key: cord-310062-mmlh9i1o
authors: Luo, Haibin; Ye, Fei; Sun, Tao; Yue, Liduo; Peng, Shuying; Chen, Jing; Li, Guowei; Du, Yi; Xie, Youhua; Yang, Yiming; Shen, Jianhua; Wang, Yuan; Shen, Xu; Jiang, Hualiang
title: In vitro biochemical and thermodynamic characterization of nucleocapsid protein of SARS
date: 2004-12-01
journal: Biophys Chem
DOI: 10.1016/j.bpc.2004.06.008
sha: 
doc_id: 310062
cord_uid: mmlh9i1o

The major biochemical and thermodynamic features of nucelocapsid protein of SARS coronavirus (SARS_NP) were characterized by use of non-denatured gel electrophoresis, size-exclusion chromatographic and surface plasmon resonance (SPR) techniques. The results showed that SARS_NP existed in vitro as oligomer, more probably dimer, as the basic functional unit. This protein shows its maximum conformational stability near pH 9.0, and it seems that its oligomer dissociation and protein unfolding occur simultaneously. Thermal-induced unfolding for SARS_NP was totally irreversible. Both the thermal and chemical denaturant-induced denaturation analyses showed that oligomeric SARS_NP unfolds and refolds through a two-state model, and the electrostatic interactions among the charge groups of SARS_NP made a significant contribution to its conformational stability.

Between the end of the year 2002 and the June of the year 2003, one severe epidemic disease called severe acute respiratory syndrome (SARS) broke out in China and more than 30 other countries. It has been known that SARS coronavirus (SARS _ CoV) is a novel human coronavirus and responsible for SARS infection [1] [2] [3] [4] .

Recently, remarkable achievements have been made in genome sequencing of SARS _ CoV [5] , SARS protein functional studies [6] [7] [8] , three-dimensional structural modeling [9] [10] [11] , and X-ray crystal structural analysis [12] .

SARS _ CoV genome contains 11 major open reading frames (ORFs) that encode the replicase polyprotein, the spike (S) protein, the small envelope (E) protein, the membrane (M) protein, and the nucleocapsid protein (NP) [5] . For coronaviruses, NP plays an important role in the host cell entry and virus particle assembly and release [13] [14] [15] . In particular, it binds to a defined packaging signal of viral RNA, leading to the formation of the helical nucleocapsid. NP is incorporated into virions by intracellular budding through a membrane containing three envelope proteins: the M glycoprotein [15] , the E protein and S glycoprotein [16] . Additionally, NP has been proposed to be multifunctional with additional roles in replication, transcription and translation for coronaviruses [17] [18] [19] .

To our knowledge, nucleocapsid protein (NP) of some kinds of viruses might self-assemble as oligomer when carrying out its biological functions [19] [20] [21] . While we are preparing this manuscript, Surjit et al. [22] published their result that SARS _ NP is capable of self-association through a C-terminal 209-amino-acid interaction domain, even though there is lack of detailed description for this work. Additionally, Jaenicke and Seckler [23] reported that oligomeric proteins always form intermediate and give more than one transition during unfolding. Nevertheless, whether NP forms intermediate during unfolding

has not yet been reported elsewhere. In this report, we used non-denatured gel electrophoresis and size-exclusion chromatographic techniques as well as surface plasmon resonance (SPR) technology based Bicore3000 for trying to investigate quantitatively the possible assembly features of SARS _ NP. The results suggested that in the absence of genomic nucleic acid, SARS _ NP tends to form dimer at a low concentration, and trimer or polymer at higher concentration. In addition, the unfolding and refolding characterizations of SARS _ NP dimer caused by thermaland chemical denaturant-induced denaturations were also inspected by fluorescent and CD spectral investigation, it is found that SARS _ NP exhibits its most stable conformation near pH 9.0, and its oligomer dissociation and protein unfolding seem to be of coinstantaneous occurring events.

The restriction and modifying enzymes were purchased from TaKaRa, and the vector pQE30, the bacterial strains M15 and DH5a were from Qiagen. TRIzol and Superscript II reverse transcriptase were bought from GIBCO. Trypsin (sequencing grade) was purchased from Sigma. DNAase and RNAase were from NEB. The chelating affinity column and lower molecular weight (LMW) marker and ovalbumin (45 kDa) used as gel filtration reference protein were purchased from Amersham Pharmacia Biotech (Sweden). All other chemicals were from Sigma in analytical grade.

