id	sid	tid	token	lemma	pos
cord-275413-e2rhioty	1	1	key	key	JJ
cord-275413-e2rhioty	1	2	:	:	:
cord-275413-e2rhioty	1	3	cord-275413-e2rhioty	cord-275413-e2rhioty	NNP
cord-275413-e2rhioty	1	4	authors	author	NNS
cord-275413-e2rhioty	1	5	:	:	:
cord-275413-e2rhioty	1	6	Rowland	Rowland	NNP
cord-275413-e2rhioty	1	7	,	,	,
cord-275413-e2rhioty	1	8	Raymond	Raymond	NNP
cord-275413-e2rhioty	1	9	R.R.	R.R.	NNP
cord-275413-e2rhioty	1	10	title	title	NN
cord-275413-e2rhioty	1	11	:	:	:
cord-275413-e2rhioty	2	1	The	the	DT
cord-275413-e2rhioty	2	2	interaction	interaction	NN
cord-275413-e2rhioty	2	3	between	between	IN
cord-275413-e2rhioty	2	4	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	2	5	and	and	CC
cord-275413-e2rhioty	2	6	the	the	DT
cord-275413-e2rhioty	2	7	late	late	JJ
cord-275413-e2rhioty	2	8	gestation	gestation	NN
cord-275413-e2rhioty	2	9	pig	pig	NN
cord-275413-e2rhioty	2	10	fetus	fetus	NN
cord-275413-e2rhioty	2	11	date	date	NN
cord-275413-e2rhioty	2	12	:	:	:
cord-275413-e2rhioty	2	13	2010	2010	CD
cord-275413-e2rhioty	2	14	-	-	SYM
cord-275413-e2rhioty	2	15	09	09	CD
cord-275413-e2rhioty	2	16	-	-	HYPH
cord-275413-e2rhioty	2	17	09	09	CD
cord-275413-e2rhioty	2	18	journal	journal	NN
cord-275413-e2rhioty	2	19	:	:	:
cord-275413-e2rhioty	3	1	Virus	virus	NN
cord-275413-e2rhioty	3	2	Res	Res	NNP
cord-275413-e2rhioty	3	3	DOI	doi	NN
cord-275413-e2rhioty	3	4	:	:	:
cord-275413-e2rhioty	3	5	10.1016/	10.1016/	CD
cord-275413-e2rhioty	4	1	j.virusres.2010.09.001	j.virusres.2010.09.001	NNP
cord-275413-e2rhioty	4	2	sha	sha	NNP
cord-275413-e2rhioty	4	3	:	:	:
cord-275413-e2rhioty	5	1	e6e47cc241431c90ddcefa5583b526a7bf4cab0d	e6e47cc241431c90ddcefa5583b526a7bf4cab0d	NNP
cord-275413-e2rhioty	5	2	doc_id	doc_id	NNPS
cord-275413-e2rhioty	5	3	:	:	:
cord-275413-e2rhioty	6	1	275413	275413	CD
cord-275413-e2rhioty	7	1	cord_uid	cord_uid	NN
cord-275413-e2rhioty	7	2	:	:	:
cord-275413-e2rhioty	8	1	e2rhioty	e2rhioty	NNP
cord-275413-e2rhioty	8	2	Porcine	porcine	JJ
cord-275413-e2rhioty	8	3	reproductive	reproductive	JJ
cord-275413-e2rhioty	8	4	and	and	CC
cord-275413-e2rhioty	8	5	respiratory	respiratory	JJ
cord-275413-e2rhioty	8	6	syndrome	syndrome	NN
cord-275413-e2rhioty	8	7	virus	virus	NN
cord-275413-e2rhioty	8	8	(	(	-LRB-
cord-275413-e2rhioty	8	9	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	8	10	)	)	-RRB-
cord-275413-e2rhioty	8	11	crosses	cross	VBZ
cord-275413-e2rhioty	8	12	the	the	DT
cord-275413-e2rhioty	8	13	placenta	placenta	NN
cord-275413-e2rhioty	8	14	during	during	IN
cord-275413-e2rhioty	8	15	late	late	JJ
cord-275413-e2rhioty	8	16	gestation	gestation	NN
cord-275413-e2rhioty	8	17	and	and	CC
cord-275413-e2rhioty	8	18	productively	productively	RB
cord-275413-e2rhioty	8	19	infects	infect	VBZ
cord-275413-e2rhioty	8	20	the	the	DT
cord-275413-e2rhioty	8	21	fetus	fetus	NN
cord-275413-e2rhioty	8	22	.	.	.
cord-275413-e2rhioty	9	1	Virus	virus	NN
cord-275413-e2rhioty	9	2	replication	replication	NN
cord-275413-e2rhioty	9	3	and	and	CC
cord-275413-e2rhioty	9	4	cytokine	cytokine	NN
cord-275413-e2rhioty	9	5	responses	response	NNS
cord-275413-e2rhioty	9	6	were	be	VBD
cord-275413-e2rhioty	9	7	measured	measure	VBN
cord-275413-e2rhioty	9	8	in	in	IN
cord-275413-e2rhioty	9	9	tissues	tissue	NNS
cord-275413-e2rhioty	9	10	of	of	IN
cord-275413-e2rhioty	9	11	fetuses	fetus	NNS
cord-275413-e2rhioty	9	12	recovered	recover	VBN
cord-275413-e2rhioty	9	13	at	at	IN
cord-275413-e2rhioty	9	14	109–112	109–112	CD
cord-275413-e2rhioty	9	15	days	day	NNS
cord-275413-e2rhioty	9	16	of	of	IN
cord-275413-e2rhioty	9	17	gestation	gestation	NN
cord-275413-e2rhioty	9	18	,	,	,
cord-275413-e2rhioty	9	19	just	just	RB
cord-275413-e2rhioty	9	20	prior	prior	RB
cord-275413-e2rhioty	9	21	to	to	IN
cord-275413-e2rhioty	9	22	parturition	parturition	NN
cord-275413-e2rhioty	9	23	.	.	.
cord-275413-e2rhioty	10	1	At	at	IN
cord-275413-e2rhioty	10	2	the	the	DT
cord-275413-e2rhioty	10	3	time	time	NN
cord-275413-e2rhioty	10	4	of	of	IN
cord-275413-e2rhioty	10	5	recovery	recovery	NN
cord-275413-e2rhioty	10	6	,	,	,
cord-275413-e2rhioty	10	7	gross	gross	JJ
cord-275413-e2rhioty	10	8	anatomical	anatomical	JJ
cord-275413-e2rhioty	10	9	abnormalities	abnormality	NNS
cord-275413-e2rhioty	10	10	were	be	VBD
cord-275413-e2rhioty	10	11	evident	evident	JJ
cord-275413-e2rhioty	10	12	in	in	IN
cord-275413-e2rhioty	10	13	both	both	CC
cord-275413-e2rhioty	10	14	infected	infected	JJ
cord-275413-e2rhioty	10	15	and	and	CC
cord-275413-e2rhioty	10	16	non	non	JJ
cord-275413-e2rhioty	10	17	-	-	JJ
cord-275413-e2rhioty	10	18	infected	infected	JJ
cord-275413-e2rhioty	10	19	fetuses	fetus	NNS
cord-275413-e2rhioty	10	20	from	from	IN
cord-275413-e2rhioty	10	21	the	the	DT
cord-275413-e2rhioty	10	22	infected	infected	JJ
cord-275413-e2rhioty	10	23	dams	dam	NNS
cord-275413-e2rhioty	10	24	.	.	.
cord-275413-e2rhioty	11	1	Virus	virus	NN
cord-275413-e2rhioty	11	2	isolation	isolation	NN
cord-275413-e2rhioty	11	3	and	and	CC
cord-275413-e2rhioty	11	4	immunohistochemistry	immunohistochemistry	NN
cord-275413-e2rhioty	11	5	identified	identify	VBD
cord-275413-e2rhioty	11	6	the	the	DT
cord-275413-e2rhioty	11	7	thymus	thymus	NN
cord-275413-e2rhioty	11	8	as	as	IN
cord-275413-e2rhioty	11	9	the	the	DT
cord-275413-e2rhioty	11	10	primary	primary	JJ
cord-275413-e2rhioty	11	11	site	site	NN
cord-275413-e2rhioty	11	12	of	of	IN
cord-275413-e2rhioty	11	13	virus	virus	NN
cord-275413-e2rhioty	11	14	replication	replication	NN
cord-275413-e2rhioty	11	15	.	.	.
cord-275413-e2rhioty	12	1	Steady	steady	JJ
cord-275413-e2rhioty	12	2	state	state	NN
cord-275413-e2rhioty	12	3	RT	RT	NNP
cord-275413-e2rhioty	12	4	-	-	HYPH
cord-275413-e2rhioty	12	5	PCR	PCR	NNP
cord-275413-e2rhioty	12	6	amplification	amplification	NN
cord-275413-e2rhioty	12	7	of	of	IN
cord-275413-e2rhioty	12	8	inflammatory	inflammatory	JJ
cord-275413-e2rhioty	12	9	,	,	,
cord-275413-e2rhioty	12	10	Th1	th1	NN
cord-275413-e2rhioty	12	11	and	and	CC
cord-275413-e2rhioty	12	12	Th2	th2	CD
cord-275413-e2rhioty	12	13	cytokines	cytokine	NNS
cord-275413-e2rhioty	12	14	,	,	,
cord-275413-e2rhioty	12	15	showed	show	VBD
cord-275413-e2rhioty	12	16	elevated	elevate	VBN
cord-275413-e2rhioty	12	17	IFN	IFN	NNP
cord-275413-e2rhioty	12	18	-	-	HYPH
cord-275413-e2rhioty	12	19	γ	γ	NNP
cord-275413-e2rhioty	12	20	and	and	CC
cord-275413-e2rhioty	12	21	TNF	TNF	NNP
cord-275413-e2rhioty	12	22	-	-	HYPH
cord-275413-e2rhioty	12	23	α	α	NNP
cord-275413-e2rhioty	12	24	mRNAs	mrna	NNS
cord-275413-e2rhioty	12	25	in	in	IN
cord-275413-e2rhioty	12	26	tissues	tissue	NNS
cord-275413-e2rhioty	12	27	from	from	IN
cord-275413-e2rhioty	12	28	infected	infected	JJ
cord-275413-e2rhioty	12	29	fetuses	fetus	NNS
cord-275413-e2rhioty	12	30	,	,	,
cord-275413-e2rhioty	12	31	which	which	WDT
cord-275413-e2rhioty	12	32	corresponded	correspond	VBD
cord-275413-e2rhioty	12	33	to	to	IN
cord-275413-e2rhioty	12	34	elevated	elevated	JJ
cord-275413-e2rhioty	12	35	cytokine	cytokine	NN
cord-275413-e2rhioty	12	36	proteins	protein	NNS
cord-275413-e2rhioty	12	37	in	in	IN
cord-275413-e2rhioty	12	38	serum	serum	NN
cord-275413-e2rhioty	12	39	but	but	CC
cord-275413-e2rhioty	12	40	not	not	RB
cord-275413-e2rhioty	12	41	amniotic	amniotic	NN
cord-275413-e2rhioty	12	42	fluid	fluid	NN
cord-275413-e2rhioty	12	43	.	.	.
cord-275413-e2rhioty	13	1	Further	further	JJ
cord-275413-e2rhioty	13	2	evidence	evidence	NN
cord-275413-e2rhioty	13	3	for	for	IN
cord-275413-e2rhioty	13	4	induction	induction	NN
cord-275413-e2rhioty	13	5	of	of	IN
cord-275413-e2rhioty	13	6	immunity	immunity	NN
cord-275413-e2rhioty	13	7	was	be	VBD
cord-275413-e2rhioty	13	8	found	find	VBN
cord-275413-e2rhioty	13	9	in	in	IN
cord-275413-e2rhioty	13	10	the	the	DT
cord-275413-e2rhioty	13	11	hyperplastic	hyperplastic	JJ
cord-275413-e2rhioty	13	12	response	response	NN
cord-275413-e2rhioty	13	13	of	of	IN
cord-275413-e2rhioty	13	14	lymph	lymph	NN
cord-275413-e2rhioty	13	15	nodes	node	NNS
cord-275413-e2rhioty	13	16	,	,	,
cord-275413-e2rhioty	13	17	which	which	WDT
cord-275413-e2rhioty	13	18	included	include	VBD
cord-275413-e2rhioty	13	19	the	the	DT
cord-275413-e2rhioty	13	20	development	development	NN
cord-275413-e2rhioty	13	21	of	of	IN
cord-275413-e2rhioty	13	22	germinal	germinal	JJ
cord-275413-e2rhioty	13	23	centers	center	NNS
cord-275413-e2rhioty	13	24	occupied	occupy	VBD
cord-275413-e2rhioty	13	25	CDw75	CDw75	NNS
cord-275413-e2rhioty	13	26	+	+	CC
cord-275413-e2rhioty	13	27	B	b	NN
cord-275413-e2rhioty	13	28	cells	cell	NNS
cord-275413-e2rhioty	13	29	.	.	.
cord-275413-e2rhioty	14	1	Collectively	collectively	RB
cord-275413-e2rhioty	14	2	,	,	,
cord-275413-e2rhioty	14	3	these	these	DT
cord-275413-e2rhioty	14	4	data	datum	NNS
cord-275413-e2rhioty	14	5	support	support	VBP
cord-275413-e2rhioty	14	6	the	the	DT
cord-275413-e2rhioty	14	7	notion	notion	NN
cord-275413-e2rhioty	14	8	that	that	IN
cord-275413-e2rhioty	14	9	the	the	DT
cord-275413-e2rhioty	14	10	immunocompetent	immunocompetent	JJ
cord-275413-e2rhioty	14	11	fetus	fetus	NN
cord-275413-e2rhioty	14	12	is	be	VBZ
cord-275413-e2rhioty	14	13	capable	capable	JJ
cord-275413-e2rhioty	14	14	of	of	IN
cord-275413-e2rhioty	14	15	initiating	initiate	VBG
cord-275413-e2rhioty	14	16	an	an	DT
cord-275413-e2rhioty	14	17	antiviral	antiviral	JJ
cord-275413-e2rhioty	14	18	response	response	NN
cord-275413-e2rhioty	14	19	,	,	,
cord-275413-e2rhioty	14	20	which	which	WDT
cord-275413-e2rhioty	14	21	is	be	VBZ
cord-275413-e2rhioty	14	22	compartmentalized	compartmentalize	VBN
cord-275413-e2rhioty	14	23	within	within	IN
cord-275413-e2rhioty	14	24	the	the	DT
cord-275413-e2rhioty	14	25	infected	infected	JJ
cord-275413-e2rhioty	14	26	fetus	fetus	NN
cord-275413-e2rhioty	14	27	.	.	.
cord-275413-e2rhioty	15	1	Furthermore	furthermore	RB
cord-275413-e2rhioty	15	2	,	,	,
cord-275413-e2rhioty	15	3	fetal	fetal	JJ
cord-275413-e2rhioty	15	4	pathology	pathology	NN
cord-275413-e2rhioty	15	5	may	may	MD
cord-275413-e2rhioty	15	6	not	not	RB
cord-275413-e2rhioty	15	7	be	be	VB
cord-275413-e2rhioty	15	8	a	a	DT
cord-275413-e2rhioty	15	9	direct	direct	JJ
cord-275413-e2rhioty	15	10	result	result	NN
cord-275413-e2rhioty	15	11	of	of	IN
cord-275413-e2rhioty	15	12	virus	virus	NN
cord-275413-e2rhioty	15	13	replication	replication	NN
cord-275413-e2rhioty	15	14	in	in	IN
cord-275413-e2rhioty	15	15	the	the	DT
cord-275413-e2rhioty	15	16	fetus	fetus	NN
cord-275413-e2rhioty	15	17	.	.	.
cord-275413-e2rhioty	16	1	Porcine	porcine	JJ
cord-275413-e2rhioty	16	2	reproductive	reproductive	JJ
cord-275413-e2rhioty	16	3	and	and	CC
cord-275413-e2rhioty	16	4	respiratory	respiratory	JJ
cord-275413-e2rhioty	16	5	syndrome	syndrome	NN
cord-275413-e2rhioty	16	6	(	(	-LRB-
cord-275413-e2rhioty	16	7	PRRS	PRRS	NNP
cord-275413-e2rhioty	16	8	)	)	-RRB-
cord-275413-e2rhioty	16	9	is	be	VBZ
cord-275413-e2rhioty	16	10	caused	cause	VBN
cord-275413-e2rhioty	16	11	by	by	IN
cord-275413-e2rhioty	16	12	an	an	DT
cord-275413-e2rhioty	16	13	enveloped	envelop	VBN
cord-275413-e2rhioty	16	14	positive	positive	JJ
cord-275413-e2rhioty	16	15	-	-	HYPH
cord-275413-e2rhioty	16	16	stranded	strand	VBN
cord-275413-e2rhioty	16	17	RNA	RNA	NNP
cord-275413-e2rhioty	16	18	virus	virus	NN
cord-275413-e2rhioty	16	19	,	,	,
cord-275413-e2rhioty	16	20	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	16	21	,	,	,
cord-275413-e2rhioty	16	22	belonging	belong	VBG
cord-275413-e2rhioty	16	23	to	to	IN
cord-275413-e2rhioty	16	24	the	the	DT
cord-275413-e2rhioty	16	25	family	family	NN
cord-275413-e2rhioty	16	26	Arteriviridae	Arteriviridae	NNP
cord-275413-e2rhioty	16	27	Cavanagh	Cavanagh	NNP
cord-275413-e2rhioty	16	28	,	,	,
cord-275413-e2rhioty	16	29	1997	1997	CD
cord-275413-e2rhioty	16	30	;	;	:
cord-275413-e2rhioty	16	31	Nelsen	Nelsen	NNP
cord-275413-e2rhioty	16	32	et	et	NNP
cord-275413-e2rhioty	16	33	al	al	NNP
cord-275413-e2rhioty	16	34	.	.	NNP
cord-275413-e2rhioty	16	35	,	,	,
cord-275413-e2rhioty	16	36	1999	1999	CD
cord-275413-e2rhioty	16	37	;	;	:
cord-275413-e2rhioty	16	38	Wensvoort	Wensvoort	NNP
cord-275413-e2rhioty	16	39	et	et	NNP
cord-275413-e2rhioty	16	40	al	al	NNP
cord-275413-e2rhioty	16	41	.	.	NNP
cord-275413-e2rhioty	16	42	,	,	,
cord-275413-e2rhioty	16	43	1991	1991	CD
cord-275413-e2rhioty	16	44	)	)	-RRB-
cord-275413-e2rhioty	16	45	.	.	.
cord-275413-e2rhioty	17	1	Other	other	JJ
cord-275413-e2rhioty	17	2	members	member	NNS
cord-275413-e2rhioty	17	3	of	of	IN
cord-275413-e2rhioty	17	4	the	the	DT
cord-275413-e2rhioty	17	5	arterivirus	arterivirus	NNP
cord-275413-e2rhioty	17	6	group	group	NN
cord-275413-e2rhioty	17	7	include	include	VBP
cord-275413-e2rhioty	17	8	lactate	lactate	NN
cord-275413-e2rhioty	17	9	dehydrogenase	dehydrogenase	NN
cord-275413-e2rhioty	17	10	-	-	HYPH
cord-275413-e2rhioty	17	11	elevating	elevate	VBG
cord-275413-e2rhioty	17	12	virus	virus	NN
cord-275413-e2rhioty	17	13	(	(	-LRB-
cord-275413-e2rhioty	17	14	LDV	LDV	NNP
cord-275413-e2rhioty	17	15	)	)	-RRB-
cord-275413-e2rhioty	17	16	of	of	IN
cord-275413-e2rhioty	17	17	mice	mouse	NNS
cord-275413-e2rhioty	17	18	,	,	,
cord-275413-e2rhioty	17	19	equine	equine	JJ
cord-275413-e2rhioty	17	20	arteritis	arteritis	NN
cord-275413-e2rhioty	17	21	virus	virus	NN
cord-275413-e2rhioty	17	22	(	(	-LRB-
cord-275413-e2rhioty	17	23	EAV	EAV	NNP
cord-275413-e2rhioty	17	24	)	)	-RRB-
cord-275413-e2rhioty	17	25	,	,	,
cord-275413-e2rhioty	17	26	and	and	CC
cord-275413-e2rhioty	17	27	simian	simian	JJ
cord-275413-e2rhioty	17	28	hemorrhagic	hemorrhagic	JJ
cord-275413-e2rhioty	17	29	fever	fever	NN
cord-275413-e2rhioty	17	30	virus	virus	NN
cord-275413-e2rhioty	17	31	(	(	-LRB-
cord-275413-e2rhioty	17	32	SHFV	SHFV	NNP
cord-275413-e2rhioty	17	33	;	;	:
cord-275413-e2rhioty	17	34	for	for	IN
cord-275413-e2rhioty	17	35	review	review	NN
cord-275413-e2rhioty	17	36	see	see	VBP
cord-275413-e2rhioty	17	37	Plagemann	Plagemann	NNP
cord-275413-e2rhioty	17	38	,	,	,
cord-275413-e2rhioty	17	39	1996	1996	CD
cord-275413-e2rhioty	17	40	)	)	-RRB-
cord-275413-e2rhioty	17	41	.	.	.
cord-275413-e2rhioty	18	1	The	the	DT
cord-275413-e2rhioty	18	2	arteriviruses	arteriviruse	NNS
cord-275413-e2rhioty	18	3	,	,	,
cord-275413-e2rhioty	18	4	toroviruses	toroviruses	NNP
cord-275413-e2rhioty	18	5	,	,	,
cord-275413-e2rhioty	18	6	roniviruses	roniviruses	NNP
cord-275413-e2rhioty	18	7	and	and	CC
cord-275413-e2rhioty	18	8	coronaviruses	coronaviruse	NNS
cord-275413-e2rhioty	18	9	form	form	VBP
cord-275413-e2rhioty	18	10	a	a	DT
cord-275413-e2rhioty	18	11	single	single	JJ
cord-275413-e2rhioty	18	12	order	order	NN
cord-275413-e2rhioty	18	13	,	,	,
cord-275413-e2rhioty	18	14	Nidovirales	Nidovirales	NNP
cord-275413-e2rhioty	18	15	.	.	.
cord-275413-e2rhioty	19	1	Arteriviruses	Arteriviruses	NNP
cord-275413-e2rhioty	19	2	structurally	structurally	RB
cord-275413-e2rhioty	19	3	resemble	resemble	VBP
cord-275413-e2rhioty	19	4	togaviruses	togaviruse	NNS
cord-275413-e2rhioty	19	5	,	,	,
cord-275413-e2rhioty	19	6	but	but	CC
cord-275413-e2rhioty	19	7	similar	similar	JJ
cord-275413-e2rhioty	19	8	to	to	IN
cord-275413-e2rhioty	19	9	coronaviruses	coronaviruse	NNS
cord-275413-e2rhioty	19	10	,	,	,
cord-275413-e2rhioty	19	11	replicate	replicate	VB
cord-275413-e2rhioty	19	12	via	via	IN
cord-275413-e2rhioty	19	13	a	a	DT
cord-275413-e2rhioty	19	14	nested	nested	JJ
cord-275413-e2rhioty	19	15	3	3	CD
cord-275413-e2rhioty	19	16	-co	-co	NN
cord-275413-e2rhioty	19	17	-	-	HYPH
cord-275413-e2rhioty	19	18	terminal	terminal	NN
cord-275413-e2rhioty	19	19	set	set	NN
cord-275413-e2rhioty	19	20	of	of	IN
cord-275413-e2rhioty	19	21	subgenomic	subgenomic	NNP
cord-275413-e2rhioty	19	22	mRNAs	mRNAs	NNPS
cord-275413-e2rhioty	19	23	that	that	WDT
cord-275413-e2rhioty	19	24	possesses	possess	VBZ
cord-275413-e2rhioty	19	25	a	a	DT
cord-275413-e2rhioty	19	26	common	common	JJ
cord-275413-e2rhioty	19	27	leader	leader	NN
cord-275413-e2rhioty	19	28	and	and	CC
cord-275413-e2rhioty	19	29	a	a	DT
cord-275413-e2rhioty	19	30	poly	poly	JJ
cord-275413-e2rhioty	19	31	-	-	HYPH
cord-275413-e2rhioty	19	32	A	a	DT
cord-275413-e2rhioty	19	33	tail	tail	NN
cord-275413-e2rhioty	19	34	(	(	-LRB-
cord-275413-e2rhioty	19	35	reviewed	review	VBN
cord-275413-e2rhioty	19	36	in	in	IN
cord-275413-e2rhioty	19	37	Snijder	Snijder	NNP
cord-275413-e2rhioty	19	38	and	and	CC
cord-275413-e2rhioty	19	39	Mulenberg	Mulenberg	NNP
cord-275413-e2rhioty	19	40	,	,	,
cord-275413-e2rhioty	19	41	1998	1998	CD
cord-275413-e2rhioty	19	42	)	)	-RRB-
cord-275413-e2rhioty	19	43	.	.	.
cord-275413-e2rhioty	20	1	The	the	DT
cord-275413-e2rhioty	20	2	arteriviruses	arteriviruse	NNS
cord-275413-e2rhioty	20	3	exhibit	exhibit	VBP
cord-275413-e2rhioty	20	4	several	several	JJ
cord-275413-e2rhioty	20	5	important	important	JJ
cord-275413-e2rhioty	20	6	properties	property	NNS
cord-275413-e2rhioty	20	7	relevant	relevant	JJ
cord-275413-e2rhioty	20	8	to	to	IN
cord-275413-e2rhioty	20	9	the	the	DT
cord-275413-e2rhioty	20	10	study	study	NN
cord-275413-e2rhioty	20	11	of	of	IN
cord-275413-e2rhioty	20	12	viral	viral	JJ
cord-275413-e2rhioty	20	13	pathogenesis	pathogenesis	NN
cord-275413-e2rhioty	20	14	,	,	,
cord-275413-e2rhioty	20	15	including	include	VBG
cord-275413-e2rhioty	20	16	cytopathic	cytopathic	JJ
cord-275413-e2rhioty	20	17	replication	replication	NN
cord-275413-e2rhioty	20	18	in	in	IN
cord-275413-e2rhioty	20	19	macrophages	macrophage	NNS
cord-275413-e2rhioty	20	20	,	,	,
cord-275413-e2rhioty	20	21	the	the	DT
cord-275413-e2rhioty	20	22	capacity	capacity	NN
cord-275413-e2rhioty	20	23	to	to	TO
cord-275413-e2rhioty	20	24	establish	establish	VB
cord-275413-e2rhioty	20	25	and	and	CC
cord-275413-e2rhioty	20	26	maintain	maintain	VB
cord-275413-e2rhioty	20	27	an	an	DT
cord-275413-e2rhioty	20	28	asymptomatic	asymptomatic	JJ
cord-275413-e2rhioty	20	29	infec	infec	NN
cord-275413-e2rhioty	20	30	-	-	HYPH
cord-275413-e2rhioty	20	31	tion	tion	NN
cord-275413-e2rhioty	20	32	,	,	,
cord-275413-e2rhioty	20	33	as	as	RB
cord-275413-e2rhioty	20	34	well	well	RB
cord-275413-e2rhioty	20	35	as	as	IN
cord-275413-e2rhioty	20	36	cause	cause	NN
cord-275413-e2rhioty	20	37	severe	severe	JJ
cord-275413-e2rhioty	20	38	and	and	CC
cord-275413-e2rhioty	20	39	fatal	fatal	JJ
cord-275413-e2rhioty	20	40	disease	disease	NN
cord-275413-e2rhioty	20	41	(	(	-LRB-
cord-275413-e2rhioty	20	42	Plagemann	Plagemann	NNP
cord-275413-e2rhioty	20	43	,	,	,
cord-275413-e2rhioty	20	44	1996	1996	CD
cord-275413-e2rhioty	20	45	)	)	-RRB-
cord-275413-e2rhioty	20	46	.	.	.
cord-275413-e2rhioty	21	1	Infection	infection	NN
cord-275413-e2rhioty	21	2	of	of	IN
cord-275413-e2rhioty	21	3	adult	adult	NN
cord-275413-e2rhioty	21	4	pigs	pig	NNS
cord-275413-e2rhioty	21	5	with	with	IN
cord-275413-e2rhioty	21	6	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	21	7	usually	usually	RB
cord-275413-e2rhioty	21	8	produces	produce	VBZ
cord-275413-e2rhioty	21	9	a	a	DT
cord-275413-e2rhioty	21	10	non	non	JJ
cord-275413-e2rhioty	21	11	-	-	JJ
cord-275413-e2rhioty	21	12	fatal	fatal	JJ
cord-275413-e2rhioty	21	13	disease	disease	NN
cord-275413-e2rhioty	21	14	,	,	,
cord-275413-e2rhioty	21	15	characterized	characterize	VBN
cord-275413-e2rhioty	21	16	by	by	IN
cord-275413-e2rhioty	21	17	flu	flu	NN
cord-275413-e2rhioty	21	18	-	-	HYPH
cord-275413-e2rhioty	21	19	like	like	JJ
cord-275413-e2rhioty	21	20	symptoms	symptom	NNS
cord-275413-e2rhioty	21	21	,	,	,
cord-275413-e2rhioty	21	22	a	a	DT
cord-275413-e2rhioty	21	23	transient	transient	JJ
cord-275413-e2rhioty	21	24	elevation	elevation	NN
cord-275413-e2rhioty	21	25	in	in	IN
cord-275413-e2rhioty	21	26	temperature	temperature	NN
cord-275413-e2rhioty	21	27	and	and	CC
cord-275413-e2rhioty	21	28	inappetance	inappetance	NN
cord-275413-e2rhioty	21	29	(	(	-LRB-
cord-275413-e2rhioty	21	30	reviewed	review	VBN
cord-275413-e2rhioty	21	31	in	in	IN
cord-275413-e2rhioty	21	32	Benfield	Benfield	NNP
cord-275413-e2rhioty	21	33	et	et	NNP
cord-275413-e2rhioty	21	34	al	al	NNP
cord-275413-e2rhioty	21	35	.	.	NNP
cord-275413-e2rhioty	21	36	,	,	,
cord-275413-e2rhioty	21	37	1999	1999	CD
cord-275413-e2rhioty	21	38	;	;	:
cord-275413-e2rhioty	21	39	Christianson	Christianson	NNP
cord-275413-e2rhioty	21	40	et	et	NNP
cord-275413-e2rhioty	21	41	al	al	NNP
cord-275413-e2rhioty	21	42	.	.	NNP
cord-275413-e2rhioty	21	43	,	,	,
cord-275413-e2rhioty	21	44	1992	1992	CD
cord-275413-e2rhioty	21	45	)	)	-RRB-
cord-275413-e2rhioty	21	46	.	.	.
cord-275413-e2rhioty	22	1	The	the	DT
cord-275413-e2rhioty	22	2	reproductive	reproductive	JJ
cord-275413-e2rhioty	22	3	form	form	NN
cord-275413-e2rhioty	22	4	of	of	IN
cord-275413-e2rhioty	22	5	PRRS	PRRS	NNP
cord-275413-e2rhioty	22	6	occurs	occur	VBZ
cord-275413-e2rhioty	22	7	following	follow	VBG
cord-275413-e2rhioty	22	8	the	the	DT
cord-275413-e2rhioty	22	9	infection	infection	NN
cord-275413-e2rhioty	22	10	of	of	IN
cord-275413-e2rhioty	22	11	late	late	JJ
cord-275413-e2rhioty	22	12	gestation	gestation	NN
cord-275413-e2rhioty	22	13	pregnant	pregnant	JJ
cord-275413-e2rhioty	22	14	gilts	gilt	NNS
cord-275413-e2rhioty	22	15	or	or	CC
cord-275413-e2rhioty	22	16	sows	sow	NNS
cord-275413-e2rhioty	22	17	.	.	.
cord-275413-e2rhioty	23	1	Natural	natural	JJ
cord-275413-e2rhioty	23	2	infection	infection	NN
cord-275413-e2rhioty	23	3	of	of	IN
cord-275413-e2rhioty	23	4	the	the	DT
cord-275413-e2rhioty	23	5	fetus	fetus	NN
cord-275413-e2rhioty	23	6	with	with	IN
cord-275413-e2rhioty	23	7	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	23	8	is	be	VBZ
cord-275413-e2rhioty	23	9	initiated	initiate	VBN
cord-275413-e2rhioty	23	10	with	with	IN
cord-275413-e2rhioty	23	11	the	the	DT
cord-275413-e2rhioty	23	12	infection	infection	NN
cord-275413-e2rhioty	23	13	of	of	IN
cord-275413-e2rhioty	23	14	gilts	gilt	NNS
cord-275413-e2rhioty	23	15	and	and	CC
cord-275413-e2rhioty	23	16	sows	sow	NNS
cord-275413-e2rhioty	23	17	at	at	IN
cord-275413-e2rhioty	23	18	90	90	CD
cord-275413-e2rhioty	23	19	days	day	NNS
cord-275413-e2rhioty	23	20	gestation	gestation	NN
cord-275413-e2rhioty	23	21	.	.	.
cord-275413-e2rhioty	24	1	After	after	IN
cord-275413-e2rhioty	24	2	productive	productive	JJ
cord-275413-e2rhioty	24	3	replication	replication	NN
cord-275413-e2rhioty	24	4	on	on	IN
cord-275413-e2rhioty	24	5	the	the	DT
cord-275413-e2rhioty	24	6	maternal	maternal	JJ
cord-275413-e2rhioty	24	7	side	side	NN
cord-275413-e2rhioty	24	8	,	,	,
cord-275413-e2rhioty	24	9	the	the	DT
cord-275413-e2rhioty	24	10	virus	virus	NN
cord-275413-e2rhioty	24	11	crosses	cross	VBZ
cord-275413-e2rhioty	24	12	the	the	DT
cord-275413-e2rhioty	24	13	placenta	placenta	NN
cord-275413-e2rhioty	24	14	and	and	CC
cord-275413-e2rhioty	24	15	productively	productively	RB
cord-275413-e2rhioty	24	16	infects	infect	VBZ
cord-275413-e2rhioty	24	17	the	the	DT
cord-275413-e2rhioty	24	18	fetus	fetus	NN
cord-275413-e2rhioty	24	19	.	.	.
cord-275413-e2rhioty	25	1	The	the	DT
cord-275413-e2rhioty	25	2	mechanism	mechanism	NN
cord-275413-e2rhioty	25	3	of	of	IN
cord-275413-e2rhioty	25	4	transplacental	transplacental	NNP
cord-275413-e2rhioty	25	5	infection	infection	NN
cord-275413-e2rhioty	25	6	is	be	VBZ
cord-275413-e2rhioty	25	7	unknown	unknown	JJ
cord-275413-e2rhioty	25	8	,	,	,
cord-275413-e2rhioty	25	9	but	but	CC
cord-275413-e2rhioty	25	10	could	could	MD
cord-275413-e2rhioty	25	11	be	be	VB
cord-275413-e2rhioty	25	12	similar	similar	JJ
cord-275413-e2rhioty	25	13	to	to	IN
cord-275413-e2rhioty	25	14	the	the	DT
cord-275413-e2rhioty	25	15	infected	infected	JJ
cord-275413-e2rhioty	25	16	"	"	``
cord-275413-e2rhioty	25	17	Trojan	Trojan	NNP
cord-275413-e2rhioty	25	18	Horse	Horse	NNP
cord-275413-e2rhioty	25	19	"	"	''
cord-275413-e2rhioty	25	20	macrophage	macrophage	NN
cord-275413-e2rhioty	25	21	,	,	,
cord-275413-e2rhioty	25	22	described	describe	VBN
cord-275413-e2rhioty	25	23	for	for	IN
cord-275413-e2rhioty	25	24	LDV	LDV	NNP
cord-275413-e2rhioty	25	25	(	(	-LRB-
cord-275413-e2rhioty	25	26	Cafruny	Cafruny	NNP
cord-275413-e2rhioty	25	27	and	and	CC
cord-275413-e2rhioty	25	28	Bradley	Bradley	NNP
cord-275413-e2rhioty	25	29	,	,	,
cord-275413-e2rhioty	25	30	1996	1996	CD
cord-275413-e2rhioty	25	31	)	)	-RRB-
cord-275413-e2rhioty	25	32	.	.	.
cord-275413-e2rhioty	26	1	Since	since	IN
cord-275413-e2rhioty	26	2	the	the	DT
cord-275413-e2rhioty	26	3	pig	pig	NN
cord-275413-e2rhioty	26	4	fetus	fetus	NN
cord-275413-e2rhioty	26	5	becomes	become	VBZ
cord-275413-e2rhioty	26	6	immunocompetent	immunocompetent	JJ
cord-275413-e2rhioty	26	7	at	at	IN
cord-275413-e2rhioty	26	8	about	about	RB
cord-275413-e2rhioty	26	9	70	70	CD
cord-275413-e2rhioty	26	10	days	day	NNS
cord-275413-e2rhioty	26	11	of	of	IN
cord-275413-e2rhioty	26	12	gestation	gestation	NN
cord-275413-e2rhioty	26	13	,	,	,
cord-275413-e2rhioty	26	14	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	26	15	infection	infection	NN
cord-275413-e2rhioty	26	16	occurs	occur	VBZ
cord-275413-e2rhioty	26	17	in	in	IN
cord-275413-e2rhioty	26	18	an	an	DT
cord-275413-e2rhioty	26	19	immune	immune	JJ
cord-275413-e2rhioty	26	20	environment	environment	NN
cord-275413-e2rhioty	26	21	containing	contain	VBG
cord-275413-e2rhioty	26	22	functional	functional	JJ
cord-275413-e2rhioty	26	23	B	b	NN
cord-275413-e2rhioty	26	24	and	and	CC
cord-275413-e2rhioty	26	25	T	t	NN
cord-275413-e2rhioty	26	26	cells	cell	NNS
cord-275413-e2rhioty	26	27	.	.	.
cord-275413-e2rhioty	27	1	Accordingly	accordingly	RB
cord-275413-e2rhioty	27	2	,	,	,
cord-275413-e2rhioty	27	3	virus	virus	NN
cord-275413-e2rhioty	27	4	-	-	HYPH
cord-275413-e2rhioty	27	5	induced	induce	VBN
cord-275413-e2rhioty	27	6	reproductive	reproductive	JJ
cord-275413-e2rhioty	27	7	failure	failure	NN
cord-275413-e2rhioty	27	8	can	can	MD
cord-275413-e2rhioty	27	9	present	present	VB
cord-275413-e2rhioty	27	10	clinically	clinically	RB
cord-275413-e2rhioty	27	11	as	as	IN
cord-275413-e2rhioty	27	12	delayed	delay	VBN
cord-275413-e2rhioty	27	13	returns	return	NNS
cord-275413-e2rhioty	27	14	to	to	IN
cord-275413-e2rhioty	27	15	estrus	estrus	NN
cord-275413-e2rhioty	27	16	,	,	,
cord-275413-e2rhioty	27	17	as	as	RB
cord-275413-e2rhioty	27	18	well	well	RB
cord-275413-e2rhioty	27	19	as	as	IN
cord-275413-e2rhioty	27	20	abortions	abortion	NNS
cord-275413-e2rhioty	27	21	,	,	,
cord-275413-e2rhioty	27	22	mummified	mummified	JJ
cord-275413-e2rhioty	27	23	fetuses	fetus	NNS
cord-275413-e2rhioty	27	24	,	,	,
cord-275413-e2rhioty	27	25	stillborn	stillborn	JJ
cord-275413-e2rhioty	27	26	and	and	CC
cord-275413-e2rhioty	27	27	weak	weak	JJ
cord-275413-e2rhioty	27	28	-	-	HYPH
cord-275413-e2rhioty	27	29	born	bear	VBN
cord-275413-e2rhioty	27	30	pigs	pig	NNS
cord-275413-e2rhioty	27	31	Christianson	Christianson	NNP
cord-275413-e2rhioty	27	32	et	et	NNP
cord-275413-e2rhioty	27	33	al	al	NNP
cord-275413-e2rhioty	27	34	.	.	NNP
cord-275413-e2rhioty	27	35	,	,	,
cord-275413-e2rhioty	27	36	1993	1993	CD
cord-275413-e2rhioty	27	37	;	;	:
cord-275413-e2rhioty	27	38	Collins	Collins	NNP
cord-275413-e2rhioty	27	39	et	et	NNP
cord-275413-e2rhioty	27	40	al	al	NNP
cord-275413-e2rhioty	27	41	.	.	NNP
cord-275413-e2rhioty	27	42	,	,	,
cord-275413-e2rhioty	27	43	1992	1992	CD
cord-275413-e2rhioty	27	44	;	;	:
cord-275413-e2rhioty	27	45	Mengeling	Mengeling	NNP
cord-275413-e2rhioty	27	46	et	et	FW
cord-275413-e2rhioty	27	47	al	al	NNP
cord-275413-e2rhioty	27	48	.	.	NNP
cord-275413-e2rhioty	27	49	,	,	,
cord-275413-e2rhioty	27	50	1994	1994	CD
cord-275413-e2rhioty	27	51	;	;	.
cord-275413-e2rhioty	28	1	Rossow	Rossow	NNP
cord-275413-e2rhioty	28	2	et	et	NNP
cord-275413-e2rhioty	28	3	al	al	NNP
cord-275413-e2rhioty	28	4	.	.	NNP
cord-275413-e2rhioty	28	5	,	,	,
cord-275413-e2rhioty	28	6	1999	1999	CD
cord-275413-e2rhioty	28	7	;	;	:
cord-275413-e2rhioty	28	8	Rowland	Rowland	NNP
cord-275413-e2rhioty	28	9	et	et	NNP
cord-275413-e2rhioty	28	10	al	al	NNP
cord-275413-e2rhioty	28	11	.	.	NNP
cord-275413-e2rhioty	28	12	,	,	,
cord-275413-e2rhioty	28	13	2003	2003	CD
cord-275413-e2rhioty	28	14	)	)	-RRB-
cord-275413-e2rhioty	28	15	.	.	.
cord-275413-e2rhioty	29	1	Surviving	survive	VBG
cord-275413-e2rhioty	29	2	neonates	neonate	NNS
cord-275413-e2rhioty	29	3	can	can	MD
cord-275413-e2rhioty	29	4	exhibit	exhibit	VB
cord-275413-e2rhioty	29	5	the	the	DT
cord-275413-e2rhioty	29	6	severest	severe	JJS
cord-275413-e2rhioty	29	7	form	form	NN
cord-275413-e2rhioty	29	8	of	of	IN
cord-275413-e2rhioty	29	9	respiratory	respiratory	JJ
cord-275413-e2rhioty	29	10	disease	disease	NN
cord-275413-e2rhioty	29	11	with	with	IN
cord-275413-e2rhioty	29	12	mortality	mortality	NN
cord-275413-e2rhioty	29	13	sometimes	sometimes	RB
cord-275413-e2rhioty	29	14	reaching	reach	VBG
cord-275413-e2rhioty	29	15	100	100	CD
cord-275413-e2rhioty	29	16	%	%	NN
cord-275413-e2rhioty	29	17	within	within	IN
cord-275413-e2rhioty	29	18	three	three	CD
cord-275413-e2rhioty	29	19	weeks	week	NNS
cord-275413-e2rhioty	29	20	after	after	IN
cord-275413-e2rhioty	29	21	birth	birth	NN
cord-275413-e2rhioty	30	1	(	(	-LRB-
cord-275413-e2rhioty	30	2	Feng	Feng	NNP
cord-275413-e2rhioty	30	3	et	et	FW
cord-275413-e2rhioty	30	4	al	al	NNP
cord-275413-e2rhioty	30	5	.	.	NNP
cord-275413-e2rhioty	30	6	,	,	,
cord-275413-e2rhioty	30	7	2001	2001	CD
cord-275413-e2rhioty	30	8	;	;	:
cord-275413-e2rhioty	31	1	Rossow	Rossow	NNP
cord-275413-e2rhioty	31	2	et	et	NNP
cord-275413-e2rhioty	31	3	al	al	NNP
cord-275413-e2rhioty	31	4	.	.	.
cord-275413-e2rhioty	32	1	,	,	,
cord-275413-e2rhioty	32	2	1994	1994	CD
cord-275413-e2rhioty	32	3	;	;	:
cord-275413-e2rhioty	32	4	Rossow	Rossow	NNP
cord-275413-e2rhioty	32	5	,	,	,
cord-275413-e2rhioty	32	6	1998	1998	CD
cord-275413-e2rhioty	32	7	)	)	-RRB-
cord-275413-e2rhioty	32	8	.	.	.
cord-275413-e2rhioty	33	1	The	the	DT
cord-275413-e2rhioty	33	2	complex	complex	JJ
cord-275413-e2rhioty	33	3	pathology	pathology	NN
cord-275413-e2rhioty	33	4	following	follow	VBG
cord-275413-e2rhioty	33	5	exposure	exposure	NN
cord-275413-e2rhioty	33	6	to	to	IN
cord-275413-e2rhioty	33	7	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	33	8	in	in	IN
cord-275413-e2rhioty	33	9	utero	utero	NN
cord-275413-e2rhioty	33	10	represents	represent	VBZ
cord-275413-e2rhioty	33	11	a	a	DT
cord-275413-e2rhioty	33	12	unique	unique	JJ
cord-275413-e2rhioty	33	13	form	form	NN
cord-275413-e2rhioty	33	14	of	of	IN
cord-275413-e2rhioty	33	15	the	the	DT
cord-275413-e2rhioty	33	16	disease	disease	NN
cord-275413-e2rhioty	33	17	referred	refer	VBD
cord-275413-e2rhioty	33	18	to	to	IN
cord-275413-e2rhioty	33	19	as	as	IN
cord-275413-e2rhioty	33	20	congenital	congenital	JJ
cord-275413-e2rhioty	33	21	PRRS	PRRS	NNP
cord-275413-e2rhioty	34	1	(	(	-LRB-
cord-275413-e2rhioty	34	2	Rowland	Rowland	NNP
cord-275413-e2rhioty	34	3	et	et	NNP
cord-275413-e2rhioty	34	4	al	al	NNP
cord-275413-e2rhioty	34	5	.	.	NNP
cord-275413-e2rhioty	34	6	,	,	,
cord-275413-e2rhioty	34	7	2003	2003	CD
cord-275413-e2rhioty	34	8	)	)	-RRB-
cord-275413-e2rhioty	34	9	.	.	.
cord-275413-e2rhioty	35	1	The	the	DT
cord-275413-e2rhioty	35	2	purpose	purpose	NN
cord-275413-e2rhioty	35	3	of	of	IN
cord-275413-e2rhioty	35	4	this	this	DT
cord-275413-e2rhioty	35	5	study	study	NN
cord-275413-e2rhioty	35	6	was	be	VBD
cord-275413-e2rhioty	35	7	to	to	TO
cord-275413-e2rhioty	35	8	characterize	characterize	VB
cord-275413-e2rhioty	35	9	the	the	DT
cord-275413-e2rhioty	35	10	interaction	interaction	NN
cord-275413-e2rhioty	35	11	between	between	IN
cord-275413-e2rhioty	35	12	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	35	13	and	and	CC
cord-275413-e2rhioty	35	14	the	the	DT
cord-275413-e2rhioty	35	15	pig	pig	NN
cord-275413-e2rhioty	35	16	fetus	fetus	NN
cord-275413-e2rhioty	35	17	by	by	IN
cord-275413-e2rhioty	35	18	(	(	-LRB-
cord-275413-e2rhioty	35	19	1	1	CD
cord-275413-e2rhioty	35	20	)	)	-RRB-
cord-275413-e2rhioty	35	21	identifying	identify	VBG
cord-275413-e2rhioty	35	22	sites	site	NNS
cord-275413-e2rhioty	35	23	of	of	IN
cord-275413-e2rhioty	35	24	virus	virus	NN
cord-275413-e2rhioty	35	25	replication	replication	NN
cord-275413-e2rhioty	35	26	,	,	,
cord-275413-e2rhioty	35	27	(	(	-LRB-
cord-275413-e2rhioty	35	28	2	2	LS
cord-275413-e2rhioty	35	29	)	)	-RRB-
cord-275413-e2rhioty	35	30	measuring	measure	VBG
cord-275413-e2rhioty	35	31	immune	immune	JJ
cord-275413-e2rhioty	35	32	and	and	CC
cord-275413-e2rhioty	35	33	inflammatory	inflammatory	JJ
cord-275413-e2rhioty	35	34	cytokines	cytokine	NNS
cord-275413-e2rhioty	35	35	in	in	IN
cord-275413-e2rhioty	35	36	different	different	JJ
cord-275413-e2rhioty	35	37	compartments	compartment	NNS
cord-275413-e2rhioty	35	38	,	,	,
cord-275413-e2rhioty	35	39	and	and	CC
cord-275413-e2rhioty	35	40	(	(	-LRB-
cord-275413-e2rhioty	35	41	3	3	LS
cord-275413-e2rhioty	35	42	)	)	-RRB-
cord-275413-e2rhioty	35	43	evaluating	evaluate	VBG
cord-275413-e2rhioty	35	44	the	the	DT
cord-275413-e2rhioty	35	45	response	response	NN
cord-275413-e2rhioty	35	46	of	of	IN
cord-275413-e2rhioty	35	47	lymph	lymph	NN
cord-275413-e2rhioty	35	48	nodes	node	NNS
cord-275413-e2rhioty	35	49	.	.	.
cord-275413-e2rhioty	36	1	Experiments	experiment	NNS
cord-275413-e2rhioty	36	2	involving	involve	VBG
cord-275413-e2rhioty	36	3	animals	animal	NNS
cord-275413-e2rhioty	36	4	were	be	VBD
cord-275413-e2rhioty	36	5	approved	approve	VBN
cord-275413-e2rhioty	36	6	by	by	IN
cord-275413-e2rhioty	36	7	the	the	DT
cord-275413-e2rhioty	36	8	Kansas	Kansas	NNP
cord-275413-e2rhioty	36	9	State	State	NNP
cord-275413-e2rhioty	36	10	University	University	NNP
cord-275413-e2rhioty	36	11	IACU	IACU	NNP
cord-275413-e2rhioty	36	12	Committee	Committee	NNP
cord-275413-e2rhioty	36	13	.	.	.
cord-275413-e2rhioty	37	1	Pregnant	pregnant	JJ
cord-275413-e2rhioty	37	2	sows	sow	NNS
cord-275413-e2rhioty	37	3	,	,	,
cord-275413-e2rhioty	37	4	obtained	obtain	VBN
cord-275413-e2rhioty	37	5	from	from	IN
cord-275413-e2rhioty	37	6	a	a	DT
cord-275413-e2rhioty	37	7	closely	closely	RB
cord-275413-e2rhioty	37	8	monitored	monitor	VBN
cord-275413-e2rhioty	37	9	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	37	10	-	-	HYPH
cord-275413-e2rhioty	37	11	negative	negative	JJ
cord-275413-e2rhioty	37	12	herd	herd	NN
cord-275413-e2rhioty	37	13	,	,	,
cord-275413-e2rhioty	37	14	were	be	VBD
cord-275413-e2rhioty	37	15	challenged	challenge	VBN
cord-275413-e2rhioty	37	16	at	at	IN
cord-275413-e2rhioty	37	17	90	90	CD
cord-275413-e2rhioty	37	18	days	day	NNS
cord-275413-e2rhioty	37	19	gestation	gestation	NN
cord-275413-e2rhioty	37	20	with	with	IN
cord-275413-e2rhioty	37	21	a	a	DT
cord-275413-e2rhioty	37	22	sixth	sixth	JJ
cord-275413-e2rhioty	37	23	passage	passage	NN
cord-275413-e2rhioty	37	24	isolate	isolate	NN
cord-275413-e2rhioty	37	25	of	of	IN
cord-275413-e2rhioty	37	26	SD-23983	SD-23983	NNS
cord-275413-e2rhioty	37	27	,	,	,
cord-275413-e2rhioty	37	28	a	a	DT
cord-275413-e2rhioty	37	29	typical	typical	JJ
cord-275413-e2rhioty	37	30	North	north	JJ
cord-275413-e2rhioty	37	31	American	american	JJ
cord-275413-e2rhioty	37	32	field	field	NN
cord-275413-e2rhioty	37	33	isolate	isolate	VBP
cord-275413-e2rhioty	37	34	(	(	-LRB-
cord-275413-e2rhioty	37	35	Rowland	Rowland	NNP
cord-275413-e2rhioty	37	36	et	et	NNP
cord-275413-e2rhioty	37	37	al	al	NNP
cord-275413-e2rhioty	37	38	.	.	NNP
cord-275413-e2rhioty	37	39	,	,	,
cord-275413-e2rhioty	37	40	2001	2001	CD
cord-275413-e2rhioty	37	41	)	)	-RRB-
cord-275413-e2rhioty	37	42	.	.	.
cord-275413-e2rhioty	38	1	The	the	DT
cord-275413-e2rhioty	38	2	methods	method	NNS
cord-275413-e2rhioty	38	3	for	for	IN
cord-275413-e2rhioty	38	4	the	the	DT
cord-275413-e2rhioty	38	5	preparation	preparation	NN
cord-275413-e2rhioty	38	6	of	of	IN
cord-275413-e2rhioty	38	7	the	the	DT
cord-275413-e2rhioty	38	8	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	38	9	inoculum	inoculum	NN
cord-275413-e2rhioty	38	10	on	on	IN
cord-275413-e2rhioty	38	11	MARC-145	MARC-145	NNP
cord-275413-e2rhioty	38	12	cells	cell	NNS
cord-275413-e2rhioty	38	13	and	and	CC
cord-275413-e2rhioty	38	14	infection	infection	NN
cord-275413-e2rhioty	38	15	of	of	IN
cord-275413-e2rhioty	38	16	pigs	pig	NNS
cord-275413-e2rhioty	38	17	are	be	VBP
cord-275413-e2rhioty	38	18	described	describe	VBN
cord-275413-e2rhioty	38	19	in	in	IN
cord-275413-e2rhioty	38	20	Rowland	Rowland	NNP
cord-275413-e2rhioty	38	21	et	et	NNP
cord-275413-e2rhioty	38	22	al	al	NNP
cord-275413-e2rhioty	38	23	.	.	.
cord-275413-e2rhioty	39	1	(	(	-LRB-
cord-275413-e2rhioty	39	2	2003	2003	CD
cord-275413-e2rhioty	39	3	)	)	-RRB-
cord-275413-e2rhioty	39	4	.	.	.
cord-275413-e2rhioty	40	1	Virus	virus	NN
cord-275413-e2rhioty	40	2	was	be	VBD
cord-275413-e2rhioty	40	3	cultivated	cultivate	VBN
cord-275413-e2rhioty	40	4	on	on	IN
cord-275413-e2rhioty	40	5	MARC-145	MARC-145	NNP
cord-275413-e2rhioty	40	6	cells	cell	NNS
cord-275413-e2rhioty	40	7	in	in	IN
cord-275413-e2rhioty	40	8	MEM	mem	NN
cord-275413-e2rhioty	40	9	supplemented	supplement	VBN
cord-275413-e2rhioty	40	10	with	with	IN
cord-275413-e2rhioty	40	11	antibiotics	antibiotic	NNS
cord-275413-e2rhioty	40	12	(	(	-LRB-
cord-275413-e2rhioty	40	13	pen	pen	NN
cord-275413-e2rhioty	40	14	/	/	SYM
cord-275413-e2rhioty	40	15	step	step	NN
cord-275413-e2rhioty	40	16	)	)	-RRB-
cord-275413-e2rhioty	40	17	and	and	CC
cord-275413-e2rhioty	40	18	7	7	CD
cord-275413-e2rhioty	40	19	%	%	NN
cord-275413-e2rhioty	40	20	FBS	FBS	NNP
cord-275413-e2rhioty	40	21	.	.	.
cord-275413-e2rhioty	41	1	Dams	dam	NNS
cord-275413-e2rhioty	41	2	,	,	,
cord-275413-e2rhioty	41	3	at	at	IN
cord-275413-e2rhioty	41	4	90	90	CD
cord-275413-e2rhioty	41	5	days	day	NNS
cord-275413-e2rhioty	41	6	gestation	gestation	NN
cord-275413-e2rhioty	41	7	were	be	VBD
cord-275413-e2rhioty	41	8	challenged	challenge	VBN
cord-275413-e2rhioty	41	9	with	with	IN
cord-275413-e2rhioty	41	10	approximately	approximately	RB
cord-275413-e2rhioty	41	11	10	10	CD
cord-275413-e2rhioty	41	12	5	5	CD
cord-275413-e2rhioty	41	13	TCID	TCID	NNP
cord-275413-e2rhioty	41	14	50	50	CD
cord-275413-e2rhioty	41	15	of	of	IN
cord-275413-e2rhioty	41	16	virus	virus	NN
cord-275413-e2rhioty	41	17	diluted	dilute	VBN
cord-275413-e2rhioty	41	18	in	in	IN
cord-275413-e2rhioty	41	19	5	5	CD
cord-275413-e2rhioty	41	20	ml	ml	NNS
cord-275413-e2rhioty	41	21	of	of	IN
cord-275413-e2rhioty	41	22	culture	culture	NN
cord-275413-e2rhioty	41	23	medium	medium	NN
cord-275413-e2rhioty	41	24	.	.	.
