key: cord-303745-wx3udkee
authors: Martinez-Fleta, P.; Alfranca, A.; Gonzalez-Alvaro, I.; Casasnovas, J. M.; Fernandez Soto, D.; Esteso, G.; Caceres-Martell, Y.; Gardeta, S.; Prat, S.; Mateu-Alberoa, T.; Gabrie, L.; Lopez-Granados, E.; Sanchez-Madrid, F.; Rodriguez-Frade, J. M.; Reyburn, H. T.; Vales-Gomez, M.
title: SARS-Cov-2 cysteine-like protease (Mpro) is immunogenic and can be detected in serum and saliva of COVID-19-seropositive individuals
date: 2020-07-18
journal: nan
DOI: 10.1101/2020.07.16.20155853
sha: 
doc_id: 303745
cord_uid: wx3udkee

Currently, there is a need for reliable tests that allow identification of individuals that have been infected with SARS-CoV-2 even if the infection was asymptomatic. To date, the vast majority of the serological tests for SARS-CoV-2 specific antibodies are based on serum detection of antibodies to either the viral spike glycoprotein (the major target for neutralising antibodies) or the viral nucleocapsid protein that are known to be highly immunogenic in other coronaviruses. Conceivably, exposure of antigens released from infected cells could stimulate antibody responses that might correlate with tissue damage and, hence, they may have some value as a prognostic indicator. We addressed whether other non-structural viral proteins, not incorporated into the infectious viral particle, specifically the viral cysteine-like protease, might also be potent immunogens. Using ELISA tests, coating several SARS-CoV-2 proteins produced in vitro, we describe that COVID-19 patients make high titre IgG, IgM and IgA antibody responses to the Cys-like protease from SARS-CoV-2, also known as 3CLpro or Mpro, and it can be used to identify individuals with positive serology against the coronavirus. Higher antibody titres in these assays associated with more severe disease and no cross-reactive antibodies against prior betacoronavirus were found. Remarkably, IgG antibodies specific for Mpro and other SARS-CoV-2 antigens can also be detected in saliva. In conclusion, Mpro is a potent antigen in infected patients that can be used in serological tests and its detection in saliva could be the basis for a rapid, non-invasive test for COVID-19 seropositivity.

202020E079) and grants from Madrid Regional Government "IMMUNOTHERCAN" The identification of the link between a novel beta-coronavirus strain, named 56 Severe Acute Respiratory Syndrome-CoronaVirus-2 (SARS-CoV-2), and a fatal 57 respiratory illness, COVID-19, formally recognised as a pandemic by the WHO on 58 March 11 (1, 2) has led to a rush by health systems all over the world to develop and onset of the disease, information of clinical importance will be produced. Finally, 75 quantitative and qualitative assays of antibody responses can aid in the identification 76 of factors that correlate with effective immunity to SARS-CoV-2, the duration of these 77 immune responses and may also aid in the selection of donors from whom 78 preparations of convalescent serum/plasma can be generated for therapeutic use. 79 Multiple antibody tests to detect exposure to SARS-CoV-2, are becoming available. 80 The majority of these assays have been optimised to detect immunoglobulin G (IgG) 81 and, in some cases, IgM antibodies using different viral antigens, being the Spike (S) 82 protein and the nucleoprotein of SARS-CoV-2 the more widely used (6, 7). These 83 proteins are key elements of the viral particle and are expected, by analogy with other 84 coronaviruses, to be highly immunogenic. However, the immunogenicity of other viral 85 proteins, 28 are encoded in the viral genome, has been little explored. Here we have 86 studied the antibody response to the main viral protease (Mpro, or 3CLPro) elicited 87 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020 . . https://doi.org/10.1101 after viral infection. Although this protein is not exposed in the viral particle, Mpro 88 carries out a critical role in viral replication. Like other beta-coronaviruses, SARS-CoV-89 2 is a positive-sense RNA virus that expresses all of its proteins as a single polypeptide 90 chain and Mpro cleaves the 1ab polyprotein to yield the rest of the mature proteins of 91 the virus. Since this activity is essential for the viral life cycle, Mpro structure and 92 function has been studied intensively (8); in particular, Mpro has been suggested as a 93 target for specific inhibitors that might act as potent anti-viral agents (9). However, to 94 our knowledge, no study on the antigenicity of this protease has been reported. 95 To increase the possibilities of diagnosing COVID-19 patients, here we report the 96 use of an ELISA test involving the assay of sero-reactivity to three different SARS-97 CoV-2 antigens, including the protease Mpro. These data demonstrate that individuals 98 who have been infected with SARS-CoV-2 make high titre antibody responses to Mpro 99 and that assays for seroreactivity to this protein sensitively and specifically 100 discriminate between infected and non-infected individuals. Further, while most 101 available tests assess for SARS-CoV-2-specific IgM and IgG antibodies, here, we also 102 explored the presence of IgA antibodies in the sera tested. While, in general, assays 103 for IgM antibodies resulted in a high background that limited the sensitivity of the 104 ELISA, testing for IgA seropositivity provided very clean data, with low background 105 and high signal, therefore providing a very good tool to complement IgG assays. 106 Interestingly, considerable significant amounts of IgA antibodies specific for MPro, as 107 well as the Receptor Binding Domain (RBD) and NP, were also frequently found in 108 serum of COVID-19 infected individuals and the amounts of IgA and IgM antibodies 109 could be related with disease severity.

