id	sid	tid	token	lemma	pos
cord-269867-k10siwur	1	1	key	key	JJ
cord-269867-k10siwur	1	2	:	:	:
cord-269867-k10siwur	1	3	cord-269867-k10siwur	cord-269867-k10siwur	NN
cord-269867-k10siwur	1	4	authors	author	NNS
cord-269867-k10siwur	1	5	:	:	:
cord-269867-k10siwur	1	6	Méchin	Méchin	NNP
cord-269867-k10siwur	1	7	,	,	,
cord-269867-k10siwur	1	8	Marie	Marie	NNP
cord-269867-k10siwur	1	9	-	-	HYPH
cord-269867-k10siwur	1	10	Claire	Claire	NNP
cord-269867-k10siwur	1	11	;	;	:
cord-269867-k10siwur	1	12	Der	Der	NNP
cord-269867-k10siwur	1	13	Vartanian	Vartanian	NNP
cord-269867-k10siwur	1	14	,	,	,
cord-269867-k10siwur	1	15	Maurice	Maurice	NNP
cord-269867-k10siwur	1	16	;	;	:
cord-269867-k10siwur	1	17	Martin	Martin	NNP
cord-269867-k10siwur	1	18	,	,	,
cord-269867-k10siwur	1	19	Christine	Christine	NNP
cord-269867-k10siwur	1	20	title	title	NN
cord-269867-k10siwur	1	21	:	:	:
cord-269867-k10siwur	1	22	The	the	DT
cord-269867-k10siwur	1	23	major	major	JJ
cord-269867-k10siwur	1	24	subunit	subunit	NN
cord-269867-k10siwur	1	25	ClpG	ClpG	NNP
cord-269867-k10siwur	1	26	of	of	IN
cord-269867-k10siwur	1	27	Escherichia	Escherichia	NNP
cord-269867-k10siwur	1	28	coli	coli	NNS
cord-269867-k10siwur	1	29	CS31A	CS31A	NNP
cord-269867-k10siwur	1	30	fibrillae	fibrillae	NNP
cord-269867-k10siwur	1	31	as	as	IN
cord-269867-k10siwur	1	32	an	an	DT
cord-269867-k10siwur	1	33	expression	expression	NN
cord-269867-k10siwur	1	34	vector	vector	NN
cord-269867-k10siwur	1	35	for	for	IN
cord-269867-k10siwur	1	36	different	different	JJ
cord-269867-k10siwur	1	37	combinations	combination	NNS
cord-269867-k10siwur	1	38	of	of	IN
cord-269867-k10siwur	1	39	two	two	CD
cord-269867-k10siwur	1	40	TGEV	TGEV	NNP
cord-269867-k10siwur	1	41	coronavirus	coronavirus	NN
cord-269867-k10siwur	1	42	epitopes	epitope	NNS
cord-269867-k10siwur	1	43	date	date	NN
cord-269867-k10siwur	1	44	:	:	:
cord-269867-k10siwur	1	45	1996	1996	CD
cord-269867-k10siwur	1	46	-	-	SYM
cord-269867-k10siwur	1	47	12	12	CD
cord-269867-k10siwur	1	48	-	-	SYM
cord-269867-k10siwur	1	49	31	31	CD
cord-269867-k10siwur	1	50	journal	journal	NN
cord-269867-k10siwur	1	51	:	:	:
cord-269867-k10siwur	2	1	Gene	gene	NN
cord-269867-k10siwur	2	2	DOI	DOI	NNP
cord-269867-k10siwur	2	3	:	:	:
cord-269867-k10siwur	2	4	10.1016	10.1016	CD
cord-269867-k10siwur	2	5	/	/	SYM
cord-269867-k10siwur	2	6	s0378	s0378	NNP
cord-269867-k10siwur	2	7	-	-	HYPH
cord-269867-k10siwur	2	8	1119(96)00348	1119(96)00348	NNP
cord-269867-k10siwur	2	9	-	-	HYPH
cord-269867-k10siwur	2	10	4	4	CD
cord-269867-k10siwur	2	11	sha	sha	NNP
cord-269867-k10siwur	2	12	:	:	:
cord-269867-k10siwur	3	1	b151730d74e21025def6ee80cd69132d3a4a2e21	b151730d74e21025def6ee80cd69132d3a4a2e21	NNP
cord-269867-k10siwur	3	2	doc_id	doc_id	CD
cord-269867-k10siwur	3	3	:	:	:
cord-269867-k10siwur	3	4	269867	269867	CD
cord-269867-k10siwur	4	1	cord_uid	cord_uid	NN
cord-269867-k10siwur	4	2	:	:	:
cord-269867-k10siwur	5	1	k10siwur	k10siwur	NNP
cord-269867-k10siwur	5	2	Abstract	Abstract	NNP
cord-269867-k10siwur	6	1	Previously	previously	RB
cord-269867-k10siwur	6	2	,	,	,
cord-269867-k10siwur	6	3	two	two	CD
cord-269867-k10siwur	6	4	B	b	NN
cord-269867-k10siwur	6	5	-	-	HYPH
cord-269867-k10siwur	6	6	cell	cell	NN
cord-269867-k10siwur	6	7	epitopes	epitope	NNS
cord-269867-k10siwur	6	8	from	from	IN
cord-269867-k10siwur	6	9	the	the	DT
cord-269867-k10siwur	6	10	entero	entero	NNP
cord-269867-k10siwur	6	11	-	-	HYPH
cord-269867-k10siwur	6	12	pathogenic	pathogenic	JJ
cord-269867-k10siwur	6	13	transmissible	transmissible	JJ
cord-269867-k10siwur	6	14	gastroenteritis	gastroenteritis	NN
cord-269867-k10siwur	6	15	virus	virus	NN
cord-269867-k10siwur	6	16	(	(	-LRB-
cord-269867-k10siwur	6	17	TGEV	TGEV	NNP
cord-269867-k10siwur	6	18	)	)	-RRB-
cord-269867-k10siwur	6	19	,	,	,
cord-269867-k10siwur	6	20	namely	namely	RB
cord-269867-k10siwur	6	21	the	the	DT
cord-269867-k10siwur	6	22	C	C	NNP
cord-269867-k10siwur	6	23	epitope	epitope	NN
cord-269867-k10siwur	6	24	(	(	-LRB-
cord-269867-k10siwur	6	25	TGEV	TGEV	NNP
cord-269867-k10siwur	6	26	-	-	HYPH
cord-269867-k10siwur	6	27	C	C	NNP
cord-269867-k10siwur	6	28	)	)	-RRB-
cord-269867-k10siwur	6	29	amino	amino	NN
cord-269867-k10siwur	6	30	acids	acid	NNS
cord-269867-k10siwur	6	31	(	(	-LRB-
cord-269867-k10siwur	6	32	aa	aa	NNP
cord-269867-k10siwur	6	33	)	)	-RRB-
cord-269867-k10siwur	7	1	363–371	363–371	CD
cord-269867-k10siwur	7	2	and	and	CC
cord-269867-k10siwur	7	3	the	the	DT
cord-269867-k10siwur	7	4	A	a	DT
cord-269867-k10siwur	7	5	epitope	epitope	NN
cord-269867-k10siwur	7	6	(	(	-LRB-
cord-269867-k10siwur	7	7	TGEV	TGEV	NNP
cord-269867-k10siwur	7	8	-	-	HYPH
cord-269867-k10siwur	7	9	A	a	NN
cord-269867-k10siwur	7	10	)	)	-RRB-
cord-269867-k10siwur	8	1	aa	aa	NNP
cord-269867-k10siwur	8	2	522–531	522–531	CD
cord-269867-k10siwur	8	3	of	of	IN
cord-269867-k10siwur	8	4	the	the	DT
cord-269867-k10siwur	8	5	spike	spike	NN
cord-269867-k10siwur	8	6	S	s	NN
cord-269867-k10siwur	8	7	protein	protein	NN
cord-269867-k10siwur	8	8	(	(	-LRB-
cord-269867-k10siwur	8	9	TGEV	TGEV	NNP
cord-269867-k10siwur	8	10	-	-	HYPH
cord-269867-k10siwur	8	11	S	S	NNP
cord-269867-k10siwur	8	12	)	)	-RRB-
cord-269867-k10siwur	8	13	,	,	,
cord-269867-k10siwur	8	14	have	have	VBP
cord-269867-k10siwur	8	15	been	be	VBN
cord-269867-k10siwur	8	16	separately	separately	RB
cord-269867-k10siwur	8	17	expressed	express	VBN
cord-269867-k10siwur	8	18	on	on	IN
cord-269867-k10siwur	8	19	the	the	DT
cord-269867-k10siwur	8	20	CS31A	cs31a	NN
cord-269867-k10siwur	8	21	fibrillae	fibrillae	NNP
cord-269867-k10siwur	8	22	at	at	IN
cord-269867-k10siwur	8	23	the	the	DT
cord-269867-k10siwur	8	24	surface	surface	NN
cord-269867-k10siwur	8	25	of	of	IN
cord-269867-k10siwur	8	26	Escherichia	Escherichia	NNP
cord-269867-k10siwur	8	27	coli	coli	NNS
cord-269867-k10siwur	8	28	following	follow	VBG
cord-269867-k10siwur	8	29	insertion	insertion	NN
cord-269867-k10siwur	8	30	into	into	IN
cord-269867-k10siwur	8	31	a	a	DT
cord-269867-k10siwur	8	32	same	same	JJ
cord-269867-k10siwur	8	33	region	region	NN
cord-269867-k10siwur	8	34	of	of	IN
cord-269867-k10siwur	8	35	ClpG.	ClpG.	.
cord-269867-k10siwur	9	1	However	however	RB
cord-269867-k10siwur	9	2	,	,	,
cord-269867-k10siwur	9	3	the	the	DT
cord-269867-k10siwur	9	4	resulting	result	VBG
cord-269867-k10siwur	9	5	chimeras	chimera	NNS
cord-269867-k10siwur	9	6	induced	induce	VBD
cord-269867-k10siwur	9	7	a	a	DT
cord-269867-k10siwur	9	8	marginal	marginal	JJ
cord-269867-k10siwur	9	9	TGEV	TGEV	NNP
cord-269867-k10siwur	9	10	-	-	HYPH
cord-269867-k10siwur	9	11	neutralizing	neutralize	VBG
cord-269867-k10siwur	9	12	antibody	antibody	NN
cord-269867-k10siwur	9	13	(	(	-LRB-
cord-269867-k10siwur	9	14	Ab	ab	NN
cord-269867-k10siwur	9	15	)	)	-RRB-
cord-269867-k10siwur	9	16	response	response	NN
cord-269867-k10siwur	9	17	in	in	IN
cord-269867-k10siwur	9	18	mice	mouse	NNS
cord-269867-k10siwur	9	19	.	.	.
cord-269867-k10siwur	10	1	Here	here	RB
cord-269867-k10siwur	10	2	,	,	,
cord-269867-k10siwur	10	3	with	with	IN
cord-269867-k10siwur	10	4	the	the	DT
cord-269867-k10siwur	10	5	view	view	NN
cord-269867-k10siwur	10	6	to	to	IN
cord-269867-k10siwur	10	7	improving	improve	VBG
cord-269867-k10siwur	10	8	this	this	DT
cord-269867-k10siwur	10	9	response	response	NN
cord-269867-k10siwur	10	10	,	,	,
cord-269867-k10siwur	10	11	we	-PRON-	PRP
cord-269867-k10siwur	10	12	introduced	introduce	VBD
cord-269867-k10siwur	10	13	TGEV	TGEV	NNP
cord-269867-k10siwur	10	14	-	-	HYPH
cord-269867-k10siwur	10	15	C	C	NNP
cord-269867-k10siwur	10	16	alone	alone	RB
cord-269867-k10siwur	10	17	or	or	CC
cord-269867-k10siwur	10	18	in	in	IN
cord-269867-k10siwur	10	19	different	different	JJ
cord-269867-k10siwur	10	20	tandem	tandem	NN
cord-269867-k10siwur	10	21	association	association	NN
cord-269867-k10siwur	10	22	with	with	IN
cord-269867-k10siwur	10	23	TGEV	TGEV	NNP
cord-269867-k10siwur	10	24	-	-	HYPH
cord-269867-k10siwur	10	25	A	A	NNP
cord-269867-k10siwur	10	26	(	(	-LRB-
cord-269867-k10siwur	10	27	A::C	a::c	JJ
cord-269867-k10siwur	10	28	or	or	CC
cord-269867-k10siwur	10	29	C::A	C::A	NNP
cord-269867-k10siwur	10	30	)	)	-RRB-
cord-269867-k10siwur	10	31	in	in	IN
cord-269867-k10siwur	10	32	twelve	twelve	CD
cord-269867-k10siwur	10	33	putatively	putatively	RB
cord-269867-k10siwur	10	34	exposed	expose	VBN
cord-269867-k10siwur	10	35	regions	region	NNS
cord-269867-k10siwur	10	36	of	of	IN
cord-269867-k10siwur	10	37	ClpG.	ClpG.	.
cord-269867-k10siwur	11	1	Among	among	IN
cord-269867-k10siwur	11	2	the	the	DT
cord-269867-k10siwur	11	3	28	28	CD
cord-269867-k10siwur	11	4	resulting	result	VBG
cord-269867-k10siwur	11	5	engineered	engineer	VBN
cord-269867-k10siwur	11	6	proteins	protein	NNS
cord-269867-k10siwur	11	7	only	only	RB
cord-269867-k10siwur	11	8	15	15	CD
cord-269867-k10siwur	11	9	,	,	,
cord-269867-k10siwur	11	10	carrying	carry	VBG
cord-269867-k10siwur	11	11	up	up	RP
cord-269867-k10siwur	11	12	to	to	TO
cord-269867-k10siwur	11	13	51	51	CD
cord-269867-k10siwur	11	14	extra	extra	JJ
cord-269867-k10siwur	11	15	aa	aa	NN
cord-269867-k10siwur	11	16	,	,	,
cord-269867-k10siwur	11	17	had	have	VBD
cord-269867-k10siwur	11	18	not	not	RB
cord-269867-k10siwur	11	19	essentially	essentially	RB
cord-269867-k10siwur	11	20	disturbed	disturb	VBN
cord-269867-k10siwur	11	21	the	the	DT
cord-269867-k10siwur	11	22	correct	correct	JJ
cord-269867-k10siwur	11	23	CS31A	cs31a	NN
cord-269867-k10siwur	11	24	fibrillae	fibrillae	NNP
cord-269867-k10siwur	11	25	formation	formation	NN
cord-269867-k10siwur	11	26	process	process	NN
cord-269867-k10siwur	11	27	.	.	.
cord-269867-k10siwur	12	1	Six	six	CD
cord-269867-k10siwur	12	2	partially	partially	RB
cord-269867-k10siwur	12	3	permissive	permissive	JJ
cord-269867-k10siwur	12	4	sites	site	NNS
cord-269867-k10siwur	12	5	accepting	accept	VBG
cord-269867-k10siwur	12	6	only	only	RB
cord-269867-k10siwur	12	7	TGEV	TGEV	NNP
cord-269867-k10siwur	12	8	-	-	HYPH
cord-269867-k10siwur	12	9	C	C	NNP
cord-269867-k10siwur	12	10	and	and	CC
cord-269867-k10siwur	12	11	three	three	CD
cord-269867-k10siwur	12	12	highly	highly	RB
cord-269867-k10siwur	12	13	permissive	permissive	JJ
cord-269867-k10siwur	12	14	sites	site	NNS
cord-269867-k10siwur	12	15	tolerating	tolerate	VBG
cord-269867-k10siwur	12	16	A::C	a::c	JJ
cord-269867-k10siwur	12	17	or	or	CC
cord-269867-k10siwur	12	18	C::A	c::a	JJ
cord-269867-k10siwur	12	19	tandem	tandem	NN
cord-269867-k10siwur	12	20	peptide	peptide	NN
cord-269867-k10siwur	12	21	,	,	,
cord-269867-k10siwur	12	22	were	be	VBD
cord-269867-k10siwur	12	23	identified	identify	VBN
cord-269867-k10siwur	12	24	throughout	throughout	IN
cord-269867-k10siwur	12	25	ClpG.	ClpG.	.
cord-269867-k10siwur	13	1	Intact	intact	JJ
cord-269867-k10siwur	13	2	bacteria	bacteria	NNS
cord-269867-k10siwur	13	3	or	or	CC
cord-269867-k10siwur	13	4	extracted	extract	VBN
cord-269867-k10siwur	13	5	CS31A	cs31a	NN
cord-269867-k10siwur	13	6	hybrid	hybrid	JJ
cord-269867-k10siwur	13	7	fibrillae	fibrillae	NNP
cord-269867-k10siwur	13	8	expressing	express	VBG
cord-269867-k10siwur	13	9	TGEV	TGEV	NNP
cord-269867-k10siwur	13	10	epitopes	epitope	NNS
cord-269867-k10siwur	13	11	at	at	IN
cord-269867-k10siwur	13	12	any	any	DT
cord-269867-k10siwur	13	13	of	of	IN
cord-269867-k10siwur	13	14	the	the	DT
cord-269867-k10siwur	13	15	permissive	permissive	JJ
cord-269867-k10siwur	13	16	sites	site	NNS
cord-269867-k10siwur	13	17	,	,	,
cord-269867-k10siwur	13	18	were	be	VBD
cord-269867-k10siwur	13	19	recognized	recognize	VBN
cord-269867-k10siwur	13	20	by	by	IN
cord-269867-k10siwur	13	21	Ab	Ab	NNP
cord-269867-k10siwur	13	22	directed	direct	VBN
cord-269867-k10siwur	13	23	against	against	IN
cord-269867-k10siwur	13	24	the	the	DT
cord-269867-k10siwur	13	25	foreign	foreign	JJ
cord-269867-k10siwur	13	26	parent	parent	NN
cord-269867-k10siwur	13	27	protein	protein	NN
cord-269867-k10siwur	13	28	,	,	,
cord-269867-k10siwur	13	29	providing	provide	VBG
cord-269867-k10siwur	13	30	a	a	DT
cord-269867-k10siwur	13	31	direct	direct	JJ
cord-269867-k10siwur	13	32	argument	argument	NN
cord-269867-k10siwur	13	33	for	for	IN
cord-269867-k10siwur	13	34	exposure	exposure	NN
cord-269867-k10siwur	13	35	of	of	IN
cord-269867-k10siwur	13	36	the	the	DT
cord-269867-k10siwur	13	37	corresponding	correspond	VBG
cord-269867-k10siwur	13	38	ClpG	ClpG	NNP
cord-269867-k10siwur	13	39	region	region	NN
cord-269867-k10siwur	13	40	at	at	IN
cord-269867-k10siwur	13	41	the	the	DT
cord-269867-k10siwur	13	42	cell	cell	NN
cord-269867-k10siwur	13	43	surface	surface	NN
cord-269867-k10siwur	13	44	and	and	CC
cord-269867-k10siwur	13	45	for	for	IN
cord-269867-k10siwur	13	46	antigenicity	antigenicity	NN
cord-269867-k10siwur	13	47	of	of	IN
cord-269867-k10siwur	13	48	the	the	DT
cord-269867-k10siwur	13	49	epitopes	epitope	NNS
cord-269867-k10siwur	13	50	in	in	IN
cord-269867-k10siwur	13	51	the	the	DT
cord-269867-k10siwur	13	52	polymeric	polymeric	JJ
cord-269867-k10siwur	13	53	CS31A	cs31a	NN
cord-269867-k10siwur	13	54	fibrillae	fibrillae	NNP
cord-269867-k10siwur	13	55	context	context	NN
cord-269867-k10siwur	13	56	.	.	.
cord-269867-k10siwur	14	1	The	the	DT
cord-269867-k10siwur	14	2	potential	potential	NN
cord-269867-k10siwur	14	3	of	of	IN
cord-269867-k10siwur	14	4	CS31A	CS31A	NNP
cord-269867-k10siwur	14	5	fibrillae	fibrillae	NNP
cord-269867-k10siwur	14	6	as	as	IN
cord-269867-k10siwur	14	7	carriers	carrier	NNS
cord-269867-k10siwur	14	8	of	of	IN
cord-269867-k10siwur	14	9	the	the	DT
cord-269867-k10siwur	14	10	TGEV	TGEV	NNP
cord-269867-k10siwur	14	11	peptides	peptide	NNS
cord-269867-k10siwur	14	12	indicates	indicate	VBZ
cord-269867-k10siwur	14	13	that	that	IN
cord-269867-k10siwur	14	14	there	there	EX
cord-269867-k10siwur	14	15	may	may	MD
cord-269867-k10siwur	14	16	be	be	VB
cord-269867-k10siwur	14	17	three	three	CD
cord-269867-k10siwur	14	18	positions	position	NNS
cord-269867-k10siwur	14	19	(	(	-LRB-
cord-269867-k10siwur	14	20	N	n	CD
cord-269867-k10siwur	14	21	terminus	terminus	NN
cord-269867-k10siwur	14	22	,	,	,
cord-269867-k10siwur	14	23	aa	aa	NNP
cord-269867-k10siwur	14	24	202–204	202–204	CD
cord-269867-k10siwur	14	25	and	and	CC
cord-269867-k10siwur	14	26	202–218	202–218	CD
cord-269867-k10siwur	14	27	)	)	-RRB-
cord-269867-k10siwur	14	28	in	in	IN
cord-269867-k10siwur	14	29	ClpG	ClpG	NNP
cord-269867-k10siwur	14	30	which	which	WDT
cord-269867-k10siwur	14	31	may	may	MD
cord-269867-k10siwur	14	32	turn	turn	VB
cord-269867-k10siwur	14	33	out	out	RP
cord-269867-k10siwur	14	34	to	to	TO
cord-269867-k10siwur	14	35	be	be	VB
cord-269867-k10siwur	14	36	important	important	JJ
cord-269867-k10siwur	14	37	fusion	fusion	NN
cord-269867-k10siwur	14	38	sites	site	NNS
cord-269867-k10siwur	14	39	and	and	CC
cord-269867-k10siwur	14	40	therefore	therefore	RB
cord-269867-k10siwur	14	41	be	be	VB
cord-269867-k10siwur	14	42	relevant	relevant	JJ
cord-269867-k10siwur	14	43	for	for	IN
cord-269867-k10siwur	14	44	the	the	DT
cord-269867-k10siwur	14	45	eventual	eventual	JJ
cord-269867-k10siwur	14	46	design	design	NN
cord-269867-k10siwur	14	47	of	of	IN
cord-269867-k10siwur	14	48	TGEV	TGEV	NNP
cord-269867-k10siwur	14	49	vaccines	vaccine	NNS
cord-269867-k10siwur	14	50	.	.	.
cord-269867-k10siwur	15	1	Unexpectedly	unexpectedly	RB
cord-269867-k10siwur	15	2	,	,	,
cord-269867-k10siwur	15	3	TGEV	TGEV	NNP
cord-269867-k10siwur	15	4	-	-	HYPH
cord-269867-k10siwur	15	5	A	A	NNP
cord-269867-k10siwur	15	6	,	,	,
cord-269867-k10siwur	15	7	whatever	whatever	WDT
cord-269867-k10siwur	15	8	its	-PRON-	PRP$
cord-269867-k10siwur	15	9	position	position	NN
cord-269867-k10siwur	15	10	in	in	IN
cord-269867-k10siwur	15	11	ClpG	ClpG	NNP
cord-269867-k10siwur	15	12	,	,	,
cord-269867-k10siwur	15	13	mediated	mediate	VBD
cord-269867-k10siwur	15	14	the	the	DT
cord-269867-k10siwur	15	15	partial	partial	JJ
cord-269867-k10siwur	15	16	proteolytic	proteolytic	JJ
cord-269867-k10siwur	15	17	degradation	degradation	NN
cord-269867-k10siwur	15	18	of	of	IN
cord-269867-k10siwur	15	19	the	the	DT
cord-269867-k10siwur	15	20	hybrid	hybrid	JJ
cord-269867-k10siwur	15	21	proteins	protein	NNS
cord-269867-k10siwur	15	22	,	,	,
cord-269867-k10siwur	15	23	suggesting	suggest	VBG
cord-269867-k10siwur	15	24	that	that	IN
cord-269867-k10siwur	15	25	it	-PRON-	PRP
cord-269867-k10siwur	15	26	functions	function	VBZ
cord-269867-k10siwur	15	27	as	as	IN
cord-269867-k10siwur	15	28	a	a	DT
cord-269867-k10siwur	15	29	substrate	substrate	NN
cord-269867-k10siwur	15	30	for	for	IN
cord-269867-k10siwur	15	31	a	a	DT
cord-269867-k10siwur	15	32	cellular	cellular	JJ
cord-269867-k10siwur	15	33	protease	protease	NN
cord-269867-k10siwur	15	34	,	,	,
cord-269867-k10siwur	15	35	and	and	CC
cord-269867-k10siwur	15	36	thereby	thereby	RB
cord-269867-k10siwur	15	37	that	that	IN
cord-269867-k10siwur	15	38	its	-PRON-	PRP$
cord-269867-k10siwur	15	39	suitability	suitability	NN
cord-269867-k10siwur	15	40	as	as	IN
cord-269867-k10siwur	15	41	a	a	DT
cord-269867-k10siwur	15	42	vaccine	vaccine	NN
cord-269867-k10siwur	15	43	antigen	antigen	NN
cord-269867-k10siwur	15	44	candidate	candidate	NN
cord-269867-k10siwur	15	45	is	be	VBZ
cord-269867-k10siwur	15	46	doubtful	doubtful	JJ
cord-269867-k10siwur	15	47	.	.	.
cord-269867-k10siwur	16	1	Epitope	epitope	NN
cord-269867-k10siwur	16	2	-	-	HYPH
cord-269867-k10siwur	16	3	based	base	VBN
cord-269867-k10siwur	16	4	recombinant	recombinant	JJ
cord-269867-k10siwur	16	5	vaccine	vaccine	NN
cord-269867-k10siwur	16	6	technologies	technology	NNS
cord-269867-k10siwur	16	7	offer	offer	VBP
cord-269867-k10siwur	16	8	the	the	DT
cord-269867-k10siwur	16	9	potential	potential	NN
cord-269867-k10siwur	16	10	for	for	IN
cord-269867-k10siwur	16	11	oral	oral	JJ
cord-269867-k10siwur	16	12	or	or	CC
cord-269867-k10siwur	16	13	mucosal	mucosal	JJ
cord-269867-k10siwur	16	14	delivery	delivery	NN
cord-269867-k10siwur	16	15	,	,	,
cord-269867-k10siwur	16	16	especially	especially	RB
cord-269867-k10siwur	16	17	when	when	WRB
cord-269867-k10siwur	16	18	the	the	DT
cord-269867-k10siwur	16	19	relevant	relevant	JJ
cord-269867-k10siwur	16	20	epitope	epitope	NN
cord-269867-k10siwur	16	21	genetically	genetically	RB
cord-269867-k10siwur	16	22	fused	fuse	VBN
cord-269867-k10siwur	16	23	to	to	IN
cord-269867-k10siwur	16	24	a	a	DT
cord-269867-k10siwur	16	25	carrier	carrier	NN
cord-269867-k10siwur	16	26	protein	protein	NN
cord-269867-k10siwur	16	27	,	,	,
cord-269867-k10siwur	16	28	is	be	VBZ
cord-269867-k10siwur	16	29	displayed	display	VBN
cord-269867-k10siwur	16	30	as	as	IN
cord-269867-k10siwur	16	31	a	a	DT
cord-269867-k10siwur	16	32	heterologous	heterologous	JJ
cord-269867-k10siwur	16	33	peptide	peptide	NN
cord-269867-k10siwur	16	34	on	on	IN
cord-269867-k10siwur	16	35	the	the	DT
cord-269867-k10siwur	16	36	surface	surface	NN
cord-269867-k10siwur	16	37	of	of	IN
cord-269867-k10siwur	16	38	a	a	DT
cord-269867-k10siwur	16	39	bacterial	bacterial	JJ
cord-269867-k10siwur	16	40	strain	strain	NN
cord-269867-k10siwur	16	41	(	(	-LRB-
cord-269867-k10siwur	16	42	Rabinovich	Rabinovich	NNP
cord-269867-k10siwur	16	43	et	et	NNP
cord-269867-k10siwur	16	44	al	al	NNP
cord-269867-k10siwur	16	45	.	.	NNP
cord-269867-k10siwur	16	46	,	,	,
cord-269867-k10siwur	16	47	1994	1994	CD
cord-269867-k10siwur	16	48	)	)	-RRB-
cord-269867-k10siwur	16	49	.	.	.
cord-269867-k10siwur	17	1	However	however	RB
cord-269867-k10siwur	17	2	,	,	,
cord-269867-k10siwur	17	3	coupling	couple	VBG
cord-269867-k10siwur	17	4	foreign	foreign	JJ
cord-269867-k10siwur	17	5	peptides	peptide	NNS
cord-269867-k10siwur	17	6	to	to	IN
cord-269867-k10siwur	17	7	carriers	carrier	NNS
cord-269867-k10siwur	17	8	can	can	MD
cord-269867-k10siwur	17	9	result	result	VB
cord-269867-k10siwur	17	10	in	in	IN
cord-269867-k10siwur	17	11	a	a	DT
cord-269867-k10siwur	17	12	poor	poor	JJ
cord-269867-k10siwur	17	13	immunogenicity	immunogenicity	NN
cord-269867-k10siwur	17	14	of	of	IN
cord-269867-k10siwur	17	15	the	the	DT
cord-269867-k10siwur	17	16	chimeric	chimeric	JJ
cord-269867-k10siwur	17	17	antigens	antigen	NNS
cord-269867-k10siwur	17	18	due	due	IN
cord-269867-k10siwur	17	19	to	to	IN
cord-269867-k10siwur	17	20	the	the	DT
cord-269867-k10siwur	17	21	local	local	JJ
cord-269867-k10siwur	17	22	conformational	conformational	JJ
cord-269867-k10siwur	17	23	restrictions	restriction	NNS
cord-269867-k10siwur	17	24	imposed	impose	VBN
cord-269867-k10siwur	17	25	on	on	IN
cord-269867-k10siwur	17	26	epitopes	epitope	NNS
cord-269867-k10siwur	17	27	by	by	IN
cord-269867-k10siwur	17	28	the	the	DT
cord-269867-k10siwur	17	29	embedding	embed	VBG
cord-269867-k10siwur	17	30	structure	structure	NN
cord-269867-k10siwur	17	31	(	(	-LRB-
cord-269867-k10siwur	17	32	Benito	Benito	NNP
cord-269867-k10siwur	17	33	et	et	NNP
cord-269867-k10siwur	17	34	al	al	NNP
cord-269867-k10siwur	17	35	.	.	NNP
cord-269867-k10siwur	17	36	,	,	,
cord-269867-k10siwur	17	37	1995	1995	CD
cord-269867-k10siwur	17	38	)	)	-RRB-
cord-269867-k10siwur	17	39	.	.	.
cord-269867-k10siwur	18	1	Therefore	therefore	RB
cord-269867-k10siwur	18	2	,	,	,
cord-269867-k10siwur	18	3	approaches	approach	VBZ
cord-269867-k10siwur	18	4	to	to	IN
cord-269867-k10siwur	18	5	enhancing	enhance	VBG
cord-269867-k10siwur	18	6	immunogenicity	immunogenicity	NN
cord-269867-k10siwur	18	7	are	be	VBP
cord-269867-k10siwur	18	8	critical	critical	JJ
cord-269867-k10siwur	18	9	.	.	.
cord-269867-k10siwur	19	1	Since	since	IN
cord-269867-k10siwur	19	2	the	the	DT
cord-269867-k10siwur	19	3	conformation	conformation	NN
cord-269867-k10siwur	19	4	of	of	IN
cord-269867-k10siwur	19	5	a	a	DT
cord-269867-k10siwur	19	6	foreign	foreign	JJ
cord-269867-k10siwur	19	7	sequence	sequence	NN
cord-269867-k10siwur	19	8	within	within	IN
cord-269867-k10siwur	19	9	a	a	DT
cord-269867-k10siwur	19	10	carrier	carrier	NN
cord-269867-k10siwur	19	11	varies	vary	VBZ
cord-269867-k10siwur	19	12	widely	widely	RB
cord-269867-k10siwur	19	13	depending	depend	VBG
cord-269867-k10siwur	19	14	on	on	IN
cord-269867-k10siwur	19	15	the	the	DT
cord-269867-k10siwur	19	16	flanking	flank	VBG
cord-269867-k10siwur	19	17	sequences	sequence	NNS
cord-269867-k10siwur	19	18	(	(	-LRB-
cord-269867-k10siwur	19	19	Tishminetzky	Tishminetzky	NNP
cord-269867-k10siwur	19	20	et	et	FW
cord-269867-k10siwur	19	21	al	al	NNP
cord-269867-k10siwur	19	22	.	.	NNP
cord-269867-k10siwur	19	23	,	,	,
cord-269867-k10siwur	19	24	1994	1994	CD
cord-269867-k10siwur	19	25	)	)	-RRB-
cord-269867-k10siwur	19	26	,	,	,
cord-269867-k10siwur	19	27	the	the	DT
cord-269867-k10siwur	19	28	insertion	insertion	NN
cord-269867-k10siwur	19	29	of	of	IN
cord-269867-k10siwur	19	30	an	an	DT
cord-269867-k10siwur	19	31	antigen	antigen	NN
cord-269867-k10siwur	19	32	into	into	IN
cord-269867-k10siwur	19	33	different	different	JJ
cord-269867-k10siwur	19	34	exposed	expose	VBN
cord-269867-k10siwur	19	35	regions	region	NNS
cord-269867-k10siwur	19	36	of	of	IN
cord-269867-k10siwur	19	37	a	a	DT
cord-269867-k10siwur	19	38	delivery	delivery	NN
cord-269867-k10siwur	19	39	protein	protein	NN
cord-269867-k10siwur	19	40	,	,	,
cord-269867-k10siwur	19	41	thus	thus	RB
cord-269867-k10siwur	19	42	changing	change	VBG
cord-269867-k10siwur	19	43	antigen	antigen	NN
cord-269867-k10siwur	19	44	conformation	conformation	NN
cord-269867-k10siwur	19	45	,	,	,
cord-269867-k10siwur	19	46	could	could	MD
cord-269867-k10siwur	19	47	permit	permit	VB
cord-269867-k10siwur	19	48	a	a	DT
cord-269867-k10siwur	19	49	strategy	strategy	NN
cord-269867-k10siwur	19	50	for	for	IN
cord-269867-k10siwur	19	51	finding	find	VBG
cord-269867-k10siwur	19	52	appropriate	appropriate	JJ
cord-269867-k10siwur	19	53	environments	environment	NNS
cord-269867-k10siwur	19	54	for	for	IN
cord-269867-k10siwur	19	55	peptide	peptide	JJ
cord-269867-k10siwur	19	56	presentation	presentation	NN
cord-269867-k10siwur	19	57	among	among	IN
cord-269867-k10siwur	19	58	the	the	DT
cord-269867-k10siwur	19	59	complex	complex	JJ
cord-269867-k10siwur	19	60	assortment	assortment	NN
cord-269867-k10siwur	19	61	of	of	IN
cord-269867-k10siwur	19	62	molecular	molecular	JJ
cord-269867-k10siwur	19	63	contexts	context	NNS
cord-269867-k10siwur	19	64	offered	offer	VBN
cord-269867-k10siwur	19	65	by	by	IN
cord-269867-k10siwur	19	66	the	the	DT
cord-269867-k10siwur	19	67	carrier	carrier	NN
cord-269867-k10siwur	19	68	.	.	.
cord-269867-k10siwur	20	1	A	a	DT
cord-269867-k10siwur	20	2	second	second	JJ
cord-269867-k10siwur	20	3	strategy	strategy	NN
cord-269867-k10siwur	20	4	to	to	IN
cord-269867-k10siwur	20	5	improving	improve	VBG
cord-269867-k10siwur	20	6	immunogenicity	immunogenicity	NN
cord-269867-k10siwur	20	7	is	be	VBZ
cord-269867-k10siwur	20	8	the	the	DT
cord-269867-k10siwur	20	9	fusion	fusion	NN
cord-269867-k10siwur	20	10	of	of	IN
cord-269867-k10siwur	20	11	The	the	DT
cord-269867-k10siwur	20	12	one	one	CD
cord-269867-k10siwur	20	13	-	-	HYPH
cord-269867-k10siwur	20	14	letter	letter	NN
cord-269867-k10siwur	20	15	code	code	NN
cord-269867-k10siwur	20	16	for	for	IN
cord-269867-k10siwur	20	17	aa	aa	NNP
cord-269867-k10siwur	20	18	designation	designation	NN
cord-269867-k10siwur	20	19	is	be	VBZ
cord-269867-k10siwur	20	20	used	use	VBN
cord-269867-k10siwur	20	21	.	.	.
cord-269867-k10siwur	21	1	Numbered	number	VBN
cord-269867-k10siwur	21	2	vertical	vertical	JJ
cord-269867-k10siwur	21	3	arrows	arrow	NNS
cord-269867-k10siwur	21	4	above	above	IN
cord-269867-k10siwur	21	5	the	the	DT
cord-269867-k10siwur	21	6	nt	nt	NNP
cord-269867-k10siwur	21	7	sequence	sequence	NN
cord-269867-k10siwur	21	8	indicate	indicate	VBP
cord-269867-k10siwur	21	9	the	the	DT
cord-269867-k10siwur	21	10	number	number	NN
cord-269867-k10siwur	21	11	and	and	CC
cord-269867-k10siwur	21	12	position	position	NN
cord-269867-k10siwur	21	13	of	of	IN
cord-269867-k10siwur	21	14	the	the	DT
cord-269867-k10siwur	21	15	twelve	twelve	CD
cord-269867-k10siwur	21	16	selected	select	VBN
cord-269867-k10siwur	21	17	insertion	insertion	NN
cord-269867-k10siwur	21	18	sites	site	NNS
cord-269867-k10siwur	21	19	.	.	.
cord-269867-k10siwur	22	1	Asterisks	asterisk	NNS
cord-269867-k10siwur	22	2	denote	denote	VBP
cord-269867-k10siwur	22	3	the	the	DT
cord-269867-k10siwur	22	4	nt	nt	RB
cord-269867-k10siwur	22	5	modified	modify	VBN
cord-269867-k10siwur	22	6	by	by	IN
cord-269867-k10siwur	22	7	site	site	NN
cord-269867-k10siwur	22	8	-	-	HYPH
cord-269867-k10siwur	22	9	directed	direct	VBN
cord-269867-k10siwur	22	10	mutagenesis	mutagenesis	NN
cord-269867-k10siwur	22	11	and	and	CC
cord-269867-k10siwur	22	12	the	the	DT
cord-269867-k10siwur	22	13	corresponding	correspond	VBG
cord-269867-k10siwur	22	14	mutated	mutate	VBN
cord-269867-k10siwur	22	15	aa	aa	NN
cord-269867-k10siwur	22	16	residue	residue	NN
cord-269867-k10siwur	22	17	.	.	.