All cloning techniques including PCR, restriction digestion, ligation, Escherichia coli transformation, plasmid DNA preparation, were according to the literature method [24] . SARS _ CoV (isolate BJ01) RNA was extracted with TRIzol reagent according to the manufacturer's instruction (http://www.genehub.net/trizol.htm). The reverse transcription was performed with the random priming method by the Superscript II reverse transcriptase.

The appropriate SARS _ NP coding sequence (TRO2) was isolated by PCR from the cDNA of SARS _ CoV. The obtained SARS _ NP DNA was amplified by PCR using the primers:

NPf, 5V ATTAGGATCCTCTGATAATGGACCCCAATCA 3V; NPr, 5VTTAAGTCGACTGCCTGAGTTGAATCAGCAGA 3V .

The PCR products were digested by BamHI and SalI restriction enzymes then inserted into the pQE30 vector (QIAgen). The construct of pQE30-SARS _ NP was sequenced.

The recombinant plasmid pQE30-SARS _ NP was transfected into M15 (DE3) bacterial strain. Clones were grown overnight in LB medium containing 100 mg/l ampicillin and 25 mg/l kanamycin. Expression of the Histagged recombinant protein (SARS _ NP) was induced at an OD 600 of 0.7-0.9 with the addition of isopropyl-h-dthiogalasctopyranoside (IPTG) to a final concentration of 1 mM. After induction for 12 h at 37 8C, the cells were harvested by centrifugation for 30 min at 4000 rpm, 4 8C and stored at À70 8C. During the protein purification, cells were resuspended in 20 ml of buffer A (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 5 mM imidazole, 1 mM PMSF), and then lysed by sonication for 15 min in ice bath. The lysate was cleared by centrifugation at 4 8C, 14000 rpm for 60 min. To the supernatant were added DNAase and RNAase to the final concentration of 2 Ag/ ml for either of them in order to get rid of the possible bound DNA and RNA scraps to the protein of interest. This mixture was incubated at 20 8C for 3 h before further treatments.

The nuclease treated supernatant was loaded on a 4 ml of Sepharose Ni-NTA column (Amersham Pharmacia) equilibrated with 30 ml of buffer A. The column was eluted with buffer B (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 500 mM imidazole) after being washed by buffer C (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 120 mM imidazole). The elution fraction was further applied to a gel filtration column (HiprepTM 16/60 sephacyl S100) on a FPLC (Amersham Pharmacia) system. The column was preequilibrated with 2 column volumes of Buffer D (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1.5 mM EDTA) before loading the protein sample (2 ml). SARS _ NP was thus eluted by 1.5 column volumes of Buffer D, and concentrated by Centricon (Pharmacia) The protein purity was determined by SDS-PAGE and concentration was monitored by measuring the absorbance at 280 nm in Buffer D using the extinction coefficient of 43,890 l/mol/cm. SARS _ NP sequence was confirmed through LC-Ion Trap-MS and MS/Ms techniques.

SARS _ NP/SRAS _ NP interaction analysis was performed using the dual flow cell Biacore 3000 instrument (Biacore, Rapsgatan 7, S-754 50 Uppsala, Sweden). All the experiments were carried out at a constant system flow rate of 20 Al/min at 25 8C. SARS _ NP was immobilized on a CM5 sensor chip by amine coupling at the level of 4000 response units (RU). In considering that this signal may involve the SARS _ NP oligomer (as stated in later related parts), several injections of 10 Al of 100 mM NaOH were processed in order to wash out the possible oligomers of SRAS _ NP as completely as possible. The next injection was performed after the stable response unit (around 2400 RU in this stage) was obtained. The reference flow cell surface was immobilized at a parallel level (2200 RU) using lysozyme. Every sample injection was performed at 30 Al/min within 1 min and the surface was regenerated by injection of 10 Al of 100 mM NaOH twice.

Fluorescent spectra were recorded on a HITACHI F-2500 fluorescence spectrophotometer in a 1-cm quartz cell. For monitoring tryptophan fluorescence excitation, wavelength of 285 nm was used, and the spectra were collected between 300 and 400 nm. Both the excitation and emission slits were 5 nm.

