key: cord-349365-2ot1kf2k
authors: Shi, Yi; Luo, Haifeng; Jia, Jie; Xiong, Jie; Yang, Dehua; Huang, Bing; Jin, Youxin
title: Antisense downregulation of SARS‐CoV gene expression in Vero E6 cells
date: 2004-11-15
journal: J Gene Med
DOI: 10.1002/jgm.640
sha: 
doc_id: 349365
cord_uid: 2ot1kf2k

BACKGROUND: Severe acute respiratory syndrome (SARS) is caused by a novel coronavirus (SARS‐CoV). It is an enveloped, single‐stranded, plus‐sense RNA virus with a genome of ∼30 kb. The structural proteins E, M and N of SARS‐CoV play important roles during host cell entry and viral morphogenesis and release. Therefore, we have studied whether expression of these structural proteins can be down‐regulated using an antisense technique. METHODS: Vero E6 cells were transfected with plasmid constructs containing exons of the SARS‐CoV structural protein E, M or N genes or their exons in frame with the reporter protein EGFP. The transfected cell cultures were treated with antisense phosphorothioated oligonucleotides (antisense PS‐ODN, 20mer) or a control oligonucleotide by addition to the culture medium. RESULTS: Among a total of 26 antisense PS‐ODNs targeting E, M and N genes, we obtained six antisense PS‐ODNs which could sequence‐specifically reduce target genes expression by over 90% at the concentration of 50 µM in the cell culture medium tested by RT‐PCR. The antisense effect was further proved by down‐regulating the expression of the fusion proteins containing the structural proteins E, M or N in frame with the reporter protein EGFP. In Vero E6 cells, the antisense effect was dependent on the concentrations of the antisense PS‐ODNs in a range of 0–10 µM or 0–30 µM. CONCLUSIONS: The antisense PS‐ODNs are effective in downregulation of SARS. The findings indicate that antisense knockdown of SARS could be a useful strategy for treatment of SARS, and could also be suitable for studies of the pathological function of SARS genes in a cellular model system. Copyright © 2004 John Wiley & Sons, Ltd.

Severe acute respiratory syndrome (SARS) is a newly emerging infectious disease which has caught the attention not only of the scientific community, but also of the public. Infection is usually characterized by fever, dry cough, myalgia, and mild sore throat, which progresses to atypical pneumonia. SARS is caused by a newly identified virus within the family Coronaviridae [1] [2] [3] . This virus has been designated SARS coronavirus (SARS-CoV) [4] . The overall genome of many SARS-CoV strains has been sequenced. It is an enveloped, single-stranded, plus-sense RNA virus with a genome of ∼30 kb [5, 6] . From 1 November 2002 to 31 July 2003, 8098 cases and 774 deaths in 26 countries were reported as a result of SARS by the World Health Organization [7] . Although the initial global outbreak of SARS seems to be under control, SARS will remain a serious concern while there are no suitable measures for curing this disease.

The SARS genome encodes 23 putative proteins and the organization is typical of a coronavirus [5 -replicase (rep) , spike (S), envelope (E), membrane (M), and nucleocapsid (N) -3 ] . The SARS-CoV rep gene comprises approximately two-thirds of the genome and incorporates a ribosomal slippage site [5, 6, 8] . Translation without ribosomal frameshifting generates the Orf1a protein and the (−1) frameshift results in translation of the extended Orf1ab polyprotein [8] . These products are then auto-cleaved by the main proteinase (3CL pro ), which is encoded within the 5 -proximal region of the rep gene [9] , to generate several nonstructural proteins including the main proteinase (3CL pro ), the RNA-dependent RNA polymerase (RdRP) and the RNA helicase. The structural proteins S, E, M and N are common to all known coronaviruses [5] . They function during host cell entry and viron morphogenesis and release [10, 11] . During viron assembly, N binds to a defined packaging signal on viral RNA to form the helical nucleocapsid. M is localized at intracellular membrane structures. The interaction between the M and E proteins and nucleocapsids results in budding through the membrane. The S protein is a membranous glycoprotein and is important for viral entry and might define host range, tissue tropism and virulence [12, 13] .