cord-275413-e2rhioty	42	1	One	one	CD
cord-275413-e2rhioty	42	2	half	half	NN
cord-275413-e2rhioty	42	3	of	of	IN
cord-275413-e2rhioty	42	4	the	the	DT
cord-275413-e2rhioty	42	5	inoculum	inoculum	NN
cord-275413-e2rhioty	42	6	was	be	VBD
cord-275413-e2rhioty	42	7	administered	administer	VBN
cord-275413-e2rhioty	42	8	by	by	IN
cord-275413-e2rhioty	42	9	intramuscular	intramuscular	JJ
cord-275413-e2rhioty	42	10	injection	injection	NN
cord-275413-e2rhioty	42	11	in	in	IN
cord-275413-e2rhioty	42	12	the	the	DT
cord-275413-e2rhioty	42	13	neck	neck	NN
cord-275413-e2rhioty	42	14	.	.	.
cord-275413-e2rhioty	43	1	The	the	DT
cord-275413-e2rhioty	43	2	remaining	remain	VBG
cord-275413-e2rhioty	43	3	dose	dose	NN
cord-275413-e2rhioty	43	4	was	be	VBD
cord-275413-e2rhioty	43	5	administered	administer	VBN
cord-275413-e2rhioty	43	6	intranasally	intranasally	RB
cord-275413-e2rhioty	43	7	.	.	.
cord-275413-e2rhioty	44	1	Mock	mock	JJ
cord-275413-e2rhioty	44	2	-	-	HYPH
cord-275413-e2rhioty	44	3	infected	infect	VBN
cord-275413-e2rhioty	44	4	sows	sow	NNS
cord-275413-e2rhioty	44	5	were	be	VBD
cord-275413-e2rhioty	44	6	challenged	challenge	VBN
cord-275413-e2rhioty	44	7	with	with	IN
cord-275413-e2rhioty	44	8	medium	medium	NN
cord-275413-e2rhioty	44	9	recovered	recover	VBN
cord-275413-e2rhioty	44	10	from	from	IN
cord-275413-e2rhioty	44	11	MARC-145	MARC-145	NNP
cord-275413-e2rhioty	44	12	cells	cell	NNS
cord-275413-e2rhioty	44	13	.	.	.
cord-275413-e2rhioty	45	1	Dams	dam	NNS
cord-275413-e2rhioty	45	2	were	be	VBD
cord-275413-e2rhioty	45	3	monitored	monitor	VBN
cord-275413-e2rhioty	45	4	for	for	IN
cord-275413-e2rhioty	45	5	clinical	clinical	JJ
cord-275413-e2rhioty	45	6	signs	sign	NNS
cord-275413-e2rhioty	45	7	and	and	CC
cord-275413-e2rhioty	45	8	blood	blood	NN
cord-275413-e2rhioty	45	9	collected	collect	VBD
cord-275413-e2rhioty	45	10	weekly	weekly	RB
cord-275413-e2rhioty	45	11	.	.	.
cord-275413-e2rhioty	46	1	At	at	IN
cord-275413-e2rhioty	46	2	between	between	IN
cord-275413-e2rhioty	46	3	109	109	CD
cord-275413-e2rhioty	46	4	and	and	CC
cord-275413-e2rhioty	46	5	112	112	CD
cord-275413-e2rhioty	46	6	days	day	NNS
cord-275413-e2rhioty	46	7	of	of	IN
cord-275413-e2rhioty	46	8	an	an	DT
cord-275413-e2rhioty	46	9	approximate	approximate	JJ
cord-275413-e2rhioty	46	10	114	114	CD
cord-275413-e2rhioty	46	11	days	day	NNS
cord-275413-e2rhioty	46	12	gestation	gestation	NN
cord-275413-e2rhioty	46	13	period	period	NN
cord-275413-e2rhioty	46	14	,	,	,
cord-275413-e2rhioty	46	15	the	the	DT
cord-275413-e2rhioty	46	16	dams	dam	NNS
cord-275413-e2rhioty	46	17	were	be	VBD
cord-275413-e2rhioty	46	18	euthanized	euthanize	VBN
cord-275413-e2rhioty	46	19	.	.	.
cord-275413-e2rhioty	47	1	The	the	DT
cord-275413-e2rhioty	47	2	uterine	uterine	JJ
cord-275413-e2rhioty	47	3	horns	horn	NNS
cord-275413-e2rhioty	47	4	were	be	VBD
cord-275413-e2rhioty	47	5	immediately	immediately	RB
cord-275413-e2rhioty	47	6	removed	remove	VBN
cord-275413-e2rhioty	47	7	and	and	CC
cord-275413-e2rhioty	47	8	the	the	DT
cord-275413-e2rhioty	47	9	individual	individual	JJ
cord-275413-e2rhioty	47	10	fetuses	fetus	NNS
cord-275413-e2rhioty	47	11	with	with	IN
cord-275413-e2rhioty	47	12	intact	intact	JJ
cord-275413-e2rhioty	47	13	placenta	placenta	NN
cord-275413-e2rhioty	47	14	were	be	VBD
cord-275413-e2rhioty	47	15	carefully	carefully	RB
cord-275413-e2rhioty	47	16	removed	remove	VBN
cord-275413-e2rhioty	47	17	and	and	CC
cord-275413-e2rhioty	47	18	immediately	immediately	RB
cord-275413-e2rhioty	47	19	necropsied	necropsied	JJ
cord-275413-e2rhioty	47	20	.	.	.
cord-275413-e2rhioty	48	1	A	a	DT
cord-275413-e2rhioty	48	2	sample	sample	NN
cord-275413-e2rhioty	48	3	of	of	IN
cord-275413-e2rhioty	48	4	amniotic	amniotic	NN
cord-275413-e2rhioty	48	5	fluid	fluid	NN
cord-275413-e2rhioty	48	6	was	be	VBD
cord-275413-e2rhioty	48	7	collected	collect	VBN
cord-275413-e2rhioty	48	8	prior	prior	RB
cord-275413-e2rhioty	48	9	to	to	IN
cord-275413-e2rhioty	48	10	removal	removal	NN
cord-275413-e2rhioty	48	11	.	.	.
cord-275413-e2rhioty	49	1	The	the	DT
cord-275413-e2rhioty	49	2	brachial	brachial	JJ
cord-275413-e2rhioty	49	3	artery	artery	NN
cord-275413-e2rhioty	49	4	of	of	IN
cord-275413-e2rhioty	49	5	each	each	DT
cord-275413-e2rhioty	49	6	fetus	fetus	NN
cord-275413-e2rhioty	49	7	was	be	VBD
cord-275413-e2rhioty	49	8	severed	sever	VBN
cord-275413-e2rhioty	49	9	and	and	CC
cord-275413-e2rhioty	49	10	blood	blood	NN
cord-275413-e2rhioty	49	11	collected	collect	VBN
cord-275413-e2rhioty	49	12	using	use	VBG
cord-275413-e2rhioty	49	13	a	a	DT
cord-275413-e2rhioty	49	14	disposable	disposable	JJ
cord-275413-e2rhioty	49	15	syringe	syringe	NN
cord-275413-e2rhioty	49	16	and	and	CC
cord-275413-e2rhioty	49	17	serum	serum	NN
cord-275413-e2rhioty	49	18	stored	store	VBN
cord-275413-e2rhioty	49	19	at	at	IN
cord-275413-e2rhioty	49	20	−80	−80	NNP
cord-275413-e2rhioty	50	1	•	•	NNP
cord-275413-e2rhioty	51	1	C.	C.	NNP
cord-275413-e2rhioty	51	2	Maternal	Maternal	NNP
cord-275413-e2rhioty	51	3	,	,	,
cord-275413-e2rhioty	51	4	accessory	accessory	NN
cord-275413-e2rhioty	51	5	and	and	CC
cord-275413-e2rhioty	51	6	fetal	fetal	JJ
cord-275413-e2rhioty	51	7	tissues	tissue	NNS
cord-275413-e2rhioty	51	8	were	be	VBD
cord-275413-e2rhioty	51	9	collected	collect	VBN
cord-275413-e2rhioty	51	10	and	and	CC
cord-275413-e2rhioty	51	11	stored	store	VBN
cord-275413-e2rhioty	51	12	in	in	IN
cord-275413-e2rhioty	51	13	formalin	formalin	NN
cord-275413-e2rhioty	51	14	for	for	IN
cord-275413-e2rhioty	51	15	histological	histological	JJ
cord-275413-e2rhioty	51	16	staining	staining	NN
cord-275413-e2rhioty	51	17	and	and	CC
cord-275413-e2rhioty	51	18	immunohistochemistry	immunohistochemistry	NN
cord-275413-e2rhioty	51	19	(	(	-LRB-
cord-275413-e2rhioty	51	20	IHC	IHC	NNP
cord-275413-e2rhioty	51	21	)	)	-RRB-
cord-275413-e2rhioty	51	22	,	,	,
cord-275413-e2rhioty	51	23	or	or	CC
cord-275413-e2rhioty	51	24	storage	storage	NN
cord-275413-e2rhioty	51	25	in	in	IN
cord-275413-e2rhioty	51	26	RNAlater	RNAlater	NNP
cord-275413-e2rhioty	51	27	(	(	-LRB-
cord-275413-e2rhioty	51	28	Ambion	Ambion	NNP
cord-275413-e2rhioty	51	29	)	)	-RRB-
cord-275413-e2rhioty	51	30	for	for	IN
cord-275413-e2rhioty	51	31	RT	RT	NNP
cord-275413-e2rhioty	51	32	-	-	HYPH
cord-275413-e2rhioty	51	33	PCR	PCR	NNP
cord-275413-e2rhioty	51	34	of	of	IN
cord-275413-e2rhioty	51	35	cytokine	cytokine	NN
cord-275413-e2rhioty	51	36	mRNAs	mrnas	ADD
cord-275413-e2rhioty	51	37	.	.	.
cord-275413-e2rhioty	52	1	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	52	2	-	-	HYPH
cord-275413-e2rhioty	52	3	specific	specific	JJ
cord-275413-e2rhioty	52	4	antibody	antibody	NN
cord-275413-e2rhioty	52	5	was	be	VBD
cord-275413-e2rhioty	52	6	measured	measure	VBN
cord-275413-e2rhioty	52	7	in	in	IN
cord-275413-e2rhioty	52	8	sera	sera	NNP
cord-275413-e2rhioty	52	9	using	use	VBG
cord-275413-e2rhioty	52	10	the	the	DT
cord-275413-e2rhioty	52	11	HerdCheck	HerdCheck	NNP
cord-275413-e2rhioty	52	12	®	®	POS
cord-275413-e2rhioty	52	13	PRRS	PRRS	NNP
cord-275413-e2rhioty	52	14	ELISA	ELISA	NNP
cord-275413-e2rhioty	52	15	(	(	-LRB-
cord-275413-e2rhioty	52	16	IDEXX	IDEXX	NNP
cord-275413-e2rhioty	52	17	)	)	-RRB-
cord-275413-e2rhioty	52	18	and	and	CC
cord-275413-e2rhioty	52	19	performed	perform	VBN
cord-275413-e2rhioty	52	20	by	by	IN
cord-275413-e2rhioty	52	21	personnel	personnel	NNS
cord-275413-e2rhioty	52	22	at	at	IN
cord-275413-e2rhioty	52	23	Kansas	Kansas	NNP
cord-275413-e2rhioty	52	24	State	State	NNP
cord-275413-e2rhioty	52	25	University	University	NNP
cord-275413-e2rhioty	52	26	Veterinary	Veterinary	NNP
cord-275413-e2rhioty	52	27	Diagnostic	Diagnostic	NNP
cord-275413-e2rhioty	52	28	Laboratory	Laboratory	NNP
cord-275413-e2rhioty	52	29	.	.	.
cord-275413-e2rhioty	53	1	Serology	serology	NN
cord-275413-e2rhioty	53	2	results	result	NNS
cord-275413-e2rhioty	53	3	were	be	VBD
cord-275413-e2rhioty	53	4	reported	report	VBN
cord-275413-e2rhioty	53	5	as	as	IN
cord-275413-e2rhioty	53	6	a	a	DT
cord-275413-e2rhioty	53	7	sample	sample	NN
cord-275413-e2rhioty	53	8	/	/	SYM
cord-275413-e2rhioty	53	9	positive	positive	JJ
cord-275413-e2rhioty	53	10	(	(	-LRB-
cord-275413-e2rhioty	53	11	S	s	NN
cord-275413-e2rhioty	53	12	/	/	SYM
cord-275413-e2rhioty	53	13	P	p	NN
cord-275413-e2rhioty	53	14	)	)	-RRB-
cord-275413-e2rhioty	53	15	ratio	ratio	NN
cord-275413-e2rhioty	53	16	.	.	.
cord-275413-e2rhioty	54	1	An	an	DT
cord-275413-e2rhioty	54	2	S	S	NNP
cord-275413-e2rhioty	54	3	/	/	SYM
cord-275413-e2rhioty	54	4	P	p	NN
cord-275413-e2rhioty	54	5	ratio	ratio	NN
cord-275413-e2rhioty	54	6	greater	great	JJR
cord-275413-e2rhioty	54	7	than	than	IN
cord-275413-e2rhioty	54	8	0.39	0.39	CD
cord-275413-e2rhioty	54	9	was	be	VBD
cord-275413-e2rhioty	54	10	considered	consider	VBN
cord-275413-e2rhioty	54	11	positive	positive	JJ
cord-275413-e2rhioty	54	12	for	for	IN
cord-275413-e2rhioty	54	13	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	54	14	antibody	antibody	NN
cord-275413-e2rhioty	54	15	.	.	.
cord-275413-e2rhioty	55	1	Virus	virus	NN
cord-275413-e2rhioty	55	2	isolation	isolation	NN
cord-275413-e2rhioty	55	3	(	(	-LRB-
cord-275413-e2rhioty	55	4	VI	VI	NNP
cord-275413-e2rhioty	55	5	)	)	-RRB-
cord-275413-e2rhioty	55	6	in	in	IN
cord-275413-e2rhioty	55	7	serum	serum	NN
cord-275413-e2rhioty	55	8	and	and	CC
cord-275413-e2rhioty	55	9	tissues	tissue	NNS
cord-275413-e2rhioty	55	10	was	be	VBD
cord-275413-e2rhioty	55	11	performed	perform	VBN
cord-275413-e2rhioty	55	12	as	as	IN
cord-275413-e2rhioty	55	13	described	describe	VBN
cord-275413-e2rhioty	55	14	in	in	IN
cord-275413-e2rhioty	55	15	Rowland	Rowland	NNP
cord-275413-e2rhioty	55	16	et	et	NNP
cord-275413-e2rhioty	55	17	al	al	NNP
cord-275413-e2rhioty	55	18	.	.	.
cord-275413-e2rhioty	56	1	(	(	-LRB-
cord-275413-e2rhioty	56	2	2003	2003	CD
cord-275413-e2rhioty	56	3	)	)	-RRB-
cord-275413-e2rhioty	56	4	.	.	.
cord-275413-e2rhioty	57	1	Briefly	briefly	RB
cord-275413-e2rhioty	57	2	,	,	,
cord-275413-e2rhioty	57	3	serum	serum	NN
cord-275413-e2rhioty	57	4	was	be	VBD
cord-275413-e2rhioty	57	5	serially	serially	RB
cord-275413-e2rhioty	57	6	diluted	dilute	VBN
cord-275413-e2rhioty	57	7	in	in	IN
cord-275413-e2rhioty	57	8	MEM	MEM	NNP
cord-275413-e2rhioty	57	9	supplemented	supplement	VBN
cord-275413-e2rhioty	57	10	with	with	IN
cord-275413-e2rhioty	57	11	pen	pen	NN
cord-275413-e2rhioty	57	12	/	/	SYM
cord-275413-e2rhioty	57	13	step	step	NN
cord-275413-e2rhioty	57	14	antibiotics	antibiotic	NNS
cord-275413-e2rhioty	57	15	and	and	CC
cord-275413-e2rhioty	57	16	7	7	CD
cord-275413-e2rhioty	57	17	%	%	NN
cord-275413-e2rhioty	57	18	FBS	FBS	NNP
cord-275413-e2rhioty	57	19	and	and	CC
cord-275413-e2rhioty	57	20	placed	place	VBN
cord-275413-e2rhioty	57	21	on	on	IN
cord-275413-e2rhioty	57	22	96	96	CD
cord-275413-e2rhioty	57	23	well	well	JJ
cord-275413-e2rhioty	57	24	plates	plate	NNS
cord-275413-e2rhioty	57	25	of	of	IN
cord-275413-e2rhioty	57	26	confluent	confluent	JJ
cord-275413-e2rhioty	57	27	MARC-145	MARC-145	NNP
cord-275413-e2rhioty	57	28	cells	cell	NNS
cord-275413-e2rhioty	57	29	.	.	.
cord-275413-e2rhioty	58	1	After	after	IN
cord-275413-e2rhioty	58	2	three	three	CD
cord-275413-e2rhioty	58	3	days	day	NNS
cord-275413-e2rhioty	58	4	,	,	,
cord-275413-e2rhioty	58	5	plates	plate	NNS
cord-275413-e2rhioty	58	6	were	be	VBD
cord-275413-e2rhioty	58	7	fixed	fix	VBN
cord-275413-e2rhioty	58	8	in	in	IN
cord-275413-e2rhioty	58	9	80	80	CD
cord-275413-e2rhioty	58	10	%	%	NN
cord-275413-e2rhioty	58	11	acetone	acetone	NN
cord-275413-e2rhioty	58	12	and	and	CC
cord-275413-e2rhioty	58	13	stained	stain	VBN
cord-275413-e2rhioty	58	14	with	with	IN
cord-275413-e2rhioty	58	15	FITC	FITC	NNP
cord-275413-e2rhioty	58	16	-	-	HYPH
cord-275413-e2rhioty	58	17	SDOW-17	SDOW-17	NNP
cord-275413-e2rhioty	58	18	anti	anti	JJ
cord-275413-e2rhioty	58	19	-	-	JJ
cord-275413-e2rhioty	58	20	nucleocapsid	nucleocapsid	JJ
cord-275413-e2rhioty	58	21	antibody	antibody	NN
cord-275413-e2rhioty	58	22	,	,	,
cord-275413-e2rhioty	58	23	diluted	dilute	VBN
cord-275413-e2rhioty	58	24	in	in	IN
cord-275413-e2rhioty	58	25	PBS	PBS	NNP
cord-275413-e2rhioty	58	26	with	with	IN
cord-275413-e2rhioty	58	27	5	5	CD
cord-275413-e2rhioty	58	28	%	%	NN
cord-275413-e2rhioty	58	29	FBS	FBS	NNP
cord-275413-e2rhioty	58	30	(	(	-LRB-
cord-275413-e2rhioty	58	31	Nelson	Nelson	NNP
cord-275413-e2rhioty	58	32	et	et	NNP
cord-275413-e2rhioty	58	33	al	al	NNP
cord-275413-e2rhioty	58	34	.	.	NNP
cord-275413-e2rhioty	58	35	,	,	,
cord-275413-e2rhioty	58	36	1993	1993	CD
cord-275413-e2rhioty	58	37	)	)	-RRB-
cord-275413-e2rhioty	58	38	.	.	.
cord-275413-e2rhioty	59	1	The	the	DT
cord-275413-e2rhioty	59	2	results	result	NNS
cord-275413-e2rhioty	59	3	were	be	VBD
cord-275413-e2rhioty	59	4	reported	report	VBN
cord-275413-e2rhioty	59	5	as	as	IN
cord-275413-e2rhioty	59	6	the	the	DT
cord-275413-e2rhioty	59	7	log	log	NN
cord-275413-e2rhioty	59	8	10	10	CD
cord-275413-e2rhioty	59	9	of	of	IN
cord-275413-e2rhioty	59	10	the	the	DT
cord-275413-e2rhioty	59	11	inverse	inverse	JJ
cord-275413-e2rhioty	59	12	dilution	dilution	NN
cord-275413-e2rhioty	59	13	of	of	IN
cord-275413-e2rhioty	59	14	the	the	DT
cord-275413-e2rhioty	59	15	last	last	JJ
cord-275413-e2rhioty	59	16	positive	positive	JJ
cord-275413-e2rhioty	59	17	well	well	RB
cord-275413-e2rhioty	59	18	.	.	.
cord-275413-e2rhioty	60	1	Virus	virus	NN
cord-275413-e2rhioty	60	2	isolation	isolation	NN
cord-275413-e2rhioty	60	3	from	from	IN
cord-275413-e2rhioty	60	4	tissues	tissue	NNS
cord-275413-e2rhioty	60	5	was	be	VBD
cord-275413-e2rhioty	60	6	the	the	DT
cord-275413-e2rhioty	60	7	same	same	JJ
cord-275413-e2rhioty	60	8	except	except	IN
cord-275413-e2rhioty	60	9	that	that	IN
cord-275413-e2rhioty	60	10	tissues	tissue	NNS
cord-275413-e2rhioty	60	11	were	be	VBD
cord-275413-e2rhioty	60	12	weighed	weigh	VBN
cord-275413-e2rhioty	60	13	and	and	CC
cord-275413-e2rhioty	60	14	homogenized	homogenize	VBN
cord-275413-e2rhioty	60	15	in	in	IN
cord-275413-e2rhioty	60	16	Hanks	Hanks	NNP
cord-275413-e2rhioty	60	17	balanced	balanced	JJ
cord-275413-e2rhioty	60	18	salt	salt	NN
cord-275413-e2rhioty	60	19	solution	solution	NN
cord-275413-e2rhioty	60	20	and	and	CC
cord-275413-e2rhioty	60	21	then	then	RB
cord-275413-e2rhioty	60	22	centrifuged	centrifuge	VBN
cord-275413-e2rhioty	60	23	at	at	IN
cord-275413-e2rhioty	60	24	500	500	CD
cord-275413-e2rhioty	60	25	×	×	NN
cord-275413-e2rhioty	60	26	g	g	NN
cord-275413-e2rhioty	60	27	for	for	IN
cord-275413-e2rhioty	60	28	20	20	CD
cord-275413-e2rhioty	60	29	min	min	NN
cord-275413-e2rhioty	60	30	to	to	TO
cord-275413-e2rhioty	60	31	remove	remove	VB
cord-275413-e2rhioty	60	32	debris	debris	NN
cord-275413-e2rhioty	60	33	.	.	.
cord-275413-e2rhioty	61	1	The	the	DT
cord-275413-e2rhioty	61	2	sequencing	sequencing	NN
cord-275413-e2rhioty	61	3	of	of	IN
cord-275413-e2rhioty	61	4	the	the	DT
cord-275413-e2rhioty	61	5	hypervariable	hypervariable	JJ
cord-275413-e2rhioty	61	6	region	region	NN
cord-275413-e2rhioty	61	7	of	of	IN
cord-275413-e2rhioty	61	8	ORF5	ORF5	NNP
cord-275413-e2rhioty	61	9	is	be	VBZ
cord-275413-e2rhioty	61	10	described	describe	VBN
cord-275413-e2rhioty	61	11	in	in	IN
cord-275413-e2rhioty	61	12	Rowland	Rowland	NNP
cord-275413-e2rhioty	61	13	et	et	NNP
cord-275413-e2rhioty	61	14	al	al	NNP
cord-275413-e2rhioty	61	15	.	.	.
cord-275413-e2rhioty	62	1	(	(	-LRB-
cord-275413-e2rhioty	62	2	1999	1999	CD
cord-275413-e2rhioty	62	3	)	)	-RRB-
cord-275413-e2rhioty	62	4	.	.	.
cord-275413-e2rhioty	63	1	Total	Total	NNP
cord-275413-e2rhioty	63	2	RNA	RNA	NNP
cord-275413-e2rhioty	63	3	was	be	VBD
cord-275413-e2rhioty	63	4	prepared	prepare	VBN
cord-275413-e2rhioty	63	5	from	from	IN
cord-275413-e2rhioty	63	6	serum	serum	NN
cord-275413-e2rhioty	63	7	or	or	CC
cord-275413-e2rhioty	63	8	infected	infect	VBN
cord-275413-e2rhioty	63	9	MARC-145	MARC-145	NNP
cord-275413-e2rhioty	63	10	cells	cell	NNS
cord-275413-e2rhioty	63	11	using	use	VBG
cord-275413-e2rhioty	63	12	an	an	DT
cord-275413-e2rhioty	63	13	RNeasy	RNeasy	NNP
cord-275413-e2rhioty	63	14	kit	kit	NN
cord-275413-e2rhioty	63	15	(	(	-LRB-
cord-275413-e2rhioty	63	16	Qiagen	Qiagen	NNP
cord-275413-e2rhioty	63	17	)	)	-RRB-
cord-275413-e2rhioty	63	18	according	accord	VBG
cord-275413-e2rhioty	63	19	manufacturer	manufacturer	NN
cord-275413-e2rhioty	63	20	's	's	POS
cord-275413-e2rhioty	63	21	instructions	instruction	NNS
cord-275413-e2rhioty	63	22	.	.	.
cord-275413-e2rhioty	64	1	For	for	IN
cord-275413-e2rhioty	64	2	PCR	PCR	NNP
cord-275413-e2rhioty	64	3	,	,	,
cord-275413-e2rhioty	64	4	cDNA	cdna	NN
cord-275413-e2rhioty	64	5	was	be	VBD
cord-275413-e2rhioty	64	6	prepared	prepare	VBN
cord-275413-e2rhioty	64	7	using	use	VBG
cord-275413-e2rhioty	64	8	MLV	MLV	NNP
cord-275413-e2rhioty	64	9	reverse	reverse	NN
cord-275413-e2rhioty	64	10	transcriptase	transcriptase	NN
cord-275413-e2rhioty	64	11	(	(	-LRB-
cord-275413-e2rhioty	64	12	Promega	Promega	NNP
cord-275413-e2rhioty	64	13	)	)	-RRB-
cord-275413-e2rhioty	64	14	and	and	CC
cord-275413-e2rhioty	64	15	4MSB	4msb	CD
cord-275413-e2rhioty	64	16	as	as	IN
cord-275413-e2rhioty	64	17	the	the	DT
cord-275413-e2rhioty	64	18	primer	primer	NN
cord-275413-e2rhioty	64	19	.	.	.
cord-275413-e2rhioty	65	1	The	the	DT
cord-275413-e2rhioty	65	2	sense	sense	NN
cord-275413-e2rhioty	65	3	and	and	CC
cord-275413-e2rhioty	65	4	antisense	antisense	NN
cord-275413-e2rhioty	65	5	primers	primer	NNS
cord-275413-e2rhioty	65	6	for	for	IN
cord-275413-e2rhioty	65	7	the	the	DT
cord-275413-e2rhioty	65	8	outer	outer	JJ
cord-275413-e2rhioty	65	9	amplification	amplification	NN
cord-275413-e2rhioty	65	10	were	be	VBD
cord-275413-e2rhioty	65	11	4MSA	4msa	CD
cord-275413-e2rhioty	65	12	,	,	,
cord-275413-e2rhioty	65	13	5	5	CD
cord-275413-e2rhioty	65	14	-CTTCGTCCCTTCTTTTCCTCGTGG	-cttcgtcccttcttttcctcgtgg	SYM
cord-275413-e2rhioty	65	15	,	,	,
cord-275413-e2rhioty	65	16	and	and	CC
cord-275413-e2rhioty	65	17	4MSB	4msb	CD
cord-275413-e2rhioty	65	18	,	,	,
cord-275413-e2rhioty	65	19	5	5	CD
cord-275413-e2rhioty	65	20	-CCGCTCTAGAGCCAACGATAGAGTCTGC	-ccgctctagagccaacgatagagtctgc	CC
cord-275413-e2rhioty	65	21	,	,	,
cord-275413-e2rhioty	65	22	respectively	respectively	RB
cord-275413-e2rhioty	65	23	.	.	.
cord-275413-e2rhioty	66	1	The	the	DT
cord-275413-e2rhioty	66	2	product	product	NN
cord-275413-e2rhioty	66	3	was	be	VBD
cord-275413-e2rhioty	66	4	re	re	VBN
cord-275413-e2rhioty	66	5	-	-	VBN
cord-275413-e2rhioty	66	6	amplified	amplify	VBN
cord-275413-e2rhioty	66	7	with	with	IN
cord-275413-e2rhioty	66	8	a	a	DT
cord-275413-e2rhioty	66	9	nested	nested	JJ
cord-275413-e2rhioty	66	10	set	set	NN
cord-275413-e2rhioty	66	11	of	of	IN
cord-275413-e2rhioty	66	12	sense	sense	NN
cord-275413-e2rhioty	66	13	and	and	CC
cord-275413-e2rhioty	66	14	antisense	antisense	NN
cord-275413-e2rhioty	66	15	primers	primer	NNS
cord-275413-e2rhioty	66	16	,	,	,
cord-275413-e2rhioty	66	17	04A	04a	CD
cord-275413-e2rhioty	66	18	,	,	,
cord-275413-e2rhioty	66	19	5	5	CD
cord-275413-e2rhioty	66	20	-ACCGTGTATGTTACCATCACAGCC	-accgtgtatgttaccatcacagcc	NN
cord-275413-e2rhioty	66	21	and	and	CC
cord-275413-e2rhioty	66	22	04B	04b	CD
cord-275413-e2rhioty	66	23	,	,	,
cord-275413-e2rhioty	66	24	ACGGGAAAGATGACAAAACTCTCC	ACGGGAAAGATGACAAAACTCTCC	NNP
cord-275413-e2rhioty	66	25	.	.	.
cord-275413-e2rhioty	67	1	Thirty	thirty	CD
cord-275413-e2rhioty	67	2	-	-	HYPH
cord-275413-e2rhioty	67	3	two	two	CD
cord-275413-e2rhioty	67	4	cycles	cycle	NNS
cord-275413-e2rhioty	67	5	of	of	IN
cord-275413-e2rhioty	67	6	amplification	amplification	NN
cord-275413-e2rhioty	67	7	were	be	VBD
cord-275413-e2rhioty	67	8	performed	perform	VBN
cord-275413-e2rhioty	67	9	for	for	IN
cord-275413-e2rhioty	67	10	each	each	DT
cord-275413-e2rhioty	67	11	primer	primer	NN
cord-275413-e2rhioty	67	12	pair	pair	NN
cord-275413-e2rhioty	67	13	.	.	.
cord-275413-e2rhioty	68	1	The	the	DT
cord-275413-e2rhioty	68	2	conditions	condition	NNS
cord-275413-e2rhioty	68	3	for	for	IN
cord-275413-e2rhioty	68	4	both	both	DT
cord-275413-e2rhioty	68	5	amplifications	amplification	NNS
cord-275413-e2rhioty	68	6	included	include	VBD
cord-275413-e2rhioty	68	7	a	a	DT
cord-275413-e2rhioty	68	8	95	95	CD
cord-275413-e2rhioty	68	9	•	•	NN
cord-275413-e2rhioty	68	10	C	c	NN
cord-275413-e2rhioty	68	11	denaturing	denaturing	NN
cord-275413-e2rhioty	68	12	step	step	NN
cord-275413-e2rhioty	68	13	(	(	-LRB-
cord-275413-e2rhioty	68	14	25	25	CD
cord-275413-e2rhioty	68	15	s	s	NNPS
cord-275413-e2rhioty	68	16	)	)	-RRB-
cord-275413-e2rhioty	68	17	,	,	,
cord-275413-e2rhioty	68	18	a	a	DT
cord-275413-e2rhioty	68	19	58	58	CD
cord-275413-e2rhioty	68	20	•	•	NN
cord-275413-e2rhioty	68	21	C	c	NN
cord-275413-e2rhioty	68	22	annealing	annealing	NN
cord-275413-e2rhioty	68	23	step	step	NN
cord-275413-e2rhioty	68	24	(	(	-LRB-
cord-275413-e2rhioty	68	25	10	10	CD
cord-275413-e2rhioty	68	26	s	s	NNPS
cord-275413-e2rhioty	68	27	)	)	-RRB-
cord-275413-e2rhioty	68	28	,	,	,
cord-275413-e2rhioty	68	29	and	and	CC
cord-275413-e2rhioty	68	30	a	a	DT
cord-275413-e2rhioty	68	31	74	74	CD
cord-275413-e2rhioty	68	32	•	•	NN
cord-275413-e2rhioty	68	33	C	c	NN
cord-275413-e2rhioty	68	34	(	(	-LRB-
cord-275413-e2rhioty	68	35	25	25	CD
cord-275413-e2rhioty	68	36	s	s	NNPS
cord-275413-e2rhioty	68	37	)	)	-RRB-
cord-275413-e2rhioty	68	38	polymerization	polymerization	NN
cord-275413-e2rhioty	68	39	step	step	NN
cord-275413-e2rhioty	68	40	.	.	.
cord-275413-e2rhioty	69	1	The	the	DT
cord-275413-e2rhioty	69	2	final	final	JJ
cord-275413-e2rhioty	69	3	PCR	PCR	NNP
cord-275413-e2rhioty	69	4	product	product	NN
cord-275413-e2rhioty	69	5	,	,	,
cord-275413-e2rhioty	69	6	which	which	WDT
cord-275413-e2rhioty	69	7	contained	contain	VBD
cord-275413-e2rhioty	69	8	the	the	DT
cord-275413-e2rhioty	69	9	last	last	JJ
cord-275413-e2rhioty	69	10	312	312	CD
cord-275413-e2rhioty	69	11	nucleotides	nucleotide	NNS
cord-275413-e2rhioty	69	12	of	of	IN
cord-275413-e2rhioty	69	13	ORF4	ORF4	NNP
cord-275413-e2rhioty	69	14	,	,	,
cord-275413-e2rhioty	69	15	the	the	DT
cord-275413-e2rhioty	69	16	10	10	CD
cord-275413-e2rhioty	69	17	nucleotide	nucleotide	JJ
cord-275413-e2rhioty	69	18	untranslated	untranslated	JJ
cord-275413-e2rhioty	69	19	region	region	NN
cord-275413-e2rhioty	69	20	(	(	-LRB-
cord-275413-e2rhioty	69	21	UTR	UTR	NNP
cord-275413-e2rhioty	69	22	)	)	-RRB-
cord-275413-e2rhioty	69	23	,	,	,
cord-275413-e2rhioty	69	24	and	and	CC
cord-275413-e2rhioty	69	25	the	the	DT
cord-275413-e2rhioty	69	26	first	first	JJ
cord-275413-e2rhioty	69	27	215	215	CD
cord-275413-e2rhioty	69	28	nucleotides	nucleotide	NNS
cord-275413-e2rhioty	69	29	of	of	IN
cord-275413-e2rhioty	69	30	ORF5	ORF5	NNP
cord-275413-e2rhioty	69	31	was	be	VBD
cord-275413-e2rhioty	69	32	sequenced	sequence	VBN
cord-275413-e2rhioty	69	33	directly	directly	RB
cord-275413-e2rhioty	69	34	by	by	IN
cord-275413-e2rhioty	69	35	automated	automate	VBN
cord-275413-e2rhioty	69	36	DNA	dna	NN
cord-275413-e2rhioty	69	37	sequencing	sequencing	NN
cord-275413-e2rhioty	69	38	.	.	.
cord-275413-e2rhioty	70	1	PCR	PCR	NNP
cord-275413-e2rhioty	70	2	products	product	NNS
cord-275413-e2rhioty	70	3	were	be	VBD
cord-275413-e2rhioty	70	4	cloned	clone	VBN
cord-275413-e2rhioty	70	5	into	into	IN
cord-275413-e2rhioty	70	6	a	a	DT
cord-275413-e2rhioty	70	7	pCR2.1	pCR2.1	NNP
cord-275413-e2rhioty	70	8	TA	TA	NNP
cord-275413-e2rhioty	70	9	cloning	cloning	NN
cord-275413-e2rhioty	70	10	vector	vector	NN
cord-275413-e2rhioty	70	11	(	(	-LRB-
cord-275413-e2rhioty	70	12	Invitrogen	Invitrogen	NNP
cord-275413-e2rhioty	70	13	)	)	-RRB-
cord-275413-e2rhioty	70	14	,	,	,
cord-275413-e2rhioty	70	15	propagated	propagate	VBN
cord-275413-e2rhioty	70	16	in	in	IN
cord-275413-e2rhioty	70	17	Escherichia	Escherichia	NNP
cord-275413-e2rhioty	70	18	coli	coli	NNS
cord-275413-e2rhioty	70	19	and	and	CC
cord-275413-e2rhioty	70	20	individual	individual	JJ
cord-275413-e2rhioty	70	21	plasmids	plasmid	NNS
cord-275413-e2rhioty	70	22	sequenced	sequence	VBN
cord-275413-e2rhioty	70	23	using	use	VBG
cord-275413-e2rhioty	70	24	M13	M13	NNP
cord-275413-e2rhioty	70	25	forward	forward	RB
cord-275413-e2rhioty	70	26	and	and	CC
cord-275413-e2rhioty	70	27	reverse	reverse	VB
cord-275413-e2rhioty	70	28	primers	primer	NNS
cord-275413-e2rhioty	70	29	.	.	.
cord-275413-e2rhioty	71	1	Sequences	sequence	NNS
cord-275413-e2rhioty	71	2	were	be	VBD
cord-275413-e2rhioty	71	3	analyzed	analyze	VBN
cord-275413-e2rhioty	71	4	using	use	VBG
cord-275413-e2rhioty	71	5	Gene	Gene	NNP
cord-275413-e2rhioty	71	6	Jockey	Jockey	NNP
cord-275413-e2rhioty	71	7	II	II	NNP
cord-275413-e2rhioty	71	8	software	software	NN
cord-275413-e2rhioty	71	9	.	.	.
cord-275413-e2rhioty	72	1	Tissue	tissue	NN
cord-275413-e2rhioty	72	2	samples	sample	NNS
cord-275413-e2rhioty	72	3	for	for	IN
cord-275413-e2rhioty	72	4	RT	RT	NNP
cord-275413-e2rhioty	72	5	-	-	HYPH
cord-275413-e2rhioty	72	6	PCR	PCR	NNP
cord-275413-e2rhioty	72	7	were	be	VBD
cord-275413-e2rhioty	72	8	immediately	immediately	RB
cord-275413-e2rhioty	72	9	placed	place	VBN
cord-275413-e2rhioty	72	10	in	in	IN
cord-275413-e2rhioty	72	11	RNA	RNA	NNP
cord-275413-e2rhioty	72	12	-	-	:
cord-275413-e2rhioty	72	13	Later	Later	NNP
cord-275413-e2rhioty	72	14	(	(	-LRB-
cord-275413-e2rhioty	72	15	Ambion	Ambion	NNP
cord-275413-e2rhioty	72	16	)	)	-RRB-
cord-275413-e2rhioty	72	17	and	and	CC
cord-275413-e2rhioty	72	18	stored	store	VBN
cord-275413-e2rhioty	72	19	at	at	IN
cord-275413-e2rhioty	72	20	−80	−80	NNP
cord-275413-e2rhioty	73	1	•	•	NNP
cord-275413-e2rhioty	74	1	C.	C.	NNP
cord-275413-e2rhioty	74	2	Total	Total	NNP
cord-275413-e2rhioty	74	3	RNA	RNA	NNP
cord-275413-e2rhioty	74	4	was	be	VBD
cord-275413-e2rhioty	74	5	extracted	extract	VBN
cord-275413-e2rhioty	74	6	from	from	IN
cord-275413-e2rhioty	74	7	approximately	approximately	RB
cord-275413-e2rhioty	74	8	50	50	CD
cord-275413-e2rhioty	74	9	g	g	NN
cord-275413-e2rhioty	74	10	of	of	IN
cord-275413-e2rhioty	74	11	tissue	tissue	NN
cord-275413-e2rhioty	74	12	using	use	VBG
cord-275413-e2rhioty	74	13	RNeasy	RNeasy	NNP
cord-275413-e2rhioty	74	14	kit	kit	NN
cord-275413-e2rhioty	74	15	(	(	-LRB-
cord-275413-e2rhioty	74	16	Qiagen	Qiagen	NNP
cord-275413-e2rhioty	74	17	)	)	-RRB-
cord-275413-e2rhioty	74	18	according	accord	VBG
cord-275413-e2rhioty	74	19	to	to	IN
cord-275413-e2rhioty	74	20	manufacturer	manufacturer	NN
cord-275413-e2rhioty	74	21	's	's	POS
cord-275413-e2rhioty	74	22	instructions	instruction	NNS
cord-275413-e2rhioty	74	23	.	.	.
cord-275413-e2rhioty	75	1	The	the	DT
cord-275413-e2rhioty	75	2	design	design	NN
cord-275413-e2rhioty	75	3	of	of	IN
cord-275413-e2rhioty	75	4	cytokinespecific	cytokinespecific	NN
cord-275413-e2rhioty	75	5	primers	primer	NNS
cord-275413-e2rhioty	75	6	and	and	CC
cord-275413-e2rhioty	75	7	RT	RT	NNP
cord-275413-e2rhioty	75	8	-	-	HYPH
cord-275413-e2rhioty	75	9	PCR	PCR	NNP
cord-275413-e2rhioty	75	10	procedures	procedure	NNS
cord-275413-e2rhioty	75	11	were	be	VBD
cord-275413-e2rhioty	75	12	performed	perform	VBN
cord-275413-e2rhioty	75	13	according	accord	VBG
cord-275413-e2rhioty	75	14	to	to	IN
cord-275413-e2rhioty	75	15	Reddy	Reddy	NNP
cord-275413-e2rhioty	75	16	and	and	CC
cord-275413-e2rhioty	75	17	Wilkie	Wilkie	NNP
cord-275413-e2rhioty	75	18	(	(	-LRB-
cord-275413-e2rhioty	75	19	2000	2000	CD
cord-275413-e2rhioty	75	20	)	)	-RRB-
cord-275413-e2rhioty	75	21	.	.	.
cord-275413-e2rhioty	76	1	Primer	primer	NN
cord-275413-e2rhioty	76	2	sequences	sequence	NNS
cord-275413-e2rhioty	76	3	are	be	VBP
cord-275413-e2rhioty	76	4	listed	list	VBN
cord-275413-e2rhioty	76	5	in	in	IN
cord-275413-e2rhioty	76	6	Table	Table	NNP
cord-275413-e2rhioty	76	7	1	1	CD
cord-275413-e2rhioty	76	8	.	.	.
cord-275413-e2rhioty	77	1	RNA	RNA	NNP
cord-275413-e2rhioty	77	2	was	be	VBD
cord-275413-e2rhioty	77	3	diluted	dilute	VBN
cord-275413-e2rhioty	77	4	to	to	IN
cord-275413-e2rhioty	77	5	a	a	DT
cord-275413-e2rhioty	77	6	final	final	JJ
cord-275413-e2rhioty	77	7	volume	volume	NN
cord-275413-e2rhioty	77	8	of	of	IN
cord-275413-e2rhioty	77	9	50	50	CD
cord-275413-e2rhioty	77	10	l	l	NN
cord-275413-e2rhioty	77	11	in	in	IN
cord-275413-e2rhioty	77	12	nuclease	nuclease	DT
cord-275413-e2rhioty	77	13	free	free	JJ
cord-275413-e2rhioty	77	14	water	water	NN
cord-275413-e2rhioty	77	15	.	.	.
cord-275413-e2rhioty	78	1	cDNA	cDNA	NNP
cord-275413-e2rhioty	78	2	was	be	VBD
cord-275413-e2rhioty	78	3	prepared	prepared	JJ
cord-275413-e2rhioty	78	4	from10	from10	NNP
cord-275413-e2rhioty	78	5	l	l	NNP
cord-275413-e2rhioty	78	6	of	of	IN
cord-275413-e2rhioty	78	7	total	total	NNP
cord-275413-e2rhioty	78	8	RNA	RNA	NNP
cord-275413-e2rhioty	78	9	by	by	IN
cord-275413-e2rhioty	78	10	reverse	reverse	JJ
cord-275413-e2rhioty	78	11	transcription	transcription	NN
cord-275413-e2rhioty	78	12	using	use	VBG
cord-275413-e2rhioty	78	13	Molony	Molony	NNP
cord-275413-e2rhioty	78	14	murine	murine	JJ
cord-275413-e2rhioty	78	15	leukemia	leukemia	NN
cord-275413-e2rhioty	78	16	virus	virus	NN
cord-275413-e2rhioty	78	17	reverse	reverse	NN
cord-275413-e2rhioty	78	18	transcriptase	transcriptase	NN
cord-275413-e2rhioty	78	19	(	(	-LRB-
cord-275413-e2rhioty	78	20	Promega	Promega	NNP
cord-275413-e2rhioty	78	21	)	)	-RRB-
cord-275413-e2rhioty	78	22	and	and	CC
cord-275413-e2rhioty	78	23	random	random	JJ
cord-275413-e2rhioty	78	24	hexamers	hexamer	NNS
cord-275413-e2rhioty	78	25	as	as	IN
cord-275413-e2rhioty	78	26	primers	primer	NNS
cord-275413-e2rhioty	78	27	.	.	.
cord-275413-e2rhioty	79	1	The	the	DT
cord-275413-e2rhioty	79	2	amplification	amplification	NN
cord-275413-e2rhioty	79	3	of	of	IN
cord-275413-e2rhioty	79	4	␤	␤	CD
cord-275413-e2rhioty	79	5	2	2	CD
cord-275413-e2rhioty	79	6	m	m	NNP
cord-275413-e2rhioty	79	7	mRNA	mRNA	NNP
cord-275413-e2rhioty	79	8	was	be	VBD
cord-275413-e2rhioty	79	9	used	use	VBN
cord-275413-e2rhioty	79	10	as	as	IN
cord-275413-e2rhioty	79	11	an	an	DT
cord-275413-e2rhioty	79	12	internal	internal	JJ
cord-275413-e2rhioty	79	13	control	control	NN
cord-275413-e2rhioty	79	14	.	.	.
cord-275413-e2rhioty	80	1	PCR	PCR	NNP
cord-275413-e2rhioty	80	2	amplification	amplification	NN
cord-275413-e2rhioty	80	3	of	of	IN
cord-275413-e2rhioty	80	4	cytokine	cytokine	NN
cord-275413-e2rhioty	80	5	and	and	CC
cord-275413-e2rhioty	80	6	control	control	NN
cord-275413-e2rhioty	80	7	cDNAs	cdna	NNS
cord-275413-e2rhioty	80	8	consisted	consist	VBD
cord-275413-e2rhioty	80	9	of	of	IN
cord-275413-e2rhioty	80	10	35	35	CD
cord-275413-e2rhioty	80	11	cycles	cycle	NNS
cord-275413-e2rhioty	80	12	(	(	-LRB-
cord-275413-e2rhioty	80	13	45	45	CD
cord-275413-e2rhioty	80	14	s	s	NN
cord-275413-e2rhioty	80	15	at	at	IN
cord-275413-e2rhioty	80	16	94	94	CD
cord-275413-e2rhioty	80	17	•	•	NN
cord-275413-e2rhioty	80	18	C	C	NNP
cord-275413-e2rhioty	80	19	,	,	,
cord-275413-e2rhioty	80	20	45	45	CD
cord-275413-e2rhioty	80	21	s	s	NN
cord-275413-e2rhioty	80	22	at	at	IN
cord-275413-e2rhioty	80	23	55	55	CD
cord-275413-e2rhioty	80	24	•	•	NN
cord-275413-e2rhioty	80	25	C	C	NNP
cord-275413-e2rhioty	80	26	,	,	,
cord-275413-e2rhioty	80	27	and	and	CC
cord-275413-e2rhioty	80	28	45	45	CD
cord-275413-e2rhioty	80	29	s	s	NN
cord-275413-e2rhioty	80	30	at	at	IN
cord-275413-e2rhioty	80	31	72	72	CD
cord-275413-e2rhioty	81	1	•	•	NNP
cord-275413-e2rhioty	81	2	C	C	NNP
cord-275413-e2rhioty	81	3	)	)	-RRB-
cord-275413-e2rhioty	81	4	and	and	CC
cord-275413-e2rhioty	81	5	DNA	dna	NN
cord-275413-e2rhioty	81	6	products	product	NNS
cord-275413-e2rhioty	81	7	electrophoresed	electrophorese	VBN
cord-275413-e2rhioty	81	8	on	on	IN
cord-275413-e2rhioty	81	9	a	a	DT
cord-275413-e2rhioty	81	10	2.0	2.0	CD
cord-275413-e2rhioty	81	11	%	%	NN
cord-275413-e2rhioty	81	12	agarose	agarose	NN
cord-275413-e2rhioty	81	13	gel	gel	NN
cord-275413-e2rhioty	81	14	and	and	CC
cord-275413-e2rhioty	81	15	visualized	visualize	VBD
cord-275413-e2rhioty	81	16	using	use	VBG
cord-275413-e2rhioty	81	17	ethidium	ethidium	NN
cord-275413-e2rhioty	81	18	bromide	bromide	NN
cord-275413-e2rhioty	81	19	.	.	.
cord-275413-e2rhioty	82	1	The	the	DT
cord-275413-e2rhioty	82	2	identity	identity	NN
cord-275413-e2rhioty	82	3	of	of	IN
cord-275413-e2rhioty	82	4	the	the	DT
cord-275413-e2rhioty	82	5	DNA	dna	NN
cord-275413-e2rhioty	82	6	products	product	NNS
cord-275413-e2rhioty	82	7	was	be	VBD
cord-275413-e2rhioty	82	8	confirmed	confirm	VBN
cord-275413-e2rhioty	82	9	by	by	IN
cord-275413-e2rhioty	82	10	DNA	dna	NN
cord-275413-e2rhioty	82	11	sequencing	sequencing	NN
cord-275413-e2rhioty	82	12	.	.	.
cord-275413-e2rhioty	83	1	Tissue	tissue	NN
cord-275413-e2rhioty	83	2	samples	sample	NNS
cord-275413-e2rhioty	83	3	were	be	VBD
cord-275413-e2rhioty	83	4	collected	collect	VBN
cord-275413-e2rhioty	83	5	and	and	CC
cord-275413-e2rhioty	83	6	immediately	immediately	RB
cord-275413-e2rhioty	83	7	placed	place	VBD
cord-275413-e2rhioty	83	8	in	in	IN
cord-275413-e2rhioty	83	9	10	10	CD
cord-275413-e2rhioty	83	10	%	%	NN
cord-275413-e2rhioty	83	11	buffered	buffer	VBN
cord-275413-e2rhioty	83	12	formalin	formalin	NN
cord-275413-e2rhioty	83	13	.	.	.
cord-275413-e2rhioty	84	1	Paraffin	paraffin	NN
cord-275413-e2rhioty	84	2	-	-	HYPH
cord-275413-e2rhioty	84	3	embedded	embed	VBN
cord-275413-e2rhioty	84	4	thin	thin	JJ
cord-275413-e2rhioty	84	5	sections	section	NNS
cord-275413-e2rhioty	84	6	were	be	VBD
cord-275413-e2rhioty	84	7	mounted	mount	VBN
cord-275413-e2rhioty	84	8	on	on	IN
cord-275413-e2rhioty	84	9	slides	slide	NNS
cord-275413-e2rhioty	84	10	,	,	,
cord-275413-e2rhioty	84	11	deparaffinized	deparaffinized	JJ
cord-275413-e2rhioty	84	12	and	and	CC
cord-275413-e2rhioty	84	13	stained	stain	VBN
cord-275413-e2rhioty	84	14	with	with	IN
cord-275413-e2rhioty	84	15	hematoxylin	hematoxylin	NNP
cord-275413-e2rhioty	84	16	For	for	IN
cord-275413-e2rhioty	84	17	the	the	DT
cord-275413-e2rhioty	84	18	detection	detection	NN
cord-275413-e2rhioty	84	19	of	of	IN
cord-275413-e2rhioty	84	20	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	84	21	antigen	antigen	NNP
cord-275413-e2rhioty	84	22	,	,	,
cord-275413-e2rhioty	84	23	slides	slide	NNS
cord-275413-e2rhioty	84	24	were	be	VBD
cord-275413-e2rhioty	84	25	incubated	incubate	VBN
cord-275413-e2rhioty	84	26	for	for	IN
cord-275413-e2rhioty	84	27	30	30	CD
cord-275413-e2rhioty	84	28	min	min	NN
cord-275413-e2rhioty	84	29	with	with	IN
cord-275413-e2rhioty	84	30	a	a	DT
cord-275413-e2rhioty	84	31	1:100	1:100	CD
cord-275413-e2rhioty	84	32	dilution	dilution	NN
cord-275413-e2rhioty	84	33	of	of	IN
cord-275413-e2rhioty	84	34	mAb	mAb	NNP
cord-275413-e2rhioty	84	35	SR-30	SR-30	NNP
cord-275413-e2rhioty	84	36	anti	anti	JJ
cord-275413-e2rhioty	84	37	-	-	JJ
cord-275413-e2rhioty	84	38	nucleocapsid	nucleocapsid	JJ
cord-275413-e2rhioty	84	39	antibody	antibody	NN
cord-275413-e2rhioty	84	40	(	(	-LRB-
cord-275413-e2rhioty	84	41	Rural	Rural	NNP
cord-275413-e2rhioty	84	42	Technologies	Technologies	NNPS
cord-275413-e2rhioty	84	43	)	)	-RRB-
cord-275413-e2rhioty	84	44	.	.	.
cord-275413-e2rhioty	85	1	Other	other	JJ
cord-275413-e2rhioty	85	2	antibodies	antibody	NNS
cord-275413-e2rhioty	85	3	included	include	VBD
cord-275413-e2rhioty	85	4	a	a	DT
cord-275413-e2rhioty	85	5	polyclonal	polyclonal	JJ
cord-275413-e2rhioty	85	6	anti	anti	JJ
cord-275413-e2rhioty	85	7	-	-	JJ
cord-275413-e2rhioty	85	8	human	human	JJ
cord-275413-e2rhioty	85	9	CD3	cd3	NN
cord-275413-e2rhioty	85	10	and	and	CC
cord-275413-e2rhioty	85	11	B	B	NNP
cord-275413-e2rhioty	85	12	cell	cell	NN
cord-275413-e2rhioty	85	13	antibodies	antibody	NNS
cord-275413-e2rhioty	85	14	,	,	,
cord-275413-e2rhioty	85	15	anti	anti	JJ
cord-275413-e2rhioty	85	16	-	-	NNS
cord-275413-e2rhioty	85	17	CDw75	cdw75	JJ
cord-275413-e2rhioty	85	18	and	and	CC
cord-275413-e2rhioty	85	19	anti	anti	JJ
cord-275413-e2rhioty	85	20	-	-	JJ
cord-275413-e2rhioty	85	21	CD79	CD79	NNP
cord-275413-e2rhioty	86	1	␣	␣	NNP
cord-275413-e2rhioty	86	2	.	.	.
cord-275413-e2rhioty	87	1	Bound	bound	JJ
cord-275413-e2rhioty	87	2	antibody	antibody	NN
cord-275413-e2rhioty	87	3	was	be	VBD
cord-275413-e2rhioty	87	4	detected	detect	VBN
cord-275413-e2rhioty	87	5	with	with	IN
cord-275413-e2rhioty	88	1	biotinylated	biotinylated	NNP
cord-275413-e2rhioty	88	2	goat	goat	NNP
cord-275413-e2rhioty	88	3	anti	anti	NNP
cord-275413-e2rhioty	88	4	-	-	JJ
cord-275413-e2rhioty	88	5	mouse	mouse	JJ
cord-275413-e2rhioty	88	6	or	or	CC
cord-275413-e2rhioty	88	7	anti	anti	JJ
cord-275413-e2rhioty	88	8	-	-	JJ
cord-275413-e2rhioty	88	9	rabbit	rabbit	JJ
cord-275413-e2rhioty	88	10	Ig	Ig	NNPS
cord-275413-e2rhioty	88	11	followed	follow	VBN
cord-275413-e2rhioty	88	12	by	by	IN
cord-275413-e2rhioty	88	13	avidin	avidin	NN
cord-275413-e2rhioty	88	14	-	-	HYPH
cord-275413-e2rhioty	88	15	HRPO	HRPO	NNP
cord-275413-e2rhioty	88	16	and	and	CC
cord-275413-e2rhioty	88	17	DAB	DAB	NNP
cord-275413-e2rhioty	88	18	chromagen	chromagen	NNP
cord-275413-e2rhioty	88	19	(	(	-LRB-
cord-275413-e2rhioty	88	20	Ventana	Ventana	NNP
cord-275413-e2rhioty	88	21	Medical	Medical	NNP
cord-275413-e2rhioty	88	22	)	)	-RRB-
cord-275413-e2rhioty	88	23	.	.	.
cord-275413-e2rhioty	89	1	Slides	slide	NNS
cord-275413-e2rhioty	89	2	were	be	VBD
cord-275413-e2rhioty	89	3	counterstained	counterstaine	VBN
cord-275413-e2rhioty	89	4	with	with	IN
cord-275413-e2rhioty	89	5	hematoxylin	hematoxylin	NNP
cord-275413-e2rhioty	89	6	.	.	.
cord-275413-e2rhioty	90	1	The	the	DT
cord-275413-e2rhioty	90	2	experiment	experiment	NN
cord-275413-e2rhioty	90	3	incorporated	incorporate	VBD
cord-275413-e2rhioty	90	4	four	four	CD
cord-275413-e2rhioty	90	5	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	90	6	-	-	HYPH
cord-275413-e2rhioty	90	7	infected	infect	VBN
cord-275413-e2rhioty	90	8	and	and	CC
cord-275413-e2rhioty	90	9	twomock	twomock	NN
cord-275413-e2rhioty	90	10	-	-	HYPH
cord-275413-e2rhioty	90	11	infected	infect	VBN
cord-275413-e2rhioty	90	12	dams	dam	NNS
cord-275413-e2rhioty	90	13	.	.	.