cord-269867-k10siwur	23	1	The	the	DT
cord-269867-k10siwur	23	2	resulting	result	VBG
cord-269867-k10siwur	23	3	engineered	engineer	VBN
cord-269867-k10siwur	23	4	restriction	restriction	NN
cord-269867-k10siwur	23	5	sites	site	NNS
cord-269867-k10siwur	23	6	SpeI	SpeI	NNP
cord-269867-k10siwur	23	7	and	and	CC
cord-269867-k10siwur	23	8	BgllI	BgllI	NNP
cord-269867-k10siwur	23	9	in	in	IN
cord-269867-k10siwur	23	10	plasmids	plasmid	NNS
cord-269867-k10siwur	23	11	pPSX6S	ppsx6s	POS
cord-269867-k10siwur	23	12	and	and	CC
cord-269867-k10siwur	23	13	pPSX10S	pPSX10S	.
cord-269867-k10siwur	24	1	(	(	-LRB-
cord-269867-k10siwur	24	2	Bousquet	Bousquet	NNP
cord-269867-k10siwur	24	3	et	et	NNP
cord-269867-k10siwur	24	4	al	al	NNP
cord-269867-k10siwur	24	5	.	.	NNP
cord-269867-k10siwur	24	6	,	,	,
cord-269867-k10siwur	24	7	1994	1994	CD
cord-269867-k10siwur	24	8	)	)	-RRB-
cord-269867-k10siwur	24	9	,	,	,
cord-269867-k10siwur	24	10	coding	code	VBG
cord-269867-k10siwur	24	11	for	for	IN
cord-269867-k10siwur	24	12	mutants	mutant	NNS
cord-269867-k10siwur	24	13	ClpG202	ClpG202	NNP
cord-269867-k10siwur	24	14	and	and	CC
cord-269867-k10siwur	24	15	CIpG420	cipg420	NN
cord-269867-k10siwur	24	16	,	,	,
cord-269867-k10siwur	24	17	are	be	VBP
cord-269867-k10siwur	24	18	mentioned	mention	VBN
cord-269867-k10siwur	24	19	.	.	.
cord-269867-k10siwur	25	1	(	(	-LRB-
cord-269867-k10siwur	25	2	a	a	LS
cord-269867-k10siwur	25	3	-	-	HYPH
cord-269867-k10siwur	25	4	e	e	NN
cord-269867-k10siwur	25	5	)	)	-RRB-
cord-269867-k10siwur	25	6	in	in	IN
cord-269867-k10siwur	25	7	panel	panel	NN
cord-269867-k10siwur	25	8	C	C	NNP
cord-269867-k10siwur	25	9	represent	represent	VBP
cord-269867-k10siwur	25	10	(	(	-LRB-
cord-269867-k10siwur	25	11	a	a	LS
cord-269867-k10siwur	25	12	)	)	-RRB-
cord-269867-k10siwur	25	13	predicted	predict	VBN
cord-269867-k10siwur	25	14	secondary	secondary	JJ
cord-269867-k10siwur	25	15	structured	structure	VBN
cord-269867-k10siwur	25	16	,	,	,
cord-269867-k10siwur	25	17	(	(	-LRB-
cord-269867-k10siwur	25	18	b	b	LS
cord-269867-k10siwur	25	19	)	)	-RRB-
cord-269867-k10siwur	25	20	hydrophilic	hydrophilic	JJ
cord-269867-k10siwur	25	21	(	(	-LRB-
cord-269867-k10siwur	25	22	hatched	hatch	VBN
cord-269867-k10siwur	25	23	box	box	NN
cord-269867-k10siwur	25	24	)	)	-RRB-
cord-269867-k10siwur	25	25	,	,	,
cord-269867-k10siwur	25	26	(	(	-LRB-
cord-269867-k10siwur	25	27	c	c	NN
cord-269867-k10siwur	25	28	)	)	-RRB-
cord-269867-k10siwur	25	29	variable	variable	JJ
cord-269867-k10siwur	25	30	(	(	-LRB-
cord-269867-k10siwur	25	31	black	black	JJ
cord-269867-k10siwur	25	32	boxes	box	NNS
cord-269867-k10siwur	25	33	)	)	-RRB-
cord-269867-k10siwur	25	34	or	or	CC
cord-269867-k10siwur	25	35	conserved	conserve	VBN
cord-269867-k10siwur	25	36	(	(	-LRB-
cord-269867-k10siwur	25	37	open	open	JJ
cord-269867-k10siwur	25	38	boxes	box	NNS
cord-269867-k10siwur	25	39	)	)	-RRB-
cord-269867-k10siwur	26	1	(	(	-LRB-
cord-269867-k10siwur	26	2	Girardeau	Girardeau	NNP
cord-269867-k10siwur	26	3	et	et	NNP
cord-269867-k10siwur	26	4	al	al	NNP
cord-269867-k10siwur	26	5	.	.	.
cord-269867-k10siwur	27	1	,	,	,
cord-269867-k10siwur	27	2	1991	1991	CD
cord-269867-k10siwur	27	3	;	;	:
cord-269867-k10siwur	27	4	Mrchin	Mrchin	NNP
cord-269867-k10siwur	27	5	et	et	NNP
cord-269867-k10siwur	27	6	al	al	NNP
cord-269867-k10siwur	27	7	.	.	NNP
cord-269867-k10siwur	27	8	,	,	,
cord-269867-k10siwur	27	9	1995	1995	CD
cord-269867-k10siwur	27	10	)	)	-RRB-
cord-269867-k10siwur	28	1	(	(	-LRB-
cord-269867-k10siwur	28	2	Stanssens	Stanssens	NNP
cord-269867-k10siwur	28	3	et	et	NNP
cord-269867-k10siwur	28	4	al	al	NNP
cord-269867-k10siwur	28	5	.	.	NNP
cord-269867-k10siwur	28	6	,	,	,
cord-269867-k10siwur	28	7	1989	1989	CD
cord-269867-k10siwur	28	8	)	)	-RRB-
cord-269867-k10siwur	28	9	,	,	,
cord-269867-k10siwur	28	10	or	or	CC
cord-269867-k10siwur	28	11	performed	perform	VBN
cord-269867-k10siwur	28	12	on	on	IN
cord-269867-k10siwur	28	13	double	double	RB
cord-269867-k10siwur	28	14	-	-	HYPH
cord-269867-k10siwur	28	15	stranded	stranded	JJ
cord-269867-k10siwur	28	16	DNA	dna	NN
cord-269867-k10siwur	28	17	using	use	VBG
cord-269867-k10siwur	28	18	an	an	DT
cord-269867-k10siwur	28	19	adapted	adapt	VBN
cord-269867-k10siwur	28	20	protocol	protocol	NN
cord-269867-k10siwur	28	21	from	from	IN
cord-269867-k10siwur	28	22	the	the	DT
cord-269867-k10siwur	28	23	methods	method	NNS
cord-269867-k10siwur	28	24	of	of	IN
cord-269867-k10siwur	28	25	Jung	Jung	NNP
cord-269867-k10siwur	28	26	et	et	NNP
cord-269867-k10siwur	28	27	al	al	NNP
cord-269867-k10siwur	28	28	.	.	.
cord-269867-k10siwur	29	1	(	(	-LRB-
cord-269867-k10siwur	29	2	1992	1992	CD
cord-269867-k10siwur	29	3	)	)	-RRB-
cord-269867-k10siwur	29	4	and	and	CC
cord-269867-k10siwur	29	5	Deng	Deng	NNP
cord-269867-k10siwur	29	6	and	and	CC
cord-269867-k10siwur	29	7	Nickoloff	Nickoloff	NNP
cord-269867-k10siwur	29	8	(	(	-LRB-
cord-269867-k10siwur	29	9	1992	1992	CD
cord-269867-k10siwur	29	10	)	)	-RRB-
cord-269867-k10siwur	29	11	.	.	.
cord-269867-k10siwur	30	1	Mutations	mutation	NNS
cord-269867-k10siwur	30	2	were	be	VBD
cord-269867-k10siwur	30	3	verified	verify	VBN
cord-269867-k10siwur	30	4	by	by	IN
cord-269867-k10siwur	30	5	DNA	dna	NN
cord-269867-k10siwur	30	6	sequencing	sequencing	NN
cord-269867-k10siwur	30	7	(	(	-LRB-
cord-269867-k10siwur	30	8	Sanger	Sanger	NNP
cord-269867-k10siwur	30	9	et	et	NNP
cord-269867-k10siwur	30	10	al	al	NNP
cord-269867-k10siwur	30	11	.	.	NNP
cord-269867-k10siwur	30	12	,	,	,
cord-269867-k10siwur	30	13	1977	1977	CD
cord-269867-k10siwur	30	14	)	)	-RRB-
cord-269867-k10siwur	30	15	.	.	.
cord-269867-k10siwur	31	1	The	the	DT
cord-269867-k10siwur	31	2	oligos	oligo	NNS
cord-269867-k10siwur	31	3	used	use	VBN
cord-269867-k10siwur	31	4	in	in	IN
cord-269867-k10siwur	31	5	this	this	DT
cord-269867-k10siwur	31	6	study	study	NN
cord-269867-k10siwur	31	7	were	be	VBD
cord-269867-k10siwur	31	8	synthesized	synthesize	VBN
cord-269867-k10siwur	31	9	and	and	CC
cord-269867-k10siwur	31	10	,	,	,
cord-269867-k10siwur	31	11	when	when	WRB
cord-269867-k10siwur	31	12	necessary	necessary	JJ
cord-269867-k10siwur	31	13	,	,	,
cord-269867-k10siwur	31	14	PAGE	page	NN
cord-269867-k10siwur	31	15	-	-	HYPH
cord-269867-k10siwur	31	16	purified	purify	VBN
cord-269867-k10siwur	31	17	and	and	CC
cord-269867-k10siwur	31	18	5'-phosphoryled	5'-phosphoryled	CD
cord-269867-k10siwur	32	1	(	(	-LRB-
cord-269867-k10siwur	32	2	Eurogentec	Eurogentec	NNP
cord-269867-k10siwur	32	3	,	,	,
cord-269867-k10siwur	32	4	Belgium	Belgium	NNP
cord-269867-k10siwur	32	5	)	)	-RRB-
cord-269867-k10siwur	32	6	;	;	:
cord-269867-k10siwur	32	7	in	in	IN
cord-269867-k10siwur	32	8	the	the	DT
cord-269867-k10siwur	32	9	oligos	oligo	NNS
cord-269867-k10siwur	32	10	shown	show	VBN
cord-269867-k10siwur	32	11	below	below	RB
cord-269867-k10siwur	32	12	,	,	,
cord-269867-k10siwur	32	13	names	name	NNS
cord-269867-k10siwur	32	14	are	be	VBP
cord-269867-k10siwur	32	15	indicated	indicate	VBN
cord-269867-k10siwur	32	16	,	,	,
cord-269867-k10siwur	32	17	numbers	number	NNS
cord-269867-k10siwur	32	18	in	in	IN
cord-269867-k10siwur	32	19	parentheses	parenthesis	NNS
cord-269867-k10siwur	32	20	refer	refer	VBP
cord-269867-k10siwur	32	21	to	to	IN
cord-269867-k10siwur	32	22	nt	nt	RB
cord-269867-k10siwur	32	23	position	position	VB
cord-269867-k10siwur	32	24	in	in	IN
cord-269867-k10siwur	32	25	the	the	DT
cord-269867-k10siwur	32	26	coding	coding	NN
cord-269867-k10siwur	32	27	strand	strand	NN
cord-269867-k10siwur	32	28	of	of	IN
cord-269867-k10siwur	32	29	the	the	DT
cord-269867-k10siwur	32	30	clpG	clpG	NNS
cord-269867-k10siwur	32	31	gene	gene	NN
cord-269867-k10siwur	32	32	(	(	-LRB-
cord-269867-k10siwur	32	33	see	see	VB
cord-269867-k10siwur	32	34	C	C	NNP
cord-269867-k10siwur	32	35	)	)	-RRB-
cord-269867-k10siwur	32	36	,	,	,
cord-269867-k10siwur	32	37	and	and	CC
cord-269867-k10siwur	32	38	bold	bold	JJ
cord-269867-k10siwur	32	39	characters	character	NNS
cord-269867-k10siwur	32	40	represent	represent	VBP
cord-269867-k10siwur	32	41	mutations	mutation	NNS
cord-269867-k10siwur	32	42	resulting	result	VBG
cord-269867-k10siwur	32	43	of	of	IN
cord-269867-k10siwur	32	44	the	the	DT
cord-269867-k10siwur	32	45	SpeI	SpeI	NNP
cord-269867-k10siwur	32	46	site	site	NN
cord-269867-k10siwur	32	47	introduction	introduction	NN
cord-269867-k10siwur	32	48	:	:	:
cord-269867-k10siwur	32	49	VN1	VN1	NNP
cord-269867-k10siwur	32	50	,	,	,
cord-269867-k10siwur	32	51	(	(	-LRB-
cord-269867-k10siwur	32	52	559)CTTCAAGCAGTAACTAGTAACCCTAACGCG(582	559)cttcaagcagtaactagtaaccctaacgcg(582	CD
cord-269867-k10siwur	32	53	)	)	-RRB-
cord-269867-k10siwur	32	54	;	;	:
cord-269867-k10siwur	32	55	NP2	NP2	NNP
cord-269867-k10siwur	32	56	,	,	,
cord-269867-k10siwur	32	57	(	(	-LRB-
cord-269867-k10siwur	32	58	562)CAAGCAGTAAACACTAGTCCTAACGCGGGC(585	562)caagcagtaaacactagtcctaacgcgggc(585	CD
cord-269867-k10siwur	32	59	)	)	-RRB-
cord-269867-k10siwur	32	60	;	;	:
cord-269867-k10siwur	32	61	PN3	pn3	NN
cord-269867-k10siwur	32	62	,	,	,
cord-269867-k10siwur	32	63	(	(	-LRB-
cord-269867-k10siwur	32	64	565)GCAGTAAACCCTACTAGTAACGCGGGCAAT(588	565)gcagtaaaccctactagtaacgcgggcaat(588	CD
cord-269867-k10siwur	32	65	)	)	-RRB-
cord-269867-k10siwur	32	66	;	;	:
cord-269867-k10siwur	32	67	NA4	NA4	NNP
cord-269867-k10siwur	32	68	,	,	,
cord-269867-k10siwur	32	69	tandem	tandem	NN
cord-269867-k10siwur	32	70	peptides	peptide	NNS
cord-269867-k10siwur	32	71	to	to	IN
cord-269867-k10siwur	32	72	immunogenic	immunogenic	JJ
cord-269867-k10siwur	32	73	carrier	carrier	NN
cord-269867-k10siwur	32	74	proteins	protein	NNS
cord-269867-k10siwur	33	1	(	(	-LRB-
cord-269867-k10siwur	33	2	Broekhuijsen	Broekhuijsen	NNP
cord-269867-k10siwur	33	3	et	et	NNP
cord-269867-k10siwur	33	4	al	al	NNP
cord-269867-k10siwur	33	5	.	.	.
cord-269867-k10siwur	34	1	,	,	,
cord-269867-k10siwur	34	2	1986	1986	CD
cord-269867-k10siwur	34	3	;	;	:
cord-269867-k10siwur	34	4	Martineau	Martineau	NNP
cord-269867-k10siwur	34	5	et	et	NNP
cord-269867-k10siwur	34	6	al	al	NNP
cord-269867-k10siwur	34	7	.	.	NNP
cord-269867-k10siwur	34	8	,	,	,
cord-269867-k10siwur	34	9	1992	1992	CD
cord-269867-k10siwur	34	10	;	;	:
cord-269867-k10siwur	34	11	Khan	Khan	NNP
cord-269867-k10siwur	34	12	et	et	NNP
cord-269867-k10siwur	34	13	al	al	NNP
cord-269867-k10siwur	34	14	.	.	NNP
cord-269867-k10siwur	34	15	,	,	,
cord-269867-k10siwur	34	16	1994	1994	CD
cord-269867-k10siwur	34	17	)	)	-RRB-
cord-269867-k10siwur	34	18	.	.	.
cord-269867-k10siwur	35	1	A	a	DT
cord-269867-k10siwur	35	2	third	third	JJ
cord-269867-k10siwur	35	3	strategy	strategy	NN
cord-269867-k10siwur	35	4	might	may	MD
cord-269867-k10siwur	35	5	be	be	VB
cord-269867-k10siwur	35	6	the	the	DT
cord-269867-k10siwur	35	7	insertion	insertion	NN
cord-269867-k10siwur	35	8	of	of	IN
cord-269867-k10siwur	35	9	epitopes	epitope	NNS
cord-269867-k10siwur	35	10	in	in	IN
cord-269867-k10siwur	35	11	an	an	DT
cord-269867-k10siwur	35	12	accessible	accessible	JJ
cord-269867-k10siwur	35	13	surface	surface	NN
cord-269867-k10siwur	35	14	region	region	NN
cord-269867-k10siwur	35	15	previously	previously	RB
cord-269867-k10siwur	35	16	observed	observe	VBD
cord-269867-k10siwur	35	17	as	as	IN
cord-269867-k10siwur	35	18	a	a	DT
cord-269867-k10siwur	35	19	natural	natural	JJ
cord-269867-k10siwur	35	20	immunodominant	immunodominant	JJ
cord-269867-k10siwur	35	21	site	site	NN
cord-269867-k10siwur	35	22	on	on	IN
cord-269867-k10siwur	35	23	the	the	DT
cord-269867-k10siwur	35	24	native	native	JJ
cord-269867-k10siwur	35	25	carrier	carrier	NN
cord-269867-k10siwur	35	26	molecule	molecule	NN
cord-269867-k10siwur	35	27	.	.	.
cord-269867-k10siwur	36	1	Here	here	RB
cord-269867-k10siwur	36	2	,	,	,
cord-269867-k10siwur	36	3	we	-PRON-	PRP
cord-269867-k10siwur	36	4	developed	develop	VBD
cord-269867-k10siwur	36	5	these	these	DT
cord-269867-k10siwur	36	6	different	different	JJ
cord-269867-k10siwur	36	7	approaches	approach	NNS
cord-269867-k10siwur	36	8	simultaneously	simultaneously	RB
cord-269867-k10siwur	36	9	by	by	IN
cord-269867-k10siwur	36	10	using	use	VBG
cord-269867-k10siwur	36	11	the	the	DT
cord-269867-k10siwur	36	12	major	major	JJ
cord-269867-k10siwur	36	13	ClpG	ClpG	NNP
cord-269867-k10siwur	36	14	subunit	subunit	NN
cord-269867-k10siwur	36	15	of	of	IN
cord-269867-k10siwur	36	16	the	the	DT
cord-269867-k10siwur	36	17	E.	E.	NNP
cord-269867-k10siwur	36	18	coli	coli	NNS
cord-269867-k10siwur	36	19	CS31A	CS31A	NNP
cord-269867-k10siwur	36	20	fibrillae	fibrillae	NNP
cord-269867-k10siwur	36	21	as	as	IN
cord-269867-k10siwur	36	22	the	the	DT
cord-269867-k10siwur	36	23	carrier	carrier	NN
cord-269867-k10siwur	36	24	protein	protein	NN
cord-269867-k10siwur	36	25	(	(	-LRB-
cord-269867-k10siwur	36	26	Bousquet	Bousquet	NNP
cord-269867-k10siwur	36	27	et	et	NNP
cord-269867-k10siwur	36	28	al	al	NNP
cord-269867-k10siwur	36	29	.	.	NNP
cord-269867-k10siwur	36	30	,	,	,
cord-269867-k10siwur	36	31	1994	1994	CD
cord-269867-k10siwur	36	32	;	;	:
cord-269867-k10siwur	36	33	Der	Der	NNP
cord-269867-k10siwur	36	34	Vartanian	Vartanian	NNP
cord-269867-k10siwur	36	35	et	et	FW
cord-269867-k10siwur	36	36	al	al	NNP
cord-269867-k10siwur	36	37	.	.	NNP
cord-269867-k10siwur	36	38	,	,	,
cord-269867-k10siwur	36	39	1994	1994	CD
cord-269867-k10siwur	36	40	)	)	-RRB-
cord-269867-k10siwur	36	41	,	,	,
cord-269867-k10siwur	36	42	and	and	CC
cord-269867-k10siwur	36	43	two	two	CD
cord-269867-k10siwur	36	44	B	b	NN
cord-269867-k10siwur	36	45	-	-	HYPH
cord-269867-k10siwur	36	46	cell	cell	NN
cord-269867-k10siwur	36	47	epitopes	epitope	NNS
cord-269867-k10siwur	36	48	from	from	IN
cord-269867-k10siwur	36	49	TGEV	TGEV	NNP
cord-269867-k10siwur	36	50	consisting	consist	VBG
cord-269867-k10siwur	36	51	of	of	IN
cord-269867-k10siwur	36	52	the	the	DT
cord-269867-k10siwur	36	53	site	site	NN
cord-269867-k10siwur	36	54	C	C	NNP
cord-269867-k10siwur	36	55	(	(	-LRB-
cord-269867-k10siwur	36	56	aa	aa	NNP
cord-269867-k10siwur	36	57	363	363	CD
cord-269867-k10siwur	36	58	-	-	HYPH
cord-269867-k10siwur	36	59	371	371	CD
cord-269867-k10siwur	36	60	)	)	-RRB-
cord-269867-k10siwur	36	61	and	and	CC
cord-269867-k10siwur	37	1	site	site	NN
cord-269867-k10siwur	37	2	A	a	NN
cord-269867-k10siwur	37	3	(	(	-LRB-
cord-269867-k10siwur	37	4	aa	aa	NNP
cord-269867-k10siwur	37	5	522	522	CD
cord-269867-k10siwur	37	6	-	-	HYPH
cord-269867-k10siwur	37	7	531	531	CD
cord-269867-k10siwur	37	8	)	)	-RRB-
cord-269867-k10siwur	37	9	of	of	IN
cord-269867-k10siwur	37	10	TGEV	TGEV	NNP
cord-269867-k10siwur	37	11	-	-	HYPH
cord-269867-k10siwur	37	12	S	S	NNP
cord-269867-k10siwur	37	13	as	as	IN
cord-269867-k10siwur	37	14	the	the	DT
cord-269867-k10siwur	37	15	foreign	foreign	JJ
cord-269867-k10siwur	37	16	antigenic	antigenic	JJ
cord-269867-k10siwur	37	17	determinants	determinant	NNS
cord-269867-k10siwur	37	18	(	(	-LRB-
cord-269867-k10siwur	37	19	Delmas	Delmas	NNP
cord-269867-k10siwur	37	20	et	et	NNP
cord-269867-k10siwur	37	21	al	al	NNP
cord-269867-k10siwur	37	22	.	.	NNP
cord-269867-k10siwur	37	23	,	,	,
cord-269867-k10siwur	37	24	1990	1990	CD
cord-269867-k10siwur	37	25	;	;	:
cord-269867-k10siwur	37	26	Gebauer	Gebauer	NNP
cord-269867-k10siwur	37	27	et	et	NNP
cord-269867-k10siwur	37	28	al	al	NNP
cord-269867-k10siwur	37	29	.	.	NNP
cord-269867-k10siwur	37	30	,	,	,
cord-269867-k10siwur	37	31	1991	1991	CD
cord-269867-k10siwur	37	32	)	)	-RRB-
cord-269867-k10siwur	37	33	.	.	.
cord-269867-k10siwur	38	1	The	the	DT
cord-269867-k10siwur	38	2	continuous	continuous	JJ
cord-269867-k10siwur	38	3	site	site	NN
cord-269867-k10siwur	38	4	C	c	NN
cord-269867-k10siwur	38	5	elicits	elicit	VBZ
cord-269867-k10siwur	38	6	neutralizing	neutralize	VBG
cord-269867-k10siwur	38	7	Ab	Ab	NNP
cord-269867-k10siwur	38	8	and	and	CC
cord-269867-k10siwur	38	9	the	the	DT
cord-269867-k10siwur	38	10	site	site	NN
cord-269867-k10siwur	39	1	A	a	DT
cord-269867-k10siwur	39	2	is	be	VBZ
cord-269867-k10siwur	39	3	part	part	NN
cord-269867-k10siwur	39	4	of	of	IN
cord-269867-k10siwur	39	5	highly	highly	RB
cord-269867-k10siwur	39	6	immunogenic	immunogenic	JJ
cord-269867-k10siwur	39	7	conformational	conformational	JJ
cord-269867-k10siwur	39	8	antigenic	antigenic	JJ
cord-269867-k10siwur	39	9	region	region	NN
cord-269867-k10siwur	39	10	(	(	-LRB-
cord-269867-k10siwur	39	11	Delmas	Delmas	NNP
cord-269867-k10siwur	39	12	et	et	FW
cord-269867-k10siwur	39	13	al	al	NNP
cord-269867-k10siwur	39	14	.	.	.
cord-269867-k10siwur	40	1	,	,	,
cord-269867-k10siwur	40	2	1990	1990	CD
cord-269867-k10siwur	40	3	;	;	:
cord-269867-k10siwur	40	4	Correa	Correa	NNP
cord-269867-k10siwur	40	5	et	et	NNP
cord-269867-k10siwur	40	6	al	al	NNP
cord-269867-k10siwur	40	7	.	.	NNP
cord-269867-k10siwur	40	8	,	,	,
cord-269867-k10siwur	40	9	1990	1990	CD
cord-269867-k10siwur	40	10	)	)	-RRB-
cord-269867-k10siwur	40	11	.	.	.
cord-269867-k10siwur	41	1	TGEV	TGEV	NNP
cord-269867-k10siwur	42	1	-A	-A	:
cord-269867-k10siwur	42	2	or	or	CC
cord-269867-k10siwur	42	3	TGEV	TGEV	NNP
cord-269867-k10siwur	42	4	-	-	HYPH
cord-269867-k10siwur	42	5	C	C	NNP
cord-269867-k10siwur	42	6	inserted	insert	VBD
cord-269867-k10siwur	42	7	in	in	IN
cord-269867-k10siwur	42	8	the	the	DT
cord-269867-k10siwur	42	9	position	position	NN
cord-269867-k10siwur	42	10	aa	aa	NNP
cord-269867-k10siwur	42	11	202	202	CD
cord-269867-k10siwur	42	12	-	-	HYPH
cord-269867-k10siwur	42	13	218	218	CD
cord-269867-k10siwur	42	14	of	of	IN
cord-269867-k10siwur	42	15	CIpG	CIpG	NNPS
cord-269867-k10siwur	42	16	was	be	VBD
cord-269867-k10siwur	42	17	previously	previously	RB
cord-269867-k10siwur	42	18	shown	show	VBN
cord-269867-k10siwur	42	19	to	to	TO
cord-269867-k10siwur	42	20	induce	induce	VB
cord-269867-k10siwur	42	21	a	a	DT
cord-269867-k10siwur	42	22	low	low	JJ
cord-269867-k10siwur	42	23	neutralizing	neutralize	VBG
cord-269867-k10siwur	42	24	Ab	Ab	NNP
cord-269867-k10siwur	42	25	response	response	NN
cord-269867-k10siwur	42	26	in	in	IN
cord-269867-k10siwur	42	27	mice	mouse	NNS
cord-269867-k10siwur	43	1	(	(	-LRB-
cord-269867-k10siwur	43	2	Bousquet	Bousquet	NNP
cord-269867-k10siwur	43	3	et	et	NNP
cord-269867-k10siwur	43	4	al	al	NNP
cord-269867-k10siwur	43	5	.	.	NNP
cord-269867-k10siwur	43	6	,	,	,
cord-269867-k10siwur	43	7	1994	1994	CD
cord-269867-k10siwur	43	8	)	)	-RRB-
cord-269867-k10siwur	43	9	.	.	.
cord-269867-k10siwur	44	1	The	the	DT
cord-269867-k10siwur	44	2	aim	aim	NN
cord-269867-k10siwur	44	3	of	of	IN
cord-269867-k10siwur	44	4	this	this	DT
cord-269867-k10siwur	44	5	work	work	NN
cord-269867-k10siwur	44	6	was	be	VBD
cord-269867-k10siwur	44	7	to	to	TO
cord-269867-k10siwur	44	8	explore	explore	VB
cord-269867-k10siwur	44	9	recombinant	recombinant	JJ
cord-269867-k10siwur	44	10	ClpG::TGEV	ClpG::TGEV	NNS
cord-269867-k10siwur	44	11	proteins	protein	NNS
cord-269867-k10siwur	44	12	for	for	IN
cord-269867-k10siwur	44	13	the	the	DT
cord-269867-k10siwur	44	14	display	display	NN
cord-269867-k10siwur	44	15	of	of	IN
cord-269867-k10siwur	44	16	different	different	JJ
cord-269867-k10siwur	44	17	combinations	combination	NNS
cord-269867-k10siwur	44	18	of	of	IN
cord-269867-k10siwur	44	19	the	the	DT
cord-269867-k10siwur	44	20	two	two	CD
cord-269867-k10siwur	44	21	TGEV	TGEV	NNP
cord-269867-k10siwur	44	22	peptides	peptide	NNS
cord-269867-k10siwur	44	23	in	in	IN
cord-269867-k10siwur	44	24	particular	particular	JJ
cord-269867-k10siwur	44	25	contexts	context	NNS
cord-269867-k10siwur	44	26	that	that	WDT
cord-269867-k10siwur	44	27	could	could	MD
cord-269867-k10siwur	44	28	result	result	VB
cord-269867-k10siwur	44	29	in	in	IN
cord-269867-k10siwur	44	30	improved	improved	JJ
cord-269867-k10siwur	44	31	epitope	epitope	NN
cord-269867-k10siwur	44	32	performance	performance	NN
cord-269867-k10siwur	44	33	,	,	,
cord-269867-k10siwur	44	34	and	and	CC
cord-269867-k10siwur	44	35	thus	thus	RB
cord-269867-k10siwur	44	36	allow	allow	VB
cord-269867-k10siwur	44	37	the	the	DT
cord-269867-k10siwur	44	38	design	design	NN
cord-269867-k10siwur	44	39	of	of	IN
cord-269867-k10siwur	44	40	vaccine	vaccine	NN
cord-269867-k10siwur	44	41	antigens	antigen	NNS
cord-269867-k10siwur	44	42	.	.	.
cord-269867-k10siwur	45	1	For	for	IN
cord-269867-k10siwur	45	2	this	this	DT
cord-269867-k10siwur	45	3	purpose	purpose	NN
cord-269867-k10siwur	45	4	,	,	,
cord-269867-k10siwur	45	5	we	-PRON-	PRP
cord-269867-k10siwur	45	6	examine	examine	VBP
cord-269867-k10siwur	45	7	the	the	DT
cord-269867-k10siwur	45	8	permissivity	permissivity	NN
cord-269867-k10siwur	46	1	(	(	-LRB-
cord-269867-k10siwur	46	2	Charbit	Charbit	NNP
cord-269867-k10siwur	46	3	et	et	NNP
cord-269867-k10siwur	46	4	al	al	NNP
cord-269867-k10siwur	46	5	.	.	NNP
cord-269867-k10siwur	46	6	,	,	,
cord-269867-k10siwur	46	7	1991	1991	CD
cord-269867-k10siwur	46	8	)	)	-RRB-
cord-269867-k10siwur	47	1	Fig	Fig	NNP
cord-269867-k10siwur	47	2	.	.	NNP
cord-269867-k10siwur	47	3	2	2	CD
cord-269867-k10siwur	47	4	.	.	.
cord-269867-k10siwur	48	1	Foreign	foreign	JJ
cord-269867-k10siwur	48	2	sequences	sequence	NNS
cord-269867-k10siwur	48	3	used	use	VBN
cord-269867-k10siwur	48	4	in	in	IN
cord-269867-k10siwur	48	5	this	this	DT
cord-269867-k10siwur	48	6	study	study	NN
cord-269867-k10siwur	48	7	for	for	IN
cord-269867-k10siwur	48	8	the	the	DT
cord-269867-k10siwur	48	9	construction	construction	NN
cord-269867-k10siwur	48	10	of	of	IN
cord-269867-k10siwur	48	11	the	the	DT
cord-269867-k10siwur	48	12	chimeric	chimeric	JJ
cord-269867-k10siwur	48	13	clpG	clpG	NNS
cord-269867-k10siwur	48	14	genes	gene	NNS
cord-269867-k10siwur	48	15	.	.	.
cord-269867-k10siwur	49	1	The	the	DT
cord-269867-k10siwur	49	2	six	six	CD
cord-269867-k10siwur	49	3	double	double	RB
cord-269867-k10siwur	49	4	-	-	HYPH
cord-269867-k10siwur	49	5	stranded	strand	VBN
cord-269867-k10siwur	49	6	synthetic	synthetic	JJ
cord-269867-k10siwur	49	7	oligos	oligo	NNS
cord-269867-k10siwur	49	8	coding	code	VBG
cord-269867-k10siwur	49	9	for	for	IN
cord-269867-k10siwur	49	10	TGEV	TGEV	NNP
cord-269867-k10siwur	49	11	-	-	HYPH
cord-269867-k10siwur	49	12	C	C	NNP
cord-269867-k10siwur	49	13	(	(	-LRB-
cord-269867-k10siwur	49	14	oligos	oligo	NNS
cord-269867-k10siwur	49	15	#	#	NN
cord-269867-k10siwur	49	16	l	l	NN
cord-269867-k10siwur	49	17	,	,	,
cord-269867-k10siwur	49	18	#	#	$
cord-269867-k10siwur	49	19	4	4	CD
cord-269867-k10siwur	49	20	and	and	CC
cord-269867-k10siwur	49	21	#	#	$
cord-269867-k10siwur	49	22	5	5	CD
cord-269867-k10siwur	49	23	)	)	-RRB-
cord-269867-k10siwur	49	24	and	and	CC
cord-269867-k10siwur	50	1	TGEV	TGEV	NNP
cord-269867-k10siwur	50	2	-	-	HYPH
cord-269867-k10siwur	50	3	A	a	NN
cord-269867-k10siwur	50	4	(	(	-LRB-
cord-269867-k10siwur	50	5	oligos	oligo	NNS
cord-269867-k10siwur	50	6	#	#	$
cord-269867-k10siwur	50	7	2	2	CD
cord-269867-k10siwur	50	8	,	,	,
cord-269867-k10siwur	50	9	#	#	$
cord-269867-k10siwur	50	10	3	3	CD
cord-269867-k10siwur	50	11	and	and	CC
cord-269867-k10siwur	50	12	#	#	$
cord-269867-k10siwur	50	13	6	6	CD
cord-269867-k10siwur	50	14	)	)	-RRB-
cord-269867-k10siwur	50	15	of	of	IN
cord-269867-k10siwur	50	16	TGEV	TGEV	NNP
cord-269867-k10siwur	50	17	-	-	HYPH
cord-269867-k10siwur	50	18	S	S	NNP
cord-269867-k10siwur	50	19	of	of	IN
cord-269867-k10siwur	50	20	the	the	DT
cord-269867-k10siwur	50	21	porcine	porcine	JJ
cord-269867-k10siwur	50	22	Purdue	Purdue	NNP
cord-269867-k10siwur	50	23	-	-	HYPH
cord-269867-k10siwur	50	24	ll5	ll5	NNP
cord-269867-k10siwur	50	25	strain	strain	NN
cord-269867-k10siwur	50	26	of	of	IN
cord-269867-k10siwur	50	27	TGEV	TGEV	NNS
cord-269867-k10siwur	50	28	are	be	VBP
cord-269867-k10siwur	50	29	shown	show	VBN
cord-269867-k10siwur	50	30	.	.	.
cord-269867-k10siwur	51	1	The	the	DT
cord-269867-k10siwur	51	2	bolded	bolded	JJ
cord-269867-k10siwur	51	3	aa	aa	NN
cord-269867-k10siwur	51	4	residues	residue	NNS
cord-269867-k10siwur	51	5	correspond	correspond	VBP
cord-269867-k10siwur	51	6	to	to	IN
cord-269867-k10siwur	51	7	the	the	DT
cord-269867-k10siwur	51	8	residues	residue	NNS
cord-269867-k10siwur	51	9	361	361	CD
cord-269867-k10siwur	51	10	-	-	HYPH
cord-269867-k10siwur	51	11	371	371	CD
cord-269867-k10siwur	51	12	and	and	CC
cord-269867-k10siwur	51	13	522	522	CD
cord-269867-k10siwur	51	14	-	-	SYM
cord-269867-k10siwur	51	15	531	531	CD
cord-269867-k10siwur	51	16	of	of	IN
cord-269867-k10siwur	51	17	TGEV	TGEV	NNP
cord-269867-k10siwur	51	18	-	-	HYPH
cord-269867-k10siwur	51	19	S	S	NNP
cord-269867-k10siwur	51	20	,	,	,
cord-269867-k10siwur	51	21	spanning	span	VBG
cord-269867-k10siwur	51	22	the	the	DT
cord-269867-k10siwur	51	23	sites	site	NNS
cord-269867-k10siwur	51	24	C	c	NN
cord-269867-k10siwur	51	25	and	and	CC
cord-269867-k10siwur	51	26	A	A	NNP
cord-269867-k10siwur	51	27	,	,	,
cord-269867-k10siwur	51	28	respectively	respectively	RB
cord-269867-k10siwur	51	29	.	.	.
cord-269867-k10siwur	52	1	Restriction	restriction	NN
cord-269867-k10siwur	52	2	sites	site	NNS
cord-269867-k10siwur	52	3	are	be	VBP
cord-269867-k10siwur	52	4	underlined	underline	VBN
cord-269867-k10siwur	52	5	.	.	.
cord-269867-k10siwur	53	1	introducing	introduce	VBG
cord-269867-k10siwur	53	2	TGEV	TGEV	NNP
cord-269867-k10siwur	53	3	-	-	HYPH
cord-269867-k10siwur	53	4	C	C	NNP
cord-269867-k10siwur	53	5	alone	alone	RB
cord-269867-k10siwur	53	6	or	or	CC
cord-269867-k10siwur	53	7	in	in	IN
cord-269867-k10siwur	53	8	tandem	tandem	NN
cord-269867-k10siwur	53	9	with	with	IN
cord-269867-k10siwur	53	10	TGEV	TGEV	NNP
cord-269867-k10siwur	53	11	-	-	HYPH
cord-269867-k10siwur	53	12	A	a	NN
cord-269867-k10siwur	53	13	in	in	IN
cord-269867-k10siwur	53	14	these	these	DT
cord-269867-k10siwur	53	15	sites	site	NNS
cord-269867-k10siwur	53	16	and	and	CC
cord-269867-k10siwur	53	17	by	by	IN
cord-269867-k10siwur	53	18	investigating	investigate	VBG
cord-269867-k10siwur	53	19	the	the	DT
cord-269867-k10siwur	53	20	influence	influence	NN
cord-269867-k10siwur	53	21	of	of	IN
cord-269867-k10siwur	53	22	the	the	DT
cord-269867-k10siwur	53	23	resulting	result	VBG
cord-269867-k10siwur	53	24	modifications	modification	NNS
cord-269867-k10siwur	53	25	on	on	IN
cord-269867-k10siwur	53	26	the	the	DT
cord-269867-k10siwur	53	27	expression	expression	NN
cord-269867-k10siwur	53	28	of	of	IN
cord-269867-k10siwur	53	29	CS31A	CS31A	NNP
cord-269867-k10siwur	53	30	fibrillae	fibrillae	NNP
cord-269867-k10siwur	53	31	.	.	.
