled to the intermediate compartment. in this compartment the membrane proteins accumulate and interact with the nucleocapsid. subsequent budding gives rise to viral particles which are moved to and through the golgi complex by vesicular transport, undergoing various modifications while on their way. from the golgi complex they are transported (again by vesicles) to the plasma membrane and exocytosed. many properties of the membrane proteins are known. the s-protein is a homotrimer of a glycoprotein of some kda. the m-protein is a triple-spanning membrane protein ± a typical nidovirales protein found also in toro-and arteriviruses in that configuration. finally there is the largely hydrophobic kda e-protein. as we have shown, only the last approximately residues of this polypeptide are exposed at the cytoplasmic side of cellular membranes; these residues end up in the interior of the virus particle after assembly. we have extensively studied the coronaviral envelope proteins, amongst others by coexpressing their genes in different combinations. using the vaccinia virus/t polymerase expression system with plasmids coding for the respective proteins we asked the question what would emerge from these cells. when we coexpressed all three membrane proteins, we encountered particles in the medium, which were morphologically indistinguishale from coronavirions (vennema et al., ) . we have done the experiment for mouse hepatitis virus and repeated it with feline coronaviruses, with the same result the particles produced by coexpression are indistinguishable from authentic virions. the surprise was great when we studied the various combinations and found that, with only the m and e envelope proteins particles were still formed, while nothing happened when the proteins were expressed separately. this finding means that while the m protein alone is unable to assemble coexpression of the e protein allows the formation of a curvature in the membrane, and eventually budding of vesicles with virion size. if the s protein is present, it is co-incorporated. we know that the s protein interacts with the m protein whereby it is apparently drawn into these particles. the conclusion of this experiment is that the assembly of the coronavirus envelope is independent of the nucleocapsid, the m and e proteins being essential, while the spike protein is also dispensable. these findings are interesting not only for fundamental studies on virus assembly, but also for applied research. feline coronaviruses can be grouped on the basis of different criteria, one of them being virulence for the host. this has led to the definition of biotypes, or pathotypes as we may want to call them. we have on the one hand avirulent strains which cause usually mild or even subclinical enteric infections. they are mostly referred to as feline enteric coronaviruses (fecv). on the other hand we have the virulent strains which cause feline infectious peritonitis (fip), and we then talk about fip viruses (fipv). for a general review, see de groot and horzinek ( ) . another distinction is made on the basis of serology, which has allowed the definition of two serotypes. the epidemiology of coronavirus infections can be summarized as follows. all viruses are transmitted by the oro-faecal route, the viruses being widespread in all cat populations known. if you look in catteries or community shelters where cats are in crowded situations, seropositivity is high; but even many single-cat households appear to be seropositive. on the other hand fip is a rare consequence of the infection, occurring in only ± % of the infected animals, mainly in kittens, but sometimes also in old cats. the signs of the infection leading to fip are chronic undulating fever, anorexia, general malaise, ocular and neurological disorders. very characteristic is the abdominal extension which is caused by the formation of ascitic fluid in the`wet' or exudative form of fip; there is also a`dry' or proliferative form where only little if any exudate is found. the pathogenesis of fip is clearly immune-mediated. the key pathogenic event appears to be the infection of cells of the monocyte/macrophage lineage. as shown recently by bart haagmans there is bystander apoptosis of activated t-cells mediated by some soluble factor, while the t-cells are not replicating the virus (haagmans et al., ) . also antibody enhancement is a very well-known phenomenon, with early death as a consequence under experimental conditions. the enhanced infection of macrophages is probably mediated by antibodies complexed with virions and taken up via a fc receptor. what is the origin of the coronaviruses causing fip? this question has kept us busy for many years. what is the relation of fipv with fecv, so to say. how do fip-inducing coronaviruses arise? a quote from a recent paper of harry vennema (vennema et al., ) is appropriate here: fipv is derived by mutation from endemic enteric coronaviruses and the paper provides strong indications for that. there were already indications from the work of arnold herrewegh and others before, but this paper most convincingly shows that fipv is a variant, a mutant of fecv arising in an infected animal. vennema and coworkers came to this conclusion on the basis of extensive sequence analyses and sequence comparisons. they compared sequences of fipv viruses from different geographic areas with those of fecv viruses from these same areas and concluded that the viruses isolated from fip cases are most similar to the coronaviruses from the area where this particular case of fip occurred. this important conclusion also has implications e.g., for protection. another pathogenetic indication obtained was that virulence, the sudden appearance of an fipv biotype, appears to correlate with deletions in the c and b genes. what the c gene actually does is unknown; in essence the same is true for the b gene product, though we know that this is a small glycoprotein that is released into the medium from infected cells in culture. we have suggested that it might have a signalling function, acting as a`virokine'. the two feline coronavirus serotypes can be distinguished on the basis of their relationship to canine coronavirus. ccv specific sera neutralize type ii viruses but fail to neutralize, or neutralize only poorly those of type i. the viruses also have different in vitro characteristics: type ii strains grow well in tissue culture, type i strains grow poorly (pedersen et al., ) . as a consequence more is known about type ii viruses than about type i viruses. in the field, however, type i strains are predominant; in europe for instance, type ii strains have hardly been found, if ever, and also in the us they have been detected only incidentally. in japan they are reported to constitute ± % of the viruses. what is the origin of the serotype ii, what is the molecular basis for the serotypes? it has become clear from sequence comparisons by vennema et al. ( ) , motokawa et al. ( ) and herrewegh et al. ( ) that the type ii strains are the result of double recombination events between fecv type i strains and ccv (see abstract from harry vennema in this issue). recombinations have been found to occur somewhere in the e and the m gene, the second cross-over point being found in orf . since in the various cases of type ii viruses analyzed the same picture has been found (where the spike protein of ccv has been acquired by a type i virus) it is understandable why type ii viruses are ccv related serologically. the fact that several genetically different fecv type i/ccv recombinant strains have been recognized indicates that they have been independently generated, and this double recombination is apparently not a rare event. for many years there have been indications that feline coronaviruses can persist in their natural host. epidemiological studies have indicated that and there is of course niels pedersen's classical experiment where he infected a cat with a sublethal dose of fipv, put the cat in isolation, waited for months and then superinfected it with felv. the immunosuppression caused by the retrovirus made the coronavirus reappear, it was activated to replicate, and eventually the disease picture of fip was seen (pedersen and floyd, ) . more recently, using our sensitive rt-pcr methods (herrewegh et al., a, b) , we designed studies in a closed cat facility in hannover, germany, which confirmed and extended these observations. this was the laboratory cat facility of the medical school, and its history was well documented. it had been fecv-free for many years when, in , feline coronavirus has been inadvertently introduced and from that time on there were yearly cases of ftp; a total of some % of the cats succumbed to the disease. when we came to analyze the situation, no fip cases had been observed over the last years. irrespective of this fact, the virus was really still around: of the cats studied, were seropositive by immunofluorescence; % of these cats were rt-pcr positive in faeces and/or serum and/or plasma. after months we re-examined five rt-pcr positives and found that four of them were still positive. . these data strongly suggested virus persistence in this cattery. the question was then asked whether the continuous presence of the virus was due to recurrent infections between animals or to its extended presence in individual cats. consequently, two pcrpositive cats were placed in strict isolation and their faeces collected. after months, one cat (#h ) was sacrificed, and the collected samples were tested by rt-pcr. the results shown in fig. clearly show that this animal had remained rt-pcr positive for the entire observation period. the long bars in fig. indicate that the samples were positive by direct pcr, the short bars indicate that a nested pcr was required to show a positive result. in essence the same was true for the cat that had been maintained in isolation (cat #h ). we saw that the infection waned and some samples were negative even using a nested pcr. later on positive results were recorded for up to months. this finding demonstrates that the virus can really persist in isolated cats for a long time. from cat #h , the animal that had been sacrificed, a number of tissues were examined for the presence of virus in different tissues. by pcr, viral (genomic) rna was found in many organs. we then employed a pcr designed to detect only mrna, to fig. . chronic shedding of feline coronavirus as monitored by rt-pcr on feces. amplification reactions were targeted to the ' nontranslated region of the viral genome. cats h and h were placed in isolation at day . the numbers of days that the cats were in isolation is on the horizontal axis. the rt-pcr results are expressed by bars above (i.e. positive in rt-pcr) or below (i.e. negative) the horizontal axis. long and short bars represent single and nested rt-pcr. check for replication occurring in these tissues, and there oniy the lower part of the gastro-intestinal tract was found positive. immunohistochemistry performed by bart haagmans evidenced single, scattered antigen-positive cells in various areas in the ileum, close to peyer's patches. the conclusion from these experiments is that feline coronaviruses may persist in the lower intestinal tract where the virus continues to replicate at low levels. we used the samples collected in this cattery also for sequencing, to learn more about the evolution of the viruses, about their genetic changes. the b gene is quite a stable gene (herrewegh et al., c) and was taken for comparison. we found that feline coronaviruses in this colony formed a distinct dade . when we compared them with viruses from other sources and with laboratory strains, they were quite distinct. the viruses from the hannover cattery form one dade, as do viruses originating from another cattery. most probably the viruses in the hannover cattery originated from a single founder infection. the most interesting finding came when we compared the viruses in their ' end of the s gene, known to be highly variable. it appeared that each cat harbors its own distinct feline coronavirus quasispecies. conceivably, the persisting virus confers to its host resistance against superinfection by the closely related feline coronaviruses, which were infecting the other cats. this is an important piece of information when we think about protection, especially the fact that there is resistance against superinfection. we have seen that the feline coronaviruses are harbored in the lower intestinal tract. the question remains whether they are restricted to the enteric epithelium or whether they can cross it. the idea was that`feline enteric coronaviruses' are indeed restricted in tropism, while`fip viruses' would cross the epithelium, infect macrophages and go systemically. epithelial cells are specialized cells; they possess an apical membrane facing e.g. the gut lumen, and a basolateral membrane keeping contact with the neighboring cells and facing e.g., the submucosa;`tight junctions' form a barrier between both the compartments and make sure that different proteins and lipids can be kept separately in them. these cells are specialized in the sorting of proteins and lipids, in the transport of immunoglobulins by transcytosis etc. to study their functions, these cells are grown on filter membranes, whereby the basolateral and apical membranes are separately accessible, e.g., for a virus infection. when the monolayer is complete, there is no transport of medium from the upper part into the lower part of the filter device. using this system, john rossen from our group studied the infection and release behavior of fipv, fecv, ccv, mhv, and tgev. we knew from earlier experiments that tgev is secreted into the apical medium, and by inference into the gut lumen if one considers the intestinal tract, with progression of the infection through apical virus uptake. in contrast, mhv is released into the basolateral medium, and in the mouse, this virus causes a systemic infection, giving rise to hepatitis amongst other symptoms. thus, its basolateral release would be in line with the systemic infection (rossen et al., a (rossen et al., , b, . when examining fipv, fecv, and ccv we found virus release into the basolateral medium in all cases, which would mean that the direction of release is toward the blood stream. so we will probably need to modify our preconception that these viruses are restricted to the intestine. it needs to be examined, of course, if the same holds true for the natural situation. there have been many attempts to protect cats against fip, using various approaches. the result of all these studies is that generally there is no protection when an antibody response to the spike protein is induced there is rather an enhancement of the infection, with an`early death' phenomenon. all these attempts although fruitless in the practical sense have gathered a body of information that allows a number of better focused questions to be asked. one important question is: do we really want to protect against the fipv infection? since fip-inducing coronavirus mutants are generated within the persistently infected animal the objective would rather be to prevent fecv infetion and persistence. when fipv is generated in an animal and causes disease, it is probably shed to some extent, but other cats usually do not get infected. so the transmission is either not very efficient, or most of these cats are resistant to superinfection due to an infection with a related coronavirus variant. usually one sees catteries with one or two isolated cases but the virulent virus obviously does not spread very efficiently. so who is the enemy? the enemy is fecv. what we should want to prevent is the establishment of an fecv infection, because it will eventually be the source of an fipv strain. what we would want to achieve is to protect cats against an infection with fecv. it is highly unlikely that any vaccination strategy will result in sterile immunity. it is unlikely that any vaccine will prevent an infection to occur. there will probably always be a few cells that become infected. what one would want to achieve then is to have an immune system in place that can either terminate or contain that infection immediately. replication of the infecting fecv must be kept to a minimum, such that the viral load and the eplication determinants for the stochastic appearance of fipv mutants are as low as possible. what are the correlates of protection? cellular immunity is probably most important, and there are many indications that this is where the solution must be sought. the vaccinological objective can be summed up in one sentence: novel vaccines aimed at protection against fip should induce a vigorous t-cell response, above all against type i viruses. feline infectious peritonitis the genome organization of the nidovirales: similarities and differences between arteri-, toro-, and coronaviruses tgev coronavirus orf encodes a membrane protein that is incorporated into virions apoptosis and t-cell depletion during feline infectious peritonitis molecular genetics, persistence and evolution of fcov persistence and evolution of feline coronavirus in a closed cat-breeding colony detection of feline coronavirus rna in feces, tissues and body fluids of naturally infected cats by reverse transcriptase pcr polymerase chain reaction (pcr) for the diagnosis of naturally occurring feline coronavirus infections the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes feline coronavirus type ii strains fecv - and fipv - originate from a double recombination between feline coronavirus type i and canine coronavirus comparison of the amino acid sequence and phylogenetic analysis of the peplomer integral membrane and nucleocapsid proteins of feline canine and porcine coronaviruses pathogenic differences between various feline coronavirus isolates experimental studies with three new strains of feline infectious peritonitis virus: fipv-ucd , fipv-ucd , and fipv-ucd a murine and a porcine coronavirus are released from opposite surfaces of the same epithelial cells coronavirus infection of polarized epithelial cells mhv-a enters polarized murine epithelial cells through the apical surface but is released basolaterally nucleocapsid-independent assembly of coronavirus-like particles by coexpression of viral envelope proteins a comparison of the genomes of fecvs and fipvs and what they tell us about the relationships between feline coronaviruses and their evolution key: cord- -p b mtbl authors: theerawatanasirikul, sirin; kuo, chih jung; phecharat, nanthawan; chootip, jullada; lekcharoensuk, chalermpol; lekcharoensuk, porntippa title: structural-based virtual screening and in vitro assays for small molecules inhibiting the feline coronavirus cl protease as a surrogate platform for coronaviruses date: - - journal: antiviral res doi: . /j.antiviral. . sha: doc_id: cord_uid: p b mtbl feline infectious peritonitis (fip) which is caused by feline infectious peritonitis virus (fipv), a variant of feline coronavirus (fcov), is a member of family coronaviridae, together with severe acute respiratory syndrome coronavirus (sars-cov), middle east respiratory syndrome coronavirus (mers-cov), and sars-cov- . so far, neither effective vaccines nor approved antiviral therapeutics are currently available for the treatment of fipv infection. both human and animal covs shares similar functional proteins, particularly the cl protease ( cl(pro)), which plays the pivotal role on viral replication. we investigated the potential drug-liked compounds and their inhibitory interaction on the cl(pro) active sites of covs by the structural-bases virtual screening. fluorescence resonance energy transfer (fret) assay revealed that three out of twenty-eight compounds could hamper fipv cl(pro) activities with ic( ) of . ± . μm to . ± . μm, and ki values of . ± . to . ± . μm, respectively. evaluation of antiviral activity using cell-based assay showed that nsc and nsc could strongly inhibit the cytopathic effect and also reduced replication of fipv in crfk cells in all examined conditions with the low range of ec( ) ( . ± . to . ± . μm and . ± . to . ± . μm, respectively), less than those of ribavirin and lopinavir. analysis of fipv cl(pro)-ligand interaction demonstrated that the selected compounds reacted to the crucial residues (his and cys ) of catalytic dyad. our investigations provide a fundamental knowledge for the further development of antiviral agents and increase the number of anti-cov agent pools for feline coronavirus and other related covs. feline infectious peritonitis (fip), which is caused by feline infectious peritonitis virus (fipv), is a life threatening, immunopathogenic disease affecting multiple organs in cats (pedersen, a) . and % antibiotics-antimycotics (invitrogen tm , carlsbad, usa) at °c with %co for h. the cytopathic effect (cpe) was observed daily under an inverted microscope (olympus ckx , tokyo, japan). after the fifth passages of viral propagation, the virus stock was quantitated as decribed previously (lekcharoensuk, et al., ) presented as means and standard deviation, and qpcr data were analyzed and reported as the percentage of viral reduction for each compound. selectivity index (si) was determined as the ratio of cc to ec for each compound. in this study, the structure-based virtual screening was performed in which the compounds were placed within the binding pocket of the cl pro due to high similarity of amino acid residues among various covs. then, the most favorable binding energies between the compounds and the catalytic dyads within the binding pocket of covs- cl pro were analized. the binding affinity scores of the top-ranked compounds and covs- cl pro structure were ranged from - . to - . annotate the active sites of all covs, which their d structures were highly conserved especially at his and cys numbering based on the positions on the fipv cl pro analysis of other covs- cl pro in respect to the fipv cl pro sequence exhibits highly conserved amino acid residues at leu , pro , val , phe , cys , his , glu , leu and asp ) in the catalytic dyad which strongly interact with the candidate compounds (supplementary figure d) . these results indicates that fipv cl pro has a potential use as a surrogate platform to screen the candidate compounds that could inhibit the covs- cl pro activities. according to the fipv cl pro structurral based study, we determined if the candidate compounds that could bind to the active site and inhibited the protease activity still actively impeded the viral growth in cell culture. the candidate compounds possessing the inhibitory effect on protease activity had ic values of . ± . μm (nsc ), . ± . μm (nsc ), and . ± . μm (nsc ) as shown in table . the ki values of these three compounds were . ± . , . ± . , and . ± . μm, respectively ( figure ) . in addition, the protease inhibition assay of pedv cl pro and sars-cov cl pro was also performed and the inhibition results are corresponding that of fipv cl pro (figure c ). after screening using in silico and in vitro protease assay, the three selected compounds were further examined for their cytotoxicity. the results showed that compound nsc had no effect on the crfk cells even though at the concentration as high as . μm, whereas the cc values of nsc and nsc were . ± . μm and . ± . μm, respectively (table ) . prophylaxis experiment was designed to allow the entry of small compounds into the host cells, and also determined that the compounds remaining in the supernatant still have a sufficient viral inhibition potency. we found that compounds nsc and nsc had inhibitory effect on fipv with ec = . ± . μm and . ± . μm, respectively. although, the protease inhibitory assay showed that nsc could strongly inhibit fipv cl pro activity with very low ki value (figure (figure ) . in this study, % dmso was used instead of the compound in the mock-treated fipv infected crfk cells as a non- inhibitor control, which was not influent on fipv infectivity (data not shown). we also studied the interaction of nsc and nsc with fipv cl pro binding pocket using molecular docking simulation and protein ligand interaction analysis ( figure ) . the results showed that the molecule of nsc folded and fit well within the active site of the protease (figures a) . two nitrogen atoms of a benzonitrile group formed hydrogen bonds with thr and his residues. the compound buried perfectly in the binding pocket and formed hydrophobic interaction with hydrophobic residues (amino acid residue: leu , val , and leu ), and asn , thr , his , and cys , respectively. in addition, cys residue can form non-covalent bonds, such as π-alkyl and π-donor interactions with benzofuran and nitrile functional groups, respectively. for nsc , the compound favorably located into the active site of fipv cl pro (figure b) . particularly, his residue in the catalytic dyad links with oxygen atom by hydrogen bond, and also form π-π stack bond to the -chlorophenol functional group of this compound. most hydrophobic bonds were well defined which involve amino acid residues: leu , thr , cys , leu , asp , gln and pro , respectively. in addition, pro can form amide-π stack with -chlorophenol functional group and form alkyl bond to the chloride atom of this functional group. cys and his , the active residues of fipv cl pro , formed the π-alkyl interaction and hydrogen bond to the compounds, respectively. the absorption, distribution, metabolism, excretion and toxicity (adme/t) properties of the three compounds are shown in supplementary table . all three compounds -nsc , nsc , and nsc - did not violate the druglikeness of lipinski's rule of five when analyzed using swissadme tract. moreover, compounds nsc and nsc might be able to permeate blood- brain barrier as shown in supplementary table clinical features of patients infected with novel coronavirus in wuhan triple combination of interferon beta- b, lopinavir-ritonavir, and ribavirin in the treatment of patients admitted to hospital with covid- : an open-label, randomised, phase trial mechanism of the maturation process potent inhibition of feline coronaviruses with peptidyl compounds targeting coronavirus c-like protease broad-spectrum antivirals against c or c-like proteases of picornaviruses, noroviruses, and coronaviruses characterization of sars main protease and inhibitor assay using a fluorogenic substrate ligplot+: multiple ligand-protein interaction diagrams for drug discovery cloned cdna of a/swine/iowa/ / internal genes as a candidate backbone for reverse genetics vaccine against influenza a viruses chloroquine for covid- infection coronavirus emerging in china -key questions for impact assessment the nucleoside analog gs- strongly inhibits feline infectious peritonitis (fip) virus in tissue culture and experimental cat infection studies open babel: an open chemical toolbox the nucleoside analog gs- strongly inhibits feline infectious peritonitis (fip) virus in tissue culture and experimental cat infection studies remdesivir in adults with severe covid- : a randomised, double-blind, placebo-controlled, multicentre trial inhibitory effects of ribavirin alone or combined with human alpha interferon on feline infectious peritonitis virus replication in vitro update on antiviral therapies. august's consult the interactions are presented as dashed lines for alkyl/π-alkyl bonds (pink), π-donor (dark blue), hydrogen bonds (green) and hydrophobic interaction (red circles and ellipses) in the right panel. the visualizations are generated using ucsf chimera version . . and ligplot software version . . of tgev and pedv and also shared superclustering with the betacoronaviruses (sars-cov, sars-cov- and mers-cov) (a). the analysis of covs- cl pro alignment by t-coffee and visualized by jalview analysis of complexes between covs- cl pro with the two best compounds revealed that both compounds are completely buried within the binding pockets. the nsc and nsc are presented in cyan and dark purple key: cord- -rbn foj authors: hohdatsu, t.; sasamoto, t.; okada, s.; koyama, h. title: antigenic analysis of feline coronaviruses with monoclonal antibodies (mabs): preparation of mabs which discriminate between fipv strain - and fecv strain - date: - - journal: veterinary microbiology doi: . / - ( ) -x sha: doc_id: cord_uid: rbn foj abstract we prepared monoclonal antibodies (mabs) against either fipv strain - or fecv strain - , and tested them for reactivity with various coronaviruses by indirect flourescent antibody assay (ifa). sixteen mabs which reacted with all of the strains of feline coronaviruses, also reacted with canine coronavirus (ccv) and transmissible gastroenteritis virus (tgev). in many of them, the polypeptide specifity was the recognition of transmembrane (e ) protein of the virus. we succeeded in obtaining mabs which did not react with eight strains fipv type i viruses (showing cell-associated growth) but reacted with fipv type ii ( - , ku- ) and/or fecv type ii ( - ) viruses (showing non-cell associated growth). these mabs also reacted with ccv or tgev. these mabs recognized peplomer (e ) glycoprotein, and many antigenic differences were found in this e protein. these results suggest that fipv type ii and fecv type ii viruses are antigenically closer to tgev or ccv than to fipv type i viruses. furthermore, the mab prepared in this study has enabled discrimination between fipv strain - and fecv strain - , which was thought to be impossible by the previous serological method. for serological diagnosis of feline infectious peritonitis virus (fipv) infection, detection of antibody by indirect fluorescent antibody assay (ifa) is popular (pedersen, b; horzinek and osterhaus, ; scott, ) . on the other hand, feline enteric coronavirus (fecv) which antigenically crossreacts with fipv, and causes only mild enteritis without inducing fip, may be present (mckeirnan et al., ; pedersen et al., a; pedersen et al., b; pedersen et al., ) . thus, the serological diagnosis of fip and the mechanisms of its onset become more complex. pedersen et al. ( a) classified the feline coronaviruses in terms of the disease types. they divided fipv into types i and ii according to the presence or absence of the induction of fip, ability of the viruses to proliferate in cell cultures, and the antigenic relationship with porcine and canine coronaviruses. fecv has been divided into types i and ii in the same way. types i and ii of fipv in this classification can be serologically discriminated by the neutralization test. fipv type i and fecv type ii can also be distinguished by the neutralization test. cultivation of fecv type i in cells is not possible at present, and its serological position remains unclear. on the other hand, even the neutralization test cannot discriminate between fipv type ii and fecv type ii. it goes without saying that, since all feline coronaviruses show cross-reaction in ifa, it is impossible to discern the types of virus infection. there are many healthy but fipv antibody-positive cats living outdoors. as long as fipv type ii and fecv type ii cannot be distinguished serologically, the clinical diagnostic significance of antibody detection in such cats is low. in this study, we attempted to distinguish between the - strain classified as fipv type ii and the - strain classified as fecv type ii, by means of monoclonal antibodies (mabs). at the same time, we examined feline coronaviruses for antigenic differences by using the mabs. we also investigated the antigenic relationship between feline coronaviruses and canine and porcine coronaviruses. cell cultures. feline whole fetus cells (fcwf- ), crandell feline kidney cells (crfk) and swine kidney cells (cpk) were grown in eagle's minimum essential medium (mem) containing % leibovitz l- medium (l- ) % fetal calf serum, units ml-~ penicillin and #g ml-~ streptomycin. the maintenance medium was mem containing % l- and antibiotics as above. the cells were maintained in a humidified % co incubator at ° c. viruses. the coronavirus isolates used in this study and their sources are shown in table . among these virus strains, the authors isolated the strain ku- of fipv from the liver cells of a kitten with the effusive form of fip, and the strain ku- of fipv from the peritoneal cells of an adult cat, also with effusive fip. among the fipv strains used in the study, strains ucd- , nw- , ucd- , ucd- , ucd- , black, yayoi and ku- show cell-associated growth, and are therefore regarded as type i virus strains in the classification of pedersen et al. ( a) . moreover, since strain ku- , like strain - , pedersen et al., b mckeirnan et al., pedersen et al., a pedersen, a pedersen et al., a pedersen and black, pedersen and floyd, pedersen and floyd, pedersen and floyd, black, pedersen and black, hayashi et al., mckeirnan et al., pedersen et al., b furuuchi et al., harada el al., binn et al., grows well even in crfk cells in a non-cell associated manner, it is considered to be a type ii virus strain. fipv and fecv, tgev, and ccv were passaged two or three times in fcwf- cells, cpk cells, and crfk cells, respectively, and were used for the study. preparation of virus antigen. the antigen was prepared with the fipv - strain or fecv - strain grown in fcwf- cell cultures. infectious culture fluid concentrated about tenfold by ammonium sulfate precipitation was layered onto a discontinuous sucrose density gradient ( and %) in an rps rotor (hitachi koki co., ltd., japan) and centrifuged at r.p.m, for h. the virus bands formed were collected, diluted in nte buffer, ( . m nac , . m tris-hc , ph . , . m edta) and centrifuged at g for h. the virus-containing pellet was suspended in a / volume of nte buffer. production of antibody-secreting hybrydomas. balb/c mice, about weeks of age, were inoculated intraperitoneally with a mixture of /~g of the viral antigen prepared as above and cells of pertussis adjuvant. four or six weeks later the mice received an intravenous booster dose of /~g of viral antigen, and spleen cells were obtained for fusing d later. the fusion was carried out by essentially the same method described by k/shler and milstein ( ) . polyethyleneglycol- (merck, germany) was used as a fusing agent and the ratio of mouse spleen cells and mouse myeloma cells (p- /x- -ag o , , ) was : . the selective medium contained hypoxanthine ( - m), aminopterin ( × l - m) and thymidine ( . × - m). the fused cells at a concentration of . × spleen cells per ml was dispensed in /a volumes into wells of -well, flat-bottomed microplates (corning glass works, corning, ny ) and incubated at ° c in a humid atmosphere containing % co . after incubation for weeks, the wells were examined and those which contained hybridoma cultures were tested for feline coronavirus specific antibody by an indirect immunofluorescence test (see below). the colonies in antibody positive wells were passaged in -well multiplates (coming glass works, corning, ny) and incubated in medium containing hypoxanthine ( - m) and thymidine ( . × - m). the cells were then cloned by the soft agar method. body-secreting hybridoma cultures were concentrated tenfold by % saturation with ammonium sulfate and used for determination of antibody class and subclass by double diffusion in % agar gel containing . % nan . rabbit antisera against mouse immunoglobulins, igg , igg a, igg b, igg , igm and iga, and x and chains (miles laboratories, u.s.a. ) were placed in center wells and test samples were added to adjacent wells. the plates were incubated overnight at room temperature in a humidified chamber. indirect fluorescent antibody assay. hybridoma culture supernatant fluid was added to acetone-fixed infected monolayers, incubated for min at °c, washed times with phosphate buffered saline solution (pbs) and then stained with rabbit anti-mouse-igg,a,m serum conjugated with fluorescein isothiocyanate (fitc) (miles lab., u.s.a. ). after a further min incubation at °c, slides were washed in pbs. stained monolayers were mounted in buffered glycerol and examined using a fluorescence microscope. neutralization (nt) test. serial twofold dilution of the mabs were mixed with an equal volume of a virus suspension diluted so as to contain approximately tcidso/ . ml. the mixtures were incubated at °c for min. each mixture was then inoculated into cell cultures in flat-bottomed microplates, and incubated in an atmosphere of % co in air at °c for d. two wells were employed for each antibody dilution. the antibody titer was expressed as the reciprocal of the highest dilution of mab that completely inhibited cytopathic effect in the test. western immunoblotting. viral antigen separated in polyacrylamide gel by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (sds-page) were transferred to nitrocellulose sheets of . /zm pore size. the transfer was carried out electrophoretically by the method adapted from towbin et al. ( ) in a transfer-blot cell apparatus at ma and v for h using transfer buffer consisting of g -~ tris (ph . ), % methanol and . g - glycine. the nitrocellulose sheets were then cut into strips and incubated at °c for h in pbs containing % fetal-calf serum. the supernatant fluid of antibody-secreting hybridoma cultures was added in ml volumes to individual strips and incubated at °c for h. the strips were then washed times with pbs containing . % tween- , and incubated at °c for h with horseradish peroxidase-conjugated rabbit antibody against mouse igg,a,m (miles lab., u.s.a. ) diluted : with pbs containing % fetal calf serum. the strips were then washed and treated with substrate solution containing . g diaminobenzidine, # of % h in ml of . m tris-hc , ph . . when distinct bands appeared about min later, the reaction was stopped by pouring offthe substrate solution and rinsing with distilled water. determination of polypeptide specificity by enzyme-linked immunosorbent assay (elisa). the polypeptide specificity of the mabs which could not be determined by western immunoblotting was determined according to the method of . briefly, the virus antigen described above was first disrupted with % nonidet p- (np- ). this material was placed on a - % linear sucrose density gradient containing . % np- , and centrifuged at g for h. after fractionation, each fraction was diluted with nte buffer, and allowed to be absorbed by -well, flat-bottomed microelisa plates. the mabs against n, e and e proteins with polypeptide specificity clarified by western immunoblotting were delivered into the wells of each fraction, and subjected to elisa. elisa was performed according to the method of hohdatsu et al. ( ) . among the mabs which recognize each protein, fractions which reacted strongly with a single type of mab were collected. elisa was performed with these fractions used as antigens, and the polypeptide specificity of the mabs was determined. - was used as the immunogen, mabs (f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - , f - ) were obtained. in addition, with fecv strain - as the immunogen, mabs (el - , e - , e - , e - , e - , e- - ) were obtained. the polypeptide specificity, ig isotypes, and nt activity to fipv strain - of these mabs are shown in table . for most mabs, western immunoblotting could deter- mine their polypeptide specificity. however, this method failed to determine the specificity of mabs, f - , f - , f - and f - . elisa using np- disrupted, sucrose gradient-purified viral polypeptide revealed that these mabs recognise e protein. moreover, western immunoblotting and elisa using viral polypeptide yielded the same results with respect to the other mabs. figure shows examples of the western immunoblotting reaction of mabs which recognize n, e and e proteins. as shown in table , two (f - , el - ) of the mabs had nt activity to fipv strain - . we examined the mabs for reactivity with feline coronaviruses by ifa. as shown in table by means of indirect if test, with fitc-conjugated rabbit anti-mouse immunoglobulin, on each virus-infected cvfk or cpk cell culture grown on coverslips. the monoclonal antibodies were used undiluted cell culture fluids. the minus sign indicates negative reactivity. the polypeptide specificity of each of the mabs was determined by its reactivity to each of the three major structural components of the fipv virion either by immunoblotting of sds-page or by elisa. did react with the only strain of fecv. all mabs in group iv, v and vi were found to recognize e protein. we examined the mabs for reactivity with porcine and canine coronaviruses by ifa. table shows the results. all mabs in group i, which reacted with all feline coronaviruses, also reacted with ccv and tgev. mabs in groups ii and iii, which did not react with ucd- , ucd- , ucd- and black strains, did not react with ccv and tgev either. however, out of four mabs in group iv, which reacted only with the - and ku- strains of fipv and strain - of fecv, three reacted with either ccv or tgev. moreover, among the mabs in group v, which reacted only with the - and ku- strains of fipv, two reacted with the sh strain of tgev, and type reacted with the - strain of ccv. furthermore, mabs in group vi, which reacted with fecv alone, reacted with the - strain of ccv. thirty-one mabs were prepared by using strain - , classified as fipv type ii, and strain - , classified as fecv type ii, as immunogens. table shows their reactivity with strains of feline coronavirus. all mabs in group i reacted with feline coronaviruses. besides feline coronaviruses, these mabs reacted with the - strain of ccv, and the sh and to- strains of tgev. these results confirm the previous reports (pedersen et al., ; horzinek et al., ; pedersen et al., a) that these virus strains are antigenically close to each other. concerning polypeptide specificity, many mabs in this group i recognize e protein. among these viruses, many common epitopes seem to exist, particularly in the e protein. among eight virus strains with the characteristics of fipv type i, reactivities of e - and e - in group ii, and f - in group iii with the mabs were different, and all of these mabs recognized n protein. four mabs in group iv (f - , f - , f - and f - ) reacted with the - and ku- strains of fipv type ii and strain - strain of fecv type ii, but not with fipv type i viruses. of these mabs, however, f - reacted with ccv, and f - and f - reacted with ccv and tgev. similarly, among the mabs in group v, which react with fipv type ii viruses alone, f - reacted with ccv, and f - and f - reacted with the sh strain of tgev. furthermore, all mabs in group vi, which react with the - strain of fecv alone reacted with ccv. as pedersen et al. ( a) have reported from their study with polyclonal antibody, these results suggest that fipv type ii viruses and fecv type ii viruses are antigenically closer to tgev or ccv than to fipv type i viruses. at present, the authors are preparing mabs with neutralizing activity using fipv strain - as immunogen, and are determining the serological re-lationships among these viruses by the presence or absence of the neutralization epitope. moreover, since all mabs in groups iv, v and vi recognize e protein, it was assumed that there are many antigenic differences in e protein among these viruses. by using mabs, also found antigenic differences among feline coronaviruses, especially in the e protein. conventional serological methods have failed to discriminate between strain - of fipv type ii and strain - of fecv type ii. however, mabs in group v reacted with fipv type ii viruses alone, while mabs in group vi reacted with the - strain of fecv type ii alone. these mabs have enabled the discrimination of these viruses, by clearly indicating antigenic differences among them. the proportions of types i and ii of fipv and types i and ii of fecv actually present in the natural environment are not clear. as stated in the introduction, the neutralizing test can appraise infection with type i and ii of fipv at the serological level. however, in the case of infection with viruses other than fipv type i, distinction of infection particularly by fipv type ii an fecv type ii at the serological level is difficult. in the future, it will be of use to be able to distinguish infection of these viruses by competitive enzyme immunoassay (fiscus et al., ; using type-specific mabs. the mabs in groups v and vi which the authors have prepared in this study are expected to be useful as such type-specific mabs. recovery and characterization of a coronavirus from military dogs with diarrhoea recovery and in-vitro cultivation ofa coronavirus from laboratory-induced cases of feline infectious peritonitis (fi p ) antigenic comparison feline coronavirus isolates: evidence for markedly different peplomer glycoproteins competitive enzyme immunoassays for the rapid detection of antibodies to feline infectious peritonitis virus polypeptides epitope-specific antibody responses to virulent and avirulent feline infectious peritonitis virus isolates comparison between virulent and attenuated strains of transmissible gastroenteritis virus studies on transmissible gastroenteritis in pigs. iii. isolation of cytopathogenic virus and its use for serological investigation serodiagnosis for feline infectious peritonitis by immunofluorescence using infected suckling mouse brain sections antigenic variation of porcine transmissible gastroenteritis virus detected by monoclonal antibodies feline infectious peritonitis: a worldwide serosurvey antigenic relationships among homologous structural polypeptides of porcine, feline and canine coronaviruses continuous cultures of fused cells secreting antibody of predefined specificity isolation of feline coronaviruses from two cats with diverse disease manifestations morphologic and physical characteristics of feline infectious peritonitis virus and its growth in autochthonous peritoneal cell cultures serologic studies of naturally occurring feline infectious peritonitis attempted immunization of cats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus experimental studies with three new strains of feline infectious peritonitis virus: fipv-ucd , fipv-ucd and fipv-ucd antigenic relationship of feline infectious peritonitis virus to coronaviruses of other species infection studies in kittens utilizing feline infectious peritonitis virus propagated in cell culture lb. an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis pathogenic differences between various feline coronavirus isolates pathogenicity studies of feline coronavirus isolates - and - fip antibody test-interpretation and recommendations electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications this work has been funded by the kitasato research foundation under grant no. . key: cord- - rwevq authors: kiss, i.; poland, a.m.; pedersen, n.c. title: disease outcome and cytokine responses in cats immunized with an avirulent feline infectious peritonitis virus (fipv)-ucd and challenge-exposed with virulent fipv-ucd date: - - journal: j feline med surg doi: . /j.jfms. . . sha: doc_id: cord_uid: rwevq eight cats were immunized with an avirulent strain of feline infectious peritonitis virus (fipv)-ucd , then challenge-exposed to a highly virulent cat passaged strain (fipv-ucd ). th and th cytokine profiles in the peripheral blood mononuclear cells (pbmcs) were measured throughout in the experiment. no clinical signs of fip were evident in the experimental cats after immunization. after challenge, the immunized cats demonstrated one of four clinical outcomes: ( ) classical effusive fip; ( ) accelerated fip; ( ) non-effusive fip, or ( ) resistance to challenge. only minor cytokine changes were observed following immunization, however, several cytokine changes occurred following challenge-exposure. the most noteworthy changes were in tumor necrosis factor-alpha (tnf-α) and interferon gamma (ifn-γ) levels. our preliminary findings suggest that immunity against fip is associated with tnf-α and ifn-γ response imbalance, with high tnf-α/low ifn-γ mrna responses favouring disease and low tnf-α/high ifn-γ mrna responses being indicative of immunity. feline infectious peritonitis (fip) is a highly fatal disease in felidae caused by a coronavirus and usually affects cats between months and years of age (reviewed by pedersen, ) . the fipv is a common mutant of the far more ubiquitous and largely non-pathogenic feline enteric coronavirus (fecv) (pedersen, a; vennema et al., ) . the enteric virus is highly tropic to the mature epithelium of the small intestine, whereas the mutant fipv gains a tropism for macrophages. this macrophage tropism allows the virus to disseminate throughout the body and is responsible for pathogenicity (stoddart and scott, ). the disease presents in two major forms: ( ) an effusive form associated with peritonitis and/or pleuritis and vasculitis, and ( ) a non-effusive form characterized by more classical granulomatous disease of major abdominal organs, uveal tract, and meninges (reviewed by pedersen, ) . both forms of the disease are uniformly lethal, with affected cats dying over several days to many months. immunity to fipv is presumed to be cellular (pedersen, b) , as is typical of highly cell-associated pathogens (tizard, ) . antibody responses, by themselves, are actually harmful by facilitating virus uptake by macrophages and participating in arthus like reactions (pedersen and boyle, ) . therefore, whether a cat develops wet or dry fip is thought to depend on the strength of the cat's cell-mediated immune response. cats producing a negligible cell-mediated response and a strong antibody response rapidly develop acute wet fip. cats producing a partial cell-mediated response develop the chronic form of the disease. there is strong circumstantial evidence that susceptibility to fip has a significant genetic component (foley et al., ) . the goal of developing effective fipv vaccines has been elusive. most vaccines either fail to protect or enhance the infection (pedersen, ) . partial success has been obtained by using temperature sensitive mutants of a type ii strain of fipv (gerber et al., ; hoskins et al., ; reeves et al., ) . we were fortunate to create another avirulent fipv, but to a preferred type i rather than type ii strain (fipv-ucd ). type ii strains are recombinants with canine coronavirus, while type i strains are uniquely cat. type i strains cause - % or more of disease (hohdatsu et al., ) . we decided to test our avirulent strain of fipv-ucd- as a vaccine. after primary vaccination cats were then challenge-exposed to a highly virulent type i strain of fipv (fipv-ucd ). in order to see whether there was a relationship between vaccine immunity and challenge-exposure outcome, we also analysed th and th cytokine profiles during immunization and following challenge-exposure. ten -month-old male cats were obtained from the specific pathogen free breeding colony of the feline nutrition laboratory, school of veterinary medicine, uc davis, usa. cats were housed in the facilities of the center for companion animal health, school of veterinary medicine, uc davis, usa under the supervision of the center for laboratory animal sciences. eight cats were inoculated intraperitoneally, first with a non-pathogenic strain of fipv-ucd , then days later with pathogenic fipv-ucd . attenuated fipv-ucd was passaged on fcwf- cells and animals inoculated with ml of infectious tissue culture fluid. fipv-ucd was serially passaged in laboratory cats and infectious material was in the form of ml of pooled ascitic fluid. this fluid had been harvested from cats dying of experimentally induced effusive fip. two control animals were mock vaccinated and challenge-exposed with pbs. the clinical status of the cats was monitored throughout the experiment. three millilitres of heparinized blood were collected at the following time points: day − , day (time of experimental infection with ucd- ), day , day , day , day , day , day , day , day (time of experimental infection with ucd- ), day , day , day , day , and day . all animals were euthanased on day . a complete necropsy was performed on each animal, including histologic examination of a range of potential target tissues. necropsies were done to confirm the form of disease and to rule out the presence of subclinical infections in animals that appeared outwardly normal (hoskins et al., ) . blood samples were immediately centrifuged in order to separate the buffy coat and plasma for cytokine analysis and serology, respectively. all fractions were stored at − °c until further processing. three time points (day , day , and day ) were selected for the serological investigations of the plasma samples by ifa technique using serum dilutions of : and : (pedersen, ) . ifa substrate slides were made from fcwf- cells infected with fipv-ucd . cytokine mrna measurements from unstimulated peripheral blood mononuclear cells (pbmc) were performed for the following cytokines: il , il , il , il p , il , ifn-, and tnf-as described previously (kipar et al., ; leutenegger et al., ) . relative cytokine mrna levels were determined at the time points indicated above and calibrated against cytokine mrna levels measured days prior to immunization and from the two control animals. experimentally infected cats were euthanased and necropsied when it became obvious that their disease was terminal or at the completion of the study (day ). the form of fip was determined grossly and histologically. no clinical signs of illness were observed in the eight experimental cats after immunization with fipv strain ucd , except for slight rise in rectal temperatures lasting to days (data not shown). all but one (cat ) vaccinated cats seroconverted, but to low titer (table ) . three of eight vaccinated cats (nos , , ) developed effusive fip within weeks of challengeexposure to fipv-ucd , typical of classical nonenhanced disease (pedersen and boyle, ) ( table ) . one of the eight cats (no. ) developed fip within days, characteristic of enhanced disease (pedersen and boyle, ) . two cats (nos , ) developed non-effusive fip. two of eight cats (nos , ) showed no signs of illness, as did the two control animals. secondary antibody responses appeared to reflect disease outcome (table ). the three cats (nos , , ) dying of classical effusive fip had a rise in antibody titer post-challenge-exposure. cats nos and , which developed non-effusive fip, had low primary antibody responses at day postimmunization and with the same or decreased antibody titers days post-challenge-exposure (day ). the antibody titers of the two cats (nos and ) that resisted challenge-exposure declined to negligible levels even after challengeexposure with fipv-ucd . no major changes in cytokine mrna levels were detected following the initial non-pathogenic fipv-ucd immunization (figs. - ) when compared to individual pre-infection values and to parallel cytokine responses in the two control cats (data not shown). a moderate elevation of tnf-mrna occurred between the second and third week after vaccination in cat . a small post-immunization increase of the ifn-mrna level was seen in cat , which was one of the ultimate survivors. various cytokine mrna changes were observed following challenge-exposure with fipv-ucd (figs. - ) . il- and il- mrna levels did not change from pre-infection or control cat levels in any of the eight infected animals. slight to low increases in il- mrna were seen following fipv-ucd infection in all cats, while il- mrna levels increases were negligible to low following challengeexposure and bore no relationship to disease outcome (data not shown). changes, or lack thereof, were deemed significant for three cytokines mrnas, ifn-, tnf-and il- p . the level of ifn-mrna was strongly elevated in one of the surviving two cats; in the other one it remained unaltered. cats that developed fip had negligible or below normal ifnresponses, save cat that showed slightly elevated levels of this cytokine on the day of challenge-exposure. all of the cats that developed fip, regardless of form, had elevated postchallenge-exposure levels of tnf-mrna. il- mrna responses were increased following infection with fipv-ucd , but did not appear to relate to disease outcome or ifn-/tnf-mrna responses. fipv-ucd immunization induced only partial protection at best, as gauged against historical data. animal-passaged fipv-ucd usually kills from - % of inoculated cats, almost always from effusive fip (nc pedersen, uc davis, unpublished information). in this study, two of eight vaccinated cats (nos and ) appeared immune to challenge-exposure with virulent fipv-ucd and two (nos and ) developed non-effusive fip (indicative of partial immunity; pedersen, ) . three immunized cats (nos , , and ) died of the classical form of effusive fip, indicating a predominance of non-protective humoral immunity. one cat (no. ) developed a highly accelerated form of effusive fip, indicating that immunization had elicited enhancing type antibodies (pedersen and boyle, ) . therefore, immunization induced a spectrum of immune effects, ranging from protection (two cats), partial immunity (two cats), typical humoral immunity (three cats), to antibody enhancement (one cat). this reflects past experiences with attenuated live fipv vaccines (mcardle et al., ; pedersen and black, ; scott et al., ) . although this pilot study of a potential fip vaccine was deemed largely a failure as far as protection was concerned, there were interesting findings in regards to th and th type cytokine responses and post-challenge exposure disease course. we were fortunate in this study to have cats representing each of the four possible disease outcomes: ( ) classical effusive fip occurring about weeks following infection; ( ) enhanced fip occurring almost immediately after challenge, ( ) non-effusive fip, and ( ) resistance. based on the cytokine profile analysis of the different groups, we suggest that disease, regardless of form, is associated with a strong tnf-mrna response in pbmc and a failure to induce ifn-mrna. in contrast, immune cats failed to upregulate tnf-mrna and one manifested strong ifn-mrna responses. the former profile tends to favor th (humoral) immunity, while the latter favors th (cell-mediated) immun-ity. fipv is an intracellular pathogen of macrophages, and as such, cell mediated immunity would be most important. it was interesting to note the relationship between responses to avirulent or virulent virus and the magnitude and even duration of cytokine mrna responses in pbmcs. cats infected with the avirulent fipv only showed transient fevers (data not shown) and low to negligible changes in cytokine mrnas in pbmcs. the cat that had the most pronounced primary cytokine responses was also the animal that developed the most severe febrile reaction to the vaccine. this indicated that changes in cytokine mrnas within pbmcs were only noticeable when reactions within internal lymphoid organs reached a certain threshold, thus allowing the responses to spill over into the blood. this was also observed after challenge-exposure. cats that became very sick with fip tended to have marked upregulation of cytokine mrnas in their pbmcs. a dichotomy in responses was seen between the two cats that were immune to challenge exposure with virulent fipv-ucd . cat no. developed weak cytokine reactions during immunization and strong cytokine responses following challenge-exposure, while cat showed very little changes during either immunization or challenge-exposure. this suggested that cat no. , while being immune, was none the less infected by the challenge virus and did mount a vigorous secondary immune response (at the cytokine, but not antibody level). in contrast, cat appeared to develop exceptionally strong protective immunity from the onset, precluding the need for a systemic response. therefore, the magnitude and duration of cytokine mrna responses in pbmcs does not always correlate with strength of immunity. the importance of ifn-responses in fipv immunity is strongly supported by what has been described recently for both experimental (kyuwa et al., a,b) and natural (france et al., ) mouse hepatitis virus (mhv) infections. mhv, like the feline coronaviruses (horzinek et al., ) , exists in two biotypes, a naturally occurring and largely enterotropic biotype and a more laboratoryassociated polytropic biotype (homberger et al., ) . the enterotropic biotype of mhv is analogous to fecv, while polytropic biotypes have many parallels with fipv. the similarities between feline and murine coronaviruses and their biotype-associated diseases were quickly noted following the creation of ifn-deficient mice. ifnknockout mice developed severe peritonitis, identical to fip, upon experimental challenge with a polytropic mhv (kyuwa et al., a (kyuwa et al., , and this disease could be partially inhibited with exogenously administered ifn- (kyuwa et al., ) . this supports our findings on the importance of ifn-mrna responses in cats exposed to fipv. a granulomatous peritonitis and pleuritis has also been described in a colony of ifn-knockout mice infected naturally with enterotropic mhv (france et al., ) . this latter observation parallels what is seen in a group of retrovirus immunocompromised cats exposed to fecv (poland et al., ) . other similarities exist between murine and feline coronavirus infections. age and genetic factors have been shown to play a role in naturally occurring mhv infection, with week olds being more susceptible than and weeks, and balb and icr mice more susceptible than sjl mice (barthold, ) . age and genetic susceptibility have been shown to be important risk factors for fip in purebred cats (foley et al., ; foley and pedersen, ) . the central question coming out of this preliminary experiment and previous mhvrelated studies concerns the role of ifn-in fipv immunity. in the presented preliminary experiment, vaccination of cats with an attenuated live strain of fipv-ucd appeared to induce a degree of protection, in that two of eight cats were immune and two more developed non-effusive fip post challenge. a more significant finding was the possible relationship between certain cytokine mrna responses and disease outcome. cats developing fip after challenge-exposure failed to demonstrate ifn-mrna responses in pbmcs, but did make high levels of tnf-mrna. conversely, immune cats did not make detectable levels of tnf-mrna, and one made markedly high level of ifn-. although only a pilot study, the findings are supported by parallel observations in mhv disease in ifn-knockout mice, and suggest the need for more in depth studies of the role of ifn-in fipv disease and immunity. host age and genotype effects on enterotropic mouse hepatitis virus infection inheritance of susceptibility to feline infectious peritonitis in purebred catteries risk factors for feline infectious peritonitis among cats in multiple-cat environments with endemic feline enteric coronavirus granulomatous peritonitis and pleuritis in interferon-gamma gene knockout mice naturally infected with mouse hepatitis virus protection against feline infectious peritonitis by intranasal inoculation of a temperaturesensitive fipv vaccine the prevalence of types i and ii feline coronavirus infections in cats prevalence of enterotropic and polytropic mouse hepatitis virus in enzootically infected mouse colonies perspectives on feline coronavirus evolution independent evaluation of a modified live feline infectious peritonitis virus vaccine under experimental conditions (louisiana experience) cytokine mrna levels isolated feline monocytes acute hepatic failure in ifn-gammadeficient balb/c mice after murine coronavirus infection mhv-induced fatal peritonitis in mice lacking ifn-gamma murine coronavirus-induced subacute fatal peritonitis in c bl/ mice deficient in gamma interferon immunization of cats against feline immunodeficiency virus (fiv) infection by using minimalistic immunogenic defined gene expression vector vaccines expressing fiv gp alone or with feline interleukin (il- ), il- , or a cpg motif independent evaluation of a modified live fipv vaccine under experimental conditions (university of liverpool experience) an overview of feline enteric coronavirus and infectious peritonitis virus infection animal virus infections that defy vaccination. equine infectious anemia, caprine arthritis encephalitis, maedi-visna, and feline infectious peritonitis virologic and immunologic aspects of feline infectious peritonitis an overview of feline enteric coronavirus and infectious peritonitis virus infections serologic studies of naturally occurring feline infectious peritonitis attempted immunization of cats against feline infectious peritonitis using either avirulent live virus or sublethal amounts of virulent virus immunologic phenomenon in the effusive form of feline infectious peritonitis two related strains of feline infectious peritonitis isolated from immunocompromised cats infected with feline enteric coronavirus long-term follow-up study of cats vaccinated with a temperaturesensitive feline infectious peritonitis vaccine independent evaluation of a modified live fipv vaccine under experimental conditions (cornell experience) intrinsic resistance of feline peritoneal macrophages to coronaviruses correlates with virulence resistance to viruses feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses funding for i. kiss was provided by a fellowship from the fulbright foundation and laboratory costs by the center for companion animal health center (ccah), school of veterinary medicine, university of california, davis, ca, usa, . additional thanks go to jill mikovich and the animal care staff at the ccah for their care of the animals, and to dr Árpád bacsadi, veterinary institute of debrecen, p.o. box , h- , debrecen, hungary for histopathological studies. we wish to also thank dr christian leutenegger and the taqman ® service, uc davis for invaluable assistance with cytokine assays. key: cord- -chgjpg v authors: takano, tomomi; azuma, natsuko; hashida, yoshikiyo; satoh, ryoichi; hohdatsu, tsutomu title: b-cell activation in cats with feline infectious peritonitis (fip) by fip-virus-induced b-cell differentiation/survival factors date: - - journal: arch virol doi: . /s - - - sha: doc_id: cord_uid: chgjpg v it has been suggested that antibody overproduction plays a role in the pathogenesis of feline infectious peritonitis (fip). however, only a few studies on the b-cell activation mechanism after fip virus (fipv) infection have been reported. the present study shows that: ( ) the ratio of peripheral blood sig(+) cd (−) b-cells was higher in cats with fip than in spf cats, ( ) the albumin-to-globulin ratio has negative correlation with the ratio of peripheral blood sig(+) cd (−) b-cell, ( ) cells strongly expressing mrna of the plasma cell master gene, b-lymphocyte-induced maturation protein (blimp- ), were increased in peripheral blood in cats with fip, ( ) mrna expression of b-cell differentiation/survival factors, il- , cd ligand, and b-cell-activating factor belonging to the tumor necrosis factor family (baff), was enhanced in macrophages in cats with fip, and ( ) mrnas of these b-cell differentiation/survival factors were overexpressed in antibody-dependent enhancement (ade)-induced macrophages. these data suggest that virus-infected macrophages overproduce b-cell differentiation/survival factors, and these factors act on b-cells and promote b-cell differentiation into plasma cells in fipv-infected cats. feline coronavirus (fcov) belongs to group of the family coronaviridae. fcov is classified into two biotypes based on differences in pathogenicity: feline enteric coronavirus (fecv) and feline infectious peritonitis virus (fipv). fecv infection is asymptomatic in cats. in contrast, fipv infection causes a fatal disease, feline infectious peritonitis (fip). the difference in pathogenicity between fecv and fipv in cats is considered to be associated with macrophage tropism of the viruses [ , ] . it has been proposed that fipv arises from fecv by mutation [ , , ] , but the exact mutation and inducing factors have not yet been clarified. when anti-fcov antibody-positive cats are inoculated with fipv, the onset time of fip is earlier than that in antibody-negative cats, and symptoms are severer [ ] . this phenomenon is known as antibody-dependent enhancement (ade) of fipv infection. a similar phenomenon has been observed with other virus infections, such as dengue and human immunodeficiency virus infections [ , , ] . ade of fipv infection has been reported to be induced by antibodies against fipv spike (s) protein [ , , ] . in ade-induced macrophages (ade macrophages), tnf-alpha production increases with viral replication, and this tnf-alpha acts on macrophages and promotes virus receptor (feline aminopeptidase n; fapn) expression [ ] . there are several events suggested to involve anti-fipv antibodies in fip development, other than ade. for example, antibodies produced due to fipv infection bind to the virus and form immune-complexes [ , ] . these complexes are deposited in micro blood vessels. complement binding to the deposit injures the vascular tissue and causes vasculitis (immune-complex-mediated vasculitis). hyperproteinemia also develops with an increase of gamma-globulin in fip cats [ ] . moreover, increased levels of interleukin (il)- , a cytokine involved in the survival of b-cells and their differentiation into plasma cells, in ascites t. takano Á n. azuma Á y. hashida Á r. satoh Á t. hohdatsu (&) laboratory of veterinary infectious disease, school of veterinary medicine, kitasato university, towada, aomori - , japan e-mail: hohdatsu@vmas.kitasato-u.ac.jp and culture supernatant of peritoneal exudative cells (pec) from fip cats have been reported [ ] . this suggests a close involvement of antibodies in fip pathogenesis. however, the mechanism leading to the alteration of b-cells into plasma cells has not been investigated. overproduction of the virus and tnf-alpha also occurs in ade macrophages in fipv infection [ ] , but it is not clear whether the production of b-cell differentiation/survival factors, such as il- , is involved in the induction of ade. in this study, we collected peripheral blood mononuclear cells (pbmcs) from fip cats and analyzed the b-cell surface antigens as well as measured the mrna expression level of the plasma cell master gene, b-lymphocyteinduced maturation protein (blimp- ). we also collected macrophages from fip cats and measured the expression levels of the viral rna and mrna of b-cell differentiation/survival factors: il- , cd ligand (cd l), and bcell-activating factor belonging to the tumor necrosis factor family (baff). furthermore, we investigated the relationship between fipv infection-induced ade activity of macrophages and il- , cd l, and baff mrna expression levels. type-ii fipv strain - ( tcid /ml) was administered orally to -to -month-old, specific-pathogen-free (spf) cats. thirteen cats that developed fip symptoms (fip cats), such as fever, weight loss, peritoneal or pleural effusion, dyspnea, ocular lesions, and neural symptoms, and thirteen -to -month-old spf cats as controls were used in this study. fip diagnosis was confirmed upon postmortem examination, revealing peritoneal and pleural effusions and pyogranuloma in major organs. all experiments were performed in accordance with the guidelines for animal experiments of kitasato university. felis catus whole fetus- (fcwf- ) cells was grown in eagles' minimum essential medium containing % l- medium, % fetal calf serum (fcs), u/ml penicillin and lg/ml streptomycin. feline alveolar macrophages and pbmcs were maintained in rpmi growth medium supplemented with % fcs, u/ml penicillin, lg/ml streptomycin, lm -mercaptoethanol, and lg/ml of polybrene. type-ii fipv strain - was grown in fcwf- cells at °c. fipv strain - was supplied by dr. m. c. horzinek of state university utrecht, the netherlands. phycoerythrin (pe)-conjugated anti-cd monoclonal antibody (mab) (anti-canine cd homologue of feline cd and human cd : mab cd . d ) and fluorescein isothiocyanate (fitc)-conjugated igg f(ab ) fragments of rabbit anti-feline igg(anti-feline sig ab) were used to stain feline b-cells. pe-conjugated mab cd . d was obtained from serotec ltd (uk). fitc-conjugate anti-feline sig ab was obtained from rockland inc. (usa). mab - - (igg a) used in the present study recognizes s protein of type-ii fipv, as demonstrated by immunoblotting [ ] . it has been reported that mab - - exhibits a neutralizing activity in fcwf- and crfk cells, but exhibits an enhancing activity in feline macrophages, depending on the reaction conditions [ ] . heparinized blood ( ml) was diluted twofold with phosphate-buffered saline (pbs) and subjected to ficoll-hypaque density gradient centrifugation at , rpm for min. the pbmc layer was collected, washed twice with pbs, and resuspended at cells/ml. a total of cells were incubated with pe-conjugated mab cd . d or fitc-conjugated anti-feline sig ab at °c for min. after the cells were washed three times with pbs containing . % nan , the number of stained cells was determined by counting , cells on a facs (becton dickinson, usa). albumin-to-globulin ratio for plasma samples, blood was collected from cats using a heparinized syringe and centrifuged at , rpm for min, and the supernatant was collected. the albumin and globulin levels were determined in plasma samples of spf cats and in fip cats, using an automatic analyzer. the albumin-to-globulin ratio was calculated by dividing the albumin levels by the globulin levels. feline alveolar macrophages were obtained from spf and fip cats by broncho-alveolar lavage with hank's balanced salt solution (hbss), as previously described by hohdatsu et al. [ ] . t. takano et al. rna isolation and cdna preparation rna isolation and cdna preparation were performed by the method of takano et al. [ , ] . determination of levels of feline gapdh mrna, il- mrna, cd l mrna, baff mrna, blimp- mrna and fcov n gene expression cdna was amplified by pcr using specific primers for feline gapdh mrna, il- mrna, cd l mrna, baff mrna, blimp- mrna, and the fcov n genes. the primer sequences are shown in table . pcr was performed by the method of takano et al. [ , ] . band density was quantified under appropriate uv exposure by video densitometry using scion image software (scion corporation, usa). il- mrna, cd l mrna, baff mrna, blimp- mrna, and the fcov n genes were quantitatively analyzed in terms of the relative density value to the mrna for the housekeeping gene gapdh. sequencing and analysis of blimp- and baff cdna pcr products ( ll) were electrophoresed with dna markers on a . % agarose gel. singlet bands were excised and transferred to microtubes, and dna was purified using a qiaquick gel extraction kit (qiagen gmbh, germany). the purified dna was sent to shimadzu corporation (japan) for sequencing, and the partial base sequences of blimp- cdna and baff cdna were determined. the sequences determined were then analyzed with the genetyx computer program (software development, japan). equal volumes a viral suspension (fipv strain - , tcid / . ml) and a mab - - solution were mixed and reacted at °c for h, and . ml of this reaction solution was used to inoculate feline alveolar macrophages ( cells) cultured in each well of well multi-plates. as controls, medium alone, virus suspension alone, or mab - - solution alone was added to feline alveolar macrophages. after virus adsorption at °c for h, the cells were washed with hbss and ml of growth medium. the cells and culture supernatant were collected every h thereafter. the cells were used for measurement of the fcov n genes, il- mrna, cd l mrna, and baff mrna, and the culture supernatant was used for measurement of the virus titer. confluent fcwf- cell monolayers in -well multi-plates were inoculated with ll of the sample dilutions. after virus adsorption at °c, the cells were washed with hbss, and ml of growth medium containing . % carboxymethyl cellulose was added to each well. the cultures were incubated at °c for days, fixed in % buffered formalin, and stained with % crystal violet. data were analyzed by student's t test. the data in fig. a and b were also analyzed by the mann-whitney test. p values . were considered to indicate a significant difference between compared groups. fig. b . the ratio of sig ? cd ? b-cells in pbmcs was not significantly different between spf and fip cats. in contrast, the ratio of sig ? cd -b-cells was significantly higher in fip than in spf cats. figure c shows (table ) . using these primers, rt-pcr was performed on pbmcs from fip cats, and a -bp band was specifically amplified. this amplified dna was sequenced, and the base sequence was partially identified (partial base sequence) (data not shown). the amino acid sequence was also deduced from the partial base sequence. homologies among the partial base sequences of feline, canine, bovine, mouse, and human blimp- mrna and the deduced amino acid sequences are shown in table . the blimp- mrna expression level in pbmcs was measured in spf and fip cats. rt-pcr was performed using feline blimp- -specific primers, and the blimp- mrna expression level in pbmcs was compared between fip and spf cats. the blimp- mrna expression level was significantly elevated in pbmc from fip cats, compared to that in spf cats (fig. ) . partial base sequence analysis of baff cdna, deduction of amino acid sequence, and comparison with other animal species il- , cd l, and baff are known as b-cell differentiation/survival factors. we investigated whether these factors in macrophages were increased in fip cats by measuring mrna expression. since the nucleotide sequence of feline baff mrna has not yet been determined, we partially sequenced the cdna of baff mrna. the sequences of mouse (genbank accession number: nm_ ), human (nm_ ), and bovine (xm_ ) baff mrna have been determined. primers corresponding to a highly conserved region were prepared for the detection of feline baff mrna (table ) . using these primers, rt-pcr of pbmcs from fip cats was performed, and a -bp band was specifically amplified. this amplified dna was partially sequenced (data not shown), and the amino acid sequence was deduced from this. homologies among the partial nucleotide sequences of feline, canine, bovine, mouse, and human baff mrna and their deduced amino acid sequences are shown in table . measurement of fcov n gene expression and il- , cd l, and baff mrna expression in alveolar macrophages of spf and fip cats the production of b-cell differentiation/survival factors in fip cats was investigated. macrophages, one of the target cells of fipv, were collected from fip cats. the il- , cd l, and baff mrna expression levels in these cells were measured by rt-pcr and compared to those in spf cats. fig. blimp- mrna expression levels in pbmcs of fip and spf cats. pbmcs ( cells) were collected from fip and spf cats, and the blimp- mrna was detected by rt-pcr. blimp- mrna was quantitatively analyzed in terms of their relative density compared to that of the mrna for the housekeeping gene gapdh virus replication in macrophages was investigated in fip cats by measuring fipv negative-strand rna expression. in all fip cats investigated, fipv negative-strand rna was expressed in alveolar macrophages (fig. a) . when the mrna expression levels of b-cell differentiation/survival factors were measured, expression of il- , cd l, and baff mrna was significantly enhanced in fip cats compared to spf cats (fig. b) . relationship between fipv replication and il- , cd l, and baff mrna expression levels in alveolar macrophages to investigate the relationship between fipv replication and b-cell differentiation/survival factor production in macrophages, alveolar macrophages from spf cats were inoculated with fipv alone or a mixture of fipv and anti-fipv s mab (mab - - ). the culture supernatant and cells were collected every h for days, and fipv replication and b-cell differentiation/survival factor production were measured. in the measurement of fipv replication, the virus titer in the macrophage culture supernatant was measured by the plaque method, and intracellular virus production was measured using fipv negative-strand rna expression as an index. to assess bcell differentiation/survival factor production, the il- , cd l, and baff mrna expression levels in the cells were measured. fipv negative-strand rna was strongly expressed in macrophages inoculated with a mixture of fipv and anti-fipv s mab compared to that in macrophages inoculated with the virus alone, and the virus titer in the culture supernatant was also significantly higher ( fig. a and b) . the mrna expression levels of all b-cell differentiation/survival factors, il- , cd l, and baff, were also significantly increased in macrophages inoculated with the mixture (fig. c) , suggesting that virus production increased in ade macrophages, in which b-cell differentiation/survival factor production also increased. in fip cats, the gamma-globulin level increases, and immune-complex-mediated vasculitis develops, suggesting that overproduced antibodies are closely involved in the pathogenesis of fip. however, only a few studies on b-cell characteristics and their activation mechanism after fipv infection in fip cats have been reported. here, we show that the ratio of sig-positive, cd negative cells increases in pbmcs of fip cats, and correlates with the albumin-to-globulin ratio in plasma samples. we also show that the blimp- mrna expression level is significantly elevated in pbmcs from fip cats. tedder et al. [ ] reported that cd molecules disappeared from the cell surface, when b-cells differentiated into antibodyproducing cells. shapiro-shelef and calame [ ] reported that blimp- is the master gene that causes the final differentiation of b-cells into plasma cells. thus, the number of plasma cells may increase in the peripheral blood of fip cats. plasma cells are mainly present in the bone marrow, spleen, and lymph nodes, but not in peripheral blood. an increase in plasma cells in peripheral blood may be evidence of enhanced b-cell activation. b-cells are stimulated by antigen-presenting cells (dendritic cells and macrophages) in lymphatic tissues, and start to differentiate into plasma cells. for b-cells to differentiate into plasma cells, various factors (cytokines, antigens, etc.) are necessary. we focused on il- , cd l, and baff as b-cell differentiation/survival factors. il- is involved in the differentiation of b-cells into plasma cells, and signal transmission via the il- receptor inhibits b-cell apoptosis [ , , ] . cd l inhibits the induction of bcell apoptosis by binding to cd expressed on the b-cell surface, activating b-cells [ , , , ] . baff induces an apoptosis-inhibitory gene, bcl- , by binding to the baff receptor expressed on b-cells, inhibiting b-cell apoptosis [ , ] . we clarified that il- , cd l, and baff mrna expression was increased in macrophages in fip cats. the il- , cd l, and baff mrna expression levels were also increased with virus replication in macrophages inoculated with fipv, suggesting that fipv replication a b fig. fcov n gene, il- , cd l and baff mrna expression levels in alveolar macrophages of fip and spf cats. a alveolar macrophages ( cells) were collected from fip and spf cats, and the fipv negative-strand rna was detected by rt-pcr. b alveolar macrophages ( cells) were collected from fip and spf cats, and il- , cd l and baff mrna was detected by rt-pcr. il- , cd l and baff mrna were quantitatively analyzed in terms of their relative density compared to that of the mrna for the housekeeping gene gapdh induced baff, il- , and cd l production in macrophages of fip cats, and these factors promoted b-cell differentiation into plasma cells. virus production and il- , cd l, and baff mrna expression were markedly enhanced in ade macrophages in vitro compared to macrophages inoculated with the virus alone. we reported previously that when the fipv antigen was detected by the fluorescent antibody method, - % of cells were positive when spf cat-derived alveolar macrophages were inoculated with fipv ? anti-fipv s mab, whereas - % of cells were positive when alveolar macrophages were inoculated with fipv [ , ] . it seems that the increased number of virus-infected macrophages leads to the over-expression of b-cell differentiation/survival factor mrna in macrophages. however, there is no evidence that this hypothesis is correct. a continued examination of the mechanism of ade activity in fipv infection would strengthen this hypothesis. we reported previously that ade activity in fipv infection of feline macrophages caused overproduction of tnf-alpha, which may lead to serious fip symptoms [ ] . the increased il- , cd l, and baff mrna expression levels in ade macrophages may also be closely involved in aggravation of pathogenesis, as well as tnf-alpha. that is, our data suggest that fipv re-infection induces ade and advances fip development in cats. however, addie et al. [ ] reported that fcov re-infection of anti-fcov antibody-positive domestic cats might not result in the development of ade. although the details are unclear, differences in the immunological condition of fcovinfected cats may be the reason why the phenomenon noted in ade does not occur in domestic cats. it is necessary to analyze mechanism of ade in detail. of the b-cell differentiation/survival factors measured, significant elevation of the ascitic and serum il- levels in fip cats has been reported [ ] . regarding cd l, tissue deposition of immune-complexes, similar to that in fip, is involved in the pathogenesis of systemic lupus erythematosus, rheumatoid arthritis, and sjogren's disease, in which a significantly increased serum cd l level has been reported [ ] . similarly, increased levels of immune-complexes in the blood of mice induced to overexpress baff have been reported [ ] . therefore, it is easily predicted that il- , cd l, and baff are involved in the development of immune-complex-mediated vasculitis. il- has also been reported to induce blimp- expression in b-cells, mainly by activating stat [ ] , suggesting that il- is involved in the enhanced blimp- mrna expression in pbmcs in fip cats. in this study, we showed that virus-infected macrophages overproduce b-cell differentiation/survival factors and that these factors act on b-cells and promote b-cell differentiation into plasma cells in fipv-infected cats. these findings may be important for the elucidation of the pathogenesis of fip. feline coronavirus infection risk of feline infectious peritonitis in cats naturally infected with feline coronavirus molecular and biological characterization of a murine ligand for cd gamma interferon/interleukin balance in tissue lymphocytes correlates with down modulation of mucosal feline immunodeficiency virus infection monoclonal antibody analysis of neutralization and antibody-dependent enhancement of feline infectious peritonitis virus macrophageand dendric cell-dependent regulation of human b cell proliferation requires the tnf family ligand baff cellular and molecular bases of bcell clonal expansions il- activity in feline infectious peritonitis elevated levels of soluble cd ligand (scd l) in serum of patients with systemic autoimmune diseases neutralization and antibody-dependent enhancement of dengue viruses the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies characterization of monoclonal antibodies against feline infectious peritonitis virus type ii and antigenic relationship between feline, porcine and canine coronaviruses enhancement and neutralization of feline infectious peritonitis virus infection in feline macrophages by neutralizing monoclonal antibodies recognizing different epitopes the role of igg subclass of mouse monoclonal antibodies in antibody-dependent enhancement of feline infectious peritonitis virus infection of feline macrophages inhibitory co-receptors activated by antigens but not by anti-immunoglobulin heavy chain antibodies install requirement of co-stimulation through cd for survival and proliferation of b cells suppression of apoptosis in normal and neoplastic human b lymphocytes by cd ligand is independent of bcl- induction differentiation of early plasma cells on bone marrow stromal cells requires interleukin- for escaping from apoptosis survival and proliferation factors of normal and malignant plasma cells functional cd ligand is expressed on human vascular endothelial cells, smooth muscle cells, and macrophages: implications for cd -cd ligand signaling in atherosclerosis mice transgenic for baff develop lymphocytic disorders along with autoimmune manifestations the role of baff in autoimmune disease monoclonal antibodies to the spike protein of feline infectious peritonitis virus mediate antibody-dependent enhancement of infection of feline macrophages a review of feline infectious peritonitis virus: molecular biology, immunopathogenesis, clinical aspects, and vaccination immunologic phenomena in the effusive form of feline infectious peritonitis two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein regulation of plasma-cell development intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence a ''possible'' involvement of tnf-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis tnf-alpha, produced by feline infectious peritonitis virus (fipv)-induced macrophages, upregulates expression of type ii fipv receptor feline aminopeptidase n in feline macrophages analysis of the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection: aminopeptidase n is not important and a process of acidification of the endosome is necessary two receptors are required for antibody-dependent enhancement of human immunodeficiency virus type infection: cd and fc gamma r expression of c d receptors during human b cell differentiation: immunofluorescence analysis with the hb- monoclonal antibody antibody-dependent enhancement of virus infection and disease il- rescues the hyporesponsiveness of c-rel deficient b cells independent of bcl-xl, mcl- , and bcl- feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses key: cord- -qht q l authors: takano, tomomi; azuma, natsuko; satoh, miyuki; toda, ayako; hashida, yoshikiyo; satoh, ryoichi; hohdatsu, tsutomu title: neutrophil survival factors (tnf-alpha, gm-csf, and g-csf) produced by macrophages in cats infected with feline infectious peritonitis virus contribute to the pathogenesis of granulomatous lesions date: - - journal: arch virol doi: . /s - - - sha: doc_id: cord_uid: qht q l feline infectious peritonitis (fip) is a feline coronavirus (fcov)-induced fatal disease of domestic and wild cats. the infiltration of neutrophils into granulomatous lesions is unusual for a viral disease, but it is a typical finding of fip. this study aimed to investigate the reason for the lesions containing neutrophils in cats with fip. neutrophils of cats with fip were cultured, and changes in the cell survival rate were assessed. in addition, the presence or absence of neutrophil survival factors was investigated in specimens collected from cats with fip. furthermore, it was investigated whether macrophages, one of the target cells of fipv infection, produce neutrophil survival factors (tnf-alpha, gm-csf, and g-csf). we showed that virus-infected macrophages overproduce neutrophil survival factors, and these factors act on neutrophils and up-regulate their survival. these observations suggest that sustained production of neutrophil survival factors by macrophages during fcov infection is sufficient for neutrophil survival and contributes to development of granulomatous lesions. feline coronavirus (fcov) belongs to group i of the family coronaviridae. fcov consists of three major proteins: nucleocapsid (n) protein, membrane (m) protein and peplomer spike (s) protein [ ] . fcov is classified into serotypes i and ii according to the amino acid sequence of its s protein [ , ] . both serotypes consist of two biotypes: feline infectious peritonitis (fip) virus (fipv) and feline enteric coronavirus (fecv). thus, there are types i and ii fecv and fipv in fcov. fecv is asymptomatic in cats, but fipv causes fip. it has been proposed that fipv arises from fecv by mutation [ , , ] , but the exact mutation and inducing factors have not yet been clarified. fip is a fatal disease, characterized by vasculitis associated with granulomatous inflammation containing b cells, neutrophils and macrophages. the infiltration of neutrophils into granulomatous lesions is unusual for a viral disease, but it is a typical finding of fip [ ] . macrophages/monocytes play an important role in the pathogenesis of fip. it has been reported that the difference in the proliferation of macrophages/monocytes is related to the difference in pathogenicity between fecv and fipv [ , ] . the possibility of feline vascular endothelial cell injury caused by metalloproteinase- and tnf-alpha produced by fipv-infected monocytes has also been reported [ ] . we reported that virus replication in macrophages induced tnf-alpha production, and the tnf-alpha produced was involved in aggravation of the fip pathology: tnf-alpha produced by fipv-infected macrophages was involved in lymphopenia and an increase in the level of the cellular receptor of type ii fipv, aminopeptidase n [ ] . tnf-alpha reportedly inhibits neutrophil apoptosis [ ] , suggesting its involvement in the infiltration of neutrophils into granulomatous lesions in cats with fip, but this has not yet been clarified. it is also unclear whether fipv-infected macrophages/monocytes produce factors other than tnfalpha that are related to the survival of neutrophils. in this study, we investigated the reason for the granulomatous lesions containing neutrophils in cats with fip. neutrophils of cats with fip were cultured, and changes in the survival rate were examined. the presence or absence of neutrophil survival factors in specimens from cats with fip was also investigated. furthermore, whether macrophages, one of the target cells of fipv, produce neutrophil survival factors was assessed. type ii fipv strain - ( tcid /ml) was administered orally to -to -month-old spf cats. nine cats that developed fip symptoms (fip cats), such as fever, weight loss, peritoneal or pleural effusion, dyspnea, ocular lesions, and neural symptoms, and nine -to -month-old spf cats administered a medium as mock infection controls were used in this study. fip diagnoses were confirmed upon postmortem examination, revealing peritoneal and pleural effusions and granulomatous lesions in major organs. all experiments were performed in accordance with the guidelines for animal experiments of kitasato university. felis catus whole fetus- (fcwf- ) cells were grown in eagle's minimum essential medium containing % l- medium, % fetal calf serum (fcs), u/ml penicillin, and lg/ml streptomycin. feline neutrophils and alveolar macrophages were maintained in rpmi growth medium supplemented with % fcs, u/ml penicillin, lg/ml streptomycin, and lm -mercaptoethanol. type ii fipv strain - was grown in fcwf- cells at °c. fipv strain - was supplied by dr. m. c. horzinek of state university utrecht, the netherlands. mab - - (igg a) used in the present study recognizes the s protein of type ii fipv, as demonstrated by immunoblotting. it has been reported that mab - - has virusneutralizing activity in assays carried out in fcwf- and crfk cells, but an enhancing activity in feline macrophage cultures, depending on the reaction conditions [ ] . blood collected from spf and fip cats using a heparinized syringe was centrifuged at , rpm for min, and the supernatant was used as a plasma sample. ascites fluid was collected from fip cats using a heparinized syringe and centrifuged at , rpm for min, and the supernatant was collected. heparinized blood ( ml) from spf and fip cats was diluted in twofold steps with phosphate-buffered saline (pbs) and subjected to ficoll-hypaque density gradient centrifugation at , rpm for min. after the removal of peripheral blood mononuclear cells and supernatant by aspiration from the top layer, the pellets were mixed with an equal volume of saline containing % dextran for granulocyte separation and allowed to stand for min at °c. the top clear layer was centrifuged at g for min, and the pellet was mixed with ml of . % nacl for min to eliminate contaminating erythrocytes and then mixed with ml of . % nacl. the cells were washed three times with pbs and resuspended with growth medium. cell purity was assessed to be more than % neutrophils by the examination of a smear stained with wright/giemsa solutions. to examine the effect of specimens from cats on the survival rate of neutrophils, feline neutrophils ( cells/ ll) were seeded into -well plates and cultured in the presence of fip-cat-derived ascites fluid (final concentration of : ), plasma (final concentration of : ), and spf-cat-derived plasma (final concentration of : ) for h. prior to and after incubation, ll of wst- solution (wst- cell proliferation assay kit; kishida chemical co., ltd, japan) was added. wst- is a tetrazolium salt that reacts with mitochondrial dehydrogenases, forming the formazan dye. expansion of viable cell numbers results in an increase in the activity of the mitochondrial dehydrogenases in the cells, corresponding to an increase in formazan dye metabolism. after the cells were returned to the incubator for h, the absorbance of the formazan produced was measured at nm with a -well spectrophotometric plate reader, as described by the manufacturer. the percent viability was calculated using the following formula: cell viability (%) = (after incubation od/prior to incubation od) . feline alveolar macrophages were obtained from spf and fip cats by broncho-alveolar lavage with hank's balanced salt solution (hbss) as described previously by hohdatsu et al. [ ] . rna isolation and cdna preparation rna isolation and cdna preparation were performed employing the method of takano et al. [ ] . determination of levels of feline gapdh mrna, tnf-alpha mrna, g-csf mrna, gm-csf mrna, and fcov n gene expression cdna was amplified by pcr using primers specific for feline gapdh mrna, tnf-alpha mrna, g-csf mrna, gm-csf mrna, and fcov n genes. the primer sequences are shown in table . pcr was performed using the method of takano et al. [ ] . the band density was quantified under appropriate uv exposure by video densitometry using scion image software (scion corporation, usa). tnf-alpha mrna, g-csf mrna, gm-csf mrna, and fcov n genes were quantitatively analyzed in terms of the relative density value compared to the mrna for the housekeeping gene gapdh. confluent fcwf- cell monolayers in -well multi-plates were inoculated with ll of the sample dilutions. after virus adsorption at °c, the cells were washed with hbss, and ml of growth medium containing . % carboxymethyl cellulose was added to each well. the cultures were incubated at °c for days, fixed in % buffered formalin, and stained with % crystal violet. inoculation of feline alveolar macrophages with fipv viral suspension (fipv strain - , tcid / . ml) and mab - - solution were mixed in an equal volume ratio and allowed to react at °c for h, and . ml of this reaction solution was used to inoculate feline alveolar macrophages ( cells) cultured in each well of -well multi-plates. as controls, medium alone and virus suspension alone were added to feline alveolar macrophages. after virus adsorption at °c for h, the cells were washed with hbss and ml of growth medium. the cells and culture supernatant were collected every h thereafter. the cells were used for measurement of the tnf-alpha mrna, g-csf mrna, gm-csf mrna, and fcov n genes. tnfalpha mrna, g-csf mrna, gm-csf mrna, and fcov n genes were quantitatively analyzed in terms of the relative density value compared to the mrna for the housekeeping gene gapdh. the culture supernatant was employed for determination of the virus titer. data were analyzed by student's t test. the data in fig. a , b were also analyzed using the mann-whitney test. p values \ . were considered to indicate a significant difference between compared groups. the neutrophil counts in peripheral blood of fip cats were examined and compared with those of uninfected spf cats. the count of neutrophils at the time of blood sampling is shown in fig. . the blood neutrophil counts in spf and fip cats were , ± , ll - (mean ± sd) and , ± , ll - , and median values were , and , ll - , respectively (p \ . ). to investigate the cause of increases in the neutrophil counts in fip cats, neutrophils were isolated from spf and fip cats, and the survival rates after -h culture were compared. the survival rate of neutrophils from fip cats was increased, but not significantly (p = . ), compared to that of spf cats (fig. ) . the survival rate of neutrophils in the presence of specimens from fip cats was significantly higher than those of neutrophils cultured with spf cat-derived plasma and medium (fig. ) . tnf-alpha, gm-csf, and g-csf mrna and fcov n gene expression levels in macrophages of spf and fip cats tnf-alpha, gm-csf, and g-csf mrna and fcov n gene expression levels were increased in alveolar macrophages derived from fip cats (fig. ) . the virus titer was significantly higher in the culture supernatant of macrophages infected with a mixture of fipv and mab - - than in that of macrophages cultured with medium and fipv alone. the neutrophil survival rates were significantly increased in the presence of the culture supernatant of macrophages infected with the mixture of fipv and mab - - compared to those in the presence of other supernatants (fig. ) . when spf-cat-derived alveolar macrophages were infected with a mixture of fipv and mab - - , the intracellular tnf-alpha, gm-csf, and g-csf mrna levels increased (fig. ). neutrophils are important for host defense against pathogens. viral infection generally reduces the number of neutrophils. the transfer of peripheral blood neutrophils to marginal tissues, destruction of neutrophils due to excess antibody production, and direct cell death caused by viral infection are considered to be the causes of neutropenia [ , , , ] . in human immunodeficiency virus and canine parvovirus infections, a reduced neutrophil count has been suggested to allow severe bacterial infection [ , ] . feline immunodeficiency virus and feline panleucopenia virus infections also affect stromal cells in the bone marrow, thus leading to a decreased production of neutrophils [ , ] . in contrast, severe acute respiratory syndrome (sars) coronavirus, which belongs to the same family as fipv, can also cause neutrophilia [ ] . neutrophilia has been also reported in cats with fip [ ] . paltrinieri [ ] reported that cytokines accelerate the delivery of neutrophils to the inflamed lesions, thereby prolonging the lifespan of circulating neutrophils. he also reported that the apoptosis of neutrophils is delayed by cytokines, thus increasing the life of neutrophils in lesions. it is likely that neutrophilia in cats with fip is associated with the infiltration of neutrophils into granulomatous lesions. however, there seems to be no established theory to explain the infiltration of neutrophils into granulomatous lesions in cats with fip. in humans, the lifespan of neutrophils is short. when neutrophils are isolated from peripheral blood and cultured in vitro, apoptosis is induced, and about half of the cells die within h [ ] . when neutrophils isolated from peripheral blood of spf cats were cultured for h, more than % died, suggesting that feline neutrophils also die due to apoptosis, similar to human neutrophils. furthermore, coculture with specimens from fip cats increased the survival rate of neutrophils, suggesting that the production of factors involved in the survival of neutrophils is enhanced in fip cats, and these factors act on neutrophils and prolong their lifespan. the tnf-alpha, gm-csf, and g-csf mrna levels were increased in macrophages of fip cats. these cytokine mrna levels were also elevated in macrophages infected with fipv and mab - - , clarifying the presence of neutrophil survival factors in the macrophage culture supernatant. it was suggested that: ( ) fipv-infected macrophages release tnf-alpha, gm-csf, and g-csf in response to virus replication, and ( ) these cytokines act on neutrophils and prolong their survival. we previously reported that fipv-infected macrophages produced tnfalpha and b-cell differentiation/survival factors, and these factors may have been involved in lymphopenia and hypergammaglobulinemia [ ] [ ] [ ] . kipar et al. [ ] suggested that fipv-infected monocytes are involved in feline vascular endothelial cell injury. cytokines and chemical mediators produced by fipv-infected macrophages/monocytes may play an important role in the pathogenesis of fip in cats. fig. the culture supernatant of fipv-infected macrophages promotes neutrophil survival. spf-cat-derived alveolar macrophages ( cells) were cultured with medium alone, fipv, or fipv and mab - - . the culture supernatant was collected after h. the virus titer in the culture supernatant was measured by the plaque assay method (left). the neutrophils of spf cats ( ml - ) were cultured at °c for h in the presence of each culture supernatant (final dilution of : ), and cell viability was assessed by the wst- assay (right). n = . nd not detected fig. relationship between tnf-alpha, gm-csf, and g-csf mrna expression and fipv replication in macrophages. spf-catderived alveolar macrophages ( cells) were cultured with medium alone, fipv, or fipv and mab - - . the cells were collected at h (as a control) and h. the intracellular tnf-alpha, gm-csf, and g-csf mrna expression levels were measured by rt-pcr. tnf-alpha, gm-csf, and g-csf mrna were quantitatively analyzed in terms of the relative density value to mrna for the housekeeping gene gapdh. n = neutrophil survival factors produced by macrophages in cats tnf-alpha, gm-csf, and g-csf are cytokines inhibiting the apoptosis of neutrophils [ , , , ] . these cytokines are secreted by macrophages and t cells. when these cytokines act on neutrophils, the intracellular apoptosis-inhibitory protein level increases, whereas the apoptosis-promoting protein level decreases, prolonging the survival of neutrophils [ , ] . in inflammatory diseases, such as cystic fibrosis and kawasaki disease, the pathological condition is aggravated as the survival time of neutrophils is prolonged [ , ] . moreover, the pathological aggravation of inflammatory diseases is associated with protease and reactive oxygen species produced by neutrophils [ , ] . these mediators may also be produced in excess and aggravate the granulomatous lesions in fip cats. we are now progressing with studies on the expression of apoptosis-inhibitory and -promoting proteins in neutrophils of fip cats. the enhancement of cathepsin b production in macrophages by elastase produced by neutrophils has been reported [ ] , while fipv reportedly requires cathepsin b to invade cells [ ] , suggesting that neutrophils are also involved in a viral replication enhancement mechanism, different from antibody-dependent enhancement (ade), in fipv infection. addie et al. [ ] reported that fcov re-infection of anti-fcov antibody-positive domestic cats might not result in the development of ade. the involvement of neutrophils in the enhancement of fipv production in macrophages and the influence of macrophages on neutrophil survival should be investigated further. virus production and tnf-alpha, gm-csf, and g-csf mrna expression were markedly enhanced in macrophages infected with fipv and mab - - compared to macrophages infected with the virus alone. we used immunofluorescence to detect fipv antigen: - % of cells were positive when spf cat-derived alveolar macrophages were infected with fipv and mab - - , whereas - % of cells were positive when alveolar macrophages were infected with fipv [ , ] . it seems that the increased number of virus-infected macrophages leads to the overexpression of neutrophil survival-factor-associated mrna in macrophages. in cats with fip, virus can be detected in macrophages of granulomatous lesions. to elucidate the mechanism of the infiltration of neutrophils into granulomatous lesions, we used alveolar macrophages, which can be readily collected in appropriate numbers. in addition, alveolar macrophages can be cultured without activation treatment, unlike monocytes. in this study, we showed that virus-infected macrophages overproduce neutrophil survival factors, and these factors act on neutrophils and up-regulate their survival. these observations suggest that sustained production of neutrophil survival factors by macrophages during fcov infection is sufficient for neutrophil survival and contributes to the development of granulomatous lesions. these findings may be important for elucidating the pathogenesis of fip. risk of feline infectious peritonitis in cats naturally infected with feline coronavirus gamma interferon/interleukin balance in tissue lymphocytes correlates with down modulation of mucosal feline immunodeficiency virus infection immune and idiopathic neutropenia replication of feline coronaviruses in peripheral blood monocytes cytokine-mediated bax deficiency and consequent delayed neutrophil apoptosis: a general mechanism to accumulate effector cells in inflammation polymorphonuclear leukocytemediated cell and tissue injury: oxygen metabolites and their relations to human disease neutrophil elastase up-regulates cathepsin b and matrix metalloprotease- expression the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies enhancement and neutralization of feline infectious peritonitis virus infection in feline macrophages by neutralizing monoclonal antibodies recognizing different epitopes the role of igg subclass of mouse monoclonal antibodies in antibody-dependent enhancement of feline infectious peritonitis virus infection of feline macrophages morphologic features and development of granulomatous vasculitis in feline infectious peritonitis spontaneous neutrophil apoptosis and regulation of cell survival by granulocyte macrophage-colony stimulating factor asymptomatic bacteriuria in puppies with canine parvovirus infection: a cohort study neutropenia, neutrophil dysfunction, and bacterial infection in patients with human immunodeficiency virus disease: the role of granulocyte colony-stimulating factor epstein-barr virus infects and induces apoptosis in human neutrophils marrow accessory cell infection and alterations in hematopoiesis accompany severe neutropenia during experimental acute infection with feline immunodeficiency virus virus infection of endothelial cells increases granulocyte adherence molecular cloning and sequence determination of the peplomer protein gene of feline infectious peritonitis virus type i comparison of the amino acid sequence and phylogenetic analysis of the peplomer, integral membrane and nucleocapsid proteins of feline, canine and porcine coronaviruses in vitro effect of recombinant human granulocyte colonystimulating factor on canine neutrophil apoptosis in vitro effect of recombinant human tumor necrosis factor-alpha on canine neutrophil apoptosis a review of feline infectious peritonitis virus: molecular biology, immunopathogenesis, clinical aspects, and vaccination the acute phase reaction some aspects of humoral and cellular immunity in naturally occurring feline infectious peritonitis pathogenesis of feline panleukopenia virus and canine parvovirus programmed cell death of the normal human neutrophil: an in vitro model of senescence feline infectious peritonitis and feline enteric coronavirus infections. . feline infectious peritonitis two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus differential role for low ph and cathepsin-mediated cleavage of the viral spike protein during entry of serotype ii feline coronaviruses acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein the role of eosinophils and neutrophils in inflammation a ''possible'' involvement of tnf-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis tnf-alpha, produced by feline infectious peritonitis virus (fipv)-induced macrophages, upregulates expression of type ii fipv receptor feline aminopeptidase n in feline macrophages b-cell activation in cats with feline infectious peritonitis (fip) by fip-virus-induced b-cell differentiation/survival factors delayed apoptosis of circulating neutrophils in kawasaki disease feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses bcl-xl-and baxalpha-mediated regulation of apoptosis of human neutrophils via caspase- haematological manifestations in patients with severe acute respiratory syndrome: retrospective analysis neutrophil survival factors produced by macrophages in cats acknowledgments this work was supported by grant for encouragement of young scientists (no. e ) from the school of veterinary medicine, kitasato university. key: cord- -cza qsv authors: würdinger, t; verheije, m h; raaben, m; bosch, b j; de haan, c a m; van beusechem, v w; rottier, p j m; gerritsen, w r title: targeting non-human coronaviruses to human cancer cells using a bispecific single-chain antibody date: - - journal: gene ther doi: . /sj.gt. sha: doc_id: cord_uid: cza qsv to explore the potential of using non-human coronaviruses for cancer therapy, we first established their ability to kill human tumor cells. we found that the feline infectious peritonitis virus (fipv) and a felinized murine hepatitis virus (fmhv), both normally incapable of infecting human cells, could rapidly and effectively kill human cancer cells artificially expressing the feline coronavirus receptor aminopeptidase n. also -d multilayer tumor spheroids established from such cells were effectively eradicated. next, we investigated whether fipv and fmhv could be targeted to human cancer cells by constructing a bispecific single-chain