CD spectra were recorded on a JASCO J810 spectropolarimeter calibrated with ammonium (+)-10-camphorsulfonate, and normalized by subtracting the baseline recorded for the buffer having the same concentration of denaturant under similar conditions.

Equilibrium unfolding experiments were performed in 20 mM Tris-HCl, 150 mM NaCl, 1.5 mM EDTA, pH 6.0-11.0 with the protein concentration at 0.4-4.0 AM (0.2-2 mg/ml). Thermal denaturations were characterized with the help of intrinsic fluorescence and far-UV CD (k=222 nm) spectral investigations. The temperature was scanned in a 58 interval from 20 to 95 8C heated by a thermostat. Each measurement was repeated three times and the final result was the average.

Protein samples were incubated in the presence of 0-8 M urea (or 0-6 M GuHCl) for at least 12 h at 16 8C prior to fluorescence and CD measurements. Urea stock solution in 9 M was made freshly for each experiment, and GuHCl stock solution in 8 M was used within 1 week.

The chemical denaturant-induced denaturations in urea and GuHCl were performed in Buffer D (pH 9.0) at 25 8C. For each experiment, a known amount of buffer was mixed with a fixed amount of the protein stock solution and varying amounts of the denaturant in a final volume of 2 ml, and the final signal was obtained by subtracting the same concentration of the denaturant buffer.

During the protein refolding experiment from thermalinduced denatured state, the samples heated to different temperatures (30-95 8C) were cooled down to 25 8C, and kept at this temperature for 12 h, then applied to the refolding analysis by fluorescence and CD instruments at 25 8C.

While in the refolding test from the chemical denaturantinduced denatured state, protein samples were incubated at 16 8C for 12 h with denaturant in different concentrations (0-8 M for urea; 0-6 M for GuHCl). The sample was dialyzed against Buffer D at 16 8C for 24 h, and then left to stand still for 1 h at 25 8C before fluorescence and CD spectral investigations.

Gel filtration experiments were carried out on a HiprepTM16/60 Sephacyl S100 column on an AKTA FPLC (Amersham Pharmacia Biotech) system. The column was equilibrated and run with Buffer D at 20 8C. At the same temperature, 2 ml of protein sample was loaded on the column and run in a flow rate of 0.5 ml/ min with a detection of 280 nm absorbance. Two proteins, GST-PPARa-LBD (90 kDa) and ovalbumin (45 kDa) were used as references. GST-PPARa-LBD was expressed and purified in our lab according to the published method by Xu et al. [25] .

Response curves were prepared by subtraction of the signal generated simultaneously on the control flow cell. As will be discussed in the later part, the binding feature for SARS _ NP/SARS _ NP characterized as a complex mode with (A+B X AB; AB+A X AB; AA+B X AAB), which thus cannot be simply fitted by BIAevalation binding model. However, according to the formula:

We can follow the response unit (RU) value to quantify approximately the protein concentration where SARS _ NP formed dimer or higher order oligomer. At the same time, the slope of the affinity curve may be used to characterize the association and dissociation features.

Data from fluorescence and CD measurements were fitted as non-linear least-squares regression to the following equation for a typical two-state transition [26, 27] 

where Y is the experimental data (the fluorescent intensities at 340 nm, or fluorescent maximum emission k max shifts, or the ellipticity values at 222 nm in CD), T is the temperature in Kevin, R is the gas constant (1.987Â10 À3 kcal/mol), T m is the transition temperature, and DH m is the enthalpy of unfolding at T m (van't Hoff enthalpy). The parameters Y n and Y d refer to the Y intercepts of the native and denatured baseline, respectively, while M n and M d are the slopes of the baselines. These raw experimental data were fitted to the Eq. (2) using Origin 6.0 (OriginLab, http://www.OriginLab.com).

To compare the transitions monitored at different concentrations, each unfolding curve was normalized to the apparent fraction of the unfolded form by using the following relations [27] :

In Eq. (3), y is the value of the optical parameter being monitored, Y n and Y d are the values for the fully folded and fully unfolded state at each temperature as determined by linear regression of the points in the unfolding experiments.

Data from thermal and chemical denaturant-induced denaturation experiments at different pH values ranging from 6.0 to 11.0 were used to construct a plot of DH m versus T m . The slope of this plot (DC p , heat capacity) was determined by linear least-squares fitting according to the following equation [27] .