cord-269867-k10siwur	54	1	We	-PRON-	PRP
cord-269867-k10siwur	54	2	discuss	discuss	VBP
cord-269867-k10siwur	54	3	the	the	DT
cord-269867-k10siwur	54	4	nature	nature	NN
cord-269867-k10siwur	54	5	of	of	IN
cord-269867-k10siwur	54	6	permissive	permissive	JJ
cord-269867-k10siwur	54	7	sites	site	NNS
cord-269867-k10siwur	54	8	and	and	CC
cord-269867-k10siwur	54	9	the	the	DT
cord-269867-k10siwur	54	10	positioning	positioning	NN
cord-269867-k10siwur	54	11	and	and	CC
cord-269867-k10siwur	54	12	tandem	tandem	NN
cord-269867-k10siwur	54	13	insertion	insertion	NN
cord-269867-k10siwur	54	14	effects	effect	NNS
cord-269867-k10siwur	54	15	of	of	IN
cord-269867-k10siwur	54	16	the	the	DT
cord-269867-k10siwur	54	17	epitopes	epitope	NNS
cord-269867-k10siwur	54	18	.	.	.
cord-269867-k10siwur	55	1	Twelve	twelve	CD
cord-269867-k10siwur	55	2	sites	site	NNS
cord-269867-k10siwur	55	3	within	within	IN
cord-269867-k10siwur	55	4	ClpG	ClpG	NNP
cord-269867-k10siwur	55	5	were	be	VBD
cord-269867-k10siwur	55	6	selected	select	VBN
cord-269867-k10siwur	55	7	for	for	IN
cord-269867-k10siwur	55	8	insertion	insertion	NN
cord-269867-k10siwur	55	9	of	of	IN
cord-269867-k10siwur	55	10	TGEV	TGEV	NNP
cord-269867-k10siwur	55	11	peptides	peptide	NNS
cord-269867-k10siwur	56	1	(	(	-LRB-
cord-269867-k10siwur	56	2	Fig	Fig	NNP
cord-269867-k10siwur	56	3	.	.	NNP
cord-269867-k10siwur	56	4	1	1	CD
cord-269867-k10siwur	56	5	)	)	-RRB-
cord-269867-k10siwur	56	6	.	.	.
cord-269867-k10siwur	57	1	One	one	CD
cord-269867-k10siwur	57	2	of	of	IN
cord-269867-k10siwur	57	3	them	-PRON-	PRP
cord-269867-k10siwur	57	4	is	be	VBZ
cord-269867-k10siwur	57	5	located	locate	VBN
cord-269867-k10siwur	57	6	at	at	IN
cord-269867-k10siwur	57	7	the	the	DT
cord-269867-k10siwur	57	8	N	n	CD
cord-269867-k10siwur	57	9	terminfis	terminfis	NNP
cord-269867-k10siwur	57	10	(	(	-LRB-
cord-269867-k10siwur	57	11	Fig	Fig	NNP
cord-269867-k10siwur	57	12	.	.	.
cord-269867-k10siwur	57	13	1B	1B	NNP
cord-269867-k10siwur	57	14	)	)	-RRB-
cord-269867-k10siwur	57	15	,	,	,
cord-269867-k10siwur	57	16	and	and	CC
cord-269867-k10siwur	57	17	the	the	DT
cord-269867-k10siwur	57	18	others	other	NNS
cord-269867-k10siwur	57	19	are	be	VBP
cord-269867-k10siwur	57	20	distributed	distribute	VBN
cord-269867-k10siwur	57	21	along	along	IN
cord-269867-k10siwur	57	22	the	the	DT
cord-269867-k10siwur	57	23	aa	aa	NNP
cord-269867-k10siwur	57	24	182	182	CD
cord-269867-k10siwur	57	25	-	-	SYM
cord-269867-k10siwur	57	26	218	218	CD
cord-269867-k10siwur	57	27	region	region	NN
cord-269867-k10siwur	57	28	(	(	-LRB-
cord-269867-k10siwur	57	29	Fig	Fig	NNP
cord-269867-k10siwur	57	30	.	.	.
cord-269867-k10siwur	57	31	1C	1C	NNP
cord-269867-k10siwur	57	32	)	)	-RRB-
cord-269867-k10siwur	57	33	.	.	.
cord-269867-k10siwur	58	1	This	this	DT
cord-269867-k10siwur	58	2	region	region	NN
cord-269867-k10siwur	58	3	contains	contain	VBZ
cord-269867-k10siwur	58	4	a	a	DT
cord-269867-k10siwur	58	5	variable	variable	JJ
cord-269867-k10siwur	58	6	flexible	flexible	JJ
cord-269867-k10siwur	58	7	loop	loop	NN
cord-269867-k10siwur	58	8	structure	structure	NN
cord-269867-k10siwur	58	9	(	(	-LRB-
cord-269867-k10siwur	58	10	aa	aa	NNP
cord-269867-k10siwur	58	11	190	190	CD
cord-269867-k10siwur	58	12	-	-	SYM
cord-269867-k10siwur	58	13	217	217	CD
cord-269867-k10siwur	58	14	)	)	-RRB-
cord-269867-k10siwur	58	15	carrying	carry	VBG
cord-269867-k10siwur	58	16	a	a	DT
cord-269867-k10siwur	58	17	hydrophilic	hydrophilic	JJ
cord-269867-k10siwur	58	18	domain	domain	NN
cord-269867-k10siwur	58	19	and	and	CC
cord-269867-k10siwur	58	20	several	several	JJ
cord-269867-k10siwur	58	21	accessible	accessible	JJ
cord-269867-k10siwur	58	22	continuous	continuous	JJ
cord-269867-k10siwur	58	23	immunodominant	immunodominant	JJ
cord-269867-k10siwur	58	24	epitopes	epitope	NNS
cord-269867-k10siwur	58	25	,	,	,
cord-269867-k10siwur	58	26	one	one	CD
cord-269867-k10siwur	58	27	of	of	IN
cord-269867-k10siwur	58	28	which	which	WDT
cord-269867-k10siwur	58	29	(	(	-LRB-
cord-269867-k10siwur	58	30	aa	aa	NNP
cord-269867-k10siwur	58	31	189	189	CD
cord-269867-k10siwur	58	32	-	-	SYM
cord-269867-k10siwur	58	33	194	194	CD
cord-269867-k10siwur	58	34	)	)	-RRB-
cord-269867-k10siwur	58	35	is	be	VBZ
cord-269867-k10siwur	58	36	exposed	expose	VBN
cord-269867-k10siwur	58	37	on	on	IN
cord-269867-k10siwur	58	38	the	the	DT
cord-269867-k10siwur	58	39	native	native	JJ
cord-269867-k10siwur	58	40	ClpG	ClpG	NNP
cord-269867-k10siwur	58	41	subunit	subunit	NN
cord-269867-k10siwur	58	42	at	at	IN
cord-269867-k10siwur	58	43	the	the	DT
cord-269867-k10siwur	58	44	surface	surface	NN
cord-269867-k10siwur	58	45	of	of	IN
cord-269867-k10siwur	58	46	the	the	DT
cord-269867-k10siwur	58	47	polymeric	polymeric	JJ
cord-269867-k10siwur	58	48	CS31A	cs31a	NN
cord-269867-k10siwur	58	49	fibrillae	fibrillae	NNP
cord-269867-k10siwur	58	50	(	(	-LRB-
cord-269867-k10siwur	58	51	Fig	Fig	NNP
cord-269867-k10siwur	58	52	.	.	.
cord-269867-k10siwur	58	53	1C	1C	NNP
cord-269867-k10siwur	58	54	)	)	-RRB-
cord-269867-k10siwur	58	55	.	.	.
cord-269867-k10siwur	59	1	For	for	IN
cord-269867-k10siwur	59	2	these	these	DT
cord-269867-k10siwur	59	3	reasons	reason	NNS
cord-269867-k10siwur	59	4	,	,	,
cord-269867-k10siwur	59	5	we	-PRON-	PRP
cord-269867-k10siwur	59	6	hypothesized	hypothesize	VBD
cord-269867-k10siwur	59	7	that	that	IN
cord-269867-k10siwur	59	8	the	the	DT
cord-269867-k10siwur	59	9	region	region	NN
cord-269867-k10siwur	59	10	aa	aa	NNP
cord-269867-k10siwur	59	11	182	182	CD
cord-269867-k10siwur	59	12	-	-	HYPH
cord-269867-k10siwur	59	13	218	218	CD
cord-269867-k10siwur	59	14	is	be	VBZ
cord-269867-k10siwur	59	15	naturally	naturally	RB
cord-269867-k10siwur	59	16	favorable	favorable	JJ
cord-269867-k10siwur	59	17	to	to	IN
cord-269867-k10siwur	59	18	the	the	DT
cord-269867-k10siwur	59	19	presentation	presentation	NN
cord-269867-k10siwur	59	20	of	of	IN
cord-269867-k10siwur	59	21	the	the	DT
cord-269867-k10siwur	59	22	TGEV	TGEV	NNP
cord-269867-k10siwur	59	23	epitopes	epitope	NNS
cord-269867-k10siwur	59	24	.	.	.
cord-269867-k10siwur	60	1	To	to	TO
cord-269867-k10siwur	60	2	construct	construct	VB
cord-269867-k10siwur	60	3	insertion	insertion	NN
cord-269867-k10siwur	60	4	p]asmid	p]asmid	NN
cord-269867-k10siwur	60	5	vectors	vector	NNS
cord-269867-k10siwur	60	6	as	as	IN
cord-269867-k10siwur	60	7	a	a	DT
cord-269867-k10siwur	60	8	preliminary	preliminary	JJ
cord-269867-k10siwur	60	9	step	step	NN
cord-269867-k10siwur	60	10	for	for	IN
cord-269867-k10siwur	60	11	viral	viral	JJ
cord-269867-k10siwur	60	12	epitopes	epitope	NNS
cord-269867-k10siwur	60	13	insertion	insertion	NN
cord-269867-k10siwur	60	14	in	in	IN
cord-269867-k10siwur	60	15	the	the	DT
cord-269867-k10siwur	60	16	selected	select	VBN
cord-269867-k10siwur	60	17	regions	region	NNS
cord-269867-k10siwur	60	18	aa	aa	NNP
cord-269867-k10siwur	60	19	190	190	CD
cord-269867-k10siwur	60	20	-	-	SYM
cord-269867-k10siwur	60	21	198	198	CD
cord-269867-k10siwur	60	22	and	and	CC
cord-269867-k10siwur	60	23	202	202	CD
cord-269867-k10siwur	60	24	-	-	SYM
cord-269867-k10siwur	60	25	218	218	CD
cord-269867-k10siwur	60	26	of	of	IN
cord-269867-k10siwur	60	27	ClpG	ClpG	NNP
cord-269867-k10siwur	60	28	(	(	-LRB-
cord-269867-k10siwur	60	29	Fig	Fig	NNP
cord-269867-k10siwur	60	30	.	.	.
cord-269867-k10siwur	60	31	1C	1C	NNP
cord-269867-k10siwur	60	32	)	)	-RRB-
cord-269867-k10siwur	60	33	,	,	,
cord-269867-k10siwur	60	34	the	the	DT
cord-269867-k10siwur	60	35	corresponding	correspond	VBG
cord-269867-k10siwur	60	36	clpG	clpG	NNS
cord-269867-k10siwur	60	37	sequences	sequence	NNS
cord-269867-k10siwur	60	38	were	be	VBD
cord-269867-k10siwur	60	39	submitted	submit	VBN
cord-269867-k10siwur	60	40	to	to	IN
cord-269867-k10siwur	60	41	oligodeoxyribonucleotide	oligodeoxyribonucleotide	NNP
cord-269867-k10siwur	60	42	(	(	-LRB-
cord-269867-k10siwur	60	43	oligo	oligo	NNP
cord-269867-k10siwur	60	44	)	)	-RRB-
cord-269867-k10siwur	60	45	site	site	NN
cord-269867-k10siwur	60	46	-	-	HYPH
cord-269867-k10siwur	60	47	directed	direct	VBN
cord-269867-k10siwur	60	48	mutagenesis	mutagenesis	NN
cord-269867-k10siwur	60	49	to	to	TO
cord-269867-k10siwur	60	50	create	create	VB
cord-269867-k10siwur	60	51	unique	unique	JJ
cord-269867-k10siwur	60	52	restriction	restriction	NN
cord-269867-k10siwur	60	53	sites	site	NNS
cord-269867-k10siwur	60	54	at	at	IN
cord-269867-k10siwur	60	55	different	different	JJ
cord-269867-k10siwur	60	56	positions	position	NNS
cord-269867-k10siwur	60	57	within	within	IN
cord-269867-k10siwur	60	58	these	these	DT
cord-269867-k10siwur	60	59	sequences	sequence	NNS
cord-269867-k10siwur	60	60	.	.	.
cord-269867-k10siwur	61	1	Thus	thus	RB
cord-269867-k10siwur	61	2	,	,	,
cord-269867-k10siwur	61	3	a	a	DT
cord-269867-k10siwur	61	4	SpeI	SpeI	NNP
cord-269867-k10siwur	61	5	site	site	NN
cord-269867-k10siwur	61	6	was	be	VBD
cord-269867-k10siwur	61	7	independently	independently	RB
cord-269867-k10siwur	61	8	engineered	engineer	VBN
cord-269867-k10siwur	61	9	after	after	IN
cord-269867-k10siwur	61	10	each	each	DT
cord-269867-k10siwur	61	11	codon	codon	NN
cord-269867-k10siwur	61	12	expressing	express	VBG
cord-269867-k10siwur	61	13	every	every	DT
cord-269867-k10siwur	61	14	one	one	CD
cord-269867-k10siwur	61	15	of	of	IN
cord-269867-k10siwur	61	16	aa	aa	NNP
cord-269867-k10siwur	61	17	composing	compose	VBG
cord-269867-k10siwur	61	18	the	the	DT
cord-269867-k10siwur	61	19	region	region	NN
cord-269867-k10siwur	61	20	aa	aa	NNP
cord-269867-k10siwur	61	21	190	190	CD
cord-269867-k10siwur	62	1	-198	-198	NNP
cord-269867-k10siwur	62	2	(	(	-LRB-
cord-269867-k10siwur	62	3	Fig	Fig	NNP
cord-269867-k10siwur	62	4	.	.	.
cord-269867-k10siwur	62	5	1C	1C	NNP
cord-269867-k10siwur	62	6	)	)	-RRB-
cord-269867-k10siwur	62	7	,	,	.
cord-269867-k10siwur	63	1	resulting	result	VBG
cord-269867-k10siwur	63	2	in	in	IN
cord-269867-k10siwur	63	3	the	the	DT
cord-269867-k10siwur	63	4	addition	addition	NN
cord-269867-k10siwur	63	5	of	of	IN
cord-269867-k10siwur	63	6	the	the	DT
cord-269867-k10siwur	63	7	dipeptide	dipeptide	JJ
cord-269867-k10siwur	63	8	threonine	threonine	NN
cord-269867-k10siwur	63	9	-	-	HYPH
cord-269867-k10siwur	63	10	serine	serine	NN
cord-269867-k10siwur	63	11	(	(	-LRB-
cord-269867-k10siwur	63	12	TS	TS	NNP
cord-269867-k10siwur	63	13	)	)	-RRB-
cord-269867-k10siwur	63	14	(	(	-LRB-
cord-269867-k10siwur	63	15	Fig	Fig	NNP
cord-269867-k10siwur	63	16	.	.	.
cord-269867-k10siwur	63	17	3	3	CD
cord-269867-k10siwur	63	18	)	)	-RRB-
cord-269867-k10siwur	63	19	.	.	.
cord-269867-k10siwur	64	1	The	the	DT
cord-269867-k10siwur	64	2	aa	aa	NNP
cord-269867-k10siwur	64	3	202	202	CD
cord-269867-k10siwur	64	4	-	-	HYPH
cord-269867-k10siwur	64	5	218	218	CD
cord-269867-k10siwur	64	6	peptide	peptide	NN
cord-269867-k10siwur	64	7	-	-	HYPH
cord-269867-k10siwur	64	8	encoding	encode	VBG
cord-269867-k10siwur	64	9	sequence	sequence	NN
cord-269867-k10siwur	64	10	was	be	VBD
cord-269867-k10siwur	64	11	Y	y	NN
cord-269867-k10siwur	64	12	-	-	HYPH
cord-269867-k10siwur	64	13	ended	end	VBN
cord-269867-k10siwur	64	14	by	by	IN
cord-269867-k10siwur	64	15	a	a	DT
cord-269867-k10siwur	64	16	SpeI	SpeI	NNP
cord-269867-k10siwur	64	17	site	site	NN
cord-269867-k10siwur	64	18	and	and	CC
cord-269867-k10siwur	64	19	Y	Y	NNP
cord-269867-k10siwur	64	20	-	-	HYPH
cord-269867-k10siwur	64	21	ended	end	VBN
cord-269867-k10siwur	64	22	by	by	IN
cord-269867-k10siwur	64	23	a	a	DT
cord-269867-k10siwur	64	24	BgllI	BgllI	NNP
cord-269867-k10siwur	64	25	site	site	NN
cord-269867-k10siwur	64	26	after	after	IN
cord-269867-k10siwur	64	27	two	two	CD
cord-269867-k10siwur	64	28	rounds	round	NNS
cord-269867-k10siwur	64	29	of	of	IN
cord-269867-k10siwur	64	30	mutagenesis	mutagenesis	NN
cord-269867-k10siwur	64	31	which	which	WDT
cord-269867-k10siwur	64	32	induced	induce	VBD
cord-269867-k10siwur	64	33	changes	change	NNS
cord-269867-k10siwur	64	34	in	in	IN
cord-269867-k10siwur	64	35	ClpG	ClpG	NNP
cord-269867-k10siwur	64	36	(	(	-LRB-
cord-269867-k10siwur	64	37	Fig	Fig	NNP
cord-269867-k10siwur	64	38	.	.	.
cord-269867-k10siwur	64	39	1C	1C	NNP
cord-269867-k10siwur	64	40	,	,	,
cord-269867-k10siwur	64	41	mutants	mutant	NNS
cord-269867-k10siwur	64	42	CIpG202	CIpG202	NNP
cord-269867-k10siwur	64	43	and	and	CC
cord-269867-k10siwur	64	44	ClpG420	ClpG420	NNP
cord-269867-k10siwur	64	45	)	)	-RRB-
cord-269867-k10siwur	64	46	;	;	:
cord-269867-k10siwur	64	47	the	the	DT
cord-269867-k10siwur	64	48	first	first	JJ
cord-269867-k10siwur	64	49	round	round	NN
cord-269867-k10siwur	64	50	allows	allow	VBZ
cord-269867-k10siwur	64	51	insertions	insertion	NNS
cord-269867-k10siwur	64	52	into	into	IN
cord-269867-k10siwur	64	53	the	the	DT
cord-269867-k10siwur	64	54	site	site	NN
cord-269867-k10siwur	64	55	aa	aa	NNP
cord-269867-k10siwur	64	56	202	202	CD
cord-269867-k10siwur	64	57	-	-	HYPH
cord-269867-k10siwur	64	58	204	204	CD
cord-269867-k10siwur	64	59	and	and	CC
cord-269867-k10siwur	64	60	the	the	DT
cord-269867-k10siwur	64	61	second	second	JJ
cord-269867-k10siwur	64	62	the	the	DT
cord-269867-k10siwur	64	63	replacement	replacement	NN
cord-269867-k10siwur	64	64	of	of	IN
cord-269867-k10siwur	64	65	the	the	DT
cord-269867-k10siwur	64	66	region	region	NN
cord-269867-k10siwur	64	67	aa	aa	NNP
cord-269867-k10siwur	64	68	203	203	NNP
cord-269867-k10siwur	64	69	-	-	HYPH
cord-269867-k10siwur	64	70	217	217	CD
cord-269867-k10siwur	64	71	.	.	.
cord-269867-k10siwur	65	1	The	the	DT
cord-269867-k10siwur	65	2	strategy	strategy	NN
cord-269867-k10siwur	65	3	of	of	IN
cord-269867-k10siwur	65	4	ClpG::TGEV	ClpG::TGEV	NNS
cord-269867-k10siwur	65	5	hybrids	hybrid	NNS
cord-269867-k10siwur	65	6	construction	construction	NN
cord-269867-k10siwur	65	7	was	be	VBD
cord-269867-k10siwur	65	8	to	to	TO
cord-269867-k10siwur	65	9	use	use	VB
cord-269867-k10siwur	65	10	these	these	DT
cord-269867-k10siwur	65	11	engineered	engineer	VBN
cord-269867-k10siwur	65	12	restriction	restriction	NN
cord-269867-k10siwur	65	13	sites	site	NNS
cord-269867-k10siwur	65	14	,	,	,
cord-269867-k10siwur	65	15	and	and	CC
cord-269867-k10siwur	65	16	two	two	CD
cord-269867-k10siwur	65	17	naturally	naturally	RB
cord-269867-k10siwur	65	18	occurring	occur	VBG
cord-269867-k10siwur	65	19	sites	site	NNS
cord-269867-k10siwur	65	20	,	,	,
cord-269867-k10siwur	65	21	SphI	SphI	NNP
cord-269867-k10siwur	65	22	(	(	-LRB-
cord-269867-k10siwur	65	23	Fig	Fig	NNP
cord-269867-k10siwur	65	24	.	.	.
cord-269867-k10siwur	65	25	1B	1b	LS
cord-269867-k10siwur	65	26	)	)	-RRB-
cord-269867-k10siwur	65	27	and	and	CC
cord-269867-k10siwur	65	28	MunI	MunI	NNP
cord-269867-k10siwur	65	29	(	(	-LRB-
cord-269867-k10siwur	65	30	Fig	Fig	NNP
cord-269867-k10siwur	65	31	.	.	.
cord-269867-k10siwur	65	32	1C	1C	NNP
cord-269867-k10siwur	65	33	unique	unique	JJ
cord-269867-k10siwur	65	34	XhoI	XhoI	NNP
cord-269867-k10siwur	65	35	site	site	NN
cord-269867-k10siwur	65	36	with	with	IN
cord-269867-k10siwur	65	37	SpeI	SpeI	NNP
cord-269867-k10siwur	65	38	-	-	HYPH
cord-269867-k10siwur	65	39	compafible	compafible	JJ
cord-269867-k10siwur	65	40	ends	end	VBZ
cord-269867-k10siwur	65	41	into	into	IN
cord-269867-k10siwur	65	42	the	the	DT
cord-269867-k10siwur	65	43	SpeI	SpeI	NNP
cord-269867-k10siwur	65	44	site	site	NN
cord-269867-k10siwur	65	45	of	of	IN
cord-269867-k10siwur	65	46	pPSX6S	ppsx6s	NN
cord-269867-k10siwur	66	1	(	(	-LRB-
cord-269867-k10siwur	66	2	see	see	VB
cord-269867-k10siwur	66	3	Fig	Fig	NNP
cord-269867-k10siwur	66	4	.	.	NNP
cord-269867-k10siwur	66	5	1	1	CD
cord-269867-k10siwur	66	6	and	and	CC
cord-269867-k10siwur	66	7	its	-PRON-	PRP$
cord-269867-k10siwur	66	8	legend	legend	NN
cord-269867-k10siwur	66	9	)	)	-RRB-
cord-269867-k10siwur	66	10	;	;	:
cord-269867-k10siwur	66	11	pGAC326	pGAC326	NNP
cord-269867-k10siwur	66	12	and	and	CC
cord-269867-k10siwur	66	13	pGXC326	pGXC326	NNPS
cord-269867-k10siwur	66	14	were	be	VBD
cord-269867-k10siwur	66	15	constructed	construct	VBN
cord-269867-k10siwur	66	16	by	by	IN
cord-269867-k10siwur	66	17	inserting	insert	VBG
cord-269867-k10siwur	66	18	the	the	DT
cord-269867-k10siwur	66	19	oligo	oligo	NN
cord-269867-k10siwur	66	20	#	#	$
cord-269867-k10siwur	66	21	3	3	CD
cord-269867-k10siwur	66	22	(	(	-LRB-
cord-269867-k10siwur	66	23	Fig	fig	NN
cord-269867-k10siwur	66	24	.	.	NNP
cord-269867-k10siwur	66	25	2	2	LS
cord-269867-k10siwur	66	26	)	)	-RRB-
cord-269867-k10siwur	66	27	with	with	IN
cord-269867-k10siwur	66	28	Xhol	Xhol	NNP
cord-269867-k10siwur	66	29	-	-	HYPH
cord-269867-k10siwur	66	30	compatible	compatible	JJ
cord-269867-k10siwur	66	31	ends	end	NNS
cord-269867-k10siwur	66	32	into	into	IN
cord-269867-k10siwur	66	33	the	the	DT
cord-269867-k10siwur	66	34	XhoI	XhoI	NNP
cord-269867-k10siwur	66	35	site	site	NN
cord-269867-k10siwur	66	36	of	of	IN
cord-269867-k10siwur	66	37	pGC326	pGC326	NNP
cord-269867-k10siwur	66	38	,	,	,
cord-269867-k10siwur	66	39	resulting	result	VBG
cord-269867-k10siwur	66	40	in	in	IN
cord-269867-k10siwur	66	41	the	the	DT
cord-269867-k10siwur	66	42	addition	addition	NN
cord-269867-k10siwur	66	43	of	of	IN
cord-269867-k10siwur	66	44	the	the	DT
cord-269867-k10siwur	66	45	oligo	oligo	NN
cord-269867-k10siwur	66	46	#	#	$
cord-269867-k10siwur	66	47	3	3	CD
cord-269867-k10siwur	66	48	in	in	IN
cord-269867-k10siwur	66	49	the	the	DT
cord-269867-k10siwur	66	50	correct	correct	JJ
cord-269867-k10siwur	66	51	and	and	CC
cord-269867-k10siwur	66	52	in	in	IN
cord-269867-k10siwur	66	53	-	-	HYPH
cord-269867-k10siwur	66	54	frame	frame	NN
cord-269867-k10siwur	66	55	reverse	reverse	NN
cord-269867-k10siwur	66	56	orientations	orientation	NNS
cord-269867-k10siwur	66	57	,	,	,
cord-269867-k10siwur	66	58	respectively	respectively	RB
cord-269867-k10siwur	66	59	;	;	:
cord-269867-k10siwur	66	60	pGA102	pGA102	NNS
cord-269867-k10siwur	66	61	(	(	-LRB-
cord-269867-k10siwur	66	62	Bousquet	Bousquet	NNP
cord-269867-k10siwur	66	63	et	et	NNP
cord-269867-k10siwur	66	64	al	al	NNP
cord-269867-k10siwur	66	65	.	.	NNP
cord-269867-k10siwur	66	66	,	,	,
cord-269867-k10siwur	66	67	1994	1994	CD
cord-269867-k10siwur	66	68	)	)	-RRB-
cord-269867-k10siwur	66	69	was	be	VBD
cord-269867-k10siwur	66	70	made	make	VBN
cord-269867-k10siwur	66	71	by	by	IN
cord-269867-k10siwur	66	72	replacing	replace	VBG
cord-269867-k10siwur	66	73	the	the	DT
cord-269867-k10siwur	66	74	38-bp	38-bp	CD
cord-269867-k10siwur	66	75	SpeI	SpeI	NNP
cord-269867-k10siwur	66	76	-	-	HYPH
cord-269867-k10siwur	66	77	BglII	BglII	NNP
cord-269867-k10siwur	66	78	fragment	fragment	NN
cord-269867-k10siwur	66	79	from	from	IN
cord-269867-k10siwur	66	80	pPSX10S	ppsx10	NNS
cord-269867-k10siwur	66	81	(	(	-LRB-
cord-269867-k10siwur	66	82	see	see	VB
cord-269867-k10siwur	66	83	Fig	Fig	NNP
cord-269867-k10siwur	66	84	.	.	NNP
cord-269867-k10siwur	66	85	1	1	CD
cord-269867-k10siwur	66	86	and	and	CC
cord-269867-k10siwur	66	87	its	-PRON-	PRP$
cord-269867-k10siwur	66	88	legend	legend	NN
cord-269867-k10siwur	66	89	)	)	-RRB-
cord-269867-k10siwur	66	90	with	with	IN
cord-269867-k10siwur	66	91	oligo	oligo	NNP
cord-269867-k10siwur	66	92	#	#	$
cord-269867-k10siwur	66	93	6	6	CD
cord-269867-k10siwur	67	1	(	(	-LRB-
cord-269867-k10siwur	67	2	Fig	Fig	NNP
cord-269867-k10siwur	67	3	.	.	NNP
cord-269867-k10siwur	67	4	2	2	CD
cord-269867-k10siwur	67	5	)	)	-RRB-
cord-269867-k10siwur	68	1	having	have	VBG
cord-269867-k10siwur	68	2	5'-SpeI	5'-spei	CD
cord-269867-k10siwur	68	3	and	and	CC
cord-269867-k10siwur	68	4	BgllI-3	BgllI-3	NNP
cord-269867-k10siwur	68	5	'	'	POS
cord-269867-k10siwur	68	6	compatible	compatible	JJ
cord-269867-k10siwur	68	7	ends	end	NNS
cord-269867-k10siwur	68	8	;	;	:
cord-269867-k10siwur	68	9	pGCA102	pGCA102	NNP
cord-269867-k10siwur	68	10	was	be	VBD
cord-269867-k10siwur	68	11	constructed	construct	VBN
cord-269867-k10siwur	68	12	by	by	IN
cord-269867-k10siwur	68	13	inserting	insert	VBG
cord-269867-k10siwur	68	14	the	the	DT
cord-269867-k10siwur	68	15	oligo	oligo	NN
cord-269867-k10siwur	68	16	#	#	$
cord-269867-k10siwur	68	17	5	5	CD
cord-269867-k10siwur	68	18	containing	contain	VBG
cord-269867-k10siwur	68	19	unique	unique	JJ
cord-269867-k10siwur	68	20	XhoI	XhoI	NNP
cord-269867-k10siwur	68	21	site	site	NN
cord-269867-k10siwur	68	22	with	with	IN
cord-269867-k10siwur	68	23	SpeI	SpeI	NNP
cord-269867-k10siwur	68	24	-	-	HYPH
cord-269867-k10siwur	68	25	compatible	compatible	JJ
cord-269867-k10siwur	68	26	ends	end	NNS
cord-269867-k10siwur	68	27	into	into	IN
cord-269867-k10siwur	68	28	the	the	DT
cord-269867-k10siwur	68	29	SpeI	SpeI	NNP
cord-269867-k10siwur	68	30	site	site	NN
cord-269867-k10siwur	68	31	of	of	IN
cord-269867-k10siwur	68	32	pGA102	pGA102	NNS
cord-269867-k10siwur	68	33	;	;	:
cord-269867-k10siwur	68	34	pGisa226	pGisa226	NNP
cord-269867-k10siwur	68	35	was	be	VBD
cord-269867-k10siwur	68	36	engineered	engineer	VBN
cord-269867-k10siwur	68	37	by	by	IN
cord-269867-k10siwur	68	38	cloning	clone	VBG
cord-269867-k10siwur	68	39	the	the	DT
cord-269867-k10siwur	68	40	oligo	oligo	NN
cord-269867-k10siwur	68	41	#	#	$
cord-269867-k10siwur	68	42	1	1	CD
cord-269867-k10siwur	69	1	(	(	-LRB-
cord-269867-k10siwur	69	2	Fig	Fig	NNP
cord-269867-k10siwur	69	3	.	.	NNP
cord-269867-k10siwur	69	4	2	2	LS
cord-269867-k10siwur	69	5	)	)	-RRB-
cord-269867-k10siwur	69	6	comprising	comprise	VBG
cord-269867-k10siwur	69	7	unique	unique	JJ
cord-269867-k10siwur	69	8	XhoI	XhoI	NNP
cord-269867-k10siwur	69	9	site	site	NN
cord-269867-k10siwur	69	10	with	with	IN
cord-269867-k10siwur	69	11	SphI	SphI	NNP
cord-269867-k10siwur	69	12	-	-	HYPH
cord-269867-k10siwur	69	13	flanked	flank	VBN
cord-269867-k10siwur	69	14	ends	end	NNS
cord-269867-k10siwur	69	15	into	into	IN
cord-269867-k10siwur	69	16	the	the	DT
cord-269867-k10siwur	69	17	unique	unique	JJ
cord-269867-k10siwur	69	18	SphI	SphI	NNP
cord-269867-k10siwur	69	19	site	site	NN
cord-269867-k10siwur	69	20	of	of	IN
cord-269867-k10siwur	69	21	pDSPH524	pDSPH524	NNP
cord-269867-k10siwur	69	22	;	;	:
cord-269867-k10siwur	69	23	pGAC524	pGAC524	NNP
cord-269867-k10siwur	69	24	was	be	VBD
cord-269867-k10siwur	69	25	obtained	obtain	VBN
cord-269867-k10siwur	69	26	by	by	IN
cord-269867-k10siwur	69	27	inserting	insert	VBG
cord-269867-k10siwur	69	28	the	the	DT
cord-269867-k10siwur	69	29	oligo	oligo	NN
cord-269867-k10siwur	69	30	#	#	$
cord-269867-k10siwur	69	31	3	3	CD
cord-269867-k10siwur	69	32	with	with	IN
cord-269867-k10siwur	69	33	XhoI	XhoI	NNP
cord-269867-k10siwur	69	34	-	-	HYPH
cord-269867-k10siwur	69	35	compatible	compatible	JJ
cord-269867-k10siwur	69	36	ends	end	NNS
cord-269867-k10siwur	69	37	into	into	IN
cord-269867-k10siwur	69	38	the	the	DT
cord-269867-k10siwur	69	39	XhoI	XhoI	NNP
cord-269867-k10siwur	69	40	site	site	NN
cord-269867-k10siwur	69	41	of	of	IN
cord-269867-k10siwur	69	42	pGisa226	pGisa226	NNP
cord-269867-k10siwur	69	43	;	;	:
cord-269867-k10siwur	69	44	pGCA41155	pGCA41155	NNP
cord-269867-k10siwur	69	45	was	be	VBD
cord-269867-k10siwur	69	46	constructed	construct	VBN
cord-269867-k10siwur	69	47	in	in	IN
cord-269867-k10siwur	69	48	two	two	CD
cord-269867-k10siwur	69	49	steps	step	NNS
cord-269867-k10siwur	69	50	from	from	IN
cord-269867-k10siwur	69	51	pDEV41155	pDEV41155	NNP
cord-269867-k10siwur	69	52	:	:	:
cord-269867-k10siwur	69	53	in	in	IN
cord-269867-k10siwur	69	54	the	the	DT
cord-269867-k10siwur	69	55	first	first	JJ
cord-269867-k10siwur	69	56	step	step	NN
cord-269867-k10siwur	69	57	,	,	,
cord-269867-k10siwur	69	58	the	the	DT
cord-269867-k10siwur	69	59	oligo	oligo	NN
cord-269867-k10siwur	69	60	#	#	$
cord-269867-k10siwur	69	61	1	1	CD
cord-269867-k10siwur	69	62	including	include	VBG
cord-269867-k10siwur	69	63	unique	unique	JJ
cord-269867-k10siwur	69	64	NsiI	NsiI	NNP
cord-269867-k10siwur	69	65	site	site	NN
cord-269867-k10siwur	69	66	with	with	IN
cord-269867-k10siwur	69	67	SphI	SphI	NNP
cord-269867-k10siwur	69	68	-	-	HYPH
cord-269867-k10siwur	69	69	flanked	flank	VBN
cord-269867-k10siwur	69	70	ends	end	NNS
cord-269867-k10siwur	69	71	was	be	VBD
cord-269867-k10siwur	69	72	cloned	clone	VBN
cord-269867-k10siwur	69	73	into	into	IN
cord-269867-k10siwur	69	74	the	the	DT
cord-269867-k10siwur	69	75	SphI	SphI	NNP
cord-269867-k10siwur	69	76	site	site	NN
cord-269867-k10siwur	69	77	of	of	IN
cord-269867-k10siwur	69	78	clpG	clpG	NNS
cord-269867-k10siwur	69	79	(	(	-LRB-
cord-269867-k10siwur	69	80	Fig	Fig	NNP
cord-269867-k10siwur	69	81	.	.	.
cord-269867-k10siwur	69	82	1B	1B	NNP
cord-269867-k10siwur	69	83	)	)	-RRB-
cord-269867-k10siwur	69	84	and	and	CC
cord-269867-k10siwur	69	85	in	in	IN
cord-269867-k10siwur	69	86	the	the	DT
cord-269867-k10siwur	69	87	second	second	JJ
cord-269867-k10siwur	69	88	step	step	NN
cord-269867-k10siwur	69	89	,	,	,
cord-269867-k10siwur	69	90	the	the	DT
cord-269867-k10siwur	69	91	NsiI	NsiI	NNP
cord-269867-k10siwur	69	92	site	site	NN
cord-269867-k10siwur	69	93	in	in	IN
cord-269867-k10siwur	69	94	oligo	oligo	NNP
cord-269867-k10siwur	69	95	#	#	$
cord-269867-k10siwur	69	96	1	1	CD
cord-269867-k10siwur	69	97	allowed	allow	VBD
cord-269867-k10siwur	69	98	the	the	DT
cord-269867-k10siwur	69	99	insertion	insertion	NN
cord-269867-k10siwur	69	100	of	of	IN
cord-269867-k10siwur	69	101	oligo	oligo	NN
cord-269867-k10siwur	69	102	#	#	$
cord-269867-k10siwur	69	103	2	2	CD
cord-269867-k10siwur	70	1	(	(	-LRB-
cord-269867-k10siwur	70	2	Fig	Fig	NNP
cord-269867-k10siwur	70	3	.	.	NNP
cord-269867-k10siwur	70	4	2	2	CD
cord-269867-k10siwur	70	5	)	)	-RRB-
cord-269867-k10siwur	70	6	with	with	IN
cord-269867-k10siwur	70	7	NsiI	NsiI	NNP
cord-269867-k10siwur	70	8	compatible	compatible	JJ
cord-269867-k10siwur	70	9	ends	end	NNS
cord-269867-k10siwur	70	10	downstream	downstream	RB
cord-269867-k10siwur	70	11	of	of	IN
cord-269867-k10siwur	70	12	oligo	oligo	NN
cord-269867-k10siwur	70	13	#	#	$
cord-269867-k10siwur	70	14	1	1	CD
cord-269867-k10siwur	70	15	;	;	:
cord-269867-k10siwur	70	16	pCO6	pCO6	NNP
cord-269867-k10siwur	70	17	was	be	VBD
cord-269867-k10siwur	70	18	made	make	VBN
cord-269867-k10siwur	70	19	from	from	IN
cord-269867-k10siwur	70	20	pDEV41155	pdev41155	JJ
cord-269867-k10siwur	70	21	by	by	IN
cord-269867-k10siwur	70	22	inserting	insert	VBG
cord-269867-k10siwur	70	23	the	the	DT
cord-269867-k10siwur	70	24	oligo	oligo	NN
cord-269867-k10siwur	70	25	#	#	$
cord-269867-k10siwur	70	26	4	4	CD
cord-269867-k10siwur	70	27	(	(	-LRB-
cord-269867-k10siwur	70	28	Fig	Fig	NNP
cord-269867-k10siwur	70	29	.	.	NNP
cord-269867-k10siwur	70	30	2	2	CD
cord-269867-k10siwur	70	31	)	)	-RRB-
cord-269867-k10siwur	70	32	with	with	IN
cord-269867-k10siwur	70	33	MunI	MunI	NNP
cord-269867-k10siwur	70	34	-	-	HYPH
cord-269867-k10siwur	70	35	compatible	compatible	JJ
cord-269867-k10siwur	70	36	ends	end	NNS
cord-269867-k10siwur	70	37	into	into	IN
cord-269867-k10siwur	70	38	the	the	DT
cord-269867-k10siwur	70	39	MunI	MunI	NNP
cord-269867-k10siwur	70	40	site	site	NN
cord-269867-k10siwur	70	41	of	of	IN
cord-269867-k10siwur	70	42	clpG	clpG	NNS
cord-269867-k10siwur	70	43	(	(	-LRB-
cord-269867-k10siwur	70	44	Fig	Fig	NNP
cord-269867-k10siwur	70	45	.	.	.