antibody directed on the one hand against the feline coronavirus spike protein – responsible for receptor binding and subsequent cell entry through virus–cell membrane fusion – and on the other hand against the human epidermal growth factor receptor (egfr). the targeting antibody mediated specific infection of egfr-expressing human cancer cells by both coronaviruses. furthermore, in the presence of the targeting antibody, infected cancer cells formed syncytia typical of productive coronavirus infection. by their potent cytotoxicity, the selective targeting of non-human coronaviruses to human cancer cells provides a rationale for further investigations into the use of these viruses as anticancer agents. replicative oncolytic viruses represent new agents with potential utility in cancer therapy. they are aimed to effectively eradicate tumor cells without affecting normal tissues. several different dna and rna viruses are currently being evaluated for their efficacy and selectivity toward cancer cells. , so far, there are no reports describing the potential use of coronavirus-based oncolytic agents in cancer virotherapy, despite a number of features that make coronaviruses potentially attractive for this purpose. coronaviruses are positive-strand rna viruses consisting of a nucleocapsid, which contains the approximately kb genome and the nucleocapsid (n) protein, and which is surrounded by an envelope carrying three membrane proteins, spike (s), envelope (e), and matrix (m). of these, the spike glycoprotein s is responsible for virus entry and syncytia formation, as it binds to the cellular receptor and induces membrane fusion. [ ] [ ] [ ] the specific interaction between the amino-terminal spike protein domain s and its cognate receptor [ ] [ ] [ ] induces conformational changes in the spike protein domain s that trigger the membrane fusion process. these con-formational changes require physical interaction between two heptad repeat (hr) regions, hr and hr , that occur in the s domain. prevention of this interaction by using peptides that correspond to these hr and hr regions can block membrane fusion, by binding of the peptides to their respective counterparts. [ ] [ ] [ ] most coronaviruses exhibit strict species specificity, as determined by the spike-receptor interaction. [ ] [ ] [ ] the coronavirus feline infectious peritonitis virus (fipv), for instance, selectively infects and induces syncytium formation of feline cells via its receptor feline aminopeptidase n (fapn). likewise, the recombinant felinized mouse hepatitis virus (fmhv), a derivative of mouse hepatitis virus (mhv) carrying a chimeric spike of which the ectodomain is from the fipv spike protein, also infects and fuses only feline cells through the fapn molecule. as a consequence of their species restricted tropism, fipv and mhv are nonpathogenic to human cells. however, once the tropism barrier is alleviated, coronaviruses can replicate in cells of different species. , thus, fipv and mhv may potentially be converted into specific oncolytic agents for the treatment of human cancer if their spike protein would recognize a receptor on human tumor cells. toward developing recombinant coronaviruses with a selective human tumor tropism, we first set out to investigate the effectiveness of fipv and mhv in eradicating, in vitro, human cancer cells expressing the virus receptor. to allow comparison of the two viruses in the same cells, we assessed fipv and, instead of mhv, the chimeric coronavirus fmhv for their ability to kill human cancer cells artificially expressing fapn. subsequently, we investigated whether fipv and fmhv could be targeted to human cancer cells expressing the epidermal growth factor receptor (egfr), a molecule commonly overexpressed on many types of cancer cells and associated with poor prognosis and response to cancer therapy. , for this purpose, we prepared a bispecific single-chain variable fragment (scfv) antibody, binding on one side to the fipv and fmhv spike protein and on the other side to the human egfr. the antibody indeed functioned as a specific targeting device. our findings justify the further development of coronaviruses as oncolytic agents. to determine whether non-human coronaviruses can infect and kill human cancer cells when the host species barrier determined by specific receptor recognition is alleviated, fipv and fmhv were redirected to human cancer cells via the virus receptor fapn. first, the susceptibility of the tumor cell lines caco- , ovcar- , hct- , hela, hepg , and widr to fipv and fmhv was successfully demonstrated by transient transfection of these cells with an fapn expression plasmid followed by virus inoculation (data not shown). control inoculations on cells not transfected with the fapn expression construct did not show any detectable fipv or fmhv infection, confirming that infection required the appropriate receptor expression. studies of fipv and fmhv propagation, cytotoxicity, and syncytia formation require host cells with stable receptor expression. therefore, hela and ovcar- cell lines stably expressing fapn were produced. fipv and fmhv were tested for their growth characteristics in these hela-fapn and ovcar-fapn cells ( figure a) . evidently, infection of fapn-expressing human cancer cells with the viruses fipv and fmhv resulted in a typical rapid production of progeny virus. to determine the potency of fipv and fmhv to kill human cancer cells, hela-fapn and ovcar-fapn cells were inoculated at various multiplicities of fipv or fmhv and the cell viability was measured at several time points after infection. fipv and fmhv efficiently killed both types of cells in a dose-dependent manner. the onset of cell death was found to occur as early as - h after inoculation. following infection at a multiplicity of infection (moi) of , both viruses completely eliminated the ovcar-fapn and hela-fapn monolayers within and h, respectively. infections at lower moi apparently required multiple rounds of infection resulting in the death of all or nearly all cells within h ( figure b) . furthermore, infected cells clearly showed membrane fusion typical of coronavirus replication (figure c ). we also determined whether non-human coronaviruses were able to eradicate human cancer cells in an in vitro solid tumor model. multilayer tumor spheroids offer a useful -d model for assessing virus-mediated eradica-tion of tumor tissue. this model has already been employed to study the potency of oncolytic adenoviruses and adeno-associated viruses. , ovcar-fapn spheroids were established and inoculated with fmhv at  plaque forming units (pfu)/spheroid. for comparison, the oncolytic effect of adenovirus type (ad ) at  pfu/spheroid was also measured. at several days post-inoculation (p.i.), the cell viability was determined (figure a) . at day p.i., a clear decrease in viability was observed for spheroids inoculated with either virus. after days, the ovcar-fapn spheroids infected with  pfu fmhv were essentially destroyed, whereas spheroids infected with  pfu ad were only partially eradicated. it should, however, be noted that the cytolytic and entry mechanisms of coronaviruses and adenoviruses differ distinctly, making a direct comparison not entirely valid. the results were confirmed by light microscopic analysis (figure b ). having established that fipv and fmhv can infect and destroy cancer cells once the entry barrier has been overcome, we wanted to develop a general method to target these viruses to a suitable antigen expressed on such cells. to this end, we constructed the bispecific scfv f- , which combines the antigen binding domains from antibodies f . and , recognizing the fipv s protein and egfr, respectively. the protein was produced by expression in eucaryotic cells. its synthesis and secretion were verified by radiolabeling followed by immunoprecipitation from the cell lysate and culture medium using an anti-myc antibody ( figure ). the results clearly show the synthesis and secretion of the approximately kda bispecific single-chain molecules. to investigate whether scfv f- could serve as an adapter molecule for fipv and fmhv infection via human egfr, cultures of human cancer cell lines of different tissue origin with confirmed expression of egfr ( figure ) were inoculated with similar amounts of fipv or fmhv in the presence or absence of the bispecific antibody. after h at c, the inoculum was replaced by regular culture medium and incubation of the cells was continued for h. the cells were immunostained for coronavirus protein expression. as can be seen in figure , all cell lines tested had become infected with fipv and fmhv in the presence of scfv f- . in contrast, none of the cells stained positive after inoculation with fipv or fmhv that had been preincubated with mock control supernatant (data not shown). similarly, no positive staining was observed when human cancer cells had been inoculated with the control virus mhv in the presence of scfv f- (data not shown). differences in infection efficiency were observed between different cell lines, with the egfr-high a cells showing the highest susceptibility to egfr-targeted coronavirus infection and the egfr-low hepg cells being the most poorly infected. on most cell lines, hela cells being the exception, egfr-targeted fipv exhibited a similar infection efficiency as egfr-targeted fmhv. interestingly, infected cells formed syncytia typical for productive coronavirus infection. the formation of infectious progeny virus was confirmed by monitoring -through titration on fcwf- cells -the increase in viral targeting non-human coronaviruses to human cancer cells t würdinger et al titers in the medium of a cells after inoculation with fipv or fmhv. typical growth curves were obtained, but only after the a cells had been inoculated in the presence of bispecific scfv f- ( figure ). to confirm that the infections of fipv and fmhv established by scfv f- were indeed mediated by the human egfr protein, we tested the mouse fibroblast cell line nih t and its human egfr-expressing derivative nih t -hegfr for their susceptibility to fipv and fmhv in the presence and absence of scfv f- . as illustrated in figure a further evidence for a specific interaction between the bispecific scfv f- and human egfr was obtained by studying the effect of the egfr antibody on the scfv f- -mediated coronavirus infection. hela cells were incubated with the monoclonal antibody prior to inoculation of fmhv in the presence of scfv f- . figure b shows that infection was blocked almost completely, confirming that a direct interaction with the egfr is required. similarly, the necessity of an interaction between the fipv spike protein and scfv f- was confirmed. we incubated fmhv with and without anti-fipv spike monoclonal antibody f . before adding scfv f- and inoculating hela cells. again, the anti-s antibody inhibited infection, demonstrating that scfv f- has to bind to the virus spike protein in order to function as a targeting adaptor ( figure b ). several human cancer cell lines that were infected with egfr-targeted fipv or fmhv showed cell-cell fusion typical for coronaviruses (see figure ). syncytium formation is an important determinant for cytotoxicity and spread of coronaviruses. therefore, it was important to investigate if syncytium formation between infected and neighboring cells resulted from undefined interactions or from specific bridging by scfv f- . to this end, a cells were inoculated with fmhv in scfv f- -containing medium for h and subsequently cultured for another h in the presence or absence of scfv f- . thus, scfv f- was either present continuously to support infection and syncytium formation or only briefly to mediate targeted infection. removal of scfv f- after h significantly reduced syncytium formation by approximately four-fold from . . to . . nuclei per syncytium (the data represent the average amount of nuclei per syncytium measured in three independent experiments; indicates the standard deviation). hence, scfv f- did not only promote fusion between the fmhv envelope and target cells, but also fusion between fmhv-infected and neighboring cells. coronaviruses use a class i membrane fusion mechanism, common to a number of enveloped virus families, in which hr regions occurring in the spike protein play an instrumental role. the mechanism involves conformational changes in the spike protein subsequent to receptor binding, resulting in an interaction of the hr and hr domains, which is necessary to drive the membrane fusion process. this process can be inhibited specifically using peptides corresponding to targeting non-human coronaviruses to human cancer cells t würdinger et al the hr domains as we showed recently for mhv. in order to investigate if the bispecific antibody-targeted fipv and fmhv infections and their induction of syncytia also depend on those conformational rearrangements in the viral spike protein, we tested the sensitivity of these processes to hr-derived peptide. to this end, we prepared a peptide corresponding to the hr region of the fipv s protein and initially studied this fhr peptide for its ability to block fipv and fmhv infection of feline fcwf- cells, which it did. as illustrated for fmhv (figure a and b) , addition of fhr during or after inoculation of feline fcwf- cells abrogated infection and syncytium formation, respectively. next, we determined whether scfv f- -mediated infection and syncytium formation are also sensitive to the fhr peptide. to this end, fmhv was targeted toward egfr on a cells in the presence or absence of fhr . as can be seen in figure c and d, addition of the peptide reduced both scfv f- -mediated infection and syncytium formation. thus, both processes seem to utilize a membrane fusion process similar to that of the native coronavirus. despite tremendous research efforts over the last decades into the nature of the disease and its causes, and despite the significant new insights acquired, cancer remains one of the most common causes of death. actually, treatment still relies for a major part on classical approaches such as surgery, radiotherapy, and chemotherapy. clearly, novel and creative methods are needed to complement the conventional treatment options. recently, the use of viruses as potential tools for anticancer therapy has gained considerable interest. , in this first exploratory study, we demonstrate two important features that make coronaviruses attractive for this purpose, that is, the ability to target these viruses to human tumor cells and their subsequent infection and eradication of these cells. the non-human coronaviruses fipv and fmhv appeared to possess a strong capacity to kill human cancer cells once they are able to enter these cells through an artificially expressed receptor, consistent with earlier observations with mhv by gallagher and co-workers. , the observed rapid and efficient eradication of cancer cells can probably be attributed to two coronaviral features. first, coronaviruses are positive-strand rna targeting non-human coronaviruses to human cancer cells t würdinger et al viruses that exhibit a fast, cytoplasmic transcription process leading to rapid virus protein synthesis and progeny virus production. second, the ability of coronaviruses to induce syncytia between infected and noninfected neighboring cells amplifies their cytotoxicity. we found that fipv and fmhv retained these properties in human cancer cells expressing the virus receptor, thus enabling a rapid cytotoxic spread of the virus to surrounding noninfected cancer cells. coronaviruses share some of these attractive characteristics with other enveloped viruses such as a fusogenic mutant of herpes simplex virus and the live attenuated edmonston b vaccine strain of measles virus. however, in contrast to these viruses, the coronaviruses fipv and fmhv are normally incapable of infecting human cells, due to their restricted tropism. thus, their native tropism does not need to be abolished in order to specifically limit their access, hence cytotoxicity, to human cancer cells. the ability to deliberately target viruses to preselected cells is a tremendous challenge with far-reaching implications for all kinds of therapeutic applications. although we were able to demonstrate the principle of retargeting of coronaviruses by exchanging spike ectodomains, , neither the detailed structural information nor the knowledge and technology required to purposely redesign the spike for binding to any given antigen are presently available. therefore, as an alternative and also potentially versatile tool, we embarked on the development of a bispecific adapter. thus, to redirect the non-human coronaviruses fipv and fmhv to egfrexpressing cells, we constructed the bispecific antibody molecule scfv f- that binds to both the feline spike and egfr. the latter was chosen for its frequent overexpression on human cancer cells. inoculation of targeting non-human coronaviruses to human cancer cells t würdinger et al fipv and fmhv onto a number of different egfrexpressing human cancer cell lines of various tissue origins in the presence of scfv f- resulted in infection, replication, and subsequent formation of syncytia. the targeted infection was completely dependent on the presence of the antibody and its efficiency generally correlated with the levels of egfr expression on the cancer cells. these observations are similar to native coronavirus infections where virus-cell and cellcell fusion efficiencies also correlate with host cell receptor density. the results imply that the bispecific antibody-mediated targeting approach can in principle be applied to direct coronaviruses to any cell surface antigen for which an appropriate antibody (ie hybridoma cell line) is available. the successful application of bispecific adapters for viral tumor therapy will depend, among others, on cell surface antigens that are -preferably -unique to the tumor. useful tumor-specific markers have not yet been identified and future work should reveal whether they occur or can be specifically induced in tumor cells. interestingly, for the attenuated measles virus, it was recently described that receptor density could also be a determinant of preferential tumor killing. this indicates that even overexpression of certain receptors on tumor cells may result in tumor selective infection and subsequent cell killing. this may also be of importance for the targeting of coronaviruses, since similar receptor density dependence has been described to be important for coronavirus infection and syncytia formation. the application also depends on the sufficient, local presence of the adapter. this might be achieved by incorporating the adapter gene sequence into the viral genome to have the virus produce its own targeting device. we have demonstrated this principle recently for the targeting of conditionally replicating adenoviruses. thus, adenoviruses expressing a bispecific scfv for targeting to egfr showed enhanced oncolytic replication in egfr-positive, adenovirus receptor-negative cancer cells. foreign gene expression can also be achieved with coronaviruses as we showed recently after inserting different reporter genes at various positions in the mhv genome. coronaviruses exhibit high mutation rates and are prone to recombination. their application in adaptermediated targeting to tumors will thus raise serious safety questions, particularly regarding the possibility of generating viruses that acquired the capacity to infect human cells independent of targeting devices. these questions will have to be addressed. several options to reduce the risks already exist. one is the use of coronaviruses lacking specific virulence genes; as we showed recently for mhv and fipv, such viruses are strongly attenuated in their natural host. another option is to combine deletion of nonessential virulence genes with genomic rearrangement; reorganization of the order of the structural protein genes, found for mhv to be tolerated without loss of viability, will reduce the risk of generating viable viruses by recombination with circulating field viruses. entry of coronaviruses into cells normally requires binding of the spike to the receptor followed by a series of structural rearrangements in the s protein that eventually lead to the merging of viral and cellular membranes. it appeared that the bispecific antibody-mediated entry, as well as the antibody-mediated induction of syncytia, uses this same fusion mechanism as was illustrated most clearly by the inhibitory effect of the hr -derived peptide. it will be interesting to find out how this fusion process actually takes place and whether, for instance, the necessary conformational changes in the s protein are induced by its interaction with the antibody or triggered by the binding to the egfr. alternatively, fusion may not be mediated by the spikes that effect the binding but, rather, by the conformational changes induced in the 'free' spikes upon interaction with undefined molecules on the target cells or by the particular conditions experienced when the virus is taken up in endosomes. evidence for the latter mechanism might be obtained by studying whether infection can also be achieved when using a bispecific antibody not binding the virus through the s protein but through one of the other envelope proteins, m or e, as these are not involved in the fusion process. an elegant application of the targeting principle has recently been described for another enveloped virus. in measles virus, the receptor binding and membrane fusion functions are divided over two different envelope proteins, the hemagglutinin (h) and the fusion (f) protein, respectively. when an scfv was carboxy-terminally appended to the type ii membrane glycoprotein h, the virus was successfully targeted to cells expressing the distinguishing receptor. , obviously, appending the egfr binding moiety of scfv f- to the amino terminus of the coronavirus s protein might also expand the targeting possibilities of these viruses. recombinant fmhv and fipv strain - stocks were produced and titrated in parallel on feline fcwf- cells, yielding titers of  and  tcid /ml (tissue culture infectious dose ), respectively. wildtype ad was produced and titrated on human embryonic kidney cells. the recombinant vaccinia virus vtf - containing the bacteriophage t rna polymerase gene was used as a t rna polymerase source for the t promoter-driven production of bispecific scfv in ost - cells. ost - (obtained from b moss), nih t , hela, ovcar- , hct- , caco- , widr, hepg , a (american type culture collection), and fcwf- cells (obtained from nc pedersen) were grown in dulbecco's modified eagle's medium (dmem) (cambrex bio science, verviers, belgium) containing % fetal bovine serum (fbs), iu of penicillin/ml, and mg of streptomycin/ml (all from life technologies, ltd, paisley, uk). nih-hegfr cells (nih t -her , obtained from pmp van bergen en henegouwen) were maintained in dmem containing % fbs, iu of penicillin/ml, mg of streptomycin/ml, and . mg/ ml g (life technologies, ltd, paisley, uk). hela-fapn and ovcar-fapn were maintained in the same medium supplemented with . and . mg/ml g , respectively. the hybridoma cell line producing the f . monoclonal antibody (mab) against the fipv spike protein was cultured in cd hybridoma medium (all from life technologies, ltd, paisley, uk) . c , ascitic fluid from an fipv-infected cat (kindly provided by bj haijema), was used as a source of polyclonal antibodies to fipv. the rabbit antiserum k raised against purified mhv and the mab r-g- directed against the fapn receptor have been described previously. , the culture supernatant of the hybridoma cell line f . was used as a source of the mab f . directed against the fipv and fmhv spike. for egfr detection, the mab was used (culture supernatant from the hybridoma cell line , atcc). to detect myctagged scfv f- , the anti-myc antibody myc was used (culture supernatant from the hybridoma cell line myc e , atcc). the expression plasmid pcr -fapn, containing the fapn cdna under the control of the cytomegalovirus promoter, was used to transiently express fapn on different cancer cell lines following transfection with lipofectamine plus reagent (life technologies, ltd, paisley, uk). transfected hela and ovcar- cells were also cultured in g -containing cell culture medium to select for stable transfectants. hela and ovcar- g resistant cells were cloned by two and four rounds of limiting dilution, respectively, and tested for their susceptibility to fipv infection and for fapn expression by fluorescent activated cell sorter (facs) analysis. furthermore, fipv infection was blocked by the anti-fapn antibody r-g- , confirming that the infections occurred via fapn. an amount of  cells/ cm well was seeded and inoculated the next day with virus at an moi of pfu/ cell for h in serum-free culture medium. the cells were washed three times with pbs, and cultured for up to h. at several time points p.i., the medium was harvested, centrifuged for min at r.p.m., and stored at À c until analysis. the amount of virus produced at each time point p.i. was determined by end point titration on feline fcwf- cells. an amount of  hela-fapn or ovcar-fapn cells was seeded per . cm well and infected in triplicate with various amounts of fipv or fmhv. at several time points after inoculation, the cells were cultured for h in % wst- (roche diagnostics gmbh, mannheim, germany), after which the od was measured. viability was expressed relative to uninfected control cells, after subtraction of background values of wst- incubated in the absence of cells. three-dimensional multilayer spheroids were produced by incubating  ovcar-fapn cells in . cm wells coated with ml % multi purpose agarose (roche diagnostics gmbh, mannheim, germany) in pbs for h on a spinner-platform set at r.p.m., at c and % co . subsequently, the spheroids were cultured for days at c and % co , reaching a diameter of approximately mm, before they were used for infection experiments. spheroids were infected in a total volume of ml and cultured for , , or days, after which they were incubated for h in % wst- . the od was measured directly in spheroid-containing wells. viability was expressed relative to uninfected control spheroids, after subtraction of background values of wst- incubated in the absence of spheroids. statistical significance between different groups was determined by the t-test. the linker. in a subsequent pcr, the assembled scfv dna was amplified and restriction sites were added by using the rs primers of the scfv isolation system. the resulting dna fragment contained a sfii site and a noti site, and was subsequently cloned into pgemteasy and sequenced. the sequence was compared to the sequences of the independent f . -v h and f . -v l fragments, and the resulting correct clone was named pgemteasy- fv h v l . the pgemteasy- fv h v l plasmid was digested by sfii and noti to isolate the bp scfv f, which was ligated into the pcantab derivative pstcf that had been digested by sfii and noti, resulting in pstcf f. the scfv directed against the egfr was isolated from pstcfs - , by noti digestion and ligated in a v h -v l configuration into the noti site downstream of the scfv f in pstcf f creating a three ala linker between the two scfv fragments. this resulted in the expression vector pstcf f- , which contains the bp bispecific cdna construct encoding the antispike scfv f linked to the anti-egfr scfv in fusion with an amino-terminal igk signal sequence and a carboxy-terminal myc tag under the control of cmv and t promoters. to determine whether scfv f- was produced and secreted into the culture medium, subconfluent monolayers of ost - cells in cm tissue culture dishes were targeting non-human coronaviruses to human cancer cells t würdinger et al inoculated with vtf - at pfu/cell (t ¼ h) and subsequently transfected (t ¼ h) without dna, with pstcf f- , or with pstcfs - plasmid dna by using lipofectin (life technologies, ltd, paisley, uk). , at t ¼ h, the cells were starved for min in cysteineand methionine-free modified eagle's medium containing mm hepes, ph . , and % fbs. the medium was then replaced by ml of similar medium containing mci of s in vitro cell-labeling mixture (amersham pharmacia biotech europe gmbh, germany). after h, the cells were either lysed or the labeling medium on the cells was replaced by ml normal culture medium and incubation continued for , , or h. the cells were lysed in ml tesv lysis buffer ( mm tris-hcl (ph . ), mm edta, mm nacl, mm pmsf, % triton x- ). to the cleared medium, ml of  tesv lysis buffer was added. proteins were immunoprecipitated from the medium or the lysed cells by using the anti-myc antibody diluted : . the immune complexes were adsorbed to pansorbin cells (calbiochem, la jolla, usa) as described previously. equal volumes of the immunoprecipitates were analyzed by sds-page containing % polyacrylamide. for the production of scfv f- , subconfluent monolayers of ost - cells were inoculated at an moi of with vtf - (t ¼ h) and transfected (t ¼ h) with pstcf f- , or mock transfected (no plasmid dna), by using lipofectin (life technologies, ltd, paisley, uk). the medium was refreshed at t ¼ . h, harvested at t ¼ h, and centrifuged for min at r.p.m. to clear it from cell debris. the mock supernatant and the supernatant containing the bispecific scfv were loaded onto a % sucrose cushion, centrifuged for min at r.p.m. to clear the supernatant from vtf - virus, and stored at À c in aliquots until use. the supernatant from ost - cells infected with vtf - , but not transfected with plasmid dna, was used as a control supernatant. a single batch of scfv f- and control supernatant was used for all experiments described. to determine the optimal amount of scfv f- to be used in targeted infections, fipv (moi ) was preincubated for h with various amounts of scfv f- and inoculated in a total volume of ml on a cells in a cm well. after h at c, the inoculum was replaced by regular culture medium and incubation of the cells was continued for h. an immunostaining with serum directed against fipv proteins was performed, after which the stained cells were counted and their numbers plotted against the amount of scfv f- used. the titration results revealed the optimal amount of bispecific antibody needed for maximal targeting efficiency under these standard conditions to be ml scfv f- . more antibody did not increase but, rather, decreased the level of infection, presumably because excess antibodies in the inoculum may bind to egfr on cells thereby blocking their use by the virus. cells inoculated with fipv preincubated with mock control supernatant remained negative (data not shown). cells were incubated with c anti-fipv ascites fluid diluted : , or k anti-mhv serum diluted : , followed by goat anti-cat peroxidase (dako, glostrup, denmark) diluted : , or swine anti-rabbit peroxidase (dako, glostrup, denmark) diluted : , respectively. the cells were stained by aec (brunschwig, amsterdam, the netherlands) according to the manufacturer's protocol, and analyzed by light microscopy. to determine whether scfv f- interacts with the egfr,  hela cells per cm well were incubated with or without ml hybridoma supernatant containing mab for min at c in order to block the interaction of egfr and scfv f- . next, the cells were inoculated for h at c with  pfu fmhv preincubated with ml scfv f- for h at c in a total volume of ml. thereafter, the cells were fixed, permeabilized, and immunostained for the presence of fmhv. the number of infected cells was counted by using light microscopy. the interaction of scfv f- and the spike protein was analyzed by incubating  pfu fmhv with or without ml hybridoma supernatant containing anti-fmhv-s antibody f . . after h of incubation at c, ml scfv f- was added for h of incubation at c in a total volume of ml. next, the infection mixes were inoculated on  hela cells per cm well for h at c. the cells were fixed, permeabilized, and immunostained for the presence of fmhv. again, the number of infected cells was determined by using light microscopy. an amount of  a cells per . cm well was inoculated at an moi of for h with fmhv preincubated with ml of scfv f- for h at c. the cells were washed three times with pbs and incubated further in the presence or absence of ml scfv f- . an immunostaining was performed h after infection, and the number of nuclei per syncytium was determined by light microscopy. for the production of the fhr peptide corresponding to amino acids - of the fipv spike protein (acc. no. vgih ), a pcr fragment was prepared using as a template the sequence from cdna clone b , which contains the fipv spike gene. the fhr peptide was expressed in escherichia coli, purified, and quantified as described elsewhere. , analysis of the fusion mechanisms of coronavirus infection sensitivity of the normal virus-cell fusion process to fhr was studied by inoculating feline fcwf- with fmhv at an moi of . in the presence or absence of . mm fhr peptide for h. the effect of fhr on the targeted fusion process was analyzed by preparing in parallel two inoculation mixtures by preincubating fmhv with scfv f- for h at c after which . mm fhr peptide was added to one mixture. two cultures of human a cells were washed with pbs and targeting non-human coronaviruses to human cancer cells t würdinger et al inoculated at an moi of for h at c with the infection mixes. the cells were fixed, permeabilized, and stained for the presence of fmhv using anti-mhv rabbit antiserum k . the number of infected cells was counted by using light microscopy. the sensitivity of the cell-cell fusion process during normal infection of feline fcwf- cells was analyzed by inoculating cells with fmhv at an moi of . for h at c, washing them three times with pbs, and incubating for h in culture medium with or without . mm fhr peptide. for a similar analysis of cell-cell fusion after targeted infection, cultures of a cells were inoculated at an moi of with fmhv preincubated with scfv f- for h at c. next, the cells were washed three times with pbs, and incubated for h in culture medium with or without . mm fhr peptide. the cells were fixed, permeabilized, and immunostained for the presence of fmhv proteins. the number of nuclei per syncytium was counted under the light microscope. cytolytic viruses as potential anti-cancer agents rna viruses as virotherapy agents the viruses and their replication the coronavirus surface protein intracellular transport of recombinant coronavirus spike proteins: implications for virus assembly feline aminopeptidase n serves as a receptor for feline, canine, porcine, and human coronaviruses in serogroup i several members of the mouse carcinoembryonic antigen-related glycoprotein family are functional receptors for the coronavirus mouse hepatitis virus-a the s subunit of the murine coronavirus spike protein is not involved in receptor binding conformational change of the coronavirus peplomer glycoprotein at ph . and degrees c correlates with virus aggregation and virus-induced cell fusion the s subunit of the spike glycoprotein of bovine coronavirus mediates membrane fusion in insect cells the coronavirus spike protein is a class i virus fusion protein: structural and functional characterization of the fusion core complex interspecies aminopeptidase-n chimeras reveal species-specific receptor recognition by canine coronavirus, feline infectious peritonitis virus, and transmissible gastroenteritis virus molecular determinants of species specificity in the coronavirus receptor aminopeptidase n (cd ): influence of n-linked glycosylation coronavirus species specificity: murine coronavirus binds to a mouse-specific epitope on its carcinoembryonic antigen-related receptor glycoprotein retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier switching species tropism: an effective way to manipulate the feline coronavirus genome protein tyrosine kinases and cancer the erbb signaling network: receptor heterodimerization in development and cancer a novel approach in the treatment of cancer: targeting the epidermal growth factor receptor the organotypic multicellular spheroid is a relevant three-dimensional model to study adenovirus replication and penetration in human tumors in vitro adeno-associated viral vectors penetrate human solid tumor tissue in vivo more effectively than adenoviral vectors maximal epidermal growth-factor-induced cytosolic phospholipase a activation in vivo requires phosphorylation followed by an increased intracellular calcium concentration mechanisms of viral membrnae fusion and its inhibition identification of a contiguous -residue determinant in the mhv receptor that controls the level of virion binding to cells potent systemic antitumor activity from an oncolytic herpes simplex virus of syncytial phenotype oncolytic measles viruses displaying a singlechain antibody against cd , a myeloma cell marker high cd receptor density determines preferential killing of tumor cells by oncolytic measles virus conditionally replicative adenovirus expressing a targeting adapter molecule exhibits enhanced oncolytic potency on car-deficient tumors coronaviruses as vectors: position dependence of foreign gene expression the group-specific murine coronavirus genes are not essential, but their deletion, by reverse genetics, is attenuating in the natural host targeting non-human coronaviruses to human cancer cells t würdinger et al vaccines through the directed deletion of group-specific genes provide protection against feline infectious peritonitis coronaviruses maintain viability despite dramatic rearrangements of the strictly conserved genome organization an oncolytic measles virus engineered to enter cells through the cd antigen characterization of a feline infectious peritonitis virus isolate cytoplasmic expression system based on constitutive synthesis of bacteriophage t rna polymerase in mammalian cells monoclonal antibody analysis of neutralization and antibody-dependent enhancement of feline infectious peritonitis virus viral protein synthesis in mouse hepatitis virus strain a -infected cells: effect of tunicamycin differences in virus receptor for type i and type ii feline infectious peritonitis virus a dimeric bispecific miniantibody combines two specificities with avidity targeting of adenoviral vectors through a bispecific single-chain antibody stably expressed fipv peplomer protein induces cell fusion and elicits neutralizing antibodies in mice large-scale production, purification and refolding of the full-length cellular prion protein from syrian golden hamster in escherichia coli using the glutathione s-transferase-fusion system targeting non-human coronaviruses to human cancer cells t würdinger et al we are grateful to tsutomu hohdatsu (kitasato university, towada, aomori, japan) for providing anti-fapn antibody r-g- , to kathryn v holmes (university of colorado health sciences center, denver, usa) for supplying the fapn expression vector pcr -fapn, to ed dubovi (cornell university, ithaca, usa) for providing the hybridoma cell line f . , and to paul mp van bergen en henegouwen (utrecht university, utrecht, the netherlands) for the gift of nih t -her cells.this work was supported by the dutch cancer society (uu - ). victor w van beusechem is supported by a research fellowship of the royal netherlands academy of arts and sciences (knaw). key: cord- -rfw njpo authors: olsen, christopher w. title: a review of feline infectious peritonitis virus: molecular biology, immunopathogenesis, clinical aspects, and vaccination date: - - journal: veterinary microbiology doi: . / - ( ) -r sha: doc_id: cord_uid: rfw njpo abstract feline infectious peritontis (fip) has been an elusive and frustrating problem for veterinary practitioners and cat breeders for many years. over the last several years, reports have begun to elucidate aspects of the molecular biology of the causal virus (fipv). these papers complement a rapidly growing base of knowledge concerning the molecular organization and replication of coronaviruses in general. the fascinating immunopathogenesis of fipv infection and the virus' interaction with macrophages has also been the subject of several recent papers. it is now clear that fipv may be of interest to scientists other than veterinary virologists since its pathogenesis may provide a useful model system for other viruses whose infectivity is enhanced in the presence of virus-specific antibody. with these advances and the recent release of the first commercially-available fipv vaccine, it is appropriate to review what is known about the organization and replication of coronaviruses and the pathogenesis of fipv infection. list of abbreviations: ade=antibody-dependent enhancement; bcv=bovine coronavirus; c' =complement; c'-ade=complement-mediated antibody-dependent enhancement; ccv=canine coronavirus; cns=central nervous system; cr=complement receptor; cvlp=coronavirus-like particle; ds=double-stranded; dth=delayed-type hypersensitivity; eav=equine arteritis virus; fcr = fc receptor; fecv = feline enteric coronavirus; felv = feline leukemia virus; fip = feline infectious peritonitis; fipv = feline infectious peritonitis virus; hcv- e = human coronavirus e; hcv-oc =human coronavirus oc ; he=hemagglutinating esterase; hev=hemagglutinating encephalomyelitis virus; hiv=human immunodeficiency virus; hrsv=human respiratory syncytial virus; ibv = infectious bronchitis virus; kb = kilobases; kda = kilodaltons; ldhv = lactate dehydrogenase virus; m = membrane (protein); mab = monoclonal antibody; mhc = major histocompatability; mhv=mouse hepatitis virus; mrna=messenger rna; n=nucleocapsid (protein); nlinked = asparagine-linked (glycosylation); ns = nonstructural (protein); o-linked = serine-or th reonine-linked (glycosylation); orf--open reading frame; pol = polymerase (protein); prcv = porcine respiratory coronavirus; rcv = rat coronavirus; recv = rabbit enteric coronaivirus; ri = replicative intermediate; rhuifn~ =recombinant human interferon alpha; s= spike (protein); sdav = sialodacryoadenitis virus; siv = simian immunodeficiency virus; spf = specific-pathogen-free; tcids =tissue culture infectious dose %; tcv=turkey coronavirus; tgev=transmissible gastroenteritis virus; ts=temperature-sensitive; vn=virus neutralization (-izing). history feline infectious peritonitis was first described as a disease entity in the s (holzworth, ; wolfe and griesemer, ) . the etiology of this disease was uncertain until , when virus particles were described from of cats with fip (ward, ) . this early paper by ward is notable because it outlined several salient features regarding the viral etiology of fip which have been confirmed by more recent studies. these include the tropism of the virus for macrophages, the presence of virions in vesicles and cysternae of the golgi body, the lack of plasma membrane budding by the virus, and the presence of club-like projections from the surface of the virions. ward and colleagues (ward, ; ward et al., ) suggested that the virus responsible for fip might be a member of the coronaviridae. evidence for this characterization included structural similarities between mouse hepatitis virus (mhv) and the putative fipv, disease similarities between fip and mhvrelated disease, and the possible association of a coronavirus with a retrovirus (feline leukemia virus (felv)/fipv and murine leukemia virus/mhv, respectively) in the etiology of both diseases. confirmation of the viral etiology and elucidation of the pathogenesis of fip was hampered for a number of years because of difficulties encountered in isolating fipv from clinical cases and growing the virus in vitro. the first cultivation of the virus in vitro was accomplished using peritoneal exudate cell cultures (pedersen, a) . in so doing, pedersen confirmed the subcellular localizations, virion features, and macrophage tropism first described by ward. the virus was subsequently grown in feline small intestinal organ cultures (hoshino and scott, ) . finally, the growth and serial passage, in a continuous cell line of feline origin, of a virus which produced fip upon experimental inoculation of cats was demonstrated in . this virus was also characterized as a coronavirus (o'reilly et al., ) . coronaviridae the family coronaviridae includes pathogens of several mammalian and avian species. this family has been defined morphologically as a group of spherical to pleomorphic, large ( - nm), enveloped viruses with helical nucleocapsid cores (wege, et al., ) . projecting from the envelope of coronavirus virions is a fringe of club- (wege, et al., ) or petal-shaped (holmes, ) spikes or peplomers. these spikes have given rise to the name coronavirus by analogy to either the corona of the sun or the crowns of thorns (corona spinarum) used in medieval artworks (holmes, ) . coronaviruses have historically been arranged antigenically into five groups (wege, et al., ) . one group includes fipv and the related feline enteric coronavirus (fecv), canine coronavirus (ccv), transmissible gastroenter-itis virus of swine (tgev), and human coronavirus e (hcv- e). a second group includes human coronavirus oc (hcv-oc ) and related isolates, mhv, rat coronavirus (rcv) and sialodacryoadenitis virus (sdav), bovine coronavirus (bcv), and hemagglutinating encephalomyelitis virus of swine (hev). the avian coronaviruses have been classified into two separate groups typified by infectious bronchitis virus (ibv) of chickens and turkey coronavirus (tcv). there are also several unclassified coronaviruses including an enteric coronavirus of rabbits (recv) (descoteaux and lussier, ) , a coronavirus which induces myocarditis after experimental inoculation of rabbits (edwards, et al., ) , and a coronavirus isolated from a horse (mair et al., ) . within this classification framework, recent work suggests that the barriers between antigenic groups are not absolute. tcv has been shown to be related antigenically to ibv as well as two mammalian coronaviruses, mhv and bcv (dea, et al., ) . furthermore, an evolutionary relationship between tcv, bcv, mhv, and hcv-oc is supported by genetic sequence analysis of the ' ends of these viruses (verbeek and tijssen, ) . there is also evidence from a recent monoclonal antibody (mab) analysis that hcv- e should be moved out of the tgev group (sanchez, et al., ) . beyond these changes within the coronavirus family, the coronaviridae is now seen to represent a larger rna virus superfamily. toroviruses have been isolated from horses (snijder, et al., b) , cattle (koopmans, et al., ) , cats (muir, et al., ) , and humans (beards, et al., ) . though morphologically different (toroviruses have a tubular nucleocapsid), the genomic organization (snijder, et al., b; snijder, et al., ) and protein structure (snijder, et al., a) of toroviruses and coronaviruses are very similar and there is evidence for recombination between toroviruses and coronaviruses during their co-evolution . equine arteritis virus (eav) contains an icosahedral-core and has been classified historically as a togavirus but is now included in the coronavirus superfamily because of its similar genetic organization . another traditional member of the togaviridae, lactate dehydrogenase-elevating virus (ldhv), is also similar genetically to coronaviruses kuo, et al., ) . coronaviruses appear to enter cells via plasma membrane fusion without significant involvement of phagocytic or endosomal pathways (kooi, et al., ; payne, et al., ; stoddart, ; sturman, et al., ; weismiller, et al., ) . neither cytochalasin b (which disrupts cellular microfilaments and phagocytosis) nor lysosomotropic bases (which elevate endosomal ph) affected infection of macrophages by fipv (stoddart, ) . bcv infection of human rectal tumor cells was likewise unaffected by lysosomotropic bases and an electron microscopic analysis demonstrated bcv fusion only with the plasmalemma, not with intracellular membranes (payne, et al., ) . mhv infection of fibroblasts has also been found to be largely independent of endocytotic pathways (kooi, et al., ) . the ability of a given coronavirus to infect specific hosts and/or tissues is thought to be dependent upon the presence of a specific cellular receptor (lai, ) . a receptor for mhv has recently been identified on murine enterocyte and hepatocyte membranes and cloned (dvelsler, et al., ) . the receptor is a kilodalton (kda) glycoprotein of the immunoglobulin superfamily, with amino acid sequence and antigenic homologies to members of the carcinoembryonic antigen family of proteins . transfection of fibroblasts with the putative mhv receptor gene conferred susceptibility to infection whereas mab to the receptor blocked infection (dvelsler, et al., ) . in addition, the presence of a functional form of the receptor correlated with tissue and mouse strain susceptibility to infection with mhv . to date, no work has been published concerning a receptor for fipv. a number of reviews have outlined the molecular biology of coronaviruses (holmes, ; lai, ; spaan, et al., ; sturman and holmes, ). these will be drawn upon to create a model into which recent advances in the molecular biology of fipv can be integrated. replication of coronaviruses is accomplished entirely in the cytoplasm of infected cells. the genome of coronaviruses is single-stranded rna of positive polarity. upon initial infection of a cell, the '-capped and '-polyadenylated genomic rna can function as messenger rna (mrna). coronaviruses are among the largest rna viruses; the genome of ibv is over kilobases (kb) . viral replication and transcription occur via the formation of double-stranded (ds) rna replicative intermediates (ris). a stretch of highly conserved nucleotides about bases from the ' end of the genome has been identified as a negative-strand initiation signal (lai, ) . traditionally it was thought that new positive-sense, genomiclength rna as well as positive-sense, subgenomic mrnas were all transcribed off a genomic-length ri (lai, et al., ) . however, results from recent studies of tgev (sethna, et al., ; sethna, et al., ) , mhv (sawicki and sawicki, ) , and bcv (liu, et al., ) have demonstrated transcription via subgenomic ris as well. coronavirus mrnas form a '-nested set, i.e. all of the mrnas share the same sequences at their ' ends. the number ofmrnas varies among different coronaviruses. fipv and ibv produce mrnas, tgev produces mrnas, and bcv produces mrnas, including the genomic-length mrna in each case. despite this variation in number, there is a consensus coding pattern among all coronaviruses. from ' to ' the gene order is polymerase (pol) polyprotein, spike (s) protein, membrane (m) protein, and nucleocapsid (n) protein, with nonstructural (ns) protein genes variably interspersed (lai, ) . the coding assignments (where known ) and sizes of the fipv (strain - ) mrnas are as follows: mrna , kb-genomic rna (de groot, et al., d) ; mrna , . kb-s protein (de groot, et al., c; de groot, et al., d) ; mrna , . kb (de groot, et al., d) ; mrna , . kb-m protein (de groot, et al., d; vennema, et al., ); mrna , . kb-n protein (de groot, et al., d; vennema, et al., ) ; and, mrna , . kb-open reading frames (orfs) and (de groot, et al., ) . each of the fecv strain mrnas has been found to be . kb shorter than the corresponding fipv - mrnas, suggesting a deletion of nucleotides at the ' end of the fecv genome (baines, ) . although all but the smallest coronavirus mrnas are structurally polycistronic, most are functionally monocistronic since only the unique '-most orf of each mrna is translated (lai, ; spaan, et al., ) . exceptions to this include the mrnas which encode the polymerase proteins (see below), mrnas and of mhv and mrna of tgev spaan, et al., ) , mrnas and oflbv (liu, et al., ) , and mrna of fipv (de groot, et al., ) . fipv mrna encodes polypeptides, an kda protein from orf- and a kda protein from orf- . orf- is homologous to orf-x from tgev, which is also encoded by the '-most mrna of tgev, mrna . the kda protein from orf- has structural similarity to membrane proteins (de groot, et al., ) . tgev mrna lacks a homolog to orf- (de groot, et al., ) . thus, the deletion at the ' end of the fecv genome compared to the fipv genome (baines, ) may be very interesting since both tgev and fecv are largely restricted to replication in enterocytes, whereas fipv infects macrophages in a variety of tissues systemically. the genomic-length mrnas of coronaviruses encode the rna-dependent rna polymerase proteins (lai, ) . research with mhv has demonstrated two "temporally and enzymatically distinct...polymerase activities" in mhv transcription . in addition, in vitro translation of the genomic-length mrna of mhv-a resulted in the detection of two predominant protein products, p and p . the p product was shown to be the n-terminal portion of a larger precursor protein (p ) and could be detected by two-dimensional gel electrophoresis of mhv-infected cells only at late times ( - hours ) after infection (denison and perlman, ) . cloning, sequencing, and in vitro translation of the ibv brieirly, et al., ; brieirly, et al., ) and mhv (lee, et al., ) pol mrnas has revealed that in both cases two orfs are translated via a - frameshifting-pseudoknot to produce the pol polyprotein. nucleotide (lee, et al., ) and protein (denison, et al., ) sequence analysis of the mhv pol region has also delineated a number of putative functional domains. these include membrane anchor, cysteine-rich, and protease domains in orf-la (lee, et al., ) , as well as polymerase, helicase, and zinc-finger domains and protease cleavage sites in orf- b (denison, et al., ; lee, et al., ) . similar domains have also been identified in the ibv (gorbalenya, et al., ), torovirus, and eav (denboon, et al., ) polymerases. but despite identification of these domains by sequence analysis, it is still unclear what the exact relationship is between the component proteins identified and the early and late polymerase activities which have been functionally defined. however, a group of temperature-sensitive (ts) mutants of mhv have been identified. these mutations fell into complementation groups relative to positive-and negative-sense rna transcription (schaad, et al., ) . sequence analysis of such mutations may allow assignment of distinct polymerase functions to specific polymerase protein components. for a given coronavirus, genomic-length and subgenomic mrnas all contain an identical ' leader sequence, the length of which varies among different coronaviruses . lai and colleagues, working with mhv, have pioneered research into the role of leader rna in coronavirus transcription. in , the leader segments of several mhv a mrna species were sequenced and found to be identical . the same sequence was also found at the ' end of the genomic-length rna, suggesting that the '-genomic rna coded for the mrna leaders via the complementary ' end of the negative-sense strand of the ri. lai and colleagues reasoned that since coronavirus replication is an entirely cytoplasmic process, conventional eukaryotic splicing, a nuclear process, could not explain their findings. they also found a sequence complementary to a region near the ' end of the leader at the initiation site for mrna , suggesting a role for the leader in transcription initiation . in , makino and colleagues demonstrated that during a mixed infection with two different mhv strains (bi and ca ), the respective leader sequences could freely reassort (makino, et al., b) . they have further demonstrated that such reassortment/ recombination occurs at a high frequency (makino, et al., a; makino et al., b) . it also appears that recombination occurs randomly with respect to the site of crossover (banner and lai, ) . (a previous report had suggested that recombination crossover sites were clustered near a hypervariable region in the s gene (banner et al., ) . ) the ability to study such recombinants may play a critical role in elucidating questions of coronavirus pathogenesis (baines, ) . recombinants have already been used to localize functionally important epitopes on the s protein of mhv (makino, et al., ) . coronavirus transcription is thus proposed to occur via a discontinuous, leader-primed mechanism (lai, ) . the leader is transcribed from the ' end of the ri's negative-sense strand, dissociates from this template, then reassociates with the template at intergenic sites and primes downstream transcription. the sites of leader reassociation with the template are determined by homologous binding between sequences near the ' end of the leader sequence and a consensus sequence in the intergenic regions. (such a consensus intergenic sequence has been identified preceeding the orfs for the fipv s (degroot, et al., c ) , m, and n (vennema, et al., ) proteins. ) the ' end of the mhv leader contains repeats of a ucuaa sequence which is also imperfectly repeated at intergenic sites (lai, ) . the number of repeats in the leader not only varies among strains of mhv but can also change during passage in vitro (lai, ; makino, et al., a) . these pentanucleotide repeats are thought to play an important role in the binding of leader to intergenic sequence rna (makino, et al., a) . coronavirus mrnas are not all synthesized in equal amounts during transcription, but their individual, relative rates of synthesis are constant throughout transcription . the relative abundance of the mrna species progressively increases from ' to ' along the genome (konings, et al., ) . two factors may be responsible for governing this gradient in mrna levels: the relative degree of homology, and thus binding efficiency, of leader rna to the intergenic sequences makino, et al., a) ; or, the internal initiation events during leader-primed transcription, which may occur slowly enough to block the elongation of passing transcripts (konings, et al., ) . the later theory proposes that upstream transcripts are forced to pause at new sites of initiation and thus prematurely terminate and dissociate from the template. such incomplete transcripts had previously been detected (makino et al., a) . ultimately, both mechanisms may be acting together to govern mrna levels. in addition, with the recognition of subgenomic-mrna replication (hoffman, et al., ; sawicki and sawicki, ; sethna, et al., ; sethna, et al., ) , it is possible that differing efficiencies of subgenomic-mrna replication may also affect mrna levels. all coronaviruses encode at least three structural proteins: s (formerly e ), m (formerly e ), and n (holmes, ; spaan, et al., ; sturman and holmes, ) . the s protein forms the peplomers which project from the surface of virions and are responsible for receptor binding, induction of cellto-cell fusion and fusion of the viral envelope with target cell membranes, induction of neutralizing ab, and induction of cell-mediated immune (cmi) responses. in addition, alterations in the s protein have been shown to affect the virulence ofmhv (dalziel, et al., ) and bcv . the mhv s protein also has fc receptor-like activity (oleszak, et al., ) ; binding of nonspecific ab to cell surface-exposed s proteins may protect the infected cell from virus-specific ab attachment and antibody-dependent cellular cytoxicity (oleszak, et al., ) . coronavirus s proteins are - kda glycoproteins with asparaginelinked (n-linked) oligosaccharide attachment. they contain an n-terminal signal sequence, a large domain exterior to the virus envelope, a transmembrane domain, and a c-terminal hydrophilic tail interior to the virus envelope . each peplomer consists of molecules of s protein arranged in a coiled-coil structure (de groot, et al., a; de groot, et al., b) . the sequence of each s polypeptide can be divided into two regions, s and $ . s is the n-terminal portion and $ is the region between s and the transmembrane domain . studies of fipv have confirmed that its s protein is also n-linked glycosylated (olsen, et al., c; vennema, et al., b) , structurally similar to the generalized coronavirus s protein (de groot, et al., c) , and responsible for mediating cell-to-cell fusion and neutralizing ab induction (de groot, et al., ) . there has been substantial interest in the extent to which s /$ proteolytic cleavage occurs among coronaviruses. results appear to depend upon the virus in question as well as the cell type involved (frana, et al., ; . the s proteins of ibv and bcv appear to be cleaved consistently (binns, et al., ; cavanaugh, et al., ) . cleavage of the mhv s proteins varies among different mhv strains and the s proteins of fipv, ccv, and tgev were not thought to be cleaved at all . however, a trypsin-sensitive cleavage site has recently been demonstrated in the s protein of fipv and fecv (baines, ) . cleavage at this site did not occur during normal processing of the virus in cell culture and cleavage with exogenous trypsin did not increase virus infectivity for a or crandell feline kidney cells (crfkc). cleavage did, however, increase the ability of attenuated strains of fipv to infect feline macrophages (baines, ) . a latent cleavage site may also exist in the tgev s protein (rasschaert and laude, ) . the degree of amino acid sequence homology among the s proteins of various coronaviruses differs for the s and $ portions of the polypeptides. a comparison between fipv, mhv, and ibv revealed - % homology in $ , but little homology in s (degroot, et al., b) . within the fipv antigenic group of viruses, however, there is much greater homology throughout the s protein. a significant degree of antigenic homology has been noted among the s proteins of tgev, porcine respiratory coronavirus (prcv), fipv, fecv, and ccv (sanchez, et al., ) . comparison of the s gene sequences of tgev and fipv has revealed % homology over the first amino acids and % homology for residues - (jacobs, et al., ) . extensive efforts have gone into mapping the dominant antigenic sites on the s proteins oftgev correa, et al., ; delmas, et al., ; garwas, et al., ; gebauer, et al., ; laviada, et al., ; posthumus, et al., ) , bcv (yoo, et al., ) , ibv (koch, et al., ; kusters, et al., ) , mhv (makino, et al., ; routledge, et al., ; stuhler, et al., ; takese-yoden, et al., ) , and fipv olsen, et al., a) . in all cases, multiple neutralizing domains have been delineated, with immunodominant domains generally located in the s portion of the protein. neutralization domains have, however, been identified in $ as well (koch, et al., ; kusters, et al., ; makino, et al., ; posthumus, et al., ; routledge, et al., ) . on the fipv s protein, a number of epitopes have been defined which appear to mediate both virus neutralization and antibody-dependent enhancement (ade) of fipv infectivity olsen, et al, a; olsen, et al., b) . coronavirus s proteins are co-translationally glycosylated, with the majority of s protein incorporated into budding virions and a smaller portion transported to the plasma membrane (sturman and holmes, ) . s protein which was incorporated into virions was transported substantially faster than recombinant-expressed s protein (degroot, et al., ; vennema, et al., b) , suggesting the existence of a retention signal in the cytoplasmic tail of s (vennema, et al., b) . a second study, however, would appear to refute the presence of such a retention signal since c-terminally-truncated s protein expressed by a recombinant vaccinia virus was completely retained in the endoplasmic reticulum (er) of infected cells (pulford and britton, ) . trimerization of the tgev s protein has been shown to occur primarily at a stage when the carbohydrate moieties are only partially trimmed, with terminal glycosylation occurring mainly on trimeric s protein (delmas and luade, ). in addition, oligomerization appears to be the rate-limiting step in transport oftgev s protein from the er to the golgi body (delmas and luade, ) . antigenic sites on the tgev s protein may be structurally dependent upon or independent of trimerization . however, the majority of antigenic sites on both the s and m proteins of tgev appear to require at least core-glycosylation (delmas and laude, ). this appears not to be the case for the s protein of fipv (olsen et al., c ) , despite the high degree of antigenic homology between the s proteins of fipv and tgev (jacobs, et al., ) . the m or membrane proteins of coronaviruses are smaller surface glycoproteins, approximately - kda in size . as opposed to the substantial external portion of coronavirus s proteins, only about % of the n-terminal portion of the m proteins protrudes from the viral envelope . the form of glycosylation (n-linked or o-linked) and the presence or absence of a signal peptide on the m protein varies among different coronaviruses . the m proteins oftgev (pulford and britton, ) , ibv (lai, ) , and fipv and fecv (baines, ) are n-linked glycoproteins, whereas glycosylation of the m protein of mhv is o-linked (lai, ) . for those coronaviruses lacking an n-terminal signal sequence on the m protein, one of the three alpha helices which span the developing virus membrane may function as a signal sequence . the first membrane spanning domain may also be responsible for targetting m proteins to the golgi (machamer, et al., ) . m protein is necessary for virus maturation and its insertion into golgi membranes determines, via interaction with the n protein, the sites of virus assembly and budding (holmes, ; lai, ; spaan, et al., ) . though the s proteins have traditionally been associated with the induction of protective immune responses to coronaviruses, mab to the m protein of mhv has been shown to protect mice against acute encephalitis (fleming, et al., ) . in addition, a recombinant vaccinia virus expressing the m protein of fipv - induced protection against challenge with virulent fipv for of vaccinated cats (vennema, et al., ) . the third structural protein common to all coronaviruses is the n protein. the n proteins are highly basic proteins of - kda which are phosphorylated on serine residues ). like many viral nucleocapsid proteins, the coronavirus n proteins encase the genomic rna and play an integral part in formation of the helical nucleocapsids ). in addition, n protein appears to be critical for viral transcription. in vitro studies have demonstrated that antibody to n protein inhibited transcription of mhv . subsequent studies confirmed a specific interaction of n protein with mhv leader rna at bases to (from the ' end of the leader) and ruled out direct binding of n protein to negative-sense rna in ris stohlman, et al., ) . these authors suggested that n protein may be an integral part of the transcription complex, possibly functioning to open secondary structure constraints known to occur at the region of n binding, targeting the transcription complex of protein and leader rna during the discontinuous transcription process, or serving to prevent rna-rna base pairing after transcription. a sequence comparison of the n genes from strains of mhv has demonstrated that each n protein contains highly homologous domains separated by more variable "spacer regions". the central domain appears to be responsible for rna binding ( parker and masters, ). the level of n protein may also act as the switch between transcription/mrna synthesis and replication/genomic rna synthesis for coronaviruses (lai, ) . involvement of n proteins in the transcription of helical rna viruses is by no means limited to coronaviruses. n protein functions similarly during the transcription and replication of rhabdoviruses (banerjee, ) . a fourth structural protein, he, is present in certain strains of mhv as well as bcv and hcv- c . it is a glycoprotein of approximately kda which functionally exists as a dimer (hogue, et al., ; spaan, et al., ) . this protein from bcv has been shown to have hemagglutinating activity and to be a "receptor-destroying enzyme with acetylesterase activity" (hogue, et al., ; spaan, et al., ; storz, et al., ; vlasak, et al., ) . recent work, however, indicates that the s protein of bcv is actually a more efficient hemagglutinin than the he protein (schultze, et al., ) . no such he protein has been identified for fipv. completion of the coronavirus replication cycle requires encapsidation of viral rna and release of virions from infected cells. recent studies with mhv have demonstrated a -nucleotide encapsidation sequence at the ' end of orf-lb (makino, et al., ; van der most, et al., ) . this location would explain the fact that only genomic-length mhv rna is packaged (van der most, et al., ) . however, bcv (hoffman, et al., ) and tgev (sethna, et al., ) subgenomic rnas are also packaged, suggesting that this encapsidation sequence site may not be consistent among all coronaviruses. subsequent to passage through the golgi, mature virions may be released from post-golgi vesicles by either fusion with the plasma membrane or cell lysis (holmes, ) . coronaviruses produce a broad range of disease manifestations in their respective hosts (mclntosh, ; wege, et al., ) . many coronaviruses induce diseases limited to a single organ system. for instance, tcv, bcv, ccv, recv, fecv, and tgev produce primarily enteric disease while ibv, rcv, and the hcvs are mainly respiratory tract pathogens. a respiratory coronavirus has also been identified recently in swine. it was initially sought out because of a high incidence of tgev ab in populations of pigs without evidence of tgev-related enteric disease (pensaert, et al., ; van nieuwstadt and pol, ) . experimentally, the severity of clinical disease associated with porcine respiratory coronavirus (prcv) infection has varied from mild (o'toole, et al., ) to fatal (van nieuwstadt and pol, ) and may depend upon the strain and dose of prcv and the age of piglets at challenge. though prcv primarily infects epithelial cells and macrophages in the respiratory tract, it is also capable of limited replication in the gastrointestinal tract (cox, et al., a; cox, et al., b; o'toole, et al., ) . like fipv and fecv, tgev and prcv are very similar antigenically across the s, m, and n proteins, though mab analysis of their s proteins appears to offer a method for differentiating these two viruses (callebaut, et al., ; callebaut, et al., ) . genetic comparisons of prcv and tgev have revealed deletions in the prcv s gene and the first ns gene downstream of s (page, et al., ; rasschaert, et al., ; wesley, et al., ) . interestingly, analysis of a small plaque variant of tgev also revealed alterations in the ns genes downstream of s (wesley, et al., ) . this variant virus also exhibited a different cell tropism within the small intestine. as previously noted, the fecv genome also appears to be deleted in comparison to fipv. as opposed to these coronaviruses which induce disease of primarily a single organ system, disease manifestations of mhv and fipv infections involve a variety of organs (wege, et al., ) . in mhv infections, the exact nature of the disease produced (hepatic, neurologic, or enteric) depends upon the strain of virus and the route and dose of inoculation, as well as host factors such as age and genetic make-up (levy, et al., ; wege, et al., ) . the pathogenicity of mhv- for different strains of mice has also been correlated with the ability of the virus to either replicate in or lyse macrophages or lymphocytes or mediate t cell-induced expression of a procoagulant monokine (chung, et al., ; lamontagne, et al., a; lamontagne, et al., b; lamontagne and jolicoeur, ; levy and abecassis, ) . similar correlations between host resistance to virus infection in vivo and intrinsic resistance (morahan, et al., ) ofmacrophages to infection in vitro have been documented for several other virus families (mogensen, ) . as will be seen, the nature of fip is also multifactorial with regard to virus strain, host parameters, and virus-immune cell interactions. fipv is only one of the coronaviruses which can infect cats. most notably, a distinction must be drawn between fipv and fecv (pedersen, a; pedersen, et al., b; pedersen, et al., ; stoddart and gaskell, ; tupper, et al., ) . fecv infections are generally inapparent or induce only mild enteritis, though more severe enteric disease has been seen in young, specific-pathogen-free (spf) kittens (pedersen, a; pedersen, et al., b) . clinical signs may include a low-grade fever, mucoid diarrhea, sometimes with hematochezia, occasional vomiting, anorexia, and lethargy. a transient leukopenia may accompany the onset of diarrhea. fecv targets the epithelium of the small intestine. histologically, villous atrophy may develop (most prominently in the jejunum and ileum) in severe cases. serum antibodies appear - days after infection (pedersen, a) . fecvs must also be differentiated from "coronavirus-like particles" (cvlps). cvlps have been detected in the feces of a variety of species of animals, both with and without diarrhea. these include rodents, dogs, cats, pigs, cows, poultry species, man, and non-human primates (hoshino and scott, ) . cvlps detected in the feces of clinically normal cats were morphologically similar to cvlps from other species (hoshino and scott, ) . cvlps can be distinguished from enteric coronaviruses based upon the ultrastructural characteristics of their surface projections. coronavirus peplomers are typically petal-shaped with a short stalk whereas the projections from the surface of cvlps are spherical or teardrop-shaped and attached via a long stalk (hoshino and scott, ) . (based upon this distinction, one report (dea, et al., ) of feline cvlps may have been describing a true enteric coronavirus.) the role of cvlps as pathogenic agents or their identity as viruses is yet to be conclusively determined (mcintosh, ) . it is vitally important to realize that there are multiple strains of both fipv and fecv which vary substantially in pathogenicity (fiscus, et al., ; fiscus and teramoto, b; pedersen and floyd, ; stoddart, ; stoddart and scott, ). among fipv strains, for instance, ucd is relatively avirulent, ucd and are intermediate in virulence, and ucd and - are extremely virulent (pedersen and floyd, ) . feline coronaviruses have also been separated into two groups based upon reactivity with s protein-specific mabs. group i viruses are typified by fipv strains ucd and and nw , while group ii consistently includes - , df /nor , and fecv (fiscus and teramoto, a; fiscus and teramoto, b; hohdatsu, et al., lb) . the classification of fipv strains ucd l and and tn /black varies between studies. this type of antigenic classification may also reflect biological characteristics such as rate of internalization and cellto-cell spread (fiscus and teramoto, b) . certain strains of feline coronaviruses (e.g., the yayoi strain) can apparently produce both enteritis with diarrhea as well as fatal fip (hayashi, et al., ) . the existence of such intermediate strains and the antigenic similarity among fipv and fecv isolates may indicate that all feline coronaviruses are simply different biotypes of a single prototypical virus (scott, ). it has even been suggested that that fipv strains are directly derived from fecvs by mutation or recombination in the gastrointestinal tract of an infected cat (evermann, et al., ; pedersen, et al., b) . finally, cats can also be infected with heterologous coronaviruses from other species. cats which were infected experimentally with tgev shed the virus in their feces and mounted homologous and heterologous humoral immune responses (reynolds and garwes, ) . conversely, pigs infected orally with virulent fipv demonstrated clinical signs, histologic lesions, and coronaviral antigen localization typical of tgev infection (woods, et al., ) . cats infected with ccv remained clinically normal and demonstrated homologous as well as heterologous humoral immune responses, but virus was not detectable in their stools (barlough, et al., ) . infection of cats with hcv- e resulted in only an homologous antibody response, with "little or no replication of the virus in inoculated animals" (barlough, et al., ) . given this potential for cross-species infection and the close antigenic relationship between fipv, fecv, tgev, and ccv pedersen, et al., ; sanchez, et al., ) , all of these viruses may be host-range mutants of one another . the clinical characteristics of fip in domestic cats have been well outlined (barlough and scott, ; hoskins, ; pedersen, b; pedersen and floyd, ; scott, ; stoddart and gaskell, ) . although a cat of any age may be affected, disease occurs most often in cats from months to years of age, with the majority of cases occurring in cats ~< year of age (addie and jarrett, ; scott, ) . it has been suggested that the incidence of fip is greater among purebred cats (pedersen, b ) , though it is unclear whether this reflects an actual genetic predisposition to infection or only increased fipv exposure and transmission in cattery situations (scott, ) . although the attack rate for fip is greater in catteries and multi-cat households, it is still a disease which usually occurs only sporadically (pedersen, b) . transmission of fipv is thought to occur via ingestion or inhalation subsequent to cat-to-cat contact. fipv is shed from infected cats in their feces and oronasal secretions. virus shedding has only been documented to occur for - days after experimental infection. thus, most cats are probably not shedding the virus at the time of clinical illness (scott, ; stoddart, et al., a,b,c) . there have been reports of transplacental transmission and reproductive tract disease manifestations (scott, ) , but this route of transmission and form of disease are yet to be conclusively proven experimentally. anecdotal reports, however, indicate that queens, both seropositive and possibly seronegative, may repeatedly give birth to kittens which develop fip over the first few months of life (scott, ) . survival of fipv in the environment has traditionally been assumed to be quite limited, given the enveloped nature of coronaviruses. a recent report, however, suggests that after drying onto a surface, infectious virus may persist for up to weeks (scott, ) . nonetheless, fipv is readily inactivated by commonly used disinfectants (scott, ) . the incubation period for fip varies greatly. it may be as short as two weeks or clinical disease may not be evident for months to years following infection (scott, ) . the existence of an fipv latent carrier state remains an assumption, but is supported by such circumstantial evidence as the prolonged incubation periods and the apparent activation of clinical disease upon subsequent infection with felv (pedersen, b) or corticosteroid treatment (pedersen and floyd, ) . in addition, a recent study of multicat households in the uk also supports the existence of asymptomatic cartier cats, their importance in fipv transmission, and the potential for fipv shedding subsequent to the first days after infection (addie and jarrett, ). there are two major forms of fip, the effusive or "wet" form and the noneffusive or "dry" form. in addition, there may be a combination of these forms with multiple granulomas but only limited, localized fluid accumulation. in the effusive form of the disease, fibrin-rich fluid accumulates in the peritoneal, pleural, pericardial, and/or renal subcapsular spaces. the specific signs exhibited by each cat depend upon the site of the effusion. the abdominal enlargement seen with peritoneal fluid accumulation is generally nonpainful. dyspnea may accompany significant pleural effusion and signs ofcor pulmonale may accompany pericardial effusion. renal subcapsular fluid accumulation is sometimes palpable upon physical examination. regardless of the site(s) of fluid extravasation, there are certain general signs which are typically present in all cases: anorexia, weight loss, listlessness, dehydration, and fever. the fever may fluctuate over a diurnal or longer pattern. other specific signs may occur with extension of the inflammatory process in the peritoneum to specific organs, e.g., jaundice with hepatic involvement. likewise, exocrine or endocrine pancreatic insufficiency may become evident with pancreatic involvement, but this is rare. signs associated with noneffusive fip are more unpredictable because of the more discrete nature of organ involvement by the pyogranulomatous lesions. fever, however, is particularly consistent with this form of fip and may be the only initially-evident clinical sign. consequently, fip should be a prominent rule-out for cats which present with a fever-of-unknown-origin. central nervous system (cns) and ocular involvement are more common with the non-effusive form of fip. cns signs may reflect spinal cord involvement with upper-motor neuron paresis and ataxia, or cerebral or cerebellomedullary lesions with ataxia, nystagamus, behavioral changes, or seizures. signs of ocular disease may accompany other manifestations of fip or may be the only clinically apparent evidence of fip. most commonly the uveal tract is involved, resulting in iritis, uveitis, or chorioretinitis. retinal hemorrhage and detachment or panophthalmitis may also occur. the course of disease tends to be different for the various forms of fip. cats with effusive disease generally progress along a more fulminant course, with death in weeks to several months. young kittens tend to survive for the shortest periods of time. the noneffusive form of the disease may wax and wane over a period of many months, particularly in cases with only ocular involvement. our understanding of the pathogenesis of fip is still incomplete and evolving. it is clear that exposure to fipv does not consistently correlate with the development of clinical disease (pedersen, b) . other disease determinants may include the strain of fipv involved (pedersen and floyd, ) , the dose and route of infection (pedersen, et al., la) , nonspecific stress factors, and the age (stoddart and gaskell, ) , immune status/felv status (pedersen, b ) , and genetic makeup of the cat (pedersen, b ) . support for the role of genetic factors comes from the possible increased incidence of fip in purebred cats and from the nature of fip in cheetahs. fipv has been documented to cause clinical disease in a variety of exotic felid species including cheetahs, sand cats, caracals, lynx, cougars, jaguars, leopards, pallas cats, and lions (barlough and scott, ; pedersen, b) . cheetahs, however, appear to be exceptionally sensitive to fipv infection. fipv infection in a captive breeding colony of cheetahs in oregon in produced a "disease storm" with high morbidity and mortality. investigations of this epizootic (evermann, et al., ; o'brien, et al., ) demonstrated that cheetahs are genetically homogeneous at their major histocompatability (mhc) loci. it has been hypothesized that because of a lack of mhc variability, cheetahs may be deficient in their ability to present fipv antigen and mount protective immune responses (o'brien, et al., ) . the recent characterization of the domestic cat mhc (winkler, et al., ) should allow further investigation into the possible genetic basis for any increased incidence of fip in purebred domestic cats. following oronasal infection, fipv first replicates in pharyngeal, respiratory (hayashi, et al., b; scott, ) , or intestinal epithelial cells (pedersen, b) . a primarily cell-associated viremia subsequently occurs in which monocytes are the predominant cell type infected (weiss and scott, l b) . monocytes likely serve to distribute fipv to target organs throughout the body. the virus localizes in macrophages in the reticuloendothelial organs and perivascularly in many organs (weiss and scott, c) . the histologic lesions of fip are characterized as necrotizing pyogranulomas with phlebitis and thrombosis (weiss and scott, c) . one of the most perplexing aspects of the pathogenesis of fip is the frequent occurrence of accelerated, more fulminant disease upon fipv challenge of seropositive as compared with seronegative cats. accelerated fip was first documented when it was shown that the onset of clinical disease among experimentally infected kittens correlated with the appearance of serum antibodies (pedersen and boyle, ) . confirmation of these results came with the demonstration that the onset of viremia, clinical signs, thrombocytopenia, lymphopenia, and the appearance of viral antigen and necrotizing lesions in affected tissues all occurred earlier in seropositive kittens than in seronegative kittens (weiss and scott, l b; weiss and scott, l c) . survival times were also significantly shorter for seropositive kittens (pedersen and boyle, ; weiss and scott, lb) . in addition, seronegative kittens given immune serum (pedersen and boyle, ; weiss and scott, a) or anti-fipv igg (pedersen and boyle, ) before challenge developed clinical disease in the same manner and over the same time course as seropositive kittens. jacobse-geels and colleagues (jacobse-geels, et al., ; demonstrated immune complex and complement (c') deposition in fip. both host proteins as well as fipv proteins have been demonstrated in the immune complexes purified from sera and ascites fluid of cats with fip (horzinek, et al., ) , though the potential significance of an autoimmune component in the pathogenesis of fip is yet to be evaluated. with activation of c', other inflamatory mediator cascades as well as the blood coagulation cascade may be initiated. subclinical disseminated intravascular coagulation (dic) has been demonstrated during experimental fip (weiss, et al., ) . other inflamatory mediators which have been implicated in the pathogenesis of fip include ill (goitsuka, et al., ) , il (goitsuka, et al., ) , and leukotriene b and prostaglandin e (weiss and vaughn, ) . the demonstration of immune complex deposition in fip initially seemed to explain both the pathologic changes of fip and the phenomenon of accelerated fip. however, a new consideration has been introduced with the demonstration of antibody-dependent enhancement (ade) of fipv infection of macrophages in vitro hohdatsu, et al., a; olsen, et al., b olsen, et al., , stoddart, ). antibody-dependent enhancement of virus infection occurs when monocytes or macrophages are more efficiently infected by complexes of virus plus ab, via receptor-mediated endocytosis, than by virus alone (porterfield, ) . since ade of virus infection in vitro was first documented in (hawkes, ) , it has been demonstrated for a wide range of viruses. a partial list includes flaviviruses such as west nile virus and murray valley encephalitis virus (cardosa, et al., ; pieris and porterfield, ) , alphaviruses such as semliki forest virus, sindbis virus, and western equine encephalitis virus (chanas, et al., ; pieris and porterfield, ) , bunyaviruses (lewis, et al., ; pieris and porterfield, ) , human respiratory syncytial virus (hrsv) (gimenez, et al., ; krilov, et al., ) , influenza a virus (ochiai, et al., ; ; ) , ldhv (inada and mims, ) , rabies virus (king, et al., ) , murine cytomegalovirus , reoviruses (burstin, et al., ) , and arenaviruses (lewis, et al., ) . however, the most informative work regarding ade of virus infection has come from studies of dengue virus (dv), human immunodeficiency virus (hiv), and most recently fipv (see below). despite all of the descriptions of ade of virus infectivity, numerous questions remain regarding the actual basis of the enhancement. for instance, which receptors mediate ade of virus infectivity? traditionally the process has been attributed to fc receptors (fcrs) for igg, both fcri and fcrii (littaua, et al., ; porterfield, ) . work with hiv and simian immunodeficiency virus (siv) has, however, demonstrated enhancement of virus infectivity via fcrs alone (homsy, et al., ; takeda, et al., ) ; via c' receptors (crs) and cd in the presence of both c' and ab (c'-ade) (montefiori, et al., a,b; robinson, et al., a robinson, et al., , b or in the presence of c' alone (robinson, et al., b) ; via fcr and cd (connor, et al., ; takeda, et al., ) ; and, in the presence of soluble cd (allan, et al., ; werner, et al., ) or synthetic peptides to hiv (derossi, et al., ) in the absence of serum and c'. crs have been implicated in ade of flaviviruses as well (cardosa, et al., ) . to date, reports of ade of fipv infectivity hohdatsu, et al., a; olsen, et al., b; stoddart, ) have reported only fcr-mediated enhancement in the absence of c'. given the involvement of c' activation in the pathogenesis of fip (jacobse-geels, et al., ; jacobse-geels, et al., ) , the potential for c'-ade of fipv needs to be addressed as well. a second question is what are the specific viral components which mediate ade of infectivity for each virus? mabs have been used to delineate viral proteins and specific epitopes involved in ade ofdv , hiv (robinson, et al., a,b; , and fipv hohdatsu, et al., a; olsen, et al., b) . for fipv, studies olsen, et al., b) indicate that enhancement is strictly mediated by epitopes on the s protein, while a third paper found that m protein-specific mabs could also mediate ade of fipv infectivity (hohdatsu, et al., a ) . an associated fact is that individual epitopes are capable of mediating both virus neutralization (vn) and ade of virus infectivity. this has been clearly shown for dv (halstead, et al., ; morens and halstead, ) and hiv (robinson, et al., ) , as well as for fipv hohdatsu, et al., a; olsen, et al., b) . does the subclass of a given ab determine whether it is able to mediate both neutralization and ade of virus infectivity? results with fipv suggest that igg a mabs can mediate both processes while igg mabs can only mediate vn . a report of ade of hiv infectivity found no dependence upon ig subclass, but since this was a report of c'-ade, the results don't refute the conclusions from the fipv report . work with ade of fipv infectivity has demonstrated a bell-shaped distri-bution of enhancement relative to ab concentration, with maximal enhancement occurring at subneutralizing concentrations of ab (olsen, et al., b) . similar results have been obtained with dv (morens and halstead, ) . mechanistically, how does the binding of enhancing ab to a particular epitope on a virus induce an increase in virus infectivity? it has been suggested that enhancing abs increase the binding of virus to cell surfaces, thereby potentiating a productive interaction between virus and its normal cell surface receptor (connor, et al., ; mady, et al., ; porterfield, ) . in support of this, bispecific abs to dv or hiv and a variety of cell surface molecules in addition to fcrs were found to enhance virus infectivity (connor, et al., ; mady, et al., ) . however, results of an in situ hybridization analysis of ade of fipv infectivity found no difference in the initial uptake of virus by macrophages infected in the presence or absence of enhancing ab . in other virus systems it has also been suggested that enhancing ab may facilitate uncoating (jolly, ; porterfield, ; robinson, et al., a) . the ultimate question is what bearing ade of virus infection, as described in vitro, has upon the pathogenesis of disease in vivo and the development of virus vaccines. this question has fueled an ongoing debate among researchers ofdv (halstead, ; morens and halstead, ; rosen, ) and hiv (bolognesi, ; homsy, et al., ; robinson, et al., b) . there is a substantial body of epidemiological information to suggest that ade of dv infection of macrophages underlies the development of a more severe form of dengue called dengue hemorrhagic fever or dengue shock syndrome. experimental data has, however, been largely restricted to measurements of viremia levels or clinical pathology parameters in nonhuman primates (halstead, ; halstead, et al., ; ). an attempt has been made to correlate the presence of enhancing abs in the serum of hiv-infected patients to the progression of aquired immunodeficiency syndrome. however, the in vitro enhancement levels demonstrated were fairly low and the number of patients was limited (homsy, et al., ) . with hrsv, ab may not only function to enhance infectivity, but also to enhance leukotriene production in infected cells (ananaba and anderson, ) . recent results of fipv candidate vaccine testing seem to provide the strongest support to date for a direct relationship between enhanced infectivity in vitro and enhanced disease in vivo. inoculation of cats with a recombinant vaccinia virus expressing the s protein of fipv - sensitized the cats and led to accelerated disease after fipv challenge (vennema, et al., a) . inoculation with recombinant vaccinia viruses expressing the m or n proteins of fipv - did not predispose the cats to accelerated disease (vennema, et al., ) . (these results in vivo also support the in vitro-defined localization of enhancing epitopes to the s protein of fipv olsen, et al., b) ). in addition, recent experiments among groups of cats used to study the efficacy of a candidate fip vaccine demonstrated a statistically significant association (under certain challenge conditions) between the ability of a cat's serum to mediate enhancement of fipv infectivity in vitro and the development of accelerated fip in vivo . it is very difficult to make a definitive diagnosis of fip. biopsy and subsequent histopathologic examination is the only absolutely conclusive method for antemortem diagnosis (barlough and scott, ). short of this, a variety of factors must be taken together to support a diagnosis of fip (barlough and scott, ; pedersen, b; scott, ; stoddart and gaskell, ; sparkes, et al., ) . clinicopathologically, patients may demonstrate any of the following, depending upon the particular organ system affected: elevated serum liver enzyme and bilirubin levels, elevated serum urea nitrogen and creatinine levels, elevated fibrinogen levels, decreased packed cell volumes, neutrophilia, lymphopenia, or proteinuria. analysis of blood protein levels may be very helpful. while albumin levels may be normal or decreased, globulin levels are often increased. serum protein electrophoresis commonly demonstrates a polyclonal gammopathy. in cases of effusive fip, analysis of fluid obtained by abdomino-or thoracocentesis may be helpful. the fluid is generally yellow (though there may be various degrees of blood-tinging) and viscous with visible strands of fibrin. fluid analysis should reveal a high specific gravity and elevated protein level, with variable numbers of inflammatory cells. the fluid may clot upon standing. cerebrospinal fluid may reveal elevated protein levels and increased cellularity when fip affects the cns. the ability to utilize serologic testing in the diagnosis of fipv infection and clinical fip is limited. an early serologic study revealed that % of a local general cat population and % of cats in fip "problem catteries" were seropositive, but very few of the cats developed clinical disease (pedersen, b) . these results suggested that there was a mild primary form of the disease (pedersen, b) and that more severe, classical fip was an uncommon secondary sequela (pedersen, b) . subsequent to the discovery of the antigenically-related fecvs, it has been suggested that the vast majority of seropositive test results may indicate exposure to fecvs rather than fipvs (pedersen, b) . at this point, "the presence of serum coronavirus antibody in any cat, whether healthy or diseased, is indicative only of prior exposure to a coronavirus in the fipv antigenic group" (barlough and scott, ) , and has "little predicitive or diagnostic value" (scott, ) . in addition, not all cats with fip will have elevated coronavirus ab titers. in a recent study, of cats with fip had coronavirus titers of ~< , and of the cats tested negative for coronavirus ab (sparkes, et al., ) . early attempts to serologically discriminate between cats infected with fipv versus fecv were uniformly unsuccessful (ingersoll and wylie, a,b) . however, mabs which distinguish fipv - and fecv have recently been identified hohdatsu, et al., c) . such mabs may provide the basis for a competitive enzyme-linked immunosorbent assay to differentiate between a cat's exposure to fipv and fecv (fiscus and teramato, a) . one final complication in feline coronavirus serologic testing is that cats may produce ab directed against bovine serum components, possibly as a result of their presence in routine vaccine preparations (barlough and scott, ) . these abs can produce false positive coronavirus titers if bovine serum is also used to propagate the target viruses used for coronavirus ab testing. such cross-reacting abs decrease over a period of - months after vaccination (barlough and scott, ). treatment of cats suffering from fip is largely symptomatic, e.g. fluid replacement and nutritional support. due to the immunologic nature of the disease, immunosuppressive doses of corticosteroids ( - mg of prednisolone per kg per day) are often prescribed, along with broad spectrum antibiotics (barlough and scott, ) . less commonly, immunosuppressive drugs such as cyclophosphamide or melphalan are used (barlough and scott, ) . ribavirin, human recombinant alpha interferon (rhulfna), and feline fibroblastic beta ifn have been shown to inhibit fipv replication in vitro (weiss and oostrom-ram, ; weiss and toivio-kinnucan, ) . in vivo, high-dose therapy with rhulfna + an immunomodulating drug derived from propionibacterium acnes was successful in suppressing clinical signs of disease and prolonging survival times in cats, but was unable to significantly protect against fatal disease (weiss, et al., ) . with the potentially long and unpredictable incubation period for fip, the difficulty inherent in identifying cats which are shedding the virus and distinguishing fipv from fecv serologic responses, and the survivability of fipv in the environment, it is not surprising that feline coronaviruses have been notoriously difficult to control in multicat environments. it is becoming increasingly clear that controlling contact between kittens and adult carrier cats may be the critical factor in controlling enzootic fip in catteries. addie and jarret have shown that isolation of kittens and their queen from the rest of the cattery population reduced seroconversion among the kittens, and that isolation of kittens from their queens as well (from to weeks of age ) completely eliminated seroconversion among the kittens (addie and jarrett, jarrett, , . however, the role of queens is more complicated. a special form of immunity may be conferred by infected queens to their offspring. pedersen and floyd demonstrated that kittens born to fipv-infected queens could resist challenge with virulent fipv. they suggested that "natural" transmission of fipv from queens to kittens at an early age may provide a form of premunition immunity (pedersen and floyd, ) . given the immune-mediated pathogenesis of fip, what is the basis for protective immunity to fipv infection? clearly, humoral immunity is not protective (pedersen, b) . some form of immunity would seem to exist, however, since there are reports (though rare) of spontaneous remissions, and the rate of seropositivity in cats far exceeds the incidence of clinical disease (pedersen, b) . it has been suggested that cmi responses may be important in immunity (pedersen and floyd, ; scott, ). weiss and cox evaluated delayed-type hypersensitivity (dth) skin reactions to fipv antigen in cats. they initially found a strong dth response in an fip-resistant cat, but only "minimal" response in a susceptible cat (weiss and cox, ) . subsequent work with more subjects documented similar results; after lethal challenge with fipv, of cats with positive dth responses to fipv antigen had increased survival times compared to dth ( -) cats (weiss and cox, ) . further support for the importance of cmi responses to fipv resistance comes from work in nude mice. following intracerebral challenge with fipv, mortality rates were significantly higher for homozygous (nu/nu) than heterozygous (nu/+ ) nude mice (takenouchi, et al., ) . more severe intestinal lesions have also been noted after fipv challenge in thymectomized kittens as opposed to normal kittens (hayashi, et al., a) . however, cmi responses may also contribute to the granulomatous lesions seen in noneffusive fip when cmi responses are only partially protective (pedersen, b; weiss and cox, ) . considering the lack of understanding as to what constitutes protective immunity to fipv infection and the problem of ade of infection and disease, the development of a safe and effective vaccine against fipv has been very problematic. a variety of approaches has been unsuccessful (olsen and scott, ) including the administration of inactivated fipv (scott, ) , avirulent fipv (fipv ucd , , and ) or sublethal doses of virulent fipv (pedersen, ; pedersen and black, ) , heterologous (ccv, hcv- e, tgev) live virus vaccines (barlough, et al., (barlough, et al., , woods and pedersen, ) , and a recombinant vaccinia virus expressing fipv s protein (vennema, et al., a) . most recently, a temperature-sensitive mutant of fipv df has been developed as an fipv vaccine (christianson, et al., ) . this vaccine strain was derived after passages of parental fipv df in cell culture (passages - at ° c ) followed by ultraviolet irradiation. intranasal vaccination of cats induces strong mucosal iga and lymphocyte blastogenesis responses (gerber, ; gerber, et al., ) . the vaccine's safety has been demonstrated after parenteral administration, administration to corticosteroid-and felv-immunosuppressed cats, and administration to cats previously exposed to fecv (gerber, ; gerber, et al., ) . the mean vaccine efficacy (calculated by the author from published data as preventable fraction) for experimental challenge studies conducted by the manufacturer (gerber, ) was %. however, independent testing of this vaccine which has just been completed partially refutes these initially reported (gerber, ) efficacy and safety results. the data presented by scott et al. indicate that the ability of the vaccine to protect cats against experimental challenge is dependent upon the strain and particularly the dose of challenge virus. low dose exposure ( tcidso) resulted in protection of >t % of vaccinated cats, while higher dose exposure ( >/ tcidso) resulted in virtually no protection and even induced accelerated fip in many cases. to date, accelerated fip has not been reported under field conditions. however, field studies conducted by the manufacturer in multicat facilities also failed to demonstrate a significant difference in the incidence of fip or kitten mortality between vaccinated and unvaccinated cats (fanton, ) . summary coronaviruses are now seen as representative of a larger rna virus superfamily whose viruses employ a unique and interesting replication scheme. in addition, traditional antigenically-defined boundaries within the coronaviridae are falling and the emerging relationships between prcv and tgev and fipv and fecv should provide for a fruitful area of viral pathogenesis research. while our knowledge of the molecular biology of feline coronaviruses is limited compared to that of mhv and ibv, the cloning and characterization of the fipv s, m, n, and ' orfs has provided very useful information. the recent characterization of the mhv receptor should provide an impetus for the identification of an fipv receptor. development of the ts df vaccine also represents a significant achievement. but while this vaccine has provided encouragement for the control of fipv infections, there are still questions concerning its safety under experimental conditions and its efficacy under field conditions. in this regard, the immunopathogenesis of fip has become even more complex with recent advances in our understanding of ade of fipv infectivity. the identification of discrete epitopes which mediate ade may allow for the development of a recombinant-engineered fipv vaccine from which enhancing epitopes have been deleted. in addition, the work of vennema and colleagues ( ) with a recombinant vaccinia virus expressing the m protein of fipv deserves further consideration. as regards the treatment of fip, weiss and colleagues' work ( - ) with specific antiviral drugs will hopefully be expanded, perhaps evaluating the combination of ribavirin and interferon in vivo. in addition, addle and jarrett's ( , ) data regarding control of enzootic fip in catteries is very encouraging. however, the lack of a diagnostic test which is specific for fipv exposure remains as a significant hurdle to the routine control of fipv infections. control of feline coronavirus infection in kittens a study of naturally occurring feline coronavirus infection in kittens enhancement of siv infection with soluble receptor molecules antibody enhancment of respiratory syncytial virus stimulation of leukotriene production by a macrophagelike cell line identification of a domain required for autoproteolyic cleavage of murine coronavirus gene a polyprotein transcription and replication of rhabdoviruses random nature of coronavirus rna recombination in the absence of selection pressure a clustering of rna recombination sites adjacent to a hypervariable region of the peplomer gene of murine coronavirus interactions between coronavirus nucleocapsid protein and viral rnas: implications for viral transcription feline infectious peritonitis experimental inoculation of cats with human coronavirus e and subsequent challenge with feline infectious peritonitis virus experimental inoculation of cats with canine coronavirus and subsequent challenge with feline infectious peritonitis virus an enveloped virus in the stools of children and adults with gastroenteritis that resembles breda virus of calves cloning and sequencing of the gene encoding the spike protein of the coronavirus ibv do antibodies enhance the infection of cells by hiv? completion of the sequence of the genome of the coronavirus avian infectious bronchitis virus further characterization of mouse hepatitis virus rna-dependent rna polymerases an efficient ribosomal frame-shifting signal in the polymerase-encoding region of the coronavirus ibv characterization of an efficient ribosomal frameshifting signal: requirement for an rna pseudoknot infection of a macrophage-like cell line, p d , with reovirus; effects of immune ascitic fluids and monoclonal antibodies on neutralization and on enhancement of viral growth antigenic differentiation between transmissible gastroenteritis virus of swine and a related porcine respiratory coronavirus a competitive inhibition elisa for the differentiation of serum antibodies from pigs infected with transmissible gastroenteritis virus (tgev) or with the tgev-related porcine respiratory coronavirus interaction of west nile virus with primary murine macrophages: role of cell activation and receptors for antibody and complement complement receptor mediates enhanced flavivirus replication in macrophages coronavirus ibv: partial amino terminal sequencing of spike polyprotein $ identifies the sequence arg-arg-phe-arg-arg at the cleavage site of the spike precursor polyprotein of ibv strains beaudette and m monoclonal antibodies to sindbis virus glycoprotein e can neutralize, enhance infectivity, and independently inhibit haemagglutination or haemolysis characterization of a temperature sensitive feline infectious peritonitis coronavirus cellular and metabolic requirements for the induction of macrophage procoagulant activity by routine hepatitis virus strain in vitro fc receptors for iggs (fcyrs) on human monocytes and macrophages are not infectivity receptors for human immunodeficiency virus type (hiv- ): studies using bispecific antibodies to target hiv-i to various myeloid cell surface molecules, including the fcyr monoclonal antibody analysis of neutralization and antibody-dependent enhancement of feline infectious peritontis virus localization of antigenic sites of the e glycoprotein of transmissible gastroenteritis coronavirus antigenic structure of the e glycoprotein from transmissible gastroenteritis coronavirus sites of replication of a porcine respiratory coronavirus related to transmissible gastroenteritis virus intestinal replication of a porcine respiratory coronavirus closely related antigenically to the enteric transmissible gastroenteritis virus site-specific alteration of routine hepatitis virus type peplomer glycoprotein e results in reduced neurovirulence coronavirus-like particles in the feces of a cat with diarrhea antigenic and genomic relationships among turkey and bovine enteric coronaviruses sequence analysis of the ' end of the feline coronavirus fipv - genome: comparison with the genome of porcine coronavirus tgev reveals large deletions sequence and structure of the coronavirus peplomer protein evidence for a coiled-coil structure in the spike proteins of coronaviruses cdna cloning and sequence analysis of the gene encoding the peplomer protein of feline infectious peritonitis virus intracellular rnas of the feline infectious peritonitis coronavirus strain - stably expressed fipv peplomer protein induces cell fusion and elicits neutralizing antibodies in mice assembly of coronavirus spike protein into lrimers and its role in epitope expression carbohydrate-induced conformational changes strongly modulate the antigenicity of coronavirus tgev glycoproteins s and m antigenic structure of transmissible gastroenteritis virus, li. domains in the peplomer glycoprotein four major antigenic sites of the coronavirus transmissible gastroenteritis virus are located on the amino-terminal half of the spike protein equine arteritis is not a togavirus but belongs to the coronaviruslike superfamily identification of putative polymerase gene product in cells infected with murine coronavirus a identification of polypeptides encoded in open reading frame lb of the putative polymerase gene of the murine coronavirus mouse hepatitis virus a synthetic peptides from the principal neutralizing domain of human immunodeficiency virus type (hiv- ) enhance hiv- infection through a cd -dependent mechanism experimental infection of young rabbits with a rabbit enteric coronavirus cloning of the mouse hepatitis virus (mhv) receptor: expression in human and hamster cell lines confers susceptibility to mhv an experimental model for myocarditis and congestive heart failure after rabbit coronavirus infection biological and pathological consequences of feline infectious peritonitis virus infection in the cheetah perspectives on the epizootiology of feline enteric coronavirus and the pathogenesis of feline infectious peritonitis field safety studies of an intranasal fipv vaccine antigenic comparison of feline coronavirus isolates: evidence for markedly different peplomer glycoproteins functional differences in the peplomer glycoproteins of feline coronavirus isolates epitope-specific antibody responses to virulent and avirulent feline infectious peritonitis virus isolates monoclonal antibodies to the matrix (el) glycoprotein of mouse hepatitis virus protect mice from encephalitis proteolytic cleavage of the e glycoprotein of murine coronavirus: host-dependent differences in proteolytic cleavage and cell fusion identification of epitopes of immunological importance on the peplomer of porcine transmissible gastroenteritis virus residues involved in the antigenic sites of transmissible gastroenteritis coronavirus s glycoprotein development and evaluation of an intranasal, temperature-sensitive fipv vaccine protection against feline infectious c peritonitis by intranasal inoculation of a temperature-sensitive fipv vaccine in vitro enhancement of respiratory syncytial virus infection ofu cells by human sera release of interleukin from peritoneal cells of cats with feline infectious peritonitis il- activity in feline infectious peritonitis coronavirus genome: prediction of putative functional domains in the nonstructural polyprotein by comparative amino acid sequence analysis in vivo enhancement of dengue virus infection in rhesus monkeys by passively transferred antibody antibody, macrophages, dengue virus infection, shock, and hemorrhage: a pathogenetic cascade studies of the pathogenesis of dengue infection in monkeys. ii. clinical laboratory responses to heterologous infection heterogeneity of infection enhancement of dengue strains by monoclonal antibodies enhancement of infectivity of arboviruses by specific antisera produced in domestic fowls role of thymus-dependent lymphocytes and antibodies in feline infectious peritonitis after oral infection enteritis due to feline infectious peritonitis virus role of circulating antibodies in feline infectious peritonitis after oral infection bovine coronavirus mrna replication continues through persistent infection in cell culture synthesis and processing of the bovine enteric coronavirus haemagglutinin protein a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies characterization of monoclonal antibodies against feline infectious peritonitis virus type ii and antigenic relationship between feline, porcine, and canine coronaviruses antigenic analysis of feline coronaviruses with monoclonal antibodies (mabs): preparation of mabs which discriminate between fipv strain - and fecv strain coronavirus replication some important disorders of the cat serum enhancement of human immunodeficiency virus (hiv) infection correlates with disease in hiv-infected individuals the fc and not cd receptor mediates antibody enhancement of hiv infection in human cells virion polypeptide specificity of immune complexes and antibodies in cats inoculated with feline infectious peritonitis virus antigenic relationships among homologous structural polypeptides of porcine, feline, and canine coronaviruses replication of feline infectious peritonitis virus in organ cultures of feline tissue coronavirus-like particles in the feces of normal cats i. coronavirus infection in cats. compendium on continuing education for the practicing