Thermodynamic parameters T m and DH m , obtained from the spectroscopic measurements, were used to figure out the free energy changes (DG8) of unfolding at temperature (T) by using the following Gibbs-Helmholtz equation [27] :

where T is the absolute temperature. The entropy change (DS m ) of unfolding was determined by following equation [27, 28] :

The apparent free energy change (DG u H 2 O ) in the absence of denaturant was determined by fitting the optical value changes at a particular concentration of denaturant to the following equation [29] : 

The purified His-tagged SARS _ NP was isolated through a nickel metal-affinity column followed by a gel filtration column on an FPLC system. The purity (N95%) of SARS _ NP was examined by SDS-PAGE with one single band corresponding to 48 kDa. Otherwise, LC/MS and LC/ MS/MS analyses were processed for protein identity determination (see Supplementary materials).

It has been known that nucleocapsid protein (NP) of many kinds of viruses tend to self-assemble with genomic nucleic acid for implementation of their biological functions [19, 30, 31] . For example, for NP of hepatitis B virus, its assembly does not occur without genomic DNA in vivo [19, 30, 32] , and few cases about NP self-assembly without RNA/DNA in vitro were reported [33, 34] . Surjit et al. [22] recently expressed the N protein as a fusion protein in the yeast two-hybrid system to demonstrate self-association and confirmed dimerization of the N protein from mammalian cell lysates by coimmunoprecipitation. However, SARS _ NP self-assembly as higher order oligomers in the absence of genomic RNA in vitro was observed in our present work.

To preliminarily study the self-assembly of SAS _ NP, non-denatured gel electrophoresis technique was applied. The result was shown in Fig. 1A , where the protein (0.5 mg/ ml) was mixed with 4 M urea, then used as a reference for monomer on native gel. It is found that at its low concentration around 1.0 mg/ml, SARS _ NP tends to form largely in monomer involving a small quantity of dimer (Lane 1), and the amount of dimer is fortified with the increasing concentration of SARS _ NP (~1.5 mg/ml) as indicated in lane 2. When the protein concentration was higher (~3.0 mg/ml), the trimer state of SARS _ NP appeared (Lane 4). Such a result suggested that homo-oligomerization of SARS _ NP is of concentration dependence. Due to the difficulty in obtaining large quantity of soluble SARS _ NP and the weak visualization of Coomassie brilliant blue dye for SARS _ NP in gel, higher polymer than trimer could not be obtained for SARS _ NP by native gel.

In order to gain more insight into the assembly mechanism for SARS _ NP, and evaluate the molecular dimensions of the native SARS _ NP dependence on concentration, size-exclusion chromatographic studies on an S100 gel filtration column were carried out according to the published method [21] . The two reference proteins GST-PPARa (90 kDa) and ovalbumin (45 kDa) with the elution peaks at 42.3 and 63.1 ml (Fig. 1B) , respectively, were used for molecular weight indication in size-exclusion chromatographic experiment.

As also indicated in Fig. 1B , some more detailed interesting results could be also found: For SARS _ P at 0.2 mg/ml, two elution peaks emerged at 40.7 and 61.8 ml. According to the reference proteins, these two peaks might be ascribed to the dimer and monomer of SARS _ NP, respectively; SARS _ NP at 2.5 mg/ml had a new small elution peak at 23.8 ml, which may be ascribed to SARS _ NP trimer. This is in agreement with the results of non-denatured gel electrophoresis that oligomer formation of SRAS _ NP is of concentration dependence. According to Fig. 1B , SARS _ NP at 0.2 mg/ml contained equivalent ratio of monomer and dimer, and at 2.5 mg/ml, it existed as a mixture with more dimer and less monomer and trimer. It is noticed that in native gel experiment, SARS _ NP at different concentrations existed mostly in monomer state. This might be resulted from the experimental differences between native gel and gel filtration. The heat generated during the native gel test might cause some of the protein oligomer to dissociate into monomer.

As reflected in the amino acid sequence of SARS _ NP, there is no cysteine residue in the structure of SARS _ NP, its polymerization as oligomer was thus probably be attributed to the non-covalently bond forces, different from the oligomerization feature for NP of porcine reproductive and respiratory syndrome virus whose oligomers formation involves disulfide linkage [35] .