cord-269867-k10siwur	70	46	1C	1C	NNP
cord-269867-k10siwur	70	47	)	)	-RRB-
cord-269867-k10siwur	70	48	;	;	:
cord-269867-k10siwur	70	49	pVN1	pvn1	XX
cord-269867-k10siwur	70	50	,	,	,
cord-269867-k10siwur	70	51	pNP2	pNP2	NNP
cord-269867-k10siwur	70	52	,	,	,
cord-269867-k10siwur	70	53	pPN3	pPN3	NNP
cord-269867-k10siwur	70	54	,	,	,
cord-269867-k10siwur	70	55	pNA4	pNA4	NNP
cord-269867-k10siwur	70	56	,	,	,
cord-269867-k10siwur	70	57	pAG5	pAG5	NNP
cord-269867-k10siwur	70	58	,	,	,
cord-269867-k10siwur	70	59	pGN6	pGN6	NNP
cord-269867-k10siwur	70	60	,	,	,
cord-269867-k10siwur	70	61	pNR7	pNR7	NNP
cord-269867-k10siwur	70	62	and	and	CC
cord-269867-k10siwur	70	63	pRG8	pRG8	NNP
cord-269867-k10siwur	70	64	were	be	VBD
cord-269867-k10siwur	70	65	constructed	construct	VBN
cord-269867-k10siwur	70	66	from	from	IN
cord-269867-k10siwur	70	67	pDEV41155	pDEV41155	NNP
cord-269867-k10siwur	70	68	as	as	IN
cord-269867-k10siwur	70	69	follows	follow	VBZ
cord-269867-k10siwur	70	70	:	:	:
cord-269867-k10siwur	70	71	a	a	DT
cord-269867-k10siwur	70	72	SpeI	SpeI	NNP
cord-269867-k10siwur	70	73	site	site	NN
cord-269867-k10siwur	70	74	within	within	IN
cord-269867-k10siwur	70	75	clpG	clpG	NNS
cord-269867-k10siwur	70	76	was	be	VBD
cord-269867-k10siwur	70	77	introduced	introduce	VBN
cord-269867-k10siwur	70	78	after	after	IN
cord-269867-k10siwur	70	79	each	each	DT
cord-269867-k10siwur	70	80	codon	codon	NN
cord-269867-k10siwur	70	81	expressing	express	VBG
cord-269867-k10siwur	70	82	every	every	DT
cord-269867-k10siwur	70	83	one	one	CD
cord-269867-k10siwur	70	84	of	of	IN
cord-269867-k10siwur	70	85	aa	aa	NNP
cord-269867-k10siwur	70	86	residues	residue	NNS
cord-269867-k10siwur	70	87	covering	cover	VBG
cord-269867-k10siwur	70	88	the	the	DT
cord-269867-k10siwur	70	89	region	region	NN
cord-269867-k10siwur	70	90	190	190	CD
cord-269867-k10siwur	70	91	-	-	SYM
cord-269867-k10siwur	70	92	197	197	CD
cord-269867-k10siwur	70	93	of	of	IN
cord-269867-k10siwur	70	94	CIpG	CIpG	NNPS
cord-269867-k10siwur	71	1	(	(	-LRB-
cord-269867-k10siwur	71	2	Fig	Fig	NNP
cord-269867-k10siwur	71	3	.	.	.
cord-269867-k10siwur	71	4	1C	1C	NNP
cord-269867-k10siwur	71	5	)	)	-RRB-
cord-269867-k10siwur	71	6	by	by	IN
cord-269867-k10siwur	71	7	in	in	FW
cord-269867-k10siwur	71	8	vitro	vitro	FW
cord-269867-k10siwur	71	9	mutagenesis	mutagenesis	NN
cord-269867-k10siwur	71	10	using	use	VBG
cord-269867-k10siwur	71	11	oligos	oligos	NNP
cord-269867-k10siwur	71	12	VN1	VN1	NNP
cord-269867-k10siwur	71	13	,	,	,
cord-269867-k10siwur	71	14	NP2	np2	JJ
cord-269867-k10siwur	71	15	,	,	,
cord-269867-k10siwur	71	16	PN3	pn3	NN
cord-269867-k10siwur	71	17	,	,	,
cord-269867-k10siwur	71	18	NA4	NA4	NNP
cord-269867-k10siwur	71	19	,	,	,
cord-269867-k10siwur	71	20	AG5	AG5	NNP
cord-269867-k10siwur	71	21	,	,	,
cord-269867-k10siwur	71	22	GN6	GN6	NNP
cord-269867-k10siwur	71	23	,	,	,
cord-269867-k10siwur	71	24	NR7	NR7	NNP
cord-269867-k10siwur	71	25	and	and	CC
cord-269867-k10siwur	71	26	RG8	RG8	NNP
cord-269867-k10siwur	71	27	(	(	-LRB-
cord-269867-k10siwur	71	28	Fig	Fig	NNP
cord-269867-k10siwur	71	29	.	.	.
cord-269867-k10siwur	71	30	1	1	CD
cord-269867-k10siwur	71	31	legend	legend	NN
cord-269867-k10siwur	71	32	)	)	-RRB-
cord-269867-k10siwur	71	33	;	;	:
cord-269867-k10siwur	71	34	pVN1C	pvn1c	CD
cord-269867-k10siwur	71	35	,	,	,
cord-269867-k10siwur	71	36	pNP2C	pnp2c	CD
cord-269867-k10siwur	71	37	,	,	,
cord-269867-k10siwur	71	38	pPN3C	pPN3C	NNS
cord-269867-k10siwur	71	39	,	,	,
cord-269867-k10siwur	71	40	pNA4C	pna4c	CD
cord-269867-k10siwur	71	41	,	,	,
cord-269867-k10siwur	71	42	pAG5C	pag5c	CD
cord-269867-k10siwur	71	43	,	,	,
cord-269867-k10siwur	71	44	pGN6C	pgn6c	CD
cord-269867-k10siwur	71	45	,	,	,
cord-269867-k10siwur	71	46	pNR7C	pnr7c	XX
cord-269867-k10siwur	71	47	and	and	CC
cord-269867-k10siwur	71	48	pRG8C	prg8c	CD
cord-269867-k10siwur	71	49	were	be	VBD
cord-269867-k10siwur	71	50	obtained	obtain	VBN
cord-269867-k10siwur	71	51	by	by	IN
cord-269867-k10siwur	71	52	inserting	insert	VBG
cord-269867-k10siwur	71	53	the	the	DT
cord-269867-k10siwur	71	54	oligo	oligo	NN
cord-269867-k10siwur	71	55	#	#	$
cord-269867-k10siwur	71	56	5	5	CD
cord-269867-k10siwur	71	57	containing	contain	VBG
cord-269867-k10siwur	71	58	XhoI	XhoI	NNP
cord-269867-k10siwur	71	59	site	site	NN
cord-269867-k10siwur	71	60	with	with	IN
cord-269867-k10siwur	71	61	SpeI	SpeI	NNP
cord-269867-k10siwur	71	62	compatible	compatible	JJ
cord-269867-k10siwur	71	63	ends	end	VBZ
cord-269867-k10siwur	71	64	into	into	IN
cord-269867-k10siwur	71	65	the	the	DT
cord-269867-k10siwur	71	66	SpeI	SpeI	NNP
cord-269867-k10siwur	71	67	site	site	NN
cord-269867-k10siwur	71	68	of	of	IN
cord-269867-k10siwur	72	1	pVN1	pVN1	NNP
cord-269867-k10siwur	72	2	,	,	,
cord-269867-k10siwur	72	3	pNP2	pNP2	NNP
cord-269867-k10siwur	72	4	,	,	,
cord-269867-k10siwur	72	5	pPN3	pPN3	NNP
cord-269867-k10siwur	72	6	,	,	,
cord-269867-k10siwur	72	7	pNA4	pNA4	NNP
cord-269867-k10siwur	72	8	,	,	,
cord-269867-k10siwur	72	9	pAG5	pAG5	NNP
cord-269867-k10siwur	72	10	,	,	,
cord-269867-k10siwur	72	11	pGN6	pGN6	NNP
cord-269867-k10siwur	72	12	,	,	,
cord-269867-k10siwur	72	13	pNR7	pNR7	NNP
cord-269867-k10siwur	72	14	and	and	CC
cord-269867-k10siwur	72	15	pRG8	pRG8	NNP
cord-269867-k10siwur	72	16	respectively	respectively	RB
cord-269867-k10siwur	72	17	;	;	:
cord-269867-k10siwur	72	18	pVN1AC	pvn1ac	UH
cord-269867-k10siwur	72	19	,	,	,
cord-269867-k10siwur	72	20	pPN3AC	pPN3AC	NNP
cord-269867-k10siwur	72	21	,	,	,
cord-269867-k10siwur	72	22	pNA4AC	pna4ac	LS
cord-269867-k10siwur	72	23	,	,	,
cord-269867-k10siwur	72	24	pGN6AC	pGN6AC	NNS
cord-269867-k10siwur	72	25	and	and	CC
cord-269867-k10siwur	72	26	pNR7AC	pnr7ac	JJ
cord-269867-k10siwur	72	27	were	be	VBD
cord-269867-k10siwur	72	28	made	make	VBN
cord-269867-k10siwur	72	29	by	by	IN
cord-269867-k10siwur	72	30	cloning	clone	VBG
cord-269867-k10siwur	72	31	the	the	DT
cord-269867-k10siwur	72	32	oligo	oligo	NN
cord-269867-k10siwur	72	33	#	#	$
cord-269867-k10siwur	72	34	3	3	CD
cord-269867-k10siwur	72	35	with	with	IN
cord-269867-k10siwur	72	36	XhoI	XhoI	NNP
cord-269867-k10siwur	72	37	-	-	HYPH
cord-269867-k10siwur	72	38	compatible	compatible	JJ
cord-269867-k10siwur	72	39	ends	end	NNS
cord-269867-k10siwur	72	40	into	into	IN
cord-269867-k10siwur	72	41	the	the	DT
cord-269867-k10siwur	72	42	XhoI	XhoI	NNP
cord-269867-k10siwur	72	43	site	site	NN
cord-269867-k10siwur	72	44	of	of	IN
cord-269867-k10siwur	72	45	pVN1C	pvn1c	CD
cord-269867-k10siwur	72	46	,	,	,
cord-269867-k10siwur	72	47	pPN3C	pPN3C	NNS
cord-269867-k10siwur	72	48	,	,	,
cord-269867-k10siwur	72	49	pNA4C	pNA4C	NNS
cord-269867-k10siwur	72	50	,	,	,
cord-269867-k10siwur	72	51	pGN6C	pgn6c	NN
cord-269867-k10siwur	72	52	and	and	CC
cord-269867-k10siwur	72	53	pNR7C	pnr7c	XX
cord-269867-k10siwur	72	54	,	,	,
cord-269867-k10siwur	72	55	respectively	respectively	RB
cord-269867-k10siwur	72	56	;	;	:
cord-269867-k10siwur	72	57	pVN1XC	pvn1xc	ADD
cord-269867-k10siwur	72	58	,	,	,
cord-269867-k10siwur	72	59	pNP2XC	pnp2xc	JJ
cord-269867-k10siwur	72	60	,	,	,
cord-269867-k10siwur	72	61	pPN3XC	ppn3xc	JJ
cord-269867-k10siwur	72	62	,	,	,
cord-269867-k10siwur	72	63	pAG5XC	pag5xc	NN
cord-269867-k10siwur	72	64	and	and	CC
cord-269867-k10siwur	72	65	pGN6XC	pGN6XC	NNS
cord-269867-k10siwur	72	66	were	be	VBD
cord-269867-k10siwur	72	67	engineered	engineer	VBN
cord-269867-k10siwur	72	68	from	from	IN
cord-269867-k10siwur	72	69	pVN1C	pvn1c	CD
cord-269867-k10siwur	72	70	,	,	,
cord-269867-k10siwur	72	71	pNP2C	pnp2c	CD
cord-269867-k10siwur	72	72	,	,	,
cord-269867-k10siwur	72	73	pPN3C	ppn3c	CD
cord-269867-k10siwur	72	74	,	,	,
cord-269867-k10siwur	72	75	pAG5C	pag5c	CD
cord-269867-k10siwur	72	76	and	and	CC
cord-269867-k10siwur	72	77	pGN6C	pgn6c	NN
cord-269867-k10siwur	72	78	,	,	,
cord-269867-k10siwur	72	79	respectively	respectively	RB
cord-269867-k10siwur	72	80	,	,	,
cord-269867-k10siwur	72	81	as	as	IN
cord-269867-k10siwur	72	82	indicated	indicate	VBN
cord-269867-k10siwur	72	83	just	just	RB
cord-269867-k10siwur	72	84	above	above	RB
cord-269867-k10siwur	72	85	except	except	IN
cord-269867-k10siwur	72	86	that	that	DT
cord-269867-k10siwur	72	87	oligo	oligo	NN
cord-269867-k10siwur	72	88	#	#	NN
cord-269867-k10siwur	72	89	3	3	CD
cord-269867-k10siwur	72	90	was	be	VBD
cord-269867-k10siwur	72	91	inserted	insert	VBN
cord-269867-k10siwur	72	92	in	in	IN
cord-269867-k10siwur	72	93	-	-	HYPH
cord-269867-k10siwur	72	94	frame	frame	NN
cord-269867-k10siwur	72	95	in	in	IN
cord-269867-k10siwur	72	96	the	the	DT
cord-269867-k10siwur	72	97	reverse	reverse	JJ
cord-269867-k10siwur	72	98	orientation	orientation	NN
cord-269867-k10siwur	72	99	,	,	,
cord-269867-k10siwur	72	100	as	as	IN
cord-269867-k10siwur	72	101	designated	designate	VBN
cord-269867-k10siwur	72	102	by	by	IN
cord-269867-k10siwur	72	103	the	the	DT
cord-269867-k10siwur	72	104	letter	letter	NN
cord-269867-k10siwur	72	105	X	x	NN
cord-269867-k10siwur	72	106	;	;	:
cord-269867-k10siwur	72	107	pDEV2CA	pDEV2CA	NNP
cord-269867-k10siwur	72	108	was	be	VBD
cord-269867-k10siwur	72	109	made	make	VBN
cord-269867-k10siwur	72	110	by	by	IN
cord-269867-k10siwur	72	111	replacing	replace	VBG
cord-269867-k10siwur	72	112	a	a	DT
cord-269867-k10siwur	72	113	0.3-kb	0.3-kb	CD
cord-269867-k10siwur	72	114	MunI	MunI	NNP
cord-269867-k10siwur	72	115	-	-	HYPH
cord-269867-k10siwur	72	116	SacI	SacI	NNP
cord-269867-k10siwur	72	117	fragment	fragment	NN
cord-269867-k10siwur	72	118	from	from	IN
cord-269867-k10siwur	72	119	pGCA41155	pGCA41155	NNS
cord-269867-k10siwur	72	120	with	with	IN
cord-269867-k10siwur	72	121	the	the	DT
cord-269867-k10siwur	72	122	0.32-kb	0.32-kb	CD
cord-269867-k10siwur	72	123	MunI	MunI	NNP
cord-269867-k10siwur	72	124	-	-	HYPH
cord-269867-k10siwur	72	125	SacI	SacI	NNP
cord-269867-k10siwur	72	126	fragment	fragment	NN
cord-269867-k10siwur	72	127	from	from	IN
cord-269867-k10siwur	72	128	pGCAI02	pgcai02	NN
cord-269867-k10siwur	72	129	.	.	.
cord-269867-k10siwur	73	1	(	(	-LRB-
cord-269867-k10siwur	73	2	c	c	NN
cord-269867-k10siwur	73	3	)	)	-RRB-
cord-269867-k10siwur	74	1	The	the	DT
cord-269867-k10siwur	74	2	presence	presence	NN
cord-269867-k10siwur	74	3	olTGEV	oltgev	NN
cord-269867-k10siwur	74	4	-	-	HYPH
cord-269867-k10siwur	74	5	C	c	NN
cord-269867-k10siwur	74	6	and	and	CC
cord-269867-k10siwur	74	7	-A	-A	NNS
cord-269867-k10siwur	74	8	is	be	VBZ
cord-269867-k10siwur	74	9	specified	specify	VBN
cord-269867-k10siwur	74	10	by	by	IN
cord-269867-k10siwur	74	11	the	the	DT
cord-269867-k10siwur	74	12	letters	letter	NNS
cord-269867-k10siwur	74	13	C	c	NN
cord-269867-k10siwur	74	14	and	and	CC
cord-269867-k10siwur	74	15	A	a	DT
cord-269867-k10siwur	74	16	respectively	respectively	RB
cord-269867-k10siwur	74	17	;	;	:
cord-269867-k10siwur	74	18	CA	CA	NNP
cord-269867-k10siwur	74	19	or	or	CC
cord-269867-k10siwur	74	20	AC	AC	NNP
cord-269867-k10siwur	74	21	,	,	,
cord-269867-k10siwur	74	22	(	(	-LRB-
cord-269867-k10siwur	74	23	Fig	fig	NN
cord-269867-k10siwur	74	24	.	.	NNP
cord-269867-k10siwur	74	25	2	2	CD
cord-269867-k10siwur	74	26	)	)	-RRB-
cord-269867-k10siwur	74	27	.	.	.
cord-269867-k10siwur	75	1	All	all	PDT
cord-269867-k10siwur	75	2	these	these	DT
cord-269867-k10siwur	75	3	constructions	construction	NNS
cord-269867-k10siwur	75	4	summarized	summarize	VBN
cord-269867-k10siwur	75	5	in	in	IN
cord-269867-k10siwur	75	6	Fig	Fig	NNP
cord-269867-k10siwur	75	7	.	.	.
cord-269867-k10siwur	76	1	3	3	CD
cord-269867-k10siwur	76	2	are	be	VBP
cord-269867-k10siwur	76	3	described	describe	VBN
cord-269867-k10siwur	76	4	in	in	IN
cord-269867-k10siwur	76	5	detail	detail	NN
cord-269867-k10siwur	76	6	in	in	IN
cord-269867-k10siwur	76	7	the	the	DT
cord-269867-k10siwur	76	8	Fig	Fig	NNP
cord-269867-k10siwur	76	9	.	.	.
cord-269867-k10siwur	77	1	3	3	CD
cord-269867-k10siwur	77	2	legend	legend	NN
cord-269867-k10siwur	77	3	.	.	.
cord-269867-k10siwur	78	1	In	in	IN
cord-269867-k10siwur	78	2	total	total	JJ
cord-269867-k10siwur	78	3	,	,	,
cord-269867-k10siwur	78	4	36	36	CD
cord-269867-k10siwur	78	5	mutants	mutant	NNS
cord-269867-k10siwur	78	6	were	be	VBD
cord-269867-k10siwur	78	7	obtained	obtain	VBN
cord-269867-k10siwur	78	8	.	.	.
cord-269867-k10siwur	79	1	Twenty	twenty	CD
cord-269867-k10siwur	79	2	-	-	HYPH
cord-269867-k10siwur	79	3	eight	eight	CD
cord-269867-k10siwur	79	4	of	of	IN
cord-269867-k10siwur	79	5	them	-PRON-	PRP
cord-269867-k10siwur	79	6	contained	contain	VBD
cord-269867-k10siwur	79	7	at	at	IN
cord-269867-k10siwur	79	8	least	least	JJS
cord-269867-k10siwur	79	9	one	one	CD
cord-269867-k10siwur	79	10	TGEV	TGEV	NNP
cord-269867-k10siwur	79	11	peptide	peptide	NN
cord-269867-k10siwur	79	12	,	,	,
cord-269867-k10siwur	79	13	among	among	IN
cord-269867-k10siwur	79	14	which	which	WDT
cord-269867-k10siwur	79	15	10	10	CD
cord-269867-k10siwur	79	16	had	have	VBD
cord-269867-k10siwur	79	17	both	both	DT
cord-269867-k10siwur	79	18	TGEV	TGEV	NNP
cord-269867-k10siwur	79	19	-	-	HYPH
cord-269867-k10siwur	79	20	C	C	NNP
cord-269867-k10siwur	79	21	and	and	CC
cord-269867-k10siwur	79	22	-A	-A	:
cord-269867-k10siwur	79	23	as	as	IN
cord-269867-k10siwur	79	24	an	an	DT
cord-269867-k10siwur	79	25	A::C	a::c	JJ
cord-269867-k10siwur	79	26	or	or	CC
cord-269867-k10siwur	79	27	C::A	c::a	JJ
cord-269867-k10siwur	79	28	fusion	fusion	NN
cord-269867-k10siwur	79	29	.	.	.
cord-269867-k10siwur	80	1	Finally	finally	RB
cord-269867-k10siwur	80	2	,	,	,
cord-269867-k10siwur	80	3	modifications	modification	NNS
cord-269867-k10siwur	80	4	in	in	IN
cord-269867-k10siwur	80	5	ClpG	ClpG	NNP
cord-269867-k10siwur	80	6	resulted	result	VBD
cord-269867-k10siwur	80	7	in	in	IN
cord-269867-k10siwur	80	8	an	an	DT
cord-269867-k10siwur	80	9	insert	insert	NN
cord-269867-k10siwur	80	10	of	of	IN
cord-269867-k10siwur	80	11	2	2	CD
cord-269867-k10siwur	80	12	,	,	,
cord-269867-k10siwur	80	13	13	13	CD
cord-269867-k10siwur	80	14	,	,	,
cord-269867-k10siwur	80	15	14	14	CD
cord-269867-k10siwur	80	16	,	,	,
cord-269867-k10siwur	80	17	25	25	CD
cord-269867-k10siwur	80	18	,	,	,
cord-269867-k10siwur	80	19	26	26	CD
cord-269867-k10siwur	80	20	or	or	CC
cord-269867-k10siwur	80	21	51	51	CD
cord-269867-k10siwur	80	22	aa	aa	NN
cord-269867-k10siwur	80	23	in	in	IN
cord-269867-k10siwur	80	24	length	length	NN
cord-269867-k10siwur	80	25	(	(	-LRB-
cord-269867-k10siwur	80	26	Fig	fig	NN
cord-269867-k10siwur	80	27	.	.	.
cord-269867-k10siwur	80	28	3	3	CD
cord-269867-k10siwur	80	29	)	)	-RRB-
cord-269867-k10siwur	80	30	.	.	.
cord-269867-k10siwur	81	1	Each	each	DT
cord-269867-k10siwur	81	2	of	of	IN
cord-269867-k10siwur	81	3	the	the	DT
cord-269867-k10siwur	81	4	36	36	CD
cord-269867-k10siwur	81	5	mutant	mutant	JJ
cord-269867-k10siwur	81	6	plasmids	plasmid	NNS
cord-269867-k10siwur	81	7	(	(	-LRB-
cord-269867-k10siwur	81	8	Fig	Fig	NNP
cord-269867-k10siwur	81	9	.	.	.
cord-269867-k10siwur	81	10	3	3	LS
cord-269867-k10siwur	81	11	)	)	-RRB-
cord-269867-k10siwur	81	12	was	be	VBD
cord-269867-k10siwur	81	13	transferred	transfer	VBN
cord-269867-k10siwur	81	14	into	into	IN
cord-269867-k10siwur	81	15	E.	E.	NNP
cord-269867-k10siwur	81	16	coli	coli	NNS
cord-269867-k10siwur	82	1	DH5~	DH5~	NNS
cord-269867-k10siwur	82	2	bearing	bear	VBG
cord-269867-k10siwur	82	3	the	the	DT
cord-269867-k10siwur	82	4	trans	trans	NN
cord-269867-k10siwur	82	5	-	-	JJ
cord-269867-k10siwur	82	6	complementing	complement	VBG
cord-269867-k10siwur	82	7	plasmid	plasmid	NN
cord-269867-k10siwur	82	8	pDSPH524	pDSPH524	NNP
cord-269867-k10siwur	82	9	.	.	.
cord-269867-k10siwur	83	1	The	the	DT
cord-269867-k10siwur	83	2	cell	cell	NN
cord-269867-k10siwur	83	3	-	-	HYPH
cord-269867-k10siwur	83	4	surface	surface	NN
cord-269867-k10siwur	83	5	location	location	NN
cord-269867-k10siwur	83	6	of	of	IN
cord-269867-k10siwur	83	7	the	the	DT
cord-269867-k10siwur	83	8	corresponding	corresponding	JJ
cord-269867-k10siwur	83	9	hybrid	hybrid	NN
cord-269867-k10siwur	83	10	ClpG	ClpG	NNP
cord-269867-k10siwur	83	11	subunits	subunit	NNS
cord-269867-k10siwur	83	12	(	(	-LRB-
cord-269867-k10siwur	83	13	Fig	Fig	NNP
cord-269867-k10siwur	83	14	.	.	.
cord-269867-k10siwur	83	15	3	3	CD
cord-269867-k10siwur	83	16	)	)	-RRB-
cord-269867-k10siwur	84	1	on	on	IN
cord-269867-k10siwur	84	2	CS31A	cs31a	NN
cord-269867-k10siwur	85	1	fibrillae	fibrillae	NNP
cord-269867-k10siwur	85	2	was	be	VBD
cord-269867-k10siwur	85	3	determined	determine	VBN
cord-269867-k10siwur	85	4	on	on	IN
cord-269867-k10siwur	85	5	intact	intact	JJ
cord-269867-k10siwur	85	6	cells	cell	NNS
cord-269867-k10siwur	85	7	by	by	IN
cord-269867-k10siwur	85	8	in	in	IN
cord-269867-k10siwur	85	9	situ	situ	NN
cord-269867-k10siwur	85	10	colony	colony	NN
cord-269867-k10siwur	85	11	immunoblotting	immunoblotting	NN
cord-269867-k10siwur	85	12	and	and	CC
cord-269867-k10siwur	85	13	from	from	IN
cord-269867-k10siwur	85	14	isolated	isolated	JJ
cord-269867-k10siwur	85	15	mutated	mutated	JJ
cord-269867-k10siwur	85	16	CS31A	cs31a	NN
cord-269867-k10siwur	85	17	polymers	polymer	NNS
cord-269867-k10siwur	85	18	by	by	IN
cord-269867-k10siwur	85	19	immunodot	immunodot	NNP
cord-269867-k10siwur	85	20	analysis	analysis	NN
cord-269867-k10siwur	85	21	using	use	VBG
cord-269867-k10siwur	85	22	a	a	DT
cord-269867-k10siwur	85	23	CS31A	cs31a	NN
cord-269867-k10siwur	85	24	-	-	HYPH
cord-269867-k10siwur	85	25	specific	specific	JJ
cord-269867-k10siwur	85	26	polyclonal	polyclonal	JJ
cord-269867-k10siwur	85	27	Ab	ab	NN
cord-269867-k10siwur	85	28	(	(	-LRB-
cord-269867-k10siwur	85	29	pAb	pAb	NNP
cord-269867-k10siwur	85	30	)	)	-RRB-
cord-269867-k10siwur	85	31	,	,	,
cord-269867-k10siwur	85	32	the	the	DT
cord-269867-k10siwur	85	33	TGEV	TGEV	NNP
cord-269867-k10siwur	85	34	-	-	HYPH
cord-269867-k10siwur	85	35	C	C	NNP
cord-269867-k10siwur	85	36	-	-	HYPH
cord-269867-k10siwur	85	37	specific	specific	JJ
cord-269867-k10siwur	85	38	3b.5	3b.5	CD
cord-269867-k10siwur	85	39	mAb	mAb	NNS
cord-269867-k10siwur	85	40	and	and	CC
cord-269867-k10siwur	85	41	the	the	DT
cord-269867-k10siwur	85	42	TGEV	TGEV	NNP
cord-269867-k10siwur	85	43	-	-	HYPH
cord-269867-k10siwur	85	44	A	a	NN
cord-269867-k10siwur	85	45	-	-	HYPH
cord-269867-k10siwur	85	46	specific	specific	JJ
cord-269867-k10siwur	85	47	1AF10	1af10	CD
cord-269867-k10siwur	85	48	mAb	mAb	NNS
cord-269867-k10siwur	85	49	(	(	-LRB-
cord-269867-k10siwur	85	50	not	not	RB
cord-269867-k10siwur	85	51	shown	show	VBN
cord-269867-k10siwur	85	52	)	)	-RRB-
cord-269867-k10siwur	85	53	.	.	.
cord-269867-k10siwur	86	1	Out	out	IN
cord-269867-k10siwur	86	2	of	of	IN
cord-269867-k10siwur	86	3	28	28	CD
cord-269867-k10siwur	86	4	recombinant	recombinant	JJ
cord-269867-k10siwur	86	5	CS31A	cs31a	NN
cord-269867-k10siwur	86	6	fibrillae	fibrillae	NNP
cord-269867-k10siwur	86	7	carrying	carry	VBG
cord-269867-k10siwur	86	8	at	at	RB
cord-269867-k10siwur	86	9	least	least	RBS
cord-269867-k10siwur	86	10	one	one	CD
cord-269867-k10siwur	86	11	TGEV	TGEV	NNP
cord-269867-k10siwur	86	12	peptide	peptide	NN
cord-269867-k10siwur	86	13	only	only	RB
cord-269867-k10siwur	86	14	13	13	CD
cord-269867-k10siwur	86	15	failed	fail	VBD
cord-269867-k10siwur	86	16	to	to	TO
cord-269867-k10siwur	86	17	react	react	VB
cord-269867-k10siwur	86	18	whatever	whatever	WDT
cord-269867-k10siwur	86	19	Ab	ab	NN
cord-269867-k10siwur	86	20	.	.	.
cord-269867-k10siwur	87	1	In	in	IN
cord-269867-k10siwur	87	2	contrast	contrast	NN
cord-269867-k10siwur	87	3	,	,	,
cord-269867-k10siwur	87	4	the	the	DT
cord-269867-k10siwur	87	5	15	15	CD
cord-269867-k10siwur	87	6	remaining	remain	VBG
cord-269867-k10siwur	87	7	hybrids	hybrid	NNS
cord-269867-k10siwur	87	8	were	be	VBD
cord-269867-k10siwur	87	9	capable	capable	JJ
cord-269867-k10siwur	87	10	of	of	IN
cord-269867-k10siwur	87	11	exposing	expose	VBG
cord-269867-k10siwur	87	12	the	the	DT
cord-269867-k10siwur	87	13	TGEV	TGEV	NNP
cord-269867-k10siwur	87	14	peptides	peptide	NNS
cord-269867-k10siwur	87	15	at	at	IN
cord-269867-k10siwur	87	16	the	the	DT
cord-269867-k10siwur	87	17	cell	cell	NN
cord-269867-k10siwur	87	18	surface	surface	NN
cord-269867-k10siwur	87	19	on	on	IN
cord-269867-k10siwur	87	20	the	the	DT
cord-269867-k10siwur	87	21	correctly	correctly	RB
cord-269867-k10siwur	87	22	assembled	assemble	VBN
cord-269867-k10siwur	87	23	CS31A	CS31A	NNP
cord-269867-k10siwur	87	24	fibrillae	fibrillae	NNP
cord-269867-k10siwur	87	25	.	.	.
cord-269867-k10siwur	88	1	Nine	nine	CD
cord-269867-k10siwur	88	2	permissive	permissive	JJ
cord-269867-k10siwur	88	3	were	be	VBD
cord-269867-k10siwur	88	4	identified	identify	VBN
cord-269867-k10siwur	88	5	throughout	throughout	IN
cord-269867-k10siwur	88	6	ClpG.	ClpG.	.
cord-269867-k10siwur	89	1	The	the	DT
cord-269867-k10siwur	89	2	positions	position	NNS
cord-269867-k10siwur	89	3	aa	aa	NNP
cord-269867-k10siwur	89	4	-1/1	-1/1	NNP
cord-269867-k10siwur	89	5	,	,	,
cord-269867-k10siwur	89	6	202	202	CD
cord-269867-k10siwur	89	7	-	-	SYM
cord-269867-k10siwur	89	8	204	204	CD
cord-269867-k10siwur	89	9	and	and	CC
cord-269867-k10siwur	89	10	202	202	CD
cord-269867-k10siwur	89	11	-	-	SYM
cord-269867-k10siwur	89	12	218	218	CD
cord-269867-k10siwur	89	13	appeared	appear	VBD
cord-269867-k10siwur	89	14	to	to	TO
cord-269867-k10siwur	89	15	be	be	VB
cord-269867-k10siwur	89	16	the	the	DT
cord-269867-k10siwur	89	17	most	most	RBS
cord-269867-k10siwur	89	18	permissive	permissive	JJ
cord-269867-k10siwur	89	19	targets	target	NNS
cord-269867-k10siwur	89	20	since	since	IN
cord-269867-k10siwur	89	21	the	the	DT
cord-269867-k10siwur	89	22	largest	large	JJS
cord-269867-k10siwur	89	23	insertions	insertion	NNS
cord-269867-k10siwur	89	24	(	(	-LRB-
cord-269867-k10siwur	89	25	25	25	CD
cord-269867-k10siwur	89	26	or	or	CC
cord-269867-k10siwur	89	27	26	26	CD
cord-269867-k10siwur	89	28	aa	aa	NNP
cord-269867-k10siwur	89	29	)	)	-RRB-
cord-269867-k10siwur	89	30	,	,	,
cord-269867-k10siwur	89	31	did	do	VBD
cord-269867-k10siwur	89	32	not	not	RB
cord-269867-k10siwur	89	33	interfere	interfere	VB
cord-269867-k10siwur	89	34	with	with	IN
cord-269867-k10siwur	89	35	the	the	DT
cord-269867-k10siwur	89	36	CS31A	CS31A	NNP
cord-269867-k10siwur	89	37	fibrillae	fibrillae	NNP
cord-269867-k10siwur	89	38	formation	formation	NN
cord-269867-k10siwur	89	39	.	.	.
cord-269867-k10siwur	90	1	Even	even	RB
cord-269867-k10siwur	90	2	the	the	DT
cord-269867-k10siwur	90	3	hybrid	hybrid	JJ
cord-269867-k10siwur	90	4	ClpG1/203-CA	ClpG1/203-CA	NNP
cord-269867-k10siwur	90	5	protein	protein	NN
cord-269867-k10siwur	90	6	with	with	IN
cord-269867-k10siwur	90	7	an	an	DT
cord-269867-k10siwur	90	8	insert	insert	NN
cord-269867-k10siwur	90	9	of	of	IN
cord-269867-k10siwur	90	10	51	51	CD
cord-269867-k10siwur	90	11	aa	aa	NNP
cord-269867-k10siwur	90	12	long	long	RB
cord-269867-k10siwur	90	13	,	,	,
cord-269867-k10siwur	90	14	resulting	result	VBG
cord-269867-k10siwur	90	15	from	from	IN
cord-269867-k10siwur	90	16	the	the	DT
cord-269867-k10siwur	90	17	simultaneous	simultaneous	JJ
cord-269867-k10siwur	90	18	tandem	tandem	NN
cord-269867-k10siwur	90	19	addition	addition	NN
cord-269867-k10siwur	90	20	of	of	IN
cord-269867-k10siwur	90	21	the	the	DT
cord-269867-k10siwur	90	22	two	two	CD
cord-269867-k10siwur	90	23	TGEV	TGEV	NNP
cord-269867-k10siwur	90	24	peptides	peptide	NNS
cord-269867-k10siwur	90	25	in	in	IN
cord-269867-k10siwur	90	26	both	both	DT
cord-269867-k10siwur	90	27	positions	position	NNS
cord-269867-k10siwur	91	1	aa	aa	NNP
cord-269867-k10siwur	91	2	-1/1	-1/1	NNP
cord-269867-k10siwur	91	3	and	and	CC
cord-269867-k10siwur	91	4	202	202	CD
cord-269867-k10siwur	91	5	-	-	SYM
cord-269867-k10siwur	91	6	218	218	CD
cord-269867-k10siwur	91	7	,	,	,
cord-269867-k10siwur	91	8	was	be	VBD
cord-269867-k10siwur	91	9	incorporated	incorporate	VBN
cord-269867-k10siwur	91	10	in	in	IN
cord-269867-k10siwur	91	11	CS31A	cs31a	NN
cord-269867-k10siwur	91	12	polymer	polymer	NN
cord-269867-k10siwur	91	13	.	.	.
cord-269867-k10siwur	92	1	In	in	IN
cord-269867-k10siwur	92	2	positions	position	NNS
cord-269867-k10siwur	92	3	aa	aa	NNP
cord-269867-k10siwur	92	4	192	192	CD
cord-269867-k10siwur	92	5	to	to	IN
cord-269867-k10siwur	92	6	197	197	CD
cord-269867-k10siwur	92	7	less	less	JJR
cord-269867-k10siwur	92	8	residues	residue	NNS
cord-269867-k10siwur	92	9	(	(	-LRB-
cord-269867-k10siwur	92	10	14	14	CD
cord-269867-k10siwur	92	11	aa	aa	NNP
cord-269867-k10siwur	92	12	)	)	-RRB-
cord-269867-k10siwur	92	13	was	be	VBD
cord-269867-k10siwur	92	14	tolerated	tolerate	VBN
cord-269867-k10siwur	92	15	.	.	.