110 Surprisingly, IgG antibodies specific for SARS-CoV-2 antigens were also readily 111 detectable in the saliva of these patients and, in this case, the titre of protease-specific 112 antibodies was higher than for the other two proteins tested. Since the nasal and 113 buccal mucosa are key sites of viral infection and replication, the presence of 114 antibodies in saliva may be an important feature of the virus-specific immune 115 response, but this observation may also allow the development of a rapid, completely 116 non-invasive assay for COVID-19 seropositivity.

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted July 18, 2020 . . https://doi.org/10.1101 119

Since this study evaluated, for the first time, whether coronavirus-infected individuals could 121 generate an antibody response against the Cys-like protease, MPro, other SARS-CoV-2 122 proteins, commonly used in serology tests, were produced, for comparison. Mpro and NP were 123 expressed in E coli, and two different constructs of the Receptor Binding Domain (RBD) of the 124 spike protein were used: one was expressed by transfection in mammalian cells (mRBD) and 125 a second, produced by baculovirus infection of insect cells (iRBD-His). All the proteins, except 126 mRBD, had a histidine-tag and they were purified on Ni 2+ -NTA columns followed by size 127 exclusion chromatography (Figure 1 ). 128 129 Before testing a large number of sera from COVID-19 patients and healthy donors, 130 experiments were designed to optimize coating and dilution conditions. These data already 131 revealed that COVID-19 patient sera contained high titres of Mpro-specific antibodies. 132

Antibody reactivity to the viral protease reached saturation at relatively low concentrations and 133 discriminated efficiently between individuals who had been infected with SARS-CoV-2 and 134 those that had not been exposed to the virus ( Figure 2A ). Serum dilutions from 1/50 to 1/1600 135 covered a broad range of reactivity to Mpro from almost no recognition to saturation (reached 136 at 1/100 dilution). It was also possible to detect low titres of antibodies of the IgM and IgA 137 isotypes in these patients ( Figure 2B ), suggesting that, in subsequent experiments, a large 138 screening of patient samples should be performed including the three Ig subclasses. Coating 139 titration experiments further confirmed the specificity of the assay ( Figure 2C ). The IgG 140 reactivity against the protease MPro in COVID-19 patients was comparable, or in certain cases 141 stronger, to the reactivity against RBD, however, no differences were noticed between the 142 RBD recombinant proteins expressed in either mammalian cells or baculovirus 143 (Supplementary Figure 1) . These initial experiments suggested that the humoral response 144 against the three viral proteins can be heterogeneous between different patients. 145

To further validate the assay, additional controls were performed such as monitoring the 146 background in plates with no viral antigen coating and testing sera collected before the 147 COVID-19 pandemic (Supplementary Figure 2) . 148 149 150 151 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10. 1101 individuals with high specificity and sensitivity 153 A cohort of 36 COVID-19 patients (PCR+) and 33 healthy donors was recruited at La Princesa 154 University Hospital, Madrid (Table 1 ) and ELISA assays were performed to detect Mpro-, as 155 well as RBD-and NP-, specific antibodies of the IgG, IgA and IgM subclasses in sera ( Figure  156 3). 157