veterinarian ia antigens and fc receptors of mouse peritoneal macrophages as determinants of susceptibility to lactate dehydrogenase virus enhancing antibodies, macrophages and virulence in mouse cytomegalovirus infection comparison of serologic assays for measurement of antibody to coronavirus in cats identification of viral antigens that induce antibody responses on exposure to coronaviruses the nucleotide sequence of the peplomer gene of porcine transmissible gastroenteritis virus (tgev): comparison with the sequence of the peplomer protein of feline infectious peritonits virus (fipv) isolation and characterization of feline c and evidence for the immune complex pathogenesis of feline infectious peritonitis antibody, immune complexes, and complement activity fluctuations in kittens with experimentally induced feline infectious peritonitis modualtion oflentivirus replication by antibodies: fc portion of immunoglobulin molecule is essential for enhancement of binding, internalization, and neutralization of visna virus in macrophages antibody-mediated enhancement of rabies virus infection in a mouse macrophage cell line (p d ) antigenic domains on the peplomer protein of avian infectious bronchitis virus: correlation with biological functions differential premature termination of transcription as a proposed mechanism for the regulation of coronavirus gene expression i. differentiation of acid-ph-dependent and-nondependent entry pathways for mouse hepatitis virus association of diarrhea in cattle with torovirus infections on farms antibody-mediated enhancement of respiratory syncytial virus infection in two monocyte/macrophage cell lines a nested set of eight rnas is formed in macrophages infected with lactate dehydrogenase-elevating virus analysis of an immunodominant region of infectious bronchitis virus coronavirus: organization, replication and expression of genome characterization of leader rna sequences on the virion and mrnas of mouse hepatitis virus, a cytoplasmic rna virus replication of mouse hepatitis virus: negative-stranded rna and replicative form rna are of genome length mouse hepatitis virus -thymic cell interactions correlating with viral pathogenicity host cell resistance to mouse hepatitis virus type is expressed in vitro in macrophages and lymphocytes mouse hepatitis virus replication in t and b lymphocytes correlate with viral pathogenicity expression of swine transmissible gastroenteritis virus envelope antigens on the surface of infected cells: epitopes externally exposed the complete sequence ( kilobases) of murine coronavirus gene encoding the putative proteases and rna polymerase activation of the immune coagulation system by murine hepatitis virus strain the immune response to mouse hepatitis virus: genetic variation in antibody response and disease immune serum increases arenavirus replication in monocytes replication of hemorrhagic fever viruses in monocytic cells human igg fc receptor ii mediates antibodydependent enhancement of dengue virus infection a polycistronic mrna specified by the coronavirns infectious bronchitis virus the e glycoprotein of an avian coronavirus is targeted to the cis golgi complex antibody-dependent enhancement of dengue virus infection mediated by bispecific antibodies against cell surface molecules other than fcy receptors concurrent cryptosporidium and coronavirus infections in an arabian foal with combined immunodeficiency syndrome evolution of the '-end ofgenomic rna ofmurine coronaviruses during passage in vitro high-frequency leader sequence switching during coronavirus defective interfering rna replication rna recombination of coronaviruses: localization of neutralizing epitopes and neuropathogenic determinants on the carboxyl terminus of peplomers high-frequency rna recombination ofmurine coronaviruses leader sequences of murine coronavirus mrnas can be freely reassorted: evidence for the role of free leader rna in transcription analysis of efficiently packaged defective interfering rnas of murine coronavirus: localization of a possible rna-packaging signal coronaviruses genetic aspects of macrophage involvement in natural resistance to virus infections complementmediated, infection-enhancing antibodies in plasma from vaccinated macaques before and after inoculation with live simian immunodeficiency virus antibody-dependent enhancement of simian immunodeficiency virus (siv) infection in vitro by plasma from siv-infected rhesus macaques viruses and the versatile macrophage disease severity-related antigenic differences in dengue strains detected by dengue monoclonal antibodies measurement of antibody-dependent infection enhancment of four dengue virus serotypes by monoclonal and polyclonal antibodies dengue virus monoclonal antibodies identify epitopes that mediate immune infection enhancement of dengue viruses a clinical and microbiological study of cats with protruding nictitating membranes and diarrhoea: isolation of a novel virus genetic basis of the species vulnerability in the cheetah antibody-mediated growth of influenza a nws virus in macrophagelike cell line p d infection enhancement of influenza a h subtype viruses in macrophage-like p d cells by cross-reactive antibodies infection enhancement of influenza a nws virus in primary murine macrophages by anti-hemagglutinin monoclonal antibody mhv s peplomer protein expressed by a recombinant vaccinia virus vector exhibits igg fc-receptor activity feline infectious peritonitis vaccination-past and present identification of antigenic sites mediating antibody-dependent enhancement of feline infectious peritonitis virus infectivity monclonal antibodies to the spike protein of feline infectious peritonitis virus mediate antibody-dependent enhancement of infection of feline macrophages feline infectious peritonitis: isolation ofa coronavirus pathogenicity of experimental infection with "pneumotropic" porcine coronavirus sequence comparison ofther ' end ofmrna from transmissible gastroenteritis virus and porcine respiratory coronavirus sequence comparison of the n genes of five strains of the coronavirus mouse hepatitis virus suggests a three domain structure for the nucleocapsid protein initial events in bovine coronavirus infection: analysis through immunogold probes and lysosomotropic inhibitors morphologic and physical characteristics of feline infectious peritonitis virus and its growth in autochthonus peritoneal cell cultures serologic studies of naturally occurring feline infectious peritonitis feline infectious peritonitis feline infectious peritonitis and feline enteric coronavirus infections. part : feline enteric coronaviruses feline infectious peritonitis and feline enteric coronavirus infections. part : feline infectious peritonitis feline infectious peritonitis attempted immunization of cats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus immunologic phenomena in the effusive form of feline infectious peritonitis experimental studies with three new strains of feline infectious peritonitis virus: fipv-ucd , fipv-ucd , and fipv-ucd . compendium on continuing education for the practicing veterinarian infection studies in kittens, using feline infectious peritonitis virus propagated in cell culture an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis pathogenicity studies of feline coronavirus isolates - and - antigenic relationship of the feline infectious peritonitis virus to coronaviruses of other species isolation of a porcine respiratory, non-enteric coronavirus related to transmissible gastroenteritis antibody-dependent enhancement of plaque formation on cell lines ofmacrophage origin-a sensitive assay for antiviral antibody antibody-dependent enhancement of viral infectivity analysis and simulation of a neutralizing epitope of transmissible gastroenteritis virus expression and cellular localisation of porcine transmissible gastroenteritis virus n and m proteins by recombinant vaccinia viruses intracellular processing of the porcine coronavirus transmissible gastroenteritis virus spike protein expressed by recombinant vaccinia virus the predicted primary structure of the peplomer protein e of the porcine coronavirus transmissible gastroenteritis virus porcine respiratory coronavirus differs from transmissible gastroenteritis virus by a few genomic deletions virus isolation and serum antibody responses after infection of cats with transmissible gastroenteritis virus two immunodominant domains of gp bind antibodies which enhance human immunodeficiency virus type infection in vitro human monoclonal antibodies to the human immunodeficiency virus type (hiv- ) transmembrane glycoprorein gp enhance hiv- infection in vitro antibodies to the primary immunodominant domain of human immunodeficiency virus type (hiv-i) glycoprotein pg enhance hiv- infection in vitro complement-mediated, antibody-dependent enhancement of hiv- infection in vitro is characterized by increased protein and rna syntheses and infectious virus release antibody-dependent enhancement of human immunodeficiency virus type infection will antibody-dependent enhancement of hiv- infection be a problem with aids vaccines complement-mediated antibody-dependent enhancement of hiv- infection requires cd and complement receptors antibody-dependent enhancement of human immunodeficiency virus type (hiv- ) infection in vitro by serum from hiv-l-infected and passively immunized chimpanzees disease exacerbation caused by sequential dengue infections: myth or reality? analysis of murine coronavirus surface glycoprotein functions by using monoclonal antibodies antigenic homology among coronaviruses related to transmissible gastroenteritis virus coronavirus transcription: subgenomic mouse hepatitis virus replicative intermediates function in rna synthesis genetics of mouse hepatitis virus transcription: identification of cistrons which may function in positive and negative strand rna synthesis antibody-mediated infection of macrophages and macrophage-like cell lines with d-yellow fever virus growth of d yellow fever virus in a macrophage-like cell line, u : role of fc and viral receptors in antibody-mediated infection the s protein of bovine coronavirus is a hemagglutinin recognizing -o-acetylated sialic acid as a receptor determinant update on fip feline infectious peritonitis: transmission and epidemiology evaluation of the safety and efficacy of primucell-fip k vaccine minus-strand copies of replicating coronavirus mrnas contain antileaders coronavirus subgenomic minus-strand rnas and the potential for mrna replicons identification of a new transcriptional initiation site and the corresponding functional gene b in the murine coronavirus rna genome comparison of the genome organization of toro-and coronaviruses: evidence for two nonhomologous rna recombination events during berne virus evolution primary structure and post-translational processing of the berne virus peplomer protein a '-coterminal nested set of independently transcribed mrnas is generated during berne virus replication coronaviruses: structure and genome expression feline infectious peritonitis: a review of clinicopathological changes in cases, and a critical assessment of their diagnostic value intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence feline coronavirus infection virus shedding and immune responses in cats inoculated with cell culture-adapted feline infectious peritonitis virus the sites of early viral replication in feline infectious peritonitis cats inoculated with feline infectious peritonitis virus exhibit a biphasic-acute phase plasma protein response specific interaction between coronavirus leader rna and nucleocapsid protein monocional antibodies differentiate between the haemagglutinating and the receptordestroying activities of bovine coronavirus localization of antigenic sites on the surface glycoprotein of mouse hepatitis virus the novel glycoproteins of coronavirus characterization of a coronavirus. it. glycoproteins of the viral envelope: tryptic peptide analysis the molecular biology of coronaviruses conformational change of the coronavirus peplomer glycoprotein at ph . and °c correlates with virus aggregation and virus-induced fusion localization of major neutralizing epitopes on the s polypeptide of the murine coronavirus peplomer glycoprotein two receptors are required for antibody-dependent enhancement of human immunodeficiency virus type infection: cd and fcyr antibody-dependent enhanced infection of hiv- via fc receptor-mediated entry role oft cells in feline infectious peitonitis virus infection of suclding mice antigenic and biological diversity of feline coronaviruses: feline infectious peritonitis and feline enteric coronavirus a domain at the ' end of the polymerase gene is essential for encapsidation of coronavirus defective interfering rnas isolation ofa tge virus-related respiratory coronavirus causing fatal pneumonia in pigs early death after feline infectious peritonitis challange due to recombinant vaccinaia virus immunization primary structure of the membrane and nucleocapsid protein genes of feline infectious peritonitis virus and immunogenicity of recombinant vaccinia viruses in kittens intracellular transport of recombinant coronavirus spike proteins: implications for virus assembly sequence analysis of the turkey enteric coronavirus nucleocapsid and membrane protein genes: a close genomic relationship with bovine coronavirus the e protein of bovine coronavirus is a receptor-destroying enzyme with acetylesterase activity morphogenesis of a virus in cats with experimental feline infectious peritonitis feline infectious peritonitis: experimental evidence for its multiphasic nature the biology and pathogenesis of coronaviruses monoclonal antibodies to the peplomer glycoprotein of coronavirus mouse hepatitis virus identify two subunits and detect a conmformational change in the subunit released under mild alkaline conditions delayed-type hypersensitivity skin responses associated with feline infectious peritonitis in two cats evaluation of immunity to feline infectious peritonitis in cats with cutaneous viral-induced delayed hypersensitivity inhibitory effects of ribavirin alone or combined with human alpha interferon on feline infectious peritonitis virus replication in vitro antibody-mediated enhancement of disease in feline infectious peritonitis: comparison with dengue hemorrhagic fever pathogenesis of feline infectious peritonitis: nature and development ofviremia pathogenesis of feline infectious peritonitis: pathologic changes and immunofluorescence inhibition of feline infectious peritonitis virus replication by recombinant human leukocyte (alpha) interferon and feline fibroblastic (beta) interferon elevated leukotriene b and prostaglandin e plasma levels in cats experimentally infected with feline coronavirus effect of interferon or propionibacterium aches on the course of experimentally induced feline infectious peritonitis in specific-pathogen-free cats and random source cats disseminated intravascular coagulation in experimentally induced feline infectious peritonitis soluble cd enhances simian immunodeficiency virus sivagm infection genetic basis for the pathogenesis of transmissible gastroenteritis virus genetic analysis of porcine respiratory coroanvirus, an attenuated variant of transmissible gastroenteritis virus receptor for mouse hepatitis virus is a member of the carcinoembryonic antigen family of glycoproteins genetic characterization of fla, the cat major histocompatability complex feline infectious peritonitis cross-protection studies between feline infectious peritonitis and porcine transmissible gastroenteritis viruses lesions in the small intestine of newborn pigs inoculated with porcine, feline, and canine coronaviruses structural analysis of the conformational domains involved in neutralization of bovine coronavirus using deletion mutants of the spike glycoprotein s subunit expressed by recombinant baculoviruses comparison of the nucleotide and deduced amino acid sequences of the s genes specified by virulent and avirulent strains of bovine coronaviruses key: cord- - thmsr authors: chang, hui-wen; egberink, herman f.; halpin, rebecca; spiro, david j.; rottier, peter j.m. title: spike protein fusion peptide and feline coronavirus virulence date: - - journal: emerg infect dis doi: . /eid . sha: doc_id: cord_uid: thmsr coronaviruses are well known for their potential to change their host or tissue tropism, resulting in unpredictable new diseases and changes in pathogenicity; severe acute respiratory syndrome and feline coronaviruses, respectively, are the most recognized examples. feline coronaviruses occur as pathotypes: nonvirulent feline enteric coronaviruses (fecvs), which replicate in intestinal epithelium cells, and lethal feline infectious peritonitis viruses (fipvs), which replicate in macrophages. evidence indicates that fipv originates from fecv by mutation, but consistent distinguishing differences have not been established. we sequenced the full genome of viruses of each pathotype and then focused on the single most distinctive site by additionally sequencing hundreds of viruses in that region. as a result, we identified alternative amino acid differences in the putative fusion peptide of the spike protein that together distinguish fipv from fecv in > % of cases. by these and perhaps other mutations, the virus apparently acquires its macrophage tropism and spreads systemically. c oronaviruses (subfamily coronavirinae, order nidovirales) are enveloped, plus-strand rna viruses that infect mammals and birds. they are quite common and cause infections in humans and a wide variety of animals; infection typically results in respiratory or enteric disease. severe acute respiratory syndrome coronavirus (sars-cov), which emerged suddenly in and caused severe acute respiratory disease in humans, is the most notorious coronavirus. sars-cov spread rapidly around the globe, infecting thousands and killing ≈ persons. the virus presumably originated from bats and was transmitted to humans either directly or by using civets or raccoon dogs as intermediate hosts ( , ) . sars-cov best illustrates the remarkable potential for covs to change their tropism. tropism switching has been implicated in the zoonotic emergence of human coronavirus oc from a bovine coronavirus and in turning transmissible gastroenteritis virus, an enteric porcine coronavirus, into porcine respiratory coronavirus, a respiratory pathogen ( , ) . such changes can be accompanied, although not necessarily, by crossspecies transmissions; thus, the erratic occurrence and unpredictable new disease manifestations of tropism switching are a matter of public health concern. the feline coronaviruses (fcovs) present an example of pathogenetic change apparently associated with tropism switching. these viruses occur as pathotypes with an enigmatic, even controversial, relationship: the lowvirulence or nonvirulent feline enteric coronavirus (fecv) and the highly lethal feline infectious peritonitis virus (fipv). fecv and fipv are considered independently circulating viruses by some investigators ( , ) . however, accumulating evidence supports the mutation hypothesis, which proposes that fipv evolves from fecv by mutation in individually infected cats ( ) ( ) ( ) ( ) ( ) ( ) . a responsible mutation(s) has not been identifi ed to back this hypothesis. fecv is ubiquitous and spreads effi ciently by the fecal-oral route; hence, seropositivity among cat populations can reach %, depending on the fi eld conditions ( ) . the infection is restricted to the enteric tract, where the virus replicates in epithelial cells lining the gut mucosa. fecv infection is mild, causing transient enteritis that often passes unnoticed. the infection cannot be cleared effi ciently by the immune system and thus persists, often for weeks or months, sometimes even longer ( ) ( ) ( ) ( ) ( ) . in contrast, fipv is rare, but the consequences of infection are devastating. fipv infection causes a progressive systemic disease called feline infectious peritonitis. the disease affects many organs, usually inducing fatal immunopathologic disease characterized by disseminated pyogranulomas and severe infl ammatory damage to serosal membranes. in the past, sequence differences in several virus genes, including those encoding membrane and spike (s) structural proteins and the so-called group-specifi c proteins c and b, have been implicated in the fcov virulence shift ( ) ( ) ( ) , , ( ) ( ) ( ) ( ) . however, none of these differences appeared to consistently correlate with disease phenotype. to establish a consistent cause for a virulence shift in fcov, specifi cally the predominant serotype i fcov, we sequenced the entire genome of several fecv and fipv specimens and then concentrated on the most conspicuous region of consistent difference by collecting and sequencing additional fecv and fipv samples. fecv strain rm and fecv strain ucd (fecv uu ) were propagated in specifi c pathogen-free cats. fipv uu was obtained from a lymph node of a cat infected with fecv ucd; the presence of feline infectious peritonitis in the cat was pathologically confi rmed. during - , with the assistance of veterinarians in the netherlands, we randomly obtained fi eld cats with suspected feline infectious peritonitis and feces samples from apparently healthy cats from all geographic areas of the netherlands; we did not use any selection criteria, such as age, sex, or breed of cat. cats originated from different catteries and single-and multicat households. cats were pathologically diagnosed with feline infectious peritonitis by postmortem examination at the veterinary pathology department, utrecht university; fi ndings confi rmed that the cats had feline infectious peritonitis. ascites samples and lesions from affected organs were obtained for rna isolation. fecal material from apparently healthy cats was obtained from the rectum by using a cotton swab. we suspended fecal specimens to a fi nal concentration of % (wt/vol) in phosphate-buffered saline by vigorously vortexing the specimens. the supernatant was cleared (centrifugation for min at , × g) and then used for rna extraction. following the manufacturer's protocols, we used the qiaamp viral rna mini kit (qiagen, valencia, ca, usa) to extract viral rna from μl of fecal supernatants or ascites and the qiaamp rneasy mini kit to extract viral rna from mg of organ tissue homogenate. we tested rna isolated from organs or ascites of cats with feline infectious peritonitis and from feces of apparently healthy cats for the presence of fcov rna by using a reverse transcription nested pcr (rt-npcr) targeting the highly conserved × untranslated region ( ) . samples with results positive for fcov were checked for the virus serotype by using an rt-npcr targeting the s gene ( ) . only samples positive for serotype i fcov were included in this study. we determined the sequence in the s gene region of interest by using an rt-npcr. in brief, we synthesized complementary dna by using an antisense primer ( ′-ccctcgagtcccgcagaaaccataccta- ′) and superscript ii reverse transcriptase (promega, madison, wi, usa) at °С for h. we then performed the pcr by using taq dna polymerase (promega) and specifi c primers (sense ′-caatattacaatggcataatgg- ′, antisense ′-cc ctcgagtcccgcagaaaccataccta- ′) for the fi rst reaction and specifi c primers (sense ′-ggcataatg gttttacctggtg- ′, antisense ′-taattaagcct cgcctgcactt- ′) for the second reaction. pcr cycling conditions were cycles at °С for s, at °С for s, and at °С for min plus a -min extension at °С at the end of the reaction. all enzymes were used according to the manufacturer's instructions. primer pairs were expected to generate a -bp product for the fi rst pcr run and a bp product for the second run. representative pcr products were purifi ed by electrophoresis in % agarose gel followed by extraction from the gel by using a gel extraction kit (qiagen) according to the manufacturer's recommended instructions. macrogen inc. (http://dna.macrogen.com/eng/) sequenced the gel-purifi ed dna. two -well plates of degenerate primers (online technical appendix, www.cdc.gov/eid-static/spreadsheets/ - -techapp.xls) were designed from aligned reference genomes by using a computational pcr primer design pipeline. the pipeline was developed at the j. craig venter institute (jcvi) to produce tiled amplicons with an optimal length of bp, with -bp overlap to provide -fold sequence coverage of the genome. an m sequence tag was added to the × end of each degenerate primer and was used for sequencing. primers were arranged in a -well plate format, and all pcrs for each sample were performed in plates. the primers used in this study are listed in the online technical appendix. sequencing reactions were performed by using big dye terminator (applied biosystems, foster city, ca, usa) chemistry. each amplicon was sequenced from both ends by using m primers, and sequencing reactions were analyzed by using a abi sequencer (applied biosystems). raw sequence data were trimmed to remove any primer-derived and low-quality sequence; gene sequences were assembled by using a viral assembly tool (www.jcvi.org/cms/research/software). assemblies were edited computationally and manually. when insuffi cient underlying sequence information was obtained, the sample was entered into the secondary sequencing pipeline and reamplifi ed by using existing primers or primers designed from the problematic sequence assembly itself. the reamplifi ed sample was then sequenced again. an rna virus genome prediction program called vigor (viral genome orf reader, jcvi (www.jcvi. org/vigor) can decode many classes of viruses, taking into account virus-specifi c features, such as alternative splicing, internal open reading frames, and ribosomal slippage. this program was used to annotate de novo assemblies of coronaviruses sequenced at jcvi and also to validate newly assembled genomes during the fi nishing process. last, we performed a quality control assessment and manually inspected the gene predictions before loading them into the annotation database at jcvi, from which they were exported in formats acceptable to the national center for biotechnology information. the full-length and partial fcov genomic nucleotide sequences we obtained were deposited in the national center for biotechnology information database (www.ncbi. nlm.nih.gov). the sequence accession numbers of the fulllength fcov sequences used in this study are listed in table . the genbank accession numbers for the partial s gene sequences are jq -jq . multiple-sequence alignments were constructed by using clustal w (www.ebi. ac.uk/clustalw) with the lasergene megalign (dnastar, www.dnastar.com/t-sub-products-lasergene-megalign. aspx) and mega (www.megasoftware.net) software programs. to identify key differences between fipv and fecv, we analyzed their genomes and proteomes; for each nucleotide or amino acid position, we determined the rate at which fipvs differed from all fecvs at that position. phylogenetic analysis was performed by using features of the mega suite of programs. phylogenetic trees of these sequences were obtained by using the neighbor-joining method. the bootstrap consensus tree, inferred from , replicates, was prepared; positions containing gaps and missing data were eliminated from the dataset. to identify the distinguishing difference(s) between the fcov pathotypes, we initiated a full genome sequencing program of fecvs found in the feces of apparently healthy cats and of fipvs found in organs or ascites of cats with pathologically confi rmed feline infectious peritonitis. to obtain a more extensive analysis of the coronavirus genome, this sequencing program is still ongoing; however, after the sequences of genomes of each pathotype were completed, we performed a comparative fecv-fipv analysis, screening the genomes for nucleotide differences (table ) . this was done by counting, for every nucleotide position, the number of fipv genomes for which the identity at that position differed from that in all fecv genomes. our results showed that differences were scattered along the entire genome (figure nucleotide identity differed the most at position : it was highly conserved ( % a) in all fecv genomes, and it was c or t in of the fipv genomes. this difference occurs in the s gene and results in an amino acid difference in the predicted s protein. thus, although all fecv s proteins have a methionine at position , a leucine is encoded in the fipvs, irrespective of the identity of the genetic difference (c or t). to further investigate the single most prominent region of difference between fecvs and fipvs, we established an rt-npcr method to amplify and analyze the genomic region covering nucleotides - for the fi rst pcr run and nucleotides - for the second run, which includes deviant position . altogether, fecv and fipv rnas isolated from different cats were sequenced in this specifi c region. results for the entirely sequenced fecvs and fipvs are shown in figure . the a at nucleotide was % conserved in all fecvs in our collection. of the fipvs, ( . %) had a t and ( . %) a c at this position; in both cases, this changes the methionine occurring at position in the fecv s protein into a leucine in fipv (i.e., mutation m l). assuming that the difference observed in of the sequenced fipvs may be responsible for the virulent phenotype, the remaining viruses should be expected to carry alternative differences. in search of those differences, we performed a phylogenetic analysis of the partial nucleotide sequences accumulated by the rt-npcr procedure, but the results did not enable further differentiation (data not shown). when carrying out a phylogenetic analysis of the translated partial amino acid sequences, we observed a small but distinct second cluster b in addition to the major cluster a constituted by the fipvs having leucine at position in their s protein (figure ). this smaller cluster, formed by ( . %) of the sequenced fipvs, appeared to be characterized by the occurrence of an alanine at position (i.e., mutation s a), just residues downstream of the m that is changed in most fipvs. all other fipvs and all sequenced fecvs consistently had a serine at this position. the difference is brought about in all cases by a t→g change at nucleotide . overall, we have detected characteristic differences with fecv for ( . %) of the sequenced fipvs. these differences were observed in both pathologic forms (i.e., wet and dry forms) of feline infectious peritonitis (table ). our fi ndings show differences in alternative codons of the fcov s gene that correlate with the feline infectious peritonitis disease phenotype in > % of cases. besides providing a realistic basis for diagnostic discrimination of the fcov pathotypes, our fi ndings also support the dq ) was used as the reference for nt numbering. *highest difference score: fipvs had identities at nt position that differed from those at the same position in all fecvs. a, gene a; b, gene b; s, spike protein gene; abc, gene cluster abc; e, envelope protein gene; m, membrane protein gene; n, nucleocapsid protein gene; ab, gene cluster ab. figure . alignment of partial nucleotide sequences and translated amino acid sequences in the spike protein of strains each of feline coronavirus pathotypes: fipvs (lethal) and fecvs (nonvirulent). the viruses were sequenced in a study to distinguish virulent from nonvirulent feline coronaviruses (see table ). fipv strain c je (genbank accession no. dq ) was used as the reference for numbering. sequence positions are shown along the top; virus strains are shown on the right. specifi c differences between the pathotypes are boxed. fipvs, feline infectious peritonitis viruses; fecvs, feline enteric coronaviruses. mutation hypothesis. thus, we propose that alternative mutations in the s protein of fecv give rise to a tropism change that allows the virus to escape from the intestine into body tissues, where it causes feline infectious peritonitis. proof of this hypothesis will require introduction of these mutations into the fecv genome and demonstration of the virulence switch by infection of cats. however, this is a formidable challenge in the absence of a reverse genetics system and a proper cell culture system to generate and propagate these viruses. our fi ndings relating the s protein to fcov pathogenicity are not surprising, given earlier explorations into the involvement of various genes ( a, b, m, and c) ( ) ( ) ( ) , , ( ) ( ) ( ) ( ) , ) . one of the most notable consequences of the presumed mutation in fecv is the acquisition of monocyte/macrophage tropism by the resulting virus ( ) . thus, whereas replication of fecv is restricted to the epithelial cells lining the gut, the virulence mutation enables fipv to effi ciently infect and replicate in macrophages and spread the infection systemically ( ) . such tropism change corresponds most logically with a modifi cation in the s protein. an earlier study, using serotype ii fcovs, indicated a virulence role for the s protein ( ) ; however, identifi cation of the mutation(s) was not pursued because of the controversial nature of the fecv strain used in the study ( ) . as for the serotype ii viruses, the putative virulence mutations detected in the serotype i fcov spike occur in the membrane-proximal domain of the protein. in coronaviruses, the s protein functions in cell entry; it is responsible for receptor attachment and membrane fusion. while the receptor binding site is located in the n terminal part of the protein, fusion is mediated by its membraneproximal part. coronavirus s proteins are class i fusion proteins, which typically contain domains instrumental for this process: heptad repeat regions and a fusion peptide ( ) . the fusion peptide is located just upstream of the membrane-distal heptad repeat region, but it remains to be proven that it functions as a fusion peptide. the putative virulence mutations identifi ed in our study, m l and s a, map to this characteristic hydrophobic domain. both changes are subtle and do not give clues as to their functional consequences. we assume, however, that these alternative mutations have a similar effect, and we speculate that the mutations in the remaining % of cases might also occur in the fusion peptide of the s protein. if these mutations are all that is needed to convert a nonvirulent fecv into a lethal fipv, the question arises as to why feline infectious peritonitis occurs so infrequently. for example, simple calculations based on a − frequency and a stochastic occurrence of rna polymerase errors across the genome ( ) predict that the m l mutation, for which alternative substitutions of a (to t or g) occur, would statistically arise once in every . × genomes produced. in experimental fecv infection of kittens, we showed that up to genome equivalents of the virus are shed per microliter of feces ( ) ; thus, typical fecv infections would be expected to generate thousands of progeny carrying of the critical mutations. however, the virulence phenotype supposedly associated with the mutation is not observed to any proportional extent. we can only speculate as to the reasons. one likely possibility is that additional mutations ( or more, perhaps alternative mutations) are required to generate the virulent pathotype. such mutations would most probably involve the accessory gene c, which is intact in fecvs but severely affected in about two thirds of fipvs ( , ( ) ( ) ( ) . the c protein apparently is figure . phylogenetic tree based on partial amino acid sequences (aa - ) of the spike proteins of feline infectious peritonitis viruses (fipvs) and feline enteric coronaviruses (fecvs) obtained by using reverse transcription nested pcr and sequencing of the distinguishing genomic region. a circular rooted neighbor-joining tree was constructed by using the bootstrap method and applying , replicates. black dots indicate fipvs. clade a comprises fipvs containing the m l mutation; clade b comprises fipvs containing the s a mutation. essential for replication of fecv in the gut but becomes nonessential once virulence mutation(s) elsewhere in the genome (e.g., in the s gene) enable the virus to infect macrophages and spread systemically. as we suggested earlier, loss of c function may not only be tolerated, it may even enhance the fi tness of the mutant virus in its new biotope and, as a consequence, hamper its return to the gut. if the mutant virus is absent in the gut, it will not be shed in feces, providing an explanation for the seemingly rare incidence of feline infectious peritonitis outbreaks. our discoveries of the critical differences between fecvs and fipvs are clearly only a small step toward understanding the pathogenetic phenomena of feline coronavirus infections. coronaviruses post-sars: update on replication and pathogenesis coronavirus pathogenesis porcine respiratory coronavirus: molecular features and virus-host interactions sequence comparison of porcine respiratory coronavirus isolates reveals heterogeneity in the s, , and - genes genetics and pathogenesis of feline infectious peritonitis virus genetic determinants of pathogenesis by feline infectious peritonitis virus feline infectious peritonitis: insights into feline coronavirus pathobiogenesis and epidemiology based on genetic analysis of the viral c gene sequence analysis of feline coronaviruses and the circulating virulent/avirulent theory two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses signifi cance of coronavirus mutants in diseased tissues of cats suffering from feline infectious peritonitis feline infectious peritonitis: role of the feline coronavirus c gene in intestinal tropism and pathogenicity based upon isolates from resident and adopted shelter cats common virus infections in cats, before and after being placed in shelters, with emphasis on feline enteric coronavirus pathogenesis of feline enteric coronavirus infection a review of feline infectious peritonitis virus infection: - sites of feline coronavirus persistence in healthy cats persistence and evolution of feline coronavirus in a closed cat-breeding colony pathogenic characteristics of persistent feline enteric coronavirus infection in cats alazawy a. diagnostic methods for feline coronavirus: a review the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein mutation of neutralizing/antibody-dependent enhancing epitope on spike protein and b gene of feline infectious peritonitis virus: infl uences of viral replication in monocytes/macrophages and virulence in cats detection of feline coronavirus rna in feces, tissues, and body fl uids of naturally infected cats by reverse transcriptase pcr persistence and transmission of natural type i feline coronavirus infection the paradox of feline coronavirus pathogenesis: a review intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence the coronavirus spike protein is a class i virus fusion protein: structural and functional characterization of the fusion core complex map locations of mouse hepatitis virus temperaturesensitive mutants: confi rmation of variable rates of recombination we thank niels pedersen for providing fecv strain rm and fecv strain ucd.this project was funded in part by the national institute of allergy and infectious diseases, national institutes of health, department of health and human services (contract no. hhsn c).dr chang is a veterinary postdoctoral researcher in the virology division, department of infectious diseases and immunology, veterinary faculty, utrecht university, the netherlands. her research interests include viral pathogenesis and veterinary virology, pathology, and immunology. key: cord- - t yuq v authors: takano, tomomi; katoh, yasuichiroh; doki, tomoyoshi; hohdatsu, tsutomu title: effect of chloroquine on feline infectious peritonitis virus infection in vitro and in vivo date: - - journal: antiviral res doi: . /j.antiviral. . . sha: doc_id: cord_uid: t yuq v feline infectious peritonitis (fip) is a feline coronavirus-induced fatal disease in domestic and wild cats. several studies have investigated potential treatments for fip. however, there have been no reports on agents that have exhibited a therapeutic effect. recently, chloroquine has been reported to antiviral effect. we investigated whether chloroquine can be used to treat fip in vitro and in vivo. it was demonstrated that chloroquine has inhibitory effect against the replication of fipv and anti-inflammatory effect in vitro. in vivo study using cats with experimentally induced fip, the clinical score of chloroquine-treatment groups were better than in chloroquine-untreated group. however, alanine aminotransferase levels increased in the chloroquine-treated groups. it will be necessary to further investigate the possibility of fip treatment with a combination of chloroquine and other agents. coronaviruses cause diseases of the respiratory, digestive, and nervous systems in mammals and birds. after severe acute respiratory syndrome coronavirus (sars-cov) was newly identified as a pathogen of fatal respiratory disease in (ksiazek et al., ) , new coronavirus species have been isolated from various animals including humans. recently, it has been suggested that coronavirus may be transmitted from animals to humans (müller et al., ) . feline infectious peritonitis virus (fip virus: fipv), a feline coronavirus (fcov) of the family coronaviridae, causes a fatal disease called fip in wild and domestic cat species. cats that developed fip were affected in several organs, including the liver, lungs, spleen, and central nervous system, forming lesions accompanied by necrosis and pyogenic granulomatous inflammation (pedersen, ) . in some cats, pleural effusion and ascitic fluid accumulated. monocytes and macrophages (monocytes/macrophages) play an important role in the pathogenesis of fip. it has been reported that virus replication in monocytes/macrophages induced interleukin (il)- b, il- , and tumor necrosis factor (tnf)-a production (regan et al., ; takano et al., b takano et al., , . fipv replication and cytokine production are enhanced when monocytes/macrophages are inoculated with fipv in the presence of anti-fipv s antibodies (antibody-dependent enhancement: ade) (hohdatsu et al., ; corapi et al., ; olsen et al., ) . the phenomenon of ade is involved in the aggravation of the pathology of fip (pedersen and boyle, ; takano et al., b) . over the past forty years, several studies have investigated potential treatments for fip (hartmann and ritz, ) . antiviral, immunostimulating, and immunosuppressive drugs have been experimentally used for the treatment of fip, but none of these have exhibited a sufficient therapeutic effect. several agents that significantly inhibit fcov replication in vitro have been identified (balzarini et al., ; barlough and shacklett, ; hsieh et al., ; kim et al., ; takano et al., ) ; however, whether or not these agents exhibit a therapeutic effect in cats with fip has not been investigated. the anti-malarial drug, chloroquine, has been reported to inhibit the replication of human immunodeficiency virus (hiv), influenza a/h n virus, sars-cov, and human coronavirus e (kono et al., ; murray et al., ; savarino et al., ; vincent et al., ; yan et al., ) . chloroquine also has been used to treat immune-mediated inflammatory disorders (karres et al., ; landewé et al., ; lesiak et al., ) . fip is a viral infection that causes an immune-mediated inflammatory disease. on the basis of these findings, chloroquine may be effective as a therapeutic drug for fip. we investigated whether or not chloroquine inhibited fipv replication in vitro and the fipv-induced ade activity of monocytes. furthermore, we investigated the effect of chloroquine for cats with experimentally induced fip. felis catus whole fetus- (fcwf- ) cells were grown in eagles' minimum essential medium containing % l- medium, % fetal calf serum (fcs), and antibiotics. feline monocytes were cultured in rpmi medium containing % fcs and antibiotics. strain fipv - was grown in fcwf- cells. strain fipv - was supplied by dr. m.c. horzinek (utrecht university). mab - - (igg a) used in the present study recognizes the spike (s) protein of type ii fipv, as demonstrated by immunoblotting. it has been reported that mab - - exhibits a neutralizing activity in fcwf- cells, and an enhancing activity in feline monocytes/macrophages depending on the reaction conditions (hohdatsu et al., ) . feline monocytes were isolated from specific pathogen-free (spf) cats as previously described by dewerchin et al. ( ) . confluent fcwf- cell monolayers were cultured in medium containing chloroquine (wako, japan) in -well multi-plates at °c for h. after washing, fipv strain - (  tcid ) was added to the culture and adsorbed to the cells at °c for h in the presence of chloroquine. after washing, cells were cultured in medium containing chloroquine, and culture supernatants were collected after day. the experiment using feline monocytes from spf cats was performed as follows: feline monocytes (  cells) were cultured in this medium in -well multiplates at °c for h. after washing, fipv strain - (  tcid ) reacted with or without mab - - was added to the culture and adsorbed to the cells at °c for h in the presence of chloroquine. after washing, cells were cultured in medium containing chloroquine, and culture supernatants and cells were collected after days. as the virus titer in the culture supernatant, tcid was calculated by the method of reed-muench. cells were used to measure il- b, tnf-a, and il- mrna, and fcov n genes. to evaluate the cytotoxic effects of chloroquine in feline cells, cell viability was measured by the wst- assay as described before (takano et al., b) . the percent viability was calculated using the following formula: cell viability (%) = (od of chloroquine-treated cells/od of chloroquine-untreated cells)  . fipv strain - (  tcid ) was added to the culture and adsorbed to the fcwf- cells at °c for h. after washing, cells were cultured in medium containing chloroquine, and culture supernatants were collected after day. the experiment using feline monocytes from spf cats was performed as follows: fipv strain - (  tcid ) reacted with or without mab - - was added to the culture and adsorbed to the feline monocytes at °c for h. after washing, cells were cultured in medium containing chloroquine, and culture supernatants and cells were collected after days. the experiment using feline monocytes from cats with fip (fip cats) was performed as follows: feline monocytes were cultured in medium containing chloroquine, and culture supernatants and cells were collected after days. as the virus titer in the culture supernatant, tcid was calculated. cells were used to measure cytokine mrna, and fcov n genes. rna isolation and cdna preparation were performed employing the method of takano et al. ( a) . . . determination of feline cytokine mrna and fcov n gene expression levels cdna was amplified by pcr using specific primers as shown in table . pcr was performed using the method of takano et al. ( a) . band density was quantified under appropriate uv exposure by video densitometry using image j software (nih, u.s.a.). cytokine mrna and fcov n genes were quantitatively analyzed in terms of the relative density value to the mrna of the housekeeping gene gapdh. nine spf cats were randomly assigned to three experimental groups. in accordance with the experimental schedule indicated in fig. . group a: chloroquine ( mg/kg) was subcutaneously administered every days from days before fipv inoculation. strain fipv - ( tcid /ml) was inoculated orally to cats. group b: hanks' balanced salt solution (hbss) was subcutaneously administered every days from days before fipv inoculation. strain fipv - ( tcid /ml) was inoculated orally to cats. hbss administration was completed days after fipv inoculation, and chloroquine ( mg/kg) was subcutaneously administered every days thereafter instead of hbss. group c: hbss was subcutaneously administered every days from days before fipv inoculation. strain fipv - ( tcid /ml) was inoculated orally to cats. one animal in the group c died unexpectedly before the challenge of fipv, and was excluded from this study. cats were checked daily for clinical signs, and we measured their body temperature and weight. fip diagnoses were confirmed upon postmortem examination, revealing peritoneal and pleural effusions, and pyogranuloma in the major organs. to evaluate the condition of cats, we monitored karnofsky's score. karnofsky's score was calculated in reference to the report by hartmann and kuffer ( ) , ritz et al. ( ) . the protocol for the experiments in the present table the cytotoxic effects of chloroquine in fcwf- cells and monocytes. cell viability was evaluated by wst- assay. chloroquine ( blood ( ml) collected from cats using a syringe coated with edta were used for the collection of samples for blood biochemistry and hematological analyses. a half milliliter of the blood sam-ple was centrifuged ( g) and the supernatant was used as a plasma sample for blood biochemistry. the remainder of blood samples was used for hematological analyses. heparinized blood ( ml) was -fold diluted with phosphate-buffered saline (pbs), and subjected to ficoll-hypaque , followed by inoculation with fipv at °c. after h, the supernatant was removed and cells were then treated with chloroquine at °c in the pre/post treatment and post treatment groups. after day, the virus titer in the fcwf- cell culture supernatant was measured. n = . (b) monocytes were cultured with chloroquine at °c for h in the pre/post treatment group, but not in the post treatment group, followed by inoculation with fipv at °c. after h, the supernatant was removed and cells were then treated with chloroquine at °c in the pre/post treatment and post treatment groups. after day, the virus titer in the feline primary monocyte culture supernatant was measured. n = . ⁄⁄ p < . vs. without chloroquine ( lm), ⁄ p < . vs. without chloroquine ( lm). monocytes were cultured with chloroquine for h in the pre/post treatment group (black bar), but not in the none group (white bar) or post treatment group (gray bar), followed by treatment with a reaction mixture of fipv and anti-fipv-s antibodies (fipv + mab - - ) for h. then, the supernatant was removed and cells were treated with chloroquine at °c in the pre/post treatment and post treatment groups, but not in the none group. after days, the virus titer in the cell culture supernatant (c) or the intracellular fcov n gene level (d) was measured. the fcov n gene was quantitatively analyzed in terms of the relative density value to the mrna of the housekeeping gene gapdh. n = . with chloroquine at °c in the pre/post treatment and post treatment groups, but not in the none group. after days, intracellular il- b, tnf-a, and il- mrna levels were measured. cytokine mrnas were quantitatively analyzed in terms of the relative density value to the mrna of the housekeeping gene gapdh. n = . density gradient centrifugation at g for min. the pbmc layer was collected, washed twice with pbs, and resuspended with growth medium at  cells/ml. . . statistical analysis data from two groups were analyzed by the student's t test, and multiple groups were analyzed by a one-way anova. the effect of chloroquine on fipv infection in fcwf- cells and spf cat-derived monocytes was investigated. the cytotoxic effect by chloroquine in feline cells was showed in table . in fcwf- cells, fipv replication was inhibited in a chloroquine concentration-dependent manner in both pre/post and post treatment groups (fig. a) . similarly, concentration-dependent inhibition of viral replication was noted in feline monocytes treated with chloroquine (fig. b) . however, the antiviral effect of chloroquine was slightly lower in the post treatment group than in the pre/post treatment group. the effect of chloroquine on the antibody-dependent enhancement of fipv infection in monocytes was investigated. the virus titer and intracellular expression level of the fipv n gene were significantly higher in the culture supernatant of monocytes inoculated with a mixture of fipv and mab - - than in monocytes cultured with fipv alone ( fig. a and b) . in monocytes inoculated with a mixture of fipv and mab - - , the virus titer was significantly lower in the post and pre/post treatment groups than in the none group (fig. c) . the intracellular expression level of the fipv n gene was significantly lower in the pre/post treatment group than in the none group (fig. d) . intracellular il- b, tnfa, and il- mrna expression levels were significantly higher in monocytes inoculated with a mixture of fipv and mab - - than in monocytes cultured with medium or fipv alone (fig. a) . in monocytes inoculated with a mixture of fipv and mab - - , il- b, tnf-a and il- mrna expression levels were significantly lower in the pre/post treatment group than in the none group (fig. b) . however, no significant differences in these mrna expression levels were noted between the post treatment and the none groups (fig. b) . the influence of chloroquine on cytokine mrna and fcov n gene expressions was investigated in monocytes from cats with fip. il- b, tnf-a, and il- mrna expression levels were signifi-cantly higher, with an increase in the level of fcov n gene expression, in monocytes from cats with fip than in monocytes from spf cats (fig. a) . these mrna expression levels were significantly lower in monocytes from cats with fip cultured in medium containing lm of chloroquine than in monocytes cultured without chloroquine (fig. b) . however, no significant difference was noted in the level of fcov n gene expression with or without chloroquine. based on the in vitro results, the therapeutic effect of chloroquine was investigated using cats with experimentally induced fip. the experiment was performed following the schedule shown in fig. . the fcov n gene and cytokine mrna were detected and clinical parameters were measured after fipv inoculation until the onset of fip. pbmc was collected and days after fipv inoculation, viral mrna expression level was measured. the viral mrna expression level was measured by semiquantitative rt-pcr. on day , viral mrna expression level was slightly lower in group a than in group b and c. on day , viral mrna expression level was slightly lower in group a and b (chloroquine-treated groups) than in group c. (fig. ) . inflammatory cytokine mrna expression levels in pbmc on day - after fipv inoculation were measured, and the ratios of mrna expression levels to those before inoculation were determined (fig. ) . inflammatory cytokine mrna expression ratios were slightly lower in group a and b (chloroquine-treated groups) than in group c. changes in body temperature after fipv inoculation were measured (table ) . no major change in body temperature was noted in any group. lymphocyte and neutrophil counts in peripheral blood decreased in all cats on day after fipv inoculation (table ), but the level of this reduction was smaller in chloroquine-treated groups than in group c. increases in total protein (tp), alkaline phosphatase (alp), gamma-glutamyl transferase (ggt), and direct bilirubin (d-bil) levels were smaller in group a than in the other groups (table ) . on the other hand, alanine aminotransferase (alt) levels increased in the chloroquine-treated groups. when the clinical condition of the cats in each group was evaluated using the karnofsky score, the score was high in the chloroquine-treated groups ( table ). the mean number of survival days were . , . , and . in groups a, b, and c, respectively. unfortunately, one animal in the group c died before the challenge of fipv, statistical significance was not shown for any of the differences between . . cytokine mrna levels (ratio to the control) il- il- tnf- fig. . il- b, tnf-a, and il- mrna expression levels of pbmc in fipv-infected cats treated with chloroquine. after inoculation with fipv - for - days, pbmcs were collected from cats. intracellular il- b, tnf-a, and il- mrna levels were measured. cytokine mrnas were quantitatively analyzed in terms of the relative density value to the mrna of the housekeeping gene gapdh. data are expressed as a ratio of the control value (at the day of inoculation with fipv). the chloroquine-treatment groups and the group c in the days of survival. it has been reported that chloroquine is useful for the treatment for viral infections (kono et al., ; murray et al., ; savarino et al., ; vincent et al., ; yan et al., ) . however, most of studies were obtained by in vitro experiments; only a few studies have investigated the antiviral effect of chloroquine using experimental animals (pallister et al., ; vigerust and mccullers, ) . we investigated the effect of chloroquine as a therapeutic drug for fip both in vitro and in vivo. fipv was enhanced proliferation in monocytes treated with a reaction mixture of fipv and anti-fipv-s antibodies. in contrast, virus proliferation was inhibited in chloroquine-treated monocytes, i.e., chloroquine inhibited the fipv-induced ade activity of monocytes. in addition, a significant inhibitory effect on fipv gene expression was noted in cells with pre/post treatment. in contrast, no significant inhibitory effect was noted in cells with post treatment, and the treatment of fipv-infected monocytes collected from fip cats with chloroquine did not change fipv n gene expression, suggesting that the treatment of cells already infected with fipv with chloroquine induces no antiviral effect. fipv-infected monocytes/macrophages are major component cells that produce the inflammatory cytokines involved in pathological deterioration (regan et al., ; takano et al., b takano et al., , . in this study, chloroquine significantly inhibited inflammatory cytokine mrna expression levels in fipv-infected monocytes. the mechanism of inhibiting inflammatory cytokine mrna expression by chloroquine is still unclear. weber and levitz ( ) suggested the presence of lysosomotropic and non-lysosomotropic mechanisms in the chloroquine-induced inhibition of tnf-a production. the former inhibits tnf-a release from cells and the latter inhibits tnf-a mrna expression and transcription, which suggests that the significant inhibition of inflammatory cytokine mrna expression levels by chloroquine in fipv-infected monocytes involves the non-lysosomotropic mechanism. however, in a more recent paper by jang et al. ( ) , it was shown that chloroquine does inhibit tnf-a release, but does not change the tnf-a mrna levels or the synthesis of the tnf-a precursor. the reason for this discrepancy is unclear. furthermore, in addition to the lowering of tnf-a mrna expression, the expression of il- b and il- mrna was decreased. jang et al. ( ) reported that the stability of il- b and il- mrna was decreased by chloroquine. in the present study, the same mechanisms might decrease the expression of cytokine mrna. chloroquine is administered orally or intravenously for the treatment of malaria. however, oral or intravenous administration of chloroquine is a burden on veterinarians and/or owners. thus, in the present study, we chose a subcutaneous route. unfortunately, there are no pharmacokinetic data on chloroquine after subcutaneous administration. therefore, we must rely on pharmacokinetic data on chloroquine after intravenous administration examined under similar conditions to our study. aderounmu et al. ( ) reported pharmacokinetic data after a single intravenous dose of mg/kg chloroquine. in our present study, the subcutaneous dose of chloroquine was . - . mg/kg. thus, pharmacokinetic data on chloroquine after subcutaneous administration to cats may be similar to those reported by aderounmu et al. ( ) . we administered chloroquine when there were some clinical symptoms in cats after inoculation with fipv strain - . the timing of administration was established based on the report of de groot-mijnes et al. ( ) and our previous experiments (takano and hohdatsu, unpublished data). therefore, the cq treatment timing in group b was set to days after inoculation with fipv strain - . the clinical score of chloroquine-treatment groups were better than in chloroquine-untreated group, which suggests that chloroquine has therapeutic effect against fip. if chloroquine has antiviral effect against fipv in vivo, this drug may be useful for the treatment of fip. to obtain the antiviral effect, it is necessary to increase the chloroquine dosage. however, as mentioned above, when the chloroquine concentration is increased, a severe side effect may be induced. combining chloroquine with other ''anti-fipv agents'' overcomes this problem. hsieh et al. ( ) succeeded in inhibiting fipv replication in fcwf- cells using the low-cytotoxic antiviral agents. it will be necessary to further investigate the possibility of fip treatment with a combination of chloroquine and other agents. in conclusion, it was demonstrated that chloroquine has inhibitory effect against the replication of fipv and anti-inflammatory effect. it was also noted experimentally that chloroquine may be an effective drug for the treatment of fip. the present experiments only examined whether cq is effective for treating fip. future studies are necessary to collect preclinical data using the pharmacokinetics data of cq reported by aderounmu et al. ( ) and others (aderounmu and fleckenstein, ; gustafsson et al., ; ducharme and farinotti, ) . table sequences of pcr primers for feline gapdh, il- b, tnf-alpha, il- , and fcov n. nucleotide sequence location length ( pharmacokinetics of chloroquine diphosphate in the dog comparison of the pharmacokinetics of chloroquine after single intravenous and intramuscular administration in healthy africans pyridine n-oxide derivatives are inhibitory to the human sars and feline infectious peritonitis coronavirus in cell culture antiviral studies of feline infectious peritonitis virus in vitro monoclonal antibody analysis of neutralization and antibody-dependent enhancement of feline infectious peritonitis virus replication of feline coronaviruses in peripheral blood monocytes treatment of cats with feline infectious peritonitis clinical pharmacokinetics and metabolism of chloroquine. focus on recent advancements natural history of a recurrent feline coronavirus infection and the role of cellular immunity in survival and disease disposition of chloroquine in man after single intravenous and oral doses karnofsky's score modified for cats a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies enhancement and neutralization of feline infectious peritonitis virus infection in feline macrophages by neutralizing monoclonal antibodies recognizing different epitopes synergistic antiviral effect of galanthus nivalis agglutinin and nelfinavir against feline coronavirus chloroquine inhibits production of tnf-alpha, il- beta and il- from lipopolysaccharide-stimulated human monocytes/macrophages by different modes chloroquine inhibits proinflammatory cytokine release into human whole blood potent inhibition of feline coronaviruses with peptidyl compounds targeting coronavirus c-like protease inhibition of human coronavirus e infection in human epithelial lung cells (l ) by chloroquine: involvement of p mapk and erk a novel coronavirus associated with severe acute respiratory syndrome a randomized, double-blind, -week controlled study of low-dose cyclosporine versus chloroquine for early rheumatoid arthritis effect of chloroquine phosphate treatment on serum mmp- and timp- levels in patients with systemic lupus erythematosus human coronavirus emc does not require the sarscoronavirus receptor and maintains broad replicative capability in mammalian cell lines reduction of immune activation with chloroquine therapy during chronic hiv infection monoclonal antibodies to the spike protein of feline infectious peritonitis virus mediate antibody-dependent enhancement of infection of feline macrophages chloroquine administration does not prevent nipah virus infection and disease in ferrets a review of feline infectious peritonitis virus infection: - immunologic phenomena in the effusive form of feline infectious peritonitis activation of p mapk by feline infectious peritonitis virus regulates pro-inflammatory cytokine production in primary blood-derived feline mononuclear cells effect of feline interferon-omega on the survival time and quality of life of cats with feline infectious peritonitis effects of chloroquine on viral infections: an old drug against today's diseases? neutrophil survival factors (tnf-alpha, gm-csf, and g-csf) produced by macrophages in cats infected with feline infectious peritonitis virus contribute to the pathogenesis of granulomatous lesions a ''possible'' involvement of tnf-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis tnf-alpha, produced by feline infectious peritonitis virus (fipv)-induced macrophages, upregulates expression of type ii fipv receptor feline aminopeptidase n in feline macrophages analysis of the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection: aminopeptidase n is not important and a process of acidification of the endosome is necessary chloroquine is a potent inhibitor of sars coronavirus infection and spread chloroquine is effective against influenza a virus in vitro but not in vivo chloroquine interferes with lipopolysaccharideinduced tnf-alpha gene expression by a nonlysosomotropic mechanism anti-malaria drug chloroquine is highly effective in treating avian influenza a h n virus infection in an animal model this work was in part supported by kakenhi (grants-in-aid for young scientists (b), no. ) from the ministry of education, culture, sports, science and technology, and kitasato university research grant for young researchers ( ). key: cord- - bt vh authors: shuid, ahmad naqib; safi, nikoo; haghani, amin; mehrbod, parvaneh; haron, mohd syamsul reza; tan, sheau wei; omar, abdul rahman title: apoptosis transcriptional mechanism of feline infectious peritonitis virus infected cells date: - - journal: apoptosis doi: . /s - - - sha: doc_id: cord_uid: bt vh apoptosis has been postulated to play an important role during feline infectious peritonitis virus (fipv) infection; however, its mechanism is not well characterized. this study is focused on apoptosis and transcriptional profiling of fipv-infected cells following in vitro infection of crfk cells with fipv - wsu. flow cytometry was used to determine mode of cell death in first h post infection (hpi). fipv infected cells underwent early apoptosis at hpi (p < . ) followed by late apoptosis at hpi (p < . ) and necrosis from hpi (p < . ). then, next generation sequencing was performed on hpi and control uninfected cells by illumina analyzer. an aggregate of genes ( down-regulated and up-regulated) from cellular process, molecular functions and possible biological pathways were affected by fipv. genes from apoptosis cluster ( down-regulated and up-regulated) along with increase of apoptosis, p , p mapk, vegf and chemokines/cytokines signaling pathways were probably involved in apoptosis process. six of the de-regulated genes expression (rassf , batf , mageb , pdcd , tnfα and traf ) and tnfα protein concentration were analyzed by rt-qpcr and elisa, respectively, at different time-points. up-regulations of both pro-apoptotic (i.e. pdcd ) and anti-apoptotic (i.e. traf ) were detected from first hpi and continuing to deregulate during apoptosis process in the infected cells. electronic supplementary material: the online version of this article (doi: . /s - - - ) contains supplementary material, which is available to authorized users. feline coronavirus (fcov) is a spherical positive sense single-stranded rna virus that is ubiquitous in wild and domestic felidae family, with more than percent prevalence in cats [ , ] . the genome of this virus is approximately -kb in length with open reading frames (orfs) that encode structural, non-structural and accessory proteins [ ] . this virus has two main prototypes; feline enteric coronavirus (fecv) that usually causes subclinical or mild diarrhea with restricted infection in lower small intestine and colon [ ] and feline infectious peritonitis virus (fipv), which cause a systemic disease with granulomatous serositis with high amount of protein effusion (effusive fip) or necrotizing and inflammatory lesions in variety of organs (non effusive fip) [ ] . probably, fipv is a virulent virus that arose from mutation in some sites like orf c, spike (s) gene, and orf b of fecv, which would change the enterocytes tropism to monocyte/macrophage cells [ ] . these mutations would shift the localized intestinal infection to the severe systemic infectious peritonitis. both these viruses contain two different serotypes based on virus neutralizing antibody reactions and sequencing [ ] . type i fcovs are unique in cats with predominant prevalence in europe and americas [ ] . type ii fcovs with more than % prevalence in electronic supplementary material the online version of this article (doi: . /s - - - ) contains supplementary material, which is available to authorized users. asia is a double recombination of type i fcovs and is closely related canine cov [ , ] . despite over years of research, the mechanism of fipv disease and induced immunity remains ambiguous. severity of fip is correlated with imbalance of b cells and t cells population, where the cell-mediated immunity can properly shift the disease to the dry form whilst, increase of b cells and antibody response can lead to type iii hypersensitivity, antibody-dependent vasculitis and effusive form of the disease [ ] . hence, during fipv infection, depletion of the lymphoid cells plays an important role in the virus pathogenesis [ ] . in addition, infection of macrophages can increase b cells activity and contribute to antibody dependent enhancement (ade) of the symptoms and effusive form of the disease [ ] . since fipv does not infect lymphocytes, it seems that this virus cause the lymphopenia through apoptosis induction. studies have reported that apoptosis of mononuclear cells and particularly cd ? t cells in infected cats is associated with the secretion of tnf-alpha from macrophages [ ] . on the other hand, decreased of tnf-a along with high amount of ifn-c and il- b resulted in the augmentation of these cd ? t-cells in peripheral blood mononuclear cells (pbmcs) of the infected cats [ ] . therefore, apoptosis t cell is probably caused by soluble mediators released from infection to macrophages and/or intestinal epithelial cells [ ] . further studies are required to elucidate the mechanism of apoptosis during fipv infection. the current study is investigating mode of cell death of crandell rees feline kidney (crfk) cells and the transcriptome of the infected cells following infection with fipv wsu - . furthermore, this study focused on understanding the apoptosis process during the infection and genes that may involve in apoptosis induction mechanism of the virus. semi confluent cm tissue culture flasks of crfk cells (atcc Ò no: ccl- tm ) were used for the time point infections. these cells were infected with ml of fipv wsu - (atcc Ò no. vr- tm ) with multiplicity of infection (moi) of . . after h incubation for virus attachment, the infection media was replaced with % fbs mem and incubated at °c with % co depend on different time points of each phase of the study. afterwards, cells were harvested using tryple tm and centrifuged twice in d-pbs at °c for min at rpm. cell pellets were stored at - °c for further usages. the same process was repeated for the control group with the exception of ml sterile d-pbs instead of the virus was used. crfk cells were infected with fipv strain wsu - (atcc Ò no: vr- tm ) (moi of . ) at different time points ( , , , , , , , , , , , , , and h) to determine the mode of cell death during virus infection. fipv-infected crfk cells were incubated with fitc-labeled annexin v and harvested using tryple tm express. detection of early apoptosis, late apoptosis and necrosis was carried out by using flow cytometer (becton-dickinson facscalibur flow cytometer) and the readings for each group of samples (in triplicates) at each time points were then calculated using bd cellquest software (bd bioscience, usa). the analyses were performed using , cells stained with annexin v-fitc/pi. the mean and standard deviation for samples at each time point were calculated and paired t test (two-tailed) was conducted between control and treated cells at . level of significance in different time points using spss statistical software version (spss inc., chicago, il, usa). for sequencing, the samples from control and infected cells that started to undergo significant early apoptosis at hpi was chosen for rna extraction and further analysis. rneasy Ò mini kit (qiagen Ò , usa) was used to extract and purify rna samples following the method recommended by the manufacturer. the quality of the extracted rna was determined by ultrospec pro uv/visible spectrophotometer (ge healthcare, uk), where samples with an absorbance ratio value (a /a ) of . - . were considered for further analysis with agilent Ò bioanalyzer. samples with rna integrity numbers (rin) - and concentrations higher than ng/ll per sample, were sent for next generation sequencing analysis using illumina gaii analyzer. rna sequencing was performed on control and h infected crfk cells with fipv wsu - . filtered raw data was then mapped separately to gtf format annotated whole genome shotgun sequencing of felis catus downloaded from www.ensembl.org (pubmed id ) reference using clc bio genome workbench (gwb) rnaseq function with minimum length fraction of . , maximum mismatches of two and maximum number of hits for a read of ten (clc bio version . . , aarhus, denmark). an aggregate of gb of the sequencing data which included both control and infected samples, was imported into the clc bio gwb (clc bio version . . , aarhus, denmark). the sequences were trimmed for adapter sequences and low quality base. the trimmed raw sequences were subjected to rna-sequence analysis, by mapping them to an annotated feline genome reference sequence accounting for a maximum of two gaps or mismatches in each sequence. the relative transcript levels were considered as output and expressed as reads per kilobase of exon model per million mapped reads (rpkm) [ ] . significant differentially expressed genes were selected via kal's z test on proportional differences and fdr value less than . (fdr \ . ) and fold change [ . . later, the genes were converted into unigene ids format for further functionally annotated analysis in panther database. the resulting list was then converted from ensembl transcript id to entrezgene id using ensembl genes database (felis_catus_ . data sets) at biomart (http://www.ensembl.org). then, gene ontology of pan-ther database was applied for interpretation of biological processes, molecular function, and pathways of genes with significant deregulation level in fipv-infected crfk cells compared to control, (http://www.pantherdb.org) (applied biosystem) [ ] . based on bioinformatics analysis, five deregulated genes of the apoptosis cluster were chosen for further analysis; namely, ras association (ralgds/af- ) domain family member (rassf ), basic leucine zipper transcriptional factor atf-like (batf ), melanoma antigen family b (mageb ), programmed cell death (pdcd ) and tnf receptor-associated factor (traf ). rna samples from crfk cells infected with fipv strain wsu - (atcc Ò no: vr- tm ) (moi of . ) at different time points ( , , , , and hpi) were extracted as described above followed by cdna synthesis (high-capacity cdna reverse transcription kit, applied biosystems Ò ). four ll of each cdna was used to perform real-time qpcr using maxima sybr green qpcr master mix (thermo scientific, usa) and specific primers for each gene (table ) . melting curve analysis was performed to confirm the specificity of the results. in addition, for all these genes, non-template controls (ntc) were run in parallel with the samples. the mean c t values of all genes were normalized with three housekeeping genes (gapdh, actb and gusb) for relative expression analysis. analysis of variance (anova) followed by post hoc tukey hsd was conducted to determine the differences among the time points at . level of significance. previous studies have indicated the involvement of tnfa in inducing apoptosis during fipv infection [ ] , hence, we analysed both the mrna and the intracellular as well as the extracellular protein concentration of tnfa during first h post infection. for each time points ( , , , and hpi), three crfk semi confluent mm flasks were infected with fipv strain wsu - (atcc Ò no: vr- tm ) as described before. afterwards, the cells and supernatant of the flasks were collected at the targeted time points. the expression of tnfa was evaluated by rt-qpcr as described in previous section. for intracellular proteins, the cells were lysed in ll of cytobuster tm protein extraction reagent (novagen, usa) with % protease inhibitor cocktail from protein extraction kit (ab ) (abcam, uk). then, the protein concentrations were evaluated by photospectrometer (eppendorf, germany) and all the concentrations were normalized prior to analysis. for extracellular protein analysis, the supernatants were concentrated for % using a centrifugal vacuum concentrator (eppendorf, germany) prior to analysis. subsequently, the protein concentrations were analysed by enzyme linked immunosorbent assay (elisa) kit specific for tnfa detection (catalog no. cata ; r&d systems, usa) according to manufacturer instruction. crfk cells infected with fipv undergo early apoptosis with significant decreased in the number of viable cells at hpi (p \ . ). the number of cells that underwent early apoptosis increased from . ± . cells (p \ . ) at hpi to . ± . cells (p \ . ) at hpi. similar pattern was observed in late apoptotic cells as well, where the number of late apoptotic cells increased significantly at hpi with . ± . cells (p \ . ) and increased further to . ± . cells (p \ . ) at hpi. the number of cells that underwent necrosis started to increase significantly (p \ . ) only at hpi (figs. and ; table ). hence, this study showed that fipv efficiently destroyed infected cells by inducing apoptosis as early as hpi followed by necrosis after hpi. total rna from the control and hpi samples were sequenced using illuminia gaii sequencer. from the raw sequences obtained in a form of gb fastq format data, low-quality reads were filtered out at high stringency which produced . % ( , , ) of control and . % ( , , ) of infected samples of high-quality bp sequence length (data not shown). the distribution of original expression values were found to be positively skewed for both control and infected samples where the median (m) value is higher in control (m = ) compared to the infected sample (m = ) (fig. ) . hence, the original expression values were normalized. the normalized expression values also resulted in positive skewed distribution in both control and infected samples. there were no outliers observed and both the control and infected samples possessed the same median (m = ). the iqr for both samples was and the range for both samples was also ( fig. ) . as a result of normalization, both samples, on average possessed similar expression values and variability. the normalized expression value data were used for subsequent analysis using clc bio genomic workbench for the identification of deregulated genes involved in cell cycle, apoptosis and immune responses. panther's gene analysis revealed that a total of ( down-regulated and up-regulated) with fold table primer sequences of apoptotic related genes and housekeeping genes used for rt-qpcr study primers sequence role in apoptosis basic leucine zipper transcriptional factor atf-like (batf ) -tgaaggagcagccatagc- pro apoptosis ras association domain-containing protein (rassf ) -ctggaggcgtggcgtgtat- pro apoptosis tumor necrosis factor alpha (tnfa) house keeping gene trend of viable cell depletion, early apoptosis, late apoptosis and necrosis of crfk cells infected with fipv change more than (x [ ) and less than - (x \ - ) with fdr . were deregulated at hpi. furthermore, gene ontology (go) analysis based on panther database could analyze of these deregulated genes based on cellular processes, molecular functions and involved pathways. these genes were accounted for cellular processes involved in cellular such as apoptosis, immune system and metabolic processes, whilst based on molecular functions, these genes were related to functions divided into clusters, which mostly related to catalytic and binding activities. tables and show the clusters of the affected genes by fipv at hpi according to different cellular processes and molecular functions, respectively. panther pathway analysis revealed that of these genes belonged to possible cellular pathways, which can be affected by fipv at hpi of the crfk cells. some of the most affected pathways include wnt signaling, inflammation mediated by chemokines and cytokines signaling, integrin signaling and apoptosis signaling pathways. the pathways containing more than deregulated genes are listed in table . among the resulted clusters, genes were classified as apoptosis genes ( down-regulated and up-regulated genes) with absolute fold change more than and fdr . . in addition, genes were detected from the apoptosis-signaling pathway. a total of most significant down and up regulated genes from the apoptosis cluster after fipv infection are shown in tables and . in the apoptosis-signaling pathway, genes were significantly deregulated (fdr . , pfc [ or \- ) ( table ). some of the important effects of fipv on this pathway include activation of tumor necrosis factor ligand and fas mediated apoptosis through up regulation of tnf receptor associated death domain (tradd), fas associated death domain (fadd) and death associated protein (daxx). in addition, several of the anti apoptotic genes like protein kinases genes (prkcd, akt , and prkca) were down regulated. this pathway also showed some anti apoptotic signaling like up regulation of traf and nuclear factor kappa-b (nfkb ) and down regulation of caspase (casp ) genes. five up regulated pro apoptotic genes (rassf , batf , mageb , pdcd , tnfa) and one up regulated anti apoptotic gene (traf ) were selected from apoptotic cluster for further validation via rt-qpcr. in qpcr, the trend of expression changes was investigated in first hpi following infection with fipv. all these genes showed upregulation trend during this period, which is in accord with the transcriptomic study (fig. ) . among the pro apoptotic genes, significant change in expression of batf was detected at hpi and this trend continued during until hpi (fig. ) . it is worth mentioning that batf was the only gene that showed significant up regulation at hpi time point. the expression of all the other genes started to down regulated after hpi (fig. ) . on the other hand, pdcd expression started to increase at hpi with an ascending trend until hpi. afterwards, the expression level decreased gradually until a significant (p \ . ) down regulation compared to the control cells at hpi. another targeted pro apoptotic gene of this study is rassf . this gene did not increased at first hpi. however, after this time point, the expression level commenced to augment gradually and remained up regulated at and hpi. however, the expression of this gene decreased to the normal state at hpi. as opposed to the previous genes, mageb remained normal at first hpi (fig. ) . this gene was the only gene that did not show significant up regulation (p \ . ) during this period. subsequently, the expression of mageb significantly increased at hpi and once more decreased to the normal state at hpi. with regards to gene with anti-apoptotic function, significant increased of traf was detected from the first hour of infection. this level of expression remained high until hpi. subsequently, the expression gradually reduced to the normal state at hpi (fig. ) . relative sd standard deviation, n number of samples expression analysis of these selected genes by rt-qpcr was in accord with results of the ngs fold change analysis. the only gene that did not show significant up regulation at hpi was mageb , which started to increase at hpi. although tnfa did not show significant deregulation at hpi using rna-seq analysis, the number of related affected genes including significant up regulation of fadd, tradd, traf , tumor necrosis factor induced protein and (tnfaip and tnfaip ) show the importance of analysis of this cytokine during apoptosis mechanism of fipv. since specific feline tnfa antibody is not available commercially, the kit for canine tnfa detection, which has high homology to feline, was used during this analysis. both rt-qpcr and elisa analysis showed that tnfa production would be significantly increased during first hpi of fipv. the production of this cytokine started to increase significantly (p \ . ) at hpi compared to negative control. at hpi, although neither mrna expression level and intracellular concentration of tnfa did not show any significant difference with control, the extracellular concentration of this cytokine still showed significant higher concentration compared to uninfected cells; which probably explain the up regulation in other related genes at this time point. at hpi, both intracellular and extracellular tnfa concentration started to drop to the normal state, which was in contrast to expression level of this gene that started to significantly increase at this time point. subsequently, tnfa started to significantly increase in expression and both intracellular and extracellular protein concentration until hpi of fipv (fig. ). studies have showed that fipv can be classified into serotypes, serotype i are difficult to growth in cell culture compared to serotype namely wsu - , etc. [ ] . previous studies have shown that cytopathic effects (cpe) of fipv infected crfk cells can be observed between and h of infection [ , ] . however, the cell death mode of the infected cells is not characterized. in this study, we characterized fipv infected cells based on flow cytometry measurement along with transcriptome analysis of genes that were deregulated in the infected cells. in addition to fipv, crfk cells have been used to study apoptosis of other feline viruses such as feline immunodeficiency virus (fiv) and feline calcivirus (fcv). previous studies have shown that fiv can induce apoptosis in crfk cells through tnf-a signalling, caspase activation and nf-jb pathways [ , ] , whilst, fcv also induce apoptosis of crfk cells via mitochondrial pathways and activation of an executioner caspase like caspase [ ] . hence, crfk cells can be a suitable in vitro model for studying the apoptosis process of fipv infected cells. the mechanism of apoptosis induction in lymphoid tissue of fipv-infected cats remains unclear although lymphocyte depletion and the presence of apoptotic cells were found in the t-cell region of mesenteric lymph nodes and spleen of cats with fip [ , ] . however, since fipv does not replicate in peripheral blood lymphocytes, it is difficult to consider that lymphopenia is due to direct destruction by virus infection of lymphocytes. we hypothesized that fipv infected cells might release mediators that cause the induction of apoptosis of lymphocytes. study has shown that tnf-a released from macrophages of fip cats, induced apoptosis in lymphocytes, particularly cd ? t cells [ ] . transcriptome analysis of fipv infected cells showed that the virus probably increase the inflammation through the chemokine and cytokine signaling pathways, wnt signaling, cadherin signaling, to name but a few (tables , , ). after hpi, this virus could significant deregulate genes, which is much higher than genes at hpi according to a previous study by harun et al. [ ] . in addition, the expression of some of the isg genes (e.g. isg and isg ), pro inflammatory and th -like cytokines (e.g. ccl , cxcl , and ccl ), genes related to innate immune responses (e.g. phf and irf ), and some genes like mx also showed significant up regulation (supplementary table ), confirming the findings from previous study by harun and his colleagues [ ] . the current results also showed that the virus would efficiently induce apoptosis at hpi by increasing the apoptosis signaling pathways and many other factors like p pathway, vascular epithelial growth factor (vegf) signaling, p signaling for over production of cytokines and chemokines/cytokines receptors (table ) . a previous study has indeed indicated that vegf is highly related to pyogranuloma and effusive form of the disease [ ] . the importance of p mitogen-activated kinase (mapk) pathway in cytokines production also has been reported by regan et al. [ ] during fipv infection. a study showed that medium from fipv infected macrophage-derived (fcwf- ) cell line could not induce apoptosis to cultured t cells [ ] proposing that mediators released from virus infection to epithelial cells may cause t cells death and depletion. this can explain the reason of chemokines and cytokines signaling augmentation in parallel with increase of apoptosis during the infection (table ) . furthermore, it has been reported that apoptosis prompt the activation of endogenous endonucleases, which lead to fragmentation of cellular dna [ ] . hence, fipv might use apoptosis as a viral strategy to enhance the spread of progeny to neighboring cells. previous studies have highlighted that the augmentation of tnf-a production by fipv and the possible role of adipokine in apoptosis induction and depletion of cd ? t cells [ ] . the results of this study also revealed that this virus would increase the production of this cytokine during first hpi, which would activate tnf receptor superfamily (tnfr and fas) signaling and cause overexpression of tradd and fadd associated with the activation of these mechanisms after fipv infection (table ) . previous studies have indeed showed that tradd up regulation can heterotrimeric g-protein signaling pathway-gq alpha and go alpha mediated pathway (p ) angiotensin ii-stimulated signaling through g proteins and beta-arrestin (p ) dna replication (p ) p pathway feedback loops (p ) induced tnfr signaling pathways and caused both apoptosis and tnf mediated nf-kb activation [ , ] . fadd protein also contains a death domain that act as a bridge between fas receptors and different procaspases, which form the death-induction signaling complex (disc) during apoptosis [ ] . in addition to fadd, daxx was also unregulated. the c-terminal of this protein can interact with fadd and also activate jun n-terminal kinase (jnk) and apoptosis pathways [ ] . hence, tnf-a play a pivotal role in apoptosis during fipv infection, and according to our results, both mrna and protein levels of this cytokine were significantly increased in the first hpi, which would affect many of aforementioned pathways that induce apoptosis. after investigation of the trend of apoptosis and expression change of selected genes from apoptosis cluster, the tnf receptor-associated factor (traf ) and programmed cell death- (pdcd ) were the only genes that showed significant up regulation from the first hour after infection (fig. ) . hence, the process of apoptosis induction of fipv would be started as early as hpi. however this process could not be detected by flow cytometry until hpi. pdcd is a pro-apoptotic gene that is highly expressed in cells that undergo apoptosis [ ] and may participate in the pathophysiologic course of disease involving abnormal programmed cell death [ ] . previous study also has showed that fipv can up regulate the expression of programmed cell death- (pdcd ), a known pro apoptotic gene after hpi [ ] . on the other hand, an anti-apoptotic gene like traf would be up regulated after hpi. this gene is involved in apoptosis signaling and p pathways, which plays an important role in protecting cells from er stress induced apoptosis [ ] . therefore, these two pathways would be affected from the first hour of infection. it is shown that traf depletion lowers the signal threshold for death receptor-mediated apoptosis [ ] . the delicate balance between pro-and anti-apoptotic molecules during coronavirus (cov) infection enables rapid multiplication of virus before cell lysis [ ] . it has been shown that anti-apoptotic response induced by sars cov infection in infected enterocytes is important to inhibit or delay cell destruction, which results in extending virus production and shedding. the sars cov has a protein named orf a that shows high pro-apoptotic properties through the cell receptors and mitochondrial pathways [ ] . similarly, fipv has a mutant of this protein that named orf c with high expression in the death tissues of the infected cats [ ] . however, the direct involvement of this gene in fipv induced apoptosis of the infected cells has not been studied. after hpi, two other pro apoptotic genes, ras association domain-containing protein- (rassf ) and basic leucine zipper transcriptional factor atf-like (batf ), also showed up regulation. hence, it can be concluded that increase of communalities of pro apoptotic genes at this time point lead to significant augmentation of the number of early apoptosis cells and depletion of the viable cells. rassf is known as a tumor suppressor gene by inducing cell cycle arrest at g( )/s phase of cell cycle progression [ ] . this gene can serve as a novel ras effector [ ] , and enhance apoptosis [ ] . over expression of batf or sari (ap -protein suppressor), another gene of interest of current study, can result in inhibition of dna binding activation protein (ap ), which causes growth inhibition and induced apoptosis particularly in cancerous cells [ ] . hence, ap protein and ifn-b can be another factors involved in fipv apoptosis induction. the results of this study also showed significant (fdr. ) up regulation in ifn a/b receptor and down regulation of ap complex subunit beta- (ap b ), which confirms the mechanism of action of batf in apoptosis induction. down regulation of batf may result in poor prognosis of different types of carcinoma like hepato-cellular and squamous cell carcinoma [ , ] . this gene is also up regulated in some other viral diseases like hepatitis e and hepatitis c [ , ] . table ). all the selected genes showed high up regulations in this time point. melanoma-associated antigen b (mageb ) also started to up regulate at this time point. the mage genes have come under attention of many scientists for gene therapy in cancer and even viral diseases [ , ] . different mage genes play variety of roles in apoptosis and cell activities [ ] . the activation of these genes make them the antigenic targets for immune system [ ] . for instance, co expression of maged and p ntr of the neutrophils will result in enhancement of cellular apoptosis [ ] . hence, mageb can play an important role in late stages of apoptosis and necrosis of the cells during fipv infection. after hpi, batf still showed high up regulation. hence, this gene is an important factor during death stages of the cells. in this time point, all the other selected genes, even an anti apoptotic gene like traf were down regulated. hence, it can be concluded that other mechanisms and pathways are involved in this stage. in conclusion, transcriptome analysis can be a promising approach in understanding the pathogenesis and underlying factors involved in pathogenesis of fcovs or other viruses. this study managed to propose the onset time of early and late apoptosis in fipv infection and also identified the factors and pathways involved during fipv infection. more studies are required to understand the role of these genes from different cellular functions, molecular processes, and biological pathways during fipv pathogenesis. among variety of involved factors, we have underlined the importance of apoptosis during fipv infection. a mrna pcr for the diagnosis of feline infectious peritonitis feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses feline infectious peritonitis: still an enigma? sites of feline coronavirus persistence in healthy cats an update on feline infectious peritonitis: virology and immunopathogenesis a review of feline infectious peritonitis virus infection: - isolation and molecular characterization of type i and type ii feline coronavirus in malaysia prevalence of korean cats with natural feline coronavirus infections immunologic phenomena in the effusive form of feline infectious peritonitis a ''possible'' involvement of tnf-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis whole blood cytokine profiles in cats infected by feline coronavirus and healthy non-fcov infected specific pathogen-free cats mapping and quantifying mammalian transcriptomes by rna-seq panther: a library of protein families and subfamilies indexed by function apoptosis enhanced by soluble factor produced in feline immunodeficiency virus infection clathrin-and caveolae-independent entry of feline infectious peritonitis virus in monocytes depends on dynamin intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence detection of feline coronaviruses in cell cultures and in fresh and fixed feline tissues using polymerase chain reaction tnf-alpha-induced cell death in feline immunodeficiency virus-infected cells is mediated by the caspase cascade the mitochondrial pathway of apoptosis is triggered during feline apoptosis and t-cell depletion during feline infectious peritonitis b-cell activation in cats with feline infectious peritonitis (fip) by fip-virus-induced b-cell differentiation/survival factors transcriptional profiling of feline infectious peritonitis virus infection in crfk cells and in pbmcs from fip diagnosed cats vascular endothelial growth factor (vegf), produced by feline infectious peritonitis (fip) virus-infected monocytes and macrophages, induces vascular permeability and effusion in cats with fip activation of p mapk by feline infectious peritonitis virus regulates pro-inflammatory cytokine production in primary blood-derived feline mononuclear cells tradd-traf and tradd-fadd interactions define two distinct tnf receptor signal transduction pathways the tnf receptor -associated protein tradd signals cell death and nf-jb activation cytotoxicity-dependent apo- (fas/cd )-associated proteins form a death-inducing signaling complex (disc) with the receptor daxx, a novel fas-binding protein that activates jnk and apoptosis nuclear translocation of pdcd (tfar ): an early signal for apoptosis? structurefunction correlation of human programmed cell death protein central role of the scaffold protein tumor necrosis factor receptor-associated factor in regulating endoplasmic reticulum stress-induced apoptosis traf sets a threshold for extrinsic apoptosis by tagging caspase- with a ubiquitin shutoff timer biochemical aspects of coronavirus replication and virus-host interaction the role of severe acute respiratory syndrome (sars)-coronavirus accessory proteins in virus pathogenesis the rassf a tumor suppressor blocks cell cycle progression and inhibits cyclin d accumulation ras uses the novel tumor suppressor rassf as an effector to mediate apoptosis the dark side of ras: regulation of apoptosis cloning and characterization of sari (suppressor of ap- , regulated by ifn) decreased expression of batf is associated with a poor prognosis in hepatocellular carcinoma decreased expression of batf is significantly associated with poor prognosis in oral tongue squamous cell carcinoma chronic hepatitis e virus infection is specifically associated with an interferon-related transcriptional program pathogenesis of hepatitis e virus and hepatitis c virus in chimpanzees: similarities and differences the mage proteins: emerging roles in cell cycle progression, apoptosis, and neurogenetic disease biological functions of melanoma-associated antigens acknowledgments this work was supported by grant number - - - fr from ministry of education, malaysia. the funder had no role in the study design, data collection and analysis, or preparation of the manuscript.authors' contributions ans, ns, msrh and aro co-defined the research theme. ans, ns, msrh and aro designed the experiments. ans, ns, ah, msrh, swt carried out the laboratory experiments. ah, ns, pm and aro analyzed and interpreted the data. ah, ns and aro had written the manuscript. all authors revised the manuscript thoroughly and approved the final manuscript. conflict of interest the authors have declared that no conflict of interest exists. key: cord- -imx a authors: christianson, k. k.; ingersoll, j. d.; landon, r. m.; pfeiffer, n. e.; gerber, j. d. title: characterization of a temperature sensitive feline infectious peritonitis coronavirus date: journal: arch virol doi: . /bf sha: doc_id: cord_uid: imx a the characteristics of a temperature sensitive feline infectious peritonitis virus (ts-fipv) were examined. ts-fipv, unlike its parent strain, df wild type fipv (wt-fipv), propagated at °c (permissive temperature) but not at °c (nonpermissive temperature). this temperature preference of ts-fipv was also demonstrated in cats by the ability of the virus to replicate only at the lower temperature in the upper respiratory tract and not at systemic sites where higher temperatures ( – °c) prevail. viral structural proteins and rna were synthesized at °c but some undefined maturational defect prevented the formation of infectious ts-fipv at its nonpermissive temperature. ts-fipv was more thermolabile than wt-fipv which indicated alterations in the structural proteins of ts-fipv, and a difference in the envelope protein of the two viruses was revealed by western blot analysis. plaque assay characterization showed that ts-fipv produced small plaques in comparison to the large plaques of wt-fipv. these unique characteristics possessed by ts-fipv may account for its nonvirulent nature and ability to stimulate protective immune responses in cats. feline infectious peritonitis (fip) is a complex and fatal disease of cats caused by infection with feline infectious peritonitis virus (fipv). previous attempts to consistently protect cats by immunization with other antigenically related coronaviruses such as porcine transmissible gastroenteritis virus (tgev) [ ] , canine coronavirus (cev) [ ] , and human coronavirus [ ] have been unsuccessful. inconsistent protection was found when cats were given a sublethal dose of virulent fipv and cats vaccinated with an avirulent fipv were more easily infected than were nonvaccinated cats [ ] . recently, it has been demonstrated that an intranasally (in) administered temperature sensitive fip¥ (ts-fipv) vaccine is efficacious and safe upon fipv challenge [ ] . the pathogenesis of f i p is complicated and not fully understood. evidence indicates that fip is an immune-mediated disease [ ] . the virus has been shown to replicate initially in the upper respiratory tract and small intestine [ ] . macrophages, the primary f i p v target cell, may then cross the mucosal barrier and spread virus throughout the cat [ , , ] . furthermore, a correlation between fipv virulence in vivo and ability to infect macrophages in vitro has been observed [ ] . it has been suggested that a strong cell-mediated immune response to f i p v may be more important than humoral immunity in protecting cats from this disease [ , ] . however, the role of local i m m u n e responses in the upper respiratory tract and intestinal tract has not been carefully evaluated and may represent an important i m m u n e defense mechanism against fip. ts-fipv was developed by serial passages at a reduced temperature, followed by ultraviolet irradiation. the selected virus will propagate at its permissive temperature ( °c) but not at its nonpermissive temperature ( °c). temperature sensitivity was accompanied by the appearance of various characteristics that distinguish ts-fipv from its virulent parent strain. the purpose of this report is to present these distinguishing characteristics which include plaque size, temperature stability, ability to synthesize r n a , expression of structural proteins and temperature dependent replication in vitro and in vivo. norden laboratories feline kidney (nlfk) cells were used from passage to . cells were propagated in basal medium eagle (bme) supplemented with % fetal bovine serum (fbs) and ram hepes buffer. the df wild type fip virus (wt-fipv) was originally isolated from a cat liver explant. after several passages of tissue homogenates in specific pathogen free (spf) cats, the virus was adapted to nlfk cells by cocultivation with infected primary spleen cells. the df wt-fipv strain was grown on nlfk cells at °c for passages i through and then passed at °c up to passage . the virus collected at passage was ultraviolet irradiated ( cm distance with a westinghouse - lamp, v, cycles, . amps) for min. the virus was plaque purified and designated ts-fipv. passage of the plaque purified ts-fipv was used in the characterization studies. the plaque assay was done with confluent cell monolayers inoculated with . ml of a tenfold virus dilution. after adsorption for h at °c or °c, the cells were overlaid with ml of . % carboxymethylcellulose in medium. monolayers were fixed and stained with a solution of % formalin, % crystal violet and % ethanol h postinfection. viral growth curves were conducted to compare the growth of ts-fipv and wt-fipv at both °c and °c. ts-fipv and wt-fipv were inoculated onto confluent cell monolayers at a multiplicity of infection (m.o.i.) of approximately . . at predetermined times over h, viral fluids were aseptically removed, stored at - °c, and titrated for infectivity at the completion of the growth curve. the tcids assay for virus infectivity was done in -well microtiter plates by infection of wells each with gl of a tenfold virus dilution. ts-fipv was titered at °c and wt-fipv was titered at °c. wells were examined for cytopathic effects (cpe) on day and the method of reed and muench [ ] was used to calculate the tcids . thermolability studies were performed at °c with wt-fipv and ts-fipv. each virus was diluted : in serum-free bme. at intervals between and m in, samples were removed, immediately cooled in an ice bath and titrated for residual infectivity. nlfk cells were used to determine ts-fipv virus-specific rna synthesis. cell monolayers were infected at an m.o.i, of approximately for h at °c. after removal of the inoculum, ml of bme containing % dialyzed fbs, ~g/ml actinomycin d and txci [ - h]uridine was added to duplicate cultures. following incubation for h, the radiolabeled cellular rna was extracted according to miller et al. [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . the rna pellets were solubilized in readi-protein (beckman, fullerton, ca) and counted in a liquid scintillation counter (model ls , beckman instruments, fullerton, ca). a parallel set of cultures without radiolabel was used to monitor infectivity. the unlabeled cells and medium collected at h were titrated after one freeze-thaw cycle. spleen cells from balb/c mice immunized with either ccv or wt-fipv were fused with ns /ag mouse plasmacytoma cells (american type cell culture, rockville, md) using standard procedures [ ] . hybridoma culture fluids were screened for specific antibody production by elisa and western blot. selected hybridomas were cloned twice by limiting dilution and ascites was produced by intraperitoneal injection of × hybridoma cells into pristane-treated balb/c mice. the monoclonal antibodies chosen for use in this study were broadly cross-reactive against ccv, fipv, and feline enteric coronavirus (fecv). three antibodies designated mab-p, mab-n, and mab-e were selected based on their specificities for the peplomer protein (mab-p), nucleocapsid protein (mab-n) and envelope protein (mab-e). mab-p and mab-n were obtained from a fusion performed with a ccv-immunized mouse and mab-e originated from a mouse immunized with wt-fipv. all three antibodies were used as the primary antibody in the western blot and indirect immunofluorescence assays (ifa) (see below). the structural proteins of wt-fipv grown at °c and ts-fipv grown at °c were examined by sds-page and western blot. sds-page was performed by a modified laemmli system [ ] . after electrophoresis, the proteins were blotted to immobilon pvdf transfer membrane (millipore, bedford, ma) by the procedure of towbin et al. [ ] . following transfer, the blot was blocked with % nonfat dried milk in pbs, incubated with mab-p, mab-n, or mab-e and then reacted with alkaline phosphatase-conjugated goat anti-mouse igg (h + l) (kirkegaard and perry, gaithersburg, md). ts-fipv proteins in supernatants from cells infected at °c and °c were examined by western blot. nlfk monolayers were infected at an m.o.i, of approximately or for k . k . christianson et al. h at °c or °c. the inocula were removed, the cultures were washed twice with bme and finally ml of bme was added. at intervals between and h post-adsorption, the culture medium was removed and centrifuged (t , x g) for min. the supernatants were frozen at - °c until western blot analysis. wt-fipv and ts-fipv intracellular and surface antigens expressed at °c and °c were examined by an indirect ifa [ ] . cell monolayers were infected with wt-fipv and ts-fipv at an m.o.i, of approximately . . at the appropriate time point the cells were rinsed with pbs and then fixed in acetone for min at - °c. the slides were then exposed to mab-p, mab-n, or mab-e for rain at °c. following incubation, the slides were rinsed in pbs and then exposed to fluorescein-conjugated goat anti-mouse igg (h + l) (kirkegaard and perry, gaithersburg, md) for rain at °c. detection of viral surface antigens by indirect ifa was done as described for detection of intracetlular antigens except the monolayers were not fixed. the cells were observed and photographed with a zeiss axioskop photomicroscope equipped with a zeiss x objective. in vivo fate of the virus spf cats (liberty labs, liberty corner, nj), to months old, were used in this study. three cats were vaccinated in with ml of ts-fipv ( . tcids /ml ). at , , and days after inoculation one ts-fipv vaccinated cat was sacrificed. one cat was infected orally with wt-fipv ( . tcids /ml ) and sacrificed on day . after sacrifice, tissues were aseptically removed from the cats and frozen at - °c. tissues were then thawed and pulverized with a manually operated tissue grinder to make a % to % (w/v) suspension using bme with antibiotics as a diluent. the suspensions were clarified by centrifugation ( , x g) for min and . ml was then added to the cell monolayers for h at °c for ts-fipv and °c for wt-fipv. after incubation the tissue suspensions were removed and the monolayers were washed once with bme followed by the addition of ml bme. the plates were incubated at the optimal temperature for each virus and were observed for viral cpe daily for days following inoculation. a standard virus neutralization test [ ] was done with mab-p on the virus positive tissue homogenates to confirm the presence of coronavirus. cat tissues were examined by direct ifa for viral antigen. the effect o f incubation temperature on the in vitro growth o f t s -f i p v is shown in table . t s -f i p v h a d optimal infectivity when p r o p a g a t e d and titrated at °c. the cpe produced at °c was characterized by formation of syncytia. when grown at °c, ts-fipv showed infectivity initially when titrated at °c. however, after days at °c cpe was observed on less than ten percent of the monolayer and all plaques that formed were healed within days. when grown at °c, ts-fipv had no detectable infectivity when assayed at °c, but showed minimal infectivity when assayed at °c. the growth curves (fig. ) as can be seen in fig. , ts-fipv was rapidly inactivated at °c. ts-fipv infectivity decreased by five logs in min. wt-fipv was more stable at °c than ts-fipv since only two logs of infectious virus were inactivated within min. the synthesis of ts-fip virus-specific rna, as measured by h-uridine incorporation, was compared at permissive and nonpermissive temperatures. viral rna synthesis at °c and °c was similar h following infection, indicating that normal viral entry and initial synthesis occurred at the nonpermissive temperature. the h-uridine incorporation at °c was , cpm and at °c was , cpm. however, a difference in the number of mature, infectious virions was apparent by h post-infection. virus grown for h at the permissive temperature had a titer of . × tcids /ml, while virus grown at the nonpermissive temperature had a titer of only . × tcids /ml. thus, at the nonpermissive temperature, it appears that early viral rna synthesis occurred without a concomitant virus maturation process. the structural proteins of wt-fipv and ts-fipv grown at °c and °c, respectively, were compared by western blot using coronavirus-specific monoclonal antibodies. the western blots showed that wt-fipv and ts-fipv had structural protein profiles characteristic of that reported for other coronaviruses [ ] . the peplomer protein band had a molecular weight of kda and the apparent molecular weight of nucleocapsid was kda for both viruses (fig. ) . conspicuous differences appeared in the pattern of blotted envelope proteins for the wild type and temperature sensitive viruses. the wt-fipv envelope (fig. , e, a) , whereas the envelope protein of ts-fipv produced several protein bands from kda to kda (fig. , e, b) . the kda component of ts-fipv was present but not at the same intensity as it was for wt-fipv. the differences in molecular weight of the envelope protein of the two viruses were confirmed using immune cat sera. immune sera from both ts-fipv vaccinated