key: cord-283895-1p5uog38 authors: Trottier, J.; Darques, R.; Ait Mouheb, N.; Partiot, E.; Bakhache, W.; Deffieu, M. S.; Gaudin, R. title: Post-lockdown detection of SARS-CoV-2 RNA in the wastewater of Montpellier, France date: 2020-07-09 journal: nan DOI: 10.1101/2020.07.08.20148882 sha: doc_id: 283895 cord_uid: 1p5uog38 The evolution of the COVID-19 pandemic can be monitored through the detection of SARS-CoV-2 RNA in sewage. Here, we measured the amount of SARS-CoV-2 RNA at the inflow point of the main waste water treatment plant (WWTP) of Montpellier, France. We collected samples 4 days before the end of lockdown and up to 45 days post-lockdown. We detected increased amounts of SARS-CoV-2 RNA at the WWTP, which was not correlated with the number of newly diagnosed patients. Future epidemiologic investigations may explain such asynchronous finding. SARS-CoV-2 is the etiologic agent responsible for the current coronavirus disease 2019 pandemic. Wastewater-based epidemiology represents an attractive strategy to surveil the evolution of virus circulation in populations , Carducci et al., 2020 , contributing to costeffective virus control without infringing on individual liberties. About half of symptomatic patients shed SARS-CoV-2 RNA in their stools, with persistent fecal viral shedding reported (Chen et al., 2020 . Recently, an asymptomatic child was reported as negative for SARS-CoV-2 RNA based on throat swab specimen, while his stools were positive , suggesting that symptomatic and asymptomatic persons are likely to release SARS-CoV-2 RNA in city sewerages. Indeed, several reports indicate that SARS-CoV-2 RNA was readily detected in wastewater, and it is proposed that such approach could anticipate the occurrence of novel COVID-19 outbreaks in low prevalence regions , La Rosa et al., 2020 , Medema et al., 2020 , Orive et al., 2020 , Randazzo et al., 2020 . The end of the stringent lockdown (that occurred in France on May 11 th ) is therefore an adequate time to measure the re-emergence of the virus through the monitoring of wastewater. Here, we collected effluent composite samples (using a 24-hour automatic sampler) in waste water upstream of the main waste water treatment plant (WWTP) of Montpellier metropolitan area located in Lattes, France. The sampling dates were May 7 th , 18 th , 26 th , June 4 th , 15 th and 25 th , to monitor SARS-CoV-2 RNA expression levels during lockdown and up to 45 days after its end. At this time, the virus was still circulating in the area, but the incidence was low (number of newly diagnosed COVID-19 patients per day < 20). Collected wastewater was processed as follows: on the day of water collection, samples were maintained at 4°C for transport and immediately cleared by centrifugation at 4500 g for 30 min at 4°C. The supernatant was passed through a 40 µm cell strainer (Corning) to remove large floating components. At this stage, the samples were frozen at -20°C for later analyses with samples collected at other timepoints. Upon thawing, RNAs were concentrated on a Vivaspin 50 kDa MWCO filter membrane (Sartorius). Starting from 50 ml of water, the sample was concentrated down a hundred times to an adjusted volume of 500 µl. RNA extraction using the NucleoSpin RNA Virus kit (Macherey-Nagel) and RT-qPCR was performed on 10 µl of purified RNA using the TaqPath One-Step RT-qPCR, CG master mix (ThermoFisher Scientific). The N1 and N3 primer/probe sets designed by the center for disease control (CDC) were used to detect SARS-CoV-2 RNA and a standard curve was run in parallel using a positive control plasmid (Integrated DNA Technologies) coding for the nucleoprotein (N) of SARS-CoV-2. Using RNA extracted from Vero E6 cells either non-infected or infected with SARS-CoV-2 in vitro, we showed that the N1 and N3 primer/probe sets recognized solely the RNA from infected cells (Table 1) . A recent study used a Dengue virus (DENV) sequence surrogate to determine PCR efficiency (Medema et al., 2020) but in Montpellier area, this approach would be risky, as autochthonous DENV infections have been repeatedly reported in the south of France (European Centre for Disease Prevention and Control). In order to determine the RT-qPCR efficiency intrinsic to each sample, we used a sensitive primer/probe set previously described (Ro et al., 2017 ) that target the VP40-encoding RNA of Ebola virus (Zaire strain). First, we showed that the Ebola standard (Ebo Std) primer/probe set was not detecting RNA from SARS-CoV-2-infected Vero E6 cells (Table 1) . Using water samples from upstream WWTP of the Montpellier metropolitan area collected on June 15 th , we found that the Ebo Std primer/probe set gave no signal while the primer/probes N1, N3, and RLP27 (targeting the human rlp27 gene) returned positive signals (Table 1) . . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprint this version posted July 9, 2020. . https://doi.org/10.1101/2020.07.08.20148882 doi: medRxiv preprint nucleotides (gcagaucgaauccacucaggccaaucuauggugaaugucauaucgggccccaaagugcuaaugaaguuuggcuuccucuaggugu cggcag) derived from the VP40-coding gene of Ebola virus and recognized by the above-mentioned Ebo Std primer/probe set was purchased (Integrated DNA Technologies) to be used as an internal normalization standard. Standard curves were run using the N control plasmid (N1 and N3 primer/probe sets) or the Ebo Std RNA (Ebo Std primer/probe set) to estimate copy numbers ( Figure 1 ). Of note, the Ebo Std primer/probe set was less sensitive than N1 and N3, probably because the Ebo Std synthetic template RNA is relatively fragile and short (91 nucleotides). Next, we evaluated the relative efficiency of RNA extraction and RT-qPCR reaction for each sample by adding 10 7 copies of synthetic Ebo Std RNA before RNA