cord-275413-e2rhioty	91	1	All	all	DT
cord-275413-e2rhioty	91	2	maternal	maternal	JJ
cord-275413-e2rhioty	91	3	serum	serum	NN
cord-275413-e2rhioty	91	4	samples	sample	NNS
cord-275413-e2rhioty	91	5	were	be	VBD
cord-275413-e2rhioty	91	6	VI	vi	NN
cord-275413-e2rhioty	91	7	-	-	HYPH
cord-275413-e2rhioty	91	8	negative	negative	JJ
cord-275413-e2rhioty	91	9	and	and	CC
cord-275413-e2rhioty	91	10	seronegative	seronegative	JJ
cord-275413-e2rhioty	91	11	for	for	IN
cord-275413-e2rhioty	91	12	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	91	13	prior	prior	RB
cord-275413-e2rhioty	91	14	to	to	IN
cord-275413-e2rhioty	91	15	infection	infection	NN
cord-275413-e2rhioty	91	16	.	.	.
cord-275413-e2rhioty	92	1	Between	between	IN
cord-275413-e2rhioty	92	2	one	one	CD
cord-275413-e2rhioty	92	3	and	and	CC
cord-275413-e2rhioty	92	4	two	two	CD
cord-275413-e2rhioty	92	5	weeks	week	NNS
cord-275413-e2rhioty	92	6	after	after	IN
cord-275413-e2rhioty	92	7	virus	virus	NN
cord-275413-e2rhioty	92	8	challenge	challenge	NN
cord-275413-e2rhioty	92	9	,	,	,
cord-275413-e2rhioty	92	10	all	all	DT
cord-275413-e2rhioty	92	11	infected	infect	VBN
cord-275413-e2rhioty	92	12	sows	sow	NNS
cord-275413-e2rhioty	92	13	were	be	VBD
cord-275413-e2rhioty	92	14	VI	vi	NN
cord-275413-e2rhioty	92	15	-	-	HYPH
cord-275413-e2rhioty	92	16	positive	positive	JJ
cord-275413-e2rhioty	92	17	in	in	IN
cord-275413-e2rhioty	92	18	serum	serum	NN
cord-275413-e2rhioty	92	19	,	,	,
cord-275413-e2rhioty	92	20	confirming	confirm	VBG
cord-275413-e2rhioty	92	21	the	the	DT
cord-275413-e2rhioty	92	22	presence	presence	NN
cord-275413-e2rhioty	92	23	of	of	IN
cord-275413-e2rhioty	92	24	an	an	DT
cord-275413-e2rhioty	92	25	active	active	JJ
cord-275413-e2rhioty	92	26	infection	infection	NN
cord-275413-e2rhioty	92	27	.	.	.
cord-275413-e2rhioty	93	1	By	by	IN
cord-275413-e2rhioty	93	2	the	the	DT
cord-275413-e2rhioty	93	3	time	time	NN
cord-275413-e2rhioty	93	4	of	of	IN
cord-275413-e2rhioty	93	5	necropsy	necropsy	JJ
cord-275413-e2rhioty	93	6	,	,	,
cord-275413-e2rhioty	93	7	the	the	DT
cord-275413-e2rhioty	93	8	concentration	concentration	NN
cord-275413-e2rhioty	93	9	of	of	IN
cord-275413-e2rhioty	93	10	circulating	circulate	VBG
cord-275413-e2rhioty	93	11	virus	virus	NN
cord-275413-e2rhioty	93	12	in	in	IN
cord-275413-e2rhioty	93	13	the	the	DT
cord-275413-e2rhioty	93	14	dams	dam	NNS
cord-275413-e2rhioty	93	15	had	have	VBD
cord-275413-e2rhioty	93	16	dipped	dip	VBN
cord-275413-e2rhioty	93	17	to	to	IN
cord-275413-e2rhioty	93	18	below	below	IN
cord-275413-e2rhioty	93	19	detectable	detectable	JJ
cord-275413-e2rhioty	93	20	levels	level	NNS
cord-275413-e2rhioty	93	21	by	by	IN
cord-275413-e2rhioty	93	22	VI	VI	NNP
cord-275413-e2rhioty	93	23	.	.	.
cord-275413-e2rhioty	94	1	A	a	DT
cord-275413-e2rhioty	94	2	total	total	NN
cord-275413-e2rhioty	94	3	of	of	IN
cord-275413-e2rhioty	94	4	44	44	CD
cord-275413-e2rhioty	94	5	viable	viable	JJ
cord-275413-e2rhioty	94	6	fetuses	fetus	NNS
cord-275413-e2rhioty	94	7	were	be	VBD
cord-275413-e2rhioty	94	8	recovered	recover	VBN
cord-275413-e2rhioty	94	9	from	from	IN
cord-275413-e2rhioty	94	10	the	the	DT
cord-275413-e2rhioty	94	11	four	four	CD
cord-275413-e2rhioty	94	12	infected	infected	JJ
cord-275413-e2rhioty	94	13	dams	dam	NNS
cord-275413-e2rhioty	94	14	(	(	-LRB-
cord-275413-e2rhioty	94	15	see	see	VB
cord-275413-e2rhioty	94	16	Table	table	NN
cord-275413-e2rhioty	94	17	2	2	CD
cord-275413-e2rhioty	94	18	for	for	IN
cord-275413-e2rhioty	94	19	summary	summary	NN
cord-275413-e2rhioty	94	20	)	)	-RRB-
cord-275413-e2rhioty	94	21	.	.	.
cord-275413-e2rhioty	95	1	Two	two	CD
cord-275413-e2rhioty	95	2	fetuses	fetus	NNS
cord-275413-e2rhioty	95	3	were	be	VBD
cord-275413-e2rhioty	95	4	dead	dead	JJ
cord-275413-e2rhioty	95	5	and	and	CC
cord-275413-e2rhioty	95	6	partially	partially	RB
cord-275413-e2rhioty	95	7	autolysed	autolyse	VBN
cord-275413-e2rhioty	95	8	and	and	CC
cord-275413-e2rhioty	95	9	not	not	RB
cord-275413-e2rhioty	95	10	subjected	subject	VBN
cord-275413-e2rhioty	95	11	to	to	IN
cord-275413-e2rhioty	95	12	further	further	JJ
cord-275413-e2rhioty	95	13	study	study	NN
cord-275413-e2rhioty	95	14	.	.	.
cord-275413-e2rhioty	96	1	10	10	CD
cord-275413-e2rhioty	96	2	(	(	-LRB-
cord-275413-e2rhioty	96	3	22	22	CD
cord-275413-e2rhioty	96	4	%	%	NN
cord-275413-e2rhioty	96	5	)	)	-RRB-
cord-275413-e2rhioty	96	6	of	of	IN
cord-275413-e2rhioty	96	7	the	the	DT
cord-275413-e2rhioty	96	8	44	44	CD
cord-275413-e2rhioty	96	9	viable	viable	JJ
cord-275413-e2rhioty	96	10	fetuses	fetus	NNS
cord-275413-e2rhioty	96	11	were	be	VBD
cord-275413-e2rhioty	96	12	positive	positive	JJ
cord-275413-e2rhioty	96	13	for	for	IN
cord-275413-e2rhioty	96	14	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	96	15	by	by	IN
cord-275413-e2rhioty	96	16	VI	VI	NNP
cord-275413-e2rhioty	96	17	.	.	.
cord-275413-e2rhioty	97	1	Since	since	IN
cord-275413-e2rhioty	97	2	dams	dam	NNS
cord-275413-e2rhioty	97	3	were	be	VBD
cord-275413-e2rhioty	97	4	VI	vi	NN
cord-275413-e2rhioty	97	5	-	-	HYPH
cord-275413-e2rhioty	97	6	negative	negative	JJ
cord-275413-e2rhioty	97	7	in	in	IN
cord-275413-e2rhioty	97	8	blood	blood	NN
cord-275413-e2rhioty	97	9	at	at	IN
cord-275413-e2rhioty	97	10	the	the	DT
cord-275413-e2rhioty	97	11	time	time	NN
cord-275413-e2rhioty	97	12	of	of	IN
cord-275413-e2rhioty	97	13	necropsy	necropsy	JJ
cord-275413-e2rhioty	97	14	,	,	,
cord-275413-e2rhioty	97	15	it	-PRON-	PRP
cord-275413-e2rhioty	97	16	was	be	VBD
cord-275413-e2rhioty	97	17	concluded	conclude	VBN
cord-275413-e2rhioty	97	18	that	that	IN
cord-275413-e2rhioty	97	19	the	the	DT
cord-275413-e2rhioty	97	20	presence	presence	NN
cord-275413-e2rhioty	97	21	of	of	IN
cord-275413-e2rhioty	97	22	virus	virus	NN
cord-275413-e2rhioty	97	23	Serology	serology	NN
cord-275413-e2rhioty	97	24	results	result	NNS
cord-275413-e2rhioty	97	25	,	,	,
cord-275413-e2rhioty	97	26	shown	show	VBN
cord-275413-e2rhioty	97	27	in	in	IN
cord-275413-e2rhioty	97	28	parentheses	parenthesis	NNS
cord-275413-e2rhioty	97	29	,	,	,
cord-275413-e2rhioty	97	30	are	be	VBP
cord-275413-e2rhioty	97	31	presented	present	VBN
cord-275413-e2rhioty	97	32	as	as	IN
cord-275413-e2rhioty	97	33	the	the	DT
cord-275413-e2rhioty	97	34	S	S	NNP
cord-275413-e2rhioty	97	35	/	/	SYM
cord-275413-e2rhioty	97	36	P	p	NN
cord-275413-e2rhioty	97	37	ratio	ratio	NN
cord-275413-e2rhioty	97	38	.	.	.
cord-275413-e2rhioty	98	1	S	S	NNP
cord-275413-e2rhioty	98	2	/	/	SYM
cord-275413-e2rhioty	98	3	P	p	NN
cord-275413-e2rhioty	98	4	ratios	ratio	NNS
cord-275413-e2rhioty	98	5	greater	great	JJR
cord-275413-e2rhioty	98	6	than	than	IN
cord-275413-e2rhioty	98	7	0.4	0.4	CD
cord-275413-e2rhioty	98	8	were	be	VBD
cord-275413-e2rhioty	98	9	considered	consider	VBN
cord-275413-e2rhioty	98	10	positive	positive	JJ
cord-275413-e2rhioty	98	11	for	for	IN
cord-275413-e2rhioty	98	12	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	98	13	antibody	antibody	NN
cord-275413-e2rhioty	98	14	.	.	.
cord-275413-e2rhioty	99	1	Dead	dead	JJ
cord-275413-e2rhioty	99	2	fetuses	fetus	NNS
cord-275413-e2rhioty	99	3	were	be	VBD
cord-275413-e2rhioty	99	4	partially	partially	RB
cord-275413-e2rhioty	99	5	autolysed	autolyse	VBN
cord-275413-e2rhioty	99	6	and	and	CC
cord-275413-e2rhioty	99	7	not	not	RB
cord-275413-e2rhioty	99	8	tested	test	VBN
cord-275413-e2rhioty	99	9	.	.	.
cord-275413-e2rhioty	100	1	Gross	gross	JJ
cord-275413-e2rhioty	100	2	pathology	pathology	NN
cord-275413-e2rhioty	100	3	key	key	NN
cord-275413-e2rhioty	100	4	:	:	:
cord-275413-e2rhioty	101	1	*	*	NFP
cord-275413-e2rhioty	101	2	1	1	CD
cord-275413-e2rhioty	101	3	,	,	,
cord-275413-e2rhioty	101	4	partially	partially	RB
cord-275413-e2rhioty	101	5	mummified	mummify	VBN
cord-275413-e2rhioty	101	6	;	;	:
cord-275413-e2rhioty	101	7	*	*	NFP
cord-275413-e2rhioty	101	8	2	2	CD
cord-275413-e2rhioty	101	9	,	,	,
cord-275413-e2rhioty	101	10	non	non	JJ
cord-275413-e2rhioty	101	11	-	-	JJ
cord-275413-e2rhioty	101	12	viable	viable	JJ
cord-275413-e2rhioty	101	13	fetus	fetus	NN
cord-275413-e2rhioty	101	14	or	or	CC
cord-275413-e2rhioty	101	15	relatively	relatively	RB
cord-275413-e2rhioty	101	16	low	low	JJ
cord-275413-e2rhioty	101	17	quantity	quantity	NN
cord-275413-e2rhioty	101	18	of	of	IN
cord-275413-e2rhioty	101	19	amniotic	amniotic	NN
cord-275413-e2rhioty	101	20	fluid	fluid	NN
cord-275413-e2rhioty	101	21	;	;	:
cord-275413-e2rhioty	101	22	*	*	NFP
cord-275413-e2rhioty	101	23	3	3	CD
cord-275413-e2rhioty	101	24	,	,	,
cord-275413-e2rhioty	101	25	necrotic	necrotic	JJ
cord-275413-e2rhioty	101	26	placenta	placenta	NN
cord-275413-e2rhioty	101	27	;	;	.
cord-275413-e2rhioty	102	1	*	*	NFP
cord-275413-e2rhioty	102	2	4	4	CD
cord-275413-e2rhioty	102	3	,	,	,
cord-275413-e2rhioty	102	4	merconium	merconium	NNP
cord-275413-e2rhioty	102	5	-	-	HYPH
cord-275413-e2rhioty	102	6	and	and	CC
cord-275413-e2rhioty	102	7	/	/	SYM
cord-275413-e2rhioty	102	8	or	or	CC
cord-275413-e2rhioty	102	9	blood	blood	NN
cord-275413-e2rhioty	102	10	-	-	HYPH
cord-275413-e2rhioty	102	11	stained	stain	VBN
cord-275413-e2rhioty	102	12	amniotic	amniotic	NN
cord-275413-e2rhioty	102	13	fluid	fluid	NN
cord-275413-e2rhioty	102	14	;	;	.
cord-275413-e2rhioty	103	1	*	*	NFP
cord-275413-e2rhioty	103	2	5	5	CD
cord-275413-e2rhioty	103	3	,	,	,
cord-275413-e2rhioty	103	4	small	small	JJ
cord-275413-e2rhioty	103	5	,	,	,
cord-275413-e2rhioty	103	6	underdeveloped	underdeveloped	JJ
cord-275413-e2rhioty	103	7	fetus	fetus	NN
cord-275413-e2rhioty	103	8	.	.	.
cord-275413-e2rhioty	104	1	in	in	IN
cord-275413-e2rhioty	104	2	the	the	DT
cord-275413-e2rhioty	104	3	fetal	fetal	JJ
cord-275413-e2rhioty	104	4	circulation	circulation	NN
cord-275413-e2rhioty	104	5	was	be	VBD
cord-275413-e2rhioty	104	6	the	the	DT
cord-275413-e2rhioty	104	7	result	result	NN
cord-275413-e2rhioty	104	8	of	of	IN
cord-275413-e2rhioty	104	9	virus	virus	NN
cord-275413-e2rhioty	104	10	replication	replication	NN
cord-275413-e2rhioty	104	11	in	in	IN
cord-275413-e2rhioty	104	12	the	the	DT
cord-275413-e2rhioty	104	13	fetus	fetus	NN
cord-275413-e2rhioty	104	14	and	and	CC
cord-275413-e2rhioty	104	15	not	not	RB
cord-275413-e2rhioty	104	16	from	from	IN
cord-275413-e2rhioty	104	17	contamination	contamination	NN
cord-275413-e2rhioty	104	18	with	with	IN
cord-275413-e2rhioty	104	19	maternal	maternal	JJ
cord-275413-e2rhioty	104	20	blood	blood	NN
cord-275413-e2rhioty	104	21	.	.	.
cord-275413-e2rhioty	105	1	(	(	-LRB-
cord-275413-e2rhioty	105	2	The	the	DT
cord-275413-e2rhioty	105	3	virus	virus	NN
cord-275413-e2rhioty	105	4	isolation	isolation	NN
cord-275413-e2rhioty	105	5	technique	technique	NN
cord-275413-e2rhioty	105	6	is	be	VBZ
cord-275413-e2rhioty	105	7	not	not	RB
cord-275413-e2rhioty	105	8	subject	subject	JJ
cord-275413-e2rhioty	105	9	to	to	IN
cord-275413-e2rhioty	105	10	false	false	JJ
cord-275413-e2rhioty	105	11	positives	positive	NNS
cord-275413-e2rhioty	105	12	from	from	IN
cord-275413-e2rhioty	105	13	minute	minute	JJ
cord-275413-e2rhioty	105	14	amounts	amount	NNS
cord-275413-e2rhioty	105	15	of	of	IN
cord-275413-e2rhioty	105	16	cross	cross	NN
cord-275413-e2rhioty	105	17	-	-	NN
cord-275413-e2rhioty	105	18	contamination	contamination	NN
cord-275413-e2rhioty	105	19	with	with	IN
cord-275413-e2rhioty	105	20	viral	viral	JJ
cord-275413-e2rhioty	105	21	protein	protein	NN
cord-275413-e2rhioty	105	22	or	or	CC
cord-275413-e2rhioty	105	23	RNA	RNA	NNP
cord-275413-e2rhioty	105	24	.	.	.
cord-275413-e2rhioty	105	25	)	)	-RRB-
cord-275413-e2rhioty	106	1	The	the	DT
cord-275413-e2rhioty	106	2	number	number	NN
cord-275413-e2rhioty	106	3	of	of	IN
cord-275413-e2rhioty	106	4	infected	infected	JJ
cord-275413-e2rhioty	106	5	fetuses	fetus	NNS
cord-275413-e2rhioty	106	6	in	in	IN
cord-275413-e2rhioty	106	7	each	each	DT
cord-275413-e2rhioty	106	8	litter	litter	NN
cord-275413-e2rhioty	106	9	varied	varied	JJ
cord-275413-e2rhioty	106	10	from	from	IN
cord-275413-e2rhioty	106	11	no	no	DT
cord-275413-e2rhioty	106	12	infected	infect	VBN
cord-275413-e2rhioty	106	13	fetuses	fetus	NNS
cord-275413-e2rhioty	106	14	(	(	-LRB-
cord-275413-e2rhioty	106	15	dam	dam	VBP
cord-275413-e2rhioty	106	16	no	no	NN
cord-275413-e2rhioty	106	17	.	.	NN
cord-275413-e2rhioty	106	18	2	2	CD
cord-275413-e2rhioty	106	19	)	)	-RRB-
cord-275413-e2rhioty	106	20	to	to	IN
cord-275413-e2rhioty	106	21	five	five	CD
cord-275413-e2rhioty	106	22	of	of	IN
cord-275413-e2rhioty	106	23	14	14	CD
cord-275413-e2rhioty	106	24	(	(	-LRB-
cord-275413-e2rhioty	106	25	36	36	CD
cord-275413-e2rhioty	106	26	%	%	NN
cord-275413-e2rhioty	106	27	)	)	-RRB-
cord-275413-e2rhioty	106	28	infected	infect	VBN
cord-275413-e2rhioty	106	29	fetuses	fetus	NNS
cord-275413-e2rhioty	106	30	for	for	IN
cord-275413-e2rhioty	106	31	dam	dam	NN
cord-275413-e2rhioty	106	32	no	no	NN
cord-275413-e2rhioty	106	33	.	.	NN
cord-275413-e2rhioty	106	34	4	4	CD
cord-275413-e2rhioty	106	35	.	.	.
cord-275413-e2rhioty	107	1	Fetuses	fetus	NNS
cord-275413-e2rhioty	107	2	that	that	WDT
cord-275413-e2rhioty	107	3	were	be	VBD
cord-275413-e2rhioty	107	4	VI	vi	NN
cord-275413-e2rhioty	107	5	-	-	HYPH
cord-275413-e2rhioty	107	6	negative	negative	JJ
cord-275413-e2rhioty	107	7	in	in	IN
cord-275413-e2rhioty	107	8	serum	serum	NN
cord-275413-e2rhioty	107	9	were	be	VBD
cord-275413-e2rhioty	107	10	confirmed	confirm	VBN
cord-275413-e2rhioty	107	11	as	as	IN
cord-275413-e2rhioty	107	12	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	107	13	-	-	HYPH
cord-275413-e2rhioty	107	14	negative	negative	JJ
cord-275413-e2rhioty	107	15	by	by	IN
cord-275413-e2rhioty	107	16	VI	vi	NN
cord-275413-e2rhioty	107	17	-	-	HYPH
cord-275413-e2rhioty	107	18	negative	negative	JJ
cord-275413-e2rhioty	107	19	results	result	NNS
cord-275413-e2rhioty	107	20	in	in	IN
cord-275413-e2rhioty	107	21	placenta	placenta	NN
cord-275413-e2rhioty	107	22	,	,	,
cord-275413-e2rhioty	107	23	lung	lung	NN
cord-275413-e2rhioty	107	24	,	,	,
cord-275413-e2rhioty	107	25	lymph	lymph	NN
cord-275413-e2rhioty	107	26	nodes	node	NNS
cord-275413-e2rhioty	107	27	and	and	CC
cord-275413-e2rhioty	107	28	thymus	thymus	NN
cord-275413-e2rhioty	107	29	(	(	-LRB-
cord-275413-e2rhioty	107	30	data	datum	NNS
cord-275413-e2rhioty	107	31	not	not	RB
cord-275413-e2rhioty	107	32	shown	show	VBN
cord-275413-e2rhioty	107	33	)	)	-RRB-
cord-275413-e2rhioty	107	34	.	.	.
cord-275413-e2rhioty	108	1	One	one	CD
cord-275413-e2rhioty	108	2	fetus	fetus	NN
cord-275413-e2rhioty	108	3	,	,	,
cord-275413-e2rhioty	108	4	1	1	CD
cord-275413-e2rhioty	108	5	-	-	SYM
cord-275413-e2rhioty	108	6	1	1	CD
cord-275413-e2rhioty	108	7	,	,	,
cord-275413-e2rhioty	108	8	was	be	VBD
cord-275413-e2rhioty	108	9	seropositive	seropositive	JJ
cord-275413-e2rhioty	108	10	for	for	IN
cord-275413-e2rhioty	108	11	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	109	1	(	(	-LRB-
cord-275413-e2rhioty	109	2	S	S	NNP
cord-275413-e2rhioty	109	3	/	/	SYM
cord-275413-e2rhioty	109	4	P	p	NN
cord-275413-e2rhioty	109	5	ratio	ratio	NN
cord-275413-e2rhioty	109	6	=	=	SYM
cord-275413-e2rhioty	109	7	0.94	0.94	CD
cord-275413-e2rhioty	109	8	)	)	-RRB-
cord-275413-e2rhioty	109	9	.	.	.
cord-275413-e2rhioty	110	1	Since	since	IN
cord-275413-e2rhioty	110	2	there	there	EX
cord-275413-e2rhioty	110	3	is	be	VBZ
cord-275413-e2rhioty	110	4	no	no	DT
cord-275413-e2rhioty	110	5	maternal	maternal	JJ
cord-275413-e2rhioty	110	6	transfer	transfer	NN
cord-275413-e2rhioty	110	7	of	of	IN
cord-275413-e2rhioty	110	8	antibody	antibody	NN
cord-275413-e2rhioty	110	9	from	from	IN
cord-275413-e2rhioty	110	10	mother	mother	NN
cord-275413-e2rhioty	110	11	to	to	IN
cord-275413-e2rhioty	110	12	fetus	fetus	NN
cord-275413-e2rhioty	110	13	(	(	-LRB-
cord-275413-e2rhioty	110	14	Tizard	Tizard	NNP
cord-275413-e2rhioty	110	15	,	,	,
cord-275413-e2rhioty	110	16	1996	1996	CD
cord-275413-e2rhioty	110	17	)	)	-RRB-
cord-275413-e2rhioty	110	18	,	,	,
cord-275413-e2rhioty	110	19	it	-PRON-	PRP
cord-275413-e2rhioty	110	20	was	be	VBD
cord-275413-e2rhioty	110	21	concluded	conclude	VBN
cord-275413-e2rhioty	110	22	that	that	IN
cord-275413-e2rhioty	110	23	this	this	DT
cord-275413-e2rhioty	110	24	fetus	fetus	NN
cord-275413-e2rhioty	110	25	generated	generate	VBD
cord-275413-e2rhioty	110	26	an	an	DT
cord-275413-e2rhioty	110	27	antibody	antibody	NN
cord-275413-e2rhioty	110	28	response	response	NN
cord-275413-e2rhioty	110	29	to	to	IN
cord-275413-e2rhioty	110	30	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	110	31	in	in	IN
cord-275413-e2rhioty	110	32	utero	utero	NNS
cord-275413-e2rhioty	110	33	.	.	.
cord-275413-e2rhioty	111	1	7	7	CD
cord-275413-e2rhioty	111	2	of	of	IN
cord-275413-e2rhioty	111	3	the	the	DT
cord-275413-e2rhioty	111	4	10	10	CD
cord-275413-e2rhioty	111	5	infected	infected	JJ
cord-275413-e2rhioty	111	6	fetuses	fetus	NNS
cord-275413-e2rhioty	111	7	showed	show	VBD
cord-275413-e2rhioty	111	8	some	some	DT
cord-275413-e2rhioty	111	9	form	form	NN
cord-275413-e2rhioty	111	10	of	of	IN
cord-275413-e2rhioty	111	11	gross	gross	JJ
cord-275413-e2rhioty	111	12	pathology	pathology	NN
cord-275413-e2rhioty	111	13	,	,	,
cord-275413-e2rhioty	111	14	including	include	VBG
cord-275413-e2rhioty	111	15	growth	growth	NN
cord-275413-e2rhioty	111	16	retardation	retardation	NN
cord-275413-e2rhioty	111	17	(	(	-LRB-
cord-275413-e2rhioty	111	18	two	two	CD
cord-275413-e2rhioty	111	19	fetuses	fetus	NNS
cord-275413-e2rhioty	111	20	)	)	-RRB-
cord-275413-e2rhioty	111	21	or	or	CC
cord-275413-e2rhioty	111	22	reduced	reduce	VBN
cord-275413-e2rhioty	111	23	amounts	amount	NNS
cord-275413-e2rhioty	111	24	and/or	and/or	CC
cord-275413-e2rhioty	111	25	merconium	merconium	NN
cord-275413-e2rhioty	111	26	-	-	HYPH
cord-275413-e2rhioty	111	27	stained	stain	VBN
cord-275413-e2rhioty	111	28	amniotic	amniotic	NN
cord-275413-e2rhioty	111	29	fluid	fluid	NN
cord-275413-e2rhioty	111	30	(	(	-LRB-
cord-275413-e2rhioty	111	31	five	five	CD
cord-275413-e2rhioty	111	32	fetuses	fetus	NNS
cord-275413-e2rhioty	111	33	)	)	-RRB-
cord-275413-e2rhioty	111	34	.	.	.
cord-275413-e2rhioty	112	1	Ongoing	ongoing	JJ
cord-275413-e2rhioty	112	2	virus	virus	NN
cord-275413-e2rhioty	112	3	replication	replication	NN
cord-275413-e2rhioty	112	4	in	in	IN
cord-275413-e2rhioty	112	5	the	the	DT
cord-275413-e2rhioty	112	6	fetus	fetus	NN
cord-275413-e2rhioty	112	7	as	as	IN
cord-275413-e2rhioty	112	8	the	the	DT
cord-275413-e2rhioty	112	9	source	source	NN
cord-275413-e2rhioty	112	10	of	of	IN
cord-275413-e2rhioty	112	11	these	these	DT
cord-275413-e2rhioty	112	12	gross	gross	JJ
cord-275413-e2rhioty	112	13	pathological	pathological	JJ
cord-275413-e2rhioty	112	14	changes	change	NNS
cord-275413-e2rhioty	112	15	is	be	VBZ
cord-275413-e2rhioty	112	16	questionable	questionable	JJ
cord-275413-e2rhioty	112	17	,	,	,
cord-275413-e2rhioty	112	18	since	since	IN
cord-275413-e2rhioty	112	19	non	non	JJ
cord-275413-e2rhioty	112	20	-	-	JJ
cord-275413-e2rhioty	112	21	infected	infected	JJ
cord-275413-e2rhioty	112	22	fetuses	fetus	NNS
cord-275413-e2rhioty	112	23	from	from	IN
cord-275413-e2rhioty	112	24	infected	infected	JJ
cord-275413-e2rhioty	112	25	dams	dam	NNS
cord-275413-e2rhioty	112	26	exhibited	exhibit	VBD
cord-275413-e2rhioty	112	27	similar	similar	JJ
cord-275413-e2rhioty	112	28	changes	change	NNS
cord-275413-e2rhioty	112	29	.	.	.
cord-275413-e2rhioty	113	1	For	for	IN
cord-275413-e2rhioty	113	2	example	example	NN
cord-275413-e2rhioty	113	3	,	,	,
cord-275413-e2rhioty	113	4	fetuses	fetus	NNS
cord-275413-e2rhioty	113	5	from	from	IN
cord-275413-e2rhioty	113	6	dam	dam	NN
cord-275413-e2rhioty	113	7	no	no	NN
cord-275413-e2rhioty	113	8	.	.	NN
cord-275413-e2rhioty	113	9	2	2	LS
cord-275413-e2rhioty	113	10	(	(	-LRB-
cord-275413-e2rhioty	113	11	see	see	VB
cord-275413-e2rhioty	113	12	Fig	Fig	NNP
cord-275413-e2rhioty	113	13	.	.	.
cord-275413-e2rhioty	114	1	1	1	LS
cord-275413-e2rhioty	114	2	)	)	-RRB-
cord-275413-e2rhioty	114	3	were	be	VBD
cord-275413-e2rhioty	114	4	either	either	RB
cord-275413-e2rhioty	114	5	merconium	merconium	NN
cord-275413-e2rhioty	114	6	stained	stain	VBN
cord-275413-e2rhioty	114	7	(	(	-LRB-
cord-275413-e2rhioty	114	8	two	two	CD
cord-275413-e2rhioty	114	9	fetuses	fetus	NNS
cord-275413-e2rhioty	114	10	)	)	-RRB-
cord-275413-e2rhioty	114	11	,	,	,
cord-275413-e2rhioty	114	12	non	non	JJ
cord-275413-e2rhioty	114	13	-	-	JJ
cord-275413-e2rhioty	114	14	viable	viable	JJ
cord-275413-e2rhioty	114	15	,	,	,
cord-275413-e2rhioty	114	16	possessed	possess	VBD
cord-275413-e2rhioty	114	17	reduced	reduced	JJ
cord-275413-e2rhioty	114	18	amniotic	amniotic	NN
cord-275413-e2rhioty	114	19	fluid	fluid	NN
cord-275413-e2rhioty	114	20	levels	level	NNS
cord-275413-e2rhioty	114	21	(	(	-LRB-
cord-275413-e2rhioty	114	22	four	four	CD
cord-275413-e2rhioty	114	23	fetuses	fetus	NNS
cord-275413-e2rhioty	114	24	)	)	-RRB-
cord-275413-e2rhioty	114	25	or	or	CC
cord-275413-e2rhioty	114	26	small	small	JJ
cord-275413-e2rhioty	114	27	(	(	-LRB-
cord-275413-e2rhioty	114	28	one	one	CD
cord-275413-e2rhioty	114	29	fetus	fetus	NN
cord-275413-e2rhioty	114	30	)	)	-RRB-
cord-275413-e2rhioty	114	31	.	.	.
cord-275413-e2rhioty	115	1	Except	except	IN
cord-275413-e2rhioty	115	2	for	for	IN
cord-275413-e2rhioty	115	3	one	one	CD
cord-275413-e2rhioty	115	4	autolysed	autolysed	JJ
cord-275413-e2rhioty	115	5	fetus	fetus	NN
cord-275413-e2rhioty	115	6	,	,	,
cord-275413-e2rhioty	115	7	the	the	DT
cord-275413-e2rhioty	115	8	23	23	CD
cord-275413-e2rhioty	115	9	fetuses	fetus	NNS
cord-275413-e2rhioty	115	10	from	from	IN
cord-275413-e2rhioty	115	11	the	the	DT
cord-275413-e2rhioty	115	12	two	two	CD
cord-275413-e2rhioty	115	13	control	control	NN
cord-275413-e2rhioty	115	14	dams	dam	NNS
cord-275413-e2rhioty	115	15	showed	show	VBD
cord-275413-e2rhioty	115	16	no	no	DT
cord-275413-e2rhioty	115	17	evidence	evidence	NN
cord-275413-e2rhioty	115	18	of	of	IN
cord-275413-e2rhioty	115	19	gross	gross	JJ
cord-275413-e2rhioty	115	20	pathology	pathology	NN
cord-275413-e2rhioty	115	21	(	(	-LRB-
cord-275413-e2rhioty	115	22	data	datum	NNS
cord-275413-e2rhioty	115	23	not	not	RB
cord-275413-e2rhioty	115	24	shown	show	VBN
cord-275413-e2rhioty	115	25	)	)	-RRB-
cord-275413-e2rhioty	115	26	.	.	.
cord-275413-e2rhioty	116	1	RNA	RNA	NNP
cord-275413-e2rhioty	116	2	viruses	virus	NNS
cord-275413-e2rhioty	116	3	frequently	frequently	RB
cord-275413-e2rhioty	116	4	exist	exist	VBP
cord-275413-e2rhioty	116	5	as	as	IN
cord-275413-e2rhioty	116	6	a	a	DT
cord-275413-e2rhioty	116	7	heterogeneous	heterogeneous	JJ
cord-275413-e2rhioty	116	8	population	population	NN
cord-275413-e2rhioty	116	9	,	,	,
cord-275413-e2rhioty	116	10	frequently	frequently	RB
cord-275413-e2rhioty	116	11	referred	refer	VBD
cord-275413-e2rhioty	116	12	to	to	IN
cord-275413-e2rhioty	116	13	as	as	IN
cord-275413-e2rhioty	116	14	a	a	DT
cord-275413-e2rhioty	116	15	quasispecies	quasispecie	NNS
cord-275413-e2rhioty	116	16	.	.	.
cord-275413-e2rhioty	117	1	The	the	DT
cord-275413-e2rhioty	117	2	appearance	appearance	NN
cord-275413-e2rhioty	117	3	or	or	CC
cord-275413-e2rhioty	117	4	disappearance	disappearance	NN
cord-275413-e2rhioty	117	5	of	of	IN
cord-275413-e2rhioty	117	6	individual	individual	JJ
cord-275413-e2rhioty	117	7	viral	viral	JJ
cord-275413-e2rhioty	117	8	sequences	sequence	NNS
cord-275413-e2rhioty	117	9	within	within	IN
cord-275413-e2rhioty	117	10	a	a	DT
cord-275413-e2rhioty	117	11	quasispecies	quasispecie	NNS
cord-275413-e2rhioty	117	12	population	population	NN
cord-275413-e2rhioty	117	13	is	be	VBZ
cord-275413-e2rhioty	117	14	often	often	RB
cord-275413-e2rhioty	117	15	used	use	VBN
cord-275413-e2rhioty	117	16	as	as	IN
cord-275413-e2rhioty	117	17	evidence	evidence	NN
cord-275413-e2rhioty	117	18	to	to	TO
cord-275413-e2rhioty	117	19	support	support	VB
cord-275413-e2rhioty	117	20	the	the	DT
cord-275413-e2rhioty	117	21	existence	existence	NN
cord-275413-e2rhioty	117	22	of	of	IN
cord-275413-e2rhioty	117	23	positive	positive	JJ
cord-275413-e2rhioty	117	24	or	or	CC
cord-275413-e2rhioty	117	25	negative	negative	JJ
cord-275413-e2rhioty	117	26	selection	selection	NN
cord-275413-e2rhioty	117	27	during	during	IN
cord-275413-e2rhioty	117	28	infection	infection	NN
cord-275413-e2rhioty	117	29	(	(	-LRB-
cord-275413-e2rhioty	117	30	Elena	Elena	NNP
cord-275413-e2rhioty	117	31	et	et	FW
cord-275413-e2rhioty	117	32	al	al	NNP
cord-275413-e2rhioty	117	33	.	.	.
cord-275413-e2rhioty	118	1	,	,	,
cord-275413-e2rhioty	118	2	2000	2000	CD
cord-275413-e2rhioty	118	3	;	;	:
cord-275413-e2rhioty	118	4	Forns	Forns	NNP
cord-275413-e2rhioty	118	5	et	et	NNP
cord-275413-e2rhioty	118	6	al	al	NNP
cord-275413-e2rhioty	118	7	.	.	NNP
cord-275413-e2rhioty	118	8	,	,	,
cord-275413-e2rhioty	118	9	1999	1999	CD
cord-275413-e2rhioty	118	10	;	;	:
cord-275413-e2rhioty	119	1	Tsibris	Tsibris	NNP
cord-275413-e2rhioty	119	2	et	et	FW
cord-275413-e2rhioty	119	3	al	al	NNP
cord-275413-e2rhioty	119	4	.	.	NNP
cord-275413-e2rhioty	119	5	,	,	,
cord-275413-e2rhioty	119	6	2009	2009	CD
cord-275413-e2rhioty	119	7	)	)	-RRB-
cord-275413-e2rhioty	119	8	.	.	.
cord-275413-e2rhioty	120	1	Mutations	mutation	NNS
cord-275413-e2rhioty	120	2	that	that	WDT
cord-275413-e2rhioty	120	3	appear	appear	VBP
cord-275413-e2rhioty	120	4	in	in	IN
cord-275413-e2rhioty	120	5	the	the	DT
cord-275413-e2rhioty	120	6	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	120	7	genome	genome	NN
cord-275413-e2rhioty	120	8	are	be	VBP
cord-275413-e2rhioty	120	9	useful	useful	JJ
cord-275413-e2rhioty	120	10	as	as	IN
cord-275413-e2rhioty	120	11	markers	marker	NNS
cord-275413-e2rhioty	120	12	to	to	TO
cord-275413-e2rhioty	120	13	identify	identify	VB
cord-275413-e2rhioty	120	14	and	and	CC
cord-275413-e2rhioty	120	15	follow	follow	VB
cord-275413-e2rhioty	120	16	the	the	DT
cord-275413-e2rhioty	120	17	appearance	appearance	NN
cord-275413-e2rhioty	120	18	and	and	CC
cord-275413-e2rhioty	120	19	disappearance	disappearance	NN
cord-275413-e2rhioty	120	20	of	of	IN
cord-275413-e2rhioty	120	21	viruses	virus	NNS
cord-275413-e2rhioty	120	22	within	within	IN
cord-275413-e2rhioty	120	23	the	the	DT
cord-275413-e2rhioty	120	24	population	population	NN
cord-275413-e2rhioty	120	25	(	(	-LRB-
cord-275413-e2rhioty	120	26	Allende	Allende	NNP
cord-275413-e2rhioty	120	27	et	et	NNP
cord-275413-e2rhioty	120	28	al	al	NNP
cord-275413-e2rhioty	120	29	.	.	NNP
cord-275413-e2rhioty	120	30	,	,	,
cord-275413-e2rhioty	120	31	2000	2000	CD
cord-275413-e2rhioty	120	32	;	;	:
cord-275413-e2rhioty	120	33	Rowland	Rowland	NNP
cord-275413-e2rhioty	120	34	et	et	NNP
cord-275413-e2rhioty	120	35	al	al	NNP
cord-275413-e2rhioty	120	36	.	.	NNP
cord-275413-e2rhioty	120	37	,	,	,
cord-275413-e2rhioty	120	38	1999	1999	CD
cord-275413-e2rhioty	120	39	)	)	-RRB-
cord-275413-e2rhioty	120	40	.	.	.
cord-275413-e2rhioty	121	1	DNA	dna	NN
cord-275413-e2rhioty	121	2	sequencing	sequencing	NN
cord-275413-e2rhioty	121	3	of	of	IN
cord-275413-e2rhioty	121	4	ORF5	ORF5	NNP
cord-275413-e2rhioty	121	5	PCR	PCR	NNP
cord-275413-e2rhioty	121	6	products	product	NNS
cord-275413-e2rhioty	121	7	,	,	,
cord-275413-e2rhioty	121	8	amplified	amplify	VBN
cord-275413-e2rhioty	121	9	directly	directly	RB
cord-275413-e2rhioty	121	10	from	from	IN
cord-275413-e2rhioty	121	11	the	the	DT
cord-275413-e2rhioty	121	12	sera	sera	NNP
cord-275413-e2rhioty	121	13	of	of	IN
cord-275413-e2rhioty	121	14	infected	infected	JJ
cord-275413-e2rhioty	121	15	dams	dam	NNS
cord-275413-e2rhioty	121	16	,	,	,
cord-275413-e2rhioty	121	17	Table	Table	NNP
cord-275413-e2rhioty	121	18	3	3	CD
cord-275413-e2rhioty	121	19	Frequency	Frequency	NNP
cord-275413-e2rhioty	121	20	of	of	IN
cord-275413-e2rhioty	121	21	T	T	NNP
cord-275413-e2rhioty	121	22	at	at	IN
cord-275413-e2rhioty	121	23	nucleotide	nucleotide	JJ
cord-275413-e2rhioty	121	24	position	position	NN
cord-275413-e2rhioty	121	25	77	77	CD
cord-275413-e2rhioty	121	26	of	of	IN
cord-275413-e2rhioty	121	27	ORF5	ORF5	NNP
cord-275413-e2rhioty	121	28	.	.	.
cord-275413-e2rhioty	122	1	Consensus	consensus	NN
cord-275413-e2rhioty	122	2	nucleotide	nucleotide	JJ
cord-275413-e2rhioty	122	3	at	at	IN
cord-275413-e2rhioty	122	4	position	position	NN
cord-275413-e2rhioty	122	5	77	77	CD
cord-275413-e2rhioty	122	6	of	of	IN
cord-275413-e2rhioty	122	7	ORF5	ORF5	NNP
cord-275413-e2rhioty	122	8	T	t	NN
cord-275413-e2rhioty	122	9	:	:	:
cord-275413-e2rhioty	123	1	C	c	NN
cord-275413-e2rhioty	123	2	ratio	ratio	NN
cord-275413-e2rhioty	123	3	in	in	IN
cord-275413-e2rhioty	123	4	cloned	clone	VBN
cord-275413-e2rhioty	123	5	PCR	PCR	NNP
cord-275413-e2rhioty	123	6	products	product	NNS
cord-275413-e2rhioty	123	7	(	(	-LRB-
cord-275413-e2rhioty	123	8	percent	percent	NN
cord-275413-e2rhioty	123	9	)	)	-RRB-
cord-275413-e2rhioty	124	1	T	T	NNP
cord-275413-e2rhioty	124	2	3/5	3/5	CD
cord-275413-e2rhioty	124	3	(	(	-LRB-
cord-275413-e2rhioty	124	4	60	60	CD
cord-275413-e2rhioty	124	5	)	)	-RRB-
cord-275413-e2rhioty	125	1	Fetus	fetus	NN
cord-275413-e2rhioty	125	2	4	4	CD
cord-275413-e2rhioty	125	3	-	-	SYM
cord-275413-e2rhioty	125	4	09	09	CD
cord-275413-e2rhioty	125	5	T	T	NNP
cord-275413-e2rhioty	125	6	6/7	6/7	CD
cord-275413-e2rhioty	125	7	(	(	-LRB-
cord-275413-e2rhioty	125	8	86	86	CD
cord-275413-e2rhioty	125	9	)	)	-RRB-
cord-275413-e2rhioty	126	1	Fetus	fetus	NN
cord-275413-e2rhioty	126	2	4	4	CD
cord-275413-e2rhioty	126	3	-	-	SYM
cord-275413-e2rhioty	126	4	10	10	CD
cord-275413-e2rhioty	126	5	T	T	NNP
cord-275413-e2rhioty	126	6	3/6	3/6	CD
cord-275413-e2rhioty	126	7	(	(	-LRB-
cord-275413-e2rhioty	126	8	50	50	CD
cord-275413-e2rhioty	126	9	)	)	-RRB-
cord-275413-e2rhioty	127	1	Fetus	fetus	NN
cord-275413-e2rhioty	127	2	4	4	CD
cord-275413-e2rhioty	127	3	-	-	SYM
cord-275413-e2rhioty	127	4	11	11	CD
cord-275413-e2rhioty	127	5	C	c	NN
cord-275413-e2rhioty	127	6	1/4	1/4	CD
cord-275413-e2rhioty	127	7	(	(	-LRB-
cord-275413-e2rhioty	127	8	25	25	CD
cord-275413-e2rhioty	127	9	)	)	-RRB-
cord-275413-e2rhioty	128	1	Fetus	fetus	NN
cord-275413-e2rhioty	128	2	4	4	CD
cord-275413-e2rhioty	128	3	-	-	SYM
cord-275413-e2rhioty	128	4	12	12	CD
cord-275413-e2rhioty	128	5	T	T	NNP
cord-275413-e2rhioty	128	6	6/6	6/6	CD
cord-275413-e2rhioty	128	7	(	(	-LRB-
cord-275413-e2rhioty	128	8	100	100	CD
cord-275413-e2rhioty	128	9	)	)	-RRB-
cord-275413-e2rhioty	129	1	Fetus	fetus	NN
cord-275413-e2rhioty	129	2	4	4	CD
cord-275413-e2rhioty	129	3	-	-	SYM
cord-275413-e2rhioty	129	4	13	13	CD
cord-275413-e2rhioty	129	5	T	T	NNP
cord-275413-e2rhioty	129	6	5/5	5/5	CD
cord-275413-e2rhioty	129	7	(	(	-LRB-
cord-275413-e2rhioty	129	8	100	100	CD
cord-275413-e2rhioty	129	9	)	)	-RRB-
cord-275413-e2rhioty	129	10	identified	identify	VBD
cord-275413-e2rhioty	129	11	one	one	CD
cord-275413-e2rhioty	129	12	dam	dam	NN
cord-275413-e2rhioty	129	13	,	,	,
cord-275413-e2rhioty	129	14	no	no	NN
cord-275413-e2rhioty	129	15	.	.	NN
cord-275413-e2rhioty	129	16	4	4	CD
cord-275413-e2rhioty	129	17	,	,	,
cord-275413-e2rhioty	129	18	which	which	WDT
cord-275413-e2rhioty	129	19	possessed	possess	VBD
cord-275413-e2rhioty	129	20	a	a	DT
cord-275413-e2rhioty	129	21	virus	virus	NN
cord-275413-e2rhioty	129	22	with	with	IN
cord-275413-e2rhioty	129	23	a	a	DT
cord-275413-e2rhioty	129	24	mutation	mutation	NN
cord-275413-e2rhioty	129	25	within	within	IN
cord-275413-e2rhioty	129	26	the	the	DT
cord-275413-e2rhioty	129	27	hypervariable	hypervariable	JJ
cord-275413-e2rhioty	129	28	region	region	NN
cord-275413-e2rhioty	129	29	of	of	IN
cord-275413-e2rhioty	129	30	ORF5	ORF5	NNP
cord-275413-e2rhioty	129	31	.	.	.
cord-275413-e2rhioty	130	1	The	the	DT
cord-275413-e2rhioty	130	2	change	change	NN
cord-275413-e2rhioty	130	3	detected	detect	VBN
cord-275413-e2rhioty	130	4	by	by	IN
cord-275413-e2rhioty	130	5	sequencing	sequence	VBG
cord-275413-e2rhioty	130	6	the	the	DT
cord-275413-e2rhioty	130	7	PCR	PCR	NNP
cord-275413-e2rhioty	130	8	product	product	NN
cord-275413-e2rhioty	130	9	was	be	VBD
cord-275413-e2rhioty	130	10	a	a	DT
cord-275413-e2rhioty	130	11	C	c	NN
cord-275413-e2rhioty	130	12	to	to	IN
cord-275413-e2rhioty	130	13	T	T	NNP
cord-275413-e2rhioty	130	14	(	(	-LRB-
cord-275413-e2rhioty	130	15	U	U	NNP
cord-275413-e2rhioty	130	16	for	for	IN
cord-275413-e2rhioty	130	17	RNA	RNA	NNP
cord-275413-e2rhioty	130	18	)	)	-RRB-
cord-275413-e2rhioty	130	19	nucleotide	nucleotide	JJ
cord-275413-e2rhioty	130	20	transition	transition	NN
cord-275413-e2rhioty	130	21	at	at	IN
cord-275413-e2rhioty	130	22	position	position	NN
cord-275413-e2rhioty	130	23	77	77	CD
cord-275413-e2rhioty	130	24	that	that	WDT
cord-275413-e2rhioty	130	25	resulted	result	VBD
cord-275413-e2rhioty	130	26	in	in	IN
cord-275413-e2rhioty	130	27	a	a	DT
cord-275413-e2rhioty	130	28	non	non	JJ
cord-275413-e2rhioty	130	29	-	-	JJ
cord-275413-e2rhioty	130	30	conserved	conserved	JJ
cord-275413-e2rhioty	130	31	amino	amino	NN
cord-275413-e2rhioty	130	32	acid	acid	NN
cord-275413-e2rhioty	130	33	change	change	NN
cord-275413-e2rhioty	130	34	from	from	IN
cord-275413-e2rhioty	130	35	threonine	threonine	NN
cord-275413-e2rhioty	130	36	to	to	IN
cord-275413-e2rhioty	130	37	isoleucine	isoleucine	NNP
cord-275413-e2rhioty	130	38	in	in	IN
cord-275413-e2rhioty	130	39	GP5	GP5	NNP
cord-275413-e2rhioty	130	40	.	.	.
cord-275413-e2rhioty	131	1	The	the	DT
cord-275413-e2rhioty	131	2	T-77	T-77	NNP
cord-275413-e2rhioty	131	3	mutation	mutation	NN
cord-275413-e2rhioty	131	4	was	be	VBD
cord-275413-e2rhioty	131	5	not	not	RB
cord-275413-e2rhioty	131	6	detected	detect	VBN
cord-275413-e2rhioty	131	7	after	after	IN
cord-275413-e2rhioty	131	8	sequencing	sequence	VBG
cord-275413-e2rhioty	131	9	the	the	DT
cord-275413-e2rhioty	131	10	ORF5	ORF5	NNP
cord-275413-e2rhioty	131	11	PCR	PCR	NNP
cord-275413-e2rhioty	131	12	products	product	NNS
cord-275413-e2rhioty	131	13	from	from	IN
cord-275413-e2rhioty	131	14	the	the	DT
cord-275413-e2rhioty	131	15	other	other	JJ
cord-275413-e2rhioty	131	16	dams	dam	NNS
cord-275413-e2rhioty	131	17	(	(	-LRB-
cord-275413-e2rhioty	131	18	see	see	VB
cord-275413-e2rhioty	131	19	Table	Table	NNP
cord-275413-e2rhioty	131	20	3	3	CD
cord-275413-e2rhioty	131	21	)	)	-RRB-
cord-275413-e2rhioty	131	22	.	.	.
cord-275413-e2rhioty	132	1	PCR	PCR	NNP
cord-275413-e2rhioty	132	2	products	product	NNS
cord-275413-e2rhioty	132	3	were	be	VBD
cord-275413-e2rhioty	132	4	cloned	clone	VBN
cord-275413-e2rhioty	132	5	into	into	IN
cord-275413-e2rhioty	132	6	a	a	DT
cord-275413-e2rhioty	132	7	TA	TA	NNP
cord-275413-e2rhioty	132	8	plasmid	plasmid	NN
cord-275413-e2rhioty	132	9	and	and	CC
cord-275413-e2rhioty	132	10	the	the	DT
cord-275413-e2rhioty	132	11	individual	individual	JJ
cord-275413-e2rhioty	132	12	plasmids	plasmid	NNS
cord-275413-e2rhioty	132	13	sequenced	sequence	VBN
cord-275413-e2rhioty	132	14	.	.	.
cord-275413-e2rhioty	133	1	Even	even	RB
cord-275413-e2rhioty	133	2	though	though	IN
cord-275413-e2rhioty	133	3	T-77	T-77	NNP
cord-275413-e2rhioty	133	4	was	be	VBD
cord-275413-e2rhioty	133	5	detected	detect	VBN
cord-275413-e2rhioty	133	6	in	in	IN
cord-275413-e2rhioty	133	7	the	the	DT
cord-275413-e2rhioty	133	8	PCR	PCR	NNP
cord-275413-e2rhioty	133	9	product	product	NN
cord-275413-e2rhioty	133	10	from	from	IN
cord-275413-e2rhioty	133	11	dam	dam	NN
cord-275413-e2rhioty	133	12	no	no	NN
cord-275413-e2rhioty	133	13	.	.	NN
cord-275413-e2rhioty	133	14	4	4	CD
cord-275413-e2rhioty	133	15	,	,	,
cord-275413-e2rhioty	133	16	the	the	DT
cord-275413-e2rhioty	133	17	sequence	sequence	NN
cord-275413-e2rhioty	133	18	of	of	IN
cord-275413-e2rhioty	133	19	individual	individual	JJ
cord-275413-e2rhioty	133	20	clones	clone	NNS
cord-275413-e2rhioty	133	21	showed	show	VBD
cord-275413-e2rhioty	133	22	that	that	IN
cord-275413-e2rhioty	133	23	two	two	CD
cord-275413-e2rhioty	133	24	of	of	IN
cord-275413-e2rhioty	133	25	the	the	DT
cord-275413-e2rhioty	133	26	five	five	CD
cord-275413-e2rhioty	133	27	sequences	sequence	NNS
cord-275413-e2rhioty	133	28	possessed	possess	VBD
cord-275413-e2rhioty	133	29	a	a	DT
cord-275413-e2rhioty	133	30	C	c	NN
cord-275413-e2rhioty	133	31	at	at	IN
cord-275413-e2rhioty	133	32	position	position	NN
cord-275413-e2rhioty	133	33	77	77	CD
cord-275413-e2rhioty	133	34	mutation	mutation	NN
cord-275413-e2rhioty	133	35	,	,	,
cord-275413-e2rhioty	133	36	which	which	WDT
cord-275413-e2rhioty	133	37	indicated	indicate	VBD
cord-275413-e2rhioty	133	38	that	that	IN
cord-275413-e2rhioty	133	39	viruses	virus	NNS
cord-275413-e2rhioty	133	40	with	with	IN
cord-275413-e2rhioty	133	41	the	the	DT
cord-275413-e2rhioty	133	42	wild	wild	JJ
cord-275413-e2rhioty	133	43	-	-	HYPH
cord-275413-e2rhioty	133	44	type	type	NN
cord-275413-e2rhioty	133	45	ORF5	orf5	NN
cord-275413-e2rhioty	133	46	sequence	sequence	NN
cord-275413-e2rhioty	133	47	were	be	VBD
cord-275413-e2rhioty	133	48	still	still	RB
cord-275413-e2rhioty	133	49	present	present	JJ
cord-275413-e2rhioty	133	50	in	in	IN
cord-275413-e2rhioty	133	51	the	the	DT
cord-275413-e2rhioty	133	52	population	population	NN
cord-275413-e2rhioty	133	53	.	.	.
cord-275413-e2rhioty	134	1	Whole	whole	JJ
cord-275413-e2rhioty	134	2	PCR	pcr	NN
cord-275413-e2rhioty	134	3	and	and	CC
cord-275413-e2rhioty	134	4	plasmid	plasmid	NN
cord-275413-e2rhioty	134	5	-	-	HYPH
cord-275413-e2rhioty	134	6	cloned	clone	VBN
cord-275413-e2rhioty	134	7	PCR	PCR	NNP
cord-275413-e2rhioty	134	8	products	product	NNS
cord-275413-e2rhioty	134	9	were	be	VBD
cord-275413-e2rhioty	134	10	sequenced	sequence	VBN
cord-275413-e2rhioty	134	11	for	for	IN
cord-275413-e2rhioty	134	12	the	the	DT
cord-275413-e2rhioty	134	13	five	five	CD
cord-275413-e2rhioty	134	14	infected	infected	JJ
cord-275413-e2rhioty	134	15	fetuses	fetus	NNS
cord-275413-e2rhioty	134	16	from	from	IN
cord-275413-e2rhioty	134	17	dam	dam	NN
cord-275413-e2rhioty	134	18	no	no	NN
cord-275413-e2rhioty	134	19	.	.	NN
cord-275413-e2rhioty	134	20	4	4	CD
cord-275413-e2rhioty	134	21	.	.	.
cord-275413-e2rhioty	135	1	The	the	DT
cord-275413-e2rhioty	135	2	frequency	frequency	NN
cord-275413-e2rhioty	135	3	of	of	IN
cord-275413-e2rhioty	135	4	the	the	DT
cord-275413-e2rhioty	135	5	T-77	T-77	NNP
cord-275413-e2rhioty	135	6	mutation	mutation	NN
cord-275413-e2rhioty	135	7	ranged	range	VBD
cord-275413-e2rhioty	135	8	from	from	IN
cord-275413-e2rhioty	135	9	25	25	CD
cord-275413-e2rhioty	135	10	%	%	NN
cord-275413-e2rhioty	135	11	(	(	-LRB-
cord-275413-e2rhioty	135	12	fetus	fetus	NN
cord-275413-e2rhioty	135	13	4	4	CD
cord-275413-e2rhioty	135	14	-	-	SYM
cord-275413-e2rhioty	135	15	11	11	CD
cord-275413-e2rhioty	135	16	)	)	-RRB-
cord-275413-e2rhioty	135	17	to	to	IN
cord-275413-e2rhioty	135	18	100	100	CD
cord-275413-e2rhioty	135	19	%	%	NN
cord-275413-e2rhioty	135	20	(	(	-LRB-
cord-275413-e2rhioty	135	21	fetuses	fetus	NNS
cord-275413-e2rhioty	135	22	4	4	CD
cord-275413-e2rhioty	135	23	-	-	SYM
cord-275413-e2rhioty	135	24	12	12	CD
cord-275413-e2rhioty	135	25	and	and	CC
cord-275413-e2rhioty	135	26	4	4	CD
cord-275413-e2rhioty	135	27	-	-	SYM
cord-275413-e2rhioty	135	28	13	13	CD
cord-275413-e2rhioty	135	29	)	)	-RRB-
cord-275413-e2rhioty	135	30	.	.	.