cord-269867-k10siwur	93	1	Positions	position	NNS
cord-269867-k10siwur	93	2	aa	aa	NNP
cord-269867-k10siwur	93	3	182	182	CD
cord-269867-k10siwur	93	4	-	-	SYM
cord-269867-k10siwur	93	5	183	183	CD
cord-269867-k10siwur	93	6	,	,	,
cord-269867-k10siwur	93	7	190	190	CD
cord-269867-k10siwur	93	8	-	-	SYM
cord-269867-k10siwur	93	9	191	191	CD
cord-269867-k10siwur	93	10	and	and	CC
cord-269867-k10siwur	93	11	191	191	CD
cord-269867-k10siwur	93	12	-	-	SYM
cord-269867-k10siwur	93	13	192	192	CD
cord-269867-k10siwur	93	14	were	be	VBD
cord-269867-k10siwur	93	15	nonpermissive	nonpermissive	JJ
cord-269867-k10siwur	93	16	since	since	IN
cord-269867-k10siwur	93	17	,	,	,
cord-269867-k10siwur	93	18	except	except	IN
cord-269867-k10siwur	93	19	for	for	IN
cord-269867-k10siwur	93	20	ClpG190	ClpG190	NNP
cord-269867-k10siwur	93	21	with	with	IN
cord-269867-k10siwur	93	22	only	only	RB
cord-269867-k10siwur	93	23	two	two	CD
cord-269867-k10siwur	93	24	extra	extra	JJ
cord-269867-k10siwur	93	25	aa	aa	NN
cord-269867-k10siwur	93	26	,	,	,
cord-269867-k10siwur	93	27	no	no	DT
cord-269867-k10siwur	93	28	hybrid	hybrid	NN
cord-269867-k10siwur	93	29	was	be	VBD
cord-269867-k10siwur	93	30	detected	detect	VBN
cord-269867-k10siwur	93	31	.	.	.
cord-269867-k10siwur	94	1	All	all	DT
cord-269867-k10siwur	94	2	nonpermissible	nonpermissible	JJ
cord-269867-k10siwur	94	3	insertions	insertion	NNS
cord-269867-k10siwur	94	4	were	be	VBD
cord-269867-k10siwur	94	5	located	locate	VBN
cord-269867-k10siwur	94	6	in	in	IN
cord-269867-k10siwur	94	7	or	or	CC
cord-269867-k10siwur	94	8	near	near	IN
cord-269867-k10siwur	94	9	a	a	DT
cord-269867-k10siwur	94	10	predicted	predict	VBN
cord-269867-k10siwur	94	11	a	a	DT
cord-269867-k10siwur	94	12	-	-	HYPH
cord-269867-k10siwur	94	13	helix	helix	NN
cord-269867-k10siwur	94	14	structure	structure	NN
cord-269867-k10siwur	94	15	,	,	,
cord-269867-k10siwur	94	16	and	and	CC
cord-269867-k10siwur	94	17	targeted	target	VBD
cord-269867-k10siwur	94	18	conserved	conserve	VBN
cord-269867-k10siwur	94	19	aa	aa	NN
cord-269867-k10siwur	94	20	residues	residue	NNS
cord-269867-k10siwur	94	21	(	(	-LRB-
cord-269867-k10siwur	94	22	Fig	Fig	NNP
cord-269867-k10siwur	94	23	.	.	NNP
cord-269867-k10siwur	94	24	1	1	CD
cord-269867-k10siwur	94	25	,	,	,
cord-269867-k10siwur	94	26	aa	aa	NNP
cord-269867-k10siwur	94	27	182	182	CD
cord-269867-k10siwur	94	28	-193	-193	NN
cord-269867-k10siwur	94	29	)	)	-RRB-
cord-269867-k10siwur	94	30	.	.	.
cord-269867-k10siwur	95	1	By	by	IN
cord-269867-k10siwur	95	2	contrast	contrast	NN
cord-269867-k10siwur	95	3	,	,	,
cord-269867-k10siwur	95	4	all	all	DT
cord-269867-k10siwur	95	5	permissive	permissive	JJ
cord-269867-k10siwur	95	6	sites	site	NNS
cord-269867-k10siwur	95	7	,	,	,
cord-269867-k10siwur	95	8	excluding	exclude	VBG
cord-269867-k10siwur	95	9	the	the	DT
cord-269867-k10siwur	95	10	ClpG	ClpG	NNP
cord-269867-k10siwur	95	11	-	-	HYPH
cord-269867-k10siwur	95	12	N	N	NNP
cord-269867-k10siwur	95	13	terminus	terminus	NN
cord-269867-k10siwur	95	14	,	,	,
cord-269867-k10siwur	95	15	were	be	VBD
cord-269867-k10siwur	95	16	included	include	VBN
cord-269867-k10siwur	95	17	in	in	IN
cord-269867-k10siwur	95	18	a	a	DT
cord-269867-k10siwur	95	19	predicted	predict	VBN
cord-269867-k10siwur	95	20	loop	loop	NN
cord-269867-k10siwur	95	21	(	(	-LRB-
cord-269867-k10siwur	95	22	Fig	Fig	NNP
cord-269867-k10siwur	95	23	.	.	NNP
cord-269867-k10siwur	95	24	1	1	CD
cord-269867-k10siwur	95	25	,	,	,
cord-269867-k10siwur	95	26	aa	aa	NNP
cord-269867-k10siwur	95	27	194	194	CD
cord-269867-k10siwur	95	28	-	-	HYPH
cord-269867-k10siwur	95	29	212	212	CD
cord-269867-k10siwur	95	30	)	)	-RRB-
cord-269867-k10siwur	95	31	that	that	WDT
cord-269867-k10siwur	95	32	is	be	VBZ
cord-269867-k10siwur	95	33	more	more	RBR
cord-269867-k10siwur	95	34	likely	likely	JJ
cord-269867-k10siwur	95	35	to	to	TO
cord-269867-k10siwur	95	36	be	be	VB
cord-269867-k10siwur	95	37	flexible	flexible	JJ
cord-269867-k10siwur	95	38	enough	enough	RB
cord-269867-k10siwur	95	39	to	to	TO
cord-269867-k10siwur	95	40	accommodate	accommodate	VB
cord-269867-k10siwur	95	41	large	large	JJ
cord-269867-k10siwur	95	42	inserts	insert	NNS
cord-269867-k10siwur	95	43	,	,	,
cord-269867-k10siwur	95	44	as	as	IN
cord-269867-k10siwur	95	45	indicated	indicate	VBN
cord-269867-k10siwur	95	46	by	by	IN
cord-269867-k10siwur	95	47	the	the	DT
cord-269867-k10siwur	95	48	proposed	propose	VBN
cord-269867-k10siwur	95	49	CIpG	CIpG	NNP
cord-269867-k10siwur	95	50	topology	topology	NN
cord-269867-k10siwur	95	51	(	(	-LRB-
cord-269867-k10siwur	95	52	Mrchin	Mrchin	NNP
cord-269867-k10siwur	95	53	et	et	NNP
cord-269867-k10siwur	95	54	al	al	NNP
cord-269867-k10siwur	95	55	.	.	NNP
cord-269867-k10siwur	95	56	,	,	,
cord-269867-k10siwur	95	57	1995	1995	CD
cord-269867-k10siwur	95	58	)	)	-RRB-
cord-269867-k10siwur	95	59	.	.	.
cord-269867-k10siwur	96	1	While	while	IN
cord-269867-k10siwur	96	2	the	the	DT
cord-269867-k10siwur	96	3	two	two	CD
cord-269867-k10siwur	96	4	fully	fully	RB
cord-269867-k10siwur	96	5	permissive	permissive	JJ
cord-269867-k10siwur	96	6	sites	site	NNS
cord-269867-k10siwur	96	7	(	(	-LRB-
cord-269867-k10siwur	96	8	aa	aa	NNP
cord-269867-k10siwur	96	9	202	202	CD
cord-269867-k10siwur	96	10	-	-	HYPH
cord-269867-k10siwur	96	11	204	204	CD
cord-269867-k10siwur	96	12	and	and	CC
cord-269867-k10siwur	96	13	202	202	CD
cord-269867-k10siwur	96	14	-	-	SYM
cord-269867-k10siwur	96	15	218	218	CD
cord-269867-k10siwur	96	16	)	)	-RRB-
cord-269867-k10siwur	96	17	were	be	VBD
cord-269867-k10siwur	96	18	located	locate	VBN
cord-269867-k10siwur	96	19	between	between	IN
cord-269867-k10siwur	96	20	the	the	DT
cord-269867-k10siwur	96	21	top	top	NN
cord-269867-k10siwur	96	22	and	and	CC
cord-269867-k10siwur	96	23	the	the	DT
cord-269867-k10siwur	96	24	end	end	NN
cord-269867-k10siwur	96	25	of	of	IN
cord-269867-k10siwur	96	26	the	the	DT
cord-269867-k10siwur	96	27	loop	loop	NN
cord-269867-k10siwur	96	28	,	,	,
cord-269867-k10siwur	96	29	the	the	DT
cord-269867-k10siwur	96	30	six	six	CD
cord-269867-k10siwur	96	31	partially	partially	RB
cord-269867-k10siwur	96	32	permissive	permissive	JJ
cord-269867-k10siwur	96	33	sites	site	NNS
cord-269867-k10siwur	96	34	(	(	-LRB-
cord-269867-k10siwur	96	35	aa	aa	NNP
cord-269867-k10siwur	96	36	192	192	CD
cord-269867-k10siwur	96	37	to	to	IN
cord-269867-k10siwur	96	38	197	197	CD
cord-269867-k10siwur	96	39	)	)	-RRB-
cord-269867-k10siwur	96	40	targeted	target	VBN
cord-269867-k10siwur	96	41	region	region	NN
cord-269867-k10siwur	96	42	immediately	immediately	RB
cord-269867-k10siwur	96	43	beginning	begin	VBG
cord-269867-k10siwur	96	44	this	this	DT
cord-269867-k10siwur	96	45	loop	loop	NN
cord-269867-k10siwur	96	46	.	.	.
cord-269867-k10siwur	97	1	These	these	DT
cord-269867-k10siwur	97	2	data	datum	NNS
cord-269867-k10siwur	97	3	suggest	suggest	VBP
cord-269867-k10siwur	97	4	a	a	DT
cord-269867-k10siwur	97	5	relationship	relationship	NN
cord-269867-k10siwur	97	6	between	between	IN
cord-269867-k10siwur	97	7	the	the	DT
cord-269867-k10siwur	97	8	permissivity	permissivity	NN
cord-269867-k10siwur	97	9	of	of	IN
cord-269867-k10siwur	97	10	ClpG	ClpG	NNP
cord-269867-k10siwur	97	11	and	and	CC
cord-269867-k10siwur	97	12	the	the	DT
cord-269867-k10siwur	97	13	local	local	JJ
cord-269867-k10siwur	97	14	CIpG	CIpG	NNP
cord-269867-k10siwur	97	15	structures	structure	NNS
cord-269867-k10siwur	97	16	into	into	IN
cord-269867-k10siwur	97	17	which	which	WDT
cord-269867-k10siwur	97	18	the	the	DT
cord-269867-k10siwur	97	19	epitope	epitope	NN
cord-269867-k10siwur	97	20	was	be	VBD
cord-269867-k10siwur	97	21	inserted	insert	VBN
cord-269867-k10siwur	97	22	.	.	.
cord-269867-k10siwur	98	1	On	on	IN
cord-269867-k10siwur	98	2	the	the	DT
cord-269867-k10siwur	98	3	basis	basis	NN
cord-269867-k10siwur	98	4	of	of	IN
cord-269867-k10siwur	98	5	these	these	DT
cord-269867-k10siwur	98	6	results	result	NNS
cord-269867-k10siwur	98	7	,	,	,
cord-269867-k10siwur	98	8	we	-PRON-	PRP
cord-269867-k10siwur	98	9	conclude	conclude	VBP
cord-269867-k10siwur	98	10	that	that	IN
cord-269867-k10siwur	98	11	ClpG	ClpG	NNP
cord-269867-k10siwur	98	12	as	as	IN
cord-269867-k10siwur	98	13	a	a	DT
cord-269867-k10siwur	98	14	carrier	carrier	NN
cord-269867-k10siwur	98	15	is	be	VBZ
cord-269867-k10siwur	98	16	very	very	RB
cord-269867-k10siwur	98	17	flexible	flexible	JJ
cord-269867-k10siwur	98	18	since	since	IN
cord-269867-k10siwur	98	19	insertions	insertion	NNS
cord-269867-k10siwur	98	20	varying	vary	VBG
cord-269867-k10siwur	98	21	in	in	IN
cord-269867-k10siwur	98	22	length	length	NN
cord-269867-k10siwur	98	23	and	and	CC
cord-269867-k10siwur	98	24	nature	nature	NN
cord-269867-k10siwur	98	25	can	can	MD
cord-269867-k10siwur	98	26	be	be	VB
cord-269867-k10siwur	98	27	made	make	VBN
cord-269867-k10siwur	98	28	in	in	IN
cord-269867-k10siwur	98	29	different	different	JJ
cord-269867-k10siwur	98	30	sites	site	NNS
cord-269867-k10siwur	98	31	without	without	IN
cord-269867-k10siwur	98	32	affecting	affect	VBG
cord-269867-k10siwur	98	33	CS31A	cs31a	NN
cord-269867-k10siwur	98	34	formation	formation	NN
cord-269867-k10siwur	98	35	.	.	.
cord-269867-k10siwur	99	1	Only	only	RB
cord-269867-k10siwur	99	2	hybrid	hybrid	JJ
cord-269867-k10siwur	99	3	ClpG	ClpG	NNP
cord-269867-k10siwur	99	4	subunits	subunit	NNS
cord-269867-k10siwur	99	5	displaying	display	VBG
cord-269867-k10siwur	99	6	at	at	IN
cord-269867-k10siwur	99	7	least	least	JJS
cord-269867-k10siwur	99	8	one	one	CD
cord-269867-k10siwur	99	9	TGEV	tgev	NN
cord-269867-k10siwur	99	10	peptide	peptide	NN
cord-269867-k10siwur	99	11	on	on	IN
cord-269867-k10siwur	99	12	CS31A	cs31a	NN
cord-269867-k10siwur	99	13	were	be	VBD
cord-269867-k10siwur	99	14	characterized	characterize	VBN
cord-269867-k10siwur	99	15	by	by	IN
cord-269867-k10siwur	99	16	Western	western	JJ
cord-269867-k10siwur	99	17	immunoblot	immunoblot	NNS
cord-269867-k10siwur	99	18	analysis	analysis	NN
cord-269867-k10siwur	99	19	(	(	-LRB-
cord-269867-k10siwur	99	20	Fig	Fig	NNP
cord-269867-k10siwur	99	21	.	.	NNP
cord-269867-k10siwur	99	22	4	4	CD
cord-269867-k10siwur	99	23	)	)	-RRB-
cord-269867-k10siwur	99	24	.	.	.
cord-269867-k10siwur	100	1	Proteins	protein	NNS
cord-269867-k10siwur	100	2	CIpG192-C	CIpG192-C	VBN
cord-269867-k10siwur	100	3	,	,	,
cord-269867-k10siwur	100	4	ClpG193-C	clpg193-c	NN
cord-269867-k10siwur	100	5	,	,	,
cord-269867-k10siwur	100	6	ClpG194-C	ClpG194-C	NNP
cord-269867-k10siwur	100	7	,	,	,
cord-269867-k10siwur	100	8	ClpG195-C	clpg195-c	NN
cord-269867-k10siwur	100	9	,	,	,
cord-269867-k10siwur	100	10	ClpG196-C	ClpG196-C	NNS
cord-269867-k10siwur	100	11	,	,	,
cord-269867-k10siwur	100	12	Clp	Clp	NNP
cord-269867-k10siwur	100	13	G197-C	G197-C	NNP
cord-269867-k10siwur	100	14	,	,	,
cord-269867-k10siwur	100	15	ClpG202-XC	ClpG202-XC	NNPS
cord-269867-k10siwur	100	16	,	,	,
cord-269867-k10siwur	100	17	ClpG1-CA	ClpG1-CA	NNP
cord-269867-k10siwur	100	18	,	,	,
cord-269867-k10siwur	101	1	ClpG1-C	ClpG1-C	NNP
cord-269867-k10siwur	101	2	,	,	,
cord-269867-k10siwur	101	3	GlpG1-AC	GlpG1-AC	NNP
cord-269867-k10siwur	101	4	and	and	CC
cord-269867-k10siwur	101	5	ClpG202-C	ClpG202-C	NNP
cord-269867-k10siwur	101	6	migrated	migrate	VBN
cord-269867-k10siwur	101	7	as	as	IN
cord-269867-k10siwur	101	8	a	a	DT
cord-269867-k10siwur	101	9	single	single	JJ
cord-269867-k10siwur	101	10	band	band	NN
cord-269867-k10siwur	101	11	which	which	WDT
cord-269867-k10siwur	101	12	corresponds	correspond	VBZ
cord-269867-k10siwur	101	13	to	to	IN
cord-269867-k10siwur	101	14	the	the	DT
cord-269867-k10siwur	101	15	expected	expect	VBN
cord-269867-k10siwur	101	16	full	full	JJ
cord-269867-k10siwur	101	17	-	-	HYPH
cord-269867-k10siwur	101	18	length	length	NN
cord-269867-k10siwur	101	19	hybrid	hybrid	NN
cord-269867-k10siwur	101	20	since	since	IN
cord-269867-k10siwur	101	21	revealed	reveal	VBN
cord-269867-k10siwur	101	22	by	by	IN
cord-269867-k10siwur	101	23	anti	anti	JJ
cord-269867-k10siwur	101	24	-	-	JJ
cord-269867-k10siwur	101	25	ClpG	ClpG	NNP
cord-269867-k10siwur	101	26	pAb	pab	NN
cord-269867-k10siwur	101	27	,	,	,
cord-269867-k10siwur	101	28	3b,5mAb	3b,5mab	CD
cord-269867-k10siwur	101	29	and	and	CC
cord-269867-k10siwur	101	30	1AF10mAb	1af10mab	CD
cord-269867-k10siwur	101	31	(	(	-LRB-
cord-269867-k10siwur	101	32	Fig	Fig	NNP
cord-269867-k10siwur	101	33	.	.	.
cord-269867-k10siwur	101	34	4a	4a	CD
cord-269867-k10siwur	101	35	,	,	,
cord-269867-k10siwur	101	36	b	b	NN
cord-269867-k10siwur	101	37	,	,	,
cord-269867-k10siwur	101	38	c	c	NNP
cord-269867-k10siwur	101	39	)	)	-RRB-
cord-269867-k10siwur	101	40	.	.	.
cord-269867-k10siwur	102	1	Mutants	mutant	NNS
cord-269867-k10siwur	102	2	ClpG203-A	clpg203-a	NN
cord-269867-k10siwur	102	3	,	,	,
cord-269867-k10siwur	103	1	ClpG203-CA	ClpG203-CA	NNP
cord-269867-k10siwur	103	2	and	and	CC
cord-269867-k10siwur	103	3	CIpG202-AC	CIpG202-AC	NNP
cord-269867-k10siwur	103	4	showed	show	VBD
cord-269867-k10siwur	103	5	two	two	CD
cord-269867-k10siwur	103	6	protein	protein	NN
cord-269867-k10siwur	103	7	products	product	NNS
cord-269867-k10siwur	103	8	,	,	,
cord-269867-k10siwur	103	9	all	all	DT
cord-269867-k10siwur	103	10	reacting	react	VBG
cord-269867-k10siwur	103	11	with	with	IN
cord-269867-k10siwur	103	12	anti	anti	JJ
cord-269867-k10siwur	103	13	-	-	JJ
cord-269867-k10siwur	103	14	ClpG	ClpG	NNP
cord-269867-k10siwur	103	15	(	(	-LRB-
cord-269867-k10siwur	103	16	Fig	fig	NN
cord-269867-k10siwur	103	17	.	.	.
cord-269867-k10siwur	103	18	4a	4a	LS
cord-269867-k10siwur	103	19	)	)	-RRB-
cord-269867-k10siwur	103	20	;	;	:
cord-269867-k10siwur	103	21	their	-PRON-	PRP$
cord-269867-k10siwur	103	22	upper	upper	JJ
cord-269867-k10siwur	103	23	band	band	NN
cord-269867-k10siwur	103	24	detected	detect	VBN
cord-269867-k10siwur	103	25	by	by	IN
cord-269867-k10siwur	103	26	the	the	DT
cord-269867-k10siwur	103	27	three	three	CD
cord-269867-k10siwur	103	28	Ab	Ab	NNP
cord-269867-k10siwur	103	29	represents	represent	VBZ
cord-269867-k10siwur	103	30	the	the	DT
cord-269867-k10siwur	103	31	whole	whole	JJ
cord-269867-k10siwur	103	32	fusion	fusion	NN
cord-269867-k10siwur	103	33	molecule	molecule	NN
cord-269867-k10siwur	103	34	which	which	WDT
cord-269867-k10siwur	103	35	was	be	VBD
cord-269867-k10siwur	103	36	more	more	RBR
cord-269867-k10siwur	103	37	abundant	abundant	JJ
cord-269867-k10siwur	103	38	in	in	IN
cord-269867-k10siwur	103	39	ClpG203-CA	ClpG203-CA	NNP
cord-269867-k10siwur	103	40	.	.	.
cord-269867-k10siwur	104	1	In	in	IN
cord-269867-k10siwur	104	2	ClpG203A	clpg203a	NN
cord-269867-k10siwur	104	3	and	and	CC
cord-269867-k10siwur	104	4	ClpG202-AC	ClpG202-AC	NNP
cord-269867-k10siwur	104	5	,	,	,
cord-269867-k10siwur	104	6	the	the	DT
cord-269867-k10siwur	104	7	major	major	JJ
cord-269867-k10siwur	104	8	lower	low	JJR
cord-269867-k10siwur	104	9	band	band	NN
cord-269867-k10siwur	104	10	was	be	VBD
cord-269867-k10siwur	104	11	recognized	recognize	VBN
cord-269867-k10siwur	104	12	by	by	IN
cord-269867-k10siwur	104	13	only	only	JJ
cord-269867-k10siwur	104	14	anti	anti	NNS
cord-269867-k10siwur	104	15	-	-	NNS
cord-269867-k10siwur	104	16	ClpG	ClpG	NNP
cord-269867-k10siwur	104	17	while	while	IN
cord-269867-k10siwur	104	18	in	in	IN
cord-269867-k10siwur	104	19	Clp	Clp	NNP
cord-269867-k10siwur	104	20	-	-	HYPH
cord-269867-k10siwur	104	21	G203-CA	G203-CA	NNP
cord-269867-k10siwur	104	22	the	the	DT
cord-269867-k10siwur	104	23	minor	minor	JJ
cord-269867-k10siwur	104	24	lower	low	JJR
cord-269867-k10siwur	104	25	band	band	NN
cord-269867-k10siwur	104	26	was	be	VBD
cord-269867-k10siwur	104	27	additionally	additionally	RB
cord-269867-k10siwur	104	28	by	by	IN
cord-269867-k10siwur	104	29	3b.5	3b.5	CD
cord-269867-k10siwur	104	30	mAb	mAb	NNS
cord-269867-k10siwur	104	31	(	(	-LRB-
cord-269867-k10siwur	104	32	Fig	Fig	NNP
cord-269867-k10siwur	104	33	.	.	.
cord-269867-k10siwur	104	34	4b	4b	CD
cord-269867-k10siwur	104	35	)	)	-RRB-
cord-269867-k10siwur	104	36	.	.	.
cord-269867-k10siwur	105	1	In	in	IN
cord-269867-k10siwur	105	2	ClpG1/203-CA	ClpG1/203-CA	NNP
cord-269867-k10siwur	105	3	the	the	DT
cord-269867-k10siwur	105	4	two	two	CD
cord-269867-k10siwur	105	5	uppermost	uppermost	JJ
cord-269867-k10siwur	105	6	bands	band	NNS
cord-269867-k10siwur	105	7	were	be	VBD
cord-269867-k10siwur	105	8	lighted	light	VBN
cord-269867-k10siwur	105	9	whatever	whatever	WDT
cord-269867-k10siwur	105	10	Ab	ab	NN
cord-269867-k10siwur	105	11	(	(	-LRB-
cord-269867-k10siwur	105	12	Fig	Fig	NNP
cord-269867-k10siwur	105	13	.	.	.
cord-269867-k10siwur	105	14	4a	4a	CD
cord-269867-k10siwur	105	15	,	,	,
cord-269867-k10siwur	105	16	b	b	NN
cord-269867-k10siwur	105	17	,	,	,
cord-269867-k10siwur	105	18	c	c	NNP
cord-269867-k10siwur	105	19	)	)	-RRB-
cord-269867-k10siwur	105	20	and	and	CC
cord-269867-k10siwur	105	21	the	the	DT
cord-269867-k10siwur	105	22	two	two	CD
cord-269867-k10siwur	105	23	lowermost	lowermost	NN
cord-269867-k10siwur	105	24	bands	band	NNS
cord-269867-k10siwur	105	25	only	only	RB
cord-269867-k10siwur	105	26	with	with	IN
cord-269867-k10siwur	105	27	anti	anti	NNS
cord-269867-k10siwur	105	28	-	-	JJ
cord-269867-k10siwur	105	29	ClpG	ClpG	NNS
cord-269867-k10siwur	105	30	and	and	CC
cord-269867-k10siwur	105	31	3b.5	3b.5	CD
cord-269867-k10siwur	105	32	Ab	Ab	NNP
cord-269867-k10siwur	105	33	(	(	-LRB-
cord-269867-k10siwur	105	34	Fig	Fig	NNP
cord-269867-k10siwur	105	35	.	.	.
cord-269867-k10siwur	105	36	4a	4a	CD
cord-269867-k10siwur	105	37	,	,	,
cord-269867-k10siwur	105	38	b	b	LS
cord-269867-k10siwur	105	39	)	)	-RRB-
cord-269867-k10siwur	105	40	.	.	.
cord-269867-k10siwur	106	1	These	these	DT
cord-269867-k10siwur	106	2	observations	observation	NNS
cord-269867-k10siwur	106	3	indicated	indicate	VBD
cord-269867-k10siwur	106	4	that	that	IN
cord-269867-k10siwur	106	5	most	most	JJS
cord-269867-k10siwur	106	6	of	of	IN
cord-269867-k10siwur	106	7	the	the	DT
cord-269867-k10siwur	106	8	hybrids	hybrid	NNS
cord-269867-k10siwur	106	9	carrying	carry	VBG
cord-269867-k10siwur	106	10	TGEV	TGEV	NNP
cord-269867-k10siwur	106	11	-	-	HYPH
cord-269867-k10siwur	106	12	A	A	NNP
cord-269867-k10siwur	106	13	was	be	VBD
cord-269867-k10siwur	106	14	subjected	subject	VBN
cord-269867-k10siwur	106	15	to	to	IN
cord-269867-k10siwur	106	16	an	an	DT
cord-269867-k10siwur	106	17	incomplete	incomplete	JJ
cord-269867-k10siwur	106	18	proteolysis	proteolysis	NN
cord-269867-k10siwur	106	19	which	which	WDT
cord-269867-k10siwur	106	20	,	,	,
cord-269867-k10siwur	106	21	however	however	RB
cord-269867-k10siwur	106	22	,	,	,
cord-269867-k10siwur	106	23	did	do	VBD
cord-269867-k10siwur	106	24	not	not	RB
cord-269867-k10siwur	106	25	prevent	prevent	VB
cord-269867-k10siwur	106	26	the	the	DT
cord-269867-k10siwur	106	27	CS31A	cs31a	NN
cord-269867-k10siwur	106	28	formation	formation	NN
cord-269867-k10siwur	106	29	(	(	-LRB-
cord-269867-k10siwur	106	30	Fig	Fig	NNP
cord-269867-k10siwur	106	31	.	.	.
cord-269867-k10siwur	106	32	3	3	CD
cord-269867-k10siwur	106	33	and	and	CC
cord-269867-k10siwur	106	34	Section2.2	section2.2	CD
cord-269867-k10siwur	106	35	)	)	-RRB-
cord-269867-k10siwur	106	36	)	)	-RRB-
cord-269867-k10siwur	106	37	.	.	.
cord-269867-k10siwur	107	1	In	in	IN
cord-269867-k10siwur	107	2	a	a	DT
cord-269867-k10siwur	107	3	general	general	JJ
cord-269867-k10siwur	107	4	way	way	NN
cord-269867-k10siwur	107	5	,	,	,
cord-269867-k10siwur	107	6	ClpG	ClpG	NNP
cord-269867-k10siwur	107	7	hybrids	hybrid	NNS
cord-269867-k10siwur	107	8	containing	contain	VBG
cord-269867-k10siwur	107	9	TGEV	TGEV	NNP
cord-269867-k10siwur	107	10	-	-	HYPH
cord-269867-k10siwur	107	11	A	A	NNP
cord-269867-k10siwur	107	12	reacted	react	VBD
cord-269867-k10siwur	107	13	faintly	faintly	RB
cord-269867-k10siwur	107	14	with	with	IN
cord-269867-k10siwur	107	15	1AFI0	1afi0	CD
cord-269867-k10siwur	107	16	mAb	mAb	NNS
cord-269867-k10siwur	107	17	(	(	-LRB-
cord-269867-k10siwur	107	18	Fig	Fig	NNP
cord-269867-k10siwur	107	19	.	.	NNP
cord-269867-k10siwur	107	20	4c	4c	CD
cord-269867-k10siwur	107	21	)	)	-RRB-
cord-269867-k10siwur	107	22	.	.	.
cord-269867-k10siwur	108	1	peptides	peptide	NNS
cord-269867-k10siwur	108	2	C	C	NNP
cord-269867-k10siwur	108	3	and	and	CC
cord-269867-k10siwur	108	4	A	a	NN
cord-269867-k10siwur	108	5	in	in	IN
cord-269867-k10siwur	108	6	tandem	tandem	NN
cord-269867-k10siwur	108	7	;	;	.
cord-269867-k10siwur	109	1	X	x	NN
cord-269867-k10siwur	109	2	,	,	,
cord-269867-k10siwur	109	3	cryptic	cryptic	JJ
cord-269867-k10siwur	109	4	peptide	peptide	NN
cord-269867-k10siwur	109	5	encoded	encode	VBN
cord-269867-k10siwur	109	6	by	by	IN
cord-269867-k10siwur	109	7	oligo	oligo	NNP
cord-269867-k10siwur	109	8	#	#	$
cord-269867-k10siwur	109	9	3	3	CD
cord-269867-k10siwur	110	1	(	(	-LRB-
cord-269867-k10siwur	110	2	Fig	Fig	NNP
cord-269867-k10siwur	110	3	.	.	NNP
cord-269867-k10siwur	110	4	2	2	LS
cord-269867-k10siwur	110	5	)	)	-RRB-
cord-269867-k10siwur	110	6	inserted	insert	VBN
cord-269867-k10siwur	110	7	in	in	IN
cord-269867-k10siwur	110	8	-	-	HYPH
cord-269867-k10siwur	110	9	phase	phase	NN
cord-269867-k10siwur	110	10	but	but	CC
cord-269867-k10siwur	110	11	in	in	IN
cord-269867-k10siwur	110	12	the	the	DT
cord-269867-k10siwur	110	13	reverse	reverse	JJ
cord-269867-k10siwur	110	14	orientation	orientation	NN
cord-269867-k10siwur	110	15	.	.	.
cord-269867-k10siwur	111	1	(	(	-LRB-
cord-269867-k10siwur	111	2	d	d	LS
cord-269867-k10siwur	111	3	)	)	-RRB-
cord-269867-k10siwur	111	4	aa	aa	NNP
cord-269867-k10siwur	111	5	changes	change	NNS
cord-269867-k10siwur	111	6	resulting	result	VBG
cord-269867-k10siwur	111	7	from	from	IN
cord-269867-k10siwur	111	8	the	the	DT
cord-269867-k10siwur	111	9	engineering	engineering	NN
cord-269867-k10siwur	111	10	of	of	IN
cord-269867-k10siwur	111	11	the	the	DT
cord-269867-k10siwur	111	12	TGEV	TGEV	NNP
cord-269867-k10siwur	111	13	epitopes	epitopes	NN
cord-269867-k10siwur	111	14	-	-	HYPH
cord-269867-k10siwur	111	15	encoding	encode	VBG
cord-269867-k10siwur	111	16	oligos	oligo	NNS
cord-269867-k10siwur	111	17	(	(	-LRB-
cord-269867-k10siwur	111	18	Fig	fig	NN
cord-269867-k10siwur	111	19	.	.	NNP
cord-269867-k10siwur	111	20	2	2	CD
cord-269867-k10siwur	111	21	)	)	-RRB-
cord-269867-k10siwur	111	22	in	in	IN
cord-269867-k10siwur	111	23	CIpG	CIpG	NNP
cord-269867-k10siwur	112	1	:	:	:
cord-269867-k10siwur	112	2	the	the	DT
cord-269867-k10siwur	112	3	numbers	number	NNS
cord-269867-k10siwur	112	4	refer	refer	VBP
cord-269867-k10siwur	112	5	to	to	IN
cord-269867-k10siwur	112	6	the	the	DT
cord-269867-k10siwur	112	7	indicated	indicate	VBN
cord-269867-k10siwur	112	8	first	first	RB
cord-269867-k10siwur	112	9	and	and	CC
cord-269867-k10siwur	112	10	last	last	JJ
cord-269867-k10siwur	112	11	aa	aa	NNP
cord-269867-k10siwur	112	12	residues	residue	NNS
cord-269867-k10siwur	112	13	of	of	IN
cord-269867-k10siwur	112	14	the	the	DT
cord-269867-k10siwur	112	15	wild	wild	JJ
cord-269867-k10siwur	112	16	-	-	HYPH
cord-269867-k10siwur	112	17	type	type	NN
cord-269867-k10siwur	112	18	(	(	-LRB-
cord-269867-k10siwur	112	19	wt	wt	NN
cord-269867-k10siwur	112	20	)	)	-RRB-
cord-269867-k10siwur	112	21	CIpG	CIpG	NNP
cord-269867-k10siwur	112	22	sequence	sequence	NN
cord-269867-k10siwur	112	23	;	;	:
cord-269867-k10siwur	112	24	residues	residue	NNS
cord-269867-k10siwur	112	25	from	from	IN
cord-269867-k10siwur	112	26	the	the	DT
cord-269867-k10siwur	112	27	original	original	JJ
cord-269867-k10siwur	112	28	ClpG	ClpG	NNP
cord-269867-k10siwur	112	29	protein	protein	NN
cord-269867-k10siwur	112	30	are	be	VBP
cord-269867-k10siwur	112	31	in	in	IN
cord-269867-k10siwur	112	32	small	small	JJ
cord-269867-k10siwur	112	33	characters	character	NNS
cord-269867-k10siwur	112	34	and	and	CC
cord-269867-k10siwur	112	35	additional	additional	JJ
cord-269867-k10siwur	112	36	residues	residue	NNS
cord-269867-k10siwur	112	37	are	be	VBP
cord-269867-k10siwur	112	38	in	in	IN
cord-269867-k10siwur	112	39	large	large	JJ
cord-269867-k10siwur	112	40	bold	bold	JJ
cord-269867-k10siwur	112	41	type	type	NN
cord-269867-k10siwur	112	42	.	.	.
cord-269867-k10siwur	113	1	Hatched	hatch	VBN
cord-269867-k10siwur	113	2	boxes	box	NNS
cord-269867-k10siwur	113	3	,	,	,
cord-269867-k10siwur	113	4	TGEV	TGEV	NNP
cord-269867-k10siwur	113	5	-	-	HYPH
cord-269867-k10siwur	113	6	C	C	NNP
cord-269867-k10siwur	113	7	;	;	,
cord-269867-k10siwur	113	8	black	black	JJ
cord-269867-k10siwur	113	9	boxes	box	NNS
cord-269867-k10siwur	113	10	,	,	,
cord-269867-k10siwur	113	11	TGEV	TGEV	NNP
cord-269867-k10siwur	113	12	-	-	HYPH
cord-269867-k10siwur	113	13	A	a	NN
cord-269867-k10siwur	113	14	;	;	,
cord-269867-k10siwur	113	15	open	open	JJ
cord-269867-k10siwur	113	16	boxes	box	NNS
cord-269867-k10siwur	113	17	,	,	,
cord-269867-k10siwur	113	18	cryptic	cryptic	JJ
cord-269867-k10siwur	113	19	peptide	peptide	NN
cord-269867-k10siwur	113	20	X	x	NN
cord-269867-k10siwur	113	21	:	:	:
cord-269867-k10siwur	113	22	TQQADHSQISS	TQQADHSQISS	NNP
cord-269867-k10siwur	113	23	.	.	.
cord-269867-k10siwur	114	1	(	(	-LRB-
cord-269867-k10siwur	114	2	e	e	LS
cord-269867-k10siwur	114	3	)	)	-RRB-
cord-269867-k10siwur	114	4	Total	total	JJ
cord-269867-k10siwur	114	5	number	number	NN
cord-269867-k10siwur	114	6	of	of	IN
cord-269867-k10siwur	114	7	added	add	VBN
cord-269867-k10siwur	114	8	aa	aa	NNP
cord-269867-k10siwur	114	9	with	with	IN
cord-269867-k10siwur	114	10	respect	respect	NN
cord-269867-k10siwur	114	11	to	to	IN
cord-269867-k10siwur	114	12	wt	wt	NN
cord-269867-k10siwur	114	13	CIpG.	CIpG.	NNP
cord-269867-k10siwur	114	14	(	(	-LRB-
cord-269867-k10siwur	115	1	f	f	LS
cord-269867-k10siwur	115	2	)	)	-RRB-
cord-269867-k10siwur	115	3	CS31A	CS31A	NNP
cord-269867-k10siwur	115	4	fibrillae	fibrillae	NNP
cord-269867-k10siwur	115	5	biogenesis	biogenesis	NN
cord-269867-k10siwur	115	6	:	:	:
cord-269867-k10siwur	116	1	+	+	CC
cord-269867-k10siwur	116	2	and	and	CC
cord-269867-k10siwur	116	3	-	-	HYPH
cord-269867-k10siwur	116	4	,	,	,
cord-269867-k10siwur	116	5	synthesis	synthesis	NN
cord-269867-k10siwur	116	6	and	and	CC
cord-269867-k10siwur	116	7	no	no	DT
cord-269867-k10siwur	116	8	synthesis	synthesis	NN
cord-269867-k10siwur	116	9	,	,	,
cord-269867-k10siwur	116	10	respectively	respectively	RB
cord-269867-k10siwur	116	11	.	.	.
cord-269867-k10siwur	117	1	Methods	method	NNS
cord-269867-k10siwur	117	2	:	:	:
cord-269867-k10siwur	117	3	The	the	DT
cord-269867-k10siwur	117	4	production	production	NN
cord-269867-k10siwur	117	5	of	of	IN
cord-269867-k10siwur	117	6	hybrid	hybrid	JJ
cord-269867-k10siwur	117	7	CS31A	cs31a	NN
cord-269867-k10siwur	117	8	polymers	polymer	NNS
cord-269867-k10siwur	117	9	was	be	VBD
cord-269867-k10siwur	117	10	detected	detect	VBN
cord-269867-k10siwur	117	11	by	by	IN
cord-269867-k10siwur	117	12	in	in	IN
cord-269867-k10siwur	117	13	situ	situ	JJ
cord-269867-k10siwur	117	14	colony	colony	NN
cord-269867-k10siwur	117	15	immunoblotting	immunoblotting	NN
cord-269867-k10siwur	117	16	and	and	CC
cord-269867-k10siwur	117	17	immunodot	immunodot	NNP
cord-269867-k10siwur	117	18	analysis	analysis	NN
cord-269867-k10siwur	117	19	.	.	.