cats and wt-fipv challenged cats showed the same differences in the envelope protein of the two viruses as did the monoclonal antibody (data not shown). thus, the differences in the molecular weights of the envelope polypeptides were not due to differences in reactivity to the monoclonal antibody. there was not a difference in the molecular weights of the envelope polypeptides from ts-fipv grown at °c or °c (data not shown). the specificity of the monoclonal antibodies used for antigen detection is demonstrated by the lack of reactivity with nlfk cell extracts (fig. , c) . the culture supernatant from ts-fipv infected cells was monitored for the appearance of structural proteins at both the permissive and nonpermissive temperatures. ts-fipv grown at °c for , , , or h had all three structural proteins detected in the culture supernatant (fig. a) . when ts-fipv was grown at °c for similar lengths of time, only nucleocapsid was found (fig. b) . nucleocapsid may be the only protein released at °c or the less abundant peplomer and envelope proteins were not detected. figure also shows that the nucleocapsid protein released at °c may be associated with infectious rna or a few viral particles were released at °c because these culture supernatants were infective at °c. however, at h the infectivity of intracellular synthesis of ts-fipv and wt-fipv proteins was compared at °c and °c. synthesis was monitored by ifa using coronavirus-specific monoclonal antibodies on acetone-fixed, infected cells. all three structural proteins of ts-fipv were detected in the cells by ifa at both the permissive and nonpermissive temperatures ( table ). the ts-fipv proteins appeared at both temperatures within h post-infection. similar results were observed with wt-fipv infected cells at °c. when incubated at °c, wt-fipv proteins appeared somewhat later. nucleocapsid was visible by h while peplomer and envelope proteins were apparent by h. examination of the surface of infected cells by immunofluorescence using a peplomer monoclonat antibody indicated that ts-fipv was present on the surface of living cells by h post-infection at °c but not °c (table ). small areas of envelope surface fluorescence were observed for ts-fipv by h at its permissive temperature only. after h at °c peplomer and envelope antigens were detected on the surface of wt-fipv infected cells, but at °c only slight peplomer fluorescence was found after h. nucleocapsid was not detected on the surface of cells infected with either virus. in order to determine if the temperature sensitive characteristics of ts-fipv observed in vitro were reflected by growth of the virus in vivo, cats were inoculated with either ts-fipv or wt-fipv. at predetermined times postinoculation, cats were sacrificed and tissues were examined for the presence of virus. evidence of ts-fipv replication in the upper respiratory tract was found by virus isolation and immunofluorescence (table ) . virus was isolated from the cervical lymph node, tonsil, trachea and turbinate at , , or days postvaccination. ts-fipv antigen was identified by direct ifa in the mandibular lymph node and the tonsil. in contrast, by days after oral infection with wt-fipv, the virus had disseminated throughout the cat. wt-fipv was isolated from four different lymph nodes (cervical, mandibular, mediastinal and ruesenteric), the oral/nasal/pharyngeal area, as well as from the thymus and spleen. all of these tissues except the thymus were positive for viral antigen by direct ifa. the differences in the characteristics of ts-fipv and wt-fipv may account for the protective immunity afforded by ts-fipv [ ] and the onset of disease by wt-fipv. ts-fipv and wt-fipv differ in temperature specificity and stability, plaque size, and structural protein expression. in addition, ts-fipv and wt-fipv disseminate differently in the cat. although the lesions responsible for the temperature sensitive defect have not been located, the characteristics of ts-fipv in relation to its parent strain suggest a maturation defect. ts-fipv growth is impaired at the optimal temperature ( °c) for wt-fipv but ts-fipv replicates normally at its permissive temperature ( °c). this temperature preference allows ts-fipv to grow in the upper respiratory tract of cats but retards systemic growth in cats where the temperature is °c. replication of ts-fipv in the upper respiratory tract may stimulate mucosal responses that may be required to protect cats against fipv challenge. mucosal immunity provided by ts-fipv may be important in stopping the primary infection of fipv since stoddart et al. [ ] has shown that fipv administered orally replicated initially in the tonsil and small intestine. also, the temperature preference of ts-fipv may prevent a vaccine-induced sensitization of the cat. this contrasts with a previous study by pedersen and black [ ] in which vaccination with a modified-live fipv not only failed to protect cats against disease, but appeared to sensitize cats so they were more susceptible to fipv challenge than were nonvaccinated cats. wt-fipv produced larger plaques in nlfk cells than did ts-fipv. tupper et al. demonstrated that two virulent fipv strains ( - and nor , a plaque purified df wt-fipv) produced larger plaques than the nonvirulent fecv strain - [ ] . mckeirnan and coworkers also documented this difference in plaquing profiles between these same feline coronavirus strains [ ] . it appears that avirulent feline coronaviruses produce small plaques, whereas virulent fipv produces large plaques. ts-fipv rna synthesis occurred normally at °c for approximately h, even though viral growth did not proceed normally. the absence of intact virion production in the presence of rna synthesis at °c suggests a defect in the maturation and assembly of the virion which has been shown in other temperature sensitive viruses [ , , ] . the detection of ts-fipv structural proteins by indirect ifa in nlfk cells at °c without concomitant virus production also indicates a maturation defect at °c. surface expression of ts-fipv and wt-fipv peplomer and envelope proteins but not nucleocapsid at the optimal temperature for each virus resembles the situation in fipv-infected macrophage-like cells [ ] . the expression of viral antigen on the cell surface may be important in the pathogenesis of fipv. the absence of ts-fipv surface antigen at °c may account for the lack of sensitization in ts-fipv vaccinated cats. a difference was evident in the molecular weights of the envelope polypep-tides of ts-fipv and wt-fipv as shown by western blotting. the low molecular weight ( kda) component was detected to a lesser degree for ts-fipv than wt-fipv. this same kind of difference was observed with two virulent strains of fipv; ucd did not have the low molecular weight component that was present in the dahlberg strain of fipv i- ]. these observed differences in the envelope protein may be due to differences in glycosylation. further investigation by two-dimensional gels is needed to clearly differentiate the envelope proteins of ts-fipv and wt-fipv. different characteristics are apparent between ts-fipv and its parent strain wt-fipv. the importance of these ts-fipv characteristics in relation to the protective response of the virus in cats is under investigation. experimental inoculation of cats with human coronavirus e and subsequent challenge with feline infectious peritonitis virus experimental inoculation of cats with canine coronavirus and subsequent challenge with feline infectious peritonitis virus isolation and characterization of conditionamethal mutants of sindbis virus physiological characterization of heatdefective (temperature-sensitive) poliovirus mutants: preliminary classification protection against feline infectious peritonitis (fip) by a temperature sensitive-fip virus vaccine inoculated intranasally virion polypeptide specificity of immune complexes and antibodies in cats inoculated with feline infectious peritonitis virus comparison of serologic assays for measurement of antibody response to coronavirus in cats expression of feline infectious peritonitis coronavirus antigens on the surface of feline macrpohage-like cells cleavage of structural proteins during the assembly of the head of bacteriophage t feline infectious peritonitis (fip)--the present state of knowledge comparative properties of feline coronaviruses in vitro temperature sensitive coronavirus characterization kinetics of accumulation and processing of simian virus rna in xenopus laevis oocytes injected with simian virus dna immunoglobulin-producing hybrid cell lines attempted immunization ofcats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus experimental studies with three new strains of feline infectious peritonitis virus: fipv-ucd , fipv-ucd , and fipv-ucd a simple method for estimating fifty percent endpoints the biology of coronaviruses intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence virus shedding and immune responses in cats inoculated with cell culture-adapted feline infectious peritonitis virus the sites of early viral replication in feline infectious peritonitis semliki forest temperature-sensitive mutants: isolation and characterization electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose: procedure and some applications antigenic and biological diversity of feline coronaviruses: feline infectious peritonitis and feline enteritis virus pathogenesis of feline infectious peritonitis: nature and development of viremia pathogenesis of feline infectious peritonitis: pathogenic changes and immunofluorescence cross-protection studies between feline infectious peritonitis and porcine transmissible gastroenteritis viruses the authors thank dr. b. huseman for performing the necropsies and b. suiter and dr. m. mellencamp for monoclonal antibody production. the critical review of this manuscript by dr. w. beckenhauer, s. christianson, dr. k. haffer and dr. a. torres was greatly appreciated. received july , key: cord- -wkg xeq authors: dye, charlotte; siddell, stuart g. title: genomic rna sequence of feline coronavirus strain fcov c je date: - - journal: j feline med surg doi: . /j.jfms. . . sha: doc_id: cord_uid: wkg xeq this paper reports the first genomic rna sequence of a field strain feline coronavirus (fcov). viral rna was isolated at post mortem from the jejunum and liver of a cat with feline infectious peritonitis (fip). a consensus sequence of the jejunum-derived genomic rna (fcov c je) was determined from overlapping cdna fragments produced by reverse transcriptase polymerase chain reaction (rt-pcr) amplification. rt-pcr products were sequenced by a reiterative sequencing strategy and the genomic rna termini were determined using a rapid amplification of cdna ends pcr strategy. the fcov c je genome was found to be , nucleotides in length, excluding the poly(a) tail. comparison of the fcov c je genomic rna sequence with that of the laboratory strain fcov fip virus (fipv) - showed that both viruses have a similar genome organisation and predictions made for the open reading frames and cis-acting elements of the fipv - genome hold true for fcov c je. in addition, the sequence of the ′-proximal third of the liver derived genomic rna (fcov c li), which encompasses the structural and accessory protein genes of the virus, was also determined. comparisons of the enteric (jejunum) and non-enteric (liver) derived viral rna sequences revealed % nucleotide identity, a finding that questions the well accepted ‘internal mutation theory’ of fipv pathogenicity. this paper reports the first genomic rna sequence of a field strain feline coronavirus (fcov). viral rna was isolated at post mortem from the jejunum and liver of a cat with feline infectious peritonitis (fip). a consensus sequence of the jejunum-derived genomic rna (fcov c je) was determined from overlapping cdna fragments produced by reverse transcriptase polymerase chain reaction (rt-pcr) amplification. rt-pcr products were sequenced by a reiterative sequencing strategy and the genomic rna termini were determined using a rapid amplification of cdna ends pcr strategy. the fcov c je genome was found to be , nucleotides in length, excluding the poly(a) tail. comparison of the fcov c je genomic rna sequence with that of the laboratory strain fcov fip virus (fipv) - showed that both viruses have a similar genome organisation and predictions made for the open reading frames and cis-acting elements of the fipv - genome hold true for fcov c je. in addition, the sequence of the -proximal third of the liver derived genomic rna (fcov c li), which encompasses the structural and accessory protein genes of the virus, was also determined. comparisons of the enteric (jejunum) and non-enteric (liver) derived viral rna sequences revealed % nucleotide identity, a finding that questions the well accepted 'internal mutation theory' of fipv pathogenicity. f eline coronavirus (fcov) infection is extremely common in cats worldwide. in the united kingdom approximately % of the domestic cat population is seropositive and where cats are housed together in multi-cat households, this figure increases still further to around % (addie and jarrett , sparkes et al , addie . natural infections with fcov are usually transient, although a significant percentage of infections may become persistent (addie and jarrett ) . most infections are asymptomatic or result in mild, self-limiting gastrointestinal disease and in these cases, the causative agent is known as feline enteric coronavirus (fecv) . in a small percentage of animals (< %), however, a fatal multi-systemic, immunemediated disease occurs and this is known as feline infectious peritonitis (fip) (pedersen ) . the virus associated with fip is referred to as fip virus (fipv) and it is proposed that cats acquire fipv by mutation of an endogenous fecv (poland et al , vennema et al . this hypothesis is known as the 'internal mutation theory' and is widely accepted. despite this, any genetic differences between fecv and fipv that can account for their different pathogenicity remain to be identified. there are two types of fcov that can be distinguished by serology and by sequence analysis. type i viruses are most prevalent in the field and account for approximately % of all infections (hohdatsu et al , addie et al . type ii viruses are less prevalent and are characterised by recombination events that result in the replacement of the fcov spike glycoprotein gene with the equivalent gene of canine enteric coronavirus (ccov) (herrewegh et al ) . there is no evidence that either type is more commonly associated with fip in natural infections (benetka et al ) . the majority of research on fcov to date has concentrated on the investigation of type ii strains, most notably fipv - , because they replicate well in cell culture and are, therefore, easy to work with in the laboratory. however, fipv - is unlikely to be representative of coronavirus strains that are currently circulating within domestic cat populations. firstly, it was isolated in america in and the geographical and time differences make it unlikely that this strain would be in current circulation in the uk. secondly, it is a type ii strain, which represent only e % of field isolates (hohdatsu et al , benetka et al , kummrow et al . thirdly, and most importantly, fipv - has been extensively passaged in cell culture, which increases the likelihood of mutation. we, therefore, felt it important that more clinically relevant strains should be investigated and genomic sequencing of a field strain virus obtained directly from clinical material was the first step in this process. the 'internal mutation theory' states that fip occurs when a cat is exposed to variants of fcov that have mutated within the host and are able to disseminate from the gut (primary site of infection) by gaining the ability to replicate efficiently within macrophages (pedersen , poland et al , vennema et al . this hypothesis has had many proponents and numerous speculations regarding the location of mutation(s) that could result in the alteration of pathogenicity have been made (haijema et al . it should, however, be noted that the difference between fcov infection with and without fip disease is believed to be quantitative rather than absolute (meli et al , kipar et al . most authors have concurred that although low-level monocyte-associated viraemia is found with fecv infection, this virus is mainly confined to the gut. this is in contrast to the highly pathogenic fipv, which disseminates systemically with high viral titres. thus, obtaining sequence data from enteric and non-enteric fcovs found within individual cats with fip may shed more light on any genetic differences between fecv and fipv. this paper presents the first genomic rna sequence of a field strain fcov. viral rna (designated fcov c je) was isolated at post mortem from the jejunum of a cat with a histopathologically confirmed diagnosis of fip. the sequence was analysed to identify cis-acting elements involved in the replication, transcription and translation of viral rna and to identify the structural, non-structural and accessory proteins encoded by the genomic rna. a direct comparison has been made with similar elements in the previously published genomic rna of the laboratory strain fcov, fipv - . furthermore, the structural and accessory gene regions of viral rna isolated from the liver of the same cat (fcov c li) were sequenced and the data derived from the enteric (jejunum) and non-enteric (liver) sources were compared. a . cm biopsy of jejunum and liver tissue from a cat with a diagnosis of fip (confirmed by histopathology) was placed into ml of 'rna later' solution (ambion, uk) at post mortem. this was stored at c overnight. the 'rna later' solution was then discarded and the tissue stored at À c. rna was extracted from the tissue biopsies using a macheryenagel nucleospin rna ii kit (abgene, uk) according to the manufacturer's instructions. briefly, tissue biopsies ( mg) were added to ml of lysis buffer with % (v/v) -mercaptoethanol in a -ml tube containing a stainless steel ball bearing. samples were disrupted using a tissue lyser (qiagen, uk) at a frequency of revolutions per second for e min. using a 'shredder column', ml of the tissue lysate was homogenised and one volume of % ethanol was added before loading onto an 'extraction column'. the sample was incubated with dnase solution, washed three times, eluted in  ml of rnase-free water and stored at À c. sequence data previously generated for the laboratory strain fcov, fipv - , were used to design primers for conventional reverse transcriptase polymerase chain reaction (rt-pcr) amplification of short lengths ( e bases) of the field strain rna. these primers were chosen in regions that were expected to show sequence conservation on the basis of comparative analysis of published sequences. subsequently, sequence data derived from these short pcr fragments were used to design field strain specific pcr primers that were used to amplify longer overlapping fragments spanning the entire genome (fig ) . for small rt-pcr fragments (< kb), superscript ii rnase h À rt (invitrogen, uk) was used to reverse transcribe viral rna. rna and pmol of reverse primer were incubated at c for min and then chilled on ice. the rna/primer mix was then added to a ml reaction containing units of human placental ribonuclease inhibitor (hpri), mm deoxyribonucleotide equimolar mix of datp, dctp, dgtp and dttp (dntp), . m dithiothreitol (dtt), units of rt and  first strand buffer. the reaction was incubated at c for min followed by c for min. samples were immediately chilled on ice and stored at À c. pcr amplification was undertaken using recombinant taq dna polymerase (invitrogen, uk) in a ml reaction containing ml cdna, . mm forward primer, . mm reverse primer, . mm dntp, units of dna polymerase,  pcr buffer and mm mgcl . reactions were incubated at c for min and then amplified using cycles of c for s, e c for s and c for min per kb of pcr product. following a final incubation of c for min, the dna was stored at c. for larger rt-pcr fragments (> kb), a onestep rt-pcr amplification was undertaken using a one-step pcr kit for long templates (invitrogen, uk) according to the manufacturer's instructions. briefly, a ml reaction containing rna, pmol forward primer, pmol reverse primer, ml superscript ii rt/platinum taq hifi dna polymerase enzyme mix and  reaction buffer was incubated at c for min and c for min, followed by cycles of c for s, e c for s and c for min per kb of pcr product. the reaction was held at c for min and then stored at c. pcr products were purified using sigmaspin post-reaction purification columns (sigmae aldrich, uk) or, if non-specific products were present, then gel purification was undertaken using a qiagen gel purification kit (qiagen, uk) according to the manufacturer's instructions. an aliquot of each purified dnawas electrophoresed in  tbe buffer at v for min on a % agarose/  tbe gel containing ml/ml ethidium bromide. dna stocks were diluted to a final concentration of e ng/ml and stored at À c. race and race -and rapid amplification of cdna ends (race) strategies were employed for amplification of the viral rna termini. race was undertaken by reverse transcribing the rna using primer -rt followed by pcr amplification with primers f and p (table ) . race was undertaken using a generacer race kit (invitrogen, uk) according to the manufacturer's instructions. briefly, rna was dephosphorylated using calf intestinal phosphatase, decapped using tobacco acid pyrophosphatase and ligated to a generacer rna oligo using t rna ligase. phenol:chloroform extraction and ethanol precipitation of the rna were undertaken between each step and the rna was re-suspended in rnasefree water. reverse transcription was undertaken with superscript ii rnase h À rt (invitrogen, uk) using primer f and pcr amplification was done with taq dna polymerase (invitrogen, uk) using primers p and f (table ) . ). short c je pcr fragments amplified using primers specific for fipv - are shown in blue ( ). the sequence data derived using these initial primers were used to design c je specific primers for amplification of longer fragments. c je specific primers used for reverse transcription and pcr are highlighted in red ( ). pcr products are represented by a thin black line ( ) joining the forward and reverse pcr primers and are labelled alphabetically from a to i. cycle sequencing was undertaken in ml reactions containing  big dye mix v . (applied biosystems, uk), sequencing primer ( pmol) and purified pcr product ( ng). amplification was undertaken in a geneamp thermocycler (applied biosystems, uk) using cycles of c for s, c for s and c for min. unincorporated dye terminators and primers were removed by ethanol precipitation and the products were then analysed by capillary electrophoresis using an abi genetic analyser (applied biosystems, uk). the 'seqman' program in the lasergene- software package (dnastar inc, usa) was used for the alignment of sequence data. comparison of predicted fipv - structural and nonstructural proteins with those of fcov c je and fcov c li were undertaken with the 'megalign' program using the jotun hein method. the putative ribosomal frameshift element, as well as putative -untranslated region ( -utr) and -untranslated region ( -utr) secondary structure elements, was identified visually. protease cleavage sites within the replicase polyprotein were predicted by alignment with the replicase polyproteins of fipv - . the simplot v . . program (http://sray.med.som.jhmi.edu/ scroftware/simplot) was used to analyse for 'identity' in the aligned s genes and flanking regions using a window size of nucleotides and a step size of nucleotides. the 'identity' values were calculated using a maximum likelihood probability. genomic sequence data were generated for viral rna derived from the jejunum of a cat with a histopathologically confirmed diagnosis of fip. the viral rna was designated fcov c je and the genomic sequence was derived from nine overlapping pcr products (seven rt-pcr and two race-pcr) (fig ) . the genomic rna sequence of fcov c je comprises , nucleotides, excluding the poly(a) tail. the genomic organisation is similar to that of fipv - and the overall nucleotide composition is a, . %; g, . %; u, . % and c, . %. the sequence has been deposited with the gen-bank database (accession number dq ). the fcov c je -utr comprises nucleotides, one nucleotide less than that of fipv - . within this region, two putative secondary structures, the so-called 'leader transcription-associated-sequence hairpin (lth)' (nts e ) and a second stem loop structure (nts e ) can be predicted (fig ) , bearing > % nucleotide identity with similar structures found in the fipv - genomic rna. as in fipv - , these structures encompass a 'miniopen reading frame (orf)' of four codons (nts e ) and the leader 'transcription-associated-sequence' (tas) (nts e ), -cuaaac- , which is also located adjacent and upstream of six putative orfs in the genomic rna. the -utr of fcov c je contains a putative bulged stem loop and pseudoknot, again bearing > % nucleotide identity with the analogous structures of fipv - (fig ) . as in fipv - , these structures extend into the upstream orf b, which in this isolate, unlike in - , appears to be intact (see below). as expected, analysis of the fcov c je genomic rna sequence data reveals the presence of six orfs that, by comparison with other coronaviruses, can be deduced to encode the non-structural and structural proteins of the virus (siddell et al , gorbalenya et al . orf a (nts e , ) and orf b (nts e , ) encode the non-structural proteins (nsps). as in fipv - , these orfs overlap by nucleotides and a typical coronavirus 'slip-site', -uuuaaac- (nts , e , ), is located within the overlap. adjacent and downstream of the 'slip-site' is a putative pseudoknot structure that shares % nucleotide identity with the putative fipv - pseudoknot. amino acid comparisons of the fcov c je nsps with those of fipv - (table ) reveal fairly high conservation (> %). the orfs encoding the structural proteins are orf s (nts , e , ), orf e (nts , e , ), orf m (nts , e , ) and orf n (nts , e , ) and their predicted translation products are the spike glycoprotein (s), the envelope protein (e), the membrane protein (m) and the nucleocapsid protein (n). comparative sequence analysis shows that most of the structural proteins of fcov c je are very closely related to those of fipv - with amino acid identities exceeding % (table ) . however, this is not the case for the s protein, which shares only . % amino acid identity between the two isolates. since e % of field strain fcovs are serotype i (hohdatsu et al , benetka et al , the fcov c je isolate is likely to be a type i virus. the amino acid identity of the fcov c je s protein with that of published fcov type i s protein sequence data is very high (> %) (table ) confirming that it as a type i strain. fipv - is a serotype ii isolate and this is illustrated by the finding that the fipv - s protein shares strong (> %) amino acid identity with published ccov isolates (table ) . previous predictions based on limited sequence data have identified type ii fcov strains with a double recombination event occurring in the half of orf b (herrewegh et al ) and between the s and m genes (motokawa et al ) . the fipv - and fcov c je s genes and their flanking sequences were aligned and a graph of the relative nucleotide identities was plotted. this was used to make a prediction for the putative crossover sites of fipv - with ccov (fig ) . the upstream crossover site was predicted to lie at position , e , ( end of orf b) and the downstream crossover site at position , e , ( end of s gene) in the fipv - genome (genbank accession number dq ). a short conserved region of approximately nucleotides lying within the predicted recombination site is likely to represent the heptad repeat sequences in the s subdomain which are essential for fusogenic activity and are conserved throughout coronaviruses (bosch et al , de haan and . analysis of the accessory gene cluster of the fcov c je genome reveals orfs corresponding to a and b as found in the fipv - isolate. although the encoded proteins appear to be analogous to those of fipv - and are of similar length, the amino acid conservation is not high (table ) . this may reflect the fact that these orfs are believed to be dispensable for replication in cell culture and are thus unlikely to be conserved in the laboratory-adapted strain of fipv - (haijema et al ) . as in fipv - , orf c of fcov c je appears to be defunct and has a stop codon after only amino acids. however, the introduction of only two nucleotide mutations would enable extension of the reading frame to overlap with that of orf e (fig ) . analysis of the accessory gene region of the fcov c je genome identifies two orfs, which have translation products sharing high amino acid identity with proteins a and b of fipv - . however, unlike the fipv - orf b, which appears to terminate early as a result of a single nucleotide mutation (c , to u , ) (dye and siddell ) , the fcov c je orf b is intact. using the strategy outlined earlier, the sequence of the -proximal kb (nts , e , ) of viral rna derived from liver tissue of the same cat was determined. this sequence was designated fcov c li. when the nucleotide and amino acid sequences of fcov c je (enteric) and fcov c li (non-enteric) were compared, the sequences were found to be identical. thus, cis-acting rna elements in this region, as well as the structural and accessory genes and encoded proteins of the two rnas, were found to share % identity (table ). the genomic rna sequence of fcov c je provides the first full-length sequence of a field strain fcov. comparisons with the genomic rna of fipv - show that as expected it has a very similar genome organisation and predictions made for the orfs and cis-acting elements within fipv - are equally valid for fcov c je. however, more detailed comparative sequence analysis of the field strain type i rna (fcov c je) with that of the type ii laboratory strain (fipv - ) does reveal a number of interesting differences. as expected there was significant diversity in the s gene region resulting from the evolutionary recombination of fipv - with ccov (herrewegh et al ) . the discontinuous transcription method used by coronaviruses is very similar to that of the template switching that occurs during similarity-assisted or high frequency copy-choice rna recombination (sawicki and sawicki , sawicki ). recombination is a common phenomenon amongst coronaviruses (wang et al , schaad and baric , collisson et al , rest and mindell , johnson et al and it may have greater evolutionary significance than the slow process of genetic drift. it provides a mechanism for the rapid formation of new viral strains with dramatically altered tropisms and pathogenicity, which can have a significant impact on host disease. first, it raises the threat of potentially lethal phenotypes emerging over a very short evolutionary time scale and second, it compounds the difficulties of vaccine production resulting from the heterogeneity of virus populations. this again emphasises the importance of investigating current field strain viruses rather than relying solely on laboratory-adapted isolates. second, comparisons of the replicase proteins of fipv - and fcov c je showed them to be extremely similar and of the nonstructural proteins had amino acid identities of > %. the amino acid identity of the nsp regions was, however, slightly lower at . % and this was largely due to the presence of an extra amino acids in fcov c je. the closely related coronavirus transmissible gastroenteritis virus (tgev) also contains similar additional amino acids within its nsp region (penzes et al ) and it is most likely that a amino acid deletion has occurred in fipv - during its passage in cell culture. the presence of this deletion in fipv - suggests that this particular region is not required for viral replication, at least in vitro. analysis of the accessory gene regions of the clinical strain is particularly interesting. it has long been suspected that these genes confer a selective advantage in vivo but are not required in vitro (herrewegh and vennema, , kennedy et al , haijema et al , and that analysis of sequences derived directly from clinical material might, therefore, provide some insight into their importance. both gene and gene regions have also been implicated in viral pathogenicity. for example, mutant viruses containing either abc or ab cluster deletions multiply well in cell culture but show an attenuated phenotype in the cat (haijema et al ) . interestingly, cats vaccinated with either of these viral mutants showed some protection against a lethal homologous challenge but vaccination with a mutant virus lacking both gene clusters provided no protection (haijema et al ) . it is certainly noteworthy that orf b is intact in the clinical strain but not in fipv - . this region, along with orf c, has been previously implicated in viral pathogenicity. for example, investigation of paired fecv/fipv samples from various geographical locations has suggested that the fipv may arise from deletion mutations in the fecv accessory genes (vennema et al ) . further investigation into the function of the encoded b protein would certainly be rewarding. it has previously been shown that the c gene region of fipv - is degenerate but that it could be restored by just two nucleotide insertions that would enable its extension to overlap with orf e (dye and siddell ) . it was, therefore, suspected that the orf c of fcov c je might be intact, but this was not the case. it is difficult to speculate on the implications of this finding but is does at least suggest that the c protein may have restricted functional significance in vivo. in this paper, viral rna extracted from two different tissue samples, one enteric (jejunum) and one non-enteric (liver), was sequenced and compared in an attempt to investigate the possibility of genetic differences that might account for the enhanced pathogenicity of fipv compared with fecv. the finding of a % nucleotide identity in the structural and accessory gene regions of the enteric virus (fcov c je) and the non-enteric virus (fcov c li) does not support this view. in fact, it provides a powerful argument opposing the 'internal mutation theory'. however, there are some limitations that may also explain this result. for example, consensus sequencing will mask minority virus populations and it is possible that a second viral isolate is present at low levels within the cat jejunum sample. one potential model would be that following immune impairment in cats with well-progressed fip disease, pathogenic fipv is able to replicate uncontrollably and migrates back to the gut where viral loads are able to exceed those of the enteric fecv strains. secondly, it is possible that the important determinants of pathogenicity are located in the proteins encoded in the replicase gene region. it is certainly conceivable that interaction between proteins of the replicase complex and cellular proteins could have critical importance and that alterations in this interaction could lead to altered pathogenicity. it is known, for example, that significant cd and cd t cell epitopes are located in the replicase proteins of murine hepatitis virus (mhv) (stohlman et al ) and it is already clear that some coronavirus non-structural proteins have profound effects on cellular processes such as deubiquitination and adenosine diphosphate (adp)-ribose metabolism (barretto et al , putics et al . the next step would certainly be to obtain the full genomic rna sequence of fcov c li so that the replicase gene regions can be compared. there are still many unanswered questions regarding the molecular epidemiology of fcov. for example, does the fcov strain within a defined multi-cat population remain conserved over time or are new strains constantly emerging? if new strains do emerge, are they the result of original strain mutation or 'de novo' infections from external sources? are all coronavirus positive cats within a household infected with the same viral strain and are some cats co-infected with several fcov strains simultaneously? is the fcov strain present in the gut always a reflection of the predominant systemic strain, and similarly, do cats with fip excrete pathogenic fipv or only fecv? is there a consistent mutation associated with pathogenicity? various authors have previously addressed many of these questions (addie , addie and jarrett , pedersen . however, only small sections of the viral genome have so far been considered and interpretation of the findings has proved difficult. now that the genomic rna sequence of a type i clinical strain has been elucidated it will be much easier and quicker to sequence more extensive specific regions from further viral field strains. it is hoped that this will help to shed more light on the findings of future epidemiological studies and increase their significance. lastly, the genomic rna sequence of fcov c je provides a solid foundation for the construction of a full-length cdna copy of a field strain fcov. this could be used as the basis for production of a reverse genetics system, a tool that would enable us to study fcov molecular biology and pathogenesis. studying a clinical isolate in such a way is likely to provide more clinically relevant information than studying fipv - and would have greater potential for use in any future attempt to make a live attenuated vaccine. clustering of feline coronaviruses in multicat households a study of naturally occurring feline coronavirus infections in kittens use of a reverse-transcriptase polymerase chain reaction for monitoring the shedding of feline coronavirus by healthy cats the papain-like protease of severe acute respiratory syndrome coronavirus has deubiquitinating activity prevalence of feline coronavirus types i and ii in cats with histopathologically verified feline infectious peritonitis the coronavirus spike protein is a class i virus fusion protein: structural and functional characterization of the fusion core complex genomic rna sequence of feline coronavirus strain fipv wsu- / nidovirales: evolving the largest rna virus genome molecular interactions in the assembly of coronaviruses switching species tropism: an effective way to manipulate the feline coronavirus genome feline coronavirus type ii strains - and - originate from a double recombination between feline coronavirus type i and canine coronavirus the prevalence of types i and ii feline coronavirus infections in cats effect of mutations in the mouse hepatitis virus (+) protein binding element on rna replication deletions in the a orf of feline coronavirus associated with an epidemic of feline infectious peritonitis natural fcov infection: cats with fip exhibit significantly higher viral loads than healthy infected cats feline coronavirus serotypes and : seroprevalence and association with disease in switzerland high viral loads despite absence of clinical and pathological findings in cats experimentally infected with feline coronavirus (fcov) type i and in naturally fcov-infected cats comparison of the amino acid sequence and phylogenetic analysis of the peplomer, integral membrane and nucleocapsid proteins of feline, canine and porcine coronaviruses an overview of feline enteric coronavirus and infectious peritonitis virus infections. feline practice an overview of feline coronavirus and feline infectious peritonitis two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus adp-ribose- -monophosphatase: a conserved coronavirus enzyme that is dispensable for viral replication in tissue culture sars associated coronavirus has a recombinant polymerase and coronaviruses have a history of host-shifting acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein coronavirus transcription: a perspective a contemporary view of coronavirus transcription genetics of mouse hepatitis virus transcription: evidence that subgenomic negative strands are functional templates topley and wilson s microbiology and microbial infections feline coronavirus antibodies in uk cats characterization of mouse hepatitis virus-specific cytotoxic t cells derived from the central nervous system of mice infected with the jhm strain feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses evidence of natural recombination within the s gene of infectious bronchitis virus the work was supported by funding from the wellcome trust. we would like to thank tamera jones for technical help as well as andrew davidson and helen stokes for advice and reagents. key: cord- -i c nf authors: cornelissen, e.; dewerchin, h.l.; van hamme, e.; nauwynck, h.j. title: absence of antibody-dependent, complement-mediated lysis of feline infectious peritonitis virus-infected cells date: - - journal: virus res doi: . /j.virusres. . . sha: doc_id: cord_uid: i c nf cats infected with virulent feline coronavirus which causes feline infectious peritonitis (fip) usually succumb to disease despite high antibody concentrations. one of the mechanisms that can help resolving infection is antibody-dependent, complement-mediated lysis (adcml) of infected cells. adcml consists of virus-specific antibodies that bind to cell surface expressed viral proteins which result in complement activation and cell lysis. the objective of this study was to determine the sensitivity of fip-virus (fipv) infected cells towards adcml and to examine the role of the accessory proteins abc and ab in this process. adcml assays, using fipv strain - and its deletion mutant strain Δ abc/Δ ab, were performed on: (i) crfk cells that show surface-expressed viral antigens, (ii) monocytes without surface-expressed viral proteins due to retention and (iii) monocytes with surface-expressed viral proteins since the antibody-mediated internalization of these proteins was blocked. as expected, no adcml was detected of the monocytes without surface-expressed viral antigens. surprisingly, no lysis was observed in the crfk cells and the monocytes that do show surface-expressed viral proteins, while controls showed that the adcml assay was functional. these experiments proof that fipv can employ another immune evasion strategy against adcml (besides preventing surface expression): the inhibition of complement-mediated lysis. this new evasion strategy is not attributed to the group-specific proteins since lysis of cells infected with fipv Δ abc/Δ ab was not detected. cats infected with virulent feline coronavirus which causes feline infectious peritonitis (fip) usually succumb to disease despite high antibody concentrations. one of the mechanisms that can help resolving infection is antibody-dependent, complement-mediated lysis (adcml) of infected cells. adcml consists of virus-specific antibodies that bind to cell surface expressed viral proteins which result in complement activation and cell lysis. the objective of this study was to determine the sensitivity of fip-virus (fipv) infected cells towards adcml and to examine the role of the accessory proteins abc and ab in this process. adcml assays, using fipv strain - and its deletion mutant strain abc/ ab, were performed on: (i) crfk cells that show surface-expressed viral antigens, (ii) monocytes without surface-expressed viral proteins due to retention and (iii) monocytes with surface-expressed viral proteins since the antibody-mediated internalization of these proteins was blocked. as expected, no adcml was detected of the monocytes without surface-expressed viral antigens. surprisingly, no lysis was observed in the crfk cells and the monocytes that do show surface-expressed viral proteins, while controls showed that the adcml assay was functional. these experiments proof that fipv can employ another immune evasion strategy against adcml (besides preventing surface expression): the inhibition of complementmediated lysis. this new evasion strategy is not attributed to the group-specific proteins since lysis of cells infected with fipv abc/ ab was not detected. © elsevier b.v. all rights reserved. feline infectious peritonitis (fip) is a fatal disease, characterized by fibrinous-granulomatous serositis often with protein-rich effusions in body cavities, granulomatous-necrotising phlebitis and periphlebitis and granulomatous inflammatory lesions in several organs (weiss and scott, a,b; kipar et al., kipar et al., , . the causative agent is a virulent form of the feline coronaviruses (fcovs) belonging to the family coronaviridae, order nidovirales. in vivo, monocytes and tissue macrophages are the target cells and play a central role in the development of the lesions (kipar et al., ) . these infected cells should be excellent targets for the immune system to fight the infection. however, in most cases the immune response is not protective and the cat succumbs to the infection. the cell-mediated immunity is believed to be important in control and clearance of the fip-virus (fipv) infection if there is an efficient first response to the infection. the humoral immune response is believed to be not protective. high concentrations of neutralizing antibodies are present in cats with end-stage fip and no difference is seen in the antibody concentration and fluctuations between survivors and non-survivors after a fipv infection (de groot-mijnes et al., ) . in general, virus-specific antibodies can help to resolve infection by antibody-mediated lysis of infected cells via cytolytic immune cells with fc receptor (like nk cells, macrophages or neutrophils) or via complement (sissons and oldstone, ). the complement system is an immunological defense system and plays a role in both the innate and the adaptive immune response against invading pathogens. complement consists of serum and membrane-bound proteins which, once activated, can trigger a biochemical cascade of reactions contributing to the eradication of pathogens (blue et al., ) . important complement effector functions are opsonization of pathogens, cytolysis and promoting host inflammatory responses (anaphylatoxin and chemotaxin production) (janeway et al., ) . in viral infections, the complement system can be activated by free virus particles and virus-infected cells. complement can inactivate free virus in the presence or absence of antibodies. opsonization of the virus with complement proteins can promote phagocytosis, virolysis and interference with attachment, internalization or uncoating of the virions (hirsch, ) . cells infected with enveloped viruses can be lysed by complement in the presence of antibodies if newly synthesized viral glycoproteins are expressed at the plasma membrane of the infected cell. virus-specific antibodies can then bind to these surface-expressed proteins and thereby activate the complement system. eventually, this results in cell death (sissons and oldstone, process is called antibody-dependent, complement-mediated lysis (adcml). recently, we described for fipv two processes that inhibit the expression of viral proteins at the plasma membrane of in vitro infected monocytes. namely, the retention of viral proteins in infected cells and the antibody-mediated internalization of surfaceexpressed viral proteins. both processes result in the clearance of all detectable viral antigens from the plasma membrane of infected cells (dewerchin et al., ; dewerchin et al., ) . fipvinfected monocytes/macrophages isolated from naturally infected cats do not express viral proteins at their plasma membrane either (cornelissen et al., ) . absence of viral proteins in the plasma membrane of infected monocytes can protect the infected cells from efficient adcml. this has been described for pseudorabies virus (prv), equine herpesvirus- (ehv- ) and porcine reproductive and respiratory syndrome virus (prrsv) (van der meulen et al., ; van de walle et al., ; costers et al., ) . the objective of this study was to determine if there is efficient adcml of fipv-infected cells that show surface-expressed viral antigens, since this would open treatment possibilities based on inhibiting antibody-mediated internalization of surface-expressed viral antigens. furthermore, the role of the accessory proteins abc and ab was assessed in this context. adcml assays with crandell feline kidney cells (crfks) and peripheral blood monocytes were performed. crfks were seeded in six-well plates (nunc) and cultivated in mem-medium containing % fetal bovine serum (fbs), % lactalbumine, . mg/ml glutamine, u/ml penicillin, . mg/ml streptomycin and . mg/ml kanamycin. peripheral blood monocytes were isolated from feline coronavirus, feline leukemia virus and feline immunodeficiency virus negative cats as described previously (dewerchin et al., ) . they were cultivated in six-well plates in rpmi -medium containing % fbs, . mg/ml glutamine, u/ml penicillin, . mg/ml streptomycin, . mg/ml kanamycin, u/ml heparin, mm sodium pyruvate and % non-essential amino acids × (gibco brl). cells were infected with fipv type ii strain - or with its attenuated deletion mutant virus strain fipv abc/ ab at a multiplicity of infection of . both viruses were kindly provided by dr rottier (faculty of veterinary medicine, utrecht university, the netherlands). the deletion mutant strain is the fipv strain - from which the open reading frames abc and ab were deleted, using reverse genetics (haijema et al., ) . the crfks and the monocytes were mechanically detached (by gently pipetting up and down) from the wells at h postinoculation (hpi) and hpi, respectively, to perform the assays in suspension. the cells were incubated for h with fipv-specific polyclonal antibodies (pabs) ( , . and . mg/ml) or antibodies purified from fipv-negative serum ( . mg/ml). the fipv-specific pabs originated from cats infected with fipv - and were provided by dr rottier. the fipv-negative serum was derived from an fcov-negative cat (ipma antibody titer < ). both pabs had been purified using protein a-sepharose (amersham biosciences). the cells were washed and incubated with % complement (noninactivated serum of a fcov-negative cat). then, the cells were stained with ethidium monoazide bromide (ema) (molecular probes) to label dead cells, fixed with % paraformaldehyde (vwr), permeabilized with . % saponin (sigma) and stained with specific monoclonal antibodies (mabs) against fipv nucleocapsid (n) protein and membrane (m) protein, followed by fitc-labeled goat anti-mouse igg (molecular probes) to identify fipv-infected cells. the mab recognizing the m and n protein were produced and characterized in our laboratory. nuclei were stained with hoechst (molecular probes). dead infected cells were counted using fluorescence microscopy. for the monocytes, the antibody-induced internalization was inhibited by pre-treatment for min with myosin light chain kinase inhibitor and inclusion of the inhibitor during antibody and complement incubation (dewerchin, ) . since antibodies must be bound to the cell before adcml can occur, an immunofluorescent staining was performed to determine the presence of the antibodies on the surface of the infected cells. cells were fixed with % paraformaldehyde after incubation with fipv-specific pabs. antibodies were stained with fitc-labeled goat anti-cat igg (sigma). after permeabilization with . % saponin, infected cells were stained with n-and m-specific mabs and texas red-labeled goat anti-mouse igg (molecular probes). nuclei were stained with hoechst (molecular probes). two control assays were performed to verify the functionality of the adcml assay: (i) a fipv neutralization assay to detect a higher neutralization in the presence of complement in order to confirm the activity of the feline complement in combination with the fipv-specific pabs and (ii) an adcml assay on pseudorabies virus (prv)-infected feline monocytes and crfks to confirm the activity of the feline complement, the sensitivity of the cells to adcml and to exclude possible interference of the used media. the adcml assay was performed as described above using prv strain kaplan, feline pabs against prv (derived from a geskypur (merial) vaccinated fcov-negative cat, according to manufacturer's instructions), feline complement and fitc-labeled prv-specific pabs to identify infected cells. it has been described that prv-infected porcine macrophages with surface-expressed viral antigens are sensitive to adcml (van de walle et al., ). the results of the adcml with fipv - and the deletion mutant virus strain fipv abc/ ab are given in fig. . with both viruses and both cell types, the percentages of dead fipv-infected cells in the adcml assay with virus-specific antibodies were not significantly different from those in the assay without antibodies (p ≤ . ). also no significant difference was seen with the adcml assay with fipv-negative antibodies. triplicate assays were performed and results were compared using the friedman test from the spss software package (version . ; spss inc.). the presence of fipv-specific antibodies on the surface of infected cells was similar for fipv - and fipv abc/ ab. of the infected crfks, ± . % showed surface-bound antibodies. formation of small aggregates was seen in approximately onefourth of these cells ( fig. a) while the other cells showed larger aggregates (patches) (fig. b) . of the infected monocytes, ± % showed surface-bound antibodies. approximately two thirds of these cells showed small antibody aggregates (fig. c) while the remaining cells showed a more homogeneous antibody distribution (fig. d ). this means that cells are protected against adcml, irrespective of the expression of viral proteins at their surface. the performed controls showed that the combination of antibodies and complement was effective in neutralizing fipv and that the cells were sensitive to adcml. in the presence of complement the virus neutralization titer was two times and times higher for and tcid of fipv - , respectively. the adcml assay with prv showed that the adcml was effective for both crfks and feline monocytes. for both cell types there was a significant rise in the percentage of dead cells with higher antibody concentrations (p ≤ . ; friedman test) (fig. ) . the humoral immune system is activated during a fipv infection, but the antibodies formed seem to be ineffective in eliminating virus and virus-infected cells. for fipv-infected cells, antibodymediated internalization of plasma membrane-expressed viral proteins has been described (dewerchin et al., ) . this inter-nalization, resulting in the absence of viral proteins in the plasma membrane, can protect the infected cells from efficient adcml. inhibiting this internalization process, resulting in infected cells being recognizable by antibodies, could be a part of a treatment protocol for fip cats. unfortunately, results of this study show that even if there are viral proteins present on the plasma membrane, no lysis does occur through adcml. however, if antibodies bind to the surface-expressed viral proteins, cell lysis may still occur via other cell lysis mechanisms e.g. via antibody-dependent, cell-mediated cytotoxicity. in this mechanism, lysis is performed by activated natural killer cells, neutrophils, monocytes or macrophages. lysis of virus-infected cells by antibodies and complement requires viral proteins that are expressed in a form and configuration recognizable by antibodies that can bind complement (hirsch, ) . the fipv-specific antibodies used are able to bind complement since virus-neutralization was higher in the presence of complement. this higher neutralization can be due to virolysis, agglutination of virus-antibody-complement complexes or coating of the virus with complement components which can interfere with the binding of the virus to target cells or alter the surface charge of the virus (hirsch, ; lachmann and davies, ) . for example, it could be possible that binding of complement to the fc portion of the antibody inhibits antibody-dependent enhancement of infectivity (adei), a mechanism which is described in vitro (hohdatsu et al., ) . the fact that neutralizing antibodies are present in a cat with fip, together with the observed enhancement of neutralization by complement in this study, indicates that cell free virus does not play an important role in the pathogenesis of fip (de groot-mijnes et al., ) . for the effectiveness of the adcml, the amount of bound antibodies is also important. the more antibodies that are bound on the surface of infected cells, the higher the percentage of lysed cells is . all fipv-infected crfks showed bound antibodies on their surface. the formation of patches is not likely to have an influence on the adcml assay. it has been described for measles virus-infected cells that redistribution of viral antigens has no influence on the effectiveness of the adcml . half of the infected monocytes showed bound antibodies on their surface, which are consistent with previously published results (dewerchin et al., ) . as expected, the monocytes without surface-expressed viral proteins were protected against adcml, but also no adcml was seen of the monocytes with surface-expressed viral proteins. the possibility that insufficient amounts of antibodies were bound on infected crfks and monocytes to have a detectable effect of adcml is unlikely, but cannot be completely excluded. it seems that fipv can employ another virus complement evasion strategy in addition to the already described retention of viral proteins in the cytoplasm of infected cells and the antibodymediated internalization of plasma membrane-expressed viral proteins. this additional evasion strategy cannot be attributed to the accessory or group-specific proteins abc and ab since lysis of cells infected with the double mutant strain fipv abc/ ab was not detected. these genes encode for proteins that are not necessary for virus growth and infection. their deletion has an attenuating effect on the virulence of the virus in cats (haijema et al., ) . the basis of the attenuation is not known, but there is no correlation with the efficacy of the adcml, as shown in the present study. this new immune evasion strategy has to be attributed to the structural proteins or the non-structural proteins of orf ab and can be direct via viral proteins or indirect by means of cellular proteins that regulate the complement cascade. various virus complement evasion strategies have been described for other viruses. viruses can express proteins with fc receptor activity that can inhibit the binding of complement to the antibody-antigen complex. the glycoprotein ge expressed by herpes simplex virus (hsv) has an fc receptor activity and protects against antibody and complement-mediated lysis, both in vitro and in vivo (adler et al., ; lubinski et al., ) . for fipv, the presence of an fc receptor activity has never been studied but the spike proteins of other coronaviruses, namely mouse hepatitis virus (mhv), bovine coronavirus (bcv) and transmissible gastroenteritis virus (tgev) display fc receptor activity (oleszak et al., ) . another possibility is that the virus encodes proteins with functional similarities to complement control proteins, inhibitors of the complement cascade. no viral complement control proteins have been described for coronaviruses but several have been described for poxviruses and herpesviruses bernet et al., ) . for fipv, this would imply that the spike, membrane and envelope protein or the non-structural proteins encoded by orf should exhibit complement control protein activity, like binding to or accelerating the decay of certain complement factors. finally, it is possible that the virus induces an upregulation of host complement control factors in the infected cell. this has been described for human cytomegalovirus (hcmv) where upregulation of complement regulator cd protected infected cells from complement-mediated lysis (spiller et al., ) . fipv occurs in two types (types i and ii) with type i prevailing in the field (pedersen, ). both types can cause clinical fip and evade the immune system of the cat. the results in this study were obtained with a type ii strain. whether cells infected with a type i strain also show inhibition of complement-mediated lysis has to be determined. a different outcome is possible since this evasion strategy could be attributed to the s protein and the main differences between types i and ii are found in this protein (herrewegh et al., ) . in conclusion, it can be stated that fipv-infected cells are protected against adcml, both the cells with and without surfaceexpressed viral proteins. it appears that during evolution, fipv has become a master in disguise, exhibiting several immune evasion mechanisms to avoid clearance of infected cells by the humoral immune response. possible role of fc receptors on cells infected and transformed by herpesvirus: escape from immune cytolysis viral mimicry of the complement system the relevance of complement to virus biology absence of surface expression of feline infectious peritonitis virus (fipv) antigens on infected cells isolated from cats with fip porcine reproductive and respiratory syndrome virus-infected alveolar macrophages contain no detectable levels of viral proteins in their plasma membrane and are protected against antibodydependent, complement-mediated cell lysis natural history of a recurrent feline coronavirus infection and the role of cellular immunity in survival and disease characterization of putative immune evasion mechanisms of feline infectious peritonitis virus replication of feline coronaviruses in peripheral blood monocytes feline infectious peritonitis virus-infected monocytes internalize viral membrane-bound proteins upon antibody addition virus complement evasion strategies live, attenuated coronavirus vaccines through the directed deletion of group-specific genes provide protection against feline infectious peritonitis feline coronavirus type ii strains - and - originate from a double recombination between feline coronavirus type i and canine coronavirus the complement system: its importance in the host response to viral infection a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies immunobiology, the immune system in health and disease measurement of virus antigens on the surface of hela cells persistently infected with wild type and vaccine strains of measles virus by radioimmune assay cellular composition, coronavirus antigen expression and production of specific antibodies in lesions in feline infectious peritonitis morphologic features and development of granulomatous vasculitis in feline infectious peritonitis complement and immunity to viruses herpes simplex virus type evades the effects of antibody and complement in vivo molecular mimicry between fc receptor and s peplomer protein of mouse hepatitis virus, bovine corona virus, and transmissible gastroenteritis virus a review of feline infectious peritonitis virus infection: - mechanism of injury of virus-infected cells by antiviral antibody and complement: participation of igg, f(ab ) , and the alternative complement pathway antibody-mediated destruction of virus-infected cells altered expression of hostencoded complement regulators on human cytomegalovirus-infected cells absence of viral antigens on the surface of equine herpesvirus- -infected peripheral blood mononuclear cells: a strategy to avoid complement-mediated lysis antibodyinduced internalization of viral glycoproteins and ge-gi fc receptor activity protect pseudorabies virus-infected monocytes from efficient complementmediated lysis pathogenesis of feline infectious peritonitis, pathologic changes and immunofluorescence pathogenesis of feline infectious peritonitis, nature and development of viremia e. cornelissen and h.l. dewerchin were supported by the institute for the promotion of innovation through science and technology in flanders (iwt-vlaanderen). e. van hamme was supported by a doctoral grant from the special research fund of ghent university. key: cord- -kv ekg authors: takano, tomomi; yamada, shinji; doki, tomoyoshi; hohdatsu, tsutomu title: pathogenesis of oral type i feline infectious peritonitis virus (fipv) infection: antibody-dependent enhancement infection of cats with type i fipv via the oral route date: - - journal: j vet med sci doi: . /jvms. - sha: doc_id: cord_uid: kv ekg feline infectious peritonitis virus (fipv) causes a severe, immune-mediated disease called fip in domestic and wild cats. it is unclear whether fip transmits from cat to cat through the oral route of fipv infection, and the reason for this includes that fip is caused by oral inoculation with some fipv strains (e.g., type ii fipv wsu - ), but is not caused by other fipv (e.g., type i fipv ku- strain: fipv-i ku- ). in this study, when cats passively immunized with anti-fipv-i ku- antibodies were orally inoculated with fipv-i ku- , fip was caused at a % probability, i.e., fipv not causing fip through oral infection caused fip by inducing antibody-dependent enhancement. many strains of type i fipv do not cause fip by inoculation through the oral route in cats. based on the findings of this study, type i fipv which orally infected cats may cause fip depending on the condition. feline coronavirus (fcov) belongs to the genus alphacoronavirus, subfamily coronavirinae, family coronaviridae [ ] . fcov is classified into two serotypes (i and ii), based on differences in the amino acid (aa) sequence of spike (s) protein and antibody neutralization. furthermore, fcov exists as two different biotypes: feline enteric coronavirus (fecv: avirulent fcov) and feline infectious peritonitis virus (fipv: virulent fcov) [ ] . antibodies against virus enhance viral load and disease severity in some viral infections including fip. this phenomenon is known as antibody-dependent enhancement (ade) of viral infection [ ] . ade of fipv infection can be induced by the presence of sub-neutralizing levels of anti-fipv s antibodies [ ] . unlike dengue virus infection, ade was induced by re-infection with the identical serotype virus in fipv infection [ ] . fecv is spread predominantly through the oral route in cats [ ] . on the contrary, it is unclear fipv transmits from cat to cat through the oral route of fipv infection. it is suggested that the incidence of fip in cats is dependent on the route of fipv infection. the incidences of fip in cats intraperitoneally and oronasally inoculated with the type i fipv ucd strain were . and %, respectively [ ] . in a similar fashion, a previous study described that oral inoculation with type i fipv ku- strain (fipv-i ku- ) cannot lead to fip in cats, but subcutaneous and intraperitoneal inoculation with fipv-i ku- can lead to fip [ , ] . in this study, we investigated whether oral inoculation with fipv-i ku- causes fip in cats passively immunized with anti-fipv-i ku- antibodies. in addition, we investigated whether ade of type i fipv infection can be promoted in vitro using feline macrophages. anti-fcov antibody-negative seven specific pathogen free (spf) cats aged - months were used. the cats were maintained in a temperature-controlled isolated facility. all experiments were approved by the president of kitasato university through the judgment of the institutional animal care and use committee of kitasato university ( , and - ), and performed in accordance with the guidelines for animal experiments of kitasato university. sample sizes were determined based on the previous study, and the minimum number of cats was used. passive immunization with anti-fipv-i ku- antibodies was performed as described before [ ] . briefly, three cats (ab , ab , and ab ) were subcutaneously administrated with serum from fipv-i ku- -infected healthy cats, and one cat (ab ) was administrated with igg purified from fipv-i ku- -infected cats-derived ascites by ammonium sulfate precipitation followed affinity purification on a protein a column. the neutralizing antibody titer against fipv-i ku- was : in both the serum-and purified igg. the cats were orally inoculated with fipv-i ku- ( . tcid /head) days after passive immunization. as a control, three cats (c , c , and c ) without passive immunization were inoculated with the virus (fig. a) . cats were euthanized when reaching the humane endpoint or days after inoculation with fipv. the test sera were serially -fold diluted in medium and mixed with an equal volume of a virus suspension containing approximately tcid / µl and the mixtures were incubated at °c for min. each mixture was then inoculated into the felis catus whole fetus- cells (kindly supplied by dr. m. c. horzinek of utrecht university) in -well flat-bottomed plates, and incubation was made in an atmosphere of % co in air at °c for days. for each serum dilution, tests were duplicated. the neutralizing antibody titer (nt) was expressed as a reciprocal of the highest dilution of the test sera that inhibiting cytopathic effect completely. the elisa for anti-fcov antibodies was performed as described by takano et al [ ] . briefly, detergent-disrupted, purified fipv virions were diluted appropriately with carbonate buffer ( . m, ph . ). a total of µl of the dilution was pipetted into each well of a -well flat-bottomed plate. the plates were allowed to stand overnight at °c, washed with pbs containing . % tween- , and µl of the test serum sample was then added to each well. horseradish peroxidase-conjugated goat anti-cat igg (icn pharmaceuticals inc., costa mesa, ca, u.s.a.) was diluted to optimal concentration with pbs containing % fcs and . % tween- , and µl of dilution was added to each well of plates. after incubation at °c for min, µl of the substrate solution was added to each well and plates were incubated at °c for min in a dark room. the substrate solution was prepared by dissolving o-phenylenediamine dihydrochloride at a concentration of . mg/ml in . m citric acid and . m na hpo buffer (ph . ), and . µl/ml of % h o was then added. the reaction was stopped with n h so solution and the optical density (o.d.) at nm was determined. rna was isolated from rectal swab samples by a method reported previously [ ] . to synthesize cdna from fipv genomic rna, µl rna extract and . mol sense primer for the fipv nucleocapsid (n) gene (positions - , ′-caactggggagatgaacctt- ′) were added to ready-to-go rt-pcr beads (ge healthcare life sciences) and the volume was adjusted to µl with water. the resulting solution was incubated at °c for hr to synthesize cdna. cdna was amplified by pcr using primers specific for the fcov n gene (sense primer, positions - , ′-caactggggagatgaacctt- ′; antisense primer, positions - , ′-ggtagcatttggcagcgtta- ′). pcr was performed as reported previously [ ] . for the macrophages, feline alveolar macrophages, which are used for analysis of ade of type ii fipv infection [ ] , were selected. feline alveolar macrophages were obtained from spf cats by broncho-alveolar lavage with hank's balanced salt solution (hbss) as described previously by hohdatsu et al. [ ] . feline alveolar macrophages were maintained in rpmi growth medium supplemented with % fcs, u of penicillin per ml, µg of streptomycin per ml, and µm -mercaptoethanol. viral suspension (fipv-i ku- , . tcid / ml) and igg purified from fipv-i ku- -infected cats-derived ascites (subneutralizing titer: final concentration of : ) were mixed in an equal volume ratio and allowed to react at °c for hr, and . ml of this reaction solution was used to inoculate feline alveolar macrophages ( cells) cultured in each well of -well lab-tek chamber slide (thermo fisher scientific, waltham, ma, u.s.a.). as controls, igg alone and virus suspension alone were added to feline alveolar macrophages. after virus adsorption at °c for hr, the cells were washed with hbss and then added ml of growth medium. after hr, n protein levels were determined by immunofluorescence assay (ifa), as described previously [ ] . for recognizing fipv-i ku- n protein, mab yn (mouse igg b) prepared by our laboratory [ ] was used. fipv-infected cells were analyzed using a leica dm microscope and las x integrated imaging system (leica microsystems, wetzlar, germany). two cats (ab and ab ) were euthanized at and day of post fipv infection (dpi) with fipv-i ku- , respectively, when they reached the humane endpoint. these animals showed febrile (> . °c), lethargy, anorexia, and jaundice. upon necropsy, ascites was noted in two cats with fip and pyogranulomatous lesions were present in the intestine and spleen. pleural effusion and inflammatory lesions in the lung were noted in ab . in passively immunized cats without clinical symptoms after fipv infection, several - -mm nodules were observed in the intestine, but there was no other lesion. cats inoculated orally with fipv-i ku- without passive immunization did not develop clinical symptoms. no fip-related lesion was noted on necropsy at dpi with fipv-i ku- . figure b shows the survival rate of cats infected with fipv-i ku- . the survival rate of cats with passive immunization was lower than that of the cats without passive immunization, and the average survival time after infection with fipv-i ku- was also shorter. we tested for the presence of neutralizing antibodies against fipv-i ku- in cats with passive immunization. in cats with passive immunization, nt was increased to - fold on the day of virus inoculation (day post passive immunization) ( fig. a) . nt was maintained at a constant level in cats excluding cats (ab and ab ) which developed fip after viral challenge. in cats without passive immunization, nt started to increase on dpi with fipv-i ku- , and reached - fold on dpi (fig. b) . time-course changes in the serum anti-fipv antibody level were investigated by elisa using purified soluble fipv antigen. in cats passive immunization, the elisa od value was increased to . - . on the day of virus inoculation (day post passive immunization). as with the nt titer, the elisa od value was continuously increased in cats excluding cats developed fip (ab and ab ; fig. c ). in cats without passive immunization, the elisa od value continuously increased - dpi after inoculation with fipv-i ku- , and reached . - . on - dpi (fig. d ). rectal swab samples from cats were subjected to rt-pcr targeting fcov n gene. in cats with passive immunization, fcov n gene was detected day after virus inoculation in ab . however, fcov n gene was not detected in any samples of the other cats (table ) . based on the findings described above, fipv-i ku- was suggested to promote ade through not only subcutaneous but also oral infection. however, the mechanism of ade induced by fipv-i ku- infection is unclear. to elucidate this mechanism, it is necessary to promote fipv-i ku- -induced ade in vitro. therefore, the ade infection with fipv-i ku- was performed in feline macrophage. no fcov n protein was detected in macrophages treated with only igg purified from ascites of fipv-i ku- -infected cats (fig. a) . in macrophages treated with only fipv-i ku- , fcov n protein was detected in . ± . % (mean ± s.d.) of cells (fig. b) . in macrophages treated with both purified igg and fipv-i ku- , fcov n protein was detected in . ± . % (mean ± s.d.) of cells (fig. c) , showing that the fipv-i ku- infection rate in macrophages increased in the presence of the antibody. cats orally infected with fipv-i ku- do not develop fip. on the basis of this fact, the biotype (phenotype) of the orally inoculated fipv-i ku- is classified as "fecv". however, fipv-i ku- has the genetic characteristics of "fipv", i.e., the sequence of the s /s site of fipv-i ku- is rsrss (p r→s) [ ] , and aa at position has been changed from methionine to leucine [ ] . in addition, aa is deleted from c protein in fipv-i ku- [ , ] . furthermore, no amino acid deletion was noted in b protein of fipv-i ku- [ , ] . it is unclear which of these regions is involved in the pathogenicity of fipv-i ku- . it is now possible to prepare recombinant type i fcov by reverse genetics [ , ] . it is desired to mutate the regions associated with pathogenicity in fipv-i ku- , inoculate cats with these mutants through various routes, and confirm whether the mutant causes fip. fcov n genes were hardly detectable from rectal swab samples of cats infected with fipv-i ku- . the reason for this is unclear. we previously confirmed that fcov n genes were detected from rectal swab samples after fipv-i ku- subcutaneous -i ku- ab ------ab - ------+: fcov n gene positive; -: fcov n gene negative. on the basis of these facts, we suggested that inoculation routes result in differential patterns of virus shedding in cats infected with fipv. generally, when a cat developed fip in multi-cat environments, cats living together also develop fip at a high probability [ ] . fipv excreted from cats with fip may infect other cats through the oral route. however, orally inoculated type i fipv mostly does not cause fip in cats [ ] . it has been difficult to explain these contradictory facts. it was clarified that even fipv not causing fip through oral infection may cause fip in anti-type i fcov-seropositive cats. however, not all anti-fipv seropositive cats develop fip. for example, ade is not promoted and the virus is neutralized in cats with a high anti-fipv neutralizing antibody level [ ] . fip also does not develop when cellular immunity is strongly induced after fipv infection [ ] . based on these findings, to elucidate the clinical state of fip, it is necessary to analyze the status of immunity in cats after viral infection. however, many recent studies on fip do not focus on the host but focus on the virus. we suggest that fip is a "multi-causal disease" involving various risk factors (virulence of fcov, the status of immunity in host, and the route of virus infection etc.). we confirmed that fip was caused in % when cats passively immunized with anti-fipv-i ku- antibodies were inoculated orally with fipv-i ku- , i.e., fipv not causing fip through oral infection caused fip by inducing ade. moreover, we were able to demonstrate that infection of fipv-i ku- to feline macrophages was enhanced by anti-fipv-i ku- igg. this study may provide a platform for understanding the mechanism of ade induced by oral viral infection. acknowledgment. this work was in part supported by mext/jsps kakenhi grant number jp k . feline infectious peritonitis. abcd guidelines on prevention and management spike protein fusion peptide and feline coronavirus virulence feline infectious peritonitis: insights into feline coronavirus pathobiogenesis and epidemiology based on genetic analysis of the viral c gene reverse genetics for type i feline coronavirus field isolate to study the molecular pathogenesis of feline infectious peritonitis the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies feline coronavirus: insights into viral pathogenesis based on the spike protein structure and function the prevalence of a group coronavirus in dogs in japan sites of feline coronavirus persistence in healthy cats mutation in spike protein cleavage site and pathogenesis of feline coronavirus virologic and immunologic aspects of feline infectious peritonitis virus infection an update on feline infectious peritonitis: virology and immunopathogenesis screening and identification of t helper and linear immunodominant antibody-binding epitopes in the spike domain and the nucleocapsid protein of feline infectious peritonitis virus antibody-dependent enhancement of viral infection: molecular mechanisms and in vivo implications the cholesterol transport inhibitor u a inhibits type i feline coronavirus infection serological diagnosis of feline coronavirus infection by immunochromatographic test antibody-dependent enhancement occurs upon re-infection with the identical serotype virus in feline infectious peritonitis virus infection tnf-alpha, produced by feline infectious peritonitis virus (fipv)-infected macrophages, upregulates expression of type ii fipv receptor feline aminopeptidase n in feline macrophages mutation of neutralizing/antibody-dependent enhancing epitope on spike protein and b gene of feline infectious peritonitis virus: influences of viral replication in monocytes/macrophages and virulence in cats genome organization and reverse genetic analysis of a type i feline coronavirus feline coronaviruses: pathogenesis of feline infectious peritonitis feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses key: cord- -d iycdyh authors: choong, oi kuan; mehrbod, parvaneh; tejo, bimo ario; omar, abdul rahman title: in vitro antiviral activity of circular triple helix forming oligonucleotide rna towards feline infectious peritonitis virus replication date: - - journal: biomed res int doi: . / / sha: doc_id: cord_uid: d iycdyh feline infectious peritonitis (fip) is a severe fatal immune-augmented disease in cat population. it is caused by fip virus (fipv), a virulent mutant strain of feline enteric coronavirus (fecv). current treatments and prophylactics are not effective. the in vitro antiviral properties of five circular triple-helix forming oligonucleotide (tfo) rnas (tfo to tfo ), which target the different regions of virulent feline coronavirus (fcov) strain fipv wsu - genome, were tested in fipv-infected crandell-rees feline kidney (crfk) cells. rt-qpcr results showed that the circular tfo rnas, except tfo , inhibit fipv replication, where the viral genome copy numbers decreased significantly by -fold log( ) from ( ) in the virus-inoculated cells to ( ) in the circular tfo rnas-transfected cells. furthermore, the binding of the circular tfo rna with the targeted viral genome segment was also confirmed using electrophoretic mobility shift assay. the strength of binding kinetics between the tfo rnas and their target regions was demonstrated by nanoitc assay. in conclusion, the circular tfos have the potential to be further developed as antiviral agents against fipv infection. feline infectious peritonitis virus (fipv) is an enveloped virus with a nonsegmented, positive sense, single-stranded rna genome. fipv is grouped as feline coronavirus (fcov), under the family coronaviridae. fcov is divided into two biotypes, namely, feline enteric coronavirus (fecv), a ubiquitous enteric biotype of fcov, and fipv, a virulent biotype of fcov [ ] . the relationship between these two biotypes still remains unclear. two hypotheses have been proposed, (i) internal mutation theory and (ii) circulating high virulent-low virulent theory. internal mutation theory stated that the development of fip is due to the exposure of cat to variants of fcov which have been mutated by gaining the ability to replicate within the macrophages [ ] , while the circulating high virulent-low virulent theory explains the existence of both distinctive pathogenic and benign lineages of viruses within the cat population [ ] . study has shown that about - % of cats are detected with fecv shedding in their faeces [ ] . about % of these fecv-positive cats have developed immune-mediated fatal fip disease [ ] . the prevalence of fip among felines is due to continual cycles of infection and reinfection of fecv and indiscernible clinical symptoms of infected cats with fecv at an early stage before the progressive development of fipv. vaccination against fipv with an attenuated, temperature-sensitive strain of type ii fipv induces low antibody titre in kittens that have not been exposed to fcov. however, there is considerable controversy on the safety and efficacy of this vaccine, since the vaccine contains type strain, whereas type viruses are more prevalent in the field [ ] . in addition, antibodies against fipv do not protect infected cats but enhance the infection of monocytes and macrophages via a mechanism known as antibody-dependent enhancement [ ] . besides vaccines, several antiviral drugs such as ribavirin, biomed research international interferons, and immunosuppressive drugs have been used as treatments for fipv-infected cats, mainly to suppress the inflammatory and detrimental immune response [ ] [ ] [ ] [ ] . however, those treatments were ineffective. hence, there is still significant unmet medical need to develop effective treatments and prophylactics for fipv infection. triple helix forming oligonucleotide (tfo) is defined as homopyrimidine oligonucleotides, which can form a sequence-specific triple helix by hoogsteen bonds to the major groove of a complementary homopyrimidinehomopurine stretch in duplex dna [ ] . furthermore, double helical rna or dna-rna hybrids can be targeted as a template for triple helix formation, once the strand composition on the stabilities of triple helical complexes is determined [ ] . hence, tfo has been used to impede gene expressions by transcription inhibition of viral genes or oncogenes [ ] [ ] [ ] [ ] [ ] [ ] . the main purpose of this study is to develop and evaluate the in vitro antiviral properties of circular tfo rnas against fipv replication. serotype ii strain wsu - (atcc no. vr- ) was grown in crfk cells. a serial -fold dilution of fipv was prepared from the working stock. confluent -well plate was inoculated with l of each virus dilution/well. the plate was incubated in a humidified incubator at ∘ c, % co . cytopathic effects (cpe) development was observed. the results were recorded after hours and the virus tissue culture infective dose (tcid ) was calculated using reed and muench's method [ ] . oligonucleotide rna. the triple helix forming oligonucleotides (tfos) were designed based on the genome sequence of fipv serotype ii strain wsu - (accession no: ay ) [ ] . tfos, which specifically target the different regions of the fipv genome, and one unrelated tfo were constructed ( table ). the specificity of the tfos was identified using blast search in the ncbi database. the designed linear tfos were synthesized by dharmacon research (usa), whereby the and ends of the linear tfos were modified with phosphate (po ) group and hydroxide (oh) group, respectively. these modifications were necessary for the circularization of linear tfo. the process of circularization, using the t rna ligase (ssrna ligase) (new england biolabs inc., england), was carried out according to the manufacturer's protocol. after ligation, the circular tfo rnas were recovered by ethanol precipitation and the purity of the circular tfo rnas was measured using spectrophotometer. denaturing of urea polyacrylamide gel electrophoresis was performed as described before [ ] with modification. briefly, % of denatured urea polyacrylamide gel was prepared and polymerized for minutes. then, the gel was prerun at to v for minutes. five l of tfo rna mixed with l of urea loading buffer was heated at ∘ c for minutes and immediately chilled on ice. it was run on the gel at v for minutes. finally, the gel was stained with ethidium bromide (sigma, usa) and viewed with a bio-rad gel doc xr system (ca, usa). (emsa) . the target regions of the fipv genome were synthesized by dharmacon research (usa) ( table ) . each tfo rna was mixed with the target region in x binding buffer containing mm tris-hcl, mm mgcl , and mmnacl in a final volume of l and subsequently incubated at ∘ c for hours. the sample was run on % native polyacrylamide gel at v, in cool condition. the stained gel was viewed by a bio-rad gel doc xr system. regions. the binding strength was measured using a nano isothermal titration calorimeter (itc) (ta instruments, newcastle, uk). the rna sample mixtures, consisting of circular tfos ( . mm), were incubated with their respective synthetic target regions ( . mm) using x binding buffer as the diluent. the experiment was run at ∘ c with l/injection, for a total of injections. data was collected every seconds and analyzed using the nanoanalyze software v . . provided by the manufacturer. this experiment was conducted in crfk cells, where × cell/well was seeded in -well plate to reach % confluency hours prior to transfection. one hundred nm of tfo rnas was separately transfected into the crfk cells using a hiperfect transfection reagent (qiagen, germany), as per the manufacturer's protocol. the plate was incubated at ∘ c with % co for hours. then, the cultures were infected with tcid of fipv serotype ii strain wsu - for hour at ∘ c ( l/well). finally, the viral inoculum was replaced by fresh maintenance media (mem containing % fbs and % pen/strep). virus-infected and uninfected cells were maintained as positive and negative controls, respectively. the morphology of the cultures was recorded hours after infection and samples were harvested at this time point and stored at − ∘ c prior to rna extraction. inhibition. different concentrations of circular tfo rna ( nm, nm, nm, and nm) were transfected into crfk cells. the plate was incubated for hours followed by virus inoculation for hour at ∘ c with % co . the cells were processed as described above. madin-darby canine kidney (mdck) cell (atcc no. ccl- ), at a concentration of × cell/well, was seeded in -well plate to reach % confluency hours prior to transfection. transfection was performed the same as before. one hundred nm of circular tfo rna was transfected into mdck cells. following hours orf a/ b and - orf a/ b and - orf a/ b and - - * highlighted in bold indicated the binding region. * * unrelated circular tfo. [ , ] , respectively. the reverse transcriptase quantitative real-time pcr (rt-qpcr) was performed using a bio-rad cfx real-time system (biorad, usa). the reaction was amplified in a final volume of l using a sensimix sybr no-rox one-step kit (bioline, uk), which consisted of . l x sensimix sybr no-rox one- step reaction buffer, m forward and reverse primers, units ribosafe rnase inhibitor, and l template rna. absolute quantification approach was used to quantify qpcr results where a standard curve of a serial dilution of virus was plotted before the quantification. amount of the virus in the samples was quantified based on this standard curve. analysis. data statistical analysis was performed using spss . . data were represented as mean ± se of three independent tests. one-way anova, tukey post hoc test was used to analyze the significant level among the data. ≤ . was considered significant. genome, which play important roles in viral replication, were selected as the target binding sites for the triplex formation. the target regions were untranslated region ( utr), open reading frames (orfs) a and b, and untranslated region ( utr) ( table ). the tfos were designed in duplex, as they can bind with the single stranded target region and reshape into triplex. both ends of the duplex tfos were ligated with a linker sequence or clamps (c-c) to construct circular tfo rna. denaturing page assay was carried out after the ligation process to determine the formation of the circular tfo. as shown in figure , the circular tfo rnas migrated faster than the linear tfo rnas, when subjected to % denaturing page. target region. the binding ability was determined using electrophoretic mobility shift assay (emsa) [ ] . the appearance of the slow mobility band indicates the successful hybridization of circular tfo rna with its target region. the binding ability of different tfo rnas (tfo to tfo ) against their target regions was determined by emsa (figure ) . tfo , tfo , tfo , and tfo showed slow mobility band, while tfo showed the lack of an upward shifted band. this indicates the possession of triplex binding ability for all circular tfo rnas, except tfo . tfo rna. study on the interaction and hybridization of tfo towards its target region is crucial, since the stronger the binding is, the more stable the triplex structure forms. as shown in supplementary figure (table ) . the antiviral effect of circular tfo rnas was investigated by rt-qpcr assay at hours after transfection. the results showed viral rna genome copy numbers of . × , . × , . × , . × , . × , and . × in cells treated with tfo , tfo , tfo , tfo , tfo , and tfo , respectively. the data analyzed by one-way anova, tukey post hoc test showed significant high viral rna genome copy number of . × for virus inoculated cells as compared to circular tfo , tfo , tfo , and tfo treatments ( ≤ . ). the viral rna copies of circular tfo , linear tfo and tfo , and unrelated circular tfo rnas transfected cells also showed high viral rna copy numbers which did not show significant differences to the infected cells ( ≥ . ) ( figure ). the morphological changes of the cells were also captured hours after transfection. the cells transfected with circular tfo , tfo , tfo , and tfo appeared to be in good condition following virus inoculation, while the cells transfected with circular tfo and linear tfo and tfo showed visible cytopathic effect (cpe), the same as virus inoculated cells (supplementary figure ) . furthermore, cells transfected with tfo only remain viable indicating that tfo treatment is generally not toxic to the cells. hence, these results illustrated the capacity of circular tfo rnas (except tfo ) to inhibit fipv replication. concentrations on fipv replication. circular tfo was used to examine the dose-response relationship as a representative to other tfos. the experimental conditions were identical to that of the previous experiment, except for tfo concentrations of nm, nm, nm, and nm. there was no significant reduction in viral rna genome copies using the concentration of nm tfo . the other concentrations caused significant reductions in copy numbers as compared to the virus-infected cells. however, no significant difference was detected in copy numbers from all of these concentrations ( figure ). the specificity of the tfo towards fipv was tested, using tfo and tfo , as the proper representatives of tfos, on influenza a virus h n new jersey / . the analyzed data using one-way anova, tukey post hoc test did not show significant reductions in the copies of viral rna for both tfos compared to the influenza virus inoculated cells ( ≥ . ) (supplementary figure ). complex structure g /cir figure : emsa analysis. emsa analysis illustrated the binding of circular tfo , , , and to the target regions as evidenced by upward band shift. binding of each circular tfo except circular tfo to its respective target forms a complex that migrates slower than unbound tfo. g to g represent the target region for circular tfo to tfo and cir to cir represent the circular tfo to tfo , respectively. in the replication process [ ] . meanwhile, the orf a/ b of fipv are translated into polyproteins that are cleaved into nonstructural proteins which assemble into replicationtranscription complexes together with other viral proteins [ ] . hence, the development of molecular therapy targeting these critical regions may provide the possibility to inhibit fipv replication. development of antiviral therapies against fipv using sirna [ ] and viral protease inhibitors [ ] figure : tfo dose-response study for inhibiting fipv replication. the concentrations of nm and higher showed significant antiviral effects. nm of circular tfo rna was able to reduce viral copy number by -fold log from to , while and nm showed -fold reduction. data are averages of independent tests (mean ± se). * significantly different from fipv-infected group. as potential new treatments against fipv infection. in this study, circular triple helix forming oligonucleotide (tfo) rnas, specifically targeting the short regions of viral genome for triplex formation, were designed and evaluated. tfo and tfo targeted the and utrs of the viral genome, respectively. tfo to tfo targeted different regions of the orf a/ b on fipv genome. prior to in vitro antiviral study, the ligated circular tfos were evaluated using page analysis. all of the circularised tfo showed faster migration pattern compared to the linear tfo; however, only slight variation was detected for some of the tfo (figure ). the reason for this is not clear but probably due to the differences in length and the tertiary structures of the tfos leading to differences in the migration rate. emsa was used to show the binding capability of each circular tfo towards the target region in the fipv genome except for tfo which showed lack of formation of complex structure upon hybridization ( figure ) . the emsa result also concurred with the antiviral study, where all circular tfos (except tfo ) were able to demonstrate a significant reduction in the viral rna genome copy numbers by -fold log from in virus inoculated cells to in tfo-transfected cells (figure ). however, no antiviral properties were detected from the linear tfos and unrelated circular tfo rna, confirming that the antiviral activity is associated with specific binding of circular tfos towards targeted regions. furthermore, the binding of the circular tfo to the target region was confirmed by nanoitc analysis; where the low value and high stability allowed tfos to compete effectively with the target regions for inhibiting transcription in cell-free systems. since, tfo shows the lowest value (table ) , the antiviral properties of this tfo were evaluated in doseresponse study. as shown in figure , and nm of tfo showed similar antiviral effects indicating the potential therapeutic application of tfo on fipv replication. however, increasing the concentration of tfo to nm failed to reduce the viral load further probably due to inefficiency of the transfection reagent to transfect the tfo into the cells. in addition, the virus has fast replication rate upon in vitro infection, where previous study on the growth of fipv in crfk cells showed that by hours approximately % of fipv - were internalized by crfk cells by endocytosis increasing to more than % at hours [ , ] . the above finding probably also explained the reason why no antiviral effect was detected when the transfection of the tfo was performed on virus-infected cells (data not shown). the antiviral properties, as demonstrated by the circular tfos, were probably associated with the binding of the tfo to the target region, based on both the watson-crick and hoogsteen hydrogen bonds, which enhance the stability in terms of enthalpy, which is brought about by joining together two out of three strands of the triple helix in the proper orientation [ ] . therefore, the triplex formation is tightly bonded and not easy to detach. furthermore, the circular tfos were designed in such way that the presence of hydrogen bonding donors and acceptors in the purines is able to form two hydrogen bonds, while the pyrimidine bases can only form one additional hydrogen bond with incoming third bases [ ] . however, there are various factors that may limit the activity of tfos in cells like intracellular degradation of the tfo and limited accessibility of the tfo to the target sites which can prevent triplex formation [ ] . these findings may also explain the inability of the designed tfo to inhibit further virus replication in dose-response study (figure ) . various molecular-based therapies against infectious diseases and cancer have been developed and tested. however, only the sirna-based therapy has been studied extensively as a novel antiviral and anticancer therapy [ , ] . recently, mcdonagh et al. [ ] developed sirna with antiviral activity against the fipv - , where the designed sirna was able to reduce the copy number of viral genome compared with virus-infected cells. the potential therapeutic application of tfos, such as linear tfo conjugated with psoralen to inhibit the transcription of human immunodeficiency provirus [ ] and tfo to inhibit the transcription of (i) collagen in rat fibroblasts [ ] , has also been reported. in addition, short tfo conjugated with daunomycin targeting the promoter region of oncogene has been designed and evaluated on human cancer cells [ ] . these studies indicated the flexibility of using tfo-based oligonucleotides as a potential molecular-based therapy. in this study, we demonstrated short circular tfo rnas between and mers (table ) , which are able to inhibit fipv replication by binding to specific target regions of the fipv genome. all designed circular tfos (except tfo ) showed significant inhibitory effects against fipv replication. the tfos that formed triplex structures showed antiviral effects towards fipv replication. the reason why tfo failed to show any interaction with the target region or antiviral activity is probably due to the length of tfo (i.e., mers), which might be insufficient to a triplex formation upon hybridization (figure ), be effective enough to suppress viral rna transcription, and eventually inhibit virus replication. nevertheless, the inability of tfo to show antiviral effect due to failure in the formation of functional tertiary structure of the triplex formation cannot be ruled out. in vitro antiviral study which showed no antiviral property for unrelated tfo (tfo ) and also inability of circular tfo and tfo to inhibit influenza a virus h n infected cells confirms the specificity of the tfos' activity. in conclusion, the circular tfo rna has the potential to be developed as a therapy against fipv in cats. however, further studies on tfo specificity, actual mechanism of circular tfo rna in the transcription alteration consequence of inhibiting the viral transcription process, and in vivo animal studies are important for this approach to work as a therapy in the future. antibody-dependent enhancement occurs upon re-infection with the identical serotype virus in feline infectious peritonitis virus infection feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses intrahost diversity of feline coronavirus: a consensus between the circulating virulent/avirulent strains and the internal mutation hypotheses? the european advisory board on cat diseases inhibitory effects of ribavirin alone or combined with human alpha interferon on feline infectious peritonitis virus replication in vitro feline infectious peritonitis treatment of cats with feline infectious peritonitis use of recombinant feline interferon and glucocorticoid in the treatment of feline infectious peritonitis specific inhibition of transcription by triple helix-forming oligonucleotides sequence-specific recognition of double helical rna and rna⋅dna by triple helix formation triplex forming oligonucleotides against type (i) collagen attenuates liver fibrosis induced by bile duct ligation targeted inhibition of transcription elongation in cells mediated by triplex-forming oligonucleotides accessibility of nuclear dna to triplex-forming oligonucleotides: the integrated hiv- pro virus as a target antiparallel polypurine phosphorothioate oligonucleotides form stable triplexes with the rat (i) collagen gene promoter and inhibit transcription in cultured rat fibroblasts design of a novel triple helix-forming oligodeoxyribonucleotide directed to the major promoter of the c-myc gene inhibition of human prostate cancer xenograft growth by i labeled triple-helin forming oligonucleotide directed against androgen receptor a simple method of estimating fifty per cent endpoints polyacrylamide gel electrophoresis of rna detection of feline coronavirus rna in feces, tissues, and body fluids of naturally infected cats by reverse transcriptase pcr attenuation of influenza virus infectivity with herbal-marine compound (hesa-a): an in vitro study in mdck cells targeting pyrimidine single strands by tripler formation: structural optimization of binding effect of cations on purine⋅purine⋅pyrimidine triple helix formation in mixed-valence salt solutions a contemporary view of coronavirus transcription in vitro inhibition of feline coronavirus replication by small interfering rnas a biodegradable polymersome containing bcl-xl sirna and doxorubicin as a dual delivery vehicle for a synergistic anticancer effect attachment and internalization of feline infectious peritonitis virus in feline blood monocytes and crandell feline kidney cells feline infectious peritonitis virus-infected monocytes internalize viral membrane-bound proteins upon antibody addition targeting of single-stranded dna and rna containing adjacent pyrimidine and purine tracts by triple helix formation with circular and clamp oligonucleotides triplex dna: fundamentals, advances, and potential applications for gene therapy dna binding and antigene activity of a daunomycin-conjugated triplex-forming oligonucleotide targeting the p promoter of the human c-myc gene structural diversity repertoire of gene silencing small interfering rnas the rna silencing endonuclease argonaute mediates specific antiviral immunity in drosophila melanogaster this work was supported by grant no. ergs/ - / from the ministry of higher education, government of malaysia. the funder had no role in the study design, data collection and analysis, or preparation of the paper. the authors have declared that no conflict of interests exists. oi kuan choong, abdul rahman omar, and bimo ario tejo codefined the research theme. oi kuan choong designed biomed research international and carried out the laboratory experiments, analyzed and interpreted the data, and drafted the paper. oi kuan choong, abdul rahman omar, and parvaneh mehrbod revised the paper thoroughly. all authors have read and approved the final paper. key: cord- -dzmvjh j authors: tupper, g. t.; evermann, j. f.; russell, r. g.; thouless, m. e. title: antigenic and biological diversity of feline coronaviruses: feline infectious peritonitis and feline enteritis virus date: journal: arch virol doi: . /bf sha: doc_id: cord_uid: dzmvjh j antigenically related feline coronaviruses cause two distinct disease manifestations in infected cats. the diseases are feline infectious peritonitis (fip), in which the virus is widely disseminated, and feline enteric coronavirus (fecv), a mild disease in which the virus is usually limited to the villi. these two viruses were found to differ in their growth in cell culture. fipv grows to higher titer, forms larger plaques and switches off host cell protein synthesis more effectively than fecv. cross neutralization studies showed antigenic differences between the strains. there also appeared to be a difference in the nucleoprotein molecular weight of the viruses causing these two different disease syndromes. antigenically related i~line coronaviruses (fcv) cause two different disease manifestations in cats ( , , , ) . the first is known as feline infectious peritonitis (fip), and is characterized by peritonitis and/or pleuritis with occasional central nervous system and ocular involvement ( ) . the inflammatory infiltrate consists of lymphoeytes, plasma cells, and macrophages resulting in either nonsuppurative or a granulomatous inflammarion. the second disease is caused by feline enteric eoronavirus (fecv) and is a subclinical or mild enteric infection in which, lesions are located in the upper third of the villi of the small intestine ( ) . although these viruses are associated with very different disease syndromes, evidence has suggested that the viruses are antigenicmly and biologiemly similar ( ) . it was reported that both virus strains produce relatively large plaques in cell culture and grew to fairly high titers ( ) . in addition, their polypeptides appeared to be the same molecular weight by immunoblotting ( ) . although the strains eausing peritonitis and enteritis in eats were antigenieally and biologicmly similar; neither protected against infection with the other ( ) . therefore, we investigated the antigenic biological and biochemical properties of these viruses in more detail. the viruses were grown in crandell feline kidney (crfk) cells. the cells were mycoplasma free by the method of kenny ( ) . cells were grown at ° c in eagle's minimum essential medium (auto-pow, flow lab., mcclean, va) supplemented with l percent heat inactivated fetal calf serum, mm l-glutamine, my~ sodium bicarbonate, m:~ hepes, tlg/ml sm~ptomycin, and units/ml of penicillin (mem- ). the calf serum was reduced to percent for virus propagation (mem- ). the fip strains wsu -i and nor , and the fecv strains wsu - isolates of fcv were studied. the viruses were cloned by endpoint titration times in microtiter plates. the isolation and in vivo pathogenicity of these strains has been previously reported ( , , ) . virus titers were measured by a plaque assay or a tcids endpoint. the plaque assay was done in mm tissue culture petri dishes (corning, ny). confluent monolayers of crfk cells were inoculated with ~i of a tenfold virus dilution. after adsorption for hour at ° c an overlay media of ml of warmed . percent, carboxyraethyl cellulose in mem- was added. monolayers were fixed with formalin and stained with percent crystal violet five days post infection (pi). plaques were counted using a light box and a plaque counting device (seientifiea). the tcids assay tbr virus infectivity was done in well microtiter plates (falcon) by infection of wells with txl of a tenfold virus dilution. the monolayers were fixed and stained after days. wells were examined for cybopathie effects (cpe) and the formula of reed and muench was used to calculate the tcid~ ( ) . photographs of infected monolayers in mm plates containing approximately distinct plaques were enlarged . times to determine the average plaque size. the diameters of the plaques were measured with a ruler. crfk cells were grown in roller bottles at ° c and infected with the feline coronavirus strains at a multiplicity of infection (moi) of . to . . the supernatant was harvested and pooled at hours pi. all subsequent steps were carried out at ° c similar to the procedure used by schmidt and kenny ( ) . the suspension was clarified by centrifhgation at × g for minutes. polyethylene glycol was added to make a final concentration of percent (w/v). after a hour incubation the precipitate was collected by clarification at , × g for minutes. the pellets were resuspended in hepes bus fer ( . rn.