cord-275413-e2rhioty	136	1	These	these	DT
cord-275413-e2rhioty	136	2	results	result	NNS
cord-275413-e2rhioty	136	3	indicate	indicate	VBP
cord-275413-e2rhioty	136	4	that	that	IN
cord-275413-e2rhioty	136	5	the	the	DT
cord-275413-e2rhioty	136	6	fetus	fetus	NN
cord-275413-e2rhioty	136	7	is	be	VBZ
cord-275413-e2rhioty	136	8	capable	capable	JJ
cord-275413-e2rhioty	136	9	of	of	IN
cord-275413-e2rhioty	136	10	selecting	select	VBG
cord-275413-e2rhioty	136	11	for	for	IN
cord-275413-e2rhioty	136	12	a	a	DT
cord-275413-e2rhioty	136	13	particular	particular	JJ
cord-275413-e2rhioty	136	14	virus	virus	NN
cord-275413-e2rhioty	136	15	population	population	NN
cord-275413-e2rhioty	136	16	,	,	,
cord-275413-e2rhioty	136	17	which	which	WDT
cord-275413-e2rhioty	136	18	either	either	CC
cord-275413-e2rhioty	136	19	arises	arise	VBZ
cord-275413-e2rhioty	136	20	in	in	IN
cord-275413-e2rhioty	136	21	the	the	DT
cord-275413-e2rhioty	136	22	dam	dam	NN
cord-275413-e2rhioty	136	23	or	or	CC
cord-275413-e2rhioty	136	24	fetus	fetus	NN
cord-275413-e2rhioty	136	25	.	.	.
cord-275413-e2rhioty	137	1	Therefore	therefore	RB
cord-275413-e2rhioty	137	2	,	,	,
cord-275413-e2rhioty	137	3	fetal	fetal	JJ
cord-275413-e2rhioty	137	4	infection	infection	NN
cord-275413-e2rhioty	137	5	is	be	VBZ
cord-275413-e2rhioty	137	6	a	a	DT
cord-275413-e2rhioty	137	7	potential	potential	JJ
cord-275413-e2rhioty	137	8	source	source	NN
cord-275413-e2rhioty	137	9	of	of	IN
cord-275413-e2rhioty	137	10	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	137	11	diversity	diversity	NN
cord-275413-e2rhioty	137	12	.	.	.
cord-275413-e2rhioty	138	1	During	during	IN
cord-275413-e2rhioty	138	2	acute	acute	JJ
cord-275413-e2rhioty	138	3	infection	infection	NN
cord-275413-e2rhioty	138	4	of	of	IN
cord-275413-e2rhioty	138	5	the	the	DT
cord-275413-e2rhioty	138	6	postnatal	postnatal	JJ
cord-275413-e2rhioty	138	7	pig	pig	NN
cord-275413-e2rhioty	138	8	,	,	,
cord-275413-e2rhioty	138	9	the	the	DT
cord-275413-e2rhioty	138	10	largest	large	JJS
cord-275413-e2rhioty	138	11	quantity	quantity	NN
cord-275413-e2rhioty	138	12	of	of	IN
cord-275413-e2rhioty	138	13	virus	virus	NN
cord-275413-e2rhioty	138	14	and	and	CC
cord-275413-e2rhioty	138	15	greatest	great	JJS
cord-275413-e2rhioty	138	16	number	number	NN
cord-275413-e2rhioty	138	17	of	of	IN
cord-275413-e2rhioty	138	18	cells	cell	NNS
cord-275413-e2rhioty	138	19	supporting	support	VBG
cord-275413-e2rhioty	138	20	virus	virus	NN
cord-275413-e2rhioty	138	21	replication	replication	NN
cord-275413-e2rhioty	138	22	are	be	VBP
cord-275413-e2rhioty	138	23	found	find	VBN
cord-275413-e2rhioty	138	24	in	in	IN
cord-275413-e2rhioty	138	25	the	the	DT
cord-275413-e2rhioty	138	26	lung	lung	NN
cord-275413-e2rhioty	138	27	,	,	,
cord-275413-e2rhioty	138	28	a	a	DT
cord-275413-e2rhioty	138	29	consequence	consequence	NN
cord-275413-e2rhioty	138	30	of	of	IN
cord-275413-e2rhioty	138	31	targeting	target	VBG
cord-275413-e2rhioty	138	32	alveolar	alveolar	NN
cord-275413-e2rhioty	138	33	macrophages	macrophage	NNS
cord-275413-e2rhioty	138	34	.	.	.
cord-275413-e2rhioty	139	1	During	during	IN
cord-275413-e2rhioty	139	2	the	the	DT
cord-275413-e2rhioty	139	3	later	later	JJ
cord-275413-e2rhioty	139	4	stages	stage	NNS
cord-275413-e2rhioty	139	5	of	of	IN
cord-275413-e2rhioty	139	6	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	139	7	infection	infection	NN
cord-275413-e2rhioty	139	8	,	,	,
cord-275413-e2rhioty	139	9	secondary	secondary	JJ
cord-275413-e2rhioty	139	10	lymphoid	lymphoid	JJ
cord-275413-e2rhioty	139	11	organs	organ	NNS
cord-275413-e2rhioty	139	12	,	,	,
cord-275413-e2rhioty	139	13	including	include	VBG
cord-275413-e2rhioty	139	14	tonsil	tonsil	NN
cord-275413-e2rhioty	139	15	and	and	CC
cord-275413-e2rhioty	139	16	lymph	lymph	NN
cord-275413-e2rhioty	139	17	nodes	node	NNS
cord-275413-e2rhioty	139	18	,	,	,
cord-275413-e2rhioty	139	19	become	become	VB
cord-275413-e2rhioty	139	20	sources	source	NNS
cord-275413-e2rhioty	139	21	of	of	IN
cord-275413-e2rhioty	139	22	virus	virus	NN
cord-275413-e2rhioty	139	23	replication	replication	NN
cord-275413-e2rhioty	139	24	(	(	-LRB-
cord-275413-e2rhioty	139	25	Allende	Allende	NNP
cord-275413-e2rhioty	139	26	et	et	NNP
cord-275413-e2rhioty	139	27	al	al	NNP
cord-275413-e2rhioty	139	28	.	.	NNP
cord-275413-e2rhioty	139	29	,	,	,
cord-275413-e2rhioty	139	30	2000	2000	CD
cord-275413-e2rhioty	139	31	;	;	:
cord-275413-e2rhioty	139	32	Rossow	Rossow	NNP
cord-275413-e2rhioty	139	33	,	,	,
cord-275413-e2rhioty	139	34	1998	1998	CD
cord-275413-e2rhioty	139	35	;	;	:
cord-275413-e2rhioty	139	36	Rowland	Rowland	NNP
cord-275413-e2rhioty	139	37	et	et	NNP
cord-275413-e2rhioty	139	38	al	al	NNP
cord-275413-e2rhioty	139	39	.	.	NNP
cord-275413-e2rhioty	139	40	,	,	,
cord-275413-e2rhioty	139	41	1999	1999	CD
cord-275413-e2rhioty	139	42	;	;	:
cord-275413-e2rhioty	139	43	.	.	.
cord-275413-e2rhioty	140	1	Virus	virus	NN
cord-275413-e2rhioty	140	2	replication	replication	NN
cord-275413-e2rhioty	140	3	in	in	IN
cord-275413-e2rhioty	140	4	fetal	fetal	JJ
cord-275413-e2rhioty	140	5	tissues	tissue	NNS
cord-275413-e2rhioty	140	6	was	be	VBD
cord-275413-e2rhioty	140	7	assessed	assess	VBN
cord-275413-e2rhioty	140	8	using	use	VBG
cord-275413-e2rhioty	140	9	a	a	DT
cord-275413-e2rhioty	140	10	combination	combination	NN
cord-275413-e2rhioty	140	11	of	of	IN
cord-275413-e2rhioty	140	12	virus	virus	NN
cord-275413-e2rhioty	140	13	isolation	isolation	NN
cord-275413-e2rhioty	140	14	and	and	CC
cord-275413-e2rhioty	140	15	IHC	IHC	NNP
cord-275413-e2rhioty	140	16	detection	detection	NN
cord-275413-e2rhioty	140	17	of	of	IN
cord-275413-e2rhioty	140	18	nucleocapsid	nucleocapsid	NN
cord-275413-e2rhioty	140	19	antigen	antigen	NN
cord-275413-e2rhioty	140	20	in	in	IN
cord-275413-e2rhioty	140	21	formalin	formalin	NN
cord-275413-e2rhioty	140	22	-	-	HYPH
cord-275413-e2rhioty	140	23	fixed	fix	VBN
cord-275413-e2rhioty	140	24	tissues	tissue	NNS
cord-275413-e2rhioty	140	25	.	.	.
cord-275413-e2rhioty	141	1	As	as	IN
cord-275413-e2rhioty	141	2	summarized	summarize	VBN
cord-275413-e2rhioty	141	3	in	in	IN
cord-275413-e2rhioty	141	4	Table	Table	NNP
cord-275413-e2rhioty	141	5	4	4	CD
cord-275413-e2rhioty	141	6	,	,	,
cord-275413-e2rhioty	141	7	virus	virus	NN
cord-275413-e2rhioty	141	8	was	be	VBD
cord-275413-e2rhioty	141	9	isolated	isolate	VBN
cord-275413-e2rhioty	141	10	from	from	IN
cord-275413-e2rhioty	141	11	all	all	DT
cord-275413-e2rhioty	141	12	tissues	tissue	NNS
cord-275413-e2rhioty	141	13	from	from	IN
cord-275413-e2rhioty	141	14	infected	infected	JJ
cord-275413-e2rhioty	141	15	fetuses	fetus	NNS
cord-275413-e2rhioty	141	16	,	,	,
cord-275413-e2rhioty	141	17	including	include	VBG
cord-275413-e2rhioty	141	18	placenta	placenta	NN
cord-275413-e2rhioty	141	19	,	,	,
cord-275413-e2rhioty	141	20	umbilical	umbilical	JJ
cord-275413-e2rhioty	141	21	cord	cord	NN
cord-275413-e2rhioty	141	22	,	,	,
cord-275413-e2rhioty	141	23	heart	heart	NN
cord-275413-e2rhioty	141	24	,	,	,
cord-275413-e2rhioty	141	25	lung	lung	NN
cord-275413-e2rhioty	141	26	,	,	,
cord-275413-e2rhioty	141	27	spleen	spleen	NNS
cord-275413-e2rhioty	141	28	,	,	,
cord-275413-e2rhioty	141	29	lymph	lymph	NN
cord-275413-e2rhioty	141	30	nodes	node	NNS
cord-275413-e2rhioty	141	31	and	and	CC
cord-275413-e2rhioty	141	32	thymus	thymus	NN
cord-275413-e2rhioty	141	33	.	.	.
cord-275413-e2rhioty	142	1	Overall	overall	RB
cord-275413-e2rhioty	142	2	,	,	,
cord-275413-e2rhioty	142	3	the	the	DT
cord-275413-e2rhioty	142	4	thymus	thymus	NN
cord-275413-e2rhioty	142	5	contained	contain	VBD
cord-275413-e2rhioty	142	6	the	the	DT
cord-275413-e2rhioty	142	7	largest	large	JJS
cord-275413-e2rhioty	142	8	quantity	quantity	NN
cord-275413-e2rhioty	142	9	of	of	IN
cord-275413-e2rhioty	142	10	virus	virus	NN
cord-275413-e2rhioty	142	11	.	.	.
cord-275413-e2rhioty	143	1	Nine	nine	CD
cord-275413-e2rhioty	143	2	of	of	IN
cord-275413-e2rhioty	143	3	ten	ten	CD
cord-275413-e2rhioty	143	4	fetuses	fetus	NNS
cord-275413-e2rhioty	143	5	yielded	yield	VBD
cord-275413-e2rhioty	143	6	measurable	measurable	JJ
cord-275413-e2rhioty	143	7	amounts	amount	NNS
cord-275413-e2rhioty	143	8	of	of	IN
cord-275413-e2rhioty	143	9	virus	virus	NN
cord-275413-e2rhioty	143	10	with	with	IN
cord-275413-e2rhioty	143	11	five	five	CD
cord-275413-e2rhioty	143	12	of	of	IN
cord-275413-e2rhioty	143	13	the	the	DT
cord-275413-e2rhioty	143	14	ten	ten	CD
cord-275413-e2rhioty	143	15	fetal	fetal	JJ
cord-275413-e2rhioty	143	16	thymuses	thymus	NNS
cord-275413-e2rhioty	143	17	producing	produce	VBG
cord-275413-e2rhioty	143	18	titers	titer	NNS
cord-275413-e2rhioty	143	19	greater	great	JJR
cord-275413-e2rhioty	143	20	than	than	IN
cord-275413-e2rhioty	143	21	3.0	3.0	CD
cord-275413-e2rhioty	143	22	.	.	.
cord-275413-e2rhioty	144	1	For	for	IN
cord-275413-e2rhioty	144	2	lung	lung	NN
cord-275413-e2rhioty	144	3	,	,	,
cord-275413-e2rhioty	144	4	6	6	CD
cord-275413-e2rhioty	144	5	of	of	IN
cord-275413-e2rhioty	144	6	10	10	CD
cord-275413-e2rhioty	144	7	fetuses	fetus	NNS
cord-275413-e2rhioty	144	8	were	be	VBD
cord-275413-e2rhioty	144	9	VI	vi	NN
cord-275413-e2rhioty	144	10	-	-	HYPH
cord-275413-e2rhioty	144	11	positive	positive	JJ
cord-275413-e2rhioty	144	12	and	and	CC
cord-275413-e2rhioty	144	13	only	only	RB
cord-275413-e2rhioty	144	14	one	one	CD
cord-275413-e2rhioty	144	15	fetal	fetal	JJ
cord-275413-e2rhioty	144	16	lung	lung	NN
cord-275413-e2rhioty	144	17	yielded	yield	VBD
cord-275413-e2rhioty	144	18	a	a	DT
cord-275413-e2rhioty	144	19	virus	virus	NN
cord-275413-e2rhioty	144	20	titer	titer	NN
cord-275413-e2rhioty	144	21	greater	great	JJR
cord-275413-e2rhioty	144	22	than	than	IN
cord-275413-e2rhioty	144	23	2.0	2.0	CD
cord-275413-e2rhioty	144	24	.	.	.
cord-275413-e2rhioty	145	1	The	the	DT
cord-275413-e2rhioty	145	2	recovery	recovery	NN
cord-275413-e2rhioty	145	3	of	of	IN
cord-275413-e2rhioty	145	4	virus	virus	NN
cord-275413-e2rhioty	145	5	from	from	IN
cord-275413-e2rhioty	145	6	a	a	DT
cord-275413-e2rhioty	145	7	tissue	tissue	NN
cord-275413-e2rhioty	145	8	can	can	MD
cord-275413-e2rhioty	145	9	represent	represent	VB
cord-275413-e2rhioty	145	10	virus	virus	NN
cord-275413-e2rhioty	145	11	in	in	IN
cord-275413-e2rhioty	145	12	circulating	circulate	VBG
cord-275413-e2rhioty	145	13	blood	blood	NN
cord-275413-e2rhioty	145	14	.	.	.
cord-275413-e2rhioty	146	1	Therefore	therefore	RB
cord-275413-e2rhioty	146	2	,	,	,
cord-275413-e2rhioty	146	3	to	to	TO
cord-275413-e2rhioty	146	4	determine	determine	VB
cord-275413-e2rhioty	146	5	if	if	IN
cord-275413-e2rhioty	146	6	cells	cell	NNS
cord-275413-e2rhioty	146	7	in	in	IN
cord-275413-e2rhioty	146	8	the	the	DT
cord-275413-e2rhioty	146	9	thymus	thymus	NN
cord-275413-e2rhioty	146	10	and	and	CC
cord-275413-e2rhioty	146	11	other	other	JJ
cord-275413-e2rhioty	146	12	tissues	tissue	NNS
cord-275413-e2rhioty	146	13	were	be	VBD
cord-275413-e2rhioty	146	14	a	a	DT
cord-275413-e2rhioty	146	15	source	source	NN
cord-275413-e2rhioty	146	16	of	of	IN
cord-275413-e2rhioty	146	17	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	146	18	,	,	,
cord-275413-e2rhioty	146	19	tissue	tissue	NN
cord-275413-e2rhioty	146	20	thin	thin	JJ
cord-275413-e2rhioty	146	21	sections	section	NNS
cord-275413-e2rhioty	146	22	were	be	VBD
cord-275413-e2rhioty	146	23	stained	stain	VBN
cord-275413-e2rhioty	146	24	with	with	IN
cord-275413-e2rhioty	146	25	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	146	26	anti	anti	NNP
cord-275413-e2rhioty	146	27	-	-	JJ
cord-275413-e2rhioty	146	28	nucleocapsid	nucleocapsid	JJ
cord-275413-e2rhioty	146	29	antibody	antibody	NN
cord-275413-e2rhioty	146	30	.	.	.
cord-275413-e2rhioty	147	1	The	the	DT
cord-275413-e2rhioty	147	2	IHC	IHC	NNP
cord-275413-e2rhioty	147	3	staining	staining	NN
cord-275413-e2rhioty	147	4	procedure	procedure	NN
cord-275413-e2rhioty	147	5	included	include	VBD
cord-275413-e2rhioty	147	6	two	two	CD
cord-275413-e2rhioty	147	7	sets	set	NNS
cord-275413-e2rhioty	147	8	of	of	IN
cord-275413-e2rhioty	147	9	negative	negative	JJ
cord-275413-e2rhioty	147	10	controls	control	NNS
cord-275413-e2rhioty	147	11	:	:	:
cord-275413-e2rhioty	147	12	tissue	tissue	NN
cord-275413-e2rhioty	147	13	thin	thin	JJ
cord-275413-e2rhioty	147	14	sections	section	NNS
cord-275413-e2rhioty	147	15	from	from	IN
cord-275413-e2rhioty	147	16	non	non	JJ
cord-275413-e2rhioty	147	17	-	-	JJ
cord-275413-e2rhioty	147	18	infected	infected	JJ
cord-275413-e2rhioty	147	19	fetuses	fetus	NNS
cord-275413-e2rhioty	147	20	and	and	CC
cord-275413-e2rhioty	147	21	from	from	IN
cord-275413-e2rhioty	147	22	infected	infected	JJ
cord-275413-e2rhioty	147	23	fetuses	fetus	NNS
cord-275413-e2rhioty	147	24	stained	stain	VBN
cord-275413-e2rhioty	147	25	with	with	IN
cord-275413-e2rhioty	147	26	only	only	JJ
cord-275413-e2rhioty	147	27	secondary	secondary	JJ
cord-275413-e2rhioty	147	28	antibody	antibody	NN
cord-275413-e2rhioty	147	29	.	.	.
cord-275413-e2rhioty	148	1	Both	both	DT
cord-275413-e2rhioty	148	2	controls	control	NNS
cord-275413-e2rhioty	148	3	were	be	VBD
cord-275413-e2rhioty	148	4	negative	negative	JJ
cord-275413-e2rhioty	148	5	for	for	IN
cord-275413-e2rhioty	148	6	staining	stain	VBG
cord-275413-e2rhioty	148	7	(	(	-LRB-
cord-275413-e2rhioty	148	8	data	datum	NNS
cord-275413-e2rhioty	148	9	not	not	RB
cord-275413-e2rhioty	148	10	shown	show	VBN
cord-275413-e2rhioty	148	11	)	)	-RRB-
cord-275413-e2rhioty	148	12	.	.	.
cord-275413-e2rhioty	149	1	The	the	DT
cord-275413-e2rhioty	149	2	results	result	NNS
cord-275413-e2rhioty	149	3	in	in	IN
cord-275413-e2rhioty	149	4	Table	Table	NNP
cord-275413-e2rhioty	149	5	4	4	CD
cord-275413-e2rhioty	149	6	showed	show	VBD
cord-275413-e2rhioty	149	7	the	the	DT
cord-275413-e2rhioty	149	8	largest	large	JJS
cord-275413-e2rhioty	149	9	number	number	NN
cord-275413-e2rhioty	149	10	of	of	IN
cord-275413-e2rhioty	149	11	positive	positive	JJ
cord-275413-e2rhioty	149	12	tissues	tissue	NNS
cord-275413-e2rhioty	149	13	for	for	IN
cord-275413-e2rhioty	149	14	the	the	DT
cord-275413-e2rhioty	149	15	thymus	thymus	NN
cord-275413-e2rhioty	149	16	(	(	-LRB-
cord-275413-e2rhioty	149	17	8	8	CD
cord-275413-e2rhioty	149	18	of	of	IN
cord-275413-e2rhioty	149	19	10	10	CD
cord-275413-e2rhioty	149	20	positive	positive	JJ
cord-275413-e2rhioty	149	21	)	)	-RRB-
cord-275413-e2rhioty	149	22	,	,	,
cord-275413-e2rhioty	149	23	followed	follow	VBN
cord-275413-e2rhioty	149	24	by	by	IN
cord-275413-e2rhioty	149	25	spleen	spleen	NNS
cord-275413-e2rhioty	149	26	(	(	-LRB-
cord-275413-e2rhioty	149	27	2	2	CD
cord-275413-e2rhioty	149	28	of	of	IN
cord-275413-e2rhioty	149	29	8	8	CD
cord-275413-e2rhioty	149	30	positive	positive	JJ
cord-275413-e2rhioty	149	31	)	)	-RRB-
cord-275413-e2rhioty	149	32	and	and	CC
cord-275413-e2rhioty	149	33	lymph	lymph	NN
cord-275413-e2rhioty	149	34	node	node	NN
cord-275413-e2rhioty	149	35	(	(	-LRB-
cord-275413-e2rhioty	149	36	1	1	CD
cord-275413-e2rhioty	149	37	of	of	IN
cord-275413-e2rhioty	149	38	9	9	CD
cord-275413-e2rhioty	149	39	positive	positive	JJ
cord-275413-e2rhioty	149	40	)	)	-RRB-
cord-275413-e2rhioty	149	41	.	.	.
cord-275413-e2rhioty	150	1	Within	within	IN
cord-275413-e2rhioty	150	2	the	the	DT
cord-275413-e2rhioty	150	3	thymus	thymus	NN
cord-275413-e2rhioty	150	4	,	,	,
cord-275413-e2rhioty	150	5	antigen	antigen	NN
cord-275413-e2rhioty	150	6	-	-	HYPH
cord-275413-e2rhioty	150	7	positive	positive	JJ
cord-275413-e2rhioty	150	8	cells	cell	NNS
cord-275413-e2rhioty	150	9	were	be	VBD
cord-275413-e2rhioty	150	10	located	locate	VBN
cord-275413-e2rhioty	150	11	in	in	IN
cord-275413-e2rhioty	150	12	both	both	DT
cord-275413-e2rhioty	150	13	medullar	medullar	JJ
cord-275413-e2rhioty	150	14	and	and	CC
cord-275413-e2rhioty	150	15	cortical	cortical	JJ
cord-275413-e2rhioty	150	16	regions	region	NNS
cord-275413-e2rhioty	150	17	(	(	-LRB-
cord-275413-e2rhioty	150	18	data	datum	NNS
cord-275413-e2rhioty	150	19	not	not	RB
cord-275413-e2rhioty	150	20	shown	show	VBN
cord-275413-e2rhioty	150	21	)	)	-RRB-
cord-275413-e2rhioty	150	22	.	.	.
cord-275413-e2rhioty	151	1	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	151	2	antigen	antigen	NN
cord-275413-e2rhioty	151	3	-	-	HYPH
cord-275413-e2rhioty	151	4	positive	positive	JJ
cord-275413-e2rhioty	151	5	cells	cell	NNS
cord-275413-e2rhioty	151	6	were	be	VBD
cord-275413-e2rhioty	151	7	not	not	RB
cord-275413-e2rhioty	151	8	detected	detect	VBN
cord-275413-e2rhioty	151	9	in	in	IN
cord-275413-e2rhioty	151	10	lung	lung	NN
cord-275413-e2rhioty	151	11	or	or	CC
cord-275413-e2rhioty	151	12	tonsil	tonsil	NN
cord-275413-e2rhioty	151	13	.	.	.
cord-275413-e2rhioty	152	1	Taken	take	VBN
cord-275413-e2rhioty	152	2	together	together	RB
cord-275413-e2rhioty	152	3	,	,	,
cord-275413-e2rhioty	152	4	the	the	DT
cord-275413-e2rhioty	152	5	virus	virus	NN
cord-275413-e2rhioty	152	6	titration	titration	NN
cord-275413-e2rhioty	152	7	and	and	CC
cord-275413-e2rhioty	152	8	IHC	IHC	NNP
cord-275413-e2rhioty	152	9	results	result	NNS
cord-275413-e2rhioty	152	10	identify	identify	VBP
cord-275413-e2rhioty	152	11	the	the	DT
cord-275413-e2rhioty	152	12	thymus	thymus	NN
cord-275413-e2rhioty	152	13	as	as	IN
cord-275413-e2rhioty	152	14	a	a	DT
cord-275413-e2rhioty	152	15	principal	principal	JJ
cord-275413-e2rhioty	152	16	source	source	NN
cord-275413-e2rhioty	152	17	of	of	IN
cord-275413-e2rhioty	152	18	virus	virus	NN
cord-275413-e2rhioty	152	19	replication	replication	NN
cord-275413-e2rhioty	152	20	in	in	IN
cord-275413-e2rhioty	152	21	the	the	DT
cord-275413-e2rhioty	152	22	PRRSVinfected	prrsvinfected	JJ
cord-275413-e2rhioty	152	23	fetus	fetus	NN
cord-275413-e2rhioty	152	24	.	.	.
cord-275413-e2rhioty	153	1	In	in	IN
cord-275413-e2rhioty	153	2	the	the	DT
cord-275413-e2rhioty	153	3	post	post	JJ
cord-275413-e2rhioty	153	4	-	-	JJ
cord-275413-e2rhioty	153	5	natal	natal	JJ
cord-275413-e2rhioty	153	6	pig	pig	NN
cord-275413-e2rhioty	153	7	,	,	,
cord-275413-e2rhioty	153	8	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	153	9	infection	infection	NN
cord-275413-e2rhioty	153	10	results	result	VBZ
cord-275413-e2rhioty	153	11	in	in	IN
cord-275413-e2rhioty	153	12	distinct	distinct	JJ
cord-275413-e2rhioty	153	13	pathology	pathology	NN
cord-275413-e2rhioty	153	14	in	in	IN
cord-275413-e2rhioty	153	15	the	the	DT
cord-275413-e2rhioty	153	16	lung	lung	NN
cord-275413-e2rhioty	153	17	,	,	,
cord-275413-e2rhioty	153	18	including	include	VBG
cord-275413-e2rhioty	153	19	the	the	DT
cord-275413-e2rhioty	153	20	appearance	appearance	NN
cord-275413-e2rhioty	153	21	of	of	IN
cord-275413-e2rhioty	153	22	interstitial	interstitial	JJ
cord-275413-e2rhioty	153	23	pneumonia	pneumonia	NN
cord-275413-e2rhioty	153	24	.	.	.
cord-275413-e2rhioty	154	1	Representative	representative	JJ
cord-275413-e2rhioty	154	2	lymph	lymph	NN
cord-275413-e2rhioty	154	3	node	node	NN
cord-275413-e2rhioty	154	4	and	and	CC
cord-275413-e2rhioty	154	5	lung	lung	NN
cord-275413-e2rhioty	154	6	tissues	tissue	NNS
cord-275413-e2rhioty	154	7	from	from	IN
cord-275413-e2rhioty	154	8	non	non	JJ
cord-275413-e2rhioty	154	9	-	-	JJ
cord-275413-e2rhioty	154	10	infected	infected	JJ
cord-275413-e2rhioty	154	11	and	and	CC
cord-275413-e2rhioty	154	12	infected	infected	JJ
cord-275413-e2rhioty	154	13	fetuses	fetus	NNS
cord-275413-e2rhioty	154	14	are	be	VBP
cord-275413-e2rhioty	154	15	shown	show	VBN
cord-275413-e2rhioty	154	16	in	in	IN
cord-275413-e2rhioty	154	17	Fig	Fig	NNP
cord-275413-e2rhioty	154	18	.	.	.
cord-275413-e2rhioty	155	1	2	2	LS
cord-275413-e2rhioty	155	2	.	.	.
cord-275413-e2rhioty	156	1	There	there	EX
cord-275413-e2rhioty	156	2	was	be	VBD
cord-275413-e2rhioty	156	3	no	no	DT
cord-275413-e2rhioty	156	4	discernable	discernable	JJ
cord-275413-e2rhioty	156	5	difference	difference	NN
cord-275413-e2rhioty	156	6	between	between	IN
cord-275413-e2rhioty	156	7	lungs	lung	NNS
cord-275413-e2rhioty	156	8	from	from	IN
cord-275413-e2rhioty	156	9	infected	infected	JJ
cord-275413-e2rhioty	156	10	and	and	CC
cord-275413-e2rhioty	156	11	non	non	JJ
cord-275413-e2rhioty	156	12	-	-	JJ
cord-275413-e2rhioty	156	13	infected	infected	JJ
cord-275413-e2rhioty	156	14	fetuses	fetus	NNS
cord-275413-e2rhioty	156	15	(	(	-LRB-
cord-275413-e2rhioty	156	16	compare	compare	VB
cord-275413-e2rhioty	156	17	Fig	Fig	NNP
cord-275413-e2rhioty	156	18	.	.	.
cord-275413-e2rhioty	157	1	2	2	CD
cord-275413-e2rhioty	157	2	panels	panel	NNS
cord-275413-e2rhioty	157	3	C	c	NN
cord-275413-e2rhioty	157	4	and	and	CC
cord-275413-e2rhioty	157	5	D	D	NNP
cord-275413-e2rhioty	157	6	)	)	-RRB-
cord-275413-e2rhioty	157	7	.	.	.
cord-275413-e2rhioty	158	1	Lymph	lymph	NN
cord-275413-e2rhioty	158	2	nodes	node	NNS
cord-275413-e2rhioty	158	3	from	from	IN
cord-275413-e2rhioty	158	4	PRRSV	prrsv	NN
cord-275413-e2rhioty	158	5	-	-	HYPH
cord-275413-e2rhioty	158	6	negative	negative	JJ
cord-275413-e2rhioty	158	7	fetuses	fetus	NNS
cord-275413-e2rhioty	158	8	appeared	appear	VBD
cord-275413-e2rhioty	158	9	largely	largely	RB
cord-275413-e2rhioty	158	10	undeveloped	undeveloped	JJ
cord-275413-e2rhioty	158	11	and	and	CC
cord-275413-e2rhioty	158	12	devoid	devoid	JJ
cord-275413-e2rhioty	158	13	of	of	IN
cord-275413-e2rhioty	158	14	well	well	RB
cord-275413-e2rhioty	158	15	-	-	HYPH
cord-275413-e2rhioty	158	16	defined	define	VBN
cord-275413-e2rhioty	158	17	germinal	germinal	JJ
cord-275413-e2rhioty	158	18	centers	center	NNS
cord-275413-e2rhioty	158	19	.	.	.
cord-275413-e2rhioty	159	1	In	in	IN
cord-275413-e2rhioty	159	2	contrast	contrast	NN
cord-275413-e2rhioty	159	3	,	,	,
cord-275413-e2rhioty	159	4	the	the	DT
cord-275413-e2rhioty	159	5	lymph	lymph	NN
cord-275413-e2rhioty	159	6	nodes	node	NNS
cord-275413-e2rhioty	159	7	from	from	IN
cord-275413-e2rhioty	159	8	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	159	9	-	-	HYPH
cord-275413-e2rhioty	159	10	infected	infect	VBN
cord-275413-e2rhioty	159	11	fetuses	fetus	NNS
cord-275413-e2rhioty	159	12	appeared	appear	VBD
cord-275413-e2rhioty	159	13	much	much	RB
cord-275413-e2rhioty	159	14	more	more	RBR
cord-275413-e2rhioty	159	15	pronounced	pronounced	JJ
cord-275413-e2rhioty	159	16	and	and	CC
cord-275413-e2rhioty	159	17	enlarged	enlarged	JJ
cord-275413-e2rhioty	159	18	.	.	.
cord-275413-e2rhioty	160	1	At	at	IN
cord-275413-e2rhioty	160	2	the	the	DT
cord-275413-e2rhioty	160	3	microscopic	microscopic	JJ
cord-275413-e2rhioty	160	4	level	level	NN
cord-275413-e2rhioty	160	5	,	,	,
cord-275413-e2rhioty	160	6	the	the	DT
cord-275413-e2rhioty	160	7	increased	increase	VBN
cord-275413-e2rhioty	160	8	lymph	lymph	NN
cord-275413-e2rhioty	160	9	node	node	NN
cord-275413-e2rhioty	160	10	volume	volume	NN
cord-275413-e2rhioty	160	11	was	be	VBD
cord-275413-e2rhioty	160	12	associated	associate	VBN
cord-275413-e2rhioty	160	13	with	with	IN
cord-275413-e2rhioty	160	14	increased	increase	VBN
cord-275413-e2rhioty	160	15	numbers	number	NNS
cord-275413-e2rhioty	160	16	of	of	IN
cord-275413-e2rhioty	160	17	cells	cell	NNS
cord-275413-e2rhioty	160	18	and	and	CC
cord-275413-e2rhioty	160	19	the	the	DT
cord-275413-e2rhioty	160	20	formation	formation	NN
cord-275413-e2rhioty	160	21	of	of	IN
cord-275413-e2rhioty	160	22	distinct	distinct	JJ
cord-275413-e2rhioty	160	23	germinal	germinal	JJ
cord-275413-e2rhioty	160	24	centers	center	NNS
cord-275413-e2rhioty	160	25	(	(	-LRB-
cord-275413-e2rhioty	160	26	see	see	VB
cord-275413-e2rhioty	160	27	Fig	Fig	NNP
cord-275413-e2rhioty	160	28	.	.	NNP
cord-275413-e2rhioty	160	29	2	2	CD
cord-275413-e2rhioty	160	30	panels	panel	NNS
cord-275413-e2rhioty	160	31	A	a	VBP
cord-275413-e2rhioty	160	32	and	and	CC
cord-275413-e2rhioty	160	33	 	 	_SP
cord-275413-e2rhioty	160	34	B	B	NNP
cord-275413-e2rhioty	160	35	)	)	-RRB-
cord-275413-e2rhioty	160	36	.	.	.
cord-275413-e2rhioty	161	1	The	the	DT
cord-275413-e2rhioty	161	2	overall	overall	JJ
cord-275413-e2rhioty	161	3	appearance	appearance	NN
cord-275413-e2rhioty	161	4	is	be	VBZ
cord-275413-e2rhioty	161	5	consistent	consistent	JJ
cord-275413-e2rhioty	161	6	with	with	IN
cord-275413-e2rhioty	161	7	an	an	DT
cord-275413-e2rhioty	161	8	antigen	antigen	NN
cord-275413-e2rhioty	161	9	-	-	HYPH
cord-275413-e2rhioty	161	10	activated	activate	VBN
cord-275413-e2rhioty	161	11	lymph	lymph	NN
cord-275413-e2rhioty	161	12	node	node	NN
cord-275413-e2rhioty	161	13	.	.	.
cord-275413-e2rhioty	162	1	To	to	TO
cord-275413-e2rhioty	162	2	determine	determine	VB
cord-275413-e2rhioty	162	3	the	the	DT
cord-275413-e2rhioty	162	4	source	source	NN
cord-275413-e2rhioty	162	5	of	of	IN
cord-275413-e2rhioty	162	6	the	the	DT
cord-275413-e2rhioty	162	7	increased	increase	VBN
cord-275413-e2rhioty	162	8	cell	cell	NN
cord-275413-e2rhioty	162	9	volume	volume	NN
cord-275413-e2rhioty	162	10	,	,	,
cord-275413-e2rhioty	162	11	formalin	formalin	NN
cord-275413-e2rhioty	162	12	-	-	HYPH
cord-275413-e2rhioty	162	13	fixed	fix	VBN
cord-275413-e2rhioty	162	14	thin	thin	JJ
cord-275413-e2rhioty	162	15	sections	section	NNS
cord-275413-e2rhioty	162	16	of	of	IN
cord-275413-e2rhioty	162	17	lymph	lymph	NN
cord-275413-e2rhioty	162	18	nodes	node	NNS
cord-275413-e2rhioty	162	19	were	be	VBD
cord-275413-e2rhioty	162	20	stained	stain	VBN
cord-275413-e2rhioty	162	21	with	with	IN
cord-275413-e2rhioty	162	22	T	T	NNP
cord-275413-e2rhioty	162	23	cell	cell	NN
cord-275413-e2rhioty	162	24	-	-	HYPH
cord-275413-e2rhioty	162	25	specific	specific	JJ
cord-275413-e2rhioty	162	26	(	(	-LRB-
cord-275413-e2rhioty	162	27	CD3	CD3	NNP
cord-275413-e2rhioty	162	28	)	)	-RRB-
cord-275413-e2rhioty	162	29	and	and	CC
cord-275413-e2rhioty	162	30	B	b	NN
cord-275413-e2rhioty	162	31	cell	cell	NN
cord-275413-e2rhioty	162	32	-	-	HYPH
cord-275413-e2rhioty	162	33	specific	specific	JJ
cord-275413-e2rhioty	162	34	(	(	-LRB-
cord-275413-e2rhioty	162	35	CDw75	CDw75	NNS
cord-275413-e2rhioty	162	36	and	and	CC
cord-275413-e2rhioty	162	37	CD79	CD79	NNP
cord-275413-e2rhioty	162	38	␣	␣	NNP
cord-275413-e2rhioty	162	39	)	)	-RRB-
cord-275413-e2rhioty	162	40	antibodies	antibody	NNS
cord-275413-e2rhioty	162	41	.	.	.
cord-275413-e2rhioty	163	1	Representative	representative	JJ
cord-275413-e2rhioty	163	2	results	result	NNS
cord-275413-e2rhioty	163	3	for	for	IN
cord-275413-e2rhioty	163	4	mandibular	mandibular	JJ
cord-275413-e2rhioty	163	5	lymph	lymph	NN
cord-275413-e2rhioty	163	6	nodes	node	NNS
cord-275413-e2rhioty	163	7	from	from	IN
cord-275413-e2rhioty	163	8	infected	infected	JJ
cord-275413-e2rhioty	163	9	and	and	CC
cord-275413-e2rhioty	163	10	non	non	JJ
cord-275413-e2rhioty	163	11	-	-	JJ
cord-275413-e2rhioty	163	12	infected	infected	JJ
cord-275413-e2rhioty	163	13	fetuses	fetus	NNS
cord-275413-e2rhioty	163	14	are	be	VBP
cord-275413-e2rhioty	163	15	shown	show	VBN
cord-275413-e2rhioty	163	16	in	in	IN
cord-275413-e2rhioty	163	17	Fig	Fig	NNP
cord-275413-e2rhioty	163	18	.	.	.
cord-275413-e2rhioty	164	1	3	3	LS
cord-275413-e2rhioty	164	2	.	.	.
cord-275413-e2rhioty	165	1	The	the	DT
cord-275413-e2rhioty	165	2	lymph	lymph	NN
cord-275413-e2rhioty	165	3	nodes	node	NNS
cord-275413-e2rhioty	165	4	from	from	IN
cord-275413-e2rhioty	165	5	both	both	CC
cord-275413-e2rhioty	165	6	infected	infected	JJ
cord-275413-e2rhioty	165	7	and	and	CC
cord-275413-e2rhioty	165	8	non	non	JJ
cord-275413-e2rhioty	165	9	-	-	JJ
cord-275413-e2rhioty	165	10	infected	infected	JJ
cord-275413-e2rhioty	165	11	fetuses	fetus	NNS
cord-275413-e2rhioty	165	12	showed	show	VBD
cord-275413-e2rhioty	165	13	exten-	exten-	JJ
cord-275413-e2rhioty	165	14	 	 	_SP
cord-275413-e2rhioty	165	15	sive	sive	JJ
cord-275413-e2rhioty	165	16	areas	area	NNS
cord-275413-e2rhioty	165	17	of	of	IN
cord-275413-e2rhioty	165	18	staining	stain	VBG
cord-275413-e2rhioty	165	19	with	with	IN
cord-275413-e2rhioty	165	20	anti	anti	JJ
cord-275413-e2rhioty	165	21	-	-	JJ
cord-275413-e2rhioty	165	22	CD3	CD3	NNP
cord-275413-e2rhioty	165	23	,	,	,
cord-275413-e2rhioty	165	24	indicating	indicate	VBG
cord-275413-e2rhioty	165	25	the	the	DT
cord-275413-e2rhioty	165	26	presence	presence	NN
cord-275413-e2rhioty	165	27	of	of	IN
cord-275413-e2rhioty	165	28	T	t	NN
cord-275413-e2rhioty	165	29	cells	cell	NNS
cord-275413-e2rhioty	165	30	.	.	.
cord-275413-e2rhioty	166	1	Lymph	lymph	NN
cord-275413-e2rhioty	166	2	nodes	node	NNS
cord-275413-e2rhioty	166	3	from	from	IN
cord-275413-e2rhioty	166	4	non	non	JJ
cord-275413-e2rhioty	166	5	-	-	JJ
cord-275413-e2rhioty	166	6	infected	infected	JJ
cord-275413-e2rhioty	166	7	fetuses	fetus	NNS
cord-275413-e2rhioty	166	8	were	be	VBD
cord-275413-e2rhioty	166	9	negative	negative	JJ
cord-275413-e2rhioty	166	10	for	for	IN
cord-275413-e2rhioty	166	11	CwD75	CwD75	NNP
cord-275413-e2rhioty	166	12	staining	staining	NN
cord-275413-e2rhioty	166	13	,	,	,
cord-275413-e2rhioty	166	14	but	but	CC
cord-275413-e2rhioty	166	15	possessed	possess	VBD
cord-275413-e2rhioty	166	16	some	some	DT
cord-275413-e2rhioty	166	17	regions	region	NNS
cord-275413-e2rhioty	166	18	that	that	WDT
cord-275413-e2rhioty	166	19	were	be	VBD
cord-275413-e2rhioty	166	20	positive	positive	JJ
cord-275413-e2rhioty	166	21	for	for	IN
cord-275413-e2rhioty	166	22	CD79	CD79	NNP
cord-275413-e2rhioty	167	1	␣	␣	NNP
cord-275413-e2rhioty	167	2	.	.	.
cord-275413-e2rhioty	168	1	The	the	DT
cord-275413-e2rhioty	168	2	B	b	NN
cord-275413-e2rhioty	168	3	cell	cell	NN
cord-275413-e2rhioty	168	4	receptor	receptor	NN
cord-275413-e2rhioty	168	5	for	for	IN
cord-275413-e2rhioty	168	6	antigen	antigen	NN
cord-275413-e2rhioty	168	7	(	(	-LRB-
cord-275413-e2rhioty	168	8	BCR	BCR	NNP
cord-275413-e2rhioty	168	9	)	)	-RRB-
cord-275413-e2rhioty	168	10	signal	signal	NN
cord-275413-e2rhioty	168	11	transduction	transduction	NN
cord-275413-e2rhioty	168	12	complex	complex	NN
cord-275413-e2rhioty	168	13	is	be	VBZ
cord-275413-e2rhioty	168	14	composed	compose	VBN
cord-275413-e2rhioty	168	15	of	of	IN
cord-275413-e2rhioty	168	16	a	a	DT
cord-275413-e2rhioty	168	17	heterodimer	heterodimer	NN
cord-275413-e2rhioty	168	18	of	of	IN
cord-275413-e2rhioty	168	19	Ig	Ig	NNP
cord-275413-e2rhioty	168	20	␣	␣	NNP
cord-275413-e2rhioty	168	21	and	and	CC
cord-275413-e2rhioty	168	22	Ig	Ig	NNP
cord-275413-e2rhioty	168	23	␤	␤	NNP
cord-275413-e2rhioty	168	24	chains	chain	NNS
cord-275413-e2rhioty	168	25	,	,	,
cord-275413-e2rhioty	168	26	which	which	WDT
cord-275413-e2rhioty	168	27	are	be	VBP
cord-275413-e2rhioty	168	28	also	also	RB
cord-275413-e2rhioty	168	29	known	know	VBN
cord-275413-e2rhioty	168	30	as	as	IN
cord-275413-e2rhioty	168	31	CD79	CD79	NNP
cord-275413-e2rhioty	169	1	␣	␣	NNP
cord-275413-e2rhioty	169	2	and	and	CC
cord-275413-e2rhioty	169	3	CD79	CD79	NNP
cord-275413-e2rhioty	169	4	␤	␤	NNP
cord-275413-e2rhioty	169	5	,	,	,
cord-275413-e2rhioty	169	6	respectively	respectively	RB
cord-275413-e2rhioty	169	7	.	.	.
cord-275413-e2rhioty	170	1	CD79	CD79	NNP
cord-275413-e2rhioty	171	1	␣	␣	LS
cord-275413-e2rhioty	171	2	staining	stain	VBG
cord-275413-e2rhioty	171	3	in	in	IN
cord-275413-e2rhioty	171	4	the	the	DT
cord-275413-e2rhioty	171	5	lymph	lymph	NN
cord-275413-e2rhioty	171	6	node	node	NN
cord-275413-e2rhioty	171	7	from	from	IN
cord-275413-e2rhioty	171	8	non	non	JJ
cord-275413-e2rhioty	171	9	-	-	JJ
cord-275413-e2rhioty	171	10	infected	infected	JJ
cord-275413-e2rhioty	171	11	fetuses	fetus	NNS
cord-275413-e2rhioty	171	12	is	be	VBZ
cord-275413-e2rhioty	171	13	consistent	consistent	JJ
cord-275413-e2rhioty	171	14	with	with	IN
cord-275413-e2rhioty	171	15	the	the	DT
cord-275413-e2rhioty	171	16	presence	presence	NN
cord-275413-e2rhioty	171	17	of	of	IN
cord-275413-e2rhioty	171	18	pro	pro	JJ
cord-275413-e2rhioty	171	19	-	-	JJ
cord-275413-e2rhioty	171	20	and	and	CC
cord-275413-e2rhioty	171	21	pre	pre	JJ
cord-275413-e2rhioty	171	22	-	-	JJ
cord-275413-e2rhioty	171	23	B	b	NN
cord-275413-e2rhioty	171	24	cells	cell	NNS
cord-275413-e2rhioty	171	25	(	(	-LRB-
cord-275413-e2rhioty	171	26	Lee	Lee	NNP
cord-275413-e2rhioty	171	27	et	et	NNP
cord-275413-e2rhioty	171	28	al	al	NNP
cord-275413-e2rhioty	171	29	.	.	NNP
cord-275413-e2rhioty	171	30	,	,	,
cord-275413-e2rhioty	171	31	2008	2008	CD
cord-275413-e2rhioty	171	32	)	)	-RRB-
cord-275413-e2rhioty	171	33	.	.	.
cord-275413-e2rhioty	172	1	The	the	DT
cord-275413-e2rhioty	172	2	principle	principle	JJ
cord-275413-e2rhioty	172	3	difference	difference	NN
cord-275413-e2rhioty	172	4	between	between	IN
cord-275413-e2rhioty	172	5	infected	infected	JJ
cord-275413-e2rhioty	172	6	and	and	CC
cord-275413-e2rhioty	172	7	non	non	JJ
cord-275413-e2rhioty	172	8	-	-	JJ
cord-275413-e2rhioty	172	9	infected	infected	JJ
cord-275413-e2rhioty	172	10	fetuses	fetus	NNS
cord-275413-e2rhioty	172	11	was	be	VBD
cord-275413-e2rhioty	172	12	found	find	VBN
cord-275413-e2rhioty	172	13	in	in	IN
cord-275413-e2rhioty	172	14	an	an	DT
cord-275413-e2rhioty	172	15	overall	overall	JJ
cord-275413-e2rhioty	172	16	increase	increase	NN
cord-275413-e2rhioty	172	17	in	in	IN
cord-275413-e2rhioty	172	18	CD79	CD79	NNP
cord-275413-e2rhioty	173	1	␣	␣	NNP
cord-275413-e2rhioty	173	2	+	+	CC
cord-275413-e2rhioty	173	3	cells	cell	NNS
cord-275413-e2rhioty	173	4	as	as	RB
cord-275413-e2rhioty	173	5	well	well	RB
cord-275413-e2rhioty	173	6	as	as	IN
cord-275413-e2rhioty	173	7	the	the	DT
cord-275413-e2rhioty	173	8	appearance	appearance	NN
cord-275413-e2rhioty	173	9	of	of	IN
cord-275413-e2rhioty	173	10	CDw75	CDw75	NNS
cord-275413-e2rhioty	173	11	+	+	CC
cord-275413-e2rhioty	173	12	cells	cell	NNS
cord-275413-e2rhioty	173	13	,	,	,
cord-275413-e2rhioty	173	14	which	which	WDT
cord-275413-e2rhioty	173	15	were	be	VBD
cord-275413-e2rhioty	173	16	associated	associate	VBN
cord-275413-e2rhioty	173	17	with	with	IN
cord-275413-e2rhioty	173	18	germinal	germinal	JJ
cord-275413-e2rhioty	173	19	centers	center	NNS
cord-275413-e2rhioty	173	20	.	.	.
cord-275413-e2rhioty	174	1	CDw79	CDw79	NNP
cord-275413-e2rhioty	174	2	is	be	VBZ
cord-275413-e2rhioty	174	3	beta	beta	NN
cord-275413-e2rhioty	174	4	-	-	HYPH
cord-275413-e2rhioty	174	5	galactoside	galactoside	JJ
cord-275413-e2rhioty	174	6	alpha-2,6-sialyltransferase	alpha-2,6-sialyltransferase	NNP
cord-275413-e2rhioty	174	7	,	,	,
cord-275413-e2rhioty	174	8	which	which	WDT
cord-275413-e2rhioty	174	9	is	be	VBZ
cord-275413-e2rhioty	174	10	up	up	RB
cord-275413-e2rhioty	174	11	-	-	HYPH
cord-275413-e2rhioty	174	12	regulated	regulate	VBN
cord-275413-e2rhioty	174	13	in	in	IN
cord-275413-e2rhioty	174	14	activated	activate	VBN
cord-275413-e2rhioty	174	15	B	b	NN
cord-275413-e2rhioty	174	16	cells	cell	NNS
cord-275413-e2rhioty	175	1	(	(	-LRB-
cord-275413-e2rhioty	175	2	Erikstein	Erikstein	NNP
cord-275413-e2rhioty	175	3	et	et	NNP
cord-275413-e2rhioty	175	4	al	al	NNP
cord-275413-e2rhioty	175	5	.	.	NNP
cord-275413-e2rhioty	175	6	,	,	,
cord-275413-e2rhioty	175	7	1992	1992	CD
cord-275413-e2rhioty	175	8	)	)	-RRB-
cord-275413-e2rhioty	175	9	.	.	.
cord-275413-e2rhioty	176	1	The	the	DT
cord-275413-e2rhioty	176	2	absence	absence	NN
cord-275413-e2rhioty	176	3	of	of	IN
cord-275413-e2rhioty	176	4	CDw75	CDw75	NNS
cord-275413-e2rhioty	176	5	staining	staining	NN
cord-275413-e2rhioty	176	6	in	in	IN
cord-275413-e2rhioty	176	7	non	non	JJ
cord-275413-e2rhioty	176	8	-	-	JJ
cord-275413-e2rhioty	176	9	infected	infected	JJ
cord-275413-e2rhioty	176	10	fetuses	fetus	NNS
cord-275413-e2rhioty	176	11	is	be	VBZ
cord-275413-e2rhioty	176	12	consistent	consistent	JJ
cord-275413-e2rhioty	176	13	with	with	IN
cord-275413-e2rhioty	176	14	the	the	DT
cord-275413-e2rhioty	176	15	overall	overall	JJ
cord-275413-e2rhioty	176	16	quiescent	quiescent	JJ
cord-275413-e2rhioty	176	17	nature	nature	NN
cord-275413-e2rhioty	176	18	of	of	IN
cord-275413-e2rhioty	176	19	the	the	DT
cord-275413-e2rhioty	176	20	non	non	JJ
cord-275413-e2rhioty	176	21	-	-	JJ
cord-275413-e2rhioty	176	22	stimulated	stimulated	JJ
cord-275413-e2rhioty	176	23	fetal	fetal	JJ
cord-275413-e2rhioty	176	24	immune	immune	JJ
cord-275413-e2rhioty	176	25	system	system	NN
cord-275413-e2rhioty	176	26	.	.	.
cord-275413-e2rhioty	177	1	The	the	DT
cord-275413-e2rhioty	177	2	up	up	JJ
cord-275413-e2rhioty	177	3	-	-	HYPH
cord-275413-e2rhioty	177	4	regulation	regulation	NN
cord-275413-e2rhioty	177	5	of	of	IN
cord-275413-e2rhioty	177	6	CDw75	CDw75	NNS
cord-275413-e2rhioty	177	7	after	after	IN
cord-275413-e2rhioty	177	8	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	177	9	infection	infection	NN
cord-275413-e2rhioty	177	10	is	be	VBZ
cord-275413-e2rhioty	177	11	consistent	consistent	JJ
cord-275413-e2rhioty	177	12	with	with	IN
cord-275413-e2rhioty	177	13	B	b	NN
cord-275413-e2rhioty	177	14	cell	cell	NN
cord-275413-e2rhioty	177	15	activation	activation	NN
cord-275413-e2rhioty	177	16	and	and	CC
cord-275413-e2rhioty	177	17	the	the	DT
cord-275413-e2rhioty	177	18	formation	formation	NN
cord-275413-e2rhioty	177	19	of	of	IN
cord-275413-e2rhioty	177	20	mature	mature	JJ
cord-275413-e2rhioty	177	21	germinal	germinal	JJ
cord-275413-e2rhioty	177	22	centers	center	NNS
cord-275413-e2rhioty	177	23	in	in	IN
cord-275413-e2rhioty	177	24	response	response	NN
cord-275413-e2rhioty	177	25	to	to	IN
cord-275413-e2rhioty	177	26	infection	infection	NN
cord-275413-e2rhioty	177	27	.	.	.
cord-275413-e2rhioty	178	1	It	-PRON-	PRP
cord-275413-e2rhioty	178	2	should	should	MD
cord-275413-e2rhioty	178	3	be	be	VB
cord-275413-e2rhioty	178	4	noted	note	VBN
cord-275413-e2rhioty	178	5	that	that	IN
cord-275413-e2rhioty	178	6	infected	infected	JJ
cord-275413-e2rhioty	178	7	fetuses	fetus	NNS
cord-275413-e2rhioty	178	8	showed	show	VBD
cord-275413-e2rhioty	178	9	different	different	JJ
cord-275413-e2rhioty	178	10	degrees	degree	NNS
cord-275413-e2rhioty	178	11	of	of	IN
cord-275413-e2rhioty	178	12	staining	staining	NN
cord-275413-e2rhioty	178	13	,	,	,
cord-275413-e2rhioty	178	14	a	a	DT
cord-275413-e2rhioty	178	15	likely	likely	JJ
cord-275413-e2rhioty	178	16	consequence	consequence	NN
cord-275413-e2rhioty	178	17	of	of	IN
cord-275413-e2rhioty	178	18	the	the	DT
cord-275413-e2rhioty	178	19	different	different	JJ
cord-275413-e2rhioty	178	20	stages	stage	NNS
cord-275413-e2rhioty	178	21	of	of	IN
cord-275413-e2rhioty	178	22	fetal	fetal	JJ
cord-275413-e2rhioty	178	23	infection	infection	NN
cord-275413-e2rhioty	178	24	;	;	:
cord-275413-e2rhioty	178	25	i.e.	i.e.	FW
cord-275413-e2rhioty	178	26	less	less	RBR
cord-275413-e2rhioty	178	27	staining	staining	NN
cord-275413-e2rhioty	178	28	was	be	VBD
cord-275413-e2rhioty	178	29	the	the	DT
cord-275413-e2rhioty	178	30	result	result	NN
cord-275413-e2rhioty	178	31	of	of	IN
cord-275413-e2rhioty	178	32	early	early	JJ
cord-275413-e2rhioty	178	33	infection	infection	NN
cord-275413-e2rhioty	178	34	.	.	.
cord-275413-e2rhioty	179	1	Together	together	RB
cord-275413-e2rhioty	179	2	,	,	,
cord-275413-e2rhioty	179	3	the	the	DT
cord-275413-e2rhioty	179	4	overall	overall	JJ
cord-275413-e2rhioty	179	5	morphology	morphology	NN
cord-275413-e2rhioty	179	6	and	and	CC
cord-275413-e2rhioty	179	7	lymphocyte	lymphocyte	NN
cord-275413-e2rhioty	179	8	marker	marker	NN
cord-275413-e2rhioty	179	9	expression	expression	NN
cord-275413-e2rhioty	179	10	results	result	NNS
cord-275413-e2rhioty	179	11	indicate	indicate	VBP
cord-275413-e2rhioty	179	12	that	that	IN
cord-275413-e2rhioty	179	13	the	the	DT
cord-275413-e2rhioty	179	14	increased	increase	VBN
cord-275413-e2rhioty	179	15	volume	volume	NN
cord-275413-e2rhioty	179	16	in	in	IN
cord-275413-e2rhioty	179	17	the	the	DT
cord-275413-e2rhioty	179	18	lymph	lymph	NN
cord-275413-e2rhioty	179	19	nodes	node	NNS
cord-275413-e2rhioty	179	20	of	of	IN
cord-275413-e2rhioty	179	21	infected	infected	JJ
cord-275413-e2rhioty	179	22	fetuses	fetus	NNS
cord-275413-e2rhioty	179	23	is	be	VBZ
cord-275413-e2rhioty	179	24	largely	largely	RB
cord-275413-e2rhioty	179	25	the	the	DT
cord-275413-e2rhioty	179	26	result	result	NN
cord-275413-e2rhioty	179	27	of	of	IN
cord-275413-e2rhioty	179	28	increased	increase	VBN
cord-275413-e2rhioty	179	29	numbers	number	NNS
cord-275413-e2rhioty	179	30	of	of	IN
cord-275413-e2rhioty	179	31	mature	mature	JJ
cord-275413-e2rhioty	179	32	activated	activate	VBN
cord-275413-e2rhioty	179	33	B	b	NN
cord-275413-e2rhioty	179	34	cells	cell	NNS
cord-275413-e2rhioty	179	35	,	,	,
cord-275413-e2rhioty	179	36	which	which	WDT
cord-275413-e2rhioty	179	37	occupy	occupy	VBP
cord-275413-e2rhioty	179	38	germinal	germinal	JJ
cord-275413-e2rhioty	179	39	centers	center	NNS
cord-275413-e2rhioty	179	40	.	.	.