Antisense technology has become a widely used research tool for the specific inhibition of gene expression. It has attracted considerable attention as a potential therapeutic strategy [14, 15] . Antisense oligodeoxynucleotides (ODNs), usually 18-21 nucleotides in length, could sequence-specifically hybridize to the target mRNA through Watson-Crick base pairing to form an mRNA/DNA duplex, which is then degraded by RNAse H, a ubiquitously expressed endonuclease which hydrolyses the RNA strand of the heteroduplex. The antisense ODNs might also physically block mRNA function (e.g. translation) or gene transcription [14] . Therefore, treatment based on an antisense technique only demands knowledge of the DNA sequence of the gene and not of the function of the protein. Antisense ODNs play potential roles in the treatment of many diseases, such as cancer, influenza, AIDS and other diseases [15] [16] [17] [18] [19] [20] [21] . The problems of nuclease sensitivity and lower cellular uptake limit antisense oligonucleotides in in vivo applications [22] . More stable oligonucleotide derivatives, such as methylphosphonates [23] , phosphorothioates [24] , and phosphoramidites [25] , have been designed. Among these derivatives, phosphorothioate oligonucleotide seems to be a potential antiviral therapeutic agent. In this study, we selected antisense phosphorothioated oligodeoxynucleotide (antisense PS-ODN, 20mer) complementary to 20-base segments within the transcripts of SARS-CoV structural proteins E, M and N.

The purpose of the present study was to establish a model to evaluate the effect of the antisense oligonucleotides on the expression of SARS-CoV gene expression and pick out good target sites within E, M, and N genes for antisense downregulation. We used transiently transfected Vero E6 cells expressing the exon of the E, M, or N protein of SARS-CoV or these exons in fusion with the enhanced green fluorescent protein (EGFP). Cells were then treated with the antisense oligonucleotides used by adding them to the culture medium, which then reached the nuclei and resulted in sequence-specific antisense downregulation of SARS-CoV gene expression.

We conclude that the antisense PS-ODNs could effectively and sequence-specifically downregulate SARS-CoV gene expression in a dose-dependent manner. We obtained six antisense PS-ODNs which could sequencespecifically reduce target gene expression by over 90% at the concentration of 50 µM in the cell culture medium. These findings suggest that antisense technology could be a useful strategy for treatment of SARS, and could also be suitable for studies of the pathological function of SARS genes.

The E, M and N gene expression vectors (pCDNA3.1/E, pCDNA3.1/M, and pCDNA3.1/N) were constructed and donated by Mr. Youhua Xie (Institute of Biochemistry and Cell Biology, SIBS, CAS). The E, M and N segments were released from these vectors and inserted 5 to the EGFP gene into the pEGFP-N3 N-terminal 'protein fusion mammalian expression vector' (Clontech) between the EcoR I and BamH I sites. Three plasmid constructs were generated: pEGFP/E, pEGFP/M, and pEGFP/N. All inserts were checked for orientation and correct frame by sequencing.

The Vero E6 cells (from the cell bank of the Institute of Biochemistry and Cell Biology, SIBS, CAS) were cultured in Dulbecco's modified Eagle's medium (DMEM), high glucose (Gibco), supplemented with 10% heat-inactivated fetal calf serum (FCS, Hyclone).

The Vero E6 cells were transiently transfected with the plasmid constructs described above with the use of Lipofectamine 2000 (Invitrogen). Following the manufacturer's instructions, the transfection procedures were optimized with respect to relative amounts of DNA and transfection agent and with respect to incubation time. The Vero E6 cells were seeded with 1 × 10 5 cells in each well of a 24-well plate one day before transfection.

Two µl Lipofectamine 2000 were mixed with 50 µl Opti-MEM I (Invitrogen) and incubated for 5 min at room temperature. 0.8 µg constructs were mixed with 50 µl Opti-MEM I, added to the Lipofectamine 2000/Opti-MEM I mix and incubated for 25 min at room temperature. The cells were washed with DMEM to remove serum and transfected with the construct/Lipofectamine 2000 mix in 500 µl DMEM. After 2 h, the antisense or control oligos were added to the medium. The cell cultures were supplemented with 10% FCS 6 h post-transfection and grew until fluorescence microscopy or harvesting for RT-PCR analysis.

The viability of the cells was tested by removing the cells from the culture plate and counting with a haemocytometer after trypan blue staining. The total number of living and dead cells was then calculated.

Oligos, phosphorothioate-substituted in all positions, were FPLC-purified (Pharmacia Biotech). The sequences of the antisense oligos are described in Table 1 . The scrambled oligo had a randomly chosen sequence.