~( hepes-- . ~ nac -- . mm edta-na , ph . ) layered onto a and percent (w/v) sucrose step gradient, and centrifuged at , x g for . hours in a beckman sw rotor. the virus bands at the interface were collected, diluted with an equal volume of hepes buffer and pelleted by centrifugation at , x g for minutes in a beckman sw . . the virus was resuspended in the hepes buffer for inoculation into rabbits to obtain hyperimmune sera. further purification by isopycnic banding was undertaken to obtain purified virus for page. the virus bands were concentrated on a ml cushion of . gm/ml renografin (squibb) in a sw . rotor. the concentrated virus was again diluted in the ttepes buffer and layered onto a continuous . to . (gm/ml) renografin gradient for isopyenie banding using a beckman type rotor at , × g for hours. the visible bands were collected (density . gm/ml) and then pelleted using a beckman sw . rotor. virus pellets were resuspended in hepes buffer and frozen until further use. viral infectivity was measured by tcid. and the protein concentrations were determined by the lowry method ( ). rabbits were hyperimmunized with fipv - or fecv - purified by sucrose rate zonal centrifugation as described above. the rabbit immunization schedule was an intramuscular injection of × t plaque forming units (pfu)/ml in freund's incomplete adjuvant, followed by four small intravenous boosts using doses of . to . ml of inocula containing × l s pfu/ml ( ) . the rabbits were bled l days after the last boost. virus neutralization was carried out in well microtiter plates ( ) . virus, ( tcids virus in ~ ), was added to ~ of serial twofold dilutions of rabbit hyperimmune sera against fipv - or fecv - . the virus-serum mixture was incubated at room temperature for hour after which . × crfk cells in ~! mem- was added. plates were placed in a . percent c incubator at ° c for to hours. monolayers were fixed with formalin, stained with percent crystal violet stain. page was performed in . mm thick slab gels by the method of laemmli ( ) . purified virus samples ( l~g) in buffer ( . ~i tris-hct, pig . , percent mercaptoethanol, percent sodium dodecyl sulfate [sds] and l percent glycerol plus bromophenol blue) were boiled for minutes and placed into each well. proteins were migrated through a stacking gel containing . percent polyacrylamide and resolved using a to percent continuous polyacrylamide gradient gel. a modified silver stain was used to stain protein ( ) . the molecular weight of virus structural proteins was determined by using molecular weight standards (sigma, st. louis, mo). the procedure was similar to that used to label rotavirus polypeptides ( ) . monolayers were prepared in well (costar, cambridge, ma) tissue culture plates by adding × cells/well. the monolayers were washed once and infected with a moi of . virus was allowed to adsorb for hour and then t~g actinomycin d (sigma) in ml mem- was added. the infected cells were incubated for the desired time, washed three times and i ml of t~ci/ml s-methionine in methionine free mem~i was added. the plates were incubated for hour at ° c at which time the media was removed and the monolayers washed once. disruption mixture ( m~ tris-hc , ph . , percent mercaptoethanol, percent sds, and percent glycerol with bromophenol blue) in a . ml volume at ° c was added. samples were treated with an ultrasonic probe and kept at - ° c until used. g.t. qsapper et al.: cell controls of uninfected cells were treated in the same manner. an amount of sample containing to , counts was used per lane for page. some of the gels were stained with . percent coomassie blue in percent isopropano percent acetic acid and destained in percent isopropanol i percent acetic acid. dried gels were exposed to kodak film for autoradiography. virus titers were reproducible throughout the study with fipv strains - and nor having virus titers of - × l pfu/ml and fecv - having a lower titer of n × pfu/ml. the cytopathic effect produced by the three feline coronavirus isolates was characterized by syncytial formation. the plaques of the - and nor strains measured . mm with a + . mm standard deviation while the - strain produced smaller plaques of . mm with a _+ . mm standard deviation ( fig. ) in days in crfk. the plaque size of the fecv - strain were significantly smaller than those of the other two fipv strains by the t test (p = . ). the - and the nor fip isolates were distinct from the - fecv isolate by virus neutralization using homologous and heterologous antisera prepared in rabbits against - and - (table ). the neutralizing titers for fipv -i and nor were similar irrespective of the antiserum used. by comparison, the fecv - strain had a fold difference in neutralization titer using antisera against - and a fold difference when antisera against - was used. these results suggest that - and noi~ strains are antigenically similar by virus neutralization and are distinct from the - strain of feline eoronavirus. each of the three virus strains had the structural protein profile characteristic of that reported for the eoronavirus family ( ) . the peplomer (p) surface protein band measured , molecular weight (mw). the mere- (figs. and ) . this indicated the differences were consistent and were not due to maturation artitsct. there was a cell protein band just above the nucleoprotein of the fecv - of the radiolabelled virus. this band was not present in the purified virus preparation or in radiolabelled - where host cell synthesis was switched off. virus proteins appeared at hours pi and continued to be synthesized throughout the hour study period. in the presence of actinomyein d, fipv - shutoff protein synthesis of crfk cells at to hours post infection, nor a,t to hours. celtula, r protein synthesis was reduced at hours pi by fecv - but was not completely shutoff (fig. ) . the feline coronavirus strains did not shutoff eellula, r protein synthesis in the absence of actinomyein d. the - , nor , and - isolates of feline coronavirus have previously been reported to be similar by their relatively high titer in cell culture, large plaque size, and by indirect immunofluorescenee with antibody-to canine coronavirus ( ) . this study showed similarities between the - and the nor isolates of fipv and difference with the - fecv isolate. the fipv strains produced larger plaques in crfk cells and half a log higher titer of virus than the fecv strain. use of a different cell line (fcwl- cells) and time that the plaques were left to develop may have accounted for the fact that boyle et al. ( ) did not find a difference. however, differences in plaque size and virus titers have been reported for human, murine and porcine eoronaviruses grown in different cell lines ( , , , ) . the fipv strains could be distinguished from the fecv strain by cross neutralization. the low level of cross reactivity with heterologous serum compared to homologous serum suggests considerable antigenic variation between the two groups. however the sera were not very high titer despite immunization of rabbits with biologiemly cloned purified virus, perhaps due to the fragility of the peplomer protein which induces neutralizing antibody ( ) . no differences were seen in the molecular weights of the peplomer but this might be undetectable in such a high molecular weight protein where the relevant epitope may be only a very small part of the entity. previous studies with convalescent sera from naturally and experimentally infected cats did not show these differences in vitro ( , ) but did in vivo where fipv strains did not protect against fecv infection and prior fecv infection even seemed to enhance the pathogenicity of fipv. the molecular weight of the nucleoproteins differed by about , with the fecv strain nueleoprotein being smaller than that of the fipv strains. this was determined by co-running purified virus and pulse radiolabelled polypeptides of both strains. this is considered to be a more sensitive technique than immunoblotting used by boyle et al. ( ) , and may explain the fact that they did not observe this difference. the significance of the dit; ferenee in the molecular weight and any possible relationship to pathogenicity is unknown at the present time. however, differences in molecular weight of the nueleoproteins have been found in strains of murine coronaviruses and a high degree of homology was found between them by hybridization kinetics and peptide mapping ( ) . in vitro infection with the fipv strains reduced the production of host cell proteins. this effect was enhanced by actinomycin d. the fecv strain did not switch off host cell synthesis even in the presence of aetinomyein d. host cell protein synthesis was also shut offby infection with murine coronavirus and different strains vary in the extent to which they do it, ( ) . highly lyric strains of mcv synthesize m structurm polypeptides synchronously whereas the nucleoprotein appears earlier than the other two polypeptides in less lytic infections ( , ) . in this study, all st, ruetural polypeptides appeared synchronously in cells infected with fipv or fecv strains. it is interesting that the more vigorously growing strains which produce more varied and severe disease (fipv) shut off host cell synthesis more effectively than the less pathogenic fecv strain. despite the aforementioned differences, there is currently no evidence that the in vitro differences between the virus strains studied are associated with or linked to the differences in the pathogenicity of fipv and fecv strains in vivo. plaque assay, poiypeptide composition, and immunochemistry of feline infectious peritonitis virus and feline enteric coronavirus isolates rna and polypeptide homology among murine coronavirus characterization of a feline infectious peritonitis vires isolate replication ofmurine coronaviruses in somatic cell hybrids foltned between a mouse fibroblast cell line and either a rat schwannoma line or a rat glioina line defective replication of porcine transmissible gastroenteritis virus in a continuous cell line isolation of subviral components from transmissible gastroenteritis virus the virology and pathogenesis of feline infectious peritonitis hnmunogenicity of myeoplasma pneumoniae contamination of mammalian cells in culture with myeoptasmata. in: fogh j (ed) contamination in tissue culture cleavage of structural proteins during the assembly of the head of bacteriophage t protein measurement with the folin phenol reagent isolation of feline coronavirus from two eats with diverse disease manifestations a simplified uttrasensitive silver strain for detecting proteins in potyaerylamide gels feline infectious peritonitis and feline enteric coronavirus intbction ii. feline infectious peritonitis pathogenic differences between various feline eoronavirus isolates an enteric eoronavirus infection and its relationship to feline infectious peritonitis pathogenicity studies of feline eoronavirus isolates - and - muench tt (i ) a simple method for estimating fifty percent endpoints viral protein synthesis in mouse hepatitis virus strain a -infected cells: effect oftunieamyein application of a microtechnique to viral serological investigation plaque assay and improved yield of human coronaviruses in a human rhabdomyosarcoma cell line immunogenicity and antigenicity of human coronaviruses e and oc coronavirus jhm: intracellular protein synthesis the structure and replication of coronaviruses the molecular biology of coronaviruses thouless me ( ) i~otavirus polypeptides ter meulen v ( ) the biology and pathogenesis of coronaviruses the authors wish to expi~ss their appreciation to a. j. mekeirnan tbr assistance with feline eoronavirus strains. t~eceived august , key: cord- -l vjtrjq authors: shirato, kazuya; chang, hui-wen; rottier, peter j.m. title: differential susceptibility of macrophages to serotype ii feline coronaviruses correlates with differences in the viral spike protein date: - - journal: virus res doi: . /j.virusres. . . sha: doc_id: cord_uid: l vjtrjq the ability to infect and replicate in monocytes/macrophages is a critically distinguishing feature between the two feline coronavirus (fcov) pathotypes: feline enteric coronavirus (fecv; low-virulent) and feline infectious peritonitis virus (fipv; lethal). previously, by comparing serotype ii strains fipv - and fecv - and recombinant chimeric forms thereof in cultured feline bone marrow macrophages, we mapped this difference to the c-terminal part of the viral spike (s) protein (s ). in view of the later identified diagnostic difference in this very part of the s protein of serotype i fcov pathotypes, the present study aimed to further define the contribution of the earlier observed ten amino acids difference to the serotype ii virus phenotype in macrophages. using targeted rna recombination as a reverse genetics system we introduced the mutations singly and in combinations into the s gene and evaluated their effects on the infection characteristics of the mutant viruses in macrophages. while some of the single mutations had a significant effect, none of them fully reverted the infection phenotype. only by combining five specific mutations the infections mediated by the fipv and fecv spike proteins could be fully blocked or potentiated, respectively. hence, the differential macrophage infection phenotype is caused by the cooperative effect of five mutations, which occur in five functionally different domains of the spike fusion subunit s . the significance of these observations will be discussed, taking into account also some questions related to the identity of the virus strains used. coronaviruses (covs) are enveloped, positive-strand rna viruses with genomes of about kilobases (kb). originally considered of veterinary relevance primarily, the outbreaks of severe acute respiratory syndrome (sars)-cov and middle east respiratory syndrome (mers)-cov dramatically established their importance as life-threatening human pathogens as well. while the human coronaviruses (hcovs) mainly target the respiratory system, coronaviruses generally cause respiratory and intestinal tract infections. coronaviruses have been detected in almost all animal species. in cats their occurrence is quite ubiquitous, animals often becoming infected already at a very young age. feline coronaviruses (fcovs) generally cause enteric infections that are very mild or, more typically, pass unnoticed, particularly in older cats. yet, the infections by these feline enteric coronaviruses (fecvs) are not efficiently cleared and often persist in cells of the intestinal mucosa, with virus being shed through the feces for weeks or months, sometimes for over a year (kipar et al., ; pedersen et al., a, b; vogel et al., ) . besides this harmless enteric pathotype another feline coronavirus occurs that causes severe and generally fatal systemic infection: feline infectious peritonitis virus (fipv). this highly virulent but more sporadically occurring pathotype is able to induce lethal immunopathological disease characterized by disseminated pyogranulomas and severe inflammatory damage to serosal membranes, often accompanied by exudation into body cavities (addie et al., ; campolo et al., ; de groot and horzinek, ; drechsler et al., ; haijema et al., ; kipar and meli, ; lorusso et al., ; myrrha et al., ; pedersen, ) . fcovs also come in two serotypes (pedersen et al., a) . serotype i viruses are most prevalent and responsible for about - % of field infections (addie et al., ; benetka et al., ; hohdatsu et al., ; kummrow et al., ) . serotype ii viruses are more rarely observed except in asia, where they may represent up to about % of infections hohdatsu et al., ) . genetic evidence indicates that serotype ii viruses arise by recombination between serotype i fcovs and canine coronaviruses (ccovs) in doubly-infected animals, as a result of which the feline virus acquires the canine virus spike (s) protein (herrewegh et al., ; vennema, ) . together with the ccov s-specific antigenic properties the resulting type ii fcov thus also acquires receptor specificity for the aminopeptidase n (apn) protein, a practically important feature as it has enabled investigators to grow and study these type ii viruses in fapn expressing culture cells while such susceptible cell systems were lacking for type i viruses. the s proteins of the two fcov serotypes are very different. yet, interestingly, each serotype exhibits both pathotypes, fecv and fipv (hohdatsu et al., a, b; pedersen et al., a) . rather than being distinctive circulating viruses (brown et al., ) , ample and convincing evidence has accumulated indicating that fipv arises from fecv by mutation in individual, fecv-infected cats (chang et al., (chang et al., , licitra et al., ; pedersen et al., pedersen et al., , poland et al., ; vennema et al., ) . favored by its ability to persist in the gut and by the relatively high mutation rate of rna viruses, genetic changes in the fecv genome enable this enteric biotype to go systemic. monocytes/macrophages are considered to be instrumental in this biotope switch as they appear to become susceptible to infection due to the critical mutation(s) (pedersen, ) . infected macrophages subsequently transport the virulent pathotype through the body to the organs where it can cause its devastating pathogenic effects. earlier we investigated this macrophage tropism of fcovs in vitro (rottier et al., ) . we used the serotype ii strains fecv - and fipv - . the comparative pathogenicity of these strains was originally described in (pedersen et al., a) , on the basis of which these viruses have subsequently served as the prototypic representatives of the two fcov pathotypes. consistent with observations made by others (dewerchin et al., ; stoddart and scott, ) , we found that fipv, in contrast to fecv, infects and replicates effectively in cultured bone marrow derived macrophages. by constructing -using reverse genetics (haijema et al., ) -and testing fecv/fipv chimeric viruses we were able to map this macrophage tropism to the viral spike protein. surprisingly, but consistent with both viral strains using the fapn receptor, the property was further mapped to the c-terminal, i.e. membrane-proximal domain of the s protein (s ) (rottier et al., ) , which is the domain responsible not for virusreceptor interaction but for viral membrane fusion. the residues responsible for the difference were not further defined. the genomic mutation(s) responsible for the fcov virulence switch have not been identified yet. several genes, including the s gene and the accessory genes a, b, c, a, and b, have been considered (balint et al., ; chang et al., ; kennedy et al., ; licitra et al., ; pedersen et al., ; rottier et al., ; vennema et al., ) . recently, by comparative full-genome analysis of serotype i viruses of each pathotype and by subsequently zooming in on one region of consistent variance by specifically sequencing this region, we detected an amino acid difference that occurred in more than % among fipvs and fecvs (chang et al., ) . intriguingly, this characteristic difference also mapped to the membrane-proximal s part of the s protein. though the biological significance of this difference, particularly its possible effect on the viral monocyte/macrophage infection phenotype, is still unknown, further studies indicated it to relate to systemic spread of the virus in the infected animal (barker et al., ; porter et al., ) . the identification of this characteristic difference between the serotype i fcov pathotypes in the c-terminal part of the s protein, the very part to which we earlier mapped the macrophage tropism in the serotype ii viruses, prompted us to try to identify the critical tropism determinant(s) in these latter viruses. despite some concerns relating to the precise identity of the fcov strains - and - , to be discussed later, but lacking better options to address this critical issue in the pathogenesis of fip, we continued in the present study with investigating the contributions of the amino acids in the spike s domain differing between the prototypic strains to the distinguishing macrophage tropism of these viruses. felis catus whole fetus (fcwf) and murine lr cells (kuo et al., ) were maintained in dulbecco's modified eagle's medium (dmem) (lonza group ltd., bazel, switzerland) containing % fetal calf serum (fcs), iu penicillin/ml and μg streptomycin/ml (all from life technologies, ltd, paisley, united kingdom). the recombinant form of fipv strain - (rec - ) and its derivative carrying the s protein of fecv strain - ( - / s) were generated by targeted rna recombination as described below. all recombinant viruses were propagated and titrated using fcwf cells. the chimeric mfipv, a fipv - derivative in which the s protein ectodomain is from the mouse hepatitis coronavirus (mhv, strain a ), was propagated in and titrated on lr cells (haijema et al., ) . for constructing recombinant mutant fipvs the targeted rna recombination method was performed as described previously (haijema et al., ; rottier et al., ) and as illustrated in fig. a . it makes use of the transcription plasmid pbrdi (genbank ay ), rna transcripts of which consist of a defective fipv - genome lacking nucleotides (nt) - , i.e. they are composed of the genomic 'terminal nt fused to the '-terminal -nt proximal end of orf b and running to the ' end of the genome (haijema et al., ) (numbers based on ay and dq sequences). for the preparation of s gene mutants, derivatives of pbrdi were constructed in which the s gene was replaced entirely (fig. a) or partially (fig. b) by that of fecv strain - (rottier et al., ) and/or in which more subtle mutations were introduced. nucleotide mutations were inserted in the pbrdi plasmid using specific primers and the quikchange xl site-directed mutagenesis kit (agilent, palo alto, ca, usa) following the provider's instructions. donor rna transcripts were synthesized from noti-linearized pbrdi using mmessage mmachine t (life technologies, carlsbad, ca, usa). briefly, μg of template plasmid was mixed with μl of ×buffer, μl of gtp, μl of cap/ntp, and μl of enzyme mix, and incubated at °c for more than h. lr cells were infected with mfipv at a multiplicity of infection (m.o.i.) of . after h of incubation, cells were trypsinized and washed once with % fcs/ dmem and once with pbs (-), and then resuspended in μl of pbs(-) in . cm cuvette for gene pulser (bio-rad, hercules, ca, usa). the rna transcripts were added to the cuvette and pulsed once at . kv with μf using gene pulser. after electroporation, the lr cells were added to a monolayer of fcwf cells in a t flask. after to h of incubation, supernatants were collected and purified by two rounds of limited dilution on fcwf cells. the resulting virus was subsequently amplified once using fcwf cells and used for the experiments. to confirm the sequences of recombinants, viral rnas were isolated after propagation using a qiaamp viral rna mini kit (qiagen, hilden, germany), cdna was synthesized using random primers and super-scriptii reverse transcriptase (life technologies) and the relevant s gene region was amplified with specific primers and the expand high fidelity pcr system (roche, basel, switzerland). the sequencing analysis was performed by macrogen corp. europe (amsterdam, the netherlands). feline macrophages were grown as previously described (rottier et al., ; van der meer et al., ) with some modifications. briefly, the stocks of bone marrow-derived mononuclear cells ( × cells/ ml) stored at - °c were thawed, the cells were washed and resuspended in ml of rpmi (life technologies) containing % fcs, penicillin, streptomycin, l-glutamine, and ng/ml of feline gm-csf ( -fl: r&d systems, minneapolis, mn, usa), and then seeded in -well plates. after days of incubation, non-adherent cells were removed by aspirating the medium and fresh rpmi medium containing ng/ml of gm-csf was added. after an additional days of incubation, the majority of the cells had differentiated into macrophages ( . - . × cells/well) and were used for infection experiments. macrophages were inoculated with viruses at an m.o.i. of or . after h of incubation, inoculum viruses were removed by washing the cells twice with pbs after which % fcs rpmi medium containing penicillin, streptomycin and l-glutamine was added and incubation at °c continued. at the indicated hours of post-infection (h.p.i.), culture supernatants were collected and the virus titers were determined on fcwf cells by tcid assay. fcwf cells were also used to analyze the replication kinetics of viruses. to this end the viruses were inoculated onto fcwf cells at an m.o.i. of . after h of virus adsorption the cells were washed twice with pbs and dmem containing % fcs, penicillin and streptomycin was added. cells were incubated further at °c and culture supernatants were collected at indicated h.p.i. for titration on fcwf cells. to detect viral antigens, macrophages were infected with recombinant viruses as described above and were fixed at and h p.i. with methanol/acetone. the cells were first incubated with a : dilution in pbs of ascites , derived from a fipv - -infected cat (a gift from dr. h. glansbeek and e. te lintelo), and then stained with fitc-conjugated goat anti-cat igg ( , mp biomedicals, santa ana, ca, usa) and dapi (d , invitrogen). the cell images were captured by evos fl (amg, bothell, wa, usa) and the number of nuclei and fluorescence positive cells were counted by image j software ( . r, national institute of health, usa). unpaired t-test was used to detect the statistical significance of the difference. a p value of < . was considered to be statistically significant. the significance levels were expressed as *, p < . or **, (haijema et al., ; rottier et al., ) . these observations confirmed that the poor growth phenotype of strain - in feline macrophages maps to the c-terminal part of its s protein. there are eleven amino acid differences in the c-terminal domain of the s proteins of fipv - and fecv - to which we mapped these viruses' differential ability to infect macrophages (fig. c) . due to the rare occurrence of type ii viruses in the field (addie et al., ; an et al., ; hohdatsu et al., ) , only few s protein sequences, all from fipv's, are available for comparison. alignment of these sequences indicated three amino acids in the c terminal s domain [ (a), (k), and (p)] to be unique to fecv - (fig. c) . we started studying the significance of these unique differences by individually replacing each one of these amino acids in the - s protein of the chimeric - / s virus to the corresponding residue of fipv s using site directed mutagenesis. the mutant viruses were generated by targeted rna recombination. they all replicated indistinguishable from their parents in fcwf cells to titers of to tcid / μl at h p.i. (fig. a) . in macrophages a slight but significant enhancement of replication was observed only by the substitutions a v and k q, with titers reaching around tcid / μl (fig. b) . clearly, the growth difference between viruses - and - in feline macrophages is not caused by a single point mutation in the s protein. thus, we also created double-mutants by combining substitutions. though the resulting three viruses all seemed to exhibit increased replication in macrophages relative to the parental - / s virus, the effect was only significant for the virus carrying the combined substitutions a v and k q (fig. b ). yet, the titer this virus reached was still much lower than that of fipv rec - . in a next round of mutagenesis, we combined additional substitutions by including in our analysis also "non-unique" amino acid differences between the s proteins of strains - and - . we were particularly interested in the effect of substitutions in the protein's c-terminal domain, in view of the atypical amino acid pattern of strain tokyo/cat/ in this domain relative to that of all other fipvs in our sequence collection (see fig. c ). thus, we combined substitutions of the three - -specific amino acids with substitutions at positions and . all new viruses grew equally well in fcwf cells to titers of to tcid / μl (fig. c) . in macrophages, replication of most viruses appeared to be enhanced to some extent relative to virus - / s. among the viruses combining substitutions, significant enhancement was observed for the combination of mutations a v/i v and p s/m i (fig. d) . in the latter case it is of note that each of these mutations individually had not revealed any effect ( fig. b and d) . additional enhancement of replication was achieved when the mutations at these different sites were further combined. thus, the combination of three (positions , and ) and five (positions , , , and ) amino acid substitutions increased virus yields extra by - log units (fig. d) . next, we studied the effects of the reciprocal mutations. thus, corresponding substitutions were made into recfipv - and evaluated for their effect on virus replication in macrophages (fig. ) . as before, all recombinant viruses showed unaffected growth to to tcid / μl in fcwf cells (fig. a) . consistent with our earlier observations (fig. ) , single amino acid substitutions at positions (v to a) and (q to k) reduced virus multiplication in feline macrophages slightly (fig. b) . when combining these substitutions, viruses carrying mutations v a/q k and v a/q k/v i grew statistically less efficient in macrophages than rec - thought the difference was only about log unit (fig. b) . finally, combining substitutions of all five amino acids resulted in a strong and significant virus growth reduction to a level approximating that of virus - / s (fig. b) . collectively, the observations in figs. and indicate that the combined amino acid substitutions in the c-terminal part of s protein can revert the fcov macrophage infection phenotype. there are six other differences between fipv - and fecv - in the c-terminal part of their s proteins ( fig. c ; note that fipv strains df- and - have the same origin). among these differences, the a to d substitution at position in - s has been reported not to affect fcov infection of feline macrophages (rottier et al., ) . we therefore evaluated the effect of mutations at the remaining five positions in the - s protein (fig. ) . once again, all the resulting recombinant viruses grew to the usual titers of to tcid / μl in fcwf cells (fig. a) . of the five single amino acid substitutions, only mutation f c caused a significant, about log decrease in virus yield in feline macrophages. consistently, the reciprocal mutation c f introduced into the - / virus increased replication significantly as well (fig. b) . we also introduced this mutation into two rec fipv - viruses already carrying mutations that decreased replication in macrophages (v a/q k/v i and v a/q k/s p/v i/ i m) as well as into the corresponding two - / s viruses that already carried the inverse mutations causing increased replication in macrophages (a v/k q/i v and a v/k q/ p s/i v/m i). however, when studied for its effect, no additional decrease or increase in virus yield was observed (fig. c) . finally, we evaluated the effects of the mutations on the susceptibility of macrophages to infection and on virus spread. primary infection (virus entry) was measured by immunofluorescence staining of the cells at h.p.i. and virus spread was measured by staining the cells at h.p.i. feline macrophages were inoculated at an m.o.i. of (note that all virus stocks were titrated on fcwf cells), at which dose about % of the cells became antigen-positive at h.p.i. after inoculation with fipv rec - while almost no cells became positive after inoculation with virus - / - (fig. ) , consistent with observations using the parental viruses fipv - and fecv - (rottier et al., ) . for this study we selected three - / s mutant viruses based on their significantly increased growth phenotypes in macrophages: mutants c f, a v/k q/i v and a v/k q/p s/i v/m i. all three recombinant viruses showed increased primary infection at h as well as increased infection spread in macrophages at h after inoculation (fig. a) . the reciprocal substitutions, introduced into fipv rec - s, had generally less dramatic effects on virus entry. only the substitution of all five amino acids caused a significantly decreased infection at h.p.i. (fig. b) . however, when measured at h.p.i., all three mutant viruses exhibited a significant decrease in secondary spread (fig. b) . the results indicate that the observed differences in viral growth in feline macrophages are caused by differences in virus entry and spread (i.e. secondary infection) rather than by differences in virus replication per se. serotype ii fcov strains - and - grow similarly well in feline culture cells like fcwf and crfk but propagate remarkably different in cultured feline bone marrow macrophages, with strain - multiplying very poorly in these macrophage cultures. interesting as these observations are already by themselves, their impact seems even more relevant considering that the differential ability to infect macrophages is the main hallmark distinguishing the harmless enteric from the lethal systemic fcov pathotype (pedersen, (pedersen, , . hence the observations described in this paper are of peculiar interest as the fecv - and fipv - s trains studied have historically served as the prototypes of both pathotypes, though their precise origin and identity have recently been questioned, as discussed below. earlier we mapped the differential efficiency of macrophage infection by the two prototypic serotype ii fcov strains to the s subunit of the viral spike protein. coronavirus spike proteins, trimers of which form the typical virion projections, are class i fusion proteins of which the n-terminal s subunit functions in receptor binding and the cterminal s subunit in membrane fusion. functional domains within the s protein are a proteolytic cleavage site (s ') for fusion activation, located just upstream of a fusion peptide (fp), downstream of which two heptad repeats (hr and hr ) occur, followed by a transmembrane (tm) domain and a c-terminal tail. of the amino acid differences in the s subunit that distinguish fecv - from almost all known fipvs one is located within the putative fp, one in hr , one in the domain between hr and hr , one in the tm domain and one in the c-terminal tail (fig. c) . when analyzing these differences by introducing the relevant mutations into the s domains of our chimeric test viruses it appeared that none of the differences individually could account for the difference in macrophage tropism. thus, though some of the single mutations (a v, k q) significantly enhanced infection mediated by the fecv - s protein, the effect of the others was only marginal. reciprocally, none of the single mutations introduced into fipv - s ignificantly reduced infection of macrophages. rather, combinations of the mutations were required, and only the collective effect of all mutations elicited the maximal, almost complete phenotype reversal, both ways. as the tropism difference between the two fcov strains results from multiple amino acid differences in multiple functional domains of the s subunit, a clear mechanistic interpretation is difficult. since infection by both viruses is mediated by binding of their s subunit to the same fapn receptor (rottier et al., ) , the individually insignificant differences in their s subunit somehow cooperatively determine whether or not feline macrophages, not other feline cells, can be infected. if not at the level of receptor recognition, these differences must act at another level of cell entry, one that manifests itself specifically upon infection of macrophages. considering their distribution across the s polypeptide various aspects can then be considered including coreceptor usage, fusion activation and membrane fusion per se. except for the potential involvement of sialic acids and c-type lectins as attachment factors -mediated by the s subunit (li et al., ) and by s protein-linked sugars (regan et al., ; van hamme et al., ) , respectively -there are no indications for an involvement of an additional receptor in fcov infection. yet, it cannot be excluded that such co-receptor, interacting with the s subunit, is essentially required for infection of feline macrophages and specifically exposed by these cells. similarly, also conditions for membrane fusion per se might be typically different in macrophages as compared to other cells. specific circumstances such as the membrane lipid composition might require adaptations in the s protein to enable efficient fusion and infection. activation of coronavirus spike proteins for membrane fusion occurs by proteolytic cleavage at two sites, the s ' site located just upstream of the fp and the s /s site (millet and whittaker, ) . cleavage at the latter site is typically mediated by furin-like enzymes. this cleavage seems, however, not essential; a furin cleavage motif is absent in the s proteins of many coronaviruses. interestingly, unlike serotype i fcovs the s proteins of which do have a furin cleavage site (de haan et al., ) , such a site is lacking in fcovs of serotype ii. the implications hereof are presently unclear. in the comparable situation of sars-cov, introduction of a furin cleavage motif at the s /s site was shown to enhance cell-cell fusion mediated by the expressed spike protein (belouzard et al., ) . proteolytic activation at the s ' site liberates the fusion peptide, which seems critical for efficient initiation of membrane fusion. cleavage is achieved by enzymes occurring at the cell surface or in the endosomes. the repertoire of these proteases can vary significantly among different cell types, which hence potentially represents a host tropism determinant. consistently, the tropism difference between the serotype ii fcov pathotypes was found by regan et al. to be accompanied by distinctive differences in the sensitivities of fecv - and fipv - to inhibitors of endo-/lysosomal enzymes and endosomal acidification. thus, while infection of various feline cell lines (crfk, ak-d and fc lu) with fecv was highly dependent on cathepsin b and l as well as on low endosomal ph, infection by fipv was independent on cathepsin l and low ph condition but dependent on cathepsin b activity only. notably, this dependence of fipv on cathepsin b was also found to be critical for infection of primary feline blood monocytes . the primary sequences of the two viruses at and around their s ' site do not offer an obvious explanation for these different entry requirements. though there is one sequence difference occurring immediately upstream of the fp, where fipv has a g instead of the r that occurs in the fecv s sequence, this difference is not consistent when considering other available fipv sequences. besides in strain df , which is nearly identical to fipv - and which is perhaps just another descendant of the same viral isolate from which fipv - originated, all other fipvs have an r at this position (fig. c) . we can only speculate about the reasons for the different macrophage entry requirements of fecv - and fipv - , such as long-range structural effects on the exposure of the s ' loop that might be caused by other sequence differences in the s subunit. with regard to the r/g difference observed at the s ' site of fcov strains - and - it is interesting to mention an r to g mutation at exactly the same s ' position that occurred at least twice independently during adaptation of pedv field viruses to vero cells wicht et al., ) . whereas infection of cultured cells with pedv requires trypsin to activate the spike protein for membrane fusion, this particular mutation appeared to render pedv infection trypsin-independent (wicht et al., ) . of the sequence differences between the fcov strains - and - s proteins those at fecv positions , and generally contributed most strongly to the macrophage entry phenotype. of these, residue a occurs in the putative fp. the mechanistic consequences of a change to v as it occurs in fipv s are hard to imagine. this holds as well for a similar change in hydrophobic residues -i to v -occurring in the tm domain. residue k is located in the hr domain. its positive charge is likely to be involved in stabilizing the prefusion spike structure and in facilitating the proper assembly of the -helix bundle during the membrane fusion reaction. a change into the polar residue q is likely to affect these processes though it remains hard to understand why this is beneficial for infection of macrophages. the other two unique differences -p vs s and m vs iexhibited their effects only in combination with the others. though the p to s change certainly has structural consequences, the effects of either of these changes cannot be easily appreciated without more knowledge about the fcov spike structure as well as about the molecular details of the membrane fusion process. an interesting example of how subtle mutations can alter the entry pathway and thereby also the susceptibility of cells to viral infections was recently reported for another alphacoronavirus, hcov- e, known to cause common cold. primary isolates of this virus were found to prefer cell entry via the cell surface by using the transmembrane protease serine [tmprss ]) as the cellular protease for cleavage activation of their s protein (shirato et al., ) . upon serial passaging in culture cells, the virus appeared to rapidly adapt to preferentially using the endosomal pathway by the acquisition of just a single mutation (s d) that allows fusion activation of the s protein by cathepsin l. consistently, the highly passaged classical hcov- e isolate (atcc-vr ) was already shown earlier to use this endosomal enzyme to infect cells (kawase et al., ) . in this case, sequence comparison of the s protein of this laboratory strain with s proteins of clinical isolates led to the identification of two other responsible mutations. their substitutions (r m and n k) in the s protein of the laboratory strain reduced hela cell infection and rendered the virus less sensitive to the action of cathepsin l inhibitor while the converse was observed after introduction of the reciprocal mutations in the s protein of a clinical isolate, suggesting these amino acids to be critical for the cathepsin l recognition of the hcov- e s protein (shirato et al., ) . thus, different amino acid substitutions, all in the s part of the viral spike protein, gave rise to the same outcome. notably, none of these residues is part of the protease recognition site itself as deduced from d structural homology modeling, suggesting their substitutions induce structural changes that alter the s protein's accessibility to cathepsin l. similar effects might also explain the differential abilities of different feline coronaviruses to infect feline macrophages, not only for the serotype ii strains investigated in the current study but perhaps as well for the two serotype i pathotypes that we showed earlier to generally differ by just one amino acid (m l or s a) at a position just upstream of the fp (chang et al., ) . lacking a suitable cell culture system for the more relevant serotype i fcovs, studies into the molecular biology of fcovs have for decades been performed almost exclusively with serotype ii viruses, out of necessity. strains - and - always served as the pathotypic prototypes, particularly after a comparative evaluation of their pathogenicity in kittens had reproduced the distinctive characteristics of the intestinal and systemic infections, respectively, including the typical replication in mature apical columnar epithelial cells by the enteric virus which was also observed for serotype i fecv strain ucd (pedersen et al., b) . more recently, however, concerns have been raised regarding the precise identities of these serotype ii viruses (pedersen, (pedersen, , . fipv - was originally reported to be isolated from a -day-old kitten . it has about % homology to fipv strain df (except in its orf abc region) (balint et al., ) , which was reported to originate from the spleen of a cat that died from fip (evermann et al., ) . the fecv - virus was originally isolated from tissue of an adult cat with fatal peracute hemorrhagic enteritis , yet caused mild to inapparent enteritis in spf cats (pedersen et al., b) . all these viruses were isolated around the same time and in the same laboratory, leading to speculations about their possible relationships. thus, it was suggested that the three virulent viruses might share a common ancestor (balint et al., ) and that the avirulent virus might actually represent a tissue culture-attenuated derivative of a virulent precursor (pedersen, (pedersen, , . the latter concern stems in particular from the observed occurrence of deletions in fecv - ' s genes c and b, genes that are normally intact in avirulent field strains. these deletions may have been acquired during in vitro passaging of the virus as these genes are known to be dispensable for viral replication in cultured cells; actually, during propagation in cell culture fcov mutants with deletions in the b gene are even selected for, suggesting that functional loss of the gene increases viral fitness in vitro (herrewegh et al., ) . of note, avirulent field viruses with (generally small) deletions in gene b have been described (desmarets et al., ; lin et al., a) . it is also worrisome that strain - thus far is the only serotype ii enteric coronavirus isolated. though such viruses have been detected in feces from clinically healthy cats by rt-pcr (lin et al., b) , no successful isolations have been described and, thus, no alternative enteric pathotypes are yet available. in our previous study (rottier et al., ) we described that neither the functional deletion of gene b nor the restoration of gene c in fipv - affected the mutant virus' infection efficiency of bone marrowderived macrophages. obviously, limitations intrinsic to this in vitro system preclude evaluation of contributions from these as well as from other viral genes to biological features that exhibit their phenotype only in the context of the infected animal. rather, our observations with this system primarily relate to the differential in vitro macrophage entry characteristics of the two strains used. hence, the general implications of our observations will await further studies using more and better fecv and fipv representatives, preferably including viruses of serotype i. this work was supported by a grant-in-aid for inter-institute researchers ( - ) from the naito foundation, japan. persistence and transmission of natural type i feline coronavirus infection feline infectious peritonitis. abcd guidelines on prevention and management prevalence of korean cats with natural feline coronavirus infections molecular characterization of feline infectious peritonitis virus strain df- and studies of the role of orf abc in viral cell tropism limitations of using feline coronavirus spike protein gene mutations to diagnose feline infectious peritonitis activation of the sars coronavirus spike protein via sequential proteolytic cleavage at two distinct sites prevalence of feline coronavirus types i and ii in cats with histopathologically verified feline infectious peritonitis genetics and pathogenesis of feline infectious peritonitis virus identification of a feline coronavirus type i strain from a cat with feline infectious peritonitis by rt-pcr and phylogenetic analysis feline infectious peritonitis: insights into feline coronavirus pathobiogenesis and epidemiology based on genetic analysis of the viral c gene spike protein fusion peptide and feline coronavirus virulence feline infectious peritonitis cleavage of group coronavirus spike proteins: how furin cleavage is traded off against heparan sulfate binding upon cell culture adaptation experimental feline enteric coronavirus infection reveals an aberrant infection pattern and shedding of mutants with impaired infectivity in enterocyte cultures replication of feline coronaviruses in peripheral blood monocytes feline coronavirus in multicat environments characterization of a feline infectious peritonitis virus isolate switching species tropism: an effective way to manipulate the feline coronavirus genome feline coronaviruses: a tale of twofaced types the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes feline coronavirus type ii strains - and - originate from a double recombination between feline coronavirus type i and canine coronavirus characterization of monoclonal antibodies against feline infectious peritonitis virus type ii and antigenic relationship between feline, porcine, and canine coronaviruses antigenic analysis of feline coronaviruses with monoclonal antibodies (mabs): preparation of mabs which discriminate between fipv strain - and fecv strain - the prevalence of types i and ii feline coronavirus infections in cats protease-mediated entry via the endosome of human coronavirus e deletions in the a orf of feline coronavirus associated with an epidemic of feline infectious peritonitis feline infectious peritonitis: still an enigma? sites of feline coronavirus persistence in healthy cats feline coronavirus serotypes and : seroprevalence and association with disease in switzerland retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier cellular entry of the porcine epidemic diarrhea virus mutation in spike protein cleavage site and pathogenesis of feline coronavirus field strain feline coronaviruses with small deletions in orf b associated with both enteric infection and feline infectious peritonitis genetic diversity and correlation with feline infectious peritonitis of feline coronavirus type i and ii: a -year study in taiwan discrepancies between feline coronavirus antibody and nucleic acid detection in effusions of cats with suspected feline infectious peritonitis isolation of feline coronaviruses from two cats with diverse disease manifestations host cell proteases: critical determinants of coronavirus tropism and pathogenesis the paradox of feline coronavirus pathogenesis: a review receptor-bound porcine epidemic diarrhea virus spike protein cleaved by trypsin induces membrane fusion a review of feline infectious peritonitis virus infection: - an update on feline infectious peritonitis: virology and immunopathogenesis pathogenic differences between various feline coronavirus isolates pathogenicity studies of feline coronavirus isolates - and - pathogenesis of feline enteric coronavirus infection pathogenesis of feline enteric coronavirus infection significance of coronavirus mutants in feces and diseased tissues of cats suffering from feline infectious peritonitis feline infectious peritonitis: role of the feline coronavirus c gene in intestinal tropism and pathogenicity based upon isolates from resident and adopted shelter cats two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus amino acid changes in the spike protein of feline coronavirus correlate with systemic spread of virus from the intestine and not with feline infectious peritonitis utilization of dc-sign for entry of feline coronaviruses into host cells differential role for low ph and cathepsin-mediated cleavage of the viral spike protein during entry of serotype ii feline coronaviruses feline lectin activity is critical for the cellular entry of feline infectious peritonitis virus acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein clinical isolates of human coronavirus e bypass the endosome for cell entry intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence intriguing interplay between feline infectious peritonitis virus and its receptors during entry in primary feline monocytes genetic drift and genetic shift during feline coronavirus evolution feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses pathogenic characteristics of persistent feline enteric coronavirus infection in cats proteolytic activation of the porcine epidemic diarrhea coronavirus spike fusion protein by trypsin in cell culture the authors declare that they have no competing interests. key: cord- - r ow authors: o’brien, amornrat; mettelman, robert c.; volk, aaron; andré, nicole m.; whittaker, gary r.; baker, susan c. title: characterizing replication kinetics and plaque production of type i feline infectious peritonitis virus in three feline cell lines date: - - journal: virology doi: . /j.virol. . . sha: doc_id: cord_uid: r ow investigating type i feline coronaviruses (fcovs) in tissue culture is critical for understanding the basic virology, pathogenesis, and virus-host interactome of these important veterinary pathogens. this has been a perennial challenge as type i fcov strains do not easily adapt to cell culture. here we characterize replication kinetics and plaque formation of a model type i strain fipv black in fcwf- cells established at cornell university (fcwf- cu). we determined that maximum virus titers (> ( ) pfu/ml) were recoverable from infected fcwf- cu cell-free supernatant at hours post-infection. type i fipv black and both biotypes of type ii fcov formed uniform and enumerable plaques on fcwf- cu cells. therefore, these cells were employable in a standardized plaque assay. finally, we determined that the fcwf- cu cells were morphologically distinct from feline bone marrow-derived macrophages and were less sensitive to exogenous type i interferon than were fcwf- cells purchased from atcc. feline coronaviruses (fcovs) are members of the alphacoronavirus genus that infect cats and can cause the highly lethal disease known as feline infectious peritonitis (fip) (pedersen, ). fcov infection is widespread among domestic feline populations, especially within multicat households and catteries, which can exhibit upwards of % seropositivity (addie et al., ; addie and jarrett, ; hohdatsu et al., ; pedersen, pedersen, , vennema et al., ) . despite the global burden of fcov infection, there are no currently approved therapeutics to treat fip; however, reports of direct inhibition of virus growth and treatment of individual cats using small molecule viral inhibitors have been promising (kim et al., (kim et al., , (kim et al., , (kim et al., , murphy et al., ; pedersen et al., ; st john et al., ) . fcovs are typically grouped into two biotypes (or pathotypes), which have been classified as feline enteric coronavirus (fecv) and feline infectious peritonitis virus (fipv), based on tissue tropism, disease progression, and genetic markers (reviewed in kipar and meli, ; pedersen, pedersen, , , although the range of disease signs and clinical outcomes are likely to extend beyond these two basic definitions. endemic fecv causes mild enteritis associated with loose stool and diarrhea and commonly leads to an asymptomatic, persistent infection (addie, ; addie et al., ; pedersen et al., ) . a subset of these infections ( - %) result in lethal fip (addie and jarrett, ; pedersen, ) arising from a shift in virus tropism and systemic infection of monocytes and macrophages. perturbations of the host feline immune state leading to immune deficiency can allow virus replication to surge (pedersen, ; tekes and thiel, ) , resulting in the formation of a quasispecies and the genetic sampling required for progression of fecv to the second biotype, fipv. the internal mutation theory proposes that, within an individual animal, fipv arises directly from fecv due to accumulation of non-synonymous mutations in spike (s) (licitra et al., (licitra et al., , rottier et al., ) and group-specific proteins (chang et al., ; herrewegh et al., ; lin et al., ; pedersen et al., ; phillips et al., ; poland et al., ; vennema et al., ) . the resulting infection of monocytes and macrophages by fipv leads to systemic spread and development of immune-mediated fip (pedersen, ) . fcov biotypes are further defined by their viral s protein. classically, antigenicity of the s protein alone has been used to categorize fcovs into two serotypes (type i and type ii) (hohdatsu et al., specific grouping of fcovs into two clades via functionality-based sprotein sequencing (whittaker et al., ) . type i viruses account for the bulk ( - %) of natural infections in domestic cats, while type ii fcov, a naturally-occurring recombinant between the type i and canine coronavirus (ccov) spike proteins (herrewegh et al., ) , is far less prevalent (< %) (addie et al., ; benetka et al., ; hohdatsu et al., ; kennedy et al., ) . a commendable number of studies focus on type ii fcov as these viruses are much more easily propagated in cell culture. however, it is difficult to know how accurately type ii laboratory strains reflect natural infections with type i viruses given that the bulk of what is known about type i is extrapolated from studies using a type ii virus. it is critical that we investigate type i fipv in laboratory cell culture in order to understand the basic virology of natural infection, characterize type i clinical isolates, test novel therapeutics, and develop effective feline vaccines with broader coverage. however, this has been challenging because type i fcovs cannot be easily adapted to laboratory cell culture; furthermore, the receptor for type i is not known (cham et al., ; dye et al., ; hohdatsu et al., ) , making the identification of highly permissive cell types difficult. select type i isolates, such as the fipv black strain used in this study, have been adapted to growth in tissue culture at the cost of reduced in vivo virulence (black, ; pedersen, ; tekes et al., ; thiel et al., ) . feline airway epithelial (ak-d) cells propagate fipv black (regan et al., ) ; however, these cells do not represent natural tropism for fipv. felis catus whole fetus (fcwf- ) cells are a more physiologically-relevant feline macrophage-like cell line (jacobse-geels and horzinek, ), but these cells come with several technical drawbacks for studying type i fipv. first, fcwf- cell doubling time is slow (> h) (american type culture collection, ) and cells do not grow to high density. second, previous studies report that type i fipv grows to low titers (< pfu/ml) in these cells relative to type ii (> pfu/ml) (tekes et al., ) and can be measured by determining the % tissue culture infectious dose (tcid ) (ramakrishnan, ; reed and muench, ) or by plaque assay (tekes et al., (tekes et al., , . third, type i virus kinetics are variable in fcwf- cells, requiring between and h to achieve maximum titer (jacobse-geels and horzinek, ; tekes et al., tekes et al., , this study) . finally, some reports suggest that type i is highly cell-associated (jacobse-geels and horzinek, ; pedersen et al., ) and multiple freeze-thaw cycles may be required to recover virus. together, these factors have made investigation of type i fipv challenging. as part of this study, we characterized three feline cell lines-two from the american type culture collection (atcc) and one from cornell university-and evaluated the replication kinetics, efficiency of plaque formation, and responsiveness of these cells to interferon (ifn) in order to identify the optimal cell culture conditions for type i fipv black. we found that an fcwf- cell line established at cornell university college of veterinary medicine, designated fcwf- cu, propagates type i fipv to significantly higher titers in cell-free supernatant and with more rapid kinetics compared to commercially available fcwf- cells. we show that fcwf- cu cells are less responsive to exogenous type i interferon than fcwf- cells from the atcc and are permissive to infection by both biotypes of type ii fcov. to facilitate cell-free titer was determined from cell-clarified supernatants; cell-associated titer was determined from suspended cell monolayers following three freeze-thaw cycles alternating between − °c and o c. samples were taken at hours post-infection (hpi) just prior to, at, and following the maximum (max) virus titer for each cell type. titers determined by plaque assay on ak-d cells in triplicate; error bars ± sd. quantitation of fipv black, we established a standardized plaque assay method using fcwf- cu cells and commercially available ak-d cells and show that both cell types permit rapid and consistent quantitation of infectious titers of type i fipv as well as type ii fipv and fecv from cell-free supernatants. to determine the optimal cell type and conditions required to grow the type i fipv black strain, we evaluated virus growth kinetics using a standard infection time course. cells were infected at a multiplicity of infection (moi) of . and virus titer was determined by plaque assay from cell-free supernatants over h. fipv black, a distinct type i lab strain that replicates in feline epithelial cells, replicated as expected in ak-d cells reaching a maximum titer > pfu/ml at h post-infection (hpi) (fig. a) . in our hands, using fcwf- cells purchased from the atcc, the replication of fipv black reached a maximum titer > pfu/ml over - hpi (fig. a) . strikingly, fipv black replication kinetics and maximum titer were drastically different in an fcwf- cell line established at cornell university college of veterinary medicine (fcwf- cu). using these cells, the virus reached a significantly higher maximum titer of > pfu/ml at hpi. in other words, nearly times more virus was produced from the fcwf- cu cells a full - days faster than in fcwf- atcc cells. to address whether the differences in titer observed between ak-d, fcwf- cu, and fcwf- atcc cells were due to differences in cell-free and cell-associated virus, we compared the cell-associated and cell-free virus titers from each cell type at the time points around the respective maximum titers. surprisingly, the cell-free virus titers were higher than the cell-associated titers at all time points and in all cell types assayed (fig. b) . this indicates that fipv black virions are released into cell supernatant during infection of cell culture and freeze-thaw cycles are not necessary to obtain high virus titers. although the maximum titers of fipv black were comparable between ak-d and fcwf- cu cells, the progression of cell cytopathic effects (cpe) induced by the virus differed. fipv black formed large, uniform syncytia in fcwf- cu cells, while individual cell-death-induced clearings were observed in infected ak-d cells ( fig. a ). of note, maximum titers from both cell types were obtained just prior to the appearance of major cpe, allowing a visual guide to virus collection. to further demonstrate this point, fcwf- cu and ak-d cells infected with fipv black were labeled with an anti-nucleocapsid antibody (ccv - ) (poncelet et al., ) and visualized by immunofluorescence prior to the induction of major observable cpe. as expected, the majority of cells were positive for virus antigen (fig. b ) and the differences in cpe are clearly shown: note the syncytial membrane fusion in infected fcwf- cu cells and the maintenance of distinct cell membranes in infected ak-d cells (fig. b) . together, these results demonstrate the ability of the fcwf- cu cells to rapidly produce high levels of type i fipv black in cell-free supernatants. after observing the rapid and uniform development of cpe and release of virus into cell supernatants during infection of ak-d and fcwf- cu cells, we reasoned that these cells would be employable in a standardized plaque assay to consistently determine fipv black titer. to this end, we calculated the endpoint titer and compared the size, uniformity, and timing of virus plaque development over time in ak-d, fcwf- atcc, and fcwf- cu cells following infection with -fold dilutions of the same fipv black virus stock initially grown on fcwf- cu cells. a detailed description of the plaque assay is provided in the materials and methods; we note here that oxoid agar is critical for visualizing clear plaques. at days post-infection (dpi), fipv black formed enumerable plaques on both ak-d and fcwf- cu cells with the latter cells producing more numerous and larger plaques at higher dilutions (fig. top) . plaques were not observed in fcwf- atcc cells at dpi (fig. top) . plaques were detected at dpi (fig. middle) ; and were more clear at dpi in fcwf- atcc cells (fig. bottom) . calculated titers overall were higher in fcwf- cu (> pfu/ml) than in ak-d cells (≥ pfu/ml); however, we report that both cell types are useful for determining virus titer, whereas the fcwf- atcc cells are not ideal for use in this assay. the apparent differences in production and kinetics of fipv black virus in two fcwf- cell lines led us to ask if there are morphologic or functional differences between the two cell types. to answer this question, we first compared the single-cell morphologies of fcwf- atcc, fcwf- cu cells, and primary feline bone marrow-derived macrophages (fbmdms) by wright-giemsa staining. the typical morphologic characteristics of feline macrophages (large cytoplasmic inclusions, a non-dominant nucleus, a non-ruffled cell membrane) (bienzle et al., ) were observed for the fbmdms (fig. a) . comparison of the two fcwf- cell lines revealed stark differences in morphology. fcwf- atcc cells were large with a smooth cell membrane and had large and abundant cytoplasmic inclusions comparable to the fbmdms (fig. a ). fcwf- cu cells were more similar in size to fbmdms; however, the fcwf- cu cell line exhibited fewer cytoplasmic inclusions and more cell membrane ruffling (fig. a ) than either the fbmdms or fcwf- atcc cells. neither fcwf- cell line had a "true" macrophage morphology further corroborating their original "macrophage-like" description (jacobse-geels and horzinek, ). as macrophages are innate immune cells that restrict virus replication through production of interferon-stimulated genes (isgs) in response to type i ifn, we reasoned that differences in virus replication may be due to variation in cell ifn-responsiveness. therefore, we asked if fcwf- atcc and cu cell lines differed in responsiveness to exogenous type i ifn by measuring the resulting isg transcript production following treatment with ifn. remarkably, fcwf- atcc cells produced significantly higher isg transcripts in response to ifn stimulation compared to fcwf- cu cells (fig. b) , suggesting that the fcwf- cu cells are much less responsive to ifn. this is not to say, however, that fcwf- cu cells are insensitive to ifn since they also exhibit significant, dose-dependent isg transcript production. together, these data highlight the distinct morphology of the fcwf- cu cells and suggest that enhanced virus replication in these cells may be due, at least in part, to reduced ifnresponsiveness. due to the high titer and rapid kinetics of type i fipv black replication in the fcwf- cu cells, we next addressed whether these cells are permissive to type ii fcov infection. fcwf- cu cells were infected with type i fipv black or one of two type ii viruses, fipv - or fecv - . cell cytopathic effects were observed over time in these cells, with the viruses all forming similar, large syncytia (fig. a) . cellfree virus titers were determined at and hpi. all three viruses accumulated to titers > pfu/ml in supernatants by hpi (fig. b) , with fipv - reaching the highest titer. the kinetics of the type ii viruses were faster than the type i fipv black strain, producing higher titers by hpi (fig. b) and inducing more substantial syncytial cpe by hpi (fig. a) . next, we asked if the fcwf- cu cells could be utilized in a plaque assay for determining the titer of type ii fcov. indeed, both fipv - and fecv - formed clear, uniform, enumerable plaques at hpi (fig. c) . thus, we have demonstrated that the fcwf- cu cells replicate both fcov types and biotypes to high titers and are employable in a plaque assay to consistently determine the titers of all viruses assayed. since the isolation of the fipv black strain in (black, ) it has remained a predominant model of type i fipv because it is cultivatable in commercially available fcwf- cells. however, different groups have reported major variations in the growth kinetics, maximum obtainable titer, and techniques for recovery of this virus from tissue culture (jacobse-geels and horzinek, ; pedersen et al., ; tekes et al., tekes et al., , thiel et al., ) . for example, maximal titers measured by determining the tcid can range between > (jacobse-geels and horzinek, ) and tcid /ml (takano et al., ) at - hpi, or measured by plaque assay between > ( hpi) (tekes et al., (tekes et al., , and > pfu/ml ( hpi) (this report). this suggests either high variability in the fcwf- cell lines used or co-adaptation between a particular virus and fcwf- cell line used during laboratory cultivation. indeed, we report significant differences in fipv black replication properties between an fcwf- cell line that was newly purchased from the atcc, and the fcwf- cells that were established at cornell university. the enhanced rate of fipv black virus growth and increased maximum titer (> pfu/ml by hpi) obtained from infected fcwf- cu cells, however, may not be due to coadaptation with our particular strain of fipv black, as these cells also replicated both biotypes of type ii viruses. instead, the fcwf- cu cells may be highly susceptible to fcov infection in general and therefore may be particularly useful in generating highly-permissive cell types to isolate and grow clinical type i fcovs. the increased virus infection of fcwf- cu cells could be due to any number of cellular factors; however, it is tempting to speculate that the reduced ifn-responsiveness of the fcwf- cu cells relative to the fcwf- atcc cells may significantly enhance infection in the former. further, these fcwf- cu cells may express a higher density of the yet unknown type i virus receptor (cham et al., ; dye et al., ) and therefore may be critical in identifying the receptor or other cellular characteristics that allow for enhanced type i virus replication. fipv black infection of fcwf- cells has also been reported to be highly cell-associated (jacobse-geels and horzinek, ; pedersen et al., ) , requiring suspension and freeze-thaw cycling to release infectious virus. in contrast, we found significantly higher titers of virus in cell-free supernatants and speculate that multiple freeze-thaw cycles may actually decrease virus titer by damaging the virus envelope. the release of virus into cell supernatants and the uniform cpe observed in ak-d and fcwf- cu cells were critical in establishing a standardized plaque assay using either cell type. further, we report that the stage of cpe development can be used as an indicator of when maximal virus titers can be recovered. one possible explanation for the varied reports on titer of fipv black is that laboratory lines of fcwf- cells have deviated from the original atcc stock. this is likely what occurred at cornell university to produce the fcwf- cu cell line, given that fcwf- cells were obtained from the atcc and then passaged for many years. to our knowledge, this is the first report describing the phenotypic differences between the original fcwf- cells available from the atcc and a distinct lineage that was derived from the original cells. many challenges are still associated with the growth of type i fcov in tissue culture, including the lack of a known cell-entry receptor and no highly permissive cell type that rapidly grows clinical samples of these viruses. however, our studies with the fcwf- cu cell line demonstrate that rapid, high titers of type i fipv black can be recovered from cell-free supernatants and enumerated using a standardized plaque assay. it is our hope that the fcwf- cu cells will alleviate some of the technical hardships associated with the growth of type i fcov and expedite investigation of a wider range of type i fcov strains. the fcwf- cu cells, due to their distinct growth kinetics and enhanced replication of fipv black virus, will be deposited at the atcc to facilitate their distribution to the research community. feline coronavirus strains including type i feline infectious peritonitis virus (fipv) , type ii fipv wsu - , and type ii feline enteric coronavirus (fecv) wsu - were kindly provided by dr. fred scott, cornell university college of veterinary medicine, ithaca, ny. feline airway epithelial (ak-d) cells were purchased from the american type culture collection (atcc) (atcc ® ccl- ™) and maintained in dulbecco's modified eagle medium (dmem; gibco, # - ) containing % fetal bovine serum (fbs) (atlanta biologicals, #s ), supplemented with . g/l of sodium bicarbonate (sigma, #s ), % non-essential amino acids (hyclone, #sh . ), % hepes (hyclone, #sh . ), % sodium pyruvate (corning, # - -ci), % l-glutamine (hyclone, #sh . ), and % penicillin/ streptomycin (corning, # - -ci). when cells grew to a confluent monolayer, the medium was removed and the monolayer was rinsed with pbs. the cells were removed by addition of ml of . % trypsin (gibco, # - ) in versene solution ( . mm edta in pbs) for - min at room temperature. for routine passaging, approximately . × - . × cells were transferred ( : split) to a new t- flask every days. felis catus whole fetus (fcwf- ) cells were purchased from the atcc (atcc ® crl- ™), designated fcwf- atcc cells. fcwf- atcc cells were maintained in minimal essential medium eagle (emem) (sigma, #m ) containing % fbs, supplemented with . g/l sodium bicarbonate, % non-essential amino acids, % hepes, % sodium pyruvate, % lglutamine and % penicillin/streptomycin. as described by the atcc, the doubling time for these cells is > h. when cells were confluent in t- flask, the monolayer was washed with pbs, then cells were removed by addition of . ml . % trypsin-versene solution for - min at room temperature. for routine passaging, approximately . × - . × cells were transferred ( : split) to a new t- flask every days. a second source of felis catus whole fetus cells were provided by dr. edward j. dubovi, cornell university college of veterinary medicine, ithaca, ny, designated fcwf- cu, and maintained in the same medium as the fcwf- atcc cells. when cells were confluent, the monolayer was washed with pbs, then cells were removed by addition of ml . % trypsin-versene solution for - min at room temperature. for routine passaging, approximately . × - . × cells were transferred ( : split) to a new t- flask every days. all cells used in this study were monitored for mycoplasma contamination using a pcr-based assay. cell culture supernatants were routinely collected after days of culture and then heat-inactivated at °c for min. pcr amplification for mycoplasma detection was performed using a forward primer: '-ggc gaa tgg gtg agt aac acg - ' and a reverse primer: '-cgg ata acg ctt gcg acc tat g - '. thermocycler settings were as follows: initial denaturation at °c for min; cycles consisting of denaturation at °c for s, annealing at °c for s, and extension at °c for s; and a final extension at °c for min. the pcr products were analyzed on % (w/v) agarose gel. dna fragments were visualized with a uv transilluminator after being stained with ethidium bromide. if mycoplasma was detected, the cells were treated for days with . μg/ml of mycoplasma removal agent (bio-rad, #buf ). all results shown here are from mycoplasma negative cells. iacuc approved protocols. total bone marrow content was collected. red blood cells and fatty tissue were removed by lysis in ack lysis buffer and straining through a . µm filter (falcon). the remaining cells, predominantly hematopoietic stem cells, were cryopreserved at . × cells/ml in % fbs and % dmso. feline bone marrow derived macrophages (fbmdms) were differentiated as previously reported (gow et al., ) with slight modification. briefly, . × bone marrow cells were plated in × mm petri dishes (vwr, # - ) in dmem (corning, # - -cv) supplemented with % fbs, , iu/ml recombinant human (rh) m-csf (peprotech, # - ) and μm β-mercaptoethanol then incubated at °c and % co . at day , supernatant was removed, clarified of cells, diluted : with fresh dmem supplemented with % fcs and , iu/ml rhm-csf, and returned to cells. fbmdms were recovered on day by gentle aspiration in pbs following min, °c incubation in pbs. the plaque assay technique was established using both ak-d and fcwf- cu cells. . × cells per well were plated in -well plates or . × cells per well were plated in -well plates. cells were infected with -fold serial dilutions of viral samples for h at °c, followed by overlaying with a . % oxoid agar (oxoid ltd, #lp )-dmem containing % fbs mixture. plates were incubated at °c for h (or the indicated time) and fixed using . % formaldehyde-pbs solution for min. viral plaques were visualized by staining with . % crystal violet for min and photographed. we note plaques were clearly evident when we used oxoid agar, but not if we used noble agar. we analyzed the growth kinetics of type i fipv black in three cell lines: ak-d, fcwf- cu, and fcwf- atcc. type ii fcov titers were evaluated in fcwf- cu cells. for all cell types, . × cells were plated in -well plates or . × cells in -well plates. after incubating for h, cells were infected with fipv in serum-free media at a multiplicity of infection (moi) of . at °c. after a h incubation, the infectious media were replaced with fresh media containing % fbs. at the indicated time points, cell-free supernatants and/or infected cells were harvested and used for titration by plaque assay on ak-d (fipv black) or fcwf- cu (type ii fcovs) cells. the supernatant was collected from the cultures at the time indicated and subjected to centrifugation at ×g for min at °c to remove any dead cells. this cell free supernatant was aliquoted and frozen at − °c until use. to prepare the cell-associated sample, . ml of medium was added to the infected cells in the -well plate, and the entire plate was frozen at − °c. the infected cells were then subjected to two additional rounds of freezing and thawing ( °c for - min). after the third thaw, the cells and medium were transferred to a centrifuge tube and centrifuged at ×g for min at °c to remove cell debris. the supernatant containing the viruses released from the cells during the freeze-thaw process was designated the cellassociated virus sample. monolayers of . × ak-d and fcwf- cu cells were cultured in -well chamber slides (nalge nunc international, # ) at °c for h. cells were infected with fipv black at a moi of . for h at °c. at times indicated, the infected cells were fixed with . % formaldehyde-pbs solution for min, permeabilized with . % triton x- in pbs for min, and then incubated with blocking solution containing % normal goat serum and . % triton x- in pbs at °c overnight. for immunofluorescence staining of fipv black-infected cells, the cells were incubated with mouse monoclonal anti-fipv nucleocapsid (ccv - ) (poncelet et al., ) (bio-rad, #mca b) as a primary antibody at a dilution of : at room temperature for h. cells were then incubated with a secondary antibody, alexa fluor conjugated goat anti-mouse igg (thermo fisher scientific, #a ) at a dilution of : in the presence of hoechst (thermo fisher scientific, #h ) at a dilution of : for nucleus stain. after min incubation with the secondary antibody at room temperature, the cells were then washed with pbs, mounted, and examined under a fluorescence microscope. . . quantification of isg transcript production by rt-qpcr following stimulation with feline ifn cells ( . × in a -well plate) were treated with , , or u/ml of purified feline ifn-alpha (pbl assay science, # - ) for h. to determine isg and feline β-actin mrna production, total rna was extracted and an equal amount of rna ( ng) was used for cdna synthesis using rt ht first-strand kit (qiagen, # ). qpcr was performed with specific primers for feline β-actin transcript (fwd '-caa ccg tga gaa gat gac tca ga - '; rev '-ccc aga gtc cat gac aat acc a - ') or isg transcript (fwd '-cct gag ctg cag cct ttc aga aca g - '; rev '-cac gtg aaa tgg cat tta agt tgc cgc ag - ') using rt sybr green qpcr mastermix (qiagen, # ). a bio-rad cfx thermocycler was set as follows: one step at °c ( min); cycles of °c ( s), °c ( min), and plate read; one step at °c ( s); and a melt curve from °c to °c at increments of . °c/ . s. samples were evaluated in triplicate and data are representative of three independent experiments. the levels of mrna are reported relative to β-actin mrna and expressed as −Δct [Δc t = c t(gene of interest) −c t(β-actin) ]. feline bone marrow-derived macrophages, fcwf- cu, or fcwf- atcc cells, grown for h in × mm petri dishes (vwr, # - ), were washed with pbs, incubated in pbs for min at °c, then collected with gentle pipetting. using a cytospin (shandon), μl of cells ( , cells/ml) suspended in pbs supplemented with % bsa were spun onto glass coverslips (pre-treated with % bsa in pbs) at xg for min. cells were dried, rinsed in pbs, then fixed in absolute methanol for min. wright-giemsa (thermo fisher scientific, # ) staining was performed per the manufacturer's instructions using a min primary stain and a min counter stain, and washed with ) . b) fcov growth kinetics in fcwf- cu cells (moi= . ) determined by c) plaque assay on fcwf- cu indicator cells. tenfold serial dilutions of cellfree virus inoculum were applied to cells. following oxoid agar/media overlay, cells were fixed in . % formaldehyde and stained using . % crystal violet after h. fcov used were the type i strain fipv black and the type ii strains fipv wsu - and fecv wsu - . plaque assay performed in triplicate; error bars ± sd. a. o'brien et al. virology ( ) ml rinse solution. slides were dried and imaged under oil immersion at x magnification. infectious diseases of the dog and cat. saunders a study of naturally occurring feline coronavirus infections in kittens persistence and transmission of natural type i feline coronavirus infection american type culture collection prevalence of feline coronavirus types i and ii in cats with histopathologically verified feline infectious peritonitis immunophenotype and functional properties of feline dendritic cells derived from blood and bone marrow recovery and in vitro cultivation of a coronavirus from laboratoryinduced cases of feline infectious peritonitis (fip) determination of the cell tropism of serotype feline infectious peritonitis virus using the spike affinity histochemistry in paraffin-embedded tissues feline infectious peritonitis: insights into feline coronavirus pathobiogenesis and epidemiology based on genetic analysis of the viral c gene type i feline coronavirus spike glycoprotien fails to recognize aminopeptidase n as a functional receptor on feline cell lines cloning and expression of feline colony stimulating factor receptor (csf- r) and analysis of the species specificity of stimulation by colony stimulating factor- (csf- ) and interleukin- (il- ) feline coronavirus type ii strains - and - originate from a double recombination between feline coronavirus type i and canine coronavirus the molecular genetics of feline coronaviruses: comparitive sequence analysis of the orf a/ b transcription unit of different biotypes differences in virus receptor for type i and type ii feline infectious peritonitis virus the prevalence of types i and ii feline coronavirus infections in cats characterization of monoclonal antibodies against feline infectious peritonitis virus type ii and antigenic relationship between feline, porcine, and canine coronaviruses expression of feline infectious peritonitis coronavirus antigens on the surface of feline macrophage-like cells detection of feline coronavirus in captive felidae in the usa reversal of the progression of fatal coronavirus infection in cats by a broad-spectrum coronavirus protease inhibitor broad-spectrum antivirals against c or c-like proteases of picornaviruses, noroviruses, and coronaviruses potent inhibition of feline coronaviruses with peptidyl compounds targeting coronavirus c-like protease broad-spectrum inhibitors against c-like proteases of feline coronaviruses and feline caliciviruses feline infectious peritonitis: still an enigma? mutation in spike protein cleavage site and pathogenesis of feline coronavirus feline coronaviruses associated with feline infectious peritonitis have modifications to spike protein activation sites at two discrete positions field strain feline coronaviruses with small deletions in orf b associated with both enteric infection and feline infectious peritonitis the nucleoside analog gs- strongly inhibits feline infectious peritonitis (fip) virus in tissue culture and experimental cat infection studies an update on feline infectious peritonitis: virology and immunopathogenesis a review of feline infectious peritonitis virus infection: - serologic studies of naturally occurring feline infectious peritonitis pathogenesis of feline enteric coronavirus infection pathogenic differences between various feline coronavirus isolates efficacy of a c-like protease inhibitor in treating various forms of acquired feline infectious peritonitis feline infectious peritonitis: role of the feline coronavirus c gene in intestinal tropism and pathogenicity based upon isolates from resident and adopted shelter cats comparative sequence analysis of fulllength genome of fipv at different tissue passage levels two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus detection of antigenic heterogeneity in feline coronavirus nucleocapsid in feline pyogranulomatous meningoencephalitis determination of % endpoint titer using a simple formula a simple method of estimating fifty per cent endpoints characterization of a recombinant canine coronavirus with a distinct receptor-binding (s ) domain acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein x-ray structure and inhibition of the feline infectious peritonitis virus c-like protease: structural implications for drug design differential effects of viroporin inhibitors against feline infectious peritonitis virus serotypes i and ii chimeric feline coronaviruses that encode type ii spike protein on type i genetic background display accelerated viral growth and altered receptor usage genome organization and reverse genetic analysis of a type i feline coronavirus a reverse genetics approach to study feline infectious peritonitis feline coronaviruses: pathogenesis of feline infectious peritonitis tackling feline infectious peritonitis via reverse genetics feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses improving virus taxonomy by recontextualizing sequence-based classification with biologically relevant data: the case of the alphacoronavirus species we thank matthew hackbart, dr. xufang deng, dr. jean k. millet and javier jaimes for helpful discussions. we also thank dr. fred scott and dr. edward j. dubovi for the provision of reagents. tissue samples and associated phenotypic data were provided by the cornell veterinary biobank, a resource built with the support of national institutes of health (nih) grant r gm and the cornell university college of veterinary medicine. this work was supported by a pilot project grant issued to s.c.b. by loyola university of chicago and a research grant from the winn feline foundation bria fund (#mtw - to s.c.b. and g.r.w.). r.c.m. is supported by the (nih) t training grant for experimental immunology (#ai ) and the arthur j. schmitt dissertation fellowship in leadership and service (arthur j. schmitt foundation). g.r.w. is supported by research grants from the cornell feline health center and the winn feline foundation. key: cord- - xi ee authors: evermann, j. f.; heeney, j. l.; roelke, m. e.; mckeirnan, a. j.; o'brien, s. j. title: biological and pathological consequences of feline infectious peritonitis virus infection in the cheetah date: journal: arch virol doi: . /bf sha: doc_id: cord_uid: xi ee an epizootic of feline infectious peritonitis in a captive cheetah population during – served to focus attention on the susceptibility of the cheetah (acinoyx jubatus) to infectious disease. subsequent observations based upon seroepidemiological surveys and electron microscopy of fecal material verified that cheetahs were indeed capable of being infected by coronaviruses, which were antigenically related to coronaviruses affecting domestic cats, i.e. feline infectious peritonitis virus/feline enteric coronavirus. coincident with the apparent increased susceptibility of the cheetah to infectious diseases, were observations that the cheetah was genetically unusual insofar as large amounts of enzyme-encoding loci were monomorphic, and that unrelated cheetahs were capable of accepting allogenic skin grafts. these data provided the basis for a hypothesis that the cheetah, through intensive inbreeding, had become more susceptible to viral infections as a result of genetic homogeneity. research aimed toward understanding the pathogenesis of viral infections of endangered species constitutes a major component of the species survival management plan for the cheetah [ , ] . one of the primary reasons for this emphasis was the recent occurrence of a devastating epizootic of feline coronavirus infection (feline infectious peritonitis [fip] ) in captive cheetahs in - [ , , ] . since that time, there have been other reports on the apparent susceptibility of the cheetah to infectious diseases with emphasis on fip [- , , , , , ] . since there are currently no vaccines available for control of fip in either domestic or exotic cat populations it is essential that biologists, diagnosticians, and veterinarians be aware of the impact that this infection has upon the cheetah, so that appropriate management steps can be taken to minimize the chance for infection and thereby lessen the risk of fatal disease. the purpose of this review is to present desciptions of the various forms of coronaviral infections in the cheetah relying upon studies of both natural infections, as well as experimental infections in other species with coronaviruses, such as mouse hepatitis virus (mhv), canine coronavirus (ccv), transmissible gastroenteritis virus (tgev) of swine, and bovine coronavirus (bcv) of neonatal calves [ , , , , , , , , , ] . the biology of the feline coronaviruses has a short history since isolates were not available for laboratory studies until [see for review]. prior to that time, the disease was referred to as feline systemic proliferative and exudative vasculitis [ , ] , and later feline infectious peritonitis (fip) [ ] . recognition of the first coronavirus associated with fip in cats was determined by electron microscopy in [ ] . inasmuch as cell culture-adapted isolates of the fip virus (fipv) were not yet available, the disease condition was experimentally transmitted by the inoculation of liver homogenates from diseased cats into the peritoneal cavity of susceptible cats. during the period of experimental transmission of fip by tissue homogenates, serologic assays were developed which utilized indirect immunofluorescence on cryostat sections of liver obtained from cats with clinical fip [ ] . subsequent serologic studies relied upon cell culturegrown homologous virus, fipv, or heterologous cross-reacting coronavirus strains, such as ccv and tgev [ , , ~ , , ] . seroprevalence studies conducted during the s indicated that certain populations of cats had a high percentage of antibody, suggesting that either fipv was not % fatal as was generally believed, or that cats were also being [ , , , ] . since those initial reports on the divergent nature of feline coronaviruses and the designation of fipv and fecv strains, there have been additional reports on the detection and/or isolation of feline coronaviruses [ , ] . the spectrum of disease resulting from these various isolates is presented in table . although there are marked phenotypic differences in terms of in vivo virulence, efforts to distinguish fecv strains from fipv strains in vitro have not been successful [ , , , ] . it is conceivable that molecular technology will reveal differences at the genomic level, which reflect variation in strain virulence or pathology [ , , , ] . diagnostic molecular procedures would be useful in the detection of cats that were shedding fipv into the environment. however, if fipv is the progeny of a random mutation from fecv, or a recombinant of two enteric coronaviruses, then the application would vary according to the frequency of these mutational events [ , , , , , , ] . although the majority of research on the feline coronaviruses has been conducted in domestic cats, access to serologic tests has allowed investigators to test serum from other felidae, as well as from closely related members of the cat family, such as the cheetah [ , ] . the serologic results, as well as reports of sporadic cases of fip in cheetahs, indicated that they were susceptible to infection and in some cases succumbed to disease [ , , , , ] . the susceptibility of the cheetah to fip was of particular interest during an outbreak of the disease in a wildlife park in - [ , ] . in this incident, an infected cheetah was imported to the facility, which was a leading center for breeding cheetahs in north america. infectious agents were isolated in crandell feline kidney (crfk) cells from tissues submitted from cheetahs that died during the fip epizootic of - [ , ] . a common feature of the isolates was their reduced cytopathic effect (cpe) in crfk cells and cytoplasmic immunofluorescence when stained with antisera to a strain of moderate virulence, fipv ucd- ( fig. a, the cheetah virus has been maintained in cell culture as a persistent noncytolytic infection [ , ] . however, infected cells do express periods of cytopathogenicity referred to as "crisis periods", but following each crisis, cells emerge and the infection is maintained. assays for cell-free, virus have been hampered due to the low release of extracellular virus. ultrastructural studies conducted on the cells persistently infected by the cheetah coronavirus have revealed the presence of virus particles in cytoplasmic vacuoles, but minimal virus at the cell surface [ ] . this is in contrast to the high number of virus particles observed, both within virus-infected cells, as well as at the surface of cells with the cytopathogenic coronaviruses, fecv - and fipv - [ ] . the phenotypic parameters of the cheetah coronavirus in vitro indicate that the virus is a biological variant of a virulent coronavirus or is in a partially nonpermissive host cell [ ] . this is further suggested by its cell-associated nature and the lack of cell fusion capability, which would indicate incomplete expression of the essential e protein (fusion protein) [ , , , ] . this observation may be due to a partially defective virus [ ] or to a virus which fails to mature properly due to the absence of a host-cell protease [ , ] . the cheetah agent represents the least virulent in cell culture as compared with other feline coronaviruses (table ) except for fecv ucd, which has not yet been cultured in vitro, but must be maintained by passage through cats [ , . enzymatic enhancement of coronavirus replication and expression of cpe in vitro have been reported for a number of different coronaviruses including bcv and tgev [ , , , , ] . the addition of low amounts of trypsin ( ixg/ml) to serum-free culture media enhances the cpe of the feline corona- viruses fipv ucd- and fipv ucd- , and also appears to augment the expression of the cheetah coronavirus [ ] . studies on the effects of trypsin on various coronavirus strains, including fecv and fipv, have suggested that trypsin-sensitive and trypsin-resistant phenotypes occur in nature [ , ] . those strains that are highly resistant have been hypothesized to survive longer in the gastrointestinal tract and therefore be infectious longer, both for the infected host, as well as for other susceptible animals in the population which come in contact with the shedding host [ , ] . initially, definitive information on the natural spread of the feline coronaviruses was hampered due to the lack of cell-free virus; however, subsequent studies with cell-free the incubation periods for feline coronavirus infections are variable depending upon the dose and strain of virus and the age of and route of entry into the host. pedersen has conducted the most definitive studies to date on the pathogenicity of the viruses [ , ] . his results indicated an incubation period of - days for fecv-induced enteric infection, and days to months for the fipv strains. in some cases the outcome of fipv infection is dependent upon concurrent immunosuppression such as may occur with feline leukemia virus infection [ ] . the clinical features of the feline coronaviruses in domestic cats and cheetahs appear to be very similar ]- , , , , , ] . symptoms in domestic cats following fecv infection may range from subclinical to a mild diarrhea in uncomplicated cases [ ] . although not well documented in cats, multiple enteric infections with other viruses or bacteria should be considered in making a differential diagnosis. this has been reported to be the case in dogs with concurrent ccv and canine parvovirus infections [ ] . the clinical manifestations of fip include anorexia, icterus, and elevated serum proteins in fluids within the thoracic/abdominal cavities (wet form). although experimental studies of fip in cheetahs has not been conducted, information obtained from naturally occurring cases has indicated that the majority show early signs of liver dysfunction followed by periods of anorexia, dehydration and death [ , ] . it is important to recognize that although cheetahs appear to be very susceptible to fip-related disease, there are other factors which may contribute to a generalized liver dysfunction, such as dietary deficiencies [ , ] . pathologic studies of cheetahs diagnosed as having fip have many features in common with the lesions reported in domestic cats [ , , , , ] . a predominant feature in the fip lesions in cheetahs is multi-focal necrosis throughout many organs including the liver, kidneys, pancreas, spleen, lymph nodes, and thymus. the necrotic areas are characterized by karyorrhexis, karyolysis, cytolysis, and infiltration by lymphocytes and macrophages. fibronecrotic plaques are present on many organs in both the pleural and peritoneal cavities. necrotic foci containing lymphocytic infiltrates, macrophages, and neutrophils are also present in mesenteric fat and within the muscular layers of the small and large bowel. lymphoid aggregates in the spleen and lymph nodes were depleted. the fundamental histopathological lesions are a generalized vasculitis and perivasculitis [ , , , , , ] . although the course of the disease and distribution of lesions bear a close resemblance to fip in domestic cats, it is important that a complete necropsy and detailed histological examination be conducted in order to confirm the occurrence of fip in the cheetah [ ] . several other lesions have been noted in cheetahs in addition to changes attributed to fipv [ , ] . the gastric mucosa of four cheetahs contained superficial erosions of mucosal epithelium. in most cases, the changes were relatively mild with hyperemia of superficial mucosal vessels, mild focal hemorrhages and mild fibrosis of the interstitium. gastric ulcers have been observed in one cheetah. epithelium within the gastric pits was generally intact, although fibroblastic response bridged gastric pits in some areas. a moderate interstitial infiltrate of lymphocytes, plasma cells and macrophages was associated with areas of erosion. the immune response of the cat to the feline coronaviruses presents a critical factor in the pathogenesis of fipv infection. many of the lesions observed in cases of fip can be directly attributed to the immune response; i.e., an immunemediated vasculitis [ , , , , ] . these findings are supported by the reports of enhancement of fip by prior infusion of passively acquired antibody and the failure of conventional vaccine preparations to protect cats against subsequent challenge [see , for review] . currently, at least three distinct cellular lineages of the cat's immune system appear to be critical in determining the outcome of fipv infection [ , t, , , , ] . these include the macrophage, the b-cell and the t-cell populations. the macrophage appears to be one of the primary sites for fipv replication in vivo and was demonstrated to be a source of virus in vitro prior to the isolation of viruses in conventional cell cultures [ ] . although definitive studies have not been reported yet with fipv, it may be predicted that cells of the monocyte-macrophage lineage are very important in conferring resistance to infection, and in subsequent immune reactions of the processed fipv antigens with the b-and t-cell populations. coronaviral infection of the macrophage has been reported to be one of the major criteria for distinguishing resistance and susceptibility in mice with the murine coronavirus, mhv [ , , , , , , , , ] . fip-inducing strains apparently infect and replicate in feline macrophages while non-fip strains, e.g., the fecv strains, are primarily restricted to mucosal infections without replication in macrophages [see , for review]. in the majority of cases of fip, serum antibody has been measured by the indirect immunofluorescence assay (ifa), a group-specific test that does not distinguish between antibody to fipv and fecv [ , , , , ] . serum from cats with high ifa antibody titers has been demonstrated to enhance the pathogenesis of fipv when passively administered to cats six hours prior to virus inoculation [ ] . the role of antibody in the pathogenesis of fip has been controversial, but is not without precedent since there are several viral infections which have been documented to have an immune-mediated disease sequelae. these include dengue fever of humans [ , , ] , and yellow fever virus [ ] . the mechanism(s) of antibody-mediated enhancement may take the form of non-neutralizing antibodies, enhancing antibodies, or blocking antibodies (bind to/or block t-cell receptors) [see for review]. a likely explanation is that certain strains of feline coronavirus, i.e., fipv variants or mutants [ , , , ] , infect and replicate in macrphage cells, perhaps altering normal b-and t-cell interactions. the b-cell response is polyclonal and antibodies that are formed appear to detect all the major viral proteins as determined by western blot techniques [ ] . certain types of these antibodies may serve as enhancing antibodies in terms of increased viral uptake and replication within macrophages, which are subsequently spread throughout the body. the effectiveness of the t-cell response appears to play a critical role in controlling fipv infection, but may also play a part in the subsequent immunemediated pathogenesis. impairment of the t-cell response, such as may occur during concurrent viral infection with either feline panleukopenia virus or feline leukemia virus, appears to predispose cats to fip [ , , evermann, unpublished observation]. without t-cell surveillance of virus-infected macrophages, cell-associated viremia occurs and dispersal of virus occurs throughout the body [ ] . the actual mechanism(s) of fipv-induced tissue damage is being investigated, but may be a combination of inflammatory response with neutrophils imparting tissue damage alone or in combination with cytotoxic t cells attempting to rid tissues of virus-infected macrophages [ ] . the basic lesions in fip are a result of the cat's immune response producing large quantities of antibodies and the formation of immune complexes which are subsequently deposited within the vessels of the serosa [ , , , , ] . persistence of viral antigens in the serosal blood vessels provokes a hypersensitivity reaction with the migration and infiltration of mononuclear cells into vessel adventitia and media, resulting in severe vascular damage [ , ] . the outcome from the vessel damage usually includes a serous effusion and accumulation of fluid in the major body cavities. this type of immune response is characteristic of a type iii hypersensitivity reaction [ , , , ] . the genetic regulation of the immune response has been of interest in studying viral infections of animals, since it has been shown that resistance to certain viruses appears to be under genetic control [ , , , ] . more recently, the cheetah has been shown to be genetically unusual insofar as large amounts of enzyme-encoding loci are monomorphic in natural populations [ , , ] . this observation, coupled with the extraordinary finding that unrelated cheetahs would immunologically accept allogenic skin grafts, was interpreted in the context of a hypothesis that the cheetah had undergone intensive inbreeding in its recent natural history [ ] . such a situation would have significant effect upon the immune defenses against microbial pathogens. by analogy to other species, natural populations have multiple loci which are polymorphic for functions which influence the outcome of viral-induced disease outbreaks [- ] . notable amongst such genes are those forming the major histocompatibility complex, whose gene products function directly in monitoring immune response to viral infections [ , , , ] . the genetic homogeneity of the cheetah may be an important contributing factor in the increased susceptibility of the species to viral infections, such as fipv and feline herpesvirus [ , , ] . since the fatal outcome of the fip epizootic of - , it has been apparent that cheetahs are highly vulnerable to infection and disease from the feline coronaviruses [ , , , ] . in an effort to determine the prevalence of feline coronavirus infection in cheetahs, a serologic survey and an electron microscopic analysis were conducted on captive and wild-caught cheetahs [ ] . the serological results from captive cheetahs in zoologic parks in north america (table ) indicated that of ( %) captive cheetahs were seropositive to feline coronavirus by ifa (group-specific serology test). these results were higher than those of captive cheetahs located in southern africa and europe, but similar to captive cheetahs in eastern africa as well as to wild-caught cheetahs ( table ). the serologic results indicated that the cheetahs were being infected by a virus which was antigenically related to the feline coronavirus group, and that there was a comparable risk of acquiring infection whether efforts to control fip in captive cheetahs are structured around periodic serologic testing and the segregation of cheetahs that are seropositive to feline coronaviruses by ifa. the limitations of these recommendations are the possible lack of specificitly of ifa for identifying exposure to pathological variants, and the lack of complete understanding of the coronaviruses affecting cheetahs [ , , , ] . however, until further information is reported regarding coronaviral diseases of exotic cats, especially the cheetah, then the management should follow basic guidelines for control of an infectious disease (table ). the cheetah has assumed a prominent position in the zoologic and wildlife communities due to its endangered status and its apparent increased susceptibility to microbial infections [ , ] . these factors have emphasized the need for further research into the genetics and the diseases that may affect the cheetah in captivity, as well as in the wild [ ] . although coronaviral infections of the domestic cat have been recognized for over decades, the emergence of pathogenic variants in the cheetah populations has only recently been acknowledged as having a potentially severe impact on its survival [ , , ] . primary amongst the coronaviruses affecting domestic cats is fipv, which is regarded as being % fatal once clinical signs are manifested [ , ] . the occurrence of coronaviral infections of the cheetah have now been documented based on serology, electron microscopy of fecal contents, and the occurrence of fatal forms of infectious peritonitis compatible with the clinicopathologic signs observed in domestic cats with fip [ , , , , , , , ] . these observations may indicate that the cheetah has acquired a unique group of coronaviruses which have antigenic similarity to the domestic cat coronaviruses or that the cheetah is susceptible to cross-species transmission of domestic cat coronaviruses [ , , , ] . serological studies support the contention that both situations may be important in the epizootiology of fipv in cheetahs [ , , ] . although cheetahs in the wild have a comparable seroprevalence to the feline coronavirus group, their antibody titers are invariably lower than those titers detected in captive cheetahs during a disease outbreak [ , ] . the seroprevalence of feline coronavirus infection in cheetahs in captivity, both in north america and africa, indicates that the virus is transmitted with equal frequency. while evidence in support of cross-species transmission of feline coronaviruses to the cheetah is lacking, it is known that the cheetah cells are susceptible to some of the domestic cat coronaviruses in vitro [ ] . it is apparent that further analysis of cheetahs in captivity needs to be conducted in order to determine more about their microbial flora and their immune response [ ] . this information is essential in order to determine the risk of infection and disease from viruses such as fipv and feline herpesvirus [ , ] . until more is known regarding the pathogenesis of coronaviral infections of the cheetah, it would be prudent to establish surveillance programs which utilize a combination of serologic monitoring and quarantine procedures in order to insure the survival of the cheetah in captivity [ ]. feline infectious peritonitis. an immune-mediated coronaviral vasculitis transmissible gastroenteritis (tge) of swine: survivor selection of tge virus mutants in stomach juice of adult pigs genetics of resistance of animals to viruses. i. introduction and studies in mice feline coronaviral infections host age and genotypic effects on enterotropic mouse hepatitis virus infection response of genetically susceptible and resistant mice to intranasal inoculation with mouse hepatitis virus jhm feline infectious peritonitis in south africa plaque assay, polypeptide composition and immunochemistry of feline infectious peritonitis virus and feline enteric coronavirus isolates genetic resistance to mouse hepatitis virus correlates with absence of virus-binding activity on target tissues feline infectious peritonitis. an update of a captive cheetah population intraepithelial leukocytes contain a unique subpopulation of nk-like cytotoxic cells active in the defense of gut epithelium to enteric murine coronavirus health of adult free-living cheetahs enzymatic and acidic sensitivity profiles of selected virulent and attenuated transmissible gastroenteritis viruses of swine a double-protease-resistant variant of transmissible gastroenteritis virus and its ability to induce lactogenic immunity shedding of eneteric coronavirus in adult cattle chronic shedding of bovine enteric coronavirus antigen-antibody complexes by clinically normal cows evidence for two mechanisms of dengue virus infection of adherent human monocytes: trypsin-sensitive virus receptors and trypsin-resistant immune complex receptors cdna cloning and sequence analysis of the gene encoding the peplomer protein of feline infectious peritonitis virus intracellutar rnas of the feline infectious peritonitis coronavirus strain - susceptibility/resistance to mouse hepatitis virus strain and macrophage procoagulant activity are genetically linked and controlled by two non-h- - inked genes neutralizing secretory iga and igg do not inhibit attachment of transmissible gastroenteritis virus interactive influence of infectious disease and genetic diversity in natural populations genetic basis for species vulnerability in the cheetah the cheetah is depauperate in genetic variation delayed-type hypersensitivity: probable role in the pathogenesis of dengue hemorrhagic fever/dengue shock syndrome coronavirus disease (coronavirus enteritis, feline infectious peritonitis). in: holzworth j (ed) diseases of the cat infection studies in kittens using feline infectious peritonitis virus propagated in cell culture an enteric coronavirus infection of cats and relationship to feline infectious peritonitis pathogenicity studies of feline coronavirus isolates - and - experimental studies with three new strains of feline infectious peritonitis virus: fipv-ucd , fipv-ucd and fipv-ucd eosinophilic ulcers in association with herpetic dermatitis in sibling cheetahs feline infectious peritonitis in a captive cheetah antibody-dependent enhancement of viral infectivity infectious disease of nondomestic cats experimentally induced coronavirus infections in calves: viral replication in the respiratory and intestinal tracts dietary estrogen--a probable cause of infertility and liver disease in captive cheetahs diagnosis of porcine and bovine enteric coronavirus infections using cloned cdna probes the mutation rate and variability of eukaryotic viruses: an analytical review intestinal, pulmonary, and serum antibody responses of feeder pigs exposed to transmissible gastroenteritis virus by the oral and the oralintranasal routes of inoculation rapid evolution of rna viruses experimental studies of a coronavirus and coronavirus-like agent in a barrier-maintained feine breeding colony proteolytic cleavage of the e glycoprotein of murine coronavirus: activation of cell-fusing activity of virions by trypsin and separation of two different k cleavage fragments role oft cells in feline infectious peritonitis virus infection of suckling mice trypsin-enhanced replication of neonatal calf diarrhea coronavirus in bovine embryonic lung cells antigenic and biological diversity of feline coronaviruses: feline infectious peritonitis and feline enteritis virus morphogenesis of a virus in cats with experimental feline infectiuos peritonitis antibody-mediated enhancement of disease in feline infectious peritonitis: comparisons with dengue hemorrhagic fever pathogenesis of feline infectious peritonitis: nature and development of viremia proteases involved in the processing of viral polyproteins viral interference-dominance of mutant viruses over wild-type viruses in mixed infections feline infectious peritonitis: review of gross and histopathologic lesions lesions in the small intestine of newborn pigs inoculated with porcine, feline and canine coronaviruses feline coronavirus. in: appel mj (ed) virus infections of carnivores genetic variation of major histocompatibility complex class i genes in various species: the lack of polymorphism in the african cheetah the authors wish to express their appreciation to drs. niels pedersen key: cord- -j l dh authors: drechsler, yvonne; vasconcelos, elton j. r.; griggs, lisa m.; diniz, pedro p. p. v.; collisson, ellen title: host gene expression of macrophages in response to feline coronavirus infection date: - - journal: cells doi: . /cells sha: doc_id: cord_uid: j l dh feline coronavirus is a highly contagious virus potentially resulting in feline infectious peritonitis (fip), while the pathogenesis of fip remains not well understood, particularly in the events leading to the disease. a predominant theory is that the pathogenic fipv arises from a mutation, so that it could replicate not only in enterocytes of the intestines but also in monocytes, subsequently systemically transporting the virus. the immune status and genetics of affected cats certainly play an important role in the pathogenesis. considering the importance of genetics and host immune responses in viral infections, the goal of this study was to elucidate host gene expression in macrophages using rna sequencing. macrophages from healthy male cats infected with fipv - ex vivo displayed a differential host gene expression. despite the virus uptake, aligned viral reads did not increase from to h. the overlap of host gene expression among macrophages from different cats was limited, even though viral transcripts were detected in the cells. interestingly, some of the downregulated genes in all macrophages were involved in immune signaling, while some upregulated genes common for all cats were found to be inhibiting immune activation. our results highlight individual host responses playing an important role, consistent with the fact that few cats develop feline infectious peritonitis despite a common presence of enteric fcov. feline coronavirus (fcov) is a highly contagious virus that is distributed worldwide and is ubiquitous in virtually all cat populations, particularly in multi-cat environments, such as shelters and rescues [ ] [ ] [ ] [ ] . fcov exists as two pathotypes, feline enteric coronavirus (fecv) and feline infectious peritonitis virus (fipv). the enteric virus, fecv, commonly causes an asymptomatic infection presenting with mild gastrointestinal signs, and can persist in certain individuals [ ] . fecv is readily transmitted via the fecal-oral route; therefore, the prevalence of fecv infection is generally associated with the number and density of cats housed together [ , , ] . sporadically and unpredictably, the infection can turn pathogenic, in which case the fipv infection is associated with the highly fatal, systemic immune-mediated disease, feline infectious peritonitis (fip) [ ] . in this form, the virus develops a % fatal syndrome with two possible presentations: a pyogranulomatous disease of the visceral serosa and omentum, with consequent cavitary effusions, termed the "wet" or "effusive" form; and the dry form with granulomatous all animal procedures were conducted and approved under the guidelines of the iacuc of western university of health sciences, protocol approval number r /iacuc/ . peripheral blood for transcriptome studies was taken from six healthy male, specific pathogen-free (spf) cats residing in an existing colony at the university of california, davis. - ml of blood, equivalent to % of body weight or less was collected in heparinized tubes. the ages of cats at the time of blood draw were five months up to two years (five cats), and four years (one cat). monocytes from peripheral blood were isolated as previously described for canine