cord-275413-e2rhioty	180	1	Immune	immune	JJ
cord-275413-e2rhioty	180	2	cytokines	cytokine	NNS
cord-275413-e2rhioty	180	3	are	be	VBP
cord-275413-e2rhioty	180	4	important	important	JJ
cord-275413-e2rhioty	180	5	factors	factor	NNS
cord-275413-e2rhioty	180	6	in	in	IN
cord-275413-e2rhioty	180	7	antiviral	antiviral	JJ
cord-275413-e2rhioty	180	8	immunity	immunity	NN
cord-275413-e2rhioty	180	9	and	and	CC
cord-275413-e2rhioty	180	10	can	can	MD
cord-275413-e2rhioty	180	11	influence	influence	VB
cord-275413-e2rhioty	180	12	the	the	DT
cord-275413-e2rhioty	180	13	outcome	outcome	NN
cord-275413-e2rhioty	180	14	of	of	IN
cord-275413-e2rhioty	180	15	pregnancy	pregnancy	NN
cord-275413-e2rhioty	181	1	(	(	-LRB-
cord-275413-e2rhioty	181	2	Arck	Arck	NNP
cord-275413-e2rhioty	181	3	et	et	FW
cord-275413-e2rhioty	181	4	al	al	NNP
cord-275413-e2rhioty	181	5	.	.	NNP
cord-275413-e2rhioty	181	6	,	,	,
cord-275413-e2rhioty	181	7	1999	1999	CD
cord-275413-e2rhioty	181	8	;	;	:
cord-275413-e2rhioty	181	9	Basurko	Basurko	NNP
cord-275413-e2rhioty	181	10	et	et	NNP
cord-275413-e2rhioty	181	11	al	al	NNP
cord-275413-e2rhioty	181	12	.	.	NNP
cord-275413-e2rhioty	181	13	,	,	,
cord-275413-e2rhioty	181	14	2009	2009	CD
cord-275413-e2rhioty	181	15	)	)	-RRB-
cord-275413-e2rhioty	181	16	.	.	.
cord-275413-e2rhioty	182	1	The	the	DT
cord-275413-e2rhioty	182	2	detection	detection	NN
cord-275413-e2rhioty	182	3	of	of	IN
cord-275413-e2rhioty	182	4	cytokine	cytokine	NN
cord-275413-e2rhioty	182	5	gene	gene	NN
cord-275413-e2rhioty	182	6	expression	expression	NN
cord-275413-e2rhioty	182	7	in	in	IN
cord-275413-e2rhioty	182	8	tissues	tissue	NNS
cord-275413-e2rhioty	182	9	was	be	VBD
cord-275413-e2rhioty	182	10	performed	perform	VBN
cord-275413-e2rhioty	182	11	using	use	VBG
cord-275413-e2rhioty	182	12	a	a	DT
cord-275413-e2rhioty	182	13	steady	steady	JJ
cord-275413-e2rhioty	182	14	state	state	NN
cord-275413-e2rhioty	182	15	RT	RT	NNP
cord-275413-e2rhioty	182	16	-	-	HYPH
cord-275413-e2rhioty	182	17	PCR	PCR	NNP
cord-275413-e2rhioty	182	18	procedure	procedure	NN
cord-275413-e2rhioty	182	19	.	.	.
cord-275413-e2rhioty	183	1	RT	RT	NNP
cord-275413-e2rhioty	183	2	-	-	HYPH
cord-275413-e2rhioty	183	3	PCR	PCR	NNP
cord-275413-e2rhioty	183	4	was	be	VBD
cord-275413-e2rhioty	183	5	performed	perform	VBN
cord-275413-e2rhioty	183	6	on	on	IN
cord-275413-e2rhioty	183	7	RNA	RNA	NNP
cord-275413-e2rhioty	183	8	isolated	isolate	VBN
cord-275413-e2rhioty	183	9	from	from	IN
cord-275413-e2rhioty	183	10	four	four	CD
cord-275413-e2rhioty	183	11	fetuses	fetus	NNS
cord-275413-e2rhioty	183	12	randomly	randomly	RB
cord-275413-e2rhioty	183	13	chosen	choose	VBN
cord-275413-e2rhioty	183	14	from	from	IN
cord-275413-e2rhioty	183	15	the	the	DT
cord-275413-e2rhioty	183	16	two	two	CD
cord-275413-e2rhioty	183	17	mock	mock	JJ
cord-275413-e2rhioty	183	18	-	-	HYPH
cord-275413-e2rhioty	183	19	infected	infect	VBN
cord-275413-e2rhioty	183	20	dams	dam	NNS
cord-275413-e2rhioty	183	21	and	and	CC
cord-275413-e2rhioty	183	22	four	four	CD
cord-275413-e2rhioty	183	23	randomly	randomly	RB
cord-275413-e2rhioty	183	24	selected	select	VBN
cord-275413-e2rhioty	183	25	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	183	26	-	-	HYPH
cord-275413-e2rhioty	183	27	infected	infect	VBN
cord-275413-e2rhioty	183	28	fetuses	fetus	NNS
cord-275413-e2rhioty	183	29	.	.	.
cord-275413-e2rhioty	184	1	The	the	DT
cord-275413-e2rhioty	184	2	tissues	tissue	NNS
cord-275413-e2rhioty	184	3	selected	select	VBN
cord-275413-e2rhioty	184	4	for	for	IN
cord-275413-e2rhioty	184	5	RT	RT	NNP
cord-275413-e2rhioty	184	6	-	-	HYPH
cord-275413-e2rhioty	184	7	PCR	PCR	NNP
cord-275413-e2rhioty	184	8	amplification	amplification	NN
cord-275413-e2rhioty	184	9	were	be	VBD
cord-275413-e2rhioty	184	10	lung	lung	NN
cord-275413-e2rhioty	184	11	,	,	,
cord-275413-e2rhioty	184	12	lymph	lymph	NN
cord-275413-e2rhioty	184	13	node	node	NN
cord-275413-e2rhioty	184	14	and	and	CC
cord-275413-e2rhioty	184	15	placenta	placenta	NN
cord-275413-e2rhioty	184	16	.	.	.
cord-275413-e2rhioty	185	1	Lung	lung	NN
cord-275413-e2rhioty	185	2	and	and	CC
cord-275413-e2rhioty	185	3	lymph	lymph	NN
cord-275413-e2rhioty	185	4	node	node	NN
cord-275413-e2rhioty	185	5	represent	represent	VBP
cord-275413-e2rhioty	185	6	sites	site	NNS
cord-275413-e2rhioty	185	7	cytokine	cytokine	JJ
cord-275413-e2rhioty	185	8	alterations	alteration	NNS
cord-275413-e2rhioty	185	9	in	in	IN
cord-275413-e2rhioty	185	10	the	the	DT
cord-275413-e2rhioty	185	11	post	post	JJ
cord-275413-e2rhioty	185	12	-	-	JJ
cord-275413-e2rhioty	185	13	natal	natal	JJ
cord-275413-e2rhioty	185	14	pig	pig	NN
cord-275413-e2rhioty	185	15	.	.	.
cord-275413-e2rhioty	186	1	Placenta	placenta	NN
cord-275413-e2rhioty	186	2	was	be	VBD
cord-275413-e2rhioty	186	3	selected	select	VBN
cord-275413-e2rhioty	186	4	as	as	IN
cord-275413-e2rhioty	186	5	an	an	DT
cord-275413-e2rhioty	186	6	accessory	accessory	NN
cord-275413-e2rhioty	186	7	tissue	tissue	NN
cord-275413-e2rhioty	186	8	located	locate	VBN
cord-275413-e2rhioty	186	9	at	at	IN
cord-275413-e2rhioty	186	10	the	the	DT
cord-275413-e2rhioty	186	11	fetal	fetal	JJ
cord-275413-e2rhioty	186	12	maternal	maternal	JJ
cord-275413-e2rhioty	186	13	interface	interface	NN
cord-275413-e2rhioty	186	14	.	.	.
cord-275413-e2rhioty	187	1	Amplification	amplification	NN
cord-275413-e2rhioty	187	2	of	of	IN
cord-275413-e2rhioty	187	3	mRNAs	mRNAs	NNPS
cord-275413-e2rhioty	187	4	included	include	VBD
cord-275413-e2rhioty	187	5	cytokines	cytokine	NNS
cord-275413-e2rhioty	187	6	associated	associate	VBN
cord-275413-e2rhioty	187	7	with	with	IN
cord-275413-e2rhioty	187	8	inflammatory	inflammatory	JJ
cord-275413-e2rhioty	187	9	(	(	-LRB-
cord-275413-e2rhioty	187	10	IL-6	IL-6	NNP
cord-275413-e2rhioty	187	11	,	,	,
cord-275413-e2rhioty	187	12	IL-8	IL-8	NNP
cord-275413-e2rhioty	187	13	)	)	-RRB-
cord-275413-e2rhioty	187	14	,	,	,
cord-275413-e2rhioty	187	15	Th1	th1	NN
cord-275413-e2rhioty	187	16	(	(	-LRB-
cord-275413-e2rhioty	187	17	IL-12	IL-12	NNP
cord-275413-e2rhioty	187	18	,	,	,
cord-275413-e2rhioty	187	19	IFN-	IFN-	NNP
cord-275413-e2rhioty	187	20	␥	␥	NNP
cord-275413-e2rhioty	187	21	,	,	,
cord-275413-e2rhioty	187	22	IL-2	IL-2	NNP
cord-275413-e2rhioty	187	23	)	)	-RRB-
cord-275413-e2rhioty	187	24	and	and	CC
cord-275413-e2rhioty	187	25	Th2	Th2	NNP
cord-275413-e2rhioty	187	26	/	/	SYM
cord-275413-e2rhioty	187	27	regulatory	regulatory	JJ
cord-275413-e2rhioty	187	28	(	(	-LRB-
cord-275413-e2rhioty	187	29	IL-4	IL-4	NNP
cord-275413-e2rhioty	187	30	,	,	,
cord-275413-e2rhioty	187	31	IL-10	IL-10	NNP
cord-275413-e2rhioty	187	32	)	)	-RRB-
cord-275413-e2rhioty	187	33	responses	response	NNS
cord-275413-e2rhioty	187	34	.	.	.
cord-275413-e2rhioty	188	1	The	the	DT
cord-275413-e2rhioty	188	2	amplification	amplification	NN
cord-275413-e2rhioty	188	3	of	of	IN
cord-275413-e2rhioty	188	4	␤	␤	CD
cord-275413-e2rhioty	188	5	2	2	CD
cord-275413-e2rhioty	188	6	m	m	NNP
cord-275413-e2rhioty	188	7	mRNA	mRNA	NNP
cord-275413-e2rhioty	188	8	was	be	VBD
cord-275413-e2rhioty	188	9	included	include	VBN
cord-275413-e2rhioty	188	10	as	as	IN
cord-275413-e2rhioty	188	11	an	an	DT
cord-275413-e2rhioty	188	12	internal	internal	JJ
cord-275413-e2rhioty	188	13	control	control	NN
cord-275413-e2rhioty	188	14	.	.	.
cord-275413-e2rhioty	189	1	The	the	DT
cord-275413-e2rhioty	189	2	determination	determination	NN
cord-275413-e2rhioty	189	3	of	of	IN
cord-275413-e2rhioty	189	4	a	a	DT
cord-275413-e2rhioty	189	5	cytokine	cytokine	NN
cord-275413-e2rhioty	189	6	response	response	NN
cord-275413-e2rhioty	189	7	was	be	VBD
cord-275413-e2rhioty	189	8	based	base	VBN
cord-275413-e2rhioty	189	9	on	on	IN
cord-275413-e2rhioty	189	10	the	the	DT
cord-275413-e2rhioty	189	11	presence	presence	NN
cord-275413-e2rhioty	189	12	or	or	CC
cord-275413-e2rhioty	189	13	absence	absence	NN
cord-275413-e2rhioty	189	14	of	of	IN
cord-275413-e2rhioty	189	15	a	a	DT
cord-275413-e2rhioty	189	16	PCR	PCR	NNP
cord-275413-e2rhioty	189	17	product	product	NN
cord-275413-e2rhioty	189	18	.	.	.
cord-275413-e2rhioty	190	1	IL-6	IL-6	NNP
cord-275413-e2rhioty	190	2	,	,	,
cord-275413-e2rhioty	190	3	IL-8	IL-8	NNP
cord-275413-e2rhioty	190	4	,	,	,
cord-275413-e2rhioty	190	5	IL-12	IL-12	NNP
cord-275413-e2rhioty	190	6	and	and	CC
cord-275413-e2rhioty	190	7	IL-10	IL-10	NNP
cord-275413-e2rhioty	190	8	products	product	NNS
cord-275413-e2rhioty	190	9	were	be	VBD
cord-275413-e2rhioty	190	10	detected	detect	VBN
cord-275413-e2rhioty	190	11	in	in	IN
cord-275413-e2rhioty	190	12	tissues	tissue	NNS
cord-275413-e2rhioty	190	13	from	from	IN
cord-275413-e2rhioty	190	14	both	both	DT
cord-275413-e2rhioty	190	15	control	control	NN
cord-275413-e2rhioty	190	16	and	and	CC
cord-275413-e2rhioty	190	17	infected	infected	JJ
cord-275413-e2rhioty	190	18	fetuses	fetus	NNS
cord-275413-e2rhioty	190	19	.	.	.
cord-275413-e2rhioty	191	1	Because	because	IN
cord-275413-e2rhioty	191	2	of	of	IN
cord-275413-e2rhioty	191	3	the	the	DT
cord-275413-e2rhioty	191	4	qualitative	qualitative	JJ
cord-275413-e2rhioty	191	5	nature	nature	NN
cord-275413-e2rhioty	191	6	of	of	IN
cord-275413-e2rhioty	191	7	the	the	DT
cord-275413-e2rhioty	191	8	PCR	PCR	NNP
cord-275413-e2rhioty	191	9	method	method	NN
cord-275413-e2rhioty	191	10	,	,	,
cord-275413-e2rhioty	191	11	it	-PRON-	PRP
cord-275413-e2rhioty	191	12	was	be	VBD
cord-275413-e2rhioty	191	13	not	not	RB
cord-275413-e2rhioty	191	14	possible	possible	JJ
cord-275413-e2rhioty	191	15	to	to	TO
cord-275413-e2rhioty	191	16	accurately	accurately	RB
cord-275413-e2rhioty	191	17	determine	determine	VB
cord-275413-e2rhioty	191	18	quantitative	quantitative	JJ
cord-275413-e2rhioty	191	19	differences	difference	NNS
cord-275413-e2rhioty	191	20	between	between	IN
cord-275413-e2rhioty	191	21	control	control	NN
cord-275413-e2rhioty	191	22	and	and	CC
cord-275413-e2rhioty	191	23	infected	infected	JJ
cord-275413-e2rhioty	191	24	fetuses	fetus	NNS
cord-275413-e2rhioty	191	25	;	;	:
cord-275413-e2rhioty	191	26	and	and	CC
cord-275413-e2rhioty	191	27	therefore	therefore	RB
cord-275413-e2rhioty	191	28	,	,	,
cord-275413-e2rhioty	191	29	these	these	DT
cord-275413-e2rhioty	191	30	cytokines	cytokine	NNS
cord-275413-e2rhioty	191	31	were	be	VBD
cord-275413-e2rhioty	191	32	not	not	RB
cord-275413-e2rhioty	191	33	subjected	subject	VBN
cord-275413-e2rhioty	191	34	to	to	TO
cord-275413-e2rhioty	191	35	further	further	JJ
cord-275413-e2rhioty	191	36	study	study	VB
cord-275413-e2rhioty	191	37	(	(	-LRB-
cord-275413-e2rhioty	191	38	data	datum	NNS
cord-275413-e2rhioty	191	39	not	not	RB
cord-275413-e2rhioty	191	40	shown	show	VBN
cord-275413-e2rhioty	191	41	)	)	-RRB-
cord-275413-e2rhioty	191	42	.	.	.
cord-275413-e2rhioty	192	1	IL-4	IL-4	NNP
cord-275413-e2rhioty	193	1	mRNA	mRNA	NNP
cord-275413-e2rhioty	193	2	was	be	VBD
cord-275413-e2rhioty	193	3	not	not	RB
cord-275413-e2rhioty	193	4	detected	detect	VBN
cord-275413-e2rhioty	193	5	in	in	IN
cord-275413-e2rhioty	193	6	any	any	DT
cord-275413-e2rhioty	193	7	of	of	IN
cord-275413-e2rhioty	193	8	the	the	DT
cord-275413-e2rhioty	193	9	selected	select	VBN
cord-275413-e2rhioty	193	10	tissues	tissue	NNS
cord-275413-e2rhioty	193	11	for	for	IN
cord-275413-e2rhioty	193	12	control	control	NN
cord-275413-e2rhioty	193	13	and	and	CC
cord-275413-e2rhioty	193	14	infected	infected	JJ
cord-275413-e2rhioty	193	15	fetuses	fetus	NNS
cord-275413-e2rhioty	193	16	.	.	.
cord-275413-e2rhioty	194	1	Marked	marked	JJ
cord-275413-e2rhioty	194	2	differences	difference	NNS
cord-275413-e2rhioty	194	3	in	in	IN
cord-275413-e2rhioty	194	4	expression	expression	NN
cord-275413-e2rhioty	194	5	were	be	VBD
cord-275413-e2rhioty	194	6	observed	observe	VBN
cord-275413-e2rhioty	194	7	for	for	IN
cord-275413-e2rhioty	194	8	TNF-	TNF-	NNP
cord-275413-e2rhioty	194	9	␣	␣	NNP
cord-275413-e2rhioty	194	10	and	and	CC
cord-275413-e2rhioty	194	11	IFN-	IFN-	NNP
cord-275413-e2rhioty	194	12	␥	␥	NNP
cord-275413-e2rhioty	194	13	mRNAs	mrnas	ADD
cord-275413-e2rhioty	194	14	.	.	.
cord-275413-e2rhioty	195	1	The	the	DT
cord-275413-e2rhioty	195	2	results	result	NNS
cord-275413-e2rhioty	195	3	for	for	IN
cord-275413-e2rhioty	196	1	IFN-	IFN-	NNP
cord-275413-e2rhioty	196	2	␥	␥	CD
cord-275413-e2rhioty	196	3	and	and	CC
cord-275413-e2rhioty	196	4	TNF-	TNF-	NNP
cord-275413-e2rhioty	196	5	␣	␣	NN
cord-275413-e2rhioty	196	6	from	from	IN
cord-275413-e2rhioty	196	7	lung	lung	NN
cord-275413-e2rhioty	196	8	,	,	,
cord-275413-e2rhioty	196	9	mandibular	mandibular	JJ
cord-275413-e2rhioty	196	10	lymph	lymph	NN
cord-275413-e2rhioty	196	11	node	node	NN
cord-275413-e2rhioty	196	12	and	and	CC
cord-275413-e2rhioty	196	13	placenta	placenta	NN
cord-275413-e2rhioty	196	14	are	be	VBP
cord-275413-e2rhioty	196	15	presented	present	VBN
cord-275413-e2rhioty	196	16	in	in	IN
cord-275413-e2rhioty	196	17	Fig	Fig	NNP
cord-275413-e2rhioty	196	18	.	.	.
cord-275413-e2rhioty	197	1	4	4	LS
cord-275413-e2rhioty	197	2	.	.	.
cord-275413-e2rhioty	198	1	The	the	DT
cord-275413-e2rhioty	198	2	results	result	NNS
cord-275413-e2rhioty	198	3	for	for	IN
cord-275413-e2rhioty	198	4	IL-10	IL-10	NNP
cord-275413-e2rhioty	198	5	are	be	VBP
cord-275413-e2rhioty	198	6	also	also	RB
cord-275413-e2rhioty	198	7	shown	show	VBN
cord-275413-e2rhioty	198	8	.	.	.
cord-275413-e2rhioty	199	1	The	the	DT
cord-275413-e2rhioty	199	2	internal	internal	JJ
cord-275413-e2rhioty	199	3	control	control	NN
cord-275413-e2rhioty	199	4	mRNA	mrna	NN
cord-275413-e2rhioty	199	5	,	,	,
cord-275413-e2rhioty	199	6	␤	␤	NNP
cord-275413-e2rhioty	199	7	2	2	CD
cord-275413-e2rhioty	199	8	m	m	NNP
cord-275413-e2rhioty	199	9	,	,	,
cord-275413-e2rhioty	199	10	was	be	VBD
cord-275413-e2rhioty	199	11	amplified	amplify	VBN
cord-275413-e2rhioty	199	12	from	from	IN
cord-275413-e2rhioty	199	13	all	all	DT
cord-275413-e2rhioty	199	14	tissues	tissue	NNS
cord-275413-e2rhioty	199	15	,	,	,
cord-275413-e2rhioty	199	16	indicating	indicate	VBG
cord-275413-e2rhioty	199	17	that	that	IN
cord-275413-e2rhioty	199	18	the	the	DT
cord-275413-e2rhioty	199	19	RNA	RNA	NNP
cord-275413-e2rhioty	199	20	was	be	VBD
cord-275413-e2rhioty	199	21	intact	intact	JJ
cord-275413-e2rhioty	199	22	.	.	.
cord-275413-e2rhioty	200	1	IL-10	IL-10	NNP
cord-275413-e2rhioty	200	2	was	be	VBD
cord-275413-e2rhioty	200	3	amplified	amplify	VBN
cord-275413-e2rhioty	200	4	from	from	IN
cord-275413-e2rhioty	200	5	lung	lung	NN
cord-275413-e2rhioty	200	6	and	and	CC
cord-275413-e2rhioty	200	7	mandibular	mandibular	JJ
cord-275413-e2rhioty	200	8	lymph	lymph	NN
cord-275413-e2rhioty	200	9	nodes	node	NNS
cord-275413-e2rhioty	200	10	from	from	IN
cord-275413-e2rhioty	200	11	two	two	CD
cord-275413-e2rhioty	200	12	of	of	IN
cord-275413-e2rhioty	200	13	the	the	DT
cord-275413-e2rhioty	200	14	four	four	CD
cord-275413-e2rhioty	200	15	control	control	NN
cord-275413-e2rhioty	200	16	fetuses	fetus	NNS
cord-275413-e2rhioty	200	17	and	and	CC
cord-275413-e2rhioty	200	18	from	from	IN
cord-275413-e2rhioty	200	19	all	all	DT
cord-275413-e2rhioty	200	20	infected	infect	VBN
cord-275413-e2rhioty	200	21	fetuses	fetus	NNS
cord-275413-e2rhioty	200	22	.	.	.
cord-275413-e2rhioty	201	1	The	the	DT
cord-275413-e2rhioty	201	2	presence	presence	NN
cord-275413-e2rhioty	201	3	of	of	IN
cord-275413-e2rhioty	201	4	IL-10	IL-10	NNP
cord-275413-e2rhioty	201	5	was	be	VBD
cord-275413-e2rhioty	201	6	not	not	RB
cord-275413-e2rhioty	201	7	unexpected	unexpected	JJ
cord-275413-e2rhioty	201	8	,	,	,
cord-275413-e2rhioty	201	9	since	since	IN
cord-275413-e2rhioty	201	10	increased	increase	VBN
cord-275413-e2rhioty	201	11	IL-10	IL-10	NNP
cord-275413-e2rhioty	201	12	production	production	NN
cord-275413-e2rhioty	201	13	is	be	VBZ
cord-275413-e2rhioty	201	14	associated	associate	VBN
cord-275413-e2rhioty	201	15	with	with	IN
cord-275413-e2rhioty	201	16	fetal	fetal	JJ
cord-275413-e2rhioty	201	17	T	t	NN
cord-275413-e2rhioty	201	18	cell	cell	NN
cord-275413-e2rhioty	201	19	responses	response	NNS
cord-275413-e2rhioty	201	20	(	(	-LRB-
cord-275413-e2rhioty	201	21	Lin	Lin	NNP
cord-275413-e2rhioty	201	22	et	et	NNP
cord-275413-e2rhioty	201	23	al	al	NNP
cord-275413-e2rhioty	201	24	.	.	NNP
cord-275413-e2rhioty	201	25	,	,	,
cord-275413-e2rhioty	201	26	1993	1993	CD
cord-275413-e2rhioty	201	27	;	;	:
cord-275413-e2rhioty	202	1	Rainsford	Rainsford	NNP
cord-275413-e2rhioty	202	2	and	and	CC
cord-275413-e2rhioty	202	3	Reen	Reen	NNP
cord-275413-e2rhioty	202	4	,	,	,
cord-275413-e2rhioty	202	5	2002	2002	CD
cord-275413-e2rhioty	202	6	)	)	-RRB-
cord-275413-e2rhioty	202	7	.	.	.
cord-275413-e2rhioty	203	1	As	as	IN
cord-275413-e2rhioty	203	2	shown	show	VBN
cord-275413-e2rhioty	203	3	in	in	IN
cord-275413-e2rhioty	203	4	Fig	Fig	NNP
cord-275413-e2rhioty	203	5	.	.	.
cord-275413-e2rhioty	204	1	4A	4a	CD
cord-275413-e2rhioty	204	2	,	,	,
cord-275413-e2rhioty	205	1	IFN-	IFN-	NNP
cord-275413-e2rhioty	205	2	␥	␥	CD
cord-275413-e2rhioty	205	3	and	and	CC
cord-275413-e2rhioty	205	4	TNF-	TNF-	NNP
cord-275413-e2rhioty	205	5	␣	␣	NN
cord-275413-e2rhioty	205	6	PCR	PCR	NNP
cord-275413-e2rhioty	205	7	products	product	NNS
cord-275413-e2rhioty	205	8	were	be	VBD
cord-275413-e2rhioty	205	9	not	not	RB
cord-275413-e2rhioty	205	10	detected	detect	VBN
cord-275413-e2rhioty	205	11	in	in	IN
cord-275413-e2rhioty	205	12	lung	lung	NN
cord-275413-e2rhioty	205	13	,	,	,
cord-275413-e2rhioty	205	14	lymph	lymph	NN
cord-275413-e2rhioty	205	15	node	node	NN
cord-275413-e2rhioty	205	16	or	or	CC
cord-275413-e2rhioty	205	17	placenta	placenta	NN
cord-275413-e2rhioty	205	18	from	from	IN
cord-275413-e2rhioty	205	19	the	the	DT
cord-275413-e2rhioty	205	20	non	non	JJ
cord-275413-e2rhioty	205	21	-	-	JJ
cord-275413-e2rhioty	205	22	infected	infected	JJ
cord-275413-e2rhioty	205	23	fetuses	fetus	NNS
cord-275413-e2rhioty	205	24	.	.	.
cord-275413-e2rhioty	206	1	However	however	RB
cord-275413-e2rhioty	206	2	,	,	,
cord-275413-e2rhioty	206	3	IFN-	IFN-	NNP
cord-275413-e2rhioty	206	4	␥	␥	CD
cord-275413-e2rhioty	206	5	PCR	PCR	NNP
cord-275413-e2rhioty	206	6	products	product	NNS
cord-275413-e2rhioty	206	7	were	be	VBD
cord-275413-e2rhioty	206	8	obtained	obtain	VBN
cord-275413-e2rhioty	206	9	for	for	IN
cord-275413-e2rhioty	206	10	lung	lung	NN
cord-275413-e2rhioty	206	11	and	and	CC
cord-275413-e2rhioty	206	12	lymph	lymph	NN
cord-275413-e2rhioty	206	13	nodes	node	NNS
cord-275413-e2rhioty	206	14	from	from	IN
cord-275413-e2rhioty	206	15	infected	infected	JJ
cord-275413-e2rhioty	206	16	fetuses	fetus	NNS
cord-275413-e2rhioty	206	17	.	.	.
cord-275413-e2rhioty	207	1	One	one	CD
cord-275413-e2rhioty	207	2	infected	infected	JJ
cord-275413-e2rhioty	207	3	fetus	fetus	NN
cord-275413-e2rhioty	207	4	,	,	,
cord-275413-e2rhioty	207	5	4	4	CD
cord-275413-e2rhioty	207	6	-	-	SYM
cord-275413-e2rhioty	207	7	3	3	CD
cord-275413-e2rhioty	207	8	,	,	,
cord-275413-e2rhioty	207	9	yielded	yield	VBD
cord-275413-e2rhioty	207	10	a	a	DT
cord-275413-e2rhioty	207	11	faint	faint	JJ
cord-275413-e2rhioty	207	12	IFN-	IFN-	NNP
cord-275413-e2rhioty	207	13	␥	␥	CD
cord-275413-e2rhioty	207	14	product	product	NN
cord-275413-e2rhioty	207	15	for	for	IN
cord-275413-e2rhioty	207	16	placenta	placenta	NN
cord-275413-e2rhioty	207	17	.	.	.
cord-275413-e2rhioty	208	1	For	for	IN
cord-275413-e2rhioty	208	2	infected	infected	JJ
cord-275413-e2rhioty	208	3	fetuses	fetus	NNS
cord-275413-e2rhioty	208	4	,	,	,
cord-275413-e2rhioty	208	5	TNF-	TNF-	NNP
cord-275413-e2rhioty	208	6	␣	␣	NNP
cord-275413-e2rhioty	208	7	mRNA	mrna	NN
cord-275413-e2rhioty	208	8	was	be	VBD
cord-275413-e2rhioty	208	9	amplified	amplify	VBN
cord-275413-e2rhioty	208	10	from	from	IN
cord-275413-e2rhioty	208	11	lung	lung	NN
cord-275413-e2rhioty	208	12	,	,	,
cord-275413-e2rhioty	208	13	but	but	CC
cord-275413-e2rhioty	208	14	not	not	RB
cord-275413-e2rhioty	208	15	lymph	lymph	NN
cord-275413-e2rhioty	208	16	node	node	NN
cord-275413-e2rhioty	208	17	or	or	CC
cord-275413-e2rhioty	208	18	placenta	placenta	NN
cord-275413-e2rhioty	208	19	(	(	-LRB-
cord-275413-e2rhioty	208	20	Fig	fig	NN
cord-275413-e2rhioty	208	21	.	.	.
cord-275413-e2rhioty	208	22	4B	4b	CD
cord-275413-e2rhioty	208	23	)	)	-RRB-
cord-275413-e2rhioty	208	24	.	.	.
cord-275413-e2rhioty	209	1	To	to	TO
cord-275413-e2rhioty	209	2	determine	determine	VB
cord-275413-e2rhioty	209	3	if	if	IN
cord-275413-e2rhioty	209	4	cytokine	cytokine	NN
cord-275413-e2rhioty	209	5	gene	gene	NN
cord-275413-e2rhioty	209	6	expression	expression	NN
cord-275413-e2rhioty	209	7	was	be	VBD
cord-275413-e2rhioty	209	8	the	the	DT
cord-275413-e2rhioty	209	9	direct	direct	JJ
cord-275413-e2rhioty	209	10	result	result	NN
cord-275413-e2rhioty	209	11	of	of	IN
cord-275413-e2rhioty	209	12	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	209	13	infection	infection	NN
cord-275413-e2rhioty	209	14	,	,	,
cord-275413-e2rhioty	209	15	RT	RT	NNP
cord-275413-e2rhioty	209	16	-	-	HYPH
cord-275413-e2rhioty	209	17	PCR	PCR	NNP
cord-275413-e2rhioty	209	18	for	for	IN
cord-275413-e2rhioty	210	1	IFN-	IFN-	NNP
cord-275413-e2rhioty	210	2	␥	␥	CD
cord-275413-e2rhioty	210	3	and	and	CC
cord-275413-e2rhioty	210	4	TNF-	TNF-	NNP
cord-275413-e2rhioty	210	5	␣	␣	NNP
cord-275413-e2rhioty	210	6	was	be	VBD
cord-275413-e2rhioty	210	7	performed	perform	VBN
cord-275413-e2rhioty	210	8	on	on	IN
cord-275413-e2rhioty	210	9	the	the	DT
cord-275413-e2rhioty	210	10	same	same	JJ
cord-275413-e2rhioty	210	11	tissues	tissue	NNS
cord-275413-e2rhioty	210	12	from	from	IN
cord-275413-e2rhioty	210	13	fetuses	fetus	NNS
cord-275413-e2rhioty	210	14	of	of	IN
cord-275413-e2rhioty	210	15	infected	infected	JJ
cord-275413-e2rhioty	210	16	dam	dam	NN
cord-275413-e2rhioty	210	17	no	no	NN
cord-275413-e2rhioty	210	18	.	.	NN
cord-275413-e2rhioty	210	19	2	2	CD
cord-275413-e2rhioty	210	20	,	,	,
cord-275413-e2rhioty	210	21	which	which	WDT
cord-275413-e2rhioty	210	22	produced	produce	VBD
cord-275413-e2rhioty	210	23	only	only	RB
cord-275413-e2rhioty	210	24	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	210	25	VI	VI	NNP
cord-275413-e2rhioty	210	26	-	-	HYPH
cord-275413-e2rhioty	210	27	negative	negative	JJ
cord-275413-e2rhioty	210	28	fetuses	fetus	NNS
cord-275413-e2rhioty	210	29	(	(	-LRB-
cord-275413-e2rhioty	210	30	see	see	VB
cord-275413-e2rhioty	210	31	Fig	Fig	NNP
cord-275413-e2rhioty	210	32	.	.	NNP
cord-275413-e2rhioty	210	33	1	1	CD
cord-275413-e2rhioty	210	34	)	)	-RRB-
cord-275413-e2rhioty	210	35	.	.	.
cord-275413-e2rhioty	211	1	The	the	DT
cord-275413-e2rhioty	211	2	analysis	analysis	NN
cord-275413-e2rhioty	211	3	of	of	IN
cord-275413-e2rhioty	211	4	mRNA	mRNA	NNP
cord-275413-e2rhioty	211	5	expression	expression	NN
cord-275413-e2rhioty	211	6	in	in	IN
cord-275413-e2rhioty	211	7	lungs	lung	NNS
cord-275413-e2rhioty	211	8	and	and	CC
cord-275413-e2rhioty	211	9	lymph	lymph	NN
cord-275413-e2rhioty	211	10	nodes	node	NNS
cord-275413-e2rhioty	211	11	from	from	IN
cord-275413-e2rhioty	211	12	six	six	CD
cord-275413-e2rhioty	211	13	fetuses	fetus	NNS
cord-275413-e2rhioty	211	14	from	from	IN
cord-275413-e2rhioty	211	15	dam	dam	NN
cord-275413-e2rhioty	211	16	no	no	NN
cord-275413-e2rhioty	211	17	.	.	.
cord-275413-e2rhioty	212	1	Fig	Fig	NNP
cord-275413-e2rhioty	212	2	.	.	NNP
cord-275413-e2rhioty	212	3	4	4	CD
cord-275413-e2rhioty	212	4	.	.	.
cord-275413-e2rhioty	213	1	Cytokine	cytokine	NN
cord-275413-e2rhioty	213	2	gene	gene	NN
cord-275413-e2rhioty	213	3	expression	expression	NN
cord-275413-e2rhioty	213	4	in	in	IN
cord-275413-e2rhioty	213	5	fetal	fetal	JJ
cord-275413-e2rhioty	213	6	tissues	tissue	NNS
cord-275413-e2rhioty	213	7	.	.	.
cord-275413-e2rhioty	214	1	RT	RT	NNP
cord-275413-e2rhioty	214	2	-	-	HYPH
cord-275413-e2rhioty	214	3	PCR	PCR	NNP
cord-275413-e2rhioty	214	4	for	for	IN
cord-275413-e2rhioty	214	5	cytokine	cytokine	NN
cord-275413-e2rhioty	214	6	mRNAs	mrnas	CD
cord-275413-e2rhioty	214	7	was	be	VBD
cord-275413-e2rhioty	214	8	performed	perform	VBN
cord-275413-e2rhioty	214	9	on	on	IN
cord-275413-e2rhioty	214	10	lung	lung	NN
cord-275413-e2rhioty	214	11	(	(	-LRB-
cord-275413-e2rhioty	214	12	L	L	NNP
cord-275413-e2rhioty	214	13	)	)	-RRB-
cord-275413-e2rhioty	214	14	,	,	,
cord-275413-e2rhioty	214	15	mandibular	mandibular	JJ
cord-275413-e2rhioty	214	16	lymph	lymph	NN
cord-275413-e2rhioty	214	17	node	node	NN
cord-275413-e2rhioty	214	18	(	(	-LRB-
cord-275413-e2rhioty	214	19	N	n	NN
cord-275413-e2rhioty	214	20	)	)	-RRB-
cord-275413-e2rhioty	214	21	and	and	CC
cord-275413-e2rhioty	214	22	placenta	placenta	NN
cord-275413-e2rhioty	214	23	(	(	-LRB-
cord-275413-e2rhioty	214	24	P	p	NN
cord-275413-e2rhioty	214	25	)	)	-RRB-
cord-275413-e2rhioty	214	26	for	for	IN
cord-275413-e2rhioty	214	27	control	control	NN
cord-275413-e2rhioty	214	28	(	(	-LRB-
cord-275413-e2rhioty	214	29	panel	panel	NN
cord-275413-e2rhioty	214	30	A	A	NNP
cord-275413-e2rhioty	214	31	)	)	-RRB-
cord-275413-e2rhioty	214	32	and	and	CC
cord-275413-e2rhioty	214	33	infected	infect	VBN
cord-275413-e2rhioty	214	34	(	(	-LRB-
cord-275413-e2rhioty	214	35	panel	panel	NN
cord-275413-e2rhioty	214	36	B	b	NN
cord-275413-e2rhioty	214	37	)	)	-RRB-
cord-275413-e2rhioty	214	38	fetuses	fetus	NNS
cord-275413-e2rhioty	214	39	as	as	IN
cord-275413-e2rhioty	214	40	described	describe	VBN
cord-275413-e2rhioty	214	41	in	in	IN
cord-275413-e2rhioty	214	42	the	the	DT
cord-275413-e2rhioty	214	43	text	text	NN
cord-275413-e2rhioty	214	44	using	use	VBG
cord-275413-e2rhioty	214	45	the	the	DT
cord-275413-e2rhioty	214	46	primers	primer	NNS
cord-275413-e2rhioty	214	47	in	in	IN
cord-275413-e2rhioty	214	48	Table	Table	NNP
cord-275413-e2rhioty	214	49	2	2	CD
cord-275413-e2rhioty	214	50	.	.	.
cord-275413-e2rhioty	215	1	Amplification	amplification	NN
cord-275413-e2rhioty	215	2	of	of	IN
cord-275413-e2rhioty	216	1	␤	␤	IN
cord-275413-e2rhioty	216	2	2-microglobulin	2-microglobulin	CD
cord-275413-e2rhioty	216	3	mRNA	mrna	NN
cord-275413-e2rhioty	216	4	was	be	VBD
cord-275413-e2rhioty	216	5	used	use	VBN
cord-275413-e2rhioty	216	6	as	as	IN
cord-275413-e2rhioty	216	7	an	an	DT
cord-275413-e2rhioty	216	8	internal	internal	JJ
cord-275413-e2rhioty	216	9	control	control	NN
cord-275413-e2rhioty	216	10	.	.	.
cord-275413-e2rhioty	217	1	PCR	PCR	NNP
cord-275413-e2rhioty	217	2	products	product	NNS
cord-275413-e2rhioty	217	3	were	be	VBD
cord-275413-e2rhioty	217	4	electrophoresed	electrophorese	VBN
cord-275413-e2rhioty	217	5	on	on	IN
cord-275413-e2rhioty	217	6	a	a	DT
cord-275413-e2rhioty	217	7	1.2	1.2	CD
cord-275413-e2rhioty	217	8	%	%	NN
cord-275413-e2rhioty	217	9	agarose	agarose	NN
cord-275413-e2rhioty	217	10	gel	gel	NN
cord-275413-e2rhioty	217	11	and	and	CC
cord-275413-e2rhioty	217	12	stained	stain	VBN
cord-275413-e2rhioty	217	13	with	with	IN
cord-275413-e2rhioty	217	14	ethidium	ethidium	NN
cord-275413-e2rhioty	217	15	bromide	bromide	NN
cord-275413-e2rhioty	217	16	.	.	.
cord-275413-e2rhioty	218	1	2	2	CD
cord-275413-e2rhioty	218	2	showed	show	VBD
cord-275413-e2rhioty	218	3	only	only	RB
cord-275413-e2rhioty	218	4	the	the	DT
cord-275413-e2rhioty	218	5	amplification	amplification	NN
cord-275413-e2rhioty	218	6	of	of	IN
cord-275413-e2rhioty	218	7	the	the	DT
cord-275413-e2rhioty	218	8	␤	␤	NNP
cord-275413-e2rhioty	218	9	2	2	CD
cord-275413-e2rhioty	218	10	m	m	NN
cord-275413-e2rhioty	218	11	,	,	,
cord-275413-e2rhioty	218	12	but	but	CC
cord-275413-e2rhioty	219	1	not	not	RB
cord-275413-e2rhioty	219	2	TNF-	tnf-	RB
cord-275413-e2rhioty	219	3	␣	␣	.
cord-275413-e2rhioty	220	1	or	or	CC
cord-275413-e2rhioty	220	2	IFN-	IFN-	NNP
cord-275413-e2rhioty	220	3	␥	␥	XX
cord-275413-e2rhioty	220	4	mRNAs	mrnas	XX
cord-275413-e2rhioty	221	1	(	(	-LRB-
cord-275413-e2rhioty	221	2	data	datum	NNS
cord-275413-e2rhioty	221	3	not	not	RB
cord-275413-e2rhioty	221	4	shown	show	VBN
cord-275413-e2rhioty	221	5	)	)	-RRB-
cord-275413-e2rhioty	221	6	.	.	.
cord-275413-e2rhioty	222	1	Similar	similar	JJ
cord-275413-e2rhioty	222	2	results	result	NNS
cord-275413-e2rhioty	222	3	were	be	VBD
cord-275413-e2rhioty	222	4	obtained	obtain	VBN
cord-275413-e2rhioty	222	5	from	from	IN
cord-275413-e2rhioty	222	6	virusnegative	virusnegative	JJ
cord-275413-e2rhioty	222	7	fetuses	fetus	NNS
cord-275413-e2rhioty	222	8	located	locate	VBN
cord-275413-e2rhioty	222	9	immediately	immediately	RB
cord-275413-e2rhioty	222	10	adjacent	adjacent	JJ
cord-275413-e2rhioty	222	11	to	to	IN
cord-275413-e2rhioty	222	12	infected	infected	JJ
cord-275413-e2rhioty	222	13	fetuses	fetus	NNS
cord-275413-e2rhioty	222	14	(	(	-LRB-
cord-275413-e2rhioty	222	15	data	datum	NNS
cord-275413-e2rhioty	222	16	not	not	RB
cord-275413-e2rhioty	222	17	shown	show	VBN
cord-275413-e2rhioty	222	18	)	)	-RRB-
cord-275413-e2rhioty	222	19	.	.	.
cord-275413-e2rhioty	223	1	In	in	IN
cord-275413-e2rhioty	223	2	order	order	NN
cord-275413-e2rhioty	223	3	to	to	TO
cord-275413-e2rhioty	223	4	confirm	confirm	VB
cord-275413-e2rhioty	223	5	that	that	IN
cord-275413-e2rhioty	223	6	TNF-	TNF-	NNP
cord-275413-e2rhioty	223	7	␣	␣	NN
cord-275413-e2rhioty	223	8	and	and	CC
cord-275413-e2rhioty	223	9	IFN-	IFN-	NNP
cord-275413-e2rhioty	223	10	␥	␥	NNPS
cord-275413-e2rhioty	223	11	were	be	VBD
cord-275413-e2rhioty	223	12	produced	produce	VBN
cord-275413-e2rhioty	223	13	during	during	IN
cord-275413-e2rhioty	223	14	infection	infection	NN
cord-275413-e2rhioty	223	15	,	,	,
cord-275413-e2rhioty	223	16	cytokine	cytokine	NN
cord-275413-e2rhioty	223	17	protein	protein	NN
cord-275413-e2rhioty	223	18	levels	level	NNS
cord-275413-e2rhioty	223	19	were	be	VBD
cord-275413-e2rhioty	223	20	measured	measure	VBN
cord-275413-e2rhioty	223	21	in	in	IN
cord-275413-e2rhioty	223	22	fetal	fetal	JJ
cord-275413-e2rhioty	223	23	sera	sera	NN
cord-275413-e2rhioty	223	24	and	and	CC
cord-275413-e2rhioty	223	25	amniotic	amniotic	NN
cord-275413-e2rhioty	223	26	fluid	fluid	NN
cord-275413-e2rhioty	223	27	from	from	IN
cord-275413-e2rhioty	223	28	infected	infected	JJ
cord-275413-e2rhioty	223	29	fetuses	fetus	NNS
cord-275413-e2rhioty	223	30	and	and	CC
cord-275413-e2rhioty	223	31	fetuses	fetus	NNS
cord-275413-e2rhioty	223	32	from	from	IN
cord-275413-e2rhioty	223	33	mock	mock	JJ
cord-275413-e2rhioty	223	34	-	-	HYPH
cord-275413-e2rhioty	223	35	infected	infect	VBN
cord-275413-e2rhioty	223	36	dams	dam	NNS
cord-275413-e2rhioty	223	37	.	.	.
cord-275413-e2rhioty	224	1	As	as	IN
cord-275413-e2rhioty	224	2	shown	show	VBN
cord-275413-e2rhioty	224	3	in	in	IN
cord-275413-e2rhioty	224	4	Fig	Fig	NNP
cord-275413-e2rhioty	224	5	.	.	.
cord-275413-e2rhioty	225	1	5	5	LS
cord-275413-e2rhioty	225	2	,	,	,
cord-275413-e2rhioty	225	3	the	the	DT
cord-275413-e2rhioty	225	4	concentration	concentration	NN
cord-275413-e2rhioty	225	5	of	of	IN
cord-275413-e2rhioty	225	6	TNF-	TNF-	NNP
cord-275413-e2rhioty	225	7	␣	␣	NN
cord-275413-e2rhioty	225	8	in	in	IN
cord-275413-e2rhioty	225	9	serum	serum	NN
cord-275413-e2rhioty	225	10	for	for	IN
cord-275413-e2rhioty	225	11	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	225	12	-	-	HYPH
cord-275413-e2rhioty	225	13	infected	infect	VBN
cord-275413-e2rhioty	225	14	fetuses	fetus	NNS
cord-275413-e2rhioty	225	15	ranged	range	VBD
cord-275413-e2rhioty	225	16	between	between	IN
cord-275413-e2rhioty	225	17	20	20	CD
cord-275413-e2rhioty	225	18	and	and	CC
cord-275413-e2rhioty	225	19	100	100	CD
cord-275413-e2rhioty	225	20	pg	pg	NN
cord-275413-e2rhioty	225	21	/	/	SYM
cord-275413-e2rhioty	225	22	ml	ml	NNS
cord-275413-e2rhioty	225	23	compared	compare	VBN
cord-275413-e2rhioty	225	24	to	to	IN
cord-275413-e2rhioty	225	25	less	less	JJR
cord-275413-e2rhioty	225	26	than	than	IN
cord-275413-e2rhioty	225	27	30	30	CD
cord-275413-e2rhioty	225	28	pg	pg	NN
cord-275413-e2rhioty	225	29	/	/	SYM
cord-275413-e2rhioty	225	30	ml	ml	NN
cord-275413-e2rhioty	225	31	for	for	IN
cord-275413-e2rhioty	225	32	control	control	NN
cord-275413-e2rhioty	225	33	fetuses	fetus	NNS
cord-275413-e2rhioty	225	34	.	.	.
cord-275413-e2rhioty	226	1	Even	even	RB
cord-275413-e2rhioty	226	2	though	though	IN
cord-275413-e2rhioty	226	3	the	the	DT
cord-275413-e2rhioty	226	4	maximum	maximum	JJ
cord-275413-e2rhioty	226	5	quantities	quantity	NNS
cord-275413-e2rhioty	226	6	obtained	obtain	VBN
cord-275413-e2rhioty	226	7	for	for	IN
cord-275413-e2rhioty	226	8	infected	infected	JJ
cord-275413-e2rhioty	226	9	fetuses	fetus	NNS
cord-275413-e2rhioty	226	10	were	be	VBD
cord-275413-e2rhioty	226	11	near	near	IN
cord-275413-e2rhioty	226	12	the	the	DT
cord-275413-e2rhioty	226	13	lower	low	JJR
cord-275413-e2rhioty	226	14	limit	limit	NN
cord-275413-e2rhioty	226	15	of	of	IN
cord-275413-e2rhioty	226	16	detection	detection	NN
cord-275413-e2rhioty	226	17	for	for	IN
cord-275413-e2rhioty	226	18	the	the	DT
cord-275413-e2rhioty	226	19	ELISA	ELISA	NNP
cord-275413-e2rhioty	226	20	test	test	NN
cord-275413-e2rhioty	226	21	,	,	,
cord-275413-e2rhioty	226	22	it	-PRON-	PRP
cord-275413-e2rhioty	226	23	was	be	VBD
cord-275413-e2rhioty	226	24	clear	clear	JJ
cord-275413-e2rhioty	226	25	that	that	IN
cord-275413-e2rhioty	226	26	TNF-	TNF-	NNP
cord-275413-e2rhioty	226	27	␣	␣	NNP
cord-275413-e2rhioty	226	28	was	be	VBD
cord-275413-e2rhioty	226	29	elevated	elevate	VBN
cord-275413-e2rhioty	226	30	during	during	IN
cord-275413-e2rhioty	226	31	infection	infection	NN
cord-275413-e2rhioty	226	32	.	.	.
cord-275413-e2rhioty	227	1	Detectable	detectable	JJ
cord-275413-e2rhioty	227	2	concentrations	concentration	NNS
cord-275413-e2rhioty	227	3	of	of	IN
cord-275413-e2rhioty	227	4	TNF-	TNF-	NNP
cord-275413-e2rhioty	227	5	␣	␣	NN
cord-275413-e2rhioty	227	6	(	(	-LRB-
cord-275413-e2rhioty	227	7	>	>	NFP
cord-275413-e2rhioty	227	8	23	23	CD
cord-275413-e2rhioty	227	9	pg	pg	NNP
cord-275413-e2rhioty	227	10	/	/	SYM
cord-275413-e2rhioty	227	11	ml	ml	NN
cord-275413-e2rhioty	227	12	)	)	-RRB-
cord-275413-e2rhioty	227	13	were	be	VBD
cord-275413-e2rhioty	227	14	found	find	VBN
cord-275413-e2rhioty	227	15	in	in	IN
cord-275413-e2rhioty	227	16	amniotic	amniotic	NN
cord-275413-e2rhioty	227	17	fluid	fluid	NN
cord-275413-e2rhioty	227	18	from	from	IN
cord-275413-e2rhioty	227	19	only	only	RB
cord-275413-e2rhioty	227	20	two	two	CD
cord-275413-e2rhioty	227	21	control	control	NN
cord-275413-e2rhioty	227	22	and	and	CC
cord-275413-e2rhioty	227	23	two	two	CD
cord-275413-e2rhioty	227	24	infected	infected	JJ
cord-275413-e2rhioty	227	25	fetuses	fetus	NNS
cord-275413-e2rhioty	227	26	.	.	.
cord-275413-e2rhioty	228	1	Compared	compare	VBN
cord-275413-e2rhioty	228	2	to	to	IN
cord-275413-e2rhioty	228	3	fetuses	fetus	NNS
cord-275413-e2rhioty	228	4	from	from	IN
cord-275413-e2rhioty	228	5	mockinfected	mockinfected	JJ
cord-275413-e2rhioty	228	6	dams	dam	NNS
cord-275413-e2rhioty	228	7	,	,	,
cord-275413-e2rhioty	228	8	IFN-	IFN-	NNP
cord-275413-e2rhioty	228	9	␥	␥	CD
cord-275413-e2rhioty	228	10	concentrations	concentration	NNS
cord-275413-e2rhioty	228	11	were	be	VBD
cord-275413-e2rhioty	228	12	detected	detect	VBN
cord-275413-e2rhioty	228	13	in	in	IN
cord-275413-e2rhioty	228	14	sera	sera	NNP
cord-275413-e2rhioty	228	15	,	,	,
cord-275413-e2rhioty	228	16	with	with	IN
cord-275413-e2rhioty	228	17	values	value	NNS
cord-275413-e2rhioty	228	18	ranging	range	VBG
cord-275413-e2rhioty	228	19	from	from	IN
cord-275413-e2rhioty	228	20	a	a	DT
cord-275413-e2rhioty	228	21	low	low	NN
cord-275413-e2rhioty	228	22	of	of	IN
cord-275413-e2rhioty	228	23	60	60	CD
cord-275413-e2rhioty	228	24	to	to	TO
cord-275413-e2rhioty	228	25	more	more	JJR
cord-275413-e2rhioty	228	26	than	than	IN
cord-275413-e2rhioty	228	27	500	500	CD
cord-275413-e2rhioty	228	28	pg	pg	NN
cord-275413-e2rhioty	228	29	/	/	SYM
cord-275413-e2rhioty	228	30	ml	ml	NN
cord-275413-e2rhioty	228	31	.	.	.
cord-275413-e2rhioty	229	1	A	a	DT
cord-275413-e2rhioty	229	2	maximum	maximum	JJ
cord-275413-e2rhioty	229	3	level	level	NN
cord-275413-e2rhioty	229	4	of	of	IN
cord-275413-e2rhioty	229	5	60	60	CD
cord-275413-e2rhioty	229	6	pg	pg	NN
cord-275413-e2rhioty	229	7	/	/	SYM
cord-275413-e2rhioty	229	8	ml	ml	NN
cord-275413-e2rhioty	229	9	was	be	VBD
cord-275413-e2rhioty	229	10	obtained	obtain	VBN
cord-275413-e2rhioty	229	11	for	for	IN
cord-275413-e2rhioty	229	12	a	a	DT
cord-275413-e2rhioty	229	13	single	single	JJ
cord-275413-e2rhioty	229	14	non	non	JJ
cord-275413-e2rhioty	229	15	-	-	JJ
cord-275413-e2rhioty	229	16	infected	infected	JJ
cord-275413-e2rhioty	229	17	fetus	fetus	NN
cord-275413-e2rhioty	229	18	.	.	.
cord-275413-e2rhioty	230	1	IFN-	IFN-	NNP
cord-275413-e2rhioty	230	2	␥	␥	NNP
cord-275413-e2rhioty	230	3	was	be	VBD
cord-275413-e2rhioty	230	4	not	not	RB
cord-275413-e2rhioty	230	5	detected	detect	VBN
cord-275413-e2rhioty	230	6	in	in	IN
cord-275413-e2rhioty	230	7	amniotic	amniotic	NN
cord-275413-e2rhioty	230	8	fluid	fluid	NN
cord-275413-e2rhioty	230	9	from	from	IN
cord-275413-e2rhioty	230	10	either	either	CC
cord-275413-e2rhioty	230	11	the	the	DT
cord-275413-e2rhioty	230	12	infected	infected	JJ
cord-275413-e2rhioty	230	13	or	or	CC
cord-275413-e2rhioty	230	14	control	control	NN
cord-275413-e2rhioty	230	15	fetuses	fetus	NNS
cord-275413-e2rhioty	230	16	.	.	.