The total RNA of the cells were extracted by using TRIZOL reagent (Invitrogen) and digested by RQ1 DNase (Rnasefree, Promega) at 37 • C for 30 min. The DNase was then heat-inactivated at 65 • C for 10 min. The sequences of the primers for the detection of E gene expression are: 5 ATGTACTCATTCGTTTCGGAA 3 (forward) and 5 TTAGACCAGAAGATCAGGAAC 3 (reverse). The primers for the M gene are: 5 ATGTTACTACAATTTGCCTATTC 3 and 5 ACGCTCCTAATTTGTAATAAGA 3 . The primers for the N gene are: 5 ATGTCTGATAATGGACCCCAA 3 and 5 GCCAGGAGTTGAATTTCTTGA 3 . The primers for β-actin are: 5 GTGCCAC CAGACAGCACTGTGTTG 3 and 5 TGGAGAAGAGCTATGAGCTGCCTG 3 . Singletube and one-step RT-PCR were performed with the One-step RNA PCR kit (TaKaRa). Each reaction mixture contained 1× buffer, each deoxynucleotide triphosphate at a concentration of 1 mM, each primer at a concentration of 0.4 µM, MgCl 2 at a concentration of 5 mM, 40 U of RNase inhibitor, 5 U of AMV reverse transcriptase, 5 U of AMV-optimized Taq, and 1 µg of extracted RNA brought to a volume of 50 µl with diethyl pyrocarbonate (DEPC)treated water. After an initial incubation for 30 min at 50 • C followed by denaturation at 94 • C for 4 min, 28 cycles of amplification were performed by using a thermo profile of 94 • C for 30 s and 58 • C for 30 s, with a final extension at 72 • C for 30 s. The amplification products were analyzed by electrophoresis on a 2% agarose gel and stained with ethidium bromide.

The Vero E6 cells were seeded on coverslips in the wells of 6-well plates (500 000 cells/well) and transfected as 

The uptake of the antisense PS-ODN and its stability in Vero E6 cells

The method of administration of the antisense oligo is crucial for the inhibition effect obtained in Vero E6 cells. The down-regulation effect of antisense PS-ODN added to the culture medium as a free oligonucleotide is varied between different cell types. This could be due to different intracellular concentrations of the PS-ODN, to cell-type-specific differences in the level of RNase H, which is supposed to be a main factor in antisense inhibition of gene expression mediated by PS-ODNs [26] . (Figure 3 ). The expression did not vary for increasing concentrations of the scrambled oligo within this range suggesting that the inhibition obtained with the antisense oligo was 

sequence-specific ( Figure 3A) . We tested for different toxicities of the oligos in a setup using 2, 10, 30, and 50 µM of the No.13 oligo. The total number of living and dead cells at the termination of the experiment revealed no significant differences between the antisensetreated and the scrambled-treated cultures (Table 3 ). This indicates that the observed antisense downregulation of SARS-CoV gene expression is not due to toxic effects of these oligos.

To further study the antisense inhibition effects, we targeting E and N respectively had no effect on M-EGFP ( Figures 5B and 5E ). The No. 18 and No.20 antisense PS-ODNs could reduce the expression of the N-EGFP protein, whereas the No. 4 and No.13 antisense PS-ODNs targeting E and M respectively had no effect on N-EGFP ( Figures 5C and 5F ). The scrambled oligo had no effect on the expressions of these three EGFP fusion proteins. All these data further proved that the antisense PS-ODNs could specifically block the expression of E, M, and N proteins in mammalian cells. FAM-labeled antisense PS-ODN had demonstrated that it could remain stably in the cytoplasm and the nucleus for 5 days. Therefore, we tested if the inhibition effect Figure 6 ).

The genome of coronavirus encodes 23 putative proteins, including four major structural proteins; nucleocapsid (N), spike (S), membrane (M), and small envelope (E), which play essential roles during host cell entry, viral morphogenesis and release [10, 11] . These structural proteins were attractive targets for the development of an anti-SARS agent. Among these proteins, we selected E, M, and N as the targets of antisense oligos. A characteristic of RNA viruses is the high rate of genetic mutation, which leads to evolution of new viral strains and is a mechanism by which viruses escape host defenses. The spike protein, a glycoprotein projection on the viral surface, was crucial for viral attachment and entry into the host cell. In addition, variations of S protein among strains of coronavirus are responsible for host range and tissue tropism [27] . China confirmed a new case of SARS on January 5, 2004. It is the country's first new case since the outbreak last year. The results of genetic sequencing of samples from the latest patient with SARS show that variation of the S gene existed in this SARS-CoV strain [28] . Since the S1 subunit of the spike protein is the major antigenic moiety for coronaviruses and is not an essential structural protein, it is prone to high mutation rates as the virus evolves in host populations [29] . Therefore, we have not chosen the S protein as a target of antisense oligos. In this work, we have evaluated the down-regulation effects of 26 antisense PS-ODNs targeting different sites along the open reading frames (ORFs) of E, M, and N proteins and obtained 12 antisense oligos which could reduce target gene expression by over 50% in Vero E6 cells at the concentration of 50 µM in the culture medium. Therefore, we could have many choices when one target site is mutated.

Human coronaviruses are usually difficult to culture in vitro, whereas most animal coronaviruses and SARS-CoV can be easily cultured in African green monkey kidney (Vero E6) cells [30] . Direct cytopathic effects of SARS-CoV could be demonstrated on inoculating the viral isolates into Vero E6 cells [3, 5, 31] , which makes Vero E6 cells a suitable model for the study of the antisense effect. Because SARS is dangerous for its high morbidity and mortality rates, it is safer and more convenient to study anti-SARS agents by using Vero E6 cells transfected with SARS-CoV gene expression vectors. In this cell model, we obtained an antisense sequence-specific downregulation of SARS-CoV gene expression as seen from the results of RT-PCR and from a reduced fluorescence intensity of EGFP to which the SARS-CoV protein E, M, or N was fused.