monocytes [ ] with some modifications. briefly, the gradient centrifugation steps occurred at × g without break at deceleration and the subsequent washes to remove platelets were performed at × g for a total of three washes. pbmcs were counted, resuspended in rpmi , containing % of fbs, % of penicillin and streptomycin, and × of non-essential amino acids, and plated at × in -well plates. non-adherent cells were removed after h by vigorously washing with a culture medium and cells were infected the following day. for host transcriptome studies, macrophages were infected with fipv - (atcc vr ). the viruses were incubated at a multiplicity of infection (moi) of in a serum-free optimem (gibco, thermo fisher scientific, waltham, ma, usa) for h for virus attachment, washed with optimem, and incubated with fresh supplemented rpmi for an additional or h. technical replicates for the control, and h for macrophages from each cat were plated and incubated with pbs or the virus, respectively. crfk cells (including technical replicates) were also infected as the control at an moi of in optimem, followed by incubation in a supplemented dmem. uninfected controls underwent the same process with pbs without the virus. after incubation, the cell culture medium was completely removed and µl of trizol (invitrogen, thermo fisher scientific, waltham, ma, usa) was added to each well, followed by rna extraction with the zymoresearch rna kit (zymoresearch, irvine, ca) according to the manufacturer's instructions. the rna quality was evaluated via the bioanalyzer (agilent, santa clara, ca) and sent ( µg per sample) for mrna sequencing to novogene, inc. (sacramento, ca, usa). rna paired-end sequencing quality control was assessed through fastqc (www.bioinformatics. babraham.ac.uk/projects/fastqc). an average of million paired reads were sequenced per sample. both adapters and low-quality bases (qv < ) were trimmed from the reads' extremities with trimmomatic [ ] . kallisto [ ] was the algorithm of choice for performing the alignment of all paired reads against the whole felis catus reference transcriptome (f. catus ncbi-refseq- . ). an average of . % of the total reads from each sample was mapped onto the cat's annotated transcriptome. alternatively, we also attempted to retrieve viral reads for both macrophages and crfk from the sequenced libraries using kallisto to align reads against the protein-coding genes from the feline coronavirus (fcov). an average of . % of the total reads per sample was aligned against the fcov annotated transcripts. viral read counts were normalized as fragments per kilobase per million (fpkm): [read_counts / (gene_length_in_kb × total_reads_in_sample)] × , , . tables generated by kallisto were used as input for differential expression (de) analyses. due to the unique host responses in the macrophage dataset, the noiseq version . . [ ] (ctrl, , and h) was employed to assess differentially expressed genes (degs) from each cat from which the ex vivo infected macrophages were derived. noiseq output tables contained degs for each comparison ( h versus control and h vs. control) per cat. venncounts and venndiagram functions from the limma r package [ ] were used for combining degs from each cat. datasets were submitted to a multidimensional scaling (mds) analysis, with the plotmds function from edger, to identify distinct samples clustered in a two dimensions-reduction landscape prior to the start of de analyses. all tools described above for differential expression were run within the r environment version . . . after generating a list of differentially expressed genes (degs), we used cluego [ ] under the cytoscape version . . [ , ] for a gene enrichment analysis relying on the felis catus annotation from both gene ontology (http://geneontology.org/) and kegg pathways (https://www.genome.jp/ kegg/pathway.html) consortia. both enrichment analyses adopted the hypergeometric test along with the benjamini and hochberg p-value adjustment method. a . threshold was set for the latter. to analyze host responses to fipv, mrna from feline macrophages (n = ), infected ex vivo, was isolated and processed for next-generation sequencing. a unique bioinformatic analysis of differentially expressed genes (noiseq) was necessary to compare gene expression. individual cats displayed very different patterns of gene activation, with macrophages from some cats showing a clear separation of uninfected control versus infected samples (# and ), while macrophages from other cats (# and ) did cluster closely together independent of infection status or infection time ( figure ). cells , , x for peer review of limma r package [ ] were used for combining degs from each cat. datasets were submitted to a multidimensional scaling (mds) analysis, with the plotmds function from edger, to identify distinct samples clustered in a two dimensions-reduction landscape prior to the start of de analyses. all tools described above for differential expression were run within the r environment version . . . after generating a list of differentially expressed genes (degs), we used cluego [ ] under the cytoscape version . . [ , ] for a gene enrichment analysis relying on the felis catus annotation from both gene ontology (http://geneontology.org/) and kegg pathways (https://www.genome.jp/kegg/pathway.html) consortia. both enrichment analyses adopted the hypergeometric test along with the benjamini and hochberg p-value adjustment method. a . threshold was set for the latter. to analyze host responses to fipv, mrna from feline macrophages (n = ), infected ex vivo, was isolated and processed for next-generation sequencing. a unique bioinformatic analysis of differentially expressed genes (noiseq) was necessary to compare gene expression. individual cats displayed very different patterns of gene activation, with macrophages from some cats showing a clear separation of uninfected control versus infected samples (# and ), while macrophages from other cats (# and ) did cluster closely together independent of infection status or infection time ( figure ). macrophages were derived from six different cats that are represented by distinct symbol shapes on the chart: cat # (circle), cat # (square), cat # (asterisk), cat # (triangle), cat # (diamond), and cat # (cross symbol). cultured macrophages were infected with the fipv - for and h before rna was collected for the expression analysis of host genes and viral reads. the viral presence was very low in the samples as indicated by the aligned reads for most macrophage samples at h. however, the presence in most samples did indicate that viral particles were taken up by the cells (table ) . no viral reads were detected in macrophages from cat # . cultured macrophages were infected with the fipv - for and h before rna was collected for the expression analysis of host genes and viral reads. the viral presence was very low in the samples as indicated by the aligned reads for most macrophage samples at h. however, the presence in most samples did indicate that viral particles were taken up by the cells (table ) . no viral reads were detected in macrophages from cat # . table . viral rna load per sample in both raw read count summation and normalized fragments per kilobase million (fpkm) average from all virus' genes combined, obtained in cellular extracts of either macrophages or crfk cells infected with fipv, at and h post-infection. cats # - were healthy cats from the uc davis cat colony, ages five months ( m) to four years ( y). in macrophages, there was a limited viral presence/uptake of fipv at h, or not detected (nd), and no evidence of significant replication at h (cat # n/a (no sample available)). in crfk cells, viral rna increased several log-fold from to h. comparing to h samples, there was no indication of viral amplification despite viral uptake, as no increase of viral reads was observed in macrophages at the later time point. the viral reads at h were either similar or lower than the number of reads at h. macrophages from one cat (cat # ) did not show any viral presence at h. in contrast to the macrophages exposed to the virus, rna sequencing showed several log-fold increases of viral isolates in the crfk cells used as replication controls from to h (table ). this indicated that very few viral particles entering crfk cells result in a significant amplification of the virus. this is also associated with pronounced cytopathic effects, which was observed in crfk, but not macrophages. macrophages from each of the individual cats did differentially express several hundred genes at and h, compared to uninfected macrophages, highlighting the unique host responses of the cells from individual cats. cat # was excluded from the bioinformatic analysis due to the lack of viral rna in the macrophages. since no control sample was available for cat # , no noiseq individual analysis of or h samples of cat # was possible in comparison to its own uninfected control. at h after infection, macrophages from cats # , , , and expressed , , , and differentially downregulated genes, while , , , and genes were differentially upregulated ( figure ). it is of interest that, while the macrophages clearly show a differential regulation of genes, there are relatively few common degs expressed in all of the macrophages from the four cats that were compared. only genes were significantly upregulated in macrophages from all cats, while one gene was downregulated ( figure ). the gene significantly downregulated in all macrophages was atpase phospholipid transporting b (atp b ), which is involved in the cation transport and biosynthesis of atp. among the upregulated genes, several are involved in immune signaling of the viral infection, such as smad , atp binding cassette, haus , fch domain, ubiquitin peptidase , and heteronuclear ribonuclear protein c (hnrnp c). the remaining genes in this group are involved in biosynthesis and other non-immune cellular functions (table ) . it is of interest that, while the macrophages clearly show a differential regulation of genes, there are relatively few common degs expressed in all of the macrophages from the four cats that were compared. only genes were significantly upregulated in macrophages from all cats, while one gene was downregulated ( figure ). the gene significantly downregulated in all macrophages was atpase phospholipid transporting b (atp b ), which is involved in the cation transport and biosynthesis of atp. among the upregulated genes, several are involved in immune signaling of the viral infection, such as smad , atp binding cassette, haus , fch domain, ubiquitin peptidase , and heteronuclear ribonuclear protein c (hnrnp c). the remaining genes in this group are involved in biosynthesis and other non-immune cellular functions (table ). monocyte isolations yielded different amounts of cells for each cat resulting in sufficient macrophages from only four cats to conduct the h infection time point, with cat # not showing viral reads and thus not included in the analysis. therefore, macrophage gene expression from cats # , , and was compared. at h, macrophages from cats # , , and differentially downregulated , , and genes, respectively, with of the same genes downregulated in macrophages from all three cats ( figure ). the number for upregulation of genes was similar, with , , and genes for macrophages from cats # , , and , respectively. one hundred and thirty-two genes were differentially upregulated in macrophages from all three cats ( figure ). downregulated immune genes at h tumor necrosis factor (tnf) receptor superfamily , interleukin , transforming growth factor (tgf)-beta, signal transducer and transcription activator (stat ), and transcription factors interferon regulatory factor (irf) , and smad family member (table a ) . one hundred and thirty-four upregulated genes common for all cats included several other proteins involved in cell cycle and metabolism. among these were several in the centromere or centrosomal category, nuclear body protein sp , or -dehydrocholesterol reductase. there were only two classical cytokine genes among the upregulated, namely leukemia inhibitory factor (lif), from the interleukin cytokine family, and the transcription factor irf (table a ). as indicated in figure , at h after infection, there was no significant overlap of degs common to all infected macrophages in order to allow gene enrichment analyses (both go terms and kegg pathways). there was more commonality of degs expressed in response to fipv at h when macrophage responses of individual cats were compared, therefore gene enrichment was performed. overall, genes were differentially downregulated in all cats in response to fipv with one kegg pathway enriched, "arginine and proline metabolism" (table ) . gene ontology for enriched genes downregulated at h showed the terms "extracellular matrix binding" and "collagen binding" for the molecular function, and "regulation of endothelial cell proliferation", "regulation of epithelial cell proliferation", "positive regulation of vasculature development", "positive regulation of angiogenesis", and "regulation of peptidase activity" for biological processes (table ). kegg pathways for enriched genes upregulated at h were "steroid biosynthesis", "valine, leucine and isoleucine degradation", "butanoate metabolism", "terpenoid backbone biosynthesis", "cell cycle", "p signaling pathway", and "progesterone-mediated oocyte maturation" (table ) . gene ontology for this same set of degs resulted in terms related to several nuclear and mitotic cellular processes, including cytoskeletal and spindle organization ( table ). the cytoscape network analysis (by cluego) shows how several of these pathways interact with each other, yielding two networks ( figure ). while isolates of both fcov serotypes i and ii have been shown to be pathogenic, only serotype ii has been shown to efficiently replicate in the cell culture, using crfk or felis catus whole fetus (fcwf) cell lines. therefore, serotype ii strains have been the subject of expanded in vitro and ex vivo investigations, including those focusing on viral entry and replication in monocytes/macrophages. it remains to be satisfactorily explained how both of these serotypes can arise from fecv in individual cats, with a yet unidentified mutation potentially resulting in a differential replication in monocytes and subsequently, leading to de novo pathogenesis in the affected cats. it is, however, likely that host immune responses play a significant, but not sufficiently while isolates of both fcov serotypes i and ii have been shown to be pathogenic, only serotype ii has been shown to efficiently replicate in the cell culture, using crfk or felis catus whole fetus (fcwf) cell lines. therefore, serotype ii strains have been the subject of expanded in vitro and ex vivo investigations, including those focusing on viral entry and replication in monocytes/macrophages. it remains to be satisfactorily explained how both of these serotypes can arise from fecv in individual cats, with a yet unidentified mutation potentially resulting in a differential replication in monocytes and subsequently, leading to de novo pathogenesis in the affected cats. it is, however, likely that host immune responses play a significant, but not sufficiently elucidated, role in the pathogenesis, and the question remains: what are the responses by the macrophages when infected with fcov? the presence of the virus has been evaluated directly in studies in macrophages [ , , ] using pcr or immunofluorescence. most studies showing an increased replication of fipv in vitro, particularly in comparison to fecv, use indirect methods such as tcid in crfk cells incubated with virus-infected macrophage extracts or supernatants [ , ] . however, to our knowledge, no studies so far have verified replication in macrophages by more state-of-the-art sensitive techniques, such as rna sequencing. in this study, rna sequencing and analysis of viral reads indicated that at h, the virus is taken up by the macrophages, as evidenced by the presence of viral rna. however, there was no significant increase in viral rna at h, a time close to peak replication of the virus, which is usually at h. instead of a significant increase in viral reads, which would be expected with viral amplification, a similar amount, or even decrease of the virus was observed in the samples. in contrast to this, just a limited uptake of the virus into crfk cells at h led to several log-fold of replication, indicated by several thousands to hundreds of thousands of viral transcripts at h. while the samples were not enriched for the pathogen, but rather the host rna, there is a striking difference between replication of the virus in the macrophages compared to crfk cells. since subtle differences of replication in macrophages might not be recognized and could be below the threshold of detection, further investigations are warranted. macrophages of one cat # did not show the presence of viral rna at all. this might be a technical issue, such as a higher moi needed for successful infection. it is also possible that this particular host was more resistant to infection, which has been shown before both in vivo and in vitro [ , ] . macrophages are competent immune cells and it has been shown that in vitro or ex vivo infection of macrophages with other viruses is challenging even if viremia exists in vivo. for example, there is evidence that marek's disease virus, a herpesvirus, is phagocytized by macrophages in vivo and then disseminated to infect t and b lymphocytes. in contrast, in vitro/ex vivo infection of macrophages has been shown to be difficult [ ] . the investigators were successful when virally infected target cells were incubated with the macrophages, which then phagocytized the infected cells and therefore, took up the virus much more effectively. similarly, it might be worth exploring the incubation of feline macrophages with infected epithelial target cells for studies requiring a higher ratio of macrophages positive for the viral antigen. in addition, methods such as rna sequencing could be explored to better quantify differences between fipv and fecv uptake, viral presence, and amplification in macrophages. gene expression of monocytes/macrophages following exposure to the feline coronavirus so far has not been investigated with next-generation sequencing. the pcr analysis of mrna expression of individual cytokines and other immune-related proteins has been done in vitro and in vivo [ ] [ ] [ ] ] , but next-generation sequencing is poised to give a more complete picture of gene expression after infection. in particular, differences in responses to fipv and fecv can be better defined. transcriptome analyses of fipv-infected feline macrophages were done in this study at h (early phase of infection) and h (closer to the known peak of amplification of fcov), and samples were positive for a limited presence of viral transcripts. however, no enrichment of pathways or gene ontology common for all cats was possible in the early phase after infection. the only gene downregulated in all analyzed samples at h was atpase phospholipid transporting b (atp b ). this protein is involved in phospholipid transport, but there are no studies to its involvement in viral infection and replication. from the upregulated genes, several are involved in immune-related host responses (table a ) . smad is a transcription factor involved in immune signaling, particularly in tgf-beta signaling. tgf-beta is an anti-inflammatory or regulatory cytokine that has been demonstrated to act as a proviral factor in epithelial cells during an influenza infection [ ] . haus is involved in maintaining cellular spindle integrity, but appears to have a role in the rig- like antiviral signaling pathway in a sendai virus infection [ ] . atp binding cassette subfamily a member , alternatively named rnase l inhibitor, blocks ribonuclease l. the interferon-regulated - a/rnase l pathway plays a major role in the antiviral innate immune response. consequently, several viruses are known to inhibit this pathway, including hiv which also induces the rnase l inhibitor [ ] . the fch domain is a phosphoprotein, associated with a viral infection. it is linked to endocytosis in an avian influenza virus replication [ ] . heterogeneous nuclear ribonucleoprotein c associated with pre-mrna processing, rna metabolism, and transport is a host factor important in the replication of positive-strand rna viruses [ , ] . finally, ubiquitin-specific peptidase is an enzyme that has been shown to negatively regulate nfkb in an htlv infection [ ] . other genes in this group are involved in cellular processes not linked to viral replication. taken together, we identified several genes that are downregulated in all macrophages infected with fipv and are linked to antiviral signaling. however, further studies are needed to elucidate the role of these genes in viral host interactions. interestingly, several downregulated genes that did overlap among cats were involved in immune signaling, which might confirm that the immune responses of macrophages are negatively altered by fipv. while a few of these genes are easily identifiable for involvement in antiviral or inflammatory responses, such as interferon regulatory factor (irf ) or tgf beta, a further investigation shows that several of the transcripts do, in fact, play a role in responses to infection. for example, heterogeneous nuclear ribonucleoprotein a /b (hnrp a /b ), which is involved in rna binding and trafficking, has previously been shown to bind to the np of avian influenza [ ] . other proteins downregulated are purinergic receptors (p y), that are involved in antiviral responses, affecting cytokine responses and t-cell activation [ ] . these receptors also contribute to the direct elimination of the virus by inhibiting their intracellular replication [ ] . intersectin plays important role in the regulation of the adaptive immune response in viral infection [ ] . ubiquitin-like proteins have been shown to modify proteins, thus conferring functions related to programmed cell death, autophagy and regulation of the immune system [ ] , and irf , which is critical to t-cell effector function [ ] . in regards to the viral infection of macrophages, it would be expected to see a strong inflammatory response of the cell in response to the virus, such as upregulation of toll-like receptor pathways, interferon type i signaling, etc. in our study, the absence of typical inflammatory signals is notable. while immune molecules irf and lif were upregulated, no classical virally activated signaling is discernable or enriched in kegg pathways. lif has not been well investigated in regards to viral infections, but it has been implicated in suppressing the replication of hiv [ ] . irf is necessary for ifn beta induction and sars-cov has been shown to block a step between the nuclear transport of irf and its phosphorylation, which is necessary for an ifn induction, but not with the induction of irf itself [ ] . our data is consistent with fcov employing a similar strategy, however, further studies are needed. some differentially upregulated genes common for all cats, after a macrophage infection, were found to be within unexpected cellular functions, such as centromere proteins and tpx that are involved in specific phases of the cell cycle. recent studies have indicated that centrosomes, as well as spindle organization, are actually involved in responses to a viral infection [ ] [ ] [ ] . on the other hand, some upregulated transcripts included the protein tyrosine phosphatase, which is involved in attenuating t-cell activation [ ] or nuclear body protein sp . the latter has been shown to act as important repressor of genes involved in the regulation of cytokine production, inflammatory response, and cell-cell adhesion [ ] . the picture emerging from these differentially expressed genes is that genes involved in antiviral responses and immune activation are depressed by fipv uptake, while other genes involved in cell cycle and proteins repressing immune responses are upregulated. even without an active viral replication, these changes most likely influence the pathogenesis and might explain how the monocytes carrying the virus potentially affect other cells, specifically lymphocytes. the fipv exposure and uptake leads to a limited differential gene expression in feline macrophages that might affect cell function. it will be of importance to further investigate cellular responses to fcov isolates, in order to understand virus interactions with the host macrophages. a comparison between infection with fipv and fecv strains focusing on host responses might yield insights into the pathogenesis of the virus. on the other hand, individual cat responses may be found to be of significant relevance to the pathogenesis and the number of samples required for analyses might be very high. the problem remains that very few cells take up the virus, and thus it will be difficult to analyze the transcriptome of a low number of infected cells. however, with high sample numbers, it could still be possible to identify differential gene expression that can provide valuable insight into the pathogenesis. an alternative is to use bone marrow-derived macrophages for viral infection since these macrophages have been shown to support replication at a higher rate, especially at a high moi. an attempt to increase the number of virus-positive cells by incubating them with infected target cells may also identify more infected macrophages. another possible source of infected macrophages is to isolate and analyze cells directly from viremic cats for transcriptome studies, however, immunologically those cells are representative of an ongoing disease process, and gene expression probably would be very different than early in the pathogenesis. in any case, further analyzing the host responses with next-generation molecular techniques will increase our understanding of fipv pathogenesis. the authors declare no conflict of interest. a study of naturally occurring feline coronavirus infections in kittens serologic studies of naturally occurring feline infectious peritonitis risk factors for feline coronavirus seropositivity in cats relinquished to a uk rescue charity feline coronavirus in multicat environments an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis risk factors for feline infectious peritonitis among cats in multiple-cat environments with endemic feline enteric coronavirus feline infectious peritonitis replication of feline coronaviruses in peripheral blood monocytes sites of feline coronavirus persistence in healthy cats pathogenic characteristics of persistent feline enteric coronavirus infection in cats feline infectious peritonitis: role of the feline coronavirus c gene in intestinal tropism and pathogenicity based upon isolates from resident and adopted shelter cats prevalence of feline infectious peritonitis in specific cat breeds clinicopathological findings associated with feline infectious peritonitis in clinicopathological findings and disease staging of feline infectious peritonitis: cases from to in taiwan preliminary studies on feline coronavirus distribution in naturally and experimentally infected cats an overview of feline enteric coronavirus and infectious peritonitis virus infections antibody-dependent enhancement of serotype ii feline enteric coronavirus infection in primary feline monocytes antibody-dependent enhancement of feline infectious peritonitis virus infection in feline alveolar macrophages and human monocyte cell line u by serum of cats experimentally or naturally infected with feline coronavirus a "possible" involvement of tnf-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis natural feline coronavirus infection: differences in cytokine patterns in association with the outcome of infection in vivo cytokine response to experimental feline infectious peritonitis virus infection disease outcome and cytokine responses in cats immunized with an avirulent feline infectious peritonitis virus (fipv)-ucd and challenge-exposed with virulent fipv-ucd natural history of a recurrent feline coronavirus infection and the role of cellular immunity in survival and disease apoptosis and t-cell depletion during feline infectious peritonitis transcriptome analysis of feline infectious peritonitis virus infection transcriptional profiling of feline infectious peritonitis virus infection in crfk cells and in pbmcs from fip diagnosed cats characterization of peritoneal cells from cats with experimentally-induced feline infectious peritonitis (fip) using rna-seq a rapid and simple method to obtain canine peripheral blood-derived macrophages trimmomatic: a flexible trimmer for illumina sequence data near-optimal probabilistic rna-seq quantification data quality aware analysis of differential expression in rna-seq with noiseq r/bioc package limma powers differential expression analyses for rna-sequencing and microarray studies cluego: a cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks cytoscape: a software environment for integrated models of biomolecular interaction networks cytoscape . : new features for data integration and network visualization differential susceptibility of macrophages to serotype ii feline coronaviruses correlates with differences in the viral spike protein intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence a review of feline infectious peritonitis virus infection: - two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus marek's disease virus infection of phagocytes: a de novo in vitro infection model vascular endothelial growth factor (vegf), produced by feline infectious peritonitis (fip) virus-infected monocytes and macrophages, induces vascular permeability and effusion in cats with fip epithelial-derived tgf-beta acts as a pro-viral factor in the lung during influenza a infection haus regulates rlrvisa antiviral signaling positively by targeting visa rnase l inhibitor is induced during human immunodeficiency virus type infection and down regulates the - a/rnase l pathway in human t cells phosphoproteomics to characterize host response during influenza a virus infection of human macrophages cellular hnrnp a /b interacts with the np of influenza a virus and impacts viral replication strand-specific affinity of host factor hnrnp c /c guides positive to negative-strand ratio in coxsackievirus b infection ubiquitin-specific peptidase targets traf and human t cell leukemia virus type tax to negatively regulate nf-kappab signaling immune cell regulation by autocrine purinergic signalling multifaceted roles of purinergic receptors in viral infection tuning of in vivo cognate b-t cell interactions by intersectin is required for effective anti-viral b cell immunity modification by ubiquitin-like proteins: significance in apoptosis and autophagy pathways interferon regulatory factor controls th cell effector function and metabolism leukemia inhibitor factor (lif) inhibits hiv- replication via restriction of stat activation inhibition of beta interferon induction by severe acute respiratory syndrome coronavirus suggests a two-step model for activation of interferon regulatory factor centrosome and retroviruses: the dangerous liaisons centrosomal protein trim restricts herpesvirus infection by regulating nuclear lamina integrity microtubule regulation and function during virus infection t cell protein tyrosine phosphatase attenuates t cell signaling to maintain tolerance in mice sp regulates the expression of immune-related genes associated with multiple sclerosis and other autoimmune diseases by nf-kappab inhibition key: cord- - n ms c authors: pedersen, niels c.; liu, hongwei; gandolfi, barbara; lyons, leslie a. title: the influence of age and genetics on natural resistance to experimentally induced feline infectious peritonitis date: - - journal: vet immunol immunopathol doi: . /j.vetimm. . . sha: doc_id: cord_uid: n ms c naturally occurring feline infectious peritonitis (fip) is usually fatal, giving the impression that immunity to the fip virus (fipv) is extremely poor. this impression may be incorrect, because not all cats experimentally exposed to fipv develop fip. there is also a belief that the incidence of fip may be affected by a number of host, virus, and environmental cofactors. however, the contribution of these cofactors to immunity and disease incidence has not been determined. the present study followed random-bred specific pathogen free (spf) cats that were obtained from a single research breeding colony and experimentally infected with fipv. the cats were from several studies conducted over the past years, and as a result, some of them had prior exposure to feline enteric coronavirus (fecv) or avirulent fipvs. the cats were housed under optimized conditions of nutrition, husbandry, and quarantine to eliminate most of the cofactors implicated in fipv infection outcome and were uniformly challenge exposed to the same field strain of serotype fipv. forty of the ( %) cats survived their initial challenge exposure to a type i cat-passaged field strains of fipv. six of these survivors succumbed to fip to a second or third challenge exposure, suggesting that immunity was not always sustained. exposure to non-fip-inducing feline coronaviruses prior to challenge with virulent fipv did not significantly affect fip incidence but did accelerate the disease course in some cats. there were no significant differences in fip incidence between males and females, but resistance increased significantly between months and or more years of age. genetic testing was done on of the infected cats. multidimensional scaling (mds) segregated the cats into three distinct families based primarily on a common sire(s), and resistant and susceptible cats were equally distributed within each family. genome-wide association studies (gwas) on cats that died of fip after one or more exposures (cases) and cats that survived (controls) demonstrated four significant associations after k permutations. when these same cats were analyzed using a sib-pair transmission test, three of the four associations were confirmed although not with genome-wide significance. gwas was then done on three different age groups of cases to take into account age-related resistance, and different associations were observed. the only common and strong association identified between the various gwas case configurations was for the . – . mb region of chromosome a . no obvious candidate genes were present in this region. naturally occurring feline infectious peritonitis (fip) is usually fatal, giving the impression that immunity to the fip virus (fipv) is extremely poor. this impression may be incorrect, because not all cats experimentally exposed to fipv develop fip. there is also a belief that the incidence of fip may be affected by a number of host, virus, and environmental cofactors. however, the contribution of these cofactors to immunity and disease incidence has not been determined. the present study followed random-bred specific pathogen free (spf) cats that were obtained from a single research breeding colony and experimentally infected with fipv. the cats were from several studies conducted over the past years, and as a result, some of them had prior exposure to feline enteric coronavirus (fecv) or avirulent fipvs. the cats were housed under optimized conditions of nutrition, husbandry, and quarantine to eliminate most of the cofactors implicated in fipv infection outcome and were uniformly challenge exposed to the same field strain of serotype fipv. forty of the ( %) cats survived their initial challenge exposure to a type i cat-passaged field strains of fipv. six of these survivors succumbed to fip to a second or third challenge exposure, suggesting that immunity was not always sustained. exposure to non-fip-inducing feline coronaviruses prior to challenge with virulent fipv did not significantly affect fip incidence but did accelerate the disease course in some cats. there were no significant differences in fip incidence between males and females, but resistance increased significantly between months and or more years of age. genetic testing was done on of the infected cats. multidimensional scaling (mds) segregated the cats into three distinct families based primarily on a common sire(s), and resistant and susceptible cats were equally distributed within each family. genome-wide association studies (gwas) on cats that died of fip after one or more exposures (cases) and cats that survived (controls) demonstrated four significant associations after k permutations. when these same cats were analyzed using a sib-pair transmission test, three of the four associations were confirmed although not with genome-wide significance. gwas was then done on three different age groups of cases to take into account age-related resistance, and different associations were observed. the prevalence and severity of infectious diseases among multi-cat populations is a product of many diverse factors that affect the host/pathogen interaction (pedersen, ) . environmental factors include things such as population density, sanitation, and interchange of animals while agent factors include virulence, dose, and route of exposure. host factors include developmental and heritable anomalies in the immune system and age at the time of exposure and intercurrent illnesses. many of these diverse cofactors have been implicated in fip. foley et al. ( ) studied a number of environmental risk factors for fip in seven catteries and found that cat numbers (density) and husbandry procedures had no influence on fip incidence while age, high coronavirus antibody titers, and the proportion of cats shedding coronavirus were significantly associated with fip risk. all of these risk factors are interrelated, because fecal coronavirus shedders are much more likely to have antibody titers > : and younger cats are more likely to shed fecv at higher levels and for longer periods (pedersen et al., , . the stresses of placing young cats into shelters have also been shown to greatly increase the levels of fecv shedding . field strains of fipv are known to vary intrinsically in virulence and this virulence may be further affected by the route of administration (pedersen et al., ; pedersen and floyd, ) . the dose of virus used also can alter disease outcome although a dose that causes lethal infection in one cat may be insufficient to infect another (pedersen and black, ) . virulence may be influenced by the exact fip-inducing mutations that are present. the known fipassociated mutations in fecv c and the s /s cleavage site are highly variable and unique to each isolate while the two single nucleotide mutations in the fusion domain are common to all fipvs (pedersen, ) . mutations in b can also alter virulence in some tissue culture-adapted strains, but do not play a role in the fecv-to-fipv mutations in nature (pedersen, ) . additional mutations may await discovery and their singular or collective roles in fip remain to be determined. several host factors have been implicated in fip. the stress of surgery, especially when performed at a young age, may increase susceptibility of cats to fip development (kass and dent, ) . co-infections with felv will greatly increase the incidence of fip by interfering with fip immunity; more than one-third of all fip cases occurred in cats that were persistently infected with felv (cotter et al., ; pedersen et al., ) . feline immunodeficiency virus (fiv) can also compromise host immunity and increase fip prevalence under experimental conditions (poland et al., ) . the present study was designed to eliminate as many potential agents, environmental, and host risk factors for fipv infection as possible. the same field strain and infectious dose of virus were used for challenge exposure, a uniform standard of care was provided with no extraneous pathogen exposure, and the cats originated from the same breeding stock. the study was then concentrated on two potential risk factors that have been poorly studied, age at the time of exposure and genetic susceptibility. the effect of age on fipv infection has not been directly addressed, even though it has been previously discussed (pedersen, ) and well documented for pathogens such as feline leukemia virus (felv) (hoover et al., ) . kittens are born with immature immune systems, and the period between and weeks of age is when igg and iga systems are being compensated by passive local and systemic immunity (pedersen, a) . immaturity of the immune system may also play a role in the ability to vaccinate kittens to fip; a commercially marketed attenuated live fipv vaccine only demonstrated sufficient efficacy for licensing when given to kittens weeks or older (gerber et al., ) . field and laboratory studies indicate that some sort of maternal or innate resistance to fecv infection is present in neonatal kittens and that fecv fecal shedding usually does not occur until weeks of age, even among kittens born to infected queens (pedersen et al., ) . most cases of fip occur in cats between and months of age (reviewed pedersen, ) suggesting that some infections may remain subclinical for an extended period of time. the possible role of genetics in fip resistance has been implied from a number of studies. fip did not exist before the s (holzworth, ) , suggesting that cats may not have had time to genetically adapt, thus explaining why morbidity and mortality are so high in experimental fipv infections. pedigreed cats are more likely to develop fip than random-bred cats (robison et al., ; rohrbach et al., ; pesteanu-somogyi et al., ; worthing et al., ) , and certain breeds are also more likely to succumb to fip (bell et al., ; norris et al., ; pesteanu-somogyi et al., ; worthing et al., ) . one study of persian catteries and pedigrees indicated that susceptibility to fip was at least % heritable . resistance to fip in birman cats also appears to have a genetic component as determined by gwas (golovko et al., ) . natural resistance to fip has also been observed in up to one-third of random-bred cats used as controls in vaccine studies (baldwin and scott, ; gerber et al., ; glansbeek et al., ; hohdatsu et al., ; kiss et al., ; pedersen and black, ; wasmoen et al., ) . the cats, infection outcome data, and dna used in the present study originated from studies on type fipv and fecv conducted over the last several years with other objectives. over the course of these studies, cats of various age and gender were exposed one or more times to virulent strains of fipv and their disease course closely monitored and cause of death confirmed to be fip. forty of the cats resisted a single challenge exposure and remained resistant after repeated infections. the studies were unique in that all of the cats were housed in identical facilities, cared for in an identical manner, and maintained free from other feline pathogens. therefore, they were not affected by many of the agents, environmental, and host factors that might affect the incidence of fip in nature. this allowed for an uncomplicated assessment of risk factors such as age, gender, and genetic susceptibility on disease outcome. cats were obtained from the specific pathogen free (spf) breeding colony of the feline nutrition and pet care center, university of california, davis (uc davis) (uc davis iacuc # ). the colony was established in with a small number of cats derived aseptically by cesarean section and records on all matings have been maintained to the present time. mating pairs were selected based on degree of relatedness and outcrossing to enhance genetic diversity done on two occasions, and . the relationships of all cats were known from the colony records. cats used for this study were housed in the feline research laboratory of the center for companion animal health under conditions required by usda regulations. fifty-four of the of cats were coronavirus naïve while had previous fecv or non-virulent fipv exposure (pedersen et al., (pedersen et al., , . experimental infection studies were conducted under uc davis institutional animal care and use committee protocol # . the origins of type i fipv-i c and fipv-m c and the preparation of cell-free infectious inoculates have been previously described (pedersen et al., ) . a total of ml of a : - : dilution of a % cell-free suspension of diseased omentum was given by either the intraperitoneal (ip) or oronasal (on) route. this proved infectious to % of cats by either route based on the occurrence of disease and/or seroconversion. cats were sedated with ketamine hydrochloride and inoculated either intraperitoneally (ip) or on ( . ml orally, . ml nasally) with the various virus stocks. rectal temperatures were recorded starting - days prior to inoculation and at - day intervals thereafter. cats were examined daily for signs of disease, such as fever, inappetance, depression, diarrhea, dehydration, ascites, hyperbilrubinemia, hyperbilirubinuria, and jaundice. affected cats were euthanized with an intravenous overdose of pentabarbital/ phenytoin as soon as their disease course was deemed terminal. antibodies to feline coronavirus were titrated by indirect immunofluorescence using crandell-rees feline kidney cells infected with fipv- - as an antigen substrate (pedersen, ) . whole edta-treated blood was available from of cats and genomic dna isolated using the qiagen (valencia, ca) gentra puregene blood core kit. gwas was performed using the illumina infinium iselect feline dna array (illumina inc., san diego, ca). the arrays were tested by geneseek inc. (lincoln, ne). snp genotyping rate and minor allele frequency (maf) was evaluated using plink (purcell et al., ) . snps with a maf < %, genotyping rate < %, and individuals genotyped for < % of snps were excluded from downstream analyses. an mds with two dimensions was performed on , snps in plink to evaluate population substructure within cases and controls. inflation of p-values was evaluated by calculating the , and assessed with a q-q plot. a casecontrol whole genome association analysis was performed and corrected with , t-max permutations (-mperm , ) with significance at −log (pgenome) ≥ . . the transmission disequilibrium test among sib-pairs (sib-tdt) (spielman and ewens, ) was performed on phenotypically discordant sib-pairs using the function (-dfam). the sib-tdt analysis was conducted without including the founders in frequency calculation (-nonfounders). one hundred eleven cats were experimentally infected with virulent fipv either by the ip or on routes, and the disease outcome ultimately confirmed either by necropsy or seroconversion. there was no difference in challenge outcome between the two routes (data not shown). fifty-seven cats had one or two prior exposures to fecv, non-infectious fipv mutants, or sub-infectious doses of virulent fipv. thirty-three of these ( %) cats developed fatal fip, compared to of ( %) of naïve cats after experimental infection with virulent fipv (fig. ) , which was not significantly different (p = . , fisher's exact test). the strength of immunity was tested by re-challenge. twenty two of ( %) of the pre-sensitized survivors and of ( %) survivors without prior coronavirus exposure were still resistant after a second challenge-exposure (fig. ) . thirteen survivors from both groups were then exposed to fipv a third time, and of ( %) remained resistant (fig. ) . one cat survived a fourth infection and another survived five exposures (fig. ) . the onset of disease after fipv infection always coincided with the appearance of fever (fig. ) , which was rapidly followed by other signs such as inappetence, lethargy, cessation of grooming, hyperbilirubinemia, hyperbilirubinuria, jaundice, and ascites. in contrast, cats that resisted disease showed virtually no febrile response, remained outwardly normal, and seroconverted (fig. ) . pre-sensitization to non-disease-causing feline coronaviruses did not significantly alter the mortality rate although cats with prior exposure were somewhat more likely to develop accelerated disease (fig. ) . all of the cats with prior coronavirus exposure became terminally ill within days while five cats without prior exposure survived from to days. four of these five slow progressors died of non-effusive of fip and one of effusive fip. survival rates were examined for cats of different gender and age. no difference was observed in fip incidence between male and female cats (data not shown). there was a progressive and significant (p = . ) decrease in mortality from months to greater than year of age (fig. ) . over % of cats younger than months of age died compared to less than % of cats infected at greater than year of age. cats from - months of age were intermediate in susceptibility. fip is known to persist in a subclinical form for some period of time following survival from challenge exposure to fipv (pedersen, b) and this has confounded the interpretation of survival data in past fip vaccine studies (baldwin and scott, ; hoskins et al., ) . to rule out subclinical infections among resistant cats in the present study, six individuals that had survived two or more challenge exposures were necropsied after - months and examined for subclinical lesions. no gross evidence of subclinical disease was found. therefore, most cats that survived fipv challenge will eventually clear the infection if given enough time. genome-wide association studies were conducted on of the infected, including cases and controls. plink analysis showed snps with genome-wide significance on chromosomes a , b , b , and c (fig. ) . a fifth snp with genome-wide significance was present among non-annotated snps (uk) but was not further investigated. in order to determine any effect of relatedness on gwas of the total population, family-related substructure was determined by multidimensional scaling (mds). mds segregated all case and control cats into three separate families (a, b, c) (fig. ) . cats from family a were sired by multiple related cats while cats in families b and c were each descended from a single sire. there was no significant difference in how fip resistant and susceptible cats segregated between and within families (fig. ) . the family substructure identified by mds was amended using a sib-tdt analysis with phenotypically discordant nuclear families. after permutation, none of the snps remained genome-wide significant although strong associations were again observed on chromosomes a , b , and c , the association on b was lost, and two new associations occurred on chromosomes c and d (fig. ) . it was apparent that age at the time of exposure was a significant independent risk factor for disease outcome. therefore, an attempt was made to compensate for age in the selection of cats used for gwas (fig. ) . the control group of cats remained the same based on the assumption that if a cat survived fipv infection at < months of age, it would also survive exposure at months and older. conversely, a cat that died when exposed at < months of age might have survived if infected at > months of age fig. . sib-transmission/disequilibrium test of cats that died of fip and survivors using the -dfam and , permutation command in plink. five peaks of strong association were identified on defined chromosomes. four of the five associations were near potential candidate genes relevant to fip immunopathogenesis. independent on any genetic factors. although the population size of case and controls was similar for each age group tested by gwas, there were marked differences in the major genome-wide associations seen on manhattan plots depending on the age of the case cats at the time of fipv exposure (fig. ) . the only strong association in common with these three age-adjusted gwas studies and the total case/control population was for a region on chromosome a that extended from . - . mb (table ) . it was also noteworthy that a disproportionate number of the highest ranking snps fell into this region, regardless of the configuration of case and controls based on age (fig. ) , relatedness (fig. ) , or on neither of these factors (fig. ) . based on ensembl, this region contains protein-coding genes and novel protein-coding transcripts. none of the genes appeared to be obvious candidates for immune or inflammatory processes involved in fip. the goal of this study was to identify cofactors that were most strongly involved with natural resistance to fipv infection. this was accomplished by negating as many potential cofactors as possible using a standardized virus challenge, cats from the breeding facility, optimal husbandry, providing a uniform environment and diet, minimizing extraneous stresses, and eliminating the effects of other common infections that might occur in multi-cat environments such as catteries or shelters. after minimizing the agent, environmental, and host cofactors, the opportunity existed to study host-related factors such as genetics, age, and gender on fip resistance. the present study also dealt with the strength of immunity, which does not appear to be absolute. about % of cats that survived one fipv infection succumbed to a second or third exposure. a similar occurrence was observed by wasmoen et al. ( ) ; one of five cats that had successfully resisted a challenge exposure that killed of non-vaccinates developed fip upon a second exposure. this type of immunity is different from that established by feline panleukopenia, a parvovirus disease. panleukopenia immunity is usually solid and is more dependent on humoral than cellular responses (scott, ) . therefore, fipv immunity more closely resembles immunity to its parent virus, feline enteric coronavirus (fecv). fecv-infected cats shed virus in their feces for weeks or months before sufficient immunity develops to stop shedding, but after shedding ceases, antibody levels fall and many of the cats become susceptible to reinfection (pedersen et al., ) . subclinical disease is also known to linger after initial natural and experimental infection in some cats as demonstrated by felv activation (pedersen, b; pedersen et al., ) . this was the first study documenting the significance of age at time of exposure on fipv outcome, even though it has been frequently cited as a disease cofactor (pedersen, ). immunity to experimental fipv infection increased progressively from months of age through adulthood. gerber et al. ( ) also reported an age-related response to an attenuated live fipv vaccine, with significant protection only observed when vaccination was started at weeks of age. the effect of age on disease outcome is well known for infectious disease agents such as feline leukemia virus (hoover et al., ) . age resistance to felv increases dramatically during kittenhood as the immune system matures and has confounded felv vaccine duration of immunity studies (wilson et al., ) . gender, in particular intact males, has been reported as a risk factor for fip in other studies (norris et al., ; pesteanu-somogyi et al., ; rohrbach et al., ) . we did not see a gender bias in the present study, nor was it seen in an earlier study of purebred and random-bred cats (foley et al., ) . a large component of the present study involved attempts to associate fip resistance to specific genetic markers by gwas. previous experience with a large cohort of inbred birman cats (golovko et al., ) suggested that this approach could be applied to the present cohort of randomly bred cats. however, the same population substructure problems encountered in the birman study were faced in this study. gwas comparing all cases and controls demonstrated four significant genome-wide associations on several chromosomes and some possible candidate genes. however, there was considerable population substructure as revealed by mds and attributed to separate male founder effects. population substructure due to relatedness in a case-control study can be overcome by using different types of analysis, such as the transmission disequilibrium test (tdt) or the sib-tdt that was employed in this study. a previous gwas study localized the autosomal recessive locus associated with hypokalemia in cats by analyzing as few as cases and controls (gandolfi et al., ) . however, the present study was conducted on random-bred cats, which are known to have less linkage disequilibrium than within pedigreed cats (alhaddad et al., ) . the study was further confounded by the polygenic appearance of the inheritance. inheritance to fip resistance/susceptibility in a similarly sized cohort of birman cats also appeared to be polygenic and there were no common regions of association, which would have reinforced both studies (golovko et al., ) . to compensate for family-related substructure, a transmission disequilibrium test among sib-pairs using the statistics of spielman and ewens ( ) was then performed. eighteen discordant sib-pair nuclear families were identified within the cohort, which was more than the phenotypically discordant sib-pairs that successfully detected the association with a cone-rod dystrophy in dogs (wiik et al., ) . based on sib-tdt on the fip cohort, five strong snp associations on different chromosomes were identified, but none reached genomewide significance. snps on chromosomes a , b , and c were shared by the two different analyses while two new associations on chromosomes c and d appeared. although the associations detected by sib-tdt did not reach genome-wide significance after permutations, similar regions were suggested by both analyses within the three overlapping chromosomes. it is possible that these regions could reach genome-wide significance if more discordant sib-pairs are added to the association analysis. an attempt was also made to compensate for age at the time of exposure as an independent and presumably non-genetic risk factor for fip resistance. unfortunately, the number of case and control cats challenge exposed after year of age was too low, so cats exposed at > months and > year were combined. the control population remained the same for all gwas configurations based on the premise that kittens surviving exposure at less than months of age would still resist exposure as they aged. as was expected based on previous gwas configurations, relatively small changes in the case populations had a marked effect on observed associations. after comparing the results of gwas based on age, gwas of the total population, and gwas based on family structure, only one peak of strong, but not genome-wide significant, associations were present on chromosomes a in a region between . and mb. thirty five annotated genes were present within this region, but none appeared to be strong candidates for fip resistance. it can be concluded from these various gwas studies that resistance to fip in this population of relatively random-bred spf cats was not influenced by a single or even small number of genes. as in an earlier study with a much more inbred birman population (golovko et al., ) , any genetic component of resistance is likely to be polygenic and divergent between various populations. although mutations in a single gene have been identified that confer resistance to infectious disease, such as the ccr mutation for hiv infection (dean et al., ) , susceptibility and resistances to infectious agents clearly involve complex host/virus/environment interactions that make genetic studies difficult. this has been shown in diseases such as human and ruminant tuberculosis (chimusa et al., ; le roex et al., ) , a disease that closely resembles the dry form of fip. the existence of additional risk factors, involving the environment, host, and agent, is perhaps one of the most daunting problems in the search for genetic influences on infectious diseases. this study removed a large number of those confounding factors but was still unable to identify specific genes that might be involved in fip resistance. unfortunately, even highly inbred breeds, such as birman, with significant linkage disequilibrium and closed colonies, such as the one in this study, suffer from high genomic inflations. even so, the strong associations demonstrated in this relatively small gwas employing a relatively low-density array indicate that fip resistance is influenced in some part to genetic factors. the heritability of these genetic factors remains a subject of ongoing breeding studies. we did not interrogate one region on chromosome a that was consistently found to differ in association between all of the various gwas configurations. hopefully, the present data can be reanalyzed as the cat genome annotation improves and more dense arrays become available. next-generation and whole exome sequencing are also becoming cost accessible and might be preferable ways to search for complex genetic associations and specific mutations. it might also be fruitful to mate immune cats to see if resistance is heritable and if so, to do gwas or next-generation sequencing on their offspring. the objective of this study was to define natural immunity to fip among randomly bred specific pathogen-free cats bred for laboratory purposes under conditions that would eliminate as many extrinsic disease cofactors as possible. cats were housed free of other feline pathogens and fed and cared for in a uniform manner. this emphasized the relative influence of age at the time of exposure, strength of immunity as gauged by repeated challenge exposure, and possible genetic resistance. one-third of random-bred laboratory cats used in various studies over the last decade appeared to be resistant to infection with type i field strains of fipv. however, immunity was not absolute and a small number of cats died after a second and even third challenge. age at the time of exposure seemed to be the most significant predictor of resistance; cats under months of age were most apt to develop fip, cats - months were intermediate, and cats over months of age demonstrated significant resistance. strong genetic associations were identified by gwas in regions of several chromosomes, especially when comparing all cats that died of fip with all survivors. however, all but one of these regional associations changed when gwas was adjusted for family substructure or age at the time of fipv exposure. this confirmed previous gwas studies on fip resistance in birman cats (golovko et al., ) ; both studies showed inheritance of fip resistance to be highly complex and confounded by considerable population stratification. future breeding studies will hopefully confirm the heritability of fip resistance. the authors declare no conflicts of interest. extent of linkage disequilibrium in the domestic cat, felis silvestris catus, and its breeds attempted immunization of cats with feline infectious peritonitis virus propagated at reduced temperatures the relationship between the feline coronavirus antibody titre and the age, breed, gender and health status of australian cats genome-wide association study of ancestry-specific tb risk in the south african coloured population multiple cases of feline leukemia and feline infectious peritonitis in a household genetic restriction of hiv- infection and progression to aids by a deletion allele of the ckrs structural gene the inheritance of susceptibility to feline infectious peritonitis in purebred catteries risk factors for feline infectious peritonitis among cats in multiple-cat environments with endemic feline enteric coronavirus first wnk -hypokalemia animal model identified by genome-wide association in burmese cats protection against feline infectious peritonitis by intranasal inoculation of a temperature-sensitive fipv vaccine adverse effects of feline il- during dna vaccination against feline infectious peritonitis virus genetic susceptibility to feline infectious peritonitis in birman cats vaccine efficacy of a cell lysate with recombinant baculovirus-expressed feline infectious peritonitis (fip) virus nucleocapsid protein against progression of fip some important disorders of cats feline leukemia virus infection: age-related variation in response to cats to experimental infection challenge trial of an intranasal feline infectious peritonitis vaccine the epidemiology of feline infectious peritonitis in catteries disease outcome and cytokine responses in cats immunized with an avirulent feline infectious peritonitis virus (fipv)-ucd and challenge-exposed with virulent fipv-ucd bovine tb in livestock and wildlife: what's in the genes? clinicopathological findings associated with feline infectious peritonitis in sydney, australia: cases an update on feline infectious peritonitis: virology and immunopathogenesis a review of feline infectious peritonitis virus infection: - feline husbandry. in: diseases and management in the multiple-cat environment basic and clinical immunology virologic and immunologic aspects of feline infectious peritonitis virus infection serologic studies of naturally occurring feline infectious peritonitis attempted immunization of cats against feline infectious peritonitis using either avirulent live virus or sublethal amounts of virulent virus experimental studies with three new strains of feline infectious peritonitis virus: fipv-ucd , fipv-ucd , and fipv-ucd . compendium feline infectious peritonitis: role of the feline coronavirus c gene in intestinal tropism and pathogenicity based upon isolates from resident and adopted shelter cats significance of coronavirus mutants in feces and diseased tissues of cats suffering from feline infectious peritonitis pathogenesis of feline enteric coronavirus infection common virus infections in cats, before and after being placed in shelters, with emphasis on feline enteric coronavirus pathogenic differences between various feline coronavirus isolates studies of naturally transmitted feline leukemia virus infection prevalence of feline infectious peritonitis in specific cat breeds two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus plink: a tool set for whole-genome association and population-based linkage analyses naturally occurring feline infectious peritonitis: signs and clinical diagnosis epidemiology of feline infectious peritonitis among cats examined at veterinary medical teaching hospitals viral diseases (panleukopenia) a sibship test for linkage in the presence of association: the sib transmission/disequilibrium test protection of cats from infectious peritonitis by vaccination with a recombinant raccoon poxvirus expressing the nucleocapsid gene of feline infectious peritonitis virus a deletion in nephronophthisis (nphp ) is associated with recessive cone-rod dystrophy in standard wire-haired dachshund difficulties in demonstrating long term immunity in felv vaccinated cats due to increasing agerelated resistance to infection risk factors for feline infectious peritonitis in australian cats funds for this study were provided over a period of many years by organizations such as the center for companion animal health, school of veterinary medicine, uc davis, winn feline health, and the cat health network grant d fe- (a consortium of the morris animal foundation, the winn feline foundation, the american association of feline practitioners and the american veterinary medical foundation). we are also grateful for the many private donations that have been made by individuals and private groups such as save our cats and kittens fip (sock fip). key: cord- -xg foch authors: tanaka, yoshikazu; sato, yuka; osawa, shuichi; inoue, mai; tanaka, satoka; sasaki, takashi title: suppression of feline coronavirus replication in vitro by cyclosporin a date: - - journal: vet res doi: . / - - - sha: doc_id: cord_uid: xg foch the feline infectious peritonitis virus (fipv) is a member of the feline coronavirus family that causes fip, which is incurable and fatal in cats. cyclosporin a (csa), an immunosuppressive agent that targets the nuclear factor pathway of activated t-cells (nf-at) to bind cellular cyclophilins (cyp), dose-dependently inhibited fipv replication in vitro. fk (an immunosuppressor of the pathway that binds cellular fk -binding protein (fkbp) but not cyp) did not affect fipv replication. neither cell growth nor viability changed in the presence of either csa or fk , and these factors did not affect the nf-at pathway in fcwf- cells. therefore, csa does not seem to exert inhibitory effects via the nf-at pathway. in conclusion, csa inhibited fipv replication in vitro and further studies are needed to verify the practical value of csa as an anti-fipv treatment in vivo. coronaviruses are single-stranded rna viruses that generally cause respiratory or intestinal infections such as severe acute respiratory syndrome (sars) in humans and transmissible gastroenteritis (tge) in pigs. feline coronaviruses (fcov) have been classified into two biotypes, comprising the ubiquitous feline enteric coronavirus (fecv) and infectious peritonitis virus (fipv). the widely accepted theory in vitro is that fipv arises by mutation of parental fecv in the gastrointestinal tract of infected cats, then systemically spreads and causes fip that is fatal in cats [ , ] . although the mutation sites are not fully understood, some accessory genes are candidates for the site of the critical mutations responsible for fip [ , ] . approximately % of all purebred cats are infected with feline coronavirus and among these, - % develop the classical symptoms of effusive/ wet fip, the non-effusive/dry form of fip, or a combination of the two [ ] . many strategies have been developed to cure fip. interferon ω inhibits fipv in vitro but is ineffective in vivo [ ] . various other immunosuppressants, such as glucocorticoids and cyclophosphamide, have been studied, but although these drugs prolong life, the outcome of fipv infection remains fatal [ ] . thus, an effective vaccine and therapeutic medicine against fipv are still needed. investigators have reported that the immunosuppressant cyclosporin a (csa) can suppress the genomic replication and transcription of several viruses [ ] [ ] [ ] [ ] . cyclophilins (cyp) are cellular factors with high affinity for csa [ ] and comprise a family of cellular peptidyl-prolyl cis-trans isomerases (ppiases) that catalyze the cis-trans interconversion of the amino-terminal of peptide bonds to proline residues, thus facilitating changes in protein conformation as a chaperone protein [ ] . cyclosporin a blocks both the enzymatic activities of cyp that lead to the calcineurin (cn)-nf-at and p-glycoprotein pathways. the capsid protein of human immunodeficiency virus type (hiv- ) possesses a cyclophilin a (cypa) binding site for incorporation into the virion [ , ] . a csa-induced reduction in cypa inhibits transport of the reverse-transcribed viral genome to the nucleus [ ] . cyclophilin b (cypb) is another target of csa that promotes hepatitis c virus (hcv) replication by regulating the rna-binding ability of the hcv ns b protein. in addition, cypa facilitates mouse cytomegalovirus (mcmv) replication and cypb is required for the infectious entry of human papillomavirus type . here, we show that csa inhibits intracellular replication of the fipv genome and viral protein expression in vitro independently of the nf-at pathway. felis catus whole fetus- (fcwf- ; american type culture collection, va, usa) cells were maintained in dulbecco's modified eagle's medium (d-mem, sigma-aldrich, tokyo, japan) supplemented with % fetal bovine serum (jrh, nissui, tokyo, japan). we propagated fipv ( - strain; a gift from dr tsutomu hodatsu, kitasato university, japan) in fcwf- cells and then purified them by linear sucrose gradient ultracentrifugation. we inoculated fcwf- cells with fipv - at a multiplicity of infection (moi) of plaque-forming unit (pfu) per cell to study their effects on fipv infection. after adsorption for h at °c, the medium containing the virus was removed, and the cells were rinsed three times with phosphate-buffered saline [pbs (−)] and incubated with or without various concentrations of csa (sigma-aldrich), cyclosporin h (csh; cosmobio, tokyo, japan) and fk (sigma-aldrich) for h. the cells were then processed for photography. the cells were adsorbed with fipv, rinsed three times with pbs (−), overlaid with dmem containing % fetal bovine serum and % agarose s (nippon gene, toyama, japan). after a -h incubation, the cells were stained with giemsa solution and the plaques were counted. we isolated the nucleocapsid (n) gene of fipv from the plasmid pbrdi (provided by dr peter j. m. rottier, institute of biomembranes, utrecht university, the netherlands) containing the fipv - genome, using the polymerase chain reaction (pcr) with the primers '-acaaggac gacgacgacaaggccacacagggacaacgcg- ' and '-ccggaattcttagttcgtaacctcatcaa- ' for the first amplification. the products of the first amplification were purified by electrophoresis and gel extraction, and then a second pcr proceeded with the purified products and primers containing a flag-tagged sequence: ( '-gccaccatggactacaaggacgacgacgacaag- ' and '-ccggaattcttagttcgtaacctcatcaa- '). the second pcr products were cut with nco i and eco ri and subcloned into the sites between nco i and eco ri of the ptri-ex . vector (novagen, takara bio, kyoto, japan) to express flag-tagged n protein. the fcwf- cells were infected at an moi of pfu per cell and then incubated with or without csa, csh or fk . the medium was removed at h post-infection, and rnaiso-plus (takara bio) was added to the cells for rna preparation according to the manufacturer's protocol. total rna ( ng) was reverse-transcribed using the pri-mescript rt-pcr kit (perfect real time; takara bio). viral cdna were quantified by real-time pcr using the forward and reverse primers to the fipv-n gene ( '-tggccacacagggacaac- ') and ( '-agaac gaccacgtcttttggaa- '), and the taqman probe (fam-gttgca gcacagccagcataaacaa-bhq- ). reaction mixtures were prepared according to the manufacturer's protocol using premix extaq (takara bio), and sequences were amplified using a sequence detection system (applied biosystems, tokyo, japan) under the following cycling conditions: initial denaturation at °c for s and cycles at °c for s and °c for s each. complementary dna to the fipv-n gene was cloned into the ptri-ex . vector, which was serially diluted to provide standards for fipv gene quantification. the viral rna copy number was normalized using the feline β- -microglobulin (β m) gene (genbank; nm_ ). the β m gene derived from fcwf- cells was cloned by pcr amplification using the following primers: fβ m-f '-ggcgcgttttgtggtcttggtc- ' and fβ m-r '-cacttaacgaccttgggctc- '. the amplified pcr products were subcloned into ptac- plasmids (biodynamics laboratory inc. tokyo, japan) to provide standards for the β m gene. we then quantified the feline β m gene by real-time pcr using the forward ( '-cgcgttttgtggtcttggtcttggt- ') and reverse ( '-aaacctgaacctttggagaatgc- ') primers for the β m gene and detected the gene using the taqman probe, tamra-cggactgctctatctgtc ccacctgga-bhq- . luciferase activities were quantified using pgl . [luc p/nfat-re/hygro] (promega, tokyo, japan), prl-sv vectors for the nf-at response assay and the interferon stimulation response was determined using the plasmid pisre-tk hrluc (f) provided by riken bioresource center (tsukuba, japan) and the pgl promoter (promega). both reporter assays proceeded using the dual-luciferase reporter assay system (promega). briefly, the two reporter plasmids were co-transfected into fcwf- cells with or without csa or fk for each assay. recombinant feline ifnα (pbl biomedical laboratories, nj, usa) was added at a concentration of units/ml to the culture medium to evaluate the response to interferon (ifn). total cell lysates were prepared with reporter lysis buffer provided with the dual-luciferase reporter assay system at h before the assay. luciferase activities were quantified in triplicate assays using a lumat lb (berthold technologies, tokyo, japan). the cell membranes were disrupted with cell lysis buffer [ mm tris-hcl, ph . , mm ethylenediamine tetraacetic acid (edta), % np- , . m nacl] including complete mini (roche diagnostics, tokyo, japan) at h after infection. the cell lysates were resolved by electrophoresis on - % bis-tris gels (invitrogen, ca, usa) and western blotted onto immobilon-p membranes (millipore, tokyo, japan). non-specific protein binding was blocked with % non-fat dry milk for h and then the membranes were incubated with anti-feline coronavirus nucleocapsid (n) antibody (fipv - ; mybiosource, ca, usa) or anti-β-actin (sigma-aldrich) for h. antigen signals were visualized by reacting proteins on the membranes with horseradish peroxidaseconjugated anti-mouse igg antibody (promega) followed by an enhanced chemiluminescence substrate (supersignal west femto maximum sensitivity substrate; thermo scientific, tokyo, japan) according to the manufacturer's protocol. we assayed wst- to evaluate cytotoxicity using the cell counting kit- (dojin chemical inc., wako, japan) according to the manufacturer's directions. statistical significance was determined using the student's t test. for all data analyzed, a significance threshold of p < . was assumed. the values are expressed in some figures as means ± standard deviation (sd). we initially assessed the effects of csa on fipv rna replication using cytotoxicity assays. cyclosporin a at concentrations of - . μm (cytotoxic dose , . ± . μm) did not affect fcwf- cell viability ( figure a ) and dose-dependently reduced the numbers of fipv plaques ( figure b) , whereas μm csa was slightly cytotoxic. cyclosporin a blocks both the enzymatic activities of cyp that lead to the calcineurin (cn)-nf-at and the p-glycoprotein pathway. we therefore assessed the effect of various concentrations of fk , which also blocks the nf-at pathway, on cell viability to confirm that csa inhibited fipv through this pathway. the cytopathic inhibitory effects did not significantly differ in the presence or absence of . - μm fk ( figure b ) and cell viability was not affected by μm fk (figure a ). quantitative rt-pcr showed that . - μm csa dose-dependently suppressed fipv rna replication, whereas fk did not exert significant inhibitory effects, except at μm fk (approximately % reduction compared to μm fk , p < . ; figure a ). western blotting showed that csa, but not fk dosedependently decreased fipv-n protein ( figure b) . we then examined whether the suppressive effects of csa on fipv replication depend on the inhibitory nf-at pathway or p-glycoprotein pathway by incubating fipv-infected cells with csh, which specifically blocks the p-glycoprotein pathway. the results show that no inhibition occurred (data not shown). to determine whether the action of csa and fk involves activation of interferon-stimulated gene responses in fcwf- cells, the isre-luciferase reporter plasmid, pisre-tk hrluc (f) and pgl promoter plasmid as a normalization-control plasmid were transfected into fcwf- cells and cultured with feline interferon α, csa or fk . the results of the dual-luciferase assay showed that none of these factors significantly affected luciferase activities at h after transfection. these results indicate that fcwf- cells are unresponsive, even to interferon α ( figure a) . consequently, the action of csa on intracellular fipv replication does not involve the activation of interferonstimulated genes on fcwf- cells. moreover, to evaluate the effects of csa and fk on the calcineurin-nf-at pathway in fcwf- cells, the nf-at luciferase reporter plasmid, pgl . [luc p/nfat-re/hygro] and prl-sv as a normalization-control plasmid were transfected into fcwf- cells that had been incubated with csa or fk . neither csa nor fk affected nf-at luciferase activities in fcwf- cells ( figure b ). these findings show that csa does not influence the nf-at pathway in fcwf- cells and that the inhibition of fipv rna replication by csa is independent of the calcineurin nf-at pathway. we discovered that csa inhibits intracellular fipv replication in vitro. the results of qrt-pcr and western blotting showed that viral proliferation was strikingly inhibited at csa concentrations between . and μm. the results of cell viability assays showed that μm csa was slightly cytotoxic. the inhibitory effects at this concentration should therefore be considered in the light of cytotoxicity. in contrast, immunosuppressive fk did not inhibit fipv replication except at μm according to the qrt-pcr findings. however, the inhibitory effects of . - μm fk did not significantly differ on western blots and the number of plaques did not significantly differ within the same concentration range of fk . these findings might be related to the difference of the analytical detection sensitivity between qrt-pcr and western blot assays. cyclosporin a binds cyclophilins, whereas fk binds cellular fkbp. each complex independently inhibits the phosphatase activity of calcineurin that mediates the nf-at pathway, which is critical to the expression of cytokines and their receptors [ , ] . the results of nf-at reporter assays indicate that neither csa nor fk influenced nf-at activities on fcwf- cells under our experimental conditions. thus, the antiviral activity against fipv is not involved in the suppression of gene responses regulated by nf-at but instead is exerted through distinct mechanisms that are independent of fk . pfefferle et al. recently described that sarscoronavirus nsp overexpression increases signaling through the nf-at pathway and enhances the induction of interleukin [ ] . our data were somewhat inconsistent with these findings. the discrepancy might be explained in part by the fact that their experimental system included the addition of -o-acetylphorbol -myristate (pma) and ionomycin to the culture medium. further knockdown studies of the nf-at gene would clarify its role in fipv proliferation. furthermore, ifnα did not stimulate isre-promoter activities in fcwf- cells under these conditions. these data suggest that the action of csa on the intracellular replication of fipv is independent of the ifn pathway. this cell line might not be responsive to ifnα and would thus be useful for isolating feline coronavirus. cyclophilins have ppiase activity [ , [ ] [ ] [ ] , contribute to the maturation of several proteins, and are involved in cell signaling, mitochondrial function (atp synthesis), molecular chaperone activity, rna splicing, stress response, gene expression, cholesterol transport, and the regulation of kinase activity [ ] [ ] [ ] [ ] . surface plasmon resonance technology and bioinformatics tools have found that the sars coronavirus n protein binds to cypa [ ] [ ] [ ] . therefore, the n protein of fipv probably binds to cyp proteins to regulate viral replication. the roles of cyp in virus replication and the inhibitory effect by csa on hcv and several other viruses have been studied [ ] [ ] [ ] [ ] . the proposed mechanisms of the inhibitory effect of csa mainly involve cypa and cypb in virus replication [ , , ] . based on these earlier findings, we believe that interaction between the fipv genome is likely or that viral and cyp proteins play critical roles in viral replication and transcription. further studies are required to resolve which cyp is critical for viral replication and which viral protein is required to form replication complexes with cyp and/or other cellular proteins. cats with clinically diagnosed fip have very rarely been cured, although several therapeutic strategies have been attempted. some cats treated with prednisolone and phenylalanine mustard or cyclophosphamide have gone into remission [ ] . various immunosuppressants, such as glucocorticoids and cyclophosphamide, may prolong life but do not alter the fatal outcome [ ] . further investigations using ppiase dominant-negative assays and rna interference methods are warranted to clarify the role of csa against ppiase in fipv replication in vitro. in addition, whether csa could be useful as fip treatment in vivo remains to be determined acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis deletions in the a orf of feline coronavirus associated with an epidemic of feline infectious peritonitis a review of feline infectious peritonitis virus infection: - cellular composition and interferongamma expression of the local inflammatory response in feline infectious peritonitis (fip) effect of feline interferon-omega on the survival time and quality of life of cats with feline infectious peritonitis treatment of cats with feline infectious peritonitis sdz pri , an orally bioavailable human immunodeficiency virus type proteinase inhibitor containing the -aminobenzylstatine moiety mode of action of sdz nim , a nonimmunosuppressive cyclosporin a analog with activity against human immunodeficiency virus (hiv) type : interference with hiv protein-cyclophilin a interactions requirement for cyclophilin a for the replication of vesicular stomatitis virus new jersey serotype cyclophilin b is a functional regulator of hepatitis c virus rna polymerase cyclophilin: a specific cytosolic binding protein for cyclosporin a active site mutants of human cyclophilin a separate peptidyl-prolyl isomerase activity from cyclosporin a binding and calcineurin inhibition sdz - , a new picornavirus capsid-binding agent with potent antiviral activity in vivo efficacy of sdz - , a new picornavirus capsid-binding agent inhibition of human immunodeficiency virus type replication in human cells by debio- , a novel cyclophilin binding agent handschumacher re: calmodulin, cyclophilin, and cyclosporin a the sars-coronavirus-host interactome: identification of cyclophilins as target for pan-coronavirus inhibitors cyclosporin a inhibits an initial step in folding of transferrin within the endoplasmic reticulum cyclosporin-mediated inhibition of bovine calcineurin by cyclophilins a and b overexpression, purification, and characterization of yeast cyclophilins a and b cyclophilin and peptidyl-prolyl cis-trans isomerase are probably identical proteins multiple cyclophilins involved in different cellular pathways mediate hcv replication immunophilins: switched on protein binding domains? peptidyl-prolyl cis-trans isomerase is the cyclosporin a-binding protein cyclophilin cyclophilin a-induced alterations of human immunodeficiency virus type ca protein in vitro cyclophilin a is required for an early step in the life cycle of human immunodeficiency virus type before the initiation of reverse transcription cyclophilin a modulates processing of human immunodeficiency virus type p gag: mechanism for antiviral effects of cyclosporin a purified matrix protein of vesicular stomatitis virus blocks viral transcription in vitro nucleocapsid protein of sars coronavirus tightly binds to human cyclophilin a suppression of feline coronavirus replication in vitro by cyclosporin a this study was supported by a grant-in-aid for scientific research (c) from the japan society for the promotion of science and the strategic research base the authors declare that they have no competing interests. key: cord- -jaue mv authors: simons, fermin a.; vennema, harry; rofina, jaime e.; pol, jan m.; horzinek, marian c.; rottier, peter j.m.; egberink, herman f. title: a mrna pcr for the diagnosis of feline infectious peritonitis date: - - journal: j virol methods doi: . /j.jviromet. . . sha: doc_id: cord_uid: jaue mv a reverse transcriptase polymerase chain reaction (rt-pcr) for the detection of feline coronavirus (fcov) messenger rna in peripheral blood mononuclear cells (pbmcs) is described. the assay is evaluated as a diagnostic test for feline infectious peritonitis (fip). it is based on a well-documented key event in the development of fip: the replication of virulent fcov mutants in monocytes/macrophages. to detect most feline coronavirus field strains, the test was designed to amplify subgenomic mrna of the highly conserved m gene. the test was applied to feline blood samples ( from healthy, from sick cats suspected of fip) and returned % of the diseased cats as positive for feline coronavirus mrna in their peripheral blood cells; of the healthy cats, % tested positive. of a group of animals in which fip had been confirmed by post-mortem examination, ( %) tested positive, whereas cats with different pathologies (non-fip cases) all tested negative. in view of the low rate of false-positive results (high specificity) the mrna rt-pcr may be a valuable addition to the diagnostic arsenal for fip. coronaviruses are enveloped, positive-stranded ssrna viruses, a genus in the family coronaviridae, order nidovirales. they are ubiquitous in cat populations, with particularly high prevalence in catteries and multiple-cat households. feline coronaviruses (fcovs) show a bimodal pathogenicity distribution, with subclinical or mild enteric infections in young kittens at one extreme and the deadly feline infectious peritonitis (fip) at the other. the low virulence strains are referred to as feline enteric coronaviruses (fecv), the highly virulent ones as fip viruses (fipv) . though occurring only sporadically (i.e. not causing epidemics), fip is an important disease: it is mostly fatal, its biology is still poorly understood and prevention is difficult, to say the least. fip is an immune mediated, progressive polyserositis and pyogranulomatosis. it occurs worldwide, affecting both domestic and wild felids (holzworth, ; horzinek and osterhaus, ) . antibodies against fcovs are found in - % of the animals living in catteries or multiple-cat households and in up to % of solitary cats; however, only some - % of the seropositive cats eventually come down with fip. the reason for this discrepancy became clear when the biological and genetic properties of fecv and fipv isolates had been studied (addie and jarrett, ; hohdatsu et al., ; horzinek and osterhaus, ) : the avirulent fcov strains causing inconspicuous infections are responsible for the high sero- prevalence; in cats experiencing some immunosuppressive event, expansion of the quasispecies cloud and mutations in the fecv genome lead to virulent variants that induce fip (vennema et al., ) . at present, there are no routine serological and virological assays available for an aetiological diagnosis of fip, and to distinguish avirulent from virulent fcovs. although serology is still used in the diagnosis of fip, it is of very limited value. results can only be interpreted in correlation with clinical symptoms. currently the presumptive diagnosis of fip is based on clinical data and characteristic changes in some blood parameters (cammarata parodi et al., ; gouffeux et al., ) . a definite diagnosis can only be made on the basis of histological examination of biopsy material or postmortem (sparkes et al., (sparkes et al., , . our pcr technique using primers targeted to conserved regions of the viral genome, the -utr (lai and cavanagh, ) , and its modifications (using the s gene (gamble et al., ) ) became a valuable tool for the detection of fcov in body fluids and tissue samples. unfortunately, the technique detects also avirulent fcovs in healthy cats. although the percentage of pcr-positive healthy animals is much lower when compared to fip cats, a positive pcr result alone does not allow a definite diagnosis gunn-moore et al., ). an important event in fip pathogenesis is the infection of monocytes and macrophages (stoddart and scott, ). originally, it was thought that the avirulent fecvs would remain confined to the digestive tract and not spread beyond the intestinal epithelium and regional lymph nodes. virulent fipvs, on the other hand, would leave the gut, enter the bloodstream, generalize and reach different organ parenchymas via infected monocytes. not unexpectedly, however, fcov were detected in blood samples of healthy cats that never developed fip, and also after experimental fcov infection (gamble et al., ; gunn-moore et al., ; herrewegh et al., ; kipar et al., ) . there may be a difference between the sheer presence of fcov in peripheral blood mononuclear cells (pbmcs) and their replication in pbmcs, and we hypothesized that the latter may be a correlate of virulence. a rt-pcr that detects messenger rna of the highly conserved m gene of the fcov genome in peripheral blood cell samples (lai and cavanagh, ; zhang et al., ) would detect the macrophage-tropic variants and bypass non-virulent fcov strains in blood. the present study presents the results of this approach. the fcov reference strains and their sources are listed in table . strains fipv - , fecv - , and fipv ucd were grown in felis catus whole fetus (fcwf) cells. fipv ucd was obtained from tissue cell culture from in- kapke and brian ( ) a assignment according to pedersen et al., a. b tentative assignment (hohdatsu et al., ) . fected fcwf cells (pedersen et al., b) . fecv ucd was acquired from feline faeces as described by pedersen ( ) and grown to low titers in fcwf cells. fipv dahlberg was obtained from brain of a mouse inoculated with homogenate as described by osterhaus et al. ( ) . fipv wellcome was derived from feline embryonic lung (fel) culture cells as described by o'reilly et al. ( ) . blood samples were collected from diseased cats suspected of having fip based on clinical symptoms (n = ) as well as from healthy cats (n = ). the healthy cats were mainly animals living in the same household or cattery as the cats suspected of having fip. these samples were obtained from different veterinary clinics in the netherlands. blood: a maximum of ml of non-coagulated edta blood was centrifuged for min at rpm. plasma was separated from the cell pellet and stored at − • c. one volume of pbs was added to the blood cells and total rna was isolated following the total quick rna blood kit protocol (talent). the oligonucleotide primers were chosen from the highly conserved m gene sequence (primer ) of the fcov genome combined with a primer aiming at the leader sequence of the fcov-genome (primer ). primer sequences are shown in table . as a control to check the efficiency of the rna isolation from all the blood samples and the subsequent reverse transcriptase reaction, a glyceraldehyde- -phosphate dehydrogenase (gapdh) rt-pcr was performed for every clinical sample (primers and ). for the reverse transcriptase (rt) reactions, l of the rna solution and l of reverse primer or (each samples were stored at − • c before using it in the mrna rt-pcr assay. following reverse transcription, l of the rt reaction mixture was added to l of the pcr reaction mixture. the pcr mix consisted of l pcr buffer ( ×; perkin elmer usa, × mm tris-hcl, ph . , mm kcl), . l magnesium chloride ( mm; gibcobrl life technologies), l dntps ( mm each dntp; gibcobrl life technologies), l primer ( mm), and l primer ( mm) (both invitrogen), . l taq polymerase ( u/ l; gibcobrl life technologies). for the gapdh rt-pcr reaction the same pcr mix was used but with different primers: l primers and (each mm) (both invitrogen). the reaction mixture was placed in a thermal cycler (biozym). the temperature cycling protocol consisted of min incubation at • c followed by cycles of min denaturation at • c, min primer annealing at • c and min primer extension at • c. the cycles were followed by min at • c and finally the reaction mixture was cooled to • c. twenty microliters of each pcr sample was analysed by electrophoresis using a . % tae agarose gel (gibcobrl life technologies) for min at v. a bp molecular weight marker (invitrogen) was used to control the size of the amplified pcr product. amplification products were visualised using ethidium bromide staining and uv radiation. samples revealing a bp fragment for the primers and and another fragment of bp for the primers and were considered positive for coronavirus. amplification products were photographed using the biorad geldoc . twenty-three of the obtained pcr products were sequenced to confirm the rt-pcr product. in order to avoid contamination due to carry-over of amplification products several precautions were taken including physical separation of the pre-and post-pcr procedures, the use of aerosol-resistant filter tips (biozym), and during each step from rna isolation to reverse transcriptase and amplification, negative controls of rnase free water were included to try to rule out any false positives. if possible, necropsy of the cat was performed to confirm or rule out a clinical diagnosis of fip. a total of cats were subjected to post-mortem examination. when macroscopic observations were inconclusive, sections of different organs like liver, kidney, spleen etc. were prepared and examined histopathologically. to determine if a rt-pcr for m gene mrna detects different coronavirus isolates, several laboratory isolates were subjected to this assay (table ) . rna from fipv serotype i (strains ucd , ucd ), and serotype ii (strains - , nor , wellcome), fecv serotype i (ucd, rm), fecv serotype ii ( - ), fipv wellcome, ccv-k and tgev purdue could all be detected in cell culture and faeces material or tissue homogenates. after amplification, fragments of the expected size of bp were obtained with all isolates, as shown in fig. . in all samples tested, gapdh amplicons were demonstrated. the gapdh gene, which is constitutively expressed at high levels in most tissues, was used for reference as a positive result in the gapdh rt-pcr will rules out any failure of sample rna isolation or reverse transcription. an example of a positive mrna rt-pcr assay and gapdh control is shown in fig. . blood samples from healthy cats were assessed for the presence of fcov in peripheral blood cells. these animals had been living in catteries or multiple cat households, where other cats with fip-related clinical signs were living. twentythree cats out of the cats ( %) indeed tested positive for fcov in the mrna rt-pcr test. two cats from the pcrpositive animals became sick within months, both showing different clinical symptoms, one of them indicative of fip. unfortunately, the cause of death could not be assessed by necropsy. veterinary practitioners had submitted samples from cats they suspected to suffer from fip. the animals had shown one or several of the following symptoms: fever, anorexia, weight loss, diarrhea, poor growth, enlarged abdomen, presence of ascitic or thoracic fluid, uveitis and neurological signs. of these, samples ( %) were positive for fcov degrees of freedom: ; chi-square = . ; p is less than or equal to . ; the distribution is significant. mrna in blood cells. a summary of the pcr results is shown in table . microscopy was performed on cats tested for fcov mrna in the blood. in cases fip was confirmed. of these, cats ( %) were found to have fcov mrna in their peripheral blood cells (table ). in none of animals that were shown to have suffered from other diseases than fip, fcov mrna was detected in peripheral blood cells (e.g. heart failure, neoplastia, and bacterial infections. the obtained results were statistically significant when controlled by a chi-square (table ) . this report describes an rt-pcr assay to detect fcov mrna in blood samples of cats. our approach was based on the assumption that during the pathogenesis of fip, the mutant virus would replicate in monocytes and macrophages. we postulated that detection of fcov mrna in blood samples would correlate with the development of fip. there are several observations that led to this assumption. infection of monocytes and macrophages is considered as the most important pathogenetic event in fip. the mutant virus has acquired a new tropism and replicates to high titers in monocytes and macrophages (stoddart and scott, ; kipar et al., ) . in vitro, the virulence of fcov strains correlated with their ability to infect macrophages: avirulent fcovs infected fewer cells and produced lower titers than virulent fcovs. the avirulent fcovs were also inferior in sustaining viral replication and spreading to other macrophages (haijema, personal communication) . in coronavirus-infected cells a nested set of subgenomic mrnas is synthesized, each molecule possessing a "leader sequence". this stretch of - nucleotides (coronavirus species dependent) has been derived from the -end of the genome through discontinuous transcription and is not translated. making use of primers specific for the m-gene mrna leader sequence (lai and cavanagh, ) and a conserved part of the m-gene, a molecule of bp will be amplified. using the mrna rt-pcr assay, type ii fcov genomes like fipv - , fipv wellcome, fipv nor and fecv - could be detected in cell culture. type i fcovs like fipv ucd , fipv ucd , fecv ucd, and fipv dahlberg were detected as well. in view of the fact that also canine (ccv k ) and porcine (tgev purdue) coronaviruses tested positive the assay should detect most, if not all, fcov variants. the high detection rate of fcov from cats suspected of suffering from fip in the field supports this assumption. from its design, the mrna assay would appear to be more specific (only replicating virus detected) and more sensitive (only nucleated blood cells employed) for the diagnosis of fip than previous rt-pcr assays focused on genomic rna in body fluids, feces, and tissues (gamble et al., ; gunn-moore et al., ; herrewegh et al., ) . using this assay, we detected mrna in about % of edta blood samples from confirmed fip cases. in the genomic rna pcr, - % of fip cats were found to test positive (gamble et al., ; gunn-moore et al., ; herrewegh et al., ) . more importantly, of the healthy cats living in catteries or multiple cat households with a notoriously large virus burden, only % tested positive for fcov. the presence of fcov rna in blood monocytes in healthy cats infected with fcov is an indication that the development of fip is not associated with the capability of an fcov to cause viraemia and systemic infection (meli et al., ) previous studies quote figures between and % (gamble et al., ; gunn-moore et al., ; herrewegh et al., ) , which can be expected in view of the high sensitivity of the pcr. the specificity of our test format would therefore appear as a significant improvement over previously published methods. the question remains if the mrna positive, healthy cats harbour virulent mutants in an early stage of fip pathogenesis. quantitative analyses of fcov mrna levels would be needed to identify potential differences between healthy and diseased cats. a study of naturally occurring feline coronavirus infections in kittens using direct immunofluorescence to detect coronavirus in peritoneal and pleural effusions sequence analysis of the -end of the feline coronavirus fipv - genome: comparison with the genome of porcine coronavirus tgev reveals large insertions fip, easy to diagnose? characterization of a feline infectious peritonitis virus isolate development of a nested pcr assay for detection of feline infectious peritonitis virus in clinical specimens feline infectious peritonitis. proteins of plasma and ascitic fluid detection of feline coronaviruses by culture and reverse transcriptase-polymerase chain reaction of blood samples from healthy cats and cats with clinical feline infectious peritonitis detection of feline coronavirus rna in feces, tissues, and body fluids of naturally infected cats by reverse transcriptase pcr elimination of feline coronavirus infection from a large experimental specific pathogen-free catbreeding colony by serologic testing and isolation the prevalence of type i and ii feline coronavirus infections in cats some important disorders of cats the virology and pathogenesis of felineinfectious peritonitis sequence analysis of the porcine transmissible gastroenteritis coronavirus nucleocapsid protein gene histopathological alterations of lymphatic tissues in cats without feline infectious peritonitis after long-term exposure to fip virus the molecular biology of coronaviruses isolation of feline coronaviruses from two cats with divers disease manifestations high viral loads despite absence of clinical and pathological findings in cats experimentally infected with feline coronavirus (fcov) type i and in naturally fcov-infected cats feline infectious peritonitis: isolation of a coronavirus feline infectious peritonitis (fip) virus; propagation in suckling rat and hamster brain virologic and immunologic aspects of feline infectious peritonitis virus infection infection studies in kittens, using feline infectious peritonitis virus propagated in cell culture an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis experimental studies with three new strains of feline infectious peritonitis virus: fipv-ucd , fipv-ucd , and fipv-ucd . th annual symposium of viral diseases of feline infectious peritonitis: a review of clinicopathological changes in cases, and a critical assessment of their diagnostic value coronavirus serology in healthy pedigree cats intrinsic resistance of feline peritoneal macrophages to coronavirus infection correlates with in vivo virulence genomic organization and expression of the end of the canine and feline enteric coronaviruses feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses coronavirus leader rna regulates and initiates subgenomic mrna transcription both in trans and cis the authors would like to thank the veterinary practitioners and referring cat owners; without their help this study could not have been completed. this study was supported by a research grant from id-lelystad, the netherlands. key: cord- -c u t authors: pedersen, niels c. title: an update on feline infectious peritonitis: virology and immunopathogenesis date: - - journal: vet j doi: . /j.tvjl. . . sha: doc_id: cord_uid: c u t feline infectious peritonitis (fip) continues to be one of the most researched infectious diseases of cats. the relatively high mortality of fip, especially for younger cats from catteries and shelters, should be reason enough to stimulate such intense interest. however, it is the complexity of the disease and the grudging manner in which it yields its secrets that most fascinate researchers. feline leukemia virus infection was conquered in less than two decades and the mysteries of feline immunodeficiency virus were largely unraveled in several years. after a half century, fip remains one of the last important infections of cats for which we have no single diagnostic test, no vaccine and no definitive explanations for how virus and host interact to cause disease. how can a ubiquitous and largely non-pathogenic enteric coronavirus transform into a highly lethal pathogen? what are the interactions between host and virus that determine both disease form (wet or dry) and outcome (death or resistance)? why is it so difficult, and perhaps impossible, to develop a vaccine for fip? what role do genetics play in disease susceptibility? this review will explore research conducted over the last years that attempts to answer these and other questions. although much has been learned about fip in the last years, the ultimate answers remain for yet more studies. feline infectious peritonitis (fip) continues to be a major killer of young cats and is one of the most researched infections of the species. over published articles concerning fip have appeared in the world's literature since the last extensive review of the disease (pedersen, ). many of these and earlier publications have been covered in excellent clinical (addie et al., ; drechsler et al., ) and scientific (myrrha et al., ; kipar and meli, ) reviews. the goal of the present review is not to retrace old tracks, but rather to present old and new discoveries on fip in a different light. fip is a relatively new disease of cats and only became clinically significant in the late s (pedersen, ) . it is uncertain where the first fip virus (fipv) came from, but one possibility is that feline coronaviruses originated within the century from another host species. alternatively, it is possible that contemporary feline coronaviruses are genetic variants of a preexisting and somewhat different virus species that was less prone to undergo biotype conversion. both scenarios are known to occur with coronaviruses. the intestinal form of coronavirus in pigs has been replaced worldwide by a much less pathogenic pneumotropic strain (rasschaert et al., ) , while several coronaviruses have entered human beings from other mammalian hosts (chan et al., ) . we also cannot discount the important changes that occurred in the status and husbandry of cats in the period after world war ii and how they affect fip incidence. cats have grown steadily in numbers as pets, and pedigreed cats and catteries have increased greatly in popularity. the post-war urban and suburban sprawl has greatly increased the numbers of feral and semi-feral (community) cats, and resulted in large numbers of kittens and cats coming into shelters and other foster/rescue organizations. an increasing proportion of our pet cats now come from these types of multicat environments, which can be stressful and favor fecal-oral transmission at a very young age. it should not be surprising that coronaviruses are now the most common pathogen identified in the feces of cats (sabshin et al., ) . coronaviruses have adapted themselves over thousands of years to virtually every species of mammals and birds, and are a common cause of transient enteritis and respiratory disease. prior to the last decade, research interest in coronaviruses as pathogens has largely been limited to poultry, pigs, cattle and cats (hagemeijer et al., ) . however, with the emergence of severe acute respiratory syndrome (sars) and middle eastern respiratory syndrome (mers), interest in coronaviruses as pathogens has dramatically increased, along with levels of research funding. there are commonalities between what has been learned with animal coronaviruses and these emerging and sometimes fatal human viruses. they are continuously adapting themselves to new hosts, they readily recombine with closely related species to form new viruses, and they even change cell tropisms and virulence within the same host. although there is still no cure or sure prevention for fip, a great deal has been learned about the disease in the last years. the internal mutation theory, whereby a ubiquitous feline enteric coronavirus (fecv) mutates into a fipv, has been reconfirmed and at least three specific mutations have now been associated with the fecv-to-fipv biotype conversion. much more is known about the interaction of enteric and fip biotypes with their specific and very different host cells, and the radically different host response and clinical outcomes they provoke. a number of new reagents have been developed, allowing researchers to better understand these two biotypes and their diseases, and hopefully more are forthcoming. nevertheless, fip remains one of the most complex of all viral infections of cats. it is not possible to understand the interrelationship of fecvs and fipvs without understanding how enveloped, positive, singlestranded rna viruses replicate (hagemeijer et al., ) . the genome of feline coronaviruses consists of > , nucleotides and open reading frames (orfs) encoding structural, non-structural and accessory genes. coronaviruses attach to specific cell receptors through a complimentary ligand on the spike or surface (s) protein. once attachment occurs, fusion with the cell membrane is dependent on a separate fusion domain and a fusion peptide comprising two heptad repeat regions (hr and hr ). the virus is then internalized and the single positive strand of rna is released into the cytosol. the ' two thirds of the feline coronavirus genome consists of two orfs, orf a and orf b. ribosomes initiate translation at the beginning of orf a and a proportion undergo frame shifting at the junction of orf a and b, resulting in polyprotein pp ab. ribosomes that do not frame shift produce polyprotein pp a. these polyproteins consist of approximately non-structural proteins involved in proteolytic processing, genome replication and subgenomic mrna synthesis. the non-structural proteins of feline coronaviruses interact with components of the endoplasmic reticulum and golgi apparatus to produce a replication-transcription complex. a rna-dependent rna polymerase makes negative sense copies of the genome, as well as subgenomic rnas, which in turn serve as templates for the production of positive strand mrnas. only positive-stranded rnas are capped and polyadenylated. the ' polyadenylation and ' cap structures mimic those of cellular mrnas, enabling the virus to use the cell's own machinery for viral protein synthesis. the nucleocapsid (n) protein plays an essential role in viral rna and protein synthesis, and virion assembly (verheije et al., ) . viruses undergoing assembly make their way to the cell surface within membrane structures, where they are released by exocytosis as mature virions (almazán et al., ) . in the process of maturation, the viral envelope also incorporates proteins acquired from various cell compartments. these added host constituents might aid survival in the face of host defenses. this strategy to produce viral proteins from nested subgenomic mrnas is highly efficient. however, like any process involving rna polymerases, an error rate in the order of / , nucleotides is expected. to minimize errors, the large genome encodes a number of non-structural proteins that ensure a higher fidelity of replication (hagemeijer et al., ) . nonetheless, mutations do occur with some frequency. chang et al. ( ) compared whole virus sequencing of fipv-fecv pairs and observed substitutions in at least nucleotides, representing % of the genome. of these nucleotides, occurred in orf ab, in orf s (encoding the s glycoprotein), in orf abc, in orf e (encoding the small envelope protein), in orf m (encoding the integral membrane protein), in orf n (encoding the n protein) and in orf ab. other types of mutations, leading to insertions, deletions