SPR technology might be not highly competent for studying protein oligomerization in this report, but we can use it to qualitatively investigate SARS _ NP protein oligomerization. To avoid the non-specific interactions, an equivalent amount of lysozyme was immobilized on the sensor chip as a reference. As shown in Fig. 2 , even under very low concentrations (below 4 AM or 0.2 mg/ml), SARS _ NP has tendency to assemble as dimer based on the fact that the binding curves in the sensor gram showed saturation tendency at 2000 RU, nearly equivalent to the coupling level of 2400 RU. This result is in accordance with the fact obtained in size-exclusion chromatography experiment that SARS _ NP exists as oligomer at 0.2 mg/ml. Furthermore, as indicated in Fig. 2 , when SARS _ NP concentration was higher than 4 AM (0.2 mg/ml), the binding level exceeded the immobilized one (2400 RU) on the sensor chip and increased in a linear way; this may be tentatively attributed to the formation of trimer (or higher polymer) for SRAS _ NP. Therefore, based on the results from the non-denatured gel, gel filtration analyses and the preliminary SPR data, it is suggested that SARS _ NP might exist in oligomer, more probably dimer, as the basic functional unit in vivo. As can be seen from Fig. 2 (dotted curves), the trimer (or higher polymer) of SARS _ NP departed quickly firstly then appeared as the similar dissociation course to that of dimer, suggesting that during the dissociation course of SARS _ NP oligomer, it firstly dissociates into dimer. The quicker dissociation course indicates that the structure of SARS _ NP polymer is possibly less compact than that of its dimer.

It is suggested here that SARS _ NP tends to form dimer and oligomer in vitro, and the order of oligomer increases with the protein concentration increasing. The polymerization of SARS _ NP was thus surely driven totally by the non-covalently bond forces not the covalent ones.

The fluorescent and CD spectra with pH ranging from 3.5 to 12 for SARS _ NP were monitored at room temperature for investigating its pH-induced denaturation. It is found that from pH 7.0 to 10.0, all the fluorescent intensities kept at high level with small changes, and far-UV CD measurements gave the similar spectra ( Fig. 3A and B) .

From pH 10.5 to 12, the fluorescent intensity decreases dramatically with increase of pH value, and within the pH range between 3.5 and 6.0, the intensity decreased as the pH value increased. The emission k max maintained the value at 333 nm within pH values between 7.0 and 10.0, and changed to 336 nm at pH 11.0, then shifted to 345 nm above pH 11.5. These results suggested that SARS _ NP lost its native structure at extreme pH. Additionally, at the extreme alkaline pH above 11.5, SARS _ NP displayed a fluorescent spectrum similar to its thermal-induced and chemical denaturant-induced denaturations states (Fig. 5A) . The far-UV CD spectra at pHN11.5 showed a typical random coil curve corresponding to the denatured protein of SARS _ NP.

The thermal-induced denaturations of SARS _ NP at various pH values were investigated by following the intrinsic fluorescence of SARS _ NP and far-UV CD (at 222 nm) spectral analyses. Despite the fact that the unfolding of an oligomeric protein is dependent on the protein concentrations [36] , this present work however showed the similar unfolding profiles for SARS _ NP within the concentrations ranging from 1 to 6 AM (data not shown). Fig. 4A and B shows the typical fluorescence and far-UV CD spectral changes for thermal-induced denaturations of SARS _ NP (SARS _ NP concentration: 0.15 mg/ml for fluorescent experiment, and 0.45 mg/ml for CD). The changes in the fluorescent spectra and the well-fitted curves (according to Eq. (2)) showed related profiles (Fig. 4C) . The fluorescent intensity was found to decrease with increase of temperature accompanied by a shift in emission k max from 333 to 343 nm ( Fig. 4A and  C) , whereas far-UV CD spectral information suggested the loss of secondary structure for SARS _ NP during its thermal-induced denaturation (Fig. 4B and D) .