cord-275413-e2rhioty	231	1	The	the	DT
cord-275413-e2rhioty	231	2	presence	presence	NN
cord-275413-e2rhioty	231	3	of	of	IN
cord-275413-e2rhioty	232	1	IFN-	IFN-	NNP
cord-275413-e2rhioty	232	2	␥	␥	CD
cord-275413-e2rhioty	232	3	and	and	CC
cord-275413-e2rhioty	232	4	TNF-	TNF-	NNP
cord-275413-e2rhioty	232	5	␣	␣	NN
cord-275413-e2rhioty	232	6	in	in	IN
cord-275413-e2rhioty	232	7	serum	serum	NN
cord-275413-e2rhioty	232	8	,	,	,
cord-275413-e2rhioty	232	9	but	but	CC
cord-275413-e2rhioty	232	10	not	not	RB
cord-275413-e2rhioty	232	11	amniotic	amniotic	NN
cord-275413-e2rhioty	232	12	fluid	fluid	NN
cord-275413-e2rhioty	232	13	,	,	,
cord-275413-e2rhioty	232	14	further	further	RB
cord-275413-e2rhioty	232	15	supports	support	VBZ
cord-275413-e2rhioty	232	16	the	the	DT
cord-275413-e2rhioty	232	17	notion	notion	NN
cord-275413-e2rhioty	232	18	that	that	IN
cord-275413-e2rhioty	232	19	the	the	DT
cord-275413-e2rhioty	232	20	IFN-	IFN-	NNP
cord-275413-e2rhioty	232	21	␥	␥	NNP
cord-275413-e2rhioty	232	22	and	and	CC
cord-275413-e2rhioty	232	23	TNF-	TNF-	NNP
cord-275413-e2rhioty	232	24	␣	␣	JJ
cord-275413-e2rhioty	232	25	responses	response	NNS
cord-275413-e2rhioty	232	26	are	be	VBP
cord-275413-e2rhioty	232	27	primarily	primarily	RB
cord-275413-e2rhioty	232	28	restricted	restrict	VBN
cord-275413-e2rhioty	232	29	to	to	IN
cord-275413-e2rhioty	232	30	the	the	DT
cord-275413-e2rhioty	232	31	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	232	32	-	-	HYPH
cord-275413-e2rhioty	232	33	infected	infect	VBN
cord-275413-e2rhioty	232	34	fetus	fetus	NN
cord-275413-e2rhioty	232	35	and	and	CC
cord-275413-e2rhioty	232	36	do	do	VBP
cord-275413-e2rhioty	232	37	not	not	RB
cord-275413-e2rhioty	232	38	extend	extend	VB
cord-275413-e2rhioty	232	39	to	to	IN
cord-275413-e2rhioty	232	40	the	the	DT
cord-275413-e2rhioty	232	41	accessory	accessory	JJ
cord-275413-e2rhioty	232	42	tissue	tissue	NN
cord-275413-e2rhioty	232	43	compartments	compartment	NNS
cord-275413-e2rhioty	232	44	.	.	.
cord-275413-e2rhioty	233	1	This	this	DT
cord-275413-e2rhioty	233	2	study	study	NN
cord-275413-e2rhioty	233	3	characterizes	characterize	VBZ
cord-275413-e2rhioty	233	4	the	the	DT
cord-275413-e2rhioty	233	5	unique	unique	JJ
cord-275413-e2rhioty	233	6	biology	biology	NN
cord-275413-e2rhioty	233	7	associated	associate	VBN
cord-275413-e2rhioty	233	8	with	with	IN
cord-275413-e2rhioty	233	9	the	the	DT
cord-275413-e2rhioty	233	10	interaction	interaction	NN
cord-275413-e2rhioty	233	11	between	between	IN
cord-275413-e2rhioty	233	12	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	233	13	and	and	CC
cord-275413-e2rhioty	233	14	the	the	DT
cord-275413-e2rhioty	233	15	late	late	JJ
cord-275413-e2rhioty	233	16	gestation	gestation	NN
cord-275413-e2rhioty	233	17	fetus	fetus	NN
cord-275413-e2rhioty	233	18	.	.	.
cord-275413-e2rhioty	234	1	Consistent	consistent	JJ
cord-275413-e2rhioty	234	2	with	with	IN
cord-275413-e2rhioty	234	3	the	the	DT
cord-275413-e2rhioty	234	4	body	body	NN
cord-275413-e2rhioty	234	5	of	of	IN
cord-275413-e2rhioty	234	6	published	publish	VBN
cord-275413-e2rhioty	234	7	literature	literature	NN
cord-275413-e2rhioty	234	8	,	,	,
cord-275413-e2rhioty	234	9	the	the	DT
cord-275413-e2rhioty	234	10	fetuses	fetus	NNS
cord-275413-e2rhioty	234	11	from	from	IN
cord-275413-e2rhioty	234	12	the	the	DT
cord-275413-e2rhioty	234	13	infected	infected	JJ
cord-275413-e2rhioty	234	14	dams	dam	NNS
cord-275413-e2rhioty	234	15	obtained	obtain	VBN
cord-275413-e2rhioty	234	16	in	in	IN
cord-275413-e2rhioty	234	17	this	this	DT
cord-275413-e2rhioty	234	18	study	study	NN
cord-275413-e2rhioty	234	19	exhibited	exhibit	VBD
cord-275413-e2rhioty	234	20	several	several	JJ
cord-275413-e2rhioty	234	21	anatomic	anatomic	JJ
cord-275413-e2rhioty	234	22	pathological	pathological	JJ
cord-275413-e2rhioty	234	23	features	feature	NNS
cord-275413-e2rhioty	234	24	typical	typical	JJ
cord-275413-e2rhioty	234	25	of	of	IN
cord-275413-e2rhioty	234	26	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	234	27	infection	infection	NN
cord-275413-e2rhioty	234	28	of	of	IN
cord-275413-e2rhioty	234	29	the	the	DT
cord-275413-e2rhioty	234	30	fetus	fetus	NN
cord-275413-e2rhioty	234	31	,	,	,
cord-275413-e2rhioty	234	32	including	include	VBG
cord-275413-e2rhioty	234	33	lesions	lesion	NNS
cord-275413-e2rhioty	234	34	associated	associate	VBN
cord-275413-e2rhioty	234	35	with	with	IN
cord-275413-e2rhioty	234	36	the	the	DT
cord-275413-e2rhioty	234	37	accessory	accessory	JJ
cord-275413-e2rhioty	234	38	organs	organ	NNS
cord-275413-e2rhioty	234	39	,	,	,
cord-275413-e2rhioty	234	40	such	such	JJ
cord-275413-e2rhioty	234	41	as	as	IN
cord-275413-e2rhioty	234	42	umbilical	umbilical	JJ
cord-275413-e2rhioty	234	43	cord	cord	NN
cord-275413-e2rhioty	234	44	and	and	CC
cord-275413-e2rhioty	234	45	amniotic	amniotic	NN
cord-275413-e2rhioty	234	46	sac	sac	NN
cord-275413-e2rhioty	234	47	(	(	-LRB-
cord-275413-e2rhioty	234	48	Lager	Lager	NNP
cord-275413-e2rhioty	234	49	and	and	CC
cord-275413-e2rhioty	234	50	Halbur	Halbur	NNP
cord-275413-e2rhioty	234	51	,	,	,
cord-275413-e2rhioty	234	52	1996	1996	CD
cord-275413-e2rhioty	234	53	;	;	:
cord-275413-e2rhioty	234	54	Mengeling	Mengeling	NNP
cord-275413-e2rhioty	234	55	et	et	FW
cord-275413-e2rhioty	234	56	al	al	NNP
cord-275413-e2rhioty	234	57	.	.	NNP
cord-275413-e2rhioty	234	58	,	,	,
cord-275413-e2rhioty	234	59	1996	1996	CD
cord-275413-e2rhioty	234	60	)	)	-RRB-
cord-275413-e2rhioty	234	61	.	.	.
cord-275413-e2rhioty	235	1	One	one	CD
cord-275413-e2rhioty	235	2	interesting	interesting	JJ
cord-275413-e2rhioty	235	3	observation	observation	NN
cord-275413-e2rhioty	235	4	from	from	IN
cord-275413-e2rhioty	235	5	this	this	DT
cord-275413-e2rhioty	235	6	study	study	NN
cord-275413-e2rhioty	235	7	was	be	VBD
cord-275413-e2rhioty	235	8	the	the	DT
cord-275413-e2rhioty	235	9	apparent	apparent	JJ
cord-275413-e2rhioty	235	10	absence	absence	NN
cord-275413-e2rhioty	235	11	of	of	IN
cord-275413-e2rhioty	235	12	a	a	DT
cord-275413-e2rhioty	235	13	correlation	correlation	NN
cord-275413-e2rhioty	235	14	between	between	IN
cord-275413-e2rhioty	235	15	the	the	DT
cord-275413-e2rhioty	235	16	presence	presence	NN
cord-275413-e2rhioty	235	17	of	of	IN
cord-275413-e2rhioty	235	18	gross	gross	JJ
cord-275413-e2rhioty	235	19	abnormalities	abnormality	NNS
cord-275413-e2rhioty	235	20	and	and	CC
cord-275413-e2rhioty	235	21	productive	productive	JJ
cord-275413-e2rhioty	235	22	fetal	fetal	JJ
cord-275413-e2rhioty	235	23	infection	infection	NN
cord-275413-e2rhioty	235	24	.	.	.
cord-275413-e2rhioty	236	1	For	for	IN
cord-275413-e2rhioty	236	2	example	example	NN
cord-275413-e2rhioty	236	3	,	,	,
cord-275413-e2rhioty	236	4	several	several	JJ
cord-275413-e2rhioty	236	5	fetuses	fetus	NNS
cord-275413-e2rhioty	236	6	from	from	IN
cord-275413-e2rhioty	236	7	dam	dam	NN
cord-275413-e2rhioty	236	8	no	no	NN
cord-275413-e2rhioty	236	9	.	.	NN
cord-275413-e2rhioty	236	10	2	2	CD
cord-275413-e2rhioty	236	11	exhibited	exhibit	VBD
cord-275413-e2rhioty	236	12	several	several	JJ
cord-275413-e2rhioty	236	13	types	type	NNS
cord-275413-e2rhioty	236	14	of	of	IN
cord-275413-e2rhioty	236	15	gross	gross	JJ
cord-275413-e2rhioty	236	16	pathology	pathology	NN
cord-275413-e2rhioty	236	17	,	,	,
cord-275413-e2rhioty	236	18	including	include	VBG
cord-275413-e2rhioty	236	19	death	death	NN
cord-275413-e2rhioty	236	20	,	,	,
cord-275413-e2rhioty	236	21	growth	growth	NN
cord-275413-e2rhioty	236	22	retardation	retardation	NN
cord-275413-e2rhioty	236	23	,	,	,
cord-275413-e2rhioty	236	24	or	or	CC
cord-275413-e2rhioty	236	25	merconium	merconium	NN
cord-275413-e2rhioty	236	26	/	/	SYM
cord-275413-e2rhioty	236	27	blood	blood	NN
cord-275413-e2rhioty	236	28	stained	stain	VBN
cord-275413-e2rhioty	236	29	amniotic	amniotic	NN
cord-275413-e2rhioty	236	30	fluid	fluid	NN
cord-275413-e2rhioty	236	31	.	.	.
cord-275413-e2rhioty	237	1	There	there	EX
cord-275413-e2rhioty	237	2	were	be	VBD
cord-275413-e2rhioty	237	3	also	also	RB
cord-275413-e2rhioty	237	4	examples	example	NNS
cord-275413-e2rhioty	237	5	of	of	IN
cord-275413-e2rhioty	237	6	productively	productively	RB
cord-275413-e2rhioty	237	7	infected	infect	VBN
cord-275413-e2rhioty	237	8	fetuses	fetus	NNS
cord-275413-e2rhioty	237	9	that	that	WDT
cord-275413-e2rhioty	237	10	showed	show	VBD
cord-275413-e2rhioty	237	11	no	no	DT
cord-275413-e2rhioty	237	12	evidence	evidence	NN
cord-275413-e2rhioty	237	13	of	of	IN
cord-275413-e2rhioty	237	14	gross	gross	JJ
cord-275413-e2rhioty	237	15	pathology	pathology	NN
cord-275413-e2rhioty	237	16	(	(	-LRB-
cord-275413-e2rhioty	237	17	see	see	VB
cord-275413-e2rhioty	237	18	fetuses	fetus	NNS
cord-275413-e2rhioty	237	19	1	1	CD
cord-275413-e2rhioty	237	20	-	-	SYM
cord-275413-e2rhioty	237	21	2	2	CD
cord-275413-e2rhioty	237	22	,	,	,
cord-275413-e2rhioty	237	23	3	3	CD
cord-275413-e2rhioty	237	24	-	-	SYM
cord-275413-e2rhioty	237	25	12	12	CD
cord-275413-e2rhioty	237	26	,	,	,
cord-275413-e2rhioty	237	27	4	4	CD
cord-275413-e2rhioty	237	28	-	-	SYM
cord-275413-e2rhioty	237	29	9	9	CD
cord-275413-e2rhioty	237	30	,	,	,
cord-275413-e2rhioty	237	31	4	4	CD
cord-275413-e2rhioty	237	32	-	-	SYM
cord-275413-e2rhioty	237	33	11	11	CD
cord-275413-e2rhioty	237	34	,	,	,
cord-275413-e2rhioty	237	35	4	4	CD
cord-275413-e2rhioty	237	36	-	-	SYM
cord-275413-e2rhioty	237	37	13	13	CD
cord-275413-e2rhioty	237	38	in	in	IN
cord-275413-e2rhioty	237	39	Fig	Fig	NNP
cord-275413-e2rhioty	237	40	.	.	NNP
cord-275413-e2rhioty	237	41	1	1	CD
cord-275413-e2rhioty	237	42	)	)	-RRB-
cord-275413-e2rhioty	237	43	.	.	.
cord-275413-e2rhioty	238	1	The	the	DT
cord-275413-e2rhioty	238	2	mechanism	mechanism	NN
cord-275413-e2rhioty	238	3	for	for	IN
cord-275413-e2rhioty	238	4	fetal	fetal	JJ
cord-275413-e2rhioty	238	5	pathology	pathology	NN
cord-275413-e2rhioty	238	6	remains	remain	VBZ
cord-275413-e2rhioty	238	7	unclear	unclear	JJ
cord-275413-e2rhioty	238	8	,	,	,
cord-275413-e2rhioty	238	9	but	but	CC
cord-275413-e2rhioty	238	10	the	the	DT
cord-275413-e2rhioty	238	11	results	result	NNS
cord-275413-e2rhioty	238	12	suggest	suggest	VBP
cord-275413-e2rhioty	238	13	that	that	IN
cord-275413-e2rhioty	238	14	the	the	DT
cord-275413-e2rhioty	238	15	source	source	NN
cord-275413-e2rhioty	238	16	pathology	pathology	NN
cord-275413-e2rhioty	238	17	is	be	VBZ
cord-275413-e2rhioty	238	18	likely	likely	JJ
cord-275413-e2rhioty	238	19	result	result	NN
cord-275413-e2rhioty	238	20	of	of	IN
cord-275413-e2rhioty	238	21	the	the	DT
cord-275413-e2rhioty	238	22	infection	infection	NN
cord-275413-e2rhioty	238	23	of	of	IN
cord-275413-e2rhioty	238	24	tissues	tissue	NNS
cord-275413-e2rhioty	238	25	on	on	IN
cord-275413-e2rhioty	238	26	the	the	DT
cord-275413-e2rhioty	238	27	maternal	maternal	JJ
cord-275413-e2rhioty	238	28	side	side	NN
cord-275413-e2rhioty	238	29	and	and	CC
cord-275413-e2rhioty	238	30	damage	damage	NN
cord-275413-e2rhioty	238	31	to	to	IN
cord-275413-e2rhioty	238	32	maternal	maternal	JJ
cord-275413-e2rhioty	238	33	tissues	tissue	NNS
cord-275413-e2rhioty	238	34	or	or	CC
cord-275413-e2rhioty	238	35	production	production	NN
cord-275413-e2rhioty	238	36	of	of	IN
cord-275413-e2rhioty	238	37	maternal	maternal	JJ
cord-275413-e2rhioty	238	38	factors	factor	NNS
cord-275413-e2rhioty	238	39	that	that	WDT
cord-275413-e2rhioty	238	40	affect	affect	VBP
cord-275413-e2rhioty	238	41	the	the	DT
cord-275413-e2rhioty	238	42	fetus	fetus	NN
cord-275413-e2rhioty	238	43	.	.	.
cord-275413-e2rhioty	239	1	In	in	IN
cord-275413-e2rhioty	239	2	this	this	DT
cord-275413-e2rhioty	239	3	study	study	NN
cord-275413-e2rhioty	239	4	we	-PRON-	PRP
cord-275413-e2rhioty	239	5	did	do	VBD
cord-275413-e2rhioty	239	6	not	not	RB
cord-275413-e2rhioty	239	7	observe	observe	VB
cord-275413-e2rhioty	239	8	lesions	lesion	NNS
cord-275413-e2rhioty	239	9	in	in	IN
cord-275413-e2rhioty	239	10	the	the	DT
cord-275413-e2rhioty	239	11	myometrium	myometrium	NN
cord-275413-e2rhioty	239	12	or	or	CC
cord-275413-e2rhioty	239	13	placenta	placenta	NN
cord-275413-e2rhioty	239	14	;	;	:
cord-275413-e2rhioty	239	15	however	however	RB
cord-275413-e2rhioty	239	16	,	,	,
cord-275413-e2rhioty	239	17	Stockhofe	Stockhofe	NNP
cord-275413-e2rhioty	239	18	-	-	HYPH
cord-275413-e2rhioty	239	19	Zurwieden	Zurwieden	NNP
cord-275413-e2rhioty	239	20	et	et	NNP
cord-275413-e2rhioty	239	21	al	al	NNP
cord-275413-e2rhioty	239	22	.	.	.
cord-275413-e2rhioty	240	1	(	(	-LRB-
cord-275413-e2rhioty	240	2	1995	1995	CD
cord-275413-e2rhioty	240	3	)	)	-RRB-
cord-275413-e2rhioty	240	4	reported	report	VBD
cord-275413-e2rhioty	240	5	PRRS	PRRS	NNP
cord-275413-e2rhioty	240	6	virions	virion	NNS
cord-275413-e2rhioty	240	7	budding	bud	VBG
cord-275413-e2rhioty	240	8	from	from	IN
cord-275413-e2rhioty	240	9	maternal	maternal	JJ
cord-275413-e2rhioty	240	10	vascular	vascular	JJ
cord-275413-e2rhioty	240	11	endothelial	endothelial	JJ
cord-275413-e2rhioty	240	12	cells	cell	NNS
cord-275413-e2rhioty	240	13	at	at	IN
cord-275413-e2rhioty	240	14	the	the	DT
cord-275413-e2rhioty	240	15	maternal	maternal	JJ
cord-275413-e2rhioty	240	16	-	-	HYPH
cord-275413-e2rhioty	240	17	fetal	fetal	JJ
cord-275413-e2rhioty	240	18	interface	interface	NN
cord-275413-e2rhioty	240	19	.	.	.
cord-275413-e2rhioty	241	1	Lager	Lager	NNP
cord-275413-e2rhioty	241	2	and	and	CC
cord-275413-e2rhioty	241	3	Halbur	Halbur	NNP
cord-275413-e2rhioty	241	4	(	(	-LRB-
cord-275413-e2rhioty	241	5	1996	1996	CD
cord-275413-e2rhioty	241	6	)	)	-RRB-
cord-275413-e2rhioty	241	7	reported	report	VBD
cord-275413-e2rhioty	241	8	damage	damage	NN
cord-275413-e2rhioty	241	9	to	to	IN
cord-275413-e2rhioty	241	10	the	the	DT
cord-275413-e2rhioty	241	11	myometrium	myometrium	NN
cord-275413-e2rhioty	241	12	during	during	IN
cord-275413-e2rhioty	241	13	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	241	14	infection	infection	NN
cord-275413-e2rhioty	241	15	.	.	.
cord-275413-e2rhioty	242	1	Virus	virus	NN
cord-275413-e2rhioty	242	2	-	-	HYPH
cord-275413-e2rhioty	242	3	associated	associate	VBN
cord-275413-e2rhioty	242	4	lesions	lesion	NNS
cord-275413-e2rhioty	242	5	in	in	IN
cord-275413-e2rhioty	242	6	the	the	DT
cord-275413-e2rhioty	242	7	myometrium	myometrium	NN
cord-275413-e2rhioty	242	8	are	be	VBP
cord-275413-e2rhioty	242	9	observed	observe	VBN
cord-275413-e2rhioty	242	10	for	for	IN
cord-275413-e2rhioty	242	11	horses	horse	NNS
cord-275413-e2rhioty	242	12	infected	infect	VBN
cord-275413-e2rhioty	242	13	with	with	IN
cord-275413-e2rhioty	242	14	EAV	EAV	NNP
cord-275413-e2rhioty	242	15	(	(	-LRB-
cord-275413-e2rhioty	242	16	Coignoul	Coignoul	NNP
cord-275413-e2rhioty	242	17	and	and	CC
cord-275413-e2rhioty	242	18	Cheville	Cheville	NNP
cord-275413-e2rhioty	242	19	,	,	,
cord-275413-e2rhioty	242	20	1984	1984	CD
cord-275413-e2rhioty	242	21	)	)	-RRB-
cord-275413-e2rhioty	242	22	.	.	.
cord-275413-e2rhioty	243	1	The	the	DT
cord-275413-e2rhioty	243	2	appar	appar	NNP
cord-275413-e2rhioty	243	3	-	-	HYPH
cord-275413-e2rhioty	243	4	ent	ent	NNP
cord-275413-e2rhioty	243	5	discrepancy	discrepancy	NN
cord-275413-e2rhioty	243	6	between	between	IN
cord-275413-e2rhioty	243	7	pathology	pathology	NN
cord-275413-e2rhioty	243	8	and	and	CC
cord-275413-e2rhioty	243	9	infection	infection	NN
cord-275413-e2rhioty	243	10	helps	help	VBZ
cord-275413-e2rhioty	243	11	to	to	TO
cord-275413-e2rhioty	243	12	explain	explain	VB
cord-275413-e2rhioty	243	13	the	the	DT
cord-275413-e2rhioty	243	14	stealthy	stealthy	JJ
cord-275413-e2rhioty	243	15	nature	nature	NN
cord-275413-e2rhioty	243	16	of	of	IN
cord-275413-e2rhioty	243	17	the	the	DT
cord-275413-e2rhioty	243	18	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	243	19	.	.	.
cord-275413-e2rhioty	244	1	A	a	DT
cord-275413-e2rhioty	244	2	significant	significant	JJ
cord-275413-e2rhioty	244	3	number	number	NN
cord-275413-e2rhioty	244	4	of	of	IN
cord-275413-e2rhioty	244	5	apparently	apparently	RB
cord-275413-e2rhioty	244	6	healthy	healthy	JJ
cord-275413-e2rhioty	244	7	,	,	,
cord-275413-e2rhioty	244	8	but	but	CC
cord-275413-e2rhioty	244	9	infected	infected	JJ
cord-275413-e2rhioty	244	10	fetuses	fetus	NNS
cord-275413-e2rhioty	244	11	,	,	,
cord-275413-e2rhioty	244	12	are	be	VBP
cord-275413-e2rhioty	244	13	likely	likely	RB
cord-275413-e2rhioty	244	14	go	go	VB
cord-275413-e2rhioty	244	15	on	on	RP
cord-275413-e2rhioty	244	16	to	to	TO
cord-275413-e2rhioty	244	17	become	become	VB
cord-275413-e2rhioty	244	18	healthy	healthy	JJ
cord-275413-e2rhioty	244	19	growing	grow	VBG
cord-275413-e2rhioty	244	20	pigs	pig	NNS
cord-275413-e2rhioty	244	21	with	with	IN
cord-275413-e2rhioty	244	22	the	the	DT
cord-275413-e2rhioty	244	23	capacity	capacity	NN
cord-275413-e2rhioty	244	24	to	to	TO
cord-275413-e2rhioty	244	25	shed	shed	VB
cord-275413-e2rhioty	244	26	virus	virus	NN
cord-275413-e2rhioty	244	27	.	.	.
cord-275413-e2rhioty	245	1	RNA	RNA	NNP
cord-275413-e2rhioty	245	2	viruses	virus	NNS
cord-275413-e2rhioty	245	3	often	often	RB
cord-275413-e2rhioty	245	4	exist	exist	VBP
cord-275413-e2rhioty	245	5	as	as	IN
cord-275413-e2rhioty	245	6	a	a	DT
cord-275413-e2rhioty	245	7	population	population	NN
cord-275413-e2rhioty	245	8	of	of	IN
cord-275413-e2rhioty	245	9	closely	closely	RB
cord-275413-e2rhioty	245	10	related	related	JJ
cord-275413-e2rhioty	245	11	sequences	sequence	NNS
cord-275413-e2rhioty	245	12	,	,	,
cord-275413-e2rhioty	245	13	frequently	frequently	RB
cord-275413-e2rhioty	245	14	referred	refer	VBD
cord-275413-e2rhioty	245	15	to	to	IN
cord-275413-e2rhioty	245	16	as	as	IN
cord-275413-e2rhioty	245	17	a	a	DT
cord-275413-e2rhioty	245	18	quasispecies	quasispecie	NNS
cord-275413-e2rhioty	245	19	.	.	.
cord-275413-e2rhioty	246	1	The	the	DT
cord-275413-e2rhioty	246	2	appearance	appearance	NN
cord-275413-e2rhioty	246	3	or	or	CC
cord-275413-e2rhioty	246	4	disappearance	disappearance	NN
cord-275413-e2rhioty	246	5	of	of	IN
cord-275413-e2rhioty	246	6	individual	individual	JJ
cord-275413-e2rhioty	246	7	gene	gene	NN
cord-275413-e2rhioty	246	8	sequences	sequence	NNS
cord-275413-e2rhioty	246	9	in	in	IN
cord-275413-e2rhioty	246	10	the	the	DT
cord-275413-e2rhioty	246	11	population	population	NN
cord-275413-e2rhioty	246	12	over	over	IN
cord-275413-e2rhioty	246	13	the	the	DT
cord-275413-e2rhioty	246	14	course	course	NN
cord-275413-e2rhioty	246	15	of	of	IN
cord-275413-e2rhioty	246	16	infection	infection	NN
cord-275413-e2rhioty	246	17	is	be	VBZ
cord-275413-e2rhioty	246	18	used	use	VBN
cord-275413-e2rhioty	246	19	as	as	IN
cord-275413-e2rhioty	246	20	evidence	evidence	NN
cord-275413-e2rhioty	246	21	for	for	IN
cord-275413-e2rhioty	246	22	changes	change	NNS
cord-275413-e2rhioty	246	23	in	in	IN
cord-275413-e2rhioty	246	24	fitness	fitness	NN
cord-275413-e2rhioty	246	25	that	that	WDT
cord-275413-e2rhioty	246	26	result	result	VBP
cord-275413-e2rhioty	246	27	from	from	IN
cord-275413-e2rhioty	246	28	selection	selection	NN
cord-275413-e2rhioty	246	29	.	.	.
cord-275413-e2rhioty	247	1	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	247	2	variants	variant	NNS
cord-275413-e2rhioty	247	3	with	with	IN
cord-275413-e2rhioty	247	4	mutations	mutation	NNS
cord-275413-e2rhioty	247	5	in	in	IN
cord-275413-e2rhioty	247	6	ORF5	ORF5	NNP
cord-275413-e2rhioty	247	7	typically	typically	RB
cord-275413-e2rhioty	247	8	appear	appear	VBP
cord-275413-e2rhioty	247	9	during	during	IN
cord-275413-e2rhioty	247	10	the	the	DT
cord-275413-e2rhioty	247	11	serial	serial	JJ
cord-275413-e2rhioty	247	12	passage	passage	NN
cord-275413-e2rhioty	247	13	of	of	IN
cord-275413-e2rhioty	247	14	virus	virus	NN
cord-275413-e2rhioty	247	15	in	in	IN
cord-275413-e2rhioty	247	16	culture	culture	NN
cord-275413-e2rhioty	247	17	and	and	CC
cord-275413-e2rhioty	247	18	during	during	IN
cord-275413-e2rhioty	247	19	infection	infection	NN
cord-275413-e2rhioty	247	20	of	of	IN
cord-275413-e2rhioty	247	21	pigs	pig	NNS
cord-275413-e2rhioty	247	22	Allende	Allende	NNP
cord-275413-e2rhioty	247	23	et	et	NNP
cord-275413-e2rhioty	247	24	al	al	NNP
cord-275413-e2rhioty	247	25	.	.	NNP
cord-275413-e2rhioty	247	26	,	,	,
cord-275413-e2rhioty	247	27	2000	2000	CD
cord-275413-e2rhioty	247	28	)	)	-RRB-
cord-275413-e2rhioty	247	29	.	.	.
cord-275413-e2rhioty	248	1	The	the	DT
cord-275413-e2rhioty	248	2	significance	significance	NN
cord-275413-e2rhioty	248	3	of	of	IN
cord-275413-e2rhioty	248	4	mutations	mutation	NNS
cord-275413-e2rhioty	248	5	in	in	IN
cord-275413-e2rhioty	248	6	ORF5	ORF5	NNP
cord-275413-e2rhioty	248	7	as	as	IN
cord-275413-e2rhioty	248	8	a	a	DT
cord-275413-e2rhioty	248	9	source	source	NN
cord-275413-e2rhioty	248	10	for	for	IN
cord-275413-e2rhioty	248	11	increased	increased	JJ
cord-275413-e2rhioty	248	12	fitness	fitness	NN
cord-275413-e2rhioty	248	13	during	during	IN
cord-275413-e2rhioty	248	14	infection	infection	NN
cord-275413-e2rhioty	248	15	is	be	VBZ
cord-275413-e2rhioty	248	16	not	not	RB
cord-275413-e2rhioty	248	17	completely	completely	RB
cord-275413-e2rhioty	248	18	understood	understand	VBN
cord-275413-e2rhioty	248	19	;	;	:
cord-275413-e2rhioty	248	20	but	but	CC
cord-275413-e2rhioty	248	21	is	be	VBZ
cord-275413-e2rhioty	248	22	useful	useful	JJ
cord-275413-e2rhioty	248	23	for	for	IN
cord-275413-e2rhioty	248	24	following	follow	VBG
cord-275413-e2rhioty	248	25	the	the	DT
cord-275413-e2rhioty	248	26	fate	fate	NN
cord-275413-e2rhioty	248	27	of	of	IN
cord-275413-e2rhioty	248	28	individual	individual	JJ
cord-275413-e2rhioty	248	29	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	248	30	subpopulations	subpopulation	NNS
cord-275413-e2rhioty	248	31	over	over	IN
cord-275413-e2rhioty	248	32	the	the	DT
cord-275413-e2rhioty	248	33	course	course	NN
cord-275413-e2rhioty	248	34	of	of	IN
cord-275413-e2rhioty	248	35	a	a	DT
cord-275413-e2rhioty	248	36	long	long	JJ
cord-275413-e2rhioty	248	37	-	-	HYPH
cord-275413-e2rhioty	248	38	term	term	NN
cord-275413-e2rhioty	248	39	infection	infection	NN
cord-275413-e2rhioty	248	40	.	.	.
cord-275413-e2rhioty	249	1	In	in	IN
cord-275413-e2rhioty	249	2	this	this	DT
cord-275413-e2rhioty	249	3	study	study	NN
cord-275413-e2rhioty	249	4	,	,	,
cord-275413-e2rhioty	249	5	one	one	CD
cord-275413-e2rhioty	249	6	dam	dam	NN
cord-275413-e2rhioty	249	7	,	,	,
cord-275413-e2rhioty	249	8	no	no	NN
cord-275413-e2rhioty	249	9	.	.	NN
cord-275413-e2rhioty	249	10	4	4	CD
cord-275413-e2rhioty	249	11	,	,	,
cord-275413-e2rhioty	249	12	showed	show	VBD
cord-275413-e2rhioty	249	13	evidence	evidence	NN
cord-275413-e2rhioty	249	14	of	of	IN
cord-275413-e2rhioty	249	15	a	a	DT
cord-275413-e2rhioty	249	16	mixed	mixed	JJ
cord-275413-e2rhioty	249	17	PRRSV	prrsv	NN
cord-275413-e2rhioty	249	18	infection	infection	NN
cord-275413-e2rhioty	249	19	as	as	IN
cord-275413-e2rhioty	249	20	indicated	indicate	VBN
cord-275413-e2rhioty	249	21	by	by	IN
cord-275413-e2rhioty	249	22	the	the	DT
cord-275413-e2rhioty	249	23	presence	presence	NN
cord-275413-e2rhioty	249	24	of	of	IN
cord-275413-e2rhioty	249	25	two	two	CD
cord-275413-e2rhioty	249	26	different	different	JJ
cord-275413-e2rhioty	249	27	ORF5	orf5	NN
cord-275413-e2rhioty	249	28	sequences	sequence	NNS
cord-275413-e2rhioty	249	29	,	,	,
cord-275413-e2rhioty	249	30	which	which	WDT
cord-275413-e2rhioty	249	31	were	be	VBD
cord-275413-e2rhioty	249	32	distinguished	distinguish	VBN
cord-275413-e2rhioty	249	33	from	from	IN
cord-275413-e2rhioty	249	34	each	each	DT
cord-275413-e2rhioty	249	35	other	other	JJ
cord-275413-e2rhioty	249	36	by	by	IN
cord-275413-e2rhioty	249	37	a	a	DT
cord-275413-e2rhioty	249	38	nucleotide	nucleotide	JJ
cord-275413-e2rhioty	249	39	substitution	substitution	NN
cord-275413-e2rhioty	249	40	at	at	IN
cord-275413-e2rhioty	249	41	position	position	NN
cord-275413-e2rhioty	249	42	77	77	CD
cord-275413-e2rhioty	249	43	in	in	IN
cord-275413-e2rhioty	249	44	ORF5	ORF5	NNP
cord-275413-e2rhioty	249	45	.	.	.
cord-275413-e2rhioty	250	1	The	the	DT
cord-275413-e2rhioty	250	2	C	C	NNP
cord-275413-e2rhioty	250	3	to	to	IN
cord-275413-e2rhioty	250	4	T	T	NNP
cord-275413-e2rhioty	250	5	change	change	NN
cord-275413-e2rhioty	250	6	was	be	VBD
cord-275413-e2rhioty	250	7	observed	observe	VBN
cord-275413-e2rhioty	250	8	in	in	IN
cord-275413-e2rhioty	250	9	approximately	approximately	RB
cord-275413-e2rhioty	250	10	60	60	CD
cord-275413-e2rhioty	250	11	%	%	NN
cord-275413-e2rhioty	250	12	of	of	IN
cord-275413-e2rhioty	250	13	the	the	DT
cord-275413-e2rhioty	250	14	cloned	clone	VBN
cord-275413-e2rhioty	250	15	plasmid	plasmid	NN
cord-275413-e2rhioty	250	16	products	product	NNS
cord-275413-e2rhioty	250	17	obtained	obtain	VBN
cord-275413-e2rhioty	250	18	from	from	IN
cord-275413-e2rhioty	250	19	dam	dam	NN
cord-275413-e2rhioty	250	20	no	no	NN
cord-275413-e2rhioty	250	21	.	.	NN
cord-275413-e2rhioty	250	22	4	4	LS
cord-275413-e2rhioty	250	23	(	(	-LRB-
cord-275413-e2rhioty	250	24	see	see	VB
cord-275413-e2rhioty	250	25	Table	Table	NNP
cord-275413-e2rhioty	250	26	2	2	CD
cord-275413-e2rhioty	250	27	)	)	-RRB-
cord-275413-e2rhioty	250	28	.	.	.
cord-275413-e2rhioty	251	1	However	however	RB
cord-275413-e2rhioty	251	2	,	,	,
cord-275413-e2rhioty	251	3	the	the	DT
cord-275413-e2rhioty	251	4	same	same	JJ
cord-275413-e2rhioty	251	5	frequency	frequency	NN
cord-275413-e2rhioty	251	6	was	be	VBD
cord-275413-e2rhioty	251	7	not	not	RB
cord-275413-e2rhioty	251	8	transferred	transfer	VBN
cord-275413-e2rhioty	251	9	to	to	IN
cord-275413-e2rhioty	251	10	the	the	DT
cord-275413-e2rhioty	251	11	individual	individual	JJ
cord-275413-e2rhioty	251	12	fetuses	fetus	NNS
cord-275413-e2rhioty	251	13	,	,	,
cord-275413-e2rhioty	251	14	which	which	WDT
cord-275413-e2rhioty	251	15	included	include	VBD
cord-275413-e2rhioty	251	16	two	two	CD
cord-275413-e2rhioty	251	17	fetuses	fetus	NNS
cord-275413-e2rhioty	251	18	that	that	WDT
cord-275413-e2rhioty	251	19	possessed	possess	VBD
cord-275413-e2rhioty	251	20	only	only	RB
cord-275413-e2rhioty	251	21	viruses	virus	NNS
cord-275413-e2rhioty	251	22	with	with	IN
cord-275413-e2rhioty	251	23	the	the	DT
cord-275413-e2rhioty	251	24	T-77	T-77	NNP
cord-275413-e2rhioty	251	25	mutation	mutation	NN
cord-275413-e2rhioty	251	26	and	and	CC
cord-275413-e2rhioty	251	27	a	a	DT
cord-275413-e2rhioty	251	28	single	single	JJ
cord-275413-e2rhioty	251	29	fetus	fetus	NN
cord-275413-e2rhioty	251	30	with	with	IN
cord-275413-e2rhioty	251	31	a	a	DT
cord-275413-e2rhioty	251	32	virus	virus	NN
cord-275413-e2rhioty	251	33	population	population	NN
cord-275413-e2rhioty	251	34	dominated	dominate	VBN
cord-275413-e2rhioty	251	35	by	by	IN
cord-275413-e2rhioty	251	36	C	C	NNP
cord-275413-e2rhioty	251	37	at	at	IN
cord-275413-e2rhioty	251	38	position	position	NN
cord-275413-e2rhioty	251	39	77	77	CD
cord-275413-e2rhioty	251	40	.	.	.
cord-275413-e2rhioty	252	1	These	these	DT
cord-275413-e2rhioty	252	2	results	result	NNS
cord-275413-e2rhioty	252	3	suggest	suggest	VBP
cord-275413-e2rhioty	252	4	that	that	IN
cord-275413-e2rhioty	252	5	fetal	fetal	JJ
cord-275413-e2rhioty	252	6	infection	infection	NN
cord-275413-e2rhioty	252	7	can	can	MD
cord-275413-e2rhioty	252	8	alter	alter	VB
cord-275413-e2rhioty	252	9	the	the	DT
cord-275413-e2rhioty	252	10	selection	selection	NN
cord-275413-e2rhioty	252	11	of	of	IN
cord-275413-e2rhioty	252	12	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	252	13	variants	variant	NNS
cord-275413-e2rhioty	252	14	and	and	CC
cord-275413-e2rhioty	252	15	may	may	MD
cord-275413-e2rhioty	252	16	represent	represent	VB
cord-275413-e2rhioty	252	17	a	a	DT
cord-275413-e2rhioty	252	18	source	source	NN
cord-275413-e2rhioty	252	19	of	of	IN
cord-275413-e2rhioty	252	20	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	252	21	genetic	genetic	JJ
cord-275413-e2rhioty	252	22	diversity	diversity	NN
cord-275413-e2rhioty	252	23	.	.	.
cord-275413-e2rhioty	253	1	To	to	TO
cord-275413-e2rhioty	253	2	identify	identify	VB
cord-275413-e2rhioty	253	3	the	the	DT
cord-275413-e2rhioty	253	4	targets	target	NNS
cord-275413-e2rhioty	253	5	of	of	IN
cord-275413-e2rhioty	253	6	virus	virus	NN
cord-275413-e2rhioty	253	7	replication	replication	NN
cord-275413-e2rhioty	253	8	in	in	IN
cord-275413-e2rhioty	253	9	the	the	DT
cord-275413-e2rhioty	253	10	fetus	fetus	NN
cord-275413-e2rhioty	253	11	,	,	,
cord-275413-e2rhioty	253	12	a	a	DT
cord-275413-e2rhioty	253	13	variety	variety	NN
cord-275413-e2rhioty	253	14	of	of	IN
cord-275413-e2rhioty	253	15	tissues	tissue	NNS
cord-275413-e2rhioty	253	16	were	be	VBD
cord-275413-e2rhioty	253	17	assessed	assess	VBN
cord-275413-e2rhioty	253	18	for	for	IN
cord-275413-e2rhioty	253	19	the	the	DT
cord-275413-e2rhioty	253	20	presence	presence	NN
cord-275413-e2rhioty	253	21	of	of	IN
cord-275413-e2rhioty	253	22	virus	virus	NN
cord-275413-e2rhioty	253	23	and	and	CC
cord-275413-e2rhioty	253	24	virus	virus	NN
cord-275413-e2rhioty	253	25	-	-	HYPH
cord-275413-e2rhioty	253	26	infected	infect	VBN
cord-275413-e2rhioty	253	27	cells	cell	NNS
cord-275413-e2rhioty	253	28	.	.	.
cord-275413-e2rhioty	254	1	VI	VI	NNP
cord-275413-e2rhioty	254	2	,	,	,
cord-275413-e2rhioty	254	3	as	as	IN
cord-275413-e2rhioty	254	4	opposed	oppose	VBN
cord-275413-e2rhioty	254	5	to	to	IN
cord-275413-e2rhioty	254	6	more	more	RBR
cord-275413-e2rhioty	254	7	sensitive	sensitive	JJ
cord-275413-e2rhioty	254	8	approaches	approach	NNS
cord-275413-e2rhioty	254	9	,	,	,
cord-275413-e2rhioty	254	10	such	such	JJ
cord-275413-e2rhioty	254	11	as	as	IN
cord-275413-e2rhioty	254	12	PCR	PCR	NNP
cord-275413-e2rhioty	254	13	,	,	,
cord-275413-e2rhioty	254	14	was	be	VBD
cord-275413-e2rhioty	254	15	selected	select	VBN
cord-275413-e2rhioty	254	16	as	as	IN
cord-275413-e2rhioty	254	17	the	the	DT
cord-275413-e2rhioty	254	18	means	mean	NNS
cord-275413-e2rhioty	254	19	for	for	IN
cord-275413-e2rhioty	254	20	measuring	measure	VBG
cord-275413-e2rhioty	254	21	virus	virus	NN
cord-275413-e2rhioty	254	22	,	,	,
cord-275413-e2rhioty	254	23	because	because	IN
cord-275413-e2rhioty	254	24	the	the	DT
cord-275413-e2rhioty	254	25	relative	relative	JJ
cord-275413-e2rhioty	254	26	insensitivity	insensitivity	NN
cord-275413-e2rhioty	254	27	of	of	IN
cord-275413-e2rhioty	254	28	VI	VI	NNP
cord-275413-e2rhioty	254	29	avoids	avoid	VBZ
cord-275413-e2rhioty	254	30	the	the	DT
cord-275413-e2rhioty	254	31	possibility	possibility	NN
cord-275413-e2rhioty	254	32	of	of	IN
cord-275413-e2rhioty	254	33	false	false	JJ
cord-275413-e2rhioty	254	34	positive	positive	JJ
cord-275413-e2rhioty	254	35	PCR	PCR	NNP
cord-275413-e2rhioty	254	36	results	result	NNS
cord-275413-e2rhioty	254	37	that	that	WDT
cord-275413-e2rhioty	254	38	might	may	MD
cord-275413-e2rhioty	254	39	result	result	VB
cord-275413-e2rhioty	254	40	from	from	IN
cord-275413-e2rhioty	254	41	small	small	JJ
cord-275413-e2rhioty	254	42	amounts	amount	NNS
cord-275413-e2rhioty	254	43	of	of	IN
cord-275413-e2rhioty	254	44	contaminating	contaminate	VBG
cord-275413-e2rhioty	254	45	maternal	maternal	JJ
cord-275413-e2rhioty	254	46	material	material	NN
cord-275413-e2rhioty	254	47	.	.	.
cord-275413-e2rhioty	255	1	Within	within	IN
cord-275413-e2rhioty	255	2	the	the	DT
cord-275413-e2rhioty	255	3	group	group	NN
cord-275413-e2rhioty	255	4	of	of	IN
cord-275413-e2rhioty	255	5	selected	select	VBN
cord-275413-e2rhioty	255	6	tissues	tissue	NNS
cord-275413-e2rhioty	255	7	,	,	,
cord-275413-e2rhioty	255	8	virus	virus	NN
cord-275413-e2rhioty	255	9	could	could	MD
cord-275413-e2rhioty	255	10	be	be	VB
cord-275413-e2rhioty	255	11	isolated	isolate	VBN
cord-275413-e2rhioty	255	12	from	from	IN
cord-275413-e2rhioty	255	13	all	all	DT
cord-275413-e2rhioty	255	14	tissues	tissue	NNS
cord-275413-e2rhioty	255	15	.	.	.
cord-275413-e2rhioty	256	1	However	however	RB
cord-275413-e2rhioty	256	2	,	,	,
cord-275413-e2rhioty	256	3	the	the	DT
cord-275413-e2rhioty	256	4	most	most	RBS
cord-275413-e2rhioty	256	5	consistent	consistent	JJ
cord-275413-e2rhioty	256	6	source	source	NN
cord-275413-e2rhioty	256	7	and	and	CC
cord-275413-e2rhioty	256	8	largest	large	JJS
cord-275413-e2rhioty	256	9	quantity	quantity	NN
cord-275413-e2rhioty	256	10	of	of	IN
cord-275413-e2rhioty	256	11	virus	virus	NN
cord-275413-e2rhioty	256	12	were	be	VBD
cord-275413-e2rhioty	256	13	obtained	obtain	VBN
cord-275413-e2rhioty	256	14	from	from	IN
cord-275413-e2rhioty	256	15	the	the	DT
cord-275413-e2rhioty	256	16	thymus	thymus	NN
cord-275413-e2rhioty	256	17	.	.	.
cord-275413-e2rhioty	257	1	Collectively	collectively	RB
cord-275413-e2rhioty	257	2	,	,	,
cord-275413-e2rhioty	257	3	these	these	DT
cord-275413-e2rhioty	257	4	data	datum	NNS
cord-275413-e2rhioty	257	5	identify	identify	VBP
cord-275413-e2rhioty	257	6	the	the	DT
cord-275413-e2rhioty	257	7	thymus	thymus	NN
cord-275413-e2rhioty	257	8	as	as	IN
cord-275413-e2rhioty	257	9	a	a	DT
cord-275413-e2rhioty	257	10	primary	primary	JJ
cord-275413-e2rhioty	257	11	site	site	NN
cord-275413-e2rhioty	257	12	of	of	IN
cord-275413-e2rhioty	257	13	virus	virus	NN
cord-275413-e2rhioty	257	14	replication	replication	NN
cord-275413-e2rhioty	257	15	in	in	IN
cord-275413-e2rhioty	257	16	the	the	DT
cord-275413-e2rhioty	257	17	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	257	18	-	-	HYPH
cord-275413-e2rhioty	257	19	infected	infect	VBN
cord-275413-e2rhioty	257	20	fetus	fetus	NN
cord-275413-e2rhioty	257	21	and	and	CC
cord-275413-e2rhioty	257	22	confirm	confirm	VB
cord-275413-e2rhioty	257	23	an	an	DT
cord-275413-e2rhioty	257	24	earlier	early	JJR
cord-275413-e2rhioty	257	25	observation	observation	NN
cord-275413-e2rhioty	257	26	for	for	IN
cord-275413-e2rhioty	257	27	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	257	28	by	by	IN
cord-275413-e2rhioty	257	29	Benson	Benson	NNP
cord-275413-e2rhioty	257	30	et	et	NNP
cord-275413-e2rhioty	257	31	al	al	NNP
cord-275413-e2rhioty	257	32	.	.	.
cord-275413-e2rhioty	258	1	(	(	-LRB-
cord-275413-e2rhioty	258	2	2002	2002	CD
cord-275413-e2rhioty	258	3	)	)	-RRB-
cord-275413-e2rhioty	258	4	.	.	.
cord-275413-e2rhioty	259	1	The	the	DT
cord-275413-e2rhioty	259	2	specific	specific	JJ
cord-275413-e2rhioty	259	3	cell	cell	NN
cord-275413-e2rhioty	259	4	population	population	NN
cord-275413-e2rhioty	259	5	in	in	IN
cord-275413-e2rhioty	259	6	the	the	DT
cord-275413-e2rhioty	259	7	thymus	thymus	NN
cord-275413-e2rhioty	259	8	targeted	target	VBN
cord-275413-e2rhioty	259	9	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	259	10	replication	replication	NN
cord-275413-e2rhioty	259	11	remains	remain	VBZ
cord-275413-e2rhioty	259	12	unknown	unknown	JJ
cord-275413-e2rhioty	259	13	.	.	.
cord-275413-e2rhioty	260	1	The	the	DT
cord-275413-e2rhioty	260	2	natural	natural	JJ
cord-275413-e2rhioty	260	3	predisposition	predisposition	NN
cord-275413-e2rhioty	260	4	of	of	IN
cord-275413-e2rhioty	260	5	maternal	maternal	JJ
cord-275413-e2rhioty	260	6	immunity	immunity	NN
cord-275413-e2rhioty	260	7	towards	towards	IN
cord-275413-e2rhioty	260	8	Th2like	th2like	JJ
cord-275413-e2rhioty	260	9	responses	response	NNS
cord-275413-e2rhioty	260	10	aids	aid	NNS
cord-275413-e2rhioty	260	11	in	in	IN
cord-275413-e2rhioty	260	12	protecting	protect	VBG
cord-275413-e2rhioty	260	13	the	the	DT
cord-275413-e2rhioty	260	14	fetus	fetus	NN
cord-275413-e2rhioty	260	15	by	by	IN
cord-275413-e2rhioty	260	16	blocking	block	VBG
cord-275413-e2rhioty	260	17	cell	cell	NN
cord-275413-e2rhioty	260	18	-	-	HYPH
cord-275413-e2rhioty	260	19	mediated	mediate	VBN
cord-275413-e2rhioty	260	20	Th1-related	Th1-related	NNP
cord-275413-e2rhioty	260	21	allorejection	allorejection	NN
cord-275413-e2rhioty	260	22	responses	response	NNS
cord-275413-e2rhioty	260	23	(	(	-LRB-
cord-275413-e2rhioty	260	24	Arck	Arck	NNP
cord-275413-e2rhioty	260	25	et	et	FW
cord-275413-e2rhioty	260	26	al	al	NNP
cord-275413-e2rhioty	260	27	.	.	NNP
cord-275413-e2rhioty	260	28	,	,	,
cord-275413-e2rhioty	260	29	1999	1999	CD
cord-275413-e2rhioty	260	30	;	;	:
cord-275413-e2rhioty	260	31	Entrican	Entrican	NNP
cord-275413-e2rhioty	260	32	,	,	,
cord-275413-e2rhioty	260	33	2002	2002	CD
cord-275413-e2rhioty	260	34	;	;	:
cord-275413-e2rhioty	260	35	Raghupathy	Raghupathy	NNP
cord-275413-e2rhioty	260	36	,	,	,
cord-275413-e2rhioty	260	37	2001	2001	CD
cord-275413-e2rhioty	260	38	;	;	:
cord-275413-e2rhioty	260	39	recently	recently	RB
cord-275413-e2rhioty	260	40	reviewed	review	VBN
cord-275413-e2rhioty	260	41	in	in	IN
cord-275413-e2rhioty	260	42	Challis	Challis	NNP
cord-275413-e2rhioty	260	43	et	et	NNP
cord-275413-e2rhioty	260	44	al	al	NNP
cord-275413-e2rhioty	260	45	.	.	NNP
cord-275413-e2rhioty	260	46	,	,	,
cord-275413-e2rhioty	260	47	2009	2009	CD
cord-275413-e2rhioty	260	48	)	)	-RRB-
cord-275413-e2rhioty	260	49	.	.	.
cord-275413-e2rhioty	261	1	The	the	DT
cord-275413-e2rhioty	261	2	negative	negative	JJ
cord-275413-e2rhioty	261	3	influence	influence	NN
cord-275413-e2rhioty	261	4	of	of	IN
cord-275413-e2rhioty	261	5	Th1	th1	NN
cord-275413-e2rhioty	261	6	cytokines	cytokine	NNS
cord-275413-e2rhioty	261	7	on	on	IN
cord-275413-e2rhioty	261	8	fetal	fetal	JJ
cord-275413-e2rhioty	261	9	development	development	NN
cord-275413-e2rhioty	261	10	can	can	MD
cord-275413-e2rhioty	261	11	be	be	VB
cord-275413-e2rhioty	261	12	demonstrated	demonstrate	VBN
cord-275413-e2rhioty	261	13	experimentally	experimentally	RB
cord-275413-e2rhioty	261	14	in	in	IN
cord-275413-e2rhioty	261	15	mice	mouse	NNS
cord-275413-e2rhioty	261	16	,	,	,
cord-275413-e2rhioty	261	17	which	which	WDT
cord-275413-e2rhioty	261	18	show	show	VBP
cord-275413-e2rhioty	261	19	that	that	IN
cord-275413-e2rhioty	261	20	a	a	DT
cord-275413-e2rhioty	261	21	single	single	JJ
cord-275413-e2rhioty	261	22	injection	injection	NN
cord-275413-e2rhioty	261	23	of	of	IN
cord-275413-e2rhioty	261	24	IL-2	IL-2	NNP
cord-275413-e2rhioty	261	25	or	or	CC
cord-275413-e2rhioty	261	26	IFN-	IFN-	NNP
cord-275413-e2rhioty	261	27	␥	␥	NNP
cord-275413-e2rhioty	261	28	into	into	IN
cord-275413-e2rhioty	261	29	certain	certain	JJ
cord-275413-e2rhioty	261	30	strains	strain	NNS
cord-275413-e2rhioty	261	31	induces	induce	VBZ
cord-275413-e2rhioty	261	32	fetal	fetal	JJ
cord-275413-e2rhioty	261	33	resorption	resorption	NN
cord-275413-e2rhioty	261	34	(	(	-LRB-
cord-275413-e2rhioty	261	35	Lala	Lala	NNP
cord-275413-e2rhioty	261	36	,	,	,
cord-275413-e2rhioty	261	37	1990	1990	CD
cord-275413-e2rhioty	261	38	;	;	:
cord-275413-e2rhioty	261	39	Chaouat	Chaouat	NNP
cord-275413-e2rhioty	261	40	et	et	NNP
cord-275413-e2rhioty	261	41	al	al	NNP
cord-275413-e2rhioty	261	42	.	.	NNP
cord-275413-e2rhioty	261	43	,	,	,
cord-275413-e2rhioty	261	44	1990	1990	CD
cord-275413-e2rhioty	261	45	)	)	-RRB-
cord-275413-e2rhioty	261	46	.	.	.
cord-275413-e2rhioty	262	1	TNF-	TNF-	NNP
cord-275413-e2rhioty	263	1	␣	␣	NNP
cord-275413-e2rhioty	263	2	,	,	,
cord-275413-e2rhioty	263	3	when	when	WRB
cord-275413-e2rhioty	263	4	infected	infect	VBN
cord-275413-e2rhioty	263	5	into	into	IN
cord-275413-e2rhioty	263	6	mice	mouse	NNS
cord-275413-e2rhioty	263	7	is	be	VBZ
cord-275413-e2rhioty	263	8	abortifacient	abortifacient	JJ
cord-275413-e2rhioty	264	1	(	(	-LRB-
cord-275413-e2rhioty	264	2	Clark	Clark	NNP
cord-275413-e2rhioty	264	3	et	et	NNP
cord-275413-e2rhioty	264	4	al	al	NNP
cord-275413-e2rhioty	264	5	.	.	NNP
cord-275413-e2rhioty	264	6	,	,	,
cord-275413-e2rhioty	264	7	2004	2004	CD
cord-275413-e2rhioty	264	8	)	)	-RRB-
cord-275413-e2rhioty	264	9	.	.	.
cord-275413-e2rhioty	265	1	Th1	th1	NN
cord-275413-e2rhioty	265	2	cytokines	cytokine	NNS
cord-275413-e2rhioty	265	3	can	can	MD
cord-275413-e2rhioty	265	4	also	also	RB
cord-275413-e2rhioty	265	5	have	have	VB
cord-275413-e2rhioty	265	6	important	important	JJ
cord-275413-e2rhioty	265	7	long	long	JJ
cord-275413-e2rhioty	265	8	-	-	HYPH
cord-275413-e2rhioty	265	9	term	term	NN
cord-275413-e2rhioty	265	10	impacts	impact	NNS
cord-275413-e2rhioty	265	11	.	.	.
cord-275413-e2rhioty	266	1	For	for	IN
cord-275413-e2rhioty	266	2	example	example	NN
cord-275413-e2rhioty	266	3	,	,	,
cord-275413-e2rhioty	266	4	newborn	newborn	JJ
cord-275413-e2rhioty	266	5	mice	mouse	NNS
cord-275413-e2rhioty	266	6	that	that	WDT
cord-275413-e2rhioty	266	7	survive	survive	VBP
cord-275413-e2rhioty	266	8	maternal	maternal	JJ
cord-275413-e2rhioty	266	9	infection	infection	NN
cord-275413-e2rhioty	266	10	with	with	IN
cord-275413-e2rhioty	266	11	influenza	influenza	NN
cord-275413-e2rhioty	266	12	virus	virus	NN
cord-275413-e2rhioty	266	13	exhibit	exhibit	NNP
cord-275413-e2rhioty	266	14	behav	behav	NNP
cord-275413-e2rhioty	266	15	-	-	HYPH
cord-275413-e2rhioty	266	16	ior	ior	NNP
cord-275413-e2rhioty	266	17	similar	similar	JJ
cord-275413-e2rhioty	266	18	to	to	IN
cord-275413-e2rhioty	266	19	hyperanxiety	hyperanxiety	NN
cord-275413-e2rhioty	266	20	and	and	CC
cord-275413-e2rhioty	266	21	autism	autism	NN
cord-275413-e2rhioty	266	22	.	.	.
cord-275413-e2rhioty	267	1	The	the	DT
cord-275413-e2rhioty	267	2	behavioral	behavioral	JJ
cord-275413-e2rhioty	267	3	changes	change	NNS
cord-275413-e2rhioty	267	4	are	be	VBP
cord-275413-e2rhioty	267	5	a	a	DT
cord-275413-e2rhioty	267	6	consequence	consequence	NN
cord-275413-e2rhioty	267	7	of	of	IN
cord-275413-e2rhioty	267	8	the	the	DT
cord-275413-e2rhioty	267	9	altered	altered	JJ
cord-275413-e2rhioty	267	10	distribution	distribution	NN
cord-275413-e2rhioty	267	11	of	of	IN
cord-275413-e2rhioty	267	12	dopamine	dopamine	NN
cord-275413-e2rhioty	267	13	and	and	CC
cord-275413-e2rhioty	267	14	glutamine	glutamine	NN
cord-275413-e2rhioty	267	15	receptors	receptor	NNS
cord-275413-e2rhioty	267	16	during	during	IN
cord-275413-e2rhioty	267	17	fetal	fetal	JJ
cord-275413-e2rhioty	267	18	brain	brain	NN
cord-275413-e2rhioty	267	19	development	development	NN
cord-275413-e2rhioty	267	20	.	.	.