and premature stop codons, as well as recombinants, have also been observed in vivo, both within and between hosts (pedersen et al., , . phillips et al. ( ) studied the mutation rate of fipv strain wsu- - in vitro after , and passages, followed by whole viral genome sequencing at each passage level. they observed predicted amino acid changes in orf a/ b during this period in culture, one predicted change in the s protein (which reverted back after additional passages), four changes in orf c and one each in orfs a, m, n and a, and calculated the mutation rate to be - × − nucleotides/site/passage. this suggested that the genome was relatively stable in vitro and in the absence of host and environmental selection pressures. feline coronavirus mutations that do not have a negative impact on survival accumulate with time and can become dominant within micro-and macro-environments, such as catteries and geographically distinct regions . such mutations can be used to track a specific coronavirus back to its most likely origin. recombination also adds to genetic variation between coronaviruses and is common within clades, within the same cat and between cats (pedersen et al., , . recombination can even occur between related coronaviruses from different animal species. the type (serotype) ii feline coronaviruses are an example of cross-species recombination that has occurred between the s gene region of type i feline coronaviruses and canine coronavirus. the proportion of types i and ii fecvs, and therefore types i and ii fipvs, varies across the world, although type i strains predominate. duarte et al. ( ) studied the distribution of types i and ii fipvs in a portuguese cat population using a reverse transcriptase (rt)-pcr assay that amplified the ' end of the genome encompassing the region of feline/canine coronavirus s gene recombination. in cats with fip, type i coronavirus was present in % and type ii coronavirus in . %, whereas the remaining . % could not be typed. these viral sequences were further analyzed using a heteroduplex mobility assay, which detected quasi-species in % of samples. phylogenetic analysis of type i sequences revealed high genetic diversity among portuguese and previously characterized strains, while the tree for type ii strains had higher genetic homogeneity than the tree for type i strains (duarte et al., ) . there is a general consensus that fipvs arise by internal mutation from fecvs in the same environment (pedersen et al., , harley et al., ) . except in unusual circumstances , the causative mutations occur independently within each cat and each fipv strain has unique genetic features (pedersen et al., , chang et al., ; barker et al., ; licitra et al., ) . currently, three different genes have been associated with the fecv-to-fipv mutation or biotype conversion. each mutation is a result of positive selection pressures, initially for a switch from enterocyte to monocyte/macrophage tropism, then ultimately for infection, replication and survival in peritoneal macrophages in the face of host immunity. the orf c accessory gene was the first gene to be implicated in fecv-to-fipv conversion (vennema et al., ) , and these findings have been corroborated in subsequent studies (poland et al., ; chang et al., ; pedersen et al., ) . two thirds or more of fipvs have orf c mutations that lead to a truncated protein product, i.e. nucleotide deletions and insertions leading to frame shifting, and single nucleotide polymorphisms causing premature stop codons chang et al., ; hsieh et al., ) . the one third that do not have truncating mutations have an increased number of nucleotide changes, leading to an accumulation of non-synonymous amino acid changes in the ' terminus of the gene (pedersen et al., ) . however, only truncating mutations have a known effect on host cell tropism. two independent studies have confirmed the absolute requirement of an intact orf c for replication of feline coronavirus in the intestinal epithelium (chang et al., ; pedersen et al., ) . fipvs with truncating orf c mutations will not replicate in the gut epithelium, but will efficiently replicate in macrophages. fipvs with non-truncating mutations in the ' terminus of orf c will replicate in the intestine, but they do not appear to be infectious under experimental conditions (pedersen et al., ) . the function of the protein expressed by orf c is unknown. hsieh et al. ( ) transiently expressed orf c in macrophagelike cells (fcwf- ) and found that the protein was distributed mainly in the perinuclear region. they then infected fcwf- cells expressing the intact orf c protein with fipv ntu (lin et al., ) , which has a functionally mutated orf c gene. a significant inhibition of viral replication was observed relative to cells not expressing the orf c protein; this inhibition did not involve autophagy. the authors concluded that loss of a functional orf c protein in fipvs could enhance viral replication in macrophage-like cells. it might also be possible to infer functions to the orf c gene product by studying similar and better studied genes in other coronaviruses. a genbank blast search demonstrated % genetic homology between feline coronavirus orf c and sars coronavirus orf a . although the genetic homology is low, the orf c protein of feline coronavirus has a similar hydrophilicity profile to its own membrane (m) protein, and to the m and orf a proteins of sars coronavirus (oostra et al., ) . the sars orf a protein has pro-apoptotic properties involving both cells death receptor and mitochondrial pathways (mcbride and fielding, ) . similar to fipv orf c, mutants of the sars orf a gene are frequently identified in diseased tissues and encode proteins with shorter n termini than found in wild type (i.e. bat coronavirus) forms (tan et al., ) . the most recent studies on the orf a protein of sars coronavirus indicate that it forms a cation-selective channel that is expressed in infected cells and is involved in release of virions (schwarz et al., ) . is it also possible that mutations in fipv orf c protein inhibit apoptosis of infected macrophages? programmed cell death is a major factor in immunity to viral infection of a cell. the first mutation in the s gene that was associated with the fipv biotype was reported by chang et al. ( ) , who sequenced and compared the complete genomes of fipv-fecv pairs. a single nucleotide change within the s gene encoding the fusion peptide was present in / ( %) fipvs from cats with the wet and dry forms of fip, but absent from fecvs. a second mutation, two nucleotides away, was also strongly associated with fipvs. either or both of these two single base pair mutations were observed in most fipvs, but not in fecvs. these mutations, designated m l and s a, caused minor changes in single amino acids within the s protein in fipvs (i.e. methionine to leucine at position and serine to alanine at position ). the authors postulated that even minor changes in amino acids might be responsible for the increased macrophage tropism of fipvs. since these mutations were only observed in fipvs in diseased tissue and not in virus in feces, it can also be assumed that these particular mutations occur outside the intestine, possibly in monocytes/macrophages. their role in causing disease is unknown, but they are more likely to be involved in macrophage infectivity than in subsequent host-virus immune interactions. a second set of s gene mutations was reported by licitra et al. ( ) , who examined mutations at the s /s cleavage site of feline coronaviruses. this site is cleaved by furin, a protein that processes normal cellular precursor proteins into biologically active forms and is found in large quantities in the golgi network. compared to fecvs, all fipvs had at least one single base mutation in and around the s /s cleavage domain. these mutations were unique to each fipv and, depending on the number of mutations and exact amino acids that were changed, affected the efficiency of cleavage of the s protein by furin; in most cases, the efficiency was increased, while in some cases it was decreased and in others it remained unchanged. mutations in the region of the s /s cleavage site were not universal to all fipvs. unlike the two single base pair mutations described in the s region encoding the fusion peptide, which were present in % of fipv genomes examined (chang et al., ) , only two thirds of the same genomes had mutations at the s /s cleavage site (licitra et al., ) . there is evidence from a single cat that mutations in the region of the s /s cleavage site can occur early in the conversion of fecvs to fipvs (licitra et al., ) . two cats in this study shed fecvs in their feces for - years before one of them developed fip. the same single base pair mutation in the s /s cleavage region was identified in the fecal fecv and the fipv from diseased tissues of the cat that developed fip, whereas this mutation was not present in the cat that remained unaffected. these particular mutations may have resulted from positive selection pressures related to the adaptation of fecv for better replication in monocyte-macrophages, but not in later processes involving host-virus interactions. the above studies indicate that regions within the c terminus of the protein encoded by the s gene may be important in the conversion of fecvs to fipvs. a type i fipv (strain c ) remained fully virulent despite a base pair deletion encoding a predicted amino acid sequence in the n terminus (terada et al., ) ; this deletion would not affect the fusion peptide or s /s cleavage regions of the s protein. this begs the question as to what is the role of the n terminus of the s protein. it is too soon to say whether all of the mutations relevant to the fecv-to-fipv transition have been found. although we do not fully understand how these mutations function in disease, they do suggest potential targets for antiviral drugs, such as protease inhibitors (kim et al., ) or viral ion channel blockers (schwarz et al., ) . loss of virulence in fipvs such as strain wsu- - has been associated with large mutations encompassing almost the entire orf b accessory gene (herrewegh et al., (herrewegh et al., , , as well as small mutations, including those of only two nucleotide changes . lin et al. ( ) sequenced and compared feline coronavirus orf b mutations in ascites or pleural effusions from cats with effusive fip and in feces from clinically healthy fecv infected cats. thirty-two of the sequences had an intact orf b, whereas / sequences had deletions of either three or nucleotides. however, only / viruses with deletions were from cats with fip. therefore, deletions in orf b can occur naturally, as well as in tissue culture, and can occur in both fecvs and fipvs. loss of virulence associated with orf b mutations in fipvs has also led to false assumptions regarding the importance of this orf in fecv-to-fipv conversion and the designation of feline coronavirus strain wsu- - as a prototypic fecv, which was originally based on cat infection studies comparing type ii wsu- - , which does not cause fip, with wsu- - , the prototypic type ii fipv (pedersen et al., ) . the authors concluded that wsu- - did behave as a fecv. however, this conclusion is counterintuitive, since according to the mutation theory the orf b mutation should have been in wsu- - . furthermore, wsu- - grew readily in crandell rees feline kidney (crfk) cells, while the enteric coronavirus could not be cultured from infectious feces in any cell line at the time. sequencing of wsu- - also demonstrated a mutated orf c, whereas the orf c of fecvs is always intact (chang et al., ) . these findings led to the conclusion that the wsu- - strain was not a true fecv (pedersen, ). this finding altered the conclusions of many previous studies using wsu- - and wsu- - as prototypic fecvs and fipvs, respectively. dedeurwaerder et al. ( a) tried to link orf b with macrophage tropism and hence with the evolution of fipvs by measuring the replication kinetics of fipv wsu- - and several specific deletion mutants in monocyte cultures. the mutants lacked either the orf abc accessory genes (fipv-Δ ), orf ab (fipv-Δ ) or both orf abc and orf b (fipv-Δ Δ ). growth of fipv-Δ and fipv-Δ Δ could not be sustained in monocyte cultures, whereas sustained growth was observed in monocyte cultures infected with intact fipv wsu- - . fipv-Δ replicated in monocyte cultures, but at a lower level than intact fipv wsu- - . the authors concluded that orf is crucial for fipv replication in monocytes/ macrophages. they also concluded that their findings support the role of orf b in the development of fip and provide an explanation as to why orf b is almost always conserved in field strains of fipv. however, they failed to note that orf b is also highly conserved in field strains of fecv chang et al., ) . therefore, it is true that loss of the integrity of orf b (almost always occurring during cell culture passage) will cause fipvs to lose virulence, but it is not true that orf b mutations are involved in fecv-to-fipv transformation. a study by brown et al. ( ) temporarily shook the foundations of the internal mutation theory and was supported in theory, but not in fact, by at least one other group (licitra et al., ) . using phylogenetic analyses of coronaviruses identified in a small number of fipv-infected and healthy cats in a regional shelter in new england, usa, the authors purported to show the existence of two distinct types of feline coronaviruses circulating independently in the population tested; one type causing fip and the other not. the authors identified five non-contiguous amino acids in the m protein of feline coronavirus that differentiated these two types. however, the numbers of cats used to construct the phylogenetic trees were inadequate and the authors failed to consider that many of the cats originated from different geographic regions, thus introducing genetic drift and population bias. several subsequent experiments using larger numbers of cats and taking into consideration geographic bias failed to confirm the existence of distinct fecv and fipv types. a study from the netherlands failed to show that the five amino acid sequence defined distinct virus types and concluded that fipvs originate from fecvs in the same environments (chang et al., ) . additional studies on a large population of cats, taking into consideration genetic differences related to geographic origins, also failed to find evidence for the 'two virus' theory or any significant genetic differences between fipvs and fecvs from the same environments (pedersen et al., ) . a phylogenetic analysis of fecal and tissue coronaviruses from an outbreak of fip in a group of cats also confirmed that strains of fip-associated feline coronaviruses were very closely related to viruses identified in the feces of healthy cats in the same environment (barker et al., ) . this study also provided no evidence that genetically distinct virulent (fipv) and avirulent (fecv) strains of feline coronavirus were present during this outbreak. considerable information has been gained about mutations affecting biotypes and virulence of feline coronaviruses using reverse genetics. haijema et al. ( ) generated a mutant of fipv wsu- - in which the s gene was replaced by that of murine hepatitis virus (mhv), which allowed recombinant virus to be selected for in murine cells. in a second reverse process, the fipv s gene was reintroduced to permit growth in feline cells. the growth characteristics of this reverse recombinant virus in tissue culture and its virulence for cats were indistinguishable from that of the parental virus, fipv wsu- - . this technique was then used to develop an avirulent deletion mutant of fipv wsu- - that was assessed as a potential vaccine (haijema et al., ) . tekes et al. ( tekes et al. ( , tekes et al. ( , ) used a similar reverse genetics technique, but with a replication competent molecular clone of the type i fipv black strain, as well as the type ii fipv wsu- - . in their first study, orf abc of fipv black was replaced by a green fluorescent protein and luciferase so that the virus could be tracked in cd + blood monocytes and dendritic cells (tekes et al., ) . in a subsequent study, tekes et al. ( ) demonstrated that recombinant feline coronaviruses expressing the type ii s protein acquire the ability to efficiently use feline aminopeptidase n for host cell entry, while type i viruses use another host cell receptor. they also noted that the recombinant virus containing the type ii s gene produced high levels of large plaque virus identical to wild type fipv wsu- - . therefore, both the growth kinetics and the efficient usage of aminopeptidase n as a cellular receptor for type ii feline coronaviruses were attributed solely to the s protein. in their most recent study, tekes et al. ( ) studied the virulence of their earlier molecular clones in specific pathogen free (spf) cats inoculated via the intraperitoneal route. both engineered viruses established productive infection in cats, as determined by the detection of viral rna in feces and the induction of specific antibodies, but neither induced fip. unfortunately, neither control wild type fipv black, nor its recombinant, caused fip. the authors deduced that the mutation(s) responsible for the loss of virulence occurred upon prior tissue culture passage and resided in orfs a, m, n or ab, or the '-untranslated region ( '-utr). in contrast, spf cats infected with wild type fipv wsu- - and its replication competent molecular clone exhibited clinical signs starting at - weeks post infection and one cat in each group had to be euthanased after weeks. these two cats, along with two others, had typical lesions of fip at postmortem examination. a full length genome sequence was obtained from one of the cats infected with wild type fipv wsu- - . nine nucleotide differences were observed in the infecting virus, with three nonsynonymous mutations in the s gene, one in the gene encoding non-structural protein (replicase gene) and one in the e gene. significantly, the stop codon in the orf c accessory gene was changed to encode a glutamine residue, thus yielding an intact orf c protein. a full-length genomic sequence was also obtained from the spleen and kidney of one cat infected with the molecular cloned virus. two non-synonymous nucleotide changes were identified in the virus sequence from the spleen, while seven non-synonymous and three silent changes were identified in the virus sequence from the kidney. restoration of orf c was observed once again and viral rna with this genotype was also detected in the feces of both cats. this finding appeared to contradict earlier reports suggesting that only enteric biotypes (fecvs) require an intact orf c for intestinal replication (chang et al., ; pedersen et al., ) . however, fipvs with intact orf c genes have been found in the feces of cats with fip, and these viruses often have an increase in non-synonymous mutations in the ' terminus of orf c (pedersen et al., ) . tekes et al. ( ) demonstrated the importance of extending this reverse genetics approach to pathogenic type i feline coronaviruses and the need to generate recombinant fecvs that could be used to study early events in natural fecv-to-fipv evolution. three studies from different groups have addressed the behavior of fecv infection and immunity in laboratory cats (pedersen et al., ; kipar et al., ; vogel et al., ) . these experiments confirmed what had been previously observed in cats naturally infected with fecvs. primary fecv infection is largely subclinical or associated with a transient and usually mild diarrhea and is centered in the lower small intestine and colon (kipar et al., ; vogel et al., ) . large amounts of virus are shed in the feces for many weeks and even months after initial infection, but with time most cats cease shedding. there also appears to be a low level of fecv in blood monocytes during initial infection (kipar et al., ) . however, immunity is not always solid and, as antibody levels in the blood decrease, many cats become susceptible to reinfection (pedersen et al., ) . these secondary infections closely resemble the primary infection. the comparative importance of various feline enteric pathogens, including fecv, was studied by sabshin et al. ( ) in shelter cats. fecal samples were collected within h after admission in normal cats and cats with diarrhea, and tested by fecal flotation, antigen assays, pcr and electron microscopy for pathogens. twelve enteric pathogens were identified, including coronavirus, clostridium perfringens enterotoxin a, cryptosporidium spp., giardia spp., cystoisospora spp., hookworms, ascarids, salmonella spp., astrovirus, feline panleukopenia virus, calicivirus and spirometra spp. interestingly, cats with diarrhea were no more likely to be infected with one or more of these enteropathogens than cats with normal feces ( % in both groups). only fecv was significantly more prevalent in cats with diarrhea than in normal cats ( % and %, respectively). fecv was also the most common fecal pathogen, being several times more common than any other enteric pathogen studied. although numerous strains of fecv are found among cats throughout the world, at least one population has remained surprisingly free of infection. cats in the falkland islands have no signs of infection and attempts are being made to quarantine these cats from an inadvertent introduction of the virus (addie et al., ) . the long isolation of cats in the falklands is indirect evidence that coronaviruses might not have existed in cats at the time of their transit to the island. research investigating the fecv-to-fipv pathotype transformation has been hampered by an inability to grow fecv in tissue culture. a group from belgium might have solved this problem by creating a long-term feline ileocyte/colonocyte cell line using simian virus t antigen/human telomerase reverse transcriptase for immortalization . this cell line readily propagated two strains of type i fecvs, while no infection was seen in cultures inoculated with fipv tissue homogenates. the fact that fipvs would not grow in this cell line supports the theory that fipvs lose tropism for the intestinal epithelium and that fecv is the main biotype circulating among cats. the creation of this cell line will fill a large hole in the list of reagents needed to study the pathogenic properties of fipv. fecvs, and therefore fipvs, exist as two distinct types based on both serology and sequencing. type i fecvs/fipvs are unique to cats, while type ii fecvs/fipvs appear to be recombinants between type i fecvs and the closely related canine coronaviruses. serologic differences are due to canine coronavirus s protein sequences encoded by the orf a and s gene regions . type i fecvs/fipvs predominate in europe and the americas, while up to % or more feline coronaviruses from asian countries are type ii (sharif et al., ; an et al., ; amer et al., ) . the exact origin of type ii feline coronaviruses is unknown, but their genetic variability suggests that they are continuously being generated. the independent nature of these recombination events is indicated by the varying genetic makeup of the 'hybrid' viruses. these recombination events are often highly complex. this is demonstrated by strains such as ntu from taiwan (lin et al., ) . this strain not only contains an in-frame deletion of nucleotides in orf c, a mutation associated with the fecv-to-fipv biotype change, but also two crossover events with recombination sites located in the rnadependent rna polymerase and m genes. this produced a new virus with one-third of its genome originating from canine coronavirus. although not proven, it is widely assumed that type ii fipvs are more virulent than type i fipvs (lin et al., ; wang et al., ) , possibly associated with the ease with which they are propagated in a number of cat and dog cell lines. type ii fipvs might also be more likely to be transmitted between cats and to be associated with outbreaks of fip, such as one described in a taiwanese shelter . the question of whether fipv is transmitted cat-to-cat (horizontal transmission) or by internal mutation from fecv (vertical transmission) has also been a topic of interest. there is no solid evidence that cats with fip readily transmit fipv directly to other cats, although the possibility has been suggested as an explanation for rare mini-outbreaks of fip (pedersen, ). fipv can cause disease when fed to laboratory cats, and some experimentally infected cats will shed low levels of fipv-like virus (pedersen et al., , . however, such virus does not appear to be infectious when fed to other cats (pedersen et al., ) . some cats with naturally acquired fip can also shed either fecv or a coronavirus that appears genetically similar to the fipv within the same cats (chang et al., ). an outbreak of fip in taiwan associated with a type ii fipv appeared to be transmissible, but was self-limiting, either due to quarantine measures or more likely to genetic drift . sequential samples collected over time from this outbreak documented the replacement of the original virus, which had an intact orf c, with viruses having functionally mutated orf c. this provided indirect evidence that orf c mutations are more likely to be associated with disease than with infectivity. our knowledge of the pathogenesis of fip remains at a very basic level (pedersen, ; myrrha et al., ) . the working hypothesis is that fecvs mutate in a manner that causes them to lose tropism for enterocytes, while gaining tropism for macrophages. the exact site where these mutations occur is unknown, but it is apparently at some point between the intestine (enterocyte) and fip lesions (macrophage). a possible intermediate site for this transformation would be blood monocytes/macrophages, which are known to be infected during fecv infection (kipar et al., ) . fecv-to-fipv transition appears to involve positive selection for mutants that are increasingly fit for replication in macrophages and unfit for replication in enterocytes. the ultimate target cell is not just any macrophage, but rather a distinct population of precursor monocytes/ macrophages that have a specific affinity for the endothelium of venules in the serosa, omentum, pleura, meninges and uveal tract. it is widely assumed that immunity, when it occurs, is largely cell-mediated and that the production of antibodies is counterproductive. antibodies enhance the uptake and replication of fipvs in macrophages and also contribute to a type iii hypersensitivity (antibody-mediated or arthus-type) vasculitis (pedersen, ) . it is also assumed that much of the pathology occurring in fip is associated with how macrophages respond to viral infection and how the immune system of the host responds to the infected cells. in this scenario, the effusive form of fip results from a failure to mount t cell immunity in the face of a vigorous b cell response. at the opposite extreme, cats that resist disease presumably mount a vigorous cell-mediated immune response that is able to overcome any negative effects of antibodies. cats with the dry form of fip represent an intermediate state involving a cellular response that is partially effective in containing the virus to a relatively small number of macrophages in a few focal sites within specific target organs. the two forms of fip are somewhat interchangeable; when it has been observed in experimental infection, the dry form always follows a brief bout of effusive disease. in the terminal stages of naturally occurring dry fip, immunity can completely collapse and the disease reverts to a more effusive form. although this scenario fits what is known about fip, it must be emphasized that much of this scheme awaits confirmation and there are large gaps to be filled. an imbalance in t cell vs. b cell immune responses has been evoked as one reason for the inability of cats to resist fipv infection. one study demonstrated that the ratio of peripheral blood surface immunoglobulin positive cells (sig + ) to cd + cells was higher in cats with fip than in spf cats, and that cells strongly expressing mrna of the plasma cell master gene encoding b lymphocyteinduced maturation protein (blimp- ) were increased (takano et al., a) . the mrnas of interleukin , cd and b cell activating factor (baff) were also overexpressed in macrophages previously shown to be associated with antibody-dependent enhancement. vermeulen et al. ( ) studied the role of natural killer (nk) cells and regulatory t cells (tregs) in the innate and adaptive cellmediated immunity, respectively, in cats with naturally occurring fip. nk cells and tregs were drastically depleted from the peripheral blood, mesenteric lymph nodes and spleen in cats with fip, while the mesentery and kidneys from cats with fip did not show any differences when compared to healthy uninfected control cats. other regulatory lymphocytes of the cd + cd − foxp + and cd + cd + foxp + phenotypes were depleted from both blood and lymph nodes. nk cells in cats with fip were upregulated for the activation markers cd and cd , and migration markers cd b and cd l, while nk cells from lymph nodes had upregulation of cd and cd l only. nk cells from the lymph nodes of cats with fip also exhibited less cytotoxic activity than nk cells from the lymph nodes of healthy cats. therefore, it appears that infection with fipv is associated with severe depletion of both nk cells and tregs, and reduced nk cell function. this could reduce the capacity of the innate immune system to attack the virus and to suppress the associated immunologic and inflammatory responses. the most compelling evidence for the role of t cell immunity in fip might actually come from research with a distantly related coronavirus infection of another species. mouse hepatitis virus (mhv) is one of the most common virus models in laboratory mice. mhv, like fipv, exists as two biotypes, designated enterotropic and polytropic. polytropic strains of mhv are mainly of laboratory origin and cause a variety of hepatic and neurologic syndromes, depending on the laboratory of origin, in vitro and in vivo passage history, and inbred mouse strain used for the infection study (homberger, ) . in contrast, enterotropic biotypes tend to predominate in nature. most coronavirus contamination in experimental mice colonies is associated with enterotropic strains of mhv brought in from wild mice. interestingly, certain polytropic laboratory strains of mhv cause a disease syndrome analogous to fip of cats when they infect an interferon (ifn)-γ deficient strain of mice (kyuwa et al., ) . this prompted additional comparative studies of enterotropic and polytropic strains of mhv (compton et al., ) . immunocompetent, as well as b and t cell deficient strains of laboratory mice were infected with an enterotropic strain of mhv, mhv-y. the infection in immunocompetent mice was limited to the small intestine for the first week and then to the cecum and colon for the next weeks. b cell deficient mice also developed chronic subclinical infection restricted to the gastrointestinal tract, but lasting for - weeks. the pattern of infection in these two strains of mice was reminiscent of fecv infection in laboratory cats (pedersen et al., ; kipar et al., ) . in contrast, t cell deficient mice infected with mhv-y developed a multi-systemic lethal infection, with virus detected in the intestine during the first week; the mice then developed peritonitis by week , with virus detected in mesentery and visceral peritoneum, before the mice died by weeks - . these findings with mhv strains in inbred strains of mice support the importance of both ifn-γ and t cell immunity in resistance to fip. in the mouse model, it was the host's response to mhv and not the biotype that determined the disease form (enteritis or fip-like disease), while in the case of fip, genetic differences between the fecv and fipv biotypes determine the host response and disease form (enteritis or fip). the classical lesions of fip are the pyogranuloma of the effusive form and the somewhat more typical granuloma of the dry form. as the name implies, the pyogranuloma is an accumulation of macrophages, neutrophils, lymphocytes and occasional plasma cells that tend to form small aggregations around venules in the target tissues. these cells arrive from the bloodstream as a result of upregulation of both adhesion proteins and their receptors. olyslaegers et al. ( ) studied the altered expression of the transmigration adhesion molecules cd a, cd b, cd s, cd , cd d and cd on blood leukocytes from cats with naturally occurring fip. they found that t and b lymphocytes and monocytes expressed higher levels of cd a and cd , while b lymphocytes had increased levels of expression of cd d and granulocytes had increased levels of expression of cd b. it was concluded that all of these blood leukocytes exhibited features of systemic activation in cats with fip and that this contributed to their transmigration into the pyogranulomas seen in the disease. the pyogranuloma is also strongly associated with edema and the effusion of large volumes of a proteinaceous fluid that is rich in plasma proteins, hemoglobin breakdown products, inflammatory proteins of many types and activated clotting factors. the factors responsible for this outpouring of fluid have not been identified fully, but at least one of these factors appears to be vascular endothelial growth factor (vegf; takano et al., a) . this is produced by fipv infected monocytes and macrophages. other proteins, such as tumor necrosis factor (tnf)-α, granulocyte macrophagecolony stimulating factor (gm-csf) and granulocyte-colony stimulating factor (g-csf) are also produced by macrophages in cats with fip and are thought to contribute to increased survival of neutrophils (takano et al., b) . the p mitogen-activated protein kinase (mapk) pathway has been shown to play an important role in the over production of pro-inflammatory cytokines in fipv infected peripheral blood mononuclear cells (pbmcs) (regan et al., ) . clinically normal cats living in catteries with enzootic fecv infection overall had higher serum ifn-γ concentrations than cats in catteries experiencing losses due to fip and catteries free of infection (giordano and paltrinieri, ). ifn-γ concentrations were high in the sera of cats with fip, and even higher in body cavity effusions, the latter thought to reflect production by local inflammation. it was concluded that fecv-infected cats have a strong systemic ifn-γ response, while cats with fip have a strong ifn-γ response at the tissue level. a test to measure the ability of leukocytes in whole blood to produce ifn-γ (protein and mrna) in vitro in response to eight immunogenic peptides derived from the n protein of virulent (fipvs) and avirulent (fecvs) feline coronaviruses has been developed for cats (rossi et al., ) . the sequences used were obtained from an earlier study by battilani et al. ( ) that compared a small number of n gene sequences from lesions of cats with fip and feces of clinically healthy cats, and purported to show n epitopes that would differentiate the two. the test was applied to a group of healthy cats and another group with chronic diseases other than fip. cats with chronic diseases other than fip responded with increases in both ifn-γ protein and mrna when exposed to peptides that were presumed to be specific for avirulent (fecv) or a mixture of avirulent (fecv) and virulent (fipv) epitopes. unfortunately, no results were given for cats with fip. satoh et al. ( a) developed monoclonal antibodies against feline ifn-γ and used them to study immune responses to fipv. pbmcs from cats experimentally infected with fipv that did not develop clinical disease had significantly increased levels of ifn-γ production after exposure to heat-inactivated fipv compared to cats that died of fip; the increased ifn-γ levels were more marked in cd + than cd + t cells. it was concluded that cell-mediated immunity was important in resistance to fip. dedeurwaerder et al. ( b) studied the role of the orf a gene product in antiviral defense. deletion of orf a and orf b of fipv wsu- - rendered the virus more susceptible to ifn-α treatment in cell culture. they then separately added orf a and orf b back into the mutant virus; orf a, but not orf b, rescued normal sensitivity to ifn-α. when these insertions were performed in a mutant of fipv wsu- - with deletions of orf abc and orf ab, sensitivity to ifn-α was not restored. it was concluded that the orf a protein acted as a type i ifn antagonist in the presence of orf abc protein(s) and protected fipv against the effects of this particular host cell antiviral response. one of the newest approaches to studying immune responses involves transcriptional profiling, wherein the various cellular mrnas triggered by a viral infection can be monitored for up-or downregulation. harun et al. ( ) demonstrated the feasibility of such an approach using crfk cells exposed to fipv wsu- - for h. they were able to detect , of the , annotated feline genes. based on results from their culture studies and kal's z test, genes were upregulated, genes were not affected by virus infection and the remaining genes were down-regulated. this transcriptional profile was used to identify three genes (a h, pd- and pd-l ) that were both upregulated and potentially relevant to fip. a real-time (rt)-pcr was than developed for each gene, and the level of expression in pbmcs from seven cats with confirmed fip was measured. upregulation of cdnas from the three genes was observed, but it tended to be low and highly variable between individual genes, as well as cats. although this study did not report details on the number of replicates used in various parts of the study, and could have used actual normal and diseased tissues/ cells in preference to experimentally infected and non-infected crfk cells, it is an approach that will be applied much more in the future. there is ample evidence from experimental studies that fipv infection is greatly enhanced in the presence of coronavirus antibodies, whether they are actively elicited by exposure to fecv or avirulent fipvs, or passively administered in the form of immune serum from either fecv-or fipv-infected cats (pedersen, ). this antibody-dependent enhancement (ade) is best demonstrated when the antibody and challenge strain of fipv are of similar type (takano et al., ) . this ade is not unique to feline coronaviruses and has been the bane of vaccines used or tested in the field against dengue virus, feline immunodeficiency virus and human immunodeficiency virus type (hiv- ) (huisman et al., ) . the exact anti-coronavirus epitopes responsible for ade have been somewhat elusive, but they appear to reside in the s protein. satoh et al. ( b) synthesized peptides from the s region of the s protein of a type i fipv (ku- ) and type ii fipv (wsu- - ), and from the n protein of fipv ku- . they used these peptides to stimulate ifn-γ production from pbmcs of cats experimentally infected with fipv and identified a number of linear immunodominant antibody-binding epitopes at different positions in the s and n regions within both type i and type ii fipvs. satoh et al. ( ) also studied three baculovirus expressed proteins derived from different regions of the s domain of the s protein of the type i fipv ku- strain. one of these proteins, which spanned the region from the fusion peptide to the heptad repeat region, induced a vigorous t helper type (th ) and t helper type (th ) immune response in mice. out of peptides derived from this region that were tested in mice, four peptides that included both th and th epitopes were identified; the authors concluded that these regions should be explored in cats as potential immunogens. takano et al. ( b) also studied the putative ade epitopes in fipv wsu- - with a battery of monoclonal antibodies against the virus neutralizing epitope on the s protein. virus cultures exposed to one of these monoclonal antibodies eventually yielded a virus with two amino acid changes in the neutralizing epitope of the s protein that rendered it resistant to neutralization. in the process, the monoclonal antibody used to produce this mutant also lost its ability to enhance the replication of homologous virus, thus suggesting that virus neutralization and ade were present in the same region of the s protein. the mutant virus used in the study also replicated to lower levels in monocyte/macrophages. evasion of antibody-dependent, complement-mediated lysis has been studied in crfk cells and monocytes infected with fipv wsu- - and an orf abc/orf b deletion mutant (cornelissen et al., ) . surface expression of viral proteins by infected cells, whether by wild type fipv or the deletion mutant, prevented complementmediated lysis, even though controls showed it to be functional. the authors postulated that this was a new mechanism for fipv to evade the immune system. a different evasion route was proposed by dewerchin et al. ( ) . monocytes infected with fipv express viral proteins on their plasma membranes; upon binding of antibodies, these proteins are rapidly internalized through a clathrin-and caveolae-independent pathway, which is also dependent on dynamin . in doing so, the infected monocytes can escape antibody-dependent cell lysis. in a subsequent study, dewerchin et al. ( ) identified kinases and cytoskeletal proteins that were involved in internalization and subsequent intracellular transport of fipv. myosin light chain kinase and myosin were crucial for the initiation of the internalization process, as shown by the co-localization of both proteins with antigens prior to virus internalization. one minute after internalization commenced, the virus-laden vesicles had colocalized with microtubules and accumulated at the microtubule organizing center after - min. this activity of myosin light chain kinase was effectively inhibited by ml- , thus identifying a possible target for an anti-viral drug. the mechanism by which the various feline coronaviruses attach to their host cells is not known. type ii fipvs appear to utilize aminopeptidase n as their principal receptor. while the primary receptor for type i feline coronaviruses is unknown, the lectin dendritic cell-specific intercellular adhesion molecule- -grabbing nonintegrin (dc-sign, cd ) can act as a co-receptor (regan and whittaker, ; regan et al., ) . these receptors are undoubtedly important for fecv binding to target enterocytes, but whether they play a role in infection of macrophages by fipvs is unknown. it is possible that fipvs could enter their target macrophages using less specific means, such as through the fc-receptors used for complement binding. a spate of papers describing possible vaccines against fip has appeared over the last three decades (pedersen, ) . several reportedly showed protection, but only one of doubtful efficacy went into commercial production. however, recently there has been a renewed interest in fip vaccines. bálint et al. ( ) developed a vaccine based on a pair of recombinant viruses derived from the type ii fipv strain df , a virus nearly identical to fipv wsu- - . one strain was avirulent and the other of low virulence. spf cats appeared to be fully protected against virulent fipv df after two oronasal and two intramuscular injections weeks apart. surprisingly, purebred british shorthair cats were not protected following the same vaccine regimen, although experimental and control groups were small. vaccination with the avirulent virus induced ade and, following challenge-exposure, all cats developed fip; % of cats had prolonged survival, while % died from fulminant disease. the researchers evoked differences between conventional and spf cats, as well as heterologous virus pre-exposure, as reasons for the various experimental outcomes. takano et al. ( a) immunized cats with th stimulating peptides identified previously in the n protein of the type i fipv strain ku- using feline cpg-oligodeoxynucleotides (fcpg-odns) as adjuvants. some immunity was demonstrated against challengeexposure with the type ii fipv strain wsu- - , but immune tolerance was also observed at higher vaccine dosages. the researchers concluded that further investigations on the combination and concentrations of the peptides and fcpg-odns, along with dose, frequency and route of administration, were needed. takano et al. ( b) identified strong th epitopes within the s domain of the s protein and in the m protein of both type i (ku- ) and type ii (wsu- - ) fipvs. interestingly, no immunodominant antibody binding th epitope-containing peptide was identified in the primary antibody binding s domain of the type ii fipv. eleven th epitope-containing peptides were identified in the s, m and n proteins that were common to both type i and type ii fipvs. three of these peptides were administered with cpg-odns to spf cats; two of these peptides from the s and m proteins induced th activity to peptide stimulation of pbmc cultures, but no cat infection results were reported. early research strongly suggested that susceptibility to fip might be controlled to some extent by genetic factors (pedersen, ) . a genome-wide association study of a relatively large number of birman cats identified five regions on four different chromosomes that could harbor genes involved in susceptibility (golovko et al., ) . five candidate genes (elmo , rraga, tnsf , erap and erap ) were identified in these four regions; all are associated with processes relevant to fip, such as cellular migration, phagocytosis, apoptosis and virus-host interactions. these associations require confirmation and further study, as they might only be relevant to one breed. if genetics are involved in the disease, as it appears, the exact genes and pathways involved appear to be numerous and, therefore, inheritance is likely to be complex. we are rapidly gaining a better understanding of the mutational events that cause fecvs to become fipvs, but we lack knowledge of how these mutations are involved in immunopathogenesis. at least three separate types of mutations have been associated with the acquisition of fip virulence and more are likely to be discovered. cell lines that will replicate fecvs in vitro have been developed and this, coupled with the creation of infectious molecular clones of fipv, will hopefully allow us to assess the importance of these and any future mutations. a number of new reagents and procedures have given us a window into the cells involved in the inflammatory and immune responses that characterize the two distinct, yet overlapping, clinical forms of fip. other environmental and host factors undoubtedly play a role in determining the outcome of exposure, but their roles are not understood. the elaboration of various cytokines and other inflammatory proteins in the fip disease process has been extensively studied, but how these various factors are stimulated and their role in pathology is poorly understood. a possible role for genetic susceptibility has been identified in at least one breed of cats, but the genetics appear to be highly complex and cannot explain the entire disease incidence. a more parsimonious conclusion is that fip results from a confluence of numerous viral, host and environmental factors akin to the 'perfect storm'. although we are heartened by our increasing knowledge of this disease, we are continually reminded of the words of robert frost in his poem 'the secret sits': 'we dance round in a ring and suppose, but the secret sits in the middle and knows.' feline infectious peritonitis. abcd guidelines on prevention and management quarantine protects falkland islands (malvinas) cats from feline coronavirus infection the nucleoprotein is required for efficient coronavirus genome replication isolation and molecular characterization of type i and type ii feline coronavirus in malaysia prevalence of korean cats with natural feline coronavirus infections recombinant feline coronaviruses as vaccine candidates confer protection in spf but not in conventional cats phylogenetic analysis of feline coronavirus strains in an epizootic outbreak of feline infectious peritonitis sequence analysis of the nucleocapsid gene of feline coronaviruses (fcovs) circulating in italy genetics and pathogenesis of feline infectious peritonitis virus interspecies transmission and emergence of novel viruses: lessons from bats and birds feline infectious peritonitis: insights into feline coronavirus pathobiogenesis and epidemiology based on genetic analysis of the viral c gene sequence analysis of feline coronaviruses and the circulating virulent/avirulent theory spike protein fusion peptide and feline coronavirus virulence pathogenesis of enterotropic mouse hepatitis virus in immunocompetent and immunodeficient mice absence of antibody-dependent, complement-mediated lysis of feline infectious peritonitis virus-infected cells the role of accessory proteins in the replication of feline infectious peritonitis virus in peripheral blood monocytes the orf -encoded accessory protein a of feline infectious peritonitis virus as a counteragent against interferon-α induced antiviral response establishment of feline intestinal epithelial cell cultures for the propagation and study of feline enteric coronaviruses surface-expressed viral proteins in feline infectious peritonitis virus-infected monocytes are internalized through a clathrin-and caveolaeindependent pathway myosins and , myosin light chain kinase, actin and microtubules cooperate during antibodymediated internalisation and trafficking of membrane-expressed viral antigens in feline infectious peritonitis virus infected monocytes feline coronavirus in multicat environments genetic diversity and phylogenetic analysis of feline coronavirus sequences from portugal interferon-γ in the serum and effusions of cats with feline coronavirus infection genetic susceptibility to feline infectious peritonitis in birman cats biogenesis and dynamics of the coronavirus replicative structures switching species tropism: an effective way to manipulate the feline coronavirus genome live, attenuated coronavirus vaccines through the directed deletion of group-specific genes provide protection against feline infectious peritonitis phylogenetic analysis of feline coronavirus strains in an epizootic outbreak of feline infectious peritonitis transcriptional profiling of feline infectious peritonitis virus infection in crfk cells and in pbmcs from fip diagnosed cats the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes feline coronavirus type ii strains - and - originate from a double recombination between feline coronavirus type i and canine coronavirus enterotropic mouse hepatitis virus c protein of feline coronavirus inhibits viral replication independently of the autophagy pathway vaccine-induced enhancement of viral infections potent inhibition of feline coronaviruses with peptidyl compounds targeting coronavirus c-like protease feline infectious peritonitis: still an enigma? sites of feline coronavirus persistence in healthy cats murine coronavirus-induced subacute fatal peritonitis in c bl/ mice deficient in gamma interferon mutation in spike protein cleavage site and pathogenesis of feline coronavirus field strain feline coronaviruses with small deletions in orf b associated with both enteric infection and feline infectious peritonitis full genome analysis of a novel type ii feline coronavirus ntu the role of severe acute respiratory syndrome (sars)-coronavirus accessory proteins in virus pathogenesis the paradox of feline coronavirus pathogenesis: a review altered expression of adhesion molecules on peripheral blood leukocytes in feline infectious peritonitis glycosylation of the severe acute respiratory syndrome coronavirus triple-spanning membrane proteins a and m a review of feline infectious peritonitis virus infection pathogenicity studies of feline coronavirus isolates - and - pathogenesis of feline enteric coronavirus infection significance of coronavirus mutants in feces and diseased tissues of cats suffering from feline infectious peritonitis feline infectious peritonitis: role of the feline coronavirus c gene in intestinal tropism and pathogenicity based upon isolates from resident and adopted shelter cats comparative sequence analysis of full-length genome of fipv at different tissue passage levels pedersen nc. two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus porcine respiratory coronavirus differs from transmissible gastroenteritis virus by a few genomic deletions utilization of dc-sign for entry of feline coronaviruses into host cells activation of p mapk by feline infectious peritonitis virus regulates pro-inflammatory cytokine production in primary blood-derived feline mononuclear cells feline lectin activity is critical for the cellular entry of feline infectious peritonitis virus production of ifn-γ in feline whole blood after incubation with potential t-cell epitopes of the nucleocapsid protein of feline coronavirus enteropathogens identified in cats entering a florida animal shelter with normal feces or diarrhea characterization of t helper (th) -and th -type immune responses caused by baculovirus-expressed protein derived from the s domain of feline infectious peritonitis virus, and exploration of the th and th epitopes in a mouse model development of monoclonal antibodies (mabs) to feline interferon (fifn)-γ as tools to evaluate cellular immune responses to feline infectious peritonitis virus (fipv) screening and identification of t helper and linear immunodominant antibody-binding epitopes in the spike domain and the nucleocapsid protein of feline infectious peritonitis virus emodin inhibits current through sars-associated coronavirus a protein descriptive distribution and phylogenetic analysis of feline infectious peritonitis virus isolates of malaysia antibodydependent enhancement occurs upon re-infection with the identical serotype virus in feline infectious peritonitis virus infection b-cell activation in cats with feline infectious peritonitis (fip) by fip-virus-induced b-cell differentiation/survival factors neutrophil survival factors (tnf-alpha, gm-csf, and g-csf) produced by macrophages in cats infected with feline infectious peritonitis virus contribute to the pathogenesis of granulomatous lesions vascular endothelial growth factor (vegf), produced by feline infectious peritonitis (fip) virus-infected monocytes and macrophages, induces vascular permeability and effusion in cats with fip mutation of neutralizing/antibody-dependent enhancing epitope on spike protein and b gene of feline infectious peritonitis virus: influences of viral replication in monocytes/macrophages and virulence in cats evaluation of protective efficacy of the synthetic peptide vaccine containing the t helper epitope with cpg oligodeoxynucleotide against feline infectious peritonitis virus infection in cats screening and identification of t helper and linear immunodominant antibody-binding epitopes in spike domain and membrane protein of feline infectious peritonitis virus novel severe acute respiratory syndrome coronavirus protein, u , is transported to the cell surface and undergoes endocytosis genome organization and reverse genetic analysis of a type i feline coronavirus chimeric feline coronaviruses that encode type ii spike protein on type i genetic background display accelerated viral growth and altered receptor usage a reverse genetics approach to study feline infectious peritonitis feline infectious peritonitis virus with a large deletion in the '-terminal region of the spike gene retains its virulence for cats clathrin-and caveolae-independent entry of feline infectious peritonitis virus in monocytes depends on dynamin feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses the coronavirus nucleocapsid protein is dynamically associated with the replication-transcription complexes suppression of nk cells and regulatory t lymphocytes in cats naturally infected with feline infectious peritonitis virus pathogenic characteristics of persistent feline enteric coronavirus infection in cats an outbreak of feline infectious peritonitis in a taiwanese shelter: epidemiologic and molecular evidence for horizontal transmission of a novel type ii feline coronavirus the author has no financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of this paper. key: cord- -drhiqch authors: hohdatsu, t.; tokunaga, j.; koyama, h. title: the role of igg subclass of mouse monoclonal antibodies in antibody-dependent enhancement of feline infectious peritonitis virus infection of feline macrophages date: journal: arch virol doi: . /bf sha: doc_id: cord_uid: drhiqch antibody-dependent enhancement (ade) of feline infectious peritonitis virus (fipv) infection was studied in feline alveolar macrophages and human monocyte cell line u using mouse neutralizing monoclonal antibodies (mabs) directed to the spike protein of fipv. even among the mabs that have been shown to recognize the same antigenic site, igg a mabs enhanced fipv infection strongly, whereas igg mabs did not. these igg a mabs enhanced the infection even when macrophages pretreated with the mab were washed and then inoculated with the virus. immunofluorescence flow cytometric analysis of the macrophages treated with each of the mabs showed that the igg a mabs but not the igg mabs bound to feline alveolar macrophages. treatment of the igg a mab with protein a decreased the binding to the macrophages and, in parallel, diminished the ade activity. although no infection was observed by inoculation of fipv to human monocyte cell line u cells, fipv complexed with either the igg a mab or the igg mab caused infection in u cells which are shown to express fc gamma receptor (fc γ r) i and ii that can bind mouse igg a and igg , respectively. these results suggest that the enhancing activity of mab is closely correlated with igg subclass and that the correlation is involved in binding of mab to fc γ r on feline macrophage. feline infectious peritonitis virus (fipv) is a member of the coronavirus family and causes a chronic progressive disease in its natural host. the natural route of fipv infection is unknown although cats can be experimentally infected by oral, nasal, and parenteral administration of fipv. following infection by these routes, fipv first multiplies in the epithelial cells of the upper respiratory tract and intestine [ ] . clinically apparent fip occurs after the viruses in infected t. hohdatsu et al. macrophages and monocytes cross the mucosal barrier and spread throughout the body of the cat. generally, macrophages play an important role in non-specific defense against viral infection. however, it is also known that viruses bound to antibodies invade macrophages via fc region of the bound antibody and the macrophage's fc gamma receptor (fc r) and eventually lead to enhancement of infection [ , - , , , , ] . its most typical example is a disease called dengue hemorrhagic fever/dengue shock syndrome. the antibody for fipv is also known to enhance the fipv infection and accelerate the disease onset in cats [ , , ] . following experimental fipv infection, cats with naturally occurring fipv-neutralizing antibody frequently develop fip more rapidly and with more severe clinical signs than do seronegative cats. when cats passively immunized with anti-fipv antibodies were infected with virulent fipv, severe symptoms were observed and some of them died soon after the infection [ , ] . the enhancing effect of the antibody of fipv infection impedes prophylaxis of fip by vaccination [ , , - , , ] . we previously reported that in vitro fipv infection of feline alveolar macrophages is enhanced by murine monoclonal antibodies (mabs) to the peplomer spike (s) protein or the transmembrane (m) protein of fipv [ , ] . this antibody-dependent enhancement (ade) was completely eliminated or reduced by pretreatment of the mabs with protein a or when f(ab') fragments of the mabs were used. olsen et al. have supported our findings by showing enhancement of fipv infection in primary feline peritoneal macrophages by mouse mabs to the viral s protein [ ] . in many instances virus-neutralizing mabs were shown to have strong ade activity, and it was suggested that there was some relationship between neutralizing activity and ade activity. on the other hand, corapi et al. recognized a difference in immunoglobulin subclasses between ade-inducing fipv-neutralizing mab and ade-non inducing fipv-neutralizing mab, and they showed that the majority of the ade-inducing mabs belong to the igg a subclass [ ] . these results were obtained by the experiments in which mouse mabs and feline macrophages, i.e., xenogeneic combination of mabs and macrophages, were used. in contrast, it has been reported that mouse mabs irrespective of whether the subclass is igg , igg a or igg b enhanced infection of mouse (homologous) macrophages of dengue virus [ , ] , influenza a virus [ "] and west nile virus [ ] . since ade of the disease caused by fipv has been clearly demonstrated after vaccination of cats with a variety of candidate vaccines, a more specific understanding of ade of fipv infection is needed [ , , - , , ] . it is especially important for development of vaccines to understand the relationship between fipv neutralizing activity and ade activity of anti fipv mabs. in this study, we determined the relationship between immunoglobulin subclass and ade activity of fipv-neutralizing mabs, and attempted to explore mechanisms of ade of fipv infection in in vitro system using mouse mabs and feline alveolar macrophages or human monocytes. fipv strain - was used in this study. this strain was kindly provided by dr. m. c. horzinek of the state university utrecht, the netherlands, and was passaged two or three times in feline fetal cell (fcwf- ) cultures. feline alveolar macrophages were collected from anti-coronavirus antibody-negative adult cats and cultured in eagle's minimum essential medium containing ~ leibovitz's l- medium, ~ fetal calf serum, units of penicillin per ml and ~tg of streptomycin per ml as previously described [ ] . human monocyte cell line u was kindly provided by dr. j. arikawa of the university of hokkaido, japan, and was cultured in rpmi medium containing ~o fetal calf serum, units of penicillin per ml and ~tg of streptomycin per ml. mabs - - , - - , -l-l, - - , - - , and - - used in the present study recognize s protein of the virus as demonstrated by immunoblotting. these mabs have the ability to neutralize fipv strain - , and recognize two different antigenic sites of the viral s protein [ ] . the neutralization titer, indirect immunoftuorescent antibody titer, immunoglobulin isotype and epitope specificity of these mabs are shown in table . the culture fluid of each mab-producing hybridoma was used for the experiment. f(ab') of mab . , fab of mab iv. and f(ab') of mab g were purchased from medarex, lebanon, nh. mab . is a mouse igg antibody that reacts with human fc r i [ ] . mab iv. is a mouse igg b antibody that reacts with human fc r ii [ ] . mab g is a mouse igg antibody that reacts with human fc? r iii [ ] . a mixture of mabs that recognize peplomer protein (s), transmembrane protein (m) and nucleocapsid protein (n) of fipv strain - , respectively, was used as the primary antibody. the mabs were added to acetone-fixed fipv-infected cells and allowed to stand at °c for rain. after the specimens were washed with phosphate-buffered saline (pbs) three times, they were stained with rabbit anti-mouse igg, iga and igm serum conjugated with fluorescein isothiocyanate (miles laboratories, naperville, u.s.a). after being held at °c for min, they were washed with pbs, mounted in ~ glycerol buffer and observed under a fluorescence microscope. confluent fcwf- cell monolayers in -min plastic petri dishes were inoculated with virus dilutions of specimen to be assayed for amount of infectious virus in . ml amounts. after virus adsorption at °c for rain, the inoculated cultures were covered with ml of agar overlay medium which consisted of ~o bacto agar in minimal essential medium. the cultures were incubated in a co incubator at °c for days, and stained by incubating at °c for h under a second overlay medium containing . ~o neutral red. the infectious titer was expressed in plaque-forming units (pfu). ade assay of fipv infection of feline alveolar macrophages was performed by two methods. in the first method, equal amounts of mab and viral suspension were allowed to react at t. hohdatsu et al. °c for h before inoculation onto the macrophages. in the second method, mabs alone were allowed to react with the macrophages at °c for h before viral inoculation. in both methods, the virus-inoculated cells were examined for viral antigen by ifa using mixture of anti-fipv mabs after incubation for h, and the percent of ade was determined by the following formula: where a is the rate of ifa positive cells in the culture infected in the presence of mab and b is that in the culture infected in the absence of mab. in ade assay of fipv infection of human monocyte cell line u , virus suspension was allowed to react with mab at °c for h and then inoculated to a cell pellet of u cells. the inoculated cells were incubated at °c for h to allow virus adsorption, and then washed with hanks' balanced salt solution (hbss). after washing, the cells were cultured and h later, were examined for infecting fipv antigen by ifa. at the same time, the level of infectious virus in the culture supernatant was determined by plaque assay. undiluted mab ( - - , - - , - - , - - , - - or - - ) or a mixture of either one of the mab and fipv was added to x feline alveolar macrophages and held at °c for h. after three washings with hbss containing . % n,n , the cells were allowed to react with -fold diluted fitc-conjugated fab of goat anti-mouse igg antibody at °c for h. after being washed three times, the stained cells were analyzed by counting about , cells on a facs (becton dickinson co., u.s.a.). the relationship between ig subclass and a d e activity was investigated with the m a b s shown in table . as shown in fig. , despite the fact that they a d e activity of these m a b s was also determined by inoculating f i p v to macrophages pretreated with each m a b (fig. ) . m a b s - - , - - and - - , whose subclass is i g g a, enhanced the infection in the same way as in the case when mixture of f i p v and m a b was inoculated to macrophages. in contrast, none of the subclass igg mabs ( - - , - - and - - ) showed ade activity (fig. ) . these results, together with those shown in fig. , clearly indicate the relationship between ig subclass of mabs and the ade activity. binding of mouse anti-fipv mabs to the fc r on feline alveolar macrophages was determined by indirect immunofluorescence flow cytometry of the mabtreated macrophages. figure a shows the percentages of positively stained cells in the macrophages treated with different mab. percentage of the stained macrophages which had been treated with either one of the igg t mabs was very low and almost the same as that of control macrophages which had been treated with hbss instead of mab. in contrast, percentage of the stained macrophages which had been treated with either one of the igg a mabs was distinctly increased• figure b next, to determine ade by mouse anti-fipv mabs of f i p v infection in h u m a n u cells, f i p v alone or a mixture of f i p v and either one of the mabs was inoculated to u cells. the inoculated cells were cultured, and h later, viral proliferation was assessed by ifa of the cells with mixture of anti-fipv mabs and virus plaque assay of the culture supernatant. in table , when f i p v alone was inoculated to u cells, viral proliferation did not occur at all, whereas it occurred when the virus complexed with either one of the mabs was inoculated. notably, f i p v infection was established in u cells even with the igg mabs that did not show a d e of the infection in feline macrophages, even though the degree of the a d e was far less than that by the igg a mabs. in vitro studies using a n t i -f i p v mabs and in vivo studies of cats immunized with recombinant vaccinia virus expressing f i p v s protein have indicated that antibody against f i p v s protein induces a d e of f i p v infection [ , , , , , ] . some studies showed that mabs having virus neutralizing activity caused intense a d e of f i p v infection, and suggested that epitope of f i p v to be recognized for a d e is closely related to that for virus neutralization [ , , , , -i. in the present study, it was d e m o n s t r a t e d that even a m o n g mouse f i p v neutralizing mabs that have been shown to recognize the same antigenic site by competitive binding assay, igg a m a b s but not igg m a b s enhanced f i p v infection of feline alveolar m a c r o p h a g e s (fig. ) . these igg a mabs enhanced the infection even when macrophages pretreated with the mab were washed and then inoculated with the virus (fig. ) . therefore we assumed that mouse igg a antibodies can bind fc ? r on feline alveolar macrophages, whereas igg antibodies can not. this was confirmed by the flow cytometric analysis of binding of the mabs to feline macrophages (fig. ). in addition, it was found that the igg a mabs complexed with fipv bound to macrophages more intensely than the mab alone did (figs. a and b ). in accordance with these findings, ade of the fipv infection was intenser in the macrophages infected by the former pathway than in the virus-inoculated latter macrophages ( figs. and ) . flow cytometric analysis of the binding of protein a-treated igg a mab to macrophages and determination of ade of fipv infection by the treated mab revealed that the binding of the mouse igg a mabs to feline macrophages and their ade activity on fipv infection of the macrophages are mediated by fc region of the mabs (fig. ) . since fc y rs on feline cells have not been defined, we explored the fc-mediated ade of fipv infection by using human cells, of which fc y rs are well defined, as targets of the virus. it is known that there are three types of human fc y r, i.e., fc y r i, ii and iii [ ] . it has also been shown that fc r i and ii are present on human macrophages and that mouse igg a and igg bind well to the fc ? r i and ii, respectively. the human monocyte cell line u cells used in the present study were shown to express fc r i and ii to a similar degree on their surface from the reactivity to mab specific to the respective human fc y r (fig. ) . fipv strain - did not infect u cells at all. however, when the fipv complexed with either one of the mouse anti-fipv mabs was inoculated onto u cells, distinct viral proliferation was observed. notably, igg mabs, which did not bind to feline macrophages and did not cause ade of fipv infection of feline macrophages, caused viral proliferation in u cells. these results suggest that u cells of human origin have no virus receptor for fipv, but fc ? rs, i.e., fc y r i and ii, act as receptors for the mouse igg a and igg mabs complexed with the virus and thus allow the virus to enter and proliferate in the cells. some mouse anti-fipv igg mabs devoid of neutralizing activity were reported to exert ade of fipv infection of feline macrophages [ , ] , though the ade activity of these igg mabs was far less than that of mouse igg a mabs used in the present study. reason for the discrepancy between these studies and our study, in which mouse anti-fipv igg mabs were not found to show ade of fipv infection of feline macrophages, is not clear. there are the following possibilities: fc y r for mouse igg is expressed on feline macrophages in very small number, or fc y r for mouse igg on feline macrophages has very low affinity. in relation to the latter possibility, u cells of human origin express fc y r i and ii at a similar level, but ade activity of mouse anti-fipv igg mab on fipv infection of these cells was found to be far weaker than that of anti-fipv igg a mab. it is also known that human igg and igg have weak affinity for fc y r on human macrophages [ ] . one study of ade of dengue virus infection of mouse macrophages has shown that treatment of macrophages with neuraminidase increased affinity of their fc r ii for mouse igg mab and resulted in increased ade of the infection by mouse anti-dengue virus igg mab [ ] . this might be verified by a similar experiment with fipv system. taken all results of the present study together, it is indicated that ade of fipv infection is mediated by binding of fc region of anti-fipv antibody to fc receptor expressed on the target cells of fipv. this is supported by finding that any fipv-neutralizing mabs could not enhance fipv infection of crandell feline kidney cells which are devoid of fc r. the present study, however, explored ade of fipv infection by in vitro experiments in which xenogeneic combination of virus targets and anti-fipv antibody, i.e., feline alveolar macrophages or human monocyte u cells and mouse anti-fipv s protein mabs, was used. therefore, the findings in the present study could not be applied directly to ade of natural infection in cats. schultz et al. [ ] reported two subclasses of feline igg. however, biological properties of feline igg subclasses have not yet been clarified. further study of the feline igg subclasses and exploration of fc r on feline cells are mandatory, and what igg subclass of anti-fipv antibody in the serum of naturally infected cats enhances the fipv infection should be investigated. these studies are worthwhile for determination of basic pathogenesis of fip and development of vaccines for prevention of fipv infection. monoclonal antibodies to fc receptors for igg on human mononudear phagocytes: antibody characterization and induction of superoxide production in a monocyte cell line experimental inoculation of cats with canine coronavirus and subsequent challenge with feline infectious peritonitis virus interaction of west nile virus with primary murine macrophages: role of cell activation and receptors for antibody and complement monoclonal antibodies to sindbis virus glycoprotein e can neutralize, enhance infectivity, and independently inhibit haemagglutination or haemolysis monoclonal antibody analysis of neutralization and antibody-dependent enhancement of feline infectious peritonitis virus human neutrophilic fcq, receptor distribution and structure pathogenesis of dengue: challenges to molecular biology antibody-enhanced dengue virus infection in primate teukocytes dengue viruses and mononuclear phagocytes. i. infection enhancement by nonneutralizing antibody heterogeneity of infection enhancement of dengue strains by monoclonal antibodies characterization of monoelonal antibodies against feline infectious peritonitis virus type ii and antigenic relationship between feline, porcine and canine coronaviruses a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoctonal antibodies enhancement and neutralization of feline infectious peritonitis virus infection in feline macrophages by neutralizing monoclonal antibodies recognizing different epitopes studies on the mechanism of antibody-mediated enhancement of getah virus infectivity human monocytes and u cells bear two distinct fc receptors for igg neuraminidase augments fc y receptor ii-mediated antibody-dependent enhancement of dengue virus infection dengue virus monoctonal antibodies identify epitopes that mediate immune infection enhancement of dengue viruses antibody-mediated growth of influenza a nws virus in macrophagelike cell line p d identification of antigenic sites mediating antibody-dependent enhancement of feline infectious peritonitis virus infectivity monoclonal antibodies to the spike protein of feline infectious peritonitis virus mediate antibodydependent enhancement of infection of feline macrophages attempted immunization of cats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus immunologic phenomena in the effusive form of feline infectious peritonitis pathogenicity studies of feline coronavirus isolates - and - an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis virologic and immunologic aspects of feline infectious peritonitis virus infection antibody-mediated enhancement of flavivirus replication in macrophage-like cell lines growth of d yellow fever virus in a macrophage-like cell line, u : role of fc and viral receptors in antibody-mediated infection feline immunoglobulins attempted immunisation of cats against feline infectious peritonitis using canine coronavirus the sites of early viral replication in feline infectious peritonitis antibody-enhanced infection by hiv- via fc receptor-mediated entry function and heterogeneity of human fc receptors for immunoglobulin g early death after feline infectious peritonitis virus challenge due to recombinant vaccinia virus immunization antibody-mediated enhancement of disease in feline infectious peritonitis: comparisons with dengue hemorrhagic fever cross-protection studies between feline infectious peritonitis and porcine transmissible gastroenteritis viruses this work was supported by private contributions of sankyo co., ltd., ajinomoto general foods, inc. and dainippon pharmaceutical co., ltd., japan. authors' address: dr. t. hohdatsu, department of veterinary infectious diseases, school of veterinary medicine and animal sciences, kitasato university, towada, aomori , japan.received may , key: cord- - l lb authors: pedersen, niels c.; liu, hongwei; dodd, kimberly a.; pesavento, patricia a. title: significance of coronavirus mutants in feces and diseased tissues of cats suffering from feline infectious peritonitis date: - - journal: viruses doi: . /v sha: doc_id: cord_uid: l lb the internal fecv→fipv mutation theory and three of its correlates were tested in four sibs/half-sib kittens, a healthy contact cat, and in four unrelated cats that died of fip at geographically disparate regions. coronavirus from feces and extraintestinal fip lesions from the same cat were always > % related in accessory and structural gene sequences. snps and deletions causing a truncation of the c gene product were found in almost all isolates from the diseased tissues of the eight cats suffering from fip, whereas most, but not all fecal isolates from these same cats had intact c genes. other accessory and structural genes appeared normal in both fecal and lesional viruses. deliterious mutations in the c gene were unique to each cat, indicating that they did not originate in one cat and were subsequently passed horizontally to the others. compartmentalization of the parental and mutant forms was not absolute; virus of lesional type was sometimes found in feces of affected cats and virus identical to fecal type was occasionally identified in diseased tissues. although c gene mutants in this study were not horizontally transmitted, the parental fecal virus was readily transmitted by contact from a cat that died of fip to its housemate. there was a high rate of mutability in all structural and accessory genes both within and between cats, leading to minor genetic variants. more than one variant could be identified in both diseased tissues and feces of the same cat. laboratory cats inoculated with a mixture of two closely related variants from the same fip cat developed disease from one or the other variant, but not both. significant genetic drift existed between isolates from geographically distinct regions of the western us. feline infectious peritonitis (fip) was first introduced as an "important disorder of cats" by holzworth [ ] and a clinico-pathologic conference on the disease was published the following year [ ] . the incidence of fip rose progressively over the next two decades. the occurrence of fip among all cats seen at veterinary medical teaching hospitals in the usa from - was : among new feline visits, : among total cat accessions, and % of accessions at diagnostic laboratories [ ] . the incidence is several times higher among kittens and young cats originating from catteries or shelters. the disease was thought to be viral when first described but no specific etiologic agent was identified at the time [ ] . zook et al. [ ] observed virus particles in the tissues of experimentally infected cats, however, the close similarities of fip virus (fipv) in tissues to members of the family coronaviridae was noted by ward [ ] . the ability of fipv to cause either a non-effusive (dry, parenchymatous) or effusive (wet, non-parenchymatous) form of the disease was first reported by montali and strandberg [ ] . the close genetic relationship of fipv to coronaviruses of dogs and swine was first recognized by pedersen et al. [ ] . the existence of two serotypes, feline-or canine-coronavirus like, was described in [ ] . fip was originally believed to be an uncommon clinical manifestation of a ubiquitous and largely nonpathogenic agent named feline enteric coronavirus (fecv) [ ] . subsequent studies demonstrated that the agent of fip was distinct from fecv in disease potential but that both viruses co-existed in the same population and were antigenically identical [reviewed in , ] . it was subsequently hypothesized that fipv might be a simple mutant of fecv [ ] , and the two viruses were later described as biotypes of each other [ ] . animal studies, with both natural [ ] and experimental [ ] infection, also suggest that fipvs arise spontaneously during the course of fecv infection. vennema et al. [ ] demonstrated that all major structural and accessory genes of wild type fecvs were virtually identical to fipvs from the same or closely related cats. however, % of fipvs studied had deleterious mutations in a small accessory gene called c. these mutations, which were either deletions or introduced stop codons, were also found to be unique to each cat. in spite of indirect and direct supporting evidence for internal fecv→fipv mutation, the role of fecv mutation in fip, and especially in the c gene, has not been given much attention in the literature of fip [reviewed ] . in fact, there is a general feeling that fipv and fecv are either the same virus, with disease being dependent on the nature of the host's immune response [reviewed ] , or that the causative mutation is in other genes [ ] . although the precise origin of fipvs is debated, there appears to be agreement regarding the relative cell tropisms of fecvs and fipvs. fecvs are thought to have greater tropism for the mature apical intestinal epithelium, while fipvs are believed to have a greater tropism for macrophages [reviewed ]. this has led to the a strongly held belief that coronaviruses found in the feces are fecv-like, while viruses found in extra-intestinal (usually lesional) tissues are fipv-like [ ] . the purpose of this study was to repeat the original work of vennema et al. [ ] with a new and geographically diverse group of cats and to test the major tenant of the fecv→fipv theory and three of its possible correlates. the major tenant of the theory assumes that functional mutations in the c gene are somehow related to the fip biotype. the first correlate of this theory supposes that each fip cat will have its own unique c mutant which is not transmitted cat-to-cat. the second correlate assumes compartmentalization of enteric and fip biotypes to gut and internal tissues, respectively. the third correlate, if correct, should show fipvs to be as geographically diverse as the fecvs from which they arise complete structural (s, e, m, n) and accessory ( a-c and a, b) gene sequences were obtained from diseased omentum of the four related cats that died of fip and the isolates designated were fipv-ucd , , and ( table ). the numbers of nucleotides sequenced for isolates fipv-ucd to ucd are shown in table , while the relationship of the fipvs isolated from the related scottish fold cats is shown in figure . the overall sequence identity for the nine structural and accessory genes was ≥ % with only a small number of mutations among the four highly related viruses (table ) . mutations consisted of minor snp changes, and less commonly deletions that appeared to be randomly scattered among the genes that were sequenced; about one half of the mutations resulted in amino acid changes ( table ). among the structural and accessory genes of the four related cats, the highest genetic variability was in the c gene, followed by the s and m genes ( table ). the least variability was detected in the b, a, and a accessory genes. among all of the genes sequenced, only the c genes of the fipv isolates had snps that resulted in premature stop codons or deletions that caused frame shifts; both resulting in a variable truncation of the c protein ( figure ). the omentum viruses from red consisted of two distinct variants, as determined by sequences obtained from multiple overlapping pcr products (table ) . these variants were designated fipv-ucd a and -ucd b. there were only five snps scattered across the nine structural and accessory genes between the two variants. two variants were also sequenced from the omentum of toby, one with a non-functional c gene (fipv-ucd ) and one with a functional c gene (fecv-ucd ). these two variants were identical in sequence except for a single-base deletion in the c of one of the variants (fipv-ucd ). four additional unrelated cats ( , and ) from paradise, menlo park, and san jose, ca, respectively, and cat-t from mountlake terrace, wa were included in the study. the three cats seen at the vmth suffered from the non-effusive form of fip, while the washington state cat died of effusive fip. the e, m, n, a-c and a, b genes were amplified from the omentum or organ granulomas of all four animals. viruses were readily detected in the diseased tissues of cats , , cat-t, and and designated fipv-ucd to ucd , respectively (table ) . fipv-ucd a possessed a two-nucleotide deletion near the end of the c gene and a second deletion of nucleotide involving the terminus of b and beginning of c ( figure ). mutations of the c gene in fipv-ucd and -ucd involved premature stop codons. two variants with six scattered snps and an identical deletion in the c genes were identified in organ granulomas of cat and designated fipv-ucd a and -ucd b (table ). all of the structural and accessory genes that were sequenced for the eight different fip cats appeared to be intact, except for the c genes. the c genes from all eight isolates contained deletions or snps that either produced truncating frame shifts or premature stop codons ( figure ). the sequence relationship of the four unrelated fipv isolates to each other and to the fipv isolates from the four related scottish fold cats is shown in figure . the overall genetic similarity for the e, m, n, and a-c, a, b genes ranged from - % among the fipv isolates. the four fipvs from unrelated cats showed sequence identity of - % to each other and to the fipvs from the four related cats. feces or colonic scrapings from the four related cats and a fifth unrelated housemate contained feline coronaviruses ( table ). the amount of viral rna in feces in cats with fip was much lower than in diseased omentum and obtaining complete sequences of all genes was not always possible. therefore, the actual genes sequenced for each fecal coronavirus isolate are shown in table . coronaviruses isolated from the feces of two cats, tux and toby, were ≥ % identical and contained identical c gene mutations to the omental viruses from the same cats. the coronavirus isolated from lucy's feces (designated fecv-ucd ) had an intact (i.e., wild type or non-deliterious) c and its sequence was otherwise % identical to the sequence of fipv-ucd found in her diseased omentum. the sequence obtained from the fecal virus of simba, a housemate of lucy, also had an intact c gene and was designated fecv-ucd . fecv-ucd , was most closely related to the fipv isolated from lucy and was . % related to the consensus nucleotide sequences of coronaviruses obtained from the four related fip cats ( figure , table ). c there were snps between fipvs found in colonic scraping and the diseased omentum. d the biotypes of the virus isolated from the feces of these cats were not determined due to an inability to amplify the c gene. a similar finding was found for the cats that were unrelated to those described above and that were from disparate geographic regions. three of four fecal samples ( , and cat-t) contained amplifiable rna and complete c genes were sequenced in / of these cats ( and ). the c gene sequence of the fecal virus of cat was intact and ≥ % related to the fipv found in diseased tissue ( table ). this fecal isolate was designated fecv-ucd . the c gene of fecal virus contained a deliterious two-nucleotide deletion near the end of the c gene and was designated fipv-ucd b. this same deletion was also detected in the lesional fipv-ucd a. however, fipv-ucd a did not contain the -nucleotide deletion involving b and c of fipv-ucd b ( figure ). only the a, b genes were sequenced from the feces of cat-t and the sequence was % identical to the a, b sequence from the omental fipv-ucd . this study of lesional and/or fecal coronaviruses from nine cats both supported and modified the previous conclusions of vennema et al. [ ] . viruses from diseased tissues from all eight cats in this study had truncating mutations, either in the form of deletions leading to frame shifts or coding changes causing premature stop codons in the c gene. such damaging mutations were not present in other accessory and structural genes in this or in a previous study [ ] . as with the earlier study [ ] , all or almost all of the fecal isolates from diseased cats and a healthy contact control animal had intact c genes. taken as a whole, the present study supported a role for deleterious c gene mutations in the genesis of fipvs from fecvs. however, not all fipv isolates have deleterious c gene mutations. although / ( %) of lesional isolates in the present study had functional mutations in their c genes, only / ( %) of the fipvs reported by vennema et al. [ ] had deliterious c gene mutations. we have also recently observed what appeared to be intact c genes in / random breed cats that were adopted from a large shelter in northern california and died of fip. however, several of these isolates contained mutated c genes as minor variants, and without animal inoculation studies it is not possible to say whether or not these or the remaining isolates were capable of causing fip. the existence of helper/defective virus replication in the latter situation also needs to be considered. animal inoculation studies to determine the biotype of a given feline coronavirus are critical for determining the ultimate biotype of any isolate, regardless of its sequence regularities or irregularities. it was therefore important to demonstrate herein that an isolate from the four related cats reported herein was capable of causing fip. since some fipvs appear to have intact c genes, it may be premature to ascribe the fip biotype solely to deleterious mutations in the c gene. however, what are the alternatives? it can be argued that mutations in the conserved replicase/transcriptase genes may have a similar effect; that small mutations in other structural and accessory genes, collectively or singly, will have the same effect; that fipv and fecv are identical viruses; or that deleterious c gene mutations are an effect of the disease and not its cause. involvement of the replicase/transcriptase genes is unlikely, because the replicase/transcriptase region is highly conserved among feline coronaviruses and unlikely to be involved in cell tropism or evasion of the host's immune response. one study of a natural serotype i fipv isolate (c je) showed a high degree of sequence conservation within the replicase/transcriptase genes compared to other feline coronaviruses, while a premature stop codon limited the c gene product to the first amino acids [ ] . it is also unlikely that mutations in other accessory or structural genes are involved, even though such mutations have been frequently found in feline coronaviruses. firstly, c gene mutations in fipvs occur significantly out of proportion to mutations in other structural or accessory genes. secondly, there is little scientific evidence, especially based on animal inoculation, that other accessory genes are involved in fip. in the original report that proposed the internal mutation theory, / of the fipvs had c mutations, while / isolates had only b mutations [ ] . however, both of the latter cats were related and had been experimentally infected with an identical fecv (fecv-rm); a third sibling cat from this group had the same b mutation but with a unique functional c mutation. variants were not tested at the time and it is possible that c mutants would have been present if the two discordant isolates had been adequately sequenced. earlier studies have also demonstrated an absence of b mutations in almost all fecvs and other fipvs and indicate that such mutations are most likely tissue culture artifacts [ , ] . yet other studies suggest that a and b mutations occur in nature in both fip and enteric infections and are therefore not directly linked to pathogenicity [ , , ] . there is a general belief that host and environmental factors, and not virus mutation, are the basic determinants of whether a cat develops fip or just a mild enteritis following exposure to the common feline coronavirus [ ] [ ] [ ] [ ] [ ] . for such a theory to be correct, fecvs and fipvs would have to be identical in both genetic structure and virulence. the evidence that fecvs and fipvs cause very different diseases is strong [ ] [ ] [ ] [ ] . even though environmental and host factors are admittedly important in fip [ , ] , lesional viruses from the eight fip cats in this study, even though highly related to fecal isolates, were easily differentiated from each other based on deliterious c gene mutations alone. moreover, an infectious inoculum made from the diseased omentum of one of the fip cats induced fip in of cats that were experimentally infected (see section . .). confirmation of biotype by animal inoculation, such as described herein, is rarely done in published reports concerned with feline coronavirus infection [reviewed in ] . the possibility that deleterious c gene mutations are an effect of the disease and not a cause also has to be considered. however, there is little precedence for this and given the ability of a lesional isolate from the present study to produce fip, it is counterintuitive for a functional c gene mutant to be both a cause and effect of its own disease. this theory would also not explain why all non-tissue culture adapted fecv strains used for experimental inoculation studies have intact c genes, while all tissue culture adapted and non-adapted strains have mutated c genes [ ] . the existence of feline coronavirus variants was not a novel observation [ , , ] , but their frequency and fate has not been previously addressed. variant forms were found in both extraintestinal tissues and feces of the cats in this study, but only one variant became predominant upon experimental passage from one cat to another (see section . ). the infecting variant may have been merely the first virus into a macrophage, or its selection may have involved more complex host/virus interactions. we also found that subtle, and sometimes significant, genetic mutations (usually snps and deletions) occurred upon primary replication in a new host. therefore, genetic variation among feline coronaviruses occurs both within and between host cats. selective infection with a single variant can also rapidly lead to genetically distinct clades of coronavirus, especially when combined with a high intrinsic and extrinsic mutation rate. twelve laboratory cats were inoculated intraperitoneally with a cell-free inoculum prepared from the diseased omentum of red, which contained two variant forms of the virus (fipv-ucd a and -ucd b). three of these cats developed effusive fip within - weeks. viral rna was isolated from the omentum of each experimentally infected cat at the time of necropsy. the s (one cat) and e, m, n and a-c, a, b genes (all three cats) were sequenced. one of the cats was found to be infected with fipv-ucd a, while two of the cats were each infected with fipv-ucd b. each of these cats had a nearly identical variant of ucd- a or ucd- b in its diseased omentum ( table ). the premature stop codon of parental c gene was preserved in fipv isolates from all three cats. however, fipv-ucd b. isolated from one of the three cats had acquired two additional large deletions affecting both the b and c genes that were not in the infecting virus (table and figure ). table . name and biotype designation of coronavirus isolates from three cats dying of experimentally induced fip. the genes that were sequenced, their mutability, degree of relatedness to the consensus sequence of fipv-ucd a, b, and nature of the functional mutation in the c gene are given for each cat. it is important to determine by animal inoculation studies the true biotype of a feline coronavirus that is being reported, rather than always referring to a generic feline coronavirus [reviewed in ] . feline coronaviruses that possess the fip biotype, such as fipv-ucd a,b, will readily induce fip in from - % of infected individuals, depending on the strain being tested [reviewed in ]. however, bonifed (cat-to-cat passaged, non-tissue culture adapted) fecv strains will rarely induce fip in healthy cats [ , , , ]. the present study adds to our knowledge of genetic drift among feline coronaviruses that inhabit the same cat, multi-cat household, cattery, or geographically distant region. all of the fipvs and fecvs isolated from the five cats that had close contact with each other in sonoma, california were ≥ % related (tables and ; figure ). based on gene sequences and historical facts, it can be reasonably concluded that cat simba was infected with an fecv following contact with cat lucy. this supported another correlate of the internal mutation theory; fecvs are easily spread cat-to-cat, while fipvs are not. addie et al. [ ] also noted that the same strain of coronavirus tended to persist among any given group of cats. however, coronaviruses within a closely housed group of cats, and even within the same cat, undergo continuous genetic drift. we observed sequence differences of - % or less in cats from the same group, while genetic drift between cats from distant areas of the western us was on the order of - %. herewegh et al. [ ] also found that feline coronaviruses from individuals within the same environment had unique genetic fingerprints and fell within the same clade, while geographically distant isolates belonged to genetically unique clades. the notable mutational drift observed among feline coronaviruses across geographic regions, in the face of genetic conservation within stable groups of cats, is paradoxical. however, the evidence indicates that coronavirus infection in any group of cats originates from a single founder virus, that virtually every cat in a group is infected rapidly and efficiently, and that cats appear to resist superinfection with closely related strains [ ] . the single founder virus effect was confirmed in the present study (table ) . thus, marked genetic drift occurs when a single coronavirus strain is serially passed from one susceptible population to the next. this scenario was supported by our animal transmission studies; when cats were simultaneously infected with two closely related variants of fipv, each variant segregated into different cats. therefore, minor mutants may become predominate when passed cat-to-cat. the s sequences of fipv-ucd to were compared to that of previously reported fipvs and to a purported fecv (wsu- - ) (data not shown). the s protein shared % sequence identity among the four fipv isolates, and - % sequence identity to other published serotype i fipvs. however, when compared to the s protein of serotype ii feline coronaviruses wsu- - and wsu- - , there was only - % sequence identity (data not shown). based on the comparison of s proteins, fipv-ucd to were classified as serotype i feline coronaviruses. however, these studies demonstrate that serotype designation of feline coronaviruses can be more easily made from comparisons of the much smaller a rather than significantly larger s sequences ( vs amino acids in the respective gene products) (figure ). similar to the s protein comparison, the a sequence of all four fipvs from the related cats shared - % sequence identity to each other, and - % sequence identity to the four fipvs from unrelated cats and from published serotype i fipvs ( figure ). however, when compared to the a protein of serotype ii feline coronaviruses wsu- - and wsu- - or to a of canine coronavirus, there was only - % sequence identity. these results indicate all eight fipvs from this study clearly belonged to serotype i based on their a protein sequences, while known serotype ii viruses and the canine coronavirus formed a separate group (figure ). fipv is unique from most other viruses, because it is infrequently spread from animal-to-animal in a horizontal manner, yet it is highly infectious when extracts of diseased tissues or fluids are inoculated into naïve cats by a number of routes [reviewed in ] . the general belief is that enteric biotypes are compartmentalized to the gut, while fip biotypes are found only within internal organs [ ] . however, viruses with c mutations identical to fipvs from lesional tissues were present in the feces of some cats in this study (table ) , thus making horizontal transmission theoretically possible in certain circumstances. there is also evidence that fipv may have been shed in urine of fipv infected cats [ ] , and that coronavirus may be present in the blood, especially among younger cats [ ] . there are also several reports of fip outbreaks of sufficient magnitude and acuteness to suggest horizontal transmission [reviewed in ] . while this study did not answer the question as to the relative importance of vertical and horizontal transmission, it indicated the need to carefully study fecal and lesional virus isolates that are involved in explosive, large scale, epizootics of fip and not just the common enzootic form. amount of sequence homology among this protein, the similarities in their hydropathy profiles, both to each other and to the corresponding m proteins, as well as to the sars-cob a protein, are quite remarkable. nothing is known about these proteins, but it is clear that it will be interesting to learn more about their biological features." a great deal of research has been reported, and is being conducted, on the sars coronavirus a gene and protein and it is evident that this gene and its product play an important role in viral assembly, spread and pathogenesis, as well as to protective immunity [ ] [ ] [ ] . if the c protein of feline coronavirus truly has an analogous function to sars coronavirus a protein, sars coronavirus research might be applicable to feline coronaviruses and how they cause disease. the authors have used the original names of fecv to refer the enteric biotype of feline coronavirus, and fipv for the fip biotype. published non-tissue culture adapted coronavirus isolates from the feces of healthy cats always possess an intact or wildtype c, while strains from fip diseased tissues have mutated c genes [ ] . therefore, the designation of fecv or fipv in this study was applied to isolates with c genes that yielded either intact or truncated proteins, respectively. the generic term "coronavirus" or "feline coronavirus" was used herein when not referring to a specific biotype. four scottish fold kittens were born into the same cattery in sonoma, california; red, toby and lucy were from the same litter of three, while tux was born a week later in a litter of three to a sister queen and the same tom. simba, an year-old american curl, was born in an unrelated cattery and resided in another sonoma household as a pet. lucy was placed into this household with simba when she was weeks old, while red went to live in another home with two other older cats when at weeks of age. tux and toby remained in their home cattery with several other cats. lucy, tux, red and toby first showed signs of indicative fip at , , and , weeks of age, and were euthanatized with confirmed disease at , , and weeks of age, respectively. all other contact cats have remained healthy to this time. four additional cats were recruited from the western us. two of them were -and -month old burmese ( and ) from paradise and menlo park, ca, respectively. the third was a month old birman ( ) from san jose, ca, and the fourth was a -year old sphinx (cat-t) from mountlake terrace, wa (courtesy dr. tracy tomlinson). full necropsies on all cats, except cat-t were performed at the school of veterinary medicine teaching hospital (vmth), university of california, davis, ca. cat-t was necropsied at a private veterinary diagnostic laboratory (phoenix central laboratory, everett, wa). a definitive diagnosis of fip was confirmed on all eight cats by gross and microscopic examination of tissues and immunohistochemistry. the four related scottish folds and cat-t suffered from the effusive form of fip, while the two burmese and one birman cats suffered from non-effusive fip. samples of diseased omentum (effusive fip) or kidney granulomas (non-effusive fip), along with feces (or colonic mucus/mucosal scrapings from one cat) were collected at the time of necropsy and stored at - °c. feces from the healthy sentinel cat, simba, were also collected. a cell free inoculum was made from the diseased omentum of red, one of the four related cats. omentum was frozen in liquid nitrogen and ground to a powder. the frozen omental powder was reconstituted in . g/ml hbss (hanks buffered saline solution) and centrifuged twice at , x g for minutes. the supernatant was stored at - °c as viral stock. the viral stock was diluted : with hbss when used as inoculum for the fipv transmission study. adult specific pathogen free cats were obtained from the breeding colony of the feline health and pet care center, school of veterinary medicine, university of california, davis, ca. a total of twelve cats were inoculated intraperitoneally with ml of cell free viral inoculum. three cats developed fip within - weeks and complete necropsies established that all three cats had effusive fip. diseased tissues and feces were collected for isolation of feline coronavirus rna. viral rna was extracted from omentum, granulomas of kidney, and colonic mucus/mucosal scrapings using qiagen raeasy mini kit (qiagen, usa). about mg ground lesional tissues were lysed with µl lysis buffer containing b-mercaptoethanol. after thoroughly mixing, the lysate was homogenized with qiashredder (qiagen, usa) and an equal volume of % ethanol was added to the homogenized lysate. the lysate mixture was applied to rneasy spin column and the rna binding to the column was achieved by centrifugation. the rneasy spin column was then washed and the rna was eluted with µl rnase-free water and stored at - °c. feces from / cats were suspended with volumes of phosphate buffer saline (pbs) by vortexing. the suspension was centrifuged at , x g for min and the supernatant transferred to a new tube and centrifuged at , x g for min. the pellet containing the virus was suspended with ml pbs and centrifuged again at , x g for min. the pellet was suspended in µl pbs and the viral rna extracted using a qiaamp viral rna mini kit (qiagen, usa). briefly, µl lysis buffer containing carrier rna was mixed with the µl viral suspension and incubated at ambient temperature for min; µl % ethanol was added to the lysate. the lysate mixture was applied to qiaamp mini spin column and the rna binding to the column was achieved by centrifugation. the column was then washed and the rna was eluted with ml rnase-free water and stored at - °c. the published sequences of feline coronaviruses in genbank were used to design the primers for a reverse transcripase polymerase chain reaction (rt-pcr). three primer pairs were designed from highly conserved regions and used to amplify three overlapping fragments containing the nine structural and accessory genes of feline coronavirus (figure and table ). the rt-pcr was carried out with qiagen longrange step rt-pcr kit (qiagen, usa). the viral rna was first denatured by incubating at °c for min and then chilled on ice. the reverse transcription was carried out in l reaction mixture containing units of longrange reverse transcriptase, . unit of rnase inhibitor, mm dntp, mm oligo dt , and l of denatured viral rna in x reaction buffer. the mixture was incubated at °c for hr followed by °c for min. the reverse transcribed cdna was stored at - °c or used immediately in pcr amplification. the viral cdna was amplified in l reaction mixture containing l cdna, unit longrange pcr enzyme mix, . mm dntp, . mm forward primer, and . mm reverse primer in x pcr buffer. the mixture was then incubated at °c for min and amplified for cycles at °c for s, °c for s, and °c for min per kb of pcr product, followed by a final extension for min at °c. the reverse transcribed viral rna from feces was amplified for cycles under the same condition. the pcr products were electrophoresed in tae buffer on a . % agarose gel. the pcr product was purified using a qiagen gel purification kit (qiagen, usa). sixty primers were ultimately used for sequencing, with the s gene requiring the most primer development and modification (primer sequences not shown). regions containing mixed sequences due to the presence of a minor variant were also resolved with overlapping primers. the purified overlapping pcr products encoding the nine structural and accessory genes were sequenced with a bigdye terminator v . cycle sequencing kit (applied biosystems, usa) in µl reaction containing µl big dye terminator mix, µl reaction buffer ( x), ng sequencing primer, and µl (out of µl) gel purified pcr product. the sequencing reaction was incubated at °c for min and then amplified for cycles at °c for s, °c for s, and °c for min. unincorporated dye terminators and dntp were removed by gel filtration based performa dtr ultra -well plate kit (edgebio, usa) and the cycle amplified products were analyzed by capillary electrophoresis using an abi genetic analyser (applied biosystems, usa). vector nti advance software (invitrogen, usa) was used for alignment of sequence data. the percent sequence identity for pairwise alignment and the phylogenetic relationship among different fipv isolates was analyzed using clustalw ii (www.ebi.ac.uk/tools/clustalw /). tables and list the various fipv and fecv isolates that were studied and the genes that were sequenced for each. these sequences have been deposited in the database of genbank. the ubiquitous form of feline coronavirus is readily passed cat-to-cat by the fecal-oral route and is the cause of a mild or unapparent enteritis. like coronaviruses in general, feline enteric coronavirus (fecv) is undergoing constant mutation within its accessory and structural genes. feline infectious peritonitis (fip), which is a highly fatal systemic disease, is a sequel of fecv infection in a small proportion of cats. the virus isolated from the diseased tissues of cats with fip is highly related to the fecv identified in the feces. although snp and deletion mutations were common between isolates from the same cat, only the c gene was rendered non functional by such mutations. deleterious mutations in c tend to be found in diseased internal tissues, while viruses with intact c are found mainly in the feces. while deleterious mutations of the c gene were seen in all fip cats in this study, and in virtually all previously reported fipvs, they are by no means a universal finding. however, there is compelling evidence that when they do occur, they are the cause of fip and not an effect of the disease. deleterious c gene mutants will readily cause fip when inoculated into laboratory cats, whereas their largely non-pathogenic fecal counterparts with intact c genes are readily transmitted from one cat to another. these gene c mutants, when they occur, are unique to each cat with fip, indicating that they arise independently in each host and not by mutation in one cat with subsequent horizontal spread to others. several minor variants can co-exist in both tissues and feces and when two variants are inoculated together into the same cat, one or the other, but not both, will predominate. the high mutability of feline coronaviruses leads to minor genetic differences between cats in one closely contained geographic area, while significant genetic differences are seen between isolates from geographically disparate regions. more in depth studies on the function of the feline coronavirus c gene will be important for determining its precise role in fip. some important disorders of cats clinico-pathology conference epidemiology of feline infectious peritonitis among cats examined at veterinary medical teaching hospitals feline infectious peritonitis ultrastructural evidence for the viral etiology of feline infectious peritonitis morphogenesis of a virus in cats with experimental feline infectious peritonitis extraperitoneal lesions in feline infectious peritonitis antigenic relationship of the feline infections peritonitis virus to coronaviruses of other species pathogenic differences between various feline coronavirus isolates. coronaviruses; molecular biology and pathogenesis an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis a review of feline infectious peritonitis virus infection: - pathogenesis of feline enteric coronavirus infection virologic and immunologic aspects of feline