Titration of the serum samples was carried out over a dilution range of 1/50 to1/3200, and these 158 experiments showed that assay for seropositivity to all three antigens discriminated between 159 COVID-19 positive and negative donors, as shown in dot plots comparing different dilutions 160 (Supplementary Figure 3) . Figure 3 summarises the absorbance data from all the sera samples. 161

To estimate the cut-off value, the sensitivity, and the specificity parameters for each antigen/Ig 162 isotype pair, receiver operating characteristic (ROC) analyses were performed (Table 2, Figure 4 ). 163

The best area under the curve (AUC) values were obtained with the measurement of IgG 164 antibodies specific for Mpro and NP (AUCs= 0.9945 and 0.9927, respectively). The sensitivity and 165 specificity was above 90% for detection of IgG antibodies of the three proteins tested, with values 166 of sensitivity and specificity for Mpro of 97% and 100% respectively. AUC values above 0.85 were 167 obtained for the other isotypes (IgA, IgM). Measurement of anti-IgA antibodies appeared to 168 discriminate less accurately between pre-COVID-19 sera and COVID-19 sera, however, this is not 169 due to a lack in sensitivity for this isotype. Instead, because background levels with IgA were very 170 low and the signal clearly positive in some patients, the lack of detection suggests that certain 171 COVID-19-positive patients have circulating IgA while other COVID-19-positive patients lack IgA 172 in peripheral blood. Whether the presence of IgA in periphery has any relationship with clinical 173 aspects needs to be explored further in larger cohorts of patients. 174 175 Comparison between proteins showed some heterogeneity in the capacity of different donors to 176 produce antibodies, especially for IgM and IgA subclasses. Non-linear polynomial regression 177 showed a better correlation between the detection of antibodies against NP and Mpro compared 178 to NP and RBD or MPro and RBD ( Figure 5A ). Only one COVID-19 donor failed to make a full 179 antibody response. 180 181 Further analyses were performed to explore the correlations between the titres of the different 182 antibodies in serum and clinical parameters. Interestingly, a trend for higher titre antibody 183 responses was found in patients with more severe disease ( Figure 5B ), being more pronounced 184 for IgM against Mpro and IgG against RBD. However, several other variables also contributed to 185 the heterogeneity in antibody response, mainly age and time since the onset of symptoms (Table  186 3). After adjustment for these possibly confounding factors, IgA anti-RBD was observed to be 187 significantly higher in critical patients compared to patients with mild disease. In addition, critical 188 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10. 1101 Furthermore, intense IgM and IgA responses against the three proteins were significantly 190 associated with higher serum IL-6 levels (data not shown). 191 192 Importantly, in the experiments reported here no SARS-CoV-2-specific antibodies were detected 193 in more than 70 serum samples collected pre-pandemic. However, the majority of these pre-194 COVID-19 sera did contain antibodies against the nucleoprotein from the related HCoVOC43 195 betacoronavirus, that causes mild common cold-like diseases ( Figure 6 ). Thus these data 196 demonstrate that prior infection with another coronavirus does not seem to lead to the generation 197 of antibodies cross-reactive with the SARS-CoV-2 virus. 198 199 Therefore, the use of SARS-CoV-2 Mpro, in combination with other antigens already described 200 for serology tests, provided outstanding specificity and sensitivity for patient identification. IgG 201 titrated further than IgA or IgM indicating that, as expected, the IgG subclass is more abundant 202 in serum. Assay for IgM antibodies had a lower signal/noise ratio and, in many of the SARS-203

CoV-2 negative sera a significant background could be observed for IgM. In contrast, SARS-204

CoV-2-specific IgA antibodies were not detected in healthy donors, but were clearly present 205 in 27 out of the 36 sera tested from COVID-19 patients. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10. 1101 The results presented here describe the detection of antibodies against the SARS-CoV-2 217 protease, Mpro, in serum from COVID-19 patients. The titres of Mpro-specific antibodies were 218 comparable to those produced against SARS-CoV-2 nucleoprotein and somewhat higher than 219 the antibody responses to the RBD fragment of the Spike glycoprotein, both of which are 220 generally considered immunogenic coronavirus proteins. These high titre antibody responses 221 in serum were accompanied by the detection of Mpro-specific IgG antibodies in saliva, 222 providing a new opportunity for completely, non-invasive diagnostic tests. 223