cord-275413-e2rhioty	268	1	The	the	DT
cord-275413-e2rhioty	268	2	effect	effect	NN
cord-275413-e2rhioty	268	3	of	of	IN
cord-275413-e2rhioty	268	4	influenza	influenza	NN
cord-275413-e2rhioty	268	5	virus	virus	NN
cord-275413-e2rhioty	268	6	infection	infection	NN
cord-275413-e2rhioty	268	7	on	on	IN
cord-275413-e2rhioty	268	8	the	the	DT
cord-275413-e2rhioty	268	9	fetal	fetal	JJ
cord-275413-e2rhioty	268	10	brain	brain	NN
cord-275413-e2rhioty	268	11	can	can	MD
cord-275413-e2rhioty	268	12	be	be	VB
cord-275413-e2rhioty	268	13	mimicked	mimic	VBN
cord-275413-e2rhioty	268	14	by	by	IN
cord-275413-e2rhioty	268	15	the	the	DT
cord-275413-e2rhioty	268	16	administration	administration	NN
cord-275413-e2rhioty	268	17	of	of	IN
cord-275413-e2rhioty	268	18	poly	poly	NNP
cord-275413-e2rhioty	268	19	I	I	NNP
cord-275413-e2rhioty	268	20	:	:	:
cord-275413-e2rhioty	268	21	C	C	NNP
cord-275413-e2rhioty	268	22	,	,	,
cord-275413-e2rhioty	268	23	an	an	DT
cord-275413-e2rhioty	268	24	inducer	inducer	NN
cord-275413-e2rhioty	268	25	of	of	IN
cord-275413-e2rhioty	268	26	IFN	IFN	NNP
cord-275413-e2rhioty	268	27	(	(	-LRB-
cord-275413-e2rhioty	268	28	Shi	Shi	NNP
cord-275413-e2rhioty	268	29	et	et	FW
cord-275413-e2rhioty	268	30	al	al	NNP
cord-275413-e2rhioty	268	31	.	.	NNP
cord-275413-e2rhioty	268	32	,	,	,
cord-275413-e2rhioty	268	33	2003	2003	CD
cord-275413-e2rhioty	268	34	)	)	-RRB-
cord-275413-e2rhioty	268	35	.	.	.
cord-275413-e2rhioty	269	1	Furthermore	furthermore	RB
cord-275413-e2rhioty	269	2	,	,	,
cord-275413-e2rhioty	269	3	the	the	DT
cord-275413-e2rhioty	269	4	addition	addition	NN
cord-275413-e2rhioty	269	5	of	of	IN
cord-275413-e2rhioty	269	6	IFN-	IFN-	NNP
cord-275413-e2rhioty	269	7	␥	␥	NNP
cord-275413-e2rhioty	269	8	to	to	IN
cord-275413-e2rhioty	269	9	hippocampal	hippocampal	JJ
cord-275413-e2rhioty	269	10	neuron	neuron	NN
cord-275413-e2rhioty	269	11	cultures	culture	NNS
cord-275413-e2rhioty	269	12	alters	alter	VBZ
cord-275413-e2rhioty	269	13	the	the	DT
cord-275413-e2rhioty	269	14	distribution	distribution	NN
cord-275413-e2rhioty	269	15	of	of	IN
cord-275413-e2rhioty	269	16	glutamate	glutamate	NN
cord-275413-e2rhioty	269	17	receptors	receptor	NNS
cord-275413-e2rhioty	269	18	,	,	,
cord-275413-e2rhioty	269	19	sufficient	sufficient	JJ
cord-275413-e2rhioty	269	20	to	to	TO
cord-275413-e2rhioty	269	21	affect	affect	VB
cord-275413-e2rhioty	269	22	synaptic	synaptic	JJ
cord-275413-e2rhioty	269	23	activity	activity	NN
cord-275413-e2rhioty	269	24	between	between	IN
cord-275413-e2rhioty	269	25	neurons	neuron	NNS
cord-275413-e2rhioty	269	26	(	(	-LRB-
cord-275413-e2rhioty	269	27	Vikman	Vikman	NNP
cord-275413-e2rhioty	269	28	et	et	NNP
cord-275413-e2rhioty	269	29	al	al	NNP
cord-275413-e2rhioty	269	30	.	.	NNP
cord-275413-e2rhioty	269	31	,	,	,
cord-275413-e2rhioty	269	32	2001	2001	CD
cord-275413-e2rhioty	269	33	)	)	-RRB-
cord-275413-e2rhioty	269	34	.	.	.
cord-275413-e2rhioty	270	1	Virus	virus	NN
cord-275413-e2rhioty	270	2	infections	infection	NNS
cord-275413-e2rhioty	270	3	during	during	IN
cord-275413-e2rhioty	270	4	pregnancy	pregnancy	NN
cord-275413-e2rhioty	270	5	present	present	VBP
cord-275413-e2rhioty	270	6	an	an	DT
cord-275413-e2rhioty	270	7	interesting	interesting	JJ
cord-275413-e2rhioty	270	8	paradox	paradox	NN
cord-275413-e2rhioty	270	9	:	:	:
cord-275413-e2rhioty	270	10	those	those	DT
cord-275413-e2rhioty	270	11	cytokines	cytokine	NNS
cord-275413-e2rhioty	270	12	that	that	WDT
cord-275413-e2rhioty	270	13	protect	protect	VBP
cord-275413-e2rhioty	270	14	the	the	DT
cord-275413-e2rhioty	270	15	fetus	fetus	NN
cord-275413-e2rhioty	270	16	from	from	IN
cord-275413-e2rhioty	270	17	viral	viral	JJ
cord-275413-e2rhioty	270	18	infection	infection	NN
cord-275413-e2rhioty	270	19	,	,	,
cord-275413-e2rhioty	270	20	tend	tend	VBP
cord-275413-e2rhioty	270	21	to	to	TO
cord-275413-e2rhioty	270	22	inhibit	inhibit	VB
cord-275413-e2rhioty	270	23	fetal	fetal	JJ
cord-275413-e2rhioty	270	24	development	development	NN
cord-275413-e2rhioty	270	25	or	or	CC
cord-275413-e2rhioty	270	26	potentiate	potentiate	VB
cord-275413-e2rhioty	270	27	rejection	rejection	NN
cord-275413-e2rhioty	270	28	of	of	IN
cord-275413-e2rhioty	270	29	the	the	DT
cord-275413-e2rhioty	270	30	fetus	fetus	NN
cord-275413-e2rhioty	270	31	;	;	:
cord-275413-e2rhioty	270	32	while	while	IN
cord-275413-e2rhioty	270	33	those	those	DT
cord-275413-e2rhioty	270	34	cytokines	cytokine	NNS
cord-275413-e2rhioty	270	35	that	that	WDT
cord-275413-e2rhioty	270	36	maintain	maintain	VBP
cord-275413-e2rhioty	270	37	and	and	CC
cord-275413-e2rhioty	270	38	promote	promote	VB
cord-275413-e2rhioty	270	39	fetal	fetal	JJ
cord-275413-e2rhioty	270	40	development	development	NN
cord-275413-e2rhioty	270	41	are	be	VBP
cord-275413-e2rhioty	270	42	associated	associate	VBN
cord-275413-e2rhioty	270	43	with	with	IN
cord-275413-e2rhioty	270	44	the	the	DT
cord-275413-e2rhioty	270	45	inhibition	inhibition	NN
cord-275413-e2rhioty	270	46	of	of	IN
cord-275413-e2rhioty	270	47	antiviral	antiviral	JJ
cord-275413-e2rhioty	270	48	immune	immune	JJ
cord-275413-e2rhioty	270	49	responses	response	NNS
cord-275413-e2rhioty	270	50	.	.	.
cord-275413-e2rhioty	271	1	Because	because	IN
cord-275413-e2rhioty	271	2	of	of	IN
cord-275413-e2rhioty	271	3	the	the	DT
cord-275413-e2rhioty	271	4	potential	potential	JJ
cord-275413-e2rhioty	271	5	negative	negative	JJ
cord-275413-e2rhioty	271	6	impact	impact	NN
cord-275413-e2rhioty	271	7	of	of	IN
cord-275413-e2rhioty	271	8	Th1	th1	NN
cord-275413-e2rhioty	271	9	cytokines	cytokine	NNS
cord-275413-e2rhioty	271	10	on	on	IN
cord-275413-e2rhioty	271	11	fetal	fetal	JJ
cord-275413-e2rhioty	271	12	outcome	outcome	NN
cord-275413-e2rhioty	271	13	,	,	,
cord-275413-e2rhioty	271	14	there	there	EX
cord-275413-e2rhioty	271	15	is	be	VBZ
cord-275413-e2rhioty	271	16	a	a	DT
cord-275413-e2rhioty	271	17	natural	natural	JJ
cord-275413-e2rhioty	271	18	predisposition	predisposition	NN
cord-275413-e2rhioty	271	19	for	for	IN
cord-275413-e2rhioty	271	20	the	the	DT
cord-275413-e2rhioty	271	21	fetus	fetus	NN
cord-275413-e2rhioty	271	22	to	to	TO
cord-275413-e2rhioty	271	23	block	block	VB
cord-275413-e2rhioty	271	24	the	the	DT
cord-275413-e2rhioty	271	25	induction	induction	NN
cord-275413-e2rhioty	271	26	of	of	IN
cord-275413-e2rhioty	271	27	Th1-associated	Th1-associated	NNP
cord-275413-e2rhioty	271	28	cytokines	cytokine	NNS
cord-275413-e2rhioty	271	29	.	.	.
cord-275413-e2rhioty	272	1	For	for	IN
cord-275413-e2rhioty	272	2	example	example	NN
cord-275413-e2rhioty	272	3	,	,	,
cord-275413-e2rhioty	272	4	the	the	DT
cord-275413-e2rhioty	272	5	IFN-	IFN-	NNP
cord-275413-e2rhioty	272	6	␥	␥	CD
cord-275413-e2rhioty	272	7	response	response	NN
cord-275413-e2rhioty	272	8	in	in	IN
cord-275413-e2rhioty	272	9	the	the	DT
cord-275413-e2rhioty	272	10	developing	develop	VBG
cord-275413-e2rhioty	272	11	fetus	fetus	NN
cord-275413-e2rhioty	272	12	can	can	MD
cord-275413-e2rhioty	272	13	be	be	VB
cord-275413-e2rhioty	272	14	blocked	block	VBN
cord-275413-e2rhioty	272	15	by	by	IN
cord-275413-e2rhioty	272	16	a	a	DT
cord-275413-e2rhioty	272	17	combination	combination	NN
cord-275413-e2rhioty	272	18	of	of	IN
cord-275413-e2rhioty	272	19	factors	factor	NNS
cord-275413-e2rhioty	272	20	,	,	,
cord-275413-e2rhioty	272	21	including	include	VBG
cord-275413-e2rhioty	272	22	(	(	-LRB-
cord-275413-e2rhioty	272	23	1	1	CD
cord-275413-e2rhioty	272	24	)	)	-RRB-
cord-275413-e2rhioty	272	25	defects	defect	NNS
cord-275413-e2rhioty	272	26	in	in	IN
cord-275413-e2rhioty	272	27	the	the	DT
cord-275413-e2rhioty	272	28	capacity	capacity	NN
cord-275413-e2rhioty	272	29	of	of	IN
cord-275413-e2rhioty	272	30	fetal	fetal	JJ
cord-275413-e2rhioty	272	31	dendritic	dendritic	JJ
cord-275413-e2rhioty	272	32	cells	cell	NNS
cord-275413-e2rhioty	272	33	to	to	TO
cord-275413-e2rhioty	272	34	express	express	VB
cord-275413-e2rhioty	272	35	MHC	MHC	NNP
cord-275413-e2rhioty	272	36	class	class	NN
cord-275413-e2rhioty	272	37	II	II	NNP
cord-275413-e2rhioty	272	38	and	and	CC
cord-275413-e2rhioty	272	39	synthesize	synthesize	VB
cord-275413-e2rhioty	272	40	IL-12	IL-12	NNP
cord-275413-e2rhioty	272	41	,	,	,
cord-275413-e2rhioty	272	42	(	(	-LRB-
cord-275413-e2rhioty	272	43	2	2	LS
cord-275413-e2rhioty	272	44	)	)	-RRB-
cord-275413-e2rhioty	272	45	hypermethylation	hypermethylation	NN
cord-275413-e2rhioty	272	46	of	of	IN
cord-275413-e2rhioty	272	47	the	the	DT
cord-275413-e2rhioty	272	48	IFN-	IFN-	NNP
cord-275413-e2rhioty	272	49	␥	␥	CD
cord-275413-e2rhioty	272	50	gene	gene	NN
cord-275413-e2rhioty	272	51	in	in	IN
cord-275413-e2rhioty	272	52	fetal	fetal	JJ
cord-275413-e2rhioty	272	53	T	t	NN
cord-275413-e2rhioty	272	54	cells	cell	NNS
cord-275413-e2rhioty	272	55	,	,	,
cord-275413-e2rhioty	272	56	(	(	-LRB-
cord-275413-e2rhioty	272	57	3	3	LS
cord-275413-e2rhioty	272	58	)	)	-RRB-
cord-275413-e2rhioty	272	59	the	the	DT
cord-275413-e2rhioty	272	60	absence	absence	NN
cord-275413-e2rhioty	272	61	of	of	IN
cord-275413-e2rhioty	272	62	target	target	NN
cord-275413-e2rhioty	272	63	macrophages	macrophage	NNS
cord-275413-e2rhioty	272	64	,	,	,
cord-275413-e2rhioty	272	65	and	and	CC
cord-275413-e2rhioty	272	66	(	(	-LRB-
cord-275413-e2rhioty	272	67	4	4	LS
cord-275413-e2rhioty	272	68	)	)	-RRB-
cord-275413-e2rhioty	272	69	the	the	DT
cord-275413-e2rhioty	272	70	presence	presence	NN
cord-275413-e2rhioty	272	71	of	of	IN
cord-275413-e2rhioty	272	72	an	an	DT
cord-275413-e2rhioty	272	73	immune	immune	JJ
cord-275413-e2rhioty	272	74	environment	environment	NN
cord-275413-e2rhioty	272	75	dominated	dominate	VBN
cord-275413-e2rhioty	272	76	by	by	IN
cord-275413-e2rhioty	272	77	Th2	Th2	NNP
cord-275413-e2rhioty	272	78	/	/	SYM
cord-275413-e2rhioty	272	79	regulatory	regulatory	JJ
cord-275413-e2rhioty	272	80	cytokines	cytokine	NNS
cord-275413-e2rhioty	272	81	(	(	-LRB-
cord-275413-e2rhioty	272	82	Goriely	Goriely	NNP
cord-275413-e2rhioty	272	83	et	et	NNP
cord-275413-e2rhioty	272	84	al	al	NNP
cord-275413-e2rhioty	272	85	.	.	NNP
cord-275413-e2rhioty	272	86	,	,	,
cord-275413-e2rhioty	272	87	2001	2001	CD
cord-275413-e2rhioty	272	88	;	;	:
cord-275413-e2rhioty	272	89	Langrish	Langrish	NNP
cord-275413-e2rhioty	272	90	et	et	NNP
cord-275413-e2rhioty	272	91	al	al	NNP
cord-275413-e2rhioty	272	92	.	.	NNP
cord-275413-e2rhioty	272	93	,	,	,
cord-275413-e2rhioty	272	94	2002	2002	CD
cord-275413-e2rhioty	272	95	;	;	:
cord-275413-e2rhioty	272	96	Melvin	Melvin	NNP
cord-275413-e2rhioty	272	97	et	et	NNP
cord-275413-e2rhioty	272	98	al	al	NNP
cord-275413-e2rhioty	272	99	.	.	NNP
cord-275413-e2rhioty	272	100	,	,	,
cord-275413-e2rhioty	272	101	1995	1995	CD
cord-275413-e2rhioty	272	102	;	;	:
cord-275413-e2rhioty	272	103	Marodi	Marodi	NNP
cord-275413-e2rhioty	272	104	et	et	NNP
cord-275413-e2rhioty	272	105	al	al	NNP
cord-275413-e2rhioty	272	106	.	.	.
cord-275413-e2rhioty	273	1	,	,	,
cord-275413-e2rhioty	273	2	2001	2001	CD
cord-275413-e2rhioty	273	3	;	;	:
cord-275413-e2rhioty	273	4	Murphy	Murphy	NNP
cord-275413-e2rhioty	273	5	et	et	NNP
cord-275413-e2rhioty	273	6	al	al	NNP
cord-275413-e2rhioty	273	7	.	.	.
cord-275413-e2rhioty	274	1	,	,	,
cord-275413-e2rhioty	274	2	2009	2009	CD
cord-275413-e2rhioty	274	3	;	;	:
cord-275413-e2rhioty	274	4	Prescott	Prescott	NNP
cord-275413-e2rhioty	274	5	et	et	NNP
cord-275413-e2rhioty	274	6	al	al	NNP
cord-275413-e2rhioty	274	7	.	.	NNP
cord-275413-e2rhioty	274	8	,	,	,
cord-275413-e2rhioty	274	9	1998	1998	CD
cord-275413-e2rhioty	274	10	;	;	:
cord-275413-e2rhioty	274	11	White	White	NNP
cord-275413-e2rhioty	274	12	et	et	NNP
cord-275413-e2rhioty	274	13	al	al	NNP
cord-275413-e2rhioty	274	14	.	.	NNP
cord-275413-e2rhioty	274	15	,	,	,
cord-275413-e2rhioty	274	16	2002	2002	CD
cord-275413-e2rhioty	274	17	,	,	,
cord-275413-e2rhioty	274	18	)	)	-RRB-
cord-275413-e2rhioty	274	19	.	.	.
cord-275413-e2rhioty	275	1	With	with	IN
cord-275413-e2rhioty	275	2	this	this	DT
cord-275413-e2rhioty	275	3	in	in	IN
cord-275413-e2rhioty	275	4	mind	mind	NN
cord-275413-e2rhioty	275	5	,	,	,
cord-275413-e2rhioty	275	6	there	there	EX
cord-275413-e2rhioty	275	7	are	be	VBP
cord-275413-e2rhioty	275	8	examples	example	NNS
cord-275413-e2rhioty	275	9	of	of	IN
cord-275413-e2rhioty	275	10	viruses	virus	NNS
cord-275413-e2rhioty	275	11	,	,	,
cord-275413-e2rhioty	275	12	such	such	JJ
cord-275413-e2rhioty	275	13	as	as	IN
cord-275413-e2rhioty	275	14	Epstein	Epstein	NNP
cord-275413-e2rhioty	275	15	-	-	HYPH
cord-275413-e2rhioty	275	16	Barr	Barr	NNP
cord-275413-e2rhioty	275	17	virus	virus	NN
cord-275413-e2rhioty	275	18	(	(	-LRB-
cord-275413-e2rhioty	275	19	EBV	EBV	NNP
cord-275413-e2rhioty	275	20	)	)	-RRB-
cord-275413-e2rhioty	275	21	,	,	,
cord-275413-e2rhioty	275	22	which	which	WDT
cord-275413-e2rhioty	275	23	are	be	VBP
cord-275413-e2rhioty	275	24	capable	capable	JJ
cord-275413-e2rhioty	275	25	of	of	IN
cord-275413-e2rhioty	275	26	stimulating	stimulate	VBG
cord-275413-e2rhioty	275	27	antigen	antigen	NN
cord-275413-e2rhioty	275	28	-	-	HYPH
cord-275413-e2rhioty	275	29	specific	specific	JJ
cord-275413-e2rhioty	275	30	IFN-	IFN-	NNP
cord-275413-e2rhioty	275	31	␥	␥	CD
cord-275413-e2rhioty	275	32	responses	response	NNS
cord-275413-e2rhioty	275	33	in	in	IN
cord-275413-e2rhioty	275	34	human	human	JJ
cord-275413-e2rhioty	275	35	umbilical	umbilical	JJ
cord-275413-e2rhioty	275	36	cord	cord	NN
cord-275413-e2rhioty	275	37	blood	blood	NN
cord-275413-e2rhioty	275	38	lymphocytes	lymphocyte	NNS
cord-275413-e2rhioty	275	39	(	(	-LRB-
cord-275413-e2rhioty	275	40	Ito	Ito	NNP
cord-275413-e2rhioty	275	41	et	et	FW
cord-275413-e2rhioty	275	42	al	al	NNP
cord-275413-e2rhioty	275	43	.	.	NNP
cord-275413-e2rhioty	275	44	,	,	,
cord-275413-e2rhioty	275	45	1998	1998	CD
cord-275413-e2rhioty	275	46	;	;	:
cord-275413-e2rhioty	275	47	Wilson	Wilson	NNP
cord-275413-e2rhioty	275	48	and	and	CC
cord-275413-e2rhioty	275	49	Morgan	Morgan	NNP
cord-275413-e2rhioty	275	50	,	,	,
cord-275413-e2rhioty	275	51	2002	2002	CD
cord-275413-e2rhioty	275	52	)	)	-RRB-
cord-275413-e2rhioty	275	53	.	.	.
cord-275413-e2rhioty	276	1	These	these	DT
cord-275413-e2rhioty	276	2	and	and	CC
cord-275413-e2rhioty	276	3	other	other	JJ
cord-275413-e2rhioty	276	4	data	datum	NNS
cord-275413-e2rhioty	276	5	provide	provide	VBP
cord-275413-e2rhioty	276	6	a	a	DT
cord-275413-e2rhioty	276	7	description	description	NN
cord-275413-e2rhioty	276	8	of	of	IN
cord-275413-e2rhioty	276	9	the	the	DT
cord-275413-e2rhioty	276	10	fetus	fetus	NN
cord-275413-e2rhioty	276	11	as	as	IN
cord-275413-e2rhioty	276	12	capable	capable	JJ
cord-275413-e2rhioty	276	13	of	of	IN
cord-275413-e2rhioty	276	14	initiating	initiate	VBG
cord-275413-e2rhioty	276	15	a	a	DT
cord-275413-e2rhioty	276	16	robust	robust	JJ
cord-275413-e2rhioty	276	17	antiviral	antiviral	JJ
cord-275413-e2rhioty	276	18	Th1	th1	CD
cord-275413-e2rhioty	276	19	immune	immune	JJ
cord-275413-e2rhioty	276	20	response	response	NN
cord-275413-e2rhioty	276	21	(	(	-LRB-
cord-275413-e2rhioty	276	22	Chaouat	Chaouat	NNP
cord-275413-e2rhioty	276	23	et	et	NNP
cord-275413-e2rhioty	276	24	al	al	NNP
cord-275413-e2rhioty	276	25	.	.	NNP
cord-275413-e2rhioty	276	26	,	,	,
cord-275413-e2rhioty	276	27	2002	2002	CD
cord-275413-e2rhioty	276	28	;	;	:
cord-275413-e2rhioty	276	29	Chipeta	Chipeta	NNP
cord-275413-e2rhioty	276	30	et	et	FW
cord-275413-e2rhioty	276	31	al	al	NNP
cord-275413-e2rhioty	276	32	.	.	NNP
cord-275413-e2rhioty	276	33	,	,	,
cord-275413-e2rhioty	276	34	2000	2000	CD
cord-275413-e2rhioty	276	35	;	;	:
cord-275413-e2rhioty	276	36	Murphy	Murphy	NNP
cord-275413-e2rhioty	276	37	et	et	NNP
cord-275413-e2rhioty	276	38	al	al	NNP
cord-275413-e2rhioty	276	39	.	.	NNP
cord-275413-e2rhioty	276	40	,	,	,
cord-275413-e2rhioty	276	41	2009	2009	CD
cord-275413-e2rhioty	276	42	)	)	-RRB-
cord-275413-e2rhioty	276	43	.	.	.
cord-275413-e2rhioty	277	1	In	in	IN
cord-275413-e2rhioty	277	2	this	this	DT
cord-275413-e2rhioty	277	3	study	study	NN
cord-275413-e2rhioty	277	4	IFN-	IFN-	NNP
cord-275413-e2rhioty	277	5	␥	␥	NNP
cord-275413-e2rhioty	277	6	and	and	CC
cord-275413-e2rhioty	277	7	TNF-	TNF-	NNP
cord-275413-e2rhioty	277	8	␣	␣	NNP
cord-275413-e2rhioty	277	9	mRNAs	mrnas	PRP
cord-275413-e2rhioty	277	10	were	be	VBD
cord-275413-e2rhioty	277	11	identified	identify	VBN
cord-275413-e2rhioty	277	12	in	in	IN
cord-275413-e2rhioty	277	13	tissues	tissue	NNS
cord-275413-e2rhioty	277	14	from	from	IN
cord-275413-e2rhioty	277	15	infected	infected	JJ
cord-275413-e2rhioty	277	16	fetuses	fetus	NNS
cord-275413-e2rhioty	277	17	.	.	.
cord-275413-e2rhioty	278	1	RNA	RNA	NNP
cord-275413-e2rhioty	278	2	message	message	NN
cord-275413-e2rhioty	278	3	was	be	VBD
cord-275413-e2rhioty	278	4	not	not	RB
cord-275413-e2rhioty	278	5	identified	identify	VBN
cord-275413-e2rhioty	278	6	in	in	IN
cord-275413-e2rhioty	278	7	tissues	tissue	NNS
cord-275413-e2rhioty	278	8	of	of	IN
cord-275413-e2rhioty	278	9	fetuses	fetus	NNS
cord-275413-e2rhioty	278	10	from	from	IN
cord-275413-e2rhioty	278	11	mock	mock	JJ
cord-275413-e2rhioty	278	12	-	-	HYPH
cord-275413-e2rhioty	278	13	infected	infect	VBN
cord-275413-e2rhioty	278	14	dams	dam	NNS
cord-275413-e2rhioty	278	15	or	or	CC
cord-275413-e2rhioty	278	16	non	non	JJ
cord-275413-e2rhioty	278	17	-	-	JJ
cord-275413-e2rhioty	278	18	infected	infected	JJ
cord-275413-e2rhioty	278	19	fetuses	fetus	NNS
cord-275413-e2rhioty	278	20	from	from	IN
cord-275413-e2rhioty	278	21	infected	infected	JJ
cord-275413-e2rhioty	278	22	dams	dam	NNS
cord-275413-e2rhioty	278	23	.	.	.
cord-275413-e2rhioty	279	1	This	this	DT
cord-275413-e2rhioty	279	2	indicates	indicate	VBZ
cord-275413-e2rhioty	279	3	that	that	IN
cord-275413-e2rhioty	279	4	altered	alter	VBN
cord-275413-e2rhioty	279	5	gene	gene	NN
cord-275413-e2rhioty	279	6	expression	expression	NN
cord-275413-e2rhioty	279	7	is	be	VBZ
cord-275413-e2rhioty	279	8	the	the	DT
cord-275413-e2rhioty	279	9	direct	direct	JJ
cord-275413-e2rhioty	279	10	result	result	NN
cord-275413-e2rhioty	279	11	of	of	IN
cord-275413-e2rhioty	279	12	fetal	fetal	JJ
cord-275413-e2rhioty	279	13	infection	infection	NN
cord-275413-e2rhioty	279	14	.	.	.
cord-275413-e2rhioty	280	1	Up	up	RB
cord-275413-e2rhioty	280	2	-	-	HYPH
cord-275413-e2rhioty	280	3	regulated	regulate	VBN
cord-275413-e2rhioty	280	4	expression	expression	NN
cord-275413-e2rhioty	280	5	was	be	VBD
cord-275413-e2rhioty	280	6	confirmed	confirm	VBN
cord-275413-e2rhioty	280	7	by	by	IN
cord-275413-e2rhioty	280	8	the	the	DT
cord-275413-e2rhioty	280	9	presence	presence	NN
cord-275413-e2rhioty	280	10	of	of	IN
cord-275413-e2rhioty	280	11	detectable	detectable	JJ
cord-275413-e2rhioty	280	12	levels	level	NNS
cord-275413-e2rhioty	280	13	of	of	IN
cord-275413-e2rhioty	280	14	IFN-	IFN-	NNP
cord-275413-e2rhioty	280	15	␥	␥	CD
cord-275413-e2rhioty	280	16	and	and	CC
cord-275413-e2rhioty	280	17	TNF-	TNF-	NNP
cord-275413-e2rhioty	280	18	␣	␣	NN
cord-275413-e2rhioty	280	19	proteins	protein	NNS
cord-275413-e2rhioty	280	20	in	in	IN
cord-275413-e2rhioty	280	21	serum	serum	NN
cord-275413-e2rhioty	280	22	.	.	.
cord-275413-e2rhioty	281	1	Furthermore	furthermore	RB
cord-275413-e2rhioty	281	2	,	,	,
cord-275413-e2rhioty	281	3	the	the	DT
cord-275413-e2rhioty	281	4	results	result	NNS
cord-275413-e2rhioty	281	5	indicate	indicate	VBP
cord-275413-e2rhioty	281	6	that	that	IN
cord-275413-e2rhioty	281	7	INF-	INF-	NNP
cord-275413-e2rhioty	282	1	␣	␣	NNP
cord-275413-e2rhioty	282	2	and	and	CC
cord-275413-e2rhioty	283	1	IFN-	IFN-	NNP
cord-275413-e2rhioty	283	2	␥	␥	CD
cord-275413-e2rhioty	283	3	cytokines	cytokine	NNS
cord-275413-e2rhioty	283	4	response	response	NN
cord-275413-e2rhioty	283	5	are	be	VBP
cord-275413-e2rhioty	283	6	compartmentalized	compartmentalize	VBN
cord-275413-e2rhioty	283	7	within	within	IN
cord-275413-e2rhioty	283	8	the	the	DT
cord-275413-e2rhioty	283	9	fetus	fetus	NN
cord-275413-e2rhioty	283	10	and	and	CC
cord-275413-e2rhioty	283	11	do	do	VBP
cord-275413-e2rhioty	283	12	not	not	RB
cord-275413-e2rhioty	283	13	extend	extend	VB
cord-275413-e2rhioty	283	14	to	to	IN
cord-275413-e2rhioty	283	15	other	other	JJ
cord-275413-e2rhioty	283	16	compartments	compartment	NNS
cord-275413-e2rhioty	283	17	,	,	,
cord-275413-e2rhioty	283	18	such	such	JJ
cord-275413-e2rhioty	283	19	as	as	IN
cord-275413-e2rhioty	283	20	amniotic	amniotic	NN
cord-275413-e2rhioty	283	21	fluid	fluid	NN
cord-275413-e2rhioty	283	22	or	or	CC
cord-275413-e2rhioty	283	23	placenta	placenta	NN
cord-275413-e2rhioty	283	24	,	,	,
cord-275413-e2rhioty	283	25	thus	thus	RB
cord-275413-e2rhioty	283	26	lessening	lessen	VBG
cord-275413-e2rhioty	283	27	the	the	DT
cord-275413-e2rhioty	283	28	probability	probability	NN
cord-275413-e2rhioty	283	29	of	of	IN
cord-275413-e2rhioty	283	30	allorejection	allorejection	NN
cord-275413-e2rhioty	283	31	by	by	IN
cord-275413-e2rhioty	283	32	the	the	DT
cord-275413-e2rhioty	283	33	dam	dam	NN
cord-275413-e2rhioty	283	34	.	.	.
cord-275413-e2rhioty	284	1	From	from	IN
cord-275413-e2rhioty	284	2	these	these	DT
cord-275413-e2rhioty	284	3	data	datum	NNS
cord-275413-e2rhioty	284	4	,	,	,
cord-275413-e2rhioty	284	5	it	-PRON-	PRP
cord-275413-e2rhioty	284	6	is	be	VBZ
cord-275413-e2rhioty	284	7	apparent	apparent	JJ
cord-275413-e2rhioty	284	8	that	that	IN
cord-275413-e2rhioty	284	9	the	the	DT
cord-275413-e2rhioty	284	10	fetus	fetus	NN
cord-275413-e2rhioty	284	11	is	be	VBZ
cord-275413-e2rhioty	284	12	capable	capable	JJ
cord-275413-e2rhioty	284	13	of	of	IN
cord-275413-e2rhioty	284	14	initiating	initiate	VBG
cord-275413-e2rhioty	284	15	a	a	DT
cord-275413-e2rhioty	284	16	Th1-like	Th1-like	NNP
cord-275413-e2rhioty	284	17	response	response	NN
cord-275413-e2rhioty	284	18	;	;	:
cord-275413-e2rhioty	284	19	however	however	RB
cord-275413-e2rhioty	284	20	,	,	,
cord-275413-e2rhioty	284	21	the	the	DT
cord-275413-e2rhioty	284	22	capacity	capacity	NN
cord-275413-e2rhioty	284	23	of	of	IN
cord-275413-e2rhioty	285	1	IFN-	IFN-	NNP
cord-275413-e2rhioty	285	2	␥	␥	CD
cord-275413-e2rhioty	285	3	and	and	CC
cord-275413-e2rhioty	285	4	TNF-	TNF-	NNP
cord-275413-e2rhioty	285	5	␣	␣	NNP
cord-275413-e2rhioty	285	6	to	to	TO
cord-275413-e2rhioty	285	7	control	control	VB
cord-275413-e2rhioty	285	8	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	285	9	infection	infection	NN
cord-275413-e2rhioty	285	10	in	in	IN
cord-275413-e2rhioty	285	11	the	the	DT
cord-275413-e2rhioty	285	12	fetus	fetus	NN
cord-275413-e2rhioty	285	13	is	be	VBZ
cord-275413-e2rhioty	285	14	not	not	RB
cord-275413-e2rhioty	285	15	known	know	VBN
cord-275413-e2rhioty	285	16	.	.	.
cord-275413-e2rhioty	286	1	Additional	additional	JJ
cord-275413-e2rhioty	286	2	evidence	evidence	NN
cord-275413-e2rhioty	286	3	for	for	IN
cord-275413-e2rhioty	286	4	induction	induction	NN
cord-275413-e2rhioty	286	5	of	of	IN
cord-275413-e2rhioty	286	6	virus	virus	NN
cord-275413-e2rhioty	286	7	-	-	HYPH
cord-275413-e2rhioty	286	8	specific	specific	JJ
cord-275413-e2rhioty	286	9	immunity	immunity	NN
cord-275413-e2rhioty	286	10	was	be	VBD
cord-275413-e2rhioty	286	11	found	find	VBN
cord-275413-e2rhioty	286	12	in	in	IN
cord-275413-e2rhioty	286	13	the	the	DT
cord-275413-e2rhioty	286	14	development	development	NN
cord-275413-e2rhioty	286	15	of	of	IN
cord-275413-e2rhioty	286	16	germinal	germinal	JJ
cord-275413-e2rhioty	286	17	centers	center	NNS
cord-275413-e2rhioty	286	18	containing	contain	VBG
cord-275413-e2rhioty	286	19	activated	activate	VBN
cord-275413-e2rhioty	286	20	(	(	-LRB-
cord-275413-e2rhioty	286	21	CDw75	CDw75	NNS
cord-275413-e2rhioty	286	22	+	+	CC
cord-275413-e2rhioty	286	23	)	)	-RRB-
cord-275413-e2rhioty	286	24	B	b	NN
cord-275413-e2rhioty	286	25	cells	cell	NNS
cord-275413-e2rhioty	286	26	and	and	CC
cord-275413-e2rhioty	286	27	seroconversion	seroconversion	NN
cord-275413-e2rhioty	286	28	in	in	IN
cord-275413-e2rhioty	286	29	at	at	RB
cord-275413-e2rhioty	286	30	least	least	RBS
cord-275413-e2rhioty	286	31	one	one	CD
cord-275413-e2rhioty	286	32	fetus	fetus	NN
cord-275413-e2rhioty	286	33	.	.	.
cord-275413-e2rhioty	287	1	Pro	pro	JJ
cord-275413-e2rhioty	287	2	-	-	JJ
cord-275413-e2rhioty	287	3	inflammatory	inflammatory	JJ
cord-275413-e2rhioty	287	4	cytokines	cytokine	NNS
cord-275413-e2rhioty	287	5	,	,	,
cord-275413-e2rhioty	287	6	such	such	JJ
cord-275413-e2rhioty	287	7	as	as	IN
cord-275413-e2rhioty	287	8	TNF-	TNF-	NNP
cord-275413-e2rhioty	287	9	␣	␣	NNP
cord-275413-e2rhioty	287	10	and	and	CC
cord-275413-e2rhioty	287	11	IFN-	IFN-	NNP
cord-275413-e2rhioty	287	12	␥	␥	NNP
cord-275413-e2rhioty	287	13	can	can	MD
cord-275413-e2rhioty	287	14	contribute	contribute	VB
cord-275413-e2rhioty	287	15	to	to	IN
cord-275413-e2rhioty	287	16	pulmonary	pulmonary	JJ
cord-275413-e2rhioty	287	17	distress	distress	NN
cord-275413-e2rhioty	287	18	through	through	IN
cord-275413-e2rhioty	287	19	the	the	DT
cord-275413-e2rhioty	287	20	activation	activation	NN
cord-275413-e2rhioty	287	21	of	of	IN
cord-275413-e2rhioty	287	22	alveolar	alveolar	JJ
cord-275413-e2rhioty	287	23	macrophages	macrophage	NNS
cord-275413-e2rhioty	287	24	and	and	CC
cord-275413-e2rhioty	287	25	other	other	JJ
cord-275413-e2rhioty	287	26	cell	cell	NN
cord-275413-e2rhioty	287	27	populations	population	NNS
cord-275413-e2rhioty	287	28	.	.	.
cord-275413-e2rhioty	288	1	The	the	DT
cord-275413-e2rhioty	288	2	increased	increase	VBN
cord-275413-e2rhioty	288	3	quantities	quantity	NNS
cord-275413-e2rhioty	288	4	of	of	IN
cord-275413-e2rhioty	289	1	IFN-	IFN-	NNP
cord-275413-e2rhioty	289	2	␥	␥	CD
cord-275413-e2rhioty	289	3	and	and	CC
cord-275413-e2rhioty	289	4	TNF-	TNF-	NNP
cord-275413-e2rhioty	289	5	␣	␣	NNP
cord-275413-e2rhioty	289	6	found	find	VBD
cord-275413-e2rhioty	289	7	in	in	IN
cord-275413-e2rhioty	289	8	the	the	DT
cord-275413-e2rhioty	289	9	lungs	lung	NNS
cord-275413-e2rhioty	289	10	of	of	IN
cord-275413-e2rhioty	289	11	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	289	12	-	-	HYPH
cord-275413-e2rhioty	289	13	infected	infect	VBN
cord-275413-e2rhioty	289	14	fetuses	fetus	NNS
cord-275413-e2rhioty	289	15	may	may	MD
cord-275413-e2rhioty	289	16	not	not	RB
cord-275413-e2rhioty	289	17	be	be	VB
cord-275413-e2rhioty	289	18	sufficient	sufficient	JJ
cord-275413-e2rhioty	289	19	to	to	TO
cord-275413-e2rhioty	289	20	cause	cause	VB
cord-275413-e2rhioty	289	21	pulmonary	pulmonary	JJ
cord-275413-e2rhioty	289	22	damage	damage	NN
cord-275413-e2rhioty	289	23	to	to	IN
cord-275413-e2rhioty	289	24	the	the	DT
cord-275413-e2rhioty	289	25	fetal	fetal	JJ
cord-275413-e2rhioty	289	26	lung	lung	NN
cord-275413-e2rhioty	289	27	,	,	,
cord-275413-e2rhioty	289	28	primarily	primarily	RB
cord-275413-e2rhioty	289	29	because	because	IN
cord-275413-e2rhioty	289	30	fetal	fetal	JJ
cord-275413-e2rhioty	289	31	macrophages	macrophage	NNS
cord-275413-e2rhioty	289	32	have	have	VBP
cord-275413-e2rhioty	289	33	a	a	DT
cord-275413-e2rhioty	289	34	reduced	reduce	VBN
cord-275413-e2rhioty	289	35	capacity	capacity	NN
cord-275413-e2rhioty	289	36	to	to	TO
cord-275413-e2rhioty	289	37	respond	respond	VB
cord-275413-e2rhioty	289	38	to	to	IN
cord-275413-e2rhioty	289	39	inflammatory	inflammatory	JJ
cord-275413-e2rhioty	289	40	stimuli	stimulus	NNS
cord-275413-e2rhioty	289	41	.	.	.
cord-275413-e2rhioty	290	1	In	in	IN
cord-275413-e2rhioty	290	2	addition	addition	NN
cord-275413-e2rhioty	290	3	,	,	,
cord-275413-e2rhioty	290	4	IL-10	IL-10	NNP
cord-275413-e2rhioty	290	5	,	,	,
cord-275413-e2rhioty	290	6	up	up	RB
cord-275413-e2rhioty	290	7	-	-	HYPH
cord-275413-e2rhioty	290	8	regulated	regulate	VBN
cord-275413-e2rhioty	290	9	in	in	IN
cord-275413-e2rhioty	290	10	response	response	NN
cord-275413-e2rhioty	290	11	to	to	IN
cord-275413-e2rhioty	290	12	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	290	13	infection	infection	NN
cord-275413-e2rhioty	290	14	,	,	,
cord-275413-e2rhioty	290	15	is	be	VBZ
cord-275413-e2rhioty	290	16	a	a	DT
cord-275413-e2rhioty	290	17	potent	potent	JJ
cord-275413-e2rhioty	290	18	antagonist	antagonist	NN
cord-275413-e2rhioty	290	19	of	of	IN
cord-275413-e2rhioty	291	1	IFN-	IFN-	NNP
cord-275413-e2rhioty	291	2	␥	␥	CD
cord-275413-e2rhioty	291	3	and	and	CC
cord-275413-e2rhioty	291	4	TNF-	TNF-	NNP
cord-275413-e2rhioty	291	5	␣	␣	NN
cord-275413-e2rhioty	291	6	activation	activation	NN
cord-275413-e2rhioty	291	7	of	of	IN
cord-275413-e2rhioty	291	8	macrophages	macrophage	NNS
cord-275413-e2rhioty	291	9	(	(	-LRB-
cord-275413-e2rhioty	291	10	Burchett	Burchett	NNP
cord-275413-e2rhioty	291	11	et	et	FW
cord-275413-e2rhioty	291	12	al	al	NNP
cord-275413-e2rhioty	291	13	.	.	NNP
cord-275413-e2rhioty	291	14	,	,	,
cord-275413-e2rhioty	291	15	1992	1992	CD
cord-275413-e2rhioty	291	16	;	;	:
cord-275413-e2rhioty	291	17	Marodi	Marodi	NNP
cord-275413-e2rhioty	291	18	et	et	NNP
cord-275413-e2rhioty	291	19	al	al	NNP
cord-275413-e2rhioty	291	20	.	.	.
cord-275413-e2rhioty	292	1	,	,	,
cord-275413-e2rhioty	292	2	2001	2001	CD
cord-275413-e2rhioty	292	3	;	;	:
cord-275413-e2rhioty	292	4	Johnsen	Johnsen	NNP
cord-275413-e2rhioty	292	5	et	et	NNP
cord-275413-e2rhioty	292	6	al	al	NNP
cord-275413-e2rhioty	292	7	.	.	.
cord-275413-e2rhioty	293	1	,	,	,
cord-275413-e2rhioty	293	2	2002	2002	CD
cord-275413-e2rhioty	293	3	;	;	:
cord-275413-e2rhioty	293	4	Thanawongnuwech	Thanawongnuwech	NNP
cord-275413-e2rhioty	293	5	et	et	NNP
cord-275413-e2rhioty	293	6	al	al	NNP
cord-275413-e2rhioty	293	7	.	.	NNP
cord-275413-e2rhioty	293	8	,	,	,
cord-275413-e2rhioty	293	9	2003	2003	CD
cord-275413-e2rhioty	293	10	)	)	-RRB-
cord-275413-e2rhioty	293	11	.	.	.
cord-275413-e2rhioty	294	1	However	however	RB
cord-275413-e2rhioty	294	2	,	,	,
cord-275413-e2rhioty	294	3	within	within	IN
cord-275413-e2rhioty	294	4	days	day	NNS
cord-275413-e2rhioty	294	5	after	after	IN
cord-275413-e2rhioty	294	6	birth	birth	NN
cord-275413-e2rhioty	294	7	,	,	,
cord-275413-e2rhioty	294	8	adult	adult	NN
cord-275413-e2rhioty	294	9	macrophages	macrophage	NNS
cord-275413-e2rhioty	294	10	,	,	,
cord-275413-e2rhioty	294	11	including	include	VBG
cord-275413-e2rhioty	294	12	mature	mature	JJ
cord-275413-e2rhioty	294	13	alveolar	alveolar	NN
cord-275413-e2rhioty	294	14	and	and	CC
cord-275413-e2rhioty	294	15	intravascular	intravascular	JJ
cord-275413-e2rhioty	294	16	macrophages	macrophage	NNS
cord-275413-e2rhioty	294	17	emerge	emerge	VBP
cord-275413-e2rhioty	294	18	into	into	IN
cord-275413-e2rhioty	294	19	an	an	DT
cord-275413-e2rhioty	294	20	environment	environment	NN
cord-275413-e2rhioty	294	21	already	already	RB
cord-275413-e2rhioty	294	22	enriched	enrich	VBN
cord-275413-e2rhioty	294	23	in	in	IN
cord-275413-e2rhioty	294	24	IFN-	IFN-	NNP
cord-275413-e2rhioty	294	25	␥	␥	NNP
cord-275413-e2rhioty	294	26	and	and	CC
cord-275413-e2rhioty	294	27	TNF-	TNF-	NNP
cord-275413-e2rhioty	294	28	␣	␣	NN
cord-275413-e2rhioty	294	29	.	.	.
cord-275413-e2rhioty	295	1	The	the	DT
cord-275413-e2rhioty	295	2	outcome	outcome	NN
cord-275413-e2rhioty	295	3	is	be	VBZ
cord-275413-e2rhioty	295	4	the	the	DT
cord-275413-e2rhioty	295	5	rapid	rapid	JJ
cord-275413-e2rhioty	295	6	recruitment	recruitment	NN
cord-275413-e2rhioty	295	7	,	,	,
cord-275413-e2rhioty	295	8	activation	activation	NN
cord-275413-e2rhioty	295	9	,	,	,
cord-275413-e2rhioty	295	10	and	and	CC
cord-275413-e2rhioty	295	11	cytopathic	cytopathic	JJ
cord-275413-e2rhioty	295	12	killing	killing	NN
cord-275413-e2rhioty	295	13	of	of	IN
cord-275413-e2rhioty	295	14	large	large	JJ
cord-275413-e2rhioty	295	15	numbers	number	NNS
cord-275413-e2rhioty	295	16	of	of	IN
cord-275413-e2rhioty	295	17	virus	virus	NN
cord-275413-e2rhioty	295	18	-	-	HYPH
cord-275413-e2rhioty	295	19	permissive	permissive	JJ
cord-275413-e2rhioty	295	20	macrophages	macrophage	NNS
cord-275413-e2rhioty	295	21	(	(	-LRB-
cord-275413-e2rhioty	295	22	Choi	Choi	NNP
cord-275413-e2rhioty	295	23	and	and	CC
cord-275413-e2rhioty	295	24	Chae	Chae	NNP
cord-275413-e2rhioty	295	25	,	,	,
cord-275413-e2rhioty	295	26	2002	2002	CD
cord-275413-e2rhioty	295	27	)	)	-RRB-
cord-275413-e2rhioty	295	28	.	.	.
cord-275413-e2rhioty	296	1	This	this	DT
cord-275413-e2rhioty	296	2	scenario	scenario	NN
cord-275413-e2rhioty	296	3	as	as	IN
cord-275413-e2rhioty	296	4	a	a	DT
cord-275413-e2rhioty	296	5	cause	cause	NN
cord-275413-e2rhioty	296	6	of	of	IN
cord-275413-e2rhioty	296	7	severe	severe	JJ
cord-275413-e2rhioty	296	8	interstitial	interstitial	JJ
cord-275413-e2rhioty	296	9	pnuemonia	pnuemonia	NN
cord-275413-e2rhioty	296	10	in	in	IN
cord-275413-e2rhioty	296	11	the	the	DT
cord-275413-e2rhioty	296	12	PRRSV	PRRSV	NNP
cord-275413-e2rhioty	296	13	-	-	HYPH
cord-275413-e2rhioty	296	14	infected	infect	VBN
cord-275413-e2rhioty	296	15	newborn	newborn	NN
cord-275413-e2rhioty	296	16	requires	require	VBZ
cord-275413-e2rhioty	296	17	further	further	JJ
cord-275413-e2rhioty	296	18	investigation	investigation	NN
cord-275413-e2rhioty	296	19	,	,	,
cord-275413-e2rhioty	296	20	but	but	CC
cord-275413-e2rhioty	296	21	has	have	VBZ
cord-275413-e2rhioty	296	22	obvious	obvious	JJ
cord-275413-e2rhioty	296	23	implications	implication	NNS
cord-275413-e2rhioty	296	24	in	in	IN
cord-275413-e2rhioty	296	25	the	the	DT
cord-275413-e2rhioty	296	26	etiology	etiology	NN
cord-275413-e2rhioty	296	27	of	of	IN
cord-275413-e2rhioty	296	28	postnatal	postnatal	JJ
cord-275413-e2rhioty	296	29	pulmonary	pulmonary	JJ
cord-275413-e2rhioty	296	30	complications	complication	NNS
cord-275413-e2rhioty	296	31	following	follow	VBG
cord-275413-e2rhioty	296	32	virus	virus	NN
cord-275413-e2rhioty	296	33	infections	infection	NNS
cord-275413-e2rhioty	296	34	of	of	IN
cord-275413-e2rhioty	296	35	the	the	DT
cord-275413-e2rhioty	296	36	fetus	fetus	NN
cord-275413-e2rhioty	296	37	.	.	.
cord-275413-e2rhioty	297	1	Porcine	porcine	JJ
cord-275413-e2rhioty	297	2	reproductive	reproductive	JJ
cord-275413-e2rhioty	297	3	and	and	CC
cord-275413-e2rhioty	297	4	respiratory	respiratory	JJ
cord-275413-e2rhioty	297	5	syndrome	syndrome	NN
cord-275413-e2rhioty	297	6	virus	virus	NN
cord-275413-e2rhioty	297	7	:	:	:
cord-275413-e2rhioty	297	8	description	description	NN
cord-275413-e2rhioty	297	9	of	of	IN
cord-275413-e2rhioty	297	10	persistence	persistence	NN
cord-275413-e2rhioty	297	11	in	in	IN
cord-275413-e2rhioty	297	12	individual	individual	JJ
cord-275413-e2rhioty	297	13	pigs	pig	NNS
cord-275413-e2rhioty	297	14	upon	upon	IN
cord-275413-e2rhioty	297	15	experimental	experimental	JJ
cord-275413-e2rhioty	297	16	infection	infection	NN
cord-275413-e2rhioty	297	17	Murine	Murine	NNP
cord-275413-e2rhioty	297	18	T	T	NNP
cord-275413-e2rhioty	297	19	cell	cell	NN
cord-275413-e2rhioty	297	20	determination	determination	NN
cord-275413-e2rhioty	297	21	of	of	IN
cord-275413-e2rhioty	297	22	pregnancy	pregnancy	NN
cord-275413-e2rhioty	297	23	outcome	outcome	NN
cord-275413-e2rhioty	297	24	Maternal	maternal	JJ
cord-275413-e2rhioty	297	25	and	and	CC
cord-275413-e2rhioty	297	26	foetal	foetal	JJ
cord-275413-e2rhioty	297	27	consequences	consequence	NNS
cord-275413-e2rhioty	297	28	of	of	IN
cord-275413-e2rhioty	297	29	dengue	dengue	NN
cord-275413-e2rhioty	297	30	fever	fever	NN
cord-275413-e2rhioty	297	31	during	during	IN
cord-275413-e2rhioty	297	32	pregnancy	pregnancy	NN
cord-275413-e2rhioty	297	33	Characterization	characterization	NN
cord-275413-e2rhioty	297	34	of	of	IN
cord-275413-e2rhioty	297	35	swine	swine	NN
cord-275413-e2rhioty	297	36	infertility	infertility	NN
cord-275413-e2rhioty	297	37	and	and	CC
cord-275413-e2rhioty	297	38	respiratory	respiratory	JJ
cord-275413-e2rhioty	297	39	syndrome	syndrome	NN
cord-275413-e2rhioty	297	40	(	(	-LRB-
cord-275413-e2rhioty	297	41	SIRS	SIRS	NNP
cord-275413-e2rhioty	297	42	)	)	-RRB-
cord-275413-e2rhioty	297	43	virus	virus	NN
cord-275413-e2rhioty	297	44	(	(	-LRB-
cord-275413-e2rhioty	297	45	Isolate	isolate	VB
cord-275413-e2rhioty	297	46	ATCC	ATCC	NNP
cord-275413-e2rhioty	297	47	VR-2332	vr-2332	NN
cord-275413-e2rhioty	297	48	)	)	-RRB-
cord-275413-e2rhioty	298	1	Porcine	porcine	JJ
cord-275413-e2rhioty	298	2	reproductive	reproductive	JJ
cord-275413-e2rhioty	298	3	and	and	CC
cord-275413-e2rhioty	298	4	respiratory	respiratory	JJ
cord-275413-e2rhioty	298	5	syndrome	syndrome	NN
cord-275413-e2rhioty	298	6	virus	virus	NN
cord-275413-e2rhioty	299	1	A	a	DT
cord-275413-e2rhioty	299	2	comparison	comparison	NN
cord-275413-e2rhioty	299	3	of	of	IN
cord-275413-e2rhioty	299	4	virus	virus	NN
cord-275413-e2rhioty	299	5	isolation	isolation	NN
cord-275413-e2rhioty	299	6	,	,	,
cord-275413-e2rhioty	299	7	immunohistochemistry	immunohistochemistry	NN
cord-275413-e2rhioty	299	8	,	,	,
cord-275413-e2rhioty	299	9	fetal	fetal	JJ
cord-275413-e2rhioty	299	10	serology	serology	NN
cord-275413-e2rhioty	299	11	,	,	,
cord-275413-e2rhioty	299	12	and	and	CC
cord-275413-e2rhioty	299	13	reverse	reverse	JJ
cord-275413-e2rhioty	299	14	-	-	HYPH
cord-275413-e2rhioty	299	15	transcription	transcription	NN
cord-275413-e2rhioty	299	16	polymerase	polymerase	NN
cord-275413-e2rhioty	299	17	chain	chain	NN
cord-275413-e2rhioty	299	18	reaction	reaction	NN
cord-275413-e2rhioty	299	19	assay	assay	NN
cord-275413-e2rhioty	299	20	for	for	IN
cord-275413-e2rhioty	299	21	identification	identification	NN
cord-275413-e2rhioty	299	22	of	of	IN
cord-275413-e2rhioty	299	23	porcine	porcine	JJ
cord-275413-e2rhioty	299	24	reproductive	reproductive	JJ
cord-275413-e2rhioty	299	25	and	and	CC
cord-275413-e2rhioty	299	26	respiratory	respiratory	JJ
cord-275413-e2rhioty	299	27	syndrome	syndrome	NN
cord-275413-e2rhioty	299	28	virus	virus	NN
cord-275413-e2rhioty	299	29	transplacental	transplacental	NNP
cord-275413-e2rhioty	299	30	infection	infection	NN
cord-275413-e2rhioty	299	31	in	in	IN
cord-275413-e2rhioty	299	32	the	the	DT
cord-275413-e2rhioty	299	33	fetus	fetus	NN
cord-275413-e2rhioty	299	34	Diminished	diminish	VBN
cord-275413-e2rhioty	299	35	interferon	interferon	NN
cord-275413-e2rhioty	299	36	-	-	HYPH
cord-275413-e2rhioty	299	37	gamma	gamma	NN
cord-275413-e2rhioty	299	38	and	and	CC
cord-275413-e2rhioty	299	39	lymphocyte	lymphocyte	NN
cord-275413-e2rhioty	299	40	proliferation	proliferation	NN
cord-275413-e2rhioty	299	41	in	in	IN
cord-275413-e2rhioty	299	42	neonatal	neonatal	JJ
cord-275413-e2rhioty	299	43	and	and	CC
cord-275413-e2rhioty	299	44	postpartum	postpartum	NN
cord-275413-e2rhioty	299	45	primary	primary	JJ
cord-275413-e2rhioty	299	46	herpes	herpes	NN
cord-275413-e2rhioty	299	47	simplex	simplex	NN
cord-275413-e2rhioty	299	48	virus	virus	NN
cord-275413-e2rhioty	299	49	infection	infection	NN
cord-275413-e2rhioty	299	50	Trojan	Trojan	NNP
cord-275413-e2rhioty	299	51	Horse	Horse	NNP
cord-275413-e2rhioty	299	52	macrophages	macrophage	NNS
cord-275413-e2rhioty	299	53	:	:	:
cord-275413-e2rhioty	299	54	studies	study	NNS
cord-275413-e2rhioty	299	55	with	with	IN
cord-275413-e2rhioty	299	56	the	the	DT
cord-275413-e2rhioty	299	57	murine	murine	JJ
cord-275413-e2rhioty	299	58	lactate	lactate	NN
cord-275413-e2rhioty	299	59	dehydrogenase	dehydrogenase	NN
cord-275413-e2rhioty	299	60	-	-	HYPH
cord-275413-e2rhioty	299	61	elevating	elevate	VBG
cord-275413-e2rhioty	299	62	virus	virus	NN
cord-275413-e2rhioty	299	63	and	and	CC
cord-275413-e2rhioty	299	64	implications	implication	NNS
cord-275413-e2rhioty	299	65	for	for	IN
cord-275413-e2rhioty	299	66	sexually	sexually	RB
cord-275413-e2rhioty	299	67	transmitted	transmit	VBN
cord-275413-e2rhioty	299	68	virus	virus	NN
cord-275413-e2rhioty	299	69	infection	infection	NN
cord-275413-e2rhioty	299	70	Nidovirales	Nidovirales	NNP
cord-275413-e2rhioty	299	71	.	.	.