cord-269867-k10siwur	118	1	For	for	IN
cord-269867-k10siwur	118	2	colony	colony	NN
cord-269867-k10siwur	118	3	blots	blot	NNS
cord-269867-k10siwur	118	4	analysis	analysis	NN
cord-269867-k10siwur	118	5	,	,	,
cord-269867-k10siwur	118	6	single	single	JJ
cord-269867-k10siwur	118	7	colonies	colony	NNS
cord-269867-k10siwur	118	8	were	be	VBD
cord-269867-k10siwur	118	9	streaked	streak	VBN
cord-269867-k10siwur	118	10	on	on	IN
cord-269867-k10siwur	118	11	a	a	DT
cord-269867-k10siwur	118	12	solid	solid	JJ
cord-269867-k10siwur	118	13	agar	agar	JJ
cord-269867-k10siwur	118	14	LB	LB	NNP
cord-269867-k10siwur	118	15	plate	plate	NN
cord-269867-k10siwur	118	16	containing	contain	VBG
cord-269867-k10siwur	118	17	appropriate	appropriate	JJ
cord-269867-k10siwur	118	18	antibiotics	antibiotic	NNS
cord-269867-k10siwur	118	19	.	.	.
cord-269867-k10siwur	119	1	After	after	IN
cord-269867-k10siwur	119	2	overnight	overnight	JJ
cord-269867-k10siwur	119	3	incubation	incubation	NN
cord-269867-k10siwur	119	4	at	at	IN
cord-269867-k10siwur	119	5	37	37	CD
cord-269867-k10siwur	119	6	°	°	NN
cord-269867-k10siwur	119	7	C	c	NN
cord-269867-k10siwur	119	8	,	,	,
cord-269867-k10siwur	119	9	a	a	DT
cord-269867-k10siwur	119	10	nitrocellulose	nitrocellulose	NN
cord-269867-k10siwur	119	11	filter	filter	NN
cord-269867-k10siwur	119	12	(	(	-LRB-
cord-269867-k10siwur	119	13	pore	pore	NN
cord-269867-k10siwur	119	14	diameter	diameter	NN
cord-269867-k10siwur	119	15	,	,	,
cord-269867-k10siwur	119	16	0.45	0.45	CD
cord-269867-k10siwur	119	17	~tm	~tm	NNP
cord-269867-k10siwur	119	18	;	;	:
cord-269867-k10siwur	119	19	Schleicher	Schleicher	NNP
cord-269867-k10siwur	119	20	and	and	CC
cord-269867-k10siwur	119	21	Schuell	Schuell	NNP
cord-269867-k10siwur	119	22	)	)	-RRB-
cord-269867-k10siwur	119	23	was	be	VBD
cord-269867-k10siwur	119	24	carefully	carefully	RB
cord-269867-k10siwur	119	25	applied	apply	VBN
cord-269867-k10siwur	119	26	on	on	IN
cord-269867-k10siwur	119	27	agar	agar	NN
cord-269867-k10siwur	119	28	surface	surface	NN
cord-269867-k10siwur	119	29	.	.	.
cord-269867-k10siwur	120	1	Blots	blot	NNS
cord-269867-k10siwur	120	2	were	be	VBD
cord-269867-k10siwur	120	3	blocked	block	VBN
cord-269867-k10siwur	120	4	and	and	CC
cord-269867-k10siwur	120	5	then	then	RB
cord-269867-k10siwur	120	6	washed	wash	VBD
cord-269867-k10siwur	120	7	with	with	IN
cord-269867-k10siwur	120	8	1	1	CD
cord-269867-k10siwur	120	9	%	%	NN
cord-269867-k10siwur	120	10	BSA-0.01	bsa-0.01	JJ
cord-269867-k10siwur	120	11	%	%	NN
cord-269867-k10siwur	120	12	Tween	Tween	NNP
cord-269867-k10siwur	120	13	20	20	CD
cord-269867-k10siwur	120	14	in	in	IN
cord-269867-k10siwur	120	15	PBS	PBS	NNP
cord-269867-k10siwur	120	16	until	until	IN
cord-269867-k10siwur	120	17	the	the	DT
cord-269867-k10siwur	120	18	bulk	bulk	NN
cord-269867-k10siwur	120	19	of	of	IN
cord-269867-k10siwur	120	20	bacteria	bacteria	NNS
cord-269867-k10siwur	120	21	was	be	VBD
cord-269867-k10siwur	120	22	removed	remove	VBN
cord-269867-k10siwur	120	23	.	.	.
cord-269867-k10siwur	121	1	The	the	DT
cord-269867-k10siwur	121	2	filters	filter	NNS
cord-269867-k10siwur	121	3	were	be	VBD
cord-269867-k10siwur	121	4	further	further	RB
cord-269867-k10siwur	121	5	incubated	incubate	VBN
cord-269867-k10siwur	121	6	with	with	IN
cord-269867-k10siwur	121	7	appropriate	appropriate	JJ
cord-269867-k10siwur	121	8	primary	primary	JJ
cord-269867-k10siwur	121	9	Ab	ab	NN
cord-269867-k10siwur	121	10	in	in	IN
cord-269867-k10siwur	121	11	1	1	CD
cord-269867-k10siwur	121	12	%	%	NN
cord-269867-k10siwur	121	13	BSA	BSA	NNP
cord-269867-k10siwur	121	14	in	in	IN
cord-269867-k10siwur	121	15	PBS	PBS	NNP
cord-269867-k10siwur	121	16	.	.	.
cord-269867-k10siwur	122	1	Bound	bind	VBN
cord-269867-k10siwur	122	2	primary	primary	JJ
cord-269867-k10siwur	122	3	Ab	Ab	NNP
cord-269867-k10siwur	122	4	were	be	VBD
cord-269867-k10siwur	122	5	detected	detect	VBN
cord-269867-k10siwur	122	6	by	by	IN
cord-269867-k10siwur	122	7	incubation	incubation	NN
cord-269867-k10siwur	122	8	of	of	IN
cord-269867-k10siwur	122	9	the	the	DT
cord-269867-k10siwur	122	10	filters	filter	NNS
cord-269867-k10siwur	122	11	with	with	IN
cord-269867-k10siwur	122	12	either	either	CC
cord-269867-k10siwur	122	13	horseradish	horseradish	NN
cord-269867-k10siwur	122	14	peroxidase	peroxidase	NN
cord-269867-k10siwur	122	15	-	-	HYPH
cord-269867-k10siwur	122	16	conjugated	conjugate	VBN
cord-269867-k10siwur	122	17	anti	anti	JJ
cord-269867-k10siwur	122	18	-	-	JJ
cord-269867-k10siwur	122	19	rabbit	rabbit	JJ
cord-269867-k10siwur	122	20	or	or	CC
cord-269867-k10siwur	122	21	anti	anti	JJ
cord-269867-k10siwur	122	22	-	-	JJ
cord-269867-k10siwur	122	23	mouse	mouse	NN
cord-269867-k10siwur	122	24	secondary	secondary	JJ
cord-269867-k10siwur	122	25	Ab	Ab	NNP
cord-269867-k10siwur	122	26	,	,	,
cord-269867-k10siwur	122	27	and	and	CC
cord-269867-k10siwur	122	28	developed	develop	VBD
cord-269867-k10siwur	122	29	with	with	IN
cord-269867-k10siwur	122	30	H202-~-chloronaphthol	H202-~-chloronaphthol	NNP
cord-269867-k10siwur	122	31	.	.	.
cord-269867-k10siwur	123	1	For	for	IN
cord-269867-k10siwur	123	2	the	the	DT
cord-269867-k10siwur	123	3	immunodot	immunodot	NNP
cord-269867-k10siwur	123	4	analysis	analysis	NN
cord-269867-k10siwur	123	5	of	of	IN
cord-269867-k10siwur	123	6	the	the	DT
cord-269867-k10siwur	123	7	extracted	extract	VBN
cord-269867-k10siwur	123	8	mutated	mutate	VBN
cord-269867-k10siwur	123	9	CS31A	cs31a	NN
cord-269867-k10siwur	123	10	fibrillae	fibrillae	NNP
cord-269867-k10siwur	123	11	,	,	,
cord-269867-k10siwur	123	12	bacteria	bacteria	NNS
cord-269867-k10siwur	123	13	growing	grow	VBG
cord-269867-k10siwur	123	14	overnight	overnight	RB
cord-269867-k10siwur	123	15	on	on	IN
cord-269867-k10siwur	123	16	LB	LB	NNP
cord-269867-k10siwur	123	17	agar	agar	NN
cord-269867-k10siwur	123	18	medium	medium	NN
cord-269867-k10siwur	123	19	with	with	IN
cord-269867-k10siwur	123	20	the	the	DT
cord-269867-k10siwur	123	21	appropriate	appropriate	JJ
cord-269867-k10siwur	123	22	antibiotics	antibiotic	NNS
cord-269867-k10siwur	123	23	were	be	VBD
cord-269867-k10siwur	123	24	carefully	carefully	RB
cord-269867-k10siwur	123	25	scraped	scrape	VBN
cord-269867-k10siwur	123	26	and	and	CC
cord-269867-k10siwur	123	27	suspended	suspend	VBN
cord-269867-k10siwur	123	28	in	in	IN
cord-269867-k10siwur	123	29	PBS	PBS	NNP
cord-269867-k10siwur	123	30	.	.	.
cord-269867-k10siwur	124	1	This	this	DT
cord-269867-k10siwur	124	2	suspension	suspension	NN
cord-269867-k10siwur	124	3	was	be	VBD
cord-269867-k10siwur	124	4	then	then	RB
cord-269867-k10siwur	124	5	vigorously	vigorously	RB
cord-269867-k10siwur	124	6	agitated	agitated	JJ
cord-269867-k10siwur	124	7	for	for	IN
cord-269867-k10siwur	124	8	]	]	-RRB-
cord-269867-k10siwur	124	9	[	[	-LRB-
cord-269867-k10siwur	124	10	min	min	NN
cord-269867-k10siwur	124	11	with	with	IN
cord-269867-k10siwur	124	12	a	a	DT
cord-269867-k10siwur	124	13	top	top	JJ
cord-269867-k10siwur	124	14	mix	mix	NN
cord-269867-k10siwur	124	15	shaker	shaker	NN
cord-269867-k10siwur	124	16	,	,	,
cord-269867-k10siwur	124	17	and	and	CC
cord-269867-k10siwur	124	18	placed	place	VBN
cord-269867-k10siwur	124	19	at	at	IN
cord-269867-k10siwur	124	20	60	60	CD
cord-269867-k10siwur	124	21	°	°	NN
cord-269867-k10siwur	124	22	C	c	NN
cord-269867-k10siwur	124	23	for	for	IN
cord-269867-k10siwur	124	24	20	20	CD
cord-269867-k10siwur	124	25	min	min	NN
cord-269867-k10siwur	124	26	(	(	-LRB-
cord-269867-k10siwur	124	27	thermo	thermo	NNP
cord-269867-k10siwur	124	28	-	-	HYPH
cord-269867-k10siwur	124	29	elution	elution	NNP
cord-269867-k10siwur	124	30	of	of	IN
cord-269867-k10siwur	124	31	the	the	DT
cord-269867-k10siwur	124	32	CS31A	CS31A	NNP
cord-269867-k10siwur	124	33	polymer	polymer	NNP
cord-269867-k10siwur	124	34	)	)	-RRB-
cord-269867-k10siwur	124	35	.	.	.
cord-269867-k10siwur	125	1	After	after	IN
cord-269867-k10siwur	125	2	centrifugation	centrifugation	NN
cord-269867-k10siwur	125	3	at	at	IN
cord-269867-k10siwur	125	4	12	12	CD
cord-269867-k10siwur	125	5	000	000	CD
cord-269867-k10siwur	125	6	x	x	NN
cord-269867-k10siwur	125	7	g	g	NN
cord-269867-k10siwur	125	8	for	for	IN
cord-269867-k10siwur	125	9	10	10	CD
cord-269867-k10siwur	125	10	min	min	NN
cord-269867-k10siwur	125	11	,	,	,
cord-269867-k10siwur	125	12	the	the	DT
cord-269867-k10siwur	125	13	resulting	result	VBG
cord-269867-k10siwur	125	14	supernatant	supernatant	NN
cord-269867-k10siwur	125	15	was	be	VBD
cord-269867-k10siwur	125	16	used	use	VBN
cord-269867-k10siwur	125	17	for	for	IN
cord-269867-k10siwur	125	18	experiments	experiment	NNS
cord-269867-k10siwur	125	19	.	.	.
cord-269867-k10siwur	126	1	CS31A	CS31A	NNP
cord-269867-k10siwur	127	1	fibrillae	fibrillae	NNP
cord-269867-k10siwur	127	2	-	-	HYPH
cord-269867-k10siwur	127	3	specific	specific	JJ
cord-269867-k10siwur	127	4	rabbit	rabbit	NN
cord-269867-k10siwur	127	5	antiserum	antiserum	NN
cord-269867-k10siwur	127	6	(	(	-LRB-
cord-269867-k10siwur	127	7	anti	anti	JJ
cord-269867-k10siwur	127	8	-	-	JJ
cord-269867-k10siwur	127	9	CS3lA	cs3la	JJ
cord-269867-k10siwur	127	10	)	)	-RRB-
cord-269867-k10siwur	127	11	was	be	VBD
cord-269867-k10siwur	127	12	obtained	obtain	VBN
cord-269867-k10siwur	127	13	as	as	IN
cord-269867-k10siwur	127	14	described	describe	VBN
cord-269867-k10siwur	127	15	by	by	IN
cord-269867-k10siwur	127	16	Girardeau	Girardeau	NNP
cord-269867-k10siwur	127	17	et	et	NNP
cord-269867-k10siwur	127	18	al	al	NNP
cord-269867-k10siwur	127	19	.	.	.
cord-269867-k10siwur	128	1	(	(	-LRB-
cord-269867-k10siwur	128	2	1988	1988	CD
cord-269867-k10siwur	128	3	)	)	-RRB-
cord-269867-k10siwur	128	4	.	.	.
cord-269867-k10siwur	129	1	mAb	mab	NN
cord-269867-k10siwur	129	2	3b.5	3b.5	CD
cord-269867-k10siwur	129	3	(	(	-LRB-
cord-269867-k10siwur	129	4	Delmas	Delmas	NNP
cord-269867-k10siwur	129	5	et	et	NNP
cord-269867-k10siwur	129	6	al	al	NNP
cord-269867-k10siwur	129	7	.	.	NNP
cord-269867-k10siwur	129	8	,	,	,
cord-269867-k10siwur	129	9	1990	1990	CD
cord-269867-k10siwur	129	10	)	)	-RRB-
cord-269867-k10siwur	129	11	and	and	CC
cord-269867-k10siwur	129	12	mAb	mab	NN
cord-269867-k10siwur	129	13	1AF10	1af10	CD
cord-269867-k10siwur	130	1	(	(	-LRB-
cord-269867-k10siwur	130	2	Gebauer	Gebauer	NNP
cord-269867-k10siwur	130	3	et	et	NNP
cord-269867-k10siwur	130	4	al	al	NNP
cord-269867-k10siwur	130	5	.	.	NNP
cord-269867-k10siwur	130	6	,	,	,
cord-269867-k10siwur	130	7	1991	1991	CD
cord-269867-k10siwur	130	8	)	)	-RRB-
cord-269867-k10siwur	130	9	raised	raise	VBD
cord-269867-k10siwur	130	10	,	,	,
cord-269867-k10siwur	130	11	respectively	respectively	RB
cord-269867-k10siwur	130	12	,	,	,
cord-269867-k10siwur	130	13	against	against	IN
cord-269867-k10siwur	130	14	the	the	DT
cord-269867-k10siwur	130	15	C	C	NNP
cord-269867-k10siwur	130	16	and	and	CC
cord-269867-k10siwur	130	17	A	a	DT
cord-269867-k10siwur	130	18	sites	site	NNS
cord-269867-k10siwur	130	19	of	of	IN
cord-269867-k10siwur	130	20	TGEV	TGEV	NNP
cord-269867-k10siwur	130	21	-	-	HYPH
cord-269867-k10siwur	130	22	S	S	NNP
cord-269867-k10siwur	130	23	on	on	IN
cord-269867-k10siwur	130	24	native	native	JJ
cord-269867-k10siwur	130	25	coronavirus	coronavirus	NN
cord-269867-k10siwur	130	26	,	,	,
cord-269867-k10siwur	130	27	were	be	VBD
cord-269867-k10siwur	130	28	used	use	VBN
cord-269867-k10siwur	130	29	.	.	.
cord-269867-k10siwur	131	1	Fig	Fig	NNP
cord-269867-k10siwur	131	2	.	.	.
cord-269867-k10siwur	132	1	3	3	CD
cord-269867-k10siwur	132	2	legend	legend	NN
cord-269867-k10siwur	132	3	)	)	-RRB-
cord-269867-k10siwur	132	4	were	be	VBD
cord-269867-k10siwur	132	5	mixed	mix	VBN
cord-269867-k10siwur	132	6	with	with	IN
cord-269867-k10siwur	132	7	an	an	DT
cord-269867-k10siwur	132	8	equal	equal	JJ
cord-269867-k10siwur	132	9	volume	volume	NN
cord-269867-k10siwur	132	10	of	of	IN
cord-269867-k10siwur	132	11	2	2	CD
cord-269867-k10siwur	132	12	x	x	SYM
cord-269867-k10siwur	132	13	Laemmli	Laemmli	NNP
cord-269867-k10siwur	132	14	buffer	buffer	NN
cord-269867-k10siwur	132	15	,	,	,
cord-269867-k10siwur	132	16	boiled	boil	VBN
cord-269867-k10siwur	132	17	for	for	IN
cord-269867-k10siwur	132	18	5	5	CD
cord-269867-k10siwur	132	19	min	min	NN
cord-269867-k10siwur	132	20	,	,	,
cord-269867-k10siwur	132	21	separated	separate	VBN
cord-269867-k10siwur	132	22	by	by	IN
cord-269867-k10siwur	132	23	15	15	CD
cord-269867-k10siwur	132	24	%	%	NN
cord-269867-k10siwur	132	25	SDS	SDS	NNP
cord-269867-k10siwur	132	26	-	-	HYPH
cord-269867-k10siwur	132	27	PAGE	PAGE	NNP
cord-269867-k10siwur	132	28	and	and	CC
cord-269867-k10siwur	132	29	semi	semi	JJ
cord-269867-k10siwur	132	30	-	-	JJ
cord-269867-k10siwur	132	31	dry	dry	JJ
cord-269867-k10siwur	132	32	electrotransferred	electrotransferre	VBN
cord-269867-k10siwur	132	33	onto	onto	IN
cord-269867-k10siwur	132	34	nitrocellulose	nitrocellulose	NN
cord-269867-k10siwur	132	35	sheets	sheet	NNS
cord-269867-k10siwur	133	1	(	(	-LRB-
cord-269867-k10siwur	133	2	Towbin	Towbin	NNP
cord-269867-k10siwur	133	3	et	et	NNP
cord-269867-k10siwur	133	4	al	al	NNP
cord-269867-k10siwur	133	5	.	.	NNP
cord-269867-k10siwur	133	6	,	,	,
cord-269867-k10siwur	133	7	1979	1979	CD
cord-269867-k10siwur	133	8	)	)	-RRB-
cord-269867-k10siwur	133	9	.	.	.
cord-269867-k10siwur	134	1	Control	Control	NNP
cord-269867-k10siwur	134	2	,	,	,
cord-269867-k10siwur	134	3	wt	wt	NNP
cord-269867-k10siwur	134	4	CS31A	CS31A	NNP
cord-269867-k10siwur	134	5	fibrillae	fibrillae	NNP
cord-269867-k10siwur	134	6	produced	produce	VBN
cord-269867-k10siwur	134	7	by	by	IN
cord-269867-k10siwur	134	8	E.	E.	NNP
cord-269867-k10siwur	134	9	coil	coil	NN
cord-269867-k10siwur	134	10	DH5e	DH5e	NNP
cord-269867-k10siwur	134	11	[	[	-LRB-
cord-269867-k10siwur	134	12	pDEV41155	pdev41155	NN
cord-269867-k10siwur	134	13	,	,	,
cord-269867-k10siwur	134	14	pDSPH524	pDSPH524	NNP
cord-269867-k10siwur	134	15	]	]	-RRB-
cord-269867-k10siwur	134	16	.	.	.
cord-269867-k10siwur	135	1	Western	western	JJ
cord-269867-k10siwur	135	2	blots	blot	NNS
cord-269867-k10siwur	135	3	were	be	VBD
cord-269867-k10siwur	135	4	then	then	RB
cord-269867-k10siwur	135	5	treated	treat	VBN
cord-269867-k10siwur	135	6	as	as	IN
cord-269867-k10siwur	135	7	described	describe	VBN
cord-269867-k10siwur	135	8	in	in	IN
cord-269867-k10siwur	135	9	the	the	DT
cord-269867-k10siwur	135	10	Fig	Fig	NNP
cord-269867-k10siwur	135	11	.	.	.
cord-269867-k10siwur	136	1	3	3	CD
cord-269867-k10siwur	136	2	legend	legend	NN
cord-269867-k10siwur	136	3	by	by	IN
cord-269867-k10siwur	136	4	using	use	VBG
cord-269867-k10siwur	136	5	as	as	IN
cord-269867-k10siwur	136	6	primary	primary	JJ
cord-269867-k10siwur	136	7	Ab	ab	NN
cord-269867-k10siwur	136	8	either	either	CC
cord-269867-k10siwur	136	9	(	(	-LRB-
cord-269867-k10siwur	136	10	a	a	DT
cord-269867-k10siwur	136	11	)	)	-RRB-
cord-269867-k10siwur	136	12	anti	anti	JJ
cord-269867-k10siwur	136	13	-	-	JJ
cord-269867-k10siwur	136	14	ClpG	ClpG	NNP
cord-269867-k10siwur	136	15	pAb	pab	NN
cord-269867-k10siwur	136	16	,	,	,
cord-269867-k10siwur	136	17	or	or	CC
cord-269867-k10siwur	137	1	(	(	-LRB-
cord-269867-k10siwur	137	2	b	b	NN
cord-269867-k10siwur	137	3	)	)	-RRB-
cord-269867-k10siwur	137	4	3b.5	3b.5	CD
cord-269867-k10siwur	138	1	mAb	mAb	NNS
cord-269867-k10siwur	138	2	,	,	,
cord-269867-k10siwur	138	3	or	or	CC
cord-269867-k10siwur	139	1	(	(	-LRB-
cord-269867-k10siwur	139	2	c	c	NN
cord-269867-k10siwur	139	3	)	)	-RRB-
cord-269867-k10siwur	139	4	1AF10	1af10	CD
cord-269867-k10siwur	140	1	mAb	mAb	NNS
cord-269867-k10siwur	140	2	,	,	,
cord-269867-k10siwur	140	3	or	or	CC
cord-269867-k10siwur	141	1	(	(	-LRB-
cord-269867-k10siwur	141	2	d	d	LS
cord-269867-k10siwur	141	3	)	)	-RRB-
cord-269867-k10siwur	141	4	anti	anti	JJ
cord-269867-k10siwur	141	5	-	-	JJ
cord-269867-k10siwur	141	6	G15Q	g15q	JJ
cord-269867-k10siwur	141	7	pAb	pab	NN
cord-269867-k10siwur	141	8	,	,	,
cord-269867-k10siwur	141	9	or	or	CC
cord-269867-k10siwur	141	10	(	(	-LRB-
cord-269867-k10siwur	141	11	e	e	LS
cord-269867-k10siwur	141	12	)	)	-RRB-
cord-269867-k10siwur	141	13	anti	anti	JJ
cord-269867-k10siwur	141	14	-	-	JJ
cord-269867-k10siwur	141	15	T15P	t15p	JJ
cord-269867-k10siwur	141	16	pAb	pab	NN
cord-269867-k10siwur	141	17	.	.	.
cord-269867-k10siwur	142	1	ClpG	ClpG	NNP
cord-269867-k10siwur	142	2	subunit	subunit	NN
cord-269867-k10siwur	142	3	-	-	HYPH
cord-269867-k10siwur	142	4	specific	specific	JJ
cord-269867-k10siwur	142	5	rabbit	rabbit	NN
cord-269867-k10siwur	142	6	antiserum	antiserum	NN
cord-269867-k10siwur	142	7	(	(	-LRB-
cord-269867-k10siwur	142	8	anti	anti	NNP
cord-269867-k10siwur	142	9	-	-	JJ
cord-269867-k10siwur	142	10	ClpG	ClpG	NNP
cord-269867-k10siwur	142	11	pAb	pab	NN
cord-269867-k10siwur	142	12	)	)	-RRB-
cord-269867-k10siwur	142	13	was	be	VBD
cord-269867-k10siwur	142	14	obtained	obtain	VBN
cord-269867-k10siwur	142	15	as	as	IN
cord-269867-k10siwur	142	16	described	describe	VBN
cord-269867-k10siwur	142	17	by	by	IN
cord-269867-k10siwur	142	18	Girardeau	Girardeau	NNP
cord-269867-k10siwur	142	19	et	et	NNP
cord-269867-k10siwur	142	20	al	al	NNP
cord-269867-k10siwur	142	21	.	.	.
cord-269867-k10siwur	143	1	(	(	-LRB-
cord-269867-k10siwur	143	2	1988	1988	CD
cord-269867-k10siwur	143	3	)	)	-RRB-
cord-269867-k10siwur	143	4	.	.	.
cord-269867-k10siwur	144	1	The	the	DT
cord-269867-k10siwur	144	2	G15Q	g15q	NN
cord-269867-k10siwur	144	3	peptide	peptide	NN
cord-269867-k10siwur	144	4	(	(	-LRB-
cord-269867-k10siwur	144	5	GQLQAVNPNAGNRGQ	GQLQAVNPNAGNRGQ	NNP
cord-269867-k10siwur	144	6	)	)	-RRB-
cord-269867-k10siwur	144	7	and	and	CC
cord-269867-k10siwur	144	8	the	the	DT
cord-269867-k10siwur	144	9	T15P	T15P	NNP
cord-269867-k10siwur	144	10	peptide	peptide	NN
cord-269867-k10siwur	144	11	(	(	-LRB-
cord-269867-k10siwur	144	12	TFTNPVVSTTQWSAP	TFTNPVVSTTQWSAP	NNP
cord-269867-k10siwur	144	13	)	)	-RRB-
cord-269867-k10siwur	144	14	correspond	correspond	VBP
cord-269867-k10siwur	144	15	to	to	IN
cord-269867-k10siwur	144	16	the	the	DT
cord-269867-k10siwur	144	17	aa	aa	NNP
cord-269867-k10siwur	144	18	residues	residue	NNS
cord-269867-k10siwur	144	19	185	185	CD
cord-269867-k10siwur	144	20	-	-	SYM
cord-269867-k10siwur	144	21	199	199	CD
cord-269867-k10siwur	144	22	and	and	CC
cord-269867-k10siwur	144	23	235	235	CD
cord-269867-k10siwur	144	24	-	-	SYM
cord-269867-k10siwur	144	25	249	249	CD
cord-269867-k10siwur	144	26	of	of	IN
cord-269867-k10siwur	144	27	CIpG	CIpG	NNPS
cord-269867-k10siwur	144	28	,	,	,
cord-269867-k10siwur	144	29	respectively	respectively	RB
cord-269867-k10siwur	144	30	.	.	.
cord-269867-k10siwur	145	1	The	the	DT
cord-269867-k10siwur	145	2	synthetic	synthetic	JJ
cord-269867-k10siwur	145	3	G15Q	g15q	NN
cord-269867-k10siwur	145	4	and	and	CC
cord-269867-k10siwur	145	5	T15P	t15p	NN
cord-269867-k10siwur	145	6	peptides	peptide	NNS
cord-269867-k10siwur	145	7	were	be	VBD
cord-269867-k10siwur	145	8	obtained	obtain	VBN
cord-269867-k10siwur	145	9	from	from	IN
cord-269867-k10siwur	145	10	Neosystem	Neosystem	NNP
cord-269867-k10siwur	145	11	(	(	-LRB-
cord-269867-k10siwur	145	12	Strasbourg	Strasbourg	NNP
cord-269867-k10siwur	145	13	,	,	,
cord-269867-k10siwur	145	14	France	France	NNP
cord-269867-k10siwur	145	15	)	)	-RRB-
cord-269867-k10siwur	145	16	and	and	CC
cord-269867-k10siwur	145	17	their	-PRON-	PRP$
cord-269867-k10siwur	145	18	purity	purity	NN
cord-269867-k10siwur	145	19	was	be	VBD
cord-269867-k10siwur	145	20	>	>	:
cord-269867-k10siwur	145	21	75	75	CD
cord-269867-k10siwur	145	22	%	%	NN
cord-269867-k10siwur	145	23	as	as	IN
cord-269867-k10siwur	145	24	determined	determine	VBN
cord-269867-k10siwur	145	25	by	by	IN
cord-269867-k10siwur	145	26	high	high	JJ
cord-269867-k10siwur	145	27	-	-	HYPH
cord-269867-k10siwur	145	28	performance	performance	NN
cord-269867-k10siwur	145	29	liquid	liquid	NN
cord-269867-k10siwur	145	30	chromatography	chromatography	NN
cord-269867-k10siwur	145	31	.	.	.
cord-269867-k10siwur	146	1	To	to	TO
cord-269867-k10siwur	146	2	prepare	prepare	VB
cord-269867-k10siwur	146	3	anti	anti	JJ
cord-269867-k10siwur	146	4	-	-	JJ
cord-269867-k10siwur	146	5	G15Q	g15q	JJ
cord-269867-k10siwur	146	6	and	and	CC
cord-269867-k10siwur	146	7	anti	anti	JJ
cord-269867-k10siwur	146	8	-	-	JJ
cord-269867-k10siwur	146	9	Tl5P	tl5p	JJ
cord-269867-k10siwur	146	10	antisera	antisera	NNP
cord-269867-k10siwur	146	11	,	,	,
cord-269867-k10siwur	146	12	peptides	peptide	NNS
cord-269867-k10siwur	146	13	G15Q	g15q	NN
cord-269867-k10siwur	146	14	and	and	CC
cord-269867-k10siwur	146	15	T15P	T15P	NNP
cord-269867-k10siwur	146	16	were	be	VBD
cord-269867-k10siwur	146	17	coupled	couple	VBN
cord-269867-k10siwur	146	18	to	to	IN
cord-269867-k10siwur	146	19	BSA	BSA	NNP
cord-269867-k10siwur	146	20	using	use	VBG
cord-269867-k10siwur	146	21	glutaraldehyde	glutaraldehyde	NN
cord-269867-k10siwur	146	22	(	(	-LRB-
cord-269867-k10siwur	146	23	Sigma	Sigma	NNP
cord-269867-k10siwur	146	24	)	)	-RRB-
cord-269867-k10siwur	146	25	;	;	:
cord-269867-k10siwur	146	26	rabbits	rabbit	NNS
cord-269867-k10siwur	146	27	were	be	VBD
cord-269867-k10siwur	146	28	primed	prime	VBN
cord-269867-k10siwur	146	29	by	by	IN
cord-269867-k10siwur	146	30	intradermic	intradermic	JJ
cord-269867-k10siwur	146	31	injection	injection	NN
cord-269867-k10siwur	146	32	of	of	IN
cord-269867-k10siwur	146	33	250	250	CD
cord-269867-k10siwur	146	34	gg	gg	NNS
cord-269867-k10siwur	146	35	of	of	IN
cord-269867-k10siwur	146	36	peptide	peptide	NN
cord-269867-k10siwur	146	37	emulsified	emulsify	VBN
cord-269867-k10siwur	146	38	with	with	IN
cord-269867-k10siwur	146	39	incomplete	incomplete	JJ
cord-269867-k10siwur	146	40	Freund	Freund	NNP
cord-269867-k10siwur	146	41	's	's	POS
cord-269867-k10siwur	146	42	adjuvant	adjuvant	NN
cord-269867-k10siwur	146	43	,	,	,
cord-269867-k10siwur	146	44	then	then	RB
cord-269867-k10siwur	146	45	boosted	boost	VBD
cord-269867-k10siwur	146	46	20	20	CD
cord-269867-k10siwur	146	47	and	and	CC
cord-269867-k10siwur	146	48	40	40	CD
cord-269867-k10siwur	146	49	days	day	NNS
cord-269867-k10siwur	146	50	later	later	RB
cord-269867-k10siwur	146	51	,	,	,
cord-269867-k10siwur	146	52	and	and	CC
cord-269867-k10siwur	146	53	finally	finally	RB
cord-269867-k10siwur	146	54	bled	bleed	VBD
cord-269867-k10siwur	146	55	15	15	CD
cord-269867-k10siwur	146	56	days	day	NNS
cord-269867-k10siwur	146	57	after	after	IN
cord-269867-k10siwur	146	58	the	the	DT
cord-269867-k10siwur	146	59	last	last	JJ
cord-269867-k10siwur	146	60	immunization	immunization	NN
cord-269867-k10siwur	146	61	.	.	.
cord-269867-k10siwur	147	1	Although	although	IN
cord-269867-k10siwur	147	2	we	-PRON-	PRP
cord-269867-k10siwur	147	3	have	have	VBP
cord-269867-k10siwur	147	4	not	not	RB
cord-269867-k10siwur	147	5	sequenced	sequence	VBN
cord-269867-k10siwur	147	6	the	the	DT
cord-269867-k10siwur	147	7	N	N	NNP
cord-269867-k10siwur	147	8	-	-	HYPH
cord-269867-k10siwur	147	9	and	and	CC
cord-269867-k10siwur	147	10	C	c	NN
cord-269867-k10siwur	147	11	-	-	HYPH
cord-269867-k10siwur	147	12	terminal	terminal	NN
cord-269867-k10siwur	147	13	parts	part	NNS
cord-269867-k10siwur	147	14	of	of	IN
cord-269867-k10siwur	147	15	cleaved	cleaved	JJ
cord-269867-k10siwur	147	16	products	product	NNS
cord-269867-k10siwur	147	17	from	from	IN
cord-269867-k10siwur	147	18	CIpG::TGEV	CIpG::TGEV	NNS
cord-269867-k10siwur	147	19	hybrids	hybrid	NNS
cord-269867-k10siwur	147	20	,	,	,
cord-269867-k10siwur	147	21	several	several	JJ
cord-269867-k10siwur	147	22	lines	line	NNS
cord-269867-k10siwur	147	23	of	of	IN
cord-269867-k10siwur	147	24	evidence	evidence	NN
cord-269867-k10siwur	147	25	suggest	suggest	VBP
cord-269867-k10siwur	147	26	that	that	IN
cord-269867-k10siwur	147	27	a	a	DT
cord-269867-k10siwur	147	28	proteolytic	proteolytic	JJ
cord-269867-k10siwur	147	29	event	event	NN
cord-269867-k10siwur	147	30	occurs	occur	VBZ
cord-269867-k10siwur	147	31	within	within	IN
cord-269867-k10siwur	147	32	the	the	DT
cord-269867-k10siwur	147	33	TGEV	TGEV	NNP
cord-269867-k10siwur	147	34	-	-	HYPH
cord-269867-k10siwur	147	35	A	a	DT
cord-269867-k10siwur	147	36	oligopeptide	oligopeptide	NN
cord-269867-k10siwur	147	37	:	:	:
cord-269867-k10siwur	148	1	(	(	-LRB-
cord-269867-k10siwur	148	2	1	1	LS
cord-269867-k10siwur	148	3	)	)	-RRB-
cord-269867-k10siwur	148	4	no	no	DT
cord-269867-k10siwur	148	5	truncated	truncated	JJ
cord-269867-k10siwur	148	6	products	product	NNS
cord-269867-k10siwur	148	7	from	from	IN
cord-269867-k10siwur	148	8	any	any	DT
cord-269867-k10siwur	148	9	of	of	IN
cord-269867-k10siwur	148	10	the	the	DT
cord-269867-k10siwur	148	11	hybrids	hybrid	NNS
cord-269867-k10siwur	148	12	containing	contain	VBG
cord-269867-k10siwur	148	13	one	one	CD
cord-269867-k10siwur	148	14	copy	copy	NN
cord-269867-k10siwur	148	15	of	of	IN
cord-269867-k10siwur	148	16	TGEV	TGEV	NNP
cord-269867-k10siwur	148	17	-	-	HYPH
cord-269867-k10siwur	148	18	A	A	NNP
cord-269867-k10siwur	148	19	was	be	VBD
cord-269867-k10siwur	148	20	detected	detect	VBN
cord-269867-k10siwur	148	21	with	with	IN
cord-269867-k10siwur	148	22	1AF10	1af10	CD
cord-269867-k10siwur	148	23	mAb	mAb	NNS
cord-269867-k10siwur	148	24	;	;	,
cord-269867-k10siwur	148	25	(	(	-LRB-
cord-269867-k10siwur	148	26	2	2	LS
cord-269867-k10siwur	148	27	)	)	-RRB-
cord-269867-k10siwur	148	28	no	no	DT
cord-269867-k10siwur	148	29	proteolysis	proteolysis	NN
cord-269867-k10siwur	148	30	happened	happen	VBD
cord-269867-k10siwur	148	31	with	with	IN
cord-269867-k10siwur	148	32	ClpG	ClpG	NNP
cord-269867-k10siwur	148	33	alone	alone	RB
cord-269867-k10siwur	148	34	or	or	CC
cord-269867-k10siwur	148	35	in	in	IN
cord-269867-k10siwur	148	36	association	association	NN
cord-269867-k10siwur	148	37	with	with	IN
cord-269867-k10siwur	148	38	TGEV	TGEV	NNP
cord-269867-k10siwur	148	39	-	-	HYPH
cord-269867-k10siwur	148	40	C	C	NNP
cord-269867-k10siwur	148	41	;	;	,
cord-269867-k10siwur	148	42	(	(	-LRB-
cord-269867-k10siwur	148	43	3	3	LS
cord-269867-k10siwur	148	44	)	)	-RRB-
cord-269867-k10siwur	148	45	ClpG202-XC	clpg202-xc	JJ
cord-269867-k10siwur	148	46	chimera	chimera	NN
cord-269867-k10siwur	148	47	that	that	WDT
cord-269867-k10siwur	148	48	differs	differ	VBZ
cord-269867-k10siwur	148	49	from	from	IN
cord-269867-k10siwur	148	50	ClpG202-AC	ClpG202-AC	NNP
cord-269867-k10siwur	148	51	in	in	IN
cord-269867-k10siwur	148	52	only	only	RB
cord-269867-k10siwur	148	53	a	a	DT
cord-269867-k10siwur	148	54	TGEV	TGEV	NNP
cord-269867-k10siwur	148	55	-	-	HYPH
cord-269867-k10siwur	148	56	A	a	DT
cord-269867-k10siwur	148	57	sequence	sequence	NN
cord-269867-k10siwur	148	58	in	in	IN
cord-269867-k10siwur	148	59	reverse	reverse	JJ
cord-269867-k10siwur	148	60	orientation	orientation	NN
cord-269867-k10siwur	148	61	,	,	,
cord-269867-k10siwur	148	62	was	be	VBD
cord-269867-k10siwur	148	63	not	not	RB
cord-269867-k10siwur	148	64	cleaved	cleave	VBN
cord-269867-k10siwur	148	65	;	;	:
cord-269867-k10siwur	148	66	(	(	-LRB-
cord-269867-k10siwur	148	67	4	4	LS
cord-269867-k10siwur	148	68	)	)	-RRB-
cord-269867-k10siwur	148	69	the	the	DT
cord-269867-k10siwur	148	70	immunoblot	immunoblot	NNP
cord-269867-k10siwur	148	71	patterns	pattern	NNS
cord-269867-k10siwur	148	72	of	of	IN
cord-269867-k10siwur	148	73	ClpG1/203-CA	ClpG1/203-CA	NNP
cord-269867-k10siwur	148	74	,	,	,
cord-269867-k10siwur	148	75	carrying	carry	VBG
cord-269867-k10siwur	148	76	two	two	CD
cord-269867-k10siwur	148	77	copies	copy	NNS
cord-269867-k10siwur	148	78	of	of	IN
cord-269867-k10siwur	148	79	TGEV	TGEV	NNP
cord-269867-k10siwur	148	80	-	-	HYPH
cord-269867-k10siwur	148	81	A	A	NNP
cord-269867-k10siwur	148	82	,	,	,
cord-269867-k10siwur	148	83	are	be	VBP
cord-269867-k10siwur	148	84	consistent	consistent	JJ
cord-269867-k10siwur	148	85	with	with	IN
cord-269867-k10siwur	148	86	the	the	DT
cord-269867-k10siwur	148	87	presence	presence	NN
cord-269867-k10siwur	148	88	of	of	IN
cord-269867-k10siwur	148	89	a	a	DT
cord-269867-k10siwur	148	90	cleavage	cleavage	NN
cord-269867-k10siwur	148	91	site	site	NN
cord-269867-k10siwur	148	92	within	within	IN
cord-269867-k10siwur	148	93	each	each	DT
cord-269867-k10siwur	148	94	copy	copy	NN
cord-269867-k10siwur	148	95	since	since	IN
cord-269867-k10siwur	148	96	four	four	CD
cord-269867-k10siwur	148	97	fragments	fragment	NNS
cord-269867-k10siwur	148	98	were	be	VBD
cord-269867-k10siwur	148	99	visualized	visualize	VBN
cord-269867-k10siwur	148	100	.	.	.