For IgG antibodies in sera, the titres of NP and Mpro-specific antibodies correlate very well 224 with each other (r=0.94 y p<10 -4 ) and also with anti-RBD responses (r=0.89 y p<10 -4 ). In 225 contrast, while NP-and Mpro-specific antibody titres also correlate well for IgA and IgM 226 responses (r values greater than 0.9), the correlation with IgM and IgA for RBD is much weaker 227

(r values around 0.6). One plausible possibility is that the antibody responses to internal 228 antigens, Mpro and NP, correlate well, since production of antibodies against these proteins 229 requires either viruses with a broken membrane or release of viral material from infected cells. 230

The correlation with clinical data and symptoms onset reveals that antibodies have higher 231 titres as the severity of the disease increases. Although the sample size is not large, this 232 correlation was significant and independent of age and time from the beginning of symptoms 233 for anti-RBD IgA and almost significant for anti-Mpro IgM and IgA. The retrospective design of 234 our study does not allow to determine whether these increased levels are cause or 235 consequence of more severe disease and what is the basis of its relationship with higher levels 236 of IL-6 detected in critical patients. In this regard, it is surprising that IgM persisted at high 237 levels in patients' sera for more than a month after the beginning of symptoms. 238

The finding that the protease Mpro can be antigenic opens a new series of questions on the 239 biology of this protein that is an important target for the development of antivirals to block 240 SARS-CoV-2 replication. Mpro is key for cleavage and activation of the first polypeptide 241 translated after infection, but the protein has not been found in the virion. So, most probably, 242 the generation of antibodies directed against Mpro occurs at the end of the viral life cycle when 243 intracellular antigens are released from the infected cell. It is not clear whether antibodies 244 specific for Mpro might interfere with viral replication directly, however B cells producing these 245 antibodies would likely efficiently internalise and present this antigen to stimulate T cell 246 recognition of peptides from intracellular proteins. 247

The data presented here also show that, while antibodies for another betacoronavirus, 248

HCoVOC43, were found frequently in pre-COVID19 sera, SARS-Cov-2-specific antibodies were 249 undetectable, demonstrating that infection with one coronavirus does not necessarily prime for a 250 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10. 1101 better antibody response to another, at least for the viral antigens tested in these assays. 251

Sequence analysis also suggests that it is unlikely that the response detected against NP and 252

Mpro is due to cross-reactivity between coronavirus-specific antibodies. While COVID-19 Mpro 253 has 96% homology with the main protease of SARS-CoV, which emerged in China in 2003, the 254 similarity with other coronaviruses is much lower. All the samples analysed in this study came from 255 hospitals in Spain, where no cases of SARS-CoV-1 have been reported. The similarity between 256 the Cys-like proteases (Mpro) of different coronaviruses: SARS-CoV-2, HCovNL63, 257

HCoVOC43 and HCov229E similarity is only around 40% with changes and similarities 258 distributed along the whole sequence (Supplementary Figure 4) . 259 260 A remarkable observation is that SARS-CoV-2 specific antibodies can be detected in the saliva 261 of seropositive individuals. Two major antibody classes are found in saliva: secretory IgA 262 (SIgA), synthesized locally by plasma cells (PCs) in salivary glands and IgG that is mainly 263 derived from serum via gingival crevices (10). In our experiments salivary SARs-CoV-2 264 antibodies were mainly IgG rather than IgA; only one out of 12 individuals with SARS2-specific 265

IgA was observed, corresponding to a donor that had recovered from the disease one month 266 before the saliva test. The observation that COVID-19-positive, but not COVID-19-negative, 267 individuals contain robustly detectable levels of SARS-CoV-2 NP and Mpro-specific antibodies 268 in saliva is interesting because the development and validation of a saliva-based assay for 269 SARS-CoV-2 seropositivity would represent a practical, non-invasive alternative to blood-270 based assays for COVID-19 diagnostic testing that might complement saliva-based nucleic 271 acid tests for SARS-CoV-2 nucleic acid. 272 273 274 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10.1101/2020.07.16.20155853 doi: medRxiv preprint

A gene encoding SARS-CoV-2 Mpro from the Wuhan-Hu-1 strain (ORF1ab polyprotein 278 residues 3264-3569, GenBank code:MN908947.3) was amplified by PCR using the oligos 5´-279 gacccatggcttcagctgtttttcagagtggttt-3´ and 5´-gacctcgagttggaaagtaacacctgagcatt-3´, digested 280 with NcoI and XhoI and ligated into the vector pET22b (Novagen) linearized with the same 281 restriction enzymes. 282