extraction. This step allows quantitative comparison of samples collected at different dates. Our data show that RNA extraction and RT-qPCR (RERP) efficiency was marginally affected according to the collection date (Table 2) . Table 2 . RNA extraction and RT-qPCR (RERP) efficiency using Ebo Std. RERP efficiency was calculated by dividing the copy number of Ebo Std RNA measured by RT-qPCR (using the standard curve in Figure 1 ) by the theoretical copy number of synthetic Ebo Std RNA and multiplied by 100. RERP efficency (%) 5/7/2020 13.6 5/18/2020 15.1 5/26/2020 15.8 6/4/2020 12.1 6/15/2020 14.4 6/25/2020 9.73 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprint this version posted July 9, 2020. . https://doi.org/10.1101/2020.07.08.20148882 doi: medRxiv preprint Next, we measured the SARS-CoV-2 RNA levels using N1 and N3 primer/probe sets in wastewater collected upstream of the main WWTP of the Montpellier metropolitan area on May 7 th , 18 th , 26 th , June 4 th , 15 th and 25 th (Figure 2A ). Of note, the Montpellier wastewater network is partially united and thus, we checked that rain precipitation was negligible and would not significantly dilute the samples according to the collection date ( Figure 2B ). Our data highlights that the wastewater from the two later dates (June 15 th and 25 th ) contained more viral RNA than the ones from previous dates (Figure 2A and color-coded in Figure 2C-D) . In contrast, the number of daily COVID-19 patients hospitalized in the Hérault department (> 40% inhabitant living in the Montpellier metropolitan area) and the newly diagnosed patients ( Figure 2E -F) is overall decreasing since April 1 st . From these observations, it seems that there is no direct temporal correlation between SARS-CoV-2 RNA detection in wastewater and the epidemiological features associated with COVID-19, at least on such a short time window. This intriguing result is reminiscent of a recent Spanish study, in which the authors could detect SARS-CoV-2 RNA in wastewater weeks before the first COVID-19 cases were reported (Randazzo et al., 2020) . However, they could not see a correlation between SARS-CoV-2 RNA levels in wastewater and the number of newly diagnosed COVID-19 patients. On the same line, Medema & colleagues showed a correlation between the cumulative cases of COVID-19 and SARS-CoV-2 RNA although the data were not correlated as a function of time (Medema et al., 2020) . In conclusion, we report effective detection of SARS-CoV-2 RNA in the wastewater of Montpellier area upstream of the treatment plant and identified a recent increase of the amount of detected viral RNA. At this stage, we are unable to determine whether this increase is due to an upcoming increase of COVID-19 cases in the area or to intrinsic SARS-CoV-2 RNA variations associated with uneven virus shedding (from patient-to-patient and depending on the stage of the disease for a given patient). Moreover, various other parameters might also impact these results, such as people from distant clusters moving to second homes and tourist accommodation, the chronic underestimation of prevalence rates, or local variability in the geographical pattern of virus spread. Both hypotheses are non-exclusive and future multiparametric investigations are required to better determine whether the monitoring of wastewater could be a powerful predictive tool to future epidemic outbreaks. . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprint this version posted July 9, 2020. . https://doi.org/10.1101/2020.07.08.20148882 doi: medRxiv preprint (A) The number of SARS-CoV-2 RNA copies was measured using either the N1 or N3 primer/probe set. Each dot corresponds to the concentration of SARS-CoV-2 RNA in wastewater measured from the sum of the RNA copy number calculated from two RNA extractions and four RT-qPCR reactions performed in two individual runs. Sterile water wells were included in duplicates for each primer/probe set in each plate as negative control and always returned "No Ct" (not shown on the graph). Of note, the graph does not take into account the RERP efficiency calculated in Table 2 supplied by the National Reference Centre for Respiratory Viruses hosted by Institut Pasteur (Paris, France) and headed by Dr. Sylvie van der Werf. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: A proof of concept for the wastewater surveillance of COVID-19 in the community Making Waves: Coronavirus detection, presence and persistence in the water environment: State of the art and knowledge needs for public health The presence of SARS-CoV-2 RNA in the feces of COVID-19 patients First detection of SARS-CoV-2 in untreated wastewaters in Italy Presence of SARS-Coronavirus-2 RNA in Sewage and Correlation with Reported COVID-19 Prevalence in the Early Stage of the Epidemic in The Netherlands Early SARS-CoV-2 outbreak detection by sewage-based epidemiology SARS-CoV-2 RNA in wastewater anticipated COVID-19 occurrence in a low prevalence area Rapid detection and quantification of Ebola Zaire virus by one-step real-time quantitative reverse transcription-polymerase chain reaction Detection of Novel Coronavirus by RT-PCR in Stool Specimen from Asymptomatic Child Detection of SARS-CoV-2 in Different Types of Clinical Specimens Prolonged presence of SARS-CoV-2 viral RNA in faecal samples Infectious SARS-CoV-2 in Feces of Patient with Severe COVID-19 Characteristics of pediatric SARS-CoV-2 infection and potential evidence for persistent fecal viral shedding We thank Jean Verdier and Nima Machouf for their helpful comments and suggestions, and Yonis Bare for technical assistance. The strain Beta CoV/France/IDF0372/2020 was Funding statement: This work was funded by the CNRS. The funder had no role in the design of the study.