infectious peritonitis virus infection perspectives on feline coronavirus evolution elimination of feline coronavirus infection from a large experimental specific pathogen-free cat breeding colony by serologic testing and isolation two related strains of feline infectious peritonitis virus isolated from immunocompromised cats infected with a feline enteric coronavirus feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein genomic rna sequence of feline coronavirus strain fcov c je persistence and evolution of feline coronavirus in a closed catbreeding colony field strain feline coronaviruses with small deletions in orf b associated with both enteric infection and feline infectious peritonitis deletions in the a orf of feline coronavirus associated with an epidemic of feline infectious peritonitis belák s. preliminary studies on feline coronavirus distribution in naturally and experimentally infected cats feline leucocyte antigen class ii polymorphism and susceptibility to feline infectious peritonitis natural fcov infection: cats with fip exhibit significantly higher viral loads than healthy infected cats natural feline coronavirus infection: differences in cytokine patterns in association with the outcome of infection high viral loads despite absence of clinical and pathological findings in cats experimentally infected with feline coronavirus (fcov) type i and in naturally fcov-infected cats association between faecal shedding of feline coronavirus and serum alpha -acid glycoprotein sialylation inheritance of susceptibility of feline infectious peritonitis in purebred catteries risk factors for feline infectious peritonitis among cats in multiple-cat environments with endemic feline enteric coronavirus quasispecies composition and pylogenetic analysis of feline coronaviruses (fcovs) in naturally infected cats. fems antigenic and plaque variations of serotype ii feline infectious peritonitis coronaviruses persistence and transmission of natural type i feline coronavirus infection the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes feline infectious peritonitis: experimental studies the detection of feline coronaviruses in blood samples from cats by mrna rt-pcr glycosylation of the severe acute respiratory syndrome coronavirus triple-spanning membrane proteins a and m severe acute respiratory syndrome coroanvirus a protein is a viral structural protein amino terminus of the sars coronavirus protein a elicits strong, potentially protective humoral responses in infected patients the severe acute respiratory syndrome (sars)-coronavirus a protein may function as a modulator of the trafficking properties of the spike protein this research was funded by the center for companion animal health, school of veterinary medicine, university of california, davis, ca . we are also grateful for anonymous and named donations from owners of cats dying from fip. the authors are grateful for the assistance of sue weitendorf for allowing access to a critical group of cats used in this study. positive proof that the c protein is responsible for the fip phenotype, in at least a proportion of cats dying of fip, will require knowledge of its exact function, of which we currently know very little. a genblank blast search shows a % genetic homology between feline coronavirus c and sars coronavirus a (data not shown). moreover, the c protein of feline coronavirus also has an identical hydrophillicity profile to its own m protein and to the m and a proteins of sars coronavirus [ ] . these similarities prompted oostra and colleagues [ ] to state -"(…) it appears that all group [corona] viruses expresss group-specific proteins predicted to be triple-spanning membrane proteins. examples are the feline orf c protein and the hcov-nl orf a protein (…) despite the small key: cord- -w ptl n authors: satoh, ryoichi; kobayashi, hiroshige; takano, tomomi; motokawa, kenji; kusuhara, hajime; hohdatsu, tsutomu title: characterization of t helper (th) ‐ and th ‐type immune responses caused by baculovirus‐expressed protein derived from the s domain of feline infectious peritonitis virus, and exploration of the th and th epitopes in a mouse model date: - - journal: microbiol immunol doi: . /j. - . . .x sha: doc_id: cord_uid: w ptl n feline infectious peritonitis virus (fipv) may cause a lethal infection in cats. antibody‐dependent enhancement (ade) of fipv infection has been recognized, and cellular immunity is considered to play an important role in preventing the onset of feline infectious peritonitis. in the present study, whether or not the t helper (th) epitope was present in the spike (s) domain was investigated, the ade epitope being thought to be absent from this domain. three kinds of protein derived from the c‐terminal s domain of s protein of the fipv ku‐ strain were developed using a baculovirus expression system. these expressed proteins were the pre‐coil region which is the n‐terminal side of the putative fusion protein (fp), the region from fp to the heptad repeat (hr) (fp‐hr ) region, and the inter‐helical region which is sandwiched between hr and hr . the ability of three baculovirus‐expressed proteins to induce th ‐ and th ‐type immune responses was investigated in a mouse model. it was shown that fp‐hr protein induced marked th ‐ and th ‐type immune responses. furthermore, peptides derived from the fp‐hr region were synthesized. five and peptides which included the th and th epitopes, respectively, were identified. of these, four peptides which included both th and th epitopes were identified. these findings suggest that the identification of th epitopes in the s domain of fipv has important implications in the cat. ous vaccines, such as virulence-attenuated live or inactivated fipv vaccines, have been investigated. however none have shown sufficient efficacy, rather these vaccines have enhanced the onset of fip ( ) ( ) ( ) ( ) ( ) ( ) ( ) . compared to antibody-negative kittens, intraperitoneal inoculation with fipv induces more severe clinical signs in anti-fipv antibody-positive kittens, and in kittens which have undergone passive immunization with serum or purified igg from antibody-positive cats ( , ) . this phenomenon is referred to as ade of viral infection. the ade of fipv infection is a serious obstacle to its vaccine-based prevention. cellular immunity is considered to play an important role in preventing the onset of fip ( ) . thus, it is essential that vaccines against fipv infection induce a cellular immune response. fipv consists of three major proteins, n, m, and s, which are classified as class i virus fusion proteins ( , ) . s protein exists as radially protruding trimers on the viral envelope, and can be structurally or functionally divided into two domains, namely the s and s domains, representing the n-terminal globular head and c-terminal membrane-bound stalk, respectively. the cterminal s domain sequentially contains the pc region, putative fp, , hydrophobic hr , ih domain, hr , and the cluster aromatic amino acid domain from the nterminal, and is responsible for driving viral and target cell membrane fusion ( , ) . the n-terminal s domain contains receptor-binding, neutralizing antibodybinding, and ade epitopes ( ) ( ) ( ) ( ) ( ) ( ) ( ) . recently, it was reported that th /tc epitopes are present in the s and s domains of sars-cov, which belongs to the coronaviridae, as does fipv ( ) ( ) ( ) ( ) ( ) ( ) . however, it is not yet known whether the th /tc epitope is present in the s and/or s domain of fipv. in the present study, we examined whether the th epitope was present in the s domain, a domain in which it was thought that the ade epitope was absent ( , , , , ) . we performed two experiments using a mouse model. firstly, we investigated the immunogenicity of three baculovirus-expressed proteins, pc, ih, and fp-hr proteins, derived from the s domain of the type i fipv ku- strain (fig. ). it has been suggested that fp-hr protein has marked immunogenicity. secondly, we searched for epitopes inducing a th -and/or th type immune response using synthetic peptides derived from the fp-hr region. as a result, we identified and peptides including th and th epitopes, respectively. genomic rna was extracted from fipv ku- straininfected culture fluid. rt of genomic rna and amplification of cdna employing pcr were carried out using a standard technique with a dna thermal cycler. rt-pcr primers were designed for each region: pc region (forward, -gggggatccttttgtaacatcctat actatgcc- ; reverse, -ggggaattcttaagtgta catagacatcttattacca- ), ih region (forward, -gggagatctatggcccaagttgaccgt- ; reverse, -ggggaattcttacacaatctcctgaaatgtc- ), and fp-hr region (forward, -gggagatctatggc atctttaattggcgg- ; reverse, -ggggaattctta ttttacataagtttcaatcctgtt- ), of the s gene of the fipv ku- strain. the pcr products were cloned into a pvl plasmid (pharmingen, san diego, ca, usa). escherichia coli top strain was transformed with recombinant plasmid dna and cultured. the white colonies that grew were selected and recombinant bacmid dna recovered. sf- cells were transfected with recombinant bacmid dna using cell cellfectin (gibco brl, grand island, ny, usa), and the culture supernatant used in further experiments as each protein recombinant baculovirus (fig. ) . gene transfer was confirmed employing the pcr method (data not shown). sf- cells cultured for a day were inoculated with the recombinant baculovirus. the infected cells were harvested and washed with pbs. one milliliter of rsb buffer ( . m nacl, . m mgcl , and . m tris-hcl, ph . ) containing . % np- was added to × cells, and the cell suspension kept at • c for min with gentle shaking. the suspensions were centrifuged at × g for min and the precipitate washed in pbs. the precipitate was then resuspended in pbs and used for immunization. the specificity and amount of each expressed protein were measured by western immunoblotting using serum from the fipv ku- strain-infected cat. wild-type baculovirus-infected sf- cells were prepared by np- treatment as control antigens for each expressed protein. each expressed protein was separated employing % sds-page and transferred to a nitrocellulose membrane. a standard protein marker (precision plus protein standards) was purchased from bio-rad (hercules, ca, usa). the membrane was blocked with % non-fat dry milk powder in tbst ( mm tris-hcl, ph . , . % nacl, and . % tween- ) for hr at • c, incubated for hr at c the societies and blackwell publishing asia pty ltd • c with serum from the fipv ku- strain-infected cat and then incubated with peroxidase-conjugated goat anticat igg (mp biomedicals, llc-cappel products, irvine, ca, usa) for hr at • c. it was then visualized in substrate for min. to determine the th and/or th epitope, peptides derived from the s domain of the fipv ku- strain were synthesized at sigma-aldrich (st louis, mo, usa) ( table ) . one peptide (fp) was derived from the putative fp region. twenty-five peptides (hr - -hr - and hr - -hr - ) synthesized as -mer fragments with a -amino-acid overlap were derived from the hr and hr regions. four peptides (ih- -ih- ) were derived from the hydrophobic area of the ih domain. all peptides were purified to purities of more than % and supplied as lyophilized powder. the peptides were dissolved in % dimethyl sulfoxide at mg/ml, aliquoted, and stored at − • c. four-week-old female balb/c mice (n = or per group) were obtained from charles river (hino, japan) and maintained under spf conditions. all immunizations were given intraperitoneally every two weeks with each expressed protein (western immunoblotting: units per dose). mice were immunized three times in total. wildtype baculovirus-infected sf- cell-derived antigen and pbs-immunized groups were used as negative controls. one or two weeks after the final immunization, the mice were killed to harvest their spleens. splenocytes were cultured in rpmi- medium containing % fbs, u/ml penicillin, and μg/ml streptomycin. erythrocyte-depleted splenocytes ( × cells/well) in -well plates were cultured with μg/ml of each peptide, heat-inactivated virus (fipv ku- strain, . tcid /ml; fipv - strain, . tcid /ml; the homology of the amino acid sequence of the s domain of these two viruses is . %), or culture medium as a control for three days. the concentrations of ifn-γ, il- , and il- in the supernatant of splenocytes cultured with stimulatory substances for three days were measured using commercial mouse ifn-γ, il- , and il- elisa kits (endogen, cambridge, ma, usa) according to the manufacturer's protocol, respectively. all results are expressed as means ± standard error of the mean. student's t-test or one-way analysis of variance was employed as appropriate to determine the significance of differences. a p-value of < . or p < . was considered significant. the specificity and amount of three expressed proteins, pc, fp-hr , and ih, were measured by western immunoblotting assay using serum from the fipv ku- strain-infected cat. in agreement with the size of pc, fp-hr , and ih proteins, -, -, and -kda bands, respectively, were visualized (fig. ) and detected in up to a -fold dilution ( units) . no expressed proteins reacted with the serum of the spf cat. evaluation of the th -type immune response of pc, fp-hr , and ih proteins was based on the concentrations of ifn-γ and il- in the culture supernatant (fig. a, b) . in fp-hr protein-immunized mice, the concentra- tions of ifn-γ and il- in the supernatant of splenocytes cultured with or without fipv antigen were significantly higher than in that of splenocytes derived from wild-type baculovirus-infected sf- -or pbs-immunized mice (p < . , p < . , respectively). in ih proteinimmunized mice, the concentration of il- in the supernatant of splenocytes cultured with or without fipv antigen was significantly higher than in that of splenocytes derived from wild-type baculovirus-infected sf- or pbs-immunized mice (p < . , p < . , respectively). however, in pc protein-immunized mice, the concentrations of ifn-γ and il- in the supernatant of splenocytes cultured with or without fipv antigen were not significantly higher than in that of splenocytes derived from wild-type baculovirus-infected sf- -or pbs-immunized mice. evaluation of the th -type immune response of pc, fp-hr , and ih proteins was based on the concentration of il- in the supernatant (fig. c) . in fp-hr proteinimmunized mice, the concentration of il- in the supernatant of splenocytes cultured with or without fipv antigen was significantly higher than in that of splenocytes derived from wild-type baculovirus-infected sf- or pbs-immunized mice (p < . , p < . ). in ih protein-immunized mice, the concentration of il- in the supernatant of splenocytes cultured with the heatinactivated fipv - strain was significantly higher than in that of splenocytes derived from pbs-immunized mice (p < . ). however, in pc protein-immunized mice, the concentration of il- in the supernatant of splenocytes cultured with or without fipv antigen was not significantly higher than in that of splenocytes derived from wild-type baculovirus-infected sf- -or pbsimmunized mice. th -and th -type immune responses against peptides derived from the fp-hr region of murine splenocytes immunized with fp-hr protein evaluation of the th -or th -type immune response against peptides derived from the fp-hr region was based on the concentration of ifn-γ or il- in the supernatant, respectively (figs , ) . in fp-hr proteinimmunized mice, the concentration of ifn-γ in the supernatant of splenocytes cultured with the hr - , hr - , ih- , hr - , hr - , or fipv antigen was significantly higher than in that of splenocytes cultured with medium alone (p < . : ih- , hr - , hr - , and fipv antigen; p < . : hr - and hr - ) (fig. a) . the concentration of il- in the supernatant of splenocytes cultured with the fp, hr - , hr - , hr - , hr - , hr - , hr - , ih- , ih- , ih- , hr - , hr - , hr - , hr - , hr - , hr - , or fipv antigen was significantly higher than in that of splenocytes cultured with medium alone (p < . : hr - , hr - , hr - , hr - , hr - , hr - , hr - , hr - , hr - , hr - , and fipv antigen; p < . : fp, hr - , ih- , ih- , ih- , and hr - ) (fig. a) . this indicates that four peptides, hr - , hr - , ih- , and hr - , induce both th -and th -type immune responses. in wild-type baculovirus-infected sf- -or pbs-immunized mice, the concentrations of ifnγ and il- in the supernatant of splenocytes cultured with or without peptide were not increased (fig. b, c; fig. b, c) . we have shown that fp-hr protein derived from the s domain, which does not include ade epitopes, exhibits strong immunogenicity in the mouse. in addition, we showed that and peptides derived from the fp-hr region induce th -and th -type immune responses, respectively. these results suggest that these peptides contain the th and th epitopes, respectively. of these, four peptides contained both the th and th epitopes. comparing the immunogenicity of mouse n-terminalsided pc protein with that of c-terminal-sided fp-hr protein of the s domain, ifn-γ, il- , and il- concentrations were significantly increased only in fp-hr protein-immunized mice. fp-hr protein consists of fp, hr , hr , and ih domains. the concentrations of ifn-γ, il- , and il- in fp-hr protein-immunized mice were significantly higher than those of ih protein-immunized mice. this suggests that, except for the ih domain, the fp, hr , and/or hr region contains a highly immunogenic site. ih protein showed less immunogenicity in mice, especially in regard to induction of ifn-γ, than did fp-hr protein. however, stimulation with ih- , a peptide derived from the ih region, induced ifn-γ production, suggesting the presence of th epitopes. reportedly, sars-cov and transmissible gastroenteritis virus produce no neutralizing antibodies after immunization of mice with a peptide containing a neutralizing epitope, but enhance immunogenicity and produce neutralizing antibodies when bound to a peptide with th epitopes ( , ) . the hr and hr regions contain peptides with the th epitopes identified in this study, (i.e. hr - , hr - , hr - , and hr - ). thus, ih protein alone is unlikely to recognize antigen-presenting cells; however, fp-hr protein (i.e. ih protein bound to hr and hr ) may exhibit greater immunogenicity. h- db, an mhc class i molecule of balb/c mice, is known to have a structure similar to that of hla-a . experimental inoculation of cats with canine coronavirus and subsequent challenge with feline infectious peritonitis virus a review of feline infectious peritonitis virus infection: - attempted immunization of cats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis pathogenicity studies of feline coronavirus isolates - and - attempted immunisation of cats against feline infectious peritonitis using canine coronavirus cross-protection studies between feline infectious peritonitis and porcine transmissible gastroenteritis viruses immunologic phenomena in the effusive form of feline infectious peritonitis antibody-mediated enhancement of disease in feline infectious peritonitis: comparisons with dengue hemorrhagic fever the coronavirus spike protein is a class i virus fusion protein: structural and functional characterization of the fusion core complex a review of feline infectious peritonitis virus: molecular biology, immunopathogenesis, clinical aspects, and vaccination virus entry: molecular mechanisms and biomedical applications localization of antigenic sites of the s glycoprotein of feline infectious peritonitis virus involved in neutralization and antibody-dependent enhancement monoclonal antibody analysis of neutralization and antibody-dependent enhancement of feline infectious peritonitis virus a study of the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies enhancement and neutralization of feline infectious peritonitis virus infection in feline macrophages by neutralizing monoclonal antibodies recognizing different epitopes antibody-dependent enhancement of feline infectious peritonitis virus infection in feline alveolar macrophages and human monocyte cell line u by serum of cats experimentally or naturally infected with feline coronavirus selection of antigenic variants of the s glycoprotein of feline infectious peritonitis virus and analysis of antigenic sites involved in neutralization monoclonal antibodies to the spike protein of feline infectious peritonitis virus mediate antibody-dependent enhancement of infection of feline macrophages vaccination of mice with recombinant baculovirus expressing spike or nucleocapsid protein of sars-like coronavirus generates humoral and cellular immune responses response of memory cd + t cells to severe acute respiratory syndrome (sars) coronavirus in recovered sars patients and healthy individuals hla-a * t-cell epitopes in severe acute respiratory syndrome (sars) coronavirus nucleocapsid and spike proteins identification of an hla-a * -restricted cd + t-cell epitope ssp- of sars-cov spike protein t-cell epitopes in severe acute respiratory syndrome (sars) coronavirus spike protein elicit a specific t-cell immune response in patients who recover from sars screening and identification of severe acute respiratory syndrome-associated coronavirus-specific ctl epitopes a transmissible gastroenteritis coronavirus nucleoprotein epitope elicits t helper cells that collaborate in the in vitro antibody synthesis to the three major structural viral proteins identification and characterization of dominant helper t-cell epitopes in the nucleocapsid protein of severe acute respiratory syndrome coronavirus amino acid sequences predicted by the national institute of health (http://www-bimas.cit.nih.gov/molbio/ hla bind/) to have a strong capacity to bind to hla-a , were explored in the fp, hr , and hr regions. the results demonstrated the presence of epitopes showing a marked capacity to bind to aa - (hr - ) of the hr region and aa - (hr - ), aa - (hr - and hr - ), aa - (hr - ), and aa - (hr - ) of the hr region. among these peptides, hr - and hr - induced ifn-γ production in this experiment. this suggests that these two peptides are mhc class ibinding peptides with the tc epitope. the other peptides, hr - , hr - , and ih- , have the th epitope.like the sites of th epitopes in fipv identified in this study, sars-cov contains th /tc epitopes in the hr , ih, and hr regions of the s domain ( ) ( ) ( ) . among these, th /tc epitopes (ssp- ) present in the hr region are known to induce strong ctl activity and are regarded as candidates for vaccine development. thus, the peptides with th /tc epitopes identified in this study, particularly hr - and hr - that seem to have tc epitopes, are potential candidates for vaccine development for prevention of fipv infection.although th /tc epitopes in the fp-hr region appeared to strongly induce the th -type immune response in a mouse model, their effects in the cat remain unknown. it is important for an effective peptide-based vaccine against fipv infection to include th /tc , but not ade, epitopes. in the cat, the identification of th /tc epitopes in the s domain of fipv has important implications. in the future, th /tc epitopes in fipv will be explored using fipv-infected cats. the development of a vaccine against fipv infection based on these epitopes is awaited. key: cord- -s w yr authors: hohdatsu, t.; okada, s.; koyama, h. title: characterization of monoclonal antibodies against feline infectious peritonitis virus type ii and antigenic relationship between feline, porcine, and canine coronaviruses date: journal: arch virol doi: . /bf sha: doc_id: cord_uid: s w yr seven monoclonal antibodies (mabs) with neutralizing activity against feline infectious peritonitis virus (fipv) strain - (type ii) were prepared. when the polypeptide specificity recognized by these monoclonal antibodies (mabs) was investigated by western immunoblotting, all of the mabs reacted with peplomer glycoprotein (s) of the virus. by competitive binding assay these mabs were found to recognize at least different epitopes. the reactivity of these mabs with viruses classified as fipv type i (ucd- , ucd- , ucd- , ucd- , nw- , and black), feline enteric coronavirus (fecv) type ii strain - , canine coronavirus (ccv) strain - , and transmissible gastroenteritis virus (tgev) strains to- and sh was examined by neutralization tests. all mabs neutralized fecv strain - , ccv strain - , and tgev strains to- and sh, while they did not neutralize the fipv type i viruses. moreover, the mab against tgev strain to- , which has strong neutralizing activity against tgev viruses, neutralized ccv strain - , fecv strain - , and fipv strain - , but did not neutralize the fipv type i viruses. these results demonstrated that there are at least epitopes involved in the neutralization of fipv type ii strain - , and that these epitopes are not present in fipv type i viruses but are present in fecv strain - which does not induce feline infectious peritonitis, tgev strains to- and sh, and ccv strain - . these results suggest the presence of serotypes of fipv which can be clearly distinguished by the neutralization test using mabs. the mammalian members of the family coronaviridae are divided into distinct antigenic groups on the basis of serologic tests [ , ] . one antigenic group t. hohdatsu et al. contains mouse hepatitis virus, neonatal calf diarrhea coronavirus, human coronavirus hcv-oc , hemagglutinating encephalomyelitis virus of swine, and rat coronavirus. the second antigenic group consists of human respiratory coronavirus hcv- e, transmissible gastroenteritis virus (tgev) of swine, canine coronavirus (ccv), and feline infectious peritonitis virus (fipv) [ , ] . in addition to these members, a feline enteric coronavirus (fecv) has been isolated, which is very closely related to fipv, tgev, and ccv [ , ] . feline coronaviruses are divided into fipv types i and ii, and fecv types i and ii, on the basis of the disease types, that is, whether it causes feline infectious peritonitis (fip) or not, the ability of the viruses to proliferate in cell cultures, and the antigenic relationship to tgev and ccv [ ] . among these types, fipv type ii and fecv type ii are reported to be antigenicatly closer to tgev and ccv. between tgev purdue strain and fipv - strain a high degree of homology in the primary structure of the peplomer protein (s, k) has been described ( % for amino acid residues to and % for residues to ) [ ] . the authors prepared mabs which react only with the feline coronaviruses fipv type ii strain - and fecv type ii strain - . some of these mabs reacted with either tgev or ccv in indirect fluorescent antibody assays. also, some differences in antigenically between fipv type i virus strains were noted in an analysis using mabs (unpubl. obs.). in this study, we prepared mabs with neutralizing activity against fipv strain - , and investigated the differences in the epitopes recognized by these mabs, using a competitive binding assay. using these mabs and mabs with neutralizing activity against tgev strain to- , we examined the neutralizing epitopes for differences between feline coronaviruses, and tgev and ccv viruses. feline whole fetus cells (fcwf- ), crandell feline kidney cells (crfk), and swine kidney cells (cpk) were grown in eagle's minimum essential medium (mem) containing % l- medium, % fetal calf serum, units/ml penicillin and gg/ml streptomycin. the maintenance medium was mem containing % l- and antibiotics as above. the cells were maintained in a humidified % co incubator at °c. the coronavirus isolates used in this study and their sources are shown in table . among the fipv strains used in the study, strains ucd-t, nw- , ucd- , ucd- , ucd- , and black show cell-associated growth, and are therefore regarded as type i virus strains in the classification of pedersen et al. [ ] . fipv and fecv, tgev, and ccv were passaged or times in fcwf- cells, cpk cells, and crfk cells, respectively, and were used for the study. the antigen was prepared with the fipv - strain grown in fcwf- cell cultures. infectious culture fluid concentrated about tenfold by ammonium sulfate precipitation was layered onto a discontinuous sucrose density gradient ( and %) in a rps rotor (hitachi koki co., ltd, japan) and centrifuged at , r.p.m, for h. the virus bands formed at the interface of % and % sucrose layers were collected, diluted in nte buffer ( . m nac , . m tris-hc , ph . , . m edta) and centrifuged at , x g for h. the ,arus-containing pellet was suspended in a / volume of nte buffer. for preparation of neutralizing mabs against fipv - strain, balb/c mice, about weeks of age, were inoculated intraperitoneally with a mixture of ~tg of the viral antigen prepared as above and t cells of pertussis adjuvant. four or weeks later the mice received an intravenous booster dose of gg of viral antigen, and spleen cells were obtained for fusion days later. the fusion was carried out by essentially the same method described by k hler and milstein [ . polyethyleneglycol- , (merck, federal republic of ger-many) was used as a fusing agent and the ratio of mouse spleen cells and mouse myeloma cells (p- /x- -ag - , , ) was : . the selective medium contained hypoxanthine ( - m), aminopterin ( x - m) and thymidine ( . x -sm). the fused cells, at a concentration of . x spleen cells per ml, were dispended in ~tl volumes into wells of -well, flat-bottomed microplates (coming glass works, corning, ny) and incubated at °c in a humid atmosphere containing % cq. after incubation for weeks, the wells were examined and those which contained hybridoma cultures were tested for feline coronavirus specific antibody by a neutralization (nt) test (see below). the colonies in antibody positive wells were passaged in -well multiplates (corning glass works, corning, ny) and incubated in medium containing hypoxanthine ( - m) and thymidine ( . x - m). the cells were then cloned by the soft agar method. the neutralizing mabs against tgev to- strain used were previously reported by hohdatsu et al. [ ] . the supernatant fluid of antibody-secreting hybridoma cultures were concentrated tenfold by % saturation of ammonium sulfate and used for determination of antibody class and subclass by double diffusion in % agar gel containing . % nan . rabbit antisera against mouse immunoglobulins, igg , igg a, igg b, igg , igm and iga, and • and )~ chains (miles laboratories, naperville, u.s.a.) were placed in center wells and test samples were added to peripheral wells. the plates were incubated overnight at room temperature in a humidified chamber. sds-page was performed in slab gets under a nonreducing condition. the separation gel contained % polyacrylamide and the stacking gel contained % polyacrylamide. the sample buffer contained final concentration of % (w/v) sds, % (v/v) glycerol, . % (w/v) bromphenol blue and mm tris-hc (ph . ). the electrode buffer (ph . ) contained . g/ tris, . g/ glycine and . % sds. samples were mixed with sample buffer and kept at room temperature for h without boiling. electrophoresis was performed at room temperature for h at a constant current of ma. viral antigen separated in polyacrylamide gel by sds-page were transferred to nitrocellulose sheets of . gm pore size. the transfer was carried out electrophoretically by the method adapted from towbin et al. [ ] in a transfer-blot cell apparatus (bio-rad laboratories, richmond, ca) at ma and v for h using transfer buffer consisting of g/ tris (ph . ), % methanol and . g/ glycine. the nitrocellulose sheets were then cut into strips and incubated at °c for h in pbs containing % fetal calf serum. the sur)ernatant fluid of antibody-secreting hybridoma cultures were added in ml volumes to individual strips and incubated at °c for h. the strips were then washed times with pbs containing . % tween- , and incubated at °c for h with horseradish peroxidase-conjugated rabbit antibody against mouse igg, iga, and igm (miles lab., u.s.a.) diluted : with pbs containing % fetal calf serum. the strips were then washed and treated with substrate solution containing . g diaminobenzidine, lal of % h in ml of . m tris-hc , ph . . when distinct bands appeared about min later, the reaction was stopped by pouring off the substrate solution and rinsing with distilled water. this was carried out by a modified enzyme-linked immunosorbent assay (elisa) [ ] . serial tenfold dilutions in gl volumes of each competing mab from ascitic fluid were added to wells of a flat-bottomed microelisa plate coated with virus antigen (see above), and incubated at °c for rain. after washings with washing solution ( . % nac solution containing . % tween- ), gl of biotin-labeled mab diluted so as to show an optical density (od) of . was added, and incubated at °c for min. after washings with washing solution, peroxidase conjugated avidin (cappel, cooper biomedical, inc. malvern, pa) were diluted to the optimal concentration with pbs containing % fetal calf serum and . % tween- and gl of the dilution was added to each well of the plates. after incubation at °c for min, each well received gl of substrate solution and incubated at °c for min in a dark room. after completion of the incubation, the reaction was stopped with n h so solution and the od at nm was determined. the amount of competitive binding was estimated from the od in the presence or absence of unlabeled competing antibodies. the percentage of competition was determined by the formula, (a -n)/(a -b), where a is the od in the absence of competing antibody, b is the od in the presence of homologous antibody ( elisa units), and n is the od in the presence of a competitor. serial twofold dilutions of the mab were mixed with an equal volume of a virus suspension diluted so as to contain approximately tcid / . ml. the mixtures were incubated at °c for rain. each mixture was then inoculated into cell cultures in flat-bottomed microplates (coming glass works, coming, ny), and incubated in an atmosphere of % co in air at °c for days. two wells were employed for each antibody dilution. the anitbody titer was expressed as the reciprocal of the highest dilution of mab that completely inhibited cytopathic effect in the test. using the spleen cells of mice immunized with fipv strain - , cell fusion was conducted times. as a result, mabs ( - - , - - , - - , - - , - - , - - , and - - ) with neutralizing activity against fipv strain - were obtained. the immunoglobulin isotype and polypeptide specificity of these mabs are shown in table . polypeptide specificity was determined by western immunoblotting. all mabs were found to recognize the s protein of the viruses. figure shows an example of the reaction. to determine the differences in the epitope specificity of the neutralizing mabs, competitive binding assay was performed, and the results are summarized in table . binding of the biotin-labeled mabs - - , - - , - - , and - - to virus antigen was completely blocked by all of these unlabeled mabs. - - , - - , - - , - - , and - - by .t'-~ . %. on the basis of these results, epitopes recognized by these mabs were named i, ii, and iii. reactivity of the mabs which recognize the neutralizing epitopes in fipv strain - , with feline, porcine, and canine coronaviruses was investigated with the neutralization (nt) test. as shown in table , these mabs did not neutralize the fipv type i strains, but neutralized fecv strain - , as well as the porcine and canine coronaviruses. in particular, mabs which recognize epitope iii ( - - and - - ) also showed a high neutralizing activity against these viruses, as against fipv strain - . the the results are shown in table . while mab - neutralized the fipv type ii strain - , fecv type ii strain - , and ccv strain - , it did not neutralize fipv type i viruses. mabs -a and -a did not neutralize any coronaviruses other than tgev. in this study, we prepared mabs with neutralizing activity against fipv strain - , and used them to investigate the serological relationships between feline, porcine, and canine coronaviruses. it is generally accepted that epitopes associated with neutralization are present on the s protein of viruses. fiscus and teramoto have reported this phenomenon in feline coronaviruses i- ]. all mabs with neutralizing activity were observed to recognize s protein. this finding confirms the presence of a neutralizing epitope on the s protein. however, there have been no reports on the characteristics of this epitope. the results of the competitive binding assay using the mabs revealed the existence of at least different neutralizing epitopes (i, ii, and iii) in fipv strain - (table ) . we believe that the topographical relationship between epitopes i, ii, and iii is as follows. since (fig. a) resulting in blocking by steric hindrance, or that epitope iii overlaps part of epitopes i and ii (fig. b) . differences in the epitopes recognized by the mabs were determined. the nt activity of these mabs against several feline, porcine, and canine coronaviruses was examined. these mabs did not neutralize the fipv type i viruses, but neutralized fecv strain - , tgev strains to- and sh, and ccv strain - , which do not cause feline infectious peritonitis (table ) . moreover, a mab against tgev strain to- , which neutralized the tgev strains, neutralized fipv strain - , fecv strain - , and ccv strain - (table ). these results support the classification by pedersen et al. [ ] . when the virus groups (fipv type i, fipv type ii, fecv type ii, tgev, and ccv) are serologicalty compared, fipv type ii, fecv type ii, tgev, and ccv are found to form a group. fipv type i virus seems to be a virus of a distinct serotype. in other words, fipv inducing feline infectious peritonitis seem to consist of viruses of at least serotypes. pedersen etal. [ ] have indicated that many cases of feline infectious peritonitis in cats are induced by type i virus infection. we also found that, out of cats with feline infectious peritonitis-like symptoms and antibody-positive by indirect fluorescent antibody assay, only were positive for neutralizing antibody against fipv strain - (fipv type ii) (unpubl. data). it is probable that fipv type i is more prevalent in a natural environment. in the future, examination of the effects of different virus types on the anitbody-mediated enhancement of fipv infection [ , ] , as seen in dengue virus infection [ , ] , would be valuable. at present, we are investigating the effects of the neutralizing mab prepared in this study against in vivo fipv infection. differences between tgev strain purdue and fipv type ii strain - at the gene level of s protein have been reported [ ] . analysis of fipv type i at the gene level is also desired. recovery and characterization of a coronavirus from military dogs with diarrhoea recovery and in-vitro cultivation of a coronavirus from laboratoryinduced cases of feline infectious peritonitis (fip) antigenic comparison feline coronavirus isolates: evidence for markedly different peplomer glycoproteins comparison between virulent and attenuated strains of transmissible gastroenteritis virus heterogeneity of infection enhancement of dengue strains by monoclonal antibodies studies on transmissible gastroenteritis in pigs. iii. isolation of cytopathogenic virus and its use for serological investigation antigenic variation of porcine transmissible gastroenteritis virus detected by monoctonal antibodies antigenic relationships among homologous structural polypeptides of porcine, feline and canine coronaviruses spaan wjm (t ) the nucleotide sequence of the peplomer gene of porcine transmissible gastroenteritis virus (tgev): comparison with the sequence of the peplomer protein of feline infectious peritonitis virus (fipv) topographical analysis of antigenic determinants on envelope glycoprotein v (e) of japanese encephalitis virus, using monoclonal antibodies continuous cultures of fused cells secreting antibody of predefined specificity isolation of feline coronaviruses from two cats with diverse disease manifestations dengue virus monoclonal antibodies identify epitopes that mediate immune infection enhancement of dengue viruses attempted immunization of cats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus immunologic phenomena in the effusive form of feline infectious peritonitis experimental studies with three new strains of feline infections peritonitis virus: fipv-ucd , fipv-ucd and fipv-ucd pathogenic differences between various feline coronavirus isolates infection studies in kittens utilizing feline infections peritonitis virus propagated in cell culture an enteric coronavirus infection of cats and its relationship to feline infectious peritonitis pathogenicity studies of feline coronavirus isolates - and - morphologic and physical characteristics of feline infectious peritonitis virus and its growth in autochthonous peritoneal cell cultures antigenic relationship of the feline infectious peritonitis virus to coronaviruses of other species electrophoretic transfer of proteins from polyacrytamide gets to nitrocellulose sheets: procedure and some applications antibody-mediated enhancement of disease in feline infectious peritonitis: comparison with dengue hemorrhagic fever this work has been funded by the kitasato research foundation under grant no. . key: cord- - rgcc h authors: pedersen, n. c.; ward, j.; mengeling, w. l. title: antigenic relationship of the feline infectious peritonitis virus to coronaviruses of other species date: journal: arch virol doi: . /bf sha: doc_id: cord_uid: rgcc h utilizing the direct and indirect fluorescent antibody procedure, the antigenic relationship of the feline infectious peritonitis virus (fipv) to other human and animal coronaviruses was studied. fipv was found to be closely related to transmissible gastroenteritis virus (tgev) of swine. transmissible gastroenteritis virus and fipv were in turn antigenically related to human coronavirus e (hcv- e) and canine coronavirus (ccv). an interesting finding in the study was that the coronaviruses selected for this study fell into one of two antigenically distinct groups. viruses in each group were antigenically related to each other to varying degrees, but were antigenically unrelated to coronaviruses of the second group. the first antigenically related group was comprised of mouse hepatitis virus, type (mhv- ), hemeagglutinating encephalomyelitis virus n (hev- n) of swine, calf diarrhea coronavirus (cdcv), and human coronavirus oc (hcv-oc ). the second antigenically related group was comprised of fipv, tgev, hcv- e and ccv. utilizing the direct and indirect fluorescent antibody procedure, the antigenic relationship of the feline infectious peritonitis virus (fipv) to other human and animal coronaviruses was studied. fipv was found to be closely related to transmissible gastroenteritis virus (tgev) of swine. transmissible gastroenteritis virus and fipv were in turn antigenically related to human eoronavirus e (i-icv- e) and canine coronavirus (ccv). an interesting finding in the study was that the eoronaviruses selected for this study fell into one of two antigenically distinct groups. viruses in each group were antigenieally related to each other to varying degrees, but were antigenically unrelated to coronaviruses of the second group. the first antigenically related group was comprised of mouse hepatitis virus, type (mi-iv- ), hemeagglutinating encephalomyelitis virus n (hev- n) of swine, calf diarrhea coronavirus (cdcv), and human coronavirus oc (hcv-oc ). the second antigenically related group was comprised of fipv, tgev, hcv- e and ccv. the family coronaviridae is a recently characterized group of animal and human viruses ( ) . coronaviruses are to nm in diameter, have a buoyant density in sucrose of . to . g/cm , are sensitive to lipid solvents, contain a large single strand of ribonucleic acid, have regularly spaced surface projections n.c. pedersen, j. wai~d, and w. l. mesrg~ll~g: t h a t are to n m in length, and bud from profiles of endoplasmic reticulum into cytoplasmic vesicles in the infected cells ( ) . coronaviruses cause bronchitis in chickens ( ), humans ( , ) and rats ( ) , acute enteric infections in b a b y pigs ( ) , calves ( ) a n d puppies ( ) , hepatitis in mice ( ), and encephalomyelitis a n d chronic vomition and wasting in swine ( , ) . feline infectious peritonitis (fip) is a viral disease of cats t h a t is characterized b y peritonitis, pleuritis or disseminated granulomata ( ) . feline infectious peritonitis represents an uncommon secondary form of a common i n a p p a r e n t or mild p r i m a r y illness of cats ( ) . the f i p agent has strong morphologie and physical similarities to known coronaviruses ( , , , ) . a possible antigenic relationship between feline infectious peritonitis virus (fipv) and the transmissible gastroenteritis virus (tgev) of swine has been recently reported ( , , ) , which further supports the assumption t h a t f i p v is a coronavirus. the antigenic relationship of f i p v to h u m a n and animal coronaviruses other t h a n t g e v has not been studied, and confirmation of the antigenic relationship of f i p v and t g e v using monospeeific antiserum is needed. the purpose of this s t u d y is twofold: to confirm the antigenic relationship of f i p v to tgev, and to demonstrate the antigenic relationship of different animal and h u m a n coronaviruses to f i p v , and to each other. the viruses selected for this s t u d y were h u m a n coronavirus c (hcv- c ), h u m a n eoronavirus e (hcv- e), t g e v and hemagglutinating encephalomyelitis virus n (hev- n) of swine, mouse hepatitis virus t y p e (miiv- ), calf diarrheal coronavirus (cdcv), and canine coronavirus (ccv). antigenic comparisons were m a d e utilizing the direct and indirect fluorescent a n t i b o d y technique. this procedure has been utilized to s t u d y serologic differences between several h u m a n coronaviruses (/ ). monospecific antiserum to f i p v was prepared in specific pathogen free kittens (liberty laboratories, liberty corners, nit). the cats were inoculated intraperitoneally with . g equivalents of liver suspension containing approximately id of the ucd- strain of fipv. the origin of this strain and the preparation of the inoeula have been previously described ( ) . serum was harvested prior to the animms' death, from to days after inoculation. by the indirect fluorescent antibody technique ( ) this antiserum had a titer of : against fipv. mouse anti-mttv- serum was produced in specific pathogen free adult. swiss white mice. mice were inoculated intraperitoneally with a sublethal dose of a per cent mouse liver suspension containing the craig strain of mitv (mhv- ). this material was obtained from the american type culture collection, rockville, md. three weeks later the mice were challenged intraperitonemly with a second sublethal dose of mhv- , followed by challenge weeks later with a lethal dose of virus. serum was harvested weeks after the final challenge dose. this serum had a titer by the indirect fluorescent antibody technique of : against mi-iv infected nctc- cells. bovine anti-cdcv antiserum was obtained from calves that. had been experimentally infected with the virus. the globulin fraction of this serum was conjugated with fluoreseein isothiocyanate (fitc). conjugated antiserum was provided by dr. c. a. mebus, lincoln, nebraska.. the conjugated antiserum produced maximum fluorescence in cdcv infected bovine fetal lung cells at dilutions of : or less. swine anti-tgev serum was obtained from a specific pathogen free sow that was experimentally infected with the miller strain of tgev. this serum was kindly provided by dr. roger woods, ames, iowa. both swine anti-tgev and ttev serum produced maximum fluorescence by the antibody technique at di utions of t : or less. guinea pig anti,hcv- e serum was provided by dr. harold kaye, communicable diseases center, atlanta, georgia. before use, the serum was absorbed with swine testicle, human embryo flbroblasts, nctc-t , african green monkey (cv- ), bovine fetal lung cells and with cat liver homogenate. this serum produced maximum fluorescence by the indirect fluorescent antibody technique at dilutions of : or less. mouse anti-i-icv-oc ascitie fluid was kindly provided by dr. harold kaye, communicable diseases center, atlanta, georgia. ascitic fluid was collected from virus free mice that had been experimentally infected with hcv-oc . this serum produced maximum fluorescence by the indirect fluorescent antibody technique at dilutions of : or tess. canine anti-ccv globulin conjugated with fluorescein isothioeyanate was provided by dr. l. q. binn, walter reed army institute of research, washing*on, d.c. it was prepared from convalescent serum of puppies experimentally infected with ccv. the conjugated antiserum produced maximum fluorescence in ccv infected canine fetal thymus cells at dilutions of : or less. cryostat microtome sections of liver from fib¥ infected cal~s were used as the antigen source of fibv. the preparation of these slides has been previously described ( ) . prior to use, the fixed liver sections were immersed for minutes in . ~ glycine-i.ic buffer, pit . to remove immunoglobulin bound in rive. when this bound immunoglobulin was not removed, a false positive reaction was seen in the indirect fluorescent antibody test, especially when the second antibody was rabbit anti-cat igg. after treating in buffer, the slides were washed immediately in phosphate buffered saline (bbs), followed by a minute and minute wash in bbs. mhv- infected cell monolayers were prepared as follows. nctc- cells (microbiological associates, bethesda, md.), adapted to grow in eagle's minimum essential media (mem) and per cent fetal calf serum (fcs), were grown in well culture chamber slides (lab-tek, microbiological associates, bethesda, md.). when confluent, the cell monolayer was exposed ~o mhv- by placing .t nil of a : dilution of per cent infected mouse liver suspension in each well. the slides were fixed in absolute acetone when significant cytopathic effect was noticed. calf diarrhea coronavirus was obtained from dr. c. a. mebus, lincoln, nebraska.. one-tenth ml of infectious tissue culture media was placed in each well of a culture chamber slide containing a three-fourth confluent monolayer of low passage fetal bovine lung cells. the slides were fixed in absolute acetone after -- days. tgev and i.iev were cultivated in swine embryonic testicle cells {national animal diseases center, ames, iowa). tgev (miller strain) infected tissue culture fluid was provided by dr. roger woods, ames, iowa,. i.iev ( n strain) infected tissue culture fluid was obtained from the national animal disease center, ames, iowa. swine testicle cells were grown in eagle's mem in per cent fcs in well culture chamber slides. when the cultures were almost confluent they were exposed to the n strain of ttev or miller strain of tgev by placing .i ml of infected tissue culture fluid in each well. the slides were fixed in absolute acetone after to days. ttcv- e was obtained as infected tissue culture fluid from dr. harold kaye, communicable diseases center, atlanta, georgia. low passage human embryonic fibroblasts were grown in eagle's mem in per cent fcs in well culture chamber slides. when the cultures were ahnost confluent, . nil of infected tissue culture fluid was placed in each well. slide cultures were fixed after days. n.c. ped~ase~, j. ward, and w. l. mengeling: hcv-oc was obtained as a mouse brain suspension from dr. harold kaye, communicable diseases center, atlanta, georgia. high passaged african green monkey kidney cells (cv- ) were grown in eagle's mem with per cent fcs in well culture chamber slides. when nearly confluent, . ml of a : dilution of brain suspension was placed in each well. slides were fixed in absolute acetone after to days. canine eoronavirus (i- ) in tissue culture fluid was obtained from the american type culture collection, izockville, ,md. low passage dog thymus cells were cultivated in well culture chamber slides. when nearly confluent, . ml of infected tissue culture fluid was placed in each well. cultures were fixed in absolute acetone after eytopathie effect became noticeable. rabbit anti-mouse igg globulin-fitc, rabbit a~nti-cat igg globulin-fitc, rabbit anti-pig igg-fitc, and goat anti-guinea pig igg-fitc were obtained from antibodies incorporated, davis, ca. conjugated anti-igg globulins were free of anticoronavirus activity as determined by reacting antigen substrates with the diluted conjugates alone. goat anti-guinea pig igg-fitc was absorbed with eat liver homogenate and human embryo cells. indirect fluorescent antibody staining was carried out as follows. antigen substrate slides were overlaid with a : dilution in pbs of the appropriate antiserum and incubated at ° c for hour in a humidified chamber. the slides were immediately rinsed with pbs and then washed for minutes in pbs. the slides were blotted dry and then overlaid with the appropriate anti-igg conjugate diluted : in pbs. the slides were incubated for i hour at ° c in humidified chamber and then washed in pbs. this treatment was followed by a minute wash in pbs containing a : dilution of a per cent stock solution of aqueous evans blue, and a minute wash in pbs. slides were then blotted dry, and eoverslips mounted with per cent glycerol in pbs. direct fluorescent antibody staining was carried out essentially as above, except tha~ the first antibody reaction was omitted. slides were photographed with a zeiss reflected light fluorescent microscope, powered by a watt ac mereury~vapor bulb, using exciter and barrier filters specific for fluorescein isothioeyanate. photomicrographs were made using ektachrome mm daylight slide film, asa (kodak co., l%oehester, ny), with second exposures. all photomicrographs were prepared from black and white negatives made from the colored slides. the cross-reactivity by immunofluorescence of antisera to different coronaviruses is listed in table . antigenic cross-reactivity varied from nondetectable, barely detectable, weak, moderate, to very strong (equal to that produced by the homologous serum). cross-reactivity, varying from barely detectable to very strong, was seen between mhv- , cdcv, hev- n and hcv-oc . there was no detectable antigenic cross-reactivity between these viruses and fipv, tgev, hcv- e, or ccv. antiserum to fipv reacted strongly with tgev, and vice versa. antiserum to both of these viruses had barely detectable to weak antigenic cross-reactivity with hcv- e, and antiserum to iicv- e had weak to moderate cross-reactivity with fipv and tgev. antiserum to ccv did not react with any of the other coronaviruses, although antiserum to fipv and tgev reacted very strongly with ccv. photomicrographs of some of the strongly positive eross-reae~ions are shown in figures and . it was concluded from these studies that, miiv- , hcv- c , cdcv, and hev- n are all antigeniemly interrelated to varying degrees, but a~ not related antigenieally to any of the other [ eoronaviruses. similany, fipv, tgev, hcv- e and ccv share antigens to varying degrees with each other, but appear antigenieally unrelated to mhv- , hcv-oc , cdcv, and hev- n. in the ease of ccv, however, the reactivity was largely in. one direction only, in t, hat antiserum to ccv showed no reactivity with any of the other eoronaviruses, whereas antiserum to fipv and tgev reacted strongly with ccv. these studies demonstrate conclusively that the fip virus has antigenic similarities to known coronaviruses, namely tge virus of swine, e virus of humans, and canine eoronavirus. this finding, coupled with the morphologic and it was interesting that the coronaviruses selected for this study segregated into distinct groups on the basis of antigenic cross-reactivity by immunefluorescence. although viruses within each group were antigenieally related to each other, there appeared to be no antigenic relationship of viruses from one group with viruses of the other group. the first antigenically related group was comprised of mhv- , hev- n, cdcv and i-icv-oc , and the second group was comprised of tgev, fipv, hcv- e and ccv. these findings confirm a number of published reports on antigenic relationships among recognized coronaviruses. on the basis of serum neutralization or complement fixation tests, antigenie relationship has been previously reported between rat eoronavirus and mi-iv ( ) , hcv-oc and mhv ( ), hev- n and ci)cv ( ) , hcv-oc and tiev- n ( ), and ccv and tgev ( ) . it has also been previously reported that hcv- e appeared to be antigenically unrelated to mhv- and hcv-oc ( ). the lack of relationship by immunofluorescence of hcv- c and hcv- e has also been reported ( ) . although the results of our studies were in agreement with most of the published literature on antigenic relationships among various corona viruses, there were several reports that we could not confirm. we could find no antigenic relationship by immunofluoreseenee between mhv- and hcv- e, and i-icv-oc and hcv- e. a relationship between these viruses has been previously described ( ). we also found no antigenic relationship between hev- n and tgev, although a relationship using the immnnopreeipitation technique has been reported ( ) . it has been reported that antiserum to tgev does not react against fipv in the fluorescent antibody test ( ) . in contrast, we found that ~ntiserum to tgev reacted strongly with fipv. finally, we are at a loss to explain the failure of anti-ccv globulin to react with tgev and fipv with immunefluorescence, especially considering the strong reaction against ccv demonstrated by both anti-fipv and tgev serum. dog anti-ccv serum will apparently neutralize tgev ( ), and it is strange that this reaction was not detected with immnnofluoreseence. recovery and characterization of a eoronavirus from military dogs with diarrhea the detection of transmissible gastroenteritis viral antibodies by immunodiffusion antigenic relationships amongst eoronaviruses a virus related to that causing hepatitis in mice (mi-iv) studies on the infectious bronchitis virus of chickens isolated in finland a hemagglutinating virus producing encephalomyeiitis in baby pigs a new virus isolated from the human respiratory tract feline infectious peritonitis virus. zbl antigenic relationship between human corona virus strain c and hemagglutinating encephalomyelitis virus strain n of swine: antibody responses in human and animal sera i~ecovery in tracheal organ cultures of novel viruses from patients with respiratory disease antigenic relationship among the coronaviruses of man and between human and animal coronaviruses detection of eoronavirus infection of man by immunofluorescence seroepidemiology of feline infectious peritonitis virus infections using transmissible gastroenteritis virus as antigen rat corona virus (rcv) : a prevalent, naturally occurring pneumotropic virus of rats serologic studies of naturally occurring feline infectious peritonitis morphologic and physical characteristics of feline infectious peritonitis virus and its growth in autochthonous peritoneal ceil cultures feline infectious peritonitis: something old, something new characteristics of a coronavirus causing vomition and wasting in pigs detection of transmissible gastroenteritis virus neutralizing antibody in cats characterization of a calf diarrheal coronavirus characterization of a calf diarrheal coronavirus morphology-of transmissible gastroenteritis virus of pigs morphogenesis of a virus in cats with experimental feline infectious peritonitis untersuchungen fiber die antigenverwandtschaft der viren der felinen infekti ser peritonitis und der transmissiblen gastroenteritis des sehweines ultrastruetural evidence for the viral etiology of feline infectious peritonitis received october , key: cord- -c icxir authors: weiss, r. c.; vaughn, d. m.; cox, n. r. title: increased plasma levels of leukotriene b and prostaglandin e in cats experimentally inoculated with feline infectious peritonitis virus date: journal: vet res commun doi: . /bf sha: doc_id: cord_uid: c icxir specific-pathogen-free kittens experimentally infected with feline infectious peritonitis virus (fipv) subsequently demonstrated increased plasma levels of the arachidonic acid metabolites, leukotriene (lt) b and prostaglandin (pg) e . significant increases (p< . ) in ltb plasma levels occurred in all ( / ) fipv-inoculated kittens on postchallenge-exposure days (pcd) and vs pcd . significant increases (p< . ) in pge plasma levels occurred in % ( / ) of fipv-infected kittens on pcd and . maximal mean plasma levels of ltb and pge occurred on pcd ( . ± . pg/ml and . ± . pg/ml, respectively). a positive correlation was found between ltb plasma levels and body temperature (r= . , p< . ). mean survival time in fipv-inoculated kittens was . ± . days. gross lesions, including peritoneal or pleural effusions (or both) and connective tissue edema, indicated an increased vascular permeability in the fipv-infected kittens. histologically, lesions were characterized by pyogranulomatous inflammation. immunofluorescent studies of tissues from fipv-infected kittens demonstrated foci of polymorphonuclear leukocytes and fipv-positive macrophages oriented around dilated blood vessels. seemingly, arachidonic acid metabolites, including ltb or pge released from macrophages, neutrophils or other cells, may be involved in the pathogenesis of fip vascular and inflammatory lesions and in some of the clinical disease manifestations. (fipv) subsequently demonstrated increased plasma levels of the arachidonic acid metabolites, leukotriene (lt) b and prostaglandin (pg) e . significant increases (p<o.o ) in ltb plasma levels occurred in all ( ) fipv-inoculated kittens on postchallenge-exposure days (pcd) and vs pcd . significant increases (pco. ) in pge plasma levels occurred in % ( / ) of fipv-infected kittens on pcd and . maximal mean plasma levels of ltb and pge occurred on pcd ( . k . pgiml and . + . pg/mi, respectively). a positive correlation was found between ltb plasma levels and body temperature (r = . , p<o.ol). mean survival time in fipv-inoculated kittens was . k . days. gross lesions, including peritoneal or pleura effusions (or both) and connective tissue edema, indicated an increased vascular permeability in the fipv-infected kittens. histologically, lesions were characterized by vasculitis or perivasculitis, vasodilatation, perivascular edema, and fibrinonecrotizing and pyogranulomatous inflammation. immunofluorescent studies of tissues from fipv-infected kittens demonstrated foci of polymorphonuclear leukocytes and fipv-positive macrophages oriented around dilated blood vessels. seemingly, arachidonic acid metabolites, including ltb or pge released from macrophages, neutrophils or other cells, may be involved in the pathogenesis of fip vascular and inflammatory lesions and in some of the clinical disease manifestations. feline infectious peritonitis (fip) is a progressive and fatal immune-mediated coronaviral disease of cats (pedersen, ; august, ) . the pathologic lesions in fip are detailed in numerous reports (wolfe & griesemer, ; holmberg & gribble, ; montali & strandberg, ; slausen & finn, ; weiss & scott, b ) and consist of vasculitis and perivascular pyogranulomatous or fibrinonecrotizing inflammation (or both) in serosae and visceral organs. clinically, fip-diseased cats can have a chronic fluctuating fever and develop variable amounts of peritoneal or pleural fluid (or both). the fluids are exudates containing mostly fibrin and other serum proteins, macrophages, and neutrophils (pedersen, ; barlough & weiss, ) . the pathophysiologic mechanisms responsible for fip lesions are not well understood. loss of fluid and other plasma constituents from inflamed blood vessels, immunologically damaged by complexes of virus, antiviral antibodies and complement (c) proteins (august, ; barlough &weiss, ; pedersen & boyle, ; weiss & scott, ~; jacobse-geels et al., ) or by cytotoxic lymphokines or other enzymatically-active factors released during cellular immune responses (pedersen, ) , may occur in cases of acute fip. except for studies of c fragments (pedersen & boyle, ; weiss & scott, ~; jacobse-geels et al., ; ) and a recent report on interleukin (il)- (goitsuka et al., ) , there are presently no reports of biochemical mediators of inflammation involved in. fip. inflammatory mediators-such as leukotrienes (lt) and prostaglandins (pg), both of which are fatty acid metabolites of arachidonic acid (aa), can be synthesized in cell membranes and subsequently released after cellular activation or injury (gerrard, a) . various pharmacologic actions, including increased vascular permeability, edema, vasomotor changes, neutrophil and macrophage chemotaxis, or fever production, are associated with their release (piper, ; parker, ; wolfe & coceani, ) . additionally, pge can suppress specific cellular (t-cell) immune responses (rocklin et al., ) . although several kinds of cells, including leukocytes, platelets, endothelial cells, smooth muscle cells and fibroblasts, can be stimulated to synthesize lt or pg, macrophages and neutrophils are apparently the major sources (parker, ; gerrard, b; gordon, ) . macrophages and neutrophils are also the predominant cells in fip inflammatory lesions; and macrophages are frequently infected by fipv (pedersen, ; weiss & scott, b; barlough & weiss, ) . the objectives of the present study were to measure the plasma concentrations of ltb and pge in specific-pathogen-free (spf) kittens before and after experimental infection with fipv and to suggest a role of aa metabolites in the pathogenesis of fip. the spf kittens used in this study were purchased from a commercial breeding colony (liberty laboratories, liberty corners, nj) at -to -weeks-old. the kittens were housed in individual cages and were maintained at the auburn university animal isolation facility. all the kittens were test negative (by immunofluorescence) for feline leukemia virus and were test negative for feline coronavirus serum antibodies (by virus neutralization). the fipv challenge-exposed and nonchallenged-exposed control kittens were housed in separate isolation rooms. the df strain of fipv (atcc no vr- , american type culture collection, rockville, md) was used both for virus challenge-exposure and also as target virus for fipv antibody assays. the virus was passed times in crfk cells (obtained from dr l. swango, auburn, al) in our laboratory, concentrated by ultrafiltration (minitantm system, millipore, bedford, mass), and stored in tissue culture growth media (l-ml aliquots) at - °c until use. the titer of the fipv was approximately o . tissue culture infective doses (tcidx) per ml. by titration, it was determined that the inoculum contained approximately .s cat lethal doses (ld,,) per ml. each of five kittens was inoculated intraperitoneally (ip) with approximately ld,, of fipv on postchallenge-exposure day (pcd) . two additional kittens were inoculated with growth media only (age-matched nonchallenge-exposed controls). on pcd , , , and the kittens were mildly sedated with ketamine hcl (vetalartm, parke, davis & co, detroit, mi) given intramuscularly ( mg/kg) and blood samples were collected from the external jugular vein into vacuum-evacuated blood collection tubes (vacutaine?, becton dickinson & co, columbus, nb). plasma or serum was processed for ltb and pge determinations, or for virus neutralizing antibody assays, respectively. recta temperatures and clinical signs of disease were monitored daily. complete gross necropsy examinations were performed on all the kittens and samples were taken for histopathologic examinations and immunofluorescent studies. control kittens were euthanatized and necropsied on pcd . levels of ltb or pge in plasma were determined using ria and liquid scintillation techniques. pilot studies using human ria reagents for ltb or pge determinations in feline plasma samples showed good reproducibility, accuracy, and sensitivity. plastic pipettes and tubes (sarstedt, princeton, nj) were used for all sample preparations and ria procedures. three ml of blood from each kitten was collected into evacuated tubes containing k edta and centrifuged at x g for minutes at °c. the plasma was removed, frozen, and stored at - °c until used. before ria analysis, ltb and pge were extracted from plasma. briefly, . ml hcl ( . n) was added to .o ml plasma to acidify the samples. this mixture was vortexed and . ml ethylacetate was added. the mixture was vortexed twice for seconds each. the sample was centrifuged at x g for minutes at °c. the supernatant was removed and dispensed into tubes containing equal . ml portions for ltb or pge analysis. the ethylacetate extracts were placed in a water bath at °c and blown to dryness under a stream of nitrogen gas. the residues were resuspended in . ml of ltb or pge buffer supplied with the respective ria kit (ltb ria kit, new england nuclear, boston, mass; pge ria kit, seragen, boston, mass) and were stored at - °c until used. on the day of assay, the samples were thawed, vortexed, centrifuged at x g for minutes at "c, and placed on ice until assayed. for ltb or pge determinations, . ml aliquots of extracted plasma samples were assayed in duplicate using the respective ria kit and procedure outlined in the manufacturer's protocol. briefly, test samples or standard solutions containing unlabelled ltb or pge were incubated with diluted antibodies and radiolabelled ligands for hours at °c. bound fractions were separated after addition of dextran-coated charcoal followed by centrifugation at x g for minutes at °c. the supernatants were removed and transferred into -ml scintillation vials, and -ml of scintillation fluid (scinti verse iitm, fischer scientific co, fairlawn, nj) was added to each vial. the vials were vortexedfor seconds and the radioactivity in each vial was determined using a liquid scintillation counter (ls , beckman instruments inc, irvine, ca). the levels of ltb or pge in the extracted samples were determined by interpolation from their respective standard curves. virus neutralizing antibody (vna) assay for vna assays, blood was collected into evacuated tubes without anticoagulant and stored overnight at room temperature. the blood was centrifuged at x g for minutes and the supernatants were dispensed into l-ml portions, frozen, and stored at - °c until use. serum vna titers to fipv-df were determined using a standard infectivity inhibition-type assay in feline embryo (fcwf- ) cells (obtained from dr nc pedersen, davis, ca). this assay was performed essentially as described by pedersen & black ( ) , except that tcidso of fipv were incubated with each dilution of serum and cytopathic effects (cpe) were scored at hours. serum vna titers were recorded as the reciprocal of the highest dilution of serum that inhibited cpe in % of test wells. all kittens were examined for gross lesions. representative sections of all organs and lesions were fixed in % neutral buffered formalin. the fixed tissues were embedded in paraffin, sectioned at pm, stained with hematoxylin and eosin (h & e) and examined by light microscopy. for immunofluorescent (if) studies, l-cm pieces of liver were frozen by immersion in liquid nitrogen and stored at - °c until use. frozen tissues were cryosectioned at pm, fixed in acetone for minutes at - °c and then stored at - °c until use. indirect fluorescent antibody (fa) tests for detection of fipv antigens in tissues were performed as previously described (weiss & scott, a) . samples were examined with an epifluorescent ultraviolet light microscope (imt- , olympus corp, lake success, ny). analysis of data was performed using a computerized statistical analysis program (stat pak goldtm, walonick assoc, minneapolis, mn). correlations between body temperatures in fipv challenge-exposed kittens and corresponding ltb or pge plasma levels were determined by simple linear regression analysis. a l-way analysis of variance and l-tailed student's t test were used to determine significant (p<o.o ) differences between ltb or pge mean plasma levels before and at weekly intervals after fipv challengeexposure. all fipv challenge-exposed kittens demonstrated an initial increase (range, . to .o"c) in rectal temperature on pcd . the initial febrile response was transient, lasting only to hours before body temperature returned to normal levels. the maximal temperatures on pcd or ranged between . and . "c. a second and more sustained increase in body temperature occurred after to weeks, or about to days before death. mucous membrane pallor, icterus, anorexia, central nervous system depression, dyspnea and occasionally melena accompanied the fever. subnormal body temperatures were present to hours before death. mean survival time f standard deviation (sd) and range (min-max) were . k . , to days. virus neutralizing serum antibodies against fipv were either not detected (cats and ) or were present only at low concentrations (cats , and ) on pcd . primary antibody responses in cats and occurred between pcd and . antibody titers in all fipv challenge-exposed kittens increased rapidly after pcd and vna titers on pcd ranged from to (table ) . age-matched nonchallenged control kittens (n = ) did not demonstrate vna in their sera on pcd , , , or and did not show fever or other signs of disease. increased levels of ltb and pge were detected in the plasma of kittens after challenge-exposure to fipv. compared to mean plasma levels on pcd , ltb levels in fipv challenge-exposed kittens were significantly increased on pcd (p<o.ol) and also on pcd (p<o.o ); maximal increases occurred on pcd (cats , and ) or on pcd (cats and ) (figure ). in cats and , ltb levels rapidly declined after the peak response on pcd ; cats and , however, demonstrated increased ltb levels throughout the disease. mean plasma levels + sd of ltb in all fipv challenge-exposed kittens were increased on pcd , and compared to mean plasma levels of ltb in agematched control kittens sampled on the same days ( . k . , . , and . + . pg/ml vs . + . , . ? . , and . pg/ml, respectively) (table l) , plasma levels of pge were increased in out of kittens after fipv challengeexposure ( figure ). mean pge plasma levels in these kittens were significantly increased on pcd (p<o.o ) and also on pcd (p<o.o ) compared to mean plasma pge levels on pcd . in cat , plasma pge levels decreased after fipv challengeexposure. in individual kittens, maximal plasma pge levels ( . to . pg/ml) occurred on pcd or . mean f sd plasma pge levels in all fipv challenge-exposed kittens were increased on pcd and vs levels in age-matched control kittens ( . + . and . k . pg/ml vs . k . and o.ok . pg/ml, respectively) ( table ) . maximal increases in mean ltb or pge plasma levels occurred in fipv challengeexposed kittens on pcd . at this time, kittens had demonstrated febrile responses (mean +-sd, . ko. c) and serum antibodies were either not detected or were present only at low concentrations (table ) . a significant positive correlation (r = . ; df, p<o.ol) was found between ltb plasma levels and body temperature (figure ) . a correlation between plasma pge levels and body temperature, however, was not observed (r = . ; df, p>o. ) (figure ) . gross lesions in fipv challenged-exposed kittens appeared as disseminated . to lo.omm white foci in liver, omentum, spleen, kidney, lungs, visceral and parietal peritoneum, intestines, pancreas and mesenteric, ileo-cecal and sternal lymph nodes. the foci were frequently oriented around superficial veins. clear yellow, viscous peritoneal or pleural fluid containing fibrin strands was present in most kittens. the fluid ranged from several ml to more than ml in volume. the mesentery, omentum, mediastinal tissue, and mesenteric lymph nodes were frequently edematous. mesenteric and sternal lymph nodes were enlarged. several kittens demonstrated thymic atrophy. microscopic lesions consisted of disseminated foci of fibrinonecrotic or pyogranulomatous inflammation predominantly in the parietal peritoneum and serosae, liver, spleen, pancreas, visceral lymph nodes, thymus, kidneys, and leptomeninges. the lesions were oriented around small veins as perivenous infiltrates of macrophages, neutrophils, small lymphocytes, fibrin, and nuclear debris. the inflammatory cell infiltrates were frequently located around dilated blood vessels in edematous areas of mesentery, intestinal serosa or omentum. gross or microscopic changes were not observed in tissues from nonchallenge-exposed control kittens. immunofluorescent studies indirect fa tests on frozen sections of liver from fipv challenge-exposed kittens demonstrated specific antiviral fluorescence. the fluorescent foci were frequently in periportal areas or near the capsule. scattered fipv-positive cells also were in sinusoids. the antiviral fluorescence was observed as diffuse or granular patterns in the cytoplasm of large, pleomorphic mononuclear cells resembling macrophages. infected cells were often around blood vessels, the latter frequently dilated veins or small arteries. fipv-positive mononuclear cells were occasionally within the lumen, attached to the intimal surface or loosely scattered within or around the adventitia of hepatic blood vessels. the fipv antigens were also detected extracellularly in areas of necrosis infiltrated by polymorphonuclear leukocytes (pmn) and fluorescent mononuclear inflammatory cells. specific antiviral fluorescence was not observed in liver sections from nonchallengeexposed control kittens. kittens experimentally infected with fipv developed increased plasma levels of the inflammatory mediators ltb and pge during the disease. circulating levels of ltb the pathophysiologic responses of animals to aa metabolites (including ltb or pge ), viz increased vascular permeability, vasodilatation, chemotaxis for neutrophils or monocytes, lysosomal enzyme release and the production of fever (piper, ; parker, ; wolfe & coceani, ) are consistent with several pathologic findings observed in the fipv-infected kittens. major cellular sources of pge and ltb are macrophages and neutrophils (parker, ; gerrard, b) , cell-types which predominate in fip lesions (weiss & scott, b) . the findings in this study and in a previous study (weiss & scott, ~) of perivascular edema and infiltrating pmn and fipvinfected macrophages around blood vessels, suggest that local mediator release plays a role in the pathogenesis of fip lesions. synthesis by and release of pge or ltb (or both) by perivascular and migrating macrophages and neutrophils could ( ) mediate vascular permeability changes, resulting in edema and peritoneal or pleural effusions; and ( ) provide additional chemotactic stimuli for neutrophils and monocytes. seemingly, a vicious cycle might ensue, in which these inflammatory mediators are released from infected or other cells and attract more pmn and viral target cells (viz macrophages). the migrating cells may themselves release additional mediators and also cell-damaging lysosomal enzymes and toxic metabolites of oxygen (free radicals), includ- figure scattergram of plasma pge levels and rectal temperatures in fipv challengeexposed kittens. a correlation between pge levels and rectal temperature was not observed. y = - . x + . ; r = . ; p>o. . ing superoxide, hydrogen peroxide, and hydroxy radical (parker, ) . the net result would be enhanced local virus production and increased tissue damage. although vascular lesions, and possibly the pathologic effusions, in fip are believed to occur via immunological (antibody-mediated) mechanisms (pedersen, ; august, ; weiss & scott, b; c) , the occurrence of fever and increased plasma levels of ltb and pge prior to detectable antibody responses in some fipv-infected kittens suggest that nonimmunological factors can be involved in some disease manifestations. the immune system, certainly, could amplify initial pathophysiologic responses to fipv by generating circulating c-activating immune complexes (jacobse-geels et al., ) or by promoting local cell-mediated reactions and release of lymphokines and other enzymatically-active factors (pedersen, ) . the release of certain c fragments, particularly c a and c a, can be associated with several vascular effects related previously to aa metabolitas, ie increased vascular permeability, granule enzyme release and pmn ehnatmis (parker, ) . indeed, c tiapiments can aiso he synthesized ia mrrerephages (koj, @; caltan, %) . other investigators have r&c? reported early increases in serum c levels aft.er expeerimaatal fipv infection (jac~bse~gwls df al ). some af the pathologic changes daseribed in this study may in fact be due to c-activation. it is likely, however, that early vascular disturbances retiect the release of multiple acute phase (ap) proteins, including aa metabolites, c fragments il- and enzymes from infected macrophages or other cells. thus, local production of ap proteins by macrophages could provide the initial host response to virus invasion. a positive correlation was found in the present study between plasma ltb levels and temperature responses in fipv-infected kittens. although pge or monocyte-derived il-l has been associated with the general febrile response (wolfe & coceani, ; cebula et al., ) , there are presently no reports of ltb involvement in the pathogenesis of fever. apparently, the initial step in the pathogenesis of infectious fever is interaction of the pathogen with monocytes or macrophages and, subsequently, elaboration and release of endogenous pyrogen, believed to be il-l (cebula ef al., ) . indeed, stimulated peritoneal exudate cells from cats with spontaneous fip produce significant amounts of il-l (goitsuka et al., ) . although il-l may stimulate pge secretion by macrophage-like cells situated in or near hypothalmic thermoregulatory centers (stitt, ) ) it is not presently known whether endogenous or exogenous ltb is capable of mediating fever. to show this, the ltb might have to be inoculated directly into the cerebral vasculature, since blood levels of other molecules such as pge may not reach the hypothalamus in sufficient quantities to produce fever directly (gerrard, %) . the early fever in fip could also be mediated by interferon (ifn) which, like pge , ltb or c fragments, may be released by macrophages (stewart, ) . fipv induces increased levels of circulating ifn in kittens within days after experimental infection (weiss, unpublished data, ) . apparently, the synthesis of pge is enhanced by ifn, particularly during virus infections which induce ifn (stringfellow & brideau, ) . possibly, local ifn-stimulated synthesis and release of pge from brain macrophages could stimulate hypothalamic cells to generate febrile responses (stitt, ) . in addition to the proinflammatory effects of pge , the latter may directly enhance the replication of certain viruses and also suppress in vitro cytotoxic, suppressor and natural killer cell activities (parker, ; gerrard, ~) . some authors suggest that endogenous macrophage-derived pge may block critical immunoregulatory and antiviral actions mediated by ifn (stringfellow & brideau, ) . if this indeed occurs, viruses like fipv which infect and damage macrophages may enhance their survival by promoting release of biochemically-active molecules which suppress early host antiviral and protective immune responses. future studies are needed to define the roles (and interactions) of aa metabolites, ifn and the c-system in fip pathogenesis and immunity. feline infectious peritonitis: an immune-mediated coronaviral vaculitis current veterinary therapy viii: small animalpractice synthesis of four endogenous pyrogens by rabbit macrophages biosynthesis of complement prostaglandins and leukotrienes: blood and vascular cell function prostaglandins and leukotrienes: blood and vascular cell function prostaglandins and leukotrienes: blood and vascular cell function release of interleukin- from peritoneal exudate cells of cats with feline infectious peritonitis responses of connective and other tissue and cell types to injury-derived factors feline infectious peritonitis: diagnostic gross and microscopic lesions isolation and characterization of feline c and evidence for the immune complex pathogenesis of feline infectious peritonitis antibody, immune complexes and complement activity. fluctuations in kittens with experimentally induced feline infectious peritonitis the acute-phase response to injury and injection extraperitoneal lesions in feline infectious peritonitis mediators: release and function immunologic phenomena in the effusive form of feline infectious peritonitis feline infectious peritonitis and feline enteric coronavirus infections. part : feline infectious peritonitis attempted immunization of cats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus feline infectious peritonitis formation and actions of leukotrienes mediators of immunity: lymphokines and monokines meningo-encephalitis and panophthalmitis in feline infectious peritonitis the interferon system prostaglandin e as the neural mediator of the febrile response interferon : znterferons and the immune system pathogenesis of feline infectious peritonitis: nature and development of viremia pathogenesis of feline infectious peritonitis: pathologic changes and immunofluorescence antibody-mediated enhancement of disease in feline infectious peritonitis: comparisons with dengue hemorrhagic fever feline infectious peritonitis. review of gross and histopathologic lesions the role of prostaglandins in the central nervous system publication no from the college of veterinary medicine, auburn university, al, usa.the authors thank chiradath satjawatcharaphong, susan strickland and atoska studdard for technical assistance. key: cord- - z qxz authors: harun, mohammad syamsul reza; kuan, choong oi; selvarajah, gayathri thevi; wei, tan sheau; arshad, siti suri; bejo, mohd hair; omar, abdul rahman title: transcriptional profiling of feline infectious peritonitis virus infection in crfk cells and in pbmcs from fip diagnosed cats date: - - journal: virol j doi: . / - x- - sha: doc_id: cord_uid: z qxz background: feline infectious peritonitis (fip) is a lethal systemic disease, caused by the fip virus (fipv); a virulent mutant of feline enteric coronavirus (fecv). currently, the viruses virulence determinants and host gene expressions during fipv infection are not fully understood. methods: rna sequencing of crandell rees feline kidney (crfk) cells, infected with fipv strain – at hours post infection (h.p.i), were sequenced using the illumina next generation sequencing approach. bioinformatic’s analysis, based on felis catus x annotated shotgun reference genome, using clc bio genome workbench mapped both control and infected cell reads to genes out of annotated genes. kal’s z test statistical analysis was used to analyse the differentially expressed genes from the infected crfk cells. real time rt-qpcr was developed for further transcriptional profiling of three genes (pd- , pd-l and a h) in infected crfk cells and peripheral blood mononuclear cells (pbmcs) from healthy and fip-diseased cats. results: based on kal’s z-test, with false discovery rate (fdr) < . and > . fold change on gene expressions, a total of genes were differentially expressed by both samples, where genes were up-regulated and the remainder were down-regulated. most genes were closely clustered together, suggesting a homogeneous expression. the majority of the genes that were significantly regulated, were those associated with monocytes-macrophage and th cell functions, and the regulation of apoptosis. real time rt-qpcr developed focusing on up-regulated genes (pd-l and a h) together with an apoptosis associated gene pd- expressions in fipv infected crfk cells and in pbmcs from healthy and fip diagnosed cats produced concordant results with transcriptome data. conclusion: the possible roles of these genes, and their importance in feline coronaviruses infection, are discussed. feline coronaviruses are enveloped, positive sense rna viruses that can be classified into two biotypes, namely low virulent feline enteric coronavirus (fecv) and highly virulent feline infectious peritonitis virus (fipv). fecv is very common in the cat population worldwide, and has been shown to have infected - % pet cats and shed by - % cats in multi-cat environments [ , ] . of those shedding the virus, - % will develop feline infectious peritonitis (fip) disease [ ] . within the biotypes, the viruses are differentiated further into serotype i and serotype ii, based on virus neutralizing antibodies. type i fecv and fipv strains are more ubiquitous worldwide and are more likely to cause clinical fip, while type ii strains are less common, but more adaptable to cell culture [ ] . it has been suggested that fipv, the causative agent for fip, is a mutant form of fecv [ , ] ; where several possible nature of mutation responsible for the increase in virulence has been characterized. studies have shown that several mutations throughout the fipv genome were detected, but mutations at c membrane protein and b secretory glycoprotein genes were suggested to be responsible for transforming fecv to fipv [ , ] . a recent study revealed that mutation of the s /s locus and modulation of a furin recognition site normally present in the s gene of fecvs is a critical contributing factor for development of fip [ ] . furthermore, it was found that fipv infection is associated with t cell depletion by apoptosis; although the virus cannot infect cd + and cd + t cells [ , ] . therefore, apoptosis of cd + and cd + t cells is probably caused by mediators from infected macrophages and/or intestinal epithelial cells [ , ] . hence, little is known about the interaction of the virus and host cells; especially the early cellular transcriptional responses towards virus infection, virus mechanism of inducing t cell apoptosis, and the absence of cell-mediated immunity (cmi) response in fip infected cats. the use of a next generation sequencing approach in rna sequencing has facilitated understanding in defining the expression profiles of cellular responses during pathogen infections. this method has been proven to be helpful in explaining the pathogenesis of various viruses [ , ] , including feline immunodeficiency virus (fiv) infection [ , ] . furthermore, the availability of complete . x of cat genome, using the whole genome shotgun (wgs) approach, provides valuable information for the bioinformatic's analysis of feline host responses, following pathogen infection. moreover, the cat genome contigs were aligned, mapped, and annotated to ncbi annotated genome sequence of six index mammalian genomes (human, chimpanzee, mouse, rat, dog, and cow) using megablast [ ] . previous study has shown that more than % of fipv strain - were internalized by crfk cells at hours post infection [ ] . hence, in this study, mrna from crfk cells infected with fipv strain - at h.p.i were sequenced using illumina next generation sequencing technology. the generated data was then analyzed using clc bio genomic workbench, where the genes were compared to felis catus . x annotated shotgun reference genome. kal's z-test on expression proportions [ ] was used to determine significantly expressed genes. genes expressed with a false discovery rate (fdr) < . and > . fold change were considered for further analysis. overall, the trimmed sequence reads match to , annotated transcripts; where only ( . %) were statistically significant (kal's z test, p < . ), and out of the significant matched, only ( . %) transcripts were expressed with fold absolute change of or more. of these transcripts, ( . %) were up-regulated and the remainder were down-regulated. after blast analysis, up-regulated transcripts were matched to genes while down-regulated transcripts were matched to genes. of the up-regulated genes, there were transcripts per gene for genes, but only one transcript per gene for the remaining genes. meanwhile, of the down-regulated genes, there was one transcript per gene for genes and transcripts per gene for genes. as shown in figure , the rpkm of control samples was plotted against the rpkm of infected samples; and as such, genes with equal expression will line-up on the diagonal identity line while genes with different expression values will either be over or under the diagonal line. the further away the point is from the identity line, the larger is the difference between its expressions in one experiment compared with the other. except for genes (mx , rsad , plin , and serpinb ), most genes from both samples were closely clustered together, thus suggesting a homogeneous expression. the plot excluded genes (ccl , rnf , and rpl ) that had infinite fold change expressions. table shows the top up-regulated genes (in decreasing order) and their functions. the majority of the genes were those associated with immune response, while the remainder were associated with apoptosis, cell cycle, cytokine, and ubiquitination activities. furthermore, there were also interferon stimulated genes (isgs) coded for proteins (rsad , a c, a h, mda , ifi , and mx ) that were involved in inhibiting viral entry, replication, and production. interestingly, one gene (pd-l ), which negatively regulates immune response in viral infection, was also found to be highly up-regulated. meanwhile, the majority of the down-regulated genes were involved in pro-inflammatory cytokine's activation, cmi, and anti-apoptosis activities ( table ) . two unique downregulated genes (rnf and rpl ) were found to be expressed in control uninfected cells only, where the former had anti-apoptotic effect and the latter translated rna to protein. three host genes (a h, pd- , and pd-l ) were selected for real-time rt-qpcr analysis, because they were highly up-regulated and may play important roles during fipv induced disease; judging by their functions. a h was involved in viral rna and dna editing, causing mutation, while pd- and its ligand (pd-l ) were involved in programmed cell death that was associated with negative regulation of immune response. comparisons of fold change results of real-time pcr and transcriptome study for a h and pd-l genes revealed almost similar levels of fold changes. the transcriptome resulted in . and . fold change for transcripts of a h while real-time pcr resulted in . ± . fold changes (tables and ) . meanwhile, transcriptome resulted in . and . fold changes for transcripts of pd-l gene while real-time pcr resulted in . ± . fold changes. in the case of the pd- gene, rna sequencing was unable to detect the gene expression, due to low coverage (i.e., data not shown), although real-time pcr was able to detect an up-regulation of the gene at h.p.i. fipv induced high and exceptionally high a h expression at and h.p.i. respectively, but from to h.p.i., the gene was down-regulated. fipv infected cells also showed high up-regulation of pd- expression at h.p.i. and moderately up-regulated at h.p.i but were being down-regulated at , , and h.p.i. meanwhile, pd-l gene was consistently down-regulated from hours to h.p.i. peripheral blood mononuclear cells (pbmcs), obtained from cats with clinical signs associated with fip (table ) , were purified and analysed with real-time pcr. in general, all of the fip diagnosed cats expressed the pd- and pd-l genes more than folds, while only cats expressed a h gene more than folds ( table ). the highest expression fold for a h, pd- and pd-l genes was detected from cat no. at . ± . , . ± . , and . ± . fold changes, respectively. meanwhile, cat no. showed less fold changes of the genes compared to the other fip diagnosed cats. the pathogenesis of feline coronavirus infection is unclear. the reference feline genome sequence assembly of transcriptome analysis of early infection ( h.p.i.) of crfk cells with fipv - showed that the expressions of transcripts ( . % of the trimmed annotated) were statistically significant, based on kal's z test. only transcripts, which consisted of up-regulated genes and down-regulated genes, were expressed with fold absolute changes of or more. since only one sample per group was analysed, kal's z test was used to determine the significant differences in the expression profiles. study has shown that this test evaluates single sample against another single sample where each group in an experiment has only one sample [ ] . this test is based on an approximation of the binomial distribution by the normal distribution considering proportions figure scatter plot of control rna-seq rpkm versus infected rna-seq rpkm of significant transcripts (p < . ) with absolute fold change value of or more. most genes from both samples are closely clustered except for genes label to . and are mx transcripts and , respectively, and = rsad transcripts and , respectively, = plin and = serpinb . rather than raw counts so that it can be used reliably on libraries of different size. the transcriptional profiles of selected genes in fipv in vitro infected cells, as well as cats diagnosed with fip, were explored. the expressions of a h, which involved in viral rna and dna editing causing mutation during rna virus infection [ ] and pd- and its ligand (pd-l ), which are involved in programmed cell death and negative regulation of t cells immune response [ ] , were characterised. a h has antiretroviral activity by generating lethal hypermutations in viral genomes and is associated with increased resistance to hiv- infection in certain populations [ ] . in the case of felines, a h (but not a c) has been found to reduce the infectivity of feline leukemia virus [ ] . it is interesting to detect that the expression of a h is readily expressed at higher levels in pbmcs than in fipv infected cells (tables and ), indicating the possible involvement of the gene in antiviral activity. furthermore, the up-regulation of the gene is less, compared to pd- and pd-l in fipv diagnosed cats. in addition, the expressions of a h are significantly up-regulated in fipv infected crfk cells at h.p.i. the actual reason for this high expression of a h is unclear, but suggests that this gene is essential in restricting viral replication or forming part of the type interferon-induced innate response, since recent study has indicated the involvement of a h in restricting virus replication [ , ] . our results show that up-regulation of pd- and pd-l gene's expression in pbmcs occurred in cats diagnosed with the fip disease. in general, their expressions are correlated to each other. similar patterns were also observed in chronic fiv infection [ ] and in hiv infection in humans [ ] ; where they were associated with increasing immune dysfunction and t cell depletion. previous studies have shown that although fipv cannot infect cd + and cd + t-cells [ ] , cats infected with the virus showed t cell depletion by apoptosis resulting in an acute immunodeficiency [ ] . hence, we hypothesized that pd-l could be a mediator that mediates apoptosis of cd + and cd + t-cells, since its expression is found in a wide range of nonhematopoietic cells [ ] . furthermore, the blockade of pd-l expression was found to enhance t cell immunity and cytokine production [ ] . nevertheless, more studies are required to confirm our hypothesis. it has been established that cats infected with fipv undergo extensive tissue destruction due to inflammatory reaction [ ] . even though the study was performed on infected crfk cells, a kidney epithelial cells, it is interesting to note that transcriptome analysis of cells proposed that the inflammation process was associated with proinflammatory and th -like cytokines production, due to the up-regulation of several chemokine genes, such as ccl , cxcl , and ccl ; and genes associated with innate immune responses, such as phf , atf , and irf . further study on infection of fipv in particularly type i fipv on macrophage-like cells namely fcwf- cells and samples from fip diagnosed cats will add more value to our findings. furthermore, the down-regulation of crip (a t helper regulatory gene) ( table ) also suggests that fipv infection is associated with th response, based on a study on crip gene in mice, transgenic mice, and in murine cell line [ ] . in that study, they found that the down-regulation of crip was associated with the expression of il- , ifn-γ, and tnfα. previous studies have shown that in vitro and in vivo fipv infections were associated with tnf-α and ifn-γ expressions [ , ] . based on previous studies on the growth of fipv - in crfk cells, production of progeny virus start between and hours post inoculation and increased rapidly until hours post inoculation [ ] . in our study, we found that at hours, a few complete virus genomes that completely aligned to fipv - reference genome sequence (data not shown) has already been assembled. mx expression was up-regulated in fipv infection (table ) , similar to other rna virus infections, its role in fip pathogenesis is still unclear and requires further investigation. previous studies have shown that the expression of mx gene inhibits viral replication during various rna virus infections [ , ] . early in vitro fipv infection is also associated with a marked increase in the expression of rsad (radical sadenosyl methionine domain-containing protein ) also known as viperin (table ) . previous studies have shown viperin involvement in inhibiting viral rna and/or protein synthesis during different virus infections, such as the west nile virus, dengue virus, and hepatitis virus [ , ] . hence, further study is required to define the role of viperin in fipv replication and infection. serine proteinase inhibitor clade b member (serpinb ) is the only gene that was markedly down-regulated (table ) . serpinb functions as an inhibitor of the neutrophil serine proteases, found at inflammatory sites where the inhibition of the gene prevents tissue destruction by phagocytic cells during the virus clearance process by infiltrating neutrophils and monocytes [ , ] . thus, serpinb down-regulation could possibly be part of innate immune response in recruiting phagocytic cells for the proteolytic destruction of infected cells. besides genes that modulate t cell functions, several genes with proapoptotic and/or anti-apoptotic are also differentially regulated; thus highlighting their functions in regulating the apoptosis of virus infected cells (additional file : table s and additional file : table s ). however, the pro-apoptotic gene yap- or yap- , which was found up-regulated in fiv infection in crfk cells [ ] , was not up-regulated in this study. in conclusion, this present study has described the transcriptional profiles of cellular genes in vitro system can be applied to an in vivo situation and the possible involvement of a h, pd- , and pd-l genes during fipv infection. however, further studies are required to elucidate the roles of these genes, and their interactions with other genes, during fipv replication and infection especially in in vivo model. monolayers of crandell rees feline kidney (crfk) cells (atcc® no. ccl- ™) were grown in a base media consisting of minimum essential medium (mem), % fetal bovine serum (fbs), % penicillin and streptomycin, % amphotericin b, and non-essential amino acids at °c and % co . for transcriptome study, crfk cells were infected with fipv - (atcc® no. vr- ™) at a multiplicity of infection (moi) of . the virus was incubated for one hour for virus attachment. after incubation, % fbs mem was added and the cells were incubated for a further hours. at the end of incubation, the cells were harvested using tryple™ and centrifuged twice in a pbs at °c for minutes at rpm. cell pellets were stored at − °c until rna extraction. for the control sample, the same process was applied, with the exception that ml of sterile pbs was used to replace the virus. an rneasy® mini kit (qiagen®, usa) was used to extract and purify rna samples as per the methods recommended by the manufacturer. the quality of the extracted rna was determined by an ultrospec pro uv/visible spectrophotometer (ge healthcare, uk), where samples with an absorbance ratio value (a / a ) of . to . were considered for further analysis with an agilent® bioanalyzer. samples with rna integrity numbers (rin) to , and concentrations higher than ng/μl per sample, were sent for illumina gaii sequence analysis. a total of . gb of sequencing data, comprised of both control and infected samples, was imported into the clc bio genomic workbench (gwb). the sequences were trimmed for adapter sequences and low quality base. the trimmed raw sequences were subjected to rna-sequence analysis, by mapping them to an annotated feline genome reference sequence [ ] accounting for a maximum of two gaps or mismatches in each sequence. unpaired group comparisons, based on reads per kilo base per million (rpkm) [ ] , were chosen as expression values for comparison. kal's z test statistical analyses, based on false discovery rate (fdr) < . and fold change > . were used to filter the expressed transcripts. the resulting list was then blast at ncbi servers (http://www.ncbi.nlm.nih.gov/) using gwb's builtin blast (blastn, refseq_rna or nr databases, mammals only). homologous sequences with the lowest e-value, highest score, and lowest percentage of gaps to the query sequence, was selected as the transcript identity. in order to validate the transcriptome results, the expression profiles of genes (a h, pd- , and pd-l ) were analysed using real-time pcr. briefly, viral rna from fipv strain - infected crfk cells at , , , , , and hours post infection (h.p.i.) were collected and processed as described previously. control cells, inoculated with pbs only, were used as a control. primers were designed using primer-blast (http://www.ncbi.nlm. nih.gov/tools/primer-blast/) and synthesized by aitbiotech pte ltd (singapore) ( table ). the reactions were performed using sensifast™ sybr no-rox one step kit (bioline ltd, uk) on bio-rad cfx ™ real-time system, with c ™ thermal cycler (bio-rad laboratories, usa). briefly, the reaction mixture of μl contained μl × sensifast sybr no-rox one-step mix, . μl forward & reverse primers ( nm for gadph, pd-l and a h, nm for pd- and nm for ywhaz), . μl rt, . μl ribosafe rnase inhibitor, . μl h o, and μl extracted rna. the rt-qpcr reaction conditions were as follows; one cycle at °c for mins, one cycle at °c for mins, and cycles at °c for secs; then °c (ywhaz), °c (pd-l ), °c (gapdh), °c (a h), and °c (pd- ) for secs; and finally, at °c for secs. one cycle for the dissociation curve for all reactions was added and melting curve analysis was performed. data generated from the technical triplicate experiment was analysed with -ΔΔct method [ ] using bio-rad cfx manager version . . gapdh and/or ywhaz genes were chosen as reference genes, based on previous studies [ , ] . besides fipv infected cell cultures, peripheral blood mononuclear cells (pbmcs) were also used to analyse the transcriptome results. six fip diagnosed domestic short hair breed cats, with ages ranging from months to adult, that were admitted to university veterinary hospital, upm, were considered for this study ( table ). the cats tested negative for felv and fiv antibodies, but positive for fcov antibodies, and showed abdominal/pleural effusion. meanwhile, healthy cats, with negative results for fcov, felv, and fiv antibodies, were selected as controls. the kits for fcov, felv and fiv antibody tests originated from biogal's feline coronavirus (fcov) [fip] immunocomb® antibody test kit (biogal galed laboratories, usa) and idexx's snap® combo felv ag/fiv antibody test kit (idexx laboratories, usa), respectively. the tests were performed as per the methods recommended in their respective manuals. the health assessment and blood collection of the cats were performed by a trained and certified veterinarian (gts). the sampling were performed according to internationally recognized guidelines and recommended by the animal care and use committee at the faculty of veterinary medicine, universiti putra malaysia. two to ml of cat blood was drawn and stored at °c in bd vacutainer® (bd usa) edta-k tubes. parts of the blood were used for the test kits, while the rest was processed for pbmcs extraction. pbmcs were isolated using the ficoll-paque™ plus (ge healthcare, usa) method, according to the manufacturers protocol. total rna from pbmcs was isolated using an rneasy mini plus kit (qiagen, germany), as described by the manufacturer. rna quantity and purity was measured and assessed using a nanodrop nanophotometer p-class (implen gmbh, germany). the isolated rna samples were either kept at − °c for further analysis, or immediately used for real-time rt-qpcr analysis. additional file : table s . list of transcripts from up regulated genes with proportions fold change of or more (kal's z test, fdr < . ) with their blast results, ncbi accession number and gene product function. table s . list of transcripts from down regulated genes with proportions fold change of − or more (kal's z test, fdr < . ) with their blast results, ncbi accession number and gene product function. prevalence of feline coronavirus in two cat populations in malaysia a review of feline infectious peritonitis virus infection: - feline infectious peritonitis the molecular genetics of feline coronaviruses: comparative sequence analysis of the orf a/ b transcription unit of different biotypes feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses mutation in spike protein cleavage site and pathogenesis of feline coronavirus natural history of a recurrent feline coronavirus infection and the role of cellular immunity in survival and disease apoptosis and t-cell depletion during feline infectious peritonitis a "possible" involvement of tnf-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis kinetic analysis of a complete poxvirus transcriptome an immediate early class of gene hepatic transcriptome analysis of hepatitis c virus infection in chimpanzees defines unique gene expression patterns associated with viral clearance gene-expression changes induced by feline immunodeficiency virus infection differ in epithelial cells and lymphocytes viral transcriptome analysis of feline immunodeficiency virus infected cells using second generation sequencing technology a greedy algorithm for aligning dna sequences attachment and internalization of feline infectious peritonitis virus in feline blood monocytes and crandell feline kidney cells dynamics of gene expression revealed by comparison of serial analysis of gene expression transcript profiles from yeast grown on two different carbon sources functions, structure, and read-through alternative splicing of feline apobec genes increased pd-l expression and pd-l /cd ratio on dendritic cells were associated with impaired dendritic cells function in hcv infection polymorphism in human apobec h affects a phenotype dominant for subcellular localization and antiviral activity reduced apobec h variant antiviral activities are associated with altered rna binding activities feline programmed death and its ligand: characterization and changes with feline immunodeficiency virus infection upregulation of pd- expression on hiv-specific cd + t cells leads to reversible immune dysfunction pd- and its ligands in tolerance and immunity blockade of programmed death- ligands on dendritic cells enhances t cell activation and cytokine production regulation of cysteine-rich intestinal protein, a zinc finger protein, by mediators of the immune response cellular composition and interferon-γ expression of the local inflammatory response in feline infectious peritonitis (fip) replication of feline coronaviruses in peripheral blood monocytes andes virus stimulates interferon-inducible mxa protein expression in endothelial cells west nile virusinduced cytoplasmic membrane structures provide partial protection against the interferon-induced antiviral mxa protein identification of five interferon-induced cellular proteins that inhibit west nile virus and dengue virus infections analysis of isg expression in chronic hepatitis c identifies viperin as a potential antiviral effector the neutrophil serine protease inhibitor serpinb protects against inflammatory lung injury and morbidity in influenza virus infection serpinb protects the mature neutrophil reserve in the bone marrow akt phosphorylates the yes-associated protein, yap, to induce interaction with - - and attenuation of p -mediated apoptosis the ucsc felcat data from the dec. catchrv e draft assembly mapping and quantifying mammalian transcriptomes by rna-seq analysis of relative gene expression data using real-time quantitative pcr and the (−delta delta c(t)) method a validation of feline reference genes for gene expression measurements in snap-frozen tissues quantitative taqman® real-time pcr assays for gene expression normalisation in feline tissues submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution the authors wish to thanks laboratory personnel at virology lab, faculty of veterinary medicine, upm and laboratory of vaccines and immunotherapeutics, institute of bioscience, upm. this project is funded by fundamental research project no: - - - fr, ministry of higher education malaysia. the funding source has no role in this study. the authors declare that we have no competing interests. msrh & cok -cell culture works; virus inoculation; rna extraction, purification and quantification; rt-qpcr assays; bioinformatic analysis; data analysis and interpretation; wrote the manuscript. gts -diagnose cats; collect blood samples from cats with fip symptoms; perform fcov, fiv and felv kit tests. tswhelps with pcr; primers design; rt-qpcr assays and data analysis. ssa, mhb & arosecure & manage fundings; coordinated the project; designed experiments and collaborated in analyzing data and writing the manuscript. all the authors have read and approved the final manuscript.