The denaturation curves studied by fluorescent intensity, emission k max and far-UV CD at 222 nm were analyzed using Eq. (2) (The fitting goodness was shown in Fig 4C  and D) , and DH m was plotted against T m (transition midpoint of thermal-induced denaturation) to obtain DC p by linear fitting (Fig. 4E) (Eq. (4) ). The averaged DC p of 1.5039F0.0567 kcal/mol was used to calculate DG8 (Eq. (5)), and the entropy changes (DS m ) (Eq. (6)) at different pH values. It was found that SARS _ NP is more stable in alkaline than in acidic condition, indicating that the variation of the electric charge of the protein with pH change will modify the intra-molecular cooperative process [37] . Table 1 summarizes the thermodynamic parameters for characterizing the thermal denaturation of SARS _ NP by fluorescence intensity, emission k max and CD ellipticity at 222 nm at different pH. In the pH ranges from 6.0 to 9.0, T m increases with the increasing pH, e.g. from 42 8C at pH 6.0 to 48 8C at pH 9.0. However, T m decreases with increasing pH after 9.0. The free energy (DG8) of unfolding is used to estimate the protein stability in enduring the denaturants, high DG8 means the protein might be more stable against denaturant [28] . Comparing the DG8 values of SARS _ NP at different pH, the conformational stability of SARS-NP is highest near pH 9.0, with the highest DG8 about 4.459 kcal/mol.

Chemical denaturant-induced denaturations of SARS _ NP were studied based on the totally measured tryptophan fluorescence emission upon excitation at 285 nm, and far-UV CD spectral data. Fig. 5A shows the fluorescent spectral changes for SARS _ NP at 0.09 mg/ml in Buffer D in the presence of different concentrations of urea at pH 9.0, and the goodness of the fitting is according to (Eq. (7)). As shown in Fig. 5A , an apparent decrease in fluorescent intensity at 340 nm was observed upon unfolding. The native SARS _ NP exhibited emission k max around 333F0.5 nm, and k max of SARS _ NP was found to shift to 346F1 nm when denatured by urea and GuHCl, as expected for a tryptophan exposed to solvent. The far-UV CD spectra of SARS _ NP at 0.45 mg/ml in Buffer D with different concentrations of urea suggested that SARS _ NP lost its secondary structures with increasing urea concentration and fully denatured at 5 M urea.

DG u H 2 O (free energy change of thermal-induced denaturation), m and C m (transition midpoint of chemical induced denaturation) could be calculated using (Eq. (7)) (where DG u H 2 O =mC m ), and the results were summarized in Table 2 . C m (4.29 M) and DG u H 2 O (7.188 kcal/mol) of SARS _ NP unfolding were the highest at pH 9.0. This suggests the same results as in the thermal-induced unfolding characterization that SARS _ NP has the maximum conformational stability near pH 9.0. It could be also found from Table 2 that when pH became higher or lower than 9, the stability of this protein decreased as reflected by the reduced values of C m and DG u H 2 O . The results from the urea-induced denaturation investigated by fluorescence and far-UV CD spectra are shown to be in good agreement with each other ( Table 2) .

As we know, urea and guanidine hydrochloride (GuHCl) are the most commonly used denaturants in the studies of protein unfolding and refolding. The equilibrium unfolding transitions induced by these two denaturants are not always similar to each other, and the difference might be more related to the ionic character for GuHCl [38] . GuHClinduced unfolding of SARS _ NP obeys the similar transition pattern as the urea-induced unfolding. However, as shown in Table 2 , DG u H 2 O obtained by GuHCl-induced unfolding is a little bigger than that by urea-induced unfolding, at pH 9.0, for example, 7.1884 kcal/mol for urea-induced unfold- ing and 7.801 kcal/mol for GuHCl. Such a difference in free energy of unfolding may thus be also attributed to the ionic effect of GuHCl.

Thermal-induced denaturation of SARS _ NP was refolded by cooling the protein sample down to 20 8C and let to be kept at this temperature for 12 h before analyzed by fluorescence and CD measurements. We found that thermal-induced denaturation of SARS _ NP is not reversible. Denatured SARS _ NP in 8 M urea was refolded by diluting to lower urea concentrations and kept at 20 8C for 12 h before monitoring the k max at 25 8C. The refolding sample applied to CD was prepared by dialysis against Buffer D for 24 h and was measured at 25 8C. The results shown in Fig.  6A and B indicated that urea-induced unfolding and refolding is basically reversible.