Oligonucleotides 5´-gatccatggcttctgataatggtccgcaaaatcagcgtaatgca-3´ and 5´-283 caggtcgacaggctctgttggtgggaatg-3´were used to amplify the nucleocapsid protein of SARS-284

CoV-2. The amplification product was then digested with NcoI and SalI and ligated into the 285 pET26b vector (Novagen) digested with NcoI and XhoI. 286

Oligonucleotides 5´-gatccatggtctcttttactcctggtaagcaatcc -3´ and 5´-287 gacctcgagtatttctgaggtgtcttcagtatag -3´were used to amplify the nucleocapsid protein of 288

HCoVOC43. The amplification product was then digested with NcoI and XhoI and ligated into 289 the pET26b vector (Novagen) digested with NcoI and XhoI. 290

The integrity of all constructs was verified by sequencing at MWG Eurofins. 291

proteins 293

Recombinant viral proteins were expressed in the E. coli strain BL21 Star (DE3) pLysS 294 (ThermoFisher). 295 SARS-CoV-2 Mpro protein was expressed by transforming this plasmid into the E. coli 296 strain BL21 Star (DE3) pLysS. Transformed clones were pre-cultured overnight at room 297 temperature in 50 mL 1 x LB medium with ampicillin (150 μg/mL) and chloramphenicol 298 (34ug/ml). The overnight culture was then inoculated into 1L of 1 x LB medium (150 μg/mL 299 ampicillin and 34ug/ml chloramphenicol) and the culture was grown at 37 o C with agitation until 300 the OD600 reached 0.6 when Isopropyl-D-thiogalactoside (IPTG) was added to 1mM to induce 301 overexpression of the Mpro gene. The same protocol was followed to produce the 302 nucleocapsid proteins except that kanamycin (150ug/ml) was used instead of ampicillin for 303 antibiotic-mediated selection. 304

After overnight culture at 22 o C for NP, 3h at 37 o C for Mpro, bacteria were harvested 305 by centrifugation at 9500 x g, 4°C for 15 min and the pellets were washed by resuspension in 306 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10. 1101 Washed pellets were either processed immediately or stored frozen for later use. 308

Fresh, or thawed, cell pellets were resuspended in ice.cold 50 mM NaH2PO4 buffer 309 pH8, 500 mM NaCl, 10 mM imidazole (I2399, Sigma Aldrich), 0.1% Sarkosyl, and 5% glycerol 310 (pH 8.0). Lysozyme was then added (to 0.25 mg/ml) as were phenylmethylsulfonyl fluoride, 311

Leupeptin and Pepstatin A (all to a final concentration of 1mM) and DNase I (2 µg/ml). Mammalian RBD (mRBD) fused to the mucin domain and the Fc region (mRBD-338 mucin-Fc) was initially purified from cell supernatants by affinity chromatography using an 339

IgSelect column (GE Healthcare). The mucin-Fc portion and the HA-tag were released from 340 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10.1101/2020.07.16.20155853 doi: medRxiv preprint a protein A column to remove the mucin-Fc protein and mRBD was further purified by size-342 exclusion chromatography with a Superdex 75 column in HBS buffer (25 mM HEPES and 343 150 mM NaCl, pH 7.5). The concentration of purified mRBD was determined by absorbance 344 at 280 nm. 345

A recombinant baculovirus expressing the RBD domain was generated using a 347 pFastBac Dual-derived plasmid harboring the RBD coding sequence kindly provided by Dr. . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. Station, TX, USA). Quantitative variables following a non-normal distribution were represented 383 as median and interquartile range (IQR) and the Mann Whitney test was used to test for 384 statistically significant differences. Variables with a normal distribution were described by 385 mean±standard deviation (SD) and differences between groups were assessed with Student's 386 t-test. Qualitative variables were described as counts and proportions and 2 or Fisher´s exact 387 test was used for comparisons. Correlation between quantitative variables was analysed using 388 the Pearson correlation test. 389

Severity of COVID-19 was established as previously described (13). In this case, to determine 390 differences in titres of antibodies between groups of severity the Cuzick's test, that assesses 391 trends across ordered groups, was employed. 392