A problem in the use of antisense oligonucleotides is their inefficient cellular uptake. They are found mainly in endosomes and lysosomes [32, 33] . Therefore, we used high concentrations of the free antisense PS-ODNs in the cell culture medium to increase the intracellular concentrations of the PS-ODNs. In experiments with FAM-labeled antisense oligos in concentrations of 50 µM, we observed that most Vero E6 cells internalized antisense oligos in the cytoplasm and about 5% of the Vero E6 cells showed nuclear uptake of the oligo. The FAM-labeled PS-ODN also showed high stability in Vero E6 cells. In accordance with this, we obtained a long antisense downregulation effect in Vero E6 cells. As antisense PS-ODNs may not work well in in vivo treatment of diseases because of a fast breakdown and of possible toxicity, more suitable antisense oligonucleotide derivatives have been developed for therapeutic use, for example, NeuGenes antisense compounds (AVI Biopharma [34]) and locked oligonucleotides. They displayed advantageous pharmaceutical properties in stability, specificity, efficacy, delivery and safety. However, the PS-ODNs can play an important role in further studies of pathological functions of SARS genes in the Vero E6 cell model for a future treatment and cure.

Taken together, we have found some good target sites for antisense downregulation of SARS-CoV gene expression. Our present results indicate a sequencespecific down-regulation effect of antisense PS-ODN (20mer) in Vero E6 cells, and we found an effective range of concentrations, where the antisense oligo inhibited expression of the E, M, and N genes of SARS-CoV in a concentration-dependent manner. The antisense PS-ODNs can be developed into effective anti-SARS agents. Besides being a potential therapeutic tool, antisense oligonucleotides provide a highly selective means to study the pathological functions of SARS-CoV genes.

Identification of a novel coronavirus in patients with severe acute respiratory syndrome

A novel coronavirus associated with severe acute respiratory syndrome

Coronavirus as a possible cause of severe acute respiratory syndrome

Update 31: coronavirus never before seen in humans is the cause of SARS

Characterization of a novel coronavirus associated with severe acute respiratory syndrome

The genome sequence of the SARS-associated coronavirus

Murine coronavirus spike glycoprotein medicates degree of viral spread, inflammation and virus-induced immunopathology in the central nervous system

Coronavirus spike proteins in viral entry and pathogenesis

Antisense DNA and RNA strategies: new approaches to therapy

Antisense oligonucleotide-based therapeutics for cancer

Supression of influenza A virus growth in mice by a PB2-as antisense oligonucleotide

Selective inhibition of the cytopathic effect of type A influenza virus by oligonucleotides covalently linked to an intercalating agent

Regulation of viral expression of HIV in vitro by an antisense phosphorothioate oligodeoxynucleotide against rev in chronically infected cells

Phosphorothioate analogues of oligodeoxyribonucleotides: synthesis and activity as inhibitors of replication of human immunodeficiency virus

Anti-HIV activities and physicochemical properties of phosphorothioate analogues complementary to HIV sequences

Inhibition of Rous sarcoma virus replication and transformation by a specific oligodeoxynucleotide

Specific regulation of gene expression by antisense, sense and antigene nucleic acids

Control ribonuleic acid function by oligonucleotide methylphosphonates

Automated solid-phase synthesis, separation, and stereochemistry of phosphorothioate analogs of oligodeoxyribonucleotides

Phosphoramidate, phosphorothioate, and methylphosphonate analogs of oligodeoxynucleotide: inhibitors of replication of human immunodeficiency virus

The involvement of human ribonucleases H1 and H2 in the variation of response of cells to antisense phosphorothioate oligonucleotides

Retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier

WHO confirms SARS in Chinese journalist

Comparative full-length genome sequence analysis of 14 SARS coronavirus isolates and common mutations associated with putative origins of infection

Identification of a novel coronavirus in patients with severe acute respiratory syndrome

Proliferative grown of SARS coronavirus in Vero E6 cells

Antisense oligonucleotides as therapeutic agents -is the bullet really magical?

Problems in interpretation of data derived from in vitro and in vivo use of antisense oligodeoxynucleotides

We thank Professor Xirui Ge for giving us the Vero E6 cell line and Dr. Youhua Xie for donating us three plasmids: pCDNA3/E, pCDNA3/M, and pCDNA3/N. This work was supported by Grant No. 2003AA208215 from the National High Technology Programs of China and Grant No. 03DZ14103 from the Science and Technology Commission of Shanghai Municipality.