In conclusion, in this work, the important biochemical and thermodynamic features of SARS _ NP were characterized with the help of SPR technology, non-denatured gel electrophoresis, gel filtration in FPLC system, fluorescent and circular dichroism (CD) investigations. SARS _ NP is prone to assembling itself as dimer below~4 AM and incompact oligomer at higher concentration (over 4 AM) in the absence of genomic RNA. SARS _ NP might exist in oligomer, more probably dimer, as the basic functional unit in vivo. Thermal and chemical denaturant-induced denaturations of SARS _ NP are subject to the two-state transition model: NU. In addition, it is found that the dissociation of subunit and loss of SARS _ NP structure are of simultaneous events. The denaturation investigation has proved that SARS _ NP shows its most stable conformation near pH 9.0 with the highest DG u H 2 O and DG8. The electrostatic interactions among the charge groups make a significant contribution to the conformational stability for SARS _ NP. Thermal-induced unfolding and refolding are irreversible, while urea-induced unfolding of SARS _ NP is nearly reversible. ing SARS from the Ministry of Science and Technology, Chinese Academy of Sciences, National Natural Science Foundation of China and Shanghai Science and Technology Commission.

Clinical progression and viral load in a community outbreak of coronavirusassociated SARS pneumonia: a prospective study

Coronavirus as a possible cause of severe acute respiratory syndrome

Identification of a novel coronavirus in patients with severe acute respiratory syndrome

A novel coronavirus associated with severe acute respiratory syndrome

Small envelope protein E of SARS: cloning, expression, purification, CD determination, and bioinformatics analysis

Mass spectrometric characterization of proteins from the SARS virus: a preliminary report

Identification of an epitope of SARS-coronavirus nucleocapsid protein

Coronavirus main proteinase (3CLpro) structure: basis for design of anti-SARS drugs

A 3D model of SARS-CoV 3CL proteinase and its inhibitors design by virtual screening

mRNA cap-1 methyltransferase in the SARS genome

The crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor

Characterization of the coronavirus M protein and nucleocapsid interaction in infected cells

Nucleocapsidindependent specific viral RNA packaging via viral envelope protein and viral RNA signal

HIV nucleocapsid protein. Expression in Escherichia coli, purification, and characterization

Genetic evidence for a structural interaction between the carboxy termini of the membrane and nucleocapsid proteins of mouse hepatitis virus

The molecular biology of coronaviruses

Coronavirus translational regulation: leader affects mRNA efficiency

High affinity interaction between nucleocapsid protein and leader/intergenic sequence of mouse hepatitis virus RNA

Study of the assembly of vesicular stomatitis virus N protein: role of the P protein

Guanidinium chloride-and ureainduced unfolding of the dimeric enzyme glucose oxidase

The nucleocapsid protein of the SARS coronavirus is capable of self-association through a C-terminal 209 amino acid interaction domain

Protein misassembly in vitro

Molecular Cloning, A Laboratory Manual

Structural determinants of ligand binding selectivity between the peroxisome proliferator-activated receptors

Stability of yeast iso-1-ferricytochrome c as a function of pH and temperature

Thermodynamics of unfolding of beta-trypsin at pH 2.8

Equilibrium unfolding of RNase Rs from Rhizopus stolonifer: pH dependence of chemical and thermal denaturation

A test of the linear extrapolation of unfolding free energy changes over an extended denaturant concentration range1

In vitro assembly of alphavirus cores by using nucleocapsid protein expressed in Escherichia coli

Effect of osmolytes and chaperone-like action of P-protein on folding of nucleocapsid protein of Chandipura virus

Hepatitis B virus nucleocapsid envelopment does not occur without genomic DNA synthesis

Interaction between molecules of hantavirus nucleocapsid protein

Thermodynamic dissection of a low affinity protein-protein interface involved in human immunodeficiency virus assembly

Homo-oligomerization of the porcine reproductive and respiratory syndrome virus nucleocapsid protein and the role of disulfide linkages

Urea-induced unfolding studies of free-and ligand-bound tetrameric ATP-dependent Saccharomyces cerevisiae phosphoenolpyruvate carboxykinase. Influence of quaternary structure on protein conformational stability

Thermodynamic features of the chemical and thermal denaturations of human serum albumin

Protein denaturation with guanidine hydrochloride or urea provides a different estimate of stability depending on the contributions of electrostatic interactions

The authors are grateful to the Chinese Military Medical Academy for providing the SARS _ CoV (BJ01) virus. 

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bpc. 2004.06.008.