cord-269867-k10siwur	149	1	This	this	DT
cord-269867-k10siwur	149	2	implies	imply	VBZ
cord-269867-k10siwur	149	3	that	that	IN
cord-269867-k10siwur	149	4	TGEV	TGEV	NNP
cord-269867-k10siwur	149	5	-	-	HYPH
cord-269867-k10siwur	149	6	A	a	NN
cord-269867-k10siwur	149	7	fused	fuse	VBN
cord-269867-k10siwur	149	8	to	to	IN
cord-269867-k10siwur	149	9	the	the	DT
cord-269867-k10siwur	149	10	N	n	CD
cord-269867-k10siwur	149	11	terminus	terminus	NN
cord-269867-k10siwur	149	12	of	of	IN
cord-269867-k10siwur	149	13	ClpG	ClpG	NNP
cord-269867-k10siwur	149	14	was	be	VBD
cord-269867-k10siwur	149	15	cleaved	cleave	VBN
cord-269867-k10siwur	149	16	in	in	IN
cord-269867-k10siwur	149	17	a	a	DT
cord-269867-k10siwur	149	18	fashion	fashion	NN
cord-269867-k10siwur	149	19	similar	similar	JJ
cord-269867-k10siwur	149	20	to	to	IN
cord-269867-k10siwur	149	21	TGEV	TGEV	NNP
cord-269867-k10siwur	149	22	-	-	HYPH
cord-269867-k10siwur	149	23	A	a	NN
cord-269867-k10siwur	149	24	in	in	IN
cord-269867-k10siwur	149	25	the	the	DT
cord-269867-k10siwur	149	26	C	c	NN
cord-269867-k10siwur	149	27	-	-	HYPH
cord-269867-k10siwur	149	28	terminal	terminal	NN
cord-269867-k10siwur	149	29	part	part	NN
cord-269867-k10siwur	149	30	of	of	IN
cord-269867-k10siwur	149	31	ClpG.	ClpG.	.
cord-269867-k10siwur	150	1	In	in	IN
cord-269867-k10siwur	150	2	this	this	DT
cord-269867-k10siwur	150	3	case	case	NN
cord-269867-k10siwur	150	4	,	,	,
cord-269867-k10siwur	150	5	proteolytic	proteolytic	JJ
cord-269867-k10siwur	150	6	cleavage	cleavage	NN
cord-269867-k10siwur	150	7	would	would	MD
cord-269867-k10siwur	150	8	result	result	VB
cord-269867-k10siwur	150	9	in	in	IN
cord-269867-k10siwur	150	10	a	a	DT
cord-269867-k10siwur	150	11	N	n	CD
cord-269867-k10siwur	150	12	-	-	HYPH
cord-269867-k10siwur	150	13	terminal	terminal	NN
cord-269867-k10siwur	150	14	fragment	fragment	NN
cord-269867-k10siwur	150	15	too	too	RB
cord-269867-k10siwur	150	16	small	small	JJ
cord-269867-k10siwur	150	17	(	(	-LRB-
cord-269867-k10siwur	150	18	<	<	XX
cord-269867-k10siwur	150	19	20	20	CD
cord-269867-k10siwur	150	20	aa	aa	NNP
cord-269867-k10siwur	150	21	)	)	-RRB-
cord-269867-k10siwur	150	22	to	to	TO
cord-269867-k10siwur	150	23	be	be	VB
cord-269867-k10siwur	150	24	detected	detect	VBN
cord-269867-k10siwur	150	25	,	,	,
cord-269867-k10siwur	150	26	that	that	IN
cord-269867-k10siwur	150	27	explaining	explain	VBG
cord-269867-k10siwur	150	28	why	why	WRB
cord-269867-k10siwur	150	29	no	no	DT
cord-269867-k10siwur	150	30	truncated	truncated	JJ
cord-269867-k10siwur	150	31	product	product	NN
cord-269867-k10siwur	150	32	was	be	VBD
cord-269867-k10siwur	150	33	visualized	visualize	VBN
cord-269867-k10siwur	150	34	from	from	IN
cord-269867-k10siwur	150	35	ClpG1-CA	ClpG1-CA	NNP
cord-269867-k10siwur	150	36	or	or	CC
cord-269867-k10siwur	150	37	ClpG1-AC	clpg1-ac	NN
cord-269867-k10siwur	151	1	(	(	-LRB-
cord-269867-k10siwur	151	2	Fig	Fig	NNP
cord-269867-k10siwur	151	3	.	.	NNP
cord-269867-k10siwur	151	4	4	4	CD
cord-269867-k10siwur	151	5	)	)	-RRB-
cord-269867-k10siwur	151	6	.	.	.
cord-269867-k10siwur	152	1	To	to	TO
cord-269867-k10siwur	152	2	probe	probe	VB
cord-269867-k10siwur	152	3	more	more	RBR
cord-269867-k10siwur	152	4	precisely	precisely	RB
cord-269867-k10siwur	152	5	the	the	DT
cord-269867-k10siwur	152	6	N	N	NNP
cord-269867-k10siwur	152	7	-	-	HYPH
cord-269867-k10siwur	152	8	and	and	CC
cord-269867-k10siwur	152	9	C	c	NN
cord-269867-k10siwur	152	10	-	-	HYPH
cord-269867-k10siwur	152	11	terminal	terminal	NN
cord-269867-k10siwur	152	12	parts	part	NNS
cord-269867-k10siwur	152	13	of	of	IN
cord-269867-k10siwur	152	14	the	the	DT
cord-269867-k10siwur	152	15	truncated	truncated	JJ
cord-269867-k10siwur	152	16	proteins	protein	NNS
cord-269867-k10siwur	152	17	generated	generate	VBN
cord-269867-k10siwur	152	18	by	by	IN
cord-269867-k10siwur	152	19	ClpG203-A	clpg203-a	NN
cord-269867-k10siwur	152	20	,	,	,
cord-269867-k10siwur	152	21	ClpG203-CA	ClpG203-CA	NNP
cord-269867-k10siwur	152	22	and	and	CC
cord-269867-k10siwur	152	23	ClpG202-AC	ClpG202-AC	NNP
cord-269867-k10siwur	152	24	we	-PRON-	PRP
cord-269867-k10siwur	152	25	used	use	VBD
cord-269867-k10siwur	152	26	two	two	CD
cord-269867-k10siwur	152	27	additional	additional	JJ
cord-269867-k10siwur	152	28	specific	specific	JJ
cord-269867-k10siwur	152	29	pAb	pab	NN
cord-269867-k10siwur	152	30	,	,	,
cord-269867-k10siwur	152	31	anti	anti	JJ
cord-269867-k10siwur	152	32	-	-	JJ
cord-269867-k10siwur	152	33	G15Q	g15q	JJ
cord-269867-k10siwur	152	34	and	and	CC
cord-269867-k10siwur	152	35	anti	anti	NNS
cord-269867-k10siwur	152	36	-	-	JJ
cord-269867-k10siwur	152	37	T15P	t15p	JJ
cord-269867-k10siwur	152	38	,	,	,
cord-269867-k10siwur	152	39	that	that	WDT
cord-269867-k10siwur	152	40	recognize	recognize	VBP
cord-269867-k10siwur	152	41	the	the	DT
cord-269867-k10siwur	152	42	peptides	peptide	NNS
cord-269867-k10siwur	152	43	G15Q	G15Q	NNP
cord-269867-k10siwur	153	1	(	(	-LRB-
cord-269867-k10siwur	153	2	aa	aa	NNP
cord-269867-k10siwur	153	3	185	185	CD
cord-269867-k10siwur	153	4	-	-	SYM
cord-269867-k10siwur	153	5	199	199	CD
cord-269867-k10siwur	153	6	)	)	-RRB-
cord-269867-k10siwur	154	1	and	and	CC
cord-269867-k10siwur	154	2	T15P	T15P	NNP
cord-269867-k10siwur	154	3	(	(	-LRB-
cord-269867-k10siwur	154	4	aa	aa	NNP
cord-269867-k10siwur	154	5	235	235	CD
cord-269867-k10siwur	154	6	-	-	HYPH
cord-269867-k10siwur	154	7	249	249	CD
cord-269867-k10siwur	154	8	)	)	-RRB-
cord-269867-k10siwur	154	9	in	in	IN
cord-269867-k10siwur	154	10	ClpG	ClpG	NNP
cord-269867-k10siwur	154	11	,	,	,
cord-269867-k10siwur	154	12	respectively	respectively	RB
cord-269867-k10siwur	155	1	;	;	:
cord-269867-k10siwur	155	2	insertions	insertion	NNS
cord-269867-k10siwur	155	3	in	in	IN
cord-269867-k10siwur	155	4	G15Q	g15q	NN
cord-269867-k10siwur	155	5	sequence	sequence	NN
cord-269867-k10siwur	155	6	abolished	abolish	VBD
cord-269867-k10siwur	155	7	the	the	DT
cord-269867-k10siwur	155	8	binding	binding	NN
cord-269867-k10siwur	155	9	of	of	IN
cord-269867-k10siwur	155	10	anti	anti	JJ
cord-269867-k10siwur	155	11	-	-	JJ
cord-269867-k10siwur	155	12	G15Q	g15q	JJ
cord-269867-k10siwur	155	13	(	(	-LRB-
cord-269867-k10siwur	155	14	Fig	Fig	NNP
cord-269867-k10siwur	155	15	.	.	NNP
cord-269867-k10siwur	155	16	4d	4d	NNP
cord-269867-k10siwur	155	17	,	,	,
cord-269867-k10siwur	155	18	mutants	mutant	NNS
cord-269867-k10siwur	155	19	ClpG192-C	ClpG192-C	NNP
cord-269867-k10siwur	155	20	to	to	IN
cord-269867-k10siwur	155	21	ClpG197-C	ClpG197-C	NNP
cord-269867-k10siwur	155	22	)	)	-RRB-
cord-269867-k10siwur	155	23	.	.	.
cord-269867-k10siwur	156	1	In	in	IN
cord-269867-k10siwur	156	2	these	these	DT
cord-269867-k10siwur	156	3	constructs	construct	NNS
cord-269867-k10siwur	156	4	,	,	,
cord-269867-k10siwur	156	5	G15Q	G15Q	NNP
cord-269867-k10siwur	156	6	is	be	VBZ
cord-269867-k10siwur	156	7	placed	place	VBN
cord-269867-k10siwur	156	8	10	10	CD
cord-269867-k10siwur	156	9	aa	aa	NN
cord-269867-k10siwur	156	10	upstream	upstream	RB
cord-269867-k10siwur	156	11	from	from	IN
cord-269867-k10siwur	156	12	the	the	DT
cord-269867-k10siwur	156	13	ClpG::TGEV	ClpG::TGEV	NNP
cord-269867-k10siwur	156	14	epitope	epitope	NN
cord-269867-k10siwur	156	15	fusion	fusion	NN
cord-269867-k10siwur	156	16	junction	junction	NN
cord-269867-k10siwur	156	17	and	and	CC
cord-269867-k10siwur	156	18	T15P	T15P	NNP
cord-269867-k10siwur	156	19	20	20	CD
cord-269867-k10siwur	156	20	to	to	TO
cord-269867-k10siwur	156	21	30	30	CD
cord-269867-k10siwur	156	22	aa	aa	NNP
cord-269867-k10siwur	156	23	downstream	downstream	RB
cord-269867-k10siwur	156	24	.	.	.
cord-269867-k10siwur	157	1	Western	western	JJ
cord-269867-k10siwur	157	2	immunoblots	immunoblot	NNS
cord-269867-k10siwur	157	3	indicated	indicate	VBD
cord-269867-k10siwur	157	4	that	that	IN
cord-269867-k10siwur	157	5	the	the	DT
cord-269867-k10siwur	157	6	intact	intact	JJ
cord-269867-k10siwur	157	7	ClpG203-CA	ClpG203-CA	NNP
cord-269867-k10siwur	157	8	and	and	CC
cord-269867-k10siwur	157	9	CIpG202-AC	CIpG202-AC	NNP
cord-269867-k10siwur	157	10	molecules	molecule	NNS
cord-269867-k10siwur	157	11	reacted	react	VBD
cord-269867-k10siwur	157	12	with	with	IN
cord-269867-k10siwur	157	13	both	both	CC
cord-269867-k10siwur	157	14	anti	anti	JJ
cord-269867-k10siwur	157	15	-	-	JJ
cord-269867-k10siwur	157	16	G15Q	g15q	JJ
cord-269867-k10siwur	157	17	and	and	CC
cord-269867-k10siwur	157	18	anti	anti	JJ
cord-269867-k10siwur	157	19	-	-	JJ
cord-269867-k10siwur	157	20	T15P	t15p	JJ
cord-269867-k10siwur	157	21	;	;	:
cord-269867-k10siwur	157	22	in	in	IN
cord-269867-k10siwur	157	23	CIpG203-A	cipg203-a	NN
cord-269867-k10siwur	157	24	the	the	DT
cord-269867-k10siwur	157	25	intact	intact	JJ
cord-269867-k10siwur	157	26	molecule	molecule	NN
cord-269867-k10siwur	157	27	is	be	VBZ
cord-269867-k10siwur	157	28	undetectable	undetectable	JJ
cord-269867-k10siwur	157	29	because	because	IN
cord-269867-k10siwur	157	30	too	too	RB
cord-269867-k10siwur	157	31	low	low	JJ
cord-269867-k10siwur	157	32	in	in	IN
cord-269867-k10siwur	157	33	amount	amount	NN
cord-269867-k10siwur	157	34	(	(	-LRB-
cord-269867-k10siwur	157	35	Fig	Fig	NNP
cord-269867-k10siwur	157	36	.	.	NNP
cord-269867-k10siwur	157	37	4d	4d	NNP
cord-269867-k10siwur	157	38	,	,	,
cord-269867-k10siwur	157	39	e	e	LS
cord-269867-k10siwur	157	40	)	)	-RRB-
cord-269867-k10siwur	157	41	.	.	.
cord-269867-k10siwur	158	1	By	by	IN
cord-269867-k10siwur	158	2	contrast	contrast	NN
cord-269867-k10siwur	158	3	,	,	,
cord-269867-k10siwur	158	4	their	-PRON-	PRP$
cord-269867-k10siwur	158	5	degraded	degrade	VBN
cord-269867-k10siwur	158	6	forms	form	NNS
cord-269867-k10siwur	158	7	were	be	VBD
cord-269867-k10siwur	158	8	probed	probe	VBN
cord-269867-k10siwur	158	9	by	by	IN
cord-269867-k10siwur	158	10	anti	anti	JJ
cord-269867-k10siwur	158	11	-	-	JJ
cord-269867-k10siwur	158	12	G15Q	g15q	JJ
cord-269867-k10siwur	158	13	but	but	CC
cord-269867-k10siwur	158	14	not	not	RB
cord-269867-k10siwur	158	15	by	by	IN
cord-269867-k10siwur	158	16	anti	anti	JJ
cord-269867-k10siwur	158	17	-	-	JJ
cord-269867-k10siwur	158	18	T15P	t15p	JJ
cord-269867-k10siwur	158	19	(	(	-LRB-
cord-269867-k10siwur	158	20	Fig	Fig	NNP
cord-269867-k10siwur	158	21	.	.	.
cord-269867-k10siwur	158	22	4d	4d	CD
cord-269867-k10siwur	158	23	)	)	-RRB-
cord-269867-k10siwur	158	24	.	.	.
cord-269867-k10siwur	159	1	Together	together	RB
cord-269867-k10siwur	159	2	with	with	IN
cord-269867-k10siwur	159	3	the	the	DT
cord-269867-k10siwur	159	4	facts	fact	NNS
cord-269867-k10siwur	159	5	that	that	WDT
cord-269867-k10siwur	159	6	the	the	DT
cord-269867-k10siwur	159	7	cleaved	cleaved	JJ
cord-269867-k10siwur	159	8	form	form	NN
cord-269867-k10siwur	159	9	of	of	IN
cord-269867-k10siwur	159	10	ClpG203-CA	ClpG203-CA	NNP
cord-269867-k10siwur	159	11	was	be	VBD
cord-269867-k10siwur	159	12	detected	detect	VBN
cord-269867-k10siwur	159	13	with	with	IN
cord-269867-k10siwur	159	14	3b.5mAb	3b.5mAb	NNP
cord-269867-k10siwur	159	15	(	(	-LRB-
cord-269867-k10siwur	159	16	Fig	fig	NN
cord-269867-k10siwur	159	17	.	.	.
cord-269867-k10siwur	159	18	4b	4b	CD
cord-269867-k10siwur	159	19	)	)	-RRB-
cord-269867-k10siwur	159	20	but	but	CC
cord-269867-k10siwur	159	21	not	not	RB
cord-269867-k10siwur	159	22	with	with	IN
cord-269867-k10siwur	159	23	1AF10mAb	1af10mab	CD
cord-269867-k10siwur	159	24	(	(	-LRB-
cord-269867-k10siwur	159	25	Fig	Fig	NNP
cord-269867-k10siwur	159	26	.	.	NNP
cord-269867-k10siwur	159	27	4c	4c	CD
cord-269867-k10siwur	159	28	)	)	-RRB-
cord-269867-k10siwur	159	29	,	,	,
cord-269867-k10siwur	159	30	and	and	CC
cord-269867-k10siwur	159	31	that	that	IN
cord-269867-k10siwur	159	32	the	the	DT
cord-269867-k10siwur	159	33	truncated	truncated	JJ
cord-269867-k10siwur	159	34	product	product	NN
cord-269867-k10siwur	159	35	of	of	IN
cord-269867-k10siwur	159	36	CIpG202-AC	cipg202-ac	NN
cord-269867-k10siwur	159	37	did	do	VBD
cord-269867-k10siwur	159	38	not	not	RB
cord-269867-k10siwur	159	39	react	react	VB
cord-269867-k10siwur	159	40	with	with	IN
cord-269867-k10siwur	159	41	any	any	DT
cord-269867-k10siwur	159	42	of	of	IN
cord-269867-k10siwur	159	43	the	the	DT
cord-269867-k10siwur	159	44	two	two	CD
cord-269867-k10siwur	159	45	mAb	mAb	NNS
cord-269867-k10siwur	159	46	(	(	-LRB-
cord-269867-k10siwur	159	47	Fig	Fig	NNP
cord-269867-k10siwur	159	48	.	.	.
cord-269867-k10siwur	159	49	4b	4b	CD
cord-269867-k10siwur	159	50	,	,	,
cord-269867-k10siwur	159	51	c	c	NNP
cord-269867-k10siwur	159	52	)	)	-RRB-
cord-269867-k10siwur	159	53	,	,	,
cord-269867-k10siwur	159	54	these	these	DT
cord-269867-k10siwur	159	55	data	datum	NNS
cord-269867-k10siwur	159	56	suggest	suggest	VBP
cord-269867-k10siwur	159	57	that	that	IN
cord-269867-k10siwur	159	58	protease	protease	NN
cord-269867-k10siwur	159	59	cleavage	cleavage	NN
cord-269867-k10siwur	159	60	occurs	occur	VBZ
cord-269867-k10siwur	159	61	within	within	IN
cord-269867-k10siwur	159	62	TGEV	TGEV	NNP
cord-269867-k10siwur	159	63	-	-	HYPH
cord-269867-k10siwur	159	64	A.	a.	NN
cord-269867-k10siwur	160	1	Furthermore	furthermore	RB
cord-269867-k10siwur	160	2	,	,	,
cord-269867-k10siwur	160	3	the	the	DT
cord-269867-k10siwur	160	4	uncleaved	uncleaved	JJ
cord-269867-k10siwur	160	5	form	form	NN
cord-269867-k10siwur	160	6	of	of	IN
cord-269867-k10siwur	160	7	Clp	Clp	NNP
cord-269867-k10siwur	160	8	-	-	HYPH
cord-269867-k10siwur	160	9	G203-CA	G203-CA	NNP
cord-269867-k10siwur	160	10	was	be	VBD
cord-269867-k10siwur	160	11	substantially	substantially	RB
cord-269867-k10siwur	160	12	more	more	RBR
cord-269867-k10siwur	160	13	abundant	abundant	JJ
cord-269867-k10siwur	160	14	than	than	IN
cord-269867-k10siwur	160	15	its	-PRON-	PRP$
cord-269867-k10siwur	160	16	truncated	truncated	JJ
cord-269867-k10siwur	160	17	form	form	NN
cord-269867-k10siwur	160	18	(	(	-LRB-
cord-269867-k10siwur	160	19	Fig	fig	NN
cord-269867-k10siwur	160	20	.	.	.
cord-269867-k10siwur	160	21	4a	4a	CD
cord-269867-k10siwur	160	22	)	)	-RRB-
cord-269867-k10siwur	160	23	.	.	.
cord-269867-k10siwur	161	1	In	in	IN
cord-269867-k10siwur	161	2	contrast	contrast	NN
cord-269867-k10siwur	161	3	,	,	,
cord-269867-k10siwur	161	4	CIpG203-A	cipg203-a	NN
cord-269867-k10siwur	161	5	and	and	CC
cord-269867-k10siwur	161	6	ClpG202-AC	ClpG202-AC	NNP
cord-269867-k10siwur	161	7	showed	show	VBD
cord-269867-k10siwur	161	8	a	a	DT
cord-269867-k10siwur	161	9	prominence	prominence	NN
cord-269867-k10siwur	161	10	in	in	IN
cord-269867-k10siwur	161	11	amount	amount	NN
cord-269867-k10siwur	161	12	of	of	IN
cord-269867-k10siwur	161	13	the	the	DT
cord-269867-k10siwur	161	14	cleaved	cleaved	JJ
cord-269867-k10siwur	161	15	products	product	NNS
cord-269867-k10siwur	161	16	,	,	,
cord-269867-k10siwur	161	17	indicating	indicate	VBG
cord-269867-k10siwur	161	18	that	that	IN
cord-269867-k10siwur	161	19	C::A	c::a	JJ
cord-269867-k10siwur	161	20	fusion	fusion	NN
cord-269867-k10siwur	161	21	,	,	,
cord-269867-k10siwur	161	22	rather	rather	RB
cord-269867-k10siwur	161	23	than	than	IN
cord-269867-k10siwur	161	24	A::C	a::c	JJ
cord-269867-k10siwur	161	25	fusion	fusion	NN
cord-269867-k10siwur	161	26	,	,	,
cord-269867-k10siwur	161	27	significantly	significantly	RB
cord-269867-k10siwur	161	28	reduced	reduce	VBN
cord-269867-k10siwur	161	29	cleavage	cleavage	NN
cord-269867-k10siwur	161	30	process	process	NN
cord-269867-k10siwur	161	31	,	,	,
cord-269867-k10siwur	161	32	probably	probably	RB
cord-269867-k10siwur	161	33	due	due	IN
cord-269867-k10siwur	161	34	to	to	IN
cord-269867-k10siwur	161	35	the	the	DT
cord-269867-k10siwur	161	36	protective	protective	JJ
cord-269867-k10siwur	161	37	placement	placement	NN
cord-269867-k10siwur	161	38	of	of	IN
cord-269867-k10siwur	161	39	the	the	DT
cord-269867-k10siwur	161	40	hydrophobic	hydrophobic	JJ
cord-269867-k10siwur	161	41	TGEV	TGEV	NNP
cord-269867-k10siwur	161	42	-	-	HYPH
cord-269867-k10siwur	161	43	C	C	NNP
cord-269867-k10siwur	161	44	motif	motif	NN
cord-269867-k10siwur	161	45	at	at	IN
cord-269867-k10siwur	161	46	the	the	DT
cord-269867-k10siwur	161	47	N	n	CD
cord-269867-k10siwur	161	48	-	-	HYPH
cord-269867-k10siwur	161	49	terminal	terminal	JJ
cord-269867-k10siwur	161	50	end	end	NN
cord-269867-k10siwur	161	51	of	of	IN
cord-269867-k10siwur	162	1	TGEV	TGEV	NNP
cord-269867-k10siwur	162	2	-	-	HYPH
cord-269867-k10siwur	162	3	A.	A.	NNP
cord-269867-k10siwur	162	4	Therefore	therefore	RB
cord-269867-k10siwur	162	5	,	,	,
cord-269867-k10siwur	162	6	we	-PRON-	PRP
cord-269867-k10siwur	162	7	speculate	speculate	VBP
cord-269867-k10siwur	162	8	that	that	IN
cord-269867-k10siwur	162	9	the	the	DT
cord-269867-k10siwur	162	10	site	site	NN
cord-269867-k10siwur	162	11	of	of	IN
cord-269867-k10siwur	162	12	cleavage	cleavage	NN
cord-269867-k10siwur	162	13	must	must	MD
cord-269867-k10siwur	162	14	be	be	VB
cord-269867-k10siwur	162	15	N	n	CD
cord-269867-k10siwur	162	16	-	-	HYPH
cord-269867-k10siwur	162	17	terminally	terminally	RB
cord-269867-k10siwur	162	18	located	locate	VBN
cord-269867-k10siwur	162	19	with	with	IN
cord-269867-k10siwur	162	20	respect	respect	NN
cord-269867-k10siwur	162	21	to	to	IN
cord-269867-k10siwur	162	22	the	the	DT
cord-269867-k10siwur	162	23	TGEV	TGEV	NNP
cord-269867-k10siwur	162	24	-	-	HYPH
cord-269867-k10siwur	162	25	A	a	DT
cord-269867-k10siwur	162	26	sequence	sequence	NN
cord-269867-k10siwur	162	27	.	.	.
cord-269867-k10siwur	163	1	Supporting	support	VBG
cord-269867-k10siwur	163	2	this	this	DT
cord-269867-k10siwur	163	3	hypothesis	hypothesis	NN
cord-269867-k10siwur	163	4	,	,	,
cord-269867-k10siwur	163	5	the	the	DT
cord-269867-k10siwur	163	6	two	two	CD
cord-269867-k10siwur	163	7	first	first	JJ
cord-269867-k10siwur	163	8	aa	aa	NNP
cord-269867-k10siwur	163	9	residues	residue	NNS
cord-269867-k10siwur	163	10	of	of	IN
cord-269867-k10siwur	163	11	TGEV	TGEV	NNP
cord-269867-k10siwur	163	12	-	-	HYPH
cord-269867-k10siwur	163	13	A	A	NNP
cord-269867-k10siwur	163	14	consist	consist	NN
cord-269867-k10siwur	163	15	of	of	IN
cord-269867-k10siwur	163	16	lysine	lysine	NN
cord-269867-k10siwur	163	17	(	(	-LRB-
cord-269867-k10siwur	163	18	K	K	NNP
cord-269867-k10siwur	163	19	)	)	-RRB-
cord-269867-k10siwur	163	20	and	and	CC
cord-269867-k10siwur	163	21	arginine	arginine	NN
cord-269867-k10siwur	163	22	(	(	-LRB-
cord-269867-k10siwur	163	23	R	r	NN
cord-269867-k10siwur	163	24	)	)	-RRB-
cord-269867-k10siwur	163	25	which	which	WDT
cord-269867-k10siwur	163	26	are	be	VBP
cord-269867-k10siwur	163	27	often	often	RB
cord-269867-k10siwur	163	28	involved	involve	VBN
cord-269867-k10siwur	163	29	in	in	IN
cord-269867-k10siwur	163	30	the	the	DT
cord-269867-k10siwur	163	31	proteolytic	proteolytic	JJ
cord-269867-k10siwur	163	32	maturation	maturation	NN
cord-269867-k10siwur	163	33	of	of	IN
cord-269867-k10siwur	163	34	viral	viral	JJ
cord-269867-k10siwur	163	35	envelope	envelope	NN
cord-269867-k10siwur	163	36	glycoproteins	glycoprotein	NNS
cord-269867-k10siwur	163	37	(	(	-LRB-
cord-269867-k10siwur	163	38	Moulard	Moulard	NNP
cord-269867-k10siwur	163	39	et	et	FW
cord-269867-k10siwur	163	40	al	al	NNP
cord-269867-k10siwur	163	41	.	.	NNP
cord-269867-k10siwur	163	42	,	,	,
cord-269867-k10siwur	163	43	1995	1995	CD
cord-269867-k10siwur	163	44	)	)	-RRB-
cord-269867-k10siwur	163	45	.	.	.
cord-269867-k10siwur	164	1	assistance	assistance	NN
cord-269867-k10siwur	164	2	,	,	,
cord-269867-k10siwur	164	3	S.	S.	NNP
cord-269867-k10siwur	164	4	Dutilloy	Dutilloy	NNP
cord-269867-k10siwur	164	5	for	for	IN
cord-269867-k10siwur	164	6	secretarial	secretarial	JJ
cord-269867-k10siwur	164	7	assistance	assistance	NN
cord-269867-k10siwur	164	8	,	,	,
cord-269867-k10siwur	164	9	Dr.	Dr.	NNP
cord-269867-k10siwur	164	10	L.	L.	NNP
cord-269867-k10siwur	164	11	Enjuanes	Enjuanes	NNP
cord-269867-k10siwur	164	12	and	and	CC
cord-269867-k10siwur	164	13	Dr.	Dr.	NNP
cord-269867-k10siwur	164	14	H.	H.	NNP
cord-269867-k10siwur	164	15	Laude	Laude	NNP
cord-269867-k10siwur	164	16	for	for	IN
cord-269867-k10siwur	164	17	providing	provide	VBG
cord-269867-k10siwur	164	18	mAb	mab	NN
cord-269867-k10siwur	164	19	1AF10	1AF10	NNS
cord-269867-k10siwur	164	20	and	and	CC
cord-269867-k10siwur	164	21	mAb	mab	NN
cord-269867-k10siwur	164	22	3b.5	3b.5	CD
cord-269867-k10siwur	164	23	,	,	,
cord-269867-k10siwur	164	24	respectively	respectively	RB
cord-269867-k10siwur	164	25	.	.	.
cord-269867-k10siwur	165	1	This	this	DT
cord-269867-k10siwur	165	2	work	work	NN
cord-269867-k10siwur	165	3	was	be	VBD
cord-269867-k10siwur	165	4	supported	support	VBN
cord-269867-k10siwur	165	5	by	by	IN
cord-269867-k10siwur	165	6	grants	grant	NNS
cord-269867-k10siwur	165	7	AGRE-0008-C	AGRE-0008-C	NNP
cord-269867-k10siwur	165	8	from	from	IN
cord-269867-k10siwur	165	9	European	European	NNP
cord-269867-k10siwur	165	10	Economic	Economic	NNP
cord-269867-k10siwur	165	11	Community	Community	NNP
cord-269867-k10siwur	165	12	(	(	-LRB-
cord-269867-k10siwur	165	13	ECLAIR	ECLAIR	NNP
cord-269867-k10siwur	165	14	program	program	NN
cord-269867-k10siwur	165	15	)	)	-RRB-
cord-269867-k10siwur	165	16	.	.	.
cord-269867-k10siwur	166	1	(	(	-LRB-
cord-269867-k10siwur	166	2	1	1	CD
cord-269867-k10siwur	166	3	)	)	-RRB-
cord-269867-k10siwur	167	1	Three	three	CD
cord-269867-k10siwur	167	2	nonpermissive	nonpermissive	JJ
cord-269867-k10siwur	167	3	sites	site	NNS
cord-269867-k10siwur	167	4	(	(	-LRB-
cord-269867-k10siwur	167	5	aa	aa	NNP
cord-269867-k10siwur	167	6	182	182	CD
cord-269867-k10siwur	167	7	-	-	SYM
cord-269867-k10siwur	167	8	183	183	CD
cord-269867-k10siwur	167	9	,	,	,
cord-269867-k10siwur	167	10	190	190	CD
cord-269867-k10siwur	167	11	-	-	SYM
cord-269867-k10siwur	167	12	191	191	CD
cord-269867-k10siwur	167	13	and	and	CC
cord-269867-k10siwur	167	14	191	191	CD
cord-269867-k10siwur	167	15	-	-	SYM
cord-269867-k10siwur	167	16	192	192	CD
cord-269867-k10siwur	167	17	)	)	-RRB-
cord-269867-k10siwur	167	18	,	,	,
cord-269867-k10siwur	167	19	six	six	CD
cord-269867-k10siwur	167	20	partially	partially	RB
cord-269867-k10siwur	167	21	permissive	permissive	JJ
cord-269867-k10siwur	167	22	sites	site	NNS
cord-269867-k10siwur	167	23	(	(	-LRB-
cord-269867-k10siwur	167	24	aa	aa	NNP
cord-269867-k10siwur	167	25	192	192	CD
cord-269867-k10siwur	167	26	to	to	IN
cord-269867-k10siwur	167	27	197	197	CD
cord-269867-k10siwur	167	28	)	)	-RRB-
cord-269867-k10siwur	167	29	and	and	CC
cord-269867-k10siwur	167	30	three	three	CD
cord-269867-k10siwur	167	31	fully	fully	RB
cord-269867-k10siwur	167	32	permissive	permissive	JJ
cord-269867-k10siwur	167	33	sites	site	NNS
cord-269867-k10siwur	167	34	(	(	-LRB-
cord-269867-k10siwur	167	35	aa	aa	NNP
cord-269867-k10siwur	167	36	-1/1	-1/1	NNP
cord-269867-k10siwur	167	37	,	,	,
cord-269867-k10siwur	167	38	202	202	CD
cord-269867-k10siwur	167	39	-	-	SYM
cord-269867-k10siwur	167	40	204	204	CD
cord-269867-k10siwur	167	41	and	and	CC
cord-269867-k10siwur	167	42	202	202	CD
cord-269867-k10siwur	167	43	-	-	SYM
cord-269867-k10siwur	167	44	218	218	CD
cord-269867-k10siwur	167	45	)	)	-RRB-
cord-269867-k10siwur	167	46	were	be	VBD
cord-269867-k10siwur	167	47	identified	identify	VBN
cord-269867-k10siwur	167	48	throughout	throughout	IN
cord-269867-k10siwur	167	49	CIpG.	cipg.	XX
cord-269867-k10siwur	168	1	The	the	DT
cord-269867-k10siwur	168	2	latter	latter	JJ
cord-269867-k10siwur	168	3	sites	site	NNS
cord-269867-k10siwur	168	4	appeared	appear	VBD
cord-269867-k10siwur	168	5	as	as	IN
cord-269867-k10siwur	168	6	the	the	DT
cord-269867-k10siwur	168	7	most	most	RBS
cord-269867-k10siwur	168	8	versatile	versatile	JJ
cord-269867-k10siwur	168	9	targets	target	NNS
cord-269867-k10siwur	168	10	since	since	IN
cord-269867-k10siwur	168	11	the	the	DT
cord-269867-k10siwur	168	12	largest	large	JJS
cord-269867-k10siwur	168	13	insertions	insertion	NNS
cord-269867-k10siwur	168	14	consisting	consist	VBG
cord-269867-k10siwur	168	15	of	of	IN
cord-269867-k10siwur	168	16	26	26	CD
cord-269867-k10siwur	169	1	~ta	~ta	NNP
cord-269867-k10siwur	169	2	residues	residue	NNS
cord-269867-k10siwur	169	3	did	do	VBD
cord-269867-k10siwur	169	4	not	not	RB
cord-269867-k10siwur	169	5	interfere	interfere	VB
cord-269867-k10siwur	169	6	with	with	IN
cord-269867-k10siwur	169	7	CS31A	cs31a	NN
cord-269867-k10siwur	169	8	biogenesis	biogenesis	NN
cord-269867-k10siwur	169	9	.	.	.
cord-269867-k10siwur	170	1	Even	even	RB
cord-269867-k10siwur	170	2	an	an	DT
cord-269867-k10siwur	170	3	insert	insert	NN
cord-269867-k10siwur	170	4	of	of	IN
cord-269867-k10siwur	170	5	51	51	CD
cord-269867-k10siwur	170	6	aa	aa	NNP
cord-269867-k10siwur	170	7	long	long	JJ
cord-269867-k10siwur	170	8	resulting	resulting	NN
cord-269867-k10siwur	170	9	of	of	IN
cord-269867-k10siwur	170	10	the	the	DT
cord-269867-k10siwur	170	11	addition	addition	NN
cord-269867-k10siwur	170	12	of	of	IN
cord-269867-k10siwur	170	13	the	the	DT
cord-269867-k10siwur	170	14	TGEV	TGEV	NNP
cord-269867-k10siwur	170	15	-	-	HYPH
cord-269867-k10siwur	170	16	C::TGEV	C::TGEV	NNP
cord-269867-k10siwur	170	17	-	-	HYPH
cord-269867-k10siwur	170	18	A	a	DT
cord-269867-k10siwur	170	19	tandem	tandem	NN
cord-269867-k10siwur	170	20	peptide	peptide	NN
cord-269867-k10siwur	170	21	in	in	IN
cord-269867-k10siwur	170	22	both	both	DT
cord-269867-k10siwur	170	23	positions	position	NNS
cord-269867-k10siwur	171	1	aa	aa	NNP
cord-269867-k10siwur	171	2	-1/1	-1/1	NNP
cord-269867-k10siwur	171	3	and	and	CC
cord-269867-k10siwur	171	4	202	202	CD
cord-269867-k10siwur	171	5	-	-	SYM
cord-269867-k10siwur	171	6	218	218	CD
cord-269867-k10siwur	171	7	was	be	VBD
cord-269867-k10siwur	171	8	normally	normally	RB
cord-269867-k10siwur	171	9	incorporated	incorporate	VBN
cord-269867-k10siwur	171	10	in	in	IN
cord-269867-k10siwur	171	11	CS31A	cs31a	NN
cord-269867-k10siwur	171	12	polymer	polymer	NN
cord-269867-k10siwur	171	13	.	.	.