cord-275413-e2rhioty	300	1	A	a	DT
cord-275413-e2rhioty	300	2	new	new	JJ
cord-275413-e2rhioty	300	3	order	order	NN
cord-275413-e2rhioty	300	4	comprising	comprise	VBG
cord-275413-e2rhioty	300	5	Coronaviridae	Coronaviridae	NNP
cord-275413-e2rhioty	300	6	and	and	CC
cord-275413-e2rhioty	300	7	Arterivirdae	Arterivirdae	NNP
cord-275413-e2rhioty	300	8	Inflammation	Inflammation	NNP
cord-275413-e2rhioty	300	9	and	and	CC
cord-275413-e2rhioty	300	10	pregnancy	pregnancy	NN
cord-275413-e2rhioty	300	11	A	a	DT
cord-275413-e2rhioty	300	12	brief	brief	JJ
cord-275413-e2rhioty	300	13	review	review	NN
cord-275413-e2rhioty	300	14	of	of	IN
cord-275413-e2rhioty	300	15	recent	recent	JJ
cord-275413-e2rhioty	300	16	data	datum	NNS
cord-275413-e2rhioty	300	17	on	on	IN
cord-275413-e2rhioty	300	18	some	some	DT
cord-275413-e2rhioty	300	19	cytokine	cytokine	JJ
cord-275413-e2rhioty	300	20	expressions	expression	NNS
cord-275413-e2rhioty	300	21	at	at	IN
cord-275413-e2rhioty	300	22	the	the	DT
cord-275413-e2rhioty	300	23	materno	materno	NN
cord-275413-e2rhioty	300	24	-	-	HYPH
cord-275413-e2rhioty	300	25	foetal	foetal	JJ
cord-275413-e2rhioty	300	26	interface	interface	NN
cord-275413-e2rhioty	300	27	which	which	WDT
cord-275413-e2rhioty	300	28	might	may	MD
cord-275413-e2rhioty	300	29	challenge	challenge	VB
cord-275413-e2rhioty	300	30	the	the	DT
cord-275413-e2rhioty	300	31	classical	classical	JJ
cord-275413-e2rhioty	300	32	Th1	Th1	NNP
cord-275413-e2rhioty	300	33	/	/	SYM
cord-275413-e2rhioty	300	34	Th2	Th2	NNP
cord-275413-e2rhioty	300	35	dichotomy	dichotomy	NN
cord-275413-e2rhioty	300	36	Control	Control	NNP
cord-275413-e2rhioty	300	37	of	of	IN
cord-275413-e2rhioty	300	38	fetal	fetal	JJ
cord-275413-e2rhioty	300	39	survival	survival	NN
cord-275413-e2rhioty	300	40	in	in	IN
cord-275413-e2rhioty	300	41	CBA	CBA	NNP
cord-275413-e2rhioty	300	42	×	×	NNP
cord-275413-e2rhioty	301	1	DBA/2	DBA/2	NNP
cord-275413-e2rhioty	301	2	mice	mouse	NNS
cord-275413-e2rhioty	301	3	by	by	IN
cord-275413-e2rhioty	301	4	lymphokine	lymphokine	NN
cord-275413-e2rhioty	301	5	therapy	therapy	NN
cord-275413-e2rhioty	301	6	Neonatal	neonatal	NN
cord-275413-e2rhioty	301	7	(	(	-LRB-
cord-275413-e2rhioty	301	8	cord	cord	NN
cord-275413-e2rhioty	301	9	blood	blood	NN
cord-275413-e2rhioty	301	10	)	)	-RRB-
cord-275413-e2rhioty	302	1	T	t	NN
cord-275413-e2rhioty	302	2	cells	cell	NNS
cord-275413-e2rhioty	302	3	can	can	MD
cord-275413-e2rhioty	302	4	competently	competently	RB
cord-275413-e2rhioty	302	5	raise	raise	VB
cord-275413-e2rhioty	302	6	type	type	NN
cord-275413-e2rhioty	302	7	1	1	CD
cord-275413-e2rhioty	302	8	and	and	CC
cord-275413-e2rhioty	302	9	2	2	CD
cord-275413-e2rhioty	302	10	immune	immune	JJ
cord-275413-e2rhioty	302	11	responses	response	NNS
cord-275413-e2rhioty	302	12	upon	upon	IN
cord-275413-e2rhioty	302	13	polyclonal	polyclonal	JJ
cord-275413-e2rhioty	302	14	activation	activation	NN
cord-275413-e2rhioty	302	15	Expression	expression	NN
cord-275413-e2rhioty	302	16	of	of	IN
cord-275413-e2rhioty	302	17	tumour	tumour	NN
cord-275413-e2rhioty	302	18	necrosis	necrosis	NN
cord-275413-e2rhioty	302	19	factor	factor	NN
cord-275413-e2rhioty	302	20	-	-	HYPH
cord-275413-e2rhioty	302	21	alpha	alpha	NN
cord-275413-e2rhioty	302	22	is	be	VBZ
cord-275413-e2rhioty	302	23	associated	associate	VBN
cord-275413-e2rhioty	302	24	with	with	IN
cord-275413-e2rhioty	302	25	apoptosis	apoptosis	NN
cord-275413-e2rhioty	302	26	in	in	IN
cord-275413-e2rhioty	302	27	lungs	lung	NNS
cord-275413-e2rhioty	302	28	of	of	IN
cord-275413-e2rhioty	302	29	pigs	pig	NNS
cord-275413-e2rhioty	302	30	experimentally	experimentally	RB
cord-275413-e2rhioty	302	31	infected	infect	VBN
cord-275413-e2rhioty	302	32	with	with	IN
cord-275413-e2rhioty	302	33	porcine	porcine	JJ
cord-275413-e2rhioty	302	34	reproductive	reproductive	JJ
cord-275413-e2rhioty	302	35	and	and	CC
cord-275413-e2rhioty	302	36	respiratory	respiratory	JJ
cord-275413-e2rhioty	302	37	syndrome	syndrome	NN
cord-275413-e2rhioty	302	38	virus	virus	NN
cord-275413-e2rhioty	302	39	Pathogenesis	Pathogenesis	NNP
cord-275413-e2rhioty	302	40	of	of	IN
cord-275413-e2rhioty	302	41	porcine	porcine	JJ
cord-275413-e2rhioty	302	42	reproductive	reproductive	JJ
cord-275413-e2rhioty	302	43	and	and	CC
cord-275413-e2rhioty	302	44	respiratory	respiratory	JJ
cord-275413-e2rhioty	302	45	syndrome	syndrome	NN
cord-275413-e2rhioty	302	46	virus	virus	NN
cord-275413-e2rhioty	302	47	infection	infection	NN
cord-275413-e2rhioty	302	48	in	in	IN
cord-275413-e2rhioty	302	49	mid	mid	JJ
cord-275413-e2rhioty	302	50	gestation	gestation	NN
cord-275413-e2rhioty	302	51	sows	sow	NNS
cord-275413-e2rhioty	302	52	and	and	CC
cord-275413-e2rhioty	302	53	fetuses	fetuse	VBZ
cord-275413-e2rhioty	302	54	Experimental	experimental	JJ
cord-275413-e2rhioty	302	55	reproduction	reproduction	NN
cord-275413-e2rhioty	302	56	of	of	IN
cord-275413-e2rhioty	302	57	swine	swine	NN
cord-275413-e2rhioty	302	58	infertility	infertility	NN
cord-275413-e2rhioty	302	59	and	and	CC
cord-275413-e2rhioty	302	60	respiratory	respiratory	JJ
cord-275413-e2rhioty	302	61	syndrome	syndrome	NN
cord-275413-e2rhioty	302	62	in	in	IN
cord-275413-e2rhioty	302	63	pregnant	pregnant	JJ
cord-275413-e2rhioty	302	64	sows	sow	NNS
cord-275413-e2rhioty	302	65	Ecology	Ecology	NNP
cord-275413-e2rhioty	302	66	of	of	IN
cord-275413-e2rhioty	302	67	danger	danger	NN
cord-275413-e2rhioty	302	68	-	-	HYPH
cord-275413-e2rhioty	302	69	dependent	dependent	JJ
cord-275413-e2rhioty	302	70	cytokine	cytokine	NN
cord-275413-e2rhioty	302	71	-	-	HYPH
cord-275413-e2rhioty	302	72	boosted	boost	VBN
cord-275413-e2rhioty	302	73	spontaneous	spontaneous	JJ
cord-275413-e2rhioty	302	74	abortion	abortion	NN
cord-275413-e2rhioty	302	75	in	in	IN
cord-275413-e2rhioty	302	76	the	the	DT
cord-275413-e2rhioty	302	77	CBA	CBA	NNP
cord-275413-e2rhioty	302	78	x	x	SYM
cord-275413-e2rhioty	302	79	DBA/2	DBA/2	NNP
cord-275413-e2rhioty	302	80	mouse	mouse	NN
cord-275413-e2rhioty	302	81	model	model	NN
cord-275413-e2rhioty	302	82	.	.	.
cord-275413-e2rhioty	303	1	I.	I.	NNP
cord-275413-e2rhioty	303	2	Synergistic	synergistic	JJ
cord-275413-e2rhioty	303	3	effect	effect	NN
cord-275413-e2rhioty	303	4	of	of	IN
cord-275413-e2rhioty	303	5	LPS	LPS	NNP
cord-275413-e2rhioty	303	6	and	and	CC
cord-275413-e2rhioty	303	7	(	(	-LRB-
cord-275413-e2rhioty	303	8	TNF	tnf	NN
cord-275413-e2rhioty	303	9	-	-	HYPH
cord-275413-e2rhioty	303	10	alpha	alpha	NN
cord-275413-e2rhioty	304	1	+	+	CC
cord-275413-e2rhioty	304	2	IFN	IFN	NNP
cord-275413-e2rhioty	304	3	-	-	HYPH
cord-275413-e2rhioty	304	4	gamma	gamma	NNP
cord-275413-e2rhioty	304	5	)	)	-RRB-
cord-275413-e2rhioty	304	6	on	on	IN
cord-275413-e2rhioty	304	7	pregnancy	pregnancy	NN
cord-275413-e2rhioty	304	8	loss	loss	NN
cord-275413-e2rhioty	304	9	Pathology	Pathology	NNP
cord-275413-e2rhioty	304	10	of	of	IN
cord-275413-e2rhioty	304	11	maternal	maternal	JJ
cord-275413-e2rhioty	304	12	genital	genital	JJ
cord-275413-e2rhioty	304	13	tract	tract	NN
cord-275413-e2rhioty	304	14	,	,	,
cord-275413-e2rhioty	304	15	placenta	placenta	NN
cord-275413-e2rhioty	304	16	,	,	,
cord-275413-e2rhioty	304	17	and	and	CC
cord-275413-e2rhioty	304	18	fetus	fetus	NN
cord-275413-e2rhioty	304	19	in	in	IN
cord-275413-e2rhioty	304	20	equine	equine	JJ
cord-275413-e2rhioty	304	21	viral	viral	JJ
cord-275413-e2rhioty	304	22	arteritis	arteritis	NN
cord-275413-e2rhioty	304	23	Isolation	isolation	NN
cord-275413-e2rhioty	304	24	of	of	IN
cord-275413-e2rhioty	304	25	swine	swine	NN
cord-275413-e2rhioty	304	26	infertility	infertility	NN
cord-275413-e2rhioty	304	27	and	and	CC
cord-275413-e2rhioty	304	28	respiratory	respiratory	JJ
cord-275413-e2rhioty	304	29	syndrome	syndrome	NN
cord-275413-e2rhioty	304	30	virus	virus	NN
cord-275413-e2rhioty	304	31	(	(	-LRB-
cord-275413-e2rhioty	304	32	isolate	isolate	VB
cord-275413-e2rhioty	304	33	ATCC	ATCC	NNP
cord-275413-e2rhioty	304	34	VR-2332	vr-2332	NN
cord-275413-e2rhioty	304	35	)	)	-RRB-
cord-275413-e2rhioty	304	36	in	in	IN
cord-275413-e2rhioty	304	37	North	North	NNP
cord-275413-e2rhioty	304	38	America	America	NNP
cord-275413-e2rhioty	304	39	and	and	CC
cord-275413-e2rhioty	304	40	experimental	experimental	JJ
cord-275413-e2rhioty	304	41	reproduction	reproduction	NN
cord-275413-e2rhioty	304	42	of	of	IN
cord-275413-e2rhioty	304	43	the	the	DT
cord-275413-e2rhioty	304	44	disease	disease	NN
cord-275413-e2rhioty	304	45	in	in	IN
cord-275413-e2rhioty	304	46	gnotobiotic	gnotobiotic	JJ
cord-275413-e2rhioty	304	47	pigs	pig	NNS
cord-275413-e2rhioty	305	1	The	the	DT
cord-275413-e2rhioty	305	2	two	two	CD
cord-275413-e2rhioty	305	3	faces	face	NNS
cord-275413-e2rhioty	305	4	of	of	IN
cord-275413-e2rhioty	305	5	mutation	mutation	NN
cord-275413-e2rhioty	305	6	:	:	:
cord-275413-e2rhioty	305	7	extinction	extinction	NN
cord-275413-e2rhioty	305	8	and	and	CC
cord-275413-e2rhioty	305	9	adaptation	adaptation	NN
cord-275413-e2rhioty	305	10	in	in	IN
cord-275413-e2rhioty	305	11	RNA	RNA	NNP
cord-275413-e2rhioty	305	12	viruses	virus	NNS
cord-275413-e2rhioty	305	13	Immune	immune	VBP
cord-275413-e2rhioty	305	14	regulation	regulation	NN
cord-275413-e2rhioty	305	15	during	during	IN
cord-275413-e2rhioty	305	16	pregnancy	pregnancy	NN
cord-275413-e2rhioty	305	17	and	and	CC
cord-275413-e2rhioty	305	18	host	host	NN
cord-275413-e2rhioty	305	19	-	-	HYPH
cord-275413-e2rhioty	305	20	pathogen	pathogen	NN
cord-275413-e2rhioty	305	21	interactions	interaction	NNS
cord-275413-e2rhioty	305	22	in	in	IN
cord-275413-e2rhioty	305	23	infectious	infectious	JJ
cord-275413-e2rhioty	305	24	abortion	abortion	NN
cord-275413-e2rhioty	305	25	Cell	cell	NN
cord-275413-e2rhioty	305	26	cycle	cycle	NN
cord-275413-e2rhioty	305	27	-	-	HYPH
cord-275413-e2rhioty	305	28	dependent	dependent	JJ
cord-275413-e2rhioty	305	29	regulation	regulation	NN
cord-275413-e2rhioty	305	30	of	of	IN
cord-275413-e2rhioty	305	31	CDw75	CDw75	NNS
cord-275413-e2rhioty	305	32	(	(	-LRB-
cord-275413-e2rhioty	305	33	betagalactoside	betagalactoside	NNP
cord-275413-e2rhioty	305	34	alpha-2,6-sialyltransferase	alpha-2,6-sialyltransferase	NNP
cord-275413-e2rhioty	305	35	)	)	-RRB-
cord-275413-e2rhioty	305	36	on	on	IN
cord-275413-e2rhioty	305	37	human	human	JJ
cord-275413-e2rhioty	305	38	B	b	NN
cord-275413-e2rhioty	305	39	lymphocytes	lymphocyte	NNS
cord-275413-e2rhioty	306	1	In	in	IN
cord-275413-e2rhioty	306	2	utero	utero	NN
cord-275413-e2rhioty	306	3	infection	infection	NN
cord-275413-e2rhioty	306	4	by	by	IN
cord-275413-e2rhioty	306	5	porcine	porcine	JJ
cord-275413-e2rhioty	306	6	reproductive	reproductive	JJ
cord-275413-e2rhioty	306	7	and	and	CC
cord-275413-e2rhioty	306	8	respiratory	respiratory	JJ
cord-275413-e2rhioty	306	9	syndrome	syndrome	NN
cord-275413-e2rhioty	306	10	virus	virus	NN
cord-275413-e2rhioty	306	11	is	be	VBZ
cord-275413-e2rhioty	306	12	sufficient	sufficient	JJ
cord-275413-e2rhioty	306	13	to	to	TO
cord-275413-e2rhioty	306	14	increase	increase	VB
cord-275413-e2rhioty	306	15	susceptibility	susceptibility	NN
cord-275413-e2rhioty	306	16	of	of	IN
cord-275413-e2rhioty	306	17	piglets	piglet	NNS
cord-275413-e2rhioty	306	18	to	to	TO
cord-275413-e2rhioty	306	19	challenge	challenge	VB
cord-275413-e2rhioty	306	20	by	by	IN
cord-275413-e2rhioty	306	21	Streptococcus	Streptococcus	NNP
cord-275413-e2rhioty	306	22	suis	suis	NN
cord-275413-e2rhioty	306	23	type	type	NN
cord-275413-e2rhioty	306	24	II	II	NNP
cord-275413-e2rhioty	306	25	Quasispecies	Quasispecies	NNPS
cord-275413-e2rhioty	306	26	in	in	IN
cord-275413-e2rhioty	306	27	viral	viral	JJ
cord-275413-e2rhioty	306	28	persistence	persistence	NN
cord-275413-e2rhioty	306	29	and	and	CC
cord-275413-e2rhioty	306	30	pathogenesis	pathogenesis	NN
cord-275413-e2rhioty	306	31	of	of	IN
cord-275413-e2rhioty	306	32	hepatitis	hepatitis	NN
cord-275413-e2rhioty	306	33	C	C	NNP
cord-275413-e2rhioty	306	34	virus	virus	NN
cord-275413-e2rhioty	306	35	Deficient	Deficient	NNP
cord-275413-e2rhioty	306	36	IL-12(p35	il-12(p35	NN
cord-275413-e2rhioty	306	37	)	)	-RRB-
cord-275413-e2rhioty	307	1	gene	gene	NN
cord-275413-e2rhioty	307	2	expression	expression	NN
cord-275413-e2rhioty	307	3	by	by	IN
cord-275413-e2rhioty	307	4	dendritic	dendritic	JJ
cord-275413-e2rhioty	307	5	cells	cell	NNS
cord-275413-e2rhioty	307	6	derived	derive	VBN
cord-275413-e2rhioty	307	7	from	from	IN
cord-275413-e2rhioty	307	8	neonatal	neonatal	JJ
cord-275413-e2rhioty	307	9	monocytes	monocyte	NNS
cord-275413-e2rhioty	307	10	Changes	change	NNS
cord-275413-e2rhioty	307	11	in	in	IN
cord-275413-e2rhioty	307	12	intracellular	intracellular	JJ
cord-275413-e2rhioty	307	13	cytokine	cytokine	NN
cord-275413-e2rhioty	307	14	levels	level	NNS
cord-275413-e2rhioty	307	15	in	in	IN
cord-275413-e2rhioty	307	16	newborn	newborn	JJ
cord-275413-e2rhioty	307	17	and	and	CC
cord-275413-e2rhioty	307	18	adult	adult	NN
cord-275413-e2rhioty	307	19	lymphocytes	lymphocyte	NNS
cord-275413-e2rhioty	307	20	induced	induce	VBN
cord-275413-e2rhioty	307	21	by	by	IN
cord-275413-e2rhioty	308	1	HSV-1	HSV-1	NNP
cord-275413-e2rhioty	308	2	Cytokine	Cytokine	NNP
cord-275413-e2rhioty	308	3	mRNA	mRNA	NNP
cord-275413-e2rhioty	308	4	profiles	profile	NNS
cord-275413-e2rhioty	308	5	in	in	IN
cord-275413-e2rhioty	308	6	bronchoalveolar	bronchoalveolar	JJ
cord-275413-e2rhioty	308	7	cells	cell	NNS
cord-275413-e2rhioty	308	8	of	of	IN
cord-275413-e2rhioty	308	9	piglets	piglet	NNS
cord-275413-e2rhioty	308	10	experimentally	experimentally	RB
cord-275413-e2rhioty	308	11	infected	infect	VBN
cord-275413-e2rhioty	308	12	in	in	IN
cord-275413-e2rhioty	308	13	utero	utero	NN
cord-275413-e2rhioty	308	14	with	with	IN
cord-275413-e2rhioty	308	15	porcine	porcine	JJ
cord-275413-e2rhioty	308	16	reproductive	reproductive	JJ
cord-275413-e2rhioty	308	17	and	and	CC
cord-275413-e2rhioty	308	18	respiratory	respiratory	JJ
cord-275413-e2rhioty	308	19	syndrome	syndrome	NN
cord-275413-e2rhioty	308	20	virus	virus	NN
cord-275413-e2rhioty	308	21	:	:	:
cord-275413-e2rhioty	308	22	association	association	NN
cord-275413-e2rhioty	308	23	of	of	IN
cord-275413-e2rhioty	308	24	sustained	sustained	JJ
cord-275413-e2rhioty	308	25	expression	expression	NN
cord-275413-e2rhioty	308	26	of	of	IN
cord-275413-e2rhioty	308	27	IFN	IFN	NNP
cord-275413-e2rhioty	308	28	-	-	HYPH
cord-275413-e2rhioty	308	29	gamma	gamma	NN
cord-275413-e2rhioty	308	30	and	and	CC
cord-275413-e2rhioty	309	1	IL-10	IL-10	NNP
cord-275413-e2rhioty	309	2	after	after	IN
cord-275413-e2rhioty	309	3	viral	viral	JJ
cord-275413-e2rhioty	309	4	clearance	clearance	NN
cord-275413-e2rhioty	309	5	Gross	gross	JJ
cord-275413-e2rhioty	309	6	and	and	CC
cord-275413-e2rhioty	309	7	microscopic	microscopic	JJ
cord-275413-e2rhioty	309	8	lesions	lesion	NNS
cord-275413-e2rhioty	309	9	in	in	IN
cord-275413-e2rhioty	309	10	porcine	porcine	JJ
cord-275413-e2rhioty	309	11	fetuses	fetus	NNS
cord-275413-e2rhioty	309	12	infected	infect	VBN
cord-275413-e2rhioty	309	13	with	with	IN
cord-275413-e2rhioty	309	14	porcine	porcine	JJ
cord-275413-e2rhioty	309	15	reproductive	reproductive	JJ
cord-275413-e2rhioty	309	16	and	and	CC
cord-275413-e2rhioty	309	17	respiratory	respiratory	JJ
cord-275413-e2rhioty	309	18	syndrome	syndrome	NN
cord-275413-e2rhioty	309	19	virus	virus	NN
cord-275413-e2rhioty	309	20	Interruption	interruption	NN
cord-275413-e2rhioty	309	21	of	of	IN
cord-275413-e2rhioty	309	22	murine	murine	JJ
cord-275413-e2rhioty	309	23	pregnancy	pregnancy	NN
cord-275413-e2rhioty	309	24	by	by	IN
cord-275413-e2rhioty	309	25	activation	activation	NN
cord-275413-e2rhioty	309	26	of	of	IN
cord-275413-e2rhioty	309	27	antigen	antigen	NN
cord-275413-e2rhioty	309	28	-	-	HYPH
cord-275413-e2rhioty	309	29	nonspecific	nonspecific	JJ
cord-275413-e2rhioty	309	30	killer	killer	NN
cord-275413-e2rhioty	309	31	cells	cell	NNS
cord-275413-e2rhioty	309	32	in	in	IN
cord-275413-e2rhioty	309	33	the	the	DT
cord-275413-e2rhioty	309	34	endometrium	endometrium	NN
cord-275413-e2rhioty	309	35	with	with	IN
cord-275413-e2rhioty	309	36	endomethacin	endomethacin	NNS
cord-275413-e2rhioty	309	37	,	,	,
cord-275413-e2rhioty	309	38	high	high	JJ
cord-275413-e2rhioty	309	39	dose	dose	NN
cord-275413-e2rhioty	309	40	IL-2	il-2	NN
cord-275413-e2rhioty	309	41	,	,	,
cord-275413-e2rhioty	309	42	or	or	CC
cord-275413-e2rhioty	309	43	a	a	DT
cord-275413-e2rhioty	309	44	combination	combination	NN
cord-275413-e2rhioty	310	1	Neonatal	neonatal	JJ
cord-275413-e2rhioty	310	2	dendritic	dendritic	JJ
cord-275413-e2rhioty	310	3	cells	cell	NNS
cord-275413-e2rhioty	310	4	are	be	VBP
cord-275413-e2rhioty	310	5	intrinsically	intrinsically	RB
cord-275413-e2rhioty	310	6	biased	biased	JJ
cord-275413-e2rhioty	310	7	against	against	IN
cord-275413-e2rhioty	310	8	Th-1	Th-1	NNP
cord-275413-e2rhioty	310	9	immune	immune	JJ
cord-275413-e2rhioty	310	10	responses	response	NNS
cord-275413-e2rhioty	311	1	Molecular	molecular	JJ
cord-275413-e2rhioty	311	2	cloning	cloning	NN
cord-275413-e2rhioty	311	3	and	and	CC
cord-275413-e2rhioty	311	4	expression	expression	NN
cord-275413-e2rhioty	311	5	analysis	analysis	NN
cord-275413-e2rhioty	311	6	of	of	IN
cord-275413-e2rhioty	311	7	pig	pig	NN
cord-275413-e2rhioty	311	8	CD79alpha	CD79alpha	NNP
cord-275413-e2rhioty	311	9	Synthesis	Synthesis	NNP
cord-275413-e2rhioty	311	10	of	of	IN
cord-275413-e2rhioty	311	11	T	T	NNP
cord-275413-e2rhioty	311	12	helper	helper	NN
cord-275413-e2rhioty	311	13	2-type	2-type	CD
cord-275413-e2rhioty	311	14	cytokines	cytokine	NNS
cord-275413-e2rhioty	311	15	at	at	IN
cord-275413-e2rhioty	311	16	the	the	DT
cord-275413-e2rhioty	311	17	maternal	maternal	JJ
cord-275413-e2rhioty	311	18	-	-	HYPH
cord-275413-e2rhioty	311	19	fetal	fetal	JJ
cord-275413-e2rhioty	311	20	interface	interface	NN
cord-275413-e2rhioty	311	21	Cytokine	cytokine	NN
cord-275413-e2rhioty	311	22	receptor	receptor	NN
cord-275413-e2rhioty	311	23	signalling	signal	VBG
cord-275413-e2rhioty	311	24	in	in	IN
cord-275413-e2rhioty	311	25	neonatal	neonatal	JJ
cord-275413-e2rhioty	311	26	macrophages	macrophage	NNS
cord-275413-e2rhioty	311	27	:	:	:
cord-275413-e2rhioty	311	28	defective	defective	JJ
cord-275413-e2rhioty	311	29	STAT-1	STAT-1	NNS
cord-275413-e2rhioty	311	30	phosphorylation	phosphorylation	NN
cord-275413-e2rhioty	311	31	in	in	IN
cord-275413-e2rhioty	311	32	response	response	NN
cord-275413-e2rhioty	311	33	to	to	IN
cord-275413-e2rhioty	311	34	stimulation	stimulation	NN
cord-275413-e2rhioty	311	35	with	with	IN
cord-275413-e2rhioty	311	36	IFN	IFN	NNP
cord-275413-e2rhioty	311	37	-	-	HYPH
cord-275413-e2rhioty	311	38	gamma	gamma	NNP
cord-275413-e2rhioty	311	39	Hypomethylation	Hypomethylation	NNP
cord-275413-e2rhioty	311	40	of	of	IN
cord-275413-e2rhioty	311	41	the	the	DT
cord-275413-e2rhioty	311	42	interferon	interferon	NN
cord-275413-e2rhioty	311	43	-	-	HYPH
cord-275413-e2rhioty	311	44	gamma	gamma	NN
cord-275413-e2rhioty	311	45	gene	gene	NN
cord-275413-e2rhioty	311	46	correlates	correlate	VBZ
cord-275413-e2rhioty	311	47	with	with	IN
cord-275413-e2rhioty	311	48	its	-PRON-	PRP$
cord-275413-e2rhioty	311	49	expression	expression	NN
cord-275413-e2rhioty	311	50	by	by	IN
cord-275413-e2rhioty	311	51	primary	primary	JJ
cord-275413-e2rhioty	311	52	T	t	NN
cord-275413-e2rhioty	311	53	-	-	HYPH
cord-275413-e2rhioty	311	54	lineage	lineage	NN
cord-275413-e2rhioty	311	55	cells	cell	NNS
cord-275413-e2rhioty	311	56	Temporal	temporal	JJ
cord-275413-e2rhioty	311	57	characterization	characterization	NN
cord-275413-e2rhioty	311	58	of	of	IN
cord-275413-e2rhioty	311	59	transplacental	transplacental	JJ
cord-275413-e2rhioty	311	60	infection	infection	NN
cord-275413-e2rhioty	311	61	of	of	IN
cord-275413-e2rhioty	311	62	porcine	porcine	JJ
cord-275413-e2rhioty	311	63	fetuses	fetus	NNS
cord-275413-e2rhioty	311	64	with	with	IN
cord-275413-e2rhioty	311	65	porcine	porcine	JJ
cord-275413-e2rhioty	311	66	reproductive	reproductive	JJ
cord-275413-e2rhioty	311	67	and	and	CC
cord-275413-e2rhioty	311	68	respiratory	respiratory	JJ
cord-275413-e2rhioty	311	69	syndrome	syndrome	NN
cord-275413-e2rhioty	311	70	virus	virus	NN
cord-275413-e2rhioty	311	71	Comparison	comparison	NN
cord-275413-e2rhioty	311	72	among	among	IN
cord-275413-e2rhioty	311	73	strains	strain	NNS
cord-275413-e2rhioty	311	74	of	of	IN
cord-275413-e2rhioty	311	75	porcine	porcine	JJ
cord-275413-e2rhioty	311	76	reproductive	reproductive	JJ
cord-275413-e2rhioty	311	77	and	and	CC
cord-275413-e2rhioty	311	78	respiratory	respiratory	JJ
cord-275413-e2rhioty	311	79	syndrome	syndrome	NN
cord-275413-e2rhioty	311	80	virus	virus	NN
cord-275413-e2rhioty	311	81	for	for	IN
cord-275413-e2rhioty	311	82	their	-PRON-	PRP$
cord-275413-e2rhioty	311	83	ability	ability	NN
cord-275413-e2rhioty	311	84	to	to	TO
cord-275413-e2rhioty	311	85	cause	cause	VB
cord-275413-e2rhioty	311	86	reproductive	reproductive	JJ
cord-275413-e2rhioty	311	87	failure	failure	NN
cord-275413-e2rhioty	312	1	Interferon	interferon	NN
cord-275413-e2rhioty	312	2	gamma	gamma	NN
cord-275413-e2rhioty	312	3	in	in	IN
cord-275413-e2rhioty	312	4	successful	successful	JJ
cord-275413-e2rhioty	312	5	pregnancies	pregnancy	NNS
cord-275413-e2rhioty	313	1	Porcine	porcine	JJ
cord-275413-e2rhioty	313	2	reproductive	reproductive	JJ
cord-275413-e2rhioty	313	3	and	and	CC
cord-275413-e2rhioty	313	4	respiratory	respiratory	JJ
cord-275413-e2rhioty	313	5	syndrome	syndrome	NN
cord-275413-e2rhioty	313	6	virus	virus	NN
cord-275413-e2rhioty	313	7	comparison	comparison	NN
cord-275413-e2rhioty	313	8	:	:	:
cord-275413-e2rhioty	313	9	divergent	divergent	JJ
cord-275413-e2rhioty	313	10	evolution	evolution	NN
cord-275413-e2rhioty	313	11	on	on	IN
cord-275413-e2rhioty	313	12	two	two	CD
cord-275413-e2rhioty	313	13	continents	continent	NNS
cord-275413-e2rhioty	313	14	Differentiation	differentiation	NN
cord-275413-e2rhioty	313	15	of	of	IN
cord-275413-e2rhioty	313	16	United	United	NNP
cord-275413-e2rhioty	313	17	States	States	NNP
cord-275413-e2rhioty	313	18	and	and	CC
cord-275413-e2rhioty	313	19	European	european	JJ
cord-275413-e2rhioty	313	20	isolates	isolate	NNS
cord-275413-e2rhioty	313	21	of	of	IN
cord-275413-e2rhioty	313	22	porcine	porcine	JJ
cord-275413-e2rhioty	313	23	reproductive	reproductive	JJ
cord-275413-e2rhioty	313	24	and	and	CC
cord-275413-e2rhioty	313	25	respiratory	respiratory	JJ
cord-275413-e2rhioty	313	26	syndrome	syndrome	NN
cord-275413-e2rhioty	313	27	(	(	-LRB-
cord-275413-e2rhioty	313	28	PRRS	PRRS	NNP
cord-275413-e2rhioty	313	29	)	)	-RRB-
cord-275413-e2rhioty	313	30	virus	virus	NN
cord-275413-e2rhioty	313	31	using	use	VBG
cord-275413-e2rhioty	313	32	monoclonal	monoclonal	JJ
cord-275413-e2rhioty	313	33	antibodies	antibody	NNS
cord-275413-e2rhioty	313	34	Lactate	lactate	NN
cord-275413-e2rhioty	313	35	dehydrogenase	dehydrogenase	NN
cord-275413-e2rhioty	313	36	-	-	HYPH
cord-275413-e2rhioty	313	37	elevating	elevate	VBG
cord-275413-e2rhioty	313	38	virus	virus	NN
cord-275413-e2rhioty	313	39	and	and	CC
cord-275413-e2rhioty	313	40	related	relate	VBN
cord-275413-e2rhioty	313	41	viruses	virus	NNS
cord-275413-e2rhioty	313	42	Transplacental	Transplacental	NNP
cord-275413-e2rhioty	313	43	priming	priming	NN
cord-275413-e2rhioty	313	44	of	of	IN
cord-275413-e2rhioty	313	45	the	the	DT
cord-275413-e2rhioty	313	46	human	human	JJ
cord-275413-e2rhioty	313	47	immune	immune	JJ
cord-275413-e2rhioty	313	48	system	system	NN
cord-275413-e2rhioty	313	49	to	to	IN
cord-275413-e2rhioty	313	50	environmental	environmental	JJ
cord-275413-e2rhioty	313	51	allergens	allergen	NNS
cord-275413-e2rhioty	313	52	:	:	:
cord-275413-e2rhioty	313	53	universal	universal	JJ
cord-275413-e2rhioty	313	54	skewing	skewing	NN
cord-275413-e2rhioty	313	55	of	of	IN
cord-275413-e2rhioty	313	56	initial	initial	JJ
cord-275413-e2rhioty	313	57	T	T	NNP
cord-275413-e2rhioty	313	58	cell	cell	NN
cord-275413-e2rhioty	313	59	responses	response	NNS
cord-275413-e2rhioty	313	60	toward	toward	IN
cord-275413-e2rhioty	313	61	the	the	DT
cord-275413-e2rhioty	313	62	Th2	th2	CD
cord-275413-e2rhioty	313	63	cytokine	cytokine	NN
cord-275413-e2rhioty	313	64	profile	profile	NN
cord-275413-e2rhioty	314	1	Pregnancy	pregnancy	NN
cord-275413-e2rhioty	314	2	:	:	:
cord-275413-e2rhioty	314	3	success	success	NN
cord-275413-e2rhioty	314	4	and	and	CC
cord-275413-e2rhioty	314	5	failure	failure	NN
cord-275413-e2rhioty	314	6	within	within	IN
cord-275413-e2rhioty	314	7	the	the	DT
cord-275413-e2rhioty	314	8	Th1	th1	CD
cord-275413-e2rhioty	314	9	/	/	SYM
cord-275413-e2rhioty	314	10	Th2	th2	CD
cord-275413-e2rhioty	314	11	/	/	SYM
cord-275413-e2rhioty	314	12	Th3	th3	CD
cord-275413-e2rhioty	314	13	paradigm	paradigm	NN
cord-275413-e2rhioty	314	14	Interleukin	Interleukin	NNP
cord-275413-e2rhioty	314	15	10	10	CD
cord-275413-e2rhioty	314	16	,	,	,
cord-275413-e2rhioty	314	17	produced	produce	VBN
cord-275413-e2rhioty	314	18	in	in	IN
cord-275413-e2rhioty	314	19	abundance	abundance	NN
cord-275413-e2rhioty	314	20	by	by	IN
cord-275413-e2rhioty	314	21	human	human	JJ
cord-275413-e2rhioty	314	22	newborn	newborn	NN
cord-275413-e2rhioty	314	23	T	T	NNP
cord-275413-e2rhioty	314	24	cells	cell	NNS
cord-275413-e2rhioty	314	25	,	,	,
cord-275413-e2rhioty	314	26	may	may	MD
cord-275413-e2rhioty	314	27	be	be	VB
cord-275413-e2rhioty	314	28	the	the	DT
cord-275413-e2rhioty	314	29	regulator	regulator	NN
cord-275413-e2rhioty	314	30	of	of	IN
cord-275413-e2rhioty	314	31	increased	increase	VBN
cord-275413-e2rhioty	314	32	tolerance	tolerance	NN
cord-275413-e2rhioty	314	33	associated	associate	VBN
cord-275413-e2rhioty	314	34	with	with	IN
cord-275413-e2rhioty	314	35	cord	cord	NN
cord-275413-e2rhioty	314	36	blood	blood	NN
cord-275413-e2rhioty	314	37	stem	stem	NN
cord-275413-e2rhioty	314	38	cell	cell	NN
cord-275413-e2rhioty	314	39	transplantation	transplantation	NN
cord-275413-e2rhioty	314	40	Quantitation	Quantitation	NNP
cord-275413-e2rhioty	314	41	of	of	IN
cord-275413-e2rhioty	314	42	porcine	porcine	JJ
cord-275413-e2rhioty	314	43	cytokine	cytokine	NN
cord-275413-e2rhioty	314	44	and	and	CC
cord-275413-e2rhioty	314	45	beta	beta	JJ
cord-275413-e2rhioty	314	46	2-microglobulin	2-microglobulin	CD
cord-275413-e2rhioty	314	47	mRNA	mrna	NN
cord-275413-e2rhioty	314	48	expression	expression	NN
cord-275413-e2rhioty	314	49	by	by	IN
cord-275413-e2rhioty	314	50	reverse	reverse	JJ
cord-275413-e2rhioty	314	51	transcription	transcription	NN
cord-275413-e2rhioty	314	52	polymerase	polymerase	NN
cord-275413-e2rhioty	314	53	chain	chain	NN
cord-275413-e2rhioty	314	54	reaction	reaction	NN
cord-275413-e2rhioty	314	55	Porcine	porcine	JJ
cord-275413-e2rhioty	314	56	reproductive	reproductive	JJ
cord-275413-e2rhioty	314	57	and	and	CC
cord-275413-e2rhioty	314	58	respiratory	respiratory	JJ
cord-275413-e2rhioty	314	59	syndrome	syndrome	NN
cord-275413-e2rhioty	314	60	Lymph	lymph	NN
cord-275413-e2rhioty	314	61	node	node	NN
cord-275413-e2rhioty	314	62	lesions	lesion	NNS
cord-275413-e2rhioty	314	63	in	in	IN
cord-275413-e2rhioty	314	64	neonatal	neonatal	JJ
cord-275413-e2rhioty	314	65	pigs	pig	NNS
cord-275413-e2rhioty	314	66	congenitally	congenitally	RB
cord-275413-e2rhioty	314	67	exposed	expose	VBN
cord-275413-e2rhioty	314	68	to	to	IN
cord-275413-e2rhioty	314	69	porcine	porcine	JJ
cord-275413-e2rhioty	314	70	reproductive	reproductive	JJ
cord-275413-e2rhioty	314	71	and	and	CC
cord-275413-e2rhioty	314	72	respiratory	respiratory	JJ
cord-275413-e2rhioty	314	73	syndrome	syndrome	NN
cord-275413-e2rhioty	314	74	virus	virus	NN
cord-275413-e2rhioty	314	75	Porcine	porcine	JJ
cord-275413-e2rhioty	314	76	reproductive	reproductive	JJ
cord-275413-e2rhioty	314	77	and	and	CC
cord-275413-e2rhioty	314	78	respiratory	respiratory	JJ
cord-275413-e2rhioty	314	79	syndrome	syndrome	NN
cord-275413-e2rhioty	314	80	virus	virus	NN
cord-275413-e2rhioty	314	81	infection	infection	NN
cord-275413-e2rhioty	314	82	in	in	IN
cord-275413-e2rhioty	314	83	neonatal	neonatal	JJ
cord-275413-e2rhioty	314	84	pigs	pig	NNS
cord-275413-e2rhioty	314	85	characterised	characterise	VBN
cord-275413-e2rhioty	314	86	by	by	IN
cord-275413-e2rhioty	314	87	marked	mark	VBN
cord-275413-e2rhioty	314	88	neurovirulence	neurovirulence	NN
cord-275413-e2rhioty	315	1	The	the	DT
cord-275413-e2rhioty	315	2	evolution	evolution	NN
cord-275413-e2rhioty	315	3	of	of	IN
cord-275413-e2rhioty	315	4	porcine	porcine	JJ
cord-275413-e2rhioty	315	5	reproductive	reproductive	JJ
cord-275413-e2rhioty	315	6	and	and	CC
cord-275413-e2rhioty	315	7	respiratory	respiratory	JJ
cord-275413-e2rhioty	315	8	syndrome	syndrome	NN
cord-275413-e2rhioty	315	9	virus	virus	NN
cord-275413-e2rhioty	315	10	:	:	:
cord-275413-e2rhioty	315	11	quasispecies	quasispecie	NNS
cord-275413-e2rhioty	315	12	and	and	CC
cord-275413-e2rhioty	315	13	emergence	emergence	NN
cord-275413-e2rhioty	315	14	of	of	IN
cord-275413-e2rhioty	315	15	a	a	DT
cord-275413-e2rhioty	315	16	virus	virus	NN
cord-275413-e2rhioty	315	17	subpopulation	subpopulation	NN
cord-275413-e2rhioty	315	18	during	during	IN
cord-275413-e2rhioty	315	19	infection	infection	NN
cord-275413-e2rhioty	315	20	of	of	IN
cord-275413-e2rhioty	315	21	pigs	pig	NNS
cord-275413-e2rhioty	315	22	with	with	IN
cord-275413-e2rhioty	315	23	VR-2332	vr-2332	NN
cord-275413-e2rhioty	315	24	Lymphoid	lymphoid	JJ
cord-275413-e2rhioty	315	25	tissue	tissue	NN
cord-275413-e2rhioty	315	26	tropism	tropism	NN
cord-275413-e2rhioty	315	27	of	of	IN
cord-275413-e2rhioty	315	28	porcine	porcine	JJ
cord-275413-e2rhioty	315	29	reproductive	reproductive	JJ
cord-275413-e2rhioty	315	30	and	and	CC
cord-275413-e2rhioty	315	31	respiratory	respiratory	JJ
cord-275413-e2rhioty	315	32	syndrome	syndrome	NN
cord-275413-e2rhioty	315	33	virus	virus	NN
cord-275413-e2rhioty	315	34	replication	replication	NN
cord-275413-e2rhioty	315	35	during	during	IN
cord-275413-e2rhioty	315	36	persistent	persistent	JJ
cord-275413-e2rhioty	315	37	infection	infection	NN
cord-275413-e2rhioty	315	38	of	of	IN
cord-275413-e2rhioty	315	39	pigs	pig	NNS
cord-275413-e2rhioty	315	40	originally	originally	RB
cord-275413-e2rhioty	315	41	exposed	expose	VBN
cord-275413-e2rhioty	315	42	to	to	IN
cord-275413-e2rhioty	315	43	virus	virus	NN
cord-275413-e2rhioty	315	44	in	in	IN
cord-275413-e2rhioty	315	45	utero	utero	NN
cord-275413-e2rhioty	315	46	Inhibition	inhibition	NN
cord-275413-e2rhioty	315	47	of	of	IN
cord-275413-e2rhioty	315	48	porcine	porcine	JJ
cord-275413-e2rhioty	315	49	reproductive	reproductive	JJ
cord-275413-e2rhioty	315	50	and	and	CC
cord-275413-e2rhioty	315	51	respiratory	respiratory	JJ
cord-275413-e2rhioty	315	52	syndrome	syndrome	NN
cord-275413-e2rhioty	315	53	virus	virus	NN
cord-275413-e2rhioty	315	54	by	by	IN
cord-275413-e2rhioty	315	55	interferon	interferon	NN
cord-275413-e2rhioty	315	56	-	-	HYPH
cord-275413-e2rhioty	315	57	gamma	gamma	NN
cord-275413-e2rhioty	315	58	and	and	CC
cord-275413-e2rhioty	315	59	recovery	recovery	NN
cord-275413-e2rhioty	315	60	of	of	IN
cord-275413-e2rhioty	315	61	virus	virus	NN
cord-275413-e2rhioty	315	62	replication	replication	NN
cord-275413-e2rhioty	315	63	with	with	IN
cord-275413-e2rhioty	315	64	2	2	CD
cord-275413-e2rhioty	315	65	aminopurine	aminopurine	JJ
cord-275413-e2rhioty	315	66	Maternal	maternal	JJ
cord-275413-e2rhioty	315	67	influenza	influenza	NN
cord-275413-e2rhioty	315	68	infection	infection	NN
cord-275413-e2rhioty	315	69	causes	cause	VBZ
cord-275413-e2rhioty	315	70	marked	mark	VBN
cord-275413-e2rhioty	315	71	behavioral	behavioral	JJ
cord-275413-e2rhioty	315	72	and	and	CC
cord-275413-e2rhioty	315	73	pharmacological	pharmacological	JJ
cord-275413-e2rhioty	315	74	changes	change	NNS
cord-275413-e2rhioty	315	75	in	in	IN
cord-275413-e2rhioty	315	76	the	the	DT
cord-275413-e2rhioty	315	77	offspring	offspring	NN
cord-275413-e2rhioty	315	78	The	the	DT
cord-275413-e2rhioty	315	79	molecular	molecular	JJ
cord-275413-e2rhioty	315	80	biology	biology	NN
cord-275413-e2rhioty	315	81	of	of	IN
cord-275413-e2rhioty	315	82	arteriviruses	arteriviruse	NNS
cord-275413-e2rhioty	315	83	Uterine	uterine	NN
cord-275413-e2rhioty	315	84	and	and	CC
cord-275413-e2rhioty	315	85	placental	placental	JJ
cord-275413-e2rhioty	315	86	alterations	alteration	NNS
cord-275413-e2rhioty	315	87	in	in	IN
cord-275413-e2rhioty	315	88	pregnant	pregnant	JJ
cord-275413-e2rhioty	315	89	sows	sow	NNS
cord-275413-e2rhioty	315	90	associated	associate	VBN
cord-275413-e2rhioty	315	91	with	with	IN
cord-275413-e2rhioty	315	92	the	the	DT
cord-275413-e2rhioty	315	93	porcine	porcine	JJ
cord-275413-e2rhioty	315	94	epidemic	epidemic	NN
cord-275413-e2rhioty	315	95	abortion	abortion	NN
cord-275413-e2rhioty	315	96	and	and	CC
cord-275413-e2rhioty	315	97	respiratory	respiratory	JJ
cord-275413-e2rhioty	315	98	syndrome	syndrome	NN
cord-275413-e2rhioty	315	99	(	(	-LRB-
cord-275413-e2rhioty	315	100	PEARS	PEARS	NNP
cord-275413-e2rhioty	315	101	)	)	-RRB-
cord-275413-e2rhioty	316	1	Immunohistochemical	immunohistochemical	JJ
cord-275413-e2rhioty	316	2	staining	staining	NN
cord-275413-e2rhioty	316	3	of	of	IN
cord-275413-e2rhioty	316	4	IFN	IFN	NNP
cord-275413-e2rhioty	316	5	-	-	HYPH
cord-275413-e2rhioty	316	6	gamma	gamma	NN
cord-275413-e2rhioty	316	7	positive	positive	JJ
cord-275413-e2rhioty	316	8	cells	cell	NNS
cord-275413-e2rhioty	316	9	in	in	IN
cord-275413-e2rhioty	316	10	porcine	porcine	JJ
cord-275413-e2rhioty	316	11	reproductive	reproductive	JJ
cord-275413-e2rhioty	316	12	and	and	CC
cord-275413-e2rhioty	316	13	respiratory	respiratory	JJ
cord-275413-e2rhioty	316	14	syndrome	syndrome	NN
cord-275413-e2rhioty	316	15	virus	virus	NN
cord-275413-e2rhioty	316	16	-	-	HYPH
cord-275413-e2rhioty	316	17	infected	infect	VBN
cord-275413-e2rhioty	316	18	lung	lung	NN
cord-275413-e2rhioty	316	19	Immunity	immunity	NN
cord-275413-e2rhioty	316	20	in	in	IN
cord-275413-e2rhioty	316	21	the	the	DT
cord-275413-e2rhioty	316	22	fetus	fetus	NN
cord-275413-e2rhioty	316	23	and	and	CC
cord-275413-e2rhioty	316	24	newborn	newborn	JJ
cord-275413-e2rhioty	316	25	.	.	.
cord-275413-e2rhioty	317	1	In	in	IN
cord-275413-e2rhioty	317	2	:	:	:
cord-275413-e2rhioty	317	3	Veterinary	Veterinary	NNP
cord-275413-e2rhioty	317	4	Immunology	Immunology	NNP
cord-275413-e2rhioty	317	5	:	:	:
cord-275413-e2rhioty	317	6	An	an	DT
cord-275413-e2rhioty	317	7	Introduction	introduction	NN
cord-275413-e2rhioty	317	8	,	,	,
cord-275413-e2rhioty	317	9	Chapter	chapter	NN
cord-275413-e2rhioty	317	10	19	19	CD
cord-275413-e2rhioty	317	11	Quantitative	quantitative	JJ
cord-275413-e2rhioty	317	12	deep	deep	JJ
cord-275413-e2rhioty	317	13	sequencing	sequencing	NN
cord-275413-e2rhioty	317	14	reveals	reveal	VBZ
cord-275413-e2rhioty	317	15	dynamic	dynamic	JJ
cord-275413-e2rhioty	317	16	HIV-1	HIV-1	NNP
cord-275413-e2rhioty	317	17	escape	escape	NN
cord-275413-e2rhioty	317	18	and	and	CC
cord-275413-e2rhioty	317	19	large	large	JJ
cord-275413-e2rhioty	317	20	population	population	NN
cord-275413-e2rhioty	317	21	shifts	shift	NNS
cord-275413-e2rhioty	317	22	during	during	IN
cord-275413-e2rhioty	317	23	CCR5	CCR5	NNP
cord-275413-e2rhioty	317	24	antagonist	antagonist	NN
cord-275413-e2rhioty	317	25	therapy	therapy	NN
cord-275413-e2rhioty	317	26	in	in	IN
cord-275413-e2rhioty	317	27	vivo	vivo	NNP
cord-275413-e2rhioty	317	28	Interferongamma	Interferongamma	NNP
cord-275413-e2rhioty	317	29	-	-	HYPH
cord-275413-e2rhioty	317	30	induced	induce	VBN
cord-275413-e2rhioty	317	31	changes	change	NNS
cord-275413-e2rhioty	317	32	in	in	IN
cord-275413-e2rhioty	317	33	synaptic	synaptic	JJ
cord-275413-e2rhioty	317	34	activity	activity	NN
cord-275413-e2rhioty	317	35	and	and	CC
cord-275413-e2rhioty	317	36	AMPA	AMPA	NNP
cord-275413-e2rhioty	317	37	receptor	receptor	NN
cord-275413-e2rhioty	317	38	clustering	clustering	NN
cord-275413-e2rhioty	317	39	in	in	IN
cord-275413-e2rhioty	317	40	hippocampal	hippocampal	JJ
cord-275413-e2rhioty	317	41	cultures	culture	NNS
cord-275413-e2rhioty	317	42	Differential	differential	JJ
cord-275413-e2rhioty	317	43	patterns	pattern	NNS
cord-275413-e2rhioty	317	44	of	of	IN
cord-275413-e2rhioty	317	45	methylation	methylation	NN
cord-275413-e2rhioty	317	46	of	of	IN
cord-275413-e2rhioty	317	47	the	the	DT
cord-275413-e2rhioty	317	48	IFN	IFN	NNP
cord-275413-e2rhioty	317	49	-	-	HYPH
cord-275413-e2rhioty	317	50	gamma	gamma	NN
cord-275413-e2rhioty	317	51	promoter	promoter	NN
cord-275413-e2rhioty	317	52	at	at	IN
cord-275413-e2rhioty	317	53	CpG	CpG	NNP
cord-275413-e2rhioty	317	54	and	and	CC
cord-275413-e2rhioty	317	55	non	non	JJ
cord-275413-e2rhioty	317	56	-	-	JJ
cord-275413-e2rhioty	317	57	CpG	cpg	JJ
cord-275413-e2rhioty	317	58	sites	site	NNS
cord-275413-e2rhioty	317	59	underlie	underlie	VBP
cord-275413-e2rhioty	317	60	differences	difference	NNS
cord-275413-e2rhioty	317	61	in	in	IN
cord-275413-e2rhioty	317	62	IFN	IFN	NNP
cord-275413-e2rhioty	317	63	-	-	HYPH
cord-275413-e2rhioty	317	64	gamma	gamma	NN
cord-275413-e2rhioty	317	65	gene	gene	NN
cord-275413-e2rhioty	317	66	expression	expression	NN
cord-275413-e2rhioty	317	67	between	between	IN
cord-275413-e2rhioty	317	68	human	human	JJ
cord-275413-e2rhioty	317	69	neonatal	neonatal	NN
cord-275413-e2rhioty	317	70	and	and	CC
cord-275413-e2rhioty	317	71	adult	adult	NN
cord-275413-e2rhioty	317	72	CD45RO	CD45RO	NNP
cord-275413-e2rhioty	317	73	-	-	HYPH
cord-275413-e2rhioty	317	74	T	t	NN
cord-275413-e2rhioty	317	75	cells	cell	NNS
cord-275413-e2rhioty	317	76	Primary	primary	JJ
cord-275413-e2rhioty	317	77	immune	immune	JJ
cord-275413-e2rhioty	317	78	responses	response	NNS
cord-275413-e2rhioty	317	79	by	by	IN
cord-275413-e2rhioty	317	80	cord	cord	NN
cord-275413-e2rhioty	317	81	blood	blood	NN
cord-275413-e2rhioty	317	82	CD4(+	CD4(+	NNS
cord-275413-e2rhioty	317	83	)	)	-RRB-
cord-275413-e2rhioty	318	1	T	T	NNP
cord-275413-e2rhioty	318	2	cells	cell	NNS
cord-275413-e2rhioty	318	3	and	and	CC
cord-275413-e2rhioty	318	4	NK	NK	NNP
cord-275413-e2rhioty	318	5	cells	cell	NNS
cord-275413-e2rhioty	318	6	inhibit	inhibit	VBP
cord-275413-e2rhioty	318	7	Epstein	Epstein	NNP
cord-275413-e2rhioty	318	8	-	-	HYPH
cord-275413-e2rhioty	318	9	Barr	Barr	NNP
cord-275413-e2rhioty	318	10	virus	virus	NN
cord-275413-e2rhioty	318	11	B	b	NN
cord-275413-e2rhioty	318	12	-	-	HYPH
cord-275413-e2rhioty	318	13	cell	cell	NN
cord-275413-e2rhioty	318	14	transformation	transformation	NN
cord-275413-e2rhioty	318	15	in	in	IN
cord-275413-e2rhioty	318	16	vitro	vitro	FW
cord-275413-e2rhioty	318	17	This	this	DT
cord-275413-e2rhioty	318	18	work	work	NN
cord-275413-e2rhioty	318	19	was	be	VBD
cord-275413-e2rhioty	318	20	partially	partially	RB
cord-275413-e2rhioty	318	21	supported	support	VBN
cord-275413-e2rhioty	318	22	by	by	IN
cord-275413-e2rhioty	318	23	the	the	DT
cord-275413-e2rhioty	318	24	USDA	USDA	NNP
cord-275413-e2rhioty	318	25	National	National	NNP
cord-275413-e2rhioty	318	26	Research	Research	NNP
cord-275413-e2rhioty	318	27	Initiative	Initiative	NNP
cord-275413-e2rhioty	318	28	for	for	IN
cord-275413-e2rhioty	318	29	Competitive	Competitive	NNP
cord-275413-e2rhioty	318	30	Grants	Grants	NNPS
cord-275413-e2rhioty	318	31	Program	Program	NNP
cord-275413-e2rhioty	318	32	Grants	Grants	NNPS
cord-275413-e2rhioty	318	33	#	#	$
cord-275413-e2rhioty	318	34	97	97	CD
cord-275413-e2rhioty	318	35	-	-	HYPH
cord-275413-e2rhioty	318	36	35204	35204	CD
cord-275413-e2rhioty	318	37	-	-	HYPH
cord-275413-e2rhioty	318	38	5071	5071	CD
cord-275413-e2rhioty	318	39	.	.	.