Since several variables might contribute to differences in ELISA titres, multivariable linear 393 analysis using generalized linear models (glm command of Stata) in which the dependent 394 variable were ELISA titres of each isotype against each protein. The first model included age, 395 gender and time from symptoms onset, followed by backward stepwise approach removing all 396 variables with a p value >0.15 to obtain the best model for each protein and isotype. Then, the 397 variable of interest (severity, anosmia or IL-6 serum levels) was forced in the model. 398

To determine the capacity of the different ELISA to discriminate between pre-COVID-19 sera 399 and those sera obtained from patients with SARS-CoV-2, as determined by positive PCR from 400 nasopharyngeal exudates, ROC analysis was performed, using the roctab command of Stata This study used samples from the research project "Immune response dynamics as predictor 407 of COVID-19 disease evolution. Implications for therapeutic decision-making" [PREDINMUN-408 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10.1101/2020.07.16.20155853 doi: medRxiv preprint 499 500 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. 

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020 . . https://doi.org/10.1101 Whitney tests. **** means p<0.0001. 548 individuals. Plates coated with either 0.5 µg/ml of SARS-CoV-2 Mpro and NP or 1 µg/ml of 580 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10.1101/2020.07.16.20155853 doi: medRxiv preprint done using antibodies directed against human IgG. Data were normalised for each antigen 582 using the signal obtained for the positive control histidine-tag. Mann-Whitney test was 583 performed to compare the values obtained for each dilution in healthy donors and patients. ** 584 p<0.01, **** p<0.0001. 585 586 . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted July 18, 2020. . https://doi.org/10.1101/2020.07.16.20155853 doi: medRxiv preprint Plates were coated with SARS-CoV-2 RBD proteins produced in eukaryotic systems, either using insect or mammalian cells, and sera dilutions (1/100 to 1/1600) were tested. Detection was performed using anti-human IgG antibody. Black symbols correspond to COVID-19 patients and grey symbols to samples from donors pre-COVID-19. Plates were coated with 1 μg/ml of SARS-CoV-2 Mpro or iRBD and different dilutions of patient sera, as indicated, and detected with anti-human F(ab)2' antibody (left and middle panels). Casein control corresponds to wells coated with the blocking solution, containing casein (right). These wells were incubated with the same sera and developed with anti-human F(ab)2' antibody to check the background corresponding to individual sera. B. SARS-CoV-2 negative controls. 24 sera collected before 2020 (Pre-COVID-19) were tested in plates coated with 1 μg/ml of SARS-CoV-2 Mpro or NP. Sera were added at a 1/50-1/900 dilution. Detection was performed using antibodies directed against human IgG or IgM. Data from the 1/50 dilution are shown for IgM and 1/200 for IgG. Serum number 0850 corresponds to a positive control serum.

A. Serum background in plates coated with casein (no viral protein) B. Sera collected before 2020 (pre-COVID-19) 0001  0002  0003  0004  0005  0006  0007  0008  0009  0010  0011  0012  0013  0014  0015  0016  0017  0018  0019  0020  0021  0022  0023  0024  0850  0001  0002  0003  0004  0005  0006  0007  0008  0009  0010  0011  0012  0013  0014  0015  0016  0017  0018  0019  0020  0021  0022  0023 

A Novel Coronavirus from 462 Patients with Pneumonia in China

Coronaviridae Study Group of the International Committee on Taxonomy of V. The 464 species Severe acute respiratory syndrome-related coronavirus: classifying 2019-465 nCoV and naming it SARS-CoV-2

Positive rate of RT-PCR detection of 467 SARS-CoV-2 infection in 4880 cases from one hospital in

Viral Load Analysis of SARS-CoV-2 in Infected Patients

The genetic sequence, origin, and 472 diagnosis of SARS-CoV-2

A serological assay to detect SARS-CoV-2 seroconversion in humans

Serology for 477 SARS-CoV-2: Apprehensions, opportunities, and the path forward

Crystal structure of 480 SARS-CoV-2 main protease provides a basis for design of improved alpha-481 ketoamide inhibitors

Structure-based design of 483 antiviral drug candidates targeting the SARS-CoV-2 main protease

Do salivary antibodies reliably reflect both mucosal and systemic 486 immunity?

Kinetics and thermodynamics of virus binding to 490 receptor. Studies with rhinovirus, intercellular adhesion molecule-1 (ICAM-1), and 491 surface plasmon resonance

Characteristics of and Important Lessons From the 494

COVID-19) Outbreak in China: Summary of a Report of 495 72 314 Cases From the Chinese Center for Disease Control and Prevention