cord-269867-k10siwur	172	1	The	the	DT
cord-269867-k10siwur	172	2	binding	binding	NN
cord-269867-k10siwur	172	3	of	of	IN
cord-269867-k10siwur	172	4	the	the	DT
cord-269867-k10siwur	172	5	TGEV	TGEV	NNP
cord-269867-k10siwur	172	6	-	-	HYPH
cord-269867-k10siwur	172	7	specific	specific	JJ
cord-269867-k10siwur	172	8	mAb	mab	NN
cord-269867-k10siwur	172	9	with	with	IN
cord-269867-k10siwur	172	10	hybrid	hybrid	JJ
cord-269867-k10siwur	172	11	fibrillae	fibrillae	NNP
cord-269867-k10siwur	172	12	indicates	indicate	VBZ
cord-269867-k10siwur	172	13	that	that	IN
cord-269867-k10siwur	172	14	the	the	DT
cord-269867-k10siwur	172	15	TGEV	TGEV	NNP
cord-269867-k10siwur	172	16	antigenic	antigenic	JJ
cord-269867-k10siwur	172	17	determinants	determinant	NNS
cord-269867-k10siwur	172	18	expressed	express	VBN
cord-269867-k10siwur	172	19	at	at	IN
cord-269867-k10siwur	172	20	any	any	DT
cord-269867-k10siwur	172	21	of	of	IN
cord-269867-k10siwur	172	22	the	the	DT
cord-269867-k10siwur	172	23	permissive	permissive	JJ
cord-269867-k10siwur	172	24	sites	site	NNS
cord-269867-k10siwur	172	25	are	be	VBP
cord-269867-k10siwur	172	26	exposed	expose	VBN
cord-269867-k10siwur	172	27	on	on	IN
cord-269867-k10siwur	172	28	both	both	DT
cord-269867-k10siwur	172	29	ClpG	ClpG	NNP
cord-269867-k10siwur	172	30	and	and	CC
cord-269867-k10siwur	172	31	CS31A	cs31a	NN
cord-269867-k10siwur	172	32	proteins	protein	NNS
cord-269867-k10siwur	172	33	at	at	IN
cord-269867-k10siwur	172	34	the	the	DT
cord-269867-k10siwur	172	35	E.	E.	NNP
cord-269867-k10siwur	172	36	coli	coli	VBZ
cord-269867-k10siwur	172	37	cell	cell	NN
cord-269867-k10siwur	172	38	-	-	HYPH
cord-269867-k10siwur	172	39	surface	surface	NN
cord-269867-k10siwur	172	40	.	.	.
cord-269867-k10siwur	173	1	We	-PRON-	PRP
cord-269867-k10siwur	173	2	show	show	VBP
cord-269867-k10siwur	173	3	here	here	RB
cord-269867-k10siwur	173	4	that	that	IN
cord-269867-k10siwur	173	5	the	the	DT
cord-269867-k10siwur	173	6	potential	potential	NN
cord-269867-k10siwur	173	7	of	of	IN
cord-269867-k10siwur	173	8	ClpG	ClpG	NNP
cord-269867-k10siwur	173	9	as	as	IN
cord-269867-k10siwur	173	10	a	a	DT
cord-269867-k10siwur	173	11	carrier	carrier	NN
cord-269867-k10siwur	173	12	for	for	IN
cord-269867-k10siwur	173	13	foreign	foreign	JJ
cord-269867-k10siwur	173	14	peptides	peptide	NNS
cord-269867-k10siwur	173	15	may	may	MD
cord-269867-k10siwur	173	16	be	be	VB
cord-269867-k10siwur	173	17	influenced	influence	VBN
cord-269867-k10siwur	173	18	by	by	IN
cord-269867-k10siwur	173	19	the	the	DT
cord-269867-k10siwur	173	20	general	general	NN
cord-269867-k10siwur	173	21	predicted	predict	VBN
cord-269867-k10siwur	173	22	properties	property	NNS
cord-269867-k10siwur	173	23	of	of	IN
cord-269867-k10siwur	173	24	the	the	DT
cord-269867-k10siwur	173	25	local	local	JJ
cord-269867-k10siwur	173	26	sequences	sequence	NNS
cord-269867-k10siwur	173	27	.	.	.
cord-269867-k10siwur	174	1	(	(	-LRB-
cord-269867-k10siwur	174	2	2	2	LS
cord-269867-k10siwur	174	3	)	)	-RRB-
cord-269867-k10siwur	174	4	Unlike	unlike	IN
cord-269867-k10siwur	174	5	TGEV	TGEV	NNP
cord-269867-k10siwur	174	6	-	-	HYPH
cord-269867-k10siwur	174	7	C	C	NNP
cord-269867-k10siwur	174	8	,	,	,
cord-269867-k10siwur	174	9	TGEV	TGEV	NNP
cord-269867-k10siwur	174	10	-	-	HYPH
cord-269867-k10siwur	174	11	A	A	NNP
cord-269867-k10siwur	174	12	expressed	express	VBN
cord-269867-k10siwur	174	13	at	at	IN
cord-269867-k10siwur	174	14	any	any	DT
cord-269867-k10siwur	174	15	permissive	permissive	JJ
cord-269867-k10siwur	174	16	site	site	NN
cord-269867-k10siwur	174	17	of	of	IN
cord-269867-k10siwur	174	18	ClpG	ClpG	NNP
cord-269867-k10siwur	174	19	rendered	render	VBD
cord-269867-k10siwur	174	20	the	the	DT
cord-269867-k10siwur	174	21	hybrid	hybrid	JJ
cord-269867-k10siwur	174	22	proteins	protein	NNS
cord-269867-k10siwur	174	23	partially	partially	RB
cord-269867-k10siwur	174	24	susceptible	susceptible	JJ
cord-269867-k10siwur	174	25	to	to	IN
cord-269867-k10siwur	174	26	proteolytic	proteolytic	JJ
cord-269867-k10siwur	174	27	degradation	degradation	NN
cord-269867-k10siwur	174	28	,	,	,
cord-269867-k10siwur	174	29	indicating	indicate	VBG
cord-269867-k10siwur	174	30	that	that	IN
cord-269867-k10siwur	174	31	it	-PRON-	PRP
cord-269867-k10siwur	174	32	was	be	VBD
cord-269867-k10siwur	174	33	influential	influential	JJ
cord-269867-k10siwur	174	34	in	in	IN
cord-269867-k10siwur	174	35	,	,	,
cord-269867-k10siwur	174	36	but	but	CC
cord-269867-k10siwur	174	37	not	not	RB
cord-269867-k10siwur	174	38	critical	critical	JJ
cord-269867-k10siwur	174	39	for	for	IN
cord-269867-k10siwur	174	40	,	,	,
cord-269867-k10siwur	174	41	fibrillae	fibrillae	NNP
cord-269867-k10siwur	174	42	integrity	integrity	NN
cord-269867-k10siwur	174	43	,	,	,
cord-269867-k10siwur	174	44	presumably	presumably	RB
cord-269867-k10siwur	174	45	because	because	IN
cord-269867-k10siwur	174	46	providing	provide	VBG
cord-269867-k10siwur	174	47	a	a	DT
cord-269867-k10siwur	174	48	protease	protease	NN
cord-269867-k10siwur	174	49	cleavage	cleavage	NN
cord-269867-k10siwur	174	50	site	site	NN
cord-269867-k10siwur	174	51	.	.	.
cord-269867-k10siwur	175	1	(	(	-LRB-
cord-269867-k10siwur	175	2	3	3	LS
cord-269867-k10siwur	175	3	)	)	-RRB-
cord-269867-k10siwur	175	4	CS31A	CS31A	NNP
cord-269867-k10siwur	175	5	fibrillum	fibrillum	NNP
cord-269867-k10siwur	175	6	appears	appear	VBZ
cord-269867-k10siwur	175	7	as	as	IN
cord-269867-k10siwur	175	8	a	a	DT
cord-269867-k10siwur	175	9	potent	potent	JJ
cord-269867-k10siwur	175	10	cell	cell	NN
cord-269867-k10siwur	175	11	-	-	HYPH
cord-269867-k10siwur	175	12	surface	surface	NN
cord-269867-k10siwur	175	13	presenting	present	VBG
cord-269867-k10siwur	175	14	vector	vector	NN
cord-269867-k10siwur	175	15	for	for	IN
cord-269867-k10siwur	175	16	TGEV	TGEV	NNP
cord-269867-k10siwur	175	17	epitopes	epitope	NNS
cord-269867-k10siwur	175	18	.	.	.
cord-269867-k10siwur	176	1	Such	such	JJ
cord-269867-k10siwur	176	2	hybrid	hybrid	JJ
cord-269867-k10siwur	176	3	fibrillae	fibrilla	NNS
cord-269867-k10siwur	176	4	might	may	MD
cord-269867-k10siwur	176	5	be	be	VB
cord-269867-k10siwur	176	6	valuable	valuable	JJ
cord-269867-k10siwur	176	7	tools	tool	NNS
cord-269867-k10siwur	176	8	in	in	IN
cord-269867-k10siwur	176	9	the	the	DT
cord-269867-k10siwur	176	10	development	development	NN
cord-269867-k10siwur	176	11	as	as	IN
cord-269867-k10siwur	176	12	components	component	NNS
cord-269867-k10siwur	176	13	of	of	IN
cord-269867-k10siwur	176	14	a	a	DT
cord-269867-k10siwur	176	15	subunit	subunit	JJ
cord-269867-k10siwur	176	16	vaccine	vaccine	NN
cord-269867-k10siwur	176	17	.	.	.
cord-269867-k10siwur	177	1	Whether	whether	IN
cord-269867-k10siwur	177	2	these	these	DT
cord-269867-k10siwur	177	3	hybrid	hybrid	JJ
cord-269867-k10siwur	177	4	fibrillae	fibrilla	NNS
cord-269867-k10siwur	177	5	induce	induce	VBP
cord-269867-k10siwur	177	6	specific	specific	JJ
cord-269867-k10siwur	177	7	Ab	ab	NN
cord-269867-k10siwur	177	8	is	be	VBZ
cord-269867-k10siwur	177	9	currently	currently	RB
cord-269867-k10siwur	177	10	under	under	IN
cord-269867-k10siwur	177	11	investigation	investigation	NN
cord-269867-k10siwur	177	12	.	.	.
cord-269867-k10siwur	178	1	The	the	DT
cord-269867-k10siwur	178	2	ClpG	ClpG	NNP
cord-269867-k10siwur	178	3	exposure	exposure	NN
cord-269867-k10siwur	178	4	vector	vector	NN
cord-269867-k10siwur	178	5	system	system	NN
cord-269867-k10siwur	178	6	described	describe	VBN
cord-269867-k10siwur	178	7	here	here	RB
cord-269867-k10siwur	178	8	provides	provide	VBZ
cord-269867-k10siwur	178	9	a	a	DT
cord-269867-k10siwur	178	10	number	number	NN
cord-269867-k10siwur	178	11	of	of	IN
cord-269867-k10siwur	178	12	insertion	insertion	NN
cord-269867-k10siwur	178	13	sites	site	NNS
cord-269867-k10siwur	178	14	and	and	CC
cord-269867-k10siwur	178	15	therefore	therefore	RB
cord-269867-k10siwur	178	16	a	a	DT
cord-269867-k10siwur	178	17	variety	variety	NN
cord-269867-k10siwur	178	18	of	of	IN
cord-269867-k10siwur	178	19	flanking	flank	VBG
cord-269867-k10siwur	178	20	aa	aa	NNP
cord-269867-k10siwur	178	21	sequences	sequence	NNS
cord-269867-k10siwur	178	22	for	for	IN
cord-269867-k10siwur	178	23	the	the	DT
cord-269867-k10siwur	178	24	expression	expression	NN
cord-269867-k10siwur	178	25	of	of	IN
cord-269867-k10siwur	178	26	TGEV	TGEV	NNP
cord-269867-k10siwur	178	27	epitopes	epitope	NNS
cord-269867-k10siwur	178	28	.	.	.
cord-269867-k10siwur	179	1	Consequently	consequently	RB
cord-269867-k10siwur	179	2	,	,	,
cord-269867-k10siwur	179	3	a	a	DT
cord-269867-k10siwur	179	4	further	further	JJ
cord-269867-k10siwur	179	5	study	study	NN
cord-269867-k10siwur	179	6	of	of	IN
cord-269867-k10siwur	179	7	the	the	DT
cord-269867-k10siwur	179	8	immunogenicity	immunogenicity	NN
cord-269867-k10siwur	179	9	of	of	IN
cord-269867-k10siwur	179	10	the	the	DT
cord-269867-k10siwur	179	11	TGEV	TGEV	NNP
cord-269867-k10siwur	179	12	epitopes	epitope	NNS
cord-269867-k10siwur	179	13	in	in	IN
cord-269867-k10siwur	179	14	different	different	JJ
cord-269867-k10siwur	179	15	contexts	context	NNS
cord-269867-k10siwur	179	16	of	of	IN
cord-269867-k10siwur	179	17	ClpG	ClpG	NNP
cord-269867-k10siwur	179	18	will	will	MD
cord-269867-k10siwur	179	19	improve	improve	VB
cord-269867-k10siwur	179	20	our	-PRON-	PRP$
cord-269867-k10siwur	179	21	understanding	understanding	NN
cord-269867-k10siwur	179	22	of	of	IN
cord-269867-k10siwur	179	23	the	the	DT
cord-269867-k10siwur	179	24	relationship	relationship	NN
cord-269867-k10siwur	179	25	between	between	IN
cord-269867-k10siwur	179	26	flanking	flank	VBG
cord-269867-k10siwur	179	27	sequences	sequence	NNS
cord-269867-k10siwur	179	28	and	and	CC
cord-269867-k10siwur	179	29	the	the	DT
cord-269867-k10siwur	179	30	immunogenicity	immunogenicity	NN
cord-269867-k10siwur	179	31	of	of	IN
cord-269867-k10siwur	179	32	the	the	DT
cord-269867-k10siwur	179	33	epitopes	epitope	NNS
cord-269867-k10siwur	179	34	.	.	.
cord-269867-k10siwur	180	1	Improved	improve	VBN
cord-269867-k10siwur	180	2	mimicry	mimicry	NN
cord-269867-k10siwur	180	3	of	of	IN
cord-269867-k10siwur	180	4	a	a	DT
cord-269867-k10siwur	180	5	foot	foot	NN
cord-269867-k10siwur	180	6	-	-	HYPH
cord-269867-k10siwur	180	7	and	and	CC
cord-269867-k10siwur	180	8	-	-	HYPH
cord-269867-k10siwur	180	9	mouth	mouth	NN
cord-269867-k10siwur	180	10	disease	disease	NN
cord-269867-k10siwur	180	11	virus	virus	NN
cord-269867-k10siwur	180	12	antigenic	antigenic	JJ
cord-269867-k10siwur	180	13	site	site	NN
cord-269867-k10siwur	180	14	by	by	IN
cord-269867-k10siwur	180	15	a	a	DT
cord-269867-k10siwur	180	16	viral	viral	JJ
cord-269867-k10siwur	180	17	peptide	peptide	NN
cord-269867-k10siwur	180	18	displayed	display	VBN
cord-269867-k10siwur	180	19	on	on	IN
cord-269867-k10siwur	180	20	fl	fl	JJ
cord-269867-k10siwur	180	21	-	-	HYPH
cord-269867-k10siwur	180	22	galactosidase	galactosidase	NN
cord-269867-k10siwur	180	23	surface	surface	NN
cord-269867-k10siwur	180	24	CS31A	cs31a	NN
cord-269867-k10siwur	180	25	capsule	capsule	NN
cord-269867-k10siwur	180	26	-	-	HYPH
cord-269867-k10siwur	180	27	like	like	JJ
cord-269867-k10siwur	180	28	antigen	antigen	NN
cord-269867-k10siwur	180	29	as	as	IN
cord-269867-k10siwur	180	30	an	an	DT
cord-269867-k10siwur	180	31	exposure	exposure	NN
cord-269867-k10siwur	180	32	vector	vector	NN
cord-269867-k10siwur	180	33	for	for	IN
cord-269867-k10siwur	180	34	heterologous	heterologous	JJ
cord-269867-k10siwur	180	35	antigenic	antigenic	JJ
cord-269867-k10siwur	180	36	determinants	determinant	NNS
cord-269867-k10siwur	180	37	Synthesis	Synthesis	NNP
cord-269867-k10siwur	180	38	of	of	IN
cord-269867-k10siwur	180	39	fusion	fusion	NN
cord-269867-k10siwur	180	40	proteins	protein	NNS
cord-269867-k10siwur	180	41	with	with	IN
cord-269867-k10siwur	180	42	multiple	multiple	JJ
cord-269867-k10siwur	180	43	copies	copy	NNS
cord-269867-k10siwur	180	44	of	of	IN
cord-269867-k10siwur	180	45	an	an	DT
cord-269867-k10siwur	180	46	antiigenic	antiigenic	JJ
cord-269867-k10siwur	180	47	determinant	determinant	NN
cord-269867-k10siwur	180	48	of	of	IN
cord-269867-k10siwur	180	49	footand	footand	NN
cord-269867-k10siwur	180	50	-	-	HYPH
cord-269867-k10siwur	180	51	mouth	mouth	NN
cord-269867-k10siwur	180	52	disease	disease	NN
cord-269867-k10siwur	180	53	virus	virus	NN
cord-269867-k10siwur	180	54	Permissive	permissive	JJ
cord-269867-k10siwur	180	55	sites	site	NNS
cord-269867-k10siwur	180	56	and	and	CC
cord-269867-k10siwur	180	57	topology	topology	NN
cord-269867-k10siwur	180	58	of	of	IN
cord-269867-k10siwur	180	59	an	an	DT
cord-269867-k10siwur	180	60	outer	outer	JJ
cord-269867-k10siwur	180	61	membrane	membrane	NN
cord-269867-k10siwur	180	62	protein	protein	NN
cord-269867-k10siwur	180	63	with	with	IN
cord-269867-k10siwur	180	64	a	a	DT
cord-269867-k10siwur	180	65	reporter	reporter	NN
cord-269867-k10siwur	180	66	epitope	epitope	NN
cord-269867-k10siwur	180	67	Localization	localization	NN
cord-269867-k10siwur	180	68	of	of	IN
cord-269867-k10siwur	180	69	antigenic	antigenic	JJ
cord-269867-k10siwur	180	70	sites	site	NNS
cord-269867-k10siwur	180	71	of	of	IN
cord-269867-k10siwur	180	72	the	the	DT
cord-269867-k10siwur	180	73	E2	E2	NNP
cord-269867-k10siwur	180	74	glycoprotein	glycoprotein	NN
cord-269867-k10siwur	180	75	of	of	IN
cord-269867-k10siwur	180	76	transmissible	transmissible	JJ
cord-269867-k10siwur	180	77	gastroenteritis	gastroenteritis	NN
cord-269867-k10siwur	180	78	coronavirus	coronavirus	NN
cord-269867-k10siwur	181	1	Four	four	CD
cord-269867-k10siwur	181	2	major	major	JJ
cord-269867-k10siwur	181	3	antigenic	antigenic	JJ
cord-269867-k10siwur	181	4	sites	site	NNS
cord-269867-k10siwur	181	5	of	of	IN
cord-269867-k10siwur	181	6	the	the	DT
cord-269867-k10siwur	181	7	coronavirus	coronavirus	NN
cord-269867-k10siwur	181	8	transmissible	transmissible	JJ
cord-269867-k10siwur	181	9	gastroenteritis	gastroenteritis	NN
cord-269867-k10siwur	181	10	virus	virus	NN
cord-269867-k10siwur	181	11	are	be	VBP
cord-269867-k10siwur	181	12	located	locate	VBN
cord-269867-k10siwur	181	13	on	on	IN
cord-269867-k10siwur	181	14	the	the	DT
cord-269867-k10siwur	181	15	amino	amino	NN
cord-269867-k10siwur	181	16	-	-	HYPH
cord-269867-k10siwur	181	17	terminal	terminal	NN
cord-269867-k10siwur	181	18	half	half	NN
cord-269867-k10siwur	181	19	of	of	IN
cord-269867-k10siwur	181	20	spike	spike	NN
cord-269867-k10siwur	181	21	protein	protein	NN
cord-269867-k10siwur	181	22	Site	site	NN
cord-269867-k10siwur	181	23	-	-	HYPH
cord-269867-k10siwur	181	24	directed	direct	VBN
cord-269867-k10siwur	181	25	mutagenesis	mutagenesis	NN
cord-269867-k10siwur	181	26	of	of	IN
cord-269867-k10siwur	181	27	virtually	virtually	RB
cord-269867-k10siwur	181	28	any	any	DT
cord-269867-k10siwur	181	29	plasmid	plasmid	NN
cord-269867-k10siwur	181	30	by	by	IN
cord-269867-k10siwur	181	31	eliminating	eliminate	VBG
cord-269867-k10siwur	181	32	a	a	DT
cord-269867-k10siwur	181	33	unique	unique	JJ
cord-269867-k10siwur	181	34	site	site	NN
cord-269867-k10siwur	181	35	Permissible	permissible	JJ
cord-269867-k10siwur	181	36	peptide	peptide	NN
cord-269867-k10siwur	181	37	insertions	insertion	NNS
cord-269867-k10siwur	181	38	surrounding	surround	VBG
cord-269867-k10siwur	181	39	the	the	DT
cord-269867-k10siwur	181	40	signal	signal	JJ
cord-269867-k10siwur	181	41	peptide	peptide	NN
cord-269867-k10siwur	181	42	-	-	HYPH
cord-269867-k10siwur	181	43	mature	mature	JJ
cord-269867-k10siwur	181	44	protein	protein	NN
cord-269867-k10siwur	181	45	junction	junction	NN
cord-269867-k10siwur	181	46	of	of	IN
cord-269867-k10siwur	181	47	the	the	DT
cord-269867-k10siwur	181	48	CIpG	CIpG	NNP
cord-269867-k10siwur	181	49	prepilin	prepilin	NN
cord-269867-k10siwur	181	50	:	:	:
cord-269867-k10siwur	181	51	CS31A	CS31A	NNP
cord-269867-k10siwur	181	52	fimbriae	fimbriae	NNP
cord-269867-k10siwur	181	53	of	of	IN
cord-269867-k10siwur	181	54	Escherichia	Escherichia	NNP
cord-269867-k10siwur	181	55	coli	coli	NNS
cord-269867-k10siwur	181	56	as	as	IN
cord-269867-k10siwur	181	57	carriers	carrier	NNS
cord-269867-k10siwur	181	58	of	of	IN
cord-269867-k10siwur	181	59	foreign	foreign	JJ
cord-269867-k10siwur	181	60	sequences	sequence	NNS
cord-269867-k10siwur	181	61	Residues	residue	NNS
cord-269867-k10siwur	181	62	involved	involve	VBN
cord-269867-k10siwur	181	63	in	in	IN
cord-269867-k10siwur	181	64	the	the	DT
cord-269867-k10siwur	181	65	formation	formation	NN
cord-269867-k10siwur	181	66	of	of	IN
cord-269867-k10siwur	181	67	the	the	DT
cord-269867-k10siwur	181	68	antigenic	antigenic	JJ
cord-269867-k10siwur	181	69	sites	site	NNS
cord-269867-k10siwur	181	70	of	of	IN
cord-269867-k10siwur	181	71	the	the	DT
cord-269867-k10siwur	181	72	S	S	NNP
cord-269867-k10siwur	181	73	protein	protein	NN
cord-269867-k10siwur	181	74	of	of	IN
cord-269867-k10siwur	181	75	transmissible	transmissible	JJ
cord-269867-k10siwur	181	76	gastroenteritis	gastroenteritis	JJ
cord-269867-k10siwur	181	77	coronavirus	coronavirus	NN
cord-269867-k10siwur	181	78	Sequence	sequence	NN
cord-269867-k10siwur	181	79	analysis	analysis	NN
cord-269867-k10siwur	181	80	of	of	IN
cord-269867-k10siwur	181	81	the	the	DT
cord-269867-k10siwur	181	82	clpG	clpG	NNS
cord-269867-k10siwur	181	83	gene	gene	NN
cord-269867-k10siwur	181	84	,	,	,
cord-269867-k10siwur	181	85	which	which	WDT
cord-269867-k10siwur	181	86	codes	code	VBZ
cord-269867-k10siwur	181	87	for	for	IN
cord-269867-k10siwur	181	88	surface	surface	NN
cord-269867-k10siwur	181	89	antigen	antigen	NNP
cord-269867-k10siwur	181	90	CS31A	cs31a	NN
cord-269867-k10siwur	181	91	subunit	subunit	NN
cord-269867-k10siwur	181	92	:	:	:
cord-269867-k10siwur	181	93	evidence	evidence	NN
cord-269867-k10siwur	181	94	of	of	IN
cord-269867-k10siwur	181	95	an	an	DT
cord-269867-k10siwur	181	96	evolutionary	evolutionary	JJ
cord-269867-k10siwur	181	97	relationship	relationship	NN
cord-269867-k10siwur	181	98	between	between	IN
cord-269867-k10siwur	181	99	CS31A	cs31a	NN
cord-269867-k10siwur	181	100	,	,	,
cord-269867-k10siwur	181	101	K88	K88	NNP
cord-269867-k10siwur	181	102	and	and	CC
cord-269867-k10siwur	181	103	F41	F41	NNP
cord-269867-k10siwur	181	104	subunit	subunit	NN
cord-269867-k10siwur	181	105	genes	gene	NNS
cord-269867-k10siwur	181	106	CS31A	cs31a	NN
cord-269867-k10siwur	181	107	,	,	,
cord-269867-k10siwur	181	108	a	a	DT
cord-269867-k10siwur	181	109	new	new	JJ
cord-269867-k10siwur	181	110	K88-related	K88-related	NNP
cord-269867-k10siwur	181	111	fimbrial	fimbrial	JJ
cord-269867-k10siwur	181	112	antigen	antigen	NN
cord-269867-k10siwur	181	113	on	on	IN
cord-269867-k10siwur	181	114	bovine	bovine	JJ
cord-269867-k10siwur	181	115	enterotoxigenic	enterotoxigenic	NNP
cord-269867-k10siwur	181	116	and	and	CC
cord-269867-k10siwur	181	117	septicemic	septicemic	JJ
cord-269867-k10siwur	181	118	Escherichia	Escherichia	NNP
cord-269867-k10siwur	181	119	coli	coli	VBZ
cord-269867-k10siwur	181	120	strains	strain	NNS
cord-269867-k10siwur	182	1	A	a	DT
cord-269867-k10siwur	182	2	simple	simple	JJ
cord-269867-k10siwur	182	3	and	and	CC
cord-269867-k10siwur	182	4	efficient	efficient	JJ
cord-269867-k10siwur	182	5	method	method	NN
cord-269867-k10siwur	182	6	for	for	IN
cord-269867-k10siwur	182	7	the	the	DT
cord-269867-k10siwur	182	8	oligodeoxyribonucleotide	oligodeoxyribonucleotide	NN
cord-269867-k10siwur	182	9	-	-	HYPH
cord-269867-k10siwur	182	10	directed	direct	VBN
cord-269867-k10siwur	182	11	mutagenesis	mutagenesis	NN
cord-269867-k10siwur	182	12	of	of	IN
cord-269867-k10siwur	182	13	double	double	RB
cord-269867-k10siwur	182	14	-	-	HYPH
cord-269867-k10siwur	182	15	stranded	strand	VBN
cord-269867-k10siwur	182	16	plasmid	plasmid	NN
cord-269867-k10siwur	182	17	DNA	DNA	NNP
cord-269867-k10siwur	182	18	Construction	Construction	NNP
cord-269867-k10siwur	182	19	,	,	,
cord-269867-k10siwur	182	20	expression	expression	NN
cord-269867-k10siwur	182	21	and	and	CC
cord-269867-k10siwur	182	22	immunogenicity	immunogenicity	NN
cord-269867-k10siwur	182	23	of	of	IN
cord-269867-k10siwur	182	24	multiple	multiple	JJ
cord-269867-k10siwur	182	25	tandem	tandem	NN
cord-269867-k10siwur	182	26	copies	copy	NNS
cord-269867-k10siwur	182	27	of	of	IN
cord-269867-k10siwur	182	28	the	the	DT
cord-269867-k10siwur	182	29	Schistosoma	Schistosoma	NNP
cord-269867-k10siwur	182	30	mansoni	mansoni	NN
cord-269867-k10siwur	182	31	peptide	peptide	NN
cord-269867-k10siwur	182	32	115	115	CD
cord-269867-k10siwur	182	33	-	-	SYM
cord-269867-k10siwur	182	34	131	131	CD
cord-269867-k10siwur	182	35	of	of	IN
cord-269867-k10siwur	182	36	the	the	DT
cord-269867-k10siwur	182	37	P28	P28	NNP
cord-269867-k10siwur	182	38	glutathione	glutathione	NN
cord-269867-k10siwur	182	39	S	s	NN
cord-269867-k10siwur	182	40	-	-	HYPH
cord-269867-k10siwur	182	41	transferase	transferase	NNP
cord-269867-k10siwur	182	42	expressed	express	VBD
cord-269867-k10siwur	182	43	as	as	IN
cord-269867-k10siwur	182	44	C	c	NN
cord-269867-k10siwur	182	45	-	-	HYPH
cord-269867-k10siwur	182	46	terminal	terminal	NN
cord-269867-k10siwur	182	47	fusions	fusion	NNS
cord-269867-k10siwur	182	48	to	to	IN
cord-269867-k10siwur	182	49	tetanus	tetanus	NN
cord-269867-k10siwur	182	50	toxin	toxin	NN
cord-269867-k10siwur	182	51	fragment	fragment	NN
cord-269867-k10siwur	182	52	C	c	NN
cord-269867-k10siwur	182	53	in	in	IN
cord-269867-k10siwur	182	54	a	a	DT
cord-269867-k10siwur	182	55	live	live	JJ
cord-269867-k10siwur	182	56	Aro	aro	RB
cord-269867-k10siwur	182	57	-	-	HYPH
cord-269867-k10siwur	182	58	attenuated	attenuated	JJ
cord-269867-k10siwur	182	59	vaccine	vaccine	NN
cord-269867-k10siwur	182	60	strain	strain	NN
cord-269867-k10siwur	182	61	of	of	IN
cord-269867-k10siwur	182	62	Salmonella	Salmonella	NNP
cord-269867-k10siwur	182	63	Expression	Expression	NNP
cord-269867-k10siwur	182	64	of	of	IN
cord-269867-k10siwur	182	65	heterologous	heterologous	JJ
cord-269867-k10siwur	182	66	peptides	peptide	NNS
cord-269867-k10siwur	182	67	at	at	IN
cord-269867-k10siwur	182	68	two	two	CD
cord-269867-k10siwur	182	69	permissive	permissive	JJ
cord-269867-k10siwur	182	70	sites	site	NNS
cord-269867-k10siwur	182	71	of	of	IN
cord-269867-k10siwur	182	72	the	the	DT
cord-269867-k10siwur	182	73	MalE	MalE	NNP
cord-269867-k10siwur	182	74	protein	protein	NN
cord-269867-k10siwur	182	75	:	:	:
cord-269867-k10siwur	182	76	antigenicity	antigenicity	NN
cord-269867-k10siwur	182	77	and	and	CC
cord-269867-k10siwur	182	78	immunogenicity	immunogenicity	NN
cord-269867-k10siwur	182	79	of	of	IN
cord-269867-k10siwur	182	80	foreign	foreign	JJ
cord-269867-k10siwur	182	81	B	b	NN
cord-269867-k10siwur	182	82	-	-	HYPH
cord-269867-k10siwur	182	83	cell	cell	NN
cord-269867-k10siwur	182	84	and	and	CC
cord-269867-k10siwur	182	85	T	t	NN
cord-269867-k10siwur	182	86	-	-	HYPH
cord-269867-k10siwur	182	87	cell	cell	NN
cord-269867-k10siwur	182	88	epitopes	epitope	NNS
cord-269867-k10siwur	182	89	Hydrophobic	hydrophobic	JJ
cord-269867-k10siwur	182	90	cluster	cluster	NN
cord-269867-k10siwur	182	91	analysis	analysis	NN
cord-269867-k10siwur	182	92	and	and	CC
cord-269867-k10siwur	182	93	secondary	secondary	JJ
cord-269867-k10siwur	182	94	structure	structure	NN
cord-269867-k10siwur	182	95	predictions	prediction	NNS
cord-269867-k10siwur	182	96	revealed	reveal	VBD
cord-269867-k10siwur	182	97	that	that	IN
cord-269867-k10siwur	182	98	major	major	JJ
cord-269867-k10siwur	182	99	and	and	CC
cord-269867-k10siwur	182	100	minor	minor	JJ
cord-269867-k10siwur	182	101	structural	structural	JJ
cord-269867-k10siwur	182	102	subunits	subunit	NNS
cord-269867-k10siwur	182	103	of	of	IN
cord-269867-k10siwur	182	104	K88-related	K88-related	NNP
cord-269867-k10siwur	182	105	adhesins	adhesin	NNS
cord-269867-k10siwur	182	106	of	of	IN
cord-269867-k10siwur	182	107	Escherichia	Escherichia	NNP
cord-269867-k10siwur	182	108	coli	coli	NNS
cord-269867-k10siwur	182	109	share	share	VBP
cord-269867-k10siwur	182	110	a	a	DT
cord-269867-k10siwur	182	111	common	common	JJ
cord-269867-k10siwur	182	112	overall	overall	JJ
cord-269867-k10siwur	182	113	fold	fold	NN
cord-269867-k10siwur	182	114	and	and	CC
cord-269867-k10siwur	182	115	differ	differ	VBP
cord-269867-k10siwur	182	116	structurally	structurally	RB
cord-269867-k10siwur	182	117	from	from	IN
cord-269867-k10siwur	182	118	other	other	JJ
cord-269867-k10siwur	182	119	fimbrial	fimbrial	JJ
cord-269867-k10siwur	182	120	subunits	subunit	NNS
cord-269867-k10siwur	182	121	Role	role	NN
cord-269867-k10siwur	182	122	of	of	IN
cord-269867-k10siwur	182	123	proteolytic	proteolytic	JJ
cord-269867-k10siwur	182	124	processing	processing	NN
cord-269867-k10siwur	182	125	of	of	IN
cord-269867-k10siwur	182	126	viral	viral	JJ
cord-269867-k10siwur	182	127	envelope	envelope	NN
cord-269867-k10siwur	182	128	glycoproteins	glycoprotein	NNS
cord-269867-k10siwur	182	129	Vaccine	Vaccine	NNP
cord-269867-k10siwur	182	130	technologies	technology	NNS
cord-269867-k10siwur	182	131	:	:	:
cord-269867-k10siwur	183	1	view	view	VB
cord-269867-k10siwur	183	2	to	to	IN
cord-269867-k10siwur	183	3	the	the	DT
cord-269867-k10siwur	183	4	future	future	JJ
cord-269867-k10siwur	183	5	DNA	dna	NN
cord-269867-k10siwur	183	6	sequencing	sequencing	NN
cord-269867-k10siwur	183	7	with	with	IN
cord-269867-k10siwur	183	8	chain	chain	NN
cord-269867-k10siwur	183	9	-	-	HYPH
cord-269867-k10siwur	183	10	terminating	terminate	VBG
cord-269867-k10siwur	183	11	inhibitors	inhibitor	NNS
cord-269867-k10siwur	183	12	Efficiency	Efficiency	NNP
cord-269867-k10siwur	183	13	oligonucleotide	oligonucleotide	RB
cord-269867-k10siwur	183	14	-	-	HYPH
cord-269867-k10siwur	183	15	directed	direct	VBN
cord-269867-k10siwur	183	16	construction	construction	NN
cord-269867-k10siwur	183	17	of	of	IN
cord-269867-k10siwur	183	18	mutations	mutation	NNS
cord-269867-k10siwur	183	19	in	in	IN
cord-269867-k10siwur	183	20	expression	expression	NN
cord-269867-k10siwur	183	21	vectors	vector	NNS
cord-269867-k10siwur	183	22	by	by	IN
cord-269867-k10siwur	183	23	the	the	DT
cord-269867-k10siwur	183	24	gapped	gap	VBN
cord-269867-k10siwur	183	25	duplex	duplex	NN
cord-269867-k10siwur	183	26	DNA	dna	NN
cord-269867-k10siwur	183	27	method	method	NN
cord-269867-k10siwur	183	28	using	use	VBG
cord-269867-k10siwur	183	29	alternative	alternative	JJ
cord-269867-k10siwur	183	30	selectable	selectable	JJ
cord-269867-k10siwur	183	31	markers	marker	NNS
cord-269867-k10siwur	183	32	Immunoreactivity	Immunoreactivity	NNP
cord-269867-k10siwur	183	33	of	of	IN
cord-269867-k10siwur	183	34	chimeric	chimeric	JJ
cord-269867-k10siwur	183	35	proteins	protein	NNS
cord-269867-k10siwur	183	36	carrying	carry	VBG
cord-269867-k10siwur	183	37	the	the	DT
cord-269867-k10siwur	183	38	HIV-1	HIV-1	NNP
cord-269867-k10siwur	183	39	epitope	epitope	NN
cord-269867-k10siwur	183	40	IGPGRAF	IGPGRAF	NNP
cord-269867-k10siwur	183	41	:	:	:
cord-269867-k10siwur	183	42	correlation	correlation	NN
cord-269867-k10siwur	183	43	between	between	IN
cord-269867-k10siwur	183	44	predicted	predict	VBN
cord-269867-k10siwur	183	45	conformation	conformation	NN
cord-269867-k10siwur	183	46	and	and	CC
cord-269867-k10siwur	183	47	antigenicity	antigenicity	NN
cord-269867-k10siwur	183	48	Electrophoretic	electrophoretic	JJ
cord-269867-k10siwur	183	49	transfer	transfer	NN
cord-269867-k10siwur	183	50	of	of	IN
cord-269867-k10siwur	183	51	proteins	protein	NNS
cord-269867-k10siwur	183	52	from	from	IN
cord-269867-k10siwur	183	53	polyacrylamide	polyacrylamide	JJ
cord-269867-k10siwur	183	54	gels	gel	NNS
cord-269867-k10siwur	183	55	to	to	IN
cord-269867-k10siwur	183	56	nitrocellulose	nitrocellulose	NN
cord-269867-k10siwur	183	57	sheet	sheet	NN
cord-269867-k10siwur	183	58	:	:	:
cord-269867-k10siwur	183	59	procedure	procedure	NN
cord-269867-k10siwur	183	60	and	and	CC
cord-269867-k10siwur	183	61	some	some	DT
cord-269867-k10siwur	183	62	applications	application	NNS